U.S. patent application number 13/183913 was filed with the patent office on 2012-02-02 for methods for treating skin pigmentation.
Invention is credited to John Kung, Susan Niemiec, Miri Seiberg, Stanley S. Shapiro.
Application Number | 20120027706 13/183913 |
Document ID | / |
Family ID | 27368528 |
Filed Date | 2012-02-02 |
United States Patent
Application |
20120027706 |
Kind Code |
A1 |
Shapiro; Stanley S. ; et
al. |
February 2, 2012 |
METHODS FOR TREATING SKIN PIGMENTATION
Abstract
This invention relates to methods and compositions for bringing
about changes in skin pigmentation. More particularly, this
invention relates to compounds which affect melanogenesis and can
be used as depigmenting agents or as agents for darkening skin
utilizing the PAR-2 pathway.
Inventors: |
Shapiro; Stanley S.;
(Livingston, NJ) ; Seiberg; Miri; (Princeton,
NJ) ; Niemiec; Susan; (Yardley, PA) ; Kung;
John; (Somerset, NJ) |
Family ID: |
27368528 |
Appl. No.: |
13/183913 |
Filed: |
July 15, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09110409 |
Jul 6, 1998 |
8039026 |
|
|
13183913 |
|
|
|
|
Current U.S.
Class: |
424/62 ;
514/423 |
Current CPC
Class: |
A61K 8/42 20130101; A61K
8/41 20130101; A61Q 19/02 20130101; A61P 17/16 20180101; A61Q 19/04
20130101; A61K 8/9794 20170801; A61K 8/4926 20130101; A61P 43/00
20180101; A61K 8/46 20130101; A61K 8/14 20130101; A61K 8/64
20130101; A61P 17/00 20180101; A61K 8/676 20130101; A61K 8/9789
20170801; A61K 8/44 20130101; A61K 8/678 20130101 |
Class at
Publication: |
424/62 ;
514/423 |
International
Class: |
A61K 8/49 20060101
A61K008/49; A61Q 19/02 20060101 A61Q019/02; A61Q 19/00 20060101
A61Q019/00 |
Claims
1-9. (canceled)
10. A method of effecting changes in mammalian skin pigmentation
comprising administering to a mammal a pigmentation-changing
effective amount of a compound which affects the PAR-2-pathway
wherein said compound is a compound of formula I: ##STR00003##
wherein: A is selected from the group consisting of C.sub.1-alkyl,
carboxyC.sub.1-4alkyl, C.sub.1-4alkoxycarbonylC.sub.1-4alkyl,
phenylC.sub.1-4alkyl, substituted phenylC.sub.1-4alkyl (where the
phenyl substituents are independently selected from one or more of,
C.sub.1-4 alkyl, perfluoroC.sub.1-4, alkyl, C.sub.1-4alkoxy,
hydroxy, halo, amido, nitro amino, C.sub.1-4alkylamino,
C.sub.1-4dialkylamino, carboxy or C.sub.1-4alkoxycarbonyl), formyl,
C.sub.1-4alkoxycarbonyl, C.sub.1-2alkylcarbonyl,
phenylC.sub.1-4alkoxycarbonyl, C.sub.3-7cycloakylcarbonyl,
phenylcarbonyl, substituted phenylcarbonyl (where the phenyl
substituents are independently selected from one or more of,
C.sub.1-4alkyl, perfluoroC.sub.1-4alkyl, C.sub.1-4alkoxy, hydroxy,
halo, amido, nitro, amino, C.sub.1-4alkylamino,
C.sub.1-4dialkylamino, carboxy or C.sub.1-4 alkoxycarbonyl),
C.sub.1-4alkylsulfonyl, C.sub.1-4alkoxysulfonyl,
perfluoroC.sub.1-4alkyl-sulfonyl, phenylsulfonyl, substituted
phenylsulfonyl (where the phenyl substituents are independently
selected from one or more of, C.sub.1-4alkyl,
perfluoroC.sub.1-4alkyl, C.sub.1-4alkoxy, hydroxy, halo, amido,
nitro, amino, C.sub.1-4alkylamino, C.sub.1-4dialkylamino, carboxy
or C.sub.1-4 alkoxycarbonyl), 10camphorsulfonyl,
phenylC.sub.1-4alkysulfonyl, substituted
phenylC.sub.1-4alkysulfonyl, C.sub.1-4alkylsulfinyl,
perfluoroC.sub.1-4alkylsulfinyl, phenylsulfinyl, substituted
phenylsulfinyl (where the phenyl substituents are independently
selected from one or more of, C.sub.1-4alkyl,
perfluoroC.sub.1-4alkyl, C.sub.1-4alkoxy, hydroxy, halo, amido,
nitro, amino, C.sub.1-4alkylamino, C.sub.1-4dialkylamino, carboxy
or C.sub.1-4alkoxycarbonyl), phenyl C.sub.1-4alkylsulfinyl,
substituted phenylC.sub.1-4alkylsulfinyl, 1-naphthylsulfonyl,
2-naphthylsulfonyl or substituted naphthylsulfonyl (where the
naphthyl substituents are independently selected from one or more
of C.sub.1-4alkyl, perfluoroC.sub.1-4alkyl, C.sub.1-4alkoxy,
hydroxy, halo, amido, nitro, amino, carboxy or
C.sub.1-4alkoxy-carbonyl), 1-naphthylsulfinyl, 2-naphthylsulfinyl
or substituted naphthylsulfinyl (where the naphthyl substituents
are independently selected from one or more of, C.sub.1-4alkyl,
perfluoroC.sub.1-4alkyl, C.sub.1-4alkoxy, hydroxy, halo, amido,
nitro, amino, C.sub.1-4alkylamino, C.sub.1-4dialkylamino, carboxy
or C.sub.1-4alkoxycarbonyl); a D or L amino acid which is coupled
as its carboxy terminus to the nitrogen depicted in formula I and
is selected from the group consisting of alanine, asparagine,
2-azetidinecarboxylic acid, glycine, N--C.sub.1-8-alkyglycine,
proline, 1-amino-1-cycloC.sub.1-8alkylcarboxylic acid,
thiazolidine-4-carboxylic acid,
5,5-dimethylthiazolidine-4-carboxylic acid,
oxadolidine-4-carboxylic acid, pipecolinic acid, valine,
methionine, cysteine, serine, threonine, norleucine, leucine,
tert-leucine, isoleucine, phenylalanine, 1-naphthalanine,
2-naphthylamine, 2-thienylalanine, 3-thienylalanine,
[1,2,3,4]tetrahydroisoquinoline-1-carboxylic acid and
1,2,3,4,1-tetrahydroisoquinoline-2-carboxylic acid where the amino
terminus of said amino acid is connected to a member selected form
the group consisting of .sub.C1-4alkyl,
tetrazol-5-yl-C.sub.1-2alkyl, carboxyC.sub.1-4alkyl,
C1-4alkoxycarbonyl C.sub.1-4alkyl, phenylC.sub.1-4alkyl,
substituted phenyl C.sub.1-4 alkyl (where the phenyl substituents
are independently selected from one or more of, C.sub.1-4alkyl,
perfluoroC.sub.1-4alkyl, C.sub.1-4alkoxy, hydroxy, halo, amido,
nitro, amino, C.sub.1-4alkylamino, C.sub.1-4dialkylamino, carboy or
C.sub.1-4alkoxycarbonyl), 1,1-diphenylC.sub.1-4alkyl,
3-phenyl-2-hydroxypropionyl, 2,2-diphenyl-1-hydroxyethylcarbonyl,
[1,2,3,4]-tetrahydroisoquinoline-1-carbonyl,
[1,2,3,4]-tetrahydroisoquinoline-3carbonyl,
1-methylamino-1-cyclohexanecarbonyl,
1-hydroxy-1-cyclohexanecarbonyl, 1-hydroxy-1-pheny-lacetyl,
1-cyclohexyl-1-hydroxyacetyl, 3-phenyl2-hydroxypropionyl,
3,3diphenyl-2-hydroxypropionyl, 3-cyclohexyl-2-hydroxypropionyl,
formyl, C.sub.1-4alkoxycarbonyl, C.sub.4-12alkylcarbonyl,
perfluoroC.sub.1-4alkyl, C.sub.1-4alkylcarbonyl,
phenylC.sub.1-4alkylcarbonl, substituted
phenylC.sub.1-4alkylcarbonyl (where the phenyl substituents are
independently selected from one or more of, C.sub.1-4alkyl,
perfluoroC.sub.1-4alkyl, C.sub.1-4alkoxy, hydroxy, halo amido,
nitro amino, C.sub.1-4alkylamino, C.sub.1-4dialkylamino, carboxy or
C.sub.1-4alkoxycarbonyl) 1,1diphenylC.sub.1-4alkylcarbonyl,
substituted 1,1-diphenylC.sub.1-4alkylcarbonyl (where the phenyl
substituents are independently selected from one or more of,
C.sub.1-4alkyl, perfluoro C.sub.1-4alkyl, C.sub.1-4alkoxy, hydroxy,
halo, amido, nitro, amino, C.sub.1-4alkylamino,
C.sub.1-4dialkylamino, carboxy or C.sub.1-4 alkoxycarbanyl),
perfluoroC.sub.1-4alkysulfonyl, C.sub.1-4alkysulfonyl,
C.sub.1-4alkoxysulfonyl, phenysulfonyl, substituted phenylsulfonyl
(where the phenyl substituents are independently selected from one
or more of, C.sub.1-4alkyl, perfluoro C.sub.1-4alkylamino,
C.sub.1-4dialkylamino, carboxy or C.sub.1-4alkoxycarbonyl), 10
camphorsulfonyl, phenylC.sub.1-4alkylsulfonyl, substituted
phenylC.sub.1-4alkylsulfonyl, perfluoroC.sub.1-4alkysulfinyl,
C.sub.1-4alkysulfinyl, phenylsulfinyl, substituted phenysulfinyl
(where the phenyl substituents are independently selected from one
or more of C.sub.1-4alkyl, perfluoro C.sub.1-4alkyl, C.sub.1-4
alkoxy, hydroxy, halo, amido, nitro, amino, C.sub.1-, alkylamino,
C.sub.1-4dialkylamino, carboxy or C, alkoxycarbonyl),
1-naphthysulfonl, 2-naphthylsulfonyl, substituted naphthylsulfonyl
(where the naphthyl substituents are independently selected from
one or more of, C.sub.1-4alkyl, perfluoroC.sub.1-4alkyl,
C.sub.1-4alkoxy, hydroxy, halo, amido, nitro, amino,
C.sub.1-4alkylamino, C.sub.1-4dialkylamino, carboxy or
C.sub.1-4-alkoxycarbonyl), 1-naphthysulfinyl, 2-naphthysulfinyl,
and substituted naphthylsulfinyl (where the naphthyl substituents
are independently selected from one or more of, C.sub.1-4alkyl,
perfluoroC.sub.1-4alkl, C.sub.1-4alkoxy, hydroxy, halo amido,
nitro, amino, C.sub.1-4alkylamino, C.sub.1-4dialkylamono, carboxy
or C.sub.1-4alkoxycarbonyl): or a poly peptide comprised of two
amino acids, where the first amino acid is a D or L amino acid,
bound via its carboxy terminus to the nitrogen depicted in Formula
I and is selected from the group consisting of glycine,
N--C.sub.1-8alkylglycine, alanine, 2-azetidinecarboxylic acid,
proline, thiazolidine-4-carboxylic acid,
5.5-dimethylthiazolidine-4-carboxylic acid,
oxazolidine-4-carboxylic acid, 1-amino-1-cycloC.sub.3-8 alkyl
carboxylic acid, 3-hydroxypropoline, 4-hydroxyproline,
3-(C.sub.1-4alkoxy)proline, 4(C.sub.1-4alkoxy) proline,
3,4-dehydroprline, 2,2-dimethyl-4-thiazolidine carboxylic acid,
2.2-dimethyl-4-oxadolidine carboxylic acid, pipecolinic acid,
valine, methionine, cysteine, asparagine, serine, threonine,
leucine, tert-leucine, isoleucine, phenylalanine, 1-naphthalanine,
2-naphthalanine, 2-thienylalanine, 3-thienylalnine,
[1,2,3,4]-tetrahydroisoquinoline-2-carboxylic acid, aspartic
acid-4-C.sub.1-4alkyl ester and glutamic acid 5-C.sub.1-4alkyl
ester and the second D or L amino acid, is bound to the amino
terminus of said first amino acid, and is selected from the group
consisting of phenylalanine, 4-benzolyphenylalanine,
4-carboxyphenylalanine, 4-(Carboxy C.sub.1-4alkyl)phenylalanine,
substituted phenylalanine (where the phenyl substituents are
independently selected from one or more of C.sub.1-4alkyl,
perfluoroC.sub.1-4alkyl, C.sub.1-4alkoxy, hydroxy, halo, amido,
nitro, amino, C.sub.1-4alkylamino, C.sub.1-4dialkylamino, carboxy
C.sub.1-4dialkylamino, carboxy- or C.sub.1-4alkoxycarbonyl),
3-benzothienylalanine, 4biphenylalanine, homophenylalanine,
octahydroindole-2-carboxylic acid, 2-Pyridylalanine,
3-pyridylalanine, 4-thiazolyalanine, 2-thienylalanine,
3-(3-benzothienyl)alanine, 3-thienylalanine, tryptophan, tyrosine,
asparagine, cyclohexylglycine, diphenylglycine, phenylglycine,
methionine sulfoxide, methionine sulfone, 2,2-dicyclohexylalanine,
2-(lnaphthylalanine), 2-(2-naphthylalanine), phenyl substituted
phenylalanine (where the substituents are selected from
C.sub.1-4alkyl, perfluoroC.sub.1-4alkyl, C.sub.1 alkoxy, hydroxy,
halo, amido, nitro, amino, C.sub.1-4alkylamino,
C.sub.1-4dialylamino, carboxy or C.sub.1 alkoxycarbonyl), aspartic
acid, aspartic acid4C.sub.1-4alkyl, perfluoroC.sub.1-4alkyl,
C.sub.1-4alkoxy, hydroxy, halo, amido, nitro, amino,
C.sub.1-4alkylamino, C.sub.3-4dialkylamino, carboxy or
C.sub.1-4alkoxycarbony), aspartic acid, aspartic
acid-4-C.sub.1-4alkyl ester glutamic acid, glutamic
acid-5-C.sub.1-4alkyl ester, cycloC3-salkylaalanine, substituted
cycloC.sub.3-8alkylalanine (where the ring substituents are
carboxy, C.sub.1-4 alkyl ester, cycloC.sub.3-8alkylalanine,
substituted cycloC.sub.3-8alkylalanine (where the ring substituents
are carboxy, C.sub.1-4alkylcarboxy, C.sub.1-4alkoxycarbonyl or
aminocarbonyl), 2,2-diphenylalanine and all alpha-C.sub.1-5alkyl of
all amino acid derivatives thereof, where the amino terminus of
said second amino acid is unsubstituted or monosubstituted with a
member of the group consisting of formyl, C.sub.1-12 alkyl,
tetrazol-5ylC.sub.1-2alkyl, carboxyc, alkyl,
carboalkoxyC.sub.1-4alkyl, phenyl C.sub.1-4alkyl, substituted
phenyl C.sub.1-4alkyl (where the phenyl substituents or
independently selected from one or more of, C.sub.1-4alkyl,
perfluoroC.sub.1-4alkyl, C.sub.1-4alkoxy, hydroxy, halo, amido,
nitro, amino, C.sub.1-4alkylamino, C.sub.1-4dialkylamino, carboxy
or C.sub.1-4alkoxycarbonyl), 1,1-diphenylC.sub.1-4alkyl,
C.sub.1-6alkoxycarbonyl, phenylC.sub.1-6alkoxycarbonyl,
C.sub.1-2alkylcarbonyl,
perfluoroC.sub.1-lkylC.sub.1-4alkylcarbonyl,
phenyC.sub.1-4alkylcarbonyl, substituted
phenyC.sub.1-4alkylcarbonyl(where the phenyl substituents are
independently selected from one or more of C.sub.1-4alkyl,
perfluoro C.sub.1-4alkyl, C.sub.1-4alkoxy, hydroxy, halo, amido,
nitro, amino, C.sub.1-4alkylamino, C.sub.1-4dialkylamino, carboxy
or C.sub.1-4alkoxycarbonyl), 1,1-diphenylC.sub.1-4alkyl,
perfluoroC.sub.1-4alkyl, C.sub.1-4alkoxycarbonyl),
10-camphorsulfonyl, phenylC.sub.1-4alkysulfonyl, substituted
phenylC.sub.1-4alkylsulfonyl, C.sub.1-4alkysulfinyl, perfluoro
C.sub.1-4alkylsulfinyl, phenylsulfinyl, substituted phenylsulfinyl
(where the phenyl substituents are independently selected from one
or more of, C.sub.1-4alkyl, perfluoroC.sub.1-4alkyl,
C.sub.1-4alkoxy, hydroxy, halo, amido, nitro, amino,
C.sub.1-4alkylamono, C.sub.1-4dialkylamono, carboxy or
C.sub.1-4alkoxycarbonyl), phenyC1-4-alkylsulfinyl, substituted
phenylC1-4alkylsulfinyl 1-naphthylsulfonyl, 2-naphthylsulfonyl,
substituted naphthylsulfonyl (where the naphthyl substituent is
selected from C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy,
halo amido, nitro, amino, C1-4alkylamino, C1-4-dialkylamino,
carboxy or C1-4alkoxycarbonyl), 1-naphthyl-sulfinyl,
2naphthylsulfinyl and substituted naphthylsulfinyl (where the
naphthyl substituent is selected from C1-4alkyl,
perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino,
C1-4alkylamino, C1-4-dialkylamino, carboxy or C1-4alkoxycarbonyl);
R1 is selected from the group consisting of hydrogen and alkyl; R2
is selected from the group consisting of aminoC.sub.2-5alkyl,
guanidinoC.sub.2-5alkyl, C.sub.1-4alkylguanidinoC.sub.2-5alkyl,
diC.sub.1-4alkylguanidinoC.sub.2-5alkyl, amidinoC.sub.1-4alkyl,
C.sub.1-4alky-lamidinoC.sub.2-5alkyl,
diC.sub.1-4alky-lamidinoC2-5alkyl, C.sub.1-3alkoxyC2-5alkyl,
phenyl, substituted phenyl (where the substituents are
independently selected from one or more of amino, amidino,
guanidino, C.sub.1-4alkylamino, C.sub.1-4dialkylamino, halogen,
perfluoro C.sub.1-4alkyl, C.sub.1-3 alkoxy or nitro), benzyl,
phenyl substituted benzyl (where the substituents are independently
selected from one or more of, amino, amidino, guanidino,
C.sub.1-4dialky-lamino, halogen, perfluoro C.sub.1-4alkyl,
Cl-04alkyl, C.sub.1-3alkoxy or nitro), hydroxyC.sub.2-5alkyl,
C.sub.1-5alkylaminoC.sub.2-5alkyl,
C.sub.1-5dialkylaminoC.sub.2-5alkyl, 4-aminocyclohexylC.sub.O-2
alkyl and C.sub.1-5alkyl; p is 0 or 1; B is ##STR00004## where n is
0-3, R, is H or C.sub.1-Saikyl and the carbonyl moiety of B is
bound to E; E is a heterocycle selected from the group consisting
of oxazolin-2-yl, oxazol-2-yl, thiazol-2-yl, thiazol-5-yl,
thiazol-4-yl, thiazolin-2-yl, imidazol-2-yl,
4-oxo-2-quinoxalin-2yl, 2-pyridyl, 3-pyridyl,
benzo[b]thiophen-2-yl, triazol-4-yl triazol-6-yl, pyrazol-2-yl,
4,5,6,7-tetrahydrobenzothiazol-2yl, naphtho[2,1-d]thiazol-2-yl,
naphtho[1-2-dlthiazoi-2-yl quinoxalin-2-yl, isoquinclin-1-yl,
isoquinolin-3-yl, benzo[b]furan-2-yl, [pyrazin-2-yl,
quinazoiin-2-yl, isothiazol-5-yl, isothiazol-3-yl, purin-8yul and a
substituted heterocycle where the substituents are selected from C,
perfluoro C.sub.1-4alkoxy, C.sub.1-4alkoxy, hydroxy, halo, amido,
nitro, amino, C.sub.1-4alkylamino, carboxy,
C.sub.1-4alkoxycarbonyl, hydroxy or phenylC.sub.1-4
alkylaminocarbonyl; or pharmaceutically acceptable salts
thereof.
10. A method according to claim 9 wherein said compound contains a
d-phenylalanine-proline-arginine sequence.
11. A method according to claim 10 wherein said compound is
(S)--N-Methyl-D-phenylalanyl-N-[4-[(aminoiminomethyl)aminol-1-(2-benzothi-
azolylcarbonyl)butyl-L-prolinamide.
12-68. (canceled)
Description
FIELD OF THE INVENTION
[0001] This invention is related to methods and compositions for
bringing about skin pigmentation and/or for causing skin
depigmentation. More particularly, this invention relates to
compounds which affect melanogenesis and can be used as
depigmenting agents or as agents for darkening skin.
BACKGROUND OF THE INVENTION
[0002] Skin coloring has been of concern to human beings for many
years. In particular, the ability to remove hyperpigmentation, such
as found in age spots, freckles or aging skin generally, is of
interest to individuals desiring a uniform complexion. In certain
areas of the world, general body whitening is desirable. There are
also hypopigmentation and hyperpigmentation disorders that are
desirable to treat. Likewise, the ability to generate a tanned
appearance without incurring photodamage due to solar radiation is
important to many individuals. There have been many methods
proposed to accomplish depigmentation, as well as to accomplish
darkening of the skin. For example, kojic acid, hydroquinone,
retinoids and other chemical compounds have been used for
depigmentation. Dihydroxyacetone and like chemical compounds have
been utilized for their ability to "tan" the skin without exposure
to the sun.
[0003] Many of these previous solutions have not been found
acceptable. There is often a distinct line of demarcation between
the areas of skin to which such previous compositions have been
applied. Therefore, precise application of all these compounds is
necessary in order to achieve the desired result. Many of these
compounds have been found to be quite irritating to the skin and
therefore undesirable for use.
[0004] The understanding of the chemical and enzymatic basis of
melanogenesis is heavily documented. Melanocytes migrate from the
embryonal neural crest into the skin to produce secretory granules,
melanosomes, which produce melanin. Melanogenesis occurs within the
melanosome, and the melanin is later distributed to keratinocytes
via the melanocyte dendrites. The key enzyme in melanogenesis is
tyrosinase, which initiates a cascade of reactions which convert
tyrosine to the biopolymer melanin. Two tyrosinase-related proteins
(TRP's) are known, TRP-1 and TRP-2. These proteins share with
tyrosinase about 40% homology and have catalytic activities as well
as regulatory roles in melanogenesis. TRP-1 is the most abundant
glycoprotein in melanocytes.
[0005] In spite of the fact that the chemical and enzymatic basis
of melanogenesis is well-documented, its regulation at the cellular
level is only partially understood. Tyrosinase and the TRP's share
structural and biological properties with the to
lysosomal-associated membrane protein (LAMP) gene family, therefore
their targeting to the melanosomal membrane might induce their
activation. A phosphorylation/dephosphorylation reaction at the
cytoplasmic tails of these proteins could be involved in the
regulation of melanogenesis. The beta isoform of the Protein Kinase
C (PKC) family has been shown to regulate human melonogenesis
through tyrosinase activation. Gene expression of tyrosinase, TRP-1
and TRP-2 is coordinated. All three enzymes are expressed in human
epidermis. In melanocytes co-cultured with keratinocytes, these
transcripts are expressed at a ratio of 45:45:10, respectively. In
melanocytes cultured alone, only TRP-1 transcripts are present,
indicating that a keratinocyte-derived signal is involved in the
coordinate expression of these genes. The regulation of
keratinocyte-melanocyte interactions and the mechanism of
melanosome transfer into keratinocytes are not yet understood.
[0006] The Protease-activated receptor-2 (PAR-2) is a seven
transmembrane G-protein-coupled receptor, that is related to, but
distinct from the thrombin receptors (TR, also named PAR-1, and
PAR-3) in its sequence. Both receptors are activated
proteolytically by an arginine-serine cleavage at the extracellular
domain. The newly created N-termini then activate these receptors
as tethered ligands. Both receptors could be activated by trypsin,
but only the TRs are activated by thrombin. Only PAR-2 is activated
by mast cell tryptase. Both receptors could also be activated by
the peptides that correspond to their new N-termini, independent of
receptor cleavage. SLIGRL, the mouse PAR-2 activating peptide, is
quipotent in the activation of the human receptor. While the
function of the TR is well documented, the biology of the PAR-2 has
not yet been fully identified. A role for PAR-2 activation in the
inhibition of keratinocyte growth and differentiation has been
recently described (Derian et al., "Differential Regulation of
Human Keratinocyte Growth and Differentiation by a Novel Family of
Protease-activate Receptors", Cell Growth & Differentiation,
Vol. 8, pp. 743-749, July 1997).
SUMMARY OF THE INVENTION
[0007] In accordance with this invention, we have found a method
for affecting changes in mammalian skin pigmentation comprising
topically applying to the skin to of a mammal a compound which
affects the PAR-2 pathway. The compositions of this invention may
contain one or more compounds that act as trypsin, as tryptase, as
serine protease or as PAR-2 agonists, for increase in pigmentation.
Alternatively, they may contain one or more compounds that act as
serine protease inhibitors, trypsin inhibitors, thrombin
inhibitors, tryptase inhibitors, as PAR-2 pathway inhibitors or as
a PAR-2 antagonist for decrease in pigmentation, or
"depigmentation".
[0008] As used herein, "mammal" means any member "of the higher
vertebrate animals comprising the class "Mammalia", as defined in
Webster's Medical Desk Dictionary 407 (1986), and includes but is
not limited to humans. As used herein, "receptor" shall include
both intracellular and extracellular receptors and shall mean those
molecules capable of receiving and transducing a signal. The term
PAR-2 refers to the protease-activated receptor-2 or a related
protease activated receptor.
[0009] The Protease-activated receptor-2 (hereinafter, "PAR-2") is
a serine-protease activated receptor that is expressed in numerous
tissues, including keratinocytes and fibroblasts. The thrombin
receptor (also named PAR-1, hereinafter, "TR") is a serine-protease
activated receptor that is expressed in numerous tissues, including
keratinocytes. The biological roles of PAR-2 and TR in skin are not
entirely known. However, we have found that interactions between
keratinocytes and melanocytes, via the PAR-2 pathway, affect
melanogenesis. We have found that thrombin inhibitors, and/or
tryptase inhibitors, and/or trypsin inhibitors and PAR-2
antagonists can be used as depigmenting agents without irritation
of the skin. PAR-2 agonists and serine proteases such as trypsin
and tryptase can be used as darkening agents. Furthermore, PAR-2
could be useful as a target for whitening and darkening agents.
BRIEF DESCRIPTION OF THE DRAWINGS
[0010] FIG. 1A is a graph depicting the increase or decrease in
relative pigmentation of epidermal equivalents containing
melanocytes treated with known pigmenting and depigmenting agents
in accordance with the methods of this invention.
[0011] FIG. 1B is a graph depicting the increase or decrease in
relative pigmentation in epidermal equivalents containing
melanocytes treated in accordance with the methods and compositions
of this invention.
[0012] FIG. 2 is a group of images of epidermal equivalents
containing melanocytes treated with PAR-2 agonists and Compound
I.
[0013] FIG. 3 is a graph depicting the increase or decrease in
relative pigmentation in epidermal equivalents containing
melanocytes treated in accordance with the methods and compositions
of this invention.
[0014] FIG. 4A is a graph depicting the dose/response with respect
to pigmentation in epidermal equivalents containing melanocytes
when treated with compositions of this invention.
[0015] FIG. 4B is a graph depicting the response of epidermal
equivalents containing melanocytes after exposure to ultraviolet
light followed by treatment with compositions of this
invention.
[0016] FIG. 5A is a photograph depicting gels showing the
expression of TR and PAR-2 in skin, melanoma cells and epidermal
equivalents containing melanocytes.
[0017] FIG. 5B is a photograph depicting gels showing the
expression of TR and PAR-2 by primary human melanocytes.
[0018] FIGS. 6A and 6B are photographs depicting gels showing the
expression of various genes after treatment with different
concentrations of Compound I and SLIGRL.
[0019] FIG. 7 is a graph showing the effects of different
compositions of this invention on the brightness of guinea pig
nipple pigmentation.
[0020] FIG. 8 is a photograph of Yucatan Swine skin which has been
treated with compositions of this invention for depigmentation of
skin.
[0021] FIG. 9 is a graph depicting the brightness of Yucatan Swine
skin during the course of treatment in accordance with the methods
and compositions of this invention.
[0022] FIGS. 10A, 10B, 10C and 10D are photographs of F&M
stained histological sections of Yucatan Swine skin treated with
compositions containing Compound I in accordance with methods of
this invention at concentrations of 0, 10 .mu.M, 50 .mu.M and 250
.mu.M respectively.
[0023] FIGS. 11A, 11B and 11C are photographs of electron
micrographic views of epidermal equivalents containing melanocytes
treated with compositions of this invention.
[0024] FIGS. 11E, 11F and 11H are photographs of electron
micrographic views of Yucatan Swine skin treated with compositions
of this invention.
[0025] FIGS. 11D and 11G are photographs of electron micrographic
views of untreated sites of Yucatan Swine skin.
[0026] FIGS. 12A, 12B, 12C, 12D and 12E are photographs of
histological F&M stained sections of Yucatan Swine skin, as
follows: 12A shows untreated skin; 12B shows skin treated with
compositions of this invention after eight weeks of treatment; 12C
shows skin one week after stopping treatment; 12D shows skin two
weeks after stopping treatment and 12E shows skin four weeks after
stopping treatment.
[0027] FIG. 13 is a photograph of F&M stained histological
sections taken from Yucatan Swine skin treated with compositions of
this invention.
[0028] FIG. 14 contains ultraviolet and visible light digital
photographs of human skin prior to treatment and subsequent to
treatment with compositions of this invention.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0029] We have discovered that trypsin, tryptase and PAR-2 agonists
can be used to increase pigmentation and that trypsin inhibitors,
and/or tryptase inhibitors, and/or thrombin inhibitors and PAR-2
antagonists act to decrease pigmentation in mammalian skin. In our
opinion, some of the compounds described in U.S. Pat. No.
5,523,308, which is hereby incorporated herein by reference, and
behave as thrombin and/or trypsin and/or tryptase inhibitors, will
be useful in methods of this invention. Some of these compounds are
also described in Costanzo, et al., "Potent Thrombin Inhibitors
That Probe the S.sub.1' Subsite: Tripeptide Transition State
Analogues Based on a Heterocycle-Activated Carbonyl Group", J. Med.
Chem., 1996, Vol. 39, pp. 3039-3043 and have the following
structural formula:
##STR00001##
wherein:
[0030] A is selected from the group consisting of C.sub.1-8alkyl,
carboxyC.sub.1-4alkyl, C.sub.1-4alkoxycarbonylC.sub.1-4alkyl,
phenylC.sub.1-4alkyl, substituted phenylC.sub.1-4alkyl (where the
phenyl substituents are independently selected from one or more of,
C.sub.1-4 alkyl, perfluoroC.sub.1-4alkyl, C.sub.1-4alkoxy, hydroxy,
halo, amido, nitro amino, C.sub.1-4alkylamino,
C.sub.1-4dialkylamino, carboxy or C.sub.1-4 alkoxycarbonyl),
formyl, C.sub.1-4alkoxycarbonyl, C.sub.1-2alkylcarbonyl,
phenylC.sub.1-4alkoxycarbonyl, C3-7cycloakylcarbonyl,
phenylcarbonyl, substituted phenylcarbonyl (where the phenyl
substituents are independently selected from one or more of,
C.sub.1-4alkyl, perfluoroC.sub.1-4alkyl, C.sub.1-4alkoxy, hydroxy,
halo, amido, nitro, amino, C.sub.1-4alkylamino,
C.sub.1-4dialkylamino, carboxy or C.sub.1-4 alkoxycarbonyl),
C.sub.1-4alkylsulfonyl, C.sub.1-4alkoxysulfonyl,
perfluoroC.sub.1-4alkyl-sulfonyl, phenylsulfonyl, substituted
phenylsulfonyl (where the phenyl substituents are independently
selected from one or more of, C.sub.1-4alkl,
perfluoroC.sub.1-4alkyl, C.sub.1-4alkoxy, hydroxy, halo, amido,
nitro, amino, C.sub.1-4-alkylamino, C.sub.1-4dialkylamino, carboxy
or C.sub.1-4 alkoxycarbonyl), 10-camphorsulfonyl,
phenylC.sub.1-4alkysulfonyl, substituted
phenylC.sub.1-4alkysulfonyl, C.sub.1-4alkylsulfinyl,
perfluoroC.sub.1-4alkylsulfinyl, phenylsulfinyl, substituted
phenylsulfinyl (where the phenyl substituents are independently
selected from one or more of, C.sub.1-4alkyl,
perfluoroC.sub.1-4alkyl, C.sub.1-4alkoxy, hydroxy, halo, amido,
nitro, amino, C.sub.1-4alkylamino, C.sub.1-4dialkylamino, carboxy
or C.sub.1-4alkoxycarbonyl), phenylC.sub.1-4alkylsulfinyl,
substituted pehnylC.sub.1-4alkylsulfinyl, 1-naphthylsulfonyl,
2-naphthylsulfonyl or substituted naphthylsulfonyl (where the
naphthyl substituents are independently selected from one or more
of, C.sub.1-4alkyl, perfluoroC.sub.1-4alkyl, C.sub.1-4alkoxy,
hydroxy, halo, amido, nitro, amino, carboxy or
C.sub.1-4alkoxy-carbonyl), 1-naphthylsulfinyl, 2-naphthylsulfinyl
or substituted naphthylsulfinyl (where the naphthyl substituents
are independently selected from one or more of, C.sub.1-4alkyl,
perfluoroC.sub.1-4alkyl, C.sub.1-4alkoxy, hydroxy, halo, amido,
nitro, amino, C.sub.1-4alkylamino, C.sub.1-4dialkylamino, carboxy
or C.sub.1-4alkoxycarbonyl); a D or L amino acid which is coupled
as its carboxy terminus to the nitrogen depicted in formula I and
is selected from the group consisting of alanine, asparagine,
2-azetidinecarboxytic acid, glycine, N--C.sub.1-8alkyglycine,
proline, 1-amino-1-cycloC.sub.3-8alkylcarboxylic acid,
thiazolidine-4-carboxylic acid,
5,5-dimethylthiazolidine-4-carboxylic acid,
oxazolidine-4-carboxylic acid, pipecolinic acid, valine,
methionine, cysteine, serine, threonine, norleucine, leucine,
tert-leucine, isoleucine, phenylalanine, 1-naphthalanine,
2-naphthalamine, 2-thienylalanine, 3-thienylalanine,
[1,2,3,4]-tetrahydroisoquinoline-1-carboxylic acid and
1,2,3,4]-tetrahydroisoquinoline-2-carboxylic acid
[0031] where the amino terminus of said amino acid is connected to
a member selected form the group consisting of C.sub.1-4alkyl,
tetrazol-5-yl-C.sub.1-2alkyl, carboxytC.sub.1-4alkyl,
C.sub.1-4alkoxycarbonylC14alkyl, phenylC.sub.1-4alkyl, substituted
phenyl C.sub.1-4 alkyl (where the phenyl substituents are
independently selected from one or more of, C.sub.1-4alkyl,
perfluoroC.sub.1-4alkyl, C.sub.1-4alkoxy, hydroxy, halo, amido,
nitro, amino, C.sub.1-4alkylamino, C.sub.1-4dialkylamino, carboy or
C.sub.1-4alkoxycarbonyl), 1,1-diphenylC.sub.1-4alkyl,
3-phenyl-2-hydroxypropionyl, 2,2-diphenyl-1-hydroxyethylcarbonyl,
[1,2,3,4]-tetrahydroisoquinoline-[1,2,3,4]-tetrahydroisoquinoline-3,
carbonyl, 1-methylamino-1-cyclohexanecarbonyl,
1-hydroxy-1-cyclohexanecarbonyl, 1-hydroxy-1-pheny-lacetyl,
1-cyclohexyl-1-hydroxyacetyl, 3-phenyl-2-hydroxypropionyl,
3,3-diphenyl-2-hydroxypropionyl, 3-cyclohexyl-2-hydroxypropionyl,
formyl, C.sub.1-4alkoxycarbonyl, C.sub.1-12alkylcarbonyl,
perfluoroC.sub.1-4alkyl, C.sub.1-4alkylcarbonyl,
phenylC.sub.1-4alkylcarbonyl, substituted
phenylC.sub.1-4alkylcarbonyl (where the phenyl substituents are
independently selected from one or more of, C.sub.1-4alkyl,
perfluoroC.sub.1-4alkyl, C.sub.1-4alkoxy, hydroxy, halo amido,
nitro amino, C.sub.1-4alkylamino, C.sub.1-4dialkylamino, carboxy or
C.sub.1-4alkoxycarbonyl) 1,1-diphenylC.sub.1-4alkylcarbonyl,
substituted 1,1-diphenylC.sub.1-4alkylcarbonyl (where the phenyl
substituents are independently selected from one or more of,
C.sub.1-4alkyl, perfluoro C.sub.1-4alkyl, C.sub.1-4alkoxy, hydroxy,
halo, amido, nitro, amino, C.sub.1-4alkylamino,
C.sub.1-4dialkylamino, carboxy or C.sub.1-4 alkoxy-carbonyl),
perfluoroC.sub.1-4alkysulfonyl, C.sub.1-4alkysulfonyl,
C.sub.1-4alkoxysulfonyl, phenysulfonyl, substituted phenylsulfonyl
(where the phenyl substituents are independently selected from one
or more of, C-1alkyl, perfluoro C.sub.1-4alkylamino,
C.sub.1-4dialkylamino, carboxy or C.sub.1-4alkoxycarbonyl),
10-camphorsulfonyl, phenylC.sub.1-4alkylsulfonyl, substituted
phenylC.sub.1-4alkylsufonyl, perfluoroC.sub.1-4alkysulfinyl,
C-14alkysulfinyl, phenylsulfinyl, substituted phenysulfinyl (where
the phenyl substituents are independently selected from one or more
of, C.sub.1-4alkyl, perfluoro C.sub.1-4alkyl, C.sub.1-4 alkoxy,
hydroxy, halo, amido, nitro, amino, C.sub.1-4 alkylamino, C.sub.1-4
dialkylamino, carboxy or C.sub.1-4 alkoxycarbonyl),
1-naphthylsulfinyl, 2-naphthylsulfonyl, and substituted
naphthylsulfonyl (where the naphthyl substituents are independently
selected from one or more of, C.sub.1-4alkyl,
perfluoroC.sub.1-4alkyl, C.sub.1-4alkoxy, hydroxy, halo, amido,
nitro, amino, C.sub.1-4alkylamino, C.sub.1-4dialkylamino, carboy or
C.sub.1-4alkoxycarbonyl), 1-naphthysulfinyl, 2-naphthysulfinyl, and
substituted naphthylsulfinyl (where the naphthyl substituents are
independently selected from one or more of, C.sub.1-4alkyl,
perfluoroC.sub.1-4alkyl, C.sub.1-4alkoxy, hydroxy, halo amido,
nitro, amino, C.sub.1-4alkylamino, C104dialkylamono, carboxy or
C-14alkoxycarbonyl): or a poly peptide comprised of two amino
acids,
where the first amino acid is a D or L amino acid, bound via its
carboxy terminus to the nitrogen depicted in Formula I and is
selected from the group consisting of glycine,
N--C.sub.1-8alkylglycine, alanine, 2-azetidinecarboxylic acid,
proline, thiazolidine-4-carboxylic acid,
5.5-dimethylthiazolidine-4-carboxylic acid,
oxazolidine-4-carboxylic acid, 1-amino-1-cycloC.sub.3-8
alkylcarboxylic acid, 3-hydroxypropoline, 4-hydroxyproline,
3-(C.sub.1-4alkoxy)proline, 4(C.sub.1-4alkoxy)proline,
3,4-dehydroprline, 2,2-dimethyl-4-thiazolidine carboxylic acid,
2.2-dimethyl-4-oxadolidine carboxylic acid, pipecolinic acid,
valine, methionine, cysteine, asparagine, serine, threonine,
leucine, tert-leucine, isoleucine, phenylalanine, 1-naphthalanine,
2-naphthalanine, 2-thienylalanine, 3-thienylalnine,
[2,3,4]-tetrahydroisoquinoline-2-carboxylic acid, aspartic
acid-4-C.sub.1-4alkyl ester and glutamic acid 5-C.sub.1-4alkyl
ester and the second D or L amino acid, is bound to the amino
terminus of said first amino acid, and is selected from the group
consisting of phenylalanine, 4-benzolyphenylalanine,
4-carboxyphenylalanine, 4-(Carboxy C1-2alkyl)phenylalanine,
substituted phenylalanine (where the phenyl substituents are
independently selected from one or more of C.sub.1-4alkyl,
perfluoroC.sub.1-4alkyl, C.sub.1-4alkoxy, hydroxy, halo, amido,
nitro, amino, C.sub.1-4alkylamino, C.sub.1-4dialkylamino, carboxy
or C.sub.1-4alkoxycarbonyl), 3-benzothienylalanine,
4-biphenylalanine, homophenylalanine, octahydroindole-2-carboxylic
acid, 2-pyridylalanine, 3-pyridylalanine, 4-thiazolyalanine,
2-thienylalanine, 3-(3-benzothienyl)alanine, 3-thienylalanine,
tryptophan, tyrosine, asparagine, 3-tri-C.sub.1-4alkylsilylalanine,
cyclohexylglycine, diphenylglycine, phenylglycine, methionine
sulfoxide, methionine sulfone, 2,2-dicyclohexylalanine,
2-(1-naphthylalanine), 2-(2-naphthylalanine), phenyl substituted
phenylalanine (where the substituents are selected from
C.sub.1-4alkyl, perfluoroC.sub.1-4alkyl, C.sub.1-4alkoxy, hydroxy,
halo, amido, nitro, amino, C.sub.1-4alkylamino,
C.sub.1-4dialylamino, carboxy or C.sub.1-4 alkoxycarbonyl),
aspartic acid, aspartic acid-4C.sub.1-4alkyl,
perfluoroc.sub.1-4alkyl, C.sub.1-4alkoxy, hydroxy, halo, amido,
nitro, amino, C.sub.1-4alkylamino, C.sub.1-4dialkylamino, carboxy
or C.sub.1-4alkoxycarbony), aspartic acid, aspartic
acid-4-C.sub.1-4alkyl ester glutamic acid, glutamic
acid-5-C.sub.1-4 alkyl ester, cycloC3-salkylaalanine, substituted
cycloC.sub.3-8alkylalanine (where the ring substituents are
carboxy, C.sub.1-4 alkyl ester, cycloC3-salkylalanine, substituted
cycloC.sub.3-8alkylalanine (where the ring substituents are
carboxy, C.sub.1-4alkylcarboxy, C.sub.1-4alkoxycarbonyl or
aminocarbonyl), 2,2-diphenylalanine and all alpha-C.sub.1-5alkyl of
all amino acid derivatives thereof, where the amino terminus of
said second amino acid is unsubstituted or monosubstituted with a
member of the group consisting of formyl, C1-12 alkyl,
tetrazol-5-ylC1-2alkyl, carboxyC1-8 alkyl,
carboalkoxyC.sub.1-4alkyl, phenyl C.sub.1-4alkyl, substituted
phenylC.sub.1-4alkyl (where the phenyl substituents or
independently selected from one or more of, C.sub.1-4alkyl,
perfluoroC.sub.1-4alkyl, C.sub.1-4alkoxy, hydroxy, halo, amido,
nitro, amino, C.sub.1-4alkylamino, C.sub.1-4dialkylamino, carboxy
or C.sub.1-4alkoxycarbonyl), C1-6alkoxycarbonyl,
phenylC1-6alkoxycarbonyl, C1-2alkylcarbonyl,
perfluoroC1-4alkylCo-4alkylcarbonyl, phenyC.sub.1-4alkylcarbonyl,
substituted phenyC.sub.1-4alkylcarbonyl (where the phenyl
substituents are independently selected from one or more of
C.sub.1-4alkyl, perfluoro C.sub.1-4alkyl, C.sub.1-4 alkoxy,
hydroxy, halo, amido, nitro, amino, C.sub.1-4alkylamino,
C.sub.1-4dialkylamino, carboxy or C.sub.1-4alkoxycarbonyl),
1,1-dipenylC.sub.1-4alkyl, perfluoroC.sub.1-4alkyl,
C.sub.1-4alkoxycarbonyl), 10-camphorsulfonyl,
phenylC.sub.1-4alkysulfonyl, substituted
phenylC.sub.1-4alkylsulfonyl, C.sub.1-4alkysulfinyl, perfluoro
C.sub.1-4alkylsulfinyl, phenylsulfinyl, substituted phenylsulfinyl
(where the phenyl substituents are independently selected from one
or more of, C.sub.1-4alkyl, perfluoroC.sub.1-4alkyl,
C.sub.1-4alkoxy, hydroxy, halo, amido, nitro, amino,
C.sub.1-4alkylamono, C.sub.1-4-dialkylamono, carboxy or
C.sub.1-4alkoxycarbonyl), phenyC.sub.1-4alkylsulfinyl, substituted
phenylC.sub.1-4alkylsulfinyl 1-naphthylsulfonyl,
2-naphthylsulfonyl, substituted naphthylsulfonyl (where the
naphthyl substituent is selected from C.sub.1-4alkyl,
perfluoroC.sub.1-4alkyl, C.sub.1-4alkoxy, hydroxy, halo amido,
nitro, amino, C.sub.1-4dialkylamino, carboxy or
C.sub.1-4alkoxycarbonyl), 1-haphthylsulfinyl, 2-haphthylsulfinyl
and substituted naphthyl-sulfinyl (where the naphthyl substituent
is selected from C.sub.1-4 alkyl, perfluoroC.sub.1-4 alkyl,
C.sub.1-4alkoxy, hydroxy, halo, amido, nitro, amino,
C.sub.1-4alkylamino, C-14dialkylamino, carboxy or
C.sub.1-4alkoxycarbonyl); R.sub.1 is selected from the group
consisting of hydrogen and alkyl; R.sub.2 is selected from the
group consisting of aminoC2-salkyl, guanidinoC.sub.2-5alkyl,
C.sub.1-4-alkylguanidinoC.sub.2-5alkyl,
diC.sub.1-4alkylguanidinoC.sub.2-5alkyl, amidinoC.sub.2-5-alkyl,
C.sub.1-4alky-lamidinoC.sub.2-5alkyl,
C.sub.1-3alkoxyC.sub.2-5-alkyl, phenyl, substituted phenyl (where
the substituents are independently selected from one or more of
amino, amidino, guanidino, C.sub.1-4alkylamino,
C.sub.1-4dialkylamino, halogen, perfluoro C.sub.1-4alkyl,
C.sub.1-4alkyl, C.sub.1-3 alkoxy or nitro), benzyl, phenyl
substituted benzyl (where the substituents are independently
selected from one or more of, amino, amidino, guanidino,
C.sub.1-4-alkylamino, C.sub.1-4dialkylamino, halogen, perfluoro
C.sub.1-4alkyl, C.sub.1-3alkoxy or nitro), hydroxyC.sub.2-5alkl,
C'.sub.1-5alkylaminoC.sub.2-5alkyl,
C.sub.1-5dialkylaminoC.sub.2-5alkyl,
4-aminacyclohexylC.sub.0-2alkyl and C.sub.1-5alkyl;
[0032] p is 0 or 1;
[0033] B is
##STR00002##
[0034] where n is 0-3, R.sub.3 is H or C1-5alkyl and the carbonyl
moiety of B is bound to E;
E is a heterocycle selected from the group consisting of
oxazolin-2-yl, oxazol-2-yl, thiazol-2-yl, thiazol-5-yl,
thiazol-4-yl, thiazolin-2-yl, imidazol-2-yl,
4-oxo-2-quinoxalin-2yl, 2-pyridyl, 3-pyridyl,
benzo[b}thiophen-2-yl, triazol-4-yl triazol-6-yl, pyrazol-2-yl,
4,5,6,7-tetrahydrobenzothiazol-2yl, naphtho[2,1-d]thiazol-2-yl,
naphtho[1-2-d]thiazol-2-ylquinoxalin-2-yl, isoquinolin-1-yl,
isoquinolin-3-yl, benzo[b]furan-2-yl, [pyrazin-2-yl,
quinazolin-2-yl, isothiazol-5-yl, isothiazol-3-yl, purin-8yul and a
substituted heterocycle where the substituents are selected from
C.sub.1-4 from C-14alky, perfluoro C.sub.1-4alkyl, C.sub.1-4alkoxy,
hydroxy, halo, amido, nitro, amino, C.sub.1-4alkylamino,
C.sub.1-4dialkylamino, carboxy, C.sub.1-4alkoxycarbonyl, hydroxy or
phenylC.sub.1-4 alkylaminocarbonyl;
[0035] or pharmaceutically acceptable salts thereof.
[0036] More particularly, in our opinion, some of the compounds of
the foregoing formula containing a d-phenylalanine-proline-arginine
motif should be effective in inhibiting the PAR-2 pathway and
causing depigmentation. One particularly preferred compound which
acts as a thrombin and trypsin inhibitor and is active in
depigmenting mammalian skin is
(S)--N-Methyl-D-phenylalanyl-N-[4-[(aminoiminomethyl)amino)-1-(2--
benzothiazolylcarbonyl)butyl]-L-prolinamide (Chemical Abstracts
name) (hereinafter referred to as "Compound I"). We suggest that
other compounds which are analogs or function similarly to Compound
I and are set forth in U.S. Pat. No. 5,523,308 may be active in the
methods and compositions of this invention. Other compounds that
inhibit trypsin, such as serine protease inhibitors, and in
particular, soybean trypsin inhibitor (STI) will also be useful in
methods of this invention. Soybean, limabean and blackbean
extracts, and other natural products made from these beans, such
as, but not limited to, bean milk, bean paste, miso and the like,
also serve to reduce pigmentation by this mechanism.
[0037] Additional sources of serine protease inhibitors may be
extracted from the species belonging to the following plant
families: Solanaceae (e.g., potato, tomato, tomatilla, and the
like); Gramineae (e.g., rice, buckwheat, sorghum, wheat, barley,
oats and the like); Cucurbitaceae (e.g., cucumbers, squash, gourd,
luffa and the like); and, preferably, Leguminosae (e.g., beans,
peas, lentils, peanuts, and the like).
[0038] While not willing to be bound by the following theory, we
theorize that the compounds capable of affecting the pigmentation
of the skin do so by interacting directly or indirectly with the
keratinocyte PAR-2 or with its activating protease, and thereby
affect melanogenesis, directly or indirectly. Possibly, the
compounds of this invention induce, in the case of increased
pigmentation or reduce, in the case of decreased pigmentation, the
signal to transport melanosomes by melanocytes, or to receive
melanosomes by keratinocytes in the skin.
[0039] The compounds which are active in the compositions and
methods of this invention may be delivered topically by any means
known to those of skill in the art. If the delivery parameters of
the topically active pharmaceutical or cosmetic agent so require,
the topically active composition of this invention may preferably
be further composed of a pharmaceutically or cosmetically
acceptable vehicle capable of functioning as a delivery system to
enable the penetration of the topically active agent into the
skin.
[0040] One acceptable vehicle for topical delivery of some of the
compositions of this invention, particularly proteins such as
trypsin and STI, may contain liposomes. The liposomes are more
preferably non-ionic and contain a) glycerol dilaurate (preferably
in an amount of between about 5% and about 70% by weight); b)
compounds having the steroid backbone found in cholesterol
(preferably in an amount of between about 5% and about 45% by
weight); and c) one or more fatty acid ethers having from about 12
to about 18 carbon atoms (preferably in an amount of between about
5% and about 70% by weight collectively), wherein the constituent
compounds of the liposomes are preferably in a ratio of about
37.5:12.5:33.3:16.7. Liposomes comprised of glycerol
dilaurate/cholesterol/polyoxyethylene-10-stearyl
ether/polyonfethylene-9-lauryl ether (GDL liposomes) are most
preferred. Preferably the liposomes are present in an amount, based
upon the total volume of the composition, of from about 10 mg/mL to
about 100 mg/mL, and more preferably from about 20 mg/mL to about
50 mg/mL. A ratio of about 37.5:12.5:33.3:16.7 is most preferred.
Suitable liposomes may preferably be prepared in accordance with
the protocol set forth in Example 1, though other methods commonly
used in the art are also acceptable. The above described
composition may be prepared by combining the desired components in
a suitable container and mixing them under ambient conditions in
any conventional high shear mixing means well known in the art for
non-ionic liposomes preparations, such as those disclosed in
Niemiec et al., "Influence of Nonionic Liposomal Composition On
Topical Delivery of Peptide Drugs Into Pilosebacious Units: An In
Vivo Study Using the Hamster Ear Model," 12 Pharm. Res. 1184-88
(1995) ("Niemiec"), which is incorporated by reference herein in
its entirety. We have found that the presence of these liposomes in
the compositions of this invention may enhance the depigmenting
capabilities of som of the compositions of this invention.
[0041] Other preferable formulations may contain, for example,
soybean milk or other liquid formulations derived directly from
legumes or other suitable plant. For example, such a formulation
may contain a large proportion of soybean milk, an emulsifier that
maintains the physical stability of the soybean milk, and,
optionally a chelating agent, preservatives, emollients, humectants
and/or thickeners or gelling agents.
[0042] Oil-in-water emulsions, water-in-oil emulsions,
solvent-based formulations and aqueous gels known to those of skill
in the art may also be utilized as vehicles for the delivery of the
compositions of this invention.
[0043] The source of active compound to be formulated will
generally depend upon the particular form of the compound. Small
organic molecules and peptidyl fragments can be chemically
synthesized and provided in a pure form suitable for is
pharmaceutical/cosmetic usage. Products of natural extracts can be
purified according to techniques known in the art. Recombinant
sources of compounds are also available to those of ordinary skill
in the art.
[0044] In alternative embodiments, the topically active
pharmaceutical or cosmetic composition may be optionally combined
with other ingredients such as moisturizers, cosmetic adjuvants,
anti-oxidants, bleaching agents, tyrosinase inhibitors and other
known depigmentation agents, surfactants, foaming agents,
conditioners, humectants, fragrances, viscosifiers, buffering
agents, preservatives, sunscreens and the like. The compositions of
this invention may also contain active amounts of retinoids (i.e.,
compounds that bind to any members of the family of retinoid
receptors), including, for example, tretinoin, retinal, esters of
tretinoin and/or retinol and the like.
[0045] The topically active pharmaceutical or cosmetic composition
should be applied in an amount effective to affect changes in the
pigmentation of mammalian skin. As used herein "amount effective"
shall mean an amount sufficient to cover the region of skin surface
where a change in pigmentation is desired. Preferably, the
composition is liberally applied to the skin surface such that,
based upon a square cm of skin surface, from about 2 .mu.l/cm.sup.2
to about 200 .mu.l/cm.sup.2 of topically active agent is present
when a change in pigmentation is desired. When using a thrombin and
trypsin inhibitor such as Compound I or its analogs, whether
synthetically- or naturally-derived in a formulation, such an
active compound should be present in the amount of from about
0.0001% to about 15% by weight/volume of the composition. More
preferably, it should be present in an amount from about 0.0005% to
about 5% of the composition; most preferably, it should be present
in an amount of from about 0.001 to about 1% of the composition. Of
course, these ranges are suggested for the foregoing components.
The lower set of ranges is intended to be efficacious for PAR-2
pathway agonists/antagonists and/or inhibitors having high
therapeutic indices and which do not require significantly larger
concentrations or doses to be effective in the methods of this
invention. Such compounds may be synthetically- or
naturally-derived.
[0046] Liquid derivatives and natural extracts made directly from
plants or botanical sources may be employed in the compositions of
this invention in a concentration (w/v) from about 1 to about 99%.
Fractions of natural extracts and naturally-derived protease
inhibitors such as STI may have a different preferred range, from
about 0.01% to about 20% and, more preferably, from about 1% to
about 10% of the composition. Of course, mixtures of the active
agents of this invention may be combined and used together in the
same formulation, or in serial applications of different
formulations.
[0047] We have unexpectedly found that when topically active
agents, such as PAR-2 agonists and/or inhibitors and trypsin and/or
thrombin and/or tryptase and/or their inhibitors, are topically
applied to an animal's skin, a significant change in pigmentation
was achieved. Preferably, depigmenting agents (as w II as other
pigmentation-affecting agents of this invention) are applied to the
skin of a mammal at a relatively high concentration and dose (from
about 0.005% to about 1% for compounds having high therapeutic
indices such as Compound I and related compounds; from about 20% to
about 99% for liquid derivatives and extracts of botanical
materials; and from about 1% to about 20% for fractions of natural
extracts and naturally-derived protease inhibitors such as STI or
mixtures thereof) between one and two times daily for a period of
time until the skin evidences a change in pigmentation. This may be
for from about four to about ten weeks or more. Thereafter, once
the change in pigmentation has been achieved, a lower concentration
and dose (from about 0.00001% to about 0.005% for compounds having
high therapeutic indices such as Compound I and related compounds;
from about 10% to about 90% for liquid derivatives and extracts of
botanical materials; and from about 0.01% to about 5% for fractions
of natural extracts and naturally-derived protease inhibitors such
as STI or mixtures thereof), of active ingredient may be applied on
a less frequent time schedule, e.g., about once per day to about
twice per week. The effects of the active agents of this invention
are reversible, therefore, in order to maintain these effects,
continuous application or administration should be performed. The
invention illustratively disclosed herein suitably may be practiced
in the absence of any component, ingredient, or step which is not
specifically disclosed herein.
[0048] Several examples are set forth below to further illustrate
the nature of the invention and the manner of carrying it out, but
do not serve to limit the scope of the methods and compositions of
this invention.
Example 1
Protease Inhibitors Affect Pigmentation
[0049] In order to study the possible roles of the PAR-2 pathway in
pigmentation, an in vitro epidermal equivalent system was used. The
epidermal equivalent system used contained melanocytes. One
epidermal equivalent system which is useful in performing this
study is the MelanoDerm system, available commercially from MatTek
Co. This system contains human normal melanocytes, together with
normal, human-derived epidermal keratinocytes, which have been
cultured to form a multi-layered, highly differentiated model of
the human epidermis. In the following examples, equivalents were
treated with test compounds for three days and samples were
harvested on the fourth day after beginning of treatment. The
harvested equivalents were stained with DOPA (a substrate for
tyrosinase) and H&E (a standard histological stain) or with
Fontana-Mason (F&M) staining, another stain known to those of
skill in the art. F&M staining is a silver staining technique
that clearly and cleanly marks melanins which have high silver
nitrate reducing activity. Multilayered human epidermal equivalents
containing melanocytes were used as an in vitro model system to
study the effect of protease inhibitors on melanogenesis. Epidermal
equivalents used were commercially available as MelanoDerm from
MatTek of Ashland, Mass. These equivalents are known to respond to
ultraviolet B ("UVB") irradiation and known whitening agents such
as benzaldehyde and hydroquinone by increasing and reducing
pigmentation, respectively. The MelanoDerm epidermal equivalents
were exposed to benzaldehyde (available from Sigma of St. Louis,
Mo.), hydroquinone (available from Sigma) and UVB irradiation. UV
irradiation was performed with a UVB FS light source in an exposure
chamber, with plate covers removed and Phosphate-buffered saline
(PBS, from Gibco-BRL, Gaithersburg, Md.) present in the lower
chamber. UVB intensity was measured with a UVX radiometer (UVP
Inc., San Gabriel, Calif.). Equivalents were treated with 0.1-0.12
J/cm.sup.2. No loss of viability was observed in equivalents
treated with up to 0.3 J/cm.sup.2.
[0050] On the fourth day of exposure to the test
compounds/ultraviolet irradiation, the equivalents were fixed,
sectioned and stained, or stained as whole without sectioning.
MelanoDerm equivalents were formalin fixed and put in paraffin
blocks, and sections from the MelanoDerm equivalents were stained
in accordance with the following standard procedures: (1) H&E,
(2) DOPA+H&E and (3) Fontana-Mason ("F&M") using standard
techniques known to those of skill in the art. Alternatively, whole
MelanoDerm equivalents were stained and their images were captured
for image analysis. At least three sections per equivalent, thre
equivalents per experiment were processed. Each experiment was
repeated three time. DOPA is a substrate for tyrosinase. F&M
identifies silver nitrate reducing molecules, which identifies
primarily melanins. F&M stained sections were used for image
analysis using Optomax Image Analysis Systems, from Optomax Inc.,
Hollis, N.H. Alternatively, Empire Images database 1.1 was used on
a Gateway 2000 P5-100 computer (Media Cybernetics, Silver Springs,
Md.) for capturing images. Image Pro Plus version 4.0 was used for
image analysis. Parameters measured were as follows: (1) level of
pigmentation within individual melanocytes and (2) number of
pigmented melanocytes per field, for the Optomax system, or (1) the
surface area of silver deposits within melanocytes and (2) the
number of pigmented melanocytes for the image Pro system. Using the
Optomax system, surface area of silver deposits within individual
melanocytes was measured in 60 melanocytes, using multiple sections
from triplicate equivalents per treatment. The number of
melanocytes per field was calculated in these sections. A
"pigmentation factor" was defined as the average surface area of
silver deposits within an individual melanocyte, multiplied by the
number of pigmented melanocytes per field. A value of one was
assigned to untreated controls, and values of treatment groups were
normalized to their relevant controls. Using the Image Pro system,
surface area of is silver nitrate deposits and number of
melanocytes were measured for whole equivalents. A value of one was
assigned to untreated controls and values of treatment groups were
normalized to their relevant controls.
[0051] FIG. 1A is a graph depicting the increase or decrease in
relative pigmentation, as measured and calculated by the whole
equivalent/Image Pro system, as set forth above, when exposed to
benzaldehyde (50 .mu.M), hydroquinone (50 .mu.M) and UVB
irradiation (0.12 J/cm.sup.2).
[0052] The human epidermal equivalents were also exposed to
mixtures of protease inhibitors, said protease inhibitors are set
forth in Table A below. The protease inhibitors were available from
Boehringer Mannheim of Indianapolis, Ind. Complete.RTM. Protease
Inhibitor Cocktail tablets available from Boehringer Mannheim were
used, containing inhibitors of chymotrypsin, thermolysin, papain,
pronase, pancreatic extract and trypsin. Soybean trypsin inhibitor
("STI") was available from Sigma and was dissolved in a 50 mg/ml
liposome vehicle or in 1.times.PBS. All other protease inhibitors
used in this in vitro example were dissolved in 1.times.PBS. GDL
liposomes were prepared as set forth in Niemic, at al, above, with
the exception of the following changes: the non-ionic liposomal
formulation contained glycerol dilaurate (Emulsynt GDL, ISP Van
Dyk)/cholesterol (Croda)/polyoxyethylene-10-stearyl ether (Brij76,
ICI)/polyoxyethylene-9-lauryl ether, as at ratio of
37.5:12.5:33.3:16.7. Hepes buffer, 0.05M, pH 7.4 (Gibco-BRL of
Gaithersburg, Md.) was used as the aqueous phase in the preparation
of the liposomes. These mixtures of protease inhibitors and
different combinations of serine protease inhibitors were tested
for their ability to affect melanogenesis. As set forth in FIG. 1B,
some of the serine protease inhibitors, particularly STI (soybean
trypsin inhibitor), were very effective in inhibiting
melanogenesis.
TABLE-US-00001 TABLE A Test Formulation Ingredients Complete .RTM.
Total protease inhibitor mixture - x25 Mix-1 Serine Protease
inhibitors - 90 .mu.g/mL Phenylmethyl-sulfonyl fluoride ("PMSF")
and 50 .mu.g/mL L-1-Chloro-3-[4-tosylamido]-4-phenyl- butanone
("TPCK") Mix-2 Serine protease inhibitors - 0.1 .mu.g/mL aprotinin,
50 .mu.g/mL Soybean trypsin inhibitor ("STI"), 0.5 .mu.g/mL
leupeptin and 0.25 .mu.g/mL (L-1-Chloro-3-[4-tosylamido]-7-amino-2-
heptanone-HCl) ("TLCK") STI Soybean trypsin inhibitor - 1 mg/ml
Example 2
A Protease-Activated Receptor is Involved in Pigmentation
[0053] Example 1 demonstrates that STI reduces pigmentation. STI
inhibits trypsin. Because trypsin is known to activate TR and
PAR-2, we tested the possible involvement of TR and PAR-2 in
pigmentation. MelanoDerm human epidermal equivalents were treated
with the TR and PAR-2 agonists and antagonists set forth in Table B
below daily for three days. On the fourth day, the samples were
harvested, fixed, and DORA, H&E or F&M staining was
performed. Histological and whole-equivalent examination revealed
changes in pigmentation following the treatments. FIG. 2 depicts
the results of this example. As shown therein, the PAR-2 peptide
agonist SLIGRL induced pigmentation in individual melanocytes.
Treatment with Compound I, an inhibitor of thrombin and trypsin,
resulted in decreased pigmentation.
[0054] FIG. 3 shows the results of the studies set forth in this
example, representing the level of pigmentation in MelanoDerm
equivalents treated with TR and PAR-2 reagents. SLIGRL, a PAR-2
agonist, dramatically increased pigmentation, indicating that PAR-2
might be involved in pigmentation. Hirudin, a thrombin-specific
inhibitor, and TFLLRNPNDK, a TR selective agonist had no effect on
pigmentation. However, SFLLRN, a less specific TR agonists, showed
a trend of lightening or reducing pigmentation. This indicates that
TR is less likely to be involved in pigmentation.
TABLE-US-00002 TABLE B TR and PAR-2 Reagents Description Thrombin
Activates TR Trypsin Activates TR and PAR-2 TFLLRNPNDK TR peptide
agonist - activates TR only SLIGRL PAR-2 peptide agonist -
activates PAR-2 only SFLLRN TR peptide agonist - activates TR,
cross-reacts with PAR-2 FSLLRN Scrambled peptide - inactive Hirudin
Specific inhibitor of thrombin Compound I Thrombin and trypsin
inhibitor
Example 3
A Dose-Response Relation Between Protease-Activated Receptors
Signaling and Melanogenesis
[0055] MelanoDerm equivalents were treated with increasing
concentrations of SLIGRL, the PAR-2 peptide agonist, at 0, 10 and
50 .mu.M in the same manner as set forth in Example 2. F&M
staining was performed in the fourth day. As shown in FIG. 4A,
increasing concentrations of SLIGRL, the PAR-2 activator, result in
increased pigmentation. Trypsin, a PAR-2 activator, has the same
effect. Treatment with increasing concentrations of Compound I, the
thrombin and trypsin inhibitor, from 0.1 pM to 1 .mu.M resulted in
decreasing pigmentation (see FIG. 4A). Pretreatment of the
equivalents with UVB irradiation increased melanogenesis, relative
to untreated controls. Compound I was able to reduce this
UVB-induced pigmentation as well (FIG. 4B). This example
demonstrates a dose-response relation for increasing and decreasing
pigmentation with the modulation of PAR-2 signaling. This example
also demonstrates that Compound I can inhibit pigmentation and
prevent UV-induced pigmentation.
Example 4
PAR-2 is Expressed in Keratin Cytes, but not in Melanocytes
[0056] PAR-2 and TR expression have been demonstrated previously in
keratinocytes and fibroblasts. This example demonstrates that PAR-2
is expressed in keratinocytes, but not in melanocytes. Furthermore,
it demonstrates that TR is expressed in both keratinocytes and
melanocytes. In order to demonstrate this, MelanoDerm human
epidermal equivalents, human primary melanocyte cultures (neonatal
and adult, from Clonetics of San Diego, Calif.) and Cloudman S91
mouse melanoma cells from ATCC of Rockville, Md. were grown in
culture and total RNAs were extracted using "RNA Stat-60" reagent
available from "Tel-Test B", Incorporated as described in
Chomczymski, "Single Step Method of RNA Isolation by Acid
Guanidinium Thiocyanate-phenol-chloroform extraction," 162 Anal.
Biochem. 156-69 (1987). A sufficient amount of RNase-free DNase
available from Promega Corporation under the tradename "RQ1
RNase-free DNase" was then added to the extracted RNA from each
sample such that each respective product will yield 200 ng of
DNased-RNA using the procedure set forth in "RNase-free DNase",
protocol published by Promega Corporation (May, 1995). The
resulting 200 ng of DNased-RNA was reverse transcribed ("RT") via
the procedure set forth in "Superscript II Reverse Transcriptase" a
protocol published by Gibco-BRL (now Life Technologies,
Incorporated) (April 1992), using random hexamers such as the
random primers which are commercially available from Life
Technologies, Incorporated.
[0057] The resulting RT products were then amplified via polymerase
chain reaction ("PCR") using about a 0.5 unit (per 100 .mu.l
reaction) of a thermostable DNA polymerase which is commercially
available from Perkin-Elmer-Cetus Corporation under the tradename
"Taq polymerase" and about 0.1 .mu.mol/reaction of TR and PAR-2
specific primers as described in Table C and in Marthinuss et al.,
1995 which is hereby incorporated herein by reference or of
glyceraldehyde-3-phosphate-dehydrogenase (G3PDH) primers, available
from Clontech Laboratories, Inc. of Palo Alto, Calif. in accordance
with the procedures set forth in Marthinuss et al., 1995 or in the
protocol accompanying the primers from Clontech Laboratories.
[0058] The PCR products were then analyzed using 2%
agarose/ethidium bromide gels according to methods well-known in
the art in order to compare the level of expression of certain
genes in keratinocytes and melanocytes. When necessary for better
visualization, the resulting PCR products were precipitated with
ethanol according to well-known procedures. When primers for G3PDH
were used, only 10% of the PCR reaction products were used. An RNA
sample from epidermal equivalents that was not reverse-transcribed
was used as a negative control for each PCR amplification. The lack
of genomic DNA contaminants was indicated by the lack of a band on
the relevant lanes in the gels. A human skin RNA sample which was
reverse-transcribed was used as a positive control when commercial
positive controls were not available. The migration of the RT-PCR
products on the gels was always identical to that of the positive
controls, and to that of the reported amplimer sizes.
[0059] The relative quality of each respective RT-PCR reaction
product was then compared by analyzing the mRNA level of G3PDH, a
"housekeeping" gene, in each respective product. As illustrated in
FIGS. 5 and 6, G3PDH gene expression was found to be similar at all
the time points examined, which thereby enabled the comparison of
the relative levels of gene expression for the desired genes.
[0060] FIG. 5A shows that, as expected, TR and PAR-2 are expressed
in total skin and in the MelanoDerm equivalents ("MD"). However,
S91 melanoma cells ("S91") did not express PAR-2 or TR. To
investigate this further, we tested primary newborn ("mel-NB") and
adult ("mel-A") melanocytes for TR and PAR-2 expression. As shown
in FIG. 5B, primary human melanocytes express TR but not PAR-2.
Therefore, we suggest that PAR-2 agonists and antagonists can
interact with keratinocytes, but not with melanocytes, in the
MelanoDerm equivalents, and that TR agonists and antagonists could
interact with both keratinocytes and melanocytes. A
keratinocyte-melanocyte interaction is, therefore, suggested,
during which the keratinocyte-PAR-2 signal is converted into a
pigmentation end-point.
[0061] Table C illustrates some of the DNA primers used, the amount
of MgCl.sub.2 required for the PCR reaction, and the length of the
PCR cycle.
TABLE-US-00003 TABLE C DNA Primers Utilized in RT-PCR Assay Amt.
DNA Primer of Cycle No. Seq. (See attached MgCl.sub.2 (min) of. ID
Sequence Listing) (mM) @ .degree. C. cycles No. Tyrosinase sense
1.25 1 @ 94 35 1 TCAGCCCAGC ATCCTTCTTC 2 @ 55 3 @ 72 Tyrosinase
antisense 1.25 1 @ 94 35 2 CAGCCATTGT TCAAAAATAC- 2 @ 55 TGTCC 3 @
72 TRP-1 sense 2.5 1 @ 94 35 3 5'CCACTCTAATAAGCCCAAAC 2 @ 55 3 @ 72
TRP-1 antisense 2.5 1 @ 94 35 4 5'CTCAGCCATTCATCAAAGAC 2 @ 55 3 @
72 TRP-2 sense 2.5 1 @ 94 35 5 5'AAAAGACATACGAGATTGCC 2 @ 55 3 @ 72
TRP-2 antisense 2.5 1 @ 94 35 6 5'CACAAAAAGACCAACCAAAG 2 @ 55 3 @
72 Trypsin sense 2.5 1 @ 94 35 7 5'ATCC/TACTCCTGATCCTTACC 2 @ 45 3
@ 72 Trypsin antisense 2.5 1 @ 94 35 8 5'TGTCATTGTT/CCAGAGTCT/- 2 @
45 CT/GC/GC 3 @ 72 PAR-2 sense - 2.5 .5 @ 94 30 9
GGGAAAGGGGTTGGGGTAGAA 1 @ 55 CCAGGCTTTTCC (5') 3 @ 72 PAR-2
antisense - 2.5 .5 @ 94 30 10 GGCCAACGGCGATGTTTGCCTT 1 @ 55
CTTCCTGGGG(3') 3 @ 72 TR-sense - 2.5 .5 @ 94 30 11
CCTCTGAGTGCCAGAGGTACG- 1 @ 55 TCTACAG (5') 3 @ 72 TR-antisense -
2.5 .5 @ 94 30 12 CCTAAGTTAACAGCTTTTTGTAT 1 @ 55 ATGCTGTTATTCAGG
(3') 3 @ 72 Thrombin-sense - 2.5 .5 @ 94 35 13 AACCTGAAGGAGACGTGGAC
1 @ 55 (3' 3 @ 72 Thrombin-antisense - 2.5 .5 @ 94 35 14
CAGGAGCCCAGAATATGAGTG 1 @ 55 ( 3 @ 72 indicates data missing or
illegible when filed
Example 5
Keratinocyte-Melanocyte Contact is Required for Compound I
Depigmenting Effect
[0062] The results of Example 4 suggest that melanocytes alone
might not respond to the depigmenting effect of PAR-2 antagonists.
Indeed, the level of pigmentation of human primary melanocytes or
choleratoxin-induced S91 cells, which is reduced by hydroquinone
and benzaldehyde, was not affected by Compound L
Since PAR-2 is not expressed in melanocytes, we tested the possible
requirement of keratinocyte-melanocyte interactions for the
depigmenting effect of Compound I. Primary melanocyte cultures were
compared to identical cultures plated under epidermal equivalents
(EpiDerm, lacking melanocytes) to create a co-culture with no
contact between keratinocytes and melanocytes. These were also
compared to MelanoDerm equivalents, where melanocytes are present
in the basal layer of the equivalent. Cultures were treated for
three days with Compound I, with the PAR-2 agonist SLIGRL, and with
the TR agonist TFLLRNPNDK, as set forth in Table D, and DOPA
stained on the fourth day. In Table D, keratinocytes are indicated
by "K", melanocytes are indicated by "M" and lack of
keratinocyte-melanocyte contact is indicated as "no K-M contact".
As shown in Table D, no effect on pigmentation was observed in
primary melanocytes and in co-cultures treated with these agents.
In MelanoDerm equivalents, compound I reduced and SLIGRL induced
pigmentation, while TFLLRNPNDK had no effect. These results
demonstrate that to keratinocyte-melanocyte contact is required for
the PAR-2 effect on pigmentation.
TABLE-US-00004 TABLE D Melanocytes Co-cultures MelanoDerm Treatment
(no K) (no K-M contact) (K-M contact) Compound I no effect no
effect lightening SLIGRL no effect no effect darkening TFLLRNPNDK
no effect no effect no effect
Example 6
Compound I Affects Melanocyte Gene Expression
[0063] MelanoDerm equivalents were treated with increasing
concentrations of the thrombin and trypsin inhibitor, Compound I,
or with increasing concentrations of the PAR-2 agonist SLIGRL. RNAs
extracted from untreated and Compound I-treated equivalents were
analyzed for gene expression by RT-PCR in the manner set forth
above in Example 4. Gene-specific primers were designed as set
forth in Table C above, and Clontech primers for human G3PDH were
used as in Example 4. Melanogenic genes tested for expression level
were tyrosinase, TRP-1, and TRP-2.
[0064] A dose-dependent decrease in TRP-1 and a dose-dependent
increase in TRP-2 mRNA levels were observed in Compound I-treated
samples, as shown in FIG. 6A Tyrosinase expression, however, was
not affected. These changes correlated with the dose-dependent
whitening effect of this inhibitor. Both patterns of gene
expression result in a lightening effect. TRP-2 enzyme processes
dopaquinone to 5,6-dihydroxyindole carboxylic acid (DHICA), rather
than to 5.6-dihydroxyindole (DHI). This process results in brown,
finely dispersed eumelanin, as opposed to insoluble black
eumelanin, and results in a lighter skin tone. TRP-1 stabilizes the
melanogenic complex, enabling pigment production. Reduced levels of
TRP-1 result in reduced tyrosinase activity and reduced
pigmentation. Lack of this protein results in albinism. Increasing
concentrations of SLIGRL, however, did not affect melanogenic gene
expression (FIG. 6B).
[0065] TRP-1 and TRP-2 are melanocyte-specific. Compound I inhibits
trypsin and thrombin. Hirudin, a specific thrombin inhibitor, had
no effect on pigmentation, as seen above in Example 2. Thus, we
decided to test whether trypsin and thrombin are expressed in skin.
A probe designed to detect both brain and gastric trypsins, as
described in Table C, detected the expression of both mRNAs in a
total skin mRNA sample available from Invitrogen of Carlsbad,
Calif., as well as in MelanoDerm equivalents. The same expression
pattern was detected for thrombin. Both trypsin and thrombin were
not expressed in normal melanocytes (FIGS. 5A, B). These data
suggest that if trypsin activates PAR-2, it could be produced by
the keratinocytes only. As shown in FIG. 6A, treatment with
Compound I resulted in increased expression of trypsin. SLIGRL,
which did not affect melanogenesis gene expression (FIG. 6B) also
increased trypsin expression in the equivalents. We conclude that
while trypsin is a possible natural activator of PAR-2 in skin and
possibly affects pigmentation, its mRNA levels do not correlate
with pigmentation. This suggests that another, yet unidentified
serine protease, which is inhibited by compound I, STI and the
like, is the natural activator of PAR-2 in the epidermis. Compounds
that induce or inhibit this protease would serve as darkening and
lightening agents, respectively.
Example 7
Thrombin and Trypsin Inhibitors and Par-2 Agonists Affect
Pigmentation In Vivo
[0066] Two guinea pigs were treated twice daily, five days/week for
seven weeks with Compound I at 1 and 10 .mu.M in 70:30
ethanol:propylene glycol vehicle on one pigmented nipple. The other
nipple of each animal was treated with vehicle only and served as a
control. Chromameter measurement after seven weeks of treatment
revealed a dose-dependent lightening effect of +9.6 L* and nearly
18 L* units respectively. No visible signs of irritation were
observed at that time.
[0067] Four groups of three guinea pigs each were treated
respectively with Compound I, SFLLRN, FSLLRN and SLIGRL at 10
.mu.M, twice daily five days per week for eight weeks. Chromameter
measurement after six weeks demonstrates a lightening effect by
Compound I and a darkening effect by SLIGRL, the PAR-2 agonist. The
results of this example are set forth in FIG. 7.
Example 8
Thrombin and Trypsin Inhibitors and PAR-2 Agonists Affect
Pigmentation In vivo
[0068] A Yucatan microswine was treated with Compound I, SFLLRN,
FSLLRN and SLIGRL at 10 .mu.M. Each compound was applied to two
sites on the pig twice daily, is five days per week for eight
weeks. After eight weeks of treatment, chromameter measurements
were taken. The application of Compound I resulted in a visible
lightening effect. The PAR-2 agonist SLIGRL resulted in a darkening
effect as measured by chromameter. SFLLRN and FSLLRN had no
significant effects.
[0069] Two Yucatan swine were treated for seven and a half weeks,
or for ten weeks, twice daily, five days per week, with increasing
concentrations of Compound I. Four concentrations of active
compound were used, as follows: 0, 10, 50 and 250 .mu.M. Two sites
per concentration were placed on opposite sides of the swine
dorsum. Chromameter measurements were taken before treatment
started and every two weeks thereafter. Pictures were taken
periodically and at the end of the experiment. A visible lightening
effect was observed during the 4th, 5th and 6th weeks of treatment,
for the 250, 50 and 10 .mu.M treatments, respectively. By the
eighth week, the whitening effect of the two highest doses was
similar. These results are illustrated in FIG. 8. The chromameter
readings (L*, measuring brightness) during the treatment course of
one swine are shown in FIG. 9. A saturation effect is observed,
which is a time and concentration dependent. This example
demonstrates a visual depigmenting effect by Compound I, in the
animal model system most resemble pigmented human skin.
[0070] At the end of these experiments, biopsies were taken for
histological and electron microscopy (EM) analyses. Histological
samples were stained with H&E and F&M. H&E staining
showed that there was no irritation, inflammatory response or
changes in skin architecture, demonstrating the safety of using
Compound I over long periods of time. F&M staining demonstrated
that there was reduced pigmentation in the treated samples, both in
the basal layer and throughout the epidermis. These results are
illustrated in FIG. 10. Untreated and vehicle-treated samples (FIG.
10A) were identical and darkest. The 10 .mu.M treatment (FIG. 10B)
showed reduced pigmentation and the 50 and 250 .mu.M treatments
(FIG. 10C, 10D, respectively) were the lightest.
[0071] The results of this example suggest that the maximal
whitening effect of Compound I could be achieved with higher
concentration over a shorter period of time or with lower
concentration over a longer period of time. Thus, at least two
difference regimens may be used to achieve the desired skin
whitening results.
Example 9
Ultrastructural Studies Demonstrate the Effect of Compound I on the
Skin In Vitro and In Vivo
[0072] Ultrastructural analysis was performed on MelanoDerm
equivalents and swine skin sites treated with Compound I.
MelanoDerm equivalents treated with Compound I were analyzed for
melanosome formation and distribution using electron microscopy.
Treated samples contained more melanosomes, but less mature
melanosomes, i.e., melanosomes which evidence reduced melanin
production, within the melanocytes, relative to untreated controls
(FIG. 11A, 11B). Dendrites containing melanosomes were easily
identified within treated keratinocytes (FIG. 11C), but were
difficult to find within control keratinocytes. This suggests
abnormal melanosome formation and slow or impaired melanosome
transfer into keratinocytes in the treated samples.
[0073] Skin samples from Yucatan swine treated with compound I for
eight weeks, as described in example 8, were also analyzed by
electron microscopy. Melanosomes within keratinocytes of treated
sites were smaller and less pigmented, compared to controls (FIGS.
11D, 11E and 11F). Moreover, the distribution of melanosomes within
the treated skins was abnormal. Melanosomes were detected mainly at
the epidermal-dermal border, compared to a random distribution in
untreated controls (FIG. 11G, 11H). While we cannot rule out other
mechanisms, we suggest that Compound I treated keratinocytes were
unable to actively take or receive melanosomes from the presenting
dendrites.
Example 10
The In Vivo Depigmenting Effect of Compound I is Reversible
[0074] A Yucatan swine was treated with Compound I, 250 .mu.M, for
eight weeks, twice daily, five days a week, on eight sites. All
sites showed visible depigmentation by the end of the treatment
period, as set forth in FIG. 12B. For the following four weeks
(starting at week nine of the experiment), the color of the treated
sites was monitored, and two biopsies were taken each week from two
treated sites. Untreated sites were biopsied as well. The
depigmenting effect could be visualized at one and two weeks post
treatment, and a complete reversal was observed by the forth week.
Histological examination of F&M stained skin sections confirmed
the repigmentation observed visually (as indicated in FIG. 12). As
any as one week post treatment, repigmentation was demonstrated
histologically. The visual observations correlate with the
histological demonstration of stratum corneum pigmentation. This
example demonstrates that Compound I does not induce a permanent
damage to the pigmentation machinery, and its effect is reversible
in vivo. FIG. 12A shows two histological F&M stained sections
of sites which were not treated with Compound I. FIG. 12B shows two
histological F&M stained sections of sites which were treated
with Compound I for eight weeks. FIG. 12C shows sections of sites
which were treated for eight weeks with Compound I, one week after
treatment was stopped. FIG. 12D shows sections of sites which were
treated for eight weeks with Compound I, two weeks after treatment
was stopped. FIG. 12E shows sections of sites which were treated
for eight weeks with Compound I, four weeks after treatment was
stopped. As indicated in FIG. 12E, the sections were fully
repigmented four weeks after the end of treatment.
Example 11
Preparation of Naturally-Derived Products Containing STI
[0075] Example 1 demonstrates that the presence of soybean trypsin
inhibitor in any lightening formulation is desirable for its
depigmenting activity. Based on analytical testing, it has been
determined that soybean milk and soybean paste are rich sources of
soybean trypsin inhibitor.
[0076] To make soybean paste, soybeans were first soaked in
deionized or to purified water for several hours. The soybeans were
ground after they were fully hydrated, with the addition of small
quantities of water, if needed, to smoothen the paste. To make
soybean milk, the same procedure was performed with the addition of
more water. (The grinding process allows the soybean milk to be
extracted). After collection, the soybean milk was filtered to
remove any residual parts of the bean husk.
[0077] Soybean milk, soybean paste and miso were prepared to be
used as naturally-derived materials that contain STI and are able
to lighten skin color.
Example 12
Treatment with Naturally-Derived Materials that Affect the PAR-2
Pathway Induces Depigmentation
[0078] Two Yucatan swine were treated for eight and ten weeks,
twice a day, five days a week, with different soybean- and
lima-bean-derived products. These natural products include soybean
paste, soybean protein acid hydrolysate, miso, native and boiled
soybean milk, and a commercially available extract of soybean
(Actiphyte.TM. of Active Organics, Dallas Tex.), as well as
purified STI, and different preparations of trypsin inhibitors from
soybeans and limabeans. At seven weeks of treatment, all sites were
visually lighter than the surrounding skin, except for the boiled
soybean milk and the soybean protein acid hydrolysate treated
sites. Histological analysis of biopsies from the treated sites
following F&M staining confirmed the depigmenting effect of the
soybean and limabean products. An example of such histological data
is given in FIG. 13. The lack of depigmenting activity in the
boiled soybean milk and in the soy protein acid hydrolysate is
explained by the denaturation or the degradation of the soy
proteins in these preparations, respectively. We theorize that the
active depigmenting agents in the soybean and limabean products are
soybean trypsin inhibitor (STI) and limabean trypsin inhibitor,
respectively. (Example 1 shows the depigmenting effect of STI in
vitro). This example demonstrate that natural extracts containing
trypsin inhibitory activity could be used as whitening agents which
affect the PAR-2 pathway.
Example 13
An STI in Liposome Formulation can Lighten Human Age Spots
[0079] An individual with three age spots on the dorsum of their
hand was treated for eight weeks, twice a day, with the following:
The age spot located closest to the arm was treated with placebo,
containing 20 mg/ml of liposomes. The middle age spot was not
treated. The third age spot was treated with STI, 1%, in liposomes
(20 mg/ml). GDL liposomes were prepared as set forth in Niemiec, et
al., above, with the exception of the following changes: the
non-ionic liposomal formulation contained glycerol dilaurate
(Emulsynt GDL, ISP Van Dyk)/cholesterol
(Croda)/polyoxyethylene-10-stearyl ether (Brij76,
ICI)/polyoxyethylene-9-lauryl ether, as at ratio of
37.5:12.5:33.3:16.7. Hepes buffer, 0.05M, pH 7.4 (Gibco-BRL of
Gaithersburg, Md.) was used as the aqueous phase in the preparation
of the liposomes. UV and visible light digital pictures were taken
at time 0, 4 and 8 weeks of treatment. L* (brightness) values were
calculated from the images using Adobe Photoshop.
[0080] As shown in FIG. 14, the age spot treated with STI became
lighter following 8 weeks of treatment. FIG. 14 is a composite of
four pictures. The left panel is the visible light pictures of the
hand, before (upper) and after (lower) 8 weeks of treatment. At
this orientation the top age spot is the placebo-treated, the
middle age spot is untreated, and the lower age spot is the
STI-treated. The right panel shows the same hand at the same time
points, using UV-photography. UV light enables the visualization of
pigment deeper in the skin, demonstrating that the STI whitening
effect was not superficial. FIG. 14 clearly demonstrates that the
STI formulation was able to lighten the lower age-spot. An increase
of 15 L* units was calculated for this STI-treated sit, further
demonstrating the ability of this treatment to lighten age
spots.
Example 14
Depigmenting Formulations with Soybean Milk
[0081] In making the soybean milk, it was discovered that the rich
emolliency of the milk would be desirable in a skin care
formulation. Because water is used as the predominant ingredient of
any oil-in-water emulsion, and in many other skin-care formulations
we hypothesized that the soymilk could be used to substitute for
the deionized water in such formulations. However, we expected that
this to type of formulation would not be physically stable due to
the immiscibility of the oil and water components of the soybean
milk. Surprisingly, we found that this substitution of soybean milk
for water was physically stable. Formulations utilizing soybean
milk should contain between about 1% and about 99% of soybean milk,
more preferably from about 80% to about 95% soybean milk.
Preferably, this and similar formulations should include a
viscosity builder in an amount from about 0% to about 5% (more
preferably, from about 0.1 to about 2%), one or more emollients in
an amount up to about 20% and/or emulsifiers in an amount from
about 0.1% to about 10% (more preferably from about 3 to about 5%),
and, optionally, a spreading agent in an amount from about 0 to
about 5% (more preferably from about 1 to about 2%), a
preservative, a chelating agent or a humectant. The preservative
should be present in an effective amount in order to preserve
integrity of the milk and maintain the composition's activity.
Sufficient thickener should be present to impart body to the
formulation without causing it to become so viscous that it would
hinder spreadability, e.g., from about 0 to about 10%, more
preferably from about 3 to about 5%. Sunscreen, antioxidants,
vitamins other depigmenting agents and other skin care topical
ingredients may also be incorporated into the compositions of this
invention.
[0082] A particularly preferred example of a depigmenting
formulation substituting soymilk for water is shown in table E
below.
TABLE-US-00005 TABLE E Ingredient Function % Wgt/Wgt soybean milk
Vehicle, depigmenting 84.9% aluminum starch viscosity builder 0.75%
octenyl succinate cyclomethicone spreading agent 2% PEG
6-capric/caprylic emollient/emulsifier 3% triglycerides
phenoxyethanol preservative 0.75% sucrose cocoate
emollient/emulsifier 1% Na.sub.2EDTA chelating agent 0.1% glycerin
humectant 2.5% polyacrylamide; thickener 5% isoparaffin;
laureth-7
[0083] STI, soybean paste and other trypsin inhibitor-containing
natural extracts can be incorporated into such formulations to
provide increasing concentrations of the serine protease inhibitor.
Use levels of the added active ingredient can range between 0.01%
to 15% in a formulation. Other depigmenting agents, including PAR-2
inhibitors, tyrosinase inhibitors, hydroquinones, soy products,
ascorbic acid and its derivatives, as well as other ingredients
with skin care benefits could also be incorporated into this
formulation.
Example 15
An Oil-in-Water Emulsion Depigmenting Formulation
[0084] Two examples of a depigmenting formulation with oil-in-water
emulsion are presented in Table F. A formulation with STI, where
STI could be replaced with any naturally-derived serine protease
inhibitor, or with any naturally-derived extract or fraction
thereof containing serine protease inhibitors, is described in
column 4 of Table F. A similar formulation with Compound I is
presented in column 5 of Table F. Compound I in this composition
could be replaced with similar compounds, or with serine protease
inhibitors or with any PAR-2 inhibitor materials having high
therapeutic indices, whether derived synthetically or naturally, as
the active ingredient. Suggest d ranges for the ingredients in such
formulations are also listed in Table F. The deionized water
content of these formulations could be replaced with soybean
milk.
TABLE-US-00006 TABLE F Phase CTFA Name Function % W/W % W/W Ranges
OIL Cetearyl Surfactant 1.4 1.4 0.1-2.8 Glucoside C12-15 Alkyl
Surfactant 4.0 4.0 1-6 Benzoate Octyl Hydroxy- Emollient 1.0 1.0
0-5 stearate Dimethicone Spreading 1.0 1.0 0-5 Agent Cyclomethicone
Spreading 1.0 1.0 0-5 Agent Cetyl Alcohol Emollient 2.5 2.5 0-4
Butylated Anti-oxidant 0.1 0.1 0-0.5 Hydroxytoluene Octyl Methoxy-
Sunscreen 6.0 6.0 0-10 cinnamate Propylparaben Preservative 0.5 0.1
0-0.5 Vitamin E Anti-oxidant 0.5 0.5 0-0.5 acetate Tocopherol
Anti-oxidant 0.5 0.5 0-0.5 Acetate AQUE- Glycerine Humectant 3.0
3.0 0-20 OUS D-Pathenol Pro-Vitamin 0.5 0.5 0-5 Disodium EDTA
Chelator, 0.1 0.1 0.01-1 whitening agent Methyl Paraben
Preservative 0.2 0.2 0-0.3 Carbomer Thickener 0.35 0.35 0-3
Deionized Water Carrier/ 76.35 77.5 50-80 or Soybean Milk Whitening
Agent STI or natural Whitening 1.0 0 0-15 extract Agent Compound I
Whitening 0 0.25 0-1 Agent
[0085] To prepare this formulation, the ingredients of the lipid
phase were combined and mixed at 85.degree. C., and then cooled to
60.degree. C. In a separate vessel, the carbopol was slowly added
to the water or to the soybean milk. After mixing for ten minutes
the rest of the aqueous phase ingredients were added and the mix
was heated to 60.degree. C. The two phases were then combined,
mixed for ten minutes, and cooled to room temperature. Of course,
one or more depigmentation agents may be combined within the same
formulation, in this Example and in the following examples and
other embodiments of the methods and compositions of this
invention.
Example 16
Depigmenting Composition (Oil-in-Water Emulsion)
[0086] Two additional examples of an oil-in-water emulsion
depigmenting formulation are presented in Table G. A formulation
with STI, where STI could be replaced with any naturally-derived
serine protease inhibitor, or with is any naturally-derived extract
or fraction thereof containing serine protease inhibitors, is
described in column 3 of Table G. A similar formulation with
Compound I is presented in column 4 of Table G. Compound I in this
composition could be replaced with similar compounds or with serine
protease inhibitor or with any PAR-2 inhibitor materials having
high therapeutic indices, whether derived synthetically or
naturally, as the active ingredient. Suggested ranges for the
ingredients in such formulations are also listed in Table G. The
deionized water content of these formulations could be replaced
with soybean milk.
TABLE-US-00007 TABLE G Pref'd. CTFA Name Function % W/W % W/W
Ranges Ethanol Solvent 12.0 12.0 5-20 Propylene Glycol Solvent 3.0
3.0 1-10 Hydroxyethylcellulose Thickener/ 0.2 0.2 0-3 Polymer
Acrylates/C10-30 Alkyl Thickener/ 1.0 1.0 0-3 Acrylate Crosspolymer
Polymer Panthenol (98%) Pro-Vitamin/ 1.5 1.5 0.1-3 Humectant
Fragrance Fragrance 0.5 0.5 0-0.5 Isohexadecane Spreading 4.0 4.0
0-5 Agent Vitamin E acetate Anti-oxidant 1.0 1.0 0-2 Sodium
Hydroxide Neutralizer 0.35 0.35 0.1-0.5 Glycerine Humectant 3.0 3.0
0-20 Deionized Water or Carrier/ 72.2 71.95 60-80 Soybean Milk
Whitening Agent Compound I Whitening 0 0.25 0-1 Agent STI or
natural extract Whitening/ 1.0 0 0-15 Agent
[0087] To prepare this formulation, the hydroxyethylcellulose was
slowly added to the water or to the soybean milk and stir until
completely dissolved. In a separate container the Acrylates/C10-30
Alkyl Acrylate Crosspolymer was added and stir until completely
dissolved. The content of the two containers was combined and mixed
for 20 minutes. Vitamin E acetate was then added and mixed,
following by the addition of Isohexadecane and Panthenol (98%).
After mixing for five minutes the STI, or the natural extract, or
Compound I were added together with Propylene Glycol, and stirred
for 5 minutes. Next, glycerine was added and the formulation was
stirred for 20 minutes. Finally, the pH was adjusted with sodium
hydroxide to 8 for STI (range is 6-8.5) or to 7 for Compound I
(range is 5.5-8.5).
Example 17
Depigmenting Composition (Water-in-Oil Emulsion)
[0088] An example of a depigmenting formulation with water-in-oil
emulsion is presented in Table H. A formulation with STI, where STI
could be replaced with any naturally-derived serine protease
inhibitor, or with any naturally-derived extract or fraction
thereof containing serine protease inhibitors, is described in
column 4 of Table H. A similar formulation with Compound I is
presented in column 5 of Table H. Compound I in this composition
could be replaced with similar compounds or with serine protease
inhibitor or with any PAR-2 inhibitor materials having high
therapeutic indices, whether derived synthetically or naturally, as
the active ingredient. Suggested ranges for the ingredients in such
formulations are also listed in Table H. The deionized water
content of these formulations could be replaced with soybean
milk.
TABLE-US-00008 TABLE H Pref'd Phase CTFA Name Function % W/W % W/W
Ranges OIL Mineral Oil Emollient 25.0 25.0 40-80 Sorbitan
Surfactant 5.0 5.0 1-6 Monooleate Stearyl Alcohol Emollient 25.0
25.0 20-60 Dimethicone Spreading 1.0 1.0 1-5 Agent Cetyl Alcohol
Emollient 2.0 2.0 0.1-10 Hydrogenated Anti-oxidant 3.0 3.0 0-10
Lecithin Parsol MCX Sunscreen 3.0 3.0 0-10 Propylparaben
Preservative 0.5 0.5 0.01-0.5 Vitamin E Anti-oxidant 0.5 0.5
0.01-0.5 acetate AQUE- Glycerine Humectant 3.0 3.0 0-20 OUS Methyl
Paraben Preservative 0.2 0.2 0.01-0.3 Water or Soy Carrier/ 30.8
31.55 20-45 Milk Whitening Agent STI Whitening 1.0 0 0-10 Agent Cpd
I Whitening 0 0.25 0-1 Agent
[0089] To prepare this formulation the stearyl alcohol and mineral
oil were melted at 70.degree. C. The other oil phase ingredients
were added and the mixture heated to 75.degree. C. The aqueous
phase ingredients, which have been previously dissolved in the bulk
phase water or Soy Milk and warmed to 70.degree. C., were then
added and the mixture was stirred until it congealed.
Example 18
Depigmentation Composition (Aqueous Gel)
[0090] Two examples of a depigmenting formulation with aqueous gel
are presented in Table J. A formulation with STI, where STI could
be replaced with any naturally-derived serine protease inhibitor,
or with any naturally-derived extract or fraction thereof
containing serine protease inhibitors, is described in column 3 of
Table J. A similar formulation with Compound I is presented in
column 4 of Table J. Compound I in this composition could be
replaced with similar compounds or with serine protease inhibitor
or with any PAR-2 inhibitor materials having high therapeutic
indices, whether derived synthetically or naturally, as the active
ingredient. Suggested ranges for the ingredients in such
formulations are also listed in Table J. The deionized water
content of these formulations could be replaced with soybean
milk.
TABLE-US-00009 TABLE J CTFA Name Function % W/W % W/W Octoxynol-13
Surfactant 0.2 0.2 0.05-0.5 2,4-Hexadienoic Preservative 0.1 0.1
0-0.3 Acid Benzenemethanol Preservative 1.0 1.0 0-2 Disodium EDTA
Chelator/ 0.05 0.05 0.01-0.2 Preservative Ascorbic Acid
Anti-oxidant 0.1 0.1 0-0.2 Sodium Anti-oxidant 0.2 0.2 0-0.3
Metabisulfite Carbomer Thickener 1.5 1.5 0-3.0 NaOH % 20 Soln.
Neutralizer 2.45 2.45 0.1-5 DEIONIZED Carrier/ 93.4 94.15 85-98
Water or Whitening Soybean Milk Agent STI or natural Whitening 1.0
0 0-15 extract Agent Compound I Whitening 0 0.25 0-1 Agent
[0091] To prepare this formulation, the Disodium EDTA, sodium
metabisulfite and ascorbic acid were slowly added to the water or
to the soybean milk and stir until completely dissolved. STI,
natural extracts or Compound I were then added and mixed slowly for
five minutes. The speed of agitation was then to increased and
carbopol was added. The composition was mixed for 30 minutes or
until the dispersion was free of "fish eyes", which are
non-dispersed clear lumps, and heated to 50.degree. C. In a
separate container, the slurry phase was prepared by combining
Octoxynol-13,2,4-Hexadienoic acid, and [0092] Benzenemethanol and
stirring ten minutes at 40-50.degree. C. The slurry was then added
slowly to the aqueous phase, mixed, and cooled to 45.degree. C. 20%
sodium hydroxide solution was used to pH the composition to pH of
7.0 (range is 5.5-8.5). This was mixed to homogeneity using
agitation or sweep vessel.
Example 19
Solvent-Based Depigmenting Composition
[0093] An example of a depigmenting formulation containing solvent
is presented in Table K A formulation with STI, where STI could be
replaced with any naturally-derived serine protease inhibitor, or
with any naturally-derived extract or fraction thereof containing
serine protease inhibitors, is described in column 3 of Table K. A
similar formulation with Compound I is presented in column 4 of
Table K. Compound I in this composition could be replaced with
similar compounds or with serine protease inhibitor or with any
PAR-2 inhibitor materials having high therapeutic indices, whether
derived synthetically or naturally, as the active ingredient.
Suggested ranges for the ingredients in such formulations are also
listed in Table K. The deionized water content of these
formulations could be replaced with soybean milk
TABLE-US-00010 TABLE K CTFA Name Function % W/W Range Ethanol
Solvent (1) 70 40-90 Propylene Glycol Solvent (2) 29 1-40 Deionized
Water Carrier q.s. 1-40 STI Whitening Agent 0 Compound I Whitening
Agent 1 .mu.M .00001-1
To prepare this formulation Compound I was dissolved in water. The
ethanol and propylene glycol were mixed and combined with the
aqueous solution containing Compound I.
[0094] In summary, we have demonstrated that activation of the
keratinocyte receptor PAR-2 results in increased pigmentation.
Preferably, such activation may be accomplished by the use of
trypsin or SLIGRL or SLIGKVD or other SLIGRL or SLIGKVD
derivatives. We have also demonstrated that whitening may be
accomplished by the use of serine protease inhibitors or PAR-2
antagonists, as well as by melanosome-transfer blockers. Other
compounds known to those of skill in the art that inhibit
melanosome transfer into keratinocytes could also be used as
depigmenting agents.
[0095] Compound I, a trypsin and thrombin inhibitor, for example,
inhibits melanosome transfer to keratinocytes. STI works by the
same mechanism. The accumulation of undelivered melanosomes in the
melanocytes could induce a negative feed back mechanism, that slows
new melanosome formation. The production of TRP-1, the major
glycoprotein in melanocytes, is down-regulated, which leads to
destabilization of tyrosinase. This results in reduced melanin
formation, and in a color switch to a lighter brown, as the ratio
of TRP-1:TRP-2 is reduced. The melanosomes accumulation in the
melanocyte after Compound I treatment, or after STI treatment,
therefore, have reduced and altered melanin content, which adds to
the whitening effect of compound I or STI.
Sequence CWU 1
1
14120DNAArtificial SequenceDNA Primers 1tcagcccagc atccttcttc
20225DNAArtificial SequenceDNA Primers 2cagccattgt tcaaaaatac tgtcc
25320DNAArtificial SequenceDNA Primers 3ccactctaat aagcccaaac
20420DNAArtificial SequenceDNA Primers 4ctcagccatt catcaaagac
20520DNAArtificial SequenceDNA Primers 5aaaagacata cgagattgcc
20620DNAArtificial SequenceDNA Primers 6cacaaaaaga ccaaccaaag
20721DNAArtificial SequenceDNA Primers 7atcctactcc tgatccttac c
21825DNAArtificial SequenceDNA Primers 8tgtcattgtt ccagagtctc tgcgc
25933DNAArtificial SequenceDNA Primers 9gggaaagggg ttggggtaga
accaggcttt tcc 331032DNAArtificial SequenceDNA Primers 10ggccaacggc
gatgtttgcc ttcttcctgg gg 321128DNAArtificial SequenceDNA Primers
11cctctgagtg ccagaggtac gtctacag 281238DNAArtificial SequenceDNA
Primers 12cctaagttaa cagctttttg tatatgctgt tattcagg
381320DNAArtificial SequenceDNA Primers 13aacctgaagg agacgtggac
201421DNAArtificial SequenceDNA Primers 14caggagccca gaatatgagt g
21
* * * * *