Isolated plant deoxyhypusine synthase and nucleotides encoding same

Abstract

Regulation of expression of programmed cell death, including senescence, in plants is achieved by integration of a gene or gene fragment encoding senescence-induced deoxyhypusine synthase, senescence-induced eIF-5A or both into the plant genome in antisense orientation. Plant genes encoding senescence-induced deoxyhypusine synthase and senescence-induced eIF-5A are identified and the nucleotide sequences of each, alone and in combination are used to modify senescence in transgenic plants.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application is a continuation of U.S. Ser. No. 11/206,810 filed Aug. 19, 2005, which is a continuation of U.S. Ser. No. 09/725,019 filed Nov. 29, 2000, now U.S. Pat. No. 6,878,860, which is a continuation-in-part application of Ser. No. 09/597,771 filed Jun. 19, 2000, now U.S. Pat. No. 6,538,182, which is a continuation-in-part of Ser. No. 09/348,675 filed on Jul. 6, 1999 now abandoned, which are hereby incorporated by reference in their entirety.

SEQUENCE LISTING SUBMISSION VIA EFS-WEB

[0002] A computer readable text file, entitled 061945-5017-03-SequenceListing.txt" created on or about Jun. 20, 2011 with a file size of about 72 kb contains the sequence listing for this application and is hereby incorporated by reference in its entirety.

FIELD OF THE INVENTION

[0003] The present invention relates to polynucleotides which encode plant polypeptides that exhibit senescence-induced expression. The invention also relates to transgenic plants containing the polynucleotides in antisense orientation and methods for controlling programmed cell death, including senescence, in plants. More particularly, the present invention relates to a senescence induced plant deoxyhypusine synthase gene and a senescence-induced eIF-5A gene whose expressions are induced by the onset of programmed cell death, including senescence, and the use of the deoxyhypusine synthase gene and eIF-5A gene, alone or in combination, to control programmed cell death and senescence in plants.

DESCRIPTION OF THE PRIOR ART

[0004] Senescence is the terminal phase of biological development in the life of a plant. It presages death and occurs at various levels of biological organization including the whole plant, organs, flowers and fruit, tissues and individual cells.

[0005] The onset of senescence can be induced by different factors both internal and external. Senescence is a complex, highly regulated developmental stage in the life of a plant or plant tissue, such as fruit, flowers and leaves. Senescence results in the coordinated breakdown of cell membranes and macromolecules and the subsequent mobilization of metabolites to other parts of the plant.

[0006] In addition to the programmed senescence which takes place during normal plant development, death of cells and tissues and ensuing remobilization of metabolites occurs as a coordinated response to external, environmental factors. External factors that induce premature initiation of senescence, which is also referred to as necrosis or apoptosis, include environmental stresses such as temperature, drought, poor light or nutrient supply, as well as pathogen attack. Plant tissues exposed to environmental stress also produce ethylene, commonly known as stress ethylene (Buchanan-Wollaston, V., 1997, J. Exp. Botany, 48:181-199; Wright, M., 1974, Plant, 120:63-69). Ethylene is known to cause senescence in some plants.

[0007] Senescence is not a passive process, but, rather, is an actively regulated process that involves coordinated expression of specific genes. During senescence, the levels of total RNA decrease and the expression of many genes is switched off (Bate et al., 1991, J. Exper. Botany, 42, 801-11; Hensel et al., 1993, The Plant Cell, 5, 553-64). However, there is increasing evidence that the senescence process depends on de novo transcription of nuclear genes. For example, senescence is blocked by inhibitors of mRNA and protein synthesis and enucleation. Molecular studies using mRNA from senescing leaves and green leaves for in vitro translation experiments show a changed pattern of leaf protein products in senescing leaves (Thomas et al, 1992, J. Plant Physiol., 139, 403-12). With the use of differential screening and subtractive hybridization techniques, many cDNA clones representing senescence-induced genes have been identified from a range of different plants, including both monocots and dicots, such as Arabidopsis, maize, cucumber, asparagus, tomato, rice and potato. Identification of genes that are expressed specifically during senescence is hard evidence of the requirement for de novo transcription for senescence to proceed.

[0008] The events that take place during senescence appear to be highly coordinated to allow maximum use of the cellular components before necrosis and death occur. Complex interactions involving the perception of specific signals and the induction of cascades of gene expression must occur to regulate this process. Expression of genes encoding senescence related proteins is probably regulated via common activator proteins that are, in turn, activated directly or indirectly by hormonal signals. Little is known about the mechanisms involved in the initial signaling or subsequent co-ordination of the process.

[0009] Coordinated gene expression requires factors involved in transcription and translation, including initiation factors. Translation initiation factor genes have been isolated and characterized in a variety of organisms, including plants. Eukaryotic translation initiation factor 5A (eIF-5A) is an essential protein factor approximately 17 KDa in size, which is involved in the initiation of eukaryotic cellular protein synthesis. It is characterized by the presence of hypusine [N-(4-amino-2-hydroxybutyl) lysine], a unique modified amino acid, known to be present only in eIF-5A. Hypusine is formed post-translationally via the transfer and hydroxylation of the butylamino group from the polyamine, spermidine, to the side chain amino group of a specific lysine residue in eIF-5A. Activation of eIF-5A involves transfer of the butylamine residue of spermidine to the lysine of eIF-5A, forming hypusine and activating eIF-5A. In eukaryotes, deoxyhypusine synthase (DHS) mediates the post-translational synthesis of hypusine in eIF-5A. A corresponding DHS gene has not been identified in plants, however, it is known that plant eIF-5A contains hypusine. The hypusine modification has been shown to be essential for eIF-5A activity in vitro using a methionyl-puromycin assay.

[0010] Hypusine is uniquely present in eIF-5A and is found in all eukaryotes, some archaebacteria (which appear to be related to eukaryota), but not in eubacteria. Moreover, the amino acid sequence of eIF-5A is highly conserved, especially in the region surrounding the hypusine residue, suggesting that eIF-5A and its activating protein, deoxyhypusine synthase, execute fundamentally important steps in eukaryotic cell physiology (Joe et al., JBC, 270:22386-22392, 1995). eIF-5A has been cloned from human, alfalfa, slime mold, Neurospora crassa, tobacco and yeast. It was originally identified as a general translation initiation factor based on its isolation from ribosomes of rabbit reticulocyte lysates and its in vitro activity in stimulating methionine-puromycin synthesis. However, more recent data indicate that eIF-5A is not a translation initiation factor for global protein synthesis, but rather serves to facilitate the translation of specific subsets of mRNA populations. For example, there is strong evidence from experiments with animal cells and yeast that one or more isoforms of eIF-5A play an essential role in mediating the translation of a subset of mRNAs involved in cell proliferation. There are two isoforms in yeast, and if both genes are silenced the cells are unable to divide (Park et al., Biol. Signals, 6:115-123, 1997). Similarly, silencing the expression of yeast deoxyhypusine synthase, which activates eIF-5A, blocks cell division. Indeed, inhibitors of deoxyhypusine synthase have been developed that are likely to have importance in the therapy of hyperproliferative conditions (Wolff, et al., JBC, 272:15865-15871, 1997). Other studies have indicated that another isoform of eIF-5A is essential for Rev function in HIV-1 replication or Rex function in HTLV V replication (Park, et al., Biol. Signals, 6:115-123, 1997). There are also at least two expressed eIF-5A genes in tobacco. Gene-specific probes indicate that although they are both expressed in all tissues examined, each gene has a distinctive expression pattern, presumably regulating the translation of specific transcripts (Chamot, et al., Nuc. Acids Res., 20:625-669, 1992).

[0011] Deoxyhypusine synthase has been purified from rat testis, HeLa cells, Neurospora crassa and yeast. The amino acid sequence of deoxyhypusine synthase is highly conserved, and the enzymes from different species share similar physical and catalytic properties and display cross-species reactivities with heterologous eIF-5A precursors (Park, et al., 6 Biol. Signals, 6:115-123, 1997).

[0012] Plant polyamines have been implicated in a wide variety of physiological effects including floral induction, embryogenesis, pathogen resistance, cell growth, differentiation and division (Evans et al., 1989, Annu Rev. Plant Physiol. Plant Mol. Biol., 40, 235-269; and Galston, et al., 1990, Plant Physiol., 94, 406-10). It has been suggested that eIF-5A is the intermediary through which polyamines exert their effects (Chamot et al., 1992, Nuc. Acids Res., 20(4), 665-69).

[0013] Two genes encoding isoforms of eIF-5A from Nicotiana have been identified (NeIF-5A1 and NeIF-5A2) (Chamot et al., 1992, Nuc. Acids Res., 20(4), 665-69). The genes were shown to be very similar. However, they display differential patterns of expression. One gene appears to be constitutively expressed at the mRNA level, while the expression pattern of the other correlates with the presence or absence of photosynthetic activity. Based on gene structure and genomic Southern mapping it has been suggested that there is a multigene family of NeIF-5A genes in tobacco. It is likely that there is an eIF-5A isoform that regulates translation of a subset of senescence/necrosis specific mRNA transcripts.

[0014] Presently, there is no widely applicable method for controlling the onset of programmed cell death (including senescence) caused by either internal or external, e.g., environmental stress, factors. It is, therefore, of interest to develop senescence modulating technologies that are applicable to all types of plants and that are effective at the earliest stages in the cascade of events leading to senescence.

SUMMARY OF THE INVENTION

[0015] This invention is based on the discovery and cloning of a full length cDNA clone encoding a tomato senescence-induced deoxyhypusine synthase (DHS), as well as full length senescence-induced DHS cDNA clones from Arabidopsis leaf and carnation petal. The nucleotide sequences and corresponding amino acid sequences are disclosed herein.

[0016] The invention is also based, in part, on the discovery and cloning of full length cDNA clones encoding a senescence-induced eIF-5A gene from tomato, Arabidopsis and carnation. The nucleotide sequence and corresponding amino acid sequence of each of the eIF-5A cDNA clones are disclosed herein.

[0017] The present invention provides a method for genetic modification of plants to control the onset of senescence, either age-related senescence or environmental stress-induced senescence. The senescence-induced DHS nucleotide sequences of the invention, fragments thereof, or combinations of such fragments, are introduced into a plant cell in reverse orientation to inhibit expression of the endogenous senescence-induced DHS gene, thereby reducing the level of endogenous senescence-induced DHS protein, and reducing and/or preventing activation of eIF-5A and ensuing expression of the genes that mediate senescence.

[0018] In another aspect of the invention, the senescence-induced eIF-5A nucleotide sequences of the invention, fragments thereof, or combinations of such fragments, are introduced into a plant cell in reverse orientation to inhibit expression of the endogenous senescence-induced eIF-5A gene, and thereby reduce the level of endogenous senescence-induced eIF-5A protein, and reduce and/or prevent ensuing expression of the genes that mediate senescence. Alternatively, both DHS sequences and eIF-5A sequences can be used together to reduce the levels of endogenous DHS and eIF-5A proteins.

[0019] In yet another aspect, the present invention is directed to a method for genetic modification of plants to control the onset of senescence, either age-related senescence or environmental stress-induced senescence via the introduction into a plant cell of a combination of senescence-induced eIF-5A nucleotide sequences of the invention and senescence-induced DHS nucleotide sequences of the invention in reverse orientation to inhibit expression of the endogenous senescence-induced eIF-5A gene and senescence-induced DHS gene, thereby reducing the level of endogenous senescence-induced DHS protein, and reducing and/or preventing activation of eIF-5A and ensuing expression of the genes that mediate senescence.

[0020] In yet another aspect, the present invention is directed to methods for genetic modification of plants to increase resistance to physiological disease (such as, but not limited to, blossom end rot) via the introduction into a plant cell of a combination of senescence-induced eIF-5A nucleotide sequences of the invention and/or senescence-induced DHS nucleotide sequences of the invention in reverse orientation to inhibit expression of the endogenous senescence-induced eIF-5A gene and/or senescence-induced DHS gene, thereby reducing the level of endogenous senescence-induced DHS protein, and/or reducing and/or preventing activation of eIF-5A and ensuing expression of the genes that mediate senescence. In a particularly preferred aspect, the 3' end of the endogenous senescence-induced DHS in reverse orientation is introduced.

[0021] Using the methods of the invention, transgenic plants are generated and monitored for growth, development and either natural or prematurely-induced senescence. Plants or detached parts of plants (e.g., cuttings, flowers, vegetables, fruits, seeds or leaves) exhibiting prolonged life or shelf life, (e.g., extended life of flowers, reduced fruit or vegetable spoilage, enhanced biomass, increased seed yield, increased resistance to physiological disease (e.g., blossom end rot), reduced seed aging and/or reduced yellowing of leaves) due to reduction in the level of senescence-induced DHS, senescence-induced eIF-5A or both are selected as desired products having improved properties including reduced leaf yellowing, reduced petal abscission, reduced fruit and vegetable spoilage during shipping and storage. These superior plants are propagated. Similarly, plants exhibiting increased resistance to environmental stress, e.g., decreased susceptibility to low temperature (chilling), drought, infection, etc., and/or increased resistance to pathogens and/or physiological disease, are selected as superior products.

[0022] In one aspect, the present invention is directed to an isolated DNA molecule encoding senescence-induced DHS, wherein the DNA molecule hybridizes with SEQ ID NO:1, or a functional derivative of the isolated DNA molecule which hybridizes with SEQ ID NO:1. In one embodiment of this aspect of the invention, the isolated DNA molecule has the nucleotide sequence of SEQ ID NO:1, i.e., 100% complementarity (sequence identity) to SEQ ID NO:1.

[0023] The present invention also is directed to an isolated DNA molecule encoding senescence-induced DHS, wherein the DNA molecule hybridizes with SEQ ID NO:9, or a functional derivative of the isolated DNA molecule which hybridizes with SEQ ID NO:9. In one embodiment of this aspect of the invention, the isolated DNA molecule has the nucleotide sequence of SEQ ID NO:9, i.e., 100% complementarity (sequence identity) to SEQ ID NO:9.

[0024] The present invention also is directed to an isolated DNA molecule encoding senescence-induced eIF-5A, wherein the DNA molecule hybridizes with SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15 or a functional derivative of the isolated DNA molecule which hybridizes with SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15. In one embodiment of this aspect of the invention, the isolated DNA molecule has the nucleotide sequence of SEQ ID NO:11, SEQ ID NO:13, or SEQ ID NO:15, i.e., 100% complementarity (sequence identity) to SEQ ID NO:11, SEQ ID NO:13 or SEQ ID NO:15.

[0025] In another embodiment of the invention, there is provided an isolated protein encoded by a DNA molecule as described herein above, or a functional derivative thereof. A preferred protein has the amino acid sequence of SEQ ID NO:2, or is a functional derivative thereof. Another preferred protein has the amino acid sequence of SEQ ID NO:10, or is a functional derivative thereof. Other preferred proteins of the invention have the amino acid sequence of SEQ ID NO:12, SEQ ID NO:14 or SEQ ID NO: 16.

[0026] Also provided herein is an antisense oligonucleotide or polynucleotide encoding an RNA molecule which is complementary to a corresponding portion of an RNA transcript of a DNA molecule described herein above, wherein the oligonucleotide or polynucleotide hybridizes with the RNA transcript such that expression of endogenous senescence-induced DHS is altered. In another embodiment of this aspect of the invention, the antisense oligonucleotide or polynucleotide is an RNA molecule that hybridizes to a corresponding portion of an RNA transcript of a DNA molecule described herein above, such that expression of endogenous senescence-induced eIF-5A is altered. The antisense oligonucleotide or polynucleotide can be full length or preferably has about six to about 100 nucleotides.

[0027] The antisense oligonucleotide or polynucleotide may be substantially complementary to a corresponding portion of one strand of a DNA molecule encoding senescence-induced DHS, wherein the DNA molecule encoding senescence-induced DHS hybridizes with SEQ ID NO:1, SEQ ID NO:5, SEQ ID NO:9, or with a combination thereof, or is substantially complementary to at least a corresponding portion of an RNA sequence encoded by the DNA molecule encoding senescence-induced DHS. In one embodiment of the invention, the antisense oligonucleotide or polynucleotide is substantially complementary to a corresponding portion of one strand of the nucleotide sequence SEQ ID NO:1, SEQ ID NO:5, SEQ ID NO:9 or with a combination thereof, or the RNA transcript transcribed from SEQ ID NO:1, SEQ ID NO:5, SEQ ID NO:9 or with a combination thereof. In another embodiment, the antisense oligonucleotide is substantially complementary to a corresponding portion of the 5' non-coding portion or 3' portion of one strand of a DNA molecule encoding senescence-induced DHS, wherein the DNA molecule hybridizes with SEQ ID NO:1, SEQ ID NO:5, SEQ ID NO:9 or with a combination thereof.

[0028] Alternatively, the antisense oligonucleotide or polynucleotide may be substantially complementary to a corresponding portion of one strand of a DNA molecule encoding senescence-induced eIF-5A, wherein the DNA molecule encoding senescence-induced eIF-5A hybridizes with SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or any combination thereof, or is substantially complementary to at least a corresponding portion of an RNA sequence transcribed from SEQ ID NO:11, SEQ ID NO:13 or SEQ ID NO:15. In one embodiment of the invention, the antisense oligonucleotide or polynucleotide is substantially complementary to a corresponding portion of one strand of the nucleotide sequence SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15 or a combination thereof, or the RNA transcript encoded is substantially complementary to a corresponding portion of an RNA sequence encoded by a DNA molecule encoding senescence-induced eIF-5A. In another embodiment, the antisense oligonucleotide is substantially complementary to a corresponding portion of the 5' non-coding region or 3' region of one strand of a DNA molecule encoding senescence-induced eIF-5A, wherein the DNA molecule hybridizes with SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15 or a combination thereof.

[0029] The invention is further directed to a vector for transformation of plant cells, comprising [0030] (a) an antisense oligo- or polynucleotide substantially complementary to (1) a corresponding portion of one strand of a DNA molecule encoding senescence-induced DHS, wherein the DNA molecule encoding senescence-induced DHS hybridizes with SEQ ID NO:1, SEQ ID NO:5 or SEQ ID NO:9, or (2) a corresponding portion of an RNA sequence encoded by the DNA molecule encoding senescence-induced DHS; and [0031] (b) regulatory sequences operatively linked to the antisense oligo- or polynucleotide such that the antisense oligo- or polynucleotide is expressed in a plant cell into which it is transformed.

[0032] The invention is further directed to a vector for transformation of plant cells, comprising [0033] (a) an antisense oligo- or polynucleotide substantially complementary to (1) a corresponding portion of one strand of a DNA molecule encoding senescence-induced eIF-5A, wherein the DNA molecule encoding senescence-induced eIF-5A hybridizes with SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15 or (2) a corresponding portion of an RNA sequence encoded by the DNA molecule encoding senescence-induced eIF-5A; and [0034] (b) regulatory sequences operatively linked to the antisense oligo- or polynucleotide such that the antisense oligo- or polynucleotide is expressed in a plant cell into which it is transformed.

[0035] The regulatory sequences include a promoter functional in the transformed plant cell, which promoter may be inducible or constitutive. Optionally, the regulatory sequences include a polyadenylation signal.

[0036] The invention also provides a plant cell transformed with a vector or combination of vectors as described above, a plantlet or mature plant generated from such a cell, or a plant part of such a plantlet or plant.

[0037] The present invention is further directed to a method of producing a plant having a reduced level of senescence-induced DHS, senescence-induced eIF-5A or both compared to an unmodified plant, comprising: [0038] (1) transforming a plant with a vector or combination of vectors as described above; [0039] (2) allowing the plant to grow to at least a plantlet stage; [0040] (3) assaying the transformed plant or plantlet for altered senescence-induced DHS activity and/or eIF-5A activity and/or altered senescence and/or altered environmental stress-induced senescence and/or pathogen-induced senescence and/or ethylene-induced senescence; and [0041] (4) selecting and growing a plant having altered senescence-induced DHS activity and/or reduced eIF-5A and/or altered senescence and/or altered environmental stress-induced senescence and/or altered pathogen-induced senescence and/or ethylene-induced senescence compared to a non-transformed plant.

[0042] Plants produced as above, or progeny, hybrids, clones or plant parts preferably exhibit reduced senescence-induced DHS expression, reduced senescence-induced eIF-5A activity, or both and delayed senescence and/or delayed stress-induced senescence and/or pathogen-induced senescence and/or ethylene-induced senescence.

[0043] This invention is further directed to a method of inhibiting expression of endogenous senescence-induced DHS in a plant cell, said method comprising: [0044] (1) integrating into the genome of a plant a vector comprising [0045] (A) an antisense oligo- or polynucleotide complementary to (I) at least a portion of one strand of a DNA molecule encoding endogenous senescence-induced DHS, wherein the DNA molecule encoding the endogenous senescence-induced DHS hybridizes with SEQ ID NO:1, SEQ ID NO:5 and/or SEQ ID NO. 9, or (ii) at least a portion of an RNA sequence encoded by the endogenous senescence-induced DHS gene; and [0046] (B) regulatory sequences operatively linked to the antisense oligo- or polynucleotide such that the antisense oligo- or polynucleotide is expressed; and [0047] (2) growing said plant, whereby said antisense oligo- or polynucleotide is transcribed and the transcript binds to said endogenous RNA whereby expression of said senescence-induced DHS gene is inhibited.

[0048] This invention is further directed to a method of inhibiting expression of endogenous senescence-induced eIF-5A in a plant cell, said method comprising: [0049] (1) integrating into the genome of a plant a vector comprising [0050] (A) an antisense oligo- or polynucleotide complementary to (i) a corresponding portion of one strand of a DNA molecule encoding endogenous senescence-induced eIF-5A, wherein the DNA molecule encoding the endogenous senescence-induced eIF-5A hybridizes with SEQ ID NO:11, SEQ ID NO:15, SEQ ID NO:17 or a combination thereof, or (ii) at least a portion of an RNA sequence encoded by the endogenous senescence-induced eIF-5A gene; and [0051] (B) regulatory sequences operatively linked to the antisense oligo- or polynucleotide such that the antisense oligo- or polynucleotide is expressed; and [0052] (2) growing said plant, whereby said antisense oligo- or polynucleotide is transcribed and the transcript binds to said endogenous RNA whereby expression of said senescence-induced eIF-5A gene is inhibited.

BRIEF DESCRIPTION OF THE DRAWINGS

[0053] FIG. 1 depicts the nucleotide sequence of the senescence-induced tomato leaf DHS cDNA sequence (nucleotides 1-1583 of SEQ ID NO:1) and the derived amino acid sequence (SEQ ID NO. 2) obtained from a tomato leaf cDNA library.

[0054] FIG. 2A depicts the nucleotide sequence of an Arabidopsis DHS gene obtained by aligning the tomato DHS sequence with unidentified genomic sequences in the Arabidopsis gene bank (http://genome-www.stanford.edu/Arabidopsis/) (SEQ ID NO:5). The gaps between amino acid sequences are predicted introns (SEQ ID NO: 6). FIG. 2B depicts the derived Arabidopsis DHS amino acid sequence (SEQ ID NO:6). FIG. 2C depicts the nucleotide sequence (SEQ ID NO: 26) of a 600 base pair senescence-induced Arabidopsis DHS cDNA obtained by PCR. FIG. 2D depicts the derived amino acid sequence (SEQ ID NO: 32) of the senescence-induced Arabidopsis DHS cDNA fragment.

[0055] FIG. 3 is an alignment of the derived full length tomato leaf senescence-induced DHS amino acid sequence (residues 1-369 of SEQ ID NO: 2) and the derived full length Arabidopsis senescence-induced DHS amino acid sequence (SEQ ID NO: 6) with sequences of DHS proteins of human (SEQ ID NO: 48), yeast (SEQ ID NO: 37), fungi, and Archaeobacteria (SEQ ID NO: 38). Identical amino acids among three or four of the sequences are boxed.

[0056] FIG. 4 is a restriction map of the tomato DHS cDNA.

[0057] FIG. 5 is a Southern blot of genomic DNA isolated from tomato leaves and probed with .sup.32P-dCTP-labeled full length tomato senescence-induced DHS cDNA.

[0058] FIG. 6 is a Northern blot of RNA isolated from tomato flowers at different stages of development. FIG. 6A is the ethidium bromide stained gel of total RNA. Each lane contains 10 .mu.g RNA. FIG. 6B is an autoradiograph of the Northern blot probed with .sup.32P-dCTP-labeled full length tomato senescence-induced DHS cDNA.

[0059] FIG. 7 is a Northern blot of RNA isolated from tomato fruit at various stages of ripening that was probed with .sup.32P-dCTP-labelled full length tomato senescence-induced DHS cDNA. Each lane contains 10 .mu.g RNA.

[0060] FIG. 8 is a Northern blot of RNA isolated from tomato leaves that had been drought-stressed by treatment with 2 M sorbitol for six hours. Each lane contains 10 .mu.g RNA. The blot was probed with .sup.32P-dCTP-labelled full length tomato senescence-induced DHS cDNA.

[0061] FIG. 9 is a Northern blot of RNA isolated from tomato leaves that had been exposed to chilling temperature. FIG. 9A is the ethidium bromide stained gel of total RNA. Each lane contained 10 .mu.g RNA. FIG. 9B is an autoradiograph of the Northern blot probed with .sup.32P-dCTP-labelled full length tomato senescence-induced DHS cDNA. FIG. 9C shows corresponding leakage data measured as conductivity of leaf diffusates.

[0062] FIG. 10 is the carnation DHS full-length (1384 base pairs) cDNA clone nucleotide sequence (SEQ ID NO: 9) not including the PolyA tail and 5' end non-coding region. The derived amino acid sequence is shown below the nucleotide sequence (373 amino acids). (SEQ ID NO:10).

[0063] FIG. 11 is a Northern blot of total RNA from senescing Arabidopsis leaves probed with .sup.32P-dCTP-labelled full-length Arabidopsis senescence-induced DHS cDNA. The autoradiograph is at the top, the ethidium stained gel below.

[0064] FIG. 12 is a Northern blot of total RNA isolated from petals of carnation flowers at various stages. The blot was probed with .sup.32P-dCTP-labelled full-length carnation senescence-induced DHS cDNA. The autoradiograph is at the top, the ethidium stained gel below.

[0065] FIG. 13 is the nucleotide (top) (SEQ ID NO:11) and derived amino acid (bottom) (SEQ ID NO:12) sequence of the tomato fruit senescence-induced eIF-5A gene.

[0066] FIG. 14 is the nucleotide (top) (SEQ ID NO:13) and derived amino acid (bottom) (SEQ ID NO:14) sequence of the carnation senescence-induced eIF-5A gene.

[0067] FIG. 15 is the nucleotide (top) (SEQ ID NO:15) and derived amino acid (bottom) (SEQ ID NO:16) sequence of the Arabidopsis senescence-induced eIF-5A gene.

[0068] FIG. 16 is a Northern blot of total RNA isolated from leaves of Arabidopsis plants at various developmental stages. The blot was probed with .sup.32P-dCTP-labelled full-length Arabidopsis senescence-induced DHS cDNA and full-length senescence-induced eIF-5A. The autoradiograph is at the top, the ethidium stained gel below.

[0069] FIG. 17 is a Northern blot of total RNA isolated from tomato fruit at breaker (BK), red-firm (RF) and red-soft (RS) stages of development. The blot was probed with .sup.32P-dCTP-labelled full-length senescence-induced DHS cDNA and full-length senescence-induced eIF-5A. DHS and eIF-5A are up-regulated in parallel in red-soft fruit coincident with fruit ripening. The autoradiograph is at the top, the ethidium stained gel below.

[0070] FIG. 18 is a Northern blot of total RNA isolated from leaves of tomato that were treated with sorbitol to induce drought stress. C is control; S is sorbitol treated. The blot was probed with .sup.32P-dCTP-labelled full-length senescence-induced DHS cDNA and full-length senescence-induced eIF-5A. Both eIF-5A and DHS are up-regulated in response to drought stress. The autoradiograph is at the top, the ethidium stained gel below.

[0071] FIG. 19 is a Northern blot of total RNA isolated from flower buds and open senescing flowers of tomato plants. The blot was probed with .sup.32P-dCTP-labelled full-length senescence-induced DHS cDNA and full-length senescence-induced eIF-5A. Both eIF-5A and DHS are up-regulated in open/senescing flowers. The autoradiograph is at the top, the ethidium stained gel below.

[0072] FIG. 20 is a Northern blot of total RNA isolated from chill-injured tomato leaves. The blot was probed with .sup.32P-dCTP-labelled full-length senescence-induced DHS cDNA and full-length senescence-induced eIF-5A. Both eIF-5A and DHS are up-regulated with the development of chilling injury during rewarming The autoradiograph is at the top, the ethidium stained gel below.

[0073] FIG. 21 is a photograph of 3.1 week old Arabidopsis wild-type (left) and transgenic plants expressing the 3'-end of the senescence DHS gene (sequence shown in FIG. 36) in antisense orientation showing increased leaf size in the transgenic plants.

[0074] FIG. 22 is a photograph of 4.6 week old Arabidopsis wild-type (left) and transgenic plants expressing the 3'-end of the senescence DHS gene (sequence shown in FIG. 36) in antisense orientation showing increased leaf size in the transgenic plants.

[0075] FIG. 23 is a photograph of 5.6 week old Arabidopsis wild-type (left) and transgenic plants expressing the 3'-end of the senescence DHS gene (sequence shown in FIG. 36) in antisense orientation showing increased leaf size in the transgenic plants.

[0076] FIG. 24 is a photograph of 6.1 week old Arabidopsis wild-type (left) and transgenic plants expressing the 3'-end of the senescence DHS gene (sequence shown in FIG. 36) in antisense orientation showing increased size of transgenic plants.

[0077] FIG. 25 is a graph showing the increase in seed yield from three T.sub.1 transgenic Arabidopsis plant lines expressing the senescence-induced DHS gene in antisense orientation. Seed yield is expressed as volume of seed. SE for n=30 is shown for wild-type plants.

[0078] FIG. 26 is a photograph of transgenic tomato plants expressing the 3'-end of the senescence DHS gene (sequence shown in FIG. 36) in antisense orientation (left) and wild-type plants (right) showing increased leaf size and increased plant size in the transgenic plants. The photograph was taken 18 days after transfer of the plantlets to soil.

[0079] FIG. 27 is a photograph of transgenic tomato plants expressing the 3'-end of the senescence DHS gene (sequence shown in FIG. 36) in antisense orientation (left) and wild-type plants (right) showing increased leaf size and increased plant size in the transgenic plants. The photograph was taken 32 days after transfer of the plantlets to soil.

[0080] FIGS. 28 through 35 are photographs of tomato fruit from wild-type (top panels) and transgenic plants expressing the full-length senescence DHS gene in antisense orientation (bottom panels). Fruit were harvested at the breaker stage of development and ripened in a growth chamber. Days after harvest are indicated in the upper left corner of each panel.

[0081] FIG. 36 is the nucleotide (top & bottom) (SEQ ID NO:30) and derived amino acid (top & bottom) SEQ ID NO: 34) sequences of the 3'-end of the Arabidopsis senescence-induced DHS gene used in antisense orientation to transform plants.

[0082] FIG. 37 is the nucleotide (top & bottom) (SEQ ID NO:31) and derived amino acid (top) (SEQ ID NO: 35) sequences of the 3'-end of the tomato senescence-induced DHS gene used in antisense orientation to transform plants.

[0083] FIG. 38 is the nucleotide (top) (SEQ ID NO:26) and derived amino acid (bottom) (SEQ ID NO: 32) sequence of a 600 base pair Arabidopsis senescence-induced DHS probe used to isolate the full-length Arabidopsis gene.

[0084] FIG. 39 is the nucleotide (top) (SEQ ID NO:27) and derived amino acid (bottom) (SEQ ID NO: 33) sequence of the 483 base pair carnation senescence-induced DHS probe used to isolate the full-length carnation gene.

[0085] FIGS. 40 (a) and (b) are photographs of tomato fruits from transgenic tomato plants expressing the 3'-end of the senescence DHS gene (sequence shown in FIG. 37) in antisense orientation (right) and tomato fruits from wild-type plants (left). While the wild-type fruit exhibits blossom end rot, the transgenic fruit does not.

DETAILED DESCRIPTION OF THE INVENTION

[0086] Methods and compositions are provided for altering the expression of senescence-induced DHS gene(s), senescence-induced eIF-5A gene(s) or both in plant cells. Alteration of expression of senescence-induced DHS and senescence-induced eIF-5A, either alone or in combination, in plants results in delayed onset of senescence and improved resistance to environmental stress and pathogens, thus extending the plant shelf-life and/or growth period.

[0087] A full length cDNA sequence encoding a tomato DHS gene exhibiting senescence-induced expression has been isolated by reverse transcriptase mediated polymerase chain reaction (RT-PCR) using RNA isolated from chill-injured tomato leaves as a template and using the RT-PCR product to screen a chill-injured, sorbitol-treated tomato leaf cDNA library. Polynucleotide probes corresponding to selected regions of the isolated tomato leaf cDNA sequence as well as the full length tomato leaf cDNA were used to determine the presence of mRNA encoding the DHS gene in environmentally stressed (chilled) tomato leaves, (dehydrated) sorbitol-treated tomato leaves, ripening tomato fruit and senescing tomato blossoms.

[0088] Primers designed from an Arabidopsis DHS genomic clone were used to generate a polymerase chain reaction (PCR) product using a senescing Arabidopsis leaf cDNA library as template. The Arabidopsis nucleotide sequence has 73% nucleotide sequence identity and 81% amino acid sequence identity with the corresponding sequence of the senescence-induced tomato DHS.

[0089] The senescence-induced tomato DHS gene of the present invention was isolated by using RT-PCR. The upstream primer used to isolate the tomato DHS gene is a 24 nucleotide primer: 5' AG TCT AGA AGG TGC TCG TCC TGA T 3' (SEQ ID NO. 3); the downstream primer contains 34 nucleotides: 5' G ACT GCA GTC GAC ATC GAT (T).sub.15 3' (SEQ ID NO. 4). Using 100 .mu.mol of the downstream primer, a first strand of cDNA was isolated using standard RT-PCR. The first strand was then used as template in a RT-PCR, using both the upstream and downstream primers. Separation of the RT-PCR products on an agarose gel revealed the presence of three distinct bands ranging in size from 1.5 kb to 600 bp. The three fragments were subcloned into the plasmid vector, pBluescript.TM. (Stratagene Cloning Systems, LaJolla, Calif.) using XbaI and SalI cloning sites present in the upstream and downstream primers, respectively, and sequenced. The sequences of the fragments were compared and aligned with sequences present in the GeneBank data base. The results showed the 1.5 kb and 1 kb fragments to be tomato DHS sequence. The 600 by fragment also aligned with human, yeast and Neurospora DHS sequences.

[0090] The 600 by RT-PCR fragment was used to screen a tomato (cv. Match F1 hybrid) cDNA library made from RNA obtained from tomato leaves that had been treated with 2 M sorbitol for six hours to induce dehydration. The cDNA library was constructed using a .lamda.Zap.TM. (Stratagene Cloning Systems, LaJolla, Calif.) cDNA library kit. Three identical positive full-length cDNA clones corresponding to the senescence-induced DHS gene were obtained and sequenced. The nucleotide sequence of the senescence-induced DHS cDNA clone is shown in SEQ ID NO:1. The cDNA clone encodes a 381 amino acid polypeptide (SEQ ID NO: 2) having a calculated molecular mass of 42.1 KDa.

[0091] Based on the expression pattern of the gene in developing and stressed tomato flowers, fruit and leaves, it is involved in senescence.

[0092] The tomato DHS cDNA sequence was aligned with unidentified genomic sequences in the Arabidopsis thaliana genome bank (http://genome-www.stanford.edu/Arabidopsis). The results showed alignment with an unidentified Arabidopsis genomic sequence (AB107060). The alignment information was used to identify an open reading frame in the Arabidopsis sequence and generate predicted amino acid sequence therefrom. The resulting nucleotide and amino acid sequences of the aligned Arabidopsis DHS gene are designated as SEQ ID NO. 5 (FIG. 2A) and SEQ ID NO. 6, respectively.

[0093] Two primers based on short regions of the identified Arabidopsis DHS sequence were generated: primer 1, 5' GGTGGTGTTGAGGAAGATC 3' (SEQ ID NO. 7); and primer 2, 5' GGTGCACGCCCTGATGAAGC 3' (SEQ ID NO. 8). An Arabidopsis senescing leaf cDNA library was used as template for the two primers in a standard PCR. A 600 by PCR product was isolated and sequenced and shown to have an identical sequence as that of the corresponding fragment of the genomic DHS sequence.

[0094] The full-length senescence-induced tomato DHS cDNA clone was also used to isolate full-length senescence-induced Arabidopsis and carnation DHS cDNA clones. The Arabidopsis and carnation DHS cDNA clones were isolated by screening a senescing Arabidopsis leaf cDNA library and a senescencing carnation petal cDNA library, respectively, using the full-length tomato DHS cDNA clone as probe. cDNA clones obtained from the cDNA libraries were then sequenced. The nucleotide sequence of the Arabidopsis full-length cDNA clone isolated in this manner has the same sequence as the coding region of the Arabidopsis genomic sequence identified as encoding Arabidopsis DHS by alignment with the tomato cDNA sequence. (FIG. 2A, SEQ ID NO: 5). The nucleotide sequence of the full-length carnation petal senescence-induced DHS clone and derived amino acid sequence are shown in FIG. 10 (SEQ ID NO:9 and SEQ ID NO:10, respectively).

[0095] Thus, the cDNA sequences of the invention, encoding DHS from tomato, carnation and Arabidopsis can be used as probe in a similar manner to isolate DHS genes from other plants, which can then be used to alter senescence in transgenic plants.

[0096] The senescence-induced DHS gene appears to be a member of a DHS gene family. Genomic Southern blot analysis of tomato leaf DNA was carried out using genomic DNA extracted from a hybrid plant. The DNA was cut with various restriction enzymes that recognize a single site within the coding region of the DHS gene or which do not recognize any sites within the open reading frame of the DHS gene. A restriction map for tomato DHS is shown in FIG. 4.

[0097] Restriction enzyme digested tomato leaf genomic DNA was probed with .sup.32P-dCTP-labeled full length tomato DHS cDNA. Hybridization under high stringency conditions revealed hybridization of the full length cDNA probe to two to three restriction fragments for each restriction enzyme digested DNA sample. Of particular note, when tomato leaf genomic DNA was digested with XbaI and EcoRI, which have restriction sites within the open reading frame of DHS (FIG. 4), more than two restriction fragments were detectable in the Southern blot (FIG. 5). Genomic DNA from cv Match F1, a hybrid variety, and the homozygous line, UCT5, yielded the same pattern of restriction fragments. These results suggest that there are two or more isoforms of the DHS gene in tomato plants. As shown in FIG. 3, the DHS gene is highly conserved across species and so it would be expected that there is a significant amount of conservation between isoforms within any species.

[0098] Northern blots of tomato flower total RNA probed with the full length tomato cDNA show that the expression of the senescence-induced DHS gene is significantly induced in tomato blossoms, but expression is barely detectable in the buds (FIG. 6). Northern blot analysis of DHS expression during various developmental stages of tomato fruit demonstrate that the DHS gene is expressed at low levels in breaker and pink fruit, whereas DHS expression in red (ripe) tomato fruit is significantly enhanced (FIG. 7).

[0099] Northern blot analyses also demonstrate that the senescence-induced DHS gene is induced by environmental stress conditions, e.g., dehydration (FIG. 8) and chilling (FIG. 9). Tomato leaves that had been treated with 2 M sorbitol to induce dehydration demonstrate induction of DHS expression in the dehydrated leaves compared to non-treated leaves (FIG. 8). Plants that have been exposed to chilling temperatures and returned to ambient temperature show induced expression of the senescence-induced DHS gene coincident with the development of chilling injury symptoms (e.g., leakiness) (FIG. 9). The overall pattern of gene expression in tomato plants and various plant tissues, e.g., leaves, fruit and flowers, demonstrates that the DHS gene of the invention is involved in the initiation of senescence in these plants and plant tissues.

[0100] Similar results in terms of induction of DHS gene expression are observed with the onset of leaf senescence in Arabidopsis and petal senescence in carnation. Northern blot analyses of Arabidopsis leaf total RNA isolated from plants of various ages show that the expression of the senescence-induced DHS gene is not evident in young (five-week-old plants), but begins to appear at about six weeks. Expression of the DHS gene is significantly induced by seven weeks. Northern blot analysis indicates that the Arabidopsis DHS gene is significantly enhanced as the plant ages. (FIG. 11).

[0101] Northern blot analyses also demonstrate that the DHS gene is similarly regulated in flowering plants, such as the carnation. (FIG. 12) Northern blot analyses of total RNA isolated from petals of carnation flowers of various ages show that the expression of carnation DHS is significantly induced in petals from flowers that have symptoms of age-induced senescence such as petal inrolling, which is the first morphological manifestation of senescence, but expression is much lower in tight-bud flowers. Petals from carnation flowers that are just beginning to open have significantly more DHS expression than flowers in the tight-bud stage, and petals from flowers that are fully open also show enhanced expression of DHS.

[0102] Thus, it is expected that by substantially repressing or altering the expression of the senescence-induced DHS gene in plant tissues, deterioration and spoilage can be delayed, increasing the shelf-life of perishable fruits, flowers, and vegetables, and plants and their tissues can be rendered more stress-tolerant and pathogen resistant. This can be achieved by producing transgenic plants in which the DHS cDNA or an oligonucleotide fragment thereof is expressed in the antisense configuration in fruits, flowers, leaves and vegetables, preferably using a constitutive promoter such as the CaMV 35S promoter, or using a tissue-specific or senescence/stress-inducible promoter.

[0103] Another gene, eIF-5A, which is involved in the induction of senescence related morphological changes in plants has also been isolated and sequenced herein and like the DHS, it can be used to alter senescence and senescence-related processes in plants, preferably, by introduction in antisense orientation into plants. A full-length senescence-induced eIF-5A cDNA clone was isolated from each of ripening tomato fruit, senescing Arabidopsis leaf and senescing carnation flower cDNA libraries. The nucleotide and derived amino acid sequences of each of the full length clones is shown in FIGS. 13 (tomato senescence-induced eIF-5A), 14 (carnation senescence-induced eIF-5A) and 15 (Arabidopsis senescence-induced eIF-5A). The nucleotide sequence of each of these cDNA clones is also shown as SEQ ID NO: 11 (tomato) (FIG. 13), SEQ ID NO:13 (carnation) (FIG. 14) and SEQ ID NO:15 (Arabidopsis) (FIG. 15). The derived amino acid sequence of each of the genes is shown as SEQ ID NO:12 (FIG. 13), SEQ ID NO:14 (FIG. 14) and SEQ ID NO:16 (FIG. 15), respectively.

[0104] As is the case with the DHS gene sequences described herein, the eIF-5A sequence of the present invention can be used to isolate eIF-5A genes from other plants. The isolated eIF-5A sequences can be used to alter senescence and senescence-related processes in plants. Isolation of eIF-5A sequences from plants can be achieved using art known methods, based on sequences similarities of at least about 70% across species.

[0105] Parallel induction of eIF-5A and DHS occurs in plants during senescence. Northern blot analyses demonstrate that eIF-5A is upregulated in parallel with DHS at the onset of both natural and stress-induced senescence. (FIGS. 16 through 20) For example, Northern blot analyses of total RNA isolated from leaves of Arabidopsis plants at various ages demonstrate that from the time leaf senescence is evident in the plant the expression of eIF-5A is induced and expression is significantly enhanced as senescence progresses. In fruit bearing plants, such as tomato, eIF-5A and DHS are upregulated in parallel in red-soft fruit coincident with the onset of fruit softening and spoilage. (FIG. 17)

[0106] Northern blot analysis also demonstrates that eIF-5A and DHS are upregulated in parallel in plants in response to environmental stress, such as drought (FIG. 18) and chilling injury (FIG. 20). Similarly, in flowering plants, eIF-5A and DHS are upregulated in parallel in open flowers and expression of both genes continues to be enhanced through the later stages of flowering.

[0107] The cloned senescence-induced DHS gene, fragment(s) thereof, or cloned senescence-induced eIF-5A gene or fragment(s) thereof, or combinations of eIF-5A and DHS sequences, when introduced in reverse orientation (antisense) under control of a constitutive promoter, such as the fig wart mosaic virus 35S promoter, cauliflower mosaic virus promoter CaMV35S, double 35S promoter or MAS promoter, can be used to genetically modify plants and alter senescence in the modified plants. Selected antisense sequences from other plants which share sufficient sequence identity with the tomato, Arabidopsis or carnation senescence-induced DHS genes or senescence-induced eIF-5A genes can be used to achieve similar genetic modification. One result of the genetic modification is a reduction in the amount of endogenous translatable senescence-induced DHS-encoding mRNA, eIF-5A-encoding mRNA or both. Consequently, the amount of senescence-induced DHS and/or senescence-induced eIF-5A produced in the plant cells is reduced, thereby reducing the amount of activated eIF-5A, which in turn reduces translation of senescence induced proteins, including senescence-induced lipase, senescence-induced proteases and senescence-induced nucleases. Senescence is thus inhibited or delayed, since de novo protein synthesis is required for the onset of senescence.

[0108] For example, Arabidopsis plants transformed with vectors that express either the full-length or 3'-region of the Arabidopsis senescence-induced DHS gene (SEQ ID NO:26) (FIG. 38) in antisense orientation, under regulation of a double 35S promoter exhibit increased biomass, e.g., larger leaf size and overall larger plant growth throughout all stages of growth, and delayed leaf senescence in comparison to control plants as shown in FIGS. 21 through 24.

[0109] The effect of reduced expression of the senescence-induced DHS gene brought about by expressing either the full-length or 3' coding region of the Arabidopsis senescence-induced DHS gene in antisense orientation in transgenic Arabidopsis plants is also seen as an increase in seed yield in the transformed plants. Arabidopsis plant lines expressing the antisense 3' non-coding region of the Arabidopsis senescence-induced DHS gene produce up to six times more seed than wild type plants. (FIG. 25)

[0110] Similar results are obtained with tomato plants transformed with the 3' end of the tomato senescence-induced DHS gene (SEQ ID NO:27) in antisense orientation and under regulation of a double 35S promoter. Plants transformed with the 3' end of the gene in antisense orientation show increased leaf size and increased plant size in comparison to control (non-transformed) tomato plants. (FIGS. 26 and 27)

[0111] Tomato plants transformed with the full length tomato senescence-induced DHS in antisense orientation produce fruit that exhibits delayed softening and spoilage in comparison to wild type plants. (FIGS. 28 through 35). Thus, the methods and sequences of the present invention can be used to delay fruit softening and spoilage, as well as to increase plant biomass and seed yield and in general, delay senescence in plants.

[0112] Tomato fruits of tomato plants transformed with vectors that express the 3'-region of the tomato senescence-induced DHS gene (SEQ ID NO:31) (FIG. 37) in antisense orientation, under regulation of a double 35S promoter exhibit increased resistance to blossom end rot, a physiological disease, in comparison to control plants as shown in FIG. 40.

[0113] The isolated nucleotide sequences of this invention can be used to isolate substantially complementary DHS and' or eIF-5A nucleotide sequence from other plants or organisms. These sequences can, in turn, be used to transform plants and thereby alter senescence of the transformed plants in the same manner as shown with the use of the isolated nucleotide sequences shown herein.

[0114] The genetic modifications obtained with transformation of plants with DHS, eIF-5A, fragments thereof or combinations thereof can effect a permanent change in levels of senescence-induced DHS, eIF-5A or both in the plant and be propagated in offspring plants by selfing or other reproductive schemes. The genetically altered plant is used to produce a new variety or line of plants wherein the alteration is stably transmitted from generation to generation. The present invention provides for the first time the appropriate DNA sequences which may be used to achieve a stable genetic modification of senescence in a wide range of different plants.

[0115] For the identification and isolation of the senescence-induced DHS gene and eIF-5A gene, in general, preparation of plasmid DNA, restriction enzyme digestion, agarose gel electrophoresis of DNA, polyacrylamide gel electrophoresis of protein, PCR, RT-PCR, Southern blots, Northern blots, DNA ligation and bacterial transformation were carried out using conventional methods well-known in the art. See, for example, Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Press, Cold Spring Harbor, N.Y., 1989. Techniques of nucleic acid hybridization are disclosed by Sambrook (Supra).

[0116] As used herein, the term "plant" refers to either a whole plant, a plant part, a plant cell or a group of plant cells. The type of plant which can be used in the methods of the invention is not limited and includes, for example, ethylene-sensitive and ethylene-insensitive plants; fruit bearing plants such as apricots, apples, oranges, bananas, grapefruit, pears, tomatoes, strawberries, avocados, etc.; vegetables such as carrots, peas, lettuce, cabbage, turnips, potatoes, broccoli, asparagus, etc.; flowers such as carnations, roses, mums, etc.; agronomic crop plants and forest species such as corn, rice, soybean, alfalfa and the like; and in general, any plant that can take up and express the DNA molecules of the present invention. It may include plants of a variety of ploidy levels, including haploid, diploid, tetraploid and polyploid. The plant may be either a monocotyledon or dicotyledon.

[0117] A transgenic plant is defined herein as a plant which is genetically modified in some way, including but not limited to a plant which has incorporated heterologous or homologous senescence-induced DHS DNA or modified DNA or some portion of heterologous senescence-induced DHS DNA or homologous senescence-induced DHS DNA into its genome. Alternatively a transgenic plant of the invention may have incorporated heterologous or homologous senescence-induced eIF-5A DNA or modified DNA or some portion of heterologous senescence-induced eIF-5A DNA or homologous senescence-induced eIF-5A DNA into its genome. Transgenic plants of the invention may have incorporated heterologous or homologous senescence-induced DHS and eIF-5A DNA or modified DNA or some portion of heterologous senescence-induced DHS and eIF-5A DNA or homologous senescence-induced DHS DNA or a combination of heterologous and homologous DHS and eIF-5A sequences into its genome. The altered genetic material may encode a protein, comprise a regulatory or control sequence, or may be or include an antisense sequence or encode an antisense RNA which is antisense to the endogenous senescence-induced DHS or eIF-5A DNA or mRNA sequence or portion thereof of the plant. A "transgene" or "transgenic sequence" is defined as a foreign gene or partial sequence which has been incorporated into a transgenic plant.

[0118] The term "hybridization" as used herein is generally used to mean hybridization of nucleic acids at appropriate conditions of stringency as would be readily evident to those skilled in the art depending upon the nature of the probe sequence and target sequences. Conditions of hybridization and washing are well known in the art, and the adjustment of conditions depending upon the desired stringency by varying incubation time, temperature and/or ionic strength of the solution are readily accomplished. See, for example, Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor Press, Cold Spring Harbor, N.Y., 1989. The choice of conditions is dictated by the length of the sequences being hybridized, in particular, the length of the probe sequence, the relative G-C content of the nucleic acids and the amount of mismatches to be permitted. Low stringency conditions are preferred when partial hybridization between strands that have lesser degrees of complementarity is desired. When perfect or near perfect complementarity is desired, high stringency conditions are preferred. For typical high stringency conditions, the hybridization solution contains 6.times.S.S.C., 0.01 M EDTA, 1.times.Denhardt's solution and 0.5% SDS. Hybridization is carried out at about 68.degree. C. for about 3 to 4 hours for fragments of cloned DNA and for about 12 to about 16 hours for total eukaryotic DNA. For lower stringencies the temperature of hybridization is reduced to about 42.degree. C. below the melting temperature (TM) of the duplex. The TM is known to be a function of the G-C content and duplex length as well as the ionic strength of the solution.

[0119] As used herein, the term "substantial sequence identity" or "substantial homology" is used to indicate that a nucleotide sequence or an amino acid sequence exhibits substantial structural or functional equivalence with another nucleotide or amino acid sequence. Any structural or functional differences between sequences having substantial sequence identity or substantial homology will be de minimis; that is, they will not affect the ability of the sequence to function as indicated in the desired application. Differences may be due to inherent variations in codon usage among different species, for example. Structural differences are considered de minimis if there is a significant amount of sequence overlap or similarity between two or more different sequences or if the different sequences exhibit similar physical characteristics even if the sequences differ in length or structure. Such characteristics include, for example, ability to hybridize under defined conditions, or in the case of proteins, immunological crossreactivity, similar enzymatic activity, etc. Each of these characteristics can readily be determined by the skilled practitioner by art known methods.

[0120] Additionally, two nucleotide sequences are "substantially complementary" if the sequences have at least about 70 percent, more preferably, 80 percent and most preferably about 90 percent sequence similarity between them. Two amino acid sequences are substantially homologous if they have at least 50%, preferably 70% similarity between the active portions of the polypeptides.

[0121] As used herein, the phrase "hybridizes to a corresponding portion" of a DNA or RNA molecule means that the molecule that hybridizes, e.g., oligonucleotide, polynucleotide, or any nucleotide sequence (in sense or antisense orientation) recognizes and hybridizes to a sequence in another nucleic acid molecule that is of approximately the same size and has enough sequence similarity thereto to effect hybridization under appropriate conditions. For example, a 100 nucleotide long antisense molecule from the 3' coding or non-coding region of tomato DHS will recognize and hybridize to an approximately 100 nucleotide portion of a nucleotide sequence within the 3' coding or non-coding region, respectively of carnation DHS gene or any other plant DHS gene so long as there is about 70% or more sequence similarity between the two sequences. It is to be understood that the size of the "corresponding portion" will allow for some mismatches in hybridization such that the "corresponding portion" may be smaller or larger than the molecule which hybridizes to it, for example 20-30% larger or smaller, preferably no more than about 12-15% larger or smaller.

[0122] The term "functional derivative" of a nucleic acid (or poly- or oligonucleotide) is used herein to mean a fragment, variant, homolog, or analog of the gene or nucleotide sequence encoding senescence-induced DHS or senescence-induced eIF-5A. A functional derivative may retain at least a portion of the function of the senescence-induced DHS or eIF-5A encoding DNA which permits its utility in accordance with the invention. Such function may include the ability to hybridize under low stringency conditions with native tomato, Arabidopsis or carnation senescence-induced DHS or eIF-5A or substantially homologous DNA from another plant which encodes senescence-induced DHS or eIF-5A or with an mRNA transcript thereof, or, in antisense orientation, to inhibit the transcription and/or translation of plant senescence-induced DHS or eIF-5A mRNA, or the like.

[0123] A "fragment" of the gene or DNA sequence refers to any subset of the molecule, e.g., a shorter polynucleotide or oligonucleotide. A "variant" refers to a molecule substantially similar to either the entire gene or a fragment thereof, such as a nucleotide substitution variant having one or more substituted nucleotides, but which maintains the ability to hybridize with the particular gene or to encode mRNA transcript which hybridizes with the native DNA. A "homolog" refers to a fragment or variant sequence from a different plant genus or species. An "analog" refers to a non-natural molecule substantially similar to or functioning in relation to either the entire molecule, a variant or a fragment thereof.

[0124] By "altered expression" or "modified expression" of a gene, e.g., the senescence-induced DHS gene or senescence-induced eIF-5A gene, is meant any process or result whereby the normal expression of the gene, for example, that expression occurring in an unmodified fruit bearing, flowering or other plant, is changed in some way. As intended herein, alteration in gene expression is complete or partial reduction in the expression of the senescence-induced DHS gene or senescence-induced eIF-5A gene or both, but may also include a change in the timing of expression, or another state wherein the expression of the senescence-induced DHS gene or senescence-induced eIF-5A gene or both differs from that which would be most likely to occur naturally in an unmodified plant or cultivar. A preferred alteration is one which results in reduction of senescence-induced DHS production, senescence-induced eIF-5A production or both by the plant compared to production in an unmodified plant.

[0125] In producing a genetically altered plant in accordance with this invention, it is preferred to select individual plantlets or plants by the desired trait, generally reduced senescence-induced DHS expression or production or reduced senescence-induced eIF-5A expression or both. Expression of senescence-induced DHS and senescence-induced eIF-5A can be determined, for example by observations of delayed or reduced senescence in transgenic plants. It is also possible to quantitate the activity of DHS and/or eIF-5A in transgenic plants in comparison to control (normal, non-transgenic) plants using known assays.

[0126] In order for a newly inserted gene or DNA sequence to be expressed, resulting in production of the protein which it encodes, or in the case of antisense DNA, to be transcribed, resulting in an antisense RNA molecule, the proper regulatory elements should be present in proper location and orientation with respect to the gene or DNA sequence. The regulatory regions may include a promoter, a 5'-non-translated leader sequence and a 3'-polyadenylation sequence as well as enhancers and other regulatory sequences.

[0127] Promoter regulatory elements that are useful in combination with the senescence-induced DHS gene to generate sense or antisense transcripts of the gene include any plant promoter in general, and more particularly, a constitutive promoter such as the fig wart mosaic virus 35S promoter, the cauliflower mosaic virus promoter, CaMV35S promoter, or the MAS promoter, or a tissue-specific or senescence-induced promoter, such as the carnation petal GST1 promoter or the Arabidopsis SAG12 promoter (See, for example, J. C. Palaqui et al., Plant Physiol., 112:1447-1456 (1996); Morton et al., Molecular Breeding, 1:123-132 (1995); Fobert et al., Plant Journal, 6:567-577 (1994); and Gan et al., Plant Physiol., 113:313 (1997), incorporated herein by reference). Preferably, the promoter used in the present invention is a constitutive promoter, most preferably a double 35S promoter is used.

[0128] Expression levels from a promoter which is useful for the present invention can be tested using conventional expression systems, for example by measuring levels of a reporter gene product, e.g., protein or mRNA in extracts of the leaves, flowers, fruit or other tissues of a transgenic plant into which the promoter/reporter gene have been introduced.

[0129] The present invention provides antisense oligonucleotides and polynucleotides complementary to the gene encoding tomato senescence-induced DHS, carnation senescence-induced DHS, Arabidopsis senescence-induced DHS or complementary to a gene or gene fragment from another plant, which hybridizes with the tomato, carnation or Arabidopsis senescence-induced DHS gene under low to high stringency conditions. The present invention also provides antisense oligonucleotides and polynucleotides complementary to the gene encoding tomato senescence-induced eIF-5A, carnation senescence-induced eIF-5A, Arabidopsis senescence-induced eIF-5A or complementary to a gene or gene fragment from another plant, which hybridizes with the tomato, carnation or Arabidopsis senescence-induced eIF-5A gene under low to high stringency conditions. Such antisense oligonucleotides should be at least about six nucleotides in length to provide minimal specificity of hybridization and may be complementary to one strand of DNA or mRNA encoding the senescence-induced gene or a portion thereof, or to flanking sequences in genomic DNA which are involved in regulating senescence-induced DHS or eIF-5A gene expression. The antisense oligonucleotide may be as large as 100 nucleotides or more and may extend in length up to and beyond the full coding sequence for which it is antisense. The antisense oligonucleotides can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, single stranded or double stranded.

[0130] The action of the antisense oligonucleotide may result in alteration, primarily inhibition, of senescence-induced DHS expression, senescence-induced eIF-5A expression or both in cells. For a general discussion of antisense see: Alberts, et al., Molecular Biology of the Cell, 2nd ed., Garland Publishing, Inc. New York, N.Y., 1989 (in particular pages 195-196, incorporated herein by reference).

[0131] The antisense oligonucleotide may be complementary to any corresponding portion of the senescence-induced DHS or eIF-5A gene. In one embodiment, the antisense oligonucleotide may be between 6 and 100 nucleotides in length, and may be complementary to the 5'-non-coding or sequences within the 3'-end of the senescence-induced DHS or eIF-5A sequence, for example. Antisense oligonucleotides primarily complementary to 5'-non-coding sequences are known to be effective inhibitors of expression of genes encoding transcription factors. Branch, M. A., Molec. Cell Biol., 13:4284-4290 (1993).

[0132] Preferred antisense oligonucleotides are substantially complementary to a portion of the mRNA encoding senescence-induced DHS or senescence-induced eIF-5A, the portion of the mRNA being approximately the same size as the antisense oligonucleotide. For example, introduction of the full length cDNA clone encoding senescence-induced DHS or eIF-5A in an antisense orientation into a plant is expected to result in successfully altered senescence-induced DHS and/or eIF-5A gene expression. Moreover, as demonstrated in FIGS. 21-35 introduction of partial sequences, targeted to specific portions of the senescence-induced DHS gene or senescence-induced eIF-5A gene or both, can be equally effective.

[0133] The minimal amount of homology required by the present invention is that sufficient to result in sufficient complementarity to provide recognition of the specific target RNA or DNA and inhibition or reduction of its translation or function while not affecting function of other RNA or DNA molecules and the expression of other genes. While the antisense oligonucleotides of the invention comprise sequences complementary to a corresponding portion of an RNA transcript of the senescence-induced DHS gene or senescence-induced eIF-5A gene, absolute complementarity, although preferred is not required. The ability to hybridize may depend on the length of the antisense oligonucleotide and the degree of complementarity. Generally, the longer the hybridizing nucleic acid, the more base mismatches with the senescence-induced DHS target sequence it may contain and still form a stable duplex. One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting temperature of the hybridized complex, for example.

[0134] The antisense RNA oligonucleotides may be generated intracellularly by transcription from exogenously introduced nucleic acid sequences. The antisense molecule may be delivered to a cell by transformation or transfection or infection with a vector, such as a plasmid or virus into which is incorporated DNA encoding the antisense senescence-induced DHS sequence operably linked to appropriate regulatory elements, including a promoter. Within the cell the exogenous DNA sequence is expressed, producing an antisense RNA of the senescence-induced DHS gene.

[0135] Vectors can be plasmids, preferably, or may be viral or other vectors known in the art to replicate and express genes encoded thereon in plant cells or bacterial cells. The vector becomes chromosomally integrated such that it can be transcribed to produce the desired antisense senescence-induced DHS RNA. Such plasmid or viral vectors can be constructed by recombinant DNA technology methods that are standard in the art. For example, the vector may be a plasmid vector containing a replication system functional in a prokaryotic host and an antisense oligonucleotide or polynucleotide according to the invention. Alternatively, the vector may be a plasmid containing a replication system functional in Agrobacterium and an antisense oligonucleotide or polynucleotide according to the invention. Plasmids that are capable of replicating in Agrobacterium are well known in the art. See, Miki, et al., Procedures for Introducing Foreign DNA Into Plants, Methods in Plant Molecular Biology and Biotechnology, Eds. B. R. Glick and J. E. Thompson. CRC Press (1993), PP. 67-83.

[0136] The tomato DHS gene was cloned in antisense orientation into a plasmid vector in the following manner. The pCD plasmid, which is constructed from a pUC18 backbone and contains the 35S promoter from cauliflower mosaic virus (CaMV) followed by a multiple cloning site and an octapine synthase termination sequence was used for cloning the tomato DHS gene. The pCd-DHS (antisense) plasmid was constructed by subcloning the full length tomato DHS gene in the antisense orientation into the pCD plasmid using XhoI and Sad restriction sites.

[0137] An oligonucleotide, preferably between about 6 and about 100 nucleotides in length and complementary to the target sequence of senescence-induced DHS or senescence-induced eIF-5A gene, may be prepared by recombinant nucleotide technologies or may be synthesized from mononucleotides or shorter oligonucleotides, for example. Automated synthesizers are applicable to chemical synthesis of the oligo- and polynucleotides of the invention. Procedures for constructing recombinant nucleotide molecules in accordance with the present invention are disclosed in Sambrook, et al., In: Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1989), which is incorporated herein in its entirety. Oligonucleotides which encode antisense RNA complementary to senescence-induced deoxyhypusine synthase sequence can be prepared using procedures well known to those in the art. Details concerning such procedures are provided in Maniatis, T. et al., Molecular mechanisms in the Control of Gene expression, eds., Nierlich, et al., eds., Acad. Press, N.Y. (1976).

[0138] In an alternative embodiment of the invention, inhibition of expression of endogenous plant senescence-induced DHS, senescence-induced eIF-5A or both is the result of co-suppression through over-expression of an exogenous senescence-induced DHS or eIF-5A gene or gene fragment or both introduced into the plant cell. In this embodiment of the invention, a vector encoding senescence-induced DHS, senescence-induced eIF-5A or both in the sense orientation is-introduced into the cells in the same manner as described herein for antisense molecules. Preferably, the senescence-induced DHS or senescence-induced eIF-5A is operatively linked to a strong constitutive promoter, such as for example the fig wart mosaic virus promoter or CaMV35S or a double 35 S promoter.

[0139] In another embodiment of the invention, inhibition of expression of endogenous plant senescence-induced DHS, senescence-induced eIF-5A or both is effected through the use of ribozymes. Ribozymes are RNA molecules exhibiting sequence-specific endoribonuclease activity. An example is the hammerhead ribozyme which cleaves at a UH (where H is an A, C or U residue) recognition site in the target RNA and contains base-pairing regions that direct the catalytic domain of the ribozyme to the target site of the substrate RNA. Ribozymes are highly target-specific and can be designed to inactivate one member of a multigene family or targeted to conserved regions of related mRNAs. (See Merlo et al., The Plant Cell, 10:1603-1621, 1998). The ribozyme molecule may be delivered to a cell by transformation, transfection or infection with a vector, such as a plasmid or virus, into which is incorporated the ribozyme operatively linked to appropriate regulatory elements, including a promoter. Such a ribozyme construct contains base-pairing arms that direct it to a cleavage site within the senescence-induced DHS mRNA, or senescence-induced eIF-5A mRNA resulting in cleavage of DHS or eIF-5A mRNA and inhibition of senescence-induced DHS and/or eIF-5A expression.

[0140] Transgenic plants made in accordance with the present invention may be prepared by DNA transformation using any method of plant transformation known in the art. Plant transformation methods include direct co-cultivation of plants, tissues or cells with Agrobacterium tumefaciens or direct infection (Miki, et al., Meth. in Plant Mol. Biol. and Biotechnology, (1993), p. 67-88); direct gene transfer into protoplasts or protoplast uptake (Paszkowski, et al., EMBO J., 12:2717 (1984); electroporation (Fromm, et al., Nature, 319:719 (1986); particle bombardment (Klein et al., BioTechnology, 6:559-563 (1988); injection into meristematic tissues of seedlings and plants (De LaPena, et al., Nature, 325:274-276 (1987); injection into protoplasts of cultured cells and tissues (Reich, et al., BioTechnology, 4:1001-1004 (1986)).

[0141] Generally a complete plant is obtained from the transformation process. Plants are regenerated from protoplasts, callus, tissue parts or explants, etc. Plant parts obtained from the regenerated plants in which the expression of senescence-induced DHS, senescence-induced eIF-5A or both is altered, such as leaves, flowers, fruit, seeds and the like are included in the definition of "plant" as used herein. Progeny, variants and mutants of the regenerated plants are also included in the definition of "plant."

[0142] The tomato, carnation or Arabidopsis senescence-induced DHS protein or functional derivatives thereof, and tomato, carnation or Arabidopsis senescence-induced eIF-5A protein or functional derivatives thereof are preferably produced by recombinant technologies, optionally in combination with chemical synthesis methods. In one embodiment of the invention the senescence-induced DHS is expressed as a fusion protein, preferably consisting of the senescence-induced DHS fused with maltose binding protein.

[0143] "Functional derivatives" of the senescence-induced DHS or senescence-induced eIF-5A protein as described herein are fragments, variants, analogs, or chemical derivatives of senescence-induced DHS or senescence-induced eIF-5A, respectively, which retain at least a portion of the senescence-induced DHS or eIF-5A activity or immunological cross reactivity with an antibody specific for senescence-induced DHS or senescence-induced eIF-5A, respectively. A fragment of the senescence-induced DHS or senescence-induced eIF-5A protein refers to any subset of the molecule. Variant peptides may be made by direct chemical synthesis, for example, using methods well known in the art. An analog of senescence-induced DHS or senescence-induced eIF-5A refers to a non-natural protein substantially similar to either the entire protein or a fragment thereof. Chemical derivatives of senescence-induced DHS or senescence-induced-eIF-5A contain additional chemical moieties not normally a part of the peptide or peptide fragment. Modifications may be introduced into peptides or fragments thereof by reacting targeted amino acid residues of the peptide with an organic derivatizing agent that is capable of reacting with selected side chains or terminal residues.

[0144] A senescence-induced DHS or senescence-induced eIF-5A protein or peptide according to the invention may be produced by culturing a cell transformed with a nucleotide sequence of this invention (in the sense orientation), allowing the cell to synthesize the protein and then isolating the protein, either as a free protein or as a fusion protein, depending on the cloning protocol used, from either the culture medium or from cell extracts. Alternatively, the protein can be produced in a cell-free system. Ranu, et al., Meth. Enzymol., 60:459-484, (1979).

[0145] Having now generally described the invention, the same will be more readily understood through reference to the following examples which are provided by way of illustration, and are not intended to be limiting to the present invention.

Example 1

Messenger RNA (mRNA) Isolation

[0146] Total RNA was isolated from tomato flowers and tomato fruit at various developmental stages and from leaves (untreated or after chilling or sorbitol treatment). Briefly, the tissue (5 g) was ground in liquid nitrogen. The ground powder was mixed with 30 ml guanidinium buffer (4 M guanidinium isothiocyanate, 2.5 mM NaOAc pH 8.5, 0.8% .beta.-mercaptoethanol). The mixture was filtered through four layers of cheesecloth and centrifuged at 10,000.times.g at 4.degree. C. for 30 minutes. The supernatant was then subjected to cesium chloride density gradient centrifugation at 26,000.times.g for 20 hours. The pelleted RNA was rinsed with 75% ethanol, resuspended in 600 .mu.l DEPC-treated water and the RNA precipitated at -70.degree. C. with 0.75 ml 95% ethanol and 30 .mu.l of 3M NaOAc. Ten 1 .mu.g of RNA were fractionated on a 1.2% denaturing formaldehyde agarose gel and transferred to a nylon membrane. Randomly primed .sup.32P-dCTP-labelled full length DHS cDNA (SEQ ID NO:1) was used to probe the membrane at 42.degree. C. overnight. The membrane was then washed once in 1.times.SSC containing 0.1% SDS at room temperature for 15 minutes and three times in 0.2.times.SSC containing 0.1% SDS at 65.degree. C. for 15 minutes each. The membrane was exposed to x-ray film overnight at -70.degree. C.

[0147] PolyA.sup.+ mRNA was isolated from total RNA using the PolyA `tract mRNA Isolation System available from Promega. PolyA` mRNA was used as a template for cDNA synthesis using the ZAP Express.RTM. cDNA synthesis system available from Stratagene (La Jolla, Calif.)

Tomato Leaf cDNA Library Screening

[0148] A cDNA library made using mRNA isolated from Match F1 hybrid tomato leaves that had been exposed to 2 M sorbitol for six hours was diluted to approximately 5.times.10.sup.6 PFU/ml. The cDNA library was screened using a .sup.32P-labelled 600 by RT-PCR fragment. Three positive cDNA clones were excised and recircularized into a pBK-CMV.RTM. (Stratagene) phagemid using the method in the manufacturer's instructions. The full length cDNA was inserted into the pBK-CMV vector.

Plasmid DNA Isolation, DNA Sequencing

[0149] The alkaline lysis method described by Sambrook et al., (Supra) was used to isolate plasmid DNA. The full length positive cDNA clone was sequenced using the dideoxy sequencing method. Sanger, et al., Proc. Natl. Acad. Sci. USA, 74:5463-5467. The open reading frame was compiled and analyzed using BLAST search (GenBank, Bethesda, Md.) and alignment of the five most homologous proteins with the derived amino acid sequence of the encoded gene was achieved using a BCM Search Launcher: Multiple Sequence Alignments Pattern-Induced Multiple Alignment Method (See F. Corpet, Nuc. Acids Res., 16:10881-10890, (1987)). Functional motifs present in the derived amino acid sequence were identified by MultiFinder.

Northern Blot Hybridizations of Tomato RNA

[0150] Ten .mu.g of total RNA isolated from tomato flowers at various stages (bud and blossom and senescing petals that are open widely or drying), tomato leaves, and tomato fruit at various stages of ripening (breaker, i.e., green fruit with less than 10% red color, pink, i.e., the entire fruit is orange or pink, and red, either soft or firm) were separated on 1% denatured formaldehyde agarose gels and immobilized on nylon membranes. The full length tomato cDNA labelled with .sup.32P-dCTP using a random primer kit (Boehringer Mannheim) was used to probe the filters (7.times.10.sup.7 cpm). The filters were washed once with 1.times.SSC, 0.1% SDS at room temperature and three times with 0.2.times.SSC, 0.1% SDS at 65.degree. C. The filters were dried and exposed to X-ray film overnight at -70.degree. C. The results are shown in FIGS. 6, 7, 8 and 9.

Northern Blot Hybridization of Arabidopsis RNA

[0151] Total RNA from leaves of Arabidopsis plants at five weeks of age (lane 1), six weeks (lane 2) and seven weeks (lane 3) was isolated as above, separated on 1% denatured formaldehyde agarose gels and immobilized on nylon membranes. The full-length Arabidopsis senescence-induced DHS cDNA labelled with .sup.32P-dCTP using a random primer kit (Boehringer Mannheim) was used to probe the filters (7.times.10.sup.7 cpm). The filters were washed once with 1.times.SSC, 0.1% SDS at room temperature and three times with 0.2.times.SSC, 0.1% SDS at 65.degree. C. The filters were dried and exposed to X-ray film overnight at -70.degree. C. The results are shown in FIG. 11.

Northern Blot Hybridization of Carnation RNA

[0152] Total RNA from petals of carnation plants at various stages of flower development, i.e., tight-bud flowers (lane 1), beginning to open (lane 2), fully open flowers (lane 3), flowers with inrolling petals (lane 4), was isolated as above, separated on 1% denatured formaldehyde agarose gels and immobilized on nylon membranes. The full-length carnation senescence-induced DHS cDNA labelled with .sup.32P-dCTP using a random primer kit (Boehringer Mannheim) was used to probe the filters (7.times.10.sup.7 cpm). The filters were washed once with 1.times.SSC, 0.1% SDS at room temperature and three times with 0.2.times.SSC, 0.1% SDS at 65.degree. C. The filters were dried and exposed to X-ray film overnight at -70.degree. C. The results are shown in FIG. 12.

Example 2

Sorbitol Induction of Tomato Senescence-Induced DHS Gene

[0153] Tomato leaves were treated with 2 M sorbitol in a sealed chamber for six hours. RNA was extracted from the sorbitol treated leaves as follows.

[0154] Leaves (5 g) were ground in liquid nitrogen. The ground powder was mixed with 30 ml guanidinium buffer (4 M guanidinium isothiocyanate, 2.5 mM NaOAc pH 8.5, 0.8% .beta.-mercaptoethanol). The mixture was filtered through four layers of cheesecloth and centrifuged at 10,000.times.g at 4.degree. C. for 30 minutes. The supernatant was then subjected to cesium chloride density gradient centrifugation at 26,000.times.g for 20 hours. The pelleted RNA was rinsed with 75% ethanol, resuspended in 600 .mu.l DEPC-treated water and the RNA precipitated at -70.degree. C. with 0.75 ml 95% ethanol and 30 .mu.l of 3M NaOAc. Ten .mu.g of RNA were fractionated on a 1.2% denaturing formaldehyde agarose gel and transferred to a nylon membrane. Randomly primed .sup.32P-dCTP-labelled full length DHS cDNA (SEQ ID NO:1) was used to probe the membrane at 42.degree. C. overnight. The membrane was then washed once in 1.times.SSC containing 0.1% SDS at room temperature for 15 minutes and three times in 0.2.times.SSC containing 0.1% SDS at 65.degree. C. for 15 minutes each. The membrane was exposed to x-ray film overnight at -70.degree. C.

[0155] The results are shown in FIG. 8. As can be seen, transcription of DHS is induced in leaves by sorbitol.

Example 3

Induction of the Tomato DHS Gene in Senescing Flowers

[0156] Tight flower buds and open, senescing flowers of tomato plants were harvested, and RNA was isolated as in Example 2. Ten .mu.g RNA were fractionated on a 1.2% denaturing formaldehyde agarose gel and transferred to a nylon membrane. Randomly primed .sup.32P-dCTP-labelled full length DHS cDNA (SEQ ID NO. 1) was used to probe the membrane at 42.degree. C. overnight. The membrane then was washed once in 1.times.SSC containing 0.1% SDS at room temperature for 15 minutes and then washed three times in 0.2.times.SSC containing 0.1% SDS at 65.degree. C. for fifteen minutes each. The membrane was exposed to x-ray film overnight at -70.degree. C.

[0157] The results are shown in FIG. 6. As can be seen, transcription of DHS is induced in senescing flowers.

Example 4

Induction of the Tomato DHS Gene in Ripening Fruit

[0158] RNA was isolated from breaker, pink and ripe fruit as in Example 2. Ten .mu.g RNA were fractionated on a 1.2% denaturing formaldehyde agarose gel and transferred to a nylon membrane. Randomly primed .sup.32P-dCTP-labelled full length DHS cDNA (SEQ ID NO. 1) (FIG. 1) was used to probe the membrane at 42.degree. C. overnight. The membrane then was washed once in 1.times.SSC containing 0.1% SDS at room temperature for 15 minutes and then washed three times in 0.2.times.SSC containing 0.1% SDS at 65.degree. C. for fifteen minutes each. The membrane was exposed to x-ray film overnight at -70.degree. C.

[0159] The results are shown in FIG. 7. As can be seen, transcription of DHS is strongest in ripe, red fruit just prior to the onset of senescence leading to spoilage.

Example 5

Induction of Tomato Senescence-Induced DHS Gene by Chilling

[0160] Tomato plants in pots (7-8 weeks old) were exposed to 6.degree. C. for two days, three days or six days in a growth chamber. The light cycle was set for eight hours of dark and sixteen hours of light. Plants were rewarmed by moving them back into a greenhouse. Plants that were not rewarmed were harvested immediately after removal from the growth chamber. RNA was extracted from the leaves as follows.

[0161] Leaves (5 g) were ground in liquid nitrogen. The ground powder was mixed with 30 ml guanidinium buffer (4 M guanidinium isothiocyanate, 2.5 mM NaOAc pH 8.5, 0.8% .beta.-mercaptoethanol). The mixture was filtered through four layers of cheesecloth and centrifuged at 10,000 g at 4.degree. C. for 30 minutes. The supernatant was then subjected to cesium chloride density gradient centrifugation at 26,000 g for 20 hours. The pelleted RNA was rinsed with 75% ethanol, resuspended in 600 .mu.l DEPC-treated water and the RNA precipitated at -70.degree. C. with 0.75 ml 95% ethanol and 30 .mu.l of 3M NaOAc. Ten .mu.g of RNA were fractionated on a 1.2% denaturing formaldehyde agarose gel and transferred to a nylon membrane. Randomly primed .sup.32P-dCTP-labelled full length DHS cDNA (SEQ ID NO:1) was used to probe the membrane at 42.degree. C. overnight. The membrane was then washed once in 1.times.SSC containing 0.1% SDS at room temperature for 15 minutes and three times in 0.2.times.SSC containing 0.1% SDS at 65.degree. C. for 15 minutes each. The membrane was exposed to x-ray film overnight at -70.degree. C.

[0162] The results are shown in FIG. 9. As can be seen, transcription of DHS is induced in leaves by exposure to chilling temperature and subsequent rewarming, and the enhanced transcription correlates with chilling damage measured as membrane leakiness.

Example 6

[0163] Generation of an Arabidopsis PCR Product Using Primers Based on Unidentified Arabidopsis Genomic Sequence

[0164] A partial length senescence-induced DHS sequence from an Arabidopsis cDNA template was generated by PCR using a pair of oligonucleotide primers designed from Arabidopsis genomic sequence. The 5' primer is a 19-mer having the sequence, 5'-GGTGGTGT5TGAGGAAGATC (SEQ ID NO:7); the 3' primer is a 20 mer having the sequence, GGTGCACGCCCTGATGAAGC-3' (SEQ ID NO:8). A polymerase chain reaction using the Expand High Fidelity PCR System (Boehringer Mannheim) and an Arabidopsis senescing leaf cDNA library as template was carried out as follows.

[0165] Reaction Components:

TABLE-US-00001 cDNA 1 .PHI.l (5 .times. 10.sup.7 pfu) dNTP (10 mM each) 1 .PHI.l MgCl.sub.2 (5 mM) + 10x buffer 5 .PHI.l Primers 1 and 2 (100 .PHI.M each) 2 .PHI.l Expand High Fidelity DNA polymerase 1.75 U Reaction volume 50 .PHI.l

[0166] Reaction Parameters: [0167] 94.degree. C. for 3 min [0168] 94.degree. C./1 min, 58.degree. C./1 min, 72.degree. C./2 min, for 45 cycles [0169] 72.degree. C. for 15 min.

Example 7

Isolation of Genomic DNA and Southern Analysis

[0170] Genomic DNA was extracted from tomato leaves by grinding 10 grams of tomato leaf tissue to a fine powder in liquid nitrogen. 37.5 ml of a mixture containing 25 ml homogenization buffer [100 mM Tris-HCl, pH 8.0, 100 mm EDTA, 250 mM NaCl, 1% sarkosyl, 1% 2-mercaptoethanol, 10 .mu.g/ml RNase and 12.5 ml phenol] prewarmed to 60.degree. C. was added to the ground tissue. The mixture was shaken for fifteen minutes. An additional 12.5 ml of chloroform/isoamyl alcohol (24:1) was added to the mixture and shaken for another 15 minutes. The mixture was centrifuged and the aqueous phase reextracted with 25 ml phenol/chloroform/isoamylalcohol (25:24:1) and chloroform/isoamylalcohol (24:1). The nucleic acids were recovered by precipitation with 15 ml isopropanol at room temperature. The precipitate was resuspended in 1 ml of water.

[0171] Genomic DNA was subjected to restriction enzyme digestion as follows: 10 .mu.g genomic DNA, 40 .mu.A 10.times. reaction buffer and 100 U restriction enzyme (XbaI, EcoRI, EcoRV or HinDIII) were reacted for five to six hours in a total reaction volume of 400 .mu.l. The mixture was then phenol-extracted and ethanol-precipitated. The digested DNA was subjected to agarose gel electrophoresis on a 0.8% agarose gel at 15 volts for approximately 15 hours. The gel was submerged in denaturation buffer [87.66 g NaCl and 20 g NaOH/Liter] for 30 minutes with gentle agitation, rinsed in distilled water and submerged in neutralization buffer [87.66 g NaCl and 60.55 g tris-HCl, pH 7.5/Liter] for 30 minutes with gentle agitation. The DNA was transferred to a Hybond-N+ nylon membrane by capillary blotting.

[0172] Hybridization was performed overnight at 42.degree. C. using 1.times.10.sup.6 cpm/ml of .sup.32P-dCTP-labeled full length DHS cDNA or 3'-non-coding region of the DHS cDNA clone. Prehybridization and hybridization were carried out in buffer containing 50% formamide, 6.times.SSC, 5.times.Denhardt's solution, 0.1% SDS and 100 mg/ml denatured salmon sperm DNA. The membrane was prehybridized for two to four hours; hybridization was carried out overnight.

[0173] After hybridization was complete, membranes were rinsed at room temperature in 2.times.SSC and 0.1% SDS and then washed in 2.times.SSC and 0.1% SDS for 15 minutes and 0.2.times.SSC and 0.1% SDS for 15 minutes. The membrane was then exposed to x-ray film at -80.degree. C. overnight. The results are shown in FIG. 5.

Example 8

Isolation of A Senescence-Induced eIF-5A Gene from Arabidopsis

[0174] A full-length cDNA clone of the senescence-induced eIF-5A gene expressed in Arabidopsis leaves was obtained by PCR using an Arabidopsis senescing leaf cDNA library as template. Initially, PCR products corresponding to the 5'- and 3'-ends of the gene were made using a degenerate upstream primer <AAARRYCGMCCYTGCAAGGT> (SEQ ID NO: 17) paired with vector T7 primer <AATACGACTCACTATAG> (SEQ ID NO:18), and a degenerate downstream primer <TCYTTNCCYTCMKCTAAHCC> (SEQ ID NO:19) paired with vector T3 primer <ATTAACCCTCACTAAAG> (SEQ ID NO: 20). The PCR products were subcloned into pBluescript for sequencing. The full-length cDNA was then obtained using a 5'-specific primer <CTGTTACCAAAAAATCTGTACC> (SEQ ID NO: 21) paired with a 3'-specific primer <AGAAGAAGTATAAAAACCATC> (SEQ ID NO: 22), and subcloned into pBluescript for sequencing.

Example 9

Isolation of a Senescence-Induced eIF-5A Gene from Tomato Fruit

[0175] A full-length cDNA clone of the senescence-induced eIF-5A gene expressed in tomato fruit was obtained by PCR using a tomato fruit cDNA library as template. Initially, PCR products corresponding to the 5'- and 3'-ends of the gene were made using a degenerate upstream primer (SEQ ID NO:17) paired with vector T7 primer (SEQ ID NO:18), and a degenerate downstream primer (SEQ ID NO:19) paired with vector T3 primer (SEQ ID NO: 20). The PCR products were subcloned into pBluescript for sequencing. The full-length cDNA was then obtained using a 5'-specific primer <AAAGAATCCTAGAGAGAGAAAGG> (SEQ ID NO: 23) paired with vector T7 primer (SEQ ID NO: 18), and subcloned into pBluescript for sequencing.

Example 10

Isolation of a Senescence-Induced eIF-5A Gene from Carnation

[0176] A full-length cDNA clone of the senescence-induced eIF-5A gene expressed in carnation flowers was obtained by PCR using a carnation senescing flower cDNA library as template. Initially, PCR products corresponding to the 5'- and 3'-ends of the gene were made using a degenerate upstream primer (SEQ ID NO:17) paired with vector T7 primer (SEQ ID NO:18), and a degenerate downstream primer (SEQ ID NO:19) paired with vector T3 primer (SEQ ID NO:20). The PCR products were subcloned into pBluescript for sequencing. The full-length cDNA was then obtained using a 5'-specific primer <TTTTACATCAATCGAAAA> (SEQ ID NO: 24) paired with a 3'-specific primer <ACCAAAACCTGTGTTATAACTCC> (SEQ ID NO: 25), and subcloned into pBluescript for sequencing.

Example 11

Isolation of a Senescence-Induced DHS Gene from Arabidopsis

[0177] A full-length cDNA clone of the senescence-induced DHS gene expressed in Arabidopsis leaves was obtained by screening an Arabidopsis senescing leaf cDNA library. The sequence of the probe (SEQ ID NO: 26) that was used for screening is shown in FIG. 38. The probe was obtained by PCR using the senescence leaf cDNA library as a template and primers (indicated as underlined regions in FIG. 38) designed from the unidentified genomic sequence (AB017060) in GenBank. The PCR product was subcloned into pBluescript for sequencing.

Example 12

Isolation of a Senescence-Induced DHS Gene from Carnation

[0178] A full-length cDNA clone of the senescence-induced DHS gene expressed in carnation petals was obtained by screening a carnation senescing petal cDNA library. The sequence of the probe (SEQ ID NO: 27) that was used for screening is shown in FIG. 39. The probe was obtained by PCR using the senescence petal cDNA library as a template and degenerate primers (upstream: 5' TTG ARG AAG ATY CAT MAA RTG CCT 3') (SEQ ID NO: 28); downstream: 5' CCA TCA AAY TCY TGK GCR GTG TT 3') (SEQ ID NO: 29)). The PCR product was subcloned into pBluescript for sequencing.

Example 13

Transformation of Arabidopsis with Full-Length or 3' Region of Arabidopsis DHS in Antisense Orientation

[0179] Agrobacteria were transformed with the binary vector, pKYLX71, containing the full-length senescence-induced Arabidopsis DHS cDNA sequence or the 3' end of the DHS gene (SEQ ID NO:30) (FIG. 36), both expressed in the antisense configuration, under the regulation of double 35S promoter. Arabidopsis plants were transformed with the transformed Agrobacteria by vacuum infiltration, and transformed seeds from resultant T.sub.o plants were selected on ampicillin.

[0180] FIGS. 21 through 24 are photographs of the transformed Arabidopsis plants, showing that expression of the DHS gene or 3' end thereof in antisense orientation in the transformed plants results in increased biomass, e.g., larger leaves and increased plant size. FIG. 25 illustrates that the transgenic Arabidopsis plants have increased seed yield.

Example 14

Transformation of Tomato Plants With Full-Length or 3' Region of Tomato DHS in Antisense Orientation

[0181] Agrobacteria were transformed with the binary vector, pKYLX71, containing the full-length senescence-induced tomato DHS cDNA sequence or the 3' end of the DHS gene (SEQ ID NO:31) (FIG. 37), both expressed in the antisense configuration, under the regulation of double 35S promoter. Tomato leaf explants were formed with these Agrobacteria, and transformed callus and plantlets were generated and selected by standard tissue culture methods. Transformed plantlets were grown to mature fruit-producing T.sub.1 plants under greenhouse conditions.

[0182] FIGS. 26 through 35 are photographs showing that reduced expression of the senescence-induced tomato DHS gene in the transformed plants results in increased biomass, e.g., larger leaf size and larger plants as seen in the transformed Arabidopsis plants, as well as delayed softening and spoilage of tomato fruit.

Example 15

Transformation of Tomato Plants with the 3' Region of Tomato DHS in Anitsense Orientation

[0183] Agrobacteria were transformed with the binary vector, pKYLX71, containing the 3' end of the DHS gene (FIG. 37) expressed in the antisense configuration, under the regulation of double 35S promoter. Tomato leaf explants were formed with these Agrobacteria, and transformed callus and plantlets were generated and selected by standard tissue culture methods. Transformed plantlets were grown to mature fruit producing T.sub.1 plants under green house conditions.

[0184] Fruit from these transgenic plants with reduced DHS expression were completely free of blossom end rot under conditions in which about 33% of fruit from control plants developed this disease. Blossom end rot is a physiological disease attributable to nutrient stress that causes the bottom (blossom) end of the fruit to senesce and rot. FIGS. 40(a) and 40(b) are photographs showing a control fruit exhibiting blossom end rot and a transgenic fruit that is free of blossom end rot.

[0185] The results indicate that reducing the expression of DHS prevents the onset of tissue and cell death arising from physiological disease.

Sequence CWU 1

1

4811609DNALycopersicon sp.CDS(54)..(1196) 1cgcagaaact cgcggcggca gtcttgttcc ctacataatc ttggtctgca ata atg 56 Met 1gga gaa gct ctg aag tac agt atc atg gac tca gta aga tcg gta gtt 104Gly Glu Ala Leu Lys Tyr Ser Ile Met Asp Ser Val Arg Ser Val Val 5 10 15ttc aaa gaa tcc gaa aat cta gaa ggt tct tgc act aaa atc gag ggc 152Phe Lys Glu Ser Glu Asn Leu Glu Gly Ser Cys Thr Lys Ile Glu Gly 20 25 30tac gac ttc aat aaa ggc gtt aac tat gct gag ctg atc aag tcc atg 200Tyr Asp Phe Asn Lys Gly Val Asn Tyr Ala Glu Leu Ile Lys Ser Met 35 40 45gtt tcc act ggt ttc caa gca tct aat ctt ggt gac gcc att gca att 248Val Ser Thr Gly Phe Gln Ala Ser Asn Leu Gly Asp Ala Ile Ala Ile50 55 60 65gtt aat caa atg cta gat tgg agg ctt tca cat gag ctg ccc acg gag 296Val Asn Gln Met Leu Asp Trp Arg Leu Ser His Glu Leu Pro Thr Glu 70 75 80gat tgc agt gaa gaa gaa aga gat gtt gca tac aga gag tcg gta acc 344Asp Cys Ser Glu Glu Glu Arg Asp Val Ala Tyr Arg Glu Ser Val Thr 85 90 95tgc aaa atc ttc ttg ggg ttc act tca aac ctt gtt tct tct ggt gtt 392Cys Lys Ile Phe Leu Gly Phe Thr Ser Asn Leu Val Ser Ser Gly Val 100 105 110aga gac act gtc cgc tac ctt gtt cag cac cgg atg gtt gat gtt gtg 440Arg Asp Thr Val Arg Tyr Leu Val Gln His Arg Met Val Asp Val Val 115 120 125gtt act aca gct ggt ggt att gaa gag gat ctc ata aag tgc ctc gca 488Val Thr Thr Ala Gly Gly Ile Glu Glu Asp Leu Ile Lys Cys Leu Ala130 135 140 145cca acc tac aag ggg gac ttc tct tta cct gga gct tct cta cga tcg 536Pro Thr Tyr Lys Gly Asp Phe Ser Leu Pro Gly Ala Ser Leu Arg Ser 150 155 160aaa gga ttg aac cgt att ggt aac tta ttg gtt cct aat gac aac tac 584Lys Gly Leu Asn Arg Ile Gly Asn Leu Leu Val Pro Asn Asp Asn Tyr 165 170 175tgc aaa ttt gag aat tgg atc atc cca gtt ttt gac caa atg tat gag 632Cys Lys Phe Glu Asn Trp Ile Ile Pro Val Phe Asp Gln Met Tyr Glu 180 185 190gag cag att aat gag aag gtt cta tgg aca cca tct aaa gtc att gct 680Glu Gln Ile Asn Glu Lys Val Leu Trp Thr Pro Ser Lys Val Ile Ala 195 200 205cgt ctg ggt aaa gaa att aat gat gaa acc tca tac ttg tat tgg gct 728Arg Leu Gly Lys Glu Ile Asn Asp Glu Thr Ser Tyr Leu Tyr Trp Ala210 215 220 225tac aag aac cgg att cct gtc ttc tgt cct ggc ttg acg gat gga tca 776Tyr Lys Asn Arg Ile Pro Val Phe Cys Pro Gly Leu Thr Asp Gly Ser 230 235 240ctt ggt gac atg cta tac ttc cat tct ttc aaa aag ggt gat cca gat 824Leu Gly Asp Met Leu Tyr Phe His Ser Phe Lys Lys Gly Asp Pro Asp 245 250 255aat cca gat ctt aat cct ggt cta gtc ata gac att gta gga gat att 872Asn Pro Asp Leu Asn Pro Gly Leu Val Ile Asp Ile Val Gly Asp Ile 260 265 270agg gcc atg aat ggt gaa gct gtc cat gct ggt ttg agg aag aca gga 920Arg Ala Met Asn Gly Glu Ala Val His Ala Gly Leu Arg Lys Thr Gly 275 280 285atg att ata ctg ggt gga ggg ctg cct aag cac cat gtt tgc aat gcc 968Met Ile Ile Leu Gly Gly Gly Leu Pro Lys His His Val Cys Asn Ala290 295 300 305aat atg atg cgc aat ggt gca gat ttt gcc gtc ttc att aac acc gca 1016Asn Met Met Arg Asn Gly Ala Asp Phe Ala Val Phe Ile Asn Thr Ala 310 315 320caa gag ttt gat ggt agt gac tct ggt gcc cgt cct gat gaa gct gta 1064Gln Glu Phe Asp Gly Ser Asp Ser Gly Ala Arg Pro Asp Glu Ala Val 325 330 335tca tgg gga aag ata cgt ggt ggt gcc aag act gtg aag gtg cat tgt 1112Ser Trp Gly Lys Ile Arg Gly Gly Ala Lys Thr Val Lys Val His Cys 340 345 350gat gca acc att gca ttt ccc ata tta gta gct gag aca ttt gca gct 1160Asp Ala Thr Ile Ala Phe Pro Ile Leu Val Ala Glu Thr Phe Ala Ala 355 360 365aag agt aag gaa ttc tcc cag ata agg tgc caa gtt tgaacattga 1206Lys Ser Lys Glu Phe Ser Gln Ile Arg Cys Gln Val370 375 380ggaagctgtc cttccgacca cacatatgaa ttgctagctt ttgaagccaa cttgctagtg 1266tgcagcacca tttattctgc aaaactgact agagagcagg gtatattcct ctaccccgag 1326ttagacgaca tcctgtatgg ttcaaattaa ttatttttct ccccttcaca ccatgttatt 1386tagttctctt cctcttcgaa agtgaagagc ttagatgttc ataggttttg aattatgttg 1446gaggttggtg ataactgact agtcctctta ccatatagat aatgtatcct tgtactatga 1506gattttgggt gtgtttgata ccaaggaaaa tgtttatttg gaaaacaatt ggatttttaa 1566tttatttttt cttgtttaaa aaaaaaaaaa aaaaaaaaaa aaa 16092381PRTLycopersicon sp. 2Met Gly Glu Ala Leu Lys Tyr Ser Ile Met Asp Ser Val Arg Ser Val1 5 10 15Val Phe Lys Glu Ser Glu Asn Leu Glu Gly Ser Cys Thr Lys Ile Glu 20 25 30Gly Tyr Asp Phe Asn Lys Gly Val Asn Tyr Ala Glu Leu Ile Lys Ser 35 40 45Met Val Ser Thr Gly Phe Gln Ala Ser Asn Leu Gly Asp Ala Ile Ala 50 55 60Ile Val Asn Gln Met Leu Asp Trp Arg Leu Ser His Glu Leu Pro Thr65 70 75 80Glu Asp Cys Ser Glu Glu Glu Arg Asp Val Ala Tyr Arg Glu Ser Val 85 90 95Thr Cys Lys Ile Phe Leu Gly Phe Thr Ser Asn Leu Val Ser Ser Gly 100 105 110Val Arg Asp Thr Val Arg Tyr Leu Val Gln His Arg Met Val Asp Val 115 120 125Val Val Thr Thr Ala Gly Gly Ile Glu Glu Asp Leu Ile Lys Cys Leu 130 135 140Ala Pro Thr Tyr Lys Gly Asp Phe Ser Leu Pro Gly Ala Ser Leu Arg145 150 155 160Ser Lys Gly Leu Asn Arg Ile Gly Asn Leu Leu Val Pro Asn Asp Asn 165 170 175Tyr Cys Lys Phe Glu Asn Trp Ile Ile Pro Val Phe Asp Gln Met Tyr 180 185 190Glu Glu Gln Ile Asn Glu Lys Val Leu Trp Thr Pro Ser Lys Val Ile 195 200 205Ala Arg Leu Gly Lys Glu Ile Asn Asp Glu Thr Ser Tyr Leu Tyr Trp 210 215 220Ala Tyr Lys Asn Arg Ile Pro Val Phe Cys Pro Gly Leu Thr Asp Gly225 230 235 240Ser Leu Gly Asp Met Leu Tyr Phe His Ser Phe Lys Lys Gly Asp Pro 245 250 255Asp Asn Pro Asp Leu Asn Pro Gly Leu Val Ile Asp Ile Val Gly Asp 260 265 270Ile Arg Ala Met Asn Gly Glu Ala Val His Ala Gly Leu Arg Lys Thr 275 280 285Gly Met Ile Ile Leu Gly Gly Gly Leu Pro Lys His His Val Cys Asn 290 295 300Ala Asn Met Met Arg Asn Gly Ala Asp Phe Ala Val Phe Ile Asn Thr305 310 315 320Ala Gln Glu Phe Asp Gly Ser Asp Ser Gly Ala Arg Pro Asp Glu Ala 325 330 335Val Ser Trp Gly Lys Ile Arg Gly Gly Ala Lys Thr Val Lys Val His 340 345 350Cys Asp Ala Thr Ile Ala Phe Pro Ile Leu Val Ala Glu Thr Phe Ala 355 360 365Ala Lys Ser Lys Glu Phe Ser Gln Ile Arg Cys Gln Val 370 375 380324DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 3agtctagaag gtgctcgtcc tgat 24434DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 4gactgcagtc gacatcgatt tttttttttt tttt 3452272DNAArabidopsis sp.CDS(68)..(265)CDS(348)..(536)CDS(624)..(842)CDS(979)..(1065)CDS(1154).- .(1258)CDS(1575)..(1862) 5gaactcccaa aaccctctac tactacactt tcagatccaa ggaaatcaat tttgtcattc 60gagcaac atg gag gat gat cgt gtt ttc tct tcg gtt cac tca aca gtt 109 Met Glu Asp Asp Arg Val Phe Ser Ser Val His Ser Thr Val 1 5 10ttc aaa gaa tcc gaa tca ttg gaa gga aag tgt gat aaa atc gaa gga 157Phe Lys Glu Ser Glu Ser Leu Glu Gly Lys Cys Asp Lys Ile Glu Gly15 20 25 30tac gat ttc aat caa gga gta gat tac cca aag ctt atg cga tcc atg 205Tyr Asp Phe Asn Gln Gly Val Asp Tyr Pro Lys Leu Met Arg Ser Met 35 40 45ctc acc acc gga ttt caa gcc tcg aat ctc ggc gaa gct att gat gtc 253Leu Thr Thr Gly Phe Gln Ala Ser Asn Leu Gly Glu Ala Ile Asp Val 50 55 60gtc aat caa atg gttcgtttct cgaattcatc aaaaataaaa attccttctt 305Val Asn Gln Met 65tttgttttcc tttgttttgg gtgaattagt aatgacaaag ag ttt gaa ttt gta 359 Phe Glu Phe Val 70ttg aag cta gat tgg aga ctg gct gat gaa act aca gta gct gaa gac 407Leu Lys Leu Asp Trp Arg Leu Ala Asp Glu Thr Thr Val Ala Glu Asp 75 80 85tgt agt gaa gag gag aag aat cca tcg ttt aga gag tct gtc aag tgt 455Cys Ser Glu Glu Glu Lys Asn Pro Ser Phe Arg Glu Ser Val Lys Cys 90 95 100aaa atc ttt cta ggt ttc act tca aat ctt gtt tca tct ggt gtt aga 503Lys Ile Phe Leu Gly Phe Thr Ser Asn Leu Val Ser Ser Gly Val Arg 105 110 115gat act att cgt tat ctt gtt cag cat cat atg gtttgtgatt tttgctttat 556Asp Thr Ile Arg Tyr Leu Val Gln His His Met 120 125caccctgctt ttttatagat gttaaaattt tcgagcttta gttttgattt caatggtttt 616tctgcag gtt gat gtt ata gtc acg aca act ggt ggt gtt gag gaa gat 665 Val Asp Val Ile Val Thr Thr Thr Gly Gly Val Glu Glu Asp 130 135 140ctc ata aaa tgc ctt gca cct aca ttt aaa ggt gat ttc tct cta cct 713Leu Ile Lys Cys Leu Ala Pro Thr Phe Lys Gly Asp Phe Ser Leu Pro 145 150 155gga gct tat tta agg tca aag gga ttg aac cga att ggg aat ttg ctg 761Gly Ala Tyr Leu Arg Ser Lys Gly Leu Asn Arg Ile Gly Asn Leu Leu160 165 170 175gtt cct aat gat aac tac tgc aag ttt gag gat tgg atc att ccc atc 809Val Pro Asn Asp Asn Tyr Cys Lys Phe Glu Asp Trp Ile Ile Pro Ile 180 185 190ttt gac gag atg ttg aag gaa cag aaa gaa gag gtattgcttt atctttcctt 862Phe Asp Glu Met Leu Lys Glu Gln Lys Glu Glu 195 200tttatatgat ttgagatgat tctgtttgtg cgtcactagt ggagatagat tttgattcct 922ctcttgcatc attgacttcg ttggtgaatc cttctttctc tggtttttcc ttgtag aat 981 Asngtg ttg tgg act cct tct aaa ctg tta gca cgg ctg gga aaa gaa atc 1029Val Leu Trp Thr Pro Ser Lys Leu Leu Ala Arg Leu Gly Lys Glu Ile 205 210 215aac aat gag agt tca tac ctt tat tgg gca tac aag gtatccaaaa 1075Asn Asn Glu Ser Ser Tyr Leu Tyr Trp Ala Tyr Lys220 225 230ttttaacctt tttagttttt taatcatcct gtgaggaact cggggattta aattttccgc 1135ttcttgtggt gtttgtag atg aat att cca gta ttc tgc cca ggg tta aca 1186 Met Asn Ile Pro Val Phe Cys Pro Gly Leu Thr 235 240gat ggc tct ctt ggg gat atg ctg tat ttt cac tct ttt cgt acc tct 1234Asp Gly Ser Leu Gly Asp Met Leu Tyr Phe His Ser Phe Arg Thr Ser 245 250 255ggc ctc atc atc gat gta gta caa ggtacttctt ttactcaata agtcagtgtg 1288Gly Leu Ile Ile Asp Val Val Gln 260 265ataaatattc ctgctacatc tagtgcagga atattgtaac tagtagtgca ttgtagcttt 1348tccaattcag caacggactt tactgtaagt tgatatctaa aggttcaaac gggagctagg 1408agaatagcat aggggcattc tgatttaggt ttggggcact gggttaagag ttagagaata 1468ataatcttgt tagttgttta tcaaactctt tgatggttag tctcttggta atttgaattt 1528tatcacagtg tttatggtct ttgaaccagt taatgtttta tgaaca gat atc aga 1583 Asp Ile Arggct atg aac ggc gaa gct gtc cat gca aat cct aaa aag aca ggg atg 1631Ala Met Asn Gly Glu Ala Val His Ala Asn Pro Lys Lys Thr Gly Met270 275 280 285ata atc ctt gga ggg ggc ttg cca aag cac cac ata tgt aat gcc aat 1679Ile Ile Leu Gly Gly Gly Leu Pro Lys His His Ile Cys Asn Ala Asn 290 295 300atg atg cgc aat ggt gca gat tac gct gta ttt ata aac acc ggg caa 1727Met Met Arg Asn Gly Ala Asp Tyr Ala Val Phe Ile Asn Thr Gly Gln 305 310 315gaa ttt gat ggg agc gac tcg ggt gca cgc cct gat gaa gcc gtg tct 1775Glu Phe Asp Gly Ser Asp Ser Gly Ala Arg Pro Asp Glu Ala Val Ser 320 325 330tgg ggt aaa att agg ggt tct gct aaa acc gtt aag gtc tgc ttt tta 1823Trp Gly Lys Ile Arg Gly Ser Ala Lys Thr Val Lys Val Cys Phe Leu 335 340 345att tct tca cat cct aat tta tat ctc act cag tgg ttt tgagtacata 1872Ile Ser Ser His Pro Asn Leu Tyr Leu Thr Gln Trp Phe350 355 360tttaatattg gatcattctt gcaggtatac tgtgatgcta ccatagcctt cccattgttg 1932gttgcagaaa catttgccac aaagagagac caaacctgtg agtctaagac ttaagaactg 1992actggtcgtt ttggccatgg attcttaaag atcgttgctt tttgatttta cactggagtg 2052accatataac actccacatt gatgtggctg tgacgcgaat tgtcttcttg cgaattgtac 2112tttagtttct ctcaacctaa aatgatttgc agattgtgtt ttcgtttaaa acacaagagt 2172cttgtagtca ataatccttt gccttataaa attattcagt tccaacaaca cattgtgatt 2232ctgtgacaag tctcccgttg cctatgttca cttctctgcg 22726362PRTArabidopsis sp. 6Met Glu Asp Asp Arg Val Phe Ser Ser Val His Ser Thr Val Phe Lys1 5 10 15Glu Ser Glu Ser Leu Glu Gly Lys Cys Asp Lys Ile Glu Gly Tyr Asp 20 25 30Phe Asn Gln Gly Val Asp Tyr Pro Lys Leu Met Arg Ser Met Leu Thr 35 40 45Thr Gly Phe Gln Ala Ser Asn Leu Gly Glu Ala Ile Asp Val Val Asn 50 55 60Gln Met Phe Glu Phe Val Leu Lys Leu Asp Trp Arg Leu Ala Asp Glu65 70 75 80Thr Thr Val Ala Glu Asp Cys Ser Glu Glu Glu Lys Asn Pro Ser Phe 85 90 95Arg Glu Ser Val Lys Cys Lys Ile Phe Leu Gly Phe Thr Ser Asn Leu 100 105 110Val Ser Ser Gly Val Arg Asp Thr Ile Arg Tyr Leu Val Gln His His 115 120 125Met Val Asp Val Ile Val Thr Thr Thr Gly Gly Val Glu Glu Asp Leu 130 135 140Ile Lys Cys Leu Ala Pro Thr Phe Lys Gly Asp Phe Ser Leu Pro Gly145 150 155 160Ala Tyr Leu Arg Ser Lys Gly Leu Asn Arg Ile Gly Asn Leu Leu Val 165 170 175Pro Asn Asp Asn Tyr Cys Lys Phe Glu Asp Trp Ile Ile Pro Ile Phe 180 185 190Asp Glu Met Leu Lys Glu Gln Lys Glu Glu Asn Val Leu Trp Thr Pro 195 200 205Ser Lys Leu Leu Ala Arg Leu Gly Lys Glu Ile Asn Asn Glu Ser Ser 210 215 220Tyr Leu Tyr Trp Ala Tyr Lys Met Asn Ile Pro Val Phe Cys Pro Gly225 230 235 240Leu Thr Asp Gly Ser Leu Gly Asp Met Leu Tyr Phe His Ser Phe Arg 245 250 255Thr Ser Gly Leu Ile Ile Asp Val Val Gln Asp Ile Arg Ala Met Asn 260 265 270Gly Glu Ala Val His Ala Asn Pro Lys Lys Thr Gly Met Ile Ile Leu 275 280 285Gly Gly Gly Leu Pro Lys His His Ile Cys Asn Ala Asn Met Met Arg 290 295 300Asn Gly Ala Asp Tyr Ala Val Phe Ile Asn Thr Gly Gln Glu Phe Asp305 310 315 320Gly Ser Asp Ser Gly Ala Arg Pro Asp Glu Ala Val Ser Trp Gly Lys 325 330 335Ile Arg Gly Ser Ala Lys Thr Val Lys Val Cys Phe Leu Ile Ser Ser 340 345 350His Pro Asn Leu Tyr Leu Thr Gln Trp Phe 355 360719DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 7ggtggtgttg aggaagatc 19820DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 8ggtgcacgcc ctgatgaagc 2091660DNADianthus sp.CDS(256)..(1374) 9gtcattacaa tgcataggat cattgcacat gctaccttcc tcattgcact tgagcttgcc 60atacttttgt ttttgacgtt tgataataat actatgaaaa tattatgttt tttcttttgt 120gtgttggtgt ttttgaagtt gtttttgata agcagaaccc agttgtttta cacttttacc 180attgaactac tgcaattcta aaactttgtt tacattttaa ttccatcaaa gattgagttc 240agcataggaa aaagg atg gag gat gct aat cat gat agt gtg gca tct gcg 291 Met Glu Asp Ala Asn His Asp Ser Val Ala Ser Ala 1 5 10cac tct gca gca ttc aaa aag tcg gag aat tta gag ggg aaa agc gtt 339His Ser Ala Ala Phe Lys Lys Ser Glu Asn Leu Glu Gly Lys Ser

Val 15 20 25aag att gag ggt tat gat ttt aat caa ggt gta aac tat tcc aaa ctc 387Lys Ile Glu Gly Tyr Asp Phe Asn Gln Gly Val Asn Tyr Ser Lys Leu 30 35 40ttg caa tct ttc gct tct aat ggg ttt caa gcc tcg aat ctt gga gat 435Leu Gln Ser Phe Ala Ser Asn Gly Phe Gln Ala Ser Asn Leu Gly Asp45 50 55 60gcc att gaa gta gtt aat cat atg cta gat tgg agt ctg gca gat gag 483Ala Ile Glu Val Val Asn His Met Leu Asp Trp Ser Leu Ala Asp Glu 65 70 75gca cct gtg gac gat tgt agc gag gaa gag agg gat cct aaa ttc aga 531Ala Pro Val Asp Asp Cys Ser Glu Glu Glu Arg Asp Pro Lys Phe Arg 80 85 90gaa tct gtg aag tgc aaa gtg ttc ttg ggc ttt act tca aat ctt att 579Glu Ser Val Lys Cys Lys Val Phe Leu Gly Phe Thr Ser Asn Leu Ile 95 100 105 tcc tct ggt gtt cgt gac aca att cgg tat ctc gtg caa cat cat atg 627Ser Ser Gly Val Arg Asp Thr Ile Arg Tyr Leu Val Gln His His Met 110 115 120gtt gac gtg ata gta acg aca acc gga ggt ata gaa gaa gat cta ata 675Val Asp Val Ile Val Thr Thr Thr Gly Gly Ile Glu Glu Asp Leu Ile125 130 135 140aaa gga aga tcc atc aag tgc ctt gca ccc act ttc aaa ggc gat ttt 723Lys Gly Arg Ser Ile Lys Cys Leu Ala Pro Thr Phe Lys Gly Asp Phe 145 150 155gcc tta cca gga gct caa tta cgc tcc aaa ggg ttg aat cga att ggt 771Ala Leu Pro Gly Ala Gln Leu Arg Ser Lys Gly Leu Asn Arg Ile Gly 160 165 170aat ctg ttg gtt ccg aat gat aac tac tgt aaa ttt gag gat tgg atc 819Asn Leu Leu Val Pro Asn Asp Asn Tyr Cys Lys Phe Glu Asp Trp Ile 175 180 185att cca att tta gat aag atg ttg gaa gag caa att tca gag aaa atc 867Ile Pro Ile Leu Asp Lys Met Leu Glu Glu Gln Ile Ser Glu Lys Ile 190 195 200tta tgg aca cca tcg aag ttg att ggt cga tta gga aga gaa ata aac 915Leu Trp Thr Pro Ser Lys Leu Ile Gly Arg Leu Gly Arg Glu Ile Asn205 210 215 220gat gag agt tca tac ctt tac tgg gcc ttc aag aac aat att cca gta 963Asp Glu Ser Ser Tyr Leu Tyr Trp Ala Phe Lys Asn Asn Ile Pro Val 225 230 235ttt tgc cca ggt tta aca gac ggc tca ctc gga gac atg cta tat ttt 1011Phe Cys Pro Gly Leu Thr Asp Gly Ser Leu Gly Asp Met Leu Tyr Phe 240 245 250cat tct ttt cgc aat ccg ggt tta atc gtc gat gtt gtg caa gat ata 1059His Ser Phe Arg Asn Pro Gly Leu Ile Val Asp Val Val Gln Asp Ile 255 260 265aga gca gta aat ggc gag gct gtg cac gca gcg cct agg aaa aca ggc 1107Arg Ala Val Asn Gly Glu Ala Val His Ala Ala Pro Arg Lys Thr Gly 270 275 280atg att ata ctc ggt gga ggg ttg cct aag cac cac atc tgc aac gca 1155Met Ile Ile Leu Gly Gly Gly Leu Pro Lys His His Ile Cys Asn Ala285 290 295 300aac atg atg aga aat ggc gcc gat tat gct gtt ttc atc aac act gcc 1203Asn Met Met Arg Asn Gly Ala Asp Tyr Ala Val Phe Ile Asn Thr Ala 305 310 315gaa gag ttt gac ggc agt gat tct ggt gct cgc ccc gat gag gct att 1251Glu Glu Phe Asp Gly Ser Asp Ser Gly Ala Arg Pro Asp Glu Ala Ile 320 325 330tca tgg ggc aaa att agc gga tct gct aag act gtg aag gtg cat tgt 1299Ser Trp Gly Lys Ile Ser Gly Ser Ala Lys Thr Val Lys Val His Cys 335 340 345gat gcc acg ata gct ttc cct cta cta gtc gct gag aca ttt gca gca 1347Asp Ala Thr Ile Ala Phe Pro Leu Leu Val Ala Glu Thr Phe Ala Ala 350 355 360aaa aga gaa aaa gag agg aag agc tgt taaaactttt ttgattgttg 1394Lys Arg Glu Lys Glu Arg Lys Ser Cys365 370aaaaatctgt gttatacaag tctcgaaatg cattttagta attgacttga tcttatcatt 1454tcaatgtgtt atctttgaaa atgttggtaa tgaaacatct cacctcttct atacaacatt 1514gttgatccat tgtactccgt atcttgtaat tttggaaaaa aaaaaccgtc tattgttacg 1574agagagtaca tttttgaggt aaaaatatag gatttttgtg cgatgcaaat gctggttatt 1634cccttgaaaa aaaaaaaaaa aaaaaa 166010373PRTDianthus sp. 10Met Glu Asp Ala Asn His Asp Ser Val Ala Ser Ala His Ser Ala Ala1 5 10 15Phe Lys Lys Ser Glu Asn Leu Glu Gly Lys Ser Val Lys Ile Glu Gly 20 25 30Tyr Asp Phe Asn Gln Gly Val Asn Tyr Ser Lys Leu Leu Gln Ser Phe 35 40 45Ala Ser Asn Gly Phe Gln Ala Ser Asn Leu Gly Asp Ala Ile Glu Val 50 55 60Val Asn His Met Leu Asp Trp Ser Leu Ala Asp Glu Ala Pro Val Asp65 70 75 80Asp Cys Ser Glu Glu Glu Arg Asp Pro Lys Phe Arg Glu Ser Val Lys 85 90 95Cys Lys Val Phe Leu Gly Phe Thr Ser Asn Leu Ile Ser Ser Gly Val 100 105 110Arg Asp Thr Ile Arg Tyr Leu Val Gln His His Met Val Asp Val Ile 115 120 125Val Thr Thr Thr Gly Gly Ile Glu Glu Asp Leu Ile Lys Gly Arg Ser 130 135 140Ile Lys Cys Leu Ala Pro Thr Phe Lys Gly Asp Phe Ala Leu Pro Gly145 150 155 160Ala Gln Leu Arg Ser Lys Gly Leu Asn Arg Ile Gly Asn Leu Leu Val 165 170 175Pro Asn Asp Asn Tyr Cys Lys Phe Glu Asp Trp Ile Ile Pro Ile Leu 180 185 190Asp Lys Met Leu Glu Glu Gln Ile Ser Glu Lys Ile Leu Trp Thr Pro 195 200 205Ser Lys Leu Ile Gly Arg Leu Gly Arg Glu Ile Asn Asp Glu Ser Ser 210 215 220Tyr Leu Tyr Trp Ala Phe Lys Asn Asn Ile Pro Val Phe Cys Pro Gly225 230 235 240Leu Thr Asp Gly Ser Leu Gly Asp Met Leu Tyr Phe His Ser Phe Arg 245 250 255Asn Pro Gly Leu Ile Val Asp Val Val Gln Asp Ile Arg Ala Val Asn 260 265 270Gly Glu Ala Val His Ala Ala Pro Arg Lys Thr Gly Met Ile Ile Leu 275 280 285Gly Gly Gly Leu Pro Lys His His Ile Cys Asn Ala Asn Met Met Arg 290 295 300Asn Gly Ala Asp Tyr Ala Val Phe Ile Asn Thr Ala Glu Glu Phe Asp305 310 315 320Gly Ser Asp Ser Gly Ala Arg Pro Asp Glu Ala Ile Ser Trp Gly Lys 325 330 335Ile Ser Gly Ser Ala Lys Thr Val Lys Val His Cys Asp Ala Thr Ile 340 345 350Ala Phe Pro Leu Leu Val Ala Glu Thr Phe Ala Ala Lys Arg Glu Lys 355 360 365Glu Arg Lys Ser Cys 37011780DNALycopersicon sp.CDS(43)..(522) 11aaagaatcct agagagagaa agggaatcct agagagagaa gc atg tcg gac gaa 54 Met Ser Asp Glu 1gaa cac cat ttt gag tca aag gca gat gct ggt gcc tca aaa act ttc 102Glu His His Phe Glu Ser Lys Ala Asp Ala Gly Ala Ser Lys Thr Phe5 10 15 20cca cag caa gct gga acc atc cgt aag aat ggt tac atc gtt atc aaa 150Pro Gln Gln Ala Gly Thr Ile Arg Lys Asn Gly Tyr Ile Val Ile Lys 25 30 35ggc cgt ccc tgc aag gtt gtt gag gtc tcc act tca aaa act gga aaa 198Gly Arg Pro Cys Lys Val Val Glu Val Ser Thr Ser Lys Thr Gly Lys 40 45 50cac gga cat gct aaa tgt cac ttt gtg gca att gac att ttc aat gga 246His Gly His Ala Lys Cys His Phe Val Ala Ile Asp Ile Phe Asn Gly 55 60 65aag aaa ctg gaa gat atc gtt ccg tcc tcc cac aat tgt gat gtg cca 294Lys Lys Leu Glu Asp Ile Val Pro Ser Ser His Asn Cys Asp Val Pro 70 75 80cat gtt aac cgt acc gac tat cag ctg att gat atc tct gaa gat ggt 342His Val Asn Arg Thr Asp Tyr Gln Leu Ile Asp Ile Ser Glu Asp Gly85 90 95 100ttt gtc tca ctt ctt act gaa agt gga aac acc aag gat gac ctc agg 390Phe Val Ser Leu Leu Thr Glu Ser Gly Asn Thr Lys Asp Asp Leu Arg 105 110 115ctt ccc acc gat gaa aat ctg ctg aag cag gtt aaa gat ggg ttc cag 438Leu Pro Thr Asp Glu Asn Leu Leu Lys Gln Val Lys Asp Gly Phe Gln 120 125 130gaa gga aag gat ctt gtg gtg tct gtt atg tct gcg atg ggc gaa gag 486Glu Gly Lys Asp Leu Val Val Ser Val Met Ser Ala Met Gly Glu Glu 135 140 145cag att aac gcc gtt aag gat gtt ggt acc aag aat tagttatgtc 532Gln Ile Asn Ala Val Lys Asp Val Gly Thr Lys Asn 150 155 160atggcagcat aatcactgcc aaagctttaa gacattatca tatcctaatg tggtactttg 592atatcactag attataaact gtgttatttg cactgttcaa aacaaaagaa agaaaactgc 652tgttatggct agagaaagta ttggctttga gcttttgaca gcacagttga actatgtgaa 712aattctactt tttttttttt gggtaaaata ctgctcgttt aatgttttgc aaaaaaaaaa 772aaaaaaaa 78012160PRTLycopersicon sp. 12Met Ser Asp Glu Glu His His Phe Glu Ser Lys Ala Asp Ala Gly Ala1 5 10 15Ser Lys Thr Phe Pro Gln Gln Ala Gly Thr Ile Arg Lys Asn Gly Tyr 20 25 30Ile Val Ile Lys Gly Arg Pro Cys Lys Val Val Glu Val Ser Thr Ser 35 40 45Lys Thr Gly Lys His Gly His Ala Lys Cys His Phe Val Ala Ile Asp 50 55 60Ile Phe Asn Gly Lys Lys Leu Glu Asp Ile Val Pro Ser Ser His Asn65 70 75 80Cys Asp Val Pro His Val Asn Arg Thr Asp Tyr Gln Leu Ile Asp Ile 85 90 95Ser Glu Asp Gly Phe Val Ser Leu Leu Thr Glu Ser Gly Asn Thr Lys 100 105 110Asp Asp Leu Arg Leu Pro Thr Asp Glu Asn Leu Leu Lys Gln Val Lys 115 120 125Asp Gly Phe Gln Glu Gly Lys Asp Leu Val Val Ser Val Met Ser Ala 130 135 140Met Gly Glu Glu Gln Ile Asn Ala Val Lys Asp Val Gly Thr Lys Asn145 150 155 16013812DNADianthus sp.CDS(67)..(546) 13ctcttttaca tcaatcgaaa aaaaattagg gttcttattt tagagtgaga ggcgaaaaat 60cgaacg atg tcg gac gac gat cac cat ttc gag tca tcg gcc gac gcc 108 Met Ser Asp Asp Asp His His Phe Glu Ser Ser Ala Asp Ala 1 5 10gga gca tcc aag act tac cct caa caa gct ggt aca atc cgc aag agc 156Gly Ala Ser Lys Thr Tyr Pro Gln Gln Ala Gly Thr Ile Arg Lys Ser15 20 25 30ggt cac atc gtc atc aaa aat cgc cct tgc aag gtg gtt gag gtt tct 204Gly His Ile Val Ile Lys Asn Arg Pro Cys Lys Val Val Glu Val Ser 35 40 45acc tcc aag act ggc aag cac ggt cat gcc aaa tgt cac ttt gtt gcc 252Thr Ser Lys Thr Gly Lys His Gly His Ala Lys Cys His Phe Val Ala 50 55 60att gac att ttc aac ggc aag aag ctg gaa gat att gtc ccc tca tcc 300Ile Asp Ile Phe Asn Gly Lys Lys Leu Glu Asp Ile Val Pro Ser Ser 65 70 75cac aat tgt gat gtt cca cat gtc aac cgt gtc gac tac cag ctg ctt 348His Asn Cys Asp Val Pro His Val Asn Arg Val Asp Tyr Gln Leu Leu 80 85 90gat atc act gaa gat ggc ttt gtt agt ctg ctg act gac agt ggt gac 396Asp Ile Thr Glu Asp Gly Phe Val Ser Leu Leu Thr Asp Ser Gly Asp95 100 105 110acc aag gat gat ctg aag ctt cct gct gat gag gcc ctt gtg aag cag 444Thr Lys Asp Asp Leu Lys Leu Pro Ala Asp Glu Ala Leu Val Lys Gln 115 120 125atg aag gag gga ttt gag gcg ggg aaa gac ttg att ctg tca gtc atg 492Met Lys Glu Gly Phe Glu Ala Gly Lys Asp Leu Ile Leu Ser Val Met 130 135 140tgt gca atg gga gaa gag cag atc tgc gcc gtc aag gac gtt agt ggt 540Cys Ala Met Gly Glu Glu Gln Ile Cys Ala Val Lys Asp Val Ser Gly 145 150 155ggc aag tagaagcttt tgatgaatcc aatactacgc ggtgcagttg aagcaatagt 596Gly Lys 160aatctcgaga acattctgaa ccttatatgt tgaattgatg gtgcttagtt tgttttggaa 656atctctttgc aattaagttg taccaaatca atggatgtaa tgtcttgaat ttgttttatt 716tttgttttga tgtttgctgt gattgcatta tgcattgtta tgagttatga cctgttataa 776cacaaggttt tggtaaaaaa aaaaaaaaaa aaaaaa 81214160PRTDianthus sp. 14Met Ser Asp Asp Asp His His Phe Glu Ser Ser Ala Asp Ala Gly Ala1 5 10 15Ser Lys Thr Tyr Pro Gln Gln Ala Gly Thr Ile Arg Lys Ser Gly His 20 25 30Ile Val Ile Lys Asn Arg Pro Cys Lys Val Val Glu Val Ser Thr Ser 35 40 45Lys Thr Gly Lys His Gly His Ala Lys Cys His Phe Val Ala Ile Asp 50 55 60Ile Phe Asn Gly Lys Lys Leu Glu Asp Ile Val Pro Ser Ser His Asn65 70 75 80Cys Asp Val Pro His Val Asn Arg Val Asp Tyr Gln Leu Leu Asp Ile 85 90 95Thr Glu Asp Gly Phe Val Ser Leu Leu Thr Asp Ser Gly Asp Thr Lys 100 105 110Asp Asp Leu Lys Leu Pro Ala Asp Glu Ala Leu Val Lys Gln Met Lys 115 120 125Glu Gly Phe Glu Ala Gly Lys Asp Leu Ile Leu Ser Val Met Cys Ala 130 135 140Met Gly Glu Glu Gln Ile Cys Ala Val Lys Asp Val Ser Gly Gly Lys145 150 155 16015702DNAArabidopsis sp.CDS(56)..(529) 15ctgttaccaa aaaatctgta ccgcaaaatc ctcgtcgaag ctcgctgctg caacc atg 58 Met 1tcc gac gag gag cat cac ttt gag tcc agt gac gcc gga gcg tcc aaa 106Ser Asp Glu Glu His His Phe Glu Ser Ser Asp Ala Gly Ala Ser Lys 5 10 15acc tac cct caa caa gct gga acc atc cgt aag aat ggt tac atc gtc 154Thr Tyr Pro Gln Gln Ala Gly Thr Ile Arg Lys Asn Gly Tyr Ile Val 20 25 30atc aaa aat cgt ccc tgc aag gtt gtt gag gtt tca acc tcg aag act 202Ile Lys Asn Arg Pro Cys Lys Val Val Glu Val Ser Thr Ser Lys Thr 35 40 45ggc aag cat ggt cat gct aaa tgt cat ttt gta gct att gat atc ttc 250Gly Lys His Gly His Ala Lys Cys His Phe Val Ala Ile Asp Ile Phe50 55 60 65acc agc aag aaa ctc gaa gat att gtt cct tct tcc cac aat tgt gat 298Thr Ser Lys Lys Leu Glu Asp Ile Val Pro Ser Ser His Asn Cys Asp 70 75 80gtt cct cat gtc aac cgt act gat tat cag ctg att gac att tct gaa 346Val Pro His Val Asn Arg Thr Asp Tyr Gln Leu Ile Asp Ile Ser Glu 85 90 95gat gga tat gtc agt ttg ttg act gat aac ggt agt acc aag gat gac 394Asp Gly Tyr Val Ser Leu Leu Thr Asp Asn Gly Ser Thr Lys Asp Asp 100 105 110ctt aag ctc cct aat gat gac act ctg ctc caa cag atc aag agt ggg 442Leu Lys Leu Pro Asn Asp Asp Thr Leu Leu Gln Gln Ile Lys Ser Gly 115 120 125ttt gat gat gga aaa gat cta gtg gtg agt gta atg tca gct atg gga 490Phe Asp Asp Gly Lys Asp Leu Val Val Ser Val Met Ser Ala Met Gly130 135 140 145gag gaa cag atc aat gct ctt aag gac atc ggt ccc aag tgagactaac 539Glu Glu Gln Ile Asn Ala Leu Lys Asp Ile Gly Pro Lys 150 155aaagcctccc ctttgttatg agattcttct tcttctgtag gcttccatta ctcgtcggag 599attatcttgt ttttgggtta ctcctatttt ggatatttaa acttttgtta ataatgccat 659cttcttcaac cttttccttc tagatggttt ttatacttct tct 70216158PRTArabidopsis sp. 16Met Ser Asp Glu Glu His His Phe Glu Ser Ser Asp Ala Gly Ala Ser1 5 10 15Lys Thr Tyr Pro Gln Gln Ala Gly Thr Ile Arg Lys Asn Gly Tyr Ile 20 25 30Val Ile Lys Asn Arg Pro Cys Lys Val Val Glu Val Ser Thr Ser Lys 35 40 45Thr Gly Lys His Gly His Ala Lys Cys His Phe Val Ala Ile Asp Ile 50 55 60Phe Thr Ser Lys Lys Leu Glu Asp Ile Val Pro Ser Ser His Asn Cys65 70 75 80Asp Val Pro His Val Asn Arg Thr Asp Tyr Gln Leu Ile Asp Ile Ser 85 90 95Glu Asp Gly Tyr Val Ser Leu Leu Thr Asp Asn Gly Ser Thr Lys Asp 100 105 110Asp Leu Lys Leu Pro Asn Asp Asp Thr Leu Leu Gln Gln Ile Lys Ser 115 120 125Gly Phe Asp Asp Gly Lys Asp Leu Val Val Ser Val Met Ser Ala Met 130 135 140Gly Glu Glu Gln Ile Asn Ala Leu Lys Asp Ile Gly Pro Lys145 150 1551720DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 17aaarrycgmc cytgcaaggt 201817DNAArtificial

SequenceDescription of Artificial Sequence Synthetic primer 18aatacgactc actatag 171920DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 19tcyttnccyt cmkctaahcc 202017DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 20attaaccctc actaaag 172122DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 21ctgttaccaa aaaatctgta cc 222221DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 22agaagaagta taaaaaccat c 212323DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 23aaagaatcct agagagagaa agg 232418DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 24ttttacatca atcgaaaa 182523DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 25accaaaacct gtgttataac tcc 2326581DNAArabidopsis sp.CDS(1)..(579) 26ggt ggt gtt gag gaa gat ctc ata aaa tgc ctt gca cct aca ttt aaa 48Gly Gly Val Glu Glu Asp Leu Ile Lys Cys Leu Ala Pro Thr Phe Lys1 5 10 15ggt gat ttc tct cta cct gga gct tat tta agg tca aag gga ttg aac 96Gly Asp Phe Ser Leu Pro Gly Ala Tyr Leu Arg Ser Lys Gly Leu Asn20 25 30cga att ggg aat ttg ctg gtt cct aat gat aac tac tgc aag ttt gag 144Arg Ile Gly Asn Leu Leu Val Pro Asn Asp Asn Tyr Cys Lys Phe Glu35 40 45gat tgg atc att ccc atc ttt gac gag atg ttg aag gaa cag aaa gaa 192Asp Trp Ile Ile Pro Ile Phe Asp Glu Met Leu Lys Glu Gln Lys Glu50 55 60gag aat gtg ttg tgg act cct tct aaa ctg tta gca cgg ctg gga aaa 240Glu Asn Val Leu Trp Thr Pro Ser Lys Leu Leu Ala Arg Leu Gly Lys65 70 75 80gaa atc aac aat gag agt tca tac ctt tat tgg gca tac aag atg aat 288Glu Ile Asn Asn Glu Ser Ser Tyr Leu Tyr Trp Ala Tyr Lys Met Asn 85 90 95att cca gta ttc tgc cca ggg tta aca gat ggc tct ctt agg gat atg 336Ile Pro Val Phe Cys Pro Gly Leu Thr Asp Gly Ser Leu Arg Asp Met 100 105 110ctg tat ttt cac tct ttt cgt acc tct ggc ctc atc atc gat gta gta 384Leu Tyr Phe His Ser Phe Arg Thr Ser Gly Leu Ile Ile Asp Val Val 115 120 125caa gat atc aga gct atg aac ggc gaa gct gtc cat gca aat cct aaa 432Gln Asp Ile Arg Ala Met Asn Gly Glu Ala Val His Ala Asn Pro Lys 130 135 140aag aca ggg atg ata atc ctt gga ggg ggc ttg cca aag cac cac ata 480Lys Thr Gly Met Ile Ile Leu Gly Gly Gly Leu Pro Lys His His Ile145 150 155 160tgt aat gcc aat atg atg cgc aat ggt gca gat tac gct gta ttt ata 528Cys Asn Ala Asn Met Met Arg Asn Gly Ala Asp Tyr Ala Val Phe Ile 165 170 175aac acc ggg caa gaa ttt gat ggg agc gac tcg ggt gca cgc cct gat 576Asn Thr Gly Gln Glu Phe Asp Gly Ser Asp Ser Gly Ala Arg Pro Asp 180 185 190gaa gc 581Glu 27522DNADianthus sp.CDS(3)..(521) 27ga aga tcc atc aag tgc ctt gca ccc act ttc aaa ggc gat ttt gcc 47 Arg Ser Ile Lys Cys Leu Ala Pro Thr Phe Lys Gly Asp Phe Ala 1 5 10 15tta cca gga gct caa tta cgc tcc aaa ggg ttg aat cga att ggt aat 95Leu Pro Gly Ala Gln Leu Arg Ser Lys Gly Leu Asn Arg Ile Gly Asn 20 25 30ctg ttg gtt ccg aat gat aac tac tgt aaa ttt gag gat tgg atc att 143Leu Leu Val Pro Asn Asp Asn Tyr Cys Lys Phe Glu Asp Trp Ile Ile 35 40 45cca att tta gat aag atg ttg gaa gag caa att tca gag aaa atc tta 191Pro Ile Leu Asp Lys Met Leu Glu Glu Gln Ile Ser Glu Lys Ile Leu 50 55 60tgg aca cca tcg aag ttg att ggt cga tta gga aga gaa ata aac gat 239Trp Thr Pro Ser Lys Leu Ile Gly Arg Leu Gly Arg Glu Ile Asn Asp 65 70 75gag agt tca tac ctt tac tgg gcc ttc aag aac aat att cca gta ttt 287Glu Ser Ser Tyr Leu Tyr Trp Ala Phe Lys Asn Asn Ile Pro Val Phe80 85 90 95tgc cca ggt tta aca gac ggc tca ctc gga gac atg cta tat ttt cat 335Cys Pro Gly Leu Thr Asp Gly Ser Leu Gly Asp Met Leu Tyr Phe His 100 105 110tct ttt cgc aat ccg ggt tta atc atc gat gtt gtg caa gat ata aga 383Ser Phe Arg Asn Pro Gly Leu Ile Ile Asp Val Val Gln Asp Ile Arg 115 120 125gca gta aat ggc gag gct gtg cac gca gcg cct agg aaa aca ggc atg 431Ala Val Asn Gly Glu Ala Val His Ala Ala Pro Arg Lys Thr Gly Met 130 135 140att ata ctc ggt gga ggg ttg cct aag cac cac atc tgc aac gca aac 479Ile Ile Leu Gly Gly Gly Leu Pro Lys His His Ile Cys Asn Ala Asn 145 150 155atg atg aga aat ggc gcc gat tat gct gtt ttc atc aac acc g 522Met Met Arg Asn Gly Ala Asp Tyr Ala Val Phe Ile Asn Thr160 165 1702824DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 28ttgargaaga tycatmaart gcct 242923DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 29ccatcaaayt cytgkgcrgt gtt 2330484DNAArabidopsis sp.CDS(2)..(112) 30t gca cgc cct gat gaa gct gtg tct tgg ggt aaa att agg ggt tct gct 49 Ala Arg Pro Asp Glu Ala Val Ser Trp Gly Lys Ile Arg Gly Ser Ala 1 5 10 15aaa acc gtt aag gtc tgc ttt tta att tct tca cat cct aat tta tat 97Lys Thr Val Lys Val Cys Phe Leu Ile Ser Ser His Pro Asn Leu Tyr 20 25 30ctc act cag tgg ttt tgagtacata tttaatattg gatcattctt gcaggtatac 152Leu Thr Gln Trp Phe 35tgtgatgcta ccatagcctt cccattgttg gttgcagaaa catttgccac aaagagagac 212caaacctgtg agtctaagac ttaagaactg actggtcgtt ttggccatgg attcttaaag 272atcgttgctt tttgatttta cactggagtg accatataac actccacatt gatgtggctg 332tgacgcgaat tgtcttcttg cgaattgtac tttagtttct ctcaacctaa aatgatttgc 392agattgtgtt ttcgtttaaa acacaagagt cttgtagtca ataatccttt gccttataaa 452attattcagt tccaacaaaa aaaaaaaaaa aa 48431559DNALycopersicon sp.CDS(1)..(156)modified_base(542)a, c, g, t, unknown or other 31ggt gct cgt cct gat gaa gct gta tca tgg gga aag ata cgt ggt ggt 48Gly Ala Arg Pro Asp Glu Ala Val Ser Trp Gly Lys Ile Arg Gly Gly1 5 10 15gcc aag act gtg aag gtg cat tgt gat gca acc att gca ttt ccc ata 96Ala Lys Thr Val Lys Val His Cys Asp Ala Thr Ile Ala Phe Pro Ile 20 25 30tta gta gct gag aca ttt gca gct aag agt aag gaa ttc tcc cag ata 144Leu Val Ala Glu Thr Phe Ala Ala Lys Ser Lys Glu Phe Ser Gln Ile 35 40 45agg tgc caa gtt tgaacattga ggaagctgtc cttccgacca cacatatgaa 196Arg Cys Gln Val 50ttgctagctt ttgaagccaa cttgctagtg tgcagcacca tttattctgc aaaactgact 256agagagcagg gtatattcct ctaccccgag ttagacgaca tcctgtatgg ttcaaattaa 316ttatttttct ccccttcaca ccatgttatt tagttctctt cctcttcgaa agtgaagagc 376ttagatgttc ataggttttg aattatgttg gaggttggtg ataactgact agtcctctta 436ccatatagat aatgtatcct tgtactatga gattttgggt gtgtttgata ccaaggaaaa 496atgtttattt ggaaaacaat tggattttta atttaaaaaa aattgnttaa aaaaaaaaaa 556aaa 55932193PRTArabidopsis sp. 32Gly Gly Val Glu Glu Asp Leu Ile Lys Cys Leu Ala Pro Thr Phe Lys1 5 10 15Gly Asp Phe Ser Leu Pro Gly Ala Tyr Leu Arg Ser Lys Gly Leu Asn 20 25 30Arg Ile Gly Asn Leu Leu Val Pro Asn Asp Asn Tyr Cys Lys Phe Glu 35 40 45Asp Trp Ile Ile Pro Ile Phe Asp Glu Met Leu Lys Glu Gln Lys Glu 50 55 60Glu Asn Val Leu Trp Thr Pro Ser Lys Leu Leu Ala Arg Leu Gly Lys65 70 75 80Glu Ile Asn Asn Glu Ser Ser Tyr Leu Tyr Trp Ala Tyr Lys Met Asn 85 90 95Ile Pro Val Phe Cys Pro Gly Leu Thr Asp Gly Ser Leu Arg Asp Met 100 105 110Leu Tyr Phe His Ser Phe Arg Thr Ser Gly Leu Ile Ile Asp Val Val 115 120 125Gln Asp Ile Arg Ala Met Asn Gly Glu Ala Val His Ala Asn Pro Lys 130 135 140Lys Thr Gly Met Ile Ile Leu Gly Gly Gly Leu Pro Lys His His Ile145 150 155 160Cys Asn Ala Asn Met Met Arg Asn Gly Ala Asp Tyr Ala Val Phe Ile 165 170 175Asn Thr Gly Gln Glu Phe Asp Gly Ser Asp Ser Gly Ala Arg Pro Asp 180 185 190Glu 33173PRTDianthus sp. 33Arg Ser Ile Lys Cys Leu Ala Pro Thr Phe Lys Gly Asp Phe Ala Leu1 5 10 15Pro Gly Ala Gln Leu Arg Ser Lys Gly Leu Asn Arg Ile Gly Asn Leu 20 25 30Leu Val Pro Asn Asp Asn Tyr Cys Lys Phe Glu Asp Trp Ile Ile Pro 35 40 45Ile Leu Asp Lys Met Leu Glu Glu Gln Ile Ser Glu Lys Ile Leu Trp 50 55 60Thr Pro Ser Lys Leu Ile Gly Arg Leu Gly Arg Glu Ile Asn Asp Glu65 70 75 80Ser Ser Tyr Leu Tyr Trp Ala Phe Lys Asn Asn Ile Pro Val Phe Cys 85 90 95Pro Gly Leu Thr Asp Gly Ser Leu Gly Asp Met Leu Tyr Phe His Ser 100 105 110Phe Arg Asn Pro Gly Leu Ile Ile Asp Val Val Gln Asp Ile Arg Ala 115 120 125Val Asn Gly Glu Ala Val His Ala Ala Pro Arg Lys Thr Gly Met Ile 130 135 140Ile Leu Gly Gly Gly Leu Pro Lys His His Ile Cys Asn Ala Asn Met145 150 155 160Met Arg Asn Gly Ala Asp Tyr Ala Val Phe Ile Asn Thr 165 1703437PRTArabidopsis sp. 34Ala Arg Pro Asp Glu Ala Val Ser Trp Gly Lys Ile Arg Gly Ser Ala1 5 10 15Lys Thr Val Lys Val Cys Phe Leu Ile Ser Ser His Pro Asn Leu Tyr 20 25 30Leu Thr Gln Trp Phe 353552PRTLycopersicon sp. 35Gly Ala Arg Pro Asp Glu Ala Val Ser Trp Gly Lys Ile Arg Gly Gly1 5 10 15Ala Lys Thr Val Lys Val His Cys Asp Ala Thr Ile Ala Phe Pro Ile 20 25 30Leu Val Ala Glu Thr Phe Ala Ala Lys Ser Lys Glu Phe Ser Gln Ile 35 40 45Arg Cys Gln Val 5036353PRTUnknownDescription of Unknown Organism Fungi sequence 36Met Ala Asp Asn Gln Ile Pro Ser Ser Val Ala Asp Ala Val Leu Val1 5 10 15Lys Ser Ile Glu Met Pro Glu Gly Ser Gln Lys Val Glu Glu Leu Asp 20 25 30Phe Asn Lys Phe Lys Gly Arg Pro Ile Thr Val Asp Asp Leu Leu Gln 35 40 45Gly Met Lys His Met Gly Phe Gln Ala Ser Ser Met Cys Glu Ala Val 50 55 60Arg Ile Ile Asn Glu Met Arg Ala Tyr Arg Asp Pro Thr Thr Ser Glu65 70 75 80Lys Thr Thr Ile Phe Leu Gly Tyr Thr Ser Asn Leu Ile Ser Ser Gly 85 90 95Leu Arg Gly Thr Leu Arg Tyr Leu Val Gln His Lys His Val Ser Ala 100 105 110Ile Val Thr Thr Ala Gly Gly Ile Glu Glu Asp Phe Ile Lys Cys Leu 115 120 125Gly Asp Thr Tyr Met Ser Ser Phe Ser Ala Val Gly Ala Asp Leu Arg 130 135 140Ser Lys Gly Leu Asn Arg Ile Gly Asn Leu Val Val Pro Asn Ser Asn145 150 155 160Tyr Cys Ala Phe Glu Asp Trp Val Val Pro Ile Leu Asp Lys Met Leu 165 170 175Glu Glu Gln Glu Ala Ser Arg Gly Thr Glu Asn Glu Ile Asn Trp Thr 180 185 190Pro Ser Lys Val Ile His Arg Leu Gly Lys Glu Ile Asn Asp Glu Arg 195 200 205Ser Val Tyr Tyr Trp Ala Trp Lys Asn Asp Ile Pro Val Phe Cys Pro 210 215 220Ala Leu Thr Asp Gly Ser Leu Gly Asp Met Leu Tyr Phe His Thr Phe225 230 235 240Lys Ala Ser Pro Glu Gln Leu Arg Ile Asp Ile Val Glu Asp Ile Arg 245 250 255Lys Ile Asn Thr Ile Ala Val Arg Ala Lys Arg Ala Gly Met Ile Ile 260 265 270Leu Gly Gly Gly Ile Val Lys His His Ile Ala Asn Ala Cys Leu Met 275 280 285Arg Asn Gly Ala Glu Ser Ala Val Tyr Ile Asn Thr Ala Gln Glu Phe 290 295 300Asp Gly Ser Asp Ala Gly Ser Arg Pro Asp Glu Ala Val Ser Trp Gly305 310 315 320Lys Ile Lys Val Gly Ala Asp Ala Val Lys Val Tyr Met Glu Ala Thr 325 330 335Ala Ala Phe Pro Phe Ile Val Ala Asn Thr Phe Ala Lys Glu Asp Gly 340 345 350Leu 37387PRTUnknownDescription of Unknown Organism Yeast sequence 37Met Ser Asp Ile Asn Glu Lys Leu Pro Glu Leu Leu Gln Asp Ala Val1 5 10 15Leu Lys Ala Ser Val Pro Ile Pro Asp Asp Phe Val Lys Val Gln Gly 20 25 30Ile Asp Tyr Ser Lys Pro Glu Ala Thr Asn Met Arg Ala Thr Asp Leu 35 40 45Ile Glu Ala Met Lys Thr Met Gly Phe Gln Ala Ser Ser Val Gly Thr 50 55 60Ala Cys Glu Ile Ile Asp Ser Met Arg Ser Trp Arg Gly Lys His Ile65 70 75 80Asp Glu Leu Asp Asp His Glu Lys Lys Gly Cys Phe Asp Glu Glu Gly 85 90 95Tyr Gln Lys Thr Thr Ile Phe Met Gly Tyr Thr Ser Asn Leu Ile Ser 100 105 110Ser Gly Val Arg Glu Thr Leu Arg Tyr Leu Val Gln His Lys Met Val 115 120 125Asp Ala Val Val Thr Ser Ala Gly Gly Val Glu Glu Asp Leu Ile Lys 130 135 140Cys Leu Ala Pro Thr Tyr Leu Gly Glu Phe Ala Leu Lys Gly Lys Ser145 150 155 160Leu Arg Asp Gln Gly Met Asn Arg Ile Gly Asn Leu Leu Val Pro Asn 165 170 175Asp Asn Tyr Cys Lys Phe Glu Glu Trp Ile Val Pro Ile Leu Asp Lys 180 185 190Met Leu Glu Glu Gln Asp Glu Tyr Val Lys Lys His Gly Ala Asp Cys 195 200 205Leu Glu Ala Asn Gln Asp Val Asp Ser Pro Ile Trp Thr Pro Ser Lys 210 215 220Met Ile Asp Arg Phe Gly Lys Glu Ile Asn Asp Glu Ser Ser Val Leu225 230 235 240Tyr Trp Ala His Lys Asn Lys Ile Pro Ile Phe Cys Pro Ser Leu Thr 245 250 255Asp Gly Ser Ile Gly Asp Met Leu Phe Phe His Thr Phe Lys Ala Ser 260 265 270Pro Lys Gln Leu Arg Val Asp Ile Val Gly Asp Ile Arg Lys Ile Asn 275 280 285Ser Met Ser Met Ala Ala Tyr Arg Ala Gly Met Ile Ile Leu Gly Gly 290 295 300Gly Leu Ile Lys His His Ile Ala Asn Ala Cys Leu Met Arg Asn Gly305 310 315 320Ala Asp Tyr Ala Val Tyr Ile Asn Thr Gly Gln Glu Tyr Asp Gly Ser 325 330 335Asp Ala Gly Ala Arg Pro Asp Glu Ala Val Ser Trp Gly Lys Ile Lys 340 345 350Ala Glu Ala Lys Ser Val Lys Leu Phe Ala Asp Val Thr Thr Val Leu 355 360 365Pro Leu Ile Val Ala Ala Thr Phe Ala Ser Gly Lys Pro Ile Lys Lys 370 375 380Val Lys Asn38538370PRTUnknownDescription of Unknown Organism Archaebacterial sequence 38Met Arg Asp Ile Lys Asp Asn Pro Ile Arg Arg Gly Ile Ala Glu Gln1 5 10 15Ser Glu Ala Met His Pro Gly Tyr Thr Asn Arg Ala Lys Pro Tyr Gly 20 25 30Cys Lys Arg Asp Pro Lys Asp Ile Val Leu Lys Glu Ser Glu Asp Ile 35 40 45Glu Gly Ile Ala Ile Glu Gly Pro Trp Leu Glu Asp Asp Ile Ser Leu 50 55 60Glu Glu Ile Ile Lys Lys Tyr Tyr Leu Lys Ile Gly Phe Gln Ala Ser65 70 75 80His Ile Gly Lys Ala Ile Lys Ile Trp Lys His Ile Glu Glu Lys Arg 85 90 95Lys Lys Gly Asp Glu Ile Thr Val Phe Phe Gly Tyr Thr Ser Asn Ile 100 105 110Val Ser Ser Gly Leu Arg Glu Ile Ile Ala Tyr Leu Val Lys His Lys 115 120

125Lys Ile Asp Ile Ile Val Thr Thr Ala Gly Gly Val Glu Glu Asp Phe 130 135 140Ile Lys Cys Leu Lys Pro Phe Ile Leu Gly Asp Trp Glu Val Asp Gly145 150 155 160Lys Met Leu Arg Glu Lys Gly Ile Asn Arg Ile Gly Asn Ile Phe Val 165 170 175Pro Asn Asp Arg Tyr Ile Ala Phe Glu Glu Tyr Met Met Glu Phe Phe 180 185 190Glu Glu Ile Leu Asn Leu Gln Arg Glu Thr Gly Lys Ile Ile Thr Ala 195 200 205Ser Glu Phe Cys Tyr Lys Leu Gly Glu Phe Met Asp Lys Lys Leu Lys 210 215 220Ser Lys Glu Lys Glu Lys Ser Ile Leu Tyr Trp Ala Tyr Lys Asn Asn225 230 235 240Ile Pro Ile Phe Cys Pro Ala Ile Thr Asp Gly Ser Ile Gly Asp Met 245 250 255Leu Tyr Phe Phe Lys Lys Tyr Asn Lys Asp Glu Glu Leu Lys Ile Asp 260 265 270Val Ala Asn Asp Ile Val Lys Leu Asn Asp Ile Ala Ile Asn Ser Lys 275 280 285Glu Thr Ala Cys Ile Val Leu Gly Gly Ser Leu Pro Lys His Ser Ile 290 295 300Ile Asn Ala Asn Leu Phe Arg Glu Gly Thr Asp Tyr Ala Ile Tyr Val305 310 315 320Thr Thr Ala Leu Pro Trp Asp Gly Ser Leu Ser Gly Ala Pro Pro Glu 325 330 335Glu Gly Val Ser Trp Gly Lys Ile Gly Ala Lys Ala Asp Tyr Val Glu 340 345 350Ile Trp Gly Asp Ala Thr Ile Ile Phe Pro Leu Leu Val Tyr Cys Val 355 360 365Met Lys 3703917PRTUnknownDescription of Unknown Organism Isolated plant deoxyhypusine sythase sequence 39Cys Lys Xaa Phe Leu Gly Phe Thr Ser Asn Leu Xaa Ser Ser Gly Val1 5 10 15Arg405PRTUnknownDescription of Unknown Organism Isolated plant deoxyhypusine sythase sequence 40Asn Arg Ile Gly Asn1 5415PRTUnknownDescription of Unknown Organism Isolated plant deoxyhypusine sythase sequence 41Phe Thr Ser Asn Leu1 5424PRTUnknownDescription of Unknown Organism Isolated plant deoxyhypusine sythase sequence 42Gly Phe Gln Ala14310PRTUnknownDescription of Unknown Organism Isolated plant deoxyhypusine sythase sequence 43Val Thr Thr Xaa Gly Gly Xaa Glu Glu Asp1 5 104411PRTUnknownDescription of Unknown Organism Isolated plant deoxyhypusine sythase sequence 44Ile Ile Leu Gly Gly Gly Leu Pro Lys His His1 5 10458PRTUnknownDescription of Unknown Organism Isolated plant deoxyhypusine sythase sequence 45Arg Asn Gly Ala Asp Xaa Ala Val1 54619PRTUnknownDescription of Unknown Organism Isolated plant deoxyhypusine sythase sequence 46Glu Phe Asp Gly Ser Asp Ser Gly Ala Arg Pro Asp Glu Ala Xaa Ser1 5 10 15Trp Gly Lys4718PRTUnknownDescription of Unknown Organism Isolated plant deoxyhypusine sythase sequence 47Glu Phe Asp Gly Ser Asp Ser Gly Ala Arg Pro Asp Glu Ala Xaa Ser1 5 10 15Trp Gly48368PRTHomo sapiens 48Met Glu Gly Ser Leu Glu Arg Glu Ala Pro Ala Gly Ala Leu Ala Ala1 5 10 15Val Leu Lys His Ser Ser Thr Leu Pro Pro Glu Ser Thr Gln Val Arg 20 25 30Gly Tyr Asp Phe Asn Arg Gly Val Asn Tyr Arg Ala Leu Leu Glu Ala 35 40 45Phe Gly Thr Thr Gly Phe Gln Ala Thr Asn Phe Gly Arg Ala Val Gln 50 55 60Gln Val Asn Ala Met Ile Glu Lys Lys Leu Glu Pro Leu Ser Gln Asp65 70 75 80Glu Asp Gln His Ala Asp Leu Thr Gln Ser Arg Arg Pro Leu Thr Ser 85 90 95Cys Thr Ile Phe Leu Gly Tyr Thr Ser Asn Leu Ile Ser Ser Gly Ile 100 105 110Arg Glu Thr Ile Arg Tyr Leu Val Gln His Asn Met Val Asp Val Leu 115 120 125Val Thr Thr Ala Gly Gly Val Glu Glu Asp Leu Ile Lys Cys Leu Ala 130 135 140Pro Thr Tyr Leu Gly Glu Phe Ser Leu Arg Gly Lys Glu Leu Arg Glu145 150 155 160Asn Gly Ile Asn Arg Ile Gly Asn Leu Leu Val Pro Asn Glu Asn Tyr 165 170 175Cys Lys Phe Glu Asp Trp Leu Met Pro Ile Leu Asp Gln Met Val Met 180 185 190Glu Gln Asn Thr Glu Gly Val Lys Trp Thr Pro Ser Lys Met Ile Ala 195 200 205Arg Leu Gly Lys Glu Ile Asn Asn Pro Glu Ser Val Tyr Tyr Trp Ala 210 215 220Gln Lys Asn His Ile Pro Val Phe Ser Pro Ala Leu Thr Asp Gly Ser225 230 235 240Leu Gly Asp Met Ile Phe Phe His Ser Tyr Lys Asn Pro Gly Leu Val 245 250 255Leu Asp Ile Val Glu Asp Leu Arg Leu Ile Asn Thr Gln Ala Ile Phe 260 265 270Ala Lys Cys Thr Gly Met Ile Ile Leu Gly Gly Gly Trp Lys His His 275 280 285Ile Ala Asn Ala Asn Leu Met Arg Asn Gly Ala Asp Tyr Ala Val Tyr 290 295 300Ile Asn Thr Ala Gln Glu Phe Asp Gly Ser Asp Ser Gly Ala Arg Pro305 310 315 320Asp Glu Ala Val Ser Trp Gly Lys Ile Arg Val Asp Ala Gln Pro Val 325 330 335Lys Val Tyr Ala Asp Ala Ser Leu Val Pro Pro Leu Leu Val Ala Glu 340 345 350Thr Phe Ala Gln Lys Met Asp Ala Phe Met His Glu Lys Asn Glu Asp 355 360 365

Claims

1-70. (canceled)

71. An isolated plant deoxyhypusine synthase comprising the amino acid motif of E-F-D-G-S-D-S-G-A-R-P-D-E-A-X.sub.1-S-W-G-K (SEQ ID NO: 46), wherein X.sub.1 is V or I and wherein the isolated deoxyhypusine synthase exhibits deoxyhypusine synthase catalytic activity.

72. An isolated polynucleotide encoding the isolated deoxyhypusine synthase of claim 71.

73. The plant deoxyhypusine synthase of claim 71 further comprising the amino acid motif of C-K-X.sub.1-F-L-G-F-T-S-N-L-X.sub.2-S-S-G-V-R (SEQ ID NO: 39), wherein X.sub.1 and X.sub.2 are independently either an I or V.

74. An isolated polynucleotide encoding the isolated deoxyhypusine synthase of claim 73.

75. The plant deoxyhypusine synthase of claim 71 further comprising the amino acid motif of N-R-I-G-N (SEQ ID NO: 40).

76. An isolated polynucleotide encoding the isolated deoxyhypusine synthase of claim 75.

77. The plant deoxyhypusine synthase of claim 71 further comprising the amino acid motif of F-T-S-N-L (SEQ ID NO: 41).

78. An isolated polynucleotide encoding the isolated deoxyhypusine synthase of claim 77.

79. The plant deoxyhypusine synthase of claim 71 further comprising the amino acid motif of G-F-Q-A (SEQ ID NO: 42).

80. An isolated polynucleotide encoding the isolated deoxyhypusine synthase of claim 79.

81. The plant deoxyhypusine synthase of claim 71 further comprising the amino acid motif of V-T-T-X.sub.1-G-G X.sub.2-E-E-D (SEQ ID NO: 43) wherein X.sub.1 is A or T and X.sub.2 is I or V.

82. An isolated polynucleotide encoding the isolated deoxyhypusine synthase of claim 81.

83. The plant deoxyhypusine synthase of claim 71 further comprising the amino acid motif of 1-L-G-G-G-L-P-K-H-H (SEQ ID NO: 44).

84. An isolated polynucleotide encoding the isolated deoxyhypusine synthase of claim 83.

85. The plant deoxyhypusine synthase of claim 71 further comprising the amino acid motif of R-N-G-A-D-X.sub.1-A-V (SEQ ID NO: 45), wherein X.sub.1 is Y or F.

86. An isolated polynucleotide encoding the isolated deoxyhypusine synthase of claim 85.