U.S. patent application number 13/169686 was filed with the patent office on 2012-02-23 for novel genes encoding proteins having prognostic, diagnostic, preventive, therapeutic, and other uses.
This patent application is currently assigned to Millennium Pharmaceuticals, Inc.. Invention is credited to Thomas M. Barnes, Christopher C. Fraser, Andrew D.J. Goodearl, Douglas A. Holtzman, Susan J. Kirst, Kevin R. Leiby, Charles R. Mackay, Sean A. McCarthy, Paul S. Myers, John D. Sharp, Nicholas Wrighton.
Application Number | 20120045777 13/169686 |
Document ID | / |
Family ID | 27581239 |
Filed Date | 2012-02-23 |
United States Patent
Application |
20120045777 |
Kind Code |
A1 |
Fraser; Christopher C. ; et
al. |
February 23, 2012 |
NOVEL GENES ENCODING PROTEINS HAVING PROGNOSTIC, DIAGNOSTIC,
PREVENTIVE, THERAPEUTIC, AND OTHER USES
Abstract
The invention provides isolated nucleic acids encoding a variety
of proteins having diagnostic, preventive, therapeutic, and other
uses. These nucleic and proteins are useful for diagnosis,
prevention, and therapy of a number of human and other animal
disorders. The invention also provides antisense nucleic acid
molecules, expression vectors containing the nucleic acid molecules
of the invention, host cells into which the expression vectors have
been introduced, and non-human transgenic animals in which a
nucleic acid molecule of the invention has been introduced or
disrupted. The invention still further provides isolated
polypeptides, fusion polypeptides, antigenic peptides and
antibodies. Diagnostic, screening, and therapeutic methods using
compositions of the invention are also provided. The nucleic acids
and polypeptides of the present invention are useful as modulating
agents in regulating a variety of cellular processes.
Inventors: |
Fraser; Christopher C.;
(Lexington, MA) ; Barnes; Thomas M.; (Brookline,
MA) ; Sharp; John D.; (Arlington, MA) ; Kirst;
Susan J.; (Brookline, MA) ; Myers; Paul S.;
(Cambridge, MA) ; Leiby; Kevin R.; (Natick,
MA) ; Holtzman; Douglas A.; (Jamaica Plain, MA)
; McCarthy; Sean A.; (San Diego, CA) ; Wrighton;
Nicholas; (Winchester, MA) ; Mackay; Charles R.;
(Vaucluse, AU) ; Goodearl; Andrew D.J.; (Natick,
MA) |
Assignee: |
Millennium Pharmaceuticals,
Inc.
Cambridge
MA
|
Family ID: |
27581239 |
Appl. No.: |
13/169686 |
Filed: |
June 27, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12387959 |
May 8, 2009 |
8003334 |
|
|
13169686 |
|
|
|
|
10741790 |
Dec 19, 2003 |
7547766 |
|
|
12387959 |
|
|
|
|
09759130 |
Jan 12, 2001 |
|
|
|
10741790 |
|
|
|
|
09479249 |
Jan 7, 2000 |
|
|
|
09759130 |
|
|
|
|
09559497 |
Apr 27, 2000 |
|
|
|
09479249 |
|
|
|
|
09578063 |
May 24, 2000 |
6764677 |
|
|
09559497 |
|
|
|
|
09333159 |
Jun 14, 1999 |
7033780 |
|
|
09578063 |
|
|
|
|
09596194 |
Jun 16, 2000 |
|
|
|
09759130 |
|
|
|
|
09342364 |
Jun 29, 1999 |
|
|
|
09596194 |
|
|
|
|
09608452 |
Jun 30, 2000 |
|
|
|
09759130 |
|
|
|
|
09393996 |
Sep 10, 1999 |
|
|
|
09608452 |
|
|
|
|
09602871 |
Jun 23, 2000 |
|
|
|
09759130 |
|
|
|
|
09420707 |
Oct 19, 1999 |
|
|
|
09602871 |
|
|
|
|
Current U.S.
Class: |
435/7.21 ;
435/184; 435/226; 435/23; 435/320.1; 435/325; 435/375; 435/69.1;
435/7.4; 435/7.92; 436/501; 436/94; 530/350; 530/387.9; 536/23.1;
536/23.2 |
Current CPC
Class: |
C07K 2319/00 20130101;
A61K 38/00 20130101; Y10T 436/143333 20150115; C07K 14/47 20130101;
Y02A 50/411 20180101; Y02A 50/30 20180101; A01K 2217/05 20130101;
C07K 14/705 20130101 |
Class at
Publication: |
435/7.21 ;
435/7.4; 435/7.92; 435/23; 435/69.1; 435/184; 435/226; 435/325;
435/375; 435/320.1; 436/501; 436/94; 530/350; 530/387.9; 536/23.1;
536/23.2 |
International
Class: |
G01N 33/53 20060101
G01N033/53; C12Q 1/37 20060101 C12Q001/37; C12P 21/02 20060101
C12P021/02; C12N 9/99 20060101 C12N009/99; C12N 9/64 20060101
C12N009/64; C12N 15/57 20060101 C12N015/57; C12N 5/00 20060101
C12N005/00; C12N 15/63 20060101 C12N015/63; G01N 33/50 20060101
G01N033/50; C07K 14/00 20060101 C07K014/00; C07K 16/18 20060101
C07K016/18; C07H 21/04 20060101 C07H021/04; G01N 33/573 20060101
G01N033/573; C12N 5/10 20060101 C12N005/10 |
Claims
1. An isolated nucleic acid molecule selected from the group
consisting of: a) a nucleic acid molecule having a nucleotide
sequence which is at least 90% identical to the nucleotide sequence
of any of SEQ ID NOs: 1, 2, 31, 32, 51, 52, 71, 72, 81, 82, 91, 92,
96, 97, 101, 102, 106, 107, 111, 112, 121, 122, 141, 142, 151, 152,
161, 162, 171, 172, 181, 182, 191, 192, 201, 202, 215, 217, 221,
222, 241, 242, 251, 252, 271, 272, 279, 280, 303, 304, 308, 309,
324, 325, 329, 330, 351, 352, 362, 371, 372, 379, 380, 387, 388,
403, 404, 415, 416, 423, 424, 437, 438, and the nucleotide sequence
of any of the clones deposited as ATCC.RTM. Accession numbers
207184, 207219, 207220, 207221, 207228, 207230, PTA-147, PTA-150,
PTA-151, PTA-295, PTA-424, PTA-438, PTA-455, PTA-817, PTA-1156, and
PTA-1764, or a complement thereof; b) a nucleic acid molecule
comprising at least 15 nucleotide residues and having a nucleotide
sequence identical to at least 15 consecutive nucleotide residues
of any of SEQ ID NOs: 1, 2, 31, 32, 51, 52, 71, 72, 81, 82, 91, 92,
96, 97, 101, 102, 106, 107, 111, 112, 121, 122, 141, 142, 151, 152,
161, 162, 171, 172, 181, 182, 191, 192, 201, 202, 215, 217, 221,
222, 241, 242, 251, 252, 271, 272, 279, 280, 303, 304, 308, 309,
324, 325, 329, 330, 351, 352, 362, 371, 372, 379, 380, 387, 388,
403, 404, 415, 416, 423, 424, 437, 438, and the nucleotide sequence
of any of the clones deposited as ATCC.RTM. Accession numbers
207184, 207219, 207220, 207221, 207228, 207230, PTA-147, PTA-150,
PTA-151, PTA-295, PTA-424, PTA-438, PTA-455, PTA-817, PTA-1156, and
PTA-1764, or a complement thereof; c) a nucleic acid molecule which
encodes a polypeptide comprising the amino acid sequence of any of
SEQ ID NOs: 3-8, 33, 35, 38, 53-60, 73-78, 83-85, 93-95, 98-100,
103-105, 108-110, 113-115, 123-131, 143-145, 153-160, 163, 173-175,
183-185, 193-198, 203-214, 216, 223-236, 243-252, 253, 273-278,
281-302, 305-307, 310-315, 326-328, 331-333, 353-358, 363-368,
373-378, 381-386, 389-394, 405-414, 417-422, 425-436, and 439, and
the amino acid sequence encoded by the nucleotide sequence of any
of the clones deposited as ATCC.RTM. Accession numbers 207184,
207219, 207220, 207221, 207228, 207230, PTA-147, PTA-150, PTA-151,
PTA-295, PTA-424, PTA-438, PTA-455, PTA-817, PTA-1156, and
PTA-1764; d) a nucleic acid molecule which encodes a fragment of a
polypeptide comprising the amino acid sequence of any of SEQ ID
NOs: 3-8, 33, 35, 38, 53-60, 73-78, 83-85, 93-95, 98-100, 103-105,
108-110, 113-115, 123-131, 143-145, 153-160, 163, 173-175, 183-185,
193-198, 203-214, 216, 223-236, 243-252, 253, 273-278, 281-302,
305-307, 310-315, 326-328, 331-333, 353-358, 363-368, 373-378,
381-386, 389-394, 405-414, 417-422, 425-436, and 439 and the amino
acid sequence encoded by the nucleotide sequence of any of the
clones deposited as ATCC.RTM. Accession numbers 207184, 207219,
207220, 207221, 207228, 207230, PTA-147, PTA-150, PTA-151, PTA-295,
PTA-424, PTA-438, PTA-455, PTA-817, PTA-1156, and PTA-1764, wherein
the fragment comprises at least 10 consecutive amino acid residues
of any of SEQ ID NOs: 3-8, 33, 35, 38, 53-60, 73-78, 83-85, 93-95,
98-100, 103-105, 108-110, 113-115, 123-131, 143-145, 153-160, 163,
173-175, 183-185, 193-198, 203-214, 216, 223-236, 243-252, 253,
273-278, 281-302, 305-307, 310-315, 326-328, 331-333, 353-358,
363-368, 373-378, 381-386, 389-394, 405-414, 417-422, 425-436, and
439 and the amino acid sequence encoded by the nucleotide sequence
of any of the clones deposited as ATCC.RTM. Accession numbers
207184, 207219, 207220, 207221, 207228, 207230, PTA-147, PTA-150,
PTA-151, PTA-295, PTA-424, PTA-438, PTA-455, PTA-817, PTA-1156, and
PTA-1764; and e) a nucleic acid molecule which encodes a fragment
of a polypeptide comprising the amino acid sequence of any of SEQ
ID NOs: 3, 53, 73, 83, 93, 98, 103, 108, 113, 123, 143, 153, 163,
173, 183, 193, 203, 223, 243, 253, 273, 281, 305, 310, 326, 331,
353, 363, 373, 381, 389, 405, 417, 425, and 439 and the amino acid
sequence encoded by the nucleotide sequence of any of the clones
deposited as ATCC.RTM. Accession numbers 207184, 207219, 207220,
207221, 207228, 207230, PTA-147, PTA-150, PTA-151, PTA-295,
PTA-424, PTA-438, PTA-455, PTA-817, PTA-1156, and PTA-1764, wherein
the fragment comprises consecutive amino acid residues
corresponding to at least half of the full length of any of SEQ ID
NOs: 3, 53, 73, 83, 93, 98, 103, 108, 113, 123, 143, 153, 163, 173,
183, 193, 203, 223, 243, 253, 273, 281, 305, 310, 326, 331, 353,
363, 373, 381, 389, 405, 417, 425, and 439 and the amino acid
sequence encoded by the nucleotide sequence of any of the clones
deposited as ATCC.RTM. Accession numbers 207184, 207219, 207220,
207221, 207228, 207230, PTA-147, PTA-150, PTA-151, PTA-295,
PTA-424, PTA-438, PTA-455, PTA-817, PTA-1156, and PTA-1764; and f)
a nucleic acid molecule which encodes a naturally occurring allelic
variant of a polypeptide comprising the amino acid sequence of any
of SEQ ID NOs: 3-8, 33, 35, 38, 53-60, 73-78, 83-85, 93-95, 98-100,
103-105, 108-110, 113-115, 123-131, 143-145, 153-160, 163, 173-175,
183-185, 193-198, 203-214, 216, 223-236, 243-252, 253, 273-278,
281-302, 305-307, 310-315, 326-328, 331-333, 353-358, 363-368,
373-378, 381-386, 389-394, 405-414, 417-422, 425-436, and 439,
wherein the nucleic acid molecule hybridizes with a nucleic acid
molecule consisting of the nucleotide sequence of any of SEQ ID
NOs: 1, 2, 31, 32, 51, 52, 71, 72, 81, 82, 91, 92, 96, 97, 101,
102, 106, 107, 111, 112, 121, 122, 141, 142, 151, 152, 161, 162,
171, 172, 181, 182, 191, 192, 201, 202, 215, 217, 221, 222, 241,
242, 251, 252, 271, 272, 279, 280, 303, 304, 308, 309, 324, 325,
329, 330, 351, 352, 362, 371, 372, 379, 380, 387, 388, 403, 404,
415, 416, 423, 424, 437, 438, and the nucleotide sequence of any of
the clones deposited as ATCC.RTM. Accession numbers 207184, 207219,
207220, 207221, 207228, 207230, PTA-147, PTA-150, PTA-151, PTA-295,
PTA-424, PTA-438, PTA-455, PTA-817, PTA-1156, and PTA-1764, or a
complement thereof under stringent conditions.
2. The isolated nucleic acid molecule of claim 1, which is selected
from the group consisting of: a) a nucleic acid having the
nucleotide sequence of any of SEQ ID NOs: 1, 2, 31, 32, 51, 52, 71,
72, 81, 82, 91, 92, 96, 97, 101, 102, 106, 107, 111, 112, 121, 122,
141, 142, 151, 152, 161, 162, 171, 172, 181, 182, 191, 192, 201,
202, 215, 217, 221, 222, 241, 242, 251, 252, 271, 272, 279, 280,
303, 304, 308, 309, 324, 325, 329, 330, 351, 352, 362, 371, 372,
379, 380, 387, 388, 403, 404, 415, 416, 423, 424, 437, 438, and the
nucleotide sequence of any of the clones deposited as ATCC.RTM.
Accession numbers 207184, 207219, 207220, 207221, 207228, 207230,
PTA-147, PTA-150, PTA-151, PTA-295, PTA-424, PTA-438, PTA-455,
PTA-817, PTA-1156, and PTA-1764, or a complement thereof; and b) a
nucleic acid molecule which encodes a polypeptide having the amino
acid sequence of any of SEQ ID NOs: 3-8, 33, 35, 38, 53-60, 73-78,
83-85, 93-95, 98-100, 103-105, 108-110, 113-115, 123-131, 143-145,
153-160, 163, 173-175, 183-185, 193-198, 203-214, 216, 223-236,
243-252, 253, 273-278, 281-302, 305-307, 310-315, 326-328, 331-333,
353-358, 363-368, 373-378, 381-386, 389-394, 405-414, 417-422,
425-436, and 439 and the amino acid sequence encoded by the
nucleotide sequence of any of the clones deposited as ATCC.RTM.
Accession numbers 207184, 207219, 207220, 207221, 207228, 207230,
PTA-147, PTA-150, PTA-151, PTA-295, PTA-424, PTA-438, PTA-455,
PTA-817, PTA-1156, and PTA-1764, or a complement thereof.
3. The nucleic acid molecule of claim 1, further comprising vector
nucleic acid sequences.
4. The nucleic acid molecule of claim 1 further comprising nucleic
acid sequences encoding a heterologous polypeptide.
5. A host cell which contains the nucleic acid molecule of claim
1.
6. The host cell of claim 5 which is a mammalian host cell.
7. A non-human mammalian host cell containing the nucleic acid
molecule of claim 1.
8. An isolated polypeptide selected from the group consisting of:
a) a fragment of a polypeptide comprising the amino acid sequence
of any of SEQ ID NOs: 3-8, 33, 35, 38, 53-60, 73-78, 83-85, 93-95,
98-100, 103-105, 108-110, 113-115, 123-131, 143-145, 153-160, 163,
173-175, 183-185, 193-198, 203-214, 216, 223-236, 243-252, 253,
273-278, 281-302, 305-307, 310-315, 326-328, 331-333, 353-358,
363-368, 373-378, 381-386, 389-394, 405-414, 417-422, 425-436, and
439 and the amino acid sequence encoded by the nucleotide sequence
of any of the clones deposited as ATCC.RTM. Accession numbers
207184, 207219, 207220, 207221, 207228, 207230, PTA-147, PTA-150,
PTA-151, PTA-295, PTA-424, PTA-438, PTA-455, PTA-817, PTA-1156, and
PTA-1764; b) a naturally occurring allelic variant of a polypeptide
comprising the amino acid sequence of any of SEQ ID NOs: 3-8, 33,
35, 38, 53-60, 73-78, 83-85, 93-95, 98-100, 103-105, 108-110,
113-115, 123-131, 143-145, 153-160, 163, 173-175, 183-185, 193-198,
203-214, 216, 223-236, 243-252, 253, 273-278, 281-302, 305-307,
310-315, 326-328, 331-333, 353-358, 363-368, 373-378, 381-386,
389-394, 405-414, 417-422, 425-436, and 439, wherein the
polypeptide is encoded by a nucleic acid molecule which hybridizes
with a nucleic acid molecule consisting of the nucleotide sequence
of any of SEQ ID NOs: 1, 2, 31, 32, 51, 52, 71, 72, 81, 82, 91, 92,
96, 97, 101, 102, 106, 107, 111, 112, 121, 122, 141, 142, 151, 152,
161, 162, 171, 172, 181, 182, 191, 192, 201, 202, 215, 217, 221,
222, 241, 242, 251, 252, 271, 272, 279, 280, 303, 304, 308, 309,
324, 325, 329, 330, 351, 352, 362, 371, 372, 379, 380, 387, 388,
403, 404, 415, 416, 423, 424, 437, 438, and the nucleotide sequence
of any of the clones deposited as ATCC.RTM. Accession numbers
207184, 207219, 207220, 207221, 207228, 207230, PTA-147, PTA-150,
PTA-151, PTA-295, PTA-424, PTA-438, PTA-455, PTA-817, PTA-1156, and
PTA-1764, or a complement thereof under stringent conditions; and
c) a polypeptide which is encoded by a nucleic acid molecule
comprising a nucleotide sequence which is at least 90% identical to
a nucleic acid consisting of the nucleotide sequence of any of SEQ
ID NOs: 1, 2, 31, 32, 51, 52, 71, 72, 81, 82, 91, 92, 96, 97, 101,
102, 106, 107, 111, 112, 121, 122, 141, 142, 151, 152, 161, 162,
171, 172, 181, 182, 191, 192, 201, 202, 215, 217, 221, 222, 241,
242, 251, 252, 271, 272, 279, 280, 303, 304, 308, 309, 324, 325,
329, 330, 351, 352, 362, 371, 372, 379, 380, 387, 388, 403, 404,
415, 416, 423, 424, 437, 438, and the nucleotide sequence of any of
the clones deposited as ATCC.RTM. Accession numbers 207184, 207219,
207220, 207221, 207228, 207230, PTA-147, PTA-150, PTA-151, PTA-295,
PTA-424, PTA-438, PTA-455, PTA-817, PTA-1156, and PTA-1764, or a
complement thereof.
9. The isolated polypeptide of claim 8 having the amino acid
sequence of any of SEQ ID NOs: 3-8, 33, 35, 38, 53-60, 73-78,
83-85, 93-95, 98-100, 103-105, 108-110, 113-115, 123-131, 143-145,
153-160, 163, 173-175, 183-185, 193-198, 203-214, 216, 223-236,
243-252, 253, 273-278, 281-302, 305-307, 310-315, 326-328, 331-333,
353-358, 363-368, 373-378, 381-386, 389-394, 405-414, 417-422,
425-436, and 439 and the amino acid sequence encoded by the
nucleotide sequence of any of the clones deposited as ATCC.RTM.
Accession numbers 207184, 207219, 207220, 207221, 207228, 207230,
PTA-147, PTA-150, PTA-151, PTA-295, PTA-424, PTA-438, PTA-455,
PTA-817, PTA-1156, and PTA-1764.
10. The polypeptide of claim 8, wherein the amino acid sequence of
the polypeptide further comprises heterologous amino acid
residues.
11. An antibody which selectively binds with the polypeptide of
claim 8.
12. A method for producing a polypeptide selected from the group
consisting of: a) a polypeptide comprising the amino acid sequence
of any of SEQ ID NOs: 3-8, 33, 35, 38, 53-60, 73-78, 83-85, 93-95,
98-100, 103-105, 108-110, 113-115, 123-131, 143-145, 153-160, 163,
173-175, 183-185, 193-198, 203-214, 216, 223-236, 243-252, 253,
273-278, 281-302, 305-307, 310-315, 326-328, 331-333, 353-358,
363-368, 373-378, 381-386, 389-394, 405-414, 417-422, 425-436, and
439 and the amino acid sequence encoded by the nucleotide sequence
of any of the clones deposited as ATCC.RTM. Accession numbers
207184, 207219, 207220, 207221, 207228, 207230, PTA-147, PTA-150,
PTA-151, PTA-295, PTA-424, PTA-438, PTA-455, PTA-817, PTA-1156, and
PTA-1764; b) a polypeptide comprising a fragment of the amino acid
sequence of any of SEQ ID NOs: 3-8, 33, 35, 38, 53-60, 73-78,
83-85, 93-95, 98-100, 103-105, 108-110, 113-115, 123-131, 143-145,
153-160, 163, 173-175, 183-185, 193-198, 203-214, 216, 223-236,
243-252, 253, 273-278, 281-302, 305-307, 310-315, 326-328, 331-333,
353-358, 363-368, 373-378, 381-386, 389-394, 405-414, 417-422,
425-436, and 439 and the amino acid sequence encoded by the
nucleotide sequence of any of the clones deposited as ATCC.RTM.
Accession numbers 207184, 207219, 207220, 207221, 207228, 207230,
PTA-147, PTA-150, PTA-151, PTA-295, PTA-424, PTA-438, PTA-455,
PTA-817, PTA-1156, and PTA-1764, wherein the fragment comprises at
least 10 contiguous amino acids of any of SEQ ID NOs: 3-8, 33, 35,
38, 53-60, 73-78, 83-85, 93-95, 98-100, 103-105, 108-110, 113-115,
123-131, 143-145, 153-160, 163, 173-175, 183-185, 193-198, 203-214,
216, 223-236, 243-252, 253, 273-278, 281-302, 305-307, 310-315,
326-328, 331-333, 353-358, 363-368, 373-378, 381-386, 389-394,
405-414, 417-422, 425-436, and 439 and the amino acid sequence
encoded by the nucleotide sequence of any of the clones deposited
as ATCC.RTM. Accession numbers 207184, 207219, 207220, 207221,
207228, 207230, PTA-147, PTA-150, PTA-151, PTA-295, PTA-424,
PTA-438, PTA-455, PTA-817, PTA-1156, and PTA-1764; and c) a
naturally occurring allelic variant of a polypeptide comprising the
amino acid sequence of any of SEQ ID NOs: 3-8, 33, 35, 38, 53-60,
73-78, 83-85, 93-95, 98-100, 103-105, 108-110, 113-115, 123-131,
143-145, 153-160, 163, 173-175, 183-185, 193-198, 203-214, 216,
223-236, 243-252, 253, 273-278, 281-302, 305-307, 310-315, 326-328,
331-333, 353-358, 363-368, 373-378, 381-386, 389-394, 405-414,
417-422, 425-436, and 439, or a complement thereof, wherein the
polypeptide is encoded by a nucleic acid molecule which hybridizes
with a nucleic acid molecule consisting of the nucleotide sequence
of any of SEQ ID NOs: 1, 2, 31, 32, 51, 52, 71, 72, 81, 82, 91, 92,
96, 97, 101, 102, 106, 107, 111, 112, 121, 122, 141, 142, 151, 152,
161, 162, 171, 172, 181, 182, 191, 192, 201, 202, 215, 217, 221,
222, 241, 242, 251, 252, 271, 272, 279, 280, 303, 304, 308, 309,
324, 325, 329, 330, 351, 352, 362, 371, 372, 379, 380, 387, 388,
403, 404, 415, 416, 423, 424, 437, 438, and the nucleotide sequence
of any of the clones deposited as ATCC.RTM. Accession numbers
207184, 207219, 207220, 207221, 207228, 207230, PTA-147, PTA-150,
PTA-151, PTA-295, PTA-424, PTA-438, PTA-455, PTA-817, PTA-1156, and
PTA-1764, or a complement thereof under stringent conditions; the
method comprising culturing the host cell of claim 5 under
conditions in which the nucleic acid molecule is expressed.
13. A method for detecting the presence of a polypeptide of claim 8
in a sample, comprising: a) contacting the sample with a compound
which selectively binds with a polypeptide of claim 8; and b)
determining whether the compound binds with the polypeptide in the
sample.
14. The method of claim 13, wherein the compound which binds with
the polypeptide is an antibody.
15. A kit comprising a compound which selectively binds with a
polypeptide of claim 8 and instructions for use.
16. A method for detecting the presence of a nucleic acid molecule
of claim 1 in a sample, comprising the steps of: a) contacting the
sample with a nucleic acid probe or primer which selectively
hybridizes with the nucleic acid molecule; and b) determining
whether the nucleic acid probe or primer binds with a nucleic acid
molecule in the sample.
17. The method of claim 16, wherein the sample comprises mRNA
molecules and is contacted with a nucleic acid probe.
18. A kit comprising a compound which selectively hybridizes with a
nucleic acid molecule of claim 1 and instructions for use.
19. A method for identifying a compound which binds with a
polypeptide of claim 8 comprising the steps of: a) contacting a
polypeptide, or a cell expressing a polypeptide of claim 8 with a
test compound; and b) determining whether the polypeptide binds
with the test compound.
20. The method of claim 19, wherein the binding of the test
compound to the polypeptide is detected by a method selected from
the group consisting of: a) detection of binding by direct
detecting of test compound/polypeptide binding; b) detection of
binding using a competition binding assay; c) detection of binding
using an assay for an activity characteristic of the
polypeptide.
21. A method for modulating the activity of a polypeptide of claim
8 comprising contacting a polypeptide or a cell expressing a
polypeptide of claim 8 with a compound which binds with the
polypeptide in a sufficient concentration to modulate the activity
of the polypeptide.
22. A method for identifying a compound which modulates the
activity of a polypeptide of claim 8, comprising: a) contacting a
polypeptide of claim 8 with a test compound; and b) determining the
effect of the test compound on the activity of the polypeptide to
thereby identify a compound which modulates the activity of the
polypeptide.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 12/387,959, filed on May 8, 2009 (published), which is a
continuation of U.S. application Ser. No. 10/741,790, filed on Dec.
19, 2003 (now U.S. Pat. No. 7,547,766), which is a continuation of
U.S. application Ser. No. 09/759,130, filed Jan. 12, 2001 (now
abandoned).
[0002] U.S. application Ser. No. 09/759,130, is a
continuation-in-part of U.S. application Ser. No. 09/479,249, filed
on Jan. 7, 2000 (abandoned), and a continuation-in-part of U.S.
application Ser. No. 09/559,497, filed on Apr. 27, 2000
(abandoned).
[0003] U.S. application Ser. No. 09/759,130, is also a
continuation-in-part of U.S. application Ser. No. 09/578,063, filed
on May 24, 2000 (now U.S. Pat. No. 6,764,677), which is a
continuation-in-part of U.S. application Ser. No. 09/333,159, filed
on Jun. 14, 1999 (now U.S. Pat. No. 7,033,780).
[0004] U.S. application Ser. No. 09/759,130, is also a
continuation-in-part of U.S. application Ser. No. 09/596,194, filed
on Jul. 14, 2000 (abandoned), which is a continuation-in-part of
U.S. application Ser. No. 09/342,364, filed on Jun. 29, 1999
(abandoned).
[0005] U.S. application Ser. No. 09/759,130, is also a
continuation-in-part of U.S. application Ser. No. 09/608,452, filed
on Jun. 30, 2000 (abandoned), which is a continuation-in-part of
U.S. application Ser. No. 09/393,996, filed on Sep. 10, 1999
(abandoned).
[0006] U.S. application Ser. No. 09/759,130, is also a
continuation-in-part of U.S. application Ser. No. 09/602,871, filed
on Jun. 23, 2000 (abandoned), which is a continuation-in-part of
U.S. application Ser. No. 09/420,707, filed on Oct. 19, 1999
(abandoned).
[0007] Each of the applications cross-referenced in this section
are incorporated into this disclosure by reference.
STATEMENT REGARDING FEDERAL RESEARCH SUPPORT
[0008] Not Applicable
REFERENCE TO MICROFICHE APPENDIX
[0009] Not Applicable
BACKGROUND OF THE INVENTION
[0010] The molecular bases underlying many human and animal
physiological states (e.g., diseased and homeostatic states of
various tissues) remain unknown. Nonetheless, it is well understood
that these states result from interactions among the proteins and
nucleic acids present in the cells of the relevant tissues. In the
past, the complexity of biological systems overwhelmed the ability
of practitioners to understand the molecular interactions giving
rise to normal and abnormal physiological states. More recently,
though, the techniques of molecular biology, transgenic and null
mutant animal production, computational biology, and
pharmacogenomics have enabled practitioners to discern the role and
importance of individual genes and proteins in particular
physiological states.
[0011] Knowledge of the sequences and other properties of genes
(particularly including the portions of genes encoding proteins)
and the proteins encoded thereby enables the practitioner to design
and screen agents which will affect, prospectively or
retrospectively, the physiological state of an animal tissue in a
favorable way. Such knowledge also enables the practitioner, by
detecting the levels of gene expression and protein production, to
diagnose the current physiological state of a tissue or animal and
to predict such physiological states in the future. This knowledge
furthermore enables the practitioner to identify and design
molecules which bind with the polynucleotides and proteins, in
vitro, in vivo, or both.
[0012] Cadherins are a class of cell-surface adhesion molecules
that mediate calcium-dependent cell-to-cell adhesion. Many
cadherins exhibit homophilic adhesion; i.e. they bind with
molecules of the same cadherin on a different cell. However,
cadherins that bind specifically with other molecules have also
been described (e.g. Telo et al., 1998, J. Biol. Chem.
273:17565-17572; Ludviksson et al., 1999 J. Immunol.
162:4975-4982). In addition to their binding capabilities,
cadherins also exhibit transmembrane signaling and regulatable
adhesion activity (e.g. Yap et al., 1997, 13:119-146; Gumbiner,
2000, J. Cell Biol. 148:399-403). Despite the fact that numerous
cadherins and cadherin-like proteins have been described, many
others have not yet been characterized. A family of cadherin-like
proteins which the inventor believes to be novel is described
herein.
[0013] Many secreted proteins, for example, cytokines and cytokine
receptors, play a vital role in the regulation of cell growth, cell
differentiation, and a variety of specific cellular responses. A
number of medically useful proteins, including erythropoietin,
granulocyte-macrophage colony stimulating factor, human growth
hormone, and various interleukins, are secreted proteins. Thus, an
important goal in the design and development of new therapies is
the identification and characterization of secreted and
transmembrane proteins and the genes which encode them.
[0014] Many secreted proteins are receptors which bind a ligand and
transduce an intracellular signal, leading to a variety of cellular
responses. The identification and characterization of such a
receptor enables one to identify both the ligands which bind to the
receptor and the intracellular molecules and signal transduction
pathways associated with the receptor, permitting one to identify
or design modulators of receptor activity, e.g., receptor agonists
or antagonists and modulators of signal transduction.
SUMMARY OF THE INVENTION
[0015] The present invention is based, at least in part, on the
discovery of human cDNA molecules which encode proteins which are
herein designated TANGO 202, TANGO 210, INTERCEPT 217, TANGO 229,
TANGO 234, TANGO 265, TANGO 276, TANGO 286, INTERCEPT 289, TANGO
292, TANGO 294, INTERCEPT 296, INTERCEPT 297, INTERCEPT 309, TANGO
331, TANGO 332, TANGO 366, INTERCEPT 394, INTERCEPT 400, TANGO 416,
MANGO 419, INTERCEPT 429, and TANGO 457. These proteins, fragments
thereof, derivatives thereof, and variants thereof are collectively
referred to herein as the polypeptides of the invention or the
proteins of the invention. Nucleic acid molecules encoding
polypeptides of the invention are collectively referred to as
nucleic acids of the invention.
[0016] The nucleic acids and polypeptides of the present invention
are useful as modulating agents for regulating a variety of
cellular processes. Accordingly, in one aspect, the present
invention provides isolated nucleic acid molecules encoding a
polypeptide of the invention or a biologically active portion
thereof. The present invention also provides nucleic acid molecules
which are suitable as primers or hybridization probes for the
detection of nucleic acids encoding a polypeptide of the
invention.
[0017] The invention includes fragments of any of the nucleic acids
described herein wherein the fragment retains a biological or
structural function by which the full-length nucleic acid is
characterized (e.g., an activity, an encoded protein, or a binding
capacity). The invention furthermore includes fragments of any of
the nucleic acids described herein wherein the fragment has a
nucleotide sequence sufficiently (e.g., 50%, 60%, 70%, 80%, 85%,
90%, 95%, 98%, or 99% or greater) identical to the nucleotide
sequence of the corresponding full-length nucleic acid that it
retains a biological or structural function by which the
full-length nucleic acid is characterized (e.g., an activity, an
encoded protein, or a binding capacity).
[0018] The invention includes fragments of any of the polypeptides
described herein wherein the fragment retains a biological or
structural function by which the full-length polypeptide is
characterized (e.g., an activity or a binding capacity). The
invention furthermore includes fragments of any of the polypeptides
described herein wherein the fragment has an amino acid sequence
sufficiently (e.g., 50%, 60%, 70%, 80%, 85%, 90%, 95%, 98%, or 99%
or greater) identical to the amino acid sequence of the
corresponding full-length polypeptide that it retains a biological
or structural function by which the full-length polypeptide is
characterized (e.g., an activity or a binding capacity).
[0019] The invention also features nucleic acid molecules which are
at least 40% (or 50%, 60%, 70%, 80%, 90%, 95%, or 98%) identical to
the nucleotide sequence of any of SEQ ID NOs: 1, 2, 31, 32, 51, 52,
71, 72, 81, 82, 91, 92, 96, 97, 101, 102, 106, 107, 111, 112, 121,
122, 141, 142, 151, 152, 161, 162, 171, 172, 181, 182, 191, 192,
201, 202, 215, 217, 221, 222, 241, 242, 251, 252, 271, 272, 279,
280, 303, 304, 308, 309, 324, 325, 329, 330, 351, 352, 362, 371,
372, 379, 380, 387, 388, 403, 404, 415, 416, 423, 424, 437, and
438, the TANGO 202 nucleotide sequence of the cDNA insert of a
clone deposited on Apr. 21, 1999 with the ATCC.RTM. as accession
no. 207219, the TANGO 202 nucleotide sequence of the cDNA insert of
a clone deposited on Apr. 21, 1999 with the ATCC.RTM. as accession
no. 207221, the TANGO 210 nucleotide sequence of the cDNA insert of
a clone deposited on Jul. 29, 1999 with the ATCC.RTM. as accession
no. PTA-438, the INTERCEPT 217 nucleotide sequence of the cDNA
insert of a clone deposited on May 28, 1999 with the ATCC.RTM. as
accession no. PTA-147, the TANGO 229 nucleotide sequence of the
cDNA insert of a clone deposited on Oct. 1, 1999 with the ATCC.RTM.
as accession no. PTA-295, the TANGO 234 nucleotide sequence of the
cDNA insert of a clone deposited on Apr. 2, 1999 with the ATCC.RTM.
as accession no. 207184, the TANGO 265 nucleotide sequence of the
cDNA insert of a clone deposited on Apr. 28, 1999 with the
ATCC.RTM. as accession no. 207228, the TANGO 276 nucleotide
sequence of the cDNA insert of a clone deposited on May 28, 1999
with the ATCC.RTM. as accession no. PTA-150, the TANGO 286
nucleotide sequence of the cDNA insert of a clone deposited on Apr.
21, 1999 with the ATCC.RTM. as accession no. 207220, the INTERCEPT
289 nucleotide sequence of the cDNA insert of a clone deposited on
Oct. 1, 1999 with the ATCC.RTM. as accession no. PTA-295, the TANGO
292 nucleotide sequence of the cDNA insert of a clone deposited on
Apr. 28, 1999 with the ATCC.RTM. as accession no. 207230, the TANGO
294 nucleotide sequence of the cDNA insert of a clone deposited on
Apr. 21, 1999 with the ATCC.RTM. as accession no. 207220, the
INTERCEPT 296 nucleotide sequence of the cDNA insert of a clone
deposited on Apr. 21, 1999 with the ATCC.RTM. as accession no.
207220, the INTERCEPT 297 nucleotide sequence of the cDNA insert of
a clone deposited on May 28, 1999 with the ATCC.RTM. as accession
no. PTA-147, the INTERCEPT 309 nucleotide sequence of the cDNA
insert of a clone deposited on Jan. 6, 2000 with the ATCC.RTM. as
accession no. PTA-1156, the TANGO 331 nucleotide sequence of the
cDNA insert of a clone deposited on May 28, 1999 with the ATCC.RTM.
as accession no. PTA-147, the TANGO 332 nucleotide sequence of the
cDNA insert of a clone deposited on May 28, 1999 with the ATCC.RTM.
as accession no. PTA-151, the TANGO 366 nucleotide sequence of the
cDNA insert of a clone deposited on Jul. 23, 1999 with the
ATCC.RTM. as accession no. PTA-424, the INTERCEPT 394 nucleotide
sequence of the cDNA insert of a clone deposited on Jul. 23, 1999
with the ATCC.RTM. as accession no. PTA-424, the INTERCEPT 400
nucleotide sequence of the cDNA insert of a clone deposited on Jul.
29, 1999 with the ATCC.RTM. as accession no. PTA-438, the TANGO 416
nucleotide sequence of the cDNA insert of a clone deposited on Apr.
26, 1999 with the ATCC.RTM. as accession no. PTA-1764, the MANGO
419 nucleotide sequence of the cDNA insert of a clone deposited on
Jan. 6, 2000 with the ATCC.RTM. as accession no. PTA-1156, the
INTERCEPT 429 nucleotide sequence of the cDNA insert of a clone
deposited on Aug. 5, 1999 with the ATCC.RTM. as accession no.
PTA-455, the TANGO 457 nucleotide sequence of the cDNA insert of a
clone deposited on Oct. 1, 1999 with the ATCC.RTM. as accession no.
PTA-817, or a complement thereof. These deposited nucleotide
sequences are hereafter individually and collectively referred to
as "the nucleotide sequence of any of the clones deposited as
ATCC.RTM. Accession numbers 207184, 207219, 207220, 207221, 207228,
207230, PTA-147, PTA-150, PTA-151, PTA-295, PTA-424, PTA-438,
PTA-455, PTA-817, PTA-1156, and PTA-1764."
[0020] The invention features nucleic acid molecules which include
a fragment of at least 15 (25, 40, 60, 80, 100, 150, 200, 250, 300,
350, 400, 450, 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600,
1800, 2000, 2200, 2400, 2600, 2800, 3000, 3500, 4000, 4500, 5000,
or more) consecutive nucleotide residues of any of SEQ ID NOs: 1,
2, 31, 32, 51, 52, 71, 72, 81, 82, 91, 92, 96, 97, 101, 102, 106,
107, 111, 112, 121, 122, 141, 142, 151, 152, 161, 162, 171, 172,
181, 182, 191, 192, 201, 202, 215, 217, 221, 222, 241, 242, 251,
252, 271, 272, 279, 280, 303, 304, 308, 309, 324, 325, 329, 330,
351, 352, 362, 371, 372, 379, 380, 387, 388, 403, 404, 415, 416,
423, 424, 437, 438, and the nucleotide sequence of any of the
clones deposited as ATCC.RTM. Accession numbers 207184, 207219,
207220, 207221, 207228, 207230, PTA-147, PTA-150, PTA-151, PTA-295,
PTA-424, PTA-438, PTA-455, PTA-817, PTA-1156, and PTA-1764, or a
complement thereof.
[0021] The invention also features nucleic acid molecules which
include a nucleotide sequence encoding a protein having an amino
acid sequence that is at least 50% (or 60%, 70%, 80%, 90%, 95%, or
98%) identical to the amino acid sequence of any of SEQ ID NOs:
3-8, 33, 35, 38, 53-60, 73-78, 83-85, 93-95, 98-100, 103-105,
108-110, 113-115, 123-131, 143-145, 153-160, 163, 173-175, 183-185,
193-198, 203-214, 216, 223-236, 243-252, 253, 273-278, 281-302,
305-307, 310-315, 326-328, 331-333, 353-358, 363-368, 373-378,
381-386, 389-394, 405-414, 417-422, 425-436, and 439, or the amino
acid sequence encoded by the nucleotide sequence of any of the
clones deposited as ATCC.RTM. Accession numbers 207184, 207219,
207220, 207221, 207228, 207230, PTA-147, PTA-150, PTA-151, PTA-295,
PTA-424, PTA-438, PTA-455, PTA-817, PTA-1156, and PTA-1764 or a
complement thereof.
[0022] In certain embodiments, the nucleic acid molecules have the
nucleotide sequence of any of SEQ ID NOs: 1, 2, 31, 32, 51, 52, 71,
72, 81, 82, 91, 92, 96, 97, 101, 102, 106, 107, 111, 112, 121, 122,
141, 142, 151, 152, 161, 162, 171, 172, 181, 182, 191, 192, 201,
202, 215, 217, 221, 222, 241, 242, 251, 252, 271, 272, 279, 280,
303, 304, 308, 309, 324, 325, 329, 330, 351, 352, 362, 371, 372,
379, 380, 387, 388, 403, 404, 415, 416, 423, 424, 437, 438, and the
nucleotide sequence of any of the clones deposited as ATCC.RTM.
Accession numbers 207184, 207219, 207220, 207221, 207228, 207230,
PTA-147, PTA-150, PTA-151, PTA-295, PTA-424, PTA-438, PTA-455,
PTA-817, PTA-1156, and PTA-1764.
[0023] Also within the invention are nucleic acid molecules which
encode a fragment of a polypeptide having the amino acid sequence
of any of SEQ ID NOs: 3-8, 33, 35, 38, 53-60, 73-78, 83-85, 93-95,
98-100, 103-105, 108-110, 113-115, 123-131, 143-145, 153-160, 163,
173-175, 183-185, 193-198, 203-214, 216, 223-236, 243-252, 253,
273-278, 281-302, 305-307, 310-315, 326-328, 331-333, 353-358,
363-368, 373-378, 381-386, 389-394, 405-414, 417-422, 425-436, and
439, the fragment including at least 10 (12, 15, 20, 25, 30, 40,
50, 75, 100, 125, 150, 200, 250, 300, 400, 500, 750, 1000 or more)
consecutive amino acid residues of any of SEQ ID NOs: 3-8, 33, 35,
38, 53-60, 73-78, 83-85, 93-95, 98-100, 103-105, 108-110, 113-115,
123-131, 143-145, 153-160, 163, 173-175, 183-185, 193-198, 203-214,
216, 223-236, 243-252, 253, 273-278, 281-302, 305-307, 310-315,
326-328, 331-333, 353-358, 363-368, 373-378, 381-386, 389-394,
405-414, 417-422, 425-436, and 439.
[0024] The invention includes nucleic acid molecules which encode a
naturally occurring allelic variant of a polypeptide comprising the
amino acid sequence of any of SEQ ID NOs: 3-8, 33, 35, 38, 53-60,
73-78, 83-85, 93-95, 98-100, 103-105, 108-110, 113-115, 123-131,
143-145, 153-160, 163, 173-175, 183-185, 193-198, 203-214, 216,
223-236, 243-252, 253, 273-278, 281-302, 305-307, 310-315, 326-328,
331-333, 353-358, 363-368, 373-378, 381-386, 389-394, 405-414,
417-422, 425-436, and 439, wherein the nucleic acid molecule
hybridizes under stringent conditions to a nucleic acid molecule
having a nucleic acid sequence of any of SEQ ID NOs: 1, 2, 31, 32,
51, 52, 71, 72, 81, 82, 91, 92, 96, 97, 101, 102, 106, 107, 111,
112, 121, 122, 141, 142, 151, 152, 161, 162, 171, 172, 181, 182,
191, 192, 201, 202, 215, 217, 221, 222, 241, 242, 251, 252, 271,
272, 279, 280, 303, 304, 308, 309, 324, 325, 329, 330, 351, 352,
362, 371, 372, 379, 380, 387, 388, 403, 404, 415, 416, 423, 424,
437, 438, and the nucleotide sequence of any of the clones
deposited as ATCC.RTM. Accession numbers 207184, 207219, 207220,
207221, 207228, 207230, PTA-147, PTA-150, PTA-151, PTA-295,
PTA-424, PTA-438, PTA-455, PTA-817, PTA-1156, and PTA-1764, or a
complement thereof.
[0025] Also within the invention are isolated polypeptides or
proteins having an amino acid sequence that is at least about 50%,
preferably 60%, 75%, 90%, 95%, or 98% identical to the amino acid
sequence of any of SEQ ID NOs: 3-8, 33, 35, 38, 53-60, 73-78,
83-85, 93-95, 98-100, 103-105, 108-110, 113-115, 123-131, 143-145,
153-160, 163, 173-175, 183-185, 193-198, 203-214, 216, 223-236,
243-252, 253, 273-278, 281-302, 305-307, 310-315, 326-328, 331-333,
353-358, 363-368, 373-378, 381-386, 389-394, 405-414, 417-422,
425-436, and 439.
[0026] Also within the invention are isolated polypeptides or
proteins which are encoded by a nucleic acid molecule having a
nucleotide sequence that is at least about 40%, preferably 50%,
60%, 75%, 85%, or 95% identical the nucleic acid sequence encoding
any of SEQ ID NOs: 3-8, 33, 35, 38, 53-60, 73-78, 83-85, 93-95,
98-100, 103-105, 108-110, 113-115, 123-131, 143-145, 153-160, 163,
173-175, 183-185, 193-198, 203-214, 216, 223-236, 243-252, 253,
273-278, 281-302, 305-307, 310-315, 326-328, 331-333, 353-358,
363-368, 373-378, 381-386, 389-394, 405-414, 417-422, 425-436, and
439, and isolated polypeptides or proteins which are encoded by a
nucleic acid molecule consisting of the nucleotide sequence which
hybridizes under stringent hybridization conditions to a nucleic
acid molecule having the nucleotide sequence of any of SEQ ID NOs:
1, 2, 31, 32, 51, 52, 71, 72, 81, 82, 91, 92, 96, 97, 101, 102,
106, 107, 111, 112, 121, 122, 141, 142, 151, 152, 161, 162, 171,
172, 181, 182, 191, 192, 201, 202, 215, 217, 221, 222, 241, 242,
251, 252, 271, 272, 279, 280, 303, 304, 308, 309, 324, 325, 329,
330, 351, 352, 362, 371, 372, 379, 380, 387, 388, 403, 404, 415,
416, 423, 424, 437, 438, and the nucleotide sequence of any of the
clones deposited as ATCC.RTM. Accession numbers 207184, 207219,
207220, 207221, 207228, 207230, PTA-147, PTA-150, PTA-151, PTA-295,
PTA-424, PTA-438, PTA-455, PTA-817, PTA-1156, and PTA-1764.
[0027] Also within the invention are polypeptides which are
naturally occurring allelic variants of a polypeptide that includes
the amino acid sequence of any of SEQ ID NOs: 3-8, 33, 35, 38,
53-60, 73-78, 83-85, 93-95, 98-100, 103-105, 108-110, 113-115,
123-131, 143-145, 153-160, 163, 173-175, 183-185, 193-198, 203-214,
216, 223-236, 243-252, 253, 273-278, 281-302, 305-307, 310-315,
326-328, 331-333, 353-358, 363-368, 373-378, 381-386, 389-394,
405-414, 417-422, 425-436, and 439, wherein the polypeptide is
encoded by a nucleic acid molecule which hybridizes under stringent
conditions to a nucleic acid molecule having the nucleotide
sequence of any of SEQ ID NOs: 1, 2, 31, 32, 51, 52, 71, 72, 81,
82, 91, 92, 96, 97, 101, 102, 106, 107, 111, 112, 121, 122, 141,
142, 151, 152, 161, 162, 171, 172, 181, 182, 191, 192, 201, 202,
215, 217, 221, 222, 241, 242, 251, 252, 271, 272, 279, 280, 303,
304, 308, 309, 324, 325, 329, 330, 351, 352, 362, 371, 372, 379,
380, 387, 388, 403, 404, 415, 416, 423, 424, 437, 438, and the
nucleotide sequence of any of the clones deposited as ATCC.RTM.
Accession numbers 207184, 207219, 207220, 207221, 207228, 207230,
PTA-147, PTA-150, PTA-151, PTA-295, PTA-424, PTA-438, PTA-455,
PTA-817, PTA-1156, and PTA-1764, or a complement thereof.
[0028] The invention also features nucleic acid molecules that
hybridize under stringent conditions to a nucleic acid molecule
having the nucleotide sequence of any of SEQ ID NOs: 1, 2, 31, 32,
51, 52, 71, 72, 81, 82, 91, 92, 96, 97, 101, 102, 106, 107, 111,
112, 121, 122, 141, 142, 151, 152, 161, 162, 171, 172, 181, 182,
191, 192, 201, 202, 215, 217, 221, 222, 241, 242, 251, 252, 271,
272, 279, 280, 303, 304, 308, 309, 324, 325, 329, 330, 351, 352,
362, 371, 372, 379, 380, 387, 388, 403, 404, 415, 416, 423, 424,
437, 438, and the nucleotide sequence of any of the clones
deposited as ATCC.RTM. Accession numbers 207184, 207219, 207220,
207221, 207228, 207230, PTA-147, PTA-150, PTA-151, PTA-295,
PTA-424, PTA-438, PTA-455, PTA-817, PTA-1156, and PTA-1764, or a
complement thereof. In some embodiments, the isolated nucleic acid
molecules encode a cytoplasmic, transmembrane, extracellular, or
other domain of a polypeptide of the invention. In other
embodiments, the invention provides an isolated nucleic acid
molecule which is antisense to the coding strand of a nucleic acid
of the invention.
[0029] Another aspect of the invention provides vectors, e.g.,
recombinant expression vectors, comprising a nucleic acid molecule
of the invention. In another embodiment, the invention provides
isolated host cells, e.g., mammalian or non-mammalian cells,
containing such a vector or a nucleic acid of the invention. The
invention also provides methods for producing a polypeptide of the
invention by culturing, in a suitable medium, a host cell of the
invention containing a recombinant expression vector encoding a
polypeptide of the invention such that the polypeptide of the
invention is produced.
[0030] Another aspect of this invention features isolated or
recombinant proteins and polypeptides of the invention. Preferred
proteins and polypeptides possess at least one biological activity
possessed by the corresponding naturally-occurring human
polypeptide. An activity, a biological activity, and a functional
activity of a polypeptide of the invention refers to an activity
exerted by a protein or polypeptide of the invention on a
responsive cell as determined in vivo, or in vitro, according to
standard techniques. Such activities can be a direct activity, such
as an association with or an enzymatic activity exerted on a second
protein or an indirect activity, such as a cellular processes
mediated by interaction of the protein with a second protein.
[0031] The observations that expression of TANGO 416 protein is
up-regulated in porcine endothelial cells, that TANGO 416 is a
member of the cadherin family of proteins, and that at least one
cadherin (designated E-cadherin), which is expressed in endothelial
cells, binds to integrin .alpha.E.beta.7 indicate that TANGO 416
protein can also bind with integrin .alpha.E.beta.7. Thus, TANGO
416 nucleic acids, proteins, compounds which modulate their
activity, expression, or both, and compounds (e.g., antibodies)
which bind with TANGO 416 proteins (collectively "TANGO 416-related
molecules") can modulate one or more of growth, proliferation,
survival, differentiation, activity, morphology, and
movement/migration of, for example, cells (e.g. endothelial cells)
which normally express TANGO 416 and cells (e.g. certain T cells,
eosinophils, mast cells, and other lymphocytes) which normally
express integrin .alpha.E.beta.7.
[0032] The ability of TANGO 416 to bind with integrin
.alpha.E.beta.7 indicates that TANGO 416 protein and other TANGO
416-related molecules can be used to modulate the physiological
activities associated with integrin .alpha.E.beta.7 function and to
treat disorders to which such physiological activities contribute.
TANGO 416 protein can thus be involved in disorders which affect
epithelial and lymphocytic tissues. Such disorders include cell
proliferation disorders, disorders associated with aberrant
epithelial permeability, auto-, hypo-, and hyper-immune disorders,
disorders associated with aberrant binding or adhesion of cells
with other cells, and inflammatory disorders. TANGO 416-related
molecules can be used to prognosticate, prevent, diagnose, or treat
one or more such disorders.
[0033] The present invention is based, at least in part, on the
discovery of cDNA molecules which encode TANGO 457 proteins, which
are transmembrane proteins with one or more immunoglobulin domains
and which are encoded by sequences expressed in at least, uterus,
fetal liver, fetal spleen, and placenta tissues.
[0034] The biological activities of TANGO 457 and modulators
thereof include, e.g., (1) the ability to form, e.g., stabilize,
promote, inhibit, or disrupt, protein-protein interactions (e.g.,
homophilic and/or heterophilic) with proteins in the signaling
pathway of the naturally-occurring polypeptide; (2) the ability to
bind a ligand of the naturally-occurring polypeptide; and (3) the
ability to interact with a TANGO 457 receptor. Other activities
include the ability to modulate function, survival, morphology,
migration, proliferation and/or differentiation of cells of tissues
(e.g., uterus, fetal liver, fetal spleen, and placenta) in which it
is expressed.
[0035] TANGO 229, compounds which modulate its activity,
expression, or both, and compounds which interact with TANGO 229
can exhibit the ability to affect one or more of growth,
proliferation, survival, differentiation, activity, morphology, and
movement/migration of, for example, T cells and cells of heart,
liver, pancreas, placenta, brain lung, skeletal muscle, kidney,
spleen, lymph node, peripheral blood leukocyte, bone marrow, and
thymus tissues. TANGO 229 protein can be involved in mediating cell
binding and adhesion, including binding/adhesion of cells with
other cells, with extracellular matrix, and with foreign materials.
TANGO 229 protein can thus have a role in disorders associated with
aberrant binding of these types. TANGO 229 protein can also be
involved in mediating attraction and repulsion of cells and
translocation of cells through, past, or along other cells or
tissues. TANGO 229 protein can furthermore be involved in
transducing signals across the cell membrane.
[0036] INTERCEPT 289, compounds which modulate its activity,
expression, or both, and compounds which interact with INTERCEPT
289 can exhibit the ability to affect one or more of growth,
proliferation, survival, differentiation, activity, morphology, and
movement/migration of, for example, lymphocytes such as monocytes
and macrophages. INTERCEPT 289 protein can be involved in
activating one or more types of macrophages and monocytes, and thus
can be involved in one or more immune disorders and other types of
disorders mediated by monocytes and macrophages.
[0037] INTERCEPT 309, compounds which modulate its activity,
expression, or both, and compounds which interact with INTERCEPT
309 modulate one or more of growth, proliferation, survival,
differentiation, activity, morphology, and movement/migration of
cells of brain, liver, colon, prostate, kidneys, thyroid, and other
epithelial and endothelial tissues. INTERCEPT 309 is a claudin-like
protein, and can modulate tight-junction regulated intercellular
and paracellular diffusion. INTERCEPT 309 also can participate in
cell-to-cell adhesive mechanisms that do not necessarily involve
tight junction formation. In addition, INTERCEPT 309 can mediate
interaction of cells in which it is expressed with Clostridium
perfringens enterotoxin, and can thus be involved in disorders
mediated by C. perfringens and other pathogens. Furthermore,
INTERCEPT 309 is associated with normal and aberrant apoptosis, and
thus with disorders associated with aberrant apoptosis.
[0038] MANGO 419, compounds which modulate its activity,
expression, or both, and compounds which interact with MANGO 419
can modulate one or more of growth, proliferation, survival,
differentiation, activity, morphology, and movement/migration of,
for example, cells of embryonic and mammary, prostate, and other
epithelial and endothelial tissues. MANGO 419 protein can be
involved in disorders which affect epithelial and endothelial
tissues. Such disorders include cell proliferation disorders,
disorders associated with aberrant epithelial/endothelial
permeability, and disorders associated with aberrant binding or
adhesion of cells with other cells, with extracellular matrix, or
with foreign materials.
[0039] INTERCEPT 429, compounds which modulate its activity,
expression, or both, and compounds which interact with INTERCEPT
429 can modulate one or more of growth, proliferation, survival,
differentiation, activity, morphology, and movement/migration of,
for example, cells of cardiac muscle, small intestine, and one or
more of fetal lung, testis, and B cell tissues. INTERCEPT 429 can
be involved in modulating growth, proliferation, survival,
differentiation, and activity of cells of these tissues, in both
normal and diseased tissues.
[0040] TANGO 210, compounds which modulate its activity,
expression, or both, and compounds which interact with TANGO 210
exhibit the ability to affect one or more of growth, proliferation,
survival, differentiation, activity, morphology, and
movement/migration of, for example, human adult kidney, fetal
kidney, skin, and bone marrow cells and tissues. TANGO 210
modulates the structure of extracellular matrix within, or in fluid
communication with, one or more of these tissues. For example,
TANGO 210 exhibits proteinase activity that can enzymatically
degrade one or more of the proteinaceous components of
extracellular matrix. Thus, TANGO 210-related molecules can be used
to prognosticate, prevent, diagnose, or treat disorders relating to
aberrant formation or degradation of extracellular matrix. In
various embodiments, for example, TANGO 210 is used to
prognosticate, prevent, diagnose, or treat kidney, bone marrow, and
skin disorders. TANGO 210 can also be used to prognosticate,
prevent, diagnose, or treat one or more cancers, including
metastatic cancers.
[0041] TANGO 366, compounds which modulate its activity,
expression, or both, and compounds which interact with TANGO 366
modulate one or more of growth, proliferation, survival,
differentiation, activity, morphology, and movement/migration of
human fibroblast cells and tissues in which fibroblasts normally or
aberrantly occur. TANGO 366 is a cell surface protein-binding
protein. TANGO 366 modulates binding of a cell which expresses it
with one or more of an extracellular fluid protein, a protein
component of the extracellular matrix, a surface protein another
cell of the same animal, and a surface protein of a bacterium,
fungus, or virus. TANGO 366 is therefore involved in cell-to-cell
adhesion, tissue and extracellular matrix invasivity of cells,
infectivity of cells by pathogens such as bacteria and viruses,
endocrine signaling processes, tissue developmental and
organizational processes, and the like.
[0042] INTERCEPT 394, compounds which modulate its activity,
expression, or both, and compounds which interact with INTERCEPT
394 modulate one or more of growth, proliferation, survival,
differentiation, activity, morphology, and movement/migration of,
for example, human adult and fetal kidney cells and tissues.
INTERCEPT 394, a transmembrane protein, is involved in modulation
of intracellular processes, including modulation that is effected
upon binding of a ligand to an extracellular portion of INTERCEPT
394. INTERCEPT 394 protein is thus capable of transmitting signals
across a membrane (e.g., from a signal source outside the cell to a
molecule within the cell or from a signal source within the cell to
a molecule outside the cell), along a membrane (i.e., between two
or more molecules on a single side of a membrane), and combinations
thereof. INTERCEPT 394 protein is also capable of interacting with
other membrane-associated proteins to form complexes, the activity
or specificity of which can be affected by association of INTERCEPT
394 therewith.
[0043] INTERCEPT 400, compounds which modulate its activity,
expression, or both, and compounds which interact with INTERCEPT
400 modulate one or more of growth, proliferation, survival,
differentiation, activity, morphology, and movement/migration of,
for example, human adult and fetal keratinocytes and brain cells
and tissues. INTERCEPT 400 is a transmembrane protein that is
involved in modulating interactions between membrane components and
cellular cytoskeletons, such as interactions involved in activation
of leukocytes, interactions involved in affecting cellular
metabolism, interactions involved in cellular growth, and
interactions involved in cellular proliferation.
[0044] INTERCEPT 217 polypeptides, nucleic acids, and modulators
thereof exhibit the ability to affect growth, proliferation,
survival, differentiation, and activity of human pancreas, skeletal
muscle, heart, brain, placenta, lung, liver, and kidney cells.
INTERCEPT 217 modulates cellular binding to one or more mediators,
modulates activity and release of one or more pancreatically
secreted digestive enzymes, and protects tissue from endogenous
digestive enzymes. INTERCEPT 217 polypeptides, nucleic acids, and
modulators thereof can be used to prevent, diagnose, or treat
disorders relating to aberrant endogenous digestive enzyme
activity, inappropriate interaction (or non-interaction) of cells
with mediators, inappropriate cellular development and
proliferation, inappropriate inflammation, and inappropriate immune
responses.
[0045] INTERCEPT 297 polypeptides, nucleic acids, and modulators
thereof exhibit the ability to affect growth, proliferation,
survival, differentiation, and activity of human fetal cells and
spleen cells and of (e.g., bacterial or fungal) cells and viruses
which infect humans. Furthermore, INTERCEPT 297 modulates
organization, structure, and function of biological membranes.
INTERCEPT 297 polypeptides, nucleic acids, and modulators thereof
can be used to affect development and persistence of atherogenesis
and arteriosclerosis, for example, or to modulate transmembrane
transport processes such as ion transport across neuronal and
muscle cell membranes.
[0046] TANGO 276 polypeptides, nucleic acids, and modulators
thereof modulate growth, proliferation, survival, differentiation,
and activity of human heart, placenta, brain, lung, liver, skin,
kidney, pancreas, spleen, and fetal tissues. TANGO 276 guides
neuronal growth and development and modulates growth, homeostasis,
and regeneration of other epithelial tissues. TANGO 276 is a
secreted protein which mediates cellular interaction with cells,
molecules, and structures (e.g., extracellular matrix) in the
extracellular environment. TANGO 276 is involved in growth,
organization, migration, and adhesion of tissues and the cells
which constitute those tissues. Furthermore, TANGO 276 modulates
growth, proliferation, survival, differentiation, and activity of
neuronal cells and immune system cells.
[0047] TANGO 292 polypeptides, nucleic acids, and modulators
thereof modulate growth, proliferation, survival, differentiation,
and activity of human keratinocytes, including embryonic
keratinocytes. TANGO 292, a transmembrane protein, is also involved
in binding and uptake of calcium and other metal ions, and in
responses of cells which express it to the presence and uptake of
such ions. TANGO 292 polypeptides, nucleic acids, and modulators
can be used to prevent, diagnose, and treat disorders involving one
or more of bone uptake, maintenance, and deposition, formation,
maintenance, and repair of cartilage and skin, formation and
maintenance of extracellular matrices, movement of cells through
extracellular matrices, coagulation and dissolution of blood
components, and deposition of materials in and on arterial
walls.
[0048] TANGO 331 polypeptides, nucleic acids, and modulators
thereof modulate growth, proliferation, survival, differentiation,
and activity of human fetal, lung, spleen, and thymus cells and
tissues. As described herein, TANGO 331 is involved in
physiological activities such as maintenance of epithelia,
carcinogenesis, modulation and storage of protein factors and
metals, lactation, and infant nutrition. TANGO 331 also modulates
cellular binding and uptake of cytokines, growth factors, and metal
ions.
[0049] TANGO 332 polypeptides, nucleic acids, and modulators
thereof modulate growth, proliferation, survival, differentiation,
and activity of human brain and other tissues. As described herein,
TANGO 332 is involved in modulating establishment and maintenance
of neural connections, cell-to-cell adhesion, tissue and
extracellular matrix invasivity, and the like.
[0050] TANGO 202 exhibits the ability to affect growth,
proliferation, survival, differentiation, and activity of human
hematopoietic cells (e.g., bone marrow stromal cells) and fetal
cells. TANGO 202 modulates cellular binding to one or more
mediators, modulates proteolytic activity in vivo, modulates
developmental processes, and modulates cell growth, proliferation,
survival, differentiation, and activity.
[0051] TANGO 234 exhibits the ability to affect growth,
proliferation, survival, differentiation, and activity of human
lung, hematopoietic, and fetal cells and of (e.g., bacterial or
fungal) cells and viruses which infect humans. TANGO 234 modulates
growth, proliferation, survival, differentiation, and activity of
gamma delta T cells, for example. Furthermore, TANGO 234 modulates
cholesterol deposition on human arterial walls, and is involved in
uptake and metabolism of low density lipoprotein and regulation of
serum cholesterol levels.
[0052] TANGO 265 modulates growth and regeneration of neuronal and
epithelial tissues, and guides neuronal axon development. TANGO 265
is a transmembrane protein which mediates cellular interaction with
cells, molecules and structures (e.g., extracellular matrix) in the
extracellular environment. TANGO 265 is involved in growth,
organization, and adhesion of tissues and the cells which
constitute those tissues. Furthermore, TANGO 265 modulates growth,
proliferation, survival, differentiation, and activity of neuronal
cells and immune system cells.
[0053] TANGO 286 protein is involved in lipid-binding physiological
processes such as lipid transport, metabolism, serum lipid particle
regulation, host anti-microbial defensive mechanisms, and the
like.
[0054] TANGO 294 protein is involved in facilitating absorption and
metabolism of fat. Disorders which can be modulated by TANGO 294
proteins, nucleic acids, and compounds that interact with them
include, for example, inadequate expression of gastric/pancreatic
lipase, cystic fibrosis, exocrine pancreatic insufficiency, medical
treatments which alter fat absorption, and obesity.
[0055] INTERCEPT 296 protein is involved in physiological processes
related to disorders of the human lung and esophagus. Disorders
which can be modulated by INTERCEPT 296 proteins, nucleic acids,
and compounds that interact with them include, for example, various
cancers, bronchitis, cystic fibrosis, respiratory infections (e.g.,
influenza, bronchiolitis, pneumonia, and tuberculosis), asthma,
emphysema, chronic bronchitis, bronchiectasis, pulmonary edema,
pleural effusion, pulmonary embolus, adult and infant respiratory
distress syndromes, heartburn, and gastric esophageal reflux
disease.
[0056] In one embodiment, a polypeptide of the invention has an
amino acid sequence sufficiently identical to a polypeptide of the
invention or to an identified domain thereof. As used herein, the
term "sufficiently identical" refers to a first amino acid or
nucleotide sequence which contains a sufficient or minimum number
of identical or equivalent (e.g., with a similar side chain) amino
acid residues or nucleotides to a second amino acid or nucleotide
sequence such that the first and second amino acid or nucleotide
sequences have a common domain and/or common functional activity.
For example, amino acid or nucleotide sequences which contain a
common domain having about 65% identity, preferably 75% identity,
more preferably 85%, 95%, or 98% identity are defined herein as
sufficiently identical.
[0057] In one embodiment, the isolated polypeptide of the invention
lacks both a transmembrane and a cytoplasmic domain. In another
embodiment, the polypeptide lacks both a transmembrane domain and a
cytoplasmic domain and is soluble under physiological
conditions.
[0058] The polypeptides of the present invention, or biologically
active portions thereof, can be operably linked with a heterologous
amino acid sequence to form fusion proteins. The invention further
features antibody substances that specifically bind a polypeptide
of the invention, such as monoclonal or polyclonal antibodies,
antibody fragments, and single-chain antibodies. In addition, the
polypeptides of the invention or biologically active portions
thereof can be incorporated into pharmaceutical compositions, which
optionally include pharmaceutically acceptable carriers. These
antibody substances can be made, for example, by providing the
polypeptide of the invention to an immunocompetent vertebrate and
thereafter harvesting blood or serum from the vertebrate.
[0059] In another aspect, the present invention provides methods
for detecting the presence of the activity or expression of a
polypeptide of the invention in a biological sample by contacting
the biological sample with an agent capable of detecting an
indicator of activity such that the presence of activity is
detected in the biological sample.
[0060] In another aspect, the invention provides methods for
modulating activity of a polypeptide of the invention comprising
contacting a cell with an agent that modulates (inhibits or
enhances) the activity or expression of a polypeptide of the
invention such that activity or expression in the cell is
modulated. In one embodiment, the agent is an antibody that
specifically binds with a polypeptide of the invention.
[0061] In another embodiment, the agent modulates expression of a
polypeptide of the invention by modulating transcription, splicing,
or translation of an mRNA encoding a polypeptide of the invention.
In yet another embodiment, the agent is a nucleic acid molecule
having a nucleotide sequence that is antisense with respect to the
coding strand of an mRNA encoding a polypeptide of the
invention.
[0062] The present invention also provides methods of treating a
subject having a disorder characterized by aberrant activity of a
polypeptide of the invention or aberrant expression of a nucleic
acid of the invention by administering an agent which is a
modulator of the activity of a polypeptide of the invention or a
modulator of the expression of a nucleic acid of the invention to
the subject. In one embodiment, the modulator is a protein of the
invention. In another embodiment, the modulator is a nucleic acid
of the invention. In other embodiments, the modulator is a peptide,
peptidomimetic, or other small molecule. In yet another embodiment,
the modulator is an antibody.
[0063] The present invention also provides diagnostic assays for
identifying the presence or absence of a genetic lesion or mutation
characterized by at least one of: (i) aberrant modification or
mutation of a gene encoding a polypeptide of the invention, (ii)
mis-regulation of a gene encoding a polypeptide of the invention,
and (iii) aberrant post-translational modification of a polypeptide
of the invention wherein a wild-type form of the gene encodes a
polypeptide having the activity of the polypeptide of the
invention.
[0064] In another aspect, the invention provides a method for
identifying a compound that binds with or modulates the activity of
a polypeptide of the invention. In general, such methods entail
measuring a biological activity of the polypeptide in the presence
and absence of a test compound and identifying those compounds
which bind with or alter the activity of the polypeptide.
[0065] The invention also features methods for identifying a
compound which modulates the expression of a polypeptide or nucleic
acid of the invention by measuring the expression of the
polypeptide or nucleic acid in the presence and absence of the
compound.
[0066] Other features and advantages of the invention will be
apparent from the following detailed description and claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0067] FIG. 1 is a hydrophobicity plot of the embodiment of human
TANGO 416 protein listed in SEQ ID NO:3. In the hydrophobicity
plots disclosed herein, the locations of cysteine residues ("Cys")
and potential N-glycosylation sites ("Ngly") are indicated by
vertical bars and the predicted extracellular ("out"),
intracellular ("ins"), or transmembrane ("TM") portions of the
protein backbone are indicated by a horizontal bar. Relatively
hydrophobic regions of the protein are above the dashed horizontal
line, and relatively hydrophilic regions of the protein are below
the dashed horizontal line.
[0068] FIG. 2A-2H is an alignment of a portion of the TANGO 416
cDNA sequence ("T416"; residues 1651-4000 of SEQ ID NO: 1) with a
human testis cDNA clone having GenBank accession number AL137471
("AL137471"; SEQ ID NO: 40). This alignment indicates that the two
nucleotide sequences are about 98.6% identical over the overlapping
region. The alignment was made using the ALIGN software (BLOSUM62
scoring matrix, gap opening penalty 12, gap extension penalty 4,
frameshift gap penalty 5). In the alignments in this disclosure,
similar residues are indicated by ".", and identical residues are
indicated by ":" or "|".
[0069] FIG. 3A-3O is an alignment of a portion of the TANGO 416 ORF
nucleotide sequence ("T416"; residues 1-3405 of SEQ ID NO: 2) with
the ORF nucleotide sequence ("m-PC"; SEQ ID NO: 41) of murine
protocadherin (sometimes designated vascular endothelial cadherin-2
or mVE-cad-2). This alignment indicates that the two nucleotide
sequences are about 55.4% identical over the overlapping region.
The alignment was made using the ALIGN software (BLOSUM62 scoring
matrix, gap opening penalty 12, gap extension penalty 4, frameshift
gap penalty 5).
[0070] FIG. 4A-4E is an alignment of a portion of the TANGO 416
protein amino acid sequence ("T416"; residues 1-1135 of SEQ ID NO:
3) with the amino acid sequence ("m-PC"; SEQ ID NO: 42) of murine
protocadherin. This alignment indicates that the two amino acid
sequences are about 32.8% identical over the overlapping region.
The alignment was made using the ALIGN software (BLOSUM62 scoring
matrix, gap opening penalty 12, gap extension penalty 4).
[0071] FIG. 5 depicts a hydrophobicity plot of human TANGO 457.
[0072] FIGS. 6A-6D depict a local alignment of the nucleic acid of
human TANGO 457 shown in SEQ ID NO: 51 and a portion of the
nucleotide sequence of human chromosome 11p14.3 PAC clone
pDJ239b22, from nucleic acids 121077 to 122478 (SEQ ID NO: 61;
accession number AC003969). In the alignment, the TANGO 457
sequence is the top strand, and the 11p14.3 PAC clone pDJ239b22
sequences is on the bottom. The alignment shows that there is 100%
nucleotide sequence identity between the TANGO 457 sequence of SEQ
ID NO: 51 and human chromosome 11p14.3 PAC clone pDJ239b22, from
nucleotides 908 to 2305 of TANGO 457. This alignment was performed
using the ALIGN alignment program with a PAM120 scoring matrix, a
gap length penalty of 12, and a gap penalty of 4.
[0073] FIG. 7 is a hydrophobicity plot of one embodiment of human
TANGO 229 protein.
[0074] FIG. 8 is an alignment, made using the Wisconsin.TM. BestFit
software (Smith and Waterman, (1981) Adv. Appl. Math. 2:482-489;
BLOSUM62 scoring matrix, gap opening penalty 10/gap extension
penalty 10) of the amino acid sequences of murine myeloid DNAX
accessory protein associated lectin-1 ("M"; MDL-1; SEQ ID NO: 88),
murine INTERCEPT 289 ("R"; SEQ ID NO: 163), human MDL-1 ("H"; SEQ
ID NO: 86), form 1a of INTERCEPT 289 ("A"; SEQ ID NO: 83), form 1b
of INTERCEPT 289 ("B"; SEQ ID NO: 93), form 2a of INTERCEPT 289
("C"; SEQ ID NO: 98), form 2b of INTERCEPT 289 ("D"; SEQ ID NO:
103), form 3a of INTERCEPT 289 ("E"; SEQ ID NO: 108), and form 3b
of INTERCEPT 289 ("F"; SEQ ID NO: 113).
[0075] FIGS. 9A-9N is an alignment (made using the Wisconsin.TM.
BestFit software; Smith and Waterman, (1981) Adv. Appl. Math.
2:482-489; gap opening penalty 10/gap extension penalty 10), of the
nucleotide sequences of cDNA molecules encoding form 1a of
INTERCEPT 289 ("A"; SEQ ID NO: 81), form 1b of INTERCEPT 289 ("B";
SEQ ID NO: 91), form 2a of INTERCEPT 289 ("C"; SEQ ID NO: 96), form
2b of INTERCEPT 289 ("D"; SEQ ID NO: 101), form 3a of INTERCEPT 289
("E"; SEQ ID NO: 106), and form 3b of INTERCEPT 289 ("F"; SEQ ID
NO: 111).
[0076] FIGS. 10A-10F is a series of hydrophobicity plots for
individual forms of human INTERCEPT 289 protein. The plot
corresponding to form 1a is shown in FIG. 10A. The plot
corresponding to form 1b is shown in FIG. 10B. The plot
corresponding to form 2a is shown in FIG. 10C. The plot
corresponding to form 2b is shown in FIG. 10D. The plot
corresponding to form 3a is shown in FIG. 10E. The plot
corresponding to form 3b is shown in FIG. 10F.
[0077] FIGS. 11A-11B are a manual alignment of the nucleotide
sequences of murine INTERCEPT 289 ORF ("MI289"; SEQ ID NO: 162) and
the ORF of form 1a of human INTERCEPT 289 ("HI289"; SEQ ID NO:
82).
[0078] FIG. 12 is a hydrophobicity plot for murine INTERCEPT 289
protein.
[0079] FIG. 13 is a hydrophobicity plot of human INTERCEPT 309
protein. An alignment (made using the ALIGN software; pam120.mat
scoring matrix, gap opening penalty=12, gap extension penalty=4) of
the nucleotide sequences of a cDNA clone ("DKFZ"; SEQ ID NO: 134;
GenBank accession no. AL049977) obtained from human fetal brain
tissue and INTERCEPT 309 cDNA ("1309"; SEQ ID NO: 121) is shown in
FIGS. 14A-14G. An alignment (made using the ALIGN software;
pam120.mat scoring matrix, gap opening penalty=12, gap extension
penalty=4) of the nucleotide sequences of the cDNA encoding human
INTERCEPT 309 ("1309"; SEQ ID NO: 121) and a portion of a cDNA
encoding murine claudin-8 protein ("CLAUD8"; SEQ ID NO: 132) is
shown in FIGS. 15A-15G. An alignment (made using the ALIGN
software; pam120.mat scoring matrix, gap opening penalty=12, gap
extension penalty=4) of the amino acid sequences of human INTERCEPT
309 protein ("1309"; SEQ ID NO: 123) and murine claudin-8 protein
("CLAUD8"; SEQ ID NO: 133) is shown in FIG. 16. A manual alignment
of individual alignments (made using the Wisconsin.TM. BestFit
software; Smith and Waterman (1981) Adv. Appl. Math. 2:482-489;
blosum62 scoring matrix, gap opening penalty 10/gap extension
penalty 10) of the amino acid sequences of human INTERCEPT 309
protein ("1309"; SEQ ID NO: 123) with each of human Clostridium
perfringens enterotoxin receptor ("hCPE"; SEQ ID NO: 135), murine
C. perfringens enterotoxin receptor ("mCPE"; SEQ ID NO: 136), and a
protein encoded by a cDNA recovered from regressing rat ventral
prostate tissue ("rRPV"; SEQ ID NO: 137) is shown in FIG. 17.
[0080] FIG. 18 is a hydrophobicity plot of human MANGO 419
protein.
[0081] FIG. 19 is a hydrophobicity plot of human INTERCEPT 429
protein.
[0082] FIG. 20 is a hydrophobicity plot of human TANGO 210 protein
(the conformation of the alternative form of TANGO 210 protein,
wherein the carboxyl terminal portion comprises a transmembrane
domain, is shown here).
[0083] FIG. 21 is a hydrophobicity plot of murine TANGO 210
protein. An alignment of the amino acid sequences of human TANGO
210 protein (SEQ ID NO: 173) and murine TANGO 210 protein (SEQ ID
NO: 183) amino acid sequences is shown in FIGS. 22A-22B, wherein
identical amino acid residues are indicated by ":" and similar
amino acid residues are indicated by ".". An alignment of the
nucleotide sequences of the human (SEQ ID NO: 171) and murine (SEQ
ID NO: 181) cDNAs encoding TANGO 210 protein is shown in FIGS.
23A-23I.
[0084] FIGS. 24A-24B are an alignment of the amino acid sequences
of human TANGO 210 protein ("210"; SEQ ID NO: 173) and human matrix
metalloproteinase-8 (MMP-8; "MMP-8"; SEQ ID NO: 176). An alignment
of the nucleotide sequences of the open reading frame (ORF)
encoding human TANGO 210 ("210"; SEQ ID NO: 172) and the ORF
encoding human MMP-8 (SEQ ID NO: 177) is shown in FIGS.
24A-25F.
[0085] FIG. 26 is a graph which depicts expression of TANGO 210
mRNA in selected human tissue and cell types, relative to TANGO 210
expression in the human fetal heart tissue.
[0086] FIG. 27 is a hydrophobicity plot of human TANGO 366
protein.
[0087] FIG. 28 is a hydrophobicity plot of human INTERCEPT 394
protein.
[0088] FIG. 29 is a hydrophobicity plot of human INTERCEPT 400
protein.
[0089] FIG. 30 is a hydrophobicity plot of murine INTERCEPT 400
protein. An alignment of the amino acid sequences of human
INTERCEPT 400 protein (SEQ ID NO: 223) and murine INTERCEPT 400
protein (SEQ ID NO: 243) amino acid sequences is shown in FIG. 31.
An alignment of the nucleotide sequences of the human (SEQ ID NO:
222) and murine (SEQ ID NO: 242) ORFs encoding INTERCEPT 400
protein is shown in FIGS. 32A-32C. FIG. 33 is an alignment of the
amino acid sequences of human INTERCEPT 400 protein (1400''; SEQ ID
NO: 223) and murine Cig30 protein ("CIG30"; SEQ ID NO: 239). An
alignment of the nucleotide sequences of the ORFs encoding human
INTERCEPT 400 protein ("1400"; SEQ ID NO: 222) and the ORF encoding
murine Cig30 ("CIG30"; SEQ ID NO: 238) is shown in FIGS.
34A-34C.
[0090] FIG. 35 is an alignment of the amino acid sequences of human
(SEQ ID NO: 223), murine (SEQ ID NO: 243), and rat (SEQ ID NO: 253)
INTERCEPT 400 proteins.
[0091] FIG. 36 is a hydrophobicity plot of human INTERCEPT 217
protein. An alignment of the amino acid sequences of human
INTERCEPT 217 protein ("H"; SEQ ID NO: 273) and porcine
ribonuclease inhibitor protein ("P"; SwissProt Accession number
P10775; SEQ ID NO: 334) is shown in FIGS. 37A-37B. These alignments
were made using the ALIGN software {Myers and Miller (1989) CABIOS,
ver. 2.0}; pam120.mat scoring matrix; gap opening penalty=12, gap
extension penalty=4).
[0092] FIG. 38 is a hydrophobicity plot of murine INTERCEPT 217
protein. An alignment of the amino acid sequences of human
INTERCEPT 217 protein ("H"; SEQ ID NO: 273) and murine INTERCEPT
217 protein ("M"; SEQ ID NO: 363) is shown in FIG. 39. These
alignments were made using the BESTFIT software (BLOSUM62 scoring
matrix, gap opening penalty=12, frameshift gap penalty=5, gap
extension penalty=4).
[0093] FIG. 40 is a hydrophobicity plot of human INTERCEPT 297
protein.
[0094] FIG. 41 is a hydrophobicity plot of TANGO 276 protein. An
alignment of the amino acid sequences of human TANGO 276 protein
("H"; SEQ ID NO: 305) and murine protein M-Sema-F ("M"; SEQ ID NO:
335) is shown in FIGS. 42A-42C.
[0095] In FIGS. 43A-43J, an alignment of the nucleotide sequences
of the cDNA encoding human TANGO 276 protein ("H"; SEQ ID NO: 303)
and the nucleotide sequences of the cDNA encoding murine protein
M-Sema-F ("M"; SEQ ID NO: 66) is shown. These alignments were made
using the ALIGN software {Myers and Miller (1989) CABIOS, ver.
2.0}; pam120.mat scoring matrix; gap opening penalty=12, gap
extension penalty=4).
[0096] FIG. 44 is a hydrophobicity plot of human TANGO 292
protein.
[0097] FIGS. 45A-45C are an alignment of the nucleotide sequences
of the ORF encoding human TANGO 292 protein ("H"; SEQ ID NO: 308)
and the nucleotide sequence of the ORF encoding gerbil TANGO 292
protein ("G"; SEQ ID NO: 351), made using the ALIGN software {Myers
and Miller (1989) CABIOS, ver. 2.0}; pam120.mat scoring matrix; gap
opening penalty=12, gap extension penalty=4). FIG. 26 is an
alignment of the human (H) and gerbil (G) TANGO 292 amino acid
sequences, made using the same software and parameters.
[0098] FIG. 47 is a hydrophobicity plot of gerbil TANGO 292
protein.
[0099] FIG. 48 is a hydrophobicity plot of TANGO 331 protein. An
alignment of the amino acid sequences of human TANGO 331 protein
("H"; SEQ ID NO: 326) and Chinese hamster protein HT ("C"; SEQ ID
NO: 339; GenBank Accession No. U48852) is shown in FIG. 49. In
FIGS. 50A-50E, an alignment of the nucleotide sequences of the cDNA
encoding human TANGO 331 protein ("H"; SEQ ID NO: 324) and the
nucleotide sequence of the cDNA encoding Chinese hamster protein HT
("C"; SEQ ID NO: 340) is shown. These alignments were made using
the ALIGN software {Myers and Miller (1989) CABIOS, ver. 2.0};
pam120.mat scoring matrix; gap opening penalty=12, gap extension
penalty=4).
[0100] FIG. 51 is a hydrophobicity plot of TANGO 332 protein. An
alignment of the amino acid sequences of TANGO 332 protein ("332";
SEQ ID NO: 331) and BEF protein ("BEF"; SEQ ID NO: 341) is shown in
FIGS. 52A-52B. An alignment of the amino acid sequences of human
TANGO 332 protein ("H"; SEQ ID NO: 331) and murine brevidin protein
("M"; SEQ ID NO: 342) is shown in FIGS. 53A-53C. In FIGS. 54A-54J,
an alignment of the nucleotide sequences of the cDNA encoding human
TANGO 332 protein ("H"; SEQ ID NO: 330) and the nucleotide sequence
of the cDNA encoding murine brevidin protein ("M"; SEQ ID NO: 343)
is shown. These alignments were made using the ALIGN software
{Myers and Miller (1989) CABIOS, ver. 2.0}; pam120.mat scoring
matrix; gap opening penalty=12, gap extension penalty=4). An
alignment of the amino acid sequences of human ("Hum."; SEQ ID NO:
373) and murine ("Mur."; SEQ ID NO: 439) TANGO 202 protein is shown
in FIGS. 55A-55B.
[0101] FIG. 56A is a hydrophobicity plot of human TANGO 202
protein.
[0102] FIG. 56B is a hydrophobicity plot of murine TANGO 202
protein.
[0103] FIG. 57 is a hydrophobicity plot of human TANGO 234 protein.
An alignment of the amino acid sequences of human TANGO 234 ("Hum";
SEQ ID NO: 381) and bovine WC1 ("WC1"; SEQ ID NO: 448) proteins is
shown in FIGS. 58A-58F. An alignment of the nucleotide sequences of
an ORF encoding human TANGO 234 ("Hum"; SEQ ID NO: 380) and an ORF
encoding bovine WC1 ("WC1"; SEQ ID NO: 449) proteins is shown in
FIGS. 59A-59Q.
[0104] An alignment of the amino acid sequences of human TANGO 265
protein ("Hum."; SEQ ID NO: 389) and murine semaphorin B protein
("Mur."; SEQ ID NO: 440; GenBank Accession No. X85991) is shown in
FIGS. 60A-60C. In FIGS. 61A-61L, an alignment of the nucleotide
sequences of the cDNA encoding human TANGO 265 protein ("Hum."; SEQ
ID NO: 387) and the nucleotide sequences of the cDNA encoding
murine semaphorin B protein ("Mur."; SEQ ID NO: 441; GenBank
Accession No. X85991) is shown.
[0105] FIG. 62 is a hydrophobicity plot of TANGO 265 protein.
[0106] FIG. 63 is a hydrophobicity plot of TANGO 286 protein. An
alignment of the amino acid sequences of human TANGO 286 ("286";
SEQ ID NO: 405) and BPI protein ("BPI"; SEQ ID NO: 408) protein is
shown in FIGS. 64A-64B. An alignment of the amino acid sequences of
human TANGO 286 ("286"; SEQ ID NO: 405) and RENP protein ("RENP";
SEQ ID NO: 409) is shown in FIGS. 65A-65B.
[0107] An alignment of the amino acid sequences of human TANGO 294
protein ("294"; SEQ ID NO: 417) and a known human lipase protein
("HLP"; SEQ ID NO: 445; GenBank Accession No. NP.sub.--004181) is
shown in FIGS. 66A-66B.
[0108] FIG. 67 is a hydrophobicity plot of TANGO 294 protein. An
alignment of the amino acid sequences of human TANGO 294 protein
("294"; SEQ ID NO: 417) and a known human lysosomal acid lipase
protein ("LAL"; SEQ ID NO: 411) is shown in FIGS. 68A-68B.
[0109] FIG. 69 is a hydrophobicity plot of INTERCEPT 296 protein.
An alignment of the amino acid sequences of human INTERCEPT 296
protein ("296"; SEQ ID NO: 425) and C. elegans C06E1.3 related
protein ("CRP"; SEQ ID NO: 410) is shown in FIGS. 70A-70B.
DETAILED DESCRIPTION OF THE INVENTION
[0110] The present invention is based, at least in part, on the
discovery of a variety of cDNA molecules which encode proteins
which are herein designated TANGO 202, TANGO 210, INTERCEPT 217,
TANGO 229, TANGO 234, TANGO 265, TANGO 276, TANGO 286, INTERCEPT
289, TANGO 292, TANGO 294, INTERCEPT 296, INTERCEPT 297, INTERCEPT
309, TANGO 331, TANGO 332, TANGO 366, INTERCEPT 394, INTERCEPT 400,
TANGO 416, MANGO 419, INTERCEPT 429, and TANGO 457. These proteins
exhibit a variety of physiological activities, and are included in
a single application for the sake of convenience. It is understood
that the allowability or non-allowability of claims directed to one
of these proteins has no bearing on the allowability of claims
directed to the others. The characteristics of each of these
proteins and the cDNAs encoding them are described separately in
the ensuing sections. In addition to the full length mature and
immature proteins described in the following sections, the
invention includes fragments, derivatives, and variants of these
proteins, as described herein. These proteins, fragments,
derivatives, and variants are collectively referred to herein as
polypeptides of the invention or proteins of the invention.
TANGO 416
[0111] Expression of cDNA encoding a TANGO 416 protein was
up-regulated in porcine endothelial cells that were activated using
one or more of bacterial lipopolysaccharide, tumor necrosis factor
alpha, and human serum. Up-regulation was detected by extracting
total RNA from activated cells and subjecting the RNA to reverse
transcriptase polymerase chain reaction for differential display.
cDNA clones encoding at least a portion of human TANGO 416 protein
and corresponding to the porcine TANGO 416 cDNA were isolated from
human fetal spleen and osteoblast cDNA libraries (including a clone
designated jthsa97d5 obtained from a fetal spleen library, a clone
designated jthoc122e2 obtained from an osteoblast library, and a
clone designated jthsa121f10 obtained from a fetal spleen
library).
[0112] Human TANGO 416 protein is a transmembrane protein which can
occur in at least two alternative forms, which differ in the
presence or absence of a single amino acid residue (i.e. the
glutamine residue at amino acid residue 830 of SEQ ID NO: 3 and
corresponding nucleotide residues 2863-2865 in SEQ ID NO: 1). In
this application, reference to amino acid and nucleotide residues
is made to those residues in the longer form of TANGO 416 (i.e. the
form having the amino acid sequence SEQ ID NO: 3 and the
corresponding cDNA and ORF sequences SEQ ID NOs: 1 and 2,
respectively). The longer form of TANGO 416 has a glutamine residue
at amino acid residue 830 that is not present in the shorter form
of TANGO 416.
[0113] It is understood that both forms of TANGO 416 can exhibit
the same biological properties, and that references to amino acid
residues numbered 831 or higher in SEQ ID NO: 3 correspond to amino
acid residues having the next lower number in SEQ ID NO: 33 (i.e.
amino acid residue 901 in the longer form of TANGO 416 {SEQ ID NO:
3} corresponds to amino acid residue 900 in the shorter form of
TANGO 416 {SEQ ID NO: 33}). Similarly, references to nucleotide
residues numbered 2866 or higher in SEQ ID NO: 1 correspond to
nucleotide residues having a number that is lower by 3 in SEQ ID
NO: 31 (i.e. nucleotide residue 2903 in the longer form of TANGO
416 {SEQ ID NO: 1} corresponds to nucleotide residue 2900 in the
shorter form of TANGO 416 {SEQ ID NO: 31}).
[0114] The full length of a cDNA which was isolated from a human
fetal spleen cDNA library and which encodes human TANGO 416 protein
(SEQ ID NO: 1; i.e. the longer form of TANGO 416) is 5121
nucleotide residues. The open reading frame (ORF) of this cDNA,
nucleotide residues 376 to 3780 of SEQ ID NO: 1 (i.e., SEQ ID NO:
2), encodes a 1135-amino acid residue protein (SEQ ID NO: 3),
corresponding to a 1108-residue transmembrane mature protein.
[0115] The invention thus includes purified human TANGO 416
protein, both in the form of the immature 1135 amino acid residue
protein (SEQ ID NO: 3, including the shorter 1134-residue protein
{SEQ ID NO: 33}) and in the form of the mature 1108 amino acid
residue protein (SEQ ID NO: 5, including the shorter 1107-residue
protein {SEQ ID NO: 35}). Mature human TANGO 416 proteins can be
synthesized without the signal sequence polypeptide at the amino
terminus thereof, or they can be synthesized by generating immature
TANGO 416 protein and cleaving the signal sequence therefrom.
[0116] The invention includes nucleic acid molecules which encode a
polypeptide of the invention. Such nucleic acids include, for
example, a DNA molecule having the nucleotide sequence listed in
SEQ ID NOs: 1, 2, 31, and 32, such as the portion which encodes a
mature TANGO 416 protein, an immature TANGO 416 protein, or a
domain of a TANGO 416 protein. These nucleic acids are among the
nucleic acids of the invention.
[0117] TANGO 416 proteins and nucleic acid molecules encoding them
comprise a family of molecules having certain conserved structural
and functional features. As used in this disclosure, the term
"family" means two or more proteins or nucleic acid molecules
having a common or similar domain structure and having sufficient
amino acid or nucleotide sequence identity as defined herein.
Family members can be from either the same or different species
(e.g., human and mouse). For example, a family can comprise two or
more proteins of human origin, or can comprise one or more proteins
of human origin and one or more of non-human origin.
[0118] A common domain present in TANGO 416 proteins is a signal
sequence. As used herein, a signal sequence includes a peptide of
at least about 10 amino acid residues in length which occurs at the
amino terminus of membrane-bound and secreted proteins and which
contains at least about 45% hydrophobic amino acid residues such as
alanine, leucine, isoleucine, phenylalanine, proline, tyrosine,
tryptophan, or valine. In one embodiment, a signal sequence
contains at least about 10 to 35 amino acid residues, and has at
least about 35-60%, more preferably 40-50%, and more preferably at
least about 45% hydrophobic residues. A signal sequence serves to
direct a protein containing such a sequence to a lipid bi-layer.
Thus, in one embodiment, a TANGO 416 protein contains a signal
sequence corresponding to amino acid residues 1 to 27 of SEQ ID NO:
3 and 33 (i.e. SEQ ID NO: 4). It is recognized that the carboxyl
terminal boundary of the signal sequence can be located one or two
residues from the residue identified above (i.e., following
residues 25, 26, 27, 28, or 29 of SEQ ID NOs: 3 and 33). The signal
sequence is cleaved during processing of the mature protein.
[0119] TANGO 416 proteins include a transmembrane domain and two
extra-membrane domains flanking the cell membrane. The
transmembrane domain corresponds to about amino acid residues 701
to 721 of SEQ ID NOs: 3 and 33 (i.e., the transmembrane domain
having the sequence SEQ ID NO: 7). One of the extra-membrane
domains corresponds to about amino acid residues 28 to 700 of SEQ
ID NOs: 3 and 33 (i.e. the domain having the sequence SEQ ID NO:
6). The other extra-membrane domain corresponds to about amino acid
residues 722 to 1135 of SEQ ID NO: 3 (i.e. residues 722 to 1134 of
SEQ ID NO: 33, this domain having the sequence SEQ ID NO: 8 in the
longer form of TANGO 416 and SEQ ID NO: 38 in the shorter form). In
one embodiment, the extra-membrane domain corresponding to SEQ ID
NO: 6 is an extra-cellular domain and the other extra-membrane
domain is an intracellular domain. In an alternative embodiment,
the extra-membrane domain corresponding to SEQ ID NO: 6 is an
intracellular domain and the other extra-membrane domain is an
extra-cellular domain.
[0120] As used herein, an "extracellular domain" refers to a
portion of a protein which is localized to the non-cytoplasmic side
of a lipid bi-layer of a cell when a nucleic acid encoding the
protein is expressed in the cell. A "transmembrane domain" refers
to an amino acid sequence which is at least about 20 to 25 amino
acid residues in length and which contains at least about 65-70%
hydrophobic amino acid residues such as alanine, leucine,
phenylalanine, protein, tyrosine, tryptophan, or valine. As used
herein, a "cytoplasmic domain" refers to a portion of a protein
which is localized to the cytoplasmic side of a lipid bi-layer of a
cell when a nucleic acid encoding the protein is expressed in the
cell.
[0121] TANGO 416 proteins typically comprise a variety of potential
post-translational modification sites and protein domains (often
positioned within an extracellular domain), such as those described
herein in Table I, as predicted by computerized sequence analysis
of TANGO 416 proteins using amino acid sequence comparison software
(comparing the amino acid sequence of TANGO 416 with the
information in the PROSITE database {rel. 12.2; February, 1995} and
the Hidden Markov Models database {Rel. PFAM 3.3}).
TABLE-US-00001 TABLE I Amino Type of Potential Acid Residues
Modification Site of SEQ Amino Acid or Domain ID NO: 3 Sequence
N-glycosylation site 103 to 106 NCSI 269 to 272 NATD 420 to 423
NATL 559 to 562 NTTV 583 to 586 NNTA 641 to 644 NVSM 766 to 769
NGTL 816 to 819 NFSL cAMP/cGMP-dependent 728 to 731 KKDT protein
kinase 748 to 751 KRPS phosphorylation site 979 to 982 KKKS Protein
kinase C 63 to 65 TVR phosphorylation site 290 to 292 SPK 296 to
298 TFK 301 to 303 SER 447 to 449 TVK 552 to 554 SPK 848 to 850 SFR
857 to 859 SYR 869 to 871 SLK 873 to 875 SGR 1082 to 1084 SSK
Casein kinase II 160 to 163 SAFD phosphorylation site 177 to 180
SAND 188 to 191 TRTD 210 to 213 SSYE 217 to 220 TASD 235 to 238
SISD 271 to 274 TDPD 468 to 471 SRYE 488 to 491 TATD 503 to 506
TILE 565 to 568 TIID 650 to 653 TEWE 869 to 872 SLKD 883 to 886
SDYD 891 to 894 SPID 966 to 969 SLED 990 to 993 SPND 1022 to 1025
TYSE 1027 to 1030 SEVD Tyrosine Kinase 187 to 195 RTRTDGAKY
Phosphorylation Site 409 to 415 KTYENNY 726 to 734 REKKDTRSY 737 to
743 RVAESTY N-myristoylation site 41 to 46 GSVIAR 192 to 197 GAKYAE
481 to 486 GAYITT 511 to 516 GSSITT 525 to 530 GAIYAL 593 to 598
GAESGF 623 to 628 GNEENI 707 to 712 GAICAV 788 to 793 GQMGSR 851 to
856 GNKYSR 1074 to 1079 GTHSSV Cell Attachment Sequence 875 to 877
RGD Zinc Carboxypeptidase 639 to 649 HTNVSMDSVPY Zinc-Binding
Region 2 Signature Cadherin Extracellular 125 to 135 VEVLDINDNSP
Repeated Domain 234 to 244 ISISDSNDNSP Signature 342 to 352
IKVVDVNDNKP 453 to 463 VQIINDINDNPP 564 to 574 LTIIDENDNVP
[0122] As used herein, the term "post-translational modification
site or domain" refers to a protein region that includes about 3 to
10 amino acid residues, more preferably about 3 to 6 amino acid
residues wherein the domain has an amino acid sequence which
comprises a consensus sequence which is recognized and modified by
a protein-modifying enzyme. The term also includes protein domains
having greater lengths, as indicated herein. Examples of
protein-modifying enzymes include amino acid glycosylases, cAMP-
and cGMP-dependent protein kinases, protein kinase C, casein kinase
II, tyrosine kinase, myristoylases, and prenyl transferases. In
various embodiments, the protein of the invention has at least 1,
2, 4, 6, 10, 15, 20, 30, 40, or 50 or more of the
post-translational modification sites described herein in Table I.
In one embodiment, the protein of the invention has all 63 of the
sites described in Table I
[0123] Examples of additional domains present in human TANGO 416
protein include cadherin extracellular repeated domains. In one
embodiment, the protein of the invention has at least one domain or
signature sequence that is at least 55%, preferably at least about
65%, 75%, 85%, or 95% identical to one of the cadherin
extracellular domains or signature sequences described herein in
Table I. Preferably, the protein of the invention has 2, 3, 4, or
all 5, cadherin extracellular repeated domains.
[0124] Cadherin extracellular repeated domains have a conserved
consensus sequence that occurs in numerous cadherins. The conserved
extracellular cadherin repeated domain sequence, which is
frequently repeated in cadherins is
TABLE-US-00002 (SEQ ID NO: 450) {L or I or V}-X-{L or I or
V}-X.sub.(1 or 2)-D-X-N-D- {N or H}-X-P,
where X is any amino acid residue, and wherein the subscript `1 or
2` indicates that either one or two X residues can be present at
that position. Folding of the extracellular repeated domain of
cadherins is believed to roughly correspond to occurrence of
extracellular cadherin repeated domains.
[0125] Cadherins are a family of cell-surface proteins which are
involved in cell-to-cell binding, including specific cell adhesion
processes which occur during development and adherens junction
formation related to tissue organization in developing and adult
organisms. Cadherins are also involved in intracellular signaling.
Repeated cadherin extracellular domains occur in a variety of
cadherins, including, for example, epithelial cadherin (sometimes
designated E-cadherin, uvomorulin, L-CAM, or CDH1), neural cadherin
(sometimes designated N-cadherin or CDH2), placental cadherin
(sometimes designated P-cadherin or CDH3), retinal cadherin
(sometimes designated R-cadherin or CDH4), vascular endothelial
cadherin (sometimes designated VE-cadherin or CDH5), kidney
cadherin (sometimes designated K-cadherin or CDH6), cadherin-8
(sometimes designated CDH8), osteoblast cadherin (sometimes
designated OB-cadherin or CDH11), brain cadherin (sometimes
designated BR-cadherin or CDH12), truncated cadherin (sometimes
designated T-cadherin or CDH13), muscle cadherin (sometimes
designated M-cadherin or CDH14), liver-intestine cadherin
(sometimes designated LI-cadherin), and EP-cadherin. Occurrence of
repeated cadherin extracellular domains in TANGO 416 is an
indication that TANGO 416 is a member of the cadherin family of
proteins, and is thus involved in specific cell adhesion processes
and regulation of intracellular signaling events in tissues in
which it occurs.
[0126] The signal peptide prediction program SIGNALP (Nielsen et
al. (1997) Protein Engineering 10:1-6) predicted that human TANGO
416 protein includes a 27 amino acid residue signal peptide (amino
acid residues 1 to 27 of SEQ ID NOs: 3 and 33 {SEQ ID NO: 4})
preceding the mature TANGO 416 protein (about amino acid residues
28 to 1135 of SEQ ID NO: 3 {SEQ ID NO: 5} and about amino acid
residues 28 to 1134 of SEQ ID NO: 33 {SEQ ID NO: 35}). Human TANGO
416 protein includes an extracellular domain (about amino acid
residues 28 to 700 of SEQ ID NOs: 3 and 33 {SEQ ID NO: 6}), a
transmembrane domain (about amino acid residues 701 to 721 of SEQ
ID NOs: 3 and 33 {SEQ ID NO: 7}), and an intracellular domain
(about amino acid residues 722 to 1135 of SEQ ID NO: 3 {SEQ ID NO:
8} and about amino acid residues 722 to 1134 of SEQ ID NO: 33 {SEQ
ID NO: 38}).
[0127] FIG. 1 depicts a hydrophobicity plot of human TANGO 416
protein. Relatively hydrophobic regions are above the dashed
horizontal line, and relatively hydrophilic regions are below the
dashed horizontal line. The hydrophobic region which corresponds to
amino acid residues 1 to 27 of SEQ ID NOs: 3 and 33 is the signal
sequence of human TANGO 416 (SEQ ID NO: 4). As described elsewhere
herein, relatively hydrophilic regions are generally located at or
near the surface of a protein, and are more frequently effective
immunogenic epitopes than are relatively hydrophobic regions. For
example, the region of human TANGO 416 protein from about amino
acid residue 450 to about amino acid residue 470 appears to be
located at or near the surface of the protein, while the region
from about amino acid residue 335 to about amino acid residue 345
appears not to be located at or near the surface.
[0128] The predicted molecular weight of human TANGO 416 protein
without modification and prior to cleavage of the signal sequence
is about 126.0 kilodaltons. The predicted molecular weight of the
mature human TANGO 416 protein without modification and after
cleavage of the signal sequence is about 122.8 kilodaltons.
[0129] TANGO 416 DNA maps to chromosome 4, between chromosomal
markers D4S422 and D4S1576, as assessed by comparing TANGO 416
sequence with an ESTs in a mapping database. Other genes which map
to this chromosomal segment include those encoding endothelin-1
receptor precursor, surfactant protein A, transforming growth
factor beta signaling protein-1 (Bsp-1), and a gene highly similar
to Mus musculus hemoglobin zeta chain. Thus, disorders previously
attributed to these loci by others can also be attributable to the
chromosomal portion encoding TANGO 416.
[0130] cDNA encoding TANGO 416 protein occurs in cDNA libraries
generated from human fetal spleen tissue and from human
osteoblasts. High homology of TANGO 416 cDNA was observed with
expressed sequence tags (ESTs) obtained from EST libraries
generated from human fetal heart, human fetal lung, human testis,
human pancreas, human prostate, and human B cell tissues,
indicating that TANGO 416 protein can be expressed in these tissues
as well.
[0131] Residues 1651-4000 of SEQ ID NO: 1 (the nucleotide sequence
of TANGO 416 cDNA) were aligned (using the ALIGN software with gap
length penalty of 12, and a gap penalty of 4) with the nucleotide
sequence of the human testis cDNA clone DKFZp434B0923 listed in
GenBank accession number AL137471. This alignment, shown in FIGS.
2A-2H, was generated using the ALIGN software (using the BLOSUM62
scoring matrix, a gap opening penalty of 12, a gap extension
penalty of 4, and a frameshift gap penalty of 5), and indicated
98.6% identity between the two sequences in the 2350-residue
overlapping portion. The nucleotide sequence (SEQ ID NO: 2) of the
ORF encoding TANGO 416 was aligned using the ALIGN software (with
gap length penalty of 12, and a gap penalty of 4)) with the
nucleotide sequence of the ORF of a murine protocadherin
(GenBank.TM. accession number Y08715; Telo et al., 1998, J. Biol.
Chem. 273:17565-17572), as shown in FIGS. 3A-3O. This alignment was
generated using the ALIGN software (using the BLOSUM62 scoring
matrix, a gap opening penalty of 12, a gap extension penalty of 4,
and a frameshift gap penalty of 5), and indicated 55.4% identity
between the two sequences in the overlapping portion. Alignment of
the amino acid sequence of TANGO 416 with the amino acid sequence
of the murine protocadherin, as shown in FIGS. 4A-4E, indicated
32.8% sequence identity and 42.2% sequence similarity. This
alignment was generated using the ALIGN software (using the
BLOSUM62 scoring matrix, a gap opening penalty of 12, a gap
extension penalty of 4).
[0132] Uses of TANGO 416 Nucleic acids,
[0133] Polypeptides, and Modulators Thereof
[0134] TANGO 416 proteins are involved in disorders which affect
both tissues in which they are normally expressed and tissues in
which they are normally not expressed. Based on the observations
that cDNA corresponding to TANGO 416 occurs in human fetal spleen
and human osteoblast cDNA libraries, and that ESTs corresponding to
portions of TANGO 416 can be detected in ESTs prepared from each of
human fetal heart, human fetal lung, human testis, human pancreas,
human prostate, and human B cell tissues, TANGO 416 protein can be
involved in one or more biological processes which occur in these
tissues. In particular, TANGO 416 can be involved in modulating
growth, proliferation, survival, differentiation, adhesion, and
activity of cells of these tissues. Furthermore, because TANGO 416
likely belongs to the cadherin family of proteins, it can also be
involved in modulating movement of cells (e.g., T cells and other
cells of the immune system) through tissues which express receptors
for TANGO 416 (e.g. cells which express one or more cadherin
receptors, e.g., cells which express integrin .alpha.E.beta.7).
[0135] Integrin .alpha.E.beta.7 (sometimes designated
.alpha.E/HML-1, .alpha.E/human mucosal lymphocyte-1 and CD103, and
described in international patent application publication number
WO95/22610, published on Aug. 24, 1995) is an integrin protein
which is expressed by more than 90% of intestinal epithelial
lymphocytes, on 40-50% of intestinal lamina propria T lymphocytes,
and on about 2% of peripheral blood leukocyte. Integrin
.alpha.E.beta.7 is also expressed by T lymphocytes at other mucosal
epithelia and on about 40% of T cells obtained by bronchioalveolar
lavage. Integrin .alpha.E.beta.7 is apparently not expressed on B
cells. A putative endothelial ligand designated E-cadherin binds
with integrin .alpha.E.beta.7. Antibodies which bind specifically
with the .alpha.E subunit of integrin .alpha.E.beta.7 have
demonstrated efficacy for treatment of inflammatory bowel disease
and for reducing pulmonary inflammation and airway
hyper-responsiveness in murine models of these disorders. Integrin
.alpha.E.beta.7 is believed to have a role in binding of
lymphocytes with endothelial cells and with regulation of tissue
levels of T.sub.H1 and T.sub.H2 cytokines (e.g. IL-5, IL-13) and
eotaxin. The ability of TANGO 416 to bind with integrin
.alpha.E.beta.7 indicates that TANGO 416 protein and other TANGO
416-related molecules can be used to modulate the physiological
activities associated with integrin .alpha.E.beta.7 function and to
treat disorders to which such physiological activities
contribute.
[0136] In one embodiment of the invention, TANGO 416-related
molecules are used to modulate interaction of cells which normally
express integrin .alpha.E.beta.7 (e.g. binding with, movement over,
among, or past, or activation of cellular function by) and cells
which normally express TANGO 416. TANGO 416-related molecules can
also be used to modulate production, release, or both, of cytokines
and eotaxin by cells which normally express integrin
.alpha.E.beta.7. TANGO 416 protein can thus be involved in
disorders which affect epithelial and lymphocytic tissues. Such
disorders include cell proliferation disorders, disorders
associated with aberrant epithelial permeability, auto-, hypo-, and
hyper-immune disorders, disorders associated with aberrant binding
or adhesion of cells with other cells, and inflammatory disorders.
TANGO 416-related molecules can be used to prognosticate, prevent,
diagnose, or treat one or more such disorders. Examples of these
disorders include acute and chronic inflammatory diseases of the
bowel, colitis of various etiologies, gastrointestinal infections,
gastritis, gastroesophageal reflux disorder, acute and chronic
peritonitis, appendicitis, diarrhea, constipation, gastroenteritis,
hemorrhoids, proctitis, chronic and acute bronchitis, asthma,
pneumonia, hypersensitivity pneumonitis, allergic disorders,
anemia, leukopenia, thrombocytopenia, lymphoproliferative diseases,
transplant rejection, graft-versus-host reactions, allergic
reactions, hypersplenism, autoimmune disorders, metastasis of tumor
tissue, cystic fibrosis, various chronic obstructive pulmonary
disorders, pericarditis, hypogonadism, and testosterone deficiency
syndrome.
[0137] Other disorders which can be treated using TANGO 416
proteins, nucleic acids encoding them, and agents that modulate
activity or expression of either of these include disorders of bone
and cartilage tissues (e.g., traumatic and degenerative injuries),
disorders of the spleen (e.g., lymphoma and splenomegaly),
disorders associated with aberrant processing of blood cells in
splenic tissue (e.g., disorders involving aberrant macrophage
activity), cardiovascular disorders (e.g., disorders of the cardiac
muscle and disorders of blood vessels), disorders involving
aberrant association (or non-association) of B and T lymphocytes
with each other and with endothelial tissues (e.g., immune
disorders and inflammatory disorders), pancreatic disorders (e.g.,
pancreatitis, pancreatic cysts, pancreatic tumors, diabetes
mellitus, and islet cell tumors), and disorders of the prostate
(e.g., inflammatory prostatic diseases, prostatic hyperplasia, and
prostate tumors).
[0138] TANGO 416 can interact as a ligand with integrin
.alpha.E.beta.7, as discussed above. Integrin .alpha.E.beta.7 (also
designated human mucosal lymphocyte 1 antigen or CD103) is
expressed on more than 90% of intestinal epithelial lymphocytes
(IEL), and about 40-50% of intestinal lamina propria T lymphocytes,
but only on about 2% of peripheral blood leukocytes. Integrin
.alpha.E.beta.7 is also expressed on T lymphocytes which are
present at other mucosal epithelial (e.g. on about 40% of T cells
recovered by bronchioalveolar lavage {BAL}). Integrin
.alpha.E.beta.7 does not appear to be expressed on B lymphocytes.
Transforming growth factor beta 1 (TGF-.beta.1) induces expression
of integrin .alpha.E.beta.7 on both T lymphocytes and cultured
murine mast cells.
[0139] Antibodies which bind specifically with integrin
.alpha.E.beta.7 reduce morbidity and pathological effects
associated with experimentally induced inflammatory bowel disease
(IBD; e.g. using the CD45Rb.sup.hiSCID transfer model of IBD),
transmural colitis, (e.g. using interleukin-2 {IL-2} knockout mice
immunized using 2,4,6-trinitrophenol), and pulmonary inflammation
(e.g. using mice sensitized intraperitoneally with and challenged
with aerosol ovalbumin). In BAL fluids obtained from mice which
were sensitized and challenged with ovalbumin and to which
anti-integrin .alpha.E.beta.7 were administered, decreased numbers
of eosinophils and leukocytes were detected, and levels of T.sub.H2
cytokines (e.g. IL-5 and IL-13) and eotaxin were decreased as well.
Integrin .alpha.E.beta.7 knockout (i.e. nullizygous) mice exhibited
decreased numbers of intestinal epithelial lymphocytes, decreased
susceptibility to pulmonary inflammation, reduced airway
hyper-responsiveness, and decreased levels of T.sub.H2 cytokines in
BAL fluids. These data indicate that integrin .alpha.E.beta.7 can
function as a receptor for guiding lymphocytes (e.g. T cells, mast
cells, and eosinophils) to mucosal epithelia and maintaining them
at those locations. These data also indicate that integrin
.alpha.E.beta.7 can modulate T.sub.H1 and T.sub.H2 cytokine levels
in tissues which contain integrin .alpha.E.beta.7-bearing cells
(see international patent application publication number
WO95/22610, published on Aug. 24, 1995).
[0140] TANGO 416 proteins can bind with integrin .alpha.E.beta.7
and thereby modulate the integrin's physiological effects. In
particular, TANGO 416 proteins can modulate localization of
integrin .alpha.E.beta.7-bearing lymphocytes at tissues which
express TANGO 416 (e.g. at mucosal epithelia such as intestinal and
pulmonary epithelia) and release and maintenance of T.sub.H1 and
T.sub.H2 cytokine levels in or near such tissues. Modulation of
cytokine levels by TANGO 416 can, in turn, modulate proliferation,
activity, and migration of cells of the immune system, such as are
associated with a variety of inflammatory, auto-immune,
hypo-immune, and hyper-immune disorders. TANGO 416 proteins,
nucleic acids encoding them, and agents that modulate activity or
expression of either of these can thus be used to modulate these
processes.
[0141] Disorders that involve proliferation, activity, and
migration of immune cells in the vicinity of mucosal epithelia
include, by way of example, acute and chronic inflammatory diseases
of the bowel (e.g. inflammatory bowel disease and Crohn's disease),
colitis (of various etiologies), gastrointestinal infections (e.g.
formation and perseverance of peptic ulcers), gastritis,
gastroesophageal reflux disorder, acute and chronic peritonitis,
appendicitis, diarrhea, constipation, gastroenteritis, hemorrhoids,
and proctitis. Such disorders also include disorders that involve
proliferation, activity, and migration of immune cells in the
vicinity of pulmonary mucosal epithelial, such as chronic and acute
bronchitis, asthma, pneumonia (e.g. pneumococcal, staphylococcal,
streptococcal, klebsiellal, hemophilal, viral, fungal, etc.),
hyper-sensitivity pneumonitis, and allergic disorders (e.g. hay
fever and the like). TANGO 416 proteins, nucleic acids encoding
them, and agents that modulate activity or expression of either of
these can thus be used to prognosticate, diagnose, and treat one or
more of these disorders.
[0142] Expression of TANGO 416 in osteoblasts is an indication that
TANGO 416 can have a role in modulating bone formation, marrow cell
differentiation and proliferation, and proliferation,
differentiation, function, or some combination of these, of bone
and cartilage cells. Examples of disorders which can be
prognosticated, diagnosed, and treated using TANGO 416 proteins,
nucleic acids encoding them, and agents that modulate activity or
expression of either of these include disorders of bone and
cartilage tissues including bone or cartilage injuries, such as
those attributable to trauma (e.g., bone breakage and cartilage
tearing), or to degeneration (e.g., osteoporosis and age-related
degradation of cartilage). The compositions can also be used to
treat disorders associated with degeneration of joints, such as
arthritis (including rheumatoid arthritis), osteoarthritis, and
bone wearing.
[0143] Occurrence of TANGO 416 cDNA in a fetal spleen library is an
indication that TANGO 416 proteins, nucleic acids encoding them,
and agents that modulate activity or expression of either of these
can be used to modulate proliferation, differentiation, function,
or some combination of these, of spleen cells (e.g., cells of the
splenic connective tissue, splenic smooth muscle cells, and
endothelial cells of splenic blood vessels). These compositions can
thus be used to treat disorders of the spleen, (including both the
fetal spleen and the adult spleen). Examples of splenic diseases
and disorders include splenic lymphoma and splenomegaly. Occurrence
of TANGO 416 in splenic tissue further indicates that TANGO 416
proteins, nucleic acids encoding them, and agents that modulate
activity or expression of either of these can be used to modulate
proliferation, differentiation, function, or some combination of
these, of blood cells that are processed in splenic tissue. These
cells include cells which are regenerated or phagocytized within
the spleen, including, for example, erythrocytes, B and T
lymphocytes, and macrophages. Examples of these disorders include
phagocytotic disorders, such as disorders in which engulfment of
bacteria and viruses in the bloodstream by macrophages in the
spleen is inhibited.
[0144] Occurrence in a fetal heart library of an EST which exhibits
homology with cDNA encoding TANGO 416 indicates that TANGO 416
proteins, nucleic acids encoding them, and agents that modulate
activity or expression of either of these can be used to treat
cardiovascular disorders, including disorders of the heart and
disorders of the blood vessels. Examples of cardiac disorders which
can be treated in this manner include ischemic heart diseases
(e.g., angina pectoris, myocardial infarction and its aftermath,
coronary artery disease, cardiac arrest, and chronic ischemic heart
disease), hypertensive heart disease, pulmonary heart disease,
valvular heart disease (e.g., rheumatic fever and rheumatic heart
disease, endocarditis, mitral valve prolapse, and aortic valve
stenosis), congenital heart disease (e.g., valvular and vascular
obstructive lesions, atrial or ventricular septal defect, and
patent ductus arteriosus), cardiac arrhythmia, cardiac
insufficiency, endocarditis, pericardial disease, muscular
dystrophy, and myocardial disease (e.g., myocarditis, congestive
cardiomyopathy, restrictive cardiomyopathy, and hypertrophic
cardiomyopathy). Examples of vascular disorders which can be
treated in this manner include arteriosclerosis, atherosclerosis,
hypertension, aberrant or non-desired angiogenesis, stenosis and
restenosis, and smooth muscle proliferation in response to
traumatic injury.
[0145] Involvement of TANGO 416 protein in binding of cells is an
indication that TANGO 416 can be involved in disorders associated
with aberrant binding or adhesion of cells with other cells, with
extracellular matrix, or with foreign materials. Disorders
involving aberrant binding or adhesion of cells with other cells
include both disorders in which cells normally bind with one
another (e.g., metastasis of normally solid tumor tissue cells away
from the tumor site of origin or immune hypersensitivity) and
disorders in which the cells do not normally bind with one another,
but do bind with one another in individuals afflicted with the
disorder (e.g., metastasis of tumor cells into a tissue in which
the cells do not normally occur, autoimmune disorders, infections,
wherein cells with which T cells bind are not normally present in
the animal, or disorders associated with abnormal blood
coagulation). Disorders involving aberrant binding or adhesion of
cells with tissue on which TANGO 416 is normally expressed, include
those in which the cells normally do, but aberrantly do not, bind
with TANGO 416-expressing tissue as well as those (e.g., metastasis
of cancers cells into mucosal epithelium) in which the cells
normally do not bind with TANGO 416-expressing tissue, but
aberrantly do. TANGO 416 proteins, nucleic acids encoding them, and
agents that modulate activity or expression of either of these can
be used to prognosticate, diagnose, and treat one or more of these
disorders.
[0146] Like many transmembrane signaling proteins, TANGO 416
protein comprises extracellular domains capable of interacting with
environmental cues (e.g., the presence or absence of particular
cells, proteins, or small molecules) and a cytoplasmic domain
having a substantial size. Numerous cadherins interact with
catenins, tyrosine kinases, and other proteins which can influence
the structure of the intracellular matrix. TANGO 416 can also
interact with such proteins, and the existence of numerous
post-translationally modifiable sites (see Table I) on TANGO 416 is
an indication that TANGO 416 can be involved in transducing signals
across the cell membrane. Binding of a ligand of TANGO 416 protein
(e.g. integrin .alpha.E.beta.7 on the surface of a different cell
such as a leukocyte) with a portion of the protein located on one
side of the membrane can affect one or more characteristics (e.g.,
conformation, phosphorylation state, or level or specificity of
enzymatic activity) of a portion of the TANGO 416 protein located
on the other side. Thus, for example, a compound in the
extracellular environment of a cell which expresses TANGO 416 can
bind with the extracellular domain of the protein, thereby
effecting a change in a characteristic of the intracellular portion
of the protein, leading to alteration of the physiology of the cell
(e.g., effected by an activity exerted by the intracellular portion
of the protein on another component of the cell). The compound in
the extracellular environment can, for example, be a compound
dissolved or suspended in a liquid, a compound attached to another
cell of the same animal, or a compound attached to a foreign cell
or virus particle.
[0147] TANGO 416 protein can associate with other signal
transduction proteins in the cell membrane, thereby modulating the
intracellular activity of those other proteins. TANGO 416 can also
bind with a membrane-bound protein (e.g. integrin .alpha.E.beta.7)
of another cell, thereby modulating physiological activities
associated with signal transduction mediated by that membrane-bound
protein. By way of example, signal transduction events associated
with integrin .alpha.E.beta.7 include modulation of T.sub.H1 and
T.sub.H2 cytokine (and eotaxin) production and release by
leukocytes and movement and adherence of leukocytes. TANGO 416
protein and fragments and variants thereof can modulate such
activities. TANGO 416 proteins can thus have a role in disorders
which involve aberrant transmembrane signal transduction. Examples
of signal transduction-related disorders include cystic fibrosis,
various chronic obstructive pulmonary disorders, lymphocyte
localization and activation disorders (e.g. transmural colitis,
airway hyper-responsiveness, and various allergic disorders), and
inflammatory disorders such as inflammatory bowel disease. TANGO
416 proteins, nucleic acids encoding them, and agents that modulate
activity or expression of either of these can be used to
prognosticate, diagnose, and treat one or more of these
disorders.
[0148] Occurrence of ESTs which exhibit homology with TANGO 416
nucleic acids in EST libraries generated from tissues which
comprise endothelial tissues (e.g. fetal heart tissue and
testicular tissue) indicates that TANGO 416-related molecules can
be used to prognosticate, diagnose, and treat one or more other
disorders which afflict endothelial tissues and organs which
contain them. By way of example, the heart is surrounded by an
endothelial pericardium which can become inflamed, leading to
pericarditis and other complications. Similarly, the endothelial
lining of blood vessels is known to bind lymphocytes (e.g. during
`rolling` movement of lymphocytes through the vessel and during
extravasation of lymphocytes). Disorders which can affect
testicular endothelium include hypogonadism and testosterone
deficiency syndrome. Interaction of one or more TANGO 416-related
molecules with cells that modulate interaction of TANGO 416 with
integrin .alpha.E.beta.7 cells can inhibit, prevent, or alleviate
such disorders. Furthermore, interaction of TANGO 416-related
molecules with sample material (e.g. blood or tissue) obtained by a
patient can be used to diagnose such disorders.
[0149] Homology of an EST obtained from a human B cell EST library
with a TANGO 416 nucleic acid is an indication that TANGO 416 can
modulate disorders involving inappropriate interaction of B and T
cells. Such disorders include hypo-, hyper-, and auto-immune
disorders and also include inflammatory disorders. By modulating
interactions of B and T lymphocytes with each other and with
endothelial tissues (and other tissues which can express integrin
.alpha.E.beta.7, TANGO 416 proteins, nucleic acids encoding them,
and agents that modulate activity or expression of either of these
can also be used to treat immune disorders and inflammatory
disorders. By way of example, they can be used to treat autoimmune
disorders (e.g., arthritis, graft rejection such as allograft
rejection), T cell disorders (e.g., AIDS)), bacterial infection,
psoriasis, bacteremia, septicemia, cerebral malaria, inflammatory
bowel disease, arthritis (e.g., rheumatoid arthritis,
osteoarthritis), and allergic inflammatory disorders (e.g., asthma
or psoriasis).
[0150] Homology of an EST of a library made using cDNA obtained
from pancreatic tissue with TANGO 416 cDNA sequence indicates that
TANGO 416 proteins, nucleic acids encoding them, and agents that
modulate activity or expression of either of these can be used to
treat pancreatic disorders. Examples of pancreatic disorders which
can be treated in this manner include pancreatitis (e.g., acute
hemorrhagic pancreatitis and chronic pancreatitis), pancreatic
cysts (e.g., congenital cysts, pseudocysts, and benign or malignant
neoplastic cysts), pancreatic tumors (e.g., pancreatic carcinoma
and adenoma), diabetes mellitus (e.g., insulin- and
non-insulin-dependent types, impaired glucose tolerance, and
gestational diabetes), and islet cell tumors (e.g., insulinomas,
adenomas, Zollinger-Ellison syndrome, glucagonomas, and
somatostatinoma).
[0151] cDNA encoding TANGO 416 also exhibits homology with an EST
of a library made using cDNA obtained from prostate tissue. Thus,
TANGO 416 proteins, nucleic acids encoding them, and agents that
modulate activity or expression of either of these can be used to
treat prostate disorders. Examples of prostate disorders which can
be treated in this manner include inflammatory prostatic diseases
(e.g., acute and chronic prostatitis and granulomatous
prostatitis), prostatic hyperplasia (e.g., benign prostatic
hypertrophy or hyperplasia), and prostate neoplasms and tumors
(e.g., carcinomas).
[0152] Homology of TANGO 416 protein with murine vascular
endothelial cadherin-2 (mVE-cad-2; Telo et al., 1998, J. Biol.
Chem. 273:17565-17572; GenBank.TM. accession number Y08715;
sometimes designated protocadherin; see FIGS. 3A-3O and 4A-4E) is
an indication that TANGO 416 is a human orthologue of that
mVE-cad-2, and exhibits one or more of the same activities. That
is, TANGO 416 can be involved in adherens junction formation and
maintenance, and can thereby modulate endothelial permeability to
plasma proteins and circulating cells.
TANGO 457
[0153] The TANGO 457 proteins and nucleic acid molecules comprise
families of molecules having certain conserved structural and
functional features.
[0154] For example, the TANGO 457 proteins of the invention can
have signal sequences. In certain embodiments, a TANGO 457
polypeptide can include the amino acid sequence SEQ ID NO: 55 at
its amino terminus, and the signal sequence is located at amino
acids 1 to 21, 1 to 22, 1 to 23, 1 to 24, 1 to 25, 1 to 26, or 1 to
27 of SEQ ID NO: 53. In such embodiments of the invention, the
domains and the mature protein resulting from cleavage of such
signal peptides are also included herein. For example, the cleavage
of a signal sequence consisting of amino acids 1 to 24 of SEQ ID
NO: 53 (SEQ ID NO: 55) results in a cytoplasmic domain consisting
of amino acids 25 to 264, a transmembrane domain consisting of
amino acids 265 to 282, an extracellular domain consisting of amino
acids 283 to 365, of SEQ ID NO: 53 (SEQ ID NO: 56, 59, and 60,
respectively) and the mature TANGO 457 protein corresponding to
amino acids 25 to 365 of SEQ ID NO: 53 (SEQ ID NO: 54). The signal
sequence is normally cleaved during processing of the mature
protein.
[0155] A TANGO 457 family member can include one or more of the
following domains: (1) an extracellular domain; (2) a transmembrane
domain; and (3) a cytoplasmic domain. For example, in one
embodiment, a TANGO 457 protein contains a cytoplasmic domain at
about amino acid residues 1 to 264 of SEQ ID NO: 53 (SEQ ID NO:
56), a transmembrane domain at about amino acid residues 265 to 282
of SEQ ID NO: 53 (SEQ ID NO: 59), and an extracellular domain at
about amino acid residues 283 to 365 of SEQ ID NO: 53 (SEQ ID NO:
60). In another embodiment, a human TANGO 457 protein contains an
cytoplasmic domain at amino acid residues 283 to 365 of SEQ ID NO:
53 (SEQ ID NO: 60), a transmembrane domain at amino acid residues
265 to 282 of SEQ ID NO: 53 (SEQ ID NO: 59), and an extracellular
domain at amino acid residues 1 to 264 of SEQ ID NO: 53 (SEQ ID NO:
56).
[0156] A TANGO 457 family member can include one or more TANGO 457
Ig domains. A TANGO 457 Ig domain as described herein is about 68
to 84 amino acid residues in length and has the following consensus
sequence, beginning about 1 to 15 amino acid residues, more
preferably about 3 to 10 amino acid residues, and most preferably
about 5 amino acid residues from the domain C-terminus:
[FYL]-X-C-X-[VA], wherein [FYL] is a phenylalanine, tyrosine or
leucine residue (preferably tyrosine), where "X" is any amino acid,
C is a cysteine residue, and [VA] is an alanine residue or a valine
residue. In one embodiment, a TANGO 457 family member includes one
or more Ig domains having an amino acid sequence that is at least
about 55%, preferably at least about 65%, more preferably at least
about 75%, yet more preferably at least about 85%, and most
preferably at least about 95% identical to amino acids 41 to 124 of
SEQ ID NO: 53 (SEQ ID NO: 57). In another embodiment, a TANGO 457
family member includes one or more Ig domains having an amino acid
sequence that is at least about 55%, preferably at least about 65%,
more preferably at least about 75%, yet more preferably at least
about 85%, and most preferably at least about 95% identical to
amino acids 163 to 230 of SEQ ID NO: 53 (SEQ ID NO: 58).
[0157] In another embodiment, a TANGO 457 family member includes
one or more TANGO 457 Ig domains having an amino acid sequence that
is at least about 55%, preferably at least about 65%, more
preferably at least about 75%, yet more preferably at least about
85%, and most preferably at least about 95% identical to amino
acids 41 to 124 and/or 163 to 230 of SEQ ID NO: 53 (SEQ ID NO: 57
and 58), and has a conserved cysteine residue about 1 to 15,
preferably 1 to 10, more preferably 1 to 8 residues downstream from
the N-terminus of the Ig domain. Thus, in this embodiment, amino
acids 48 and 163 of SEQ ID NO: 53 are cysteine residues.
[0158] In another embodiment, a TANGO 457 family member includes
one or more TANGO 457 Ig domains having an amino acid sequence that
is at least 55%, preferably at least about 65%, more preferably at
least about 75%, yet more preferably at least about 85%, and most
preferably at least about 95% identical to amino acids 41 to 124
and/or 163 to 230 of SEQ ID NO: 53 (SEQ ID NO: 57 and 58), and has
a conserved cysteine residue about 1 to 8 residues downstream from
the N-terminus of the TANGO 457 Ig domain, has a conserved cysteine
within the consensus sequence that forms a disulfide with said
first conserved cysteine, and has at least one TANGO 457 biological
activity as described herein.
[0159] A cDNA encoding human TANGO 457 was identified by analyzing
the sequences of clones present in a human uterine smooth muscle
library for sequences that encode wholly secreted or transmembrane
proteins. This analysis led to the identification of a clone,
jthUa027h12, encoding human TANGO 457. The human TANGO 457 cDNA of
this clone is 2330 nucleotides long (SEQ ID NO: 51). The open
reading frame of TANGO 457 comprises nucleotides 149 to 1243 of SEQ
ID NO: 51 (SEQ ID NO: 52), and encodes a transmembrane protein
comprising the 365 amino acid sequence depicted in SEQ ID NO:
53.
[0160] The signal peptide prediction program SIGNALP (Nielsen et
al. (1997) Protein Engineering 10:1-6) predicted that human TANGO
457 includes a 24 amino acid signal peptide (amino acids 1 to about
amino acid 24 of SEQ ID NO: 53) (SEQ ID NO: 55) preceding the
mature TANGO 457 protein (corresponding to about amino acid 25 to
amino acid 365 of SEQ ID NO: 53; SEQ ID NO: 54). Human TANGO 213 is
predicted to have a molecular weight of approximately 40.6
kilodaltons prior to cleavage of its signal peptide and a molecular
weight of approximately 38.0 kilodaltons subsequent to cleavage of
its signal peptide.
[0161] Secretion assays indicate that the polypeptide encoded by
human TANGO 457 is not secreted and thus, likely a transmembrane
protein. The secretion assays were performed essentially as
follows: 8.times.10.sup.5 293T cells were plated per well in a
6-well plate and the cells were incubated in growth medium (DMEM,
10% fetal bovine serum, penicillin/streptomycin) at 37.degree. C.,
5% CO.sub.2 overnight. 293T cells were transfected with 2
micrograms of full-length TANGO 457 inserted in the pMET7
vector/well and 10 micrograms LipofectAMINE (GIBCO/BRL Cat.
#18324-012)/well according to the protocol for GIBCO/BRL
LipofectAMINE. The transfectant was removed 5 hours later and fresh
growth medium was added to allow the cells to recover overnight.
The medium was removed and each well was gently washed twice with
DMEM without methionine and cysteine (ICN Cat. #16-424-54). Next, 1
ml DMEM without methionine and cysteine with 50 microcuries of
Trans-.sup.35S (ICN Cat. #51006) was added to each well and the
cells were incubated at 37.degree. C., 5% CO.sub.2 for the
appropriate time period. A 150 microliters aliquot of conditioned
medium was obtained and 150 microliters of 2.times. SDS sample
buffer was added to the aliquot. The sample was heat-inactivated
and loaded on a 4-20% SDS-PAGE gel. The gel was fixed and the
presence of secreted protein was detected by autoradiography.
[0162] FIG. 5 depicts a hydrophobicity plot of the human TANGO 457
amino acid sequence shown in SEQ ID NO:53. Relatively hydrophobic
regions of the protein are shown above the horizontal line, and
relatively hydrophilic regions of the protein are below the
horizontal line. The cysteine residues (cys) and N-glycosylation
site are indicated by short vertical lines just below the
hydrophobicity trace.
[0163] In one embodiment, a TANGO 457 protein contains a
cytoplasmic domain at about amino acid residues 1 to 264 of SEQ ID
NO: 53 (SEQ ID NO: 56), a transmembrane domain at about amino acid
residues 265 to 282 of SEQ ID NO: 53 (SEQ ID NO: 59), and an
extracellular domain at about amino acid residues 283 to 365 of SEQ
ID NO: 53 (SEQ ID NO: 60). In another embodiment, a human TANGO 457
protein contains an cytoplasmic domain at amino acid residues 283
to 365 of SEQ ID NO: 53 (SEQ ID NO: 60), a transmembrane domain at
amino acid residues 265 to 282 of SEQ ID NO: 53 (SEQ ID NO: 59),
and an extracellular domain at amino acid residues 1 to 264 of SEQ
ID NO: 53 (SEQ ID NO: 56). Human TANGO 457 includes an Ig domain at
amino acids 41 to 124 and 163 to 230 of SEQ ID NO: 53, (SEQ ID NO:
57 and 8).
[0164] Seven N-glycosylation sites are present in TANGO 457. The
first has the sequence NVTI (at amino acid residues 43 to 46 of SEQ
ID NO: 53), the second has the sequence NITS (at amino acid
residues 57 to 60 of SEQ ID NO: 53), the third has the sequence
NITW (at amino acid residues 174 to 177 of SEQ ID NO: 53), the
fourth has the sequence NVTS (at amino acid residues 208 to 211 of
SEQ ID NO: 53), the fifth has the sequence NSSQ (at amino acid
residues 216 to 219 of SEQ ID NO: 53), the sixth has the sequence
NFTL (at amino acid residues 242 to 245 of SEQ ID NO: 53), and the
seventh has the sequence NFSI (at amino acid residues 260 to 263 of
SEQ ID NO: 53). TANGO 457 has one glycosaminoglycan attachment site
with the sequence SGVG at amino acid residues 331 to 334 of SEQ ID
NO: 53. Six protein kinase C phosphorylation sites are present in
TANGO 457. The first has the sequence TWR (at amino acid residues 2
to 4 of SEQ ID NO: 53), the second has the sequence SLR (at amino
acid residues 106 to 108 of SEQ ID NO: 53), the third has the
sequence TQK (at amino acid residues 181 to 183 of SEQ ID NO: 53),
the fourth has the sequence TIK (at amino acid residues 199 to 201
of SEQ ID NO: 53), the fifth has the sequence TEK (at amino acid
residues 255 to 257 of SEQ ID NO: 53), and the sixth has the
sequence SKK (at amino acid residues 301 to 303 of SEQ ID NO: 53).
TANGO 457 has three casein kinase II phosphorylation sites. The
first has the sequence TEGD (at amino acid residues 22 to 25 of SEQ
ID NO: 53), the second has the sequence SSQE (at amino acid
residues 217 to 220 of SEQ ID NO: 53), and the third has the
sequence SLSE (at amino acid residues 251 to 254 of SEQ ID NO: 53).
TANGO 457 has one tyrosine kinase phosphorylation site with the
sequence KENEDKY at amino acid residues 155 to 161 of SEQ ID NO:
53. Two N-myristoylation sites are present in TANGO 457. The first
has the sequence GMKENE (at amino acid residues 153 to 158 of SEQ
ID NO: 53) and the second has the sequence GNVGCV (at amino acid
residues 334 to 339 of SEQ ID NO: 53). Lastly, TANGO 457 has an
immunoglobulin and major histocompatibility complex protein site
with the sequence YQCVVRH at amino acid residues 226 to 232 of SEQ
ID NO: 53.
[0165] FIGS. 6A-6D depict a local alignment of the nucleic acid of
human TANGO 457 shown in SEQ ID NO: 51 and a portion of the
nucleotide sequence of human chromosome 11p14.3 PAC clone
pDJ239b22, from nucleic acids 121077 to 122478 (SEQ ID NO: 61;
AC003969). The alignment shows that there is a 100% nucleotide
sequence identity between the TANGO 457 sequence of SEQ ID NO: 51
and human chromosome 11p14.3 PAC clone pDJ239b22, over the
specified region. Genes known to map to the p14 region of human
chromosome 11 include those encoding fetal brain protein 239 and
hepatitis B virus integration site-1.
[0166] Expressed sequence tags (ESTs) which exhibit homology to
TANGO 457 (SEQ ID NO: 51) have been isolated from a B-cell leukemia
cell line and from fetal liver, fetal spleen, and placenta tissues.
The dbEST accession numbers of these ESTs are AI361759, AA004711,
AA004711, and AI189960, respectively. TANGO 457 (SEQ ID NO: 51)
exhibits about 80% homology to AI361759 over about 445 base pairs,
from nucleotides 1861 to 2306 of TANGO 457. TANGO 457 (SEQ ID NO:
51) exhibits about 77% homology to AA004711 over about 375 base
pairs, from nucleotides 1830 to 2205 of TANGO 457. TANGO 457 (SEQ
ID NO: 51) exhibits about 81% homology to AI189960 over about 415
base pairs, from nucleotides 1908 to 2320.
[0167] Uses of TANGO 457 Nucleic acids,
[0168] Polypeptides, and Modulators Thereof
[0169] TANGO 457 proteins are involved in disorders which affect
both tissues in which they are normally expressed and tissues in
which they are normally not expressed. Based on the observations
that cDNA corresponding to TANGO 457 occurs in a uterine smooth
muscle cDNA library, bears homology to human chromosome 11p14.3 PAC
clone pDJ239b22, and bears homology to ESTs isolated from B-cell
leukemia, liver, spleen, and placenta libraries, it is evident that
TANGO 457 protein is involved in one or more biological processes
which occur in these tissues. In particular, TANGO 457 is involved
in modulating proliferation, migration, morphology,
differentiation, and/or function of cells of these tissues.
Relevant disorders which involve these tissues are discussed
separately below.
[0170] As TANGO 457 was originally found in a uterine smooth muscle
library, TANGO 457 polypeptides, nucleic acids, or modulators
thereof, can be used to modulate the proliferation, migration,
morphology, differentiation, and/or function of cells that form the
uterus, e.g., endometrium endothelial cells and mesometrium smooth
muscle cells, and thus to treat uterine disorders such as, e.g.,
hyperplasia of the endometrium, dysfunctional uterine bleeding
(DUB), and uterine cancers (e.g., uterine leiomyomoma, uterine
cellular leiomyoma, leiomyosarcoma of the uterus, malignant mixed
mullerian tumor of uterus, uterine sarcoma). TANGO 457
polypeptides, nucleic acids, or modulators thereof can also be used
to treat other reproductive disorders, including ovulation
disorder, blockage of the fallopian tubes (e.g., due to pelvic
inflammatory disease or endometriosis), disorders due to infections
(e.g., toxic shock syndrome, chlamydia infection, Herpes infection,
human papillomavirus infection), and ovarian disorders (e.g.,
ovarian endometriosis and ovarian cancers such as ovarian fibroma
and ovarian teratoma).
[0171] As TANGO 457 bears homology to regions of human chromosome
11p14.3 PAC clone pDJ239b22, and since human chromosome 11p14.3 is
the location to which such genes as those encoding fetal brain
protein 239 and hepatitis B virus integration site-1 are known to
map, TANGO 457 nucleic acids, proteins, and modulators thereof can
be used to modulate or treat disorders associated with hepatitis B
infection (e.g., hepatitis, e.g., hepatitis B, and hepatocellular
carcinomas) as well as CNS related disorders. Such CNS related
disorders include but are not limited to bacterial and viral
meningitis, Alzheimer's Disease, Huntington's disease, cerebral
toxoplasmosis, Parkinson's disease, multiple sclerosis, brain
cancers (e.g., cancers that have metastasized from other tissues
(e.g., metastatic carcinoma of the brain), cancers of the
supportive tissue of the brain (e.g., the glia; including cancers
such as glioblastoma and astrocytoma), and cancers of other neural
tissues (e.g., acoustic neuroma)), hydrocephalus, and
encephalitis.
[0172] TANGO 457 is also expressed in the fetal liver, TANGO 457
nucleic acids, proteins, and modulators thereof can be used to
modulate the proliferation, migration, morphology, differentiation,
and/or function of cells that form the liver, e.g., hepatocytes,
and thus to treat hepatic (liver) disorders, such as jaundice,
hepatic failure, hereditary hyperbiliruinemias (e.g., Gilbert's
syndrome, Crigler-Naijar syndromes and Dubin-Johnson and Rotor's
syndromes), hepatic circulatory disorders (e.g., hepatic vein
thrombosis and portal vein obstruction and thrombosis), hepatitis
(e.g., chronic active hepatitis, acute viral hepatitis, and toxic
and drug-induced hepatitis), hepatic adverse drug reactions such as
hepatotoxicity, fibrosis, cirrhosis (e.g., alcoholic cirrhosis,
biliary cirrhosis, and hemochromatosis), and hepatic neoplasms and
tumors (e.g., primary carcinoma, hepatoblastoma, and
angiosarcoma).
[0173] In addition, TANGO 457 is expressed in the fetal spleen.
TANGO 457 nucleic acids, proteins, and modulators thereof can be
used to modulate proliferation, migration, morphology,
differentiation, function, or some combination of these, of cells
that form the spleen, (e.g., cells of the splenic connective
tissue, splenic smooth muscle cells, or endothelial cells of the
splenic blood vessels) or of blood cells that are processed (e.g.,
regenerated, matured, or phagocytized) within the spleen, as
described elsewhere in this disclosure.
[0174] As both fetal spleen and fetal liver are sites of
hematopoiesis, TANGO 457 nucleic acids, proteins, and modulators
thereof can also be used to modulate the proliferation, migration,
morphology, differentiation, and/or function of hematopoietic
cells, e.g., pluripotential stem cells (e.g., lymphoid cells and
myeloid cells), and can be used to treat hematological
disorders.
[0175] Hematological disorders include, but are not limited to,
disorders associated with abnormal differentiation or
hematopoiesis, morphology, migration, proliferation, or function of
blood cells derived, for example, from myeloid multipotential cells
in bone marrow, such as megakaryocytes (and ultimately platelets),
monocytes, erythrocytes, and granulocytes (e.g., neutrophils,
eosinophils, and basophils) and from lymphoid multipotential cells,
such as T and B lymphocytes.
[0176] Platelet associated disorders include, but are not limited
to, thrombocytopenia due to a reduced number of megakaryocytes in
the bone marrow, for example, as a result of chemotherapy; invasive
disorders, such as leukemia, idiopathic or drug- or toxin-induced
aplasia of the marrow, or rare hereditary amegakaryocytic
thrombocytopenias; ineffective thrombopoiesis, for example, as a
result of megaloblastic anemia, alcohol toxicity, vitamin B12 or
folate deficiency, myelodysplastic disorders, or rare hereditary
disorders (e.g., Wiskott-Aldrich syndrome and May-hegglin anomaly);
a reduction in platelet distribution, for example, as a result of
cirrhosis, a splenic invasive disease (e.g., Gaucher's disease), or
myelofibrosis with extramedullary myeloid metaplasia; increased
platelet destruction, for example, as a result of removal of
IgG-coated platelets by the mononuclear phagocytic system (e.g.,
idiopathic thrombocytopenic purpura (ITP), secondary immune
thrombocytopenia (e.g., systemic lupus erythematosus, lymphoma, or
chronic lymphocytic leukemia), drug-related immune
thrombocytopenias (e.g., as with quinidine, aspirin, and heparin),
post-transfusion purpura, and neonatal thrombocytopenia as a result
of maternal platelet autoantibodies or maternal platelet
alloantibodies). Also included are thrombocytopenia secondary to
intravascular clotting and thrombin induced damage to platelets as
a result of, for example, obstetric complications, metastatic
tumors, severe gram-negative bacteremia, thrombotic
thrombocytopenic purpura, or severe illness. Also included is
dilutional thrombocytopenia, for example, due to massive
hemorrhage. Platelet associated disorders also include, but are not
limited to, essential thrombocytosis and thrombocytosis associated
with, for example, splenectomy, acute or chronic inflammatory
diseases, hemolytic anemia, carcinoma, Hodgkin's disease,
lymphoproliferative disorders, and malignant lymphomas.
[0177] Erythrocyte associated disorders include anemias such as,
for example, hemolytic anemias due to hereditary cell membrane
abnormalities, such as hereditary spherocytosis, hereditary
elliptocytosis, and hereditary pyropoikilocytosis; hemolytic
anemias due to acquired cell membrane defects, such as paroxysmal
nocturnal hemoglobinuria and spur cell anemia; hemolytic anemias
caused by antibody reactions, for example to the RBC antigens, or
antigens of the ABO system, Lewis system, Ii system, Rh system,
Kidd system, Duffy system, and Kell system; methemoglobinemia; a
failure of erythropoiesis, for example, as a result of aplastic
anemia, pure red cell aplasia, myelodysplastic syndromes,
sideroblastic anemias, and congenital dyserythropoietic anemia;
secondary anemia in non-hematolic disorders, for example, as a
result of chemotherapy, alcoholism, or liver disease; anemia of
chronic disease, such as chronic renal failure; and endocrine
deficiency diseases.
[0178] Other erythrocyte associated disorders include polycythemias
such as, for example, polycythemia vera, secondary polycythemia,
and relative polycythemia.
[0179] Neutrophil associated disorders include neutropenias that
result from or accompany a number of conditions, including, but not
limited to, chemotherapy; chronic idiopathic neutropenia; Felty's
syndrome, acute infectious disease, lymphoma or aleukemic
lymphocytic leukemia, myelodysplastic syndrome, and rheumatic
diseases such as systemic lupus erythematosus, rheumatoid
arthritis, and polymyositis. Also included is neutrophilia, for
example, accompanying chronic myelogenous leukemia.
[0180] Other hematological disorders include disorders associated
with abnormal monocyte and/or macrophage function, such as impaired
phagocytosis, chemotaxis, or secretion of cytokines, growth factors
and acute-phase reactants, resulting from certain diseases, e.g.,
lysosomal storage diseases (e.g., Gaucher's disease); impaired
monocyte cytokine production, for example, found in some patients
with disseminated non-tuberculous mycobacterial infection who are
not infected with HIV; leukocyte adhesion deficiency (LAD),
hyperimmunoglobulin E-recurrent infection (HIE) or Job's syndrome,
Chediak-Higashi syndrome (CHS), and chronic granulomatous diseases
(CGD), certain autoimmune diseases, such as systemic lupus
erythematosus and other autoimmune diseases characterized by tissue
deposition of immune complexes, as seen in Sjogren's syndrome,
mixed cryoglobulinemia, dermatitis herpetiformis, and chronic
progressive multiple sclerosis. Also included are disorders or
infections that impair mononuclear phagocyte function, for example,
influenza virus infection and AIDS.
[0181] Monocyte associated disorders include monocytoses such as,
for example, monocytoses associated with certain infections such as
tuberculosis, brucellosis, subacute bacterial endocarditis, Rocky
Mountain spotted fever, malaria, and visceral leishmaniasis (kala
azar), in malignancies, leukemias, myeloproliferative syndromes,
hemolytic anemias, chronic idiopathic neutropenias, and
granulomatous diseases such as sarcoidosis, regional enteritis, and
some collagen vascular diseases.
[0182] Other monocyte associated disorders include monocytopenias
such as, for example, monocytopenias that can occur with acute
infections, with stress, following administration of
glucocorticoids, aplastic anemia, hairy cell leukemia, and acute
myelogenous leukemia and as a direct result of administration of
myelotoxic and immunosuppressive drugs.
[0183] Eosinophil associated disorders include eosinphilias such
as, for example, eosinphilias that result from or accompany
conditions such as allergic disorders, infections caused by
parasites and other organisms, dermatologic diseases, pulmonary
diseases, collagen vascular disease, neoplasms, immunodeficiency
diseases, gastroenteritis, inflammatory bowel disease, chronic
active hepatitis, pancreatitis, and hypopituitarism. Also included
are hypereosinophilic syndrome (HES) and chronic and acute
eosinophilic leukemias.
[0184] Other eosinophil associated disorders include eosinopenias
such as, for example, eosinopenias that occur with stress, such as
acute bacterial infection, and following administration of
glucocorticoids.
[0185] Basophil associated disorders include basophilias such as,
for example, basophilias seen in myeloproliferative disorders
(e.g., chronic myeloid leukemia, polycythemia vera, and myeloid
metaplasia), following splenectomy, hemolytic anemia, ulcerative
colitis, varicella infection, and Hodgkin's disease.
[0186] As TANGO 457 is expressed in the placenta, TANGO 457 nucleic
acids, proteins, and modulators thereof can be used to modulate the
proliferation, migration, morphology, differentiation, and/or
function of cells that form the placenta, e.g., the decidual cells
(which arise during pregnancy), and thus can be used to treat
placental disorders, such as toxemia of pregnancy (e.g.,
preeclampsia and eclampsia), placentitis, or spontaneous
abortion.
[0187] As TANGO 457 is expressed in B-cell, chronic lymphotic
leukemia, TANGO 457 nucleic acids, proteins, and modulators thereof
can be used to modulate the proliferation, migration, morphology,
differentiation, and/or function of immune cells, e.g. B-cells,
dendritic cells, natural killer cells and monocytes. TANGO 457
nucleic acids, proteins and modulators thereof can also be utilized
to modulate immunoglobulins and formation of antibodies, and
immune-related processes, e.g., the host immune response.
[0188] Such TANGO 457 compositions and modulators thereof can be
utilized modulate or treat immune disorders that include, but are
not limited to, immune proliferative disorders (e.g., carcinoma,
lymphoma, e.g., follicular lymphoma), disorders associated with
fighting pathogenic infections (e.g., bacterial, such as
chlamydial, infection, parasitic infection, and viral infections
such as HSV or HIV infections), pathogenic disorders associated
with immune disorders (e.g., immunodeficiency disorders, such as
HIV), autoimmune disorders (e.g., rheumatoid and juvenile
arthritis, rheumatism, systemic lupus erythamatosus, graft or
allograft rejection, multiple sclerosis, Grave's disease, and
Hashimoto's disease), immunodeficiency disorders (e.g., B and T
cell immunodeficiency disorders and AIDS), bacterial, viral, and
parasitic infections (e.g., sepsis, influenza, common colds,
hepatitis, HIV infection, malaria, and gonorrhea), disorders
associated with undesirable immune reactions with foreign material
(e.g., transplant rejection, environmental {e.g., latex}
hypersensitivity disorders, and allergic disorders), phagocytic
dysfunction disorders (e.g., neutropenia and chronic granulomatous
disease), anaphylaxis, urticaria, and inflammatory disorders (e.g.,
septicemia, cerebral malaria, inflammatory bowel disease, arthritis
such as rheumatoid arthritis and osteoarthritis, allergic
inflammatory disorders such as asthma and psoriasis, apoptotic
disorders such as rheumatoid arthritis, systemic lupus
erythematosus, and insulin-dependent diabetes mellitus, cytotoxic
disorders, septic shock, and cachexia).
[0189] As TANGO 457 contains one or more Ig domains, and as
immunoglobulin superfamily proteins are cell surface molecules
involved in signal transduction and cellular proliferation, TANGO
457 nucleic acids, proteins and modulators thereof can be utilized
to modulate the development and progression of cancerous and
non-cancerous cell proliferative disorders, such as deregulated
proliferation (such as hyperdysplasia, hyper-IgM syndrome, or
lymphoproliferative disorders), cirrhosis of the liver (a condition
in which scarring has overtaken normal liver regeneration
processes), treatment of keloid (hypertrophic scar) formation
(disfiguring of the skin in which the scarring process interferes
with normal renewal), psoriasis (a common skin condition
characterized by excessive proliferation of the skin and delay in
proper cell fate determination), benign tumors, fibrocystic
conditions, and tissue hypertrophy (e.g., prostatic hyperplasia),
cancers such as neoplasms or tumors (such as carcinomas, sarcomas,
adenomas or myeloid lymphoma tumors, e.g., fibrosarcoma,
myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma,
chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma,
lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's
tumor, leimyosarcoma, rhabdotheliosarcoma, colon sarcoma,
pancreatic cancer, breast cancer, ovarian cancer, prostate cancer,
squamous cell carcinoma, basal cell carcinoma, adenocarcinoma,
sweat gland carcinoma, sebaceous gland carcinoma, papillary
carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary
carcinoma, bronchogenic carcinoma, renal cell carcinoma, hematoma,
bile duct carcinoma, melanoma, choriocarcinoma, semicoma, embryonal
carcinoma, Wilms' tumor, cervical cancer, testicular tumor, lung
carcinoma, small cell carcinoma, bladder carcinoma, epithelial
carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma,
ependynoma, pinealoma, hemangioblastoma, retinoblastoma),
leukemias, (e.g. acute lymphocytic leukemia), acute myelocytic
leukemia (myelolastic, promyelocytic, myelomonocytic, monocytic and
erythroleukemia), chronic leukemias (chronic myelocytic
(granulocytic) leukemia and chronic lymphocytic leukemia), or
polycythemia vera, or lymphomas (Hodgkin's disease and
non-Hodgkin's diseases), multiple myelomas and Waldenstrom's
macroglobulinemia.
TANGO 229
[0190] A cDNA clone (designated jthtc001c06) encoding at least a
portion of human TANGO 229 protein was isolated from a human T cell
cDNA library. Human TANGO 229 protein is a transmembrane
protein.
[0191] The full length of the cDNA encoding human TANGO 229 protein
(SEQ ID NO: 71) is 3594 nucleotide residues. The open reading frame
(ORF) of this cDNA, nucleotide residues 72 to 2216 of SEQ ID NO: 71
(i.e., SEQ ID NO: 72), encodes a 715-amino acid residue protein
(SEQ ID NO: 73), corresponding to a 681-residue transmembrane
mature protein.
[0192] The invention thus includes purified human TANGO 229
protein, both in the form of the immature 715 amino acid residue
protein (SEQ ID NO: 73) and in the form of the mature 681 amino
acid residue protein (SEQ ID NO: 75). Mature human TANGO 229
proteins can be synthesized without the signal sequence polypeptide
at the amino terminus thereof, or they can be synthesized by
generating immature TANGO 229 protein and cleaving the signal
sequence therefrom.
[0193] The invention includes nucleic acid molecules which encode a
polypeptide of the invention. Such nucleic acids include, for
example, a DNA molecule having the nucleotide sequence listed in
SEQ ID NO: 71, such as the portion which encodes mature TANGO 229
protein, immature TANGO 229 protein, or a domain of TANGO 229
protein. These nucleic acids are collectively referred to as
nucleic acids of the invention.
[0194] TANGO 229 proteins and nucleic acid molecules encoding them
comprise a family of molecules having certain conserved structural
and functional features.
[0195] A common domain present in TANGO 229 proteins is a signal
sequence. In one embodiment, a TANGO 229 protein contains a signal
sequence corresponding to amino acid residues 1 to 34 of SEQ ID NO:
73 (SEQ ID NO: 74). It is recognized that the carboxyl terminal
boundary of the signal sequence can be located one or two residues
from the residue identified above (i.e., following residues 32, 33,
34, 35, or 36 of SEQ ID NO: 73). The signal sequence is cleaved
during processing of the mature protein.
[0196] TANGO 229 proteins include a transmembrane domain and two
extra-membrane domains flanking the cell membrane. The
transmembrane domain corresponds to about amino acid residues 456
to 480 of SEQ ID NO: 73 (i.e., the transmembrane domain having the
sequence SEQ ID NO: 77). One of the extra-membrane domains
corresponds to about amino acid residues 35 to 455 of SEQ ID NO:
73. This domain has the sequence SEQ ID NO: 76, and is most likely
an extracellular domain. The other extra-membrane domain
corresponds to about amino acid residues 481 to 715 of SEQ ID NO:
73. This domain has the sequence SEQ ID NO: 78, and is most likely
a cytoplasmic domain. In one embodiment, the domain corresponding
to about amino acid residues 35 to 455 of SEQ ID NO: 73 is a
cytoplasmic domain, and the domain corresponding to about amino
acid residues 481 to 715 is an extracellular domain.
[0197] TANGO 229 proteins typically comprise a variety of potential
post-translational modification sites and protein domains (often
positioned within an extracellular domain), such as those described
herein in Table II, as predicted by computerized sequence analysis
of TANGO 229 proteins using amino acid sequence comparison software
(comparing the amino acid sequence of TANGO 229 with the
information in the PROSITE database {rel. 12.2; February, 1995} and
the Hidden Markov Models database {Rel. PFAM 3.3}).
TABLE-US-00003 TABLE II Amino Acid Type of Potential Residues Amino
Modification Site of SEQ Acid or Domain ID NO: 73 Sequence
N-glycosylation site 64 to 67 NHTV 124 to 127 NTSE 277 to 280 NESG
351 to 354 NNSK 418 to 421 NDSL 455 to 458 NITT 707 to 710 NQTA
cAMP/cGMP-dependent protein 322 to 325 KKIT kinase phosphorylation
site 424 to 427 RKTS 485 to 488 KKGS 553 to 556 RKGS Protein kinase
C 54 to 56 TSK phosphorylation site 129 to 131 TVR 139 to 141 SGR
244 to 246 SDK 357 to 359 TYK 433 to 435 STK 527 to 529 TQK 552 to
554 TRK 557 to 559 TFR 683 to 685 SQK Casein kinase II 46 to 49
TYQD phosphorylation site 66 to 69 TVCE 103 to 106 SSSD 157 to 160
TCLE 226 to 229 SRYE 242 to 245 SLSD 275 to 278 SVNE 434 to 437
TKKE 563 to 566 TDAE N-myristoylation site 4 to 9 GARGGG 51 to 56
GTMTSK 60 to 65 GTYPNH 135 to 140 GSHISG 214 to 219 GGQISV 230 to
235 GILANG 254 to 259 GCSRSL 265 to 270 GQIRAS 326 to 331 GIRTTG
360 to 365 GIVNNE 411 to 416 GCQITQ 453 to 458 GINITT 475 to 480
GIFAAF 487 to 492 GSPYGS 646 to 651 GAQDGD 691 to 696 GTSDSY
Amidation site 76 to 79 KGKR CUB domain 41 to 147 Factor V/VIII
discoidin domain 258 to 409
[0198] In various embodiments, the protein of the invention has at
least 1, 2, 4, 6, 10, 15, or 20 or more of the post-translational
modification sites described herein in Table II.
[0199] Examples of additional domains present in human TANGO 229
protein include a CUB domain and a Factor V/VIII discoidin domain.
In one embodiment, the protein of the invention has at least one
domain or signature sequence that is at least 55%, preferably at
least about 65%, 75%, 85%, or 95% identical to one of the domains
or signature sequences described herein in Table II. Preferably,
the protein of the invention has at least one CUB domain and one
Factor V/VIII discoidin domain.
[0200] CUB domains are extracellular domains of about 110 amino
acid residues which occur in functionally diverse, mostly
developmentally regulated proteins (Bork and Beckmann (1993) J.
Mol. Biol. 231:539-545; Bork (1991) FEBS Lett. 282:9-12). Many CUB
domains contain four conserved cysteine residues, although some,
like that of TANGO 202, contain only two of the conserved cysteine
residues. The structure of the CUB domain has been predicted to
assume a beta-barrel configuration, similar to that of
immunoglobulins. Other proteins which comprise one or more CUB
domains include, for example, mammalian complement sub-components
Cls and Clr, hamster serine protease Casp, mammalian complement
activating component of Ra-reactive factor, vertebrate
enteropeptidase, vertebrate bone morphogenic protein 1, sea urchin
blastula proteins BP10 and SpAN, Caenorhabditis elegans
hypothetical proteins F42A10.8 and R151.5, neuropilin (A5 antigen,
in which a pair of Factor V/VIII discoidin domains also occur), sea
urchin fibropellins I and III, mammalian hyaluronate-binding
protein TSG-6 (PS4), mammalian spermadhesins, and Xenopus embryonic
protein UVS.2. The presence of a CUB domain in TANGO 229 protein
indicates that TANGO 229 is involved in one or more physiological
processes in which these other CUB domain-containing proteins are
involved, has a biological activity in common with one or more of
these other CUB domain-containing proteins, or both. The presence
of a CUB domain in TANGO 229 protein also indicates that TANGO 229
can be developmentally regulated.
[0201] Factor V/VIII discoidin domains are involved in binding with
cell surface-attached carbohydrates. These domains occur in a
variety of intracellular, extracellular, and transmembrane
proteins, including human and murine coagulation factor V, human
and murine coagulation factor VIII precursor, human and murine
neuropilins, a variety of receptor-like tyrosine kinases (e.g.,
neurotrophic tyrosine kinases and cell adhesion tyrosine kinases),
carboxypeptidases and carboxypeptidase-like proteins, milk fat
globule glycoproteins, human breast epithelial antigen BA46, murine
neurexin IV, human X-linked juvenile retinoschisis precursor
protein, and human contactin associated protein. Presence of a
Factor V/VIII discoidin domain in TANGO 229 indicates that this
protein is involved in one or more physiological processes in which
these other Factor V/VIII discoidin domain-containing proteins are
involved, has biological activity in common with one or more of
these other Factor V/VIII discoidin domain-containing proteins, or
both. Presence of a Factor V/VIII discoidin domain in TANGO 229
protein is an indication that TANGO 229 is associated with binding
of one or more glycosylated proteins at the surface of cells which
express TANGO 229. Binding of glycosylated proteins at the cell
surface is associated with several physiologically relevant
phenomena, including cell adhesion (including cell repulsion),
transmembrane signal transduction, and nutrient binding and uptake
by cells. The Factor V/VIII discoidin domain of human coagulation
factor VIII protein is known to be involved in binding of factor
VIII with von Willebrand factor and with membrane-associated lipids
such as phosphatidylserine. Presence of a Factor V/VIII discoidin
domain in TANGO 229 protein is thus an indication that the
extracellular portion of TANGO 229 protein can interact with
membrane lipids.
[0202] The signal peptide prediction program SIGNALP (Nielsen et
al. (1997) Protein Engineering 10:1-6) predicted that human TANGO
229 protein includes a 34 amino acid residue signal peptide (amino
acid residues 1 to 34 of SEQ ID NO: 73; SEQ ID NO: 74) preceding
the mature TANGO 229 protein (amino acid residues 35 to 715 of SEQ
ID NO: 73; SEQ ID NO: 75). Human TANGO 229 protein includes an
extracellular domain (amino acid residues 35 to 455 of SEQ ID NO:
73; SEQ ID NO: 76), a transmembrane domain (amino acid residues 456
to 480 of SEQ ID NO: 73; SEQ ID NO: 77), and an intracellular
domain (amino acid residues 481 to 715 of SEQ ID NO: 73; SEQ ID NO:
78). In an alternative embodiment, amino acid residues 35 to 455 of
SEQ ID NO: 73 correspond to an intracellular domain of human TANGO
229 protein and residues 481 to 715 correspond to an extracellular
domain.
[0203] FIG. 7 depicts a hydrophobicity plot of human TANGO 229
protein. Relatively hydrophobic regions are above the dashed
horizontal line, and relatively hydrophilic regions are below the
dashed horizontal line. The hydrophobic region which corresponds to
amino acid residues 1 to 34 of SEQ ID NO: 73 is the signal sequence
of human TANGO 229 (SEQ ID NO: 74). As described elsewhere herein,
relatively hydrophilic regions are generally located at or near the
surface of a protein, and are more frequently effective immunogenic
epitopes than are relatively hydrophobic regions. For example, the
region of human TANGO 229 protein from about amino acid residue 50
to about amino acid residue 70 appears to be located at or near the
surface of the protein, while the region from about amino acid
residue 195 to about amino acid residue 210 appears not to be
located at or near the surface.
[0204] The predicted molecular weight of human TANGO 229 protein
without modification and prior to cleavage of the signal sequence
is about 77.9 kilodaltons. The predicted molecular weight of the
mature human TANGO 229 protein without modification and after
cleavage of the signal sequence is about 72.3 kilodaltons.
[0205] Northern hybridization experiments using human tissue
samples indicated that mRNA corresponding to cDNA encoding TANGO
229 is expressed in the tissues listed in Table 111A, wherein "++"
indicates strongly detectable expression, "+" indicates a lesser
degree of expression, and "+/-" indicates a still lesser degree of
expression. In these tissues, two alternatively spliced forms of
cDNA encoding TANGO 229 (having sizes of about 2.0 and 4.0
kilobases) were detected.
TABLE-US-00004 TABLE IIIA Tissue Expression Heart ++ Liver ++
Pancreas ++ Placenta + Brain +/- Lung +/- Skeletal Muscle +/-
Kidney +/-
[0206] Northern hybridization experiments using human immune system
tissue samples indicated that mRNA corresponding to the cDNA
encoding TANGO 229 is expressed in the tissues listed in Table IIIB
In these tissues, two alternatively spliced forms of cDNA encoding
TANGO 229 (having sizes of about 2.0 and 4.9 kilobases) were
detected.
TABLE-US-00005 TABLE IIIB Tissue Expression Spleen ++ Lymph node ++
Fetal Liver ++ Peripheral blood leukocytes + Bone Marrow + Thymus
+/-
[0207] The nucleotide sequence (SEQ ID NO: 71) of TANGO 229 cDNA
was aligned (using the LALIGN software {Huang and Miller (1991)
Adv. Appl. Math. 12:373-381}; pam120 scoring matrix, gap opening
penalty=12, gap extension penalty=4) with the nucleotide sequence
of the portion of human chromosome region 6q21 listed in GenBank
Accession No. Z85999. This alignment indicated 45.8% identity
between the two sequences in the 3826-residue overlapping portion.
The nucleotide sequence (SEQ ID NO: 71) of TANGO 229 cDNA was also
aligned (using the LALIGN software; pam120 scoring matrix, gap
opening penalty=12, gap extension penalty=4) with an expressed
sequence tag (EST) clone designated BP481 in P.C.T. Publication No.
WO98/45435. This alignment indicated 72.9% identity between the two
sequences in the 414-residue overlapping portion.
[0208] Uses of TANGO 229 Nucleic acids,
[0209] Polypeptides, and Modulators Thereof
[0210] TANGO 229 proteins are involved in disorders which affect
both tissues in which they are normally expressed and tissues in
which they are normally not expressed. Based on the observations
that cDNA corresponding to TANGO 229 occurs in a human T cell cDNA
library, and that RNA corresponding to TANGO 229 is detectable by
Northern analysis of human heart, liver, pancreas, placenta, brain
lung, skeletal muscle, kidney, spleen, lymph node, peripheral blood
leukocyte, bone marrow, and thymus tissues, it is evident that
TANGO 229 protein can be involved in one or more biological
processes which occur in these tissues. In particular, TANGO 229
can be involved in modulating growth, proliferation, survival,
differentiation, and activity of cells of these tissues (e.g., T
cells and other cells of the immune system).
[0211] Expression of TANGO 229 in a variety of immune system
tissues (e.g., T cells, peripheral blood leukocyte, and spleen,
lymph node, bone marrow, and thymus tissues) is an indication that
TANGO 229 can have a role in both normal immune processes and in a
variety of disorders which affect or involve the immune system,
such as the immune disorders described elsewhere in this
disclosure.
[0212] The presence of a factor V/VIII discoidin domain in TANGO
229 protein is an indication that the protein can be involved in
mediating cell binding and adhesion, including binding/adhesion of
cells with other cells, with extracellular matrix, and with foreign
materials (i.e., materials not originating in the body of the same
individual). Cell binding and adhesion affected by TANGO 229 can
encompass interactions between cells and between cells and
extracellular components, which interactions lend structural and
mechanical support to body tissues and containment of body fluids
(e.g., by blood coagulation). However, TANGO 229 can also regulate
cell-to-cell and cell-to-environment interactions which have little
relevance to the structural integrity of the animal, but which
permit information exchange between cells (e.g., cell-to-cell
signaling such as that which occurs between helper T cells and
antibody-producing B cells) or between cells and the environment
(e.g., recognition by cells of the presence of a particular
chemical entity, such as an antigen, in the environment). Certain
cell-to-environment interactions mediated by TANGO 229 can also
permit a cell which expresses it to exert an effect upon (e.g.,
degrade, absorb, or envelop) a component of the environment.
[0213] Involvement of TANGO 229 protein in binding of cells is an
indication that TANGO 229 can be involved in disorders associated
with aberrant binding or adhesion of cells with other cells, with
extracellular matrix, or with foreign materials. Disorders
involving aberrant binding or adhesion of cells with other cells
include both disorders in which cells normally bind with one
another (e.g., metastasis of normally solid tumor tissue cells away
from the tumor site of origin or immune hypersensitivity) and
disorders in which the cells do not normally bind with one another,
but do bind with one another in individuals afflicted with the
disorder (e.g., metastasis of tumor cells into a tissue in which
the cells do not normally occur, autoimmune disorders, infections,
wherein cells with which T cells bind are not normally present in
the animal, or disorders associated with abnormal blood
coagulation). Disorders involving aberrant binding or adhesion of
cells with extracellular matrix include those (e.g., metastasis of
cancerous cells through or into extracellular matrix and away from
the normal body location of the cells) in which the cells normally
do, but aberrantly do not, bind with extracellular matrix as well
as those (e.g., metastasis of cancers cells into extracellular
matrix at body locations at which they do not normally occur,
autoimmune disorders, liver fibrosis, abnormal blood coagulation,
atherosclerosis, and arteriosclerosis) in which the cells normally
do not bind with extracellular matrix, but aberrantly do. Examples
of disorders involving aberrant binding or adhesion of cells with
foreign materials include those (e.g., allergies and
hypersensitivity disorders such as latex hypersensitivity)
associated with aberrant binding with the foreign material and
disorders in which the cells normally bind with the foreign
material, but aberrantly do not. TANGO 229 proteins, nucleic acids
encoding them, and agents that modulate activity or expression of
either of these can be used to prognosticate, diagnose, and treat
one or more of these disorders.
[0214] Like certain known developmental proteins (e.g., human
neuropilins; Kolodkin and Ginty (1997) Neuron 19:1159-1162), TANGO
229 protein contains both a CUB domain and a factor V/VIII
discoidin domain. The presence of both of these types of domains is
an indication that TANGO 229 protein is involved in mediating
attraction and repulsion of cells and translocation of cells
through, past, or along other cells or tissues. For example, TANGO
229 can, alone or in conjunction with one or more neuropilins, bind
with a semaphorin protein to direct nerve growth. Apart from
regulating the rate and direction of nerve growth, TANGO 229 can
regulate the rate and direction of growth of other tissues, such as
vascular tissues (e.g., during angiogenesis). TANGO 229 can also
modulate the direction and rate of cell movement, relative to
another cell or relative to a tissue, such as movement of
leukocytes through vascular lumenal epithelium (e.g., during
leukocytic extravasation) or movement of metastatic cells through a
solid tissue. Another example of such modulation is the effect that
TANGO 229 can have on the rate of cell growth, depending on contact
between two cells or between two tissues. TANGO 229 can regulate
cell growth such that the growth slows or substantially stops when
two tissues contact one another (e.g., during wound healing). TANGO
229 is thus involved in disorders associated with aberrant growth
or movement of cells through, past, or along other cells or
tissues. Examples of disorders of these types include cancerous
growth and proliferation of cells, metastasis of cancerous cells
(i.e., including metastasis away from the normal body location of
the cells, through tissues and extracellular matrix, and into body
locations at which the cells do not normally occur), inflammation,
atherosclerosis, arteriosclerosis, abnormal blood coagulation,
asthma, and chronic obstructive pulmonary disorders. TANGO 229
proteins, nucleic acids encoding them, and agents that modulate
activity or expression of either of these can be used to
prognosticate, diagnose, and treat one or more of these
disorders.
[0215] Like many transmembrane signaling proteins, TANGO 229
protein comprises extracellular domains capable of interacting with
environmental cues (e.g., the presence or absence of particular
cells, proteins, or small molecules) and a cytoplasmic domain
having a substantial size. For example, several tyrosine-protein
kinases (e.g., human and murine cell adhesion kinase and
neurotrophic receptor-related tyrosine kinase-3) comprise one or
more factor V/VIII discoidin domains. The structure of TANGO 229
protein, which has several potential phosphorylation sites, is thus
an indication that the protein can be involved in transducing
signals across the cell membrane. Binding of a ligand of TANGO 229
protein with a portion of the protein located on one side of the
membrane can affect one or more characteristics (e.g.,
conformation, phosphorylation state, or level or specificity of
enzymatic activity) of a portion of the protein located on the
other side. Thus, for example, a compound in the extracellular
environment of a cell which expresses TANGO 229 can bind with the
extracellular domain of the protein, thereby effecting a change in
a characteristic of the intracellular portion of the protein,
leading to alteration of the physiology of the cell (e.g., effected
by an activity exerted by the intracellular portion of the protein
on another component of the cell). The compound in the
extracellular environment can, for example, be a compound dissolved
or suspended in a liquid, a compound attached to another cell of
the same animal, or a compound attached to a foreign cell or virus
particle. TANGO 229 protein can associate with other signal
transduction proteins in the cell membrane, thereby modulating the
intracellular activity of those other proteins. TANGO 229 protein
can thus have a role in disorders which involve aberrant
transmembrane signal transduction. Examples of signal
transduction-related disorders include cystic fibrosis, various
chronic obstructive pulmonary disorders, inflammation, aberrant or
undesirable angiogenesis, and obesity. TANGO 229 proteins, nucleic
acids encoding them, and agents that modulate activity or
expression of either of these can be used to prognosticate,
diagnose, and treat one or more of these disorders.
INTERCEPT 289
[0216] A cDNA clone (designated jthLa186d06) encoding at least a
portion of human INTERCEPT 289 protein was isolated from a human
mixed lymphocyte reaction cDNA library. Human INTERCEPT 289 protein
is a transmembrane protein which can occur in at least six
alternative forms. These forms are herein designated "form 1a,"
"form 1b," "form 2a," "form 2b," "form 3a," and "form 3b" for
convenience. The properties of and variations among these forms are
described herein.
[0217] 1a) The full length of the cDNA encoding INTERCEPT 289
protein form 1a (SEQ ID NO: 81) is 4074 nucleotide residues. The
ORF of this cDNA, nucleotide residues 179 to 742 of SEQ ID NO: 81
(i.e., SEQ ID NO: 82), encodes a 188-amino acid residue protein
having the amino acid sequence SEQ ID NO: 83.
[0218] 1b) The full length of the cDNA encoding INTERCEPT 289
protein form 1b (SEQ ID NO: 91) is 4018 nucleotide residues. The
ORF of this cDNA, nucleotide residues 179 to 712 of SEQ ID NO: 91
(i.e., SEQ ID NO: 92), encodes a 178-amino acid residue protein
having the amino acid sequence SEQ ID NO: 93.
[0219] 2a) The full length of the cDNA encoding INTERCEPT 289
protein form 2a (SEQ ID NO: 96) is 3985 nucleotide residues. The
ORF of this cDNA, nucleotide residues 162 to 656 of SEQ ID NO: 96
(i.e., SEQ ID NO: 97), encodes a 165-amino acid residue protein
having the amino acid sequence SEQ ID NO: 98.
[0220] 2b) The full length of the cDNA encoding INTERCEPT 289
protein form 2b (SEQ ID NO: 101) is 3958 nucleotide residues. The
ORF of this cDNA, nucleotide residues 162 to 626 of SEQ ID NO: 101
(i.e., SEQ ID NO: 102), encodes a 155-amino acid residue protein
having the amino acid sequence SEQ ID NO: 103.
[0221] 3a) The full length of the cDNA encoding INTERCEPT 289
protein form 3a (SEQ ID NO: 106) is 3925 nucleotide residues. The
ORF of this cDNA, nucleotide residues 162 to 596 of SEQ ID NO: 106
(i.e., SEQ ID NO: 107), encodes a 145-amino acid residue protein
having the amino acid sequence SEQ ID NO: 108.
[0222] 3b) The full length of the cDNA encoding INTERCEPT 289
protein form 3b (SEQ ID NO: 111) is 3898 nucleotide residues. The
ORF of this cDNA, nucleotide residues 162 to 566 of SEQ ID NO: 111
(i.e., SEQ ID NO: 112), encodes a 135-amino acid residue protein
having the amino acid sequence SEQ ID NO: 113.
[0223] The mixed lymphocyte reaction library from which the cDNAs
encoding INTERCEPT 289 were isolated was prepared as follows.
Mononuclear cells were isolated from 50 milliliters of peripheral
blood pooled from 22 human donors. Mononuclear cells were isolated
using HISTOPAQUE.TM. 1077 (Sigma Chemical Co., St. Louis, Mo.)
according to the manufacturer's instructions and collected in
heparinized tubes. After pooling the mononuclear cells, CD19.sup.+
B cells were removed by positive selection using MACS.TM. beads and
a VS+ separation column (Miltenyi Biotec, Germany) according to the
manufacturer's instructions. CD19.sup.- cells were re-suspended at
an approximate density of 10.times.10.sup.6 cells per milliliter in
RPMI medium supplemented with 10% (v/v) fetal bovine serum,
antibiotics, and L-glutamine. The cells were maintained at
37.degree. C. in a humidified incubator, and were harvested 4, 14,
and 24 hours following re-suspension. Total RNA was isolated from
the cells by guanidinium isothiocyanate/beta-mercaptoethanol lysis
followed by cesium chloride gradient centrifugation. Isolated RNA
was treated with DNase, and the poly-A-containing fraction of total
RNA was further purified using OLIGOTEX.TM. beads (Qiagen, Inc.).
About 4.4 micrograms of poly-A-containing RNA was used to
synthesize a cDNA library using the Superscript.TM. cDNA synthesis
kit (Gibco BRL, Inc.; Gaithersburg, Md.). cDNA was directionally
cloned into expression plasmid pMET7 vectors using SalI and NotI
polylinker restriction endonuclease sites in order to generate a
plasmid library. Transformants were randomly selected and expanded
in culture for single-pass nucleotide sequencing.
[0224] The invention includes nucleic acid molecules which encode a
polypeptide of the invention. Such nucleic acids include, for
example, a DNA molecule having the nucleotide sequence listed in
one of SEQ ID NOs: 81, 91, 96, 101, 106, and 111, such as the
portion which encodes INTERCEPT 289 protein or a domain (e.g., the
extracellular domain) of INTERCEPT 289 protein. These nucleic acids
are collectively referred to as nucleic acids of the invention.
[0225] In each form, INTERCEPT 289 protein includes a transmembrane
domain and a portion corresponding to an extra-membrane (presumably
extracellular) domain. In alternative embodiments, this
extra-membrane domain is a cytoplasmic domain. The transmembrane
domain corresponds to about amino acid residues 7 to 27 of SEQ ID
NO: 83 (i.e., SEQ ID NO: 84 in form 1a), to about amino acid
residues 7 to 27 of SEQ ID NO: 93 (i.e., SEQ ID NO: 94 in form 1b),
to about amino acid residues 7 to 27 of SEQ ID NO: 98 (i.e., SEQ ID
NO: 99 in form 2a), to about amino acid residues 7 to 27 of SEQ ID
NO: 103 (i.e., SEQ ID NO: 104 in form 2b), to about amino acid
residues 7 to 28 of SEQ ID NO: 108 (i.e., SEQ ID NO: 109 in form
3a), and to about amino acid residues 7 to 28 of SEQ ID NO: 113
(i.e., SEQ ID NO: 114 in form 3b).
[0226] Each form of INTERCEPT 289 protein also includes another
extra-membrane portion. This portion corresponds to about amino
acid residues 28 to 188 of SEQ ID NO: 83 (i.e., SEQ ID NO: 85 in
form 1a), to about amino acid residues 28 to 178 of SEQ ID NO: 93
(i.e., SEQ ID NO: 95 in form 1b), to about amino acid residues 28
to 165 of SEQ ID NO: 98 (i.e., SEQ ID NO: 100 in form 2a), to about
amino acid residues 28 to 155 of SEQ ID NO: 103 (i.e., SEQ ID NO:
105 in form 2b), to about amino acid residues 29 to 145 of SEQ ID
NO: 108 (i.e., SEQ ID NO: 110 in form 3a), and to about amino acid
residues 29 to 135 of SEQ ID NO: 113 (i.e., SEQ ID NO: 115 in form
3b).
[0227] INTERCEPT 289 proteins and nucleic acid molecules encoding
them comprise a family of molecules having certain conserved
structural and functional features, as illustrated in FIGS. 8 and
9A-9N.
[0228] In FIG. 8, the amino acid sequences of various forms of
INTERCEPT 289 ("A"-"F"; SEQ ID NOs: 83, 93, 98, 103, 108, and 113)
are shown, as aligned using the Wisconsin.TM. BestFit software
(Smith and Waterman, (1981) Adv. Appl. Math. 2:482-489; blosum62
scoring matrix; gap opening penalty 10/gap extension penalty 10).
In FIGS. 9A-9N, the nucleotide sequences (SEQ ID NOs: 81, 91, 96,
101, 106, and 111) of cDNA molecules encoding the six forms of
INTERCEPT 289 protein described herein are aligned using the
Wisconsin.TM. BestFit software (Smith and Waterman, (1981) Adv.
Appl. Math. 2:482-489; gap opening penalty 10/gap extension penalty
10). As indicated in these figures, the various forms of INTERCEPT
289 protein differ in the length of the polypeptide sequence
between the transmembrane domain and the lectin C-type domain
described below and in the amino acid sequence of the
carboxyl-terminal portion of the protein.
[0229] INTERCEPT 289 proteins typically comprise a variety of
potential post-translational modification sites and protein domains
(often positioned within a domain located at or near the protein
surface), such as those described herein in Table IVA, as predicted
by computerized sequence analysis of INTERCEPT 289 proteins using
amino acid sequence comparison software (comparing the amino acid
sequence of INTERCEPT 289 with the information in the PROSITE
database {rel. 12.2; February, 1995} and the Hidden Markov Models
database {Rel. PFAM 3.3}).
TABLE-US-00006 TABLE IVA Type of Potential Amino Acid Residues
Amino Modification Site of SEQ ID NO: ## (INTERCEPT 289 form) Acid
or Domain 83 (1a) 93 (1b) 98 (2a) 103 (2b) 108 (3a) 113 (3b)
Sequence N-glycosylation 32-35 32-35 32-35 32-35 NKSN site 93-96
93-96 70-73 70-73 50-53 50-53 NESR 144-147 144-147 121-124 121-124
101-104 101-104 NNSV 151-154 128-131 108-111 NVTN Protein kinase C
40-42 40-42 40-42 40-42 TTR phosphorylation 63-65 63-65 TTR site
178-180 155-157 135-137 SYR Casein kinase II 86-89 86-89 63-66
63-66 43-46 43-46 STSE phosphorylation 91-94 91-94 68-71 68-71
48-51 48-51 SWNE site 122-125 122-125 99-102 99-102 79-82 79-82
TDAE 168-171 145-148 125-128 TKPE N-myristoylation 103-108 103-108
80-85 80-85 60-65 60-65 GSTLAI site 150-155 127-132 107-112 GNVTNQ
165-170 142-147 122-127 GLTKTF Lectin C-type 97-183 97-170 74-160
74-147 54-140 54-127 domain
[0230] In various embodiments, the protein of the invention has at
least 1, 2, 4, 6, 8, 12, or more of the post-translational
modification sites and domains described in Table IVA.
[0231] An example of an additional domain present in INTERCEPT 289
proteins is a lectin C-type domain. In one embodiment, the protein
of the invention has at least one domain or signature sequence that
is at least 55%, preferably at least about 65%, 75%, 85%, or 95%
identical to this domain. C-type lectin domains are conserved among
proteins (e.g., animal lectins) which are involved in
calcium-dependent binding of carbohydrates, although it has
recently been recognized that these domains can also be involved in
binding of proteins (Drickamer, (1988) J. Biol. Chem.
263:9557-9560; Drickamer, (1993) Prog. Nucl. Acid Res. Mol. Biol.
45:207-232; Drickamer, (1993) Curr. Opin. Struct. Biol. 3:393-400).
C-type lectins and their relevant properties are described in
greater in P.C.T. Publication No. WO 98/28332, which, as with all
references cited herein, is incorporated by reference.
[0232] A cDNA clone (designated jtmMa127f05) encoding at least a
portion of murine INTERCEPT 289 protein was also isolated. Murine
INTERCEPT 289 protein is a transmembrane protein. The properties of
murine INTERCEPT 289 are described below.
[0233] Murine INTERCEPT 289 protein includes a transmembrane domain
and a portion corresponding to an extra-membrane domain. In one
embodiment, the domain is extracellular; in an alternative
embodiments, this extra-membrane domain is a cytoplasmic domain.
The transmembrane domain corresponds to about amino acid residues 7
to 27 of SEQ ID NO: 163 (i.e., SEQ ID NO: 164), and the
extra-membrane portion corresponds to about amino acid residues 28
to 190 of SEQ ID NO: 163 (i.e., SEQ ID NO: 165).
[0234] Murine INTERCEPT 289 proteins typically comprise a variety
of potential post-translational modification sites and protein
domains (often positioned within a domain located at or near the
protein surface), such as those described herein in Table IVB, as
predicted by computerized sequence analysis of murine INTERCEPT 289
protein using amino acid sequence comparison software (comparing
the amino acid sequence of murine INTERCEPT 289 with the
information in the PROSITE database {rel. 12.2; February, 1995} and
the Hidden Markov Models database {Rel. PFAM 3.3}).
TABLE-US-00007 TABLE IVB Type of Amino Acid Amino Potential
Modification Residues Acid Site or Domain of SEQ ID NO: 163
Sequence N-glycosylation site 51 to 54 NVSQ 146 to 149 NNSV 153 to
156 NVTN Protein kinase C 180 to 182 SYR phosphorylation site
Casein kinase II 88 to 91 SFSE phosphorylation site 155 to 158 TNQD
N-myristoylation site 105 to 110 GSTLAI 152 to 157 GNVTNQ 167 to
172 GLTKTY Lectin C-type domain 99 to 185
[0235] In various embodiments, the protein of the invention has at
least 1, 2, 4, 6, 8, or more of the post-translational modification
sites and domains described in Table IVB.
[0236] INTERCEPT 289 proteins and cDNAs exhibit homology with human
myeloid DAP12 (DNAX accessory protein, 12 kilodalton) associated
lectin-1 (MDL-1), which is described in PCT Publication No. WO
99/06557, which is also incorporated herein by reference. In FIG.
8, the amino acid sequences of various forms of INTERCEPT 289
("A"-"F" and "R"; SEQ ID NOs: 83, 93, 98, 103, 108, 113, and 163,
respectively), human MDL-1 ("H"; SEQ ID NO: 86), and murine MDL-1
("M"; SEQ ID NO: 88) proteins are shown, as aligned using the
Wisconsin.TM. BestFit software (Smith and Waterman, (1981) Adv.
Appl. Math. 2:482-489; BLOSUM62 scoring matrix; gap opening penalty
10/gap extension penalty 10). Each of the seven forms of INTERCEPT
289 protein described herein has a lysine residue (i.e., at residue
116 of SEQ ID NOs: 83 and 93, at residue 93 of SEQ ID NOs: 98 and
103, at residue 73 of SEQ ID NOs: 108 and 113, and at residue 118
of SEQ ID NO: 163) that is not present in the described sequence
(SEQ ID NO: 86) of human MDL-1 protein.
[0237] In the alignment shown in FIG. 8, the amino acid sequence
(SEQ ID NO: 83) of form 1a of INTERCEPT 289 protein is 100%
identical to that of human MDL-1 over the 187-amino acid residue
overlapping region and about 72.7% identical to that of murine
MDL-1 in the 165-amino acid residue overlapping region.
[0238] In the alignment shown in FIG. 8, the amino acid sequence
(SEQ ID NO: 93) of form 1b of INTERCEPT 289 protein is about 85.9%
identical to that of human MDL-1 over the 177-amino acid residue
overlapping region and about 60.0% identical to that of murine
MDL-1 in the 155-amino acid residue overlapping region.
[0239] In the alignment shown in FIG. 8, the amino acid sequence
(SEQ ID NO: 98) of form 2a of INTERCEPT 289 protein is 100%
identical to that of human MDL-1 over the 164-amino acid residue
overlapping region and about 71.5% identical to that of murine
MDL-1 in the 165-amino acid residue overlapping region.
[0240] In the alignment shown in FIG. 8, the amino acid sequence
(SEQ ID NO: 103) of form 2b of INTERCEPT 289 protein is about 83.8%
identical to that of human MDL-1 over the 154-amino acid residue
overlapping region and about 58.7% identical to that of murine
MDL-1 in the 155-amino acid residue overlapping region.
[0241] In the alignment shown in FIG. 8, the amino acid sequence
(SEQ ID NO: 108) of form 3a of INTERCEPT 289 protein is about 83.3%
identical to that of human MDL-1 over the 144-amino acid residue
overlapping region and about 74.5% identical to that of murine
MDL-1 in the 145-amino acid residue overlapping region.
[0242] In the alignment shown in FIG. 8, the amino acid sequence
(SEQ ID NO: 113) of form 3b of INTERCEPT 289 protein is about 63.4%
identical to that of human MDL-1 over the 134-amino acid residue
overlapping region and about 60.0% identical to that of murine
MDL-1 in the 135-amino acid residue overlapping region.
[0243] In the alignment shown in FIG. 8, the amino acid sequence
(SEQ ID NO: 163) of murine INTERCEPT 289 protein is 100% identical
to that of murine MDL-1 over the 190-amino acid residue overlapping
region and about 85.7% identical to that of human MDL-1 in the
188-amino acid residue overlapping region.
[0244] In the alignment shown in FIG. 11A-B, the nucleotide
sequence (SEQ ID NO: 162) of the ORF of murine INTERCEPT 289 is
about 71.8% identical to that of the ORF of human INTERCEPT 289
form 1a.
[0245] MDL-1 is a cell surface protein which is expressed by
monocytes and macrophages and which binds with DAP12. DAP12 is a
cell surface protein which is expressed by natural killer cells,
peripheral blood granulocytes and monocytes, macrophages, and
dendritic cells. DAP12 is an immunoreceptor tyrosine-based
activation motif-containing protein which associates non-covalently
with activating isoforms of MHC class I receptors on natural killer
cells (Bakker et al., 1999, Proc. Natl. Acad. Sci. USA
96:9792-9796). Association of MDL-1 and DAP12 on the surface of
monocytes and macrophages and binding of associated MDL-1/DAP12
with a ligand thereof (e.g., a surface protein, glycoprotein, or
glycolipid on the surface of another cell of the same animal or on
the surface of a foreign cell) causes activation of those cells.
Upon activation, and depending on the type of the
monocyte/macrophage, the monocyte/macrophage generates an oxidative
burst, produces one or more cytokines, and other
leukocyte-modulating molecules, releases one or more cytokines
other leukocyte-modulating molecules, or some combination of these
activities. MDL-1 and, by analogy, INTERCEPT 289 are therefore
involved in modulation of immune function, including modulation of
antibody and cytotoxic T cell responses, expansion of immune cell
populations, inflammation, and generation of memory B cells.
[0246] The amino acid sequences (SEQ ID NOs: 83, 93, 98, 103, 108,
and 113) of the six forms of INTERCEPT 289 protein described herein
were aligned with the amino acid sequence of CD94 protein (GenBank
Accession No. 5542082) using the Wisconsin.TM. BestFit software
(Smith and Waterman, (1981) Adv. Appl. Math. 2:482-489; BLOSUM62
scoring matrix; gap opening penalty 10/gap extension penalty 10).
The amino acid sequence identity between CD94 protein and INTERCEPT
289 protein was 28.0% for form 1a in the 126-amino acid residue
overlapping region, 25.2% for form 1b in the 115-amino acid residue
overlapping region, 28.0% for form 2a in the 125-amino acid residue
overlapping region, 25.2% for form 2b in the 127-amino acid residue
overlapping region, 27.2% for form 3a in the 125-amino acid residue
overlapping region, and 24.3% for form 3b in the 115-amino acid
residue overlapping region. CD94 protein is a cell-surface protein
which has a C-type lectin domain in its carboxyl terminal portion
and which acts as a receptor for natural killer (NK) cells. CD94
modulates the cytotoxic activity of NK cells, as well as production
of cytokines by NK cells.
[0247] FIGS. 10A-10F depict hydrophobicity plots of the six forms
of human INTERCEPT 289 protein described herein. Form 1a
corresponds to FIG. 10A, and has the amino acid sequence SEQ ID NO:
83. Form 1b corresponds to FIG. 10B, and has the amino acid
sequence SEQ ID NO: 93. Form 2a corresponds to FIG. 10C, and has
the amino acid sequence SEQ ID NO: 98. Form 2b corresponds to FIG.
10D, and has the amino acid sequence SEQ ID NO: 103. Form 3a
corresponds to FIG. 10E, and has the amino acid sequence SEQ ID NO:
108. Form 3b corresponds to FIG. 10F, and has the amino acid
sequence SEQ ID NO: 113. Relatively hydrophobic regions are above
the dashed horizontal line, and relatively hydrophilic regions are
below the dashed horizontal line. As described elsewhere herein,
relatively hydrophilic regions are generally located at or near the
surface of a protein, and are more frequently effective immunogenic
epitopes than are relatively hydrophobic regions. FIG. 12 depicts a
hydrophobicity plot of the murine INTERCEPT 289 protein described
herein.
[0248] The predicted molecular weights of the six forms of human
INTERCEPT 289 protein described herein, without modification, is
about 21.5 kilodaltons for form 1a, about 20.4 kilodaltons for form
1b, about 19.1 kilodaltons for form 2a, about 18.0 kilodaltons for
form 2b, about 16.9 kilodaltons for form 3a, and about 15.8
kilodaltons for form 3b. The predicted molecular weight of murine
INTERCEPT 289, without modification is about 21.7 kilodaltons.
[0249] Expression of one or more forms of INTERCEPT 289 was
detected in cDNA libraries prepared using human tissue and cell
samples listed in Table V, wherein "+" indicates detectable
expression and "+/-" indicates weakly detectable expression.
TABLE-US-00008 TABLE V cDNA library Expression Promyelocytic
Leukemia Cells + Bone Marrow + D8 Dendritic Cells +/- Ovarian
Ascites +/- Aortic Endothelial Cells +/- Congestive Heart Failure
(left +/- ventricle)
[0250] Uses of INTERCEPT 289 Nucleic acids,
[0251] Polypeptides, and Modulators Thereof
[0252] INTERCEPT 289 proteins are involved in disorders which
affect both tissues in which they are normally expressed and
tissues in which they are normally not expressed. Based on the
observations that cDNA corresponding to INTERCEPT 289 occurs in a
human mixed lymphocyte reaction cDNA library, and that RNA
corresponding to INTERCEPT 289 is detectable by PCR amplification,
using primers which specifically amplify INTERCEPT 289 sequences,
of nucleic acids (e.g., mRNA or cDNA) obtained from human leukemia,
bone marrow, dendritic, ovarian ascitic, aortic endothelial, and
cardiac (e.g., left ventricle cells obtained from a heart afflicted
with congestive heart failure) cells, it is evident that INTERCEPT
289 protein can be involved in one or more biological processes
which occur in these cells and in tissues which contain them. In
particular, INTERCEPT 289 is involved in modulating growth,
proliferation, survival, differentiation, and activity of cells of
these cells and tissues (e.g., lymphocytes). Examples of disorders
of such cells and tissues include various cancers (e.g., leukemias,
lymphomas, and endothelial cancers such as ovarian cancers),
atherosclerosis, arteriosclerosis, coronary artery disease, immune
insufficiency disorders, immune hypersensitivity disorders, and
congestive heart failure disorders (e.g., myocardial infarction,
cardiomegaly, and cardiac valvular defects). INTERCEPT 289
proteins, nucleic acids encoding them, and agents that modulate
activity or expression of either of these can be used to
prognosticate, diagnose, and treat one or more of these
disorders.
[0253] Presence of a C-type lectin domain in INTERCEPT 289 is an
indication that this protein can specifically recognize particular
surfaces, such as the surface of cells of a particular type.
Further supportive of this observation is the fact that human
INTERCEPT 289 proteins exhibit significant sequence identity with
MDL-1 which, in cooperation with DAP12 protein associated
therewith, is capable of binding one or more ligands and activating
one or more types of macrophages and monocytes. Aberrant activation
of macrophages and monocytes is associated with a variety of
immunological disorders including, for example, inflammation,
asthma, hypersensitivity disorders (e.g., allergies), atopic
disorders (e.g., allergic rhinitis, allergic asthma, and atopic
dermatitis), anaphylaxis, urticaria (i.e., hives), auto-immune
disorders (e.g., rheumatoid and juvenile arthritis, rheumatism,
systemic lupus erythamatosus, Grave's disease, and multiple
sclerosis), graft and transplant rejection, leukemias (e.g., ALL,
CML, CLL, and myelodysplastic syndrome), blood dyscrasias (e.g.,
multiple myeloma), polycythemia vera, myelofibrosis, leukopenias,
lymphomas (e.g., Hodgkin's disease, non-Hodgkin's lymphoma,
Burkitt's lymphoma, and mycosis fungoides), bacterial, viral, and
parasitic infections (e.g., sepsis, influenza, common colds,
hepatitis, HIV infection, malaria, and gonorrhea), immune
insufficiency (e.g., AIDS), and immunodeficiency disorders.
INTERCEPT 289 proteins, nucleic acids encoding them, and agents
that modulate activity or expression of either of these can be used
to prognosticate, diagnose, and treat one or more of these
disorders.
INTERCEPT 309
[0254] A cDNA clone (designated jthYa038a01t1) encoding at least a
portion of human INTERCEPT 309 protein was isolated from a human
thyroid tissue cDNA library. Human INTERCEPT 309 protein is an
integral membrane protein having three transmembrane regions and a
fourth transmembrane region that can act as a signal sequence.
Human INTERCEPT 309 protein is a claudin-like protein.
[0255] The full length of the cDNA encoding human INTERCEPT 309
protein (SEQ ID NO: 121) is 1909 nucleotide residues. The ORF of
this cDNA, nucleotide residues 2 to 646 of SEQ ID NO: 121 (i.e.,
SEQ ID NO: 122), encodes an approximately 215-amino acid residue
integral membrane protein (SEQ ID NO: 123) having three
transmembrane regions in its mature (181-amino acid residue; SEQ ID
NO: 138) form.
[0256] The invention includes nucleic acid molecules which encode a
polypeptide of the invention. Such nucleic acids include, for
example, a DNA molecule having the nucleotide sequence listed in
SEQ ID NO: 121, such as the portion which encodes mature INTERCEPT
309 protein, immature INTERCEPT 309 protein, or a domain of
INTERCEPT 309 protein. These nucleic acids are collectively
referred to as nucleic acids of the invention.
[0257] INTERCEPT 309 proteins and nucleic acid molecules encoding
them comprise a family of molecules having certain conserved
structural and functional features.
[0258] A common domain present in INTERCEPT 309 proteins is a
signal sequence. In one embodiment, a INTERCEPT 309 protein
contains a signal sequence corresponding to about amino acid
residues 1 to 24 of SEQ ID NO: 123 (SEQ ID NO: 124). It is
recognized that the carboxyl terminal boundary of the signal
sequence can be located one or two residues from the residue
identified above (i.e., following residues 22, 23, 24, 25, or 26 of
SEQ ID NO: 123). The signal sequence is cleaved during processing
of the mature protein.
[0259] INTERCEPT 309 proteins include three transmembrane domains
and two pairs of extra-membrane domains that flank the cell
membrane. The three transmembrane domains correspond to about amino
acid residues 72 to 92, 108 to 131, and 154 to 178 of SEQ ID NO:
123 (i.e., the transmembrane domains having the sequences SEQ ID
NOs: 126, 128, and 130, respectively). One pair of extra-membrane
domains corresponds to about amino acid residues 25 to 71 and 132
to 153 of SEQ ID NO: 123 (these domains having the sequences SEQ ID
NOs: 125 and 129). The other pair of extra-membrane domains
corresponds to about amino acid residues 93 to 107 and 179 to 215
of SEQ ID NO: 123 (these domains having the sequences SEQ ID
NOs:127 and 131). In one embodiment, the first pair of
extra-membrane domains (i.e., those having the sequences SEQ ID
NOs: 125 and 129) are extracellular domains and the other pair of
domains are cytoplasmic domains. However, in an alternative form,
the first pair of extra-membrane domains are cytoplasmic and the
other pair are extracellular domains.
[0260] It is recognized that, in certain forms, INTERCEPT 309
proteins can have an additional number of amino acid residues at
their amino terminus. For example, the proteins can have from 1 to
about 30 amino acid residues, more commonly 1 to about 12, 1 to
about 10, or 1 to about 5 residues.
[0261] INTERCEPT 309 proteins typically comprise a variety of
potential post-translational modification sites and protein domains
(often positioned within an extracellular or protein surface
domain), such as those described herein in Table VI, as predicted
by computerized sequence analysis of INTERCEPT 309 proteins using
amino acid sequence comparison software (comparing the amino acid
sequence of INTERCEPT 309 with the information in the PROSITE
database {rel. 12.2; February, 1995} and the Hidden Markov Models
database {Rel. PFAM 3.3}).
TABLE-US-00009 TABLE VI Type of Potential Amino Modification Site
Amino Acid Residues Acid or Domain of SEQ ID NO: 123 Sequence
Protein kinase C 184 to 186 SYR phosphorylation site 191 to 193 SHR
195 to 197 TQK 201 to 203 TGK Tyrosine kinase 149 to 156 RELGEALY
phosphorylation site N-myristoylation site 7 to 12 GMVGTV 39 to 44
GLWMNC 72 to 77 GLMCAA 91 to 96 GMKCTR 169 to 174 GALFCC Amidation
site 201 to 204 TGKK
[0262] In various embodiments, the protein of the invention has at
least 1, 2, 4, 6, or all 11 of the post-translational modification
sites and domains described herein in Table VI.
[0263] FIG. 13 depicts a hydrophobicity plot of an embodiment of
human INTERCEPT 309 protein. Relatively hydrophobic regions are
above the dashed horizontal line, and relatively hydrophilic
regions are below the dashed horizontal line. The hydrophobic
regions which corresponds to about amino acid residues 72 to 92,
108 to 131, and 154 to 178 of SEQ ID NO: 123 are the transmembrane
domains of human INTERCEPT 309 described above. As described
elsewhere herein, relatively hydrophilic regions are generally
located at or near the surface of a protein, and are more
frequently effective immunogenic epitopes than are relatively
hydrophobic regions. For example, the region of human INTERCEPT 309
protein from about amino acid residue 90 to about amino acid
residue 100 appears to be located at or near the surface of the
protein, while the region from about amino acid residue 70 to about
amino acid residue 85 appears not to be located at or near the
surface.
[0264] The predicted molecular weight of human INTERCEPT 309
protein without modification and prior to cleavage of the signal
sequence is about 23.8 kilodaltons. The predicted molecular weight
of the mature human INTERCEPT 309 protein without modification and
after cleavage of the signal sequence is about 21.4
kilodaltons.
[0265] INTERCEPT 309 protein exhibits amino acid sequence homology
with murine claudin-8 protein, as indicated in the alignment (made
using the ALIGN software {Myers and Miller (1989) CABIOS, ver.
2.0}; pam120.mat scoring matrix; gap opening penalty=12, gap
extension penalty=4) of the amino acid sequences of INTERCEPT 309
(SEQ ID NO: 123) and murine claudin-8 (SEQ ID NO: 132) proteins
shown in FIG. 16. In this alignment, the two amino acid sequences
are about 80.0% identical. Furthermore, INTERCEPT 309 cDNA (SEQ ID
NO: 121) is about 83.1% identical to the nucleotide sequence of
cDNA encoding murine claudin-8 (SEQ ID NO: 133; GenBank accession
no. AF087826) over the 639-residue overlapping region, as indicated
in the alignment (made using the ALIGN software; pam120.mat scoring
matrix; gap opening penalty=12, gap extension penalty=4) shown in
FIGS. 15A-15G.
[0266] An alignment (made using the ALIGN software; pam120.mat
scoring matrix; gap opening penalty=12, gap extension penalty=4) of
the nucleotide sequences of a cDNA clone (SEQ ID NO: 134; GenBank
accession no. AL049977) obtained from human fetal brain tissue and
INTERCEPT 309 cDNA (SEQ ID NO: 121) is shown in FIGS. 14A-14G and
indicates 100% sequence identity between the sequences in the
overlapping portion. The overlapping portion does not overlap the
INTERCEPT 309 ORF, with the exception of nucleotide residues 1 and
28-32. It is recognized that `overlap` of the human fetal brain
cDNA clone sequence with these ORF residues is an artifact of the
ALIGN software, and does not represent meaningful homology between
residues 1 and 28-32 of the INTERCEPT 309 ORF and the corresponding
residues of the human fetal brain cDNA clone. Nonetheless,
isolation of this cDNA clone from fetal brain tissue is an
indication that INTERCEPT 309 protein is expressed in fetal brain
tissue.
[0267] An alignment (made using the LALIGN software {Huang and
Miller, 1991, Adv. Appl. Math. 12:373-381}; pam120 scoring matrix,
gap opening penalty=12, gap extension penalty=4) of the nucleotide
sequence of INTERCEPT 309 cDNA (SEQ ID NO: 121) with the nucleotide
sequence encoding murine latent transforming growth factor-beta
binding protein-3 (LTBP-3) indicated that the two sequences were
40.3% identical in a 1969-nucleotide residue overlapping portion.
As disclosed in P.C.T. Publication No. WO 95/22611, latent
transforming growth factor-beta binding protein 3 (LTBP-3) is a
secreted protein that is expressed in murine epithelial,
parenchymal, and stromal during embryonic development. LTBP-3 is
thought to exhibit one or more of four activities
[0268] i) modulating intracellular biosynthesis of latent
transforming growth factor-beta;
[0269] ii) binding latent transforming growth factor-beta with
extracellular matrix;
[0270] iii) modulating activation of latent transforming growth
factor-beta complexes; and
[0271] iv) targeting latent transforming growth factor-beta
complexes to the cell surface.
[0272] An alignment (made using the ALIGN software; pam120.mat
scoring matrix, gap opening penalty=12, gap extension penalty=4) of
the amino acid sequence of INTERCEPT 309 cDNA (SEQ ID NO: 123) with
the amino acid sequence of human peripheral myelin protein (PMP-22)
indicated that the two protein sequences are 17.2% identical.
PMP-22 is involved in myelination of peripheral nerves,
particularly during development.
[0273] Individual alignments (made using the Wisconsin.TM. BestFit
software; Smith and Waterman (1981) Adv. Appl. Math. 2:482-489;
blosum62 scoring matrix, gap opening penalty 10/gap extension
penalty 10) of the amino acid sequence (SEQ ID NO: 123) of
INTERCEPT 309 with the amino acid sequences of human (SEQ ID NO:
135; GenBank Accession No. 4502877) and murine (SEQ ID NO: 136;
GenBank Accession No. BAA22985) receptors of Clostridium
perfringens enterotoxin (CPE) and with the amino acid sequence (SEQ
ID NO: 137) encoded by rat ventral prostate tissue during androgen
withdrawal-induced tissue regression were manually aligned (by
inserting a `blank` at position 1 of the rRPV nucleotide sequence).
The manually aligned alignments are shown in FIG. 17. The amino
acid sequence of INTERCEPT 309 protein is about 43% identical to
the human CPE receptor amino acid sequence, about 45% identical to
the murine CPE receptor amino acid sequence, and about 43%
identical to the amino acid sequence encoded by the transcript
obtained from regressing rat ventral prostate tissue.
[0274] Expressed sequence tags (ESTs) which exhibit at least
limited nucleotide sequence identity with SEQ ID NO: 121 have been
isolated from human and murine liver, kidney, prostate, and colon
tissues.
[0275] Uses of INTERCEPT 309 Nucleic acids,
[0276] Polypeptides, and Modulators Thereof
[0277] INTERCEPT 309 proteins are involved in disorders which
affect both tissues in which they are normally expressed and
tissues in which they are normally not expressed. Based on the
observations that cDNA corresponding to INTERCEPT 309 occurs in
human thyroid and fetal brain cDNA libraries, and that ESTs have
been isolated from liver, kidney, prostate, and colon tissues, it
is evident that INTERCEPT 309 protein is involved in one or more
biological processes which occur in these tissues. In particular,
INTERCEPT 309 is involved in modulating growth, proliferation,
survival, differentiation, and activity (e.g., thyroid secretion
activity) of cells of these tissues. Thus, INTERCEPT 309 has a role
in disorders which affect the brain, thyroid, and other tissues and
one or more of growth, proliferation, survival, differentiation,
activity, morphology, and movement/migration of cells in those
tissues, as well as the biological function of organs (e.g., the
brain, liver, colon, prostate, kidneys, and thyroid) comprising
such tissues. Relevant disorders which involve these tissues are
discussed separately below.
[0278] As indicated by its similarity to murine claudin-8 (e.g., as
shown in FIG. 16), INTERCEPT 309 is a claudin-like protein, and can
exhibit one or more of the activities exhibited by murine claudin-8
and other claudins. Claudins are proteins that are involved in
formation, maintenance, and regulation of tight junctions, which
are intercellular junctions that occur between cells of tissues
(e.g., epithelia and endothelia) having selective permeability
(Morita et al. (1999) Proc. Natl. Acad. Sci. USA 96:511-516). Tight
junctions can be associated with actin fibrils, and claudins can
mediate interactions between actin fibrils and other components of
the tight junction. Tissues in which tight junctions occur between
adjacent cells can form sheets or other structures which exhibit
selective trans-tissue permeability and in which the membrane and
membrane-bound components of tissue-spanning cells can be
selectively localized to one side (e.g., apical or basolateral
side) of the tissue. By way of example, epithelial and endothelial
tissues of kidney, liver, lung, and thyroid form barriers which
permit transepithelial/transendothelial passage of certain
compounds and cells (e.g., secreted/excreted products and immune
system cells), but not others. Tight junction alterations have also
been associated with tumor differentiation, particularly in thyroid
tumors (Kerjaschki et al. (1979) Am. J. Pathol. 96:207-225;
Cochand-Priollet et al. (1998) Ultrastruct. Pathol. 22:413-420).
INTERCEPT 309 can have a role in each of these functions, both in
normal tissue and in aberrant tissue (e.g., tissue of a patient
afflicted with a disorder that affects the tissue).
[0279] An important feature of tight junctions is that the
permeability of a tissue comprising such intercellular junctions
can be regulated by cellular and other (e.g., endocrine) processes.
Thus, depending on the cellular or other influences exerted on the
components of the tight junction, the permeability of the tissue to
water, solutes (e.g., urea), proteins (e.g., hormones), and immune
cells (e.g., T cells and macrophages) can be regulated (Stevenson
(1999) J. Clin. Invest. 104:3-4). Regulation of transmembrane
permeability is critical to the function of many organs (e.g.,
kidney, colon, thyroid, liver, prostate, etc.). INTERCEPT 309,
being a claudin-like protein can regulate transmembrane
permeability in organs and tissues in which it is normally or
aberrantly expressed.
[0280] One or more transmembrane proteins associated with tight
junctions mediate transmembrane signal transduction which
regulates, inter alia, the permeability of the junction (Fanning et
al., (1999) J. Am. Soc. Nephrol. 10:1337-1345). For example,
inhibition of protein tyrosine phosphorylation (a common activity
associated with transmembrane signaling) has been associated with
aberrant thyroid epithelial cell junction formation (Yap et al.,
(1997) Endocrinology 138:2315-2324). INTERCEPT 309, being a
transmembrane protein associated with tight junctions and having a
potential tyrosine kinase phosphorylation site at residues 149-156
of SEQ ID NO: 123, can be involved in transmembrane transduction of
signals between the cell interior and the extracellular milieu,
including signal transduction associated with regulation of tight
junction function.
[0281] Claudins can also participate in cell-to-cell adhesive
processes that do not necessarily involve tight junction formation.
Examples of such mechanisms include binding between cells forming
the blood-brain barrier, adhesion of myelin to nerve fibers and to
itself, and binding between skin cells to form a barrier to the
passage of moisture and solutes to and from the environment.
Similarity between the amino acid sequences of INTERCEPT 309 and
PMP-22 is also indicative of a role of INTERCEPT 309 protein in
mediating adhesion between myelin-producing cells and nerve cells
(e.g., between Schwann cells and peripheral nerve cells). INTERCEPT
309 can therefore have a role in disorders (e.g., multiple
sclerosis) involving aberrant (including insufficient) myelination
or demyelination of nerve cells.
[0282] INTERCEPT 309, being a cell surface claudin-like protein,
can be a substrate for interaction of pathogens (e.g., bacteria,
toxins, and viruses) with host cells, and can mediate interaction
of pathogens with cells which express INTERCEPT 309. For example,
Morita et al. (supra) determined that a murine claudin is a
receptor for Clostridium perfringens enterotoxin (CPE). Similarity
between the amino acid sequences of murine claudin-8 and INTERCEPT
309 indicates that INTERCEPT 309 can act as a receptor for CPE.
Furthermore, amino acid sequence similarity between INTERCEPT 309
and other human and murine CPE receptors (e.g., GenBank Accession
Nos. 4502877 and BAA22985, as indicated in FIG. 17) is a further
indication that INTERCEPT 309 can mediate interaction of CPE with
cells upon which CPE acts. INTERCEPT 309 proteins, nucleic acids
encoding them, and agents that modulate activity or expression of
either of these can be used to prognosticate, diagnose, and treat
disorders mediated by C. perfringens. Such disorders include, by
way of example, gastrointestinal disorders (e.g., diarrhea,
gastroenteritis, and other disorders associated with food
poisoning, and certain types of pseudomembranous colitis),
disorders associated with wound healing (e.g., gangrene), and other
pathogenic infections (e.g., sepsis with or without intravascular
hemolysis). INTERCEPT 309 can, of course, also mediate interaction
of other pathogens with cells which express it.
[0283] Being a claudin-like protein, INTERCEPT 309 can be involved
in formation, maintenance, and regulation of structures (e.g.,
transmembrane protein complexes including INTERCEPT 309) that
regulate the permeability of cell membranes with regard to various
molecules and macromolecules. Regulation of trans-tissue (i.e.,
intercellular) diffusion of extracellular components (e.g., water,
solutes, and immune cells) and diffusion of membrane-bound and
integral membrane components from one side of a tissue (e.g., the
apical face of an epithelium) to the other (e.g., the basolateral
face of the same epithelium; i.e., paracellular diffusion) can be
modulated by INTERCEPT 309 proteins and nucleic acids and by small
molecules which interact with INTERCEPT 309 proteins and nucleic
acids encoding them. Actin is known to be associated with tight
junction components, and modifications to the actin cytoskeleton of
a cell can modulate tight junction-regulated intercellular and
paracellular diffusion. Thus, compositions which affect the
interaction between actin and INTERCEPT 309 protein can modulate
tight junction regulation of intercellular and paracellular
diffusion. In addition, agents which act directly on an INTERCEPT
309 protein or nucleic acid, without affecting the interaction
between the claudin and actin, can be used to modulate tight
junction regulation of intercellular and paracellular diffusion.
INTERCEPT 309 protein can also act as a receptor for C. perfringens
enterotoxin and for other pathogens, and INTERCEPT 309 proteins, as
described herein, can be used to modulate C. perfringens
enterotoxin binding and toxicity, as well as binding of other
pathogens with cells and tissues which express INTERCEPT 309.
[0284] The fact that cDNA encoding INTERCEPT 309 was isolated from
human thyroid and fetal brain cDNA libraries and the fact that
INTERCEPT 309 have been isolated from liver, kidney, prostate, and
colon tissues indicates that INTERCEPT 309 can have a role in
disorders of these tissues, particularly including those
characterized above. Examples of disorders in which INTERCEPT 309
can have a role are described in the following paragraphs a)-f),
which are organized, for convenience, by tissue type.
[0285] a) Examples of brain disorders in which INTERCEPT 309 can
have role include both CNS disorders, CNS-related disorders, focal
brain disorders, global-diffuse cerebral disorders, and other
neurological and cerebrovascular disorders. CNS disorders include,
but are not limited to cognitive and neurodegenerative disorders
such as Alzheimer's disease, senile dementia, Huntington's disease,
amyotrophic lateral sclerosis, and Parkinson's disease, as well as
Gilles de la Tourette's syndrome, autonomic function disorders such
as hypertension and sleep disorders (e.g., insomnia, hypersomnia,
parasomnia, and sleep apnea), neuropsychiatric disorders (e.g.,
schizophrenia, schizoaffective disorder, attention deficit
disorder, dysthymic disorder, major depressive disorder, mania, and
obsessive-compulsive disorder), psychoactive substance use
disorders, anxiety, panic disorder, and bipolar affective disorder
(e.g., severe bipolar affective disorder and bipolar affective
disorder with hypomania and major depression). CNS-related
disorders include disorders associated with developmental,
cognitive, and autonomic neural and neurological processes, such as
pain, appetite, long term memory, and short term memory. Examples
of focal brain disorders include aphasia, apraxia, agnosia, and
amnesias (e.g., posttraumatic amnesia, transient global amnesia,
and psychogenic amnesia). Global-diffuse cerebral disorders with
which INTERCEPT 309 is associated include coma, stupor,
obtundation, and disorders of the reticular formation.
Cerebrovascular disorders include ischemic syndromes (e.g.,
stroke), hypertensive encephalopathy, hemorrhagic disorders, and
disorders involving aberrant function of the blood-brain barrier
(e.g., CNS infections such as meningitis and encephalitis, aseptic
meningitis, metastasis of non-CNS tumor cells into the CNS, various
pain disorders such as migraine, and CNS-related adverse drug
reactions such as head pain, sleepiness, and confusion). INTERCEPT
309 proteins, nucleic acids encoding them, and agents that modulate
activity or expression of either of these can be used to
prognosticate, diagnose, and treat one or more of these
disorders.
[0286] b) Examples of thyroid disorders with which INTERCEPT 309
proteins and nucleic acids encoding them can be involved include
hyper- and hypothyroidism, goiter, thyroiditis, thyroid cancers
(e.g., adenomas and carcinomas), and autoimmune diseases involving
thyroid autoantigens such as thyroglobulin and thyroperoxidase.
INTERCEPT 309 proteins, nucleic acids encoding them, and agents
that modulate activity or expression of either of these can be used
to prognosticate, diagnose, and treat one or more of these
disorders.
[0287] c) Kidney disorders with which INTERCEPT 309 proteins and
nucleic acids encoding them can be involved include acute and
chronic renal failure, immunologically-mediated renal disorders
(i.e., involving both renal antigens and extra-renal antigens that
have become located within the kidneys), glomerular diseases such
as acute and progressive nephritic syndromes and nephrotic
syndromes, acute and chronic tubulointerstitial nephritis,
infections of the kidney, nephrotoxic disorders (i.e., including
those associated with antibiotics, analgesics, anti-cancer agents,
anti-epileptic agents, etc.), nephrogenic diabetes insipidus,
hereditary chronic nephropathies, urinary incontinence, urinary
calculus formation, kidney infections, and kidney neoplasms.
INTERCEPT 309 proteins, nucleic acids encoding them, and agents
that modulate activity or expression of either of these can be used
to prognosticate, diagnose, and treat one or more of these
disorders.
[0288] d) Examples of liver disorders in which INTERCEPT 309 can
have a role include the liver disorders described elsewhere in this
disclosure.
[0289] e) Prostate disorders with which INTERCEPT 309 proteins and
nucleic acids encoding them can be involved include the prostate
disorders described elsewhere in this disclosure.
[0290] f) Disorders of the colon in which INTERCEPT 309 can have a
role include, for example, diarrhea, constipation, gastroenteritis,
malabsorption syndromes such as celiac disease and tropical sprue,
inflammatory bowel diseases such as Crohn's disease and ulcerative
colitis, antibiotic-associated colitis, functional bowel disorders
such as irritable bowel syndrome and functional diarrhea,
congenital anomalies (e.g., megacolon and imperforate anus),
idiopathic disorders (e.g., diverticular disease such as
diverticulosis and diverticulitis and melanosis coli), vascular
lesions (e.g., ischemic colitis, hemorrhoids, angiodysplasia),
inflammatory diseases (e.g., idiopathic ulcerative colitis,
pseudomembranous colitis, and lymphopathia venereum), and colon
tumors (e.g., hyperplastic polyps, adenomatous polyps, bronchogenic
cancer, colonic carcinoma, squamous cell carcinoma,
adenoacanthomas, sarcomas, lymphomas, argentaffinomas, carcinoids,
and melanocarcinomas). INTERCEPT 309 proteins, nucleic acids
encoding them, and agents that modulate activity or expression of
either of these can be used to prognosticate, diagnose, and treat
one or more of these disorders.
[0291] INTERCEPT 309 (like claudins) regulates intercellular
permeability in tissues through which one may wish to modulate the
passage of drugs or other agents. Such tissues include, for
example, the blood-brain barrier (e.g., at the choroid plexus),
vascular endothelium, and liver epithelial tissues (i.e., other
than fenestrated hepatic vascular epithelia). By way of example,
one may wish either to enhance the permeability of a tissue with
respect to a drug (e.g., a drug for which enhanced blood-brain
barrier permeability is desired) or to reduce the permeability of a
tissue with respect to a drug (e.g., a drug for which reduction of
hepatic sequestration is desired). INTERCEPT 309 proteins and
nucleic acids, and other compounds which modulate the structure or
activity of INTERCEPT 309 proteins and nucleic acids, can be used
to regulate the permeability of such tissues.
[0292] In addition to its structural and functional similarity with
claudin proteins, INTERCEPT 309 protein is also similar in sequence
to at least one protein regulator of apoptosis. As shown in FIG.
17, the amino acid sequence of INTERCEPT 309 is similar to the
amino acid sequence of a protein (rRPV) which is expressed
specifically in regressing rat ventral prostate tissue and
epididymis. As described by Briehl et al. (1991, Mol. Endocrinol.
5:1381-1388), expression of this rat protein is elevated 3- to
8-fold in ventral prostate tissue upon induction of tissue
regression mediated by withdrawal of androgens. Androgen withdrawal
induces apoptosis in rat ventral prostate tissue. Thus, the rat
protein described by Briehl et al. (supra) is an
apoptosis-associated protein. INTERCEPT 309, having a sequence
similar to that of rRPV, can also modulate apoptosis in tissues in
which it is expressed.
[0293] Apoptosis is a process of controlled cell death that occurs
normally in many tissues in which cell division occurs essentially
continuously. Examples of such tissues include nearly all tissues
other than adult brain and cardiac muscle tissues, and particularly
include rapidly-growing and rapidly-replaced tissues such as
epithelial and endothelial tissues. Elimination of abnormal or
damaged cells from a tissue (other than adult brain or cardiac
muscle tissues) frequently occurs by apoptosis of the abnormal or
damaged cells, rather than by necrosis, which can lead to
inflammation. Apoptosis thus represents an important homeostatic
process in healthy individuals, and aberrance in normal apoptosis
can lead to occurrence of one or more disorders. INTERCEPT 309
(which, as described above is similar to the rat protein of Briehl
et al.) can also be associated with apoptosis. INTERCEPT 309 can
modulate apoptosis in tissues in which it is expressed, both under
normal (i.e., homeostatic, non-disorder-associated) conditions and
in tissue affected by a disorder associated with aberrant
apoptosis. Disorders associated with aberrant apoptosis include
both disorders in which apoptosis occurs to a supra-normal degree
(e.g., human immunodeficiency virus-mediated depletion of CD4+ T
cells) and disorders in which apoptosis is inhibited, relative to
normal levels (e.g., various cancers and viral infections
characterized by survival of virus-infected cells). Examples of
disorders associated with aberrant apoptosis include substantially
all cancers and viral infections, obesity, diabetes,
atherosclerosis, arteriosclerosis, coronary artery disease, and
angiogenesis. INTERCEPT 309 proteins, nucleic acids encoding them,
and agents that modulate activity or expression of either of these
can be used to prognosticate, diagnose, and treat one or more of
these disorders.
MANGO 419
[0294] A cDNA clone (designated cohqf013f05) encoding at least a
portion of human MANGO 419 protein was isolated from a human cDNA
library prepared from prostate carcinoma tissue which had
metastasized to liver. Human MANGO 419 protein is a secreted
protein.
[0295] The full length of the cDNA encoding human MANGO 419 protein
(SEQ ID NO: 141) is 323 nucleotide residues. The ORF of this cDNA,
nucleotide residues 84 to 323 of SEQ ID NO: 141 (i.e., SEQ ID NO:
142), encodes an 80-amino acid residue (or longer) protein (SEQ ID
NO: 143), corresponding to a 56-residue (or longer) secreted mature
protein.
[0296] The invention thus includes purified human MANGO 419
protein, both in the form of the immature 80 amino acid residue
protein (SEQ ID NO: 143) and in the form of the mature 56 amino
acid residue protein (SEQ ID NO: 145). Mature human MANGO 419
proteins can be synthesized without the signal sequence polypeptide
at the amino terminus thereof, or they can be synthesized by
generating immature MANGO 419 protein and cleaving the signal
sequence therefrom.
[0297] MANGO 419 protein can have one or more amino acid residues
attached at the carboxyl terminal end thereof. By way of example,
there can be from 1 to about 500, 1 to 100, 1 to 50, 1 to 30, 1 to
20, or 1 to 10 additional amino acid residues.
[0298] The invention includes nucleic acid molecules which encode a
polypeptide of the invention. Such nucleic acids include, for
example, a DNA molecule having the nucleotide sequence listed in
SEQ ID NO: 141, such as the portion which encodes mature MANGO 419
protein, immature MANGO 419 protein, or a domain of MANGO 419
protein. These nucleic acids are collectively referred to as
nucleic acids of the invention.
[0299] MANGO 419 proteins and nucleic acid molecules encoding them
comprise a family of molecules having certain conserved structural
and functional features.
[0300] A common domain present in MANGO 419 proteins is a signal
sequence. In one embodiment, a MANGO 419 protein contains a signal
sequence corresponding to the portion of the protein from amino
acid residue 1 to about amino acid residue 24 of SEQ ID NO: 143
(SEQ ID NO: 144). It is recognized that the carboxyl terminal
boundary of the signal sequence can be located one or two residues
from the residue identified above (i.e., following residues 22, 23,
24, 25, or 26 of SEQ ID NO: 143). The signal sequence is cleaved
during processing of the mature protein.
[0301] MANGO 419 proteins typically comprise a variety of potential
post-translational modification sites and protein domains (often
positioned within an extracellular or protein surface domain), such
as those described herein in Table VII, as predicted by
computerized sequence analysis of MANGO 419 proteins using amino
acid sequence comparison software (comparing the amino acid
sequence of MANGO 419 with the information in the PROSITE database
{rel. 12.2; February, 1995} and the Hidden Markov Models database
{Rel. PFAM 3.3}).
TABLE-US-00010 TABLE VII Type of Potential Amino Acid Modification
Site Residues Amino Acid or Domain of SEQ ID NO: 143 Sequence
Casein kinase II 31 to 34 TFGE phosphorylation site 55 to 58 SSDD
N-myristoylation site 43 to 48 GCRRCC
[0302] In various embodiments, the protein of the invention has at
least 1, 2, or all 3 of the post-translational modification sites
and domains described herein in Table VII.
[0303] The signal peptide prediction program SIGNALP (Nielsen et
al. (1997) Protein Engineering 10:1-6) predicted that human MANGO
419 protein includes an approximately 24 amino acid residue signal
peptide (amino acid residues 1 to about 24 of SEQ ID NO: 143; SEQ
ID NO: 144) preceding the mature MANGO 419 protein (amino acid
residues 25 to 80 of SEQ ID NO: 143; SEQ ID NO: 145).
[0304] FIG. 18 depicts a hydrophobicity plot of human MANGO 419
protein. Relatively hydrophobic regions are above the dashed
horizontal line, and relatively hydrophilic regions are below the
dashed horizontal line. The hydrophobic region which corresponds to
amino acid residues 1 to about 24 of SEQ ID NO: 143 is the signal
sequence of human MANGO 419 (SEQ ID NO: 144). As described
elsewhere herein, relatively hydrophilic regions are generally
located at or near the surface of a protein, and are more
frequently effective immunogenic epitopes than are relatively
hydrophobic regions. For example, the region of human MANGO 419
protein from about amino acid residue 35 to about amino acid
residue 55 appears to be located at or near the surface of the
protein, while the region from about amino acid residue 60 to about
amino acid residue 65 appears not to be located at or near the
surface.
[0305] The predicted molecular weight of human MANGO 419 protein
without modification and prior to cleavage of the signal sequence
is about 8.8 kilodaltons. The predicted molecular weight of the
mature human MANGO 419 protein without modification and after
cleavage of the signal sequence is about 6.2 kilodaltons.
[0306] Expressed sequence tags (ESTs) which exhibit homology with
SEQ ID NO: 141 have been isolated from murine mammary and embryonic
tissues. Those ESTs have sequences that are similar to the sequence
of a nucleic acid encoding an inner ear-specific collagen
precursor.
[0307] Uses of MANGO 419 Nucleic acids,
[0308] Polypeptides, and Modulators Thereof
[0309] MANGO 419 proteins are involved in disorders which affect
both tissues in which they are normally expressed and tissues in
which they are normally not expressed. Based on the observations
that cDNA corresponding to MANGO 419 occurs in a human metastatic
prostate carcinoma cDNA library, and that ESTs obtained from
mammary and embryonic tissues exhibit homology with MANGO 419 cDNA,
it is evident that MANGO 419 protein can be involved in one or more
biological processes which occur in these tissues. In particular,
MANGO 419 can be involved in modulating growth, proliferation,
survival, differentiation, and activity of cells of these tissues
(e.g., mammary, prostate, and other epithelial and endothelial
cells). MANGO 419 can have a role in disorders which affect
epithelial and endothelial tissues including, for example,
prostate, breast, and embryonic tissues. MANGO 419 proteins,
nucleic acids encoding them, and small molecules which interact
with either of these can be used to prognosticate, diagnose, and
treat disorders of epithelial and endothelial tissues, particularly
including carcinogenesis and metastasis of epithelial and
endothelial neoplasms, such as prostate and mammary cancers.
[0310] Recovery of a cDNA encoding MANGO 419 from a library
prepared using metastatic prostate carcinoma cells also indicates
that MANGO 419 can affect the ability and propensity of a cell to
adhere with other cells or with extracellular surfaces, and that
MANGO 419 can affect the ability of cells which express it to move
through other tissues and through extracellular matrix.
Furthermore, the fact that MANGO 419 is a secreted protein
indicates that it can be used (e.g., by detecting it in a body
fluid) as a marker for the metastatic state of cancers,
particularly including epithelial carcinomas.
[0311] Expression of MANGO 419 protein in epithelial tissues such
as prostate and mammary tissues is an indication that MANGO 419
protein and nucleic acids which encode them can be involved in
disorders of epithelial and endothelial tissues. Examples of
disorders of epithelial and endothelial tissues include cell
binding, adhesion, and proliferation disorders and
epithelial/endothelial permeability-related disorders. MANGO 419
protein is involved in disorders associated with aberrant binding
or adhesion of cells with other cells, with extracellular matrix,
or with foreign materials. Disorders involving aberrant binding or
adhesion of cells with other cells include both disorders in which
cells normally bind with one another (e.g., metastasis of a
cancerous cells away from a solid tissue site at which they
normally occur or immune hypersensitivity) and disorders in which
the cells do not normally bind with one another, but do bind with
one another in individuals afflicted with the disorder (e.g.,
autoimmune disorders, infections, wherein cells with which T cells
bind are not normally present in the animal, or disorders
associated with abnormal blood coagulation). Disorders involving
aberrant binding or adhesion of cells with extracellular matrix
include those (e.g., metastasis of a normally solid tumor tissue
away from it site of origin) in which the cells normally do, but
aberrantly do not, bind with extracellular matrix as well as those
(e.g., metastasis of tumor cells into a tissue in which the cells
do not normally occur, autoimmune disorders, liver fibrosis,
abnormal blood coagulation, atherosclerosis, and arteriosclerosis)
in which the cells normally do not bind with extracellular matrix,
but aberrantly do. Examples of disorders involving aberrant binding
or adhesion of cells with foreign materials include those (e.g.,
allergies and hypersensitivity disorders such as latex
hypersensitivity) associated with aberrant binding with the foreign
material and disorders in which the cells normally bind with the
foreign material, but aberrantly do not. MANGO 419 proteins,
nucleic acids encoding them, and agents that modulate activity or
expression of either of these can be used to prognosticate,
diagnose, and treat one or more of these disorders.
[0312] Expression of MANGO 419 protein in epithelial tissues such
as prostate and mammary tissues is an indication that MANGO 419
proteins and nucleic acids can be involved in disorders associated
with aberrant permeability of epithelial tissues (i.e., aberrant
permeability with regard to water, solutes, proteins, immune cells,
and pathogens). Such disorders include, by way of example, kidney
disorders, liver disorders, gastrointestinal disorders, endocrine
and exocrine disorders, prostate disorders, gynecological
disorders, skin disorders, and brain disorders. Examples of
disorders of these types are described separately, for convenience,
in the following paragraphs a)-h).
[0313] a) Kidney disorders with which MANGO 419 proteins and
nucleic acids encoding them can be involved include the kidney
disorders described elsewhere in this disclosure. MANGO 419
proteins, nucleic acids encoding them, and agents that modulate
activity or expression of either of these can be used to
prognosticate, diagnose, and treat one or more of these
disorders.
[0314] b) Examples of liver disorders in which MANGO 419 can have a
role include the liver disorders described elsewhere in this
disclosure. MANGO 419 proteins, nucleic acids encoding them, and
agents that modulate activity or expression of either of these can
be used to prognosticate, diagnose, and treat one or more of these
disorders.
[0315] c) Disorders of the gastrointestinal tract in which MANGO
419 can have a role include, for example, gastroesophageal reflux
disease, gastric ulcers, gastritis, appendicitis, peritonitis,
diarrhea, constipation, gastroenteritis, malabsorption syndromes
such as celiac disease and tropical sprue, inflammatory bowel
diseases such as Crohn's disease and ulcerative colitis,
antibiotic-associated colitis, functional bowel disorders such as
irritable bowel syndrome and functional diarrhea, diverticular
diseases such as diverticulosis and diverticulitis, and benign and
malignant neoplasms of the colon. MANGO 419 proteins, nucleic acids
encoding them, and agents that modulate activity or expression of
either of these can be used to prognosticate, diagnose, and treat
one or more of these disorders.
[0316] d) Examples of endocrine and exocrine disorders with which
MANGO 419 proteins and nucleic acids encoding them can be involved
include diabetes mellitus, hypoglycemia, glucagon disorders,
pituitary disorders such as diabetes insipidus, thyroid disorders
such as hyper- and hypothyroidism, adrenal disorders such as
Cushing's syndrome and hyperaldosteronism, multiple endocrine
neoplasias, polyglandular deficiency syndromes, epithelial breast
cancers, biliary calculi, cholecystitis, and neoplasms of the bile
ducts, chronic and acute renal failure, immunologically mediated
renal diseases, glomerular diseases such as acute neprhitic
syndrome and nephrotic syndrome, tubulointerstitial diseases,
nephrotoxic disorders, and infections of the kidney, goiter,
thyroiditis, thyroid cancers, and autoimmune diseases involving
endocrine (e.g., thyroid) autoantigens. MANGO 419 proteins, nucleic
acids encoding them, and agents that modulate activity or
expression of either of these can be used to prognosticate,
diagnose, and treat one or more of these disorders.
[0317] e) Prostate disorders with which MANGO 419 proteins and
nucleic acids encoding them can be involved include prostate
neoplasms, benign prostatic hyperplasia, and benign prostatic
hypertrophy. MANGO 419 proteins, nucleic acids encoding them, and
agents that modulate activity or expression of either of these can
be used to prognosticate, diagnose, and treat one or more of these
disorders.
[0318] f) Gynecological disorders in which MANGO 419 can have a
role include ovarian, cervical, vulvar, and vaginal cancers,
infertility, and endometriosis. MANGO 419 proteins, nucleic acids
encoding them, and agents that modulate activity or expression of
either of these can be used to prognosticate, diagnose, and treat
one or more of these disorders.
[0319] g) Skin disorders with which MANGO 419 can be associated
include psoriasis, infections, wounds (and healing of wounds),
inflammation, dermatitis, acne, and benign and malignant
dermatological tumors. MANGO 419 proteins, nucleic acids encoding
them, and agents that modulate activity or expression of either of
these can be used to prognosticate, diagnose, and treat one or more
of these disorders.
[0320] h) Examples of brain disorders in which MANGO 419 can have a
role include the brain disorders described elsewhere in this
disclosure. MANGO 419 proteins, nucleic acids encoding them, and
agents that modulate activity or expression of either of these can
be used to prognosticate, diagnose, and treat one or more of these
disorders.
INTERCEPT 429
[0321] A cDNA clone (designated jchrd012h06) encoding at least a
portion of human INTERCEPT 429 protein was isolated from a human
heart cDNA library. Human INTERCEPT 429 protein is a transmembrane
protein.
[0322] The full length of the cDNA encoding human INTERCEPT 429
protein (SEQ ID NO: 151) is 546 nucleotide residues. The ORF of
this cDNA, nucleotide residues 95 to 439 of SEQ ID NO: 151 (i.e.,
SEQ ID NO: 152), encodes a 115-amino acid residue protein (SEQ ID
NO: 153), corresponding to a 93-residue transmembrane mature
protein.
[0323] The invention includes purified human INTERCEPT 429 protein,
both in the form of the immature 115 amino acid residue protein
(SEQ ID NO: 153) and in the form of the mature 93 amino acid
residue protein (SEQ ID NO: 155). Mature human INTERCEPT 429
proteins can be synthesized without the signal sequence polypeptide
at the amino terminus thereof, or they can be synthesized by
generating immature INTERCEPT 429 protein and cleaving the signal
sequence therefrom.
[0324] The invention includes nucleic acid molecules which encode a
polypeptide of the invention. Such nucleic acids include, for
example, a DNA molecule having the nucleotide sequence listed in
SEQ ID NO: 151, such as the portion which encodes mature INTERCEPT
429 protein, immature INTERCEPT 429 protein, or a domain of
INTERCEPT 429 protein. These nucleic acids are collectively
referred to as nucleic acids of the invention.
[0325] INTERCEPT 429 proteins and nucleic acid molecules encoding
them comprise a family of molecules having certain conserved
structural and functional features.
[0326] A common domain present in INTERCEPT 429 proteins is a
signal sequence. In one embodiment, an INTERCEPT 429 protein
contains a signal sequence corresponding to the portion of the
protein from amino acid residue 1 to about amino acid residue 22 of
SEQ ID NO: 153 (SEQ ID NO: 154). It is recognized that the carboxyl
terminal boundary of the signal sequence can be located one or two
residues from the residue identified above (i.e., following
residues 20, 21, 22, 23, or 24 of SEQ ID NO: 153). The signal
sequence is cleaved during processing of the mature protein.
[0327] INTERCEPT 429 proteins include two transmembrane domains, a
pair of extra-membrane domains that flank the cell membrane on the
same side of the membrane, and another extra-membrane domain that
flanks the cell membrane on the opposite side of the membrane. The
two transmembrane domains correspond to about amino acid residues
32 to 49 and 59 to 82 of SEQ ID NO: 153 (i.e., the transmembrane
domains having the sequences SEQ ID NOs:157 and 159). The pair of
extra-membrane domains corresponds to about amino acid residues 23
to 31 and 83 to 115 of SEQ ID NO: 153 (these domains having the
sequences SEQ ID NOs: 156 and 160). The other extra-membrane domain
corresponds to about amino acid residues 50 to 58 of SEQ ID NO: 153
(this domain having the sequence SEQ ID NO: 158). In one
embodiment, the pair of extra-membrane domains (i.e., those having
the sequences SEQ ID NOs: 156 and 160) are intracellular domains
and the other domain is an extracellular domain. However, in an
alternative form, the pair of extra-membrane domains are
extracellular and the other domain is cytoplasmic.
[0328] INTERCEPT 429 proteins typically comprise a variety of
potential post-translational modification sites and protein domains
(often positioned within an extracellular or protein surface
domain), such as those described herein in Table VIII, as predicted
by computerized sequence analysis of INTERCEPT 429 proteins using
amino acid sequence comparison software (comparing the amino acid
sequence of INTERCEPT 429 with the information in the PROSITE
database {rel. 12.2; February, 1995} and the Hidden Markov Models
database {Rel. PFAM 3.3}).
TABLE-US-00011 TABLE VIII Type of Potential Amino Acid Modification
Site Residues Amino Acid or Domain of SEQ ID NO: 153 Sequence
N-glycosylation site 88 to 91 NRSA Casein kinase II 93 to 96 TKCD
phosphorylation site
[0329] In various embodiments, the protein of the invention has one
or both of the post-translational modification sites and domains
described herein in Table VIII.
[0330] FIG. 19 depicts a hydrophobicity plot of human INTERCEPT 429
protein. Relatively hydrophobic regions are above the dashed
horizontal line, and relatively hydrophilic regions are below the
dashed horizontal line. The hydrophobic region which corresponds to
amino acid residues 1 to 22 of SEQ ID NO: 153 is the signal
sequence of human INTERCEPT 429 (SEQ ID NO: 154). As described
elsewhere herein, relatively hydrophilic regions are generally
located at or near the surface of a protein, and are more
frequently effective immunogenic epitopes than are relatively
hydrophobic regions. For example, the region of human INTERCEPT 429
protein from about amino acid residue 85 to about amino acid
residue 100 appears to be located at or near the surface of the
protein.
[0331] The predicted molecular weight of human INTERCEPT 429
protein without modification and prior to cleavage of the signal
sequence is about 13.4 kilodaltons. The predicted molecular weight
of the mature human INTERCEPT 429 protein without modification and
after cleavage of the signal sequence is about 10.8
kilodaltons.
[0332] Expressed sequence tags (ESTs) which exhibit homology with
SEQ ID NO: 151 have been isolated from murine small intestine
tissue and from pooled human fetal lung, testis, and B cell
tissues.
[0333] Uses of INTERCEPT 429 Nucleic acids,
[0334] Polypeptides, and Modulators Thereof
[0335] INTERCEPT 429 proteins are involved in disorders which
affect both tissues in which they are normally expressed and
tissues in which they are normally not expressed. Based on the
observations that cDNA corresponding to INTERCEPT 429 occurs in a
human heart cDNA library, and that ESTs obtained from small
intestine and one or more of fetal lung, testis, and B cell tissues
exhibit homology with MANGO 419 cDNA, it is evident that INTERCEPT
429 protein can be involved in one or more biological processes
which occur in these tissues. In particular, INTERCEPT 429 is
involved in modulating growth, proliferation, survival,
differentiation, and activity of cells of these tissues (e.g.,
cardiac muscle cells), both in normal (i.e., non-diseased) tissues
and in tissues which are affected by one or more disorders.
Examples of disorders with which INTERCEPT 429 protein can be
associated are described in the following paragraphs.
[0336] Heart disorders with one or more of which INTERCEPT 429
proteins and nucleic acids can be involved include the
cardiovascular disorders described elsewhere in this disclosure.
INTERCEPT 429 proteins, nucleic acids encoding them, and agents
that modulate activity or expression of either of these can be used
to prognosticate, diagnose, and treat one or more of these
disorders.
[0337] Muscular disorders in which INTERCEPT 429 proteins and
nucleic acids can have a role include muscular dystrophies,
myotonic myopathies, glycogen storage disorders and familial
periodic paralysis. INTERCEPT 429 proteins, nucleic acids encoding
them, and agents that modulate activity or expression of either of
these can be used to prognosticate, diagnose, and treat one or more
of these disorders.
[0338] Lung disorders with which INTERCEPT 429 proteins and nucleic
acids can be associated include, by way of example, asthma, chronic
and acute bronchitis, chronic airway obstructive disorders,
pulmonary embolism, pneumonia, and genesis and metastasis of lung
tumors. INTERCEPT 429 proteins, nucleic acids encoding them, and
agents that modulate activity or expression of either of these can
be used to prognosticate, diagnose, and treat one or more of these
disorders.
[0339] Testicular disorders which can involve INTERCEPT 429
proteins and nucleic acids include, for example,
epididymo-orchitis, mumps orchitis, and genesis and metastasis of
testicular cancers. INTERCEPT 429 proteins, nucleic acids encoding
them, and agents that modulate activity or expression of either of
these can be used to prognosticate, diagnose, and treat one or more
of these disorders.
[0340] B cell disorders in which INTERCEPT 429 proteins and nucleic
acids can be involved include leukemias, lymphomas, leukopenias,
plasma cell dyscrasias, and splenomegaly. INTERCEPT 429 proteins,
nucleic acids encoding them, and agents that modulate activity or
expression of either of these can be used to prognosticate,
diagnose, and treat one or more of these disorders.
TANGO 210
[0341] A cDNA clone (designated jthke034a06) encoding at least a
portion of human TANGO 210 protein was isolated from a human fetal
skin cDNA library. A corresponding murine cDNA clone (designated
jtmMa065g07) was isolated from a long term bone marrow cDNA
library. The `long term` bone marrow cDNA library was made by
reverse transcription of mRNA obtained from bone marrow cells which
were cultured for a period (generally two weeks) prior to
stimulating the cells using yeast hyphae and thereafter obtaining
mRNA from the cells. Human TANGO 210 protein is predicted by
structural analysis to be a secreted protein although, in an
alternative form, human TANGO 210 protein has a transmembrane
region located near its carboxyl terminal end. Murine TANGO 210
protein is a secreted protein.
[0342] The full length of the cDNA encoding human TANGO 210 protein
(SEQ ID NO: 171) is 1684 nucleotide residues. The open reading
frame (ORF) of this cDNA, nucleotide residues 45 to 1583 of SEQ ID
NO: 171 (i.e., SEQ ID NO: 172), encodes a 513-amino acid residue
protein (SEQ ID NO: 173), corresponding to a 496-residue secreted
protein.
[0343] The invention thus includes purified human TANGO 210
protein, both in the form of the immature 513 amino acid residue
protein (SEQ ID NO: 173) and in the form of the mature 496 amino
acid residue protein (SEQ ID NO: 175). Mature human TANGO 210
protein can be in its secreted or membrane-bound form, as described
below. The invention also includes purified murine TANGO 210
protein, both in the form of the immature 511-amino acid residue
protein (SEQ ID NO: 183) and in the form of the mature 494-amino
acid residue protein (SEQ ID NO: 185). Mature human or murine TANGO
210 proteins can be synthesized without the signal sequence
polypeptide at the amino terminus thereof, or they can be
synthesized by generating immature TANGO 210 protein and cleaving
the signal sequence therefrom.
[0344] The invention includes nucleic acid molecules which encode a
polypeptide of the invention. Such nucleic acids include, for
example, a DNA molecule having the nucleotide sequence listed in
SEQ ID NO: 171 or some portion thereof or SEQ ID NO: 181 or some
portion thereof, such as the portion which encodes mature human or
murine TANGO 210 protein, immature human or murine TANGO 210
protein, or a domain of human or murine TANGO 210 protein. These
nucleic acids are collectively referred to as nucleic acids of the
invention.
[0345] TANGO 210 proteins and nucleic acid molecules encoding them
comprise a family of molecules having certain conserved structural
and functional features.
[0346] A common domain present in TANGO 210 proteins is a signal
sequence. In one embodiment, a TANGO 210 protein contains a signal
sequence corresponding to the portion of the protein from amino
acid residue 1 to about amino acid residue 17 of SEQ ID NO: 173
(SEQ ID NO: 174) or to the portion of the protein from amino acid
residue 1 to about amino acid residue 17 of SEQ ID NO: 183 (SEQ ID
NO: 184). It is recognized that the carboxyl terminal boundary of
the signal sequence can be located one or two residues from the
residue identified above (i.e., at residue 15, 16, 17, 18, or 19 of
SEQ ID NO: 173 or at residue 15, 16, 17, 18, or 19 of SEQ ID NO:
183). The signal sequence is cleaved during processing of the
mature protein.
[0347] TANGO 210 proteins can also include an extracellular domain.
Murine TANGO 210 protein is secreted. However, in one alternative
form, the human TANGO 210 protein is a transmembrane protein having
an extracellular domain located from about amino acid residue 25 to
amino acid residue 488 of SEQ ID NO: 173 (i.e., SEQ ID NO: 178). In
this alternative form, human TANGO 210 protein also has a
transmembrane region (i.e., about amino acid residues 489 to 506 of
SEQ ID NO: 173; SEQ ID NO: 179) and an intracellular domain (i.e.,
about amino acid residues 507 to 513 of SEQ ID NO: 173; SEQ ID NO:
180). In another alternative form, human TANGO 210 protein has an
intracellular domain located from about amino acid residue 25 to
amino acid residue 488 of SEQ ID NO: 173 (i.e., SEQ ID NO: 178), a
transmembrane region (i.e., about amino acid residues 489 to 506 of
SEQ ID NO: 173; SEQ ID NO: 179), and an extracellular domain (i.e.,
about amino acid residues 507 to 513 of SEQ ID NO: 173; SEQ ID NO:
180).
[0348] TANGO 210 proteins typically comprise a variety of potential
post-translational modification sites (often within an
extracellular domain), domains, or both, such as those described
herein in Tables IX (for human TANGO 210) and X (for murine TANGO
210), as predicted by computerized sequence analysis of TANGO 210
proteins using amino acid sequence comparison software (comparing
the amino acid sequence of TANGO 210 with the information in the
PROSITE database {rel. 12.2; February, 1995} and the Hidden Markov
Models database {Rel. PFAM 3.3}).
TABLE-US-00012 TABLE IX Type of Potential Amino Acid Amino
Modification Site Residues of Acid or Domain SEQ ID NO: 173
Sequence N-glycosylation site 55 to 58 NRSL 110 to 113 NLTY 200 to
203 NWTK 452 to 455 NITR 470 to 473 NSSF 508 to 511 NTSI Protein
kinase C 75 to 77 TGK phosphorylation site 88 to 90 TPR 112 to 114
TYR 290 to 292 TFR 384 to 386 TTR 422 to 424 SIR Casein kinase II
24 to 27 TENE phosphorylation site 57 to 60 SLID 193 to 196 THFD
249 to 252 SQDD 311 to 314 TDVE N-myristoylation site 71 to 76
GLTVTG 205 to 210 GAGFNL 223 to 228 GLSHSN Hemopexin domain
signature 318 to 333 Hemopexin domain 285 to 327 329 to 371 376 to
423 425 to 465 Peptidase_M10 domain 36 to 202 Neutral zinc 213 to
222 metallopeptidase zinc- binding domain signature Matrix
metalloprotease 89 to 96 PRCGVPDV cysteine switch
TABLE-US-00013 TABLE X Type of Potential Amino Acid Amino
Modification Site Residues of Acid or Domain SEQ ID NO: 183
Sequence N-glycosylation site 55 to 58 NRSL 453 to 456 NITQ 471 to
474 NASF 475 to 478 NVSV cAMP- or cGMP- 107 to 110 RKYS dependent
protein 493 to 496 KRLS kinase phosphorylation site Protein kinase
C 75 to 77 TGK phosphorylation site 112 to 114 TYR 268 to 270 TTK
291 to 293 TFR 336 to 338 SPR 386 to 388 TRK 477 to 479 SVK Casein
kinase II 57 to 60 SLFD phosphorylation site 123 to 126 TPAD 193 to
196 THFD 250 to 253 SQDD 336 to 339 SPRD N-myristoylation site 71
to 76 GLTVTG 86 to 191 GLGLGG 224 to 229 GLSHSN Hemopexin domain
signature 319 to 334 Hemopexin domain 286 to 328 330 to 372 377 to
424 426 to 466 Zinc-binding 36 to 202 metallopeptidase_M10 domain
Neutral zinc 214 to 223 metallopeptidase zinc- binding domain
signature Matrix metalloproteinase 89 to 96 PRCGVPDV cysteine
switch
[0349] In various embodiments, the protein of the invention has at
least 1, 2, 4, 6, 10, 15, or 20 or more of the post-translational
modification sites described herein in Tables IX and X.
[0350] Examples of additional domains present in human and murine
TANGO 210 protein include hemopexin domains and peptidase_M10
domains and signature sequences corresponding to hemopexin domains,
zinc-binding domains, and matrix metalloproteinase (MMP) cysteine
switches. In one embodiment, the protein of the invention has at
least one domain or signature sequence that is at least 55%,
preferably at least about 65%, more preferably at least about 75%,
yet more preferably at least about 85%, and most preferably at
least about 95% identical to one of the domains and signature
sequences described herein in Tables IX and X. Preferably, the
protein of the invention has at least one hemopexin domain, one
peptidase_M10 domain, one hemopexin domain signature sequence, one
zinc-binding domain signature sequence, and one MMP cysteine switch
signature sequence.
[0351] Hemopexin domains derive their name from a portion of a
protein designated hemopexin. Hemopexin is a serum glycoprotein
that binds with heme and transports it to the liver. Hemopexin
domains facilitate binding of the protein comprising the domain
with a variety of molecules and other proteins. Besides hemopexin,
hemopexin domains occur in MMPs and in vitronectin, a cell adhesion
and factor (Hunt et al. (1987) Prot. Seq. Data Anal. 1:21-26;
Stanley (1986) FEBS Lett. 199:249-253. A consensus hemopexin domain
signature sequence has been identified (Pfam Accession PDOC00023),
which has the structure
TABLE-US-00014 (SEQ ID NO: 451) (L, I, A, or T)-X.sub.3-W-X.sub.(2
or 3)-(P or E)-X.sub.2-(L, I, V, M, F, or Y)-(D, E, N, Q, or S)-(S,
T, or A)-(A or V)-(L, I, V, M, F, or Y),
wherein standard single-letter amino acid codes are used, X being
any amino acid residue. Each of the human and murine TANGO 210
amino acid sequences include a single copy of this consensus
sequence. This consensus sequence occurs in the amino acid
sequences of many MMPs, including MMPs-1, -2, -3, -9, -10, -11,
-12, -14, -15, and -16.
[0352] Peptidase_M10 domains are conserved amino acid sequences
which occur in type 10 zinc-dependent metalloproteinases, according
to the classification of Rawlings et al. (1995, Meth. Enzymol
248:183-228). Several mammalian MMPs are type 10 zinc-dependent
metalloproteinases including, for example, MMP-1 (interstitial
collagenase), MMP-2 (72 kilodalton gelatinase), MMP-3
(stromelysin-1) MMP-7 (matrylisin), MMP-8 (neutrophil collagenase),
MMP-9 (92 kilodalton gelatinase), and MMP-10 (stromelysin-2;
Woessner, 1991, FASEB J. 5:2145-2154). The peptidase_M10 domain
includes a consensus zinc-binding domain signature sequence having
the structure
TABLE-US-00015 (SEQ ID NO: 452) (G, S, T, A, L, I, V, or
N)-X.sub.2-H-E-(L, I, V, M, F, Y, or W)-(D, E, G, H, R, K, or
P)-H-X-(L, I, V, M, F, Y, W, G, S, P, or Q),
wherein standard single-letter amino acid codes are used, X being
any amino acid residue. The two histidine residues of the consensus
sequence have been recognized as zinc ligands, and the glutamate
residue is the (proteinase) active site residue. Each of the human
and murine TANGO 210 amino acid sequences include this consensus
sequence.
[0353] Another distinguishing characteristic of mammalian
extracellular MMPs is presence in the amino acid sequence of the
MMP of an MMP cysteine switch signature. The consensus MMP cysteine
switch signature sequence has the structure
TABLE-US-00016 (SEQ ID NO: 453) P-R-C-(G or N)-X-P-(D or R)-(L, I,
V, S, A, P, K, or Q)
wherein standard single-letter amino acid codes are used, X being
any amino acid residue. Each of the human and murine TANGO 210
amino acid sequences include a single copy of this consensus
sequence. Human MMPs in which this consensus sequence occurs
include MMPs-1, -2, -3, -7, -8, -9, -10, -11, -12, -13, -14, -15,
and -16.
[0354] The signal peptide prediction program SIGNALP (Nielsen et
al. (1997) Protein Engineering 10:1-6) predicted that human TANGO
210 protein includes an approximately 17 amino acid signal peptide
(amino acid residues 1 to 15, 16, 17, 18, or 19 of SEQ ID NO: 173;
SEQ ID NO: 174) preceding the mature, secreted TANGO 210 protein
(amino acid residues 18 to 513 of SEQ ID NO: 173; SEQ ID NO: 175).
In one alternative form, human TANGO 210 protein includes an
extracellular domain (amino acid residues 18 to 488 of SEQ ID NO:
173; SEQ ID NO: 178), a transmembrane domain (amino acid residues
489 to 506 of SEQ ID NO: 173; SEQ ID NO: 179), and a cytoplasmic
domain (amino acid residues 507 to 513 of SEQ ID NO: 173; SEQ ID
NO: 180). In another alternative form, human TANGO 210 protein
includes a cytoplasmic domain (amino acid residues 18 to 488 of SEQ
ID NO: 173; SEQ ID NO: 178), a transmembrane domain (amino acid
residues 489 to 506 of SEQ ID NO: 173; SEQ ID NO: 179), and an
extracellular domain (amino acid residues 507 to 513 of SEQ ID NO:
173; SEQ ID NO: 180).
[0355] FIG. 20 depicts a hydrophobicity plot of human TANGO 210
protein. Relatively hydrophobic regions are above the dashed
horizontal line, and relatively hydrophilic regions are below the
dashed horizontal line. The hydrophobic region which corresponds to
amino acid residues 1 to about 17 of SEQ ID NO: 173 is the signal
sequence of human TANGO 210 (SEQ ID NO: 174). The hydrophobic
region which corresponds to amino acid residues 489 to 506 of SEQ
ID NO: 173 is the transmembrane portion in the alternative form of
human TANGO 210 protein. As described elsewhere herein, relatively
hydrophilic regions are generally located at or near the surface of
a protein, and are more frequently effective immunogenic epitopes
than are relatively hydrophobic regions. For example, the region of
human TANGO 210 protein from about amino acid residue 190 to about
amino acid residue 205 appears to be located at or near the surface
of the protein, while the region from about amino acid residue 145
to about amino acid residue 155 appears not to be located at or
near the surface.
[0356] The predicted molecular weight of human TANGO 210 protein
without modification and prior to cleavage of the signal sequence
is about 59.0 kilodaltons. The predicted molecular weight of the
mature human TANGO 210 protein without modification and after
cleavage of the signal sequence is about 57.0 kilodaltons.
[0357] Northern hybridization experiments using human tissue
samples indicated that mRNA corresponding to the cDNA encoding
TANGO 210 is expressed in the tissues listed in Table XI, wherein
"+" indicates detectable expression and "-" indicates failure to
detect expression.
TABLE-US-00017 TABLE XI Animal Tissue Expression Human kidney +
(Adult) heart - brain - placenta - lung - liver - skeletal muscle -
pancreas - Human kidney + (Fetus)
[0358] Human TANGO 210 exhibits sequence similarity to human MMP-8
(GENBANK.TM. Accession No. J05556), as indicated herein in FIGS.
24A-24B, which list an alignment of the amino acid sequences of
these proteins. FIGS. 25A-25F depict an alignment of the nucleotide
sequences of the ORFs of human TANGO 210 (SEQ ID NO: 172) and MMP-8
(SEQ ID NO: 176). In these alignments (each made using the ALIGN
software; pam120.mat scoring matrix; gap penalties -12/-4), the
amino acid and ORF nucleotide sequences corresponding to these two
proteins are 43.9% identical and 57.1% identical, respectively.
[0359] The full length of the cDNA encoding murine TANGO 210
protein (SEQ ID NO: 181) is 2467 nucleotide residues. The ORF of
this cDNA, nucleotide residues 22 to 927 and about 1280 to 1906 of
SEQ ID NO: 181 (i.e., collectively, SEQ ID NO: 182), encodes a
510-amino acid residue protein (SEQ ID NO: 183). It is recognized
that the precise locations of the intron boundaries in SEQ ID NO:
181 have not been identified. Thus, murine TANGO 210 protein can
comprise one or more additional or one or more fewer amino acid
residues at the exon-exon boundary (i.e., between about residues
302 and 303 of SEQ ID NO: 183).
[0360] The signal peptide prediction program SIGNALP (Nielsen et
al. (1997) Protein Engineering 10:1-6) predicted that murine TANGO
210 protein includes an approximately 17 amino acid signal peptide
(amino acid residues 1 to about 17 of SEQ ID NO: 183; SEQ ID NO:
184) preceding the mature TANGO 210 protein (amino acid residues 18
to 511 of SEQ ID NO: 183; SEQ ID NO: 185). Murine TANGO 210 protein
is a secreted protein.
[0361] FIG. 21 depicts a hydrophobicity plot of murine TANGO 210
protein. Relatively hydrophobic regions are above the dashed
horizontal line, and relatively hydrophilic regions are below the
dashed horizontal line. The hydrophobic region which corresponds to
amino acid residues 1 to about 17 of SEQ ID NO: 183 is the signal
sequence of murine TANGO 210 (SEQ ID NO: 184). As described
elsewhere herein, relatively hydrophilic regions are generally
located at or near the surface of a protein, and are more
frequently effective immunogenic epitopes than are relatively
hydrophobic regions. For example, the region of murine TANGO 210
protein from about amino acid residue 18 to about amino acid
residue 28 appears to be located at or near the surface of the
protein, while the region from about amino acid residue 148 to
about amino acid residue 158 appears not to be located at or near
the surface
[0362] The predicted molecular weight of murine TANGO 210 protein
without modification and prior to cleavage of the signal sequence
is about 58.7 kilodaltons. The predicted molecular weight of the
mature murine TANGO 210 protein without modification and after
cleavage of the signal sequence is about 56.2 kilodaltons.
[0363] Human and murine TANGO 210 proteins exhibit considerable
sequence similarity, as indicated herein in FIGS. 22A-22B. FIGS.
22A-22B depict an alignment of human and murine TANGO 210 amino
acid sequences (SEQ ID NOs: 173 and 183, respectively). In this
alignment (made using the ALIGN software {Myers and Miller (1989)
CABIOS, ver. 2.0}; pam120.mat scoring matrix; gap penalties
-12/-4), the proteins are 77.2% identical in the overlapping region
(i.e., 393 identical residues out of 509 residues in the
overlapping region, which includes amino acid residues 1-509 of SEQ
ID NO: 173 and amino acid residues 1-509 of SEQ ID NO: 183). The
human and murine cDNAs encoding TANGO 210 are 76.2% identical in
the overlapping portions (i.e., nucleotide residues 29-1601 of SEQ
ID NO: 171 and nucleotide residues 8-927 and 1280-1935 of SEQ ID
NO: 181), as assessed using the same software and parameters and as
indicated in FIGS. 23A-23I. In the respective ORFs, SEQ ID NOs: 171
and 181 are 81.7% identical.
[0364] Human TANGO 210 Gene Expression Analysis
[0365] Expression of TANGO 210 in selected human tissues and cell
types was analyzed as follows. Total RNA was prepared from selected
human tissues using a single step extraction method using the RNA
STAT-60.TM. kit according to the manufacturer's instructions
(TelTest, Inc). Each RNA preparation was treated with DNase I
(Ambion) at 37.degree. C. for 1 hour. DNase I treatment was
considered to be complete if the sample required at least 38 PCR
amplification cycles to reach a threshold level of fluorescence
using .beta.-2 microglobulin as an internal amplicon reference. The
integrity of the RNA samples following DNase I treatment was
confirmed by agarose gel electrophoresis and ethidium bromide
staining. Following phenol extraction, cDNA was prepared from the
sample using the SUPERSCRIPT.TM. Choice System following the
manufacturer's instructions (Gibco BRL). A negative control of RNA
without reverse transcriptase was mock reverse-transcribed for each
RNA sample.
[0366] TANGO 210 expression was measured by TAQMAN.RTM.
quantitative PCR (Perkin Elmer Applied Biosystems) in cDNA prepared
from the following normal human tissues: prostate, liver, breast,
skeletal muscle, brain, colon, heart, ovary, kidney, lung, vein,
aorta, testis, thyroid, placenta, fetal liver, fetal heart,
osteoblasts (undifferentiated), small intestine, spleen, thymus,
and lymph node. Probes were designed by PRIMEREXPRESS.TM. software
(PE Biosystems) based on the sequence of each gene.
[0367] Each gene probe was labeled using FAM
(6-carboxyfluorescein), and the .beta.2-microglobulin reference
probe was labeled with a different fluorescent dye, VIC. The
differential labeling of the target gene and internal reference
gene thus enabled measurement in same well. Forward and reverse
primers and the probes for both .beta.2 microglobulin and target
gene were added to the TAQMAN.RTM. Universal PCR Master Mix (PE
Applied Biosystems). Although the final concentration of primer and
probe varied, each was internally consistent within a given
experiment. A typical experiment contained 200 nanomolar forward
and reverse primers and 100 nanomolar probe for .beta.-2
microglobulin, and 600 nanomolar forward and reverse primers and
200 nanomolar probe for the target gene. TAQMAN.RTM. matrix
experiments were carried out using an ABI PRISM.TM. 7700 Sequence
Detection System (PE Applied Biosystems). The thermal cycler
conditions were as follows: hold for 2 minutes at 50.degree. C. and
10 minutes at 95.degree. C., followed by two-step PCR for 40 cycles
of 95.degree. C. for 15 seconds followed by 60.degree. C. for 1
minute.
[0368] The following method was used to quantitatively calculate
TANGO 210 gene expression in the selected tissues relative to
.beta.-2 microglobulin expression in the same tissue. The threshold
cycle (Ct) value is defined as the cycle at which a statistically
significant increase in fluorescence is detected. A lower Ct value
is indicative of a higher mRNA concentration. The Ct value of the
kinase gene is normalized by subtracting the Ct value of the
.beta.-2 microglobulin gene to obtain a .DELTA.Ct value using the
following formula: .DELTA.Ct=Ct.sub.kinase-Ct.sub..beta.-2
microglobulin. Expression is then calibrated against a cDNA sample
showing a comparatively low level of expression of the kinase gene.
The .DELTA.Ct value for the calibrator sample is then subtracted
from .DELTA.Ct for each tissue sample according to the following
formula:
.DELTA..DELTA.Ct=.DELTA.Ct-.sub.sample-.DELTA.Ct-.sub.calibrator.
Relative expression is then calculated using the arithmetic formula
given by 2.sup.-.DELTA..DELTA.Ct. Expression of the target gene in
each of the tissues tested is then graphically represented as
discussed in more detail below.
[0369] FIG. 26 depicts expression of TANGO 210 in various tissues
and cell lines as described above, relative to expression in fetal
heart tissue. The results indicate significant expression in
breast, skeletal muscle, colon, vein, aorta, testis, thyroid, and
small intestine tissues.
[0370] Uses of TANGO 210 Nucleic acids,
[0371] Polypeptides, and Modulators Thereof
[0372] TANGO 210 proteins are involved in disorders which affect
both tissues in which they are normally expressed and tissues in
which they are normally not expressed. Based on the observations
that cDNA corresponding to TANGO 210 occurs in a human fetal skin
cDNA library and in a murine long term bone marrow cDNA library,
and that RNA corresponding to TANGO 210 is detectable by Northern
analysis of human adult and fetal kidney tissue, it is evident that
TANGO 210 protein is involved in one or more biological processes
which occur in these tissues. In particular, TANGO 210 is involved
in modulating one or more of growth, proliferation, survival,
differentiation, activity, morphology, and movement/migration of
cells of these tissues. TANGO 210 is involved in modulating the
structure of extracellular matrix which contacts or is in fluid
communication with cells of these tissues. Thus, TANGO 210 has a
role in disorders which affect these cells and one or more of their
growth, proliferation, survival, differentiation, activity,
morphology, and movement/migration, as well as the biological
function of organs comprising one or more of these tissues.
[0373] The Northern analysis data described herein for human TANGO
210 indicate that nucleic acids corresponding to (i.e., homologous
with or complementary to) all or part of human TANGO 210 cDNA or
molecules (e.g., antibodies) which react specifically with human
TANGO 210 protein or a portion thereof can be used to identify
kidney tissue or to differentiate kidney tissue from other types of
tissue, such as heart, brain, placenta, lung, liver, and pancreas
tissues. Thus, human TANGO 210 proteins, nucleic acids, and
compounds which interact specifically with either of these, can be
used for one or more of tissue typing, identification, and
separation.
[0374] TANGO 210 gene expression data described herein indicate
that TANGO 210 can be expressed in at least breast, skeletal
muscle, colon, vein, aorta, testis, thyroid, small intestine, and
spleen tissues. Thus, TANGO 210 can have a role in disorders which
affect cells of these tissues and one or more of their growth,
proliferation, survival, differentiation, activity, morphology, and
movement/migration, as well as the biological function of organs
comprising one or more of these tissues.
[0375] The fact that TANGO 210 is expressed in breast tissue is an
indication that TANGO 210 can be involved in both normal
physiological function of breast tissue and in breast disorders.
Examples of breast disorders include breast cancer, insufficient
lactation, infant nutritional and growth disorders, mastalgia,
fibroadenomas, breast infections, and gynecomastia.
[0376] In another example, TANGO 210 polypeptides, nucleic acids,
and modulators thereof, can be involved in normal and aberrant
functioning of skeletal muscle tissue, and can thus be involved in
disorders of such tissue. Examples of skeletal muscle disorders
include muscular dystrophy (e.g., Duchenne muscular dystrophy,
Becker muscular dystrophy, Emery-Dreifuss muscular dystrophy,
limb-girdle muscular dystrophy, facioscapulohumeral muscular
dystrophy, myotonic dystrophy, oculopharyngeal muscular dystrophy,
distal muscular dystrophy, and congenital muscular dystrophy),
motor neuron diseases (e.g., amyotrophic lateral sclerosis,
infantile progressive spinal muscular atrophy, intermediate spinal
muscular atrophy, spinal bulbar muscular atrophy, and adult spinal
muscular atrophy), myopathies (e.g., inflammatory myopathies (e.g.,
dermatomyositis and polymyositis), myotonia congenita, paramyotonia
congenita, central core disease, nemaline myopathy, myotubular
myopathy, and periodic paralysis), and metabolic diseases of muscle
(e.g., phosphorylase deficiency, acid maltase deficiency,
phosphofructokinase deficiency, de-brancher enzyme deficiency,
mitochondrial myopathy, carnitine deficiency, carnitine palmityl
transferase deficiency, phosphoglycerate kinase deficiency,
phosphoglycerate mutase deficiency, lactate dehydrogenase
deficiency, and myoadenylate deaminase deficiency). TANGO 210
polypeptides, nucleic acids, or modulators thereof can be used to
prognosticate, diagnose, inhibit, prevent, or alleviate one or more
of these disorders.
[0377] In another example, TANGO 210 polypeptides, nucleic acids,
and modulators thereof can be used to treat colonic disorders, such
as those described elsewhere in this disclosure.
[0378] In another example, TANGO 210 polypeptides, nucleic acids,
and modulators thereof, can be used to treat cardiovascular
disorders, such as those described elsewhere in this
disclosure.
[0379] In another example, TANGO 210 polypeptides, nucleic acids,
or modulators thereof, can be used to treat testicular disorders,
such as those described elsewhere in this disclosure.
[0380] TANGO 210 polypeptides, nucleic acids, and modulators
thereof, can be involved in disorders of the thyroid gland, such as
hyperthyroidism (e.g., diffuse toxic hyperplasia, toxic
multi-nodular goiter, toxic adenoma, and acute or sub-acute
thyroiditis), hypothyroidism (e.g., cretinism and myxedema),
thyroiditis (e.g., Hashimoto's thyroiditis, sub-acute granulomatous
thyroiditis, sub-acute lymphocytic thyroiditis, Riedel's
thyroiditis), Graves' disease, goiter (e.g., simple diffuse goiter
and multi-nodular goiter), and tumors (e.g., adenoma, papillary
carcinoma, follicular carcinoma, medullary carcinoma,
undifferentiated malignant carcinoma, Hodgkin's disease, and
non-Hodgkin's lymphoma). TANGO 210 polypeptides, nucleic acids, or
modulators thereof can be used to prognosticate, diagnose, inhibit,
prevent, or alleviate one or more of these disorders.
[0381] In another example, TANGO 210 polypeptides, nucleic acids,
and modulators thereof can be used to treat intestinal disorders
(e.g., disorders of the small intestine), such as ischemic bowel
disease, infective enterocolitis, Crohn's disease, benign tumors,
malignant tumors (e.g., argentaffinomas, lymphomas,
adenocarcinomas, and sarcomas), malabsorption syndromes (e.g.,
celiac disease, tropical sprue, Whipple's disease, and
abetalipoproteinemia), obstructive lesions, hernias, intestinal
adhesions, intussusception, and volvulus.
[0382] TANGO 210 nucleic acids, proteins, and modulators thereof
can be used to modulate proliferation, migration, morphology,
differentiation, function, or some combination of these, of cells
that form the spleen, (e.g., cells of the splenic connective
tissue, splenic smooth muscle cells, or endothelial cells of the
splenic blood vessels) or of blood cells that are processed (e.g.,
regenerated, matured, or phagocytized) within the spleen, as
described elsewhere in this disclosure.
[0383] There are several indications that TANGO 210 is an MMP. For
instance, presence of each of a Peptidase_M10 domain, a
zinc-binding domain signature, a hemopexin domain signature, and a
cysteine switch in the amino acid sequences of both human and
murine TANGO 210 indicates that TANGO 210 exhibits extracellular
matrix proteinase activity (e.g., collagenase and basement membrane
degradative activities). In addition, homology between the sequence
of human TANGO 210 and MMPs (e.g., MMP-8, as described herein) is a
further indication the TANGO 210 is an MMP.
[0384] MMPs degrade extracellular matrix (ECM), and are thus
involved in maintenance, and in renewal and replacement of old ECM
with new ECM. ECM serves numerous purposes in the body, including
providing support, containment, or both, to specialized tissues
(e.g., tissues of organs such as skin, kidney, bone marrow, etc.)
and regulating fluid balance in tissues which line a void or
fluid-filled compartment (e.g., skin, bladder, kidney, stomach,
etc.). Demonstration, as described herein, that TANGO 210 is
expressed in several of these tissues (fetal skin, bone marrow,
kidney) indicates that TANGO 210 is involved in one or more of
these processes.
[0385] An important function of kidney tissue is to regulate the
volume and composition of body fluids. The kidneys regulate body
fluids by selectively permitting water, electrolytes, metabolites,
and the like to pass from the plasma into the bladder in a
regulatable manner while retaining cells and proteins in the
plasma. By regulating fluid balance, the kidneys also exert a
significant effect on arterial blood pressure. The kidneys perform
these functions in a manner analogous to filtration.
[0386] Fluid outflow from the plasma occurs through the membranes
of kidney glomerular capillaries in structures designated Bowman's
capsules. The membrane of glomerular capillaries has three layers
(normal capillaries have only two). Glomerular capillaries have a
highly fenestrated luminal endothelium which can serve to prevent
passage of cells through the capillary membrane, but do not
substantially inhibit passage of serum proteins. Surrounding the
endothelium is an ECM basement membrane comprising collagen and
peptidoglycan. An epithelial layer having gaps or channels through
which glomerular filtrate is passed surrounds the basement
membrane.
[0387] The basement membrane is the layer of the glomerular
capillary membrane which is principally responsible for retention
of serum proteins. In order to maintain proper operation of the
kidneys, it is critical that the relative porosity of the basement
membrane be maintained. Mineral precipitates, circulating bacteria,
and the like can clog the pores of the basement membrane. Turnover,
renewal, or controlled degradation of the basement membrane ensures
that the basement membrane remains functional. TANGO 210 is
involved in regulating the thickness, porosity, and rate of
degradation of the basement membrane of glomerular capillaries and
other ECM components of kidney tissue. TANGO 210 is therefore
involved in normal and abnormal formation and maintenance of
functional kidney tissue. Thus, TANGO 210 is involved in a number
of disorders which relate to aberrant kidney tissue formation and
function. Such disorders include the kidney disorders described
elsewhere herein. TANGO 210 proteins, nucleic acids encoding them,
and agents that modulate activity or expression of either of these
can be used to prognosticate, diagnose, treat, and inhibit one or
more of these disorders.
[0388] Recovery of a cDNA encoding TANGO 210 from a murine long
term bone marrow cDNA library indicates that TANGO 210 is expressed
in bone marrow, and is thus involved both in normal physiological
processes which occur in bone marrow and in disorders which affect
bone marrow. ECM is a significant component of bone marrow, and
TANGO 210 is involved in degradation of ECM associated with
turnover/renewal of bone marrow tissue, and with changes which
occur in the bone marrow with age. As mammals age, the bone marrow
becomes increasingly gelatinous and the ECM composition of the
marrow changes. The cellular content of the bone marrow changes
with time as well. In young mammals, most bones are filled with red
marrow, which comprises large numbers of hematopoietic cells. As
mammals age, red marrow is replaced by gelatinous, adipose
cell-containing white and yellow marrows. TANGO 210 is involved in
ECM changes which accompany age related changes in marrow
composition. TANGO 210 is also involved in bone marrow-related
disorders such as bone marrow failure (e.g., that associated with
anemia) and rejection of heterologous implanted bone marrow. TANGO
210 proteins, nucleic acids encoding them, and agents that modulate
activity or expression of either of these can be used to
prognosticate, diagnose, treat, and inhibit one or more of these
disorders. In addition, because TANGO 210 is associated with
remodeling of bone marrow, TANGO 210 is also capable of modulating
acceptance of donor bone marrow in a recipient.
[0389] Recovery of a cDNA encoding TANGO 210 from a human fetal
skin cDNA library indicates that TANGO 210 is expressed in human
skin, and is involved both in normal physiological processes which
occur in skin and in skin disorders. Skin is a multi-layered tissue
in which the various tissue layers can have different ECM
compositions. Skin has a variety of roles in the normal mammal.
Skin maintains the mechanical, osmotic, chemical, photic, and
thermal integrity of the exterior surface of the mammal. TANGO 210,
being expressed in the skin and able to modulate ECM composition,
is therefore involved in regulating these characteristics in normal
individuals and in individuals afflicted with disorders relating to
aberrant regulation of these characteristics (e.g., ichthyosis).
TANGO 210 is also involved in other disorders which occur in or
affect ECM in skin. Such disorders include, by way of example,
psoriasis, infections, wounds (and healing of wounds),
inflammation, dermatitis, acne, benign and malignant dermatological
tumors, and the like. TANGO 210 proteins, nucleic acids encoding
them, and agents that modulate activity or expression of either of
these can be used to prognosticate, diagnose, treat, and inhibit
one or more of these disorders.
[0390] Numerous cancers are associated with aberrant MMP expression
and activity. MMPs can aid cancer growth and metastasis by
degrading ECM, thereby providing an avenue for angiogenesis, cell
growth, or cell movement through a tissue. TANGO 210 is able to
modulate the rate and extent of angiogenesis, and is therefore
useful for prognosticating, diagnosing, treating, and inhibiting
one or more disorders associated with aberrant angiogenesis,
including, but not limited to cancers. Disorders associated with
aberrant angiogenesis include both those associated with an
abnormally high rate or extent of angiogenesis (e.g., cancerous
growth and metastasis) and those associated with an abnormally or
insufficiently low rate or extent of angiogenesis (e.g., impaired
wound healing, transplanted tissue rejection, and acute and chronic
ischemic disorders such as stroke). TANGO 210 proteins, nucleic
acids encoding them, and agents that modulate activity or
expression of either of these can be used to prognosticate,
diagnose, treat, and inhibit one or more cancers or other disorders
associated with aberrant angiogenesis.
TANGO 366
[0391] A cDNA clone (designated jthqc016c02) encoding at least a
portion of human TANGO 366 protein was isolated from a human normal
prostate fibroblast cDNA library by SPOT analysis. Human TANGO 366
protein is predicted by structural analysis to be a transmembrane
protein.
[0392] The full length of the cDNA encoding human TANGO 366 protein
(SEQ ID NO: 191) is 2628 nucleotide residues. The ORF of this cDNA,
nucleotide residues 86 to 1144 of SEQ ID NO: 191 (i.e., SEQ ID NO:
192), encodes a 353-amino acid residue protein (SEQ ID NO: 193),
corresponding to a 337-residue transmembrane protein.
[0393] The invention thus includes purified human TANGO 366
protein, both in the form of the immature 353 amino acid residue
protein (SEQ ID NO: 193) and in the form of the mature 337 amino
acid residue protein (SEQ ID NO: 195). Mature human TANGO 366
proteins can be synthesized without the signal sequence polypeptide
at the amino terminus thereof, or it can be synthesized by
generating immature TANGO 366 protein and cleaving the signal
sequence therefrom.
[0394] The invention includes nucleic acid molecules which encode a
polypeptide of the invention. Such nucleic acids include, for
example, a DNA molecule having the nucleotide sequence listed in
SEQ ID NO: 191 or some portion thereof, such as the portion which
encodes mature human TANGO 366 protein, immature human TANGO 366
protein, or a domain of human TANGO 366 protein. These nucleic
acids are collectively referred to as nucleic acids of the
invention.
[0395] TANGO 366 proteins and nucleic acid molecules encoding them
comprise a family of molecules having certain conserved structural
and functional features.
[0396] A common domain present in TANGO 366 proteins is a signal
sequence. In one embodiment, a TANGO 366 protein contains a signal
sequence corresponding to the portion of the protein from amino
acid residue 1 to about amino acid residue 16 of SEQ ID NO: 193
(SEQ ID NO: 194). It is recognized that the carboxyl terminal
boundary of the signal sequence can be located one or two residues
from the residue identified above (i.e., at residue 14, 15, 16, 17,
or 18 of SEQ ID NO: 193). The signal sequence is cleaved during
processing of the mature protein.
[0397] TANGO 366 proteins can include an extracellular domain. The
human TANGO 366 protein extracellular domain is located from about
amino acid residue 17 to amino acid residue 216 of SEQ ID NO: 193
(i.e., the extracellular domain has the sequence SEQ ID NO:
196).
[0398] In addition, TANGO 366 can include a transmembrane domain.
In one embodiment, a TANGO 366 protein of the invention contains a
transmembrane domain corresponding to about amino acid residues 217
to 239 of SEQ ID NO: 193 (i.e., the transmembrane domain has the
sequence SEQ ID NO: 197).
[0399] The present invention includes TANGO 366 proteins having a
cytoplasmic domain, particularly including proteins having a
carboxyl-terminal cytoplasmic domain. The human TANGO 366
cytoplasmic domain is located from about amino acid residue 240 to
amino acid residue 353 of SEQ ID NO: 193 (i.e., the cytoplasmic
domain has the sequence SEQ ID NO: 198).
[0400] In an alternative embodiment, TANGO 366 proteins can have a
cytoplasmic domain located from about amino acid residue 17 to
amino acid residue 216 of SEQ ID NO: 193 (i.e., the cytoplasmic
domain has the sequence SEQ ID NO: 196); a transmembrane domain
corresponding to about amino acid residues 217 to 239 of SEQ ID NO:
193 (i.e., the transmembrane domain has the sequence SEQ ID NO:
197); and an extracellular domain located from about amino acid
residue 240 to amino acid residue 353 of SEQ ID NO: 193 (i.e., the
extracellular domain has the sequence SEQ ID NO: 198)
[0401] TANGO 366 proteins typically comprise a variety of potential
post-translational modification sites (often within an
extracellular domain), such as those described herein in Table XII,
as predicted by computerized sequence analysis of TANGO 366
proteins using amino acid sequence comparison software (comparing
the amino acid sequence of TANGO 366 with the information in the
PROSITE database {rel. 12.2; February, 1995} and the Hidden Markov
Models database {Rel. PFAM 3.3}).
TABLE-US-00018 TABLE XII Type of Potential Amino Acid Amino
Modification Site Residues of Acid or Domain SEQ ID NO: 193
Sequence N-glycosylation site 74 to 77 NESV 137 to 140 NLSH Protein
kinase C 16 to 18 TTR phosphorylation site 67 to 69 SNR 332 to 334
SPK Casein kinase II 40 to 43 TRVD phosphorylation site 280 to 283
SLQE Tyrosine kinase 318 to 325 RLVREGTY phosphorylation site
N-myristoylation site 13 to 18 GAQTTR 32 to 37 GLFDSF 88 to 93
GLDLSH 214 to 219 GNPLAV 223 to 228 GAFAGL Glycosaminoglycan 45 to
48 SGLG attachment site Leucine rich repeat 19 to 58 amino terminal
(LRRNT) domain Leucine rich repeat 59 to 82 (LRR) domain 85 to 108
109 to 132 133 to 155 185 to 206 207 to 229 230 to 254 255 to 279
280 to 303 Leucine zipper pattern 284 to 305
[0402] In various embodiments, the protein of the invention has at
least 1, 2, 4, 6, 10, 15, or 20 or more of the post-translational
modification sites described herein in Table XII.
[0403] Examples of additional domains present in human TANGO 366
protein include a glycosaminoglycan attachment site, several
leucine rich repeat (LRR and LRRNT) domains, and a leucine zipper
domain. In one embodiment, the protein of the invention has at
least one domain that is at least 55%, preferably at least about
65%, more preferably at least about 75%, yet more preferably at
least about 85%, and most preferably at least about 95% identical
to one of the LRR or leucine zipper domains described herein in
Table XII. Preferably, the protein of the invention has at least
one LRR domain, one leucine zipper domain, and one potential
glycosaminoglycan attachment site sequence.
[0404] One or more LRR domains are present in a variety of proteins
involved in protein-protein interactions. Such proteins include,
for example, proteins involved in signal transduction, cell-to-cell
adhesion, cell-to-extracellular matrix adhesion, cell development,
DNA repair, RNA processing, and cellular molecular recognition
processes. Specialized LRR domains, designated LRR amino terminal
(LRRNT) domains often occur near the amino ends of a series of LRR
domains. TANGO 366 protein has nine LRR domains, arranged in two
groups, the first group including (from the amino terminus toward
the carboxyl terminus of TANGO 366) the LRRNT domain and four LRR
domains, and the second group including four LRR domains.
[0405] TANGO 366 is involved in one or more physiological processes
in which these other LRR domain-containing proteins are involved,
namely binding of cells with extracellular proteins such as soluble
extracellular proteins and cell surface proteins of other
cells.
[0406] TANGO 366 comprises a leucine zipper region at about amino
acid residue 284 to about amino acid residue 305 (i.e., 284
LdlsgtnLvplpeaLllhlpaL 305; SEQ ID NO: 458). Leucine zipper regions
are known to be involved in dimerization of proteins. Leucine
zipper regions interact with one another, leading to formation of
homo- or hetero-dimers between proteins, depending on their
identity. Dimers of proteins having leucine zipper regions can also
interact with DNA. The presence in TANGO 366 of a leucine zipper
region is a further indication that this protein is involved in
protein-protein interactions.
[0407] The signal peptide prediction program SIGNALP (Nielsen et
al. (1997) Protein Engineering 10:1-6) predicted that human TANGO
366 protein includes an approximately 16 amino acid signal peptide
(amino acid residues 1 to about 16 of SEQ ID NO: 193; SEQ ID NO:
194) preceding the mature TANGO 366 protein (amino acid residues 17
to 353 of SEQ ID NO: 193; SEQ ID NO: 195). Human TANGO 366 protein
includes an extracellular domain (amino acid residues 17 to 216 of
SEQ ID NO: 193; SEQ ID NO: 196), a transmembrane domain (amino acid
residues 217 to 239 of SEQ ID NO: 193; SEQ ID NO: 197), and a
cytoplasmic domain (amino acid residues 240 to 353 of SEQ ID NO:
193; SEQ ID NO: 198).
[0408] FIG. 27 depicts a hydrophobicity plot of human TANGO 366
protein. Relatively hydrophobic regions are above the dashed
horizontal line, and relatively hydrophilic regions are below the
dashed horizontal line. The hydrophobic region which corresponds to
amino acid residues 1 to about 16 of SEQ ID NO: 193 is the signal
sequence of human TANGO 366 (SEQ ID NO: 194), and the hydrophobic
region which corresponds to amino acid residues 217 to 239 of SEQ
ID NO: 193 is the transmembrane region of TANGO 366 (SEQ ID NO:
197). As described elsewhere herein, relatively hydrophilic regions
are generally located at or near the surface of a protein, and are
more frequently effective immunogenic epitopes than are relatively
hydrophobic regions. For example, the region of human TANGO 366
protein from about amino acid residue 315 to about amino acid
residue 330 appears to be located at or near the surface of the
protein, while the region from about amino acid residue 290 to
about amino acid residue 305 appears not to be located at or near
the surface.
[0409] The predicted molecular weight of human TANGO 366 protein
without modification and prior to cleavage of the signal sequence
is about 37.8 kilodaltons. The predicted molecular weight of the
mature human TANGO 366 protein without modification and after
cleavage of the signal sequence is about 36.1 kilodaltons.
[0410] TANGO 366 exhibits limited sequence similarity to numerous
cell surface proteins, including proteins which serve as cell
surface antigens, proteoglycans, and protein receptors. TANGO 366
protein, cDNA, and ORF exhibit sequence homology to the sequences
corresponding to a GENBANK.TM. record having Accession No.
HSM800846. The nucleotide sequence of the DNA molecule described in
GENBANK.TM. Accession No. HSM800846 is identical to nucleotide
residues 418 to 2628 of SEQ ID NO: 191. The cDNA of GENBANK.TM.
Accession No. HSM800846 was obtained from uterine tissue,
indicating that TANGO 366 is expressed in uterine tissue and thus
involved in normal and aberrant physiological processes in uterine
tissue. In addition, nucleotide residues 36 to 319 of the reverse
complement of SEQ ID NO: 191 exhibits significant homology with
expressed sequence tag (EST) 01904, which is disclosed in an
international patent application having PCT Publication No.
WO93/16178. The ESTs described in that application were isolated
from human brain tissue. This is an indication that TANGO 366 is
expressed in brain tissue and thus is involved in normal and
aberrant physiological processes in brain tissue.
[0411] Uses of TANGO 366 Nucleic acids,
[0412] Polypeptides, and Modulators Thereof
[0413] TANGO 366 proteins are involved in disorders which affect
both tissues in which they are normally expressed and tissues in
which they are normally not expressed. Based on the observations
that cDNA corresponding to TANGO 366 occurs in a human normal
prostate fibroblast, brain, and uterus cDNA libraries, it is
evident that TANGO 366 protein is involved in one or more
biological processes which occur in prostate, brain, uterus, and
other solid tissues. In particular, TANGO 366 is involved in
modulating one or more of growth, proliferation, survival,
differentiation, activity, morphology, and movement/migration of
cells of prostate, brain, uterus, and other solid tissues. Thus,
TANGO 366 has a role in disorders which affect the prostate, brain,
uterus, and other solid tissues and one or more of growth,
proliferation, survival, differentiation, activity, morphology, and
movement/migration of cells in those tissues, as well as the
biological function of organs (e.g., the prostate) comprising such
tissues.
[0414] Disorders which affect the prostate include the prostate
disorders described elsewhere in this disclosure. TANGO 366
proteins, nucleic acids encoding them, and agents that modulate
activity or expression of either of these can be used to
prognosticate, diagnose, treat, and inhibit one or more of these
disorders.
[0415] Examples of brain disorders include the brain disorders
described elsewhere in this disclosure. TANGO 366 proteins, nucleic
acids encoding them, and agents that modulate activity or
expression of either of these can be used to prognosticate,
diagnose, treat, and inhibit one or more of these disorders.
[0416] Disorders which involve uterus tissue include the uterine
disorders described elsewhere in this disclosure. TANGO 366
proteins, nucleic acids encoding them, and agents that modulate
activity or expression of either of these can be used to
prognosticate, diagnose, treat, and inhibit one or more of these
disorders.
[0417] There are several indications that TANGO 366 is a cell
surface protein which is involved in binding a protein to the cell
which expresses TANGO 366. For instance, presence in TANGO 366 of
an amino terminal extracellular domain that includes an LRRNT and
four LRR domains exemplifies the cell-surface protein interaction
capability of TANGO 366. In addition, the amino acid sequence
similarity which TANGO 366 exhibits with respect to several other
cell surface protein-binding proteins reinforces this view. TANGO
366 is involved in binding an animal cell which expresses it with
one or more of an extracellular fluid protein, a protein component
of the extracellular matrix, a surface protein another cell of the
same animal, and a surface protein of a bacterium, fungus, or
virus. Thus, TANGO 366 is involved in modulating cell-to-cell
adhesion, tissue and extracellular matrix invasivity of cells,
infectivity of cells by pathogens (e.g., bacteria and viruses),
endocrine signaling processes, tissue developmental and
organizational processes, and the like. TANGO 366 is involved in
disorders in which these physiological processes are relevant. Such
disorders include, for example, loss of control of cell growth,
tumor metastasis, malformation of neurological connections,
inflammation, immune and autoimmune responses, bacterial, fungal,
and viral infections, and the like. TANGO 366 proteins, nucleic
acids encoding them, and agents that modulate activity or
expression of either of these can be used to prognosticate,
diagnose, treat, and inhibit one or more of these disorders.
INTERCEPT 394
[0418] A cDNA clone (designated jthKa041f02) encoding at least a
portion of human INTERCEPT 394 protein was isolated from a human
fetal kidney cDNA library. Human INTERCEPT 394 protein is predicted
by structural analysis to be a transmembrane protein.
[0419] The full length of the cDNA encoding human INTERCEPT 394
protein (SEQ ID NO: 201) is 3743 nucleotide residues. The ORF of
this cDNA, nucleotide residues 320 to 2653 of SEQ ID NO: 201 (i.e.,
SEQ ID NO: 202), encodes a 778-amino acid residue protein (SEQ ID
NO: 203), corresponding to a 778-residue transmembrane protein. It
is recognized that, in an alternative form, transcription of
INTERCEPT 394 protein can be initiated at the ATG codon located at
nucleotide residues 120-122 of SEQ ID NO 201. In this alternative
form, INTERCEPT 394 protein has, at the amino-terminal end of SEQ
ID NO: 203, an additional 61 amino acid residues, this additional
portion having the amino acid sequence encoded by nucleotide
residues 120-319 of SEQ ID NO: 201. In the following discussion,
molecules of the two forms of INTERCEPT 394 are referred to
individually and collectively as molecules of the corresponding
type (e.g., cDNA or protein).
[0420] The invention thus includes purified human INTERCEPT 394
protein, both in the form of the immature 778 amino acid residue
protein (SEQ ID NO: 203) and in the form of the mature 753 amino
acid residue protein (SEQ ID NO: 205). Mature human INTERCEPT 394
proteins can be synthesized without the signal sequence polypeptide
at the amino terminus thereof, or it can be synthesized by
generating immature INTERCEPT 394 protein and cleaving the signal
sequence therefrom.
[0421] The invention includes nucleic acid molecules which encode a
polypeptide of the invention. Such nucleic acids include, for
example, a DNA molecule having the nucleotide sequence listed in
SEQ ID NO: 201 or some portion thereof, such as the portion which
encodes mature human INTERCEPT 394 protein, immature human
INTERCEPT 394 protein, or a domain of human INTERCEPT 394 protein.
These nucleic acids are collectively referred to as nucleic acids
of the invention.
[0422] INTERCEPT 394 proteins and nucleic acid molecules encoding
them comprise a family of molecules having certain conserved
structural and functional features.
[0423] A common domain present in INTERCEPT 394 proteins is a
signal sequence. In one embodiment, a INTERCEPT 394 protein
contains a signal sequence corresponding to the portion of the
protein from amino acid residue 1 to about amino acid residue 25 of
SEQ ID NO: 203 (SEQ ID NO: 204). It is recognized that the carboxyl
terminal boundary of the signal sequence can be located one or two
residues from the residue identified above (i.e., at residue 23,
24, 25, 26, or 27 of SEQ ID NO: 203). The signal sequence is
cleaved during processing of the mature protein. INTERCEPT 394
proteins can include an extracellular domain. Human
[0424] INTERCEPT 394 protein extracellular domains are located at
about amino acid residues 88 to 228 and 337 to 345 of SEQ ID NO:
203 (i.e., the extracellular domains having the sequences SEQ ID
NOs: 208 and 212, respectively).
[0425] In addition, INTERCEPT 394 can include a transmembrane
domain. In one embodiment, a INTERCEPT 394 protein of the invention
contains transmembrane domains corresponding to about amino acid
residues 71 to 87, 229 to 253, 320 to 336, and 346 to 364 of SEQ ID
NO: 203 (i.e., the transmembrane domains having the sequences SEQ
ID NOs: 207, 209, 211, and 213, respectively).
[0426] The present invention includes INTERCEPT 394 proteins having
a cytoplasmic domain. The INTERCEPT 394 cytoplasmic domains are
located from about amino acid residue 26 to 70, 254 to 319, and 365
to 778 of SEQ ID NO: 203 (i.e., the cytoplasmic domains having the
sequences SEQ ID NOs: 206, 210, and 214, respectively).
[0427] In an alternative form, INTERCEPT 394 proteins have
cytoplasmic domains located at about amino acid residues 88 to 228
and 337 to 345 of SEQ ID NO: 203 (i.e., the cytoplasmic domains
having the sequences SEQ ID NOs: 208 and 212, respectively);
transmembrane domains corresponding to about amino acid residues 71
to 87, 229 to 253, 320 to 336, and 346 to 364 of SEQ ID NO: 203
(i.e., the transmembrane domains having the sequences SEQ ID NOs:
207, 209, 211, and 213, respectively); and extracellular domains
located from about amino acid residue 26 to 70, 254 to 319, and 365
to 778 of SEQ ID NO: 203 (i.e., the extracellular domains having
the sequences SEQ ID NOs: 206, 210, and 214, respectively).
[0428] INTERCEPT 394 proteins typically comprise a variety of
potential post-translational modification sites (often within an
extracellular domain), such as those described herein in Table
XIII, as predicted by computerized sequence analysis of INTERCEPT
394 proteins using amino acid sequence comparison software
(comparing the amino acid sequence of INTERCEPT 394 with the
information in the PROSITE database {rel. 12.2; February, 1995} and
the Hidden Markov Models database {Rel. PFAM 3.3}).
TABLE-US-00019 TABLE XIII Type of Potential Amino Acid Modification
Site Residues of Amino Acid or Domain SEQ ID NO: 203 Sequence
N-glycosylation site 38 to 41 NHSL 68 to 71 NGSL 163 to 166 NKSL
446 to 449 NFTV cAMP-/cGMP-dependent 671 to 674 RRES protein kinase
phosphorylation site Protein kinase C 62 to 64 SAR phosphorylation
site 129 to 131 TQK 207 to 209 SLK 226 to 228 SNR 568 to 570 SCR
604 to 606 TGR Casein kinase II 24 to 27 SCVD phosphorylation site
50 to 53 TLPD 118 to 121 TWQE 129 to 132 TQKE 143 to 146 TELD 254
to 257 SYAE 334 to 337 TIYD 400 to 403 TRDE 552 to 555 SESE 614 to
617 SGVD 626 to 629 SVWE 680 to 683 SAPD 767 to 770 SEDE Tyrosine
kinase 140 to 148 RELTELDIY phosphorylation site N-myristoylation
site 69 to 74 GSLITI 175 to 180 GLGEAV 185 to 190 GLKYNF 264 to 269
GALGAR 319 to 324 GAFFAG 354 to 359 GVTVTV 453 to 458 GVGDTC 477 to
482 GQTEAS 527 to 532 GAAASL 600 to 605 GQAPTG 630 to 635 GQLQSL
685 to 690 GGEGAR 709 to 714 GAPETT 752 to 757 GQSASR
[0429] In various embodiments, the protein of the invention has at
least 1, 2, 4, 6, 10, 15, or 20 or more of the post-translational
modification sites described herein in Table XIII.
[0430] The signal peptide prediction program SIGNALP (Nielsen et
al. (1997) Protein Engineering 10:1-6) predicted that human
INTERCEPT 394 protein includes an approximately 25 amino acid
signal peptide (amino acid residues 1 to about 25 of SEQ ID NO:
203; SEQ ID NO: 204) preceding the mature INTERCEPT 394 protein
(amino acid residues 26 to 778 of SEQ ID NO: 203; SEQ ID NO: 205).
Human INTERCEPT 394 protein includes two extracellular domains
(amino acid residues 88 to 228 and 337 to 345 of SEQ ID NO: 203;
SEQ ID NOs: 208 and 212, respectively), four transmembrane domains
(amino acid residues 71 to 87, 229 to 253, 320 to 336, and 346 to
364 of SEQ ID NO: 203; SEQ ID NOs: 207, 209, 211, and 213,
respectively), and three cytoplasmic domains (amino acid residues
26 to 70, 254 to 319, and 365 to 778 of SEQ ID NO: 203; SEQ ID NOs:
206, 210, and 214, respectively).
[0431] FIG. 28 depicts a hydrophobicity plot of human INTERCEPT 394
protein. Relatively hydrophobic regions are above the dashed
horizontal line, and relatively hydrophilic regions are below the
dashed horizontal line. The hydrophobic region which corresponds to
amino acid residues 1 to about 25 of SEQ ID NO: 203 is the signal
sequence of human INTERCEPT 394 (SEQ ID NO: 204). Hydrophobic
regions which corresponding to amino acid residues 71 to 87, 229 to
253, 320 to 336, and 346 to 364 of SEQ ID NO: 203 are the
transmembrane regions of INTERCEPT 394 (SEQ ID NOs: 207, 209, 211,
and 213, respectively). As described elsewhere herein, relatively
hydrophilic regions are generally located at or near the surface of
a protein, and are more frequently effective immunogenic epitopes
than are relatively hydrophobic regions. For example, the region of
human INTERCEPT 394 protein from about amino acid residue 205 to
about amino acid residue 225 appears to be located at or near the
surface of the protein, while the region from about amino acid
residue 410 to about amino acid residue 340 appears not to be
located at or near the surface.
[0432] The predicted molecular weight of human INTERCEPT 394
protein without modification and prior to cleavage of the signal
sequence is about 87.4 kilodaltons. The predicted molecular weight
of the mature human INTERCEPT 394 protein without modification and
after cleavage of the signal sequence is about 84.5 kilodaltons.
Nucleotide residues 2944 to 3482 of the reverse complement of SEQ
ID NO: 201 exhibits significant homology with EST clone BJ38, which
is disclosed in an international patent application having PCT
Publication No. WO98/45435. The ESTs described in that application
were isolated from human tissues. This is an indication that
INTERCEPT 394 is expressed in the same tissues as this EST clone
and thus is involved in normal and aberrant physiological processes
in these tissues.
[0433] Uses of INTERCEPT 394 Nucleic acids,
[0434] Polypeptides, and Modulators Thereof
[0435] INTERCEPT 394 proteins are involved in disorders which
affect both tissues in which they are normally expressed and
tissues in which they are normally not expressed. Based on the
observations that cDNA corresponding to INTERCEPT 394 occurs in a
human fetal kidney cDNA library, it is evident that INTERCEPT 394
protein is involved in one or more biological processes which occur
in kidney and other fetal and adult human tissues. In particular,
INTERCEPT 394 is involved in modulating one or more of growth,
proliferation, survival, differentiation, activity, morphology, and
movement/migration of cells of kidney and other tissues. Thus,
INTERCEPT 394 has a role in disorders which affect kidney and other
tissues and one or more of growth, proliferation, survival,
differentiation, activity, morphology, and movement/migration of
cells in those tissues, as well as the biological function of
organs (e.g., the kidneys) comprising such tissues. Examples of
kidney disorders are described elsewhere in this disclosure.
[0436] The relatively large size of the carboxyl-terminal
cytoplasmic domain of INTERCEPT 394 is an indication that INTERCEPT
394 protein is involved in modulation of one or more intracellular
processes. The presence of extracellular domains indicates that the
activity of INTERCEPT 394 can be modulated by binding thereto of
ligands (i.e., either naturally-occurring ligands or
non-naturally-occurring ligands such as pharmaceutical agents).
Because INTERCEPT 394 protein is an integral membrane protein, it
is capable of exerting its physiological effect either by itself or
in combination with one or more other membrane proteins. INTERCEPT
394 is thus involved in either or both of generation of signals
which can be transmitted either to another protein (or other
molecule) on the same side of the membrane or to a protein (or
other molecule) on the opposite side of the membrane the membrane.
INTERCEPT 394 can transmit such signals by binding a ligand,
whereby its conformation is altered such that the ability of
INTERCEPT 394 to interact with another molecule (e.g., to catalyze
a reaction involving the molecule or by binding with the molecule)
is altered upon binding the ligand. Alternatively, INTERCEPT 394
can be altered by being post-translationally modified (e.g.,
phosphorylated, glycosylated, or myristoylated) such that the
ability of INTERCEPT 394 to interact with another molecule is
altered upon post-translational modification.
[0437] Involvement of INTERCEPT 394 in one or more signal
transmission pathways is an indication that INTERCEPT 394 is
involved in physiological pathways involving such transmission.
Thus, INTERCEPT 394 is also involved in disorders which involve
these signal transmission pathways. Examples of physiological
pathways that involve signal transmission include cell nutrition
and metabolism, cell proliferation, cell differentiation,
apoptosis, chemotactic and chemokinetic activities, cell
aggregation and attachment, cell movement, immune stimulation,
hematopoiesis, metastasis, and the like. INTERCEPT 394 is thus
involved in disorders relating to aberrant activity of one or more
of these signal transmission pathways. Such disorders include, for
example, carcinogenesis, tumor growth, tumor metastasis,
angiogenesis, apoptosis, inappropriate blood coagulation (e.g.,
that involved in atherosclerosis, arteriosclerosis, and stroke),
immune hypo- and hyper-stimulation, cell metabolism disorders
(e.g., diabetes), endocrine disorders (e.g., hypo- and
hyper-thyroidism), mineral import and export disorders (e.g.,
osteoporosis, kidney stone formation, and hemochromatosis), and the
like.
[0438] Presence of INTERCEPT 394 in the membrane of cells in which
it is expressed indicates that INTERCEPT 394 can be used as a
diagnostic target for detection or imaging of such cells.
Furthermore, a portion of INTERCEPT 394 (e.g., an extracellular
domain) can be used to interfere with binding of a virus which
normally binds with INTERCEPT 394, thereby inhibiting, reducing, or
eliminating pathological effects associated with infection of a
human by the virus.
INTERCEPT 400
[0439] A cDNA clone (designated jthkf014a09) encoding at least a
portion of human INTERCEPT 400 protein was isolated from a human
normal embryonic keratinocyte cDNA library. A corresponding murine
cDNA clone (designated jtmba232b12) was isolated from a brain
polysome cDNA library. Human and murine INTERCEPT 400 proteins are
predicted by structural analysis to be transmembrane proteins.
[0440] The full length of the cDNA encoding human INTERCEPT 400
protein (SEQ ID NO: 221) is 2989 nucleotide residues. The open
reading frame (ORF) of this cDNA, nucleotide residues 206 to 1000
of SEQ ID NO: 221 (i.e., SEQ ID NO: 222), encodes a 265-amino acid
residue immature protein (SEQ ID NO: 223), corresponding to a
219-residue transmembrane protein.
[0441] The invention thus includes purified human INTERCEPT 400
protein, both in the form of the immature 265 amino acid residue
protein (SEQ ID NO: 223) and in the form of the mature 219 amino
acid residue protein (SEQ ID NO: 225). The invention also includes
purified murine INTERCEPT 400 protein, which is a 180-amino acid
residue transmembrane protein (SEQ ID NO: 243). Mature human
INTERCEPT 400 proteins can be synthesized without the signal
sequence polypeptide at the amino terminus thereof, or it can be
synthesized by generating immature INTERCEPT 400 protein and
cleaving the signal sequence therefrom.
[0442] The invention includes nucleic acid molecules which encode a
polypeptide of the invention. Such nucleic acids include, for
example, a DNA molecule having the nucleotide sequence listed in
SEQ ID NO: 221 or some portion thereof or SEQ ID NO: 241 or some
portion thereof, such as the portion which encodes mature human or
murine INTERCEPT 400 protein, immature human INTERCEPT 400 protein,
or a domain of human or murine INTERCEPT 400 protein. These nucleic
acids are collectively referred to as nucleic acids of the
invention.
[0443] INTERCEPT 400 proteins and nucleic acid molecules encoding
them comprise a family of molecules having certain conserved
structural and functional features.
[0444] A common domain present in INTERCEPT 400 proteins is a
signal sequence. In one embodiment, a INTERCEPT 400 protein
contains a signal sequence corresponding to the portion of the
protein from amino acid residue 1 to about amino acid residue 46 of
SEQ ID NO: 223 (SEQ ID NO: 224). It is recognized that the carboxyl
terminal boundary of the signal sequence can be located one or two
residues from the residue identified above (i.e., at residue 44,
45, 46, 47, or 48 of SEQ ID NO: 223). The signal sequence is
cleaved during processing of the mature protein.
[0445] INTERCEPT 400 proteins can also include an extracellular
domain. Human INTERCEPT 400 protein includes extracellular domains
located from about amino acid residues 47 to 62, 154 to 164, and
218 to 231 of SEQ ID NO: 223 (i.e., the extracellular domains
having the amino acid sequences SEQ ID NOs: 226, 230, and 234,
respectively). Murine INTERCEPT 400 protein includes extracellular
domains located from about amino acid residues 61 to 71 and 125 to
140 of SEQ ID NO: 243 (i.e., these extracellular domains having the
amino acid sequences SEQ ID NOs: 246 and 250, respectively).
[0446] In addition, INTERCEPT 400 can include a transmembrane
domain. Human INTERCEPT 400 protein includes transmembrane domains
corresponding to about amino acid residues 63 to 79, 137 to 153,
165 to 183, 194 to 217, and 232 to 251 of SEQ ID NO: 223 (i.e., the
transmembrane domains having the sequences SEQ ID NOs: 227, 229,
231, 233, and 235, respectively). Murine INTERCEPT 400 protein
includes transmembrane domains corresponding to about amino acid
residues 44 to 60, 72 to 90, 101 to 124, and 141 to 160 of SEQ ID
NO: 243 (i.e., the transmembrane domains having the sequences SEQ
ID NOs: 245, 247, 249, and 251, respectively).
[0447] The present invention includes INTERCEPT 400 proteins having
a cytoplasmic domain. Human INTERCEPT 400 cytoplasmic domains are
located from about amino acid residue 80 to 136, 184 to 193, and
252 to 265 of SEQ ID NO: 223 (i.e., the cytoplasmic domains having
the sequences SEQ ID NOs: 228, 232, and 236, respectively). Murine
INTERCEPT 400 cytoplasmic domains are located from about amino acid
residue 1 to 43, 91 to 100, and 161 to 174 of SEQ ID NO: 243 (i.e.,
the cytoplasmic domains having the sequences SEQ ID NOs: 244, 248,
and 252, respectively).
[0448] It is recognized that, in one form, murine INTERCEPT 400
protein can include an amino terminal portion approximately 60-120
(likely 80-100) amino acid residues in length.
[0449] In an alternative embodiment, human INTERCEPT 400 proteins
have cytoplasmic domains located from about amino acid residues 47
to 62, 154 to 164, and 218 to 231 of SEQ ID NO: 223 (i.e., the
cytoplasmic domains having the amino acid sequences SEQ ID NOs:
226, 230, and 234, respectively); transmembrane domains
corresponding to about amino acid residues 63 to 79, 137 to 153,
165 to 183, 194 to 217, and 232 to 251 of SEQ ID NO: 223 (i.e., the
transmembrane domains having the sequences SEQ ID NOs: 227, 229,
231, 233, and 235, respectively); and extracellular domains are
located from about amino acid residue 80 to 136, 184 to 193, and
252 to 265 of SEQ ID NO: 223 (i.e., the extracellular domains
having the sequences SEQ ID NOs: 228, 232, and 236,
respectively).
[0450] In an alternative embodiment, murine INTERCEPT 400 proteins
have cytoplasmic domains located from about amino acid residues 61
to 71 and 125 to 140 of SEQ ID NO: 243 (i.e., these cytoplasmic
domains having the amino acid sequences SEQ ID NOs: 246 and 250,
respectively); transmembrane domains corresponding to about amino
acid residues 44 to 60, 72 to 90, 101 to 124, and 141 to 160 of SEQ
ID NO: 243 (i.e., the transmembrane domains having the sequences
SEQ ID NOs: 245, 247, 249, and 254, respectively); and
extracellular domains are located from about amino acid residue 1
to 43, 91 to 100, and 161 to 174 of SEQ ID NO: 243 (i.e., the
extracellular domains having the sequences SEQ ID NOs: 244, 248,
and 255, respectively).
[0451] INTERCEPT 400 proteins typically comprise a variety of
potential post-translational modification sites (often within an
extracellular domain), such as those described herein in Tables XIV
(for human INTERCEPT 400) and XV (for murine INTERCEPT 400), as
predicted by computerized sequence analysis of INTERCEPT 400
proteins using amino acid sequence comparison software (comparing
the amino acid sequence of INTERCEPT 400 with the information in
the PROSITE database {rel. 12.2; February, 1995} and the Hidden
Markov Models database {Rel. PFAM 3.3}).
TABLE-US-00020 TABLE XIV Type of Potential Amino Acid Modification
Site Residues of Amino Acid or Domain SEQ ID NO: 223 Sequence
N-glycosylation site 2 to 5 NMSV cAMP-/cGMP-dependent 259 to 262
RKTT protein kinase phosphorylation site Protein kinase C 155 to
157 SYK phosphorylation site 191 to 193 SRK 261 to 263 TTK Casein
kinase II 7 to 10 TLQE phosphorylation site 97 to 100 SVCD 155 to
158 SYKD 262 to 265 TKAE N-myristoylation site 77 to 82 GALRTG 93
to 98 GLKQSV 209 to 214 GCVVNY
TABLE-US-00021 TABLE XV Type of Potential Amino Modification Site
Amino Acid Residues Acid or Domain of SEQ ID NO: 243 Sequence
cAMP-/cGMP-dependent 168 to 171 KKAT protein kinase phosphorylation
site Protein kinase C 62 to 64 SYK phosphorylation site 98 to 100
SRK Casein kinase II 4 to 7 SVCD phosphorylation site 62 to 65 SYKD
171 to 174 TKAE N-myristoylation site 116 to 121 GCVINY
[0452] In various embodiments, the protein of the invention has at
least 1, 2, 4, 6, 10, 15, or 20 or more of the post-translational
modification sites described herein in Tables XIV and XV.
[0453] The signal peptide prediction program SIGNALP (Nielsen et
al. (1997) Protein Engineering 10:1-6) predicted that human
INTERCEPT 400 protein includes an approximately 46 amino acid
signal peptide (amino acid residues 1 to about 46 of SEQ ID NO:
223; SEQ ID NO: 224) preceding the mature INTERCEPT 400 protein
(amino acid residues 47 to 265 of SEQ ID NO: 223; SEQ ID NO: 225).
Human INTERCEPT 400 protein includes three extracellular domains
(amino acid residues 47 to 62, 154 to 164, and 218 to 231 of SEQ ID
NO: 223; SEQ ID NOs: 226, 230, and 234, respectively), five
transmembrane domains (amino acid residues 63 to 79, 137 to 153,
165 to 183, 194 to 217, and 232 to 251 of SEQ ID NO: 223; SEQ ID
NOs: 227, 229, 231, 233, and 235, respectively), and three
intracellular domains (amino acid residues 80 to 136, 184 to 193,
and 252 to 265 of SEQ ID NO: 223; SEQ ID NOs: 228, 232, and 236,
respectively).
[0454] FIG. 29 depicts a hydrophobicity plot of human INTERCEPT 400
protein. Relatively hydrophobic regions are above the dashed
horizontal line, and relatively hydrophilic regions are below the
dashed horizontal line. The hydrophobic region which corresponds to
amino acid residues 1 to about 46 of SEQ ID NO: 223 is the signal
sequence of human INTERCEPT 400 (SEQ ID NO: 224). As described
elsewhere herein, relatively hydrophilic regions are generally
located at or near the surface of a protein, and are more
frequently effective immunogenic epitopes than are relatively
hydrophobic regions. For example, the region of human INTERCEPT 400
protein from about amino acid residue 218 to about amino acid
residue 231 appears to be located at or near the surface of the
protein, while the region from about amino acid residue 80 to about
amino acid residue 95 appears not to be located at or near the
surface.
[0455] The predicted molecular weight of human INTERCEPT 400
protein without modification and prior to cleavage of the signal
sequence is about 31.4 kilodaltons. The predicted molecular weight
of the mature human INTERCEPT 400 protein without modification and
after cleavage of the signal sequence is about 25.8
kilodaltons.
[0456] Human INTERCEPT 400 exhibits sequence similarity to murine
Cig30 protein (GENBANK.TM. Accession No. U97107), as indicated
herein in FIG. 33, which lists an alignment (made using the ALIGN
software; pam120.mat scoring matrix; gap penalties -12/-4) of the
amino acid sequences of these proteins. FIGS. 34A-34C depict an
alignment (also made using the ALIGN software; pam120.mat scoring
matrix; gap penalties -12/-4) of the nucleotide sequences of the
ORFs of human INTERCEPT 400 (SEQ ID NO: 222) and Cig30 (SEQ ID NO:
238). In these alignments (made using the ALIGN software;
pam120.mat scoring matrix, gap penalties -12/-4), the amino acid
sequences of these two proteins are 43.3% identical and the ORF
nucleotide sequences corresponding to these two proteins are 56.8%
identical. The cDNAs corresponding to these two proteins were found
to be 48.4% identical using the LALIGN software (pam120.mat scoring
matrix; gap penalties -12/-4).
[0457] The length of the incomplete cDNA encoding the
carboxyl-terminal portion of murine INTERCEPT 400 protein (SEQ ID
NO: 241) is 2032 nucleotide residues. The ORF of this cDNA,
nucleotide residues 3 to 524 (SEQ ID NO: 242), encodes a protein
comprising at least 180 amino acid residues (SEQ ID NO: 243). It is
recognized that murine INTERCEPT 400 protein has about 60-120, more
likely 80-100, additional amino acid residues at the amino terminal
end thereof.
[0458] The signal peptide prediction program SIGNALP (Nielsen et
al. (1997) Protein Engineering 10:1-6) predicted that the portion
of murine INTERCEPT 400 protein described herein includes at least
two extracellular domains (amino acid residues 61 to 71 and 125 to
140 of SEQ ID NO: 243; SEQ ID NOs: 246 and 250, respectively), at
least four transmembrane domains (amino acid residues 44 to 60, 72
to 90, 101 to 124, and 141 to 160 of SEQ ID NO: 243; SEQ ID NOs:
245, 247, 249, and 254, respectively), and at least three
cytoplasmic domains (amino acid residue 1 to 43, 91 to 100, and 161
to 174 of SEQ ID NO: 243; SEQ ID NOs: 244, 248, and 255,
respectively).
[0459] FIG. 30 depicts a hydrophobicity plot of murine INTERCEPT
400 protein. Relatively hydrophobic regions are above the dashed
horizontal line, and relatively hydrophilic regions are below the
dashed horizontal line. Hydrophobic regions corresponds to the
identified transmembrane regions of murine INTERCEPT 400. As
described elsewhere herein, relatively hydrophilic regions are
generally located at or near the surface of a protein, and are more
frequently effective immunogenic epitopes than are relatively
hydrophobic regions. For example, the region from about amino acid
residue 125 to about amino acid residue 140 appears to be located
at or near the surface of the protein, while the region from about
amino acid residue 14 to about amino acid residue 19 appears not to
be located at or near the surface
[0460] The predicted molecular weight of the portion of murine
INTERCEPT 400 protein described herein is about 20.6
kilodaltons.
[0461] Human and murine INTERCEPT 400 proteins exhibit considerable
sequence similarity, as indicated herein in FIGS. 31 and 32A-32C.
FIG. 31 depicts an alignment of human and murine INTERCEPT 400
amino acid sequences (SEQ ID NOs: 223 and 243, respectively). In
this alignment (made using the ALIGN software; pam120.mat scoring
matrix; gap penalties -12/-4), the proteins are 94.8% identical in
the overlapping region (i.e., 163 identical residues out of 172
residues in the overlapping region, which includes amino acid
residues 94-265 of SEQ ID NO: 223 and amino acid residues 1-174 of
SEQ ID NO: 243). The human and murine ORFs encoding INTERCEPT 400
are 92.8% identical in the overlapping portions (i.e., nucleotide
residues 280-795 of SEQ ID NO: 222 and nucleotide residues 1-522 of
SEQ ID NO: 242), as assessed using the same software and parameters
and as indicated in FIGS. 32A-32C in an alignment made using the
ALIGN software (pam120.mat scoring matrix; gap penalties
-12/-4).
[0462] The partial nucleotide sequences of a rat cDNA clone
(designated jtmba232b12; SEQ ID NO: 251) and ORF (SEQ ID NO: 252)
encoding INTERCEPT 400 (SEQ ID NO: 253). An alignment (made using
the ALIGN software; pam120.mat scoring matrix; gap penalties
-12/-4) of human, murine and rat INTERCEPT 400 amino acid sequences
is listed in FIG. 35.
[0463] Uses of INTERCEPT 400 Nucleic acids,
[0464] Polypeptides, and Modulators Thereof
[0465] INTERCEPT 400 proteins are involved in disorders which
affect both tissues in which they are normally expressed and
tissues in which they are normally not expressed. Based on the
observations that cDNA corresponding to INTERCEPT 400 occurs in a
human normal embryonic keratinocyte cDNA library and in a murine
brain polysome cDNA library, it is evident that INTERCEPT 400
protein is involved in one or more biological processes which occur
in these tissues. In particular, INTERCEPT 400 is involved in
modulating one or more of growth, proliferation, survival,
differentiation, activity, morphology, and movement/migration of
cells of these tissues. INTERCEPT 400 is involved in modulating the
structure of extracellular matrix which contacts or is in fluid
communication with cells of these tissues. Thus, INTERCEPT 400 has
a role in disorders which affect these cells and one or more of
their growth, proliferation, survival, differentiation, activity,
morphology, and movement/migration, as well as the biological
function of organs comprising one or more of these tissues.
[0466] Examples of brain disorders are described elsewhere in this
disclosure. INTERCEPT 400 proteins, nucleic acids encoding them,
and agents that modulate activity or expression of either of these
can be used to prognosticate, diagnose, treat, and inhibit one or
more of these disorders.
[0467] Examples of skin disorders with which INTERCEPT 400 can be
associated are described elsewhere in this disclosure. INTERCEPT
400 proteins, nucleic acids encoding them, and agents that modulate
activity or expression of either of these can be used to
prognosticate, diagnose, treat, and inhibit one or more of these
disorders.
[0468] Murine Cig30 protein, with which human INTERCEPT 400 shares
significant amino acid sequence homology, is an integral membrane
protein that is involved in recruitment and thermogenesis in brown
adipose tissue in mice (Tvrdik et al., 1997, J. Biol. Chem.
272:31738-31746). Yeast proteins which share significant homology
with murine Cig30 and human, murine, and rat INTERCEPT 400 protein
include proteins encoded by yeast genes SUR4 (APA1) and FEN1
(GNS1). These proteins are involved in phospholipid metabolism,
sterol synthesis, budding, activation of glucose-regulated genes,
glucose uptake, and glucan synthesis (Desfarges et al., 1993, Yeast
9:267-277; Silve et al., 1996, Mol. Cell. Biol. 16:2719-2727;
Durrens et al., 1995, Curr. Genet. 27:213-216; Garcia-Arranz, 1994,
J. Biol. Chem. 269:18076-18082; El-Sherbeini et al., 1995, J.
Bacteriol. 177:3227-3234). These activities relate to remodeling of
the plasma membrane and actin cytoskeleton in response to growth
signals, most likely by modulating interaction between membrane
phospholipids and the cytoskeleton. Thus, INTERCEPT 400 protein is
involved in one or more of these activities, such as in immune
stimulation, proliferation of leukocytes, generation and
prolongation of an immune response, control of cellular metabolic
processes, and the like.
[0469] INTERCEPT 400 is involved in generation, accumulation, and
regulation of brown adipose tissue and other adipose tissues in
humans, and is therefore involved in body temperature regulation,
lipid metabolism, carbohydrate metabolism, body weight regulation,
and the like. Thus, INTERCEPT 400 is implicated in disorders which
relate to aberrance or imbalance in the normal physiological
regulation of these processes. INTERCEPT 400 is also involved in
disorders which relate to aberrant proliferation and growth of
cells. Examples of disorders in which INTERCEPT 400 is involved
include obesity, unusual susceptibility or insensitivity to heat or
cold, diabetes, arteriosclerosis, atherosclerosis, cancer, hypo-
and hyper-immune disorders (e.g., acquired immune deficiency
syndrome and auto-immune disorders), immune proliferation, and the
like. INTERCEPT 400 proteins, nucleic acids encoding them, and
agents that modulate activity or expression of either of these can
be used to prognosticate, diagnose, treat, and inhibit one or more
of these disorders.
[0470] Chromosomal mapping data have been used to locate the gene
encoding human INTERCEPT 400 at chromosome 4, between markers
D4S1616 and D4S1611 (115.8-119.6 centimorgans). A form of iris
hypoplasia associated with early onset glaucoma has been linked
with this chromosomal region. Human INTERCEPT 400 allelic variants
can include INTERCEPT 400 nucleotide sequence polymorphisms (e.g.,
nucleotide sequences that vary from SEQ ID NO: 221) that map to
this chromosomal region.
INTERCEPT 217
[0471] A cDNA clone (designated jthqc035f08) encoding at least a
portion of human INTERCEPT 217 protein was isolated from a human
prostate cDNA library. The human INTERCEPT 217 protein is predicted
by structural analysis to be a transmembrane protein. In addition,
cDNA clones (including those designated jtmca047g07, jTmob373b05,
and jambd078d12) encoding at least a portion of murine INTERCEPT
217 protein were isolated from murine cDNA libraries.
[0472] The full length of the cDNA encoding human INTERCEPT 217
protein (SEQ ID NO: 271) is 2895 nucleotide residues. The ORF of
this cDNA, nucleotide residues 215 to 1579 of SEQ ID NO: 271 (i.e.,
SEQ ID NO: 272), encodes a 455-amino acid transmembrane protein
(SEQ ID NO: 273): The murine ORF (SEQ ID NO: 362) comprises at
least 962 nucleotide residues. The protein encoded by the murine
ORF comprises at least 320 amino acid residues (i.e., SEQ ID NO:
363), and is also a transmembrane protein.
[0473] The invention also includes purified human INTERCEPT 217
protein, both in the form of the immature 455 amino acid residue
protein (SEQ ID NO: 273) and in the form of the mature,
approximately 435 amino acid residue protein (SEQ ID NO: 275).
Mature human INTERCEPT 217 protein can be synthesized without the
signal sequence polypeptide at the amino terminus thereof, or it
can be synthesized by generating immature INTERCEPT 217 protein and
cleaving the signal sequence therefrom.
[0474] The invention thus includes purified murine INTERCEPT 217
protein, both in the immature form comprising the 320 amino acid
residues of SEQ ID NO: 363 and in the mature form comprising the
approximately 305 carboxyl terminal amino acid residues of SEQ ID
NO: 363 (i.e., comprising SEQ ID NO: 365). Mature murine INTERCEPT
217 protein can be synthesized without the signal sequence
polypeptide at the amino terminus thereof, or it can be synthesized
by generating immature INTERCEPT 217 protein and cleaving the
signal sequence therefrom.
[0475] The invention includes nucleic acid molecules which encode
an INTERCEPT 217 polypeptide of the invention. Such nucleic acids
include, for example, a DNA molecule having the nucleotide sequence
listed in SEQ ID NO: 271, in SEQ ID NO: 362 (i.e., the murine ORF),
or in some portion of either of these, such as the portion which
encodes mature human INTERCEPT 217 protein, immature human
INTERCEPT 217 protein, or a domain of human INTERCEPT 217 protein.
These nucleic acids are collectively referred to as INTERCEPT 217
nucleic acids of the invention.
[0476] INTERCEPT 217 proteins and nucleic acid molecules encoding
them comprise a family of molecules having certain conserved
structural and functional features. Each of these molecules is
included in the invention.
[0477] A common domain present in INTERCEPT 217 proteins is a
signal sequence. In one embodiment, a INTERCEPT 217 protein
contains a signal sequence corresponding to about amino acid
residues 1 to 20 of SEQ ID NO: 273 (SEQ ID NO: 274). The signal
sequence is cleaved during processing of the mature protein.
[0478] INTERCEPT 217 proteins can include an extracellular domain.
The human INTERCEPT 217 protein extracellular domain is located
from about amino acid residue 21 to about amino acid residue 383 of
SEQ ID NO: 273 (SEQ ID NO: 276). The murine INTERCEPT 217 protein
extracellular domain is located from about amino acid residue 17 to
about amino acid residue 213 of SEQ ID NO: 363 (SEQ ID NO:
366).
[0479] In addition, INTERCEPT 217 includes a transmembrane domain.
As used herein, a "transmembrane domain" refers to an amino acid
sequence which is at least about 20 to 25 amino acid residues in
length and which contains at least about 65-70% hydrophobic amino
acid residues such as alanine, leucine, phenylalanine, protein,
tyrosine, tryptophan, or valine. In a preferred embodiment, a
transmembrane domain contains at least about 15 to 30 amino acid
residues, preferably about 20-25 amino acid residues, and has at
least about 60-80%, more preferably 65-75%, and more preferably at
least about 70% hydrophobic residues. Thus, in one embodiment, an
INTERCEPT 217 protein of the invention contains a transmembrane
domain corresponding to about amino acid residues 384 to 403 of SEQ
ID NO: 273 (SEQ ID NO: 277) or to about amino acid residues 214 to
233 of SEQ ID NO: 363 (SEQ ID NO: 367).
[0480] The present invention includes INTERCEPT 217 proteins having
a cytoplasmic domain, particularly including proteins having a
carboxyl-terminal cytoplasmic domain. The human INTERCEPT 217
cytoplasmic domain is located from about amino acid residue 404 to
amino acid residue 455 of SEQ ID NO: 273 (SEQ ID NO: 278). The
murine INTERCEPT 217 cytoplasmic domain is located from about amino
acid residue 234 to amino acid residue 320 of SEQ ID NO: 363 (SEQ
ID NO: 368).
[0481] In one embodiment, the amino acid residues of human
INTERCEPT 217 corresponding to SEQ ID NO: 278 are part of an
extracellular domain, and the amino acid residues corresponding to
SEQ ID NO: 276 are part of a cytoplasmic domain. In another
embodiment, the amino acid residues of murine INTERCEPT 217
corresponding to SEQ ID NO: 368 are part of an extracellular
domain, and the amino acid residues corresponding to SEQ ID NO: 366
are part of a cytoplasmic domain.
[0482] INTERCEPT 217 proteins typically comprise a variety of
potential post-translational modification sites (often within an
extracellular domain), such as those described herein in Tables
XVIA (for human INTERCEPT 217) and XVIB (for murine INTERCEPT 217),
as predicted by computerized sequence analysis of INTERCEPT 217
proteins using amino acid sequence comparison software (comparing
the amino acid sequence of INTERCEPT 217 with the information in
the PROSITE database {rel. 12.2; February, 1995} and the Hidden
Markov Models database {Rel. PFAM 3.3}). In certain embodiments, a
protein of the invention has at least 1, 2, 4, 6, or 10 or more of
the post-translational modification sites listed in Tables XVIA and
XVIB.
TABLE-US-00022 TABLE XVIA Type of Potential Amino Acid Amino
Modification Site Residues of Acid or Domain SEQ ID NO: 273
Sequence N-glycosylation site 107 to 110 NASG 272 to 275 NCSS 301
to 304 NTSV 362 to 365 NQTH 368 to 371 NVSV Protein kinase C 120 to
122 TLR phosphorylation site 192 to 194 SNR 295 to 297 SLR Casein
kinase II 199 to 202 SVPE phosphorylation site 440 to 443 TPPD
Tyrosine Kinase 282 to 289 KRPEEHLY Phosphorylation Site
N-myristoylation site 8 to 13 GTLLCM 19 to 24 GTPDSE 103 to 108
GVFVNA 179 to 184 GLSATH 323 to 328 GSRDGS 348 to 353 GLFVCL 390 to
395 GCAVGL 449 to 454 GQASTS Leucine zipper pattern 45 to 66
Leucine rich repeat amino 33 to 61 terminal domain (LLRNT) Leucine
rich repeat (LRR) 62 to 85 Domain 86 to 109 110 to 133 134 to 157
158 to 181 184 to 207 Leucine rich repeat 219 to 274 carboxyl
terminal (LLRCT) domain
TABLE-US-00023 TABLE XVIB Type of Potential Amino Acid Amino
Modification Site Residues of Acid or Domain SEQ ID NO: 363
Sequence N-glycosylation site 102 to 105 NCSV 131 to 134 NTSV 192
to 195 NQTL 198 to 201 NVSV cAMP- and cGMP-dependent 280 to 283
RKAS protein kinase site Protein kinase C 125 to 127 SLR
phosphorylation site 143 to 145 SPK 279 to 281 SRK Casein kinase II
29 to 32 SIPE phosphorylation site 273 to 276 TPPD N-myristoylation
site 9 to 14 GLGLTR 178 to 183 GVFVCL 220 to 225 GCIVGL 239 to 244
GCCHCC Amidation Site 293 to 296 PGKK Immunoglobulin Domain 14 to
37 Leucine rich repeat (LRR) 49 to 104 Domain Leucine rich repeat
123 to 184 carboxyl terminal (LLRCT) domain
[0483] Among the domains that occur in INTERCEPT 217 proteins are
LRR domains, LRRNT domains, LRRCT domains, and immunoglobulin
domains. In one embodiment, the protein of the invention has at
least one domain that is at least 55%, preferably at least about
65%, more preferably at least about 75%, yet more preferably at
least about 85%, and most preferably at least about 95% identical
to one of these domains. In other embodiments, the protein has at
least one of each of the LRR, LRRNT, and LRRCT domains described
herein in Tables XVIA and XVIB. In other embodiments, the protein
has at least one LRRNT domain, at least one LRRCT domain, and a
plurality of (e.g., 2, 3, 4, or more) LRR domains.
[0484] One or more LRR domains are present in a variety of proteins
involved in protein-protein interactions. Such proteins include,
for example, proteins involved in signal transduction, cell-to-cell
adhesion, cell-to-extracellular matrix adhesion, cell development,
DNA repair, RNA processing, and cellular molecular recognition
processes. Specialized LRR domains, designated LRR amino terminal
(LRRNT) domains and LRR carboxyl terminal (LRRCT) domains often
occur near the amino and carboxyl, respectively, ends of a series
of LRR domains. Human INTERCEPT 217 protein has eight clustered LRR
domains, including (from the amino terminus toward the carboxyl
terminus of INTERCEPT 217) an LRRNT domain, six LRR domains, and an
LRRCT domain.
[0485] The organization of LRR domains in human INTERCEPT 217
protein closely mirrors the organization of LRR domains in human
platelet glycoprotein IB alpha chain precursor (GP-IB.alpha.),
which also has eight clustered LRR domains from about amino acid
residue 19 to about amino acid residue 281 thereof. The eight LRR
domains of GP-IB.alpha. include an LRRNT domain at the end of the
cluster nearest the amino terminus of GP-IB.alpha. and an LRRCT
domain at the end of the cluster nearest the carboxyl terminus of
GP-IB.alpha.. GP-IB.alpha. is a membrane-bound protein of human
platelets that is involved in binding of von Willebrand's factor
and in aggregation of platelets during thrombus formation. Thus,
INTERCEPT 217 is involved in both normal and aberrant physiological
activities involving blood clotting and thrombus formation.
Examples of disorders involving such activities include, for
example, stroke, embolism (e.g., cerebral, renal, and pulmonary
emboli), hemophilia, restenotic injury, prosthesis-associated
thrombogenesis, atherosclerosis, and arteriosclerosis.
[0486] INTERCEPT 217 is involved in one or more physiological
processes in which these other LRR domain-containing proteins are
involved, namely binding of cells with extracellular proteins such
as soluble extracellular proteins and cell surface proteins of
other cells.
[0487] Human INTERCEPT 217 comprises a leucine zipper region at
about amino acid residue 45 to about amino acid residue 66 (i.e.,
45 LsctglgLqdvpaeLpaa tadL 66; SEQ ID NO: 459). Leucine zipper
regions are known to be involved in dimerization of proteins.
Leucine zipper regions interact with one another, leading to
formation of homo- or hetero-dimers between proteins, depending on
their identity. The presence in INTERCEPT 217 of a leucine zipper
region is a further indication that this protein is involved in
protein-protein interactions.
[0488] The amino acid sequence of human INTERCEPT 217 protein
includes multiple potential proline-rich Src homology 3 (SH3)
domain binding sites in the cytoplasmic portion of the protein. SH3
domains mediate specific assembly of protein complexes, presumably
by interacting with proline-rich protein domains (Morton and
Campbell (1994) Curr. Biol. 4:615-617). SH3 domains also mediate
interactions between proteins involved in transmembrane signal
transduction. Coupling of proteins mediated by SH3 domains has been
implicated in a variety of physiological systems, including those
involving regulation of cell growth and proliferation, endocytosis,
and activation of respiratory burst.
[0489] SH3 domains have been described in the art (e.g., Mayer et
al. (1988) Nature 332:272-275; Musacchio et al. (1992) FEBS Lett.
307:55-61; Pawson and Schlessinger (1993) Curr. Biol. 3:434-442;
Mayer and Baltimore (1993) Trends Cell Biol. 3:8-13; Pawson (1993)
Nature 373:573-580), and occur in a variety of cytoplasmic
proteins, including several (e.g., protein tyrosine kinases)
involved in transmembrane signal transduction. Among the proteins
in which one or more SH3 domains occur are protein tyrosine kinases
such as those of the Src, Abl, Bkt, Csk and ZAP70 families,
mammalian phosphatidylinositol-specific phospholipases C-gamma-1
and -2, mammalian phosphatidylinositol 3-kinase regulatory p85
subunit, mammalian Ras GTPase-activating protein (GAP), proteins
which mediate binding of guanine nucleotide exchange factors and
growth factor receptors (e.g., vertebrate GRB2, Caenorhabditis
elegans sem-5, and Drosophila DRK proteins), mammalian Vav
oncoprotein, guanidine nucleotide releasing factors of the CDC 25
family (e.g., yeast CDC25, yeast SCD25, and fission yeast step6
proteins), MAGUK proteins (e.g., mammalian tight junction protein
ZO-1, vertebrate erythrocyte membrane protein p55, C. elegans
protein lin-2, rat protein CASK, and mammalian synaptic proteins
SAP90/PSD-95, CHAPSYN-110/PSD-93, SAP97/DLG1, and SAP102), proteins
which interact with vertebrate receptor protein tyrosine kinases
(e.g., mammalian cytoplasmic protein Nck and oncoprotein Crk),
chicken Src substrate p80/85 protein (cortactin), human hemopoietic
lineage cell specific protein Hs1, mammalian
dihydrouridine-sensitive L-type calcium channel beta subunit, human
myasthenic syndrome antigen B (MSYB), mammalian neutrophil
cytosolic activators of NADPH oxidase (e.g., p47 {NCF-1}, p67
{NCF-2}, and C. elegans protein B0303.7), myosin heavy chains
(MYO3) from amoebae, from slime molds, and from yeast, vertebrate
and Drosophila spectrin and fodrin alpha chain proteins, human
amphiphysin, yeast actin-binding proteins ABP1 and SLA3, yeast
protein BEM1, fission yeast protein scd2 (ral3), yeast BEM1-binding
proteins B012 (BEB1) and BOB1 (BOI1), yeast fusion protein FUS1,
yeast protein RSV167, yeast protein SSU81, yeast hypothetical
proteins YAR014c, YFR024c, YHL002w, YHR016c, YJL020C, and YHR114w,
hypothetical fission yeast protein SpAC12C2.05c, and C. elegans
hypothetical protein F42H10.3. Of these proteins, multiple SH3
domains occur in vertebrate GRB2 protein, C. elegans sem-5 protein,
Drosophila DRK protein, oncoprotein Crk, mammalian neutrophil
cytosolic activators of NADPH oxidase p47 and p67, yeast protein
BEM1, fission yeast protein scd2, yeast hypothetical protein
YHR114w, mammalian cytoplasmic protein Nck, C. elegans neutrophil
cytosolic activator of NADPH oxidase B0303.7, and yeast
actin-binding protein SLA1. Of these proteins, three or more SH3
domains occur in mammalian cytoplasmic protein Nck, C. elegans
neutrophil cytosolic activator of NADPH oxidase B0303.7, and yeast
actin-binding protein SLA1. The presence of SH3 domain binding
sites in INTERCEPT 217 indicates that INTERCEPT 217 interacts with
one or more of these and other SH3 domain-containing proteins and
is thus involved in physiological processes in which one or more of
these or other SH3 domain-containing proteins are involved.
[0490] Human INTERCEPT 217 exhibits amino acid sequence similarity
to porcine ribonuclease inhibitor, a protein which binds with high
affinity to pancreatic ribonucleases and inhibits their activity.
INTERCEPT 217 thus is involved with similar physiological processes
in humans. An alignment of the amino acid sequences of human
INTERCEPT 217 and porcine ribonuclease inhibitor protein (SwissProt
Accession number P10775) is shown in FIG. 37A. In this alignment
(made using the ALIGN software {Myers and Miller (1989) CABIOS,
ver. 2.0}; pam120.mat scoring matrix; gap opening penalty=12, gap
extension penalty=4), the proteins are 20.5% identical. An
alignment of human (SEQ ID NO: 273) and murine INTERCEPT 217 amino
acid sequences (SEQ ID NO: 363; made using BESTFIT software,
BLOSUM62 scoring matrix, gap opening penalty=12, frameshift gap
penalty=5, gap extension penalty=4). In this alignment, the human
and murine amino acid sequences are 71.3% identical in the
overlapping region. Alignment of human and murine INTERCEPT 217
ORFs indicated 79.9% nucleotide sequence identity in the
overlapping region.
[0491] The signal peptide prediction program SIGNALP (Nielsen et
al. (1997) Protein Engineering 10:1-6) predicted that human
INTERCEPT 217 protein includes an approximately 20 (i.e., 18, 19,
20, 21, or 22) amino acid residue signal peptide (amino acid
residues 1 to 20 of SEQ ID NO: 273; SEQ ID NO: 274) preceding the
mature INTERCEPT 217 protein (i.e., approximately amino acid
residues 21 to 455 of SEQ ID NO: 273; SEQ ID NO: 275). In one
embodiment, human INTERCEPT 217 protein includes an extracellular
domain (amino acid residues 21 to 383 of SEQ ID NO: 273; SEQ ID NO:
276); a transmembrane domain (amino acid residues 384 to 403 of SEQ
ID NO: 273; SEQ ID NO: 277); and a cytoplasmic domain (amino acid
residues 404 to 455 of SEQ ID NO: 273; SEQ ID NO: 278). In an
alternative embodiment, human INTERCEPT 217 protein includes a
cytoplasmic domain (amino acid residues 21 to 383 of SEQ ID NO:
273; SEQ ID NO: 276); a transmembrane domain (amino acid residues
384 to 403 of SEQ ID NO: 273; SEQ ID NO: 277); and an extracellular
domain (amino acid residues 404 to 455 of SEQ ID NO: 273; SEQ ID
NO: 278).
[0492] The SIGNALP program predicted that murine INTERCEPT 217
protein includes an approximately 15 (i.e., 13, 14, 15, 16, or 17)
amino acid residue signal peptide (amino acid residues 1 to 16 of
SEQ ID NO: 363; SEQ ID NO: 364) preceding the mature INTERCEPT 217
protein (i.e., approximately amino acid residues 16 to 320 of SEQ
ID NO: 363; SEQ ID NO: 365). In one embodiment, murine INTERCEPT
217 protein includes an extracellular domain (amino acid residues
16 to 213 of SEQ ID NO: 363; SEQ ID NO: 366); a transmembrane
domain (amino acid residues 214 to 233 of SEQ ID NO: 363; SEQ ID
NO: 367); and a cytoplasmic domain (amino acid residues 234 to 320
of SEQ ID NO: 363; SEQ ID NO: 368). In an alternative embodiment,
murine INTERCEPT 217 protein includes a cytoplasmic domain (amino
acid residues 16 to 213 of SEQ ID NO: 363; SEQ ID NO: 366); a
transmembrane domain (amino acid residues 214 to 233 of SEQ ID NO:
363; SEQ ID NO: 367); and an extracellular domain (amino acid
residues 234 to 320 of SEQ ID NO: 363; SEQ ID NO: 368).
[0493] FIG. 36 depicts a hydrophobicity plot of human INTERCEPT 217
protein. Relatively hydrophobic regions are above the dashed
horizontal line, and relatively hydrophilic regions are below the
dashed horizontal line. The hydrophobic region which corresponds to
amino acid residues 1 to 20 of SEQ ID NO: 273 is the signal
sequence of human INTERCEPT 217 (SEQ ID NO: 274). The hydrophobic
region which corresponds to amino acid residues 384 to 403 of SEQ
ID NO: 273 is the transmembrane domain of human INTERCEPT 217 (SEQ
ID NO: 277). As described elsewhere herein, relatively hydrophilic
regions are generally located at or near the surface of a protein,
and are more frequently effective immunogenic epitopes than are
relatively hydrophobic regions. For example, the region of human
INTERCEPT 217 protein from about amino acid residue 355 to about
amino acid residue 380 appears to be located at or near the surface
of the protein, while the region from about amino acid residue 190
to about amino acid residue 210 appears not to be located at or
near the surface. FIG. 19L depicts a hydrophobicity plot of murine
INTERCEPT 217 protein.
[0494] The predicted molecular weight of human INTERCEPT 217
protein without modification and prior to cleavage of the signal
sequence is about 49.8 kilodaltons. The predicted molecular weight
of the mature human INTERCEPT 217 protein without modification and
after cleavage of the signal sequence is about 47.4
kilodaltons.
[0495] The predicted molecular weight of murine INTERCEPT 217
protein, without modification and prior to cleavage of the signal
sequence is about 35.5 kilodaltons. The predicted molecular weight
of the mature human INTERCEPT 217 protein without modification and
after cleavage of the signal sequence is about 33.8
kilodaltons.
[0496] Northern analysis experiments indicated that mRNA
corresponding to the cDNA encoding INTERCEPT 217 is expressed in
two forms, one having an apparent approximate size of about 6
kilobases and another having an apparent approximate size of about
3 kilobases (i.e., corresponding to the size of the INTERCEPT 217
cDNA). These experiments indicated that INTERCEPT 217 is expressed
in the tissues listed in Table XVII, wherein "++" indicates strong
expression, "+" indicates lower expression, and "+7-" indicates
still lower expression.
TABLE-US-00024 TABLE XVII Animal Tissue Relative Level of
Expression Human pancreas ++ skeletal muscle + heart +/- brain +/-
placenta +/- lung +/- liver +/- kidney +/-
[0497] An assay to detect possible secretion of INTERCEPT 217
protein was negative. This assay was performed as described
elsewhere in this disclosure.
[0498] Uses of INTERCEPT 217 Nucleic acids,
[0499] Polypeptides, and Modulators Thereof
[0500] INTERCEPT 217 proteins are involved in disorders which
affect both tissues in which they are normally expressed and
tissues in which they are normally not expressed. Based on the
observation that INTERCEPT 217 is expressed in pancreas, skeletal
muscle, heart, brain, placenta, lung, liver, and kidney tissue,
INTERCEPT 217 protein is involved in one or more biological
processes which occur in these tissues. In particular, INTERCEPT
217 is involved in modulating binding of cells of one or more of
these tissues with proteins of other cells or with secreted
proteins which occur in the extracellular environment of one or
more of these tissues. INTERCEPT 217 is especially implicated in
disorders of skeletal muscle (e.g., protection of skeletal muscle
cells during ischemia and in bruised tissue), and more especially
those involving the pancreas (e.g., diabetes, pancreatitis, and the
like).
[0501] Structural similarity of human INTERCEPT 217 protein with
human GP-IB.alpha. indicates that INTERCEPT 217 is involved in
binding extracellular proteins and other ligands. INTERCEPT 217
protein is involved in binding of proteins which induce release of
pancreatic digestive enzymes (e.g., amylases, lipases, proteases,
and nucleases) from pancreatic cells, and in disorders associated
with insufficient or inappropriate release of such enzymes.
INTERCEPT 217 protein is also involved in binding of secreted
pancreatic digestive enzymes in pancreatic tissue, thereby
protecting pancreatic tissue from autodigestion. Thus, INTERCEPT
217 protein is involved in disorders such as diabetes,
pancreatitis, and pancreatic carcinoma which involve acute and
chronic autodigestive damage to pancreatic tissues. Homology of
INTERCEPT 217 protein with porcine ribonuclease inhibitor protein
is a further indication of this involvement.
[0502] The presence of LRR domains in human INTERCEPT 217 protein
and detection of its expression in a variety of tissues indicate
that the tissue protective functions of INTERCEPT 217 are not
limited to pancreatic tissues, but are involved in protection of
other tissues as well (e.g., skeletal muscle, heart, brain,
placenta, lung, liver, prostate, and kidney tissues). INTERCEPT 217
is therefore involved in protection of these (and likely other
tissues) from the effects of inflammation, autoimmunity, infection,
and acute and chronic traumas.
[0503] Presence in INTERCEPT 217 protein of multiple SH3 domain
binding sites indicates that INTERCEPT 217 protein interacts with
one or more SH3 domain-containing proteins. Thus, INTERCEPT 217
protein mediates binding of proteins (i.e., binding of proteins to
INTERCEPT 217 and to one another to form protein complexes) in
cells in which it is expressed. INTERCEPT 217 is also involved in
transduction of signals between the exterior environment of cells
(i.e., including from other cells) and the interior of cells in
which it is expressed. INTERCEPT 217 mediates regulation of cell
growth and proliferation, endocytosis, activation of respiratory
burst, and other physiological processes triggered by transmission
of a signal via a protein with which INTERCEPT 217 interacts.
[0504] INTERCEPT 217-related molecules can be used to modulate one
or more of the activities in which INTERCEPT 217 is involved and
can also be used to prevent, diagnose, or treat one or more of the
disorders in which INTERCEPT 217 is involved.
[0505] INTERCEPT 217 polypeptides, nucleic acids, and modulators
thereof, can, for example, be used to treat pancreatic disorders,
such as the pancreatic disorders described elsewhere in this
disclosure. INTERCEPT 217 polypeptides, nucleic acids, and
modulators thereof can be used to prognosticate, diagnose, inhibit,
prevent, or alleviate one or more of these disorders.
[0506] In another example, INTERCEPT 217 polypeptides, nucleic
acids, and modulators thereof, can be used to treat disorders of
skeletal muscle, such as the skeletal muscle disorders described
elsewhere in this disclosure. INTERCEPT 217 polypeptides, nucleic
acids, and modulators thereof can be used to prognosticate,
diagnose, inhibit, prevent, or alleviate one or more of these
disorders.
[0507] Because INTERCEPT 217 exhibits expression in heart tissue,
INTERCEPT 217 nucleic acids, proteins, and modulators thereof can
be used to treat disorders such as the cardiovascular disorders
described elsewhere in this disclosure. INTERCEPT 217 polypeptides,
nucleic acids, and modulators thereof can be used to prognosticate,
diagnose, inhibit, prevent, or alleviate one or more of these
disorders.
[0508] In another example, INTERCEPT 217 polypeptides, nucleic
acids, and modulators thereof, can be used to treat disorders of
the brain, such as the brain disorders described elsewhere in this
disclosure. INTERCEPT 217 polypeptides, nucleic acids, and
modulators thereof can be used to prognosticate, diagnose, inhibit,
prevent, or alleviate one or more of these disorders.
[0509] In another example, INTERCEPT 217 polypeptides, nucleic
acids, and modulators thereof, can be used to treat placental
disorders, such as toxemia of pregnancy (e.g., preeclampsia and
eclampsia), placentitis, and spontaneous abortion. INTERCEPT 217
polypeptides, nucleic acids, and modulators thereof can be used to
prognosticate, diagnose, inhibit, prevent, or alleviate one or more
of these disorders.
[0510] In another example, INTERCEPT 217 polypeptides, nucleic
acids, and modulators thereof, can be used to treat pulmonary
(i.e., lung) disorders, such as atelectasis, cystic fibrosis,
rheumatoid lung disease, pulmonary congestion, pulmonary edema,
chronic obstructive airway disease (e.g., emphysema, chronic
bronchitis, bronchial asthma, and bronchiectasis), diffuse
interstitial diseases (e.g., sarcoidosis, pneumoconiosis,
hypersensitivity pneumonitis, Goodpasture's syndrome, idiopathic
pulmonary hemosiderosis, pulmonary alveolar proteinosis,
desquamative interstitial pneumonitis, chronic interstitial
pneumonia, fibrosing alveolitis, hamman-rich syndrome, pulmonary
eosinophilia, diffuse interstitial fibrosis, Wegener's
granulomatosis, lymphomatoid granulomatosis, and lipid pneumonia),
and tumors (e.g., bronchogenic carcinoma, bronchioloalveolar
carcinoma, bronchial carcinoid, hamartoma, and mesenchymal tumors).
INTERCEPT 217 polypeptides, nucleic acids, and modulators thereof
can be used to prognosticate, diagnose, inhibit, prevent, or
alleviate one or more of these disorders.
[0511] In yet another example, INTERCEPT 217 polypeptides, nucleic
acids, and modulators thereof, can be used to treat hepatic (i.e.,
liver) disorders, such as the liver disorders described elsewhere
in this disclosure. INTERCEPT 217 polypeptides, nucleic acids, and
modulators thereof can be used to prognosticate, diagnose, inhibit,
prevent, or alleviate one or more of these disorders.
[0512] In still another example, INTERCEPT 217 polypeptides,
nucleic acids, and modulators thereof, can be used to treat renal
(i.e., kidney) disorders, such as the kidney disorders described
elsewhere in this disclosure. INTERCEPT 217 polypeptides, nucleic
acids, and modulators thereof can be used to prognosticate,
diagnose, inhibit, prevent, or alleviate one or more of these
disorders.
INTERCEPT 297
[0513] A cDNA clone (designated jthsa085g01) encoding at least a
portion of human INTERCEPT 297 protein was isolated from a human
fetal spleen cDNA library. The human INTERCEPT 297 protein is
predicted by structural analysis to be a transmembrane protein.
[0514] The full length of the cDNA encoding human INTERCEPT 297
protein (SEQ ID NO: 279) is 1518 nucleotide residues. The ORF of
this cDNA, nucleotide residues 40 to 1152 of SEQ ID NO: 279 (i.e.,
SEQ ID NO: 280), encodes a 371-amino acid transmembrane protein
(SEQ ID NO: 281).
[0515] The invention thus includes purified human INTERCEPT 297
protein, both in the form of a 371 amino acid residue protein (SEQ
ID NO: 281) in which the `signal sequence` (i.e., the portion of
INTERCEPT 297 protein corresponding to amino acid residues 1 to 18)
described in this section is not cleaved and in the form of a 353
amino acid residue protein (SEQ ID NO: 283) in which the `signal
sequence` is cleaved. Human INTERCEPT 297 protein can exist with or
without the signal sequence polypeptide at the amino terminus
thereof. It is likely that the `signal sequence` is not cleaved,
but is instead a transmembrane domain of the protein.
[0516] The invention includes nucleic acid molecules which encode
an INTERCEPT 297 polypeptide of the invention. Such nucleic acids
include, for example, a DNA molecule having the nucleotide sequence
listed in SEQ ID NO: 279 or some portion thereof, such as the
portion which encodes mature INTERCEPT 297 protein, immature
INTERCEPT 297 protein, or a domain of INTERCEPT 297 protein. These
nucleic acids are collectively referred to as INTERCEPT 297 nucleic
acids of the invention.
[0517] INTERCEPT 297 proteins and nucleic acid molecules encoding
them comprise a family of molecules having certain conserved
structural and functional features.
[0518] A common domain present in INTERCEPT 297 proteins is a
signal sequence. In one embodiment, a INTERCEPT 297 protein
contains a signal sequence corresponding to about amino acid
residues 1 to 18 of SEQ ID NO: 281 (SEQ ID NO: 282). The signal
sequence can be cleaved during processing of the mature protein,
but it is likely that amino acid residues 1 to 18 of SEQ ID NO: 281
represent a (non-cleaved) transmembrane region of the protein.
[0519] INTERCEPT 297 proteins can include one or more extracellular
domains. In one embodiment of the human INTERCEPT 297 protein,
extracellular domains are located from about amino acid residues 19
to 47, from about amino acid residues 110 to 118, from about amino
acid residues 162 to 175, from about amino acid residues 234 to
260, and from about amino acid residues 313 to 319 of SEQ ID NO:
281 (SEQ ID NOs: 284-288, respectively). In an alternative
embodiment, extracellular domains are located from about amino acid
residue 69 to 88, from about amino acid residue 138 to 144, from
about amino acid residue 193 to 215, from about amino acid residue
284 to 292, and from about amino acid residue 337 to 371 of SEQ ID
NO: 281 (SEQ ID NOs: 298-302, respectively).
[0520] In addition, INTERCEPT 297 includes one or more
transmembrane domains. In one embodiment, a INTERCEPT 297 protein
of the invention contains transmembrane domains corresponding to
about amino acid residues 48 to 68, about amino acid residues 89 to
109, about amino acid residues 119 to 137, about amino acid
residues 145 to 161, about amino acid residues 176 to 192, about
amino acid residues 216 to 233, about amino acid residues 261 to
283, about amino acid residues 293 to 312, and about amino acid
residues 320 to 336 of SEQ ID NO: 281 (SEQ ID NOs: 289-297,
respectively). As indicated above, it is likely that the `signal
sequence` of INTERCEPT 297 is an additional (and non-cleaved)
transmembrane region.
[0521] The present invention includes INTERCEPT 297 proteins having
one or more cytoplasmic domains. In one embodiment of the human
INTERCEPT 297 protein, cytoplasmic domains are located from about
amino acid residue 69 to 88, from about amino acid residue 138 to
144, from about amino acid residue 193 to 215, from about amino
acid residue 284 to 292, and from about amino acid residue 337 to
371 of SEQ ID NO: 281 (SEQ ID NOs: 298-302, respectively). In an
alternative embodiment, cytoplasmic domains are located from about
amino acid residues 19 to 47, from about amino acid residues 110 to
118, from about amino acid residues 162 to 175, from about amino
acid residues 234 to 260, and from about amino acid residues 313 to
319 of SEQ ID NO: 281 (SEQ ID NOs: 284-288, respectively).
[0522] INTERCEPT 297 proteins typically comprise a variety of
potential post-translational modification sites (often within an
extracellular domain), such as those described herein in Table
XVIII, as predicted by computerized sequence analysis of INTERCEPT
297 proteins using amino acid sequence comparison software
(comparing the amino acid sequence of INTERCEPT 297 with the
information in the PROSITE database {rel. 12.2; February, 1995} and
the Hidden Markov Models database {Rel. PFAM 3.3}). In certain
embodiments, a protein of the invention has at least 1, 2, 4, 6,
10, 15, or 20 or more of the post-translational modification sites
listed in Table XVIII.
TABLE-US-00025 TABLE XVIII Type of Potential Amino Acid
Modification Site Residues of Amino Acid or Domain SEQ ID NO: 281
Sequence N-glycosylation site 110 to 113 NMTS 269 to 272 NISS
Protein kinase C 24 to 26 SAK phosphorylation site 290 to 292 TTR
297 to 299 SLR Casein kinase II 78 to 81 SSVD phosphorylation site
165 to 168 SKHD 245 to 248 TLED 354 to 357 SEQE N-myristoylation
site 18 to 23 GSINTL 35 to 40 GCGGSK 53 to 58 GMFLGE 74 to 79
GQSDSS 147 to 152 GILATI 236 to 241 GSFSGN 268 to 273 GNISSI 280 to
285 GISVTK Amidation site 136 to 139 LGRR DUF6 domain 44 to 171
[0523] Among the domains that occur in INTERCEPT 297 protein is a
DUF6 domain. In one embodiment, the protein of the invention has at
least one domain that is at least 55%, preferably at least about
65%, more preferably at least about 75%, yet more preferably at
least about 85%, and most preferably at least about 95% identical
to this DUF6 domain.
[0524] The DUF6 domain is a transmembrane domain that is highly
conserved among eukaryote, prokaryote, and archae kingdoms. This
high degree of domain sequence conservation indicates that proteins
of the class which includes INTERCEPT 297 are involved in
fundamental membrane physiology of living cells. INTERCEPT 297
protein is therefore involved in disorders which are associated
with aberrant membrane function including, for example, disorders
involving abnormal membrane fluidity, disorders involving aberrant
transmembrane transport, disorders involving abnormal membrane
organization, disorders involving abnormal membrane synthesis,
disorders involving aberrant cell division, and the like.
[0525] The signal peptide prediction program SIGNALP (Nielsen et
al. (1997) Protein Engineering 10:1-6) predicted that human
INTERCEPT 297 protein includes an approximately 18 (i.e., 16, 17,
18, 19, or 20) amino acid residue signal peptide (amino acid
residues 1 to 18 of SEQ ID NO: 281; SEQ ID NO: 282) preceding the
mature INTERCEPT 297 protein (i.e., approximately amino acid
residues 19 to 371 of SEQ ID NO: 281; SEQ ID NO: 283). In one
embodiment, human INTERCEPT 297 protein includes about five
extracellular domains (amino acid residues 19 to 47, 110 to 118,
162 to 175, 234 to 260, and 313 to 319 of SEQ ID NO: 281); about
nine transmembrane domains (amino acid residues 48 to 68, 89 to
109, 119 to 137, 145 to 161, 176 to 192, 216 to 233, 261 to 283,
293 to 312, and 320 to 326 of SEQ ID NO: 281); and about five
cytoplasmic domains (amino acid residues 69 to 88, 138 to 144, 193
to 215, 284 to 292, and 337 to 371 of SEQ ID NO: 281). In an
alternative embodiment, human INTERCEPT 297 protein includes about
five cytoplasmic domains (amino acid residues 19 to 47, 110 to 118,
162 to 175, 234 to 260, and 313 to 319 of SEQ ID NO: 281); about
nine transmembrane domains (amino acid residues 48 to 68, 89 to
109, 119 to 137, 145 to 161, 176 to 192, 216 to 233, 261 to 283,
293 to 312, and 320 to 326 of SEQ ID NO: 281); and about five
extracellular domains (amino acid residues 69 to 88, 138 to 144,
193 to 215, 284 to 292, and 337 to 371 of SEQ ID NO: 281).
[0526] FIG. 40 depicts a hydrophobicity plot of human INTERCEPT 297
protein. Relatively hydrophobic regions are above the dashed
horizontal line, and relatively hydrophilic regions are below the
dashed horizontal line. Hydrophobic region corresponding to the
signal sequence and the transmembrane domains are observed in this
figure. As described elsewhere herein, relatively hydrophilic
regions are generally located at or near the surface of a protein,
and are more frequently effective immunogenic epitopes than are
relatively hydrophobic regions. For example, the region of human
INTERCEPT 297 protein from about amino acid residue 165 to about
amino acid residue 175 appears to be located at or near the surface
of the protein.
[0527] The predicted molecular weight of human INTERCEPT 297
protein without modification and prior to cleavage of the signal
sequence is about 40.2 kilodaltons. The predicted molecular weight
of the mature human INTERCEPT 297 protein without modification and
after cleavage of the signal sequence is about 38.2
kilodaltons.
[0528] Uses of INTERCEPT 297 Nucleic acids,
[0529] Polypeptides, and Modulators Thereof
[0530] INTERCEPT 297 proteins are involved in disorders which
affect both tissues in which they are normally expressed and
tissues in which they are normally not expressed. Based on the
observation that INTERCEPT 297 is expressed in human fetal spleen,
INTERCEPT 297 protein is involved in one or more biological
processes which occur in fetal and spleen tissues. In particular,
INTERCEPT 297 is involved in modulating growth, proliferation,
survival, differentiation, and activity of cells including, but not
limited to, spleen and fetal cells of the animal in which it is
normally expressed. Thus, INTERCEPT 297 has a role in disorders
which affect these cells and their growth, proliferation, survival,
differentiation, and activity (e.g., hematologic and immune
disorders). Expression of INTERCEPT 297 in an animal is also
involved in modulating growth, proliferation, survival,
differentiation, and activity of cells and viruses which are
foreign to the host (i.e., bacterial, fungal, and viral
infections).
[0531] INTERCEPT 297 bears amino acid sequence similarity to
Caenorhabditis elegans protein C2G12.12, and therefore exhibits one
or more activities analogous to that protein.
[0532] INTERCEPT 297 nucleic acids, proteins, and modulators
thereof can be used to modulate proliferation, migration,
morphology, differentiation, function, or some combination of
these, of cells that form the spleen, (e.g., cells of the splenic
connective tissue, splenic smooth muscle cells, or endothelial
cells of the splenic blood vessels) or of blood cells that are
processed (e.g., regenerated, matured, or phagocytized) within the
spleen, as described elsewhere in this disclosure. INTERCEPT 297
polypeptides, nucleic acids, and modulators thereof can be used to
prognosticate, diagnose, inhibit, prevent, or alleviate one or more
of these disorders.
[0533] Structural analysis of INTERCEPT 297 and the presence of a
DUF6 domain therein indicate that INTERCEPT 297 is involved in
disorders which affect membrane structure and function. INTERCEPT
297 can be used to affect development and persistence of disorders
involving inappropriate membrane structure and function, such as
atherogenesis, arteriosclerosis, and various transmembrane
transport disorders. Other examples of disorders for which
INTERCEPT 297 is useful include disorders involving generation and
persistence of an immune response to bacterial, fungal, and viral
infections. INTERCEPT 297 polypeptides, nucleic acids, and
modulators thereof can be used to prognosticate, diagnose, inhibit,
prevent, or alleviate one or more of these disorders.
[0534] The structure of INTERCEPT 297 is analogous to the
structures of integral membrane proteins responsible for
transmembrane transport of molecules such as sugars, ions, and the
like. INTERCEPT 297 is thus involved in one or more transmembrane
transport-related disorders such as cystic fibrosis, nerve
conduction disorders (e.g., pain and loss or failure of sensation),
muscle contraction disorders (e.g., cardiac insufficiency), metal
ion uptake disorders (e.g., hemochromatosis), and the like.
INTERCEPT 297 polypeptides, nucleic acids, and modulators thereof
can be used to prognosticate, diagnose, inhibit, prevent, or
alleviate one or more of these disorders.
TANGO 276
[0535] A cDNA clone (designated jthsa006e01) encoding at least a
portion of human TANGO 276 protein was isolated from a human fetal
spleen cDNA library. The human TANGO 276 protein is predicted by
structural analysis to be a secreted protein.
[0536] The full length of the cDNA encoding human TANGO 276 protein
(SEQ ID NO: 303) is 2811 nucleotide residues. The ORF of this cDNA,
nucleotide residues 58 to 786 of SEQ ID NO: 303 (i.e., SEQ ID NO:
304), encodes a 243-amino acid secreted protein (SEQ ID NO:
305).
[0537] The invention thus includes purified human TANGO 276
protein, both in the form of the immature 243 amino acid residue
protein (SEQ ID NO: 305) and in the form of the mature,
approximately 223 amino acid residue protein (SEQ ID NO: 307).
Mature human TANGO 276 protein can be synthesized without the
signal sequence polypeptide at the amino terminus thereof, or it
can be synthesized by generating immature TANGO 276 protein and
cleaving the signal sequence therefrom.
[0538] The invention includes nucleic acid molecules which encode a
TANGO 276 polypeptide of the invention. Such nucleic acids include,
for example, a DNA molecule having the nucleotide sequence listed
in SEQ ID NO: 303 or some portion thereof, such as the portion
which encodes mature TANGO 276 protein, immature TANGO 276 protein,
or a domain of TANGO 276 protein. These nucleic acids are
collectively referred to as TANGO 276 nucleic acids of the
invention.
[0539] TANGO 276 proteins and nucleic acid molecules encoding them
comprise a family of molecules having certain conserved structural
and functional features, as indicated by the conservation of amino
acid sequence between human TANGO 276 protein and the murine
protein designated M-Sema-F (see Inagaki et al. (1995) FEBS Lett.
370:269-272), as shown in FIGS. 42A-42C.
[0540] A common domain present in TANGO 276 proteins is a signal
sequence. In one embodiment, a TANGO 276 protein contains a signal
sequence corresponding to about amino acid residues 1 to 20 of SEQ
ID NO: 305 (SEQ ID NO: 306). The signal sequence is cleaved during
processing of the mature protein.
[0541] TANGO 276 proteins can exist in a secreted form, such as a
mature protein having the amino acid sequence of amino acid
residues 21 to 243 of SEQ ID NO: 305 (SEQ ID NO: 307).
[0542] TANGO 276 proteins typically comprise a variety of potential
post-translational modification sites (often within an
extracellular domain), such as those described herein in Table XIX,
as predicted by computerized sequence analysis of TANGO 276
proteins using amino acid sequence comparison software (comparing
the amino acid sequence of TANGO 276 with the information in the
PROSITE database {rel. 12.2; February, 1995} and the Hidden Markov
Models database {Rel. PFAM 3.3}). In certain embodiments, a protein
of the invention has at least 1, 2, 4, 6, or all 8 of the
post-translational modification sites listed in Table XIX.
TABLE-US-00026 TABLE XIX Type of Potential Amino Acid Modification
Site Residues of Amino Acid or Domain SEQ ID NO: 305 Sequence
N-glycosylation site 106 to 109 NQTE 121 to 124 NASH cAMP- or
cGMP-dependent 43 to 46 RRFS protein kinase phosphorylation site
Protein kinase C 194 to 196 SLK phosphorylation site Casein kinase
II 34 to 37 SSGE phosphorylation site 57 to 60 TLTE
N-myristoylation site 16 to 21 GLGIGA 68 to 73 GAREAL Sema domain
53 to 141
[0543] A Sema domain occurs in human TANGO 276 protein. In one
embodiment, the protein of the invention has at least one domain
that is at least 55%, preferably at least about 65%, more
preferably at least about 75%, yet more preferably at least about
85%, and most preferably at least about 95% identical to this Sema
domain.
[0544] Sema domains occur in semaphorin proteins. Semaphorins are a
large family of secreted and transmembrane proteins, some of which
function as repellent signals during neural axon guidance. The Sema
domain and a variety of semaphorin proteins in which it occurs are
described, for example, in Winberg et al. (1998 Cell 95:903-916).
Sema domains also occur in human hepatocyte growth factor receptor
(SwissProt Accession no. P08581) and the similar neuronal and
epithelial transmembrane receptor protein (SwissProt Accession no.
P51805). The presence of a Sema domain in human TANGO 276 protein
indicates that TANGO 276 is involved in one or more physiological
processes in which the semaphorins are involved, has biological
activity in common with one or more of the semaphorins, or
both.
[0545] Human TANGO 276 protein exhibits considerable sequence
similarity to murine M-Sema F protein (GenBank Accession no.
S79463), as indicated herein in FIGS. 42A-42C. FIGS. 42A-42C depict
an alignment of the amino acid sequences of human TANGO 276 protein
(SEQ ID NO: 305) and murine M-Sema F protein (SEQ ID NO: 335). In
this alignment (pam120.mat scoring matrix, gap opening penalty=12,
gap extension penalty=4), the amino acid sequences of the proteins
are 76.1% identical. FIGS. 43A-43J depict an alignment of the
nucleotide sequences of cDNA encoding human TANGO 276 protein (SEQ
ID NOs: 303) and murine cDNA encoding M-Sema F protein (SEQ ID NO:
336). In this alignment (pam120.mat scoring matrix, gap opening
penalty=12, gap extension penalty=4), the nucleic acid sequences of
the cDNAs are 79.7% identical. Thus, TANGO 276 is related to murine
M-Sema F and shares functional similarities to that protein.
[0546] It is known that semaphorins are bi-functional, capable of
functioning either as attractive axonal guidance proteins or as
repellent axonal guidance proteins (Wong et al. (1997) Development
124:3597-3607). Furthermore, semaphorins bind with neuronal cell
surface proteins designated plexins, which are expressed on both
neuronal cells and cells of the immune system (Comeau et al. (1998)
Immunity 8:473-482; Jin and Strittmatter (1997) J. Neurosci.
17:6256-6263).
[0547] The signal peptide prediction program SIGNALP (Nielsen et
al. (1997) Protein Engineering 10:1-6) predicted that human TANGO
276 protein includes an approximately 20 (i.e., 18, 19, 20, 21, or
22) amino acid signal peptide (amino acid residues 1 to 20 of SEQ
ID NO: 305; SEQ ID NO: 306) preceding the mature TANGO 276 protein
(i.e., approximately amino acid residues 21 to 243 of SEQ ID NO:
304; SEQ ID NO: 307). Human TANGO 276 protein is a secreted
protein.
[0548] FIG. 41 depicts a hydrophobicity plot of human TANGO 276
protein. Relatively hydrophobic regions are above the dashed
horizontal line, and relatively hydrophilic regions are below the
dashed horizontal line. The hydrophobic region which corresponds to
about amino acid residues 1 to 20 of SEQ ID NO: 305 is the signal
sequence of human TANGO 276. As described elsewhere herein,
relatively hydrophilic regions are generally located at or near the
surface of a protein, and are more frequently effective immunogenic
epitopes than are relatively hydrophobic regions. For example, the
region of human TANGO 276 protein from about amino acid residue 90
to about amino acid residue 105 appears to be located at or near
the surface of the protein, while the region from about amino acid
residue 170 to about amino acid residue 180 appears not to be
located at or near the surface.
[0549] The predicted molecular weight of human TANGO 276 protein
without modification and prior to cleavage of the signal sequence
is about 27.1 kilodaltons. The predicted molecular weight of the
mature human TANGO 276 protein without modification and after
cleavage of the signal sequence is about 24.8 kilodaltons.
[0550] Northern analysis experiments indicated that mRNA
corresponding to the cDNA encoding TANGO 276 is expressed in the
tissues listed in Table XX, wherein "++" indicates a greater level
of expression and "+" indicates a lower level of expression.
TABLE-US-00027 TABLE XX Animal Tissue Relative Level of Expression
Human heart ++ placenta ++ brain + lung + liver + skin + kidney +
pancreas +
[0551] Uses of TANGO 276 Nucleic acids,
[0552] Polypeptides, and Modulators Thereof
[0553] TANGO 276 proteins are involved in disorders which affect
both tissues in which they are normally expressed and tissues in
which they are normally not expressed. Based on the observation
that TANGO 276 is expressed in human heart and placenta tissues, to
a lesser extent in brain, lung, liver, skin, kidney, and pancreas
tissues, and in fetal spleen tissue, TANGO 276 protein is involved
in one or more biological processes which occur in these tissues.
In particular, TANGO 276 is involved in modulating growth,
proliferation, survival, differentiation, and activity of cells
including, but not limited to, heart, placenta, spleen, brain,
lung, liver, skin, kidney, and pancreas cells of the animal in
which it is normally expressed. Thus, TANGO 276 has a role in
disorders which affect these cells and their growth, proliferation,
survival, differentiation, and activity.
[0554] Because TANGO 276 exhibits expression in the heart, TANGO
276 nucleic acids, proteins, and modulators thereof can be used to
treat cardiovascular disorders, such as those described elsewhere
in this disclosure. TANGO 276 polypeptides, nucleic acids, or
modulators thereof can be used to prognosticate, diagnose, inhibit,
prevent, or alleviate one or more of these disorders.
[0555] In another example, TANGO 276 polypeptides, nucleic acids,
and modulators thereof can be used to treat placental disorders,
such as those described elsewhere in this disclosure. TANGO 276
polypeptides, nucleic acids, and modulators thereof can be used to
prognosticate, diagnose, inhibit, prevent, or alleviate one or more
of these disorders.
[0556] In another example, TANGO 276 polypeptides, nucleic acids,
or modulators thereof, can be used to treat disorders of the brain,
such as the brain disorders described elsewhere in this disclosure.
TANGO 276 polypeptides, nucleic acids, and modulators thereof can
be used to prognosticate, diagnose, inhibit, prevent, or alleviate
one or more of these disorders.
[0557] TANGO 276 polypeptides, nucleic acids, and modulators
thereof can be associated with pulmonary (i.e., lung) disorders,
such as the pulmonary disorders described elsewhere in this
disclosure. TANGO 276 polypeptides, nucleic acids, or modulators
thereof can be used to prognosticate, diagnose, inhibit, prevent,
or alleviate one or more of these disorders.
[0558] In another example, TANGO 276 polypeptides, nucleic acids,
and modulators thereof, can be used to treat hepatic (i.e., liver)
disorders, such as the liver disorders described elsewhere in this
disclosure. TANGO 276 polypeptides, nucleic acids, and modulators
thereof can be used to prognosticate, diagnose, inhibit, prevent,
or alleviate one or more of these disorders.
[0559] Examples of skin disorders with which TANGO 276 can be
associated include those described elsewhere in this disclosure.
TANGO 276 proteins, nucleic acids encoding them, and agents that
modulate activity or expression of either of these can be used to
prognosticate, diagnose, treat, and inhibit one or more of these
disorders.
[0560] In another example, TANGO 276 polypeptides, nucleic acids,
or modulators thereof, can be used to treat renal (i.e., kidney)
disorders, such as the kidney disorders described elsewhere in this
disclosure. TANGO 276 polypeptides, nucleic acids, and modulators
thereof can be used to prognosticate, diagnose, inhibit, prevent,
or alleviate one or more of these disorders.
[0561] Pancreatic disorders in which TANGO 276 can be involved
include the pancreatic disorders described elsewhere in this
disclosure. TANGO 276 polypeptides, nucleic acids, or modulators
thereof can be used to prognosticate, diagnose, inhibit, prevent,
or alleviate one or more of these disorders.
[0562] The presence of the Sema domain in TANGO 276 indicates that
this protein is involved in development of neuronal and epithelial
tissues and also functions as a repellant protein which guides
axonal development. TANGO 276 modulates nerve growth and
regeneration and also modulates growth and regeneration of other
epithelial tissues. TANGO 276 is thus involved in a variety of
neuronal disorder including, but not limited to, one or more of
seizure, epilepsy, (regeneration of) neuronal damage, pain
(including, for example, migraine, headache, and other chronic
pain), infections of the central nervous system, multiple
sclerosis, sleep disorders, psychological disorders, nerve root
disorders, and the like. Presence of a Sema domain in TANGO 276
further indicates that TANGO 276 has one or more physiological
roles in common with other proteins (e.g., secreted and
transmembrane semaphorins, collapsins, neuropilins, plexins, and
the like) in which the Sema domain occurs. Thus, TANGO 276 is
implicated in development, maintenance, and regeneration of
neuronal connections and networks, in modulating differentiation of
cells of the immune system, in modulating cytokine production by
cells of the immune system, in modulating reactivity of cells of
the immune system toward cytokines, in modulating initiation and
persistence of an inflammatory response, and in modulating
proliferation of epithelial cells. Sema domain-containing proteins
have also been implicated in development and progression of small
cell lung cancer, in normal brain development, and immune system
regulation. This indicates that TANGO 276 is also involved in one
or more of these processes and in disorders relating to these
processes (e.g., small cell lung cancer, brain development
disorders, and immune and auto-immune disorders). TANGO 276
polypeptides, nucleic acids, and modulators thereof can be used to
prognosticate, diagnose, inhibit, prevent, or alleviate one or more
of these disorders.
[0563] The observation that TANGO 276 shares identity with the
murine semaphorin protein designated M-Sema F suggests that TANGO
276 has activity identical or analogous to the activity of this
protein. These observations indicate that TANGO 276 modulates
growth, proliferation, survival, differentiation, and activity of
neuronal cells. Thus, TANGO 276 protein is useful, for example, for
modulating and guiding neural axon development and for modulating
establishment and maintenance of neuronal networks.
TANGO 292
[0564] A cDNA clone (designated jthkf040b11) encoding at least a
portion of human TANGO 292 protein was isolated from a human normal
embryonic keratinocyte cDNA library. A corresponding gerbil cDNA
clone (designated jtiba040e12) was also isolated, and encoded at
least a portion of gerbil TANGO 292 protein. The human and TANGO
292 proteins are predicted by structural analysis to be
transmembrane proteins.
[0565] The full length of the cDNA encoding human TANGO 292 protein
(SEQ ID NO: 308) is 2498 nucleotide residues. The ORF of this cDNA,
nucleotide residues 205 to 882 of SEQ ID NO: 308 (i.e., SEQ ID NO:
309), encodes a 226-amino acid residue transmembrane protein (SEQ
ID NO: 310). The full length of the cDNA encoding gerbil TANGO 292
protein (SEQ ID NO: 351) is 2002 nucleotide residues. The ORF of
this cDNA, nucleotide residues 89 to 763 of SEQ ID NO: 351 (i.e.,
SEQ ID NO: 352), encodes a 225-amino acid transmembrane protein
(SEQ ID NO: 353).
[0566] The invention thus includes purified human TANGO 292
protein, both in the form of the immature 226 amino acid residue
protein (SEQ ID NO: 310) and in the form of the mature,
approximately 209 amino acid residue protein (SEQ ID NO: 312). The
invention also includes purified gerbil TANGO 292 protein, both in
the form of the immature 225-amino acid residue (SEQ ID NO: 353)
protein and in the form of the mature, approximately 208-amino acid
residue protein (SEQ ID NO: 355). Mature human or gerbil TANGO 292
protein can be synthesized without the signal sequence polypeptide
at the amino terminus thereof, or it can be synthesized by
generating immature TANGO 292 protein and cleaving the signal
sequence therefrom.
[0567] The invention includes nucleic acid molecules which encode a
TANGO 292 polypeptide of the invention. Such nucleic acids include,
for example, a DNA molecule having the nucleotide sequence listed
in SEQ ID NO: 308 or 351 or some portion thereof, such as the
portion which encodes mature human or gerbil TANGO 292 protein,
immature human or gerbil TANGO 292 protein, or a domain of human or
gerbil TANGO 292 protein. These nucleic acids are collectively
referred to as TANGO 292 nucleic acids of the invention.
[0568] TANGO 292 proteins and nucleic acid molecules encoding them
comprise a family of molecules having certain conserved structural
and functional features. This family includes, for example, human
and gerbil TANGO 292 proteins and nucleic acid molecules described
herein.
[0569] A common domain present in TANGO 292 proteins is a signal
sequence. In one embodiment, a TANGO 292 protein contains a signal
sequence corresponding to about amino acid residues 1 to 17 of SEQ
ID NO: 310 (SEQ ID NO: 311) or to about amino acid residues 1 to 17
of SEQ ID NO: 353 (SEQ ID NO: 354). The signal sequence is cleaved
during processing of the mature protein.
[0570] TANGO 292 proteins can include an extracellular domain. The
human TANGO 292 protein extracellular domain is located from about
amino acid residue 18 to about amino acid residue 113 of SEQ ID NO:
310 (SEQ ID NO: 313). The gerbil TANGO 292 protein extracellular
domain includes at least about amino acid residues 18 to 112 of SEQ
ID NO: 353 (SEQ ID NO: 356).
[0571] In addition, TANGO 292 includes a transmembrane domain. In
one embodiment, a human TANGO 292 protein contains a transmembrane
domain corresponding to about amino acid residues 114 to 138 of SEQ
ID NO: 310 (SEQ ID NO: 314). Gerbil TANGO 292 protein includes a
transmembrane domain corresponding to about amino acid residues 113
to 137 of SEQ ID NO: 353 (SEQ ID NO: 357).
[0572] The present invention includes TANGO 292 proteins having a
cytoplasmic domain, particularly including proteins having a
carboxyl-terminal cytoplasmic domain. The human TANGO 292
cytoplasmic domain is located from about amino acid residue 139 to
amino acid residue 226 of SEQ ID NO: 310 (SEQ ID NO: 315). The
gerbil TANGO 292 cytoplasmic domain is located from about amino
acid residue 138 to amino acid residue 225 of SEQ ID NO: 353 (SEQ
ID NO: 358).
[0573] TANGO 292 proteins typically comprise a variety of potential
post-translational modification sites (often within an
extracellular domain), such as those described herein in Table XXIa
as predicted by computerized sequence analysis of human TANGO 292
protein, or in Table XXIb as predicted by computerized sequence
analysis of gerbil TANGO 292 protein, using amino acid sequence
comparison software (comparing the amino acid sequence of TANGO 292
with the information in the PROSITE database {rel. 12.2; February,
1995} and the Hidden Markov Models database {Rel. PFAM 3.3}). In
certain embodiments, a protein of the invention has at least 1, 2,
4, 6, or all of the post-translational modification sites listed in
Table XXIa or in Table XXIb.
TABLE-US-00028 TABLE XXIa Type of Potential Amino Acid Modification
Site Residues of Amino Acid or Domain SEQ ID NO: 310 Sequence cAMP-
or cGMP-dependent 197 to 200 RKHS protein kinase phosphorylation
site Protein kinase C 37 to 39 TSK phosphorylation site 97 to 99
SAK 102 to 104 TTK 196 to 198 TRK Casein kinase II 37 to 40 TSKE
phosphorylation site 103 to 106 TKSD 180 to 183 SVED
N-myristoylation site 116 to 121 GLLTGL Vitamin K-dependent 56 to
98 carboxylation domain
TABLE-US-00029 TABLE XXIb Type of Potential Amino Acid Modification
Site Residues of Amino Acid or Domain SEQ ID NO: 353 Sequence cAMP-
or 196 to 199 RKHS cGMP-dependent protein kinase phosphorylation
site Protein kinase C 23 to 25 SLK phosphorylation 37 to 39 SKK
site 96 to 98 SVK 101 to 103 TTR 155 to 157 TRR 195 to 197 TRK
Casein kinase II 74 to 77 SYEE phosphorylation 102 to 105 TRSD site
155 to 157 THEE 195 to 197 SSSE N-myristoylation 33 to 38 GVFASK
site 115 to 120 GLLTGL Vitamin 55 to 92 K-dependent carboxylation
domain
[0574] Among the domains that occur in TANGO 292 protein is a
vitamin K-dependent carboxylation domain. In one embodiment, the
protein of the invention has at least one domain that is at least
55%, preferably at least about 65%, more preferably at least about
75%, yet more preferably at least about 85%, and most preferably at
least about 95% identical to this vitamin K-dependent carboxylation
domain.
[0575] The vitamin K-dependent carboxylation domain has the
following consensus sequence (SEQ ID NO: 454), wherein standard
single-letter amino acid codes are used and `X` refers to any amino
acid residue. -X.sub.12-E-X.sub.3-E-X-C-X.sub.6-(D or E or N)-X-(L
or I or V or M or F or Y)-X.sub.9-(F or Y or W)-Glutamic acid
residues within this consensus region are potential vitamin
K-dependent carboxylation sites. Human TANGO 292 has 9 glutamic
acid residues in the vitamin K-dependent carboxylation domain
located from about amino acid residue 56 to 98 of SEQ ID NO: 310,
namely at amino acid residues 58, 66, 68, 71, 72, 77, 78, 81, and
86 of SEQ ID NO: 310, and gerbil TANGO 292 has 10 glutamic acid
residues in the vitamin K-dependent carboxylation domain located
from about amino acid residue 55 to 92 of SEQ ID NO: 353, namely at
amino acid residues 57, 65, 67, 70, 71, 76, 77, 80, 86, and 87 of
SEQ ID NO: 353. In one embodiment, the protein of the invention is
carboxylated at one or more of these glutamic acid residues. In
some proteins in which a vitamin K-dependent carboxylation domain
occurs, many of the glutamic acid residues which occur from the
amino terminus of the protein through the conserved aromatic
residue at the carboxyl terminal end of the domain are
carboxylated. Human TANGO 292 has 13 glutamic acid residues in the
region from the amino terminus of (both the immature and mature
forms of) the protein and the tryptophan residue at amino acid
residue 93 of SEQ ID NO: 310, and also has another glutamic acid
residue at position 95 of SEQ ID NO: 310 which can also be
carboxylated. In addition, human TANGO 292 protein has four sets of
paired (i.e., adjacent) glutamic acid residues, at residues 33-34,
40-41, 71-72, and 77-78 and a pair of glutamic acid residues (66
and 68) which are separated by a single residue. Similarly, gerbil
TANGO 292 has 12 glutamic acid residues in the region from the
amino terminus of (both the immature and mature forms of) the
protein and the tryptophan residue at amino acid residue 92 of SEQ
ID NO: 353, and also has another glutamic acid residue at position
94 of SEQ ID NO: 353 which can also be carboxylated. In addition,
gerbil TANGO 292 protein has three sets of glutamic acid residues,
at residues 70-71, 76-77, and 86-87, and a pair of glutamic acid
residues (65 and 67) which are separated by a single residue. The
protein of the invention includes proteins which are carboxylated
at one or more of the individual or paired glutamic acid
residues.
[0576] TANGO 292, like other vitamin K-dependent carboxylation
domain-containing proteins, is involved in binding, uptake, and
response to metal cations such as calcium, to proteins, and to
small molecules. Other proteins in which a vitamin K-dependent
carboxylation domain occurs include, for example, osteocalcin
(bone-Gla protein), matrix Gla protein, various plasma proteins
such as prothrombin, coagulation factors VII, IX, and X, proline
rich Gla domain-containing proteins PRGP1 and PRGP2, and proteins
C, S, and Z. Thus, TANGO 292 is involved in physiological processes
in which one or more of these other vitamin K-dependent
carboxylation domain-containing proteins is involved.
[0577] The signal peptide prediction program SIGNALP (Nielsen et
al. (1997) Protein Engineering 10:1-6) predicted that human TANGO
292 protein includes an approximately 17 (i.e., 15, 16, 17, 18, or
19) amino acid residue signal peptide (amino acid residues 1 to 17
of SEQ ID NO: 310; SEQ ID NO: 311) preceding the mature TANGO 292
protein (i.e., approximately amino acid residues 18 to 226 of SEQ
ID NO: 310; SEQ ID NO: 312). In one embodiment, human TANGO 292
protein includes an extracellular domain (amino acid residues 18 to
113 of SEQ ID NO: 310; SEQ ID NO: 313); a transmembrane domain
(amino acid residues 114 to 138 of SEQ ID NO: 310; SEQ ID NO: 314);
and a cytoplasmic domain (amino acid residues 139 to 225 of SEQ ID
NO: 310; SEQ ID NO: 315). In an alternative embodiment, human TANGO
292 protein includes a cytoplasmic domain (amino acid residues 18
to 113 of SEQ ID NO: 310; SEQ ID NO: 313); a transmembrane domain
(amino acid residues 114 to 138 of SEQ ID NO: 310; SEQ ID NO: 314);
and an extracellular domain (amino acid residues 139 to 225 of SEQ
ID NO: 310; SEQ ID NO: 315).
[0578] The SignalP program predicted that gerbil TANGO 292 protein
includes an approximately 17 (i.e., 15, 16, 17, 18, or 19) amino
acid residue amino acid signal peptide (amino acid residues 1 to 17
of SEQ ID NO: 353; SEQ ID NO: 354) preceding the mature TANGO 292
protein (i.e., approximately amino acid residues 18 to 225 of SEQ
ID NO: 353; SEQ ID NO: 355). In one embodiment, gerbil TANGO 292
protein includes an extracellular domain (amino acid residues 18 to
112 of SEQ ID NO: 353; SEQ ID NO: 356); a transmembrane domain
(amino acid residues 113 to 137 of SEQ ID NO: 353; SEQ ID NO: 357);
and a cytoplasmic domain (amino acid residues 138 to 225 of SEQ ID
NO: 353; SEQ ID NO: 358). In an alternative embodiment, gerbil
TANGO 292 protein includes a cytoplasmic domain (amino acid
residues 18 to 112 of SEQ ID NO: 353; SEQ ID NO: 356); a
transmembrane domain (amino acid residues 113 to 137 of SEQ ID NO:
353; SEQ ID NO: 357); and an extracellular domain (amino acid
residues 138 to 225 of SEQ ID NO: 353; SEQ ID NO: 358).
[0579] FIG. 44 depicts a hydrophobicity plot of human TANGO 292
protein. Relatively hydrophobic regions are above the dashed
horizontal line, and relatively hydrophilic regions are below the
dashed horizontal line. The hydrophobic region which corresponds to
amino acid residues 1 to 17 of SEQ ID NO: 310 is the signal
sequence of human TANGO 292. The hydrophobic region which
corresponds to amino acid residues 114 to 138 of SEQ ID NO: 310 is
the transmembrane domain of human TANGO 292. As described elsewhere
herein, relatively hydrophilic regions are generally located at or
near the surface of a protein, and are more frequently effective
immunogenic epitopes than are relatively hydrophobic regions. For
example, the region of human TANGO 292 protein from about amino
acid residue 90 to about amino acid residue 110 appears to be
located at or near the surface of the protein, while the region
from about amino acid residue 190 to about amino acid residue 195
appears not to be located at or near the surface.
[0580] FIG. 47 depicts a hydrophobicity plot of gerbil TANGO 292
protein. Relatively hydrophobic regions are above the dashed
horizontal line, and relatively hydrophilic regions are below the
dashed horizontal line. The hydrophobic region which corresponds to
amino acid residues 1 to 17 of SEQ ID NO: 353 is the signal
sequence of gerbil TANGO 292. The hydrophobic region which
corresponds to amino acid residues 113 to 137 of SEQ ID NO: 353 is
the transmembrane domain of gerbil TANGO 292. As described
elsewhere herein, relatively hydrophilic regions are generally
located at or near the surface of a protein, and are more
frequently effective immunogenic epitopes than are relatively
hydrophobic regions. For example, the region of gerbil TANGO 292
protein from about amino acid residue 90 to about amino acid
residue 110 appears to be located at or near the surface of the
protein.
[0581] An alignment of the human (H) and gerbil (G) ORF sequences
encoding TANGO 292 protein is shown in FIGS. 45A-45C. This
alignment was made using the ALIGN software {Myers and Miller
(1989) CABIOS, ver. 2.0}; pam120.mat scoring matrix; gap opening
penalty=12, gap extension penalty=4), and indicates about 64.1%
identity between these two cDNA sequences. An alignment of the
amino acid sequences of gerbil (G) and human (H) TANGO 292 proteins
is shown in FIG. 46. In this alignment (made using the ALIGN
software {Myers and Miller (1989) CABIOS, ver. 2.0}; pam120.mat
scoring matrix; gap opening penalty=12, gap extension penalty=4),
the proteins are about 77.7% identical and about 80% similar.
[0582] The predicted molecular weight of human TANGO 292 protein
without modification and prior to cleavage of the signal sequence
is about 25.4 kilodaltons. The predicted molecular weight of the
mature human TANGO 292 protein without modification and after
cleavage of the signal sequence is about 23.6 kilodaltons. The
predicted molecular weight of gerbil TANGO 292 protein without
modification and prior to cleavage of the signal sequence is about
25.4 kilodaltons. The predicted molecular weight of the mature
human TANGO 292 protein without modification and after cleavage of
the signal sequence is about 23.5 kilodaltons.
[0583] Northern analysis experiments indicated that human mRNA
corresponding to the cDNA encoding TANGO 292 is expressed in the
tissues listed in Table XXIc, wherein "++" indicates strong
expression, "+" indicates lower expression, "+/-" indicates still
lower expression, and "-" indicates that expression could not be
detected in the corresponding tissue.
TABLE-US-00030 TABLE XXIC Animal Tissue Relative Level of
Expression Human placenta ++ liver ++ kidney ++ lung + pancreas +
heart +/- brain - skeletal muscle -
[0584] Uses of INTERCEPT 292 Nucleic acids,
[0585] Polypeptides, and Modulators Thereof
[0586] TANGO 292 proteins are involved in disorders which affect
both tissues in which they are normally expressed and tissues in
which they are normally not expressed. Based on the observation
that TANGO 292 is expressed in human embryonic keratinocytes, and
in placenta, liver, kidney, lung, pancreas, and heart tissues,
TANGO 292 protein is involved in one or more biological processes
which occur in these tissues. In particular, TANGO 292 is involved
in modulating growth, proliferation, survival, differentiation, and
activity of cells including, but not limited to, keratinocytes and
cells with which keratinocytes interact in the animal in which
TANGO 292 is normally expressed. TANGO 292 is also involved in
modulating growth, proliferation, survival, differentiation, and
activity of placenta, liver, kidney, lung, pancreas, and heart
cells. Thus, TANGO 292 has a role in disorders which affect these
cells and their growth, proliferation, survival, differentiation,
and activity. TANGO 292 polypeptides, nucleic acids, and modulators
thereof can be used to prognosticate, diagnose, inhibit, prevent,
or alleviate one or more of these disorders.
[0587] In another example, TANGO 292 polypeptides, nucleic acids,
and modulators thereof can be used to treat placental disorders,
such as those described elsewhere in this disclosure. TANGO 292
polypeptides, nucleic acids, and modulators thereof can be used to
prognosticate, diagnose, inhibit, prevent, or alleviate one or more
of these disorders.
[0588] In another example, TANGO 292 polypeptides, nucleic acids,
and modulators thereof, can be used to treat hepatic (i.e., liver)
disorders, such as the liver disorders described elsewhere in this
disclosure. TANGO 292 polypeptides, nucleic acids, and modulators
thereof can be used to prognosticate, diagnose, inhibit, prevent,
or alleviate one or more of these disorders.
[0589] In another example, TANGO 292 polypeptides, nucleic acids,
or modulators thereof, can be used to treat renal (i.e., kidney)
disorders, such as the kidney disorders described elsewhere in this
disclosure. TANGO 292 polypeptides, nucleic acids, and modulators
thereof can be used to prognosticate, diagnose, inhibit, prevent,
or alleviate one or more of these disorders.
[0590] TANGO 292 polypeptides, nucleic acids, and modulators
thereof can be associated with pulmonary (i.e., lung) disorders,
such as the lung disorders described elsewhere in this disclosure.
TANGO 292 polypeptides, nucleic acids, or modulators thereof can be
used to prognosticate, diagnose, inhibit, prevent, or alleviate one
or more of these disorders.
[0591] Pancreatic disorders in which TANGO 292 can be involved
include the pancreatic disorders described elsewhere in this
disclosure. TANGO 292 polypeptides, nucleic acids, or modulators
thereof can be used to prognosticate, diagnose, inhibit, prevent,
or alleviate one or more of these disorders.
[0592] Because TANGO 292 exhibits expression in the heart, TANGO
292 nucleic acids, proteins, and modulators thereof can be used to
treat cardiovascular disorders. Examples of cardiovascular
disorders with which TANGO 292 can be involved include those
described elsewhere in this disclosure. TANGO 292 polypeptides,
nucleic acids, or modulators thereof can be used to prognosticate,
diagnose, inhibit, prevent, or alleviate one or more of these
disorders.
[0593] Presence in TANGO 292 of a vitamin K-dependent carboxylation
(Gla) domain indicates that TANGO 292 is involved in physiological
functions identical or analogous to the functions performed by
other proteins having such domains. For example, like other Gla
domain-containing proteins, TANGO 292 modulates binding and uptake
of calcium and other metal ions by cells which express it and the
response of those cells to the presence and uptake of such ions.
Human matrix Gla protein, for example, is involved in Keutel
syndrome, an autosomal recessive disorder characterized by abnormal
cartilage calcification, peripheral pulmonary stenosis, and
midfacial hypoplasia (Munroe et al. (1999) Nat. Genet. 21:142-144).
Other proteins containing a Gla domain include, for example, two
human proline-rich Gla proteins designated PRGP1 and PRGP2, human G
domain-containing protein Gas6, and several human blood coagulation
factors (Kulman et al. (1997) Proc. Natl. Acad. Sci. USA
94:9058-9062; Mark et al., (1996) J. Biol. Chem. 271:9785-9786;
Cancela et al. (1990) J. Biol. Chem. 265:15040-15048). These
proteins are involved in binding of mineral ions such as calcium,
phosphate, and hydroxyapatite, binding of proteins, binding of
vitamins and small molecules, and mediation of blood coagulation.
Thus, TANGO 292 is involved in numerous physiological processes
which are influenced by levels of calcium and other metal ions in
body fluids or by the presence of proteins, vitamins, or small
molecules. Such processes include, for example, bone uptake,
maintenance, and deposition, formation, maintenance, and repair of
cartilage, formation and maintenance of extracellular matrices,
movement of cells through extracellular matrices, coagulation and
dissolution of blood components (e.g., blood cells and proteins),
and deposition of materials (e.g., lipids, cells, calcium, and the
like) in arterial walls. TANGO 292 polypeptides, nucleic acids, and
modulators thereof can be used to prognosticate, diagnose, inhibit,
prevent, or alleviate one or more of these disorders.
[0594] TANGO 292 is involved in disorders which affect the tissues
in which it is normally expressed and upon which it normally acts.
Thus, TANGO 292 is involved in disorders which involve aberrant
binding or aberrant failure to bind of keratinocytes or similar
cells with a tissue affected by the disorder. Such disorders
include, by way of example and not limitation, osteoporosis,
(repair of) traumatic bone injuries, rickets, osteomalacia, Paget's
disease, and other bone disorders, osteoarthritis, rheumatoid
arthritis, ankylosing spondylitis, Keutel syndrome, and other
disorders of the joints and cartilage, iron deficiency anemia,
hemophilia, inappropriate blood coagulation, stroke,
arteriosclerosis, atherosclerosis, aneurysm, and other disorders
related to blood and blood vessels, metastasis and other disorders
related to inappropriate movement of cells through extracellular
matrices, and the like. TANGO 292 polypeptides, nucleic acids, and
modulators thereof can be used to prognosticate, diagnose, inhibit,
prevent, or alleviate one or more of these disorders.
TANGO 331
[0595] A cDNA clone (designated jthvb042g08) encoding at least a
portion of human TANGO 331 protein was isolated from a human
mammary epithelium cDNA library. A corresponding cDNA clone
(designated jchrc045a03) was isolated from a human heart library.
The human TANGO 331 protein is predicted by structural analysis to
be a secreted protein.
[0596] The full length of the cDNA encoding human TANGO 331 protein
(SEQ ID NO: 324) is 1432 nucleotide residues. The ORF of this cDNA,
nucleotide residues 114 to 1172 of SEQ ID NO: 324 (i.e., SEQ ID NO:
325), encodes a 353-amino acid secreted protein (SEQ ID NO:
326).
[0597] The invention thus includes purified human TANGO 331
protein, both in the form of the immature 353 amino acid residue
protein (SEQ ID NO: 326) and in the form of the mature,
approximately 329 amino acid residue protein (SEQ ID NO: 328).
Mature human TANGO 331 protein can be synthesized without the
signal sequence polypeptide at the amino terminus thereof, or it
can be synthesized by generating immature TANGO 331 protein and
cleaving the signal sequence therefrom.
[0598] The invention includes nucleic acid molecules which encode a
TANGO 331 polypeptide of the invention. Such nucleic acids include,
for example, a DNA molecule having the nucleotide sequence listed
in SEQ ID NO: 324 or some portion thereof, such as the portion
which encodes mature TANGO 331 protein, immature TANGO 331 protein,
or a domain of TANGO 331 protein. These nucleic acids are
collectively referred to as TANGO 331 nucleic acids of the
invention.
[0599] TANGO 331 proteins and nucleic acid molecules encoding them
comprise a family of molecules having certain conserved structural
and functional features, as indicated by the conservation of amino
acid sequence between human TANGO 331 protein and the Chinese
hamster (Cricetulus griseus) protein designated HT and having
GenBank Accession number U48852, as shown in FIG. 23E, and the
conservation of nucleotide sequence between the ORFs encoding human
TANGO 331 protein and Chinese hamster protein HT, as shown in FIGS.
50A-50E.
[0600] A common domain present in TANGO 331 proteins is a signal
sequence. In one embodiment, a TANGO 331 protein contains a signal
sequence corresponding to about amino acid residues 1 to 24 of SEQ
ID NO: 326 (SEQ ID NO: 327). The signal sequence is cleaved during
processing of the mature protein.
[0601] TANGO 331 proteins can include an extracellular domain. The
human TANGO 331 protein is a secreted protein, and thus includes an
`extracellular domain` consisting of the entire mature protein
(i.e., approximately residues 25 to 353 of SEQ ID NO: 326; SEQ ID
NO: 328).
[0602] TANGO 331 proteins typically comprise a variety of potential
post-translational modification sites (often within an
extracellular domain), such as those described herein in Table
XXII, as predicted by computerized sequence analysis of TANGO 331
proteins using amino acid sequence comparison software (comparing
the amino acid sequence of TANGO 331 with the information in the
PROSITE database {rel. 12.2; February, 1995} and the Hidden Markov
Models database {Rel. PFAM 3.3}). In certain embodiments, a protein
of the invention has at least 1, 2, 4, 6, 10, 15, or 20 or more of
the post-translational modification sites listed in Table XXII.
TABLE-US-00031 TABLE XXII Type of Potential Amino Acid Modification
Site Residues of Amino Acid or Domain SEQ ID NO: 326 Sequence
N-glycosylation 190 to 193 NETH site 251 to 254 NGSY cAMP- or 26 to
29 KKPT cGMP-dependent protein kinase phosphorylation site Protein
kinase 48 to 50 TAK C phosphorylation 123 to 125 TLK site 144 to
146 SQR 165 to 167 SCR 187 to 189 SLR 202 to 204 SCK 210 to 212 TNR
Casein 58 to 61 TAWE kinase II 66 to 69 SKYE phosphorylation 86 to
89 SDFE site 197 to 200 TACD 210 to 213 TNRD 255 to 258 TCEE 295 to
298 SLAE 339 to 342 TEGE 349 to 352 SRED Tyrosine kinase 303 to 309
RKNENCY phosphorylation site N-myristoylation 44 to 49 GMVDTA site
54 to 59 GGGNTA 81 to 86 GLCESS 150 to 155 GNGHCS 158 to 163 GSRQGD
164 to 169 GSCRCH 252 to 257 GSYTCE 313 to 318 GSYVCV Aspartic acid
308 to 319 and asparagine hydroxylation site EGF-like 166 to 177
domain cysteine pattern signature EGF domain 140 to 177 234 to 263
301 to 330 Laminin-like 153 to 199 EGF domain TNFR/NGFR 180 to 214
cysteine-rich region domain Vertebrate 229 to 298
metallothionein-like domain Leucine 94 to 115 Zipper domain
[0603] Among the domains that occur in TANGO 331 protein are EGF
domains, including a laminin-like EGF domain, a TNFR/NGFR
cysteine-rich domain, a metallothionein-like domain, and a leucine
zipper domain.
[0604] EGF-like domains are about 30 to 40 amino acid residues in
length and comprise several conserved cysteine residues in one of
several patterns. EGF-like domains occur in a large number of
proteins including, for example, human epidermal growth factor
(EGF), murine adipocyte differentiation inhibitor, human agrin,
human growth factor amphiregulin, human growth factor betacellulin,
sea urchin blastula tissue patterning proteins BP10 and Span,
cattle tick glycoprotein BM86, human bone morphogenic protein 1,
sea urchin suBMP, Drosophila tolloid protein, Caenorhabditis
elegans developmental proteins lin-12 and glp-1, C. elegans tissue
patterning protein APX-1, human calcium-dependent serine
proteinase, human cartilage matrix protein, human cartilage
oligomeric matrix protein, human cell surface antigen 114/A10, rat
cell surface glycoprotein complex transmembrane subunit ASGP-2,
human coagulation associated proteins C, Z, and S, human
coagulation factors VII, IX, X, and XII, human complement
components C1r, C1s, C6, C7, C8a, C813, and C9, human
complement-activating components of Ra-reactive factor, Drosophila
epithelial development protein Crumbs, sea urchin
exogastrula-inducing peptides A, C, D, and X, Drosophila
cadherin-related tumor suppressor protein Fat, human fetal antigen
1 (a neuroendocrine differentiation protein derived from the
delta-like protein), human fibrillins 1 and 2, sea urchin
fibropellins IA, IB, IC, II, and III, human extracellular matrix
proteins fibulin-1 and -2, Drosophila cell determination/axon
guidance protein Argos, various poxvirus growth factor-related
proteins, Drosophila developmental protein Gurken, human
heparin-binding EGF-like growth factor, human transforming growth
factor-.alpha., human growth factors Lin-3 and Spitz, human
hepatocyte growth factor activator, human LDL and VLDL receptors,
human LDL receptor-related protein, human leukocyte antigen CD97,
human cell surface glycoprotein EMR1, human cell surface
glycoprotein F4/80, Japanese horseshoe crab limulus clotting factor
C, mammalian membrane-bound endopeptidase Meprin A .alpha. subunit,
murine milk fat globule-EGF factor 8, human glial growth factors
neuregulin GGF-I and GGF-II, mammalian neurexins, human neurogenic
proteins Notch, Xotch, Tan-1, and Delta, C. elegans differentiation
protein Lag-2, Drosophila differentiation proteins Serrate and
Slit, chordate basement membrane protein Nidogen, Plasmodium
ookinete 24, 25, and 28 kilodalton surface proteins, human
pancreatic secretory granule membrane glycoprotein GP2, human
non-specific cell lysis protein Perforin, human proteoglycans
aggrecan, versican, perlecan, brevican, and chondroitin sulfate,
human endoplasmic reticulum prostaglandin G/H synthases 1 and 2,
human extracellular protein S1-5, human autocrine growth factor
Schwannoma-derived growth factor, human E-, P--, and L-selectins,
Arabidopsis thaliana chlorophyll complex assembly protein
serine/threonine-protein kinase homolog, guinea pig sperm-egg
fusion proteins PH-30.alpha. and .beta., murine stromal cell
derived protein-1, human teratocarcinoma-derived growth factor,
mammalian extracellular protein tenascin, chicken extracellular
protein TEN-A, human tenascin-X, Drosophila tenascin-like proteins
TEN-A and TEN-M, human protein C activator thrombomodulin, human
adhesive glycoproteins thrombospondins 1, 2, 3, and 4, human
thyroid peroxidases 1 and 2, human transforming growth factor
.beta.-1 binding protein, human tyrosine-protein kinase receptors
Tek and Tie, human urokinase-type plasminogen activator, human
tissue plasminogen activator, human uromodulin, human vitamin
K-dependent anticoagulant proteins C and S (and the related human
single-chain plasma glycoprotein Z), the sea urchin 63 kilodalton
sperm flagellar membrane protein, chicken Nel protein, and the
hypothetical C. Elegans protein T20G5.3. Although these proteins
have a variety of activities and sites of expression, a common
characteristic of most of them is that they are involved in
protein-to-protein binding in the extracellular space--either to a
secreted protein, a component of the extracellular matrix, or to an
extracellular portion of an integral membrane protein. Based on
this shared characteristic, the presence of multiple EGF-like
domains in TANGO 331 indicates that TANGO 331 is involved in
binding to proteins extracellularly.
[0605] Post-translational hydroxylation of aspartic acid or
asparagine to form erythro-.beta.-hydroxyaspartic acid or
erythro-.beta.-hydroxyasparagine occurs in various proteins having
one or more EGF-like domains (e.g., blood coagulation protein
factors VII, IX, and X, blood coagulation proteins C, S, and Z, the
LDL receptor, thrombomodulin, and the like). TANGO 331 has a
signature sequence which is characteristic of hydroxylation of the
asparagine residue at amino acid residue 310. The invention thus
includes TANGO 331 proteins having a hydroxylated asparagine
residue at position 310 of SEQ ID NO: 326.
[0606] TNFR/NGFR (tumor necrosis factor receptor/nerve growth
factor receptor) cysteine-rich region domains are about 30 to 40
amino acid residues in length, and generally exhibit a conserved
pattern of six or more cysteine residues. These domains occur in
several soluble and transmembrane proteins which are known to be
receptors for growth factors or for cytokines. Examples of
TNFR/NGFR cysteine-rich region domain-containing proteins are human
tumor necrosis factor (TNF) cysteine-rich region domains type I and
type II receptors, Shope fibroma virus soluble TNF receptor, human
lymphotoxin .alpha./.beta., human low-affinity nerve growth factor
receptor, human CD40L (cytokine) receptor CD40, human CD27L
(cytokine) receptor CD27, human CD30L (cytokine) receptor CD30,
human T-cell cytokine receptor 4-1BB, human apoptotic FASL protein
receptor FAS, human T-cell OX40L (cytokine) receptor OX40, human
apoptosis-related receptor Wsl-1, and Vaccinia protein A53.
Presence of a TNFR/NGFR cysteine-rich region domain in TANGO 331 is
an indication that TANGO 331 is involved in one or more
physiological processes involving extracellular binding with a
cytokine or growth factor. Such processes include, for example,
growth, homeostasis, regeneration, and proliferation of cells and
tissues, immune (including autoimmune) responses, host defenses
against infection, and the like.
[0607] Metallothioneins are cysteine-rich proteins which are
capable of binding heavy metals such as calcium, zinc, copper,
cadmium, cobalt, nickel, and the like. Proteins which have a domain
which resembles a metal-binding domain of a metallothionein are
also capable of binding such metals. TANGO 331 comprises a
metallothionein-like domain, and is capable of binding one or more
heavy metals. This is an indication that TANGO 331 is involved in
one or more physiological processes which involve metal binding.
Such processes include, by way of example and not limitation,
nutritional supply of metals to cells on a controlled basis,
removal of toxic metal species from body tissues, storage of
metals, and the like.
[0608] TANGO 331 comprises a leucine zipper region at about amino
acid residue 94 to about amino acid residue 115 (i.e., 94
LeaqeehLeawwlqLkseypdL 115; SEQ ID NO: 460). Leucine zipper regions
are known to be involved in dimerization of proteins. Leucine
zipper regions interact with one another, leading to formation of
homo- or hetero-dimers between proteins, depending on their
identity. The presence in TANGO 331 of a leucine zipper region is a
further indication that this protein is involved in protein-protein
interactions.
[0609] TANGO 331 shares amino acid and nucleic acid homology with a
Chinese hamster protein designated HT, and thus is involved in
corresponding physiological processes in humans. An alignment of
the amino acid sequences of (human) TANGO 331 and Chinese hamster
protein HT is shown in FIG. 23E. In this alignment (made using the
ALIGN software {Myers and Miller (1989) CABIOS, ver. 2.0};
pam120.mat scoring matrix; gap opening penalty=12, gap extension
penalty=4), the proteins are 71.9% identical. An alignment of the
nucleotide sequences of the ORFs encoding (human) TANGO 331 and
Chinese hamster protein HT is shown in FIGS. 50A-50E. The two ORFs
are 74.5% identical, as assessed using the same software and
parameters.
[0610] The signal peptide prediction program SIGNALP (Nielsen et
al. (1997) Protein Engineering 10:1-6) predicted that human TANGO
331 protein includes an approximately 24 (i.e., 22, 23, 24, 25, or
26) amino acid residue signal peptide (amino acid residues 1 to 24
of SEQ ID NO: 326; SEQ ID NO: 327) preceding the mature TANGO 331
protein (i.e., approximately amino acid residues 25 to 353 of SEQ
ID NO: 326; SEQ ID NO: 328). Mature human TANGO 331 is a secreted
protein.
[0611] FIG. 48 depicts a hydrophobicity plot of human TANGO 331
protein. Relatively hydrophobic regions are above the dashed
horizontal line, and relatively hydrophilic regions are below the
dashed horizontal line. The hydrophobic region which corresponds to
amino acid residues 1 to 24 of SEQ ID NO: 326 is the signal
sequence of human TANGO 331 (SEQ ID NO: 327). As described
elsewhere herein, relatively hydrophilic regions are generally
located at or near the surface of a protein, and are more
frequently effective immunogenic epitopes than are relatively
hydrophobic regions. For example, the region of human TANGO 331
protein from about amino acid residue 140 to about amino acid
residue 170 appears to be located at or near the surface of the
protein, while the region from about amino acid residue 115 to
about amino acid residue 130 appears not to be located at or near
the surface.
[0612] The predicted molecular weight of human TANGO 331 protein
without modification and prior to cleavage of the signal sequence
is about 38.2 kilodaltons. The predicted molecular weight of the
mature human TANGO 331 protein without modification and after
cleavage of the signal sequence is about 35.6 kilodaltons.
[0613] Tissue distribution of TANGO 331 mRNA was determined by
Northern blot hybridization. Northern blot hybridizations with the
various RNA samples were performed using standard Northern blotting
conditions and washing under stringent conditions (i.e.,
0.2.times.SSC at 65.degree. C.). The DNA probe used in the Northern
Blot experiments was radioactively labeled with 32P-dCTP using the
PRIME-ITT.TM. kit (Stratagene, La Jolla, Calif.) according to the
instructions of the supplier. Filters having human mRNA disposed
thereon (MULTITISSUE.TM. Northern I and MULTITISSUE.TM. Northern II
obtained from Clontech, Palo Alto, Calif.) were probed in
EXPRESSHYB.TM. hybridization solution (Clontech) and washed at high
stringency according to the manufacturer's recommendations.
[0614] Two isoforms of human TANGO 331 were identified using this
Northern blot analysis, indicating that TANGO 331 can have a splice
variant. One isoform (corresponding to the larger message) can be a
transmembrane protein (frizzled-like) and the other (i.e., smaller)
isoform can be a secreted form. The two isoforms exhibit a clear
pattern of tissue specificity. On the multiple tissue blot from
Clonetech, the large transcript is found in almost all tissues,
whereas the smaller message is expressed mainly in heart, skeletal
muscle, placenta, and pancreas tissues.
[0615] TANGO 331 can be expressed as a recombinant
glutathione-S-transferase (GST) fusion polypeptide in E. coli and
the fusion polypeptide is isolated and characterized. Specifically,
TANGO 331 can be fused with GST and this fusion polypeptide can
expressed in E. coli, e.g., in strain PEB 199. Expression of the
GST-TANGO 331 fusion protein in PEB 199 is induced with IPTG. The
recombinant fusion polypeptide can be purified from crude bacterial
lysates of the induced PEB 199 strain by affinity chromatography,
e.g., using glutathione-substituted beads. Using polyacrylamide gel
electrophoretic analysis of the polypeptide purified from the
bacterial lysates, the molecular weight of the resultant fusion
polypeptide can be determined.
[0616] To express the TANGO 331 gene in COS cells, the pcDNA/Amp
vector by Invitrogen Corporation (San Diego, Calif.) can be used.
This vector contains an SV40 origin of replication, an ampicillin
resistance gene, an E. coli replication origin, a CMV promoter
followed by a polylinker region, and an SV40 intron and
polyadenylation site. A DNA fragment encoding the entire TANGO 331
protein and an HA tag (Wilson et al. (1984) Cell 37:767) or a FLAG
tag fused in-frame to its 3' end of the fragment can be cloned into
the polylinker region of the vector, thereby placing the expression
of the recombinant protein under the control of the CMV
promoter.
[0617] To construct the plasmid, the TANGO 331 DNA sequence is
amplified by PCR using two primers. The 5' primer contains the
restriction site of interest followed by approximately twenty
nucleotides of the TANGO 331 coding sequence starting from the
initiation codon; the 3' end sequence contains complementary
sequences to the other restriction site of interest, a translation
stop codon, the HA tag or FLAG tag and the last 20 nucleotides of
the TANGO 331 coding sequence. The PCR amplified fragment and the
pcDNA/Amp vector are digested with the appropriate restriction
enzymes and the vector is dephosphorylated using the CIAP enzyme
(New England Biolabs, Beverly, Mass.). Preferably the two
restriction sites chosen are different so that the TANGO 331 gene
is inserted in the correct orientation. The ligation mixture is
transformed into E. coli cells (e.g., one or more of strains HB101,
DH5a, SURE, available from Stratagene Cloning Systems, La Jolla,
Calif.), the transformed culture is plated on ampicillin media
plates, and resistant colonies are selected. Plasmid DNA is
isolated from transformants and examined by restriction analysis
for the presence of the correct fragment.
[0618] COS cells are subsequently transfected using the TANGO
331-pcDNA/Amp plasmid DNA using the calcium phosphate or calcium
chloride co-precipitation methods, DEAE-dextran-mediated
transfection, lipofection, or electroporation. Other suitable
methods of transfecting host cells can be found in Sambrook, J.,
Fritsh, E. F., and Maniatis, T. Molecular Cloning: A Laboratory
Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., 1989. The expression of
the TANGO 331 polypeptide can be detected by radiolabelling
(.sup.35S-methionine or .sup.35S-cysteine available from NEN,
Boston, Mass., can be used) and immunoprecipitation (Harlow, E. and
Lane, D. Antibodies: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., 1988) using an HA
specific monoclonal antibody. Briefly, the cells are labeled for 8
hours with .sup.35S-methionine (or .sup.35S-cysteine). The culture
media are then collected and the cells are lysed using detergents
(RIPA buffer, 150 millimolar NaCl, 1% NP-40, 0.1% SDS, 0.5% DOC, 50
millimolar Tris, pH 7.5). Both the cell lysate and the culture
media are precipitated with an HA specific monoclonal antibody.
Precipitated polypeptides are then analyzed by SDS-PAGE.
[0619] Alternatively, DNA containing the TANGO 331 coding sequence
can be cloned directly into the polylinker of the pcDNA/Amp vector
using the appropriate restriction sites. The resulting plasmid is
transfected into COS cells in the manner described above, and the
expression of the TANGO 331 polypeptide can be detected by
radiolabelling and immunoprecipitation using an TANGO 331 specific
monoclonal antibody.
[0620] The human TANGO 331 gene was mapped using the Genebridge 4
Human Radiation hybrid mapping panel with ATTATTCAGAAGGATGTCCCGTGG
(SEQ ID NO: 369) as the forward primer and CCTCCTGATTACCTACAATGGTC
(SEQ ID NO: 370) as the reverse primer. The human TANGO 331 gene
maps to human 22q11-q13. Flanking markers for this region are
WI-4572 and WI-8917. The schizophrenia 4 (sczd4) locus also maps to
this region of the human chromosome. Also mapping to this region of
the human chromosome are the following genes: transcription factor
20 (tcf20), Benzodiazepine receptor, peripheral type (bzrp),
Arylsulfatase A (arsa), diaphorase (NADH); cytochrome b-5 reductase
(dia1), and Solute carrier family 5 (sodium/glucose transporter),
member 1 (slca1). This region is syntenic to mouse chromosome 15.
The stargazer (stg), gray tremor (gt), brachyury modifier 2 (Brm2),
bronchial hyperresponsiveness 2 (Bhr2), loss of righting induced by
ethanol 5 (Lore5), fluctuating asymmetry QTL 8 (Faq8), jerky (Jrk),
belted (bt), and koala (Koa) loci also map to this region of the
mouse chromosome, several of which are neuromuscular related.
[0621] Uses of TANGO 331 Nucleic acids,
[0622] Polypeptides, and Modulators Thereof
[0623] TANGO 331 proteins are involved in disorders which affect
both tissues in which they are normally expressed and tissues in
which they are normally not expressed. Based on the observation
that TANGO 331 is expressed in human mammary epithelial tissue and
human heart tissue, TANGO 331 protein is involved in one or more
biological processes which occur in mammary epithelial tissue, in
other epithelial tissues, and in heart tissue. In particular, TANGO
331 is involved in modulating growth, proliferation, survival,
differentiation, and activity of cells including, but not limited
to, epithelial cells (e.g., mammary epithelial cells) of the animal
in which it is normally expressed. Thus, TANGO 331 has a role in
disorders which affect these cells and their growth, proliferation,
survival, differentiation, and activity. TANGO 331 is therefore
involved in physiological processes such as maintenance of
epithelia, carcinogenesis, modulation and storage of protein
factors and metals, and lactation. Furthermore, because TANGO 331
is expressed in human mammary epithelial cells, it also has a role
in nutrition of human infants (e.g., providing nutrients such as
minerals to infants and providing protein factors not synthesized
by infants) and in disorders which affect them. Thus, TANGO 331 is
involved in a number of disorders such as breast cancer,
insufficient lactation, infant nutritional and growth disorders,
and the like. TANGO 331 polypeptides, nucleic acids, or modulators
thereof can be used to prognosticate, diagnose, inhibit, prevent,
or alleviate one or more of these disorders.
[0624] Because TANGO 331 exhibits expression in the heart, TANGO
331 nucleic acids, proteins, and modulators thereof can be used to
treat cardiovascular disorders. Examples of cardiovascular
disorders with which TANGO 331 can be involved include those
described elsewhere in this disclosure. TANGO 331 polypeptides,
nucleic acids, or modulators thereof can be used to prognosticate,
diagnose, inhibit, prevent, or alleviate one or more of these
disorders.
[0625] In another example, TANGO 331 polypeptides, nucleic acids,
and modulators thereof, can be involved in normal and aberrant
functioning of skeletal muscle tissue, and can thus be involved in
disorders of such tissue. Examples of skeletal muscle disorders are
described elsewhere in this disclosure. TANGO 331 polypeptides,
nucleic acids, or modulators thereof can be used to prognosticate,
diagnose, inhibit, prevent, or alleviate one or more of these
disorders.
[0626] In another example, TANGO 331 polypeptides, nucleic acids,
and modulators thereof can be used to treat placental disorders,
such as those described elsewhere in this disclosure. TANGO 331
polypeptides, nucleic acids, or modulators thereof can be used to
prognosticate, diagnose, inhibit, prevent, or alleviate one or more
of these disorders.
[0627] Presence in TANGO 331 of numerous EGF-like domains,
including the laminin-like EGF-like domain indicates that TANGO 331
is involved in extracellular binding of proteins, including both
other secreted proteins (e.g., growth factors and cytokines) and
cell-surface proteins. Binding of TANGO 331 to other secreted
proteins modulates their activity, their rate of uptake by cells,
and their rate of degradation. Binding of TANGO 331 to cell surface
proteins modulates their activity, including, for example, their
ability to bind with other secreted proteins, and transmits a
signal to the cell expressing the cell-surface protein. Presence in
TANGO 331 of a TNFR/NGFR cysteine-rich region domain is further
indicative of the ability of TANGO 331 to bind with growth factors
and cytokines. Thus, TANGO 331 is involved in a number of
proliferative and immune disorders including, but not limited to,
cancers (e.g., breast cancer), autoimmune disorders, insufficient
or inappropriate host responses to infection, acquired immune
deficiency syndrome, and the like. TANGO 331 polypeptides, nucleic
acids, or modulators thereof can be used to prognosticate,
diagnose, inhibit, prevent, or alleviate one or more of these
disorders.
[0628] The fact that TANGO 331 has a metallothionein-like region is
indicative of the ability of TANGO 331 to bind with metal ions,
including nutritionally required metal ions (e.g., calcium,
magnesium, zinc, manganese, cobalt, iron, and the like). Thus,
TANGO 331 is involved in binding with essential minerals and in
delivering them to their proper body locations. TANGO 331 is also
involved in binding excess or toxic metal ions so that they can be
excreted. TANGO 331 is thus involved in disorders involving
insufficient or inappropriate localization of metal ions. Such
disorders include, but are not limited to, malnutrition and mineral
deficiency disorders, hemochromatosis, inappropriate calcification
of body tissues, bone disorders such as osteoporosis, and the like.
TANGO 331 polypeptides, nucleic acids, or modulators thereof can be
used to prognosticate, diagnose, inhibit, prevent, or alleviate one
or more of these disorders.
[0629] Mapping of the human TANGO 331 gene to chromosomal region
22q11-q13 is an indication of disorders with which its expression
(or non- or aberrant-expression) can be associated. For example,
arylsulfatase A is associated with Metachromatic leukodystrophy.
Diaphorase (NADH:cytochrome b-5 reductase) is associated with
methemoglobinemia, types I and II. Solute carrier family 5
(sodium/glucose transporter), member 1 is associated with
glucose/galactose malabsorption. The gene designated schizophrenia
4 is associated with schizophrenia and velocardiofacial syndrome,
as described in Online Mendelian Inheritance in Man, Johns Hopkins
University, Baltimore, Md. MIM Number: 600850:12/7/98. These
mapping data indicate that TANGO 331 polypeptides, nucleic acids,
and modulators thereof can be used to prognosticate, diagnose,
inhibit, prevent, or alleviate one or more of these disorders.
TANGO 332
[0630] A cDNA clone (designated jlhbab463g12) encoding at least a
portion of human TANGO 332 protein was isolated from a human adult
brain cDNA library. The human TANGO 332 protein is predicted by
structural analysis to be a secreted protein.
[0631] The full length of the cDNA encoding human TANGO 332 protein
(SEQ ID NO: 329) is 2730 nucleotide residues. The ORF of this cDNA,
nucleotide residues 173 to 2185 of SEQ ID NO: 329 (i.e., SEQ ID NO:
330), encodes a 671-amino acid transmembrane protein (SEQ ID NO:
331).
[0632] The invention thus includes purified human TANGO 332
protein, both in the form of the immature 671 amino acid residue
protein (SEQ ID NO: 331) and in the form of the mature,
approximately 649 amino acid residue protein (SEQ ID NO: 333).
Mature human TANGO 332 protein can be synthesized without the
signal sequence polypeptide at the amino terminus thereof, or it
can be synthesized by generating immature TANGO 332 protein and
cleaving the signal sequence therefrom.
[0633] The invention includes nucleic acid molecules which encode a
TANGO 332 polypeptide of the invention. Such nucleic acids include,
for example, a DNA molecule having the nucleotide sequence listed
in SEQ ID NO: 329 or some portion thereof, such as the portion
which encodes mature TANGO 332 protein, immature TANGO 332 protein,
or a domain of TANGO 332 protein. These nucleic acids are
collectively referred to as TANGO 332 nucleic acids of the
invention.
[0634] TANGO 332 proteins and nucleic acid molecules encoding them
comprise a family of molecules having certain conserved structural
and functional features, as indicated by the conservation of amino
acid sequence between human TANGO 332 protein, human brain-enriched
hyaluronan-binding factor (BEF), as shown in FIGS. 52A-52B, and
murine brevican protein, as shown in FIGS. 53A-53C. This
conservation is further indicated by conservation of nucleotide
sequence between the ORFs encoding human TANGO 332 protein and
murine brevican protein, as shown in FIGS. 54A-54J.
[0635] A common domain present in TANGO 332 proteins is a signal
sequence. In one embodiment, a TANGO 332 protein contains a signal
sequence corresponding to about amino acid residues 1 to 22 of SEQ
ID NO: 331 (SEQ ID NO: 332). The signal sequence is cleaved during
processing of the mature protein.
[0636] TANGO 332 proteins are secreted proteins. The mature form of
human TANGO 332 protein has the amino acid sequence of
approximately amino acid residues 23 to 671 of SEQ ID NO: 331.
[0637] TANGO 332 proteins typically comprise a variety of potential
post-translational modification sites (often within an
extracellular domain), such as those described herein in Table
XXIII, as predicted by computerized sequence analysis of TANGO 332
proteins using amino acid sequence comparison software (comparing
the amino acid sequence of TANGO 332 with the information in the
PROSITE database {rel. 12.2; February, 1995} and the Hidden Markov
Models database {Rel. PFAM 3.3}). In certain embodiments, a protein
of the invention has at least 1, 2, 4, 6, 10, 15, or 20 or more of
the post-translational modification sites listed in Table
XXIII.
TABLE-US-00032 TABLE XXIII Type of Potential Amino Acid
Modification Site Residues of Amino Acid or Domain SEQ ID NO: 331
Sequence N-glycosylation 130 to 133 NDSG site 337 to 340 NQTG
Protein 67 to 69 SRR kinase C 74 to 76 SPR phosphorylation 165 to
167 SAR site 212 to 214 TVR 219 to 221 TPR 310 to 312 SVR 319 to
321 SQR 545 to 547 TPR 615 to 617 SGR Casein 29 to 32 SSED kinase
II 116 to 119 SLTD phosphorylation 219 to 222 TPRE site 269 to 272
TLEE 382 to 385 TVTE 386 to 389 TLEE 397 to 400 TESE 419 to 422
STPE 430 to 433 TLLE 446 to 449 SEEE 545 to 548 TPRE 558 to 561
TLVE Tyrosine kinase 128 to 135 RPNDSGIY phosphorylation 451 to 459
KALEEEEKY site N-myristoylation 47 to 52 GVLGGA site 133 to 138
GIYRCE 142 to 147 GIDDSS 174 to 179 GAQEAC 183 to 188 GAHIAT 281 to
286 GAEIAT 288 to 293 GQLYAA 297 to 302 GLDHCS 324 to 329 GGLPGV
403 to 408 GAIYSI 414 to 419 GGGGSS 576 to 581 GVPRGE 586 to 591
GSSEGA Immunoglobulin-/major 50 to 141 histocompatibility
protein-like (Ig-/MHC-like) domain Extracellular 156 to 251 link
domain 257 to 353
[0638] Among the domains that occur in TANGO 332 protein are an
Ig-/MHC-like domain and a pair of extracellular link domains. In
one embodiment, the protein of the invention has at least one
domain that is at least 55%, preferably at least about 65%, more
preferably at least about 75%, yet more preferably at least about
85%, and most preferably at least about 95% identical to one of
these domains. In other embodiments, the protein has at least one
Ig-/MHC-like domain and one extracellular link domain described
herein in Table XXIII. In other embodiments, the protein has at
least one Ig-/MHC-like domain and at least two extracellular link
domains.
[0639] Ig-/MHC-like domains are conserved among immunoglobulin (Ig)
constant (CL) regions and one of the three extracellular domains of
major histocompatibility proteins (MHC). The presence in TANGO 332
of an Ig-/MHC-like domain indicates that the corresponding region
of TANGO 332 is structurally similar to this conserved
extracellular region.
[0640] Extracellular link domains occur in hyaluronan-(HA-) binding
proteins. Proteins having this domain include cartilage link
protein, proteoglycans such as aggrecan, brevican, neurocan, and
versican, CD44 antigen (the primary cell surface receptor for HA),
and tumor necrosis factor-inducible protein TSG-6. Presence of a
pair of extracellular link domains in TANGO 332 indicates that this
protein is also involved in HA-binding, and therefore is involved
in physiological processes such as cartilage (and other tissue)
organization, extracellular matrix organization, neural growth and
branching, and cell-to-cell and cell-to-matrix interactions.
Involvement of TANGO 332 in these processes implicates this protein
in disorders such as tumor growth and metastasis, movement of cells
(e.g., leukocytes) through extracellular matrix, inappropriate
inflammation, and the like.
[0641] Brevican is a murine nervous system-specific chondroitin
sulfate proteoglycan which binds in a calcium-dependent manner with
two classes of sulfated glycolipids, namely sulfatides and
HNK-1-reactive sulfoglucuronylglycolipids (Miura et al. (1999)
[0642] J. Biol. Chem. 274:11431-11438). A human orthologue,
designated BEF ('Brain-Enriched hyaluronan-binding Factor'), of
murine brevican is expressed by human glioma cells, but not by
brain tumors of non-glial origin (P.C.T. application publication
number WO98/31800; Zhang et al. (1998) J. Neurosci. 18:2370-2376).
Those authors suggested that cleavage of that human orthologue
mediates glioma cell invasion in vivo.
[0643] An alignment of the amino acid sequences of TANGO 332 and
BEF protein is shown in FIGS. 54A-54B. In this alignment (made
using the ALIGN software {Myers and Miller (1989) CABIOS, ver.
2.0}; pam120.mat scoring matrix; gap opening penalty=12, gap
extension penalty=4), the proteins are 75.7% identical, although it
is seen that TANGO 332 includes two domains (one from about amino
acid residue 152 to about residue 208, and the other near the
carboxyl terminus of TANGO 332) which do not occur in BEF protein.
It is likely that these two regions account for the differences
between the physiological roles of TANGO 332 and BEF.
[0644] An alignment of the amino acid sequences of (human) TANGO
332 and murine brevican protein is shown in FIGS. 53A-53C. In this
alignment (made using the ALIGN software {Myers and Miller (1989)
CABIOS, ver. 2.0}; pam120.mat scoring matrix; gap opening
penalty=12, gap extension penalty=4), the proteins are 75.5%
identical, although it is seen that murine brevican protein
includes a domain which does not occur in TANGO 332 protein, this
domain is present from about amino acid residue 626 to the carboxyl
terminus of murine brevican protein. An alignment of the nucleotide
sequences of the ORFs encoding (human) TANGO 332 and murine
brevican protein is shown in FIGS. 54A-54J. The two ORFs are 62.6%
identical, as assessed using the same software and parameters.
[0645] TANGO 332 exhibits many of the same properties as BEF. TANGO
332 is also related to murine brevican protein, and thus is
involved with corresponding physiological processes (i.e., such as
those described above) in humans. For example, TANGO 332 modulates
intracellular binding and migration of cells in a tissue or
extracellular matrix. However, the absence from BEF of one of the
two extracellular link domains present in TANGO 332 indicates that
one or more of the subunit structure, the tissue specificity, and
the binding specificity of TANGO 332 and BEF proteins differ. Thus,
TANGO 332 is involved in many of the physiological processes and
disorders in which BEF protein is involved. Like murine brevican
and other proteoglycans, TANGO 332 acts in vivo as a tissue
organizing protein, influences growth and maturation of tissues in
which it is expressed, modulates growth factor-mediated activities,
modulates structural features of tissues (e.g., collagen
fibrillogenesis), modulates tumor cell growth and invasivity, and
influences neurite growth and branching.
[0646] The signal peptide prediction program SIGNALP (Nielsen et
al. (1997) Protein Engineering 10:1-6) predicted that human TANGO
332 protein includes an approximately 22 (i.e., 20, 21, 22, 23, or
24) amino acid residue signal peptide (amino acid residues 1 to 22
of SEQ ID NO: 331; SEQ ID NO: 332) preceding the mature TANGO 332
protein (i.e., approximately amino acid residues 23 to 671 of SEQ
ID NO: 331; SEQ ID NO: 333). Human TANGO 332 protein is a secreted
protein, as assessed using the secretion assay described herein.
Secreted TANGO 332 proteins having approximate sizes of 148
kilodaltons and 100 kilodaltons could be detected using this
assay.
[0647] FIG. 51 depicts a hydrophobicity plot of human TANGO 332
protein. Relatively hydrophobic regions are above the dashed
horizontal line, and relatively hydrophilic regions are below the
dashed horizontal line. The hydrophobic region which corresponds to
amino acid residues 1 to 22 of SEQ ID NO: 331 is the signal
sequence of human TANGO 332 (SEQ ID NO: 332). As described
elsewhere herein, relatively hydrophilic regions are generally
located at or near the surface of a protein, and are more
frequently effective immunogenic epitopes than are relatively
hydrophobic regions. For example, the region of human TANGO 332
protein from about amino acid residue 445 to about amino acid
residue 475 appears to be located at or near the surface of the
protein, while the region from about amino acid residue 45 to about
amino acid residue 62 appears not to be located at or near the
surface.
[0648] The predicted molecular weight of human TANGO 332 protein
without modification and prior to cleavage of the signal sequence
is about 71.7 kilodaltons. The predicted molecular weight of the
mature human TANGO 332 protein without modification and after
cleavage of the signal sequence is about 69.5 kilodaltons.
[0649] Uses of TANGO 332 Nucleic acids,
[0650] Polypeptides, and Modulators Thereof
[0651] TANGO 332 proteins are involved in disorders which affect
both tissues in which they are normally expressed and tissues in
which they are normally not expressed. Based on the observation
that TANGO 332 is expressed in human adult brain tissue, TANGO 332
protein is involved in one or more biological processes which occur
in these tissues. In particular, TANGO 332 is involved in
modulating growth, proliferation, survival, differentiation, and
activity of cells including, but not limited to, adult brain cells
of the animal in which it is normally expressed. Thus, TANGO 332
has a role in disorders which affect these cells and their growth,
proliferation, survival, differentiation, interaction, and
activity. Examples of such disorders include, by way of example and
not limitation, disorders of neural connection establishment or
maintenance, impaired cognitive function, dementia, senility,
Alzheimer's disease, mental retardation, brain tumors (e.g.,
gliomas such as astrocytomas, endophytic and exophytic
retinoblastomas, ependymomas, gangliogliomas, mixed gliomas, nasal
gliomas, optic gliomas, and Schwannomas, and other brain cell
tumors such as medulloblastomas, pituitary adenomas, teratomas,
etc.), and the like. TANGO 332 can also be involved in the other
brain disorders described elsewhere in this disclosure.
[0652] Homology of human TANGO 332 with murine brevican protein and
with human brevican homolog BEF indicates that TANGO 332 has
physiological functions in humans analogous to the functions of
these proteins. Brevican is a member of the aggrecan/versican
family of proteoglycans, and has a hyaluronic acid-binding domain
in its amino terminal region and a lectin-like domain in its
carboxyl terminal region. Expression of brevican is highly specific
to brain tissue, and increases as the mammalian brain develops.
Thus, brevican is involved in maintaining the extracellular
environment of mature brain tissue and is a constituent of adult
brain extracellular matrix. TANGO 332 is involved in modulating
cell-to-cell adhesion, tissue and extracellular matrix invasivity
of cells, and the like. Thus, TANGO 332 is involved in disorders in
which these physiological processes are relevant. Such disorders
include, for example, loss of control of cell growth, tumor
metastasis, malformation of neurological connections, inflammation,
immune and autoimmune responses, and the like.
[0653] In addition, presence in TANGO 332 of extracellular link
domains indicates that this protein is involved in physiological
processes involving structure and function of extracellular
matrices and interaction of cells with such matrices and with each
other. This is further evidence that TANGO 332 is involved in
disorders such as inappropriate inflammation, tumor metastasis,
inappropriate leukocyte extravasation, localization, and
reactivity, and the like.
[0654] TANGO 332-related molecules can be used to modulate one or
more of the activities in which TANGO 332 is involved and can also
be used to prevent, diagnose, or treat one or more of the disorders
in which TANGO 332 is involved.
TANGO 202
[0655] A cDNA clone (designated jthke096b05) encoding at least a
portion of human TANGO 202 protein was isolated from a human fetal
skin cDNA library. The corresponding murine cDNA was isolated as a
clone (designated jtmMa044f07) from a bone marrow stromal cell cDNA
library. The human TANGO 202 protein is predicted by structural
analysis to be a type I membrane protein, although it can exist in
a secreted form as well. The murine TANGO 202 protein is predicted
by structural analysis to be a secreted protein.
[0656] The full length of the cDNA encoding human TANGO 202 protein
(SEQ ID NO: 371) is 1656 nucleotide residues. The open reading
frame (ORF) of this cDNA, nucleotide residues 34 to 1458 of SEQ ID
NO: 371 (i.e., SEQ ID NO: 372), encodes a 475-amino acid
transmembrane protein (SEQ ID NO: 373).
[0657] The invention thus includes purified human TANGO 202
protein, both in the form of the immature 475 amino acid residue
protein (SEQ ID NO: 373) and in the form of the mature 456 amino
acid residue protein (SEQ ID NO: 375). The invention also includes
purified murine TANGO 202 protein, both in the form of the immature
470 amino acid residue protein (SEQ ID NO: 439) and in the form of
the mature 451 amino acid residue protein (SEQ ID NO: 413). Mature
human or murine TANGO 202 proteins can be synthesized without the
signal sequence polypeptide at the amino terminus thereof, or they
can be synthesized by generating immature TANGO 202 protein and
cleaving the signal sequence therefrom.
[0658] The invention includes nucleic acid molecules which encode a
polypeptide of the invention. Such nucleic acids include, for
example, a DNA molecule having the nucleotide sequence listed in
SEQ ID NO: 371 or some portion thereof or SEQ ID NO: 439 or some
portion thereof, such as the portion which encodes mature human or
murine TANGO 202 protein, immature human or murine TANGO 202
protein, or a domain of human or murine TANGO 202 protein. These
nucleic acids are collectively referred to as nucleic acids of the
invention.
[0659] TANGO 202 proteins and nucleic acid molecules encoding them
comprise a family of molecules having certain conserved structural
and functional features.
[0660] A common domain present in TANGO 202 proteins is a signal
sequence. In one embodiment, a TANGO 202 protein contains a signal
sequence corresponding to amino acid residues 1 to 19 of SEQ ID NO:
373 (SEQ ID NO: 374) or to amino acid residues 1 to 19 of SEQ ID
NO: 439 (SEQ ID NO: 412). The signal sequence is cleaved during
processing of the mature protein.
[0661] TANGO 202 proteins can also include an extracellular domain.
The human TANGO 202 protein extracellular domain is located from
about amino acid residue 20 to about amino acid residue 392 of SEQ
ID NO: 373 in the non-secreted form, and from about amino acid
residue 20 to amino acid residue 475 of SEQ ID NO: 373 (i.e., the
entire mature human protein). The murine TANGO 202 protein
extracellular domain is located from about amino acid residue 20 to
amino acid residue 470 of SEQ ID NO: 439 (i.e., the entire mature
murine protein).
[0662] TANGO 202 proteins of the invention can also include a
transmembrane domain. As used herein, a "transmembrane domain"
refers to an amino acid sequence having at least about 20 to 25
amino acid residues in length and which contains at least about
65-70% hydrophobic amino acid residues such as alanine, leucine,
phenylalanine, protein, tyrosine, tryptophan, or valine. In a
preferred embodiment, a transmembrane domain contains at least
about 15 to 30 amino acid residues, preferably about 20-25 amino
acid residues, and has at least about 60-80%, more preferably
65-75%, and more preferably at least about 70% hydrophobic
residues. Thus, in one embodiment, a TANGO 202 protein of the
invention contains a transmembrane domain corresponding to about
amino acid residues 393 to 415 of SEQ ID NO: 373 (SEQ ID NO:
377).
[0663] In addition, TANGO 202 proteins of the invention can include
a cytoplasmic domain, particularly including a carboxyl-terminal
cytoplasmic domain. The cytoplasmic domain is located from about
amino acid residue 416 to amino acid residue 475 of SEQ ID NO: 373
(SEQ ID NO: 378) in the non-secreted form of human TANGO 202
protein.
[0664] TANGO 202 proteins typically comprise a variety of potential
post-translational modification sites (often within an
extracellular domain), such as those described herein in Tables
XXIV (for human TANGO 202) and XXV (for murine TANGO 202), as
predicted by computerized sequence analysis of TANGO 202 proteins
using amino acid sequence comparison software (comparing the amino
acid sequence of TANGO 202 with the information in the PROSITE
database {rel. 12.2; February, 1995} and the Hidden Markov Models
database {Rel. PFAM 3.3}).
TABLE-US-00033 TABLE XXIV Type of Potential Amino Acid Modification
Site Residues Amino Acid or Domain of SEQ ID NO: 373 Sequence
N-glycosylation 47 to 50 NWTA site 61 to 64 NETF 219 to 222 NYSA
295 to 298 NVSL 335 to 338 NQTV 347 to 350 NLSV Protein 70 to 72
TLK kinase C 137 to 139 TSK phosphorylation 141 to 143 SNK site 155
to 157 SQR 238 to 240 TGR 245 to 247 TIR 277 to 279 THR 307 to 309
SDR 355 to 357 SSK 387 to 389 SHR 418 to 420 TFK 421 to 423 SHR
Casein 337 to 340 TVAE kinase II 438 to 441 TSGE phosphorylation
site 464 to 467 SQQD N-myristoylation 53 to 58 GGKPCL site 120 to
125 GNLGCY 136 to 141 GTSKTS 162 to 167 GMESGY 214 to 219 GACGGN
Kringle domain 85 to 90 YCRNPD signature Kringle Domain 34 to 116
CUB domain 216 to 320
TABLE-US-00034 TABLE XXV Type of Potential Amino Acid Modification
Site Residues of Amino Acid or Domain SEQ ID NO: 439 Sequence
N-glycosylation site 59 to 62 NETF 217 to 220 NYSA 255 to 258 NFTL
293 to 296 NVSL 333 to 336 NQTL 345 to 348 NLSV cAMP- or 455 to 458
RRSS cGMP-dependent protein kinase phosphorylation site Protein 68
to 70 TLK kinase C 135 to 137 TSK phosphorylation site 139 to 141
SNK 153 to 155 SQR 236 to 238 TGR 243 to 245 TIR 275 to 277 THR 283
to 285 SGR 305 to 307 SDR 353 to 355 SSK 408 to 410 SQR 453 to 455
SLR 457 to 459 SSR Casein 28 to 31 SGPE kinase II 257 to 260 TLFD
phosphorylation site 321 to 324 TKEE 335 to 338 TLAE 384 to 387
TATE N-myristoylation site 51 TO 56 GGKPCL 118 TO 123 GNLGCY 134 TO
139 GTSKTS 160 TO 165 GMESGY 212 TO 217 GACGGN 391 TO 396 GLCTAW
429 TO 434 GTVVSL Kringle domain 83 to 88 YCRNPD signature Kringle
Domain 32 to 114 CUB domain 214 to 318
[0665] In various embodiments, the protein of the invention has at
least 1, 2, 4, 6, 10, 15, or 20 or more of the post-translational
modification sites described herein in Tables XXIV and XXV.
[0666] Examples of additional domains present in human and murine
TANGO 202 protein include Kringle domains and CUB domains. In one
embodiment, the protein of the invention has at least one domain
that is at least 55%, preferably at least about 65%, more
preferably at least about 75%, yet more preferably at least about
85%, and most preferably at least about 95% identical to one of the
domains described herein in Tables XXIV and XXV. Preferably, the
protein of the invention has at least one Kringle domain and one
CUB domain.
[0667] A Kringle domain has a characteristic profile that has been
described in the art (Castellino and Beals (1987) J. Mol. Evol.
26:358-369; Patthy (1985) Cell 41:657-663; Ikeo et al. (1991) FEBS
Lett. 287:146-148). Many, but not all, Kringle domains comprise a
conserved hexapeptide signature sequence, namely
TABLE-US-00035 (SEQ ID NO: 455) (F or Y)-C-R-N-P-(D or N or R).
The cysteine residue is involved in a disulfide bond.
[0668] Kringle domains are triple-looped, disulfide cross-linked
domains found in a varying number of copies in, for example, some
serine proteases and plasma proteins. Kringle domains have a role
in binding mediators (e.g., membranes, other proteins, or
phospholipids) and in regulation of proteolytic activity. Kringle
domains have been identified in the following proteins, for
example: apolipoprotein A, blood coagulation factor XII (Hageman
factor), hepatocyte growth factor (HGF), HGF-like protein (Friezner
Degen et al., (1991) Biochemistry 30:9781-9791), HGF activator
(Miyazawa et al., (1993) J. Biol. Chem. 268:10024-10028),
plasminogen, thrombin, tissue plasminogen activator, urokinase-type
plasminogen activator, and four influenza neuraminidases. The
presence of a Kringle domain in each of human and murine TANGO 202
protein indicates that TANGO 202 is involved in one or more
physiological processes in which these other Kringle
domain-containing proteins are involved, has biological activity in
common with one or more of these other Kringle domain-containing
proteins, or both.
[0669] CUB domains are extracellular domains of about 110 amino
acid residues which occur in functionally diverse, mostly
developmentally regulated proteins (Bork and Beckmann (1993) J.
Mol. Biol. 231:539-545; Bork (1991) FEBS Lett. 282:9-12). Many CUB
domains contain four conserved cysteine residues, although some,
like that of TANGO 202, contain only two of the conserved cysteine
residues. The structure of the CUB domain has been predicted to
assume a beta-barrel configuration, similar to that of
immunoglobulins. Other proteins which have been found to comprise
one or more CUB domains include, for example, mammalian complement
sub-components Cls and Clr, hamster serine protease Casp, mammalian
complement activating component of Ra-reactive factor, vertebrate
enteropeptidase, vertebrate bone morphogenic protein 1, sea urchin
blastula proteins BP10 and SpAN, Caenorhabditis elegans
hypothetical proteins F42A10.8 and R151.5, neuropilin (A5 antigen),
sea urchin fibropellins I and III, mammalian hyaluronate-binding
protein TSG-6 (PS4), mammalian spermadhesins, and Xenopus embryonic
protein UVS.2. The presence of a CUB domain in each of human and
murine TANGO 202 protein indicates that TANGO 202 is involved in
one or more physiological processes in which these other CUB
domain-containing proteins are involved, has biological activity in
common with one or more of these other CUB domain-containing
proteins, or both.
[0670] The signal peptide prediction program SIGNALP (Nielsen et
al. (1997) Protein Engineering 10:1-6) predicted that human TANGO
202 protein includes a 19 amino acid signal peptide (amino acid
residues 1 to 19 of SEQ ID NO: 373; SEQ ID NO: 374) preceding the
mature TANGO 202 protein (amino acid residues 20 to 475 of SEQ ID
NO: 373; SEQ ID NO: 375). Human TANGO 202 protein includes an
extracellular domain (amino acid residues 20 to 392 of SEQ ID NO:
373; SEQ ID NO: 376); a transmembrane domain (amino acid residues
393 to 415 of SEQ ID NO: 373; SEQ ID NO: 377); and a cytoplasmic
domain (amino acid residues 416 to 475 of SEQ ID NO: 373; SEQ ID
NO: 378). The murine homolog of TANGO 202 protein is predicted to
be a secreted protein. Thus, it is recognized that human TANGO 202
can also exist in the form of a secreted protein, likely being
translated from an alternatively spliced TANGO 202 mRNA. In a
variant form of the protein, an extracellular portion of TANGO 202
protein (e.g., amino acid residues 20 to 392 of SEQ ID NO: 373) can
be cleaved from the mature protein to generate a soluble fragment
of TANGO 202.
[0671] FIG. 56A depicts a hydrophobicity plot of human TANGO 202
protein. Relatively hydrophobic regions are above the dashed
horizontal line, and relatively hydrophilic regions are below the
dashed horizontal line. The hydrophobic region which corresponds to
amino acid residues 1 to 19 of SEQ ID NO: 373 is the signal
sequence of human TANGO 202 (SEQ ID NO: 374). The hydrophobic
region which corresponds to amino acid residues 393 to 415 of SEQ
ID NO: 373 is the transmembrane domain of human TANGO 202 (SEQ ID
NO: 377). As described elsewhere herein, relatively hydrophilic
regions are generally located at or near the surface of a protein,
and are more frequently effective immunogenic epitopes than are
relatively hydrophobic regions. For example, the region of human
TANGO 202 protein from about amino acid residue 61 to about amino
acid residue 95 appears to be located at or near the surface of the
protein, while the region from about amino acid residue 395 to
about amino acid residue 420 appears not to be located at or near
the surface.
[0672] The predicted molecular weight of human TANGO 202 protein
without modification and prior to cleavage of the signal sequence
is about 51.9 kilodaltons. The predicted molecular weight of the
mature human TANGO 202 protein without modification and after
cleavage of the signal sequence is about 50.1 kilodaltons.
[0673] The full length of the cDNA encoding murine TANGO 202
protein (SEQ ID NO: 437) is 4928 nucleotide residues. The ORF of
this cDNA, nucleotide residues 81 to 1490 of SEQ ID NO: 437 (i.e.,
SEQ ID NO: 438), encodes a 470-amino acid secreted protein (SEQ ID
NO: 439).
[0674] The signal peptide prediction program SIGNALP (Nielsen et
al. (1997) Protein Engineering 10:1-6) predicted that murine TANGO
202 protein includes a 19 amino acid signal peptide (amino acid
residues 1 to 19 of SEQ ID NO: 439; SEQ ID NO: 412) preceding the
mature TANGO 202 protein (amino acid residues 20 to 470 of SEQ ID
NO: 439; SEQ ID NO: 413). Murine TANGO 202 protein is a secreted
protein.
[0675] FIG. 56B depicts a hydrophobicity plot of murine TANGO 202
protein. Relatively hydrophobic regions are above the dashed
horizontal line, and relatively hydrophilic regions are below the
dashed horizontal line. The hydrophobic region which corresponds to
amino acid residues 1 to 19 of SEQ ID NO: 439 is the signal
sequence of murine TANGO 202 (SEQ ID NO: 412). As described
elsewhere herein, relatively hydrophilic regions are generally
located at or near the surface of a protein, and are more
frequently effective immunogenic epitopes than are relatively
hydrophobic regions. For example, the region of murine TANGO 202
protein from about amino acid residue 61 to about amino acid
residue 95 appears to be located at or near the surface of the
protein, while the region from about amino acid residue 295 to
about amino acid residue 305 appears not to be located at or near
the surface
[0676] The predicted molecular weight of murine TANGO 202 protein
without modification and prior to cleavage of the signal sequence
is about 51.5 kilodaltons. The predicted molecular weight of the
mature murine TANGO 202 protein without modification and after
cleavage of the signal sequence is about 49.7 kilodaltons.
[0677] Human and murine TANGO 202 proteins exhibit considerable
sequence similarity, as indicated herein in FIGS. 55A-55B. FIGS.
55A-55B depict an alignment of human and murine TANGO 202 amino
acid sequences (SEQ ID NOs: 373 and 439, respectively). In this
alignment (made using the ALIGN software {Myers and Miller (1989)
CABIOS, ver. 2.0}; pam120.mat scoring matrix; gap penalties
-12/-4), the proteins are 76.5% identical. The human and murine
ORFs encoding TANGO 202 are 87.4% identical, as assessed using the
same software and parameters.
[0678] In situ hybridization experiments in mouse tissues indicated
that mRNA corresponding to the cDNA encoding TANGO 202 is expressed
in the tissues listed in Table XXVI, wherein "+" indicates
detectable expression and "++" indicates a greater level of
expression than "+".
TABLE-US-00036 TABLE XXVI Relative Level of Animal Tissue
Expression Mouse bladder, especially in ++ (Adult) transitional
epithelium renal glomeruli + brain + heart + liver + spleen +
placenta + Mouse ubiquitous + (Embryo)
[0679] Uses of TANGO 202 Nucleic acids,
[0680] Polypeptides, and Modulators Thereof
[0681] TANGO 202 proteins are involved in disorders which affect
both tissues in which they are normally expressed and tissues in
which they are normally not expressed. Based on the observation
that TANGO 202 is expressed in human fetal skin, ubiquitously in
fetal mouse tissues, in adult murine bone marrow stromal cells, and
in cells of adult murine bladder, renal glomeruli, brain, heart,
liver, spleen and placenta, TANGO 202 protein is involved in one or
more biological processes which occur in these tissues. In
particular, TANGO 202 is involved in modulating growth,
proliferation, survival, differentiation, and activity of cells of
these tissues including, but not limited to, hematopoietic and
fetal cells. Thus, TANGO 202 has a role in disorders which affect
these cells and their growth, proliferation, survival,
differentiation, and activity. Ubiquitous expression of TANGO 202
in fetal murine tissues, contrasted with limited expression in
adult murine tissues further indicates that TANGO 202 is involved
in disorders in which it is inappropriately expressed (e.g.,
disorders in which TANGO 202 is expressed in adult murine tissues
other than bone marrow stromal cells and disorders in which TANGO
202 is not expressed in one or more developing fetal tissues).
[0682] The presence of a Kringle domain in both the murine and
human TANGO 202 proteins indicates that this protein is involved in
modulating cellular binding to one or more mediators (e.g.,
proteins, phospholipids, intracellular organelles, or other cells),
in modulating proteolytic activity, or both. The presence of a
Kringle domain in other proteins (e.g., growth factors) indicates
activities that these proteins share with TANGO 202 protein (e.g.,
modulating cell dissociation and migration into and through
extracellular matrices). The presence of Kringle domains in
numerous plasma proteins, particularly coupled with the observation
that TANGO 202 is expressed in adult murine bone marrow stromal
cells, indicates a role for TANGO 202 protein in modulating binding
of blood or hematopoietic cells (or both) to one or more mediators.
Thus, TANGO 202 is involved in disorders relating to aberrant
cellular protease activity, inappropriate interaction or
non-interaction of cells with mediators, and in blood and
hematopoietic cell-related disorders. Such disorders include, by
way of example and not limitation, immune disorders, infectious
diseases, auto-immune disorders, vascular and cardiovascular
disorders, disorders related to mal-expression of growth factors,
cancers, hematological disorders, and the like.
[0683] The cDNA encoding TANGO 202 exhibits significant nucleotide
sequence similarity with a polynucleotide encoding a
kringle-domain-containing protein (designated HTHBZ47) described in
the European Patent Application No. EP 0 911 399 A2 (published Apr.
28, 1999). Thus, the TANGO 202 protein can exhibit one or more of
the activities exhibited by HTHBZ47, and can be used to prevent,
inhibit, diagnose, and treat one or more disorders for which
HTHBZ47 is useful. These disorders include cancer, inflammation,
autoimmune disorders, allergic disorders, asthma, rheumatoid
arthritis, inflammation of central nervous system tissues,
cerebellar degeneration, Alzheimer's disease, Parkinson's disease,
multiple sclerosis, amylotrophic lateral sclerosis, head injury
damage and other neurological abnormalities, septic shock, sepsis,
stroke, osteoporosis, osteoarthritis, ischemic reperfusion injury,
cardiovascular disease, kidney disease, liver disease, ischemic
injury, myocardial infarction, hypotension, hypertension, AIDS,
myelodysplastic syndromes and other hematologic abnormalities,
aplastic anemia, male pattern baldness, and bacterial, fungal,
protozoan, and viral infections.
[0684] The presence of a CUB domain in both the murine and human
TANGO 202 proteins indicates that this protein is involved in
biological processes common to other CUB domain-containing
proteins, such as developmental processes and binding to mediators.
Therefore, TANGO 202 protein has a role in disorders which involve
inappropriate developmental processes (e.g., abnormally high
proliferation or un-differentiation of a differentiated tissue or
abnormally low differentiation or proliferation of a non-developed
or non-differentiated tissue) and modulation of cell growth,
proliferation, survival, differentiation, and activity. Such
disorders include, by way of example and not limitation, various
cancers and birth and developmental defects.
[0685] Thus, proteins and nucleic acids of the invention which are
identical to, similar to, or derived from human and murine TANGO
202 proteins and nucleic acids encoding them are useful for
preventing, diagnosing, and treating, among others, vascular and
cardiovascular disorders, hematological disorders, disorders
related to mal-expression of growth factors, and cancer. Other uses
for these proteins and nucleic acids of the invention relate to
modulating cell growth (e.g., angiogenesis), proliferation (e.g.,
cancers), survival (e.g., apoptosis), differentiation (e.g.,
hematopoiesis), and activity (e.g., ligand-binding capacity). TANGO
202 proteins and nucleic acids encoding them are also useful for
modulating cell dissociation and modulating migration of cells in
extracellular matrices.
TANGO 234
[0686] A cDNA clone (designated jthsa104d11) encoding at least a
portion of human TANGO 234 protein was isolated from a human fetal
spleen cDNA library. The human TANGO 234 protein is predicted by
structural analysis to be a transmembrane protein, although it can
exist in a secreted form as well.
[0687] The full length of the cDNA encoding human TANGO 234 protein
(SEQ ID NO: 379) is 4628 nucleotide residues. The ORF of this cDNA,
nucleotide residues 28 to 4386 of SEQ ID NO: 379 (i.e., SEQ ID NO:
380), encodes a 1453-amino acid transmembrane protein (SEQ ID NO:
381).
[0688] The invention thus includes purified human TANGO 234
protein, both in the form of the immature 1453 amino acid residue
protein (SEQ ID NO: 381) and in the form of the mature 1413 amino
acid residue protein (SEQ ID NO: 383). Mature human TANGO 234
protein can be synthesized without the signal sequence polypeptide
at the amino terminus thereof, or it can be synthesized by
generating immature TANGO 234 protein and cleaving the signal
sequence therefrom.
[0689] The invention includes nucleic acid molecules which encode a
polypeptide of the invention. Such nucleic acids include, for
example, a DNA molecule having the nucleotide sequence listed in
SEQ ID NO: 379 or some portion thereof, such as the portion which
encodes mature TANGO 234 protein, immature TANGO 234 protein, or a
domain of TANGO 234 protein. These nucleic acids are collectively
referred to as nucleic acids of the invention.
[0690] TANGO 234 proteins and nucleic acid molecules encoding them
comprise a family of molecules having certain conserved structural
and functional features, as indicated by the conservation of amino
acid sequence between human TANGO 234 protein and bovine WC1
protein, as shown in FIGS. 58A-58F, and the conservation of
nucleotide sequence between the ORFs encoding human TANGO 234
protein and bovine WC1 protein, as shown in FIGS. 59A-59Q.
[0691] A common domain present in TANGO 234 proteins is a signal
sequence. In one embodiment, a TANGO 234 protein contains a signal
sequence corresponding to amino acid residues 1 to 40 of SEQ ID NO:
381 (SEQ ID NO: 382). The signal sequence is cleaved during
processing of the mature protein.
[0692] TANGO 234 proteins can include an extracellular domain. The
human TANGO 234 protein extracellular domain is located from about
amino acid residue 41 to about amino acid residue 1359 of SEQ ID
NO: 381. TANGO 234 can alternately exist in a secreted form, such
as a mature protein having the amino acid sequence of amino acid
residues 41 to 1453 or residues 41 to about 1359 of SEQ ID NO:
381.
[0693] In addition, TANGO 234 include a transmembrane domain. In
one embodiment, a TANGO 234 protein of the invention contains a
transmembrane domain corresponding to about amino acid residues
1360 to 1383 of SEQ ID NO: 381 (SEQ ID NO: 385).
[0694] The present invention includes TANGO 234 proteins having a
cytoplasmic domain, particularly including proteins having a
carboxyl-terminal cytoplasmic domain. The human TANGO 234
cytoplasmic domain is located from about amino acid residue 1384 to
amino acid residue 1453 of SEQ ID NO: 381 (SEQ ID NO: 386).
[0695] TANGO 234 proteins typically comprise a variety of potential
post-translational modification sites (often within an
extracellular domain), such as those described herein in Table
XXVII, as predicted by computerized sequence analysis of TANGO 234
proteins using amino acid sequence comparison software (comparing
the amino acid sequence of TANGO 234 with the information in the
PROSITE database {rel. 12.2; February, 1995} and the Hidden Markov
Models database {Rel. PFAM 3.3}). In certain embodiments, a protein
of the invention has at least 1, 2, 4, 6, 10, 15, or 20 or more of
the post-translational modification sites listed in Table
XXVII.
TABLE-US-00037 TABLE XXVII Type of Potential Amino Acid
Modification Site Residues of Amino Acid or Domain SEQ ID NO: 381
Sequence N-glycosylation site 42 to 45 NGTD 78 to 81 NTTA 120 to
123 NESA 161 to 164 NNSC 334 to 337 NESF 377 to 380 NCSG 441 to 444
NESA 548 to 551 NESN 637 to 640 NAST 972 to 975 NESL 1013 to 1016
NVSD 1084 to 1087 NATV 1104 to 1107 NCTG 1161 to 1164 NGTW 1171 to
1174 NITT 1318 to 1321 NESF 1354 to 1357 NASS Glycosaminoglycan 558
to 561 SGWG attachment site 665 to 668 SGWG cAMP- or 1229 to 1232
RRIS cGMP-dependent 1399 to 1402 RRGS protein kinase
phosphorylation site Protein 165 to 167 SGR kinase C 268 to 270 TNR
phosphorylation site 379 to 381 SGR 419 to 421 SRR 469 to 471 SDK
506 to 508 STR 589 to 591 SNR 593 to 595 SGR 661 to 663 SCR 696 to
698 SSR 746 to 748 TER 805 to 807 SGR 815 to 817 TWR 959 to 961 SVR
1256 to 1258 SGR 1349 to 1351 SLK 1396 to 1398 STR Casein 44 to 47
TDLE kinase II 71 to 74 TVCD phosphorylation site 178 to 181 TICD
245 to 248 SHNE 253 to 256 TCYD 258 to 261 SDLE 319 to 322 SGSD 332
to 335 SGNE 392 to 395 TICD 439 to 442 TGNE 606 to 609 TVCD 622 to
625 SQLD 673 to 676 SHSE 686 to 689 SDME 760 to 763 TGGE 765 to 768
SLWD 818 to 821 SVCD 845 to 848 SVGD 857 to 860 TWAE 907 to 910
SQCD 923 to 926 SLCD 927 to 930 THWD 974 to 977 SLLD 1059 to 1062
TICD 1106 to 1109 TGTE 1145 to 1148 SETE 1233 to 1236 SPAE 1241 to
1244 TCED 1269 to 1272 TVCD 1402 to 1405 SLEE 1425 to 1428 TSDD
N-myristoylation site 67 to 72 GQWGTV 90 to 95 GCPFSF 101 to 106
GQAVTR 119 to 124 GNESAL 133 to 138 GSHNCY 160 to 165 GNNSCS 197 to
202 GCPSSF 226 to 231 GNELAL 240 to 245 GNHDCS 267 to 272 GTNRCM
304 to 309 GCGTAL 328 to 333 GVSCSG 374 to 379 GSNNCS 411 to 416
GCPFSV 418 to 423 GSRRAK 440 to 445 GNESAL 465 to 470 GVICSD 547 to
552 GNESNI 588 to 593 GSNRCS 632 to 637 GMGLGN 668 to 673 GNNDCS
679 to 684 GVICSD 695 to 700 GTWGSV 712 to 717 GCGENG 720 to 725
GSWGTV 758 to 763 GCGSAL 853 to 858 GQGTGT 891 to 896 GQSDCG 944 to
949 GVRCSG 985 to 990 GTRTSD 992 to 997 GCEDAS 1078 to 1083 GVLPAS
1121 to 1126 GSSRCA 1132 to 1137 GILCAN 1162 to 1167 GMNIAE 1185 to
1190 GCTGGE 1265 to 1270 GNGLTW 1288 to 1293 GVVCSR 1302 to 1307
GTALST 1331 to 1336 GAPPCI 1342 to 1347 GNTVSV 1422 to 1427 GCGVAF
1443 to 1438 GQHDCR 1444 to 1449 GVICSE Amidation site 1167 to 1170
VGRR Speract receptor 53 to 90 repeated (SRR) 160 to 197 domain
signature 267 to 304 1041 to 1078 1251 to 1288 Scavenger 51 to 148
receptor 158 to 255 cysteine-rich (SRCR) 265 to 362 domain 372 to
469 479 to 576 586 to 683 693 to 790 798 to 895 903 to 1000 1039 to
1136 1146 to 1243 1249 to 1346
[0696] Among the domains that occur in TANGO 234 protein are SRR
domains and SRCR domains. In one embodiment, the protein of the
invention has at least one domain that is at least 55%, preferably
at least about 65%, more preferably at least about 75%, yet more
preferably at least about 85%, and most preferably at least about
95% identical to one of these domains. In other embodiments, the
protein has at least two of the SRR and SRCR domains described
herein in Table XXVII. In other embodiments, the protein has at
least one SRR domain and at least one SRCR domain.
[0697] The SRR domain is named after a receptor domain identified
in a sea urchin egg protein designated speract. The consensus
sequence of this domain (using standard one-letter amino acid
codes, wherein X is any amino acid residue) is as follows.
TABLE-US-00038 (SEQ ID NO: 456)
-G-X.sub.5-G-X.sub.2-E-X.sub.6-W-G-X.sub.2-C-X.sub.3-(F or Y or
W)-X.sub.8-C- X.sub.3-G-.
[0698] Speract is a transmembrane glycoprotein of 500 amino acid
residues (Dangott et al. (1989) Proc. Natl. Acad. Sci. USA
86:2128-2132). Structurally, this receptor consists of a large
extracellular domain of 450 residues, followed by a transmembrane
region and a small cytoplasmic domain of 12 amino acid residues.
The extracellular domain contains four repeats of an approximately
115 amino acid domain. There are 17 amino acid residues that are
perfectly conserved in the four repeats in speract, including six
cysteine residues, six glycine residues, and two glutamate
residues. TANGO 234 has five SRR domains, in which 16 of the 17
conserved speract residues are present of four of the SRR domains
and 15 are present in the remaining SRR domain. This domain is
designated the speract receptor repeated domain. The amino acid
sequence of mammalian macrophage scavenger receptor type I (MSRI)
exhibits such a domain (Freeman et al. (1990) Proc. Natl. Acad.
Sci. USA 87:8810-8814). MSRI proteins are membrane glycoproteins
implicated in the pathologic deposition of cholesterol in arterial
walls during atherogenesis. TANGO 234 is involved in one or more
physiological processes related to cholesterol deposition and
atherogenesis, as well as other vascular and cardiovascular
disorders.
[0699] Scavenger receptor cysteine-rich (SRCR) domains are
disulfide rich extracellular domains which are present in certain
cell surface and secreted proteins. Proteins having SRCR domains
exhibit diverse ligand binding specificity. For example, in
addition to modified lipoproteins, some of these proteins bind a
variety of surface components of pathogenic microorganisms, and
some of the proteins bind apoptotic cells. SRCR domains are also
involved in mediating immune development and response. Other
SRCR-containing proteins are involved in binding of modified
lipoproteins (e.g., oxidized low density lipoprotein {LDL}) by
specialized macrophages, leading to the formation of macrophages
filled with cholesteryl ester droplets (i.e., foam cells). TANGO
234 is involved in one or more physiological processes in which
these other SRCR domain-containing proteins are involved, such as
LDL uptake and metabolism, regulation of serum cholesterol level,
atherogenesis, atherosclerosis, bacterial or viral infections,
immune development, and generation and perseverance of immune
responses.
[0700] WC1 is a ruminant protein having an SRCR domain. WC1 and
gamma delta T-cell receptor are the only known gamma delta T-cell
specific antigens. Antibodies which bind specifically with WC1
induce growth arrest in IL-2-dependent gamma delta T-cell and
augment proliferation of gamma delta T-cells in an autologous mixed
lymphocyte reaction or in the presence of anti-CD2 or anti-CD5
antibodies. Injection of antibodies which bind specifically with
WC1 into calves results in long-lasting depletion of gamma delta
T-cells. Furthermore, antibodies which bind specifically with WC1
can be used to purify gamma delta T-cells.
[0701] Gamma delta T-cells are involved in a variety of
physiological processes. For example, these cells are potential
mediators of allergic airway inflammation and lyme disease.
Furthermore, these cells are involved in natural resistance to
viral infections and can mediate autoimmune diseases. Elimination
of gamma delta T-cells by injection of antibodies which bind
specifically therewith can affect the outcomes of these
disorders.
[0702] TANGO 234 is likely the human orthologue of ruminant protein
WC1, and thus is involved with the physiological processes
described above in humans. An alignment of the amino acid sequences
of (human) TANGO 234 and bovine WC1 protein is shown in FIGS.
58A-58F. In this alignment (made using the ALIGN software {Myers
and Miller (1989) CABIOS, ver. 2.0}; pam120.mat scoring matrix; gap
penalties -12/-4), the proteins are 40.4% identical. An alignment
of the nucleotide sequences of the ORFs encoding (human) TANGO 234
and bovine WC1 protein is shown in FIGS. 59A-59Q. The two ORFs are
54.3% identical, as assessed using the same software and
parameters.
[0703] The signal peptide prediction program SIGNALP (Nielsen et
al. (1997) Protein Engineering 10:1-6) predicted that human TANGO
234 protein includes a 40 amino acid signal peptide (amino acid
residues 1 to 40 of SEQ ID NO: 381; SEQ ID NO: 382) preceding the
mature TANGO 234 protein (amino acid residues 41 to 4386 of SEQ ID
NO: 381; SEQ ID NO: 383). Human TANGO 234 protein includes an
extracellular domain (amino acid residues 41 to 1359 of SEQ ID NO:
381; SEQ ID NO: 384); a transmembrane domain (amino acid residues
1360 to 1383 of SEQ ID NO: 381; SEQ ID NO: 385); and a cytoplasmic
domain (amino acid residues 1384 to 1453 of SEQ ID NO: 381; SEQ ID
NO: 386).
[0704] FIG. 57 depicts a hydrophobicity plot of human TANGO 234
protein. Relatively hydrophobic regions are above the dashed
horizontal line, and relatively hydrophilic regions are below the
dashed horizontal line. The hydrophobic region which corresponds to
amino acid residues 1 to 40 of SEQ ID NO: 381 is the signal
sequence of human TANGO 234 (SEQ ID NO: 382). The hydrophobic
region which corresponds to amino acid residues 1360 to 1383 of SEQ
ID NO: 381 is the transmembrane domain of human TANGO 234 (SEQ ID
NO: 385). As described elsewhere herein, relatively hydrophilic
regions are generally located at or near the surface of a protein,
and are more frequently effective immunogenic epitopes than are
relatively hydrophobic regions. For example, the region of human
TANGO 234 protein from about amino acid residue 225 to about amino
acid residue 250 appears to be located at or near the surface of
the protein, while the region from about amino acid residue 990 to
about amino acid residue 1000 appears not to be located at or near
the surface.
[0705] The predicted molecular weight of human TANGO 234 protein
without modification and prior to cleavage of the signal sequence
is about 159.3 kilodaltons. The predicted molecular weight of the
mature human TANGO 234 protein without modification and after
cleavage of the signal sequence is about 154.7 kilodaltons.
[0706] Chromosomal mapping to identify the location of the gene
encoding human TANGO 234 protein indicated that the gene was
located at chromosomal location h12p13 (with synteny to mo6).
Flanking chromosomal markers include WI-6980 and GATA8A09.43.
Nearby human loci include IBD2 (inflammatory bowel disease 2), FPF
(familial periodic fever), and HPDR2 (hypophosphatemia vitamin D
resistant rickets 2). Nearby genes are KLRC (killer cell receptor
cluster), DRPLA (dentatorubro-pallidoluysian atrophy), GAPD
(glyceraldehyde-3-phosphate) dehydrogenase, and PXR1 (peroxisome
receptor 1). Murine chromosomal mapping indicated that the murine
orthologue is located near the scr (scruffy) locus. Nearby mouse
genes include drpla (dentatorubral phillidoluysian atrophy), prp
(proline rich protein), and kap (kidney androgen regulated
protein).
[0707] Northern analysis experiments indicated that mRNA
corresponding to the cDNA encoding TANGO 234 is expressed in the
tissues listed in Table XXVIII, wherein "++" indicates moderate
expression, "+" indicates lower expression, and "-" indicates no
detectable expression.
TABLE-US-00039 TABLE XXVIII Relative Level of Animal Tissue
Expression Human spleen ++ fetal lung ++ lung + thymus + bone
marrow - peripheral blood leukocytes -
[0708] Uses of TANGO 234 Nucleic acids,
[0709] Polypeptides, and Modulators Thereof
[0710] TANGO 234 proteins are involved in disorders which affect
both tissues in which they are normally expressed and tissues in
which they are normally not expressed. Based on the observation
that TANGO 234 is expressed in human fetal lung, spleen, and, to a
lesser extent in adult lung and thymus tissue, TANGO 234 protein is
involved in one or more biological processes which occur in these
tissues. In particular, TANGO 234 is involved in modulating growth,
proliferation, survival, differentiation, and activity of cells
including, lung, spleen, thymus, bone marrow, hematopoietic,
peripheral blood leukocytes, and fetal cells of the animal in which
it is normally expressed. Thus, TANGO 234 has a role in disorders
which affect these cells and their growth, proliferation, survival,
differentiation, and activity. TANGO 234 can have a role in the
lung, spleen, and hematological described elsewhere in this
disclosure. Expression of TANGO 234 in an animal is also involved
in modulating growth, proliferation, survival, differentiation, and
activity of cells and viruses which are foreign to the host (i.e.,
bacterial, fungal, and viral infections).
[0711] Homology of human TANGO 234 with bovine WC1 protein
indicates that TANGO 234 has physiological functions in humans
analogous to the functions of WC1 in ruminants. Thus, TANGO 234 is
involved in modulating growth, proliferation, survival,
differentiation, and activity of gamma delta T cells. For example,
TANGO 234 affects the ability of gamma delta T cells to interact
with chemokines such as interleukin-2. TANGO 234 therefore is
involved in the physiological processes associated with allergic
airway inflammation, lyme arthritis, resistance to viral infection,
auto-immune diseases, and the like.
In addition, presence in TANGO 234 of SRR and SRCR domains
indicates that TANGO 234 is involved in physiological functions
identical or analogous to the functions performed by other proteins
having such domains. For example, like other SRR domain-containing
proteins, TANGO 234 modulates cholesterol deposition in arterial
walls, and is thus involved in development and persistence of
atherogenesis and arteriosclerosis, as well as other vascular and
cardiovascular disorders. Like other SRCR domain-containing
proteins, TANGO 234 is involved in uptake and metabolism of LDL,
regulation of serum cholesterol level, and can modulate these
processes as well as the processes of atherogenesis,
arteriosclerosis, immune development, and generation and
perseverance of immune responses to bacterial, fungal, and viral
infections.
TANGO 265
[0712] A cDNA clone (designated jthsa079g01) encoding at least a
portion of human TANGO 265 protein was isolated from a human fetal
spleen cDNA library. The human TANGO 265 protein is predicted by
structural analysis to be a transmembrane membrane protein,
although it can exist in a secreted form as well.
[0713] The full length of the cDNA encoding human TANGO 265 protein
(SEQ ID NO: 387) is 3104 nucleotide residues. The ORF of this cDNA,
nucleotide residues 32 to 2314 of SEQ ID NO: 387 (i.e., SEQ ID NO:
388), encodes a 761-amino acid transmembrane protein (SEQ ID NO:
389).
[0714] The invention thus includes purified TANGO 265 protein, both
in the form of the immature 761 amino acid residue protein (SEQ ID
NO: 389) and in the form of the mature 730 amino acid residue
protein (SEQ ID NO: 391). Mature TANGO 265 protein can be
synthesized without the signal sequence polypeptide at the amino
terminus thereof, or it can be synthesized by generating immature
TANGO 265 protein and cleaving the signal sequence therefrom.
[0715] The invention includes nucleic acid molecules which encode a
polypeptide of the invention. Such nucleic acids include, for
example, a DNA molecule having the nucleotide sequence listed in
SEQ ID NO: 387 or some portion thereof, such as the portion which
encodes mature TANGO 265 protein, immature TANGO 265 protein, or a
domain of TANGO 265 protein. These nucleic acids are collectively
referred to as nucleic acids of the invention.
[0716] TANGO 265 proteins and nucleic acid molecules encoding them
comprise a family of molecules having certain conserved structural
and functional features.
[0717] A common domain present in TANGO 265 proteins is a signal
sequence. In one embodiment, a TANGO 265 protein contains a signal
sequence corresponding to amino acid residues 1 to 31 of SEQ ID NO:
389 (SEQ ID NO: 390). The signal sequence is cleaved during
processing of the mature protein.
[0718] TANGO 265 proteins can also include an extracellular domain.
The human TANGO 265 protein extracellular domain is located from
about amino acid residue 32 to about amino acid residue 683 of SEQ
ID NO: 389. TANGO 265 can alternately exist in a secreted form,
such as a mature protein having the amino acid sequence of amino
acid residues 32 to 761 or residues 32 to about 683 of SEQ ID NO:
389.
[0719] TANGO 265 proteins can also include a transmembrane domain.
In one embodiment, a TANGO 265 protein of the invention contains a
transmembrane domain corresponding to about amino acid residues 684
to 704 of SEQ ID NO: 389 (SEQ ID NO: 393).
[0720] In addition, TANGO 265 proteins include a cytoplasmic
domain, particularly including proteins having a carboxyl-terminal
cytoplasmic domain. The human TANGO 265 cytoplasmic domain is
located from about amino acid residue 705 to amino acid residue 761
of SEQ ID NO: 389 (SEQ ID NO: 394).
[0721] TANGO 265 proteins typically comprise a variety of potential
post-translational modification sites (often within an
extracellular domain), such as those described herein in Table
XXIX, as predicted by computerized sequence analysis of TANGO 265
proteins using amino acid sequence comparison software (comparing
the amino acid sequence of TANGO 265 with the information in the
PROSITE database {rel. 12.2; February, 1995} and the Hidden Markov
Models database {Rel. PFAM 3.3}). In certain embodiments, a protein
of the invention has at least 1, 2, 4, 6, 10, 15, or 20 or more of
the post-translational modification sites listed in Table XXIX.
TABLE-US-00040 TABLE XXIX Type of Potential Amino Acid Modification
Site Residues Amino Acid or Domain of SEQ ID NO: 389 Sequence
N-glycosylation site 120 to 123 NETQ 135 to 138 NVTH 496 to 499
NCSV 607 to 610 NGLS Glycosaminoglycan 70 to 73 SGDG attachment
site cAMP- or 108 to 111 RKKS cGMP-dependent 116 to 119 KKKS
protein kinase 281 to 284 KKWT phosphorylation site Protein 106 to
108 SDR kinase 262 to 264 TSR C phosphorylation 361 to 363 TSR site
366 to 368 TYR 385 to 387 SDK 533 to 535 SWK 555 to 557 SLR 721 to
723 TLR 738 to 740 SPK Casein 152 to 155 TFIE kinase II 176 to 179
SPFD phosphorylation site 250 to 253 TASE 342 to 345 SLLD 411 to
414 SGVE 498 to 501 SVYE 502 to 505 SCVD 574 to 577 SILE 738 to 741
SPKE 745 to 748 SASD N-myristoylation site 79 to 84 GAREAI 191 to
196 GMLYSG 331 to 336 GGTRSS 412 to 417 GVEYTR 437 to 442 GTTTGS
620 to 625 GLYQCW 671 to 676 GAALAA Sema domain 64 to 478
[0722] An example of a domain which occurs in TANGO 265 proteins is
a sema domain. In one embodiment, the protein of the invention has
at least one domain that is at least 55%, preferably at least about
65%, more preferably at least about 75%, yet more preferably at
least about 85%, and most preferably at least about 95% identical
to one of the sema domains described herein in Table XXIX.
[0723] Sema domains occur in semaphorin proteins. Semaphorins are a
large family of secreted and transmembrane proteins, some of which
function as repellent signals during neural axon guidance. The sema
domain and a variety of semaphorin proteins in which it occurs are
described, for example, in Winberg et al. (1998 Cell 95:903-916).
Sema domains also occur in human hepatocyte growth factor receptor
(Swissprot Accession no. P08581) and the similar neuronal and
epithelial transmembrane receptor protein (Swissprot Accession no.
P51805). The presence of an sema domain in human TANGO 265 protein
indicates that TANGO 265 is involved in one or more physiological
processes in which the semaphorins are involved, has biological
activity in common with one or more of the semaphorins, or
both.
[0724] Human TANGO 265 protein exhibits considerable sequence
similarity to murine semaphorin B protein (GenBank Accession no.
X85991), as indicated herein in FIGS. 60A-60C. FIGS. 60A-60C depict
an alignment of the amino acid sequences of human TANGO 265 protein
(SEQ ID NO: 389) and murine semaphorin B protein (SEQ ID NO: 446).
In this alignment (pam120.mat scoring matrix, gap penalties
-12/-4), the amino acid sequences of the proteins are 82.3%
identical. FIGS. 61A-61L depict an alignment of the nucleotide
sequences of cDNA encoding human TANGO 265 protein (SEQ ID NO: 387)
and murine cDNA encoding semaphorin B protein (SEQ ID NO: 447). In
this alignment (pam120.mat scoring matrix, gap penalties -12/-4),
the nucleic acid sequences of the cDNAs are 76.2% identical. Thus,
TANGO 265 is the human orthologue of murine semaphorin B and shares
functional similarities to that protein.
[0725] It is known that semaphorins are bi-functional, capable of
functioning either as attractive axonal guidance proteins or as
repellent axonal guidance proteins (Wong et al. (1997) Development
124:3597-3607). Furthermore, semaphorins bind with neuronal cell
surface proteins designated plexins, which are expressed on both
neuronal cells and cells of the immune system (Comeau et al. (1998)
Immunity 8:473-482; Jin and Strittmatter (1997) J. Neurosci.
17:6256-6263).
[0726] The signal peptide prediction program SIGNALP (Nielsen et
al. (1997) Protein Engineering 10:1-6) predicted that human TANGO
265 protein includes a 31 amino acid signal peptide (amino acid
residues 1 to 31 of SEQ ID NO: 389; SEQ ID NO: 390) preceding the
mature TANGO 265 protein (amino acid residues 32 to 761 of SEQ ID
NO: 389; SEQ ID NO: 391). Human TANGO 265 protein includes an
extracellular domain (amino acid residues 32 to 683 of SEQ ID
NO:389; SEQ ID NO: 392); a transmembrane domain (amino acid
residues 684 to 704 of SEQ ID NO: 389; SEQ ID NO: 393); and a
cytoplasmic domain (amino acid residues 705 to 761 of SEQ ID NO:
389; SEQ ID NO: 394).
[0727] FIG. 62 depicts a hydrophobicity plot of human TANGO 265
protein. Relatively hydrophobic regions are above the dashed
horizontal line, and relatively hydrophilic regions are below the
dashed horizontal line. The hydrophobic region which corresponds to
amino acid residues 1 to 31 of SEQ ID NO: 389 is the signal
sequence of human TANGO 265 (SEQ ID NO: 390). The hydrophobic
region which corresponds to amino acid residues 684 to 704 of SEQ
ID NO: 389 is the transmembrane domain of human TANGO 265 (SEQ ID
NO: 393). As described elsewhere herein, relatively hydrophilic
regions are generally located at or near the surface of a protein,
and are more frequently effective immunogenic epitopes than are
relatively hydrophobic regions. For example, the region of human
TANGO 265 protein from about amino acid residue 350 to about amino
acid residue 375 appears to be located at or near the surface of
the protein, while the region from about amino acid residue 230 to
about amino acid residue 250 appears not to be located at or near
the surface.
[0728] The predicted molecular weight of human TANGO 265 protein
without modification and prior to cleavage of the signal sequence
is about 83.6 kilodaltons. The predicted molecular weight of the
mature human TANGO 265 protein without modification and after
cleavage of the signal sequence is about 80.2 kilodaltons.
[0729] Chromosomal mapping was performed by computerized comparison
of TANGO 265 cDNA sequences against a chromosomal mapping database
in order to identify the approximate location of the gene encoding
human TANGO 265 protein. This analysis indicated that the gene was
located on chromosome 1 between markers D1S305 and D1S2635.
[0730] Uses of TANGO 265 Nucleic acids,
[0731] Polypeptides, and Modulators Thereof
[0732] TANGO 265 proteins are involved in disorders which affect
both tissues in which they are normally expressed and tissues in
which they are normally not expressed. Based on the observation
that TANGO 265 is expressed in human fetal spleen, involvement of
TANGO 265 protein in immune system development and modulation is
indicated.
[0733] The presence of the sema domain in TANGO 265 indicates that
this protein is involved in development of neuronal and epithelial
tissues and also functions as a repellant protein which guides
axonal development. TANGO 265 modulates nerve growth and
regeneration and also modulates growth and regeneration of other
epithelial tissues.
[0734] TANGO 265 nucleic acids, proteins, and modulators thereof
can be used to modulate proliferation, migration, morphology,
differentiation, function, or some combination of these, of cells
that form the spleen, (e.g., cells of the splenic connective
tissue, splenic smooth muscle cells, or endothelial cells of the
splenic blood vessels) or of blood cells that are processed (e.g.,
regenerated, matured, or phagocytized) within the spleen, as
described elsewhere in this disclosure.
[0735] The observation that TANGO 265 shares significant identity
with murine semaphorin B suggests that it has activity identical or
analogous to the activity of this protein. These observations
indicate that TANGO 265 modulates growth, proliferation, survival,
differentiation, and activity of neuronal cells and immune system
cells. Thus, TANGO 265 protein is useful, for example, for guiding
neural axon development, for modulating differentiation of cells of
the immune system, for modulating cytokine production by cells of
the immune system, for modulating reactivity of cells of the immune
system toward cytokines, for modulating initiation and persistence
of an inflammatory response, and for modulating proliferation of
epithelial cells.
TANGO 286
[0736] A cDNA clone (designated jthkf042e03) encoding at least a
portion of human TANGO 286 protein was isolated from a human
keratinocyte cDNA library. The human TANGO 286 protein is predicted
by structural analysis to be a secreted protein.
[0737] The full length of the cDNA encoding TANGO 286 protein (SEQ
ID NO: 403) is 1980 nucleotide residues. The ORF of this cDNA,
nucleotide residues 133 to 1497 of SEQ ID NO: 403 (i.e., SEQ ID NO:
404), encodes a 455-amino acid secreted protein (SEQ ID NO:
405).
[0738] The invention thus includes purified TANGO 286 protein, both
in the form of the immature 455 amino acid residue protein (SEQ ID
NO: 405) and in the form of the mature 432 amino acid residue
protein (SEQ ID NO: 407). Mature TANGO 286 protein can be
synthesized without the signal sequence polypeptide at the amino
terminus thereof, or it can be synthesized by generating immature
TANGO 286 protein and cleaving the signal sequence therefrom.
[0739] The invention includes nucleic acid molecules which encode a
polypeptide of the invention. Such nucleic acids include, for
example, a DNA molecule having the nucleotide sequence listed in
SEQ ID NO: 403 or some portion thereof, such as the portion which
encodes mature TANGO 286 protein, immature TANGO 286 protein, or a
domain of TANGO 286 protein. These nucleic acids are collectively
referred to as nucleic acids of the invention.
[0740] TANGO 286 proteins and nucleic acid molecules encoding them
comprise a family of molecules having certain conserved structural
and functional features.
[0741] A common domain of TANGO 286 proteins is a signal sequence.
In one embodiment, a TANGO 286 protein contains a signal sequence
corresponding to amino acid residues 1 to 23 of SEQ ID NO: 405 (SEQ
ID NO: 406). The signal sequence is cleaved during processing of
the mature protein.
[0742] TANGO 286 is a secreted soluble protein (i.e., a secreted
protein having a single extracellular domain), as indicated by
computerized sequence analysis and comparison of the amino acid
sequence of TANGO 286 with related proteins, such as the soluble
proteins designated bactericidal permeability increasing (BPI)
protein and recombinant endotoxin neutralizing polypeptide
(RENP).
[0743] TANGO 286 proteins typically comprise a variety of potential
post-translational modification sites (often within an
extracellular domain), such as those described herein in Table XXX,
as predicted by computerized sequence analysis of TANGO 286
proteins using amino acid sequence comparison software (comparing
the amino acid sequence of TANGO 286 with the information in the
PROSITE database {rel. 12.2; February, 1995} and the Hidden Markov
Models database {Rel. PFAM 3.3}). In certain embodiments, a protein
of the invention has at least 1, 2, 4, 6, 10, 15, or 20 or more of
the post-translational modification sites listed in Table XXX.
TABLE-US-00041 TABLE XXX Type of Potential Amino Acid Modification
Site Residues Amino Acid or Domain of SEQ ID NO: 405 Sequence
N-glycosylation site 79 to 82 NFSN 92 to 95 NTSL 113 to 116 NIST
161 to 164 NLST 173 to 176 NYTL 205 to 208 NLTD 249 to 252 NLTL 303
to 306 NFTL 320 to 323 NSTV 363 to 366 NRSN Protein 35 to 37 TQR
kinase C 362 to 364 SNR phosphorylation site 429 to 431 SSK Casein
63 to 66 SGSE kinase II 130 to 133 SFAE phosphorylation site 163 to
166 STLE 169 to 172 TKID 175 to 178 TLLD 183 to 186 SSPE 253 to 256
STEE 321 to 324 STVE 365 to 368 SNIE 409 to 412 SDIE
N-myristoylation site 42 to 47 GVQAGM 269 to 274 GNVLSR
Lipid-binding 12 to 427 serum glycoprotein domain
[0744] Certain lipid-binding serum glycoproteins, such as
LPS-binding protein (LBP), bactericidal permeability-increasing
protein (BPI), cholesteryl ester transfer protein (CETP), and
phospholipid transfer protein (PLTP), share regions of sequence
similarity which are herein designated a lipid-binding serum
glycoprotein domain (Schumann et al., (1990) Science 249:1429-1431;
Gray et al., (1989) J. Biol. Chem. 264:9505-9509; Day et al.,
(1994) J. Biol. Chem. 269:9388-9391). The consensus pattern of
lipid-binding serum glycoprotein domains is as follows (using
standard single letter amino acid abbreviations wherein X is any
amino acid residue). [0745] -(P or A)-(G or A)-(L or I or V or M or
C)-X.sub.2-R-(I or V)-(S or T)-
[0746] X.sub.3-L-X.sub.(4 or 5)-(E or Q)-X.sub.4-(L or I or V or
M)-X.sub.(0 or 1)-(E or Q or K)-X.sub.8-P-(SEQ ID NO: 457; e.g.,
amino acid residues 28-60 of SEQ ID NO: 405).
[0747] Proteins in which a lipid-binding serum glycoprotein domain
occurs are often structurally related and exhibit related
physiological activities. LBP binds to lipid A moieties of
bacterial LPS and, once bound thereto, induces secretion of
.alpha.-tumor necrosis factor, apparently by interacting with the
CD14 receptor. BPI also binds LPS and exerts a cytotoxic effect on
Gram-negative bacteria (Elsbach, (1998) J. Leukoc. Biol. 64:14-18).
CETP is involved in transfer of insoluble cholesteryl esters during
reverse cholesterol transport. PLTP appears to be involved in
phospholipid transport and modulation of serum HDL particles.
[0748] The signal peptide prediction program SIGNALP (Nielsen et
al. (1997) Protein Engineering 10:1-6) predicted that TANGO 286
protein includes a 23 amino acid signal peptide (amino acid
residues 1 to 23 of SEQ ID NO: 405; SEQ ID NO: 406) preceding the
mature TANGO 286 protein (amino acid residues 24 to 455 of SEQ ID
NO: 45; SEQ ID NO: 407). Human TANGO 286 protein is a secreted
soluble protein.
[0749] FIG. 63 depicts a hydrophobicity plot of TANGO 286 protein.
Relatively hydrophobic regions are above the dashed horizontal
line, and relatively hydrophilic regions are below the dashed
horizontal line. As described elsewhere herein, relatively
hydrophilic regions are generally located at or near the surface of
a protein, and are more frequently effective immunogenic epitopes
than are relatively hydrophobic regions. For example, the region of
human TANGO 286 protein from about amino acid residue 420 to about
amino acid residue 435 appears to be located at or near the surface
of the protein, while the region from about amino acid residue 325
to about amino acid residue 345 appears not to be located at or
near the surface.
[0750] The predicted molecular weight of TANGO 286 protein without
modification and prior to cleavage of the signal sequence is about
50.9 kilodaltons. The predicted molecular weight of the mature
TANGO 286 protein without modification and after cleavage of the
signal sequence is about 48.2 kilodaltons.
[0751] The gene encoding human TANGO 286 protein was determined to
be located on chromosome 22 by comparison of matching genomic
clones such as the clones assigned GenBank Accession numbers W16806
and AL021937.
[0752] A portion of TANGO 286 protein exhibits significant amino
acid homology with a region of the human chromosome region 22q12-13
genomic nucleotide sequence having GenBank Accession number
AL021937. Alignment of a 45 kilobase nucleotide sequence encoding
TANGO 286 with AL021937, however, indicated the presence in TANGO
286 of exons which differ from those disclosed in L021937
(pam120.mat scoring matrix; gap penalties -12/-4). This region of
chromosome 22 comprises an immunoglobulin lambda chain C (IGLC)
pseudogene, the Ret finger protein-like 3 (RFPL3) and Ret finger
protein-like 3 antisense (RFPL3S) genes, a gene encoding a novel
immunoglobulin lambda chain V family protein, a novel gene encoding
a protein similar both to mouse RGDS protein (RALGDS, RALGEF,
guanine nucleotide dissociation stimulator A) and to rabbit
oncogene RSC, a novel gene encoding the human orthologue of worm
F16A11.2 protein, a novel gene, encoding a protein similar both to
BPI and to rabbit liposaccharide-binding protein, and a 5'-portion
of a novel gene. This region also comprises various ESTs, STSs,
GSSs, genomic marker D22S1175, a ca repeat polymorphism and
putative CpG islands. TANGO 286 protein thus shares one or more
structural or functional features of these molecules.
[0753] TANGO 286 protein exhibits considerable sequence similarity
with BPI protein, having 23.9% amino acid sequence identity
therewith, as assessed using the ALIGN v. 2.0 computer software
using a pam120.mat scoring matrix and gap penalties of -12/-4.
TANGO 286 protein also exhibits considerable sequence similarity
with recombinant endotoxin neutralizing polypeptide (RENP), having
24.5% amino acid sequence identity therewith, as assessed using the
ALIGN software. Physiological activities of BPI protein and RENP
have been described (e.g., Gabay et al., (1989) Proc. Natl. Acad.
Sci. USA 86:5610-5614; Elsbach, (1998) J. Leukoc. Biol. 64:14-18;
Mahadeva et al., (1997) Chest 112:1699-1701; International patent
application WO96/34873). RENP, for example, binds LPS and
neutralizes bacterial endotoxins. BPI, RENP, and other proteins in
which a lipid-binding serum glycoprotein domain occurs bind LPS and
neutralize bacterial endotoxins, and are therefore useful for
preventing, detecting, and treating LPS-related disorders such as
shock, disseminated intravascular coagulation, anemia,
thrombocytopenia, adult respiratory distress syndrome, renal
failure, liver disease, and disorders associated with Gram negative
bacterial infections. In addition to the physiological conditions
described above, BPI protein is known to be involved in vasculitis
and bronchiectasis, in that antibodies which bind specifically with
BPI protein are present in at least some patients afflicted with
these disorders (Mahadeva et al., supra).
[0754] Uses of TANGO 286 Nucleic acids,
[0755] Polypeptides, and Modulators Thereof
[0756] Expression of TANGO 286 in keratinocyte library indicates
that this protein is involved in a disorders which involve
keratinocytes. Such disorders include, for example, disorders
involving extracellular matrix abnormalities, dermatological
disorders, ocular disorders, inappropriate hair growth (e.g.,
baldness), infections of the nails of the fingers and toes, scalp
disorders (e.g., dandruff), and the like.
[0757] The fact that TANGO 286 protein contains a lipid-binding
serum glycoprotein domain indicates that TANGO 286 is involved in
one or more physiological processes in which these other
lipid-binding serum glycoprotein domain-containing proteins are
involved. Thus, TANGO 286 is involved in one or more of lipid
transport, metabolism, serum lipid particle regulation, host
anti-microbial defensive mechanisms, and the like.
[0758] Human TANGO 286 shares physiological functionality with
other proteins in which a lipid-binding serum glycoprotein domains
occurs (e.g., LBP, BPI protein, CETP, and PLTP). Based on the amino
acid sequence similarity of TANGO 286 with BPI protein and with
RENP, TANGO 286 protein exhibits physiological activities exhibited
by these proteins. Thus, TANGO 286 proteins are useful for
preventing, diagnosing, and treating, among others, lipid transport
disorders, lipid metabolism disorders, disorders of serum lipid
particle regulation, obesity, disorders involving insufficient or
inappropriate host anti-microbial defensive mechanisms, vasculitis,
bronchiectasis, LPS-related disorders such as shock, disseminated
intravascular coagulation, anemia, thrombocytopenia, adult
respiratory distress syndrome, renal failure, liver disease, and
disorders associated with Gram negative bacterial infections, such
as bacteremia, endotoxemia, sepsis, and the like.
TANGO 294
[0759] A cDNA clone (designated jthrc145g07) encoding at least a
portion of human TANGO 294 protein was isolated from a human
pulmonary artery smooth muscle cell cDNA library. The human TANGO
294 protein is predicted by structural analysis to be a
transmembrane membrane protein. No expression of DNA encoding TANGO
294 was detected in human heart, brain, placenta, lung, liver,
skeletal muscle, kidney, or pancreas tissues.
[0760] The full length of the cDNA encoding TANGO 294 protein (SEQ
ID NO: 415) is 2044 nucleotide residues. The ORF of this cDNA,
nucleotide residues 126 to 1394 of SEQ ID NO: 415 (i.e., SEQ ID NO:
416), encodes a 423-amino acid transmembrane protein (SEQ ID NO:
417).
[0761] The invention includes purified TANGO 294 protein, both in
the form of the immature 423 amino acid residue protein (SEQ ID NO:
417) and in the form of the mature 390 amino acid residue protein
(SEQ ID NO: 419). Mature TANGO 294 protein can be synthesized
without the signal sequence polypeptide at the amino terminus
thereof, or it can be synthesized by generating immature TANGO 294
protein and cleaving the signal sequence therefrom.
[0762] The invention includes nucleic acid molecules which encode a
polypeptide of the invention. Such nucleic acids include, for
example, a DNA molecule having the nucleotide sequence listed in
SEQ ID NO: 415 or some portion thereof, such as the portion which
encodes mature TANGO 294 protein, immature TANGO 294 protein, or a
domain of TANGO 294 protein. These nucleic acids are collectively
referred to as nucleic acids of the invention.
[0763] TANGO 294 proteins and nucleic acid molecules encoding them
comprise a family of molecules having certain conserved structural
and functional features.
[0764] Also included within the scope of the invention are TANGO
294 proteins having a signal sequence. In one embodiment, a TANGO
294 protein contains a signal sequence corresponding to amino acid
residues 1 to 33 of SEQ ID NO: 417 (SEQ ID NO: 418). The signal
sequence is cleaved during processing of the mature protein.
[0765] The naturally-occurring form of TANGO 294 protein is a
secreted protein (i.e., not comprising the predicted signal
sequence). However, in variant forms, TANGO 294 proteins can be
transmembrane proteins which include an extracellular domain. In
this transmembrane variant form, the predicted TANGO 294 protein
extracellular domain is located from about amino acid residue 34 to
about amino acid residue 254 of SEQ ID NO: 417, the predicted
cytoplasmic domain is located from about amino acid residue 280 to
amino acid residue 423 of SEQ ID NO: 417 (SEQ ID NO: 422), and the
predicted transmembrane domain is located from about amino acid
residues 255 to 279 of SEQ ID NO: 417 (SEQ ID NO: 421).
[0766] TANGO 294 proteins typically comprise a variety of potential
post-translational modification sites (often within an
extracellular domain), such as those described herein in Table
XXXI, as predicted by computerized sequence analysis of TANGO 294
proteins using amino acid sequence comparison software (comparing
the amino acid sequence of TANGO 294 with the information in the
PROSITE database {rel. 12.2; February, 1995} and the Hidden Markov
Models database {Rel. PFAM 3.3}). In certain embodiments, a protein
of the invention has at least 1, 2, 4, 6, 10, 15, or 20 or more of
the post-translational modification sites listed in Table XXXI.
TABLE-US-00042 TABLE XXXI Type of Potential Amino Acid Modification
Site Residues of Amino Acid or Domain SEQ ID NO: 417 Sequence
N-glycosylation site 48 to 51 NISE 113 to 116 NNSL 285 to 288 NMSR
413 to 416 NLSQ Protein 12 to 14 SHR kinase C 138 to 140 SRK
phosphorylation site 217 to 219 TVK Casein 155 to 158 SYDE kinase
II 175 to 178 TGQE phosphorylation site 198 to 201 TMPE 360 to 363
SNPE Tyrosine kinase 174 to 182 KTGQEKIYY phosphorylation site
N-myristoylation site 99 to 104 GLVGGA 130 to 135 GNSRGN 188 to 193
GTTMGF 277 to 282 GGFNTN Amidation site 240 to 243 FGKK Lipase
serine 180 to 189 IYYVGYSQGT active site Alpha/beta hydrolase 125
to 404 fold domain
[0767] Alpha/beta hydrolase fold domains occur in a wide variety of
enzymes (Ollis et al., (1992) Protein Eng. 5:197-211). The
alpha/beta fold domain is a conserved topological domain in which
sequence homology is not necessarily conserved. Conservation of
topology in the alpha/beta fold domain preserves arrangement of
catalytic residues, even though those residues, and the reactions
they catalyze, can vary. In many enzymes, particularly including
alpha/beta hydrolases, this domain encompasses the active site of
the enzyme. In one embodiment, the protein of the invention has at
least one domain that is at least 55%, preferably at least about
65%, more preferably at least about 75%, yet more preferably at
least about 85%, and most preferably at least about 95% identical
to the alpha/beta hydrolase fold domain described herein in Table
XXXI.
[0768] The signal peptide prediction program SIGNALP (Nielsen et
al. (1997) Protein Engineering 10:1-6) predicted that human TANGO
294 protein includes a 33 amino acid signal peptide (amino acid
residues 1 to 33 of SEQ ID NO: 417; SEQ ID NO: 418) preceding the
mature TANGO 294 protein (amino acid residues 34 to 423 of SEQ ID
NO: 417; SEQ ID NO: 419). Human TANGO 294 protein is a soluble
secreted protein. However, in the transmembrane variant form, human
TANGO 294 protein includes an extracellular domain (amino acid
residues 34 to 254 of SEQ ID NO: 417; SEQ ID NO: 420); a
transmembrane domain (amino acid residues 255 to 279 of SEQ ID NO:
417; SEQ ID NO: 421); and a cytoplasmic domain (amino acid residues
280 to 423 of SEQ ID NO: 417; SEQ ID NO: 422).
[0769] FIG. 67 depicts a hydrophobicity plot of human TANGO 294
protein. Relatively hydrophobic regions are above the dashed
horizontal line, and relatively hydrophilic regions are below the
dashed horizontal line. The hydrophobic region which corresponds to
amino acid residues 1 to 33 of SEQ ID NO: 417 is the signal
sequence of human TANGO 294 (SEQ ID NO: 419). The hydrophobic
region which corresponds to amino acid residues 255 to 279 of SEQ
ID NO: 417 is the predicted transmembrane domain of human TANGO 294
(SEQ ID NO: 421). As described elsewhere herein, relatively
hydrophilic regions are generally located at or near the surface of
a protein, and are more frequently effective immunogenic epitopes
than are relatively hydrophobic regions. For example, the region of
human TANGO 294 protein from about amino acid residue 130 to about
amino acid residue 150 appears to be located at or near the surface
of the protein, while the region from about amino acid residue 90
to about amino acid residue 100 appears not to be located at or
near the surface.
[0770] The predicted molecular weight of human TANGO 294 protein
without modification and prior to cleavage of the signal sequence
is about 48.2 kilodaltons. The predicted molecular weight of the
mature human TANGO 294 protein without modification and after
cleavage of the signal sequence is about 44.2 kilodaltons.
[0771] It may be that amino acid residues 1 to 15 of SEQ ID NO: 417
do not occur in TANGO 294 protein. However, it is recognized that
amino acid residues 16 to 33 of SEQ ID NO: 417 form a functional
signal sequence even in the absence of residues 1 to 15. The amino
acid sequence (and hence the properties) of mature TANGO 294
protein are unaffected by presence or absence of amino acid
residues 1 to 15 of immature TANGO 294 protein.
[0772] Human TANGO 294 protein exhibits considerable sequence
similarity (i.e., about 75% amino acid sequence identity) to
lingual and gastric lipase proteins of rat (Swissprot Accession no.
P04634; Docherty et al. (1985) Nucleic Acids Res. 13:1891-1903),
dog (Swissprot Accession no. P80035; Carriere et al. (1991) Eur. J.
Biochem. 202:75-83), and human (Swissprot Accession no. P07098;
Bernbaeck and Blaeckberg (1987) Biochim Biophys. Acta 909:237-244),
as assessed using the ALIGN v. 2.0 computer software using a
pam12.mat scoring matrix and gap penalties of -12/-4. TANGO 294 is
distinct from the known human lipase, as indicated in FIGS.
66A-66B. FIGS. 66A-66B depict an alignment of the amino acid
sequences of human TANGO 294 protein (SEQ ID NO: 417) and the known
human lipase protein (SEQ ID NO: 445), as assessed using the same
software and parameters. In this alignment (pam120.mat scoring
matrix, gap penalties -12/-4), the amino acid sequences of the
proteins are 49.8% identical. TANGO 294 also is distinct from the
known human lysosomal acid lipase, as indicated in FIGS. 68A-68B.
FIGS. 68A-68B depicts an alignment of the amino acid sequences of
human TANGO 294 protein (SEQ ID NO: 417) and the known human
lysosomal acid lipase protein (SEQ ID NO: 411). In this alignment
(pam120.mat scoring matrix, gap penalties -12/-4), the amino acid
sequences of the proteins are 56.9% identical.
[0773] TANGO 294 is a human lipase distinct from the known human
lipase and the known human lysosomal acid lipase. Furthermore, in
view of the comparisons of the amino acid sequences of TANGO 294
and the two human lipases and the nature of transcriptional
initiation sites, it is recognized that the transcriptional start
site can correspond to either of the methionine residues located at
residues 1 and 15 of SEQ ID NO: 417 The present invention thus
includes proteins in which the initially transcribed amino acid
residue is the methionine residue at position 1 of SEQ ID NO: 417
and proteins in which the initially transcribed amino acid residue
is the methionine residue at position 15 of SEQ ID NO: 417 (i.e.,
proteins in which the amino acid sequence of TANGO 294 does not
include residues 1 to 14 of SEQ ID NO: 417). Furthermore, because
amino acid residues 1 to 14 of SEQ ID NO: 417 are predicted to be
part of a signal sequence, it is recognized that the protein not
comprising this portion of the amino acid sequence will nonetheless
exhibit a functional signal sequence at its amino terminus.
[0774] Uses of TANGO 294 Nucleic acids,
[0775] Polypeptides, and Modulators Thereof
[0776] The sequence similarity of TANGO 294 and mammalian lingual,
gastric, and lysosomal acid lipase proteins indicates that TANGO
294 is involved in physiological processes identical or analogous
to those involving these lipases. Thus, TANGO 294 is involved in
facilitating absorption and metabolism of fat. TANGO 294 can thus
be used, for example, to prevent, detect, and treat disorders
relating to fat absorption and metabolism, such as inadequate
expression of gastric/pancreatic lipase, cystic fibrosis, exocrine
pancreatic insufficiency, obesity, medical treatments which alter
fat absorption, and the like.
[0777] TANGO 294 protein is known to be expressed in human
pulmonary artery smooth muscle tissue. This indicates that TANGO
294 protein is involved in transportation and metabolism of fats
and lipids in the human vascular and cardiovascular systems. Thus,
TANGO 294 proteins of the invention can be used to prevent, detect,
and treat disorders involving these body systems.
INTERCEPT 296
[0778] A cDNA clone (designated jthEa030h09) encoding at least a
portion of human INTERCEPT 296 protein was isolated from a human
esophagus cDNA library. The human INTERCEPT 296 protein is
predicted by structural analysis to be a transmembrane protein
having three or more transmembrane domains. Expression of DNA
encoding INTERCEPT 296 tissue has been detected by northern
analysis of human lung tissue. In human lung tissue, two moieties
corresponding to INTERCEPT 296 have been identified in Northern
blots. It is recognized that these two moieties may represent
alternatively polyadenylated INTERCEPT 296 mRNAs or alternatively
spliced INTERCEPT 296 mRNAs. It has furthermore been observed that
INTERCEPT 296 does not appear to be expressed in any of heart,
brain, placenta, skeletal muscle, kidney, and pancreas tissues.
[0779] The full length of the cDNA encoding INTERCEPT 296 protein
(SEQ ID NO: 423) is 2133 nucleotide residues. The ORF of this cDNA,
nucleotide residues 70 to 1098 of SEQ ID NO: 423 (i.e., SEQ ID NO:
424), encodes a 343-amino acid transmembrane protein (SEQ ID NO:
425).
[0780] The invention includes nucleic acid molecules which encode a
polypeptide of the invention. Such nucleic acids include, for
example, a DNA molecule having the nucleotide sequence SEQ ID NO:
423 or some portion thereof, such as the portion which encodes
INTERCEPT 296 protein or a domain thereof. These nucleic acids are
collectively referred to as nucleic acids of the invention.
[0781] INTERCEPT 296 proteins and nucleic acid molecules encoding
them comprise a family of molecules having certain conserved
structural and functional features, such as the five transmembrane
domains which occur in the protein.
[0782] INTERCEPT 296 comprises at least five transmembrane domains,
at least three cytoplasmic domains, and at least two extracellular
domains. INTERCEPT 296 does not appear to comprise a cleavable
signal sequence. Amino acid residues 1 to 70 of SEQ ID NO: 425
likely directs insertion of the protein into the cytoplasmic
membrane. There are at least two mechanisms by which this can
occur. Sequence analysis of residues 1 to 70 of SEQ ID NO: 425
indicates that this entire region may represent a signal sequence
or that residues 1 to 47 represent a signal sequence, with residues
48-70 representing a transmembrane region. Human INTERCEPT 296
protein extracellular domains are located from about amino acid
residue 70 to about amino acid residue 182 (SEQ ID NO: 427) and
from about amino acid residue 228 to about amino acid residue 249
(SEQ ID NO: 428) of SEQ ID NO: 425. Human INTERCEPT 296 cytoplasmic
domains are located from about amino acid residue 43 to amino acid
residue 50 (SEQ ID NO: 434), from about amino acid residue 205 to
amino acid residue 210 (SEQ ID NO: 435), and from amino acid
residue 272 to amino acid residue 343 (SEQ ID NO: 436) of SEQ ID
NO: 425. The five transmembrane domains of INTERCEPT 296 are
located from about amino acid residues 24 to 42 (SEQ ID NO: 429),
51 to 70 (SEQ ID NO: 430), 183 to 204 (SEQ ID NO: 431), 211 to 227
(SEQ ID NO: 432), and 250 to 271 (SEQ ID NO: 433) of SEQ ID NO:
425.
[0783] INTERCEPT 296 proteins typically comprise a variety of
potential post-translational modification sites (often within an
extracellular domain), such as those described herein in Table
XXXII, as predicted by computerized sequence analysis of INTERCEPT
296 proteins using amino acid sequence comparison software
(comparing the amino acid sequence of INTERCEPT 296 with the
information in the PROSITE database {rel. 12.2; February, 1995} and
the Hidden Markov Models database {Rel. PFAM 3.3}). In certain
embodiments, a protein of the invention has at least 1, 2, 4, 6,
10, 15, or 20 or more of the post-translational modification sites
listed in Table XXXII.
TABLE-US-00043 TABLE XXXII Type of Potential Amino Acid
Modification Site Residues of Amino Acid or Domain SEQ ID NO: 425
Sequence N-glycosylation site 71 to 74 NFSS 84 to 87 NTSY 109 to
112 NITL 121 to 124 NETI 284 to 287 NQSV Protein 86 to 88 SYK
kinase C 131 to 133 TWR phosphorylation site 162 to 164 TPR 304 to
306 SPR 313 to 315 SPK 326 to 328 STK Casein 286 to 289 SVDE kinase
II 296 to 299 SPEE phosphorylation site 309 to 312 SMAD Tyrosine
kinase 148 to 156 KGLPDPVLY phosphorylation site N-myristoylation
site 79 to 84 GQVSTN 100 to 105 GLQVGL 107 to 112 GVNITL 265 to 270
GLAMAV
[0784] FIG. 69 depicts a hydrophobicity plot of INTERCEPT 296
protein. Relatively hydrophobic regions are above the dashed
horizontal line, and relatively hydrophilic regions are below the
dashed horizontal line. The hydrophobic regions which corresponds
to amino acid residues 24 to 42, 51 to 70, 183 to 204, 211 to 227,
and 250 to 271 of SEQ ID NO: 425 are the transmembrane domains of
human INTERCEPT 296 (SEQ ID NOs: 429 through 433, respectively). As
described elsewhere herein, relatively hydrophilic regions are
generally located at or near the surface of a protein, and are more
frequently effective immunogenic epitopes than are relatively
hydrophobic regions. For example, the region of human INTERCEPT 296
protein from about amino acid residue 120 to about amino acid
residue 140 appears to be located at or near the surface of the
protein, while the region from about amino acid residue 95 to about
amino acid residue 110 appears not to be located at or near the
surface.
[0785] The predicted molecular weight of INTERCEPT 296 protein
without modification and prior to cleavage of the signal sequence
is about 37.8 kilodaltons. The predicted molecular weight of the
mature INTERCEPT 296 protein without modification and after
cleavage of the signal sequence is about 30.2 kilodaltons.
[0786] FIGS. 70A-70B depicts an alignment of the amino acid
sequences of human INTERCEPT 296 protein (SEQ ID NO: 425) and
Caenorhabditis elegans C06E1.3 related protein (SEQ ID NO: 410). In
this alignment (pam120.mat scoring matrix, gap penalties -12/-4),
the amino acid sequences of the proteins are 26.8% identical. The
C. elegans protein has five predicted transmembrane domains.
[0787] Uses of INTERCEPT 296 Nucleic acids,
[0788] Polypeptides, and Modulators Thereof
[0789] The cDNA encoding INTERCEPT 296 protein was obtained from a
human esophagus cDNA library, and INTERCEPT 296 is expressed in
lung tissue. The INTERCEPT 296-related proteins and nucleic acids
of the invention are therefore useful for prevention, detection,
and treatment of disorders of the human lung and esophagus.
Examples of lung disorders in which INTERCEPT 296 can be involved
include the lung disorders described elsewhere in this disclosure.
Examples of disorders of the esophagus in which INTERCEPT 296 can
be involved include dysphagia, achalasia, heartburn, symptomatic
diffuse esophageal spasm, corrosive esophagitis, candidiasis, and
gastroesophageal reflux disease.
[0790] Tables A-1, A-2 and B-1 to B-5 summarize sequence data
corresponding to the human nucleic acids and proteins disclosed
herein. Tables A-3 and B-6 summarize sequence data corresponding to
the non-human nucleic acids and proteins disclosed herein.
TABLE-US-00044 TABLE A-1 Protein SEQ ID NOs ATCC .RTM. Designation
cDNA ORF Protein Accession # TANGO 416 1 2 3 PTA-1764 TANGO416 32
32 33 PTA-1764 (alt.form) TANGO 457 51 52 53 PTA-817 TANGO 229 71
72 73 PTA-295 INTERCEPT 289 PTA-295 form 1a 81 82 83 form 1b 91 92
93 form 2a 96 97 98 form 2b 101 102 103 form 3a 106 107 108 form 3b
111 112 113 INTERCEPT 309 121 122 123 PTA-1156 MANGO 419 141 142
143 PTA-1156 INTERCEPT 429 151 152 153 PTA-455 TANGO 210 171 172
173 PTA-438 TANGO 366 191 192 193 PTA-424 INTERCEPT 394 201 202 203
PTA-424 INTERCEPT 400 221 222 223 PTA-438 INTERCEPT 217 271 272 273
PTA-147 INTERCEPT 297 279 280 281 PTA-147 TANGO 276 303 304 305
PTA-150 TANGO 292 308 309 310 207230 TANGO 331 324 325 326
PTA-147
TABLE-US-00045 TABLE A-2 Protein SEQ ID NOs ATCC .RTM. Designation
cDNA ORF Protein Accession # TANGO 332 329 330 331 PTA-151 TANGO
202 371 372 373 207219 TANGO 234 379 380 381 207184 TANGO 265 387
388 389 207228 TANGO 286 403 404 405 207220 TANGO 294 415 416 417
207220 INTERCEPT 296 423 424 425 207220
TABLE-US-00046 TABLE A-3 SEQ ID NOs ATCC .RTM. Protein Designation
cDNA ORF Protein Accession # murine INTERCEPT 289 161 162 163
murine TANGO 210 181 182 183 murine INTERCEPT 400 241 242 243 rat
INTERCEPT 400 251 252 253 murine INTERCEPT 217 362 363 gerbil TANGO
292 351 352 353 murine TANGO 202 437 438 439
TABLE-US-00047 TABLE B-1 Signal Extracellular Transmembrane
Cytoplasmic Protein Desig. Sequence.sup.1 Mature Protein
Domain(s).sup.2 Domain(s) Domain(s).sup.2 SEQ ID NOs TANGO 416 1 to
27 4 28 to 1135 5 28 to 700 6 701 to 721 7 722 to 1135 8
(alternative form) (1 to 27) (4) (28 to 1134) (35) (28 to 700) (6)
(701 to 721) (7) (722 to 1134) (38) TANGO 457 1 to 24 55 25 to 365
54 283 to 365 60 265 to 282 59 25 to 264 56 TANGO 229 1 to 34 74 35
to 715 75 35 to 455 76 456 to 480 77 481 to 715 78 INTERCEPT 289
form 1a N/A 1 to 188 83 28 to 188 85 7 to 27 84 form 1b N/A 1 to
178 93 28 to 178 95 7 to 27 94 form 2a N/A 1 to 165 98 28 to 165
100 7 to 27 99 form 2b N/A 1 to 155 103 28 to 155 105 7 to 27 104
form 3a N/A 1 to 145 108 29 to 145 110 7 to 28 109 form 3b N/A 1 to
135 113 29 to 135 115 7 to 28 114 INTERCEPT 309 1 to 24 124 25 to
215 138 25 to 71 125 72 to 92 126 93 to 107 127 132 to 153 129 108
to 131 128 179 to 215 131 154 to 178 130 MANGO 419 1 to 24 144 25
to 80 145 N/A N/A N/A Amino Acid Residues
TABLE-US-00048 TABLE B-2 Signal Extracellular Transmembrane
Cytoplasmic Protein Desig. Sequence.sup.1 Mature Protein
Domain(s).sup.2 Domain(s) Domain(s).sup.2 SEQ ID NOs INTERCEPT 429
1 to 22 154 23 to 115 155 50 to 58 158 32 to 49 157 23 to 31 156 59
to 82 159 83 to 115 160 TANGO 210 1 to 17 174 18 to 513 175 N/A N/A
N/A (Alternate form) 1 to 17 174 18 to 513 175 18 to 488 178 489 to
506 179 507 to 513 180 TANGO 366 1 to 16 194 17 to 353 195 17 to
216 196 217 to 239 197 240 to 353 198 INTERCEPT 394 1 to 25 204 26
to 778 205 88 to 228 208 71 to 87 207 26 to 70 206 337 to 345 212
229 to 253 209 254 to 319 210 320 to 336 211 365 to 778 214 346 to
364 213 INTERCEPT 217 1 to 20 274 21 to 455 275 21 to 383 276 384
to 403 277 404 to 455 278 Amino Acid Residues
TABLE-US-00049 TABLE B-3 Signal Extracellular Transmembrane
Cytoplasmic Protein Desig. Sequence.sup.1 Mature Protein
Domain(s).sup.2 Domain(s) Domain(s).sup.2 SEQ ID NOs INTERCEPT 400
1 to 46 224 47 to 265 225 47 to 62 226 63 to 79 227 80 to 136 228
154 to 164 230 137 to 153 229 184 to 193 232 218 to 231 234 165 to
183 231 252 to 265 236 194 to 217 233 232 to 251 235 INTERCEPT 297
(1 to 18) (282) 19 to 371 283 19 to 47 284 (1 to 18) (12) 69 to 88
298 110 to 118 285 48 to 68 289 138 to 144 299 162 to 175 286 89 to
109 290 193 to 215 300 234 to 260 287 119 to 137 291 284 to 292 301
313 to 319 288 145 to 161 292 337 to 371 302 176 to 192 293 216 to
233 294 261 to 283 295 293 to 312 296 320 to 336 297 Amino Acid
Residues
TABLE-US-00050 TABLE B-4 Signal Extracellular Transmembrane
Cytoplasmic Protein Desig. Sequence.sup.1 Mature Protein
Domain(s).sup.2 Domain(s) Domain(s).sup.2 SEQ ID NOs TANGO 276 1 to
20 306 21 to 243 307 21 to 243 307 N/A N/A TANGO 292 1 to 17 311 18
to 226 312 18 to 113 313 114 to 138 314 139 to 226 315 TANGO 331 1
to 24 327 25 to 353 328 25 to 353 328 N/A N/A TANGO 332 1 to 22 332
23 to 671 333 23 to 671 333 N/A N/A TANGO 202 1 to 19 374 20 to 475
375 20 to 392 376 393 to 415 377 416 to 475 378 (variant) (1 to 19)
(374) (20 to 475) (375) (20 to 475) (375) (N/A) (N/A) TANGO 234 1
to 40 382 41 to 1453 383 41 to 1359 384 1360 to 1383 385 1384 to
1453 386 TANGO 265 1 to 31 390 32 to 761 391 32 to 683 392 684 to
704 393 705 to 761 394 TANGO 286 1 to 23 406 24 to 455 407 24 to
455 407 N/A N/A Amino Acid Residues
TABLE-US-00051 TABLE B-5 Protein Extracellular Transmembrane
Cytoplasmic Desig. Signal Sequence.sup.1 Mature Protein
Domain(s).sup.2 Domain(s) Domain(s).sup.2 SEQ ID NOs TANGO 294 1 to
33 418 34 to 423 419 34 to 254 420 255 to 279 421 280 to 423 422
(variant 1) (15 to 33) (410) (34 to 423) (419) (34 to 254) (420)
(255 to 279) (421) (280 to 423) (422) <variant 2> <1 to
33> <418> <34 to 423> <419> <34 to 423>
<419> <N/A> <N/A> {variant 3} {15 to 33} {410}
{34 to 423} {419} {34 to 423} {419} {N/A} {N/A} INTERCEPT N/A 1 to
343 425 1 to 23 426 24 to 42 429 43 to 50 434 296 71 to 182 427 51
to 70 430 205 to 210 435 228 to 249 428 183 to 204 431 272 to 343
436 211 to 227 432 250 to 271 433 Amino Acid Residues
TABLE-US-00052 TABLE B-6 Signal Extracellular Transmembrane
Cytoplasmic Protein Desig. Sequence.sup.1 Mature Protein
Domain(s).sup.2 Domain(s) Domain(s).sup.2 SEQ ID NOs murine N/A 1
to 190 163 28 to 190 165 7 to 27 164 INTERCEPT 289 murine TANGO 1
to 17 184 18 to 513 185 N/A N/A N/A 210 murine N/A 1 to 180 243 61
to 71 246 44 to 60 2452 1 to 43 244 INTERCEPT 400 125 to 140 250 72
to 90 47 91 to 100 248 101 to 124 249 161 to 180 252 141 to 160 251
murine 1 to 15 364 16 to 320 365 17 to 213 366 214 to 233 367 234
to 320 368 INTERCEPT 217 gerbil TANGO 1 to 17 354 18 to 225 355 18
to 112 356 113 to 137 357 138 to 225 358 292 murine TANGO 1 to 19
412 20 to 470 413 N/A N/A N/A 202 Amino Acid Residues Notes for
Tables B-1 to B-6: .sup.1It is recognized that the carboxyl
terminal boundary of the signal sequence can be .+-. 1 or 2
residues from that indicated. .sup.2It is recognized that
'extracellular' and cytoplasmic' domains can have the opposite
orientation in certain embodiments, as described herein.
[0791] Various aspects of the invention are described in further
detail in the following subsections.
I. Isolated Nucleic Acid Molecules
[0792] One aspect of the invention pertains to isolated nucleic
acid molecules that encode a polypeptide of the invention or a
biologically active portion thereof, as well as nucleic acid
molecules sufficient for use as hybridization probes to identify
nucleic acid molecules encoding a polypeptide of the invention and
fragments of such nucleic acid molecules suitable for use as PCR
primers for the amplification or mutation of nucleic acid
molecules. As used herein, the term "nucleic acid molecule" is
intended to include DNA molecules (e.g., cDNA or genomic DNA) and
RNA molecules (e.g., mRNA) and analogs of the DNA or RNA generated
using nucleotide analogs. The nucleic acid molecule can be
single-stranded or double-stranded.
[0793] An "isolated" nucleic acid molecule is one which is
separated from other nucleic acid molecules which are present in
the natural source of the nucleic acid molecule. Preferably, an
"isolated" nucleic acid molecule is free of sequences (preferably
protein-encoding sequences) which naturally flank the nucleic acid
(i.e., sequences located at the 5' and 3' ends of the nucleic acid)
in the genomic DNA of the organism from which the nucleic acid is
derived. For example, in various embodiments, the isolated nucleic
acid molecule can contain less than about 5, 4, 3, 2, 1, 0.5, or
0.1 kilobases of nucleotide sequences which naturally flank the
nucleic acid molecule in genomic DNA of the cell from which the
nucleic acid is derived. Moreover, an "isolated" nucleic acid
molecule, such as a cDNA molecule, can be substantially free of
other cellular material, or culture medium when produced by
recombinant techniques, or substantially free of chemical
precursors or other chemicals when chemically synthesized.
[0794] A nucleic acid molecule of the present invention, e.g., a
nucleic acid molecule having the nucleotide sequence of all or a
portion of any of SEQ ID NOs: 1, 2, 31, 32, 51, 52, 71, 72, 81, 82,
91, 92, 96, 97, 101, 102, 106, 107, 111, 112, 121, 122, 141, 142,
151, 152, 161, 162, 171, 172, 181, 182, 191, 192, 201, 202, 215,
217, 221, 222, 241, 242, 251, 252, 271, 272, 279, 280, 303, 304,
308, 309, 324, 325, 329, 330, 351, 352, 362, 371, 372, 379, 380,
387, 388, 403, 404, 415, 416, 423, 424, 437, 438, and the
nucleotide sequence of any of the clones deposited as ATCC.RTM.
Accession numbers 207184, 207219, 207220, 207221, 207228, 207230,
PTA-147, PTA-150, PTA-151, PTA-295, PTA-424, PTA-438, PTA-455,
PTA-817, PTA-1156, and PTA-1764, or a complement thereof, or which
has a nucleotide sequence comprising one of these sequences, can be
isolated using standard molecular biology techniques and the
sequence information provided herein. Using all or a portion of the
nucleic acid sequences of any of SEQ ID NOs: 1, 2, 31, 32, 51, 52,
71, 72, 81, 82, 91, 92, 96, 97, 101, 102, 106, 107, 111, 112, 121,
122, 141, 142, 151, 152, 161, 162, 171, 172, 181, 182, 191, 192,
201, 202, 215, 217, 221, 222, 241, 242, 251, 252, 271, 272, 279,
280, 303, 304, 308, 309, 324, 325, 329, 330, 351, 352, 362, 371,
372, 379, 380, 387, 388, 403, 404, 415, 416, 423, 424, 437, 438,
and the nucleotide sequence of any of the clones deposited as
ATCC.RTM. Accession numbers 207184, 207219, 207220, 207221, 207228,
207230, PTA-147, PTA-150, PTA-151, PTA-295, PTA-424, PTA-438,
PTA-455, PTA-817, PTA-1156, and PTA-1764 as a hybridization probe,
nucleic acid molecules of the invention can be isolated using
standard hybridization and cloning techniques (e.g., as described
in Sambrook et al., Eds., Molecular Cloning: A Laboratory Manual,
2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., 1989).
[0795] A nucleic acid molecule of the invention can be amplified
using cDNA, mRNA, or genomic DNA as a template and appropriate
oligonucleotide primers according to standard PCR amplification
techniques. The nucleic acid so amplified can be cloned into an
appropriate vector and characterized by DNA sequence analysis.
Furthermore, oligonucleotides corresponding to all or a portion of
a nucleic acid molecule of the invention can be prepared by
standard synthetic techniques, e.g., using an automated DNA
synthesizer.
[0796] In another embodiment, an isolated nucleic acid molecule of
the invention comprises a nucleic acid molecule which is a
complement of the nucleotide sequence of any of SEQ ID NOs: 1, 2,
31, 32, 51, 52, 71, 72, 81, 82, 91, 92, 96, 97, 101, 102, 106, 107,
111, 112, 121, 122, 141, 142, 151, 152, 161, 162, 171, 172, 181,
182, 191, 192, 201, 202, 215, 217, 221, 222, 241, 242, 251, 252,
271, 272, 279, 280, 303, 304, 308, 309, 324, 325, 329, 330, 351,
352, 362, 371, 372, 379, 380, 387, 388, 403, 404, 415, 416, 423,
424, 437, 438, and the nucleotide sequence of any of the clones
deposited as ATCC.RTM. Accession numbers 207184, 207219, 207220,
207221, 207228, 207230, PTA-147, PTA-150, PTA-151, PTA-295,
PTA-424, PTA-438, PTA-455, PTA-817, PTA-1156, and PTA-1764, or a
portion thereof. A nucleic acid molecule which is complementary to
a given nucleotide sequence is one which is sufficiently
complementary to the given nucleotide sequence that it can
hybridize with the given nucleotide sequence thereby forming a
stable duplex.
[0797] Moreover, a nucleic acid molecule of the invention can
comprise a portion of a nucleic acid sequence encoding a full
length polypeptide of the invention, such as a fragment which can
be used as a probe or primer or a fragment encoding a biologically
active portion of a polypeptide of the invention. The nucleotide
sequence determined from cloning one gene allows generation of
probes and primers designed for identifying and/or cloning homologs
in other cell types, e.g., from other tissues, as well as homologs
from other mammals. The probe/primer typically comprises
substantially purified oligonucleotide. The oligonucleotide
typically comprises a region of nucleotide sequence that hybridizes
under stringent conditions with at least about 15, preferably about
25, more preferably about 40, 60, 80, 100, 150, 200, 250, 300, 350,
400, 450, 550, 650, 700, 800, 900, 1000, 1200, 1400, 1410, 1600,
1800, 2000, 2200, 2400, 2600, 2800, 3000, 3500, 4000, 4500, or 5000
or more consecutive nucleotides of the sense or anti-sense sequence
of any of SEQ ID NOs: 1, 2, 31, 32, 51, 52, 71, 72, 81, 82, 91, 92,
96, 97, 101, 102, 106, 107, 111, 112, 121, 122, 141, 142, 151, 152,
161, 162, 171, 172, 181, 182, 191, 192, 201, 202, 215, 217, 221,
222, 241, 242, 251, 252, 271, 272, 279, 280, 303, 304, 308, 309,
324, 325, 329, 330, 351, 352, 362, 371, 372, 379, 380, 387, 388,
403, 404, 415, 416, 423, 424, 437, 438, and the nucleotide sequence
of any of the clones deposited as ATCC.RTM. Accession numbers
207184, 207219, 207220, 207221, 207228, 207230, PTA-147, PTA-150,
PTA-151, PTA-295, PTA-424, PTA-438, PTA-455, PTA-817, PTA-1156, and
PTA-1764, or of a naturally occurring mutant of any of these
sequences.
[0798] Probes based on the sequence of a nucleic acid molecule of
the invention can be used to detect transcripts or genomic
sequences encoding the same protein molecule encoded by a selected
nucleic acid molecule. The probe comprises a label group attached
thereto, e.g., a radioisotope, a fluorescent compound, an enzyme,
or an enzyme co-factor. Such probes can be used as part of a
diagnostic test kit for identifying cells or tissues which
aberrantly express the protein, such as by measuring levels of a
nucleic acid molecule encoding the protein in a sample of cells
from a subject, e.g., detecting mRNA levels or determining whether
a gene encoding the protein has been mutated or deleted.
[0799] A nucleic acid fragment encoding a biologically active
portion of a polypeptide of the invention can be prepared by
isolating a portion of one of SEQ ID NOs: 2, 32, 52, 72, 82, 92,
97, 102, 107, 112, 122, 142, 152, 162, 172, 182, 192, 202, 215,
222, 242, 252, 272, 280, 304, 309, 325, 330, 352, 362, 372, 380,
388, 404, 416, 424, and 438 expressing the encoded portion of the
polypeptide protein (e.g., by recombinant expression in vitro), and
assessing the activity of the encoded portion of the
polypeptide.
[0800] The invention further encompasses nucleic acid molecules
that differ from the nucleotide sequence of any of SEQ ID NOs: 1,
2, 31, 32, 51, 52, 71, 72, 81, 82, 91, 92, 96, 97, 101, 102, 106,
107, 111, 112, 121, 122, 141, 142, 151, 152, 161, 162, 171, 172,
181, 182, 191, 192, 201, 202, 215, 217, 221, 222, 241, 242, 251,
252, 271, 272, 279, 280, 303, 304, 308, 309, 324, 325, 329, 330,
351, 352, 362, 371, 372, 379, 380, 387, 388, 403, 404, 415, 416,
423, 424, 437, 438, and the nucleotide sequence of any of the
clones deposited as ATCC.RTM. Accession numbers 207184, 207219,
207220, 207221, 207228, 207230, PTA-147, PTA-150, PTA-151, PTA-295,
PTA-424, PTA-438, PTA-455, PTA-817, PTA-1156, and PTA-1764, due to
degeneracy of the genetic code and thus encode the same protein as
that encoded by the nucleotide sequence of one of SEQ ID NOs: 2,
32, 52, 72, 82, 92, 97, 102, 107, 112, 122, 142, 152, 162, 172,
182, 192, 202, 215, 222, 242, 252, 272, 280, 304, 309, 325, 330,
352, 362, 372, 380, 388, 404, 416, 424, and 438.
[0801] In addition to the nucleotide sequences of one of SEQ ID
NOs: 2, 32, 52, 72, 82, 92, 97, 102, 107, 112, 122, 142, 152, 162,
172, 182, 192, 202, 215, 222, 242, 252, 272, 280, 304, 309, 325,
330, 352, 362, 372, 380, 388, 404, 416, 424, and 438, it will be
appreciated by those skilled in the art that DNA sequence
polymorphisms that lead to changes in the amino acid sequence can
exist within a population (e.g., the human population). Such
genetic polymorphisms can exist among individuals within a
population due to natural allelic variation. An allele is one of a
group of genes which occur alternatively at a given genetic
locus.
[0802] To determine the percent identity of two amino acid
sequences or of two nucleic acids, the sequences are aligned for
optimal comparison purposes (e.g., gaps can be introduced in the
sequence of a first amino acid or nucleic acid sequence for optimal
alignment with a second amino or nucleic acid sequence). The amino
acid residues or nucleotides at corresponding amino acid positions
or nucleotide positions are then compared. When a position in the
first sequence is occupied by the same amino acid residue or
nucleotide as the corresponding position in the second sequence,
then the molecules are identical at that position. The percent
identity between the two sequences is a function of the number of
identical positions shared by the sequences (i.e., % identity=# of
identical positions/total # of positions {e.g., overlapping
positions}.times.100). In one embodiment, the two sequences are the
same length.
[0803] The determination of percent identity between two sequences
can be accomplished using a mathematical algorithm. A preferred,
non-limiting example of a mathematical algorithm utilized for the
comparison of two sequences is the algorithm of Karlin and Altschul
(1990) Proc. Natl. Acad. Sci. USA 87:2264-2268, modified as in
Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877.
Such an algorithm is incorporated into the NBLAST and XBLAST
programs of Altschul, et al. (1990) J. Mol. Biol. 215:403-410.
BLAST nucleotide searches can be performed with the NBLAST program,
score=100, wordlength=12 to obtain nucleotide sequences homologous
to a nucleic acid molecules of the invention. BLAST protein
searches can be performed with the XBLAST program, score=50,
wordlength=3 to obtain amino acid sequences homologous to a protein
molecules of the invention. To obtain gapped alignments for
comparison purposes, Gapped BLAST can be utilized as described in
Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402.
Alternatively, PSI-Blast can be used to perform an iterated search
which detects distant relationships between molecules (Id.). When
utilizing BLAST, Gapped BLAST, and PSI-Blast programs, the default
parameters of the respective programs (e.g., XBLAST and NBLAST) can
be used.
[0804] Another preferred, non-limiting example of a mathematical
algorithm utilized for the comparison of sequences is the local
homology algorithm of Smith and Waterman (Advances in Applied
Mathematics 2: 482-489 (1981)). Such an algorithm is incorporated
into the BestFit program, which is part of the Wisconsin.TM.
package, and is used to find the best segment of similarity between
two sequences. BestFit reads a scoring matrix that contains values
for every possible GCG symbol match. The program uses these values
to construct a path matrix that represents the entire surface of
comparison with a score at every position for the best possible
alignment to that point. The quality score for the best alignment
to any point is equal to the sum of the scoring matrix values of
the matches in that alignment, less the gap creation penalty
multiplied by the number of gaps in that alignment, less the gap
extension penalty multiplied by the total length of all gaps in
that alignment. The gap creation and gap extension penalties are
set by the user. If the best path to any point has a negative
value, a zero is put in that position.
[0805] After the path matrix is complete, the highest value on the
surface of comparison represents the end of the best region of
similarity between the sequences. The best path from this highest
value backwards to the point where the values revert to zero is the
alignment shown by BestFit. This alignment is the best segment of
similarity between the two sequences.
[0806] Additional algorithms for sequence analysis are known in the
art and include ADVANCE and ADAM as described in Torellis and
Robotti (1994) Comput. Appl. Biosci., 10:3-5; and FASTA described
in Pearson and Lipman (1988) Proc. Natl. Acad. Sci. 85:2444-8.
Within FASTA, ktup is a control option that sets the sensitivity
and speed of the search. If ktup=2, similar regions in the two
sequences being compared are found by looking at pairs of aligned
residues; if ktup=1, single aligned amino acids are examined. ktup
can be set to 2 or 1 for protein sequences, or from 1 to 6 for DNA
sequences. The default if ktup is not specified is 2 for proteins
and 6 for DNA.
[0807] The percent identity between two sequences can be determined
using techniques similar to those described above, with or without
allowing gaps. In calculating percent identity, typically exact
matches are counted.
[0808] As used herein, the phrase "allelic variant" refers to a
nucleotide sequence which occurs at a given locus or to a
polypeptide encoded by the nucleotide sequence. For example, the
TANGO 457 gene exhibits significant homology with a portion of
human chromosome 11p14.3 PAC present in a clone designated
pDJ239b22 and having GENBANK.TM. accession number AC003969; the
TANGO 416 gene exhibits significant homology with a portion of
chromosome 4 between chromosomal markers D4S422 and D4S1576; the
INTERCEPT 400 gene exhibits significant homology with a portion of
chromosome 4 between markers D4S1616 and D4S1611; the TANGO 331
gene exhibits significant homology with a portion of chromosome 22
at 22q11-q13, between markers WI-4572 and WI-8917; the TANGO 265
gene exhibits significant homology with a portion of chromosome 1
between markers D1S305 and D1S2635; and the TANGO 286 gene exhibits
significant homology with a portion of chromosome 22 at 22q12-13.
Allelic variants of any of these genes can be identified by
sequencing the corresponding chromosomal portion at the indicated
location in multiple individuals.
[0809] As used herein, the terms "gene" and "recombinant gene"
refer to nucleic acid molecules comprising an open reading frame
encoding a polypeptide of the invention. Such natural allelic
variations can typically result in 1-5% variance in the nucleotide
sequence of a given gene. Alternative alleles can be identified by
sequencing the gene of interest in a number of different
individuals. This can be readily carried out by using hybridization
probes to identify the same genetic locus in a variety of
individuals. Any and all such nucleotide variations and resulting
amino acid polymorphisms or variations that are the result of
natural allelic variation and that do not alter the functional
activity are intended to be within the scope of the invention.
[0810] Moreover, nucleic acid molecules encoding proteins of the
invention from other species (homologs), which have a nucleotide
sequence which differs from that of the human proteins described
herein are within the scope of the invention. Nucleic acid
molecules corresponding to natural allelic variants and homologs of
a cDNA of the invention can be isolated based on their identity to
human nucleic acid molecules using the human cDNAs, or a portion
thereof, as a hybridization probe according to standard
hybridization techniques under stringent hybridization conditions.
For example, a cDNA encoding a soluble form of a membrane-bound
protein of the invention can be isolated based on its hybridization
with a nucleic acid molecule encoding all or part of the
membrane-bound form. Likewise, a cDNA encoding a membrane-bound
form can be isolated based on its hybridization with a nucleic acid
molecule encoding all or part of the soluble form.
[0811] Accordingly, in another embodiment, an isolated nucleic acid
molecule of the invention is at least 15 (25, 40, 60, 80, 100, 150,
200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1000, 1200,
1400, 1600, 1800, 2000, 2200, 2400, 2600, 2800, 3000, 3500, 4000,
4500, 5000, or more) nucleotides in length and hybridizes under
stringent conditions to the nucleic acid molecule comprising the
nucleotide sequence, preferably the coding sequence, of any of SEQ
ID NOs: 1, 2, 31, 32, 51, 52, 71, 72, 81, 82, 91, 92, 96, 97, 101,
102, 106, 107, 111, 112, 121, 122, 141, 142, 151, 152, 161, 162,
171, 172, 181, 182, 191, 192, 201, 202, 215, 217, 221, 222, 241,
242, 251, 252, 271, 272, 279, 280, 303, 304, 308, 309, 324, 325,
329, 330, 351, 352, 362, 371, 372, 379, 380, 387, 388, 403, 404,
415, 416, 423, 424, 437, 438, and the nucleotide sequence of any of
the clones deposited as ATCC.RTM. Accession numbers 207184, 207219,
207220, 207221, 207228, 207230, PTA-147, PTA-150, PTA-151, PTA-295,
PTA-424, PTA-438, PTA-455, PTA-817, PTA-1156, and PTA-1764, or a
complement thereof. As used herein, the term "hybridizes under
stringent conditions" is intended to describe conditions for
hybridization and washing under which nucleotide sequences at least
60% (65%, 70%, preferably 75%) identical to each other typically
remain hybridized with each other. Such stringent conditions are
known to those skilled in the art and can be found in Current
Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989),
6.3.1-6.3.6. A example of stringent hybridization conditions are
hybridization in 6.times. sodium chloride/sodium citrate (SSC) at
about 45.degree. C., followed by one or more washes in
0.2.times.SSC, 0.1% SDS at 50-65.degree. C. Preferably, an isolated
nucleic acid molecule of the invention that hybridizes under
stringent conditions to the sequence of any of SEQ ID NOs: 1, 2,
31, 32, 51, 52, 71, 72, 81, 82, 91, 92, 96, 97, 101, 102, 106, 107,
111, 112, 121, 122, 141, 142, 151, 152, 161, 162, 171, 172, 181,
182, 191, 192, 201, 202, 215, 217, 221, 222, 241, 242, 251, 252,
271, 272, 279, 280, 303, 304, 308, 309, 324, 325, 329, 330, 351,
352, 362, 371, 372, 379, 380, 387, 388, 403, 404, 415, 416, 423,
424, 437, 438, and the nucleotide sequence of any of the clones
deposited as ATCC.RTM. Accession numbers 207184, 207219, 207220,
207221, 207228, 207230, PTA-147, PTA-150, PTA-151, PTA-295,
PTA-424, PTA-438, PTA-455, PTA-817, PTA-1156, and PTA-1764, or a
complement thereof, corresponds to a naturally-occurring nucleic
acid molecule. As used herein, a "naturally-occurring" nucleic acid
molecule refers to an RNA or DNA molecule having a nucleotide
sequence that occurs in nature (e.g., encodes a natural
protein).
[0812] In addition to naturally-occurring allelic variants of a
nucleic acid molecule of the invention sequence that can exist in
the population, the skilled artisan will further appreciate that
changes can be introduced by mutation thereby leading to changes in
the amino acid sequence of the encoded protein, without altering
the biological activity of the protein. For example, one can make
nucleotide substitutions leading to amino acid substitutions at
"non-essential" amino acid residues. A "non-essential" amino acid
residue is a residue that can be altered from the wild-type
sequence without altering the biological activity, whereas an
"essential" amino acid residue is required for biological activity.
For example, amino acid residues that are not conserved or only
semi-conserved among homologs of various species may be
non-essential for activity and thus would be likely targets for
alteration. Alternatively, amino acid residues that are conserved
among the homologs of various species (e.g., murine and human) may
be essential for activity and thus would not be likely targets for
alteration.
[0813] Accordingly, another aspect of the invention pertains to
nucleic acid molecules encoding a polypeptide of the invention that
contain changes in amino acid residues that are not essential for
activity. Such polypeptides differ in amino acid sequence from any
of SEQ ID NOs: 3-8, 33, 35, 38, 53-60, 73-78, 83-85, 93-95, 98-100,
103-105, 108-110, 113-115, 123-131, 143-145, 153-160, 163, 173-175,
183-185, 193-198, 203-214, 216, 223-236, 243-252, 253, 273-278,
281-302, 305-307, 310-315, 326-328, 331-333, 353-358, 363-368,
373-378, 381-386, 389-394, 405-414, 417-422, 425-436, and 439, yet
retain biological activity. In one embodiment, the isolated nucleic
acid molecule includes a nucleotide sequence encoding a protein
that includes an amino acid sequence that is at least about 40%
identical, 50%, 60%, 70%, 80%, 90%, 95%, or 98% identical to the
amino acid sequence of any of SEQ ID NOs: 3-8, 33, 35, 38, 53-60,
73-78, 83-85, 93-95, 98-100, 103-105, 108-110, 113-115, 123-131,
143-145, 153-160, 163, 173-175, 183-185, 193-198, 203-214, 216,
223-236, 243-252, 253, 273-278, 281-302, 305-307, 310-315, 326-328,
331-333, 353-358, 363-368, 373-378, 381-386, 389-394, 405-414,
417-422, 425-436, and 439, or the amino acid sequence encoded by
the nucleotide sequence of any of the clones deposited as
ATCC.RTM.Accession numbers 207184, 207219, 207220, 207221, 207228,
207230, PTA-147, PTA-150, PTA-151, PTA-295, PTA-424, PTA-438,
PTA-455, PTA-817, PTA-1156, and PTA-1764.
[0814] An isolated nucleic acid molecule encoding a variant protein
can be created by introducing one or more nucleotide substitutions,
additions or deletions into the nucleotide sequence of any of SEQ
ID NOs: 1, 2, 31, 32, 51, 52, 71, 72, 81, 82, 91, 92, 96, 97, 101,
102, 106, 107, 111, 112, 121, 122, 141, 142, 151, 152, 161, 162,
171, 172, 181, 182, 191, 192, 201, 202, 215, 217, 221, 222, 241,
242, 251, 252, 271, 272, 279, 280, 303, 304, 308, 309, 324, 325,
329, 330, 351, 352, 362, 371, 372, 379, 380, 387, 388, 403, 404,
415, 416, 423, 424, 437, 438, and the nucleotide sequence of any of
the clones deposited as ATCC.RTM. Accession numbers 207184, 207219,
207220, 207221, 207228, 207230, PTA-147, PTA-150, PTA-151, PTA-295,
PTA-424, PTA-438, PTA-455, PTA-817, PTA-1156, and PTA-1764, such
that one or more amino acid residue substitutions, additions or
deletions are introduced into the encoded protein. Mutations can be
introduced by standard techniques, such as site-directed
mutagenesis and PCR-mediated mutagenesis. Preferably, conservative
amino acid substitutions are made at one or more predicted
non-essential amino acid residues. A "conservative amino acid
substitution" is one in which the amino acid residue is replaced
with an amino acid residue having a similar side chain. Families of
amino acid residues having similar side chains have been defined in
the art. These families include amino acids with basic side chains
(e.g., lysine, arginine, histidine), acidic side chains (e.g.,
aspartic acid, glutamic acid), uncharged polar side chains (e.g.,
glycine, asparagine, glutamine, serine, threonine, tyrosine,
cysteine), non-polar side chains (e.g., alanine, valine, leucine,
isoleucine, proline, phenylalanine, methionine, tryptophan),
beta-branched side chains (e.g., threonine, valine, isoleucine) and
aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan,
histidine). Alternatively, mutations can be introduced randomly
along all or part of the coding sequence, such as by saturation
mutagenesis, and the resultant mutants can be screened for
biological activity to identify mutants that retain activity.
Following mutagenesis, the encoded protein can be expressed
recombinantly and the activity of the protein can be
determined.
[0815] In one embodiment, a mutant polypeptide that is a variant of
a polypeptide of the invention can be assayed for: (1) the ability
to form protein:protein interactions with a polypeptide of the
invention; (2) the ability to bind a ligand of a polypeptide of the
invention; (3) the ability to bind with a modulator or substrate of
a polypeptide of the invention; (4) the ability to modulate a
physiological activity of a polypeptide of the invention, such as
one of those disclosed herein; or (5) the ability to catalyze a
reaction catalyzed by a polypeptide of the invention.
[0816] The present invention encompasses antisense nucleic acid
molecules, i.e., molecules which are complementary to a sense
nucleic acid encoding a polypeptide of the invention, e.g.,
complementary to the coding strand of a double-stranded cDNA
molecule or complementary to an mRNA sequence. Accordingly, an
antisense nucleic acid can hydrogen bond to a sense nucleic acid.
The antisense nucleic acid can be complementary to an entire coding
strand, or to only a portion thereof, e.g., all or part of the
protein coding region (or open reading frame). An antisense nucleic
acid molecule can be antisense to all or part of a non-coding
region of the coding strand of a nucleotide sequence encoding a
polypeptide of the invention. The non-coding regions ("5' and 3'
non-translated regions") are the 5' and 3' sequences which flank
the coding region and are not translated into amino acids.
[0817] An antisense oligonucleotide can be, for example, about 5,
10, 15, 20, 25, 30, 35, 40, 45, or 50 or more nucleotides in
length. An antisense nucleic acid of the invention can be
constructed using chemical synthesis and enzymatic ligation
reactions using procedures known in the art. For example, an
antisense nucleic acid (e.g., an antisense oligonucleotide) can be
chemically synthesized using naturally occurring nucleotides or
variously modified nucleotides designed to increase the biological
stability of the molecules or to increase the physical stability of
the duplex formed between the antisense and sense nucleic acids,
e.g., phosphorothioate derivatives and acridine substituted
nucleotides can be used. Examples of modified nucleotides which can
be used to generate the antisense nucleic acid include
5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil,
hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl)
uracil, 5-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomethyluracil, dihydrouracil,
beta-D-galactosylqueosine, inosine, N.sub.6-isopentenyladenine,
1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-adenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil,
5-methoxyuracil, 2-methylthio-N6-isopentenyladenine,
uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine,
2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil,
5-methyluracil, uracil-5-oxyacetic acid methylester,
uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil,
3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and
2,6-diaminopurine. Alternatively, the antisense nucleic acid can be
produced biologically using an expression vector into which a
nucleic acid has been sub-cloned in an antisense orientation (i.e.,
RNA transcribed from the inserted nucleic acid will be of an
antisense orientation to a target nucleic acid of interest,
described further in the following subsection).
[0818] The antisense nucleic acid molecules of the invention are
typically administered to a subject or generated in situ such that
they hybridize with or bind with cellular mRNA and/or genomic DNA
encoding a selected polypeptide of the invention to thereby inhibit
expression, e.g., by inhibiting transcription and/or translation.
The hybridization can be by conventional nucleotide complementarity
to form a stable duplex, or, for example, in the case of an
antisense nucleic acid molecule which binds with DNA duplexes,
through specific interactions in the major groove of the double
helix. An example of a route of administration of antisense nucleic
acid molecules of the invention includes direct injection at a
tissue site. Alternatively, antisense nucleic acid molecules can be
modified to target selected cells and then administered
systemically. For example, for systemic administration, antisense
molecules can be modified such that they specifically bind with
receptors or antigens expressed on a selected cell surface, e.g.,
by linking the antisense nucleic acid molecules to peptides or
antibodies which bind with cell surface receptors or antigens. The
antisense nucleic acid molecules can also be delivered to cells
using the vectors described herein. To achieve sufficient
intracellular concentrations of the antisense molecules, vector
constructs in which the antisense nucleic acid molecule is placed
under the control of a strong pol II or pol III promoter are
preferred.
[0819] An antisense nucleic acid molecule of the invention can be
an .alpha.-anomeric nucleic acid molecule. An .alpha.-anomeric
nucleic acid molecule forms specific double-stranded hybrids with
complementary RNA in which the strands run parallel to each other
(Gaultier et al. (1987) Nucleic Acids Res. 15:6625-6641). The
antisense nucleic acid molecule can also comprise a
2'-o-methylribonucleotide (Inoue et al. (1987) Nucleic Acids Res.
15:6131-6148) or a chimeric RNA-DNA analogue (Inoue et al. (1987)
FEBS Lett. 215:327-330).
[0820] The invention also encompasses ribozymes. Ribozymes are
catalytic RNA molecules which are capable of cleaving a
single-stranded nucleic acid, such as an mRNA, to which they have a
complementary region. Thus, ribozymes (e.g., hammerhead ribozymes
as described in Haselhoff and Gerlach (1988) Nature 334:585-591)
can be used to catalytically cleave mRNA transcripts to thereby
inhibit translation of the protein encoded by the mRNA. A ribozyme
having specificity for a nucleic acid molecule encoding a
polypeptide of the invention can be designed based upon the
nucleotide sequence of a cDNA disclosed herein. For example, a
derivative of a Tetrahymena L-19 IVS RNA can be constructed in
which the nucleotide sequence of the ribozyme active site is
complementary to the nucleotide sequence to be cleaved, as
described in Cech et al. U.S. Pat. No. 4,987,071; and Cech et al.
U.S. Pat. No. 5,116,742. Alternatively, an mRNA encoding a
polypeptide of the invention can be used to select a catalytic RNA
having a specific ribonuclease activity from a pool of RNA
molecules. See, e.g., Bartel and Szostak (1993) Science
261:1411-1418.
[0821] The invention includes nucleic acid molecules which form
triple helical structures. For example, expression of a polypeptide
of the invention can be inhibited by targeting nucleotide sequences
complementary to the regulatory region of the gene encoding the
polypeptide (e.g., the promoter and/or enhancer) to form triple
helical structures that prevent transcription of the gene in target
cells. See generally Helene (1991) Anticancer Drug Des.
6(6):569-84; Helene (1992) Ann. N.Y. Acad. Sci. 660:27-36; and
Maher (1992) Bioassays 14(12):807-15. "Expression" of a
polypeptide, as used herein, refers individually and collectively
to the processes of transcription of DNA to generate an RNA
transcript and translation of an RNA to generate the
polypeptide.
[0822] In various embodiments, the nucleic acid molecules of the
invention can be modified at the base moiety, sugar moiety, or
phosphate backbone to improve, e.g., the stability, hybridization,
or solubility of the molecule. For example, the deoxyribose
phosphate backbone of the nucleic acids can be modified to generate
peptide nucleic acids (see Hyrup et al. (1996) Bioorganic &
Medicinal Chemistry 4(1): 5-23). As used herein, the terms "peptide
nucleic acids" or "PNAs" refer to nucleic acid mimics, e.g., DNA
mimics, in which the deoxyribose phosphate backbone is replaced by
a pseudopeptide backbone and only the four natural nucleobases are
retained. The neutral backbone of PNAs has been shown to allow
specific hybridization with DNA and RNA under conditions of low
ionic strength. Synthesis of PNA oligomers can be performed using
standard solid phase peptide synthesis protocols such as those
described in Hyrup et al. (1996), supra; Perry-O'Keefe et al.
(1996) Proc. Natl. Acad. Sci. USA 93: 14670-675.
[0823] PNAs can be used in therapeutic and diagnostic applications.
For example, PNAs can be used as antisense or anti-gene agents for
sequence-specific modulation of gene expression by, e.g., inducing
arrest of transcription or translation or by inhibiting
replication. PNAs can also be used, e.g., in the analysis of single
base pair mutations in a gene by, e.g., PNA directed PCR clamping;
as artificial restriction enzymes when used in combination with
other enzymes, e.g., S1 nucleases (Hyrup (1996), supra; or as
probes or primers for DNA sequence and hybridization (Hyrup (1996),
supra; Perry-O'Keefe et al. (1996) Proc. Natl. Acad. Sci. USA 93:
14670-675).
[0824] In another embodiment, PNAs can be modified, e.g., to
enhance their stability or cellular uptake, by attaching lipophilic
or other helper groups to PNA, by formation of PNA-DNA chimeras, or
by use of liposomes or other techniques of drug delivery known in
the art. For example, PNA-DNA chimeras can be generated which can
combine the advantageous properties of PNA and DNA. Such chimeras
allow DNA recognition enzymes, e.g., RNase H and DNA polymerases,
to interact with the DNA portion while the PNA portion provides
high binding affinity and specificity. PNA-DNA chimeras can be
linked using linkers of appropriate lengths selected in terms of
base stacking, number of bonds between the nucleobases, and
orientation (Hyrup (1996), supra). The synthesis of PNA-DNA
chimeras can be performed as described in Hyrup (1996), supra, and
Finn et al. (1996) Nucleic Acids Res. 24(17):3357-63. For example,
a DNA chain can be synthesized on a solid support using standard
phosphoramidite coupling chemistry and modified nucleoside analogs.
Compounds such as 5'-(4-methoxytrityl)amino-5'-deoxy-thymidine
phosphoramidite can be used as a link between the PNA and the 5'
end of DNA (Mag et al. (1989) Nucleic Acids Res. 17:5973-88). PNA
monomers are then coupled in a step-wise manner to produce a
chimeric molecule with a 5' PNA segment and a 3' DNA segment (Finn
et al. (1996) Nucleic Acids Res. 24(17):3357-63). Alternatively,
chimeric molecules can be synthesized with a 5' DNA segment and a
3' PNA segment (Peterser et al. (1975) Bioorganic Med. Chem. Lett.
5:1119-11124).
[0825] In other embodiments, the oligonucleotide can include other
appended groups such as peptides (e.g., for targeting host cell
receptors in vivo), or agents facilitating transport across the
cell membrane (see, e.g., Letsinger et al. (1989) Proc. Natl. Acad.
Sci. USA 86:6553-6556; Lemaitre et al. (1987) Proc. Natl. Acad.
Sci. USA 84:648-652; PCT Publication No. WO 88/09810) or the
blood-brain barrier (see, e.g., PCT Publication No. WO 89/10134).
In addition, oligonucleotides can be modified with
hybridization-triggered cleavage agents (see, e.g., Krol et al.
(1988) Bio/Techniques 6:958-976) or intercalating agents (see,
e.g., Zon (1988) Pharm. Res. 5:539-549). To this end, the
oligonucleotide can be conjugated with another molecule, e.g., a
peptide, hybridization triggered cross-linking agent, transport
agent, hybridization-triggered cleavage agent, etc.
II. Isolated Proteins and Antibodies
[0826] One aspect of the invention pertains to isolated proteins,
and biologically active portions thereof, as well as polypeptide
fragments suitable for use as immunogens to generate antibodies
directed against a polypeptide of the invention. In one embodiment,
the native polypeptide is isolated from cells or tissue sources by
an appropriate purification scheme using standard protein
purification techniques. In another embodiment, polypeptides of the
invention are produced by recombinant DNA techniques. As an
alternative to recombinant expression, a polypeptide of the
invention can be synthesized chemically using standard peptide
synthesis techniques.
[0827] An "isolated" or "purified" protein or biologically active
portion thereof is substantially free of cellular material or other
contaminating proteins from the cell or tissue source from which
the protein is derived, or substantially free of chemical
precursors or other chemicals, when chemically synthesized. The
language "substantially free of cellular material" includes
preparations of protein in which the protein is separated from
cellular components of the cells from which it is isolated or
recombinantly produced. Thus, protein that is substantially free of
cellular material includes preparations of protein having less than
about 30%, 20%, 10%, or 5% (by dry weight) of heterologous protein
(also referred to herein as a "contaminating protein"). When the
protein or biologically active portion thereof is recombinantly
produced, it is also preferably substantially free of culture
medium, i.e., culture medium represents less than about 20%, 10%,
or 5% of the volume of the protein preparation. When the protein is
produced by chemical synthesis, it is preferably substantially free
of chemical precursors or other chemicals, i.e., it is separated
from chemical precursors or other chemicals which are involved in
the synthesis of the protein. Accordingly such preparations of the
protein have less than about 30%, 20%, 10%, 5% (by dry weight) of
chemical precursors or compounds other than the polypeptide of
interest.
[0828] Biologically active portions of a polypeptide of the
invention include polypeptide regions having an amino acid sequence
sufficiently identical to or derived from the amino acid sequence
of the protein (e.g., the amino acid sequence shown in any of SEQ
ID NOs: 3-8, 33, 35, 38, 53-60, 73-78, 83-85, 93-95, 98-100,
103-105, 108-110, 113-115, 123-131, 143-145, 153-160, 163, 173-175,
183-185, 193-198, 203-214, 216, 223-236, 243-252, 253, 273-278,
281-302, 305-307, 310-315, 326-328, 331-333, 353-358, 363-368,
373-378, 381-386, 389-394, 405-414, 417-422, 425-436, and 439, or
the amino acid sequence encoded by the nucleotide sequence of any
of the clones deposited as ATCC.RTM. Accession numbers 207184,
207219, 207220, 207221, 207228, 207230, PTA-147, PTA-150, PTA-151,
PTA-295, PTA-424, PTA-438, PTA-455, PTA-817, PTA-1156, and
PTA-1764), which include fewer amino acids than the full length
protein, and exhibit at least one activity of the corresponding
full-length protein. Typically, biologically active portions
comprise a domain or motif with at least one activity of the
corresponding protein. A biologically active portion of a protein
of the invention can be a polypeptide which is, for example, 10,
25, 50, 100 or more amino acids in length. Moreover, other
biologically active portions, in which other regions of the protein
are deleted, can be prepared by recombinant techniques and
evaluated for one or more of the functional activities of the
native form of a polypeptide of the invention.
[0829] Examples of polypeptides have the amino acid sequence of any
of SEQ ID NOs: 3-8, 33, 35, 38, 53-60, 73-78, 83-85, 93-95, 98-100,
103-105, 108-110, 113-115, 123-131, 143-145, 153-160, 163, 173-175,
183-185, 193-198, 203-214, 216, 223-236, 243-252, 253, 273-278,
281-302, 305-307, 310-315, 326-328, 331-333, 353-358, 363-368,
373-378, 381-386, 389-394, 405-414, 417-422, 425-436, and 439 or
the amino acid sequence encoded by the nucleotide sequence of any
of the clones deposited as ATCC.RTM. Accession numbers 207184,
207219, 207220, 207221, 207228, 207230, PTA-147, PTA-150, PTA-151,
PTA-295, PTA-424, PTA-438, PTA-455, PTA-817, PTA-1156, and
PTA-1764. Other useful proteins are substantially identical (e.g.,
at least about 40%, preferably 50%, 60%, 70%, 80%, 90%, 95%, or
99%) to any of SEQ ID NOs: 3-8, 33, 35, 38, 53-60, 73-78, 83-85,
93-95, 98-100, 103-105, 108-110, 113-115, 123-131, 143-145,
153-160, 163, 173-175, 183-185, 193-198, 203-214, 216, 223-236,
243-252, 253, 273-278, 281-302, 305-307, 310-315, 326-328, 331-333,
353-358, 363-368, 373-378, 381-386, 389-394, 405-414, 417-422,
425-436, and 439 or the amino acid sequence encoded by the
nucleotide sequence of any of the clones deposited as ATCC.RTM.
Accession numbers 207184, 207219, 207220, 207221, 207228, 207230,
PTA-147, PTA-150, PTA-151, PTA-295, PTA-424, PTA-438, PTA-455,
PTA-817, PTA-1156, and PTA-1764 and retain the functional activity
of the protein of the corresponding naturally-occurring protein.
Such proteins can differ in amino acid sequence owing, for example,
to natural allelic variation or mutagenesis.
[0830] The invention also provides chimeric or fusion proteins. As
used herein, a "chimeric protein" or "fusion protein" comprises all
or part (preferably biologically active) of a polypeptide of the
invention operably linked with a heterologous polypeptide (i.e., a
polypeptide other than the same polypeptide of the invention).
Within the fusion protein, the term "operably linked" is intended
to indicate that the polypeptide of the invention and the
heterologous polypeptide are fused in-frame with each other. The
heterologous polypeptide can be fused with the amino-terminus or
the carboxyl-terminus of the polypeptide of the invention.
[0831] One useful fusion protein is a GST fusion protein in which
the polypeptide of the invention is fused with the carboxyl
terminus of GST sequences. Such fusion proteins can facilitate
purification of a recombinant polypeptide of the invention.
[0832] In another embodiment, the fusion protein contains a
heterologous signal sequence at its amino terminus. For example,
the native signal sequence of a polypeptide of the invention can be
removed and replaced with a signal sequence from another protein.
For example, the gp67 secretory sequence of the baculovirus
envelope protein can be used as a heterologous signal sequence
(Current Protocols in Molecular Biology, Ausubel et al., eds., John
Wiley & Sons, 1992). Other examples of eukaryotic heterologous
signal sequences include the secretory sequences of melittin and
human placental alkaline phosphatase (Stratagene; La Jolla,
Calif.). In yet another example, useful prokaryotic heterologous
signal sequences include the phoA secretory signal (Sambrook et
al., supra) and the protein A secretory signal (Pharmacia Biotech;
Piscataway, N.J.).
[0833] In yet another embodiment, the fusion protein is an
immunoglobulin fusion protein in which all or part of a polypeptide
of the invention is fused with sequences derived from a member of
the immunoglobulin protein family. The immunoglobulin fusion
proteins of the invention can be incorporated into pharmaceutical
compositions and administered to a subject to inhibit an
interaction between a ligand (soluble or membrane-bound) and a
protein on the surface of a cell (receptor), to thereby suppress
signal transduction in vivo. The immunoglobulin fusion protein can
be used to affect the bioavailability of a cognate ligand of a
polypeptide of the invention. Inhibition of ligand/receptor
interaction can be useful therapeutically, both for treating
proliferative and differentiative disorders and for modulating
(e.g., promoting or inhibiting) cell survival. Moreover, the
immunoglobulin fusion proteins of the invention can be used as
immunogens to produce antibodies directed against a polypeptide of
the invention in a subject, to purify ligands and in screening
assays to identify molecules which inhibit the interaction of
receptors with ligands. The immunoglobulin fusion protein can, for
example, comprise a portion of a polypeptide of the invention fused
with the amino-terminus or the carboxyl-terminus of an
immunoglobulin constant region, as disclosed in U.S. Pat. No.
5,714,147, U.S. Pat. No. 5,116,964, U.S. Pat. No. 5,514,582, and
U.S. Pat. No. 5,455,165.
[0834] Chimeric and fusion proteins of the invention can be
produced by standard recombinant DNA techniques. In another
embodiment, the fusion gene can be synthesized by conventional
techniques including automated DNA synthesizers. Alternatively, PCR
amplification of gene fragments can be performed using anchor
primers which give rise to complementary overhangs between two
consecutive gene fragments and which can subsequently be annealed
and re-amplified to generate a chimeric gene sequence (see, e.g.,
Ausubel et al., supra). Moreover, many expression vectors are
commercially available that already encode a fusion moiety (e.g., a
GST polypeptide). A nucleic acid encoding a polypeptide of the
invention can be cloned into such an expression vector such that
the fusion moiety is linked in-frame to the polypeptide of the
invention.
[0835] A signal sequence of a polypeptide of the invention (e.g.,
the signal sequence in any of SEQ ID NOs: 3, 33, 53, 73, 83, 93,
98, 103, 108, 113, 123, 143, 153, 163, 173, 183, 193, 203, 216,
223, 243, 253, 273, 281, 305, 310, 326, 331, 353, 363, 381, 389,
405, 417, 425, and 439) can be used to facilitate secretion and
isolation of the secreted protein or another protein of interest.
Signal sequences are typically characterized by a core of
hydrophobic amino acids which are generally cleaved from the mature
protein during secretion in one or more cleavage events. Such
signal peptides contain processing sites that allow cleavage of the
signal sequence from the mature proteins as they pass through the
secretory pathway. Thus, the invention pertains to the described
polypeptides having a signal sequence, as well as to the signal
sequence itself and to the polypeptide in the absence of the signal
sequence (i.e., the cleavage products). In one embodiment, a
nucleic acid sequence encoding a signal sequence of the invention
can be operably linked in an expression vector with a protein of
interest, such as a protein which is ordinarily not secreted or is
otherwise difficult to isolate. The signal sequence directs
secretion of the protein, such as from a eukaryotic host into which
the expression vector is transformed, and the signal sequence is
subsequently or concurrently cleaved. The protein can then be
readily purified from the extracellular medium by art recognized
methods. Alternatively, the signal sequence can be linked with the
protein of interest using a sequence which facilitates
purification, such as with a GST domain.
[0836] In another embodiment, the signal sequences of the present
invention can be used to identify regulatory sequences, e.g.,
promoters, enhancers, repressors. Since signal sequences are the
most amino-terminal sequences of a peptide, the nucleic acids which
flank the signal sequence on its amino-terminal side are likely
regulatory sequences which affect transcription. Thus, a nucleotide
sequence which encodes all or a portion of a signal sequence can be
used as a probe to identify and isolate signal sequences and their
flanking regions, and these flanking regions can be studied to
identify regulatory elements therein.
[0837] The present invention also pertains to variants of the
polypeptides of the invention. Such variants have an altered amino
acid sequence which can function as either agonists (mimetics) or
as antagonists. Variants can be generated by mutagenesis, e.g.,
discrete point mutation or truncation. An agonist can retain
substantially the same, or a subset, of the biological activities
of the naturally occurring form of the protein. An antagonist of a
protein can inhibit one or more of the activities of the naturally
occurring form of the protein by, for example, competitively
binding with a downstream or upstream member of a cellular
signaling cascade which includes the protein of interest. Thus,
specific biological effects can be elicited by treatment with a
variant of limited function. Treatment of a subject with a variant
having a subset of the biological activities of the naturally
occurring form of the protein can have fewer side effects in a
subject, relative to treatment with the naturally occurring form of
the protein.
[0838] Variants of a protein of the invention which function as
either agonists (e.g., mimetics) or as antagonists can be
identified by screening combinatorial libraries of mutants, e.g.,
truncation mutants, of the protein of the invention for agonist or
antagonist activity. In one embodiment, a variegated library of
variants is generated by combinatorial mutagenesis at the nucleic
acid level and is encoded by a variegated gene library. A
variegated library of variants can be produced by, for example,
enzymatically ligating a mixture of synthetic oligonucleotides into
gene sequences such that a degenerate set of potential protein
sequences can be expressed as individual polypeptides, or
alternatively, as a set of larger fusion proteins (e.g., for phage
display). There are a variety of methods which can be used to
produce libraries of potential variants of the polypeptides of the
invention from a degenerate oligonucleotide sequence. Methods for
synthesizing degenerate oligonucleotides are known in the art (see,
e.g., Narang (1983) Tetrahedron 39:3; Itakura et al. (1984) Annu.
Rev. Biochem. 53:323; Itakura et al. (1984) Science 198:1056; Ike
et al. (1983) Nucleic Acid Res. 11:477).
[0839] In addition, libraries of fragments of the coding sequence
of a polypeptide of the invention can be used to generate a
variegated population of polypeptides for screening and subsequent
selection of variants. For example, a library of coding sequence
fragments can be generated by treating a double stranded PCR
fragment of the coding sequence of interest with a nuclease under
conditions wherein nicking occurs only about once per molecule,
denaturing the double stranded DNA, re-naturing the DNA to form
double stranded DNA which can include sense/antisense pairs from
different nicked products, removing single stranded portions from
reformed duplexes by treatment with S1 nuclease, and ligating the
resulting fragment library into an expression vector. By this
method, an expression library can be derived which encodes amino
terminal and internal fragments of various sizes of the protein of
interest.
[0840] Several techniques are known in the art for screening gene
products of combinatorial libraries made by point mutations or
truncation, and for screening cDNA libraries for gene products
having a selected property. The most widely used techniques, which
are amenable to high through-put analysis, for screening large gene
libraries typically include cloning the gene library into
replicable expression vectors, transforming appropriate cells with
the resulting library of vectors, and expressing the combinatorial
genes under conditions in which detection of a desired activity
facilitates isolation of the vector encoding the gene whose product
was detected. Recursive ensemble mutagenesis (REM), a technique
which enhances the frequency of functional mutants in the
libraries, can be used in combination with the screening assays to
identify variants of a protein of the invention (Arkin and Yourvan
(1992) Proc. Natl. Acad. Sci. USA 89:7811-7815; Delgrave et al.
(1993) Protein Engineering 6(3):327-331).
[0841] An isolated polypeptide of the invention, or a fragment
thereof, can be used as an immunogen to generate antibodies using
standard techniques for polyclonal and monoclonal antibody
preparation. The full-length polypeptide or protein can be used or,
alternatively, the invention provides antigenic peptide fragments
for use as immunogens. The antigenic peptide of a protein of the
invention comprises at least 10 (preferably 12, 15, 20, or 30 or
more) amino acid residues of the amino acid sequence of any of SEQ
ID NOs: 3-8, 33, 35, 38, 53-60, 73-78, 83-85, 93-95, 98-100,
103-105, 108-110, 113-115, 123-131, 143-145, 153-160, 163, 173-175,
183-185, 193-198, 203-214, 216, 223-236, 243-252, 253, 273-278,
281-302, 305-307, 310-315, 326-328, 331-333, 353-358, 363-368,
373-378, 381-386, 389-394, 405-414, 417-422, 425-436, and 439 or
the amino acid sequence encoded by the nucleotide sequence of any
of the clones deposited as ATCC.RTM. Accession numbers 207184,
207219, 207220, 207221, 207228, 207230, PTA-147, PTA-150, PTA-151,
PTA-295, PTA-424, PTA-438, PTA-455, PTA-817, PTA-1156, and
PTA-1764, and encompasses an epitope of the protein such that an
antibody raised against the peptide forms a specific immune complex
with the protein.
[0842] Examples of epitopes encompassed by the antigenic peptide
are regions that are located on the surface of the protein, e.g.,
hydrophilic regions. FIGS. 1, 5, 7, 10A-10F, 12, 13, 18, 19, 20,
21, 27, 28, 29, 30, 36, 38, 40, 41, 44, 47, 48, 51, 56A-56B, 57,
62, 63, 67, and 69 are hydrophobicity plots of proteins of the
invention. These or similar analyses can be used to identify
hydrophilic regions.
[0843] An immunogen typically is used to prepare antibodies by
immunizing a suitable (i.e., immunocompetent) subject such as a
rabbit, goat, mouse, or other mammal or vertebrate. An appropriate
immunogenic preparation can contain, for example,
recombinantly-expressed or chemically-synthesized polypeptide. The
preparation can further include an adjuvant, such as Freund's
complete or incomplete adjuvant, or a similar immunostimulatory
agent.
[0844] Accordingly, another aspect of the invention pertains to
antibodies directed against a polypeptide of the invention. The
terms "antibody" and "antibody substance" as used interchangeably
herein refer to immunoglobulin molecules and immunologically active
portions of immunoglobulin molecules, i.e., molecules that contain
an antigen binding site which specifically binds an antigen, such
as a polypeptide of the invention. A molecule which specifically
binds with a given polypeptide of the invention is a molecule which
binds the polypeptide, but does not substantially bind other
molecules in a sample, e.g., a biological sample, which naturally
contains the polypeptide. Examples of immunologically active
portions of immunoglobulin molecules include F(ab) and F(ab').sub.2
fragments which can be generated by treating the antibody with an
enzyme such as pepsin. The invention provides polyclonal and
monoclonal antibodies. The term "monoclonal antibody" or
"monoclonal antibody composition", as used herein, refers to a
population of antibody molecules that contain only one species of
an antigen binding site capable of immunoreacting with a particular
epitope.
[0845] Polyclonal antibodies can be prepared as described above by
immunizing a suitable subject with a polypeptide of the invention
as an immunogen. The antibody titer in the immunized subject can be
monitored over time by standard techniques, such as with an enzyme
linked immunosorbent assay (ELISA) using immobilized polypeptide.
If desired, the antibody molecules can be harvested or isolated
from the subject (e.g., from the blood or serum of the subject) and
further purified by well-known techniques, such as protein A
chromatography to obtain the IgG fraction. At an appropriate time
after immunization, e.g., when the specific antibody titers are
highest, antibody-producing cells can be obtained from the subject
and used to prepare monoclonal antibodies by standard techniques,
such as the hybridoma technique originally described by Kohler and
Milstein (1975) Nature 256:495-497, the human B cell hybridoma
technique (Kozbor et al. (1983) Immunol. Today 4:72), the
EBV-hybridoma technique (Cole et al. (1985), Monoclonal Antibodies
and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96) or trioma
techniques. The technology for producing hybridomas is well known
(see generally Current Protocols in Immunology (1994) Coligan et
al. (Eds.) John Wiley & Sons, Inc., New York, N.Y.). Hybridoma
cells producing a monoclonal antibody of the invention are detected
by screening the hybridoma culture supernatants for antibodies that
bind the polypeptide of interest, e.g., using a standard ELISA
assay.
[0846] Alternative to preparing monoclonal antibody-secreting
hybridomas, a monoclonal antibody directed against a polypeptide of
the invention can be identified and isolated by screening a
recombinant combinatorial immunoglobulin library (e.g., an antibody
phage display library) with the polypeptide of interest. Kits for
generating and screening phage display libraries are commercially
available (e.g., the Pharmacia Recombinant Phage Antibody System,
Catalog No. 27-9400-01; and the Stratagene SurfZAP Phage Display
Kit, Catalog No. 240612). Additionally, examples of methods and
reagents particularly amenable for use in generating and screening
antibody display library can be found in, for example, U.S. Pat.
No. 5,223,409; PCT Publication No. WO 92/18619; PCT Publication No.
WO 91/17271; PCT Publication No. WO 92/20791; PCT Publication No.
WO 92/15679; PCT Publication No. WO 93/01288; PCT Publication No.
WO 92/01047; PCT Publication No. WO 92/09690; PCT Publication No.
WO 90/02809; Fuchs et al. (1991) Bio/Technology 9:1370-1372; Hay et
al. (1992) Hum. Antibod. Hybridomas 3:81-85; Huse et al. (1989)
Science 246:1275-1281; Griffiths et al. (1993) EMBO J.
12:725-734.
[0847] Recombinant antibodies, such as chimeric and humanized
monoclonal antibodies, comprising both human and non-human
portions, which can be made using standard recombinant DNA
techniques, are within the scope of the invention. Such chimeric
and humanized monoclonal antibodies can be produced by recombinant
DNA techniques known in the art, for example using methods
described in PCT Publication No. WO 87/02671; European Patent
Application 184,187; European Patent Application 171,496; European
Patent Application 173,494; PCT Publication No. WO 86/01533; U.S.
Pat. No. 4,816,567; European Patent Application 125,023; Better et
al. (1988) Science 240:1041-1043; Liu et al. (1987) Proc. Natl.
Acad. Sci. USA 84:3439-3443; Liu et al. (1987) J. Immunol.
139:3521-3526; Sun et al. (1987) Proc. Natl. Acad. Sci. USA
84:214-218; Nishimura et al. (1987) Cancer Res. 47:999-1005; Wood
et al. (1985) Nature 314:446-449; and Shaw et al. (1988) J. Natl.
Cancer Inst. 80:1553-1559); Morrison (1985) Science 229:1202-1207;
Oi et al. (1986) Bio/Techniques 4:214; U.S. Pat. No. 5,225,539;
Jones et al. (1986) Nature 321:552-525; Verhoeyan et al. (1988)
Science 239:1534; and Beidler et al. (1988) J. Immunol.
141:4053-4060.
[0848] Completely human antibodies are particularly desirable for
therapeutic treatment of human patients. Such antibodies can be
produced using transgenic mice which are incapable of expressing
endogenous immunoglobulin heavy and light chains genes, but which
can express human heavy and light chain genes. The transgenic mice
are immunized in the normal fashion with a selected antigen, e.g.,
all or a portion of a polypeptide of the invention. Monoclonal
antibodies directed against the antigen can be obtained using
conventional hybridoma technology. The human immunoglobulin
transgenes harbored by the transgenic mice rearrange during B cell
differentiation, and subsequently undergo class switching and
somatic mutation. Thus, using such a technique, it is possible to
produce therapeutically useful IgG, IgA, and IgE antibodies. For an
overview of this technology for producing human antibodies, see
Lonberg and Huszar (1995, Int. Rev. Immunol. 13:65-93). For a
detailed discussion of this technology for producing human
antibodies and human monoclonal antibodies and protocols for
producing such antibodies, see, e.g., U.S. Pat. No. 5,625,126; U.S.
Pat. No. 5,633,425; U.S. Pat. No. 5,569,825; U.S. Pat. No.
5,661,016; and U.S. Pat. No. 5,545,806. In addition, companies such
as Abgenix, Inc. (Freemont, Calif.), can be engaged to provide
human antibodies directed against a selected antigen using
technology similar to that described above.
[0849] Completely human antibodies which recognize a selected
epitope can be generated using a technique referred to as "guided
selection." In this approach a selected non-human monoclonal
antibody, e.g., a murine antibody, is used to guide the selection
of a completely human antibody recognizing the same epitope
(Jespers et al. (1994) Bio/technology 12:899-903).
[0850] An antibody directed against a polypeptide of the invention
(e.g., monoclonal antibody) can be used to isolate the polypeptide
by standard techniques, such as affinity chromatography or
immunoprecipitation. Moreover, such an antibody can be used to
detect the protein (e.g., in a cellular lysate or cell supernatant)
in order to evaluate the abundance and pattern of expression of the
polypeptide. The antibodies can also be used diagnostically to
monitor protein levels in tissue as part of a clinical testing
procedure, e.g., to, for example, determine the efficacy of a given
treatment regimen. Detection can be facilitated by coupling the
antibody to a detectable substance. Examples of detectable
substances include various enzymes, prosthetic groups, fluorescent
materials, luminescent materials, bioluminescent materials, and
radioactive materials. Examples of suitable enzymes include
horseradish peroxidase, alkaline phosphatase, .beta.-galactosidase,
or acetylcholinesterase; examples of suitable prosthetic group
complexes include streptavidin/biotin and avidin/biotin; examples
of suitable fluorescent materials include umbelliferone,
fluorescein, fluorescein isothiocyanate, rhodamine,
dichlorotriazinylamine fluorescein, dansyl chloride or
phycoerythrin; an example of a luminescent material includes
luminol; examples of bioluminescent materials include luciferase,
luciferin, and aequorin, and examples of suitable radioactive
material include .sup.125I, .sup.131I, .sup.35S or .sup.3H.
[0851] An antibody (or fragment thereof) can be conjugated to a
therapeutic moiety such as a cytotoxin, a therapeutic agent, or a
radioactive agent (e.g., a radioactive metal ion). Cytotoxins and
cytotoxic agents include any agent that is detrimental to cells.
Examples of such agents include taxol, cytochalasin B, gramicidin
D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide,
vincristine, vinblastine, colchicin, doxorubicin, daunorubicin,
dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin
D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine,
lidocaine, propranolol, and puromycin and analogs or homologs
thereof. Therapeutic agents include, but are not limited to,
antimetabolites (e.g., methotrexate, 6-mercaptopurine,
6-thioguanine, cytarabine, and 5-fluorouracil decarbazine),
alkylating agents (e.g., mechlorethamine, thioepa chlorambucil,
melphalan, carmustine (BSNU) and lomustine (CCNU),
cyclothosphamide, busulfan, dibromomannitol, streptozotocin,
mitomycin C, and cis-dichlorodiamine platinum (II) (DDP)
cisplatin), anthracyclines (e.g., daunorubicin {formerly designated
daunomycin} and doxorubicin), antibiotics (e.g., dactinomycin
{formerly designated actinomycin}, bleomycin, mithramycin, and
anthramycin), and anti-mitotic agents (e.g., vincristine and
vinblastine).
[0852] Conjugated antibodies of the invention can be used for
modifying a given biological response, the drug moiety not being
limited to classical chemical therapeutic agents. For example, the
drug moiety can be a protein or polypeptide possessing a desired
biological activity. Such proteins include, for example, toxins
such as abrin, ricin A, Pseudomonas exotoxin, or diphtheria toxin;
proteins such as tumor necrosis factor, alpha-interferon,
beta-interferon, nerve growth factor, platelet derived growth
factor, tissue plasminogen activator; and biological response
modifiers such as lymphokines, interleukin-1, interleukin-2,
interleukin-6, granulocyte macrophage colony stimulating factor,
granulocyte colony stimulating factor, or other growth factors.
[0853] Techniques for conjugating a therapeutic moiety to an
antibody are well known (see, e.g., Arnon et al., 1985, "Monoclonal
Antibodies For Immunotargeting Of Drugs In Cancer Therapy", in
Monoclonal Antibodies And Cancer Therapy, Reisfeld et al., Eds.,
Alan R. Liss, Inc. pp. 243-256; Hellstrom et al., 1987, "Antibodies
For Drug Delivery", in Controlled Drug Delivery, 2nd ed., Robinson
et al., Eds., Marcel Dekker, Inc., pp. 623-653; Thorpe, 1985,
"Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A
Review", in Monoclonal Antibodies '84: Biological And Clinical
Applications, Pinchera et al., Eds., pp. 475-506; "Analysis,
Results, And Future Prospective Of The Therapeutic Use Of
Radiolabeled Antibody In Cancer Therapy", in Monoclonal Antibodies
For Cancer Detection And Therapy, Baldwin et al., Eds., Academic
Press, pp. 303-316, 1985; and Thorpe et al., 1982, Immunol Rev.,
62:119-158). Alternatively, an antibody can be conjugated to a
second antibody to form an antibody heteroconjugate as described by
Segal in U.S. Pat. No. 4,676,980.
III. Recombinant Expression Vectors and Host Cells
[0854] Another aspect of the invention pertains to vectors,
including expression vectors, containing a nucleic acid encoding a
polypeptide of the invention (or a portion thereof). As used
herein, the term "vector" refers to a nucleic acid molecule capable
of transporting another nucleic acid to which it has been linked.
One type of vector is a "plasmid", which refers to a circular
double stranded DNA loop into which additional DNA segments can be
ligated. Another type of vector is a viral vector, wherein
additional DNA segments can be ligated into the viral genome.
Certain vectors are capable of autonomous replication in a host
cell into which they are introduced (e.g., bacterial vectors having
a bacterial origin of replication and episomal mammalian vectors).
Other vectors (e.g., non-episomal mammalian vectors) are integrated
into the genome of a host cell upon introduction into the host
cell, and thereby are replicated along with the host genome.
Moreover, certain vectors, designated expression vectors, are
capable of directing expression of genes with which they are
operably linked. In general, expression vectors of utility in
recombinant DNA techniques are often in the form of plasmids
(vectors). However, the invention is intended to include such other
forms of expression vectors, such as viral vectors (e.g.,
replication defective retroviruses, adenoviruses and
adeno-associated viruses), which serve equivalent functions.
[0855] The recombinant expression vectors of the invention comprise
a nucleic acid of the invention in a form suitable for expression
of the nucleic acid in a host cell. This means that the recombinant
expression vectors include one or more regulatory sequences,
selected on the basis of the host cells to be used for expression,
which is operably linked with the nucleic acid sequence to be
expressed. Within a recombinant expression vector, "operably
linked" is intended to mean that the nucleotide sequence of
interest is linked with the regulatory sequence(s) in a manner
which allows expression of the nucleotide sequence (e.g., in an in
vitro transcription/translation system or in a host cell when the
vector is introduced into the host cell). The term "regulatory
sequence" is intended to include promoters, enhancers and other
expression control elements (e.g., polyadenylation signals). Such
regulatory sequences are described, for example, in Goeddel, Gene
Expression Technology: Methods in Enzymology 185, Academic Press,
San Diego, Calif. (1990). Regulatory sequences include those which
direct constitutive expression of a nucleotide sequence in many
types of host cell and those which direct expression of the
nucleotide sequence only in certain host cells (e.g.,
tissue-specific regulatory sequences). It will be appreciated by
those skilled in the art that the design of the expression vector
can depend on such factors as the choice of the host cell to be
transformed, and the level of expression of protein desired. The
expression vectors of the invention can be introduced into host
cells to thereby produce proteins or peptides, including fusion
proteins or peptides, encoded by nucleic acids as described
herein.
[0856] The recombinant expression vectors of the invention can be
designed for expression of a polypeptide of the invention in
prokaryotic (e.g., E. coli) or eukaryotic cells (e.g., insect cells
(using baculovirus expression vectors), yeast cells or mammalian
cells). Suitable host cells are discussed further in Goeddel,
supra. Alternatively, the recombinant expression vector can be
transcribed and translated in vitro, for example using T7 promoter
regulatory sequences and T7 polymerase.
[0857] Expression of proteins in prokaryotes is most often carried
out in E. coli with vectors containing constitutive or inducible
promoters directing the expression of either fusion or non-fusion
proteins. Fusion vectors add a number of amino acids to a protein
encoded therein, usually to the amino terminus of the recombinant
protein. Such fusion vectors typically serve three purposes: 1) to
increase expression of recombinant protein; 2) to increase the
solubility of the recombinant protein; and 3) to aid in the
purification of the recombinant protein by acting as a ligand in
affinity purification. Often, in fusion expression vectors, a
proteolytic cleavage site is introduced at the junction of the
fusion moiety and the recombinant protein to enable separation of
the recombinant protein from the fusion moiety subsequent to
purification of the fusion protein. Such enzymes, and their cognate
recognition sequences, include Factor Xa, thrombin and
enterokinase. Typical fusion expression vectors include pGEX
(Pharmacia Biotech Inc; Smith and Johnson (1988) Gene 67:31-40),
pMAL (New England Biolabs, Beverly, Mass.) and pRIT5 (Pharmacia,
Piscataway, N.J.) which fuse glutathione S-transferase (GST),
maltose E binding protein, or protein A, respectively, to the
target recombinant protein.
[0858] Examples of suitable inducible non-fusion E. coli expression
vectors include pTrc (Amann et al., (1988) Gene 69:301-315) and pET
11d (Studier et al., Gene Expression Technology: Methods in
Enzymology 185, Academic Press, San Diego, Calif. (1990) 60-89).
Target gene expression from the pTrc vector relies on host RNA
polymerase transcription from a hybrid trp-lac fusion promoter.
Target gene expression from the pET 11d vector relies on
transcription from a T7 gn10-lac fusion promoter mediated by a
co-expressed viral RNA polymerase (T7 gn1). This viral polymerase
is supplied by host strains BL21(DE3) or HMS174(DE3) from a
resident .lamda. prophage harboring a T7 gn1 gene under the
transcriptional control of the lacUV 5 promoter.
[0859] One strategy to maximize recombinant protein expression in
E. coli is to express the protein in a host bacteria having an
impaired capacity to proteolytically cleave the recombinant protein
(Gottesman, Gene Expression Technology: Methods in Enzymology 185,
Academic Press, San Diego, Calif. (1990) 119-128). Another strategy
is to alter the nucleic acid sequence of the nucleic acid to be
inserted into an expression vector such that the individual codons
for each amino acid are those preferentially used in E. coli (Wada
et al. (1992) Nucleic Acids Res. 20:2111-2118). Such alteration of
nucleic acid sequences of the invention can be performed by
standard DNA synthesis techniques.
[0860] In another embodiment, the expression vector is a yeast
expression vector. Examples of vectors for expression in yeast S.
cerevisiae include pYepSec1 (Baldari et al. (1987) EMBO J.
6:229-234), pMFa (Kurjan and Herskowitz, (1982) Cell 30:933-943),
pJRY88 (Schultz et al. (1987) Gene 54:113-123), pYES2 (Invitrogen
Corporation, San Diego, Calif.), and pPicZ (Invitrogen Corp, San
Diego, Calif.).
[0861] Alternatively, the expression vector is a baculovirus
expression vector. Baculovirus vectors available for expression of
proteins in cultured insect cells (e.g., Sf 9 cells) include the
pAc series (Smith et al. (1983) Mol. Cell. Biol. 3:2156-2165) and
the pVL series (Lucklow and Summers (1989) Virology 170:31-39).
[0862] In yet another embodiment, a nucleic acid of the invention
is expressed in mammalian cells using a mammalian expression
vector. Examples of mammalian expression vectors include pCDM8
(Seed (1987) Nature 329:840) and pMT2PC (Kaufman et al. (1987) EMBO
J. 6:187-195). When used in mammalian cells, the expression
vector's control functions are often provided by viral regulatory
elements. For example, commonly used promoters are derived from
polyoma, Adenovirus 2, cytomegalovirus and Simian Virus 40. For
other suitable expression systems for both prokaryotic and
eukaryotic cells see chapters 16 and 17 of Sambrook et al.,
supra.
[0863] In another embodiment, the recombinant mammalian expression
vector is capable of directing expression of the nucleic acid
preferentially in a particular cell type (e.g., tissue-specific
regulatory elements are used to express the nucleic acid).
Tissue-specific regulatory elements are known in the art.
Non-limiting examples of suitable tissue-specific promoters include
the albumin promoter (liver-specific; Pinkert et al. (1987) Genes
Dev. 1:268-277), lymphoid-specific promoters (Calame and Eaton
(1988) Adv. Immunol. 43:235-275), in particular promoters of T cell
receptors (Winoto and Baltimore (1989) EMBO J. 8:729-733) and
immunoglobulins (Banerji et al. (1983) Cell 33:729-740; Queen and
Baltimore (1983) Cell 33:741-748), neuron-specific promoters (e.g.,
the neurofilament promoter; Byrne and Ruddle (1989) Proc. Natl.
Acad. Sci. USA 86:5473-5477), pancreas-specific promoters (Edlund
et al. (1985) Science 230:912-916), and mammary gland-specific
promoters (e.g., milk whey promoter; U.S. Pat. No. 4,873,316 and
European Application Publication No. 264,166).
Developmentally-regulated promoters are also encompassed, for
example the murine hox promoters (Kessel and Gruss (1990) Science
249:374-379) and the .alpha.-fetoprotein promoter (Campes and
Tilghman (1989) Genes Dev. 3:537-546).
[0864] The invention further provides a recombinant expression
vector comprising a DNA molecule of the invention cloned into the
expression vector in an antisense orientation. That is, the DNA
molecule is operably linked with a regulatory sequence in a manner
which allows for expression (by transcription of the DNA molecule)
of an RNA molecule which is antisense, relative to the mRNA
encoding a polypeptide of the invention. Regulatory sequences
operably linked with a nucleic acid cloned in the antisense
orientation can be selected which direct continuous expression of
the antisense RNA molecule in a variety of cell types, for instance
viral promoters and/or enhancers, or regulatory sequences can be
selected which direct constitutive, tissue specific, or cell type
specific expression of antisense RNA. The antisense expression
vector can be in the form of a recombinant plasmid, phagemid, or
attenuated virus in which antisense nucleic acids are produced
under the control of a high efficiency regulatory region, the
activity of which can be determined by the cell type into which the
vector is introduced. For a discussion of the regulation of gene
expression using antisense genes see Weintraub et al.
(Reviews--Trends in Genetics, Vol. 1(1) 1986).
[0865] Another aspect of the invention pertains to host cells into
which a recombinant expression vector of the invention has been
introduced. The terms "host cell" and "recombinant host cell" are
used interchangeably herein. It is understood that such terms refer
not only to the particular subject cell but to the progeny or
potential progeny of such a cell. Because certain modifications can
occur in succeeding generations due to either mutation or
environmental influences, such progeny may not, in fact, be
identical to the parent cell, but are still included within the
scope of the term as used herein.
[0866] A host cell can be any prokaryotic (e.g., E. coli) or
eukaryotic cell (e.g., insect cells, yeast or mammalian cells).
[0867] Vector DNA can be introduced into prokaryotic or eukaryotic
cells via conventional transformation or transfection techniques.
As used herein, the terms "transformation" and "transfection" are
intended to refer to a variety of art-recognized techniques for
introducing foreign nucleic acid into a host cell, including
calcium phosphate or calcium chloride co-precipitation,
DEAE-dextran-mediated transfection, lipofection, and
electroporation. Suitable methods for transforming or transfecting
host cells can be found in Sambrook, et al. (supra), and other
laboratory manuals.
[0868] For stable transfection of mammalian cells, it is known
that, depending upon the expression vector and transfection
technique used, only a small fraction of cells integrate the
foreign DNA into their genome. In order to identify and select
these integrants, a gene that encodes a selectable marker (e.g.,
for resistance to antibiotics) can be introduced into the host
cells along with the gene of interest. Examples of selectable
markers include those which confer resistance to drugs, such as
G418, hygromycin and methotrexate. Cells stably transfected with
the introduced nucleic acid can be identified by drug selection
(e.g., cells that have incorporated the selectable marker gene
survive, while other cells die).
[0869] A host cell of the invention, such as a prokaryotic or
eukaryotic host cell in culture, can be used to produce a
polypeptide of the invention. Accordingly, the invention further
provides methods for producing a polypeptide of the invention using
the host cells of the invention. In one embodiment, the method
comprises culturing the host cell of invention (into which a
recombinant expression vector encoding a polypeptide of the
invention has been introduced) in a suitable medium such that the
polypeptide is produced. In another embodiment, the method further
comprises isolating the polypeptide from the medium or the host
cell.
[0870] The host cells of the invention can be used to produce
non-human transgenic animals. For example, in one embodiment, a
host cell of the invention is a fertilized oocyte or an embryonic
stem cell into which a sequences encoding a polypeptide of the
invention have been introduced. Such host cells can then be used to
create non-human transgenic animals in which exogenous sequences
encoding a polypeptide of the invention have been introduced into
their genome or homologous recombinant animals in which endogenous
encoding a polypeptide of the invention sequences have been
altered. Such animals are useful for studying the function and/or
activity of the polypeptide and for identifying and/or evaluating
modulators of polypeptide activity. As used herein, a "transgenic
animal" is a non-human animal, preferably a mammal, more preferably
a rodent such as a rat or mouse, in which one or more of the cells
of the animal includes a transgene. Other examples of transgenic
animals include non-human primates, sheep, dogs, cows, goats,
chickens, amphibians, etc. A transgene is exogenous DNA which is
integrated into the genome of a cell from which a transgenic animal
develops and which remains in the genome of the mature animal,
thereby directing expression of an encoded gene product in one or
more cell types or tissues of the transgenic animal. As used
herein, an "homologous recombinant animal" is a non-human animal,
preferably a mammal, more preferably a mouse, in which an
endogenous gene has been altered by homologous recombination
between the endogenous gene and an exogenous DNA molecule
introduced into a cell of the animal, e.g., an embryonic cell of
the animal, prior to development of the animal.
[0871] A transgenic animal of the invention can be created by
introducing a nucleic acid encoding a polypeptide of the invention
(or a homologue thereof) into the male pronuclei of a fertilized
oocyte (e.g., by microinjection or retroviral infection) and
allowing the oocyte to develop in a pseudopregnant female foster
animal. Intronic sequences and polyadenylation signals can also be
included in the transgene to increase the efficiency of expression
of the transgene. A tissue-specific regulatory sequence(s) can be
operably linked with the transgene to direct expression of a
polypeptide of the invention to particular cells. Methods for
generating transgenic animals via embryo manipulation and
microinjection, particularly animals such as mice, have become
conventional in the art and are described, for example, in U.S.
Pat. Nos. 4,736,866 and 4,870,009, U.S. Pat. No. 4,873,191 and in
Hogan, Manipulating the Mouse Embryo, (Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., 1986). Similar methods
are used for production of other transgenic animals. A transgenic
founder animal can be identified based upon the presence of the
transgene in its genome and/or expression of mRNA encoding the
transgene in tissues or cells of the animals. A transgenic founder
animal can be used to breed additional animals carrying the
transgene. Moreover, transgenic animals harboring the transgene can
further be bred to other transgenic animals harboring other
transgenes.
[0872] To create an homologous recombinant animal, a vector is
prepared which contains at least a portion of a gene encoding a
polypeptide of the invention into which a deletion, addition or
substitution has been introduced to thereby alter, e.g.,
functionally disrupt, the gene. In one embodiment, the vector is
designed such that, upon homologous recombination, the endogenous
gene is functionally disrupted (i.e., no longer encodes a
functional protein; also referred to as a "knock out" vector).
Alternatively, the vector can be designed such that, upon
homologous recombination, the endogenous gene is mutated or
otherwise altered, but still encodes functional protein (e.g., the
upstream regulatory region can be altered to thereby alter the
expression of the endogenous protein). In the homologous
recombination vector, the altered portion of the gene is flanked at
its 5' and 3' ends by additional nucleic acid of the gene to allow
for homologous recombination to occur between the exogenous gene
carried by the vector and an endogenous gene in an embryonic stem
cell. The additional flanking nucleic acid sequences are of
sufficient length for successful homologous recombination with the
endogenous gene. Typically, several kilobases of flanking DNA (both
at the 5' and 3' ends) are included in the vector (see, e.g.,
Thomas and Capecchi (1987) Cell 51:503 for a description of
homologous recombination vectors). The vector is introduced into an
embryonic stem cell line (e.g., by electroporation) and cells in
which the introduced gene has homologously recombined with the
endogenous gene are selected (see, e.g., Li et al. (1992) Cell
69:915). The selected cells are then injected into a blastocyst of
an animal (e.g., a mouse) to form aggregation chimeras (see, e.g.,
Bradley in Teratocarcinomas and Embryonic Stem Cells: A Practical
Approach, Robertson, ed. (IRL, Oxford, 1987) pp. 113-152). A
chimeric embryo can then be implanted into a suitable
pseudopregnant female foster animal and the embryo brought to term.
Progeny harboring the homologously recombined DNA in their germ
cells can be used to breed animals in which all cells of the animal
contain the homologously recombined DNA by germline transmission of
the transgene. Methods for constructing homologous recombination
vectors and homologous recombinant animals are described further in
Bradley (1991) Current Opinion in Bio/Technology 2:823-829 and in
PCT Publication Numbers WO 90/11354, WO 91/01140, WO 92/0968, and
WO 93/04169.
[0873] In another embodiment, transgenic non-human animals can be
produced which contain selected systems which allow for regulated
expression of the transgene. One example of such a system is the
cre/loxP recombinase system of bacteriophage P1. For a description
of the cre/loxP recombinase System, see, e.g., Lakso et al. (1992)
Proc. Natl. Acad. Sci. USA 89:6232-6236. Another example of a
recombinase system is the FLP recombinase system of Saccharomyces
cerevisiae (O'Gorman et al. (1991) Science 251:1351-1355. If a
cre/loxP recombinase system is used to regulate expression of the
transgene, animals containing transgenes encoding both the Cre
recombinase and a selected protein are required. Such animals can
be provided through the construction of "double" transgenic
animals, e.g., by mating two transgenic animals, one containing a
transgene encoding a selected protein and the other containing a
transgene encoding a recombinase.
[0874] Clones of the non-human transgenic animals described herein
can be produced according to the methods described in Wilmut et al.
(1997) Nature 385:810-813 and PCT Publication Numbers WO 97/07668
and WO 97/07669.
IV. Pharmaceutical Compositions
[0875] The nucleic acid molecules, polypeptides, and antibodies
(also referred to herein as "active compounds") of the invention
can be incorporated into pharmaceutical compositions suitable for
administration. Such compositions typically comprise the nucleic
acid molecule, protein, or antibody and a pharmaceutically
acceptable carrier. As used herein the language "pharmaceutically
acceptable carrier" is intended to include any and all solvents,
dispersion media, coatings, anti-bacterial and anti-fungal agents,
isotonic and absorption delaying agents, and the like, compatible
with pharmaceutical administration. The use of such media and
agents for pharmaceutically active substances is well known in the
art. Except insofar as any conventional media or agent is
incompatible with the active compound, use thereof in the
compositions is contemplated. Supplementary active compounds can
also be incorporated into the compositions.
[0876] The invention includes methods for preparing pharmaceutical
compositions for modulating the expression or activity of a
polypeptide or nucleic acid of the invention. Such methods comprise
formulating a pharmaceutically acceptable carrier with an agent
which modulates expression or activity of a polypeptide or nucleic
acid of the invention. Such compositions can further include
additional active agents. Thus, the invention further includes
methods for preparing a pharmaceutical composition by formulating a
pharmaceutically acceptable carrier with an agent which modulates
expression or activity of a polypeptide or nucleic acid of the
invention and one or more additional active compounds.
[0877] The agent which modulates expression or activity can, for
example, be a small molecule. For example, such small molecules
include peptides, peptidomimetics, amino acids, amino acid analogs,
polynucleotides, polynucleotide analogs, nucleotides, nucleotide
analogs, organic or inorganic compounds (i.e., including
heteroorganic and organometallic compounds) having a molecular
weight less than about 10,000 grams per mole, organic or inorganic
compounds having a molecular weight less than about 5,000 grams per
mole, organic or inorganic compounds having a molecular weight less
than about 1,000 grams per mole, organic or inorganic compounds
having a molecular weight less than about 500 grams per mole, and
salts, esters, and other pharmaceutically acceptable forms of such
compounds.
[0878] It is understood that appropriate doses of small molecule
agents and protein or polypeptide agents depends upon a number of
factors within the ken of the ordinarily skilled physician,
veterinarian, or researcher. The dose(s) of these agents will vary,
for example, depending upon the identity, size, and condition of
the subject or sample being treated, further depending upon the
route by which the composition is to be administered, if
applicable, and the effect which the practitioner desires the agent
to have upon the nucleic acid or polypeptide of the invention.
Examples of doses of a small molecule include milligram or
microgram amounts per kilogram of subject or sample weight (e.g.,
about 1 microgram per kilogram to about 500 milligrams per
kilogram, about 100 micrograms per kilogram to about 5 milligrams
per kilogram, or about 1 microgram per kilogram to about 50
micrograms per kilogram). Examples of doses of a protein or
polypeptide include gram, milligram or microgram amounts per
kilogram of subject or sample weight (e.g., about 1 microgram per
kilogram to about 5 grams per kilogram, about 100 micrograms per
kilogram to about 500 milligrams per kilogram, or about 1 milligram
per kilogram to about 50 milligrams per kilogram). For antibodies,
examples of dosages are from about 0.1 milligram per kilogram to
100 milligrams per kilogram of body weight (generally 10 milligrams
per kilogram to 20 milligrams per kilogram). If the antibody is to
act in the brain, a dosage of 50 milligrams per kilogram to 100
milligrams per kilogram is usually appropriate. It is furthermore
understood that appropriate doses of one of these agents depend
upon the potency of the agent with respect to the expression or
activity to be modulated. Such appropriate doses can be determined
using the assays described herein. When one or more of these agents
is to be administered to an animal (e.g., a human) in order to
modulate expression or activity of a polypeptide or nucleic acid of
the invention, a physician, veterinarian, or researcher can, for
example, prescribe a relatively low dose at first, subsequently
increasing the dose until an appropriate response is obtained. In
addition, it is understood that the specific dose level for any
particular animal subject will depend upon a variety of factors
including the activity of the specific agent employed, the age,
body weight, general health, gender, and diet of the subject, the
time of administration, the route of administration, the rate of
excretion, any drug combination, and the degree of expression or
activity to be modulated.
[0879] A pharmaceutical composition of the invention is formulated
to be compatible with its intended route of administration.
Examples of routes of administration include parenteral, e.g.,
intravenous, intradermal, subcutaneous, oral (e.g., inhalation),
transdermal (topical), transmucosal, and rectal administration.
Solutions or suspensions used for parenteral, intradermal, or
subcutaneous application can include the following components: a
sterile diluent such as water for injection, saline solution, fixed
oils, polyethylene glycols, glycerine, propylene glycol or other
synthetic solvents; antibacterial agents such as benzyl alcohol or
methyl parabens; antioxidants such as ascorbic acid or sodium
bisulfite; chelating agents such as ethylenediamine-tetraacetic
acid; buffers such as acetates, citrates or phosphates; and agents
for the adjustment of tonicity such as sodium chloride or dextrose.
pH can be adjusted using acids or bases, such as hydrochloric acid
or sodium hydroxide. The parenteral preparation can be enclosed in
ampules, disposable syringes or multiple dose vials made of glass
or plastic.
[0880] Pharmaceutical compositions suitable for injectable use
include sterile aqueous solutions (where water soluble) or
dispersions and sterile powders for the extemporaneous preparation
of sterile injectable solutions or dispersions. For intravenous
administration, suitable carriers include physiological saline,
bacteriostatic water, CREMOPHOR.TM. EL (BASF; Parsippany, N.J.) or
phosphate buffered saline (PBS). The composition should be sterile
and should be fluid to the extent that easy syringability exists.
It should be stable under the conditions of manufacture and storage
and should be preserved against the contaminating action of
microorganisms such as bacteria and fungi. The carrier can be a
solvent or dispersion medium containing, for example, water,
ethanol, polyol (for example, glycerol, propylene glycol, and
liquid polyethylene glycol, and the like), and suitable mixtures
thereof. The proper fluidity can be maintained, for example, by the
use of a coating such as lecithin, by the maintenance of the
required particle size in the case of dispersion and by the use of
surfactants. Prevention of the action of microorganisms can be
achieved by various anti-bacterial and anti-fungal agents, for
example, parabens, chlorobutanol, phenol, ascorbic acid,
thimerosal, and the like. In many cases, it will be preferable to
include isotonic agents, for example, sugars, polyalcohols such as
mannitol, sorbitol, or sodium chloride in the composition.
Prolonged absorption of the injectable compositions can be brought
about by including in the composition an agent which delays
absorption, for example, aluminum monostearate and gelatin.
[0881] Sterile injectable solutions can be prepared by
incorporating the active compound (e.g., a polypeptide or antibody)
in the required amount in an appropriate solvent with one or a
combination of ingredients enumerated above, as required, followed
by filtered sterilization. Generally, dispersions are prepared by
incorporating the active compound into a sterile vehicle which
contains a basic dispersion medium, and then incorporating the
required other ingredients from those enumerated above. In the case
of sterile powders for the preparation of sterile injectable
solutions, examples of methods of preparation are vacuum drying and
freeze-drying which yields a powder of the active ingredient plus
any additional desired ingredient from a previously
sterile-filtered solution thereof.
[0882] Oral compositions generally include an inert diluent or an
edible carrier. They can be enclosed in gelatin capsules or
compressed into tablets. For the purpose of oral therapeutic
administration, the active compound can be incorporated with
excipients and used in the form of tablets, troches, or capsules.
Oral compositions can also be prepared using a fluid carrier for
use as a mouthwash, wherein the compound in the fluid carrier is
applied orally and swished and expectorated or swallowed.
[0883] Pharmaceutically compatible binding agents, adjuvant
materials, or both, can be included as part of the composition. The
tablets, pills, capsules, troches, and the like can contain any of
the following ingredients, or compounds of a similar nature: a
binder such as microcrystalline cellulose, gum tragacanth or
gelatin; an excipient such as starch or lactose, a disintegrating
agent such as alginic acid, PRIMOGEL.TM., or corn starch; a
lubricant such as magnesium stearate or Sterotes; a glidant such as
colloidal silicon dioxide; a sweetening agent such as sucrose or
saccharin; or a flavoring agent such as peppermint, methyl
salicylate, or orange flavoring.
[0884] For administration by inhalation, the compounds are
delivered in the form of an aerosol spray from a pressurized
container or dispenser which contains a suitable propellant, e.g.,
a gas such as carbon dioxide, or a nebulizer.
[0885] Systemic administration can also be by transmucosal or
transdermal means. For transmucosal or transdermal administration,
penetrants appropriate to the barrier to be permeated are used in
the formulation. Such penetrants are generally known in the art,
and include, for example, for transmucosal administration,
detergents, bile salts, and fusidic acid derivatives. Transmucosal
administration can be accomplished through the use of nasal sprays
or suppositories. For transdermal administration, the active
compounds are formulated into ointments, salves, gels, or creams as
generally known in the art.
[0886] The compounds can also be prepared in the form of
suppositories (e.g., with conventional suppository bases such as
cocoa butter and other glycerides) or retention enemas for rectal
delivery.
[0887] In one embodiment, the active compounds are prepared with
carriers that will protect the compound against rapid elimination
from the body, such as a controlled release formulation, including
implants and microencapsulated delivery systems. Biodegradable,
biocompatible polymers can be used, such as ethylene vinyl acetate,
polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and
polylactic acid. Methods for preparation of such formulations will
be apparent to those skilled in the art. The materials can also be
obtained commercially from Alza Corporation and Nova
Pharmaceuticals, Inc. Liposomal suspensions (including liposomes
having monoclonal antibodies incorporated therein or thereon) can
also be used as pharmaceutically acceptable carriers. These can be
prepared according to methods known to those skilled in the art,
for example, as described in U.S. Pat. No. 4,522,811.
[0888] It is especially advantageous to formulate oral or
parenteral compositions in dosage unit form for ease of
administration and uniformity of dosage. Dosage unit form as used
herein refers to physically discrete units suited as unitary
dosages for the subject to be treated; each unit containing a
predetermined quantity of active compound calculated to produce the
desired therapeutic effect in association with the required
pharmaceutical carrier. The specification for the dosage unit forms
of the invention are dictated by and directly dependent on the
unique characteristics of the active compound and the particular
therapeutic effect to be achieved, and the limitations inherent in
the art of compounding such an active compound for the treatment of
individuals.
[0889] Generally, partially human antibodies and fully human
antibodies have a longer half-life within the human body than other
antibodies. Accordingly, lower dosages and less frequent
administration is often possible. Modifications such as lipidation
can be used to stabilize antibodies and to enhance uptake and
tissue penetration (e.g., into the brain). A method for lipidation
of antibodies is described by Cruikshank et al. ((1997) J. Acquired
Immune Deficiency Syndromes and Human Retrovirology 14:193).
[0890] The nucleic acid molecules of the invention can be inserted
into vectors and used as gene therapy vectors. Gene therapy vectors
can be delivered to a subject by, for example, intravenous
injection, local administration (U.S. Pat. No. 5,328,470), or by
stereotactic injection (see, e.g., Chen et al. (1994) Proc. Natl.
Acad. Sci. USA 91:3054-3057). The pharmaceutical preparation of the
gene therapy vector can include the gene therapy vector in an
acceptable diluent, or can comprise a slow release matrix in which
the gene delivery vehicle is imbedded. Alternatively, where the
complete gene delivery vector can be produced intact from
recombinant cells, e.g., retroviral vectors, the pharmaceutical
preparation can include one or more cells which produce the gene
delivery system.
[0891] It is recognized that the pharmaceutical compositions and
methods described herein can be used independently or in
combination with one another. That is, subjects can be administered
one or more of the pharmaceutical compositions, e.g.,
pharmaceutical compositions comprising a nucleic acid molecule or
protein of the invention or a modulator thereof, subjected to one
or more of the therapeutic methods described herein, or both, in
temporally overlapping or non-overlapping regimens. When therapies
overlap temporally, the therapies may generally occur in any order
and can be simultaneous (e.g., administered simultaneously together
in a composite composition or simultaneously but as separate
compositions) or interspersed. By way of example, a subject
afflicted with a disorder described herein can be simultaneously or
sequentially administered both a cytotoxic agent which selectively
kills aberrant cells and an antibody (e.g., an antibody of the
invention) which can, in one embodiment, be conjugated or linked
with a therapeutic agent, a cytotoxic agent, an imaging agent, or
the like.
[0892] The pharmaceutical compositions can be included in a
container, pack, or dispenser together with instructions for
administration.
V. Uses and Methods of the Invention
[0893] The nucleic acid molecules, proteins, protein homologs, and
antibodies described herein can be used in one or more of the
following methods: a) screening assays; b) detection assays (e.g.,
chromosomal mapping, tissue typing, forensic biology); c)
predictive medicine (e.g., diagnostic assays, prognostic assays,
monitoring clinical trials, and pharmacogenomics); and d) methods
of treatment (e.g., therapeutic and prophylactic). For example,
polypeptides of the invention can to used for all of the purposes
identified herein in portions of the disclosure relating to
individual types of protein of the invention. The isolated nucleic
acid molecules of the invention can be used to express proteins
(e.g., via a recombinant expression vector in a host cell in gene
therapy applications), to detect mRNA (e.g., in a biological
sample) or a genetic lesion, and to modulate activity of a
polypeptide of the invention. In addition, the polypeptides of the
invention can be used to screen drugs or compounds which modulate
activity or expression of a polypeptide of the invention as well as
to treat disorders characterized by insufficient or excessive
production of a protein of the invention or production of a form of
a protein of the invention which has decreased or aberrant activity
compared to the wild type protein. In addition, the antibodies of
the invention can be used to detect and isolate a protein of the
and modulate activity of a protein of the invention.
[0894] This invention further pertains to novel agents identified
by the above-described screening assays and uses thereof for
treatments as described herein.
A. Screening Assays
[0895] The invention provides a method (also referred to herein as
a "screening assay") for identifying modulators, i.e., candidate or
test compounds or agents (e.g., peptides, peptidomimetics, small
molecules or other drugs) which bind with a polypeptide of the
invention or have a stimulatory or inhibitory effect on, for
example, expression or activity of a polypeptide of the
invention.
[0896] In one embodiment, the invention provides assays for
screening candidate or test compounds which bind with or modulate
the activity of the membrane-bound form of a polypeptide of the
invention or biologically active portion thereof. The test
compounds of the present invention can be obtained using any of the
numerous approaches in combinatorial library methods known in the
art, including: biological libraries; spatially addressable
parallel solid phase or solution phase libraries; synthetic library
methods requiring deconvolution; the "one-bead one-compound"
library method; and synthetic library methods using affinity
chromatography selection. The biological library approach is
limited to peptide libraries, while the other four approaches are
applicable to peptide, non-peptide oligomer, or small molecule
libraries of compounds (Lam (1997) Anticancer Drug Des.
12:145).
[0897] Examples of methods useful for the synthesis of molecular
libraries can be found in the art, for example in: DeWitt et al.
(1993) Proc. Natl. Acad. Sci. USA 90:6909; Erb et al. (1994) Proc.
Natl. Acad. Sci. USA 91:11422; Zuckermann et al. (1994). J. Med.
Chem. 37:2678; Cho et al. (1993) Science 261:1303; Carrell et al.
(1994) Angew. Chem. Int. Ed. Engl. 33:2059; Carell et al. (1994)
Angew. Chem. Int. Ed. Engl. 33:2061; and Gallop et al. (1994) J.
Med. Chem. 37:1233.
[0898] Libraries of compounds can be presented in solution (e.g.,
Houghten (1992) Bio/Techniques 13:412-421), or on beads (Lam (1991)
Nature 354:82-84), chips (Fodor (1993) Nature 364:555-556),
bacteria (U.S. Pat. No. 5,223,409), spores (U.S. Pat. Nos.
5,571,698; 5,403,484; and 5,223,409), plasmids (Cull et al. (1992)
Proc. Natl. Acad. Sci. USA 89:1865-1869) or phage (Scott and Smith
(1990) Science 249:386-390; Devlin (1990) Science 249:404-406;
Cwirla et al. (1990) Proc. Natl. Acad. Sci. USA 87:6378-6382; and
Felici (1991) J. Mol. Biol. 222:301-310).
[0899] In one embodiment, an assay is a cell-based assay in which a
cell which expresses a membrane-bound form of a polypeptide of the
invention, or a biologically active portion thereof, on the cell
surface is contacted with a test compound and the ability of the
test compound to bind with the polypeptide is determined. The cell,
for example, can be a yeast cell or a cell of mammalian origin.
Determining the ability of the test compound to bind with the
polypeptide can be accomplished, for example, by coupling the test
compound with a radioisotope or enzymatic label such that binding
of the test compound to the polypeptide or biologically active
portion thereof can be determined by detecting the labeled compound
in a complex. For example, test compounds can be labeled with
.sup.125I, .sup.35S, .sup.14C, or .sup.3H, either directly or
indirectly, and the radioisotope detected by direct counting of
radio-emission or by scintillation counting. Alternatively, test
compounds can be enzymatically labeled with, for example,
horseradish peroxidase, alkaline phosphatase, or luciferase, and
the enzymatic label detected by determination of conversion of an
appropriate substrate to product. In one embodiment, the assay
comprises contacting a cell which expresses a membrane-bound form
of a polypeptide of the invention, or a biologically active portion
thereof, on the cell surface with a known compound which binds the
polypeptide to form an assay mixture, contacting the assay mixture
with a test compound, and determining the ability of the test
compound to interact with the polypeptide, wherein determining the
ability of the test compound to interact with the polypeptide
comprises determining the ability of the test compound to
preferentially bind with the polypeptide or a biologically active
portion thereof as compared to the known compound.
[0900] In another embodiment, the assay involves assessment of an
activity characteristic of the polypeptide, wherein binding of the
test compound with the polypeptide or a biologically active portion
thereof alters (i.e., increases or decreases) the activity of the
polypeptide.
[0901] In another embodiment, an assay is a cell-based assay
comprising contacting a cell expressing a membrane-bound form of a
polypeptide of the invention, or a biologically active portion
thereof, on the cell surface with a test compound and determining
the ability of the test compound to modulate (e.g., stimulate or
inhibit) the activity of the polypeptide or biologically active
portion thereof. Determining the ability of the test compound to
modulate the activity of the polypeptide or a biologically active
portion thereof can be accomplished, for example, by determining
the ability of the polypeptide to bind with or interact with a
target molecule or to transport molecules across the cytoplasmic
membrane.
[0902] Determining the ability of a polypeptide of the invention to
bind with or interact with a target molecule can be accomplished by
one of the methods described above for determining direct binding.
As used herein, a "target molecule" is a molecule with which a
selected polypeptide (e.g., a polypeptide of the invention binds or
interacts with in nature, for example, a molecule on the surface of
a cell which expresses the selected protein, a molecule on the
surface of a second cell, a molecule in the extracellular milieu, a
molecule associated with the internal surface of a cell membrane or
a cytoplasmic molecule. A target molecule can be a polypeptide of
the invention or some other polypeptide or protein. For example, a
target molecule can be a component of a signal transduction pathway
which facilitates transduction of an extracellular signal (e.g., a
signal generated by binding of a compound to a polypeptide of the
invention) through the cell membrane and into the cell or a second
intercellular protein which has catalytic activity or a protein
which facilitates association of downstream signaling molecules
with a polypeptide of the invention. Determining the ability of a
polypeptide of the invention to bind with or interact with a target
molecule can be accomplished by determining the activity of the
target molecule. For example, the activity of the target molecule
can be determined by detecting induction of a cellular second
messenger of the target (e.g., an mRNA, intracellular Ca.sup.2+,
diacylglycerol, IP3, and the like), detecting catalytic/enzymatic
activity of the target on an appropriate substrate, detecting
induction of a reporter gene (e.g., a regulatory element that is
responsive to a polypeptide of the invention operably linked with a
nucleic acid encoding a detectable marker, e.g., luciferase), or
detecting a cellular response, for example, cellular
differentiation, or cell proliferation.
[0903] In yet another embodiment, an assay of the present invention
is a cell-free assay comprising contacting a polypeptide of the
invention or biologically active portion thereof with a test
compound and determining the ability of the test compound to bind
with the polypeptide or biologically active portion thereof.
Binding of the test compound with the polypeptide can be determined
either directly or indirectly as described above. In one
embodiment, the assay includes contacting the polypeptide of the
invention or biologically active portion thereof with a known
compound which binds the polypeptide to form an assay mixture,
contacting the assay mixture with a test compound, and determining
the ability of the test compound to interact with the polypeptide,
wherein determining the ability of the test compound to interact
with the polypeptide comprises determining the ability of the test
compound to preferentially bind with the polypeptide or
biologically active portion thereof as compared to the known
compound.
[0904] In another embodiment, an assay is a cell-free assay
comprising contacting a polypeptide of the invention or
biologically active portion thereof with a test compound and
determining the ability of the test compound to modulate (e.g.,
stimulate or inhibit) the activity of the polypeptide or
biologically active portion thereof. Determining the ability of the
test compound to modulate activity of the polypeptide can be
accomplished, for example, by determining the ability of the
polypeptide to bind with a target molecule by one of the methods
described above for determining direct binding. In an alternative
embodiment, determining the ability of the test compound to
modulate the activity of the polypeptide can be accomplished by
determining the ability of the polypeptide of the invention to
further modulate the target molecule. For example, the catalytic
activity, the enzymatic activity, or both, of the target molecule
on an appropriate substrate can be determined as previously
described.
[0905] In yet another embodiment, the cell-free assay comprises
contacting a polypeptide of the invention or biologically active
portion thereof with a known compound which binds the polypeptide
to form an assay mixture, contacting the assay mixture with a test
compound, and determining the ability of the test compound to
interact with the polypeptide. Ability of the test compound to
interact with the polypeptide can be determined by assessing the
ability of the polypeptide to preferentially bind with or modulate
the activity of a target molecule, or by any other method.
[0906] The cell-free assays of the present invention are amenable
to use of either soluble or membrane-bound forms (where applicable)
of a polypeptide of the invention. In the case of cell-free assays
comprising a membrane-bound form of the polypeptide, it can be
desirable to use a solubilizing agent in order to maintain the
membrane-bound form of the polypeptide in solution. Examples of
such solubilizing agents include non-ionic detergents such as
n-octylglucoside, n-dodecylglucoside, n-octylmaltoside,
octanoyl-N-methylglucamide, decanoyl-N-methylglucamide, Triton
X-100, Triton X-114, Thesit, isotridecypoly(ethylene glycol
ether)n, 3-{(3-cholamidopropyl) dimethylamminio}-1-propane
sulfonate (CHAPS), 3-{(3-cholamidopropyl)
dimethylamminio}-2-hydroxy-1-propane sulfonate (CHAPSO), or
N-dodecyl-N,N-dimethyl-3-ammonio-1-propane sulfonate.
[0907] In one or more embodiments of the above assay methods of the
present invention, it can be desirable to immobilize either the
polypeptide of the invention or its target molecule in order to
facilitate separation of complexed and non-complexed forms of one
or both of the molecules, as well as to accommodate automation of
the assay. Binding of a test compound with the polypeptide, or
interaction of the polypeptide with a target molecule in the
presence and absence of a candidate compound, can be accomplished
in any vessel suitable for containing the reactants. Examples of
such vessels include microtiter plates, test tubes, and
micro-centrifuge tubes. In one embodiment, a fusion protein can be
provided which adds a domain that allows one or both of the
proteins to be bound to a matrix. For example,
glutathione-S-transferase fusion proteins or
glutathione-S-transferase fusion proteins can be adsorbed onto
glutathione SEPHAROSE.TM. beads (Sigma Chemical; St. Louis, Mo.) or
glutathione-derivatized microtiter plates, which are combined with
the test compound and either the non-adsorbed target protein or a
polypeptide of the invention. The combination is incubated under
conditions conducive to complex formation (e.g., at physiological
conditions for salt and pH). Following incubation, the beads or
microtiter plate wells are washed to remove unbound components, and
complex formation is measured directly or indirectly, for example,
as described above. Alternatively, the complexes can be dissociated
from the matrix, and the level of binding or activity of the
polypeptide of the invention can be determined using standard
techniques, such as those described herein.
[0908] Other techniques for immobilizing proteins on matrices can
also be used in the screening assays of the invention. For example,
either the polypeptide of the invention or a target molecule
thereof (e.g., a protein which binds therewith or a substrate or an
analog of a substrate of the protein of the invention) can be
immobilized using conjugation of biotin and streptavidin.
Biotinylated polypeptide of the invention or target molecules can
be prepared using biotin-NHS (biotin-N-hydroxy-succinimide) using
techniques well known in the art (e.g., using a commercially
available kit such as the biotinylation kit manufactured by Pierce
Chemical Co.; Rockford, Ill.), and immobilized in the wells of
streptavidin-coated 96-well plates (Pierce Chemical).
Alternatively, antibodies which are reactive with the polypeptide
of the invention or target molecules but which do not interfere
with binding of the polypeptide of the invention with its target
molecule can be derivatized to the wells of the plate, and unbound
target or polypeptide of the invention can be trapped in the wells
by antibody conjugation. Methods for detecting such complexes, in
addition to those described above for the GST-immobilized
complexes, include immunodetection of complexes using antibodies
reactive with the polypeptide of the invention or target molecule,
as well as enzyme-linked assays which rely on detecting an
enzymatic activity associated with the polypeptide of the invention
or target molecule.
[0909] In another embodiment, modulators of expression of a
polypeptide of the invention are identified in a method in which a
cell is contacted with a candidate compound and expression of the
selected mRNA or protein (i.e., mRNA or protein corresponding to a
polypeptide or nucleic acid of the invention) in the cell is
determined. The level of expression of the selected mRNA or protein
in the presence of the candidate compound is compared with the
level of expression of the selected mRNA or protein in the absence
of the candidate compound. The candidate compound can then be
identified as a modulator of expression of the polypeptide of the
invention based on this comparison. For example, if expression of
the selected mRNA or protein is greater (i.e., statistically
significantly greater) in the presence of the candidate compound
than in its absence, then the candidate compound is identified as a
stimulator of expression of the selected mRNA or protein.
Alternatively, if expression of the selected mRNA or protein is
less (i.e., statistically significantly less) in the presence of
the candidate compound than in its absence, then the candidate
compound is identified as an inhibitor of expression of the
selected mRNA or protein. The level of the selected mRNA or protein
expression in the cells can be determined by methods described
herein.
[0910] In yet another aspect of the invention, a polypeptide of the
invention can be used as a "bait protein" in a two-hybrid assay or
three hybrid assay (see, e.g., U.S. Pat. No. 5,283,317; Zervos et
al. (1993) Cell 72:223-232; Madura et al. (1993) J. Biol. Chem.
268:12046-12054; Bartel et al. (1993) Bio/Techniques 14:920-924;
Iwabuchi et al. (1993) Oncogene 8:1693-1696; and PCT Publication
No. WO 94/10300), to identify other proteins which bind with or
interact with the polypeptide of the invention and modulate
activity of the polypeptide of the invention. Such binding proteins
are also likely to be involved in the propagation of signals by the
polypeptide of the inventions as, for example, upstream or
downstream elements of a signaling pathway involving the
polypeptide of the invention.
[0911] This invention further pertains to novel agents identified
by the above-described screening assays and uses thereof for
treatments as described herein.
B. Detection Assays
[0912] Portions or fragments of the cDNA sequences identified
herein (and the corresponding complete gene sequences) can be used
in numerous ways as polynucleotide reagents. For example, these
sequences can be used to: (i) map their respective genes on a
chromosome and, thus, locate gene regions associated with genetic
disease; (ii) identify an individual from a minute biological
sample (tissue typing); and (iii) aid in forensic identification of
a biological sample. These applications are described in the
subsections below.
1. Chromosome Mapping
[0913] Once the sequence (or a portion of the sequence) of a gene
has been isolated, this sequence can be used to map the location of
the gene on a chromosome. Accordingly, nucleic acid molecules
described herein or fragments thereof, can be used to map the
location of the corresponding genes on a chromosome. Mapping of
sequences to chromosomes is an important first step in correlating
these sequences with genes associated with occurrence of disease.
For example, the TANGO 457 gene maps to human chromosome 11p14.3;
the TANGO 416 gene maps to human chromosome 4 between chromosomal
markers D4S422 and D4S1576; the INTERCEPT 400 gene maps to human
chromosome 4 between markers D4S1616 and D4S1611; the TANGO 331
gene maps to human chromosome 22 at 22g11-q13, between markers
WI-4572 and WI-8917; the TANGO 265 gene maps to human chromosome 1
between markers D1S305 and D1S2635; and the TANGO 286 gene maps to
human chromosome 22 at 22q12-13.
[0914] Briefly, genes can be mapped to chromosomes by preparing PCR
primers (preferably 15-25 nucleotide residues in length) from the
sequence of a gene of the invention. Computer analysis of the
sequence of a gene of the invention can be used to rapidly select
primers that do not span more than one exon in the genomic DNA,
which would complicate the amplification process. These primers can
be used for PCR screening of somatic cell hybrids containing
individual human chromosomes. Only those hybrids containing the
human gene corresponding to the gene sequences will yield an
amplified fragment. For a review of this technique, see D'Eustachio
et al. ((1983) Science 220:919-924).
[0915] PCR mapping of somatic cell hybrids is a rapid procedure for
assigning a particular sequence to a particular chromosome. Three
or more sequences can be assigned per day using a single thermal
cycler. Using one or more nucleic acid sequences of the invention
to design oligonucleotide primers, sub-localization can be achieved
using panels of fragments prepared from specific chromosomes. Other
mapping strategies which can similarly be used to map a gene to its
chromosomal location include in situ hybridization (described in
Fan et al. (1990) Proc. Natl. Acad. Sci. USA 87:6223-27),
pre-screening with labeled flow-sorted chromosomes, and
pre-selection by hybridization with chromosome specific cDNA
libraries. Fluorescence in situ hybridization (FISH) of a DNA
sequence using a metaphase chromosomal spread can be used to
provide a precise chromosomal location in one step. For a review of
this technique, see Verma et al. (Human Chromosomes: A Manual of
Basic Techniques (Pergamon Press, New York, 1988)).
[0916] Reagents for chromosome mapping can be used individually to
mark a single chromosome or a single site on a chromosome.
Alternatively, panels of reagents can be used for marking multiple
sites, multiple chromosomes, or both. Reagents corresponding to
non-coding regions of the genes actually are preferred for mapping
purposes. Coding sequences are more likely to be conserved within
gene families, thus increasing the chance of cross-hybridization
during chromosomal mapping.
[0917] Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the chromosome
can be correlated with genetic map data. (Such data are found, for
example, in V. McKusick, Mendelian Inheritance in Man, available
on-line through Johns Hopkins University Welch Medical Library).
The relationship between genes and disease, mapped to the same
chromosomal region, can then be identified by linkage analysis
(co-inheritance of physically adjacent genes), described in, e.g.,
Egeland et al. (1987) Nature 325:783-787.
[0918] Moreover, differences in the DNA sequences between
individuals affected and non-affected with a disease associated
with a gene of the invention can be determined. If a mutation is
observed in some or all of the affected individuals, but not in any
(or in very few) non-affected individuals, then the mutation is
likely to be the causative agent of the particular disease.
Comparison of affected and non-affected individuals generally
involves first looking for structural alterations in the
chromosomes such as deletions or translocations that are visible
from chromosome spreads or detectable using PCR based on that DNA
sequence. Ultimately, complete sequencing of genes from several
individuals can be performed to confirm the presence of a mutation
and to distinguish mutations from polymorphisms.
2. Tissue Typing
[0919] The nucleic acid sequences of the present invention can also
be used to identify individuals from minute biological samples. The
United States military, for example, is considering the use of
restriction fragment length polymorphism (RFLP) for identification
of its personnel. In this technique, an individual's genomic DNA is
digested with one or more restriction enzymes, and probed on a
Southern blot to yield unique bands for identification. This method
does not suffer from the current limitations of physical
identification devices such as general issue "dog tags," which can
be lost, switched, or stolen, making positive identification
difficult. The sequences of the present invention are useful as
additional DNA markers for RFLP (described in U.S. Pat. No.
5,272,057).
[0920] Furthermore, the sequences of the present invention can be
used to provide an alternative technique which determines the
actual base-by-base DNA sequence of selected portions of an
individual's genome. The nucleic acid sequences described herein
can be used to prepare two PCR primers from the 5' and 3' ends of
the sequences. These primers can then be used to amplify an
individual's DNA and to subsequently sequence it.
[0921] Panels of corresponding DNA sequences from individuals,
prepared in this manner, can provide unique individual
identifications, because (with the exception of identical twins)
every individual has a unique set of such DNA sequences owing, at
least in part, to allelic differences. Sequences of the present
invention can be used to obtain such identification sequences from
individuals and from tissue. The nucleic acid sequences of the
invention uniquely represent portions of the human genome. Allelic
variation occurs to some degree in the coding regions of these
sequences, and to a greater degree in the non-coding regions. It is
estimated that allelic variation between individual humans occurs
with a frequency of about once per 500 nucleotide residues. Each of
the sequences described herein can, to some degree, be used as a
standard against which DNA from an individual can be compared for
identification purposes. Because greater numbers of polymorphisms
occur in the non-coding regions, fewer non-coding sequences are
necessary to differentiate individuals. The non-coding sequences of
any of SEQ ID NOs: 1, 31, 51, 71, 81, 91, 96, 101, 106, 111, 121,
141, 151, 171, 181, 191, 201, 215, 221, 241, 251, 271, 279, 303,
308, 324, 329, 351, 371, 379, 387, 403, 415, 423, and 437 can
comfortably provide positive individual identification with a panel
of perhaps 10 to 1,000 primers which each yield a non-coding
amplified sequence of 100 bases. If predicted coding sequences,
such as those in any of SEQ ID NOs: 2, 32, 52, 72, 82, 92, 97, 102,
107, 112, 122, 142, 152, 162, 172, 182, 192, 202, 215, 222, 242,
252, 272, 280, 304, 309, 325, 330, 352, 362, 372, 380, 388, 404,
416, 424, and 438 are used, a more appropriate number of primers
for positive individual identification would be 500-2,000.
[0922] If a panel of reagents from the nucleic acid sequences
described herein is used to generate a unique identification
database for an individual, those same reagents can later be used
to identify nucleic acids, cells, or tissue from that individual.
Using the unique identification database, positive identification
of the individual, living or dead, can be made from extremely small
samples.
3. Use of Partial Gene Sequences in Forensic Biology
[0923] DNA-based identification techniques can be used in forensic
biology. Forensic biology is a scientific field employing genetic
typing of biological evidence found at a crime scene as a means for
positively identifying, for example, a perpetrator of a crime. To
make such an identification, PCR technology can be used to amplify
DNA sequences taken from very small biological samples such as
tissues (e.g., hair or skin) or body fluids (e.g., blood, saliva,
or semen) found at a crime scene. The amplified sequence can be
compared with a standard, thereby allowing identification of the
origin of the biological sample.
[0924] The sequences of the present invention can be used to
provide polynucleotide reagents (e.g., PCR primers) targeted to
specific loci in the human genome, which can enhance the
reliability of DNA-based forensic identifications by, for example,
providing another "identification marker" (i.e., another DNA
sequence that is unique to a particular individual). As mentioned
above, actual nucleotide sequence information can be used for
identification as an accurate alternative to patterns formed by
restriction enzyme-generated fragments. Sequences of non-coding
regions are particularly appropriate for this use, because greater
numbers of polymorphisms occur in non-coding regions, making it
easier to differentiate individuals using this technique. Examples
of polynucleotide reagents include the nucleic acid sequences of
the invention or portions thereof, e.g., fragments derived from
non-coding regions having a length of at least 20 or 30 nucleotide
residues.
[0925] The nucleic acid sequences described herein can further be
used to provide polynucleotide reagents, e.g., labeled or labelable
probes which can be used in, for example, an in situ hybridization
technique, to identify a specific tissue, e.g., brain tissue. This
can be very useful in cases where a forensic pathologist is
presented with a tissue of unknown origin. Panels of such probes
can be used to identify tissue by species and/or by organ type.
C. Predictive Medicine
[0926] The present invention also pertains to the field of
predictive medicine in which diagnostic assays, prognostic assays,
and monitoring clinical trials are used for prognostic (predictive)
purposes to thereby treat an individual prophylactically.
Accordingly, one aspect of the present invention relates to
diagnostic assays for determining expression of a gene encoding a
polypeptide of the invention as well as activity of a polypeptide
of the invention, in the context of a biological sample (e.g.,
blood, serum, cells, tissue) to thereby determine whether an
individual is afflicted with a disease or disorder, or is at risk
of developing a disorder, associated with aberrant or unwanted
expression of a gene encoding a polypeptide of the invention or
aberrant or unwanted activity of a polypeptide of the invention.
The invention also provides for prognostic (or predictive) assays
for determining whether an individual is at risk of developing a
disorder associated with a protein of the invention, with
expression of a nucleic acid encoding a polypeptide of the
invention, or with activity of a polypeptide of the invention. For
example, mutations in a gene encoding a polypeptide of the
invention can be assayed in a biological sample. Such assays can be
used for prognostic or predictive purpose to thereby
prophylactically treat an individual prior to the onset of a
disorder characterized by or associated with a polypeptide of the
invention, expression of a nucleic acid encoding it, or its
activity.
[0927] As an alternative to making determinations based on the
absolute expression level of selected genes, determinations may be
based on the normalized expression levels of these genes.
Expression levels are normalized by correcting the absolute
expression level of a gene encoding a polypeptide of the invention
by comparing its expression to the expression of a different gene,
e.g., a housekeeping gene that is constitutively expressed.
Suitable genes for normalization include housekeeping genes such as
the actin gene. This normalization allows the comparison of the
expression level in one sample (e.g., a patient sample), to another
sample, or between samples from different sources.
[0928] Alternatively, the expression level can be provided as a
relative expression level. To determine a relative expression level
of a gene, the level of expression of the gene is determined for 10
or more samples of different endothelial (e.g. intestinal
endothelium, airway endothelium, or other mucosal epithelium) cell
isolates, preferably 50 or more samples, prior to the determination
of the expression level for the sample in question. The mean
expression level of each of the genes assayed in the larger number
of samples is determined and this is used as a baseline expression
level for the gene(s) in question. The expression level of the gene
determined for the test sample (absolute level of expression) is
then divided by the mean expression value obtained for that gene.
This provides a relative expression level and aids in identifying
extreme cases of disorders associated with aberrant expression of a
gene encoding a polypeptide of the invention protein or with
aberrant expression of a ligand thereof.
[0929] Preferably, the samples used in the baseline determination
will be from either or both of cells which aberrantly express a
gene encoding a polypeptide of the invention or a ligand thereof
(i.e. `diseased cells`) and cells which express a gene encoding a
polypeptide of the invention at a normal level or a ligand thereof
(i.e. `normal` cells). The choice of the cell source is dependent
on the use of the relative expression level. Using expression found
in normal tissues as a mean expression score aids in validating
whether aberrance in expression of a gene encoding a polypeptide of
the invention occurs specifically in diseased cells. Such a use is
particularly important in identifying whether a gene encoding a
polypeptide of the invention can serve as a target gene. In
addition, as more data is accumulated, the mean expression value
can be revised, providing improved relative expression values based
on accumulated data. Expression data from endothelial cells (e.g.
mucosal endothelial cells) provides a means for grading the
severity of the disorder.
[0930] Another aspect of the invention pertains to monitoring the
influence of agents (e.g., drugs, antibodies, antisense
oligonucleotides, or other compounds) on the expression or activity
of a polypeptide of the invention in clinical trials.
[0931] These and other agents are described in further detail in
the following sections.
1. Diagnostic Assays
[0932] An example of a method for detecting the presence or absence
of a polypeptide or nucleic acid of the invention in a biological
sample involves obtaining a biological sample from a test subject
and contacting the biological sample with a compound or an agent
capable of detecting a polypeptide or nucleic acid (e.g., mRNA,
genomic DNA) of the invention. An example of an agent for detecting
mRNA or genomic DNA encoding a polypeptide of the invention is a
labeled nucleic acid probe capable of hybridizing with mRNA or
genomic DNA encoding a polypeptide of the invention. The nucleic
acid probe can be, for example, a full-length cDNA, such as the
nucleic acid of one of SEQ ID NOs: 1, 31, 51, 71, 81, 91, 96, 101,
106, 111, 121, 141, 151, 171, 181, 191, 201, 217, 221, 241, 251,
271, 279, 303, 308, 324, 329, 351, 371, 379, 387, 403, 415, 423,
and 437, or a portion thereof, such as an oligonucleotide of at
least 15, 30, 50, 100, 250 or 500 nucleotides in length and
sufficient to specifically hybridize under stringent conditions
with a mRNA or genomic DNA encoding a polypeptide of the invention.
Other suitable probes for use in the diagnostic assays of the
invention are described herein.
[0933] An example of an agent for detecting a polypeptide of the
invention is an antibody capable of binding with a polypeptide of
the invention, such as an antibody having a detectable label.
Antibodies can be polyclonal or, preferably, monoclonal. An intact
antibody, or a fragment thereof (e.g., Fab or F(ab').sub.2) can be
used. The term "labeled," with regard to the probe or antibody,
includes direct labeling of the probe or antibody by coupling
(i.e., physically linking) a detectable substance to the probe or
antibody, as well as indirect labeling of the probe or antibody by
coupling it with another reagent that is directly labeled. Examples
of indirect labeling include detection of a primary antibody using
a fluorescently labeled secondary antibody and end-labeling of a
DNA probe with biotin such that it can be detected with
fluorescently labeled streptavidin. The term "biological sample" is
intended to include tissues, cells, and biological fluids isolated
from a subject, as well as tissues, cells, and fluids present
within a subject. That is, the detection method of the invention
can be used to detect mRNA, protein, or genomic DNA in a biological
sample in vitro as well as in vivo. For example, in vitro
techniques for detection of mRNA include Northern hybridization
methods and in situ hybridization methods. In vitro techniques for
detection of a polypeptide of the invention include enzyme linked
immunosorbent assays (ELISAs), Western blots, immunoprecipitation,
and immunofluorescence. In vitro techniques for detection of
genomic DNA include Southern hybridizations. Furthermore, in vivo
techniques for detection of a polypeptide of the invention include
introducing into a subject a labeled antibody directed against the
polypeptide. For example, the antibody can be labeled with a
radioactive marker, the presence and location of which in a subject
can be detected using standard imaging techniques.
[0934] In one embodiment, the biological sample contains protein
molecules obtained from the test subject. Alternatively, the
biological sample can contain mRNA molecules obtained from the test
subject or genomic DNA molecules obtained from the test subject. An
example of a biological sample is a peripheral blood
leukocyte-containing sample obtained by conventional means from a
subject (e.g., isolated peripheral blood leukocytes).
[0935] In another embodiment, the methods further involve obtaining
a control biological sample from a control (i.e., non-afflicted)
subject, contacting the control sample with a compound or agent
capable of detecting a polypeptide of the invention or mRNA or
genomic DNA encoding a polypeptide of the invention. The presence
or amount of the polypeptide, mRNA, or genomic DNA encoding the
polypeptide in the control and test samples can be compared to
assess the degree, if any, to which the presence or amount in the
test sample differs from that in the control sample.
[0936] The invention also encompasses kits for detecting the
presence of a polypeptide or nucleic acid of the invention in a
biological sample obtained from a subject. Such kits can be used to
determine if a subject is suffering from or is at increased risk of
developing a disorder associated with aberrant expression of a
polypeptide of the invention (e.g., one of the disorders described
in the section of this disclosure wherein the individual
polypeptide of the invention is discussed). For example, the kit
can comprise a labeled compound or agent capable of detecting the
polypeptide or mRNA encoding the polypeptide in a biological
sample. The kit can also, or alternatively, contain means for
determining the amount of the polypeptide or mRNA in the sample
(e.g., an antibody which specifically binds with the polypeptide or
an oligonucleotide probe which binds with a nucleic acid encoding
the polypeptide). Kits can include instructions for assessing
whether the tested subject is suffering from or is at risk of
developing a disorder associated with aberrant expression of the
polypeptide if the amount of the polypeptide or mRNA encoding the
polypeptide is above or below a normal level.
[0937] For antibody-based kits, the kit can comprise, for example:
(1) a first antibody (e.g., attached to a solid support) which
specifically binds with a polypeptide of the invention; and,
optionally, (2) a second, different antibody which specifically
binds with either the polypeptide or the first antibody and is
conjugated with a detectable agent.
[0938] For oligonucleotide-based kits, the kit can comprise, for
example: (1) an oligonucleotide (e.g., a detectably labeled
oligonucleotide) which hybridizes with a nucleic acid encoding a
polypeptide of the invention or (2) a pair of primers useful for
amplifying a nucleic acid encoding a polypeptide of the invention.
The kit can comprise, for example, a buffering agent, a
preservative, or a protein stabilizing agent. The kit can also
comprise components necessary for detecting the detectable agent
(e.g., an enzyme or a substrate). The kit can contain a control
sample or a series of control samples which can be assayed and
compared with the test sample assay results. Each component of the
kit can be enclosed within an individual container and all of the
various containers can furthermore be within a single package,
optionally with instructions for assessing whether the tested
subject is suffering from or is at risk of developing a disorder
associated with aberrant expression of the polypeptide.
2. Prognostic Assays
[0939] The methods described herein can furthermore be used as
diagnostic or prognostic assays to identify subjects having or at
risk of developing a disease or disorder associated with aberrant
expression or activity of a polypeptide of the invention (e.g., one
of the disorders described in the section of this disclosure
wherein the individual polypeptide of the invention is discussed).
Thus, the present invention provides a method in which a test
sample is obtained from a subject and a polypeptide or nucleic acid
(e.g., mRNA, genomic DNA) of the invention is detected, wherein the
presence, level, or activity of the polypeptide or nucleic acid in
the sample is associated with an enhanced or diminished risk of
developing a disease or disorder associated with aberrant
expression or activity of the polypeptide.
[0940] Furthermore, the prognostic assays described herein can be
used to determine whether an agent (e.g., an agonist, antagonist,
peptidomimetic, protein, peptide, nucleic acid, small molecule, or
other drug candidate) can be administered to a subject in order to
treat a disease or disorder associated with aberrant expression or
activity of a polypeptide of the invention. For example, such
methods can be used to determine whether a subject can be
effectively treated using a specific agent or class of agents
(e.g., agents of a type which decrease activity of the
polypeptide). Thus, the present invention provides methods for
determining whether an agent can be administered to a subject in
order to effectively treat a disorder associated with aberrant
expression or activity of a polypeptide of the invention. When
efficacious agents are known or found, such assays can also be used
to estimate tan efficacious dose of the agent.
[0941] The methods of the invention can be used to detect genetic
lesions or mutations in a gene of the invention in order to assess
if a subject having the lesioned or mutated gene is at risk for a
disorder characterized aberrant expression or activity of a
polypeptide of the invention. In certain embodiments, the methods
include detecting, in a sample of cells obtained from the subject,
the presence or absence of a genetic lesion or mutation
characterized by at least one of an alteration affecting the
integrity of a gene encoding the polypeptide of the invention, or
the mis-expression of the gene encoding the polypeptide of the
invention. For example, such genetic lesions or mutations can be
detected by ascertaining the existence of at least one of: 1) a
deletion of one or more nucleotides from the gene; 2) an addition
of one or more nucleotides to the gene; 3) a substitution of one or
more nucleotides of the gene; 4) a chromosomal rearrangement of the
gene; 5) an alteration in the level of a messenger RNA transcript
of the gene; 6) an aberrant modification of the gene, such as of
the methylation pattern of the genomic DNA; 7) a non-wild type
splicing pattern of a messenger RNA transcript of the gene; 8) a
non-wild type level of the protein encoded by the gene; 9) an
allelic loss of the gene; and 10) an inappropriate
post-translational modification of the protein encoded by the gene.
As described herein, there are a large number of assay techniques
known in the art which can be used for detecting such lesions and
mutations in a gene.
[0942] In certain embodiments, detection of the lesion involves the
use of an oligonucleotide primer in a polymerase chain reaction
(PCR; see, e.g., U.S. Pat. Nos. 4,683,195 and 4,683,202), such as
anchor PCR or RACE PCR, or, alternatively, in a ligation chain
reaction (LCR; see, e.g., Landegran et al. (1988) Science
241:1077-1080; and Nakazawa et al. (1994) Proc. Natl. Acad. Sci.
USA 91:360-364), the latter of which can be particularly useful for
detecting point mutations in a gene (see, e.g., Abravaya et al.
(1995) Nucleic Acids Res. 23:675-682). This method can include the
steps of collecting a sample of cells from a patient, isolating
nucleic acid (e.g., genomic, mRNA, or both) from the cells of the
sample, contacting the nucleic acid sample with one or more primers
which specifically hybridize with the selected gene under
conditions such that hybridization and amplification of the gene
(if present) occurs, and detecting the presence or absence of an
amplification product. The method can also include detecting the
size of the amplification product and comparing the length to the
length of a corresponding product obtained in the same manner from
a control sample. PCR, LCR, or both can be used as a preliminary
amplification step in conjunction with any of the techniques used
for detecting mutations described herein.
[0943] Alternative amplification methods include: self-sustained
sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci.
USA 87:1874-1878), transcriptional amplification system (Kwoh, et
al. (1989) Proc. Natl. Acad. Sci. USA 86:1173-1177), Q-Beta
Replicase (Lizardi et al. (1988) Bio/Technology 6:1197), or any
other nucleic acid amplification method, followed by the detection
of the amplified molecules using any of a variety of techniques
well known to those of skill in the art. These detection schemes
are especially useful for detection of nucleic acid molecules if
such molecules are present in very low numbers.
[0944] In an alternative embodiment, mutations in a selected gene
can be identified in a sample by detecting alterations in
restriction enzyme cleavage patterns. For example, sample and
control DNA is isolated, (optionally) amplified, digested with one
or more restriction endonucleases, and fragment length sizes are
determined by gel electrophoresis and compared. Differences in
fragment length sizes between sample and control DNA indicates
occurrence of mutations or other sequence differences in the sample
DNA. Moreover, sequence specific ribozymes (see, e.g., U.S. Pat.
No. 5,498,531) can be used to score for the presence of specific
mutations by development or loss of a ribozyme cleavage site.
[0945] In other embodiments, genetic mutations are identified by
hybridizing a sample and control nucleic acids, e.g., DNA or RNA,
with high density arrays containing hundreds or thousands of
oligonucleotides probes (Cronin et al. (1996) Human Mutation
7:244-255; Kozal et al. (1996) Nature Medicine 2:753-759). For
example, genetic mutations can be identified using two-dimensional
arrays of light-generated DNA probes fixed to a surface, as
described in Cronin et al., supra. Briefly, a first hybridization
array of probes can be used to scan through long stretches of DNA
in a sample and control to identify base changes between the
sequences by making linear arrays of sequential overlapping probes.
This step allows the identification of point mutations. This step
is followed by hybridization of the nucleic acid sample with a
second hybridization array in order to characterize specific
mutations using smaller, specialized probe arrays complementary to
many or all potential variants or mutations. Each mutation array is
composed of parallel probe sets, one complementary to the wild-type
gene and the other complementary to the mutant gene.
[0946] In yet another embodiment, any of a variety of sequencing
methods known in the art can be used to directly sequence the
selected gene and detect mutations by comparing the sequence of the
sample nucleic acids with the corresponding wild-type (control)
sequence. Examples of sequencing reactions include those based on
techniques developed by Maxim and Gilbert ((1977) Proc. Natl. Acad.
Sci. USA 74:560) or Sanger ((1977) Proc. Natl. Acad. Sci. USA
74:5463). It is also contemplated that any of a variety of
automated sequencing procedures can be used when performing the
diagnostic assays ((1995) Bio/Techniques 19:448), including
sequencing by mass spectrometry (see, e.g., PCT Publication No. WO
94/16101; Cohen et al. (1996) Adv. Chromatogr. 36:127-162; and
Griffin et al. (1993) Appl. Biochem. Biotechnol. 38:147-159).
[0947] Other methods for detecting mutations in a selected gene
include methods in which protection from cleavage agents is used to
detect mismatched bases in RNA/RNA or RNA /DNA heteroduplexes
(Myers et al. (1985) Science 230:1242). In general, the technique
of mismatch cleavage entails providing heteroduplexes formed by
hybridizing (labeled) RNA or DNA containing the wild-type sequence
with potentially mutant RNA or DNA obtained from a tissue sample.
The double-stranded duplexes are treated with an agent that cleaves
single-stranded regions of the duplex such as those which exist due
to base pair mismatches between the control and sample strands.
RNA/DNA duplexes can be treated with RNase to digest mismatched
regions, and DNA/DNA hybrids can be treated with 51 nuclease to
digest mismatched regions.
[0948] In other embodiments, DNA/DNA or RNA/DNA duplexes can be
treated with hydroxylamine or osmium tetroxide and with piperidine
in order to digest mismatched regions. After digestion of the
mismatched regions, the resulting material is separated by size on
denaturing polyacrylamide gels to determine the site of the mutated
or mismatched region. See, e.g., Cotton et al. (1988) Proc. Natl.
Acad. Sci. USA 85:4397; Saleeba et al. (1992) Methods Enzymol.
217:286-295. In one embodiment, the control DNA or RNA is labeled
for detection.
[0949] In still another embodiment, the mismatch cleavage reaction
employs one or more proteins that recognize mismatched base pairs
in double-stranded DNA (so called DNA mismatch repair enzymes) in
defined systems for detecting and mapping point mutations in cDNAs
obtained from samples of cells. For example, the mutY enzyme of E.
coli cleaves following A residues at G/A mismatches and the
thymidine DNA glycosylase from HeLa cells cleaves following T
residues at G/T mismatches (Hsu et al. (1994) Carcinogenesis
15:1657-1662). According to one embodiment, a probe based on a
selected sequence, e.g., a wild-type sequence, is hybridized with a
cDNA or other DNA product obtained from a test cell(s). The duplex
is treated with a DNA mismatch repair enzyme, and the cleavage
products, if any, are detected using an electrophoresis protocol or
another polynucleotide-separating method. See, e.g., U.S. Pat. No.
5,459,039.
[0950] In other embodiments, alterations in electrophoretic
mobility are used to identify mutations in genes. For example,
single strand conformation polymorphism (SSCP) analysis can be used
to detect differences in electrophoretic mobility between mutant
and wild type nucleic acids (Orita et al. (1989) Proc. Natl. Acad.
Sci. USA 86:2766; see also Cotton (1993) Mutat. Res. 285:125-144;
Hayashi (1992) Genet. Anal. Tech. Appl. 9:73-79). Single-stranded
DNA fragments of sample and control nucleic acids are denatured and
allowed to re-nature. The secondary structure of single-stranded
nucleic acids varies according to their nucleotide sequence, and
the resulting alteration in electrophoretic mobility enables
detection of even a single base change. The DNA fragments can be
labeled or detected using labeled probes. The sensitivity of the
assay can be enhanced by using RNA (rather than DNA), because the
secondary structure of RNA is more sensitive to sequence changes.
In one embodiment, the method uses heteroduplex analysis to
separate double stranded heteroduplex molecules on the basis of
changes in electrophoretic mobility (Keen et al. (1991) Trends
Genet. 7:5).
[0951] In yet another embodiment, the movement of mutant or
wild-type fragments in polyacrylamide gels containing a gradient of
denaturant is assayed using denaturing gradient gel electrophoresis
(DGGE), as described (Myers et al. (1985) Nature 313:495). When
DGGE is used as the method of analysis, DNA is modified to ensure
that it does not completely denature, for example by adding a `GC
clamp` of approximately 40 nucleotide residues of high-melting
GC-rich DNA to one or both ends of the DNA strands, for example
using a PCR method. In a further embodiment, a temperature gradient
is used in place of a denaturing gradient to identify differences
in the mobility of control and sample DNA (Rosenbaum and Reissner
(1987) Biophys. Chem. 265:12753).
[0952] Examples of other techniques for detecting point mutations
include, but are not limited to, selective oligonucleotide
hybridization, selective amplification, and selective primer
extension. For example, oligonucleotide primers can be prepared in
which the known mutation is located centrally. The primers are
hybridized with target DNA under conditions which permit
hybridization only if a perfect complementary nucleotide sequence
match occurs (Saiki et al. (1986) Nature 324:163); Saiki et al.
(1989) Proc. Natl. Acad. Sci. USA 86:6230). Such allele specific
oligonucleotides are hybridized with PCR-amplified target DNA or
attached to a surface for hybridization.
[0953] Alternatively, allele specific amplification technology can
be used in conjunction with the methods of the invention.
Oligonucleotides used as primers for specific amplification have a
sequence complementary to the nucleotide sequence of a mutation of
interest in the center of the molecule, so that occurrence of
amplification depends on occurrence of the mutation in the sample
nucleic acid (Gibbs et al. (1989) Nucleic Acids Res. 17:2437-2448)
or at the extreme 3' end of one primer where, under appropriate
conditions, mismatching can prevent or inhibit polymerase extension
(Prossner (1993) Tibtech 11:238). In addition, it can be desirable
to introduce a novel restriction site in the region of the mutation
in order to facilitate cleavage-based detection (Gasparini et al.
(1992) Mol. Cell. Probes 6:1). Amplification can be performed using
Taq ligase (Barany (1991) Proc. Natl. Acad. Sci. USA 88:189). In
such cases, ligation will occur only if there is a perfect match at
the 3' end of the 5' sequence, thereby making it possible to assess
the presence of a known mutation at a specific site by looking for
the presence or absence of amplification.
[0954] The methods described herein can be performed, for example,
using pre-packaged diagnostic kits comprising at least one probe
nucleic acid or antibody reagent described herein. Such kits can be
used, for example, in clinical settings to diagnose patients
exhibiting symptoms or a family history of a disorder involving a
gene encoding a polypeptide of the invention. Furthermore, any cell
type or tissue in which the polypeptide of the invention is
expressed (e.g., a blood sample containing peripheral blood
leukocytes for proteins which are secreted or which occur on or in
peripheral blood leukocytes) can be used in the prognostic assays
described herein.
3. Pharmacogenomics
[0955] Agents which have a stimulatory or inhibitory effect on
activity or expression of a polypeptide of the invention, as
identified by a screening assay described herein for example, can
be administered to individuals to treat (prophylactically or
therapeutically) disorders associated with aberrant activity of the
polypeptide. In conjunction with such treatment, the
pharmacogenomics (i.e., the study of the relationship between an
individual's genotype and that individual's response to a foreign
compound or drug) of the individual can be considered. Differences
in metabolism of therapeutics can lead to severe toxicity or
therapeutic failure by altering the relation between dose and blood
concentration of the pharmacologically active drug. Thus, the
pharmacogenomics of the individual permits selection of effective
agents (e.g., drugs) for prophylactic or therapeutic treatments
based on a consideration of the individual's genotype. Such
pharmacogenomics can further be used to determine appropriate
dosages and therapeutic regimens. Accordingly, the activity of a
polypeptide of the invention, expression of a nucleic acid of the
invention, or mutation content of a gene of the invention in an
individual can be determined to facilitate selection of one or more
appropriate agents for therapeutic or prophylactic treatment of the
individual.
[0956] Pharmacogenomics deals with clinically significant
hereditary variations in the response to drugs due to altered drug
disposition and abnormal action in affected persons. See, e.g.,
Linder (1997) Clin. Chem. 43(2):254-266. In general, two types of
pharmacogenetic conditions can be differentiated. Genetic
conditions transmitted as a single factor altering the way drugs
act on the body are referred to as "altered drug action." Genetic
conditions transmitted as single factors altering the way the body
acts on drugs are referred to as "altered drug metabolism". These
pharmacogenetic conditions can occur either as rare defects or as
polymorphisms. For example, glucose-6-phosphate dehydrogenase
(G6PD) deficiency is a common inherited enzymopathy in which the
main clinical complication is hemolysis after ingestion of oxidant
drugs (anti-malarials, sulfonamides, analgesics, nitrofurans) and
consumption of fava beans.
[0957] As an illustrative embodiment, the activity of drug
metabolizing enzymes is a major determinant of both the intensity
and duration of drug action. The discovery of genetic polymorphisms
of drug metabolizing enzymes (e.g., N-acetyltransferase 2 {NAT 2}
and cytochrome P450 enzymes CYP2D6 and CYP2C19) explains why some
patients do not obtain the expected drug effects or exhibit
exaggerated drug response and serious toxicity following
administration of standard and safe doses of a drug. These
polymorphisms are expressed in two phenotypes in the population,
the extensive metabolizer (EM) and poor metabolizer (PM). The
prevalence of PM is different among different populations. For
example, the gene encoding CYP2D6 is highly polymorphic, and
several mutations have been identified in PM. Each of these
mutations results in absence of functional CYP2D6. Poor
metabolizers of CYP2D6 and CYP2C19 frequently experience
exaggerated drug response and side effects when they receive
standard doses. If a metabolite is the active therapeutic moiety, a
PM will show no therapeutic response, as demonstrated for the
analgesic effect of codeine mediated by its CYP2D6-formed
metabolite morphine. At the other extreme are the so called
ultra-rapid metabolizers who do not respond to standard doses.
Recently, the molecular basis of ultra-rapid metabolism has been
identified to be due to CYP2D6 gene amplification.
[0958] Thus, activity of a polypeptide of the invention, expression
of a nucleic acid encoding the polypeptide, or mutation content of
a gene encoding the polypeptide in an individual can be determined
to facilitate selection of appropriate agents for therapeutic or
prophylactic treatment of the individual. In addition,
pharmacogenetic studies can be used to apply genotyping of
polymorphic alleles encoding drug-metabolizing enzymes to
identification of an individual's drug responsiveness phenotype.
This knowledge, when applied to dosing or drug selection, can avoid
adverse reactions or therapeutic failure and thus enhance
therapeutic or prophylactic efficiency when treating a subject with
a modulator of activity or expression of the polypeptide, such as a
modulator identified by one of the examples of screening assays
described herein.
4. Monitoring of Effects During Clinical Trials
[0959] Monitoring the influence of agents (e.g., drug compounds) on
expression or activity of a polypeptide of the invention (e.g.,
ability to modulate aberrant cell proliferation chemotaxis,
differentiation, or both) can be applied not only in basic drug
screening, but also in clinical trials. For example, the
effectiveness of an agent, as determined by a screening assay as
described herein, to increase gene expression, protein levels, or
protein activity can be monitored in clinical trials of subjects
exhibiting decreased gene expression, protein levels, or protein
activity. Alternatively, the effectiveness of an agent, as
determined by a screening assay, to decrease gene expression,
protein levels, or protein activity can be monitored in clinical
trials of subjects exhibiting increased gene expression, protein
levels, or protein activity. In such clinical trials, expression or
activity of a polypeptide of the invention and, optionally, that of
other polypeptide that have been implicated in similar disorders,
can be used as a marker of the immune responsiveness of a
particular cell.
[0960] For example, genes (including those of the invention) that
are modulated in cells by treatment with an agent (e.g., a peptide,
a drug, or another small molecule) which modulates activity or
expression of a polypeptide of the invention (e.g., as identified
in a screening assay described herein) can be identified. Thus, to
study the effect of agents on cellular proliferation disorders, for
example, in a clinical trial, cells can be isolated and their RNA
can be prepared and analyzed to determine the level of expression
of one or more genes of the invention and, optionally, other genes
implicated in the disorder. The levels of gene expression (i.e., a
gene expression pattern) can be quantified by Northern blot
analysis or by RT-PCR, as described herein, or by assessing the
amount of protein produced, by one of the methods as described
herein, or by measuring the level of activity of a gene of the
invention or other gene(s). In this way, the gene expression
pattern can serve as an indicator of the physiological response of
the cells to the agent. Accordingly, this response state can be
determined before, and at various points during, or after treatment
of the individual with the agent (or, of course, at more than one
of these stages).
[0961] In one embodiment, the present invention provides a method
for monitoring the effectiveness of treatment of a subject with an
agent (e.g., an agonist, antagonist, peptidomimetic, protein,
peptide, nucleic acid, small molecule, or other drug candidate
identified by the screening assays described herein) comprising (i)
obtaining a pre-administration sample from a subject prior to
administration of the agent; (ii) detecting the level of the
polypeptide or nucleic acid of the invention in the
pre-administration sample; (iii) obtaining one or more
post-administration samples from the subject; (iv) detecting the
level the of the polypeptide or nucleic acid of the invention in
the post-administration sample(s); (v) comparing the level of the
polypeptide or nucleic acid of the invention in the
pre-administration sample with the level of the polypeptide or
nucleic acid of the invention in the post-administration sample(s);
and (vi) altering the administration of the agent to the subject
accordingly. For example, increased administration of the agent can
be desirable to increase the expression or activity of the
polypeptide to levels higher than those detected, i.e., to increase
the effectiveness of the agent. Alternatively, decreased
administration of the agent can be desirable to decrease expression
or activity of the polypeptide to levels lower than those detected,
i.e., to decrease the effectiveness of the agent.
C. Methods of Treatment
[0962] The present invention provides both prophylactic and
therapeutic methods of treating a subject afflicted with, at risk
for developing, or susceptible to a disorder associated with
aberrant expression or activity of a polypeptide of the invention.
Such disorders are described elsewhere in this disclosure.
1. Prophylactic Methods
[0963] In one aspect, the invention provides a method for
preventing in a subject, a disorder associated with aberrant
expression or activity of a polypeptide of the invention, by
administering to the subject an agent which modulates expression of
the polypeptide or at least one activity of the polypeptide.
Subjects at risk for a disease which is caused or contributed to by
aberrant expression or activity of a polypeptide of the invention
can be identified by, for example, any one or combination of the
diagnostic and prognostic assays described herein. Administration
of a prophylactic agent can occur prior to the manifestation of
symptoms characteristic of the aberrance, so that the disease or
disorder is prevented or, alternatively, delayed in its onset or
progression. Depending on the type of aberrance, for example, an
agonist or antagonist agent can be used for treating the subject.
The appropriate agent can be determined based on screening assays
described herein.
2. Therapeutic Methods
[0964] Another aspect of the invention pertains to methods of
modulating expression or activity of a polypeptide of the invention
for therapeutic purposes. The modulatory method of the invention
involves contacting a cell with an agent that modulates one or more
of the activities of the polypeptide. An agent that modulates
activity can be an agent as described herein, such as a nucleic
acid, or a protein, a naturally-occurring cognate ligand of the
polypeptide, a peptide, a peptidomimetic, or a small molecule. In
one embodiment, the agent stimulates one or more of the biological
activities of the polypeptide. Examples of such stimulatory agents
include a polypeptide of the invention, a biologically active
portion of such a polypeptide, a portion of such a polypeptide
which comprises an epitope of the native polypeptide, and a nucleic
acid molecule encoding the polypeptide of the invention that has
been introduced into the cell. In another embodiment, the agent
inhibits a biological activity of the polypeptide of the invention
or expression of a protein or nucleic acid of the invention.
Examples of such inhibitory agents include antisense nucleic acid
molecules and antibodies. These modulatory methods can be performed
in vitro (e.g., by culturing the cell with the agent) or,
alternatively, in vivo (e.g., by administering the agent to a
subject). As such, the present invention provides methods of
treating an individual afflicted with a disease or disorder
characterized by aberrant expression or activity of a polypeptide
of the invention. In one embodiment, the method involves
administering an agent (e.g., an agent identified by a screening
assay described herein), or combination of agents that modulates
(e.g., up-regulates or down-regulates) expression or activity. In
another embodiment, the method involves administering a polypeptide
of the invention or a nucleic acid molecule of the invention as
therapy to compensate or substitute for reduced or aberrant
expression or activity of the polypeptide.
[0965] Stimulation of activity is desirable in situations in which
activity or expression is abnormally low or in which increased
activity is likely to have a beneficial effect. Conversely,
inhibition of activity is desirable in situations in which activity
or expression is abnormally high or in which decreased activity is
likely to have a beneficial effect.
[0966] The contents of all references, patents, and published
patent applications cited in this disclosure are hereby
incorporated by reference.
Deposits of Clones
[0967] Clones containing one or more cDNA molecules encoding
polypeptides of the invention have been deposited with the American
Type Culture Collection (ATCC.RTM.; 10801 University Boulevard,
Manassas, Va. 20110-2209) on dates disclosed herein, and these
deposits were assigned the Accession Numbers disclosed herein.
These deposits will be maintained under the terms of the Budapest
Treaty on the International Recognition of the Deposit of
Microorganisms for the Purposes of Patent Procedure. These deposits
were made merely as a convenience for those of skill in the art and
are not an admission that any deposit is required in order to
comply with 35 U.S.C. .sctn.112.
[0968] Where a clone containing multiple cDNA molecules was
deposited, the following standard digest procedure can be used to
liberate fragments corresponding to individual cDNA molecules,
except as otherwise described. To isolate the cDNA clone, an
aliquot of the deposited clone can be streaked out to yield single
colonies on nutrient medium (e.g., Luria broth plates) supplemented
with 100 micrograms per milliliter ampicillin. Single colonies are
grown, and plasmid DNA is extracted from single colonies using a
standard mini-preparation procedure. Next, a sample of the DNA
mini-preparation is digested using a combination of the restriction
enzymes Sal I and Not I, and the resulting products are resolved on
a 0.8% (w/v) agarose gel using standard DNA electrophoresis
conditions.
[0969] A clone containing a cDNA molecule encoding TANGO 416 (clone
EpT416), was deposited with the American Type Culture Collection
(ATCC.RTM.; 10801 University Boulevard, Manassas, Va. 20110-2209)
on Apr. 26, 1999 as Accession Number PTA-1764, as an Escherichia
coli strain carrying a recombinant plasmid harboring the clone. The
standard digest procedure liberates a fragment as follows: [0970]
TANGO 416 (EpT416): 5.1 kilobases. The identity of the strain
containing TANGO 416 can be inferred from the liberation of a
fragment of the above identified size.
[0971] A clone containing a cDNA molecule encoding TANGO 457 (clone
457), was deposited with the ATCC.RTM. on Oct. 1, 1999 as Accession
Number PTA-817, as part of a composite deposit representing a
mixture of four strains, each carrying one recombinant plasmid
harboring a particular cDNA clone. The standard digest procedure
liberates a fragment as follows: [0972] TANGO 457 (457): 2.3
kilobases The identity of the strain containing TANGO 457 can be
inferred from the liberation of a fragment of the above identified
size.
[0973] Clones containing cDNA molecules encoding TANGO 229 and
INTERCEPT 289 (clones EpT229 and EpI289, respectively), were
deposited with the ATCC.RTM. on Oct. 1, 1999 as Accession No.
PTA-295, as part of a composite deposit representing a mixture of
four strains, each carrying one recombinant plasmid harboring a
particular cDNA clone. The standard digest procedure liberates
fragments as follows: [0974] TANGO 229 (EpT229): 3.6 kilobases
[0975] INTERCEPT 289 (EpI289): 1.9 kilobases The identity of the
strains can be inferred from the fragments liberated.
[0976] Clones containing cDNA molecules encoding INTERCEPT 429
(clone EpI429), were deposited with the ATCC.RTM. on Aug. 5, 1999
as Accession No. PTA-455, as part of a composite deposit
representing a mixture of three strains, each carrying one
recombinant plasmid harboring a particular cDNA clone. The standard
digest procedure liberates a fragment as follows: [0977] INTERCEPT
429 (EpI429): 0.5 kilobase The identity of the strain containing
INTERCEPT 429 can be inferred from the liberation of a fragment of
the above identified size.
[0978] Clones containing cDNA molecules encoding INTERCEPT 309 and
MANGO 419 (clones EpT309 and EpT419, respectively), were deposited
with the ATCC.RTM. on Jan. 6, 2000 as Accession Number PTA-1156, as
part of a composite deposit representing a mixture of four strains,
each carrying one recombinant plasmid harboring a particular cDNA
clone. The standard digest procedure liberates fragments as
follows: [0979] TANGO 309 (EpT309): 1.9 kilobases [0980] MANGO 419
(EpT419): 0.3 kilobases The identity of the strains can be inferred
from the fragments liberated.
[0981] Clones containing cDNA molecules encoding TANGO 366 and
INTERCEPT 394 (clones Aped and 394, respectively), were deposited
with the ATCC.RTM. on Jul. 23, 1999 as Accession No. PTA-424, as
part of a composite deposit representing a mixture of five strains,
each carrying one recombinant plasmid harboring a particular cDNA
clone. The standard digest procedure liberates fragments as
follows: [0982] TANGO 366 (EpT366): 2.6 kilobase pairs [0983]
INTERCEPT 394 (394): 3.7 kilobase pairs The identity of the strains
can be inferred from the fragments liberated.
[0984] Clones containing cDNA molecules encoding TANGO 210 and
INTERCEPT 400 (clones Aped and 400, respectively), were deposited
with the ATCC.RTM. on Jul. 29, 1999 as Accession No. PTA-438, as
part of a composite deposit representing a mixture of five strains,
each carrying one recombinant plasmid harboring a particular cDNA
clone. The standard digest procedure liberates fragments as
follows: [0985] TANGO 210 (EpT210): 1.7 kilobase pairs [0986]
INTERCEPT 400 (400): 3.0 kilobase pairs The identity of the strains
can be inferred from the fragments liberated.
[0987] Clones comprising cDNA molecules encoding human INTERCEPT
217, human INTERCEPT 297, and human TANGO 331 were deposited with
ATCC.RTM. on May 28, 1999, as part of a composite deposit
representing a mixture of five strains, each carrying one
recombinant plasmid harboring a particular cDNA clone. This deposit
was assigned Accession Number PTA-147. The standard digest
procedure (except that restriction enzymes SalI, NotI, and SmaI are
used) liberates fragments as follows: [0988] 1. human INTERCEPT 217
(clone EpT217): 2.9 kilobases [0989] 2. human INTERCEPT 297 (clone
EpT297): 1.2 kilobases and 0.3 kilobases (human INTERCEPT 297 has a
SmaI cut site at about base pair 1183). [0990] 3. human TANGO 331
(clone EpT331): 1.4 kilobases The identity of the strains can be
inferred from the fragments liberated.
[0991] Human TANGO 276, human TANGO 292, human TANGO 332, human
TANGO 202, human TANGO 234, and human TANGO 265 were each deposited
as single deposits. Their clone names, deposit dates, and accession
numbers are as follows: [0992] 1. human TANGO 276: clone EpT276 was
deposited with ATCC.RTM. on May 28, 1999, and was assigned
Accession Number PTA-150. [0993] 2. human TANGO 292: clone EpT292
was deposited with ATCC.RTM. on Apr. 28, 1999, and was assigned
Accession Number 207230. [0994] 3. human TANGO 332: clone EpT332
was deposited with ATCC.RTM. on May 28, 1999, and was assigned
Accession Number PTA-151. [0995] 4. human TANGO 202: clone EpT202
was deposited with ATCC.RTM. on Apr. 21, 1999, and was assigned
Accession Number 207219. [0996] 5. human TANGO 234: clone EpT234
was deposited with ATCC.RTM. on Apr. 2, 1999, and was assigned
Accession Number 207184. [0997] 6. human TANGO 265: clone EpT265
was deposited with ATCC.RTM. on Apr. 28, 1999, and was assigned
Accession Number 207228.
[0998] Clones containing cDNA molecules encoding human TANGO 286,
human TANGO 294, and INTERCEPT 296 were deposited with ATCC.RTM. on
Apr. 21, 1999 as Accession Number 207220, as part of a composite
deposit representing a mixture of five strains, each carrying one
recombinant plasmid harboring a particular cDNA clone. The standard
digest procedure (except that restriction enzymes SalI, NotI, and
DraII are used) liberates fragments as follows: [0999] 1. human
TANGO 286 (clone EpT286): 1.85 kilobases and 0.1 kilobases (human
TANGO 286 has a DraII cut site at about base pair 1856). [1000] 2.
human TANGO 294 (clone EpT294): 1.4 kilobases and 0.6 kilobases
(human TANGO 294 has a DraII cut site at about base pair 1447).
[1001] 3. human INTERCEPT 296 (clone EpT296): 0.4 kilobases, 1.6
kilobases, and 0.1 kilobases (human INTERCEPT 296 has DraII cut
sites at about base pair 410 and at about base pair 1933). The
identity of the strains can be inferred from the fragments
liberated.
[1002] A clone containing a cDNA molecule encoding mouse TANGO 202
was deposited with ATCC.RTM. on Apr. 21, 1999 and was assigned
Accession Number 207221, as part of a composite deposit
representing a mixture of five strains, each carrying one
recombinant plasmid harboring a particular cDNA clone. The standard
digest procedure (except that restriction enzymes SalI, NotI, and
ApaI are used) liberates a fragment as follows: [1003] mouse TANGO
202 (clone EpTm202): 3.5 kilobases and 1.4 kilobases (mouse TANGO
202 has a Apa I cut site at about base pair 3519). The identity of
the strain can be inferred from the fragment liberated.
EQUIVALENTS
[1004] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein. Such equivalents are encompassed by the following claims.
Sequence CWU 0 SQTB SEQUENCE LISTING The patent application
contains a lengthy "Sequence Listing" section. A copy of the
"Sequence Listing" is available in electronic form from the USPTO
web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20120045777A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
0 SQTB SEQUENCE LISTING The patent application contains a lengthy
"Sequence Listing" section. A copy of the "Sequence Listing" is
available in electronic form from the USPTO web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20120045777A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
* * * * *
References