U.S. patent application number 13/179421 was filed with the patent office on 2012-02-23 for compositions and methods for inducing an immune response in a mammal and methods of avoiding an immune response to oligonucleotide agents such as short interfering rnas.
Invention is credited to Antonin de Fougerolles, Stefan Endres, Gunther Hartmann, Veit Hornung.
Application Number | 20120045461 13/179421 |
Document ID | / |
Family ID | 36578622 |
Filed Date | 2012-02-23 |
United States Patent
Application |
20120045461 |
Kind Code |
A1 |
Hartmann; Gunther ; et
al. |
February 23, 2012 |
Compositions and Methods for Inducing an Immune Response in a
Mammal and Methods of Avoiding an Immune Response to
Oligonucleotide Agents Such as Short Interfering RNAs
Abstract
Tis invention provides oligonucleotide agents that modulate an
immune response by stimulating IFN production and methods of using
such agents for therapeutic treatments of mammals.
Inventors: |
Hartmann; Gunther; (Alfter,
DE) ; de Fougerolles; Antonin; (Brookline, MA)
; Hornung; Veit; (Pullach, DE) ; Endres;
Stefan; (Muenchen, DE) |
Family ID: |
36578622 |
Appl. No.: |
13/179421 |
Filed: |
July 8, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11298850 |
Dec 9, 2005 |
8003619 |
|
|
13179421 |
|
|
|
|
60634849 |
Dec 9, 2004 |
|
|
|
Current U.S.
Class: |
424/184.1 ;
424/278.1; 536/24.5; 536/25.4 |
Current CPC
Class: |
A61K 39/00 20130101;
A61P 37/08 20180101; C12N 15/1138 20130101; C12N 2310/14 20130101;
A61P 37/06 20180101; A61P 37/04 20180101; A61P 11/00 20180101; A61P
31/00 20180101; A61P 35/00 20180101; C12N 15/117 20130101; C12N
2310/17 20130101; A61P 29/00 20180101; A61P 43/00 20180101; C12N
2310/3231 20130101; A61K 2039/53 20130101; A61K 39/39 20130101;
A61P 11/06 20180101 |
Class at
Publication: |
424/184.1 ;
424/278.1; 536/25.4; 536/24.5 |
International
Class: |
A61K 31/7088 20060101
A61K031/7088; A61P 37/04 20060101 A61P037/04; A61K 39/00 20060101
A61K039/00; C07H 1/06 20060101 C07H001/06; C07H 21/02 20060101
C07H021/02 |
Claims
1. A method of stimulating an immune response in a mammal
comprising administering to said mammal an RNA oligonucleotide
agent comprising a sequence of 4 or more, 5 or more, 6 or more, 7
or more or 8 or more contiguous nucleotides from SEQ ID NO:1, taken
from the 5' end of this sequence, wherein the agent is at least 12
nucleotides in length.
2. The method of claim 1, wherein the oligonucleotide agent
comprises SEQ ID NO:1, or a sequence that differs by not more than
1 or not more than 2 nucleotides from SEQ ID NO: 1.
3. The method of claim 1, wherein the oligonucleotide agent
comprises at least two repeats of SEQ ID NO:1.
4. The method of claim 1, wherein said sequence is chosen from the
group of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and
SEQ ID NO:6.
5. The method of claim 1, wherein the oligonucleotide agent is an
iRNA agent.
6. The method of claim 1, wherein said agent is a single stranded
RNA agent.
7. A method of making an oligonucleotide agent so as to avoid
stimulating an immune response in a mammal comprising eliminating
from a potential agent pool any agent that comprises a sequence of
4 or more, 5 or more, 6 or more, 7 or more or 8 or more contiguous
nucleotides from SEQ ID NO:1, taken from the 5' end of this
sequence, or a sequence that differs from SEQ ID NO:1 by not more
than one or not more than 2 nucleotides.
8. The method of claim 7, wherein the oligonucleotide agent is an
iRNA agent.
9. The method of claim 7, wherein said agent is a single stranded
RNA agent.
10. An isolated oligonucleotide agent for inducing an immune
response comprising a sequence of 4 or more, 5 or more, 6 or more,
7 or more or 8 or more contiguous nucleotides from SEQ ID NO:1,
taken from the 5' end of this sequence, wherein the agent is at
least 12 nucleotides in length.
11. The isolated oligonucleotide agent of claim 10, wherein the
oligonucleotide agent comprises SEQ ID NO:1, or a sequence that
differs by not more than 1 or not more than 2 nucleotides from SEQ
ID NO:1.
12. The isolated oligonucleotide agent of claim 10, wherein the
oligonucleotide agent comprises at least two repeats of SEQ ID
NO:1.
13. The isolated oligonucleotide of claim 10, wherein said sequence
is chosen from the group of: SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4,
SEQ ID NO:5, and SEQ ID NO:6.
14. The oligonucleotide agent of claim 10, wherein the
oligonucleotide agent is an iRNA agent.
15. The oligonucleotide agent of claim 10, wherein said agent is a
single stranded RNA agent.
16. The isolated oligonucleotide of claim 10, further comprising at
least one 2'-fluoromodified nucleotide, wherein the
2'-fluoro-modified nucleotide is not part of a sequence of 4 or
more contiguous nucleotides from SEQ ID NO:1.
17. (canceled)
18. (canceled)
19. (canceled)
20. (canceled)
21. (canceled)
22. (canceled)
23. (canceled)
24. A pharmaceutical composition comprising the oligonucleotide
agent of claim 10 and a pharmaceutically acceptable carrier.
25. The pharmaceutical composition of claim 24, wherein the
pharmaceutical composition, is a vaccine.
26. The method of claim 7, further comprising providing the
oligonucleotide agent in such manner that it contains at least 2,
or at least 4,2'-O-methyl modified nucleotides.
27. The method of claim 26, wherein at least one, or at least two,
of the 2'-O-methyl-modified nucleotides is part of a sequence of 4
or more contiguous nucleotides from SEQ ID NO:1.
Description
RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional
Application No. 60/634,849, filed Dec. 9, 2004, which is
incorporated herein by reference in its entirety.
TECHNICAL FIELD
[0002] This invention relates to the field of immunotherapy and
drug discovery by providing sequence specific oligoribonucleotide
agents that are capable of inducing an immune response in a subject
as well as a method for avoiding sequence specific immune responses
to RNAi agents.
BACKGROUND
[0003] Double-stranded RNA molecules (dsRNA) can block gene
expression by virtue of is a highly conserved regulatory mechanism
known as RNA interference (RNAi). Briefly, the RNA III Dicer enzyme
processes dsRNA into small interfering RNA (also sometimes called
short interfering RNA or siRNA) of approximately 22 nucleotides.
One strand of the siRNA (the "antisense strand") then serves as a
guide sequence to induce cleavage of messenger RNAs (mRNAs)
including a nucleotide sequence which is at least partially
complementary to the sequence of the antisense strand by an
RNA-induced silencing complex RISC. The antisense strand is not
cleaved or otherwise degraded in this process, and the RISC
including the antisense strand can subsequently affect the cleavage
of further mRNAs.
[0004] The process of posttranscriptional dsRNA-dependent gene
silencing is commonly referred to as RNA interference (RNAi)
(Tuschl, T. Chembiochem 2, 239-45 (2001), Zamore, P. D. Science
296, 1265-9 (2002), Hannon, G. J. Nature 418, 244-51 (2002)). It
has been proposed that eukaryotes utilize RNAi to protect their
genomes against invading foreign genetic elements such as viruses.
The formation of dsRNA during viral replication is interpreted by
the cell as a signal for unwanted gene activity (Ahlquist, P.
Science 296, 1270-3 (2002), Plasterk, R. H. Science 296, 1263-5
(2002)). Dicer RNase III rapidly processes dsRNA to small dsRNA
fragments of distinct size and structure, the small interfering
RNAs (siRNAs), which direct the sequence-specific degradation of
the single-stranded mRNAs of the invading genes (Elbashir, S. M. et
al. Nature 411, 494-8 (2001), Elbashir, S. M., et al, Genes Dev 15,
188-200 (2001), Hammond, S. M., et al. Nature 404, 293-6 (2000),
Zamore, P. D., et al. Cell 191, 25-33 (2000)). Such siRNA duplexes
have 2-3 nt 3' overhanging ends and contain 5' phosphate and free
3' hydroxyl termini (Elbashir, S. M., et al. Embo J 20, 6877-88
(2001)). Cellular delivery of synthetic siRNA duplexes or
introduction of siRNA by plasmids or viral vectors is now widely
used to disrupt the activity of cellular genes homologous in
sequence to the introduced dsRNA.
[0005] An understanding of how siRNAs interact with mammalian
systems is important for refining this gene silencing technology
and for developing gene-specific therapeutic agents (Tuschl, T. et
al, Mol Interv 2, 158-67 (2002)). For the recognition of long dsRNA
two different detection modes are known, the serine threonine
kinase PKR (Williams, B. R. Sci Signal Transduction Knowledge
Environment 89, RE2 (2001), Meurs, E. F. et al. Virol 66, 5805-14
(1992), Katze; M. G. et al. Mol Cell Biol 11, 5497-505 (1991)) and
TLR3 (Alexopoulou, L., et al. Nature 413, 732-8 (2001)). While PKR
is located in the cytosol, TLR3 is present in the endosomal
compartment (Matsumoto, M. et al. J Immunol 171, 3154-62 (2003)),
TLR3 is a member of the Toll-like receptor family that has evolved
to detect pathogen-specific molecules (Takeda, K., et al. Annu Rev
Immunol 21, 335-76 (2003)).
[0006] PKR possesses two dsRNA-binding domains, one of which has
high affinity for dsRNA, while the other shows considerably lower
affinity. Full activation of the PKR-mediated response requires
simultaneous binding of dsRNA to both domains, which may be
facilitated by long dsRNAs, e.g. dsRNAs exceeding 50-80 nucleotide
pairs in length, and seems to require dimerization (Manche, L., et
al., Mol Cell Biol, 12, 5238-48 (1992); Williams, B. G., Oncogene,
18, 6112-20 (1999)). High concentrations of dsRNAs, including
dsRNAs of less than 50 nucleotide pairs, or of other ligands for
the dsRNA binding site (e.g. Alu RNAs) inhibit the activation of
PKR. Early investigations seemed to prove that siRNA duplexes are
short enough to bypass general dsRNA-induced unspecific effects in
vertebrate cells (Bitko, V. et al. BMC Microbial, 1, 34 (2001)). A
number of more recent publications, however, indicates that a large
array of genes is differentially regulated upon the introduction of
short dsRNAs, including genes involved in the interferon pathway
and specifically the activation of PKR, even if not to a similar
extent as compared to the effect of long dsRNAs (Jackson, A. L. and
Linsley, P. S., Trends Genet, 20, 521-4 (2004); Jackson, A. L., et
al., Nat Biotechnol, 21, 635-7 (2003); Moss, E. G., and Taylor, J.
M., Nat Cell Biol, 5, 771-2 (2003); Bridge, A. J., et al., Nat
Genet, 34, 263-4 (2003); Sledz, C. A., et al., Nat Cell Biol, 5,
834-9 (2003); Heidel, J. D., et al., Nat Biotechnol, 22, 1579-81
(2004); Kim, D. H., et al., Nat Biotechnol, 22, 321-5 (2004);
Zheng, X., and Bevilacqua, P. C., RNA, 10, 1934-45 (2004);
Pebemard, S., and Iggo, R., Differentiation, 72, 103-11 (2004)).
Which genes are up- or downregulated seems to be at least partly
siRNA-sequence specific, and the mechanism, or mechanisms,
underlying this regulation remain(s) to be elucidated.
[0007] A second characteristic feature of viral nucleic acids used
by the immune system to recognize viral infection are CpG motifs
found in viral DNA, which are detected via TLR9 (Lund, J., et al. J
Exp Med 198, 513-520 (2003), Krug, A. et al. Blood 103, 1433-7
(2004)). CpG motifs are unmethylated CG dinucleotides with certain
flanking bases. The frequency of CpG motifs is suppressed in
vertebrates, allowing the vertebrate immune system to detect
microbial DNA based on such CpG motifs (Krieg, A. M. et al. Nature
374, 546-9 (1995), Bauer, S. et al. Proc Natl Acad Sci USA 98,
9237-42 (2001), Wagner, H. Curr Opin Microbial 5, 62-9 (2002)).
Like TLR3, TLR9 is located in the endosomal compartment where it
directly binds to CpG motifs (Latz, E. et al. Nat Immunol 5, 190-8
(2004)).
[0008] In addition to long dsRNA and CpG DNA, two recent
publications suggest a third mechanism by which viral nucleic acids
are recognized. These studies demonstrate that single-stranded RNA
(ssRNA) of ssRNA viruses is detected via TLR7 (mouse and human) and
TLR8 (only human) (Diebold, S. S., Science 303, 1529-31 (2004),
Heil, F. et al. Science 303, 1526-9 (2004)). Guanine analogues have
been identified earlier as specific ligands for TLR7 and TLR8 (Lee,
J. et al. Proc Natl Acad Sci USA 100, 6646-51 (2003), Heil, F. et
al. Eur J Immunol 33, 2987-97 (2003)). Like TLR9 (receptor for CpG
DNA) (Latz, E. et al. Nat Immunol 5, 190-8 (2004)), TLR7 and TLR8
are located in the endosomal membrane.
[0009] Detection of viral nucleic acids leads to the production of
type I IFN (IFN-.alpha. and IFN-.beta.). The major producer of type
I IFN in humans is the plasmacytoid dendritic cell (also called
interferon producing cell, IPC). The plasmacytoid dendritic cell
(PDC) is a highly specialized subset of dendritic cells that is
thought to function as a sentinel for viral infection and that is
responsible for the vast amount of type I IFN during viral
infection (Asselin-Paturel, C. et al. Nat Immunol 2, 1144-50
(2001)). There is increasing evidence that PDC preferentially use
nucleic acid-based molecular patterns to detect viral infection.
TLR expression of human and mouse PDC is limited to TLR7 and TLR9
(Krug, A. et al. Eur J Immunol 31, 3026-37 (2001), Hornung, V. et
al. J Immunol 168, 4531-7 (2002), Edwards, A. D., et al. Eur J
Immunol 33, 827-33 (2003)).
[0010] Tokunaga et al, J. Natl. Cancer Inst. 72:955-962 (1984);
Messina et al., J. Immunol. 147: 1759-1764 (1991); Krieg et al.,
Nature 374: 546-549 (1995); Sato et al, Science 273: 352-354
(1996), teach that the presence of CpG dinucleotides in certain
sequence contexts in bacterial and synthetic
oligodeoxyribonucleotides (CpG DNAs) are known to activate
vertebrate innate immune reaction, T-cells and B cells.
[0011] Yamamoto et al., Jpn. J. Cancer Res. 79: 866-873 (1988);
Halpern et al., Cell Immunol., 167: 72-78 (1996); Klinman et al.,
Proc. Natl. Acad. Sci. U.S.A. 93: 2879-2883 (1996); Zhao et al.,
Antisense Nucleic Acid Drug Dev. 7: 495-502 (1997) teach that the
activation of immune cells by CpG DNA induces secretion of a number
of cytokines, including IFN-.gamma., IL-12, TNF-.alpha., and IL-6,
and stimulates expression of costimulatory surface molecules.
[0012] Krieg et al., supra; Yamamoto et al, J. lmmunol. 148;
4072-4076 (1992); Tokunaga et al., Microbiol. Immunol. 36: 55-66
(1992); Liang et al J. Clin. Invest. 98: 1119-1129 (1996); Hartmann
et al., J. Immunol. 164: 1617-1624 (2000), teach that the presence
of a CpG dinucleotide and the sequences flanking the dinucleotide
play a critical role in determining the immunostimulatory activity
of DNA, that CpG dinucleotides in palindromic or non-palindromic
hexameric sequences (P.sub.1. P.sub.2CGP.sub.3P.sub.4) are required
for immune stimulation, and further, that PuPuCGPyPy and PuTCG
motifs optimally activate murine and human immune systems,
respectively.
[0013] While these findings demonstrate that oligonucleotides are
useful as immune stimulating agents, some problems with such use
still exist. For example, long oligonucleotides are expensive to
make and species specificity of flanking sequences limits the
breadth of utility of any given oligonucleotide. There is,
therefore, a need for less expensive immunostimulatory agents, and
preferably immunostimulatory agents that have cross-species
efficacy as well as a need to identify additional sequence specific
motifs.
SUMMARY
[0014] The invention is based, at least in part, on the discovery
that a particular sequence motif in a single or double stranded RNA
molecule is effective at stimulating an immune response via IFN
induction, particularly in cells expressing TLR7, such as
plasmacytoid dendritic cells (PDC). Based on this discovery, the
present invention provides immunostimulatory oligonucleotide agents
that can be used to stimulate IFN production in a mammal as well as
methods of selectively designing single stranded antisense agents
and double stranded iRNA agents so as to induce a wanted immune
response or to avoid inducing an unwanted immune response.
[0015] The invention provides therapeutic compositions comprising a
single stranded or double stranded oligonucleotide as
immunostimulatory agents as well as a method of using such
composition for immunotherapy applications. The invention
specifically provides methods and compositions for enhancing the
immune response used for immunotherapy applications such as, but
not limited to, treatment of cancer, autoimmune disorders, asthma,
respiratory allergies, food allergies, and bacteria, parasitic, and
viral infections in adult and pediatric human and veterinary
applications. The invention further provides methods for making
such compounds. In addition, compounds of the invention are useful
as adjuvants in combination with DNA vaccines, antibodies, and
allergens; and in combination with other immunostimulatory agents,
chemotherapeutic agents, iRNA agents and/or antisense
oligonucleotides.
[0016] The oligonucleotide agents of the present invention will
comprise, consist of or consist essentially of the nucleotide
sequence
TABLE-US-00001 5'-GUCCUUCAA-3', (SEQ ID NO: 1)
[0017] In other embodiments, the oligonucleotide will consist of,
consist essentially of or comprise 4 or more, 5 or more, 6 or more,
7 or more or 8 or more contiguous nucleotides from SEQ ID NO:1,
preferably taken from the 5' end of this sequence, e.g. 5'-GUCC-3'
(SEQ ID NO:2), 5'-GUCCU-3' (SEQ ID NO:3), 5'-GUCCUU-3' (SEQ ID
NO:4), 5'-GUCCUUC-3' (SEQ ID NO:5), or 5'-GUCCUUCA-3' (SEQ ID
NO:6).
[0018] Specifically, in one aspect, the invention provides a method
of stimulating an immune response in a mammal comprising the step
of administering to said mammal an oligonucleotide agent consisting
of, consisting essentially of, or comprising a sequence of 4 or
more, 5 or more, 6 or more, 7 or more or 8 or more contiguous
nucleotides from SEQ ID NO:1, preferably taken from the 5' end of
this sequence. Said oligonucleotide agent may consist of, consist
essentially of, or comprise SEQ ID NO:1, or a sequence that differs
by not more than 1 or not more than 2 nucleotides from SEQ ID NO:1.
Said sequence may be chosen from the group of SEQ ID NO:2, SEQ ID
NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6. The
oligonucleotide may be an iRNA agent, or it may be a single
stranded RNA agent.
[0019] In a second aspect, the invention provides a method of
making an oligonucleotide agent so as to avoid stimulating an
immune response in a mammal, comprising the step of eliminating
from a potential agent pool any agent that comprises a sequence of
4 or more, 5 or more, 6 or more, 7 or more or 8 or more contiguous
nucleotides from SEQ ID NO:1, preferably taken from the 5' end of
this sequence, or a sequence that differs from SEQ ID NO:1 by not
more than one or not more than 2 nucleotides. The oligonucleotide
may be an iRNA agent, or it may be a single stranded RNA agent.
[0020] In a third aspect, the instant invention provides an
isolated oligonucleotide agent consisting of, consisting
essentially of, or comprising a sequence of 4 or more, 5 or more, 6
or more, 7 or more or 8 or more contiguous nucleotides from SEQ ID
NO:1, preferably taken from the 5' end of this sequence. The
oligonucleotide agent may consist of, consist essentially of, or
comprise SEQ ID NO:1, or a sequence that differs by not more than 1
or not more than 2 nucleotides from SEQ ID NO:1. Said sequence may
be chosen from the group of: SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4,
SEQ ID NO:5, and SEQ ID NO:6. The oligonucleotide may be an iRNA
agent, or it may be a single stranded RNA agent. It may further
comprise at least one 2'-fluoro-modified nucleotide, wherein the
2'-fluoro-modified nucleotide is not part of a sequence of 4 or
more contiguous nucleotides from SEQ ID NO:1. Where the
oligonucleotide agent is an iRNA agent, it may be specific for
(e.g. one strand is at least partially complementary to) any one of
the genes of Table 8.
[0021] In a fourth aspect, the present invention provides a method
of making an oligonucleotide agent so as to induce an immune
response in a mammal, comprising the step of adding to a potential
agent pool any agent that comprises 4 or more, 5 or more, 6 or
more, 7 or more, or 8 or more contiguous nucleotides of SEQ ID
NO:1, or a sequence that differs from SEQ ID NO:1 by not more than
one or not more than 2 nucleotides. The oligonucleotide may be an
iRNA agent, or it may be a single stranded RNA agent.
[0022] In a fifth aspect, the invention provides a method of
concomitantly inhibiting the expression of a gene and inducing an
immune response in a mammal, comprising administering to said
mammal an iRNA agent comprising a sequence of 4 or more, 5 or more,
6 or more, 7 or more, or 8 or more contiguous nucleotides of SEQ ID
NO:1, preferably taken from the 5' end of this sequence, or a
sequence that differs from SEQ ID NO:1 by not more than one or not
more than 2 nucleotides. Said sequence may be chosen from the group
of: SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID
NO:6. Said gene may be any one of the genes of Table 8.
[0023] In a sixth aspect, the present invention provides a method
of evaluating an iRNA agent comprising: [0024] providing a
candidate iRNA agent; [0025] reviewing the candidate iRNA agent to
determine if it includes SEQ ID NO:1 or a sequence that differs
from SEQ ID NO:1 by 1 or 2 nucleotides.
[0026] Said method may further comprise modifying the iRNA agent to
remove the sequence of SEQ ID NO:1 or the sequence that differs
from SEQ ID NO:1 by 1 or 2 nucleotides.
[0027] In a seventh aspect, the present invention provides a
pharmaceutical composition comprising an oligonucleotide of the
invention and a pharmaceutically acceptable carrier. Said
pharmaceutical composition may be a vaccine.
[0028] In an eighth aspect, the present invention provides a method
of making an oligonucleotide agent so as to avoid stimulating an
immune response in a mammal, wherein said oligonucleotides
comprises a sequence of 4 or more, 5 or more, 6 or more, 7 or more
or 8 or more contiguous nucleotides from SEQ ID NO:1, comprising
providing the oligonucleotide agent in such manner that it contains
at least 2, or at least 4, 2'-O-methyl modified nucleotides. At
least one, or at least two, of the 2'-O-methyl-modified nucleotides
may be part of a sequence of 4 or more contiguous nucleotides from
SEQ ID NO:1
BRIEF DESCRIPTION OF DRAWINGS
[0029] FIGS. 1A-1B: In HEK 293 Cells siRNA can be Used to Inhibit
TLR9 Expression without Inducing Non-Target-Specific Type I
IFN-Mediated STAT1-or STAT2-Phosphorylating Activity
[0030] HEK 293 cells (50.000/well) were incubated with different
RNA molecules and lipofectamine. FIG. 1A: HEK 293 cells expressing
a construct of human TLR9 with a C-terminal YFP-tag were
transfected with four siRNAs complementary to different regions of
human TLR9 mRNA. Transfection with siRNA targeting GFP mRNA and
TLR2 (referred to as sirna2.1 in the figures) mRNA served as a
positive or negative control. At 20 hours the median fluorescence
intensity of YFP-tag expression was analyzed by flow cytometry.
Results are shown as mean values.+-.SEM (n=3). FIG. 1B: HEK 293
cells were incubated alone (lane 1), with lipofectamine (lane 2),
with a 500 bp long dsRNA (10 .mu.g/ml, lane 3), or were transfected
with lipofectamine complexed with a 500 bp long dsRNA (lane 4),
complexed with four different siRNAs targeting the human TLR9 mRNA
(TLR9.1, TLR9.2, TLR9.3 and TLR9.4; lane 5 to 8; TLR9.1, TLR9.2,
TLR9.3 and TLR9.4 are referred to as sirna9.1, sirna9.2, sirna9.3,
and sirna9.4, respectively, in the figures). After 24 hours
supernatants were harvested and added to BL41 cells
(1.times.10.sup.5 cells/condition). Addition of recombinant
IFN-.beta. (100 U/ml) served as a positive control (lane 9). After
30 min, BL41 cells were lysed and subjected to SDS-page to examine
STAT1- and STAT2-phosphorylation. Supernatants were collected from
quadruplicates. One representative experiment out of three is
shown.
[0031] FIGS. 2A-2E: Sequence-Dependent Induction of IFN-.alpha. in
Plasmacytoid Dendritic Cells by siRNA is Based on Motif Recognition
on the Single-Strand Level
[0032] PDC (50.000/well) were transfected with different RNA
oligonucleotides using lipofectamine (0.5 .mu.l). After 36 hours,
IFN-.alpha. production was measured in the supernatants. FIG. 2A:
PDC were transfected with 200 ng of four different siRNAs (TLR9.1,
TLR9.2, TLR9.3 and TLR9.4). The TLR9-ligand CpG-A (ODN 2216, grey
bar) served as a positive control for IFN-.alpha. induction.
Results represent the mean IFN-.alpha. production.+-.SEM from
eleven individual donors (p<0.0001 for TLR9.1 vs. TLR9.2,
p<0.0001 for TLR9.1 vs. TLR9.3, p<0.0001 for TLR9.3 vs.
TLR9.1 and p<0.001 for TLR9.3 vs. TLR9.4). FIG. 2B: PDC were
transfected with decreasing amounts (200 ng, 100 ng, 50 ng, 25 ng)
of TLR9.1, TLR9.2, TLR9.3 or TLR9.4. Results represent the mean
IFN-.alpha. production.+-.SEM from three individual donors. FIG.
2C: PDC were transfected with either siRNA9.2 duplex or the
corresponding sense and anti-sense strands. Results from ten
individual donors were summarized and are depicted as mean
values.+-.SEM. FIG. 2D (left panel): The FITC-modified version of
the siRNA9.2 sense strand or the corresponding annealed
siRNA-duplex were incubated with or without RNAse at 266 .mu./ml.
After three hours 4 .mu.l of this preparation were analyzed on a 3%
agarose-gel, whereas untreated samples were included as controls.
FIG. 2D (right panel): Subsequently samples were purified via
siRNA-purification-columns to remove RNase and 3.mu.l of this
preparation was transfected into PDCs. After 36 h
IFN-.alpha.-production was assessed by ELISA. Data from one of two
representative experiments are depicted. FIG. 2E: The
self-stabilizing single-stranded hairpin-version of siRNA-duplex
9.2 (see table 2) is compared to the siRNA9.2 duplex. Data from two
independent experiments are is presented as means.+-.SEM.
[0033] FIGS. 3A-3B: A Sequence of 9 Bases at the 3' End of the
RNA9.2 Sense Strand is Responsible for the Immunostimulatory
Activity
[0034] PDC were transfected with different RNA oligonucleotides.
After 36 hours, IFN-.alpha. production was measured in the
supernatant. FIG. 3A: PDC were transfected with the sense strand of
TLR9.2 (RNA9.2s, the original sequence designated "n") and with
fluorescein-tagged (5'F or 3'F) versions of RNA9.2s. * indicate
p<0.05. FIG. 3B: PDC were transfected with the sense strand of
TLR9.2, a 19-mer polyA-oligonucleotide, a panel of RNA9.2s
derivatives in which base number 8 to 12 counting from the 5'end
were replaced by adenosine (L8A to L12A), a panel of RNA9.2s
derivatives in which one, two, three or six bases within the 9
bases counting from the 3'end (putative motif) were replaced by
adenosine or uridine (in order to disrupt the putative 9mer motif),
or two shortened versions of RNA9.2s (a 16mer and a 12mer both
containing the putative 9mer motif of the 3'end of RNA9.2s) and a
19mer RNA oligonucleotide containing the putative 9mer motif two
times within its sequence (DR). A detailed list of all sequences
used is provided in Table 2. Results from four individual donors
are depicted as mean values.+-.SEM.
[0035] FIGS. 4A-4B: LNA-Modifications of the Sense and the
Anti-Sense Strand in siRNA TLR9.2 Reveal IFN-.alpha. Induction and
Silencing as Two Independent Activities of siRNA
[0036] PDC were transfected with different RNA oligonucleotides.
After 36 hours, IFN-.alpha. production was measured in the
supernatant. FIG. 4A: The sense strand of TLR9.2 (RNA9.2s) and its
derivatives with and without LNA-modification of the 5' and the
3'end (n, 5'LNA, 3'LNA, 5'3'LNA) are compared (see Table 2). FIG.
4B: Different LNA-modified versions of the sense and the antisense
strand of siRNA9.2 were annealed to duplexes and transfected into
PDC. After 36 hours, IFN-.alpha. production was measured in the
supernatants (black bars). Results from five individual donors are
depicted as mean values.+-.SEM. In addition, HEK 293 cells stably
expressing a construct of human TLR9 with a C-terminal YFP-tag were
transfected with the same type of siRNA9.2 derivatives.
Transfection with siRNA-duplexes targeting GFP, TLR2 or TLR4 mRNA
served as controls. 20 hours after transfection the median
fluorescence intensity of YFP-tag expression was analyzed by flow
cytometry (open bars). Data are depicted as percentage of
TLR9-expression referring to siRNA2.1 as 100% and the unmodified
siRNA9.2 as 0%. Results are shown as mean values.+-.SEM (n=3).
[0037] FIGS. 5A-5D: Sequence Dependent Induction of Systemic Immune
Responses by siRNA in Mice in vivo.
[0038] FIG. 5A: Murine bone-marrow cultures (129Sv) were stimulated
with siRNA TLR9.2 duplex, sense or anti-sense strand or a 19mer
poly(A)-oligonucleotide complexed to polycationic peptide. ODN 1826
(6 .mu.g/ml) and R848 (1H-Imidazo(4,5-c)quinoline-1-ethanol
(ethoxymethyl)-Alpha; 0.5 .mu.g/ml) served as positive controls.
After 36 hours, supernatants were collected and IFN-.alpha.
production was assessed by ELISA. Data are presented as mean
values.+-.SEM from triplicates of pooled bone-marrow cultures from
three individual mice. FIG. 5B: 5 .mu.g of siRNA TLR2.1, TLR9.2, or
single strands TLR9.2a (sense strand) or TLR9.2as (anti-sense
strand) were complexed with DOTAP and administered via i.v.
injection to 129Sv mice (3 mice per group). DOTAP without RNA was
included as a control. After seven hours serum was collected and
IFN-.alpha. production was assessed by ELISA. Data are presented as
mean values.+-.SEM. FIG. 5C: 41 hours after injection, spleen cells
were isolated and CD8+ T cells and MDCs were identified in spleen
cells by using anti-CD3, anti-CD8, anti-CD11b and anti-CD11c
antibodies. CD69 or CD86-expression was assessed using an
appropriate isotype control Ab. Results from three mice per group
are presented as mean values.+-.SEM. FIG. 5D: The siRNA TLR9.2, CpG
ODN 1826 (both 5 .mu.g) or HBS with or without DOTAP-complexation
were administered via i.v. injection to 129P2/OlaHsd mice (3 mice
per group). After eighteen hours, serum was collected and
IFN-.alpha. production was assessed by ELISA (left panel). In
addition, CD86 expression was analysed on splenic MDCs 41 hours
after injection (right panel). Data are presented as mean
values.+-.SEM.
[0039] FIGS. 6A-6C: TLR7 is Required for siRNA Recognition
[0040] FIG. 6A: Murine bone-marrow cultures from wild-type (black
bars) or TLR7-/- (open bars) C57BL/6 mice were incubated with siRNA
TLR9.2, with the sense strand or the antisense strand of TLR9.2 or
a 19mer poly(A) oligonucleotide complexed with polycationic
peptide. CpG ODN 1826 (TLR9) and loxoribine (TLR7) were used at a
concentration of 6 .mu.g/ml or 0.5 .mu.g/ml respectively.
Supernatants were collected 36 h after stimulation and
IFN-.alpha.-production was assessed by ELISA. Data are presented as
mean values.+-.SEM from triplicates of pooled bone-marrow cultures
from two individual mice. FIG. 6B: 5 .mu.g of siRNA TLR9.2 was
complexed with DOTAP and injected i.v. into either wildtype (black
bars) or TLR7 -/-(open bars) C57BL/6 mice. Two mice per group were
used. After 7 and 18 hours serum was collected and IFN-.alpha.
production was assessed by ELISA. FIG. 6C: 41 hours after
injection, spleen cells were isolated. CD8+ and CD4+ T cells were
identified in spleen cells by using anti-CD3 and anti-CD8
antibodies. CD69-expression was assessed using an appropriate
isotype control antibody (grey bar). One representative histogram
is shown for CD8+ T cells. The expression of CD69 or CD86 was
analyzed on PDC (CD11c.sup.+, CD11b.sup.- and B220.sup.++) and
myeloid dendritic cells (MDC: CD11c.sup.++, CD11b.sup.++ and
B220.sup.-). Expression of CD69 and CD86 is presented as
means.+-.SEM.
DETAILED DESCRIPTION
[0041] The invention is based, at least in part, on the discovery
that a particular sequence motif in a single or double stranded RNA
molecule is effective at stimulating an immune response via IFN
induction, particularly in cells expressing TLR7, such as
plasmacytoid dendritic cells (PDC). Based on this discovery, the
present invention provides immunostimulatory oligonucleotide agents
that can be used to stimulate IFN production in a mammal as well as
methods of selectively designing single stranded antisense agents
and double stranded iRNA agents so as to induce a wanted immune
response or to avoid inducing an unwanted immune response.
[0042] Specifically, the present invention provides therapeutic
compositions comprising a single stranded or double stranded
oligonucleotide as an immunostimulatory agent as well as a method
of using such composition for immunotherapy applications. The
invention specifically provides methods and compositions for
enhancing the immune response used for immunotherapy applications
such as, but not limited to, treatment of cancer, autoimmune
disorders, asthma, respiratory allergies, food allergies, and
bacteria, parasitic, and viral infections in adult and pediatric
human and veterinary applications. The invention further provides
methods for making such compounds. In addition, compounds of the
invention are useful as adjuvants in combination with DNA vaccines,
antibodies, and allergens; and in combination with other
immunostimulatory agents, chemotherapeutic agents, iRNA agents
and/or antisense oligonucleotides.
[0043] The present invention provides oligonucleotide agents that
comprise, consist of or consist essentially of the nucleotide
sequence
TABLE-US-00002 5'-GUCCUUCAA-3'. (SEQ 1D NO: 1)
[0044] In other embodiments, the oligonucleotide agent will consist
of, consist essentially of or comprise 4 or more, 5 or more, 6 or
more, 7 or more or 8 or more contiguous nucleotides from SEQ ID
NO:1, preferably taken from the 5' end of this sequence, e.g.
5'-GUCC-3' (SEQ ID NO:2), 5'-GUCCU-3' (SEQ ID NO:3), 5'-GUCCUU-3'
(SEQ ID NO:4), 5'-GUCCUUC-3' (SEQ ID NO:5), or 5'-GUCCUUCA-3' (SEQ
ID NO:6).
[0045] As used herein, an oligonucleotide agent consists of SEQ ID
NO:1 when it does not contain other nucleotides in the agent. As
used herein, an oligonucleotide agent consists essentially of SEQ
ID NO:1 when it contains no more than 1, 2, 3, or 4 other
nucleotides in the agent. As used herein, an oligonucleotide agent
comprises SEQ ID NO:1 when it contains other nucleotides in the
agent. Preferably, such agents will contain no more than 21 other
nucleotides and more preferably no more than from about 15 to about
10 other nucleotides in the agent where the agent does not comprise
a double stranded structure. Oligonucleotide agents comprising a
double stranded structure, e.g. iRNA agents, will contain no more
than 21, 15 or 10 other nucleotides in a strand comprising SEQ ID
NO:1, and preferably no more than 30, 24, or 19 nucleotides in a
strand not comprising SEQ ID NO:1.
[0046] As used herein, the term "oligonucleotide" refers to a
polynucleotide formed from a plurality of linked nucleoside units.
Such oligonucleotides can be obtained from existing nucleic acid
sources, including genomic or cDNA, but are preferably produced by
synthetic methods. In preferred embodiments each nucleoside unit
includes a heterocyclic base and a pentofuranosyl, trehalose,
arabinose, 2'-deoxy-2'-substituted arabinose, 2'-O-substituted
arabinose or hexose sugar group. The nucleoside residues can be
coupled to each other by any of the numerous known internucleoside
linkages. Such internucleoside linkages include, without
limitation, phosphodiester, phosphorothioate, phosphorodithioate,
alkylphosphonate, alkylphosphonothioate, phosphotriester,
phosphoramidate, siloxane, carbonate, carboalkoxy, acetamidate,
carbamate, morpholino, borano, thioether, bridged phosphoramidate,
bridged methylene phosphonate, bridged phosphorothioate, and
sulfone internucleoside linkages. The term "oligonucleotide" also
encompasses polynucleosides having one or more stereospecific
internucleoside linkage (e.g., (R.sub.p)- or
(S.sub.p-)phosphorothioate, alkylphosphonate, or phosphotriester
linkages).
[0047] The oligonucleotides of the invention can include naturally
occurring nucleosides, modified nucleosides, or mixtures thereof,
so long as they consist of, consist essentially of or comprise SEQ
ID NO:1. As used herein, the term "modified nucleoside" is a
nucleoside that includes a modified heterocyclic base, a modified
sugar moiety, or a combination thereof. In some embodiments, the
modified nucleoside is a non-natural pyrimidine or purine
nucleoside, as herein described. In some embodiments, the modified
nucleoside is a 2'-substituted ribonucleoside an arabinonucleoside
or a 2'-deoxy-2'-substituted-arabinoside.
[0048] As used herein, the term "2'-substituted ribonucleoside" or
"2'-substituted arabinoside" includes ribonucleosides or
arabinonucleoside in which the hydroxyl group at the 2' position of
the pentose moiety is substituted to produce a 2'-substituted or
2'-O-substituted ribonucleoside. Preferably, such substitution is
with a lower alkyl group containing 1-6 saturated or unsaturated
carbon atoms, or with an aryl group having 6-10 carbon atoms,
wherein such alkyl, or aryl group may be unsubstituted or may be
substituted, e.g., with halo, hydroxy, trifluoromethyl, cyano,
nitro, acyl, acyloxy, alkoxy, carboxyl, carboalkoxy, or amino
groups. Examples of 2'-O-substituted ribonucleosides or
2'-O-substituted-arabinosides include, without limitation
2'-O-methylribonucleosides or 2'-O-methylarabinosides and
2'-O-methoxyethylribonucleosides or
2'-O-methoxyethylarabinosides.
[0049] The term "2'-substituted ribonucleoside" or "2'-substituted
arabinoside" also includes ribonucleosides or arabinonucleosides in
which the 2'-hydroxyl group is replaced with a lower alkyl group
containing 1-6 saturated or unsaturated carbon atoms, or with an
amino or halo group. Examples of such 2'-substituted
ribonucleosides or 2'-substituted arabinosides include, without
limitation, 2'-amino, 2'-fluoro, 2'-allyl, and 2'-propargyl
ribonucleosides or arabinosides.
[0050] The term "oligonucleotide" includes hybrid and chimeric
oligonucleotides. A "chimeric oligonucleotide" is an
oligonucleotide having more than one type of internucleoside
linkage. One preferred example of such a chimeric oligonucleotide
is a chimeric oligonucleotide comprising a phosphorothioate,
phosphodiester or phosphorodithioate region and non-ionic linkages
such as alkylphosphonate or alkylphosphonothioate linkages (see
e.g., Pederson et al. U.S. Pat. Nos. 5,635,377 and 5,366,878).
[0051] A "hybrid oligonucleotide" is an oligonucleotide having more
than one type of nucleoside. One preferred example of such a hybrid
oligonucleotide comprises a ribonucleotide or 2'-substituted
ribonucleotide region, and a deoxyribonucleotide region (see, e.g.,
Metelev and Agrawal, U.S. Pat. Nos. 5,652,355, 6,346,614 and
6,143,881).
[0052] An "immunostimulatory" agent, or an agent that "stimulates
an immune response" herein means an agent that stimulates in a cell
in vitro or in an organism in vivo a response that is commonly
understood to be part of the natural defenses of an organism
against biological pathogens, e.g. the immune system. Such response
can be, for example, without limitation, be the production of
antibodies or cytokines, e.g. interferons, e.g. interferon alpha
(IFN-.alpha.).
[0053] In another embodiment, the invention provides
immunomodulatory oligonucleotide conjugates and oligonucleotide
agent conjugates, for example comprising an immunomodulatory
oligonucleotide or an oligonucleotide agent, as described above,
and an antigen conjugated to the oligonucleotide agent at a
position other than the accessible 5'end. In some embodiments, the
non-nucleotidic linker comprises an antigen, which is conjugated to
the oligonucleotide. In some other embodiments, the antigen is
conjugated to the oligonucleotide at a position other than its 3'
end. In some embodiments, the antigen produces a vaccine effect.
Other oligonucleotide agent conjugates are further described
below.
[0054] Where an oligonucleotide agent is conjugated to an antigen,
the antigen is preferably selected from the group consisting of
antigens associated with a pathogen, antigens associated with a
cancer, antigens associated with an auto-immune disorder, and
antigens associated with other diseases such as, but not limited
to, veterinary or pediatric diseases. As used herein, the term
"associated with" means that the antigen is present when the
pathogen, cancer, auto-immune disorder, food allergy, respiratory
allergy, asthma or other disease is present, but either is not
present, or is present in reduced amounts, when the pathogen,
cancer, auto-immune disorder, food allergy, respiratory allergy, or
disease is absent.
[0055] The immunomodulatory oligonucleotide or oligonucleotide
agent is covalently linked to the antigen, or it is otherwise
operatively associated with the antigen. As used herein, the term
"operatively associated with" refers to any association that
maintains the activity of both oligonucleotide agent and antigen.
Nonlimiting examples of such operative associations include being
part of the same liposome or other such delivery vehicle or
reagent. In embodiments wherein the oligonucleotide agent is
covalently linked to the antigen, such covalent linkage preferably
is at any position on the oligonucleotide agent other than an
accessible 5' end of an immunostimulatory oligonucleotide. For
example, the antigen may be attached at an intemucleoside linkage
or may be attached to the non-nucleotidic linker. Alternatively,
the antigen may itself be the non-nucleotidic linker.
[0056] In a preferred embodiment, the oligonucleotide or
oligonucleotide agent is an iRNA agent, such as an antisense agent
or siRNA agent. In that sense, oligonucleotide or oligonucleotide
agent, as used herein, can also refer to a complex consisting of
more than one, and preferably two, oligonucleotide molecules, which
occur essentially only in direct association, e.g, by hybridizing
to each other, under certain conditions, such as those found in the
serum of mammals, e.g. humans, or in the cytoplasm of mammalian,
and particularly human, cells. To be an oligonucleotide agent
hereunder, at least one of the more than one oligonucleotide
molecules forming the complex consists, consists essentially of, or
comprises SEQ ID NO:1.
[0057] An iRNA agent, as used herein, is an agent capable of
specifically interfering with the expression of a target gene, such
as an antisense or siRNA agent. Typically, an iRNA agent comprises
an oligonucleotide sequence which is complementary to a part of an
mRNA encoded by the target gene. It interferes with the expression
of the target gene by any mechanism, e.g. by blocking the
translation of the mRNA, by initiating the degradation of the mRNA,
e.g. via an RNA interference mechanism, or by blocking the
transcription of the gene, e.g. via DNA methylation.
[0058] iRNA Agent Design
[0059] The present invention further provides methods of
designing/selecting an iRNA agent, such as an antisense or siRNA
agent, such that it will either induce an inflammatory response or
avoid inducing an inflammatory response. Specifically, this method
comprises the step of either including SEQ ID NO:1, or a fragment
thereof in an oligonucleotide agent, such as an antisense or siRNA
agent, when an IFN/inflammatory response is wanted or not including
this sequence in the agent when an inflammatory response is not
wanted.
[0060] Accordingly, the present invention provides, inter alia,
iRNA agents comprising an antisense strand and, optionally, a sense
strand, comprising a sequence of at least 15, 16, 17, 18, 19, 20,
21 or 23 nucleotides, wherein at least one of the sequences of the
antisense and the optional sense strand comprises SEQ ID NO:1 when
IFN production is wanted and wherein none of the antisense strand
and the optional sense strand will contain this sequence when IFN
production is to be avoided.
[0061] The antisense strand of an iRNA agent should be equal to or
at least, 15, 16 17, 18, 19, 25, 29, 40, or 50 nucleotides in
length. It should be equal to or less than 50, 40, or 30,
nucleotides in length. Preferred ranges are 15-30, 17 to 25, 19 to
23, and 19 to 21 nucleotides in length.
[0062] The sense strand, if any, of an iRNA agent should he equal
to or at least 15, 16 17, 18, 19, 25, 29, 40, or 50 nucleotides in
length. It should be equal to or less than 50, 40, or 30
nucleotides in length. Preferred ranges are 15-30, 17 to 25, 19 to
23, and 19 to 21 nucleotides in length.
[0063] The double stranded portion, if any, of an iRNA agent should
be equal to or at least, 15, 16 17, 18, 19, 20, 21, 22, 23, 24, 25,
29, 40, or 50 nucleotide pairs in length. It should be equal to or
less than 50, 40, or 30 nucleotides pairs in length. Preferred
ranges are 15-30, 17 to 25, 19 to 23, and 19 to 21 nucleotides
pairs in length.
[0064] In designing iRNA agents according to the invention, it may
be advantageous to first identify a region in an mRNA sequence of a
target gene which is either complementary (for use in antisense
oligonucleotides and siRNA antisense strands) or identical (for use
in an siRNA sense strand) to 4 or more, 5 or more, 6 or more, 7 or
more or 8 or more contiguous nucleotides from SEQ ID NO:1. The iRNA
agent can then be chosen to comprise the sequence complementary or
identical sequence to this region, plus a number of suitable
additional nucleotides to confer target gene expression inhibitory
activity. Therein, SEQ ID NO:1 may be comprised anywhere within the
iRNA agent, e.g. in a 3'- or 5'-terminal region, or anywhere
within, of either a sense or antisense strand of the iRNA
agent.
[0065] However, where it is desired to inhibit a certain gene where
its mRNA does not comprise a region of complete complementarity or
identity to SEQ ID NO:1, an iRNA agent comprising mismatches to the
target gene mRNA may also be used. Since mismatches are most
tolerated in the terminal regions of either strand of, for example,
an siRNA, the mismatches will best be introduced in these terminal
regions. For example, the 3'-most or 5'-most 4, 5, 6, 7, 8 or 9
nucleotides of the sense strand or the 3'-most 4, 5, 6, 7, 8 or 9
nucleotides of the antisense strand of an siRNA may be chosen from
SEQ ID NO:1, wherein not more than 1, not more than 2, or not more
than 3 nucleotides represent a mismatch to the target mRNA, and the
remaining nucleotides are chosen fully identical or complementary
to the target mRNA. The nucleotides in positions 2-9 (counting
5'.fwdarw.3') of the antisense strand, however, are believed to be
critical for target mRNA recognition (Haley, B., and Zamore, P. D.,
Nat Struct Mol Biol, 11, 599-606 (2004)). Therefore, it is
preferred that in this region (sometimes referred to as the "seed
region") there is perfect complementarity to the target mRNA.
[0066] In such embodiment, said target gene can be essentially any
gene the sequence of which enables the design of a fully matched or
partly mismatched iRNA agent as described above. The gene may, for
example be a mammalian gene, e.g. a human gene. For example,
without limitation, such a gene may be an oncogene, a gene involved
in an immune response, a gene involved in metabolism, or a gene
encoding a growth factor, a transcription factor, or a receptor.
Table 7 contains a non-limiting list of names of exemplary gene
transcripts, as obtained from BLAST searching databases of human
mRNA sequences, which may be inhibited in this fashion, as they
comprise a sequence identical or complementary to SEQ ID NO:1.
Alternatively, the target gene may be a gene from an organism that
is pathogenic to animals, preferably mammals, more preferably
humans, such as a bacterium or a virus.
[0067] iRNA Agent Chemistry
[0068] iRNA agents discussed herein include otherwise unmodified
RNA as well as RNA which have been modified, e.g., to improve
efficacy, and polymers of nucleoside surrogates. Unmodified RNA
refers to a molecule in which the components of the nucleic acid,
namely sugars, bases, and phosphate moieties, are the same or
essentially the same as that which occur in nature, preferably as
occur naturally in the human body. The art has referred to rare or
unusual, but naturally occurring, RNAs as modified RNAs, see, e.g.,
Limbach et al., (1994) Nucleic Acids Res. 22: 2183-2196. Such rare
or unusual RNAs, often termed modified RNAs (apparently because
these are typically the result of a post-transcriptional
modification) are within the term unmodified RNA, as used herein.
Modified RNA as used herein refers to a molecule in which one or
more of the components of the nucleic acid, namely sugars, bases,
and phosphate moieties, are different from that which occurs in
nature, preferably different from that which occurs in the human
body. While they are referred to as modified "RNAs," they will of
course, because of the modification, include molecules which are
not RNAs. Nucleoside surrogates are molecules in which the
ribophosphate backbone is replaced with a non-ribophosphate
construct that allows the bases to the presented in the correct
spatial relationship such that hybridization is substantially
similar to what is seen with a ribophosphate backbone, e.g.,
non-charged mimics of the ribophosphate backbone. Examples of each
of the above are discussed herein.
[0069] Enhanced Nuclease Resistance
[0070] For increased nuclease resistance and/or binding affinity to
a target mRNA, an oligonucleotide agent can include, for example,
2'-modified ribose units and/or phosphorothioate linkages. E.g.,
the 2' hydroxyl group (OH) can be modified or replaced with a
number of different "oxy" or "deoxy" substituents.
[0071] Examples of "oxy"-2' hydroxyl group modifications include
alkoxy or aryloxy (OR, e.g., R.dbd.H, alkyl, cycloalkyl, aryl,
aralkyl, heteroaryl or sugar); polyethyleneglycols (PEG),
O(CH.sub.2CH.sub.2O).sub.nCH.sub.2CH.sub.2OR; "locked" nucleic
acids (LNA) in which the 2' hydroxyl is connected, e.g., by a
methylene bridge, to the 4' carbon of the same ribose sugar;
O-AMINE and aminoalkoxy, O(CH.sub.2).sub.nAMINE, (e.g.,
AMINE=NH.sub.2; alkylamino, dialkylamino, heterocyclyl amino,
arylamino, diaryl amino, heteroaryl amino, or diheteroaryl amino,
ethylene diamine, polyamino). It is noteworthy that
oligonucleotides containing only the methoxyethyl group (MOE),
(OCH.sub.2CH.sub.2OCH.sub.3, a PEG derivative), exhibit nuclease
stabilities comparable to those modified with the robust
phosphorothioate modification.
[0072] "Deoxy" modifications include hydrogen (i.e. deoxyribose
sugars, which are of particular relevance to the overhang portions
of partially ds RNA); halo (e.g., fluoro); amino (e.g. NH.sub.2;
alkylamino, dialkylamino, heterocyclyl, arylamino, diaryl amino,
heteroaryl amino, diheteroaryl amino, or amino acid);
NH(CH.sub.2CH.sub.2NH).sub.nCH.sub.2CH.sub.2-AMINE (AMINE=NH.sub.2;
alkylamino, dialkylamino, heterocyclyl amino, arylamino, diaryl
amino, heteroaryl amino, or diheteroaryl amino), --NHC(O)R
(R=alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar), cyano;
mercapto; alkyl-thio-alkyl; thioalkoxy; and alkyl, cycloalkyl,
aryl, alkenyl and alkynyl, which may be optionally substituted with
e.g., an amino functionality.
[0073] Preferred substitutents are 2'-methoxyethyl, 2'-OCH.sub.3,
2'-O-allyl, 2'-C-allyl, and 2'-fluoro.
[0074] To maximize nuclease resistance, the 2' modifications can be
used in combination with one or more phosphate linker modifications
(e.g., phosphorothioate).
[0075] The inclusion of furanose sugars in the oligonucleotide
backbone can also decrease endonucleolytic cleavage. An
oligonucleotide agent can be further modified by including a 3'
cationic group, or by inverting the nucleoside at the 3'-terminus
with a 3'-3' linkage. In another alternative, the 3'-terminus can
be blocked with an aminoalkylgroup, e.g., a 3' C5-aminoalkyl dT.
Other 3' conjugates can inhibit 3'-5' exonucleolytic cleavage.
While not being bound by theory, a 3' conjugate, such as naproxen
or ibuprofen, may inhibit exonucleolytic cleavage by sterically
blocking the exonuclease from binding to the 3'-end of
oligonucleotide. Even small alkyl chains, aryl groups, or
heterocyclic conjugates or modified sugars (D-ribose, deoxyribose,
glucose etc.) can block 3'-5'-exonucleases.
[0076] Similarly, 5' conjugates can inhibit 5'-3' exonucleolytic
cleavage. While not being bound by theory, a 5' conjugate, such as
naproxen or ibuprofen, may inhibit exonucleolytic cleavage by
sterically blocking the exonuclease from binding to the 5'-end of
oligonucleotide. Even small alkyl chains, aryl groups, or
heterocyclic conjugates or modified sugars (D-ribose, deoxyribose,
glucose etc.) can block 3'-5'-exonucleases.
[0077] Tethered Ligands
[0078] The properties of an oligonucleotide agent, including its
pharmacological properties, can be influenced and tailored, for
example, by the introduction of ligands, e.g. tethered ligands. An
oligonucleotide agent comprising a tethered ligand may also be
referred to herein as a conjugate or bioconjugate.
[0079] A wide variety of entities, e.g., ligands, can be tethered
to an oligonucleotide agent, e.g., to the carrier of a
ligand-conjugated monomer subunit. Examples are described below in
the context of a ligand-conjugated monomer subunit but that is only
preferred, entities can be coupled at other points to an
oligonucleotide agent.
[0080] Preferred moieties are ligands, which are coupled,
preferably covalently, either directly or indirectly via an
intervening tether, to the carrier. In preferred embodiments, the
ligand is attached to the carrier via an intervening tether. The
ligand or tethered ligand may be present on the ligand-conjugated
monomer when the ligand-conjugated monomer is incorporated into the
growing strand. In some embodiments, the ligand may be incorporated
into a "precursor" ligand-conjugated monomer subunit after a
"precursor" ligand-conjugated monomer subunit has been incorporated
into the growing strand. For example, a monomer having, e.g., an
amino-terminated tether, e.g., TAP-(CH.sub.2).sub.nNH.sub.2 may be
incorporated into a growing sense or antisense strand. In a
subsequent operation, i.e., after incorporation of the precursor
monomer subunit into the strand, a ligand having an electrophilic
group, e.g., a pentafluorophenyl ester or aldehyde group, can
subsequently be attached to the precursor ligand-conjugated monomer
by coupling the electrophilic group of the ligand with the terminal
nucleophilic group of the precursor ligand-conjugated monomer
subunit tether.
[0081] In preferred embodiments, a ligand alters the distribution,
targeting or lifetime of an oligonucleotide agent into which it is
incorporated. In preferred embodiments a ligand provides an
enhanced affinity for a selected target, e.g., molecule, cell or
cell type, compartment, e.g., a cellular or organ compartment,
tissue, organ or region of the body, as, e.g., compared to a
species absent such a ligand.
[0082] Preferred ligands can improve transport, hybridization, and
specificity properties and may also improve nuclease resistance of
the resultant natural or modified oligoribonucleotide, or a
polymeric molecule comprising any combination of monomers described
herein and/or natural or modified ribonucleotides.
[0083] Ligands in general can include therapeutic modifiers, e.g.,
for enhancing uptake; diagnostic compounds or reporter groups e.g.,
for monitoring distribution; cross-linking agents;
nuclease-resistance conferring moieties; and natural or unusual
nucleobases. General examples include lipophilic moleculeses,
lipids, lectins, steroids (e.g., uvaol, hecigenin, diosgenin),
terpenes (e.g., triterpenes, e.g., sarsasapogenin, Friedelin,
epifriedelanol derivatized lithocholic acid), vitamins,
carbohydrates (e.g., a dextran, pullulan, chitin, chitosan, inulin,
cyclodextrin or hyaluronic acid), proteins, protein binding agents,
integrin targeting molecules, polycationics, peptides, polyamines,
and peptide mimics.
[0084] The ligand may be a naturally occurring or recombinant or
synthetic molecule, such as a synthetic polymer, e.g., a synthetic
polyamino acid. Examples of polyamino acids include polyamino acid
is a polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid,
styrene-maleic acid anhydride copolymer,
poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic
anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer
(HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA),
polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide
polymers, or polyphosphazine. Example of polyamines include:
polyethylenimine, polylysine (PLL), spermine, spermidine,
polyamine, pseudopeptide-polyamine, peptidomimetic polyamine,
dendrimer polyamine, arginine, amidine, protamine, cationic
moieties, e.g., cationic lipid, cationic porphyrin, quaternary salt
of a polyamine, or an alpha helical peptide.
[0085] Ligands can also include targeting groups, e.g., a cell or
tissue targeting agent, e.g., a thyrotropin, melanotropin,
surfactant protein A, Mucin carbohydrate, a glycosylated
polyaminoacid, transferrin, bisphosphonate, polyglutarnate,
polyaspartate, or an RGD peptide or RGD peptide mimetic.
[0086] Ligands can be proteins, e.g., glycoproteins, lipoproteins,
e.g. low density lipoprotein (LDL), or albumins, e.g. human serum
albumin (HSA), or peptides, e.g, molecules having a specific
affinity for a co-ligand, or antibodies e.g., an antibody, that
binds to a specified cell type such as a cancer cell, endothelial
cell, or bone cell. Ligands may also include hormones and hormone
receptors. They can also include non-peptidic species, such as
cofactors, multivalent lactose, multivalent galactose,
N-acetyl-galactosamine, N-acetyl-glucosamine, multivalent mannose,
or multivalent fucose. The ligand can be, for example, a
lipopolysaccharide, an activator of p38 MAP kinase, or an activator
of NP-.kappa.B.
[0087] The ligand can be a substance, e.g., a drug, which can
increase the uptake of the oligonucleotide agent into the cell, for
example, by disrupting the cell's cytoskeleton, e.g., by disrupting
the cell's microtubules, microfilaments, and/or intermediate
filaments. The drug can be, for example, taxon, vincristine,
vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin
A, phalloidin, swinholide A, indanocine, or myoservin.
[0088] In one embodiment, the ligand is a lipid or lipid-based
molecule. Such a lipid or lipid-based molecule preferably binds a
serum protein, e.g., human serum albumin (HSA). An HSA binding
ligand allows for distribution of the conjugate to a target tissue,
e.g., liver tissue, including parenchymal cells of the liver. Other
molecules that can bind HSA can also be used as ligands. For
example, neproxin or aspirin can be used. A lipid or lipid-based
ligand can (a) increase resistance to degradation of the conjugate,
(b) increase targeting or transport into a target cell or cell
membrane, and/or (c) can be used to adjust binding to a serum
protein, e.g., HSA.
[0089] A lipid based ligand can be used to modulate, e.g., control
the binding of the conjugate to a target tissue. For example, a
lipid or lipid-based ligand that binds to HSA more strongly will be
less likely to be targeted to the kidney and therefore less likely
to be cleared from the body. A lipid or lipid-based ligand that
binds to HSA less strongly can be used to target the conjugate to
the kidney.
[0090] In another embodiment, the ligand is a moiety, e,g., a
vitamin or nutrient, which is taken up by a target cell, e.g., a
proliferating cell. These are particularly useful for treating
disorders characterized by unwanted cell proliferation, e.g., of
the malignant or non-malignant type, e.g., cancer cells. Exemplary
vitamins include vitamin A, E, and K. Other exemplary vitamins
include the B vitamins, e.g., folic acid, B12, riboflavin, biotin,
pyridoxal or other vitamins or nutrients taken up by cancer
cells.
[0091] In another embodiment, the ligand is a cell-permeation
agent, preferably a helical cell-permeation agent. Preferably, the
agent is amphipathic. An exemplary agent is a peptide such as tat
or antennapedia. If the agent is a peptide, it can be modified,
including a peptidylmimetic, invertomers, non-peptide or
pseudo-peptide linkages, and use of D-amino acids. The helical
agent is preferably an alpha-helical agent, which preferably has a
lipophilic and a lipophobic phase.
[0092] Preferred ligands confer to the agent the ability to bind to
a cell, preferably to a cell of a specific cell type most relevant
to the disease state in question. For example, the
asialoglycoprotein receptor (ASGPr) (Wu and Wu, 1987, J. Biol.
Chem. 262, 4429-4432) is unique to hepatocytes and binds branched
galactose-terminal glycoproteins, such as asialoorosornucoid
(ASOR). In another example, the folate receptor is overexpressed in
many cancer cells. Binding of such glycoproteins, synthetic
glycoconjugates, or folates to the receptor takes place with an
affinity that strongly depends on the degree of branching to of the
oligosaccharide chain, for example, triatennary structures are
bound with greater affinity than biatenarry or monoatennary chains
(Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al.,
1982, J. Biol. Chem., 257, 939-945). Lee and Lee, 1987,
Glycoconjugate J., 4, 317-328, obtained this high specificity
through the use of N-acetyl-D-galactosamine as the carbohydrate
moiety, which has higher affinity for the receptor, compared to
galactose. This "clustering effect" has also been described for the
binding and uptake of mannosyl-terminating glycoproteins or
glycoconjugates (Ponpipom et al., 1981, J. Med. Chem., 24,
1388-1395). The use of galactose, galactosamine, or folate based
conjugates to transport exogenous compounds across cell membranes
can provide a targeted delivery approach to, for example, the
treatment of liver disease, cancers of the liver, or other cancers.
The use of bioconjugates can also provide a reduction in the
required dose of therapeutic compounds required for treatment.
Furthermore, therapeutic bioavailability, pharmacodynamics, and
pharmacokinetic parameters can be modulated through the use of
nucleic acid bioconjugates of the invention. Non-limiting examples
of such bioconjugates are described in Vargeese et al., U.S. Ser.
No. 10/201,394, filed Aug. 13, 2001; and Matulic-Adamic et al.,
U.S. Ser. No. 60/362,016, filed Mar. 6, 2002.
[0093] 5'-Phosphate Modifications
[0094] In other embodiments, oligonucleotide agents are 5'
phosphorylated or include a phosphoryl analog at the 5' prime
terminus. 5'-phosphate modifications of the antisense strand
include those which are compatible with RISC mediated gene
silencing. Suitable modifications include: 5'-monophosphate
((HO)2(O)P--O-5'); 5'-diphosphate ((HO)2(O)P--O--P(HO)(O)--O-5');
5'-triphosphate ((HO)2(O)P--O--(HO)(O)P--O--P(HO)(O)--O-5');
5'-guanosine cap (7methylated or non-methylated)
(7m-G--O-5'-(HO)(O)P--O--(HO)(O)P--O--P(HO)(O)--O-5');5'-adenosine
cap (Appp), and any modified or unmodified nucleotide cap
structure. Other suitable 5'-phosphate modifications will be known
to the skilled person.
[0095] Formulation
[0096] The oligonucleotide agents described herein can be
formulated for administration to a subject, preferably for systemic
administration, e.g. parenteral or oral administration, including,
without limitation, intravenous, intramuscular, intraperitoneal,
rectal, intradermal, subcutaneous, or percutaneous administration,
or for the targeted delivery to tissues, e.g. the lungs and nasal
passage (respiratory tissues), e.g. via inhalation or intranasal
administration, the liver, kidney, spleen, brain, spinal cord, eye,
skin, gut, mucosa, placenta, or any other tissue or organ that is a
preferred target for the effect of the oligonucleotide agent.
[0097] For ease of exposition, the formulations, compositions, and
methods in this section are discussed largely with regard to
unmodified oligonucleotide agents. It should be understood,
however, that these formulations, compositions, and methods can be
practiced with other oligonucleotide agents, e.g., modified
oligonucleotide agents, and such practice is within the
invention.
[0098] A formulated oligonucleotide agent composition can assume a
variety of states. In some examples, the composition is at least
partially crystalline, uniformly crystalline, and/or anhydrous
(e.g., less than 80, 50, 30, 20, or 10% water). in another example,
the oligonucleotide agent is in an aqueous phase, e.g., in a
solution that includes water, this form being the preferred form
for parenteral administration.
[0099] The aqueous phase or the crystalline compositions can be
incorporated into a delivery vehicle, e.g., a liposome
(particularly for the aqueous phase), or a particle (e.g., a
microparticle as can be appropriate for a crystalline composition).
Generally, the oligonucleotide agent composition is formulated in a
manner that is compatible with the intended method of
administration.
[0100] An oligonucleotide agent preparation can be formulated in
combination with another agent, e.g., another therapeutic agent or
an agent that stabilizes an oligonucleotide agent, e.g., a protein
that complexes with the oligonucleotide agent. Still other agents
include chelators, e.g., EDTA (e.g., to remove divalent cations
such as Mg .sup.2+), salts, nuclease inhibitors (e.g., a broad
specificity nuclease inhibitor such as RNAsin) and so forth.
[0101] In one embodiment, the oligonucleotide agent preparation
includes another oligonucleotide agent, e.g., an siRNA agent that
can mediate RNAi with respect to a target gene. In such a use, a
target gene is disrupted in a cell as well as the cell being
stimulated to produce IFN using the oligonucleotide agent of the
present invention. Such cotherapy is important in treating
disorders such as cancers, and viral infections.
[0102] Methods for the delivery of nucleic acid molecules are
described in Akhtar et al., 1992, Trends Cell Bio., 2, 139;
Delivery Strategies for Antisense Oligonucleotide Therapeutics, ed.
Akhtar, 1995, Maurer et al., 1999, Mol. Membr. Biol., 16, 129-140;
Hofland and Huang, 1999, Handb. Exp. Pharmacol., 137, 165-192; and
Lee et al., 2000, ACS Symp. Ser., 752, 184-192, all of which are
incorporated herein by reference. Beigelman et al., U.S. Pat. No.
6,395,713 and Sullivan et al., PCT WO 94/02595 further describe the
general methods for delivery of nucleic acid molecules. These
protocols can be utilized for the delivery of virtually any nucleic
acid molecule. Nucleic acid molecules can be administered to cells
by a variety of methods known to those of skill in the art,
including, but not restricted to, encapsulation in liposomes, by
iontophoresis, or by incorporation into other vehicles, such as
biodegradable polymers, hydrogels, cyclodextrins (see for example
Gonzalez et al., 1999, Bioconjugate Chem., 10, 1068-1074; Wang et
al., International PCT publication Nos. WO 03/47518 and WO
03/46185), poly(lactic-co-glycolic)acid (PLGA) and PLCA
microspheres (see for example U.S. Pat. No. 6,447,796 and U.S.
Patent Application Publication No. U.S. 2002130430), biodegradable
nanocapsules, and bioadhesive microspheres, or by proteinaceous
vectors (O'Hare and Normand, International PCT Publication No. WO
00/53722). Alternatively, the nucleic acid/vehicle combination is
locally delivered by direct injection or by use of an infusion
pump. Direct injection of the nucleic acid molecules of the
invention, whether subcutaneous, intramuscular, or intradermal, can
take place using standard needle and syringe methodologies, or by
needle-free technologies such as those described in Conry et al.,
1999, Clin. Cancer Res., 5, 2330-2337 and Barry et al.,
International PCT Publication No. WO 99/31262.
[0103] In another embodiment, the nucleic acid molecules of the
invention can also be formulated or complexed with
polyethyleneimine and derivatives thereof, such as
polyethyleneimine-polyethyleneglycol-N-acety-lgalactosamine
(PEI-PEG-GAL) or polyethyleneimine-polyethyleneglycol-tri-N-
-acetylgalactosamine (PEI-PEG-triGAL) derivatives. In one
embodiment, the nucleic acid molecules of the invention are
formulated as described in U.S. Patent Application Publication No.
20030077829, incorporated by reference herein in its entirety.
[0104] In one embodiment, an oligonucleotide agent of the invention
is complexed with membrane disruptive agents such as those
described in U.S. Patent Application Publication No. 20010007666,
incorporated by reference herein in its entirety including the
drawings. In another embodiment, the membrane disruptive agent or
agents and the oligonucleotide agent are also complexed with a
cationic lipid or helper lipid molecule, such as those lipids
described in U.S. Pat. No. 6,235,310, incorporated by reference
herein in its entirety including the drawings.
[0105] In one embodiment, an oligonucleotide agent of the invention
is complexed with delivery systems as described in U.S. Patent
Application Publication No. 2003077829 and International PCT
Publication Nos. WO 00/03683 and WO 02/087541, all incorporated by
reference herein in their entirety including the drawings.
[0106] In one embodiment, the nucleic acid molecules of the
invention are administered via pulmonary delivery, such as by
inhalation of an aerosol or spray dried formulation administered by
an inhalation device or nebulizer, providing rapid local uptake of
the nucleic acid molecules into relevant pulmonary tissues. Solid
particulate compositions containing respirable dry particles of
micronized nucleic acid compositions can be prepared by grinding
dried or lyophilized nucleic acid compositions, and then passing
the micronized composition through, for example, a 400 mesh screen
to break up or separate out large agglomerates. A solid particulate
composition comprising the nucleic acid compositions of the
invention can optionally contain a dispersant which serves to
facilitate the formation of an aerosol as well as other therapeutic
compounds. A suitable dispersant is lactose, which can be blended
with the nucleic acid compound in any suitable ratio, such as a 1
to 1 ratio by weight.
[0107] Aerosols of liquid particles comprising a nucleic acid
composition of the invention can be produced by any suitable means,
such as with a nebulizer (see for example U.S. Pat. No. 4,501,729).
Nebulizers are commercially available devices which transform
solutions or suspensions of an active ingredient into a therapeutic
aerosol mist either by means of acceleration of a compressed gas,
typically air or oxygen, through a narrow venturi orifice or by
means of ultrasonic agitation. Suitable formulations for use in
nebulizers comprise the active ingredient in a liquid carrier in an
amount of up to 40% w/w preferably less than 20% w/w of the
formulation. The carrier is typically water or a dilute aqueous
alcoholic solution, preferably made isotonic with body fluids by
the addition of, for example, sodium chloride or other suitable
salts. Optional additives include preservatives if the formulation
is not prepared sterile, for example, methyl hydroxybenzoate,
anti-oxidants, flavorings, volatile oils, buffering agents and
emulsifiers and other formulation surfactants. The aerosols of
solid particles comprising the active composition and surfactant
can likewise be produced with any solid particulate aerosol
generator. Aerosol generators for administering solid particulate
therapeutics to a subject produce particles which are respirable,
as explained above, and generate a volume of aerosol containing a
predetermined metered dose of a therapeutic composition at a rate
suitable for human administration. One illustrative type of solid
particulate aerosol generator is an insufflator. Suitable
formulations for administration by insufflation include finely
comminuted powders which can be delivered by means of an
insufflator. In the insufflator, the powder, e.g., a metered dose
thereof effective to carry out the treatments described herein, is
contained in capsules or cartridges, typically made of gelatin or
plastic, which are either pierced or opened in situ and the powder
delivered by air drawn through the device upon inhalation or by
means of a manually-operated pump. The powder employed in the
insufflator consists either solely of the active ingredient or of a
powder blend comprising the active ingredient, a suitable powder
diluent, such as lactose, and an optional surfactant. The active
ingredient typically comprises from 0.1 to 100 w/w of the
formulation. A second type of illustrative aerosol generator
comprises a metered dose inhaler. Metered dose inhalers are
pressurized aerosol dispensers, typically containing a suspension
or solution formulation of the active ingredient in a liquified
propellant. During use these devices discharge the formulation
through a valve adapted to deliver a metered volume to produce a
fine particle spray containing the active ingredient. Suitable
propellants include certain chlorofluorocarbon compounds, for
example, dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethan- e and mixtures thereof. The formulation
can additionally contain one or more co-solvents, for example,
ethanol, emulsifiers and other formulation surfactants, such as
oleic acid or sorbitan trioleate, anti-oxidants and suitable
flavoring agents. Other methods for pulmonary delivery are
described in, for example U.S. Patent Application No. 20040037780,
and U.S. Pat. Nos. 6,592,904; 6,582,728; 6,565,885.
[0108] In one embodiment, nucleic acid molecules of the invention
are administered to the central nervous system (CNS) or peripheral
nervous system (PNS). Experiments have demonstrated the efficient
in vivo uptake of nucleic acids by neurons. As an example of local
administration of nucleic acids to nerve cells, Sommer et al.,
1998, Antisense Nuc. Acid Drug Dev., 8, 75, describe a study in
which a 15mer phosphorothioate antisense nucleic acid molecule to
c-fos is administered to rats via microinjection into the brain.
Antisense molecules labeled with
tetramethylrhodamine-isothiocyanate (TRITC) or fluorescein
isothiocyanate (FITC) were taken up by exclusively by neurons
thirty minutes post-injection. A diffuse cytoplasmic staining and
nuclear staining was observed in these cells. As an example of
systemic administration of nucleic acid to nerve cells, Epa et al.,
2000, Antisense Nuc. Acid Drug Dev., 10, 469, describe an in vivo
mouse study in which beta-cyclodextrin-adamantane-oligonucleotide
conjugates were used to target the p75 neurotrophin receptor in
neuronally differentiated PC12 cells. Following a two week course
of IP administration, pronounced uptake of p75 neurotrophin
receptor antisense was observed in dorsal root ganglion (DRG)
cells. In addition, a marked and consistent down-regulation of p75
was observed in DRG neurons. Additional approaches to the targeting
of nucleic acid to neurons are described in Broaddus et al., 1998,
J. Neurosurg., 88(4), 734; Karle et al., 1997, Eur. J. Pharmocol.,
340(2/3), 153; Bannai et al., 1998, Brain Research, 784(1,2), 304;
Rajakumar et al., 1997, Synapse, 26(3), 199; Wu-pong et al., 1999,
BioPharm, 12(1), 32; Bannai et al., 1998, Brain Res. Protoc., 3(1),
83; Simantov et al., 1996, Neuroscience, 74(1), 39. Nucleic acid
molecules of the invention are therefore amenable to delivery to
and uptake by cells in the CNS and/or PNS.
[0109] The delivery of nucleic acid molecules of the invention to
the CNS is provided by a variety of different strategies.
Traditional approaches to CNS delivery that can be used include,
but are not limited to, intrathecal and intracerebroventricular
administration, implantation of catheters and pumps, direct
injection or perfusion at the site of injury or lesion, injection
into the brain arterial system, or by chemical or osmotic opening
of the blood-brain barrier. Other approaches can include the use of
various transport and carrier systems, for example though the use
of conjugates and biodegradable polymers. Furthermore, gene therapy
approaches, for example as described in Kaplitt et al., U.S. Pat.
No. 6,180,613 and Davidson, WO 04/013280, can be used to express
nucleic acid molecules in the CNS.
[0110] In one embodiment, delivery systems of the invention
include, for example, aqueous and nonaqueous gels, creams, multiple
emulsions, microemulsions, liposomes, ointments, aqueous and
nonaqueous solutions, lotions, aerosols, hydrocarbon bases and
powders, and can contain excipients such as solubilizers,
permeation enhancers (e.g., fatty acids, fatty acid esters, fatty
alcohols and amino acids), and hydrophilic polymers (e.g.,
polycarbophil and polyvinylpyrolidone). In one embodiment, the
pharmaceutically acceptable carrier is a liposome or a transdermal
enhancer. Examples of liposomes which can be used in this invention
include the following: (1) CellFectin, 1:1.5 (M/M) liposome
formulation of the cationic lipid
N,NI,NII,NIII-tetramethyl-N,NI,NII,NIII- -tetrapalmit-y-spermine
and dioleoyl phosphatidylethanolamine (DOPE) (GIBCO BRL); (2)
Cytofectin GSV, 2:1 (M/M) liposome formulation of a cationic lipid
and DOPE (Glen Research); (3) DOTAP
(N-[1-(2,3-dioleoyloxy)-N,N,N-tri-methyl-ammoniummethylsulfate)
(Boehringer Manheim); and (4) Lipofectamine, 3:1 (M/M) liposome
formulation of the polycationic lipid DOSPA and the neutral lipid
DOPE (GIBCO BRL).
[0111] In one embodiment, delivery systems of the invention include
patches, tablets, suppositories, pessaries, gels and creams, and
can contain excipients such as solubilizers and enhancers (e.g.,
propylene glycol, bile salts and amino acids), and other vehicles
(e.g., polyethylene glycol, fatty acid esters and derivatives, and
hydrophilic polymers such as hydroxypropylmethylcellulose and
hyaluronic acid).
[0112] In one embodiment, oligonucleotide agents of the invention
are formulated or complexed with polyethylenimine (e.g., linear or
branched PEI) and/or polyethylenimine derivatives, including for
example grafted PEIs such as galactose PEI, cholesterol PEI,
antibody derivatized PEI, and polyethylene glycol PEI (PEG-PET)
derivatives thereof (see for example Ogris et al., 2001, AAPA
PharmSci, 3, 1-11; Furgeson et al., 2003, Bioconjugate Chem., 14,
840-847; Kunath et al., 2002, Phramaceutical Research, 19, 810-817;
Choi et al., 2001, Bull. Korean Chem. Soc., 22, 46-52; Bettinger et
al., 1999, Bioconjugate Chem., 10, 558-561; Peterson et al., 2002,
Bioconjugate Chem., 13, 845-854; Erbacher et al., 1999, Journal of
Gene Medicine Preprint, 1, 1-18; Godbey et al., 1999, PNAS USA, 96,
5177-5181; Godbey et al., 1999, Journal of Controlled Release, 60,
149-160; Diebold et al., 1999, Journal of Biological Chemistry,
274, 19087-19094; Thomas and Klibanov, 2002, PNAS USA, 99,
14640-14645; and Sagara, U.S. Pat. No. 6,586,524, incorporated by
reference herein.
[0113] The present invention therefore includes pharmaceutically
acceptable formulations of the compounds described. These
formulations include salts of the above compounds, e.g., acid
addition salts, for example, salts of hydrochloric, hydrobromic,
acetic acid, and benzene sulfonic acid.
[0114] The invention also features compositions comprising
surface-modified liposomes containing poly (ethylene glycol) lipids
(PEG-modified, or long-circulating liposomes or stealth liposomes).
These formulations offer a method for increasing the accumulation
of drugs in target tissues. This class of drug carriers resists
opsonization and elimination by the mononuclear phagocytic system
(MPS or RES), thereby enabling longer blood circulation times and
enhanced tissue exposure for the encapsulated drug (Lasic et al.
Chem. Rev. 1995, 95, 2601-2627; Ishiwata et al., Chem. Pharm. Bull.
1995, 43, 1005-1011. Such liposomes have been shown to accumulate
selectively in tumors, presumably by extravasation and capture in
the neovascularized target tissues (Lasic et al., Science 1995,
267, 1275-1276; Oku et al., 1995, Biochim. Biophys. Acta, 1238,
86-90). The long-circulating liposomes enhance the pharmacokinetics
and pharmacodynamics of DNA and RNA, particularly compared to
conventional cationic liposomes which are known to accumulate in
tissues of the MPS (Liu et al., J. Biol. Chem. 1995, 42,
24864-24870; Choi et al., International PCT Publication No. WO
96/10391; Ansell et at., International PCT Publication No. WO
96/10390; Holland et al., International PCT Publication No. WO
96/10392). Long-circulating liposomes are also likely to protect
drugs from nuclease degradation to a greater extent compared to
cationic liposomes, based on their ability to avoid accumulation in
metabolically aggressive MPS tissues such as the liver and
spleen.
[0115] Methods of Modulating an Immune Response via IFN
Production
[0116] The invention further provides a method for modulating an
immune response in a vertebrate. The method comprises the step of
administering to the vertebrate an immuno-stimulatory
oligonucleotide of the invention.
[0117] As used herein, the term "vertebrate" includes, without
limitation, a fish, bird, or mammal. As used herein, the term
"mammal" includes, without limitation rats, mice, cats, dogs,
horses, cattle, cows, pigs, rabbits, non-human primates, and
humans.
[0118] As used herein, "modulating an immune response" means
causing an increase in, or activation of one or more of B-cell
induction, T-cell induction, cytokine induction, natural killer
cell induction, specific cell surface marker expression, chemokine
induction and activation of antigen presenting cells, such as
dendritic cells, monocytes and macrophages. Particularly, such
immune response will involve the production of IFN in cells
expressing the TLR7 protein, such as PDC.
[0119] The present invention further provides a method for treating
a vertebrate having a disease that can be ameliorated by inducing
IFN production. The method according to this embodiment of the
invention comprises administering to the vertebrate an
oligonucleotide agent of the present invention, e.g. an agent
consisting of, consisting essential of or comprising SEQ ID NO:1.
In such a use, an oliognucloetide agent of the present invention is
used to stimulate IFN production in a vertebrate to directly treat
the condition or augment other therapies. There are well recognized
clinical settings where selective activation of IFN production is
wanted.
[0120] In another embodiment, the invention provides methods for
therapeutically treating a patient having a disease or disorder,
such methods comprising administering to the patient an
immunomodulatory oligonucleotide, immunomodulatory oligonucleotide
conjugate, oligonucleotide agent or oligonucleotide agent conjugate
according to the invention. In various embodiments, the disease or
disorder to be treated is cancer, an autoimmune disorder, airway
inflammation, inflammatory disorders, allergy, asthma or a disease
caused by a pathogen. Pathogens include bacteria, parasites, fungi,
viruses, viroids and prions. Administration is carried out as
described elsewhere herein.
[0121] As used herein, the term "allergy" includes, without
limitation, food allergies and respiratory allergies. The term
"airway inflammation" includes, without limitation, asthma.
[0122] As used herein, the term "autoimmune disorder" refers to
disorders in which "self" proteins undergo attack by the immune
system. Such term includes autoimmune asthma.
[0123] In any of the methods of the invention, the immunomodulatory
oligonucleotide, immunomodulatory oligonucleotide conjugate,
oligonucleotide agent or oligonucleotide agent conjugate can be
administered in combination with any other agent useful for
treating the disease or condition that does not diminish the
immunostimulatory effect of the oligonucleotide agent. For example,
in the treatment of cancer, it is contemplated that the
immunomodulatory oligonucleotide, immunomodulatory oligonucleotide
conjugate, oligonucleotide agent or oligonucleotide agent conjugate
may be administered in combination with a chemotherapeutic
compound
[0124] Examples of cellular proliferative and/or differentiative
disorders include cancer, e.g., a carcinoma, sarcoma, metastatic
disorder or hematopoietic neoplastic disorder, such as a leukemia.
A metastatic tumor can arise from a multitude of primary tumor
types, including but not limited to those of prostate, colon, lung,
breast and liver origin. As used herein, the terms "cancer,"
"hyperproliferative," and "neoplastic" refer to cells having the
capacity for autonomous growth, i.e., an abnormal state or
condition characterized by rapidly proliferating cell growth. These
terms are meant to include all types of cancerous growths or
oncogenic processes, metastatic tissues or malignantly transformed
cells, tissues, or organs, irrespective of histopathologic type or
stage of invasiveness. Proliferative disorders also include
hematopoietic neoplastic disorders, including diseases involving
hyperplastic/neoplastic cells of hematopoietic origin, e.g.,
arising from myeloid, lymphoid or erythroid lineages, or precursor
cells thereof.
[0125] The pharmaceutical compositions of the present invention can
also be used to treat a variety of hematopoietic disorders.
Examples of hematopoietic disorders or diseases include, without
limitation, autoimmune diseases (including, for example, diabetes
mellitus, arthritis (including rheumatoid arthritis, juvenile
rheumatoid arthritis, osteoarthritis, psoriatic arthritis),
multiple sclerosis, encephalomyelitis, myasthenia gravis, systemic
lupus erythematosis, automimmune thyroiditis, dermatitis (including
atopic dermatitis and eczematous dermatitis), psoriasis, Sjogren's
Syndrome, Crohn's disease, aphthous ulcer, iritis, conjunctivitis,
keratoconjunctivitis, ulcerative colitis, asthma, allergic asthma,
cutaneous lupus erythematosus, scleroderma, vaginitis, proctitis,
drug eruptions, leprosy reversal reactions, erythema nodosum
leprosum, autoimmune uveitis, allergic encephalomyelitis, acute
necrotizing hemorrhagic encephalopathy, idiopathic bilateral
progressive sensorineural hearing, loss, aplastic anemia, pure red
cell anemia, idiopathic thrombocytopenia, polychondritis, Wegener's
granulomatosis, chronic active hepatitis, Stevens-Johnson syndrome,
idiopathic sprue, lichen planus, Graves' disease, sarcoidosis,
primary biliary cirrhosis, uveitis posterior, and interstitial lung
fibrosis), graft-versus-host disease, cases of transplantation, and
allergy.
[0126] In another embodiment, the invention relates to methods for
treating viral diseases, including but not limited to hepatitis C
hepatitis B, herpes simplex virus (HSV), HIV-AIDS, poliovirus, and
smallpox virus. Examples of (+) strand RNA viruses include, without
limitation, picornaviruses, caliciviruses, nodaviruses,
coronaviruses, arteriviruses, flaviviruses, and togaviruses.
Examples of picomaviruses include enterovirus (poliovirus 1),
rhinovirus (human rhinovirus 1A), hepatovirus (hepatitis A virus),
cardiovirus (encephalomyocarditis virus), aphthovirus
(foot-and-mouth disease virus O), and parechovirus (human echovirus
22). Examples of caliciviruses include vesiculovirus (swine
vesicular exanthema virus), lagovirus (rabbit hemorrhagic disease
virus), "Norwalk-like viruses" (Norwalk virus), "Sapporo-like
viruses" (Sapporo virus), and "hepatitis E-like viruses" (hepatitis
E virus). Betanodavirus (striped jack nervous necrosis virus) is
the representative nodavirus. Coronaviruses include coronavirus
(avian infections bronchitis virus) and torovirus (Berne virus).
Arterivirus (equine arteritis virus) is the representative
arteriviridus. Togavirises include alphavirus (Sindbis virus) and
rubivirus (Rubella virus). Finally, the flaviviruses include
flavivirus (Yellow fever virus), pestivirus (bovine diarrhea
virus), and hepacivirus (hepatitis C virus). In a preferred
embodiment, the virus is hepacivirus, the hepatitis C virus.
[0127] Pharmaceutical Compositions
[0128] In one embodiment, the invention relates to a pharmaceutical
composition containing an oligonucleotide agent, as described in
the preceding sections, and a pharmaceutically acceptable carrier,
as described below. A pharmaceutical composition including the
oligonucleotide agent is useful for treating a disease that can be
ameliorated by inducing IFN production. In this embodiment of the
invention, the oligonucleotide agent of the invention is formulated
as described below. The pharmaceutical compositions of the present
invention are administered in dosages sufficient to induce IFN
production. Where the pharmaceutical composition comprises an iRNA
agent, the dosage will also be sufficient to inhibit the expression
or activity of the target gene. Compositions containing the
oligonucleotide agent of the invention can be administered at
surprisingly low dosages. A maximum dosage of 5 mg oligonucleotide
agent per kilogram body weight per day may be sufficient to induce
IFN production, and, where applicable, to inhibit or completely
suppress the expression or activity of the target gene.
[0129] Acceptable carriers or diluents for therapeutic use are well
known in the pharmaceutical art, and are described, for example, in
Remington's Pharmaceutical Sciences, Mack Publishing Co. (A. R.
Gennaro edit. 1985), hereby incorporated by reference herein. For
example, preservatives, stabilizers, dyes and flavoring agents can
be provided. These include sodium benzoate, sorbic acid and esters
of p-hydroxybenzoic acid. In addition, antioxidants and suspending
agents can be used.
[0130] In general, a suitable dose of the oligonucleotide agent
will be in the range of 0.001 to 500 milligrams per kilogram body
weight of the recipient per day (e.g., about 1 microgram per
kilogram to about 500 milligrams per kilogram, about 100 micrograms
per kilogram to about 100 milligrams per kilogram, about 1
milligrams per kilogram to about 75 milligrams per kilogram, about
10 micrograms per kilogram to about 50 milligrams per kilogram, or
about 1 microgram per kilogram to about 50 micrograms per
kilogram). The pharmaceutical composition may be administered once
per day, or the oligonucleotide agent may be administered as two,
three, four, five, six or more sub-doses at appropriate intervals
throughout the day. In that case, the oligonucleotide agent
contained in each sub-dose must be correspondingly smaller in order
to achieve the total daily dosage. The dosage unit can also be
compounded for delivery over several days, e.g., using a
conventional sustained release formulation which provides sustained
release of the oligonucleotide agent over a several day period.
Sustained release formulations are well known in the art. In this
embodiment, the dosage unit contains a corresponding multiple of
the daily dose.
[0131] The skilled artisan will appreciate that certain factors may
influence the dosage and timing required to effectively treat a
subject, including but not limited to the severity of the infection
or disease, previous treatments, the general health and/or age of
the subject, and other diseases present. Moreover, treatment of a
subject with a therapeutically effective amount of a composition
can include a single treatment or a series of treatments. Estimates
of effective dosages and in vivo half-lives for the individual
oligonucleotide agent encompassed by the invention can be made
using conventional methodologies or on the basis of in vivo testing
using an appropriate animal model, as described elsewhere
herein.
[0132] The pharmaceutical compositions encompassed by the invention
may be administered by any means known in the art including, but
not limited to oral or parenteral routes, including intravenous,
intramuscular, intraperitoneal, subcutaneous, transdermal, airway
(aerosol), ocular, rectal, vaginal and topical (including buccal
and sublingual) administration, In preferred embodiments, the
pharmaceutical compositions are administered by intravenous or
intraparenteral infusion or injection. The pharmaceutical
compositions can also be administered intraparenchymally,
intrathecally, and/or by stereotactic injection.
[0133] For oral administration, the oligonucleotide agent useful in
the invention will generally be provided in the fouu of tablets or
capsules, as a powder or granules, or as an aqueous solution or
suspension. Capsules for oral use include hard gelatin capsules in
which the active ingredient is mixed with a solid diluent, and soft
gelatin capsules wherein the active ingredient is mixed with water
or an oil such as peanut oil, liquid paraffin or olive oil.
[0134] For intramuscular, intraperitoneal, subcutaneous and
intravenous use, the pharmaceutical compositions of the invention
will generally be provided in sterile aqueous solutions or
suspensions, buffered to an appropriate pH and isotonicity.
Suitable aqueous vehicles include Ringer's solution and isotonic
sodium chloride. In a preferred embodiment, the carrier consists
exclusively of an aqueous buffer. In this context, "exclusively"
means no auxiliary agents or encapsulating substances are present
which might affect or mediate uptake of oligonucleotide agent in
the cells that harbor the target gene or virus. Such substances
include, for example, micellar structures, such as liposomes or
capsids, as described below. Although microinjection, lipofection,
viruses, viroids, capsids, capsoids, or other auxiliary agents are
required to introduce oligonucleotide agents into cell cultures,
surprisingly these methods and agents are not necessary for uptake
of the oligonucleotide agent in vivo. The oligonucleotide agents of
the present invention are particularly advantageous in that they do
not require the use of an auxiliary agent to mediate uptake of the
oligonucleotide agent into the cell, many of which agents are toxic
or associated with deleterious side effects. Aqueous suspensions
according to the invention may include suspending agents such as
cellulose derivatives, sodium alginate, polyvinyl-pyrrolidone and
gum tragacanth, and a wetting agent such as lecithin. Suitable
preservatives for aqueous suspensions include ethyl and n-propyl
p-hydroxybenzoate,
[0135] The nucleic acid molecules of the invention can also be
administered in the form is of suppositories, e.g., for rectal
administration of the drug. These compositions can be prepared by
mixing the drug with a suitable non-irritating excipient that is
solid at ordinary temperatures but liquid at the rectal temperature
and will therefore melt in the rectum to release the drug. Such
materials include cocoa butter and polyethylene glycols.
[0136] The pharmaceutical compositions can also include
encapsulated formulations to protect the oligonucleotide agent
against rapid elimination from the body, such as a controlled
release formulation, including implants and microencapsulated
delivery systems. Biodegradable, bioc-ompatible polymers can be
used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic
acid, collagen, polyorthoesters, and polylactic acid. Methods for
preparation of such foiniulations will be apparent to those skilled
in the art, The materials can also be obtained commercially from
Alza Corporation and Nova
[0137] Pharmaceuticals, Inc. Liposomal suspensions (including
liposomes targeted to infected cells with monoclonal antibodies to
viral antigens) can also be used as pharmaceutically acceptable
carriers. These can be prepared according to methods known to those
skilled in the art, for example, as described in U.S. Pat. No.
4,522,811; PCT publication WO 91/06309; and European patent
publication EP-A-43075, which are incorporated by reference
herein.
[0138] A preferred pharmaceutical composition according to the
present invention is a vaccine. A vaccine should contain an antigen
besides the oligonucleotide according to the present invention. The
potential of this antigen to raise a protection/immune response of
the vaccinated individual is strongly increased by combining it
with the oligonucleotides according to the present invention,
especially due to their immunostimulatory activity.
[0139] A vaccine can contain a whole variety of different antigens.
Examples of antigens are whole-killed organisms such as inactivated
viruses or bacteria, fungi, protozoa or even cancer cells. Antigens
may also consist of subfractions of these organisms/tissues, of
proteins, or, in their most simple fowl, of peptides. Antigens can
also be recognised by the immune system in fos an of glycosylated
proteins or peptides and may also be or contain polysaccharides or
lipids. Short peptides can be used since for example cytotoxic T
cells (CTL) recognize antigens in form of short usually 8-11 amino
acids long peptides is in conjunction with major histocompatibility
complex (MHC) (Rammensee et al., Immunogenetics, 41, 178-228
(1995)). B cells recognize longer peptides starting at around 15
amino acids (Harrow et al, Cold Spring Harbor: Cold Spring Harbor
Laboratory, (1988)). By contrast to T cell epitopes, the three
dimensional structure of B cell antigens may also be important for
recognition by antibodies. In order to obtain sustained,
antigen-specific immune responses, adjuvants are helpful to trigger
immune cascades that involve all cells of the immune system
necessary. Primarily, adjuvants are acting, but are not restricted
in their mode of action, on so-called antigen presenting cells
(APCs). These cells usually first encounter the antigen(s) followed
by presentation of processed or unmodified antigen to immune
effector, Intermediate cell types may also be involved. Only
effector cells with the appropriate specificity are activated in a
productive immune response. The adjuvant may also locally retain
antigens and co-injected other factors. In addition the adjuvant
may act as a chemoattractant for other immune cells or may act
locally and/or systemically as a stimulating agent for the immune
system.
[0140] The antigens to be used in the present compositions are not
critical. Preferably, proteins or peptides derived from a viral or
a bacterial pathogen or from fungi or parasites are used as such
antigens (including derivatized antigens or glycosylated or
lipidated antigens or polysaccharides or lipids). Another preferred
source of antigens are tumor antigens. Preferred pathogens are
selected from human immunodeficiency virus (HIV), hepatitis A and B
viruses, hepatitis C virus (HCV), rous sarcoma virus (RSV), Epstein
Barr virus (EBV) Influenza virus, Rotavirus, Staphylococcus aureus,
Chlamydia pneumonias, Chlamydia trachomatis, Mycobacterium
tuberculosis, Streptococcus pneumonias, Bacillus anthracis, Vibrio
cholerae, Plasmodium sp. (Pl. falciparum, Pl. vivax, etc.),
Aspergillus sp. or Candida albicans. Antigens may also be molecules
expressed by cancer cells (tumor antigens). The derivation process
may include the purification of a specific protein from the
pathogen/cancer cells, the inactivation of the pathogen as well as
the proteolytic or chemical derivatization or stabilisation of such
a protein. In the same way also tumor antigens (cancer vaccines) or
autoimmune antigens may be used in the pharmaceutical composition
according to the present invention. With such compositions a tumor
vaccination or a treatment for autoimmume diseases may be
performed.
[0141] In the case of peptide antigens the use of peptide
mimitopes/agonists/superagonists/antagonists or peptides changed in
certain positions without affecting the immunologic properties or
non-peptide mimitopes/agonists/superagonists/antagonists (reviewed
in Sparbier and Walden, Curr Opin Immunol, 11, 214-218 (1999)) is
included in the current invention. Peptide antigens may also
contain elongations either at the carboxy or at the amino terminus
of the peptide antigen facilitating interaction with the
polycationic compound(s) or the immunostimulatory compound(s). For
the treatment of autoimmune diseases peptide antagonists may be
applied. Antigens may also be derivatized to include molecules
enhancing antigen presentation and targeting of antigens to antigen
presenting cells.
[0142] Toxicity and therapeutic efficacy of an oligonucleotide
agent can be determined by standard pharmaceutical procedures in
cell cultures or experimental animals, e.g., for determining the
LD50 (the dose lethal to 50% of the population) and the ED50 (the
dose therapeutically effective in 50% of the population). The dose
ratio between toxic and therapeutic effects is the therapeutic
index and it can be expressed as the ratio LD50/ED50.
oligonucleotide agents that exhibit high therapeutic indices are
preferred.
[0143] The data obtained from cell culture assays and animal
studies can be used in formulating a range of dosage for use in
humans. The dosages of compositions of the invention are preferably
within a range of circulating concentrations that include the ED50
with little or no toxicity. The dosage may vary within this range
depending upon the dosage form employed and the route of
administration utilized. For any io oligonucleotide agent used in
the method of the invention, the therapeutically effective dose can
be estimated initially from cell culture assays. A dose may be
formulated in animal models to achieve a circulating plasma
concentration range of the oligonucleotide agent or of IFN, or,
when appropriate, of the polypeptide product of a target sequence
of an iRNA agent (e.g., achieving a decreased concentration of the
polypeptide) that includes the IC50 (he., the concentration of the
test oligonucleotide agent which achieves a half-maximal inhibition
of symptoms) as determined in cell culture. Such information can be
used to more accurately determine useful doses in humans. Levels in
plasma may be measured, for example, by high performance liquid
chromatography.
[0144] In addition to their administration individually or as a
plurality, as discussed above, oligonucleotide agents relating to
the invention can be administered in combination with other known
agents effective in treating viral infections and diseases. In any
event, the administering physician can adjust the amount and timing
of oligonucleotide agent administration on the basis of results
observed using standard measures of efficacy known in the art or
described herein.
[0145] A number of embodiments of the invention have been
described. Nevertheless, it will be understood that various
modifications may be made without departing from the spirit and
scope of the invention. Other embodiments are in the claims.
EXAMPLES
Example 1
[0146] Isolation of Plasmacytoid Dendritic Cells
[0147] PBMC were obtained from whole blood of healthy individuals
by Ficoll-Hypaque density gradient centrifugation (Biochrom,
Berlin, Germany). PDC were isolated by MACS using the BDCA-4
dendritic cell isolation kit from Miltenyi Biotec. Briefly, PDC
were labeled with anti-BDCA-4 Ab coupled to colloidal paramagnetic
microbeads and passed through a magnetic separation column once (LS
column; Miltenyi Biotec). The purity of isolated PDC
(lineage-negative, MHC-II-positive, and CD123-positive cells) was
between 75% and 100%. Contaminating cells were mainly T cells.
Viability was >95% as determined by trypan blue exclusion.
[0148] Cell Culture
[0149] Isolated PDC were cultured in 96-well flat-bottom plates at
a concentration of 5.times.10.sup.4 cells in 150 .mu.l OPTIMEM
(Invitrogen, Karlsruhe, Germany) supplemented with 10 ng/ml IL-3
(R&D Systems, Wiesbaden, Germany). HEK 293 cells stably
transfected with a construct containing the human TLR9 gene with a
C-teiminal yellow fluorescent protein (YFP) tag were kindly
provided by D. Golenbock (Worcester, Mass.). HEK 293 cells were
cultured in RPMI 1640 culture medium (Biochrom) supplemented with
10% (v/v) fetal calf serum (BioWhittaker, Walkersville, Md.), 1.5
mM L-glutamine, 100 U/ml penicillin, and 100 .mu.g/ml streptomycin
(all from Sigma-Aldrich, Munich, Germany). EBV-negative Burkitt's
lymphoma cell line BL41 was grown in RPMI 1640 (FAA, Linz,
Austria), supplemented with 10% (v/v) fetal calf serum (Biochrom),
2 mM L-glutamine, 0.1 mg/ml penicillin/streptomycin and 1% 1 mM
pyruvate (all from PAA). Cells were incubated at 37.degree. C. and
5% CO.sub.2.
[0150] In Vitro Cell Stimulation, Transfection and
Electroporation
[0151] CpG ODN were provided by Coley Pharmaceutical Group
(Wellesley, Mass.) (underlined letters, phosphorothioate linkage
3.degree. of the base; bold letters, CpG dinucleotides):
TABLE-US-00003 ODN 2216: 5'-GGGGGACGATCGTCGGGGGG-3'; SEQ ID NO: 7
ODN 1826: 5'-TCCATGACGTTCCTGACGTT-3'. SEQ ID NO: 8
[0152] R848 was purchased from Invivogen (Toulouse, France). R848
and ODN 2216 were added at a final concentration of 500 ng/ml and 3
.mu.g/ml respectively. The siRNA sequences (see table 1) were
synthesized and annealed by Dharmacon (Lafayette, Colo.). siRNA was
transfected with lipofectamine 2000 (Invitrogen, Karlsruhe,
Germany). If not indicated otherwise, 200 ng of nucleic acid were
mixed with 25 .mu.l of OPTIMEM. In a separate tube, 0.5 .mu.l of
lipofectamine was added to 25 .mu.l of OPTIMEM and incubated for 5
min at room temperature. For complex formation, both solutions were
mixed, incubated for an additional 20 min at room temperature, and
added to cells (100 .mu.l) in a 96-well is plate (final volume 150
.mu.l). Cells in transfection solution were incubated at 37.degree.
C. without additional washing.
[0153] For electroporation, 250.000 PDC were resuspended in 400
.mu.l "isoosmolar electroporation-buffer" (Eppendorf, Hamburg,
Germany) with or without siRNA (2.5 .mu.g/ml) and pulsed once with
at 100V for 50 .mu.s (Multiporator, Eppendorf). After 5 minutes 800
.mu.l complete medium was added and cells were incubated in 24-well
flat bottom wells for additional 36 h.
[0154] Mouse Studies
[0155] For in viva stimulation, 129P2/OlaHsd or 129Sv mice were
anesthetized and 200 .mu.l containing 5 .mu.g CpG ODN 1826 or siRNA
TLR9.2 with or without prior
1,2-dioleoyloxy-3-trimethylammonium-propane (DOTAP)-complexation
(30 .mu.l DOTAP (Boehringer Mannheim) were mixed with 5 .mu.g of
nucleic acids in 170 .mu.l of Hepes-buffered saline (HBS)) were
injected i.v. into the retro-orbital vein. Control mice received
either HBS alone (control) or HBS and DOTAP (DOTAP). Whole blood
samples were obtained by tail clippings at either 7 hours, 18 hours
or 24 hours after injection. Serum was prepared from whole blood by
coagulation for 30 min at 37.degree. C. and subsequent
centrifugation.
[0156] Detection of Cytokines
[0157] Because total IFN-.alpha. is comprised of 14 different
isoforms, the quantity of IFN-.alpha. measured by ELISA depends on
the specificity of the antibody used for the detection of these
isoforms, and thus is not identical between different ELISA. For
this study, the IFN-.alpha. kit by Bender MedSystems (Graz,
Austria) (detection range 8-500 pg/ml) was used. This ELISA detects
most of IFN-.alpha. isoforins, but not IFN-B and IFN-F. The human
TNF-.alpha. ELISA (detection range 8 to 500 pg/ml) and the human
1L-6 ELISA (detection range 5 to 300 pg/ml) were from BD PharMingen
(Heidelberg, Germany). Murine IFN-.alpha. was determined using the
mouse IFN-.alpha. ELISA kit from PBL Biomedical Laboratories
(Piscataway, USA). All ELISA procedures were performed as
recommended by the manufacturer.
[0158] Flow Cytometry
[0159] Flow cytometric data were acquired on a BD Biosciences
FACSCalibur (Heidelberg, Germany) equipped with two lasers
(excitation at 488 nm and 635 nm wavelength). In general, cells
were stained for 20 min at 4.degree. C. with the indicated specific
antibodies and the appropriate isotype controls. Human PDC were
identified by positive staining with anti-CD123 PE and anti-MHC II
PerCP and negative staining with anti-lineage FITC. Costimulatory
molecule expression was determined by using anti-CD86 APC (all BD
PharMingen). For PDC survival, cells were harvested 36 h after
stimulation and the absolute number of viable cells per 50 .mu.l
aspirated volume was determined by flow cytometry. Viability of PDC
was determined by staining negative for TO-PRO-3 iodide (Molecular
Probes, Eugene, Oreg.) and a morphology-based live gate. For
phenotypic analysis of murine MDC (CD11c.sup.++,
CD11b.sup.+.degree. and B220.sup.-) and PDC (CD11c.sup.+,
CD11b.sup.-and B220.sup.++) freshly isolated spleen cells were
stained with anti-CD86 FITC, anti-CD45R/B220 PE, anti-CD11b PerCP
and anti-CD11c APC (all BD PharMingen). Activation of splenic NK
cells and T cells was determined by anti-CD69 PE on anti-pan-NK
FITC-positive cells (NK cells) and anti-CD3 APC-positive cells (T
cells) (all BD PharMingen). Data were analyzed using CellQuest (BE)
Biosciences) or FlowJo software (version 2.5.1; Tree Star,
Stanford, Calif.).
[0160] Western-Blot Analysis
[0161] The cells were washed once in phosphate-buffered saline
(PBS) counted and lysed by resuspension in Laemmli sample buffer
(10.sup.6 cells/50 .mu.l) followed by 10 sec of sonication. The
samples were separated on SDS-polyacrylamide gels (10%) and
transferred onto nitro-cellulose membranes (Hybond-ECL, Amersham).
Following transfer, the membranes were stained in Ponceau Red to
verify that equal amounts of protein were loaded. The membranes
were then washed in TBST (tris 10 mM pH 8.0, NaCl 30 mM, 0.1%
Tween) for 5 min and incubated for 30 min in TBST-MLK (TBST
supplemented with 5% dried skimmed milk). After rinsing with water
twice, specific antibodies (1:1000) in TBST-MLK were added for 1h
or overnight at 4.degree. C. After rinsing twice with water and
three washes of 5 min with TBST, the secondary antibodies
conjugated with horseradish peroxidase (1:3000 in TBS-MLK) were
added for 1.5 h, followed by 3 times rinsing with water, three
washes of 5 min in TBST and 5 times rinsing with water. Bands were
visualized on ECL films (Aniersham) by enhanced chemiluminescence
following the supplier's procedure (Amersham). Antibodies to the
following proteins were used: phospho (tyrosine 701)-STAT1
(New-England Biolabs, Beverly, Mass.) and phospho (tyrosine
689)-STAT2 (Upstate, Waltham, Mass.),
[0162] Statistical Analysis
[0163] Data are expressed as means.+-.SEM. Statistical significance
of differences was determined by the paired two-tailed Student's
t-test. Differences were considered statistically significant for
p<0.05. Statistical analyses were performed using StatView 4.51
software (Abacus Concepts Inc., Calabasas, Calif.).
[0164] Specific siRNA-Mediated Inhibition of TLR9 Expression in HEK
293 Cells
[0165] The plasmacytoid dendritic cell (PDC) has been identified as
the key sensor of CpG motifs, Selective inhibition of TLR9 in PDC
with siRNA may allow analysis of the involvement of TLR9 in the
recognition of viruses and of different types of CpG motif
containing oligodesoxynucleotides (CpG ODN). We established
siRNA-mediated downregulation of TLR9 in a HEK 293 cell line stably
transfected with a construct containing the human TLR9 gene with a
C-terminal yellow fluorescent protein (YFP) tag. Four siRNA
molecules (TLR9.1, TLR9.2, TLR9.3, TLR9.4) targeting the human TLR9
mRNA were designed (Table 1), A standard BLAST-search ensured that
these siRNA io target sequences had no homologies with other human
genes. siRNA targeting the human TLR2 mRNA was used as negative
control, and a previously established siRNA targeting the
C-terminal YFP tag of the TLR9 construct was used as a positive
inhibition control (see Table 1). Adherent HEK 293cells were
transfected with 200 ng siRNA using lipofectamine in 96-well
plates. After 20 hours, 30 hours and 54 hours, HEK 293cells were
harvested and expression of TLR9 was assessed by quantifying YFP
fluorescence intensity by flow cytometry. At all three times points
analyzed, two of the four TLR9-specific siRNA tested (TLR9.2 and
TLR9.3) showed a strong inhibition of the TLR9) YFP fusion protein
expression that was in the same range as the anti-YFP siRNA used as
a positive inhibition control (TLR9 expression after 20 hours shown
in FIG. 1A; 30 hours: TLR2.1: 151.+-.10; TLR9.1: 71.+-.10; TLR9.2:
43.+-.2; TLR9.3: 48.+-.2; TLR9.4: 119.+-.5; GFP: 37.+-.3; 54 hours:
TLR2.1: 167.+-.8, TLR9.1: 65.+-.4; TLR9.2: 32.+-.1; TLR9.3:
34.+-.2; TLR9.4; 110.+-.7; GFP: 24.+-.1),
[0166] In order to exclude the possibility that downregulation of
the target gene in HEK 293 cells is associated with non-target
specific type I IFN induction, we analyzed the supernatants of HEK
293 cells for type I IFN activity, The induction of STATI and STAT2
phosphorylation in BL41 cells was used as a highly sensitive
measure of type I IFN. No type I IFN activity was detected in the
supernatants of HEK 293 cells transfected with the four different
anti-TLR9 siRNA TLR9.1, TLR9,2, TLR9.3, TLR9.4 (FIG. 1B). As
expected, 500 by long dsRNA complexed with lipofectamine (but not
without lipofectamine) induced similar STAT1 and STAT2
phosphorylating activity as obtained with the positive control
recombinant IFN-.beta. (FIG. . ), These results demonstrated that
two anti-TLR9 siRNA, TLR9.2 and TLR9.3, allow specific
dowaregulation of TLR9 expression in HEK 293 cells, and that in
this cell line, transfection with siRNA does not induce type I IFN
as a non-target-specific effect.
[0167] Sequence Dependent Potent Induction of IFN-.alpha. by siRNA
in Plasmacytoid Dendritic Cells
[0168] Next we studied whether anti-TLR9 siRNA that inhibited TLR9
expression in HEK 293 cells desensitizes PDC for stimulation with a
TLR9 ligand. Since the PDC is a major producer of type I IFN in the
human immune system, the use of double-stranded (ds) RNA for
selective target protein inhibition in PDC might be complicated by
dsRNA-mediated non-target-specific type I IFN induction. To study
this possibility, PDC from human peripheral blood were incubated
with either poly(I:C), the prototype stimulus for dsRNA, or with a
500 basepairs (bp) long dsRNA molecule; both were complexed with
lipofectamine for cytosolic delivery. The TLR9 ligand CpG-A ODN
2216 (Krug, A. et al. Eur J Inununol 31, 2154-63 (2001)) and the
TLR7 ligand R848 served as positive controls. We found that both
dsRNA molecules lacked the ability to induce IFN-.alpha. in PDC,
while the positive controls CpG-A ODN 2216 and R848 showed a
vigorous IFN-.alpha. response. These results suggested that dsRNA
may be useful for selective knockdown of target genes in PDC.
[0169] Surprisingly, transfection of the four anti-TLR9 siRNAs at
200 ng induced a consistent pattern of IFN-.alpha. production in
PDC (FIG. 2A). TLR9.2 and TLR9.3 induced significantly more
IFN-.alpha. production in PDC than TLR9,1 and TLR9.4 (FIG. 2A), To
exclude that RNA degradation is responsible for the lower degree of
interferon-induction by TLR9.1 and TLR9.4 (see FIG. 2A), we
compared decreasing amounts of all four sequences. At 25 ng (12.5
nM) the two sequences TLR9.2 and TLR9.3 still induced higher levels
of IFN-.alpha. than TLR9.1 at 200 ng (100 nM) (FIG. 2B), confirming
the distinct activity of the four anti-TLR9 siRNA in inducing
IFN-.alpha. in PDC. Distinct IFN-.alpha. inducing activity of
TLR9.1 and TLR9.2 was also observed when siRNA was delivered into
the cytosol of PDC by electroporation demonstrating that complex
formation of siRNA with lipofectamine is not required for the
IFN-.alpha. induction by siRNA; rather, the siRNA molecule itself
seemed to be the active agent. No IFN-.alpha. induction by siRNA
was observed in B cells or myeloid dendritic cells (data not
shown).
[0170] Of note, among the four anti-TLR9 siRNAs tested, the two
with the highest activity to downregulate TLR9 expression in HEK
293 cells were also the most potent sequences to induce IFN-.alpha.
in PDC (compare FIG. 1A and FIG. 2A). Although unlikely, a
target-specific effect (inhibition of TLR9) rather than
non-target-specific immunostimulatory effect may be responsible for
the IFN-.alpha. induction in PDC. To exclude this possibility we
compared a panel of siRNAs targeting mRNA sequences that are
expressed in PDC (TLR9) or not expressed in PDC (TLR2, TLR3, TLR4,
see Table 1). Considerable differences in the potency of these
siRNAs to induce IFN-.alpha. were seen, but no correlation was
found between the potency to induce IFN-.alpha. and the presence or
absence of the target mRNA in PDC (ODN 2216: x ADD VALUE.+-.SEM;
from low to is high IFN-.alpha. induction: TLR4.1: 491.+-.59;
TLR9.1: 500.+-.88; TLR9.4: 760.+-.131; TLR4.2: 1208.+-.267; TLR3.2:
1219.+-.204; TLR2.1: 1535.+-.235; TLR3.1: 2503.+-.552; TLR9.3:
3592.+-.283; TLR9.2: 4845.+-.621: n=6). The possibility of
differences in preparation quality or contaminants contributing to
distinct IFN-.alpha.-inducing activity of siRNA was excluded by
using siRNA sequences from different commercial sources that gave
identical results (data not shown). These data indicated that
IFN-.alpha. induction in PDC by siRNA is sequence-dependent and is
not linked to the presence or absence of the target mRNA.
[0171] Identification of an IFN-.alpha.-Inducing RNA Sequence
[0172] It has been reported that guanosine- and uridine rich
single-stranded RNA induces IFN-.alpha. in PDC. A mixture of
guanosine and uridine monomers also showed immunostimulatory
activity. Therefore we speculated that differences in the guanosine
and uridine content of the siRNA in our study may be responsible
for the different activity of siRNA to induce IFN-.alpha. in PDC.
Since siRNA is double-stranded, the total content of guanosine and
uridine in a 19 mer siRNA is always 19. The number of uridines in
the siRNAs tested ranged from 9 to 11 with no correlation between
number of uridines and IFN-.alpha. inducing activity (see Table 1),
Immunoactive siRNAs may still contain specific single strands
(sense or anti-sense) with different guanosine- and uridine
content. However, the total numbers of guanosines and uridines
ranged between 7 and 12 in the single strands of the active siRNAs
(TLR9.2 and TLR9.3) as well as in single strands of siRNAs with
lower activity (TLR9.1, TLR9.4, TLR2.1, TLR4.1, TLR4.2, TLR3.1,
TLR3.2); furthermore, the ratio of uridines to guanosines was not
linked to the immunological activity (see Table 1). Therefore, a
specific sequence rather than simply the content of guanosines and
uridines seemed to be responsible for the immunological activity of
TLR9.2 and TLR9.3.
[0173] In order to identify the immunostimulatory sequence, we
compared the IFN-.alpha. inducing activity of the two single
strands (sense and antisense) of TLR9.2 with the activity of the
duplex. The sense strand of TLR9.2 was equally potent to induce
IFN-.alpha. in PDC than the duplex, while the antisense strand of
TLR9.2 showed only weak activity (FIG. 2C, left panel). IFN-.alpha.
induction by poly(U) or by poly(A) ssRNA and by poly(U:A) dsRNA was
low as compared to the sense strand of TLR9.2 siRNA (RNA9.2s:
4962.+-.797; poly(U): 574.+-.165; poly(A): 244.+-.120; poly(U:A):
111.+-.53; for poly(A) also see FIG. 3B second bar from left)
further supporting the concept that the sense strand of TLR9.2
contains a specific immunostimulatory motif that is recognized by
PDC.
[0174] Since siRNA is generated by annealing of the sense and the
antisense strand, the immunostimulatory activity of TLR9.2 siRNA
may be due to unbound sense strand in the siRNA preparation and not
due to the duplex, To exclude this possibility, the sense strand
and the duplex of TLR9.2 were exposed to single-strand RNAse. As
expected, the sense strand was completely degraded by RNAse
treatment (FIG. 2D, left panel), leading to the loss of
immunological activity (FIG. 2D, right panel). In contrast, the
duplex was not affected by RNAse treatment, and the activity to
induce IFN-.alpha. was maintained (FIG. 2D). To further exclude a
contribution of contaminating single-stranded RNA in the siRNA
preparation we designed a single-stranded RNA that for ma an
energetically stable hairpin (similar to microRNA) in which the
double-stranded region contains the complete duplex of TLR9.2 siRNA
(Table 2), This hairpin was found to be as active in inducing
IFN-.alpha. as the TLR9.2 siRNA duplex (FIG. 2E). These data
demonstrated that immunostimulatory activity of siRNA cannot be
prevented by eliminating single-stranded contaminants in siRNA
preparations, and that immunostimulation is also relevant for the
hairpin-based RNA interference (ie. microRNA).
[0175] The sequences of TLR9.2 and TLR9.3 show an overlap of 13
bases (see Table 1). Since both siRNAs were potent inducers of
IFN-crin PDC, we hypothesized that the sequence motif responsible
for IFN ce induction is located in the overlapping region of TLR9.2
and TLR9.3. Thus localization of the immunostimulatory motif
pointed to the 13 bases at the 3' end of the sense strand of
TLR9.2. This assumption was supported by decreased activity of the
sense strand when a FITC molecule was linked to the 3' end but not
the 5' end (FIG. 3A, compare 5'F to 3'F). The lack of immunological
activity of poly(A) (FIG. 3A) allowed us to substitute bases in the
sense strand of TLR9.2 with A in order to narrow the motif.
Consistent with a localization of the immunostimulatory motif
within the 13 bases of the 3 ' end of the sense strand of TLR9.2,
substitution of 8 bases at the 3' end (R8A, R stands for right) but
not at the Send (L8A, L stands for left) abolished the
immunological activity of the sense strand (FIG. 3B). By further
increasing the number of A from the 5' end (L8A to L12A), position
11 was identified to be essential for the motif at the 3' end,
suggesting that the 9 bases at the 3'end (5'GUCCUUCAA 3', SEQ ID
NO:1) of the sense strand of TLR9.2 are responsible for its
immunostimulatory activity. The exchange of increasing numbers of
bases in this 9 mer sequence resulted in a gradually decreasing
immunological activity of the sense strand of TLR9.2 with a
complete loss of activity when 6 bases were exchanged within the 9
mer sequence (FIG. 3B; R8A). The minimal length of the RNA required
for IFNs induction was found to be in the range of 19 bases, since
both a 12 mer and a 16 mer containing the 9 mer sequence showed a
much lower activity (FIG. 3B). On the other hand, by placing the 9
mer sequence twice in a 19 mer RNA oligonucleotide (termed DR), the
immunological activity was further increased as compared to the
sense strand of TLR9.2, which only contains one immunostimulatory 9
mer sequence (termed n; FIG. 3B).
[0176] Dissection of Immunostimulatory Activity and Silencing
Activity of siRNA
[0177] According to the above studies, the immunostimulatory
activity of TLR9.2 is localized in the sense strand and the
silencing activity in the anti-sense strand of the duplex.
Appropriate modifications of both single RNA strands of TLR9.2 may
allow dissection of the immunostimulatory from the silencing
activity and vice versa. The backbone modification, locked nucleic
acids (LNA), has been used to change the properties of siRNA with
regard to target inhibition. We were interested whether LNA
modification of the sense and the anti-sense strand can be used to
modulate not only the silencing but also the immunological activity
of siRNA. First we examined the impact of 5' and 3' LNA on the
immunological activity of the sense strand of TLR9.2 (see Table 2).
Consistent with linking a FITC molecule to the 5' or the 3' end
(see FIG. 3A), LNA modification at the 3' end but not at the 5' end
strongly inhibited the activity of the sense strand to induce
IFN.alpha. (FIG. 4A). Next, sense and anti-sense strand with
different LNA modifications (LNA at 5' end, at 3' end, or at both
5' and 3' ends) or without LNA modification were annealed to
generate a total of 16 different TLR9.2 siRNA derivatives. We
assessed the activity of this panel of TLR9.2 duplexes to induce
IFN.alpha. in PDC (FIG. 4B, black bars). Like for the sense strand
alone (FIG. 4A), duplexes with LNA modification of the sense strand
at the 3' end or at both the 3' end the 5' end strongly inhibited
IFN.alpha. inducing activity, while LNA modification at the 5' end
sense strand showed no major changes of the activity (FIG. 4B). LNA
modifications of the anti-sense strand did not influence the
immunostimulatory activity of an siRNA containing an unmodified
sense strand (FIG. 4B).
[0178] Next we examined the influence of LNA-modifications on the
silencing activity of TLR9.2 siRNA. Unlike for IFN.alpha.
induction, LNA modification of the sense strand had almost no
effect on the silencing activity of TLR9.2 siRNA (FIG. 4B, open
bars). In contrast, LNA modification of the anti-sense strand
strongly affected the silencing activity of the TLR9.2 siRNA. LNA
modification of the 3' end of the anti-sense strand had less impact
on the silencing activity than LNA modification of the 5' end of
the anti-sense strand. Silencing activity was completely lost when
both the 3' and the 5' ends were modified by LNA. Together these
data indicated that it is possible to dissociate the two functional
activities of siRNA by introducing LNA modifications to different
regions of the sense and the anti-sense strand: the silencing
activity can be maintained while minimizing the immunostimulatory
component of siRNA (for example: LNA at the 3' end of the sense
strand); the immunostimulatory activity can be maintained while
abolishing the silencing activity of siRNA (i.e, LNA at the 3' and
the 5' end of the anti-sense strand).
[0179] Immunostimulatory siRNA Induces Systemic Immune Responses in
Mice In Vivo
[0180] In order to study the systemic activity of siRNA in vivo, we
first examined the in vitro immunostimulatory activity of siRNA
sequences in the murine system. Similar to the human system, the
TLR9.2 duplex and the sense strand were found to induce IFN.alpha.,
while the anti-sense strand of TLR9.2 was much less active, and
poly(A) was inactive (FIG. 5A).
[0181] Next, the immunological activity of the TLR9.2 duplex, the
TLR9.2 sense strand, and the TLR9.2 anti-sense strand was assessed
in vivo. TLR2.1 was included in this analysis as a siRNA that in
the human system was less active than TLR9.2. Seven hours after
i.v. injection into 129Sv mice, the concentration of IFN-.alpha.
was measured in the serum of mice (FIG. 5B). In addition,
activation of immune cell subsets in the spleen was assessed by
flow cytometry after 43 hours (FIG. 5C). Consistent with the in
vitro data, the TLR9.2 duplex and the TLR9.2 sense strand showed
the highest activity to induce systemic levels of IFN-.alpha. and
to activate CD4 and CD8 T cells and myeloid dendritic cells (FIG.
5C). No immunological activity was observed with either cationic
liposomes (DOTAP) or siRNA alone. (FIG. 5D). Together, these
results demonstrated that administration of siRNA in vivo elicits
systemic immune responses detectable in both blood and spleen and
that the immunological activity in mice shows similar sequence
dependency as in the human system.
[0182] Immune Recognition of siRNA Requires TLR7
[0183] Conserved sequence dependent immune recognition of siRNA in
mice and humans allowed the use of knockout mice in order to
identify the responsible receptor. TLR7 and TLR9 are the only
members of the TLR family that are expressed in PDC FIX REFERENCE
{Krug, 2001 #5;Homung, 2002 #37} and that are known to be linked to
IFN-.alpha. production. So far, RNA sequence motifs specifically
detected via TLR7 have not been identified. We hypothesized that
TLR7 is involved in the recognition of the immunostimulatory
sequence motif contained in TLR9.2 siRNA. Indeed we found that
IFN-.alpha. induction in vitro by the TLR9.2 duplex and the TLR9.2
sense strand as well as by an established TLR7 ligand (loxoribine)
was absent in bone marrow cells derived from TLR7-deficient mice
(FIG. 6A). In contrast, IFN-.alpha. induction by the TLR9 ligand
CpG ODN 1826 was not reduced in bone marrow cells derived from
TLR7-deficient mice (FIG. 6A).
[0184] Additional in vivo mechanisms of immune recognition of siRNA
might exist that are not detectable in vitro. As such, TLR9.2 siRNA
was injected i.v. into TLR7-deficient mice and wild type control
mice. In contrast to wild type mice, TLR7-deficient mice had no
detectable IFN-.alpha. in serum after 7 h and 24 h (FIG. 6B).
Furthermore, no activation of CD4 T cells, CD8 T cells, myeloid
dendritic cells and PDC was found in spleen cells of TLR7-deficient
mice, while strong activation of all four cell subsets was observed
in wild type mice (FIG. 6C). Together these data indicated that
TLR7 is required for immune recognition of TLR9.2 siRNA.
[0185] Discussion
[0186] One of the most significant advances in RNA interference
technology was the observation that by reducing the length of the
dsRNA molecules down to 22 bp, PKR-mediated nonspecific type I IFN
induction can be abolished while sequence-specific downregulation
of the target mRNA is maintained. In agreement with this concept we
were able to establish siRNA-mediated sequence-specific
downregulation of TLR9 in the human HEK293 cell line in the absence
of an IFN response. However, when we attempted to apply this method
to primary plasmacytoid dendritic cells (PDC) we made the
surprising observation that the previously proposed length
dependence of dsRNA recognition seemed to be reversed: while
transfection of PDC with a 500 by long dsRNA molecule or with
poly(I:C) (mimicking long dsRNA) failed to induce IFN-.alpha., some
of the siRNA sequences tested showed a vigorous IFN-.alpha.
response.
[0187] Based on the overlapping sequence of two siRNAs with potent
IFN-.alpha. inducing activity we were able to identify an
immunostimulatory single-stranded RNA sequence consisting of 9
bases (5'GUCCUUCAA 3', SEQ ID NO:1). By chemical backbone
modification of different regions of both strands of the
immunostimulatory siRNA, we were able to dissect immunostimulation
and RNA silencing as two independent functional activities. The
same type of sequence-specificity with regard to IFN-.alpha.
induction by siRNA was seen in the mouse. In vitro
immunostimulatory activity and in vivo systemic immune responses
were abrogated in TLR7-deficient mice, demonstrating that
sequence-specific immune recognition of siRNA is mediated via
TLR7.
[0188] Our results provide evidence that the immunostimulatory
activity of siRNA is not mediated by single-stranded RNA molecules
left over in the siRNA preparation after an incomplete annealing
process: i) treatment of the siRNA preparation with single-strand
RNAse did not affect the immunological activity of siRNA, while the
activity of the corresponding immunostimulatory single-strand RNA
was abolished; ii) a single-strand RNA oligonucleotide designed to
spontaneously form an energetically stable hairpin (in the form of
microRNA) containing the complete duplex of the immunostimulatory
siRNA was as active as the immunostimulatory siRNA. These data
confirmed that recognition mechanisms responsible for the
recognition of siRNA allow the detection of a single-strand RNA
motif within the RNA duplex.
[0189] It is interesting to note that for the recognition of siRNA
and the TLR9 ligand (CpG DNA), the detection of the
immunostimulatory sequence motifs occurs on the single-strand level
although both siRNA and microbial DNA are primarily double-stranded
(viral or bacterial DNA genomes are usually double-strand). To date
there is no information whether helicase activity is part of the
recognition process. For both RNA and DNA, synthetic
single-stranded oligonucleotides containing the appropriate
sequence motifs can be used to elicit the corresponding type of
immune responses. The minimal length of an immunostimulatory RNA
oligonucleotide was approximately 19 bases. Similarly, the 6 mer
CpG motif needed to be part of a longer oligonucleotide to become
an active TLR9 ligand (Hartmann, G. et al. J Immunol 2000,
164:944-53). Since poly A RNA showed no immunological activity, the
addition of poly A could be used for elongation of an RNA
oligonucleotide containing the 9 mer stimulatory sequence up to the
length of a 19 mer. The insertion of two stimulatory 9 mer
sequences in a 19 mer RNA oligonucleotide further increased the
immunostimulatory activity. By analogy, poly(C) was used in
previous studies for elongation of a CpG motif containing
oligodesoxynucleotide, since poly(C) DNA (with and without
phosphorothioate modification) lacked immunostimulatory activity
(Hartmann, G. et al. J Immunol 2000, 164:944-53).
[0190] It has been reported that certain single-stranded RNA
viruses such as vesicular stomatitis virus and influenza virus are
recognized by immune cells via TLR7 (Lund, et al., Proc. Natl, Mad.
Sci. USA 2004, 101:5598-603; Heil et al., Science 2004, 303:1526-9;
Diebold, et al., Science 2004, 303:1526-9), but specific sequence
motifs responsible for viral RNA recognition have not been
identified so far. Instead, poly(U) has been reported to be active,
and it has been proposed that GU-rich sequences in viral RNA are
responsible for immune recognition; furthermore, that a mixture of
monomeric Gs and Us is immunostimulatory, indicating that RNA
degradation products might be involved. There are several lines of
evidence that the immunostimulatory activity of the RNA molecules
in our study is not due to GU content. First, the total number of G
and U of duplex RNA by definition is always identical with the
length of the duplex (i.e. the GU count of a 19 mer duplex is
always 19). Second, a higher number of Gs or Us or the ratio of G
to U in the one or the other of the two single strands of snRNA was
not associated with the immunological activity of siRNA. Third,
increasing the number of G in the immunostimulatory single strand
RNA reduced rather than enhanced its immunological activity; and
fourth, poly(U) was weak compared to the RNA oligonucleotide
containing the immunostimulatory RNA sequence described in this
study.
[0191] Although our results clearly demonstrate that immune
recognition of siRN A by PDC is sequence-dependent and GU
content-independent, the sequence described in this study may only
be one of several different immunostimulatory RNA sequence motifs.
Optimization of the sequence of this study and the identification
of additional sequences will be the subject of a broader screen of
sequences to identify the most potent immunostimulatory RNA
motifs.
[0192] At least for the RNA sequence described in this study,
recognition of siRNA seems to be conserved in mouse and man. Upon
intravenous injection of immunostimulatory siRNA complexed with
DOTAP we observed strong systemic immune responses including
IFN-.alpha. in the serum and activation of T cells, PDC and myeloid
dendritic cells. The level of immune activation was in the same
range as with the TLR9 ligand CpG. Activation of myeloid dendritic
cells and T cells by siRNA in vivo may be due to secondary effects
mediated by IFN-.alpha. as has been demonstrated in the human
system (Krug, A. et al. J Immunol 170, 3468-77 (2003),
Rothenfusser, S. et al. Blood 103, 2162-9 (2004), Rotherifusser, S.
et al. Eur Immunol 31, 3525-34 (2001)). As a consequence cationic
lipid-complexed siRNA, similar to CpG, may elicit potent
therapeutic activity against viral (Dittmer, U. & Olbrich, A.
R. Curr Opin Microbiol 6, 472-7 (2003)) and bacterial infection
(Wagner, H., Springer Semin Immunopathol 22, 147-52 (2000)) and
tumors (Heckelsmiller, K. et al. Eur J Immunol 32, 3235-45 (2002),
Heckelsmiller, K. et al. J Immunol 169, 3892-9 (2002), Weiner, G.
J. Curr Top Microbiol Immunol 247, 157-70 (2000)). It is
interesting to note that siRNA was successfully used to inhibit
viral replication and transcription in a murine model of hepatitis
B (Klein, C. et al. Gastroenterology 125, 9-18 (2003), Davidson, B.
L. N Engl J Med 349, 2357-9 (2003)). Since IFN-.alpha. is a
mainstay of hepatitis B treatment, PDC-derived IFN-.alpha. might
have contributed to therapeutic effects of siRNA.
[0193] In our study, immune responses induced by siRNA both in
vitro and in vivo completely depended on the presence of TLR7.
However, in many cell lines, such as HEK293 cells, TLR7 is not
expressed and thus immune recognition of siRNA via TLR7 is not
expected. This is consistent with our in vitro observation that the
supernatant of siRNA-transfected HEK293 cells, in contrast to
transfection with long dsRNA molecules, shows no type I IFN
response as evidenced by the lack of STAT1- or
STAT2-phosphorylating activity. These results are in agreement with
the concept, that in TLR7-deficient cell lines in vitro, short
dsRNA of 21 by (siRNA) lack immunostimulatory activity and are
useful for sequence-specific downregulation of target genes.
[0194] Contradicting this concept is a report suggesting that
transfection of siRNAs into cell lines results in PKR-dependent
type I IFN-mediated activation of the STAT pathway and leads to
upregulation of IFN-stimulated genes (Sledz, C. A., et al. Nat cell
Biol 5, 834-9 (2003)). Furthermore, siRNA was reported to induce
type I IFN responses via TLR3 expressed in cell lines, including
HEK293 cells (Kariko, K., et al. J Immunol 172, 6545-9 (2004),
Kariko, K. et al. Cells Tissues Organs 177, 132-8 (2004)). However,
the complete loss of immunostimulatory activity of siRNA in
TLR7-deficient mice in our study provides evidence that PKR and
TLR3 do not represent the major mechanisms by which siRNA is
detected by the innate immune system. This is supported by our
recent finding that the immunological activity of siRNA is not
affected in TRIF-deficient mice (data'not shown). TRIF is a
necessary adaptor molecule for TLR3 signaling. The lack of
immunological activity of siRNA in TRIF-deficient mice also
indicates that the alternative TLR3- and TRIF-independent pathway
of long double-stranded RNA (poly[LC]) recognition proposed by
Hoebe and colleagues Hoebe, K. et al. Nat Immunol 4, 1223-9 (2003).
is not involved in the immune recognition of siRNA.
[0195] Non-target-specific downregulation of protein expression by
siRNA-induced type I IFN production is a major issue in RNA
interference technology. Ways to separate type I IFN inducing
properties from the silencing activity of siRNA will advance the
application of siRNA. In our study, the siRNA TLR9.2 turned out to
be an excellent model to demonstrate that silencing activity and
immunostimulatory activity are two unrelated functional properties
of siRNA. Dissection of both functional activities was possible
since the RNA sequence responsible for IFN-.alpha. induction was
found to be located on the sense strand and not the anti-sense
strand. By selected backbone modification (with locked nucleic
acid; LNA) of certain regions on the sense or the antisense strand
of siRNA TLR9.2, we were able to generate derivatives of siRNA
TLR9.2 in which the immunostimulatory activity was abolished while
the silencing activity was maintained, and vice versa. This
demonstrated that the functional properties of siRNA can be changed
to favor immunostimulation and/or target mRNA silencing. Obviously,
in addition to their effects on mRNA silencing, certain siRNA can
also have added therapeutic potential due to their potential
immunostimulatory properties, especially as it relates to use as an
anti-infective or anti-tumor therapeutic. The stimulatory sequence
used in this study resulted in IFN-.alpha. induction that was
approximately 30% of the maximal stimulation seen in PDC (stimulus:
CpG-A ODN 2216). Although it is unlikely that this stimulatory
sequence is optimal, our results with this RNA sequence in vivo
highlight the potential for further development of
immunostimulatory siRNA molecules.
Example 2
Synthesis of Modified Oligonucleotides for Modulating
Immunostimulation
[0196] (a) RNA, 2'-O-Methyl-Modified, 2'-deoxy-2'-fluoro-Modified,
and Thioate-Modified Oligonucleotides
[0197] The RNA molecules were synthesized on a 394 ABI machine
using the standard cycle written by the manufacturer with
modifications to a few wait steps as described below. The solid
support was controlled pore glass (CPG; 500A, Prime Synthesis,
Inc., Aston, Pa., USA). The monomers were RNA phosphoramidites or
2'-O-Methyl (2'-OMe) RNA phosphoramidites with standard protecting
groups obtained from Pierce Nucleic Acid Technologies (Pierce
Milwaukee LLC, Milwaukee, Wis., USA) used at concentrations of 0.15
M in CH.sub.3CN unless otherwise stated. Specifically the RNA
phosphoramidites were
5'-O-dimethoxytrityl-N.sup.6-benzoyl-2'-O-tbutyldimethylsilyl-adenosine-3-
'-O-(.beta.-cyanoethyl-N,N'-diisopropyl)phosphoramidite,
5'-O-dimethoxytrityl-N.sup.2-isobutyryl-2'-O-tbutyldimethylsilyl-guanosin-
e-3'-O-(.beta.-cyanoethyl-N,N'-diisopropyl)phosphoramidite,
5'-O-dimethoxytrityl-N.sup.4-acetyl-2'-O-tbutyldimethylsilyl-cytidine-3'--
O-(.beta.-cyanoethyl-N,N'-diisopropyl)phosphoramidite,
5'-O-dimethoxytrityl-2'-O-tbutyldimethylsilyl-uridine-3'-O-(.beta.-cyanoe-
thyl-N,N'-diisopropyl)phosphoramidite,
5'-O-dimethoxytrityl-N.sup.6-benzoyl-2'-O-methyl-adenosine-3'-O-(.beta.-c-
yanoethyl-N,N'-diisopropyl)phosphoramidite,
5'-O-dimethoxytrityl-N.sup.2-isobutyryl-2'-O-methyl-guanosine-3'-O-(.beta-
.-cyanoethyl-N,N'-diisopropyl)phosphoramidite,
5'-O-dimethoxytrityl-N.sup.4-acetyl-2'-O-methyl-cytidine-3'-O-(.beta.-cya-
noethyl-N,N'-diisopropyl)phosphoramidite, and
5'-O-dimethoxytrityl-2'-O-methyl-uridinc-3'-O(.beta.-cyanoethyl-N,N'-diis-
opropyl)phosphoramidite. The 2'-deoxy-2'-fluoro
(2'-F)phosphoramidites,
O-dimethoxytrityl-N4-acetyl-2'-deoxy-2-fluoro-cytidine-3'-O--N,N'-diisopr-
opyl-2-cyanoethyl-phosphoramidite and
5'-O-dimethoxytrityl-2'-deoxy-2'-fluoro-uridine-3'-O-N,N'-diisopropyl-2-c-
yanoethyl-phosphoramidite were obtained from Promega Corp.
(Madison, Wis., USA).
5'-O-dimethoxytrityl-N6-benzoyl-2'-deoxy-2'-fluoro-adenosine-3'-O---
N,N'-diisopropyl-2-cyanoethyl-phosphoramiclite and
5'-O-dimethoxytrityl-N2-isobutyryl-2'-deoxy-2'-fluoro-guanosine-3'-O--N,N-
'-diisopropyl-2-cyanoethyl-phosphoramidite were synthesized
according to literature protocols (citations?). The coupling times
were 10 min for all monomers. Details of the other reagents are as
follows: activator, 5-ethyl thiotetrazole (0.25 M, Glen Research,
Sterling, Va., USA); Cap A, 5% acetic anhydride/THF/pyridine (Glen
Research, Sterling, Va., USA); Cap B: 10% N-methylimidazole/THF
(Glen Research, Sterling, Va., USA); PO oxidation involved 0.02 M
I.sub.2/THF/H.sub.2O (Glen Research, Sterling, Va., USA). For the
PS-oxidation a solution of the Beaucage reagent (Chruachem Ltd,
Glasgow, UK) in acetonitrile (1%) was used, The trityl group was
removed on the synthesizer with 3% TCA/dichloromethane (Glen
Research, Sterling, Va., USA).
[0198] (b) Synthesis of Oligonucleotides with LNA Linkages
[0199] The RNA molecules were synthesized on a 394 ABI machine
using the standard cycle written by the manufacturer with
modifications to a few wait steps as described below. The solid
support was rA CPG (2 .mu.mole, 520 .ANG., Prime Synthesis, Inc.,
Aston, Pa., USA, batch #CPG60N11RASN), rU CPG (G311103 is this a
Prime Synthesis, Inc., Aston, Pa., USA batch number as well?), LocA
(2 timole, Proligo LLC, Boulder, Colo., USA, 40.0 .mu.moles/g,
batch #225401), or LocT (2 timole, Proligo LLC, Boulder, Colo.,
USA, 39.0 .mu.moles/g, batch #224597). Loc designates an LNA
building block. The monomers were either RNA phosphoramidites
(Pierce Nucleic Acid Technologies, Pierce Milwaukee LLC, Milwaukee,
Wis., USA) or LNA phosphoramidites LocA.sup.Bz (Proligo LLC,
Boulder, Colo., USA, cat. no. 223917),.sup.5'DMT.sub.CE
Loc.sup.5meC.sup.Bz (Proligo LLC, Boulder, Colo., USA, cat. no.
223816), .sup.5'DMT.sub.CELoc.sup.5meG.sup.iBu (Proligo LLC,
Boulder, Colo., USA, cat. no. 223817), .sup.5'DMT.sub.CELocT
(Proligo LLC, Boulder, Colo., USA, cat. no. 22818). All had
standard protecting groups and were used at concentrations of 0.15
M in CH.sub.3CN unless otherwise stated. Specifically the RNA
phosphoramidites were
5'-O-dimethoxytrityl-N.sup.6-benzoyl-2'-O-tbutyldimethylsilyl-adenosine-3-
'-O-(.beta.-cyanoethyl-N,N'-diisopropyl)phosphoramidite (batch
#FG0082),
5'-O-dimethoxytrityl-N.sup.2-isobutyryl-2'-O-tbutyldimethylsilyl-guanosin-
e-3'-O-(.beta.-cyanoethyl-N,N'-diisopropyl)phosphoramidite (batch
#FE0031),
5'-O-dimethoxytrityl-N.sup.4-acetyl-2'-O-tbutyldimethylsilyl-cy-
tidine-3'-O-(.beta.-cyanoethyl-N,N'-diisopropyl)phosphoramidite
(batch #FF0046), and
5'-O-dimethoxytrityl-2'-O-tbutyldimethylsilykuridine-3'-O-(.beta.-cyanoet-
hyl-N,N'-diisopropyl)phosphoramidite (batch #FF0036). The LNA
phosphoramidites were
5'-O-dimethoxytrityl-N.sup.6-benzoyl-adenosine-3'-O-(.beta.-cyanoethyl-N,-
N'-diisopropyl) LNA phosphoramidite,
5'-O-dimethoxytrityl-N.sup.2-isobutyryl-guanosine-3'-O-(.beta.-cyanoethyl-
-N,N)-diisopropyl) LNA phosphoramidite,
5'-O-dimethoxytrityl-N.sup.4-acetyl-5-methyl-cytidine-3'-O-(.beta.-cyanoe-
thyl-N,N'-diisopropyl) LNA phosphoramidite, and
5'-O-dimethoxytrityl-5-methyl-thymidine-3'-O-(.beta.-cyanoethyl-N,N'-diis-
opropyl) LNA phosphoramidite.
[0200] The coupling times were 10 mins for all monomers. Details of
the other reagents are as follows: activator: 5-ethyl thiotetrazoic
(0.25 M, Glen Research, Sterling, Va., USA); Cap A, 5% acetic
anhydride/THF/pyridine (Glen Research, Sterling, Va., USA); &
Cap B, 10% N-methylimidazole/THF (Glen Research, Sterling, Va.,
USA); PO oxidation involved 0.02M I.sub.2/THF/H.sub.2O (Glen
Research, Sterling, Va., USA). The trityl group was removed on the
synthesizer with 3% TCA/dichloromethane (Glen Research, Sterling,
Va., USA).
[0201] Deprotection
[0202] After completion of synthesis the controlled pore glass
(CPG) was transferred to a screw cap sterile microfuge tube. The
oligonucleotide was cleaved and simultaneously the base and
phosphate groups deprotected with 1.0 mL of a mixture of ethanolic
ammonia (1:3) for 5 hours at 55.degree. C. The tube was cooled
briefly on ice and then the solution was transferred to a 5 mL
centrifuge tube. The solid support was washed three times using 025
mL of 50% CH.sub.3CN in water and the washes were added to the
original solution. The tubes were cooled at -80.degree. C. for 15
min and the solution was dried in a lyophilizer.
[0203] The white residue obtained was resuspended in 200 .mu.L of
triethylamine trihydrofluoride and heated at 65.degree. C. for 1.5
h to remove the TBDMS groups at the 2'-position. The
oligonucleotide was then precipitated in dry methanol (400 .mu.L).
The liquid was removed carefully to yield a pellet at the bottom of
the tube. Residual methanol was removed in the speed vacuum to give
the crude RNA as a white fluffy material.
[0204] Purification
[0205] Samples were dissolved in imL RNase free water and
quantitated at 260 nm. The crude oligonucleotides were purified by
denaturing gel electrophoresis (20% acrylamide, 6 M urea). The
purified oligonucleotides were desalted using Sephadex G25M
(Amersham Biosciences Corp, Piscataway, N.J., USA).
[0206] Tables 3-6 show the sequences of the so modified
oligonucleotides that were synthesized.
[0207] Determination of Activity
[0208] Modified oligonucleotides were incubated with PDC as
described above in Example I, and IFN-.alpha. production was
measured. Table 7 shows the results obtained for oligonucleotides
having a base sequence identical to TLR9.2s except for the terminal
thymidines, but containing 2'-fluoro or 2'-O-methyl-modifications
in positions 1 and 2, 1, 2, 18, and 19, 1 through 4 and 16 through
19, and 16 through 19, or a fully phosphorothioate-substituted
backbone, respectively, expressed in % of the IFN-.alpha.
production measured for TLR9.2s. It is evident that the 2'-fluoro
modification generally has less effect on the immunostimulating
activity of these oligonucleotides, while 2'-O-methyl modifications
almost completely abolish this activity. For the 2-fluoro
modification, modifying only those nucleotides at the 5'-end,
farthest away from the 5'-GUCCUUCAA-3' (SEQ ID NO:1) motif, had the
least effect, while modifying 4 nucleotides on both ends severely
diminished the immunostimulatory activity of the oligonucleotide.
Phosphorothioates moderately diminished the IFN-.alpha. inducing
activity.
[0209] Hence, if it seems desirable to modify an immunostimulatory
oligonucleotide of the invention, e.g. in order to protect it
against nucleolytic degradation, this may be achieved by
introducing 2'-fluoro modifications, and preferably by introducing
these modifications in such a manner that the nucleotides of SEQ ID
NO:1 remain unmodified. However, if it is desired to generate an
oligonucleotide comprising SEQ ID NO:1, or 4 or more, 5 or more, 6
or more, 7 or more or 8 or more contiguous nucleotides from SEQ ID
NO:1, e.g. 5'-GUCC-3' (SEQ ID NO:2), 5'-GUCCU-3' (SEQ ID NO:3),
5'-GUCCUU-3' (SEQ ID NO:4), 5'-GUCCUUC-3' (SEQ ID NO:5), or
5'-GUCCUUCA-3' (SEQ ID NO:6), but immunostimulating activity is to
be avoided, then this may be achieved by introducing 2'-O-inethyl
modifications, and preferably by introducing these modifications in
such a manner that the nucleotides of SEQ ID NO:1 are modified.
TABLE-US-00004 TABLE 1 siRNA sequences Base Gene target composition
(starting base) Our no. Sequence (sense/antisense) A G U C SEQ ID
NO: hTLR2 (29) TLR2.1s 5'-AAGGAGACCUAUAGUGACUdTdT 8 11 11 8 SEQ ID
NO: 8 TLR2.1as 5'-AGUCACUAUAGGUCUCCUUdTdT SEQ ID NO: 9 hTLR3 (71)
TLR3.1s 5'-GGAAAGGCUAGCAGUCAUCdTdT 10 9 9 10 SEQ ID NO: 10 TLR3.1as
5'-GAUGACUGCUAGCCUUUCCdTdT SEQ ID NO: 11 (331) TLR3.2s
5'-ACUAGCUUGGAUGUAGGAUdTdT 8 11 11 8 SEQ ID NO: 12 TLR3.2as
5'-AUCCUACAUCCAAGCUAGUdTdT SEQ ID NO: 13 hTLR4 (1039) TLR4.1s
5'-UACUUAGACUACUACCUCGdTdT 8 11 11 8 SEQ ID NO: 14 ILR4.1as
5'-CGAGGUAGUAGUCUAAGUAdTdT SEQ ID NO: 15 (1597) TLR4.2s
5'-AUGGCUGGCAAUUCUUUCCdTdT 9 10 10 9 SEQ ID NO: 16 TLR4.2as
5'-GGAAAGAAUUGCCAGCCAUdTdT SEQ ID NO: 17 hTLR9 (1155) TLR9.1s
5'-UGGACGGCAACUGUUAUUAdTdT 8 11 11 8 SEQ ID NO: 18 TLR9.1as
5'-UAAUAACAGUUGCCGUCCAdTdT SEQ ID NO: 19 (1647) TLR9.2s
5'-AGCUUAACCUGUCCUUCAAdTdT 8 11 11 8 SEQ ID NO: 20 TLR9.2as
5'-UUGAAGGACAGGUUAAGCUdTdT SEI ID NO: 21 (1653) TLR9.3s
5'-ACCUGUCCUUCAAUUACCAdTdT 8 11 11 8 SEQ ID NO: 22 TLR9.3as
5'-UGGUAAUUGAAGGACAGGUdTdT SEQ ID NO: 23 (2251) TLR9As
5'-CUCAUUCACGGAGCUACCAdTdT 10 9 9 10 SEQ ID NO: 24 TLR9.4as
5'-UGGUAGCUCCGUGAAUGAGdTdT SEQ ID NO: 25 eGFP (435) GFPs
5'-CUACAACAGCCACAACGUCdTdT 10 9 9 10 SEQ ID NO: 26 GFPas
5'-GACGUUGUGGCUGUUGUAGdTdT SEQ ID NO: 27 Numbers in parentheses
indicate the nucleotide position at which the 5'-end of the sense
strand of the siRNA matches the target sequence for either hTLR2
(NM_003264), hTLR3 (N144_003265), hTLR4 (NM_138554), hTLR9
(NM_017442), enhanced GFP.
TABLE-US-00005 TABLE 2 Single-Stranded RNA Oligonucleotides
Original sequence Name.sup.1 Sequence 5' -> 3'.sup.2 SEQ ID NO:
TLR9.2s AGCUUAACCUGUCCUUCAA SEQ ID NO: 28 L8A AAAAAAAACUGUCCUUCAA
SEQ ID NO: 29 L9A AAAAAAAAAUGUCCUUCAA SEQ ID NO :30 L10A
AAAAAAAAAAGUCCUUCAA SEQ ID NO: 31 L11A AAAAAAAAAAAUCCUUCAA SEQ ID
NO: 32 L12A AAAAAAAAAAAACCUUCAA SEQ ID NO: 33 R3A
AGCUUAACCUGUCCUUAAA SEQ ID NO: 34 R4A AGCUUAACCUGUCCUAAAA SEQ ID
NO: 35 R5A AGCUUAACCUGUCCAAAAA SEQ ID NO: 36 R8A
AGCUUAACCUGAAAAAAAA SEQ ID NO: 37 DR UGUCCUUCAAUGUCCUUCAA SEQ ID
NO: 38 19U AGCUUAACCUGUCCUUCAU SEQ ID NO: 39 81/9UU
AGCUUAACCUGUCCUUCUU SEQ ID NO: 40 hairpin AGCUUAACCUGUCCUUCAA- SEQ
ID NO: 41 CUACACAAAUUGAAGGAC AGGUUAAGCU 5'F F-AGCUUAACCUGUCCUUCAA
SEQ ID NO: 42 3'F AGCUUAACCUGUCCUUCAA-F SEQ ID NG: 43 5'LNA
AGCUUAACCUGUCCUUCAA SEQ ID NO: 44 3'LNA AGCUUAACCUGUCCUUCAA SEQ ID
NO: 45 5'3'LNA AGCUUAACCUGUCCUUCAA SEQ ID NO: 46 16 mer
UUAACCUGUCCUUCAA SEQ ID NO: 47 12 mer AACCUGUCCUUCA SEQ ID NO: 48
TLR9.2as UUGAAGGACAGGUUAAGCU SEQ ID NO: 49 5'LNA
UUGAAGGACAGGUUAAGCU SEQ ED NO: 50 3'LNA UUGAAGGACAGGUUAAGCU SEQ ID
NO: 51 5'3'LNA UUGAAGGACAGGUUAAGCU SEQ ID NO: 52 polyA
AAAAAAAAAAAAAAAAAAA SEQ ID NO: 53 polyU UUUUUUUUUUUUUUUUUUU SEQ ID
NO: 54 .sup.1L8A: read "8 A from left" (5' end); R3A: read "3 A
from right" (3' end); DR: read "double right" (sequence containing
the 3' 9 mer sequence of 9.2 sense two times); 19U: read "base at
position 19 replaced by U"; 18/19UU read "bases at position 18 and
19 replaced by U"; .sup.2underlined: 3' 9 mer sequence of TLR9,2s;
F: FITC; bold: LNA modification.
TABLE-US-00006 TABLE 3 Oligonucleotides containing ribofluoro
modifications Our D/ Extn coeff. No. Sequence tube Mass OD/mg
e260*10-3 SEQ ID NO: 2792 fAfGfCfUJUAACCUGUCCUUCAA 2 5950.57 29.8
177 SEQ ID NO: 55 2793 fAfGCUUAACCUGUCCUUCfAfAdT 3 6254.77 29.6 185
SEQ ID NO: 56 2794 fAfGfCfUUAACCUGUCCUfUfCfAfAdT 2 6262.77 29.6 185
SEQ ID NO: 57 2795 AGCUUAACCUGUCCUfUfCfAfAdT 3 6254.77 29.6 185 SEQ
ID NO: 58 2796 fUfUfGfAAGGACAGGUUAAGCU 3 6133.73 32.5 199 SEQ ID
NO: 59 2797 fUfUGAAGGACAGGUUAAGfCfUdT 2 6437.93 32.2 207 SEQ ID NO:
60 2798 fUfUfGfAAGGACAGGUUAfAfGfCfUdT 2 6445.93 32.1 207 SEQ ID NO:
61 2799 UUGAAGGACAGGUUAfAfGfCfUdT 2 6437.93 32.2 207 SEQ ID NO:
62
TABLE-US-00007 TABLE 4 Oligonucleotides containing
phosphorothioates Our OD/ Expected Extra coeff, No. Sequence tube
Mass OD/mg 260*10-3 SEQ ID NO: 2808
AsGsCsUsUsAsAsCsCsUsGsUsCsCsUsUsCsAsA 2 6230.57 28.4 177 SEQ ID NO:
63 2809 UsUsGsAsAsGsGsAsCsAsGsGsUsUsAsAsGsCsU 2 6413.73 31.03 199
SEQ ID NO: 64
TABLE-US-00008 TABLE 5 Oligonucleotides containing 2'0-methyl
modifications Our OD/ Expected Extu coeff. No Sequence tube Mass
OD/mg e260*10-3 SEQ ID NO 2800 oAoGoCoUUAACCUGUCCUUCAA 3 5998.69
29.6 177 SEQ ID NO: 65 2801 oAoGCUUAACCUGUCCUUCoAoA 3 5998.69 29.6
177 SEQ ID NO: 66 2802 oAoGoCoUUAACCUGUCCUoUoCoAoA 3 6054.81 29.28
177 SEQ ID NO: 67 2803 AGCUUAACCUGUCCUoUoCoAoA 3 5998.69 29.55 177
SEQ ID NO: 68 2804 oUoUoGoAAGGACAGGUUAAGCU 3 6181.85 32.20 199 SEQ
ID NO: 69 2805 UoUGAAGGACAGGUUAAGoCoU 3 6181.85 32.20 199 SEQ ID
NO: 70 2806 oUoUoGoAAGGACAGGUUAoAoGoCoU 3 6237.97 31.91 199 SEQ ID
NO: 71 2807 UUGAAGGACAGGUUAoAoGoCoU 3 6181.85 32.20 199 SEQ ID NO:
72 2869 AGoCoUoUAAoCoCoUGoUoCoCoUoUoCAA 2 6110.93 29.2 177 SEQ ID
NO: 73 2870 oAGoCUoUAoACoCUoGUoCCoUUoCAoA 2 6082.87 29.1 177 SEQ ID
NO: 74 2871 AoGCoUUoAAoCCoUGoUCoCUoUCoAA 2 6068.84 29.2 177 SEQ ID
NO: 75 2872 AGCUoUAACCoUGUCCUUoCAA 2 5984.66 29.6 177 SEQ ID NO: 76
2873 oUoUGAAGGAoCAGGoUoUAAGoCoU 2 6223.94 32.0 199 SEQ ID NO: 77
2874 oUUoGAoAGOGAoCAoGGoUUoAAoGCU 2 6251.64 31.8 199 SEQ ID NO: 78
2875 UoUGoAAoGGoACoAGoGUoUAoAGoCU 2 6266.03 31.8 199 SEQ ID NO: 79
2876 UoUGAAGGAoCAGGUoUAAGCU 2 6167.82 32.3 199 SEQ ID NO: 80
TABLE-US-00009 TABLE 6 Oligonucleotides containing Locked
Nucleotides Our Expected Experimental No Sequence Mass mass OD/mg
SEQ ID NO: 2784 ALGLm5CLTLUAACCUGUCCUUCAA 6018.82 6018.05 91.6 SEQ
ID NO: 81 2785 AGCUUAACCUGUCCUTLm5CLALAL 6018.32 6017.99 84.84 SEQ
ID NO: 82 2786 ALGLm5CLTLUAACCUGUCCUTLm5CLALAL 6095.09 6093.98
94.79 SEQ ID NO: 83 2787 ALGLCUUAACCUGUCCUUCALAL 5990.63 5989.88
92.66 SEQ ID NO: 84 2788 TLTLGLALAGGACAGGUUAAGCU 6201.96 6201.04
90.6 SEQ ID NO: 85 2789 UUGAAGGACAGGUUAALGLm5CLTL 6201.96 6200.97
92.22 SEQ ID NO: 86 2790 TLTLGLALAGGACAGGUUAALGLm5CLTL 6278.23
6277.1 93.18 SEQ ID NO: 87 2791 TLTLGAAGGACAGGUUAAGm5CLTL 6230.15
6229.29 92.2 SEQ ID NO: 88
[0210] In Tables 3-6, strands are shown written 5' to 3'. dT means
T-deoxy thymidine, a leading lower case "s" indicates a
5'-phosphorothioate group. Locked nucleic acids are indicated by a
trailing "L". A leading lower case "d" indicates a deoxy residue. A
leading "o" indicates a 2'-O-methyl modified nucleotide. A leading
"f" indicates a 2'-fluoro nucleotide. "T" indicates a
5-methyl-uridine and "m5C" indicates a 5methyl-cytidine. Six of the
sequencei in the fluoro set end in "dT" overhangs as the containing
ribofluoro nucleosides were not available at that time. These are
2793, 2794, 2795, 2797, 2798, and 2799. Extn coeff. e260*10.sup.''3
is the molar extinction coefficient of the oligonucleotide at 260
nm wavelength divided by (1000.times.1/(mol.times.cm)
TABLE-US-00010 TABLE 7 Interferon production in PDC cells incubated
with modified oligonucleotides derived from RNA9.2s IFN-.alpha.
production (in % of Our No. control) TLR9.2s 100% (4.5 ng/ml
IFN-.alpha.) 2792 72% 2793 56% 2794 11% 2795 26% 2800 9% 2801 11%
2802 12% 2803 8% 2808 64%
TABLE-US-00011 TABLE 8 Gene transcripts comprising a sequence
identical or complementary to SEQ ID NO: 1 spectrin, alpha,
erythrocytic 1 (elliptocytosis 2) spectrin, beta, non-erythrocytic
1 (SPTBN1), transcript variant 1 and 2 ryanodine receptor 1
(skeletal) (RYR1) WD repeat domain 9 (WDR9), transcript variant 2
WD repeat domain 9 (WDR9), transcript variant 1 phosphoglycerate
kinase 1 (PGK1) SEC11-like 3 (S. cerevisiae) (SEC11L3) SET domain,
bifurcated 1 (SETDB1) HBS1 -like (S. cerevisiae) (HBS1L)
activation-induced cytidine deaminase (AICDA) cholinergic receptor,
muscarinic 3 (CHRM3) transmembrane protein 1 (TMEM1), transcript
variant 1 and 2 SFRS protein kinase 2 (SRPK2), transcript variant 1
step II splicing factor SLU7 (SLU7) myosin, heavy polypeptide 7,
cardiac muscle, beta keratin, hair, acidic, 7 (KRTHA7) keratin,
hair, acidic, 8 (KRTHA8) inter-alpha (globulin) inhibitor H3
(ITIH3) integrin, alpha 4 (antigen CD49D, alpha 4 subunit of
integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 cleavage
stimulation factor, 3' pre-RNA, subunit 2 cubilin (intrinsic
factor-cobalamin receptor) (CUBN) cytochrome P450, family 2,
subfamily F, polypeptide 1
UDP-N-acetyl-alpha-D-galactosamine:polypeptide-N-acetylgalactosaminyltrans-
ferase 8 (GalNAc-T8) (GALNT8)
UDP-N-acetyl-alpha-D-galactosamine:polypeptide-N-acetylgalactosaminyltrans-
ferase 7 (GalNAc-T7) (GALNT7) E74-like factor 2 (ets domain
transcription factor) (ELF2), transcript variant 1 and 2 endogenous
retroviral family W, env(C7), member 1 (syncytin) (ERVWE1) solute
carrier family 7 (cationic amino acid transporter, y+ system),
member 6 (SLC7A6) AT-binding transcription factor 1 (ATBF1)
gasdermin-like (GSDML) sodium channel, nonvoltage-gated 1, gamma
(SCNN1G) zinc finger and SCAN domain containing 1 (ZSCAN1)
ubiquitin specific protease 54 (USP54) vitamin D (1,25-
dihydroxyvitamin D3) receptor (VDR) CD84 antigen (leukocyte
antigen) (CD84) alpha-kinase 3 (ALPK3) interferon, alpha 2 (IFNA2)
zinc finger protein 452 (ZNF452) SNF7 domain containing 2 (SNF7DC2)
platelet/endothelial cell adhesion molecule (CD31 antigen) (PECAM1)
hypothetical protein DKFZp547K1113 (DKFZp547K1113) repressor of
estrogen receptor activity (REA) fibrous sheath interacting protein
1 (FSIP1) neural cell adhesion molecule 1 (NCAM1) immunoglobulin
superfamily, member 4 (IGSF4) protein inhibitor of activated STAT,
2 (PIAS2), transcript variant alpha, and beta F-box protein 21
(FBXO21), transcript variant 1 and 2 F-box protein 22 (FBXO22),
transcript variant 2 Leucine-zipper-like transcription regulator 1
(LZTR1) Nuclear receptor subfamily 1, group H, member 2 (NR1H2)
UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 1
(B4GALT1) CSRP2 binding protein (CSRP2BP), transcript variant 1 and
2 cleavage stimulation factor, 3' pre-RNA, submit 1, 50 kDa (CSTF1)
solute carrier organic anion transporter family, member 4A1
(SLCO4A1) serine/threonine kinase 6 (STK6), transcript variant 3,
4, 5 and 6 zinc finger protein 295 (ZNF295) FLJ16231 protein
(FLJ16231) zinc finger protein 646 (ZNF646) mediator of RNA
polymerase II transcription, subunit 12 homolog (yeast)-like
(MED12L) olfactory receptor, family 2, subfamily W, member 1
(OR2W1) interferon, alpha 7 (IFNA7) apolipoprotein B (including
Ag(x) antigen) (APOB) syndecan binding protein (syntenin) (SDCBP),
transcript variant 1, 2, 3, 4 and 5 erbb2 interacting protein
(ERBB2IP), transcript variant 2 and 7 fibroblast growth factor 23
(FGF23) MARCKS-like 1 (MARCKSL1) v-src sarcoma (Schmidt-Ruppin A-2)
viral oncogene homolog (avion) (SRC), transcript variant 1 and 2
v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)
(SRC), transcript variant 2 CUB and Sushi multiple domains 2
(CSMD2) family with sequence similarity 49, member B (FAM49B)
pyruvate dehydrogenase kinase, isoenzyme 1 (PDK1), nuclear gene
encoding mitochondrial protein neurotrophic tyrosine kinase,
receptor, type 3 (NTRK3), transcript variant 3 ret finger protein 2
(RFP2), transcript variant 2, 3 and 4 KIAA1950 protein (KIAA1950)
collagen, type XIV, alpha 1 (undulin) (COL14A1) tektin 1 (TEKT1)
zinc finger protein 31 (KOX 29) (ZNF31) Leucine-rich
repeat-containing G protein-coupled receptor 4 (LGR4) protein
kinase, DNA-activated, catalytic polypeptide (PRKDC) scavenger
receptor class B, member 1 (SCARB1)
Sequence CWU 1
1
8919RNAArtificial SequenceSynthetically generated oligonucleotide
1guccuucaa 924RNAArtificial SequenceSynthetically generated
oligonucleotide 2gucc 435RNAArtificial SequenceSynthetically
generated oligonucleotide 3guccu 546RNAArtificial
SequenceSynthetically generated oligonucleotide 4guccuu
657RNAArtificial SequenceSynthetically generated oligonucleotide
5guccuuc 768RNAArtificial SequenceSynthetically generated
oligonucleotide 6guccuuca 8720DNAArtificial SequenceSynthetically
generated oligonucleotide 7gggggacgat cgtcgggggg 20821DNAArtificial
SequenceSynthetically generated oligonucleotide 8aaggagaccu
auagugacun n 21921DNAArtificial SequenceSynthetically generated
oligonucleotide 9agucacuaua ggucuccuun n 211021DNAArtificial
SequenceSynthetically generated oligonucleotide 10ggaaaggcua
gcagucaucn n 211121DNAArtificial SequenceSynthetically generated
oligonucleotide 11gaugacugcu agccuuuccn n 211221DNAArtificial
SequenceSynthetically generated oligonucleotide 12acuagcuugg
auguaggaun n 211321DNAArtificial Sequencemisc_feature20, 21n =
2'-deoxy thymidine 13auccuacauc caagcuagun n 211421DNAArtificial
SequenceSynthetically generated oligonucleotide 14uacuuagacu
acuaccucgn n 211521DNAArtificial SequenceSynthetically generated
oligonucleotide 15cgagguagua gucuaaguan n 211621DNAArtificial
SequenceSynthetically generated oligonucleotide 16auggcuggca
auucuuuccn n 211721DNAArtificial SequenceSynthetically generated
oligonucleotide 17ggaaagaauu gccagccaun n 211821DNAArtificial
SequenceSynthetically generated oligonucleotide 18uggacggcaa
cuguuauuan n 211921DNAArtificial SequenceSynthetically generated
oligonucleotide 19uaauaacagu ugccguccan n 212021DNAArtificial
SequenceSynthetically generated oligonucleotide 20agcuuaaccu
guccuucaan n 212121DNAArtificial SequenceSynthetically generated
oligonucleotide 21uugaaggaca gguuaagcun n 212221DNAArtificial
SequenceSynthetically generated oligonucleotide 22accuguccuu
caauuaccan n 212321DNAArtificial SequenceSynthetically generated
oligonucleotide 23ugguaauuga aggacaggun n 212421DNAArtificial
SequenceSynthetically generated oligonucleotide 24cucauucacg
gagcuaccan n 212521DNAArtificial SequenceSynthetically generated
oligonucleotide 25ugguagcucc gugaaugagn n 212621DNAArtificial
SequenceSynthetically generated oligonucleotide 26cuacaacagc
cacaacgucn n 212721DNAArtificial SequenceSynthetically generated
oligonucleotide 27gacguugugg cuguuguagn n 212819RNAArtificial
SequenceSynthetically generated oligonucleotide 28agcuuaaccu
guccuucaa 192919RNAArtificial SequenceSynthetically generated
oligonucleotide 29aaaaaaaacu guccuucaa 193019RNAArtificial
SequenceSynthetically generated oligonucleotide 30aaaaaaaaau
guccuucaa 193119RNAArtificial SequenceSynthetically generated
oligonucleotide 31aaaaaaaaaa guccuucaa 193219RNAArtificial
SequenceSynthetically generated oligonucleotide 32aaaaaaaaaa
auccuucaa 193319RNAArtificial SequenceSynthetically generated
oligonucleotide 33aaaaaaaaaa aaccuucaa 193419RNAArtificial
SequenceSynthetically generated oligonucleotide 34agcuuaaccu
guccuuaaa 193519RNAArtificial SequenceSynthetically generated
oligonucleotide 35agcuuaaccu guccuaaaa 193619RNAArtificial
SequenceSynthetically generated oligonucleotide 36agcuuaaccu
guccaaaaa 193719RNAArtificial SequenceSynthetically generated
oligonucleotide 37agcuuaaccu gaaaaaaaa 193820RNAArtificial
SequenceSynthetically generated oligonucleotide 38uguccuucaa
uguccuucaa 203919RNAArtificial SequenceSynthetically generated
oligonucleotide 39agcuuaaccu guccuucau 194019RNAArtificial
SequenceSynthetically generated oligonucleotide 40agcuuaaccu
guccuucuu 194147RNAArtificial SequenceSynthetically generated
oligonucleotide 41agcuuaaccu guccuucaac uacacaaauu gaaggacagg
uuaagcu 474219RNAArtificial SequenceSynthetically generated
oligonucleotide 42agcuuaaccu guccuucaa 194319RNAArtificial
SequenceSynthetically generated oligonucleotide 43agcuuaaccu
guccuucaa 194419RNAArtificial SequenceSynthetically generated
oligonucleotide 44agcuuaaccu guccuucaa 194519RNAArtificial
SequenceSynthetically generated oligonucleotide 45agcuuaaccu
guccuucaa 194619RNAArtificial SequenceSynthetically generated
oligonucleotide 46agcuuaaccu guccuucaa 194716RNAArtificial
SequenceSynthetically generated oligonucleotide 47uuaaccuguc cuucaa
164813RNAArtificial SequenceSynthetically generated oligonucleotide
48aaccuguccu uca 134919RNAArtificial SequenceSynthetically
generated oligonucleotide 49uugaaggaca gguuaagcu
195019RNAArtificial SequenceSynthetically generated oligonucleotide
50uugaaggaca gguuaagcu 195119RNAArtificial SequenceSynthetically
generated oligonucleotide 51uugaaggaca gguuaagcu
195219RNAArtificial SequenceSynthetically generated oligonucleotide
52uugaaggaca gguuaagcu 195319RNAArtificial SequenceSynthetically
generated oligonucleotide 53aaaaaaaaaa aaaaaaaaa
195419RNAArtificial SequenceSynthetically generated oligonucleotide
54uuuuuuuuuu uuuuuuuuu 195519RNAArtificial SequenceSynthetically
generated oligonucleotide 55nnnnuaaccu guccuucaa
195620DNAArtificial SequenceSynthetically generated oligonucleotide
56nncuuaaccu guccuucnnn 205720DNAArtificial SequenceSynthetically
generated oligonucleotide 57nnnnuaaccu guccunnnnn
205820DNAArtificial SequenceSynthetically generated oligonucleotide
58agcuuaaccu guccunnnnn 205919RNAArtificial SequenceSynthetically
generated oligonucleotide 59nnnnaggaca gguuaagcu
196020DNAArtificial SequenceSynthetically generated oligonucleotide
60nngaaggaca gguuaagnnn 206120DNAArtificial SequenceSynthetically
generated oligonucleotide 61nnnnaggaca gguuannnnn
206220DNAArtificial SequenceSynthetically generated oligonucleotide
62uugaaggaca gguuannnnn 206319RNAArtificial SequenceSynthetically
generated oligonucleotide 63agcuuaaccu guccuucaa
196419RNAArtificial SequenceSynthetically generated oligonucleotide
64uugaaggaca gguuaagcu 196519RNAArtificial SequenceSynthetically
generated oligonucleotide 65agcuuaaccu guccuucaa
196619RNAArtificial SequenceSynthetically generated oligonucleotide
66agcuuaaccu guccuucaa 196719RNAArtificial SequenceSynthetically
generated oligonucleotide 67agcuuaaccu guccuucaa
196819RNAArtificial SequenceSynthetically generated oligonucleotide
68agcuuaaccu guccuucaa 196919RNAArtificial SequenceSynthetically
generated oligonucleotide 69uugaaggaca gguuaagcu
197019RNAArtificial SequenceSynthetically generated oligonucleotide
70uugaaggaca gguuaagcu 197119RNAArtificial SequenceSynthetically
generated oligonucleotide 71uugaaggaca gguuaagcu
197219RNAArtificial SequenceSynthetically generated oligonucleotide
72uugaaggaca gguuaagcu 197319RNAArtificial SequenceSynthetically
generated oligonucleotide 73agcuuaaccu guccuucaa
197419RNAArtificial SequenceSynthetically generated oligonucleotide
74agcuuaaccu guccuucaa 197519RNAArtificial SequenceSynthetically
generated oligonucleotide 75agcuuaaccu guccuucaa
197619RNAArtificial SequenceSynthetically generated oligonucleotide
76agcuuaaccu guccuucaa 197719RNAArtificial SequenceSynthetically
generated oligonucleotide 77uugaaggaca gguuaagcu
197819RNAArtificial SequenceSynthetically generated oligonucleotide
78uugaaggaca gguuaagcu 197919RNAArtificial Sequencemodified_base1,
3, 5, 7, 9, 11, 13, 15, 17, 19/mod_base = 2'-O-methyl modification
corresponding base 79uugaaggaca gguuaagcu 198019RNAArtificial
SequenceSynthetically generated oligonucleotide 80uugaaggaca
gguuaagcu 198119RNAArtificial SequenceSynthetically generated
oligonucleotide 81nncnuaaccu guccuucaa 198219RNAArtificial
SequenceSynthetically generated oligonucleotide 82agcuuaaccu
guccuncnn 198319RNAArtificial SequenceSynthetically generated
oligonucleotide 83nncnuaaccu guccuncnn 198419RNAArtificial
SequenceSynthetically generated oligonucleotide 84nncuuaaccu
guccuucnn 198519RNAArtificial SequenceSynthetically generated
oligonucleotide 85nnnnaggaca gguuaagcu 198619RNAArtificial
SequenceSynthetically generated oligonucleotide 86uugaaggaca
gguuanncn 198719RNAArtificial SequenceSynthetically generated
oligonucleotide 87nnnnaggaca gguuanncn 198819RNAArtificial
SequenceSynthetically generated oligonucleotide 88nngaaggaca
gguuaagcn 198920DNAArtificial SequenceSynthetically generated
oligonucleotide 89tccatgacgt tcctgacgtt 20
* * * * *