Compositions And Methods For Sirna Inhibition Of Angiopoietin 1 And 2 And Their Receptor Tie2

Abstract

RNA interference using small interfering RNAs which are specific for mRNA produced from the Ang1, Ang2 or Tie2 genes inhibits expression of these genes. Diseases which involve Ang1, Ang2 or Tie2 mediated angiogenesis, such as inflammatory and autoimmune diseases, diabetic retinopathy, age related macular degeneration and many types of cancer, can be treated by administering the small interfering RNAs.

Description

CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application is a continuation of and claims priority to U.S. patent application Ser. No. 10/827,759, filed Apr. 19, 2004, which claims the benefit of U.S. Provisional Application No. 60/463,981, filed on Apr. 18, 2003; the entire contents of which is hereby incorporated by reference in its their entirety.

FIELD OF THE INVENTION

[0002] This invention relates to the regulation of angiopoietin 1, angiopoietin 2 and Tie2 gene expression by small interfering RNA, in particular for treating diseases or conditions involving angiogenesis.

BACKGROUND OF THE INVENTION

[0003] Angiogenesis or "neovascularization" is the formation of new blood vessels from the endothelial cells (EC) of preexisting blood vessels. This process involves EC migration, proliferation, and differentiation, which begins with localized breakdown of the basement membrane in the parent vessel. The EC then migrate away from the parent vessel into the interstitial extracellular matrix (ECM) to form a capillary sprout, which elongates due to continued migration and proliferation of the cells.

[0004] Angiogenesis is typically held under strict control, and under normal conditions occurs only under certain defined physiological processes. For example, angiogenesis occurs during embryogenesis, post-natal growth, wound repair, and menstruation. Uncontrolled angiogenesis, however, can result in pathogenic conditions where the developing blood vessels destroy the surrounding tissue or sustain malignancies. Such pathogenic conditions include diabetic retinopathy, psoriasis, exudative or "wet" age-related macular degeneration ("AMD"), inflammatory disorders, and most cancers. AMD in particular is a clinically important angiogenic disease. This condition is characterized by choroidal neovascularization in one or both eyes in aging individuals, and is the major cause of blindness in industrialized countries.

[0005] Two key regulators of angiogenesis are angiopoietin-1 ("Ang1") and angiopoietin-2 ("Ang2"). These regulators can act in concert with vascular endothelial growth factor ("VEGF") to regulate angiogenesis, although inhibition of Ang1 or Ang2 alone appears to block neovascularization. Ang1, Ang2 and VEGF exert their effect on EC through the two VEGF receptors and another tyrosine kinase receptor called "tyrosine kinase with immunoglobulin and epidermal growth factor homology domains 2" or "Tie2." Hackett et al. (2002), J. Cell. Phys. 192: 182-187. Whereas VEGF binding to its receptors is crucial for initiating the angiogenic process, Ang1 and Ang2 bind to Tie2 and modulate maturation of the new blood vessels. Ang1 and Ang2 are also involved in maintaining endothelial cell integrity. Lobov et al. (2002), Proc. Nat. Acad. Sci USA 99: 11205-11210. As discussed below, agents which bind to and block the Tie2 receptor can also inhibit angiogenesis.

[0006] Ang1 and Ang2 are differentially expressed, and early studies indicated that Ang1 promoted neovascularization and Ang2 was an angiogenesis antagonist. However, evidence now shows that Ang2 can increase blood vessel diameter and promote remodeling of the basal lamina. Ang2 also appears to induce EC proliferation, migration and sprouting of blood vessels in the presence of VEGF. Lobov et al., 2002, supra.

[0007] Ang1 reportedly promotes angiogenesis during embryonic development, in particular through the modulation of endothelial-stromal cell communication and by regulating the maturation and stability of blood vessels. Lin P et al., Proc. Nat. Acad. Sci. USA 95: 8829-8834 (1998). However, the widespread expression of Ang1 and Tie2 in vascular endothelium, and phosphorylation of Tie2 in quiescent adult vasculature also suggest that Ang1 is involved in postnatal angiogenesis. Takagi et al. (2003), Inv. Ophthalm. Vis. Sci. 44: 393-402.

[0008] In contrast to the more extensive expression patterns of Ang1 and Tie2, Ang2 appears to be expressed only at sites of vascular remodeling. Takagi et al. (2003), supra. For example, Ang2 expression is markedly increased in ovary, uterus and placenta during menstruation. Ang2 expression levels also follow a cyclical pattern of expression in the corpus luteum, which parallels the cycle of quiescence, angiogenesis and vascular regression of this structure (i.e., Ang2 levels are low during quiescence and high during angiogenesis and regression). Hackett et al., 2002, supra. Ang2 is also induced by hypoxic cytokines, including VEGF, and is expressed in tissues undergoing pathologic angiogenesis associated with tumors, AMD and in an animal model of retinal ischemia. Takagi et al., 2003, supra. Moreover, Ang2 is upregulated in the epiretinal membranes of patients with ischemic retinal disorders, but not in membranes from patients with non-ischemic retinal disorders. The expression of Ang1, however, remains similar in epiretinal membranes from patients with ischemic or non-ischemic disorders. Takagi et al., 2003, supra.

[0009] Ang2 and Tie2 are co-localized in the EC of highly vascularized regions, and Tie2 is overexpressed in areas of vascular remodeling. Asahara T. et al., Circ. Res. 83: 223-240 report that Ang1 and Ang2 have similar synergistic effects with VEGF to promote angiogenesis in a mouse corneal neovascularization assay. Thus, Ang1, Ang2 and Tie2 play an important role in both normal and pathogenic neovascularization in developing and adult organisms.

[0010] Ang1, Ang2 or Tie2 are therefore attractive therapeutic targets for treatment of pathogenic angiogenesis. For example, Lin Pet al. (1998), supra, inhibited tumor growth and metastasis in a mouse model by expressing a soluble recombinant Tie2 receptor. The recombinant Tie2 protein blocked ligand binding to endogenous Tie2 receptors, but likely produced only a stoichiometric reduction in Ang2/Tie2 binding. Takagi et al., 2003, supra inhibited of Tie2 signaling with a soluble fusion protein containing the ectoplasmic domain of Tie2, which suppressed hypoxia-induced retinal angiogenesis both in vitro and in vivo. Asahara et al. (1998), supra showed that administration of a soluble Tie2 receptor abolished the effects of Ang1 or Ang2 on VEGF-induced neovascularization in the mouse cornea. However, therapeutic strategies based on agents such as soluble Tie2 receptors are not preferred, however, because such agents would likely be overwhelmed by the high production of Ang2 or Tie2 in the EC of highly vascularized areas.

[0011] RNA interference (hereinafter "RNAi") is a method of post-transcriptional gene regulation that is conserved throughout many eukaryotic organisms. RNAi is induced by short (i.e., <30 nucleotide) double stranded RNA ("dsRNA") molecules which are present in the cell (Fire A et al. (1998), Nature 391: 806-811). These short dsRNA molecules, called "short interfering RNA" or "siRNA," cause the destruction of messenger RNAs ("mRNAs") which share sequence homology with the siRNA to within one nucleotide resolution (Elbashir S M et al. (2001), Genes Dev, 15: 188-200). It is believed that the siRNA and the targeted mRNA bind to an "RNA-induced silencing complex" or "RISC", which cleaves the targeted mRNA. The siRNA is apparently recycled much like a multiple-turnover enzyme, with 1 siRNA molecule capable of inducing cleavage of approximately 1000 mRNA molecules. siRNA-mediated RNAi degradation of an mRNA is therefore more effective than currently available technologies for inhibiting expression of a target gene.

[0012] Elbashir S M et al. (2001), supra, has shown that synthetic siRNA of 21 and 22 nucleotides in length, and which have short 3' overhangs, are able to induce RNAi of target mRNA in a Drosophila cell lysate. Cultured mammalian cells also exhibit RNAi degradation with synthetic siRNA (Elbashir S M et al. (2001) Nature, 411: 494-498), and RNAi degradation induced by synthetic siRNA has recently been shown in living mice (McCaffrey A P et al. (2002), Nature, 418: 38-39; Xia H et al. (2002), Nat. Biotech. 20: 1006-1010). The therapeutic potential of siRNA-induced RNAi degradation has been demonstrated in several recent in vitro studies, including the siRNA-directed inhibition of HIV-1 infection (Novina C D et al. (2002), Nat. Med. 8: 681-686) and reduction of neurotoxic polyglutamine disease protein expression (Xia H et al. (2002), supra).

[0013] What is needed, therefore, are agents and methods which selectively inhibit expression of Ang1, Ang2 or Tie2 in catalytic or sub-stoichiometric amounts, in order to effectively decrease or block angiogenesis.

SUMMARY OF THE INVENTION

[0014] The present invention is directed to siRNA which specifically target and cause RNAi-induced degradation of mRNA from Ang1, Ang2 or Tie2 genes. These siRNA degrade Ang1, Ang2 or Tie2 mRNA in substoichiometric amounts. The siRNA compounds and compositions of the invention are, thus used to inhibit angiogenesis. In particular, the siRNA of the invention are useful for treating cancerous tumors and disorders related to ocular neovascularization, such as age-related macular degeneration and diabetic retinopathy.

[0015] Thus, the invention provides an isolated siRNA which targets human Ang1, Ang2 or Tie2 mRNA, or an alternative splice form, mutant or cognate thereof. The siRNA comprises a sense RNA strand and an antisense RNA strand which form an RNA duplex. The sense RNA strand comprises a nucleotide sequence substantially identical to a target sequence of about 19 to about 25 contiguous nucleotides in the target mRNA.

[0016] The invention also provides recombinant plasmids and viral vectors which express the siRNA of the invention, as well as pharmaceutical compositions comprising the siRNA of the invention and a pharmaceutically acceptable carrier.

[0017] The invention further provides a method of inhibiting expression of human Ang1, Ang2 or Tie2 mRNA, or an alternative splice form, mutant or cognate thereof, comprising administering to a subject an effective amount of the siRNA of the invention such that the target mRNA is degraded.

[0018] The invention further provides a method of inhibiting angiogenesis in a subject, comprising administering to a subject an effective amount of an siRNA targeted to human Ang1, Ang2 or Tie2 mRNA, or an alternative splice form, mutant or cognate thereof.

[0019] The invention further provides a method of treating an angiogenic disease, comprising administering to a subject in need of such treatment an effective amount of an siRNA targeted to human Ang1, Ang2 or Tie2 mRNA, or an alternative splice form, mutant or cognate thereof, such that angiogenesis associated with the angiogenic disease is inhibited.

BRIEF DESCRIPTION OF THE FIGURES

[0020] FIG. 1 is a histogram showing the silencing effect of siRNA candidates, as measured by the levels of human angiopoietin 2 ("hANG2") protein in growth medium removed from tissue culture wells containing HEK-293 cells transfected with: twelve different siRNA targeted to hANG2 mRNA (hANG2#1-hANG2#12); with control nonspecific siRNA targeted to enhanced green fluorescent protein ("EGFP"); or with transfection reagent containing no siRNA ("no"). hANG2 protein level is given in picograms of protein per milliliter of growth medium (pg/ml), as measured by hANG2 ELISA at 48 hours post-transfection.

[0021] FIG. 2 is a histogram showing lack of cytotoxicity in HEK-293 cells transfected with twelve different siRNA targeted to hANG2 mRNA (hANG2#1-hANG2#12). Control cells were transfected with nonspecific siRNA targeted to enhanced green fluorescent protein mRNA ("EGFP"), or with transfection reagent containing no siRNA ("no"). Cytotoxicity is measured as percent growth of cells treated with siRNA vs. cells treated with transfection reagent alone.

[0022] FIG. 3 is a histogram showing the silencing effect of increasing doses of hANG2#2 and hANG2#3 on the level of hANG2 protein secreted by HEK-293 cells. The HEK-293 cells were transfected with 1 nanomolar ("nM"), 5 nM, or 25 nM hANG2#2 or hANG2#3 siRNA. Control cells were transfected with 25 nM nonspecific siRNA targeted to enhanced green fluorescent protein mRNA ("EGFP"), or with transfection reagent containing no siRNA ("no"). hANG2 protein level is given in picograms of protein per milliliter of growth medium (pg/ml), as measured by hANG2 ELISA at 48 hours post-transfection.

[0023] FIG. 4 is a histogram showing lack of cytotoxicity in HEK-293 cells transfected with increasing doses of hANG2#2 and hANG2#3 siRNA. Control cells were transfected with nonspecific siRNA targeted to enhanced green fluorescent protein mRNA ("EGFP"), or with transfection reagent containing no siRNA ("no"). Cytotoxicity is measured as percent growth of cells treated with siRNA vs. cells treated with transfection reagent alone.

DETAILED DESCRIPTION OF THE INVENTION

[0024] Unless otherwise indicated, all nucleic acid sequences herein are given in the 5' to 3' direction. Also, all deoxyribonucleotides in a nucleic acid sequence are represented by capital letters (e.g., deoxythymidine is "T"), and ribonucleotides in a nucleic acid sequence are represented by lower case letters (e.g., uridine is "u").

[0025] Compositions and methods comprising siRNA targeted to Ang1, Ang2 and Tie2 mRNA are advantageously used to inhibit angiogenesis, in particular for the treatment of angiogenic disease. The siRNA of the invention are believed to cause the RNA1-mediated degradation of these mRNAs, so that the protein products of the Ang1, Ang2 or Tie2 genes are not produced or are produced in reduced amounts. Because Ang1, Ang2 and Tie2 are involved in angiogenesis, the siRNA-mediated degradation of Ang1, Ang2 or Tie2 mRNA inhibits the angiogenic process.

[0026] As used herein, siRNA which is "targeted to the Ang1, Ang2 or Tie2 mRNA" means siRNA in which a first strand of the duplex is substantially identical to the nucleotide sequence of a portion of the Ang1, Ang2 or Tie2 mRNA sequence. It is understood that the second strand of the siRNA duplex is complementary to both the first strand of the siRNA duplex and to the same portion of the Ang1, Ang2 or Tie2 mRNA.

[0027] The invention therefore provides isolated siRNA comprising short double-stranded RNA from about 17 nucleotides to about 29 nucleotides in length, preferably from about 19 to about 25 nucleotides in length, that are targeted to the target mRNA. The siRNA's comprise a sense RNA strand and a complementary antisense RNA strand annealed together by standard Watson-Crick base-pairing interactions (hereinafter "base-paired"). As is described in more detail below, the sense strand comprises a nucleic acid sequence which is substantially identical to a target sequence contained within the target mRNA.

[0028] As used herein, a nucleic acid sequence "substantially identical" to a target sequence contained within the target mRNA is a nucleic acid sequence which is identical to the target sequence, or which differs from the target sequence by one or more nucleotides. Sense strands of the invention which comprise nucleic acid sequences substantially identical to a target sequence are characterized in that siRNA comprising such sense strands induce RNAi-mediated degradation of mRNA containing the target sequence. For example, an siRNA of the invention can comprise a sense strand comprise nucleic acid sequences which differ from a target sequence by one, two or three or more nucleotides, as long as RNAi-mediated degradation of the target mRNA is induced by the siRNA.

[0029] The sense and antisense strands of the present siRNA can comprise two complementary, single-stranded RNA molecules or can comprise a single molecule in which two complementary portions are base-paired and are covalently linked by a single-stranded "hairpin" area. Without wishing to be bound by any theory, it is believed that the hairpin area of the latter type of siRNA molecule is cleaved intracellularly by the "Dicer" protein (or its equivalent) to form a siRNA of two individual base-paired RNA molecules (see Tuschl, T. (2002), supra). As described below, the siRNA can also contain alterations, substitutions or modifications of one or more ribonucleotide bases. For example, the present siRNA can be altered, substituted or modified to contain one or more deoxyribonucleotide bases.

[0030] As used herein, "isolated" means synthetic, or altered or removed from the natural state through human intervention. For example, an siRNA naturally present in a living animal is not "isolated," but a synthetic siRNA, or an siRNA partially or completely separated from the coexisting materials of its natural state is "isolated." An isolated siRNA can exist in substantially purified form, or can exist in a non-native environment such as, for example, a cell into which the siRNA has been delivered. By way of example, siRNA which are produced inside a cell by natural processes, but which are produced from an "isolated" precursor molecule, are themselves "isolated" molecules. Thus, an isolated dsRNA can be introduced into a target cell, where it is processed by the Dicer protein (or its equivalent) into isolated siRNA.

[0031] As used herein, "target mRNA" means human Ang1, Ang2 or Tie2 mRNA, mutant or alternative splice forms of human Ang1, Ang2 or Tie2 mRNA, or mRNA from cognate Ang1, Ang2 or Tie2 genes. The human Ang1, Ang2 and Tie2 mRNA sequences are described in GenBank Record Accession Nos. AY124380, NM.sub.--00147 and L06139, respectively, as the cDNA equivalents. The human Ang1, Ang2 and Tie2 mRNA sequences are given herein as SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively, as the cDNA equivalents. One skilled in the art would understand that the cDNA sequence is equivalent to the mRNA sequence, and can be used for the same purpose herein; i.e., the generation of siRNA for inhibiting expression of Ang1, Ang2, or Tie2.

[0032] As used herein, a gene or mRNA which is "cognate" to human Ang1, Ang2 or Tie2 is a gene or mRNA from another mammalian species which is homologous to human Ang1, Ang2 or Tie2. For example, the partial sequence of Ang1 mRNA for the domesticated dog (Canis familiaris) is described as the cDNA equivalent in GenBank Record Accession No. AF345932, which is given herein as SEQ ID NO: 4. The Mus musculus (mouse) Ang2 mRNA is described as the cDNA equivalent in GenBank Record Accession No. NM.sub.--007426, which is given herein as SEQ ID NO. 5. The Mus musculus (mouse) and Rattus norvegicus (rat) Tie2 mRNA sequences are described as the cDNA equivalents in GenBank Record Accession Nos. NM.sub.--013690 and NW.sub.--043856, respectively. The mouse and rat Tie2 mRNA sequences are given herein as SEQ ID NO. 6 and SEQ ID NO. 7, respectively.

[0033] Alternative splice forms of human Ang1, Ang2 and Tie2 are also known. See, e.g., GenBank Record Accession No. AY121504, which describes a splice variant of human Ang1 as the cDNA equivalent (SEQ ID NO: 8). Kim et al., J. Biol. Chem. 275 (24), 18550-18556 (2000) and GenBank Record Accession No. AF187858 describe an Ang2 splice variant encoding an Ang2 protein lacking amino acids 96-148, given as the cDNA equivalent (SEQ 1D NO: 9). See also GenBank Record Accession No. AB086825, which describes a splice variant of Tie2 encoding a Tie2 protein lacking the epidermal growth factor-like domain, given as the cDNA equivalent (SEQ ID NO: 10).

[0034] The mRNA transcribed from the human Ang1, Ang2 or Tie2 genes can also be analyzed for alternative splice forms using techniques well-known in the art. Such techniques include reverse transcription-polymerase chain reaction (RT-PCR), northern blotting and in-situ hybridization. Techniques for analyzing mRNA sequences are described, for example, in Busting S A (2000), J. Mol. Endocrinol. 25: 169-193, the entire disclosure of which is herein incorporated by reference. Representative techniques for identifying alternatively spliced mRNAs are also described below.

[0035] For example, databases that contain nucleotide sequences related to a given disease gene can be used to identify alternatively spliced mRNA. Such databases include GenBank, Embase, and the Cancer Genome Anatomy Project (CGAP) database. The CGAP database, for example, contains expressed sequence tags (ESTs) from various types of human cancers. An mRNA or gene sequence from the Ang1, Ang2 or Tie2 genes can be used to query such a database to determine whether ESTs representing alternatively spliced mRNAs have been found.

[0036] A technique called "RNAse protection" can also be used to identify alternatively spliced Ang1, Ang2 or Tie2 mRNAs. RNAse protection involves translation of a gene sequence into synthetic RNA, which is hybridized to RNA derived from other cells; for example, cells which are induced to express Ang1, Ang2 or Tie2. The hybridized RNA is then incubated with enzymes that recognize RNA:RNA hybrid mismatches. Smaller than expected fragments indicate the presence of alternatively spliced mRNAs. The putative alternatively spliced mRNAs can be cloned and sequenced by methods well known to those skilled in the art.

[0037] RT-PCR can also be used to identify alternatively spliced Ang1, Ang2 or Tie2 mRNAs. In RT-PCR, mRNA from vascular endothelial cells or cells from other tissue known to express Ang1, Ang2 or Tie2 is converted into cDNA by the enzyme reverse transcriptase, using methods within the skill in the art. The entire coding sequence of the cDNA is then amplified via PCR using a forward primer located in the 3' untranslated region, and a reverse primer located in the 5' untranslated region. The amplified products can be analyzed for alternative splice forms, for example by comparing the size of the amplified products with the size of the expected product from normally spliced mRNA, e.g., by agarose gel electrophoresis. Any change in the size of the amplified product can indicate alternative splicing.

[0038] The mRNA produced from mutant Ang1, Ang2 or Tie2 genes can also be readily identified with the techniques described above for identifying Ang1, Ang2 or Tie2 alternative splice forms. As used herein, "mutant" Ang1, Ang2 or Tie2 genes or mRNA include human Ang1, Ang2 or Tie2 genes or mRNA which differ in sequence from the Ang1, Ang2 and Tie2 sequences set forth herein. Thus, allelic forms of the Ang1, Ang2 or Tie2 genes, and the mRNA produced from them, are considered "mutants" for purposes of this invention. See also WO 02/20734, which describes several mutants of Tie2, one of which is described in GenBank Record Accession No. AX398356, which is given herein as the cDNA equivalent in SEQ ID NO: 11.

[0039] It is understood that human Ang1, Ang2 or Tie2 mRNA may contain target sequences in common with its respective alternative splice forms, cognates or mutants. A single siRNA comprising such a common targeting sequence can therefore induce RNAi-mediated degradation of those different mRNAs which contain the common targeting sequence.

[0040] The siRNA of the invention can comprise partially purified RNA, substantially pure RNA, synthetic RNA, or recombinantly produced RNA, as well as altered RNA that differs from naturally-occurring RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides. Such alterations can include addition of non-nucleotide material, such as to the end(s) of the siRNA or to one or more internal nucleotides of the siRNA; modifications that make the siRNA resistant to nuclease digestion (e.g., the use of 2'-substituted ribonucleotides or modifications to the sugar-phosphate backbone); or the substitution of one or more nucleotides in the siRNA with deoxyribonucleotides. siRNA which are exposed to serum, lachrymal fluid or other nuclease-rich environments, or which are delivered topically (e.g., by eyedropper), are preferably altered to increase their resistance to nuclease degradation. For example, siRNA which are administered intravascularly or topically to the eye can comprise one or more phosphorothioate linkages.

[0041] One or both strands of the siRNA of the invention can also comprise a 3' overhang. As used herein, a "3' overhang" refers to at least one unpaired nucleotide extending from the 3'-end of an RNA strand.

[0042] Thus in one embodiment, the siRNA of the invention comprises at least one 3' overhang of from 1 to about 6 nucleotides (which includes ribonucleotides or deoxynucleotides) in length, preferably from 1 to about 5 nucleotides in length, more preferably from 1 to about 4 nucleotides in length, and particularly preferably from about 2 to about 4 nucleotides in length.

[0043] In the embodiment in which both strands of the siRNA molecule comprise a 3' overhang, the length of the overhangs can be the same or different for each strand. In a most preferred embodiment, the 3' overhang is present on both strands of the siRNA, and is 2 nucleotides in length. For example, each strand of the siRNA of the invention can comprise 3' overhangs of dithymidylic acid ("TT") or diuridylic acid ("uu").

[0044] In order to enhance the stability of the present siRNA, the 3' overhangs can be also stabilized against degradation. In one embodiment, the overhangs are stabilized by including purine nucleotides, such as adenosine or guanosine nucleotides. Alternatively, substitution of pyrimidine nucleotides by modified analogues, e.g., substitution of uridine nucleotides in the 3' overhangs with 2'-deoxythymidine, is tolerated and does not affect the efficiency of RNAi degradation. In particular, the absence of a 2'-hydroxyl in the 2'-deoxythymidine significantly enhances the nuclease resistance of the 3' overhang in tissue culture medium.

[0045] In certain embodiments, the siRNA of the invention comprises the sequence AA(N19)TT or NA(N21), where N is any nucleotide. These siRNA comprise approximately 30-70% GC, and preferably comprise approximately 50% G/C. The sequence of the sense siRNA strand corresponds to (N19)TT or N21 (i.e., positions 3 to 23), respectively. In the latter case, the 3' end of the sense siRNA is converted to TT. The rationale for this sequence conversion is to generate a symmetric duplex with respect to the sequence composition of the sense and antisense strand 3' overhangs. The antisense RNA strand is then synthesized as the complement to positions 1 to 21 of the sense strand.

[0046] Because position 1 of the 23-nucleotide sense strand in these embodiments is not recognized in a sequence-specific manner by the antisense strand, the 3'-most nucleotide residue of the antisense strand can be chosen deliberately. However, the penultimate nucleotide of the antisense strand (complementary to position 2 of the 23-nucleotide sense strand in either embodiment) is generally complementary to the targeted sequence.

[0047] In another embodiment, the siRNA of the invention comprises the sequence NAR(N17)YNN, where R is a purine (e.g., A or G) and Y is a pyrimidine (e.g., C or u/T). The respective 21-nucleotide sense and antisense RNA strands of this embodiment therefore generally begin with a purine nucleotide. Such siRNA can be expressed from pol III expression vectors without a change in targeting site, as expression of RNAs from pol III promoters is only believed to be efficient when the first transcribed nucleotide is a purine.

[0048] The siRNA of the invention can be targeted to any stretch of approximately 19-25 contiguous nucleotides in any of the target mRNA sequences (the "target sequence"). Techniques for selecting target sequences for siRNA's are given, for example, in Tuschl T et al., "The siRNA User Guide," revised Oct. 11, 2002, the entire disclosure of which is herein incorporated by reference. "The siRNA User Guide" is available on the world wide web at a website maintained by Dr. Thomas Tuschl, Department of Cellular Biochemistry, AG 105, Max-Planck-Institute for Biophysical Chemistry, 37077 Gottingen, Germany, and can be found by accessing the website of the Max Planck Institute and searching with the keyword "siRNA." Thus, the sense strand of the present siRNA comprises a nucleotide sequence substantially identical to any contiguous stretch of about 19 to about 25 nucleotides in the target mRNA.

[0049] Generally, a target sequence on the target mRNA can be selected from a given cDNA sequence corresponding to the target mRNA, preferably beginning 50 to 100 nt downstream (i.e., in the 3' direction) from the start codon. The target sequence can, however, be located in the 5' or 3' untranslated regions, or in the region nearby the start codon. For example, a suitable target sequence in the human Ang2 cDNA sequence is:

TABLE-US-00001 (SEQ ID NO: 12) AATGCTGTGCAGAGGGACGCG

[0050] Thus, an siRNA of the invention targeting SEQ ID NO: 12, and which has 3' uu overhangs on each strand (overhangs shown in bold), is:

TABLE-US-00002 (SEQ ID NO: 13) 5'-tgctgtgcagagggacgcguu-3' (SEQ ID NO: 14) 3'-uuucgacacgucucccugcgc-5'

[0051] An siRNA of the invention targeting SEQ ID NO: 12, but having 3' TT overhangs on each strand (overhangs shown in bold) is:

TABLE-US-00003 (SEQ ID NO: 15) 5'-tgctgtgcagagggacgcgTT-3' (SEQ ID NO: 16) 3'-TTucgacacgucucccugcgc-5'

[0052] Another target sequence from the human Ang2 cDNA sequence is:

TABLE-US-00004 (SEQ ID NO: 17) AAGTATTAAATCAGACCACGA

[0053] Thus, an siRNA of the invention targeting SEQ ID NO: 17, and which has 3' uu overhangs on each strand (overhangs shown in bold), is:

TABLE-US-00005 (SEQ ID NO: 18) 5'-gtattaaatcagaccacgauu-3' (SEQ ID NO: 19) 3'-uucauaauuuagucuggugcu-5'

[0054] An siRNA of the invention targeting SEQ ID NO: 17, but having 3' TT overhangs on each strand (overhangs shown in bold) is:

TABLE-US-00006 (SEQ ID NO: 20) 5'-gtattaaatcagaccacgaTT-3' (SEQ ID NO: 21) 3'-TTcauaauuuagucuggugcu-5'

[0055] A suitable target sequence in the human Ang1 cDNA sequence is:

TABLE-US-00007 (SEQ ID NO: 22) AATGCAGTTCAGAACCACACG

[0056] Thus, an siRNA of the invention targeting SEQ ID NO: 22, and which has 3' uu overhangs on each strand (overhangs shown in bold), is:

TABLE-US-00008 (SEQ ID NO: 23) 5'-tgcagttcagaaccacacguu-3' (SEQ ID NO: 24) 3'-uu acgucaagucuuggugugc-5'

[0057] An siRNA of the invention targeting SEQ ID NO: 22, but having 3' TT overhangs on each strand (overhangs shown in bold) is:

TABLE-US-00009 (SEQ ID NO: 25) 5'-tgcagttcagaaccacacgTT-3' (SEQ ID NO: 26) 3'-TTacgucaagucuuggugugc-5'

[0058] Another target sequence from the human Ang1 cDNA is:

TABLE-US-00010 (SEQ ID NO: 27) AACTTCTCGACTTGAGATACA

[0059] An siRNA of the invention targeting SEQ ID NO: 27, but having 3' uu overhangs on each strand (overhangs shown in bold) is:

TABLE-US-00011 (SEQ ID NO: 28) 5'-cttctcgacttgagatacauu-3' (SEQ ID NO: 29) 3'-uugaagagcugaacucuaugu-5'

[0060] An siRNA of the invention targeting SEQ ID NO: 27, but having 3' TT overhangs on each strand (overhangs shown in bold) is:

TABLE-US-00012 (SEQ ID NO: 30) 5'-cttctcgacttgagatacaTT-3' (SEQ ID NO: 31) 3'-TTgaagagcugaacucuaugu-5'

[0061] Other Ang1, Ang2 and Tie2 target sequences, from which siRNA of the invention can be derived, include those given herein: Suitable human Ang1 target sequences include those of SEQ ID NOS; 32-227; suitable human Ang2 target sequences include those of SEQ ID NOS: 228-427; and suitable human Tie2 target sequences include those of SEQ ID NOS: 428-739. It is understood that the target sequences given herein are with reference to the human Ang1, Ang2 or Tie2 cDNA, and thus these sequences contain deoxythymidines represented by "T." One skilled in the art would understand that, in the actual target sequence of the mRNA, the deoxythymidines would be replaced by uridines ("u"). Likewise, a target sequence contained within an siRNA of the invention would also contain uridines in place of deoxythymidines.

[0062] The siRNA of the invention can be obtained using a number of techniques known to those of skill in the art. For example, the siRNA, can be chemically synthesized or recombinantly produced using methods known in the art, such as the. Drosophila in vitro system described in U.S. published application 2002/0086356 of Tuschl et al., the entire disclosure of which is herein incorporated by reference.

[0063] Preferably, the siRNA of the invention are chemically synthesized using appropriately protected ribonucleoside phosphoramidites and a conventional DNA/RNA synthesizer. The siRNA can be synthesized as two separate, complementary RNA molecules, or as a single RNA molecule with two complementary regions. Commercial suppliers of synthetic RNA molecules or synthesis reagents include Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, Colo., USA), Pierce Chemical (part of Perbio Science, Rockford, Ill., USA), Glen Research (Sterling, Va., USA), ChemGenes (Ashland, Mass., USA) and Cruachem (Glasgow, UK).

[0064] Alternatively, siRNA can also be expressed from recombinant circular or linear DNA plasmids using any suitable promoter. Suitable promoters for expressing siRNA of the invention from a plasmid include, for example, the U6 or H1 RNA pol III promoter sequences and the cytomegalovirus promoter. Selection of other suitable promoters is within the skill in the art. The recombinant plasmids of the invention can also comprise inducible or regulatable promoters for expression of the siRNA in a particular tissue or in a particular intracellular environment.

[0065] The siRNA expressed from recombinant plasmids can either be isolated from cultured cell expression systems by standard techniques, or can be expressed intracellularly. The use of recombinant plasmids to deliver siRNA of the invention to cells in vivo is discussed in more detail below.

[0066] siRNA of the invention can be expressed from a recombinant plasmid either as two separate, complementary RNA molecules, or as a single RNA molecule with two complementary regions.

[0067] Selection of plasmids suitable for expressing siRNA of the invention, methods for inserting nucleic acid sequences for expressing the siRNA into the plasmid, and methods of delivering the recombinant plasmid to the cells of interest are within the skill in the art. See, for example Tuschl, T. (2002), Nat. Biotechnol, 20: 446-448; Brummelkamp T R et al. (2002), Science 296: 550-553; Miyagishi M et al. (2002), Nat. Biotechnol. 20: 497-500; Paddison P J et al. (2002), Genes Dev. 16: 948-958; Lee N S et al. (2002), Nat. Biotechnol. 20: 500-505; and Paul C P et al. (2002), Nat. Biotechnol. 20: 505-508, the entire disclosures of which are herein incorporated by reference.

[0068] In one embodiment, a plasmid expressing an siRNA of the invention comprises a sense RNA strand coding sequence in operable connection with a polyT termination sequence under the control of a human U6 RNA promoter, and an antisense RNA strand coding sequence in operable connection with a polyT termination sequence under the control of a human U6 RNA promoter. Such a plasmid can be used in producing an recombinant adeno-associated viral vector for expressing an siRNA of the invention.

[0069] As used herein, "in operable connection with a polyT termination sequence" means that the nucleic acid sequences encoding the sense or antisense strands are immediately adjacent to the polyT termination signal in the 5' direction. During transcription of the sense or antisense sequences from the plasmid, the polyT termination signals act to terminate transcription.

[0070] As used herein, "under the control" of a promoter means that the nucleic acid sequences encoding the sense or antisense strands are located 3' of the promoter, so that the promoter can initiate transcription of the sense or antisense coding sequences.

[0071] The siRNA of the invention can also be expressed from recombinant viral vectors intracellularly in vivo. The recombinant viral vectors of the invention comprise sequences encoding the siRNA of the invention and any suitable promoter for expressing the siRNA sequences. Suitable promoters include, for example, the U6 or HI RNA pol III promoter sequences and the cytomegalovirus promoter. Selection of other suitable promoters is within the skill in the art. The recombinant viral vectors of the invention can also comprise inducible or regulatable promoters for expression of the siRNA in a particular tissue or in a particular intracellular environment. The use of recombinant viral vectors to deliver siRNA of the invention to cells in vivo is discussed in more detail below.

[0072] siRNA of the invention can be expressed from a recombinant viral vector either as two separate, complementary RNA molecules, or as a single RNA molecule with two complementary regions.

[0073] Any viral vector capable of accepting the coding sequences for the siRNA molecule(s) to be expressed can be used, for example vectors derived from adenovirus (AV); adeno-associated virus (AAV); retroviruses (e.g, lentiviruses (LV), Rhabdoviruses, murine leukemia virus); herpes virus, and the like. The tropism of viral vectors can be modified by pseudotyping the vectors with envelope proteins or other surface antigens from other viruses, or by substituting different viral capsid proteins, as appropriate.

[0074] For example, lentiviral vectors of the invention can be pseudotyped with surface proteins from vesicular stomatitis virus (VSV), rabies, Ebola, Mokola, and the like. AAV vectors of the invention can be made to target different cells by engineering the vectors to express different capsid protein serotypes. For example, an AAV vector expressing a serotype 2 capsid on a serotype 2 genome is called AAV 2/2. This serotype 2 capsid gene in the AAV 2/2 vector can be replaced by a serotype 5 capsid gene to produce an AAV 2/5 vector. Techniques for constructing AAV vectors which express different capsid protein serotypes are within the skill in the art; see, e.g., Rabinowitz J E et al. (2002), J Virol 76:791-801, the entire disclosure of which is herein incorporated by reference.

[0075] Selection of recombinant viral vectors suitable for use in the invention, methods for inserting nucleic acid sequences for expressing the siRNA into the vector, and methods of delivering the viral vector to the cells of interest are within the skill in the art. See, for example, Dornburg R (1995), Gene Therap. 2: 301-310; Eglitis M A (1988), Biotechniques 6: 608-614; Miller A D (1990), Hum Gene Therap. 1: 5-14; Anderson W F (1998), Nature 392: 25-30; and Rubinson D A et al., Nat. Genet. 33: 401-406, the entire disclosures of which are herein incorporated by reference.

[0076] Preferred viral vectors are those derived from AV and AAV. In a particularly preferred embodiment, the siRNA of the invention is expressed as two separate, complementary single-stranded RNA molecules from a recombinant AAV vector comprising, for example, either the U6 or H1 RNA promoters, or the cytomegalovirus (CMV) promoter.

[0077] A suitable AV vector for expressing the siRNA of the invention, a method for constructing the recombinant AV vector, and a method for delivering the vector into target cells, are described in Xia H et al. (2002), Nat. Biotech. 20: 1006-1010.

[0078] Suitable AAV vectors for expressing the siRNA of the invention, methods for constructing the recombinant AV vector, and methods for delivering the vectors into target cells are described in Samulski R et al. (1987), J. Virol. 61: 3096-3101; Fisher K J et al. (1996), J. Virol., 70: 520-532; Samulski R et al. (1989). J. Virol. 63: 3822-3826; U.S. Pat. No. 5,252,479; U.S. Pat. No. 5,139,941; International Patent Application No. WO 94/13788; and International Patent Application No. WO 93/24641, the entire disclosures of which are herein incorporated by reference.

[0079] The ability of an siRNA containing a given target sequence to cause RNAi-mediated degradation of the target mRNA can be evaluated using standard techniques for measuring the levels of RNA or protein in cells. For example, siRNA of the invention can be delivered to cultured cells, and the levels of target mRNA can be measured by Northern blot or dot blotting techniques, or by quantitative RT-PCR. Alternatively, the levels of Ang1, Ang2 or Tie2 protein in the cultured cells can be measured by ELISA or Western blot. Suitable protocols for the delivery of siRNA to cultured cells, and assays for detecting protein and mRNA levels in cultured cells, are given in the Examples below.

[0080] For example, cells which naturally express Ang1, Ang2 or Tie2, or which are induced to express Ang1, Ang2 or Tie2, are grown to confluence in suitable cell culture vessels; e.g., 12- or 25-well culture plates or 96-well microtiter plates. siRNA of the invention can be administered to one group of Ang1, Ang2 or Tie2 expressing cells. A non-specific siRNA (or no siRNA) can be administered to a second group of Ang1, Ang2 or Tie2 expressing cells as a control. The cells are washed and directly fixed to the microtiter plate wells with 1 to 2% paraformaldehyde. Nonspecific binding sites on the microtiter plate are blocked with 2% bovine serum albumin, and the cells incubated with an Ang1, Ang2 or Tie2 specific monoclonal antibody. Bound Ang1, Ang2 or Tie2 antibody can be detected, for example, by incubation with a 1:1000 dilution of biotinylated goat anti-mouse IgG (Bethesda Research Laboratories, Gaithersberg, Md.) for 1 hour at 37.degree. C. and with a 1:1000 dilution of streptavidin conjugated to beta-galactosidase (Bethesda Research Laboratories) for 1 hour at 37.degree. C. The amount of beta-galactosidase bound to the Ang1, Ang2 or Tie2 specific monoclonal antibody is determined, for example, by developing the microtiter plate in a solution of 3.3 mM chlorophenol red-beta-D-galactopyranoside, 50 mM sodium phosphate, 1.5 mM MgCl.sub.2; pH 7.2 for 2 to 15 minutes at 37.degree. C., and measuring the concentration of bound antibody at 575 nm in an ELISA microtiter plate reader.

[0081] The ability of the present siRNA to down-regulate Ang1, Ang2 or Tie2 expression can also be evaluated in vitro by measuring tube formation by bovine retinal endothelial cells (BRECs), using techniques within the skill in the art. An inhibition of tube formation indicates a down-regulation of Ang1, Ang2 or Tie2 by the present siRNA.

[0082] A suitable BREC tube formation assay comprises culturing BRECs on fibronectin-coated dishes containing Dulbecco's modified Eagle's medium (DMEM) with 5.5 mM glucose, 10% platelet-derived horse serum (PDHS; Wheaton, Pipersville, Pa.), 50 mg/mL heparin, and 50 U/mL endothelial cell growth factor (Roche Molecular Biochemicals). BRECs suitable for use in the tube-formation assay exhibit endothelial homogeneity by immunoreactivity for factor VIII antigen, and remain morphologically unchanged under these conditions as confirmed by light microscopy.

[0083] The tube formation assay can be performed as described in King G L et al., J. Clin. Invest. 75:1028-1036 (1985) and Otani A et al., Circ. Res. 82: 619-628 (1998), the entire disclosures of which are herein incorporated by reference. Briefly, an 8:1:1 (400 microliter) mixture of Vitrogen 100 (Celtrix, Palo Alto, Calif.), 0.2 N NaOH and 200 mM HEPES in 10.times. RPMI medium (Gibco BRL, Gaithersburg, Md.), containing 5 microgram/mL fibronectin and 5 microgram/mL laminin, is added to 24-well plates. After polymerization of the gels, 1.0.times.10.sup.5 of the cultured BRECs are seeded in the wells and incubated for 24 hours at 37.degree. C. with DMEM containing 20% PDHS. The cell number is chosen to optimize the shape and tube length, as is known in the art (see King G L et al., 1985, supra and Otani A et al., 1998, supra). The medium is then removed, and additional collagen gel is introduced onto the cell layer. Before making the collagen gel, reference points can be randomly marked in the center area of the bottom of each well, in order to measure the density per surface area of any tubelike structures formed by the BRECs. Either VEGF or hypoxia-conditioned medium is then added to the wells to induce tube formation. One or more siRNA of the invention are then introduced into the BRECs of certain wells by any suitable procedure (see below). Other wells are treated with either no siRNA or a non-specific siRNA as controls. Inhibition of tube formation in the wells treated with siRNA as compared to the control wells indicates that expression of the target RNA has been has been inhibited.

[0084] RNAi-mediated degradation of Ang1, Ang2 or Tie2 mRNA by an siRNA of the invention can also be evaluated with animal models of neovascularization, such as the retinopathy of prematurity ("ROP") or choroidal neovascularization ("CNV") rat or mouse models. For example, areas of neovascularization in a CNV rat or mouse can be measured before and after administration of the present siRNA, as in Example 6 below. A reduction in the areas of neovascularization upon administration of the siRNA indicates the down-regulation of target mRNA and an inhibition of angiogenesis. Down-regulation of target mRNA and an inhibition of angiogenesis is also demonstrated below in the streptozotocin-induced diabetic retinopathy rat model (Example 3), a rat model of VEGF-induced retinal vascular permeability and leukostasis (Example 4), and a rat model of ocular neovascularization induced by corneal/limbal injury (Example 5).

[0085] The mouse model of ischemia-induced retinal neovascularization as described in Takagi et al., 2003, supra can also be used to detect RNAi-mediated degradation of Ang1, Ang2 or Tie2 with the present siRNA. Briefly, litters of 7-day-old ("postnatal day 7" or "P7") C57BL/6J mice are exposed to 75%.+-.2% oxygen for 5 days, and are then returned to room air at P12 to produce retinal neovascularization. Mice of the same age, maintained in room air, serve as a control. Maximal retinal neovascularization is typically observed at P17, S days after return to room air. One or more siRNA of the invention are injected subretinally into one eye of each treatment animal on P12 and P14. Either no siRNA, or a non-specific siRNA is injected into the contralateral eye as a control. At P17, the mice are killed by cardiac perfusion of 1 mL 4% paraformaldehyde in PBS, and the eyes are enucleated and fixed in 4% paraformaldehyde overnight at 4.degree. C. before paraffin embedding. Serial sections of the paraffin-embedded eyes can be obtained for observation of the extent of neovascularization in the retina. Reduced neovascularization in the retinas of eyes treated with one or more siRNA of the invention, as compared to controls, indicate inhibition in expression of the target mRNA.

[0086] As discussed above, the siRNA of the invention target can cause the RNAi-mediated degradation of Ang1, Ang2 or Tie2 mRNA, or alternative splice forms, mutants or cognates thereof. Degradation of the target mRNA by the present siRNA reduces the production of a functional gene product from the Ang1, Ang2 and/or Tie2 genes. Thus, the invention provides a method of inhibiting expression of Ang1, Ang2 or Tie2 in a subject, comprising administering an effective amount of an siRNA of the invention to the subject, such that the target mRNA is degraded. As the products of the Ang1, Ang2 or Tie2 genes are involved in angiogenesis, the invention also provides a method of inhibiting angiogenesis in a subject by the RNAi-mediated degradation of the target mRNA by the present siRNA.

[0087] In the practice of the present methods, two or more siRNA comprising different target sequences in the Ang1, Ang2 or Tie2 mRNA can be administered to the subject. Likewise, two or more siRNA, each comprising target sequences from a different target mRNA (i.e., Ang1, Ang2 and Tie2 mRNA) can also be administered to a subject.

[0088] As discussed above, Ang1 or Ang2 in conjunction with Tie2 appear to promote angiogenesis in the presence of VEGF, and Ang2 in conjunction with Tie2 appears to promote angiogenesis under hypoxic conditions. However, it is not clear whether VEGF and/or hypoxic conditions are required for Ang1 Ang2- and Tie2-mediated angiogenesis. Also, downregulation of either Ang1, Ang2 or Tie2 expression alone can be sufficient to inhibit angiogenesis. It is therefore not necessary to verify the presence of VEGF or hypoxia in the practice of the present methods.

[0089] As used herein, a "subject" includes a human being or non-human animal. Preferably, the subject is a human being.

[0090] As used herein, an "effective amount" of the siRNA is an amount sufficient to cause RNAi-mediated degradation of the target mRNA, or an amount sufficient to inhibit the progression of angiogenesis in a subject.

[0091] RNAi-mediated degradation of the target mRNA can be detected by measuring levels of the target mRNA or protein in the cells of a subject, using standard techniques for isolating and quantifying mRNA or protein as described above.

[0092] Inhibition of angiogenesis can be evaluated by directly measuring the progress of pathogenic or nonpathogenic angiogenesis in a subject; for example, by observing the size of a neovascularized area before and after treatment with the siRNA of the invention. An inhibition of angiogenesis is indicated if the size of the neovascularized area stays the same or is reduced. Techniques for observing and measuring the size of neovascularized areas in a subject are within the skill in the art; for example, areas of choroid neovascularization can be observed by ophthalmoscopy.

[0093] Inhibition of angiogenesis can also be inferred through observing a change or reversal in a pathogenic condition associated with the angiogenesis. For example, in AMD, a slowing, halting or reversal of vision loss indicates an inhibition of angiogenesis in the choroid. For tumors, a slowing, halting or reversal of tumor growth, or a slowing or halting of tumor metastasis, indicates an inhibition of angiogenesis at or near the tumor site. Inhibition of non-pathogenic angiogenesis can also be inferred from, for example, fat loss or a reduction in cholesterol levels upon administration of the siRNA of the invention.

[0094] It is understood that the siRNA of the invention can mediate RNA interference (and thus inhibit angiogenesis) in substoichiometric amounts. Without wishing to be bound by any theory, it is believed that the siRNA of the invention induces the RISC to degrade the target mRNA in a catalytic manner. Thus, compared to standard therapies for cell adhesion or cell adhesion mediated pathologies, significantly less siRNA needs to be administered to the subject to have a therapeutic effect.

[0095] One skilled in the art can readily determine an effective amount of the siRNA of the invention to be administered to a given subject, by taking into account factors such as the size and weight of the subject; the extent of the neovascularization or disease penetration; the age, health and sex of the subject; the route of administration; and whether the administration is regional or systemic. Generally, an effective amount of the siRNA of the invention comprises an intercellular concentration at or near the neovascularization site of from about 1 nanomolar (nM) to about 100 nM, preferably from about 2 nM to about 50 nM, more preferably from about 2.5 nM to about 10 nM. Particularly preferred effective amounts of the siRNA of the invention can comprise an intercellular concentration at or near the neovascularization site of about 1 nM, about 5 nM, or about 25 nM. It is contemplated that greater or lesser effective amounts of siRNA can be administered.

[0096] The present methods can be used to inhibit angiogenesis which is non-pathogenic; i.e., angiogenesis which results from normal processes in the subject. Examples of non-pathogenic angiogenesis include endometrial neovascularization, and processes involved in the production of fatty tissues or cholesterol. Thus, the invention provides a method for inhibiting non-pathogenic angiogenesis; e.g., for controlling weight or promoting fat loss, for reducing cholesterol levels, an inhibitor of the menstrual cycle, or as an abortifacient.

[0097] The present methods can also inhibit angiogenesis which is associated with an angiogenic disease; i.e., a disease in which pathogenicity is associated with inappropriate or uncontrolled angiogenesis. For example, most cancerous solid tumors generate an adequate blood supply for themselves by inducing angiogenesis in and around the tumor site. This tumor-induced angiogenesis is often required for tumor growth, and also allows metastatic cells to enter the bloodstream.

[0098] Other angiogenic diseases include AMD, psoriasis, rheumatoid arthritis and other inflammatory diseases. These diseases are characterized by the destruction of normal tissue by newly formed blood vessels in the area of neovascularization. For example, in the wet form of AMD, the choroid is invaded and destroyed by capillaries. The angiogenesis-driven destruction of the choroid in AMD eventually leads to partial or full blindness.

[0099] In another embodiment, the invention provides a method of treating a subject for complications arising from type I diabetes, by the RNAi-mediated degradation of the target mRNA by the present siRNA. Preferably, the complications arising from type I diabetes to be treated by the present method are diabetic retinopathy, diabetic neuropathy, diabetic nephropathy, and macrovascular disease (including coronary artery disease, cerebrovascular disease, and peripheral vascular disease).

[0100] Preferably, an siRNA of the invention is used to inhibit the growth or metastasis of solid tumors associated with cancers; for example breast cancer, lung cancer, head and neck cancer, brain cancer, abdominal cancer, colon cancer, colorectal cancer, esophagus cancer, gastrointestinal cancer, glioma, liver cancer, tongue cancer, neuroblastoma, osteosarcoma, ovarian cancer, pancreatic cancer, prostate cancer, retinoblastoma, Wilm's tumor, multiple myeloma; skin cancer (e.g., melanoma), lymphomas and blood cancer.

[0101] More preferably, an siRNA of the invention is used to treat complications arising from type I diabetes, such as diabetic retinopathy, diabetic neuropathy, diabetic nephropathy and macrovascular disease.

[0102] Particularly preferably, an siRNA of the invention is used to inhibit ocular neovascularization, for example to inhibit choroidal neovascularization in AMD.

[0103] For treating angiogenic diseases, the siRNA of the invention can administered to a subject in combination with a pharmaceutical agent which is different from the present siRNA. Alternatively, the siRNA of the invention can be administered to a subject in combination with another therapeutic method designed to treat the angiogenic disease. For example, the siRNA of the invention can be administered in combination with therapeutic methods currently employed for treating cancer or preventing tumor metastasis (e.g., radiation therapy, chemotherapy, and surgery). For treating tumors, the siRNA of the invention is preferably administered to a subject in combination with radiation therapy, or in combination with chemotherapeutic agents such as cisplatin, carboplatin, cyclophosphamide, 5-fluorouracil, adriamycin, daunorubicin or tamoxifen.

[0104] In the present methods, the present siRNA can be administered to the subject either as naked siRNA, in conjunction with a delivery reagent, or as a recombinant plasmid or viral vector which expresses the siRNA.

[0105] Suitable delivery reagents for administration in conjunction with the present siRNA include the Mirus Transit TKO lipophilic reagent; lipofectin; lipofectamine; cellfectin; or polycations (e.g., polylysine), or liposomes. A preferred delivery reagent is a liposome.

[0106] Liposomes can aid in the delivery of the siRNA to a particular tissue, such as retinal or tumor tissue, and can also increase the blood half-life of the siRNA. Liposomes suitable for use in the invention are formed from standard vesicle-forming lipids, which generally include neutral or negatively charged phospholipids and a sterol, such as cholesterol. The selection of lipids is generally guided by consideration of factors such as the desired liposome size and half-life of the liposomes in the blood stream. A variety of methods are known for preparing liposomes, for example as described in Szoka et al. (1980), Ann. Rev. Biophys. Bioeng. 9: 467; and U.S. Pat. Nos. 4,235,871, 4,501,728, 4,837,028, and 5,019,369, the entire disclosures of which are herein incorporated by reference.

[0107] Preferably, liposomes encapsulating the present siRNA comprise a ligand molecule that can target the liposome to cells such as endothelial cells which express Ang1, Ang2 or Tie2 at or near the site of angiogenesis. Ligands which bind to receptors prevalent in vascular EC, such as monoclonal antibodies that bind to EC surface antigens, are preferred.

[0108] Particularly preferably, the liposomes encapsulating the present siRNA's are modified so as to avoid clearance by the mononuclear macrophage and reticuloendothelial systems, for example by having opsonization-inhibition moieties bound to the surface of the structure. In one embodiment, a liposome of the invention can comprise both opsonization-inhibition moieties and a ligand.

[0109] Opsonization-inhibiting moieties for use in preparing the liposomes of the invention are typically large hydrophilic polymers that are bound to the liposome membrane. As used herein, an opsonization inhibiting moiety is "bound" to a liposome membrane when it is chemically or physically attached to the membrane, e.g., by the intercalation of a lipid-soluble anchor into the membrane itself, or by binding directly to active groups of membrane lipids. These opsonization-inhibiting hydrophilic polymers form a protective surface layer which significantly decreases the uptake of the liposomes by the macrophage-monocyte system ("MMS") and reticuloendothelial system ("RES"); e.g., as described in U.S. Pat. No. 4,920,016, the entire disclosure of which is herein incorporated by reference. Liposomes modified with opsonization-inhibition moieties thus remain in the circulation much longer than unmodified liposomes. For this reason, such liposomes are sometimes called "stealth" liposomes.

[0110] Stealth liposomes are known to accumulate in tissues fed by porous or "leaky" microvasculature. Thus, tissue characterized by such microvasculature defects, for example solid tumors, will efficiently accumulate these liposomes; see Gabizon, et al. (1988), P.N.A.S., USA, 18: 6949-53. In addition, the reduced uptake by the RES lowers the toxicity of stealth liposomes by preventing significant accumulation in the liver and spleen. Thus, liposomes of the invention that are modified with opsonization-inhibition moieties are particularly suited to deliver the present siRNA to tumor cells.

[0111] Opsonization inhibiting moieties suitable for modifying liposomes are preferably water-soluble polymers with a number average molecular weight from about 500 to about 40,000 daltons, and more preferably from about 2,000 to about 20,000 daltons. Such polymers include polyethylene glycol (PEG) or polypropylene glycol (PPG) derivatives; e.g., methoxy PEG or PPG, and PEG or PPG stearate; synthetic polymers such as polyacrylamide or poly N-vinyl pyrrolidone; linear, branched, or dendrimeric polyamidoamines; polyacrylic acids; polyalcohols, e.g., polyvinylalcohol and polyxylitol to which carboxylic or amino groups are chemically linked, as well as gangliosides, such as ganglioside GM.sub.1. Copolymers of PEG, methoxy PEG, or methoxy PPG, or derivatives thereof, are also suitable. In addition, the opsonization inhibiting polymer can be a block copolymer of PEG and either a polyamino acid, polysaccharide, polyamidoamine, polyethyleneamine, or polynucleotide. The opsonization inhibiting polymers can also be natural polysaccharides containing amino acids or carboxylic acids, e.g., galacturonic acid, glucuronic acid, mannuronic acid, hyaluronic acid, pectic acid, neuraminic acid, alginic acid, carrageenan; aminated polysaccharides or oligosaccharides (linear or branched); or carboxylated polysaccharides or oligosaccharides, e.g., reacted with derivatives of carbonic acids with resultant linking of carboxylic groups.

[0112] Preferably, the opsonization-inhibiting moiety is a PEG, PPG, or derivatives thereof. Liposomes modified with PEG or PEG-derivatives are sometimes called "PEGylated liposomes."

[0113] The opsonization inhibiting moiety can be bound to the liposome membrane by any one of numerous well-known techniques. For example, an N-hydroxysuccinimide ester of PEG can be bound to a phosphatidyl-ethanolamine lipid-soluble anchor, and then bound to a membrane. Similarly, a dextran polymer can be derivatized with a stearylamine lipid-soluble anchor via reductive amination using Na(CN)BH.sub.3 and a solvent mixture such as tetrahydrofuran and water in a 30:12 ratio at 60.degree. C.

[0114] Recombinant plasmids which express siRNA of the invention are discussed above. Such recombinant plasmids can also be administered directly or in conjunction with a suitable delivery reagent, including the Minis Transit LT1 lipophilic reagent; lipofectin; lipofectamine; cellfectin; polycations (e.g., polylysine) or liposomes. Recombinant viral vectors which express siRNA of the invention are also discussed above, and methods for delivering such vectors to cells of a subject which are expressing Ang1, Ang2 or Tie2 are within the skill in the art.

[0115] The siRNA of the invention can be administered to the subject by any means suitable for delivering the siRNA to the cells expressing Ang1, Ang2 or Tie2. For example, the siRNA can be administered by gene gun, electroporation, or by other suitable parenteral or enteral administration routes.

[0116] Suitable enteral administration routes include oral, rectal, or intranasal delivery.

[0117] Suitable parenteral administration routes include intravascular administration (e.g. intravenous bolus injection, intravenous infusion, intra-arterial bolus injection, intra-arterial infusion and catheter instillation into the vasculature); peri- and intra-tissue administration (e.g., peri-tumoral and intra-tumoral injection, intra-retinal injection or subretinal injection); subcutaneous injection or deposition including subcutaneous infusion (such as by osmotic pumps); direct (e.g., topical) application to the area at or near the site of neovascularization, for example by a catheter or other placement device (e.g., a corneal pellet or a suppository, eye-dropper, or an implant comprising a porous, non-porous, or gelatinous material); and inhalation. Suitable placement devices include the ocular implants described in U.S. Pat. Nos. 5,902,598 and 6,375,972, and the biodegradable ocular implants described in U.S. Pat. No 6,331,313, the entire disclosures of which are herein incorporated by reference. Such ocular implants are available from Control Delivery Systems, Inc. (Watertown, Mass.) and Oculex Pharmaceuticals, Inc. (Sunnyvale, Calif.).

[0118] In a preferred embodiment, injections or infusions of the siRNA are given at or near the site of neovascularization. For example, the siRNA of the invention can be delivered to retinal pigment epithelial cells in the eye. Preferably, the siRNA is administered topically to the eye, e.g. in liquid or gel form to the lower eye lid or conjunctival cul-de-sac, or by electroporation or iontophoresis, as is within the skill in the art (see, e.g., Acheampong A A et al, 2002, Drug Metabol. and Disposition 30: 421-429, the entire disclosure of which is herein incorporated by reference).

[0119] Typically, the siRNA of the invention is administered topically to the eye in volumes of from about 5 microliters to about 75 microliters, for example from about 7 microliters to about 50 microliters, preferably from about 10 microliters to about 30 microliters. The siRNA of the invention is highly soluble in aqueous solutions, and it is understood that topical instillation in the eye of siRNA in volumes greater than 75 microliters can result in loss of siRNA from the eye through spillage and drainage. Thus, it is preferable to administer a high concentration of siRNA (e.g., about 10 to about 200 mg/ml, or about 100 to about 1000 nM) by topical instillation to the eye in volumes of from about 5 microliters to about 75 microliters.

[0120] A particularly preferred parenteral administration route is intraocular administration. It is understood that intraocular administration of the present siRNA can be accomplished by injection or direct (e.g., topical) administration to the eye, as long as the administration route allows the siRNA to enter the eye. In addition to the topical routes of administration to the eye described above, suitable intraocular routes of administration include intravitreal, intraretinal, subretinal, subtenon, peri- and retro-orbital, trans-corneal and trans-scleral administration. Such intraocular administration routes are within the skill in the art; see, e.g., and Acheampong AA et al, 2002, supra; and Bennett et al. (1996), Hum. Gene Ther. 7: 1763-1769 and Ambati J et al., 2002, Progress in Retinal and Eye Res. 21: 145-151, the entire disclosures of which are herein incorporated by reference.

[0121] The siRNA of the invention can be administered in a single dose or in multiple doses. Where the administration of the siRNA of the invention is by infusion, the infusion can be a single sustained dose or can be delivered by multiple infusions.

[0122] One skilled in the art can also readily determine an appropriate dosage regimen for administering the siRNA of the invention to a given subject. For example, the siRNA can be administered to the subject once, such as by a single injection or deposition at or near the neovascularization site. Alternatively, the siRNA can be administered to a subject multiple times daily or weekly. For example, the siRNA can be administered to a subject once weekly for a period of from about three to about twenty-eight weeks, more preferably from about seven to about ten weeks. In a preferred dosage regimen, the siRNA is injected at or near the site of neovascularization (e.g., intravitreally) once a week for seven weeks. It is understood that periodic administrations of the siRNA of the invention for an indefinite length of time may be necessary for subjects suffering from a chronic neovascularization disease, such as wet AMD or diabetic retinopathy.

[0123] Where a dosage regimen comprises multiple administrations or the administration of two or more siRNA, each of which comprise a different target sequence, it is understood that the effective amount of siRNA administered to the subject can comprise the total amount of siRNA administered over the entire dosage regimen.

[0124] The siRNA of the invention are preferably formulated as pharmaceutical compositions prior to administering to a subject, according to techniques known in the art. Pharmaceutical compositions of the present invention are characterized as being at least sterile and pyrogen-free. As used herein, "pharmaceutical formulations" include formulations for human and veterinary use. Methods for preparing pharmaceutical compositions of the invention are within the skill in the art, for example as described in Remington's Pharmaceutical Science, 17th ed., Mack Publishing Company, Easton, Pa. (1985), the entire disclosure of which is herein incorporated by reference.

[0125] The present pharmaceutical formulations comprise an siRNA of the invention (e.g., 0.1 to 90% by weight), or a physiologically acceptable salt thereof, mixed with a physiologically acceptable carrier medium. Preferred physiologically acceptable carrier media are water, buffered water, normal saline, 0.4% saline, 0.3% glycine, hyaluronic acid and the like.

[0126] Pharmaceutical compositions of the invention can also comprise conventional pharmaceutical excipients and/or additives. Suitable pharmaceutical excipients include stabilizers, antioxidants, osmolality adjusting agents, buffers, and pH adjusting agents. Suitable additives include physiologically biocompatible buffers (e.g., tromethamine hydrochloride), additions of chelants (such as, for example, DTPA or DTPA-bisamide) or calcium chelate complexes (as for example calcium DTPA, CaNaDTPA-bisamide), or, optionally, additions of calcium or sodium salts (for example, calcium chloride, calcium ascorbate, calcium gluconate or calcium lactate). Pharmaceutical compositions of the invention can be packaged for use in liquid form, or can be lyophilized.

[0127] For topical administration to the eye, conventional intraocular delivery reagents can be used. For example, pharmaceutical compositions of the invention for topical intraocular delivery can comprise saline solutions as described above, corneal penetration enhancers, insoluble particles, petrolatum or other gel-based ointments, polymers which undergo a viscosity increase upon instillation in the eye, or mucoadhesive polymers. Preferably, the intraocular delivery reagent increases corneal penetration, or prolongs preocular retention of the siRNA through viscosity effects or by establishing physicochemical interactions with the mucin layer covering the corneal epithelium.

[0128] Suitable insoluble particles for topical intraocular delivery include the calcium phosphate particles described in U.S. Pat. No. 6,355,271 of Bell et al., the entire disclosure of which is herein incorporated by reference. Suitable polymers which undergo a viscosity increase upon instillation in the eye include polyethylenepolyoxypropylene block copolymers such as poloxamer 407 (e.g., at a concentration of 25%), cellulose acetophthalate (e.g., at a concentration of 30%), or a low-acetyl gellan gum such as Gelrite.RTM. (available from CP Kelco, Wilmington, Del.). Suitable mucoadhesive polymers include hydrocolloids with multiple hydrophilic functional groups such as carboxyl, hydroxyl, amide and/or sulfate groups; for example, hydroxypropylcellulose, polyacrylic acid, high-molecular weight polyethylene glycols (e.g., >200,000 number average molecular weight), dextrans, hyaluronic acid, polygalacturonic acid, and xylocan. Suitable corneal penetration enhancers include cyclodextrins, benzalkonium chloride, polyoxyethylene glycol lauryl ether (e.g., Brij.RTM. 35), polyoxyethylene glycol stearyl ether (e.g., Brij.RTM. 78), polyoxyethylene glycol oleyl ether (e.g., Brij.RTM. 98), ethylene diamine tetraacetic acid (EDTA), digitonin, sodium taurocholate, saponins and polyoxyethylated castor oil such as Cremaphor EL.

[0129] For solid compositions, conventional nontoxic solid carriers can be used; for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like.

[0130] For example, a solid pharmaceutical composition for oral administration can comprise any of the carriers and excipients listed above and 10-95%, preferably 25%-75%, of one or more siRNA of the invention. A pharmaceutical composition for aerosol (inhalational) administration can comprise 0.01-20% by weight, preferably 1%-10% by weight, of one or more siRNA of the invention encapsulated in a liposome as described above, and propellant. A carrier can also be included as desired; e.g., lecithin for intranasal delivery.

[0131] The invention will now be illustrated by the following non-limiting examples.

EXAMPLE 1

Inhibition of Ang2 Expression in Cultured Human Cells with siRNA Targeted to Ang2 mRNA

[0132] Human embryonic kidney (HEK-293 cells) were cultured in 24 well plates at 37.degree. C. with 5% CO.sub.2 overnight in standard growth medium. Transfections were performed the next day when the cells were about 70% confluent. The HEK-293 cells were separately transfected with twelve different siRNA (25 nM each) targeted to human Ang2 ("hANG2") mRNA, mixed with a CaPi transfection reagent. These twelve siRNAs target the sequences listed in Table 1, and all siRNAs contained 3' TT overhangs on each strand. Control cells were transfected with CaPi transfection reagent lacking siRNA, or a nonspecific siRNA targeted to enhanced green fluorescent protein (EGFP siRNA) mixed with CaPi transfection reagent. Forty eight hours post-transfection, the growth medium was removed from all wells, and a human ANG2 ELISA (R & D systems, Minneapolis, Minn.) was performed as described in the Quantikine human ANG2 ELISA protocol, the entire disclosure of which is herein incorporated by reference. ELISA results were read on an AD340 plate reader (Beckman Coulter), and are reported in FIG. 1.

TABLE-US-00013 TABLE 1 Target Sequences for hANG2 siRNAs Tested in HEK-293 Cells Target Sequence SEQ ID NO: siRNA AAGAGCATGGACAGCATAGGA 232 hANG2#1 AACCAGACGGCTGTGATGATA 254 hANG2#2 AAACGCGGAAGTTAACTGATG 262 hANG2#3 AACGCGGAAGTTAACTGATGT 263 hANG2#4 AAGAAGGTGCTAGCTATGGAA 291 hANG2#5 AATAGTGACTGCCACGGTGAA 316 hANG2#6 AATAACTTACTGACTATGATG 323 hANG2#7 AATCAGGACACACCACAAATG 336 hANG2#8 AAATGGCATCTACACGTTAAC 337 hANG2#9 AATGGCATCTACACGTTAACA 338 hANG2#10 AATTATTCAGCGACGTGAGGA 344 hANG2#11 AAGAACTCAATTATAGGATTC 366 hANG2#12

[0133] As can be seen from FIG. 1, the level of hANG2 protein secreted into the growth medium was reduced in HEK-293 cells transfected with hANG2#2, #3, #4, #9 and #10 siRNA. Transfection of HEK-293 cells with non-specific siRNA had no apparent effect on hANG2 protein levels.

[0134] After the growth medium was removed from each well, a cytotoxicity assay was performed on the cells as follows. Complete growth medium containing 10% AlamarBlue (Biosource, Camarillo, Calif.) was added to each well, and cells were incubated at 37.degree. C. with 5% CO.sub.2 for 3 hours. Cell proliferation was measured by detecting the color change of medium containing AlamarBlue which resulted from cell metabolic activity. The cytotoxicity assay results were read on an AD340 plate reader (Beckman Coulter), and are reported in FIG. 2.

[0135] As can be seen in FIG. 2, the transfection of HEK-293 cells with the hANG2#8 and #12 siRNA produced a slight reduction in cell growth as compared to control cells. The remaining hANG2 siRNAs showed no apparent cytotoxicity as compared with control cells.

[0136] After cytotoxicity assay was performed, the AlamarBlue-containing medium in each well was completely removed and RNA extractions were performed using the RNAqueous RNA isolation kit (Ambion, Austin, Tex.). The levels of hANG2 mRNA in the HEK-293 cells were measured by a quantitative reverse-transcriptase/polymerase chain reaction (RT-PCR) assay. Expression of human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA was used as a internal control. The levels of hANG2 mRNA in HEK-293 cells were reduced by transfection with the hANG2 siRNA compared to control cells, in a pattern which correlated with the reduction in hANG2 protein shown in FIG. 1.

EXAMPLE 2

Dose-Response of hAng2#2 and #3 in Cultured Human Cells

[0137] HEK-293 cells were grown to about 70% confluency as in Example 1 above. The cells were then transfected with I nanomolar ("nM"), 5 nM or 25 nM doses of hANG2#2 or #3 siRNA in CaPi transfection reagent. Control cells were transfected with 25 nM nonspecific EGFP siRNA in CaPi transfection reagent, or with transfection reagent alone. hANG2 protein levels were measured in the growth medium at 48 hours post-transfection by ANG2 ELISA as described in Example 1 above, and the results are presented in FIG. 3.

[0138] As can be seen from FIG. 3, the levels of hANG2 protein level were reduced in HEK-293 cells transfected with the hANG2#2 and #3 siRNA, in a dose-dependent manner. All doses of hANG2#2 siRNA and the 5 and 25 nM doses of hANG2#3 siRNA reduced the level of hANG2 protein secreted into the growth medium, as compared to control cells. The 1 nM dose of hANG2#3 siRNA did not reduce the hANG2 protein level as compared to control cells mock-transfected with transfection reagent alone. However, the level of hANG2 protein secreted by cells transfected with 1 nM hANG2#3 siRNA was slightly reduced as compared to control cells transfected with the nonspecific siRNA. Transfections with the non-specific siRNA had no apparent effect on hANG2 protein levels.

[0139] A cytotoxicity assay was performed on the control HEK-293 cells and the HEK-293 cells transfected with the different doses of hANG2#2 and #3 siRNA as described above in Example 1. As can be seen in FIG. 4, the transfection of HEK-293 cells with 5 nM hANG2#2 siRNA produced a slight reduction in cell growth as compared to control cells mock-transfected with transfection reagent alone. There was no apparent toxicity of the 5 nM hANG2#2 siRNA dose as compared to control cells transfected with the nonspecific siRNA. The remaining doses of hANG2#2 or #3 siRNA showed no apparent cytotoxicity as compared with control cells transfected with nonspecific siRNA or with transfection reagent alone.

EXAMPLE 3

Treatment of Streptozotocin-Induced Diabetic Retinopathy with siRNA Targeted to Ang1, Ang2 or Tie2

[0140] Vascular leakage and non-perfusion in the retinas of individuals with diabetic retinopathy is spatially and temporally associated with leukocyte stasis. See, e.g., Miyamoto K et al. (1999), Proc. Nat. Acad. Sci. USA 96(19):10836-41, the entire disclosure of which is herein incorporated by reference. It is expected that intravitreal injection of siRNA targeted to Ang1, Ang2 or Tie2 will decrease leukocyte stasis, and therefore reduce retinal vascular permeability, in diabetic rats.

[0141] Long-Evans rats (approximately 200 g) will be injected with streptozotocin in citrate buffer intravenously after an overnight fast to induce diabetes, as described in Miyamoto K et al. (1999), supra. Long-Evans rats (approximately 200 g) will be injected with citrate buffer alone after an overnight fast as a control. The serum blood-sugar will be measured and blood pressure will be recorded daily. Elevated levels of serum blood sugar as compared to control animals are considered diabetic.

[0142] Intravitreal injections of siRNA targeted to Ang1, Ang2 or Tie2 ("experimental siRNA") will be performed OD in each rat. Non-specific siRNA will be injected as a control OS. The overall group scheme will be as shown in Table 2.

TABLE-US-00014 TABLE 2 Overall Group Scheme OD OS (experimental siRNA) (non-specific siRNA) Diabetic Rat (STZ) Experimental group Control Non-diabetic Rat Control Control

[0143] At day 7 post treatment, the rats will be subjected to Acridine Orange Leukocyte Fluorography (AOLF), as described in Miyamoto K et al (1999), supra. Briefly, the rats will be anaesthetized, and their pupils dilated with tropicamide. The rats will then be injected intravenously with acridine orange suspended in sterile saline. The fundus of each eye will be observed and imaged with a scanning laser ophthalmoscope (argon blue laser as a light source) for leukocyte stasis. The rats will then be perfused with fluorescein dextran and the eyes will be further imaged. The density of leukocyte stasis will be calculated as a percentage of bright pixels in a 10 disk diameter radius. The density of leukocyte stasis will be used as an endpoint.

[0144] Also on day 7, the rats will undergo an isotope dilution technique to quantify vascular leakage, as described in Miyamoto K et al (1999), supra. Briefly, the rats will be injected intravenously with I.sup.125 in BSA at one time point, and with I.sup.131 at a second time point. The rats will be sacrificed minutes after the second injection, the retinas will be isolated, and arterial samples will be taken. The retinas and the arterial samples will be analyzed using .gamma.-spectroscopy after correcting for activity in the retinas using a quantitative index of iodine clearance. The measurements will then be normalized for exact dose given, body weight and tissue weight. The corrected quantity of .gamma. activity will be used as a marker of vascular leakage in the retina (second endpoint). It is expected that the .gamma. activity will be decreased in the retinas of the experimental animals, indicating decreased vascular leakage.

EXAMPLE 4

Treatment of VEGF-Induced Vascular Permeability and Leukostasis with siRNA Targeted to Ang1, Ang2 or Tie2

[0145] The presence of VEGF in the eye causes retinal leukostasis that corresponds with increased vascular permeability and capillary non-perfusion in the retina. See, e.g., Miyamoto K et al. (2000), Am. J. Pathol. 156(5):1733-9, the entire disclosure of which is herein incorporated by reference. It is expected that intravitreal injection of siRNA targeted to Ang1, Ang2 or Tie2 will decrease the permeability and leukostasis created by intravitreal injection of VEGF in rats.

[0146] Long-Evans rats (approximately 200 g) will be anaesthetized and injected intravitreally with VEGF in buffer OU. siRNA targeted to Ang1, Ang2 or Tie2 ("experimental siRNA") will be simultaneously delivered OD to each rat by intravitreal injection. Non-specific siRNA will be injected intravitreally as a control OS. Additional controls will include rats injected with buffer alone (no VEGF). The overall group scheme will be as shown in Table 3.

TABLE-US-00015 TABLE 3 Overall Group Scheme OD OS (experimental siRNA) (Non-specific siRNA) VEGF Experimental group Control Buffer Control Control

[0147] At 24 hours post injection the rats are subjected to AOLF and an isotope dilution technique as described in Example 3.

EXAMPLE 5

Treatment of Neovascularization in Eyes Subjected to Corneal/Limbal Injury with siRNA Targeted to Ang1, Ang2 or Tie2

[0148] Injury to the ocular surface can cause the destruction of corneal limbal stem cells. Destruction of these cells induces a VEGF-dependent corneal neovascularization, which can lead to blindness. The VEGF which drives the neovascularization is supplied by neutrophils and monocytes that infiltrate the cornea after injury to the ocular surface. See, e.g., Moromizato Y et al. (2000), Am. J. Pathol. 157(4):1277-81, the entire disclosure of which is herein incorporated by reference in its entirety. It is expected that siRNA targeted to Ang1, Ang2 or Tie2 applied to the cornea after limbal injury will decrease the resultant area of neovascularization of the cornea in mice. The area of neovascularization can be measured directly. Alternatively, a reduction in corneal neovascularization can be inferred from a decrease in the number of VEGF-producing polymorphonuclear cells in the cornea.

[0149] Corneal neovascularization will be induced in C57Bl/6 by damaging the limbus, as described in Moromizato Y et al., supra. Briefly, the mice will be anaesthetized and sodium hydroxide will be applied to the cornea. The corneal and limbal epithelia will be debrided using a corneal knife OU. siRNA targeted to Ang1, Ang2 or Tie2 will be applied to the corneal surface OD immediately, after removal, and 3 times a day for the duration of the study (7 days). Non-specific siRNA will be administered OS with the same dosing regimen as a control.

[0150] On days 2, 4 and 7 after debridement of the corneal and limbal epithelia, mice will be evaluated for the degree of corneal neovascularization as described in Moromizato Y et al., supra. Briefly, endothelial-specific, fluorescein-conjugated lectin will be injected intravenously. Thirty minutes after injection, mice will be sacrificed, and the eyes will be harvested and fixed in formalin for 24 hours. Flat mounts of the corneas will be made, and pictures of the corneal flat mounts will be taken under fluorescent microscopy and imported into Openlab software for analysis. Using the Openlab software, threshold level of fluorescence will be set, above which only vessels are seen. The area of fluorescent vessels and the area of the cornea (demarcated by the limbal arcade) will be calculated. The area of vessels will be divided by the total corneal area, and this value will equal the percent neovascular area. The percent neovascular area of the treatment and control groups will be compared.

[0151] On days 2, 4 and 7 after debridement of the corneal and limbal epithelia, additional mice will be sacrificed for quantification of corneal polymorphonuclear cells (PMNs) as described in Moromizato Y et al., supra. Briefly, mice will be sacrificed, and the eyes will be harvested and fixed in formalin for 24 hours. After formalin fixation, the enucleated eyes will be embedded in paraffin and sectioned. One paraffin section from each eye which correlates to the corneal anatomical center will be chosen and used for microscopy. The PMNs (identified as multilobulated cells) will be counted on this one section, and the number of PMNs in the sections from the treatment and control groups will be compared.

EXAMPLE 6

Treatment of Laser-Induced Choroidal Neovascularization with siRNA Targeted to Ang1, Ang2 or Tie2

[0152] Laser photocoagulation that ruptures Bruch's membrane will induce choroidal neovascularization (CNV) similar to that seen in wet macular degeneration. It is expected that intravitreal injection of siRNA targeted to Ang1, Ang2 or Tie2 will decrease the area of laser-induced CNV in mice.

[0153] CNV will be induced in mice by the procedure described in Sakurai E et al. (2003), Invest. Ophthalmol. & Visual Sci. 44(61:2743-9, the entire disclosure of which is herein incorporated by reference. Briefly, C57Bl/6 mice will be anaesthetized, and their pupils will be dilated with tropicamide. The retinas of the mice will be laser photocoagulated with one laser spot at the 9, 12, and 3 o'clock positions of each retinal OU. Immediately following laser photocoagulation, inject siRNA targeted to Ang1, Ang2 or Tie2 will be injected intravitreally OD. Non-specific siRNA will be injected intravitreally OS as a control.

[0154] Fourteen days after laser photocoagulation, the mice will be sacrificed and retinal flat mounts will be prepared for CNV area quantification as described in Sakurai E et al. (2003), supra. Briefly, the mice will be anaesthetized, the chest will be opened, and the descending aorta will be cross-clamped. The right atrium will then be clipped and fluorescein-labeled dextran will be injected slowly into the left ventricle.

[0155] After injection of the fluorescein-labeled dextran, the eyes will be enucleated and fixed in paraformaldehyde for 24 hours. The anterior chamber and retina will then be removed, and a flat mount of each choroid will be prepared for analysis. Choroidal flat mounts will be analyzed by taking a picture of each under fluorescent microscopy, and importing the picture into Openlab software. Using the Openlab software, the area of neovascularization will be outlined and quantified, being sure known laser location is compared to the fluorescent tuft. The neovascular area of the treatment animals will be compared to that of the control animals.

Sequence CWU 1

1

73611493DNAHomo sapiens 1atgacagttt tcctttcctt tgctttcctc gctgccattc tgactcacat agggtgcagc 60aatcagcgcc gaagtccaga aaacagtggg agaagatata accggattca acatgggcaa 120tgtgcctaca ctttcattct tccagaacac gatggcaact gtcgtgagag tacgacagac 180cagtacaaca caaacgctct gcagagagat gctccacacg tggaaccgga tttctcttcc 240cagaaacttc aacatctgga acatgtgatg gaaaattata ctcagtggct gcaaaaactt 300gagaattaca ttgtggaaaa catgaagtcg gagatggccc agatacagca gaatgcagtt 360cagaaccaca cggctaccat gctggagata ggaaccagcc tcctctctca gactgcagag 420cagaccagaa agctgacaga tgttgagacc caggtactaa atcaaacttc tcgacttgag 480atacagctgc tggagaattc attatccacc tacaagctag agaagcaact tcttcaacag 540acaaatgaaa tcttgaagat ccatgaaaaa aacagtttat tagaacataa aatcttagaa 600atggaaggaa aacacaagga agagttggac accttaaagg aagagaaaga gaaccttcaa 660ggcttggtta ctcgtcaaac atatataatc caggagctgg aaaagcaatt aaacagagct 720accaccaaca acagtgtcct tcagaagcag caactggagc tgatggacac agtccacaac 780cttgtcaatc tttgcactaa gaagttttac taaagggagg aaaaagagag gaagagaaac 840catttagaga ctgtgcagat gtatatcaag ctggttttaa taaaagtgga atctacacta 900tttatattaa taatatgcca gaacccaaaa aggtgttttg caatatggat gtcaatgggg 960gaggttggac tgtaatacaa catcgtgaag atggaagtct agatttccaa agaggctgga 1020aggaatataa aatgggtttt ggaaatccct ccggtgaata ttggctgggg aatgagttta 1080tttttgccat taccagtcag aggcagtaca tgctaagaat tgagttaatg gactgggaag 1140ggaaccgagc ctattcacag tatgacagat tccacatagg aaatgaaaag caaaactata 1200ggttgtattt aaaaggtcac actgggacag caggaaaaca gagcagcctg atcttacacg 1260gtgctgattt cagcactaaa gatgctgata atgacaactg tatgtgcaaa tgtgccctca 1320tgttaacagg aggatggtgg tttgatgctt gtggcccctc caatctaaat ggaatgttct 1380atactgcggg acaaaaccat ggaaaactga atgggataaa gtggcactac ttcaaagggc 1440ccagttactc cttacgttcc acaactatga tgattcgacc tttagatttt tga 149322269DNAHomo sapienstarget sequence 2tgggttggtg tttatctcct cccagccttg agggagggaa caacactgta ggatctgggg 60agagaggaac aaaggaccgt gaaagctgct ctgtaaaagc tgacacagcc ctcccaagtg 120agcaggactg ttcttcccac tgcaatctga cagtttactg catgcctgga gagaacacag 180cagtaaaaac caggtttgct actggaaaaa gaggaaagag aagactttca ttgacggacc 240cagccatggc agcgtagcag ccctgcgttt cagacggcag cagctcggga ctctggacgt 300gtgtttgccc tcaagtttgc taagctgctg gtttattact gaagaaagaa tgtggcagat 360tgttttcttt actctgagct gtgatcttgt cttggccgca gcctataaca actttcggaa 420gagcatggac agcataggaa agaagcaata tcaggtccag catgggtcct gcagctacac 480tttcctcctg ccagagatgg acaactgccg ctcttcctcc agcccctacg tgtccaatgc 540tgtgcagagg gacgcgccgc tcgaatacga tgactcggtg cagaggctgc aagtgctgga 600gaacatcatg gaaaacaaca ctcagtggct aatgaagctt gagaattata tccaggacaa 660catgaagaaa gaaatggtag agatacagca gaatgcagta cagaaccaga cggctgtgat 720gatagaaata gggacaaacc tgttgaacca aacagctgag caaacgcgga agttaactga 780tgtggaagcc caagtattaa atcagaccac gagacttgaa cttcagctct tggaacactc 840cctctcgaca aacaaattgg aaaaacagat tttggaccag accagtgaaa taaacaaatt 900gcaagataag aacagtttcc tagaaaagaa ggtgctagct atggaagaca agcacatcat 960ccaactacag tcaataaaag aagagaaaga tcagctacag gtgttagtat ccaagcaaaa 1020ttccatcatt gaagaactag aaaaaaaaat agtgactgcc acggtgaata attcagttct 1080tcaaaagcag caacatgatc tcatggagac agttaataac ttactgacta tgatgtccac 1140atcaaactca gctaaggacc ccactgttgc taaagaagaa caaatcagct tcagagactg 1200tgctgaagta ttcaaatcag gacacaccac aaatggcatc tacacgttaa cattccctaa 1260ttctacagaa gagatcaagg cctactgtga catggaagct ggaggaggcg ggtggacaat 1320tattcagcga cgtgaggatg gcagcgttga ttttcagagg acttggaaag aatataaagt 1380gggatttggt aacccttcag gagaatattg gctgggaaat gagtttgttt cgcaactgac 1440taatcagcaa cgctatgtgc ttaaaataca ccttaaagac tgggaaggga atgaggctta 1500ctcattgtat gaacatttct atctctcaag tgaagaactc aattatagga ttcaccttaa 1560aggacttaca gggacagccg gcaaaataag cagcatcagc caaccaggaa atgattttag 1620cacaaaggat ggagacaacg acaaatgtat ttgcaaatgt tcacaaatgc taacaggagg 1680ctggtggttt gatgcatgtg gtccttccaa cttgaacgga atgtactatc cacagaggca 1740gaacacaaat aagttcaacg gcattaaatg gtactactgg aaaggctcag gctattcgct 1800caaggccaca accatgatga tccgaccagc agatttctaa acatcccagt ccacctgagg 1860aactgtctcg aactattttc aaagacttaa gcccagtgca ctgaaagtca cggctgcgca 1920ctgtgtcctc ttccaccaca gagggcgtgt gctcggtgct gacgggaccc acatgctcca 1980gattagagcc tgtaaacttt atcacttaaa cttgcatcac ttaacggacc aaagcaagac 2040cctaaacatc cataattgtg attagacaga acacctatgc aaagatgaac ccgaggctga 2100gaatcagact gacagtttac agacgctgct gtcacaacca agaatgttat gtgcaagttt 2160atcagtaaat aactggaaaa cagaacactt atgttataca atacagatca tcttggaact 2220gcattcttct gagcactgtt tatacactgt gtaaataccc atatgtcct 226934138DNAHomo sapiens 3cttctgtgct gttccttctt gcctctaact tgtaaacaag acgtactagg acgatgctaa 60tggaaagtca caaaccgctg ggtttttgaa aggatccttg ggacctcatg cacatttgtg 120gaaactggat ggagagattt ggggaagcat ggactcttta gccagcttag ttctctgtgg 180agtcagcttg ctcctttctg gaactgtgga aggtgccatg gacttgatct tgatcaattc 240cctacctctt gtatctgatg ctgaaacatc tctcacctgc attgcctctg ggtggcgccc 300ccatgagccc atcaccatag gaagggactt tgaagcctta atgaaccagc accaggatcc 360gctggaagtt actcaagatg tgaccagaga atgggctaaa aaagttgttt ggaagagaga 420aaaggctagt aagatcaatg gtgcttattt ctgtgaaggg cgagttcgag gagaggcaat 480caggatacga accatgaaga tgcgtcaaca agcttccttc ctaccagcta ctttaactat 540gactgtggac aagggagata acgtgaacat atctttcaaa aaggtattga ttaaagaaga 600agatgcagtg atttacaaaa atggttcctt catccattca gtgccccggc atgaagtacc 660tgatattcta gaagtacacc tgcctcatgc tcagccccag gatgctggag tgtactcggc 720caggtatata ggaggaaacc tcttcacctc ggccttcacc aggctgatag tccggagatg 780tgaagcccag aagtggggac ctgaatgcaa ccatctctgt actgcttgta tgaacaatgg 840tgtctgccat gaagatactg gagaatgcat ttgccctcct gggtttatgg gaaggacgtg 900tgagaaggct tgtgaactgc acacgtttgg cagaacttgt aaagaaaggt gcagtggaca 960agagggatgc aagtcttatg tgttctgtct ccctgacccc tatgggtgtt cctgtgccac 1020aggctggaag ggtctgcagt gcaatgaagc atgccaccct ggtttttacg ggccagattg 1080taagcttagg tgcagctgca acaatgggga gatgtgtgat cgcttccaag gatgtctctg 1140ctctccagga tggcaggggc tccagtgtga gagagaaggc ataccgagga tgaccccaaa 1200gatagtggat ttgccagatc atatagaagt aaacagtggt aaatttaatc ccatttgcaa 1260agcttctggc tggccgctac ctactaatga agaaatgacc ctggtgaagc cggatgggac 1320agtgctccat ccaaaagact ttaaccatac ggatcatttc tcagtagcca tattcaccat 1380ccaccggatc ctcccccctg actcaggagt ttgggtctgc agtgtgaaca cagtggctgg 1440gatggtggaa aagcccttca acatttctgt taaagttctt ccaaagcccc tgaatgcccc 1500aaacgtgatt gacactggac ataactttgc tgtcatcaac atcagctctg agccttactt 1560tggggatgga ccaatcaaat ccaagaagct tctatacaaa cccgttaatc actatgaggc 1620ttggcaacat attcaagtga caaatgagat tgttacactc aactatttgg aacctcggac 1680agaatatgaa ctctgtgtgc aactggtccg tcgtggagag ggtggggaag ggcatcctgg 1740acctgtgaga cgcttcacaa cagcttctat cggactccct cctccaagag gtctaaatct 1800cctgcctaaa agtcagacca ctctaaattt gacctggcaa ccaatatttc caagctcgga 1860agatgacttt tatgttgaag tggagagaag gtctgtgcaa aaaagtgatc agcagaatat 1920taaagttcca ggcaacttga cttcggtgct acttaacaac ttacatccca gggagcagta 1980cgtggtccga gctagagtca acaccaaggc ccagggggaa tggagtgaag atctcactgc 2040ttggaccctt agtgacattc ttcctcctca accagaaaac atcaagattt ccaacattac 2100acactcctcg gctgtgattt cttggacaat attggatggc tattctattt cttctattac 2160tatccgttac aaggttcaag gcaagaatga agaccagcac gttgatgtga agataaagaa 2220tgccaccatc attcagtatc agctcaaggg cctagagcct gaaacagcat accaggtgga 2280catttttgca gagaacaaca tagggtcaag caacccagcc ttttctcatg aactggtgac 2340cctcccagaa tctcaagcac cagcggacct cggagggggg aagatgctgc ttatagccat 2400ccttggctct gctggaatga cctgcctgac tgtgctgttg gcctttctga tcatattgca 2460attgaagagg gcaaatgtgc aaaggagaat ggcccaagcc ttccaaaacg tgagggaaga 2520accagctgtg cagttcaact cagggactct ggccctaaac aggaaggtca aaaacaaccc 2580agatcctaca atttatccag tgcttgactg gaatgacatc aaatttcaag atgtgattgg 2640ggagggcaat tttggccaag ttcttaaggc gcgcatcaag aaggatgggt tacggatgga 2700tgctgccatc aaaagaatga aagaatatgc ctccaaagat gatcacaggg actttgcagg 2760agaactggaa gttctttgta aacttggaca ccatccaaac atcatcaatc tcttaggagc 2820atgtgaacat cgaggctact tgtacctggc cattgagtac gcgccccatg gaaaccttct 2880ggacttcctt cgcaagagcc gtgtgctgga gacggaccca gcatttgcca ttgccaatag 2940caccgcgtcc acactgtcct cccagcagct ccttcacttc gctgccgacg tggcccgggg 3000catggactac ttgagccaaa aacagtttat ccacagggat ctggctgcca gaaacatttt 3060agttggtgaa aactatgtgg caaaaatagc agattttgga ttgtcccgag gtcaagaggt 3120gtacgtgaaa aagacaatgg gaaggctccc agtgcgctgg atggccatcg agtcactgaa 3180ttacagtgtg tacacaacca acagtgatgt atggtcctat ggtgtgttac tatgggagat 3240tgttagctta ggaggcacac cctactgcgg gatgacttgt gcagaactct acgagaagct 3300gccccagggc tacagactgg agaagcccct gaactgtgat gatgaggtgt atgatctaat 3360gagacaatgc tggcgggaga agccttatga gaggccatca tttgcccaga tattggtgtc 3420cttaaacaga atgttagagg agcgaaagac ctacgtgaat accacgcttt atgagaagtt 3480tacttatgca ggaattgact gttctgctga agaagcggcc taggacagaa catctgtata 3540ccctctgttt ccctttcact ggcatgggag acccttgaca actgctgaga aaacatgcct 3600ctgccaaagg atgtgatata taagtgtaca tatgtgctgg aattctaaca agtcataggt 3660taatatttaa gacactgaaa aatctaagtg atataaatca gattcttctc tctcatttta 3720tccctcacct gtagcatgcc agtcccgttt catttagtca tgtgaccact ctgtcttgtg 3780tttccacagc ctgcaagttc agtccaggat gctaacatct aaaaatagac ttaaatctca 3840ttgcttacaa gcctaagaat ctttagagaa gtatacataa gtttaggata aaataatggg 3900attttctttt cttttctctg gtaatattga cttgtatatt ttaagaaata acagaaagcc 3960tgggtgacat ttgggagaca tgtgacattt atatattgaa ttaatatccc tacatgtatt 4020gcacattgta aaaagtttta gttttgatga gttgtgagtt taccttgtat actgtaggca 4080cactttgcac tgatatatca tgagtgaata aatgtcttgc ctactcaaaa aaaaaaaa 41384159DNACanis familiaris 4aggaggaagt ctagattttc caagaggttg gaaagaatat aaaatgggtt ttggaaatcc 60ctctggtgaa tattggctgg ggaatgagtt tatttttgcc attaccagtc agaggcagta 120cacactaaga attgagttaa tggactggga aggaaaccc 15952424DNAMus musculusmisc_feature2308n = a, g, c or t 5ggctgctcct tcctctcagg acagctccga gtgtgccggg gagaagagaa gagaagagac 60aggcactggg aaagagcctg ctgcgggacg gagaaggctc tcactgatgg acttattcac 120acggcacagc cctgtgcctt agacagcagc tgagagctca ggacgcaagt ttgctgaact 180cacagtttag aacccaaaaa gagagagaga atgtggcaga tcattttcct aacttttggc 240tgggatcttg tcttggcctc agcctacagt aactttagga agagcgtgga cagcacaggc 300agaaggcagt accaggtcca gaacggaccc tgcagctaca cgttcctgct gccggagacc 360gacagctgcc gatcttcctc cagcccctac atgtccaatg ccgtgcagag ggatgcaccc 420ctcgactacg acgactcagt gcaaaggctg caggtgctgg agaacattct agagaacaac 480acacagtggc tgatgaagct ggagaattac attcaggaca acatgaagaa ggagatggtg 540gagatccaac agaatgtggt gcagaaccag acagctgtga tgatagagat tggaaccagc 600ttgctgaacc agacagcagc acaaactcgg aaactgactg atgtggaagc ccaagtacta 660aaccagacga caagactcga gctgcagctt ctccaacatt ctatttctac caacaaattg 720gaaaagcaga ttttggatca gaccagtgaa ataaacaagc tacaaaataa gaacagcttc 780ctagaacaga aagttctgga catggagggc aagcacagcg agcagctaca gtccatgaag 840gagcagaagg acgagctcca ggtgctggtg tccaagcaga gctctgtcat tgacgagctg 900gagaagaagc tggtgacagc cacggtcaac aactcgctcc ttcagaagca gcagcatgac 960ctaatggaga ccgtcaacag cttgctgacc atgatgtcat cacccaactc caagagctcg 1020gttgctatcc gtaaagaaga gcaaaccacc ttcagagact gtgcggaaat cttcaagtca 1080ggactcacca ccagtggcat ctacacactg accttcccca actccacaga ggagatcaag 1140gcctactgtg acatggacgt gggtggagga gggtggacag tcatccaaca ccgagaagat 1200ggcagtgtgg acttccagag gacgtggaaa gaatacaaag agggcttcgg gaaccctctg 1260ggagagtact ggctgggcaa tgagtttgtc tcccagctga ccggtcagca ccgctacgtg 1320cttaagatcc agctgaagga ctgggaaggc aacgaggcgc attcgctgta tgatcacttc 1380tacctcgctg gtgaagagtc caactacagg attcacctta caggactcac ggggaccgcg 1440gccaaaataa gtagcatcag ccaaccagga agtgatttta gcacaaagga ttcggacaat 1500gacaaatgca tctgcaagtg ttcccagatg ctctcaggag gctggtggtt tgacgcatgt 1560ggtccttcca acttgaatgg acagtactac ccacaaaaac agaatacaaa taagtttaac 1620ggtatcaagt ggtactactg gaaggggtcc ggctactcgc tcaaggccac aaccatgatg 1680atccggccag cagatttcta aatgcctgcc tacactacca gaagaacttg ctgcatccaa 1740agattaactc caaggcactg agagacacca gtgcatagca gcccctttcc acatcaggaa 1800gtgctcctgg gggtggggag ggtctgtgtg taccagactg aagcgcatca cttaagcctg 1860caccgctaac caaccaaagg cactgcagtc tggagaaaca cttctgggaa ggttgtggct 1920gaggatcaga aggacagcgt gcagactctg tcacaaggaa gaatgttccg tgggagttca 1980gcagtaaata actggaaaac agaacactta gatggtgcag ataaatcttg ggaccacatt 2040cctctaagca cggtttctag agtgaataca ttcacagctc ggctgtcaca atgacaaggc 2100cgtgtcctcg cactgtggca gccagtatcc agggacttct aagtggtggg cacaggctat 2160catctggaga agcacacatt cattgttttc ctcttgggtg cttaacatgt tcatttgaaa 2220acaacacatt tacctatctt gatggcttag tttttaatgg ctggctacta tttactatat 2280ggcaaaaatg cccacatctc tggaatancc accaaataag cgccatgttg gtgaatgcgg 2340aggctgtact attttgtttt cttcctggct ggtaaatatg aaggtatttt tagtaattaa 2400atataagtta ttagttgaaa gacc 242464676DNAMus musculus 6ccacgcgtcc gagcaggagc cggagcagga gcagaagata agccttggat gaagggcaag 60atggataggg ctcgctctgc cccaagccct gctgatacca agtgccttta agatacagcc 120tttcccatcc taatctgcaa aggaaacagg aaaaaggaac ttaaccctcc ctgtgctcag 180acagaaatga gactgttacc gcctgcttct gtggtgtttc tccttgccgc caacttgtaa 240acaagagcga gtggaccatg cgagcgggaa gtcgcaaagt tgtgagttgt tgaaagcttc 300ccagggactc atgctcatct gtggacgctg gatggggaga tctggggaag tatggactct 360ttagccggct tagttctctg tggagtcagc ttgctccttt atggagtagt agaaggtgcc 420atggacctga tcttgatcaa ttccctacct cttgtgtctg atgccgaaac atccctcacc 480tgcattgcct ctgggtggca cccccatgag cccatcacca taggaaggga ctttgaagcc 540ttaatgaacc agcaccaaga tccactggag gttactcaag atgtgaccag agaatgggcg 600aaaaaagttg tttggaagag agaaaaggcc agtaagatta atggtgctta tttctgtgaa 660ggtcgagttc gaggacaggc tataaggata cggaccatga agatgcgtca acaagcgtcc 720ttcctacctg ctactttaac tatgaccgtg gacaggggag ataatgtgaa catatctttc 780aaaaaggtgt taattaaaga agaagatgca gtgatttaca aaaatggctc ccttcatcca 840ctcagtgccc ccggcatgaa gtaccttgat attttagaag ttcacttgcc gcatgctcag 900ccccaggatg ctggtgtgta ctcggccagg tacataggag gaaacctgtt cacctcagcc 960ttcaccaggc tgattgttcg gagatgtgaa gctcagaagt gggggcccga ctgtagccgt 1020ccttgtacta cttgcaagaa caatggagtc tgccatgaag ataccgggga atgcatttgc 1080cctcctgggt ttatggggag aacatgtgag aaagcttgtg agccgcacac atttggcagg 1140acctgtaaag aaaggtgtag tggaccagaa ggatgcaagt cttatgtgtt ctgtctccca 1200gacccttacg ggtgttcctg tgccacaggc tggagggggt tgcagtgcaa tgaagcatgc 1260ccatctggtt actacggacc agactgtaag ctcaggtgcc actgtaccaa tgaagagata 1320tgtgatcggt tccaaggatg cctctgctct caaggatggc aagggctgca gtgtgagaaa 1380gaaggcaggc caaggatgac tccacagata gaggatttgc cagatcacat tgaagtaaac 1440agtggaaaat ttaaccccat ctgcaaagcc tctgggtggc cactacctac tagtgaagaa 1500atgaccctag tgaagccaga tgggacagtg ctccaaccaa atgacttcaa ctatacagat 1560cgtttctcag tggccatatt cactgtcaac cgagtcttac ctcctgactc aggagtctgg 1620gtctgcagtg tgaacacagt ggctgggatg gtggaaaagc ctttcaacat ttccgtcaaa 1680gttcttccag agcccctgca cgccccaaat gtgattgaca ctggacataa ctttgctatc 1740atcaatatca gctctgagcc ttactttggg gatggaccca tcaaatccaa gaagcttttc 1800tataaacctg tcaatcaggc ctggaaatac attgaagtga cgaatgagat tttcactctc 1860aactacttgg agccgcggac tgactacgag ctgtgtgtgc agctggcccg tcctggagag 1920ggtggagaag ggcatcctgg gcctgtgaga cgatttacaa cagcgtctat cggactccct 1980cctccaagag gtctcagtct cctgccaaaa agccagacag ctctaaattt gacttggcaa 2040ccgatattta caaactcaga agatgaattt tatgtggaag tcgagaggcg atccctgcaa 2100acaacaagtg atcagcagaa catcaaagtg cctgggaacc tgacctcggt gctactgagc 2160aacttagtcc ccagggagca gtacacagtc cgagctagag tcaacaccaa ggcgcagggg 2220gagtggagtg aagaactcag ggcctggacc cttagtgaca ttctccctcc tcaaccagaa 2280aacatcaaga tctccaacat cactgactcc acagctatgg tttcttggac aatagtggat 2340ggctattcga tttcttccat catcatccgg tataaggttc agggcaaaaa tgaagaccag 2400cacattgatg tgaagatcaa gaatgctacc gttactcagt accagctcaa gggcctagag 2460ccagagacta cataccatgt ggatattttt gctgagaaca acataggatc aagcaaccca 2520gccttttctc atgaactgag gacgcttcca cattccccag cctctgcaga cctcggaggg 2580gggaaagatg ctactcatag ccatccttgg gtcggctgga atgactttgc atcaccgtgc 2640ttgttggcgt ttctgattat gttgcaactg aagagagcaa atgtccaaag gagaatggct 2700caggcattcc agaacgtgag agaagaacca gctgtgcagt ttaactcagg aactctggcc 2760cttaacagga aggccaaaaa caatccggat cccacaattt atcctgtgct tgactggaat 2820gacatcaagt ttcaagacgt gatcggagag ggcaactttg gccaggttct gaaggcacgc 2880atcaagaagg atgggttacg gatggatgcc gccatcaaga ggatgaaaga gtatgcctcc 2940aaagatgatc acagggactt cgcaggagaa ctggaggttc tttgtaaact tggacaccat 3000ccaaacatca tcaatctctt gggagcatgt gaacaccgag gctatttgta cctagctatt 3060gagtatgccc cgcatggaaa cctcctggac ttcctgggta agagcagagt gctagagaca 3120gaccctgctt tttgccatcg ccaacagtac agttccacac tgtcctccca acagcttctt 3180cattttgctg cagatgtggc ccgggggatg gactacttga gccagaaaca gtttatccac 3240agggacctgg ctgccagaaa cattttagtt ggtgaaaact acatagccaa aatagcagat 3300tttggattgt cacgaggtca agaagtgtat gtgaaaaaga caatgggaag gctcccagtg 3360cgttggatgg caatcgaatc actgaactat agtgtctata caaccaacag tgatgtctgg 3420tcctatggtg tattgctctg ggagattgtt agcttaggag gcacccccta ctgcggcatg 3480acgtgcgcgg agctctatga gaagctaccc cagggctaca ggctggagaa gcccctgaac 3540tgtgatgatg aggtgtatga tctaatgaga cagtgctgga gggagaagcc ttatgagaga 3600ccatcatttg cccagatatt ggtgtcctta aacaggatgc tggaagaacg gaagacatac 3660gtgaacacca cactgtatga gaagtttacc tatgcaggaa ttgactgccc tgcggaagaa 3720gcagcctaga gcagaactct tcatgtacaa cggccatttc tcctcactgg cgcgagacct 3780ttgtacacct gtaccaagca agccacccac tgccaagaga tgtgatatat aagtttatat 3840attgtgctgt gtttgggacc ctcctcatac agttcgtgcg gatctgcagt gtgttctgac 3900tctaatgtga ctgtatatac tgctcggagt aagaatgtgc taagatcaga atgcctgtcc 3960gtggtttcat ctaatatatt ttcctaaaag catagattgc acaggaaggt atgagtacaa 4020atactgtaat gcataacttg ttattgtcct agatgtgttt gatattttcg ctttacaact 4080gaatgctata aaagtgtttt gctgtgtaca cataagatac tgttcgttaa aataagcatt 4140cccttgacag cacaggaaga aaagcgaggg aaatgtatgg attatattaa atgtgggtta 4200ctacacaaga ggccgaacat tccaagtagc agaagagagg gtctctcaac tctgctcctc 4260acctgcagaa gccagtttgt ttggccatgt gacaattgtc ctgtgttttt atagcaccca

4320aatcattcta aaatatgaac atctaaaaac tttgctagga gactaagaac ctttggagag 4380atagatataa gtacggtcaa aaaacaaaac tgcgggactt acatttattt tctatagtaa 4440tctgttgtac attttaagga ggtaaactag gatttaggag tgatgtgtga catttctgcc 4500atggagttac catccccaca tgtatcacat actgcatatt cccacatgta tcacacatgt 4560attgtaaaat tttgtagttt tgatcacttg tgaatttact gttgatgtgg tagccacctg 4620ctgcaatggt tcctcttgta ggtgaataaa tgtcttgtct acccacaaaa aaaaaa 467672135DNARattus norvegicus 7agcccctgca tgccccaaat gttattgaca ctggacacaa ctttgctatc atcaacatca 60gctctgagcc ttactttggg gatggaccga tcaaatccaa gaagctcttc tataaacctg 120tcaatcaggc ttggaaatac attcaagtga tgaatgagat tgtcacactc aactacctgg 180agcctcggac tgactacgag ctgtgtgtac agctggtccg tcctggagag ggtggagaag 240gacatcctgg acctgtgaga agattcacaa cagcgtctat cggactccct cctccaagag 300gtctcagtct cctacccaaa agccagacag ctctgaattt gacttggcaa ccgatattta 360caagctcaga agatgaattt tatgtggaag ttgagaggtg gtcccagcaa acaagaagtg 420atcagcagaa catcaaagtg cctgggaacc tgacttccgt gctgctgaac aacttactcc 480ccagggagca gtacagcgtc cgagctagag tcaacaccaa ggcccagggg gagtggagtg 540aagaactcag ggcctggacc cttagtgaca aaaacatcaa gatcaccaac atcactgatt 600acacagctct ggtttcttgg acaatcgtgg acggctattc gatttcttcc atcatcatcc 660ggtataaggt tcagggcaaa aatgaagacc agcacattga cgtgaagatc aagaatgcca 720ccatcactca ataccagctc aagggcctag agccagagac tacataccat gtggatattt 780ttgctgagaa caacatagga tcaagcaacc cagccttttc ccaagaaatt aggacacttc 840cagcccctaa agaccttgga gggggaaaga tgctacttat agccattctt gggtcggctg 900gaatgacttg catcaccgtg ctattggcgt ttctgattat gttgcaactg aagagagcaa 960atgtccaaag aagaatggcc caggccttcc agaacgtgag agaagaacca gctgttcagt 1020tcaactcagg aactctggcc ctaaacagga aggccaaaaa caatccggat cccacaattt 1080atcctgtgct tgactggaat gacatcaagt tccaagatgt gattggagag ggcaactttg 1140gccaggttct gaaggcgcgc atcaagaagg atgggttacg gatggacgct gccatcaaga 1200ggatgaaagg tttggaggac agcatttgct ggggtgggga gacaccgctt cctgttgaaa 1260tcttccgttt gtggccatat attcttcaaa ccagatgtga agaagcaaca ttacaactct 1320tggcctttct tccagaatat gcctccaaag atgatcacag ggactttgca ggagaactgg 1380aggttctttg taaacttgga caccatccga acatcattaa tctcttggga gcatgtgaac 1440acagaggcta cttatacctg gctattgagt atgccccaca tggaaacctc ctggactttc 1500tgcgtaagag ccgagtgcta gagacagacc ctgcctttgc catcgccaac agcacggctt 1560ccacactgtc ctcccagcag cttcttcatt ttgctgcaga tgtggcccgg gggatggact 1620acttgagcca aaaacagttt atccacaggg acctggctgc cagaaacatt ttagttggcg 1680aaaactacat agccaaaata gcagattttg gattgtcacg aggtcaagaa gtgtatgtga 1740aaaagacaat gggaaggctc ccagtgcgct ggatggcaat tgagtctctg aactatagtg 1800tctatacaac caacagtgat gtatggtcct atggtgtatt gctctgggag atcgttagct 1860taggaggcac tccatactgc ggcatgacat gtgcagaact ctatgagaag ctgccccagg 1920gctacagatt ggagaagccc ctgaactgtg atgatgaggt gtatgatcta atgagacaat 1980gctggaggga gaagccttat gagagaccat catttgccca gatattggtg tccttaaaca 2040gaatgctgga agaacgaaag acatacgtga acaccacact ttatgagaag tttacctacg 2100caggaattga ctgttctgct gaagaagcag cctag 213581497DNAHomo sapiens 8atgacagttt tcctttcctt tgctttcctc gctgccattc tgactcacat agggtgcagc 60aatcagcgcc gaagtccaga aaacagtggg agaagatata accggattca acatgggcaa 120tgtgcctaca ctttcattct tccagaacac gatggcaact gtcgtgagag tacgacagac 180cagtacaaca caaacgctct gcagagagat gctccacacg tggaaccgga tttctcttcc 240cagaaacttc aacatctgga acatgtgatg gaaaattata ctcagtggct gcaaaaactt 300gagaattaca ttgtggaaaa catgaagtcg gagatggccc agatacagca gaatgcagtt 360cagaaccaca cggctaccat gctggagata ggaaccagcc tcctctctca gactgcagag 420cagaccagaa agctgacaga tgttgagacc caggtactaa atcaaacttc tcgacttgag 480atacagctgc tggagaattc attatccacc tacaagctag agaagcaact tcttcaacag 540acaaatgaaa tcttgaagat ccatgaaaaa aacagtttat tagaacataa aatcttagaa 600atggaaggaa aacacaagga agagttggac accttaaagg aagagaaaga gaaccttcaa 660ggcttggtta ctcgtcaaac atatataatc caggagctgg aaaagcaatt aaacagagct 720accaccaaca acagtgtcct tcagaagcag caactggagc tgatggacac agtccacaac 780cttgtcaatc tttgcactaa agaaggtgtt ttactaaagg gaggaaaaag agaggaagag 840aaaccattta gagactgtgc agatgtatat caagctggtt ttaataaaag tggaatctac 900actatttata ttaataatat gccagaaccc aaaaaggtgt tttgcaatat ggatgtcaat 960gggggaggtt ggactgtaat acaacatcgt gaagatggaa gtctagattt ccaaagaggc 1020tggaaggaat ataaaatggg ttttggaaat ccctccggtg aatattggct ggggaatgag 1080tttatttttg ccattaccag tcagaggcag tacatgctaa gaattgagtt aatggactgg 1140gaagggaacc gagcctattc acagtatgac agattccaca taggaaatga aaagcaaaac 1200tataggttgt atttaaaagg tcacactggg acagcaggaa aacagagcag cctgatctta 1260cacggtgctg atttcagcac taaagatgct gataatgaca actgtatgtg caaatgtgcc 1320ctcatgttaa caggaggatg gtggtttgat gcttgtggcc cctccaatct aaatggaatg 1380ttctatactg cgggacaaaa ccatggaaaa ctgaatggga taaagtggca ctacttcaaa 1440gggcccagtt actccttacg ttccacaact atgatgattc gacctttaga tttttga 149791376DNAHomo sapiens 9ggtttattac tgaagaaaga atgtggcaga ttgttttctt tactctgagc tgtgatcttg 60tcttggccgc agcctataac aactttcgga agagcatgga cagcatagga aagaagcaat 120atcaggtcca gcatgggtcc tgcagctaca ctttcctcct gccagagatg gacaactgcc 180gctcttcctc cagcccctac gtgtccaatg ctgtgcagag ggacgcgccg ctcgaatacg 240atgactcggt gcagaggctg caagtgctgg agaacatcat ggaaaacaac actcagtggc 300taatgaaggt attaaatcag accacgagac ttgaacttca gctcttggaa cactccctct 360cgacaaacaa attggaaaaa cagattttgg accagaccag tgaaataaac aaattgcaag 420ataagaacag tttcctagaa aagaaggtgc tagctatgga agacaagcac atcatccaac 480tacagtcaat aaaagaagag aaagatcagc tacaggtgtt agtatccaag caaaattcca 540tcattgaaga actagaaaaa aaaatagtga ctgccacggt gaataattca gttcttcaaa 600agcagcaaca tgatctcatg gagacagtta ataacttact gactatgatg tccacatcaa 660actcagctaa ggaccccact gttgctaaag aagaacaaat cagcttcaga gactgtgctg 720aagtattcaa atcaggacac accacaaatg gcatctacac gttaacattc cctaattcta 780cagaagagat caaggcctac tgtgacatgg aagctggagg aggcgggtgg acaattattc 840agcgacgtga ggatggcagc gttgattttc agaggacttg gaaagaatat aaagtgggat 900ttggtaaccc ttcaggagaa tattggctgg gaaatgagtt tgtttcgcaa ctgactaatc 960agcaacgcta tgtgcttaaa atacacctta aagactggga agggaatgag gcttactcat 1020tgtatgaaca tttctatctc tcaagtgaag aactcaatta taggattcac cttaaaggac 1080ttacagggac agccggcaaa ataagcagca tcagccaacc aggaaatgat tttagcacaa 1140aggatggaga caacgacaaa tgtatttgca aatgttcaca aatgctaaca ggaggctggt 1200ggtttgatgc atgtggtcct tccaacttga acggaatgta ctatccacag aggcagaaca 1260caaataagtt caacggcatt aaatggtact actggaaagg ctcaggctat tcgctcaagg 1320ccacaaccat gatgatccga ccagcagatt tctaaacatc ccagtccacc tgagga 1376102578DNAHomo sapiens 10acatttgtgg aaactggatg gagagatttg gggaagcatg gactctttag ccagcttggt 60tctctgtgga gtcagcttgc tcctttctgg aactgtggaa ggtgccatgg actctttagc 120cagcttagtt ctctgtggag tcagcttgct cctttctgga actgtggaag gtgccatgga 180cttgatcttg atcaattccc tacctcttgt atctgatgct gaaacatctc tcacctgcat 240tgcctctggg tggcgccccc atgagcccat caccatagga agggactttg aagccttaat 300gaaccagcac caggatccgc tggaagttac tcaagatgtg accagagaat gggctaaaaa 360agttgtttgg aagagagaaa aggctagtaa gatcaatggt gcttatttct gtgaagggcg 420agttcgagga gaggcaatca ggatacgaac catgaagatg cgtcaacaag cttccttcct 480accagctact ttaactatga ctgtggacaa gggagataac gtgaacatat ctttcaaaaa 540ggtattgatt aaagaagaag atgcagtgat ttacaaaaat ggttccttca tccattcagt 600gccccggcat gaagtacctg atattctaga agtacacctg cctcatgctc agccccagga 660tgctggagtg tactcggcca ggtatatagg aggaaacctc ttcacctcgg ccttcaccag 720gctgatagtc cggagatgtg aagcccagaa gtggggacct gaatgcaacc atctctgtac 780tgcttgtatg aacaatggtg tctgccatga agatactgga gaatgcattt gccctcctgg 840gtttatggga aggacgtgtg agaaggcttg tgaactgcac acgtttggca gaacttgtaa 900agaaaggtgc agtggacaag agggatgcaa gtcttatgtg ttctgtctcc ctgaccccta 960tgggtgttcc tgtgccacag gctggaaggg tctgcagtgc aatgaaggca taccgaggat 1020gaccccaaag atagtggatt tgccagatca tatagaagta aacagtggta aatttaatcc 1080catttgcaaa gcttctggct ggccgctacc tactaatgaa gaaatgaccc tggtgaagcc 1140ggatgggaca gtgctccatc caaaagactt taaccatacg gatcatttct cagtagccat 1200attcaccatc caccggatcc tcccccctga ctcaggagtt tgggtctgca gtgtgaacac 1260agtggctggg atggtggaaa agcccttcaa catttctgtt aaagttcttc caaagcccct 1320gaatgcccca aacgtgattg acactggaca taactttgct gtcatcaaca tcagctctga 1380gccttacttt ggggatggac caatcaaatc caagaagctt ctatacaaac ccgttaatca 1440ctatgaggct tggcaacata ttcaagtgac aaatgagatt gttacactca actatttgga 1500acctcggaca gaatatgaac tctgtgtgca actggtccgt cgtggagagg gtggggaagg 1560gcatcctgga cctgtgagac gcttcacaac agcttctatc ggactccctc ctccaagagg 1620tctaaatctc ctgcctaaaa gtcagaccac tctaaatttg acctggcaac caatatttcc 1680aagctcggaa gatgactttt atgttgaagt ggagagaagg tctgtgcaaa aaagtgatca 1740gcagaatatt aaagttccag gcaacttgac ttcggtgcta cttaacaact tacatcccag 1800ggagcagtac gtggtccgag ctagagtcaa caccaaggcc cagggggaat ggagtgaaga 1860tctcactgct tggaccctta gtgacattct tcctcctcaa ccagaaaaca tcaagatttc 1920caacattaca cactcctcgg ctgtgatttc ttggacaata ttggatggct attctatttc 1980ttctattact atccgttaca aggttcaagg caagaatgaa gaccagcacg ttgatgtgaa 2040gataaagaat gccaccatca ttcagtatca gctcaagggc ctagagcctg aaacagcata 2100ccaggtggac atttttgcag agaacaacat agggtcaagc aacccagcct tttctcatga 2160actggtgacc ctcccagaat ctcaagcacc agcggacctc ggagggggga agatgctgct 2220tatagccatc cttggctctg ctggaatgac ctgcctgact gtgctgttgg cctttctgat 2280catattgcaa ttgaagaggg caaatgtgca aaggagaatg gcccaagcct tccaaaacgt 2340gagggaagaa ccagctgtgc agttcaactc agggactctg gccctaaaca ggaaggtcaa 2400aaacaaccca gatcctacaa tttatccagt gcttgactgg aatgacatca aatttcaaga 2460tgtgattggg gagggcaatt ttggccaagt tcttaaggcg cgcatcaaga aggatgggtt 2520acggatggat gctgccatca aaagaatgaa agaatatgcc tccaaagatg atcacagg 257811984DNAHomo sapiens 11atgaagaaac atcatcatca tcatcatggc aaaaacaacc cagatcctac aatttatcca 60gtgcttgact ggaatgacat caaatttcaa gatgtgattg gggagggcaa ttttggccaa 120gttcttaagg cgcgcatcaa gaaggatggg ttacggatgg atgctgccat caaaagaatg 180aaagaatatg cctccaaaga tgatcacagg gactttgcag gagaactgga agttctttgt 240aaacttggac accatccaaa catcatcaat ctcttaggag catgtgaaca tcgaggcttc 300ttgtacctgg ccattgagta cgcgccccat ggaaaccttc tggacttcct tcgcaagagc 360cgtgtgctgg agacggaccc agcatttgcc attgccaata gcaccgcgtc cacactgtcc 420tcccagcagc tccttcactt cgctgccgac gtggcccggg gcatggacta cttgagccaa 480aaacagttta tccacaggga tctggctgcc agaaacattt tagttggtga aaactatgtg 540gcaaaaatag cagattttgg attgtcccga ggtcaagagg tgtatgtgaa aaagacaatg 600ggaaggctcc cagtgcgctg gatggccatc gagtcactga attacagtgt gtacacaacc 660aacagtgatg tatggtccta tggtgtgtta ctatgggaga ttgttagctt aggaggcaca 720ccctactgcg gaatgacttg tgcagaactc ttcgagaagc tgccccaggg ctacagactg 780gagaagcccc tgaactgtga tgatgaggtg tatgatctaa tgagacaatg ctggcgggag 840aagccttatg agaggccatc atttgcccag atattggtgt ccttaaacag aatgttagag 900gagcgaaaga cctacgtgaa taccacgctt tatgagaagt ttacttatgc aggaattgac 960tgtgctgctg aagaagcggc ctag 9841221DNAArtificial SequenceAng2 target sequence 12aatgctgtgc agagggacgc g 211321RNAArtificial SequenceAng2 siRNA sense strand 13ugcugugcag agggacgcgu u 211421RNAArtificial SequenceAng2 siRNA antisense strand 14uuacgacacg ucucccugcg c 211521DNAArtificial SequenceAng2 siRNA sense strand 15ugcugugcag agggacgcgt t 211621DNAArtificial SequenceAng2 siRNA antisense strand 16ttacgacacg ucucccugcg c 211721DNAArtificial SequenceAng2 target sequence 17ttacgacacg ucucccugcg c 211821RNAArtificial SequenceAng2 siRNA sense strand 18guauuaaauc agaccacgau u 211921RNAArtificial SequenceAng2 siRNA antisense strand 19ucguggucug auuuaauacu u 212021DNAArtificial SequenceAng2 siRNA sense strand 20guauuaaauc agaccacgat t 212121DNAArtificial SequenceAng2 siRNA antisense strand 21ucguggucug auuuaauact t 212221DNAArtificial SequenceAng1 target sequence 22aatgcagttc agaaccacac g 212321RNAArtificial SequenceAng1siRNA sense strand 23ugcaguucag aaccacacgu u 212421RNAArtificial SequenceAng1 siRNA antisense strand 24uuacgucaag ucuuggugug c 212521DNAArtificial SequenceAng1 siRNA sense strand 25ugcaguucag aaccacacgt t 212621DNAArtificial SequenceAng1 siRNA antisense strand 26cgugugguuc ugaacugcat t 212721DNAArtificial SequenceAng1 target sequence 27cuucucgacu ugagauacau u 212821RNAArtificial SequenceAng1 siRNA sense strand 28cuucucgacu ugagauacau u 212921RNAArtificial SequenceAng1 siRNA antisense strand 29uguaucucaa gucgagaagu u 213021DNAArtificial SequenceAng1 siRNA sense strand 30cuucucgacu ugagauacat t 213121DNAArtificial SequenceAng1 siRNA antisense strand 31uguaucucaa gucgagaagt t 213221DNAArtificial Sequencetarget sequence 32aatcagcgcc gaagtccaga a 213321DNAArtificial Sequencetarget sequence 33aagtccagaa aacagtggga g 213421DNAArtificial Sequencetarget sequence 34aaaacagtgg gagaagatat a 213521DNAArtificial Sequencetarget sequence 35aaacagtggg agaagatata a 213621DNAArtificial Sequencetarget sequence 36aacagtggga gaagatataa c 213721DNAArtificial Sequencetarget sequence 37aagatataac cggattcaac a 213821DNAArtificial Sequencetarget sequence 38aaccggattc aacatgggca a 213921DNAArtificial Sequencetarget sequence 39aacatgggca atgtgcctac a 214021DNAArtificial Sequencetarget sequence 40aatgtgccta cactttcatt c 214121DNAArtificial Sequencetarget sequence 41aacacgatgg caactgtcgt g 214221DNAArtificial Sequencetarget sequence 42aactgtcgtg agagtacgac a 214321DNAArtificial Sequencetarget sequence 43aacacaaacg ctctgcagag a 214421DNAArtificial Sequencetarget sequence 44aaacgctctg cagagagatg c 214521DNAArtificial Sequencetarget sequence 45aacgctctgc agagagatgc t 214621DNAArtificial Sequencetarget sequence 46aaccggattt ctcttcccag a 214721DNAArtificial Sequencetarget sequence 47aaacttcaac atctggaaca t 214821DNAArtificial Sequencetarget sequence 48aacttcaaca tctggaacat g 214921DNAArtificial Sequencetarget sequence 49aacatctgga acatgtgatg g 215021DNAArtificial Sequencetarget sequence 50aacatgtgat ggaaaattat a 215121DNAArtificial Sequencetarget sequence 51aaaattatac tcagtggctg c 215221DNAArtificial Sequencetarget sequence 52aaattatact cagtggctgc a 215321DNAArtificial Sequencetarget sequence 53aattatactc agtggctgca a 215421DNAArtificial Sequencetarget sequence 54aaaaacttga gaattacatt g 215521DNAArtificial Sequencetarget sequence 55aaaacttgag aattacattg t 215621DNAArtificial Sequencetarget sequence 56aaacttgaga attacattgt g 215721DNAArtificial Sequencetarget sequence 57aacttgagaa ttacattgtg g 215821DNAArtificial Sequencetarget sequence 58aattacattg tggaaaacat g 215921DNAArtificial Sequencetarget sequence 59aaaacatgaa gtcggagatg g 216021DNAArtificial Sequencetarget sequence 60aaacatgaag tcggagatgg c 216121DNAArtificial Sequencetarget sequence 61aacatgaagt cggagatggc c 216221DNAArtificial Sequencetarget sequence 62aagtcggaga tggcccagat a 216321DNAArtificial Sequencetarget sequence 63aatgcagttc agaaccacac g 216421DNAArtificial Sequencetarget sequence 64aaccacacgg ctaccatgct g 216521DNAArtificial Sequencetarget sequence 65aaccagcctc ctctctcaga c 216621DNAArtificial Sequencetarget sequence 66aaagctgaca gatgttgaga c 216721DNAArtificial Sequencetarget sequence 67aagctgacag atgttgagac c 216821DNAArtificial Sequencetarget sequence 68aaatcaaact tctcgacttg a 216921DNAArtificial Sequencetarget sequence 69aatcaaactt ctcgacttga g

217021DNAArtificial Sequencetarget sequence 70aaacttctcg acttgagata c 217121DNAArtificial Sequencetarget sequence 71aacttctcga cttgagatac a 217221DNAArtificial Sequencetarget sequence 72aattcattat ccacctacaa g 217321DNAArtificial Sequencetarget sequence 73aagctagaga agcaacttct t 217421DNAArtificial Sequencetarget sequence 74aagcaacttc ttcaacagac a 217521DNAArtificial Sequencetarget sequence 75aacttcttca acagacaaat g 217621DNAArtificial Sequencetarget sequence 76aacagacaaa tgaaatcttg a 217721DNAArtificial Sequencetarget sequence 77aaatgaaatc ttgaagatcc a 217821DNAArtificial Sequencetarget sequence 78aatgaaatct tgaagatcca t 217920DNAArtificial Sequencetarget sequence 79aaatcttgaa gatccatgaa 208021DNAArtificial Sequencetarget sequence 80aatcttgaag atccatgaaa a 218121DNAArtificial Sequencetarget sequence 81aagatccatg aaaaaaacag t 218221DNAArtificial Sequencetarget sequence 82aaaaaaacag tttattagaa c 218321DNAArtificial Sequencetarget sequence 83aaaaaacagt ttattagaac a 218421DNAArtificial Sequencetarget sequence 84aaaaacagtt tattagaaca t 218521DNAArtificial Sequencetarget sequence 85aaaacagttt attagaacat a 218621DNAArtificial Sequencetarget sequence 86aaacagttta ttagaacata a 218721DNAArtificial Sequencetarget sequence 87aacagtttat tagaacataa a 218821DNAArtificial Sequencetarget sequence 88aacataaaat cttagaaatg g 218921DNAArtificial Sequencetarget sequence 89aaaatcttag aaatggaagg a 219021DNAArtificial Sequencetarget sequence 90aaatcttaga aatggaagga a 219121DNAArtificial Sequencetarget sequence 91aatcttagaa atggaaggaa a 219221DNAArtificial Sequencetarget sequence 92aaatggaagg aaaacacaag g 219321DNAArtificial Sequencetarget sequence 93aatggaagga aaacacaagg a 219421DNAArtificial Sequencetarget sequence 94aaggaaaaca caaggaagag t 219521DNAArtificial Sequencetarget sequence 95aaaacacaag gaagagttgg a 219621DNAArtificial Sequencetarget sequence 96aaacacaagg aagagttgga c 219721DNAArtificial Sequencetarget sequence 97aacacaagga agagttggac a 219821DNAArtificial Sequencetarget sequence 98aaggaagagt tggacacctt a 219921DNAArtificial Sequencetarget sequence 99aagagttgga caccttaaag g 2110021DNAArtificial Sequencetarget sequence 100aaaggaagag aaagagaacc t 2110121DNAArtificial Sequencetarget sequence 101aaggaagaga aagagaacct t 2110221DNAArtificial Sequencetarget sequence 102aagagaaaga gaaccttcaa g 2110321DNAArtificial Sequencetarget sequence 103aaagagaacc ttcaaggctt g 2110421DNAArtificial Sequencetarget sequence 104aagagaacct tcaaggcttg g 2110521DNAArtificial Sequencetarget sequence 105aaccttcaag gcttggttac t 2110621DNAArtificial Sequencetarget sequence 106aaggcttggt tactcgtcaa a 2110721DNAArtificial Sequencetarget sequence 107aaacatatat aatccaggag c 2110821DNAArtificial Sequencetarget sequence 108aacatatata atccaggagc t 2110921DNAArtificial Sequencetarget sequence 109aatccaggag ctggaaaagc a 2111021DNAArtificial Sequencetarget sequence 110aaaagcaatt aaacagagct a 2111121DNAArtificial Sequencetarget sequence 111aaagcaatta aacagagcta c 2111221DNAArtificial Sequencetarget sequence 112aagcaattaa acagagctac c 2111321DNAArtificial Sequencetarget sequence 113aattaaacag agctaccacc a 2111421DNAArtificial Sequencetarget sequence 114aaacagagct accaccaaca a 2111521DNAArtificial Sequencetarget sequence 115aacagagcta ccaccaacaa c 2111621DNAArtificial Sequencetarget sequence 116aacaacagtg tccttcagaa g 2111721DNAArtificial Sequencetarget sequence 117aacagtgtcc ttcagaagca g 2111821DNAArtificial Sequencetarget sequence 118aagcagcaac tggagctgat g 2111921DNAArtificial Sequencetarget sequence 119aactggagct gatggacaca g 2112021DNAArtificial Sequencetarget sequence 120aaccttgtca atctttgcac t 2112121DNAArtificial Sequencetarget sequence 121aatctttgca ctaaagaagg t 2112221DNAArtificial Sequencetarget sequence 122aaagaaggtg ttttactaaa g 2112321DNAArtificial Sequencetarget sequence 123aagaaggtgt tttactaaag g 2112421DNAArtificial Sequencetarget sequence 124aaggtgtttt actaaaggga g 2112521DNAArtificial Sequencetarget sequence 125aaagggagga aaaagagagg a 2112621DNAArtificial Sequencetarget sequence 126aagggaggaa aaagagagga a 2112721DNAArtificial Sequencetarget sequence 127aaaaagagag gaagagaaac c 2112821DNAArtificial Sequencetarget sequence 128aaaagagagg aagagaaacc a 2112921DNAArtificial Sequencetarget sequence 129aaagagagga agagaaacca t 2113021DNAArtificial Sequencetarget sequence 130aagagaggaa gagaaaccat t 2113121DNAArtificial Sequencetarget sequence 131aagagaaacc atttagagac t 2113221DNAArtificial Sequencetarget sequence 132aaaccattta gagactgtgc a 2113321DNAArtificial Sequencetarget sequence 133aaccatttag agactgtgca g 2113421DNAArtificial Sequencetarget sequence 134aagctggttt taataaaagt g 2113521DNAArtificial Sequencetarget sequence 135aataaaagtg gaatctacac t 2113621DNAArtificial Sequencetarget sequence 136aaaagtggaa tctacactat t 2113721DNAArtificial Sequencetarget sequence 137aaagtggaat ctacactatt t 2113821DNAArtificial Sequencetarget sequence 138aagtggaatc tacactattt a 2113921DNAArtificial Sequencetarget sequence 139aatctacact atttatatta a 2114021DNAArtificial Sequencetarget sequence 140aataatatgc cagaacccaa a 2114121DNAArtificial Sequencetarget sequence 141aatatgccag aacccaaaaa g 2114221DNAArtificial Sequencetarget sequence 142aacccaaaaa ggtgttttgc a 2114321DNAArtificial Sequencetarget sequence 143aaaaaggtgt tttgcaatat g 2114421DNAArtificial Sequencetarget sequence 144aaaaggtgtt ttgcaatatg g 2114521DNAArtificial Sequencetarget sequence 145aaaggtgttt tgcaatatgg a 2114621DNAArtificial Sequencetarget sequence 146aaggtgtttt gcaatatgga t 2114721DNAArtificial Sequencetarget sequence 147aatatggatg tcaatggggg a 2114821DNAArtificial Sequencetarget sequence 148aatgggggag gttggactgt a 2114921DNAArtificial Sequencetarget sequence 149aatacaacat cgtgaagatg g 2115021DNAArtificial Sequencetarget sequence 150aacatcgtga agatggaagt c 2115121DNAArtificial Sequencetarget sequence 151aagatggaag tctagatttc c 2115221DNAArtificial Sequencetarget sequence 152aagtctagat ttccaaagag g 2115321DNAArtificial Sequencetarget sequence 153aaagaggctg gaaggaatat a 2115421DNAArtificial Sequencetarget sequence 154aagaggctgg aaggaatata a 2115521DNAArtificial Sequencetarget sequence 155aaggaatata aaatgggttt t 2115621DNAArtificial Sequencetarget sequence 156aatataaaat gggttttgga a 2115720DNAArtificial Sequencetarget sequence 157aaaatgggtt ttggaaatcc 2015821DNAArtificial Sequencetarget sequence 158aaatgggttt tggaaatccc t 2115921DNAArtificial Sequencetarget sequence 159aatgggtttt ggaaatccct c 2116021DNAArtificial Sequencetarget sequence 160aaatccctcc ggtgaatatt g 2116121DNAArtificial Sequencetarget sequence 161aatccctccg gtgaatattg g 2116221DNAArtificial Sequencetarget sequence 162aatattggct ggggaatgag t 2116321DNAArtificial Sequencetarget sequence 163aatgagttta tttttgccat t 2116421DNAArtificial Sequencetarget sequence 164aagaattgag ttaatggact g 2116521DNAArtificial Sequencetarget sequence 165aattgagtta atggactggg a 2116621DNAArtificial Sequencetarget sequence 166aatggactgg gaagggaacc g 2116721DNAArtificial Sequencetarget sequence 167aagggaaccg agcctattca c 2116821DNAArtificial Sequencetarget sequence 168aaccgagcct attcacagta t 2116921DNAArtificial Sequencetarget sequence 169aaatgaaaag caaaactata g 2117021DNAArtificial Sequencetarget sequence 170aatgaaaagc aaaactatag g 2117121DNAArtificial Sequencetarget sequence 171aaaagcaaaa ctataggttg t 2117221DNAArtificial Sequencetarget sequence 172aaagcaaaac tataggttgt a 2117321DNAArtificial Sequencetarget sequence 173aagcaaaact ataggttgta t 2117421DNAArtificial Sequencetarget sequence 174aaaactatag gttgtattta a 2117521DNAArtificial Sequencetarget sequence 175aaactatagg ttgtatttaa a 2117621DNAArtificial Sequencetarget sequence 176aactataggt tgtatttaaa a 2117721DNAArtificial Sequencetarget sequence 177aaaaggtcac actgggacag c 2117821DNAArtificial Sequencetarget sequence 178aaaggtcaca ctgggacagc a 2117921DNAArtificial Sequencetarget sequence 179aaggtcacac tgggacagca g 2118021DNAArtificial Sequencetarget sequence 180aaaacagagc agcctgatct t 2118121DNAArtificial Sequencetarget sequence 181aaacagagca gcctgatctt a 2118221DNAArtificial Sequencetarget sequence 182aacagagcag cctgatctta c 2118321DNAArtificial Sequencetarget sequence 183aaagatgctg ataatgacaa c 2118421DNAArtificial Sequencetarget sequence 184aagatgctga taatgacaac t 2118521DNAArtificial Sequencetarget sequence 185aatgacaact gtatgtgcaa a 2118621DNAArtificial Sequencetarget sequence 186aactgtatgt gcaaatgtgc c 2118721DNAArtificial Sequencetarget sequence 187aaatgtgccc tcatgttaac a 2118821DNAArtificial Sequencetarget sequence 188aatgtgccct catgttaaca g 2118921DNAArtificial Sequencetarget sequence 189aacaggagga tggtggtttg a 2119021DNAArtificial Sequencetarget sequence 190aatctaaatg gaatgttcta t 2119121DNAArtificial Sequencetarget sequence 191aaatggaatg ttctatactg c 2119221DNAArtificial Sequencetarget sequence 192aatggaatgt tctatactgc g 2119321DNAArtificial Sequencetarget sequence 193aatgttctat actgcgggac a 2119421DNAArtificial Sequencetarget sequence 194aaaaccatgg aaaactgaat g 2119521DNAArtificial Sequencetarget sequence 195aaaccatgga aaactgaatg g 2119621DNAArtificial Sequencetarget sequence 196aaccatggaa aactgaatgg g 2119721DNAArtificial Sequencetarget sequence 197aaaactgaat gggataaagt g 2119821DNAArtificial Sequencetarget sequence 198aaactgaatg ggataaagtg g 2119921DNAArtificial Sequencetarget sequence 199aactgaatgg gataaagtgg c 2120021DNAArtificial Sequencetarget sequence 200aatgggataa agtggcacta c 2120121DNAArtificial Sequencetarget sequence 201aaagtggcac tacttcaaag g 2120221DNAArtificial Sequencetarget sequence 202aagtggcact acttcaaagg g 2120321DNAArtificial Sequencetarget sequence 203aaagggccca gttactcctt a 2120421DNAArtificial Sequencetarget sequence 204aagggcccag ttactcctta c 2120521DNAArtificial Sequencetarget sequence 205gaagtccaga aaacagtggg a 2120621DNAArtificial Sequencetarget sequence 206atggcaactg tcgtgagagt a 2120721DNAArtificial Sequencetarget sequence 207cgtggaaccg gatttctctt c 2120821DNAArtificial Sequencetarget sequence 208cattgtggaa aacatgaagt c 2120921DNAArtificial Sequencetarget sequence 209ttcagaacca cacggctacc a 2121021DNAArtificial Sequencetarget sequence 210tactaaatca aacttctcga c 2121121DNAArtificial Sequencetarget sequence 211cttcaacaga caaatgaaat c 2121221DNAArtificial Sequencetarget sequence 212gttggacacc ttaaaggaag a 2121321DNAArtificial Sequencetarget sequence 213agctaccacc aacaacagtg t 2121421DNAArtificial Sequencetarget sequence 214ggtgttttac taaagggagg a 2121521DNAArtificial Sequencetarget sequence 215tgtatatcaa gctggtttta a 2121621DNAArtificial Sequencetarget sequence 216ccaaaaaggt gttttgcaat a 2121721DNAArtificial Sequencetarget sequence 217gctggaagga atataaaatg g 2121821DNAArtificial Sequencetarget sequence 218tcagaggcag tacatgctaa g 2121921DNAArtificial Sequencetarget sequence 219acactgggac agcaggaaaa c 2122020DNAArtificial Sequencetarget sequence

220atttcagcac taaagatgct 2022122DNAArtificial Sequencetarget sequence 221gataatgaca actgtatgtg ca 2222219DNAArtificial Sequencetarget sequence 222tgtgccctca tgttaacag 1922318DNAArtificial Sequencetarget sequence 223aggatggtgg tttgatgc 1822419DNAArtificial Sequencetarget sequence 224tggcccctcc aatctaaat 1922522DNAArtificial Sequencetarget sequence 225aatgttctat actgcgggac aa 2222623DNAArtificial Sequencetarget sequence 226atggaaaact gaatgggata aag 2322724DNAArtificial Sequencetarget sequence 227aactgaatgg gataaagtgg cact 2422821DNAArtificial Sequencetarget sequence 228aacaactttc ggaagagcat g 2122921DNAArtificial Sequencetarget sequence 229aactttcgga agagcatgga c 2123021DNAArtificial Sequencetarget sequence 230aagagcatgg acagcatagg a 2123121DNAArtificial Sequencetarget sequence 231aaagaagcaa tatcaggtcc a 2123221DNAArtificial Sequencetarget sequence 232aagaagcaat atcaggtcca g 2123321DNAArtificial Sequencetarget sequence 233aagcaatatc aggtccagca t 2123421DNAArtificial Sequencetarget sequence 234aatatcaggt ccagcatggg t 2123521DNAArtificial Sequencetarget sequence 235aactgccgct cttcctccag c 2123621DNAArtificial Sequencetarget sequence 236aatgctgtgc agagggacgc g 2123721DNAArtificial Sequencetarget sequence 237aatacgatga ctcggtgcag a 2123821DNAArtificial Sequencetarget sequence 238aagtgctgga gaacatcatg g 2123921DNAArtificial Sequencetarget sequence 239aacatcatgg aaaacaacac t 2124021DNAArtificial Sequencetarget sequence 240aaaacaacac tcagtggcta a 2124121DNAArtificial Sequencetarget sequence 241aaacaacact cagtggctaa t 2124221DNAArtificial Sequencetarget sequence 242aacaacactc agtggctaat g 2124321DNAArtificial Sequencetarget sequence 243aacactcagt ggctaatgaa g 2124421DNAArtificial Sequencetarget sequence 244aatgaagctt gagaattata t 2124521DNAArtificial Sequencetarget sequence 245aagcttgaga attatatcca g 2124621DNAArtificial Sequencetarget sequence 246aattatatcc aggacaacat g 2124721DNAArtificial Sequencetarget sequence 247aacatgaaga aagaaatggt a 2124821DNAArtificial Sequencetarget sequence 248aagaaagaaa tggtagagat a 2124921DNAArtificial Sequencetarget sequence 249aaagaaatgg tagagataca g 2125021DNAArtificial Sequencetarget sequence 250aagaaatggt agagatacag c 2125121DNAArtificial Sequencetarget sequence 251aaatggtaga gatacagcag a 2125221DNAArtificial Sequencetarget sequence 252aatggtagag atacagcaga a 2125321DNAArtificial Sequencetarget sequence 253aatgcagtac agaaccagac g 2125421DNAArtificial Sequencetarget sequence 254aaccagacgg ctgtgatgat a 2125521DNAArtificial Sequencetarget sequence 255aaatagggac aaacctgttg a 2125621DNAArtificial Sequencetarget sequence 256aatagggaca aacctgttga a 2125721DNAArtificial Sequencetarget sequence 257aaacctgttg aaccaaacag c 2125821DNAArtificial Sequencetarget sequence 258aacctgttga accaaacagc t 2125921DNAArtificial Sequencetarget sequence 259aaccaaacag ctgagcaaac g 2126021DNAArtificial Sequencetarget sequence 260aaacagctga gcaaacgcgg a 2126121DNAArtificial Sequencetarget sequence 261aacagctgag caaacgcgga a 2126221DNAArtificial Sequencetarget sequence 262aaacgcggaa gttaactgat g 2126321DNAArtificial Sequencetarget sequence 263aacgcggaag ttaactgatg t 2126421DNAArtificial Sequencetarget sequence 264aagttaactg atgtggaagc c 2126521DNAArtificial Sequencetarget sequence 265aactgatgtg gaagcccaag t 2126621DNAArtificial Sequencetarget sequence 266aagcccaagt attaaatcag a 2126721DNAArtificial Sequencetarget sequence 267aagtattaaa tcagaccacg a 2126821DNAArtificial Sequencetarget sequence 268aaatcagacc acgagacttg a 2126921DNAArtificial Sequencetarget sequence 269aatcagacca cgagacttga a 2127021DNAArtificial Sequencetarget sequence 270aacttcagct cttggaacac t 2127121DNAArtificial Sequencetarget sequence 271aacactccct ctcgacaaac a 2127221DNAArtificial Sequencetarget sequence 272aaacaaattg gaaaaacaga t 2127321DNAArtificial Sequencetarget sequence 273aacaaattgg aaaaacagat t 2127421DNAArtificial Sequencetarget sequence 274aaattggaaa aacagatttt g 2127521DNAArtificial Sequencetarget sequence 275aattggaaaa acagattttg g 2127621DNAArtificial Sequencetarget sequence 276aaaaacagat tttggaccag a 2127721DNAArtificial Sequencetarget sequence 277aaaacagatt ttggaccaga c 2127821DNAArtificial Sequencetarget sequence 278aaacagattt tggaccagac c 2127921DNAArtificial Sequencetarget sequence 279aacagatttt ggaccagacc a 2128021DNAArtificial Sequencetarget sequence 280aaataaacaa attgcaagat a 2128121DNAArtificial Sequencetarget sequence 281aataaacaaa ttgcaagata a 2128221DNAArtificial Sequencetarget sequence 282aaacaaattg caagataaga a 2128321DNAArtificial Sequencetarget sequence 283aacaaattgc aagataagaa c 2128421DNAArtificial Sequencetarget sequence 284aaattgcaag ataagaacag t 2128521DNAArtificial Sequencetarget sequence 285aattgcaaga taagaacagt t 2128621DNAArtificial Sequencetarget sequence 286aagataagaa cagtttccta g 2128721DNAArtificial Sequencetarget sequence 287aagaacagtt tcctagaaaa g 2128821DNAArtificial Sequencetarget sequence 288aacagtttcc tagaaaagaa g 2128921DNAArtificial Sequencetarget sequence 289aaaagaaggt gctagctatg g 2129021DNAArtificial Sequencetarget sequence 290aaagaaggtg ctagctatgg a 2129121DNAArtificial Sequencetarget sequence 291aagaaggtgc tagctatgga a 2129221DNAArtificial Sequencetarget sequence 292aaggtgctag ctatggaaga c 2129321DNAArtificial Sequencetarget sequence 293aagacaagca catcatccaa c 2129421DNAArtificial Sequencetarget sequence 294aagcacatca tccaactaca g 2129521DNAArtificial Sequencetarget sequence 295aactacagtc aataaaagaa g 2129621DNAArtificial Sequencetarget sequence 296aataaaagaa gagaaagatc a 2129721DNAArtificial Sequencetarget sequence 297aaaagaagag aaagatcagc t 2129821DNAArtificial Sequencetarget sequence 298aaagaagaga aagatcagct a 2129921DNAArtificial Sequencetarget sequence 299aagaagagaa agatcagcta c 2130021DNAArtificial Sequencetarget sequence 300aagagaaaga tcagctacag g 2130121DNAArtificial Sequencetarget sequence 301aaagatcagc tacaggtgtt a 2130221DNAArtificial Sequencetarget sequence 302aagatcagct acaggtgtta g 2130321DNAArtificial Sequencetarget sequence 303aagcaaaatt ccatcattga a 2130421DNAArtificial Sequencetarget sequence 304aaaattccat cattgaagaa c 2130521DNAArtificial Sequencetarget sequence 305aaattccatc attgaagaac t 2130621DNAArtificial Sequencetarget sequence 306aattccatca ttgaagaact a 2130721DNAArtificial Sequencetarget sequence 307aagaactaga aaaaaaaata g 2130821DNAArtificial Sequencetarget sequence 308aactagaaaa aaaaatagtg a 2130921DNAArtificial Sequencetarget sequence 309aaaaaaaaat agtgactgcc a 2131021DNAArtificial Sequencetarget sequence 310aaaaaaaata gtgactgcca c 2131121DNAArtificial Sequencetarget sequence 311aaaaaaatag tgactgccac g 2131221DNAArtificial Sequencetarget sequence 312aaaaaatagt gactgccacg g 2131321DNAArtificial Sequencetarget sequence 313aaaaatagtg actgccacgg t 2131421DNAArtificial Sequencetarget sequence 314aaaatagtga ctgccacggt g 2131521DNAArtificial Sequencetarget sequence 315aaatagtgac tgccacggtg a 2131621DNAArtificial Sequencetarget sequence 316aatagtgact gccacggtga a 2131721DNAArtificial Sequencetarget sequence 317aataattcag ttcttcaaaa g 2131821DNAArtificial Sequencetarget sequence 318aattcagttc ttcaaaagca g 2131921DNAArtificial Sequencetarget sequence 319aaaagcagca acatgatctc a 2132021DNAArtificial Sequencetarget sequence 320aaagcagcaa catgatctca t 2132121DNAArtificial Sequencetarget sequence 321aagcagcaac atgatctcat g 2132221DNAArtificial Sequencetarget sequence 322aacatgatct catggagaca g 2132321DNAArtificial Sequencetarget sequence 323aataacttac tgactatgat g 2132421DNAArtificial Sequencetarget sequence 324aacttactga ctatgatgtc c 2132521DNAArtificial Sequencetarget sequence 325aaactcagct aaggacccca c 2132621DNAArtificial Sequencetarget sequence 326aactcagcta aggaccccac t 2132721DNAArtificial Sequencetarget sequence 327aaggacccca ctgttgctaa a 2132821DNAArtificial Sequencetarget sequence 328aaagaagaac aaatcagctt c 2132921DNAArtificial Sequencetarget sequence 329aagaagaaca aatcagcttc a 2133021DNAArtificial Sequencetarget sequence 330aagaacaaat cagcttcaga g 2133121DNAArtificial Sequencetarget sequence 331aacaaatcag cttcagagac t 2133221DNAArtificial Sequencetarget sequence 332aaatcagctt cagagactgt g 2133321DNAArtificial Sequencetarget sequence 333aatcagcttc agagactgtg c 2133421DNAArtificial Sequencetarget sequence 334aagtattcaa atcaggacac a 2133521DNAArtificial Sequencetarget sequence 335aaatcaggac acaccacaaa t 2133621DNAArtificial Sequencetarget sequence 336aatcaggaca caccacaaat g 2133721DNAArtificial Sequencetarget sequence 337aaatggcatc tacacgttaa c 2133821DNAArtificial Sequencetarget sequence 338aatggcatct acacgttaac a 2133921DNAArtificial Sequencetarget sequence 339aacattccct aattctacag a 2134021DNAArtificial Sequencetarget sequence 340aattctacag aagagatcaa g 2134121DNAArtificial Sequencetarget sequence 341aagagatcaa ggcctactgt g 2134221DNAArtificial Sequencetarget sequence 342aaggcctact gtgacatgga a 2134321DNAArtificial Sequencetarget sequence 343aagctggagg aggcgggtgg a 2134421DNAArtificial Sequencetarget sequence 344aattattcag cgacgtgagg a 2134521DNAArtificial Sequencetarget sequence 345aaagaatata aagtgggatt t 2134621DNAArtificial Sequencetarget sequence 346aagaatataa agtgggattt g 2134721DNAArtificial Sequencetarget sequence 347aatataaagt gggatttggt a 2134821DNAArtificial Sequencetarget sequence 348aaagtgggat ttggtaaccc t 2134921DNAArtificial Sequencetarget sequence 349aagtgggatt tggtaaccct t 2135021DNAArtificial Sequencetarget sequence 350aacccttcag gagaatattg g 2135121DNAArtificial Sequencetarget sequence 351aatattggct gggaaatgag t 2135221DNAArtificial Sequencetarget sequence 352aaatgagttt gtttcgcaac t 2135321DNAArtificial Sequencetarget sequence 353aatgagtttg tttcgcaact g 2135421DNAArtificial Sequencetarget sequence 354aactgactaa tcagcaacgc t 2135521DNAArtificial Sequencetarget sequence 355aatcagcaac gctatgtgct t 2135621DNAArtificial Sequencetarget sequence 356aacgctatgt gcttaaaata c 2135721DNAArtificial Sequencetarget sequence 357aaaatacacc ttaaagactg g 2135821DNAArtificial Sequencetarget sequence 358aaatacacct taaagactgg g 2135921DNAArtificial Sequencetarget sequence 359aatacacctt aaagactggg a 2136021DNAArtificial Sequencetarget sequence 360aaagactggg aagggaatga g 2136121DNAArtificial Sequencetarget sequence 361aagactggga agggaatgag g 2136221DNAArtificial Sequencetarget sequence 362aagggaatga ggcttactca t 2136321DNAArtificial Sequencetarget sequence 363aatgaggctt actcattgta t 2136421DNAArtificial Sequencetarget sequence 364aacatttcta tctctcaagt g 2136521DNAArtificial Sequencetarget sequence 365aagtgaagaa ctcaattata g 2136621DNAArtificial Sequencetarget sequence 366aagaactcaa ttataggatt c 2136721DNAArtificial Sequencetarget sequence 367aactcaatta taggattcac c 2136821DNAArtificial Sequencetarget sequence 368aattatagga ttcaccttaa a 2136921DNAArtificial Sequencetarget sequence 369aaaggactta cagggacagc c 2137021DNAArtificial Sequencetarget sequence 370aaggacttac agggacagcc g

2137121DNAArtificial Sequencetarget sequence 371aaaataagca gcatcagcca a 2137221DNAArtificial Sequencetarget sequence 372aaataagcag catcagccaa c 2137321DNAArtificial Sequencetarget sequence 373aataagcagc atcagccaac c 2137421DNAArtificial Sequencetarget sequence 374aagcagcatc agccaaccag g 2137521DNAArtificial Sequencetarget sequence 375aaccaggaaa tgattttagc a 2137621DNAArtificial Sequencetarget sequence 376aaatgatttt agcacaaagg a 2137721DNAArtificial Sequencetarget sequence 377aatgatttta gcacaaagga t 2137821DNAArtificial Sequencetarget sequence 378aaaggatgga gacaacgaca a 2137921DNAArtificial Sequencetarget sequence 379aaggatggag acaacgacaa a 2138021DNAArtificial Sequencetarget sequence 380aacgacaaat gtatttgcaa a 2138121DNAArtificial Sequencetarget sequence 381aaatgtattt gcaaatgttc a 2138221DNAArtificial Sequencetarget sequence 382aatgtatttg caaatgttca c 2138321DNAArtificial Sequencetarget sequence 383aaatgttcac aaatgctaac a 2138421DNAArtificial Sequencetarget sequence 384aatgttcaca aatgctaaca g 2138521DNAArtificial Sequencetarget sequence 385aaatgctaac aggaggctgg t 2138621DNAArtificial Sequencetarget sequence 386aatgctaaca ggaggctggt g 2138721DNAArtificial Sequencetarget sequence 387aacaggaggc tggtggtttg a 2138821DNAArtificial Sequencetarget sequence 388aacttgaacg gaatgtacta t 2138921DNAArtificial Sequencetarget sequence 389aacggaatgt actatccaca g 2139021DNAArtificial Sequencetarget sequence 390aatgtactat ccacagaggc a 2139121DNAArtificial Sequencetarget sequence 391aacacaaata agttcaacgg c 2139221DNAArtificial Sequencetarget sequence 392aaataagttc aacggcatta a 2139321DNAArtificial Sequencetarget sequence 393aataagttca acggcattaa a 2139421DNAArtificial Sequencetarget sequence 394aagttcaacg gcattaaatg g 2139521DNAArtificial Sequencetarget sequence 395aacggcatta aatggtacta c 2139621DNAArtificial Sequencetarget sequence 396aaatggtact actggaaagg c 2139721DNAArtificial Sequencetarget sequence 397aatggtacta ctggaaaggc t 2139821DNAArtificial Sequencetarget sequence 398aaaggctcag gctattcgct c 2139921DNAArtificial Sequencetarget sequence 399aaggctcagg ctattcgctc a 2140021DNAArtificial Sequencetarget sequence 400agcctataac aactttcgga a 2140121DNAArtificial Sequencetarget sequence 401atcaggtcca gcatgggtcc t 2140221DNAArtificial Sequencetarget sequence 402gacaactgcc gctcttcctc c 2140321DNAArtificial Sequencetarget sequence 403ctcgaatacg atgactcggt g 2140421DNAArtificial Sequencetarget sequence 404tggctaatga agcttgagaa t 2140521DNAArtificial Sequencetarget sequence 405tccaggacaa catgaagaaa g 2140621DNAArtificial Sequencetarget sequence 406acggctgtga tgatagaaat a 2140721DNAArtificial Sequencetarget sequence 407gcaaacgcgg aagttaactg a 2140821DNAArtificial Sequencetarget sequence 408cagaccacga gacttgaact t 2140921DNAArtificial Sequencetarget sequence 409ccagaccagt gaaataaaca a 2141021DNAArtificial Sequencetarget sequence 410tgcaagataa gaacagtttc c 2141121DNAArtificial Sequencetarget sequence 411tacagtcaat aaaagaagag a 2141221DNAArtificial Sequencetarget sequence 412ttagtatcca agcaaaattc c 2141321DNAArtificial Sequencetarget sequence 413actgccacgg tgaataattc a 2141421DNAArtificial Sequencetarget sequence 414atgatgtcca catcaaactc a 2141521DNAArtificial Sequencetarget sequence 415gtgctgaagt attcaaatca g 2141621DNAArtificial Sequencetarget sequence 416gatcaaggcc tactgtgaca t 2141721DNAArtificial Sequencetarget sequence 417attcagcgac gtgaggatgg c 2141821DNAArtificial Sequencetarget sequence 418ttcagaggac ttggaaagaa t 2141921DNAArtificial Sequencetarget sequence 419tcgcaactga ctaatcagca a 2142021DNAArtificial Sequencetarget sequence 420agactgggaa gggaatgagg c 2142121DNAArtificial Sequencetarget sequence 421actcattgta tgaacatttc t 2142221DNAArtificial Sequencetarget sequence 422cagccggcaa aataagcagc a 2142321DNAArtificial Sequencetarget sequence 423tagcacaaag gatggagaca a 2142421DNAArtificial Sequencetarget sequence 424gttcacaaat gctaacagga g 2142521DNAArtificial Sequencetarget sequence 425tgtactatcc acagaggcag a 2142621DNAArtificial Sequencetarget sequence 426cggcattaaa tggtactact g 2142721DNAArtificial Sequencetarget sequence 427caaggccaca accatgatga t 2142821DNAArtificial Sequencetarget sequence 428aactgtggaa ggtgccatgg a 2142921DNAArtificial Sequencetarget sequence 429aaggtgccat ggacttgatc t 2143021DNAArtificial Sequencetarget sequence 430aattccctac ctcttgtatc t 2143121DNAArtificial Sequencetarget sequence 431aaacatctct cacctgcatt g 2143221DNAArtificial Sequencetarget sequence 432aacatctctc acctgcattg c 2143321DNAArtificial Sequencetarget sequence 433aagggacttt gaagccttaa t 2143421DNAArtificial Sequencetarget sequence 434aagccttaat gaaccagcac c 2143521DNAArtificial Sequencetarget sequence 435aatgaaccag caccaggatc c 2143621DNAArtificial Sequencetarget sequence 436aaccagcacc aggatccgct g 2143721DNAArtificial Sequencetarget sequence 437aagttactca agatgtgacc a 2143821DNAArtificial Sequencetarget sequence 438aagatgtgac cagagaatgg g 2143921DNAArtificial Sequencetarget sequence 439aatgggctaa aaaagttgtt t 2144021DNAArtificial Sequencetarget sequence 440aaaaaagttg tttggaagag a 2144121DNAArtificial Sequencetarget sequence 441aaaaagttgt ttggaagaga g 2144221DNAArtificial Sequencetarget sequence 442aaaagttgtt tggaagagag a 2144321DNAArtificial Sequencetarget sequence 443aaagttgttt ggaagagaga a 2144421DNAArtificial Sequencetarget sequence 444aagttgtttg gaagagagaa a 2144521DNAArtificial Sequencetarget sequence 445aagagagaaa aggctagtaa g 2144621DNAArtificial Sequencetarget sequence 446aaaaggctag taagatcaat g 2144721DNAArtificial Sequencetarget sequence 447aaaggctagt aagatcaatg g 2144821DNAArtificial Sequencetarget sequence 448aaggctagta agatcaatgg t 2144921DNAArtificial Sequencetarget sequence 449aagatcaatg gtgcttattt c 2145021DNAArtificial Sequencetarget sequence 450aatggtgctt atttctgtga a 2145121DNAArtificial Sequencetarget sequence 451aagggcgagt tcgaggagag g 2145221DNAArtificial Sequencetarget sequence 452aatcaggata cgaaccatga a 2145321DNAArtificial Sequencetarget sequence 453aaccatgaag atgcgtcaac a 2145421DNAArtificial Sequencetarget sequence 454aagatgcgtc aacaagcttc c 2145521DNAArtificial Sequencetarget sequence 455aacaagcttc cttcctacca g 2145621DNAArtificial Sequencetarget sequence 456aagcttcctt cctaccagct a 2145721DNAArtificial Sequencetarget sequence 457aactatgact gtggacaagg g 2145821DNAArtificial Sequencetarget sequence 458aagggagata acgtgaacat a 2145921DNAArtificial Sequencetarget sequence 459aacgtgaaca tatctttcaa a 2146021DNAArtificial Sequencetarget sequence 460aacatatctt tcaaaaaggt a 2146121DNAArtificial Sequencetarget sequence 461aaaaaggtat tgattaaaga a 2146221DNAArtificial Sequencetarget sequence 462aaaaaggtat tgattaaaga a 2146321DNAArtificial Sequencetarget sequence 463aaaaggtatt gattaaagaa g 2146421DNAArtificial Sequencetarget sequence 464aaaggtattg attaaagaag a 2146521DNAArtificial Sequencetarget sequence 465aaggtattga ttaaagaaga a 2146621DNAArtificial Sequencetarget sequence 466aaagaagaag atgcagtgat t 2146721DNAArtificial Sequencetarget sequence 467aagaagaaga tgcagtgatt t 2146821DNAArtificial Sequencetarget sequence 468aagaagatgc agtgatttac a 2146921DNAArtificial Sequencetarget sequence 469aagatgcagt gatttacaaa a 2147021DNAArtificial Sequencetarget sequence 470aaaaatggtt ccttcatcca t 2147121DNAArtificial Sequencetarget sequence 471aaaatggttc cttcatccat t 2147221DNAArtificial Sequencetarget sequence 472aaatggttcc ttcatccatt c 2147321DNAArtificial Sequencetarget sequence 473aatggttcct tcatccattc a 2147421DNAArtificial Sequencetarget sequence 474aagtacctga tattctagaa g 2147521DNAArtificial Sequencetarget sequence 475aagtacacct gcctcatgct c 2147621DNAArtificial Sequencetarget sequence 476aaacctcttc acctcggcct t 2147721DNAArtificial Sequencetarget sequence 477aacctcttca cctcggcctt c 2147821DNAArtificial Sequencetarget sequence 478aagcccagaa gtggggacct g 2147921DNAArtificial Sequencetarget sequence 479aagtggggac ctgaatgcaa c 2148021DNAArtificial Sequencetarget sequence 480aatgcaacca tctctgtact g 2148121DNAArtificial Sequencetarget sequence 481aaccatctct gtactgcttg t 2148221DNAArtificial Sequencetarget sequence 482aacaatggtg tctgccatga a 2148321DNAArtificial Sequencetarget sequence 483aatggtgtct gccatgaaga t 2148421DNAArtificial Sequencetarget sequence 484aagatactgg agaatgcatt t 2148521DNAArtificial Sequencetarget sequence 485aatgcatttg ccctcctggg t 2148621DNAArtificial Sequencetarget sequence 486aaggacgtgt gagaaggctt g 2148721DNAArtificial Sequencetarget sequence 487aaggcttgtg aactgcacac g 2148821DNAArtificial Sequencetarget sequence 488aactgcacac gtttggcaga a 2148921DNAArtificial Sequencetarget sequence 489aacttgtaaa gaaaggtgca g 2149021DNAArtificial Sequencetarget sequence 490aaagaaaggt gcagtggaca a 2149121DNAArtificial Sequencetarget sequence 491aagaaaggtg cagtggacaa g 2149221DNAArtificial Sequencetarget sequence 492aaaggtgcag tggacaagag g 2149321DNAArtificial Sequencetarget sequence 493aaggtgcagt ggacaagagg g 2149421DNAArtificial Sequencetarget sequence 494aagagggatg caagtcttat g 2149521DNAArtificial Sequencetarget sequence 495aagtcttatg tgttctgtct c 2149621DNAArtificial Sequencetarget sequence 496aagggtctgc agtgcaatga a 2149721DNAArtificial Sequencetarget sequence 497aatgaagcat gccaccctgg t 2149821DNAArtificial Sequencetarget sequence 498aagcatgcca ccctggtttt t 2149921DNAArtificial Sequencetarget sequence 499aagcttaggt gcagctgcaa c 2150021DNAArtificial Sequencetarget sequence 500aacaatgggg agatgtgtga t 2150121DNAArtificial Sequencetarget sequence 501aatggggaga tgtgtgatcg c 2150221DNAArtificial Sequencetarget sequence 502aaggatgtct ctgctctcca g 2150321DNAArtificial Sequencetarget sequence 503aaggcatacc gaggatgacc c 2150421DNAArtificial Sequencetarget sequence 504aaagatagtg gatttgccag a 2150521DNAArtificial Sequencetarget sequence 505aagatagtgg atttgccaga t 2150621DNAArtificial Sequencetarget sequence 506aagtaaacag tggtaaattt a 2150721DNAArtificial Sequencetarget sequence 507aaacagtggt aaatttaatc c 2150821DNAArtificial Sequencetarget sequence 508aacagtggta aatttaatcc c 2150921DNAArtificial Sequencetarget sequence 509aaatttaatc ccatttgcaa a 2151021DNAArtificial Sequencetarget sequence 510aatttaatcc catttgcaaa g 2151121DNAArtificial Sequencetarget sequence 511aatcccattt gcaaagcttc t 2151221DNAArtificial Sequencetarget sequence 512aaagcttctg gctggccgct a 2151321DNAArtificial Sequencetarget sequence 513aagcttctgg ctggccgcta c 2151421DNAArtificial Sequencetarget sequence 514aatgaagaaa tgaccctggt g 2151521DNAArtificial Sequencetarget sequence 515aagaaatgac cctggtgaag c 2151621DNAArtificial Sequencetarget sequence 516aaatgaccct ggtgaagccg g 2151721DNAArtificial Sequencetarget sequence 517aatgaccctg gtgaagccgg a 2151821DNAArtificial Sequencetarget sequence 518aagccggatg ggacagtgct c 2151921DNAArtificial Sequencetarget sequence 519aaaagacttt aaccatacgg a 2152021DNAArtificial Sequencetarget sequence 520aaagacttta accatacgga t 2152121DNAArtificial Sequencetarget sequence 521aagactttaa ccatacggat c

2152221DNAArtificial Sequencetarget sequence 522aaccatacgg atcatttctc a 2152321DNAArtificial Sequencetarget sequence 523aacacagtgg ctgggatggt g 2152421DNAArtificial Sequencetarget sequence 524aaaagccctt caacatttct g 2152521DNAArtificial Sequencetarget sequence 525aaagcccttc aacatttctg t 2152621DNAArtificial Sequencetarget sequence 526aagcccttca acatttctgt t 2152721DNAArtificial Sequencetarget sequence 527aacatttctg ttaaagttct t 2152821DNAArtificial Sequencetarget sequence 528aaagttcttc caaagcccct g 2152921DNAArtificial Sequencetarget sequence 529aagttcttcc aaagcccctg a 2153021DNAArtificial Sequencetarget sequence 530aaagcccctg aatgccccaa a 2153121DNAArtificial Sequencetarget sequence 531aagcccctga atgccccaaa c 2153221DNAArtificial Sequencetarget sequence 532aatgccccaa acgtgattga c 2153321DNAArtificial Sequencetarget sequence 533aaacgtgatt gacactggac a 2153421DNAArtificial Sequencetarget sequence 534aacgtgattg acactggaca t 2153521DNAArtificial Sequencetarget sequence 535aactttgctg tcatcaacat c 2153621DNAArtificial Sequencetarget sequence 536aatcaaatcc aagaagcttc t 2153721DNAArtificial Sequencetarget sequence 537aaatccaaga agcttctata c 2153821DNAArtificial Sequencetarget sequence 538aatccaagaa gcttctatac a 2153921DNAArtificial Sequencetarget sequence 539aagaagcttc tatacaaacc c 2154021DNAArtificial Sequencetarget sequence 540aagcttctat acaaacccgt t 2154121DNAArtificial Sequencetarget sequence 541aaacccgtta atcactatga g 2154221DNAArtificial Sequencetarget sequence 542aacccgttaa tcactatgag g 2154321DNAArtificial Sequencetarget sequence 543aatcactatg aggcttggca a 2154421DNAArtificial Sequencetarget sequence 544aacatattca agtgacaaat g 2154521DNAArtificial Sequencetarget sequence 545aagtgacaaa tgagattgtt a 2154621DNAArtificial Sequencetarget sequence 546aaatgagatt gttacactca a 2154721DNAArtificial Sequencetarget sequence 547aatgagattg ttacactcaa c 2154821DNAArtificial Sequencetarget sequence 548aactatttgg aacctcggac a 2154921DNAArtificial Sequencetarget sequence 549aacctcggac agaatatgaa c 2155021DNAArtificial Sequencetarget sequence 550aatatgaact ctgtgtgcaa c 2155121DNAArtificial Sequencetarget sequence 551aactctgtgt gcaactggtc c 2155221DNAArtificial Sequencetarget sequence 552aactggtccg tcgtggagag g 2155321DNAArtificial Sequencetarget sequence 553aagggcatcc tggacctgtg a 2155421DNAArtificial Sequencetarget sequence 554aacagcttct atcggactcc c 2155521DNAArtificial Sequencetarget sequence 555aagaggtcta aatctcctgc c 2155621DNAArtificial Sequencetarget sequence 556aaatctcctg cctaaaagtc a 2155721DNAArtificial Sequencetarget sequence 557aatctcctgc ctaaaagtca g 2155821DNAArtificial Sequencetarget sequence 558aaaagtcaga ccactctaaa t 2155921DNAArtificial Sequencetarget sequence 559aaagtcagac cactctaaat t 2156021DNAArtificial Sequencetarget sequence 560aagtcagacc actctaaatt t 2156121DNAArtificial Sequencetarget sequence 561aaatttgacc tggcaaccaa t 2156221DNAArtificial Sequencetarget sequence 562aatttgacct ggcaaccaat a 2156321DNAArtificial Sequencetarget sequence 563aaccaatatt tccaagctcg g 2156421DNAArtificial Sequencetarget sequence 564aatatttcca agctcggaag a 2156521DNAArtificial Sequencetarget sequence 565aagctcggaa gatgactttt a 2156621DNAArtificial Sequencetarget sequence 566aagatgactt ttatgttgaa g 2156721DNAArtificial Sequencetarget sequence 567aagtggagag aaggtctgtg c 2156821DNAArtificial Sequencetarget sequence 568aaggtctgtg caaaaaagtg a 2156921DNAArtificial Sequencetarget sequence 569aaaaaagtga tcagcagaat a 2157021DNAArtificial Sequencetarget sequence 570aaaaagtgat cagcagaata t 2157121DNAArtificial Sequencetarget sequence 571aaaagtgatc agcagaatat t 2157221DNAArtificial Sequencetarget sequence 572aaagtgatca gcagaatatt a 2157321DNAArtificial Sequencetarget sequence 573aagtgatcag cagaatatta a 2157421DNAArtificial Sequencetarget sequence 574aatattaaag ttccaggcaa c 2157521DNAArtificial Sequencetarget sequence 575aaagttccag gcaacttgac t 2157621DNAArtificial Sequencetarget sequence 576aagttccagg caacttgact t 2157721DNAArtificial Sequencetarget sequence 577aacttgactt cggtgctact t 2157821DNAArtificial Sequencetarget sequence 578aacaacttac atcccaggga g 2157921DNAArtificial Sequencetarget sequence 579aacttacatc ccagggagca g 2158021DNAArtificial Sequencetarget sequence 580aacaccaagg cccaggggga a 2158121DNAArtificial Sequencetarget sequence 581aaggcccagg gggaatggag t 2158221DNAArtificial Sequencetarget sequence 582aatggagtga agatctcact g 2158321DNAArtificial Sequencetarget sequence 583aagatctcac tgcttggacc c 2158421DNAArtificial Sequencetarget sequence 584aaccagaaaa catcaagatt t 2158521DNAArtificial Sequencetarget sequence 585aaaacatcaa gatttccaac a 2158621DNAArtificial Sequencetarget sequence 586aaacatcaag atttccaaca t 2158721DNAArtificial Sequencetarget sequence 587aacatcaaga tttccaacat t 2158821DNAArtificial Sequencetarget sequence 588aagatttcca acattacaca c 2158921DNAArtificial Sequencetarget sequence 589aacattacac actcctcggc t 2159021DNAArtificial Sequencetarget sequence 590aatattggat ggctattcta t 2159121DNAArtificial Sequencetarget sequence 591aaggttcaag gcaagaatga a 2159221DNAArtificial Sequencetarget sequence 592aaggcaagaa tgaagaccag c 2159321DNAArtificial Sequencetarget sequence 593aagaatgaag accagcacgt t 2159421DNAArtificial Sequencetarget sequence 594aatgaagacc agcacgttga t 2159521DNAArtificial Sequencetarget sequence 595aagaccagca cgttgatgtg a 2159621DNAArtificial Sequencetarget sequence 596aagataaaga atgccaccat c 2159721DNAArtificial Sequencetarget sequence 597aaagaatgcc accatcattc a 2159821DNAArtificial Sequencetarget sequence 598aagaatgcca ccatcattca g 2159921DNAArtificial Sequencetarget sequence 599aatgccacca tcattcagta t 2160021DNAArtificial Sequencetarget sequence 600aagggcctag agcctgaaac a 2160121DNAArtificial Sequencetarget sequence 601aaacagcata ccaggtggac a 2160221DNAArtificial Sequencetarget sequence 602aacagcatac caggtggaca t 2160321DNAArtificial Sequencetarget sequence 603aacaacatag ggtcaagcaa c 2160421DNAArtificial Sequencetarget sequence 604aacatagggt caagcaaccc a 2160521DNAArtificial Sequencetarget sequence 605aagcaaccca gccttttctc a 2160621DNAArtificial Sequencetarget sequence 606aacccagcct tttctcatga a 2160721DNAArtificial Sequencetarget sequence 607aactggtgac cctcccagaa t 2160821DNAArtificial Sequencetarget sequence 608aatctcaagc accagcggac c 2160921DNAArtificial Sequencetarget sequence 609aagcaccagc ggacctcgga g 2161021DNAArtificial Sequencetarget sequence 610aagatgctgc ttatagccat c 2161121DNAArtificial Sequencetarget sequence 611aatgacctgc ctgactgtgc t 2161221DNAArtificial Sequencetarget sequence 612aattgaagag ggcaaatgtg c 2161321DNAArtificial Sequencetarget sequence 613aagagggcaa atgtgcaaag g 2161421DNAArtificial Sequencetarget sequence 614aaatgtgcaa aggagaatgg c 2161521DNAArtificial Sequencetarget sequence 615aatgtgcaaa ggagaatggc c 2161621DNAArtificial Sequencetarget sequence 616aaaggagaat ggcccaagcc t 2161721DNAArtificial Sequencetarget sequence 617aaggagaatg gcccaagcct t 2161821DNAArtificial Sequencetarget sequence 618aatggcccaa gccttccaaa a 2161921DNAArtificial Sequencetarget sequence 619aagccttcca aaacgtgagg g 2162021DNAArtificial Sequencetarget sequence 620aaaacgtgag ggaagaacca g 2162121DNAArtificial Sequencetarget sequence 621aaacgtgagg gaagaaccag c 2162221DNAArtificial Sequencetarget sequence 622aacgtgaggg aagaaccagc t 2162321DNAArtificial Sequencetarget sequence 623aagaaccagc tgtgcagttc a 2162421DNAArtificial Sequencetarget sequence 624aaccagctgt gcagttcaac t 2162521DNAArtificial Sequencetarget sequence 625aactcaggga ctctggccct a 2162621DNAArtificial Sequencetarget sequence 626aaacaggaag gtcaaaaaca a 2162721DNAArtificial Sequencetarget sequence 627aacaggaagg tcaaaaacaa c 2162821DNAArtificial Sequencetarget sequence 628aaggtcaaaa acaacccaga t 2162921DNAArtificial Sequencetarget sequence 629aaaaacaacc cagatcctac a 2163021DNAArtificial Sequencetarget sequence 630aaaacaaccc agatcctaca a 2163121DNAArtificial Sequencetarget sequence 631aaacaaccca gatcctacaa t 2163221DNAArtificial Sequencetarget sequence 632aacaacccag atcctacaat t 2163321DNAArtificial Sequencetarget sequence 633aacccagatc ctacaattta t 2163421DNAArtificial Sequencetarget sequence 634aatttatcca gtgcttgact g 2163521DNAArtificial Sequencetarget sequence 635aatgacatca aatttcaaga t 2163621DNAArtificial Sequencetarget sequence 636aaatttcaag atgtgattgg g 2163721DNAArtificial Sequencetarget sequence 637aatttcaaga tgtgattggg g 2163821DNAArtificial Sequencetarget sequence 638aagatgtgat tggggagggc a 2163921DNAArtificial Sequencetarget sequence 639aattttggcc aagttcttaa g 2164021DNAArtificial Sequencetarget sequence 640aagttcttaa ggcgcgcatc a 2164121DNAArtificial Sequencetarget sequence 641aaggcgcgca tcaagaagga t 2164221DNAArtificial Sequencetarget sequence 642aagaaggatg ggttacggat g 2164321DNAArtificial Sequencetarget sequence 643aaggatgggt tacggatgga t 2164421DNAArtificial Sequencetarget sequence 644aaaagaatga aagaatatgc c 2164521DNAArtificial Sequencetarget sequence 645aaagaatgaa agaatatgcc t 2164621DNAArtificial Sequencetarget sequence 646aagaatgaaa gaatatgcct c 2164721DNAArtificial Sequencetarget sequence 647aatgaaagaa tatgcctcca a 2164821DNAArtificial Sequencetarget sequence 648aaagaatatg cctccaaaga t 2164921DNAArtificial Sequencetarget sequence 649aagaatatgc ctccaaagat g 2165021DNAArtificial Sequencetarget sequence 650aatatgcctc caaagatgat c 2165121DNAArtificial Sequencetarget sequence 651aaagatgatc acagggactt t 2165221DNAArtificial Sequencetarget sequence 652aagatgatca cagggacttt g 2165321DNAArtificial Sequencetarget sequence 653aactggaagt tctttgtaaa c 2165421DNAArtificial Sequencetarget sequence 654aagttctttg taaacttgga c 2165521DNAArtificial Sequencetarget sequence 655aaacttggac accatccaaa c 2165621DNAArtificial Sequencetarget sequence 656aacttggaca ccatccaaac a 2165721DNAArtificial Sequencetarget sequence 657aaacatcatc aatctcttag g 2165821DNAArtificial Sequencetarget sequence 658aacatcatca atctcttagg a 2165921DNAArtificial Sequencetarget sequence 659aatctcttag gagcatgtga a 2166021DNAArtificial Sequencetarget sequence 660aacatcgagg ctacttgtac c 2166121DNAArtificial Sequencetarget sequence 661aaaccttctg gacttccttc g 2166221DNAArtificial Sequencetarget sequence 662aaccttctgg acttccttcg c 2166321DNAArtificial Sequencetarget sequence 663aagagccgtg tgctggagac g 2166421DNAArtificial Sequencetarget sequence 664aatagcaccg cgtccacact g 2166521DNAArtificial Sequencetarget sequence 665aaaaacagtt tatccacagg g 2166621DNAArtificial Sequencetarget sequence 666aaaacagttt atccacaggg a 2166721DNAArtificial Sequencetarget sequence 667aaacagttta tccacaggga t 2166821DNAArtificial Sequencetarget sequence 668aacagtttat ccacagggat c 2166921DNAArtificial Sequencetarget sequence 669aaacatttta gttggtgaaa a 2167021DNAArtificial Sequencetarget sequence 670aacattttag ttggtgaaaa c 2167121DNAArtificial Sequencetarget sequence 671aaaactatgt ggcaaaaata g 2167221DNAArtificial

Sequencetarget sequence 672aaactatgtg gcaaaaatag c 2167321DNAArtificial Sequencetarget sequence 673aactatgtgg caaaaatagc a 2167421DNAArtificial Sequencetarget sequence 674aaaaatagca gattttggat t 2167521DNAArtificial Sequencetarget sequence 675aaaatagcag attttggatt g 2167621DNAArtificial Sequencetarget sequence 676aaatagcaga ttttggattg t 2167721DNAArtificial Sequencetarget sequence 677aatagcagat tttggattgt c 2167821DNAArtificial Sequencetarget sequence 678aagaggtgta cgtgaaaaag a 2167921DNAArtificial Sequencetarget sequence 679aaaaagacaa tgggaaggct c 2168021DNAArtificial Sequencetarget sequence 680aaaagacaat gggaaggctc c 2168121DNAArtificial Sequencetarget sequence 681aaagacaatg ggaaggctcc c 2168221DNAArtificial Sequencetarget sequence 682aagacaatgg gaaggctccc a 2168321DNAArtificial Sequencetarget sequence 683aatgggaagg ctcccagtgc g 2168421DNAArtificial Sequencetarget sequence 684aaggctccca gtgcgctgga t 2168521DNAArtificial Sequencetarget sequence 685aattacagtg tgtacacaac c 2168621DNAArtificial Sequencetarget sequence 686aaccaacagt gatgtatggt c 2168721DNAArtificial Sequencetarget sequence 687aacagtgatg tatggtccta t 2168821DNAArtificial Sequencetarget sequence 688aactctacga gaagctgccc c 2168921DNAArtificial Sequencetarget sequence 689aagctgcccc agggctacag a 2169021DNAArtificial Sequencetarget sequence 690aagcccctga actgtgatga t 2169121DNAArtificial Sequencetarget sequence 691aactgtgatg atgaggtgta t 2169221DNAArtificial Sequencetarget sequence 692aatgagacaa tgctggcggg a 2169321DNAArtificial Sequencetarget sequence 693aatgctggcg ggagaagcct t 2169421DNAArtificial Sequencetarget sequence 694aagccttatg agaggccatc a 2169521DNAArtificial Sequencetarget sequence 695aaacagaatg ttagaggagc g 2169621DNAArtificial Sequencetarget sequence 696aacagaatgt tagaggagcg a 2169721DNAArtificial Sequencetarget sequence 697aatgttagag gagcgaaaga c 2169821DNAArtificial Sequencetarget sequence 698aaagacctac gtgaatacca c 2169921DNAArtificial Sequencetarget sequence 699aagacctacg tgaataccac g 2170021DNAArtificial Sequencetarget sequence 700aataccacgc tttatgagaa g 2170121DNAArtificial Sequencetarget sequence 701aagtttactt atgcaggaat t 2170221DNAArtificial Sequencetarget sequence 702aattgactgt tctgctgaag a 2170321DNAArtificial Sequencetarget sequence 703ttgtatctga tgctgaaaca t 2170421DNAArtificial Sequencetarget sequence 704tactcaagat gtgaccagag a 2170521DNAArtificial Sequencetarget sequence 705tgtgaagggc gagttcgagg a 2170621DNAArtificial Sequencetarget sequence 706tcaaaaaggt attgattaaa g 2170721DNAArtificial Sequencetarget sequence 707acctgatatt ctagaagtac a 2170821DNAArtificial Sequencetarget sequence 708aggctgatag tccggagatg t 2170921DNAArtificial Sequencetarget sequence 709actggagaat gcatttgccc t 2171021DNAArtificial Sequencetarget sequence 710atgtgttctg tctccctgac c 2171121DNAArtificial Sequencetarget sequence 711cgggccagat tgtaagctta g 2171221DNAArtificial Sequencetarget sequence 712ctccagtgtg agagagaagg c 2171321DNAArtificial Sequencetarget sequence 713catttgcaaa gcttctggct g 2171421DNAArtificial Sequencetarget sequence 714ccatccaccg gatcctcccc c 2171521DNAArtificial Sequencetarget sequence 715gttaaagttc ttccaaagcc c 2171621DNAArtificial Sequencetarget sequence 716ggatggacca atcaaatcca a 2171721DNAArtificial Sequencetarget sequence 717gaacctcgga cagaatatga a 2171821DNAArtificial Sequencetarget sequence 718gcttctatcg gactccctcc t 2171917DNAArtificial Sequencetarget sequence 719aagatgactt ttatgtt 1772017DNAArtificial Sequencetarget sequence 720agaatattaa agttcca 1772118DNAArtificial Sequencetarget sequence 721cagggggaat ggagtgaa 1872218DNAArtificial Sequencetarget sequence 722atattggatg gctattct 1872319DNAArtificial Sequencetarget sequence 723actatccgtt acaaggttc 1972419DNAArtificial Sequencetarget sequence 724gtatcagctc aagggccta 1972520DNAArtificial Sequencetarget sequence 725gcaacccagc cttttctcat 2072620DNAArtificial Sequencetarget sequence 726tgacctgcct gactgtgctg 2072722DNAArtificial Sequencetarget sequence 727aaccagctgt gcagttcaac tc 2272822DNAArtificial Sequencetarget sequence 728actggaatga catcaaattt ca 2272923DNAArtificial Sequencetarget sequence 729aatgaaagaa tatgcctcca aag 2373023DNAArtificial Sequencetarget sequence 730ctcttaggag catgtgaaca tcg 2373124DNAArtificial Sequencetarget sequence 731acggacccag catttgccat tgcc 2473224DNAArtificial Sequencetarget sequence 732tgaaaactat gtggcaaaaa tagc 2473325DNAArtificial Sequencetarget sequence 733ctggatggcc atcgagtcac tgaat 2573425DNAArtificial Sequencetarget sequence 734agactggaga agcccctgaa ctgtg 2573526DNAArtificial Sequencetarget sequence 735ttgcccagat attggtgtcc ttaaac 2673626DNAArtificial Sequencetarget sequence 736atgagaagtt tacttatgca ggaatt 26

Claims

1. An isolated siRNA comprising a sense RNA strand and an antisense RNA strand, wherein the sense and an antisense RNA strands form an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence substantially identical to a target sequence of about 19 to about 25 contiguous nucleotides in human Ang1, Ang2 or Tie2 mRNA, or an alternative splice form, mutant or cognate thereof.

2. The siRNA of claim 1, wherein the cognate of the human Ang1, Ang2 or Tie2 mRNA sequence is SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7.

3. The siRNA of claim 1, wherein the sense RNA strand comprises one RNA molecule, and the antisense RNA strand comprises one RNA molecule.

4. The siRNA of claim 1, wherein the sense and antisense RNA strands forming the RNA duplex are covalently linked by a single-stranded hairpin.

5. The siRNA of claim 1, wherein the siRNA further comprises non-nucleotide material.

6. The siRNA of claim 1, wherein the siRNA further comprises an addition, deletion, substitution or alteration of one or more nucleotides.

7. The siRNA of claim 1, wherein the sense and antisense RNA strands are stabilized against nuclease degradation.

8. The siRNA of claim 1, further comprising a 3' overhang.

9. The siRNA of claim 8, wherein the 3' overhang comprises from 1 to about 6 nucleotides.

10. The siRNA of claim 8, wherein the 3' overhang comprises about 2 nucleotides.

11. The siRNA of claim 3 wherein the sense RNA strand comprises a first 3' overhang, and the antisense RNA strand comprises a second 3' overhang.

12. The siRNA of claim 11, wherein the first and second 3' overhangs separately comprise from 1 to about 6 nucleotides.

13. The siRNA of claim 12, wherein the first 3' overhang comprises a dinucleotide and the second 3' overhang comprises a dinucleotide.

14. The siRNA of claim 13, where the dinucleotide comprising the first and second 3' overhangs is dithymidylic acid (TT) or diuridylic acid (uu).

15. The siRNA of claim 8, wherein the 3' overhang is stabilized against nuclease degradation.

16. A recombinant plasmid comprising nucleic acid sequences for expressing an siRNA comprising a sense RNA strand and an antisense RNA strand, wherein the sense and an antisense RNA strands form an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence substantially identical to a target sequence of about 19 to about 25 contiguous nucleotides in human Ang1, Ang2 or Tie2 mRNA, or an alternative splice form, mutant or cognate thereof.

17. The recombinant plasmid of claim 16, wherein the nucleic acid sequences for expressing the siRNA comprise an inducible or regulatable promoter.

18. The recombinant plasmid of claim 16, wherein the nucleic acid sequences for expressing the siRNA comprise a sense RNA strand coding sequence in operable connection with a polyT termination sequence under the control of a human U6 RNA promoter, and an antisense RNA strand coding sequence in operable connection with a polyT termination sequence under the control of a human U6 RNA promoter.

19. The recombinant plasmid of claim 16, wherein the plasmid comprises a CMV promoter.

20. A recombinant viral vector comprising nucleic acid sequences for expressing an siRNA comprising a sense RNA strand and an antisense RNA strand, wherein the sense and an antisense RNA strands form an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence substantially identical to a target sequence of about 19 to about 25 contiguous nucleotides in human Ang1, Ang2 or Tie2 mRNA, or an alternative splice form, mutant or cognate thereof.

21. The recombinant viral vector of claim 20, wherein the nucleic acid sequences for expressing the siRNA comprise an inducible or regulatable promoter.

22. The recombinant viral vector of claim 20, wherein the nucleic acid sequences for expressing the siRNA comprise a sense RNA strand coding sequence in operable connection with a polyT termination sequence under the control of a human U6 RNA promoter, and an antisense RNA strand coding sequence in operable connection with a polyT termination sequence under the control of a human U6 RNA promoter.

23. The recombinant viral vector of claim 20, wherein the recombinant viral vector is selected from the group consisting of an adenoviral vector, an adeno-associated viral vector, a lentiviral vector, a retroviral vector, and a herpes virus vector.

24. The recombinant viral vector of claim 20, wherein the recombinant viral vector is pseudotyped with surface proteins from vesicular stomatitis virus, rabies virus, Ebola virus, or Mokola virus.

25. The recombinant viral vector of claim 23, wherein the recombinant viral vector comprises an adeno-associated viral vector.

26. A pharmaceutical composition comprising an siRNA and a pharmaceutically acceptable carrier, wherein the siRNA comprises a sense RNA strand and an antisense RNA strand, wherein the sense and an antisense RNA strands form an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence substantially identical to a target sequence of about 19 to about 25 contiguous nucleotides in human Ang1, Ang2 or Tie2 mRNA, or an alternative splice form, mutant or cognate thereof.

27. The pharmaceutical composition of claim 26, further comprising lipofectin, lipofectamine, cellfectin, polycations, or liposomes.

28. A pharmaceutical composition comprising the plasmid of claim 16, or a physiologically acceptable salt thereof, and a pharmaceutically acceptable carrier.

29. The pharmaceutical composition of claim 28, further comprising lipofectin, lipofectamine, cellfectin, polycations, or liposomes.

30. A pharmaceutical composition comprising the viral vector of claim 20 and a pharmaceutically acceptable carrier.

31. A method of inhibiting expression of human Ang1, Ang2 or Tie2 mRNA, or an alternative splice form, mutant or cognate thereof, comprising administering to a subject an effective amount of an siRNA comprising a sense RNA strand and an antisense RNA strand, wherein the sense and an antisense RNA strands form an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence substantially identical to a target sequence of about 19 to about 25 contiguous nucleotides in human Ang1, Ang2 or Tie2 mRNA, or an alternative splice form, mutant or cognate thereof, such that the human Ang1, Ang2 or Tie2 mRNA, or an alternative splice form, mutant or cognate thereof, is degraded.

32. The method of claim 31, wherein the subject is a human being.

33. The method of claim 31, wherein the siRNA is administered in conjunction with a delivery reagent.

34. The method of claim 33, wherein the delivery agent is selected from the group consisting of lipofectin, lipofectamine, cellfectin, polycations, and liposomes.

35. The method of claim 34, wherein the delivery agent is a liposome.

36. The method claim 35, wherein the liposome comprises a ligand which targets the liposome to cells expressing Ang1, Ang2 or Tie2.

37. The method of claim 36, wherein the cells are endothelial cells.

38. The method of claim 37, wherein the ligand comprises a monoclonal antibody.

39. The method of claim 35, wherein the liposome is modified with an opsonization-inhibition moiety.

40. The method of claim 39, wherein the opsonization-inhibiting moiety comprises a PEG, PPG, or derivatives thereof.

41. The method of claim 31, wherein the siRNA is expressed from a recombinant plasmid.

42. The method of claim 31, wherein the siRNA is expressed from a recombinant viral vector.

43. The method of claim 42, wherein the recombinant viral vector comprises an adenoviral vector, an adeno-associated viral vector, a lentiviral vector, a retroviral vector, or a herpes virus vector.

44. The method of claim 43, wherein the recombinant viral vector is pseudotyped with surface proteins from vesicular stomatitis virus, rabies virus, Ebola virus, or Mokola virus.

45. The method of claim 42, wherein the recombinant viral vector comprises an adeno-associated viral vector.

46. The method of claim 31, wherein two or more siRNA are administered to the subject, and wherein each siRNA comprises a nucleotide sequence which is substantially identical to a different Ang1, Ang2 or Tie2 mRNA target sequence.

47. The method of claim 31, wherein two or more siRNA are administered to the subject, and wherein each siRNA administered comprises a nucleotide sequence which is substantially identical to a target sequence from a different target mRNA.

48. The method of claim 31, wherein the siRNA is administered by an enteral administration route.

49. The method of claim 48, wherein the enteral administration route is selected from the group consisting of oral, rectal, and intranasal.

50. The method of claim 31, wherein the siRNA is administered by a parenteral administration route.

51. The method of claim 50, wherein the parenteral administration route is selected from the group consisting of intravascular administration, peri- and intra-tissue administration, subcutaneous injection or deposition, subcutaneous infusion, intraocular administration, and direct application at or near the site of neovascularization.

52. The method of claim 51, wherein the intravascular administration is selected from the group consisting of intravenous bolus injection, intravenous infusion, intra-arterial bolus injection, intra-arterial infusion and catheter instillation into the vasculature.

53. The method of claim 51, wherein the peri- and intra-tissue injection is selected from the group consisting of peri-tumoral injection, intra-tumoral injection, intra-retinal injection, and subretinal injection.

54. The method of claim 51, wherein the intraocular administration comprises intravitreal, intraretinal, subretinal, subtenon, peri- and retro-orbital, trans-corneal or trans-scleral administration.

55. The method of claim 51, wherein the direct application at or near the site of neovascularization comprises application by catheter, corneal pellet, eye dropper, suppository, an implant comprising a porous material, an implant comprising a non-porous material, or an implant comprising a gelatinous material.

56. The method of claim 55, wherein the site of neovascularization is in the eye, and the direct application at or near the site of neovascularization comprises application by eyedropper.

57. A method of inhibiting angiogenesis in a subject, comprising administering to a subject an effective amount of an siRNA comprising a sense RNA strand and an antisense RNA strand, wherein the sense and an antisense RNA strands form an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence substantially identical to a target sequence of about 19 to about 25 contiguous nucleotides in human Ang1, Ang2 or Tie2 mRNA, or an alternative splice form, mutant or cognate thereof.

58. The method of claim 57, wherein the angiogenesis is pathogenic.

59. The method of claim 57, wherein the angiogenesis is non-pathogenic.

60. The method of claim 59, wherein the non-pathogenic angiogenesis is associated with production of fatty tissues or cholesterol production.

61. The method of claim 59, wherein the non-pathogenic angiogenesis comprises endometrial neovascularization.

62. A method of treating an angiogenic disease in a subject, comprising administering to a subject in need of such treatment an effective amount of an siRNA comprising a sense RNA strand and an antisense RNA strand, wherein the sense and an antisense RNA strands form an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence substantially identical to a target sequence of about 19 to about 25 contiguous nucleotides in human Ang1, Ang2 or Tie2 mRNA, or an alternative splice form, mutant or cognate thereof, such that angiogenesis associated with the angiogenic disease is inhibited.

63. The method of claim 62, wherein the angiogenic disease comprises a tumor associated with a cancer.

64. The method of claim 63, wherein the cancer is selected from the group consisting of breast cancer, lung cancer, head and neck cancer, brain cancer, abdominal cancer, colon cancer, colorectal cancer, esophagus cancer, gastrointestinal cancer, glioma, liver cancer, tongue cancer, neuroblastoma, osteosarcoma, ovarian cancer, pancreatic cancer, prostate cancer, retinoblastoma, Wilm's tumor, multiple myeloma, skin cancer, lymphoma, and blood cancer.

65. The method of claim 62, wherein the angiogenic disease is selected from the group consisting of diabetic retinopathy and age-related macular degeneration.

66. The method of claim 65, wherein the angiogenic disease is age-related macular degeneration.

67. The method of claim 62, wherein the siRNA is administered in combination with a pharmaceutical agent for treating angiogenic disease, which pharmaceutical agent is different from the siRNA.

68. The method of claim 67, wherein angiogenic disease is cancer, and the pharmaceutical agent comprises a chemotherapeutic agent.

69. The method of claim 68, wherein the chemotherapeutic agent is selected from the group consisting of cisplatin, carboplatin, cyclophosphamide, 5-fluorouracil, adriamycin, daunorubicin, and tamoxifen.

70. The method of claim 62, wherein the siRNA is administered to a subject in combination with another therapeutic method designed to treat the angiogenic disease.

71. The method of claim 70, wherein the angiogenic disease is cancer, and the siRNA is administered in combination with radiation therapy, chemotherapy or surgery.

72. A method of treating complications arising from type I diabetes in a subject, comprising administering to a subject in need of such treatment an effective amount of an siRNA comprising a sense RNA strand and an antisense RNA strand, wherein the sense and an antisense RNA strands from an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence substantially identical to a target sequence of about 19 to about 25 contiguous nucleotides in human Ang1, Ang2 or Tie2 mRNA, or an alternative splice form, mutant or cognate thereof.

73. The method of claim 72, wherein the complications arising from type I diabetes are selected from the group consisting of diabetic retinopathy, diabetic neuropathy, diabetic nephropathy and macrovascular disease.

74. The method of claim 73, wherein the macrovascular disease is coronary artery disease, cerebrovascular disease or peripheral vascular disease.