Tumor Markers And Methods Of Use Thereof

Abstract

The invention provides newly identified proteins as markers for the detection of tumors, or as targets for their treatment, particularly of tumors affecting lung, colon, breast, ovary; affinity ligands capable of selectively interacting with the newly identified markers; methods of screening a tissue sample for malignancy, for determining the presence of a tumor in a subject and for screening a test compound as an antitumor candidate; a diagnostic kit.

Description

[0001] The present invention relates to newly identified proteins as markers for the detection of tumors, or as targets for their treatment, particularly of tumors affecting lung, colon, breast and ovary. Also provided are affinity ligands capable of selectively interacting with the newly identified markers, as well as methods for tumor diagnosis and therapy using such ligands.

BACKGROUND OF THE INVENTION

[0002] Tumor Markers (or Biomarkers)

[0003] Tumor markers are substances that can be produced by tumor cells or by other cells of the body in response to cancer. In particular, a protein biomarker is either a single protein or a panel of different proteins that could be used to unambiguously distinguish a disease state. Ideally, a biomarker would have both a high specificity and sensitivity, being represented in a significant percentage of the cases of given disease and not in healthy state.

[0004] Biomarkers can be identified in different biological samples, like tissue biopsies or preferably biological fluids (saliva, urine, blood-derivatives and other body fluids), whose collection does not necessitate invasive treatments. Tumor marker levels may be categorized in three major classes on the basis of their clinical use. Diagnostic markers can be used in the detection and diagnosis of cancer. Prognostics markers are indicative of specific outcomes of the disease and can be used to define predictive models that allow the clinicians to predict the likely prognosis of the disease at time of diagnosis. Moreover, prognosis markers are helpful to monitor the patient response to a drug therapy and facilitate a more personalized patient management. A decrease or return to a normal level may indicate that the cancer is responding to therapy, whereas an increase may indicate that the cancer is not responding. After treatment has ended, tumor marker levels may be used to check for recurrence of the tumor. Finally, therapeutic markers can be used to develop tumor-specific drugs or affinity ligand (i.e. antibodies) for a tumor treatment.

[0005] Currently, although an abnormal tumor marker level may suggest cancer, this alone is usually not enough to accurately diagnose cancer and their measurement in body fluids is frequently combined with other tests, such as a biopsy and radioscopic examination. Frequently, tumor marker levels are not altered in all of people with a certain cancer disease, especially if the cancer is at early stage. Some tumor marker levels can also be altered in patients with noncancerous conditions. Most biomarkers commonly used in clinical practice do not reach a sufficiently high level of specificity and sensitivity to unambiguously distinguish a tumor from a normal state.

[0006] To date the number of markers that are expressed abnormally is limited to certain types/subtypes of cancer, some of which are also found in other diseases. (http://www.cancer.gov/cancertopics/factsheet).

[0007] For example, prostate-specific antigen (PSA) levels are often used to screen men for prostate cancer, but this is controversial since elevated PSA levels can be caused by both prostate cancer or benign conditions, and most men with elevated PSA levels turn out not to have prostate cancer.

[0008] Another tumor marker, Cancer Antigen 125, (CA 125), is sometimes used to screen women who have an increased risk for ovarian cancer. Scientists are studying whether measurement of CA 125, along with other tests and exams, is useful to find ovarian cancer before symptoms develop. So far, CA 125 measurement is not sensitive or specific enough to be used to screen all women for ovarian cancer. Mostly, CA 125 is used to monitor response to treatment and check for recurrence in women with ovarian cancer. Finally, human epidermal growth factor receptor (HER2) is a marker protein overproduced in about 20% of breast cancers, whose expression is typically associated with a more aggressive and recurrent tumors of this class.

[0009] Routine Screening Test for Tumor Diagnosis

[0010] Screening tests are a way of detecting cancer early, before there are any symptoms. For a screening test to be helpful, it should have high sensitivity and specificity. Sensitivity refers to the test's ability to identify people who have the disease. Specificity refers to the test's ability to identify people who do not have the disease. Different molecular biology approaches such as analysis of DNA sequencing, small nucleotide polymorphyms, in situ hybridization and whole transcriptional profile analysis have done remarkable progresses to discriminate a tumor state from a normal state and are accelerating the knowledge process in the tumor field. However so far different reasons are delaying their use in the common clinical practice, including the higher analysis complexity and their expensiveness. Other diagnosis tools whose application is increasing in clinics include in situ hybridization and gene sequencing.

[0011] Currently, Immuno-HistoChemistry (IHC), a technique that allows the detection of proteins expressed in tissues and cells using specific antibodies, is the most commonly used method for the clinical diagnosis of tumor samples. This technique enables the analysis of cell morphology and the classification of tissue samples on the basis of their immunoreactivity. However, at present, IHC can be used in clinical practice to detect cancerous cells of tumor types for which protein markers and specific antibodies are available. In this context, the identification of a large panel of markers for the most frequent cancer classes would have a great impact in the clinical diagnosis of the disease.

[0012] Anti-Cancer Therapies

[0013] In the last decades, an overwhelming number of studies remarkably contributed to the comprehension of the molecular mechanisms leading to cancer. However, this scientific progress in the molecular oncology field has not been paralleled by a comparable progress in cancer diagnosis and therapy. Surgery and/or radiotherapy are the still the main modality of local treatment of cancer in the majority of patients. However, these treatments are effective only at initial phases of the disease and in particular for solid tumors of epithelial origin, as is the case of colon, lung, breast, ovary, prostate and others, while they are not effective for distant recurrence of the disease. In some tumor classes, chemotherapeutic treatments have been developed, which generally relies on drugs, hormones and antibodies, targeting specific biological processes used by cancers to grow and spread. However, so far many cancer therapies had limited efficacy due to severity of side effects and overall toxicity. Indeed, a major effort in cancer therapy is the development of treatments able to target specifically tumor cells causing limited damages to surrounding normal cells thereby decreasing adverse side effects. Recent developments in cancer therapy in this direction are encouraging, indicating that in some cases a cancer specific therapy is feasible. In particular, the development and commercialization of humanized monoclonal antibodies that recognize specifically tumor-associated markers and promote the elimination of cancer is one of the most promising solution that appears to be an extremely favorable market opportunity for pharmaceutical companies. However, at present the number of therapeutic antibodies available on the market or under clinical studies is very limited and restricted to specific cancer classes. So far licensed monoclonal antibodies currently used in clinics for the therapy of specific tumor classes show only a partial efficacy and are frequently associated with chemotherapies to increase their therapeutic effect. Administration of Trastuzumab (Herceptin), a commercial monoclonal antibody targeting HER2 in conjunction with Taxol adjuvant chemotherapy induces tumor remission in about 42% of the cases (1). Bevacizumab (Avastin) and Cetuximab (Erbitux) are two monoclonal antibodies recently licensed for use in humans, targeting the endothelial and epithelial growth factors respectively that, combined with adjuvant chemotherapy, proved to be effective against different tumor diseases. Bevacizumab proved to be effective in prolonging the life of patients with metastatic colorectal, breast and lung cancers. Cetuximab demonstrated efficacy in patients with tumor types refractory to standard chemotherapeutic treatments (1).

[0014] In summary, available screening tests for tumor diagnosis are uncomfortable or invasive and this sometimes limits their applications. Moreover tumor markers available today have a limited utility in clinics due to either their incapability to detect all tumor subtypes of the defined cancers types and/or to distinguish unambiguously tumor vs. normal tissues. Similarly, licensed monoclonal antibodies combined with standard chemotherapies are not effective against the majority of cases. Therefore, there is a great demand for new tools to advance the diagnosis and treatment of cancer.

[0015] Experimental Approaches Commonly Used to Identify Tumor Markers

[0016] Most popular approaches used to discover new tumor markers are based on genome-wide transcription profile or total protein content analyses of tumor. These studies usually lead to the identification of groups of mRNAs and proteins which are differentially expressed in tumors. Validation experiments then follow to eventually single out, among the hundreds of RNAs/proteins identified, the very few that have the potential to become useful markers. Although often successful, these approaches have several limitations and often, do not provide firm indications on the association of protein markers with tumor. A first limitation is that, since frequently mRNA levels not always correlate with corresponding protein abundance (approx. 50% correlation), studies based on transcription profile do not provide solid information regarding the expression of protein markers in tumor (2, 3, 4, 5).

[0017] A second limitation is that neither transcription profiles nor analysis of total protein content discriminate post-translation modifications, which often occur during oncogenesis. These modifications, including phosphorylations, acetylations, and glycosylations, or protein cleavages influence significantly protein stability, localization, interactions, and functions (6).

[0018] As a consequence, large scale studies generally result in long lists of differentially expressed genes that would require complex experimental paths in order to validate the potential markers. However, large scale genomic/proteomic studies reporting novel tumor markers frequently lack of confirmation data on the reported potential novel markers and thus do not provide solid demonstration on the association of the described protein markers with tumor.

[0019] Approach Used to Identify the Protein Markers Included in the Present Invention

[0020] The approach that we used to identify protein markers is based on an innovative immuno-proteomic technology. In essence, a library of recombinant human proteins has been produced from E. coli and is being used to generate polyclonal antibodies against each of the recombinant proteins.

[0021] The screening of the antibodies library on Tissue microarrays (TMAs) carrying clinical samples from different patients affected by the tumor under investigation leads to the identification of specific tumor marker proteins. Therefore, by screening TMAs with the antibody library, the tumor markers are visualized by IHC, the classical technology applied in all clinical pathology laboratories. Since TMAs also include healthy tissues, the specificity of the antibodies for the tumors can be immediately appreciated and information on the relative level of expression and cellular localization of the markers could be obtained. In our approach the markers are subjected to a validation process consisting in a molecular and cellular characterization.

[0022] Altogether, the detection the marker proteins disclosed in the present invention selectively in tumor samples and the subsequent validation experiments lead to an unambiguous confirmation of the marker identity and confirm its association with defined tumor classes. Moreover this experimental process provides an indication of the possible use of the proteins as tools for diagnostic or therapeutic intervention. For instance, proteins showing a cell surface localization could be both diagnostic and therapeutic markers, against which both chemical and antibody therapies can be developed. Differently, markers showing a cytoplasmic localization could be more likely considered for the development of tumor diagnostic tests and chemotherapy/small molecules treatments.

SUMMARY OF THE INVENTION

[0023] The present invention provides new means for the detection and treatment of tumors, in particular colo-rectal, lung, ovary and breast cancers, based on the identification of protein markers specific for these tumor types, namely: a) Tectonic-1 (TCTN1), Tectonic-2 (TCTN2) and Tectonic-3 (TCTN3) proteins, b) HIGD2A and HIGD2B proteins, c) chromosome 4 open reading frame 32 (C4orf32) protein and d) FAM62A protein. In preferred embodiments, the invention provides the use of a) TCTN1, TCTN2 and TCTN3 proteins, as marker or target for colon, lung and ovary tumors, b) Hypoxia induced proteins A and B (HIGD2A and HIGD2B) as markers or targets for colon and ovary tumors, c) C4orf32 proteins as markers or targets for breast and lung tumors and d) FAM62A as marker or target for breast, colon, lung and ovary tumors.

[0024] The invention also provides a method for the diagnosis of these cancer types, comprising a step of detecting the above-identified markers in a biological sample, e.g. in a tissue sample of a subject suspected of having or at risk of developing malignancies or susceptible to cancer recurrences. In particular, the protein markers of the invention allow to specifically detect lung, colon, breast and ovary cancers, according to their tumor-specificity, namely: a) TCTN1, TCTN2 and TCTN3 proteins for colon, lung and ovary tumors; b) Hypoxia induced proteins A and B (HIGD2A and HIGD2B) for colon and ovary tumors; c) chromosome 4 open reading frame 32 proteins for breast and lung tumors; d) FAM62A protein for breast, colon, lung and ovary tumors.

[0025] In addition, the tumor markers identify novel targets for affinity ligands which can be used for therapeutic applications, especially in the treatment of colo-rectal, lung, ovary and breast proliferative diseases. Also provided are affinity ligands, particularly antibodies, capable of selectively interacting with the newly identified protein markers.

DETAILED DISCLOSURE OF THE INVENTION

[0026] The present invention is based on the surprising finding of antibodies that are able to specifically bind tumor tissues from patients, while negative or very poor binding is observed in normal tissues from the same patients. These antibodies have been found to specifically bind proteins for which no previous association with tumor has been reported. Hence, in a first aspect, the invention provides a tumor marker which is selected from the group consisting of: [0027] a) Tectonic-1 (TCTN1) protein, in one of its isoforms SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8 or a different isoform having sequence identity of at least 80%, preferably at least 90%, more preferably at least 95% to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8; or a nucleic acid molecule containing a sequence coding for a TCTN1 protein, said encoding sequence being preferably selected from SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26 and SEQ ID NO:27; [0028] b) Tectonic-2 (TCTN2) protein, SEQ ID NO:9 or an isoform thereof having sequence identity of at least 80%, preferably at least 90%, more preferably at least 95% to SEQ ID NO:9; or a nucleic acid molecule containing a sequence coding for a TCTN2 protein, said encoding sequence being preferably SEQ ID NO: 28; [0029] c) Tectonic-3 (TCTN3) protein in one of its isoforms SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12 or SEQ ID NO:13, or a different isoform having sequence identity of at least 80%, preferably at least 90%, more preferably at least 95% to SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12 or SEQ ID NO:13; or a nucleic acid molecule containing a sequence coding for a TCTN3 protein, said encoding sequence being preferably selected from SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31 and SEQ ID NO:32; [0030] d) Hypoxia induced protein A (HIGD2A), SEQ ID NO:14 or an isoform thereof having sequence identity of at least 80%, preferably at least 90%, more preferably at least 95% to SEQ ID NO:14; or a nucleic acid molecule containing a sequence coding for a HIGD2A protein, said encoding sequence being preferably SEQ ID NO:33; [0031] e) Hypoxia induced protein B (HIGD2B), SEQ ID NO:15 or an isoform thereof having sequence identity of at least 80%, preferably at least 90%, more preferably at least 95% to SEQ ID NO:15; or a nucleic acid molecule containing a sequence coding for a HIGD2B protein, said encoding sequence being preferably SEQ ID NO:34; [0032] f) C4orf32 protein, SEQ ID NO:16, or an isoform thereof having sequence identity of at least 80%, preferably at least 90%, more preferably at least 95% to SEQ ID NO:16; or a nucleic acid molecule containing a sequence coding for a C4orf32 protein, said encoding sequence being preferably SEQ ID NO:35; [0033] g) FAM62A protein, in one of its variant isoforms SEQ ID NO:17, SEQ ID NO:18 or SEQ ID NO:19, or a different isoform having sequence identity of at least 80%, preferably at least 90%, more preferably at least 95% to any of SEQ ID NO:17, SEQ ID NO:18 or SEQ ID NO:19; or a nucleic acid molecule containing a sequence coding for a FAM62A protein, said encoding sequence being preferably selected from SEQ ID NO: 36, SEQ ID NO: 37 and SEQ ID NO: 38. TCTN1 (Gene name: TCTN1; Gene ID: ENSG00000204852, Protein names: Tectonic-1, TCT1, TCTN1. Eight variants identified:

TABLE-US-00001 [0033] Protein ID Transcript ID ENSP00000366882 ENST00000377654 ENSP00000380771 ENST00000397650 ENSP00000380772 ENST00000397652 ENSP00000380774 ENST00000397654 ENSP00000380775 ENST00000397655 ENSP00000380776 ENST00000397656 ENSP00000380777 ENST00000397657 ENSP00000380779 ENST00000397659),

TCTN2 (Gene names: TCTN2, C12orf38, TECT2 Gene ID: ENSG00000168778; Transcript ID: ENST00000303372; Protein Names: Tectonic-2, TCTN2; Protein ID: ENSP00000304941;), and TCTN3 (Gene names: TCTN3, C10orf61, TECT3; Gene ID: ENSG00000119977; protein names: Tectonic-3, TCT3, TCTN3. Four variants identified:

TABLE-US-00002 Protein ID Transcript ID ENSP00000265993 ENST00000265993 ENSP00000345815 ENST00000343162 ENSP00000360253 ENST00000371209 ENSP00000360261 ENST00000371217)

[0034] are proteins without previous known association in any cancer disease and are preferably used as markers for colon-, lung- and ovary-type tumors. Antibodies generated against the TCTN2 protein show a selective immunoreactivity in histological preparation of colo-rectal cancer tissues, lung cancer tissues, ovary cancer tissues, which indicates the presence of TCTN2 in these cancer samples. The most striking finding is the marker positivity in colo-rectal carcinomas, with 100% positive samples, which makes TCTN2 protein and its antibody particularly convenient tools for distinguishing a colo-rectal cancer from a normal state.

[0035] As described in detail in the Examples, TCTN1, TCTN2 and TCTN3 proteins share a large common domain showing short highly conserved internal sequences and thereby, polyclonal antibodies generated against TCTN2 protein are capable to recognize also the related proteins TCTN1 and TCTN3.

[0036] HIGD2A (HIG1 domain family member 2A, Protein ID: ENSP00000274787; Gene name: HIGD2A, Gene ID: ENSG00000146066; Transcript ID: ENST00000274787) and its homologous protein HIGD2BP (HIG1 domain family member 2B, Protein ID: ENSP00000307951; Gene name: HIGD2BP, Gene ID: ENSG00000175202; Transcript ID: ENST00000311755) are proteins without previous known association in any cancer disease and are preferably used as markers for colon- and ovary-type tumors. Antibodies generated to a fragment of HIGD2A show a selective immunoreactivity in histological preparation of colo-rectal cancer tissues and ovary cancer tissues, which indicates the presence of this protein in these cancer samples. As described in detail in the Examples, antibodies generated against HIGD2A protein are capable to recognize also its homologous protein HIGD2B and viceversa, indicating that both proteins can be stained by the same antibody.

[0037] C4orf32 (Protein ID: ENSP00000310182; Gene ID: ENSG00000174749, Gene Name: C4orf32; Transcript ID: ENST00000309733) is a protein without previous known association in any cancer disease and is preferably used as a marker for breast- and lung-type cancers. Antibodies generated to a fragment of C4orf32 show selective immunoreactivity in histological preparation of breast cancer tissues and lung cancer tissues, which indicates the presence this protein in these cancer samples.

[0038] FAM62A (Gene names: FAM62A, ESYT1, KIAA0747, MBC2; Gene ID: ENSG00000139641, Protein names: E-Syt1, Extended-synaptotagmin-1; Membrane-bound C2 domain-containing protein, Protein FAM62A. Three variants identified:

TABLE-US-00003 Protein ID Transcript ID ENSP00000386045 ENST00000402331 ENSP00000377612 ENST00000394048 ENSP00000267113 ENST00000267113)

[0039] is a protein without previous known association with any tumor class, although the corresponding genomic sequence can be isolated from pancreas tumor tissue along with a large number of different sequences (WO9955858).

[0040] Antibodies against a fragment of FAM62A showed a selective immunoreactivity in histological preparation of tumor tissue samples from breast, colon, lung and ovary.

[0041] A further aspect of this invention is a method of screening a tissue sample for malignancy, which comprises determining the presence in said sample of at least one of the above-mentioned tumor markers. This method includes detecting either the marker protein, e.g. by means of labeled monoclonal or polyclonal antibodies that specifically bind to the target protein, or the respective mRNA, e.g. by means of polymerase chain reaction techniques such as RT-PCR. The methods for detecting proteins in a tissue sample are known to one skilled in the art and include immunoradiometric, immunoenzymatic or immunohistochemical techniques, such as radioimmunoassays, immunofluorescent assays or enzyme-linked immunoassays. Other known protein analysis techniques, such as polyacrylamide gel electrophoresis (PAGE), Western blot or Dot blot are suitable as well. Preferably, the detection of the protein marker is carried out with the immune-hystochemistry technology, particularly by means of High Through-Put methods that allow the analyses of the antibody immune-reactivity simultaneously on different tissue samples immobilized on a microscope slide. Briefly, each Tissue Micro Array (TMA) slide includes tissue samples suspected of malignancy taken from different patients, and an equal number of normal tissue samples from the same patients as controls. The direct comparison of samples by qualitative or quantitative measurement, e.g. by enzimatic or colorimetric reactions, allows the identification of tumors.

[0042] In one embodiment, the invention provides a method of screening a sample of colon or colo-rectal tissue for malignancy, which comprises determining the presence in said sample of a tumor marker selected from TCTN1, TCTN2, TCTN3, HIGD2A, HIGD2B and FAM62A, variants or isoforms or combinations thereof as described above. In another embodiment, the invention provides a method of screening a sample of lung tissue for malignancy, which comprises determining the presence in said sample of a tumor marker selected from TCTN1, TCTN2, TCTN3, C4orf32 and FAM62A, variants or isoforms or combinations thereof as described above. In a further embodiment, the invention provides a method of screening a sample of ovarian tissue for malignancy, which comprises determining the presence in said sample of a tumor marker selected from TCTN1, TCTN2, TCTN3, HIGD2A, HIGD2B and FAM62A, variants or isoforms or combinations thereof as described above. In a yet further embodiment, the invention provides a method of screening a sample of breast tissue for malignancy, which comprises determining the presence in said sample of a tumor marker selected from C4orf32 and FAM62A, variants or isoforms or combinations thereof as described above.

[0043] A further aspect of the invention is a method in vitro for determining the presence of a tumor in a subject, which comprises the steps of: [0044] (1) providing a sample of the tissue suspected of containing tumor cells; [0045] (2) determining the presence of a tumor marker as above defined, or a combination thereof in said tissue sample by detecting the expression of the marker protein or the presence of the respective mRNA transcript;

[0046] wherein the detection of one or more tumor markers in the tissue sample is indicative of the presence of tumor in said subject.

[0047] The methods and techniques for carrying out the assay are known to one skilled in the art and are preferably based on immunoreactions for detecting proteins and on PCR methods for the detection of mRNAs. The same methods for detecting proteins or mRNAs from a tissue sample as disclosed above can be applied.

[0048] A further aspect of this invention is the use of the tumor markers herein provided as targets for the identification of candidate antitumor agents. Accordingly, the invention provides a method for screening a test compound which comprises contacting the cells expressing a tumor-associated protein selected from TCTN1, TCTN2, TCTN3, HIGD2A and HIGD2B, C4orf32 and FAM62A with the test compound, and determining the binding of said compound to said cells. In addition, the ability of the test compound to modulate the activity of each target molecule can be assayed.

[0049] A further aspect of the invention is a method of suppressing the function or expression of a tumor-associated protein herein provided. This includes inhibiting or blocking the protein, e.g. by means of antibodies, or silencing the gene encoding therefor, e.g. by RNA interference or RNA antisense technologies. As shown in the experimental section, marker expression confers a malignant phenotype to cells, making them able to grow and proliferate in an anchorage-independent fashion in an in vitro assay.

[0050] In one embodiment, the invention provides an antibody or a fragment thereof which is able to specifically recognize and bind to one of the tumor-associated proteins described above. The term "antibody" as used herein refers to all types of immunoglobulins, including IgG, IgM, IgA, IgD and IgE. Such antibodies may include polyclonal, monoclonal, chimeric, single chain, antibodies or fragments such as Fab or scFv. The antibodies may be of various origin, including human, mouse, rat, rabbit and horse, or chimeric antibodies. The production of antibodies is well known in the art. For the production of antibodies in experimental animals, various hosts including goats, rabbits, rats, mice, and others, may be immunized by injection with polypeptides of the present invention or any fragment or oligopeptide or derivative thereof which has immunogenic properties or forms a suitable epitope. Monoclonal antibodies may be produced following the procedures described in Kohler and Milstein, Nature 265:495 (1975) or other techniques known in the art.

[0051] The antibodies to the tumor markers of the invention can be used to detect the presence of the marker in histologic preparations or to distinguish tumor cells from normal cells. To that purpose, the antibodies may be labeled with radiocative, fluorescent or enzyme labels.

[0052] In addition, the antibodies can be used for treating proliferative diseases by modulating, e.g. inhibiting or abolishing the activity of a target protein according to the invention. Therefore, in a further aspect the invention provides the use of antibodies to a tumor-associated protein selected from TCTN1, TCTN2, TCTN3, HIGD2A and HIGD2B, C4orf32 and FAM62A, for the preparation of a therapeutic agent for the treatment of proliferative diseases. For use in therapy, the antibodies can be formulated with suitable carriers and excipients, optionally with the addition of adjuvants to enhance their effects.

[0053] In a further embodiment, the invention provides a small interfering RNA (siRNAs) complementary to a sequence selected from the group consisting of SEQ ID NO:39 through SEQ ID NO:55, for use in tumor-gene silencing.

[0054] A further aspect of the invention relates to a diagnostic kit containing suitable means for detection, in particular the polypeptides or polynucleotides, antibodies or fragments or derivatives thereof described above, reagents, buffers, solutions and materials needed for setting up and carrying out the immunoassays, nucleic acid hybridization or PCR assays as described above. Parts of the kit of the invention can be packaged individually in vials or bottles or in combination in containers or multicontainer units.

DESCRIPTION OF THE FIGURES

[0055] FIG. 1. Analysis of purified recombinant Tectonic family proteins with specific antibodies. Panel A: Comassie staining of recombinant purified His-tag TCTN2 fusion proteins after separation by SDS-PAGE; Panel B: WB on the purified recombinant TCTN2, TCTN1 or TCTN3 proteins stained with anti-TCTN2 antibodies. Arrows mark the protein bands of the expected size. Molecular weight markers are reported on the left of each panel.

[0056] FIG. 2. Examples of immuno-histochemistry analysis of tumor (left panels) and normal tissue samples (right panels) stained with anti-TCTN2 antibodies. In the case of the ovarian cancer, the normal tissue surrounds the tumor. The antibody-stains specifically tumor cells (in dark grey); negative or poor staining is visible in normal cells.

[0057] FIG. 3. TCTN2 expression in transiently transfected HeLa cells. Panel A) Western blot analysis of TCTN2 expression in total protein extracts from HeLa cells transfected with the empty vector pcDNA3 (lane 1) or with the plasmid encoding the TCTN2 gene (lane 2) stained with anti-TCTN2 antibody. Arrow marks the expected TCTN2 band. Molecular weight markers are reported on the left. Panel B) Flow cytometry analysis of TCTN2 surface localization in HeLa cells transfected with the empty vector pcDNA3 (dashed peak) or with the plasmid construct encoding the TCTN2 gene (solid peak). X axys, Fluorescence scale; Y axys, Cells (expressed as % relatively to major peaks).

[0058] FIG. 4. TCTN1, TCTN2 and TCTN3 confer malignant cell phenotypes Panel A. Silencing of either TCTN1 or TCTN3 impairs the clonogenic phenotype of the cell line HCT15 grown on soft agar. The graphs show the reduction of the size (upper panels) and number (lower panels) of colonies formed by HCT15 cells upon transfection with either TCTN1-siRNA (3) or TCTN3-siRNAs (4) compared to cells transfected with a scrambled siRNA (2) or untreated cells (1). A picture of the colonies formed under each condition are reported on the left of the graphs. Panel B. Silencing of either TCTN1 or TCTN3 reduces the invasive phenotype of the HCT15 colon cell line. The graph reports the effect of the siRNA mediated inhibition of TCTN1 or TCTN3 expression on the migration activity of the HCT-15 colon tumor cell line, measured with the Boyden assay. As controls, untransfected cells or cells transfected with a scrambled siRNA were used. Small boxes under the columns show the visual counting of the migrated cells. Panel C. TCTN2 over-expression increases the cell clonogenic phenotype. The graph reports the effect of the TCTN2 over-expression on the number of colonies formed by the HCT15 cell line on soft agar upon transfection with the TCTN2-encoding plasmid (3). Cells either untreated (1) or transfected with the empty plasmid pcDNA3 (2) were used as controls. Images of the cell colonies formed under each tested condition are reported below each histogram.

[0059] FIG. 5. Analysis of purified HIGD2A recombinant protein expressed in E. coli. Left panel: Comassie staining of purified His-tag HIGD2A fusion protein expressed in E. coli separated by SDS-PAGE; Right panel: WB on the purified recombinant HIGD2A protein stained with anti-HIGD2A antibody. Arrow marks the protein band of the expected size. Molecular weight markers are reported on the left.

[0060] FIG. 6. Examples of immuno-histochemistry analysis of tumor (left panels) and normal tissue samples (right panels) stained with anti-HID2A antibodies. In the case of the ovarian cancer, the normal tissue surrounds the tumor. The antibody-stains specifically tumor cells (in dark grey); negative or poor staining is visible in normal cells.

[0061] FIG. 7. HIGD2A expression in transiently transfected HeLa cells. Western blot analysis of HIGD2A expression in total protein extracts from HeLa cells transfected with the empty vector pcDNA3 (lane 1) or with the plasmid construct encoding the HIGD2A gene (lane 2) stained with anti-HIGD2A (right panel) and anti-HIGD2B (left panel) antibodies. Arrow marks the expected HIGD2A band. Molecular weight markers are reported on both sides.

[0062] FIG. 8. HIGD2A expression in tumor cell lines by Western blot. Total protein extracts from the human colon carcinoma tumor cell lines Colo205 (lane 1) and HCT-15 (lane 2), the ovarian carcinoma OVCAR-3 (lane 3) and the breast tumor cell line MDA-MB231 (lane 4) were separated by SDS-PAGE, transferred onto nitrocellulose membranes and probed with anti-HIGD2A antibodies. Arrow marks the expected HIGD2A band. Molecular weight markers are reported on the left

[0063] FIG. 9. Confirmation of HIGD2A antibody specificity upon gene specific silencing. At different time points, total protein extracts (corresponding to 1.times.10.sup.6 cells) from the breast tumor cell line MDA-MB231 either untreated (left panel) or transfected with a HIGD2A-siRNA (right panel) were separated by SDS-PAGE, transferred onto nitrocellulose membranes and probed with anti-HIGD2A antibodies. As normalization control, membranes were also probed with an anti-actin antibody.

[0064] FIG. 10. Analysis of purified C4orf32 recombinant protein expressed in E. coli. Left panel: Comassie staining of purified His-tag C4orf32 fusion protein expressed in E. coli separated by SDS-PAGE; Right panel: WB on the purified recombinant C4orf32 protein stained with anti-C4orf32 antibody. Arrow marks the protein band of the expected size. Molecular weight markers are reported on the left.

[0065] FIG. 11. Examples of immuno-histochemistry analysis of tumor (left panels) and normal tissue samples (right panels) stained with anti-C4orf32 antibodies. The antibody-stains specifically tumor cells (in dark grey); negative or poor staining is visible in normal cells.

[0066] FIG. 12. C4orf32 expression in transiently transfected HeLa cells. Western blot analysis of C4orf32 expression in total protein extracts from HeLa cells (corresponding to 1.times.10.sup.6 cells) transfected with the empty vector pcDNA3 (lane 1) or with the plasmid encoding C4orf32 either in the untagged native (lane 2) or the V5-fusion forms (lane 3) stained with anti-C4orf32 antibodies. A solid arrow marks the expected C4orf32 band in cells expressing the V5-fusion form (lane 3). A dashed arrow indicates the high molecular weight band in cells expressing native C4orf32 (lane 2), likely corresponding to an aggregated form of the protein. Molecular weight markers are reported on the left.

[0067] FIG. 13. Detection of C4orf32 in breast tumor tissue homogenates. Examples of tumor (lanes 3, 4) and normal samples (lanes 1, 2) stained with anti-C4orf32 antibodies. Molecular weight markers are reported on the left.

[0068] FIG. 14. Analysis of purified recombinant protein FAM62A expressed in E. coli. Left panel: Comassie staining of the purified-FAM62A protein fused to GST expressed in E. coli and separated by SDS-PAGE; Right panel: WB on the purified recombinant FAM62A protein stained with anti-FAM62A antibody. Arrow marks the protein band of the expected size. Low molecular weight bands visible on the gel correspond to degradation products of the FAM62A fusion band, as determined by mass spectrometry analysis. Molecular weight markers are reported on the left.

[0069] FIG. 15. Examples of immuno-histochemistry analysis of tumor (left panels) and normal tissue samples (right panels) stained with anti-FAM62A antibodies. The antibody-stains specifically tumor cells (in dark grey); negative or poor staining is visible in normal cells. In the case of the ovarian cancer, the normal tissue surrounds the tumor.

[0070] FIG. 16. FAM62A expression in transiently transfected HeLa cells. Western blot analysis of FAM62A expression in total protein extracts from HeLa cells transfected with the empty vector pcDNA3 (lane 1) or with the plasmid construct encoding the FAM62A gene (lane 2) stained with anti-FAM62A antibody. Arrow marks the expected FAM62A band. Different protein species are visible on the transfected cell extract, likely corresponding to FAM62A degradation products. Molecular weight markers are reported on the left.

[0071] FIG. 17. FAM62A expression in tumor cell lines. Panel A) Western blot analysis. Total protein extracts from the human lung tumor cell line H-226 (lane 1), the ovarian carcinoma OVCAR-3, (lane2), the breast tumor cell lines T47D and MCF7 (lanes 3, 4) and the colon carcinoma cell line HCT-15 (lane 5), were separated by SDS-PAGE, transferred onto nitrocellulose membranes and probed with anti-FAM62A antibodies. Arrow marks the expected FAM62A band. Molecular weight markers are reported on the left. Panel B) Localization analysis. Confocal microscopy analysis of the HCT15 cell line stained with anti-FAM62A antibodies and DAPI to visualize the nuclei. The FAM62A specific staining accumulates at the plasma membrane.

[0072] FIG. 18. Confirmation of FAM62A antibody specificity upon gene specific silencing. At different time point, total protein extracts (corresponding to 1.times.10.sup.6 cells) from the breast tumor cell line MCF-7 untreated (left panel), or transfected with a FAM62A-specific siRNA (right panel), were separated by SDS-PAGE, transferred onto nitrocellulose membranes and probed with anti-actin (normalization control) or anti-FAM62A antibodies.

[0073] FIG. 19. Detection of FAM62A in breast tumor tissue homogenates. Examples of tumor (lanes 3, 4) and normal samples (lanes 1, 2) stained with anti-FAM62A antibodies. Molecular weight markers are reported on the left. Arrow marks the FAM62A band of expected size.

[0074] FIG. 20. FAM62A confers an invasive phenotype to breast tumor cell lines. The graphs report the effect of the siRNA-mediated inhibition of FAM62A expression on the migration activity of the MCF7 (upper graph) and the MDA-MB231 (lower graph) breast tumor cell lines, measured with the Boyden assay. As controls, cells either untreated or transfected with a scrambled siRNA were used. Small boxes under the columns show the visual counting of the migrated cells.

[0075] The following examples further illustrate the invention.

EXAMPLES

Example 1

Generation of Recombinant Human Protein Antigens and Antibodies to Identify Tumor Markers

[0076] Methods

[0077] The entire coding region or suitable fragments of the genes encoding the target proteins, were designed for cloning and expression using bioinformatic tools with the human genome sequence as template (Lindskog M et al (2005). Where present, the leader sequence for secretion was replaced with the ATG codon to drive the expression of the recombinant proteins in the cytoplasm of E. coli. For cloning, genes were PCR-amplified from cDNA derived from Mammalian Gene Collection (http://mgc.nci.nih.gov/) clones using specific primers so as to fuse a 6 histidine tag sequence at the 3' end, annealed to in house developed vectors, derivatives of vector pSP73 (Promega) or pGEX6PI (GE Healthcare) adapted for the T4 ligation independent cloning method (Nucleic Acids Res. 1990 Oct. 25; 18(20): 6069-6074) and used to transform E. coli NovaBlue cells recipient strain. E. coli transformants were plated onto selective LB plates containing 100 .mu.g/ml ampicillin (LB Amp) and positive E. coli clones were identified by restriction enzyme analysis of purified plasmid followed by DNA sequence analysis. For expression, plasmids were used to transform BL21-(DE3) E. coli cells and BL21-(DE3) E. coli cells harbouring the plasmid were inoculated in ZYP-5052 growth medium (Studier, 2005) and grown at 37.degree. C. for 24 hours. Afterwards, bacteria were collected by centrifugation, lysed into B-Per Reagent containing 1 mM MgCl2, 100 units DNAse I (Sigma), and 1 mg/ml lysozime (Sigma). After 30 min at room temperature under gentle shaking, the lysate was clarified by centrifugation at 30.000 g for 40 min at 4.degree. C. With the exception of Fam62, all proteins were purified from the inclusion bodies by resuspending the pellet coming from lysate centrifugation in 40 mM TRIS-HCl, 1 mM TCEP {Tris(2-carboxyethyl)-phosphine hydrochloride, Pierce} and 6M guanidine hydrochloride, pH 8 and performing an IMAC in denaturing conditions. Briefly, the resuspended material was clarified by centrifugation at 30.000 g for 30 min and the supernatant was loaded on 0.5 ml columns of Ni-activated Chelating Sepharose Fast Flow (Pharmacia). The column was washed with 50 mM TRIS-HCl buffer, 1 mM TCEP, 6M urea, 60 mM imidazole, 0.5M NaCl, pH 8. Recombinant proteins were eluted with the same buffer containing 500 mM imidazole. Fam62A protein was purified as soluble GST-fusion by subjecting the B-PER soluble lysate to glutathione affinity purification using 0.5 ml mini-columns of Glutathione-Sepharose 4B resin (GE-Healthcare) equilibrated with 10 ml PBS, pH 7.4. After column washing with equilibrium buffer the proteins were eluted with 50 mM TRIS buffer, 10 mM reduced glutathione, pH 8.0. Proteins were analysed by SDS-Page and their concentration was determined by Bradford assay using the BIORAD reagent (BIORAD) with a bovine serum albumin standard according to the manufacturer's recommendations.

[0078] The identity of recombinant affinity purified proteins was further confirmed by tandem mass spectrometry (MS/MS), using standard procedures. This analysis also confirmed that lower mass protein species sometimes visible on the gels corresponded to truncated forms of the proteins.

[0079] To generate antisera, the purified proteins were used to immunize CD1 mice (6 week-old females, Charles River laboratories, 5 mice per group) intraperitoneally, with 3 protein doses of 20 micrograms each, at 2 week-interval. Freund's complete adjuvant was used for the first immunization, while Freund's incomplete adjuvant was used for the two booster doses. Two weeks after the last immunization animals were bleeded and sera collected from each animal was pooled.

[0080] Results

[0081] Gene fragments of the expected size were successfully isolated by PCR from specific clones of the Mammalian Gene Collection using primers specific for each gene. In particular, for the TCTN2 gene, a fragment corresponding to nucleotides 637-1458 of the transcript (SEQ ID 28) of and encoding an amino acid region from 171 to 444 (SEQ ID 9) was obtained. For the TCTN1 gene, a fragment corresponding to nucleotides 134 to 1789 of the transcript (SEQ ID NO 23, corresponding to ENST00000397655) of and encoding an amino acid region from 22 to 573 (SEQ ID NO 5, corresponding to ENSP00000380775) was obtained. For the TCTN3 gene, a fragment corresponding to nucleotides 311 to 2065 of the transcript (SEQ ID NO 32, corresponding to ENST00000371217) of and encoding an amino acid region from 23 to 607 (SEQ ID NO 13, corresponding to ENSP00000360261) was obtained.

[0082] For the HIGD2A gene, a fragment corresponding to nucleotides 49-366 of the transcript (SEQ ID 9) of and encoding an amino acid region from 1 to 106 (SEQ ID 2) was obtained. For HIGD2B gene, a fragment corresponding to nucleotides 525-852 of the transcript (SEQ ID 10) of and encoding an amino acid region from 1 to 106 (SEQ ID 3) was obtained.

[0083] For the C4orf32, a fragment corresponding to nucleotides 60-374 of the transcript (SEQ ID 11) of and encoding an amino acid region from 1 to 105 (SEQ ID 4) was obtained.

[0084] For the FAM62A, a fragment corresponding to nucleotides 53-257 of the transcript SEQ IDs 12) and encoding an amino acid region from 1 to 68 (SEQ IDs 5) was obtained. This fragment is identical in all available FAM62A isoforms (protein SEQ IDs 5, 6, 7; Transcript SEQ IDs: 12, 13, 14).

[0085] A clone encoding the correct amino acid sequence was identified for each gene/gene fragment and, upon expression in E. coli, a protein of the correct size was produced and subsequently purified using affinity chromatography (FIGS. 1, 5, 10, 14, left panel). In the case of TCTN3, different truncated forms of the protein were obtained after purification, among which a protein product of approximately 38 KDa was the major form recognized by the antibodies (FIG. 1B). Antibodies generated by immunization specifically recognized their target proteins in Western blot (WB) (FIGS. 1, 5, 10, 14 right panel). Moreover, antibodies raised against TCTN2--also recognized TCTN1 and TCTN3. Similarly, antibodies raised against HIGD2A and HIGD2B were able to recognize HIGD2A in the assay.

Example 2

Tissue Profiling by Immune-Hystochemistry Methods

[0086] The analysis of the antibodies capability to recognize their target proteins in tumor samples was carried out by Tissue Micro Array (TMA), a miniaturized immuno-histochemistry technology suitable for HTP analysis that allows to analyse the antibody immuno-reactivity simultaneously on different tissue samples immobilized on a microscope slide.

[0087] A tissue microarray was prepared containing 100 formalin-fixed paraffin-embedded cores of human tissues from patients affected by colorectal cancer, ovarian cancer, breast cancer, lung cancer, prostate cancer and corresponding normal tissues and analyzed using the specific antibody sample. Briefly, each TMA slide included tumor tissue samples representative of different well pedigreed patients, representing the 5 cancer types, and an equal number of normal tissue samples from the same patients as controls. In total, the TMA design consisted in 10 tumor samples per each tumor class and 10 normal tissue from 5 well pedigreed patients (equal to two tumor samples and 2 normal tissues from each patient) to identify promising target molecules differentially expressed in cancer and normal tissues. The direct comparison between tumor and normal tissues of each patient allowed the identification of antibodies that stain tumor cells and provide indication of target expression in the tumor under investigation.

[0088] All formalin fixed, paraffin embedded tissues used as donor blocks for TMA production were selected from the archives at the TEO (European Institute of Oncology, Milan). Corresponding whole tissue sections were examined to confirm diagnosis and tumour classification, and to select representative areas in donor blocks. Normal tissues were defined as microscopically normal (non-neoplastic) and were generally selected from specimens collected from the vicinity of surgically removed tumors. The TMA production was performed essentially as previously described (7, 8). Briefly, a hole was made in the recipient TMA block. A cylindrical core tissue sample (1 mm in diameter) from the donor block was acquired and deposited in the recipient TMA block. This was repeated in an automated tissue arrayer "Galileo TMA CK 3500" (BioRep--Milan) until a complete TMA design was produced. TMA recipient blocks were baked at 42.degree. C. for 2 h prior to sectioning. The TMA blocks were sectioned with 2-3 .mu.m thickness using a waterfall microtome (Leica), and placed onto poli-L-lysinated glass slides for immunohistochemical analysis. Automated immunohistochemistry was performed as previously described (Kampf C. et al. 2004 Clin. Proteomics 1: 285-300). In brief, the glass slides were incubated for 30' min in 60.degree. C., de-paraffinized in xylene (2.times.15 min) using the Bio-Clear solution (Midway. Scientific, Melbourne, Australia), and re-hydrated in graded alcohols. For antigen retrieval, slides were immersed 0.01 M Na-citrate buffer, pH 6.0 at 99.degree. C. for 30 min Slides were placed in the Autostainer (R) (DakoCytomation) and endogenous peroxidase was initially blocked with 3% H2O2, for 5 min. Slides were then blocked in Dako Cytomation Wash Buffer containing 5% Bovine serum albumin (BSA) and subsequently incubated with mouse antibodies for 30' (dilution 1:200 in Dako Real.TM. dilution buffer). After washing with DakoCytomation wash buffer, slides were incubated with the goat anti-mouse peroxidase conjugated Envision(R) for 30 min each at room temperature (DakoCytomation). Finally, diaminobenzidine (DakoCytomation) was used as chromogen and Harris hematoxylin (Sigma-Aldrich) was used for counterstaining. The slides were mounted with Pertex(R) (Histolab).

[0089] The staining results have been evaluated by a trained pathologist at the light microscope, and scored according to both the percentage of immunostained cells and the intensity of staining. The individual values and the combined score (from 0 to 300) were recorded in a custom-tailored database. Digital images of the immunocytochemical findings have been taken at a Leica DM LB light microscope, equipped with a Leica DFC289 color camera.

[0090] Results

[0091] A TMA design was obtained, representing tumor tissue samples from 5 tumor classes (lung, ovary, prostate, breast and colon) and normal tissues, derived from 5 patients for each tumor type. The results from tissue profiling showed that the antibodies specific for the recombinant proteins (see Example 2) are strongly immunoreactive on several cancer tissues, indicating the presence of the target proteins in tumors tissues, while no or poor reactivity was detected in normal tissues. Based on this finding, the detection of target proteins in tissue samples can be associated with the specific tumor/s.

[0092] The capability of target-specific antibodies to stain different tumor tissues is summarized in Table 1. Representative examples of microscopic enlargements of tissue samples stained by each antibody are reported within FIGS. 2, 6, 11, 15.

TABLE-US-00004 TABLE 1 TUMOR MARKERS IDENTIFIED BY TMA POSITIVE TUMOR TISSUES OF PATIENTS TESTED BY TMA TARGET PROTEIN BREAST COLON LUNG OVARY PROSTATE BIOLOGICAL INFORMATION TECTONIC-2 0/5 5/5 3/5 2/5 0/5 FUNCTION: UNKNOWN FUNCTION LOCATION: MEMBRANE HIGD2A 0/5 2/5 0/5 3/5 0/5 FUNCTION: HYPOXIA INDUCED PROTEIN LOCATION: MEMBRANE CHR 4 ORF 32 2/5 0/5 2/5 0/5 0/5 FUNCTION: UNKNOWN FUNCTION LOCATION: MEMBRANE FAM 62A 3/5 3/5 1/5 4/5 0/5 FUNCTION: RHODOPSIN-LIKE RECEPTOR ACTIVITY, G-PROTEIN COUPLED RECEPTOR LOCATION: PLASMATIC MEMBRANE

Example 3

[0093] Confirmation of the Marker Association with the Tumor/s by Expanded TMA Analysis

[0094] Method

[0095] The association of each protein with the indicated tumors was further confirmed on a larger collection of clinical samples. To this aim, a tissue microarray was prepared for each of the five tumor classes containing 100 formalin-fixed paraffin-embedded cores of human tissues from 50 patients (equal to two tissue samples from each patient). The TMAs were stained with the marker specific antibodies, using the previously reported procedure. The staining results were evaluated, as above described, by a trained pathologist at the light microscope.

[0096] Results

[0097] Five TMA designs were obtained, for each of the five tumors, representing tissue samples from 50 patients. The results from tissue analysis showed that the antibodies specific for each of the four proteins (see Example 1) are strongly immune-reactive on a large percentage of tumor tissues, indicating that the corresponding proteins are selectively detected in the tumor/s. This finding confirms a strong association of the markers with the specific tumor/s.

[0098] The capability of marker-specific antibodies to stain different tumor tissues is summarized in Table 2, which reports the percentage of positive tumor tissue samples derived from the 50 patients

TABLE-US-00005 TABLE 2 Percentage of tumor tissues showing positive immuno-istochemistry staining Target protein Breast Colon Lung Ovary Prostate Tectonic 2 na 90 75 25 na HIGD2A na 40 na 45 na C4orf32 52 na 82 na na FAM62A 86 74 96 75 na na: not applicable

Example 4

Expression and Localization of the Target Proteins in Transfected Mammalian Cells

[0099] Methods

[0100] The specificity of the antibodies for each target proteins was assessed by Western blot analysis on total protein extracts from eukaryotic cells transiently transfected with plasmid constructs containing the complete sequences of the genes encoding the target proteins.

[0101] To this aim, cDNA were generated from pools of total RNA derived from human testis, human placenta, human bone marrow, human fetal brain, in reverse transcription reactions and the entire coding regions were PCR-amplified with specific primers pairs. PCR products were cloned into plasmid pcDNA3 (Invitrogen). In the case of C4Orf32, the PCR product was also cloned into plasmid pcDNA3.1D (Invitrogen) to express a tagged form of the protein fused to a V5 epitope sequence at the carboxy-terminus. HeLa cells were grown in DMEM-10% FCS supplemented with 1 mM Glutamine were transiently transfected with preparation of the resulting plasmids and with the empty vector as negative control using the Lipofectamine-2000 transfection reagent (Invitrogen). After 48 hours, cells were collected, lysed with PBS buffer containing 1% Triton X100 and expression of target proteins was assessed by Western blot analysis on total cell extracts (corresponding to 1.times.10.sup.6 cells) using antibodies specific for TCTN2, C4orf32, FAM62A, HIGD2A, and its homologous HIGD2B protein. When the C4orf32 tagged construct was used for transfection, blots were analysed with a tag-specific antibody (anti-V5 antibody). Western blot was performed by separation of the protein extracts on pre-cast SDS-PAGE gradient gels (NuPage 4-12% Bis-Tris gel, Invitrogen) under reducing conditions, followed by electro-transfer to nitrocellulose membranes (Invitrogen) according to the manufacturer's recommendations. The membranes were blocked in blocking buffer composed of 1.times.PBS-0.1% Tween 20 (PBST) added with 10% dry milk, for 1 h at room temperature, incubated with the antibody diluted 1:2500 in blocking buffer containing 1% dry milk and washed in PBST-1%. The secondary HRP-conjugated antibody (goat anti-mouse immunoglobulin/HRP, Perkin Elmer) was diluted 1:5000 in blocking buffer and chemiluminescence detection was carried out using a Chemidoc-IT UVP CCD camera (UVP) and the Western Lightning.TM. cheminulescence Reagent Plus (Perkin Elmer), according to the manufacturer's protocol.

[0102] Surface localization of target proteins was assessed in HeLa transfected cells by cell surface staining and Flow Cytometry (FACS) analysis. HeLa cells transfected with each construct or with the empty vector (2.times.10.sup.4 per well) were pelletted in 96 U-bottom microplates by centrifugation at 200.times.g for 5 min at 4.degree. C. and incubated for 1 hour at 4.degree. C. with the appropriate dilutions of marker-specific antibodies. The cells were washed twice in PBS-5% FCS and incubated for 20 min with the appropriate dilution of R-Phycoerythrin (PE)-conjugated secondary antibodies (Jackson Immuno Research, PA, USA) at 4.degree. C. After washing, bacteria were analysed by a FACS Canto II flow cytometer (Becton Dickinson). Data were analyzed with FlowJo 8.3.3 program.

[0103] Results

[0104] To confirm the antibody specificity, the complete coding sequence/s for each target protein were cloned in a eukaryotic expression vector and used for transient transfection of HeLa cells.

[0105] Expression of each protein was detected by Western blot in total protein extracts from HeLa cells transfected with the different constructs encoding for the target proteins using their specific antibodies. As far as TCTN2, HIGD2A and FAM62A are concerned, a band of the expected size was visible in HeLa cells transfected with the corresponding plasmids while the same band was either not visible or very faintly detected in HeLa cells transfected with the empty pcDNA3 plasmid. Each antibody recognized specifically its target protein, since almost a unique single protein band was detected. Results are reported in FIGS. 3A, 7 and 16.

[0106] HeLa cells transfected with the HIGD2A construct were also tested with the antibody specific for the HIGD2B homolog. Results show that the anti-HIGD2B antibody was capable of detecting HIGD2A protein in transfected cells. (FIG. 7).

[0107] As regards C4orf32, HeLa were transfected with the C4orf32 untagged and tagged constructs and tested with the C4orf32- and the anti-V5 antibodies. A protein of expected size was detected in HeLa cells transfected with the tagged construct using both antibodies. A protein band of higher mass was detected in cells transfected with the untagged construct using the C4orf32-specific antibody. This indicates that the native C4orf32 protein forms highly stable aggregates that are detected by the antibody in immunoblot. The presence of the fusion tag at the C4orf32 carboxy-terminus appears to prevent the C4orf32 aggregation and allows the detection of the protein species with the expected mass. Results of immunoblot analysed with the C4orf32 antibody is reported in FIG. 12. Data obtained with the anti-V5 antibody are not shown.

[0108] Surface localization of target proteins was addressed by FACS analysis of transiently transfected cells stained with the specific antibodies. Data are reported for cells transfected with the construct encoding TCTN2. In this experiment the TCTN2-antibody was capable of binding the surface of transfected cells, while no binding was observed on cells transfected with the empty pcDNA3 vector (FIG. 3B). This indicates that this target protein is localized on the cell surface and are accessible to the external environment. This finding reinforces the relevance of TCTN2 protein for future development as either diagnostic marker or therapeutic targets.

Example 5

Expression of Target Proteins in Tumor Cell Lines

[0109] Expression of target proteins showing positivity by TMA was also assessed by WB on total extracts from a panel of human epithelial cell lines derived from the same tumor types. In each analysis, cells were cultured in under ATCC recommended conditions, and sub-confluent cell mono-layers were detached with PBS-0.5 mM EDTA and lysed by several freeze-thaw passages in PBS-1% Triton. Total protein extracts were loaded on SDS-PAGE (2.times.10.sup.5 cells/lane), and subjected to WB with specific antibodies as described above.

[0110] The marker cellular localization was assessed by confocal microscopy analysis. Cells were plated on glass cover slips and after 48 h were washed with PBS and fixed with 3% formaldehyde solution in PBS for 20 min at RT. Then, after extensive washing in PBS, the cells were permeabilized with 0.01% BriJ96.RTM. (Fluka), and incubated overnight at 4.degree. C. with polyclonal antibodies (1:200). Cells were then stained with Alexafluor 488-labeled goat anti-mouse antibodies (Molecular Probes). DAPI (Molecular Probes) was used to visualize nuclei. The cells were mounted with glycerol plastine and observed under a laser-scanning confocal microscope (LeicaSP5).

[0111] Results

[0112] Expression analysis of the target proteins was confirmed in tumor cell lines. Example data are shown for HIGD2A and FAM62A.

In particular, HIGD2A expression is reported for a panel of the tumor cell lines including Ovcar 3 (ovary adenocarcinoma), and HCT-15 and Colo205 (colon tumor cell lines) and MDA-MB231 (breast adenocarcinoma). FAM62A expression analysis is reported for the tumor cell lines H226, Ovcar 3, MCF7 and T47D (breast adenocarcinoma).

[0113] HIGD2A and FAM62A protein bands of the expected sizes were detected in total protein extracts of all tested tumor cell lines by immunoblot, confirming their expression in tumor cells derived from the different tumor types.

[0114] Results are reported in FIGS. 8, 17A.

[0115] Confocal microscopy analysis of the HCT-15 cell with anti-FAM62A antibody shows that the protein is localized at the plasma membrane (FIG. 17B). This suggests that the protein is accessible to the external environment and reinforces its relevance for future development as either diagnostic marker or therapeutic targets.

Example 6

Confirmation of the Specificity the Tumor-Reactive Antibodies by Gene Silencing Experiments

[0116] Methods

[0117] The specificity of the polyclonal antibodies for their targets was also confirmed by transient RNA-interference experiments, measuring the loss of detection of the expected protein bands in cell lines upon silencing. For each gene, a set of small interfering RNAs (siRNAs) and controls were obtained from QIAGEN, whose target sequence is reported in Table 3.

TABLE-US-00006 TABLE 3 NCBI gene mRNA Accessions siRNA Target Sequence TCTN1 NM_001082537 TTGAACTTGTTGACCAGATTA NM_001082538 TTGCGTGAATGTTGTTCTTGA NM_024549 TCTN2 NM_024809 TGCATCCGTCCAGTTTATTAA AAGCCTATAGTTAGACAACCA TGGCTCGAAATAATACGTGTA TTGGAACTATACCAAGAACGA TCTN3 NM_001013840 TTGGCTCTGACTGATGATATA NM_015631 AACCCGCAAGCTCATGTATCA CAGGATTCTCAGCAAGTTACA HIGD2A NM_138820 CACGGCGGCCGCCCTCACCTA CTCCGCAGAAATGATTCCAAA ATCCTAGATGCTGTTGTTTGA C4orf32 NM_152400 TTGGACCTAGACCTACTTTAA CCCAGCCTAAACTAAGGTAAA AACGAATAGTGGAACCAGTAA FAM62A NM_015292 GTGGGAGATAGTTCTCATAAA ACGCCCGACCCTAGACATCAA

[0118] The expression of marker genes was knocked down in a panel of epithelial tumor cell lines using marker-specific siRNAs with the HiPerfect transfection reagent (QIAGEN) following the manufacturer's protocol. As control, cells treated with irrelevant siRNA (scrambled siRNA) were analysed in parallel. At different time points (ranging from 24 to 72 hours) post transfection, we first assessed the reduction of gene transcription by quantitative RT-PCR (QRT-PCR) on total RNA, by evaluating the relative marker transcript level, using the beta-actin, GAPDH or MAPK genes as internal normalization control. Afterwards, the loss of protein expression was also confirmed by immunoblot on total protein extracts prepared from the siRNA-treated cell lines, using the same antibodies giving positive immune-staining on tumor tissues. Blots were also probed with an anti-actin antibody as internal normalization control.

[0119] Results

[0120] Gene silencing experiments with marker-specific siRNA reduced the marker transcripts (approximately 30-40 fold reduction), as determined by Q-RT-PCR. Under this condition, immunoblot analysis with marker-specific antibodies revealed that expression of protein bands of expected size were clearly detected in untreated cell lines while they were significantly reduced upon si-RNA treatment. Examples of this analysis are reported for HIGD2A and FAM62A in FIGS. 9 and 18, respectively.

Examples 7

The Tumor-Reactive Antibodies are Able to Recognize Proteins of Expected Size in Tumor Tissue Homogenates

[0121] The presence of protein bands corresponding to the marker proteins was also investigated in tissue homogenates of tumor biopsies from patients affected by tumor (selected from the 5 tumor classes). In these assay, tumor and normal tissues from the same patients were analysed in parallel. Homogenates were prepared by mechanic tissue disruption in buffer containing 40 mM TRIS-HCl, 1 mM TCEP {Tris(2-carboxyethyl)-phosphine hydrochloride, Pierce} and 6M guanidine hydrochloride, pH 8. Western blot was performed by separation of the total protein extracts (20 .mu.g/lane) proteins were detected by specific antibodies.

[0122] Results

[0123] All tested antibodies specifically recognized protein species on tumor tissues, while the same bands were not or faintly visible on normal tissues. Example data are represented for proteins FAM62A and C4orf32 on breast tissue homogenates. As shown in FIG. 19, in the case of FAM62A a band of expected size was detected in breast tumor tissues, while no bands were detected in normal tissue homogenates, confirming the presence of the marker proteins in the tumor. As far as C4orf32 is concerned, different protein species with higher mass (50-60 KDa) were detected by the antibody specifically in tumor samples (FIG. 13). This is in line with previous evidences indicating the tendency of the C4orf32 protein to form stable aggregates (see Example 4).

Example 8

The Marker Proteins are Involved in Cell Malignant Phenotypes

[0124] To verify that the proteins included in the present invention can be exploited as targets for therapeutic applications, the effect of alteration of marker expression, either depletion or over-expression (obtained upon transfection with specific siRNAs or expression plasmids, respectively), was evaluated in in vitro studies generally used to define the role of newly discovered proteins in tumorigenesis or tumor progression. Marker-specific knock-down or transfected tumor cell lines and their respective controls were analysed for their migration property and the ability to proliferate in an anchorage-independent fashion using the Boyden in vitro invasion and the soft agar assays, respectively. A brief description of these assays is provided below.

[0125] The Boyden chamber assay is based on a chamber of two medium-filled compartments separated by a microporous membrane. Cells are placed in the upper compartment and are allowed to migrate through the pores of the membrane into the lower compartment, in which chemotactic agents are present. After an appropriate incubation time, the membrane between the two compartments is fixed and stained, and the number of cells that have migrated to the lower side of the membrane is determined. Therefore, the Boyden chamber-based cell migration assay has also been called filter membrane migration assay, trans-well migration assay, or chemotaxis assay.

[0126] The Soft Agar Assay for Colony Formation is an anchorage independent growth assay in soft agar, which is considered the most stringent assay for detecting malignant transformation of cells. Many primary cell lines must attach to a solid surface before they can divide and proliferate, while they fail to grow when suspended in a viscous fluid or gel (e.g. agar or agarose). However, when these cell lines are transformed, they are able to grow in a viscous fluid or gel and become anchorage-independent. The process, by which these phenotypic changes occur, is assumed to be closely related to the process of in vivo carcinogenesis. Thereby, the acquisition of an anchorage independent growth style on soft agar is viewed as indicative of in vivo carcinogenesis. For this assay, cells are cultured with appropriate controls in soft agar medium for 21-28 days. Following this incubation period, formed colonies can either be analyzed morphologically using cell stain and quantifying the number of colonies formed per well.

[0127] Method

[0128] When the effect of marker depletion was analysed, tumor cell lines previously shown to express the proteins were treated with any of the marker specific siRNA molecules proved to inhibit marker expression (see Table 3 in the Example 6) and then tested in the Boyden invasion and the anchorage independent soft agar assays, as compared to control cell lines treated with a scramble siRNA. When the effect of marker overexpression was assessed, tumor cell lines showing a low endogenous marker expression were transfected with corresponding pcDNA3-derived plasmids and then tested in the Boyden and the soft agar assays.

[0129] For the Boyden in vitro invasion assay, a transwell system, equipped with 8-.mu.m pore polyvinylpirrolidone-free polycarbonate filters, was used. The upper sides of the porous polycarbonate filters were coated with 50 .mu.g/cm.sup.2 of reconstituted Matrigel basement membrane and placed into six-well culture dishes containing complete growth medium. Cells (1.times.10.sup.4 cells/well) were loaded into the upper compartment in serum-free growth medium. After 16 h of incubation at 37.degree. C., non invading cells were removed mechanically using cotton swabs, and the microporous membrane was stained with Diff-Quick solution. Chemotaxis was evaluated by counting the cells migrated to the lower surface of the polycarbonate filters (six randomly chosen fields, mean.+-.SD).

[0130] For the anchorage independent soft agar assay, cells were suspended in growth medium containing 10% FBS and 0.3% agar, seeded onto a solidified base of growth medium containing 0.6% agar, and overlaid with growth medium. Cell growth was monitored for 2 weeks by scoring the formation of colonies (all values were determined in triplicate). Photographs were taken with a phase-contrast microscope.

[0131] Results

[0132] Examples of the phenotypic changes induced by reducing the marker expression with specific siRNA are shown for FAM62A, TCTN1 and TCTN3. Inhibition of either TCTN1 or TCTN3 expression reduces the capability of the HCT15 tumor cell line to grow on soft agar, as shown by the lower number and size of colonies formed by cells treated with TCTN1- and TCTN3-siRNAs (FIG. 4A). Inhibition of TCTN1 and TCTN3 also impairs the invasive phenotype of the HCT15 cell line (FIG. 4B). Similarly, inhibition of FAM62A expression significantly impairs the invasive phenotype of the MCF7 and MDA-MB231 tumor cell lines (FIG. 20).

[0133] Examples of the phenotypic changes induced by an increased marker expression in cell transfected with the marker-encoding plasmids are reported for TCTN2. TCTN2 over-expression increases the capability of the HCT15 cell line to proliferate on soft agar, as shown by the higher number of colonies formed by TCTN2-transfected cells (FIG. 4C).

Altogether, the results indicate that the proteins are involved in tumorigenesis and/or tumor progression.

REFERENCES

[0134] 1. Adams G. P. and Weiner L. M. (2005) Monoclonal antibody therapy cancer. Nat Biotechnol. 23:1147-57; [0135] 2. Anderson, L., and Seilhamer, J. (1997). A comparison of selected mRNA and protein abundances in human liver. Electrophoresis 18, 533-537; [0136] 3. Chen, G., Gharib, T. G., Wang, H., Huang, C. C., Kuick, R., Thomas, D. G., Shedden, K. A., Misek, D. E., Taylor, J. M., Giordano, T. J., Kardia, S. L., Iannettoni, M. D., Yee, J., Hogg, P. J., Orringer, M. B., Hanash, S. M., and Beer, D. G. (2003) Protein profiles associated with survival in lung adenocarcinoma. Proc. Natl. Acad. Sci. U.S. A 100, 13537-13542; [0137] 4. Ginestier, C., Charafe-Jauffret, E., Bertucci, F., Eisinger, F., Geneix, J., Bechlian, D., Conte, N., Adelaide, J., Toiron, Y., Nguyen, C., Viens, P., Mozziconacci, M. J., Houlgatte, R., Birnbaum, D., and Jacquemier, J. (2002) Distinct and complementary information provided by use of tissue and DNA microarrays in the study of breast tumor markers. Am. J. Pathol. 161, 1223-1233; [0138] 5. Gygi, S. P., Rochon, Y., Franza, B. R., and Aebersold, R. (1999) Correlation between protein and mRNA abundance in yeast. Mol. Cell. Biol. 19, 1720-1730; Nishizuka, S., Charboneau, L., Young, L., Major, S., Reinhold, W. C., Waltham, M., Kouros-Mehr, H., Bussey, K. J., Lee, J. K., Espina, V., Munson, P. J., Petricoin, E., III, Liotta, L. A., and Weinstein, J. N. (2003) Proteomic profiling of the NCI-60 cancer cell lines using new high-density reverse-phase lysate microarrays. Proc. Natl. Acad. Sci. U.S. A 100, 14229-14234; [0139] 6. Tyers, M., and Mann, M. (2003) From genomics to proteomics. Nature 422, 193-197; [0140] 7. Kononen J et al (1998) Nature Med. 4:844-847; [0141] 8. Kallioniemi O P et al (2001) Hum. MoI. Genet. 10:657-662.

Sequence CWU 1

1

551260PRTHomo sapiens 1Met Lys Thr Ser Asp Gly Phe Thr Leu Asn Ala Glu Ser Tyr Val Ser1 5 10 15Phe Thr Thr Lys Leu Asp Ile Pro Thr Ala Ala Lys Tyr Glu Tyr Gly 20 25 30Val Pro Leu Gln Thr Ser Asp Ser Phe Leu Arg Phe Pro Ser Ser Leu 35 40 45Thr Ser Ser Leu Cys Thr Asp Asn Asn Pro Ala Ala Phe Leu Val Asn 50 55 60Gln Ala Val Lys Cys Thr Arg Lys Ile Asn Leu Glu Gln Cys Glu Glu65 70 75 80Ile Glu Ala Leu Ser Met Ala Phe Tyr Ser Ser Pro Glu Ile Leu Arg 85 90 95Val Pro Asp Ser Arg Lys Lys Val Pro Ile Thr Val Gln Ser Ile Val 100 105 110Ile Gln Ser Leu Asn Lys Thr Leu Thr Arg Arg Glu Asp Thr Asp Val 115 120 125Leu Gln Pro Thr Leu Val Asn Ala Gly His Phe Ser Leu Cys Val Asn 130 135 140Val Val Leu Glu Val Lys Tyr Ser Leu Thr Tyr Thr Asp Ala Gly Glu145 150 155 160Val Thr Lys Ala Asp Leu Ser Phe Val Leu Gly Thr Val Ser Ser Val 165 170 175Val Val Pro Leu Gln Gln Lys Phe Glu Ile His Phe Leu Gln Thr Asp 180 185 190Trp Ser Ser Pro Val Ser Ala Arg Ser Thr Glu Gly Glu Glu Pro Ala 195 200 205Val Gly Pro Gly Leu Pro Arg Leu Arg Gly Pro Phe Trp Lys Phe Pro 210 215 220Gly Pro Gly His Ala Gly Leu Gly Ala His Pro Leu His His Pro Val225 230 235 240Ile Gln Gln Glu Gly Phe Leu Pro Ala Pro Arg Gly Phe Gly Tyr Arg 245 250 255Ser Glu Val Asp 2602483PRTHomo sapiens 2Met Ile Thr Ala His Cys Ser Leu Asp Leu Leu Gly Ser Val Ala Val1 5 10 15Leu Cys Val Cys Asp Leu Ser Pro Ala Gln Cys Asp Ile Asn Cys Cys 20 25 30Cys Asp Pro Asp Cys Ser Ser Val Asp Phe Ser Val Phe Ser Ala Cys 35 40 45Ser Val Pro Val Val Thr Gly Asp Ser Gln Phe Cys Ser Gln Lys Ala 50 55 60Val Ile Tyr Ser Leu Asn Phe Thr Ala Asn Pro Pro Gln Arg Val Phe65 70 75 80Glu Leu Val Asp Gln Ile Asn Pro Ser Ile Phe Cys Ile His Ile Thr 85 90 95Asn Tyr Lys Pro Ala Leu Ser Phe Ile Asn Pro Glu Val Pro Asp Glu 100 105 110Asn Asn Phe Asp Thr Leu Met Lys Thr Ser Asp Gly Phe Thr Leu Asn 115 120 125Ala Glu Ser Tyr Val Ser Phe Thr Thr Lys Leu Asp Ile Pro Thr Ala 130 135 140Ala Lys Tyr Glu Tyr Gly Val Pro Leu Gln Thr Ser Asp Ser Phe Leu145 150 155 160Arg Phe Pro Ser Ser Leu Thr Ser Ser Leu Cys Thr Asp Asn Asn Pro 165 170 175Ala Ala Phe Leu Val Asn Gln Ala Val Lys Cys Thr Arg Lys Ile Asn 180 185 190Leu Glu Gln Cys Glu Glu Ile Glu Ala Leu Ser Met Ala Phe Tyr Ser 195 200 205Ser Pro Glu Ile Leu Arg Val Pro Asp Ser Arg Lys Lys Val Pro Ile 210 215 220Thr Val Gln Ser Ile Val Ile Gln Ser Leu Asn Lys Thr Leu Thr Arg225 230 235 240Arg Glu Asp Thr Asp Val Leu Gln Pro Thr Leu Val Asn Ala Gly His 245 250 255Phe Ser Leu Cys Val Asn Val Val Leu Glu Val Lys Tyr Ser Leu Thr 260 265 270Tyr Thr Asp Ala Gly Glu Val Thr Lys Ala Asp Leu Ser Phe Val Leu 275 280 285Gly Thr Val Ser Ser Val Val Val Pro Leu Gln Gln Lys Phe Glu Ile 290 295 300His Phe Leu Gln Glu Asn Thr Gln Pro Val Pro Leu Ser Gly Asn Pro305 310 315 320Gly Tyr Val Val Gly Leu Pro Leu Ala Ala Gly Phe Gln Pro His Lys 325 330 335Thr Gly Ala Leu Pro Cys Gln Leu Val Ala Gln Lys Val Lys Ser Leu 340 345 350Leu Trp Gly Gln Gly Phe Pro Asp Tyr Val Ala Pro Phe Gly Asn Ser 355 360 365Gln Ala Gln Asp Met Leu Asp Trp Val Pro Ile His Phe Ile Thr Gln 370 375 380Ser Phe Asn Arg Lys His Phe Val Leu Gln Asp Ser Cys Gln Leu Pro385 390 395 400Gly Ala Leu Val Ile Glu Val Lys Trp Thr Lys Tyr Gly Ser Leu Leu 405 410 415Asn Pro Gln Ala Lys Ile Val Asn Val Thr Ala Asn Leu Ile Ser Ser 420 425 430Ser Phe Pro Glu Ala Asn Ser Gly Asn Glu Arg Thr Ile Leu Ile Ser 435 440 445Thr Ala Val Thr Phe Val Asp Val Ser Ala Pro Ala Glu Ala Gly Phe 450 455 460Arg Ala Pro Pro Ala Ile Asn Ala Arg Leu Pro Phe Asn Phe Phe Phe465 470 475 480Pro Phe Val3531PRTHomo sapiens 3Met Cys Gln Leu Leu Glu Ser Thr Val Ile Gln Pro Gln Gly Asp Ser1 5 10 15Pro Val Ala Val Leu Cys Val Cys Asp Leu Ser Pro Ala Gln Cys Asp 20 25 30Ile Asn Cys Cys Cys Asp Pro Asp Cys Ser Ser Val Asp Phe Ser Val 35 40 45Phe Ser Ala Cys Ser Val Pro Val Val Thr Gly Asp Ser Gln Phe Cys 50 55 60Ser Gln Lys Ala Val Ile Tyr Ser Leu Asn Phe Thr Ala Asn Pro Pro65 70 75 80Gln Arg Val Phe Glu Leu Val Asp Gln Ile Asn Pro Ser Ile Phe Cys 85 90 95Ile His Ile Thr Asn Tyr Lys Pro Ala Leu Ser Phe Ile Asn Pro Glu 100 105 110Val Pro Asp Glu Asn Asn Phe Asp Thr Leu Met Lys Thr Ser Asp Gly 115 120 125Phe Thr Leu Asn Ala Glu Ser Tyr Val Ser Phe Thr Thr Lys Leu Asp 130 135 140Ile Pro Thr Ala Ala Lys Tyr Glu Tyr Gly Val Pro Leu Gln Thr Ser145 150 155 160Asp Ser Phe Leu Arg Phe Pro Ser Ser Leu Thr Ser Ser Leu Cys Thr 165 170 175Asp Asn Asn Pro Ala Ala Phe Leu Val Asn Gln Ala Val Lys Cys Thr 180 185 190Arg Lys Ile Asn Leu Glu Gln Cys Glu Glu Ile Glu Ala Leu Ser Met 195 200 205Ala Phe Tyr Ser Ser Pro Glu Ile Leu Arg Val Pro Asp Ser Arg Lys 210 215 220Lys Val Pro Ile Thr Val Gln Ser Ile Val Ile Gln Ser Leu Asn Lys225 230 235 240Thr Leu Thr Arg Arg Glu Asp Thr Asp Val Leu Gln Pro Thr Leu Val 245 250 255Asn Ala Gly His Phe Ser Leu Cys Val Asn Val Val Leu Glu Val Lys 260 265 270Tyr Ser Leu Thr Tyr Thr Asp Ala Gly Glu Val Thr Lys Ala Asp Leu 275 280 285Ser Phe Val Leu Gly Thr Val Ser Ser Val Val Val Pro Leu Gln Gln 290 295 300Lys Phe Glu Ile His Phe Leu Gln Glu Asn Thr Gln Pro Val Pro Leu305 310 315 320Ser Gly Asn Pro Gly Tyr Val Val Gly Leu Pro Leu Ala Ala Gly Phe 325 330 335Gln Pro His Lys Met Ser Gly Ile Ile Gln Thr Thr Asn Arg Tyr Gly 340 345 350Gln Leu Thr Ile Leu His Ser Thr Thr Glu Gln Asp Cys Leu Ala Leu 355 360 365Glu Gly Val Arg Thr Pro Val Leu Phe Gly Tyr Thr Met Gln Ser Gly 370 375 380Cys Lys Leu Arg Leu Thr Gly Ala Leu Pro Cys Gln Leu Val Ala Gln385 390 395 400Lys Val Lys Ser Leu Leu Trp Gly Gln Gly Phe Pro Asp Tyr Val Ala 405 410 415Pro Phe Gly Asn Ser Gln Ala Gln Asp Met Leu Asp Trp Val Pro Ile 420 425 430His Phe Ile Thr Gln Ser Phe Asn Arg Lys Asp Ser Cys Gln Leu Pro 435 440 445Gly Ala Leu Val Ile Glu Val Lys Trp Thr Lys Tyr Gly Ser Leu Leu 450 455 460Asn Pro Gln Ala Lys Ile Val Asn Val Thr Ala Asn Leu Ile Ser Ser465 470 475 480Ser Phe Pro Glu Ala Asn Ser Gly Asn Glu Arg Thr Ile Leu Ile Ser 485 490 495Thr Ala Val Thr Phe Val Asp Val Ser Ala Pro Ala Glu Ala Gly Phe 500 505 510Arg Ala Pro Pro Ala Ile Asn Ala Arg Leu Pro Phe Asn Phe Phe Phe 515 520 525Pro Phe Val 5304592PRTHomo sapiens 4Met Arg Pro Arg Gly Leu Pro Pro Leu Leu Val Val Leu Leu Gly Cys1 5 10 15Trp Ala Ser Val Ser Ala Gln Thr Asp Ala Thr Pro Ala Val Thr Thr 20 25 30Glu Gly Leu Asn Ser Thr Glu Ala Ala Leu Ala Thr Phe Gly Thr Phe 35 40 45Pro Ser Thr Arg Pro Pro Gly Thr Pro Arg Ala Pro Gly Pro Ser Ser 50 55 60Gly Pro Arg Pro Thr Pro Val Thr Asp Val Ala Val Leu Cys Val Cys65 70 75 80Asp Leu Ser Pro Ala Gln Cys Asp Ile Asn Cys Cys Cys Asp Pro Asp 85 90 95Cys Ser Ser Val Asp Phe Ser Val Phe Ser Ala Cys Ser Val Pro Val 100 105 110Val Thr Gly Asp Ser Gln Phe Cys Ser Gln Lys Ala Val Ile Tyr Ser 115 120 125Leu Asn Phe Thr Ala Asn Pro Pro Gln Arg Val Phe Glu Leu Val Asp 130 135 140Gln Ile Asn Pro Ser Ile Phe Cys Ile His Ile Thr Asn Tyr Lys Pro145 150 155 160Ala Leu Ser Phe Ile Asn Pro Glu Val Pro Asp Glu Asn Asn Phe Asp 165 170 175Thr Leu Met Lys Thr Ser Asp Gly Phe Thr Leu Asn Ala Glu Ser Tyr 180 185 190Val Ser Phe Thr Thr Lys Leu Asp Ile Pro Thr Ala Ala Lys Tyr Glu 195 200 205Tyr Gly Val Pro Leu Gln Thr Ser Asp Ser Phe Leu Arg Phe Pro Ser 210 215 220Ser Leu Thr Ser Ser Leu Cys Thr Asp Asn Asn Pro Ala Ala Phe Leu225 230 235 240Val Asn Gln Ala Val Lys Cys Thr Arg Lys Ile Asn Leu Glu Gln Cys 245 250 255Glu Glu Ile Glu Ala Leu Ser Met Ala Phe Tyr Ser Ser Pro Glu Ile 260 265 270Leu Arg Val Pro Asp Ser Arg Lys Lys Val Pro Ile Thr Val Gln Ser 275 280 285Ile Val Ile Gln Ser Leu Asn Lys Thr Leu Thr Arg Arg Glu Asp Thr 290 295 300Asp Val Leu Gln Pro Thr Leu Val Asn Ala Gly His Phe Ser Leu Cys305 310 315 320Val Asn Val Val Leu Glu Val Lys Tyr Ser Leu Thr Tyr Thr Asp Ala 325 330 335Gly Glu Val Thr Lys Ala Asp Leu Ser Phe Val Leu Gly Thr Val Ser 340 345 350Ser Val Val Val Pro Leu Gln Gln Lys Phe Glu Ile His Phe Leu Gln 355 360 365Glu Asn Thr Gln Pro Val Pro Leu Ser Gly Asn Pro Gly Tyr Val Val 370 375 380Gly Leu Pro Leu Ala Ala Gly Phe Gln Pro His Lys Gly Ser Gly Ile385 390 395 400Ile Gln Thr Thr Asn Arg Tyr Gly Gln Leu Thr Ile Leu His Ser Thr 405 410 415Thr Glu Gln Asp Cys Leu Ala Leu Glu Gly Val Arg Thr Pro Val Leu 420 425 430Phe Gly Tyr Thr Met Gln Ser Gly Cys Lys Leu Arg Leu Thr Gly Ala 435 440 445Leu Pro Cys Gln Leu Val Ala Gln Lys Val Lys Ser Leu Leu Trp Gly 450 455 460Gln Gly Phe Pro Asp Tyr Val Ala Pro Phe Gly Asn Ser Gln Ala Gln465 470 475 480Asp Met Leu Asp Trp Val Pro Ile His Phe Ile Thr Gln Ser Phe Asn 485 490 495Arg Lys His Phe Val Leu Gln Asp Ser Cys Gln Leu Pro Gly Ala Leu 500 505 510Val Ile Glu Val Lys Trp Thr Lys Tyr Gly Ser Leu Leu Asn Pro Gln 515 520 525Ala Lys Ile Val Asn Val Thr Ala Asn Leu Ile Ser Ser Ser Phe Pro 530 535 540Glu Ala Asn Ser Gly Asn Glu Arg Thr Ile Leu Ile Ser Thr Ala Val545 550 555 560Thr Phe Val Asp Val Ser Ala Pro Ala Glu Ala Gly Phe Arg Ala Pro 565 570 575Pro Ala Ile Asn Ala Arg Leu Pro Phe Asn Phe Phe Phe Pro Phe Val 580 585 5905573PRTHomo sapiens 5Met Arg Pro Arg Gly Leu Pro Pro Leu Leu Val Val Leu Leu Gly Cys1 5 10 15Trp Ala Ser Val Ser Ala Gln Thr Asp Ala Thr Pro Ala Val Thr Thr 20 25 30Glu Gly Leu Asn Ser Thr Glu Ala Ala Leu Ala Thr Phe Gly Thr Phe 35 40 45Pro Ser Thr Arg Pro Pro Gly Thr Pro Arg Ala Pro Gly Pro Ser Ser 50 55 60Gly Pro Arg Pro Thr Pro Val Thr Asp Val Ala Val Leu Cys Val Cys65 70 75 80Asp Leu Ser Pro Ala Gln Cys Asp Ile Asn Cys Cys Cys Asp Pro Asp 85 90 95Cys Ser Ser Val Asp Phe Ser Val Phe Ser Ala Cys Ser Val Pro Val 100 105 110Val Thr Gly Asp Ser Gln Phe Cys Ser Gln Lys Ala Val Ile Tyr Ser 115 120 125Leu Asn Phe Thr Ala Asn Pro Pro Gln Arg Val Phe Glu Leu Val Asp 130 135 140Gln Ile Asn Pro Ser Ile Phe Cys Ile His Ile Thr Asn Tyr Lys Pro145 150 155 160Ala Leu Ser Phe Ile Asn Pro Glu Val Pro Asp Glu Asn Asn Phe Asp 165 170 175Thr Leu Met Lys Thr Ser Asp Gly Phe Thr Leu Asn Ala Glu Ser Tyr 180 185 190Val Ser Phe Thr Thr Lys Leu Asp Ile Pro Thr Ala Ala Lys Tyr Glu 195 200 205Tyr Gly Val Pro Leu Gln Thr Ser Asp Ser Phe Leu Arg Phe Pro Ser 210 215 220Ser Leu Thr Ser Ser Leu Cys Thr Asp Asn Asn Pro Ala Gly Gln Ala225 230 235 240Tyr Trp Phe Thr Pro Val Ile Pro Ala Leu Trp Glu Ala Glu Ala Arg 245 250 255Gly Ser Leu Glu Val Pro Asp Ser Arg Lys Lys Val Pro Ile Thr Val 260 265 270Gln Ser Ile Val Ile Gln Ser Leu Asn Lys Thr Leu Thr Arg Arg Glu 275 280 285Asp Thr Asp Val Leu Gln Pro Thr Leu Val Asn Ala Gly His Phe Ser 290 295 300Leu Cys Val Asn Val Val Leu Glu Val Lys Tyr Ser Leu Thr Tyr Thr305 310 315 320Asp Ala Gly Glu Val Thr Lys Ala Asp Leu Ser Phe Val Leu Gly Thr 325 330 335Val Ser Ser Val Val Val Pro Leu Gln Gln Lys Phe Glu Ile His Phe 340 345 350Leu Gln Glu Asn Thr Gln Pro Val Pro Leu Ser Gly Asn Pro Gly Tyr 355 360 365Val Val Gly Leu Pro Leu Ala Ala Gly Phe Gln Pro His Lys Gly Ser 370 375 380Gly Ile Ile Gln Thr Thr Asn Arg Tyr Gly Gln Leu Thr Ile Leu His385 390 395 400Ser Thr Thr Glu Gln Asp Cys Leu Ala Leu Glu Gly Val Arg Thr Pro 405 410 415Val Leu Phe Gly Tyr Thr Met Gln Ser Gly Cys Lys Leu Arg Leu Thr 420 425 430Gly Ala Leu Pro Cys Gln Leu Val Ala Gln Lys Val Lys Ser Leu Leu 435 440 445Trp Gly Gln Gly Phe Pro Asp Tyr Val Ala Pro Phe Gly Asn Ser Gln 450 455 460Ala Gln Asp Met Leu Asp Trp Val Pro Ile His Phe Ile Thr Gln Ser465 470 475 480Phe Asn Arg Lys Asp Ser Cys Gln Leu Pro Gly Ala Leu Val Ile Glu 485 490 495Val Lys Trp Thr Lys Tyr Gly Ser Leu Leu Asn Pro Gln Ala Lys Ile 500 505 510Val Asn Val Thr Ala Asn Leu Ile Ser Ser Ser Phe Pro Glu Ala Asn 515 520 525Ser Gly Asn Glu Arg Thr Ile Leu Ile Ser Thr Ala Val Thr Phe Val 530 535 540Asp Val Ser Ala Pro Ala Glu Ala Gly Phe Arg Ala Pro Pro Ala Ile545 550 555 560Asn Ala Arg Leu Pro Phe Asn Phe Phe Phe Pro Phe Val 565 5706587PRTHomo sapiens 6Met Arg Pro Arg Gly Leu Pro Pro Leu Leu Val Val Leu Leu Gly Cys1 5 10 15Trp Ala Ser Val Ser Ala Gln Thr Asp Ala Thr Pro Ala Val Thr Thr

20 25 30Glu Gly Leu Asn Ser Thr Glu Ala Ala Leu Ala Thr Phe Gly Thr Phe 35 40 45Pro Ser Thr Arg Pro Pro Gly Thr Pro Arg Ala Pro Gly Pro Ser Ser 50 55 60Gly Pro Arg Pro Thr Pro Val Thr Asp Val Ala Val Leu Cys Val Cys65 70 75 80Asp Leu Ser Pro Ala Gln Cys Asp Ile Asn Cys Cys Cys Asp Pro Asp 85 90 95Cys Ser Ser Val Asp Phe Ser Val Phe Ser Ala Cys Ser Val Pro Val 100 105 110Val Thr Gly Asp Ser Gln Phe Cys Ser Gln Lys Ala Val Ile Tyr Ser 115 120 125Leu Asn Phe Thr Ala Asn Pro Pro Gln Arg Val Phe Glu Leu Val Asp 130 135 140Gln Ile Asn Pro Ser Ile Phe Cys Ile His Ile Thr Asn Tyr Lys Pro145 150 155 160Ala Leu Ser Phe Ile Asn Pro Glu Val Pro Asp Glu Asn Asn Phe Asp 165 170 175Thr Leu Met Lys Thr Ser Asp Gly Phe Thr Leu Asn Ala Glu Ser Tyr 180 185 190Val Ser Phe Thr Thr Lys Leu Asp Ile Pro Thr Ala Ala Lys Tyr Glu 195 200 205Tyr Gly Val Pro Leu Gln Thr Ser Asp Ser Phe Leu Arg Phe Pro Ser 210 215 220Ser Leu Thr Ser Ser Leu Cys Thr Asp Asn Asn Pro Ala Ala Phe Leu225 230 235 240Val Asn Gln Ala Val Lys Cys Thr Arg Lys Ile Asn Leu Glu Gln Cys 245 250 255Glu Glu Ile Glu Ala Leu Ser Met Ala Phe Tyr Ser Ser Pro Glu Ile 260 265 270Leu Arg Val Pro Asp Ser Arg Lys Lys Val Pro Ile Thr Val Gln Ser 275 280 285Ile Val Ile Gln Ser Leu Asn Lys Thr Leu Thr Arg Arg Glu Asp Thr 290 295 300Asp Val Leu Gln Pro Thr Leu Val Asn Ala Gly His Phe Ser Leu Cys305 310 315 320Val Asn Val Val Leu Glu Val Lys Tyr Ser Leu Thr Tyr Thr Asp Ala 325 330 335Gly Glu Val Thr Lys Ala Asp Leu Ser Phe Val Leu Gly Thr Val Ser 340 345 350Ser Val Val Val Pro Leu Gln Gln Lys Phe Glu Ile His Phe Leu Gln 355 360 365Glu Asn Thr Gln Pro Val Pro Leu Ser Gly Asn Pro Gly Tyr Val Val 370 375 380Gly Leu Pro Leu Ala Ala Gly Phe Gln Pro His Lys Gly Ser Gly Ile385 390 395 400Ile Gln Thr Thr Asn Arg Tyr Gly Gln Leu Thr Ile Leu His Ser Thr 405 410 415Thr Glu Gln Asp Cys Leu Ala Leu Glu Gly Val Arg Thr Pro Val Leu 420 425 430Phe Gly Tyr Thr Met Gln Ser Gly Cys Lys Leu Arg Leu Thr Gly Ala 435 440 445Leu Pro Cys Gln Leu Val Ala Gln Lys Val Lys Ser Leu Leu Trp Gly 450 455 460Gln Gly Phe Pro Asp Tyr Val Ala Pro Phe Gly Asn Ser Gln Ala Gln465 470 475 480Asp Met Leu Asp Trp Val Pro Ile His Phe Ile Thr Gln Ser Phe Asn 485 490 495Arg Lys Asp Ser Cys Gln Leu Pro Gly Ala Leu Val Ile Glu Val Lys 500 505 510Trp Thr Lys Tyr Gly Ser Leu Leu Asn Pro Gln Ala Lys Ile Val Asn 515 520 525Val Thr Ala Asn Leu Ile Ser Ser Ser Phe Pro Glu Ala Asn Ser Gly 530 535 540Asn Glu Arg Thr Ile Leu Ile Ser Thr Ala Val Thr Phe Val Asp Val545 550 555 560Ser Ala Pro Ala Glu Ala Gly Phe Arg Ala Pro Pro Ala Ile Asn Ala 565 570 575Arg Leu Pro Phe Asn Phe Phe Phe Pro Phe Val 580 5857573PRTHomo sapiens 7Met Arg Pro Arg Gly Leu Pro Pro Leu Leu Val Val Leu Leu Gly Cys1 5 10 15Trp Ala Ser Val Ser Ala Gln Thr Asp Ala Thr Pro Ala Val Thr Thr 20 25 30Glu Gly Leu Asn Ser Thr Glu Ala Ala Leu Ala Thr Phe Gly Thr Phe 35 40 45Pro Ser Thr Arg Pro Pro Gly Thr Pro Arg Ala Pro Gly Pro Ser Ser 50 55 60Gly Pro Arg Pro Thr Pro Val Thr Asp Val Ala Val Leu Cys Val Cys65 70 75 80Asp Leu Ser Pro Ala Gln Cys Asp Ile Asn Cys Cys Cys Asp Pro Asp 85 90 95Cys Ser Ser Val Asp Phe Ser Val Phe Ser Ala Cys Ser Val Pro Val 100 105 110Val Thr Gly Asp Ser Gln Phe Cys Ser Gln Lys Ala Val Ile Tyr Ser 115 120 125Leu Asn Phe Thr Ala Asn Pro Pro Gln Arg Val Phe Glu Leu Val Asp 130 135 140Gln Ile Asn Pro Ser Ile Phe Cys Ile His Ile Thr Asn Tyr Lys Pro145 150 155 160Ala Leu Ser Phe Ile Asn Pro Glu Val Pro Asp Glu Asn Asn Phe Asp 165 170 175Thr Leu Met Lys Thr Ser Asp Gly Phe Thr Leu Asn Ala Glu Ser Tyr 180 185 190Val Ser Phe Thr Thr Lys Leu Asp Ile Pro Thr Ala Ala Lys Tyr Glu 195 200 205Tyr Gly Val Pro Leu Gln Thr Ser Asp Ser Phe Leu Arg Phe Pro Ser 210 215 220Ser Leu Thr Ser Ser Leu Cys Thr Asp Asn Asn Pro Ala Gly Gln Ala225 230 235 240Tyr Trp Phe Thr Pro Val Ile Pro Ala Leu Trp Glu Ala Glu Ala Arg 245 250 255Gly Ser Leu Glu Val Pro Asp Ser Arg Lys Lys Val Pro Ile Thr Val 260 265 270Gln Ser Ile Val Ile Gln Ser Leu Asn Lys Thr Leu Thr Arg Arg Glu 275 280 285Asp Thr Asp Val Leu Gln Pro Thr Leu Val Asn Ala Gly His Phe Ser 290 295 300Leu Cys Val Asn Val Val Leu Glu Val Lys Tyr Ser Leu Thr Tyr Thr305 310 315 320Asp Ala Gly Glu Val Thr Lys Ala Asp Leu Ser Phe Val Leu Gly Thr 325 330 335Val Ser Ser Val Val Val Pro Leu Gln Gln Lys Phe Glu Ile His Phe 340 345 350Leu Gln Glu Asn Thr Gln Pro Val Pro Leu Ser Gly Asn Pro Gly Tyr 355 360 365Val Val Gly Leu Pro Leu Ala Ala Gly Phe Gln Pro His Lys Met Ser 370 375 380Gly Ile Ile Gln Thr Thr Asn Arg Tyr Gly Gln Leu Thr Ile Leu His385 390 395 400Ser Thr Thr Glu Gln Asp Cys Leu Ala Leu Glu Gly Val Arg Thr Pro 405 410 415Val Leu Phe Gly Tyr Thr Met Gln Ser Gly Cys Lys Leu Arg Leu Thr 420 425 430Gly Ala Leu Pro Cys Gln Leu Val Ala Gln Lys Val Lys Ser Leu Leu 435 440 445Trp Gly Gln Gly Phe Pro Asp Tyr Val Ala Pro Phe Gly Asn Ser Gln 450 455 460Ala Gln Asp Met Leu Asp Trp Val Pro Ile His Phe Ile Thr Gln Ser465 470 475 480Phe Asn Arg Lys Asp Ser Cys Gln Leu Pro Gly Ala Leu Val Ile Glu 485 490 495Val Lys Trp Thr Lys Tyr Gly Ser Leu Leu Asn Pro Gln Ala Lys Ile 500 505 510Val Asn Val Thr Ala Asn Leu Ile Ser Ser Ser Phe Pro Glu Ala Asn 515 520 525Ser Gly Asn Glu Arg Thr Ile Leu Ile Ser Thr Ala Val Thr Phe Val 530 535 540Asp Val Ser Ala Pro Ala Glu Ala Gly Phe Arg Ala Pro Pro Ala Ile545 550 555 560Asn Ala Arg Leu Pro Phe Asn Phe Phe Phe Pro Phe Val 565 5708592PRTHomo sapiens 8Met Arg Pro Arg Gly Leu Pro Pro Leu Leu Val Val Leu Leu Gly Cys1 5 10 15Trp Ala Ser Val Ser Ala Gln Thr Asp Ala Thr Pro Ala Val Thr Thr 20 25 30Glu Gly Leu Asn Ser Thr Glu Ala Ala Leu Ala Thr Phe Gly Thr Phe 35 40 45Pro Ser Thr Arg Pro Pro Gly Thr Pro Arg Ala Pro Gly Pro Ser Ser 50 55 60Gly Pro Arg Pro Thr Pro Val Thr Asp Val Ala Val Leu Cys Val Cys65 70 75 80Asp Leu Ser Pro Ala Gln Cys Asp Ile Asn Cys Cys Cys Asp Pro Asp 85 90 95Cys Ser Ser Val Asp Phe Ser Val Phe Ser Ala Cys Ser Val Pro Val 100 105 110Val Thr Gly Asp Ser Gln Phe Cys Ser Gln Lys Ala Val Ile Tyr Ser 115 120 125Leu Asn Phe Thr Ala Asn Pro Pro Gln Arg Val Phe Glu Leu Val Asp 130 135 140Gln Ile Asn Pro Ser Ile Phe Cys Ile His Ile Thr Asn Tyr Lys Pro145 150 155 160Ala Leu Ser Phe Ile Asn Pro Glu Val Pro Asp Glu Asn Asn Phe Asp 165 170 175Thr Leu Met Lys Thr Ser Asp Gly Phe Thr Leu Asn Ala Glu Ser Tyr 180 185 190Val Ser Phe Thr Thr Lys Leu Asp Ile Pro Thr Ala Ala Lys Tyr Glu 195 200 205Tyr Gly Val Pro Leu Gln Thr Ser Asp Ser Phe Leu Arg Phe Pro Ser 210 215 220Ser Leu Thr Ser Ser Leu Cys Thr Asp Asn Asn Pro Ala Ala Phe Leu225 230 235 240Val Asn Gln Ala Val Lys Cys Thr Arg Lys Ile Asn Leu Glu Gln Cys 245 250 255Glu Glu Ile Glu Ala Leu Ser Met Ala Phe Tyr Ser Ser Pro Glu Ile 260 265 270Leu Arg Val Pro Asp Ser Arg Lys Lys Val Pro Ile Thr Val Gln Ser 275 280 285Ile Val Ile Gln Ser Leu Asn Lys Thr Leu Thr Arg Arg Glu Asp Thr 290 295 300Asp Val Leu Gln Pro Thr Leu Val Asn Ala Gly His Phe Ser Leu Cys305 310 315 320Val Asn Val Val Leu Glu Val Lys Tyr Ser Leu Thr Tyr Thr Asp Ala 325 330 335Gly Glu Val Thr Lys Ala Asp Leu Ser Phe Val Leu Gly Thr Val Ser 340 345 350Ser Val Val Val Pro Leu Gln Gln Lys Phe Glu Ile His Phe Leu Gln 355 360 365Glu Asn Thr Gln Pro Val Pro Leu Ser Gly Asn Pro Gly Tyr Val Val 370 375 380Gly Leu Pro Leu Ala Ala Gly Phe Gln Pro His Lys Met Ser Gly Ile385 390 395 400Ile Gln Thr Thr Asn Arg Tyr Gly Gln Leu Thr Ile Leu His Ser Thr 405 410 415Thr Glu Gln Asp Cys Leu Ala Leu Glu Gly Val Arg Thr Pro Val Leu 420 425 430Phe Gly Tyr Thr Met Gln Ser Gly Cys Lys Leu Arg Leu Thr Gly Ala 435 440 445Leu Pro Cys Gln Leu Val Ala Gln Lys Val Lys Ser Leu Leu Trp Gly 450 455 460Gln Gly Phe Pro Asp Tyr Val Ala Pro Phe Gly Asn Ser Gln Ala Gln465 470 475 480Asp Met Leu Asp Trp Val Pro Ile His Phe Ile Thr Gln Ser Phe Asn 485 490 495Arg Lys His Phe Val Leu Gln Asp Ser Cys Gln Leu Pro Gly Ala Leu 500 505 510Val Ile Glu Val Lys Trp Thr Lys Tyr Gly Ser Leu Leu Asn Pro Gln 515 520 525Ala Lys Ile Val Asn Val Thr Ala Asn Leu Ile Ser Ser Ser Phe Pro 530 535 540Glu Ala Asn Ser Gly Asn Glu Arg Thr Ile Leu Ile Ser Thr Ala Val545 550 555 560Thr Phe Val Asp Val Ser Ala Pro Ala Glu Ala Gly Phe Arg Ala Pro 565 570 575Pro Ala Ile Asn Ala Arg Leu Pro Phe Asn Phe Phe Phe Pro Phe Val 580 585 5909697PRTHomo sapiens 9Met Gly Phe Gln Pro Pro Ala Ala Leu Leu Leu Arg Leu Phe Leu Leu1 5 10 15Gln Gly Ile Leu Arg Leu Leu Trp Gly Asp Leu Ala Phe Ile Pro Pro 20 25 30Phe Ile Arg Met Ser Gly Pro Ala Val Ser Ala Ser Leu Val Gly Asp 35 40 45Thr Glu Gly Val Thr Val Ser Leu Ala Val Leu Gln Asp Glu Ala Gly 50 55 60Ile Leu Pro Ile Pro Thr Cys Gly Val Leu Asn Asn Glu Thr Glu Asp65 70 75 80Trp Ser Val Thr Val Ile Pro Gly Ala Lys Val Leu Glu Val Thr Val 85 90 95Arg Trp Lys Arg Gly Leu Asp Trp Cys Ser Ser Asn Glu Thr Asp Ser 100 105 110Phe Ser Glu Ser Pro Cys Ile Leu Gln Thr Leu Leu Val Ser Ala Ser 115 120 125His Asn Ser Ser Cys Ser Ala His Leu Leu Ile Gln Val Glu Ile Tyr 130 135 140Ala Asn Ser Ser Leu Thr His Asn Ala Ser Glu Asn Val Thr Val Ile145 150 155 160Pro Asn Gln Val Tyr Gln Pro Leu Gly Pro Cys Pro Cys Asn Leu Thr 165 170 175Ala Gly Ala Cys Asp Val Arg Cys Cys Cys Asp Gln Glu Cys Ser Ser 180 185 190Asn Leu Thr Thr Leu Phe Arg Arg Ser Cys Phe Thr Gly Val Phe Gly 195 200 205Gly Asp Val Asn Pro Pro Phe Asp Gln Leu Cys Ser Ala Gly Thr Thr 210 215 220Thr Arg Gly Val Pro Asp Trp Phe Pro Phe Leu Cys Val Gln Ser Pro225 230 235 240Leu Ala Asn Thr Pro Phe Leu Gly Tyr Phe Tyr His Gly Ala Val Ser 245 250 255Pro Lys Gln Asp Ser Ser Phe Glu Val Tyr Val Asp Thr Asp Ala Lys 260 265 270Asp Phe Ala Asp Phe Gly Tyr Lys Gln Gly Asp Pro Ile Met Thr Val 275 280 285Lys Lys Ala Tyr Phe Thr Ile Pro Gln Val Ser Leu Ala Gly Gln Cys 290 295 300Met Gln Asn Ala Pro Val Ala Phe Leu His Asn Phe Asp Val Lys Cys305 310 315 320Val Thr Asn Leu Glu Leu Tyr Gln Glu Arg Asp Gly Ile Ile Asn Ala 325 330 335Lys Ile Lys Asn Val Ala Leu Gly Gly Ile Val Thr Pro Lys Val Ile 340 345 350Tyr Glu Glu Ala Thr Asp Leu Asp Lys Phe Ile Thr Asn Thr Glu Thr 355 360 365Pro Leu Asn Asn Gly Ser Thr Pro Arg Ile Val Asn Val Glu Glu His 370 375 380Tyr Ile Phe Lys Trp Asn Asn Asn Thr Ile Ser Glu Ile Asn Val Lys385 390 395 400Ile Phe Arg Ala Glu Ile Asn Ala His Gln Lys Gly Ile Met Thr Gln 405 410 415Arg Phe Val Val Lys Phe Leu Ser Tyr Asn Ser Gly Asn Glu Glu Glu 420 425 430Leu Ser Gly Asn Pro Gly Tyr Gln Leu Gly Lys Pro Val Arg Ala Leu 435 440 445Asn Ile Asn Arg Met Asn Asn Val Thr Thr Leu His Leu Trp Gln Ser 450 455 460Ala Gly Arg Gly Leu Cys Thr Ser Ala Thr Phe Lys Pro Ile Leu Phe465 470 475 480Gly Glu Asn Val Leu Ser Gly Cys Leu Leu Glu Val Gly Ile Asn Glu 485 490 495Asn Cys Thr Gln Leu Arg Glu Asn Ala Val Glu Arg Leu Asp Ser Leu 500 505 510Ile Gln Ala Thr His Val Ala Met Arg Gly Asn Ser Asp Tyr Ala Asp 515 520 525Leu Ser Asp Gly Trp Leu Glu Ile Ile Arg Val Asp Ala Pro Asp Pro 530 535 540Gly Ala Asp Pro Leu Ala Ser Ser Val Asn Gly Met Cys Leu Asp Ile545 550 555 560Pro Ala His Leu Ser Ile Arg Ile Leu Ile Ser Asp Ala Gly Ala Val 565 570 575Glu Gly Ile Thr Gln Gln Glu Ile Leu Gly Val Glu Thr Arg Phe Ser 580 585 590Ser Val Asn Trp Gln Tyr Gln Cys Gly Leu Thr Cys Glu His Lys Ala 595 600 605Asp Leu Leu Pro Ile Ser Ala Ser Val Gln Phe Ile Lys Ile Pro Ala 610 615 620Gln Leu Pro His Pro Leu Thr Arg Phe Gln Ile Asn Tyr Thr Glu Tyr625 630 635 640Asp Cys Asn Arg Asn Glu Val Cys Trp Pro Gln Leu Leu Tyr Pro Trp 645 650 655Thr Gln Tyr Tyr Gln Gly Glu Leu His Ser Gln Cys Val Ala Lys Gly 660 665 670Leu Leu Leu Leu Leu Phe Leu Thr Leu Ala Leu Phe Leu Ser Asn Pro 675 680 685Trp Thr Arg Ile Cys Lys Ala Tyr Ser 690 69510625PRTHomo sapiens 10Met Arg Leu Glu Thr Ala Glu Ala Tyr Val Gly Pro Gly Gly Pro Glu1 5 10 15Cys Pro Met Arg Thr Pro Gln Leu Ala Leu Leu Gln Val Phe Phe Leu 20 25 30Val Phe Pro Asp Gly Val Arg Pro Gln Pro Ser Ser Ser Pro

Ser Gly 35 40 45Ala Val Pro Thr Ser Leu Glu Leu Gln Arg Gly Thr Asp Gly Gly Thr 50 55 60Leu Gln Ser Pro Ser Glu Ala Thr Ala Thr Arg Pro Ala Val Pro Gly65 70 75 80Leu Pro Thr Val Val Pro Thr Leu Val Thr Pro Ser Ala Pro Gly Asn 85 90 95Arg Thr Val Asp Leu Phe Pro Val Leu Pro Ile Cys Val Cys Asp Leu 100 105 110Thr Pro Gly Ala Cys Asp Ile Asn Cys Cys Cys Asp Arg Asp Cys Tyr 115 120 125Leu Leu His Pro Arg Thr Val Phe Ser Phe Cys Leu Pro Gly Ser Val 130 135 140Arg Ser Ser Ser Trp Val Cys Val Asp Asn Ser Val Ile Phe Arg Ser145 150 155 160Asn Ser Pro Phe Pro Ser Arg Val Phe Met Asp Ser Asn Gly Ile Arg 165 170 175Gln Phe Cys Val His Val Asn Asn Ser Asn Leu Asn Tyr Phe Gln Lys 180 185 190Leu Gln Lys Val Asn Ala Thr Asn Phe Gln Ala Leu Ala Ala Glu Phe 195 200 205Gly Gly Glu Ser Phe Thr Ser Thr Phe Gln Thr Gln Ser Pro Pro Ser 210 215 220Phe Tyr Arg Ala Gly Asp Pro Ile Leu Thr Tyr Phe Pro Lys Trp Ser225 230 235 240Val Ile Ser Leu Leu Arg Gln Pro Ala Gly Val Gly Ala Gly Gly Leu 245 250 255Cys Ala Glu Ser Asn Pro Ala Gly Phe Leu Glu Ser Lys Ser Thr Thr 260 265 270Cys Thr Arg Phe Phe Lys Asn Leu Ala Ser Ser Cys Thr Leu Asp Ser 275 280 285Ala Leu Asn Ala Ala Ser Tyr Tyr Asn Phe Thr Val Leu Lys Val Pro 290 295 300Arg Ser Met Thr Asp Pro Gln Asn Met Glu Phe Gln Val Pro Val Ile305 310 315 320Leu Thr Ser Gln Ala Asn Ala Pro Leu Leu Ala Gly Asn Thr Cys Gln 325 330 335Asn Val Val Ser Gln Val Thr Tyr Glu Ile Glu Thr Asn Gly Thr Phe 340 345 350Gly Ile Gln Lys Val Ser Val Ser Leu Gly Gln Thr Asn Leu Thr Val 355 360 365Glu Pro Gly Ala Ser Leu Gln Gln His Phe Ile Leu Arg Phe Arg Ala 370 375 380Phe Gln Gln Ser Thr Ala Ala Ser Leu Thr Ser Pro Arg Ser Gly Asn385 390 395 400Pro Gly Tyr Ile Val Gly Lys Pro Leu Leu Ala Leu Thr Asp Asp Ile 405 410 415Ser Tyr Ser Met Thr Leu Leu Gln Ser Gln Gly Asn Gly Ser Cys Ser 420 425 430Val Lys Arg His Glu Val Gln Phe Gly Val Asn Ala Ile Ser Gly Cys 435 440 445Lys Leu Arg Leu Lys Lys Ala Asp Cys Ser His Leu Gln Gln Glu Ile 450 455 460Tyr Gln Thr Leu His Gly Arg Pro Arg Pro Glu Tyr Val Ala Ile Phe465 470 475 480Gly Asn Ala Asp Pro Ala Gln Lys Gly Gly Trp Thr Arg Ile Leu Asn 485 490 495Arg His Cys Ser Ile Ser Ala Ile Asn Cys Thr Ser Cys Cys Leu Ile 500 505 510Pro Val Ser Leu Glu Ile Gln Val Leu Trp Ala Tyr Val Gly Leu Leu 515 520 525Ser Asn Pro Gln Ala His Val Ser Gly Val Arg Phe Leu Tyr Gln Cys 530 535 540Gln Ser Ile Gln Asp Ser Gln Gln Val Thr Glu Val Ser Leu Thr Thr545 550 555 560Leu Val Asn Phe Val Asp Ile Thr Gln Lys Pro Gln Pro Pro Arg Gly 565 570 575Gln Pro Lys Met Asp Trp Lys Trp Pro Phe Asp Phe Phe Pro Phe Lys 580 585 590Val Ala Phe Ser Arg Gly Val Phe Ser Gln Lys Cys Ser Val Ser Pro 595 600 605Ile Leu Ile Leu Cys Leu Leu Leu Leu Gly Val Leu Asn Leu Glu Thr 610 615 620Met62511429PRTHomo sapiens 11Met Asp Ser Asn Gly Ile Arg Gln Phe Cys Val His Val Asn Asn Ser1 5 10 15Asn Leu Asn Tyr Phe Gln Lys Leu Gln Lys Val Asn Ala Thr Asn Phe 20 25 30Gln Ala Leu Ala Ala Glu Phe Gly Gly Glu Ser Phe Thr Ser Thr Phe 35 40 45Gln Thr Gln Ser Pro Pro Ser Phe Tyr Arg Ala Gly Asp Pro Ile Leu 50 55 60Thr Tyr Phe Pro Lys Trp Ser Val Ile Ser Leu Leu Arg Gln Pro Ala65 70 75 80Gly Val Gly Ala Gly Gly Leu Cys Ala Glu Ser Asn Pro Ala Gly Phe 85 90 95Leu Glu Ser Lys Ser Thr Thr Cys Thr Arg Phe Phe Lys Asn Leu Ala 100 105 110Ser Ser Cys Thr Leu Asp Ser Ala Leu Asn Ala Ala Ser Tyr Tyr Asn 115 120 125Phe Thr Val Leu Lys Val Pro Arg Ser Met Thr Asp Pro Gln Asn Met 130 135 140Glu Val Thr Tyr Glu Ile Glu Thr Asn Gly Thr Phe Gly Ile Gln Lys145 150 155 160Val Ser Val Ser Leu Gly Gln Thr Asn Leu Thr Val Glu Pro Gly Ala 165 170 175Ser Leu Gln Gln His Phe Ile Leu Arg Phe Arg Ala Phe Gln Gln Ser 180 185 190Thr Ala Ala Ser Leu Thr Ser Pro Arg Ser Gly Asn Pro Gly Tyr Ile 195 200 205Val Gly Lys Pro Leu Leu Ala Leu Thr Asp Asp Ile Ser Tyr Ser Met 210 215 220Thr Leu Leu Gln Ser Gln Gly Asn Gly Ser Cys Ser Val Lys Arg His225 230 235 240Glu Val Gln Phe Gly Val Asn Ala Ile Ser Gly Cys Lys Leu Arg Leu 245 250 255Lys Lys Ala Asp Cys Ser His Leu Gln Gln Glu Ile Tyr Gln Thr Leu 260 265 270His Gly Arg Pro Arg Pro Glu Tyr Val Ala Ile Phe Gly Asn Ala Asp 275 280 285Pro Ala Gln Lys Gly Gly Trp Thr Arg Ile Leu Asn Arg His Cys Ser 290 295 300Ile Ser Ala Ile Asn Cys Thr Ser Cys Cys Leu Ile Pro Val Ser Leu305 310 315 320Glu Ile Gln Val Leu Trp Ala Tyr Val Gly Leu Leu Ser Asn Pro Gln 325 330 335Ala His Val Ser Gly Val Arg Phe Leu Tyr Gln Cys Gln Ser Ile Gln 340 345 350Asp Ser Gln Gln Val Thr Glu Val Ser Leu Thr Thr Leu Val Asn Phe 355 360 365Val Asp Ile Thr Gln Lys Pro Gln Pro Pro Arg Gly Gln Pro Lys Met 370 375 380Asp Trp Lys Trp Pro Phe Asp Phe Phe Pro Phe Lys Val Ala Phe Ser385 390 395 400Arg Gly Val Phe Ser Gln Lys Cys Ser Val Ser Pro Ile Leu Ile Leu 405 410 415Cys Leu Leu Leu Leu Gly Val Leu Asn Leu Glu Thr Met 420 42512443PRTHomo sapiens 12Met Arg Thr Pro Gln Leu Ala Leu Leu Gln Val Phe Phe Leu Val Phe1 5 10 15Pro Asp Gly Val Arg Pro Gln Pro Ser Ser Ser Pro Ser Gly Ala Val 20 25 30Pro Thr Ser Leu Glu Leu Gln Arg Gly Thr Asp Gly Gly Thr Leu Gln 35 40 45Ser Pro Ser Glu Ala Thr Ala Thr Arg Pro Ala Val Pro Gly Leu Pro 50 55 60Thr Val Val Pro Thr Leu Val Thr Pro Ser Ala Pro Gly Asn Arg Thr65 70 75 80Val Asp Leu Phe Pro Val Leu Pro Ile Cys Val Cys Asp Leu Thr Pro 85 90 95Gly Ala Cys Asp Ile Asn Cys Cys Cys Asp Arg Asp Cys Tyr Leu Leu 100 105 110His Pro Arg Thr Val Phe Ser Phe Cys Leu Pro Gly Ser Val Arg Ser 115 120 125Ser Ser Trp Val Cys Val Asp Asn Ser Val Ile Phe Arg Ser Asn Ser 130 135 140Pro Phe Pro Ser Arg Val Phe Met Asp Ser Asn Gly Ile Arg Gln Phe145 150 155 160Cys Val His Val Asn Asn Ser Asn Leu Asn Tyr Phe Gln Lys Leu Gln 165 170 175Lys Val Asn Ala Thr Asn Phe Gln Ala Leu Ala Ala Glu Phe Gly Gly 180 185 190Glu Ser Phe Thr Ser Thr Phe Gln Thr Gln Ser Pro Pro Ser Phe Tyr 195 200 205Arg Ala Gly Asp Pro Ile Leu Thr Tyr Phe Pro Lys Trp Ser Val Ile 210 215 220Ser Leu Leu Arg Gln Pro Ala Gly Val Gly Ala Gly Gly Leu Cys Ala225 230 235 240Glu Ser Asn Pro Ala Gly Phe Leu Glu Ser Lys Ser Thr Thr Cys Thr 245 250 255Arg Phe Phe Lys Asn Leu Ala Ser Ser Cys Thr Leu Asp Ser Ala Leu 260 265 270Asn Ala Ala Ser Tyr Tyr Asn Phe Thr Val Leu Lys Val Pro Arg Ser 275 280 285Met Thr Asp Pro Gln Asn Met Glu Phe Gln Val Pro Val Ile Leu Thr 290 295 300Ser Gln Ala Asn Ala Pro Leu Leu Ala Gly Asn Thr Cys Gln Asn Val305 310 315 320Val Ser Gln Val Thr Tyr Glu Ile Glu Thr Asn Gly Thr Phe Gly Ile 325 330 335Gln Lys Val Ser Val Ser Leu Gly Gln Thr Asn Leu Thr Val Glu Pro 340 345 350Gly Ala Ser Leu Gln Gln His Phe Ile Leu Arg Phe Arg Ala Phe Gln 355 360 365Gln Ser Thr Ala Ala Ser Leu Thr Ser Pro Arg Ser Gly Asn Pro Gly 370 375 380Tyr Ile Val Gly Lys Pro Leu Leu Ala Leu Thr Asp Asp Ile Ser Tyr385 390 395 400Ser Val Ser Phe Leu Glu Leu Gly Gly Leu Leu Gln Pro Asn Glu Lys 405 410 415Ser Cys Lys Gly Phe Gln Thr Tyr Val Arg Leu Ala Lys Gly Glu Glu 420 425 430Phe Phe Val His Tyr Asn Glu Val Leu Ile Tyr 435 44013607PRTHomo sapiens 13Met Arg Thr Pro Gln Leu Ala Leu Leu Gln Val Phe Phe Leu Val Phe1 5 10 15Pro Asp Gly Val Arg Pro Gln Pro Ser Ser Ser Pro Ser Gly Ala Val 20 25 30Pro Thr Ser Leu Glu Leu Gln Arg Gly Thr Asp Gly Gly Thr Leu Gln 35 40 45Ser Pro Ser Glu Ala Thr Ala Thr Arg Pro Ala Val Pro Gly Leu Pro 50 55 60Thr Val Val Pro Thr Leu Val Thr Pro Ser Ala Pro Gly Asn Arg Thr65 70 75 80Val Asp Leu Phe Pro Val Leu Pro Ile Cys Val Cys Asp Leu Thr Pro 85 90 95Gly Ala Cys Asp Ile Asn Cys Cys Cys Asp Arg Asp Cys Tyr Leu Leu 100 105 110His Pro Arg Thr Val Phe Ser Phe Cys Leu Pro Gly Ser Val Arg Ser 115 120 125Ser Ser Trp Val Cys Val Asp Asn Ser Val Ile Phe Arg Ser Asn Ser 130 135 140Pro Phe Pro Ser Arg Val Phe Met Asp Ser Asn Gly Ile Arg Gln Phe145 150 155 160Cys Val His Val Asn Asn Ser Asn Leu Asn Tyr Phe Gln Lys Leu Gln 165 170 175Lys Val Asn Ala Thr Asn Phe Gln Ala Leu Ala Ala Glu Phe Gly Gly 180 185 190Glu Ser Phe Thr Ser Thr Phe Gln Thr Gln Ser Pro Pro Ser Phe Tyr 195 200 205Arg Ala Gly Asp Pro Ile Leu Thr Tyr Phe Pro Lys Trp Ser Val Ile 210 215 220Ser Leu Leu Arg Gln Pro Ala Gly Val Gly Ala Gly Gly Leu Cys Ala225 230 235 240Glu Ser Asn Pro Ala Gly Phe Leu Glu Ser Lys Ser Thr Thr Cys Thr 245 250 255Arg Phe Phe Lys Asn Leu Ala Ser Ser Cys Thr Leu Asp Ser Ala Leu 260 265 270Asn Ala Ala Ser Tyr Tyr Asn Phe Thr Val Leu Lys Val Pro Arg Ser 275 280 285Met Thr Asp Pro Gln Asn Met Glu Phe Gln Val Pro Val Ile Leu Thr 290 295 300Ser Gln Ala Asn Ala Pro Leu Leu Ala Gly Asn Thr Cys Gln Asn Val305 310 315 320Val Ser Gln Val Thr Tyr Glu Ile Glu Thr Asn Gly Thr Phe Gly Ile 325 330 335Gln Lys Val Ser Val Ser Leu Gly Gln Thr Asn Leu Thr Val Glu Pro 340 345 350Gly Ala Ser Leu Gln Gln His Phe Ile Leu Arg Phe Arg Ala Phe Gln 355 360 365Gln Ser Thr Ala Ala Ser Leu Thr Ser Pro Arg Ser Gly Asn Pro Gly 370 375 380Tyr Ile Val Gly Lys Pro Leu Leu Ala Leu Thr Asp Asp Ile Ser Tyr385 390 395 400Ser Met Thr Leu Leu Gln Ser Gln Gly Asn Gly Ser Cys Ser Val Lys 405 410 415Arg His Glu Val Gln Phe Gly Val Asn Ala Ile Ser Gly Cys Lys Leu 420 425 430Arg Leu Lys Lys Ala Asp Cys Ser His Leu Gln Gln Glu Ile Tyr Gln 435 440 445Thr Leu His Gly Arg Pro Arg Pro Glu Tyr Val Ala Ile Phe Gly Asn 450 455 460Ala Asp Pro Ala Gln Lys Gly Gly Trp Thr Arg Ile Leu Asn Arg His465 470 475 480Cys Ser Ile Ser Ala Ile Asn Cys Thr Ser Cys Cys Leu Ile Pro Val 485 490 495Ser Leu Glu Ile Gln Val Leu Trp Ala Tyr Val Gly Leu Leu Ser Asn 500 505 510Pro Gln Ala His Val Ser Gly Val Arg Phe Leu Tyr Gln Cys Gln Ser 515 520 525Ile Gln Asp Ser Gln Gln Val Thr Glu Val Ser Leu Thr Thr Leu Val 530 535 540Asn Phe Val Asp Ile Thr Gln Lys Pro Gln Pro Pro Arg Gly Gln Pro545 550 555 560Lys Met Asp Trp Lys Trp Pro Phe Asp Phe Phe Pro Phe Lys Val Ala 565 570 575Phe Ser Arg Gly Val Phe Ser Gln Lys Cys Ser Val Ser Pro Ile Leu 580 585 590Ile Leu Cys Leu Leu Leu Leu Gly Val Leu Asn Leu Glu Thr Met 595 600 60514106PRTHomo sapiens 14Met Ala Thr Pro Gly Pro Val Ile Pro Glu Val Pro Phe Glu Pro Ser1 5 10 15Lys Pro Pro Val Ile Glu Gly Leu Ser Pro Thr Val Tyr Arg Asn Pro 20 25 30Glu Ser Phe Lys Glu Lys Phe Val Arg Lys Thr Arg Glu Asn Pro Val 35 40 45Val Pro Ile Gly Cys Leu Ala Thr Ala Ala Ala Leu Thr Tyr Gly Leu 50 55 60Tyr Ser Phe His Arg Gly Asn Ser Gln Arg Ser Gln Leu Met Met Arg65 70 75 80Thr Arg Ile Ala Ala Gln Gly Phe Thr Val Ala Ala Ile Leu Leu Gly 85 90 95Leu Ala Val Thr Ala Met Lys Ser Arg Pro 100 10515106PRTHomo sapiens 15Met Ala Thr Leu Gly Phe Val Thr Pro Glu Ala Pro Phe Glu Ser Ser1 5 10 15Lys Pro Pro Ile Phe Glu Gly Leu Ser Pro Thr Val Tyr Ser Asn Pro 20 25 30Glu Gly Phe Lys Glu Lys Phe Leu Arg Lys Thr Arg Glu Asn Pro Val 35 40 45Val Pro Ile Gly Phe Leu Cys Thr Ala Ala Val Leu Thr Asn Gly Leu 50 55 60Tyr Cys Phe His Gln Gly Asn Ser Gln Cys Ser Arg Leu Met Met His65 70 75 80Thr Gln Ile Ala Ala Gln Gly Phe Thr Ile Ala Ala Ile Leu Leu Gly 85 90 95Leu Ala Ala Thr Ala Met Lys Ser Pro Pro 100 10516132PRTHomo sapiens 16Met Cys Ser Ala Gly Glu Leu Leu Arg Gly Gly Asp Gly Gly Glu Arg1 5 10 15Asp Glu Asp Gly Asp Ala Leu Ala Glu Arg Glu Ala Ala Gly Thr Gly 20 25 30Trp Asp Pro Gly Ala Ser Pro Arg Arg Arg Gly Gln Arg Pro Lys Glu 35 40 45Ser Glu Gln Asp Val Glu Asp Ser Gln Asn His Thr Gly Glu Pro Val 50 55 60Gly Asp Asp Tyr Lys Lys Met Gly Thr Leu Phe Gly Glu Leu Asn Lys65 70 75 80Asn Leu Ile Asn Met Gly Phe Thr Arg Met Tyr Phe Gly Glu Arg Ile 85 90 95Val Glu Pro Val Ile Val Ile Phe Phe Trp Val Met Leu Trp Phe Leu 100 105 110Gly Leu Gln Ala Leu Gly Leu Val Ala Val Leu Cys Leu Val Ile Ile 115 120 125Tyr Val Gln Gln 130171104PRTHomo sapiens 17Met Glu Arg Ser Pro Gly Glu Gly Pro Ser Pro Ser Pro Met Asp Gln1 5 10 15Pro Ser Ala Pro Ser Asp Pro Thr Asp Gln Pro Pro Ala Ala His Ala 20 25 30Lys Pro Asp Pro Gly Ser Gly Gly Gln Pro Ala Gly Pro Gly Ala Ala 35 40 45Gly Glu Ala Leu Ala Val Leu

Thr Ser Phe Gly Arg Arg Leu Leu Val 50 55 60Leu Ile Pro Val Tyr Leu Ala Gly Ala Val Gly Leu Ser Val Gly Phe65 70 75 80Val Leu Phe Gly Leu Ala Leu Tyr Leu Gly Trp Arg Arg Val Arg Asp 85 90 95Glu Lys Glu Arg Ser Leu Arg Ala Ala Arg Gln Leu Leu Asp Asp Glu 100 105 110Glu Gln Leu Thr Ala Lys Thr Leu Tyr Met Ser His Arg Glu Leu Pro 115 120 125Ala Trp Val Ser Phe Pro Asp Val Glu Lys Ala Glu Trp Leu Asn Lys 130 135 140Ile Val Ala Gln Val Trp Pro Phe Leu Gly Gln Tyr Met Glu Lys Leu145 150 155 160Leu Ala Glu Thr Val Ala Pro Ala Val Arg Gly Ser Asn Pro His Leu 165 170 175Gln Thr Phe Thr Phe Thr Arg Val Glu Leu Gly Glu Lys Pro Leu Arg 180 185 190Ile Ile Gly Val Lys Val His Pro Gly Gln Arg Lys Glu Gln Ile Leu 195 200 205Leu Asp Leu Asn Ile Ser Tyr Val Gly Asp Val Gln Ile Asp Val Glu 210 215 220Val Lys Lys Tyr Phe Cys Lys Ala Gly Val Lys Gly Met Gln Leu His225 230 235 240Gly Val Leu Arg Val Ile Leu Glu Pro Leu Ile Gly Asp Leu Pro Phe 245 250 255Val Gly Ala Val Ser Met Phe Phe Ile Arg Arg Pro Thr Leu Asp Ile 260 265 270Asn Trp Thr Gly Met Thr Asn Leu Leu Asp Ile Pro Gly Leu Ser Ser 275 280 285Leu Ser Asp Thr Met Ile Met Asp Ser Ile Ala Ala Phe Leu Val Leu 290 295 300Pro Asn Arg Leu Leu Val Pro Leu Val Pro Asp Leu Gln Asp Val Ala305 310 315 320Gln Leu Arg Ser Pro Leu Pro Arg Gly Ile Ile Arg Ile His Leu Leu 325 330 335Ala Ala Arg Gly Leu Ser Ser Lys Asp Lys Tyr Val Lys Gly Leu Ile 340 345 350Glu Gly Lys Ser Asp Pro Tyr Ala Leu Val Arg Leu Gly Thr Gln Thr 355 360 365Phe Cys Ser Arg Val Ile Asp Glu Glu Leu Asn Pro Gln Trp Gly Glu 370 375 380Thr Tyr Glu Val Met Val His Glu Val Pro Gly Gln Glu Ile Glu Val385 390 395 400Glu Val Phe Asp Lys Asp Pro Asp Lys Asp Asp Phe Leu Gly Arg Met 405 410 415Lys Leu Asp Val Gly Lys Val Leu Gln Ala Ser Val Leu Asp Asp Trp 420 425 430Phe Pro Leu Gln Gly Gly Gln Gly Gln Val His Leu Arg Leu Glu Trp 435 440 445Leu Ser Leu Leu Ser Asp Ala Glu Lys Leu Glu Gln Val Leu Gln Trp 450 455 460Asn Trp Gly Val Ser Ser Arg Pro Asp Pro Pro Ser Ala Ala Ile Leu465 470 475 480Val Val Tyr Leu Asp Arg Ala Gln Asp Leu Pro Leu Lys Lys Gly Asn 485 490 495Lys Glu Pro Asn Pro Met Val Gln Leu Ser Ile Gln Asp Val Thr Gln 500 505 510Glu Ser Lys Ala Val Tyr Ser Thr Asn Cys Pro Val Trp Glu Glu Ala 515 520 525Phe Arg Phe Phe Leu Gln Asp Pro Gln Ser Gln Glu Leu Asp Val Gln 530 535 540Val Lys Asp Asp Ser Arg Ala Leu Thr Leu Gly Ala Leu Thr Leu Pro545 550 555 560Leu Ala Arg Leu Leu Thr Ala Pro Glu Leu Ile Leu Asp Gln Trp Phe 565 570 575Gln Leu Ser Ser Ser Gly Pro Asn Ser Arg Leu Tyr Met Lys Leu Val 580 585 590Met Arg Ile Leu Tyr Leu Asp Ser Ser Glu Ile Cys Phe Pro Thr Val 595 600 605Pro Gly Cys Pro Gly Ala Trp Asp Val Asp Ser Glu Asn Pro Gln Arg 610 615 620Gly Ser Ser Val Asp Ala Pro Pro Arg Pro Cys His Thr Thr Pro Asp625 630 635 640Ser Gln Phe Gly Thr Glu His Val Leu Arg Ile His Val Leu Glu Ala 645 650 655Gln Asp Leu Ile Ala Lys Asp Arg Phe Leu Gly Gly Leu Val Lys Gly 660 665 670Lys Ser Asp Pro Tyr Val Lys Leu Lys Leu Ala Gly Arg Ser Phe Arg 675 680 685Ser His Val Val Arg Glu Asp Leu Asn Pro Arg Trp Asn Glu Val Phe 690 695 700Glu Val Ile Val Thr Ser Val Pro Gly Gln Glu Leu Glu Val Glu Val705 710 715 720Phe Asp Lys Asp Leu Asp Lys Asp Asp Phe Leu Gly Arg Cys Lys Val 725 730 735Arg Leu Thr Thr Val Leu Asn Ser Gly Phe Leu Asp Glu Trp Leu Thr 740 745 750Leu Glu Asp Val Pro Ser Gly Arg Leu His Leu Arg Leu Glu Arg Leu 755 760 765Thr Pro Arg Pro Thr Ala Ala Glu Leu Glu Glu Val Leu Gln Val Asn 770 775 780Ser Leu Ile Gln Thr Gln Lys Ser Ala Glu Leu Ala Ala Ala Leu Leu785 790 795 800Ser Ile Tyr Met Glu Arg Ala Glu Asp Leu Pro Leu Arg Lys Gly Thr 805 810 815Lys His Leu Ser Pro Tyr Ala Thr Leu Thr Val Gly Asp Ser Ser His 820 825 830Lys Thr Lys Thr Ile Ser Gln Thr Ser Ala Pro Val Trp Asp Glu Ser 835 840 845Ala Ser Phe Leu Ile Arg Lys Pro His Thr Glu Ser Leu Glu Leu Gln 850 855 860Val Arg Gly Glu Gly Thr Gly Val Leu Gly Ser Leu Ser Leu Pro Leu865 870 875 880Ser Glu Leu Leu Val Ala Asp Gln Leu Cys Leu Asp Arg Trp Phe Thr 885 890 895Leu Ser Ser Gly Gln Gly Gln Val Leu Leu Arg Ala Gln Leu Gly Ile 900 905 910Leu Val Ser Gln His Ser Gly Val Glu Ala His Ser His Ser Tyr Ser 915 920 925His Ser Ser Ser Ser Leu Ser Glu Glu Pro Glu Leu Ser Gly Gly Pro 930 935 940Pro His Ile Thr Ser Ser Ala Pro Glu Leu Arg Gln Arg Leu Thr His945 950 955 960Val Asp Ser Pro Leu Glu Ala Pro Ala Gly Pro Leu Gly Gln Val Lys 965 970 975Leu Thr Leu Trp Tyr Tyr Ser Glu Glu Arg Lys Leu Val Ser Ile Val 980 985 990His Gly Cys Arg Ser Leu Arg Gln Asn Gly Arg Asp Pro Pro Asp Pro 995 1000 1005Tyr Val Ser Leu Leu Leu Leu Pro Asp Lys Asn Arg Gly Thr Lys 1010 1015 1020Arg Arg Thr Ser Gln Lys Lys Arg Thr Leu Ser Pro Glu Phe Asn 1025 1030 1035Glu Arg Phe Glu Trp Glu Leu Pro Leu Asp Glu Ala Gln Arg Arg 1040 1045 1050Lys Leu Asp Val Ser Val Lys Ser Asn Ser Ser Phe Met Ser Arg 1055 1060 1065Glu Arg Glu Leu Leu Gly Lys Val Gln Leu Asp Leu Ala Glu Thr 1070 1075 1080Asp Leu Ser Gln Gly Val Ala Arg Trp Tyr Asp Leu Met Asp Asn 1085 1090 1095Lys Asp Lys Gly Ser Ser 1100181114PRTHomo sapiens 18Met Glu Arg Ser Pro Gly Glu Gly Pro Ser Pro Ser Pro Met Asp Gln1 5 10 15Pro Ser Ala Pro Ser Asp Pro Thr Asp Gln Pro Pro Ala Ala His Ala 20 25 30Lys Pro Asp Pro Gly Ser Gly Gly Gln Pro Ala Gly Pro Gly Ala Ala 35 40 45Gly Glu Ala Leu Ala Val Leu Thr Ser Phe Gly Arg Arg Leu Leu Val 50 55 60Leu Ile Pro Val Tyr Leu Ala Gly Ala Val Gly Leu Ser Val Gly Phe65 70 75 80Val Leu Phe Gly Leu Ala Leu Tyr Leu Gly Trp Arg Arg Val Arg Asp 85 90 95Glu Lys Glu Arg Ser Leu Arg Ala Ala Arg Gln Leu Leu Asp Asp Glu 100 105 110Glu Gln Leu Thr Ala Lys Thr Leu Tyr Met Ser His Arg Glu Leu Pro 115 120 125Ala Trp Val Ser Phe Pro Asp Val Glu Lys Ala Glu Trp Leu Asn Lys 130 135 140Ile Val Ala Gln Val Trp Pro Phe Leu Gly Gln Tyr Met Glu Lys Leu145 150 155 160Leu Ala Glu Thr Val Ala Pro Ala Val Arg Gly Ser Asn Pro His Leu 165 170 175Gln Thr Phe Thr Phe Thr Arg Val Glu Leu Gly Glu Lys Pro Leu Arg 180 185 190Ile Ile Gly Val Lys Val His Pro Gly Gln Arg Lys Glu Gln Ile Leu 195 200 205Leu Asp Leu Asn Ile Ser Tyr Val Gly Asp Val Gln Ile Asp Val Glu 210 215 220Val Lys Lys Tyr Phe Cys Lys Ala Gly Val Lys Gly Met Gln Leu His225 230 235 240Gly Val Leu Arg Val Ile Leu Glu Pro Leu Ile Gly Asp Leu Pro Phe 245 250 255Val Gly Ala Val Ser Met Phe Phe Ile Arg Arg Pro Thr Leu Asp Ile 260 265 270Asn Trp Thr Gly Met Thr Asn Leu Leu Asp Ile Pro Gly Leu Ser Ser 275 280 285Leu Ser Asp Thr Met Ile Met Asp Ser Ile Ala Ala Phe Leu Val Leu 290 295 300Pro Asn Arg Leu Leu Val Pro Leu Val Pro Asp Leu Gln Asp Val Ala305 310 315 320Gln Leu Arg Ser Pro Leu Pro Arg Gly Ile Ile Arg Ile His Leu Leu 325 330 335Ala Ala Arg Gly Leu Ser Ser Lys Asp Lys Tyr Val Lys Gly Leu Ile 340 345 350Glu Gly Lys Ser Asp Pro Tyr Ala Leu Val Arg Leu Gly Thr Gln Thr 355 360 365Phe Cys Ser Arg Val Ile Asp Glu Glu Leu Asn Pro Gln Trp Gly Glu 370 375 380Thr Tyr Glu Val Met Val His Glu Val Pro Gly Gln Glu Ile Glu Val385 390 395 400Glu Val Phe Asp Lys Asp Pro Asp Lys Asp Asp Phe Leu Gly Arg Met 405 410 415Lys Leu Asp Val Gly Lys Val Leu Gln Ala Ser Val Leu Asp Asp Trp 420 425 430Phe Pro Leu Gln Gly Gly Gln Gly Gln Val His Leu Arg Leu Glu Trp 435 440 445Leu Ser Leu Leu Ser Asp Ala Glu Lys Leu Glu Gln Val Leu Gln Trp 450 455 460Asn Trp Gly Val Ser Ser Arg Pro Asp Pro Pro Ser Ala Ala Ile Leu465 470 475 480Val Val Tyr Leu Asp Arg Ala Gln Asp Leu Pro Met Val Thr Ser Glu 485 490 495Leu Tyr Pro Pro Gln Leu Lys Lys Gly Asn Lys Glu Pro Asn Pro Met 500 505 510Val Gln Leu Ser Ile Gln Asp Val Thr Gln Glu Ser Lys Ala Val Tyr 515 520 525Ser Thr Asn Cys Pro Val Trp Glu Glu Ala Phe Arg Phe Phe Leu Gln 530 535 540Asp Pro Gln Ser Gln Glu Leu Asp Val Gln Val Lys Asp Asp Ser Arg545 550 555 560Ala Leu Thr Leu Gly Ala Leu Thr Leu Pro Leu Ala Arg Leu Leu Thr 565 570 575Ala Pro Glu Leu Ile Leu Asp Gln Trp Phe Gln Leu Ser Ser Ser Gly 580 585 590Pro Asn Ser Arg Leu Tyr Met Lys Leu Val Met Arg Ile Leu Tyr Leu 595 600 605Asp Ser Ser Glu Ile Cys Phe Pro Thr Val Pro Gly Cys Pro Gly Ala 610 615 620Trp Asp Val Asp Ser Glu Asn Pro Gln Arg Gly Ser Ser Val Asp Ala625 630 635 640Pro Pro Arg Pro Cys His Thr Thr Pro Asp Ser Gln Phe Gly Thr Glu 645 650 655His Val Leu Arg Ile His Val Leu Glu Ala Gln Asp Leu Ile Ala Lys 660 665 670Asp Arg Phe Leu Gly Gly Leu Val Lys Gly Lys Ser Asp Pro Tyr Val 675 680 685Lys Leu Lys Leu Ala Gly Arg Ser Phe Arg Ser His Val Val Arg Glu 690 695 700Asp Leu Asn Pro Arg Trp Asn Glu Val Phe Glu Val Ile Val Thr Ser705 710 715 720Val Pro Gly Gln Glu Leu Glu Val Glu Val Phe Asp Lys Asp Leu Asp 725 730 735Lys Asp Asp Phe Leu Gly Arg Cys Lys Val Arg Leu Thr Thr Val Leu 740 745 750Asn Ser Gly Phe Leu Asp Glu Trp Leu Thr Leu Glu Asp Val Pro Ser 755 760 765Gly Arg Leu His Leu Arg Leu Glu Arg Leu Thr Pro Arg Pro Thr Ala 770 775 780Ala Glu Leu Glu Glu Val Leu Gln Val Asn Ser Leu Ile Gln Thr Gln785 790 795 800Lys Ser Ala Glu Leu Ala Ala Ala Leu Leu Ser Ile Tyr Met Glu Arg 805 810 815Ala Glu Asp Leu Pro Leu Arg Lys Gly Thr Lys His Leu Ser Pro Tyr 820 825 830Ala Thr Leu Thr Val Gly Asp Ser Ser His Lys Thr Lys Thr Ile Ser 835 840 845Gln Thr Ser Ala Pro Val Trp Asp Glu Ser Ala Ser Phe Leu Ile Arg 850 855 860Lys Pro His Thr Glu Ser Leu Glu Leu Gln Val Arg Gly Glu Gly Thr865 870 875 880Gly Val Leu Gly Ser Leu Ser Leu Pro Leu Ser Glu Leu Leu Val Ala 885 890 895Asp Gln Leu Cys Leu Asp Arg Trp Phe Thr Leu Ser Ser Gly Gln Gly 900 905 910Gln Val Leu Leu Arg Ala Gln Leu Gly Ile Leu Val Ser Gln His Ser 915 920 925Gly Val Glu Ala His Ser His Ser Tyr Ser His Ser Ser Ser Ser Leu 930 935 940Ser Glu Glu Pro Glu Leu Ser Gly Gly Pro Pro His Ile Thr Ser Ser945 950 955 960Ala Pro Glu Leu Arg Gln Arg Leu Thr His Val Asp Ser Pro Leu Glu 965 970 975Ala Pro Ala Gly Pro Leu Gly Gln Val Lys Leu Thr Leu Trp Tyr Tyr 980 985 990Ser Glu Glu Arg Lys Leu Val Ser Ile Val His Gly Cys Arg Ser Leu 995 1000 1005Arg Gln Asn Gly Arg Asp Pro Pro Asp Pro Tyr Val Ser Leu Leu 1010 1015 1020Leu Leu Pro Asp Lys Asn Arg Gly Thr Lys Arg Arg Thr Ser Gln 1025 1030 1035Lys Lys Arg Thr Leu Ser Pro Glu Phe Asn Glu Arg Phe Glu Trp 1040 1045 1050Glu Leu Pro Leu Asp Glu Ala Gln Arg Arg Lys Leu Asp Val Ser 1055 1060 1065Val Lys Ser Asn Ser Ser Phe Met Ser Arg Glu Arg Glu Leu Leu 1070 1075 1080Gly Lys Val Gln Leu Asp Leu Ala Glu Thr Asp Leu Ser Gln Gly 1085 1090 1095Val Ala Arg Trp Tyr Asp Leu Met Asp Asn Lys Asp Lys Gly Ser 1100 1105 1110Ser 191104PRTHomo sapiens 19Met Glu Arg Ser Pro Gly Glu Gly Pro Ser Pro Ser Pro Met Asp Gln1 5 10 15Pro Ser Ala Pro Ser Asp Pro Thr Asp Gln Pro Pro Ala Ala His Ala 20 25 30Lys Pro Asp Pro Gly Ser Gly Gly Gln Pro Ala Gly Pro Gly Ala Ala 35 40 45Gly Glu Ala Leu Ala Val Leu Thr Ser Phe Gly Arg Arg Leu Leu Val 50 55 60Leu Ile Pro Val Tyr Leu Ala Gly Ala Val Gly Leu Ser Val Gly Phe65 70 75 80Val Leu Phe Gly Leu Ala Leu Tyr Leu Gly Trp Arg Arg Val Arg Asp 85 90 95Glu Lys Glu Arg Ser Leu Arg Ala Ala Arg Gln Leu Leu Asp Asp Glu 100 105 110Glu Gln Leu Thr Ala Lys Thr Leu Tyr Met Ser His Arg Glu Leu Pro 115 120 125Ala Trp Val Ser Phe Pro Asp Val Glu Lys Ala Glu Trp Leu Asn Lys 130 135 140Ile Val Ala Gln Val Trp Pro Phe Leu Gly Gln Tyr Met Glu Lys Leu145 150 155 160Leu Ala Glu Thr Val Ala Pro Ala Val Arg Gly Ser Asn Pro His Leu 165 170 175Gln Thr Phe Thr Phe Thr Arg Val Glu Leu Gly Glu Lys Pro Leu Arg 180 185 190Ile Ile Gly Val Lys Val His Pro Gly Gln Arg Lys Glu Gln Ile Leu 195 200 205Leu Asp Leu Asn Ile Ser Tyr Val Gly Asp Val Gln Ile Asp Val Glu 210 215 220Val Lys Lys Tyr Phe Cys Lys Ala Gly Val Lys Gly Met Gln Leu His225 230 235 240Gly Val Leu Arg Val Ile Leu Glu Pro Leu Ile Gly Asp Leu Pro Phe 245 250 255Val Gly Ala Val Ser Met Phe Phe Ile Arg Arg Pro Thr Leu Asp Ile 260 265 270Asn Trp Thr Gly Met Thr Asn Leu Leu Asp Ile Pro Gly Leu Ser Ser 275 280 285Leu Ser Asp Thr Met Ile Met Asp Ser Ile Ala Ala Phe Leu Val Leu 290

295 300Pro Asn Arg Leu Leu Val Pro Leu Val Pro Asp Leu Gln Asp Val Ala305 310 315 320Gln Leu Arg Ser Pro Leu Pro Arg Gly Ile Ile Arg Ile His Leu Leu 325 330 335Ala Ala Arg Gly Leu Ser Ser Lys Asp Lys Tyr Val Lys Gly Leu Ile 340 345 350Glu Gly Lys Ser Asp Pro Tyr Ala Leu Val Arg Leu Gly Thr Gln Thr 355 360 365Phe Cys Ser Arg Val Ile Asp Glu Glu Leu Asn Pro Gln Trp Gly Glu 370 375 380Thr Tyr Glu Val Met Val His Glu Val Pro Gly Gln Glu Ile Glu Val385 390 395 400Glu Val Phe Asp Lys Asp Pro Asp Lys Asp Asp Phe Leu Gly Arg Met 405 410 415Lys Leu Asp Val Gly Lys Val Leu Gln Ala Ser Val Leu Asp Asp Trp 420 425 430Phe Pro Leu Gln Gly Gly Gln Gly Gln Val His Leu Arg Leu Glu Trp 435 440 445Leu Ser Leu Leu Ser Asp Ala Glu Lys Leu Glu Gln Val Leu Gln Trp 450 455 460Asn Trp Gly Val Ser Ser Arg Pro Asp Pro Pro Ser Ala Ala Ile Leu465 470 475 480Val Val Tyr Leu Asp Arg Ala Gln Asp Leu Pro Leu Lys Lys Gly Asn 485 490 495Lys Glu Pro Asn Pro Met Val Gln Leu Ser Ile Gln Asp Val Thr Gln 500 505 510Glu Ser Lys Ala Val Tyr Ser Thr Asn Cys Pro Val Trp Glu Glu Ala 515 520 525Phe Arg Phe Phe Leu Gln Asp Pro Gln Ser Gln Glu Leu Asp Val Gln 530 535 540Val Lys Asp Asp Ser Arg Ala Leu Thr Leu Gly Ala Leu Thr Leu Pro545 550 555 560Leu Ala Arg Leu Leu Thr Ala Pro Glu Leu Ile Leu Asp Gln Trp Phe 565 570 575Gln Leu Ser Ser Ser Gly Pro Asn Ser Arg Leu Tyr Met Lys Leu Val 580 585 590Met Arg Ile Leu Tyr Leu Asp Ser Ser Glu Ile Cys Phe Pro Thr Val 595 600 605Pro Gly Cys Pro Gly Ala Trp Asp Val Asp Ser Glu Asn Pro Gln Arg 610 615 620Gly Ser Ser Val Asp Ala Pro Pro Arg Pro Cys His Thr Thr Pro Asp625 630 635 640Ser Gln Phe Gly Thr Glu His Val Leu Arg Ile His Val Leu Glu Ala 645 650 655Gln Asp Leu Ile Ala Lys Asp Arg Phe Leu Gly Gly Leu Val Lys Gly 660 665 670Lys Ser Asp Pro Tyr Val Lys Leu Lys Leu Ala Gly Arg Ser Phe Arg 675 680 685Ser His Val Val Arg Glu Asp Leu Asn Pro Arg Trp Asn Glu Val Phe 690 695 700Glu Val Ile Val Thr Ser Val Pro Gly Gln Glu Leu Glu Val Glu Val705 710 715 720Phe Asp Lys Asp Leu Asp Lys Asp Asp Phe Leu Gly Arg Cys Lys Val 725 730 735Arg Leu Thr Thr Val Leu Asn Ser Gly Phe Leu Asp Glu Trp Leu Thr 740 745 750Leu Glu Asp Val Pro Ser Gly Arg Leu His Leu Arg Leu Glu Arg Leu 755 760 765Thr Pro Arg Pro Thr Ala Ala Glu Leu Glu Glu Val Leu Gln Val Asn 770 775 780Ser Leu Ile Gln Thr Gln Lys Ser Ala Glu Leu Ala Ala Ala Leu Leu785 790 795 800Ser Ile Tyr Met Glu Arg Ala Glu Asp Leu Pro Leu Arg Lys Gly Thr 805 810 815Lys His Leu Ser Pro Tyr Ala Thr Leu Thr Val Gly Asp Ser Ser His 820 825 830Lys Thr Lys Thr Ile Ser Gln Thr Ser Ala Pro Val Trp Asp Glu Ser 835 840 845Ala Ser Phe Leu Ile Arg Lys Pro His Thr Glu Ser Leu Glu Leu Gln 850 855 860Val Arg Gly Glu Gly Thr Gly Val Leu Gly Ser Leu Ser Leu Pro Leu865 870 875 880Ser Glu Leu Leu Val Ala Asp Gln Leu Cys Leu Asp Arg Trp Phe Thr 885 890 895Leu Ser Ser Gly Gln Gly Gln Val Leu Leu Arg Ala Gln Leu Gly Ile 900 905 910Leu Val Ser Gln His Ser Gly Val Glu Ala His Ser His Ser Tyr Ser 915 920 925His Ser Ser Ser Ser Leu Ser Glu Glu Pro Glu Leu Ser Gly Gly Pro 930 935 940Pro His Ile Thr Ser Ser Ala Pro Glu Leu Arg Gln Arg Leu Thr His945 950 955 960Val Asp Ser Pro Leu Glu Ala Pro Ala Gly Pro Leu Gly Gln Val Lys 965 970 975Leu Thr Leu Trp Tyr Tyr Ser Glu Glu Arg Lys Leu Val Ser Ile Val 980 985 990His Gly Cys Arg Ser Leu Arg Gln Asn Gly Arg Asp Pro Pro Asp Pro 995 1000 1005Tyr Val Ser Leu Leu Leu Leu Pro Asp Lys Asn Arg Gly Thr Lys 1010 1015 1020Arg Arg Thr Ser Gln Lys Lys Arg Thr Leu Ser Pro Glu Phe Asn 1025 1030 1035Glu Arg Phe Glu Trp Glu Leu Pro Leu Asp Glu Ala Gln Arg Arg 1040 1045 1050Lys Leu Asp Val Ser Val Lys Ser Asn Ser Ser Phe Met Ser Arg 1055 1060 1065Glu Arg Glu Leu Leu Gly Lys Val Gln Leu Asp Leu Ala Glu Thr 1070 1075 1080Asp Leu Ser Gln Gly Val Ala Arg Trp Tyr Asp Leu Met Asp Asn 1085 1090 1095Lys Asp Lys Gly Ser Ser 1100201667DNAHomo sapiens 20gcaacgcgct gtccatgtcg cgggcctcgc tgggactccc tgggagatga ggccgcgagg 60tctcccgccg ctcctggtgg tgctcctggg ctgctgggcc tccgtgagcg cccagaccga 120tgccaccccg gcggtgacga cagagggcct caactccacc gaggcagccc tggccacctt 180cggaactttc ccgtcgacca ggccccccgg gactcccagg gctccagggc cctcctccgg 240ccccaggcct accccagtca cggacgttgc tgttctctgt gtctgtgact tatccccagc 300acagtgtgac atcaactgct gctgtgatcc cgactgcagc tccgtggatt tcagtgtctt 360ttctgcctgc tcagttccag ttgtcacggg cgacagccag ttttgtagtc aaaaagcagt 420catctattca ttgaatttta cagcaaaccc acctcaaaga gtatttgaac ttgttgacca 480gattaatcca tctattttct gcattcatat tacaaactat aaacctgcat tatcctttat 540taatccagaa gtacctgatg aaaacaattt tgatacattg atgaaaacat ctgatggttt 600tacattgaat gctgaatcat atgtttcctt cacaaccaaa ctggatattc ctactgctgc 660taaatatgag tatggggttc ctctgcagac ttcagattcg tttctgagat ttccttcgtc 720cctgacatca tctctgtgca ctgataataa ccctgcagcg tttctggtga accaggctgt 780taagtgcacc agaaaaataa atttagaaca gtgtgaagaa attgaagccc tcagcatggc 840tttttacagc agcccggaaa ttctgagggt acctgattca agaaaaaagg tccctatcac 900tgttcagtcc atcgtcattc agtctctaaa taaaacgctc acccgacggg aggacactga 960tgtgctgcag ccgactctcg tcaacgctgg acactttagc ctttgcgtga atgttgttct 1020tgaggtaaag tacagcctca catacacaga tgcaggtgaa gtcaccaaag ctgatctctc 1080attcgttctg gggacagtta gcagcgtagt ggtcccactg cagcaaaagt ttgaaattca 1140ttttcttcag actgactgga gctctcccgt gtcagctcgt agcacagaag gtgaagagcc 1200tgctgtgggg ccagggcttc ccagattacg tggccccttt tggaaattcc caggcccagg 1260acatgctgga ctgggtgccc atccacttca tcacccagtc attcaacagg aaggattcct 1320gccagctccc aggggctttg gttatagaag tgaagtggac taaatacgga tccctgctga 1380atccacaggc caaaatagtc aatgtaactg caaatctaat ttcatcctcc tttcctgagg 1440ccaactcagg aaatgaaagg acgattctta tttccactgc ggttactttt gtggatgtgt 1500ctgcacctgc agaggcaggc ttcagagctc caccagccat caatgccagg ctgcccttta 1560acttcttctt cccgtttgtt tgacaatgct cagatgcatc agttccttaa tatacacgtg 1620aaatttgaaa actgtacatt cggtgagatt aaattttata tacaact 1667211536DNAHomo sapiens 21atgatcacag ctcactgcag cctcgacctc ctaggctcag ttgctgttct ctgtgtctgt 60gacttatccc cagcacagtg tgacatcaac tgctgctgtg atcccgactg cagctccgtg 120gatttcagtg tcttttctgc ctgctcagtt ccagttgtca cgggcgacag ccagttttgt 180agtcaaaaag cagtcatcta ttcattgaat tttacagcaa acccacctca aagagtattt 240gaacttgttg accagattaa tccatctatt ttctgcattc atattacaaa ctataaacct 300gcattatcct ttattaatcc agaagtacct gatgaaaaca attttgatac attgatgaaa 360acatctgatg gttttacatt gaatgctgaa tcatatgttt ccttcacaac caaactggat 420attcctactg ctgctaaata tgagtatggg gttcctctgc agacttcaga ttcgtttctg 480agatttcctt cgtccctgac atcatctctg tgcactgata ataaccctgc agcgtttctg 540gtgaaccagg ctgttaagtg caccagaaaa ataaatttag aacagtgtga agaaattgaa 600gccctcagca tggcttttta cagcagcccg gaaattctga gggtacctga ttcaagaaaa 660aaggtcccta tcactgttca gtccatcgtc attcagtctc taaataaaac gctcacccga 720cgggaggaca ctgatgtgct gcagccgact ctcgtcaacg ctggacactt tagcctttgc 780gtgaatgttg ttcttgaggt aaagtacagc ctcacataca cagatgcagg tgaagtcacc 840aaagctgatc tctcattcgt tctggggaca gttagcagcg tagtggtccc actgcagcaa 900aagtttgaaa ttcattttct tcaggaaaat acccagccag tccctctcag tggaaaccct 960ggttatgtcg tggggctccc attagctgct ggattccagc ctcataagac tggagctctc 1020ccgtgtcagc tcgtagcaca gaaggtgaag agcctgctgt ggggccaggg cttcccagat 1080tacgtggccc cttttggaaa ttcccaggcc caggacatgc tggactgggt gcccatccac 1140ttcatcaccc agtcattcaa caggaagcat tttgttttgc aggattcctg ccagctccca 1200ggggctttgg ttatagaagt gaagtggact aaatacggat ccctgctgaa tccacaggcc 1260aaaatagtca atgtaactgc aaatctaatt tcatcctcct ttcctgaggc caactcagga 1320aatgaaagga cgattcttat ttccactgcg gttacttttg tggatgtgtc tgcacctgca 1380gaggcaggct tcagagctcc accagccatc aatgccaggc tgccctttaa cttcttcttc 1440ccgtttgttt gacaatgctc agatgcatca gttccttaat atacacgtga aatttgaaaa 1500ctgtacattc ggtgagatta aattttatat acaact 1536221680DNAHomo sapiens 22atgtgccagc tcctggagtc cacagtgatc caacctcaag gggacagccc cgttgctgtt 60ctctgtgtct gtgacttatc cccagcacag tgtgacatca actgctgctg tgatcccgac 120tgcagctccg tggatttcag tgtcttttct gcctgctcag ttccagttgt cacgggcgac 180agccagtttt gtagtcaaaa agcagtcatc tattcattga attttacagc aaacccacct 240caaagagtat ttgaacttgt tgaccagatt aatccatcta ttttctgcat tcatattaca 300aactataaac ctgcattatc ctttattaat ccagaagtac ctgatgaaaa caattttgat 360acattgatga aaacatctga tggttttaca ttgaatgctg aatcatatgt ttccttcaca 420accaaactgg atattcctac tgctgctaaa tatgagtatg gggttcctct gcagacttca 480gattcgtttc tgagatttcc ttcgtccctg acatcatctc tgtgcactga taataaccct 540gcagcgtttc tggtgaacca ggctgttaag tgcaccagaa aaataaattt agaacagtgt 600gaagaaattg aagccctcag catggctttt tacagcagcc cggaaattct gagggtacct 660gattcaagaa aaaaggtccc tatcactgtt cagtccatcg tcattcagtc tctaaataaa 720acgctcaccc gacgggagga cactgatgtg ctgcagccga ctctcgtcaa cgctggacac 780tttagccttt gcgtgaatgt tgttcttgag gtaaagtaca gcctcacata cacagatgca 840ggtgaagtca ccaaagctga tctctcattc gttctgggga cagttagcag cgtagtggtc 900ccactgcagc aaaagtttga aattcatttt cttcaggaaa atacccagcc agtccctctc 960agtggaaacc ctggttatgt cgtggggctc ccattagctg ctggattcca gcctcataag 1020atgtctggga ttattcagac cacaaataga tatggacagc ttactattct tcatagcaca 1080actgagcaag actgcttagc actggagggg gtccggaccc cagtattatt tggttacact 1140atgcaatctg gctgtaaact aagactgact ggagctctcc cgtgtcagct cgtagcacag 1200aaggtgaaga gcctgctgtg gggccagggc ttcccagatt acgtggcccc ttttggaaat 1260tcccaggccc aggacatgct ggactgggtg cccatccact tcatcaccca gtcattcaac 1320aggaaggatt cctgccagct cccaggggct ttggttatag aagtgaagtg gactaaatac 1380ggatccctgc tgaatccaca ggccaaaata gtcaatgtaa ctgcaaatct aatttcatcc 1440tcctttcctg aggccaactc aggaaatgaa aggacgattc ttatttccac tgcggttact 1500tttgtggatg tgtctgcacc tgcagaggca ggcttcagag ctccaccagc catcaatgcc 1560aggctgccct ttaacttctt cttcccgttt gtttgacaat gctcagatgc atcagttcct 1620taatatacac gtgaaatttg aaaactgtac attcggtgag attaaatttt atatacaact 1680231885DNAHomo sapiens 23cgctgggact ccctgggaga tgaggccgcg aggtctcccg ccgctcctgg tggtgctcct 60gggctgctgg gcctccgtga gcgcccagac cgatgccacc ccggcggtga cgacagaggg 120cctcaactcc accgaggcag ccctggccac cttcggaact ttcccgtcga ccaggccccc 180cgggactccc agggctccag ggccctcctc cggccccagg cctaccccag tcacggacgt 240tgctgttctc tgtgtctgtg acttatcccc agcacagtgt gacatcaact gctgctgtga 300tcccgactgc agctccgtgg atttcagtgt cttttctgcc tgctcagttc cagttgtcac 360gggcgacagc cagttttgta gtcaaaaagc agtcatctat tcattgaatt ttacagcaaa 420cccacctcaa agagtatttg aacttgttga ccagattaat ccatctattt tctgcattca 480tattacaaac tataaacctg cattatcctt tattaatcca gaagtacctg atgaaaacaa 540ttttgataca ttgatgaaaa catctgatgg ttttacattg aatgctgaat catatgtttc 600cttcacaacc aaactggata ttcctactgc tgctaaatat gagtatgggg ttcctctgca 660gacttcagat tcgtttctga gatttccttc gtccctgaca tcatctctgt gcactgataa 720taaccctgca gcgtttctgg tgaaccaggc tgttaagtgc accagaaaaa taaatttaga 780acagtgtgaa gaaattgaag ccctcagcat ggctttttac agcagcccgg aaattctgag 840ggtacctgat tcaagaaaaa aggtccctat cactgttcag tccatcgtca ttcagtctct 900aaataaaacg ctcacccgac gggaggacac tgatgtgctg cagccgactc tcgtcaacgc 960tggacacttt agcctttgcg tgaatgttgt tcttgaggta aagtacagcc tcacatacac 1020agatgcaggt gaagtcacca aagctgatct ctcattcgtt ctggggacag ttagcagcgt 1080agtggtccca ctgcagcaaa agtttgaaat tcattttctt caggaaaata cccagccagt 1140ccctctcagt ggaaaccctg gttatgtcgt ggggctccca ttagctgctg gattccagcc 1200tcataagggg tctgggatta ttcagaccac aaatagatat ggacagctta ctattcttca 1260tagcacaact gagcaagact gcttagcact ggagggggtc cggaccccag tattatttgg 1320ttacactatg caatctggct gtaaactaag actgactgga gctctcccgt gtcagctcgt 1380agcacagaag gtgaagagcc tgctgtgggg ccagggcttc ccagattacg tggccccttt 1440tggaaattcc caggcccagg acatgctgga ctgggtgccc atccacttca tcacccagtc 1500attcaacagg aagcattttg ttttgcagga ttcctgccag ctcccagggg ctttggttat 1560agaagtgaag tggactaaat acggatccct gctgaatcca caggccaaaa tagtcaatgt 1620aactgcaaat ctaatttcat cctcctttcc tgaggccaac tcaggaaatg aaaggacgat 1680tcttatttcc actgcggtta cttttgtgga tgtgtctgca cctgcagagg caggcttcag 1740agctccacca gccatcaatg ccaggctgcc ctttaacttc ttcttcccgt ttgtttgaca 1800atgctcagat gcatcagttc cttaatatac acgtgaaatt tgaaaactgt acattcggtg 1860agattaaatt ttatatacaa ctagc 1885241879DNAHomo sapiens 24gcgcctggct gtcgcggttg ccgggcaacg cgctgtccat gtcgcgggcc tcgctgggac 60tccctgggag atgaggccgc gaggtctccc gccgctcctg gtggtgctcc tgggctgctg 120ggcctccgtg agcgcccaga ccgatgccac cccggcggtg acgacagagg gcctcaactc 180caccgaggca gccctggcca ccttcggaac tttcccgtcg accaggcccc ccgggactcc 240cagggctcca gggccctcct ccggccccag gcctacccca gtcacggacg ttgctgttct 300ctgtgtctgt gacttatccc cagcacagtg tgacatcaac tgctgctgtg atcccgactg 360cagctccgtg gatttcagtg tcttttctgc ctgctcagtt ccagttgtca cgggcgacag 420ccagttttgt agtcaaaaag cagtcatcta ttcattgaat tttacagcaa acccacctca 480aagagtattt gaacttgttg accagattaa tccatctatt ttctgcattc atattacaaa 540ctataaacct gcattatcct ttattaatcc agaagtacct gatgaaaaca attttgatac 600attgatgaaa acatctgatg gttttacatt gaatgctgaa tcatatgttt ccttcacaac 660caaactggat attcctactg ctgctaaata tgagtatggg gttcctctgc agacttcaga 720ttcgtttctg agatttcctt cgtccctgac atcatctctg tgcactgata ataaccctgc 780aggccaggcg tactggttca cacctgtaat cccagcactc tgggaggccg aggcgagagg 840atcacttgag gtacctgatt caagaaaaaa ggtccctatc actgttcagt ccatcgtcat 900tcagtctcta aataaaacgc tcacccgacg ggaggacact gatgtgctgc agccgactct 960cgtcaacgct ggacacttta gcctttgcgt gaatgttgtt cttgaggtaa agtacagcct 1020cacatacaca gatgcaggtg aagtcaccaa agctgatctc tcattcgttc tggggacagt 1080tagcagcgta gtggtcccac tgcagcaaaa gtttgaaatt cattttcttc aggaaaatac 1140ccagccagtc cctctcagtg gaaaccctgg ttatgtcgtg gggctcccat tagctgctgg 1200attccagcct cataaggggt ctgggattat tcagaccaca aatagatatg gacagcttac 1260tattcttcat agcacaactg agcaagactg cttagcactg gagggggtcc ggaccccagt 1320attatttggt tacactatgc aatctggctg taaactaaga ctgactggag ctctcccgtg 1380tcagctcgta gcacagaagg tgaagagcct gctgtggggc cagggcttcc cagattacgt 1440ggcccctttt ggaaattccc aggcccagga catgctggac tgggtgccca tccacttcat 1500cacccagtca ttcaacagga aggattcctg ccagctccca ggggctttgg ttatagaagt 1560gaagtggact aaatacggat ccctgctgaa tccacaggcc aaaatagtca atgtaactgc 1620aaatctaatt tcatcctcct ttcctgaggc caactcagga aatgaaagga cgattcttat 1680ttccactgcg gttacttttg tggatgtgtc tgcacctgca gaggcaggct tcagagctcc 1740accagccatc aatgccaggc tgccctttaa cttcttcttc ccgtttgttt gacaatgctc 1800agatgcatca gttccttaat atacacgtga aatttgaaaa ctgtacattc ggtgagatta 1860aattttatat acaactagc 1879251932DNAHomo sapiens 25cgtgatgccc cgcgcctggc tgtcgcggtt gccgggcaac gcgctgtcca tgtcgcgggc 60ctcgctggga ctccctggga gatgaggccg cgaggtctcc cgccgctcct ggtggtgctc 120ctgggctgct gggcctccgt gagcgcccag accgatgcca ccccggcggt gacgacagag 180ggcctcaact ccaccgaggc agccctggcc accttcggaa ctttcccgtc gaccaggccc 240cccgggactc ccagggctcc agggccctcc tccggcccca ggcctacccc agtcacggac 300gttgctgttc tctgtgtctg tgacttatcc ccagcacagt gtgacatcaa ctgctgctgt 360gatcccgact gcagctccgt ggatttcagt gtcttttctg cctgctcagt tccagttgtc 420acgggcgaca gccagttttg tagtcaaaaa gcagtcatct attcattgaa ttttacagca 480aacccacctc aaagagtatt tgaacttgtt gaccagatta atccatctat tttctgcatt 540catattacaa actataaacc tgcattatcc tttattaatc cagaagtacc tgatgaaaac 600aattttgata cattgatgaa aacatctgat ggttttacat tgaatgctga atcatatgtt 660tccttcacaa ccaaactgga tattcctact gctgctaaat atgagtatgg ggttcctctg 720cagacttcag attcgtttct gagatttcct tcgtccctga catcatctct gtgcactgat 780aataaccctg cagcgtttct ggtgaaccag gctgttaagt gcaccagaaa aataaattta 840gaacagtgtg aagaaattga agccctcagc atggcttttt acagcagccc ggaaattctg 900agggtacctg attcaagaaa aaaggtccct atcactgttc agtccatcgt cattcagtct 960ctaaataaaa cgctcacccg acgggaggac actgatgtgc tgcagccgac tctcgtcaac 1020gctggacact ttagcctttg cgtgaatgtt gttcttgagg taaagtacag cctcacatac 1080acagatgcag gtgaagtcac caaagctgat ctctcattcg ttctggggac agttagcagc 1140gtagtggtcc cactgcagca aaagtttgaa attcattttc ttcaggaaaa tacccagcca 1200gtccctctca gtggaaaccc tggttatgtc gtggggctcc cattagctgc tggattccag

1260cctcataagg ggtctgggat tattcagacc acaaatagat atggacagct tactattctt 1320catagcacaa ctgagcaaga ctgcttagca ctggaggggg tccggacccc agtattattt 1380ggttacacta tgcaatctgg ctgtaaacta agactgactg gagctctccc gtgtcagctc 1440gtagcacaga aggtgaagag cctgctgtgg ggccagggct tcccagatta cgtggcccct 1500tttggaaatt cccaggccca ggacatgctg gactgggtgc ccatccactt catcacccag 1560tcattcaaca ggaaggattc ctgccagctc ccaggggctt tggttataga agtgaagtgg 1620actaaatacg gatccctgct gaatccacag gccaaaatag tcaatgtaac tgcaaatcta 1680atttcatcct cctttcctga ggccaactca ggaaatgaaa ggacgattct tatttccact 1740gcggttactt ttgtggatgt gtctgcacct gcagaggcag gcttcagagc tccaccagcc 1800atcaatgcca ggctgccctt taacttcttc ttcccgtttg tttgacaatg ctcagatgca 1860tcagttcctt aatatacacg tgaaatttga aaactgtaca ttcggtgaga ttaaatttta 1920tatacaacta gc 1932261917DNAHomo sapiens 26cttctcgcgg cttcgcaagc cccttcccgt gatgccccgc gcctggctgt cgcggttgcc 60gggcaacgcg ctgtccatgt cgcgggcctc gctgggactc cctgggagat gaggccgcga 120ggtctcccgc cgctcctggt ggtgctcctg ggctgctggg cctccgtgag cgcccagacc 180gatgccaccc cggcggtgac gacagagggc ctcaactcca ccgaggcagc cctggccacc 240ttcggaactt tcccgtcgac caggcccccc gggactccca gggctccagg gccctcctcc 300ggccccaggc ctaccccagt cacggacgtt gctgttctct gtgtctgtga cttatcccca 360gcacagtgtg acatcaactg ctgctgtgat cccgactgca gctccgtgga tttcagtgtc 420ttttctgcct gctcagttcc agttgtcacg ggcgacagcc agttttgtag tcaaaaagca 480gtcatctatt cattgaattt tacagcaaac ccacctcaaa gagtatttga acttgttgac 540cagattaatc catctatttt ctgcattcat attacaaact ataaacctgc attatccttt 600attaatccag aagtacctga tgaaaacaat tttgatacat tgatgaaaac atctgatggt 660tttacattga atgctgaatc atatgtttcc ttcacaacca aactggatat tcctactgct 720gctaaatatg agtatggggt tcctctgcag acttcagatt cgtttctgag atttccttcg 780tccctgacat catctctgtg cactgataat aaccctgcag gccaggcgta ctggttcaca 840cctgtaatcc cagcactctg ggaggccgag gcgagaggat cacttgaggt acctgattca 900agaaaaaagg tccctatcac tgttcagtcc atcgtcattc agtctctaaa taaaacgctc 960acccgacggg aggacactga tgtgctgcag ccgactctcg tcaacgctgg acactttagc 1020ctttgcgtga atgttgttct tgaggtaaag tacagcctca catacacaga tgcaggtgaa 1080gtcaccaaag ctgatctctc attcgttctg gggacagtta gcagcgtagt ggtcccactg 1140cagcaaaagt ttgaaattca ttttcttcag gaaaataccc agccagtccc tctcagtgga 1200aaccctggtt atgtcgtggg gctcccatta gctgctggat tccagcctca taagatgtct 1260gggattattc agaccacaaa tagatatgga cagcttacta ttcttcatag cacaactgag 1320caagactgct tagcactgga gggggtccgg accccagtat tatttggtta cactatgcaa 1380tctggctgta aactaagact gactggagct ctcccgtgtc agctcgtagc acagaaggtg 1440aagagcctgc tgtggggcca gggcttccca gattacgtgg ccccttttgg aaattcccag 1500gcccaggaca tgctggactg ggtgcccatc cacttcatca cccagtcatt caacaggaag 1560gattcctgcc agctcccagg ggctttggtt atagaagtga agtggactaa atacggatcc 1620ctgctgaatc cacaggccaa aatagtcaat gtaactgcaa atctaatttc atcctccttt 1680cctgaggcca actcaggaaa tgaaaggacg attcttattt ccactgcggt tacttttgtg 1740gatgtgtctg cacctgcaga ggcaggcttc agagctccac cagccatcaa tgccaggctg 1800ccctttaact tcttcttccc gtttgtttga caatgctcag atgcatcagt tccttaatat 1860acacgtgaaa tttgaaaact gtacattcgg tgagattaaa ttttatatac aactagc 1917271909DNAHomo sapiens 27gcaacgcgct gtccatgtcg cgggcctcgc tgggactccc tgggagatga ggccgcgagg 60tctcccgccg ctcctggtgg tgctcctggg ctgctgggcc tccgtgagcg cccagaccga 120tgccaccccg gcggtgacga cagagggcct caactccacc gaggcagccc tggccacctt 180cggaactttc ccgtcgacca ggccccccgg gactcccagg gctccagggc cctcctccgg 240ccccaggcct accccagtca cggacgttgc tgttctctgt gtctgtgact tatccccagc 300acagtgtgac atcaactgct gctgtgatcc cgactgcagc tccgtggatt tcagtgtctt 360ttctgcctgc tcagttccag ttgtcacggg cgacagccag ttttgtagtc aaaaagcagt 420catctattca ttgaatttta cagcaaaccc acctcaaaga gtatttgaac ttgttgacca 480gattaatcca tctattttct gcattcatat tacaaactat aaacctgcat tatcctttat 540taatccagaa gtacctgatg aaaacaattt tgatacattg atgaaaacat ctgatggttt 600tacattgaat gctgaatcat atgtttcctt cacaaccaaa ctggatattc ctactgctgc 660taaatatgag tatggggttc ctctgcagac ttcagattcg tttctgagat ttccttcgtc 720cctgacatca tctctgtgca ctgataataa ccctgcagcg tttctggtga accaggctgt 780taagtgcacc agaaaaataa atttagaaca gtgtgaagaa attgaagccc tcagcatggc 840tttttacagc agcccggaaa ttctgagggt acctgattca agaaaaaagg tccctatcac 900tgttcagtcc atcgtcattc agtctctaaa taaaacgctc acccgacggg aggacactga 960tgtgctgcag ccgactctcg tcaacgctgg acactttagc ctttgcgtga atgttgttct 1020tgaggtaaag tacagcctca catacacaga tgcaggtgaa gtcaccaaag ctgatctctc 1080attcgttctg gggacagtta gcagcgtagt ggtcccactg cagcaaaagt ttgaaattca 1140ttttcttcag gaaaataccc agccagtccc tctcagtgga aaccctggtt atgtcgtggg 1200gctcccatta gctgctggat tccagcctca taagatgtct gggattattc agaccacaaa 1260tagatatgga cagcttacta ttcttcatag cacaactgag caagactgct tagcactgga 1320gggggtccgg accccagtat tatttggtta cactatgcaa tctggctgta aactaagact 1380gactggagct ctcccgtgtc agctcgtagc acagaaggtg aagagcctgc tgtggggcca 1440gggcttccca gattacgtgg ccccttttgg aaattcccag gcccaggaca tgctggactg 1500ggtgcccatc cacttcatca cccagtcatt caacaggaag cattttgttt tgcaggattc 1560ctgccagctc ccaggggctt tggttataga agtgaagtgg actaaatacg gatccctgct 1620gaatccacag gccaaaatag tcaatgtaac tgcaaatcta atttcatcct cctttcctga 1680ggccaactca ggaaatgaaa ggacgattct tatttccact gcggttactt ttgtggatgt 1740gtctgcacct gcagaggcag gcttcagagc tccaccagcc atcaatgcca ggctgccctt 1800taacttcttc ttcccgtttg tttgacaatg ctcagatgca tcagttcctt aatatacacg 1860tgaaatttga aaactgtaca ttcggtgaga ttaaatttta tatacaact 1909282908DNAHomo sapiens 28agctccgggc gttcgcttgc aagatggcgg cggcggggca gtggctgctg cgttttcgtg 60tctgagtcct tcctgggttc taatgagggc gcggttctgc tgtgcccggc ccgcgaggtc 120taaggcatgg gcttccagcc tccggccgct cttcttttga ggcttttcct tctgcagggc 180atcctgaggc ttctgtgggg ggacctggct ttcatccctc cttttatccg aatgtccggc 240cctgcggtca gcgcgtccct ggtcggagac accgagggtg tgaccgtgtc cctggcagtg 300ctgcaggacg aggcgggaat attgccaatt ccgacgtgtg gagtgctgaa caatgagacg 360gaagactgga gcgtgactgt gatccccggt gcgaaggtgt tggaagtgac agtgaggtgg 420aagagaggtc tggactggtg ttcctccaat gagacagatt ccttctcaga gtccccctgt 480atcctccaga cccttctggt ttcagcatct cataattcat cctgttcagc acatctactc 540attcaagtgg aaatttatgc caactcttct ctgacccata atgcctcaga gaacgtgact 600gtcattccta accaggtgta tcagcccctt ggcccttgtc cttgtaattt aacagctgga 660gcctgtgatg ttcgctgctg ctgtgaccag gaatgctcat caaatttaac aacgctgttc 720agacggtcct gcttcaccgg cgtgtttgga ggagacgtca atcctccttt tgatcagctc 780tgctctgctg ggacgacgac acgtggtgtc cccgattggt ttccctttct gtgtgtgcag 840tccccccttg ccaacacacc cttccttggt tacttctatc atggtgctgt ttcccccaaa 900caggactctt cctttgaagt atatgtggat actgacgcaa aagactttgc agactttggt 960tacaaacaag gagatcccat tatgactgta aagaaggcat attttactat tccgcaggtg 1020tccctggctg ggcagtgtat gcagaacgcc ccagtggcat ttcttcacaa ttttgatgtt 1080aaatgcgtta ctaatttgga actataccaa gaacgagatg gtattatcaa tgcgaagata 1140aagaatgttg ccttaggagg catagttaca ccaaaagtga tctatgagga agcaactgac 1200ctagacaaat tcatcaccaa tacagaaact cctttaaata acggatcaac ccctagaatt 1260gtgaatgtgg aagaacatta tattttcaaa tggaataata ataccatcag tgaaataaat 1320gttaaaattt ttagggcaga gattaatgcc caccagaaag ggataatgac acagagattt 1380gtagtaaaat ttttaagcta taatagtggt aatgaagaag aattatctgg aaatccaggt 1440taccaacttg gcaagcctgt ccgagctcta aatatcaaca ggatgaataa tgtcacgact 1500ttacatcttt ggcaatcggc tggaaggggt ctgtgtacat cagcaacttt caaacccatt 1560ttatttggag aaaatgtact ctctggatgc ctgttagaag tcgggattaa tgaaaattgt 1620actcagctca gggagaatgc tgttgaaaga cttgattcat taatacaagc gactcacgtt 1680gcaatgagag gcaactccga ttacgctgat cttagtgatg gctggctcga aataatacgt 1740gtagatgccc ctgatccagg tgcagacccg ctggctagca gtgtgaacgg catgtgcctg 1800gatattcctg ctcacctgag catccgcatc ctcatctcgg atgctggcgc ggtggaaggg 1860attactcagc aggagatact cggtgtagag acaaggttct cctcagtgaa ctggcagtac 1920cagtgtgggc ttacctgtga gcacaaggcc gaccttctcc ctatcagtgc atccgtccag 1980tttattaaaa ttcctgcaca gttaccccac cccctgacaa gattccagat caattataca 2040gagtatgact gcaacagaaa tgaggtgtgt tggccgcagc ttctatatcc atggactcag 2100tattatcaag gggagctgca ttctcagtgt gttgctaagg gcttactgtt gctgttgttc 2160ctcacattgg ccttgttcct cagcaacccc tggaccagaa tatgcaaagc ctatagttag 2220acaaccacct ggcttttatt tttttgagat ggagttttgc tcttgttgcc caggctgaag 2280tgatctcggc tcaccacaac ctcctcctct tgggttcaag cgattctcct gcctcagcct 2340ccggagaact gggattacag gcatgcacca ccacgcccgg ctaattttgt atttttagta 2400gagacagggt tccaccgtat tggccaggct gctctcgaac tcctgacctc atgatccgcc 2460catcttggcc tcccaaagtg ctgagattac aggcatgagc caccgcaccc ggcctttttt 2520tttttttttt tttttttgag gcggggtctc tgtcacccag gctggagtgc agtgcacaat 2580ctcggctcac tgcaatctct gcctcccaag caatcctccc acctcagcct ctggtgtagc 2640tgggaccaca gatgctccac catgcctggc tgtatttttg gtaaagacgg ggtttcgcct 2700tgttgcccag ggtggtctgt aactcctgag ctcagatgat ctgcccacct cggcctccca 2760aagtgctggg atcacagacg tgagccactg cgtccggtcc atctgacttc tcaaagactt 2820tagaccttga cttcagtgat ttgttgtagt cttgtatgct tctctataaa attttaataa 2880atgaaatgtc ttatttttgt agaaaatt 2908292067DNAHomo sapiens 29atgcgattgg agaccgcgga ggcctacgtc ggacccggag gccctgaatg ccccatgcgc 60accccacagc tcgcgctcct gcaagtgttc tttctggtgt tccccgatgg cgtccggcct 120cagccctctt cctccccatc aggggcagtg cccacgtctt tggagctgca gcgagggacg 180gatggcggaa ccctccagtc cccttcagag gcgactgcaa ctcgcccggc cgtgcctgga 240ctccctacag tggtccctac tctcgtgact ccctcggccc ctgggaatag gactgtggac 300ctcttcccag tcttaccgat ctgtgtctgt gacttgactc ctggagcctg cgatataaat 360tgctgctgcg acagggactg ctatcttctc catccgagga cagttttctc cttctgcctt 420ccaggcagcg taaggtcttc aagctgggtt tgtgtagaca actctgttat cttcaggagt 480aattccccgt ttccttcaag agttttcatg gattctaatg gaatcaggca gttttgtgtc 540catgtgaaca actcaaactt aaactatttc cagaagcttc aaaaggtcaa tgcaaccaac 600ttccaggccc tggctgcaga gtttggaggc gaatcattca cttcaacatt ccaaactcaa 660tcaccaccat ctttttacag ggctggggac cccattctta cttacttccc caagtggtct 720gtaataagct tgctgagaca acctgcagga gttggagctg ggggactctg tgctgaaagc 780aatcctgcag gtttcctaga gagtaaaagt acaacttgca ctcgtttttt caagaacctg 840gctagtagct gtaccttgga ttcagccctc aatgctgcct cttactataa cttcacagtc 900ttaaaggttc caagaagcat gactgatcca cagaatatgg agttccaggt tcctgtaata 960cttacctcac aggctaatgc tcctctgttg gctggaaaca cttgtcagaa tgtagtttct 1020caggtcacct atgagataga gaccaatggg acttttggaa tccagaaagt ttctgtcagt 1080ttgggacaaa ccaacctgac tgttgagcca ggcgcttcct tacagcaaca cttcatcctt 1140cgcttcaggg cttttcaaca gagcacagct gcttctctca ccagtcctag aagtgggaat 1200cctggctata tagttgggaa gccactcttg gctctgactg atgatataag ttactcaatg 1260accctcttac agagccaggg taatggaagt tgctctgtta aaagacatga agtgcagttt 1320ggagtgaatg caatatctgg atgcaagctc aggttgaaga aggcagactg cagccacttg 1380cagcaggaga tttatcagac tcttcatgga aggcccagac cagagtatgt tgccatcttt 1440ggtaatgctg acccagccca gaaaggaggg tggaccagga tcctcaacag gcactgcagc 1500atttcagcta taaactgtac ttcctgctgt ctcataccag tttccctgga gatccaggta 1560ttgtgggcat atgtaggtct cctgtccaac ccgcaagctc atgtatcagg agttcgattc 1620ctataccagt gccagtctat acaggattct cagcaagtta cagaagtatc tttgacaact 1680cttgtgaact ttgtggacat tacccagaag ccacagcctc caaggggcca acccaaaatg 1740gactggaaat ggccattcga cttctttccc ttcaaagtgg cattcagcag aggagtattc 1800tctcaaaaat gctcagtctc tcccatcctt atcctgtgcc tcttactact tggagttctc 1860aacctagaga ctatgtgaag aaaagaaaat aatcagattt cagttttccc tatgagaaac 1920tctgaggcag ccacttatct tggctaaata gaacctcacc tgctcatgac cagagagcat 1980ttaggataat agaggaccta actgaaggaa tccttgtata tgaaaggagt tattttagaa 2040aagcaataaa aatattttat tcatcat 2067301940DNAHomo sapiens 30aatgccccat gcgcacccca cagctcgcgc tcctgcaagt gttctttctg gtgttccccg 60atggcgtccg gcctcagccc tcttcctccc catcaggggc agtgcccacg tctttggagc 120tgcagcgagg gacggatggc ggaaccctcc agtccccttc agaggcgact gcaactcgcc 180cggccgtgcc tggactccct acagtggtcc ctactctcgt gactccctcg gcccctggga 240ataggactgt ggacctcttc ccagtcttac cgatctgtgt ctgtgacttg actcctggag 300cctgcgatat aaattgctgc tgcgacaggg actgctatct tctccatccg aggacagttt 360tctccttctg ccttccaggc agcgtaaggt cttcaagctg ggtttgtgta gacaactctg 420ttatcttcag gagtaattcc ccgtttcctt caagagtttt catggattct aatggaatca 480ggcagttttg tgtccatgtg aacaactcaa acttaaacta tttccagaag cttcaaaagg 540tcaatgcaac caacttccag gccctggctg cagagtttgg aggcgaatca ttcacttcaa 600cattccaaac tcaatcacca ccatcttttt acagggctgg ggaccccatt cttacttact 660tccccaagtg gtctgtaata agcttgctga gacaacctgc aggagttgga gctgggggac 720tctgtgctga aagcaatcct gcaggtttcc tagagagtaa aagtacaact tgcactcgtt 780ttttcaagaa cctggctagt agctgtacct tggattcagc cctcaatgct gcctcttact 840ataacttcac agtcttaaag gttccaagaa gcatgactga tccacagaat atggaggtca 900cctatgagat agagaccaat gggacttttg gaatccagaa agtttctgtc agtttgggac 960aaaccaacct gactgttgag ccaggcgctt ccttacagca acacttcatc cttcgcttca 1020gggcttttca acagagcaca gctgcttctc tcaccagtcc tagaagtggg aatcctggct 1080atatagttgg gaagccactc ttggctctga ctgatgatat aagttactca atgaccctct 1140tacagagcca gggtaatgga agttgctctg ttaaaagaca tgaagtgcag tttggagtga 1200atgcaatatc tggatgcaag ctcaggttga agaaggcaga ctgcagccac ttgcagcagg 1260agatttatca gactcttcat ggaaggccca gaccagagta tgttgccatc tttggtaatg 1320ctgacccagc ccagaaagga gggtggacca ggatcctcaa caggcactgc agcatttcag 1380ctataaactg tacttcctgc tgtctcatac cagtttccct ggagatccag gtattgtggg 1440catatgtagg tctcctgtcc aacccgcaag ctcatgtatc aggagttcga ttcctatacc 1500agtgccagtc tatacaggat tctcagcaag ttacagaagt atctttgaca actcttgtga 1560actttgtgga cattacccag aagccacagc ctccaagggg ccaacccaaa atggactgga 1620aatggccatt cgacttcttt cccttcaaag tggcattcag cagaggagta ttctctcaaa 1680aatgctcagt ctctcccatc cttatcctgt gcctcttact acttggagtt ctcaacctag 1740agactatgtg aagaaaagaa aataatcaga tttcagtttt ccctatgaga aactctgagg 1800cagccactta tcttggctaa atagaacctc acctgctcat gaccagagag catttaggat 1860aatagaggac ctaactgaag gaatccttgt atatgaaagg agttatttta gaaaagcaat 1920aaaaatattt tattcatcat 1940311464DNAHomo sapiens 31atgcgcaccc cacagctcgc gctcctgcaa gtgttctttc tggtgttccc cgatggcgtc 60cggcctcagc cctcttcctc cccatcaggg gcagtgccca cgtctttgga gctgcagcga 120gggacggatg gcggaaccct ccagtcccct tcagaggcga ctgcaactcg cccggccgtg 180cctggactcc ctacagtggt ccctactctc gtgactccct cggcccctgg gaataggact 240gtggacctct tcccagtctt accgatctgt gtctgtgact tgactcctgg agcctgcgat 300ataaattgct gctgcgacag ggactgctat cttctccatc cgaggacagt tttctccttc 360tgccttccag gcagcgtaag gtcttcaagc tgggtttgtg tagacaactc tgttatcttc 420aggagtaatt ccccgtttcc ttcaagagtt ttcatggatt ctaatggaat caggcagttt 480tgtgtccatg tgaacaactc aaacttaaac tatttccaga agcttcaaaa ggtcaatgca 540accaacttcc aggccctggc tgcagagttt ggaggcgaat cattcacttc aacattccaa 600actcaatcac caccatcttt ttacagggct ggggacccca ttcttactta cttccccaag 660tggtctgtaa taagcttgct gagacaacct gcaggagttg gagctggggg actctgtgct 720gaaagcaatc ctgcaggttt cctagagagt aaaagtacaa cttgcactcg ttttttcaag 780aacctggcta gtagctgtac cttggattca gccctcaatg ctgcctctta ctataacttc 840acagtcttaa aggttccaag aagcatgact gatccacaga atatggagtt ccaggttcct 900gtaatactta cctcacaggc taatgctcct ctgttggctg gaaacacttg tcagaatgta 960gtttctcagg tcacctatga gatagagacc aatgggactt ttggaatcca gaaagtttct 1020gtcagtttgg gacaaaccaa cctgactgtt gagccaggcg cttccttaca gcaacacttc 1080atccttcgct tcagggcttt tcaacagagc acagctgctt ctctcaccag tcctagaagt 1140gggaatcctg gctatatagt tgggaagcca ctcttggctc tgactgatga tataagttac 1200tcagtatcct ttttagagct gggtggcctg ttgcagccta atgagaaaag ctgcaaaggc 1260tttcaaactt atgttagact agccaaaggt gaggaatttt ttgttcatta taatgaggta 1320cttatatact aatatatggt taatcatttt tggaatctag ttgtctctct gtggttttct 1380gaggaaaaaa atcacaaatt tgtgactcga acattatgat agtaatacaa aataaatagc 1440attaaaggag aatgagaaca taaa 1464322734DNAHomo sapiens 32ggttgccagg caacggaggc acggcccggc ccgcgttaag gaggagggcg cagaccgaag 60gacactgaaa gagctgtaac aaccccactt tcgattggtt gaagagctct cagccttctc 120atgagccaat gagaagaggc acgcggatgg cgtcagacgc tatgcgactc ctcccaccca 180cgctctggca atgcgattgg agaccgcgga ggcctacgtc ggacccggag gccctgaatg 240ccccatgcgc accccacagc tcgcgctcct gcaagtgttc tttctggtgt tccccgatgg 300cgtccggcct cagccctctt cctccccatc aggggcagtg cccacgtctt tggagctgca 360gcgagggacg gatggcggaa ccctccagtc cccttcagag gcgactgcaa ctcgcccggc 420cgtgcctgga ctccctacag tggtccctac tctcgtgact ccctcggccc ctgggaatag 480gactgtggac ctcttcccag tcttaccgat ctgtgtctgt gacttgactc ctggagcctg 540cgatataaat tgctgctgcg acagggactg ctatcttctc catccgagga cagttttctc 600cttctgcctt ccaggcagcg taaggtcttc aagctgggtt tgtgtagaca actctgttat 660cttcaggagt aattccccgt ttccttcaag agttttcatg gattctaatg gaatcaggca 720gttttgtgtc catgtgaaca actcaaactt aaactatttc cagaagcttc aaaaggtcaa 780tgcaaccaac ttccaggccc tggctgcaga gtttggaggc gaatcattca cttcaacatt 840ccaaactcaa tcaccaccat ctttttacag ggctggggac cccattctta cttacttccc 900caagtggtct gtaataagct tgctgagaca acctgcagga gttggagctg ggggactctg 960tgctgaaagc aatcctgcag gtttcctaga gagtaaaagt acaacttgca ctcgtttttt 1020caagaacctg gctagtagct gtaccttgga ttcagccctc aatgctgcct cttactataa 1080cttcacagtc ttaaaggttc caagaagcat gactgatcca cagaatatgg agttccaggt 1140tcctgtaata cttacctcac aggctaatgc tcctctgttg gctggaaaca cttgtcagaa 1200tgtagtttct caggtcacct atgagataga gaccaatggg acttttggaa tccagaaagt 1260ttctgtcagt ttgggacaaa ccaacctgac tgttgagcca ggcgcttcct tacagcaaca 1320cttcatcctt cgcttcaggg cttttcaaca gagcacagct gcttctctca ccagtcctag 1380aagtgggaat cctggctata tagttgggaa gccactcttg gctctgactg atgatataag 1440ttactcaatg accctcttac agagccaggg taatggaagt tgctctgtta aaagacatga 1500agtgcagttt ggagtgaatg caatatctgg atgcaagctc aggttgaaga aggcagactg 1560cagccacttg cagcaggaga tttatcagac tcttcatgga aggcccagac cagagtatgt 1620tgccatcttt ggtaatgctg acccagccca gaaaggaggg tggaccagga tcctcaacag 1680gcactgcagc atttcagcta taaactgtac ttcctgctgt ctcataccag tttccctgga 1740gatccaggta ttgtgggcat atgtaggtct cctgtccaac ccgcaagctc atgtatcagg 1800agttcgattc ctataccagt gccagtctat acaggattct

cagcaagtta cagaagtatc 1860tttgacaact cttgtgaact ttgtggacat tacccagaag ccacagcctc caaggggcca 1920acccaaaatg gactggaaat ggccattcga cttctttccc ttcaaagtgg cattcagcag 1980aggagtattc tctcaaaaat gctcagtctc tcccatcctt atcctgtgcc tcttactact 2040tggagttctc aacctagaga ctatgtgaag aaaagaaaat aatcagattt cagttttccc 2100tatgagaaac tctgaggcag ccacttatct tggctaaata gaacctcacc tgctcatgac 2160cagagagcat ttaggataat agaggaccta actgaaggaa tccttgtata tgaaaggagt 2220tattttagaa aagcaataaa aatattttat tcatcatagc tctctgcttt gggctctgca 2280ggccaccaga tacacatgag gcccctactt ctcaagctgg gaaggccaag agccttcctt 2340cagcctttct ggttatgtta cacctagctg aatgtttaca aggtctggat ccatcagccc 2400tcaggcacag ttgggccaag cagaaagaga gaaacacttc tgctgtcacc ttgaatgaac 2460tcaggaatag cttccctctg gactgtagag gagctaactg tttggaacag aaaactgctg 2520gctgttgatt ttgtctggtt cctttgccaa catctgggca caccctttgc ccagacacga 2580gtggggaaag cagttctttc tcctcagttt ccaaagtaaa tggggaatcc cagctttctt 2640ttctactagc aaatgaccct accatttatt tctgcctttt tcttccgttc attgtgagga 2700aaaataaaac tggttgagag ctttgttgta ctaa 273433631DNAHomo sapiens 33gaggctgagg tcggagtccc gattttctcc tgctgctgtg gcccggacat ggcgactccc 60ggccctgtga ttccggaggt cccctttgaa ccatcgaagc ctccagtcat tgaggggctg 120agccccactg tttacaggaa tccagagagt ttcaaggaaa agttcgttcg caagacccgc 180gagaacccgg tggtacccat aggttgcctg gccacggcgg ccgccctcac ctacggcctc 240tactccttcc accggggcaa cagccagcgc tctcagctca tgatgcgcac ccggatcgcc 300gcccagggtt tcacggtcgc agccatcttg ctgggtctgg ctgtcactgc tatgaagtct 360cgaccctaag cccagggtct ggccttgaaa gctccgcaga aatgattcca aaacccaggg 420agcaaccact ggccctaccg tgggacttac tccctcctct cctttgagag gcccatgtgt 480cgctggggag gaagtgaccc tttgtgtaac tgtaaccgaa agttttttca aaaatcctag 540atgctgttgt ttgaatgtta catacttcta tttgtgccac atctcccctc cactcccctg 600cttaataaac tctaaaaatc cacttgtatt t 631341085DNAHomo sapiens 34ggaggactgt gaggaagcgg gggaaggaag taaatcgccg agtgacctaa ggaatcaggg 60ggaggattag ggtctgctcc acagaaggct tacctctgaa agagtcgggg agggaatgcg 120cagccactcg ctgcctttat cccgagaagc ccctaacacc cctcgccgtg gtctgtacat 180ggtctgtacc tccggccgcg ctggctggta ggccagccac ctgggatggc agcctagttc 240tcccgccacc ttaccctgcc ctgactctaa tctgcattta attcagtcct tcttccggga 300gatttcggcg gagaatttct ttctcgcctt agctactgag gtcaaacctg aaataggctg 360tagactccac cagctgggta agaatgggaa gaagatcaga aaacctaaac tttggttgat 420ggactatttt gcccaggcaa aagcagggaa tctatgagga atatgaagac attcgtcggg 480agaactctgt tggcactttc cactgttcca tctgtggcct aggcatggcg actctcggct 540ttgtgactcc ggaggccccc tttgaatcat cgaagccccc catctttgag gggcttagcc 600ccactgttta cagcaatcca gagggtttca aggaaaagtt ccttcgcaag acccgcgaga 660atccggtggt acccataggt ttcctgtgca cggcggccgt cctcaccaac ggcctctact 720gcttccacca gggcaacagc caatgttcac ggcttatgat gcacacccag atcgccgccc 780agggcttcac cattgcagcc atcttgctgg gtctagctgc caccgctatg aagtctccac 840cctgagccca gggtcttgaa aactctgcag aaatcattcc aaaacccagg agcaaccact 900ggccctacca tgggacttac tctctcctct cctttgagag gtccctgtgt cgttggggga 960ggaagtgacc cttcctgtaa ccataactga aagatttttt caaaaatccc agattctgtt 1020gtttgaatgt tacatatttc tatttgtgcc acatcttccc tccactcccc tgcttaataa 1080actct 1085352593DNAHomo sapiens 35tggtgcgtcg cggcgtggtc ctccggcggc tgtccggggc ggtaggagtt ggctgcggga 60tgtgctcagc cggggagctg ctgcggggcg gcgacggcgg ggaacgcgac gaggacgggg 120acgcgctggc ggagcgggag gcggcaggga ccgggtggga tcccggggcg agcccgcggc 180ggcgcggaca gcggccgaag gagagcgagc aggatgttga agactcacag aaccacactg 240gtgagccggt tggagatgac tacaagaaaa tgggaacact ttttggtgaa ctgaacaaaa 300accttatcaa catgggcttc acaaggatgt attttggaga acgaatagtg gaaccagtaa 360tagtcatttt cttttgggtt atgctgtggt tccttggcct gcaagccctt ggactagttg 420ctgttctttg ccttgttatt atttatgtgc aacagtaaaa catggccgaa ttgaattgtt 480tgacatttgg tagccatata tgtaattgaa gaagttatat atttcacttt ttgacaaccg 540aaaaagtttg ccttgtttca aatcatgtgc tggctgtttt gtaagtaaat ttatacatgg 600atgtcactta aaactaaact cttgatcata acagggttga atatatattt tgaatataca 660ttagcttatt caaaactctt gtttcactac tgtgatctct gtctccttta tacacctcta 720tccccatgcc aaatcttaag taacaccacc agaaagtgaa cagggaaaat aacaggacat 780ggaattcaaa tcaagcaata tagttcttat aaagagttcc aataaaacat ttcagaagaa 840aaagtatgaa acaagctaaa agtaagtttc acttagaaaa cttctcccca ctcacactcc 900ccaccaaata atctcatatt atttgggaaa tatttggatt tcaattgtcc ctacccagcc 960taaactaagg taaatgataa ttagcataca ctaccttaat attgtgatga aaatcagtaa 1020agatagaacg ttttctaaag gtcaaaaata atatatttat tattactggg gaaagctccc 1080aggttaaata taactttttt aaaatgtaac atttggacct agacctactt taatatatca 1140tttgaagttt cagacaattt tggtgctaat tactttttgt gagtttttaa agtctcatag 1200cctagttgac tgcaccctat ggtaatgcca tattttcttg tatctaacaa gttgcatatt 1260ttttcctaga gagacatttt cagtgtattt ttttttagaa atttataatt ttatagttct 1320ttcataacac ttattctgag ttttgaaaca atgtatttcc tatcttgaca tggatttttt 1380cacaaaaaat ttgtatttta ctgttgtttt caggaaaaaa atcagatcat ttttctttga 1440tatctatatc agaaaggtac aatattaaca gtataaaacc aaatgcttaa atttggaact 1500tagccaattt tgataatctt tttctaaggc taaagtcaca tcagtaattg gctagccatg 1560ttattaaggt gtcttaattc agcattttca ggttttatat tgaaatacgc atttctttaa 1620atattctttg aaaatggaga atggctttag tgatattttg ggttttgtta gagaacctaa 1680aatctttaca ctttcatctc aaagattata aaggaaaggg gggtagttaa gatttagaat 1740tcaagttaaa tttcagaaat tggggcagtc aggcatttgt atctttggta gggcaacaag 1800taaaacatgt agagtgcttg ctatcccact tcataaagct tttacccaat cttatttcta 1860aacctctgtg cattcttagt gtcttctcat tctgaaacag aaaataagga aaaacattta 1920acttagtttt ctaaaatcag ataatcctaa acaaaaatgt tagtcagggt cactaaaaag 1980tattgcacat ttatataaat acagtccttt taaaatttga cttttaaaaa acaaaagact 2040ttgtacgata ttgtgttttt attgcttttg caatattttt atagtagcct ttatgaactc 2100agtataagtg caagttgttt gaaaaggtgt ttttattagt gcacaataga attgtgaggt 2160tttcaataga tgtcatgaga ttttgtatat ctacataaaa tatcagtaca tttttttcta 2220atgctactgg aaattttact tttcctttgc aacacataaa tgatatgatg tacaaaataa 2280cagctctggt tccaccagta cctaatgttg aaaacatttt taaagtaatt tttaatacta 2340actatttagt atactgtcag tactgtacat ctgcacactg gtgttaatag ggtatatatt 2400aaattatata aagaaataag atattttgct gttattcttt ctacatatat tattggtcag 2460tacatcaaat aatatttggc tttgatatgg gaaaaaacaa actttgccta tgtaatggaa 2520ataaaatatt ttcttttatg aaatatatta gaatgcagat tatactaata tcctgaaata 2580aaactggtaa ttt 2593363697DNAHomo sapiens 36aggcaacctc cagccagtcc ctgggtcggg cggatcctcc cagaggtggc acaatggagc 60gatctccagg agagggcccc agccccagcc ccatggacca gccctctgct ccctccgacc 120ccactgacca gccccccgct gctcacgcaa agccagaccc aggttctggg ggccaacctg 180ctggccctgg cgcggcgggt gaggccctgg cggtgctgac ttcattcggg aggcggttgc 240tggtgctgat acctgtgtat ttggccgggg cagtgggact cagcgtgggt ttcgtgctct 300tcggcctcgc cctctacctg ggctggcgcc gggtccgcga cgagaaagaa cggagccttc 360gagcagcgag gcagctactg gacgacgagg agcagctcac tgcgaaaact ctctatatga 420gtcatcgaga gctacctgcc tgggtcagct tcccagacgt ggaaaaggct gaatggctca 480ataagattgt ggcccaggtc tggcccttcc tgggccagta tatggagaag cttctggctg 540aaactgtggc tccggctgtt aggggatcta acccccatct gcaaacattt acatttacac 600gagtggaact gggtgaaaag ccattgcgca tcattggagt caaggttcac ccaggtcaga 660gaaaagagca gatcctgctg gacttgaaca tcagctatgt aggtgatgtg cagattgatg 720tggaagtgaa gaaatatttt tgcaaagcag gagtcaaggg catgcagcta catggcgttt 780tgcgggtgat actggagcca ctcattgggg accttccctt cgtgggggct gtgtcaatgt 840tcttcatccg acgcccgacc ctagacatca actggacagg gatgaccaac ctgctggata 900tcccaggact tagctcactc tctgacacca tgatcatgga ctccattgct gccttcctcg 960tgttgcccaa ccgattactg gtgccccttg tgcctgacct tcaagatgtg gctcagttgc 1020gttcccctct gcccaggggc attattcgaa ttcacctgct ggctgctcga gggctgagtt 1080ccaaggacaa atatgtgaag ggcctgattg agggcaagtc agacccatat gcacttgtgc 1140gtttgggtac ccagacattc tgcagtcgtg tcattgatga agaactcaac ccacagtggg 1200gagagactta tgaggtgatg gtacacgagg tcccagggca ggagattgaa gtggaggtgt 1260tcgacaagga tccagataaa gatgactttc tgggcagaat gaagctggat gtagggaagg 1320tgttacaggc tagcgttctg gatgattggt tccctctaca aggtgggcaa ggccaagttc 1380acttgaggct agaatggctg tcacttttgt cagatgcaga gaaactggag caggttctac 1440agtggaattg gggagtctcc tctcgaccag atcccccgtc agctgccatc ttagttgtct 1500acctggatcg ggcccaggat cttcctctga agaaggggaa caaggaaccc aaccctatgg 1560tacaactgtc aattcaggat gtgactcagg agagcaaggc tgtctacagt accaactgcc 1620cagtgtggga ggaagcgttc cggttcttcc tacaagaccc tcaaagccag gagctcgatg 1680tgcaagtgaa ggatgattcc agggccctga ctttaggagc actgacgctg cctctggccc 1740gcctgctgac tgccccagaa ctcatcctgg accagtggtt ccagctcagc agctctggtc 1800caaactccag actctatatg aaactagtca tgaggatcct gtacttggat tcatcagaaa 1860tatgcttccc cacggtgcct ggttgtcctg gtgcttggga cgtggacagt gagaatcccc 1920agagaggcag cagtgtggat gccccacctc gaccctgtca cacgactcct gatagccagt 1980ttgggactga gcatgtgctt cggatccatg tattagaggc ccaggacctg attgccaaag 2040accgtttctt ggggggactg gtgaagggca agtcagaccc ctatgtcaaa ctaaagttgg 2100caggacgaag cttccggagc catgttgttc gggaagatct caatccccgc tggaatgagg 2160tttttgaggt gatcgtcaca tcagttccag gccaagagct agaggttgaa gtctttgaca 2220aggacttgga caaggatgat tttctgggca ggtgtaaagt gcgtctcacc acagtcttaa 2280acagtggctt ccttgatgag tggctgaccc tggaggatgt cccatctggc cgcctgcact 2340tgcgcctgga gcgtctcacc ccccgtccca ctgctgctga gttagaggag gtgctgcagg 2400tgaatagttt gatccagact cagaagagtg cggagctggc tgcggccctg ctatccatct 2460atatggagcg ggcagaggac ctcccgctgc gaaaaggcac caagcacctc agcccttatg 2520ctactctcac tgtgggagat agttctcata aaaccaagac tatttcgcaa acttcagccc 2580ctgtctggga tgagagtgcc tcctttctca tcaggaaacc acacactgag agcctagagt 2640tgcaggttcg gggtgagggc actggcgtgc tgggctcatt atccctgccc ctctcagagc 2700tcctcgtggc tgaccagctc tgcttggacc gctggtttac actcagcagt ggtcaggggc 2760aggtgctact gagagcacag ctagggatcc tggtgtccca gcactcggga gtggaagctc 2820atagccacag ctacagccac agctcctcat cgctgagtga agaaccagag ctctcggggg 2880gaccccctca catcacctcc tcagccccag agctccggca gcgcctaaca catgttgaca 2940gtccccttga ggctccagcc gggcctctgg gccaggtgaa actgactctg tggtactaca 3000gtgaagaacg aaagctggtc agcattgttc atggttgccg gtcccttcga cagaatggac 3060gtgatcctcc tgatccctat gtgtcactgt tgctactgcc agacaagaac cgaggcacca 3120agaggaggac ctcacagaag aagaggaccc tgagtcctga atttaatgaa cggtttgagt 3180gggaactccc cctggatgag gcccagagac gaaagctgga tgtctctgtc aagtctaatt 3240cctccttcat gtcaagagag cgtgagctgc tggggaaggt gcagctggac ctagctgaga 3300cagacctttc ccagggtgta gcccggtggt atgacctgat ggacaacaag gacaagggca 3360gctcctagga gctggcgagt cccagcctga ctgctctgtc ttcctgcctt cgtctcgctc 3420catcaccgcc tcaatgtgat gagcctaaag ctagggtcca agggcagagc ctgtgccctt 3480cagccctttc acctaacagg cccatattcg ggcctttgcc tgaccaaaga gaagaaccgt 3540atgttccctt tactgcacgg cctttatcct tctgggcccc tggggcgggg acctgagctg 3600gctgtttcct gctttgcctg cacattgttc tcccttcctc ccaactcctc agggccttct 3660gtatctgtgc ctggatctta cattaaacat catactc 3697373727DNAHomo sapiens 37aggcaacctc cagccagtcc ctgggtcggg cggatcctcc cagaggtggc acaatggagc 60gatctccagg agagggcccc agccccagcc ccatggacca gccctctgct ccctccgacc 120ccactgacca gccccccgct gctcacgcaa agccagaccc aggttctggg ggccaacctg 180ctggccctgg cgcggcgggt gaggccctgg cggtgctgac ttcattcggg aggcggttgc 240tggtgctgat acctgtgtat ttggccgggg cagtgggact cagcgtgggt ttcgtgctct 300tcggcctcgc cctctacctg ggctggcgcc gggtccgcga cgagaaagaa cggagccttc 360gagcagcgag gcagctactg gacgacgagg agcagctcac tgcgaaaact ctctatatga 420gtcatcgaga gctacctgcc tgggtcagct tcccagacgt ggaaaaggct gaatggctca 480ataagattgt ggcccaggtc tggcccttcc tgggccagta tatggagaag cttctggctg 540aaactgtggc tccggctgtt aggggatcta acccccatct gcaaacattt acatttacac 600gagtggaact gggtgaaaag ccattgcgca tcattggagt caaggttcac ccaggtcaga 660gaaaagagca gatcctgctg gacttgaaca tcagctatgt aggtgatgtg cagattgatg 720tggaagtgaa gaaatatttt tgcaaagcag gagtcaaggg catgcagcta catggcgttt 780tgcgggtgat actggagcca ctcattgggg accttccctt cgtgggggct gtgtcaatgt 840tcttcatccg acgcccgacc ctagacatca actggacagg gatgaccaac ctgctggata 900tcccaggact tagctcactc tctgacacca tgatcatgga ctccattgct gccttcctcg 960tgttgcccaa ccgattactg gtgccccttg tgcctgacct tcaagatgtg gctcagttgc 1020gttcccctct gcccaggggc attattcgaa ttcacctgct ggctgctcga gggctgagtt 1080ccaaggacaa atatgtgaag ggcctgattg agggcaagtc agacccatat gcacttgtgc 1140gtttgggtac ccagacattc tgcagtcgtg tcattgatga agaactcaac ccacagtggg 1200gagagactta tgaggtgatg gtacacgagg tcccagggca ggagattgaa gtggaggtgt 1260tcgacaagga tccagataaa gatgactttc tgggcagaat gaagctggat gtagggaagg 1320tgttacaggc tagcgttctg gatgattggt tccctctaca aggtgggcaa ggccaagttc 1380acttgaggct agaatggctg tcacttttgt cagatgcaga gaaactggag caggttctac 1440agtggaattg gggagtctcc tctcgaccag atcccccgtc agctgccatc ttagttgtct 1500acctggatcg ggcccaggat cttcctatgg tgacctctga attgtaccca ccacagctga 1560agaaggggaa caaggaaccc aaccctatgg tacaactgtc aattcaggat gtgactcagg 1620agagcaaggc tgtctacagt accaactgcc cagtgtggga ggaagcgttc cggttcttcc 1680tacaagaccc tcaaagccag gagctcgatg tgcaagtgaa ggatgattcc agggccctga 1740ctttaggagc actgacgctg cctctggccc gcctgctgac tgccccagaa ctcatcctgg 1800accagtggtt ccagctcagc agctctggtc caaactccag actctatatg aaactagtca 1860tgaggatcct gtacttggat tcatcagaaa tatgcttccc cacggtgcct ggttgtcctg 1920gtgcttggga cgtggacagt gagaatcccc agagaggcag cagtgtggat gccccacctc 1980gaccctgtca cacgactcct gatagccagt ttgggactga gcatgtgctt cggatccatg 2040tattagaggc ccaggacctg attgccaaag accgtttctt ggggggactg gtgaagggca 2100agtcagaccc ctatgtcaaa ctaaagttgg caggacgaag cttccggagc catgttgttc 2160gggaagatct caatccccgc tggaatgagg tttttgaggt gatcgtcaca tcagttccag 2220gccaagagct agaggttgaa gtctttgaca aggacttgga caaggatgat tttctgggca 2280ggtgtaaagt gcgtctcacc acagtcttaa acagtggctt ccttgatgag tggctgaccc 2340tggaggatgt cccatctggc cgcctgcact tgcgcctgga gcgtctcacc ccccgtccca 2400ctgctgctga gttagaggag gtgctgcagg tgaatagttt gatccagact cagaagagtg 2460cggagctggc tgcggccctg ctatccatct atatggagcg ggcagaggac ctcccgctgc 2520gaaaaggcac caagcacctc agcccttatg ctactctcac tgtgggagat agttctcata 2580aaaccaagac tatttcgcaa acttcagccc ctgtctggga tgagagtgcc tcctttctca 2640tcaggaaacc acacactgag agcctagagt tgcaggttcg gggtgagggc actggcgtgc 2700tgggctcatt atccctgccc ctctcagagc tcctcgtggc tgaccagctc tgcttggacc 2760gctggtttac actcagcagt ggtcaggggc aggtgctact gagagcacag ctagggatcc 2820tggtgtccca gcactcggga gtggaagctc atagccacag ctacagccac agctcctcat 2880cgctgagtga agaaccagag ctctcggggg gaccccctca catcacctcc tcagccccag 2940agctccggca gcgcctaaca catgttgaca gtccccttga ggctccagcc gggcctctgg 3000gccaggtgaa actgactctg tggtactaca gtgaagaacg aaagctggtc agcattgttc 3060atggttgccg gtcccttcga cagaatggac gtgatcctcc tgatccctat gtgtcactgt 3120tgctactgcc agacaagaac cgaggcacca agaggaggac ctcacagaag aagaggaccc 3180tgagtcctga atttaatgaa cggtttgagt gggaactccc cctggatgag gcccagagac 3240gaaagctgga tgtctctgtc aagtctaatt cctccttcat gtcaagagag cgtgagctgc 3300tggggaaggt gcagctggac ctagctgaga cagacctttc ccagggtgta gcccggtggt 3360atgacctgat ggacaacaag gacaagggca gctcctagga gctggcgagt cccagcctga 3420ctgctctgtc ttcctgcctt cgtctcgctc catcaccgcc tcaatgtgat gagcctaaag 3480ctagggtcca agggcagagc ctgtgccctt cagccctttc acctaacagg cccatattcg 3540ggcctttgcc tgaccaaaga gaagaaccgt atgttccctt tactgcacgg cctttatcct 3600tctgggcccc tggggcgggg acctgagctg gctgtttcct gctttgcctg cacattgttc 3660tcccttcctc ccaactcctc agggccttct gtatctgtgc ctggatctta cattaaacat 3720catactc 3727384171DNAHomo sapiens 38caacctccag ccagtccctg ggtcgggcgg atcctcccag aggtggcaca atggagcgat 60ctccaggaga gggccccagc cccagcccca tggaccagcc ctctgctccc tccgacccca 120ctgaccagcc ccccgctgct cacgcaaagc cagacccagg ttctgggggc caacctgctg 180gccctggcgc ggcgggtgag gccctggcgg tgctgacttc attcgggagg cggttgctgg 240tgctgatacc tgtgtatttg gccggggcag tgggactcag cgtgggtttc gtgctcttcg 300gcctcgccct ctacctgggc tggcgccggg tccgcgacga gaaagaacgg agccttcgag 360cagcgaggca gctactggac gacgaggagc agctcactgc gaaaactctc tatatgagtc 420atcgagagct acctgcctgg gtcagcttcc cagacgtgga aaaggctgaa tggctcaata 480agattgtggc ccaggtctgg cccttcctgg gccagtatat ggagaagctt ctggctgaaa 540ctgtggctcc ggctgttagg ggatctaacc cccatctgca aacatttaca tttacacgag 600tggaactggg tgaaaagcca ttgcgcatca ttggagtcaa ggttcaccca ggtcagagaa 660aagagcagat cctgctggac ttgaacatca gctatgtagg tgatgtgcag attgatgtgg 720aagtgaagaa atatttttgc aaagcaggag tcaagggcat gcagctacat ggcgttttgc 780gggtgatact ggagccactc attggggacc ttcccttcgt gggggctgtg tcaatgttct 840tcatccgacg cccgacccta gacatcaact ggacagggat gaccaacctg ctggatatcc 900caggacttag ctcactctct gacaccatga tcatggactc cattgctgcc ttcctcgtgt 960tgcccaaccg attactggtg ccccttgtgc ctgaccttca agatgtggct cagttgcgtt 1020cccctctgcc caggggcatt attcgaattc acctgctggc tgctcgaggg ctgagttcca 1080aggacaaata tgtgaagggc ctgattgagg gcaagtcaga cccatatgca cttgtgcgtt 1140tgggtaccca gacattctgc agtcgtgtca ttgatgaaga actcaaccca cagtggggag 1200agacttatga ggtgatggta cacgaggtcc cagggcagga gattgaagtg gaggtgttcg 1260acaaggatcc agataaagat gactttctgg gcagaatgaa gctggatgta gggaaggtgt 1320tacaggctag cgttctggat gattggttcc ctctacaagg tgggcaaggc caagttcact 1380tgaggctaga atggctgtca cttttgtcag atgcagagaa actggagcag gttctacagt 1440ggaattgggg agtctcctct cgaccagatc ccccgtcagc tgccatctta gttgtctacc 1500tggatcgggc ccaggatctt cctctgaaga aggggaacaa ggaacccaac cctatggtac 1560aactgtcaat tcaggatgtg actcaggaga gcaaggctgt ctacagtacc aactgcccag 1620tgtgggagga agcgttccgg ttcttcctac aagaccctca aagccaggag ctcgatgtgc 1680aagtgaagga tgattccagg gccctgactt taggagcact gacgctgcct ctggcccgcc 1740tgctgactgc cccagaactc atcctggacc agtggttcca gctcagcagc tctggtccaa 1800actccagact ctatatgaaa ctagtcatga ggatcctgta cttggattca tcagaaatat 1860gcttccccac ggtgcctggt tgtcctggtg cttgggacgt ggacagtgag aatccccaga 1920gaggcagcag tgtggatgcc ccacctcgac cctgtcacac gactcctgat agccagtttg 1980ggactgagca tgtgcttcgg atccatgtat tagaggccca ggacctgatt gccaaagacc 2040gtttcttggg gggactggtg aagggcaagt cagaccccta

tgtcaaacta aagttggcag 2100gacgaagctt ccggagccat gttgttcggg aagatctcaa tccccgctgg aatgaggttt 2160ttgaggtgat cgtcacatca gttccaggcc aagagctaga ggttgaagtc tttgacaagg 2220acttggacaa ggatgatttt ctgggcaggt gtaaagtgcg tctcaccaca gtcttaaaca 2280gtggcttcct tgatgagtgg ctgaccctgg aggatgtccc atctggccgc ctgcacttgc 2340gcctggagcg tctcaccccc cgtcccactg ctgctgagtt agaggaggtg ctgcaggtga 2400atagtttgat ccagactcag aagagtgcgg agctggctgc ggccctgcta tccatctata 2460tggagcgggc agaggacctc ccgctgcgaa aaggcaccaa gcacctcagc ccttatgcta 2520ctctcactgt gggagatagt tctcataaaa ccaagactat ttcgcaaact tcagcccctg 2580tctgggatga gagtgcctcc tttctcatca ggaaaccaca cactgagagc ctagagttgc 2640aggttcgggg tgagggcact ggcgtgctgg gctcattatc cctgcccctc tcagagctcc 2700tcgtggctga ccagctctgc ttggaccgct ggtttacact cagcagtggt caggggcagg 2760tgctactgag agcacagcta gggatcctgg tgtcccagca ctcgggagtg gaagctcata 2820gccacagcta cagccacagc tcctcatcgc tgagtgaaga accagagctc tcggggggac 2880cccctcacat cacctcctca gccccagagc tccggcagcg cctaacacat gttgacagtc 2940cccttgaggc tccagccggg cctctgggcc aggtgaaact gactctgtgg tactacagtg 3000aagaacgaaa gctggtcagc attgttcatg gttgccggtc ccttcgacag aatggacgtg 3060atcctcctga tccctatgtg tcactgttgc tactgccaga caagaaccga ggcaccaaga 3120ggaggacctc acagaagaag aggaccctga gtcctgaatt taatgaacgg tttgagtggg 3180aactccccct ggatgaggcc cagagacgaa agctggatgt ctctgtcaag tctaattcct 3240ccttcatgtc aagagagcgt gagctgctgg ggaaggtgca gctggaccta gctgagacag 3300acctttccca gggtgtagcc cggtggtatg acctgatgga caacaaggac aagggcagct 3360cctaggagct ggcgagtccc agcctgactg ctctgtcttc ctgccttcgt ctcgctccat 3420caccgcctca atgtgatgag cctaaagcta gggtccaagg gcagagcctg tgcccttcag 3480ccctttcacc taacaggccc atattcgggc ctttgcctga ccaaagagaa gaaccgtatg 3540ttccctttac tgcacggcct ttatccttct gggcccctgg ggcggggacc tgagctggct 3600gtttcctgct ttgcctgcac attgttctcc cttcctccca actcctcagg gccttctgta 3660tctgtgcctg gccagtggca gcactagcag tggtattagc ttatgccaaa tacagctttg 3720gaaggatctt tttttcttta actagatggt caccttcttc cctaccacac atgggtggga 3780aggtggacag gctaacctct ccagctgtga gcctcttaga ctactgcatg tagcaaatgt 3840tcagcagctc aggcccccat gtccagttct gtccccactg tcctcaaccc tgtcctgaaa 3900attctactgc tttgatggct ggggccagtc tcttgtcact ttggaaactg aggacgcgtg 3960gattctactc aagcctccaa gtagtggcat atcagtcttg gagctcctag ctggtgatac 4020ggagagggct ttggaggact tgggacagca gggccaattt ttttgcccaa gtgcctaggc 4080tgctaactca ctgactagaa cttaatctgg tactttacag ttttgcacca actctgccaa 4140gccactggat cttacattaa acatcatact c 41713921DNAHomo sapiens 39ttgaacttgt tgaccagatt a 214021DNAHomo sapiens 40ttgcgtgaat gttgttcttg a 214121DNAHomo sapiens 41tgcatccgtc cagtttatta a 214221DNAHomo sapiens 42aagcctatag ttagacaacc a 214321DNAHomo sapiens 43tggctcgaaa taatacgtgt a 214421DNAHomo sapiens 44ttggaactat accaagaacg a 214521DNAHomo sapiens 45ttggctctga ctgatgatat a 214621DNAHomo sapiens 46aacccgcaag ctcatgtatc a 214721DNAHomo sapiens 47caggattctc agcaagttac a 214821DNAHomo sapiens 48cacggcggcc gccctcacct a 214921DNAHomo sapiens 49ctccgcagaa atgattccaa a 215021DNAHomo sapiens 50atcctagatg ctgttgtttg a 215121DNAHomo sapiens 51ttggacctag acctacttta a 215221DNAHomo sapiens 52cccagcctaa actaaggtaa a 215321DNAHomo sapiens 53aacgaatagt ggaaccagta a 215421DNAHomo sapiens 54gtgggagata gttctcataa a 215521DNAHomo sapiens 55acgcccgacc ctagacatca a 21

Claims

1. A tumor marker which is selected from the group consisting of: a) Tectonic-1 (TCTN1) protein, in one of its isoforms SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8 or a different isoform thereof having sequence identity of at least 80%, preferably at least 90%, more preferably at least 95% to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8; or a nucleic acid molecule containing a sequence coding for a TCTN1 protein, said encoding sequence being preferably selected from SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26 and SEQ ID NO:27; b) Tectonic-2 (TCTN2) protein, SEQ ID NO:9 or an isoform thereof having sequence identity of at least 80%, preferably at least 90%, more preferably at least 95% to SEQ ID NO:9; or a nucleic acid molecule containing a sequence coding for a TCTN2 protein, said encoding sequence being preferably SEQ ID NO: 28; c) Tectonic-3 (TCTN3) protein, in one of its isoforms SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12 or SEQ ID NO:13, or a different isoform thereof having sequence identity of at least 80%, preferably at least 90%, more preferably at least 95% to SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12 or SEQ ID NO:13; or a nucleic acid molecule containing a sequence coding for a TCTN3 protein, said encoding sequence being preferably selected from SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31 and SEQ ID NO:32; d) Hypoxia induced protein A (HIGD2A), SEQ ID NO:14 or an isoform thereof having sequence identity of at least 80%, preferably at least 90%, more preferably at least 95% to SEQ ID NO:14; or a nucleic acid molecule containing a sequence coding for a HIGD2A protein, said encoding sequence being preferably SEQ ID NO:33; e) Hypoxia induced protein B (HIGD2B), SEQ ID NO:15 or an isoform thereof having sequence identity of at least 80%, preferably at least 90%, more preferably at least 95% to SEQ ID NO:15; or a nucleic acid molecule containing a sequence coding for a HIGD2B protein, said encoding sequence being preferably SEQ ID NO:34; f) C4orf32 protein, SEQ ID NO:16, or an isoform thereof having sequence identity of at least 80%, preferably at least 90%, more preferably at least 95% to SEQ ID NO:16; or a nucleic acid molecule containing a sequence coding for a C4orf32 protein, said encoding sequence being preferably SEQ ID NO:35; g) FAM62A protein, in one of its variant isoforms SEQ ID NO:17, SEQ ID NO:18 or SEQ ID NO:19, or a different isoform having sequence identity of at least 80%, preferably at least 90%, more preferably at least 95% to any of SEQ ID NO:17, SEQ ID NO:18 or SEQ ID NO:19; or a nucleic acid molecule containing a sequence coding for a FAM62A protein, said encoding sequence being preferably selected from SEQ ID NO: 36, SEQ ID NO: 37 and SEQ ID NO: 38.

2. A tumor marker according to claim 1 selected from TCTN1, TCTN2, TCTN3, C4orf32 and FAM62A, or a combination thereof.

3. A tumor marker according to claim 1 selected from C4orf32 and FAM62A, or a combination thereof.

4. A tumor marker according to claim 1 selected from TCTN1, TCTN2, TCTN3, HIGD2A, HIGD2B and FAM62A, or a combination thereof.

5. A tumor marker according to claim 1 selected from TCTN1, TCTN2, TCTN3, HIGD2A, HIGD2B and FAM62A, or a combination thereof.

6. A method of screening a tissue sample for malignancy, which comprises determining the presence in said sample of at least one of the tumor markers of claim 1.

7. A method according to claim 6, wherein the tissue sample is a sample of colon or colo-rectal tissue, said method comprising determining the presence in said sample of a tumor marker selected from TCTN1, TCTN2, TCTN3, HIGD2A, HIGD2B and FAM62A, or a combination thereof.

8. A method according to claim 6, wherein the tissue sample is a sample of lung tissue, said method comprising determining the presence in said sample of a tumor marker selected from TCTN1, TCTN2, TCTN3, C4orf32 and FAM62A, or a combination thereof.

9. A method according to claim 6, wherein the tissue sample is a sample of breast tissue, said method comprising determining the presence in said sample of a tumor marker selected from C4orf32 and FAM62A, or a combination thereof.

10. A method according to claim 6, wherein the tissue sample is a sample of ovary tissue, said method comprising determining the presence in said sample of a tumor marker selected from TCTN1, TCTN2, TCTN3, HIGD2A, HIGD2B and FAM62A, or a combination thereof.

11. A method according to claim 6, wherein the tumor marker is a protein, wherein said method comprises immunoradiometric, immunoenzymatic or immunohistochemical techniques.

12. A method according to claim 6, wherein the tumor marker is a nucleic acid molecule, said method comprising polymerase chain reaction techniques.

13. An in vitro method for determining the presence of a tumor in a subject comprising: (1) providing a sample of a tissue sample; (2) determining the presence of a tumor marker according to claim 1 in said tissue sample by detecting the expression of a tumor marker protein or the presence of a respective mRNA transcript; wherein the detection of one or more tumor markers in the tissue sample is indicative of the presence of tumor in said subject.

14. A method of screening a test compound as an antitumor candidate, which comprises contacting cells expressing a tumor marker protein according to claim 1 with the test compound, and determining the binding of said compound to said cells.

15. An antibody or a fragment thereof which is able to specifically recognize and bind to one of the tumor marker proteins according to claim 1.

16. An antibody according to claim 15, which is either monoclonal or polyclonal.

17. A siRNA having a sequence complementary to one of SEQ ID NOs: 39-55.

18. Method for treating proliferative diseases of lungs, breast, colorectal, ovarian and colon comprising interacting with lungs, breast, colorectal, ovarian and colon tissue with an antibody according to claim 15, or with a siRNA having a sequence complementary to one of SEQ ID NOs: 39-55; and detecting lungs, breast, colorectal, ovarian and colon tumor markers.

19. A diagnostic kit containing an antibody or a fragment thereof capable of specifically recognizing and binding to one of the tumor marker proteins according to claim 1, and reagents, buffers, solutions and materials to carry out an immunoassay or a PCR assay.

20. A diagnostic kit containing an oligonucleotide complementary to a nucleic molecule encoding a tumor marker according to claim 1, and reagents, buffers, solutions and materials to carry out an immunoassay or a PCR assay.