U.S. patent application number 12/292038 was filed with the patent office on 2012-02-16 for primers, probes and methods for nucleic acid amplification.
This patent application is currently assigned to Brandeis University. Invention is credited to Cristina Hartshorn, Kenneth Pierce, Arthur Reis, John Rice, Jesse Salk, J. Aquiles Sanchez, Lawrence J. Wangh.
Application Number | 20120040352 12/292038 |
Document ID | / |
Family ID | 36203686 |
Filed Date | 2012-02-16 |
United States Patent
Application |
20120040352 |
Kind Code |
A1 |
Wangh; Lawrence J. ; et
al. |
February 16, 2012 |
Primers, probes and methods for nucleic acid amplification
Abstract
Homogenous detection during or following PCR amplification,
preferably LATE-PCR, utilizing fluorescent DNA dye and indirectly
excitable labeled primers and probes, improves reproducibility and
quantification. Low-temperature homogeneous detection during or
following non-symmetric PCR amplification, preferably LATE-PCR,
utilizing fluorescent DNA dye and indirectly excitable labeled
mismatch-tolerant probes permits analysis of complex targets.
Sequencing sample preparation methods following LATE-PCR
amplifications reduce complexity and permit "single-tube"
processing.
Inventors: |
Wangh; Lawrence J.;
(Auburndale, MA) ; Rice; John; (Quincy, MA)
; Sanchez; J. Aquiles; (Framingham, MA) ; Pierce;
Kenneth; (Natick, MA) ; Salk; Jesse; (Seattle,
WA) ; Reis; Arthur; (Arlington, MA) ;
Hartshorn; Cristina; (Needham, MA) |
Assignee: |
Brandeis University
|
Family ID: |
36203686 |
Appl. No.: |
12/292038 |
Filed: |
November 10, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11252433 |
Oct 17, 2005 |
7632642 |
|
|
12292038 |
|
|
|
|
60619654 |
Oct 18, 2004 |
|
|
|
Current U.S.
Class: |
435/6.12 ;
435/183; 435/91.2; 536/24.3; 536/24.33 |
Current CPC
Class: |
C12Q 1/6869 20130101;
C12Q 1/6851 20130101; C12Q 2600/16 20130101; C12Q 2561/113
20130101; C12Q 2600/156 20130101; C12Q 1/6844 20130101; C12Q 1/6876
20130101; C12Q 1/6844 20130101; C12Q 1/6851 20130101; C12Q 2545/114
20130101; C12Q 2527/107 20130101; C12Q 2531/107 20130101; C12Q
2531/107 20130101; C12Q 2527/107 20130101 |
Class at
Publication: |
435/6.12 ;
536/24.3; 536/24.33; 435/91.2; 435/183 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C12P 19/34 20060101 C12P019/34; C12N 9/00 20060101
C12N009/00; C07H 21/04 20060101 C07H021/04 |
Claims
1.-24. (canceled)
25. A double-stranded nucleic acid hybridization probe for a
preselected nucleic acid target sequence comprising: (a) a first
oligonucleotide comprising a first sequence perfectly complementary
to said target sequence and having a calculated melting temperature
(T.sub.m) with respect to said target sequence of 30-55.degree. C.;
(b) a second oligonucleotide comprising a second sequence that is
complementary to said first sequence but is shorter than said first
sequence by up to ten nucleotides; (c) a fluorophore label attached
to said first sequence that is excitable by fluorescence emission
from a fluorescent DNA dye but is not excitable at the maximum
absorption wavelength of said dye; and (d) a non-fluorescent
quencher attached to said second sequence.
26. An oligonucleotide set comprising (a) a pair of LATE-PCR
primers for amplifying a preselected target sequence and (b) a
probe according to claim 25.
27. A low-temperature, mismatch tolerant, single-stranded
oligonucleotide hybridization probe having a first calculated
melting temperature with respect to its perfect complement of not
more than 60.degree. C., said probe including a stem-loop hairpin
having a stem whose calculated melting temperature is at least
10.degree. C. lower than said first melting temperature but not
lower than 30.degree. C., said probe comprising a fluorophore
capable of absorption of fluorescence energy emitted by a
fluorescent DNA dye and means to quench fluorescence that would
result from exposing said probe to said dye and exciting the dye in
the absence of a target for the probe.
28. A low-temperature linear oligonucleotide hybridization probe
(a) that is mismatch tolerant at temperatures in the range of
30-60.degree. C.; (b) that forms secondary structure in the
temperature range of 30.degree. C. to 50.degree. C.; and (c) is
dual-labeled with (i) a fluorophore that is excitable by
fluorescence emission from at least one fluorescent DNA dye but is
not excitable at the wavelength appropriate for exciting said dye;
and (ii) a non-fluorescence quencher located so as to substantially
quench fluorescence associated with said secondary structure but
not florescence associated with a probe-target hybrid.
29. The probe according to claim 28, wherein said secondary
structure is a stem formed by complementary terminal nucleotides,
said stem having a T.sub.m greater than the T.sub.m of any other
secondary structure the probe would form in the absence of the
stem.
30. A sequential DNA amplification-sequencing method comprising: a)
amplifying at least one DNA target by a LATE-PCR process to
generate an amplification product containing copies of at least one
excess primer strand and at least one limiting primer strand; b)
cleaning up the amplification product by diluting it by a factor of
at least five and c) sequencing the copies of at least one of said
strands in the cleaned-up amplification product.
31. The method of claim 30, wherein sequencing is dideoxy cycle
sequencing.
32. The method of claim 31, wherein said amplification product is
diluted by a factor of at least twenty.
33. The method of claim 30, wherein said amplification product is
diluted by a factor of at least twenty.
34. The method of claim 30, wherein an excess primer strand is
sequenced.
35. The method of claim 30, wherein a limiting primer strand is
sequenced.
36. The method of claim 30, wherein the act of diluting is
performed in two steps.
37. The method of claim 30, wherein diluting comprises combining
the amplification product with a mixture of sequencing
reagents.
38. The method of claim 30, wherein the at least one target
comprises at least two targets.
39. The method of claim 30, wherein a one limiting primer strand is
sequenced utilizing its complementary excess primer as a sequencing
primer and wherein other excess primers in the cleaned-up
amplification product are blocked.
40. The method of claim 30, wherein the at least one target
comprises at least two variant sequences.
41. The method of claim 30, wherein the LATE-PCR amplification
comprises monitoring the adequacy of production of single-stranded
product strand, wherein the monitoring comprises determining the
ratio of single-stranded product to double-stranded product.
42. A kit comprising primers and the probe of claim 25.
43. The kit according to claim 38, further comprising amplification
reagents.
44. A homogeneous detection method for detecting allelic variants
of at least one nucleic acid target sequence that includes
amplification of said at least one target by a non-symmetric
nucleic sequence acid amplification process that generates
single-stranded amplification products and includes at least one
primer-annealing temperature above a first detection temperature,
comprising: (a) forming an amplification reaction mixture that
includes said at least one nucleic acid target sequence and a
mismatch-tolerant probe for the single-stranded amplification
products of said at least one target sequence that binds to
progressively more mismatched sequences as the temperature is
lowered, said probe hybridizing to one allelic variant at said
first detection temperature but hybridizing to other allelic
variants at detection temperatures below said first detection
temperature; (b) amplifying said nucleic acid target sequence by
said non-symmetric amplification process; (c) detecting
fluorescence emission from said probe at said first detection
temperature and at one or two lower detection temperatures that are
below said first detection temperature and that are temperatures at
which the probe binds to said other allelic variants; and (d)
determining the allelic make-up of said at least one target
sequence by normalizing the probe's fluorescence emission as a
ratio of emissions at said first detection temperature and said at
least one lower detection temperature.
45. The method of claim 44, wherein said one or two lower detection
temperatures consist of one temperature.
46. The method of claim 45, wherein said step of detecting is
performed following completion of the amplification reaction as an
end-point detection.
47. The method of claim 44, wherein said one or two lower detection
temperatures consist of two temperatures, a low temperature and an
intermediate temperature, and said ratio is determined by the
formula (Fs-Ft)/(Fb-Ft), where Ft is the fluorescence at said first
detection temperature, Fb is the fluorescence at said low
temperature, and Fs is the fluorescence at said intermediate
temperature.
48. The method of claim 47, wherein said step of detecting is
performed following completion of the amplification reaction as an
end-point detection.
49. The method of claim 44, wherein said step of detecting is
performed following completion of the amplification reaction as a
melt analysis.
50. The method of claim 44, wherein said at least one target
sequence is at least two target sequences, and there is a one
detector probe for each sequence.
Description
TECHNICAL FIELD
[0001] This invention relates to nucleic acid amplification
reactions, including amplifications utilizing the polymerase chain
reaction, and assays utilizing such reactions in combination with
sequencing and hybridization probe detection methods.
BACKGROUND
[0002] Nucleic acid amplification techniques and assays are well
known. Some amplification reactions are isothermal, such as nucleic
acid sequence based amplification (NASBA). Others employ thermal
cycling, such as the polymerase chain reaction (PCR). Preferred
amplification assays employing fluorescence detection of amplified
product are homogeneous, that is, they do not require the physical
separation of reagents to permit detection (for example, separation
of bound probes from unbound probes) and can be performed in a
single closed vessel. Such assays may be end-point, wherein product
is detected after amplification, or they may be real-time, wherein
product is detected as amplification proceeds.
[0003] Nucleic acid amplification and assays employing PCR are
described, for example, in U.S. Pat. Nos. 4,683,202, 4,683,195 and
4,965,188, and, generally, PCR PROTOCOLS, a guide to Methods and
Applications, Innis et al. eds., Academic Press (San Diego, Calif.
(USA) 1990). Homogeneous PCR assays, including real-time assays, in
which amplified product is detected during some or all of the PCR
cycles as the reaction proceeds are described, for example, in U.S.
Pat. Nos. 5,994,056, 5,487,972, 5,925,517 and 6,150,097.
[0004] PCR amplification reactions generally are designed to be
symmetric, that is, to make double-stranded amplicons exponentially
by utilizing forward primer and reverse primer in equimolar
concentrations and equal melting temperatures (T.sub.m's). A
technique that has found limited use for making single-stranded DNA
directly in a PCR reaction is "asymmetric PCR." Gyllensten and
Erlich, "Generation of Single-Stranded DNA by the Polymerase Chain
Reaction and Its Application to Direct Sequencing of the HLA-DQA
Locus," Proc. Natl. Acad. Sci. (USA) 85: 7652-7656 (1988); and U.S.
Pat. No. 5,066,584. Asymmetric PCR is a non-symmetric PCR
amplification method that differs from symmetric PCR in that one of
the primers is diluted fivefold to one hundredfold so as to be
present in limiting amount of 1-20 percent of the concentration of
the other primer. As a consequence, the amplification consists of
an exponential phase in which both primers are extended, generating
double-stranded product, or amplicon, followed by a linear
amplification in which only one primer remains, generating
single-stranded amplicon.
[0005] More recently we have developed a non-symmetric PCR
amplification method known as "Linear-After-The-Exponential" PCR
or, for short, "LATE-PCR." LATE-PCR is a non-symmetric PCR
amplification consisting of an exponential phase in which both
primers are annealed and extended followed by a linear phase after
exhaustion of the Limiting Primer, when only the Excess Primer is
annealed and extended. See Sanchez et al. (2004) Proc. Natl. Acad.
Sci. (USA) 101: 1933-1938, published international patent
application WO 03/054233 (3 Jul. 2003), and Pierce et al. (2005)
Proc. Natl. Acad. Sci (USA) 102: 8609-8614, all of which are
incorporated herein by reference in their entirety.
[0006] A convenient and inexpensive method for monitoring
double-stranded amplicon production in a PCR amplification is to
use a dye that fluoresces upon intercalating into or otherwise
interacting with double-stranded DNA, such as SYBR Green I or SYBR
Gold. See, for example, U.S. Pat. No. 5,994,056. Melting
temperature analysis of amplicons performed either in real time
during a PCR amplification or performed after amplification is used
for product identification. One problem with utilizing such melting
temperature analysis is that dye fluorescence is a function of
amplicon size. Another problem is that dyes redistribute from
amplification products, or amplicons, having low melting
temperatures to amplicons having higher melting temperatures during
analysis, thereby distorting results. Two approaches to solve these
problems have been advanced. One approach, G quenching, imposes
severe restrictions on primer design and causes large background
fluorescence (Crockett A O, Wittwer C T. "Fluorescein-Labeled
Oligonucleotides for Real-Time PCR: Using the Inherent Quenching of
Deoxyguanosine Nucleotides" Anal. Biochem. 290:89-97 (2001)). The
other, replacing SYBR dyes with LC Green dye, yields very small
percentage of signal for sequences not present in abundance and
requires highly specialized software and hardware (Wittwer et al.
High-Resolution Genotyping by Amplicon Melting Analysis Using
LCGreen," Clin. Chem. 49:853-860 (2003).
[0007] Fluorescent-labeled probes are used in homogeneous nucleic
acid amplification assays, including PCR assays, to measure the
accumulation of desired amplicon, either in real time or by
end-point analysis. Several available types of probes are
significantly allele-discriminating as compared to linear
single-stranded probes. Real-time probes include dual-labeled
linear probes that are cleaved by 5'-to-3' exonuclease activity of
DNA polymerase during the extension step of a PCR cycle (see U.S.
Pat. Nos. 5,210,015, 5,487,972 and 5,538,848); molecular beacon
probes (see U.S. Pat. Nos. 5,925,517, 6,103,476 and 6,365,729);
minor groove binding probes (see Afonina et al. "Minor Groove
Binder-Conjugated DNA Probes for Quantitative DNA Detection by
Hybridization-Triggered Fluorescence," Biotechniques 32: 946-949
(2002)); linear probe pairs that FRET when hybridized adjacently on
a target strand; quenched double-stranded linear probes for which a
target competes to hybridize to the labeled probe strand (see Li,
Q. et al. (2002), Nucl. Acid. Res. 30: e5); and so-called
"light-up" probes, which are peptide nucleic acid (PNA) oligomers
linked to an asymmetric cyanine dye that fluoresces when the probe
binds to target to form a double-stranded region. For LATE-PCR we
have utilized low-temperature allele-discriminating probes, such as
low temperature molecular beacon probes (See WO 03/045233). Labeled
oligonucleotide probes may be attached to primers by linkers such
that during amplification the probes are not copied but are free to
hybridize to a target sequence resulting from extension of the
primer. Examples are Scorpions.RTM., primers to which are attached
molecular beacon probes, and Anglers.RTM., primers to which are
attached fluorophore-labeled linear probes. Lee, M. A. et al.
(2002), Analytica Clinica Acta 457: 61:70; Whitcombe, D. et al.
(1999), Nature Biotechnology 17: 804-807. The probe portion of such
composite structures, which carries the fluorescent label,
hybridizes separately from the primer portion. They are, thus,
labeled probes and not labeled primers, as those terms are used
herein. Target-specific probes lack the capacity to monitor total
production of double-stranded products, however.
[0008] Certain probes are mismatch-tolerant. Mismatch-tolerant
probes hybridize with and generate detectable signal for more than
one target sequence at a detection temperature in an assay, and
various hybrids so formed will have different melting points.
Linear, or random coil, single-stranded probes are generally
mismatch tolerant. Examples of such probes are linear probes with
an internal fluorescent moiety whose level of fluorescence
increases upon hybridization to one or another target strand;
fluorescently labeled linear probes used in combination with SYBR
Gold and SYBR Green I dyes, such that fluorescence of the label
occurs by FRET from the dye when the probe hybridizes to one or
another target (see U.S. patent publication US 2002/0119450, 28
Aug. 2002), so-called "sloppy beacons", and variations of linear
probe pairs that FRET (see U.S. Pat. No. 6,472,156).
[0009] Utilizing multiple probes that each bind only to one
possible target amplicon generated in an amplification reaction
creates a problem for analyzing complicated reaction mixtures or
for detecting one or a few targets from among numerous possible
targets. Available fluorescence detection permits resolution of a
limited number of fluorophores, generally no more than eight.
Limited multiplexing is possible, for example, by designing a
different allele-discriminating molecular beacon probe for each
target and labeling each probe differentially. (See, for example,
Tyagi et al. (2000) Nature Biotechnology 18: 1191-1196). Mixtures
of allele-discriminating probes, each comprising aliquots of
multiple colors, extends the number of probe signatures and works
well if only one of many (at least up to 56) targets is actually
present, but it encounters ambiguous results if more than one
target is present.
[0010] There are many situations that involve complex targets or
one among many possible targets. Several schemes have been
developed or proposed for such situations, but all have serious
drawbacks and limitations. Tyagi et al. published international
patent application WO 01/31062, have described a technique
sometimes referred to as "sloppy beacons," which are molecular
beacon probes that have long loop sequences, rendering them
mismatch tolerant and able to bind to some extent to multiple
targets at the annealing temperature of a PCR amplification
reaction. Such probes suffer from poor reaction kinetics against
mismatched targets and are likely to remain hybridized to perfectly
matched targets at the extension temperature of a PCR amplification
and be cleaved by Taq DNA polymerase. Further, only an indirect
indication of melting temperatures of probe-target hybrids under
the assay conditions is obtained, and that assumes equilibrium has
been achieved. Real-time multiplexing in symmetric PCR
amplifications with FRET probes has been described. In order not to
interfere with amplification, the melting temperatures of all
probe-target hybrids are constrained to be in the narrow
temperature range between the primer annealing temperature and the
primer extension temperature. Also, that scheme is not
quantitative. Post-amplification multiprobe assays employing FRET
probes of different colors have been disclosed Wittwer et al.,
"Real-Time Multiplex PCR Assays, Methods" 25:430-442 (2001). The
reaction mixture following a symmetric PCR amplification is rapidly
chilled, then slowly heated to determine melting curves for the
various fluorophores present. This approach is not quantitative. In
addition, because of large scatter among replicate symmetric PCR
amplifications, end-point assays in general tend to be only
qualitative.
[0011] Sequencing reaction products provides an alternative to
probing. Traditional dideoxy sequencing may utilize products of
amplification reactions, such as symmetric PCR or LATE-PCR, as
starting materials for cycle sequencing. Amplified product is
purified utilizing ethanol precipitation or an affinity column to
remove leftover dNTPs and primers, subjected to a cycle sequencing
reaction utilizing one sequencing primer and fluorescently labeled
dideoxy nucleotides, and subjected to capillary gel
electrophoresis. "Pyrosequencing" is a real-time, isothermal,
sequence-by-synthesis method known in the art. If exponential
amplification methods, for example PCR, are used in the preparation
of starting material for Pyrosequencing, amplified product must be
cleaned up by isolation of single-stranded product as well as
removal of dNTPs, pyrophosphate and unincorporated primers from the
amplification reaction. LATE-PCR simplifies sample preparation,
because it generates primarily single-stranded product, but it does
not in and of itself eliminate the need to clean-up the
product.
[0012] An aspect of this invention is methods for homogeneous
detection of reaction products of amplification reactions,
temperature cycling or isothermal, utilizing the detection of
fluorescence from fluorophore-labeled linear oligonucleotide
primers excited indirectly by exciting a DNA fluorescent dye such
as SYBR Green I or, preferably, SYBR Gold. Such dyes become
fluorescent when they associate with double-stranded DNA, into
which they are reported to intercalate. The foregoing methods may
be performed in real time or following the amplification reaction,
either by reading fluorescence at a detection temperature
(end-point detection) or by ascertaining changes in fluorescence as
a function of temperature by post-amplification melting analysis.
As a reaction mixture is heated through the melting temperatures of
various reaction products, fluorescence decreases progressively as
various amplicons containing a particular fluorophore-containing
primer reach their melting temperatures and become single-stranded.
Preferred methods include calculating the ratio of primer signal to
dye signal.
[0013] Another aspect of this invention is reagent kits that
include both DNA fluorescents dye and at least one such labeled
primer, preferably as part of a primer pair, and optionally
amplification reagents.
[0014] Yet other aspects of this invention are homogeneous methods
for detecting reaction products of LATE-PCR reactions employing a
low-temperature detection step. Certain embodiments comprise
including in the reaction mixture at least one
allele-discriminating probe according to this invention, namely, a
quenched double-stranded probe generally of the type described by
Li, Q. et al. (2002) Nucl. Acids Res. 30: e5 except that it is a
low temperature (Low-T.sub.m or Super-Low T.sub.m) target-specific
probe and that it is excited indirectly by exciting a DNA
fluorescent dye intercalated into the probe-target hybrid such as,
preferably, SYBR Gold. Other embodiments comprise including in the
reaction mixture at least one indirectly excitable
mismatch-tolerant probe according to this invention, namely, a
quenched single-stranded probe generally of the type described by
Lee and Furst United States published patent application Pub. No.
US 2002/0119450 except that is a quenched low-temperature probe.
These various methods include exciting the dye during the
low-temperature detection steps of a LATE-PCR amplification and
detecting fluorescence from the probes under these conditions to
provide a measure of the target single-stranded sequence.
Particular embodiments may further include measuring the total
amount of double-stranded product(s) in the reaction mixture by
detecting dye fluorescence, preferably during or at the end of the
extension step of PCR cycles while the temperature of the reaction
mixture is above the melting temperature(s) of the probes. Certain
preferred methods include calculating the ratio of probe signal to
dye signal. In the case of replicate samples, such ratio corrects
for differences among replicate samples in amplification yields
known to occur in PCR amplifications.
[0015] Other aspects of this invention are such low-temperature
allele-discriminating and quenched mismatch-tolerant probes,
LATE-PCR kits that include at least one such low-temperature
target-specific probe together with amplification reagents and
preferably the fluorescent DNA dye; and oligonucleotide sets
comprising LATE-PCR primers and at least one such probe.
[0016] Other aspects of this invention are homogeneous detection
methods for use when multiple amplicons are present or may be
present, such method comprising including in a LATE-PCR
amplification reaction mixture one or more low-temperature
mismatch-tolerant detection probes that, because of their low
T.sub.m, do not interfere with amplification and are not hydrolysed
(cut) by a DNA polymerase having 5'-3' exonuclease activity, and
that emit a fluorescent signal when hybridized and excited, either
directly by a suitable excitation source or indirectly by a
fluorescent DNA dye that is excited by a suitable excitation
source. Such methods include single-probe assays and multiple-probe
assays for applications such as genotyping. More than one probe may
be labeled with the same fluorophore, in which event discrimination
relies on change in fluorescence with temperature, just as when a
single probe is used. Probes may be labeled with different
fluorophores, in which event color difference is also used for
discrimination. Discrimination among targets for purposes of
identification and quantification may include fluorescence ratios
between fluorophores at the same or different temperatures, as well
as fluorophore-to-dye ratios. Detection is preferably performed
during the amplification (real time) and more preferably during a
low-temperature detection step included in a LATE-PCR amplification
protocol, and the detection step may include detection at multiple
temperatures. Yet another aspect of this invention is a
single-stranded linear probe useful in such detection methods, such
probe being of the type described in U.S. patent application
publication U.S. 2002/0119450 (29 Aug. 2002), that is, a probe
excited by the fluorescence emission from a fluorescent DNA dye,
except that it is a low-temperature (Low-T.sub.m or
Super-Low-T.sub.m) probe, is mismatch-tolerant, and includes a
quenching moiety that quenches the fluorescence, which otherwise
would result from secondary structure of at low temperature.
[0017] Another aspect of this invention is an
amplification-through-sequencing method that permits the product of
a LATE-PCR amplification to be prepared for pyrosequencing in the
amplification reaction chamber, vessel, well, slide or container, a
"single-tube" operation, which may be utilized with LATE-PCR
amplifications performed in small volumes, preferably 17 ul or
less.
[0018] Another aspect of this invention is a method for preparing
LATE-PCR products for dideoxy sequencing utilizing only
post-amplification aqueous dilution of amplification reaction
mixtures, which may be performed as a "single-tube" operation.
SUMMARY
[0019] In this application references are made to melting
temperatures, T.sub.m, of nucleic acid primers, probes and
amplicons. T.sub.m means the temperature at which half of the
subject material exists in double-stranded form and the remainder
is single stranded. Generally, except for LATE-PCR, the T.sub.m of
a primer is a calculated value using either the "% GC" method
(Wetmar, J. G. (1991) "DNA Probes: Applications of the Principles
of Nucleic Acid Hybridization," Crit. Rev. Biochem. Mol. Biol. 26:
227-259) or the "2(A+T) plus 4(G+C)" method, both of which are well
known, at a standard condition of primer and salt concentration.
LATE-PCR, however, takes into account the actual primer melting
temperatures in a particular reaction, taking into account primer
concentrations at the start of amplification. See Sanchez et al.
(2004) PNAS (USA) 101: 1933-1938, and Pierce et al. (2005) Proc.
Natl. Acad. Sci. (USA) 102: 8609-8614.
[0020] In this application we refer to such a
concentration-adjusted melting temperature at the start of
amplification as T.sub.m[0], which can be determined empirically,
as is necessary when non-natural nucleotides are used, or
calculated according to the "nearest neighbor" method (Santa Lucia,
J. (1998), PNAS (USA) 95: 1460-1465; and Allawi, H. T. and Santa
Lucia, J. (1997), Biochem. 36: 10581-10594) using a salt
concentration adjustment, which in the examples below was 0.07 M
monovalent cation concentration. LATE-PCR may also take into
account the melting temperature of the amplicon, which is
calculated utilizing the formula: T.sub.m=81.5+0.41 (% G+%
C)-500/L+16.6 log [M]/(1+0.7[M]), where L is the length in
nucleotides and [M] is the molar concentration of monovalent
cations. Melting temperatures of linear, or random-coil, probes are
calculated as for primers. Melting temperatures of structured
probes, for example molecular beacon probes, can be determined
empirically.
[0021] As used in this application, "LATE-PCR" means a
non-symmetric DNA amplification employing the polymerase chain
reaction (PCR) process utilizing one oligonucleotide primer (the
"Excess Primer") in at least five-fold excess with respect to the
other primer (the "Limiting Primer"), which itself is utilized at
low concentration, up to 200 nM, so as to be exhausted in roughly
sufficient PCR cycles to produce fluorescently detectable
double-stranded amplicon, wherein the concentration-adjusted
melting temperature of the Limiting Primer at the start of
amplification, T.sub.m[0].sup.L, is not more than 5.degree. C.
below the concentration-adjusted melting temperature of the Excess
Primer at the start of amplification, T.sub.m[0].sup.X, preferably
at least as high and more preferably 3-10.degree. C. higher; and
wherein thermal cycling is continued for multiple cycles after
exhaustion of the Limiting Primer to produce single-stranded
product, namely, the extension product of the Excess Primer,
sometimes referred to as the "Excess Primer Strand".
[0022] Primers and probes of this invention or useful in methods
and kits of this invention are oligonucleotides in the broad sense,
by which is meant that they may be DNA, RNA, mixtures of DNA and
RNA, and they may include non-natural nucleotides (for example, 2'
o-methyl ribonucleotides) and non-natural internucleotide linkages
(for example, phosphorothioate linkages). Both primers and probes
function in part by hybridizing to a sequence of interest in a
reaction mixture. A primer is a single-stranded oligonucleotide
that can hybridize to its complementary sequence at the primer
annealing temperature of an amplification reaction and be extended
at its 3' end by a DNA polymerase. A primer of this invention is a
primer that signals hybridization of its priming sequence by means
of a fluorophore that is indirectly excitable. A probe of this
invention or useful in methods and kits of this invention is or
includes a single-stranded oligonucleotide that can hybridize to
its intended target sequence (or sequences) at the detection
temperature (or temperatures) in or following an amplification
reaction and fluorescently signal that hybridization event by means
of a fluorophore that is indirectly excitable. As used herein a
"probe" is not extended in the amplification reaction by a DNA
polymerase. Probes that are very specific for a perfectly
complementary target sequence and strongly reject closely related
sequences having one or a few mismatched bases are "allele
discriminating." Probes that hybridize under at least one
applicable detection condition not only to perfectly complementary
sequences but also to partially complementary sequences having one
or more mismatched bases are "mismatch tolerant" probes.
[0023] "Fluorescent DNA dye" as used herein means a composition,
for example SYBR Green I or SYBR Gold, that becomes fluorescently
excitable when it associates with double-stranded DNA. It has been
reported that fluorescent DNA dyes intercalate into double-stranded
DNA, but we do not wish to be bound by any theory of operation.
[0024] Primers of this invention are used in conjunction with a
fluorescent DNA dye and are linear single-stranded oligonucleotides
labeled with a fluorophore that is indirectly excitable, that is,
when the primer hybridizes to a template strand in the reaction
mixture to form a region of double-stranded DNA, and light (usually
but not necessarily visible light) of a wavelength that excites, or
is absorbed by, the DNA fluorescent dye but not the fluorophore is
shone on the sample, the fluorophore emits. It has been reported
that energy transfers from a fluorescent DNA dye to a nearby
fluorophore by fluorescence resonance energy transfer (FRET), but
we do not wish to be bound by any theory of operation. We refer to
a fluorophore that emits in this circumstance as a fluorophore that
is "indirectly excited." Probes of this invention are likewise used
in conjunction with a fluorescent dye that binds to double-stranded
DNA (a "fluorescent DNA dye") and labeled with such an indirectly
excitable fluorophore such that when the probe hybridizes to a
target strand in the reaction mixture and the dye is excited, the
fluorophore emits.
[0025] As used herein "kit" means a collection of reagents for
performing an amplification or assay. A kit may be "complete", that
is, include all reagents needed for all steps of an amplification
or amplification-detection. Alternatively a kit may be "partial",
omitting certain reagents needed for those operations. Both
complete and partial kits of this invention may additionally
include reagents for sample preparation, such as nucleic acid
isolation and reverse transcription. Sequencing may involve two
kits, for example, a complete LATE-PCR amplification kit and a
complete cycle sequencing kit, or the two may be combined into a
single kit.
[0026] As used herein an "oligonucleotide set" means a collection
of primers or primers and probes for performing an amplification or
assay. For sequencing an oligonucleotide set may include, for
example, Limiting Primer and Excess Primer for a LATE-PCR
amplification and one or more additional sequencing primers for
cycle sequencing. For a hybridization probe assay an
oligonucleotide set may include, for example, Limiting Primer and
Excess Primer for a LATE-PCR amplification and at least one
fluorophore-labeled hybridization probe.
[0027] As used herein a "single-tube" method means a series of at
least two operations, for example, sample preparation,
amplification or sequencing, that can be performed without
transferring the sample from one container, be it a test tube, a
reaction well, a chamber in a microfluidics device, a glass slide,
or any other apparatus capable of holding a reaction mixture, to
another container.
[0028] Probes that have low melting temperatures (that is, probes
that form probe-target hybrids having low melting temperatures) can
be added to amplification reaction mixtures prior to the start of
amplification and utilized only when desired. By keeping
temperatures above the melting temperature of a probe during all or
portions of an amplification reaction, the probe is kept from
hybridizing to its target and possibly reducing the efficiency of
the reaction. Certain embodiments of LATE-PCR assays utilize low
temperature probes. As used herein, "Low-T.sub.n, probe" means a
hybridization probe that has a concentration-adjusted melting
temperature at the start of amplification, T.sub.m[0], at least
5.degree. C. below the T.sub.m[0] of the Limiting Primer in a
LATE-PCR assay; and a "Super-Low-T.sub.n, probe" means a
hybridization probe that has a T.sub.m[0] that is at least
5.degree. C. below the mean primer annealing temperature of the
exponential phase of a LATE-PCR reaction. We frequently add probes
to LATE-PCR reactions at 1 micromolar (.mu.M) concentration.
Therefore, when designing probes, we sometimes utilize a nominal
T.sub.m[0] calculated as described earlier but utilizing a nominal
concentration of 1 Most Low-T.sub.m and Super-Low-T.sub.m probes
have a T.sub.m[0] calculated at 1 .mu.M concentration in the range
of 30-55.degree. C.
[0029] Detection utilizing low temperature probes requires low
temperature detection, wherein the temperature of the probe-target
mixture is lowered sufficiently for fluorescently labeled probes to
hybridize and signal. This can be done at the conclusion of
amplification (end point) or in a post-amplification melting
analysis. Alternatively a low-temperature detection step may be
included in some or all cycles of the linear phase of a LATE-PCR
amplification for a real-time assay. Preferably such a step occurs
after primer extension and before high-temperature strand melting
(or "denaturation"), although it could be included in the primer
annealing step. A low-temperature detection step in a LATE-PCR
assay signifies a reduction in temperature at least 5.degree. C.
below the primer annealing temperature.
[0030] Certain methods according to this invention utilize
fluorophore-labeled primers or hybridization probes in combination
with fluorescent dyes that bind to double-stranded DNA and include
stimulating a dye at a wavelength that excites the dye but not the
fluorophore(s) and detecting fluorescence emitted by a fluorophore
stimulated indirectly by this procedure. Some embodiments of
methods according to this invention include detecting fluorescence
emission from the dye as well. Certain preferred methods further
include calculating the ratio of fluorophore emission to dye
emission.
[0031] One embodiment of this invention includes adding to a
nucleic acid amplification mixture a fluorescent DNA dye, such as
SYBR Green I, or preferably SYBR Gold, and at least one
amplification primer according to this invention, that is, a linear
single-stranded oligonucleotide that is extendable by a DNA
polymerase and that is labeled with a fluorophore that is
indirectly excitable to signal priming as described above;
performing an amplification reaction, preferably a PCR reaction
(including LATE-PCR), that includes annealing and extending that
labeled primer; and either during the amplification (real-time
detection) or following completion of amplification (either an
end-point detection at the conclusion of the amplification reaction
or during a subsequent thermal analysis (melting curve)) exciting
the dye and detecting fluorescence emission from the fluorophore,
either alone or in combination with detecting fluorescence emission
from the dye. By appropriate amplification protocol design, melting
analysis of double-stranded products can be included at desired
points in an amplification reaction. In this embodiment only
primers that are incorporated into double-stranded DNA will
fluoresce. Unincorporated primers will not fluoresce, so there is
no need to separate unbound primers physically. The method is
homogeneous. Also, fluorophore emission comes only from
double-stranded regions of products that include a labeled primer,
not from all double-stranded products. Example 1 below demonstrates
these improvements. It shows that in a single-extension cycle
designed to produce mixed extension products of various lengths, a
melting curve based on detection of emissions from the primer's
fluorophore showed all products, whereas a melting curve based on
detection of emissions from the dye did not. Example 1 demonstrates
also the use of the method of this embodiment in isothermal
reactions.
[0032] As will be appreciated by a person versed in the art, it is
generally important to correct for fluorescence overlap when a
fluorescent DNA dye, for example SYBR Green I, is used in
conjunction with a fluorescently labeled primer or probe that is
excited by FRET from the intercalated dye. This is the case because
fluorescent DNA dyes typically emit light over a broad spectral
range which may include the wavelength of light used to measure the
fluorescence emitted by the primer or probe. The desired correction
can be achieved by: 1) establishing the emission spectrum of the
dye alone; 2) measuring the intensity of the dye emission in each
sample at a wavelength that is shorter than the emission wavelength
of the primer or probe; 3) calculating the intensity of the dye
emission at the emission wavelength of the primer or probe on the
knowledge of steps 1 and 2; and 4) subtracting that calculated dye
intensity from the total intensity measured at the emission
wavelength of the primer or probe. Many commercially machines, such
as the ABI 7700 and the Cepheid Smart Cycler provide software for
carrying out this correction. Alternatively the measurements of dye
spectrum, dye emission alone, and total dye/probe emission can be
made and a satisfactory formula for correction can be manually
applied. For instance, Lee and Fuerst, United States Published
Patent Application Pub. No. US 2002/0119450 describes such a
formula for measurement and manual correction of SYBR Green I
fluorescence overlap on the Light Cycler.
[0033] All of the Examples described in this application were
carried out on the ABI 7700 and machine software was used to
correct for fluorescence overlap in all cases in which a
fluorescent DNA dye was used in conjunction with an indirectly
excited fluorescent primer or probe, regardless of whether the
fluorescence of the dye alone was recorded.
[0034] For PCR amplifications utilizing a single primer pair,
wherein at least one primer is fluorophore-labeled for indirect
excitation as described above, a melt-curve analysis according to
this embodiment can distinguish between the intended product(s) and
non-specific products. For multiplex PCR amplifications utilizing
multiple primer pairs, wherein at least one member of each pair is
fluorophore-labeled and a different fluorophore is utilized for
each pair, different intended products can be distinguished by
color and by the melting temperatures associated with the different
fluorophores. For PCR amplifications generally, fluorophore
emission(s) and dye emissions can be monitored during the reaction
to track the build-up of specific products(s) and to track the
build-up of all double-stranded products, respectively.
[0035] Analyses of amplification reactions may utilize the ratio of
fluorophore emissions, a signal specific to hybridized primers or
probes, to the dye-emission signal, which is not so specific. Such
a ratio, for example, corrects for variations among replicate
reactions. Also, analyses may utilize the primer-template melting
peak, which decreases in magnitude as labeled primer is
incorporated into extension product or products.
[0036] This invention includes amplification kits and partial kits
that include a fluorescent DNA dye, at least one primer pair that
includes a primer labeled with a fluorophore that is excited
indirectly when the dye is excited, and reagents to amplify the
region defined by the primers, preferably by LATE-PCR.
[0037] Another embodiment of a method according to this invention
includes adding to a nucleic acid amplification mixture a
fluorescent DNA dye, such as SYBR Green I or, preferably, SYBR
Gold, and at least one indirectly excitable, quenched,
allele-discriminating Low-T.sub.m or Super-Low-T.sub.m
hybridization probe, which may be a probe of this invention.
Allele-discriminating probes of this invention are the type of
double-stranded probes described by Li, Q. et al. (2002), "A New
Class of Homogeneous Nucleic Acid Probes Based on Specific
Displacement Hybridization," Nucl. Acid Res. 30: (2)e5 (a
fluorophore-labeled linear oligonucleotide probe strand
complementary to the target, and a quencher-labeled complementary
strand that is shorter than the probe strand, generally by 2-10
nucleotides), except that they are labeled with a fluorophore that
is excited indirectly by exciting the dye, and that they have a low
melting temperature suitable for use in LATE-PCR amplifications as
Low-T.sub.m or Super-Low-T.sub.m probes. Allele-discriminating
capacity of double-stranded probes can be adjusted as has been
described by Li et al., as can the level of background
fluorescence. In addition, background fluorescence can be reduced
by including guanidine residues adjacent to the fluorescent moiety,
so-called "G-quenching."
[0038] Methods of this embodiment include amplification utilizing
such a mixture and detection at a temperature at which the probe
hybridizes in an allele-discriminating fashion. Preferred
embodiments include using a low-temperature detection step during
the linear amplification phase of a LATE-PCR reaction wherein the
foregoing probes hybridize to the single-stranded amplicon being
synthesized, exciting the fluorescent DNA dye at a wavelength that
does not excite the fluorophore or fluorophores directly, and
reading fluorescence from the probe's fluorophore or probes'
fluorophores, which is or are excited indirectly in this fashion.
Other embodiments include amplification followed by a
low-temperature detection as an end-point determination. Some
embodiments further include detecting emission from the dye, and
certain preferred embodiments include calculating a ratio of
probe(s) emission to dye emission. Detection of dye emission is
most preferably performed at the very start of the detection step,
while the temperature of the reaction mixture is above the melting
temperatures of all probes that are present. Data from accumulating
or accumulated double-stranded molecules (the dye signal) and from
accumulating or accumulated single-stranded molecules (the signal
from each probe) can be used to construct ratios in the manner
described. Methods of this embodiment also include use of
low-temperature molecular beacon probes, as described in published
application WO 03/054233, if the fluorophore label is stimulated by
emission from the dye but not by the wavelength used to excite the
dye.
[0039] This invention also includes LATE-PCR assay kits and partial
kits that include reagents for performing a non-symmetric
amplification, preferably a LATE-PCR amplification, with a low
temperature detection step (end point or real time) and that
include a fluorescent DNA dye, at least one primer pair, preferably
a LATE-PCR primer pair including an Excess Primer and Limiting
Primer, and at least one fluorophore-labeled Low-T.sub.m or
Super-Low-T.sub.m hybridization probe for a single-stranded product
of the amplification reaction (extension product of the primer
present in excess), wherein the probe is not mismatch tolerant but
rather is allele-discriminating at the intended detection
temperature, and wherein the probe's fluorophore is indirectly
excited by excitation of the dye. In preferred kits and partial
kits, at least one probe is an allele-discriminating probe of this
invention. This invention also includes oligonucleotide sets that
include at least one pair of primers for non-symmetric
amplification, preferably LATE-PCR amplification, and at least one
Low-T.sub.m or Super-Low-T.sub.m quenched allele-discriminating
double-stranded probe labeled with a fluorophore so as to be
indirectly excitable as described above, preferably by a SYBR dye,
as well as such double-stranded probes themselves.
[0040] Yet another embodiment of a method according to this
invention includes adding to a non-symmetric amplification reaction
mixture, preferably a LATE-PCR reaction mixture, detection reagents
comprising a fluorescent DNA dye such as SYBR Gold and at least one
mismatch-tolerant single-stranded linear hybridization probe that
is perfectly complementary to one possible single-stranded amplicon
target sequence that may or may not be present for amplification in
the reaction and is less than perfectly complementary to at least
one other possible single-stranded amplicon target sequence that
may be present. Probes useful in this embodiment are single strands
labeled with a fluorophore that is indirectly excitable by
fluorescence emission from the dye. They are Low-T.sub.m or,
preferably, Super-Low-T.sub.m probes with respect to their most
complementary possible targets that may be present, generally
meaning perfectly matched target. It is preferred that they have a
T.sub.m[0] against perfectly complementary target that is not more
than a few degrees higher, and preferably below, more preferably at
least 5.degree. C. below, the primer annealing temperature during
the exponential amplification phase of the amplification reaction.
The probes may be linear (or random-coil) probes, or random-coil
probes according to this invention, that is, quenched to eliminate
signal due to formation of secondary structure at low temperatures.
Quenched linear probes according to this invention preferably have
a fluorophore on one end and a non-fluorescent quenching moiety on
the other end, the one on the 3' end of the probe replacing the
phosphate cap otherwise added to prevent the probe from being
extended, that is, functioning as a primer.
[0041] This embodiment comprises subjecting the foregoing mixture
to non-symmetric, preferably LATE-PCR, amplification to generate
single-stranded amplicon molecules and subjecting the amplification
reaction mixture to a thermal analysis utilizing at least one
mismatch tolerant probe that signals upon hybridization. Thermal
analysis can be performed not only after the amplification reaction
is completed but also during a LATE-PCR low-temperature detection
step during thermal cycles in which single-stranded product is
being produced, that is, after exhaustion of the Limiting Primer.
Thermal analysis reveals targets of each probe according to the
melting temperatures of the probe-target hybrids that form or
destabilize as the temperature is lowered or raised, respectively.
As the temperature is lowered, a probe will first hybridize to its
perfectly matched target (if present) and emit a fluorescent
signal. As the temperature is lowered further, the probe will
hybridize successively to progressively "more mismatched" targets
and emit increased fluorescent signal on each occasion. As
explained in connection with previous embodiments, emission from
the fluorescent DNA dye can also be detected, preferably when
probes are not hybridized, that is, at a temperature above the
T.sub.m of the probe(s), to permit monitoring of the accumulation
of double-stranded molecules in the reaction and to permit the use
of ratios to reduce scatter among replicate samples.
[0042] This invention includes kits containing reagents for
non-symmetric amplification, preferably a LATE-PCR amplification,
that include a fluorescent DNA dye, at least one primer pair,
preferably a LATE-PCR primer pair including an Excess Primer and a
Limiting Primer, and at least one mismatch-tolerant Low-T.sub.m or
Super-Low-T.sub.m random coil probe, quenched if necessary, for a
single-stranded amplification product(s), as well as partial kits
and oligonucleotide sets containing such primers and probes, and
such probes themselves.
[0043] Methods according to this invention that utilize a
low-temperature detection step of LATE-PCR assays, preferably a
low-temperature detection step following primer extension and
before strand melting, include multiplex probe assays which contain
more than one pair of primers and generate one or more
single-stranded amplicons (one probe for each target) as well as
multiprobe assays that contain at least one probe for multiple
targets. Certain preferred methods with a low-temperature detection
step include a low-temperature detection step following primer
extension and before strand melting. During the detection step in
such assays the temperature may be dropped as much as 30.degree. C.
or even 40.degree. C. below the primer annealing temperature,
providing a large temperature window for detection.
Allele-discriminating probes, in addition to being differentiable
by color (fluorophore emission wavelength) can be differentiated by
differences in melting temperature. For example, four different
FAM-labeled allele-discriminating probes with T.sub.m's of 30, 35,
40 and 45.degree. C., respectively, against their targets can be
distinguished in real time or following amplification as an
end-point determination, as the reaction temperature is lowered or
raised, not just by post-amplification melt analysis. This added
degree of freedom multiplies significantly the number of different
probes that can be used in the same reaction. Mismatch-tolerant
probes will have lower T.sub.m's against mismatched targets than
against perfectly matched targets. Combinations of differently
colored low-temperature mismatch-tolerant probes that signal upon
hybridization produce patterns of temperature-dependent
fluorescence emission curves during low-temperature detection.
Methods according to this invention include use of such emission
curves, derivative curves, and ratios of either of them at one
temperature or different temperatures to identify the constituents
of mixed targets with post amplification melt analysis and also in
real time by monitoring fluorescence at several temperatures within
the window of LATE-PCR low-temperature detection step. Ratios may
include same probe/probe, different probe/probe ratios, probe/dye
ratios, and combinations thereof.
[0044] LATE-PCR kits, partial kits and oligonucleotide sets may
include at least two allele-discriminating probes of the same color
that can be distinguished by T.sub.m or at least two
mismatch-tolerant probes whose hybridization to different targets
can be distinguished by T.sub.m, preferably quenched random-coil
probes that are indirectly excited by exciting a fluorescent DNA
dye.
[0045] This invention includes improved methods for preparing the
amplification products of LATE-PCR amplifications for sequencing
reactions, either dideoxy sequencing or sequencing-by-synthesis
methods such as pyrosequencing. In particular, we have demonstrated
the generation and preparation of such starting materials in a
single reaction container, for example, a microcentrifuge tube.
Preferred embodiments include in the LATE-PCR reaction mixture a
reagent for inhibiting mispriming, most preferably a reagent
disclosed in our U.S. Provisional patent application No.
60/619,620, titled "Reagents and Methods for Improving
Reproducibility and Reducing Mispriming in PCR Amplification,"
which is incorporated by reference herein in its entirety. For
dideoxy sequencing we have demonstrated preparing LATE-PCR
amplification products for sequencing by the single step of sample
dilution, a method we refer to as "dilute and go." For
pyrosequencing, we have demonstrated methods that require only
addition of pyrosequencing enzyme/substrate reagents to the
LATE-PCR product mixture prior to primer annealing.
[0046] Methods according to this invention also include LATE-PCR
amplification and sample preparation for Pyrosequencing in the same
container, such as the same reaction tube or the same chamber of a
microfluidics device, all of which we refer to for short as
"single-tube" methods. In traditional Pyrosequencing, DNA is
amplified by symmetric PCR where one primer is 5' labeled with a
biotin molecule. After amplification, streptavidin coated beads are
used in conjunction with vacuum or magnetic equipment to isolate
single-stranded DNA (ssDNA) and wash away residual components of
the PCR reaction that interfere with Pyrosequencing including
pyrophosphate (PPi), dNTPs and PCR primers. By virtue of its
ability to generate ssDNA, LATE-PCR eliminates the need for strand
separation and simplifies sample preparation when combined with a
same-container method for eliminating the four interfering
components left over from PCR. In one such method, the need to
remove dNTPs remaining at the end of amplification is minimized by
using limiting amounts of dNTPs in the LATE-PCR amplification
reaction mixture, care being taken to utilize a sufficient amount
to produce enough ssDNA for Pyrosequencing. An enzyme with
pyrophosphatase activity, for example a pyrophosphatase such as
yeast pyrophosphatase, is added to the amplification product to
remove PPi and the mixture is heated to denature that enzyme before
proceeding to Pyrosequencing. Because Limiting Primer does not
remain after LATE-PCR amplification and the residual Excess Primer
cannot prime the strand extended from the Excess Primer during
amplification (Excess Primer strand), leftover primers need not be
removed in many cases. However, potential mispriming can be avoided
by including in the LATE-PCR reaction mixture an oligonucleotide
that hybridizes to the Excess Primer at temperatures below the
T.sub.m of the Excess Primer, including the temperature used for
Pyrosequencing. Alternatively, an oligonucleotide blocked for
extension at the 3' end and fully complementary to the Excess
Primer can be added after LATE-PCR amplification but before
Pyrosequencing to avoid potential mispriming by the Excess Primer
at temperatures used for Pyrosequencing. A third strategy to avoid
mispriming by the Excess Primer at the 3' end of the strand
extended from the Limiting Primer during amplification (Limiting
Primer strand) involves using a sufficient concentration of a 3'
blocked oligonucleotide containing the same sequence as the Excess
Primer to out-compete the Excess Primer for binding sites.
[0047] Our more preferred method of "single-tube" sample
preparation avoids the need to determine appropriate limiting dNTP
concentrations for particular amplifications. In this method we
first add Pyrosequencing enzyme/substrate reagents to the LATE-PCR
product, which removes dNTPs and PPi. We follow this with primer
annealing using an added sequencing primer and then add individual
dNTPs for Pyrosequencing. Alternatively, one may eliminate dNTPs by
addition of a purified enzyme with a dNTPase activity, such as
potato apyrase, followed by heating to inactivate the enzyme and
one may eliminate pyrophosphate by addition of a purified enzyme
with pyrophosphatase activity, such as yeast pyrophosphatase,
followed by heating to inactivate the enzyme. If both enzymes are
employed they can be added at the same time.
[0048] Assays according to this invention particularly LATE-PCR
assays, preferably include means to avoid mispriming, which can
cause a decrease in probe signal in the late stages of the
reaction. We have successfully avoided this "hook effect" by
including in the reaction mixture a mispriming-suppressing reagent
disclosed in our United States Provisional patent application
described above. We have also avoided that effect by adjusting the
concentration of polymerase added to the reaction. Decreasing
mispriming by adjusting polymerase can be observed in terms of the
kinetics of the LATE-PCR reaction using a probe of the ssDNA, as
well as by the composition of the final product revealed by various
means known in the art.
[0049] The details of one or more embodiments of the invention are
set forth in the accompanying drawings and the description below.
Other features, objects, and advantages of the invention will be
apparent from the description and drawings, and from the
claims.
DESCRIPTION OF DRAWINGS
[0050] FIG. 1 shows the use of fluorescently labeled primers
according to the methods of the invention for melting curve
analysis.
[0051] FIG. 2 shows reduction of signal scatter through the use of
ratios of single-stranded product to double-stranded product
according to the methods of the invention.
[0052] FIG. 3 shows comparison of identification of five species of
Mycobacteria via melting curve analysis obtained with either
conventional mismatch-tolerant probes against the 16S ribosomal RNA
gene or two different versions of quenched mismatch-tolerant probes
against the same target designed according to the methods of the
invention.
[0053] FIG. 4 shows identification of five species of Mycobacteria
using only two mismatch-tolerant probes against the 16S ribosomal
RNA gene according to the methods of the invention.
[0054] FIG. 5 shows identification of five species of Mycobacteria
via first derivative analysis of melting curves shown in FIG. 3
using two mismatch-tolerant probes against the 16S ribosomal RNA
gene designed according to the methods of the invention.
[0055] FIG. 6 shows identification of five species of Mycobacteria
using ratios of fluorescent signals collected at different
temperatures from two mismatch-tolerant probes against the 16S
ribosomal RNA gene according to the methods of the invention.
[0056] FIG. 7 shows end-point genotyping of homozygous and
heterozygous samples for the G269 mutation of the human HexA gene
using LATE-PCR and a single Low-T.sub.m mismatch-tolerant probe
against the wild-type allele according to the methods of the
invention.
[0057] FIG. 8 shows separate identification of three different
alleles of the human cystic fibrosis transmembrane regulator (CFTR)
gene using LATE-PCR, allele discriminating Low-T.sub.m probes
labeled with the same color, and first-derivative analysis of
melting curves.
[0058] FIG. 9 shows simultaneous identification of different
combinations of various alleles of the human cystic fibrosis
transmembrane regulator (CFTR) gene using allele discriminating
Low-T.sub.m probes labeled with the same color, and
first-derivative analysis of melting curves.
[0059] FIG. 10 shows identification of different allele
combinations of the human cystic fibrosis transmembrane regulator
(CFTR) gene by plotting the changes in fluorescence at two
temperatures collected according to the methods of the
invention.
[0060] FIG. 11 shows Two Temperature Normalization assays (with
background correction)
[0061] FIG. 12 shows Two Temperature Normalization assays (without
background correction)
[0062] FIG. 13 shows Three Temperature Normalization assays
[0063] FIG. 14 shows a comparison of the "dilute-and-go" method of
preparation of LATE-PCR samples for pyrosequencing according the
methods of the invention relative to the conventional method of
preparation of LATE-PCR samples for the same assay.
[0064] FIG. 15 is Pyrograms obtained from single cells prepared by
the single-tube LATE-PCR method. Arrows indicate the .beta.-globin
IVS 110 site of: a) homozygous wild-type, b) heterozygous and c)
homozygous mutant cells.
[0065] FIG. 16 is the Pyrogram from a Pyrosequencing reaction
carried out for more than fifty base pairs. Nucleotide dispensation
order is listed below each peak and the expected sequence is noted
above.
[0066] FIG. 17 is dideoxy sequencing chromatographs resulting from
the "dilute-and-go" method of preparation of LATE-PCR samples for
dideoxy sequencing according the methods of the invention and from
the conventional method of preparation of LATE-PCR samples for the
same assay.
[0067] FIG. 18 is an electrophoresis gel from a LATE-PCR
amplification of more than one product from the same DNA template
in the same reaction.
[0068] FIG. 19 is chromatographs from dilute-and-go dideoxy
sequencing of the product of the LATE-PCR amplification of FIG.
18.
[0069] FIG. 20 shows that the amount of ssDNA and dsDNA generated
by a LATE-PCR amplification can be measured independently and can
be used to calculate the ratio ssDNA/dsDNA which, in turn, can be
used to determine whether the amount of ssDNA thus far accumulated
is sufficient for subsequent sequencing via the "dilute-and-go"
method.
[0070] FIG. 21 is dideoxy sequencing chromatographs resulting from
the "dilute-and-go" method employed on a 50:50 mixture of LATE-PCR
amplicons having two closely related, but different sequences.
[0071] FIG. 22 shows the sensitivity range of mixed LATE-PCR
amplicons having closely related, but different sequences that can
be distinguished via the "dilute-and-go" method.
[0072] FIG. 23 shows that a LATE-PCR together with at least one
single mismatch-tolerant probe can be used to generate end-point
melting curves which, in turn, can be used to quantify the relative
amounts of two or more mixed LATE-PCR amplicons having closely
related, but different sequences.
[0073] FIG. 24 shows the kinetics of several LATE-PCR assays
carried out using two different concentrations of Taq polymerase
with each of three different amounts of genomic DNA.
[0074] Like reference symbols in the various drawings indicate like
elements.
DETAILED DESCRIPTION
[0075] This invention includes nucleic acid amplification assays,
for example PCR assays, that include detection of fluorescence
emission from at least one fluorophore-labeled primer that is
excited, not directly by applying light (visible or not) of a
wavelength strongly absorbed by the fluorophore, but indirectly by
applying light of a wavelength that excites a nearby fluorescent
DNA dye such as SYBR Green or, preferably, SYBR Gold, as well as
complete and partial kits containing all or some amplification
reagents and oligonucleotide sets containing such labeled primers,
and also the primers themselves.
[0076] Amplification primers are well known. Primers according to
this invention are short oligonucleotides, generally under fifty
bases in length that hybridize to a target strand and are extended
by an appropriate polymerase. A primer may be composed of naturally
occurring nucleotides, or it may include non-natural nucleotides
and non-natural internucleotide linkages. Although primers are
generally linear oligonucleotides, they may include secondary
structure. (See, for example, Nazarenko I A, Bhatnagar S K, Hohman
R J (1997), "A Closed Tube Format for Amplification and Detection
of DNA Based on Energy Transfer," Nucleic Acids Res. 25:2516-2521).
Amplifications often include use of one or more primer pairs each
consisting of a forward primer and a reverse primer. In methods,
kits and oligonucleotide sets according to this invention, either
one primer of a pair or both primers of the pair may be labeled
with a covalently bound fluorophore that fluoresces when nearby
fluorescent DNA dye is stimulated. When the labeled primer
hybridizes (or anneals) to its complementary sequence in a template
strand, a double-stranded region is formed. Fluorescent DNA dye
associates with that region, by intercalating therein or otherwise,
and becomes fluorescent in that region, which is nearby to the
primer's fluorophore such that when the dye is stimulated at a
wavelength that does not directly excite the fluorophore, the
fluorophore emits at its characteristic wavelength. These primers
may be used to monitor synthesis of products resulting by extension
of a DNA polymerase such as those resulting from PCR and primer
extension assays in real-time or by end-point detection and/or to
assess product specificity by melting curve analysis.
[0077] Primers according to this invention, used as a substrate for
extension by a DNA polymerase, including primers for PCR
amplification (symmetric or non-symmetric, including particularly
LATE-PCR), are labeled at any nucleotide position with a covalently
bound fluorophore such that the 3' end of the oligonucleotide
primer remains available for extension. The primers can have the
design of double-stranded probes described by Li, Q. et al. (2002)
("A New Class of Homogeneous Nucleic Acid Probes Based on Specific
Displacement Hybridization," Nucl. Acid Res. 30: (2)e5). The only
sequence constraint on the oligonucleotide of the primer is that
the oligonucleotide must not have any secondary structure that
itself leads to indirect fluorophore excitation, meaning that
generally there is not secondary structure greater than 2 base
pairs. The fluorophore moiety should not be appreciably excited
directly by, but the dye must be directly excited by, the
excitation source wavelength used; the fluorophore must emit when
the fluorescent DNA dye is excited in its immediate presence,
generally not greater than a distance at which the fluorophore
undergoes fluorescence resonance energy transfer (FRET) occurs; and
the emission spectrum of the chosen fluorophore must be
distinguishable from the emission spectrum of the fluorescent DNA
dye either by the use of filters or spectral deconvolution. Under
these conditions, the fluorophore fluoresces upon incorporation
into double stranded product following primer annealing, including
extension by a DNA polymerase. Loss of fluorescence takes place
during heating when at the melting temperature (T.sub.m) of the
particular stretch of double-stranded DNA containing the
fluorophore is reached.
[0078] Conditions for the use of primers according to this
invention in conjunction with fluorescent DNA dyes (primer and DNA
dye concentration, DNA dye excitation wavelength) are the same as
those known in the art for monitoring the synthesis of products of
primer extension reactions (including PCR) in the course of the
reaction and for assessing extension product specificity by melting
curve analysis using only fluorescent DNA dyes with the exception
that fluorescence is collected at the emission wavelength
corresponding to the primer fluorophore instead of or in addition
to the emission wavelength of the dye. Under these conditions, the
fluorescence signals originate from double-stranded sequences
containing the primers, rather than all double-stranded sequences
in the reaction.
[0079] Comparison of the performance of DNA dye to methods and
systems according to this invention was performed by the experiment
reported below in Example 1 and in FIG. 1. A fluorophore-labeled
primer was extended by DNA polymerase in the presence of SYBR Green
dye and in the presence of a relatively long non-extendable
oligonucleotide hybridized to the template strand near to the
region of primer extension. This resulted in a product mixture
having template strand-unextended primer hybrids, short
primer-extension products, and the non-extendable oligonucleotide,
such that hybrids with the template had T.sub.m's ranging from
60.degree. C. (the fluorophore (Cy5)-labeled primer) to 79.degree.
C. (the non-extendable oligonucleotide), with primer-extension
products falling between those two T.sub.m's.
[0080] Standard melt-curve analysis was performed on the final
reaction mixture (duplicate samples) using both fluorescence
readings from the dye and fluorescence readings from the
fluorophore. Melting curves are presented in FIG. 1. Panel A is the
melt curves 1 obtained utilizing dye emissions. The sole peak is
79.degree. C., the melting temperature of the nonextendable
oligonucleotide. No other peak is seen, not even that of the
unextended primer. Panel A demonstrates the migration of SYBR Green
dye to the higher T.sub.m hybrid during generation of a melt curve,
which masks the presence of lower T.sub.m hybrids. Panel B is the
melt curves 2 obtained utilizing fluorophore emissions. It shows a
peak at 60.degree. C., the T.sub.m of unextended primer-template
hybrid, and an additional peak at a temperature between 69.degree.
C. and 79.degree. C., that is, a peak indicative of primer
extension product. The lower T.sub.m's are seen despite the
tendency of the dye to migrate, as shown by melt curves 1.
Monitoring fluorophore emission according to this invention reveals
every hybrid species labeled with the fluorophore in the mixture at
its correct concentration.
[0081] In the case of PCR amplifications utilizing a single pair of
primers, wherein at least one member of the pair is a primer
according to this invention, melt curve analysis can distinguish
between specific and non-specific products using a single fluor
because the specific product has an expected melting temperature
and the non-specific product has an unexpected, melting
temperature. In the case of multiplex PCR amplifications, utilizing
more than one pair of primers, wherein at least one member of each
pair of primers is a primer according to this invention, two
different specific products can be distinguished from each other
either because they have different, but expected, T.sub.m values
and or because the two different primers employed are labeled with
different fluorophores. Moreover, melting curve analysis using
primers according to this invention can be carried out during an
ongoing amplification reaction or at the end of a reaction.
[0082] Incorporation of one or more primers according to this
invention during the course of a reaction can also be used to
measure quantitatively the extent of amplification of one or more
targets during the course of a PCR, or the synthesis of one or more
stretches of double-stranded DNA during the course of an isothermal
extension reaction. In either case, the amount of the full-length
double-stranded product molecule or molecules can be followed over
time by repeated detection of increasing fluorescence, or can be
measured at the end of a reaction. In addition, incorporation of
one or more primers according to this invention during the course
of either isothermal reactions or thermal cycled reactions can be
used to measure existence and/or accumulation of partial products,
i.e. those that have begun extension along a template strand but
have not reached their maximum possible length. In such cases the
melting temperatures of the partial products are lower than the
melting temperature of the full-length product, but are higher than
the melting temperature of the labeled primer from which they are
derived. In addition, concomitant with incorporation of the labeled
primer into a partial or full-length product strand, the magnitude
of the melting temperature peak generated from the primer/template
DNA-DNA hybrid decreases, and can be used as an additional measure
of DNA synthesis.
[0083] As stated above, each stretch of double-stranded DNA or
amplicon synthesized by incorporation of a primer according to this
invention generates a fluorescent signal at the emission wavelength
of the covalently bound fluorophore of the primer, when indirectly
stimulated by FRET or other mechanism from the bound SYBR dye, a
"primer-specific-signal". The same double-stranded DNA also
generates a fluorescent signal at the emission wavelength of the
SYBR dye, the "total-SYBR-signal", the sum of all double-stranded
sequences present in the reaction, since all double-stranded
sequences fluoresce, regardless of whether they have an
incorporated labeled primer. Thus, primers according to this
invention can be used to analyze the fluorescent signals in terms
of the following ratio: (primer-specific-signal/total-SYBR-signal),
hereafter the (PSS/TSS) value. Data analysis in terms of the
(PSS/TSS) value corrects for variations in fluorescent DNA dye
signal (TSS) among replicate reactions. This is particularly useful
in the case of LATE-PCR amplifications because the rate of
single-stranded amplicon synthesis is proportional to the amount of
double-stranded amplicon accumulated at the end of the exponential
phase of the reaction. Thus, small differences in the level of
double-stranded DNA among replicate reactions alter the rate of
single-stranded amplicon accumulation.
[0084] It is also possible to utilize more than one primer labeled
with the same fluorophore, as long as the amplicons are
differentiable by a post-amplification melting-curve analysis. See
FIG. 1, Panel B, for exemplification of this principle. Signal from
the common fluorophore at the end of an extension step, which may
be the final extension step (end point) or intermediate extension
steps, gives an indication of total amplicons incorporating the
fluorophore. Melt-curve analysis distinguishes among products and
provides a quantitative measure of their concentrations.
[0085] LATE-PCR is a non-symmetric PCR amplification that, among
other advantages, provides a large "temperature space" in which
actions may be taken. See WO 03/054233 and Sanchez et al. (2004),
cited above. LATE-PCR permits the use of "Low-T.sub.m" and
"Super-Low T.sub.m" hybridization probes to detect amplification
products ("amplicons") that are single-stranded. Various types of
probes that are single-target-specific in a particular assay,
including allele-discriminating probes capable of discriminating
against a single base-pair mismatch, such as allele-discriminating
molecular beacon probes, can be utilized with LATE-PCR as
Low-T.sub.m and Super-Low T.sub.m probes, as can mismatch-tolerant
probes such as mismatch-tolerant molecular beacon probes or linear
(random-coil) probes having a fluorophore excitable indirectly by
emission from a SYBR dye. We have devised a new class of
allele-discriminating probes useful as Low-T.sub.m and Super-Low
T.sub.m probes in LATE-PCR assays that permit the determination of
single-stranded/double-stranded ratios within a reaction, as can
allele-discriminating molecular beacon probes labeled with such a
fluorophore.
[0086] Allele-discriminating probes according to this invention are
modified double-stranded, allele-discriminating, quenched probes
according to Li, Q. et al. (2002), Nucl. Acid Res. 30: (2)e5). They
have the following modifications: they are labeled with a
fluorophore that is indirectly excitable by exciting a
double-stranded DNA fluorescent dye such as SYBR Green or SBYR Gold
but not directly excitable by wavelength utilized to stimulate the
dye (in this regard similar to the primers discussed above), and
they are constructed to be Low-T.sub.m or Super-Low T.sub.m probes.
When not bound to its target sequence, such a probe binds to a
shorter complementary oligonucleotide. We prefer that the
complementary oligonucleotide include a quencher such as Dabcyl or
a Black Hole.TM. quencher to reduce background fluorescence from
the probe. Alternatively or in addition, background fluorescence
can be reduced by including guanidine residues adjacent to the
fluorophore (G-quenching). In the presence of fully complementary
target strand, the shorter complementary strand is displaced, the
longer fluorophore-labeled strand hybridizes to the target, and the
fluorophore is unquenched and rendered capable of receiving energy
from the dye so as to fluoresce at its characteristic wavelength.
Several of these probes for different targets, labeled with
different fluorophores, can be used for multiplex assays.
[0087] Such allele-discriminating probes are designed to have a
concentration-adjusted melting temperature, T.sub.m[0], in the
assay that makes it a Low-T.sub.m or Super-Low T.sub.m. The
T.sub.m[0] of the probe-target hybrid is conveniently determined
and adjusted empirically, although a calculated value may be
employed at least as a good starting point to minimize adjustment.
The length and concentration of the complementary probe strand
relative to the fluorophore-labeled strand are adjusted empirically
for maximal allele discrimination. We start with a length 1-3
nucleotides shorter than the fluorophore-labeled strand and a
concentration of 1-1.2 times the concentration of the
fluorophore-labeled strand.
[0088] In a LATE-PCR assay, these allele-discriminating probes are
utilized in a low-temperature detection step, preferably following
the primer extension step in cycles following exhaustion of the
Limiting Primer. For real-time readings over multiple cycles, the
SYBR dye is excited and fluorescence is read both from both the dye
and from the fluorophore (or fluorophores). We prefer to read the
dye signal during or at the conclusion of the PCR extension step
when the temperature is above the T.sub.m of the probe (or probes),
and to read the fluorophore emission during the low detection-step
temperature when the probes (either an allele-discriminating probe
according to this invention or an appropriately labeled molecular
beacon probe) are hybridized. We then determine the ratio of
fluorescence of each probe to total-SYBR-signal. This ratio
minimizes differences among replicate assays due to differences in
product accumulation. Because differences are minimized, such
ratios can be used for end-point analysis as well.
[0089] The use of ratios of single-stranded product to
double-stranded product permitted by primers and probes according
to this invention is a technique for reducing scatter among
replicate assays, as has been stated. This is particularly
important for end-point assays, which do not reveal reaction
kinetics. An example is a LATE-PCR assay to distinguish homozygous
samples from heterozygous samples utilizing one primer pair for
both alleles and an allele-discriminating probe according to this
invention. FIG. 2 illustrates the reduction in scatter achieved
when applied to a LATE-PCR amplification with a low-temperature
detection step performed with a SYBR dye (in this case SYBR Gold),
an allele-discriminating probe for one allele labeled with Cy5,
excitation of the dye and readings of signals from the dye (at
72.degree. C., the extension temperature) and the fluorophore (at
55.degree. C., a low-temperature detection following primer
extension). Panel A presents the real-time readings from the
fluorophore for replicate homozygous samples (circle 21) and
replicate heterozygous samples (circle 22). As is apparent, scatter
among replicates blurs the difference. Panel B, however, plots the
ratio of Cy5 signals to SYBR signals for the homozygous samples
(circle 23) and heterozygous samples (circle 24). The scatter
reduction is sufficient to permit an end-point assay.
[0090] This invention also includes mismatch tolerant Low-T.sub.m
or Super-Low-T.sub.m linear single-stranded probes that are
labeled, preferably terminally labeled, with a fluorophore
excitable by emission from a fluorescent DNA dye (for example, SYBR
Green I or SYBR Gold) and that are quenched to reduce background
fluorescence. These probes carry a quenching moiety that suppresses
fluorescence in the absence of target. Mismatch-tolerant linear
probes have a tendency to fold and form short double-stranded
regions as the temperature is lowered. Use of a low-temperature
LATE-PCR detection step exacerbates this tendency. This does not
occur when the probe sequence is hybridized to the target sequence.
If the probe includes a fluorophore that is excited by emission
from a SBYR dye that is present in the reaction mixture, the dye
intercalates into or otherwise associates with the unintended
double-stranded region of the unbound probe molecules and thus
excites the fluorophore of the probe by FRET. The result is an
increase in background fluorescence at low temperature.
[0091] Quenching of mismatch-tolerant probes according to this
invention is obtained by addition of a quenching moiety, for
example, a DABCYL or a Black Hole.TM. quencher (BHQ), to the probe
at a location at which it quenches fluorophore fluorescence
resulting from unintended secondary structure within the unbound
probe. We prefer to add the quencher at the end opposite to the
fluorophore whenever possible. Example 2 below exemplifies two
possible techniques, simply adding a quencher or constructing a
quenched hairpin, that is, a specifically designed secondary
structure that brings the quencher in close proximity to the
fluorophore, to the secondary structure, or both. Preferably the
T.sub.m of the constructed secondary structure is at least
5.degree. C. higher than the T.sub.m of any alternative secondary
structure so that in the absence of target most probe molecules are
in the hairpin configuration and background fluorescence is low.
The T.sub.m of the constructed stem is below the T.sub.m of the
probe hybridized to perfectly matched target and similar to the
T.sub.m of the probe hybridized to its mismatched targets, such
that hybridization to targets of sequence within the stem is not
prevented by formation of the stem.
[0092] Detection and identification of nucleic acid targets can be
accomplished by utilizing one or multiple low-temperature mismatch
tolerant probes that signal when hybridized, including
mismatch-tolerant molecular beacon probes, linear single-stranded
probes that are indirectly excited by exciting a fluorescent DNA
dye, and quenched linear probes according to this invention. A
probe mixture may, for certain embodiments, include as well at
least one allele-specific probe according to this invention. A
useful technique is to utilize the ratio of fluorescence of two
probes as a function of temperature to distinguish among targets
having a similar with T.sub.m respect to at least one of the
probes. We sometimes refer to curves of such a ratio as a
"fluorescence signature" of a target.
[0093] With LATE-PCR that includes a low-temperature detection step
it is possible to combine the effect of detection temperature with
the effect of fluorescence signature. An assay we have used with
multiple mismatch-tolerant probes, including but not limited to
quenched, single-stranded, indirectly excitable probes according to
this invention, is a LATE-PCR amplification consisting of a
high-temperature step to denature double-stranded DNA (95.degree.
C. for 2 min), followed by exponential phase amplification
utilizing both Limiting Primer and Excess Primer (30 cycles of
95.degree. C. for 10 sec, 60.degree. C. for 15 sec, and 78.degree.
C. for 40 sec), followed by the completion of the exponential phase
and the subsequent linear phase during which probe detection steps
are included (40 cycles of 95.degree. C. for 10 sec, 60.degree. C.
for 15 sec, 78.degree. C. for 40 sec, 55.degree. C. for 20 sec,
50.degree. C. for 20 sec, 45.degree. C. for 20 sec, and 40.degree.
C. for 20 sec). This provides four detection temperatures below the
primer annealing temperature, 60.degree. C. Double-stranded
production can be monitored by emission from SYBR dye at the
primer-extension temperature, 78.degree. C., which is above the
T.sub.m of any probe. Fluorophore emission can be monitored at each
low-temperature from 55.degree. C. to 40.degree. C. Following the
last cycle, the temperature can be dropped to a low value, for
example 30.degree. C. and slowly increased for melting analysis. In
addition to detected fluorescence levels, ratios of fluorophore
fluorescence to dye fluorescence and ratios of fluorophore
fluorescence can be used to generate amplicon-differentiating
information.
[0094] Certain of the Figures are illustrative of techniques that
take advantage of the foregoing possibilities. FIG. 4 shows the
melting behavior of two mismatch-tolerant probes against the 16s
ribosomal RNA gene of several species of Mycobacteria. Two probes
were used: the hairpin-forming, quenched probe described in Example
2, having the sequence 5'-Cy5-CTG GAT AGG ACC ACG AGG CCA G-BHQ
II-3' (SEQ. ID No. 2) and a TAMRA-labeled probe having the sequence
5'-G CAT GTC TTG TGG TGG-TAMRA-3' (SEQ. ID No. 3). It was found
that the latter probe, which was unquenched, gave discernable
signals above background for several species. Panel A of FIG. 4
presents melting curves for the hairpin probe with no target (line
41), M. asiaticum (line 42), M. gordonae (line 43), M.
heidelburgense (line 44), M. malmoense (line 45) and M. marinum
(line 46). Panel B presents melting curves for the TAMRA-labeled
probe with no target (line 47), M. asiaticum (line 48), M. gordonae
(line 49), M. heidelburgense (line 50) M. malmoense (line 51), and
M. marinum (line 52). Panel C of FIG. 4 plots the ratio of TAMRA
fluorescence to Cy 5 fluorescence), M. asiaticum (line 53), M.
gordonae (line 54), M. heidelburgense (line 55), M. malmoense (line
56) and M. marinum (line 57).
[0095] Another analytical technique is to plot the rate of
fluorescence change from fluorophores as a function of temperature.
FIG. 5 presents such plots for the foregoing Cy5-labeled quenched
hairpin probe according to this invention and the TAMRA-labeled
unquenched probe, both described above. Panel A is the quenched
hairpin probe, and Panel B is the TAMRA-labeled probe. The plots
show melting peaks for M. asiaticum (lines 61, 71), M. gordonae
(lines 62, 72), M. heidelburgense (lines 63, 73), M. malmoense
(lines 64, 74), and M. marinum (lines 65, 75). Using both probes,
it is possible to distinguish the five targets by melting peaks.
The Cy5-labeled probe by itself was able to distinguish M. gordonae
(line 62) from the others. The TAMRA-labeled probe by itself could
distinguish each of M. asiaticum (line 71), M. gordonae (line 72)
and M. marinum (line 75) from one another. Taken together, the
probes could distinguish M. heidelburgense from M. asiaticum,
because M. heidelburgense yielded a high peak with the Cy5 probe
and a low peak with the TAMRA probe, whereas M. asiaticum yielded
the opposite. With a single probe per amplicon, relative peak
heights may reflect differences in product concentration. Here,
however, both probes detect the same amplicon, so relative peak
heights reflect differences in probe-target melting
characteristics.
[0096] Another analytical tool, described above, is to use one or
more fluorescence ratios, such as, in the particular embodiment
discussed here, the ratio of TAMRA fluorescence to Cy5 fluorescence
at the same temperature or at different temperatures during the
PCR. A useful strategy for probe design include designing one probe
to bind to a conserved region common to multiple species to serve
as a reference, or including, where needed, utilizing a portion of
the Limiting Primer sequence as a conserved region. This is an
option for LATE-PCR, because probe T.sub.m's are well below the
T.sub.m of the Limiting Primer and the annealing temperature, so a
probe with a common sequence does not interfere with amplification.
FIG. 6 shows the results using a combination of fluorescence
ratios. In this embodiment we utilized as one ratio the TAMRA/Cy5
fluorescence values each collected at the 40.degree. C. detection
temperature and as the other ratio the ratio of TAMRA/Cy5
fluorescent signals collected at 45.degree. C. and 55.degree. C.,
respectively, detection temperature. FIG. 6 plots both ratios at a
particular cycle, in this instance cycle 50. Six replicates yielded
non-overlapping data for the various species M. asiaticum (circle
81), M. gordonae (circle 82), M. heidelburgense (circle 83), M.
malmoense (circle 84), and M. marinum (circle 85).
[0097] Measuring probe fluorescence at different temperatures
during PCR has advantages over limiting the analysis to post-PCR
melts. One advantage is the ability to compare fluorescence values
at a specific number of cycles after the threshold cycle, C.sub.T
value, is reached. This enables the use of ratios with SYBR dyes
(or other intercalating dyes) as described above. Another advantage
is that each sample has background fluorescence measured at each
temperature during cycles prior to amplicon detection. Thus,
accurate adjustments can be made for sample-to-sample variations in
background fluorescence. It is possible to measure fluorescence at
many temperatures during the PCR, providing nearly complete melting
analysis over the temperature range at which a probe shows
differences in hybridization to different targets. The number and
duration of these steps depends in part on the capabilities of the
detection equipment. Continuous fluorescence detection during
increases or decreases in temperature is possible with some thermal
cyclers. Detection at multiple temperatures need not begin until
some point shortly before an initial rise in fluorescence is
expected. Detection at multiple temperatures can be done every
cycle, or at some other interval, for example every fifth cycle.
Eliminating multiple detection steps during the initial cycles and
reducing the frequency of those steps reduces the overall time
required to complete the amplification reaction. When utilizing the
ratio of probe fluorescence to dye fluorescence, preferably probe
fluorescence is measured over the temperatures at which the probe
hybridizes to its targets, and SYBR fluorescence is measured at
temperatures at which probes are unbound. Most preferably, SYBR
fluorescence is measured at the extension temperature. Since the
probe fluorescence increases at cycles well beyond the threshold
cycle (C.sub.T) value while the SYBR fluorescence plateaus, these
ratios will change during the amplification reaction. Therefore, it
is important to compare ratios of individual samples at a specific
number of cycles past the C.sub.T value of each sample.
[0098] Analysis of single-stranded DNA products can also be
accomplished using a single mismatch-tolerant probe whose signal is
measured at more than one, for instance two or three, different
temperatures. The resulting data can then be processed as ratios
using the fluorescence values at two or more temperatures. The
ratio significantly reduces signal differences among replicate
samples and provides quantitative measure of the interrogated
allele. FIG. 11 shows probe fluorescence levels at two
temperatures. As illustrated in FIG. 11, probe signals arising from
hybridization of the probe to the Excess Primer strand are
collected at a high temperature where the probe is allele
discriminating and binds only to the fully complementary allele, as
well as at lower temperatures where the probe is fully
mismatch-tolerant and binds to all possible allelic variants of the
target sequence. Measurement of fluorescence at the high and low
temperature and calculation of the resulting ratios can also be
carried out as an end-point assay. We refer to these assays as "Two
Temperature Normalization Assays (without background correction)."
They readily distinguish homozygous and heterozygous genotypes as
illustrated in FIG. 11. This type of assay can be carried out as
end-point homogenous LATE-PCR assays, QE-LATE-PCR assays.
[0099] FIG. 11 reports baseline-corrected fluorescence signals. As
discussed in Example 5, we prefer to use raw rather than
baseline-corrected fluorescence signals from the ABI 7700, as shown
in FIG. 12. Baseline correction potentially introduces artifacts
into the normalized fluorescent ratios of individual samples,
because the correction factor is sensitive to spurious fluctuations
in the background fluorescence signals use to define baseline. Raw
fluorescence readings are not subject to this artifact. Reliance on
raw fluorescent signals makes the assay applicable to any PCR
thermocycler with fluorimeter capabilities or to regular
thermocyclers used in combination with a temperature-regulated
fluorimeter for end-point fluorescence readings.
[0100] QE-LATE-PCR Genotyping can be further refined by
constructing ratios of signals detected at more than two
temperatures. A three-temperature method for normalizing end point
data is given by the following formula: Normalized Fluorescence
Value=(Fs-Ft)/(Fb-Ft), where (Ft=fluorescence at top temperature),
(Fb=fluorescence at bottom temperature), (Fs=fluorescence at any
given third temperature). The three-temperature method applied to
homozygous and heterozygous genotypes of a SNP site within the
human p53 gene is described in Example 6 and illustrated in FIG.
13.
[0101] Pyrosequencing is a real-time, isothermal,
sequencing-by-synthesis method known in the art. It is catalyzed by
four kinetically balanced enzymes: DNA polymerase, ATP sulfurylase,
luciferase, and apyrase. The method includes a sequencing primer
annealed to single-stranded DNA. Each nucleotide is dispensed and
tested individually for its incorporation into the 3' end of the
sequencing primer according to the sequence of the template DNA. A
successful incorporation event is accompanied by release of
pyrophosphate (PPi) in a quantity equimolar to the amount of
nucleotide incorporated. ATP sulfurylase quantitatively converts
the released PPi into ATP in the presence of adenosine 5'
phosphosulfate. ATP then drives the luciferase-mediated conversion
of luciferin to oxyluciferin that generates visible light in
amounts that are proportional to the amount of ATP. The light is
detected by a charge coupled device (CCD) camera and displayed as a
peak in a pyrogram. Unincorporated dNTP and excess ATP are
continuously degraded by Apyrase. Nucleotide sequence is determined
from the order of nucleotide dispensation and peak heights in the
pyrogram, which are proportional to the amounts of nucleotides
incorporated.
[0102] LATE-PCR efficiently generates single-stranded DNA and thus
eliminates the need for conventional pyrosequencing sample
preparation methods required to generate single-stranded templates
from traditional double-stranded PCR products. Use of LATE-PCR
products for pyrosequencing, however, requires efficient removal of
reagents left over from the amplification reaction (dNTP,
pyrophosphate, and Excess Primers that will interfere with the
pyrosequencing chemistry. Removal of leftover reagents can be
accomplished by column purification, ethanol precipitation or any
known approach of PCR product purification for removal of dNTP,
pyrophosphate and excess primers from the amplification reaction.
After cleanup, the single-stranded DNA from LATE-PCR is directly
annealed to the sequencing primer and processed for pyrosequencing
according to the manufacturer's instructions. It is important that
LATE-PCR samples should not be heated to a temperature that
denatures the double-stranded product generated in the reaction to
guarantee that the only templates available to the sequencing
primer are the single-stranded DNA products. In fact, it may not be
necessary to heat up the LATE-PCR samples for primer annealing at
all since the template DNA is already single-stranded.
[0103] We have combined LATE-PCR amplification with simplified
clean-up methods to prepare samples for sequencing operations. See
Example 7 and FIG. 14. We have devised two methods of LATE-PCR
sample preparation for Pyrosequencing that do not involve physical
PCR product purification and can be performed in a single tube. In
the first method, the problem of leftover dNTPs from a LATE-PCR
amplification is addressed by using limiting amounts of all dNTPs
during the amplification such that dNTPs are depleted in the course
of the reaction (but not prematurely so as to cause insufficient
production of single-stranded DNA, namely the Excess Primer
strand), which can be determined by routine experiment. The problem
of leftover pyrophosphate from LATE-PCR is addressed by treating
the LATE-PCR sample with an enzyme bearing a pyrophosphatase
activity, for example a pyrophosphatase such as yeast
pyrophosphatase, followed by heat inactivation. The Excess Primer
left over from a LATE-PCR amplification should not interfere with
Pyrosequencing since the matching target sequence for these primers
on the 3' end of the extension product of the Limiting Primer (the
Limiting Primer strand) is: A) bound-up in a double-stranded form
and therefore not easily available and B) 5-20 fold less abundant
than the Excess Primer strand, depending on LATE-PCR primer ratios.
However, to rule out any possibility of mispriming by the Excess
Primers on PCR products at the temperature used for Pyrosequencing,
one may optionally add an oligonucleotide complementary to the
Excess Primer at the start of LATE-PCR amplification. This
complementary oligonucleotide must have a T.sub.m is at least
5-10.degree. C. below the Excess Primer T.sub.m, for instance, by
being a few nucleotides shorter than the Excess Primer at its 3'
end, and must be blocked at the 3' end by any method known by those
skilled in the art to prevent extension of the oligonucleotide by
DNA polymerases (for example, by inclusion of phosphate group).
When designed in this fashion, the complementary oligonucleotide
does not interfere with LATE-PCR amplification but forms a stable
double-stranded hybrid with the Excess Primer at the temperature
used for Pyrosequencing, thereby preventing the Excess Primer from
mispriming other complementary sites on amplified material.
Alternatively, the complementary oligonucleotide can have the same
length or a T.sub.m that is less than 5-10.degree. C. below that of
the Excess Primer, or both, if added after the LATE-PCR reaction.
Additionally, a 3' blocked oligonucleotide containing the same
sequence as the Excess Primer, with or without other modifications
to increase its T.sub.m (for example extra bases at the 3' end or
use of LNA analogs etc.), can be added after the LATE-PCR reaction
in a concentration sufficient to out-compete Excess Primers for the
complementary site on the 3' end of the Limiting Primer strand.
[0104] The second method includes pretreatment of LATE-PCR samples
with the same enzyme and substrate mixtures used for Pyrosequencing
followed by primer annealing and addition of individual dNTPs for
Pyrosequencing. In this method the order of the manufacturer's
recommended protocol is reversed (i.e., the normal protocol calls
for primer annealing followed by addition of Pyrosequencing
reaction mix). In this method, the apyrase present in the
Pyrosequencing mix degrades dNTPs while ATP sulfurylase and
luciferase converts pyrophosphate into ATP and light. The
luciferase and luciferin contained in these solutions provide a
useful system for monitoring the breakdown of PPi as well as dNTPs.
Both ATP and dATP serve as substrates for luciferase, so cessation
of sample light output, as detected by the CCD camera in the
Pyrosequencing machine, serves as a good approximation for cleanup.
If necessary for a particular preparation, particularly if
amplicons are longer than about 100 base pairs or more than about
twenty base-pairs are to be sequenced, the substrates depleted by
these reactions (adenosine 5' phosphosulfate and luciferin) are
then replenished prior to the start of DNA sequencing. In some
cases, initial treatment will require more substrate mixture than
the manufacturer's protocol. In cases where heating and cooling is
required for subsequent primer annealing, these reagents will be
destroyed and need to be replaced prior to Pyrosequencing.
[0105] A variation of the second method is to add a purified enzyme
with a dNTPase activity, for example an apyrase such as potato
apyrase, and a purified enzyme with pyrophosphatase activity, for
example a pyrophosphatase such as yeast pyrophosphatase, followed
by heat inactivation of these enzymes, primer annealing and then
conventional Pyrosequencing. Once again, leftover excess primers
from LATE-PCR generally will not interfere with Pyrosequencing but
in the case that they do, these primers can be dealt with using the
complementary oligonucleotide strategy described above. This second
method does not require adjustments of dNTP concentration for
different LATE-PCR amplifications, and thus saves appreciable
time.
[0106] Direct Pyrosequencing of LATE-PCR products requires 0.5-4
pmoles, sometimes 2-4 pmoles, of prepared single-stranded products
annealed to 3-15 pmoles, sometimes 10-15 pmoles, of sequencing
primer depending on the Pyrosequencing instrument used. In the
second and third sample preparation methods, it is important that
the volume of added LATE-PCR sample be less than one half,
sometimes less than one third, of the total Pyrosequencing reaction
to preserve the optimal pH of the Pyrosequencing mix (pH 7.5
compared to pH 8.0 or above, for example 8.3, for PCR).
Alternatively, LATE-PCR products may comprise more than half the
reaction volume if buffer concentration and pH are adjusted
accordingly. Reagents used for monitoring the various phases of a
LATE-PCR amplification, such as fluorescent DNA dyes and
hybridization probes, are compatible with Pyrosequencing and do not
need to be removed except when a hybridization probe is designed to
bind to a region to be sequenced or where the Pyrosequencing primer
binds. In this case, one of the strategies described above for
blocking the Excess Primer may be employed to block the
hybridization probe. We have determined that reagents to inhibit
mispriming during amplification, disclosed in our concurrently
filed United States Provisional patent application, titled
"Reagents and Methods for Improving Reproducibility and Reducing
Mispriming in PCR Amplification", are compatible with
Pyrosequencing when the final concentration of these compounds in
the Pyrosequencing reaction is 300 nM or below, preferably 200 nM
or below, and the standard DNA polymerase for Pyrosequencing is
used (exonuclease-deficient Klenow DNA polymerase fragment). By
utilizing a PCR sample preparation technique that permits
preparation and amplification in the same chamber or container
(see, for example United States patent publication
US-2003-022231-A1), in combination with a LATE-PCR amplification
carried out in small volumes, preferably less than or equal to 10
.mu.l, for example 2-10 .mu.l, it is possible to obtain
Pyrosequencing information from small groups of cells (from one to
10,000 cells) in a single-tube format. According to this
"Cell-to-Sequence" assay, small groups of cells (from one to 10,000
cells) are prepared for amplification according to the PCR sample
preparation technique such as those described in Pierce et al.
(2002) Biotechniques 32(5): 1106-1111 (see United States patent
publication US-2003-022231-A1), subjected to LATE-PCR
amplification, and processed directly for Pyrosequencing in a
single container, well, tube or reaction chamber as described
above. As demonstrated in Example 8 below and shown in FIG. 15, the
single-tube method allows for precise and accurate genotyping, even
at the single cell, single molecule level.
[0107] A general concern of enzyme-based PCR cleanup approaches for
Pyrosequencing is the overproduction of breakdown byproducts that
may lead to feedback inhibition of enzymes during later sequencing
and shorten read lengths. These include SO.sub.4.sup.2-,
oxyluciferin, inorganic phosphate (Pi), dNMPs and AMP. One way to
limit the pool of Pi and dNMPs is to reduce the concentration of
dNTPs used in during PCR (though, not necessarily to the point
where they are wholly consumed during the reaction as discussed
above in method one). Through quantitative PCR observations on
LATE-PCR amplicons up to six hundred bases long, we have found that
dNTP concentrations can routinely be lowered to 100 nM without
affecting amplification efficiency. Under such conditions,
Pyrosequencing on enzymatically prepared LATE-PCR reactions can be
accomplished for more than fifty consecutive bases as demonstrated
in Example 9, FIG. 16.
[0108] In the case of dideoxy sequencing we have developed a
protocol that includes dilution as the only necessary treatment of
LATE-PCR amplified product. Conventional dideoxy sequencing of
single-stranded amplicon from a LATE-PCR amplification by cycle
sequencing requires 50 fmoles of that product and a known amount of
product, as capillary electrophoresis is sensitive to the amount of
product. Utilizing SYBR Green I fluorescent DNA binding dye to
monitor synthesis of double-stranded DNA and a linear probe labeled
with Cy5 to monitor synthesis of single-stranded amplicon, one can
monitor a LATE-PCR amplification, which preferably includes a
mispriming-inhibiting reagent disclosed in our United States
Provisional patent titled "Reagents and Methods for Improving
Reproducibility and Reducing Mispriming in PCR Amplification." None
of these three additives interferes with subsequent sequencing
reactions. In a LATE-PCR reaction the extent of exponential
amplification and synthesis of double-stranded product is defined
by the amount of Limiting Primer and is independent of the amount
of starting template. The extent of single-strand production can be
limited by restricting the amount of at least one dNTP or by
restricting the number of amplification cycles, if desired.
[0109] We have determined that, for sequencing of the Excess Primer
strand (i.e., the strand made from the Excess Primer in LATE-PCR)
diluting the LATE-PCR amplification with water a total of at least
20-fold or more renders the Excess Primer strand product suitable
as starting material for dideoxy sequencing. To ensure that the
amount utilized with our capillary sequencer contains the required
minimum amount of 50 fmoles of material to be sequenced after
dilution, the linear phase of the LATE-PCR reaction must yield at
least 200 femtomoles (fmoles) single-stranded DNA/microliter
(.mu.l) when the concentration of limiting primer is 25 nanomolar
(nM) (25 fmoles/.mu.l) and so about an 8-fold excess of
single-stranded DNA is needed. To estimate the concentration of
single-stranded DNA generated by a LATE-PCR amplification, we add
to the concentration of strands present in double-stranded DNA at
the end of the reaction (which participate in cycle sequencing, and
whose concentration is defined by the concentration of Limiting
Primer), plus the concentration of single-stranded DNA made per
cycle (we estimate that in general each cycle of linear synthesis
yields approximately 50% of theoretical product, the theoretical
product being equal to the amount of double-stranded DNA in the
reaction, times the number of cycles while the reaction remains
linear. If the product accumulation stops being linear in the
course of the reaction as shown by flattening of the real-time
fluorescence curve for the fluorophore, the amount of
single-stranded DNA made during the non-linear phase is inferred
from the fold-increase in fluorescent signals between the last
cycle when the reaction was linear to the final cycle of the
amplification reaction. Typically, if the concentration of
single-stranded product produced in a LATE-PCR amplification is 200
fmoles/ul, we dilute the Excess Primer strand 1:8 to 25 fmoles/ul
and use 2 ul of diluted products (50 fmoles) directly into a 20 ul
dideoxy sequencing reaction. Under these conditions the total
dilution factor of LATE-PCR products into the sequencing reaction
is 80-fold. One can use as much as 8 .mu.l of diluted LATE-PCR
products (200 fmoles) into the sequencing reaction for a total
dilution of 20 fold and still obtain interpretable sequence
chromatograms.
[0110] Sample purification is necessary because leftover reagents
from PCR amplification, such as dNTP and primers, will interfere
with dideoxy sequencing. LATE-PCR replaces sample preparation by
ethanol precipitation or affinity columns with a simple dilution
step in water. Preparation of LATE-PCR for dideoxy sequencing only
requires dilution of excess single-stranded DNA products in water
at least 8-10 fold to a concentration of 25 fmoles/.mu.l, followed
by addition of 50-200 fmoles single-stranded DNA product to a
dideoxy-cycle sequencing reaction containing 10 pmoles sequencing
primer. The total dilution factor in the final dideoxy sequencing
mix is at least 20-fold. Under these conditions, leftover dNTPs
from LATE PCR are too diluted to interfere with dideoxy sequencing.
Carryover Excess Primer from LATE-PCR is also not a problem,
because the template to which these primers bind, the Limiting
Primer strand, is present at a very low concentration after the
dilution step and is fully hybridized to the Excess Primer strand.
For these two reasons the Excess Primer does not serve as a
sequencing primer. Example 10 and FIG. 17 demonstrate the
effectiveness of our "dilute and go" method. FIG. 17 presents
sequence chromatographs obtained using symmetric PCR and the
traditional sample preparation method (purification of DNA products
using Qiagen columns, followed by quantification by gel
electrophoresis; total preparation time: 1 hr), and sequence
chromatographs obtained using LATE-PCR and dilution in water (total
preparation time: 30 seconds). The sequence chromatographs are
nearly identical.
[0111] Example 11 and FIGS. 18-19 illustrate strategies for
LATE-PCR amplification of more than one product from the same DNA
template in the same reaction. Thus, these reactions contain two
pairs of primers (each comprised of an Excess Primer and a Limiting
Primer) that amplify two separate sequences within a contiguous
template. The two pairs of primers can be arranged such that both
Excess Primers and both Limiting Primers hybridize to the same
strand of the template, or to opposite strands of the template. As
one versed in the art will appreciate, when like primers hybridize
to opposite strands of the template the two Excess Primers can
extend either "inwardly" or "outwardly" on their respective
template stands. FIG. 19 also shows that sequences of both Excess
Primer strands can be obtained from the same reaction mixture via
the "dilute-and-go" method.
[0112] Example 12 and FIG. 20 show that the amount of ssDNA and
dsDNA generated by a LATE-PCR amplification can be measured
independently and can be used to calculate the ratio ssDNA/dsDNA
which, in turn, can be used to determine whether the amount of
ssDNA thus far accumulated is sufficient for subsequent sequencing
via the "dilute-and-go" method.
[0113] Example 13 and FIG. 21 show the "dilute-and-go" method
employed on a 50:50 mixture of LATE-PCR amplicons having two
closely related, but different sequences. FIG. 22 shows that
mixtures comprised of 90:10 and 10:90 ratios of two LATE-PCR
amplicons having closely related, but different sequences can be
distinguished from pure 100:0 and 0:100 mixtures as well as 30:70
and 70:30 mixtures via the "dilute-and-go" method. In order to
accomplish this type of analysis it is necessary to correct the
observed amplitudes of each nucleotide peak at each heterplasmic
position in terms of the expected amplitude of the equivalent
"pure" nucleotide at that position. Once this is done, relative
amounts of each sequence can be calculated as the ratio of
amplitudes (corrected nucleotide 1)/(corrected nucleotide
1+corrected nucleotide 2). Thus, as in the case of mitochondrial
DNA sequences that differ, LATE-PCR and dideoxy "dilute-and-go"
methods described herein can be used to detect heteroplasmy. The
dideoxy method for measuring heteroplasmy is particularly
advantageous because it can be used to survey many hundreds of
nucleotides in a single analysis. Although not wishing to be bound
by any theory, we believe that the methods described herein work,
in contrast to previous attempts based on symmetric PCR and
dideoxy-sequencing, because LATE-PCR generates highly homogeneous
populations of single-stranded amplicons. Symmetric PCR in contrast
tends to generate populations of full length molecules together
with some partial amplicons and some misprimed amplicons.
[0114] Example 14 and FIG. 23 show that a LATE-PCR together with at
least one single mismatch-tolerant probe can be used to generate
end-point melting curves which in turn can be used to quantify the
relative amounts of two or more mixed LATE-PCR amplicons having
closely related, but different, sequences. Quantitative end-point
melting analysis (QE) LATE-PCR of mixtures of related amplicons is
made possible by virtue of the fact that LATE-PCR generates
single-stranded products. Thus, when one or more labeled
mismatch-tolerant probes are present in the reaction, the probe(s)
hybridize first to the most complementary target sequence and then,
if the temperature is lowered sufficiently, to all related target
sequences. Thus each probe/target hybrid in the set has its own
melting temperature and the magnitude of the melting peak derived
from each probe/target hybrid accurately reflects the amount of
each accumulated target sequence. Quantitative measurements of
either the amplitude, or two dimensional area of each melting curve
can then be used to calculate the relative abundance of each target
sequence. The data shown in FIG. 23 demonstrate that this method
can be used with 99.7% confidence to distinguish between
0:100-10:90-50:50-90:10-100:0 mixtures of two sequences that differ
by a single nucleotide.
[0115] Assays according to this invention, whether carried out in
the presence or absence of the reagent described in our U.S.
Provisional patent application 60/619,620 can be independently
optimized to avoid or minimize mispriming by adjusting the
concentration of the DNA polymerase, for example Taq polymerase,
added to the reaction. Decreasing mispriming by adjusting
polymerase can be observed in terms of the kinetics of the LATE-PCR
reaction using a probe of the ssDNA, as well as by the composition
of the final product revealed by various means known in the art. We
have found that it is experimentally convenient to start with a
typical excess concentration of Taq polymerase and then to decrease
this concentration in steps. While too little polymerase can cause
the reaction to become inefficient (manifest as a significant
decrease in the rate or extent of product amplification), optimal
levels of polymerase results in a LATE-PCR amplification assay with
efficient dsDNA amplification and sustained ssDNA synthesis over
many cycles. Example 15 demonstrates that the optimal level of
polymerase can be judged by the dsDNA signal observed using a
double-strand dye such as SYBR Green plus the melting curve of the
dsDNA product, also observed using SYBR Green. Example 16 and FIG.
24 show that when such assays are probed for a specific ssDNA
product generated from different amounts of starting material, the
resulting plots are linear and parallel over many cycles of ssDNA
production.
EXAMPLES
Example 1
Binding Dye Versus Binding Dye Plus Labeled Primers
[0116] To compare the performance of an intercalating dye to the
performance of the dye used in combination with a primer that
includes an interacting fluorophore, an extension assay was
performed. The dye utilized was SYBR Green I at a dilution of
1:40,000.
[0117] Three nucleotide strands were included. A DNA template, an
extendable DNA primer (5' labeled with Cy5, complementary to the
template, and having a T.sub.m of 60.degree. C.), and a
non-extendable DNA oligonucleotide (3' end blocked with a phosphate
group) also complementary to the target, at a location 3' to the
primer, also labeled with Cy5 fluorophore, and having a higher
T.sub.m of 79.degree. C. The spacing between the primer and the
non-extendable nucleotide was chosen such that primer extension
products up to the non-extendable oligonucleotide would all have
T.sub.m's below 79.degree. C.
[0118] The reaction mixture for the primer extension assay included
0.5 micromolar (.mu.M) template DNA, 1.5 .mu.M primer and 1.5 .mu.M
of the non-extendable oligonucleotide. The mixture also included
1.times.PCR buffer, 3 millimolar (mM) MgCl.sub.2, 250 nanomolar
(nM) of each dNTP, 1:40,000.times. SYBR Green I, and Taq DNA
polymerase. The reaction mixture was heated to 50.degree. C. for 2
minutes so as to bind the primer and the non-extendable
oligonucleotide, and to generate primer extension products short of
reaching the non-extendible oligonucleotide. Duplicate samples were
run.
[0119] Following the primer-extension reaction, the product was
subjected to melt analysis in which the SYBR Green dye was excited
as the temperature was changed. Fluorescence readings were taken at
the wavelength of the dye's emission and at the wavelength of the
fluorophore's emission as the temperature was increased through the
range of melting temperatures encompassing the unextended primer
and the non-extendable oligonucleotide. Melt curves, the first
derivative of fluorescence with respect to temperature plotted
against temperature, are presented in FIG. 1, wherein Panel A
presents the curves 1 for the two samples, data from dye emissions
and Panel B presents curves 2 for the two samples, data from Cy5
emissions.
Example 2
Quenched Mismatch-Tolerant Probes
[0120] A labeled probe was designed to have a consensus sequence
complementary to the 16S ribosomal RNA gene of Mycobacterium.
Secondary structure was predicted according to the Mfold programs
(Zucker, M (2003), "Mfold web server for nucleic acid folding and
hybridization prediction," Nucleic Acids Res 31: 3406-3415) with
sodium concentration set at 70 millimolar (mM) and magnesium
concentration set at 3 mM. The sequence of the probe was
Cy5-AATACTGGATAGGACC ACG AGG (SEQ. ID No. 1), with predicted
secondary structure formed by hybridization of the underlined
regions. The predicted T.sub.m of the probe's secondary structure
was 37.degree. C. This probe was tested in samples containing no
target, M. gordonae, or M. asiaticum in mixtures containing SYBR
Green I dye, wherein the dye was excited directly and the
fluorophore was in turn excited indirectly. Results of Cy5
fluorescence versus temperature are presented in FIG. 3, Panel A.
Line 31 (no target) shows high background fluorescence but line 32
(M. gordonae) and line 33 (M. asiaticum) show discernable signals
above background. To quench the background fluorescence, a
non-fluorescent quencher (a Black Hole.TM. II quencher) was added
to the 3' terminal nucleotide of the probe. The modified probe was
similarly tested, and the results are shown in Panel B of FIG. 3.
As can be seen, background fluorescence (line 34, no target)
dropped markedly, and the signals from M. gordonae (line 35) and M.
asiaticum (line 36) were much higher above background.
[0121] Another technique for quenching a probe is to construct the
probe to have a hairpin structure terminally labeled with an
appropriate fluorophore on one end and a quencher on the other. We
constructed a probe having the sequence
Cy5-CTGGATAGGACCACGAGGCCAG-BHQII (SEQ. ID. No. 2), wherein the
underlined sequences are complementary and form a hairpin stem. We
added the three 3'-terminal nucleotides for the purpose of
achieving the stem. The predicted melting temperature of this probe
with a perfectly matched target is 60.degree. C. The predicted
T.sub.m of the stem is about 48.degree. C. (based on the predicted
unmodified nucleotide stem T.sub.m of 40.degree. C. not accounting
for the increased affinity of the fluorophore-quencher
interaction). This probe was also tested as described above, and
the results are presented in Panel C of FIG. 3. Background
fluorescence (line 37, no target) was quite low, and the signals
from M. gordonae (line 38) and M. asiaticum (line 39) were high
above background.
Example 3
Real-Time and End-Point Genotyping Using Mismatch-Tolerant
Probes
[0122] This example illustrates identification of homozygous
samples and heterozygous samples for the G269 allele of the human
Hexosaminidase A (Hex A) gene responsible for Tay-Sachs disease
using real-time LATE-PCR amplification and a Cy5-labeled,
low-T.sub.m, mismatch-tolerant linear probe excited indirectly by
emission from a SYBR dye. Probe hybridization was monitored twice
during each amplification cycle within the detection temperature
space of LATE-PCR, first at 55.degree. C., a temperature at which
the probe is allele-discriminating in this assay and binds
exclusively to its perfectly matched target, and then at 40.degree.
C., a temperature at which the probe is mismatch-tolerant and binds
to the totality of alleles of its target sequence in the
amplification reaction. Detection of specific alleles and total
alleles with the mismatch tolerant probe permits correction of
stochastic tube-to-tube variations in amplicon yield among
replicate samples. The ratio of allele-specific-to-total alleles in
the reaction (Cy5 at 55.degree. C./Cy 5 at 40.degree. C.) allows
normalization of replicate sample for end-point genotyping.
Genotypic information is derived from the ratio values. In the case
of homozygous samples, probe signals detected under
allele-discriminating conditions are the same as probe signals
detected under mismatch-tolerant conditions, since in both cases
the probe is binding to 100% of the target sequence alleles. In
contrast, in the case of heterozygous samples, probes signals
detected under allele-discriminating conditions are half as intense
as probe signals detected under mismatch tolerant conditions, since
the probe is binding to only 50% of the target sequence alleles
under allele-discriminating conditions but to 100% of the alleles
under mismatch tolerant conditions. Hence, homozygous samples have
higher Cy5 at 55.degree. C./Cy 5 at 40.degree. C. ratios than
heterozygous samples. This method of genotyping only relies on
detection of a single allele.
[0123] The sequences and the concentration adjusted melting
temperature, T.sub.m[0], of the LATE-PCR primers and the probe are
as follows. The Limiting Primer has the sequence
5'CGAGGTCATTGAATACGCACGGCTCC 3' (SEQ. ID No. 3). It has a
concentration adjusted T.sub.m[0] of 63.2.degree. C. at 25 nM. The
Excess Primer has the sequence 5' TAACAAGCAGAGTCCCTCTGGT 3' (SEQ.
ID No. 4). It has a concentration-adjusted T.sub.m[0] of
61.8.degree. C. at 1 .mu.M. The probe has the sequence 5'
Cy5-GGGACCAGGTAAGAA 3' (SEQ. ID No. 5). It has a T.sub.m of
56.3.degree. C. It is a Low-T.sub.m probe and when used with a
65.degree. C. annealing temperature, also a Super-Low-T.sub.m
probe.
[0124] Replicate LATE-PCR assays (n=15) were set up for each
different genotype (homozygous G269 and heterozygous G269) in
1.times.PCR buffer, 3 mM MgCl.sub.2, 250 micromolar (.mu.M) dNTP,
25 nM limiting primer, 1000 nM excess primer, 1.25 units Taq DNA
polymerase, 0.6 .mu.M Cy5-labeled probe, and a 1:40,000 dilution
SYBR Gold I. PCR cycles parameters were 95.degree. C. for 3
minutes, then 25 cycles at 95.degree. C. for 10 sec, 65.degree. C.
for 20 sec, and 72.degree. C. for 20 sec, followed by 30 cycles at
95.degree. C. for 10 sec, 65.degree. C. for 20 sec, 72.degree. C.
for 20 sec, 55.degree. C. for 20 sec, and 40.degree. C. for 20 sec
with fluorescence acquisition at 55.degree. C. and 40.degree. C. in
the Cy5 channel. FIG. 7 shows analysis of the ratios of Cy5 signals
at 55.degree. C. to the Cy5 signals at 40.degree. C. and
demonstrates that these ratios are suitable for end-point
genotyping for any amplification cycle past the probe detection
threshold. In this figure, homozygous samples (circle 91) have
ratios approximately twice the ratio of heterozygous samples
(circle 92).
Example 4
Analysis of Multiple Targets Using Target-Specific Probes with
Different Melting Temperatures
[0125] Multiple probes, each labeled with the same fluorophore, can
be used in combination to detect and quantify different sequences
along a single, longer oligonucleotide (for example, a product of
asymmetric PCR, LATE-PCR, or rolling circle amplification), or on
different oligonucleotides. The use of Low-T.sub.m probes increases
the specificity for such targets, greatly reducing or eliminating
signals generated from mismatched targets. One possible application
of this technology is genotyping human DNA to identify known
alleles that cause genetic disease. This example describes
temperature analyses for probe design and for detection of
products.
[0126] As a starting point we chose the following targets that
potentially could be present in an amplification product: the
normal sequence of the cystic fibrosis transmembrane regulator
(CFTR) gene in the region that encodes amino acid 542 of the
protein; the sequence of the Delta F508 mutation, the most common
CFTR mutation; and the normal sequence corresponding to the Delta
F508 mutation.
[0127] We designed Low-T.sub.m allele-discriminating probes for
each of the three target sequences. The probes were low-temperature
molecular beacon probes, each labeled with the fluorophore FAM and
a quencher. The three probes were designed to have different
T.sub.m's versus their targets in mixtures containing 70 mM
Tris-HCl and 3 mM MgCl.sub.2. The "542 probe" had a T.sub.m of
40.degree. C. (predicted value 41.degree. C. by nearest neighbor
calculation); the "508 normal probe" had a T.sub.m of 47.degree. C.
(predicted value 46.degree. C. by nearest neighbor calculation);
and the "Delta F508 probe" had a T.sub.m of 54.degree. C.
(predicted value 53.degree. C. by nearest neighbor calculation).
FIG. 8 presents the melting curves from which the T. values were
obtained. FIG. 8 shows the negative first derivative of
fluorescence readings as a function of temperature for the 542
probe (line 96), the DF508 probe (line 97) and the 508 normal probe
(lines 98) for duplicate samples. Roughly equal peak heights were
obtained by using target concentrations of 1 .mu.M, and 542 probe
concentration of 2 .mu.M. We tested each probe against mismatched
target to check allele discrimination, and we found that
fluorescence against perfect was 5-10 times the fluorescence
against mismatched target.
[0128] It can be seen from FIG. 8 that even small T.sub.m
differences would have been easily resolvable. From a plot such as
FIG. 8, differences of 4-5.degree. C. would be resolvable.
Deconvolution utilizing software supplied with real-time PCR
thermal cyclers might permit resolution of T.sub.m's differing by
half that amount.
[0129] Examining the negative first derivative of the fluorescence
is one method to determine which oligonucleotide targets are
present in a given sample. FIG. 9 shows such an analysis, utilizing
fluorescence above background. Samples containing the normal 508
target, but no Delta F508 target (circle 101) have a melting peak
at 54.degree. C., indicative of that molecular beacon-target
hybrid. Samples containing the Delta F508 target, but no normal
target (circle 102) have a melting peak at about 47.degree. C.,
indicative of hybridization to the beacon with the mutant sequence.
Samples containing both of those targets (circle 103) have a broad
peak over that range of temperatures, indicating fluorescence from
both molecular beacon-target hybrids. The presence and relative
concentration of the normal sequence at the 542 amino acid is
indicated by the presence and relative height of the melting peak
at about 40.degree. C. Samples with 542 normal target (solid line
for each numbered group) have a large peak at that temperature,
samples with 542 mutant target containing a single nucleotide
change in this region identical to the second most common CFTR
mutation (stippled line for each numbered group) have no peak at
that temperature, and samples with both 542 targets (dashed line
for each numbered group) have peaks of intermediate height. The
height of the peak in samples with both 542 targets is affected by
the presence of the neighboring Delta F508 melting peak.
[0130] It may not always be possible or desirable to obtain a
complete melting profile during the course of an amplification
reaction. Further analysis of the samples described above shows
that a limited number of detection steps could provide the
information required to identify the specific oligonucleotides in a
mixture. Decreasing, rather than increasing temperature can be
used. Samples were heated to 70.degree. C., and then lowered in
5.degree. C. decrements to 30.degree. C. with a 30 second detection
at each step. Samples containing the normal 508 target but no Delta
F508 target, or containing the Delta F508 target but no normal
target could be distinguished based on changes in fluorescence
between 60.degree. C. and 50.degree. C. Each combination of target
oligonucleotides produced a unique pattern of fluorescence change.
A scatter plot of the percent change in fluorescence increase at
55.degree. C. vs. the percent change in fluorescence increase at
45.degree. C. is shown in FIG. 10. This analysis distinguishes the
combination of targets that are present in each sample. By using
the changes in fluorescence rather than the fluorescence intensity
itself, an accurate evaluation can be made even when samples differ
considerably in the total concentration of targets, as might occur
in replicate amplification samples. FIG. 10 includes duplicate
samples for each combination of normal 508 plus normal 542 targets
(marks circled 111), normal 508 plus both 542 targets (112), normal
508 plus mutant 542 targets (113), both 508 plus normal 542 targets
(114), both 508 plus both 542 targets (115), both 508 plus mutant
542 targets (116), Delta 508 plus normal 542 targets (117), Delta
508 plus both 542 targets (118), and Delta 508 plus mutant 542
targets (119). A similar analysis could be done using this
temperature profile during each cycle or selected cycles of an
amplification reaction. Several samples with DNA of known genotypes
could be amplified and the detection data used to establish an
expected range of values. This would provide a method for rapid
determination of genotypes from unknown samples.
[0131] Although only 3 probes were used in this example, the
combined use of much higher number of probes is possible. The main
limitations on the total number of probes are the temperature range
for detection and the minimum T.sub.m difference between the
probe-target hybrid. These are in turn dependent on the nature of
the amplification reaction and the capabilities of the equipment
and deconvolution software. For example, 10 different probe-target
combinations could be distinguished over a 30 degree temperature
range if the minimum T.sub.m difference for deconvolution is 3
degrees. This number can be increased several fold by using
multiple fluorophores.
Example 5
Two Temperature Normalization with and without Background
Correction
[0132] QE LATE-PCR genotyping of the rs858521 SNP was performed
with unknown DNA samples and homozygous control rs858521 (CC
alleles) and heterozygous control (CG alleles) using a single
Cy5-labeled mismatch-tolerant probe. Amplification and detection
were performed using an ABI Prism Sequence Detector 7700 (Applied
Biosystems, Foster City, Calif., U.S.A.), which normally generates
baseline-corrected fluorescent signals. For our analysis utilizing
ratios, however, fluorescent signal ratios were obtained both from
baseline-corrected fluorescence signals (FIG. 11) and from raw
fluorescent signals (FIG. 12). FIG. 11 presents the ratio of the
probe's fluorescence at 50.degree. C. to its fluorescence at
25.degree. C. as a function of the amplification reaction's cycle
number utilizing the instrument's baseline-corrected fluorescent
signals. In FIG. 11, circle 113 is replicates of the homozygous
control, circle 114 is replicates of the heterozygous control,
while circles 111 and 112 are the unknowns. FIG. 12 presents the
same results utilizing raw fluorescence signals. In FIG. 12, circle
116 is replicates of the homozygous control, circle 117 is
replicates of the heterozygous control, and circle 115 is the
unknowns. The use of baseline-corrected fluorescence signals for
normalization resulted in ambiguous genotyping for one sample FIG.
11, circle 112. In contrast, use of raw fluorescence signals for
normalization provided the correct genotyping for all samples. This
result demonstrates that baseline-correction in the ABI Prism 7700
Sequence Detector software can introduce artifacts that affect
signal normalization and preferably should not be used.
Example 6
Three Temperature Normalization
[0133] Replicate LATE-PCR amplification reactions containing the
rs858521 SNP primers and a single mismatch-tolerant resonsense
probe were performed with purified genomic DNA for each genotype of
the rs858521 gene SNP (1800 genomes equivalent, 18 replicate
reactions of each homozygous CC, heterozygous CG, and homozygous GG
genotypes). The amplified products were analyzed by melting curves,
shown in FIG. 13, panel A and by normalizing the data, as shown in
Panel B and panel C. FIG. 13A shows a plot of the raw fluorescence
signals collected during melting curve analysis following LATE-PCR
amplification. The probe that was utilized was
allele-discriminating at higher temperatures but became
progressively more mismatch tolerant as temperature was reduced.
The intrinsic variability in product yield among replicate samples
precludes discrimination of these genotypes by raw fluorescence
signals (circle 131) within the temperature window of allele
discrimination for this probe (40.degree. C.-60.degree. C.,
previously determined with synthetic oligonucleotide targets, data
not shown). FIG. 13B shows the signals from each sample normalized
at every temperature against the signal collected at a fully
mismatch-tolerant temperature (25.degree. C.) for that sample. In
FIG. 13B the normalized signals for the homozygous CC alleles are
circle 132, the normalized signals for the heterozygous CG alleles
are circle 133, and the normalized signals for the homozygous GG
alleles are circle 134. As the figure shows, normalization reduces
signal scatter and allows identification of each genotype within
the window of allele discrimination. Maximum separation was
observed at 52.degree. C., which corresponds to the Tm of the
resonsense probe that was used. Although signal scatter was
significantly reduced in FIG. 13B compared to FIG. 13A, there was
still some variability in signal intensity among replicate samples
judging from the spread in the kinetic plots. FIG. 13C shows that
the best method to eliminate this residual signal scattering was by
normalizing the fluorescent signals at each temperature to the
fluorescent signals collected at top and bottom temperatures of the
window of allele discrimination observed in FIG. 13B where melting
curves start to diverge (that is, 40.degree. C. and 60.degree. C.
respectively). In FIG. 13C the normalized signals for the
homozygous CC alleles are circle 135, the normalized signals for
the heterozygous CG alleles are circle 136, and the normalized
signals for the homozygous GG alleles are circle 137. If Fb and Ft
are the fluorescence readings towards the bottom and the top of the
temperature window of allele discrimination, respectively, and Fs
is the fluorescent reading at any given temperature during melt
analysis, then the normalized fluorescent ratios are calculated
as:
Three-Temperature Normalized Fluorescence Ratio=(Fs-Ft)/(Fb-Ft)
[0134] Simultaneous normalization of the fluorescent signals at
each temperature to the fluorescent signals at 40.degree. C. and
60.degree. C. within any given sample further reduced fluorescent
signal scatter and caused the replicate melting curves from each
genotype to become very tight (see FIG. 13C). Fluorescent ratios
calculated at a single temperature, namely, the T.sub.m of the
probe (52.degree. C.) normalized using the fluorescent signals
towards the top and bottom temperatures of window of allele
discrimination (i.e., at 60.degree. C., 40.degree. C.) uniquely
define each genotype with greater than 99.7% certainty (i.e., error
boxes consisting of three-standard deviations encompassing 99.7% of
all possible fluorescent ratios for each genotype are well
separated from each other, data not shown). Similarly improved
results were obtained for the rs2270517 SNP site when fluorescent
signals were calculated at the T.sub.m of the probe (57.degree. C.)
normalized to the corresponding top and bottom temperatures of
window of allele discrimination (i.e., at 71.degree. C., 45.degree.
C.).
Example 7
Direct Pyrosequencing of LATE-PCR Product
[0135] Replicate LATE-PCR amplifications were carried out in 25
.mu.l volume consisting of 1.times.PCR buffer, 3 mM MgCl.sub.2, 20
nanomolar (nM) dNTP, 25 nM Limiting Primer, 1000 nM Excess Primer,
1.25 units Platinum Taq DNA polymerase, and 100 genomes human DNA.
The sequence of the Limiting Primer was 5' CCGCCCTTCTCTCTGCCCCCTGGT
3' (SEQ. ID No. 6) and the sequence of the Excess Primer was 5'
GCCAGGGGTTCCACTACGTAGA 3' (SEQ. ID No. 7). These sequences amplify
a 94 base-pair segment from exon 11 of the human Hexosaminidase A
gene. For LATE-PCR amplification, the thermal cycle profile was
95.degree. C. for 3 min followed by 10 cycles of 95.degree. C. for
10 sec, and 72.degree. C. for 20 sec, followed by 55 cycles of
95.degree. C. for 10 sec, 67.degree. C. for 20 sec, and 72.degree.
C. for 20 sec. After the reaction 16.6 .mu.l (the equivalent of 3
pmoles of single-stranded DNA (ssDNA) as estimated empirically from
previous pyrosequencing experiments) were mixed with 20 microliter
(.mu.l) 10 mM Tris-Cl pH 8.5 and placed in a well of a microtiter
plate used for pyrosequencing. For removal of carried-over dNTP and
pyrophosphate from the LATE-PCR-amplified product, standard
pyrosequencing enzyme mixture consisting of exonuclease-deficient
Klenow DNA polymerase, apyrase, luciferase, ATP sulfurylase and
standard pyrosequencing Substrate Mixture consisting of luciferin
and adenosine 5' phosphosulfate as provided in the PSQ 96 SNP
Reagent Kit (Pyrosequencing, Inc, Westboro, Mass.) were dispensed
sequentially into the well containing the LATE-PCR sample using a
PSQ 96 instrument (Pyrosequencing, Inc., Westboro, Mass.) according
to the manufacturer's instructions and incubated for 60 sec at
37.degree. C. The subsequent dNTP additions normally carried out
automatically by the PSQ 96 instrument were replaced by a single
addition of 10 mM Tris-Cl pH 7.5 using the default volume
programmed in the instrument. Following this step, the well
containing the LATE-PCR sample received 2.5 .mu.l 10 .mu.M
sequencing primer (5' CTGGTACCTGAACCGTAT 3') (SEQ. ID No. 8).
Taking into account the volume of pyrosequencing enzyme and
substrate mixtures added to the LATE-PCR sample, the final
concentration of sequencing primer was estimated to be 0.5 .mu.M
and the final volume 50 .mu.l. The sample with the sequencing
primer was returned to the PSQ 96 instrument again and processed
according to the manufacturer's instructions except that the
pyrosequencing enzyme and substrate additions normally carried out
by the instrument were replaced by addition of similar volumes of
10 mM Tris-Cl pH 7.5 followed by addition of dNTP. The resulting
pyrogram is shown in FIG. 14, Panel A, which shows light signal
resulting from incorporation of particular nucleotides. The height
of the peaks corresponds to the number of nucleotides incorporated
during each addition. Referring to Panel C of FIG. 14, one sees
that one of each of the first two nucleotides (A, T) was
incorporated into the template, followed by two of the next
nucleotide (C, C), and so on. Based on the height of the peaks and
the order of nucleotide additions a sequence was derived: 5'
ATCCTATGGCCC3' (SEQ. ID No. 9) and subsequently confirmed using the
GenBank sequence for the human Hexosaminidase A gene (GenBank
accession number: S62068). These results demonstrate pretreatment
of LATE-PCR samples with the enzyme and substrates mixtures used
for pyrosequencing permits direct pyrosequencing of
LATE-PCR-amplified product following primer annealing and iterative
dNTP addition. Altering the above protocol to follow the
manufacturer's instructions (i.e., performing primer annealing
followed by addition of the pyrosequencing enzyme and substrate
mixtures) resulted in 80% false positive peaks upon addition of
dNTP that were not supposed to be incorporated on the template.
These false positive peaks were due to partial extension the
sequencing primer from the leftover dNTP from LATE-PCR
amplification prior to pyrosequencing.
[0136] In a separate experiment, the same LATE-PCR sample described
above was subjected to purification using a QIAquick PCR
purification kit (Qiagen, Valencia, Calif.) according to the
manufacturer's instructions and recovered at 0.375 pmoles/.mu.l in
10 mM Tris-Cl pH. 7.5. Eight microliters (.mu.l) of this solution
(3 pmoles total) were mixed with the sequencing primer described
above to a final concentration of sequencing primer of 0.5 .mu.M in
a final volume of 50 .mu.l in 10 mM Tris-Cl pH. 7.5. The sample was
subjected to pyrosequencing using the PSQ 96 instrument according
to the manufacturer's instructions. The resulting pyrogram is shown
in FIG. 14, panel B. Traditional preparation, while more
time-consuming and expensive, did not give superior data as
compared to our method that produced Panel A.
Example 8
Direct Pyrosequencing of LATE-PCR Products
[0137] To genotype single cells, replicate LATE-PCR amplifications
were carried out in a 25 .mu.l volume consisting of 1.times.PCR
buffer, 3 mM MgCl.sub.2, 100 .mu.M dNTP, 100 nM Limiting Primer,
1000 nM Excess Primer, 1.25 units AmpliTaq Gold DNA polymerase
(Applied Biosystems, USA). Each reaction was initiated with a
single human lymphoblast prepared as described in Pierce et al.
(2002) Biotechniques 32(5): 1106-1111 (see United States patent
publication US-2003-022231-A1) with one of the three possible
genotypes for the IVS-110 mutation. The sequence of the Limiting
Primer was 5' GGCCATCACTAAAGGCACCGAGCACT 3' (SEQ. ID NO. 10) and
the sequence of the Excess Primer was 5'
GGGTTTCTGATACGCACTGACTCTCTC 3' (SEQ. ID NO. 11). These sequences
amplify a 191 base-pair segment from the .beta.-Globin gene on
human chromosome 11p. For LATE-PCR amplification, the thermal cycle
profile was 95.degree. C. for 10 min followed by 65 cycles of
95.degree. C. for 10 sec, 66.degree. C. for 15 sec and 72.degree.
C. for 20 sec. After amplification, 5 .mu.l were mixed with 6.64
.mu.l 120 mM Tris-Acetate pH 7.6 and placed in a well of an optical
plate used for Pyrosequencing. For removal of carried-over dNTPs
and PPi from the product of LATE-PCR amplification a standard
volume of Pyrosequencing enzyme mixture (consisting of
exonuclease-deficient Klenow DNA polymerase, apyrase, luciferase,
ATP sulfurylase) and approximately twice the standard volume of
substrate mixture (consisting of luciferin and adenosine 5'
phosphosulfate) as provided in the Pyro Gold Reagent Kit (Biotage
AB, Uppsala, Sweden) were dispensed sequentially into the wells
containing the LATE-PCR samples using a PSQ HS 96A instrument
(Biotage AB, Uppsala, Sweden) using the following instrument
settings: enzyme mix pulse time: 23.5 ms; substrate mix pulse time:
44.0 ms; reagent dispensation pressure: 400 mbar. Samples were
incubated for 60 sec at 28.degree. C. until light output dropped
below background. Following this, 0.36 .mu.l of a 10 .mu.M
sequencing primer: 5' GACCACCAGCAGCCTAAG 3' (SEQ. ID NO. 12) was
added to each sample for a total reaction volume of 12 .mu.l and
then annealed at 80.degree. C. for 2 min followed by cooling to
room temperature for 10 min. In addition, a 900 .mu.M concentration
of a 3' phosphorylated version of the LATE-PCR Limiting Primer
(SEQ. ID NO. 7) was also added here to prevent the 3' end of the
template strand from folding over on itself and extending. Samples
with the sequencing primer were then returned to the PSQ HS 96A
instrument again and processed according to the manufacturer's
instructions, including normal enzyme and substrate mix additions.
The resulting Pyrograms from cells with a homozygous wild-type,
heterozygous and homozygous mutant genotypes are shown in FIG. 15,
Panels A-C, respectively. Light units and peak heights are as
explained in Example 7. The relative height of the peaks
corresponds to the number of nucleotides incorporated at each
position. Referring to panel A of FIG. 15, one sees that the second
peak (T) is half as tall as the first peak (G), one third as tall
as the third peak (G), one forth as tall as the fourth peak (A) and
the same height as peaks 5-8 (TAGA). The sequence for the first
eight peaks is thus read as: GGTGGGAAAATAGA (SEQ. ID No. 13). Based
on the height of the peaks and the order of nucleotide additions,
the wild-type .beta.-Globin sequence in FIG. 15, panel A was
derived and subsequently confirmed using the GenBank sequence for
the human .beta.-Globin Gene. A heterozygous (Panel B) or
homozygous (Panel C) mutation was confirmed at the IVS-110 site,
indicated by arrows. It is of note in Panel B that the 1.5 unit "C"
peak followed by a 0.5 unit "T" peak indicates a "C" base in both
alleles followed by a "C" in one allele and a "T" in the other
allele. These results demonstrate that pretreatment of LATE-PCR
samples with the enzyme and substrates mixtures used for
Pyrosequencing permits direct Pyrosequencing of LATE-PCR following
primer annealing and iterative dNTP additions. Altering the above
protocol to follow the manufacturer's instructions (i.e.,
performing primer annealing followed by addition of the
Pyrosequencing enzyme and substrate mixtures) resulted in 80% false
positive peaks upon addition of dNTP that were not supposed to be
incorporated on the template. These false positive peaks were due
to partial extension of the sequencing primer with leftover
dNTPs.
Example 9
Pyrosequencing of LATE-PCR Products for Long Sequences
[0138] A LATE-PCR amplification was carried out in a 25 .mu.l
volume consisting of 1.times.PCR buffer, 3 mM MgCl.sub.2, 100 .mu.M
dNTP, 100 nM Limiting Primer, 1000 nM Excess Primer, 1.25 units
AmpliTaq Gold DNA polymerase (Applied Biosystems, USA) and 50 nM of
mispriming-reducing reagent 9-22DD as disclosed in our filed United
States Provisional patent application, titled "Reagents and Methods
for Improving Reproducibility and Reducing Mispriming in PCR
Amplification". Reagent 9-22DD is a hairpin oligonucleotide having
a stem nine nucleotides long and a single-stranded loop 22
nucleotides long. The oligonucleotide is modified by the addition
of 5' terminal and 3' terminal Dabcyl moieties. Its nucleotide
sequence is 5' CGCGGCGTCAGGCATATAGGATACCGGGACAGACGCCGCG 3' (SEQ.
ID. No 14). The reaction was initiated with 20 genome equivalents
of human DNA. The sequence of the Limiting Primer was 5'
GGTCAGCGCCGGGCTGCAAGTGTAGA 3' (SEQ. ID NO. 15) and the sequence of
the Excess Primer was 5' GATGGGTGGAGCTTGTCTTGAGG 3' (SEQ. ID NO.
16). These sequences amplify a 78 base-pair segment near the p53
gene on human chromosome 17p. For LATE-PCR amplification, the
thermal cycle profile was 95.degree. C. for 10 min followed by 60
cycles of 95.degree. C. for 10 sec, 66.degree. C. for 10 sec and
72.degree. C. for 20 sec. After amplification, 7.5 .mu.l of product
was mixed with 9.96 .mu.l 20 mM Tris-Acetate pH 7.6 and placed in a
well of an optical plate used for Pyrosequencing. For removal of
carried-over dNTPs and PPi from LATE-PCR a standard volume of
Pyrosequencing enzyme mixture (consisting of exonuclease-deficient
Klenow DNA polymerase, apyrase, luciferase, ATP sulfurylase) and
approximately twice the standard volume of substrate mixture
(consisting of luciferin and adenosine 5' phosphosulfate) as
provided in the Pyro Gold Reagent Kit (Biotage AB, Uppsala, Sweden)
was dispensed sequentially into the well containing the LATE-PCR
samples using a PSQ HS 96A instrument (Biotage AB, Uppsala, Sweden)
using the following instrument settings: enzyme mix pulse time:
23.5 ms; substrate mix pulse time: 44.0 ms; reagent dispensation
pressure: 400 mbar. The sample was then incubated for 60 sec at
28.degree. C. until light output dropped below background. In this
amplicon, the Limiting LATE-PCR primer (SEQ. ID NO. 10) was used as
the Pyrosequencing primer and 0.54 .mu.l of 10 .mu.M solution of
this was added to each sample for a total reaction volume of 180
and then annealed at 80.degree. C. for 2 min followed by cooling to
room temperature for 10 min. Samples with the sequencing primer
were then returned to the PSQ HS 96A instrument again and processed
according to the manufacturer's instructions, including normal
enzyme and substrate mix additions. The resulting Pyrogram is shown
in FIG. 16. The relative height of the peaks corresponds to the
number of nucleotides incorporated at each position as described in
Example 8. The correctly matching expected sequence, as determined
from the GenBank database, is noted above the peaks with subscripts
indicating the number a given base in a row (i.e.
G.sub.1C.sub.1A.sub.1G.sub.2=GCAGG). These results demonstrate that
pretreatment of LATE-PCR samples with the enzyme and substrates
mixtures used for Pyrosequencing allows for reads more than fifty
base pairs long.
Example 10
Direct Dideoxy Sequencing of LATE-PCR Product
[0139] PCR amplifications were performed utilizing an ABI Prism
Sequence Detector 7700 (Applied Biosystems, Foster City, Calif.,
U.S.A.) to amplify a segment of exon 7 of the human Hexosaminidase
A gene containing the G269 mutation, which is responsible for
Tay-Sachs Disease. The sequence corresponds to GenBank accession
number M16417. One amplification was a LATE-PCR amplification, and
the product was subjected directly to dideoxy sequencing. As a
control the primer concentrations were changed to equimolar, a
conventional symmetric PCR amplification was performed, and
amplified product was subjected to conventional purification prior
to dideoxy sequencing.
Amplification Reaction Mixtures (Final Concentrations)
[0140] Volume: 25 .mu.l [0141] 1.times.PCR buffer (Invitrogen,
Carlsbad, Calif., U.S.A.) [0142] 3 mM MgCl.sub.2 [0143] 10 .mu.M
dNTPs [0144] 0.6 .mu.M Probe (LATE-PCR only) [0145] 1:41,666
dilution SYBR Gold Dye (Molecular Probes, Eugene, Oreg., U.S.A)
[0146] 1.25 Units Platinum Taq DNA polymerase (Invitrogen) [0147] 6
ng human genomic DNA (equivalent to 1000 genomes) [0148] Primers:
for LATE-PCR, 25 nM Limiting Primer and 1000 nM Excess Primer; (for
the control, 300 nM of each of the same primers).
Oligonucleotide Sequences
TABLE-US-00001 [0149] Limiting Primer: (SEQ. ID. No. 17) 5'
CGAGGTCATTGAATACGCACGGCTCC 3' Excess Primer: (SEQ. ID. No. 18) 5'
TAACAAGCAGAGTCCCTCTGGT 3' Probe: (SEQ. ID No. 19) 5' Cy5
GGGACCAGGTAAGAA-Phosphate 3'
Cycle Sequencing Reaction Mixture
Volume: 20 .mu.l
[0150] 100 femtomoles (fmoles) product being sequenced [0151] 5
picomoles (pmoles) Sequencing Primer (either the Limiting Primer or
the Excess Primer) [0152] 1.times.DTC5 Quick Start Master Mix
(Beckman Coulter, Inc., Fullerton, Calif., U.S.A.) [includes dNTPs,
ddNTP, buffer, MgCl.sub.2].
Dideoxy Sequencing
[0153] Sequencing reaction mixtures were subjected to cycle
sequencing and capillary electrophoresis in a CEQ 2000XL DNA
Sequence (Beckman Coulter, Inc., Fullerton, Calif., U.S.A.) using
the CEQ 2000 Due Termination Cycle Sequencing Kit (Beckman Coulter)
according to the manufacturer's instructions.
LATE-PCR Amplification and Sequencing Preparation
[0154] The LATE-PCR amplification reaction mixture was subjected to
thermal cycling as follows: 95.degree. C. for 3 min; 20 cycles of
95.degree. C. for 10 sec, 65.degree. C. for 20 sec and 72.degree.
C. for 20 sec, and 70 cycles of 95.degree. C. for 10 sec,
65.degree. C. for 20 sec, 72.degree. C. for 20 sec, 55.degree. C.
for 20 sec and 40.degree. C. for 20 sec. Synthesis of
double-stranded amplicon was monitored by exciting the SYBR dye and
reading its fluorescence during the 72.degree. C. primer-extension
step. Synthesis of single-stranded product following exhaustion of
the Limiting Primer was monitored by exciting the SYBR dye and
reading fluorescence from the low-T.sub.m Probe's Cy5 fluorophore
during the 40.degree. C. low-temperature detection step.
[0155] To obtain 100 (moles of the extension product of the Excess
Primer, dilution of the amplification product was necessary. We
estimated the amount of product in the 25 .mu.l of reaction product
in the following manner. First, the amount of that product in
double-stranded product made during the initial amplification
cycles is dictated by the amount of Limiting Primer. In this
example that was 25 nM, which translates to 25 fmoles/.mu.l. The
concentration of single-stranded extension product made during the
linear phase of LATE-PCR amplification, that is, after exhaustion
of the Limiting Primer, was estimated by dividing that phase into
two parts determined by inspection of the Cy5 fluorescence curve: a
first part in which amplification proceeds arithmetically, and a
second part in which product accumulation has slowed. For the first
part, which in this example was six cycles, we assumed an
amplification efficiency of 50%, based on Gyllensten, U. B. H. and
Erlich, A. (1988), "Generation of Single-Stranded DNA by the
Polymerase Chain Reaction and its Application to Direct Sequencing
of the HLA-DQA LOCUS," Proc. Natl. Acad. Sci. USA 85: 7652-7656.
Production of single strands during the six cycles was calculated
as the starting concentration (25 (moles/.mu.l) times the number of
cycles (6) times the efficiency (0.5). Further production was
estimated as the percentage increase in Cy5 signal during the
remainder of the reaction, which in this case was 233.3%. Total
production during the linear phase was thus 175 fmoles/.mu.l
(25.times.6.times.0.5.times.2.333), and the total concentration of
that product, including 25 fmoles/.mu.l in double-stranded
amplicon, was estimated to be 200 fmoles/.mu.l. To obtain 100
fmoles in the cycle-sequencing reaction mixture, we diluted the
amplification product 1:8 with water and used 4 .mu.l of the
diluted product in the 20 .mu.l reaction mixture. As will be
appreciated, this meant that the amplification product was
ultimately diluted 1:40.
[0156] To obtain 100 fmoles of the extension product of the
Limiting Primer, our starting point was that the product of the
amplification reaction contained 25 nM of that product, or 25
fmoles/.mu.l. We simply used 4 .mu.l of the amplification product
in the 20 .mu.l cycle-sequencing reaction mixture to obtain the
desired starting amount of 100 fmoles.
Control Amplification and Sequencing Preparation.
[0157] The amplification reaction mixture was subjected to the same
thermal cycling profile, except that only 18 (rather than 70) of
the five-temperature cycles were carried out, because a real-time
plot of the intercalating dye signal indicated that the
amplification plateaued at this point and only desired
amplification product was made to that point. The amplification
products in the amplification mixture at the end of amplification
were purified in conventional manner using QUIA quick PCR
purification kit (Qiagen, Valencia, Calif., U.S.A.) according to
the manufacturer's instructions. Purified amplicons were quantified
by gel electrophoresis in a 3% agarose gel in 0.5.times.TBE against
different known amounts of .PHI.X174 Hind III DNA markers following
visualization by ethidium bromide staining (0.5 .mu.g/ml). A volume
containing 100 fmoles was used in the cycle-sequencing reaction
mixture with each sequencing primer.
Results
[0158] The LATE-PCR and control methods both produced sequences
corresponding to Genbank sequence information (accession number M
16417). FIG. 17 includes four chromatographs obtained from dideoxy
sequencing. Panel A is from the LATE-PCR method with cycle
sequencing utilizing the Limiting Primer as the sequencing primer.
Panel B is from the LATE-PCR method with cycle sequencing utilizing
the Excess Primer as the sequencing primer. Panel C is the control
method utilizing the Excess Primer as the sequencing primer. Panel
D is the control method utilizing the Limiting Primer as the
sequencing primer. Each chromatograph includes the fluorescence
curves obtained from the labeled dideoxy nucleotides and the
nucleotide sequence determined.
Example 11
Strategies for Late-PCR Amplification of More than One Product from
the Same DNA Template in the Same Reaction
[0159] PCR amplifications were performed utilizing an ABI Prism
Sequence Detector 7700 (Applied Biosystems, Foster City, Calif.,
U.S.A.) to amplify two amplicons of 549 and 464 bases designated as
HV1 and HV2 H and L strands in the same duplex reaction within the
d-loop region of Human mitochondrial DNA based on which sequences
were amplified using an Excess Primer.
Amplification Reaction Mixtures (Final Concentrations)
[0160] Volume: 25 .mu.l [0161] 1.times.PCR buffer (Invitrogen,
Carlsbad, Calif., U.S.A.) [0162] 3 mM MgCl2 (Invitrogen) [0163] 250
.mu.M dNTPs (Promega) [0164] 1.0 .mu.M Probe (LATE-PCR only) [0165]
10.times. dilution SYBR Green Dye (FMC Bioproducts, Rockland Me.,
U.S.A) [0166] 1.25 Units Platinum Taq DNA polymerase (Invitrogen)
[0167] Human blood lymphocyte genomic DNA (equivalent to 100 mtDNA
genomes) [0168] Primers: for LATE-PCR, 50 nM Limiting Primer and
1000 nM Excess Primer.
Oligonucleotide Sequences
TABLE-US-00002 [0169] Probe: (SEQ. ID No. 20) 5'
Cy5-TGCTAATGGTGGAG-Phosphate 3' HV1-H Limiting Primer: (SEQ. ID.
No. 21) 5' GCCCGGAGCGAGGAGAGTAGCACTCTTG 3' Excess Primer: (SEQ. ID.
No. 22) 5' CACCAGTCTTGTAAACCGGAGATGAA 3' HV2-H Limiting Primer:
(SEQ. ID. No. 23) 5' GTATGGGAGTGGGAGGGGAAAATAATGTGTTAG 3' Excess
Primer: (SEQ. ID. No. 24) 5' AGGTCTATCACCCTATTAACCACTCA3' HV1-L
Limiting Primer: (SEQ. ID. No. 25) 5'
CACCAGTCTTGTAAACCGGAGATGAAAACC 3' Excess Primer: (SEQ. ID. No. 26)
5' CGAGGAGAGTAGCACTCTT3' HV2-L Limiting Primer: (SEQ. ID. No. 27)
5' AGGTCTATCACCCTATTAACCACTCACGGG 3' Excess Primer: (SEQ. ID. No.
28) 5' GGAGGGGAAAATAATGTGTTAGT 3'
Cycle Sequencing Reaction Mixture
[0170] Volume: 25 .mu.l [0171] 100 fmoles product being sequenced
[0172] 5 pmoles Sequencing Primer (either the Limiting Primer or
the Excess Primer) [0173] 1.times.DTC5 Quick Start Master Mix
(Beckman Coulter, Inc., Fullerton, Calif., U.S.A.) [0174] [includes
dNTPs, ddNTP, buffer, MgCl2].
Dideoxy Sequencing
[0175] Sequencing reaction mixtures were subjected to cycle
sequencing and capillary electrophoresis in a CEQ 2000XL DNA
Sequence (Beckman Coulter, Inc., Fullerton, Calif., U.S.A.) using
the CEQ 2000 Dye Termination Cycle Sequencing Kit (Beckman Coulter)
according to the manufacturer's instructions.
LATE-PCR Amplification and Sequencing Preparation
[0176] The LATE-PCR amplification reaction mixture was subjected to
thermal cycling as follows: 95.degree. C. for 3 min; 15 cycles of
95.degree. C. for 15 sec, 64.degree. C. for 10 sec and 72.degree.
C. for 45 sec, and 50 cycles of 95.degree. C. for 15 sec,
64.degree. C. for 10 sec, 72.degree. C. for 45 sec, and for HV1-H
only 50.degree. C. for 20 sec. Synthesis of double-stranded
amplicon was monitored by exciting the SYBR Green dye and reading
its fluorescence during the 72.degree. C. primer-extension step.
Synthesis of single-stranded product following exhaustion of the
Limiting Primer was monitored by exciting the SYBR dye and reading
fluorescence from the low-Tm Probe's Cy5 fluorophore during the
50.degree. C. low-temperature detection step for HV1-H region
only.
[0177] To obtain 100 fmoles of the extension product of the Excess
Primer, dilution of the amplification product was necessary. We
estimated the amount of product in the 25 .mu.l of reaction product
in the following manner. First, the amount of that product in
double-stranded product made during the initial amplification
cycles is dictated by the amount of Limiting Primer. In this
example that was 50 nM, which translates to 50 fmoles/.mu.. The
concentration of single-stranded extension product made during the
linear phase of LATE-PCR amplification, that is, after exhaustion
of the Limiting Primer, was estimated by dividing that phase into
two parts determined by inspection of the Cy5 fluorescence curve: a
first part in which amplification proceeds arithmetically, and a
second part in which product accumulation has slowed. For the first
part, which in this example was eleven cycles, we assumed an
amplification efficiency of 50%, based on Gyllensten, U. B. H. and
Erlich, A. (1988), "Generation of Single-Stranded DNA by the
Polymerase Chain Reaction and its Application to Direct Sequencing
of the HLA-DQA LOCUS," Proc. Natl. Acad. Sci. USA 85: 7652-7656.
Production of single strands during the eleven cycles was
calculated as the starting concentration (50 fmoles/.mu.l) times
the number of cycles 11) times the efficiency (0.5). Further
production was estimated as the percentage increase in Cy5 signal
during the remainder of the reaction, which in this case was 100%.
Total production during the linear phase was thus 275 (moles/.mu.l
(50.times.11.times.0.5.times.1.0), and the total concentration of
that product, including 50 fmoles/.mu.l in double-stranded
amplicon, was estimated to be 325 fmoles/.mu.l. To obtain 100
fmoles in the cycle-sequencing reaction mixture, we diluted the
amplification product 1:13 with water and used 4 .mu.l of the
diluted product in the 25 .mu.l reaction mixture.
[0178] Results
[0179] There are four possible combinations are: 1) HV1-H with
HV2-H, 2) HV1-L with HV2-L, 3) HV1-H with HV2-L, 4) HV1-L with
HV2-H. FIG. 18 shows a 4% agarose gel from electrophoresis of
no-template controls (NTC), left three lanes; amplicons from
reactions begun with 100 copies of genomic DNA, next three lanes;
and in the far right lane a 100 base-pair ladder. FIG. 18 shows the
formation of the HV1-H and HV2-H dsDNA amplicons of 549 and 464
base pairs using 100 copies of genomic DNA at the start of the
reaction. No template controls, NTC, did not amplify.
[0180] As one versed in the art will understand, in amplifying two
single-stranded amplicons in the same reaction from a single
template, the two excess primer strands can be generated from the
same strand of DNA or from complementary strands of DNA. We have
successfully employed both approaches. In the combinations HV1-H
with HV2-H and HV1-L with HV2-L both amplicons are generated from
the same DNA template strand. In the combinations HV1-H with HV2-L
and HV1-L with HV2-H the two amplicons are generated from
complementary strands of DNA. FIG. 19 A displays sequence
information for amplicon HV1-H in the duplex HV1-H with HV2-H in
the region of bases 16209-16169. FIG. 19 B displays sequence
information for the amplicon HV2-H in the duplex HV1-H with HV2-H
in the region bases 289-326. FIG. 19 C displays sequence
information for the HV1-H amplicon in the duplex HV1-H with HV2-L
in the region bases 16209-16169. FIG. 19 D displays sequence
information for the HV2-L amplicon in the duplex HV1-H with HV2-L
in the region bases 289-326. The LATE-PCR produced sequences
corresponding to GenBank sequence information.
Example 12
Determining ssDNA Need
[0181] The amount of single stranded DNA and double stranded DNA
generated by a LATE-PCR amplification can be used to determine
amount of ssDNA needed for "dilute-and-go" Dideoxy Sequencing. PCR
amplifications were performed utilizing an ABI Prism Sequence
Detector 7700 (Applied Biosystems, Foster City, Calif., U.S.A.) to
amplify the 549 base amplicon designated as HV1 H within the d-loop
region of human mitochondrial DNA. MtDNA was extracted under lysis
conditions (as described in Peirce et al. (2002) Biotechniques
32(5); 1106-1111 with the inclusion of 4 .mu.l DTT in 100 .mu.l of
the lysis reaction mixture) from a human hair shaft. All
amplifications were LATE-PCR amplifications, and the product was
subjected directly to dideoxy sequencing.
Amplification Reaction Mixtures (Final Concentrations)
[0182] Volume: 25 [0183] 1.times.PCR buffer (Invitrogen, Carlsbad,
Calif., U.S.A.) [0184] 3 mM MgC12 (Invitrogen) [0185] 250 .mu.M
dNTPs (Promega) [0186] 1.0 .mu.M Probe (LATE-PCR only) [0187]
10.times. dilution SYBR Green Dye (FMC Bioproducts, Rockland Me.,
U.S.A) [0188] 1.25 Units Platinum Taq DNA polymerase (Invitrogen)
[0189] 1 .mu.l DNA Lysis solution (equivalent to .about.10 mtDNA
genomes) [0190] Primers: for LATE-PCR, 50 nM Limiting Primer and
1000 nM Excess Primer.
Oligonucleotide Sequences
[0191] HV1H: Limiting Primer, Excess Primer and Probe as in Example
11.
Cycle Sequencing Reaction Mixture
[0192] As in Example 11.
Dideoxy Sequencing
[0193] As in Example 11.
LATE-PCR Amplification and Sequencing Preparation
[0194] As in Example 11. The raw fluorescent data of the both CY5
and SYBR Green were used to determine the amount of product
available for a sequencing reaction. The CY5/SYBR Green ratio was
used to normalize all fluctuations in the raw data.
Results
[0195] Fluorescence data from the LATE-PCR amplifications is
presented in FIG. 20, panels A and B. FIG. 20A, e.g., line 201
shows all of the hair shaft data plotted against amplification
cycle numbers as the ratio ss-DNA/ds-DNA (probe signal to dye
signal). This method of analysis minimizes the variation due to
when exponential amplification begins, or at what level it
plateaus, and demonstrates that the efficiency of ss-DNA
amplification is virtually the same in all samples except the one
that began very late. FIG. 20B shows a method for monitoring a set
of LATE-PCR assay in order to establish their readiness for
dilute-and-go sequencing. The plot shows the calculated ratios
ssDNA/dsDNA (probe signal to dye signal versus dye signal) for all
amplified samples at cycle 45 (squares) and cycle 65 (diamonds).
Only the samples that have ratios of between 0.06 and 0.10 and SYBR
values between 300 and 600 (those in the box) are ready for
sequencing. FIG. 20B extends the use of Quantitative End-point
analysis (QE LATE-PCR) to demonstrate that after 65 cycles all but
one sample had accumulated sufficient ss-DNA for use in
"dilute-and-go" sequencing.
Example 13
Amplicons Having Multiple SNPs
[0196] The sensitivity of the LATE-PCR and "dilute-and-go"
sequencing method can distinguish a mixture of amplicons having
multiple SNPs to the 10% resolution level. PCR amplifications were
from a 2 mm human hair shaft or a single human thumbprint adhered
to a glass slide. All amplifications were LATE-PCR amplifications,
and the product was subjected directly to dideoxy sequencing. Final
amplification reaction mixtures, Oligonucleotide Sequences (HV1-H),
Cycle Sequencing Reaction Mixture, and Dideoxy Sequencing, and
LATE-PCR Amplification and Sequencing Preparation were all as in
Example 11.
[0197] Mixtures from 10:90 to 90:10 of the single-stranded LATE-PCR
products of each of the three reactions were sequenced using the
"dilute-and-go" dideoxy protocol described previously. The results
are shown in FIG. 21 and FIG. 22.
[0198] FIG. 21 show a 10 base segment surrounding bases 16320 and
16311 of the 50:50 mixture of Human blood lymphocyte and the Human
thumbprint. The peak heights reflect the actual 100% heights in the
dideoxy sequence and not the expected equal heights of a 50:50
mixture. Line 211 shows the peak for the G base at this sequence
and line 202 shows the peak for the A base at the same position in
the sequence. Peak 212 is higher than peak 211 in a 50:50 mixture
of human blood lymphocyte and human hair shaft having different
genetic sequences, because of the fluormetric characteristics of
dideoxy sequencing as is demonstrable by analysis of pure sequences
for the same region.
[0199] FIG. 22 shows the reciprocal percentages (90:10, 70:30,
50:50, 30:70 and 10:90) of two samples at each of five SNPs
locations. Sample 1 came from a Human Hair Shaft and Sample 2 came
from a Human Thumbprint from another individual. The heights of
each peak at each position were measured from the printouts of the
dideoxy sequences and were then scaled based on the same base of a
100% Sample 1 or 100% Sample 2 control. In FIG. 22, line 222 is the
intended percentage of Sample 1 in the mixture plotted against the
intended percentage of Sample 2 in the mixture. Line 221 is a line
fitted to the actual results, that is, the observed percentage of
Sample 1 in the mixture plotted against the intended percentage of
Sample 2. The observed percentage for each intended percentage of
Sample 2 is five points, one for each base. The data demonstrate
that there is very little scatter among the different bases at each
percentage, but the data also show that line 221 of the observed
values does not fall on top of the line of the predicted values
(line 222), probably because amount of Sample 1 and Sample 2 in the
mixture were not exactly equal.
Example 14
Distinction of Mixtures
[0200] To distinguish samples consisting of 100% heterozygous
genomic DNA from samples consisting of 90% heterozygous DNA and 10%
homozygous genomic DNA for a single nucleotide change, we first
created a DNA mixture consisting of 90% heterozygous DNA for the
SNP site rs858521 located in human chromosome 17 (C/G alleles) plus
10% homozygous DNA for the same SNP site (C/C alleles). The SNP
site is listed in the NCBI dbSNP database accessible through
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=SNP). This DNA
mixture was prepared by mixing matched concentrations of the
corresponding heterozygous and homozygous DNAs provided by the Reid
Laboratory at the University of Washington in Seattle. DNA
concentrations for each genomic DNA for mixing purposes were
estimated based on the Ct values of SYBR fluorescence derived from
real-time analysis of LATE-PCR samples similar to the one described
below. Once the DNA mixture was prepared, we set up replicate
LATE-PCR reactions containing either 100% heterozygous DNA or 90%
heterozygous+10% homozygous DNA. Each LATE-PCR sample consisted of
1.times. Platinum Taq Buffer (Invitrogen, Carlsbad, Calif.), 3 mM
MgCl.sub.2, 250 .mu.M dNTP mix, 0.24.times. SyberGold I
(Invitrogen, Carlsbad, Calif.), 200 nM mispriming prevention
reagent that we call Elixir compound 9-31DD, 1.25 units Platinum
Taq polymerase (Invitrogen, Carlsbad, Calif.), 1 .mu.M rs858521
Excess Primer, 50 nM rs858521 Limiting primer, and 2.4 .mu.M
resonsense probe against the rs858521 SNP G allele, and 1800 genome
equivalent of the appropriate genomic DNA in a final volume of 25
.mu.l. The sequence of the rs858521 Excess Primer is
TABLE-US-00003 (SEQ. ID. No. 29) 5' CAATCCCTTGACCTGTTGTGGAGAGAA
3'
[0201] The sequence of the rs858521 limiting primer is
TABLE-US-00004 (SEQ. ID. No. 30) 5' TCCCCAGAGCCCAGCCGGTGTCATTTTC
3'
[0202] The sequence of the resonsense probe against the rs858521
SNP G allele is
TABLE-US-00005 (SEQ. ID. No. 31) 5' [Cy5] CTTCAGCTCAAACAATA
[Phos]
[0203] The sequence of the mispriming prevention reagent is 5'
Dabcyl-CGCTATAATGAAATTATAGCG-Dabcyl (SEQ. ID. No. 32)
[0204] These samples were subjected to amplification in an ABI 7700
using a thermal cycle profile consisting of one cycle of 95.degree.
C. for 3 min, followed by 45 cycles of 95.degree. C. for 10 sec.,
66.degree. C. for 10 sec. and 72.degree. C. for 20 sec. At the end
of the reaction the reaction was melted from 95.degree. C. to
25.degree. C. at 1.degree. C. intervals for 1 min. at each
temperature with fluorescence acquisition in the Cy5 channel. The
clipped Cy5 fluorescence signals with no baseline correction were
exported into the Excel computer program. Calculation of the first
derivative of the fluorescence signals was performed by subtracting
the fluorescence signals from one temperature from the fluorescence
signals of the next temperature during the melt. Results are shown
in FIG. 23, panels A and B. FIG. 23A shows the plot of the first
derivative of fluorescence signals versus temperature, that is,
melting curves. The melting curves in FIG. 23A were smoothed using
the moving average function of Excel to eliminate the noise due to
thermal fluctuations in the ABI 7700. FIG. 23A revealed the melting
peaks corresponding to the binding of the probe to its matched G
allele target at higher temperatures and to the mismatched C allele
target at lower temperatures. FIG. 23A shows that the 90%
heterozygous+10% homozygous samples, circle 231, exhibit a lower G
allele peak and a higher C allele melting peak relative to the
heights of the C allele and the G allele melting peaks in the 100%
heterozygous samples, circle 232. These differences are in accord
with the expected higher proportion of the C allele in the 90%
heterozygous+10% homozygous sample (55% C allele:45% G allele)
compared to the 100% heterozygous sample (50% G allele:50% C
allele). The ratio of the height of the C allele peak to the height
of the G allele peak is shown as a bar graph in FIG. 23B. The set
of bars on the right are for the 90% heterozygous+10% homozygous
samples, corresponding to circle 231. The darker bars on the left
are for the 100% heterozygous samples. Conventional error boxes 233
and 234 are shown for bar sets, respectively. This ratio
distinguishes 100% heterozygous samples from 90% heterozygous+10%
homozygous samples with 99.7% certainty based on the lack of
overlap of the error boxes reflecting three standard deviations of
the error of the mean.
Example 15
Sensitivity of LATE-PCR Reactions to the Initial Polymerase
Concentration
[0205] PCR amplifications were performed utilizing an ABI 7700 to
amplify the 549 base amplicon designated as HVI-H within the d-loop
region of human mitochondrial DNA. Reaction Mixtures for genomic
human DNA, Oligonucleotide Sequences (HV1-H), and LATE-PCR
amplifications were as described in Example 11, except the Units of
Platinum Taq DNA polymerase varied among samples, as follows:
0.125, 0.250, 0.375, 0.50, 0.625, and 1.25 Units.
[0206] Melt curve analysis (SYBR green fluorescence versus
temperature) were performed. Melt curves showed how the
concentration of Taq influenced the specificity of dsDNA product
for this LATE-PCR reaction. As Platinum Taq, concentration
decreased from 1.25 units to 0.375 units the specificity of the
reaction increased, as reflected in the melting peaks of
replicates. Lowering the concentration further, to 0.250 units,
decreased specificity. At 0.125 units the reaction did not occur.
The greatest specificity occurred with a Taq concentration of 0.375
units.
Example 16
Slope Variation as a Function of Taq Concentration in a Real-Time
LATE-PCR and in a Real-Time Duplex LATE-PCR
[0207] We designed a duplex real-time LATE-PCR assay for
simultaneous amplification of sequences within exons of the murine
Oct4 and Xist genes (GenBank Accession Number NM 013633 and L04961,
respectively). Each reaction was run in a final volume of 50 .mu.l
and contained the following reagents: 1.times.PCR buffer
(Invitrogen, Carlsbad, Calif.) comprised by 20 mM Tris-HCl, pH 8.4,
and 50 mM KCl, 3 mM MgCl.sub.2, 0.4 mM of each dNTP, 50 nM Oct4
Limiting Primer having the sequence 5' TGGCTGGACACCTGGCTTCAGACT 3'
(SEQ ID NO: 33), 2 .mu.M Oct4 Excess Primer having the sequence 5'
CAACTTGGGGGACTAGGC 3' (SEQ ID NO: 34), 100 nM Xist Limiting Primer
having the sequence 5' GGTCGTACAGGAAAAGATGGCGGCTCAA 3' (SEQ ID NO:
35), 2 .mu.M Xist Excess Primer having the sequence 5'
TGAAAGAAACCACTAGAGGGCA 3' (SEQ ID NO:36), 1 .mu.M of a low
melting-point Oct4 molecular beacon probe having the sequence 5'
TET-CCG CCT GGG ATG GCA TAC TGT GGA AGG CGG-Dabcyl 3' (SEQ ID NO:
37) and 300 nM of a mispriming prevention reagent (that we refer to
as compound 9-3bDD) having the sequence
5'Dabcyl-CGTTATAATGAAATTATAACG-Dabcyl 3' (SEQ. ID. No. 38).
Antibody-complexed Platinum.RTM. Taq DNA polymerase (Invitrogen,
Carlsbad, Calif.) was also included in the PCR mixture at
concentrations of 1, 2, or 3 Units per assay). A molecular beacon
probe for the detection of Xist amplicons was not added in this
example.
[0208] In parallel with these duplex LATE-PCRs, we also ran a
series of assays for LATE-PCR amplification of the Oct4 amplicon
only. These assays had identical composition as the aforementioned
duplexes, except for the omission of the Xist Limiting Primer and
the Xist Excess Primer.
[0209] Mouse genomic DNA (Sigma, St Louis, Mo.) was added to all
the assays and provided the templates for PCR amplification. The
number of genomes added to each tube was calculated as 1000, based
on a 6 pg/genome size (see Vendrely and Vendrely (1949) Experientia
5: 327-329).
[0210] All assays were run in duplicates. Amplification was carried
out in an ABI Prism 7700 Sequence Detector (Applied Biosystems, CA)
with a thermal cycling profile comprised of 1 cycle at 95.degree.
C. for 5 minutes; 6 cycles at 95.degree. C. for 10 sec, 63.degree.
C. for 20 sec, and 72.degree. C. for 30 sec; and 54 cycles at
95.degree. C. for 15 sec, 55.degree. C. for 25 sec, 72.degree. C.
for 35 sec, and 45.degree. C. for 30 sec, with fluorescence
acquisition at 45.degree. C. in the TET channel.
[0211] The results of this experiment are shown in FIG. 24, which
plots the fluorescent signals generated by accumulating Oct4
amplicons through hybridization with the TET-Oct4 molecular beacon
probe. When only one pair of primers was present, increasing Taq
polymerase concentration from 1 Unit/assay (circle 241) to 2
Units/assay (circles 242) or 3 Units/assay (circles 243) had the
effect of making the slope of the signals steeper, due to increased
amplification efficiency. Signals identified by Circles 242 and 243
(2 and 3 Units/assay, respectively) were interspersed, suggesting
that maximal efficiency had been reached at approximately these
levels. As expected, the slopes of the lines generated by the
duplex reactions (circles 244, 245 and 246) were in all cases lower
than those generated by amplification of a single amplicon, because
the Taq polymerase was used at twice that rate. As in the case of
the single-amplicon LATE-PCR, augmenting Taq concentration in the
duplex reaction from 1 Unit/assay (circle 244) to 2 Units/assay
(circle 245) or 3 Units/assay (circle 246) resulted in an increase
in signal slope. There was no further increase in the initial slope
of the 3 Units/assay (circle 246) when compared to the initial
slope of the 2 Units/assay (circle 245), again suggesting that
maximal efficiency had been reached. However, the 3 Units/assay
samples (circle 246) quickly reached a plateau and the slope
started declining, unlike that one of the 2 Units/assay samples
(circle 245), indicating the probable occurrence of mispriming in
the presence of the highest Taq concentration tested, which was not
the case for samples 243, also containing 3 Taq Units/assay but
only one pair of primers. In spite of the higher amount of
available Taq in the single-amplicon assays when compared to the
duplexes (3 units being used to generate one amplicon rather than
two amplicons at the same time), more mispriming occurred in the
duplexes due to the addition of the Xist primers. In order to
obtain maximal efficiency without mispriming, Taq polymerase
concentration needs, thus, to be optimized in consideration of the
number and sequences of the primers added to the reaction.
Sequence CWU 1
1
51122DNAArtificial Sequenceprobe 1aatactggat aggaccacga gg
22222DNAArtificial Sequenceprobe 2ctggatagga ccacgaggcc ag
22316DNAArtificial Sequenceprobe 3gcatgtcttg tggtgg
16422DNAArtificial Sequenceprimer 4taacaagcag agtccctctg gt
22515DNAArtificial Sequenceprobe 5gggaccaggt aagaa
15624DNAArtificial Sequenceprimer 6ccgcccttct ctctgccccc tggt
24722DNAArtificial Sequenceprimer 7gccaggggtt ccactacgta ga
22818DNAArtificial Sequenceprimer 8ctggtacctg aaccgtat 18912DNAHomo
sapiens 9atcctatggc cc 121026DNAArtificial Sequenceprimer
10ggccatcact aaaggcaccg agcact 261127DNAArtificial Sequenceprimer
11gggtttctga tacgcactga ctctctc 271218DNAArtificial Sequenceprimer
12gaccaccagc agcctaag 181314DNAArtificial Sequencesynthetically
generated oligonucleotide 13ggtgggaaaa taga 141440DNAArtificial
Sequencesynthetically generated oligonucleotide 14cgcggcgtca
ggcatatagg ataccgggac agacgccgcg 401526DNAArtificial Sequenceprimer
15ggtcagcgcc gggctgcaag tgtaga 261623DNAArtificial Sequenceprimer
16gatgggtgga gcttgtcttg agg 231726DNAArtificial Sequenceprimer
17cgaggtcatt gaatacgcac ggctcc 261822DNAArtificial Sequenceprimer
18taacaagcag agtccctctg gt 221915DNAArtificial Sequenceprobe
19gggaccaggt aagaa 152014DNAArtificial Sequenceprobe 20tgctaatggt
ggag 142128DNAArtificial Sequenceprimer 21gcccggagcg aggagagtag
cactcttg 282226DNAArtificial Sequenceprimer 22caccagtctt gtaaaccgga
gatgaa 262333DNAArtificial Sequenceprimer 23gtatgggagt gggaggggaa
aataatgtgt tag 332426DNAArtificial Sequenceprimer 24aggtctatca
ccctattaac cactca 262530DNAArtificial Sequenceprimer 25caccagtctt
gtaaaccgga gatgaaaacc 302619DNAArtificial Sequenceprimer
26cgaggagagt agcactctt 192730DNAArtificial Sequenceprimer
27aggtctatca ccctattaac cactcacggg 302823DNAArtificial
Sequenceprimer 28ggaggggaaa ataatgtgtt agt 232927DNAArtificial
Sequenceprimer 29caatcccttg acctgttgtg gagagaa 273028DNAArtificial
Sequenceprimer 30tccccagagc ccagccggtg tcattttc 283117DNAArtificial
Sequenceprobe 31cttcagctca aacaata 173221DNAArtificial
Sequencemispriming prevention reagent 32cgctataatg aaattatagc g
213324DNAArtificial Sequenceprimer 33tggctggaca cctggcttca gact
243418DNAArtificial Sequenceprimer 34caacttgggg gactaggc
183528DNAArtificial Sequenceprimer 35ggtcgtacag gaaaagatgg cggctcaa
283622DNAArtificial Sequenceprimer 36tgaaagaaac cactagaggg ca
223730DNAArtificial Sequenceprobe 37ccgcctggga tggcatactg
tggaaggcgg 303821DNAArtificial Sequencemispriming prevention
reagent 38cgttataatg aaattataac g 213911DNAArtificial
Sequencesynthetically generated oligonucleotide 39gatctatctg c
114022DNAHomo sapiens 40cgtgtataga ctatactagc ag
224151DNAArtificial Sequencesynthetically generated oligonucleotide
41agcaggtggt aggagcattg ctcgggctgc ctcaagacaa gctccaccca t
514248DNAArtificial Sequencesynthetically generated oligonucleotide
42gcagcagctg tagatgcatg ctcgcgtgct cagagagcag ctcacact
484350DNAHomo sapiens 43acactgctgg ccacactttg tccyggggac caggtaagaa
tgattgyctg 504450DNAHomo sapiens 44tgtggccagg agtgtcaaac tctgcaagca
cacggatacc cgggagccgt 504549DNAHomo sapiens 45acactcctgg ccagactttg
tcctggggac caggtaagaa tgatgtctg 494650DNAHomo sapiens 46tgtggccagg
agtgtcaaac tctgcaagca cacggatacc ccggagccgt 504736DNAArtificial
Sequencesynthetically generated oligonucleotide 47cttgtaagca
tggggagggg gttttgatgt ggatcg 364864DNAArtificial
Sequencesynthetically generated oligonucleotide 48taannagaca
gagnagancg aggnagagaa gggggngngn ngatataaga gataatnnaa 60tata
644938DNAArtificial Sequencesynthetically generated oligonucleotide
49cttgtaagca tggggagggg gtttctgatg tggattgc 385044DNAArtificial
Sequencesynthetically generated oligonucleotide 50aaatctccac
caaacccccc ccnacccccc gcttgcnnag gcca 445110DNAArtificial
Sequencesynthetically generated oligonucleotide 51aatgrcttta 10
* * * * *
References