U.S. patent application number 13/013732 was filed with the patent office on 2012-02-09 for ligation-based detection of genetic variants.
This patent application is currently assigned to TANDEM DIAGNOSTICS, INC.. Invention is credited to Arnold Oliphant, Ken Song, Andrew Sparks, John Stuelpnagel.
Application Number | 20120034603 13/013732 |
Document ID | / |
Family ID | 44630473 |
Filed Date | 2012-02-09 |
United States Patent
Application |
20120034603 |
Kind Code |
A1 |
Oliphant; Arnold ; et
al. |
February 9, 2012 |
LIGATION-BASED DETECTION OF GENETIC VARIANTS
Abstract
The present invention provides assays systems and methods for
detection of genetic variants in a sample, including copy number
variation and single nucleotide polymorphisms. The invention
preferably employs the technique of tandem ligation, i.e. the
ligation of two or more fixed sequence oligonucleotides and one or
more bridging oligonucleotides complementary to a region between
the fixed sequence oligonucleotides.
Inventors: |
Oliphant; Arnold; (San Jose,
CA) ; Sparks; Andrew; (San Jose, CA) ;
Stuelpnagel; John; (San Jose, CA) ; Song; Ken;
(San Jose, CA) |
Assignee: |
TANDEM DIAGNOSTICS, INC.
San Jose
CA
|
Family ID: |
44630473 |
Appl. No.: |
13/013732 |
Filed: |
January 25, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61371605 |
Aug 6, 2010 |
|
|
|
Current U.S.
Class: |
435/6.11 |
Current CPC
Class: |
C12Q 1/6862 20130101;
C12Q 1/6809 20130101; C12Q 1/6827 20130101; C12Q 1/6862 20130101;
C12Q 2525/155 20130101; C12Q 2525/161 20130101; C12Q 2533/107
20130101; C12Q 2535/131 20130101; C12Q 2565/514 20130101; C12Q
2565/543 20130101; C12Q 1/6862 20130101; C12Q 2525/155
20130101 |
Class at
Publication: |
435/6.11 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Claims
1. A set of oligonucleotides for ligation-based detection of a
nucleic acid region of interest, comprising: a first
oligonucleotide that comprises sequences complementary to the
sequences of a first portion of a nucleic acid region, and a
universal primer sequence; a second oligonucleotide that comprises
sequences complementary to the sequence of a second portion of a
nucleic acid region and a universal primer sequence; and one or
more bridging oligonucleotides that are complementary to the region
immediately adjacent and between the nucleic acid region
complementary to the first and second oligonucleotides.
2. The set of oligonucleotides of claim 1, wherein the set
comprises two or more bridging oligonucleotides with the ability to
identify different polymorphisms within the nucleic acid of
interest.
3. The set of oligonucleotides of claim 1, wherein the bridging
molecules provide degeneracy for one or more internal position of
the bridging oligonucleotide.
4. The set of oligonucleotides of claim 1, wherein the first
oligonucleotide further comprises one or more indices.
5. The set of oligonucleotides of claim 1, wherein the second
oligonucleotide further comprises one or more indices.
6. The set of oligonucleotides of claim 4, wherein the indices
include a sample index.
7. The set of oligonucleotides of claim 5, wherein the indices
include a sample index.
8. The set of oligonucleotides of claim 4, wherein the indices
include a locus index.
9. The set of oligonucleotides of claim 5, wherein the indices
include a locus index.
10. The set of oligonucleotides of claim 4, wherein the indices
include an allele index.
11. The set of oligonucleotides of claim 5, wherein the indices
include an allele index.
12. An assay system for detecting a nucleic acid region of interest
in a genetic sample, comprising the steps of: providing a genetic
sample; introducing a first and second fixed sequence
oligonucleotide to the genetic sample under conditions that allow
the fixed sequence oligonucleotides to specifically hybridize to
complementary regions in the nucleic acid of interest; introducing
one or more bridging oligonucleotides under conditions that allow
the bridging oligonucleotides to specifically hybridize to
complementary regions in the nucleic acid of interest, wherein the
one or more bridging oligonucleotides are complementary to a region
of the nucleic acid between and immediately adjacent to the region
complementary to the first and second fixed sequence
oligonucleotides; ligating the hybridized oligonucleotides to
create a contiguous ligation product complementary to the nucleic
acid region of interest; amplifying the contiguous ligation product
to create amplification products having the sequence of the nucleic
acid region; and detecting and quantifying the amplification
products; wherein detection of the amplification product provides
detection of the nucleic acid region in the genetic sample.
13. The assay system of claim 12, wherein the fixed sequence
oligonucleotides comprise universal primer regions that are used in
amplification of the contiguous ligation product.
14. The assay system of claim 12, wherein the unhybridized fixed
sequence oligonucleotides are removed prior to amplification of the
contiguous ligation product.
15. The assay system of claim 12, wherein the first and second
fixed sequence oligonucleotides are introduced prior to
introduction of the bridging oligonucleotides.
16. The assay system of claim 12, wherein the hybridization
products of the fixed sequence oligonucleotides and the nucleic
acid region are isolated prior to introduction of the bridging
oligonucleotides.
17. The assay system of claim 12, wherein the one or more bridged
oligonucleotides are introduced simultaneously with the first and
second fixed sequence oligonucleotides.
18. The assay system of claim 12, wherein the amplification
products are optionally isolated and quantified.
19. The assay system of claim 12, wherein the first or second
oligonucleotide comprises one or more indices.
20. The assay system of claim 19, wherein the amplification product
is detected by detection of the one or more indices.
21. The assay system of claim 19, wherein the first or second fixed
sequence oligonucleotide comprises an allele index, and wherein a
bridging oligonucleotide complementary for a specific polymorphism
is used in the hybridization with the corresponding allele
index.
22. The assay system of claim 12, wherein the first or second fixed
sequence oligonucleotides are allele-specific.
23. The assay system of claim 12, wherein the one or more bridging
oligonucleotides are allele-specific.
24. An assay system for detecting a nucleic acid region of interest
in a maternal sample, comprising the steps of: providing a maternal
sample comprising cell free DNA from both maternal and fetal
sources; introducing a first and second fixed sequence
oligonucleotide to the genetic sample under conditions that allow
the fixed sequence oligonucleotides to specifically hybridize to
complementary regions in the nucleic acid of interest; introducing
one or more bridging oligonucleotides under conditions that allow
the bridging oligonucleotides to specifically hybridize to
complementary regions in the nucleic acid of interest, wherein one
or more bridging oligonucleotides are complementary to a region of
the nucleic acid between and immediately adjacent to the region
complementary to the first and second fixed sequence
oligonucleotides; ligating the hybridized oligonucleotides to
create a contiguous ligation product complementary to the nucleic
acid region of interest; and amplifying the contiguous ligation
product to create amplification products having the sequence of the
nucleic acid region; and detecting and quantifying the
amplification products; wherein quantification of the amplification
product provides a relative frequency of the nucleic acid region in
the maternal sample.
25. The assay system of claim 24, wherein the fixed sequence
oligonucleotides comprise universal primer regions that are used in
amplification of the contiguous ligation product.
26. The assay system of claim 24, wherein the unhybridized fixed
sequence oligonucleotides are removed prior to amplification of the
contiguous ligation product.
27. The assay system of claim 24, wherein the first and second
fixed sequence oligonucleotides are introduced prior to
introduction of the bridging oligonucleotides.
28. The assay system of claim 24, wherein the hybridization
products of the fixed sequence oligonucleotides and the nucleic
acid region are isolated prior to introduction of the bridging
oligonucleotides.
29. The assay system of claim 24, wherein the one or more bridged
oligonucleotides are introduced simultaneously with the first and
second fixed sequence oligonucleotides.
30. The assay system of claim 24, wherein the amplification
products are optionally isolated and quantified.
31. The assay system of claim 24, wherein the first or second
oligonucleotide comprises one or more indices.
32. The assay system of claim 31, wherein the amplification
products are detected and quantified by the detection of the one or
more indices.
33. The assay system of claim 31, wherein the first or second
oligonucleotide comprises an allele index, and wherein a bridging
oligonucleotide complementary for a specific polymorphism is used
in the hybridization with the corresponding allele index.
34. A set of oligonucleotides for extension and ligation-based
detection of a nucleic acid region of interest, comprising: a first
oligonucleotide that comprises sequences complementary to the
sequences of a first portion of a nucleic acid region, and a
universal primer sequence; a second oligonucleotide that comprises
sequences complementary to the sequence of a second portion of a
nucleic acid region and a universal primer sequence; and one or
more bridging oligonucleotides that are complementary to the region
between the nucleic acid region complementary to the first and
second oligonucleotides, wherein a gap of one base or more exists
between a bridging oligonucleotide and the first and/or second
fixed sequence oligonucleotides.
35. An assay system for detecting a nucleic acid region of interest
in a genetic sample, comprising the steps of: providing a genetic
sample; introducing a first and second fixed sequence
oligonucleotide to the genetic sample under conditions that allow
the fixed sequence oligonucleotides to specifically hybridize to
complementary regions in the nucleic acid of interest; introducing
one or more bridging oligonucleotides under conditions that allow
the bridging oligonucleotides to specifically hybridize to
complementary regions in the nucleic acid of interest, wherein the
one or more bridging oligonucleotides are complementary to a region
of the nucleic acid between the first and second fixed sequence
oligonucleotides, wherein a gap of one base or more exists between
a bridging oligonucleotide and the first and/or second fixed
sequence oligonucleotides; extending one or more of the hybridized
oligonucleotides to create contiguous hybridized oligonucleotides;
ligating the contiguous hybridized oligonucleotides to create a
contiguous ligation product complementary to the nucleic acid
region of interest; amplifying the contiguous ligation product to
create amplification products having the sequence of the nucleic
acid region; and detecting and quantifying the amplification
products; wherein detection of the amplification product provides
detection of the nucleic acid region in the genetic sample.
36. The assay system of claim 35, wherein the one or more
oligonucleotides are extended by addition of dNTPs and a
polymerase.
37. The assay system of claim 36, wherein the fixed sequence
oligonucleotides comprise universal primer regions that are used in
amplification of the contiguous ligation product.
38. The assay system of claim 35, wherein the unhybridized fixed
sequence oligonucleotides are removed prior to amplification of the
contiguous ligation product.
39. The assay system of claim 35, wherein the first and second
fixed sequence oligonucleotides are introduced prior to
introduction of the bridging oligonucleotides.
40. The assay system of claim 35, wherein the hybridization
products of the fixed sequence oligonucleotides and the nucleic
acid region are isolated prior to introduction of the bridging
oligonucleotides.
41. The assay system of claim 35, wherein the one or more bridged
oligonucleotides are introduced simultaneously with the first and
second fixed sequence oligonucleotides.
42. The assay system of claim 35, wherein the amplification
products are optionally isolated and quantified.
43. The assay system of claim 35, wherein the first or second
oligonucleotide comprises one or more indices.
44. The assay system of claim 35, wherein the amplification product
is detected by detection of the one or more indices.
45. The assay system of claim 44, wherein the first or second fixed
sequence oligonucleotide comprises an allele index, and wherein a
bridging oligonucleotide complementary for a specific polymorphism
is used in the hybridization with the corresponding allele
index.
46. The assay system of claim 35, wherein the first or second fixed
sequence oligonucleotides are allele-specific.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application claims priority to U.S. Ser. No.
61/371,605, filed Aug. 6, 2010, which is herein incorporated by
reference in its entirety.
FIELD OF THE INVENTION
[0002] This invention relates to multiplexed selection,
amplification, and detection of targeted regions from a genetic
sample.
BACKGROUND OF THE INVENTION
[0003] In the following discussion certain articles and methods
will be described for background and introductory purposes. Nothing
contained herein is to be construed as an "admission" of prior art.
Applicant expressly reserves the right to demonstrate, where
appropriate, that the articles and methods referenced herein do not
constitute prior art under the applicable statutory provisions.
[0004] Genetic abnormalities account for a wide number of
pathologies, including pathologies caused by chromosomal aneuploidy
(e.g., Down's syndrome), germline mutations in specific genes
(e.g., sickle cell anemia), and pathologies caused by somatic
mutations (e.g., cancer). Diagnostic methods for determining such
genetic anomalies have become standard techniques for identifying
specific diseases and disorders, as well as providing valuable
information on disease source and treatment options.
[0005] Copy-number variations are alterations of genomic DNA that
correspond to relatively large regions of the genome that have been
deleted or amplified on certain chromosomes. CNVs can be caused by
genomic rearrangements such as deletions, duplications, inversions,
and translocations. Copy number variation has been associated with
various forms of cancer (Cappuzzo F, Hirsch, et al. (2005) 97 (9):
643-655) neurological disorders (Sebat, J., et al. (2007) Science
316 (5823): 445-9, including autism (Sebat, J., et al. (2007)
Science 316 (5823): 445-9), and schizophrenia St Clair D (2008).
Schizophr Bull 35 (1): 9-12. Detection of copy number variants of a
chromosome of interest or a portion thereof in a specific cell
population can be a powerful tool to identify genetic diagnostic or
prognostic indicators of a disease or disorder.
[0006] Detection of copy number variation is also useful in
detecting chromosomal aneuploidies in fetal DNA. Conventional
methods of prenatal diagnostic testing currently requires removal
of a sample of fetal cells directly from the uterus for genetic
analysis, using either chorionic villus sampling (CVS) between 11
and 14 weeks gestation or amniocentesis after 15 weeks. However,
these invasive procedures carry a risk of miscarriage of around 1%
Mujezinovic and Alfirevic, Obstet Gynecol 2007; 110:687-694. A
reliable and convenient method for non-invasive prenatal diagnosis
has long been sought to reduce this risk of miscarriage and allow
earlier testing.
[0007] Single nucleotide polymorphisms (SNPs) are single nucleotide
differences at specific regions of the genome. The average human
genome typically has more than three million SNPs when compared to
a reference genome. SNPs have been associated with various
diseases, including cancer, cardiovascular disease, cystic
fibrosis, and diabetes. Detection of SNPs can be a powerful tool to
identify genetic diagnostic or prognostic indicators of a disease
or disorder. It is often desirable to detect many different SNPs in
the same sample.
[0008] Re-sequencing is the use of DNA sequence detection, often in
a portion of the genome. Re-sequencing can be applied towards the
analysis of a genetic sample from any source including mammals,
other animal species, plants, bacteria, viruses, and the like.
Re-sequencing can be used for many applications including but not
limited to clinical applications and environmental applications.
One use of re-sequencing for clinical applications is the
determination of the DNA sequence in a disease causing gene.
Examples of gene re-sequencing for medical diagnostic or prognostic
indications include the re-sequencing of BRCA1 and BRCA2 for breast
cancer risk. An example of an environmental application would be
the detection of a specific pathogen in a water source.
[0009] There is thus a need for methods of screening for copy
number variations, SNPs and re-sequencing that employs an
efficient, reproducible multiplexed assay. The present invention
addresses this need.
SUMMARY OF THE INVENTION
[0010] This Summary is provided to introduce a selection of
concepts in a simplified form that are further described below in
the Detailed Description. This Summary is not intended to identify
key or essential features of the claimed subject matter, nor is it
intended to be used to limit the scope of the claimed subject
matter. Other features, details, utilities, and advantages of the
claimed subject matter will be apparent from the following written
Detailed Description including those aspects illustrated in the
accompanying drawings and defined in the appended claims.
[0011] The present invention provides assays systems and methods
for detection of copy number variation, polymorphisms, mutations
and re-sequencing. The invention employs the technique of selecting
genomic regions using fixed sequence oligonucleotides and joining
them via ligation and/or extension. In a preferred aspect this is
accomplished by tandem ligation, i.e. the ligation of two or more
non-adjacent, fixed sequence oligonucleotides and a bridging
oligonucleotide that is complementary to a region between and
directly adjacent to the portion of the nucleic acid region of
interest complementary to the fixed sequence oligonucleotides.
[0012] In one general aspect, the invention provides an assay
system for detecting a nucleic acid region of interest in a genetic
sample, comprising the steps of providing a genetic sample;
introducing a first and second fixed sequence oligonucleotide to
the genetic sample under conditions that allow the fixed sequence
oligonucleotides to specifically hybridize to complementary regions
in the nucleic acid of interest; introducing one or more bridging
oligonucleotides under conditions that allow the fixed sequence
oligonucleotides to specifically hybridize to complementary regions
in the nucleic acid of interest, wherein the one or more bridging
oligonucleotides are complementary to a region of the nucleic acid
between and immediately adjacent to the region complementary to the
first and second fixed sequence oligonucleotides; ligating the
hybridized oligonucleotides to create a contiguous ligation product
complementary to the nucleic acid region of interest; amplifying
the contiguous ligation product to create amplification products
having the sequence of the nucleic acid region; and detecting and
quantifying the amplification products, wherein detection of the
amplification product provides detection of the nucleic acid region
in the genetic sample. The amplification products are optionally
isolated and quantified to determine the relative frequency of the
nucleic acid region in the genetic sample.
[0013] In another general aspect, the invention provides an assay
system for detecting a nucleic acid region of interest in a genetic
sample, comprising the steps of providing a genetic sample;
introducing a first and second fixed sequence oligonucleotide to
the genetic sample under conditions that allow the fixed sequence
oligonucleotides to specifically hybridize to complementary regions
in the nucleic acid of interest; introducing one or more bridging
oligonucleotides complementary to a region of the nucleic acid of
interest between the regions complementary to the first and second
fixed sequence oligonucleotides under conditions that allow the
bridging oligonucleotides to specifically hybridize to the nucleic
acid of interest, wherein at least one or more bases on either or
both ends of the bridging oligonucleotide are not immediately
adjacent to the fixed sequence oligonucleotides; extending the one
or more bridging oligonucleotides so that the bridging
oligonucleotides are immediately adjacent to the fixed sequence
oligonucleotides; ligating the hybridized and extended
oligonucleotides to create a contiguous ligation product;
amplifying the contiguous ligation product to create amplification
products having the sequence of the nucleic acid region of
interest; and detecting and quantifying the amplification products,
wherein detection of the amplification product provides detection
of the nucleic acid region in the genetic sample. The amplification
products are optionally isolated and quantified to determine the
relative frequency of the nucleic acid region in the genetic
sample.
[0014] The relative frequency of the nucleic acid in the sample can
be used to determine not only copy number variation for that
particular nucleic acid region, but also in conjunction with and/or
in comparison to other nucleic acids, it may be used to determine
the copy number variation of larger genomic regions, including
chromosomes.
[0015] The fixed sequence oligonucleotides used in the assay system
preferably comprise universal primer regions that are used in
amplification of the contiguous ligation product. Alternatively,
the universal primer sequences can be added to the contiguous
ligation products following the ligation of the hybridized fixes
sequence and bridging oligonucleotides, e.g., through the
introduction of adapters comprising such universal primer sequences
to the ends of the contiguous ligation product.
[0016] The bridging oligonucleotides are preferably shorter
oligonucleotides, preferably between 1-10 nucleotides and more
preferably between 3-7 nucleotides, and can be designed to provide
degeneracy within the sequence of the bridging oligonucleotides,
e.g., the bridging oligonucleotides are provided as full or partial
randomers with various sequence variations to ensure detection of
the selected nucleic region even if the region contains a
polymorphic reside. The degeneracy of the bridging oligonucleotide
can be determined based on the predicted polymorphisms that may be
present in the selected nucleic acid region. Alternatively, the
pool of bridging oligonucleotides used in a reaction can provide
degeneracy for one or more position of the bridging
oligonucleotide. In one aspect, the pool of bridging
oligonucleotides used in a reaction can provide degeneracy for each
position of the bridging oligonucleotide. In yet another aspect,
the pool of bridging molecules used in a reaction can provide
degeneracy for each internal position of the bridging
oligonucleotide, with the nucleotides adjacent to the ligation
sites remaining constant in the pool of bridging oligonucleotides
used within the set. In another aspect, the bridging oligo is
longer than 10 nucleotides and preferably 18-30 nucleotides. In a
preferred aspect, a single bridging oligonucleotide complementary
to a region of the nucleic acid of interest is hybridized between
the region complementary to the first and second fixed sequence
oligonucleotides. In another aspect, two or more bridging
oligonucleotides are hybridized within the region between the fixed
sequence oligonucleotides, and preferably the bridging
oligonucleotides hybridize to adjacent regions on the nucleic acid
of interest. In this situation, ligation occurs between the fixed
sequence oligonucleotides and the adjacent bridging
oligonucleotides as well as between adjacent bridging
oligonucleotides. In another aspect, there are one or more bases
between the serial bridging oligonucleotides and/or one or more
bases between the bridging oligonucleotides and fixed sequence
oligonucleotides. These gaps can be extended, e.g., by use of
polymerase and dNTPs prior to ligation.
[0017] It is an advantage that using degenerate bridging
oligonucleotides obviates the need to predetermine the maternal and
fetal polymorphic content for a selected nucleic acid region prior
to employing the detection methods of the assay system.
[0018] In one aspect of the invention, the first and second fixed
sequence oligonucleotides are introduced to the genetic sample and
specifically hybridized to the complementary portions of the
nucleic acids of interest prior to introduction of the bridging
oligonucleotides. The hybridized regions are optionally isolated
following the specific hybridization of the fixed sequence
oligonucleotides to remove any excess unbound oligonucleotides in
the reaction.
[0019] In another aspect, the bridging oligonucleotides are
introduced to the genetic sample at the same time the fixed
sequence oligonucleotides are introduced, and all are allowed to
hybridize to a contiguous portion of the nucleic acid region of
interest.
[0020] In certain aspects, the fixed sequence oligonucleotides of
the invention comprise one or more indices. These indices may serve
as surrogate sequences for the identification of the nucleic acid
region of interest, a locus, or a particular allele of a locus. In
particular, these indices may serve as surrogate detection
sequences for the detection of hybridization of the nucleic acid
region of interest to an array. Other indices may be used to
correspond an amplification product to a particular sample, or to
identify experimental error within the assay methods. In particular
assays, the amplification product from the contiguous ligation
product is identified and quantified using one or more indices as a
surrogate to the actual sequence of the amplification product.
[0021] In specific assay systems, the first or second fixed
sequence oligonucleotides comprise an allele index that associates
a specific allele with that complementary fixed sequence
oligonucleotide.
[0022] In another general aspect of the invention, an assay system
is provided for detecting a nucleic acid region of interest in a
maternal sample comprising both maternal and fetal cell free DNA.
This assay system comprises the steps of providing a maternal
sample comprising cell free DNA from both maternal and fetal
sources; introducing a first and second non-adjacent, fixed
sequence oligonucleotide to the genetic sample under conditions
that allow the fixed sequence oligonucleotides to specifically
hybridize to complementary regions in the nucleic acid of interest;
introducing one or more bridging oligonucleotides under conditions
that allow the bridging oligonucleotides to specifically hybridize
to complementary regions in the nucleic acid of interest, wherein
one or more bridging oligonucleotides are complementary to a region
of the nucleic acid between and immediately adjacent to the region
complementary to the first and second fixed sequence
oligonucleotides; ligating the hybridized oligonucleotides to
create a contiguous ligation product complementary to the nucleic
acid region of interest; amplifying the contiguous ligation product
to create amplification products having the sequence of the nucleic
acid region; and detecting and quantifying the amplification
products; wherein quantification of the amplification product
provides a relative frequency of the nucleic acid region in the
maternal sample.
[0023] The relative frequency of the nucleic acid in the sample can
be used to determine not only copy number variation for that
particular nucleic acid region, but also in conjunction with and/or
in comparison to other nucleic acids, it may be used to determine
the copy number variation of larger genomic regions, including
chromosomal imbalance between maternal and fetal nucleic acid
regions due to aneuploidy in the fetus.
[0024] The invention also provides compositions that are useful in
ligation-based nucleic acid detection assays such as those of the
present invention. Accordingly, the invention provides sets of
oligonucleotides for ligation-based detection of a nucleic acid
region of interest, comprising a first oligonucleotide that
comprises sequences complementary to the sequences of a first
portion of a nucleic acid region, a universal primer sequence, and
optionally one or more indices; a second oligonucleotide that
comprises sequences complementary to the sequence of a second
portion of a nucleic acid region and a universal primer sequence;
and one or more bridging oligonucleotides that are complementary to
the region immediately adjacent and between the nucleic acid region
complementary to the first and second oligonucleotides. In certain
aspects, the set of oligonucleotides comprises two or more bridging
oligonucleotides with the ability to identify different
polymorphisms within the nucleic acid of interest. In other
aspects, the bridging molecules provide degeneracy for each
position of the bridging oligonucleotide. In yet other aspects, the
bridging molecules provide degeneracy for each internal position of
the bridging oligonucleotide, with the nucleotides adjacent to the
ligation sites remaining constant in the pool of bridging
oligonucleotides used within the set.
[0025] These aspects and other features and advantages of the
invention are described in more detail below.
BRIEF DESCRIPTION OF THE FIGURES
[0026] FIG. 1 illustrates a first general schematic for a
ligation-based assay system of the invention.
[0027] FIG. 2 illustrates a second general schematic for a
ligation-based assay system of the invention.
[0028] FIG. 3 illustrates a multiplexed assay system for detection
of two or more regions of interest.
[0029] FIG. 4 illustrates a first multiplexed assay system for
detection of two or more alleles within a region of interest.
[0030] FIG. 5 illustrates a second multiplexed assay system for
detection of two or more alleles within a region of interest.
[0031] FIG. 6 illustrates a third multiplexed assay system for
detection of two or more alleles within a region of interest.
[0032] FIG. 7 illustrates a fourth multiplexed assay system for
detection of two or more alleles within a region of interest.
[0033] FIG. 8 illustrates a fifth multiplexed assay system for
detection of two or more alleles within a region of interest.
[0034] FIG. 9 illustrates a first general schematic for assay
system utilizing oligo extension in a ligation-based assay system
of the invention.
[0035] FIG. 10 illustrates a second general schematic for assay
system utilizing oligo extension in a ligation-based assay system
of the invention.
[0036] FIG. 11 illustrates an assay system utilizing a single fixed
sequence oligonucleotide.
[0037] FIG. 12 illustrates the genotyping performance that is
obtained using one exemplary assay format.
[0038] FIG. 13 is a graph illustrating the ability of the assay
system to determine percent fetal DNA in a maternal sample.
DEFINITIONS
[0039] The terms used herein are intended to have the plain and
ordinary meaning as understood by those of ordinary skill in the
art. The following definitions are intended to aid the reader in
understanding the present invention, but are not intended to vary
or otherwise limit the meaning of such terms unless specifically
indicated.
[0040] The term "allele index" refers generally to a series of
nucleotides that corresponds to a specific SNP. The allele index
may contain additional nucleotides that allow for the detection of
deletion, substitution, or insertion of one or more bases. The
index may be combined with any other index to create one index that
provides information for two properties (e.g.,
sample-identification index, allele-locus index).
[0041] The term "binding pair" means any two molecules that
specifically bind to one another using covalent and/or non-covalent
binding, and which can be used for attachment of genetic material
to a substrate. Examples include, but are not limited to, ligands
and their protein binding partners, e.g., biotin and avidin, biotin
and streptavidin, an antibody and its particular epitope, and the
like.
[0042] The term "chromosomal abnormality" refers to any genetic
variant for all or part of a chromosome. The genetic variants may
include but not be limited to any copy number variant such as
duplications or deletions, translocations, inversions, and
mutations.
[0043] The terms "complementary" or "complementarity" are used in
reference to nucleic acid molecules (i.e., a sequence of
nucleotides) that are related by base-pairing rules. Complementary
nucleotides are, generally, A and T (or A and U), or C and G. Two
single stranded RNA or DNA molecules are said to be substantially
complementary when the nucleotides of one strand, optimally aligned
and with appropriate nucleotide insertions or deletions, pair with
at least about 90% to about 95% complementarity, and more
preferably from about 98% to about 100% complementarity, and even
more preferably with 100% complementarity. Alternatively,
substantial complementarity exists when an RNA or DNA strand will
hybridize under selective hybridization conditions to its
complement. Selective hybridization conditions include, but are not
limited to, stringent hybridization conditions. Stringent
hybridization conditions will typically include salt concentrations
of less than about 1 M, more usually less than about 500 mM and
preferably less than about 200 mM. Hybridization temperatures are
generally at least about 2.degree. C. to about 6.degree. C. lower
than melting temperatures (T.sub.in).
[0044] The term "correction index" refers to an index that may
contain additional nucleotides that allow for identification and
correction of amplification, sequencing or other experimental
errors including the detection of deletion, substitution, or
insertion of one or more bases during sequencing as well as
nucleotide changes that may occur outside of sequencing such as
oligo synthesis, amplification, and any other aspect of the
assay.
[0045] The term "diagnostic tool" as used herein refers to any
composition or assay of the invention used in combination as, for
example, in a system in order to carry out a diagnostic test or
assay on a patient sample.
[0046] The term "genetic sample" refers to any sample comprising
all or a portion of the genetic information of an organism,
including but not limited to virus, bacteria, fungus, plants and
animals, and in particular mammals. The genetic information that
can be interrogated within a genetic sample includes genomic DNA
(both coding and non-coding regions), mitochondrial DNA, RNA, and
nucleic acid products derived from each of these. Such nucleic acid
products include cDNA created from mRNA or products of
pre-amplification to increase the material for analysis.
[0047] The term "hybridization" generally means the reaction by
which the pairing of complementary strands of nucleic acid occurs.
DNA is usually double-stranded, and when the strands are separated
they will re-hybridize under the appropriate conditions. Hybrids
can form between DNA-DNA, DNA-RNA or RNA-RNA. They can form between
a short strand and a long strand containing a region complementary
to the short one. Imperfect hybrids can also form, but the more
imperfect they are, the less stable they will be (and the less
likely to form).
[0048] The term "identification index" refers generally to a series
of nucleotides that are incorporated into an oligonucleotide during
oligonucleotide synthesis for identification purposes.
Identification index sequences are preferably 6 or more nucleotides
in length. In a preferred aspect, the identification index is long
enough to have statistical probability of labeling each molecule
with a target sequence uniquely. For example, if there are 3000
copies of a particular target sequence, there are substantially
more than 3000 identification indexes such that each copy of a
particular target sequence is likely to be labeled with a unique
identification index. The identification index may contain
additional nucleotides that allow for identification and correction
of sequencing errors including the detection of deletion,
substitution, or insertion of one or more bases during sequencing
as well as nucleotide changes that may occur outside of sequencing
such as oligo synthesis, amplification, and any other aspect of the
assay. The index may be combined with any other index to create one
index that provides information for two properties (e.g.,
sample-identification index, allele-locus index).
[0049] The term "identification index" refers generally to a series
of nucleotides incorporated into a primer region of an
amplification process for unique identification of an amplification
product of a nucleic acid region. Identification index sequences
are preferably 6 or more nucleotides in length. In a preferred
aspect, the identification index is long enough to have statistical
probability of labeling each molecule with a target sequence
uniquely. For example, if there are 3000 copies of a particular
target sequence, there are substantially more than 3000
identification indexes such that each copy of a particular target
sequence is likely to be labeled with a unique identification
index. The identification index may contain additional nucleotides
that allow for identification and correction of sequencing errors
including the detection of deletion, substitution, or insertion of
one or more bases during sequencing as well as nucleotide changes
that may occur outside of sequencing such as oligo synthesis,
amplification, and any other aspect of the assay. The index may be
combined with any other index to create one index that provides
information for two properties (e.g., sample-identification index,
locus-identification index).
[0050] As used herein the term "ligase" refers generally to a class
of enzymes, DNA ligases (typically T4 DNA ligase), which can link
pieces of DNA together. The pieces must have compatible
ends--either with both of them blunt or with mutually-compatible
sticky ends--and the reaction requires ATP. "Ligation" is the
process of joining two pieces of DNA together.
[0051] The terms "locus" and "loci" as used herein refer to a
nucleic acid regions of known location in a genome.
[0052] The term "locus index" refers generally to a series of
nucleotides that correspond to a given genomic locus. In a
preferred aspect, the locus index is long enough to label each
target sequence region uniquely. For instance, if the method uses
192 target sequence regions, there are at least 192 unique locus
indexes, each uniquely identifying each target region. The locus
index may contain additional nucleotides that allow for
identification and correction of sequencing errors including the
detection of deletion, substitution, or insertion of one or more
bases during sequencing as well as nucleotide changes that may
occur outside of sequencing such as oligo synthesis, amplification,
and any other aspect of the assay. The index may be combined with
any other index to create one index that provides information for
two properties (e.g. sample-identification index, allele-locus
index).
[0053] The term "maternal sample" as used herein refers to any
sample taken from a pregnant mammal which comprises both fetal and
maternal cell free DNA. Preferably, maternal samples for use in the
invention are obtained through relatively non-invasive means, e.g.,
phlebotomy or other standard techniques for extracting peripheral
samples from a subject.
[0054] The term "melting temperature" or T.sub.m is commonly
defined as the temperature at which a population of double-stranded
nucleic acid molecules becomes half dissociated into single
strands. The equation for calculating the T.sub.m of nucleic acids
is well known in the art. As indicated by standard references, a
simple estimate of the T.sub.m value may be calculated by the
equation: T.sub.m=81.5+16.6(log10[Na+])0.41(%[G+C])-675/n-1.0 m,
when a nucleic acid is in aqueous solution having cation
concentrations of 0.5 M or less, the (G+C) content is between 30%
and 70%, n is the number of bases, and m is the % age of base pair
mismatches (see, e.g., Sambrook J et al., Molecular Cloning, A
Laboratory Manual, 3rd Ed., Cold Spring Harbor Laboratory Press
(2001)). Other references include more sophisticated computations,
which take structural as well as sequence characteristics into
account for the calculation of T.sub.m.
[0055] "Microarray" or "array" refers to a solid phase support
having a surface, preferably but not exclusively a planar or
substantially planar surface, which carries an array of sites
containing nucleic acids such that each site of the array comprises
substantially identical or identical copies of oligonucleotides or
polynucleotides and is spatially defined and not overlapping with
other member sites of the array; that is, the sites are spatially
discrete. The array or microarray can also comprise a non-planar
interrogatable structure with a surface such as a bead or a well.
The oligonucleotides or polynucleotides of the array may be
covalently bound to the solid support, or may be non-covalently
bound. Conventional microarray technology is reviewed in, e.g.,
Schena, Ed., Microarrays: A Practical Approach, IRL Press, Oxford
(2000). "Array analysis", "analysis by array" or "analysis by
microarray" refers to analysis, such as, e.g., sequence analysis,
of one or more biological molecules using a microarray.
[0056] The term "oligonucleotides" or "oligos" as used herein
refers to linear oligomers of natural or modified nucleic acid
monomers, including deoxyribonucleotides, ribonucleotides, anomeric
forms thereof, peptide nucleic acid monomers (PNAs), locked
nucleotide acid monomers (LNA), and the like, or a combination
thereof, capable of specifically binding to a single-stranded
polynucleotide by way of a regular pattern of monomer-to-monomer
interactions, such as Watson-Crick type of base pairing, base
stacking, Hoogsteen or reverse Hoogsteen types of base pairing, or
the like. Usually monomers are linked by phosphodiester bonds or
analogs thereof to form oligonucleotides ranging in size from a few
monomeric units, e.g., 8-12, to several tens of monomeric units,
e.g., 100-200 or more. Suitable nucleic acid molecules may be
prepared by the phosphoramidite method described by Beaucage and
Carruthers (Tetrahedron Lett., 22:1859-1862 (1981)), or by the
triester method according to Matteucci, et al. (J. Am. Chem. Soc.,
103:3185 (1981)), both incorporated herein by reference, or by
other chemical methods such as using a commercial automated
oligonucleotide synthesizer.
[0057] As used herein "nucleotide" refers to a base-sugar-phosphate
combination. Nucleotides are monomeric units of a nucleic acid
sequence (DNA and RNA). The term nucleotide includes ribonucleoside
triphosphates ATP, UTP, CTG, GTP and deoxyribonucleoside
triphosphates such as dATP, dCTP, dITP, dUTP, dGTP, dTTP, or
derivatives thereof. Such derivatives include, for example,
[.alpha.S]dATP, 7-deaza-dGTP and 7-deaza-dATP, and nucleotide
derivatives that confer nuclease resistance on the nucleic acid
molecule containing them. The term nucleotide as used herein also
refers to dideoxyribonucleoside triphosphates (ddNTPs) and their
derivatives. Illustrated examples of dideoxyribonucleoside
triphosphates include, but are not limited to, ddATP, ddCTP, ddGTP,
ddITP, and ddTTP.
[0058] According to the present invention, a "nucleotide" may be
unlabeled or detectably labeled by well known techniques.
Fluorescent labels and their attachment to oligonucleotides are
described in many reviews, including Haugland, Handbook of
Fluorescent Probes and Research Chemicals, 9th Ed., Molecular
Probes, Inc., Eugene Oreg. (2002); Keller and Manak, DNA Probes,
2nd Ed., Stockton Press, New York (1993); Eckstein, Ed.,
Oligonucleotides and Analogues: A Practical Approach, IRL Press,
Oxford (1991); Wetmur, Critical Reviews in Biochemistry and
Molecular Biology, 26:227-259 (1991); and the like. Other
methodologies applicable to the invention are disclosed in the
following sample of references: Fung et al., U.S. Pat. No.
4,757,141; Hobbs, Jr., et al., U.S. Pat. No. 5,151,507;
Cruickshank, U.S. Pat. No. 5,091,519; Menchen et al., U.S. Pat. No.
5,188,934; Begot et al., U.S. Pat. No. 5,366,860; Lee et al., U.S.
Pat. No. 5,847,162; Khanna et al., U.S. Pat. No. 4,318,846; Lee et
al., U.S. Pat. No. 5,800,996; Lee et al., U.S. Pat. No. 5,066,580:
Mathies et al., U.S. Pat. No. 5,688,648; and the like. Labeling can
also be carried out with quantum dots, as disclosed in the
following patents and patent publications: U.S. Pat. Nos.
6,322,901; 6,576,291; 6,423,551; 6,251,303; 6,319,426; 6,426,513;
6,444,143; 5,990,479; 6,207,392; 2002/0045045; and 2003/0017264.
Detectable labels include, for example, radioactive isotopes,
fluorescent labels, chemiluminescent labels, bioluminescent labels
and enzyme labels. Fluorescent labels of nucleotides may include
but are not limited fluorescein, 5-carboxyfluorescein (FAM),
2'7'-dimethoxy-4'5-dichloro-6-carboxyfluorescein (JOE), rhodamine,
6-carboxyrhodamine (R6G), N,N,N',N'-tetramethyl-6-carboxyrhodamine
(TAMRA), 6-carboxy-X-rhodamine (ROX), 4-(4' dimethylaminophenylazo)
benzoic acid (DABCYL), Cascade Blue, Oregon Green, Texas Red,
Cyanine and 5-(2'-aminoethyl)aminonaphthalene-1-sulfonic acid
(EDANS). Specific examples of fluorescently labeled nucleotides
include [R6G]dUTP, [TAMRA]dUTP, [R110]dCTP, [R6G]dCTP, [TAMRA]dCTP,
[JOE]ddATP, [R6G]ddATP, [FAM]ddCTP, [R110]ddCTP, [TAMRA]ddGTP,
[ROX]ddTTP, [dR6G]ddATP, [dR110]ddCTP, [dTAMRA]ddGTP, and
[dROX]ddTTP available from Perkin Elmer, Foster City, Calif.
FluoroLinki DeoxyNucleotides, FluoroLink Cy3-dCTP, FluoroLink
Cy5-dCTP, FluoroLink Fluor X-dCTP, FluoroLink Cy3-dUTP, and
FluoroLink Cy5-dUTP available from Amersham, Arlington Heights,
Ill.; Fluorescein-15-dATP, Fluorescein-12-dUTP,
Tetramethyl-rodamine-6-dUTP, IR770-9-dATP, Fluorescein-12-ddUTP,
Fluorescein-12-UTP, and Fluorescein-15-2'-dATP available from
Boehringer Mannheim, Indianapolis, Ind.; and Chromosomee Labeled
Nucleotides, BODIPY-FL-14-UTP, BODIPY-FL-4-UTP, BODIPY-TMR-14-UTP,
BODIPY-TMR-14-dUTP, BODIPY-TR-14-UTP, BODIPY-TR-14-dUTP, Cascade
Blue-7-UTP, Cascade Blue-7-dUTP, fluorescein-12-UTP,
fluorescein-12-dUTP, Oregon Green 488-5-dUTP, Rhodamine
Green-5-UTP, Rhodamine Green-5-dUTP, tetramethylrhodamine-6-UTP,
tetramethylrhodamine-6-dUTP, Texas Red-5-UTP, Texas Red-5-dUTP, and
Texas Red-12-dUTP available from Molecular Probes, Eugene,
Oreg.
[0059] As used herein the term "polymerase" refers to an enzyme
that links individual nucleotides together into a long strand,
using another strand as a template. There are two general types of
polymerase--DNA polymerases, which synthesize DNA, and RNA
polymerases, which synthesize RNA. Within these two classes, there
are numerous sub-types of polymerases, depending on what type of
nucleic acid can function as template and what type of nucleic acid
is formed.
[0060] As used herein "polymerase chain reaction" or "PCR" refers
to a technique for replicating a specific piece of target DNA in
vitro, even in the presence of excess non-specific DNA. Primers are
added to the target DNA, where the primers initiate the copying of
the target DNA using nucleotides and, typically, Taq polymerase or
the like. By cycling the temperature, the target DNA is
repetitively denatured and copied. A single copy of the target DNA,
even if mixed in with other, random DNA, can be amplified to obtain
billions of replicates. The polymerase chain reaction can be used
to detect and measure very small amounts of DNA and to create
customized pieces of DNA. In some instances, linear amplification
methods may be used as an alternative to PCR.
[0061] The term "polymorphism" as used herein refers to any genetic
changes or variants in a loci that may be indicative of that
particular loci, including but not limited to single nucleotide
polymorphisms (SNPs), methylation differences, short tandem repeats
(STRs), and the like.
[0062] Generally, a "primer" is an oligonucleotide used to, e.g.,
prime DNA extension, ligation and/or synthesis, such as in the
synthesis step of the polymerase chain reaction or in the primer
extension techniques used in certain sequencing reactions. A primer
may also be used in hybridization techniques as a means to provide
complementarity of a nucleic acid region to a capture
oligonucleotide for detection of a specific nucleic acid
region.
[0063] The term "research tool" as used herein refers to any
composition or assay of the invention used for scientific enquiry,
academic or commercial in nature, including the development of
pharmaceutical and/or biological therapeutics. The research tools
of the invention are not intended to be therapeutic or to be
subject to regulatory approval; rather, the research tools of the
invention are intended to facilitate research and aid in such
development activities, including any activities performed with the
intention to produce information to support a regulatory
submission.
[0064] The terms "sequencing" as used herein refers generally to
any and all biochemical methods that may be used to determine the
order of nucleotide bases including but not limited to adenine,
guanine, cytosine and thymine, in one or more molecules of DNA. As
used herein the term "sequence determination" means using any
method of sequencing known in the art to determine the sequence
nucleotide bases in a nucleic acid.
[0065] The term "sample index" refers generally to a series of
unique nucleotides (i.e., each sample index is unique), and can be
used to allow for multiplexing of samples in a single reaction
vessel such that each sample can be identified based on its sample
index. In a preferred aspect, there is a unique sample index for
each sample in a set of samples, and the samples are pooled during
sequencing. For example, if twelve samples are pooled into a single
sequencing reaction, there are at least twelve unique sample
indexes such that each sample is labeled uniquely. The sample index
may contain additional nucleotides that allow for identification
and correction of sequencing errors including the detection of
deletion, substitution, or insertion of one or more bases during
sequencing as well as nucleotide changes that may occur outside of
sequencing such as oligo synthesis, amplification, and any other
aspect of the assay. The index may be combined with any other index
to create one index that provides information for two properties
(e.g., sample-identification index, allele-locus index).
DETAILED DESCRIPTION OF THE INVENTION
[0066] The practice of the techniques described herein may employ,
unless otherwise indicated, conventional techniques and
descriptions of organic chemistry, polymer technology, molecular
biology (including recombinant techniques), cell biology,
biochemistry, and sequencing technology, which are within the skill
of those who practice in the art. Such conventional techniques
include polymer array synthesis, hybridization and ligation of
polynucleotides, and detection of hybridization using a label.
Specific illustrations of suitable techniques can be had by
reference to the examples herein. However, other equivalent
conventional procedures can, of course, also be used. Such
conventional techniques and descriptions can be found in standard
laboratory manuals such as Green, et al., Eds. (1999), Genome
Analysis: A Laboratory Manual Series (Vols. I-IV); Weiner, Gabriel,
Stephens, Eds. (2007), Genetic Variation: A Laboratory Manual;
Dieffenbach, Dveksler, Eds. (2003), PCR Primer: A Laboratory
Manual; Bowtell and Sambrook (2003), DNA Microarrays: A Molecular
Cloning Manual; Mount (2004), Bioinformatics: Sequence and Genome
Analysis; Sambrook and Russell (2006), Condensed Protocols from
Molecular Cloning: A Laboratory Manual; and Sambrook and Russell
(2002), Molecular Cloning: A Laboratory Manual (all from Cold
Spring Harbor Laboratory Press); Stryer, L. (1995) Biochemistry
(4th Ed.) W.H. Freeman, New York N.Y.; Gait, "Oligonucleotide
Synthesis: A Practical Approach" 1984, IRL Press, London; Nelson
and Cox (2000), Lehninger, Principles of Biochemistry 3.sup.rd Ed.,
W.H. Freeman Pub., New York, N.Y.; and Berg et al. (2002)
Biochemistry, 5.sup.th Ed., W.H. Freeman Pub., New York, N.Y., all
of which are herein incorporated in their entirety by reference for
all purposes.
[0067] Note that as used herein and in the appended claims, the
singular forms "a," "an," and "the" include plural referents unless
the context clearly dictates otherwise. Thus, for example,
reference to "an allele" refers to one or more copies of allele
with various sequence variations, and reference to "the assay
system" includes reference to equivalent steps and methods known to
those skilled in the art, and so forth.
[0068] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. All
publications mentioned herein are incorporated by reference for the
purpose of describing and disclosing devices, formulations and
methodologies that may be used in connection with the presently
described invention.
[0069] Where a range of values is provided, it is understood that
each intervening value, between the upper and lower limit of that
range and any other stated or intervening value in that stated
range is encompassed within the invention. The upper and lower
limits of these smaller ranges may independently be included in the
smaller ranges, and are also encompassed within the invention,
subject to any specifically excluded limit in the stated range.
Where the stated range includes one or both of the limits, ranges
excluding either both of those included limits are also included in
the invention.
[0070] In the following description, numerous specific details are
set forth to provide a more thorough understanding of the present
invention. However, it will be apparent to one of skill in the art
that the present invention may be practiced without one or more of
these specific details. In other instances, well-known features and
procedures well known to those skilled in the art have not been
described in order to avoid obscuring the invention.
The Invention in General
[0071] The invention provides assay systems to identify copy number
variants of nucleic acid regions (including loci, sets of loci and
larger genomic regions, e.g., chromosomes), mutations, and
polymorphisms in a genetic sample and/or to select a portion of a
genetic sample for re-sequencing in a genetic sample.
[0072] In one aspect, the assay system utilizes methods to
selectively identify and/or isolate selected nucleic acid regions
from two or more genomic regions of interest (e.g., chromosomes or
loci) in a genetic sample, and allows determination of an atypical
copy number of a particular genomic region based on the comparison
between the numbers of detected nucleic acid regions from the two
or more chromosomes in the genetic sample or by comparison to one
or more reference chromosomes from the same or a different
sample.
[0073] More particularly, the assay system utilizes a tandem
ligation method comprising the use of a first and second
non-adjacent oligonucleotides of fixed sequence complementary to a
selected nucleic acid region on a chromosome of interest or a
reference chromosome, and one or more short, bridging
oligonucleotides (also called "splint" oligos) complementary to the
region between and immediately adjacent to the first and second
oligonucleotides. Hybridization of these three or more
oligonucleotides to a selected nucleic acid of interest, followed
by ligation of these three or more oligonucleotides, provides a
contiguous template for further amplification, detection and
quantification of this region. The amplified regions may be
quantified directly from the amplification reactions, or they are
optionally isolated and identified to quantify the number of
selected nucleic acid regions in a sample.
[0074] In specific aspects, the tandem ligation methods use fixed
sequence oligonucleotides with a set of two or more contiguous,
adjacent bridging oligonucleotides that hybridize to the region of
the nucleic acid between the regions complementary to the fixed
sequence oligonucleotides. These bridging oligonucleotides
hybridize adjacent to one another and to the fixed sequence
oligonucleotides. The contiguous bridging oligonucleotides are
ligated during the ligation reaction with the fixed sequence
oligonucleotides and with each other, resulting in a single
contiguous template for further amplification and sequence
determination.
[0075] In other aspects of the invention, the assay system uses a
set of oligonucleotides that bind to non-adjacent regions within a
nucleic acid region of interest, and primer extension is utilized
to created a contiguous set of hybridized oligos prior to the
tandem ligation step. In such aspects, the assay system utilizes a
tandem ligation method comprising the use of first and second
non-adjacent oligonucleotides of fixed sequence complementary to a
selected nucleic acid region on a chromosome of interest or a
reference chromosome, and one or more short, bridging
oligonucleotides complementary to the region between the first and
second oligonucleotides but not immediately adjacent to one or the
other fixed sequence oligonucleotide. Hybridization of these three
or more oligonucleotides to a selected nucleic acid of interest is
followed by an extension reaction using dNTPs and a polymerase to
create a set of adjacent hybridized oligonucleotides, and ligation
of the adjacent hybridized oligos. The combination of extension and
ligation provides a contiguous template for further amplification,
detection and quantification of this region. The amplified regions
may be quantified directly from the amplification reactions, or
they are optionally isolated and identified to quantify the number
of selected nucleic acid regions in a sample.
[0076] In specific aspects, the tandem ligation methods use fixed
sequence oligonucleotides with a set of two or more sequential but
non-adjacent bridging oligonucleotides that hybridize to the region
of the nucleic acid between the regions complementary to the fixed
sequence oligonucleotides. The "gap" regions between the fixed
sequence oligonucleotides and the bridging oligos and/or between
the sequential bridging oligonucleotides are ligated during the
ligation reaction, resulting in a single contiguous template for
further amplification and sequence determination.
[0077] In preferred aspects of the invention, the nucleic acids
from the genetic sample are associated with a substrate, e.g.,
using binding pairs to attach the genetic material to a substrate
surface. Briefly, a first member of a binding pair (e.g., biotin)
can be associated with a nucleic acid of interest, and the
associated nucleic acid attached to a substrate comprising a second
member of a binding pair (e.g., avidin or streptavidin) on its
surface. This can be particularly useful in removing any
unhybridized oligonucleotides following specific binding of the
fixed sequence oligonucleotides and/or the bridging
oligonucleotides to the nucleic acid of interest. Briefly, the
attached nucleic acids can be hybridized to the oligonucleotides,
and the surface preferably treated to remove any unhybridized
oligonucleotides, e.g., by washing or other removal methods such as
degradation of such oligonucleotides as discussed in Willis et al.,
U.S. Pat. Nos. 7,700,323 and 6,858,412.
[0078] There are a number of methods that may be used in the
association of a nucleic acid via binding pair interactions, as
will be apparent to one skilled in the art upon reading the present
specification. For example, numerous methods may be used for
labeling the nucleic acids of a genetic sample with biotin,
including random photobiotinylation, end-labeling with biotin,
replicating with biotinylated nucleotides, and replicating with a
biotin-labeled primer.
[0079] In a preferred aspect, the assay system of the invention
employs a multiplexed reaction with a set of three or more such
oligonucleotides for each selected nucleic acid region. This
general aspect is illustrated in FIG. 1. Each set of
oligonucleotides preferably contains two oligonucleotides 101, 103
of fixed sequence and one or more bridging oligonucleotides 113.
Each of the fixed sequence oligonucleotides comprises a region
complementary to the selected nucleic acid region 105, 107, and
preferably universal primer sequences 109, 111, i.e. oligo regions
complementary to universal primers. These universal primer
sequences 109, 111 are used to amplify the different selected
nucleic acid regions following ligation of the hybridized fixed
sequence oligonucleotides and the bridging oligonucleotide. The
universal primer sequences are located at or near the ends of the
fixed sequence oligonucleotides 101, 103, and thus preserve the
nucleic acid-specific sequences in the products of any universal
amplification methods. Amplification products can be detected by
determination of the sequence of the products, e.g., through
sequence determination or hybridization, e.g., to an array or a
bead-based detection system such as the Luminex.TM. bead-based
assay (Invitrogen, Carlsbad, Calif.) or the BeadXpress.TM. assay
(Illumina, San Diego, Calif.).
[0080] In one aspect of the assay systems of the invention, the
fixed sequence oligonucleotides 101, 103 are introduced 102 to the
genetic sample 100 and allowed to specifically bind to the
complementary portions of the nucleic acid region of interest 115.
Following hybridization, the unhybridized fixed sequence
oligonucleotides are preferably separated from the remainder of the
genetic sample (not shown). The bridging oligonucleotide is then
introduced and allowed to bind 104 to the region of the selected
nucleic acid region 115 between the first 101 and second 103 fixed
sequence oligonucleotides. Alternatively, the bridging oligo can be
introduced simultaneously to the fixed sequence oligonucleotides.
The bound oligonucleotides are ligated 106 to create a contiguous
nucleic acid spanning and complementary to the nucleic acid region
of interest. Following ligation, universal primers 117, 119 are
introduced to amplify 108 the ligated template region to create 110
products 121 that comprise the sequence of the nucleic acid region
of interest. These products 121 are optionally isolated, detected,
and quantified to provide information on the presence and amount of
the selected nucleic acid region in a genetic sample. Preferably,
the products are detected and quantified through sequence
determination of the product, and in particular sequence
determination of the region of the product corresponding to the
selected nucleic acid region.
[0081] The number of selected nucleic acid regions analyzed for
each chromosome in the assay system of the invention may vary from
2-20,000 or more per chromosome analyzed. In a preferred aspect,
the number of targeted regions is between 48 and 480. In another
aspect, the number of targeted regions is at least 100. In another
aspect, the number of targeted regions is at least 400. In another
aspect, the number of targeted regions is at least 1000.
[0082] In certain aspects, the bridging oligos can be composed of
mixture of oligos with degeneracy in each of the positions, so that
the mixture of randomers used will be compatible with all reactions
in the multiplexed assay requiring a bridging of the given length.
In another aspect, the bridging oligos can be of various lengths so
that the mixture of oligos will be compatible with particular
tandem ligation reactions in the multiplexed assay requiring
bridging oligos of the given lengths.
[0083] In yet another aspect the bridging oligo can have partial
degeneracy and the multiplexed tandem ligation reactions are
restricted to those that require the specific sequences provided by
the degeneracy of the bridging oligos. For example, a set of tandem
ligation reactions may require only A and C bases in the bridging
oligo, and a mixture of bridging oligos synthesized with only A and
C bases would be provided for these particular tandem ligation
reactions in a multiplexed assay.
[0084] In yet another aspect, the bridging oligo sequences are
designed such that only those assays that have the given specific
sequences in the bridging region would be multiplexed in the assay
system. In one example the bridging oligo is a randomer, where all
combinations of the bridging oligo are synthesized. As an example,
in the case where a 5-base oligo is used, the number of unique
bridging oligos would be 4 5=1024. This would be independent of the
number of targeted regions since all possible bridging oligos would
be present in the reaction.
[0085] In another example the bridging oligo is specific,
synthesized to match the sequences in the gap. As an example, in
the case where a 5-base oligo is used, the number of unique oligos
synthesized would be equal to or less than the number of targeted
regions. A number less than the number of targeted regions could be
achieved if the gap sequence was shared between two or more
targeted regions. In one aspect of this example, one might
purposefully choose the targeted sequences and especially the gap
sequences such that there was as much identical overlap as possible
in the gap sequences, minimizing the number of bridging oligos
necessary for the multiplexed reaction.
[0086] In another aspect, the sequences of the bridging oligos are
designed and the nucleic acid regions are selected so that all
selected nucleic acid regions share the same base(s) at each end of
the bridging oligo. For instance, one might choose selected nucleic
acids and their gap location such that all of the gaps shared an
"A" base at the first position and a "G" base at the last position
of the gap. Any combination of a first and last base could be
utilized, based upon factors such as the genome investigated, the
likelihood of sequence variation in that area, and the like. In a
specific aspect of this example, the bridging oligos can be
synthesized by random degeneracy of bases at the internal positions
of the bridging oligo, specific addition at the first and last
position. In the case of a 5-mer, the second, third and fourth
positions would be randomly provided, and two specific nucleotides
would be added at the proximal positions. In this case, the number
of unique bridging oligos would be 4 3=64.
[0087] In the human genome the frequency of the dinucleotide CG is
much lower than expected by the respective mononucleotide
frequencies. This presents an opportunity to enhance the
specificity of an assay with a particular mixture of bridging
oligos. In this aspect, the bridging oligos may be selected to have
a 5' G and a 3' C. This base selection allows each oligo to have a
high frequency in the human genome but makes it a rare event for
two bridging oligos to hybridize adjacent to each other. The
probability is then reduced that multiple oligos are ligated in
locations of the genome that are not targeted in the assay.
[0088] The bridging oligo is preferably added to the reaction after
the fixed sequence oligonucleotides have been hybridized, and
following the optional removal of all unhybridized fixed sequence
oligonucleotides have been washed away. The conditions of the
hybridization reaction are preferably optimized near the T.sub.m of
the bridging oligo to prevent erroneous hybridization of oligos
that are not fully complementary to the nucleic acid region. If the
bridging oligos have a T.sub.m significantly lower than the fixed
sequence oligonucleotides, the splint oligo is preferably added as
a part of the ligase reaction.
[0089] The advantage of using short oligos is that ligation on
either end would likely occur only when all bases of the bridging
oligo match the gap sequence. A further advantage of short bridging
oligos is that the number of different oligos necessary could be
less than the number of targeted sites, raising the oligos
effective concentration to allow perfect matches to happen faster.
Fewer oligos also has advantages in cost and quality control. The
advantages of using fixed first and last bases with random bases in
between include the ability to utilize longer bridging oligos for
better specificity while reducing the number of total bridging
oligos in the reaction.
Use of Indices in the Assay Systems of the Invention
[0090] In certain aspects, all or a portion of the nucleic acids of
interest are directly detected using the described techniques. In
certain aspects, however, the nucleic acids of interest are
associated with one or more indices that are identifying for a
selected nucleic acid region or a particular sample being analyzed.
The detection of the one or more indices can serve as a surrogate
detection mechanism of the selected nucleic acid region, or as
confirmation of the presence of a particular selected nucleic acid
region if both the index and the sequence of the nucleic acid
region itself are determined. These indices are preferably
associated with the selected nucleic acids during an amplification
step using primers that comprise both the index and sequence
regions that specifically hybridize to the nucleic acid region.
[0091] In one example, the primers used for amplification of a
selected nucleic acid region are designed to provide a locus index
between the selected nucleic acid region primer region and a
universal amplification region. The locus index is unique for each
selected nucleic acid region and representative of a locus on a
chromosome of interest or reference chromosome, so that
quantification of the locus index in a sample provides
quantification data for the locus and the particular chromosome
containing the locus.
[0092] In another aspect, the primers used for amplification of the
selected nucleic acid regions to be analyzed for a genetic sample
are designed to provide a random index between the selected nucleic
acid region primer region and a universal amplification region. In
such an aspect, a sufficient number of identification indices are
present to uniquely identify each selected nucleic acid region in
the sample. Each nucleic acid region to be analyzed is associated
with a unique identification index, so that the identification
index is uniquely associated with the selected nucleic acid region.
Quantification of the identification index in a sample provides
quantification data for the associated selected nucleic acid region
and the chromosome corresponding to the selected nucleic acid
region. The identification locus may also be used to detect any
amplification bias that occurs downstream of the initial isolation
of the selected nucleic acid regions from a sample.
[0093] In certain aspects, only the locus index and/or the
identification index (if present) are detected and used to quantify
the selected nucleic acid regions in a sample. In another aspect, a
count of the number of times each locus index occurs with a unique
identification index is done to determine the relative frequency of
a selected nucleic acid region in a sample.
[0094] The primers are preferably designed so that indices
comprising identifying information are coded at the ends of the
primer flanking the region complementary to the nucleic acid of
interest. The indices are non-complementary but unique sequences
used within the primer to provide information relevant to the
selective nucleic acid region that is isolated and/or amplified
using the primer. The advantage of this is that information on the
presence and quantity of the selected nucleic acid region can be
obtained without the need to determine the actual sequence itself,
although in certain aspects it may be desirable to do so.
Generally, however, the ability to identify and quantify a selected
nucleic acid region through identification of one or more indices
will decrease the length of sequencing required as the loci
information is captured at the 3' or 5' end of the isolated
selected nucleic acid region. Use of indices as a surrogate for
identification of selected nucleic acid regions may also reduce
error since longer sequencing reads are more prone to the
introduction or error.
[0095] In addition to locus-specific indices and identification
indices, additional indices can be introduced to primers to assist
in the multiplexing of samples. In addition, indices which identify
sequencing error, which allow for highly multiplexed amplification
techniques or which allow for hybridization or ligation or
attachment to another surface can be added to the primers. The
order and placement of these indices, as well as the length of
these indices, can vary.
[0096] The primers used for identification and quantification of a
selected nucleic acid region may be associated with regions
complementary to the 5' of the selected nucleic acid region,
regions complementary to the 5' of the selected nucleic acid
region, or in certain amplification regimes the indices may be
present on one or both of a set of amplification primers
complementary to the selected nucleic acid region. The primers can
be used to multiplex the analysis of multiple selected nucleic acid
regions to be analyzed within a sample, and can be used either in
solution or on a solid substrate, e.g., on a microarray or on a
bead. These primers may be used for linear replication or
amplification, or they may create circular constructs for further
analysis.
[0097] Thus, in some aspects one or both of the fixed sequence
oligonucleotides further contain an index region. This index region
may comprise a number of different sequences that can be used to
identify the selected nucleic acid region and/or the sample being
analyzed in the assay system. Preferably, the index region
corresponds to the selected nucleic acid region, so that
identification of the index region can be used as a surrogate for
detection of the actual sequence of the selected nucleic acid
region. The index region may optionally comprise a sample index to
correspond the oligo set to a particular genetic sample in a
multiplexed assay system.
[0098] FIG. 2 illustrated the use of a single index region 221 on a
first fixed sequence oligonucleotide 201 in an oligo set for a
selected nucleic acid region. The fixed sequence oligonucleotides
201, 203 are introduced 202 to the genetic sample 200 and allowed
to specifically bind to the selected nucleic acid region 215.
Following hybridization, the unhybridized fixed sequence
oligonucleotides are preferably separated from the remainder of the
genetic sample (not shown). The bridging oligo is then introduced
and allowed to hybridize 204 to the region of the selected nucleic
acid region 215 between the first 201 and second 203 fixed sequence
oligonucleotides. The bound oligonucleotides are ligated 206 to
create a contiguous nucleic acid spanning and complementary to the
nucleic acid region of interest. Following ligation, universal
primers 217, 219 are introduced to amplify 208 the ligated template
region to create 210 products 223 that comprise the sequence of the
nucleic acid region of interest. These products 223 are optionally
isolated, detected, and/or quantified to provide information on the
presence and amount of the selected nucleic acid region in a
genetic sample. Preferably, the products are detected and
quantified through sequence determination of the index, thus
obviating the need for determining the actual sequences of the
selected nucleic acid region. In other aspects, however, it is
desirable to determine the product comprising sequences of both the
index and the selected nucleic acid region, for example, to provide
internal confirmation of the results or where the index provides
sample information and is not informative of the selected nucleic
acid region. In another aspect, the index permits unique
hybridization to a feature on an array, such hybridization leading
to the detection and quantification of the sequences.
[0099] The use of indices is especially useful in a multiplexed
assay setting where two or more different selected nucleic acid
regions are being simultaneously detected in a genetic sample. FIG.
3 illustrates an example where two different selected nucleic acid
regions are detected in a single tandem reaction assay. Two sets of
fixed sequence oligonucleotides (301 and 303, 323 and 325) that
specifically hybridize to two different nucleic acid regions 315,
331 are introduced 302 to a genetic sample and allowed to hybridize
304 to the respective nucleic acid regions. Each set comprises an
oligonucleotide 301, 323 having a sequence specific region 305,
327, a universal primer region 309 and an index region 321, 335.
The other fixed sequence oligonucleotide of the sets comprises a
sequence specific region 307, 329 and a universal primer region
311. Following hybridization, the unhybridized fixed sequence
oligonucleotides are preferably separated from the remainder of the
genetic sample (not shown). The bridging oligos 313, 333 are
introduced to the hybridized fixed sequence oligonucleotide/nucleic
acid regions and allowed to hybridize 306 to these regions.
Although shown in FIG. 3 as two different bridging oligos, in fact
the same bridging oligo may be suitable for both hybridization
events, or they may be two oligos from a pool of degenerate oligos
that are used with multiple tandem ligation events. The bound
oligonucleotides are ligated 308 to create a contiguous nucleic
acid spanning and complementary to the nucleic acid region of
interest. Following ligation, universal primers 317, 319 are
introduced to amplify 310 the ligated template regions to create
312 amplification products 337, 339 that comprise the sequence of
the nucleic acid regions of interest. These products 337, 339 are
optionally isolated, detected and/or quantified to provide
information on the presence and amount of the selected nucleic acid
region in a genetic sample.
[0100] In multiplexed assay systems, the products are detected and
quantified through sequence determination of the different indices,
thus obviating the need for determining the actual sequences of the
selected nucleic acid region. In other aspects, however, the index
may be a sample specific index as well as a region specific index,
and thus the index may not only identify the nucleic acid region,
but it may also provide information of the nucleic acid region and
the genetic sample from which the region was obtained.
Alternatively, the nucleic acid region of the product may be
detected, for example, to provide internal confirmation of the
results or where the index provides solely sample information and
is not informative of the selected nucleic acid region.
[0101] Detection of Polymorphic Regions Using the Ligation-Based
Assay System
[0102] In certain aspects, the assay system of the invention
detects one or more regions that comprise a polymorphism. This
methodology is not primarily designed to identify a particular
allele, e.g., as maternal versus fetal, but rather to ensure that
different alleles corresponding to a nucleic acid region of
interest are included in the quantification methods of the
invention. In certain aspects, however, it may be desirable to both
use the information to count all such nucleic acid regions in the
genetic sample as well as to use the information on specific
polymorphisms, e.g., to calculate the amount of fetal DNA contained
within a maternal sample, or identify the % alleles with a
particular mutation in a genetic sample from a cancer patient.
Thus, the invention is intended to encompass both mechanisms for
detection of SNP-containing nucleic acid regions for direct
determination of copy number variant through quantification as well
as detection of SNP for ensuring overall efficiency of the
assay.
[0103] Thus, in a particular aspect of the invention,
allele-discrimination is provided through the bridging oligo. In
this aspect, the bridging oligo is located over a SNP. In this
aspect, the polymorphism is preferably located close enough to one
end of a ligation reaction as to provide allele-specificity.
[0104] In one example of allele detection, both complementary
allele bridging oligo variants are present in the same reaction
mixture and allele detection results from subsequent sequencing
through the polymorphism of the ligated products or their
amplification products. FIG. 4 illustrates this aspect.
[0105] In FIG. 4, two fixed sequence oligonucleotides 401, 403 and
bridging oligonucleotides corresponding to the two possible SNPs in
the nucleic acid regions of interest 415, 429 are used in detection
of the selected nucleic acid region, and preferably to detect the
region in a single reaction. Each of the fixed sequence
oligonucleotides comprises a region complementary to the selected
nucleic acid region 405, 407, and universal primer sequences 409,
411 used to amplify the different selected nucleic acid regions
following initial selection and/or isolation of the selected
nucleic acid regions from the genetic sample. The universal primer
sequences are located at the proximal ends of the fixed sequence
oligonucleotides 401, 403, and thus preserve the nucleic
acid-specific sequences in the products of any universal
amplification methods. The fixed sequence oligonucleotides 401, 403
are introduced 402 to the genetic sample 400 and allowed to
specifically bind to the selected nucleic acid region 415, 429.
Following hybridization, the unhybridized fixed sequence
oligonucleotides are preferably separated from the remainder of the
genetic sample (not shown). The bridging oligos corresponding to an
A/T SNP 413 or a G/C SNP 433 are introduced and allowed to bind 404
to the region of the selected nucleic acid region 415, 429 between
the first 401 and second 403 fixed sequence oligonucleotides.
Alternatively, the bridging oligos 413, 433 can be introduced to
the sample simultaneously with the fixed sequence
oligonucleotides.
[0106] The bound oligonucleotides are ligated 406 to create a
contiguous nucleic acid spanning and complementary to the nucleic
acid region of interest. Following ligation, universal primers 417,
419 are introduced to amplify 408 the ligated template region to
create 410 products 421, 423 that comprise the sequence of the
nucleic acid region of interest representing both SNPs in the
selected nucleic acid region. These products 421, 423 are detected
and quantified through sequence determination of the product, and
in particular the region of the product containing the SNP in the
selected nucleic acid region.
[0107] In another example, the allele detection results from the
sequencing of a locus index or an allele index which is provided in
one or both of the fixed sequence nucleic acid region
oligonucleotides. The locus index and/or allele index is embedded
in either the first or second fixed sequence oligonucleotide used
in the set for a selected nucleic acid region containing a
polymorphism, and is used with either a specific fixed sequence
oligo or with a particular bridging oligo, either of which may be
designed to detect the polymorphism. Detection of the locus index
and/or the allele index in an amplification product allows
detection of the presence, amount or absence of a specific allele
present in a genetic sample, as well as the number of counts for
the region through addition of the polymorphic regions detected in
the sample. Two examples of how this may be performed are described
in more detail below.
[0108] For example, in one aspect of the invention, two or more
separate reactions are carried out using a single locus index and
different bridging oligos corresponding to the different
polymorphisms in the region complementary to the bridging oligos.
The reactions are differentiated by the bridging oligo, and the
ligation, amplification and detection reactions comprising the
different bridging oligos remain separate through the detection
step. The total counts for a particular nucleic acid region of
interest can be determined mathematically using the locus index by
adding the detected numbers of the counts for the nucleic acid
region from the separate reactions comprising the bridging oligos
having different polymorphic sequences.
[0109] This aspect may be useful for, e.g., circumstances in which
both information on polymorphic frequency in a sample and
information on total loci counts are desirable. Since the reactions
are detected separately, only one index may be needed for detection
in each of the separate reactions, although separate allele indices
may also be used in the separate reactions.
[0110] FIG. 5 illustrates one such aspect of the assay system of
the invention. Two fixed sequence oligonucleotides 501, 503 and
bridging oligonucleotides corresponding to the two possible SNPs in
the selected nucleic acid region 515, 525 are used in detection of
a nucleic acid region of interest. Each of the fixed sequence
oligonucleotides comprises a region complementary to the selected
nucleic acid region. The ligation, amplification, and detection
steps of the assay system take place in two separate reactions,
with a first reaction utilizing a first bridging oligo 513 and the
second reaction utilizing a second bridging oligo 533. Both
reactions utilize the same fixed sequence oligos 501, 503 having
the same regions complementary to allele-specific regions 505, 507.
A single locus index 521 can be used to detect the amplification
products in each reaction so that sequence determination of the
actual sequence of the nucleic acids of interest are not
necessarily needed, although they may still be determined to
identify or provide confirmation of the sequence. The universal
primer sequences 509, 511 are located at either end flanking the
fixed sequence oligonucleotides 501, 503, and thus preserve the
nucleic acid-specific sequences and the indices in the products of
any universal amplification methods. The fixed sequence
oligonucleotides 501, 503 are introduced 502 to the genetic sample
500 and allowed to specifically bind to the selected nucleic acid
region 515, 525. Following hybridization, the unhybridized fixed
sequence oligonucleotides are preferably separated from the
remainder of the genetic sample (not shown). The bridging oligos
corresponding to an A/T SNP 513 or a G/C SNP 533 are introduced to
each reaction and allowed to bind 504 to the region of the selected
nucleic acid region 515, 525 between the first 505 and second 507
fixed sequence oligonucleotides. Alternatively, the bridging oligos
513, 533 can be introduced to the sample simultaneously with the
fixed sequence oligonucleotides.
[0111] The bound oligonucleotides are ligated 506 to create a
contiguous nucleic acid spanning and complementary to the nucleic
acid region of interest. Following ligation, universal primers 517,
519 are introduced to amplify 508 the ligated template region to
create 510 products 527, 529 that comprise the sequence of the
nucleic acid region of interest representing both SNPs in the
selected nucleic acid region. These products 527, 529 are detected
and quantified through sequence determination of the product, and
in particular the locus index combined with the knowledge of which
bridging oligo was added to which reaction. The counts for the
nucleic acid region as a whole can be determined through addition
of the detected polymorphic regions in the genetic samples.
[0112] A different specific aspect of the invention utilizes allele
indices to identify alleles comprising different polymorphisms as
well as to determine counts of the nucleic acid region of interest.
In a multiplexed reaction, locus indices may be combined with
allele indices. In this aspect, two or more separate ligation
reactions are carried out using two or more different bridging
oligos corresponding to the different polymorphisms in the region
complementary to the bridging oligos. The reactions are
differentiated by the bridging oligo, and each bridging oligo is
used with a fixed sequence oligo comprising an allele index that
identifies that particular bridging oligo. Following the ligation
step, the reactions can be combined either prior to amplification,
since the same universal primers are preferably used, or prior to
detection, as the different alleles can be distinguished through
identification of the different allele-specific indices. The allele
may also be distinguished through sequence determination of the
allele index or alternatively from hybridizing of the allele index,
and total counts for the nucleic acid region can be determined
through the addition of the identified allelic regions.
[0113] In FIG. 6, two fixed sets of sequence oligonucleotides are
used which comprise substantially the same sequence-specific
regions 605, 607 but which comprise different indices, 621, 623 on
one of the fixed sequence oligonucleotides of the set. The ligation
reactions are carried out with material from the same genetic
sample 600, but in separate tubes with the different
allele-specific oligo sets. The bridging oligonucleotides
corresponding to the two possible SNPs in the selected nucleic acid
region 613, 633 are used in detection of the selected nucleic acid
region in each ligation reaction. Two allele indices 621, 623 that
are indicative of the particular polymorphic alleles can be used to
detect the amplification products so that sequence determination of
the actual sequence of the nucleic acids of interest are not
necessarily needed, although these sequences may still be
determined to identify and/or provide confirmation of the sequence.
Each of the fixed sequence oligonucleotides comprises a region
complementary to the selected nucleic acid region 605, 607, and
universal primer sequences 609, 611 used to amplify the different
selected nucleic acid regions following initial selection and/or
isolation of the selected nucleic acid regions from the genetic
sample. The universal primer sequences are located at the ends of
the fixed sequence oligonucleotides 601, 603, and 623 flanking the
indices and the regions complementary to the nucleic acid of
interest, thus preserving the nucleic acid-specific sequences and
the allele indices in the products of any universal amplification
methods. The fixed sequence oligonucleotides 601, 603, 623 are
introduced 602 to an aliquot of the genetic sample 600 and allowed
to specifically bind to the selected nucleic acid regions 615 or
625. Following hybridization, the unhybridized fixed sequence
oligonucleotides are preferably separated from the remainder of the
genetic sample (not shown).
[0114] The bridging oligos corresponding to an A/T SNP 613 or a G/C
SNP 633 are introduced and allowed to bind 604 to the region of the
selected nucleic acid region 615 or 625 between the first 605 and
second 607 nucleic acid-complementary regions of the fixed sequence
oligonucleotides. Alternatively, the bridging oligos 613, 633 can
be introduced to the sample simultaneously with the fixed sequence
oligonucleotides. The bound oligonucleotides are ligated 606 in the
single reaction mixture to create a contiguous nucleic acid
spanning and complementary to the nucleic acid region of
interest.
[0115] Following ligation, the separate reactions are preferably
combined for the universal amplification and detection steps.
Universal primers 617, 619 are introduced to the combined reactions
to amplify 608 the ligated template regions and create 610 products
627, 629 that comprise the sequence of the nucleic acid region of
interest representing both SNPs in the selected nucleic acid
region. These products 627, 629 are detected and quantified through
sequence determination of the product, through the allele index
and/or the region of the product containing the SNP in the selected
nucleic acid region.
[0116] Preferably, the products of the FIG. 6 methods are detected
and quantified through sequence determination of the allele
indices, thus obviating the need for determining the actual
sequences of the selected nucleic acid region. In other aspects,
however, it is desirable to determine the product comprising
sequences of both the index and the selected nucleic acid region,
for example, to provide internal confirmation of the results or
where the index provides sample information and is not informative
of the selected nucleic acid region.
[0117] The indices used with the assay systems of the invention can
also be used to identify polymorphisms that are associated with the
fixed sequences used for the detection of nucleic acids of
interest. Thus, in another exemplary assay system, an allele index
is associated with an allele-specific fixed sequence
oligonucleotide, and the allele detection results from the
sequencing of an allele index or alternatively from hybridizing of
an allele index which is provided in the nucleic acid region
primer. The allele index is embedded in either the allele-specific
first or second fixed sequence oligonucleotide used in the set for
a selected nucleic acid region containing a polymorphism. In
specific aspects, an allele index is present on both the first and
second fixed sequence oligonucleotides to detect two or more
polymorphisms within the fixed sequence regions. The number of
fixed sequence oligonucleotides used in such aspects can
corresponds to the number of possible alleles being assessed for a
selected nucleic acid region, and sequence determination or
hybridization of the allele index can detect presence, amount or
absence of a specific allele is a genetic sample.
[0118] FIG. 7 illustrates this aspect of the invention. In FIG. 7,
three fixed sequence oligonucleotides 701, 703 and 723 are used.
Two of the fixed sequence oligonucleotides 701, 723 are
allele-specific, comprising a region complementary to an allele in
a nucleic acid region comprising for example an A/T or G/C SNP,
respectively. Each fixed allele-specific oligonucleotides 701, 723
also comprises a corresponding allele index 721, 731 and a
universal primer sequence 709. The second fixed sequence
oligonucleotide 703 has another universal primer sequence 711, and
these universal primer sequences are used to amplify the \nucleic
acid regions following initial selection and/or isolation of the
nucleic acid regions from the genetic sample. The universal primer
sequences are located at the ends of the fixed sequence
oligonucleotides 701, 703, 723 flanking the indices and the nucleic
acid regions of interest, and thus preserve the nucleic
acid-specific sequences and the indices in the products of any
universal amplification methods.
[0119] The fixed sequence oligonucleotides 701, 703, 723 are
introduced 702 to the DNA sample 700 and allowed to specifically
bind to the selected nucleic acid region 715, 725. Following
hybridization, the unhybridized fixed sequence oligonucleotides are
preferably separated from the remainder of the genetic sample (not
shown). The bridging oligos 713 are introduced and allowed to bind
704 to the nucleic acid 715 complementary to the region between the
first allele-specific fixed sequence oligonucleotide region 705 and
the other fixed sequence oligonucleotide region 707 or to the
nucleic acid 725 complementary to the region between the second
allele-specific fixed sequence oligonucleotide region 735 and the
other fixed sequence oligonucleotide region 707. Alternatively, the
bridging oligos 713 can be introduced to the sample simultaneously
with the sets of fixed sequence oligonucleotides.
[0120] The bound oligonucleotides are ligated 706 to create a
contiguous nucleic acid spanning and complementary to the nucleic
acid region of interest. The ligation primarily occurs only when
the allele-specific ends match. Following ligation, universal
primers 717, 719 are introduced to amplify 708 the ligated template
region to create 710 products 727, 729 that comprise the sequence
of the nucleic acid region of interest representing both SNPs in
the selected nucleic acid region. These products 727, 729 are
detected and quantified through sequence determination of the
product, and in particular the region of the product containing the
SNP in the selected nucleic acid region. Alternatively the products
727, 729 are detected and quantified through hybridization of the
allele index to different features on an array. In this detection
method, a fluorescent label is incorporated into the products 727,
729 during the universal amplification by amplifying with primers
717 or 719 that are fluorescently labeled. It is important to note
that the ligation 706 is allele-specific. In order to make the
ligation allele-specific, the allele specifying nucleotide must be
close to the ligated end. Typically, the allele-specific nucleotide
must be within 5 nucleotides of the ligated end. In a preferred
aspect, the allele-specific nucleotide is the terminal base.
[0121] In another example, the allele detection results from the
hybridization of a locus index to an array. Each allele is detected
through an allele-specific labeling step, where each allele is
labeled with a spectrally distinct fluorescent label during the
universal amplification. FIG. 8 illustrates this aspect of the
invention. In FIG. 8, three fixed sequence oligonucleotides 801,
803 and 823 are used. Two of the fixed sequence oligonucleotides
801, 823 are allele-specific comprising a region matching a
particular allele in the same selected nucleic acid region, a
corresponding locus index 821 and allele-specific universal primer
sequences 809, 839. The matching fixed sequence oligonucleotide 803
has another universal primer sequence 811. The universal primer
sequences are used to amplify the different selected nucleic acid
regions following initial selection and/or isolation of the
selected nucleic acid regions from the genetic sample and
incorporate a label into the amplification products that
distinguish each allele. The universal primer sequences are located
at the proximal ends of the fixed sequence oligonucleotides 801,
803, 823 and thus preserve the nucleic acid-specific sequences and
the indices in the products of any universal amplification methods.
The fixed sequence oligonucleotides 801, 803, 823 are introduced
802 to the DNA sample 800 and allowed to specifically bind to the
selected nucleic acid region 815, 825. Following hybridization, the
unhybridized fixed sequence oligonucleotides are preferably
separated from the remainder of the genetic sample (not shown). The
bridging oligos 813 are introduced and allowed to bind 804 to the
region of the selected nucleic acid region 815, 825 between the
first 805 and second 807 fixed sequence oligonucleotides and
between the first 835 and second 807 fixed sequence
oligonucleotides. Alternatively, the bridging oligos 813 can be
introduced to the sample simultaneously with the fixed sequence
oligonucleotides.
[0122] The bound oligonucleotides are ligated 806 to create a
contiguous nucleic acid spanning and complementary to the nucleic
acid region of interest. The ligation primarily occurs only when
the allele-specific ends match. Following ligation, universal
primers 817, 819, 837 are introduced to amplify 808 the ligated
template region to create 810 products 827, 829 that comprise the
sequence of the nucleic acid region of interest representing both
SNPs in the selected nucleic acid region. The universal primers 817
and 837 have spectrally distinct fluorescent labels such that the
allele-specific information is retained through these fluorescent
labels. These products 827, 829 are detected and quantified through
hybridization of the locus index 821 to an array and imaging to
determine the incorporation of the fluorescent label. It is
important to note that the ligation 806 is preferably
allele-specific. In order to make the ligation allele-specific, the
allele specifying nucleotide must be close to the ligated end.
Typically, the allele-specific nucleotide must be within 5
nucleotides of the ligated end. In a preferred aspect, the
allele-specific nucleotide is the terminal base.
[0123] In another aspect, an allele index is present on both the
first and second fixed sequence oligonucleotides to detect a
polymorphism at both ends with a corresponding spectrally distinct
fluorescent label for each fixed sequence oligonucleotide for a
given allele. The number of fixed sequence oligonucleotides
corresponds to the number of possible alleles being assessed for a
selected nucleic acid region. In the above figures and examples,
the fixed sequence oligonucleotides are represented as two distinct
oligonucleotides. In another aspect, the fixed sequence
oligonucleotides may be opposite ends of the same
oligonucleotide.
[0124] In the aspects described above, the bridging oligos used
hybridize to regions of the nucleic acid of interest that are
adjacent to the regions complementary to the fixed sequence
oligonucleotides, so that when the fixed sequence and bridging
oligo(s) specifically hybridize they are directly adjacent to one
another for ligation. In other aspects, however, the bridging oligo
hybridizes to a region that is not directly adjacent to the region
complementary to one or both of the fixed sequence oligos, and an
intermediate step requiring extension of one or more of the oligos
is necessary prior to ligation.
[0125] For example, as illustrated in FIG. 9, each set of
oligonucleotides preferably contains two oligonucleotides 901, 903
of fixed sequence and one or more bridging oligonucleotides 913.
Each of the fixed sequence oligonucleotides comprises a region
complementary to the selected nucleic acid region 905, 907, and
preferably universal primer sequences 909, 911, i.e. oligo regions
complementary to universal primers. The universal primer sequences
909, 911 are located at or near the ends of the fixed sequence
oligonucleotides 901, 903, and thus preserve the nucleic
acid-specific sequences in the products of any universal
amplification methods. The fixed sequence oligonucleotides 901, 903
are introduced 902 to the genetic sample 900 and allowed to
specifically bind to the complementary portions of the nucleic acid
region of interest 915. Following hybridization, the unhybridized
fixed sequence oligonucleotides are preferably separated from the
remainder of the genetic sample (not shown). The bridging
oligonucleotide is then introduced and allowed to bind 904 to the
region of the selected nucleic acid region 915 between the first
901 and second 903 fixed sequence oligonucleotides. Alternatively,
the bridging oligo can be introduced simultaneously to the fixed
sequence oligonucleotides. In this exemplary aspect, the bridging
oligo hybridizes to a region directly adjacent to the first fixed
sequence oligo region 905, but is separated by one or more
nucleotides from the complementary region of the second fixed
sequence oligonucleotide 907. Following hybridization of the fixed
sequence and bridging oligos, the bridging oligo 913 is extended
906, e.g., using a polymerase and dNTPs, to fill the gap between
the bridging oligo 913 and the second fixed sequence oligo 903.
Following extension, the bound oligonucleotides are ligated 908 to
create a contiguous nucleic acid spanning and complementary to the
nucleic acid region of interest 915. After ligation, universal
primers 917, 919 are introduced 910 to amplify the ligated template
region to create 912 products 923 that comprise the sequence of the
nucleic acid region of interest. These products 923 are optionally
isolated, detected, and quantified to provide information on the
presence and amount of the selected nucleic acid region in a
genetic sample. Preferably, the products are detected and
quantified through sequence determination of an identification
index 921, or, alternatively, sequence determination of the nucleic
acid of interest 915 within the amplification product 923.
[0126] In another aspect, as illustrated in FIG. 10, each set of
oligonucleotides preferably contains two oligonucleotides 1001,
1003 of fixed sequence and two or more bridging oligonucleotides
1013, 1033 that bind to non-adjacent regions on a nucleic acid of
interest 1015. Each of the fixed sequence oligonucleotides
comprises a region complementary to the selected nucleic acid
region 1005, 1007, and preferably universal primer sequences 1009,
1011, i.e. oligo regions complementary to universal primers. The
universal primer sequences 1009, 1011 are located at or near the
ends of the fixed sequence oligonucleotides 1001, 1003, and thus
preserve the nucleic acid-specific sequences in the products of any
universal amplification methods. The fixed sequence
oligonucleotides 1001, 1003 are introduced 1002 to the genetic
sample 1000 and allowed to specifically bind to the complementary
portions of the nucleic acid region of interest 1015. Following
hybridization, the unhybridized fixed sequence oligonucleotides are
preferably separated from the remainder of the genetic sample (not
shown).
[0127] In FIG. 10, two separate bridging oligonucleotides 1013,
1033 are introduced and allowed to bind 1004 to the region of the
selected nucleic acid region 1015 between but not immediately
adjacent to both the first 1001 and second 1003 fixed sequence
oligonucleotides. Alternatively, the bridging oligo can be
introduced simultaneously to the fixed sequence oligonucleotides.
In this exemplary aspect, the first bridging oligo 1033 hybridizes
to a region directly adjacent to the first fixed sequence oligo
region 1005, but is separated by one or more nucleotides from the
complementary region of the second bridging oligo 1013. The second
bridging oligo 1013 is also separated from the second fixed
sequence oligonucleotide 1007 by one or more nucleotides. Following
hybridization of the fixed sequence and bridging oligos, both
bridging oligos 1013, 1033 are extended 1006, e.g., using a
polymerase and dNTPs, to fill the gap between the bridging oligos
and the gap between the second bridging oligo 1013 and the second
fixed sequence oligo 1003. Following extension, the bound
oligonucleotides are ligated 1008 to create a contiguous nucleic
acid spanning and complementary to the nucleic acid region of
interest 1015. Following ligation, universal primers 1017, 1019 are
introduced 910 to amplify the ligated template region to create
1012 products 1023 that comprise the sequence of the nucleic acid
region of interest. These products 1023 are optionally isolated,
detected, and quantified to provide information on the presence and
amount of the selected nucleic acid region in a genetic sample.
Preferably, the products are detected and quantified through
sequence determination of an identification index 1021, or,
alternatively, sequence determination of the nucleic acid of
interest 1015 within the amplification product 1023.
[0128] In specific aspects, such as the aspect illustrated in FIG.
11, the single fixed sequence oligonucleotide 1101 is complementary
to the selected nucleic acid region 1115 on both ends. When this
single fixed sequence oligonucleotide 1101 hybridizes to the
selected nucleic acid region 1115, it forms a pre-circle
oligonucleotide 1103 where the ends are separated by several
nucleotides. The bridging oligonucleotide 1113 then binds between
the complementary regions 1105, 1107 of the pre-circle
oligonucleotide 1103 to fill this gap. The oligonucleotide regions
1105, 1107 of the pre-circle oligonucleotide 1103 bound to the
genetic sample 1115 are then ligated together with the bridging
oligonucleotide 1113, forming a complete circle.
[0129] The circular template is then preferably cleaved, and
amplified using one or more of the universal primer sites. In
specific aspects, a single universal primer region is used to
replicate the template using techniques such as rolling circle
replication, as disclosed in Lizardi et al., U.S. Pat. No.
6,558,928. In a preferred aspect, as illustrated in FIG. 11 this
fixed sequence oligonucleotide has two universal priming sites
1109, 1111 on the circular template and optionally one or more
indices 1121 between the ends that are complementary to the
selected nucleic acid region. Preferably, a cleavage site 1123
exists between the two universal priming sites. Once circularized
through ligation to the bridging oligo 1113, a nuclease can be used
to remove all or most uncircularized oligonucleotides. After the
removal of the uncircularized oligonucleotides, the circularized
oligonucleotide is cleaved 1106, preserving and in some aspects
exposing the universal priming sites 1109, 1111. Universal primers
1117, 1119 are added 1108 and a universal amplification occurs 1110
to create 1112 products 1125 that comprise the sequence of the
nucleic acid region of interest. The products 1125 are detected and
quantified through sequence determination of selected nucleic acid
region or alternatively the index, which obviates the need for
determining the actual sequences of the selected nucleic acid
region. In other aspects, however, it is desirable to determine the
product comprising sequences of both the index and the selected
nucleic acid region, for example, to provide internal confirmation
of the results or where the index provides sample information and
is not informative of the selected nucleic acid region. As
mentioned above, this single fixed sequence oligonucleotide
methodology may be applied to any of the examples in FIGS.
1-10.
[0130] Resequencing
[0131] In a particular aspect, the assay system of the invention
can be used to resequence a complex nucleic acid. The tandem
ligation methods have been found to be exceptionally efficient, and
this high efficiency allows the methodology to be expanded to the
use of multiple oligos, preferably 2-100 or even more, that bind to
nucleic acid regions of interest.
[0132] In the preferred aspect, the bridging oligos would be short,
preferably between 1-10, more preferably between 2-7, even more
preferably between 3-5 nucleotides in length, and the number of
bridging oligos used in a tandem ligation reaction would be
approximately 10-50. In a preferred aspect, the bridging oligos
would be 5 bases in length and there would be approximately 15-30
ligations.
[0133] In one example, the bridging oligos might be selected to
provide degeneracy for all possible sequence variants for the
particular oligo length, for instance all sequence variations of
5-mers. Following the multiple ligations, one the ligated oligos
can be amplified using the universal amplification techniques
described herein, and sequence determination of the amplified
products to identify the underlying sequence. This multiple
ligation assay would provide the ability to target multiple
sections of the genome simultaneously through universally
amplification of tandem ligation products, and determination of
their nucleotide composition.
[0134] Universal Amplification
[0135] In preferred aspects of the invention, universal
amplification is used to amplify the ligation products created
following hybridization of the fixed sequence oligonucleotides and
the bridging oligonucleotides. In a multiplexed assay system, this
is preferably done through universal amplification of the various
nucleic acid regions to be analyzed using the assay systems of the
invention. Universal primer sequences are added to the contiguous
ligation products so that they may be amplified in a single
universal amplification reaction. These universal primer sequences
are preferably introduced in the fixed sequence oligonucleotides,
although they may also be added to the proximal ends of the
contiguous ligation products following ligation. The introduction
of universal primer regions to the fixed sequence oligonucleotides
allows a subsequent controlled universal amplification of all or a
portion of selected nucleic acids prior to or during analysis, e.g.
sequence determination.
[0136] Bias and variability can be introduced during DNA
amplification, such as that seen during polymerase chain reaction
(PCR). In cases where an amplification reaction is multiplexed,
there is the potential that loci will amplify at different rates or
efficiency. Part of this may be due to the variety of primers in a
multiplex reaction with some having better efficiency (i.e.
hybridization) than others, or some working better in specific
experimental conditions due to the base composition. Each set of
primers for a given locus may behave differently based on sequence
context of the primer and template DNA, buffer conditions, and
other conditions.
[0137] The whole tandem ligation reaction or an aliquot of the
tandem ligation reaction may be used for the universal
amplification. Using an aliquot allows different amplification
reactions to be undertaken using the same or different conditions
(e.g., polymerase, buffers, and the like), e.g., to ensure that
bias is not inadvertently introduced due to experimental
conditions. In addition, variations in primer concentrations may be
used to effectively limit the number of sequence specific
amplification cycles.
[0138] In certain aspects, the universal primer regions of the
primers or adapters used in the assay system are designed to be
compatible with conventional multiplexed assay methods that utilize
general priming mechanisms to analyze large numbers of nucleic
acids simultaneously. Such "universal" priming methods allow for
efficient, high volume analysis of the quantity of nucleic acid
regions present in a genetic sample, and allow for comprehensive
quantification of the presence of nucleic acid regions within such
a genetic sample for the determination of aneuploidy.
[0139] Examples of such assay methods include, but are not limited
to, multiplexing methods used to amplify and/or genotype a variety
of samples simultaneously, such as those described in Oliphant et
al., U.S. Pat. No. 7,582,420.
[0140] Some aspects utilize coupled reactions for multiplex
detection of nucleic acid sequences where oligonucleotides from an
early phase of each process contain sequences which may be used by
oligonucleotides from a later phase of the process. Exemplary
processes for amplifying and/or detecting nucleic acids in samples
can be used, alone or in combination, including but not limited to
the methods described below, each of which are incorporated by
reference in their entirety.
[0141] In certain aspects, the assay system of the invention
utilizes one of the following combined selective and universal
amplification techniques: (1) LDR coupled to PCR; (2) primary PCR
coupled to secondary PCR coupled to LDR; and (3) primary PCR
coupled to secondary PCR. Each of these aspects of the invention
has particular applicability in detecting certain nucleic acid
characteristics. However, each requires the use of coupled
reactions for multiplex detection of nucleic acid sequence
differences where oligonucleotides from an early phase of each
process contain sequences which may be used by oligonucleotides
from a later phase of the process.
[0142] Barany et al., U.S. Pat. Nos. 6,852,487, 6,797,470,
6,576,453, 6,534,293, 6,506,594, 6,312,892, 6,268,148, 6,054,564,
6,027,889, 5,830,711, 5,494,810, describe the use of the ligase
chain reaction (LCR) assay for the detection of specific sequences
of nucleotides in a variety of nucleic acid samples.
[0143] Barany et al., U.S. Pat. Nos. 7,807,431, 7,455,965,
7,429,453, 7,364,858, 7,358,048, 7,332,285, 7,320,865, 7,312,039,
7,244,831, 7,198,894, 7,166,434, 7,097,980, 7,083,917, 7,014,994,
6,949,370, 6,852,487, 6,797,470, 6,576,453, 6,534,293, 6,506,594,
6,312,892, and 6,268,148 describe the use of the ligase detection
reaction with detection reaction ("LDR") coupled with polymerase
chain reaction ("PCR") for nucleic acid detection.
[0144] Barany et al., U.S. Pat. Nos. 7,556,924 and 6,858,412,
describe the use of padlock probes (also called "precircle probes"
or "multi-inversion probes") with coupled ligase detection reaction
("LDR") and polymerase chain reaction ("PCR") for nucleic acid
detection.
[0145] Barany et al., U.S. Pat. Nos. 7,807,431, 7,709,201, and
7,198,814 describe the use of combined endonuclease cleavage and
ligation reactions for the detection of nucleic acid sequences.
[0146] Willis et al., U.S. Pat. Nos. 7,700,323 and 6,858,412,
describe the use of precircle probes in multiplexed nucleic acid
amplification, detection and genotyping, including
[0147] Ronaghi et al., U.S. Pat. No. 7,622,281 describes
amplification techniques for labeling and amplifying a nucleic acid
using an adapter comprising a unique primer and a barcode.
[0148] In addition to the various amplification techniques,
numerous methods of sequence determination are compatible with the
assay systems of the inventions. Preferably, such methods include
"next generation" methods of sequencing. Exemplary methods for
sequence determination include, but are not limited to, including,
but not limited to, hybridization-based methods, such as disclosed
in Drmanac, U.S. Pat. Nos. 6,864,052; 6,309,824; and 6,401,267; and
Drmanac et al, U.S. patent publication 2005/0191656, which are
incorporated by reference, sequencing by synthesis methods, e.g.,
Nyren et al, U.S. Pat. No. 7,648,824, U.S. Pat. No. 7,459,311 and
U.S. Pat. No. 6,210,891; Balasubramanian, U.S. Pat. Nos. 7,232,656
and 6,833,246; Quake, U.S. Pat. No. 6,911,345; Li et al, Proc.
Natl. Acad. Sci., 100: 414-419 (2003); pyrophosphate sequencing as
described in Ronaghi et al., U.S. Pat. Nos. 7,648,824, 7,459,311,
6,828,100, and 6,210,891; and ligation-based sequencing
determination methods, e.g., Drmanac et al., U.S. Pat. Appln No.
20100105052, and Church et al, U.S. Pat. Appln Nos. 20070207482 and
20090018024.
[0149] Alternatively, nucleic acid regions of interest can be
selected and/or identified using hybridization techniques. Methods
for conducting polynucleotide hybridization assays for detection of
have been well developed in the art. Hybridization assay procedures
and conditions will vary depending on the application and are
selected in accordance with the general binding methods known
including those referred to in: Maniatis et al. Molecular Cloning:
A Laboratory Manual (2.sup.nd Ed. Cold Spring Harbor, N.Y., 1989);
Berger and Kimmel Methods in Enzymology, Vol. 152, Guide to
Molecular Cloning Techniques (Academic Press, Inc., San Diego,
Calif., 1987); Young and Davis, P.N.A.S, 80: 1194 (1983). Methods
and apparatus for carrying out repeated and controlled
hybridization reactions have been described in U.S. Pat. Nos.
5,871,928, 5,874,219, 6,045,996 and 6,386,749, 6,391,623 each of
which are incorporated herein by reference
[0150] The present invention also contemplates signal detection of
hybridization between ligands in certain preferred aspects. See
U.S. Pat. Nos. 5,143,854, 5,578,832; 5,631,734; 5,834,758;
5,936,324; 5,981,956; 6,025,601; 6,141,096; 6,185,030; 6,201,639;
6,218,803; and 6,225,625, in U.S. Patent application 60/364,731 and
in PCT Application PCT/US99/06097 (published as WO99/47964), each
of which also is hereby incorporated by reference in its entirety
for all purposes.
[0151] Methods and apparatus for signal detection and processing of
intensity data are disclosed in, for example, U.S. Pat. Nos.
5,143,854, 5,547,839, 5,578,832, 5,631,734, 5,800,992, 5,834,758;
5,856,092, 5,902,723, 5,936,324, 5,981,956, 6,025,601, 6,090,555,
6,141,096, 6,185,030, 6,201,639; 6,218,803; and 6,225,625, in U.S.
Patent application 60/364,731 and in PCT Application PCT/US99/06097
(published as WO99/47964), each of which also is hereby
incorporated by reference in its entirety for all purposes.
Use of Indices in the Assay Systems of the Invention
[0152] In certain aspects, all or a portion of the sequences of the
nucleic acids of interest are directly detected using the described
techniques, e.g., sequence determination or hybridization. In
certain aspects, however, the nucleic acids of interest are
associated with one or more indices that are identifying for a
selected nucleic acid region or a particular sample being analyzed.
The detection of the one or more indices can serve as a surrogate
detection mechanism of the selected nucleic acid region, or as
confirmation of the presence of a particular selected nucleic acid
region if both the sequence of the index and the sequence of the
nucleic acid region itself are determined. These indices are
preferably associated with the selected nucleic acids during an
amplification step using primers that comprise both the index and
sequence regions that specifically hybridize to the nucleic acid
region.
[0153] In one example, the primers used for amplification of a
selected nucleic acid region are designed to provide a locus index
between the selected nucleic acid region primer region and a
universal amplification region. The locus index is unique for each
selected nucleic acid region and representative of a locus on a
chromosome of interest or reference chromosome, so that
quantification of the locus index in a sample provides
quantification data for the locus and the particular chromosome
containing the locus.
[0154] In another example, the primers used for amplification of a
selected nucleic acid region are designed to provide an allele
index between the selected nucleic acid region primer region and a
universal amplification region. The allele index is unique for
particular alleles of a selected nucleic acid region and
representative of a locus variation present on a chromosome of
interest or reference chromosome, so that quantification of the
allele index in a sample provides quantification data for the
allele and the summation of the allelic indices for a particular
locus provides quantification data for both the locus and the
particular chromosome containing the locus.
[0155] In another aspect, the primers used for amplification of the
selected nucleic acid regions to be analyzed for a genetic sample
are designed to provide an identification index between the
selected nucleic acid region primer region and a universal
amplification region. In such an aspect, a sufficient number of
identification indices are present to uniquely identify each
selected nucleic acid region in the sample. Each nucleic acid
region to be analyzed is associated with a unique identification
index, so that the identification index is uniquely associated with
the selected nucleic acid region. Quantification of the
identification index in a sample provides quantification data for
the associated selected nucleic acid region and the chromosome
corresponding to the selected nucleic acid region. The
identification locus may also be used to detect any amplification
bias that occurs downstream of the initial isolation of the
selected nucleic acid regions from a sample.
[0156] In certain aspects, only the locus index and/or the
identification index (if present) are detected and used to quantify
the selected nucleic acid regions in a sample. In another aspect, a
count of the number of times each locus index occurs with a unique
identification index is done to determine the relative frequency of
a selected nucleic acid region in a sample.
[0157] In some aspects, indices representative of the sample from
which a nucleic acid is isolated are used to identify the source of
the nucleic acid in a multiplexed assay system. In such aspects,
the nucleic acids are uniquely identified with the sample index.
Those uniquely identified oligonucleotides may then be combined
into a single reaction vessel with nucleic acids from other samples
prior to sequencing. The sequencing data is first segregated by
each unique sample index prior to determining the frequency of each
target locus for each sample and prior to determining whether there
is a chromosomal abnormality for each sample. For detection, the
sample indices, the locus indices, and the identification indices
(if present), are sequenced.
[0158] In aspects of the invention using indices, the fixed
sequence oligonucleotides are preferably designed to comprise the
indices. Alternatively, the indices and universal amplification
sequences can be added to the selectively amplified nucleic acids
following initial amplification. In either case, preferably the
indices are encoded upstream of the nucleic acid region-specific
sequences but downstream of the universal primers so that they are
preserved upon amplification, but also require less sequencing to
access when using the universal primers for sequence
determination.
[0159] The indices are non-complementary but unique sequences used
within the primer to provide information relevant to the selective
nucleic acid region that is isolated and/or amplified using the
primer. The advantage of this is that information on the presence
and quantity of the selected nucleic acid region can be obtained
without the need to determine the actual sequence itself, although
in certain aspects it may be desirable to do so. Generally,
however, the ability to identify and quantify a selected nucleic
acid region through identification of one or more indices will
decrease the length of sequencing required as the loci information
is captured at the 3' or 5' end of the isolated selected nucleic
acid region. Use of indices identification as a surrogate for
identification of selected nucleic acid regions may also reduce
error since longer sequencing reads are more prone to the
introduction or error.
[0160] In addition to locus indices, allele indices and
identification indices, additional indices can be introduced to
primers to assist in the multiplexing of samples. For example,
correction indices which identify experimental error (e.g., errors
introduced during amplification or sequence determination) can be
used to identify potential discrepancies in experimental procedures
and/or detection methods in the assay systems. The order and
placement of these indices, as well as the length of these indices,
can vary, and they can be used in various combinations.
[0161] The primers used for identification and quantification of a
selected nucleic acid region may be associated with regions
complementary to the 5' of the selected nucleic acid region,
regions complementary to the 5' of the selected nucleic acid
region, or in certain amplification regimes the indices may be
present on one or both of a set of amplification primers which
comprise sequences complementary to the sequences of the selected
nucleic acid region. The primers can be used to multiplex the
analysis of multiple selected nucleic acid regions to be analyzed
within a sample, and can be used either in solution or on a solid
substrate, e.g., on a microarray or on a bead. These primers may be
used for linear replication or amplification, or they may create
circular constructs for further analysis.
[0162] Detection of Other Agents or Risk Factors
[0163] Given the multiplexed nature of the assay systems of the
invention, in certain aspects it may be beneficial to utilize the
assay to detect other nucleic acids that could pose a risk to the
health of the subject(s) or otherwise impact on clinical decisions
about the treatment or prognostic outcome for a subject. Such
nucleic acids could include but are not limited to indicators of
disease or risk such as maternal alleles, polymorphisms, or somatic
mutations known to present a risk for maternal or fetal health.
Such indicators include, but are not limited to, genes associated
with Rh status; mutations or polymorphisms associated with diseases
such as diabetes, hyperlipidemia, hypercholesterolemia, blood
disorders such as sickle cell anemia, hemophilia or thalassemia,
cardiac conditions, etc.; exogenous nucleic acids associated with
active or latent infections; somatic mutations or copy number
variations associated with autoimmune disorders or malignancies
(e.g., breast cancer), or any other health issue that may impact on
the subject, and in particular on the clinical options that may be
available in the treatment and/or prevention of health risks in a
subject based on the outcome of the assay results.
[0164] Accordingly, as the preferred assay systems of the invention
are highly multiplexed and able to interrogate hundreds or even
thousands of nucleic acids within a mixed sample, in certain
aspects it is desirable to interrogate the sample for nucleic acid
markers within the mixed sample, e.g., nucleic acids associated
with genetic risk or that identify the presence or absence of
infectious organisms. Thus, in certain aspects, the assay systems
provide detection of such nucleic acids in conjunction with the
detection of nucleic acids for copy number determination within a
mixed sample.
[0165] For example, in certain mixed samples of interest, including
maternal samples, samples from subjects with autoimmune disease,
and samples from patients undergoing chemotherapy, the immune
suppression of the subject may increase the risk for the disease
due to changes in the subject's immune system. Detection of
exogenous agents in a mixed sample may be indicative of exposure to
and infection by an infectious agent, and this finding have an
impact on patient care or management of an infectious disease for
which a subject tests positively for such infectious agent.
[0166] Specifically, changes in immunity and physiology during
pregnancy may make pregnant women more susceptible to or more
severely affected by infectious diseases. In fact, pregnancy itself
may be a risk factor for acquiring certain infectious diseases,
such as toxoplasmosis, Hansen disease, and listeriosis. In
addition, for pregnant women or subjects with suppressed immune
systems, certain infectious diseases such as influenza and
varicella may have a more severe clinical course, increased
complication rate, and higher case-fatality rate. Identification of
infectious disease agents may therefore allow better treatment for
maternal disease during pregnancy, leading to a better overall
outcome for both mother and fetus.
[0167] In addition, certain infectious agents can be passed to the
fetus via vertical transmission, i.e. spread of infections from
mother to baby. These infections may occur while the fetus is still
in the uterus, during labor and delivery, or after delivery (such
as while breastfeeding).
[0168] Thus, is some preferred aspects, the assay system may
include detection of exogenous sequences, e.g., sequences from
infectious organisms that may have an adverse effect on the health
and/or viability of the fetus or infant, in order to protect
maternal, fetal, and or infant health.
[0169] Exemplary infections which can be spread via vertical
transmission, and which can be tested for using the assay methods
of the invention, include but are not limited to congenital
infections, perinatal infections and postnatal infections.
[0170] Congenital infections are passed in utero by crossing the
placenta to infect the fetus. Many infectious microbes can cause
congenital infections, leading to problems in fetal development or
even death. TORCH is an acronym for several of the more common
congenital infections. These are: toxoplasmosis, other infections
(e.g., syphilis, hepatitis B, Coxsackie virus, Epstein-Barr virus,
varicella-zoster virus (chicken pox), and human parvovirus B19
(fifth disease)), rubella, cytomegalovirus (CMV), and herpes
simplex virus.
[0171] Perinatal infections refer to infections that occur as the
baby moves through an infected birth canal or through contamination
with fecal matter during delivery. These infections can include,
but are not limited to, sexually-transmitted diseases (e.g.,
gonorrhea, chlamydia, herpes simplex virus, human papilloma virus,
etc.) CMV, and Group B Streptococci (GBS).
[0172] Infections spread from mother to baby following delivery are
known as postnatal infections. These infections can be spread
during breastfeeding through infectious microbes found in the
mother's breast milk. Some examples of postnatal infections are
CMV, Human immunodeficiency virus (HIV), Hepatitis C Virus (HCV),
and GBS.
EXAMPLES
[0173] The following examples are put forth so as to provide those
of ordinary skill in the art with a complete disclosure and
description of how to make and use the present invention, and are
not intended to limit the scope of what the inventors regard as
their invention, nor are they intended to represent or imply that
the experiments below are all of or the only experiments performed.
It will be appreciated by persons skilled in the art that numerous
variations and/or modifications may be made to the invention as
shown in the specific aspects without departing from the spirit or
scope of the invention as broadly described. The present aspects
are, therefore, to be considered in all respects as illustrative
and not restrictive.
[0174] Efforts have been made to ensure accuracy with respect to
numbers used (e.g., amounts, temperature, etc.) but some
experimental errors and deviations should be accounted for. Unless
indicated otherwise, parts are parts by weight, molecular weight is
weight average molecular weight, temperature is in degrees
centigrade, and pressure is at or near atmospheric.
Example 1
General Aspects of the Assay Systems of the Invention
[0175] A number of assay formats were tested to demonstrate the
ability to perform selective amplification and detection of
independent loci to demonstrate multiplexed, ligation-based
detection of a large number (e.g., 96 or more) of nucleic acid
regions of interest.
[0176] These assays were designed based on human genomic sequences,
and each interrogation consisted of two fixed sequence oligos per
selected nucleic acid region interrogated in the assay. The first
oligo, complementary to the 3' region of a genomic region,
comprised the following sequential (5' to 3') oligo elements: a
universal PCR priming sequence common to all assays:
TACACCGGCGTTATGCGTCGAGAC (SEQ ID NO:1); a nine nucleotide
degenerate identification code where each specific sequence is
intended to be specific to a single oligonucleotide molecule and
its progeny; a 9 base locus- or locus/allele-specific sequence that
acts as a locus code in SNP-independent assay formats and a
locus/allele code in SNP-specific assay formats; an optional
hybridization breaking nucleotide which is different from the
corresponding base in the genomic locus; and a 20-24 bp sequence
complementary to the selected genomic locus. In cases where a SNP
was detected in this portion of the selected genomic locus, the
allele-specific interrogation set consisted of two first fixed
sequence tandem ligation primers, each with a different
locus/allele code and a different allele-specific base at the SNP
position. These first oligos were designed for each selected
nucleic acid to provide a predicted uniform T.sub.m with a two
degree variation across all interrogations in the assay set.
[0177] The second fixed sequence oligo, complementary to the 5'
region of the genomic loci, comprised the following sequential (5'
to 3') elements: a 20-24 b sequence complimentary to the 5' region
in the genomic locus; a hybridization breaking nucleotide different
from the corresponding base in the genomic locus; and a universal
PCR priming sequence which was common to all third oligos in the
assay set: ATTGCGGGGACCGATGATCGCGTC (SEQ ID NO:2). In cases where a
SNP was detected in this portion of the selected genomic locus, the
allele-specific interrogation set consisted of two tandem ligation
primers, each with a different locus/allele code and a different
allele-specific base at the SNP position. This second oligo was
designed for each selected nucleic acid to provide a predicted
uniform T.sub.m with a two degree variation across all
interrogations in the assay set that was substantially the same
T.sub.m range as the first oligo set.
[0178] In certain tested aspects, one or more bridging oligos was
used that were complementary to the genomic locus sequence between
the region complementary to the first and second fixed sequence
oligos used for each selected nucleic acid region. In specific
aspects tested, more than one bridging oligo was used to span the
gap between the fixed sequence oligonucleotides, and the one or
more oligo may optionally be designed to identify one or more SNPs
in the sequence. The length of the bridging oligonucleotides used
in the assay systems varied from 5 to 36 base pairs. In specific
aspects tested, the bridging oligo(s) were designed to hybridize to
a region not directly abutting the first and/or second oligos, such
that there was a 1 base gap between the bridging oligo(s) and the
first and/or second oligos.
[0179] All oligonucleotides used in the tandem ligation formats
were synthesized using conventional solid-phase chemistry. The
oligos of the second fixed set and the bridging oligonucleotides
were synthesized with 5' phosphate moieties to enable ligation to
3' hydroxyl termini of adjacent oligonucleotides.
Example 2
Preparation of DNA for Use in Tandem Ligation Procedures
[0180] Genomic DNA from a Caucasian male (NA12801) or a Caucasian
female (NA11995) was obtained from Coriell Cell Repositories
(Camden, N.J.) and fragmented by acoustic shearing (Covaris,
Woburn, Mass.) to a mean fragment size of approximately 200 bp.
[0181] The Coriell DNA was biotinylated using standard procedures.
Briefly, the Covaris fragmented DNA was end-repaired by mixing the
following components in a 1.5 ml microtube: 5 .mu.g DNA, 12 .mu.l
10.times. T4 ligase buffer, 50 U T4 polynucleotide kinase, and
H.sub.20 to 120 .mu.l. This reaction was incubated at 37.degree. C.
for 30 minutes. The end-repaired DNA was diluted using 10 mM Tris 1
mM EDTA pH 8.5 to a concentration of .about.2 ng/.mu.l.
[0182] 5 .mu.l DNA was placed in each well of a 96-well plate. The
plate was incubated at 95.degree. C. for 3 minutes, cooled to
25.degree. C., and spun again for 10 seconds at 250.times.g. 15 uL
of biotinylation master mix [1.times. TdT buffer, 8U TdT, 250 .mu.M
CoCl.sub.2, 0.01 nmol/.mu.l biotin-16-dUTP (Roche, Nutley N.J.)]
was aliquoted into each well of the 96 well plate, and the plate
sealed with adhesive plate sealer. The plate was spun for 10
seconds at 250.times. g and incubated for 37.degree. C. for 60
minutes. Following incubation, the plate was spun again for 10
seconds at 250.times. g, and 7.5 .mu.l precipitation mix (1
ng/.mu.l Dextran Blue, 3 mM NaOAC) was added to each well.
[0183] The plate was sealed with an adhesive plate sealer and mixed
using an IKA plate vortexer for 2 minutes at 3000 rpm. 27.5 .mu.l
of isopropanol was added into each well, the plate sealed with
adhesive plate sealer, and vortexed for 5 minutes at 3000 rpm. The
plate was spun for 20 minutes at 3000.times. g, the supernatant was
decanted, and the plate inverted and centrifuged at 10.times. g for
1 minute onto an absorbent wipe. The plate was air-dried for 5
minutes, and the pellet resuspended in 30 .mu.l 10 mM Tris pH8.0, 1
mM EDTA.
Example 3
Exemplary Assay Formats Using Tandem Ligation
[0184] Numerous tandem ligation assay formats using the
biotinylated DNA were tested to illustrate proof of concept for the
assay systems of the invention, and demonstrated the ability to
perform highly multiplexed, targeted detection of a large number of
independent loci using the series of different assay formats. The
exemplary assay systems of the invention were designed to comprise
96 or more interrogations per loci in a genetic sample, and in
cases where SNPs were detected the assay formats utilized 192 or
more separate interrogations, each utilizing the detection of
different alleles per 96 loci in genetic samples. The examples
described for each assay format utilized two different sets of
fixed sequence oligonucleotides and/or bridging oligos (as
described in Example 1), comprising a total 96 or 192 interrogation
reactions for the selected nucleic acid regions depending upon
whether or not SNPs were identified.
[0185] A first exemplary assay format used locus-specific fixed
sequence oligos and bridging oligos, where there was a one base gap
between the first fixed sequence oligo and the bridging oligos, and
a second one base gap between the bridging oligos and the second
fixed sequence oligo. Each of the two gaps encompassed two
different SNPs. In this format, a DNA polymerase was used to
incorporate each of the SNP bases, and ligase was used to seal the
nicks formed thereby. SNP base discrimination derived from the
fidelity of base incorporation by the polymerase, and in the event
of mis-incorporation, the tendency of ligase to not seal nicks
adjacent to mismatched bases.
[0186] The second exemplary assay format used two locus-specific
fixed sequence oligonucleotides without a bridging oligo, where
there was a .about.15-35 base gap between the fixed sequence
oligos, and where the gap spanned one or more SNPs. In this format,
a polymerase was used to incorporate the missing bases of the gap,
and a ligase was used to seal the nick formed thereby. SNP base
discrimination derived from the fidelity of base incorporation by
the polymerase, and in the event of misincorporation, the tendency
of ligase to not seal nicks adjacent to mismatched bases.
[0187] A third exemplary assay format used allele-specific first
and second fixed sequence oligos without a bridging oligo, where
there was a .about.15-35 base gap between the first and second
fixed sequence oligos, and where the gap spanned one or more SNPs.
Two separate allele-specific first fixed sequence oligos and two
separate allele-specific second fixed sequence oligos were used. A
polymerase was used to incorporate the missing bases, and a ligase
was used to seal the nick formed thereby. SNP base discrimination
derived from hybridization specificity, the tendency of
non-proofreading polymerase to not extend annealed primers with
mismatches near the 3' end, and the tendency of the ligase to not
seal nicks adjacent to mismatched bases.
[0188] A fourth exemplary format used allele-specific fixed
sequence oligos and a locus-specific bridging oligo. In this
format, two separate fixed sequence oligos complementary to the 3'
end of the loci of interest, the first with a 3' base specific for
one allele of the targeted SNP, and the second with a 3' base
specific for the other allele of the targeted SNP. Similarly, two
separate second fixed sequence oligos were used, the first with a
5' base specific for one allele of a second targeted SNP, and the
second with a 5' base specific for the other allele of the second
targeted SNP. The bridging oligos hybridized directly adjacent to
the first and second fixed sequence oligos, and thus no polymerase
was needed prior to ligation. Ligase was used to seal the nicks
between the fixed sequence oligos and the bridging oligo. SNP base
discrimination in this assay format derived from hybridization
specificity and the tendency of the ligase to not seal nicks
adjacent to mismatched bases. This exemplary format was tested
using either T4 ligase or Taq ligase for creation of the contiguous
template, and both were proved effective in the reaction as
described below.
[0189] A fifth exemplary format used locus-specific fixed sequence
oligos that were complementary to adjacent regions on the nucleic
acid of interest, and thus no gap was created by hybridization of
these oligos. In this format, no polymerase was required, and a
ligase was used to seal the single nick between the oligos.
[0190] A sixth exemplary format used allele-specific fixed sequence
oligos and locus-specific bridging oligos, where there was a 5 base
gap between the loci region complementary to the fixed sequence
oligos. The locus-specific bridging oligo in this example was a
5mer complementary to the regions directly adjacent to the regions
complementary to the first and second fixed sequence oligos. In
this format, no polymerase was required, and a ligase was used to
seal the two nicks between the oligos.
[0191] A seventh exemplary format used locus-specific fixed
sequence oligos and a locus-specific bridging oligo, where there
was a 5 base gap containing a SNP in the region complementary to
the bridging oligo. Allele-specific bridging oligos corresponding
to the SNP alleles were included in the hybridization and ligation
reaction. In this format, no polymerase was required, and a ligase
was used to seal the two nicks between the oligos. SNP base
discrimination in this assay format derived from hybridization
specificity and the tendency of the ligase to not seal nicks near
mismatched bases.
[0192] An eighth exemplary format used locus-specific fixed
sequence oligos and two adjacent locus-specific bridging oligos,
where there was a 10 base gap between the regions complementary to
the first and second fixed sequence oligos. A mixture of pentamers
corresponding to the potential variations in the 10 base pair gap
of the different loci interrogated were included in the ligation
reaction, with the gap requiring two contiguous pentamers to bridge
the gap. In this format, no polymerase was required, and a ligase
was used to seal the three nicks between the oligos.
[0193] For each of the above-described assay formats, an equimolar
pool (40 nM each) of sets of first and second loci- or
allele-specific fixed oligonucleotides was created from the oligos
prepared as set forth in Example 2. A separate equimolar pool (20
.mu.M each) of bridging oligonucleotides was likewise created for
the assay processes based on the sequences of the selected genomic
loci.
[0194] 10 .mu.g of streptavidin beads were transferred into the
wells of a 96 well plate, and the supernatant was removed. 60 .mu.l
BB2 buffer (100 mM Tris pH 8.0, 10 mM EDTA, 500 mM NaCl.sub.2, 58%
formamide, 0.17% Tween-80), 10 .mu.L 40 nM fixed sequence oligo
pool and 30 .mu.L of the biotinylated template DNA prepared in
Example 2 were added to the beads. The plate was sealed with an
adhesive plate sealer and vortexed at 3000 rpm until beads were
resuspended. The oligos were annealed to the template DNA by
incubation at 70 C for 5 minutes, followed by slow cooling to room
temperature.
[0195] The plate was placed on a raised bar magnetic plate for 2
minutes to pull the magnetic beads and associated DNA to the side
of the wells. The supernatant was removed by pipetting, and was
replaced with 50 .mu.l of 60% BB2 (v/v in water). The beads were
resuspended by vortexing, placed on the magnet again, and the
supernatant was removed. This bead wash procedure was repeated once
using 50 .mu.l 60% BB2, and repeated twice more using 50 .mu.l wash
buffer (10 mM Tris pH 8.0, 1 mM EDTA, 50 mM NaCl.sub.2).
[0196] The beads were resuspended in 37 .mu.l ligation reaction mix
consisting of 1.times. Taq ligase buffer, 10U Taq ligase, and 2
.mu.M bridging oligo pool (depending on the assay format), and
incubated at 37.degree. C. for one hour. Where appropriate, and
depending on the assay format, a non-proofreading thermostable
polymerase plus 200 nM each dNTP was included in this mixture. The
plate was placed on a raised bar magnetic plate for 2 minutes to
pull the magnetic beads and associated DNA to the side of the
wells. The supernatant was removed by pipetting, and was replaced
with 50 uL wash buffer. The beads were resuspended by vortexing,
placed on the magnet again, and the supernatant was removed. The
wash procedure was repeated once.
[0197] To elute the products from the strepavidin beads, 30 .mu.l
of 10 mM Tris 1 mM EDTA, pH 8.0 was added to each well of 96-well
plate. The plate was sealed and mixed using an IKA vortexer for 2
minutes at 3000 rpm to resuspend the beads. The plate was incubated
at 95.degree. C. for 1 minute, and the supernatant aspirated using
an 8-channel pipetter. 25 .mu.l of supernatant from each well was
transferred into a fresh 96-well plate for universal
amplification.
Example 4
Universal Amplification of Tandem Ligated Products
[0198] The polymerized and/or ligated nucleic acids were amplified
using universal PCR primers complementary to the universal
sequences present in the first and second fixed sequence oligos
hybridized to the nucleic acid regions of interest. 25 .mu.l of
each of the reaction mixtures of Example 3 were used in each
amplification reaction. A 50 .mu.l universal PCR reaction
consisting of 25 .mu.l eluted ligation product plus 1.times.
polymerase buffer, 1M Betaine, 400 nM each dNTP, 1 U
error-correcting thermostable DNA polymerase, and the following
primer pairs: TAATGATACGGCGACCACCGAGATCTACACCGGCGTTATGCGTCGAGA (SEQ
ID NO:3) and TCAAGCAGAAGACGGCATACGAGATXAAACGACGCGATCATCGGTCCCC GCAA
(SEQ ID NO:4), where X represents one of 96 different sample tags
used to uniquely identify individual samples prior to pooling and
sequencing. The PCR was carried out under stringent conditions
using a BioRad Tetrad.TM. thermocycler.
[0199] 10 .mu.l universal PCR product from each of the samples was
pooled and the pooled PCR product was purified using AMPure.TM.
SPRI beads (Beckman-Coulter, Danvers, Mass.), and quantified using
Quant-iT.TM. PicoGreen, (Invitrogen, Carlsbad, Calif.).
Example 5
Detection and Analysis of Selected Loci
[0200] The purified PCR products from 96 samples were sequenced on
a single lane of a slide on an Illumina HiSeq 2000. Sequencing runs
typically give rise to .about.100M raw reads, of which .about.85M
(85%) mapped to expected assay structures. This translated to an
average of .about.885K reads/sample across the 96 samples, and (in
the case of an experiment using 96 loci) 9.2K reads/sample/locus
across 96 loci. The mapped reads were parsed into
replicate/locus/allele counts, and various metrics were computed
for each condition, including:
[0201] Yield: a metric of the proportion of input DNA that was
queried in sequencing, computed as the average number of unique
reads per locus (only counting unique identification code reads per
replicate/locus) divided by the total number of genomic equivalents
contained in the input DNA.
[0202] 80 percentile locus frequency range: a metric of the locus
frequency variability in the sequencing data, interpreted as the
fold range that encompasses 80% of the loci. It was computed on the
distribution of total reads per locus, across all loci, as the
90.sup.th percentile of total reads per locus divided by the
10.sup.th percentile of the total reads per locus.
[0203] SNP error rate: a metric of the error rate at the SNP
position, and computed as the proportion of reads containing a
discordant base at the SNP position.
[0204] These results are summarized in Table 1:
TABLE-US-00001 TABLE 1 Results Summary of Tandem Ligation Assay
Formats 80% FIXED SEQUENCE BRIDGING LOC SNP ASSAY OLIGO (1.sup.st
and/or OLIGO ENZYME FREQ ERROR FORMAT 2.sup.nd) USED USED YIELD
RANGE RATE 1 Locus specific Locus specific pol + lig 9.5% 5.3 0.18%
2 Locus specific No pol + lig 1.4% 58.3 0.19% 3 Allele specific No
pol + lig 0.4% 61.7 1.00% 4 Allele specific Locus specific Taq lig
5.0% 5.9 0.92% 4 Allele specific Locus specific T4 lig 5.3% 4.4
0.95% 5 Locus specific No Taq lig 22.5% 1.7 N/A 6 Locus specific
Locus specific Taq lig 12.5% 2.9 N/A 7 Locus specific Allele
specific Taq lig 14.3% 2.8 0.20% 8 Locus specific 2 Locus Taq lig
18.5% 2.8 N/A specific
[0205] Table 1 indicates that the locus-specific tandem ligation
assay using a bridging oligo (Assay format 1) converted template
DNA into targeted product with high yield (-10%), with a high
proportion of product derived from targeted loci (15% of reads did
not contain expected assay structures), with limited locus bias
(80% of loci fall within a .about.5-fold concentration range), and
with high SNP accuracy (0.2% SNP error rate). The locus-specific
tandem ligation assay without the use of a bridging oligo (Assay
format 2) produced reduced yields and substantial locus bias, but
still produced high accuracy SNP genotyping data. The
allele-specific tandem ligation assay with a bridging oligo (Assay
format 4) produced intermediate yields compared to the
locus-specific assay using both T4 and Taq ligase, but still
produced limited locus bias and high accuracy SNP genotyping data.
The allele-specific tandem ligation assay without a bridging oligo
(Assay format 3) produced reduced yields and substantial locus
bias, but still produced high accuracy SNP genotyping data.
[0206] Assay formats 5 through eight showed that template DNA can
be converted into targeted product with high yield (12-23%), and
with limited locus bias (80% of loci fall within a 2-3-fold
concentration range). FIG. 12 illustrates the genotyping
performance that was obtained using assay format seven, comparing
the sequence counts for the two alleles of all polymorphic assays
observed in a single sample. Note the clear separation of the
homozygous and heterozygous clusters, as well as the low background
counts observed amongst the homozygous clusters.
Example 6
Determination of Percent Fetal DNA Using Tandem Ligation
[0207] One exemplary assay system of the invention was designed to
determine percent fetal DNA concentration in a genetic sample as
well as to provide counts for selected loci within the sample. This
exemplary assay comprised 480 separate interrogations, each
utilizing the detection of different loci in a maternal sample. The
initial example utilized a determination of percent fetal DNA in
subjects carrying a male fetus, and so loci on the Y chromosome
were utilized as well as loci containing a paternally-inherited
fetal SNP that is different from the maternal sequence.
[0208] Specifically, 480 selected nucleic acids were interrogated
using the assay system. The 480 selected nucleic acids comprised 48
sequence-specific interrogations of nucleic acids corresponding to
loci on chromosome Y, 192 sequence-specific interrogations of
nucleic acids corresponding to loci on chromosome 21, 192
sequence-specific interrogations of selected nucleic acids
corresponding to loci on chromosome 18, and 144 sequence-specific
interrogations of selected nucleic acids corresponding to
polymorphic loci on chromosomes 1-16 which. These assays were
designed based on human genomic sequences, and each interrogation
used three oligos per selected nucleic acid interrogated in the
assay.
[0209] The first oligo used for each interrogation was
complementary to the 3' region of the selected genomic region, and
comprised the following sequential (5' to 3') oligo elements: a
universal PCR priming sequence common to all assays:
TACACCGGCGTTATGCGTCGAGAC (SEQ ID NO:1); an identification code
specific to the selected loci comprising nine nucleotides; and a
20-24 bp sequence complementary to the selected genomic locus. This
first oligo was designed for each selected nucleic acid to provide
a predicted uniform T.sub.m with a two degree variation across all
interrogations in the 480 assay set.
[0210] The second oligo used for each interrogation was a bridging
oligo complementary to the genomic locus sequence directly adjacent
to the genomic region complementary to the first oligonucleotide.
Based on the selected nucleic acids of interest, the bridging
oligos were designed to allow utilization of a total of 12
oligonucleotide sequences that could serve as bridging oligos for
all of the 480 interrogations in the assay set. For polymorphic
assays, two or more bridging oligos per locus were included, one
complimentary to each allele.
[0211] The third oligo used for each interrogation was
complementary to the 5' region of the selected genomic locus,
comprised the following sequential (5' to 3') elements: a 20-24 b
sequence complimentary to the 5' region in the genomic locus; a
hybridization breaking nucleotide which was different from the
corresponding base in the genomic locus; and a universal PCR
priming sequence which was common to all third oligos in the assay
set: ATTGCGGGGACCGATGATCGCGTC (SEQ ID NO:2). This third oligo was
designed for each selected nucleic acid to provide a predicted
uniform T.sub.m with a two degree variation across all
interrogations in the 480 assay set, and the T.sub.m range was
substantially the same as the T.sub.m range as the first oligo
set.
[0212] All oligonucleotides were synthesized using conventional
solid-phase chemistry. The first and bridging oligonucleotides were
synthesized with 5' phosphate moieties to enable ligation to 3'
hydroxyl termini of adjacent oligonucleotides. An equimolar pool of
sets of the first and third oligonucleotides used for all
interrogations in the multiplexed assay was created, and a separate
equimolar pool of all bridging oligonucleotides was created to
allow for separate hybridization reactions.
[0213] Genomic DNA was isolated from 5 mL plasma using the Dynal
Silane viral NA kit (Invitrogen, Carlsbad, Calif.). Approximately
12 ng DNA was processed from each of 37 females, including 7
non-pregnant female subjects, 10 female subjects pregnant with
males, and 22 female subjects pregnant with females. The DNA was
biotinylated using standard procedures, and the biotinylated DNA
was immobilized on a solid surface coated with streptavidin to
allow retention of the genomic DNA in subsequent assay steps.
[0214] The immobilized DNA was hybridized to the first pool
comprising the first and third oligos for each interrogated
sequences under stringent hybridization conditions. The
unhybridized oligos in the pool were then washed from the surface
of the solid support, and the immobilized DNA was hybridized to the
pool comprising the bridging oligonucleotides under stringent
hybridization conditions. Once the bridging oligonucleotides were
allow to hybridize to the immobilized DNA, the remaining unbound
oligos were washed from the surface and the three hybridized oligos
bound to the selected nucleic acid regions were ligated using T4
ligase to provide a contiguous DNA template for amplification.
[0215] The ligated DNA was amplified from the solid substrate using
an error correcting thermostable DNA polymerase, a first universal
PCR primer TAATGATACGGCGACCACCGAGATCTACACCGGCGTTATGCGTCGAGA (SEQ ID
NO:3) and a second universal PCR primer
TCAAGCAGAAGACGGCATACGAGATXAAACGACGCGATCATCGGTCC CCGCAA (SEQ ID
NO:4), where X represents one of 96 different sample indices used
to uniquely identify individual samples prior to pooling and
sequencing. 10 .mu.L of universal PCR product from each of the 37
samples described above were and the pooled PCR product was
purified using AMPure.TM. SPRI beads (Beckman-Coulter, Danvers,
Mass.), and quantified using Quant-iT.TM. PicoGreen, (Invitrogen,
Carlsbad, Calif.).
[0216] The purified PCR product was sequenced on 6 lanes of a
single slide on an Illumina HiSeq.TM. 2000. The sequencing run gave
rise to 384M raw reads, of which 343M (89%) mapped to expected
genomic loci, resulting in an average of 3.8M reads per sample
across the 37 samples, and 8K reads per sample per locus across the
480 loci. The mapped reads were parsed into sample and locus
counts, and two separate metrics of percent fetal DNA were computed
as follows.
[0217] Percent male DNA detected by chromosome Y loci corresponds
to the relative proportion of reads derived from chromosome Y locus
interrogations versus the relative proportion of reads derived from
autosomal locus interrogations, and was computed as (number of
chromosome Y reads in a test subject/number of autosome reads in
test subject)/(number of reads in male control subject/number of
autosome reads in the male control subject). This metric was used
as a measure of percent fetal DNA in the case of a male fetus using
the relative reads of chromosome Y.
[0218] Percent fetal DNA detected by polymorphic loci corresponds
to the proportion of reads derived from non-maternal versus
maternal alleles at loci where such a distinction can be made.
First, for each identified locus, the number of reads for the
allele with the fewest counts (the low frequency allele) was
divided by the total number of reads to provide a minor allele
frequency (MAF) for each locus. Then, loci with an MAF between
0.075% and 15% were identified as informative loci. The estimated
percent fetal DNA for the sample was calculated as the mean of the
minor allele frequency of the informative loci multiplied by two,
i.e. computed as 2.times. average (MAF) occurrence where
0.075%<MAF<15%.
[0219] FIG. 13 demonstrates the results from these computations. As
shown in FIG. 13, the percent male loci determined using the
above-described chromosome Y metrics (grey circles) can separate
pregnancies involving male fetuses from pregnancies involving
female fetuses (grey diamonds) and non-pregnant samples (black
circles). In addition, computation of the percent fetal amount in a
sample by polymorphic loci metric can distinguish pregnant samples
from non-pregnant samples. Finally, there was a correlation between
the percent fetal DNA estimates for a sample obtained from
chromosome Y and polymorphic loci in pregnancies involving male
fetuses. This correlation persists down to quite low percent fetal
values.
[0220] While this invention is satisfied by aspects in many
different forms, as described in detail in connection with
preferred aspects of the invention, it is understood that the
present disclosure is to be considered as exemplary of the
principles of the invention and is not intended to limit the
invention to the specific aspects illustrated and described herein.
Numerous variations may be made by persons skilled in the art
without departure from the spirit of the invention. The scope of
the invention will be measured by the appended claims and their
equivalents. The abstract and the title are not to be construed as
limiting the scope of the present invention, as their purpose is to
enable the appropriate authorities, as well as the general public,
to quickly determine the general nature of the invention. In the
claims that follow, unless the term "means" is used, none of the
features or elements recited therein should be construed as
means-plus-function limitations pursuant to 35 U.S.C. .sctn.112,
16.
Sequence CWU 1
1
4124DNAArtificial SequenceSynthetic oligonucleotide 1tacaccggcg
ttatgcgtcg agac 24224DNAArtificial SequenceSynthetic
oligonucleotide 2attgcgggga ccgatgatcg cgtc 24349DNAArtificial
SequenceSynthetic oligonucleotide 3taatgatacg gcgaccaccg agatctasca
ccggcgttat gcgtcgaga 49453DNAArtificial SequenceSynthetic
oligonucleotide 4tcaagcagaa gacggcatac gagatnaaac gacgcgatca
tcggtccccg caa 53
* * * * *