U.S. patent application number 12/399091 was filed with the patent office on 2012-02-02 for attenuated salmonella enterica serovar paratyphi a and uses thereof.
This patent application is currently assigned to University of Maryland, Baltimore. Invention is credited to Eileen M. Barry, James Galen, Myron M. Levine, Christofer Vindurampulle.
Application Number | 20120029173 12/399091 |
Document ID | / |
Family ID | 42710167 |
Filed Date | 2012-02-02 |
United States Patent
Application |
20120029173 |
Kind Code |
A1 |
Vindurampulle; Christofer ;
et al. |
February 2, 2012 |
ATTENUATED SALMONELLA ENTERICA SEROVAR PARATYPHI A AND USES
THEREOF
Abstract
The present invention is drawn to a live, attenuated S.
Paratyphi A strain, a live, attenuated S. Paratyphi A strain
comprising a stabilized plasmid expression system, an S. Paratyphi
conjugate vaccine, and methods of using these strains and conjugate
vaccine.
Inventors: |
Vindurampulle; Christofer;
(Thornbury, AU) ; Barry; Eileen M.; (Ellicott
City, MD) ; Levine; Myron M.; (Columbia, MD) ;
Galen; James; (Sykesville, MD) |
Assignee: |
University of Maryland,
Baltimore
Baltimore
MD
|
Family ID: |
42710167 |
Appl. No.: |
12/399091 |
Filed: |
March 6, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12091929 |
Apr 28, 2008 |
|
|
|
PCT/US2006/042148 |
Oct 30, 2006 |
|
|
|
12399091 |
|
|
|
|
60731349 |
Oct 28, 2005 |
|
|
|
Current U.S.
Class: |
530/395 ;
424/197.11 |
Current CPC
Class: |
A61P 37/04 20180101;
A61K 39/0275 20130101; A61K 2039/6068 20130101; Y02A 50/482
20180101; C12N 1/36 20130101; A61K 2039/522 20130101 |
Class at
Publication: |
530/395 ;
424/197.11 |
International
Class: |
C07K 14/195 20060101
C07K014/195; A61P 37/04 20060101 A61P037/04; A61K 39/385 20060101
A61K039/385 |
Goverment Interests
STATEMENT OF FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT
[0002] This invention was made with government support under NIH
Grant No. A1029471 awarded by the National Institutes of Health.
The government has certain rights in the invention.
Claims
1.-19. (canceled)
20. A method for preparing a conjugate vaccine, comprising: (a)
mutating a strain of Salmonella Paratyphi A to generate an
attenuated strain of Salmonella Paratyphi A, (b) isolating an O
polysaccharide (OPS) and a flagellin protein from the attenuated
strain of (a), wherein said flagellin protein is phase 1 flagellin
(fliC), and (c) conjugating the OPS to the flagellin protein,
thereby preparing a conjugate vaccine.
21. (canceled)
22. The method of claim 20, wherein said OPS of Salmonella
Paratyphi A belongs to Group A OPS of Salmonella.
23. (canceled)
24. The method of claim 20, wherein said attenuated Salmonella
Paratyphi A strain comprises one or more genetic mutations selected
from the group consisting of a mutation of the guaBA loci, a
mutation of the guaB gene, a mutation of the guaA gene, a mutation
of the clpP gene, a mutation of the clpX gene, a mutation of the
fliD gene, a mutation of the flgK gene, and a mutation of the flgL
gene.
25. The method of claim 24, wherein said attenuated Salmonella
Paratyphi A strain comprises a mutation of the guaBA loci and a
mutation of the clpP gene.
26. The method of claim 25, wherein the mutation of the guaBA loci
and the mutation of the clpP gene is a deletion of part or all of
the guaBA loci and a deletion of part or all of the clpP gene.
27. The method of claim 24, wherein said attenuated Salmonella
Paratyphi A strain comprises a mutation of the guaBA loci and a
mutation of the fliD gene.
28. The method of claim 27, wherein the mutation of the guaBA loci
and the mutation of the fliD gene is a deletion of part or all of
the guaBA loci and a deletion of part or all of the fliD gene.
29. The method of claim 24, wherein said attenuated Salmonella
Paratyphi A strain comprises a mutation of the guaBA loci and a
mutation of the flgK gene.
30. The method of claim 29, wherein the mutation of the guaBA loci
and the mutation of the flgK gene is a deletion of part or all of
the guaBA loci and a deletion of part or all of the flgK gene.
31. The method of claim 24, wherein said attenuated Salmonella
Paratyphi A strain comprises a mutation of the guaBA loci and a
mutation of the flgL gene.
32. The method of claim 31, wherein the mutation of the guaBA loci
and the mutation of the flgL gene is a deletion of part or all of
the guaBA loci and a deletion of part or all of the flgL gene.
33. A conjugate vaccine comprising an O polysaccharide (OPS) from a
strain of Salmonella Paratyphi A and a flagellin protein from a
strain of Salmonella Paratyphi A.
34. The conjugate vaccine of claim 33, wherein said OPS of
Salmonella Paratyphi A belongs to Group A OPS of Salmonella.
35. The conjugate vaccine of claim 33, wherein said flagellin
protein of Salmonella Paratyphi A is phase 1 flagellin (fliC).
36. A method of inducing an immune response in a subject comprising
administering to the subject a conjugate vaccine of claim 33.
37. The conjugate vaccine of claim 33, wherein the OPS and the
flagellin protein are conjugated by chemical conjugation using a
cross-linker or a polymer.
38. The conjugate vaccine of claim 33, wherein the first strain of
Salmonella Paratyphi A is an attenuated strain of Salmonella
Paratyphi A and wherein the second strain of Salmonella Paratyphi A
is an attenuated strain of Salmonella Paratyphi A.
39. A pharmaceutical composition comprising the conjugate vaccine
of claim 33 and a pharmaceutically acceptable carrier or
adjuvant.
40. The method of claim 20, wherein conjugating is via chemical
conjugation.
Description
RELATED APPLICATIONS
[0001] The present application is a continuation-in-part of U.S.
patent application Ser. No. 12/091,929, filed Apr. 28, 2008, which
claims the benefit of International Application No. PCT/US06/42148,
filed Oct. 30, 2006, and the benefit of U.S. Provisional
Application No. 60/731,349, filed Oct. 28, 2005. The entire
disclosure and teachings of the above-referenced Applications are
incorporated herein by reference.
BACKGROUND OF THE INVENTION
[0003] Enteric fever caused by members of the genus Salmonella,
including typhoid and paratyphoid fevers, continues to constitute a
significant disease and mortality burden among populations in
developing countries (Lancet 2005; 366:749-762) and represents a
notable risk for travelers (Lancet Infect Dis. 2005;
5(10):623-628). Incidences of enteric fever caused by Salmonella
enterica serovars Typhi and Paratyphi A (S. Typhi and S. Paratyphi
A) are on the rise due to the emergence and spread of antibiotic
resistant variants (Lancet Infect Dis. 2005 5(10):623-8). Although
the clinical disease caused by S. Paratyphi A is overall somewhat
milder than that due to S. Typhi, the former can nevertheless
result in full-blown enteric fever with an assortment of
complications and, if untreated or improperly treated, can result
in death. A need exists for vaccines that are safe and effective in
combating Salmonella infections.
SUMMARY OF THE INVENTION
[0004] The present invention is drawn to an attenuated S. Paratyphi
A strain, preferably a live, attenuated S. Paratyphi A strain.
[0005] In one embodiment, the S. Paratyphi A strains of the present
invention have at least one attenuating mutation selected from the
group consisting of attenuating mutations in the guaBA loci, the
guaB gene, the guaA gene, the clpP gene and the clpX gene. In
preferred embodiments, the S. Paratyphi A strain has an attenuating
mutation in the guaB gene, the guaA gene and the clpP gene. In
another preferred embodiment, the Salmonella Paratyphi A strain has
an attenuating mutation in the guaB gene, the guaA gene and the
clpX gene. In a further preferred embodiment, the Salmonella
Paratyphi A strain has an attenuating mutation in the guaB gene,
the guaA gene, the clpP gene and the clpX gene.
[0006] In one embodiment the attenuating mutations of the guaBA
loci, the guaB gene, the guaA gene, the clpP gene, and the clpX
gene are attenuating mutations that reduce the level of expression
the loci or the genes, or that block expression of the loci or the
genes.
[0007] In another embodiment the attenuating mutations of the guaBA
loci, the guaB gene, the guaA gene, the clpP gene, and the clpX
gene are attenuating mutations that reduce the activity of a
polypeptide encoded by the loci or the genes, or inactivates a
polypeptide encoded by the loci or the genes.
[0008] In a preferred embodiment, the Salmonella Paratyphi A strain
is the S. Paratyphi A 9150 strain.
[0009] The present invention also includes S. Paratyphi A strains
that have at least one attenuating mutation selected from the group
consisting of an attenuating mutation in the guaBA loci, the guaB
gene, the guaA gene, the clpP gene and the clpX gene, and that
further comprises a stabilized plasmid expression system.
[0010] In a preferred embodiment, the stabilized plasmid expression
system comprises an expression vector having (a) a
restricted-copy-number origin of replication cassette, (b) at least
one post-segregational killing cassette, (c) at least one
partitioning cassette, and (d) an expression cassette.
[0011] In preferred embodiments, the restricted-copy-number origin
of replication cassette comprises (i) a nucleotide sequence
encoding an origin of replication that limits the expression vector
to an average plasmid copy number of about 2 to 75 copies per cell,
(ii) a first unique restriction enzyme cleavage site located 5' of
the nucleotide sequence encoding the origin of replication, and
(iii) a second unique restriction enzyme cleavage site located 3'
of the nucleotide sequence encoding the origin of replication.
[0012] In the same embodiments, the post-segregational killing
cassette comprises (i) a nucleotide sequence encoding at least one
post-segregational killing locus, (ii) a third unique restriction
enzyme cleavage site located 5' of the nucleotide sequence encoding
the post-segregational killing locus, and (iii) a fourth unique
restriction enzyme cleavage site located 3' of the nucleotide
sequence encoding the post-segregational killing locus.
[0013] In the same embodiments, the partitioning cassette comprises
(i) a nucleotide sequence encoding at least one partitioning
function, (ii) a fifth unique restriction enzyme cleavage site 5'
of the nucleotide sequence encoding the partitioning function, and
(iii) a sixth unique restriction enzyme cleavage site located 3' of
the nucleotide sequence encoding the partitioning function.
[0014] In the same embodiments, the expression cassette comprises
(i) a nucleotide sequence encoding a selected antigen operably
linked to a promoter, (ii) a seventh unique restriction enzyme
cleavage site located 5' of the nucleotide sequence encoding the
selected antigen operably linked to a promoter, and (iii) an eighth
unique restriction enzyme cleavage site located 3' of the
nucleotide sequence encoding the selected antigen operably linked
to a promoter.
[0015] In preferred embodiments, the nucleotide sequence encoding
the origin of replication is a nucleotide sequence selected from
the group consisting of the oriE1 sequence of SEQ ID NO:28, the
ori101 sequence of SEQ ID NO:30, and the ori15A sequence of SEQ ID
NO:29.
[0016] In preferred embodiments, the nucleotide sequence encoding
the post-segregational killing locus is a nucleotide sequence
selected from the group consisting of a nucleotide sequence
encoding the ssb balanced-lethal system, a nucleotide sequence
encoding the asd balanced-lethal system, a nucleotide sequence
encoding the phd-doc proteic system, and a nucleotide sequence
encoding the hok-sok antisense system. More preferably, the
post-segregational killing locus is a nucleotide sequence encoding
ssb balanced-lethal system selected from the group consisting of
the Shigella flexneri ssb locus, the Salmonella Typhi ssb locus,
and the E. coli ssb locus. Even more preferably, the ssb
balanced-lethal system is a ssb locus comprising a ssb inducible
promoter, a ssb constitutive promoter and a ssb coding region of S.
flexneri 2a strain CVD 1208s set forth in SEQ ID NO:34.
[0017] In preferred embodiments, the nucleotide sequence encoding
the partitioning function is a nucleotide sequence selected from
the group consisting of the E. coli parA locus set forth in SEQ ID
NO:31 and the E. coli pSC101 par locus set forth in SEQ ID
NO:32.
[0018] In preferred embodiments, the promoter is an inducible
promoter, more preferably an ompC promoter, even more preferably
the ompC promoter set forth in SEQ ID NO:33.
[0019] In one embodiment, the nucleotide sequence encoding a
selected antigen is a nucleotide sequence encoding a homologous
antigen. In another embodiment, the nucleotide sequence encoding a
selected antigen is a nucleotide sequence encoding a heterologous
antigen.
[0020] In preferred embodiments, the nucleotide sequence encoding a
selected antigen is a nucleotide sequence encoding a heterologous
antigen selected from the group consisting of a viral antigen, a
bacterial antigen, a cancer antigen, and an auto-immune
antigen.
[0021] The present invention also includes a pharmaceutical
formulation comprising one or more of the attenuated Salmonella
Paratyphi A strains of the present invention. Preferably the
pharmaceutical formulations are oral pharmaceutical
formulations.
[0022] The present invention further includes a method of inducing
an immune response in a subject, comprising administering an
immunologically-effective amount of a pharmaceutical formulation of
the present invention to a subject. Preferably, the immune response
is a protective immune response.
[0023] The immunologically-effective amount of the pharmaceutical
formulation contains about 10.sup.2 cfu to about 10.sup.10 cfu,
more preferably about 10.sup.6 cfu to about 10.sup.9 cfu, of the
attenuated S. Paratyphi A strain within the pharmaceutical
formulation.
[0024] In one embodiment, the immune response is to Salmonella
Paratyphi A. In another embodiment, the immune response is to the
selected antigen. In a further embodiment, the immune response is
to both Salmonella Paratyphi A and the selected antigen.
[0025] The Lambda Red-mediated mutagenesis system may be used to
mutate or delete various chromosomal loci and genes from the S.
Paratyphi strains of the present invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0026] FIG. 1 shows the PCR amplification products of guaBA and
guaBA::cml. Lane 1 is wild-type guaBA; lanes 2 and 3 are
guaBA::cml. Arrows indicate molecular weight marker bands of 3 kb
(top) and 1.5 kb (bottom).
[0027] FIG. 2 shows the PCR amplification products of guaBA::cml
and guaBA deletions. Lane 1 is guaBA::cml; lanes 2 to 5 are guaBA
deletions. Arrows indicate molecular weight marker bands of 1.5 kb
(top) and 0.5 kb (bottom).
[0028] FIG. 3 shows the results of a complementation study of the
guaBA deletion. Plate 1 is the guaBA mutant transformed with
pLowBlu 184; plate 2 is the same mutant transformed with
pATGguaBA.
[0029] FIG. 4 shows the PCR amplification products of wt, clpX and
clpX-guaBA attenuated S. Paratyphi A. Panel A shows PCR products
produced using primers specific for clpX, whereas panel B shows PCR
products produced using primers specific for guaBA. Arrows indicate
molecular weight marker bands of 1.5 kb (top) and 0.5 kb (bottom)
on panel A, and 3 kb (top) and 0.5 kb (bottom) on panel B.
[0030] FIG. 5 shows the PCR amplification products of wt, clpP and
clpP-guaBA attenuated S. Paratyphi A. Panel A shows PCR products
produced using primers specific for clpP, whereas panel B shows PCR
products produced using primers specific for guaBA. Arrows indicate
molecular weight marker bands of 1 kb (top) and 0.5 kb (bottom) on
panel A, and 3 kb (top) and 0.5 kb (bottom) on panel B.
[0031] FIG. 6 is a graphical representation of data from LD.sub.50
tests in mice injected with wt, guaBA-deleted S. Paratyphi A,
guaBA-deleted complemented with pLowBlu 184, and guaBA-deleted
complemented with pATGguaBA.
[0032] FIG. 7 is a graphical representation of data from LD.sub.50
tests in mice injected with wt, clpX-deleted S. Paratyphi A,
guaBA-deleted S. Paratyphi A, or clpX-guaBA-deleted S. Paratyphi A.
The data include mice injected with clpX-deleted S. Paratyphi A
complimented with pLowBlu 184 or pATGclpX, as well as clpX-guaBA
-deleted S. Paratyphi A complimented with pLowBlu 184 or
pATGclpXATGguaBA.
[0033] FIG. 8 is a graphical representation of data from LD.sub.50
tests in mice injected with wt, clpP-deleted S. Paratyphi A,
guaBA-deleted S. Paratyphi A, or clpP-guaBA-deleted S. Paratyphi A.
The data include mice injected with clpP-deleted S. Paratyphi A
complimented with pLowBlu 184 or pATGclpP, as well as
clpP-guaBA-deleted S. Paratyphi A complimented with pLowBlu 184 or
pATGclpPATGguaBA.
[0034] FIG. 9 shows hyper-flagellation by electron microscopy of
mutations clpP in S. Paratyphi A.
[0035] FIG. 10 Alignment of chromosomal fliD-fliS loci from
Salmonella enterica serovars Typhimurium, Enteritidis, Paratyphi A,
and Typhi. FIGS. 10A-10D show the alignment of the chromosomal
fliD-fliS loci as between Salmonella Typhimurium (SEQ ID NO:47),
serovar Paratyphi A (using the shorthand "Typhi A") (SEQ ID NO:48)
and serovar Typhi strain Ty2 (SEQ ID NO:49). FIGS. 10E-10H show the
alignment of the chromosomal fliD-fliS loci as between Salmonella
Enteritidis (SEQ ID NO:50) and Salmonella Typhimurium (SEQ ID
NO:47).
DETAILED DESCRIPTION OF THE INVENTION
A. Attenuated S. Paratyphi A Strains
[0036] The present invention relates to an attenuated S. Paratyphi
A strain. Such attenuated S. Paratyphi A strains may be used to
induce an immune response in a subject without causing disease in
the subject.
[0037] The S. Paratyphi A strain used as the starting material of
the present invention may be any S. Paratyphi A strain and the
identity of the strain is not critical. Preferred S. Paratyphi A
strains include S. Paratyphi A 9150 strain.
[0038] The S. Paratyphi A strains of the present invention are
attenuated. As used herein, attenuated strains of S. Paratyphi A
are those that have a reduced, decreased, or suppressed ability to
cause disease in a subject, or those completely lacking in the
ability to cause disease in a subject. Attenuated strains may
exhibit reduced or no expression of one or more genes, may express
one or more proteins with reduced or no activity, may exhibit a
reduced ability to grow and divide, or a combination of two or more
of these characteristics. The attenuated strains of the present
invention may be living or dead.
[0039] In addition to the attenuated S. Paratyphi A strains of the
present invention, attenuated strains of other enteric pathogens
(e.g., Salmonella Typhi, Salmonella Paratyphi B, Shigella, Vibrio
cholerae), commensals (e.g., Lactobacillus, Streptococcus gordonii)
and licensed vaccine strains (e.g., BCG) are also encompassed
within the scope of the invention. These additional strains have
all of the attenuating mutations of the S. Paratyphi A strains of
the present invention, may be transformed with the stabilized
plasmid expression system of the present invention, and may be used
as an immunizing composition as described herein.
[0040] In preferred embodiments, the attenuated S. Paratyphi A
strains of the present invention have a mutation in one or more of
the guaBA loci, the guaB gene, the guaA gene, the clpP gene and the
clpX gene of S. Paratyphi. For example, the attenuated S. Paratyphi
A strains of the present invention may have a mutation (i) in the
guaB gene and the clpP gene, (ii) in the guaA gene and the clpP
gene, (iii) in the guaB gene, the guaA gene, and the clpP gene,
(iv) in the guaBA loci and the clpP gene, (v) in the guaB gene and
the clpX gene, (vi) in the guaA gene and the clpX gene, (vii) in
the guaB gene, the guaA gene, and the clpX gene, (viii) in the
guaBA loci and the clpX gene, (ix) in the guaB gene, the clpP gene
and the clpX gene, (x) in the guaA gene, the clpP gene and the clpX
gene, (xi) in the guaB gene, the guaA gene, the clpP gene and the
clpX gene, or (xii) in the guaBA loci, the clpP gene and the clpX
gene.
[0041] The mutations of the loci and genes described herein may be
any mutation, such as one or more nucleic acid deletions,
insertions or substitutions. The mutations may be any deletion,
insertion or substitution of the loci or genes that results in a
reduction or absence of expression from the loci or genes, or a
reduction or absence of activity of a polypeptide encoded by the
loci or genes. The mutations may be in the coding or non-coding
regions of the loci or genes.
[0042] Preferably, in the present invention, the chromosomal genome
of the S. Paratyphi A strain is modified by removing or otherwise
modifying the guaBA loci, and thus blocking the de novo
biosynthesis of guanine nucleotides. More preferably, a mutation in
the guaBA loci inactivates the purine metabolic pathway enzymes IMP
dehydrogenase (encoded by guaB) and GMP synthetase (encoded by
guaA). As a consequence of these mutations, S. Paratyphi A are
unable to de novo synthesize GMP, and consequently GDP and GTP
nucleotides, which severely limits bacterial growth in mammalian
tissues. In vitro, the .DELTA.guaBA S. Paratyphi A mutants of the
present invention are unable to grow in minimal medium unless
supplemented with guanine. In tissue culture, the .DELTA.guaBA S.
Paratyphi A mutants of the present invention were found to show a
significant reduction in their capability for invasion.
.DELTA.guaBA S. Paratyphi A mutants may scavenge guanine
nucleotides from the tissues of the mammalian host. However, their
assimilation into S. Paratyphi A requires prior dephosphorylation
to nucleosides by periplasmic nucleotidases to be incorporated as
nucleotide precursors into the guanine salvage pathway. Therefore,
as nucleotides are readily available in the intracellular
environment of the mammalian host, the attenuation due to the de
novo synthesis of guanine nucleotides is due either to the
inefficiency of the salvage pathway or to reasons that are obscure
to today's knowledge.
[0043] The guaA gene of S. Paratyphi A 9150, which encodes GMP
synthetase, is 1578 bp in size (SEQ ID NO:36), and is 98%
homologous to the guaA gene of S. Typhi Ty2 as determined by NCBI
BLAST nucleotide comparison. Deletion mutants can be produced by
eliminating portions of the coding region of the guaA gene of S.
Paratyphi A so that proper folding or activity of GuaA is
prevented. For example, about 25 to about 1500 bp, about 75 to
about 1400 bp, about 100 to about 1300 bp, or all of the coding
region can be deleted. Alternatively, the deletion mutants can be
produced by eliminating, for example, a 1 to 100 bp fragment of the
guaA gene of S. Paratyphi A so that the proper reading frame of the
gene is shifted. In the latter instance, a nonsense polypeptide may
be produced or polypeptide synthesis may be aborted due to a
frame-shift-induced stop codon. The preferred size of the deletion
is about 75 to 750 bp. Deletions can also be made that extend
beyond the guaA gene, i.e., deletions in the elements controlling
translation of the guaA gene, such as in a ribosome binding
site.
[0044] The guaB gene of S. Paratyphi A 9150, which encodes IMP
dehydrogenase, is 1467 bp in size (SEQ ID NO:35), and is 98%
homologous to the guaB gene of S. Typhi Ty2 as determined by NCBI
BLAST nucleotide comparison. Deletion mutants can be produced by
eliminating portions of the coding region of the guaB gene of S.
Paratyphi A so that proper folding or activity of GuaB is
prevented. For example, about 25 to about 1400 bp, about 75 to
about 1300 bp, about 100 to about 1200 bp, or all of the coding
region can be deleted. Alternatively, the deletion mutants can be
produced by eliminating, for example, a 1 to 100 bp fragment of the
guaB gene of S. Paratyphi A so that the proper reading frame of the
gene is shifted. In the latter instance, a nonsense polypeptide may
be produced or polypeptide synthesis may be aborted due to a
frame-shift-induced stop codon. The preferred size of the deletion
is about 75 to 750 bp. Deletions can also be made that extend
beyond the guaB gene, i.e., deletions in the elements controlling
transcription of the guaB gene, such as in a promoter.
[0045] The clpP gene of S. Paratyphi A 9150, which encodes a
serine-protease, is 624 bp in size (SEQ ID NO:37), and 99%
homologous to the clpP gene of S. Typhi Ty2 as determined by NCBI
BLAST nucleotide comparison. Deletion mutants can be produced by
eliminating portions of the coding region of the clpP gene of S.
Paratyphi A so that proper folding or activity of ClpP is
prevented. For example, about 25 to about 600 bp, about 75 to about
500 bp, about 100 to about 400 bp, or all of the coding region can
be deleted. Alternatively, the deletion mutants can be produced by
eliminating, for example, a 1 to 100 bp fragment of the clpP gene
of S. Paratyphi A so that the proper reading frame of the gene is
shifted. In the latter instance, a nonsense polypeptide may be
produced or polypeptide synthesis may be aborted due to a
frame-shift-induced stop codon. The preferred size of the deletion
is about 25 to 600 bp. Deletions can also be made that extend
beyond the clpP gene, i.e., deletions in the elements controlling
transcription of the clpP gene, such as in a promoter.
[0046] The clpX gene of S. Paratyphi A 9150, which encodes a
chaperone ATPase, is 1272 bp in size (SEQ ID NO:38), and 99%
homologous to the clpX gene of S. Typhi Ty2 as determined by NCBI
BLAST nucleotide comparison. Deletion mutants can be produced by
eliminating portions of the coding region of the clpX gene of S.
Paratyphi A so that proper folding or activity of ClpX is
prevented. For example, about 25 to about 1200 bp, about 75 to
about 1100 bp, about 100 to about 1000 bp, or all of the coding
region can be deleted. Alternatively, the deletion mutants can be
produced by eliminating, for example, a 1 to 100 bp fragment of the
clpX gene of S. Paratyphi A so that the proper reading frame of the
gene is shifted. In the latter instance, a nonsense polypeptide may
be produced or polypeptide synthesis may be aborted due to a
frame-shift-induced stop codon. The preferred size of the deletion
is about 75 to 750 bp. Deletions can also be made that extend
beyond the clpX gene, i.e., deletions in the elements controlling
transcription of the clpX gene, such as in a promoter.
[0047] Deletions can be made in any of the loci or genes included
herein by using convenient restriction sites located within the
loci or genes, or by site-directed mutagenesis with
oligonucleotides (Sambrook et al, In: Molecular Cloning, A
Laboratory Manual, Eds., Cold Spring Harbor Publications
(1989)).
[0048] Inactivation of the loci or genes can also be carried out by
an insertion of foreign DNA using any convenient restriction site,
or by site-directed mutagenesis with oligonucleotides (Sambrook et
al, supra) so as to interrupt the correct transcription of the loci
or genes. The typical size of an insertion that can inactivate the
loci or genes is from 1 base pair to 100 kbp, although insertions
smaller than 100 kbp are preferable. The insertion can be made
anywhere inside the loci or gene coding regions or between the
coding regions and the promoters.
[0049] Other methods for the inactivation of the loci and genes
include the transfer into Salmonella of deletions or insertions
made in other enterobacteriae guaBA loci, guaA, guaB, clpP or clpX
genes, transposon-generated deletions, and imprecise excision of
DNA insertions.
[0050] Preferably, the bacterial loci and genes are mutated using
Lambda Red-mediated mutagenesis (Datsenko and Wanner, PNAS USA
97:6640-6645 (2000)). Briefly, in step 1 host bacteria targeted for
mutation are transformed with a temperature sensitive plasmid
encoding .lamda. Red recombinase. These bacteria are grown in the
presence of arabinose to induce .lamda. Red production. Chromosomal
mutagenesis of a target sequence is accomplished by electroporation
of the host with linear DNA in which the target gene is replaced
with an antibiotic resistance marker. This DNA also encodes short
regions of flanking chromosomal sequences to allow for chromosomal
integration of the resistance marker by .lamda. Red--mediated
homologous recombination. Recombinants are selected for on solid
media containing the appropriate antibiotic, and incubated at a
temperature facilitating the loss of the plasmid encoding .lamda.
Red recombinase. For step 2, removal of the chromosomal resistance
marker is facilitated by transforming the bacteria with a
temperature sensitive plasmid encoding FLP recombinase, which
targets unique sequences within the antibiotic resistance marker
now present in the host chromosome. Transformants are grown at
temperatures permissive for the presence of the FLP recombinase
which is expressed constitutively. Mutants are screened via PCR,
grown at a temperature to facilitate loss of the plasmid encoding
FLP recombinase, and selected for storage.
[0051] The attenuated S. Paratyphi A strains of the present
invention may contain mutations in one or more additional genes.
While an extensive discussion of additional attenuating mutations
of Salmonella spp. is provide in U.S. Pat. No. 6,682,729, exemplary
genes include those encoding various biochemical pathways, global
regulatory systems, heat shock proteins, other regulatory genes,
and putative virulence properties. Specific examples of such
attenuating mutations include, but are not limited to: (i)
auxotrophic mutations, such as aro, gua, nad, thy, and asd
mutations; (ii) mutations that inactivate global regulatory
functions, such as cya, crp, phoP/phoQ, phoP.sup.c and ompR
mutations; (iii) mutations that modify the stress response, such as
recA, htrA, htpR, hsp and groEL mutations; (iv) mutations in
specific virulence factors, such as pag and prg (v) mutations that
affect DNA topology, such as topA mutations; (vi) mutations that
block biogenesis of surface polysaccharides, such as rib, galE and
via mutations; (vii) mutations that modify suicide systems, such as
sacB, nuc, hok, gef, kil, and phlA mutations; (viii) mutations that
introduce suicide systems, such as lysogens encoded by P22, .lamda.
murein transglycosylase and S-gene; and (ix) mutations that disrupt
or modify the correct cell cycle, such as minB mutations.
B. Stabilized Expression Plasmid System
[0052] The attenuated S. Paratyphi A strains of the present
invention include those strains engineered to express selected
polypeptides (antigens). Such attenuated S. Paratyphi A strains can
be used to induce an immune response to S. Paratyphi itself, or to
induce an immune response to the selected antigens expressed by the
attenuated S. Paratyphi A strains, or both.
[0053] Such attenuated S. Paratyphi A strains are transformed with
a stabilized expression plasmid system. The stabilized expression
plasmid system encodes a selected antigen.
[0054] The stabilized expression plasmid system comprises
expression vector that comprises a plasmid maintenance system (PMS)
and a nucleotide sequence encoding a selected antigen.
[0055] The stabilized expression plasmid system optimizes the
maintenance of the expression vector in the bacteria at two
independent levels by: (1) removing sole dependence on balanced
lethal maintenance systems; and (2) incorporating a plasmid
partition system to prevent random segregation of expression
vectors, thereby enhancing their inheritance and stability.
[0056] The PMS includes (a) an origin of replication, (b) at least
one post-segregational killing function, and (c) at least one
partitioning function. Each of the noted elements of the PMS may be
an individual cassette of the stabilized expression plasmid system.
Each of the cassettes may comprise unique restriction enzyme
cleavage sites located at the 5' and 3' ends of the cassettes.
[0057] Preferred stabilized expression plasmid systems are those
described in pending U.S. patent application Ser. No. 11/542,264,
which is incorporated by reference herein in its entirety.
[0058] 1. Origin of Replication
[0059] The PMS includes a restricted-copy-number origin of
replication that limits the expression vector to a range of plasmid
copies per cell. Due to varying degrees of toxicity associated with
different selected antigens (e.g., higher toxicity for antigens
derived from parasitic organisms such Plasmodium falciparum versus
virtually no toxicity for the fragment C of tetanus toxin), the
stabilized expression plasmid system of the present invention is
based on either a low or medium copy number expression vector
(plasmid). It will be appreciated by one skilled in the art that
the selection of an origin of replication will depend on the degree
of toxicity, i.e., the copy number should go down as toxicity to
the bacterial strain goes up.
[0060] It is preferable for the origin of replication to confer an
average copy number which is between about 2 and about 75 copies
per cell, between about 5 and about 60 copies per cell, between
about 5 to about 30 copies per cell, or between about 5 to about 15
copies per cell. The origins of replication included herein are
derived from the E. coli plasmid pAT153 (oriE1, .about.60 copies
per chromosomal equivalent), the E. coli plasmid pACYC184 (ori15A,
.about.15 copies per chromosomal equivalent), and the Salmonella
typhimurium plasmid pSC101 (ori101, .about.5 copies per chromosomal
equivalent). The structural organization of the engineered origins
of replication cassettes for pSC101, pACYC184, and pAT153 are
analogous in structure and function.
[0061] The origins of replication of the present invention includes
both naturally-occurring origins of replication, as well as origins
of replication encoded by nucleotide sequences which are
substantially homologous to nucleotide sequences encoding
naturally-occurring origins of replication, and which retain the
function exhibited by the naturally-occurring origins of
replication.
[0062] In preferred embodiments, the nucleotide sequence encoding
the origin of replication is a nucleotide sequence selected from
the group consisting of the oriE1 sequence of SEQ ID NO:28, the
ori101 sequence of SEQ ID NO:30, and the ori15A sequence of SEQ ID
NO:29.
[0063] In a further preferred embodiment, the origin of replication
is the oriE1 locus from pSC101, conferring a copy number of
approximately 5 copies per genome equivalent, set forth in SEQ ID
NO:28.
[0064] 2. Partitioning Function
[0065] The PMS also includes a partitioning function, also known in
the art and herein as a "segregating system" and a "partitioning
system." The partitioning function is any plasmid
stability-enhancing function that operates to increase the
frequency of successful delivery of a plasmid to each newly divided
bacterial cell, as compared to the frequency of delivery of a
corresponding plasmid without such a function. Partitioning systems
include, for example, equi-partitioning systems, pair-site
partitioning systems, and the systems provided in Table 1 of
Chapter 5, Partition Systems of Bacterial Plasmids. B. E. Funnell
and R. A. Slavcev. In Plasmid Biology. 2004. B E Funnell and G J
Phillips, eds. ASM Press, Washington, D.C.
[0066] The partitioning systems of the present invention includes
both naturally-occurring partitioning systems, as well as
partitioning systems encoded by nucleotide sequences which are
substantially homologous to nucleotide sequences encoding
naturally-occurring partitioning systems, and which retain the
function exhibited by the naturally-occurring partitioning
systems.
[0067] Exemplary partitioning functions include, without
limitation, systems of pSC101, the F factor, the P1 prophage, and
IncFII drug resistance plasmids.
[0068] In particular, the par passive partitioning locus can be
used. The function of the par locus appears to be related to
increasing plasmid supercoiling at the origin of replication, which
is also the binding site for DNA gyrase. An exemplary par sequence
is that of E. coli, set forth in SEQ ID NO:32 (Miller et al.
Nucleotide sequence of the partition locus of Escherichia coli
plasmid pSC101, Gene 24:309-15 (1983); GenBank accession no.
X01654, nucleotides 4524-4890)).
[0069] The active partitioning panA locus may also be used. An
exemplary panA locus sequence is set forth in SEQ ID NO:31.
[0070] 3. Post-Segregational Killing Function
[0071] The PMS further includes at least one post-segregational
killing (PSK) function. The PSK function is a function which
results in the death of any newly divided bacterial cell which does
not inherit the plasmid of interest, and specifically includes
balanced-lethal systems such as asd or ssb, proteic systems such as
phd-doc, and antisense systems such as hok-sok.
[0072] The PSK function of the present invention includes both
naturally-occurring PSK functions, as well as PSK functions encoded
by nucleotide sequences which are substantially homologous to
nucleotide sequences encoding naturally-occurring PSK functions,
and which retain the function exhibited by the naturally-occurring
PSK functions.
[0073] In preferred embodiments, the PSK function is the ssb
balanced lethal system. The single-stranded binding protein (SSB)
from S. Typhi is used to trans-complement an otherwise lethal
mutation introduced into the chromosomal ssb gene. The biochemistry
and metabolic roles of the E. coli SSB protein have been
extensively reviewed in Lohman et al., Annual Reviews in
Biochemistry 63:527, 1994 and Chase et al., Annual Reviews in
Biochemistry 55:103, 1986 (the disclosures of which are
incorporated herein by reference).
[0074] In the S. Paratyphi A strains of the present invention
comprising a stabilized expression plasmid system wherein the PSK
function is the ssb balanced lethal system, the native ssb locus of
the bacteria is inactivated. The native ssb locus may be
inactivated by any means known in the art, such as a suicide vector
comprising a temperature sensitive origin of replication or Lambda
Red-mediated mutagenesis (Datsenko and Wanner, PNAS USA
97:6640-6645 (2000)). In a preferred aspect, Lambda Red-mediated
mutagenesis is used to inactivate the ssb locus of the attenuated
S. Paratyphi A strains of the present invention.
[0075] In another aspect of the invention, the PSK function is the
ssb locus where both the inducible and the constitutive ssb gene
promoters are used as the promoters of the ssb PSK function. In a
preferred embodiment, the PSK function comprises a ssb inducible
promoter, a ssb constitutive promoter and a ssb coding region.
Preferably, the ssb locus is the ssb locus of any one of Shigella
flexneri, Salmonella Typhi and E. coli. In one embodiment the ssb
locus is the ssb locus of S. flexneri 2a strain CVD 1208s set forth
in SEQ ID NO:34.
[0076] In a related aspect of the invention, mutated alleles such
as ssb-1 (or any mutation functionally equivalent to this allele,
such as W54S; Carlini et al. Mol. Microbiol. 10:1067-1075 (1993))
may be incorporated into the stabilized expression plasmid system
to enhance higher copy number plasmids by over-expression of
SSB1-like proteins to form the required biologically active
tetramers of SSB.
[0077] In a further embodiment, the PMS comprises two PSK
functions.
[0078] 4. Selected Antigen
[0079] The stabilized expression plasmid system also comprises a
polynucleotide encoding selected antigen under control of a
promoter.
[0080] The promoter is preferably an environmentally regulatable
promoter, controlled by a biologically relevant signal such as
osmolarity. In a preferred embodiment, the promoter is the ompC
promoter. The ompC gene encodes a porin protein which inserts as a
trimer into the outer membrane of a bacterial cell. Expression and
control of ompC has been reviewed in considerable detail in Pratt
et al., Molecular Microbiology 20:911, 1996 and Egger et al., Genes
to Cells 2:167, 1997. In a preferred embodiment the ompC promoter
fragment from E. coli is set forth in SEQ ID NO:33. See U.S. Pat.
No. 6,703,233, which is incorporated herein by reference in its
entirety. Transcription of this cassette may be terminated in the
3'-distal region by a trpA transcriptional terminator.
[0081] In one aspect, the inducible promoter is the mutated
P.sub.ompC1, or the P.sub.ompC3 promoter. The promoter may be used
to exclusively control the transcription of the downstream selected
antigen.
[0082] The invention encompasses the expression of any antigen
which does not destroy the attenuated S. Paratyphi A strain
expressing it, and which elicits an immune response when the
attenuated S. Paratyphi A strain expressing the antigen is
administered to the subject. The selected antigens may be
homologous (from S. Paratyphi A) or heterologous.
[0083] Non-limiting examples of the selected antigen include: Shiga
toxin 1 (Stx1) antigen, Shiga toxin 2 (Stx2) antigen, hepatitis B,
Haemophilus influenzae type b, hepatitis A, acellular pertussis
(.sub.acP), varicella, rotavirus, Streptococcus pneumoniae
(pneumococcal), and Neisseria meningitidis (meningococcal). See
Ellis et al., Advances in Pharm., 39: 393423, 1997 (incorporated
herein by reference). Where the antigen is a Shiga toxin 2 antigen,
the Shiga toxin 2 antigen can, for example, be either a B subunit
pentamer or a genetically detoxified Stx 2. Further antigens of
relevance to biodefense include: 1) one or more domains of the
anthrax toxin Protective Antigen PA83 moiety, including but not
limited to domain 4 (the eukaryotic cell-binding domain; D4), the
processed 63 kDa biologically active form of PA83, or full-length
PA83; and 2) Clostridium botulinum antigens comprising the
eukaryotic cell-binding heavy chain fragment of any neurotoxin
serotype A, B, C, D, E, F, or G, in any combination. Other selected
antigens include each of those disclosed in U.S. Pat. No.
6,190,669, incorporated herein by reference.
[0084] In one aspect, the selected antigen is an antigen that
induced an immune response to cancer. In another aspect, the
selected antigen is designed to provoke an immune response to
autoantigens, B cell receptors and/or T cell receptors which are
implicated in autoimmune or immunological diseases. For example,
where inappropriate immune responses are raised against body
tissues or environmental antigens, the immunizing compositions of
the present invention may be used to induce an immune response to
the autoantigens, B cell receptors and/or T cell receptors to
modulate the responses and ameliorate the diseases. For example,
such techniques can be efficacious in treating myasthenia gravis,
lupus erythematosis, rheumatoid arthritis, multiple sclerosis,
allergies and asthma.
[0085] In another aspect of the present invention, the stabilized
expression plasmid system may include a polynucleotide encoding a
selectable marker, or a temperature sensitive marker, such as drug
resistance marker. A non-limiting example of a drug resistance
marker includes aph which is known in the art to confer resistance
to aminoglycosides kanamycin and/or neomycin.
[0086] The term "substantially homologous" or "substantial
homologue," in reference to a nucleotide sequence or amino acid
sequence herein, indicates that the nucleic acid sequence or amino
acid sequence has sufficient homology as compared to a reference
sequence (e.g., a native or naturally-occurring sequence) to permit
the sequence to perform the same basic function as the
corresponding reference sequence; a substantially homologous
sequence is typically at least about 70 percent sequentially
identical as compared to the reference sequence, typically at least
about 85 percent sequentially identical, preferably at least about
90 or 95 percent sequentially identical, and most preferably about
96, 97, 98 or 99 percent sequentially identical, as compared to the
reference sequence. It will be appreciated that throughout the
specification, where reference is made to specific nucleotide
sequences and/or amino acid sequences, that such nucleotide
sequences and/or amino acid sequences may be replaced by
substantially homologous sequences.
C. Methods of Inducing an Immune Response
[0087] The present invention also includes methods of inducing an
immune response in a subject. The immune response may be to the
attenuated S. Paratyphi A strain itself, a selected antigen
expressed by an attenuated S. Paratyphi A strain transformed with a
stabilized expression plasmid system, or both.
[0088] In one embodiment, the method of inducing an immune response
comprises administering one or more of the strains of the present
invention to a subject in an amount sufficient to induce an immune
response in the subject. As used herein, the strain of the present
invention includes both untransformed and transformed attenuated S.
Paratyphi A strains.
[0089] In a further embodiment, the method of inducing an immune
response comprises administering a pharmaceutical formulation
comprising one or more of the strains of the present invention to a
subject in an amount sufficient to induce an immune response in the
subject (an immunologically-effective amount).
[0090] For the sake of convenience, the strains of the present
invention and pharmaceutical formulations comprising the strains
are referred to herein as "immunizing compositions." The skilled
artisan will appreciate that the immunizing compositions are
synonymous with vaccines.
[0091] As used herein, an "immune response" is the physiological
response of the subject's immune system to the immunizing
composition. An immune response may include an innate immune
response, an adaptive immune response, or both.
[0092] In a preferred embodiment of the present invention, the
immune response is a protective immune response. A protective
immune response confers immunological cellular memory upon the
subject, with the effect that a secondary exposure to the same or a
similar antigen is characterized by one or more of the following
characteristics: shorter lag phase than the lag phase resulting
from exposure to the selected antigen in the absence of prior
exposure to the immunizing composition; production of antibody
which continues for a longer period than production of antibody
resulting from exposure to the selected antigen in the absence of
prior exposure to the immunizing composition; a change in the type
and quality of antibody produced in comparison to the type and
quality of antibody produced upon exposure to the selected antigen
in the absence of prior exposure to the immunizing composition; a
shift in class response, with IgG antibodies appearing in higher
concentrations and with greater persistence than IgM, than occurs
in response to exposure to the selected antigen in the absence of
prior exposure to the immunizing composition; an increased average
affinity (binding constant) of the antibodies for the antigen in
comparison with the average affinity of antibodies for the antigen
resulting from exposure to the selected antigen in the absence of
prior exposure to the immunizing composition; and/or other
characteristics known in the art to characterize a secondary immune
response.
[0093] The subject to which the immunizing compositions may be
administered is preferably a human, but may also be another mammal
such as a simian, dog, cat, horse, cow or pig, or a bird, such as a
chicken.
[0094] In one embodiment, the subject is a subject at risk for
developing an S. Paratyphi A infection. In another embodiment, the
subject is immunologically naive or, alternatively, exhibits
pre-existing immunity to S. Typhi infection or S. Paratyphi A
infection.
[0095] In a further embodiment, the subject to which the strains of
the present invention are administered develops a protective immune
response against paratyphoid fever.
D. Formulations, Dosages, and Modes of Administration
[0096] The attenuated strains of the present invention, both those
untransformed and transformed with a stabilized expression plasmid
system, may be administered to a subject to induce an immune
response. In a preferred embodiment, the strains of the present
invention are administered in a pharmaceutical formulation.
[0097] The pharmaceutical formulations of the present invention may
include pharmaceutically acceptable carriers, excipients, other
ingredients, such as adjuvants. Pharmaceutically acceptable
carriers, excipients, other ingredients are those compounds,
solutions, substances or materials that are compatible with the
strains of the present invention and are not unduly deleterious to
the recipient thereof. In particular, carriers, excipients, other
ingredients of the present invention are those useful in preparing
a pharmaceutical formulation that is generally safe, non-toxic and
neither biologically nor otherwise undesirable, and that may
present pharmacologically favorable profiles, and includes
carriers, excipients, other ingredients that are acceptable for
veterinary use as well as human pharmaceutical use.
[0098] Suitable pharmaceutically acceptable carriers and excipients
are well known in art and can be determined by those of skill in
the art as the clinical situation warrants. The skilled artisan
will understand that diluents are included within the scope of the
terms carriers and excipients. Examples of suitable carriers and
excipients include saline, buffered saline, dextrose, water,
glycerol, ethanol, more particularly: (1) Dulbecco's phosphate
buffered saline, pH about 7.4, containing about 1 mg/ml to 25 mg/ml
human serum albumin, (2) 0.9% saline (0.9% w/v NaCl), (3) 5% (w/v)
dextrose, and (4) water.
[0099] The mode of administration of the immunizing compositions of
the present invention may be any suitable delivery means and/or
methods that results in the induction of an immune response in the
subject. Delivery means may include, without limitation, parenteral
administration methods, such as subcutaneous (SC) injection,
intravenous (IV) injection, transdermal, intramuscular (IM),
intradermal (ID), as well as non-parenteral, e.g., oral, nasal,
intravaginal, pulmonary (inhalation), ophthalmic, rectal
administration, or by any other mode that results in the
immunogenic composition contacting mucosal tissues. Preferably,
administration is orally.
[0100] In one embodiment of the present invention, the immunizing
compositions exists as an atomized dispersion for delivery by
inhalation. Various liquid and powder formulations can be prepared
by conventional methods for inhalation into the lungs of the
subject to be treated. The atomized dispersion of the immunizing
compositions typically contains carriers common for atomized or
aerosolized dispersions, such as buffered saline and/or other
compounds well known to those of skill in the art. The delivery of
the immunogenic compositions via inhalation has the effect of
rapidly dispersing the immunizing compositions to a large area of
mucosal tissues as well as quick absorption by the blood for
circulation of the immunizing compositions.
[0101] Additionally, immunizing compositions also exist in a liquid
form. The liquid can be for oral dosage, for ophthalmic or nasal
dosage as drops, or for use as an enema or douche. When the
immunizing composition is formulated as a liquid, the liquid can be
either a solution or a suspension of the immunizing composition.
There are a variety of suitable formulations for the solution or
suspension of the immunizing composition that are well know to
those of skill in the art, depending on the intended use thereof.
Liquid formulations for oral administration prepared in water or
other aqueous vehicles may contain various suspending agents such
as methylcellulose, alginates, tragacanth, pectin, kelgin,
carrageenan, acacia, polyvinylpyrrolidone, and polyvinyl alcohol.
The liquid formulations may also include solutions, emulsions,
syrups and elixirs containing, together with the immunizing
compositions, wetting agents, sweeteners, and coloring and
flavoring agents.
[0102] Delivery of the described immunizing compositions in liquid
form via oral dosage exposes the mucosa of the gastrointestinal and
urogenital tracts to the immunizing compositions. A suitable dose,
stabilized to resist the pH extremes of the stomach, delivers the
immunizing composition to all parts of the gastrointestinal tract,
especially the upper portions thereof. Any methods of stabilizing
the immunizing composition in a liquid oral dosage such that the
effective delivery of the composition is distributed along the
gastrointestinal tract are contemplated for use with the immunizing
compositions described herein, including capsules and a resuspended
buffer solution to protect the attenuated bacteria against the
acidic pH. The particular pharmaceutically acceptable carriers or
diluents employed are not critical to the present invention, and
are conventional in the art. Examples of diluents include: buffers
for buffering against gastric acid in the stomach, such as citrate
buffer (pH 7.0) containing sucrose, bicarbonate buffer (pH 7.0)
alone or bicarbonate buffer (pH 7.0) containing ascorbic acid,
lactose, and optionally aspartame (Levine et al, Lancet, 11:467-470
(1988)). Examples of carriers include: proteins, e.g., as found in
skim milk; sugars, e.g., sucrose; or polyvinylpyrrolidone.
[0103] Delivery of the described immunizing compositions in liquid
form via ophthalmic drops exposes the mucosa of the eyes and
associated tissues to the immunizing compositions. A typical liquid
carrier for eye drops is buffered and contains other compounds well
known and easily identifiable to those of skill in the art.
[0104] Delivery of the described immunizing compositions in liquid
form via nasal drops or aerosol exposes the mucosa of the nose and
sinuses and associated tissues to the immunizing compositions.
Liquid carriers for nasal drops are typically various forms of
buffered saline.
[0105] Injectable formulations of the immunizing compositions may
contain various carriers such as vegetable oils, dimethylacetamide,
dimethylformamide, ethyl lactate, ethyl carbonate, isopropyl
myristate, ethanol, polyols (glycerol, propylene glycol, and liquid
polyethylene glycol) and the like. Physiologically acceptable
excipients may include, for example, 5% dextrose, 0.9% saline,
Ringer's solution or other suitable excipients. Intramuscular
preparations can be dissolved and administered in a pharmaceutical
excipient such as Water-for-Injection, 0.9% saline, or 5% glucose
solution.
[0106] The attenuated S. Paratyphi A strains of the present
invention may be administered to a subject in conjunction with
other suitable pharmacologically or physiologically active agents,
e.g., antigenic and/or other biologically active substances.
[0107] The attenuated S. Paratyphi A strains comprising a
stabilized expression plasmid system may be administered to a
subject prior to, concurrent with, or after expression of the
selected antigen has begun. For example, the attenuated S.
Paratyphi A strain comprising a stabilized expression plasmid
system may be cultured for a period of time prior to administration
to a subject to enable the bacterial to produce sufficient amounts
of the selected antigen, such that an immune response will be
raised to the selected antigen upon administration of the
bacteria.
[0108] The amount and rate of administration of the immunizing
compositions of the present invention may be readily determined by
those of ordinary skill in the art without undue experimentation,
such as by use of conventional antibody titer determination
techniques and conventional bioefficacy/biocompatibility protocols.
The amount and rate of administration will vary based on factors
such as the weight and health of the subject, the identity of the
bacteria being administered to the subject, the identity of the
polypeptide being expressed in those stains engineered to express a
selected antigen, the desired therapeutic effect, the desired time
span of bioactivity, and the mode of administration of the
immunizing composition.
[0109] In general, the amount of an immunizing composition
administered to a subject is an amount sufficient to induce an
immune response in the subject to a S. Paratyphi A strain or to the
selected antigen being expressed by the S. Paratyphi A strain (an
immunologically-effective amount). Preferably, the immune response
is a protective immune response.
[0110] Generally, the dosage employed will contain about 10.sup.2
cfu to 10.sup.10 cfu of the S. Paratyphi A strain, preferably about
10.sup.2 cfu to 10.sup.7 cfu, or about 10.sup.6 cfu to 10.sup.9
cfu. Formulations for oral administration comprise about 10.sup.2
cfu to 10.sup.10 cfu of the S. Paratyphi A strain, preferably about
10.sup.6 cfu to 10.sup.9 cfu, and the formulation is in a capsule
or resuspended in a buffer solution to protect the attenuated
bacteria against the acidic pH in the stomach. Formulations for
nasal administration comprise about 10.sup.2 cfu to 10.sup.10 cfu
of the S. Paratyphi A strain, preferably about 10.sup.2 cfu to
10.sup.7 cfu, and is used for intranasal administration in which
the bacteria is given in drops or in aerosol.
[0111] The immunizing compositions may be administered in a single
dose, or in multiple doses over prolonged periods of time. In
particular, the immunizing compositions may be administered over a
period of one week, two weeks, three weeks, one month, six weeks,
two months, ten weeks, three months, four months, six months, one
year, or for extended periods longer than one year.
[0112] The immunizing compositions may be provided in dosage unit
for uniform dosage and ease of administration. Each dosage unit
form contains a predetermined quantity of the strains of the
present invention calculated to produce a desired immune response,
in association with a pharmaceutically acceptable carrier,
excipient, or other ingredient.
[0113] The present invention also includes a kit comprising one or
more of the immunizing compositions of the present invention, and
optionally means for administering the compositions, and
instructions for administering the compositions.
E. Examples
1. Bacterial Strains and Culturing Conditions
[0114] Escherichia coli strain DH5 alpha was used for all plasmid
constructions. Live attenuated S. Typhi strain CVD 908-htrA harbors
deletion mutations in aroC and aroD, interrupting the aromatic
compound biosynthesis pathway, and htrA, which encodes a stress
response protein (see Infect Immun. 60:2 (1992), pp. 536-541 and J.
Biotechnol. 44:1-3 (1996), pp. 193-196). S. Paratyphi A 9150 lot #
11848 was purchased from the American Type Culture Collection
(Manassas, Va.), and stored as CV 223 and CV 224. CV 223 was used
in all experiments.
[0115] E. coli DH5 alpha was grown using Luria Bertani (LB) liquid
medium or agar (Difco, Detroit, Mich.) supplemented with
antibiotics carbenicillin (carb; 50 .mu.g/ml), kanamycin (kan; 50
.mu.g/ml) or chloramphenicol (cml; 25 .mu.g/ml), where necessary.
CVD 908-htrA and S. Paratyphi A 9150 and its derivatives were grown
with 2.times. soy medium (20 g Hy-soy peptone, 10 g Hy-soy yeast
extract, 3 g NaCl, .+-.15 g of granulated agar (Difco) per liter)
with guanine (0.001% v/v) and antibiotics added where necessary.
Liquid cultures were incubated at 30.degree. C. or 37.degree. C. at
250 rpm for 16-24 hrs unless stated otherwise.
[0116] Modified minimal medium (MMM) used for complementation
analysis was composed of M9 salts (K2HPO4, 7 g/l; KH2PO4, 3 g/l;
(NH4).sub.2SO4, 1 g/l (pH7.5)), 0.5% (w/v) casamino acids (Difco),
0.5% (w/v) glucose, 0.01% (w/v) MgSO4.7H2O, 15 g of granulated agar
(Difco) per liter and 1 .mu.g/ml vitamin Bl.
2. Plasmids and Molecular Genetic Techniques
[0117] Standard techniques were used for the construction of the
plasmids represented here (see, for example, Sambrook et al., 1989
which is herein incorporated by reference in its entirety). Plasmid
extraction and gel purification of DNA fragments were performed
using QIAprep Spin Miniprep and QIAquick Gel Extraction kits,
respectively, as directed by the manufacturer (Qiagen Inc.,
Valencia, Calif.). Plasmids pCR-Blunt II-TOPO (Invitrogen,
Carlsbad, Calif.), pGEM.RTM.-T or pGEM.RTM.-T Easy (Promega,
Madison, Wis.) were used as intermediates for cloning blunt ended
polymerase chain reaction (PCR) products generated with Vent.TM.
DNA Polymerase (New England Biolabs, Ipswich, Mass.). Plasmid
pLowBlu 184 (E. M. Barry, unpublished data; CVD, University of
Maryland, Baltimore) is a low copy number plasmid based on pACYC184
(ATCC) but containing the lactose operon sequence from
pGEM.RTM.-5Zf(+) (2767-273 bp; Promega, Madison, Wis.) in place of
the tetracycline resistance gene between AvaI and HindIII.
Taq-Pro.TM. DNA Polymerase (Denville Sci., Metuchen, N.J.) was used
for lambda Red-mediated mutagenesis, and for diagnostic PCR using 5
ul of a single bacterial colony diluted in 20 .mu.l of sterile
water. Taq-Pro.TM. DNA Polymerase was also used to add to pre-treat
PCR fragments generated by Vent.TM. DNA Polymerase prior to cloning
into pGEM.RTM.-T or pGEM.RTM.-T Easy. All restriction enzymes were
purchased from New England Biolabs. T4 DNA polymerase (NEB) was
used to create blunt ended DNA fragments. Electroporation of
strains was performed in a Gene Pulser apparatus (Bio-Rad) set at
2.5 kV, 200.OMEGA., and 25 .mu.F. Molecular weight markers used in
DNA gel electrophoresis are O'GeneRuler.TM. 1 kb DNA Ladder,
ready-to-use (#SM1163, Fermentas, Hanover, Md.).
3. Lambda Red-Mediated Mutagenesis
[0118] This technique was performed as described by Datsenko and
Wanner (Proc Natl Acad Sci USA. 2000 Jun. 6; 97(12):6640-50), with
certain modifications. Briefly, 10 colonies of bacteria carrying
Red helper plasmid pKD46 (reader is directed to the Datsenko and
Wanner reference for more information about this plasmid) were
added to 20 ml of 2.times. soy media supplemented with
carbenicillin and L-arabinose (0.2%) and grown at 30.degree. C.,
250 rpm for 3 hrs (OD 600 nm of .about.0.6). Bacteria were made
electrocompetent by washing 3 times with cold sterile water and
concentrating 100 fold. Competent cells were electroporated with
100 .eta.g-1 .mu.g of gel-purified PCR product. Following
electroporation, bacteria were repaired using 2.times. soy medium
with or without guanine. Cells were incubated in 2.times. soy media
at 37.degree. C. for 3 hrs prior to plating on 2.times. soy agar
containing guanine and cml overnight. Antibiotic resistant colonies
were selected and screened via PCR for alterations in the
chromosomal regions of interest. Positive colonies were re-streaked
onto 2.times. soy media containing cml, but lacking carbenicillin,
to ensure loss of pKD46. Removal of the cml resistance cassette was
performed as described by Datsenko and Wanner and involved using
pCP20. Colonies exhibiting the desired genotype were re-streaked on
2.times. soy media lacking antibiotics to ensure the loss of the
antibiotic resistance phenotype. Those selected for storage were
re-screened via PCR prior to freezing at -70.degree. C. in 2.times.
soy media containing 20% (v/v) glycerol.
4. Agglutination
[0119] S. Paratyphi A strains were tested with commercially
available sera (Difco.TM. Salmonella 0 Antiserum Group A, Becton
Dickson, Sparks, Md., lot # 4092221). Briefly, a small inoculum of
bacteria taken from a fresh plate was emulsified in 20 .mu.l of PBS
on a glass slide. 5 .mu.l of antisera was added, and the slide
agitated gently until agglutination was observed. S. flexneri
vaccine strain CVD 1208 (J Infect Dis. 2004 Nov. 15;
190(10):1745-54) or E. coli DH5 alpha served as negative control
bacteria.
5. Assessment of Virulence by Intraperitoneal Inoculation of
Mice
[0120] Salmonella virulence was assessed as described previously in
Infect Immun. 2001 August; 69(8):4734-41. Briefly, female BALB/c
mice (Charles River Breeding Laboratories, Inc., Wilmington, Mass.)
aged 6 to 8 weeks (three mice per group, three groups per vaccine
strain) were injected intraperitoneally (i.p.) with various 10-fold
dilutions of the bacteria (grown in the presence of guanine and
antibiotics where necessary, and resuspended in phosphate-buffered
saline PBS) mixed with 10% (wt/vol) hog gastric mucin (Difco, lot
#4092018) in a final volume of 0.5 ml. Mice were monitored for
extreme moribundity (close to death) or death every 24 hr for 72 h
after inoculation. The 50% lethal dose (LD50) for each group of
mice was calculated by linear regression analysis.
6. Construction of a Deletion in guaBA
[0121] The sequencing of the S. Paratyphi A genome was incomplete
at the commencement of this project. Hence, all oligonucleotides
primers and subsequent DNA templates for Lambda Red-mediated
mutagenesis were constructed based on the annotated S. Typhi Ty2
genome sequence (Genbank accession number NC.sub.--004631, Dec. 16,
2004 version). Sequence comparison of the regions mutated in S.
Paratyphi A with those of S. Typhi revealed greater than 99% DNA
sequence identity.
[0122] The genes which encode inosine-5'-monophosphate
dehydrogenase (guaB) and guanosine monophosphate synthetase (guaA)
form an operon and are located at 414059 to 417178 bp on the S.
Typhi Ty2 genome (SEQ ID NO:26; see also U.S. Pat. No. 6,190,669
for detailed information with regard to the guaBA loci). Primers
CVOL 13 and CVOL 15 (Table 1) bind to sequences outside the region
designated for mutation. Primers CVOL 28 and CVOL 32 were designed
to bind to regions of the Lambda Red template plasmid pKD3. The
resulting PCR product encoded a cml resistance cartridge flanked on
either side by a 100 bp of sequence homologous to guaBA at
positions 413846 to 413945 (CVOL 28) and 417109 to 417010 (CVOL 32)
on the S. Typhi Ty2 genome, respectively.
TABLE-US-00001 TABLE 1 SEQ ID Name Sequence.sup.a NO: Target
Region.sup.b CVOL 13 CTGCAGTCATTCCCACTCAATGGTAGC 4 Ty2
417176-417158 CVOL 15 GGAACATCGCACAGCGCA 5 Ty2 413715-413732 CVOL
26 GTGTAGGAGCTGCTTCG 6 pKD3 31-50 CVOL 27 CATATGAATATCCTCCTTAG 7
pKD3 1044-1025 CVOL 28 CGAACCGTCTGGTTAAGGCGGCTTACGGTAAAAAT 8 pKD3
31-50 TGAGGAAGTTTGAGAGGATAACATGTGAGCGGGAT
CAAATTCTAAATCAGCAGGTTATTCAATCGTGTAG GCTGGAGCTGCTTC CVOL 32
TTCATTGATGATGCGGTTGGAAACACGACCCAGGA 9 pKD3 1044-1025
AGTCATACGGCAGGTGCGCCCAGTGCGCGGTCATA
AAGTCGATGGTTTCGACAGCACGCAGAGAGCATAT GAATATCCTCCTTAG CVOL 41
GAAGGAGTATTGCCCATGCTACGTATCG 10 Ty2 414057-414077 CVOL 64
CATATGAAGGAGTATTGCCCATGCT 11 Ty2 414057-414086 ACGTATCGCTAAAGAAG
CVOL 65 ATGCATCTGCAGTCATTCCCACTCAA 12 Ty2 417176-417155 TGGTAGCCGG
CVOL 85 ACAGATAAACGCAAAGATGGCTCGGGCAAA 13 Ty2 2484865-2484836 CVOL
86 TTATTCGCCAGAAGCCTGCGCTTCCGGTTT 14 Ty2 2483597-2483626 CVOL 87
CCTGAGAATGGCATTTGCGTCGTCGTGTGC 15 Ty2 2484929-2484900 CVOL 88
ACGGCGTGTTTACAGGAAAAACGAAAGGGG 16 Ty2 2483520-2483549 CVOL 89
TCATACAGCGGAGAACGAGATAATTTGGCC 17 Ty2 2485740-2485711 CVOL 90
TTACATAAGTAAGTCACTGGGAGGCGCGCT 18 Ty2 2485027-2485056 CVOL 91
TCCATCAGGTTACAATCAGTACAGCAGATT 19 Ty2 2485800-2485771 CVOL 92
TCATTAGTATATACACAAAATCATTCGAGC 20 Ty2 2484961-2484990 CVOL 122
GCGGCCGCGAAGGAGAGACGGAAA 21 Ty2 2485752-2485722
TGTCATACAGCGGAGAACGAG CVOL 123 TCGCGAGAATTCTTACATAAGTAAG 22 Ty2
2485024-2485056 TCACTGGGAGGCGCGCT CVOL 124
GCGGCCGCGAAGGAGTTTGACTCATG 23 Ty2 2484876-2484847
ACAGATAAACGCAAAGATG CVOL 125 CATATGTTATTCGCCAGAAGCC 24 Ty2
2483597-2483626 TGCGCTTCCGGTTT CVOL 128 GCGGCCGCTTACATAAGTAAGT 25
Ty2 2485024-2485056 CACTGGGAGGCGCGCT .sup.aPrimers are listed in 5'
> 3' direction with restriction enzyme cleavage sites
underlined. .sup.bIndicates region of homology to S. Typhi Ty2
genome (genbank accession number NC_004631) or plasmid pKD3
(genbank accession number AY048742).
[0123] S. Paratyphi A 9150 was made electrocompetent and
transformed with pKD46, resulting in strain CV 250. Lambda Red
mutagenesis was performed on CV 250 using the PCR product generated
using primers CVOL 28 and CVOL 32 with template pKD3 containing a
cml resistance marker (see the Datsenko and Wanner reference for
more information about this plasmid). Transformants were plated at
37.degree. C., and those exhibiting cml resistance were screened by
PCR using CVOL 13 and CVOL 15. Unmodified guaBA amplified from S.
Paratyphi A 9150 was found to be .about.3.5 kb (FIG. 1, lane 1),
whereas a .about.1.4 kb fragment was found in two clones with a
mutated guaBA region (FIG. 1, lanes 2 and 3). These mutants were
named CV 411 and CV 412, respectively. Treatment of these mutants
with pCP20 (see Datsenko and Wanner reference for more information
about this plasmid) liberated the cml resistance cartridge. Four
deletants were analyzed by PCR with primers CVOL 13 and CVOL 15 and
found to have a .about.0.5 kb band (FIG. 2, lanes 2-4) in
comparison to a guaBA::cml progenitor (FIG. 2, lane 1). Resulting
guaBA deletants of S. Paratyphi A 9150 were named CV 415-CV 418.
The mutated guaBA region in CV 415 was PCR amplified with CVOL 15
and CVOL 13 and the product sequenced (polynucleotide sequence SEQ
ID NO:1); the 5' and 3' regions of SEQ ID NO:1 are homologous to
guaBA, whereas the center region is homologous to pKD3. Strain CV
415 was chosen for all subsequent studies.
7. In Vitro Complementation of the Deletion in guaBA
[0124] S. Paratyphi A 9150 contains an undefined auxotrophy, making
it incapable of growth on minimal medium without the addition of
casamino acids. ATCC strain 11511 and a CVD S. Paratyphi A isolate
516 are also unable to grow on minimal medium, suggesting that they
contain the same auxotrophy as found in S. Paratyphi A 9150.
[0125] To demonstrate that Lambda Red-mediated mutagenesis only
targeted guaBA in CV 415, a pLowBlu 184-based (low copy number)
plasmid was designed containing a minimal fragment encoding guaBA
under the control of the lactose promoter (P.sub.lacZ). Primers
CVOL 13 and CVOL 41 were used to amplify a .about.3.1 kb fragment
encoding guaBA with an optimized ribosome binding site (GAAGGAG) 8
bp upstream of the start codon using the chromosome of CVD 908-htrA
as a template. This fragment was subcloned into pGEM.RTM.-T Easy
and excised with EcoRI, blunted with T4 DNA polymerase and cloned
into the NotI site of pLowBlu 184 creating pATGguaBA (stored in CV
295).
[0126] CV 415 was electroporated with either pATGguaBA or pLowBlu
184 (control) and plated on 2.times. Soy media containing guanine
and cml, creating strains CV 486 and CV 487, respectively. 2.times.
soy medium lacking guanine is able to support the growth of guaBA
deleted S. Paratyphi A. Single colonies of each were re-streaked
onto MMM containing cml and incubated at 37.degree. C. overnight.
As shown in FIG. 3, CV 486 was able to grow on MMM (plate 2) in
contrast to the control (CV 487; plate 1) indicating the minimal
fragment cloned into pATGguaBA was able to complement the deletion
of guaBA from the chromosome of CV 415.
8. Construction of Secondary Deletions in CV 415
[0127] In order to minimize the reversion of guaBA deleted S.
Paratyphi A 9150 to a wild type (wt) genotype, additional genes
were targeted as secondary attenuating markers. These genes were
clpP and clpX, which encode a serine-protease and a chaperone
ATPase, respectively (reviewed in Structure (Camb). 2004 February;
12(2):175-83). Disruption of clpP and/or clpX has been shown to
significantly reduce the colonization potential of Salmonella
Typhimurium in mice (Infect Immun. 2001 May; 69(5):3164-74). In S.
Typhi Ty2, clpX (SEQ ID NO:39) and clpP (SEQ ID NO:40) are both
located between 2483597 to 2485743 (SEQ ID NO:27) on the
complementary strand of the chromosome, respectively, and are
expressed from individual promoters. Wt S. Paratyphi A 9150 was
also subjected to mutagenesis such that the virulence of mutants
containing single deletions in either clpX or clpP could be
assessed in mice.
[0128] To delete clpX, primers CVOL 85 and 86 were designed to
amplify a .about.1.3 kb fragment encoding clpX lacking a start
codon from CVD 908-htrA. This fragment was column purified,
Taq-Pro.TM. DNA Polymerase treated and cloned into pGEM.RTM.-T
(stored in CV 472). The resulting vector, pGEM.RTM.-T::clpX was
digested with NruI and EcoRI to remove a .about.0.9 kb fragment,
and treated with T4 DNA polymerase to create blunt ends. A cml
cartridge isolated from pCR-Blunt II-TOPO as an EcoRI fragment was
blunted and inserted into pGEM.RTM.-T::clpX. This cml cartridge had
been previously created by PCR using CVOL 25 and CVOL 26 with pKD3
as a template (stored in CV 134). Following ligation and
transformation, PCR was used with primers CVOL 26 and CVOL 85 to
confirm insertion of the cml cartridge in the correct orientation
for Lambda Red mutagenesis. A positive clone was identified, named
pGEM.RTM.-T::(clpX::cml) and stored as CV 481.
[0129] guaBA deleted S. Paratyphi A (CV 415) was transformed with
pKD46 and stored as CV 421. CV 421 and CV 250 (wt S. Paratyphi A
9150 transformed with pKD46) were subjected to Lambda Red
mutagenesis with a .about.1.4 kb PCR product amplified from
pGEM.RTM.-T::(clpX::cml) using CVOL 85 and CVOL 86. Cml resistant
mutants were isolated and screened by PCR with CVOL 87 and CVOL 88,
which bind to regions outside those homologous to CVOL 85 and CVOL
86. Mutants exhibiting a correct PCR profile were selected for
treatment with pCP20 to remove the cml cartridge. FIG. 4 shows that
mutants containing an altered clpX gene exhibited a smaller
.about.0.6 kb band by PCR (Panel A, lanes 1-6) compared to that
found in unaltered S. Paratyphi A 9150 (Panel A, lane 7). PCR
analysis of the same strains with CVOL 13 and 15 confirmed that
guaBA was deleted only from strains derived from CV 415 and not CV
250 (Panel B, lanes 4-6, compared to lanes 1-3 and 7). Mutants
lacking clpX, and both clpX and guaBA, were stored as CV 532 and CV
534, respectively. The mutated clpX region in CV 532 and CV 534 was
PCR amplified with primers CVOL 87 and CVOL 88 and the product
sequenced (SEQ ID NO:2); the 5' and 3' regions of SEQ ID NO:2 are
homologous to clpX, whereas the center region is homologous to
pKD3.
[0130] To delete clpP, CVOL 89 and 90 were designed to amplify a
.about.0.7 kb fragment encoding clpP lacking a start codon from CVD
908-htrA. This fragment was column purified and cloned into
pGEM.RTM.-T, creating pGEM.RTM.-T::c/pP (stored as CV 470).
pGEM.RTM.-T::clpP was digested with PstI and NsiI, T4 DNA
polymerase treated and religated (creating pGEM.RTM.-T::clpPm,
stored as CV 484) in order the remove NdeI and HincII sites from
the vector backbone. pGEM.RTM.-T::clpPm was then digested with NdeI
and HincII to remove DNA fragments totaling .about.0.5 kb in size,
and T4 DNA polymerase treated. Similarly to that abovementioned, a
cml cartridge isolated from pCR-Blunt II-TOPO as an EcoRI fragment
was T4 DNA polymerase treated and used to replace the fragments
removed from pGEM.RTM.-T::clpPm. Following ligation and
transformation, PCR was used with primers CVOL 26 and CVOL 85 to
confirm insertion of the cml cartridge in the correct orientation
for Lambda Red mutagenesis. A positive clone was identified, named
pGEM.RTM.-T::(clpPm::cml) and stored as CV 501.
[0131] Wt and guaBA deleted S. Paratyphi A 9150 containing pKD46
(CV 250 and CV 421, respectively) were subjected to Lambda Red
mutagenesis with a .about.1.4 kb PCR product amplified from
pGEM.RTM.-T::(clpPm::cml) using CVOL 89 and CVOL 90. Cml resistant
mutants were isolated and screened by PCR with CVOL 91 and CVOL 92,
which bind to regions outside those homologous to CVOL 89 and CVOL
90. Mutants exhibiting a correct PCR profile were selected for
treatment with pCP20 to remove the cml cartridge.
[0132] FIG. 5 shows that mutants containing an altered clpP gene
exhibited a smaller .about.0.4 kb band by PCR (Panel A, lanes 1-6)
compared to that found in unaltered S. Paratyphi A 9150 (Panel A,
lane 7). PCR analysis of the same strains using primers CVOL 13 and
15 confirmed that guaBA was deleted only from strains derived from
CV 415 and not from those based on CV 250 (Panel B, lanes 4-6,
compared to lanes 1-3 and 7). Mutants lacking clpP, and both clpP
and guaBA, were stored as CV 528 and CV 530, respectively. The
mutated clpP region in CV 528 and CV 530 were PCR amplified with
primers CVOL 87 and CVOL 88 and the product sequenced
(polynucleotide sequence SEQ ID NO:3); the 5' and 3' regions of SEQ
ID NO:3 are homologous to clpP, whereas the center region is
homologous to pKD3.
9. Construction of Low Copy Plasmids for Complementation
Analysis
[0133] As performed above, to confirm that the Lambda Red-mediated
mutagenesis targeted only specific loci, mono- or bi-cistronic
pLowBlu 184-based (low copy number) plasmids were designed
containing minimal fragments encoding either clpX or clpP, or guaBA
immediately downstream of either clpX or clpP. Constitutive
expression of the genes in these plasmids was directed by
P.sub.lacZ.
[0134] Primers CVOL 64 and CVOL 65 were used to PCR amplify guaBA
from CVD 908-htrA containing an enhanced ribosome binding site with
NdeI and NsiI restriction sites at the 5' and 3' ends,
respectively. The product was column purified and ligated into
pCR-Blunt II-TOPO (stored as CV 394), extracted as a .about.3.5 kb
NdeI-NsiI fragment and cloned into the NdeI and NsiI sites in
pLowBlu 184, creating pguaBAV.2 (stored as CV 482).
[0135] To create a low copy number plasmid encoding clpP, primers
CVOL 122 and CVOL 123 were used to amplify clpP with an enhanced
ribosome binding site from CVD 908-htrA with NotI and NruI sites at
the 5' and 3' ends, respectively. The .about.0.7 kb product was
column purified and ligated into pCR-Blunt II-TOPO (stored as CV
567), extracted as a NotI-NruI fragment and ligated into pLowBlu
184 previously cut with NotI and NdeI, creating pATGclpP (stored as
CV 584). To construct a bi-cistronic plasmid containing clpP and
guaBA, primers CVOL 122 and CVOL 128 were designed to amplify clpP
with an enhanced ribosome binding site from CVD 908-htrA with NotI
sites at both the 5' and 3' ends. The .about.0.7 kb product was
column purified and ligated into pCR-Blunt II-TOPO (stored as CV
600), extracted as a NotI fragment and ligated into pguaBAV.2
previously cut with NotI, creating pATGclpPATGguaBA (stored as CV
603).
[0136] To create a low copy plasmid encoding clpX, primers CVOL 124
and CVOL 125 were used to amplify clpX with an enhanced ribosome
binding site from CVD 908-htrA with NotI and NdeI sites at the 5'
and 3' ends, respectively. The .about.1.3 kb product was column
purified and ligated into pCR-Blunt II-TOPO (stored as CV 569),
extracted as a NotI-NdeI fragment and ligated into either pLowBlu
184 or pguaBAV.2 both previously cut with NotI and NdeI, creating
pATGclpX (stored as CV 582) and pATGclpXATGguaBA (stored as CV
573).
10. Assessment of Virulence of S. Paratyphi A and Mutants in
Mice
[0137] LD.sub.50 studies were performed to compare the virulence of
wt S. Paratyphi A 9150 with that of each mutant in
intraperitoneally injected mice.
[0138] FIG. 6 shows the LD.sub.50 data obtained with the injection
of mice with wt and guaBA deleted S. Paratyphi A. Wt S. Paratyphi A
has an LD.sub.50 value of <10 bacteria per mouse. In contrast,
guaBA deleted S. Paratyphi A had a LD.sub.50 value .about.4.5 logs
greater. Complementation of the guaBA mutant with pLowBlu 184 did
not alter the LD.sub.50 value, whereas transformation with
pATGguaBA restored wt-like virulence.
[0139] FIG. 7 shows the LD.sub.50 data obtained with the injection
of mice with wt S. Paratyphi A, clpX-deleted S. Paratyphi A, or
clpX-guaBA-deleted S. Paratyphi A. The LD.sub.50 values of wt and
guaBA-deleted S. Paratyphi A were consistent with those achieved
previously. clpX-deleted S. Paratyphi A displayed a .about.1 log
greater LD.sub.50 value as compared to the guaBA mutants,
indicating that a deletion in clpX was not as attenuating as that
in guaBA. Complementation of the clpX-deleted or the clpX-guaBA
deleted strains with pLowBlu 184 had no effect, whereas
transformation with pATGclpX and pATGclpXATGguaBA, respectively,
restored wt-like virulence.
[0140] FIG. 8 shows the LD.sub.50 data of mice injected with wt S.
Paratyphi A, clpP-deleted S. Paratyphi A or clpP-guaBA-deleted S.
Paratyphi A. The LD.sub.50 values of wt and guaBA-deleted S.
Paratyphi A were consistent to those achieved previously. As with
the clpX-deleted strain, clpP-deleted S. Paratyphi A exhibited
increased virulence as compared to the guaBA mutant. This indicated
that a deletion in clpP was not as attenuating as that in guaBA.
Complementation of the clpX or the clpX-guaBA-deleted strains with
pLowBlu 184 had no effect on virulence. Transformation of these
strains with pATGclpP and pATGclpPATGguaBA, respectively, did not
completely restore wt virulence. Without being bound by any theory,
regulated expression of clpP, as opposed to unregulated expression
as encoded by pATGclpP and pATGclpPATGguaBA, is required to fully
complement the clpP mutation.
11. S. Paratyphi A Derived Conjugate Vaccine
[0141] Conjugate vaccines are developed and tested as described
herein. A conjugate vaccine comprises O polysaccharide (OPS) of S.
Paratyphi A and a flagellin protein of S. Paratyphi A. In addition,
a conjugate vaccine consists of OPS of S. Paratyphi A and a
flagellin protein of S. Paratyphi A. Even more, a conjugate vaccine
consists essentially of OPS of S. Paratyphi A and a flagellin
protein of S. Paratyphi A.
[0142] A conjugate vaccine comprising a flagellin protein comprises
any known flagellin protein (see, for example, International
Application PCT/US2004/034910 and U.S. 60/512,878, which are
incorporated by reference in their entirety). In particular aspects
of the invention, a flagellin protein is any known flagellin
protein of S. Paratyphi A. In other particular aspects of the
invention, a flagellin protein is phase 1 flagellin (fliC).
[0143] A conjugate vaccine comprising OPS comprises any known OPS
of S. Paratyphi A. In particular aspects of the invention, OPS
belongs to Group A OPS which by definition exhibits immunodominant
epitope 2 and usually also has non-dominant epitopes 1 and 12. The
Salmonella Group A OPS contains a backbone of repeats of
mannosyl-rhamnosyl-galactose to which the dideoxyhexose sugar
paratose is linked alpha-1,3 to the mannose residue. This gives
rise to the immunodominant epitope "2" that defines the OPS of
Salmonella Group A.
[0144] A broad-based vaccine against paratyphoid and typhoid fever
is prepared by including conjugates to prevent S. Paratyphi B
disease, S. Paratyphi C disease, and S. Typhi disease. The
conjugates are made according to the same methods and strategies
described herein of linking the relevant purified OPS to the
homologous phase 1 flagellin protein. Thus, an S. Paratyphi B
conjugate vaccine comprises, consists of, or consists essentially
of Group B OPS conjugated to phase 1 flagella protein "b" (i.e., to
the protein subunit encoded by fliC of S. Paratyphi B). An S.
Paratyphi C conjugate vaccine comprises, consists of, or consists
essentially of Group C1 OPS conjugated to phase 1 flagella protein
"c" (i.e., conjugated to the protein subunit encoded by fliC of S.
Paratyphi C). An S. Typhi conjugate vaccine comprises, consists of,
or consists essentially of Group D OPS conjugated to phase 1
flagella protein "d" (i.e., conjugated to the protein subunit
encoded by fliC of S. Typhi). In addition to the above-described
conjugates being made according to the same methods and strategies,
these conjugates are also administered and manufactured according
the same methods and strategies described herein.
[0145] Conjugation of OPS of S. Paratyphi A and a flagellin protein
of S. Paratyphi A can be carried out by methods known to one of
ordinary skill in the art (see, for example, US Patent Application
Publication No. 20090028889). In particular aspects of the
invention drawn to conjugation of OPS of S. Paratyphi A and a
flagellin protein of S. Paratyphi A, methods for the chemical
conjugation of polypeptides, carbohydrates, and/or lipids are well
known in the art (see, for example, Hermanson. Bioconjugate
Techniques (Academic Press; 1992); Aslam and Dent, eds.
Bioconjugation: Protein coupling Techniques for the Biomedical
Sciences (MacMillan: 1998); and Wong Chemistry of Protein
Conjugation and Cross-linking (CRC Press: 1991)). For example, in
the case of carbohydrate or lipid conjugation, functional amino and
sulfhydryl groups may be incorporated therein by conventional
chemistry. For instance, primary amino groups may be incorporated
by reaction with ethylenediamine in the presence of sodium
cyanoborohydride and sulfhydryls may be introduced by reaction of
cysteamin dihydrochloride followed by reduction with a standard
disulfide reducing agent.
[0146] Heterobifunctional crosslinkers, such as, for example,
sulfosuccinimidyl (4-iodoacetyl) aminobenzoate, which link the
epsilon amino group on the D-lysine residues of copolymers of
D-lysine and D-glutamate to a sulfhydryl side chain from an amino
terminal cysteine residue on the peptide to be coupled, may be used
to increase the ratio of OPS of S. Paratyphi A to a flagellin
protein of S. Paratyphi A and/or a flagellin protein of S.
Paratyphi A. to OPS of S. Paratyphi A in the conjugate.
[0147] OPS of S. Paratyphi A or a flagellin protein of S. Paratyphi
A may contain amino acid side chains such as amino, carbonyl,
hydroxyl, or sulfhydryl groups or aromatic rings that can serve as
sites for conjugation. Residues that have such functional groups
may be added to either OPS of S. Paratyphi A or to a flagellin
protein of S. Paratyphi A. Such residues may be incorporated by
solid phase synthesis techniques or recombinant techniques, both of
which are well known in the art.
[0148] OPS of S. Paratyphi A and a flagellin protein of S.
Paratyphi A may be chemically conjugated using conventional
crosslinking agents such as carbodiimides. Examples of
carbodiimides are 1-cyclohexyl-3-(2-morpholinyl-(4-ethyl)
carbodiimide (CMC), 1-ethyl-3-(3-dimethyaminopropyl) carbodiimide
(EDC), and 1-ethyl-3-(4-azonia-44-dimethylpentyl) carbodiimide.
[0149] Examples of other suitable crosslinking agents are cyanogen
bromide, glutaraldehyde and succinic anhydride. In general, any of
a number of homobifunctional agents including a homobifunctional
aldehyde, a homobifunctional epoxide, a homobifunctional
imidoester, a homobifunctional N-hydroxysuccinimide ester, a
homobifunctional maleimide, a homobifunctional alkyl halide, a
homobifunctional pyridyl disulfide, a homobifunctional aryl halide,
a homobifunctional hydrazide, a homobifunctional diazonium
derivative or a homobifunctional photoreactive compound may be
used. Also included are heterobifunctional compounds, for example,
compounds having an amine-reactive and a sulfhydryl-reactive group,
compounds with an amine-reactive and a photoreactive group, and
compounds with a carbonyl-reactive and a sulfhydryl-reactive
group.
[0150] Specific examples of homobifunctional crosslinking agents
include the bifunctional N-hydroxysuccinimide esters dithiobis
(succinimidylpropionate), disuccinimidyl suberate, and
disuccinimidyl tartarate; the bifunctional imidoesters dimethyl
adipimidate, dimethyl pimelimidate, and dimethyl suberimidate; the
bifunctional sulfhydryl-reactive crosslinkers
1,4-di-[3'-(2'-pyridyldithio) propion-amido]butane,
bismaleimidohexane, and bis-N-maleimido-1,8-octane; the
bifunctional aryl halides 1,5-difluoro-2,4-dinitrobenzene and
4,4'-difluoro-3,3'-dinitrophenylsulfone; bifunctional photoreactive
agents such as bis-[b-(4-azidosalicylamide)ethyl]disulfide; the
bifunctional aldehydes formaldehyde, malondialdehyde,
succinaldehyde, glutaraldehyde, and adiphaldehyde; a bifunctional
epoxied such as 1,4-butaneodiol diglycidyl ether; the bifunctional
hydrazides adipic acid dihydrazide, carbohydrazide, and succinic
acid dihydrazide; the bifunctional diazoniums o-tolidine,
diazotized and bis-diazotized benzidine; the bifunctional
alkylhalides N1N'-ethylene-bis(iodoacetamide),
N1N'-hexamethylene-bis(iodoacetamide),
N1N'-undecamethylene-bis(iodoacetamide), as well as benzylhalides
and halomustards, such as ala'-diiodo-p-xylene sulfonic acid and
tri(2-chloroethyl)amine, respectively.
[0151] Examples of other common heterobifunctional crosslinking
agents that may be used include, but are not limited to, SMCC
(succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate), MBS
(m-maleimidobenzoyl-N-hydroxysuccinimide ester), SIAB
(N-succinimidyl(4-iodacteyl) aminobenzoate), SMPB
(succinimidyl-4-(p-maleimidophenyl)butyrate), GMBS
(N-(-maleimidobutyryloxy)succinimide ester), MPHB
(4-(4-N-maleimidopohenyl) butyric acid hydrazide), M2C2H
(4-(N-maleimidomethyl)cyclohexane-1-carboxyl-hydrazide), SMPT
(succinimidyloxycarbonyl-a-methyl-a-(2-pyridyldithio)toluene), and
SPDP(N-succinimidyl 3-(2-pyridyldithio) propionate). For example,
crosslinking may be accomplished by coupling a carbonyl group to an
amine group or to a hydrazide group by reductive amination.
[0152] In another aspect of the invention, OPS of S. Paratyphi A
and a flagellin protein of S. Paratyphi A are conjugated through
polymers, such as PEG, poly-D-lysine, polyvinyl alcohol,
polyvinylpyrollidone, immunoglobulins, and copolymers of D-lysine
and D-glutamic acid. Conjugation of OPS of S. Paratyphi A to a
flagellin protein of S. Paratyphi A may be achieved in any number
of ways, including involving one or more crosslinking agents and
functional groups on the OPS of S. Paratyphi A and/or a flagellin
protein of S. Paratyphi A. The polymer may be derivatized to
contain functional groups if it does not already possess
appropriate functional groups.
[0153] Without being bound by theory, a conjugate vaccine of the
invention made with OPS will stimulate bactericidal antibodies
(Konadu E et al. Infect Immun 1996; 64(7):2709-15; Maclennan et al.
J. Clin. Invest. 2008; 118:1553-62.) Using a flagellin protein as
the carrier will result in enhanced serum O antibody responses
because of the adjuvant (TLR5 agonist) effect of the flagellin
protein (Feuillet et al. PNAS 2006; 103:12487-92; Gewirtz et al. J.
Immunol. 2001; 167:1882-5; Huleatt et al. Vaccine. 2007;
25:763-75).
12. Vaccination Comprising a Conjugate Comprising OPS and a
Flagellin Protein
[0154] Vaccine strategies are well known in the art and therefore
the vaccination strategy encompassed by the invention does not
limit the invention in any manner. In certain aspects of the
invention, the conjugate vaccine is administered alone in a single
application or administered in sequential applications. In other
aspects of the invention, the conjugate vaccine is administered as
a component of a homologous or heterologous prime/boost regimen. In
particular aspects of the invention drawn to heterologous
prime/boost, a mucosal prime/parenteral boost immunization strategy
is used. For example, an attenuated S. Paratyphi A strain as taught
herein is administered orally and subsequently boosted parentally
with a conjugate vaccine of OPS of S. Paratyphi A and a flagellin
protein of S. Paratyphi A as described herein.
13. Methods of Large-Scale Manufacture of a Flagellin Protein
Derived from S. Paratyphi A
[0155] When generating attenuated vaccines for administration or
for components used to make a conjugation vaccine (including, for
example, OPS and a flagellin protein), attention to the degree of
attenuation must be considered. In regard to large-scale
manufacturing, attenuation is particularly important so as to
ensure safety in the manufacturing process (including, for example,
environmental safety). Manufacturing of an attenuated S. Paratyphi
A of the invention is sufficiently attenuated to ensure safety of
not only administration of the strain, but also manufacturing of
the strain for the production of S. Paratyphi A to derive
components for making a conjugate vaccine.
[0156] In particular aspects of the invention drawn to the S.
Paratyphi A to derive components for making a conjugate vaccine,
the attenuated strain produces, for example, more flagella than
wild-type S. Paratyphi A or causes the export of a flagellin
protein from S. Paratyphi A.
[0157] In certain aspects of the invention, an attenuated strain
that having increased flagella compared to a wild-type strain is
particularly advantageous from at least a manufacturing
perspective. In particular aspects of the invention, an attenuated
S. Paratyphi A strain having one or more mutations described herein
leading to attenuation and hyperflagellation can be used for
manufacturing an oral vaccine and/or components for a conjugate
vaccine. For example, an attenuated strain of S. Paratyphi A having
a mutation in the guaBA loci, the guaB gene, or the guaA gene, and
mutation in the clpP gene produces an attenuated and a
phenotypically hyperflagellated S. Paratyphi A strain (see, for
example, FIG. 9). Methods of purification of a flagellin protein
from whole flagella are known in the art or can be readily modified
by one of ordinary skill in the art using methods know in the art.
For example, by modifying the method of Ibrahim et al.,
purification of flagella is achieved; below pH 3.0, flagella
dissociate into flagellin subunits (Ibrahim et al. J. Clin.
Microbiol. 1985; 22:1040-4. Modern purification methods and clpP
mutants should markedly increase yield and purity of a flagellin
protein used to construct a conjugate vaccine of the invention
(see, for example, Ogushi et al. J. Biol. Chem. 2001; 276:30521-6;
Yoon et al. Infect. Immun. 2008; 76:1282-8).
[0158] In other aspects of the invention, export of a flagellin
protein from an attenuated S. Paratyphi A straine is used to derive
a flagellin protein used to construct a conjugate vaccine of the
invention. For example, a mutation in the fliD gene, flgL gene, or
flgK gene causes export of flagellin monomers into the supernatant.
Therefore, an attenuated S. Paratyphi A strain of the invention has
a mutation in at least the guaBA loci, the guaB gene, or the guaA
gene, and mutation in the fliD gene, flgL gene, or flgK gene.
[0159] In a particular embodiment of the invention, S. Paratyphi A
containing a guaBA mutation and a fliD mutation is made and used to
derive a flagellin protein used to construct a conjugate vaccine of
the invention. The mutation in guaBA has been described herein. The
mutation of the fliD gene can be accomplished by a number of
methods, including for example, knocking out the fliD gene. A
method used to knockout fliD includes, for example, referencing
Table 2, PCR #1 mixed with PCR #2 and then amplified with primers
5F11D and 3FRT-aph in an overlapping PCR, which generates a
kanomycin-resistant fragment that is recovered in, for example,
PSMART-LCAMP TM vector (Lucigen). PCR #3 can also be recovered in
PSMART-LCAMP TM vector, then cut out with BamHI and XhoI, and
inserted into the pSMART-fliD-aph clone cut with BamHI and XhoI.
The final assembled fragment is cut out and electroporated into S.
Paratyphi A carrying pKD46 and selection for kanomycin resistance
according to the method of Datsenko and Wanner, followed by
crossing out the aph cassette, where applicable, using pCP20
according to the method of Datsenko and Wanner (Proc Natl Acad Sci
USA. 2000 Jun. 6; 97(12):6640-50).
TABLE-US-00002 TABLE 2 PCR #1(using 5FliD:
5'-tcacgcacacgctgcaggttgt SEQ ID NO: 41 Salmonella guaBA
tgttgatttc-3' chromosomal 5FliD-rev: 5'-gaacttcGAAGCAGCTCC SEQ ID
NO: 42 template DNA) AGCacctaatgatgaaattgaagccatgc-3' PCR #2 (using
5FRT-aph: 5'-GCTGGAGCTGCTTCgaagt SEQ ID NO: 43 pKD13 template tc-3'
DNA) 3FRT-aph: 5'-ctcgagTTCCGGGGATCCG SEQ ID NO: 44
TCGACCTGCAGTTC-3' PCR #3 (using 3FliD: 5'-GGATCCgctatgaacaagtcct
SEQ ID NO: 45 Salmonella guaBA gataacagaggt-3' chromosomal
3FliD-rev: 5'-CTCGAGttaacgagactc SEQ ID NO: 46 template DNA)
ctggaaagatgctttcggtgaaatctgc-3'
[0160] In addition to the attenuated S. Paratyphi A strains
described herein for vaccination purposes and for deriving a
flagellin protein used as a component of the conjugate vaccine
described herein, these strains can be used to derive OPS that is
used as a component of the conjugate vaccine described herein. The
invention also encompasses any of the foregoing mutations in any
combination that provides for maximum efficacy or manufacturing
results (e.g., any combination of mutations in guaBA loci, the guaB
gene, guaA gene, clpP gene, clpX gene, fliD gene, flgL gene, flgK
gene, or any other mutation described herein can be made in all
possible combinations or variations).
[0161] While the invention has been described with reference to
certain particular examples and embodiments herein, those skilled
in the art will appreciate that various examples and embodiments
can be combined for the purpose of complying with all relevant
patent laws (e.g., methods described in specific examples can be
used to describe particular aspects of the invention and its
operation even though such are not explicitly set forth in
reference thereto).
CITED DOCUMENTS
[0162] The disclosure of references cited herein and the following
references are incorporated herein in their entirety, as are all of
the publications, patents, books, articles and other documents
referred to and set forth throughout this application, whether or
not specifically indicated to be incorporated in their entirety.
[0163] Levine M M, Herrington D, Murphy J R, Morris J G, Losonsky
G, Tall B, Lindberg A, Svenson S, Baqar S, Edwards M F, Stocker B.
Safety, infectivity, immunogenicity and in vivo stability of two
attenuated auxotrophic mutant strains of Salmonella Typhi, 541Ty
and 543Ty, as live oral vaccines in man. J Clin Invest 79:888-902,
1987. [0164] Levine M M, Ferreccio C, Black R E, Chilean Typhoid
Committee, Germanier R. Large-scale field trial of Ty21a live oral
typhoid vaccine in enteric-coated capsule formulation. Lancet
I:1049-1052, 1987. [0165] Ferreccio C, Levine M M, Rodriguez H,
Contreras R, Chilean Typhoid Committee. Comparative efficacy of
two, three, or four doses of Ty21A live oral typhoid vaccine in
enteric-coated capsules: a field trial in an endemic area. J Infect
Dis 159:766-769, 1989. [0166] Levine M M, Ferreccio C, Black R E,
Tacket C O, Germanier R. Progress in vaccines against typhoid
fever. Rev Infect Dis 2 (supplement 3):5552-5567, 1989.
[0167] Van de Verg L, Herrington D A, Murphy J R, Wasserman S S,
Formal S B, Levine M M. Specific IgA secreting cells in peripheral
blood following oral immunization with bivalent Salmonella
Typhi/Shigella sonnei vaccine or infection with pathogenic S.
sonnei in humans. Infect Immun 58:2002-2004, 1990. [0168] Levine M
M, Hone D, Heppner D G, Noriega F, Sriwathana B. Attenuated
Salmonella as carriers for the expression of foreign antigens.
Microecology and Therapy 19:23-32, 1990. [0169] Herrington D A, Van
De Verg L, Formal S B, Hale T L, Tall B D, Cryz S J, Tramont E C,
Levine M M. Studies in volunteers to evaluate candidate Shigella
vaccines: further experience with a bivalent Salmonella
Typhi-Shigella sonnei vaccine and protection conferred by previous
Shigella sonnei disease. Vaccine 8:353-357, 1990. [0170] Cryz S J,
Levine M M, Kaper J B. Randomized double-blind placebo-controlled
trial to evaluate the safety and immunogenicity of the live oral
cholera vaccine strain CVD 103-HgR in adult Swiss. Vaccine
8:577-580, 1990. [0171] Levine M M, Ferreccio C, Cryz S, Ortiz E.
Comparison of enteric-coated capsules and liquid formulation of
Ty21a typhoid vaccine in a randomized controlled field trial.
Lancet 336:891-894, 1990. [0172] Servos S, Chatfield S, Hone D,
Levine M M, Dimitriadis G, Pickard D, Dougan G, Fairweather N,
Charles I. Molecular cloning and characterization of the aroD gene
encoding 3-dehydroguinase from Salmonella Typhi. J Gen Micro
137:147-152, 1990. [0173] Levine M M, Hone D, Tacket C, Ferreccio
C, Cryz S. Clinical and field trials with attenuated Salmonella
Typhi as live oral vaccines and as "carrier vaccines". Res
Microbiol 141:807-816, 1990. [0174] Black R E, Levine M M,
Ferreccio C, Clements M L, Lanata C, Rooney J, Germanier R, and the
Chilean Typhoid Committee. Efficacy of one or two doses of Ty21a
Salmonella Salmonella Typhi vaccine in enteric-coated capsules in a
controlled field trial. Vaccine 8:81-84, 1990. [0175] Tacket C O,
Losonsky G, Taylor D N, Baron L, Kopeck D, Cryz S, Levine M M. Lack
of immune response to the Vi component of a Vi-positive variant of
the Salmonella Typhi live oral vaccine strain Ty21a in volunteer
studies. J Infect Dis 163:901-904, 1991. [0176] Hone D M, Harris A
M, Chatfield S, Dougan G, Levine M M. Construction of
genetically-defined double aro mutants of Salmonella Typhi. Vaccine
9:810-816, 1991. [0177] Tacket C O, Hone D M, Curtiss R III, Kelly
S M, Losonsky G, Guers L, Harris A M, Edelman R, Levine M M.
Comparison of the safety and immunogenicity of .DELTA.aroC
.DELTA.aroD and .DELTA.cya .DELTA.crp Salmonella typhi strains in
adult volunteers. Infect Immun 60:536-541, 1992. [0178] Tacket C O,
Hone D M, Losonsky G, Guers L, Edelman R, Levine M M. Clinical
acceptability and immunogenicity of CVD 908 Salmonella Typhi
vaccine strain. Vaccine 10:443-446, 1992. [0179] Hone D M, Tacket C
O, Harris A M, Kay B, Losonsky G, Levine M M. Evaluation in
volunteers of a candidate live oral attenuated Salmonella Typhi
vaccine. J Clin Invest 90:412-420, 1992. [0180] Olanratmanee T,
Levine M M, Losonsky G A, Thisyakorn U, Cryz S J Jr. Safety and
immunogenicity of Salmonella Typhi Ty21a liquid formulation vaccine
in 4- to 6-year-old Thai children. J Infect Dis 166:451-452, 1992.
[0181] Chatfield S N, Fairweather N, Charles I, Pickard D, Levine M
M, Hone D, Posada M, Strugnell R A, Dougan G. Construction of a
genetically defined Salmonella Typhi Ty2 aroA, aroC mutant for the
engineering of a candidate live oral typhoid-tetanus vaccine.
Vaccine 10:8-11, 1992. [0182] Cryz S J Jr, Vanprapar N, Thisyakorn
U, Olanratamanee T, Losonsky G, Levine M M, Chearskul S. Safety and
immunogenicity of Salmonella Typhi Ty21a vaccine in young children.
Infect Immun 61:1149-115, 1993. [0183] Gonzalez C, Hone D, Noriega
F, Tacket C O, Davis J R, Losonsky G, Nataro J P, Hoffman S, Malik
A, Nardin E, Sztein M B, Heppner D G, Fouts T R, Isibasi A, Levine
M M. Salmonella Typhi strain CVD 908 expressing the
circumsporozoite protein of Plasmodium falciparum: strain
construction, safety and immunogenicity. J Infect Dis 169:927-931,
1994. [0184] Sztein M B, Wasserman S S, Tacket C O, Edelman R, Hone
D, Lindberg A A, Levine MM. Cytokine production patterns and
lymphoproliferative responses in volunteers orally immunized with
attenuated vaccine strains of Salmonella Typhi. J Infect Dis
170:1508-1517, 1994. [0185] Hone D M, Harris A M, Lim V, Levine M
M. Construction and characterization of isogenic O-antigen variants
of Salmonella Typhi. Molec Microbiol 13:525-530, 1994. [0186]
Pickard D, Li J, Roberts M, Maskell D, Hone D, Levine M, Dougan G,
Chatfield S. Characterization of defined ompR mutants of Salmonella
Typhi: ompR is involved in the regulation of Vi polysaccharide
expression. Infect Immun 62:3984-3993, 1994. [0187] Noriega F R,
Wang J Y, Losonsky G, Maneval D R, Hone D M, Levine M M.
Construction and characterization of attenuated .DELTA.aroA
.DELTA.virG Shigella flexneri 2a strain CVD 1203, a prototype live
oral vaccine. Infect Immun 62:5168-5172, 1995. [0188] Gomez-Duarte,
O G, Galen J, Chatfield S N, Rappuoli R, Eidels L, Levine M M.
Expression of fragment C of tetanus toxin fused to a
carboxyl-terminal fragment of diphtheria toxin in Salmonella Typhi
CVD 908 vaccine strain. Vaccine 13:1596-1602, 1995. [0189] Cryz S J
Jr, Que J U, Levine M M, Wiedermann G, Kollaritsch H. Safety and
immunogenicity of a live oral bivalent typhoid fever (Salmonella
Typhi-Ty21a) cholera (Vibrio cholerae CVD 103-HgR) vaccine in
healthy adults. Infect Immun 63:1336-1339, 1995. [0190] Sztein M B,
Tanner M K, Polotsky Y, Orenstein J M, Levine M M. Cytotoxic T
lymphocytes after oral immunization with attenuated strains of
Salmonella Typhi in humans. J Immunol 155:3987-3993, 1995. [0191]
Levine M M, Galen J, Barry E, Noriega F, Chatfield S, Dougan G,
Tacket C. Attenuated Salmonella as live oral vaccines against
typhoid fever and as live vectors. J Biotechnology 44:193-196,
1995. [0192] Noriega F R, Losonsky G, Wang J Y, Formal S B, Levine
M M. Further characterization of .DELTA.aroA, .DELTA.virG Shigella
flexneri 2a strain CVD 1203 as a mucosal Shigella vaccine and as a
live vector for delivering antigens of enterotoxigenic Escherichia
coli. Infect Immun 64:23-27, 1996. [0193] Noriega F R, Losonsky G,
Lauderebaugh C, Liao F M, Wang J Y, Levine M M. Engineered AguaBA
AvirG Shigella flexneri 2a strain CVD 1205: construction, safety,
immunogenicity, and potential efficacy as a mucosal vaccine. Infect
Immun 64:3055-3061, 1996. [0194] Kotloff K, Noriega F, Losonsky G,
Sztein M B, Nataro J P, Levine M M. Safety, immunogenicity and
transmissibility in humans of CVD 1203, a live oral Shigella
flexneri 2a vaccine candidate attenuated by deletions in aroA and
virG. Infect Immun 64:4542-4548, 1996. [0195] Barry E M,
Gomez-Duarte O, Chatfield S, Rappuoli R, Losonsky G A, Galen J E,
Levine M M. Expression and immunogenicity of pertussis toxin S1
subunit-tetanus toxin fragment C fusions in Salmonella Typhi
vaccine strain CVD 908. Infect Immun 64:4172-4181, 1996. [0196]
Tacket C O, Sztein M B, Losonsky G A, Wasserman S S, Nataro J P,
Edelman R, Galen J E, Pickard D, Dougan G, Chatfield S N, Levine M
M. Safety of live oral Salmonella Typhi vaccine strains with
deletions in htrA and aroC aroD and immune response in humans.
Infect Immun 65:452-456, 1997. [0197] Levine M M, Galen J, Barry E,
Noriega F, Tacket C, Sztein M, Chatfield S, Dougan G, Losonsky G,
Kotloff K. Attenuated Salmonella Typhi and Shigella as live oral
vaccines and as live vectors. Behring Inst Mitt 98:120-123, 1997.
[0198] Tacket C O, Kelly S M, Schodel F, Losonsky G, Nataro J P,
Edelman R, Levine M M, Curtiss R III. Safety and immunogenicity in
humans of an attenuated Salmonella Typhivaccine vector strain
expressing plasmid-encoded hepatitis B antigens stabilized by the
Asd-balanced lethal system. Infect Immun 65:3381-3385, 1997. [0199]
Gonzalez CR, Noriega F R, Huerta S, Santiago A, Vega M, Paniagua J,
Ortiz-Navarrete V, Isibasi A, Levine M M. Immunogenicity of a
Salmonella Typhi CVD 908 candidate vaccine strain expressing the
major surface protein gp63 of Leishmania mexicana mexicana. Vaccine
16:9/10 1043-1052, 1998. [0200] Orr N, Galen J E, Levine M M.
Expression and immunogenicity of a mutant diphtheria toxin
molecule, CRM197, and its fragments in Salmonella Typhi vaccine
strain CVD 908-htrA. Infect Immun 67:4290-4294, 1999. [0201] Levine
M M, Ferreccio C, Abrego P, San Martin O, Ortiz E, Cryz S C.
Duration of efficacy of Ty21a, attenuated Salmonella Typhi live
oral vaccine. Vaccine 17:2 Supplement S22-S27, 1999. [0202] Pasetti
M F, Anderson R J, Noriega F R, Levine M M, Sztein M B. Attenuated
.DELTA.guaBA Salmonella Typhi vaccine strain CVD 915 as a live
vector utilizing prokaryotic or eukaryotic expression systems to
deliver foreign antigens and elicit immune responses. Clin Immun
92:76-89, 1999. [0203] Galen J E, Nair J, Wang J Y, Tanner M K,
Sztein M B, Levine M M. Optimization of plasmid maintenance in the
attenuated live vector vaccine Salmonella Typhi strain CVD
908-htrA. Infect Immun 67:6424-6433, 1999. [0204] Kotloff K L,
Noriega F R, Samandari T, Sztein M B, Losonsky G A, Nataro J P,
Picking W D, Levine M M. Shigella flexneri 2a strain CVD 1207 with
specific deletions in virG, sen, set and guaBA is highly attenuated
in humans. Infect Immun 68:1034-39, 2000. [0205] Tacket C O, Sztein
M B, Wasserman S S, Losonsky G, Kotloff K L, Wyant T L, Nataro J P,
Edelman R, Perry J, Bedford P, Brown D, Chatfield S, Dougan G,
Levine M M. Phase 2 clinical trial of attenuated Salmonella
enterica serovar Typhi oral live vector vaccine CVD 908-htrA in
U.S. volunteers. Infect Immun 68:1196-1201, 2000. [0206] Anderson R
J, Pasetti M F, Sztein M B, Levine M M, Noriega F R. .DELTA.guaBA
attenuated Shigella flexneri 2a strain CVD 1204 as a Shigella
vaccine and as a live mucosal delivery system for fragment C of
tetanus toxin. Vaccine 18:2193-2202, 2000. [0207] Tacket C O, Galen
J, Sztein M B, Losonsky G, Wyant T L, Nataro J, Wasserman S S,
Edelman R, Chatfield S, Dougan G, Levine M M. Safety and immune
responses to attenuated Salmonella enterica serovar Typhi oral live
vector vaccines expressing tetanus toxin fragment C. Clin Immuno
197:146-153, 2000. [0208] Pasetti M F, Tanner M K, Pickett T E,
Levine M M, Sztein M. Mechanisms and cellular events associated
with the priming of mucosal and systemic immune responses to
Salmonella enterica serovar Typhi live vector vaccines delivered
intranasally in the murine model. Vaccine 18:3208-3213, 2000.
[0209] Wu S, Beier M, Sztein M, Galen J E, Pickett T, Holder A A,
Gomez-Duarte O, Levine MM. Construction and immunogenicity in mice
of attenuated Salmonella Typhi expressing Plasmodium falciparum
merozoite surface protein (MSP-1) fused to tetanus toxin fragment
C. J. Biotechnol. 83:125-135, 2000. [0210] Wang J Y, Noriega F R,
Galen J E, Barry E, Levine M M. Constitutive expression of the Vi
polysaccharide capsular antigen in attenuated Salmonella enterica
serovar Typhi oral vaccine strain CVD 909. Infect Immun
68:4647-4652, 2000. [0211] Koprowski H II, Levine M M, Anderson R
A, Losonsky G, Pizza M, Barry E M. Attenuated Shigella flexneri 2a
vaccine strain CVD 1204 expressing colonization factor antigen I
and mutant heat-labile enterotoxin of enterotoxigenic Escherichia
coli. Infect Immun 68:4884-92, 2000. [0212] Gomez-Duarte O, Pasetti
M, Santiago A, Sztein M B, Hoffman S L, Levine M M. Expression,
secretion and immunogenicity of the Plasmodium falciparum SSP-2
protein in Salmonella vaccine strains by a type I secretion system.
Infect Immun 69:1192-1198, 2001. [0213] Orr N, Galen J E, Levine M
M. Novel use of anaerobically induced promoter, dmsA, for
controlled expression of Fragment C of tetanus toxin in live
attenuated Salmonella enterica serovar Typhi strain CVD 908-htrA.
Vaccine 19:1694-1700, 2001. [0214] Altboum Z, Barry E M, Losonsky
G, Galen J E, Levine M M. Attenuated Shigella flexneri 2a
.DELTA.guaBA strain CVD 1204 expressing ETEC CS2 and CS3 fimbriae
as a live mucosal vaccine against Shigella and enterotoxigenic
Escherichia coli infection. Infect Immun 69:3150-8, 2001. [0215]
Wang J Y, Pasetti M F, Noriega F R, Anderson R S, Wasserman S S,
Galen J E, Sztein M B, Levine M M. Construction, genotypic and
phenotypic characterization, and immunogenicity of attenuated
.DELTA.guaBA Salmonella enterica serovar Typhi strain CVD 915.
Infect Immun 69:4734-4741, 2001. [0216] Galen J E, Levine M M. Can
a "flawless" live vector vaccine strain be engineered? Trends
Microbiol 9:372-376, 2001. [0217] Kotloff K L, Taylor D N, Sztein M
B, Wasserman S S, Losonsky G A, Nataro J P, Venkatesan M, Hartman
A, Picking W D, Katz D E, Campbell J D, Levine M M, Hale T L. Phase
I evaluation of .DELTA.virG Shigella sonnei live, attenuated, oral
vaccine strain WRSS1 in healthy adults. Infect Immun 70:2016-21,
2002. [0218] Pasetti, M, Levine M M, Sztein M B. Animal models
paving the way for clinical trials of attenuated Salmonella
enterica serovar Typhi live oral vaccines and live vectors.
Vaccine. 21:401-18, 2003. [0219] Pasetti M F, Barry E M, Losonsky
G, Singh M, Medina-Moreno, S M, Polo J M, Robinson H, Sztein M B,
Levine M M. Attenuated Salmonella enterica serovar Typhi and
Shigella flexneri 2a strains mucosally deliver DNA vaccines
encoding measles virus hemagglutinin, inducing specific immune
responses and protection in cotton rats. J Virol 77:5209-5217,
2003. [0220] Salerno-Goncalves R, Wyant T L, Pasetti M F,
Fernandez-Vina M, Tacket C O, Levine M M, Sztein M B. Concomitant
Induction of CD4(+) and CD8(+) T Cell Responses in Volunteers
Immunized with Salmonella enterica Serovar Typhi Strain CVD
908-htrA. J 1 mmol. 170:2734-2741, 2003. [0221] Tacket C O, Pasetti
M F, Sztein, M B, Livio S, Levine M M. Immune responses to an oral
Typhoid vaccine strain modified to constitutively express Vi
capsular polysaccharide. J Infect Dis, 190:565-570, 2004. [0222]
Vindurampulle C J, Cuberos L F, Barry E M, Pasetti M F, Levine M M.
Recombinant Salmonella enterica serovar Typhi in a prime-boost
strategy. Vaccine 22(27-28):3744-3750, 2004. [0223] Capozzo A V,
Cuberos L, Levine M M, Pasetti M F. Mucosally delivered Salmonella
live vector vaccines elicit potent immune responses against a
foreign antigen in neonatal mice born to naive and immune mothers.
Infect Immun 72:4637-4646, 2004. [0224] Kotloff K L, Pasetti M F,
Barry E M, Nataro J P, Wasserman S S, Sztein M B, Picking W D,
Levine M M. Deletion in the Shigella enterotoxin genes further
attenuates Shigella flexneri 2a bearing guanine auxotrophy in a
Phase 1 trial of CVD 1204 and CVD 1208. J Infect Dis 190:1745-1754,
2004. [0225] Galen J E, Zhao L, Chinchilla M, Wang J Y, Pasetti M
F, Green J, Levine M M. Adaptation of the endogenous Salmonella
enterica serovar Typhi clyA-encoded hemolysin for antigen export
enhances the immunogenicity of anthrax protective antigen domain 4
expressed by the attenuated live vector vaccine strain CVD
908-htrA. Infect Immun 72:7096-7106, 2004.
Sequence CWU 1
1
501489DNAArtificial Sequencechemically-synthesized mutated guaBA
region 1ggaacatcgc acagcgcacc tgagcggtat cgtctttgag cgtaaagtac
cagtggcccg 60acgcaggctg cgtgaaatta gaaatctcgc cgctgatcca tacctgtccc
atctcctgtt 120ctaacagcag acgaaccgtc tggttaaggc ggcttacggt
aaaaattgag gaagtttgag 180aggataacat gtgagcggga tcaaattcta
aatcagcagg ttattcaatc ggtgtaggct 240ggagcctgct tcgaagttcc
tatactttct agagaatagg aacttcggaa taggaactaa 300ggaggatatt
catatgctct ctctctgcgt gctgtcgaaa ccatcgactt tatgaccgcg
360cactgggcgc acctgccgta tgacttcctg ggtcgtgttt ccaaccgcat
catcaatgaa 420gtcaacggga tttcccgtgt ggtgtatgac atcagcggta
aaccaccggc taccattgag 480tgggaatga 4892634DNAArtificial
Sequencechemically-synthesized mutated clpX region 2cctgagaatg
gcatttgcgt cgtcgtgtgc ggcacaaaga acaaagaaga ggttttgact 60catgacagat
aaacgcaaag atggctcggg caaattgttg tactgctctt tttgcggcaa
120aagccagcat gaagtgcgca agctgattgc cggtccatcc gtgtatatct
gcgacgaatg 180cgtcgattta tgtaacgaca ttattcgcgc ccttatatat
atgcggccgc tgtaggctgg 240agctgcttcg aagttcctat actttctaga
gaataggaac ttcggaatag gaactaagga 300ggatattcat atggcgcgcc
tataagggcg aattccgtga cgaagcgctg aacgctatcg 360ccaggaaagc
aatggcgcgt aaaaccggtg cccgtggtct gcgttctatc gtcgaagcgg
420cgctgctgga taccatgtac gatttgccat ctatggaaga cgtcgaaaaa
gtggtgatcg 480acgagtccgt tattgccggt cagagtaagc cgttgctgat
ttacggcaaa ccggaagcgc 540aggcttctgg cgaataatta aacattcata
caatcagtta gccaaaaaag gggggatttt 600atctcccctt tcgtttttcc
tgtaaacacg ccgt 6343370DNAArtificial Sequencechemically-synthesized
mutated clpP region 3tccatcaggt tacaatcagt acagcaggtt ttttcaattt
ttatccagga gacggaaatg 60tcatacagcg gagaacgaga taatttggcc cctcatatat
gaatatcctc cttagttcct 120attccgaagt tcctattctc tagaaagtat
aggaacttcg aagcagctcc agcctacacg 180ctaggactca attttgaccc
atcgtaattg atgccctgga cgcaagtgtg ccgctataca 240cttcatcctt
cacgctacct cggtgttggt tgccagcgcg cctcccggtg acttacttat
300gtaagcgcct gcggagtcgc cgagttgccg ccttgatgta gctcgaatga
ttttgtgtat 360atactaatga 370427DNAArtificial
Sequencechemically-synthesized oligonucleotide primer 4ctgcagtcat
tcccactcaa tggtagc 27518DNAArtificial
Sequencechemically-synthesized oligonucleotide primer 5ggaacatcgc
acagcgca 18617DNAArtificial Sequencechemically-synthesized
oligonucleotide primer 6gtgtaggagc tgcttcg 17720DNAArtificial
Sequencechemically-synthesized oligonucleotide primer 7catatgaata
tcctccttag 208119DNAArtificial Sequencechemically-synthesized
oligonucleotide primer 8cgaaccgtct ggttaaggcg gcttacggta aaaattgagg
aagtttgaga ggataacatg 60tgagcgggat caaattctaa atcagcaggt tattcaatcg
tgtaggctgg agctgcttc 1199120DNAArtificial
Sequencechemically-synthesized oligonucleotide primer 9ttcattgatg
atgcggttgg aaacacgacc caggaagtca tacggcaggt gcgcccagtg 60cgcggtcata
aagtcgatgg tttcgacagc acgcagagag catatgaata tcctccttag
1201028DNAArtificial Sequencechemically-synthesized oligonucleotide
primer 10gaaggagtat tgcccatgct acgtatcg 281142DNAArtificial
Sequencechemically-synthesized oligonucleotide primer 11catatgaagg
agtattgccc atgctacgta tcgctaaaga ag 421236DNAArtificial
Sequencechemically-synthesized oligonucleotide primer 12atgcatctgc
agtcattccc actcaatggt agccgg 361330DNAArtificial
Sequencechemically-synthesized oligonucleotide primer 13acagataaac
gcaaagatgg ctcgggcaaa 301430DNAArtificial
Sequencechemically-synthesized oligonucleotide primer 14ttattcgcca
gaagcctgcg cttccggttt 301530DNAArtificial
Sequencechemically-synthesized oligonucleotide primer 15cctgagaatg
gcatttgcgt cgtcgtgtgc 301630DNAArtificial
Sequencechemically-synthesized oligonucleotide primer 16acggcgtgtt
tacaggaaaa acgaaagggg 301730DNAArtificial
Sequencechemically-synthesized oligonucleotide primer 17tcatacagcg
gagaacgaga taatttggcc 301830DNAArtificial
Sequencechemically-synthesized oligonucleotide primer 18ttacataagt
aagtcactgg gaggcgcgct 301930DNAArtificial
Sequencechemically-synthesized oligonucleotide primer 19tccatcaggt
tacaatcagt acagcagatt 302030DNAArtificial
Sequencechemically-synthesized oligonucleotide primer 20tcattagtat
atacacaaaa tcattcgagc 302145DNAArtificial
Sequencechemically-synthesized oligonucleotide primer 21gcggccgcga
aggagagacg gaaatgtcat acagcggaga acgag 452242DNAArtificial
Sequencechemically-synthesized oligonucleotide primer 22tcgcgagaat
tcttacataa gtaagtcact gggaggcgcg ct 422345DNAArtificial
Sequencechemically-synthesized oligonucleotide primer 23gcggccgcga
aggagtttga ctcatgacag ataaacgcaa agatg 452436DNAArtificial
Sequencechemically-synthesized oligonucleotide primer 24catatgttat
tcgccagaag cctgcgcttc cggttt 362538DNAArtificial
Sequencechemically-synthesized oligonucleotide primer 25gcggccgctt
acataagtaa gtcactggga ggcgcgct 38263120DNASalmonella Typhi Ty2
26ttgcccatgc tacgtatcgc taaagaagcc ctgacgtttg acgacgtcct ccttgttccc
60gctcactcca ccgttttgcc gaatactgct gatctcagca cgcagttgac gaaaactatt
120cgtctgaata ttcctatgct ttctgcggcg atggacaccg tgacggaagc
gcgcctggca 180attgccctgg cccaggaagg cggcatcggt tttatccaca
aaaacatgtc tattgagcgc 240caggcggaag aagttcgccg cgtgaagaaa
cacgagtccg gcgtagtgac cgacccgcag 300accgtcctgc caaccaccac
gttgcatgaa gtgaaagccc tgaccgagcg taacggtttt 360gcgggctatc
cggtggtgac tgaagataac gagctggtgg gtatcatcac cggtcgtgac
420gtgcgttttg tgactgacct gaaccagccg gtgagtgttt acatgacgcc
gaaagagcgt 480ctggtgaccg ttcgtgaagg cgaagcccgt gaagtcgtgc
tggcaaaaat gcacgaaaaa 540cgcgtagaaa aagcgctggt cgttgatgat
aacttccatc tgcttggcat gattaccgta 600aaagatttcc agaaagcgga
acgtaaacca aactcctgta aagatgagca gggccgttta 660cgtgtcggcg
cggcggtcgg cgcaggcgcg ggcaacgaag agcgcgttga cgcgctggtg
720gcggcaggcg ttgacgtcct gctgatcgac tcttctcacg gtcactctga
aggcgtgttg 780caacgtatcc gtgaaacccg tgctaaatat cctgacctgc
aaatcatcgg cggcaacgtc 840gcgacgggcg caggcgctcg cgcactggcg
gaagccggtt gcagcgcggt gaaagtcggt 900atcggcccgg gttccatctg
taccactcgt atcgtgactg gcgtgggcgt tccgcagatt 960accgctgttt
ctgacgcagt tgaagcgctg gaaggcaccg ggattccggt tatcgctgac
1020ggcggtatcc gtttctccgg cgacatcgcc aaagccatcg ccgcaggcgc
gagcgctgtc 1080atggtcggtt ctatgctggc gggtaccgaa gaatccccgg
gcgaaatcga actctaccag 1140ggccgttctt acaaatctta ccgcggcatg
ggctcgctgg gcgcgatgtc caaaggttcc 1200tctgaccgtt acttccagag
cgacaacgcc gccgacaaac tggtgccgga aggtatcgaa 1260ggccgcgtag
cctataaagg tcgcctgaaa gagatcattc accagcagat gggcggcctg
1320cgctcctgta tggggctgac cggttgtgct accatcgacg aactgcgtac
taaagcggag 1380tttgtgcgta tcagcggtgc gggtatccag gaaagccacg
ttcacgacgt gaccatcacc 1440aaagagtccc cgaactaccg tctgggctcc
tgattttctt cgcccgacct tcgcgtcggg 1500cgatttattt aatctgtttc
acttgcctcg gaataagcgt caatgacgga aaacattcat 1560aagcatcgca
tcctcattct ggacttcggt tctcagtaca ctcaactggt tgcgcgccgc
1620gtgcgtgagc tgggtgttta ctgcgaactg tgggcgtggg atgtgacaga
agcacaaatt 1680cgtgacttca acccaagcgg cattattctt tccggcggcc
cggaaagcac caccgaagaa 1740aacagcccgc gcgcgccgca gtatgtcttt
gaagcaggcg tgccggtatt tggcgtctgc 1800tacgggatgc agaccatggc
gatgcagctt ggcggtcatg tagaaggttc taatgagcgt 1860gaatttggtt
acgcgcaggt cgaagtgctg accgacagcg cgctggttcg cggtattgaa
1920gattccctga ccgccgacgg caaaccgctg ctggacgtgt ggatgagcca
cggcgataaa 1980gtgacggcga ttccgtccga cttcgtgacc gtagccagca
ccgaaagctg cccgttcgcc 2040atcatggcta acgaagaaaa acgcttctac
ggcgtacagt tccacccgga agtgactcac 2100acccgccagg gtatgcgcat
gctggagcgt tttgtgcgtg atatctgcca gtgtgaagcc 2160ctgtggacgc
cggcgaagat catcgacgac gccgtggcgc gcattcgcga gcaggtaggc
2220gacgataaag tgatcctcgg tctctccggc ggcgtggatt cttccgtaac
cgcaatgctg 2280ctgcaccgcg cgatcggtaa aaatctgacc tgtgtattcg
tcgacaacgg cctgctgcgt 2340ctcaacgaag ccgagcaggt gatggacatg
tttggcgacc attttggtct gaacatcgtt 2400cacgtaccgg cagaagatcg
cttcctgtcc gcgttggctg gcgaaaacga tccggaagcg 2460aagcgtaaga
tcattggccg tgtttttgtg gaagtgttcg acgaagaagc gttgaaactg
2520gaagacgtga aatggctggc gcagggcacc atctaccctg acgtcatcga
atctgcggcg 2580tctgcaaccg gtaaagcgca cgtcatcaaa tctcaccaca
atgttggcgg cctgccgaaa 2640gagatgaaga tggggctggt tgaaccgctg
aaagagctgt tcaaagacga agtgcgtaag 2700attggtctgg agctgggcct
gccgtacgac atgctgtacc gtcatccgtt cccggggccg 2760ggcctcggcg
tacgtgtact gggtgaagtg aagaaagagt actgcgacct gctgcgccgt
2820gctgatgcca tcttcattga agagctgcgt aaggcggatc tgtacgacaa
agtcagccag 2880gcgttcaccg tcttcctgcc agtacgctcc gttggcgtaa
tgggcgatgg tcgtaagtac 2940gattgggtgg tctctctgcg tgctgtcgaa
accatcgact ttatgaccgc gcactgggcg 3000cacctgccgt atgacttcct
gggtcgtgtt tccaaccgca tcatcaatga agtcaacggg 3060atttcccgtg
tggtgtatga catcagcggt aaaccaccgg ctaccattga gtgggaataa
3120272147DNASalmonella Typhi Ty2 27ttattcgcca gaagcctgcg
cttccggttt gccgtaaatc agcaacggct tactctgacc 60ggcaataacg gactcgtcaa
tcaccacttt ttcgacgtct tccatagatg gcaaatcgta 120catggtatcc
agcagcgccg cttcgacgat agaacgcagg ccacgggcac cagttttacg
180cgccatcgct ttcctggcga tagcgttcag cgcttcgtca cggaattcca
gatcgacgcc 240ttccaggtta aacagcgcct gatactgctt ggtcagcgca
tttttcggct ctttcaggat 300ttgaaccagc gcttcttcgc tgagttcgtt
cagcgtcgcc accactggca gacgaccgat 360aaactcagga atcagaccaa
atttgatcaa atcttccggt tcaacctgcg acaacagctc 420gccttcactg
gctttgtcgg acttcgcttt caccgtcgcg ccaaaaccaa tgccggagcc
480ggtttcaaca cggttagcga tcactttatc cagaccggca aacgcgccgc
cgcagataaa 540cagaatctta gaggtatcta cctgtaagaa ctcctgctgc
ggatgtttgc gaccgccctg 600cggtggaacc gcggcgacgg tgccttcgat
cagtttcagc aacgcctgct gtacgccttc 660gccggaaaca tcgcgggtaa
tggacggatt gtctgattta cgcgaaatct tatcgatttc 720atcaatgtag
acaatcccac gctgcgcttt ttgcacgtcg tagtcgcatt tctgcaacag
780tttctgaatg atattctcga cgtcttcccc cacgtaaccc gcttcggtca
gcgtggtcgc 840atccgccata gtgaacggca catccagcaa gcgcgccagc
gtttccgcca gcagcgtttt 900accggaaccg gtcggtccag tcagcagaat
gttgcttttg cctaactcga cgccattgct 960ggtatcgccg ttacgcagac
gcttgtagtg gttatagacc gccaccgcca gcactttttt 1020cgcctgctcc
tggccgataa cgtaatcgtc caggtgagta cgaatttcat gcggcgtcgg
1080cagcgcacta cgttcacggt gcggagcaac ttctttaatt tcttcgcgaa
taatgtcgtt 1140acataaatcg acgcattcgt cgcagatata cacggatgga
ccggcaatca gcttgcgcac 1200ttcatgctgg cttttgccgc aaaaagagca
gtacaacaat ttgcccgagc catctttgcg 1260tttatctgtc atgagtcaaa
acctcttctt tgttctttgt gccgcacacg acgacgcaaa 1320tgccattctc
aggcgcaagc cgctaatcag cgttgtgccg cccttcatta gtatatacac
1380aaaatcattc gagctacatc aaggcggcaa ctcagcgact ccgcaggcgc
ttacataagt 1440aagtcactgg gaggcgcgct ggcaaccaac accgaggtag
cgtgaaggat gaagtgtata 1500gcggcacact tgcgtccagg gcatcaatta
cgatgggtca aaattgagtc aaccaaaccg 1560tactctaccg cttcaggcgc
ggagaggaag cgatcgcgct cagtatcacg ttcaatctgc 1620tcaagagatt
gacccgtatg atgcgccata agttcattca tgcgcccttt tactttcaaa
1680atttcgcggg cgtgaatttc aatatccgtc gcctggccct gatagccgcc
cagcggctgg 1740tggatcatga cgcgagagtt cggcaagcag aaacgtttgc
ctttcgcccc ggcagtcagc 1800agaaacgccc ccatagaggc cgcctgtccc
atacaaatgg tgctgacgtc tggcttaata 1860aactgcatgg tgtcatagat
ggacatcccc gcagtaatta cgccgccagg agaattaatg 1920tacagataga
tatctttttc cgggttttcc gcttccagga acagcatctg cgccacgatc
1980aggttagcca tatggtcttc gacctggccg gtcagaaata tgacgcgttc
cttaagtaga 2040cgagaataga tatcaaaaga gcgctcaccg cgtgaggtct
gttcaatgac catcggcacc 2100agcgccatat gaggggccaa attatctcgt
tctccgctgt atgacat 214728687DNAE. coli 28cctagggcca gcaaaaggcc
aggaaccgta aaaaggccgc gttgctggcg tttttccata 60ggctccgccc ccctgacgag
catcacaaaa atcgacgctc aagtcagagg tggcgaaacc 120cgacaggact
ataaagatac caggcgtttc cccctggaag ctccctcgtg cgctctcctg
180ttccgaccct gccgcttacc ggatacctgt ccgcctttct cccttcggga
agcgtggcgc 240tttctcatag ctcacgctgt aggtatctca gttcggtgta
ggtcgttcgc tccaagctgg 300gctgtgtgca cgaacccccc gttcagcccg
accgctgcgc cttatccggt aactatcgtc 360ttgagtccaa cccggtaaga
cacgacttat cgccactggc agcagccact ggtaacagga 420ttagcagagc
gaggtatgta ggcggtgcta cagagttctt gaagtggtgg cctaactacg
480gctacactag aaggacagta tttggtatct gcgctctgct gaagccagtt
accttcggaa 540aaagagttgg tagctcttga tccggcaaac aaaccaccgc
tggtagcggt ggtttttttg 600tttgcaagca gcagattacg cgcagaaaaa
aaggatctca agaagatcct ttgatctttt 660ctacggggtc tgacgctcag tagatct
68729635DNASalmonella typhimurium 29cctaggagat acttaacagg
gaagtgagag ggccgcggca aagccgtttt tccataggct 60ccgcccccct gacaagcatc
acgaaatctg acgctcaaat cagtggtggc gaaacccgac 120aggactataa
agataccagg cgtttccccc tggcggctcc ctcgtgcgct ctcctgttcc
180tgcctttcgg tttaccggtg tcattccgct gttatggccg cgtttgtctc
attccacgcc 240tgacactcag ttccgggtag gcagttcgct ccaagctgga
ctgtatgcac gaaccccccg 300ttcagtccga ccgctgcgcc ttatccggta
actatcgtct tgagtccaac ccggaaagac 360atgcaaaagc accactggca
gcagccactg gtaattgatt tagaggagtt agtcttgaag 420tcatgcgccg
gttaaggcta aactgaaagg acaagttttg gtgactgcgc tcctccaagc
480cagttacctc ggttcaaaga gttggtagct cagagaacct tcgaaaaacc
gccctgcaag 540gcggtttttt cgttttcaga gcaagagatt acgcgcagac
caaaacgatc tcaagaagat 600catcttatta atcagataaa atatttctag gatct
635301955DNAE. coli 30cctaggtttc acctgttcta ttaggtgtta catgctgttc
atctgttaca ttgtcgatct 60gttcatggtg aacagcttta aatgcaccaa aaactcgtaa
aagctctgat gtatctatct 120tttttacacc gttttcatct gtgcatatgg
acagttttcc ctttgatatc taacggtgaa 180cagttgttct acttttgttt
gttagtcttg atgcttcact gatagataca agagccataa 240gaacctcaga
tccttccgta tttagccagt atgttctcta gtgtggttcg ttgtttttgc
300gtgagccatg agaacgaacc attgagatca tgcttacttt gcatgtcact
caaaaatttt 360gcctcaaaac tggtgagctg aatttttgca gttaaagcat
cgtgtagtgt ttttcttagt 420ccgttacgta ggtaggaatc tgatgtaatg
gttgttggta ttttgtcacc attcattttt 480atctggttgt tctcaagttc
ggttacgaga tccatttgtc tatctagttc aacttggaaa 540atcaacgtat
cagtcgggcg gcctcgctta tcaaccacca atttcatatt gctgtaagtg
600tttaaatctt tacttattgg tttcaaaacc cattggttaa gccttttaaa
ctcatggtag 660ttattttcaa gcattaacat gaacttaaat tcatcaaggc
taatctctat atttgccttg 720tgagttttct tttgtgttag ttcttttaat
aaccactcat aaatcctcat agagtatttg 780ttttcaaaag acttaacatg
ttccagatta tattttatga atttttttaa ctggaaaaga 840taaggcaata
tctcttcact aaaaactaat tctaattttt cgcttgagaa cttggcatag
900tttgtccact ggaaaatctc aaagccttta accaaaggat tcctgatttc
cacagttctc 960gtcatcagct ctctggttgc tttagctaat acaccataag
cattttccct actgatgttc 1020atcatctgag cgtattggtt ataagtgaac
gataccgtcc gttctttcct tgtagggttt 1080tcaatcgtgg ggttgagtag
tgccacacag cataaaatta gcttggtttc atgctccgtt 1140aagtcatagc
gactaatcgc tagttcattt gctttgaaaa caactaattc agacatacat
1200ctcaattggt ctaggtgatt ttaatcacta taccaattga gatgggctag
tcaatgataa 1260ttactagtcc ttttcctttg agttgtgggt atctgtaaat
tctgctagac ctttgctgga 1320aaacttgtaa attctgctag accctctgta
aattccgcta gacctttgtg tgtttttttt 1380gtttatattc aagtggttat
aatttataga ataaagaaag aataaaaaaa gataaaaaga 1440atagatccca
gccctgtgta taactcacta ctttagtcag ttccgcagta ttacaaaagg
1500atgtcgcaaa cgctgtttgc tcctctacaa aacagacctt aaaaccctaa
aggcttaagt 1560agcaccctcg caagctcggg caaatcgctg aatattcctt
ttgtctccga ccatcaggca 1620cctgagtcgc tgtctttttc gtgacattca
gttcgctgcg ctcacggctc tggcagtgaa 1680tgggggtaaa tggcactaca
ggcgcctttt atggattcat gcaaggaaac tacccataat 1740acaagaaaag
cccgtcacgg gcttctcagg gcgttttatg gcgggtctgc tatgtggtgc
1800tatctgactt tttgctgttc agcagttcct gccctctgat tttccagtct
gaccacttcg 1860gattatcccg tgacaggtca ttcagactgg ctaatgcacc
cagtaaggca gcggtatcat 1920caacaggctt acccgtctta ctgtcaaccg gatct
1955311686DNAEscherichia coli 31cacttttgtt acccgccaaa caaaacccaa
aaacaaccca tacccaaccc aataaaacac 60caaaacaaga caaataatca ttgattgatg
gttgaaatgg ggtaaacttg acaaacaaac 120ccacttaaaa cccaaaacat
acccaaacac acaccaaaaa aacaccataa ggagttttat 180aaatgttggt
attcattgat gacggttcaa caaacatcaa actacagtgg caggaaagcg
240acggaacaat taaacagcac attagcccga acagcttcaa acgcgagtgg
gcagtctctt 300ttggtgataa aaaggtcttt aactacacac tgaacggcga
acagtattca tttgatccaa 360tcagcccgga tgctgtagtc acaaccaata
tcgcatggca atacagcgac gttaatgtcg 420ttgcagtgca tcacgcctta
ctgaccagtg gtctgccggt aagcgaagtg gatattgttt 480gcacacttcc
tctgacagag tattacgaca gaaataacca acccaatacg gaaaatattg
540agcgtaagaa agcaaacttc cggaaaaaaa ttacattaaa tggcggggat
acattcacaa 600taaaagatgt aaaagtcatg cctgaatcta taccggcagg
ttatgaagtt ctacaagaac 660tggatgagtt agattcttta ttaattatag
atctcggggg caccacatta gatatttctc 720aggtaatggg gaaattatcg
gggatcagta aaatatacgg agactcatct cttggtgtct 780ctctggttac
atctgcagta aaagatgccc tttctcttgc gagaacaaaa ggaagtagct
840atcttgctga cgatataatc attcacagaa aagataataa ctatctgaag
caacgaatta 900atgatgagaa caaaatatca atagtcaccg aagcaatgaa
tgaagcactt cgtaaacttg 960agcaacgtgt attaaatacg ctcaatgaat
tttctggtta tactcatgtt atggttatag 1020gcggtggcgc agaattaata
tgcgatgcag taaaaaaaca cacacagatt cgtgatgaac 1080gttttttcaa
aaccaataac tctcaatatg atttagttaa cggtatgtat ctcataggta
1140attaatgatg gacaagcgca gaaccattgc cttcaaacta aatccagatg
taaatcaaac 1200agataaaatt gtttgtgata cactggacag tatcccgcaa
ggggaacgaa gccgccttaa 1260ccgggccgca ctgacggcag gtctggcctt
atacagacaa gatccccgga cccctttcct 1320tttatgtgag ctgctgacga
aagaaaccac attttcagat atcgtgaata tattgagatc 1380gctatttcca
aaagagatgg ccgattttaa ttcttcaata gtcactcaat cctcttcaca
1440acaagagcaa aaaagtgatg aagagaccaa aaaaaatgcg atgaagctaa
taaattaatt 1500caattattat tgagttccct ttatccacta tcaggctgga
taaagggaac tcaatcaagt 1560tattttctta ccagtcatta cataatcgtt
attatgaaat aatcgtttgc actgtctctg 1620ttattcaggc aatttcaata
aaggcacttg ctcacgctct gtcattttct gaaactcttc 1680atgctg
168632367DNAEscherichia coli 32gacagtaaga cgggtaagcc tgttgatgat
accgctgcct tactgggtgc attagccagt 60ctgaatgacc tgtcacggga taatccgaag
tggtcagact ggaaaatcag agggcaggaa 120ctgctgaaca gcaaaaagtc
agatagcacc acatagcaga cccgccataa aacgccctga 180gaagcccgtg
acgggctttt cttgtattat gggtagtttc cttgcatgaa tccataaaag
240gcgcctgtag tgccatttac ccccattcac tgccagagcc gtgagcgcag
cgaactgaat 300gtcacgaaaa agacagcgac tcaggtgcct gatggtcgga
gacaaaagga atattcagcg 360atttgcc 36733459DNAEscherichia coli
33ttctgtggta gcacagaata atgaaaagtg tgtaaagaag ggtaaaaaaa accgaatgcg
60aggcatccgg ttgaaatagg ggtaaacaga cattcagaaa tgaatgacgg taataaataa
120agttaatgat gatagcggga gttattctag ttgcgagtga aggttttgtt
ttgacattca 180gtgctgtcaa atacttaaga ataagttatt gattttaacc
ttgaattatt attgcttgat 240gttaggtgct tatttcgcca ttccgcaata
atcttaaaaa gttcccttgc atttacattt 300tgaaacatct atagcgataa
atgaaacatc ttaaaagttt tagtatcata ttcgtgttgg 360attattctgc
atttttgggg agaatggact tgccgactga ttaatgaggg ttaatcagta
420tgcagtggca taaaaaagca aataaaggca tataacaga 45934734DNAShigella
flexneri 2a strain CVD 1208s 34catatgattg acctgaatga atatacagta
ttggaatgca ttatccggag tgttgtgtaa 60caatgtctgg ccaggtttgt ttcccggaac
cgaggtcaca acatagtaaa agcgctattg 120gtaatggtac aatcgcgcgt
ttacacttat tcagaacgac aggagacacg aacatggcca 180gcagaggcgt
aaacaaggtt attctcgttg gtaatctggg tcaggacccg gaagtacgct
240acatgccaaa tggtggcgca gttgccaaca ttacgctggc tacttccgaa
tcctggcgtg 300ataaagcgac cggcgagatg aaagaacaga ctgaatggca
ccgcgttgtg ctgttcggca 360aactggcaga agtggcgagc gaatatctgc
gtaaaggttc tcaggtttat atcgaaggtc 420agctgcgtac ccgtaaatgg
accgatcaat ccggtcagga tcgctacacc acagaagtcg 480tggtgaacgt
tggcggcacc atgcagatgc tgggtggtcg tcagggtggt ggcgctccgg
540caggtggcaa tatcggtggt ggtcagccgc agggcggttg gggtcagcct
cagcagccgc 600agggtggcaa tcagttcagc ggcggcgcgc agtctcgccc
gcagcagtcc gctccggcag 660cgccgtctaa cgagccgccg atggactttg
atgatgacat tccgttctga tttgtcatta 720aaacaatagc tagc
734351467DNASalmonella Paratyphi A 9150misc_featureguaB
35atgctacgta tcgctaaaga agccctgacg tttgacgacg tcctccttgt tcccgctcac
60tccaccgttt tgccgaatac tgccgatctc agcacgcagt tgacgaaaac tattcgtctg
120aatattccta tgctttctgc ggcgatggac accgtgacgg aagcgcgcct
ggcaattgcc 180ctggcccagg aaggcggcat tggttttatc cacaaaaaca
tgtccattga gcgccaggcg 240gaagaagttc gccgcgtgaa gaaacacgag
tccggcgtag tgaccgaccc gcagaccgtc 300ctgccaacca ccacgttgca
tgaagtgaaa gccctgaccg agcgtaacgg ttttgcgggc 360tatccggtgg
tgactgaaga taacgagctg gtggggatca tcaccggtcg tgacgtgcgt
420tttgtgactg acctgaacca gccggtaagt gtctacatga cgccgaaaga
gcgtctggtg 480accgttcgtg aaggcgaagc ccgtgaagtc gtgctggcaa
aaatgcacga aaaacgcgta 540gaaaaagcgc tggtcgttga tgataacttc
catctgcttg gcatgattac cgtaaaagat 600ttccagaaag cggaacgtaa
accaaactcc tgtaaagatg agcagggccg tttacgtgtc 660ggcgcggcgg
tcggcgcagg cgcgggcaac gaagagcgcg ttgacgcgct ggtggcggca
720ggcgttgacg tactgctgat cgactcctct cacggtcact ctgaaggcgt
gttgcaacgt 780atccgtgaga cgcgtgctaa atatcctgac ctgcaaatca
tcggcggcaa cgttgcgacg 840ggcgcaggcg ctcgcgcact ggcggaagcc
ggttgcagcg cggtgaaagt gggtatcggc 900ccgggctcca tctgtaccac
tcgtatcgtg actggtgtgg gcgttccgca gatcaccgct 960gtttccgacg
cggtagaagc gctggaaggc accggaattc cggttatcgc tgacggcggt
1020atccgtttct ccggcgacat cgccaaagcc atcgccgcag gcgcgagcgc
cgtgatggtg 1080ggctctatgc tggccggtac cgaagaatcc ccgggcgaaa
tcgaactcta ccagggccgt 1140tcgtacaaat cttaccgcgg catgggctcg
ctgggcgcga tgtccaaagg ttcctccgac 1200cgttacttcc agagcgacaa
cgccgctgac aaactggtgc cggaaggtat cgaaggccgc 1260gtagcctata
aaggtcgcct gaaagagatc attcaccagc agatgggcgg cctgcgctcc
1320tgtatggggc tgaccggttg tgctaccatc gacgaactgc gtactaaagc
ggagtttgtg 1380cgtatcagcg gtgcgggtat ccaggaaagc cacgttcacg
acgtgaccat caccaaagag 1440tccccgaact accgtctggg ctcctga
1467361578DNASalmonella Paratyphi A 9150misc_featureguaA
36atgacggaaa acattcataa gcatcgcatc ctcattctgg acttcggttc tcagtacact
60caactggttg cgcgccgcgt gcgtgagctg ggtgtttact gcgaactgtg ggcgtgggat
120gtgacagaag cacaaattcg tgacttcaac ccaagcggca ttattctttc
cggcggcccg 180gaaagcacca ccgaagaaaa cagcccgcgc gcgccgcagt
atgtctttga agcaggcgtg 240ccggtatttg gcgtttgcta tggtatgcag
accatggcga tgcagcttgg cggtcatgta 300gaaggttcta atgagcgtga
atttggttat gcgcaggtcg aagtgttgac cgacagcgcg 360ctggttcgcg
gtattgaaga ttccctgacc gcagacggca aaccgctgct ggacgtgtgg
420atgagccacg gcgataaagt gacggcgatt ccgtccgact tcgtgaccgt
cgccagcacc 480gagagctgcc cgttcgccat catggctaac gaagaaaaac
gcttctacgg cgtacagttc 540cacccggaag tgacccacac ccgccagggg
atgcgcatgc tggagcgttt tgtgcgtgat 600atctgccagt gtgaagcgtt
gtggacgccg gcgaagatca tcgacgacgc cgtggcgcgc 660attcgcgagc
aggtaggcga cgataaagtg atcctcggtc tctccggcgg cgtggattct
720tccgtcaccg caatgctgct gcaccgcgcg atcggtaaaa atctgacctg
tgtattcgtc 780gacaacggcc tgctgcgtct caacgaagcc gagcaggtga
tggacatgtt tggcgaccat 840tttggcctga atatcgttca cgttccggcg
gaagagcgct tcctgtccgc gttggctggc 900gaaaacgatc cggaagcgaa
gcgtaagatc attggccgtg tttttgtgga agtgttcgac 960gaagaagcgt
tgaaactgga agacgtgaaa tggctggcgc agggcaccat ctaccctgac
1020gtcatcgagt ctgcggcgtc tgcaaccggt aaagcgcacg tcatcaaatc
tcaccacaat 1080gttggcggcc tgccgaaaga gatgaagatg gggctggttg
aaccgctgaa agagctgttc 1140aaagacgaag tgcgtaagat tggtctggag
ctgggcctgc cgtacgacat gctgtaccgt 1200catccgttcc cggggccggg
cctcggcgta cgtgtactgg gtgaagtgaa gaaagagtac 1260tgcgacctgt
tgcgccgtgc tgacgccatc ttcattgaag agctgcgtaa ggcggatctg
1320tacgacaaag tcagccaggc gttcaccgtc ttcctgccag tacgctccgt
tggcgtaatg 1380ggcgatggtc gtaagtacga ttgggtggtc tccctgcgtg
ctgtcgaaac catcgacttt 1440atgactgcgc actgggcgca tctgccgtat
gacttcctgg gtcgtgtttc caaccgcatc 1500atcaatgaag tcaacgggat
ttcccgtgtg gtgtatgaca tcagcggtaa accaccggct 1560accattgagt gggaataa
157837624DNASalmonella Paratyphi A 9150misc_featureclpP
37atgtcataca gcggagaacg agataatttg gcccctcata tggcgctggt gccgatggtc
60attgaacaga cctcacgcgg tgagcgctct tttgatatct attctcgtct acttaaggaa
120cgcgtcatat ttctgaccgg ccaggtcgaa gaccatatgg ctaacctgat
cgtggcgcag 180atgctgttcc tggaagcgga aaacccggaa aaagatatct
atctgtacat taattctcct 240ggcggcgtaa ttactgcggg gatctccatc
tatgacacca tgcagtttat taagccagac 300gtcagcacca tttgtatggg
acaggcggcc tctatggggg cgtttctgct gactgccggg 360gcgaaaggca
aacgtttctg cttgccgaac tctcgcgtca tgatccacca gccgctgggc
420ggctaccagg gccaggcgac ggatattgaa attcacgccc gcgaaatttt
gaaagtaaaa 480gggcgcatga atgaacttat ggcgcatcat acgggtcaat
ctcttgagca gattgaacgt 540gatactgagc gcgatcgctt cctctccgcg
cctgaagcgg tagagtacgg tttggttgac 600tcaattttga cccatcgtaa ttga
624381272DNASalmonella Paratyphi A 9150misc_featureclpX
38atgacagata aacgcaaaga tggctcgggc aaattgttgt actgctcttt ttgcggcaaa
60agccagcatg aagtgcgcaa gctgattgcc ggtccatccg tgtatatctg cgacgaatgc
120gtcgatttat gtaacgacat tattcgcgaa gaaattaaag aagttgctcc
gcaccgtgaa 180cgtagtgcgc tgccgacgcc gcatgaaatt cgtacccacc
tggacgatta cgttatcggc 240caggagcagg cgaaaaaagt gctggcggtg
gcggtctata accactacaa gcgtctgcgt 300aacggtgata ccagcaatgg
cgtcgagtta ggcaaaagca acattctgct gattggaccg 360accggttccg
gtaaaacgct gctggcggaa acgctggcgc gcttgctgga tgtgccgttc
420actatggcgg atgcgaccac gctgaccgaa gcgggttacg tgggtgaaga
cgtcgagaat 480atcattcaga aactgttgca gaaatgcgac tacgacgtgc
aaaaagcgca gcgtgggatt 540gtctacattg atgaaatcga taagatttcg
cgtaaatcag acaatccgtc cattacccgc 600gatgtttccg gcgaaggcgt
acagcaggcg ttgctgaaac tgatcgaagg caccgtcgcc 660gcggttccac
cgcagggcgg tcgcaaacat ccgcagcagg agttcttaca ggtagatacc
720tctaagattc tgtttatctg cggcggcgcg tttgctggtc tggataaagt
gatcgctaac 780cgtgttgaaa ccggctccgg cattggtttt ggcgcgacgg
tgaaagcgaa gtccgacaaa 840gccagcgaag gcgagctgtt gtcgcaggtt
gaaccggaag atttgatcaa atttggtctg 900attcctgagt ttatcggtcg
tctgccagtg gtggcgacgc tgaacgaact cagcgaagaa 960gcgctgattc
aaatcctgaa agagccgaaa aatgcgctga ccaagcagta tcaggcgctg
1020tttaacctgg aaggcgtcga tctggaattc cgtgacgaag cgctggacgc
tatcgccagg 1080aaagcaatgg cgcgtaaaac cggtgcccgt ggtctgcgtt
ctatcgtcga agcggcgctg 1140ctggatacca tgtacgattt gccatctatg
gaagacgtcg aaaaagtggt gatcgacgag 1200tccgttattg ccggtcagag
taagccgttg ctgatttacg gcaaaccgga agcgcaggct 1260tctggcgaat aa
1272391272DNASalmonella Typhi Ty2misc_featureclpX gene 39atgacagata
aacgcaaaga tggctcgggc aaattgttgt actgctcttt ttgcggcaaa 60agccagcatg
aagtgcgcaa gctgattgcc ggtccatccg tgtatatctg cgacgaatgc
120gtcgatttat gtaacgacat tattcgcgaa gaaattaaag aagttgctcc
gcaccgtgaa 180cgtagtgcgc tgccgacgcc gcatgaaatt cgtactcacc
tggacgatta cgttatcggc 240caggagcagg cgaaaaaagt gctggcggtg
gcggtctata accactacaa gcgtctgcgt 300aacggcgata ccagcaatgg
cgtcgagtta ggcaaaagca acattctgct gactggaccg 360accggttccg
gtaaaacgct gctggcggaa acgctggcgc gcttgctgga tgtgccgttc
420actatggcgg atgcgaccac gctgaccgaa gcgggttacg tgggggaaga
cgtcgagaat 480atcattcaga aactgttgca gaaatgcgac tacgacgtgc
aaaaagcgca gcgtgggatt 540gtctacattg atgaaatcga taagatttcg
cgtaaatcag acaatccgtc cattacccgc 600gatgtttccg gcgaaggcgt
acagcaggcg ttgctgaaac tgatcgaagg caccgtcgcc 660gcggttccac
cgcagggcgg tcgcaaacat ccgcagcagg agttcttaca ggtagatacc
720tctaagattc tgtttatctg cggcggcgcg tttgccggtc tggataaagt
gatcgctaac 780cgtgttgaaa ccggctccgg cattggtttt ggcgcgacgg
tgaaagcgaa gtccgacaaa 840gccagtgaag gcgagctgtt gtcgcaggtt
gaaccggaag atttgatcaa atttggtctg 900attcctgagt ttatcggtcg
tctgccagtg gtggcgacgc tgaacgaact cagcgaagaa 960gcgctggttc
aaatcctgaa agagccgaaa aatgcgctga ccaagcagta tcaggcgctg
1020tttaacctgg aaggcgtcga tctggaattc cgtgacgaag cgctgaacgc
tatcgccagg 1080aaagcgatgg cgcgtaaaac tggtgcccgt ggcctgcgtt
ctatcgtcga agcggcgctg 1140ctggatacca tgtacgattt gccatctatg
gaagacgtcg aaaaagtggt gattgacgag 1200tccgttattg ccggtcagag
taagccgttg ctgatttacg gcaaaccgga agcgcaggct 1260tctggcgaat aa
127240624DNASalmonella Typhi Ty2misc_featureclpP gene 40atgtcataca
gcggagaacg agataatttg gcccctcata tggcgctggt gccgatggtc 60attgaacaga
cctcacgcgg tgagcgctct tttgatatct attctcgtct acttaaggaa
120cgcgtcatat ttctgaccgg ccaggtcgaa gaccatatgg ctaacctgat
cgtggcgcag 180atgctgttcc tggaagcgga aaacccggaa aaagatatct
atctgtacat taattctcct 240ggcggcgtaa ttactgcggg gatgtccatc
tatgacacca tgcagtttat taagccagac 300gtcagcacca tttgtatggg
acaggcggcc tctatggggg cgtttctgct gactgccggg 360gcgaaaggca
aacgtttctg cttgccgaac tctcgcgtca tgatccacca gccgctgggc
420ggctatcagg gccaggcgac ggatattgaa attcacgccc gcgaaatttt
gaaagtaaaa 480gggcgcatga atgaacttat ggcgcatcat acgggtcaat
ctcttgagca gattgaacgt 540gatactgagc gcgatcgctt cctctccgcg
cctgaagcgg tagagtacgg tttggttgac 600tcaattttga cccatcgtaa ttga
6244132DNAArtificial Sequencechemically-synthesized oligonucleotide
primer 41tcacgcacac gctgcaggtt gttgttgatt tc 324247DNAArtificial
Sequencechemically-synthesized oligonucleotide primer 42gaacttcgaa
gcagctccag cacctaatga tgaaattgaa gccatgc 474321DNAArtificial
Sequencechemically-synthesized oligonucleotide primer 43gctggagctg
cttcgaagtt c 214433DNAArtificial Sequencechemically-synthesized
oligonucleotide primer 44ctcgagttcc ggggatccgt cgacctgcag ttc
334534DNAArtificial Sequencechemically-synthesized oligonucleotide
primer 45ggatccgcta tgaacaagtc ctgataacag aggt 344646DNAArtificial
Sequencechemically-synthesized oligonucleotide primer 46ctcgagttaa
cgagactcct ggaaagatgc tttcggtgaa atctgc 46472363DNASalmonella
enterica serovar Typhimurium 47tcacgcacac gctgcaggtt gttgttgatt
tcgttcagcg cgccttcagt ggtctgcgca 60atggagatac cgtcgttagc gttacgggaa
gcctgagtca gacctttgat gttcgcggta 120aaacggttag caatcgcctg
acctgccgca tcgtctttcg cgctgttgat acgcagaccg 180gaagacagac
gctcgatagc ggtgcccaga gcggactggg atttgttcag gttattctgg
240gtcaacagcg acaggctgtt tgtattaatg acttgtgcca tgatcttttc
cttatcaatt 300acaacttgat gttattgggc tgttgcccac ggtttctcac
cgtaaccctt gtatcggcac 360ctgaatttcg aactttagaa aatttttcac
ttcccccgat ctttttctta ggcggcgaaa 420tagccgcttt atgcatcatt
attccgcgca ttatttttgc aaaattatca ttaaactttg 480cctccagatt
gccgataacg cgcttaacta ctgtttgcaa tcaaaaagga agaaggcatg
540gcttcaattt catcattagg tgtgggatca aacttaccgt tagaccagtt
gttgacagac 600ctgacaaaga acgaaaaagg acgcttaacg ccaattacca
aacagcagag cgcgaattcg 660gcaaagctaa ccgcctatgg cacattgaaa
agcgcattag aaaaattcca gacggcaaat 720accgcgttaa ataaagcgga
tttatttaag tctaccgtgg cgtccagcac cactgaagat 780ctcaaagtca
gtactaccgc tggcgctgcc gcagggactt ataagattaa cgtaacccag
840cttgccgccg cacagtcgct ggcgacaaaa accaccttcg cgaccaccaa
agagcagttg 900ggcgatacgt cggtcacgtc ccggacaatt aaaattgaac
agccgggacg taaagagccg 960ctggaaatta agctggataa aggcgacacc
tccatggagg cgatccgtga cgccatcaat 1020gacgccgaca gcggtatcgc
cgccagtatc gttaaggtca aagagaacga attccagttg 1080gtgcttaccg
ccaatagcgg taccgacaat acgatgaaga tcacggtgga aggcgataca
1140aaacttaacg atctactcgc ttatgacagc accaccaata ccggcaatat
gcaagagctg 1200gtgaaagcag aaaacgcgaa gctgaacgta aacggcatcg
acattgagcg tcagagcaat 1260accgtaaccg acgcccctca gggaattacg
ctcaccctga ccaagaaagt gaccgacgcg 1320accgtgacgg taacgaaaga
tgataccaag gcgaaagagg cgattaaatc ctgggtggat 1380gcctataact
cgctggtgga tacctttagc tcgttaacca aatataccgc cgttgagccg
1440ggcgaagaag ccagcgataa aaacggcgcg ctgttaggcg atagtgtggt
tcgtactatc 1500cagaccggga ttcgggcaca atttgccaat agcggcagta
attctgcgtt caaaacaatg 1560gcggaaattg gcatcaccca ggatgggact
tccggcaaac tgaagattga tgatgataag 1620ctgaccaaag tactgaaaga
taacacagcc gcagcgcgtg agctgctggt aggcgatggt 1680aaagaaacgg
gtatcaccac caaaattgcc accgaagtga aaagttatct ggcggatgac
1740ggcattattg ataatgcgca ggacaacgtt aacgccacgc tgaaaagcct
gacaaaacag 1800tacctgtccg ttagcaacag catcgatgaa accgttgccc
gttacaaggc ccagtttacc 1860caactggata ccatgatgag taagctgaat
aacaccagta gttatttgac ccagcaattt 1920acagctatga acaagtcctg
ataacagagg tcaccatgta caccgcgagc ggtatcaaag 1980cttatgcgca
agtcagcgtg gaaagcgccg tgatgagcgc cagcccgcat cagttgattg
2040aaatgttgtt tgatggcgcg aatagcgctc tggtgcgcgc tcgcctgttt
ttagaacaag 2100gcgatgttgt cgcgaaaggt gaagcgttaa gcaaagccat
caatattatc gataacgggc 2160tgaaagccgg cctcgatcag gaaaaaggcg
gtgagattgc gacgaatctt tccgagctat 2220acgactatat gattcgccgt
ttactgcagg ctaatttgcg taacgacgct caggccatcg 2280aagaagtgga
agggttactc agcaatattg cagaagcctg gaagcagatt tcaccgaaag
2340catctttcca ggagtctcgt taa 2363482363DNASalmonella enterica
serovar Paratyphi A 48tcacgcacac gctgcaggtt gttgttgatt tcgttcagcg
cgccttcagt ggtctgcgca 60atggagatac cgtcgttagc gttacgggaa gcctgagtca
gacctttgat gttcgcggtg 120aaacggttag caattgcctg acctgccgca
tcgtctttcg cgctgttgat acgcagaccg 180gaagacagac gctcgatagc
ggtgcccaga gcggactggg atttgttcag gttattctgg 240gtcaacagcg
acaggctgtt tgtattaatg acttgtgcca tgatcttttc cttatcaatt
300acaacttgat gttattgggc tgttgcccac ggtttctcac cgtaaccctt
gtatcggcac 360ctgaatttcg aactttagaa aatttttcac ttcccccgat
ctttttctta ggcggcgaaa 420tagccgcttt atgcatcatt attccgcgca
ttatttttgc aaaattatca ttaaactttg 480cctccagatt gccgataacg
cgcttaacta ctgtttgcaa tcaaaaagga agaaggcatg 540gcttcaattt
catcattagg tgtgggatca aacttaccgt tagaccagtt gttgacagac
600ctgacaaaga acgaaaaagg acgcttaacg ccaattacca aacagcagag
cgcgaattcg 660gcaaagctaa ccgcctatgg cacattgaaa agcgcattag
aaaaattcca gacggcaaat 720accgcgttaa ataaagcgga tttatttaag
tctaccgtgg cgtccagcac gacagaggac 780ctcaaagtca gtactaccgc
aggcgctgcc gcagggactt ataagattag cgtaacccag 840cttgccgccg
cgcagtcgct ggcgacaaaa accaccttcg caaccaccaa agagcagttg
900ggcgatacgt cggtcacgtc ccggacaatt aaaattgaac agccgggacg
taaagagccg 960ctggaaatta agctggataa aggcgacacc tccatggagg
cgatccgtga cgccatcaat 1020gacgccgaca gcggtatcgc cgccagtatc
gttaaggtca aagagaacga attccagttg 1080gtgcttaccg ccaatagcgg
taccgacaat acgatgaaga tcacggtgga aggcgataca 1140aaacttaacg
atctactcgc ttatgacagc accaccaata ccggcaatat gcaagagctg
1200gtgaaagcag aaaacgcgaa gctgaacgta aacggcatcg acattgagcg
tcagagcaat 1260accgtaaccg acgcccctca gggaattacg ctcaccctga
cgaagaaagt gaccgacgcg 1320accgtgacgg taacgaaaga tgataccaag
gcgaaagagg cgattaaatc ctgggtggat 1380gcctataact cgctggtgga
tacctttagc tcgttaacca aatataccgc cgttgagccg 1440ggcgaagaag
ccagcgataa aaacggcgcg ctgttaggcg atagtgtggt tcgtactatc
1500cagaccggga ttcgggcaca atttgccaat agcggcagta attctgcgtt
caaaacaatg 1560gcggaaattg gcatcaccca ggatgggact tccggcaaac
tgaagattga tgatgataag 1620ctgaccaagg tactgaaaga taacacagcc
gcagcgcgtg agctgctggt aggcgatggt 1680aaagaaacgg gtatcaccac
caaaattgcc accgaagtga aaagttatct ggcggatgac 1740ggcattattg
ataatgcgca ggacaacgtt aacgccacgc tgaaaagcct gacaaaacag
1800tacctgtccg ttagcaacag catcgatgaa accgttgccc gttacaaggc
ccagtttacc 1860caactggata ctatgatgag taagctgaat aacaccagta
gttatttgac ccagcaattt 1920acagctatga acaagtcctg ataacagagg
tcaccatgta caccgcgagc ggtatcaaag 1980cttatgcgca agtcagcgtg
gaaagcgccg tgatgagcgc cagcccgcat cagttgattg 2040aaatgttgtt
tgatggcgcg aatagcgctc tggtgcgcgc tcgcctgttt ttagaacaag
2100gcgatgttgt cgcgaaaggt gaagcgttaa gcaaagccat caatattatc
gataacgggc 2160tgaaagccgg cctcgatcag gaaaaaggcg gtgagattgc
gacgaatctt tccgagctat 2220acgactatat gattcgccgt ttactgcagg
ctaatttgcg taacgacgct caggccatcg 2280aagaagtgga agggttactc
agcaatattg cagaagcctg gaagcagatt tcaccgaaag 2340catctttcca
ggagtctcgt taa 2363492363DNASalmonella enterica serovar Typhi
strain Ty2 49tcacgcacac gctgcaggtt gttgttgatt tcgttcagcg cgccttcagt
ggtctgcgca 60atggagatac cgtcgttagc gttacgggaa gcctgagtca gacctttgat
gttcgcggta 120aaacggttag
caatcgcctg tcctgccgca tcgtctttcg cgctgttgat acgcagaccg
180gaagacaaac gctcgatagc agtgcccagt gcggactggg atttgttcag
gttattctgg 240gtcaacagcg acaggctgtt tgtattaatg acttgtgcca
tgatcttttc cttatcaatt 300acaacttgat gttattgggc tgttgcccac
ggtttctcac cgtaaccctt gtatcggcac 360ctgaatttcg aactttagaa
aatttttcac ttcccccgat ctttttctta ggcggcgaaa 420tagccgcttt
atgcatcatt attccgcgca ttatttttgc aaaattatca ttaaactttg
480cctccagatt gccgataacg cgcttaacta ctgtttgcaa tcaaaaagga
agaaggcatg 540gcttcaattt catcattagg tgtgggatca aacttaccgt
tagaccagtt gttgacagac 600ctgacaaaga acgaaaaagg acgcttaacg
ccaattacca aacagcagag cgcgaattcg 660gcaaagctaa ccgcctatgg
cacattgaaa agcgcattag aaaaattcca gacggcaaat 720accgcgttaa
ataaagcgga tttatttaag tctaccgtgg cgtccagcac gacagaggac
780ctcaaagtca gtactaccgc aggcgctgcc gcagggactt ataagattag
cgtaacccag 840cttgccgccg cgcagtcgct ggcgacaaaa accaccttcg
caaccaccaa agagcagttg 900ggcgatacgt cggtcacatc ccggacaatt
aaaattgaac agccgggacg taaagagccg 960ctggaaatta agctggataa
aggcgacacc tccatggagg cgatccgtga cgccattaat 1020gacgccgaca
gcggtatcgc cgccagtatc gttaaggtca aagagaacga attccagttg
1080gtgcttaccg ccaatagcgg taccgacaat acgatgaaga tcacggtgga
aggcgataca 1140aaacttaacg atctactcgc ttatgacagc accaccaata
ccggcaatat gcaagagctg 1200gtgaaagcag aaaacgcgaa gctgaacgta
aacggcatcg acattgagcg tcagagcaat 1260accgtaaccg acgcccctca
gggaattaca ctcaccctga ccaagaaagt gaccgacgcg 1320accgtgacgg
tgacgaaaga tgataccaag gcgaaagagg cgattaaatc ctgggtggat
1380gcctataact cgctggtgga tacttttagc tcattaacta aatataccgc
cgttgagccg 1440ggcgaagaag ccagcgataa aaacggcgcg ctgttaggcg
atagtgtggt tcgtgctatc 1500cagaccggga ttcgggcaca atttgccaat
agcggcagta attctgcgtt caaaacaatg 1560gcggaaattg gcatcaccca
ggatgggact tccggcaaac tgaagattga cgatgataag 1620ctgaccaagg
tactgaaaga taacacggcc gcagcgcgtg agctgctggt aggcgatggt
1680aaagaaacgg gtatcaccac caaaattgcc accgaagtga aaagttatct
ggcggatgac 1740ggcattattg ataatgcgca ggacaacgtt aacgccacgc
tgaaaagcct gacaaaacag 1800tacctgtccg ttagcaacag catcgatgaa
accgttgccc gttacaaggc ccagtttacc 1860caactggata ccatgatgag
taagctgaat aacaccagta gttatttgac ccagcaattt 1920acagctatga
acaagtcctg ataacagagg tcaccatgta caccgcgagc ggtatcaaag
1980cttatgcgca agtcagcgtg gaaagcgccg tgatgagcgc cagcccgcat
cagttgattg 2040aaatgttgtt tgatggcgcg aatagcgctc tggtgcgcgc
tcgcctgttt ttagaacaag 2100gcgatgttgt cgcgaaaggt gaagcgttaa
gcaaagccat caatattatc gataacgggc 2160tgaaagccgg cctcgatcag
gaaaaaggcg gtgagattgc gacgaatctt tccgagctat 2220acgactatat
gattcgccgt ttactgcagg ctaatttgcg taacgacgct caggccatcg
2280aagaagtgga aaggttactc agcaatattg cagaagcctg gaagcagatt
tcaccgaaag 2340catctttcca ggagtctcgt taa 2363502365DNASalmonella
enterica serovar Enteritidis 50tcacgcacac gctgcaggtt gttgttgatt
tcattcagcg caccttcagt ggtctgcgca 60atagaaatgc cgtcgttagc gttacgggaa
gcctgagtca gacctttgat attagaagtg 120aagcggttag caatcgcctg
gcctgccgca tcgtctttcg cgctgttgat acgcagacca 180gaggacagac
gctcaatagc ggaactcagt gaggactgag atttgttcag gttattctgg
240gtcaacagcg acaggctgtt tgtattaatg acttgtgcca tgatcttttc
cttatcaatt 300acaacttgat gttattgggc tgttgcccac ggtttctcac
cgtaaccctt gtatcggcac 360ctgaatttcg aactttagaa aatttttcac
ttcccccgat ctttttctta gcctgcgaaa 420tagccgcttt atgcatcatt
attccacgca ttatttttgc aaaattatca ttaaactttg 480cttccagatt
gccgataacg cgtttaacta ctgtttgcaa tcgaaaggaa gatggcatgg
540cttcaatttc atcattaggt gtagggtcaa acttacctct ggattcactg
ctgactaaac 600tgaccaacgc tgaaaaagga cgcttaacgc cgatcacaca
gcagcagagt gctaatacgg 660cccgtctaac ggcatacggt actttaaaaa
gtgcactgga gaagtttcaa acagcaaaca 720cggcgttaaa taaagccgat
ctgtttaaaa gtacgaatgt caccagcagt acagaagacc 780tgaaagtctc
gacggaagct ggggccgcac ctggaactta tgtggttagc gtaactcagt
840tagcacaagc acaatctttg agtacagcaa ccaaaattac atctaccaaa
gaagtgctgg 900gagataccac atctgacagc cgtaccataa aaattgaaca
gaaaggccgt aaagaaccac 960ttgaaatcaa gctcactaaa gatcaaacct
ctttagaggg tatccgtgac gccattaatg 1020atgctgacag tggtatttcc
gccagtatcg ttaaagttaa agaaggcgat tatcagcttg 1080tactgaccgc
agatagtggc acggataatc aaatgactat ctctgtggaa ggcgatagca
1140aactcagcga tctgttgtcc tatgatagta gtactggcac gggcaaaatg
aagcaactgg 1200ttgctgcaga taatgctttg ttaaccgtta acggcattga
tattgagcga ccgagtaata 1260aaatcactga cgctccacaa ggcgtgacgc
ttgaactaac caaagaagta aaagatgccc 1320gtattaccgt cacaaaagat
aatgaaaagg cgaccgaagc cgtcaaaggt tgggttgatg 1380cctacaactc
actgcttgat acctttagtt cattaacaaa atatacagag gttgatccag
1440gggctgaaga acaggacaaa aacaacggtg cactacttgg agataccgtg
gtgcgaacga 1500ttcaaactgg aatccgcgct cagttcgcta atggtgcaag
tacaggtaca tttaagaccc 1560tgaatgaaat tggtattact tctgatggta
ccaccggaaa actaaaaatt gatgatacca 1620agcttaaaaa agcgctggat
gaaaataccg cttctgtacg tgagctgctg gtaggtgatg 1680gtaaagaaac
ggggatcacc accaaaattg ccaccgaagt gaaaagttat ctggccgatg
1740acggcattat tgacagcgcc caggacagta ttaacgccac gctgaaaaag
ctgactaagc 1800aatatctgac cgtcagcagt agcattgacg acaccgttgc
ccgttacaag gcccagttta 1860cccaactgga taccatgatg agtaagctga
ataacaccag tacttatttg acccagcaat 1920ttaatgctat gaacaagtcc
tgataacaga ggttaccatg tacaccgcga gcggtatcaa 1980agcttatgcg
caagtcagcg tggaaagcgc cgtgatgagc gccagcccgc atcagttgat
2040tgaaatgttg tttgatggcg cgaatagcgc tctggtgcgc gctcgcctgt
ttttagaaca 2100aggcgatgtt gtcgcgaaag gtgaagcgtt aagcaaagcc
atcaatatta tcgataacgg 2160gctgaaagcc ggcctcgatc aggaaaaagg
cggtgagatt gcgacgaatc tttccgagct 2220atacgactat atgattcgcc
gtttactgca ggctaatttg cgtaacgacg ctcaggccat 2280cgaagaagtg
gaagggttac tcagcaatat tgcagaagcc tggaagcaga tttcaccgaa
2340agcatctttc caggagtctc gttaa 2365
* * * * *