U.S. patent application number 13/239604 was filed with the patent office on 2012-01-26 for b-lymphocyte stimulator binding polypeptides and methods based thereon.
This patent application is currently assigned to HUMAN GENOME SCIENCES, INC.. Invention is credited to James P. Beltzer, Tony J. Fleming, M. Daniel Potter, Marilou Potter, Craig A. Rosen.
Application Number | 20120022006 13/239604 |
Document ID | / |
Family ID | 22850040 |
Filed Date | 2012-01-26 |
United States Patent
Application |
20120022006 |
Kind Code |
A1 |
Beltzer; James P. ; et
al. |
January 26, 2012 |
B-LYMPHOCYTE STIMULATOR BINDING POLYPEPTIDES AND METHODS BASED
THEREON
Abstract
Binding polypeptides that specifically bind B lymphocyte
stimulator protein or B lymphocyte stimulator-like polypeptides can
be used in methods of the invention for detecting, diagnosing, or
prognosing a disease or disorder associated with aberrant B
lymphocyte stimulator or B lymphocyte stimulator receptor
expression or inappropriate function of B lymphocyte stimulator or
B lymphocyte stimulator receptor, comprising B lymphocyte
stimulator binding polypeptides or fragments or variants thereof,
that specifically bind to B lymphocyte stimulator. The present
invention further relates to methods and compositions for
preventing, treating or ameliorating a disease or disorder
associated with aberrant B lymphocyte stimulator or B lymphocyte
stimulator receptor expression or inappropriate B lymphocyte
stimulator function or B lymphocyte stimulator receptor function,
comprising administering to an animal, preferably a human, an
effective amount of one or more B lymphocyte stimulator binding
polypeptides or fragments or variants thereof, that specifically
bind to B lymphocyte stimulator.
Inventors: |
Beltzer; James P.;
(Carlisle, MA) ; Potter; M. Daniel; (Acton,
MA) ; Potter; Marilou; (Acton, MA) ; Fleming;
Tony J.; (Waltham, MA) ; Rosen; Craig A.;
(Laytonsville, MD) |
Assignee: |
HUMAN GENOME SCIENCES, INC.
Rockville
MD
|
Family ID: |
22850040 |
Appl. No.: |
13/239604 |
Filed: |
September 22, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12701301 |
Feb 5, 2010 |
8062906 |
|
|
13239604 |
|
|
|
|
11232439 |
Sep 20, 2005 |
|
|
|
12701301 |
|
|
|
|
09932613 |
Aug 17, 2001 |
|
|
|
11232439 |
|
|
|
|
60226700 |
Aug 18, 2000 |
|
|
|
Current U.S.
Class: |
514/21.4 ;
436/501; 530/326; 530/350; 530/387.3; 530/413 |
Current CPC
Class: |
A61P 37/00 20180101;
A61K 39/00 20130101; C07K 2319/00 20130101; C07K 7/08 20130101;
A61K 38/00 20130101; C07K 14/70578 20130101; C07K 14/7151
20130101 |
Class at
Publication: |
514/21.4 ;
436/501; 530/326; 530/350; 530/387.3; 530/413 |
International
Class: |
A61K 38/10 20060101
A61K038/10; C07K 7/08 20060101 C07K007/08; A61P 37/00 20060101
A61P037/00; C07K 16/00 20060101 C07K016/00; C07K 1/14 20060101
C07K001/14; G01N 33/566 20060101 G01N033/566; C07K 14/00 20060101
C07K014/00 |
Claims
1. An isolated B lymphocyte stimulator binding polypeptide
comprising an amino acid sequence at least 90% identical to an
amino acid sequence selected from the group consisting of: (a)
X.sub.1-X.sub.2-X.sub.3-Cys-X.sub.5-X.sub.6-X.sub.7-X.sub.8-X.sub.9-X.sub-
.10-X.sub.11-X.sub.12-X.sub.13-X.sub.14-Cys-X.sub.16-X.sub.17-X.sub.18
(SEQ ID NO:5), wherein X.sub.1 is Arg, Asp, Gly, His, Leu, Phe,
Pro, Ser, Trp, Tyr, or is absent; X.sub.2 is Ala, Arg, Asn, Asp,
Gly, Pro, Ser, or is absent; X.sub.3 is Arg, Asn, Gln, Glu, Gly,
Lys, Met, Pro, Trp or Val; X.sub.5 is Arg, Asn, Gln, Glu, His, Leu,
Phe, Pro, Trp, Tyr, or Val; X.sub.6 is Arg, Asp, Gln, Gly, Ile,
Lys, Phe, Thr, Trp or Tyr; X.sub.7 is Ala, Arg, Asp, Glu, Gly, Leu,
Ser, or Tyr; X.sub.8 is Asp, Gln, Glu, Leu, Met, Phe, Pro, Ser, or
Tyr; X.sub.9 is Asp, Leu, Pro, Thr, or Val; X.sub.10 is Arg, Gln,
His, Ile, Leu, Lys, Met, Phe, Thr, Trp or Tyr; X.sub.11 is Ala,
Arg, Asn, Gln, Glu, His, Leu, Lys, Met, or Thr; X.sub.12 is Ala,
Asn, Gln, Gly, Leu, Lys, Phe, Pro, Thr, Trp, or Tyr; X.sub.13 is
Ala, Arg, Gln, His, Lys, Met, Phe, Pro, Thr, Trp, or Tyr; X.sub.14
is Arg, Gln, Glu, Gly, His, Leu, Met, Phe, Pro, Ser, Thr, Tyr, or
Val; X.sub.16 is Arg, Asp, Gly, His, Lys, Met, Phe, Pro, Ser, or
Trp; X.sub.17 is Arg, Asn, Asp, Gly, His, Phe, Pro, Ser, Trp or
Tyr; and X.sub.18 is Ala, Arg, Asn, Asp, His, Leu, Phe, or Trp; (b)
Cys-X.sub.2-X.sub.3-X.sub.4-X.sub.5-X.sub.6-X.sub.7-X.sub.8-X.sub.9-X.sub-
.10-X.sub.11-Cys (SEQ ID NO: 12), wherein X.sub.2 is Arg, Asn, Gln,
Glu, His, Leu, Phe, Pro, Trp, Tyr, or Val; X.sub.3 is Arg, Asp,
Gln, Gly, Ile, Lys, Phe, Thr, Trp or Tyr X.sub.4 is Ala, Arg, Asp,
Glu, Gly, Leu, Ser, or Tyr; X.sub.5, is Asp, Gln, Glu, Leu, Met,
Phe, Pro, Ser, or Tyr; X.sub.6 is Asp, Leu, Pro, Thr, or Val;
X.sub.7 is Arg, Gln, His, Ile, Leu, Lys, Met, Phe, Thr, Trp or Tyr;
X.sub.8 is Ala, Arg, Asn, Gln, Glu, His, Leu, Lys, Met, or Thr;
X.sub.9 is Ala, Asn, Gln, Gly, Leu, Lys, Phe, Pro, Thr, Trp, or
Tyr; X.sub.10 is Ala, Arg, Gln, His, Lys, Met, Phe, Pro, Thr, Trp,
or Tyr; and X.sub.11 is Arg, Gln, Glu, Gly, His, Leu, Met, Phe,
Pro, Ser, Thr, Tyr, or Val; (c) Asp-Xaa-Leu-Thr (SEQ ID NO: 446),
wherein Xaa is Pro, Ser, Thr, Phe, Leu, Tyr, Cys, or Ala; (d)
His-Leu-Arg-Cys-Trp-Ser-Thr-Asn-Cys-Arg-Tyr-Asp (SEQ ID NO:20); (e)
Val-Met-Asp-Cys-Leu-Ile-Asn-Arg-Cys-Asp-Thr-Val (SEQ ID NO:21); (f)
Met-Ile-Ile-Val-Leu-Leu-Leu-Leu-Arg-Phe-Ala-Ile-Ser-Arg (SEQ ID
NO:62); (g) Ser-Leu-Leu-Val-Ile-Phe-Leu-Leu-Ile-Gly-Ala-Gly-Ser-Leu
(SEQ ID NO:63) (h) Cys-X.sub.2-Phe-X.sub.4-Trp-Glu-Cys (SEQ ID NO:
8), wherein X.sub.2 is Phe, Trp, or Tyr; and X.sub.4 is Pro or Tyr;
(i) Cys-X.sub.2-X.sub.3-X.sub.4-X.sub.5-X.sub.6-X.sub.7-Cys (SEQ ID
NO: 9), wherein X.sub.2 is Asp, Ile, Leu, or Tyr; X.sub.3 is Arg,
Asp, Glu, His, Ile, Leu, Lys, Phe, Pro, Tyr, or Val; X.sub.4 is
His, Leu, Lys, or Phe; X.sub.5 is Leu, Pro, or Thr; X.sub.6 is Arg,
Asn, Gly, His, Ile, Lys, Met, or Trp; and X.sub.7 is Ala, Asn, Gln,
Glu, Gly, His, Ile, Leu, Met, Phe, Ser, Trp, Tyr, or Val; (j)
Cys-X.sub.2-X.sub.3-X.sub.4-X.sub.5-X.sub.6-X.sub.7-X.sub.8-Cys
(SEQ ID NO: 10), wherein X.sub.2 is Asn, Asp, Pro, Ser, or Thr;
X.sub.3 is Arg, Asp, Ile, Leu, Met, Pro, or Val; X.sub.4 is Ala,
Ile, Leu, Pro, Thr, or Val; X.sub.5 is Asn, His, Ile, Leu, Lys,
Phe, or Thr; X.sub.6 is Asn, Glu, Gly, His, Leu, Lys, Met, Pro, or
Thr; X.sub.7 is Arg, Asn, Asp, Gln, Glu, Gly, Ile, Lys, Met, Pro,
Ser, or Trp; and X.sub.8 is Arg, Glu, Gly, Lys, Phe, Ser, Trp, or
Tyr; (k)
Cys-X.sub.2-X.sub.3-X.sub.4-X.sub.5-X.sub.6-X.sub.7-X.sub.8-X.sub.9-Cys
(SEQ ID NO: 11), wherein X.sub.2 is Asp, Gln, His, Ile, Leu, Lys,
Met, Phe, or Thr; X.sub.3 is His, Ile, Leu, Met, Phe, Pro, Trp, or
Tyr; X.sub.4 is Asp, His, Leu, or Ser; X.sub.5 is Ala, Arg, Asp,
Glu, Leu, Phe, Pro, or Thr; X.sub.6 is Ala, Arg, Asn, or Leu;
X.sub.7 is Ile, Leu, Met, Pro, Ser, or Thr; X.sub.8 is Ala, Arg,
Asn, Gly, His, Lys, Ser, or Tyr; and X.sub.9 is Ala, Arg, Asn, Gln,
Leu, Met, Ser, Trp, Tyr, or Val; (l)
X.sub.1-X.sub.2-X.sub.3-X.sub.4-X.sub.5-X.sub.6-X.sub.7-X.sub.8-X.sub-
.9-X.sub.10-X.sub.11-X.sub.12 (SEQ ID NO: 6), wherein X.sub.1 is
Ala, Arg, Gly, His, Leu, Lys, Met, Phe, Trp, Tyr, or Val; X.sub.2
is Ala, Arg, Gln, His, Ile, Leu, Phe, Thr, Trp, or Tyr; X.sub.3 is
Ala, Asp, Lys, Phe, Thr, Trp or Tyr; X.sub.4 is Arg, Asp, Gln, Lys,
Met, Phe, Pro, Ser, Tyr, or Val; X.sub.5 is Asp, Leu, Lys, Phe,
Pro, Ser, or Val; X.sub.6 is His, Ile, Leu, Pro, Ser, or Thr;
X.sub.7 is Arg, Gly, His, Leu, Lys, Met, or Thr; X.sub.8 is Ala,
Arg, Asn, Ile, Leu, Lys, Met, or Thr; X.sub.9 is Ala, Asn, Arg,
Asp, Glu, Gly, His, Leu, Met, Ser, Trp, Tyr, or Val; X.sub.10 is
Ile, Leu, Phe, Ser, Thr, Trp, Tyr, or Val; X.sub.11 is Ala, Arg,
Gly, His, Ile, Leu, Lys, Pro, Ser, Thr, Trp, Tyr, or Val; and
X.sub.12 is Arg, Asp, His, Leu, Lys, Met, Phe, Pro, Ser, Trp, Tyr,
or Val; and (m)
X.sub.1-X.sub.2-X.sub.3-X.sub.4-X.sub.5-X.sub.6-X.sub.7-X.sub.8-X.sub.9-X-
.sub.10-X.sub.11-X.sub.12-X.sub.13 (SEQ ID NO: 7), wherein X.sub.1
is Asp, Gln, Glu, Gly, His, Lys, Met, or Trp; X.sub.2 is Arg, Gln,
His, Ile, Leu, or Pro; X.sub.3 is Asp, Gly, Ile, Lys, Thr, Tyr or
Val; X.sub.4 is Asn, Asp, Gln, Glu, Met, Pro, Ser, or Tyr; X.sub.5
is Asn, Asp, His, Ile, Leu, Met, Pro, Thr or Val; X.sub.6 is Asp,
Glu, His, Leu, Lys, Pro, or Val; X.sub.7 is Arg, Asn, Gln, His,
Ile, Leu, Met, Pro, or Thr; X.sub.8 is Gln, Gly, His, Leu, Met,
Ser, or Thr; X.sub.9 is Asn, Gln, Gly, His, Leu, Lys, Ser, or Thr;
X.sub.10 is Ala, Gly, Ile, Leu, Lys, Met, or Phe; X.sub.11 is Ala,
Glu, His, Ile, Leu, Met, Ser, Thr, Trp, Tyr, or Val; X.sub.12 is
Arg, Gln, Glu, Gly, His, Ile, Lys, Tyr, or Val; and X.sub.13 is
Arg, Asn, Glu, His, Ile, Ser, Thr, Trp, or Val; wherein the B
lymphocyte stimulator binding polypeptide binds a B lymphocyte
stimulator protein selected from the group consisting of: (i) a
protein whose amino acid sequence consists of amino acid residues
1-285 of SEQ ID NO: 173; (ii) a protein whose amino acid sequence
consists of amino acid residues 134-285 of SEQ ID NO:173; and (iii)
a trimer of the protein of (b).
2. A fusion protein comprising the B lymphocyte stimulator binding
polypeptide of claim 1 fused to a heterologous polypeptide.
3. The fusion protein of claim 3, wherein the heterologous
polypeptide comprises an Fc region of an immunoglobulin.
4. A method of isolating a B lymphocyte stimulator or B lymphocyte
stimulator-like polypeptide comprising (a) contacting a solid
support that comprises the B lymphocyte stimulator binding
polypeptide of claim 1 immobilized thereon with a solution
containing a B lymphocyte stimulator or B lymphocyte
stimulator-like polypeptide, and (b) separating the solution from
the support.
5. A method for detecting a B lymphocyte stimulator or B lymphocyte
stimulator-like polypeptide in a solution comprising (a) contacting
the solution with the B lymphocyte stimulator binding polypeptide
of claim 1, and (b) detecting binding of B lymphocyte stimulator or
B lymphocyte stimulator-like polypeptide to the B lymphocyte
stimulator binding polypeptide, thereby detecting the presence of a
B lymphocyte stimulator or B lymphocyte stimulator-like polypeptide
in the solution.
6. A method for treating an autoimmune disease comprising
administering to a mammal the B lymphocyte stimulator binding
polypeptide of claim 1 in an amount sufficient to treat the
autoimmune disease.
7. The method of claim 6, wherein the autoimmune disease is lupus.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of copending U.S. patent
application Ser. No. 12/701,301, filed Feb. 5, 2010, which is a
continuation of U.S. patent application Ser. No. 11/232,439, filed
Sep. 20, 2005, now abandoned, which is a continuation of copending
U.S. patent application Ser. No. 09/932,613, filed Aug. 17, 2001,
now abandoned, which claims the benefit under 35 U.S.C.
.sctn.119(e) of U.S. Provisional Patent Application No. 60/226,700,
filed Aug. 18, 2000. Each of the above-referenced applications is
incorporated by reference herein.
INCORPORATION BY REFERENCE OF MATERIAL SUBMITTED ELECTRONICALLY
[0002] Incorporated by reference in its entirety herein is a
computer-readable nucleotide/amino acid sequence listing submitted
concurrently herewith and identified as follows: One 169,095 Byte
ASCII (Text) file named "708892SEQUENCELISTING.TXT," created on
Sep. 22, 2011.
FIELD OF THE INVENTION
[0003] The present invention relates to therapeutic and diagnostic
uses for molecules that bind to B lymphocyte stimulator protein
(BLyS.TM.). In particular, the present invention also relates to
methods and compositions for detecting, diagnosing, or prognosing a
disease or disorder associated with aberrant B lymphocyte
stimulator or B lymphocyte stimulator receptor expression or
inappropriate function of B lymphocyte stimulator or B lymphocyte
stimulator receptor, comprising B lymphocyte stimulator binding
polypeptides or fragments or variants thereof, that specifically
bind to B lymphocyte stimulator. The present invention further
relates to methods and compositions for preventing, treating or
ameliorating a disease or disorder associated with aberrant B
lymphocyte stimulator or B lymphocyte stimulator receptor
expression or inappropriate B lymphocyte stimulator function or B
lymphocyte stimulator receptor function, comprising administering
to an animal, preferably a human, an effective amount of one or
more B lymphocyte stimulator binding polypeptides or fragments or
variants thereof, that specifically bind to B lymphocyte
stimulator.
BACKGROUND OF THE INVENTION
[0004] B lymphocyte stimulator (BLyS.TM.) is a member of the tumor
necrosis factor ("TNF") superfamily that induces both in vivo and
in vitro B cell proliferation and differentiation (Moore et al.,
Science, 285: 260-263 (1999)). B lymphocyte stimulator is
distinguishable from other B cell growth and differentiation
factors such as IL-2, IL-4, IL-5, IL-6, IL-7, IL-13, IL-15, CD40L,
or CD27L (CD70) by its monocyte-specific gene and protein
expression pattern and its specific receptor distribution and
biological activity on B lymphocytes. B lymphocyte stimulator
expression is not detected on natural killer ("NK") cells, T cells
or B cells, but is restricted to cells of myeloid origin. B
lymphocyte stimulator expression on resting monocytes is
upregulated by interferon-gamma (IFN-gamma). The gene encoding B
lymphocyte stimulator has been mapped to chromosome 13q34.
[0005] B lymphocyte stimulator is expressed as a 285 amino acid
type II membrane-bound polypeptide and a soluble 152 amino acid
polypeptide (Moore et al., 1999, supra). The membrane-bound form of
B lymphocyte stimulator has a predicted transmembrane spanning
domain between amino acid residues 47 and 73. The NH.sub.2-terminus
of the soluble form of B lymphocyte stimulator begins at
Ala.sup.134 of the membrane-bound form of B lymphocyte stimulator.
Both the soluble and membrane-bound forms of the protein form
homotrimers. Soluble recombinant B lymphocyte stimulator has been
shown to induce in vitro proliferation of murine splenic B cells
and to bind to a cell-surface receptor on these cells (Moore et
al., 1999, supra). Soluble B lymphocyte stimulator administration
to mice has been shown to result in an increase in the proportion
of CD45R.sup.dull, Ly6D.sup.bright (also known as ThB) B cells and
an increase in serum IgM and IgA levels (Moore et al., 1999,
supra). Thus, B lymphocyte stimulator displays a B cell tropism in
both its receptor distribution and biological activity.
[0006] Based on its expression pattern and biological activity, B
lymphocyte stimulator has been suggested to be involved in the
exchange of signals between B cells and monocytes or their
differentiated progeny. The restricted expression patterns of B
lymphocyte stimulator receptor and ligand suggest that B lymphocyte
stimulator may function as a regulator of T cell-independent
responses in a manner analogous to that of CD40 and CD40L in T
cell-dependent antigen activation.
[0007] Accordingly, molecules that specifically bind B lymphocyte
stimulator would find a variety of uses in the study of the B
lymphocyte stimulator cytokine, in the manufacture and purification
of B lymphocyte stimulator in commercial and medically pure
quantities, and in the development new therapeutic or diagnostic
reagents. B lymphocyte stimulator binding polypeptides may also
find medical utility in, for example, the treatment of B cell
and/or monocyte disorders associated with autoimmunity, neoplasia,
or immunodeficiency syndromes.
SUMMARY OF THE INVENTION
[0008] New polypeptides that specifically bind to B lymphocyte
stimulator protein (BLyS.TM.) and/or B lymphocyte stimulator-like
polypeptides have been discovered, and the therapeutic and
diagnostic applications for such polypeptides are disclosed herein.
Particular polypeptides useful in the methods of this invention
specifically bind to a polypeptide or polypeptide fragment of human
B lymphocyte stimulator (SEQ ID NOs:173 and/or 174) or B lymphocyte
stimulator expressed on human monocytes; murine B lymphocyte
stimulator (SEQ ID NOs:175 and/or 176) or B lymphocyte stimulator
expressed on murine monocytes; rat B lymphocyte stimulator (either
the soluble forms as given in SEQ ID NOs:177, 178, 179 and/or 180
or in a membrane associated form, e.g., on the surface of rat
monocytes); or monkey B lymphocyte stimulator (e.g., the monkey B
lymphocyte stimulator polypeptides of SEQ ID NOS:181 and/or 182,
the soluble form of monkey B lymphocyte stimulator, or B lymphocyte
stimulator expressed on monkey monocytes), preferably human B
lymphocyte stimulator.
[0009] In preferred methods of the invention, B lymphocyte
stimulator binding polypeptides comprising, or alternatively
consisting of, an amino acid sequence selected from the group
consisting of SEQ ID NOs:1-12, 20-172, and 186-444, preferably SEQ
ID NOs:163-172 and 436-444 as referred to herein and in Tables 1-8,
13 and 14, and fragments and variants thereof, will be used.
[0010] In specific preferred embodiments, the B lymphocyte
stimulator binding polypeptides bind B lymphocyte stimulator and/or
B lymphocyte stimulator-like polypeptides with high affinity. In
other embodiments, the B lymphocyte stimulator binding polypeptides
reversibly bind B lymphocyte stimulator and/or B lymphocyte
stimulator-like polypeptides. In still other embodiments, the B
lymphocyte stimulator binding polypeptides irreversibly bind B
lymphocyte stimulator and/or B lymphocyte stimulator-like
polypeptides.
[0011] The cysteine residues in certain polypeptides useful in the
methods of the invention are believed to form a disulfide bond,
which would cause the polypeptide containing these cysteine
residues to form a stable loop structure under non-reducing
conditions. Especially preferred B lymphocyte stimulator binding
polypeptides useful in the methods of the invention are polypeptide
molecules that comprise amino acid sequences that form stable loop
structures or other stable structures that bind B lymphocyte
stimulator or B lymphocyte stimulator-like polypeptides.
[0012] Analysis of the sequences of the B lymphocyte stimulator
binding polypeptides described herein shows a strong selection for
polypeptides containing the tetrapeptide Asp-Xaa-Leu-Thr (SEQ ID
NO:446), and therefore in its broadest aspects, the present
invention relates to methods for using polypeptides capable of
binding to B lymphocyte stimulator comprising the polypeptide
Asp-Xaa-Leu-Thr (SEQ ID NO:446), where Xaa is Pro, Ser, Thr, Phe,
Leu, Tyr, Cys, or Ala (preferably Pro or Ser).
[0013] In addition, seven consensus sequences (SEQ ID NOs:1-7) are
disclosed for peptides useful in the methods of the invention,
based on the specific B lymphocyte stimulator binding polypeptides
shown in Tables 1-8. In preferred methods according to the
invention, B lymphocyte stimulator binding polypeptides comprising
one or more of these sequences are used. Such preferred methods
utilize B lymphocyte stimulator binding polypeptides including
polypeptides with the potential to form a cyclic or loop structure
between invariant Cys residues comprising, or alternatively
consisting of, an amino acid sequence selected from A-E (SEQ ID
NOs:1-5):
TABLE-US-00001 (A) (SEQ ID NO: 1)
X.sub.1-X.sub.2-X.sub.3-Cys-X.sub.5-Phe-X.sub.7-Trp-Glu-Cys-X.sub.11-X.su-
b.12-X.sub.13,
wherein
X.sub.1 is Ala, Asn, Lys, or Ser;
X.sub.2 is Ala, Glu, Met, Ser, or Val;
[0014] X.sub.3 is Ala, Asn, Lys, or Pro (preferably Lys); X.sub.5
is Phe, Trp, or Tyr (preferably Tyr); X.sub.7 is Pro or Tyr
(preferably Pro);
X.sub.11 is Ala, Gln, His, Phe, or Val;
X.sub.12 is Asn, Gln, Gly, His, Ser, or Val; and
X.sub.13 is Ala, Asn, Gly, Ile, Pro, or Ser,
[0015] wherein said polypeptide binds B lymphocyte stimulator
and/or B lymphocyte stimulator-like polypeptides; or
TABLE-US-00002 (B) (SEQ ID NO: 2)
X.sub.1-X.sub.2-X.sub.3-Cys-X.sub.5-X.sub.6-X.sub.7-X.sub.8-X.sub.9-X.sub-
.10-Cys-X.sub.12-X.sub.13-X.sub.14,
wherein X.sub.1 is Ala, Asp, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, Val, or is absent;
X.sub.2 is Ala, Asn, Asp, Gln, Gly, His, Ile, Leu, Lys, Met, Phe,
Pro, Ser, Thr, Trp, Tyr, or Val;
[0016] X.sub.3 is Ala, Arg, Asn, Asp, Gln, Glu, Gly, His, Ile, Leu,
Lys, Met, Phe, Pro, Ser, Trp, Tyr, or Val (preferably Asp); X.sub.5
is Asp, Ile, Leu, or Tyr (preferably Asp or Leu); X.sub.6 is Arg,
Asp, Glu, His, Ile, Leu, Lys, Phe, Pro, Tyr, or Val (preferably Glu
or Leu); X.sub.7 is His, Leu, Lys, or Phe (preferably His or Leu);
X.sub.8 is Leu, Pro, or Thr (preferably Thr or Pro); X.sub.9 is
Arg, Asn, Gly, His, Ile, Lys, Met, or Trp (preferably Lys);
X.sub.10 is Ala, Gln, Glu, Gly, His, Ile, Leu, Met, Phe, Ser, Trp,
Tyr, or Val;
X.sub.12 is Asp, Gln, Glu, Gly, Ile, Leu, Lys, Phe, Ser, Trp, Tyr,
or Val;
X.sub.13 is Ala, Arg, Asn, Asp, Gln, Glu, Gly, His, Leu, Lys, Met,
Phe, Pro, Ser, Thr, Trp, Tyr, or Val; and
[0017] X.sub.14 is Ala, Arg, Asn, Asp, Gln, Glu, Gly, His, Ile,
Leu, Lys, Phe, Pro, Trp, Tyr, Val, or is absent, wherein said
polypeptide binds B lymphocyte stimulator and/or B lymphocyte
stimulator-like polypeptides; or
TABLE-US-00003 (C) (SEQ ID NO: 3)
X.sub.1-X.sub.2-X.sub.3-Cys-X.sub.5-X.sub.6-X.sub.7-X.sub.8-X.sub.9-X.sub-
.10-X.sub.11-Cys-X.sub.13- X.sub.14-X.sub.15,
wherein
X.sub.1 is Ala, Arg, Asn, Asp, Leu, Lys, Phe, Pro, Ser, or Thr;
X.sub.2 is Asn, Asp, Gln, His, Ile, Lys, Pro, Thr, or Trp;
[0018] X.sub.3 is Ala, Arg, Asn, Gln, Glu, His, Phe, Pro, or Thr
(preferably Ala); X.sub.5 is Asn, Asp, Pro, Ser, or Thr (preferably
Asp); X.sub.6 is Arg, Asp, Ile, Leu, Met, Pro, or Val (preferably
Ile); X.sub.7 is Ala, Ile, Leu, Pro, Thr, or Val (preferably Val or
Leu); X.sub.8 is Asn, His, Ile, Leu, Lys, Phe, or Thr (preferably
Thr); X.sub.9 is Asn, Glu, Gly, His, Leu, Lys, Met, Pro, or Thr
(preferably Leu);
X.sub.10 is Arg, Asn, Asp, Gln, Glu, Gly, Ile, Lys, Met, Pro, Ser,
or Trp;
[0019] X.sub.11 is Arg, Glu, Gly, Lys, Phe, Ser, Trp, or Tyr
(preferably Ser); X.sub.13 is Gln, Glu, Ile, Leu, Phe, Pro, Ser,
Tyr, or Val (preferably Val);
X.sub.14 is Asn, Gly, Ile, Phe, Pro, Thr, Trp, or Tyr; and
[0020] X.sub.15 is Asn, Asp, Glu, Leu, Lys, Met, Pro, or Thr
(preferably Glu or Pro), wherein said polypeptide binds B
lymphocyte stimulator and/or B lymphocyte stimulator-like
polypeptides; or
TABLE-US-00004 (D) (SEQ ID NO: 4)
X.sub.1-X.sub.2-X.sub.3-Cys-X.sub.5-X.sub.6-X.sub.7-X.sub.8-X.sub.9-X.sub-
.10-X.sub.11-X.sub.12-Cys-X.sub.14- X.sub.15-X.sub.16,
wherein X.sub.1 is Asn, Asp, His, Leu, Phe, Pro, Ser, Tyr, or is
absent (preferably Ser); X.sub.2 is Arg, Asn, Asp, His, Phe, Ser,
or Trp (preferably Arg); X.sub.3 is Asn, Asp, Leu, Pro, Ser, or Val
(preferably Asn or Asp);
X.sub.5 is Asp, Gln, His, Ile, Leu, Lys, Met, Phe, or Thr;
X.sub.6 is His, Ile, Leu, Met, Phe, Pro, Trp, or Tyr;
[0021] X.sub.7 is Asp, His, Leu, or Ser (preferably Asp); X.sub.8
is Ala, Arg, Asp, Glu, Leu, Phe, Pro, or Thr (preferably Glu or
Pro); X.sub.9 is Ala, Arg, Asn, or Leu (preferably Leu); X.sub.10
is Ile, Leu, Met, Pro, Ser, or Thr (preferably Thr);
X.sub.11 is Ala, Arg, Asn, Gly, His, Lys, Ser, or Tyr;
X.sub.12 is Ala, Arg, Asn, Gln, Leu, Met, Ser, Trp, Tyr, or
Val;
[0022] X.sub.14 is Asp, Gly, Leu, Phe, Tyr, or Val (preferably
Leu); X.sub.15 is Asn, His, Leu, Pro, or Tyr (preferably His, Leu
or Pro); and X.sub.16 is Asn, Asp, His, Phe, Ser, or Tyr,
(preferably Asp or Ser), wherein said polypeptide binds B
lymphocyte stimulator and/or B lymphocyte stimulator-like
polypeptides; or
TABLE-US-00005 (E) (SEQ ID NO: 5)
X.sub.1-X.sub.2-X.sub.3-Cys-X.sub.5-X.sub.6-X.sub.7-X.sub.8-X.sub.9-X.sub-
.10-X.sub.11-X.sub.12-X.sub.13-X.sub.14-
Cys-X.sub.16-X.sub.17-X.sub.18,
wherein X.sub.1 is Arg, Asp, Gly, His, Leu, Phe, Pro, Ser, Trp,
Tyr, or is absent (preferably Arg); X.sub.2 is Ala, Arg, Asn, Asp,
Gly, Pro, Ser, or is absent (preferably Asn, Asp, Gly, or Pro);
X.sub.3 is Arg, Asn, Gln, Glu, Gly, Lys, Met, Pro, Trp or Val
(preferably Gly or Met); X.sub.5 is Arg, Asn, Gln, Glu, His, Leu,
Phe, Pro, Trp, Tyr, or Val (preferably Trp, Tyr, or Val); X.sub.6
is Arg, Asp, Gln, Gly, Ile, Lys, Phe, Thr, Trp or Tyr (preferably
Asp); X.sub.7 is Ala, Arg, Asp, Glu, Gly, Leu, Ser, or Tyr
(preferably Asp); X.sub.8 is Asp, Gln, Glu, Leu, Met, Phe, Pro,
Ser, or Tyr (preferably Leu); X.sub.9 is Asp, Leu, Pro, Thr, or Val
(preferably Leu or Thr); X.sub.10 is Arg, Gln, His, Ile, Leu, Lys,
Met, Phe, Thr, Trp or Tyr (preferably Lys or Thr); X.sub.11 is Ala,
Arg, Asn, Gln, Glu, His, Leu, Lys, Met, or Thr (preferably Arg or
Leu); X.sub.12 is Ala, Asn, Gln, Gly, Leu, Lys, Phe, Pro, Thr, Trp,
or Tyr (preferably Thr or Trp); X.sub.13 is Ala, Arg, Gln, His,
Lys, Met, Phe, Pro, Thr, Trp, or Tyr (preferably Met or Phe);
X.sub.14 is Arg, Gln, Glu, Gly, His, Leu, Met, Phe, Pro, Ser, Thr,
Tyr, or Val (preferably Val); X.sub.16 is Arg, Asp, Gly, His, Lys,
Met, Phe, Pro, Ser, or Trp (preferably Met); X.sub.17 is Arg, Asn,
Asp, Gly, His, Phe, Pro, Ser, Trp or Tyr, (preferably Arg, His, or
Tyr); and X.sub.18 is Ala, Arg, Asn, Asp, His, Leu, Phe, or Trp
(preferably His or Asn), wherein said polypeptide binds B
lymphocyte stimulator and/or B lymphocyte stimulator-like
polypeptides.
[0023] Additional preferred embodiments include methods utilizing
linear B lymphocyte stimulator binding polypeptides comprising, or
alternatively consisting of, an amino acid sequence selected from F
and G (SEQ ID NOs:6 and 7):
TABLE-US-00006 (F) (SEQ ID NO: 6)
X.sub.1-X.sub.2-X.sub.3-X.sub.4-X.sub.5-X.sub.6-X.sub.7-X.sub.8-X.sub.9-X-
.sub.10-X.sub.11-X.sub.12,
wherein X.sub.1 is Ala, Arg, Gly, His, Leu, Lys, Met, Phe, Trp,
Tyr, or Val (preferably Gly, Tyr, or Val); X.sub.2 is Ala, Arg,
Gln, His, Ile, Leu, Phe, Thr, Trp, or Tyr (preferably His or Tyr);
X.sub.3 is Ala, Asp, Lys, Phe, Thr, Trp or Tyr (preferably Asp or
Tyr); X.sub.4 is Arg, Asp, Gln, Lys, Met, Phe, Pro, Ser, Tyr, or
Val (preferably Asp or Gln); X.sub.5 is Asp, Leu, Lys, Phe, Pro,
Ser, or Val (preferably Leu or Ser); X.sub.6 is His, Ile, Leu, Pro,
Ser, or Thr (preferably Leu or Thr); X.sub.7 is Arg, Gly, His, Leu,
Lys, Met, or Thr (preferably Lys or Thr); X.sub.8 is Ala, Arg, Asn,
Ile, Leu, Lys, Met, or Thr (preferably Leu or Lys); X.sub.9 is Ala,
Asn, Arg, Asp, Glu, Gly, His, Leu, Met, Ser, Trp, Tyr, or Val
(preferably Met or Ser); X.sub.10 is Ile, Leu, Phe, Ser, Thr, Trp,
Tyr, or Val (preferably Thr or Leu); X.sub.11 is Ala, Arg, Gly,
His, Ile, Leu, Lys, Pro, Ser, Thr, Trp, Tyr, or Val (preferably Pro
or Thr); and X.sub.12 is Arg, Asp, His, Leu, Lys, Met, Phe, Pro,
Ser, Trp, Tyr, or Val (preferably Arg or Pro), wherein said
polypeptide binds B lymphocyte stimulator and/or B lymphocyte
stimulator-like polypeptides; or
TABLE-US-00007 (G) (SEQ ID NO: 7)
X.sub.1-X.sub.2-X.sub.3-X.sub.4-X.sub.5-X.sub.6-X.sub.7-X.sub.8-X.sub.9-X-
.sub.10-X.sub.11-X.sub.12-X.sub.13,
wherein X.sub.1 is Asp, Gln, Glu, Gly, His, Lys, Met, or Trp
(preferably Glu, Lys); X.sub.2 is Arg, Gln, His, Ile, Leu, or Pro
(preferably His or Pro); X.sub.3 is Asp, Gly, Ile, Lys, Thr, Tyr or
Val (preferably Tyr); X.sub.4 is Asn, Asp, Gln, Glu, Met, Pro, Ser,
or Tyr (preferably Asp or Gln); X.sub.5 is Asn, Asp, His, Ile, Leu,
Met, Pro, Thr or Val (preferably Asn or Thr); X.sub.6 is Asp, Glu,
His, Leu, Lys, Pro, or Val (preferably Asp or Pro); X.sub.7 is Arg,
Asn, Gln, His, Ile, Leu, Met, Pro, or Thr (preferably Ile or Pro);
X.sub.8 is Gln, Gly, His, Leu, Met, Ser, or Thr (preferably Leu or
Thr); X.sub.9 is Asn, Gln, Gly, His, Leu, Lys, Ser, or Thr
(preferably Lys); X.sub.10 is Ala, Gly, Ile, Leu, Lys, Met, or Phe
(preferably Gly or Met); X.sub.11 is Ala, Glu, His, Ile, Leu, Met,
Ser, Thr, Trp, Tyr, or Val (preferably Ala or Thr); X.sub.12 is
Arg, Gln, Glu, Gly, His, Ile, Lys, Tyr, or Val (preferably Arg or
His); and X.sub.13 is Arg, Asn, Glu, His, Ile, Ser, Thr, Trp, or
Val (preferably His), wherein said polypeptide binds B lymphocyte
stimulator and/or B lymphocyte stimulator-like polypeptides.
[0024] Additional polypeptides useful in the methods of the
invention include polypeptides comprising, or alternatively
consisting of, an amino acid sequence selected from H-L (SEQ ID
NOs:8-12):
TABLE-US-00008 (H) (SEQ ID NO: 8)
Cys-X.sub.2-Phe-X.sub.4-Trp-Glu-Cys,
wherein X.sub.2 is Phe, Trp, or Tyr (preferably Tyr); and X.sub.4
is Pro or Tyr (preferably Pro); or
TABLE-US-00009 (I) (SEQ ID NO: 9)
Cys-X.sub.2-X.sub.3-X.sub.4-X.sub.5-X.sub.6-X.sub.7-Cys,
wherein X.sub.2 is Asp, Ile, Leu, or Tyr (preferably Asp or Leu);
X.sub.3 is Arg, Asp, Glu, His, Ile, Leu, Lys, Phe, Pro, Tyr, or Val
(preferably Glu or Leu); X.sub.4 is His, Leu, Lys, or Phe
(preferably His or Leu); X.sub.5 is Leu, Pro, or Thr (preferably
Thr or Pro); X.sub.6 is Arg, Asn, Gly, His, Ile, Lys, Met, or Trp
(preferably Lys); and
X.sub.7 is Ala, Asn, Gln, Glu, Gly, His, Ile, Leu, Met, Phe, Ser,
Trp, Tyr, or Val; or
TABLE-US-00010 [0025] (J) (SEQ ID NO: 10)
Cys-X.sub.2-X.sub.3-X.sub.4-X.sub.5-X.sub.6-X.sub.7-X.sub.8-Cys,
wherein X.sub.2 is Asn, Asp, Pro, Ser, or Thr (preferably Asp);
X.sub.3 is Arg, Asp, Ile, Leu, Met, Pro, or Val (preferably Ile);
X.sub.4 is Ala, Ile, Leu, Pro, Thr, or Val (preferably Val or Leu);
X.sub.5 is Asn, His, Ile, Leu, Lys, Phe, or Thr (preferably Thr);
X.sub.6 is Asn, Glu, Gly, His, Leu, Lys, Met, Pro, or Thr
(preferably Leu);
X.sub.7 is Arg, Asn, Asp, Gln, Glu, Gly, Ile, Lys, Met, Pro, Ser,
or Trp;
[0026] X.sub.8 is Arg, Glu, Gly, Lys, Phe, Ser, Trp, or Tyr
(preferably Ser); or
TABLE-US-00011 (K) (SEQ ID NO: 11)
Cys-X.sub.2-X.sub.3-X.sub.4-X.sub.5-X.sub.6-X.sub.7-X.sub.8-X.sub.9-Cys,
wherein
X.sub.2 is Asp, Gln, His, Ile, Leu, Lys, Met, Phe, or Thr;
X.sub.3 is His, Ile, Leu, Met, Phe, Pro, Trp, or Tyr;
[0027] X.sub.4 is Asp, His, Leu, or Ser (preferably Asp); X.sub.5
is Ala, Arg, Asp, Glu, Leu, Phe, Pro, or Thr (preferably Glu or
Pro); X.sub.6 is Ala, Arg, Asn, or Leu (preferably Leu); X.sub.7 is
Ile, Leu, Met, Pro, Ser, or Thr (preferably Thr);
X.sub.8 is Ala, Arg, Asn, Gly, His, Lys, Ser, or Tyr;
X.sub.9 is Ala, Arg, Asn, Gln, Leu, Met, Ser, Trp, Tyr, or Val;
or
TABLE-US-00012 [0028] (L) (SEQ ID NO: 12)
Cys-X.sub.2-X.sub.3-X.sub.4-X.sub.5-X.sub.6-X.sub.7-X.sub.8-X.sub.9-X.sub-
.10-X.sub.11-Cys,
wherein X.sub.2 is Arg, Asn, Gln, Glu, His, Leu, Phe, Pro, Trp,
Tyr, or Val (preferably Trp, Tyr, or Val); X.sub.3 is Arg, Asp,
Gln, Gly, Ile, Lys, Phe, Thr, Trp or Tyr (preferably Asp); X.sub.4
is Ala, Arg, Asp, Glu, Gly, Leu, Ser, or Tyr (preferably Asp);
X.sub.5 is Asp, Gln, Glu, Leu, Met, Phe, Pro, Ser, or Tyr
(preferably Leu); X.sub.6 is Asp, Leu, Pro, Thr, or Val (preferably
Leu or Thr); X.sub.7 is Arg, Gln, His, Ile, Leu, Lys, Met, Phe,
Thr, Trp or Tyr (preferably Lys or Thr); X.sub.8 is Ala, Arg, Asn,
Gln, Glu, His, Leu, Lys, Met, or Thr (preferably Arg or Leu);
X.sub.9 is Ala, Asn, Gln, Gly, Leu, Lys, Phe, Pro, Thr, Trp, or Tyr
(preferably Thr or Trp); X.sub.10 is Ala, Arg, Gln, His, Lys, Met,
Phe, Pro, Thr, Trp, or Tyr (preferably Met or Phe); X.sub.11 is
Arg, Gln, Glu, Gly, His, Leu, Met, Phe, Pro, Ser, Thr, Tyr, or Val
(preferably Val); wherein said polypeptides bind B lymphocyte
stimulator and/or B lymphocyte stimulator-like polypeptides.
[0029] In preferred embodiments of the present invention, B
lymphocyte stimulator binding polypeptides are used which comprise
the following amino acid sequence M (SEQ ID NO:447):
TABLE-US-00013 (M) (SEQ ID NO: 447)
Ala-X.sub.2-X.sub.3-X.sub.4-Asp-X.sub.6-Leu-Thr-X.sub.9-Leu-X.sub.11-X.su-
b.12- X.sub.13-X.sub.14,
wherein X.sub.2 is Asn, Ser, Tyr, Asp, Phe, Ile, Gln, His, Pro,
Lys, Leu, Met, Thr, Val, Glu, Ala, Gly, Cys, or Trp (i.e., any
amino acid except Arg; preferably Asn); X.sub.3 is Trp, Glu, Lys,
Cys, Leu, Ala, Arg, Gly, or Ser (preferably Trp); X.sub.4 is Tyr,
Phe, Glu, Cys, Asn (preferably Tyr); X.sub.6 is Pro, Ser, Thr, Phe,
Leu, Tyr, Cys, or Ala (preferably Pro or Ser); X.sub.9 is Lys, Asn,
Gln, Gly, or Arg (preferably Lys); X.sub.11 is Trp, Ser, Thr, Arg,
Cys, Tyr, or Lys (preferably Trp); X.sub.12 is Leu, Phe, Val, Ile,
or His (preferably Leu); X.sub.13 is Pro, Leu, His, Ser, Arg, Asn,
Gln, Thr, Val, Ala, Cys, Ile, Phe, or Tyr (i.e., not Asp, Glu, Gly,
Lys, Met, or Trp; preferably Pro); and X.sub.14 is Asp, Glu, Asn,
Val, His, Gln, Arg, Gly, Ser, Tyr, Ala, Cys, Lys, Ile, Thr or Leu
(i.e., not Phe, Met, Pro, or Trp; preferably Asp, Val or Glu).
[0030] Preferred methods will utilize polypeptides comprising a
core sequence of the formula N:
TABLE-US-00014 (N) (SEQ ID NO: 448)
X.sub.1-X.sub.2-Asp-X.sub.4-Leu-Thr-X.sub.7-Leu-X.sub.9-X.sub.10,
wherein X.sub.1 is Trp, Glu, Lys, Cys, Leu, Ala, Arg, Gly, or Ser
(preferably Trp); X.sub.2 is Tyr, Phe, Glu, Cys, Asn (preferably
Tyr); X.sub.4 is Pro, Ser, Thr, Phe, Leu, Tyr, Cys, or Ala
(preferably Pro or Ser); X.sub.7 is Lys, Asn, Gln, Gly, or Arg
(preferably Lys); X.sub.9 is Trp, Ser, Thr, Arg, Cys, Tyr, or Lys
(preferably Trp); and X.sub.10 is Leu, Phe, Val, Ile, or His
(preferably Leu).
[0031] Especially preferred methods according to the invention will
utilize B lymphocyte stimulator binding polypeptides which comprise
the core peptide Trp-Tyr-Asp-Pro-Leu-Thr-Lys-Leu-Trp-Leu (SEQ ID
NO:436).
[0032] B lymphocyte stimulator binding polypeptides used in the
methods of the present invention may also have an amino terminal
(N-terminal) capping or functional group, such as an acetyl group,
which, for example, blocks the amino terminal amino group from
undesirable reactions or is useful in linking the B lymphocyte
stimulator binding polypeptide to another molecule, matrix, resin,
or solid support. B lymphocyte stimulator binding polypeptides may
also have a carboxy terminal (C-terminal) capping or functional
group, such as an amide group, which, for example, blocks the
C-terminal carboxyl group from undesirable reactions or provides a
functional group useful in conjugating the binding polypeptide to
other molecules, matrices, resins, or solid supports. Preferably,
the N- and/or C-terminal capping groups are polypeptide linker
molecules. An especially preferred C-terminal linker molecule that
is useful for immobilizing a B lymphocyte stimulator binding
polypeptide to a solid support or chromatographic matrix material
comprises the amino acid sequence Pro-Gly-Pro-Glu-Gly-Gly-Gly-Lys
(SEQ ID NO:13). Another useful C-terminal linker, e.g., for
fluoresceinating peptides, is Gly-Gly-Lys (see Table 14).
[0033] In the methods of the present invention, it may be
advantageous to use B lymphocyte stimulator binding polypeptides
that have been modified, for example, to increase or decrease the
stability of the molecule, while retaining the ability to bind B
lymphocyte stimulator and/or B lymphocyte stimulator-like
polypeptides. An example of a modified B lymphocyte stimulator
binding polypeptide is a polypeptide in which one of two cysteine
residues is substituted with a non-naturally occurring amino acid
that is capable of condensing with the remaining cysteine side
chain to form a stable thioether bridge, thereby generating a
cyclic B lymphocyte stimulator binding polypeptide. Such cyclic
thioether molecules of synthetic peptides may be routinely
generated using techniques known in the art, e.g., as described in
PCT publication WO 97/46251, incorporated herein by reference.
[0034] Some of the methods provided herein utilize B lymphocyte
stimulator binding polypeptides that have been attached, coupled,
linked or adhered to a matrix or resin or solid support. Techniques
for attaching, linking or adhering polypeptides to matrices, resins
and solid supports are well known in the art. Suitable matrices,
resins or solid supports for these materials may be any composition
known in the art to which a B lymphocyte stimulator binding
polypeptide could be attached, coupled, linked, or adhered,
including but not limited to, a chromatographic resin or matrix,
such as SEPHAROSE-4 FF agarose beads, the wall or floor of a well
in a plastic microtiter dish, such as used in an enzyme-liked
immunosorbent assay (ELISA), or a silica based biochip. Materials
useful as solid supports on which to immobilize binding
polypeptides for use in the methods include, but are not limited
to, polyacrylamide, agarose, silica, nitrocellulose, paper,
plastic, nylon, metal, and combinations thereof. A B lymphocyte
stimulator binding polypeptide may be immobilized on a matrix,
resin or solid support material by a non-covalent association or by
covalent bonding, using techniques known in the art.
[0035] In certain embodiments of the present invention, it is
preferred to utilize B lymphocyte stimulator binding polypeptides
or phage displaying such binding polypeptides that irreversibly
bind the B lymphocyte stimulator protein in its native, soluble
trimeric form.
[0036] In certain embodiments of the present, it is preferred to
utilize B lymphocyte stimulator binding polypeptides of the present
invention or phage displaying such binding polypeptides that
reversibly bind the B lymphocyte stimulator protein in its native,
soluble trimeric form.
[0037] In further embodiments of the present invention, a method
may call for the use of a composition of matter comprising isolated
nucleic acids, preferably DNA, encoding a B lymphocyte stimulator
binding polypeptide. In specific embodiments, nucleic acid
molecules encode a B lymphocyte stimulator binding polypeptide
comprising the amino acid sequence of SEQ ID NOs:1-12, 20-172, or
186-444. In additional embodiments, the nucleic acid molecules
encode a polypeptide variant or fragment of a polypeptide
comprising an amino acid sequence of SEQ ID NOs:1-12, 20-172, or
186-444. In a further additional embodiment, such nucleic acid
molecules encode a B lymphocyte stimulator binding polypeptide, the
complementary strand of which nucleic acid hybridizes to a
polynucleotide sequence encoding a polypeptide described in Tables
1-8 and 13 and in Examples 2, 5 and 6 (SEQ ID NOs:1-12, 20-172 and
186-444), under stringent conditions, e.g., hybridization to
filter-bound DNA in 6.times. sodium chloride/sodium citrate (SSC)
at about 45.degree. C. followed by one or more washes in
0.2.times.SSC/0.1% SDS at about 50-65.degree. C., under highly
stringent conditions, e.g., hybridization to filter-bound nucleic
acid in 6.times.SSC at about 45.degree. C. followed by one or more
washes in 0.1.times.SSC/0.2% SDS at about 68.degree. C., or under
other stringent hybridization conditions which are known to those
of skill in the art (see, for example, Ausubel, F. M. et al., eds.,
1989, Current Protocols in Molecular Biology, Vol. I, Green
Publishing Associates, Inc. and John Wiley & Sons, Inc., New
York at pages 6.3.1-6.3.6 and 2.10.3).
[0038] In further embodiments of the invention, recombinant
bacteriophage are utilized which display B lymphocyte stimulator
binding polypeptides on their surfaces. Such phage may be routinely
generated using techniques known in the art and are useful, for
example, as screening reagents and reagents for detecting B
lymphocyte stimulator.
[0039] In other methods according to the invention, a B lymphocyte
stimulator binding polypeptide is used to detect or isolate B
lymphocyte stimulator or B lymphocyte stimulator-like polypeptides
in a solution. Such solutions include, but are not limited to, B
lymphocyte stimulator or B lymphocyte stimulator-like polypeptides
suspended or dissolved in water or a buffer solution as well as any
fluid and/or cell obtained from an individual, biological fluid,
body tissue, body cell, cell line, tissue culture, or other source
which may contain B lymphocyte stimulator or B lymphocyte
stimulator-like polypeptides, such as, cell culture medium, cell
extracts, and tissue homogenates. Biological fluids include, but
are not limited to, sera, plasma, lymph, blood, blood fractions,
urine, synovial fluid, spinal fluid, saliva, and mucous.
[0040] Methods according to the present invention may
advantageously utilize panels of B lymphocyte stimulator binding
polypeptides (including molecules comprising, or alternatively
consisting of, B lymphocyte stimulator binding polypeptide
fragments or variants) wherein the panel members correspond to one,
two, three, four, five, ten, fifteen, twenty, or more different B
lymphocyte stimulator binding polypeptides. Methods according to
the present invention may alternatively use mixtures of B
lymphocyte stimulator binding polypeptides, wherein the mixture
corresponds to one, two, three, four, five, ten, fifteen, twenty,
or more different B lymphocyte stimulator binding polypeptides. The
present invention also provides methods of using compositions
comprising, or alternatively consisting of, one, two, three, four,
five, ten, fifteen, twenty, or more B lymphocyte stimulator binding
polypeptides (including molecules comprising, or alternatively
consisting of, B lymphocyte stimulator binding polypeptide
fragments or variants thereof). Alternatively, a method according
to the invention may utilize a composition comprising, or
alternatively consisting of, nucleic acid molecules encoding one or
more B lymphocyte stimulator binding polypeptides.
[0041] The methods of the present invention also provides for the
use of fusion proteins comprising a B lymphocyte stimulator binding
polypeptide (including molecules comprising, or alternatively
consisting of, B lymphocyte stimulator binding polypeptide
fragments or variants thereof), and a heterologous polypeptide. A
composition useful in methods of the present invention may
comprise, or alternatively consist of, one, two, three, four, five,
ten, fifteen, twenty or more fusion proteins capable of binding to
B lymphocyte stimulator. Alternatively, a composition useful in
methods of the invention may comprise, or alternatively consist of,
nucleic acid molecules encoding one, two, three, four, five, ten,
fifteen, twenty or more such fusion proteins.
[0042] The present invention encompasses methods and compositions
for detecting, diagnosing, prognosing, and/or monitoring diseases
or disorders associated with aberrant B lymphocyte stimulator or B
lymphocyte stimulator receptor expression or inappropriate B
lymphocyte stimulator or B lymphocyte stimulator receptor function
in an animal, preferably a mammal, and most preferably a human,
comprising, or alternatively consisting of, use of B lymphocyte
stimulator binding polypeptides (including molecules which
comprise, or alternatively consist of, B lymphocyte stimulator
binding polypeptide fragments or variants thereof) that
specifically bind to B lymphocyte stimulator. Diseases and
disorders which can be detected, diagnosed, prognosed and/or
monitored with the B lymphocyte stimulator binding polypeptides
include, but are not limited to, immune system diseases or
disorders (e.g., autoimmune diseases or disorders,
immunodeficiencies, lupus, glomerular nephritis, rheumatoid
arthritis, multiple sclerosis, graft vs. host disease, myasthenia
gravis, Hashimoto's disease, and immunodeficiency syndrome),
proliferative diseases or disorders (e.g., cancer, premalignant
conditions, benign tumors, hyperproliferative disorders, benign
proliferative disorders, leukemia, lymphoma, chronic lymphocytic
leukemia, multiple myeloma, Hodgkin's lymphoma, Hodgkin's disease,
T cell proliferative diseases and disorders, B cell proliferative
diseases and disorders, monocytic proliferative diseases or
disorders, acute myelogenous leukemia, macrophage proliferative
diseases and disorders, and carcinoma), infectious diseases (e.g.,
AIDS), and inflammatory disorders (e.g., asthma, allergic
disorders, and rheumatoid arthritis).
[0043] In specific embodiments, the present invention encompasses
methods and compositions for detecting, diagnosing, prognosing
and/or monitoring diseases or disorders associated with
hypergammaglobulinemia (e.g., AIDS, autoimmune diseases, and some
immunodeficiencies). In other specific embodiments, the present
invention encompasses methods and compositions for detecting,
diagnosing, prognosing and/or monitoring diseases or disorders
associated with hypogammaglobulinemia (e.g., an
immunodeficiency).
[0044] The present invention further encompasses methods and
compositions for preventing, treating and/or ameliorating diseases
or disorders associated with aberrant B lymphocyte stimulator or B
lymphocyte stimulator receptor expression or inappropriate B
lymphocyte stimulator or B lymphocyte stimulator receptor function
in an animal, preferably a mammal, and most preferably a human,
comprising, or alternatively consisting of, administering to an
animal in which such treatment, prevention or amelioration is
desired one or more B lymphocyte stimulator binding polypeptides
(including molecules which comprise, or alternatively consist of, B
lymphocyte stimulator binding polypeptide fragments or variants
thereof) in an amount effective to treat, prevent or ameliorate the
disease or disorder. Diseases and disorders which can be prevented,
treated, and/or ameliorated with the B lymphocyte stimulator
binding polypeptides include, but are not limited to, immune system
diseases or disorders (e.g., autoimmune diseases or disorders,
immunodeficiencies, lupus, glomerular nephritis, rheumatoid
arthritis, multiple sclerosis, graft vs. host disease, myasthenia
gravis, Hashimoto's disease, immunodeficiency syndrome,
hypogammaglobulinemia, and hypergammaglobulinemia), proliferative
diseases or disorders (e.g., cancer, premalignant conditions,
benign tumors, hyperproliferative disorders, benign proliferative
disorders, leukemia, lymphoma, chronic lymphocytic leukemia,
multiple myeloma, Hodgkin's lymphoma, Hodgkin's disease, T cell
proliferative diseases and disorders, B cell proliferative diseases
and disorders, monocytic proliferative diseases or disorders, acute
myelogenous leukemia, macrophage proliferative diseases and
disorders, and carcinoma), infectious diseases (e.g., AIDS), and
inflammatory disorders (e.g., asthma, allergic disorders, and
rheumatoid arthritis).
[0045] In specific embodiments, the present invention encompasses
methods and compositions (e.g., B lymphocyte stimulator binding
polypeptides that antagonize B lymphocyte stimulator activity) for
preventing, treating and/or ameliorating diseases or disorders
associated with hypergammaglobulinemia (e.g., AIDS, autoimmune
diseases, and some immunodeficiency syndromes). In other specific
embodiments, the present invention encompasses methods and
compositions (e.g., B lymphocyte stimulator binding polypeptides
that enhance B lymphocyte stimulator activity) for preventing,
treating or ameliorating diseases or disorders associated with
hypogammaglobulinemia (e.g., an immunodeficiency syndrome).
[0046] In specific embodiments, the present invention encompasses
methods and compositions (e.g., B lymphocyte stimulator binding
polypeptides that antagonize B lymphocyte stimulator activity) for
preventing, treating and/or ameliorating immune system diseases or
disorders, comprising, or alternatively consisting of,
administering to an animal in which such treatment, prevention,
and/or amelioration is desired, a B lymphocyte stimulator binding
polypeptide in an amount effective to treat, prevent and/or
ameliorate the disease or disorder.
[0047] In specific embodiments, the present invention encompasses
methods and compositions (e.g., B lymphocyte stimulator binding
polypeptides that antagonize B lymphocyte stimulator activity) for
preventing, treating and/or ameliorating diseases or disorders of
cells of hematopoietic origin, comprising, or alternatively
consisting of, administering to an animal in which such treatment,
prevention, and/or amelioration is desired, a B lymphocyte
stimulator binding polypeptide in an amount effective to treat,
prevent and/or ameliorate the disease or disorder.
[0048] Autoimmune disorders, diseases, or conditions that may be
detected, diagnosed, prognosed, monitored, treated, prevented,
and/or ameliorated using the B lymphocyte stimulator binding
polypeptides include, but are not limited to, autoimmune hemolytic
anemia, autoimmune neonatal thrombocytopenia, idiopathic
thrombocytopenia purpura, autoimmune neutropenia,
autoimmunocytopenia, hemolytic anemia, antiphospholipid syndrome,
dermatitis, gluten-sensitive enteropathy, allergic
encephalomyelitis, myocarditis, relapsing polychondritis, rheumatic
heart disease, glomerulonephritis (e.g., IgA nephropathy), Multiple
Sclerosis, Neuritis, Uveitis Ophthalmia, Polyendocrinopathies,
Purpura (e.g., Henloch-Scoenlein purpura), Reiter's Disease,
Stiff-Man Syndrome, Autoimmune Pulmonary Inflammation, myocarditis,
IgA glomerulonephritis, dense deposit disease, rheumatic heart
disease, Guillain-Barre Syndrome, insulin dependent diabetes
mellitis, and autoimmune inflammatory eye, autoimmune thyroiditis,
hypothyroidism (i.e., Hashimoto's thyroiditis), systemic lupus
erythematosus, discoid lupus, Goodpasture's syndrome, Pemphigus,
Receptor autoimmunities such as, for example, (a) Graves' Disease,
(b) Myasthenia Gravis, and (c) insulin resistance, autoimmune
hemolytic anemia, autoimmune thrombocytopenic purpura, rheumatoid
arthritis, schleroderma with anti-collagen antibodies, mixed
connective tissue disease, polymyositis/dermatomyositis, pernicious
anemia, idiopathic Addison's disease, infertility,
glomerulonephritis such as primary glomerulonephritis and IgA
nephropathy, bullous pemphigoid, Sjogren's syndrome, diabetes
mellitus, and adrenergic drug resistance (including adrenergic drug
resistance with asthma or cystic fibrosis), chronic active
hepatitis, primary biliary cirrhosis, other endocrine gland
failure, vitiligo, vasculitis, post-MI, cardiotomy syndrome,
urticaria, atopic dermatitis, asthma, inflammatory myopathies, and
other inflammatory, granulomatous, degenerative, and atrophic
disorders).
[0049] Immunodeficiencies that may be detected, diagnosed,
prognosed, monitored, treated, prevented, and/or ameliorated using
the B lymphocyte stimulator binding polypeptides include, but are
not limited to, severe combined immunodeficiency (SCID)-X linked,
SCID-autosomal, adenosine deaminase deficiency (ADA deficiency),
X-linked agammaglobulinemia (XLA), Bruton's disease, congenital
agammaglobulinemia, X-linked infantile agammaglobulinemia, acquired
agammaglobulinemia, adult onset agammaglobulinemia, late-onset
agammaglobulinemia, dysgammaglobulinemia, hypogammaglobulinemia,
transient hypogammaglobulinemia of infancy, unspecified
hypogammaglobulinemia, agammaglobulinemia, common variable
immunodeficiency (CVID) (acquired), Wiskott-Aldrich Syndrome (WAS),
X-linked immunodeficiency with hyper IgM, non X-linked
immunodeficiency with hyper IgM, selective IgA deficiency, IgG
subclass deficiency (with or without IgA deficiency), antibody
deficiency with normal or elevated Igs, immunodeficiency with
thymoma, Ig heavy chain deletions, kappa chain deficiency, B cell
lymphoproliferative disorder (BLPD), selective IgM
immunodeficiency, recessive agammaglobulinemia (Swiss type),
reticular dysgenesis, neonatal neutropenia, severe congenital
leukopenia, thymic alymphoplasia-aplasia or dysplasia with
immunodeficiency, ataxia-telangiectasia, short limbed dwarfism,
X-linked lymphoproliferative syndrome (XLP), Nezelof
syndrome-combined immunodeficiency with Igs, purine nucleoside
phosphorylase deficiency (PNP), MHC Class II deficiency (Bare
Lymphocyte Syndrome) and severe combined immunodeficiency.
[0050] The present invention further encompasses methods and
compositions for inhibiting or reducing immunoglobulin production,
comprising, or alternatively consisting of, contacting an effective
amount of B lymphocyte stimulator binding polypeptide with B
lymphocyte stimulator, wherein the effective amount of B lymphocyte
stimulator binding polypeptide inhibits or reduces B lymphocyte
stimulator mediated immunoglobulin production.
[0051] The present invention further encompasses methods and
compositions for inhibiting or reducing immunoglobulin production,
comprising, or alternatively consisting of, administering to an
animal in which such inhibition or reduction is desired, a B
lymphocyte stimulator binding polypeptide in an amount effective to
inhibit or reduce immunoglobulin production.
[0052] The present invention further encompasses methods and
compositions for inhibiting or reducing B cell proliferation,
comprising, or alternatively consisting of, contacting an effective
amount of B lymphocyte stimulator binding polypeptide with B
lymphocyte stimulator, wherein the effective amount of B lymphocyte
stimulator binding polypeptide inhibits or reduces B lymphocyte
stimulator mediated B cell proliferation.
[0053] The present invention further encompasses methods and
compositions for inhibiting or reducing B cell proliferation
comprising, or alternatively consisting of, administering to an
animal in which such inhibition or reduction is desired, a B
lymphocyte stimulator binding polypeptide in an amount effective to
inhibit or reduce B cell proliferation.
[0054] The present invention further encompasses methods and
compositions for inhibiting or reducing activation of B cells,
comprising, or alternatively consisting of, contacting an effective
amount of B lymphocyte stimulator binding polypeptide with B
lymphocyte stimulator, wherein the effective amount of B lymphocyte
stimulator binding polypeptide inhibits or reduces B lymphocyte
stimulator mediated B cell activation.
[0055] The present invention further encompasses methods and
compositions for inhibiting or reducing activation of B cells,
comprising, or alternatively consisting of, administering to an
animal in which such inhibition or reduction is desired, a B
lymphocyte stimulator binding polypeptide in an amount effective to
inhibit or reduce B cell activation.
[0056] The present invention further encompasses methods and
compositions for decreasing lifespan of B cells, comprising, or
alternatively consisting of, contacting an effective amount of B
lymphocyte stimulator binding polypeptide with B lymphocyte
stimulator, wherein the effective amount of B lymphocyte stimulator
binding polypeptide inhibits or reduces B lymphocyte stimulator
regulated lifespan of B cells.
[0057] The present invention further encompasses methods and
compositions for decreasing lifespan of B cells, comprising, or
alternatively consisting of, administering to an animal in which
such decrease is desired, a B lymphocyte stimulator binding
polypeptide in an amount effective to decrease B cell lifespan.
[0058] The present invention further encompasses methods and
compositions for inhibiting or reducing graft rejection,
comprising, or alternatively consisting of, administering to an
animal in which such inhibition or reduction is desired, a B
lymphocyte stimulator binding polypeptide in an amount effective to
inhibit or reduce graft rejection.
[0059] The present invention further encompasses methods and
compositions for killing cells of hematopoietic origin, comprising,
or alternatively consisting of, contacting B lymphocyte stimulator
binding polypeptides with B lymphocyte stimulator to form a
complex; and contacting the complex with cells of hematopoietic
origin.
[0060] The present invention further encompasses methods and
compositions for killing cells of hematopoietic origin, comprising,
or alternatively consisting of, administering to an animal in which
such killing is desired, a B lymphocyte stimulator binding
polypeptide in an amount effective to kill cells of hematopoietic
origin.
[0061] The present invention further encompasses methods and
compositions for stimulating immunoglobulin production, comprising,
or alternatively consisting of, contacting an effective amount of B
lymphocyte stimulator binding polypeptide with B lymphocyte
stimulator, wherein the effective amount of the B lymphocyte
stimulator binding polypeptide stimulates B lymphocyte stimulator
mediated immunoglobulin production.
[0062] The present invention further encompasses methods and
compositions for stimulating immunoglobulin production comprising,
or alternatively consisting of, administering to an animal in which
such stimulation is desired, a B lymphocyte stimulator binding
polypeptide in an amount effective to stimulate immunoglobulin
production.
[0063] The present invention further encompasses methods and
compositions for stimulating B cell proliferation, comprising, or
alternatively consisting of, contacting an effective amount of B
lymphocyte stimulator binding polypeptide with B lymphocyte
stimulator, wherein the effective amount of B lymphocyte stimulator
binding polypeptide stimulates B lymphocyte stimulator mediated B
cell proliferation.
[0064] The present invention further encompasses methods and
compositions for stimulating B cell proliferation, comprising, or
alternatively consisting of, administering to an animal in which
such stimulation is desired, a B lymphocyte stimulator binding
polypeptide in an amount effective to stimulate B cell
proliferation.
[0065] The present invention further encompasses methods and
compositions for increasing activation of B cells, comprising, or
alternatively consisting of, contacting an effective amount of B
lymphocyte stimulator binding polypeptide with B lymphocyte
stimulator, wherein the effective amount of B lymphocyte stimulator
binding polypeptide increases B lymphocyte stimulator mediated
activation of B cells.
[0066] The present invention further encompasses methods and
compositions for increasing activation of B cells, comprising, or
alternatively consisting of, administering to an animal in which
such increase is desired, a B lymphocyte stimulator binding
polypeptide in an amount effective to increase B cell
activation.
[0067] The present invention further encompasses methods and
compositions for increasing lifespan of B cells, comprising, or
alternatively consisting of, contacting an effective amount of B
lymphocyte stimulator binding polypeptide with B lymphocyte
stimulator, wherein the effective amount of B lymphocyte stimulator
binding polypeptide increases B lymphocyte stimulator regulated
lifespan of B cells.
[0068] The present invention further encompasses methods and
compositions for increasing lifespan of B cells, comprising, or
alternatively consisting of, administering to an animal in which
such increase is desired, a B lymphocyte stimulator binding
polypeptide in an amount effective to increase lifespan of B
cells.
DEFINITIONS
[0069] In order that the invention may be clearly understood, the
following terms are defined:
[0070] The term "recombinant" is used to describe non-naturally
altered or manipulated nucleic acids, host cells transfected with
exogenous nucleic acids, or polypeptide molecules that are
expressed non-naturally, through manipulation of isolated nucleic
acid (typically, DNA) and transformation or transfection of host
cells. "Recombinant" is a term that specifically encompasses
nucleic acid molecules that have been constructed in vitro using
genetic engineering techniques, and use of the term "recombinant"
as an adjective to describe a molecule, construct, vector, cell,
polypeptide or polynucleotide specifically excludes naturally
occurring such molecules, constructs, vectors, cells, polypeptides
or polynucleotides.
[0071] The term "bacteriophage" is defined as a bacterial virus
containing a nucleic acid core and a protective shell built up by
the aggregation of a number of different protein molecules. The
terms "bacteriophage" and "phage" are synonymous and are used
herein interchangeably.
[0072] The term "affinity ligand" is sometimes used herein and is
synonymous with B lymphocyte stimulator binding polypeptides.
[0073] The term "B lymphocyte stimulator protein" as used herein
encompasses both the membrane (e.g., SEQ ID NOs:173 and 174) and
soluble forms (e.g., amino acids 134-285 of SEQ ID NO:173) of B
lymphocyte stimulator. B lymphocyte stimulator protein may be
monomeric, dimeric, or trimeric or multivalent. Preferably, B
lymphocyte stimulator proteins are homotrimeric.
[0074] The term "B lymphocyte stimulator-like polypeptide" as used
herein encompasses natural B lymphocyte stimulator or full-length
recombinant B lymphocyte stimulator as well as fragments and
variants thereof, such as, a modified or truncated form of natural
B lymphocyte stimulator or full-length recombinant B lymphocyte
stimulator, which B lymphocyte stimulator and B lymphocyte
stimulator-like polypeptide retain a B lymphocyte stimulator
functional activity. B lymphocyte stimulator or B lymphocyte
stimulator fragments that may be specifically bound by the
compositions useful according to the invention include, but are not
limited to, human B lymphocyte stimulator (SEQ ID NOs:173 and/or
174) or B lymphocyte stimulator expressed on human monocytes;
murine B lymphocyte stimulator (SEQ ID NOs:175 and/or 176) or B
lymphocyte stimulator expressed on murine monocytes; rat B
lymphocyte stimulator (either the soluble forms as given in SEQ ID
NOs:177, 178, 179 and/or 180 or in a membrane associated form,
e.g., on the surface of rat monocytes); or monkey B lymphocyte
stimulator (e.g., the monkey B lymphocyte stimulator polypeptides
of SEQ ID NOS:181 and/or 182, the soluble form of monkey B
lymphocyte stimulator, or B lymphocyte stimulator expressed on
monkey monocytes) or fragments thereof. Preferably compositions
useful according to the invention bind human B lymphocyte
stimulator (SEQ ID NOs:173 and/or 174) or fragments thereof. B
lymphocyte stimulator and B lymphocyte stimulator-like polypeptides
retain at least one functional activity of the natural or
full-length B lymphocyte stimulator, including but not limited to
the following activities: binding to B lymphocyte stimulator
receptor (e.g., TACI (GenBank accession number AAC51790), and BCMA
(GenBank accession number NP.sub.--001183)), stimulating B cell
proliferation, stimulating immunoglobulin secretion by B cells,
stimulating the B lymphocyte stimulator receptor signaling cascade
and/or being bound by an anti-B lymphocyte stimulator antibody or
other B lymphocyte stimulator binding polypeptide. Assays that can
be used to determine the functional activities of B lymphocyte
stimulator or B lymphocyte stimulator like polypeptides can readily
be determined by one skilled in the art (e.g., see assays disclosed
in Moore et al., 1999, supra) "B lymphocyte stimulator-like
polypeptides" also include fusion polypeptides in which all or a
portion of B lymphocyte stimulator is fused or conjugated to
another polypeptide. B lymphocyte stimulator-like polypeptides that
are fusion polypeptides retain at least one functional activity of
B lymphocyte stimulator, preferably the ability to stimulate B
lymphocytes (see, for example, Moore et al., Science, 285: 260-263
(1999)), to bind the B lymphocyte stimulator receptors (e.g., TACI
or BCMA), and/or to be bound by an anti-B lymphocyte stimulator
antibody or other B lymphocyte stimulator binding polypeptide. B
lymphocyte stimulator fusion polypeptides may be made by
recombinant DNA techniques in which a gene or other polynucleotide
coding sequence for B lymphocyte stimulator or a fragment thereof
is ligated in-frame (recombined) with the coding sequence of
another protein or polypeptide. The resulting recombinant DNA
molecule is then inserted into any of a variety of plasmid or phage
expression vectors, which enable expression of the fusion protein
molecule in an appropriate eukaryotic or prokaryotic host cell. B
lymphocyte stimulator fusion polypeptides may be generated by
synthetic or semi-synthetic procedures as well.
[0075] The terms "B lymphocyte stimulator target" or "B lymphocyte
stimulator target protein" are sometimes used herein and encompass
B lymphocyte stimulator and/or B lymphocyte stimulator-like
polypeptides. Thus, the B lymphocyte stimulator binding
polypeptides used according to the methods of the invention bind "B
lymphocyte stimulator target proteins" and can be used to bind,
detect, remove, and/or purify "B lymphocyte stimulator target
proteins."
[0076] The term "binding polypeptide" is used herein to refer to
any polypeptide capable of forming a binding complex with another
molecule, polypeptide, peptidomimetic or transformant.
[0077] A "B lymphocyte stimulator binding polypeptide" is a
molecule that can bind B lymphocyte stimulator target protein.
Non-limiting examples of B lymphocyte stimulator binding
polypeptides useful in the methods of the invention are the
polypeptide molecules having an amino acid sequence described
herein (see SEQ ID NOs:1-12, 20-172, and 186-444). The term B
lymphocyte stimulator binding polypeptide also encompasses B
lymphocyte stimulator binding fragments and variants (including
derivatives) of polypeptides having the specific amino acid
sequences described herein (SEQ ID NOs:1-12, 20-172, and 186-444).
By "variant" of an amino acid sequence as described herein is meant
a polypeptide that binds B lymphocyte stimulator, but does not
necessarily comprise an identical or similar amino acid sequence of
a B lymphocyte stimulator binding polypeptide specified herein. B
lymphocyte stimulator binding polypeptides useful according to the
invention which are variants of a B lymphocyte stimulator binding
polypeptide specified herein satisfy at least one of the following:
(a) a polypeptide comprising, or alternatively consisting of, an
amino acid sequence that is at least 30%, at least 35%, at least
40%, at least 45%, at least 50%, at least 55%, at least 60%, at
least 65%, at least 70%, at least 75%, at least 80%, at least 85%,
at least 90%, at least 95% least 99%, or 100% identical to the
amino acid sequence of a B lymphocyte stimulator binding
polypeptide sequence disclosed herein (SEQ ID NOs:1-12, 20-172, and
186-444), (b) a polypeptide encoded by a nucleotide sequence, the
complementary sequence of which hybridizes under stringent
conditions to a nucleotide sequence encoding a B lymphocyte
stimulator binding polypeptide disclosed herein (e.g., a nucleic
acid sequence encoding the amino acid sequence of SEQ ID NOs:1-12,
20-172, and 186-444), and/or a fragment of a B lymphocyte
stimulator binding polypeptide disclosed herein, of at least 5
amino acid residues, at least 10 amino acid residues, at least 15
amino acid residues, or at least 20 amino acid residues. B
lymphocyte stimulator binding polypeptides useful according to the
invention also encompass polypeptide sequences that have been
modified for various applications provided that such modifications
do not eliminate the ability to bind a B lymphocyte stimulator
target. Specific, non-limiting examples of modifications
contemplated include C-terminal or N-terminal amino acid
substitutions or peptide chain elongations for the purpose of
linking the B lymphocyte stimulator binder to a chromatographic
material or other solid support. Other substitutions contemplated
herein include substitution of one or both of a pair of cysteine
residues that normally form disulfide links, for example with
non-naturally occurring amino acid residues having reactive side
chains, for the purpose of forming a more stable bond between those
amino acid positions than the former disulfide bond. All such
modified binding polypeptides are also considered B lymphocyte
stimulator binding polypeptides so long as the modified
polypeptides retain the ability to bind B lymphocyte stimulator
and/or B lymphocyte stimulator-like polypeptides, and therefore,
may be used in one or more of the various methods described herein,
such as, to detect, purify, or isolate B lymphocyte stimulator or B
lymphocyte stimulator-like polypeptides in or from a solution. B
lymphocyte stimulator binding polypeptides also include variants of
the specific B lymphocyte stimulator binding polypeptide sequences
disclosed herein (e.g., SEQ ID NOs:1-12, 20-172, and 186-444) which
have an amino acid sequence corresponding to one of these
polypeptide sequences, but in which the polypeptide sequence is
altered by substitutions, additions or deletions that provide for
molecules that bind B lymphocyte stimulator. Thus, the B lymphocyte
stimulator binding polypeptides include polypeptides containing, as
a primary amino acid sequence, all or part of the particular B
lymphocyte stimulator binding polypeptide sequence including
altered sequences in which functionally equivalent amino acid
residues are substituted for residues within the sequence,
resulting in a peptide which is functionally active. For example,
one or more amino acid residues within the sequence can be
substituted by another amino acid of a similar polarity which acts
as a functional equivalent, resulting in a silent alteration.
Conservative substitutions for an amino acid within the sequence
may be selected from other members of the class to which the amino
acid belongs. For example, the nonpolar (hydrophobic) amino acids
include alanine, leucine, isoleucine, valine, proline,
phenylalanine, tryptophan and methionine. The polar neutral amino
acids include glycine, serine, threonine, cysteine, tyrosine,
asparagine, and glutamine. The positively charged (basic) amino
acids include arginine, lysine and histidine. The negatively
charged (acidic) amino acids include aspartic acid and glutamic
acid. Such B lymphocyte stimulator binding polypeptides can be made
either by chemical peptide synthesis or by recombinant production
from a nucleic acid encoding the B lymphocyte stimulator binding
polypeptide which nucleic acid has been mutated. Any technique for
mutagenesis known in the art can be used, including but not limited
to, chemical mutagenesis, in vitro site-directed mutagenesis
(Hutchinson et al., J. Biol. Chem., 253:6551 (1978)), use of
TAB.RTM. linkers (Pharmacia), etc.
[0078] As used and understood herein, percent homology or percent
identity of two amino acid sequences or of two nucleic acid
sequences is determined using the algorithm of Karlin and Atschul
(Proc. Natl. Acad. Sci. USA, 87: 2264-2268 (1990)), modified as in
Karlin and Altschul (Proc. Natl. Acad. Sci. USA, 90: 5873-5877
(1993)). Such an algorithm is incorporated into the NBLAST and
XBLAST programs of Altschul et al. (J. Mol. Biol., 215: 403-410
(1990)). BLAST nucleotide searches are performed with the NBLAST
program to obtain nucleotide sequences homologous to a nucleic acid
molecule described herein. BLAST protein searches are performed
with the XBLAST program to obtain amino acid sequences homologous
to a reference polypeptide. To obtain gapped alignments for
comparison purposes, Gapped BLAST is utilized as described in
Altschul et al. (Nucleic Acids Res., 25: 3389-3402 (1997)). When
utilizing BLAST and Gapped BLAST programs, the default parameters
of the respective programs (e.g., XBLAST and NBLAST) are used. See,
http://www.ncbi.nlm.nih.gov. Alternatively, the percent identity of
two amino acid sequences or of two nucleic acid sequences can be
determined once the sequences are aligned for optimal comparison
purposes (e.g., gaps can be introduced in the sequence of a first
amino acid or nucleic acid sequence for optimal alignment with a
second amino acid or nucleic acid sequence). The amino acid
residues or nucleotides at corresponding amino acid positions or
nucleotide positions are then compared. When a position in the
first sequence is occupied by the same amino acid residue or
nucleotide at the corresponding position in the second sequence,
then the molecules are identical at that position. The percent
identity between the two sequences is a function of the number of
identical positions shared by the sequences (i.e., %
identity=number of identical overlapping positions/total number of
positions.times.100%). In one embodiment, the two sequences are the
same length.
[0079] The term "polypeptide", as used herein, refers to a linear,
branched, or cyclic (e.g., containing a loop structure) polymer of
two or more amino acid residues linked with a peptide bond. The
term "polypeptide" is not restricted to any particular upper limit
of amino acid residues. Thus, the B lymphocyte stimulator affinity
ligands that comprise an amino acid sequence described herein are
properly referred to as "B lymphocyte stimulator binding
polypeptides" because such binding polypeptides contain at least
two amino acid residues held together by a peptide bond, even
though such molecules may also contain one or more additional
moieties or groups that are not amino acids, such as N-terminal
and/or C-terminal capping or functional groups, and that may or may
not be involved in a peptide bond. The polypeptides may be
monovalent, divalent, trivalent, or multivalent and may comprise
one or more of the B lymphocyte stimulator binding polypeptides
having the amino acid sequence of SEQ ID NOs:1-12, 20-172, and
186-444 and/or fragments or variants thereof. The term "peptide" is
used herein to have the same meaning as "polypeptide."
[0080] The term "antibody," as used herein, refers to
immunoglobulin molecules and immunologically active portions of
immunoglobulin molecules, i.e., molecules that contain an antigen
binding site that immunospecifically binds an antigen. As such, the
term antibody encompasses not only whole antibody molecules, but
also antibody fragments as well as variants (including derivatives)
of antibodies and antibody fragments. Examples of molecules which
are described by the term "antibody" in this application include,
but are not limited to: single chain Fvs (scFvs), Fab fragments,
Fab' fragments, F(ab').sub.2, disulfide linked Fvs (sdFvs), Fvs,
and fragments comprising or alternatively consisting of, either a
VL or a VH domain. The term "single chain Fv" or "scFv" as used
herein refers to a polypeptide comprising a VL domain of antibody
linked to a VH domain of an antibody.
[0081] "Feed stream": B lymphocyte stimulator and B lymphocyte
stimulator-like polypeptides that are bound by a B lymphocyte
stimulator binding polypeptide of this invention may be produced by
any method known in the art, including, but not limited to,
chemical synthesis; production in transformed host cells; secretion
into culture medium by naturally occurring cells or recombinantly
transformed bacteria, yeasts, fungi, insect cells, plant cells, and
mammalian cells; production in genetically engineered organisms
(for example, transgenic mammals); and production in
non-genetically engineered organisms. The solution, sample, or
mixture that contains a B lymphocyte stimulator or B lymphocyte
stimulator-like polypeptide as it is produced or is found present
in a production solution will sometimes be referred to as the "feed
stream".
[0082] The term "binding" refers to the determination by standard
techniques that a binding polypeptide recognizes and binds to a
given target. Such standard techniques include, but are not limited
to, affinity chromatography, equilibrium dialysis, gel filtration,
enzyme linked immunosorbent assay (ELISA), FACS analysis, and the
monitoring of spectroscopic changes that result from binding, e.g.,
using fluorescence anisotropy, either by direct binding
measurements or competition assays with another binder.
[0083] The term "specificity" refers to a binding polypeptide
useful according to the invention that has a higher binding
affinity for one target over another. Thus, the term "B lymphocyte
stimulator target protein specificity" refers to a molecule having
a higher affinity for B lymphocyte stimulator target protein as
compared with another molecule that is not a B lymphocyte
stimulator target protein.
[0084] The term "epitopes" as used herein refers to portions of B
lymphocyte stimulator having antigenic or immunogenic activity in
an animal, preferably a mammal. An epitope having immunogenic
activity is a portion of B lymphocyte stimulator that elicits an
antibody response in an animal. An epitope having antigenic
activity is a portion of B lymphocyte stimulator to which an
antibody or B lymphocyte stimulator binding polypeptide
specifically binds as determined by any method known in the art,
for example, by the immunoassays described herein. Antigenic
epitopes need not necessarily be immunogenic.
[0085] The term "fragment" as used herein refers to a polypeptide
comprising an amino acid sequence of at least 5 amino acid
residues, at least 6 amino acid residues, at least 7 amino acid
residues, at least 8 amino acid residues, at least 9 amino acid
residues, at least 10 amino acid residues, at least 11 amino acid
residues, at least 12 amino acid residues, at least 13 amino acid
residues, at least 14 amino acid residues, at least 15 amino acid
residues, at least 16 amino acid residues, at least 17 amino acid
residues, at least 18 amino acid residues, at least 19 amino acid
residues, at least 20 amino acid residues, at least 21 amino acid
residues, at least 22 amino acid residues, at least 23 amino acid
residues, at least 24 amino acid residues, or at least 25 amino
acid residues of the amino acid sequence of B lymphocyte
stimulator, or a B lymphocyte stimulator binding polypeptide
(including molecules that comprise, or alternatively consist of, B
lymphocyte stimulator binding polypeptide fragments or variants
thereof).
[0086] The term "fusion protein" as used herein refers to a
polypeptide that comprises, or alternatively consists of, an amino
acid sequence of a B lymphocyte stimulator binding polypeptide and
an amino acid sequence of a heterologous polypeptide (i.e., a
polypeptide unrelated to the B lymphocyte stimulator binding
polypeptide).
[0087] The term "host cell" as used herein refers to the particular
subject cell transfected with a nucleic acid molecule and the
progeny or potential progeny of such a cell. Progeny may not be
identical to the parent cell transfected with the nucleic acid
molecule due to mutations or environmental influences that may
occur in succeeding generations or integration of the nucleic acid
molecule into the host cell genome.
[0088] Other terms are defined as necessary in the text below.
DETAILED DESCRIPTION OF THE INVENTION
[0089] The present invention provides methods and compositions for
detecting, diagnosing, prognosing, and/or monitoring diseases or
disorders associated with aberrant B lymphocyte stimulator or B
lymphocyte stimulator receptor expression or inappropriate B
lymphocyte stimulator or B lymphocyte stimulator receptor function
in an animal, preferably a mammal, and most preferably a human,
comprising, or alternatively consisting of, use of B lymphocyte
stimulator binding polypeptides (including molecules which
comprise, or alternatively consist of, B lymphocyte stimulator
binding polypeptide fragments or variants thereof) that
specifically bind to B lymphocyte stimulator. Diseases and
disorders which can be detected, diagnosed, prognosed and/or
monitored with the B lymphocyte stimulator binding polypeptides
include, but are not limited to, immune system diseases or
disorders (e.g., autoimmune diseases or disorders,
immunodeficiencies, lupus, glomerular nephritis, rheumatoid
arthritis, multiple sclerosis, graft vs. host disease, myasthenia
gravis, Hashimoto's disease, and immunodeficiency syndrome),
proliferative diseases or disorders (e.g., cancer, premalignant
conditions, benign tumors, hyperproliferative disorders, benign
proliferative disorders, leukemia, lymphoma, chronic lymphocytic
leukemia, multiple myeloma, Hodgkin's lymphoma, Hodgkin's disease,
T cell proliferative diseases and disorders, B cell proliferative
diseases and disorders, monocytic proliferative diseases or
disorders, acute myelogenous leukemia, macrophage proliferative
diseases and disorders, and carcinoma), infectious diseases (e.g.,
AIDS), and inflammatory disorders (e.g., asthma, allergic
disorders, and rheumatoid arthritis).
[0090] The present invention further encompasses methods and
compositions for preventing, treating and/or ameliorating diseases
or disorders associated with aberrant B lymphocyte stimulator or B
lymphocyte stimulator receptor expression or inappropriate B
lymphocyte stimulator or B lymphocyte stimulator receptor function
in an animal, preferably a mammal, and most preferably a human,
comprising, or alternatively consisting of, administering to an
animal in which such treatment, prevention or amelioration is
desired one or more B lymphocyte stimulator binding polypeptides
(including molecules which comprise, or alternatively consist of, B
lymphocyte stimulator binding polypeptide fragments or variants
thereof) in an amount effective to treat, prevent or ameliorate the
disease or disorder. Diseases and disorders which can be prevented,
treated, and/or ameliorated with the B lymphocyte stimulator
binding polypeptides include, but are not limited to, immune system
diseases or disorders (e.g., autoimmune diseases or disorders,
immunodeficiencies, lupus, glomerular nephritis, rheumatoid
arthritis, multiple sclerosis, graft vs. host disease, myasthenia
gravis, Hashimoto's disease, immunodeficiency syndrome,
hypogammaglobulinemia, and hypergammaglobulinemia), proliferative
diseases or disorders (e.g., cancer, premalignant conditions,
benign tumors, hyperproliferative disorders, benign proliferative
disorders, leukemia, lymphoma, chronic lymphocytic leukemia,
multiple myeloma, Hodgkin's lymphoma, Hodgkin's disease, T cell
proliferative diseases and disorders, B cell proliferative diseases
and disorders, monocytic proliferative diseases or disorders, acute
myelogenous leukemia, macrophage proliferative diseases and
disorders, and carcinoma), infectious diseases (e.g., AIDS), and
inflammatory disorders (e.g., asthma, allergic disorders, and
rheumatoid arthritis).
B Lymphocyte Stimulator Binding Polypeptides
[0091] The methods of the present invention may be performed
utilizing new polypeptides and families of polypeptides that
specifically bind to B lymphocyte stimulator protein (BLyS.TM.)
and/or B lymphocyte stimulator-like polypeptides. In particular,
the invention encompasses diagnostic and therapeutic uses for
polypeptides that specifically bind to a polypeptide or polypeptide
fragment of human B lymphocyte stimulator (SEQ ID NOs:173 and/or
174) or B lymphocyte stimulator expressed on human monocytes;
murine B lymphocyte stimulator (SEQ ID NOs:175 and/or 176) or B
lymphocyte stimulator expressed on murine monocytes; rat B
lymphocyte stimulator (either the soluble forms as given in SEQ ID
NOs:177, 178, 179 and/or 180 or in a membrane associated form,
e.g., on the surface of rat monocytes); or monkey B lymphocyte
stimulator (e.g., the monkey B lymphocyte stimulator polypeptides
of SEQ ID NOS:181 and/or 182, the soluble form of monkey B
lymphocyte stimulator, or B lymphocyte stimulator expressed on
monkey monocytes); preferably human B lymphocyte stimulator.
[0092] In preferred embodiments, the B lymphocyte stimulator
binding polypeptides used according to the present invention
(including molecules comprising, or alternatively consisting of, B
lymphocyte stimulator binding polypeptide fragments or variants
thereof), specifically bind to B lymphocyte stimulator and do not
cross-react with any other antigens. In more preferred embodiments,
the B lymphocyte stimulator binding polypeptides specifically bind
to B lymphocyte stimulator and do not cross-react with TRAIL (Hahne
et al., J. Exp. Med., 188(6):1185-90 (1998)), APRIL (Wilet et al.,
Immunity, 3(6):673-82 (1995)), Endokine-alpha (Kwon et al., J.
Biol. Chem., 274(10):6056-61 (1999)), TNF-alpha, TNF-beta (Nedwin
et al., J. Immunol., 135(4):2492-7 (1985)), Fas-L (Suda et al.,
Cell, 75(6):1169-78 (1993)), or LIGHT (Mauri et al., Immunity,
8(1):21-30 (1998)).
[0093] Many B lymphocyte stimulator binding polypeptides have been
discovered which may be used in the methods of the present
invention. Specific B lymphocyte stimulator binding polypeptides
for use in the present invention comprise, or alternatively consist
of, an amino acid sequence selected from the group consisting of
SEQ ID NOs: 1-12, 20-172, and 186-444, preferably SEQ ID
NOs:163-172 or 436-444 as referred to above and in Tables 1-8, 13
and 14. In its broadest aspects, the methods of the present
invention may be carried out using a polypeptide capable of binding
to B lymphocyte stimulator and comprising the polypeptide
Asp-Xaa-Leu-Thr (SEQ ID NO:446), where Xaa is Pro, Ser, Thr, Phe,
Leu, Tyr, Cys, or Ala (preferably Pro or Ser).
[0094] Additional polypeptides for use in the methods described
herein include polypeptides with the potential to form a cyclic or
loop structure between invariant Cys residues comprising, or
alternatively consisting of, an amino acid sequence selected from
A-E (SEQ ID NOs:1-5):
TABLE-US-00015 (A) (SEQ ID NO: 1)
X.sub.1-X.sub.2-X.sub.3-Cys-X.sub.5-Phe-X.sub.7-Trp-Glu-Cys-X.sub.11-X.su-
b.12-X.sub.13,
wherein
X.sub.1 is Ala, Asn, Lys, or Ser;
X.sub.2 is Ala, Glu, Met, Ser, or Val;
[0095] X.sub.3 is Ala, Asn, Lys, or Pro (preferably Lys); X.sub.5
is Phe, Trp, or Tyr (preferably Tyr); X.sub.7 is Pro or Tyr
(preferably Pro);
X.sub.11 is Ala, Gln, His, Phe, or Val;
X.sub.12 is Asn, Gln, Gly, His, Ser, or Val; and
X.sub.13 is Ala, Asn, Gly, Ile, Pro, or Ser,
[0096] wherein said polypeptide binds B lymphocyte stimulator
and/or B lymphocyte stimulator-like polypeptides; or
TABLE-US-00016 (B) (SEQ ID NO: 2)
X.sub.1-X.sub.2-X.sub.3-Cys-X.sub.5-X.sub.6-X.sub.7-X.sub.8-X.sub.9-X.sub-
.10-Cys-X.sub.12-X.sub.13-X.sub.14,
wherein X.sub.1 is Ala, Asp, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, Val, or is absent;
X.sub.2 is Ala, Asn, Asp, Gln, Gly, His, Ile, Leu, Lys, Met, Phe,
Pro, Ser, Thr, Trp, Tyr, or Val;
[0097] X.sub.3 is Ala, Arg, Asn, Asp, Gln, Glu, Gly, His, Ile, Leu,
Lys, Met, Phe, Pro, Ser, Trp, Tyr, or Val (preferably Asp); X.sub.5
is Asp, Ile, Leu, or Tyr (preferably Asp or Leu); X.sub.6 is Arg,
Asp, Glu, His, Ile, Leu, Lys, Phe, Pro, Tyr, or Val (preferably Glu
or Leu); X.sub.7 is His, Leu, Lys, or Phe (preferably His or Leu);
X.sub.8 is Leu, Pro, or Thr (preferably Thr or Pro); X.sub.9 is
Arg, Asn, Gly, His, Ile, Lys, Met, or Trp (preferably Lys);
X.sub.10 is Ala, Gln, Glu, Gly, His, Ile, Leu, Met, Phe, Ser, Trp,
Tyr, or Val;
X.sub.12 is Asp, Gln, Glu, Gly, Ile, Leu, Lys, Phe, Ser, Trp, Tyr,
or Val;
X.sub.13 is Ala, Arg, Asn, Asp, Gln, Glu, Gly, His, Leu, Lys, Met,
Phe, Pro, Ser, Thr, Trp, Tyr, or Val; and
[0098] X.sub.14 is Ala, Arg, Asn, Asp, Gln, Glu, Gly, His, Ile,
Leu, Lys, Phe, Pro, Trp, Tyr, Val, or is absent, wherein said
polypeptide binds B lymphocyte stimulator and/or B lymphocyte
stimulator-like polypeptides; or
TABLE-US-00017 (C) (SEQ ID NO: 3)
X.sub.1-X.sub.2-X.sub.3-Cys-X.sub.5-X.sub.6-X.sub.7-X.sub.8-X.sub.9-X.sub-
.10-X.sub.11-Cys-X.sub.13-X.sub.14- X.sub.15,
wherein
X.sub.1 is Ala, Arg, Asn, Asp, Leu, Lys, Phe, Pro, Ser, or Thr;
X.sub.2 is Asn, Asp, Gln, His, Ile, Lys, Pro, Thr, or Trp;
[0099] X.sub.3 is Ala, Arg, Asn, Gln, Glu, His, Phe, Pro, or Thr
(preferably Ala); X.sub.5 is Asn, Asp, Pro, Ser, or Thr (preferably
Asp); X.sub.6 is Arg, Asp, Ile, Leu, Met, Pro, or Val (preferably
Ile); X.sub.7 is Ala, Ile, Leu, Pro, Thr, or Val (preferably Val or
Leu); X.sub.8 is Asn, His, Ile, Leu, Lys, Phe, or Thr (preferably
Thr); X.sub.9 is Asn, Glu, Gly, His, Leu, Lys, Met, Pro, or Thr
(preferably Leu);
X.sub.10 is Arg, Asn, Asp, Gln, Glu, Gly, Ile, Lys, Met, Pro, Ser,
or Trp;
[0100] X.sub.11 is Arg, Glu, Gly, Lys, Phe, Ser, Trp, or Tyr
(preferably Ser); X.sub.13 is Gln, Glu, Ile, Leu, Phe, Pro, Ser,
Tyr, or Val (preferably Val);
X.sub.14 is Asn, Gly, Ile, Phe, Pro, Thr, Trp, or Tyr; and
[0101] X.sub.15 is Asn, Asp, Glu, Leu, Lys, Met, Pro, or Thr
(preferably Glu or Pro), wherein said polypeptide binds B
lymphocyte stimulator and/or B lymphocyte stimulator-like
polypeptides; or
TABLE-US-00018 (D) (SEQ ID NO: 4)
X.sub.1-X.sub.2-X.sub.3-Cys-X.sub.5-X.sub.6-X.sub.7-X.sub.8-X.sub.9-X.sub-
.10-X.sub.11-X.sub.12-Cys-X.sub.14- X.sub.15-X.sub.16,
wherein X.sub.1 is Asn, Asp, His, Leu, Phe, Pro, Ser, Tyr, or is
absent (preferably Ser); X.sub.2 is Arg, Asn, Asp, His, Phe, Ser,
or Trp (preferably Arg); X.sub.3 is Asn, Asp, Leu, Pro, Ser, or Val
(preferably Asn or Asp);
X.sub.5 is Asp, Gln, His, Ile, Leu, Lys, Met, Phe, or Thr;
X.sub.6 is His, Ile, Leu, Met, Phe, Pro, Trp, or Tyr;
[0102] X.sub.7 is Asp, His, Leu, or Ser (preferably Asp); X.sub.8
is Ala, Arg, Asp, Glu, Leu, Phe, Pro, or Thr (preferably Glu or
Pro); X.sub.9 is Ala, Arg, Asn, or Leu (preferably Leu); X.sub.10
is Ile, Leu, Met, Pro, Ser, or Thr (preferably Thr);
X.sub.11 is Ala, Arg, Asn, Gly, His, Lys, Ser, or Tyr;
X.sub.12 is Ala, Arg, Asn, Gln, Leu, Met, Ser, Trp, Tyr, or
Val;
[0103] X.sub.14 is Asp, Gly, Leu, Phe, Tyr, or Val (preferably
Leu); X.sub.15 is Asn, His, Leu, Pro, or Tyr (preferably His, Leu
or Pro); and X.sub.16 is Asn, Asp, His, Phe, Ser, or Tyr,
(preferably Asp or Ser), wherein said polypeptide binds B
lymphocyte stimulator and/or B lymphocyte stimulator-like
polypeptides; or
TABLE-US-00019 (E) (SEQ ID NO: 5)
X.sub.1-X.sub.2-X.sub.3-Cys-X.sub.5-X.sub.6-X.sub.7-X.sub.8-X.sub.9-X.sub-
.10-X.sub.11-X.sub.12-X.sub.13-X.sub.14-
Cys-X.sub.16-X.sub.17-X.sub.18,
wherein X.sub.1 is Arg, Asp, Gly, His, Leu, Phe, Pro, Ser, Trp,
Tyr, or is absent (preferably Arg); X.sub.2 is Ala, Arg, Asn, Asp,
Gly, Pro, Ser, or is absent (preferably Asn, Asp, Gly, or Pro);
X.sub.3 is Arg, Asn, Gln, Glu, Gly, Lys, Met, Pro, Trp or Val
(preferably Gly or Met); X.sub.5 is Arg, Asn, Gln, Glu, His, Leu,
Phe, Pro, Trp, Tyr, or Val (preferably Trp, Tyr, or Val); X.sub.6
is Arg, Asp, Gln, Gly, Ile, Lys, Phe, Thr, Trp or Tyr (preferably
Asp); X.sub.7 is Ala, Arg, Asp, Glu, Gly, Leu, Ser, or Tyr
(preferably Asp); X.sub.8 is Asp, Gln, Glu, Leu, Met, Phe, Pro,
Ser, or Tyr (preferably Leu); X.sub.9 is Asp, Leu, Pro, Thr, or Val
(preferably Leu or Thr); X.sub.10 is Arg, Gln, His, Ile, Leu, Lys,
Met, Phe, Thr, Trp or Tyr (preferably Lys or Thr); X.sub.11 is Ala,
Arg, Asn, Gln, Glu, His, Leu, Lys, Met, or Thr (preferably Arg or
Leu); X.sub.12 is Ala, Asn, Gln, Gly, Leu, Lys, Phe, Pro, Thr, Trp,
or Tyr (preferably Thr or Trp); X.sub.13 is Ala, Arg, Gln, His,
Lys, Met, Phe, Pro, Thr, Trp, or Tyr (preferably Met or Phe);
X.sub.14 is Arg, Gln, Glu, Gly, His, Leu, Met, Phe, Pro, Ser, Thr,
Tyr, or Val (preferably Val); X.sub.16 is Arg, Asp, Gly, His, Lys,
Met, Phe, Pro, Ser, or Trp (preferably Met); X.sub.17 is Arg, Asn,
Asp, Gly, His, Phe, Pro, Ser, Trp or Tyr, (preferably Arg, His, or
Tyr); and X.sub.18 is Ala, Arg, Asn, Asp, His, Leu, Phe, or Trp
(preferably His or Asn), wherein said polypeptide binds B
lymphocyte stimulator and/or B lymphocyte stimulator-like
polypeptides.
[0104] Additional B lymphocyte stimulator binding polypeptides that
may be used in the methods of the present invention include linear
polypeptides comprising, or alternatively consisting of, an amino
acid sequence selected from F and G (SEQ ID NOs:6 and 7):
TABLE-US-00020 (F) (SEQ ID NO: 6)
X.sub.1-X.sub.2-X.sub.3-X.sub.4-X.sub.5-X.sub.6-X.sub.7-X.sub.8-X.sub.9-X-
.sub.10-X.sub.11-X.sub.12,
wherein X.sub.1 is Ala, Arg, Gly, His, Leu, Lys, Met, Phe, Trp,
Tyr, or Val (preferably Gly, Tyr, or Val); X.sub.2 is Ala, Arg,
Gln, His, Ile, Leu, Phe, Thr, Trp, or Tyr (preferably His or Tyr);
X.sub.3 is Ala, Asp, Lys, Phe, Thr, Trp or Tyr (preferably Asp or
Tyr); X.sub.4 is Arg, Asp, Gln, Lys, Met, Phe, Pro, Ser, Tyr, or
Val (preferably Asp or Gln); X.sub.5 is Asp, Leu, Lys, Phe, Pro,
Ser, or Val (preferably Leu or Ser); X.sub.6 is His, Ile, Leu, Pro,
Ser, or Thr (preferably Leu or Thr); X.sub.7 is Arg, Gly, His, Leu,
Lys, Met, or Thr (preferably Lys or Thr); X.sub.8 is Ala, Arg, Asn,
Ile, Leu, Lys, Met, or Thr (preferably Leu or Lys); X.sub.9 is Ala,
Asn, Arg, Asp, Glu, Gly, His, Leu, Met, Ser, Trp, Tyr, or Val
(preferably Met or Ser); X.sub.10 is Ile, Leu, Phe, Ser, Thr, Trp,
Tyr, or Val (preferably Thr or Leu); X.sub.11 is Ala, Arg, Gly,
His, Ile, Leu, Lys, Pro, Ser, Thr, Trp, Tyr, or Val (preferably Pro
or Thr); and X.sub.12 is Arg, Asp, His, Leu, Lys, Met, Phe, Pro,
Ser, Trp, Tyr, or Val (preferably Arg or Pro), wherein said
polypeptide binds B lymphocyte stimulator and/or B lymphocyte
stimulator-like polypeptides; or
TABLE-US-00021 (G) (SEQ ID NO: 7)
X.sub.1-X.sub.2-X.sub.3-X.sub.4-X.sub.5-X.sub.6-X.sub.7-X.sub.8-X.sub.9-X-
.sub.10-X.sub.11-X.sub.12-X.sub.13,
wherein X.sub.1 is Asp, Gln, Glu, Gly, His, Lys, Met, or Trp
(preferably Glu, Lys); X.sub.2 is Arg, Gln, His, Ile, Leu, or Pro
(preferably His or Pro); X.sub.3 is Asp, Gly, Ile, Lys, Thr, Tyr or
Val (preferably Tyr); X.sub.4 is Asn, Asp, Gln, Glu, Met, Pro, Ser,
or Tyr (preferably Asp or Gln); X.sub.5 is Asn, Asp, His, Ile, Leu,
Met, Pro, Thr or Val (preferably Asn or Thr); X.sub.6 is Asp, Glu,
His, Leu, Lys, Pro, or Val (preferably Asp or Pro); X.sub.7 is Arg,
Asn, Gln, His, Ile, Leu, Met, Pro, or Thr (preferably Ile or Pro);
X.sub.8 is Gln, Gly, His, Leu, Met, Ser, or Thr (preferably Leu or
Thr); X.sub.9 is Asn, Gln, Gly, His, Leu, Lys, Ser, or Thr
(preferably Lys); X.sub.10 is Ala, Gly, Ile, Leu, Lys, Met, or Phe
(preferably Gly or Met); X.sub.11 is Ala, Glu, His, Ile, Leu, Met,
Ser, Thr, Trp, Tyr, or Val (preferably Ala or Thr); X.sub.12 is
Arg, Gln, Glu, Gly, His, Ile, Lys, Tyr, or Val (preferably Arg or
His); and X.sub.13 is Arg, Asn, Glu, His, Ile, Ser, Thr, Trp, or
Val (preferably His), wherein said polypeptide binds B lymphocyte
stimulator and/or B lymphocyte stimulator-like polypeptides.
[0105] Additional B lymphocyte stimulator binding polypeptides that
may be used in the methods of the present invention include B
lymphocyte stimulator binding polypeptides comprising, or
alternatively consisting of, an amino acid sequence selected from
H-L (SEQ ID NOs:8-12):
TABLE-US-00022 (H) (SEQ ID NO: 8)
Cys-X.sub.2-Phe-X.sub.4-Trp-Glu-Cys,
wherein X.sub.2 is Phe, Trp, or Tyr (preferably Tyr); and X.sub.4
is Pro or Tyr (preferably Pro); or
TABLE-US-00023 (I) (SEQ ID NO: 9)
Cys-X.sub.2-X.sub.3-X.sub.4-X.sub.5-X.sub.6-X.sub.7-Cys,
wherein X.sub.2 is Asp, Ile, Leu, or Tyr (preferably Asp or Leu);
X.sub.3 is Arg, Asp, Glu, His, Ile, Leu, Lys, Phe, Pro, Tyr, or Val
(preferably Glu or Leu); X.sub.4 is His, Leu, Lys, or Phe
(preferably His or Leu); X.sub.5 is Leu, Pro, or Thr (preferably
Thr or Pro); X.sub.6 is Arg, Asn, Gly, His, Ile, Lys, Met, or Trp
(preferably Lys); and
X.sub.7 is Ala, Asn, Gln, Glu, Gly, His, Ile, Leu, Met, Phe, Ser,
Trp, Tyr, or Val; or
TABLE-US-00024 [0106] (J) (SEQ ID NO: 10)
Cys-X.sub.2-X.sub.3-X.sub.4-X.sub.5-X.sub.6-X.sub.7-X.sub.8-Cys,
wherein X.sub.2 is Asn, Asp, Pro, Ser, or Thr (preferably Asp);
X.sub.3 is Arg, Asp, Ile, Leu, Met, Pro, or Val (preferably Ile);
X.sub.4 is Ala, Ile, Leu, Pro, Thr, or Val (preferably Val or Leu);
X.sub.5 is Asn, His, Ile, Leu, Lys, Phe, or Thr (preferably Thr);
X.sub.6 is Asn, Glu, Gly, His, Leu, Lys, Met, Pro, or Thr
(preferably Leu);
X.sub.7 is Arg, Asn, Asp, Gln, Glu, Gly, Ile, Lys, Met, Pro, Ser,
or Trp;
[0107] X.sub.8 is Arg, Glu, Gly, Lys, Phe, Ser, Trp, or Tyr
(preferably Ser); or
TABLE-US-00025 (K) (SEQ ID NO: 11)
Cys-X.sub.2-X.sub.3-X.sub.4-X.sub.5-X.sub.6-X.sub.7-X.sub.8-X.sub.9-Cys,
wherein
X.sub.2 is Asp, Gln, His, Ile, Leu, Lys, Met, Phe, or Thr;
X.sub.3 is His, Ile, Leu, Met, Phe, Pro, Trp, or Tyr;
[0108] X.sub.4 is Asp, His, Leu, or Ser (preferably Asp); X.sub.5
is Ala, Arg, Asp, Glu, Leu, Phe, Pro, or Thr (preferably Glu or
Pro); X.sub.6 is Ala, Arg, Asn, or Leu (preferably Leu); X.sub.7 is
Ile, Leu, Met, Pro, Ser, or Thr (preferably Thr);
X.sub.8 is Ala, Arg, Asn, Gly, His, Lys, Ser, or Tyr;
X.sub.9 is Ala, Arg, Asn, Gln, Leu, Met, Ser, Trp, Tyr, or Val;
or
TABLE-US-00026 [0109] (L) (SEQ ID NO: 12)
Cys-X.sub.2-X.sub.3-X.sub.4-X.sub.5-X.sub.6-X.sub.7-X.sub.8-X.sub.9-X.sub-
.10-X.sub.11-Cys,
wherein X.sub.2 is Arg, Asn, Gln, Glu, His, Leu, Phe, Pro, Trp,
Tyr, or Val (preferably Trp, Tyr, or Val); X.sub.3 is Arg, Asp,
Gln, Gly, Ile, Lys, Phe, Thr, Trp or Tyr (preferably Asp); X.sub.4
is Ala, Arg, Asp, Glu, Gly, Leu, Ser, or Tyr (preferably Asp);
X.sub.5 is Asp, Gln, Glu, Leu, Met, Phe, Pro, Ser, or Tyr
(preferably Leu); X.sub.6 is Asp, Leu, Pro, Thr, or Val (preferably
Leu or Thr); X.sub.7 is Arg, Gln, His, Ile, Leu, Lys, Met, Phe,
Thr, Trp or Tyr (preferably Lys or Thr); X.sub.8 is Ala, Arg, Asn,
Gln, Glu, His, Leu, Lys, Met, or Thr (preferably Arg or Leu);
X.sub.9 is Ala, Asn, Gln, Gly, Leu, Lys, Phe, Pro, Thr, Trp, or Tyr
(preferably Thr or Trp); X.sub.10 is Ala, Arg, Gln, His, Lys, Met,
Phe, Pro, Thr, Trp, or Tyr (preferably Met or Phe); X.sub.11 is
Arg, Gln, Glu, Gly, His, Leu, Met, Phe, Pro, Ser, Thr, Tyr, or Val
(preferably Val); wherein said polypeptides bind B lymphocyte
stimulator and/or B lymphocyte stimulator-like polypeptides.
[0110] Additional B lymphocyte stimulator binding polypeptides that
may be used in the methods of the present invention include linear
polypeptides comprise the following amino acid sequence M (SEQ ID
NO:447):
TABLE-US-00027 (M) (SEQ ID NO: 447)
Ala-X.sub.2-X.sub.3-X.sub.4-Asp-X.sub.6-Leu-Thr-X.sub.9-Leu-X.sub.11-X.su-
b.12-X.sub.13- X.sub.14,
wherein X.sub.2 is Asn, Ser, Tyr, Asp, Phe, Ile, Gln, His, Pro,
Lys, Leu, Met, Thr, Val, Glu, Ala, Gly, Cys, or Trp (i.e., any
amino acid except Arg; preferably Asn); X.sub.3 is Trp, Glu, Lys,
Cys, Leu, Ala, Arg, Gly, or Ser (preferably Trp); X.sub.4 is Tyr,
Phe, Glu, Cys, Asn (preferably Tyr); X.sub.6 is Pro, Ser, Thr, Phe,
Leu, Tyr, Cys, or Ala (preferably Pro or Ser); X.sub.9 is Lys, Asn,
Gln, Gly, or Arg (preferably Lys); X.sub.11 is Trp, Ser, Thr, Arg,
Cys, Tyr, or Lys (preferably Trp); X.sub.12 is Leu, Phe, Val, Ile,
or His (preferably Leu); X.sub.13 is Pro, Leu, His, Ser, Arg, Asn,
Gln, Thr, Val, Ala, Cys, Ile, Phe, or Tyr (i.e., not Asp, Glu, Gly,
Lys, Met, or Trp; preferably Pro); and X.sub.14 is Asp, Glu, Asn,
Val, His, Gln, Arg, Gly, Ser, Tyr, Ala, Cys, Lys, Ile, Thr or Leu
(i.e., not Phe, Met, Pro, or Trp; preferably Asp, Val or Glu).
[0111] Preferred B lymphocyte stimulator binding polypeptides that
may be used in the methods of the present invention include linear
polypeptides comprising a core sequence of the formula N:
TABLE-US-00028 (N) (SEQ ID NO: 448)
X.sub.1-X.sub.2-Asp-X.sub.4-Leu-Thr-X.sub.7-Leu-X.sub.9-X.sub.10,
wherein X.sub.1 is Trp, Glu, Lys, Cys, Leu, Ala, Arg, Gly, or Ser
(preferably Trp); X.sub.2 is Tyr, Phe, Glu, Cys, Asn (preferably
Tyr); X.sub.4 is Pro, Ser, Thr, Phe, Leu, Tyr, Cys, or Ala
(preferably Pro or Ser); X.sub.7 is Lys, Asn, Gln, Gly, or Arg
(preferably Lys); X.sub.9 is Trp, Ser, Thr, Arg, Cys, Tyr, or Lys
(preferably Trp); and X.sub.10 is Leu, Phe, Val, Ile, or His
(preferably Leu).
[0112] Especially preferred B lymphocyte stimulator binding
polypeptides that may be used in the methods of the present
invention include linear polypeptides comprising the core peptide
Trp-Tyr-Asp-Pro-Leu-Thr-Lys-Leu-Trp-Leu (SEQ ID NO:436).
[0113] In performing certain methods according to the present
invention, it is preferred that the B lymphocyte stimulator binding
polypeptides, or phage displaying such binding polypeptides,
irreversibly bind the B lymphocyte stimulator protein in its
native, soluble trimeric form.
[0114] In performing certain methods according to the present
invention, it is preferred that the B lymphocyte stimulator binding
polypeptides of the present invention, or phage displaying such
binding polypeptides, reversibly bind the B lymphocyte stimulator
protein in its native, soluble trimeric form.
[0115] In performing certain methods according to the invention, it
may be advantageous for a B lymphocyte stimulator binding
polypeptide to bind B lymphocyte stimulator target protein with
high affinity. In specific embodiments, B lymphocyte stimulator
binding polypeptides used in this invention will bind B lymphocyte
stimulator target proteins with a dissociation constant or K.sub.D
of less than or equal to 5.times.10.sup.-2 M, 10.sup.-2 M,
5.times.10.sup.-3 M, 10.sup.-3 M, 5.times.10.sup.-4 M, 10.sup.-4 M,
5.times.10.sup.-5 M, or 10.sup.-5 M. More preferably, B lymphocyte
stimulator binding polypeptides used in the invention will bind B
lymphocyte stimulator target proteins with a dissociation constant
or K.sub.D less than or equal to 5.times.10.sup.-6 M, 10.sup.-6 M,
5.times.10.sup.-7 M, 10.sup.-7M, 5.times.10.sup.-8 M, or 10.sup.-8
M. Even more preferably, B lymphocyte stimulator binding
polypeptides used in the methods of the invention bind B lymphocyte
stimulator target proteins with a dissociation constant or K.sub.D
less than or equal to 5.times.10.sup.-9 M, 10.sup.-9 M,
5.times.10.sup.-10 M, 10.sup.-10 M, 5.times.10.sup.-11 M,
10.sup.-11 M, 5.times.10.sup.-12 M, 10.sup.-12 M, 5.times..sup.-13
M, 10.sup.-13 M, 5.times.10.sup.-14 M, 10.sup.-14 M,
5.times.10.sup.-15 M, or 10.sup.-15 M.
[0116] In certain preferred embodiments, B lymphocyte stimulator
binding polypeptides reversibly bind B lymphocyte stimulator and/or
B lymphocyte stimulator-like polypeptides and release bound B
lymphocyte stimulator protein in an active form, preferably in the
native soluble trimeric form, under specific release conditions. In
specific embodiments, B lymphocyte stimulator binding polypeptides
bind B lymphocyte stimulator target proteins with off-rates or
k.sub.off greater than or equal to 10.sup.-10 s.sup.-1,
5.times.10.sup.-9 s.sup.-1, 10.sup.-9 s.sup.-1, 5.times.10.sup.-8
s.sup.-1, 10.sup.-8 s.sup.-1, 5.times.10.sup.-7 s.sup.-1, 10.sup.-7
s.sup.-1, 5.times.10.sup.-6 s.sup.-1, 10.sup.-6 s.sup.-1,
5.times.10.sup.-5 s.sup.-1, 10.sup.-5 s.sup.-1, 5.times.10.sup.-4
s.sup.-1, 10.sup.-4 s.sup.-1, 5.times.10.sup.-3 s.sup.-1, 10.sup.-3
s.sup.-1, 5.times.10.sup.-2 s.sup.-1, 10.sup.-2 s.sup.-1,
5.times.10.sup.-1 s.sup.-1, or 10.sup.-1 s.sup.-1.
[0117] Binding experiments to determine K.sub.D and off-rates can
be performed in a number of conditions including, but not limited
to, [pH 6.0, 0.01% Tween 20], [pH 6.0, 0.1% gelatin], [pH5.0, 0.01%
Tween 20], [pH9.0, 0.1% Tween 20], [pH6.0, 15% ethylene glycol,
0.01% Tween20], [pH5.0, 15% ethylene glycol, 0.01% Tween 20], and
[pH9.0, 15% ethylene glycol, 0.01% Tween 20] The buffers in which
to make these solutions can readily be determined by one of skill
in the art, and depend largely on the desired pH of the final
solution. Low pH solutions (<pH 5.5) can be made, for example,
in citrate buffer, glycine-HCl buffer, or in succinic acid buffer.
High pH solutions can be made, for example, in Tris-HCl, phosphate
buffers, or sodium bicarbonate buffers. A number of conditions may
be used to determine K.sub.D and off-rates for the purpose of
determining, for example, optimal pH and/or salt
concentrations.
[0118] In certain embodiments, B lymphocyte stimulator binding
polypeptides reversibly bind B lymphocyte stimulator and/or B
lymphocyte stimulator-like polypeptides, preferably in the native
soluble, trimeric form.
[0119] In preferred embodiments, B lymphocyte stimulator binding
polypeptides reversibly bind only the native soluble, trimeric form
of B lymphocyte stimulator.
[0120] In certain embodiments, B lymphocyte stimulator binding
polypeptides irreversibly bind B lymphocyte stimulator and/or B
lymphocyte stimulator-like polypeptides, preferably in the native
soluble, trimeric form.
[0121] In preferred embodiments, B lymphocyte stimulator binding
polypeptides irreversibly bind only the native soluble, trimeric
form of B lymphocyte stimulator.
[0122] In some screening or assay procedures, it is possible and
more convenient to use recombinant bacteriophage that display a
particular B lymphocyte stimulator binding polypeptide instead of
using isolated B lymphocyte stimulator binding polypeptide. Such
procedures include phage-based ELISA protocols and immobilization
of phage displaying a binding polypeptide to chromatographic
materials. Such screening assays and procedures are routine in the
art and may be readily adapted for procedures using recombinant
bacteriophage such as disclosed herein.
[0123] Specific methods of the present invention contemplate the
use of B lymphocyte stimulator binding polypeptides that
competitively inhibit the binding of a B lymphocyte stimulator
binding molecule. Competitive inhibition can be determined by any
suitable method known in the art, for example, using the
competitive binding assays described herein. In preferred
embodiments, the polypeptide competitively inhibits the binding of
a B lymphocyte stimulator binding molecule to B lymphocyte
stimulator by at least 95%, at least 90%, at least 85%, at least
80%, at least 75%, at least 70%, at least 60%, or at least 50%. In
a more preferred embodiment, the B lymphocyte stimulator binding
polypeptide competitively inhibits the binding of a B lymphocyte
stimulator binding molecule to the native soluble trimeric form of
B lymphocyte stimulator, by at least 95%, at least 90%, at least
85%, at least 80%, at least 75%, at least 70%, at least 60%, or at
least 50%.
[0124] B lymphocyte stimulator binding polypeptides (including
molecules comprising, or alternatively consisting of, B lymphocyte
stimulator binding polypeptide fragments or variants thereof)
useful in the practice of the methods of the present invention may
have one or more of the same biological characteristics as one or
more of the B lymphocyte stimulator binding polypeptides
specifically described herein. By "biological characteristics" is
meant, the in vitro or in vivo activities or properties of the B
lymphocyte stimulator binding polypeptides, such as, for example,
the ability to bind to B lymphocyte stimulator (e.g., the soluble
form of B lymphocyte stimulator, the membrane-bound form of B
lymphocyte stimulator, the soluble form and membrane-bound form of
B lymphocyte stimulator), and/or an antigenic and/or epitope region
of B lymphocyte stimulator), the ability to substantially block B
lymphocyte stimulator/B lymphocyte stimulator receptor (e.g., TACI
and BCMA) binding, the ability to substantially increase B
lymphocyte stimulator/B lymphocyte stimulator receptor (e.g., TACI
and BCMA) binding, the ability to block B lymphocyte stimulator
mediated biological activity (e.g., stimulation of B cell
proliferation and immunoglobulin production), or, the ability to
enhance or stimulate B lymphocyte stimulator mediated biological
activity (e.g., stimulation of B cell proliferation and
immunoglobulin production). Optionally, the B lymphocyte stimulator
binding polypeptides useful according to the invention will bind to
the same epitope as at least one of the B lymphocyte stimulator
binding polypeptides specifically referred to herein. Such epitope
binding can be routinely determined using assays known in the
art.
[0125] B lymphocyte stimulator binding polypeptides (including
molecules comprising, or alternatively consisting of, B lymphocyte
stimulator binding polypeptide fragments or variants thereof)
useful in the practice of the methods of the present invention may
be polypeptides that neutralize B lymphocyte stimulator or a
fragment thereof. By a B lymphocyte stimulator binding polypeptide
that "neutralizes B lymphocyte stimulator or a fragment thereof" is
meant a B lymphocyte stimulator binding polypeptide that inhibits
(i.e., is effective to reduce or abolish) or abolishes the ability
of B lymphocyte stimulator: to bind to its receptor (e.g., TACI and
BCMA), to stimulate B cell activation, to stimulate B cell
proliferation, to stimulate immunoglobulin secretion by B cells, to
increase B cell lifespan, and/or to stimulate the B lymphocyte
stimulator receptor signalling cascade.
[0126] B lymphocyte stimulator binding polypeptides (including
molecules comprising, or alternatively consisting of, B lymphocyte
stimulator binding polypeptide fragments or variants thereof)
useful in the practice of the methods of the present invention may
also be effective to inhibit or abolish B lymphocyte
stimulator-mediated B cell proliferation as determined by any
method known in the art such as, for example, the assays described
in the Examples, infra, said B lymphocyte stimulator binding
polypeptides comprising, or alternatively consisting of, a
polypeptide having an amino acid sequence of any one of SEQ ID
NOs:1-12, 20-172, and 186-444, preferably of SEQ ID NOs:163-172 and
436-444, or a fragment or variant thereof.
[0127] B lymphocyte stimulator binding polypeptides (including
molecules comprising, or alternatively consisting of, B lymphocyte
stimulator binding polypeptide fragments or variants thereof)
useful in the practice of the methods of the present invention may
also be effective to enhance the activity of B lymphocyte
stimulator or a fragment thereof, said B lymphocyte stimulator
binding polypeptides comprising, or alternatively consisting of, a
polypeptide having an amino acid sequence of any one of SEQ ID
NOs:1-12, 20-172, and 186-444, preferably of SEQ ID NOs:163-172 or
436-444, or a fragment or variant thereof. By a B lymphocyte
stimulator binding polypeptide that "enhances the activity of B
lymphocyte stimulator or a fragment thereof" is meant a B
lymphocyte stimulator binding polypeptide that increases the
ability of B lymphocyte stimulator: to bind to its receptor (e.g.,
TACI and BCMA), to stimulate B cell proliferation, to stimulate
immunoglobulin secretion by B cells, to activate B cells, to
increase B cell lifespan and/or to stimulate a B lymphocyte
stimulator receptor signalling cascade (e.g., to activate
calcium-modulator and cyclophilin ligand ("CAML"), calcineurin,
nuclear factor of activated T cells transcription factor ("NF-AT"),
nuclear factor-kappa B ("NF-kappa B"), activator protein-1 (AP-1),
SRF, extracellular-signal regulated kinase 1 (ERK-1), polo like
kinases (PLK), ELF-1, high mobility group I (HMG-I), and/or high
mobility group Y (HMG-Y)). Nucleic acid molecules encoding these B
lymphocyte stimulator binding polypeptides are also encompassed by
the invention.
[0128] B lymphocyte stimulator binding polypeptides (including
molecules comprising, or alternatively consisting of, B lymphocyte
stimulator binding polypeptide fragments or variants thereof)
useful in the practice of the methods of the present invention may
also be effective to stimulate B lymphocyte stimulator mediated B
cell proliferation as determined by any method known in the art,
such as, for example, the assays described in the Examples, infra,
said B lymphocyte stimulator binding polypeptides comprising, or
alternatively consisting of, a polypeptide having an amino acid
sequence of any one of SEQ ID NOs:1-12, 20-172, and 186-444,
preferably of SEQ ID NOs:163-172 or 436-444, or a fragment or
variant thereof. Nucleic acid molecules encoding these B lymphocyte
stimulator binding polypeptides are also encompassed by the
invention.
[0129] B lymphocyte stimulator binding polypeptides (including
molecules comprising, or alternatively consisting of, B lymphocyte
stimulator binding polypeptide fragments or variants thereof)
useful in the practice of the methods of the present invention may
include polypeptides effective to specifically bind to the soluble
form of B lymphocyte stimulator, polypeptides that specifically
bind to the membrane-bound form of B lymphocyte stimulator, and
polypeptides that specifically bind to both the soluble form and
membrane-bound form of B lymphocyte stimulator.
[0130] The methods of the present invention may also be carried out
using mixtures of B lymphocyte stimulator binding polypeptides
(including molecules comprising, or alternatively consisting of, B
lymphocyte stimulator binding polypeptide fragments or variants
thereof) that specifically bind to B lymphocyte stimulator, wherein
the mixture contains at least one, two, three, four, five or more
different B lymphocyte stimulator binding polypeptides. In
particular, the invention provides for the use of mixtures of
different B lymphocyte stimulator binding polypeptides that
specifically bind to the soluble form of B lymphocyte stimulator,
the membrane-bound form of B lymphocyte stimulator, and/or both the
membrane-bound form and soluble form of B lymphocyte stimulator. In
specific embodiments, the methods of the invention utilize mixtures
of at least 2, preferably at least 4, at least 6, at least 8, at
least 10, at least 12, at least 15, at least 20, or at least 25
different B lymphocyte stimulator binding polypeptides that
specifically bind to B lymphocyte stimulator, wherein at least 1,
at least 2, at least 4, at least 6, or at least 10, B lymphocyte
stimulator binding polypeptides of the mixture are B lymphocyte
stimulator binding polypeptides.
[0131] The methods of the present invention may also be carried out
using panels of B lymphocyte stimulator binding polypeptides
(including molecules comprising, or alternatively consisting of, B
lymphocyte stimulator binding polypeptide fragments or variants
thereof) that specifically bind to B lymphocyte stimulator, wherein
the panel has at least one, two, three, four, five or more
different B lymphocyte stimulator binding polypeptides. In
particular, the invention provides for the use of panels of
different B lymphocyte stimulator binding polypeptides that
specifically bind to the soluble form of B lymphocyte stimulator,
the membrane-bound form of B lymphocyte stimulator, and/or both the
membrane-bound form and soluble form of B lymphocyte stimulator. In
specific embodiments, the invention provides for the use of panels
of B lymphocyte stimulator binding polypeptides that have different
affinities for B lymphocyte stimulator, different specificities for
B lymphocyte stimulator, or different dissociation rates. The
invention provides for the use of panels of at least 10, preferably
at least 25, at least 50, at least 75, or at least 100 B lymphocyte
stimulator binding polypeptides. Panels of B lymphocyte stimulator
binding polypeptides can be used, for example, in 96 well plates
for assays such as ELISAs.
[0132] The methods of the present invention may also be carried out
using compositions comprising one or more B lymphocyte stimulator
binding polypeptides (including molecules comprising, or
alternatively consisting of B lymphocyte stimulator binding
polypeptide fragments or variants). In one embodiment, a
composition used in a method of the present invention comprises,
one, two, three, four, five, or more B lymphocyte stimulator
binding polypeptides that comprise or alternatively consist of, a
polypeptide having an amino acid sequence of any one or more of the
B lymphocyte stimulator binding polypeptides contained in SEQ ID
NOs:1-12, 20-172, and 186-444 as disclosed in Tables 1-8 and 13, or
a variant thereof.
[0133] As discussed in more detail below, a composition useful in
the methods of the invention may be used either alone or in
combination with other compositions. The B lymphocyte stimulator
binding polypeptides (including molecules comprising, or
alternatively consisting of B lymphocyte stimulator binding
polypeptide fragments or variants of the present invention) may
further be recombinantly fused to a heterologous polypeptide at the
N- or C-terminus or chemically conjugated (including covalently and
non-covalently conjugations) to polypeptides or other compositions.
For example, B lymphocyte stimulator binding polypeptides of the
present invention may be recombinantly fused or conjugated to
molecules useful as labels in detection assays and effector
molecules such as heterologous polypeptides, polypeptide linkers,
drugs, radionuclides, or toxins. See, e.g., PCT publications WO
92/08495; WO 91/14438; WO 89/12624; U.S. Pat. No. 5,314,995; and EP
0 396 387.
Production and Modification of B lymphocyte stimulator Binding
Polypeptides
[0134] B lymphocyte stimulator binding polypeptides useful in
practicing the methods of the present invention may be produced by
chemical synthesis, semi-synthetic methods, and recombinant DNA
methodologies known in the art.
[0135] In certain embodiments, B lymphocyte stimulator binding
polypeptides of the present invention are produced by chemical or
semi-synthetic methodologies known in the art (see, Kelley et al.
in Genetic Engineering Principles and Methods, Setlow, J. K., ed.
(Plenum Press, NY., 1990), vol. 12, pp. 1-19; Stewart et al.,
Solid-Phase Peptide Synthesis, W.H. Freeman Co., San Francisco,
1989). One advantage of these methodologies is that they allow for
the incorporation of non-natural amino acid residues into the
sequence of the B lymphocyte stimulator binding polypeptide.
[0136] In preferred embodiments, B lymphocyte stimulator binding
polypeptides are chemically synthesized (see, e.g., Merrifield, J.
Am. Chem. Soc., 85: 2149 (1963); Houghten, Proc. Natl. Acad. Sci.
USA, 82: 5132 (1985)). For example, polypeptides can be synthesized
by solid phase techniques, cleaved from the resin, and purified by
preparative high performance liquid chromatography (see, e.g.,
Creighton, Proteins: Structures and Molecular Properties (W.H.
Freeman and Co., N.Y., 1983), pp. 50-60). B lymphocyte stimulator
binding polypeptides can also be synthesized by use of a peptide
synthesizer. The composition of the synthetic polypeptides may be
confirmed by amino acid analysis or sequencing (e.g., the Edman
degradation procedure; see Creighton, Proteins: Structures and
Molecular Properties (W.H. Freeman and Co., N.Y., 1983), pp.
34-49). Furthermore, if desired, B lymphocyte stimulator binding
polypeptides may contain non-classical amino acids or chemical
amino acid analogs, which can routinely be introduced during
chemical synthesis as a substitution or addition into the B
lymphocyte stimulator binding polypeptides. Non-classical amino
acids include, but are not-limited to, the D-isomers of the common
amino acids, 2,4-diaminobutyric acid, alpha-aminoisobutyric acid,
4-aminobutyric acid (4Abu), 2-aminobutyric acid (Abu),
6-aminohexanoic acid (epsilon-Ahx), 2-aminoisobutyric acid (Aib),
3-amino propionic acid, ornithine, norleucine, norvaline,
hydroxyproline, sarcosine, citrulline, homocitrulline, cysteic
acid, t-butylglycine, t-butylalanine, phenylglycine,
cyclohexylalanine, beta-alanine (bAla), fluoro-amino acids,
designer amino acids such as beta-methyl amino acids, Calpha-methyl
amino acids, Nalpha-methyl amino acids, and amino acid analogs in
general. Furthermore, the amino acid can be D (dextrorotary) or L
(levorotary).
[0137] Solid phase peptide synthesis begins at the carboxy (C)
terminus of the putative polypeptide by coupling a protected amino
acid to a suitable resin, which reacts with the carboxyl group of
the C-terminal amino acid to form a bond that is readily cleaved
later, for example, a halomethyl resin such as chloromethyl resin,
bromomethyl resin, hydroxymethyl resin, aminomethyl resin,
benzhydrylamine resin, or t-alkyloxycarbonyl-hydrazide resin. After
removal of the .alpha.-amino protecting group with, for example,
trifluoroacetic acid (TFA) in methylene chloride and neutralization
with, for example TEA, the next cycle in the synthesis is ready to
proceed. The remaining .alpha.-amino and, if necessary,
side-chain-protected amino acids are then coupled sequentially in
the desired order by condensation to obtain an intermediate
compound connected to the resin. Alternatively, some amino acids
may be coupled to one another forming an oligopeptide prior to
addition to the growing solid phase polypeptide chain.
[0138] The condensation between two amino acids, or an amino acid
and a peptide, or a peptide and a peptide can be carried out
according to condensation methods known in the art, including but
not limited to, the azide method, mixed acid anhydride method, DCC
(dicyclohexylcarbodiimide) method, active ester method
(p-nitrophenyl ester method, BOP [benzotriazole-1-yl-oxy-tris
(dimethylamino) phosphonium hexafluorophosphate] method,
N-hydroxysuccinic acid imido ester method), and Woodward reagent K
method.
[0139] Common to chemical synthesis of peptides is the protection
or capping (blocking) of the reactive side chain groups of the
various amino acid residues with suitable protecting or capping
groups at that site until the group is ultimately removed after the
polypeptide chain has been completely assembled. Also common is the
protection or capping of the .alpha.-amino group on an amino acid
or a fragment while that entity reacts at the carboxyl group
followed by the selective removal of the .alpha.-amino-protecting
group to allow subsequent reaction to take place at that location.
Accordingly, during synthesis, intermediate compounds are produced
which includes each of the amino acid residues located in the
desired sequence in the peptide chain with various of these
residues having side-chain protecting or capping groups. These
protecting or capping groups on amino acid side chains are then
removed substantially at the same time so as to produce the desired
resultant product following purification.
[0140] The typical protective, capping, or blocking groups for
.alpha.- and .epsilon.-amino side chain groups found in amino acids
are exemplified by benzyloxycarbonyl (Z), isonicotinyloxycarbonyl
(iNOC), O-chlorobenzyloxycarbonyl [Z(NO.sub.2)],
p-methoxybenzyloxycarbonyl [Z(OMe)], t-butoxycarbonyl (Boc),
t-amyioxycarbonyl (Aoc), isobornyloxycarbonyl, adamatyloxycarbonyl,
2-(4-biphenyl)-2-propyloxycarbonyl (Bpoc),
9-fluorenylmethoxycarbonyl (Fmoc), methylsulfonylethoxycarbonyl
(Msc), trifluoroacetyl, phthalyl, formyl, 2-nitrophenylsulphenyl
(NPS), diphenylphosphinothioyl (Ppt), dimethylophosphinothioyl
(Mpt), and the like.
[0141] Protective, capping, or blocking groups for the carboxyl
group of amino acids include, for example, benzyl ester (OBzl),
cyclohexyl ester (Chx), 4-nitrobenzyl ester (ONb), t-butyl ester
(Obut), 4-pyridylmethyl ester (OPic), and the like. It is usually
also desirable that side chain groups of specific amino acids such
as arginine, cysteine, and serine, are protected by a suitable
protective group as occasion demands. For example, the guanidino
group in arginine may be protected with nitro, p-toluenesulfonyl,
benzyloxycarbonyl, adamantyloxycarbonyl, p-methoxybenzenesulfonyl,
4-methoxy-2,6-dimethylbenzenesulfonyl (Mds),
1,3,5-trimethylphenysulfonyl (Mts), and the like. The thiol group
in cysteine may be protected with p-methoxybenzyl, triphenylmethyl,
acetylaminomethyl ethylcarbamoyl, 4-methylbenzyl,
2,4,6-trimethyl-benzyl (Tmb), etc., and the hydroxyl group in the
serine can be protected with benzyl, t-butyl, acetyl,
tetrahydropyranyl, etc.
[0142] After the desired amino acid sequence has been completed,
the intermediate polypeptide is removed from the resin support by
treatment with a reagent, such as liquid HF and one or more
thio-containing scavengers, which cleaves the peptide molecule from
the resin and all the remaining side-chain protecting groups.
Following HF cleavage, the protein sequence is washed with ether,
transferred to a large volume of dilute acetic acid, and stirred at
pH adjusted to about 8.0 with ammonium hydroxide. Upon pH
adjustment, the polypeptide takes its desired conformational
arrangement.
[0143] By way of example but not by way of limitation, polypeptides
can be chemically synthesized and purified as follows: Peptides can
be synthesized by employing the
N-alpha-9-fluorenylmethyloxycarbonyl or Fmoc solid phase peptide
synthesis chemistry using a Rainin Symphony Multiplex Peptide
Synthesizer. The standard cycle used for coupling of an amino acid
to the peptide-resin growing chain generally includes: (1) washing
the peptide-resin three times for 30 seconds with
N,N-dimethylformamide (DMF); (2) removing the Fmoc protective group
on the amino terminus by deprotection to with 20% piperidine in DMF
by two washes for 15 minutes each, during which process mixing is
effected by bubbling nitrogen through the reaction vessel for one
second every 10 seconds to prevent peptide-resin settling; (3)
washing the peptide-resin three times for 30 seconds with DMF; (4)
coupling the amino acid to the peptide resin by addition of equal
volumes of a 250 mM solution of the Fmoc derivative of the
appropriate amino acid and an activator mix consisting or 400 mM
N-methylmorpholine and 250 mM
(2-(1H-benzotriazol-1-4))-1,1,3,3-tetramethyluronium
hexafluorophosphate (HBTU) in DMF; (5) allowing the solution to mix
for 45 minutes; and (6) washing the peptide-resin three times for
30 seconds of DMF. This cycle can be repeated as necessary with the
appropriate amino acids in sequence to produce the desired peptide.
Exceptions to this cycle program are amino acid couplings predicted
to be difficult by nature of their hydrophobicity or predicted
inclusion within a helical formation during synthesis. For these
situations, the above cycle can be modified by repeating step 4 a
second time immediately upon completion of the first 45 minute
coupling step to "double couple" the amino acid of interest.
Additionally, in the first coupling step in peptide synthesis, the
resin can be allowed to swell for more efficient coupling by
increasing the time of mixing in the initial DMF washes to three 15
minute washes rather than three 30 second washes.
[0144] After peptide synthesis, the peptide can be cleaved from the
resin as follows: (1) washing the peptide-resin three times for 30
seconds with DMF; (2) removing the Fmoc protective group on the
amino terminus by washing two times for 15 minutes it 20%
piperidine in DMF; (3) washing the peptide-resin three times for 30
seconds with DMF; and (4) mixing a cleavage cocktail consisting of
95% trifluoroacetic acid (TFA), 2.4% water, 2.4% phenol, and 0.2%
triisopropysilane with the peptide-resin for two hours, then
filtering the peptide in the cleavage cocktail away from the resin,
and precipitating the peptide out of solution by addition of two
volumes of ethyl ether. Specifically, to isolate the peptide, the
ether-peptide solution can be allowed to sit at -20.degree. C. for
20 minutes, then centrifuged at 6,000.times.G for 5 minutes to
pellet the peptide, and the peptide can be washed three times with
ethyl ether to remove residual cleavage cocktail ingredients. The
final peptide product can be purified by reversed phase high
pressure liquid chromatography (RP-HPLC) with the primary solvent
consisting of 0.1% TFA and the eluting buffer consisting of 80%
acetonitrile and 0.1% TFA. The purified peptide can then be
lyophilized to a powder.
[0145] In other specific embodiments, branched versions of the B
lymphocyte stimulator binding polypeptides described herein are
provided, e.g., by substituting one or more amino acids within the
B lymphocyte stimulator binding polypeptide sequence with an amino
acid or amino acid analog with a free side chain capable of forming
a peptide bond with one or more amino acids (and thus capable of
forming a "branch").
[0146] Branched peptides may be prepared by any method known in the
art for covalently linking any naturally occurring or synthetic
amino acid to any naturally occurring or synthetic amino acid in a
peptide chain which has a side chain group able to react with the
amino or carboxyl group on the amino acids so as to become
covalently attached to the peptide chain. In particular, amino
acids with a free amino side chain group, such as, but not limited
to, diaminobutyric acid, lysine, arginine, ornithine,
diaminopropionic acid and citrulline, can be incorporated into a
peptide so that an amino acid can form a branch therewith, for
example, by forming a peptide bond to the free amino side group,
from that residue. Alternatively, amino acids with a free carboxyl
side chain group, such as, but not limited to, glutamic acid,
aspartic acid and homocitrulline, can be incorporated into the
peptide so that an amino acid can form a branch therewith, for
example, by forming a peptide bond to the free carboxyl side group,
from that residue. The amino acid forming the branch can be linked
to a side chain group of an amino acid in the peptide chain by any
type of covalent bond, including, but not limited to, peptide
bonds, ester bonds and disulfide bonds. In a specific embodiment,
amino acids, such as those described above, that are capable of
forming a branch point, are substituted for B lymphocyte stimulator
binding polypeptide residues within a peptide including a B
lymphocyte stimulator binding polypeptide sequence.
[0147] Branched peptides can be prepared by any method known in the
art. For example, but not by way of limitation, branched peptides
can be prepared as follows: (1) the amino acid to be branched from
the main peptide chain can be purchased as an
N-alpha-tert-butyloxycarbonyl (Boc) protected amino acid
pentafluorophenyl (Opfp) ester and the residue within the main
chain to which this branched amino acid will be attached can be an
N-Fmoc-alpha-gamma-diaminobutyric acid; (2) the coupling of the Boc
protected amino acid to diaminobutyric acid can be achieved by
adding 5 grams of each precursor to a flask containing 150 ml DMF,
along with 2.25 ml pyridine and 50 mg dimethylaminopyridine and
allowing the solution to mix for 24 hours; (3) the peptide can then
be extracted from the 150 ml coupling reaction by mixing the
reaction with 400 ml dichlormethane (DCM) and 200 ml 0.12N HCl in a
1 liter separatory funnel, and allowing the phases to separate,
saving the bottom aqueous layer and re-extracting the top layer two
more times with 200 ml 0.12N HCl; (4) the solution containing the
peptide can be dehydrated by adding 2-5 grams magnesium sulfate,
filtering out the magnesium sulfate, and evaporating the remaining
solution to a volume of about 2-5 ml; (5) the dipeptide can then be
precipitated by addition of ethyl acetate and then 2 volumes of
hexanes and then collected by filtration and washed two times with
cold hexanes; and (6) the resulting filtrate can be lyophilized to
achieve a light powder form of the desired dipeptide. Branched
peptides prepared by this method will have a substitution of
diaminobutyric acid at the amino acid position which is branched.
Branched peptides containing an amino acid or amino acid analog
substitution other than diaminobutyric acid can be prepared
analogously to the procedure described above, using the N-Fmoc
coupled form of the amino acid or amino acid analog.
[0148] In a preferred embodiment, the B lymphocyte stimulator
binding polypeptide is a cyclic peptide. Cyclization can be, for
example, but not by way of limitation, via a disulfide bond between
two cysteine residues or via an amide linkage. For example, but not
by way of limitation, disulfide bridge formation can be achieved by
(1) dissolving the purified peptide at a concentration of between
0.1-0.5 mg/ml in 0.01 M ammonium acetate, pH 7.5; (2) adding to the
dissolved peptide 0.01 M potassium ferricyanide dropwise until the
solution appears pale yellow in color and allowing this solution to
mix for 24 hours; (3) concentrating the cyclized peptide to 5-10 ml
of solution, repurifying the peptide by reverse phase-high pressure
liquid chromatography (RP-HPLC) and finally lyophilizing the
peptide. In a specific embodiment, in which the peptide does not
contain two appropriately situated cysteine residues, cysteine
residues can be introduced at the amino-terminus and/or
carboxy-terminus and/or internally such that the peptide to be
cyclized contains two cysteine residues spaced such that the
residues can form a disulfide bridge. Alternatively, a cyclic
peptide can be obtained by generating an amide linkage using, for
example but not limited to, the following protocol: An allyl
protected amino acid, such as aspartate, glutamate, asparagine or
glutamine, can be incorporated into the peptide as the first amino
acid, and then the remaining amino acids are coupled on. The allyl
protective group can be removed by a two hour mixing of the
peptide-resin with a solution of tetrakistriphenylphosphine
palladium (0) in a solution of chloroform containing 5% acetic acid
and 2.5% N-methylmorpholine. The peptide resin can be washed three
times with 0.5% N,N-diisopropylethylamine (DIEA) and 0.5% sodium
diethyldithiocabamate in DMF. The amino terminal Fmoc group on the
peptide chain can be removed by two incubations for 15 minutes each
in 20% piperidine in DMF, and washed three times with DMF for 30
seconds each. The activator mix, N-methylmorpholine and HBTU in
DMF, can be brought onto the column and allowed to couple the free
amino terminal end to the carboxyl group generated by removal of
the allyl group to cyclize the peptide. The peptide can be cleaved
from the resin as described in the general description of chemical
peptide synthesis above and the peptide purified by reverse
phase-high pressure liquid chromatography (RP-HPLC). In a specific
embodiment, in which the peptide to be cyclized does not contain an
allyl protected amino acid, an allyl protected amino acid can be
introduced into the sequence of the peptide, at the amino-terminus,
carboxy-terminus or internally, such that the peptide can be
cyclized.
[0149] In addition, according to certain embodiments, it is
preferable that the B lymphocyte stimulator binding polypeptides
are produced having or retaining an amino terminal (N-terminal)
and/or a carboxy terminal (C-terminal) capping group, which may
protect the N-terminal or C-terminal amino acid from undesirable
chemical reactions during use or which may permit further
conjugations or manipulations of the binding polypeptide, for
example, in conjugating the binding polypeptide to a
chromatographic support resin or matrix or to another peptide to
tether the binding polypeptide to a resin or support. Such
N-terminal and C-terminal groups may also be used to label or tag
the binding polypeptide to detect bound complexes or to locate the
binding polypeptide (whether bound or unbound to a B lymphocyte
stimulator target protein) for example, at some point in a
separation procedure. Accordingly, a B lymphocyte stimulator
binding polypeptide synthesized in its final form for use in a
detection or separation procedure may contain an N-terminal and/or
a C-terminal capping group. A particularly preferred N-terminal
capping group, which may be present or retained in binding
polypeptides, is an acetyl group (Ac). A particularly preferred
C-terminal capping group, which may be present or retained in
binding polypeptides, is an amide group. In a further preferred
embodiment, the B lymphocyte stimulator binding polypeptides have
an acetyl group as an N-terminal capping group and an amide group
as a C-terminal capping group.
[0150] The B lymphocyte stimulator binding polypeptides may also be
prepared commercially by companies providing polypeptide synthesis
as a service (e.g., BACHEM Bioscience, Inc., King of Prussia, Pa.;
Quality Controlled Biochemicals, Inc., Hopkinton, Mass.).
[0151] The nucleic acid sequence encoding a B lymphocyte stimulator
binding polypeptide can be produced and isolated using well-known
techniques in the art. In one example, nucleic acids encoding the B
lymphocyte stimulator binding polypeptides are chemically
synthesized based on knowledge of the amino acid sequence of the B
lymphocyte stimulator binding polypeptide (preferably the sequence
is codon optimized to the host system in which the polypeptide will
be expressed). In another example, nucleic acids encoding a B
lymphocyte stimulator binding polypeptide are obtained by screening
an expression library (e.g., a phage display library) to identify
phage expressing B lymphocyte stimulator binding polypeptides, and
isolating B lymphocyte stimulator binding polypeptide encoding
nucleic acid sequences from the identified library member (e.g.,
via polymerase chain reaction methodology using primers flanking
the polypeptide encoding sequences).
[0152] Thus, B lymphocyte stimulator binding polypeptides can also
be obtained by recombinant expression techniques. (See, e.g.,
Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, 2d
Ed., Glover, D. M. (ed.), (Cold Spring Harbor Laboratory, Cold
Spring Harbor, N.Y., 1989); DNA Cloning: A Practical Approach (MRL
Press, Ltd., Oxford, U.K., 1985), Vols. I, II.
[0153] To produce a recombinant B lymphocyte stimulator binding
polypeptide, a nucleic acid sequence encoding the B lymphocyte
stimulator binding polypeptide is operatively linked to a promoter
such that the B lymphocyte stimulator binding polypeptide is
produced from said sequence. For example, a vector can be
introduced into a cell, within which cell the vector or a portion
thereof is expressed, producing the B lymphocyte stimulator binding
polypeptides. In a preferred embodiment, the nucleic acid is DNA if
the source of RNA polymerase is DNA-directed RNA polymerase, but
the nucleic acid may also be RNA if the source of polymerase is
RNA-directed RNA polymerase or if reverse transcriptase is present
in the cell or provided to produce DNA from the RNA. Such a vector
can remain episomal or, become chromosomally integrated, as long as
it can be transcribed to produce the desired RNA. Such vectors can
be constructed by recombinant DNA technology methods standard in
the art. Vectors can be bacteriophage, plasmid, viral, retroviral,
or others known in the art, used for replication and expression in
bacterial, fungal, plant, insect or mammalian cells. Retroviral
vectors may be replication competent or replication defective. In
the latter case, viral propagation generally will occur only in
complementing host cells. Introduction of the vector construct into
the host cell can be effected by techniques known in the art which
include, but are not limited to, calcium phosphate transfection,
DEAE-dextran mediated transfection, cationic lipid-mediated
transfection, electroporation, transduction, infection or other
methods. Such methods are well known in the art and are described,
for example, in many standard laboratory manuals, such as Davis et
al., Basic Methods In Molecular Biology (1986).
[0154] The present invention also contemplates the use of B
lymphocyte stimulator binding polypeptides (including molecules
comprising, or alternatively consisting of, B lymphocyte stimulator
binding polypeptide fragments or variants thereof) that are
recombinantly fused or chemically conjugated (including both
covalent and non-covalent conjugations) to a heterologous
polypeptide (or portion thereof, preferably at least 10, at least
20, at least 30, at least 40, at least 50, at least 60, at least
70, at least 80, at least 90 or at least 100 amino acids of the
heterologous polypeptide) to generate fusion proteins. The fusion
does not necessarily need to be direct, but may occur through
linker sequences. For example, B lymphocyte stimulator binding
polypeptides may be used to target heterologous polypeptides to
particular cell types (e.g., cells of monocytic lineage and
B-cells), either in vitro or in vivo, by fusing or conjugating the
heterologous polypeptides to B lymphocyte stimulator binding
polypeptides that are specific for particular cell surface antigens
(e.g., membrane-bound B lymphocyte stimulator on cells of monocytic
lineage) or which bind antigens (i.e., B lymphocyte stimulator)
that bind particular cell surface receptors (e.g., TACI and/or BCMA
located on B cells). B lymphocyte stimulator binding polypeptides
fused or conjugated to heterologous polypeptides may also be used
in in vitro immunoassays and purification methods using methods
known in the art. See e.g., Harbor et al., supra, and PCT
publication WO 93/2 1232; EP 439 095; Naramura et al., Immunol.
Lett., 39:91-99 (1994); U.S. Pat. No. 5,474,981; Gillies et al.,
Proc. Nat'l Acad. Sci. USA, 89:1428-1432 (1992); Fell et al., J.
Immunol., 146:2446-2452 (1991), which are incorporated by reference
in their entireties.
[0155] The present invention further contemplates the use of
compositions comprising, or alternatively consisting of,
heterologous polypeptides fused or conjugated to B lymphocyte
stimulator binding polypeptide fragments.
[0156] Fusion proteins useful in the methods of the invention may
be generated through the techniques of gene-shuffling,
motif-shuffling, exon-shuffling, and/or codon-shuffling
(collectively referred to as "DNA shuffling"). DNA shuffling may be
employed to modulate the activities of B lymphocyte stimulator
binding polypeptides (including molecules comprising, or
alternatively consisting of, B lymphocyte stimulator binding
polypeptide fragments or variants thereof), such methods can be
used to generate B lymphocyte stimulator binding polypeptides with
altered activity (e.g., B lymphocyte stimulator binding
polypeptides with higher affinities and lower dissociation rates).
See, generally, U.S. Pat. Nos. 5,605,793; 5,811,238; 5,830,721;
5,834,252; and 5,837,458, and Patten et al., Curr. Opinion
Biotechnol., 8:724-33 (1997); Harayama, Trends Biotechnol.,
16(2):76-82 (1998); Hansson, et al., J. Mol. Biol., 287:265-76
(1999); and Lorenzo and Blasco, Biotechniques, 24(2):308-13 (1998)
(each of these patents and publications are hereby incorporated by
reference in its entirety). In one embodiment, polynucleotides
encoding B lymphocyte stimulator binding polypeptides may be
altered by being subjected to random mutagenesis by error-prone
PCR, random nucleotide insertion or other methods prior to
recombination. In another embodiment, one or more portions of a
polynucleotide encoding a B lymphocyte stimulator binding
polypeptide which portions specifically bind to B lymphocyte
stimulator may be recombined with one or more components, motifs,
sections, parts, domains, fragments, etc. of one or more
heterologous molecules.
[0157] Polypeptides of the present invention include products of
chemical synthetic procedures, and products produced by recombinant
techniques from a prokaryotic or eukaryotic host, including, for
example, bacterial, yeast, higher plant, insect and mammalian
cells. Depending upon the host employed in a recombinant production
procedure, the polypeptides of the present invention may be
glycosylated or may be non-glycosylated. In addition, polypeptides
may also include an initial modified methionine residue, in some
cases as a result of host-mediated processes.
[0158] The B lymphocyte stimulator binding polypeptides that are
used in the methods of the present invention may be modified during
or after synthesis or translation, e.g., by glycosylation,
acetylation, benzylation, phosphorylation, amidation, pegylation,
formylation, derivatization by known protecting/blocking groups,
proteolytic cleavage, linkage to an antibody molecule,
hydroxylation, iodination, methylation, myristoylation, oxidation,
pegylation, proteolytic processing, phosphorylation, prenylation,
racemization, selenoylation, sulfation, ubiquitination, etc. (See,
for instance, Creighton, Proteins: Structures and Molecular
Properties, 2d Ed. (W.H. Freeman and Co., N.Y., 1992);
Postranslational Covalent Modification of Proteins, Johnson, ed.
(Academic Press, New York, 1983), pp. 1-12; Seifter et al., Meth.
Enzymol., 182:626-646 (1990); Rattan et al., Ann. NY Acad. Sci.,
663:48-62 (1992).) In specific embodiments, the peptides are
acetylated at the N-terminus and/or amidated at the C-terminus.
[0159] B lymphocyte stimulator binding polypeptides containing two
or more residues that have the potential to interact, such as for
example, two cysteine residues in a polypeptide, may be treated
under oxidizing conditions or other conditions that promote
interaction of these residues (e.g. disulfide bridge
formation).
[0160] Further B lymphocyte stimulator binding polypeptide
modifications contemplated herein include, for example, any of
numerous chemical modifications carried out by known techniques,
including but not limited to specific chemical cleavage by cyanogen
bromide, trypsin, chymotrypsin, papain, V8 protease, NaBH.sub.4,
acetylation, formylation, oxidation, reduction, metabolic synthesis
in the presence of tunicamycin, etc. Additional
post-translational/post-synthesis modifications that may be
employed include, for example, e.g., N-linked or O-linked
carbohydrate chains, processing of N-terminal or C-terminal ends),
attachment of chemical moieties to the amino acid backbone,
chemical modifications of N-linked or O-linked carbohydrate chains,
and addition or deletion of an N-terminal methionine residue as a
result of prokaryotic host cell expression.
[0161] Chemically modified derivatives of B lymphocyte stimulator
binding polypeptides may be used which may provide additional
advantages such as increased affinity, decreased off-rate,
solubility, stability and in vivo or in vitro circulating time of
the polypeptide, or decreased immunogenicity (see, U.S. Pat. No.
4,179,337). The chemical moieties for derivitization may be
selected from water soluble polymers such as polyethylene glycol,
ethylene glycol/propylene glycol copolymers,
carboxymethylcellulose, dextran, polyvinyl alcohol and the like.
The polypeptides may be modified at random positions within the
molecule, or at predetermined positions within the molecule and may
include one, two, three or more attached chemical moieties.
[0162] The polymer may be of any molecular weight, and may be
branched or unbranched. For polyethylene glycol, the preferred
molecular weight is between about 1 kDa and about 100 kDa (the term
"about" indicating that in preparations of polyethylene glycol,
some molecules will weigh more, some less, than the stated
molecular weight) for ease in handling and manufacturing. Other
sizes may be used, depending on the desired therapeutic profile
(e.g., the duration of sustained release desired, the effects, if
any, on biological activity, the ease in handling, the degree or
lack of antigenicity and other known effects of the polyethylene
glycol to a therapeutic protein or analog). For example, the
polyethylene glycol may have an average molecular weight of about
200, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000,
5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000, 9500, 10,000,
10,500, 11,000, 11,500, 12,000, 12,500, 13,000, 13,500, 14,000,
14,500, 15,000, 15,500, 16,000, 16,500, 17,000, 17,500, 18,000,
18,500, 19,000, 19,500, 20,000, 25,000, 30,000, 35,000, 40,000,
50,000, 55,000, 60,000, 65,000, 70,000, 75,000, 80,000, 85,000,
90,000, 95,000, or 100,000 kDa.
[0163] As noted above, the polyethylene glycol may have a branched
structure. Branched polyethylene glycols are described, for
example, in U.S. Pat. No. 5,643,575; Morpurgo et al., Appl.
Biochem. Biotechnol., 56:59-72 (1996); Vorobjev et al., Nucleosides
Nucleotides, 18:2745-2750 (1999); and Caliceti et al., Bioconjug.
Chem., 10:638-646 (1999), the disclosures of each of which are
incorporated herein by reference.
[0164] The polyethylene glycol molecules (or other chemical
moieties) should be attached to the B lymphocyte stimulator binding
polypeptide with consideration of effects on functional domains of
the polypeptide. There are a number of attachment methods available
to those skilled in the art, e.g., EP 0 401 384, herein
incorporated by reference (coupling PEG to G-CSF), see also Malik
et al., Exp. Hematol., 20:1028-1035 (1992) (reporting pegylation of
GM-CSF using tresyl chloride). For example, polyethylene glycol may
be covalently bound through amino acid residues via a reactive
group, such as, a free amino or carboxyl group. Reactive groups are
those to which an activated polyethylene glycol molecule may be
bound. The amino acid residues having a free amino group may
include, for example, lysine residues and the N-terminal amino acid
residues; those having a free carboxyl group may include aspartic
acid residues, glutamic acid residues, and the C-terminal amino
acid residue. Sulfhydryl groups may also be used as a reactive
group for attaching the polyethylene glycol molecules. In a
preferred embodiment, the polyethylene glycol molecule is attached
at an amino group, such as attachment at the N-terminus or to a
lysine side chain amino group.
[0165] As suggested above, polyethylene glycol may be attached to
polypeptides via linkage to any of a number of amino acid residues.
For example, polyethylene glycol can be linked to a polypeptide via
covalent bonds to lysine, histidine, aspartic acid, glutamic acid,
or cysteine residues. One or more reaction chemistries may be
employed to attach polyethylene glycol to specific amino acid
residues (e.g., lysine, histidine, aspartic acid, glutamic acid, or
cysteine) of the polypeptide or to more than one type of amino acid
residue (e.g., lysine, histidine, aspartic acid, glutamic acid,
cysteine and combinations thereof) of the polypeptide.
[0166] One may specifically desire proteins chemically modified at
the N-terminus. Using polyethylene glycol as an illustration, one
may select from a variety of polyethylene glycol molecules (by
molecular weight, branching, etc.), the proportion of polyethylene
glycol molecules to polypeptide molecules in the reaction mix, the
type of pegylation reaction to be performed, and the method of
obtaining the selected N-terminally pegylated polypeptide. The
method of obtaining the N-terminally pegylated preparation (i.e.,
separating this moiety from other monopegylated moieties if
necessary) may be by purification of the N-terminally pegylated
material from a population of pegylated polypeptide molecules.
Selective N-terminal modification of proteins may be accomplished
by reductive alkylation which exploits differential reactivity of
different types of primary amino groups (lysine versus the
N-terminus) available for derivatization in a particular protein.
Under the appropriate reaction conditions, substantially selective
derivatization of the protein at the N-terminus with a carbonyl
group containing polymer is achieved.
[0167] As indicated above, pegylation of the polypeptides may be
accomplished by any number of means. For example, polyethylene
glycol may be attached to the protein either directly or by an
intervening linker. Linkerless systems for attaching polyethylene
glycol to proteins are described in Delgado et al., Crit. Rev.
Thera. Drug Carrier Sys., 9:249-304 (1992); Francis et al., Intern.
J. of Hematol., 68:1-18 (1998); U.S. Pat. No. 4,002,531; U.S. Pat.
No. 5,349,052; WO 95/06058; and WO 98/32466, the disclosures of
each of which are incorporated herein by reference.
[0168] One system for attaching polyethylene glycol directly to
amino acid residues of polypeptides without an intervening linker
employs tresylated MPEG, which is produced by the modification of
monomethoxy polyethylene glycol (MPEG) using tresylchloride
(ClSO.sub.2CH.sub.2CF.sub.3). Upon reaction of protein with
tresylated MPEG, polyethylene glycol is directly attached to amine
groups of the polypeptide. Thus, the invention includes
polypeptide-polyethylene glycol conjugates produced by reacting
polypeptides with a polyethylene glycol molecule having a
2,2,2-trifluoroethane sulphonyl group.
[0169] Polyethylene glycol can also be attached to polypeptides
using a number of different intervening linkers. For example, U.S.
Pat. No. 5,612,460, the entire disclosure of which is incorporated
herein by reference, discloses urethane linkers for connecting
polyethylene glycol to polypeptides. Polypeptide-polyethylene
glycol conjugates wherein the polyethylene glycol is attached to
the polypeptide by a linker can also be produced by reaction of
polypeptides with compounds such as MPEG-succinimidylsuccinate,
MPEG activated with 1,1'-carbonyldiimidazole,
MPEG-2,4,5-trichlorophenylcarbonate, MPEG-p-nitrophenolcarbonate,
and various MPEG-succinate derivatives. A number of additional
polyethylene glycol derivatives and reaction chemistries for
attaching polyethylene glycol to polypeptides are described in WO
98/32466, the entire disclosure of which is incorporated herein by
reference. Pegylated B lymphocyte stimulator binding polypeptide
products produced using the reaction chemistries set out herein are
included within the scope of the invention.
[0170] The number of polyethylene glycol moieties attached to each
polypeptide (i.e., the degree of substitution) may also vary. For
example, the pegylated polypeptides may be linked, on average, to
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 17, 20, or more polyethylene
glycol molecules. Similarly, the average degree of substitution may
range within ranges such as 1-3,2-4, 3-5, 4-6, 5-7, 6-8, 7-9, 8-10,
9-11, 10-12, 11-13, 12-14, 13-15, 14-16, 15-17, 16-18, 17-19, or
18-20 polyethylene glycol moieties per polypeptide molecule.
Methods for determining the degree of substitution are discussed,
for example, in Delgado et al., Crit. Rev. Thera. Drug Carrier
Sys., 9:249-304 (1992).
B Lymphocyte Stimulator Binding Polypeptide Multimers, Conjugates
and Fusions
[0171] The methods of the present invention may also be carried out
using multivalent B lymphocyte stimulator binding polypeptides. B
lymphocyte stimulator binding polypeptides may be monomeric,
dimeric, trimeric, or higher-order multimers. In a preferred
embodiment multivalent B lymphocyte stimulator binding polypeptides
are homotrimeric. In another preferred embodiment a homotrimeric B
lymphocyte stimulator binding polypeptide binds a single
homotrimeric B lymphocyte stimulator.
[0172] In another preferred embodiment, monomeric or multimeric B
lymphocyte stimulator binding polypeptides are conjugated with
another polypeptide or other chemical compound. For example, B
lymphocyte stimulator binding polypeptide(s) may be conjugated to a
radioactive or other toxic compound so as to target and destroy
cells expressing B lymphocyte stimulator.
[0173] The present invention also encompasses the use of
heteromeric multimers comprised of one or more B lymphocyte
stimulator binding polypeptides and one or more non-B lymphocyte
stimulator binding polypeptides or other chemical moieties. Such
heteromeric multimers may be monomeric, dimeric, trimeric,
tetrameric, pentameric, or higher-order multimers. Heteromeric B
lymphocyte stimulator binding multimers may be used to target,
bind, inhibit, and/or activate responses in cells expressing B
lymphocyte stimulator and receptors for the heterologous, non-B
lymphocyte stimulator binding polypeptide or other chemical moiety.
Such activated responses may include, for example, apoptosis or
other biologically and chemically mediated forms of cell
destruction. Heteromeric B lymphocyte stimulator binding multimers
may also be used to target B lymphocyte stimulator expressing cells
so as to introduce a desired molecule or compound to the cells. For
example, a heteromeric B lymphocyte stimulator binding multimer may
be conjugated with a radioactive or otherwise toxic compound so as
to kill B lymphocyte stimulator expressing cells. As an alternative
example, a heteromeric B lymphocyte stimulator binding and
Adenovirus-binding multimer could be used to specifically target
and introduce adenovirus-mediated gene therapeutics into B
lymphocyte stimulator expressing cells.
[0174] B lymphocyte stimulator binding polypeptide multimers may be
fused or conjugated as homopolymers and heteropolymers using
methods known in the art. In a preferred embodiment B lymphocyte
stimulator binding polypeptides are linked as homomultimers wherein
the linker or linkers provide sufficient length and flexibility
such that each B lymphocyte stimulator binding polypeptide may
simultaneously bind an individual B lymphocyte stimulator molecule.
In another preferred embodiment B lymphocyte stimulator binding
polypeptides are linked as heteromultimers wherein the linker or
linkers provide sufficient length and flexibility such that each B
lymphocyte stimulator binding polypeptide may simultaneously bind
individual B lymphocyte stimulator molecules and the heterologous
polypeptide or chemical moiety may simultaneously bind to its
target. Numerous examples of suitable linker molecules are known in
the art. (See, for example, Todorovska et al., J. Immunol. Methods,
248(1-2):47-66 (2001); Mehvar, J. Control Release, 69(1):1-25
(2000); Francis et. al., Int. J. Hematol., 68(1):1-18 (1998).) In
specific embodiments, the linker is a member selected from the
group consisting of: (a) a peptide linker; (b) a glutamate linker;
and (c) a polyethylene glycol linker. The length of linkers to be
used according to the methods of the invention may routinely be
determined using techniques known in the art. In specific
embodiments, the linker is 5-60 angstroms in length. In other
embodiments, the linker is 10-50, 10-40, 10-30, or 10-20 angstroms
in length. In further embodiments, the linker is about 5, 10, 15,
20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or
100 angstroms in length. In this context "about" includes the
recited length, and/or lengths that are larger or smaller by
several (5, 4, 3, 2, or 1) angstroms. In other embodiments, the
linker is at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60,
65, 70, 75, 80, 85, 90, 95, or 100 angstroms in length.
[0175] In a preferred embodiment, B lymphocyte stimulator binding
polypeptides may be fused with human serum albumin (HA). See, e.g.,
U. S. application Ser. No. 09/833,245, filed Apr. 12, 2001, which
is hereby incorporated by reference herein. In one embodiment, the
albumin fusion protein comprises HA as the N-terminal portion, and
a B lymphocyte stimulator binding polypeptide as the C-terminal
portion. In another embodiment the albumin fusion protein comprise
HA as the C-terminal portion, and a B lymphocyte stimulator binding
polypeptide as the N-terminal portion.
[0176] In other embodiments, the albumin fusion protein has a B
lymphocyte stimulator binding polypeptide fused to both the
N-terminus and the C-terminus of albumin. In one preferred
embodiment, the B lymphocyte stimulator binding polypeptides fused
at the N- and C-termini are the same B lymphocyte stimulator
binding polypeptides. In another preferred embodiment, the B
lymphocyte stimulator binding polypeptides fused at the N- and
C-termini are different B lymphocyte stimulator binding
polypeptides. In another preferred embodiment, a B lymphocyte
stimulator binding polypeptide is fused at either the N- or
C-terminus of HA and a different (non-B lymphocyte stimulator
binding) polypeptide is fused at either the C- or N-terminus,
respectively.
[0177] In addition to albumin fusion proteins in which the B
lymphocyte stimulator binding polypeptide(s) is (are) fused to the
N-terminus and/or C-terminus of HA, B lymphocyte stimulator binding
polypeptide/albumin fusion proteins may also be produced by
inserting the B lymphocyte stimulator binding polypeptide into an
internal region or regions of HA. For instance, within the protein
sequence of the HA molecule a number of loops or turns exist
between the end and beginning of .alpha.-helices, which are
stabilized by disulphide bonds (see FIGS. 9-11 in U.S. application
Ser. No. 09/833,245). The loops, as determined from the crystal
structure of HA (FIG. 13 of U.S. application Ser. No. 09/833,245)
(PDB identifiers 1AO6, 1BJ5, 1BKE, 1BM0, 1E7E to 1E7I and 1UOR) for
the most part extend away from the body of the molecule. These
loops are useful for the insertion, or internal fusion, of
therapeutically active peptides (particularly those requiring a
secondary structure to be functional) or therapeutic proteins, to
essentially generate an albumin molecule with specific biological
activity.
[0178] Loops in human albumin structure into which binding
polypeptides may be inserted to generate albumin fusion proteins
include: Val54-Asn61, Thr76-Asp89, Ala92-Glu100, Gln170-Ala176, His
247-Glu252, Glu 266-Glu277, Glu 280-His288, Ala362-Glu368,
Lys439-Pro447, Val462-Lys475, Thr478-Pro486, and Lys560-Thr566. In
more preferred embodiments, polypeptides are inserted into the
Val54-Asn61, Gln170-Ala176, and/or Lys560-Thr566 loops of mature
human serum albumin (SEQ ID NO:445).
[0179] In specific embodiments, B lymphocyte stimulator binding
polypeptides are attached to macrocyclic chelators useful for
conjugating radiometal ions, including but not limited to,
.sup.111In, .sup.177Lu, .sup.90Y, .sup.166Ho, and .sup.153Sm, to
polypeptides. In a preferred embodiment, the radiometal ion
associated with the macrocyclic chelators attached to B lymphocyte
stimulator binding polypeptides is .sup.111In. In another preferred
embodiment, the radiometal ion associated with the macrocyclic
chelator attached to B lymphocyte stimulator binding polypeptides
is .sup.90Y. In specific embodiments, the macrocyclic chelator is
1,4,7,10-tetraazacyclododecane-N,N',N'',N'''-tetraacetic acid
(DOTA). In other specific embodiments, the DOTA is attached to the
B lymphocyte stimulator binding polypeptides via a linker molecule.
Examples of linker molecules useful for conjugating DOTA to a
polypeptide are commonly known in the art--see, for example,
DeNardo et al., Clin. Cancer Res., 4(10):2483-90 (1998); Peterson
et al., Bioconjug. Chem., 10(4):553-7 (1999); and Zimmerman et al,
Nucl. Med. Biol., 26(8):943-50 (1999), which are hereby
incorporated by reference in their entirety. In addition, U.S. Pat.
Nos. 5,652,361 and 5,756,065, which disclose chelating agents that
may be conjugated to antibodies, and methods for making and using
them, are hereby incorporated by reference in their entireties.
Though U.S. Pat. Nos. 5,652,361 and 5,756,065 focus on conjugating
chelating agents to antibodies, one skilled in the art would be
readily able to adapt the method disclosed therein in order to
conjugate chelating agents to other polypeptides.
[0180] The B lymphocyte stimulator binding polypeptides can be
recovered and purified by known methods which include, but are not
limited to, ammonium sulfate or ethanol precipitation, acid
extraction, anion or cation exchange chromatography,
phosphocellulose chromatography, hydrophobic interaction
chromatography, affinity chromatography, hydroxylapatite
chromatography and lectin chromatography. Most preferably, high
performance liquid chromatography ("HPLC") is employed for
purification.
[0181] The B lymphocyte stimulator binding polypeptides may also be
modified with a detectable label, including, but not limited to, an
enzyme, prosthetic group, fluorescent material, luminescent
material, bioluminescent material, radioactive material, positron
emitting metal, nonradioactive paramagnetic metal ion, and affinity
label for detection and isolation of B lymphocyte stimulator
target. The detectable substance may be coupled or conjugated
either directly to the polypeptides or indirectly, through an
intermediate (such as, for example, a linker known in the art)
using techniques known in the art. Examples of suitable enzymes
include horseradish peroxidase, alkaline phosphatase,
beta-galactosidase, glucose oxidase or acetylcholinesterase;
examples of suitable prosthetic group complexes include
streptavidin/biotin and avidin/biotin; examples of suitable
fluorescent materials include biotin, umbelliferone, fluorescein,
fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine
fluorescein, dansyl chloride or phycoerythrin; an example of a
luminescent material includes luminol; examples of bioluminescent
materials include luciferase, luciferin, and aequorin; and examples
of suitable radioactive material include a radioactive metal ion,
e.g., alpha-emitters such as, for example, .sup.213Bi, or other
radioisotopes such as, for example, iodine (.sup.131I, .sup.125I,
.sup.123I, .sup.121I), carbon (.sup.14C), sulfur (.sup.35S),
tritium (.sup.3H), indium (.sup.115mIn, .sup.113mIn, .sup.112In,
.sup.111In), and technetium (.sup.99Tc, .sup.99mTc), thallium
(.sup.201Ti), gallium (.sup.68Ga, .sup.67Ga), palladium
(.sup.103Pd), molybdenum (.sup.99Mo), xenon (.sup.133Xe), fluorine
(.sup.18F), .sup.153Sm, .sup.177Lu, .sup.159Gd, .sup.149Pm,
.sup.140La, .sup.175Yb, .sup.166Ho, .sup.90Y, .sup.47Sc,
.sup.186Re, .sup.188Re, .sup.142Pr, .sup.105Rh, .sup.97Ru,
.sup.68Ge, .sup.57Co, .sup.65Zn, .sup.85Sr, .sup.32P, .sup.153Gd,
.sup.169Yb, .sup.51Cr, .sup.54Mn, .sup.75Se, .sup.113Sn, and
.sup.117Tin.
[0182] In specific embodiments, B lymphocyte stimulator binding
polypeptides are attached macrocyclic chelators useful for
conjugating radiometal ions, including but not limited to
.sup.177Lu, .sup.90Y, .sup.166Ho, and .sup.153Sm, to polypeptides.
In specific embodiments, the macrocyclic chelator is
1,4,7,10-tetraazacyclododecane-N,N',N'',N'''-tetraacetic acid
(DOTA). In other specific embodiments, the DOTA is attached to the
B lymphocyte stimulator binding polypeptide via a linker molecule.
Examples of linker molecules useful for conjugating DOTA to a
polypeptide are commonly known in the art--see, for example,
DeNardo et al., Clin. Cancer Res., 4(10):2483-90 (1998); Peterson
et al., Bioconjug. Chem., 10(4):553-7 (1999); and Zimmerman et al,
Nucl. Med. Biol., 26(8):943-50 (1999), which are hereby
incorporated by reference in their entirety.
[0183] In a specific embodiment, B lymphocyte stimulator binding
polypeptides are labeled with biotin.
[0184] The present invention further encompasses the use of B
lymphocyte stimulator binding polypeptides (including molecules
comprising, or alternatively consisting of, B lymphocyte stimulator
binding polypeptide fragments or variants thereof), conjugated to a
diagnostic or therapeutic agent. The B lymphocyte stimulator
binding polypeptides can be used diagnostically to, for example,
monitor or prognose the development or progression of a tumor as
part of a clinical testing procedure to, e.g., determine the
efficacy of a given treatment regimen. Detection can be facilitated
by coupling the B lymphocyte stimulator binding polypeptide to a
detectable substance. Examples of detectable substances include,
but are not limited to, various enzymes, prosthetic groups,
fluorescent materials, luminescent materials, bioluminescent
materials, radioactive materials, positron emitting metals using
various positron emission tomographies, and nonradioactive
paramagnetic metal ions such as, for example, those described
herein. The detectable substance may be coupled or conjugated
either directly to the B lymphocyte stimulator binding polypeptide
or indirectly, through an intermediate (such as, for example, a
linker known in the art) using techniques known in the art. See,
for example, U.S. Pat. No. 4,741,900 for metal ions which can be
conjugated to B lymphocyte stimulator binding polypeptides for use
as diagnostics according to the present invention.
[0185] Further, a B lymphocyte stimulator binding polypeptide
(including a molecule comprising, or alternatively consisting of, B
lymphocyte stimulator binding polypeptide fragments or variants
thereof), may be conjugated to a therapeutic moiety such as a
cytotoxin, e.g., a cytostatic or cytocidal agent, a therapeutic
agent or a radioactive metal ion, e.g., alpha-emitters such as, for
example, .sup.213Bi, or other radioisotopes such as, for example,
.sup.103Pd, .sup.133Xe, .sup.131I, .sup.68Ge, .sup.57Co, .sup.65Zn,
.sup.85Sr, .sup.32P, .sup.35S, .sup.90Y, .sup.153Sm, .sup.153Gd,
.sup.169Yb, .sup.51Cr, .sup.54Mn, .sup.75Se, .sup.113Sn,
.sup.90Yttrium, .sup.117Tin, .sup.186Rhenium, .sup.166Holmium, and
.sup.188Rhenium. A cytotoxin or cytotoxic agent includes any agent
that is detrimental to cells. Examples include, but are not limited
to, paclitaxol, cytochalasin B, gramicidin D, ethidium bromide,
emetine, mitomycin, etoposide, tenoposide, vincristine,
vinblastine, colchicum, doxorubicin, daunorubicin, dihydroxy
anthracin dione, mitoxantrone, mithramycin, actinomycin D,
1-dehydrotestosterone, glucocorticoids, procaine, tetracaine,
lidocaine, propranolol, thymidine kinase, endonuclease, RNAse, and
puromycin and fragments, variants or homologs thereof. Therapeutic
agents include, but are not limited to, antimetabolites (e.g.,
methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine,
5-fluorouracil decarbazine), alkylating agents (e.g.,
mechlorethamine, thioepa chlorambucil, melphalan, carmustine (BSNU)
and lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol,
streptozotocin, mitomycin C, and cisdichlorodiamine platinum (II)
(DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly
daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin
(formerly actinomycin), bleomycin, mithramycin, and anthramycin
(AMC)), and anti-mitotic agents (e.g., vincristine and
vinblastine).
[0186] Techniques known in the art may be applied to label B
lymphocyte stimulator binding polypeptides. Such techniques
include, but are not limited to, the use of bifunctional
conjugating agents (see, e.g., U.S. Pat. Nos. 5,756,065; 5,714,631;
5,696,239; 5,652,361; 5,505,931; 5,489,425; 5,435,990; 5,428,139;
5,342,604; 5,274,119; 4,994,560; and 5,808,003; the contents of
each of which are hereby incorporated by reference in its
entirety).
[0187] The B lymphocyte stimulator binding polypeptides which are
conjugates can be used for modifying a given biological response,
the therapeutic agent or drug moiety is not to be construed as
limited to classical chemical therapeutic agents. For example, the
drug moiety may be a protein or polypeptide possessing a desired
biological activity. Such proteins may include, but are not limited
to, for example, a toxin such as abrin, ricin A, alpha toxin,
pseudomonas exotoxin, or diphtheria toxin, saporin, momordin,
gelonin, pokeweed antiviral protein, alpha-sarcin and cholera
toxin; a protein such as tumor necrosis factor, alpha-interferon,
beta-interferon, nerve growth factor, platelet derived growth
factor, tissue plasminogen activator, an apoptotic agent, e.g.,
TNF-alpha, TNF-beta, AIM I (see, International Publication No. WO
97/33899), AIM II (see, International Publication No. WO 97/34911),
fas ligand (Takahashi et al., Int. Immunol., 6:1567-1574 (1994)),
VEGI (see, International Publication No. WO 99/23105), a thrombotic
agent or an anti-angiogenic agent, e.g., angiostatin or endostatin;
or, biological response modifiers such as, for example,
lymphokines, interleukin-1 (IL-1), interleukin-2 (IL-2),
interleukin-6 (IL-6), granulocyte macrophage colony stimulating
factor (GM-CSF), granulocyte colony stimulating factor (G-CSF), or
other growth factors.
[0188] A B lymphocyte stimulator binding polypeptide (including a
molecule comprising, or alternatively consisting of, a B lymphocyte
stimulator binding polypeptide fragment or variant thereof), with
or without a therapeutic moiety conjugated to it, administered
alone or in combination with cytotoxic factor(s) and/or cytokine(s)
can be used as a therapeutic.
Characterization of B Lymphocyte Stimulator Binding
Polypeptides
[0189] B lymphocyte stimulator binding polypeptides (including
molecules comprising, or alternatively consisting of, B lymphocyte
stimulator binding polypeptide fragments or variants thereof) may
be characterized in a variety of ways. In particular, B lymphocyte
stimulator binding polypeptides and related molecules may be
assayed for the ability to specifically bind to B lymphocyte
stimulator or a fragment of B lymphocyte stimulator (e.g., to the
soluble form or the membrane-bound form of B lymphocyte stimulator)
using techniques described herein or routinely modifying techniques
known in the art. B lymphocyte stimulator or B lymphocyte
stimulator fragments that may be specifically bound by the
compositions useful according to the invention include, but are not
limited to, human B lymphocyte stimulator (SEQ ID NOs:173 and/or
174) or B lymphocyte stimulator expressed on human monocytes;
murine B lymphocyte stimulator (SEQ ID NOs:175 and/or 176) or B
lymphocyte stimulator expressed on murine monocytes; rat B
lymphocyte stimulator (either the soluble forms as given in SEQ ID
NOs:177, 178, 179 and/or 180 or in a membrane associated form,
e.g., on the surface of rat monocytes); or monkey B lymphocyte
stimulator (e.g., the monkey B lymphocyte stimulator polypeptides
of SEQ ID NOS:181 and/or 182, the soluble form of monkey B
lymphocyte stimulator, or B lymphocyte stimulator expressed on
monkey monocytes) or fragments thereof. Preferably compositions
useful according to the invention bind human B lymphocyte
stimulator (SEQ ID NOs:173 and/or 174) or fragments thereof. Assays
for the ability of the B lymphocyte stimulator binding polypeptides
to specifically bind B lymphocyte stimulator or a fragment of B
lymphocyte stimulator may be performed in solution (e.g., Houghten,
Bio/Techniques, 13:412-421 (1992)), on beads (e.g., Lam, Nature,
354:82-84 (1991)), on chips (e.g., Fodor, Nature, 364:555-556
(1993)), on bacteria (e.g., U.S. Pat. No. 5,223,409), on spores
(e.g., U.S. Pat. Nos. 5,571,698; 5,403,484; and 5,223,409), on
plasmids (e.g., Cull et al., Proc. Natl. Acad. Sci. USA,
89:1865-1869 (1992)) or on phage (e.g., Scott and Smith, Science,
249:386-390 (1990); Devlin, Science, 249:404-406 (1990); Cwirla et
al., Proc. Natl. Acad. Sci. USA, 87:6378-6382 (1990); and Felici,
J. Mol. Biol., 222:301-310 (1991)) (each of these references is
incorporated herein in its entirety by reference). B lymphocyte
stimulator binding polypeptides that have been identified to
specifically bind to B lymphocyte stimulator or a fragment of B
lymphocyte stimulator can then be assayed for their specificity and
affinity for B lymphocyte stimulator or a fragment of B lymphocyte
stimulator using or routinely modifying techniques described herein
or otherwise known in the art.
[0190] The B lymphocyte stimulator binding polypeptides may be
assayed for specific binding to B lymphocyte stimulator and
cross-reactivity with other B lymphocyte stimulator-like
polypeptides by any method known in the art. In particular, the
ability of a B lymphocyte stimulator binding polypeptide to
specifically bind to the soluble form or membrane-bound form of B
lymphocyte stimulator and the specificity of the B lymphocyte
stimulator binding polypeptide, fragment, or variant for B
lymphocyte stimulator polypeptide from a particular species (e.g.,
murine, monkey or human, preferably human) may be determined using
or routinely modifying techniques described herein or otherwise
known in art.
[0191] Assays which can be used to analyze specific binding and
cross-reactivity include, but are not limited to, competitive and
non-competitive assay systems using techniques such as western
blots, radioimmunoassays, ELISA (enzyme linked immunosorbent
assay), "sandwich" assays, "immunoprecipitation" assays, precipitin
reactions, gel diffusion precipitin reactions, immunodiffusion
assays, agglutination assays, complement-fixation assays,
radiometric assays, and fluorescent assays, to name but a few. Such
assays are routine and well known in the art (see, e.g., Current
Protocols in Molecular Biology, Vol. 1, Ausubel et al, eds. (John
Wiley & Sons, Inc., New York 1994), which is incorporated by
reference herein in its entirety) and could easily be adapted to
make use of a B lymphocyte stimulator binding polypeptide (possibly
in conjunction with an anti-B lymphocyte stimulator binding
polypeptide antibody) in place of an anti-B lymphocyte stimulator
antibody. Exemplary immunoassays that could be modified to use a B
lymphocyte stimulator binding polypeptide are described briefly
below (but are not intended by way of limitation).
[0192] Western blot analysis generally comprises preparing protein
samples, electrophoresis of the protein samples in a polyacrylamide
gel (e.g., 8%-20% SDS-PAGE depending on the molecular weight of the
antigen), transferring the protein sample from the polyacrylamide
gel to a membrane such as nitrocellulose, PVDF or nylon, blocking
the membrane in blocking solution (e.g., PBS with 3% BSA or non-fat
milk), washing the membrane in washing buffer (e.g., PBS-Tween 20),
incubating the membrane with B lymphocyte stimulator binding
polypeptide (the B lymphocyte stimulator binding polypeptide of
interest) diluted in blocking buffer, washing the membrane in
washing buffer, incubating the membrane with a secondary antibody
(which recognizes the B lymphocyte stimulator binding polypeptide)
conjugated to an enzyme (e.g., horseradish peroxidase or alkaline
phosphatase) or radioactive molecule (e.g., .sup.32P or .sup.125I)
diluted in blocking buffer, washing the membrane in wash buffer,
and detecting the presence of the antigen. Alternatively, the B
lymphocyte stimulator binding polypeptide may be directly
conjugated to a detection molecule (e.g., an enzyme or radiolabel),
thereby omitting the need for a secondary anti-B lymphocyte
stimulator binding polypeptide antibody. One of skill in the art
would be knowledgeable as to the parameters that can be modified to
increase the signal detected and to reduce the background noise.
For further discussion regarding western blot protocols see, e.g.,
Current Protocols in Molecular Biology, Vol. 1, Ausubel et al, eds.
(John Wiley & Sons, Inc., New York 1994) at 10.8.1.
[0193] ELISAs comprise preparing antigen (e.g., B lymphocyte
stimulator target), coating the well of a 96-well microtiter plate
with the antigen, washing away antigen that did not bind the wells,
adding the B lymphocyte stimulator binding polypeptide of interest
conjugated to a detectable compound such as an enzyme (e.g.,
horseradish peroxidase or alkaline phosphatase) to the wells and
incubating for a period of time, washing away unbound B lymphocyte
stimulator binding polypeptides or non-specifically bound B
lymphocyte stimulator binding polypeptides, and detecting the
presence of the B lymphocyte stimulator binding polypeptides
specifically bound to the antigen coating the well. In ELISAs the B
lymphocyte stimulator binding polypeptide employed in the assay
does not have to be conjugated to a detectable compound; instead,
an antibody that recognizes the B lymphocyte stimulator binding
polypeptide and that is conjugated to a detectable compound may be
added to the well. Further, instead of coating the well with the
antigen, the B lymphocyte stimulator binding polypeptide may be
coated to the well. In this case, the detectable molecule could be
the antigen conjugated to a detectable compound such as an enzyme
(e.g., horseradish peroxidase or alkaline phosphatase). One of
skill in the art would be knowledgeable as to the parameters that
can be modified to increase the signal detected as well as other
variations of ELISAs known in the art. For further discussion
regarding ELISAs see, e.g., Current Protocols in Molecular Biology,
Vol. 1, Ausubel et al, eds. (John Wiley & Sons, Inc., New York
1994) at 11.2.1.
[0194] Immunoprecipitation protocols generally use antibody
molecules to immunoprecipitate a protein of interest. A B
lymphocyte stimulator precipitation protocol could easily be
modified to use a B lymphocyte stimulator binding polypeptide in
place of an anti-B lymphocyte stimulator antibody.
Immunopreciptation protocols generally comprise lysing a population
of cells in a lysis buffer such as RIPA buffer (1% NP-40 or Triton
X-100, 1% sodium deoxycholate, 0.1% SDS, 0.15 M NaCl, 0.01 M sodium
phosphate at pH 7.2, 1% Trasylol) supplemented with protein
phosphatase and/or protease inhibitors (e.g., EDTA, PMSF,
aprotinin, sodium vanadate), adding the antibody of interest to the
cell lysate, incubating for a period of time (e.g., 1 to 4 hours)
at 40 degrees C., adding protein A and/or protein G sepharose beads
to the cell lysate, incubating for about an hour or more at 40
degrees C., washing the beads in lysis buffer and resuspending the
beads in SDS/sample buffer. If one wanted to substitute a B
lymphocyte stimulator binding polypeptide for the anti-B lymphocyte
stimulator antibody one could readily do so, and then isolate the B
lymphocyte stimulator-B lymphocyte stimulator binding polypeptide
complexes with an antibody that recognizes the B lymphocyte
stimulator binding polypeptide. Then the triple complex of B
lymphocyte stimulator, B lymphocyte stimulator binding polypeptide,
and anti-B lymphocyte stimulator binding polypeptide antibody could
be isolated using protein A and/or Protein G as described above.
Such a protocol may be desirable if, for example, the anti-B
lymphocyte stimulator binding polypeptide antibody has a higher
affinity for the B lymphocyte stimulator binding polypeptide than
the anti-B lymphocyte stimulator antibody may have for B lymphocyte
stimulator.
[0195] The effectiveness of incorporating a B lymphocyte stimulator
binding polypeptide in an immunoprecipitation protocol to
precipitate B lymphocyte stimulator can be assessed by, e.g.,
western blot analysis. One of skill in the art would be
knowledgeable as to the parameters that can be modified to increase
the binding of the B lymphocyte stimulator binding polypeptide to
an antigen and decrease the background (e.g., pre-clearing the cell
lysate with sepharose beads). For further discussion regarding
immunoprecipitation protocols see, e.g., Current Protocols in
Molecular Biology, Vol. 1, Ausubel et al, eds. (John Wiley &
Sons, Inc., New York 1994) at 10.16.1.
[0196] The binding affinity of a B lymphocyte stimulator binding
polypeptide (including molecules comprising, or alternatively
consisting of, B lymphocyte stimulator binding polypeptide
fragments or variants thereof) to an antigen and the off-rate of an
B lymphocyte stimulator binding polypeptide-antigen interaction can
be determined by competitive binding assays. One example of a
competitive binding assay is a modified radioimmunoassay comprising
the incubation of labeled antigen (e.g., .sup.3H- or
.sup.125I-labeled B lymphocyte stimulator target) with the B
lymphocyte stimulator binding polypeptide of interest in the
presence of increasing amounts of unlabeled antigen, followed by
detection of the B lymphocyte stimulator binding polypeptide bound
to the labeled antigen. The affinity of the B lymphocyte stimulator
binding polypeptide of the present invention for B lymphocyte
stimulator and the binding off-rates can be determined from the
data by Scatchard plot analysis. Competition with an anti-B
lymphocyte stimulator antibody or B lymphocyte stimulator binding
polypeptide can also be determined using radioimmunoassays. In this
case, B lymphocyte stimulator is incubated with a B lymphocyte
stimulator binding polypeptide of the present invention conjugated
to a labeled compound (e.g., with .sup.3H or .sup.125I) in the
presence of increasing amounts of an unlabeled B lymphocyte
stimulator binding polypeptide or anti-B lymphocyte stimulator
antibody.
[0197] In a preferred embodiment, BIAcore kinetic analysis is used
to determine the binding on and off rates of B lymphocyte
stimulator binding polypeptides (including molecules comprising, or
alternatively consisting of, B lymphocyte stimulator binding
polypeptide fragments or variants thereof) to B lymphocyte
stimulator, or fragments of B lymphocyte stimulator. BIAcore
kinetic analysis comprises analyzing the binding and dissociation
of B lymphocyte stimulator from chips with immobilized B lymphocyte
stimulator binding polypeptides on their surface (see Example 6,
infra).
[0198] The B lymphocyte stimulator binding polypeptides (including
molecules comprising, or alternatively consisting of, B lymphocyte
stimulator binding polypeptide fragments or variants thereof) can
also be assayed for their ability to inhibit, increase, or not
significantly alter, the binding of B lymphocyte stimulator to a B
lymphocyte stimulator receptor (e.g., TACI and BCMA) using
techniques known to those skilled in the art. For example, cells
expressing a receptor for B lymphocyte stimulator (e.g., IM9, REH,
ARH-77 cells, Namalwa, and RPMI-8226 B cell tumor lines as well as
peripheral CD20+ B cells) can be contacted with B lymphocyte
stimulator in the presence or absence of a B lymphocyte stimulator
binding polypeptide, and the ability of the B lymphocyte stimulator
binding polypeptide to inhibit, increase, or not significantly
alter, B lymphocyte stimulator binding to the cells can be
measured. Alternatively, the B lymphocyte stimulator binding
polypeptide may be preincubated with the B lymphocyte stimulator
prior to exposure of the B lymphocyte stimulator to cells
expressing the B lymphocyte stimulator receptor. B lymphocyte
stimulator binding to cells can be measured by, for example, flow
cytometry or a scintillation assay. B lymphocyte stimulator or the
B lymphocyte stimulator binding polypeptide can be labeled with a
detectable compound such as a radioactive label (e.g., .sup.32P,
.sup.35S, and .sup.125I) or a fluorescent label (e.g., fluorescein
isothiocyanate, rhodamine, phycoerythrin, phycocyanin,
allophycocyanin, o-phthaldehyde and fluorescamine) to enable
detection of an interaction between B lymphocyte stimulator and a B
lymphocyte stimulator receptor and/or B lymphocyte stimulator and a
B lymphocyte stimulator binding polypeptide.
[0199] The ability of B lymphocyte stimulator binding polypeptides
to inhibit, increase, or not significantly alter, B lymphocyte
stimulator binding to a B lymphocyte stimulator receptor can also
be determined in cell-free assays. For example, native or
recombinant B lymphocyte stimulator (e.g., having the amino acid
sequence of amino acids 134-285 of SEQ ID NO:173) or a fragment
thereof can be contacted with a B lymphocyte stimulator binding
polypeptide and the ability of the B lymphocyte stimulator binding
polypeptide to inhibit, increase, or not significantly alter, B
lymphocyte stimulator from binding to a B lymphocyte stimulator
receptor can be determined. Preferably, the B lymphocyte stimulator
binding polypeptide or B lymphocyte stimulator receptor is
immobilized on a solid support and B lymphocyte stimulator or a B
lymphocyte stimulator fragment is labeled with a detectable
compound. Alternatively, B lymphocyte stimulator or a B lymphocyte
stimulator fragment is immobilized on a solid support and the B
lymphocyte stimulator binding polypeptide is labeled with a
detectable compound. B lymphocyte stimulator may be partially or
completely purified (e.g., partially or completely free of other
polypeptides) or part of a cell lysate. Further, the B lymphocyte
stimulator polypeptide may be a fusion protein comprising B
lymphocyte stimulator or a biologically active portion thereof and
a domain such as an Immunoglobulin Fc or
glutathionine-S-transferase. Additionally, the B lymphocyte
stimulator binding polypeptide and/or B lymphocyte stimulator
receptor may be a fusion protein comprising a B lymphocyte
stimulator binding portion of the polypeptide or receptor and a
domain such as an Immunoglobulin Fc or glutathionine-S-transferase.
For example, amino acid residues 1-154 of TACI (GenBank accession
number AAC51790), or 1-48 of BCMA (GenBank accession number
NP.sub.--001183) may be fused to the Fc region of an IgG molecule
and used in a cell free assay to determine the ability of B
lymphocyte stimulator binding polypeptides to inhibit, increase, or
not significantly alter, B lymphocyte stimulator binding to a B
lymphocyte stimulator receptor. Alternatively, B lymphocyte
stimulator can be biotinylated using techniques well known to those
skilled in the art (e.g., biotinylation kit, Pierce Chemicals;
Rockford, Ill.).
[0200] The B lymphocyte stimulator binding polypeptides (including
molecules comprising, or alternatively consisting of, B lymphocyte
stimulator binding polypeptide fragments or variants thereof), can
also be assayed for their ability to inhibit, stimulate, or not
significantly alter, B lymphocyte stimulator-induced B-cell
proliferation using techniques known to those of skill in the art.
For example, B-cell proliferation can be assayed by
.sup.3H-thymidine incorporation assays and trypan blue cell counts
(see, e.g., Moore et al., Science, 285: 260-263 (1999)). Further,
the B lymphocyte stimulator binding polypeptides, or fragments or
variants thereof, can be assayed for their ability to inhibit,
stimulate, or not significantly alter, B lymphocyte
stimulator-induced activation of cellular signaling molecules and
transcription factors such as calcium-modulator and cyclophilin
ligand (CAML), calcineurin, nuclear factor of activated T cells
transcription factor (NF-AT), nuclear factor-kappa B (NF-kappa B),
SRF, activator protein-1 (AP-1), extracellular-signal regulated
kinase 1 (ERK-1), polo like kinases (PLK), ELF-1, high mobility
group I (HMG-I), and/or high mobility group Y (HMG-Y) using
techniques known to those of skill in the art (see, e.g., von Bulow
and Bram, Science, 278:138-141 (1997)). For example, NF-AT activity
can be determined by electromobility gel shift assays, by detecting
the expression of a protein known to be regulated by NF-AT (e.g.,
IL-2 expression), by detecting the induction of a reporter gene
(e.g., an NF-AT regulatory element operably linked to a nucleic
acid encoding a detectable marker such as luciferase,
beta-galactosidase or chloramphenicol acetyltransferase (CAT)), or
by detecting a cellular response (e.g., cellular differentiation,
or cell proliferation).
[0201] The B lymphocyte stimulator binding polypeptides, or
fragments or variants thereof can also be assayed for their ability
to neutralize, enhance, or not significantly alter, B lymphocyte
stimulator activity. For example, B lymphocyte stimulator binding
polypeptides or fragments or variants thereof, may be routinely
tested for their ability to inhibit B lymphocyte stimulator from
binding to cells expressing the receptor for B lymphocyte
stimulator.
Uses of the Binding Polypeptides and Recombinant Bacteriophage
[0202] The B lymphocyte stimulator binding polypeptides described
herein are especially useful to detect, isolate, or remove B
lymphocyte stimulator target proteins in solutions. Such solutions
may be simple dispersions or solutions of B lymphocyte stimulator
and/or B lymphocyte stimulator-like polypeptide in water or aqueous
buffer or more complex solutions, such as, a blood and other
biological fluids, tissue homogenates cell extracts, or biopsy
samples, and cell culture media containing B lymphocyte stimulator
or B lymphocyte stimulator-like polypeptides. Biological fluids
include, but are not limited to sera, plasma, lymph, blood, blood
fractions urine, synovial fluid, spinal fluid, saliva, and
mucous.
[0203] In one embodiment, the present invention provides a method
for detecting a B lymphocyte stimulator protein and/or a B
lymphocyte stimulator-like polypeptide in a solution comprising
contacting the solution with a B lymphocyte stimulator binding
polypeptide and detecting binding of B lymphocyte stimulator or B
lymphocyte stimulator-like polypeptide to the B lymphocyte
stimulator binding polypeptide. The B lymphocyte stimulator binding
polypeptide may be either free or immobilized. Preferably, the B
lymphocyte stimulator binding polypeptide is a polypeptide
immobilized on a solid surface or chromatographic material or the
well of a plastic microtiter assay dish.
[0204] Another embodiment of the present invention is a method for
isolating B lymphocyte stimulator protein and/or B lymphocyte
stimulator-like polypeptide from a solution containing it,
comprising: [0205] (a) contacting the solution with a B lymphocyte
stimulator binding polypeptide under conditions that permit binding
of B lymphocyte stimulator and/or B lymphocyte stimulator-like
polypeptides to B lymphocyte stimulator binding polypeptide, and
[0206] (b) recovering the B lymphocyte stimulator and/or B
lymphocyte stimulator-like polypeptides.
[0207] A further embodiment of the present invention is a method
for isolating B lymphocyte stimulator protein and/or B lymphocyte
stimulator-like polypeptide from a solution containing it,
comprising: [0208] (a) contacting the solution with a B lymphocyte
stimulator binding polypeptide under conditions that permit binding
of B lymphocyte stimulator and/or B lymphocyte stimulator-like
polypeptides to B lymphocyte stimulator binding polypeptide, and
[0209] (b) separating the complex(es) formed by the B lymphocyte
stimulator binding polypeptide and B lymphocyte stimulator and/or B
lymphocyte stimulator-like polypeptides from other components of
the solution.
[0210] Preferably such method also includes the further steps of:
[0211] (c) dissociating the B lymphocyte stimulator binding
polypeptide from the B lymphocyte stimulator and/or B lymphocyte
stimulator-like polypeptides, and [0212] (d) recovering the
dissociated, B lymphocyte stimulator and/or B lymphocyte
stimulator-like polypeptide.
[0213] The invention also provides for the use of kits containing a
binding polypeptide for use in methods of detecting or isolating B
lymphocyte stimulator and/or B lymphocyte stimulator-like
polypeptides.
[0214] According to the invention, detection or isolation of B
lymphocyte stimulator target proteins comprises contacting a
solution containing a B lymphocyte stimulator target protein with a
B lymphocyte stimulator binding polypeptide. Depending on the
particular application, the B lymphocyte stimulator binding
polypeptide may be free in solution or immobilized on a solid
support or chromatographic material. Sufficient time is allowed to
permit binding between the B lymphocyte stimulator target protein
and the binding polypeptides, and non-binding components in the
solution or mixture are removed or washed away. The formation of a
binding complex between the binding polypeptide and the B
lymphocyte stimulator target protein can then be detected, for
example, by detecting the signal from a label on the binding
polypeptide, which is one component of the binding complex. A label
may be any label that generates a signal that can be detected by
standard methods, such as a fluorescent label, a radioactive
compound, or an enzyme that reacts with a substrate to generate a
detectable signal. Suitable such labels are discussed above. A
phage binding polypeptide according to the invention, that is, a
recombinant phage displaying a B lymphocyte stimulator binding
polypeptide on its surface, may form a complex with B lymphocyte
stimulator and/or B lymphocyte stimulator-like polypeptides that is
detectable as a precipitate or sediment in a reaction tube, which
can be detected visually after settling or centrifugation.
Alternatively, a sandwich-type assay may be used, wherein a B
lymphocyte stimulator binding polypeptide is immobilized on a solid
support such as a plastic tube or well, or a chromatographic
support matrix such as agarose beads, then the solution suspected
of containing the B lymphocyte stimulator target is contacted with
the immobilized binding polypeptide and non-binding materials or
components are removed or washed away.
[0215] The binding polypeptides according to this invention are
particularly useful for detection and/or isolation of B lymphocyte
stimulator and/or B lymphocyte stimulator-like polypeptides by
affinity chromatography methods. Any conventional method of
chromatography may be employed. Preferably, a B lymphocyte
stimulator binding polypeptide will be immobilized on a solid
support suitable, for example, for packing a chromatography column.
The immobilized B lymphocyte stimulator binding polypeptide
affinity ligand can then be loaded or contacted with a feed stream
under conditions favorable to formation of binding polypeptide/B
lymphocyte stimulator (or B lymphocyte stimulator-like polypeptide)
complexes. Non-binding materials can be washed away. Examples of
suitable wash conditions can readily be determined by one of skill
in the art and include but are not limited to [PBS/0.01% Tween 20,
pH7.2] and [1M NaCl/10 mM Tris, pH7.5]. Tris wash buffers may be
preferable since phosphates can precipitate in 50% ethylene glycol.
In general, non-limiting terms, wash buffers are pH7.0, optionally
containing 0.0 to 1.5 M NaCl, more preferably 1M NaCl.
Additionally, wash buffers may optionally contain a mild detergent,
such as, for example, Tween 20, Tween 80, or NP-80. B lymphocyte
stimulator or B lymphocyte stimulator-like polypeptide can be
eluted from the B lymphocyte stimulator binding polypeptide by
introducing solution conditions that favor dissociation of the
binding complex. Suitable elution solutions can readily be
determined by one of skill in the art and include but are not
limited to [50% ethylene glycol/100 mM NaOAc]. By way of
non-limiting example, useful elution buffers, for the purposes of
the present invention contain 40-60% ethylene glycol, preferably
50% ethylene glycol; and 50-100 mM NaOAc with a pH in the range of
pH 4-pH7, more preferably, pH 4-pH 6 and most preferably pH 4.5-pH
5.5. Preferably, a fast flow affinity chromatographic technique is
used to bind the molecules and from which purified B lymphocyte
stimulator or B lymphocyte stimulator-like polypeptides are
eluted.
[0216] Alternatively, batch chromatography can be carried out by
mixing a solution containing the B lymphocyte stimulator target and
the B lymphocyte stimulator binding polypeptide, then isolating
complexes of the B lymphocyte stimulator target and the binding
polypeptides. For this type of separation, many methods are known.
For example, the binding polypeptide may be immobilized on a solid
support such as beads, then separated from the feed stream along
with the B lymphocyte stimulator target by filtration. In another
example, the B lymphocyte stimulator binding polypeptide may be
modified with its own affinity tag, such as a polyHis tail or
streptavidin binding region, which can be used to isolate the
binding polypeptide after complexes have formed using an
immobilized metal affinity chromatographic resin or
streptavidin-coated substrate. Once separated, the B lymphocyte
stimulator target can be released from the binding polypeptide
under elution conditions and recovered in a purified form.
[0217] Methods of producing B lymphocyte stimulator or a B
lymphocyte stimulator-like polypeptides usually yield B lymphocyte
stimulator or B lymphocyte stimulator-like polypeptides in a feed
stream that additionally contains impurities (with respect to the B
lymphocyte stimulator target). One purpose of the present invention
is to produce B lymphocyte stimulator binding polypeptides and
preparations (such as affinity chromatography media or surfaces)
comprising B lymphocyte stimulator binding polypeptides that allow
rapid and highly specific purification of B lymphocyte stimulator
target proteins from a feed stream. B lymphocyte stimulator binding
polypeptides obtained herein may easily be tailored to isolate B
lymphocyte stimulator target protein from a particular feed stream,
using or routinely modifying conditions and techniques known in the
art. If an alternate production method for B lymphocyte stimulator
is used, producing a different feed stream, a different set of B
lymphocyte stimulator binding polypeptides and/or conditions may be
necessary to achieve the same level of purification. The new set of
B lymphocyte stimulator binding polypeptides and/or conditions can
be readily obtained following or modifying procedures outlined
herein, or otherwise known in the art.
Use of B lymphocyte stimulator Binding Polypeptides for Epitope
Mapping
[0218] The present invention provides B lymphocyte stimulator
binding polypeptides (including molecules comprising, or
alternatively consisting of, B lymphocyte stimulator binding
polypeptide fragments or variants thereof), that can be used to
identify epitopes of B lymphocyte stimulator. In particular, the B
lymphocyte stimulator binding polypeptides of the present invention
can be used to identify epitopes of human B lymphocyte stimulator
(SEQ ID NOs:173 and/or 174) or B lymphocyte stimulator expressed on
human monocytes; murine B lymphocyte stimulator (SEQ ID NOs:175
and/or 176) or B lymphocyte stimulator expressed on murine
monocytes; rat B lymphocyte stimulator (either the soluble forms as
given in SEQ ID NOs:177, 178, 179 and/or 180 or in a membrane
associated form, e.g., on the surface of rat monocytes); or monkey
B lymphocyte stimulator (e.g., the monkey B lymphocyte stimulator
polypeptides of SEQ ID NOS:181 and/or 182, the soluble form of
monkey B lymphocyte stimulator, or B lymphocyte stimulator
expressed on monkey monocytes) using techniques described herein or
otherwise known in the art. Fragments which function as epitopes
may be produced by any conventional means. (See, e.g., Houghten,
Proc. Natl. Acad. Sci. USA, 82:5131-5135 (1985), further described
in U.S. Pat. No. 4,631,211.)
Diagnostic Uses of B Lymphocyte Stimulator Binding Polypeptides
[0219] Labeled and non-labelled B lymphocyte stimulator binding
polypeptides (including molecules comprising, or alternatively
consisting of, B lymphocyte stimulator binding polypeptide
fragments or variants thereof) which specifically bind to B
lymphocyte stimulator can be used for diagnostic purposes to
detect, diagnose, prognose, or monitor diseases and/or disorders
associated with the aberrant expression and/or activity of B
lymphocyte stimulator or B lymphocyte stimulator receptor. The
invention provides for the detection of aberrant expression of B
lymphocyte stimulator comprising: (a) assaying the expression of B
lymphocyte stimulator in a biological sample from an individual
using one or more B lymphocyte stimulator binding polypeptides that
specifically binds to B lymphocyte stimulator; and (b) comparing
the level of B lymphocyte stimulator with a standard level of B
lymphocyte stimulator, e.g., in normal biological samples, whereby
an increase or decrease in the assayed level of B lymphocyte
stimulator compared to the standard level of B lymphocyte
stimulator is indicative of aberrant expression.
[0220] By "biological sample" is intended any fluids and/or cells
obtained from an individual, body fluid, body tissue, body cell,
cell line, tissue culture, or other source which may contain B
lymphocyte stimulator protein or mRNA. Body fluids include, but are
not limited to, sera, plasma, urine, synovial fluid, spinal fluid,
saliva, and mucous. Tissues samples may be taken from virtually any
tissue in the body. Tissue samples may also be obtained from
autopsy material. Methods for obtaining tissue biopsies and body
fluids from mammals are well known in the art. Where the biological
sample is to include mRNA, a tissue biopsy is the preferred
source.
[0221] The invention also provides for the detection of aberrant
expression of B lymphocyte stimulator receptor comprising (a)
assaying the expression of B lymphocyte stimulator receptor in a
biological sample from an individual using one or more B lymphocyte
stimulator binding polypeptides or fragments or variants thereof
that specifically binds only to soluble B lymphocyte stimulator,
but does not inhibit B lymphocyte stimulator/B lymphocyte
stimulator receptor binding. Such a B lymphocyte stimulator binding
polypeptide, by way of an example that is not to be construed as
limiting, would be one that is able to capture a biotinylated B
lymphocyte stimulator from solution, but that would not prevent B
lymphocyte stimulator from binding to it receptor expressed, for
example on IM-9 cells, and (b) comparing the level of B lymphocyte
stimulator receptor with a standard level of B lymphocyte
stimulator receptor, e.g., in normal tissue or cell samples,
whereby an increase or decrease in the assayed level of B
lymphocyte stimulator receptor compared to the standard level of B
lymphocyte stimulator receptor is indicative of aberrant
expression.
[0222] B lymphocyte stimulator binding polypeptides (including
molecules comprising, or alternatively consisting of, B lymphocyte
stimulator binding polypeptide fragments or variants thereof) which
specifically bind to B lymphocyte stimulator can be used for
diagnostic purposes to detect, diagnose, prognose, or monitor
immune system diseases and disorders, including but not limited to
autoimmune diseases and disorders and/or immunodeficiencies, and/or
diseases, disorders, or conditions associated therewith. The
invention provides for the detection of aberrant expression of B
lymphocyte stimulator comprising: (a) assaying the expression of B
lymphocyte stimulator in a biological sample from an individual
using one or more B lymphocyte stimulator binding polypeptides that
specifically binds to B lymphocyte stimulator; and (b) comparing
the level of B lymphocyte stimulator with a standard level of B
lymphocyte stimulator, e.g., in normal biological samples, whereby
an increase or decrease in the assayed level of B lymphocyte
stimulator compared to the standard level of B lymphocyte
stimulator is indicative of an autoimmune disorder or disease
and/or an immunodeficiency. In specific embodiments, an increase in
the assayed level of B lymphocyte stimulator is indicative of an
autoimmune disorder or disease. In other specific embodiments, a
decrease in the assayed level of B lymphocyte stimulator is
indicative of an immunodeficiency.
[0223] B lymphocyte stimulator binding polypeptides (including
molecules comprising, or alternatively consisting of, B lymphocyte
stimulator binding polypeptide fragments or variants thereof) which
specifically bind to B lymphocyte stimulator but do not inhibit B
lymphocyte stimulator/B lymphocyte stimulator receptor binding can
be used for diagnostic purposes to detect, diagnose, prognose, or
monitor immune system diseases and disorders, including but not
limited to autoimmune diseases and disorders and/or
immunodeficiencies, and/or diseases, disorders, or conditions
associated therewith. The invention provides for the detection of
aberrant expression of B lymphocyte stimulator receptor comprising:
(a) assaying the expression of B lymphocyte stimulator receptor in
a biological sample from an individual using one or more B
lymphocyte stimulator binding polypeptides that specifically binds
to B lymphocyte stimulator; and (b) comparing the level of B
lymphocyte stimulator receptor with a standard level of B
lymphocyte stimulator receptor, e.g., in normal biological samples,
whereby an increase or decrease in the assayed level of B
lymphocyte stimulator receptor compared to the standard level of B
lymphocyte stimulator receptor is indicative of an autoimmune
disorder or disease and/or an immunodeficiency. In specific
embodiments, an increase in the assayed level of B lymphocyte
stimulator receptor is indicative of an autoimmune disorder or
disease. In other specific embodiments, a decrease in the assayed
level of B lymphocyte stimulator receptor is indicative of an
immunodeficiency.
[0224] Autoimmune disorders, diseases, or conditions that may be
detected, diagnosed, prognosed, or monitored using the B lymphocyte
stimulator binding polypeptides include, but are not limited to,
autoimmune hemolytic anemia, autoimmune neonatal thrombocytopenia,
idiopathic thrombocytopenia purpura, autoimmune neutropenia,
autoimmunocytopenia, hemolytic anemia, antiphospholipid syndrome,
dermatitis, gluten-sensitive enteropathy, allergic
encephalomyelitis, myocarditis, relapsing polychondritis, rheumatic
heart disease, glomerulonephritis (e.g., IgA nephropathy), multiple
sclerosis, neuritis, uveitis ophthalmia, polyendocrinopathies,
purpura (e.g., Henloch-Scoenlein purpura), Reiter's Disease,
Stiff-Man Syndrome, autoimmune pulmonary inflammation, myocarditis,
IgA glomerulonephritis, dense deposit disease, rheumatic heart
disease, Guillain-Barre Syndrome, insulin dependent diabetes
mellitis, and autoimmune inflammatory eye, autoimmune thyroiditis,
hypothyroidism (i.e., Hashimoto's thyroiditis), systemic lupus
erhythematosus, discoid lupus, Goodpasture's syndrome, Pemphigus,
receptor autoimmunities such as, for example, (a) Graves' Disease,
(b) Myasthenia Gravis, and (c) insulin resistance, autoimmune
hemolytic anemia, autoimmune thrombocytopenic purpura, rheumatoid
arthritis, schleroderma with anti-collagen B lymphocyte stimulator
binding polypeptides, mixed connective tissue disease,
polymyositis/dermatomyositis, pernicious anemia, idiopathic
Addison's disease, infertility, glomerular nephritis such as
primary glomerular nephritis and IgA nephropathy, bullous
pemphigoid, Sjogren's syndrome, diabetes millitus, and adrenergic
drug resistance (including adrenergic drug resistance with asthma
or cystic fibrosis), chronic active hepatitis, primary biliary
cirrhosis, other endocrine gland failure, vitiligo, vasculitis,
post-MI, cardiotomy syndrome, urticaria, atopic dermatitis, asthma,
inflammatory myopathies, and other inflammatory, granulamatous,
degenerative, and atrophic disorders.
[0225] In specific embodiments, the present invention encompasses
methods and compositions for detecting, diagnosing, prognosing,
and/or monitoring diseases or disorders associated with
hypergammaglobulinemia (e.g., AIDS, autoimmune diseases, and some
immunodeficiencies). In other specific embodiments, the present
invention encompasses methods and compositions for detecting,
diagnosing, prognosing, and/or monitoring diseases or disorders
associated with hypogammaglobulinemia (e.g., an
immunodeficiency).
[0226] Immunodeficiencies that may be detected, diagnosed,
prognosed, or monitored using the B lymphocyte stimulator binding
polypeptides include, but are not limited to, severe combined
immunodeficiency (SCID)-X linked, SCID-autosomal, adenosine
deaminase deficiency (ADA deficiency), X-linked agammaglobulinemia
(XLA), Bruton's disease, congenital agammaglobulinemia, X-linked
infantile agammaglobulinemia, acquired agammaglobulinemia, adult
onset agammaglobulinemia, late-onset agammaglobulinemia,
dysgammaglobulinemia, hypogammaglobulinemia, transient
hypogammaglobulinemia of infancy, unspecified
hypogammaglobulinemia, agammaglobulinemia, common variable
immunodeficiency (CVID) (acquired), Wiskott-Aldrich Syndrome (WAS),
X-linked immunodeficiency with hyper IgM, non X-linked
immunodeficiency with hyper IgM, selective IgA deficiency, IgG
subclass deficiency (with or without IgA deficiency), antibody
deficiency with normal or elevated Igs, immunodeficiency with
thymoma, Ig heavy chain deletions, kappa chain deficiency, B cell
lymphoproliferative disorder (BLPD), selective IgM
immunodeficiency, recessive agammaglobulinemia (Swiss type),
reticular dysgenesis, neonatal neutropenia, severe congenital
leukopenia, thymic alymphoplasia-aplasia or dysplasia with
immunodeficiency, ataxia-telangiectasia, short limbed dwarfism,
X-linked lymphoproliferative syndrome (XLP), Nezelof
syndrome-combined immunodeficiency with Igs, purine nucleoside
phosphorylase deficiency (PNP), MHC Class II deficiency (Bare
Lymphocyte Syndrome) and severe combined immunodeficiency.
[0227] Elevated levels of soluble B lymphocyte stimulator have been
observed in the serum of patients with Systemic Lupus Erythematosus
(SLE). In comparing the sera of 150 SLE patients with that of 38
control individuals, it was found that most of the SLE patients had
more than 5 ng/ml of serum B lymphocyte stimulator, more than 30%
of SLE patients had levels greater than 10 ng/ml, and approximately
10% of SLE patients had serum B lymphocyte stimulator levels
greater than 20 ng/ml. In contrast, the majority of normal controls
had B lymphocyte stimulator levels less than 5 ng/ml, and less than
10% had levels higher than 10 ng/ml. The elevated levels of B
lymphocyte stimulator protein in sera is present in the soluble
form and has biologic activity as assayed by the ability to
stimulate anti-IgM treated B cells in vitro. SLE patients with more
than 15 ng/ml serum B lymphocyte stimulator were also found to have
elevated levels of anti-dsDNA antibodies compared to both normal
controls and SLE patients with less than 5 ng/ml of serum B
lymphocyte stimulator (unpublished data).
[0228] In addition the serum of two subgroups of patients which
were positive for anti-nuclear antibodies (ANA+) but did not meet
the formal requirements of the American College of Rheumatology
(ACR) for classification of SLE were analyzed for B lymphocyte
stimulator levels. The first subgroup of sera was ANA+ sera that
came from patients who did not present with the clinical impression
of SLE. This group had only slightly elevated levels of B
lymphocyte stimulator (.about.9 ng/ml B lymphocyte stimulator). The
second subgroup, however, which was ANA+ sera from patients who
presented with the clinical impression of SLE, had significantly
increased B lymphocyte stimulator levels (.about.15 ng/ml). These
results suggest that an elevated level of B lymphocyte stimulator
precedes the formal fulfillment of the ACR criteria. The ACR
criteria are described in Tan et al., Arthritis and Rheumatism,
25:1271-1277 (1982).
[0229] Thus, in specific embodiments, B lymphocyte stimulator
binding polypeptides which specifically bind to B lymphocyte
stimulator can be used for diagnostic purposes to detect, diagnose,
prognose, or monitor Systemic Lupus Erythematosus or conditions
associated therewith. The invention provides for the detection of
aberrant expression of B lymphocyte stimulator comprising: (a)
assaying the expression of B lymphocyte stimulator in a biological
sample (e.g., serum, synovial fluid) of an individual using one or
more B lymphocyte stimulator binding polypeptides that specifically
binds to B lymphocyte stimulator; and (b) comparing the level of B
lymphocyte stimulator with a standard level of B lymphocyte
stimulator, e.g., in normal biological samples, whereby an increase
in the assayed level of B lymphocyte stimulator compared to the
standard level of B lymphocyte stimulator is indicative of SLE.
[0230] In additional embodiments, B lymphocyte stimulator binding
polypeptides which specifically bind to B lymphocyte stimulator can
be used for diagnostic purposes to detect, diagnose, prognose, or
monitor Rheumatoid Arthritis. The invention provides for the
detection of aberrant expression of B lymphocyte stimulator
comprising: (a) assaying the expression of B lymphocyte stimulator
in a biological sample (e.g., serum, synovial fluid) of an
individual using one or more B lymphocyte stimulator binding
polypeptides that specifically binds to B lymphocyte stimulator;
and (b) comparing the level of B lymphocyte stimulator with a
standard level of B lymphocyte stimulator, e.g., in normal
biological samples, whereby an increase in the assayed level of B
lymphocyte stimulator compared to the standard level of B
lymphocyte stimulator is indicative of Rheumatoid Arthritis.
[0231] In specific embodiments, the present invention encompasses
methods and compositions for detecting, diagnosing and/or
prognosing diseases or disorders of cells of hematopoietic origin.
Cells of hematopoietic origin include, but are not limited to,
lymphocytes (e.g., B cells and T cells), monocytes, macrophages,
dendritic cells, polymorphonuclear leukocytes (e.g., basophils,
eosinophils, neutrophils), mast cells, platelets, erythrocytes and
progenitor cells of these lineages. Cells of hematopoietic origin
include, but are not limited to, healthy and diseased cell as found
present in an animal, preferably a mammal and most preferably a
human, or as isolated from an animal, transformed cells, cell lines
derived from the above listed cell types, and cell cultures derived
from the above listed cell types. Cells of hematopoietic origin may
be found or isolated in, for example, resting, activated or anergic
states.
[0232] In specific embodiments, the present invention encompasses
methods and compositions for detecting, diagnosing, prognosing and
or monitoring growth, progression, and/or metastases of
malignancies and proliferative diseases or disorders associated
with increased cell survival, or the inhibition of apoptosis. For a
review of such disorders, see Fishman et al., Medicine, 2d Ed. (J.
B. Lippincott Co., Philadelphia 1985). An extensive list of
examples of proliferative diseases and disorders is presented below
in the section of this application entitled "Therapeutic Uses of B
lymphocyte stimulator Binding Polypeptides." Proliferative diseases
and disorders is also extended to include premalignant conditions
(e.g., benign tumors, hyperproliferative disorders, and benign
proliferative disorders--see below) as well as proliferative
disorders of B cells, monocytes, macrophages, and T cells. Other
abnormal growth conditions that may be treated, diagnosed,
prognosed or monitored include, but are not limited to,
hyperplasia, metaplasia, or most particularly, dysplasia has
occurred (for review of such abnormal growth conditions, see
Robbins and Angell, Basic Pathology, 2d Ed. (W.B. Saunders Co.,
Philadelphia 1976), pp. 68-79.) Hyperplasia is a form of controlled
cell proliferation involving an increase in cell number in a tissue
or organ, without significant alteration in structure or function.
As but one example, endometrial hyperplasia often precedes
endometrial cancer. Metaplasia is a form of controlled cell growth
in which one type of adult or fully differentiated cell substitutes
for another type of adult cell. Metaplasia can occur in epithelial
or connective tissue cells. Atypical metaplasia involves a somewhat
disorderly metaplastic epithelium. Dysplasia is frequently a
forerunner of cancer, and is found mainly in the epithelia; it is
the most disorderly form of non-neoplastic cell growth, involving a
loss in individual cell uniformity and in the architectural
orientation of cells. Dysplastic cells often have abnormally large,
deeply stained nuclei, and exhibit pleomorphism. Dysplasia
characteristically occurs where there exists chronic irritation or
inflammation, and is often found in the cervix, respiratory
passages, oral cavity, and gall bladder.
[0233] In preferred embodiments, the present invention encompasses
methods and compositions for detecting, diagnosing, prognosing and
or monitoring growth, progression, and/or metastases of
malignancies and proliferative diseases or disorders of monocytic
cells.
[0234] In specific embodiments, the present invention encompasses
methods and compositions for detecting, diagnosing, prognosing and
or monitoring growth, progression, and/or metastases of
malignancies and proliferative diseases or disorders of B
cells.
[0235] The invention provides a diagnostic assay for diagnosing or
prognosing a disease or disorder, comprising: (a) assaying for the
level of B lymphocyte stimulator in a biological sample of an
individual using one or more B lymphocyte stimulator binding
polypeptides that specifically bind to B lymphocyte stimulator; and
(b) comparing the level of B lymphocyte stimulator with a standard
B lymphocyte stimulator level, e.g., in a biological sample from a
patient without the disease or disorder, whereby an increase or
decrease in the assayed B lymphocyte stimulator level compared to
the standard level of B lymphocyte stimulator is indicative of a
particular disease or disorder. With respect to cancer, the
presence of a relatively high amount of B lymphocyte stimulator in
biopsied tissue from an individual may indicate a predisposition
for the development of the disease, or may provide a means for
detecting the disease prior to the appearance of actual clinical
symptoms. A more definitive diagnosis of this type may allow health
professionals to employ preventative measures or aggressive
treatment earlier thereby preventing the development or further
progression of the cancer.
[0236] In specific embodiments, the presence of a relatively high
amount of membrane-bound B lymphocyte stimulator in a biological
sample is indicative of monocytic cell related leukemias or
lymphomas, such as, for example acute myelogenous leukemia, and/or
the severity thereof.
[0237] In other specific embodiments, the presence of a relatively
high amount of B lymphocyte stimulator receptor in a biological
sample (as determined using B lymphocyte stimulator binding
polypeptides that bind to soluble B lymphocyte stimulator, but do
not inhibit B lymphocyte stimulator/B lymphocyte stimulator
receptor binding) is indicative of B cell related leukemias or
lymphomas (e.g., chronic lymphocytic leukemia, multiple myeloma,
non-Hodgkin's lymphoma, and Hodgkin's disease), and/or the severity
thereof.
[0238] B lymphocyte stimulator binding polypeptides (including
molecules comprising, or alternatively consisting of, B lymphocyte
stimulator binding polypeptide fragments or variants thereof) can
be used to assay protein levels in a biological sample using
classical immunohistological methods as described herein or as
known to those of skill in the art (e.g., see Jalkanen et al., J.
Cell. Biol., 101:976-985 (1985); Jalkanen et al., J. Cell. Biol.,
105:3087-3096 (1987)). Other methods that can be used for detecting
protein gene expression that might utilize B lymphocyte stimulator
binding polypeptides or fragments or variants thereof include, but
are not limited to, the enzyme linked immunosorbent assay (ELISA)
and the radioimmunoassay (RIA). Suitable antibody assay labels are
known in the art and include enzyme labels, such as, glucose
oxidase, alkaline phophatase, and horseradish peroxidase;
radioisotopes, such as iodine (.sup.121I, .sup.123I, .sup.125I,
.sup.131I), carbon (.sup.14C), sulfur (.sup.35S), tritium
(.sup.3H), indium (.sup.111In, .sup.112In, .sup.113mIn,
.sup.115mIn), technetium (.sup.99Tc, .sup.99mTc), thallium
(.sup.201Ti), gallium (.sup.68Ga, .sup.67Ga), palladium
(.sup.103Pd), molybdenum (.sup.99Mo), xenon (.sup.133Xe), fluorine
(.sup.18F), .sup.15f3Sm, .sup.177Lu, .sup.159Gd, .sup.149Pm,
.sup.140La, .sup.175Yb, .sup.166Ho, .sup.90Y, .sup.47Sc,
.sup.186Re, .sup.188Re, .sup.142Pr, .sup.105Rh, and .sup.97Ru;
luminescent labels, such as luminol; and fluorescent labels, such
as fluorescein and rhodamine, and biotin.
[0239] Certain embodiments of the invention are directed to the
detection and diagnosis of a disease or disorder associated with
aberrant expression of B lymphocyte stimulator or B lymphocyte
stimulator receptor in an animal, preferably a mammal and most
preferably a human. In one embodiment, diagnosis comprises: (a)
administering (for example, parenterally, subcutaneously, or
intraperitoneally) to a subject an effective amount of a labeled B
lymphocyte stimulator binding polypeptide (including molecules
comprising, or alternatively consisting of, B lymphocyte stimulator
binding polypeptide fragments or variants thereof) that
specifically binds to B lymphocyte stimulator; (b) waiting for a
time interval following the administering for permitting the
labeled B lymphocyte stimulator binding polypeptide to
preferentially concentrate at sites in the subject where B
lymphocyte stimulator is expressed (and for unbound labeled
molecule to be cleared to background level); (c) determining
background level; and (d) detecting the labeled B lymphocyte
stimulator binding polypeptide in the subject, such that detection
of labeled B lymphocyte stimulator binding polypeptide or fragment
thereof above the background level and above or below the level
observed in a person without the disease or disorder indicates that
the subject has a particular disease or disorder associated with
aberrant expression of B lymphocyte stimulator or B lymphocyte
stimulator receptor. Background level can be determined by various
methods, including comparing the amount of labeled molecule
detected to a standard value previously determined for a particular
system.
[0240] It will be understood by those skilled in the art that the
size of the subject and the imaging system used will determine the
quantity of imaging moiety needed to produce diagnostic images. In
the case of a radioisotope moiety, for a human subject, the
quantity of radioactivity injected will normally range from about 5
to 20 millicuries of .sup.99Tc. The labeled B lymphocyte stimulator
binding polypeptide will then preferentially accumulate at the
location of cells which contain the specific protein. In vivo tumor
imaging is described in Burchiel et al., "Immunopharmacokinetics of
Radiolabeled Antibodies and Their Fragments," Chapter 13 in Tumor
Imaging: The Radiochemical Detection of Cancer, S. W. Burchiel and
B. A. Rhodes, eds., Masson Publishing Inc. (1982).
[0241] Depending on several variables, including the type of label
used and the mode of administration, the time interval following
the administration for permitting the labeled molecule to
preferentially concentrate at sites in the subject and for unbound
labeled molecule to be cleared to background level is 6 to 48 hours
or 6 to 24 hours or 6 to 12 hours. In another embodiment the time
interval following administration is 5 to 20 days or 5 to 10
days.
[0242] In an embodiment for monitoring of the disease or disorder,
the method is carried out by repeating the method for diagnosing
the disease or disorder, for example, one month after initial
diagnosis, six months after initial diagnosis, one year after
initial diagnosis, etc. and comparing the results of the successive
tests.
[0243] Presence of the labeled molecule can be detected in the
patient using methods known in the art for in vivo scanning. These
methods depend upon the type of label used. Skilled artisans will
be able to determine the appropriate method for detecting a
particular label. Methods and devices that may be used in the
diagnostic methods of the invention include, but are not limited
to, computed tomography (CT), whole body scan such as position
emission tomography (PET), magnetic resonance imaging (MRI), and
sonography.
[0244] In a specific embodiment, the molecule is labeled with a
radioisotope and is detected in the patient using a radiation
responsive surgical instrument (see, e.g., Thurston et al., U.S.
Pat. No. 5,441,050). In another embodiment, the molecule is labeled
with a fluorescent compound and is detected in the patient using a
fluorescence responsive scanning instrument. In another embodiment,
the molecule is labeled with a positron emitting metal and is
detected in the patient using positron emission-tomography. In yet
another embodiment, the molecule is labeled with a paramagnetic
label and is detected in a patient using magnetic resonance imaging
(MRI).
Immunophenotyping Using B Lymphocyte Stimulator Binding
Polypeptides
[0245] The B lymphocyte stimulator binding polypeptides (including
molecules comprising, or alternatively consisting of, B lymphocyte
stimulator binding polypeptide fragments or variants thereof) may
be utilized for immunophenotyping of cell lines and biological
samples by their B lymphocyte stimulator expression or B lymphocyte
stimulator receptor expression. Various techniques can be employed
utilizing B lymphocyte stimulator binding polypeptides, fragments,
or variants to screen for cellular populations (i.e., immune cells,
particularly monocytic cells or B-cells) expressing B lymphocyte
stimulator or B lymphocyte stimulator receptor. Such techniques
include magnetic separation using B lymphocyte stimulator binding
polypeptide-coated magnetic beads, "panning" with B lymphocyte
stimulator binding polypeptide attached to a solid matrix (i.e.,
plate), and flow cytometry (see, e.g., U.S. Pat. No. 5,985,660; and
Morrison et al., Cell, 96:737-49 (1999)).
[0246] These techniques allow for the screening of particular
populations of cells, such as might be found with hematological
malignancies (i.e., minimal residual disease (MRD) in acute
leukemic patients) and "non-self" cells in transplantations to
prevent Graft-versus-Host Disease (GVHD). Alternatively, these
techniques allow for the screening of hematopoietic stem and
progenitor cells capable of undergoing proliferation and/or
differentiation, as might be found in human umbilical cord
blood.
[0247] In one embodiment, B lymphocyte stimulator binding
polypeptides (including molecules comprising, or alternatively
consisting of, B lymphocyte stimulator binding polypeptide
fragments or variants thereof) are used to identify cells of
monocytic or B cell origin.
Therapeutic Uses of B Lymphocyte Stimulator Binding
Polypeptides
[0248] The present invention is further directed to B lymphocyte
stimulator binding polypeptide-based therapies which involve
administering B lymphocyte stimulator binding polypeptides
(including molecules comprising, or alternatively consisting of, B
lymphocyte stimulator binding polypeptide fragments or variants
thereof) to an animal, preferably a mammal, and most preferably a
human, patient for treating one or more of the disclosed diseases,
disorders, or conditions. Therapeutic compounds of the invention
include, but are not limited to, B lymphocyte stimulator binding
polypeptides and nucleic acids encoding B lymphocyte stimulator
binding polypeptides and antibodies that bind B lymphocyte
stimulator binding polypeptides as described herein. The B
lymphocyte stimulator binding polypeptides can be used to treat,
ameliorate or prevent diseases, disorders or conditions associated
with aberrant expression and/or activity of B lymphocyte stimulator
or B lymphocyte stimulator receptor, including, but not limited to,
any one or more of the diseases, disorders, or conditions described
herein. The treatment and/or prevention of diseases, disorders, or
conditions associated with aberrant B lymphocyte stimulator
expression and/or activity or aberrant B lymphocyte stimulator
receptor expression and/or activity includes, but is not limited
to, alleviating symptoms associated with those diseases, disorders
or conditions. B lymphocyte stimulator binding polypeptides may be
provided in pharmaceutically acceptable compositions as known in
the art or as described herein.
[0249] B lymphocyte stimulator binding polypeptides of the present
invention (including molecules comprising, or alternatively
consisting of, B lymphocyte stimulator binding polypeptide
fragments or variants thereof) that function as agonists or
antagonists of B lymphocyte stimulator, preferably of B lymphocyte
stimulator-induced signal transduction, can be administered to an
animal to treat, prevent or ameliorate a disease or disorder
associated with aberrant B lymphocyte stimulator expression, lack
of B lymphocyte stimulator function, aberrant B lymphocyte
stimulator receptor expression, or lack of B lymphocyte stimulator
receptor function. For example, B lymphocyte stimulator binding
polypeptides which disrupt the interaction between B lymphocyte
stimulator and one or more of its receptors may be administered to
an animal to treat, prevent or ameliorate a disease or disorder
associated with aberrant B lymphocyte stimulator expression,
excessive B lymphocyte stimulator function, aberrant B lymphocyte
stimulator receptor expression, or excessive B lymphocyte
stimulator receptor function. B lymphocyte stimulator binding
polypeptides which do not prevent B lymphocyte stimulator from
binding its receptor but inhibit or downregulate B lymphocyte
stimulator-induced signal transduction can be administered to an
animal to treat, prevent or ameliorate a disease or disorder
associated with aberrant B lymphocyte stimulator expression,
excessive B lymphocyte stimulator function, aberrant B lymphocyte
stimulator receptor expression, or excessive B lymphocyte
stimulator receptor function. In particular, B lymphocyte
stimulator binding polypeptides of the present invention which
prevent B lymphocyte stimulator-induced signal transduction by
specifically recognizing the unbound B lymphocyte stimulator,
receptor-bound B lymphocyte stimulator, or both unbound and
receptor-bound B lymphocyte stimulator can be administered to an
animal to treat, prevent or ameliorate a disease or disorder
associated with aberrant B lymphocyte stimulator expression,
excessive B lymphocyte stimulator function, aberrant B lymphocyte
stimulator receptor expression, or excessive B lymphocyte
stimulator receptor function.
[0250] The ability of a B lymphocyte stimulator binding polypeptide
to inhibit or downregulate B lymphocyte stimulator-induced signal
transduction may be determined by techniques described herein or
otherwise known in the art. For example, B lymphocyte
stimulator-induced receptor activation and the activation of
signaling molecules can be determined by detecting the
phosphorylation (e.g., tyrosine or serine/threonine) of the
receptor or a signaling molecule by immunoprecipitation followed by
western blot analysis (for example, as described herein).
[0251] In a specific embodiment, a B lymphocyte stimulator binding
polypeptide of the present invention (including molecules
comprising, or alternatively consisting of, B lymphocyte stimulator
binding polypeptide fragments or variants thereof) that inhibits or
reduces B lymphocyte stimulator activity by at least 95%, at least
90%, at least 85%, at least 80%, at least 75%, at least 70%, at
least 60%, at least 50%, at least 45%, at least 40%, at least 45%,
at least 35%, at least 30%, at least 25%, at least 20%, or at least
10% relative to B lymphocyte stimulator activity in the absence of
the B lymphocyte stimulator binding polypeptide, is administered to
an animal to treat, prevent or ameliorate a disease or disorder
associated with aberrant B lymphocyte stimulator expression,
excessive B lymphocyte stimulator function, aberrant B lymphocyte
stimulator receptor expression, or excessive B lymphocyte
stimulator receptor function. In another embodiment, a combination
of B lymphocyte stimulator binding polypeptides, a combination of B
lymphocyte stimulator binding polypeptide fragments, a combination
of B lymphocyte stimulator binding polypeptide variants, or a
combination of B lymphocyte stimulator binding polypeptides, B
lymphocyte stimulator binding polypeptide fragments, and/or
variants that inhibit or reduce B lymphocyte stimulator activity by
at least 95%, at least 90%, at least 85%, at least 80%, at least
75%, at least 70%, at least 65%, at least 60%, at least 55%, at
least 50%, at least 45%, at least 40%, at least 45%, at least 35%,
at least 30%, at least 25%, at least 20%, or at least 10% relative
to B lymphocyte stimulator activity in absence of said B lymphocyte
stimulator binding polypeptides, B lymphocyte stimulator binding
polypeptide fragments, and/or B lymphocyte stimulator binding
polypeptide variants are administered to an animal to treat,
prevent or ameliorate a disease or disorder associated with
aberrant B lymphocyte stimulator expression, excessive B lymphocyte
stimulator function, aberrant B lymphocyte stimulator receptor
expression, or excessive B lymphocyte stimulator receptor
function.
[0252] Further, B lymphocyte stimulator binding polypeptides of the
present invention (including molecules comprising, or alternatively
consisting of, B lymphocyte stimulator binding polypeptide
fragments or variants thereof) which activate B lymphocyte
stimulator-induced signal transduction can be administered to an
animal to treat, prevent or ameliorate a disease or disorder
associated with aberrant B lymphocyte stimulator expression, lack
of B lymphocyte stimulator function, aberrant B lymphocyte
stimulator receptor expression, or lack of B lymphocyte stimulator
receptor function. These B lymphocyte stimulator binding
polypeptides may potentiate or activate either all or a subset of
the biological activities of B lymphocyte stimulator-mediated
receptor activation, for example, by inducing multimerization of B
lymphocyte stimulator and/or multimerization of the receptor. The B
lymphocyte stimulator binding polypeptides may be administered with
or without being pre-complexed with B lymphocyte stimulator. In a
specific embodiment, a B lymphocyte stimulator binding polypeptide
of the present invention that increases B lymphocyte stimulator
activity by at least 5%, at least 10%, at least 15%, at least 20%,
at least 25%, at least 30%, at least 35%, at least 40%, at least
45%, at least 50%, at least 55%, at least 60%, at least 65%, at
least 70%, at least 75%, at least 80%, at least 85%, at least 90%,
at least 95%, at least 99%, or 100% or more relative to B
lymphocyte stimulator activity in absence of the B lymphocyte
stimulator binding polypeptide is administered to an animal to
treat, prevent or ameliorate a disease or disorder associated with
aberrant B lymphocyte stimulator expression, lack of B lymphocyte
stimulator function, aberrant B lymphocyte stimulator receptor
expression, or lack of B lymphocyte stimulator receptor function.
In another embodiment, a combination of B lymphocyte stimulator
binding polypeptides, a combination of B lymphocyte stimulator
binding polypeptide fragments, a combination of B lymphocyte
stimulator binding polypeptide variants, or a combination of B
lymphocyte stimulator binding polypeptides, B lymphocyte stimulator
binding polypeptide fragments and/or B lymphocyte stimulator
binding polypeptide variants that increase B lymphocyte stimulator
activity by at least 5%, at least 10%, at least 15%, at least 20%,
at least 25%, at least 30%, at least 35%, at least 40%, at least
45%, at least 50%, at least 55%, at least 60%, at least 65%, at
least 70%, at least 75%, at least 80%, at least 85%, at least 90%,
at least 95%, at least 99%, or 100% or more relative to B
lymphocyte stimulator activity in absence of the said B lymphocyte
stimulator binding polypeptides or B lymphocyte stimulator binding
polypeptide fragments and/or B lymphocyte stimulator binding
polypeptide variants is administered to an animal to treat, prevent
or ameliorate a disease or disorder associated with aberrant B
lymphocyte stimulator expression, lack of B lymphocyte stimulator
function, aberrant B lymphocyte stimulator receptor expression, or
lack of B lymphocyte stimulator receptor function.
[0253] In a specific embodiment, the present invention provides a
method of treating, preventing or ameliorating a disease or
disorder associated with aberrant B lymphocyte stimulator or B
lymphocyte stimulator receptor expression or activity, comprising
administering to an animal in which such treatment, prevention or
amelioration is desired, a B lymphocyte stimulator binding
polypeptide in an amount effective to treat, prevent or ameliorate
the disease or disorder. Diseases and disorders which may be
treated, prevented or ameliorated by this method include, but are
not limited to, immune system diseases and disorders (e.g.,
autoimmune diseases and disorders, immunodeficiencies, lupus,
rheumatoid arthritis, multiple sclerosis, hypogammaglobulinemia and
hypergammaglobulinemia), graft vs. host disease, proliferative
diseases and disorders (e.g., cancer) and infectious diseases and
disorders.
[0254] In a specific embodiment, the present invention provides a
method of treating, preventing or ameliorating a disease or
disorder of cells of hematopoietic origin, comprising administering
to an animal in which such treatment, prevention, or amelioration
is desired, a B lymphocyte stimulator binding polypeptide in an
amount effective to treat, prevent or ameliorate the disease or
disorder. Cells of hematopoietic origin include, but are not
limited to, lymphocytes (e.g., B cells and T cells), monocytes,
macrophages, dendritic cells, polymorphonuclear leukocytes (e.g.,
basophils, eosinophils, neutrophils), mast cells, platelets,
erythrocytes and progenitor cells of these lineages.
[0255] One or more B lymphocyte stimulator binding polypeptides of
the present invention (including molecules comprising, or
alternatively consisting of, B lymphocyte stimulator binding
polypeptide fragments or variants thereof) that specifically bind
to B lymphocyte stimulator may be used locally or systemically in
the body as a therapeutic. The B lymphocyte stimulator binding
polypeptides (including molecules comprising, or alternatively
consisting of, B lymphocyte stimulator binding polypeptide
fragments or variants thereof) may also be advantageously utilized
in combination with monoclonal or chimeric antibodies, lymphokines
and/or hematopoietic growth factors (such as, e.g., IL-2, IL-3 and
IL-7), for example, which serve to increase the number or activity
of effector cells which interact with the B lymphocyte stimulator
binding polypeptides.
[0256] The B lymphocyte stimulator binding polypeptides (including
molecules comprising, or alternatively consisting of, B lymphocyte
stimulator binding polypeptide fragments or variants thereof) may
be administered alone or in combination with other types of
treatments (e.g., radiation therapy, chemotherapy, hormonal
therapy, immunotherapy, anti-tumor agents, anti-angiogenesis and
anti-inflammatory agents).
[0257] It is preferred to use high affinity and/or potent in vivo
inhibiting and/or neutralizing B lymphocyte stimulator binding
polypeptides (including molecules comprising, or alternatively
consisting of, B lymphocyte stimulator binding polypeptide
fragments or variants thereof) that specifically bind to B
lymphocyte stimulator, or polynucleotides encoding B lymphocyte
stimulator binding polypeptides that specifically bind to B
lymphocyte stimulator, for both immunoassays directed to and
therapy of disorders related to B lymphocyte stimulator
polynucleotides or polypeptides, including fragments thereof. Such
B lymphocyte stimulator binding polypeptides will preferably have
an affinity for B lymphocyte stimulator and/or B lymphocyte
stimulator fragments. Preferred binding affinities include those
with a dissociation constant or K.sub.D of less than or equal to
5.times.10.sup.-2 M, 10.sup.-2 M, 5.times.10.sup.-3 M, 10.sup.-3 M,
5.times.10.sup.-4 M, 10.sup.-4 M, 5.times.10.sup.-5 M, or 10.sup.-5
M. More preferably, B lymphocyte stimulator binding polypeptides
bind B lymphocyte stimulator target proteins with a dissociation
constant or K.sub.D less than or equal to 5.times.10.sup.-6 M,
10.sup.-6 M, 5.times.10.sup.-7 M, 10.sup.-7 M, 5.times.10.sup.-8 M,
or 10.sup.-8 M. Even more preferably, B lymphocyte stimulator
binding polypeptides bind B lymphocyte stimulator target proteins
with a dissociation constant or K.sub.D less than or equal to
5.times.10.sup.-9 M, 10.sup.-9 M, 5.times.10.sup.-10 M, 10.sup.-10
M, 5.times.10.sup.-11 M, 10.sup.-11 M, 5.times.10.sup.-12 M,
10.sup.-12 M, 5.times..sup.-13 M, 10.sup.-13 M, 5.times.10.sup.-14
M, 10.sup.-14 M, 5.times.10.sup.-15 M, or 10.sup.-15 M.
[0258] In a preferred embodiment, B lymphocyte stimulator binding
polypeptides neutralize B lymphocyte stimulator activity. In
another preferred embodiment, B lymphocyte stimulator binding
polypeptides inhibit B cell proliferation.
[0259] In a preferred embodiment, B lymphocyte stimulator binding
polypeptides (including molecules comprising, or alternatively
consisting of, B lymphocyte stimulator binding polypeptide
fragments or variants thereof) inhibit or reduce binding of the
soluble form of B lymphocyte stimulator to a B lymphocyte
stimulator receptor. In another preferred embodiment B lymphocyte
stimulator binding polypeptides inhibit or reduce B cell
proliferation induced by the soluble form of B lymphocyte
stimulator. In another preferred embodiment B lymphocyte stimulator
binding polypeptides inhibit or reduce immunoglobulin production
induced by the soluble form of B lymphocyte stimulator.
[0260] In a preferred embodiment, B lymphocyte stimulator binding
polypeptides (including molecules comprising, or alternatively
consisting of, B lymphocyte stimulator binding polypeptide
fragments or variants thereof) inhibit or reduce binding of
membrane-bound B lymphocyte stimulator to a B lymphocyte stimulator
receptor. In another preferred embodiment, B lymphocyte stimulator
binding polypeptides inhibit or reduce B cell proliferation induced
by the membrane-bound form of B lymphocyte stimulator. In another
preferred embodiment, B lymphocyte stimulator binding polypeptides
inhibit or reduce immunoglobulin production induced by the membrane
bound form of B lymphocyte stimulator.
[0261] In a preferred embodiment, B lymphocyte stimulator binding
polypeptides (including molecules comprising, or alternatively
consisting of, B lymphocyte stimulator binding polypeptide
fragments or variants thereof) inhibit or reduce binding of both
the soluble and membrane-bound forms of B lymphocyte stimulator to
a B lymphocyte stimulator receptor. In another preferred
embodiment, B lymphocyte stimulator binding polypeptides inhibit or
reduce B cell proliferation induced by either or both forms of B
lymphocyte stimulator. In another preferred embodiment, B
lymphocyte stimulator binding polypeptides inhibit or reduce
immunoglobulin production induced by either or both forms of B
lymphocyte stimulator.
[0262] In one embodiment, the invention provides a method of
delivering radiolabelled B lymphocyte stimulator binding
polypeptide and/or B lymphocyte stimulator binding polypeptide
conjugates to targeted cells, such as, for example, monocytic cells
expressing the membrane-bound form of B lymphocyte stimulator, or B
cells expressing a B lymphocyte stimulator receptor.
[0263] In one embodiment, the invention provides methods and
compositions for inhibiting or reducing immunoglobulin production
(e.g., IgM, IgG, and/or IgA production), comprising, or
alternatively consisting of, contacting an effective amount of B
lymphocyte stimulator binding polypeptide with B lymphocyte
stimulator, wherein the effective amount of B lymphocyte stimulator
binding polypeptide inhibits or reduces B lymphocyte stimulator
mediated immunoglobulin production. In another embodiment, the
invention provides methods and compositions for inhibiting or
reducing immunoglobulin production (e.g., IgM, IgG, and/or IgA
production), comprising, or alternatively consisting of,
administering to an animal in which such inhibition or reduction is
desired, a B lymphocyte stimulator binding polypeptide in an amount
effective to inhibit or reduce immunoglobulin production.
[0264] In another embodiment, the invention provides methods and
compositions for stimulating immunoglobulin production (e.g., IgM,
IgG, and/or IgA production), comprising, or alternatively
consisting of, contacting an effective amount of B lymphocyte
stimulator binding polypeptide with B lymphocyte stimulator,
wherein the effective amount of the B lymphocyte stimulator binding
polypeptide stimulates B lymphocyte stimulator mediated
immunoglobulin production. In another embodiment, the invention
provides methods and compositions for stimulating immunoglobulin
production (e.g., IgM, IgG, and/or IgA production) comprising, or
alternatively consisting of, administering to an animal in which
such stimulation is desired, a B lymphocyte stimulator binding
polypeptide in an amount effective to stimulate immunoglobulin
production. Determination of immunoglobulin levels are most often
performed by comparing the level of immunoglobulin in a sample to a
standard containing a known amount of immunoglobulin using ELISA
assays. Determination of immunoglobulin levels in a given sample,
can readily be determined using ELISA or other method known in the
art.
[0265] Receptors belonging to the TNF receptor (TNFR) super family
(e.g., TACI and BCMA) can be classified into two types based on the
presence or absence of a conserved cytoplasmic domain responsible
for apoptosis called a "death domain." TNF receptors without death
domains, such as TNF-R2 HVEM/ATAR, RANK, CD27, CD30, CD40, and OX40
interact with TNF receptor associated factors (TRAF 1-6) and
mediate anti-apoptotic survival and or proliferative responses via
activation of the transcription factor NF-kappaB (reviewed in
Wajant et al., Cytokine and Growth Factor Reviews, 10(1):15-26,
1999). TACI and BCMA do not contain death domains.
[0266] Investigation of B lymphocyte stimulator induced signaling
in human tonsillar B cells co-stimulated with Staph. aureus Cowan
consistently revealed that mRNA for ERK-1 and PLK were upregulated
by B lymphocyte stimulator+SAC treatment (see Example 12). Polo
like kinases (PLK) belong to a sub family of serine/threonine
kinases related to Saccharomyces cerevisiae cell cycle protein CDC5
(29). The expression of PLK is induced during G2 and S phase of the
cell cycle. PLK is reported to play a role in cell proliferation
(Lee et al., Proc. Natl. Acad. Sci., 95:9301-9306, 1998). The role
or extracellular-signal related kinases (ERK1/2) in cell survival
and proliferative effects of growth factors and other agonists has
been extensively studied. The induced expression of PLK and ERK-1
is consistent with the survival and proliferative effects of B
lymphocyte stimulator on B cells.
[0267] Additionally, in some samples of human tonsillar B cells
stimulated with B lymphocyte stimulator and SAC, mRNA for CD25
(IL-2Ralpha) was upregulated. Nuclear extracts from Human tonsillar
B cells treated with B lymphocyte stimulator and from IM-9 cells
treated with B lymphocyte stimulator were able to shift probes from
the CD25 promoter region containing sites for NF-kappaB, SRF, ELF-1
and HMGI/Y in an electromobility shift assay. ELF-1 for example, is
a transcription factor that is part of the ETS family of proteins
and whose expression appears to be restricted to T and B cells.
Binding sites for ELF-1 have been described in the promoters of a
number of proteins that are important in the regulation of the
immune response.
[0268] Thus B lymphocyte stimulator induced signaling has been
shown to be consistent with the activation of cellular activation
and cellular proliferation pathways as well as with cellular
signaling pathways that regulate B cell lifespan. Further, B
lymphocyte stimulator treatment of B cells induces cellular
proliferation immunoglobulin secretion, a characteristic of
activated B cells (Moore et al., Science, 285:260-263, 1999). B
lymphocyte stimulator binding polypeptides complexed with B
lymphocyte stimulator may inhibit, stimulate, or not significantly
alter these B lymphocyte stimulator mediated activities.
[0269] In one embodiment, the invention provides methods and
compositions for inhibiting or reducing B cell proliferation,
comprising, or alternatively consisting of, contacting an effective
amount of B lymphocyte stimulator binding polypeptide with B
lymphocyte stimulator, wherein the effective amount of B lymphocyte
stimulator binding polypeptide inhibits or reduces B lymphocyte
stimulator mediated B cell proliferation. In another embodiment,
the invention provides methods and compositions for inhibiting or
reducing B cell proliferation comprising, or alternatively
consisting of, administering to an animal in which such inhibition
or reduction is desired, a B lymphocyte stimulator binding
polypeptide in an amount effective to inhibit or reduce B cell
proliferation.
[0270] In one embodiment, the invention provides methods and
compositions for stimulating B cell proliferation, comprising, or
alternatively consisting of, contacting an effective amount of B
lymphocyte stimulator binding polypeptide with B lymphocyte
stimulator, wherein the effective amount of B lymphocyte stimulator
binding polypeptide stimulates B lymphocyte stimulator mediated B
cell proliferation.
[0271] In one embodiment, the invention provides methods and
compositions for stimulating B cell proliferation, comprising, or
alternatively consisting of, administering to an animal in which
such stimulation is desired, a B lymphocyte stimulator binding
polypeptide in an amount effective to stimulate B cell
proliferation.
[0272] B cell proliferation is most commonly assayed in the art by
measuring tritiated thymidine incorporation (see Examples 7 and 8).
This and other assays are commonly known in the art and may be
routinely adapted for the use of determining the effect of B
lymphocyte stimulator binding polypeptides on B cell
proliferation.
[0273] In one embodiment, the invention provides methods and
compositions for inhibiting or reducing activation of B cells,
comprising, or alternatively consisting of, contacting an effective
amount of B lymphocyte stimulator binding polypeptide with B
lymphocyte stimulator, wherein the effective amount of B lymphocyte
stimulator binding polypeptide inhibits or reduces B lymphocyte
stimulator mediated B cell activation.
[0274] In one embodiment, the invention provides methods and
compositions for inhibiting or reducing activation of B cells,
comprising, or alternatively consisting of, administering to an
animal in which such inhibition or reduction is desired, a B
lymphocyte stimulator binding polypeptide in an amount effective to
inhibit or reduce B cell activation.
[0275] In one embodiment, the invention provides methods and
compositions for increasing activation of B cells, comprising, or
alternatively consisting of, contacting an effective amount of B
lymphocyte stimulator binding polypeptide with B lymphocyte
stimulator, wherein the effective amount of B lymphocyte stimulator
binding polypeptide increases B lymphocyte stimulator mediated
activation of B cells.
[0276] In one embodiment, the invention provides methods and
compositions for increasing activation of B cells, comprising, or
alternatively consisting of, administering to an animal in which
such increase is desired, a B lymphocyte stimulator binding
polypeptide in an amount effective to increase B cell
activation.
[0277] B cell activation can measured in a variety of ways, such as
FACS analysis of activation markers expressed on B cells. B cells
activation markers include, but are not limited to, CD26, CD 28, CD
30, CD 38, CD 39, CD 69, CD70 CD71, CD 77, CD 83, CD126, CDw130,
and B220. Additionally, B cell activation may be measured by
analysis of the activation of signaling molecules involved in B
cell activation. By way of non-limiting example, such analysis may
take the form of analyzing mRNA levels of signaling molecules by
Northern analysis or real time PCR (Example 12). One can also
measure, for example, the phosphorylation of signaling molecules
using anti-phosphotyrosine antibodies in a Western blot. B cell
activation may also be measured by measuring the calcium levels in
B cells. These and other methods of determining B cell activation
are commonly known in the art and may be routinely adapted for the
use of determining the effect of B lymphocyte stimulator binding
polypeptides on B cell activation.
[0278] In one embodiment, the invention provides methods and
compositions for decreasing lifespan of B cells, comprising, or
alternatively consisting of, contacting an effective amount of B
lymphocyte stimulator binding polypeptide with B lymphocyte
stimulator, wherein the effective amount of B lymphocyte stimulator
binding polypeptide inhibits or reduces B lymphocyte stimulator
regulated lifespan of B cells.
[0279] In one embodiment, the invention provides methods and
compositions for decreasing lifespan of B cells, comprising, or
alternatively consisting of, administering to an animal in which
such decrease is desired, a B lymphocyte stimulator binding
polypeptide in an amount effective to decrease B cell lifespan.
[0280] In one embodiment, the invention provides methods and
compositions for increasing lifespan of B cells, comprising, or
alternatively consisting of, contacting an effective amount of B
lymphocyte stimulator binding polypeptide with B lymphocyte
stimulator, wherein the effective amount of B lymphocyte stimulator
binding polypeptide increases B lymphocyte stimulator regulated
lifespan of B cells.
[0281] In one embodiment, the invention provides methods and
compositions for increasing lifespan of B cells, comprising, or
alternatively consisting of, administering to an animal in which
such increase is desired, a B lymphocyte stimulator binding
polypeptide in an amount effective to increase lifespan of B
cells.
[0282] B cell life span in vivo may be measured by
5-bromo-2'-deoxyuridine (BrdU) labeling experiments which are well
known to one skilled in the art. BrdU is a thymidine analogue that
gets incorporated into the DNA of dividing cells. Cells containing
BrdU in their DNA can be detected using, for example fluorescently
labeled anti-BrdU antibody and flow cytometry. Briefly, an animal
is injected with BrdU in an amount sufficient to label developing B
cells. Then, a sample of B cells is withdrawn from the animal, for
example, from peripheral blood, and analyzed for the percentage of
cells that contain BrdU. Such an analysis performed at several time
points can be used to calculate the half life of B cells.
Alternatively, B cell survival may be measured in vitro. For
example B cells may be cultured under conditions where
proliferation does not occur, (for example the media should contain
no reagents that crosslink the immunoglobulin receptor, such as
anti-IgM antibodies) for a period of time (usually 2-4 days). At
the end of this time, the percent of surviving cells is determined,
using for instance, the vital dye Trypan Blue, or by staining cells
with propidium iodide or any other agent designed to specifically
stain apoptotic cells and analyzing the percentage of cells stained
using flow cytometry. One could perform this experiment under
several conditions, such as B cells treated with B lymphocyte
stimulator, B cells treated with B lymphocyte stimulator/B
lymphocyte stimulator binding polypeptide complexes, and untreated
B cells in order to determine the effects of B lymphocyte
stimulator and B lymphocyte stimulator binding polypeptides on B
cells survival. These and other methods for determining B cell
lifespan are commonly known in the art and could routinely be
adapted to determining the effect of B lymphocyte stimulator
binding polypeptides on B lymphocyte stimulator regulated B cell
lifespan.
[0283] In one embodiment, the invention provides a method for the
specific delivery of B lymphocyte stimulator binding polypeptides
and B lymphocyte stimulator binding polypeptide conjugates to cells
by administering molecules that are associated with heterologous
polypeptides or nucleic acids. In one example, the invention
provides a method for delivering a therapeutic protein into the
targeted cell. In another example, the invention provides a method
for delivering a single stranded nucleic acid (e.g., antisense or
ribozymes) or double stranded nucleic acid (e.g., DNA that can
integrate into the cell's genome or replicate episomally and that
can be transcribed) in the targeted cell.
[0284] In another embodiment, the invention provides for a method
of killing cells of hematopoietic origin, comprising, or
alternatively consisting of, contacting B lymphocyte stimulator
binding polypeptides with B lymphocyte stimulator to form a
complex; and contacting the complex with cells of hematopoietic
origin. In specific embodiments, the method of killing cells of
hematopoietic origin, comprises, or alternatively consists of,
administering to an animal in which such killing is desired, a B
lymphocyte stimulator binding polypeptide in an amount effective to
kill cells of hematopoietic origin. Cells of hematopoietic origin
include, but are not limited to, lymphocytes (e.g., B cells and T
cells), monocytes, macrophages, dendritic cells, polymorphonuclear
leukocytes (e.g., basophils, eosinophils, neutrophils), mast cells,
platelets, erythrocytes and progenitor cells of these lineages.
Cells of hematopoietic origin include, but are not limited to,
healthy and diseased cell as found present in an animal, preferably
a mammal and most preferably a human, or as isolated from an
animal, transformed cells, cell lines derived from the above listed
cell types, and cell cultures derived from the above listed cell
types. Cells of hematopoietic origin may be found or isolated in,
for example, resting, activated or anergic states.
[0285] In another embodiment, the invention provides a method for
the specific destruction (i.e., killing) of cells (e.g., the
destruction of tumor cells) by administering B lymphocyte
stimulator binding polypeptides or B lymphocyte stimulator binding
polypeptide conjugates (e.g., radiolabeled B lymphocyte stimulator
binding polypeptides and/or B lymphocyte stimulator binding
polypeptides conjugated with radioisotopes, toxins, or cytotoxic
prodrugs). In a specific embodiment, the invention provides a
method for the specific destruction of cells of monocytic lineage
(e.g., monocytic cell related leukemias or lymphomas, such as, for
example acute myelogenous leukemia) by administering B lymphocyte
stimulator binding polypeptides or B lymphocyte stimulator binding
polypeptide conjugates (e.g., B lymphocyte stimulator binding
polypeptides conjugated with radioisotopes, toxins, or cytotoxic
prodrugs) that specifically bind the membrane-bound form of B
lymphocyte stimulator. In another specific embodiment, the
invention provides a method for the specific destruction of cells
of B cell lineage (e.g., B cell related leukemias or lymphomas
(e.g., chronic lymphocytic leukemia, multiple myeloma,
non-Hodgkin's lymphoma, and Hodgkin's disease) by administering B
lymphocyte stimulator binding polypeptides or B lymphocyte
stimulator binding polypeptide conjugates (e.g., B lymphocyte
stimulator binding polypeptides conjugated with radioisotopes,
toxins, or cytotoxic prodrugs) that bind soluble B lymphocyte
stimulator, but do not inhibit B lymphocyte stimulator binding to a
B lymphocyte stimulator receptor on B cells.
[0286] In another embodiment of the invention, therapeutic or
pharmaceutical compositions are administered to an animal to treat,
prevent or ameliorate diseases and disorders of the immune system.
In a specific embodiment, the invention provides a method of
treating, preventing, or ameliorating an immune system disease or
disorder, comprising, or alternatively consisting of, administering
to an animal in which such treatment, prevention, or amelioration
is desired, a B lymphocyte stimulator binding polypeptide in an
amount effective to treat, prevent, or ameliorate the immune system
disease or disorder. Diseases and disorders of the immune system
include, but are not limited to, autoimmune diseases and disorders
(e.g., arthritis, graft rejection, Hashimoto's thyroiditis,
insulin-dependent diabetes, lupus, rheumatoid arthritisidiopathic
thrombocytopenic purpura, systemic lupus erythramatosus and
multiple sclerosis, and other autoimmune diseases or disorders
named or described herein), hypogammaglobulinemia,
hypergammaglobulinemia, elective IgA deficiency,
ataxia-telangiectasia, immunodeficiencies (e.g., common variable
immunodeficiency (CVID), X-linked agammaglobulinemia, severe
combined immunodeficiency (SCID), and Wiskott-Aldrich syndrome),
graft vs. host disease, idiopathic hyper-eosinophilic syndrome,
monocytic leukemoid reaction, monocytic leukocytosis, monocytic
leukopenia, monocytopenia, monocytosis, graft or transplant
rejection, as well as infectious diseases (e.g., AIDS and
hepatitis).
[0287] As discussed herein, B lymphocyte stimulator binding
polypeptides and B lymphocyte stimulator binding polypeptide
compositions, may be used to treat, prevent, ameliorate, diagnose
or prognose various immune system-related disorders and/or
conditions associated with these disorders, in mammals, preferably
humans. Many autoimmune disorders result from inappropriate
recognition of self as foreign material by immune cells. This
inappropriate recognition results in an immune response leading to
the destruction of the host tissue. Therefore, the administration
of B lymphocyte stimulator binding polypeptides and B lymphocyte
stimulator binding polypeptide compositions that can inhibit an
immune response, particularly the proliferation of B cells and/or
the production of immunoglobulins, may be an effective therapy in
treating and/or preventing autoimmune disorders. Thus, in preferred
embodiments, B lymphocyte stimulator binding polypeptides and B
lymphocyte stimulator binding polypeptide compositions are used to
treat, prevent, ameliorate, diagnose and/or prognose an autoimmune
disorder, or condition(s) associated with such disorder.
[0288] Autoimmune disorders and conditions associated with these
disorders that may be treated, prevented, ameliorated, diagnosed
and/or prognosed according to the invention with the therapeutic
and pharmaceutical compositions described herein include, but are
not limited to, autoimmune hemolytic anemia, autoimmune neonatal
thrombocytopenia, idiopathic thrombocytopenia purpura, autoimmune
neutropenia, autoimmunocytopenia, hemolytic anemia,
antiphospholipid syndrome, dermatitis, gluten-sensitive
enteropathy, allergic encephalomyelitis, myocarditis, relapsing
polychondritis, rheumatic heart disease, glomerulonephritis (e.g.,
IgA nephropathy), multiple sclerosis, neuritis, uveitis ophthalmia,
polyendocrinopathies, purpura (e.g., Henloch-Scoenlein purpura),
Reiter's Disease, Stiff-Man Syndrome, Autoimmune Pulmonary
Inflammation, myocarditis, IgA glomerulonephritis, dense deposit
disease, rheumatic heart disease, Guillain-Barre Syndrome, insulin
dependent diabetes mellitis, and autoimmune inflammatory eye
disease.
[0289] Additional autoimmune disorders and conditions associated
with these disorders that may be treated, prevented, ameliorated,
diagnosed and/or prognosed according to the present invention with
the therapeutic and pharmaceutical compositions described herein
include, but are not limited to, autoimmune thyroiditis,
hypothyroidism (i.e., Hashimoto's thyroiditis) (often
characterized, e.g., by cell-mediated and humoral thyroid
cytotoxicity), systemic lupus erhythematosus (often characterized,
e.g., by circulating and locally generated immune complexes),
discoid lupus, Goodpasture's syndrome (often characterized, e.g.,
by anti-basement membrane antibodies), Pemphigus (often
characterized, e.g., by epidermal acantholytic antibodies),
Receptor autoimmunities such as, for example, (a) Graves' Disease
(often characterized, e.g., by TSH receptor antibodies), (b)
Myasthenia Gravis (often characterized, e.g., by acetylcholine
receptor antibodies), and (c) insulin resistance (often
characterized, e.g., by insulin receptor antibodies), autoimmune
hemolytic anemia (often characterized, e.g., by phagocytosis of
antibody-sensitized RBCs), autoimmune thrombocytopenic purpura
(often characterized, e.g., by phagocytosis of antibody-sensitized
platelets.H
[0290] Additional autoimmune disorders and conditions associated
with these disorders that may be treated, prevented, ameliorated,
diagnosed and/or prognosed according to the present invention with
the therapeutic and pharmaceutical compositions described herein
include, but are not limited to, rheumatoid arthritis (often
characterized, e.g., by immune complexes in joints), schleroderma
with anti-collagen antibodies (often characterized, e.g., by
nucleolar and other nuclear antibodies), mixed connective tissue
disease (often characterized, e.g., by antibodies to extractable
nuclear antigens (e.g., ribonucleoprotein)),
polymyositis/dermatomyositis (often characterized, e.g., by
nonhistone ANA), pernicious anemia (often characterized, e.g., by
antiparietal cell, microsomes, and intrinsic factor antibodies),
idiopathic Addison's disease (often characterized, e.g., by humoral
and cell-mediated adrenal cytotoxicity, infertility (often
characterized, e.g., by antispermatozoal antibodies),
glomerulonephritis (often characterized, e.g., by glomerular
basement membrane antibodies or immune complexes) such as primary
glomerulonephritis and IgA nephropathy, bullous pemphigoid (often
characterized, e.g., by IgG and complement in basement membrane),
Sjogren's syndrome (often characterized, e.g., by multiple tissue
antibodies, and/or a specific nonhistone ANA (SS-B)), diabetes
millitus (often characterized, e.g., by cell-mediated and humoral
islet cell antibodies), and adrenergic drug resistance (including
adrenergic drug resistance with asthma or cystic fibrosis) (often
characterized, e.g., by beta-adrenergic receptor antibodies),
chronic active hepatitis (often characterized, e.g., by smooth
muscle antibodies), primary biliary cirrhosis (often characterized,
e.g., by mitchondrial antibodies), other endocrine gland failure
(often characterized, e.g., by specific tissue antibodies in some
cases), vitiligo (often characterized, e.g., by melanocyte
antibodies), vasculitis (often characterized, e.g., by Ig and
complement in vessel walls and/or low serum complement), post-MI
(often characterized, e.g., by myocardial antibodies), cardiotomy
syndrome (often characterized, e.g., by myocardial antibodies),
urticaria (often characterized, e.g., by IgG and IgM antibodies to
IgE), atopic dermatitis (often characterized, e.g., by IgG and IgM
antibodies to IgE), asthma (often characterized, e.g., by IgG and
IgM antibodies to IgE), inflammatory myopathies, and many other
inflammatory, granulamatous, degenerative, and atrophic
disorders.
[0291] In a preferred embodiment, therapeutic and pharmaceutical
compositions are used to treat, prevent, ameliorate, diagnose or
prognose, a member of the group: autoimmune hemolytic anemia, as
primary glomerulonephritis, IgA glomerulonephritis, Goodpasture's
syndrome, idiopathic thrombocytopenia, Multiple Sclerosis,
Myasthenia Gravis, Pemphigus, polymyositis/dermatomyositis,
relapsing polychondritis, rheumatoid arthritis, Sjogren's syndrome,
systemic lupus erhythematosus, Uveitis, vasculitis, and primary
biliary cirrhosis.
[0292] In another specific preferred embodiment, therapeutic and
pharmaceutical compositions are used to treat, prevent, amelioate,
diagnose or prognose, rheumatoid arthritis and/or medical
conditions associated therewith.
[0293] In a specific preferred embodiment, therapeutic and
pharmaceutical compositions are used to treat, prevent, amelioate,
diagnose or prognose, lupus and/or medical conditions associated
therewith. Lupus-associated conditions that may be treated,
prevented, ameliorated, prognosed and/or diagnosed with the B
lymphocyte stimulator binding polypeptides and B lymphocyte
stimulator binding polypeptide compositions include, but are not
limited to, hematologic disorders (e.g., hemolytic anemia,
leukopenia, lymphopenia, and thrombocytopenia), immunologic
disorders (e.g., anti-DNA antibodies, and anti-Sm antibodies),
rashes, photosensitivity, oral ulcers, arthritis, fever, fatigue,
weight loss, serositis (e.g., pleuritus (pleurisy)), renal
disorders (e.g., nephritis), neurological disorders (e.g.,
seizures, peripheral neuropathy, CNS related disorders),
gastroinstestinal disorders, Raynaud phenomenon, and pericarditis.
In a preferred embodiment, therapeutic and pharmaceutical
compositions are used to treat, prevent, ameliorate, diagnose, or
prognose, renal disorders associated with systemic lupus
erythematosus. In a most preferred embodiment, therapeutic and
pharmaceutical compositions are used to treat, prevent, ameliorate,
diagnose, or prognose, nephritis associated with systemic lupus
erythematosus. In another most preferred embodiment, therapeutic or
pharmaceutical compositions are administered to an animal to treat,
prevent or ameliorate lupus or glomerular nephritis.
[0294] In another embodiment, therapeutic or pharmaceutical
compositions are administered to an animal to treat, prevent or
ameliorate an IgE-mediated allergic reaction or histamine-mediated
allergic reaction. Examples of allergic reactions include, but are
not limited to, asthma, rhinitis, eczema, chronic urticaria, and
atopic dermatitis. In another embodiment, therapeutic or
pharmaceutical compositions are administered to an animal to treat,
prevent, or ameliorate anaphylaxis, hypersensitivity to an
antigenic molecule, or blood group incompatibility. In another
embodiment, therapeutic or pharmaceutical compositions are
administered to an animal to treat, prevent or ameliorate or
modulate inflammation or an inflammatory disorder. Examples of
chronic and acute inflammatory disorders that may be treated
prevented or ameliorated with the therapeutic and pharmaceutical
compositions include, but are not limited to, chronic prostatitis,
granulomatous prostatitis and malacoplakia, inflammation associated
with infection (e.g., septic shock, sepsis, or systemic
inflammatory response syndrome (SIRS)), ischemia-reperfusion
injury, endotoxin lethality, arthritis, complement-mediated
hyperacute rejection, nephritis, cytokine or chemokine induced lung
injury, Crohn's disease, inflammatory bowel disease, chronic and
acute inflammatory pulmonary diseases, bacterial infection,
psoriasis, septicemia, cerebral malaria, arthritis,
gastroenteritis, and glomerular nephritis.
[0295] In another embodiment, therapeutic or pharmaceutical
compositions are administered to an animal to treat, prevent or
ameliorate ischemia and arteriosclerosis. Examples of such
disorders include, but are not limited to, reperfusion damage
(e.g., in the heart and/or brain) and cardiac hypertrophy.
[0296] Therapeutic or pharmaceutical compositions may also be
administered to modulate blood clotting and to treat or prevent
blood clotting disorders, such as, for example, antibody-mediated
thrombosis (i.e., antiphospholipid antibody syndrome (APS)). For
example, therapeutic or pharmaceutical compositions as described
herein may be used to inhibit the proliferation and differentiation
of cells involved in producing anticardiolipin antibodies. These
compositions can be used to treat, prevent, ameliorate, diagnose,
and/or prognose thrombotic related events including, but not
limited to, stroke (and recurrent stroke), heart attack, deep vein
thrombosis, pulmonary embolism, myocardial infarction, coronary
artery disease (e.g., antibody-mediated coronary artery disease),
thrombosis, graft reclusion following cardiovascular surgery (e.g.,
coronary arterial bypass grafts, recurrent fetal loss, and
recurrent cardiovascular thromboembolic events.
[0297] Therapeutic or pharmaceutical compositions containing B
lymphocyte stimulator binding polypeptides may also be administered
to treat, prevent, or ameliorate organ rejection or
graft-versus-host disease (GVHD) and/or conditions associated
therewith. Organ rejection occurs by host immune cell destruction
of the transplanted tissue through an immune response. Similarly,
an immune response is also involved in GVHD, but, in this case, the
foreign transplanted immune cells destroy the host tissues.
Administration of B lymphocyte stimulator binding polypeptides that
inhibit an immune response may be an effective therapy in
preventing organ rejection or GVHD. In specific embodiments the
present invention provides a method of inhibiting or reducing graft
rejection, comprising administering to an animal in which such
inhibition or reduction is desired, a B lymphocyte stimulator
binding polypeptide in an amount effective to inhibit or reduce
graft rejection.
[0298] In another embodiment, therapeutic or pharmaceutical
compositions are administered to an animal to treat, prevent or
ameliorate a disease or disorder diseases associated with increased
apoptosis including, but not limited to, AIDS, neurodegenerative
disorders (such as Alzheimer's disease, Parkinson's disease,
Amyotrophic lateral sclerosis, Retinitis pigmentosa, Cerebellar
degeneration), myelodysplastic syndromes (such as aplastic anemia),
ischemic injury (such as that caused by myocardial infarction,
stroke and reperfusion injury), toxin-induced liver disease (such
as that caused by alcohol), septic shock, cachexia and anorexia. In
another embodiment, therapeutic or pharmaceutical compositions are
administered to an animal to treat, prevent or ameliorate bone
marrow failure, for example, aplastic anemia and myelodysplastic
syndrome.
[0299] In other embodiment, therapeutic or pharmaceutical
compositions as described herein are used to treat or prevent a
proliferative disorder (e.g., cancer). In preferred embodiments,
therapeutic or pharmaceutical compositions as described herein are
used to treat or prevent proliferative disorders of monocytic
cells. In other preferred embodiments, therapeutic or
pharmaceutical compositions as described herein are used to treat
or prevent a proliferative disorders of B cells (e.g.,
leukemia).
[0300] In another embodiment, therapeutic or pharmaceutical
compositions as described herein are administered to an animal to
treat, prevent or ameliorate growth, progression, and/or metastases
of malignancies and proliferative diseases and disorders associated
with increased cell survival, or the inhibition of apoptosis. In a
specific embodiment, the present invention provides a method of
treating a proliferative disease or disorder, comprising
administering to an animal in which such treatment is desired, a B
lymphocyte stimulator binding polypeptide in an amount effective to
treat the proliferative disease or disorder. For a review of such
disorders, see Fishman et al., Medicine, 2d Ed. (J. B. Lippincott
Co., Philadelphia 1985). Examples of such disorders, include, but
are not limited to, leukemia (e.g., acute leukemia such as acute
lymphocytic leukemia and acute myelocytic leukemia, myeloblastic
leukemia, promyelocytic leukemia, myelomonocytic leukemia,
monocytic leukemia, erythroleukemia, chronic leukemia, chronic
myelocytic (granulocytic) leukemia, and chronic lymphocytic
leukemia), Polycythemia vera, lymphomas (e.g. Hodgkin's lymphoma,
non-Hodgkin's lymphoma) Hodgkin's disease, non-Hodgkin's disease,
multiple myeloma, Waldenstrom's macroglobulinemia, neoplasms,
tumors (e.g., fibrosarcoma, myxosarcoma, liposarcoma,
chondrosarcoma, osteogenic sarcoma, osteosarcoma, chordoma,
angiosarcoma, endotheliosarcoma, lymphangiosarcoma,
lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's
tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma,
colorectal carcinoma, pancreatic cancer, breast cancer, ovarian
cancer, prostate cancer, squamous cell carcinoma, basal cell
carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland
carcinoma, papillary carcinoma, papillary adenocarcinomas,
cystadenocarcinoma, medullary carcinoma, nasopharyngeal carcinoma,
bronchogenic carcinoma, esophageal carcinoma, renal cell carcinoma,
hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal
carcinoma, Wilms' tumor, cervical cancer, uterine cancer,
testicular tumor, lung carcinoma, small cell lung carcinoma,
bladder carcinoma, epithelial carcinoma, glioma, astrocytoma,
medulloblastoma, craniopharyngioma, ependymoma, pinealoma,
hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma,
melanoma, neuroblastoma, and retinoblastoma) heavy chain disease,
metastases, or any disease or disorder characterized by
uncontrolled cell growth. This method of treating a proliferative
diseases or disorders can also be used to treat premalignant
conditions (e.g., benign tumors, hyperproliferative disorders, and
benign proliferative disorders--see below) as well as proliferative
disorders of B cells, monocytes, macrophages, and T cells.
[0301] In another embodiment of the present invention, therapeutic
or pharmaceutical compositions as described herein can also be
administered to treat a subset of proliferative disorders, namely,
premalignant conditions (e.g., benign tumors, hyperproliferative
disorders, benign proliferative disorders) and to prevent
progression to a neoplastic or malignant state, including but not
limited to those disorders listed above. Such prophylactic or
therapeutic use is indicated in conditions known or suspected of
preceding progression to neoplasia or cancer, in particular, where
non-neoplastic cell growth consisting of hyperplasia, metaplasia,
or most particularly, dysplasia has occurred (for review of such
abnormal growth conditions, see Robbins and Angell, Basic
Pathology, 2d Ed. (W.B. Saunders Co., Philadelphia 1976), pp.
68-79.) Hyperplasia is a form of controlled cell proliferation
involving an increase in cell number in a tissue or organ, without
significant alteration in structure or function. As but one
example, endometrial hyperplasia often precedes endometrial cancer.
Metaplasia is a form of controlled cell growth in which one type of
adult or fully differentiated cell substitutes for another type of
adult cell. Metaplasia can occur in epithelial or connective tissue
cells. Atypical metaplasia involves a somewhat disorderly
metaplastic epithelium. Dysplasia is frequently a forerunner of
cancer, and is found mainly in the epithelia; it is the most
disorderly form of non-neoplastic cell growth, involving a loss in
individual cell uniformity and in the architectural orientation of
cells. Dysplastic cells often have abnormally large, deeply stained
nuclei, and exhibit pleomorphism. Dysplasia characteristically
occurs where there exists chronic irritation or inflammation, and
is often found in the cervix, respiratory passages, oral cavity,
and gall bladder.
[0302] Alternatively or in addition to the presence of abnormal
cell growth characterized as hyperplasia, metaplasia, or dysplasia,
the presence of one or more characteristics of a transformed
phenotype, or of a malignant phenotype, displayed in vivo or
displayed in vitro by a cell sample from a patient, can indicate
the desirability of prophylactic/therapeutic administration of a
therapeutic or pharmaceutical composition as described herein.
Characteristics of a transformed phenotype include, but are nor
limited to, morphology changes, looser substratum attachment, loss
of contact inhibition, loss of anchorage dependence, protease
release, increased sugar transport, decreased serum requirement,
expression of fetal antigens, and disappearance of the 250,000
dalton cell surface protein.
[0303] In other embodiments, a patient which exhibits one or more
of the following predisposing factors for malignancy is treated by
administration of an effective amount of a therapeutic or
pharmaceutical composition as described herein: a chromosomal
translocation associated with a malignancy (e.g., the Philadelphia
chromosome for chronic myelogenous leukemia, t(14; 18) for
follicular lymphoma, etc.), familial polyposis or Gardner's
syndrome (possible forerunners of colon cancer), benign monoclonal
gammopathy (a possible forerunner of multiple myeloma), and a first
degree kinship with persons having a cancer or precancerous disease
showing a Mendelian (genetic) inheritance pattern (e.g., familial
polyposis of the colon, Gardner's syndrome, hereditary exostosis,
polyendocrine adenomatosis, medullary thyroid carcinoma with
amyloid production and pheochromocytoma, Peutz-Jeghers syndrome,
neurofibromatosis of Von Recklinghausen, retinoblastoma, carotid
body tumor, cutaneous melanocarcinoma, intraocular melanocarcinoma,
xeroderma pigmentosum, ataxia telangiectasia, Chediak-Higashi
syndrome, albinism, Fanconi's aplastic anemia, and Bloom's
syndrome; see Robbins and Angell, supra, pp. 112-113), etc.)
[0304] In a specific embodiment, therapeutic or pharmaceutical
compositions as described herein are used to treat or prevent a
disorder characterized by hypergammagloulinemia (e.g., AIDS,
autoimmune diseases, and some immunodeficiencies).
[0305] In a specific embodiment, therapeutic or pharmaceutical
compositions as described herein are used to treat or prevent a
disorder characterized by deficient serum immunoglobulin
production, recurrent infections, and/or immune system dysfunction.
Moreover, therapeutic or pharmaceutical compositions as described
herein may be used to treat or prevent infections of the joints,
bones, skin, and/or parotid glands, blood-borne infections (e.g.,
sepsis, meningitis, septic arthritis, and/or osteomyelitis),
autoimmune diseases (e.g., those disclosed herein), inflammatory
disorders, and malignancies, and/or any disease or disorder or
condition associated with these infections, diseases, disorders
and/or malignancies) including, but not limited to, CVID, other
primary immune deficiencies, HIV disease, CLL, recurrent
bronchitis, sinusitis, otitis media, conjunctivitis, pneumonia,
hepatitis, meningitis, herpes zoster (e.g., severe herpes zoster),
and/or pheumocystis carnii.
[0306] Therapeutic or pharmaceutical compositions as described
herein thereof, may be used to diagnose, prognose, treat or prevent
one or more of the following diseases or disorders, or conditions
associated therewith: primary immuodeficiencies, immune-mediated
thrombocytopenia, Kawasaki syndrome, bone marrow transplant (e.g.,
recent bone marrow transplant in adults or children), chronic
B-cell lymphocytic leukemia, HIV infection (e.g., adult or
pediatric HIV infection), chronic inflammatory demyelinating
polyneuropathy, and post-transfusion purpura.
[0307] Additionally, therapeutic or pharmaceutical compositions as
described herein may be used to diagnose, prognose, treat or
prevent one or more of the following diseases, disorders, or
conditions associated therewith, Guillain-Barre syndrome, anemia
(e.g., anemia associated with parvovirus B19, patients with stable
multiple myeloma who are at high risk for infection (e.g.,
recurrent infection), autoimmune hemolytic anemia (e.g., warm-type
autoimmune hemolytic anemia), thrombocytopenia (e.g., neonatal
thrombocytopenia), and immune-mediated neutropenia),
transplantation (e.g., cytamegalovirus (CMV)-negative recipients of
CMV-positive organs), hypogammaglobulinemia (e.g.,
hypogamma-globulinemic neonates with risk factor for infection or
morbidity), epilepsy (e.g., intractable epilepsy), systemic
vasculitic syndromes, myasthenia gravis (e.g., decompensation in
myasthenia gravis), dermatomyositis, and polymyositis.
[0308] Additional preferred embodiments of the invention include,
but are not limited to, the use of therapeutic or pharmaceutical
compositions as described herein in the following applications:
[0309] Administration to an animal (e.g., mouse, rat, rabbit,
hamster, guinea pig, pigs, micro-pig, chicken, camel, goat, horse,
cow, sheep, dog, cat, non-human primate, and human, most preferably
human) to boost the immune system to produce increased quantities
of one or more antibodies (e.g., IgG, IgA, IgM, and IgE), to induce
higher affinity antibody production (e.g., IgG, IgA, IgM, and IgE),
and/or to increase an immune response. In a specific nonexclusive
embodiment, therapeutic or pharmaceutical compositions as described
herein are administered to boost the immune system to produce
increased quantities of IgG. In another specific nonexclusive
embodiment, B lymphocyte stimulator binding polypeptides of the are
administered to boost the immune system to produce increased
quantities of IgA. In another specific non-limiting embodiment, B
lymphocyte stimulator binding polypeptides are administered to
boost the immune system to produce increased quantities of IgM.
[0310] Administration to an animal (including, but not limited to,
those listed above, and also including transgenic animals)
incapable of producing functional endogenous antibody molecules or
having an otherwise compromised endogenous immune system, but which
is capable of producing human immunoglobulin molecules by means of
a reconstituted or partially reconstituted immune system from
another animal (see, e.g., published PCT applications WO 98/24893,
WO 96/34096, WO 96/33735, and WO 91/10741).
[0311] Additional preferred embodiments of the invention include,
but are not limited to, the use of therapeutic or pharmaceutical
compositions as described herein in the following applications:
[0312] A vaccine adjuvant that enhances immune responsiveness to
specific antigen. In a specific embodiment, the vaccine is a B
lymphocyte stimulator binding polypeptide described herein. In
another specific embodiment, the vaccine adjuvant is a
polynucleotide described herein (e.g., a B lymphocyte stimulator
binding polypeptide polynucleotide genetic vaccine adjuvant). As
discussed herein, therapeutic or pharmaceutical compositions as
described herein may be administered using techniques known in the
art, including but not limited to, liposomal delivery, recombinant
vector delivery, injection of naked DNA, and gene gun delivery.
[0313] An adjuvant to enhance tumor-specific immune responses.
[0314] An adjuvant to enhance anti-viral immune responses.
Anti-viral immune responses that may be enhanced using the
compositions as described herein as an adjuvant, include, but are
not limited to, virus and virus associated diseases or symptoms
described herein or otherwise known in the art. In specific
embodiments, the compositions are used as an adjuvant to enhance an
immune response to a virus, disease, or symptom selected from the
group consisting of: AIDS, meningitis, Dengue, EBV, and hepatitis
(e.g., hepatitis B). In another specific embodiment, the
compositions are used as an adjuvant to enhance an immune response
to a virus, disease, or symptom selected from the group consisting
of: HIV/AIDS, Respiratory syncytial virus, Dengue, Rotavirus,
Japanese B encephalitis, Influenza A and B, Parainfluenza, Measles,
Cytomegalovirus, Rabies, Junin, Chikungunya, Rift Valley fever,
Herpes simplex, and yellow fever. In another specific embodiment,
the compositions as described herein are used as an adjuvant to
enhance an immune response to the HIV gp120 antigen.
[0315] An adjuvant to enhance anti-bacterial or anti-fungal immune
responses. Anti-bacterial or anti-fungal immune responses that may
be enhanced using the compositions as described herein as an
adjuvant, include bacteria or fungus and bacteria or fungus
associated diseases or symptoms described herein or otherwise known
in the art. In specific embodiments, the compositions as described
herein are used as an adjuvant to enhance an immune response to a
bacteria or fungus, disease, or symptom selected from the group
consisting of: tetanus, diphtheria, botulism, and meningitis type
B. In another specific embodiment, the compositions are used as an
adjuvant to enhance an immune response to a bacteria or fungus,
disease, or symptom selected from the group consisting of: Vibrio
cholerae, Mycobacterium leprae, Salmonella typhi, Salmonella
paratyphi, Neisseria meningitidis, Streptococcus pneumoniae, Group
B Streptococcus, Shigella spp., Enterotoxigenic Escherichia coli,
Enterohemorrhagic E. coli, Borrelia burgdorferi, and Plasmodium
(malaria).
[0316] An adjuvant to enhance anti-parasitic immune responses.
Anti-parasitic immune responses that may be enhanced using the
compositions as described herein as an adjuvant, include parasite
and parasite associated diseases or symptoms described herein or
otherwise known in the art. In specific embodiments, the
compositions are used as an adjuvant to enhance an immune response
to a parasite. In another specific embodiment, the compositions are
used as an adjuvant to enhance an immune response to Plasmodium
(malaria).
[0317] As a stimulator of B cell responsiveness to pathogens.
[0318] As an agent that elevates the immune status of an individual
prior to their receipt of immunosuppressive therapies.
[0319] As an agent to induce higher affinity antibodies.
[0320] As an agent to increase serum immunoglobulin
concentrations.
[0321] As an agent to accelerate recovery of immunocompromised
individuals.
[0322] As an agent to boost immunoresponsiveness among aged
populations.
[0323] As an immune system enhancer prior to, during, or after bone
marrow transplant and/or other transplants (e.g., allogeneic or
xenogeneic organ transplantation). With respect to transplantation,
compositions as described herein may be administered prior to,
concomitant with, and/or after transplantation. In a specific
embodiment, compositions are administered after transplantation,
prior to the beginning of recovery of T cell populations. In
another specific embodiment, compositions are first administered
after transplantation, after the beginning of recovery of T cell
populations, but prior to full recovery of B cell populations.
[0324] As an agent to boost immunoresponsiveness among B cell
immunodeficient individuals, such as, for example, an individual
who has undergone a partial or complete splenectomy. B cell
immunodeficiencies that may be ameliorated or treated by
administering the B lymphocyte stimulator binding polypeptides
and/or compositions as described herein include, but are not
limited to, severe combined immunodeficiency (SCID)-X linked,
SCID-autosomal, adenosine deaminase deficiency (ADA deficiency),
X-linked agammaglobulinemia (XLA), Bruton's disease, congenital
agammaglobulinemia, X-linked infantile agammaglobulinemia, acquired
agammaglobulinemia, adult onset agammaglobulinemia, late-onset
agammaglobulinemia, dysgammaglobulinemia, hypogammaglobulinemia,
transient hypogammaglobulinemia of infancy, unspecified
hypogammaglobulinemia, agammaglobulinemia, common variable
immunodeficiency (CVID) (acquired), Wiskott-Aldrich Syndrome (WAS),
X-linked immunodeficiency with hyper IgM, non-X-linked
immunodeficiency with hyper IgM, selective IgA deficiency, IgG
subclass deficiency (with or without IgA deficiency), antibody
deficiency with normal or elevated Igs, immunodeficiency with
thymoma, Ig heavy chain deletions, kappa chain deficiency, B cell
lymphoproliferative disorder (BLPD), selective IgM
immunodeficiency, recessive agammaglobulinemia (Swiss type),
reticular dysgenesis, neonatal neutropenia, severe congenital
leukopenia, thymic alymphoplasia-aplasia or dysplasia with
immunodeficiency, ataxia-telangiectasia, short limbed dwarfism,
X-linked lymphoproliferative syndrome (XLP), Nezelof
syndrome-combined immunodeficiency with Igs, purine nucleoside
phosphorylase deficiency (PNP), MHC Class II deficiency (Bare
Lymphocyte Syndrome) and severe combined immunodeficiency.
[0325] In a specific embodiment, B lymphocyte stimulator binding
polypeptides and/or compositions are administered to treat or
ameliorate selective IgA deficiency.
[0326] In another specific embodiment, B lymphocyte stimulator
binding polypeptides and/or compositions are administered to treat
or ameliorate ataxia-telangiectasia.
[0327] In another specific embodiment B lymphocyte stimulator
binding polypeptides and/or compositions are administered to treat
or ameliorate common variable immunodeficiency.
[0328] In another specific embodiment, B lymphocyte stimulator
binding polypeptides and/or compositions are administered to treat
or ameliorate X-linked agammaglobulinemia.
[0329] In another specific embodiment, B lymphocyte stimulator
binding polypeptides and/or compositions are administered to treat
or ameliorate severe combined immunodeficiency (SCID).
[0330] In another specific embodiment, B lymphocyte stimulator
binding polypeptides and/or compositions are administered to treat
or ameliorate Wiskott-Aldrich syndrome.
[0331] In another specific embodiment, B lymphocyte stimulator
binding polypeptides and/or compositions are administered to treat
or ameliorate X-linked Ig deficiency with hyper IgM.
[0332] As an agent to boost immunoresponsiveness among individuals
having an acquired loss of B cell function. Conditions resulting in
an acquired loss of B cell function that may be ameliorated or
treated by administering B lymphocyte stimulator binding
polypeptides and/or compositions include, but are not limited to,
HIV Infection, AIDS, bone marrow transplant, and B cell chronic
lymphocytic leukemia (CLL).
[0333] As an agent to boost immunoresponsiveness among individuals
having a temporary immune deficiency. Conditions resulting in a
temporary immune deficiency that may be ameliorated or treated by
administering B lymphocyte stimulator binding polypeptides and/or
compositions include, but are not limited to, recovery from viral
infections (e.g., influenza), conditions associated with
malnutrition, recovery from infectious mononucleosis, or conditions
associated with stress, recovery from measles, recovery from blood
transfusion, recovery from surgery.
[0334] As a regulator of antigen presentation by monocytes,
dendritic cells, T cells and/or B cells. In one embodiment, B
lymphocyte stimulator binding polypeptides or polynucleotides
enhance antigen presentation or antagonize antigen presentation in
vitro or in vivo. Moreover, in related embodiments, this
enhancement or antagonization of antigen presentation may be useful
in anti-tumor treatment or to modulate the immune system.
[0335] As a mediator of mucosal immune responses. The expression of
B lymphocyte stimulator on monocytes, the expression of B
lymphocyte stimulator receptor on B cells, and the responsiveness
of B cells to B lymphocyte stimulator suggests that it may be
involved in exchange of signals between B cells and monocytes or
their differentiated progeny. This activity is in many ways
analogous to the CD40-CD154 signaling between B cells and T cells.
B lymphocyte stimulator binding polypeptides and compositions may
therefore be good regulators of T cell independent immune responses
to environmental pathogens. In particular, the unconventional B
cell populations (CD5+) that are associated with mucosal sites and
responsible for much of the innate immunity in humans may respond
to B lymphocyte stimulator binding polypeptides or compositions as
described herein thereby enhancing or inhibiting individual's
immune status.
[0336] As an agent to direct an individual's immune system towards
development of a humoral response (i.e., TH2) as opposed to a TH1
cellular response.
[0337] As a means to induce tumor proliferation and thus make it
more susceptible to anti-neoplastic agents. For example, multiple
myeloma is a slowly dividing disease and is thus refractory to
virtually all anti-neoplastic regimens. If these cells were forced
to proliferate more rapidly, their susceptibility profile would
likely change.
[0338] As a monocyte cell specific binding protein to which
specific activators or inhibitors of cell growth may be attached.
The result would be to focus the activity of such activators or
inhibitors onto normal, diseased, or neoplastic moncytic cell
populations.
[0339] As a macrophage cell specific binding protein to which
specific activators or inhibitors of cell growth may be attached.
The result would be to focus the activity of such activators or
inhibitors onto normal, diseased, or neoplastic macrophage cell
populations.
[0340] As a B cell specific binding protein to which specific
activators or inhibitors of cell growth may be attached. The result
would be to focus the activity of such activators or inhibitors
onto normal, diseased, or neoplastic B cell populations.
[0341] As a means of detecting monocytic cells by virtue of its
specificity. This application may require labeling the protein with
biotin or other agents (e.g., as described herein) to afford a
means of detection.
[0342] As a means of detecting macrophage cells by virtue of its
specificity. This application may require labeling the protein with
biotin or other agents (e.g., as described herein) to afford a
means of detection.
[0343] As a means of detecting B-lineage cells by virtue of its
specificity. This application may require labeling the protein with
biotin or other agents (e.g., as described herein) to afford a
means of detection.
[0344] As a stimulator of B cell production in pathologies such as
AIDS, chronic lymphocyte disorder and/or Common Variable
Immunodeficiency.
[0345] As part of a monocyte selection device the function of which
is to isolate monocytes from a heterogenous mixture of cell types.
B lymphocyte stimulator binding polypeptides could be coupled to a
solid support to which monocytes would then specifically bind.
Unbound cells would be washed out and the bound cells subsequently
eluted. A non-limiting use of this selection would be to allow
purging of tumor cells from, for example, bone marrow or peripheral
blood prior to transplant.
[0346] As part of a B cell selection device the function of which
is to isolate B cells from a heterogenous mixture of cell types. B
lymphocyte stimulator binding polypeptides (that do not inhibit B
lymphocyte stimulator/B lymphocyte stimulator Receptor interaction)
binding soluble B lymphocyte stimulator could be coupled to a solid
support to which B cells would then specifically bind. Unbound
cells would be washed out and the bound cells subsequently eluted.
A non-limiting use of this selection would be to allow purging of
tumor cells from, for example, bone marrow or peripheral blood
prior to transplant.
[0347] As a therapy for generation and/or regeneration of lymphoid
tissues following surgery, trauma or genetic defect.
[0348] As a gene-based therapy for genetically inherited disorders
resulting in immuno-incompetence such as observed among SCID
patients.
[0349] As an antigen for the generation of antibodies to inhibit or
enhance B lymphocyte stimulator mediated responses.
[0350] As a means of activating monocytes/macrophages to defend
against parasitic diseases that effect monocytes such as
Leshmania.
[0351] As pretreatment of bone marrow samples prior to transplant.
Such treatment would increase B cell representation and thus
accelerate recovery.
[0352] As a means of regulating secreted cytokines that are
elicited by B lymphocyte stimulator and/or B lymphocyte stimulator
receptor.
[0353] B lymphocyte stimulator binding polypeptides or
polynucleotides may be used to modulate IgE concentrations in vitro
or in vivo.
[0354] Additionally, B lymphocyte stimulator binding polypeptides
or polynucleotides may be used to treat, prevent, and/or diagnose
IgE-mediated allergic reactions. Such allergic reactions include,
but are not limited to, asthma, rhinitis, and eczema.
[0355] In a specific embodiment, B lymphocyte stimulator binding
polypeptides or polynucleotides are administered to treat, prevent,
diagnose, and/or ameliorate selective IgA deficiency.
[0356] In another specific embodiment B lymphocyte stimulator
binding polypeptides or polynucleotides are administered to treat,
prevent, diagnose, and/or ameliorate ataxia-telangiectasia.
[0357] In another specific embodiment, B lymphocyte stimulator
binding polypeptides or polynucleotides are administered to treat,
prevent, diagnose, and/or ameliorate common variable
immunodeficiency.
[0358] In another specific embodiment, B lymphocyte stimulator
binding polypeptides or polynucleotides are administered to treat,
prevent, diagnose, and/or ameliorate X-linked
agammaglobulinemia.
[0359] In another specific embodiment, B lymphocyte stimulator
binding polypeptides or polynucleotides are administered to treat,
prevent, diagnose, and/or ameliorate severe combined
immunodeficiency (SCID).
[0360] In another specific embodiment, B lymphocyte stimulator
binding polypeptides or polynucleotides are administered to treat,
prevent, diagnose, and/or ameliorate Wiskott-Aldrich syndrome.
[0361] In another specific embodiment, B lymphocyte stimulator
binding polypeptides or polynucleotides are administered to treat,
prevent, diagnose, and/or ameliorate X-linked Ig deficiency with
hyper IgM. In a specific embodiment B lymphocyte stimulator binding
polypeptides or polynucleotides are administered to treat, prevent,
diagnose, and/or ameliorate X-linked Ig deficiency with hyper
IgM.
[0362] In another specific embodiment, B lymphocyte stimulator
binding polypeptides or polynucleotides are administered to treat,
prevent, and/or diagnose chronic myelogenous leukemia, acute
myelogenous leukemia, leukemia, hystiocytic leukemia, monocytic
leukemia (e.g., acute monocytic leukemia), leukemic reticulosis,
Shilling Type monocytic leukemia, and/or other leukemias derived
from monocytes and/or monocytic cells and/or tissues.
[0363] In another specific embodiment, B lymphocyte stimulator
binding polypeptides or polynucleotides are administered to treat,
prevent, diagnose, and/or ameliorate monocytic leukemoid reaction,
as seen, for example, with tuberculosis.
[0364] In another specific embodiment, B lymphocyte stimulator
binding polypeptides or polynucleotides are administered to treat,
prevent, diagnose, and/or ameliorate monocytic leukocytosis,
monocytic leukopenia, monocytopenia, and/or monocytosis.
[0365] In a specific embodiment, B lymphocyte stimulator binding
polypeptides or polynucleotides are used to treat, prevent, detect,
and/or diagnose monocyte disorders and/or diseases, and/or
conditions associated therewith.
[0366] In a specific embodiment, B lymphocyte stimulator binding
polypeptides or polynucleotides are used to treat, prevent, detect,
and/or diagnose primary B lymphocyte disorders and/or diseases,
and/or conditions associated therewith. In one embodiment, such
primary B lymphocyte disorders, diseases, and/or conditions are
characterized by a complete or partial loss of humoral immunity.
Primary B lymphocyte disorders, diseases, and/or conditions
associated therewith that are characterized by a complete or
partial loss of humoral immunity and that may be prevented,
treated, detected and/or diagnosed with compositions as described
herein include, but are not limited to, X-Linked Agammaglobulinemia
(XLA), severe combined immunodeficiency disease (SCID), and
selective IgA deficiency.
[0367] In a preferred embodiment B lymphocyte stimulator binding
polypeptides or polynucleotides are used to treat, prevent, and/or
diagnose diseases or disorders affecting or conditions associated
with any one or more of the various mucous membranes of the body.
Such diseases or disorders include, but are not limited to, for
example, mucositis, mucoclasis, mucocolitis, mucocutaneous
leishmaniasis (such as, for example, American leishmaniasis,
leishmaniasis americana, nasopharyngeal leishmaniasis, and New
World leishmaniasis), mucocutaneous lymph node syndrome (for
example, Kawasaki disease), mucoenteritis, mucoepidermoid
carcinoma, mucoepidermoid tumor, mucoepithelial dysplasia, mucoid
adenocarcinoma, mucoid degeneration, myxoid degeneration;
myxomatous degeneration; myxomatosis, mucoid medial degeneration
(for example, cystic medial necrosis), mucolipidosis (including,
for example, mucolipidosis I, mucolipidosis II, mucolipidosis III,
and mucolipidosis IV), mucolysis disorders, mucomembranous
enteritis, mucoenteritis, mucopolysaccharidosis (such as, for
example, type I mucopolysaccharidosis (i.e., Hurler's syndrome),
type IS mucopolysaccharidosis (i.e., Scheie's syndrome or type V
mucopolysaccharidosis), type II mucopolysaccharidosis (i.e.,
Hunter's syndrome), type III mucopolysaccharidosis (i.e.,
Sanfilippo's syndrome), type IV mucopolysaccharidosis (i.e.,
Morquio's syndrome), type VI mucopolysaccharidosis (i.e.,
Maroteaux-Lamy syndrome), type VII mucopolysaccharidosis (i.e,
mucopolysaccharidosis due to beta-glucuronidase deficiency), and
mucosulfatidosis), mucopolysacchariduria, mucopurulent
conjunctivitis, mucopus, mucormycosis (i.e., zygomycosis), mucosal
disease (i.e., bovine virus diarrhea), mucous colitis (such as, for
example, mucocolitis and myxomembranous colitis), and
mucoviscidosis (such as, for example, cystic fibrosis, cystic
fibrosis of the pancreas, Clarke-Hadfield syndrome, fibrocystic
disease of the pancreas, mucoviscidosis, and viscidosis). In a
highly preferred embodiment, B lymphocyte stimulator binding
polypeptides or polynucleotides are used to treat, prevent, and/or
diagnose mucositis, especially as associated with chemotherapy.
[0368] In a preferred embodiment, B lymphocyte stimulator binding
polypeptides or polynucleotides are used to treat, prevent, and/or
diagnose diseases or disorders affecting or conditions associated
with sinusitis.
[0369] An additional condition, disease or symptom that can be
treated, prevented, and/or diagnosed by B lymphocyte stimulator
binding polypeptides or polynucleotides is osteomyelitis.
[0370] An additional condition, disease or symptom that can be
treated, prevented, and/or diagnosed by B lymphocyte stimulator
binding polypeptides or polynucleotides is endocarditis.
[0371] All of the above described applications as they may apply to
veterinary medicine.
[0372] B lymphocyte stimulator binding polypeptides or
polynucleotides may be used to treat, prevent, and/or diagnose
diseases and disorders of the pulmonary system (e.g., sinopulmonary
and bronchial infections) and conditions associated with such
diseases and disorders and other respiratory diseases and
disorders. In specific embodiments, such diseases and disorders
include, but are not limited to, bronchial adenoma, bronchial
asthma, pneumonia (such as, e.g., bronchial pneumonia,
bronchopneumonia, and tuberculous bronchopneumonia), chronic
obstructive pulmonary disease (COPD), bronchial polyps,
bronchiectasia (such as, e.g., bronchiectasia sicca, cylindrical
bronchiectasis, and saccular bronchiectasis), bronchiolar
adenocarcinoma, bronchiolar carcinoma, bronchiolitis (such as,
e.g., exudative bronchiolitis, bronchiolitis fibrosa obliterans,
and proliferative bronchiolitis), bronchiolo-alveolar carcinoma,
bronchitic asthma, bronchitis (such as, e.g., asthmatic bronchitis,
Castellani's bronchitis, chronic bronchitis, croupous bronchitis,
fibrinous bronchitis, hemorrhagic bronchitis, infectious avian
bronchitis, obliterative bronchitis, plastic bronchitis,
pseudomembranous bronchitis, putrid bronchitis, and verminous
bronchitis), bronchocentric granulomatosis, bronchoedema,
bronchoesophageal fistula, bronchogenic carcinoma, bronchogenic
cyst, broncholithiasis, bronchomalacia, bronchomycosis (such as,
e.g., bronchopulmonary aspergillosis), bronchopulmonary
spirochetosis, hemorrhagic bronchitis, bronchorrhea, bronchospasm,
bronchostaxis, bronchostenosis, Biot's respiration, bronchial
respiration, Kussmaul respiration, Kussmaul-Kien respiration,
respiratory acidosis, respiratory alkalosis, respiratory distress
syndrome of the newborn, respiratory insufficiency, respiratory
scleroma, respiratory syncytial virus, and the like.
[0373] In a specific embodiment, B lymphocyte stimulator binding
polypeptides or polynucleotides are used to treat, prevent, and/or
diagnose chronic obstructive pulmonary disease (COPD).
[0374] In another embodiment, B lymphocyte stimulator binding
polypeptides or polynucleotides are used to treat, prevent, and/or
diagnose fibroses and conditions associated with fibroses,
including, but not limited to, cystic fibrosis (including such
fibroses as cystic fibrosis of the pancreas, Clarke-Hadfield
syndrome, fibrocystic disease of the pancreas, mucoviscidosis, and
viscidosis), endomyocardial fibrosis, idiopathic retroperitoneal
fibrosis, leptomeningeal fibrosis, mediastinal fibrosis, nodular
subepidermal fibrosis, pericentral fibrosis, perimuscular fibrosis,
pipestem fibrosis, replacement fibrosis, subadventitial fibrosis,
and Symmers' clay pipestem fibrosis.
[0375] In another embodiment, therapeutic or pharmaceutical
compositions are administered to an animal to treat, prevent or
ameliorate infectious diseases. Infectious diseases include
diseases associated with yeast, fungal, viral and bacterial
infections. Viruses causing viral infections which can be treated
or prevented in accordance with this invention include, but are not
limited to, retroviruses (e.g., human T-cell lymphotrophic virus
(HTLV) types I and II and human immunodeficiency virus (HIV)),
herpes viruses (e.g., herpes simplex virus (HSV) types I and II,
Epstein-Barr virus, HHV6-HHV8, and cytomegalovirus), arenavirues
(e.g., lassa fever virus), paramyxoviruses (e.g., morbillivirus
virus, human respiratory syncytial virus, mumps, and pneumovirus),
adenoviruses, bunyaviruses (e.g., hantavirus), cornaviruses,
filoviruses (e.g., Ebola virus), flaviviruses (e.g., hepatitis C
virus (HCV), yellow fever virus, and Japanese encephalitis virus),
hepadnaviruses (e.g., hepatitis B viruses (HBV)), orthomyoviruses
(e.g., influenza viruses A, B and C), papovaviruses (e.g.,
papillomavirues), picornaviruses (e.g., rhinoviruses, enteroviruses
and hepatitis A viruses), poxviruses, reoviruses (e.g.,
rotavirues), togaviruses (e.g., rubella virus), rhabdoviruses
(e.g., rabies virus). Microbial pathogens causing bacterial
infections include, but are not limited to, Streptococcus pyogenes,
Streptococcus pneumoniae, Neisseria gonorrhoea, Neisseria
meningitidis, Corynebacterium diphtheriae, Clostridium botulinum,
Clostridium perfringens, Clostridium tetani, Haemophilus
influenzae, Klebsiella pneumoniae, Klebsiella ozaenae, Klebsiella
rhinoscleromotis, Staphylococcus aureus, Vibrio cholerae,
Escherichia coli, Pseudomonas aeruginosa, Campylobacter (Vibrio)
fetus, Campylobacter jejuni, Aeromonas hydrophile, Bacillus cereus,
Edwardsiella tarda, Yersinia enterocolitica, Yersinia pestis,
Yersinia pseudotuberculosis, Shigella dysenteriae, Shigella
flexneri, Shigella sonnei, Salmonella typhimurium, Treponema
pallidum, Treponema pertenue, Treponema carateneum, Borrelia
vincentii, Borrelia burgdorferi, Leptospira icterohemorrhagiae,
Mycobacterium tuberculosis, Toxoplasma gondii, Pneumocystis
carinii, Francisella tularensis, Brucella abortus, Brucella suis,
Brucella melitensis, Mycoplasma spp., Rickettsia prowazeki,
Rickettsia tsutsugumushi, Chlamydia spp., and Helicobacter
pylori.
Gene Therapy
[0376] In a specific embodiment, nucleic acids comprising sequences
encoding B lymphocyte stimulator binding polypeptides or functional
derivatives thereof, are administered to treat, inhibit or prevent
a disease or disorder associated with aberrant expression and/or
activity of B lymphocyte stimulator and/or its receptor, by way of
gene therapy. Gene therapy refers to therapy performed by the
administration to a subject of an expressed or expressible nucleic
acid. In this embodiment of the invention, the nucleic acids
produce their encoded protein that mediates a therapeutic
effect.
[0377] Any of the methods for gene therapy available in the art can
be used according to the present invention. Exemplary methods are
described below.
[0378] For general reviews of the methods of gene therapy, see
Goldspiel et al., Clinical Pharmacy, 12:488-505 (1993); Wu and Wu,
Biotherapy, 3:87-95 (1991); Tolstoshev, Ann. Rev. Pharmacol.
Toxicol., 32:573-596 (1993); Mulligan, Science, 260:926-932 (1993);
and Morgan and Anderson, Ann. Rev. Biochem., 62:191-217 (1993);
May, TIBTECH, 11(5):155-215 (1993). Methods commonly known in the
art of recombinant DNA technology which can be used are described
in Current Protocols in Molecular Biology, Ausubel et al., eds.
(John Wiley & Sons, NY 1993); and Kriegler, Gene Transfer and
Expression, A Laboratory Manual (Stockton Press, NY 1990).
[0379] In a preferred aspect, a composition useful in the methods
of the invention comprises, or alternatively consists of, nucleic
acids encoding a B lymphocyte stimulator binding polypeptide, said
nucleic acids being part of an expression vector that expresses the
B lymphocyte stimulator binding polypeptide or fragment thereof or
chimeric protein including it in a suitable host. In particular,
such nucleic acids have promoters, preferably heterologous
promoters, operably linked to the B lymphocyte stimulator binding
polypeptide coding region, said promoter being inducible or
constitutive, and, optionally, tissue-specific. In another
particular embodiment, nucleic acid molecules are used in which the
B lymphocyte stimulator binding polypeptide coding sequences and
any other desired sequences are flanked by regions that promote
homologous recombination at a desired site in the genome, thus
providing for intrachromosomal expression of the B lymphocyte
stimulator binding polypeptide encoding nucleic acids (Koller and
Smithies, Proc. Natl. Acad. Sci. USA, 86:8932-8935 (1989); Zijlstra
et al., Nature, 342:435-438 (1989).
[0380] Delivery of the nucleic acids into a patient may be either
direct, in which case the patient is directly exposed to the
nucleic acid or nucleic acid-carrying vectors, or indirect, in
which case, cells are first transformed with the nucleic acids in
vitro, then transplanted into the patient. These two approaches are
known, respectively, as in vivo or ex vivo gene therapy.
[0381] In a specific embodiment, the nucleic acid sequences are
directly administered in vivo, where it is expressed to produce the
encoded product. This can be accomplished by any of numerous
methods known in the art, e.g., by constructing them as part of an
appropriate nucleic acid expression vector and administering it so
that they become intracellular, e.g., by infection using defective
or attenuated retrovirals or other viral vectors (see U.S. Pat. No.
4,980,286), or by direct injection of naked DNA, or by use of
microparticle bombardment (e.g., a gene gun; Biolistic, Dupont), or
coating with lipids or cell-surface receptors or transfecting
agents, encapsulation in liposomes, microparticles, or
microcapsules, or by administering them in linkage to a peptide
which is known to enter the nucleus, by administering it in linkage
to a ligand subject to receptor-mediated endocytosis (see, e.g., Wu
and Wu, J. Biol. Chem., 262:4429-4432 (1987)) (which can be used to
target cell types specifically expressing the receptors), etc. In
another embodiment, nucleic acid-ligand complexes can be formed in
which the ligand comprises a fusogenic viral peptide to disrupt
endosomes, allowing the nucleic acid to avoid lysosomal
degradation. In yet another embodiment, the nucleic acid can be
targeted in vivo for cell specific uptake and expression, by
targeting a specific receptor (see, e.g., PCT publications WO
92/06180; WO 92/22635; WO 92/20316; WO 93/14188, WO 93/20221).
Alternatively, the nucleic acid can be introduced intracellularly
and incorporated within host cell DNA for expression, by homologous
recombination (Koller and Smithies, Proc. Natl. Acad. Sci. USA,
86:8932-8935 (1989); Zijlstra et al., Nature, 342:435-438
(1989)).
[0382] In a specific embodiment, viral vectors that contains
nucleic acid sequences encoding a B lymphocyte stimulator binding
polypeptide or fragments or variants thereof are used. For example,
a retroviral vector can be used (see Miller et al., Meth. Enzymol.,
217:581-599 (1993)). These retroviral vectors contain the
components necessary for the correct packaging of the viral genome
and integration into the host cell DNA. The nucleic acid sequences
encoding the B lymphocyte stimulator binding polypeptide to be used
in gene therapy are cloned into one or more vectors, which
facilitates delivery of the gene into a patient. Additional details
concerning retroviral vectors can be found in Boesen et al.,
Biotherapy, 6:29 1-302 (1994), which describes the use of a
retroviral vector to deliver the mdr 1 gene to hematopoietic stem
cells in order to make the stem cells more resistant to
chemotherapy. Other references illustrating the use of retroviral
vectors in gene therapy are: Clowes et al., J. Clin. Invest.,
93:644-651 (1994); Klein et al., Blood, 83:1467-1473 (1994);
Salmons and Gunzberg, Human Gene Therapy, 4:129-141 (1993); and
Grossman and Wilson, Curr. Opin. in Genetics and Devel., 3:110-114
(1993).
[0383] Other viral vectors that can be used in gene therapy are
adenoviruses. Adenoviruses are especially attractive vehicles for
delivering genes to respiratory epithelia. Adenoviruses naturally
infect respiratory epithelia, where they cause a mild disease.
Other targets for adenovirus-based delivery systems are liver, the
central nervous system, endothelial cells, and muscle. Adenoviruses
have the advantage of being capable of infecting non-dividing
cells. See, Kozarsky and Wilson, Current Opinion in Genetics and
Development, 3:499-503 (1993), presenting a review of
adenovirus-based gene therapy. Bout et al., Human Gene Therapy,
5:3-10 (1994) demonstrated the use of adenovirus vectors to
transfer genes to the respiratory epithelia of rhesus monkeys.
Other instances of the use of adenoviruses in gene therapy can be
found in Rosenfeld et al., Science, 252:431-434 (1991); Rosenfeld
et al., Cell, 68:143-155 (1992); Mastrangeli et al., J. Clin.
Invest., 91:225-234 (1993); PCT publication WO 94/12649; and Wang
et al., Gene Therapy, 2:775-783 (1995). In a preferred embodiment,
adenovirus vectors are used.
[0384] Adeno-associated virus (AAV) has also been proposed for use
in gene therapy (Walsh et al., Proc. Soc. Exp. Biol. Med.,
204:289-300 (1993); U.S. Pat. No. 5,436,146).
[0385] Another approach to gene therapy involves transferring a
gene to cells in tissue culture by such methods as electroporation,
lipofection, calcium phosphate mediated transfection, or viral
infection. Usually, the method of transfer includes the transfer of
a selectable marker to the cells. The cells are then placed under
selection to isolate those cells that have taken up and are
expressing the transferred gene. Those cells are then delivered to
a patient.
[0386] In this embodiment, the nucleic acid is introduced into a
cell prior to administration in vivo of the resulting recombinant
cell. Such introduction can be carried out by any method known in
the art, including but not limited to transfection,
electroporation, microinjection, infection with a viral or
bacteriophage vector containing the nucleic acid sequences, cell
fusion, chromosome-mediated gene transfer, microcell-mediated gene
transfer, spheroplast fusion, etc. Numerous techniques are known in
the art for the introduction of foreign genes into cells (see,
e.g., Loeffler and Behr, Meth. Enzymol., 217:599-618 (1993); Cohen
et al., Meth. Enzymol., 217:618-644 (1993); Clin. Pharma. Ther.,
29:69-92m (1985)) and may be used in accordance with the present
invention, provided that the necessary developmental and
physiological functions of the recipient cells are not disrupted.
The technique should provide for the stable transfer of the nucleic
acid to the cell, so that the nucleic acid is expressible by the
cell and preferably heritable and expressible by its cell
progeny.
[0387] The resulting recombinant cells can be delivered to a
patient by various methods known in the art. Recombinant blood
cells (e.g., hematopoietic stem or progenitor cells) are preferably
administered intravenously. The amount of cells envisioned for use
depends on the desired effect, patient state, etc., and can be
determined by one skilled in the art.
[0388] Cells into which a nucleic acid can be introduced for
purposes of gene therapy encompass any desired, available cell
type, and include but are not limited to epithelial cells,
endothelial cells, keratinocytes, fibroblasts, muscle cells,
hepatocytes; blood cells such as T lymphocytes, B lymphocytes,
monocytes, macrophages, neutrophils, eosinophils, megakaryocytes,
granulocytes; various stem or progenitor cells, in particular
hematopoietic stem or progenitor cells, e.g., as obtained from bone
marrow, umbilical cord blood, peripheral blood, fetal liver,
etc.
[0389] In a preferred embodiment, the cell used for gene therapy is
autologous to the patient.
[0390] In an embodiment in which recombinant cells are used in gene
therapy, nucleic acid sequences encoding a B lymphocyte stimulator
binding polypeptide or fragment thereof are introduced into the
cells such that they are expressible by the cells or their progeny,
and the recombinant cells are then administered in vivo for
therapeutic effect. In a specific embodiment, stem or progenitor
cells are used. Any stem and/or progenitor cells that can be
isolated and maintained in vitro can potentially be used in
accordance with this embodiment of the present invention (see,
e.g., PCT publication WO 94/08598; Stemple and Anderson, Cell, 7
1:973-985 (1992); Rheinwald, Meth. Cell Bio., 21A:229 (1980); and
Pittelkow and Scott, Mayo Clinic Proc., 61:771 (1986)).
[0391] In a specific embodiment, the nucleic acid to be introduced
for purposes of gene therapy comprises an inducible promoter
operably linked to the coding region, such that expression of the
nucleic acid is controllable by controlling the presence or absence
of the appropriate inducer of transcription.
Demonstration of Therapeutic or Prophylactic Utility of a
Composition
[0392] The compounds are preferably tested in vitro, and then in
vivo for the desired therapeutic or prophylactic activity, prior to
use in humans. For example, in vitro assays which can be used to
determine whether administration of a specific B lymphocyte
stimulator binding polypeptide or composition of the present
invention is indicated, include in vitro cell culture assays in
which a patient tissue sample is grown in culture, and exposed to,
or otherwise administered, a B lymphocyte stimulator binding
polypeptide or composition of the present invention, and the effect
of such a B lymphocyte stimulator binding polypeptide or
composition of the present invention upon the tissue sample is
observed. In various specific embodiments, in vitro assays can be
carried out with representative cells of cell types involved in a
patient's disorder, to determine if a B lymphocyte stimulator
binding polypeptide or composition of the present invention has a
desired effect upon such cell types. Preferably, the B lymphocyte
stimulator binding polypeptides or compositions are also tested in
in vitro assays and animal model systems prior to administration to
humans.
[0393] B lymphocyte stimulator binding polypeptides or compositions
of the present invention for use in therapy can be tested for their
toxicity in suitable animal model systems, including but not
limited to rats, mice, chicken, cows, monkeys, and rabbits. For in
vivo testing of a B lymphocyte stimulator binding polypeptide or
composition's toxicity any animal model system known in the art may
be used.
[0394] Efficacy in treating or preventing viral infection may be
demonstrated by detecting the ability of a B lymphocyte stimulator
binding polypeptide or composition to inhibit the replication of
the virus, to inhibit transmission or prevent the virus from
establishing itself in its host, or to prevent, ameliorate or
alleviate the symptoms of disease a progression. The treatment is
considered therapeutic if there is, for example, a reduction in
viral load, amelioration of one or more symptoms, or a decrease in
mortality and/or morbidity following administration of a B
lymphocyte stimulator binding polypeptide or composition.
[0395] B lymphocyte stimulator binding polypeptides or compositions
can be tested for the ability to induce the expression of cytokines
such as IFN-.gamma., by contacting cells, preferably human cells,
with a B lymphocyte stimulator binding polypeptide or composition
or a control B lymphocyte stimulator binding polypeptide or control
composition and determining the ability of the B lymphocyte
stimulator binding polypeptide or composition to induce one or more
cytokines Techniques known to those skilled in the art can be used
to measure the level of expression of cytokines. For example, the
level of expression of cytokines can be measured by analyzing the
level of RNA of cytokines by, for example, RT-PCR and Northern blot
analysis, and by analyzing the level of cytokines by, for example,
immunoprecipitation followed by western blot analysis and ELISA. In
a preferred embodiment, a compound is tested for its ability to
induce the expression of IFN-.gamma..
[0396] B lymphocyte stimulator binding polypeptides or compositions
can be tested for their ability to modulate the biological activity
of immune cells by contacting immune cells, preferably human immune
cells (e.g., T cells, B cells, and Natural Killer cells), with a B
lymphocyte stimulator binding polypeptide or composition or a
control compound and determining the ability of the B lymphocyte
stimulator binding polypeptide or composition to modulate (i.e,
increase or decrease) the biological activity of immune cells. The
ability of a B lymphocyte stimulator binding polypeptide or
composition to modulate the biological activity of immune cells can
be assessed by detecting the expression of antigens, detecting the
proliferation of immune cells (i.e., B cell proliferation),
detecting the activation of signaling molecules, detecting the
effector function of immune cells, or detecting the differentiation
of immune cells. Techniques known to those of skill in the art can
be used for measuring these activities. For example, cellular
proliferation can be assayed by .sup.3H-thymidine incorporation
assays and trypan blue cell counts. Antigen expression can be
assayed, for example, by immunoassays including, but not limited
to, competitive and non-competitive assay systems using techniques
such as western blots, immunohistochemistry radioimmunoassays,
ELISA (enzyme linked immunosorbent assay), "sandwich" immunoassays,
immunoprecipitation assays, precipitin reactions, gel diffusion
precipitin reactions, immunodiffusion assays, agglutination assays,
complement-fixation assays, immunoradiometric assays, fluorescent
immunoassays, protein A immunoassays and FACS analysis. The
activation of signaling molecules can be assayed, for example, by
kinase assays and electrophoretic shift assays (EMSAs). In a
preferred embodiment, the ability of a B lymphocyte stimulator
binding polypeptide or composition to induce B cell proliferation
is measured. In another preferred embodiment, the ability of a B
lymphocyte stimulator binding polypeptide or composition to
modulate immunoglobulin expression is measured.
[0397] B lymphocyte stimulator binding polypeptides or compositions
can be tested for their ability to reduce tumor formation in in
vitro, ex vivo and in vivo assays. B lymphocyte stimulator binding
polypeptides or compositions can also be tested for their ability
to inhibit viral replication or reduce viral load in in vitro and
in vivo assays. B lymphocyte stimulator binding polypeptides or
compositions can also be tested for their ability to reduce
bacterial numbers in in vitro and in vivo assays known to those of
skill in the art. B lymphocyte stimulator binding polypeptides or
compositions can also be tested for their ability to alleviate of
one or more symptoms associated with cancer, an immune disorder
(e.g., an inflammatory disease), a neurological disorder or an
infectious disease. B lymphocyte stimulator binding polypeptides or
compositions can also be tested for their ability to decrease the
time course of the infectious disease. Further, B lymphocyte
stimulator binding polypeptides or compositions can be tested for
their ability to increase the survival period of animals suffering
from disease or disorder, including cancer, an immune disorder or
an infectious disease. Techniques known to those of skill in the
art can be used to analyze the function of the B lymphocyte
stimulator binding polypeptides or compositions in vivo.
Therapeutic/Prophylactic Compositions and Administration
[0398] The invention provides methods of treatment, inhibition and
prophylaxis by administration to a subject of an effective amount
of B lymphocyte stimulator binding polypeptide (or fragment or
variant thereof) or pharmaceutical composition, preferably a B
lymphocyte stimulator binding polypeptide. In a preferred aspect, a
B lymphocyte stimulator binding polypeptide or fragment or variant
thereof is substantially purified (i.e., substantially free from
substances that limit its effect or produce undesired
side-effects). The subject is preferably an animal, including but
not limited to, animals such as cows, pigs, horses, chickens, cats,
dogs, etc., and is preferably a mammal, and most preferably a
human.
[0399] Formulations and methods of administration that can be
employed when the compound comprises a nucleic acid or an
immunoglobulin are described above; additional appropriate
formulations and routes of administration can be selected from
among those described herein below.
[0400] Various delivery systems are known and can be used to
administer B lymphocyte stimulator binding polypeptide or fragment
or variant thereof, e.g., encapsulation in liposomes,
microparticles, microcapsules, recombinant cells capable of
expressing the B lymphocyte stimulator binding polypeptide or B
lymphocyte stimulator binding polypeptide fragment,
receptor-mediated endocytosis (see, e.g., Wu and Wu, J. Biol.
Chem., 262:4429-4432 (1987)), construction of a nucleic acid as
part of a retroviral or other vector, etc. Methods of introduction
include, but are not limited to, intradermal, intramuscular,
intraperitoneal, intravenous, subcutaneous, intranasal, epidural,
and oral routes. The compositions may be administered by any
convenient route, for example by infusion or bolus injection, by
absorption through epithelial or mucocutaneous linings (e.g., oral
mucosa, rectal and intestinal mucosa, etc.) and may be administered
together with other biologically active agents. Administration can
be systemic or local. In addition, it may be desirable to introduce
the pharmaceutical compositions into the central nervous system by
any suitable route, including intraventricular and intrathecal
injection; intraventricular injection may be facilitated by an
intraventricular catheter, for example, attached to a reservoir,
such as an Ommaya reservoir. Pulmonary administration can also be
employed, e.g., by use of an inhaler or nebulizer, and formulation
with an aerosolizing agent.
[0401] In a specific embodiment, it may be desirable to administer
the pharmaceutical compositions locally to the area in need of
treatment; this may be achieved by, for example, and not by way of
limitation, local infusion during surgery, topical application,
e.g., in conjunction with a wound dressing after surgery, by
injection, by means of a catheter, by means of a suppository, or by
means of an implant, said implant being of a porous, non-porous, or
gelatinous material, including membranes, such as sialastic
membranes, or fibers. Preferably, when administering a protein,
including a B lymphocyte stimulator binding polypeptide, care must
be taken to use materials to which the protein does not absorb.
[0402] In another embodiment, the composition can be delivered in a
vesicle, in particular a liposome (see, Langer, Science,
249:1527-1533 (1990); Treat et al., in Liposomes in the Therapy of
Infectious Disease and Cancer, Lopez-Berestein and Fidler, eds.
(Liss, New York 1989), pp. 353-365; Lopez-Berestein, ibid., pp.
317-327; see, generally, ibid.).
[0403] In yet another embodiment, the composition can be delivered
in a controlled release system. In one embodiment, a pump may be
used (see Langer, supra; Sefton, CRC Crit. Ref Biomed. Eng., 14:201
(1987); Buchwald et al., Surgery, 88:507 (1980); Saudek et al., N.
Engl. J. Med., 321:574 (1989)). In another embodiment, polymeric
materials can be used (see, Medical Applications of Controlled
Release, Langer and Wise, eds. (CRC Press, Boca Raton, Fla. 1974);
Controlled Drug Bioavailability, Drug Product Design and
Performance, Smolen and Ball, eds. (Wiley, New York 1984); Ranger
and Peppas, Macromol. Sci. Rev. Macromol. Chem., 23:61 (1983); see
also Levy et al., Science, 228:190 (1985); During et al., Ann.
Neurol., 25:35 1 (1989); Howard et al., J. Neurosurg., 7 1:105
(1989)). In yet another embodiment, a controlled release system can
be placed in proximity of the therapeutic target, e.g., the brain,
thus requiring only a fraction of the systemic dose (see, e.g.,
Goodson, in Medical Applications of Controlled Release, supra, vol.
2, pp. 115-138 (1984)). Other controlled release systems are
discussed in the review by Langer (Science, 249:1527-1533
(1990)).
[0404] In a specific embodiment where the composition to be used in
the method of the invention is a nucleic acid encoding a protein,
the nucleic acid can be administered in vivo to promote expression
of its encoded protein, by constructing it as part of an
appropriate nucleic acid expression vector and administering it so
that it becomes intracellular, e.g., by use of a retroviral vector
(see U.S. Pat. No. 4,980,286), or by direct injection, or by use of
microparticle bombardment (e.g., a gene gun; Biolistic, Dupont), or
coating with lipids or cell-surface receptors or transfecting
agents, or by administering it in linkage to a homeobox-like
peptide which is known to enter the nucleus (see, e.g., Joliot et
al., Proc. Natl. Acad. Sci. USA, 88:1864-1868 (1991)), etc.
Alternatively, a nucleic acid can be introduced intracellularly and
incorporated within host cell DNA for expression, by homologous
recombination.
[0405] The present invention also provides pharmaceutical
compositions. Such compositions comprise a therapeutically
effective amount of a B lymphocyte stimulator binding polypeptide
or a fragment thereof, and a pharmaceutically acceptable carrier.
In a specific embodiment, the term "pharmaceutically acceptable"
means approved by a regulatory agency of the Federal or a state
government or listed in the U.S. Pharmacopeia or other generally
recognized pharmacopeia for use in animals, and more particularly
in humans. The term "carrier" refers to a diluent, adjuvant,
excipient, or vehicle with which the therapeutic is administered.
Such pharmaceutical carriers can be sterile liquids, such as water
and oils, including those of petroleum, animal, vegetable or
synthetic origin, such as peanut oil, soybean oil, mineral oil,
sesame oil and the like. Water is a preferred carrier when the
pharmaceutical composition is administered intravenously. Saline
solutions and aqueous dextrose and glycerol solutions can also be
employed as liquid carriers, particularly for injectable solutions.
Suitable pharmaceutical excipients include starch, glucose,
lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel,
sodium stearate, glycerol monostearate, talc, sodium chloride,
dried skim milk, glycerol, propylene, glycol, water, ethanol and
the like. The composition, if desired, can also contain minor
amounts of wetting or emulsifying agents, or pH buffering agents.
These compositions can take the form of solutions, suspensions,
emulsion, tablets, pills, capsules, powders, sustained-release
formulations, and the like. The composition can be formulated as a
suppository, with traditional binders and carriers such as
triglycerides. Oral formulation can include standard carriers such
as pharmaceutical grades of mannitol, lactose, starch, magnesium
stearate, sodium saccharine, cellulose, magnesium carbonate, etc.
Examples of suitable pharmaceutical carriers are described in
Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed. (Mack
Publishing Co., 1990). Such compositions will contain a
therapeutically effective amount of the B lymphocyte stimulator
binding polypeptide or fragment thereof, preferably in purified
form, together with a suitable amount of carrier so as to provide
the form for proper administration to the patient. The formulation
should suit the mode of administration.
[0406] In a preferred embodiment, the composition is formulated in
accordance with routine procedures as a pharmaceutical composition
adapted for intravenous administration to human beings. Typically,
compositions for intravenous administration are solutions in
sterile isotonic aqueous buffer. Where necessary, the composition
may also include a solubilizing agent and a local anesthetic such
as lignocamne to ease pain at the site of the injection. Generally,
the ingredients are supplied either separately or mixed together in
unit dosage form, for example, as a dry lyophilized powder or water
free concentrate in a hermetically sealed container such as an
ampoule or sachette indicating the quantity of active agent. Where
the composition is to be administered by infusion, it can be
dispensed with an infusion bottle containing sterile pharmaceutical
grade water or saline. Where the composition is administered by
injection, an ampoule of sterile water for injection or saline can
be provided so that the ingredients may be mixed prior to
administration.
[0407] The compositions for use in the methods of the invention can
be formulated as neutral or salt forms. Pharmaceutically acceptable
salts include those formed with anions such as those derived from
hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and
those formed with cations such as those derived from sodium,
potassium, ammonium, calcium, ferric hydroxides, isopropylamine,
triethylamine, 2-ethylaminoethanol, histidine, procaine, etc.
[0408] The amount of the composition which will be effective in the
treatment, inhibition and prevention of a disease or disorder
associated with aberrant expression and/or activity of a
polypeptide can be determined by standard clinical techniques. In
addition, in vitro assays may optionally be employed to help
identify optimal dosage ranges. The precise dose to be employed in
the formulation will also depend on the route of administration,
and the seriousness of the disease or disorder, and should be
decided according to the judgment of the practitioner and each
patient's circumstances. Effective doses may be extrapolated from
dose-response curves derived from in vitro or animal model test
systems.
[0409] For B lymphocyte stimulator binding polypeptides, the dosage
administered to a patient is typically 0.1 mg/kg to 100 mg/kg of
the patient's body weight. Preferably, the dosage administered to a
patient is between 0.1 mg/kg and 20 mg/kg of the patient's body
weight, more preferably 1 mg/kg to 10 mg/kg of the patient's body
weight. Further, the dosage and frequency of administration of
therapeutic or pharmaceutical compositions may be reduced by
enhancing uptake and tissue penetration (e.g., into the brain) of
the B lymphocyte stimulator binding polypeptides by modifications
such as, for example, lipidation.
[0410] The B lymphocyte stimulator binding polypeptides and B
lymphocyte stimulator binding polypeptide compositions may be
administered alone or in combination with other molecules including
B lymphocyte stimulator. In further embodiments of the invention,
the B lymphocyte stimulator binding polypeptides are administered
in complex with B lymphocyte stimulator. Preferably the B
lymphocyte stimulator binding polypeptide is radiolabelled or in
complex with a radioisotope, toxin, or prodrug. Combinations may be
administered either concomitantly, e.g., as an admixture,
separately but simultaneously or concurrently; or sequentially.
This includes presentations in which the combined agents are
administered together as a therapeutic mixture, and also procedures
in which the combined agents are administered separately but
simultaneously, e.g., as through separate intravenous lines into
the same individual. Administration "in combination" further
includes the separate administration of one of the compounds or
agents given first, followed by the second.
[0411] The B lymphocyte stimulator binding polypeptides and B
lymphocyte stimulator binding polypeptide compositions may be
administered alone or in combination with other adjuvants.
Adjuvants that may be administered with the B lymphocyte stimulator
binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions include, but are not limited to, alum,
alum plus deoxycholate (ImmunoAg), MTP-PE (Biocine Corp.), QS21
(Genentech, Inc.), BCG, and MPL. In a specific embodiment, B
lymphocyte stimulator binding polypeptides and B lymphocyte
stimulator binding polypeptide compositions are administered in
combination with alum. In another specific embodiment, B lymphocyte
stimulator binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions are administered in combination with
QS-21. Further adjuvants that may be administered with the B
lymphocyte stimulator binding polypeptides and B lymphocyte
stimulator binding polypeptide compositions include, but are not
limited to, Monophosphoryl lipid immunomodulator, AdjuVax 100a,
QS-21, QS-18, CRL1005, Aluminum salts, MF-59, and Virosomal
adjuvant technology. Vaccines that may be administered with the B
lymphocyte stimulator binding polypeptides and B lymphocyte
stimulator binding polypeptide compositions include, but are not
limited to, vaccines directed toward protection against MMR
(measles, mumps, rubella), polio, varicella, tetanus/diptheria,
hepatitis A, hepatitis B, haemophilus influenzae B, whooping cough,
pneumonia, influenza, Lyme's Disease, rotavirus, cholera, yellow
fever, Japanese encephalitis, poliomyelitis, rabies, typhoid fever,
and pertussis, and/or PNEUMOVAX-23.TM..
[0412] In another specific embodiment, B lymphocyte stimulator
binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions are used in combination with
PNEUMOVAX-23.TM. (Pneumonococcal vaccine polyvalent) to treat,
prevent, and/or diagnose infection and/or any disease, disorder,
and/or condition associated therewith. In one embodiment, B
lymphocyte stimulator binding polypeptides and B lymphocyte
stimulator binding polypeptide compositions are used in combination
with PNEUMOVAX-23.TM. to treat, prevent, and/or diagnose any Gram
positive bacterial infection and/or any disease, disorder, and/or
condition associated therewith. In another embodiment, B lymphocyte
stimulator binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions are used in combination with
PNEUMOVAX-23.TM. to treat, prevent, and/or diagnose infection
and/or any disease, disorder, and/or condition associated with one
or more members of the genus Enterococcus and/or the genus
Streptococcus. In another embodiment, B lymphocyte stimulator
binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions are used in any combination with
PNEUMOVAX-23.TM. to treat, prevent, and/or diagnose infection
and/or any disease, disorder, and/or condition associated with one
or more members of the Group B streptococci. In another embodiment,
B lymphocyte stimulator binding polypeptides and B lymphocyte
stimulator binding polypeptide compositions are used in combination
with PNEUMOVAX-23.TM. to treat, prevent, and/or diagnose infection
and/or any disease, disorder, and/or condition associated with
Streptococcus pneumoniae.
[0413] The B lymphocyte stimulator binding polypeptides and B
lymphocyte stimulator binding polypeptide compositions may be
administered alone or in combination with other therapeutic agents,
including but not limited to, chemotherapeutic agents, antibiotics,
antivirals, steroidal and non-steroidal anti-inflammatories,
conventional immunotherapeutic agents and cytokines Combinations
may be administered either concomitantly, e.g., as an admixture,
separately but simultaneously or concurrently; or sequentially.
This includes presentations in which the combined agents are
administered together as a therapeutic mixture, and also procedures
in which the combined agents are administered separately but
simultaneously, e.g., as through separate intravenous lines into
the same individual. Administration "in combination" further
includes the separate administration of one of the compounds or
agents given first, followed by the second.
[0414] In one embodiment, the B lymphocyte stimulator binding
polypeptides and B lymphocyte stimulator binding polypeptide
compositions are administered in combination with other members of
the TNF family. TNF, TNF-related or TNF-like molecules that may be
administered with the B lymphocyte stimulator binding polypeptides
and B lymphocyte stimulator binding polypeptide compositions
include, but are not limited to, soluble forms of TNF-alpha,
lymphotoxin-alpha (LT-alpha, also known as TNF-beta), LT-beta
(found in complex heterotrimer LT-alpha2-beta), OPGL, FasL, CD27L,
CD30L, CD40L, 4-1BBL, DcR3, OX40L, TNF-gamma (PCT publication WO
96/14328), TRAIL, AIM-II (PCT publication WO 97/34911), APRIL (J.
Exp. Med., 188(6):1185-1190 (1998)), endokine-alpha (PCT
publication WO 98/07880), Neutrokine-alpha (PCT publication WO
98/18921), OPG, OX40, and nerve growth factor (NGF), and soluble
forms of fas, CD30, CD27, CD40 and 4-IBB, TR2 (PCT publication WO
96/34095), DR3 (PCT publication WO 97/33904), DR4 (PCT publication
WO 98/32856), TR5 (PCT publication WO 98/30693), TR6 (PCT
publication WO 98/30694), TR7 (PCT publication WO 98/41629), TRANK,
TR9 (PCT publication WO 98/56892), 312C2 (PCT publication WO
98/06842), and TR12, and soluble forms CD154, CD70, and CD153.
[0415] In a preferred embodiment, the B lymphocyte stimulator
binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions are administered in combination with CD40
ligand (CD40L), a soluble form of CD40L (e.g., AVREND.TM.),
bioloigically active fragments, variants, or derivatives of CD40L,
anti-CD40L antibodies (e.g., agonistic or antagonistic antibodies),
and/or anti-CD40 antibodies (e.g., agonistic or antagonistic
antibodies).
[0416] In an additional embodiment, the B lymphocyte stimulator
binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions are administered alone or in combination
with an anti-angiogenic agent(s). Anti-angiogenic agents that may
be administered with the B lymphocyte stimulator binding
polypeptides and B lymphocyte stimulator binding polypeptide
compositions include, but are not limited to, Angiostatin
(Entremed, Rockville, Md.), Troponin-1 (Boston Life Sciences,
Boston, Mass.), anti-Invasive Factor, retinoic acid and derivatives
thereof, paclitaxel (Taxol), Suramin, Tissue Inhibitor of
Metalloproteinase-1, Tissue Inhibitor of Metalloproteinase-2, VEGI,
Plasminogen Activator Inhibitor-1, Plasminogen Activator
Inhibitor-2, and various forms of the lighter "d group" transition
metals.
[0417] Lighter "d group" transition metals include, for example,
vanadium, molybdenum, tungsten, titanium, niobium, and tantalum
species. Such transition metal species may form transition metal
complexes. Suitable complexes of the above-mentioned transition
metal species include oxo transition metal complexes.
[0418] Representative examples of vanadium complexes include oxo
vanadium complexes such as vanadate and vanadyl complexes. Suitable
vanadate complexes include metavanadate and orthovanadate complexes
such as, for example, ammonium metavanadate, sodium metavanadate,
and sodium orthovanadate. Suitable vanadyl complexes include, for
example, vanadyl acetylacetonate and vanadyl sulfate including
vanadyl sulfate hydrates such as vanadyl sulfate mono- and
trihydrates.
[0419] Representative examples of tungsten and molybdenum complexes
also include oxo complexes. Suitable oxo tungsten complexes include
tungstate and tungsten oxide complexes. Suitable tungstate
complexes include ammonium tungstate, calcium tungstate, sodium
tungstate dihydrate, and tungstic acid. Suitable tungsten oxides
include tungsten (IV) oxide and tungsten (VI) oxide. Suitable oxo
molybdenum complexes include molybdate, molybdenum oxide, and
molybdenyl complexes. Suitable molybdate complexes include ammonium
molybdate and its hydrates, sodium molybdate and its hydrates, and
potassium molybdate and its hydrates. Suitable molybdenum oxides
include molybdenum (VI) oxide, molybdenum (VI) oxide, and molybdic
acid. Suitable molybdenyl complexes include, for example,
molybdenyl acetylacetonate. Other suitable tungsten and molybdenum
complexes include hydroxo derivatives derived from, for example,
glycerol, tartaric acid, and sugars.
[0420] A wide variety of other anti-angiogenic factors may also be
utilized within the context of the present invention.
Representative examples include, but are not limited to, platelet
factor 4; protamine sulphate; sulphated chitin derivatives
(prepared from queen crab shells), (Murata et al., Cancer Res.,
51:22-26, 1991); Sulphated Polysaccharide Peptidoglycan Complex
(SP-PG) (the function of this compound may be enhanced by the
presence of steroids such as estrogen, and tamoxifen citrate);
Staurosporine; modulators of matrix metabolism, including for
example, proline analogs, cishydroxyproline,
d,L-3,4-dehydroproline, Thiaproline, alpha,alpha-dipyridyl,
aminopropionitrile fumarate;
4-propyl-5-(4-pyridinyl)-2(3H)-oxazolone; Methotrexate;
Mitoxantrone; Heparin; Interferons; 2 Macroglobulin-serum; ChIMP-3
(Pavloff et al., J. Bio. Chem., 267:17321-17326, 1992); Chymostatin
(Tomkinson et al., Biochem J., 286:475-480, 1992); Cyclodextrin
Tetradecasulfate; Eponemycin; Camptothecin; Fumagillin (Ingber et
al., Nature, 348:555-557, 1990); Gold Sodium Thiomalate ("GST";
Matsubara and Ziff, J. Clin. Invest., 79:1440-1446, 1987);
anticollagenase-serum; alpha2-antiplasmin (Holmes et al., J. Biol.
Chem., 262(4):1659-1664, 1987); Bisantrene (National Cancer
Institute); Lobenzarit disodium
(N-(2)-carboxyphenyl-4-chloroanthronilic acid disodium or "CCA";
(Takeuchi et al., Agents Actions, 36:312-316, 1992); and
metalloproteinase inhibitors such as BB94.
[0421] Additional anti-angiogenic factors that may also be utilized
within the context of the present invention include Thalidomide,
(Celgene, Warren, N.J.); Angiostatic steroid; AGM-1470 (Brem and
Folkman, J. Pediatr. Surg., 28:445-51 (1993)); an integrin alpha v
beta 3 antagonist (Storgard et al., J. Clin. Invest., 103:47-54
(1999)); carboxynaminolmidazole; Carboxyamidotriazole (CAI)
(National Cancer Institute, Bethesda, Md.); Conbretastatin A-4
CA4P) (OXiGENE, Boston, Mass.); Squalamine (Magainin
Pharmaceuticals, Plymouth Meeting, Pa.); TNP-470, (Tap
Pharmaceuticals, Deerfield, Ill.); ZD-0101 AstraZeneca (London,
UK); APRA (CT2584); Benefin, Byrostatin-1 (SC339555); CGP-41251
(PKC 412); CM101; Dexrazoxane (ICRF187); DMXAA; Endostatin;
Flavopridiol; Genestein; GTE; ImmTher; Iressa (ZD1839); Octreotide
(Somatostatin); Panretin; Penacillamine; Photopoint; PI-88;
Prinomastat (AG-3340) Purlytin; Suradista (FCE26644); Tamoxifen
(Nolvadex); Tazarotene; Tetrathiomolybdate; Xeloda (Capecitabine);
and 5-Fluorouracil.
[0422] Anti-angiogenic agents that may be administered in
combination with the compounds may work through a variety of
mechanisms including, but not limited to, inhibiting proteolysis of
the extracellular matrix, blocking the function of endothelial
cell-extracellular matrix adhesion molecules, by antagonizing the
function of angiogenesis inducers such as growth factors, and
inhibiting integrin receptors expressed on proliferating
endothelial cells. Examples of anti-angiogenic inhibitors that
interfere with extracellular matrix proteolysis and which may be
administered in combination with the B lymphocyte stimulator
binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions include, but are not limited to, AG-3340
(Agouron, La Jolla, Calif.), BAY-12-9566 (Bayer, West Haven,
Conn.), BMS-275291 (Bristol Myers Squibb, Princeton, N.J.),
CGS-27032A (Novartis, East Hanover, N.J.), Marimastat (British
Biotech, Oxford, UK), and Metastat (Aeterna, St-Foy, Quebec).
Examples of anti-angiogenic inhibitors that act by blocking the
function of endothelial cell-extracellular matrix adhesion
molecules and which may be administered in combination with the B
lymphocyte stimulator binding polypeptides and B lymphocyte
stimulator binding polypeptide compositions include, but are not
limited to, EMD-121974 (Merck KcgaA Darmstadt, Germany) and Vitaxin
(Ixsys, La Jolla, Calif./Medimmune, Gaithersburg, Md.). Examples of
anti-angiogenic agents that act by directly antagonizing or
inhibiting angiogenesis inducers and which may be administered in
combination with the B lymphocyte stimulator binding polypeptides
and B lymphocyte stimulator binding polypeptide compositions
include, but are not limited to, Angiozyme (Ribozyme, Boulder,
Colo.), Anti-VEGF B lymphocyte stimulator binding polypeptide
(Genentech, S. San Francisco, Calif.), PTK-787/ZK-225846 (Novartis,
Basel, Switzerland), SU-101 (Sugen, S. San Francisco, Calif.),
SU-5416 (Sugen/Pharmacia Upjohn, Bridgewater, N.J.), and SU-6668
(Sugen). Other anti-angiogenic agents act to indirectly inhibit
angiogenesis. Examples of indirect inhibitors of angiogenesis which
may be administered in combination with the B lymphocyte stimulator
binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions include, but are not limited to, IM-862
(Cytran, Kirkland, Wash.), Interferon-alpha, IL-12 (Roche, Nutley,
N.J.), and Pentosan polysulfate (Georgetown University, Washington,
D.C.).
[0423] In particular embodiments, the use of B lymphocyte
stimulator binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions in combination with anti-angiogenic agents
is contemplated for the treatment, prevention, and/or amelioration
of an autoimmune disease, such as for example, an autoimmune
disease described herein.
[0424] In a particular embodiment, the use of B lymphocyte
stimulator binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions in combination with anti-angiogenic agents
is contemplated for the treatment, prevention, and/or amelioration
of arthritis. In a more particular embodiment, the use of B
lymphocyte stimulator binding polypeptides and B lymphocyte
stimulator binding polypeptide compositions in combination with
anti-angiogenic agents is contemplated for the treatment,
prevention, and/or amelioration of rheumatoid arthritis.
[0425] In another embodiment, B lymphocyte stimulator binding
polypeptides and B lymphocyte stimulator binding polypeptide
compositions are administered in combination with an anticoagulant.
Anticoagulants that may be administered with the B lymphocyte
stimulator binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions include, but are not limited to, heparin,
warfarin, and aspirin. In a specific embodiment, B lymphocyte
stimulator binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions are administered in combination with
heparin and/or warfarin. In another specific embodiment, B
lymphocyte stimulator binding polypeptides and B lymphocyte
stimulator binding polypeptide compositions are administered in
combination with warfarin. In another specific embodiment, B
lymphocyte stimulator binding polypeptides and B lymphocyte
stimulator binding polypeptide compositions are administered in
combination with warfarin and aspirin. In another specific
embodiment, B lymphocyte stimulator binding polypeptides and B
lymphocyte stimulator binding polypeptide compositions are
administered in combination with heparin. In another specific
embodiment, B lymphocyte stimulator binding polypeptides and B
lymphocyte stimulator binding polypeptide compositions are
administered in combination with heparin and aspirin.
[0426] In another embodiment, B lymphocyte stimulator binding
polypeptides and B lymphocyte stimulator binding polypeptide
compositions are administered in combination with an agent that
suppresses the production of anticardiolipin antibodies. In
specific embodiments, the polypeptides are administered in
combination with an agent that blocks and/or reduces the ability of
anticardiolipin antibodies to bind phospholipid-binding plasma
protein beta 2-glycoprotein I (b2GPI).
[0427] In certain embodiments, B lymphocyte stimulator binding
polypeptides and B lymphocyte stimulator binding polypeptide
compositions are administered in combination with anti-retroviral
agents, nucleoside reverse transcriptase inhibitors, non-nucleoside
reverse transcriptase inhibitors, and/or protease inhibitors.
Nucleoside reverse transcriptase inhibitors that may be
administered in combination with the B lymphocyte stimulator
binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions, include, but are not limited to,
RETROVIR.TM. (zidovudine/AZT), VIDEX.TM. (didanosine/ddI),
HIVID.TM. (zalcitabine/ddC), ZERIT.TM. (stavudine/d4T), EPIVIR.TM.
(lamivudine/3TC), and COMBIVIR.TM. (zidovudine/lamivudine).
Non-nucleoside reverse transcriptase inhibitors that may be
administered in combination with the B lymphocyte stimulator
binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions, include, but are not limited to,
VIRAMUNE.TM. (nevirapine), RESCRIPTOR.TM. (delavirdine), and
SUSTIVAT.TM. (efavirenz). Protease inhibitors that may be
administered in combination with the B lymphocyte stimulator
binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions, include, but are not limited to,
CRIXIVAN.TM. (indinavir), NORVIR.TM. (ritonavir), INVIRASE.TM.
(saquinavir), and VIRACEPT.TM. (nelfinavir). In a specific
embodiment, antiretroviral agents, nucleoside reverse transcriptase
inhibitors, non-nucleoside reverse transcriptase inhibitors, and/or
protease inhibitors may be used in any combination with B
lymphocyte stimulator binding polypeptides and B lymphocyte
stimulator binding polypeptide compositions to treat, prevent,
and/or diagnose AIDS and/or to treat, prevent, and/or diagnose HIV
infection.
[0428] In other embodiments, B lymphocyte stimulator binding
polypeptides and B lymphocyte stimulator binding polypeptide
compositions may be administered in combination with
anti-opportunistic infection agents. Anti-opportunistic agents that
may be administered in combination with the B lymphocyte stimulator
binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions, include, but are not limited to,
trimethoprim-sulfamethoxazole, DAPSONE.TM. (diamino diphenyl
sulfone), pentamidine, atovaquone, isoniazid, rifampin,
PYRAZINAMIDE.TM. (pyrazinamide), ethambutol, rifabutin,
clarithromycin, azithromycin, ganciclovir, foscarnet, cidofovir,
fluconazole, itraconazole, ketoconazole, acyclovir, famciclovir,
pyrimethamine, leucovorin, NEUPOGEN.TM. (filgrastim/G-CSF), and
LEUKINE.TM. (sargramostim/GM-CSF). In a specific embodiment, B
lymphocyte stimulator binding polypeptides and B lymphocyte
stimulator binding polypeptide compositions are used in any
combination with trimethoprim-sulfamethoxazole, DAPSONE.TM.
(diamino diphenyl sulfone), pentamidine, and/or atovaquone to
prophylactically treat, prevent, and/or diagnose an opportunistic
Pneumocystis carinii pneumonia infection. In another specific
embodiment, B lymphocyte stimulator binding polypeptides and B
lymphocyte stimulator binding polypeptide compositions are used in
any combination with isoniazid, rifampin, PYRAZINAMIDE.TM.
(pyrazinamide), and/or ethambutol to prophylactically treat,
prevent, and/or diagnose an opportunistic Mycobacterium avium
complex infection. In another specific embodiment, B lymphocyte
stimulator binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions are used in any combination with
rifabutin, clarithromycin, and/or azithromycin to prophylactically
treat, prevent, and/or diagnose an opportunistic Mycobacterium
tuberculosis infection. In another specific embodiment, B
lymphocyte stimulator binding polypeptides and B lymphocyte
stimulator binding polypeptide compositions are used in any
combination with ganciclovir, foscarnet, and/or cidofovir to
prophylactically treat, prevent, and/or diagnose an opportunistic
cytomegalovirus infection. In another specific embodiment, B
lymphocyte stimulator binding polypeptides and B lymphocyte
stimulator binding polypeptide compositions are used in any
combination with fluconazole, itraconazole, and/or ketoconazole to
prophylactically treat, prevent, and/or diagnose an opportunistic
fungal infection. In another specific embodiment, B lymphocyte
stimulator binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions are used in any combination with acyclovir
and/or famciclovir to prophylactically treat, prevent, and/or
diagnose an opportunistic herpes simplex virus type I and/or type
II infection. In another specific embodiment, B lymphocyte
stimulator binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions are used in any combination with
pyrimethamine and/or leucovorin to prophylactically treat, prevent,
and/or diagnose an opportunistic Toxoplasma gondii infection. In
another specific embodiment, B lymphocyte stimulator binding
polypeptides and B lymphocyte stimulator binding polypeptide
compositions are used in any combination with leucovorin and/or
NEUPOGEN.TM. to prophylactically treat, prevent, and/or diagnose an
opportunistic bacterial infection.
[0429] In a further embodiment, the B lymphocyte stimulator binding
polypeptides and B lymphocyte stimulator binding polypeptide
compositions are administered in combination with an antiviral
agent. Antiviral agents that may be administered with the B
lymphocyte stimulator binding polypeptides and B lymphocyte
stimulator binding polypeptide compositions include, but are not
limited to, acyclovir, ribavirin, amantadine, and remantidine.
[0430] In a further embodiment, the B lymphocyte stimulator binding
polypeptides and B lymphocyte stimulator binding polypeptide
compositions are administered in combination with an antibiotic
agent. Antibiotic agents that may be administered with the B
lymphocyte stimulator binding polypeptides and B lymphocyte
stimulator binding polypeptide compositions include, but are not
limited to, amoxicillin, aminoglycosides, beta-lactam
(glycopeptide), beta-lactamases, Clindamycin, chloramphenicol,
cephalosporins, ciprofloxacin, ciprofloxacin, erythromycin,
fluoroquinolones, macrolides, metronidazole, penicillins,
quinolones, rifampin, streptomycin, sulfonamide, tetracyclines,
trimethoprim, trimethoprim-sulfamthoxazole, and vancomycin.
[0431] Conventional nonspecific immunosuppressive agents, that may
be administered in combination with the B lymphocyte stimulator
binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions include, but are not limited to, steroids,
cyclosporine, cyclosporine analogs cyclophosphamide,
cyclophosphamide IV, methylprednisolone, prednisolone,
azathioprine, FK-506, 15-deoxyspergualin, and other
immunosuppressive agents that act by suppressing the function of
responding T cells.
[0432] In specific embodiments, B lymphocyte stimulator binding
polypeptides and B lymphocyte stimulator binding polypeptide
compositions are administered in combination with
immunosuppressants. Immunosuppressant preparations that may be
administered with the B lymphocyte stimulator binding polypeptides
and B lymphocyte stimulator binding polypeptide compositions
include, but are not limited to, ORTHOCLONE.TM. (OKT3),
SANDIMMUNE.TM./NEORAL.TM./SANGDYA.TM. (cyclosporin), PROGRAF.TM.
(tacrolimus), CELLCEPT.TM. (mycophenolate), Azathioprine,
glucorticosteroids, and RAPAMUNE.TM. (sirolimus). In a specific
embodiment, immunosuppressants may be used to prevent rejection of
organ or bone marrow transplantation.
[0433] In a preferred embodiment, the B lymphocyte stimulator
binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions are administered in combination with
steroid therapy. Steroids that may be administered in combination
with the B lymphocyte stimulator binding polypeptides and B
lymphocyte stimulator binding polypeptide compositions, include,
but are not limited to, oral corticosteroids, prednisone, and
methylprednisolone (e.g., IV methylprednisolone). In a specific
embodiment, B lymphocyte stimulator binding polypeptides and B
lymphocyte stimulator binding polypeptide compositions are
administered in combination with prednisone. In a further specific
embodiment, the B lymphocyte stimulator binding polypeptides and B
lymphocyte stimulator binding polypeptide compositions are
administered in combination with prednisone and an
immunosuppressive agent. Immunosuppressive agents that may be
administered with the B lymphocyte stimulator binding polypeptides
and B lymphocyte stimulator binding polypeptide compositions and
prednisone are those described herein, and include, but are not
limited to, azathioprine, cylophosphamide, and cyclophosphamide IV.
In a another specific embodiment, B lymphocyte stimulator binding
polypeptides and B lymphocyte stimulator binding polypeptide
compositions are administered in combination with
methylprednisolone. In a further specific embodiment, the B
lymphocyte stimulator binding polypeptides and B lymphocyte
stimulator binding polypeptide compositions are administered in
combination with methylprednisolone and an immunosuppressive agent.
Immunosuppressive agents that may be administered with the B
lymphocyte stimulator binding polypeptides and B lymphocyte
stimulator binding polypeptide compositions and methylprednisolone
are those described herein, and include, but are not limited to,
azathioprine, cylophosphamide, and cyclophosphamide IV.
[0434] In a preferred embodiment, the B lymphocyte stimulator
binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions are administered in combination with an
antimalarial. Antimalarials that may be administered with the B
lymphocyte stimulator binding polypeptides and B lymphocyte
stimulator binding polypeptide compositions include, but are not
limited to, hydroxychloroquine, chloroquine, and/or quinacrine.
[0435] In a preferred embodiment, the B lymphocyte stimulator
binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions are administered in combination with an
NSAID.
[0436] In a nonexclusive embodiment, the B lymphocyte stimulator
binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions are administered in combination with one,
two, three, four, five, ten, or more of the following drugs:
NRD-101 (Hoechst Marion Roussel), diclofenac (Dimethaid), oxaprozin
potassium (Monsanto), mecasermin (Chiron), T-614 (Toyama),
pemetrexed disodium (Eli Lilly), atreleuton (Abbott), valdecoxib
(Monsanto), eltenac (Byk Gulden), campath, AGM-1470 (Takeda),
CDP-571 (Celltech Chiroscience), CM-101 (CarboMed), ML-3000
(Merckle), CB-2431 (KS Biomedix), CBF-BS2 (KS Biomedix), IL-1Ra
gene therapy (Valentis), JTE-522 (Japan Tobacco), paclitaxel
(Angiotech), DW-166HC (Dong Wha), darbufelone mesylate
(Warner-Lambert), soluble TNF receptor 1 (synergen; Amgen),
IPR-6001 (Institute for Pharmaceutical Research), trocade
(Hoffman-La Roche), EF-5 (Scotia Pharmaceuticals), BIIL-284
(Boehringer Ingelheim), BIIF-1149 (Boehringer Ingelheim), LeukoVax
(Inflammatics), MK-663 (Merck), ST-1482 (Sigma-Tau), and butixocort
propionate (WarnerLambert).
[0437] In a preferred embodiment, the B lymphocyte stimulator
binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions are administered in combination with one,
two, three, four, five or more of the following drugs:
methotrexate, sulfasalazine, sodium aurothiomalate, auranofin,
cyclosporine, penicillamine, azathioprine, an antimalarial drug
(e.g., as described herein), cyclophosphamide, chlorambucil, gold,
ENBREL.TM. (Etanercept), anti-TNF antibody, UP 394 (La Jolla
Pharmaceutical Company, San Diego, Calif.) and prednisolone.
[0438] In a more preferred embodiment, the B lymphocyte stimulator
binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions are administered in combination with an
antimalarial, methotrexate, anti-TNF antibody, REMICADE.TM.,
ENBREL.TM. and/or suflasalazine. In one embodiment, the B
lymphocyte stimulator binding polypeptides and B lymphocyte
stimulator binding polypeptide compositions are administered in
combination with methotrexate. In another embodiment, the B
lymphocyte stimulator binding polypeptides and B lymphocyte
stimulator binding polypeptide compositions are administered in
combination with anti-TNF antibody. In another embodiment, the B
lymphocyte stimulator binding polypeptides and B lymphocyte
stimulator binding polypeptide compositions are administered in
combination with methotrexate and anti-TNF antibody. In another
embodiment, the B lymphocyte stimulator binding polypeptides and B
lymphocyte stimulator binding polypeptide compositions are
administered in combination with suflasalazine. In another specific
embodiment, the B lymphocyte stimulator binding polypeptides and B
lymphocyte stimulator binding polypeptide compositions are
administered in combination with methotrexate, anti-TNF antibody,
and suflasalazine. In another embodiment, the B lymphocyte
stimulator binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions are administered in combination
ENBREL.TM.. In another embodiment, the B lymphocyte stimulator
binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions are administered in combination with
ENBREL.TM. and methotrexate. In another embodiment, the B
lymphocyte stimulator binding polypeptides and B lymphocyte
stimulator binding polypeptide compositions are administered in
combination with ENBREL.TM., methotrexate and suflasalazine. In
another embodiment, the B lymphocyte stimulator binding
polypeptides and B lymphocyte stimulator binding polypeptide
compositions are administered in combination with ENBREL.TM.,
methotrexate and suflasalazine. In other embodiments, one or more
antimalarials is combined with one of the above-recited
combinations. In a specific embodiment, the B lymphocyte stimulator
binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions are administered in combination with an
antimalarial (e.g., hydroxychloroquine), ENBREL.TM., methotrexate
and suflasalazine. In another specific embodiment, the B lymphocyte
stimulator binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions are administered in combination with an
antimalarial (e.g., hydroxychloroquine), sulfasalazine, anti-TNF
antibody, and methotrexate.
[0439] In an additional embodiment, B lymphocyte stimulator binding
polypeptides and B lymphocyte stimulator binding polypeptide
compositions are administered alone or in combination with one or
more intravenous immune globulin preparations. Intravenous immune
globulin preparations that may be administered with the B
lymphocyte stimulator binding polypeptides and B lymphocyte
stimulator binding polypeptide compositions include, but not
limited to, GAMMAR.TM. (immune globulin (intravenous)), IVEEGAM.TM.
(immune globulin (intravenous)), SANDOGLOBULIN.TM. (immune globulin
(intravenous)), GAMMAGARD S/D.TM. (immune globulin (intravenous)),
and GAMIMUNE.TM. (immune globulin (intravenous)). In a specific
embodiment, B lymphocyte stimulator binding polypeptides and B
lymphocyte stimulator binding polypeptide compositions are
administered in combination with intravenous immune globulin
preparations in transplantation therapy (e.g., bone marrow
transplant).
[0440] CD40 ligand (CD40L), a soluble form of CD40L (e.g.,
AVREND.TM.), biologically active fragments, variants, or
derivatives of CD40L, anti-CD40L antibodies (e.g., agonistic or
antagonistic antibodies), and/or anti-CD40 antibodies (e.g.,
agonistic or antagonistic antibodies).
[0441] In an additional embodiment, the B lymphocyte stimulator
binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions are administered alone or in combination
with an anti-inflammatory agent. Anti-inflammatory agents that may
be administered with the B lymphocyte stimulator binding
polypeptides and B lymphocyte stimulator binding polypeptide
compositions include, but are not limited to, glucocorticoids and
the nonsteroidal anti-inflammatories, aminoarylcarboxylic acid
derivatives, arylacetic acid derivatives, arylbutyric acid
derivatives, arylcarboxylic acids, arylpropionic acid derivatives,
pyrazoles, pyrazolones, salicylic acid derivatives,
thiazinecarboxamides, e-acetamidocaproic acid,
S-adenosylmethionine, 3-amino-4-hydroxybutyric acid, amixetrine,
bendazac, benzydamine, bucolome, difenpiramide, ditazol,
emorfazone, guaiazulene, nabumetone, nimesulide, orgotein,
oxaceprol, paranyline, perisoxal, pifoxime, proquazone, proxazole,
and tenidap.
[0442] In another embodiment, compostions are administered in
combination with a chemotherapeutic agent. Chemotherapeutic agents
that may be administered with the B lymphocyte stimulator binding
polypeptides and B lymphocyte stimulator binding polypeptide
compositions include, but are not limited to, antibiotic
derivatives (e.g., doxorubicin, bleomycin, daunorubicin, and
dactinomycin); antiestrogens (e.g., tamoxifen); antimetabolites
(e.g., fluorouracil, 5-FU, methotrexate, floxuridine, interferon
alpha-2b, glutamic acid, plicamycin, mercaptopurine, and
6-thioguanine); cytotoxic agents (e.g., carmustine, BCNU,
lomustine, CCNU, cytosine arabinoside, cyclophosphamide,
estramustine, hydroxyurea, procarbazine, mitomycin, busulfan,
cis-platin, and vincristine sulfate); hormones (e.g.,
medroxyprogesterone, estramustine phosphate sodium, ethinyl
estradiol, estradiol, megestrol acetate, methyltestosterone,
diethylstilbestrol diphosphate, chlorotrianisene, and
testolactone); nitrogen mustard derivatives (e.g., mephalen,
chorambucil, mechlorethamine (nitrogen mustard) and thiotepa);
steroids and combinations (e.g., bethamethasone sodium phosphate);
and others (e.g., dicarbazine, asparaginase, mitotane, vincristine
sulfate, vinblastine sulfate, and etoposide).
[0443] In a specific embodiment, B lymphocyte stimulator binding
polypeptides and B lymphocyte stimulator binding polypeptide
compositions are administered in combination with CHOP
(cyclophosphamide, doxorubicin, vincristine, and prednisone) or any
combination of the components of CHOP. In another embodiment, B
lymphocyte stimulator binding polypeptides and B lymphocyte
stimulator binding polypeptide compositions are administered in
combination with Rituximab. In a further embodiment, B lymphocyte
stimulator binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions are administered with Rituxmab and CHOP,
or Rituxmab and any combination of the components of CHOP.
[0444] In an additional embodiment, the B lymphocyte stimulator
binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions are administered in combination with
cytokines. Cytokines that may be administered with the B lymphocyte
stimulator binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions include, but are not limited to, GM-CSF,
G-CSF, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-10, IL-12, IL13,
IL-15, anti-CD40, CD40L, IFN-alpha (IFN-.alpha.), IFN-beta
(IFN-.beta.), IFN-gamma (IFN-.gamma.), TNF-alpha (TNF-.alpha.), and
TNF-beta (TNF-.beta.). In preferred embodiments, B lymphocyte
stimulator binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions are administered with B lymphocyte
stimulator (e.g., amino acids 134-285 of SEQ ID NO:173). In another
embodiment, B lymphocyte stimulator binding polypeptides and B
lymphocyte stimulator binding polypeptide compositions may be
administered with any interleukin, including, but not limited to,
IL-1alpha, IL-1beta, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8,
IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17,
IL-18, IL-19, IL-20, IL-21, and IL-22. In preferred embodiments,
the B lymphocyte stimulator binding polypeptides and B lymphocyte
stimulator binding polypeptide compositions are administered in
combination with IL-4 and IL-10.
[0445] In one embodiment, the B lymphocyte stimulator binding
polypeptides and B lymphocyte stimulator binding polypeptide
compositions are administered in combination with one or more
chemokines. In specific embodiments, the B lymphocyte stimulator
binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions are administered in combination with an
.alpha.(C.times.C) chemokine selected from the group consisting of
gamma-interferon inducible protein-10 (.gamma.IP-10), interleukin-8
(IL-8), platelet factor-4 (PF4), neutrophil activating protein
(NAP-2), GRO-.alpha., GRO-.beta., GRO-.gamma.,
neutrophil-activating peptide (ENA-78), granulocyte chemoattractant
protein-2 (GCP-2), and stromal cell-derived factor-1 (SDF-1, or
pre-B cell stimulatory factor (PBSF)); and/or a .beta.(CC)
chemokine selected from the group consisting of: RANTES (regulated
on activation, normal T expressed and secreted), macrophage
inflammatory protein-1 alpha (MIP-1.alpha.), macrophage
inflammatory protein-1 beta (MIP-1.beta.), monocyte chemotactic
protein-1 (MCP-1), monocyte chemotactic protein-2 (MCP-2), monocyte
chemotactic protein-3 (MCP-3), monocyte chemotactic protein-4
(MCP-4) macrophage inflammatory protein-1 gamma (MIP-1.gamma.),
macrophage inflammatory protein-3 alpha (MIP-3.alpha.), macrophage
inflammatory protein-3 beta (MIP-3.beta.), macrophage inflammatory
protein-4 (MIP-4/DC-CK-1/PARC), eotaxin, Exodus, and I-309; and/or
the .gamma.(C) chemokine, lymphotactin.
[0446] In another embodiment, the B lymphocyte stimulator binding
polypeptides and B lymphocyte stimulator binding polypeptide
compositions are administered with chemokine beta-8, chemokine
beta-1, and/or macrophage inflammatory protein-4. In a preferred
embodiment, the B lymphocyte stimulator binding polypeptides and B
lymphocyte stimulator binding polypeptide compositions are
administered with chemokine beta-8.
[0447] In an additional embodiment, the B lymphocyte stimulator
binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions are administered in combination with an
IL-4 antagonist. IL-4 antagonists that may be administered with the
B lymphocyte stimulator binding polypeptides and B lymphocyte
stimulator binding polypeptide compositions include, but are not
limited to: soluble IL-4 receptor polypeptides, multimeric forms of
soluble IL-4 receptor polypeptides; anti-IL-4 receptor antibodies
that bind the IL-4 receptor without transducing the biological
signal elicited by IL-4, anti-IL4 antibodies that block binding of
IL-4 to one or more IL-4 receptors, and muteins of IL-4 that bind
IL-4 receptors but do not transduce the biological signal elicited
by IL-4. Preferably, the antibodies employed according to this
method are monoclonal antibodies (including B lymphocyte stimulator
binding polypeptide fragments, such as, for example, those
described herein).
[0448] The invention also encompasses combining the polynucleotides
and/or polypeptides (and/or agonists or antagonists thereof) with
other proposed or conventional hematopoietic therapies. Thus, for
example, the polynucleotides and/or polypeptides (and/or agonists
or antagonists thereof) can be combined with compounds that singly
exhibit erythropoietic stimulatory effects, such as erythropoietin,
testosterone, progenitor cell stimulators, insulin-like growth
factor, prostaglandins, serotonin, cyclic AMP, prolactin, and
triiodothyzonine. Also encompassed are combinations of the B
lymphocyte stimulator binding polypeptides and B lymphocyte
stimulator binding polypeptide compositions with compounds
generally used to treat aplastic anemia, such as, for example,
methenolene, stanozolol, and nandrolone; to treat iron-deficiency
anemia, such as, for example, iron preparations; to treat malignant
anemia, such as, for example, vitamin B.sub.12 and/or folic acid;
and to treat hemolytic anemia, such as, for example, adrenocortical
steroids, e.g., corticoids. See, e.g., Resegotti et al., Panminerva
Medica, 23:243-248 (1981); Kurtz, FEBS Letters, 14a:105-108 (1982);
McGonigle et al., Kidney Int., 25:437-444 (1984); and
Pavlovic-Kantera, Expt. Hematol., 8(supp. 8):283-291 (1980), the
contents of each of which are hereby incorporated by reference in
their entireties.
[0449] Compounds that enhance the effects of or synergize with
erythropoietin are also useful as adjuvants herein, and include but
are not limited to, adrenergic agonists, thyroid hormones,
androgens, hepatic erythropoietic factors, erythrotropins, and
erythrogenins See, for example, Dunn, Current Concepts in
Erythropoiesis (John Wiley and Sons, Chichester, England 1983);
Kalmani, Kidney Int., 22:383-391 (1982); Shahidi, New Eng. J. Med.,
289:72-80 (1973); Urabe et al., J. Exp. Med., 149:1314-1325 (1979);
Billat et al., Expt. Hematol., 10:133-140 (1982); Naughton et al.,
Acta Haemat., 69:171-179 (1983); Cognote et al., in abstract 364,
Proceedings 7th Intl. Cong. of Endocrinology (Quebec City, Quebec,
Jul. 1-7, 1984); and Rothman et al., J. Surg. Oncol., 20:105-108
(1982). Methods for stimulating hematopoiesis comprise
administering a hematopoietically effective amount (i.e., an amount
which effects the formation of blood cells) of a pharmaceutical
composition containing polynucleotides and/or polypeptides (and/or
agonists or antagonists thereof) to a patient. The polynucleotides
and/or polypeptides and/or agonists or antagonists thereof are
administered to the patient by any suitable technique, including
but not limited to parenteral, sublingual, topical, intrapulmonary
and intranasal, and those techniques further discussed herein. The
pharmaceutical composition optionally contains one or more members
of the group consisting of erythropoietin, testosterone, progenitor
cell stimulators, insulin-like growth factor, prostaglandins,
serotonin, cyclic AMP, prolactin, triiodothyzonine, methenolene,
stanozolol, and nandrolone, iron preparations, vitamin B.sub.12,
folic acid and/or adrenocortical steroids.
[0450] In an additional embodiment, the B lymphocyte stimulator
binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions are administered in combination with
hematopoietic growth factors. Hematopoietic growth factors that may
be administered with the B lymphocyte stimulator binding
polypeptides and B lymphocyte stimulator binding polypeptide
compositions include, but are not limited to, LEUKINE.TM.
(sargramostim) and NEUPOGEN.TM. (filgrastim).
[0451] In an additional embodiment, the B lymphocyte stimulator
binding polypeptides and B lymphocyte stimulator binding
polypeptide compositions are administered in combination with
fibroblast growth factors. Fibroblast growth factors that may be
administered with the B lymphocyte stimulator binding polypeptides
and B lymphocyte stimulator binding polypeptide compositions
include, but are not limited to, FGF-1, FGF-2, FGF-3, FGF-4, FGF-5,
FGF-6, FGF-7, FGF-8, FGF-9, FGF-10, FGF-11, FGF-12, FGF-13, FGF-14,
and FGF-15.
[0452] Additionally, the B lymphocyte stimulator binding
polypeptides and B lymphocyte stimulator binding polypeptide
compositions may be administered alone or in combination with other
therapeutic regimens, including but not limited to, radiation
therapy. Such combinatorial therapy may be administered
sequentially and/or concomitantly.
Kits for Detecting and/or Quantitating B Lymphocyte Stimulator or B
Lymphocyte Stimulator-Like Polypeptides
[0453] The present invention is also directed to an assay kit which
can be useful in screening for the presence of B lymphocyte
stimulator and/or quantitating B lymphocyte stimulator
concentrations in a fluid, such as, for example, a biological fluid
(e.g., blood, serum, synovial fluid).
[0454] In a particular embodiment of the present invention, an
assay kit is contemplated which comprises in one or more containers
one or more B lymphocyte stimulator binding polypeptides and
optionally, a detection means for determining the presence of a B
lymphocyte stimulator-B lymphocyte stimulator binding polypeptide
interaction or the absence thereof. The kit further optionally
contains B lymphocyte stimulator protein that may be used, for
example as a control. The B lymphocyte stimulator binding
polypeptide may be free or expressed on the surface of a phage.
[0455] In a specific embodiment, either the B lymphocyte stimulator
binding polypeptide or the B lymphocyte stimulator protein is
labeled. As further discussed herein, a wide range of labels can be
used accordance with the present invention, including but not
limited to conjugating the recognition unit to biotin by
conventional means. Alternatively, the label may comprise, e.g., a
fluorogen, an enzyme, an epitope, a chromogen, or a radionuclide.
Preferably, the biotin is conjugated by covalent attachment to
either the B lymphocyte stimulator binding polypeptide or the B
lymphocyte stimulator protein. Preferably, the B lymphocyte
stimulator binding polypeptide is immobilized on a solid support.
The detection means employed to detect the label will depend on the
nature of the label and can be any known in the art, e.g., film to
detect a radionuclide, an enzyme substrate that gives rise to a
detectable signal to detect the presence of an enzyme, antibody to
detect the presence of an epitope, etc.
[0456] The invention also provides a pharmaceutical pack or kit
comprising one or more containers filled with one or more of the
ingredients of the pharmaceutical compositions. Optionally
associated with such container(s) can be a notice in the form
prescribed by a governmental agency regulating the manufacture, use
or sale of pharmaceuticals or biological products, which notice
reflects approval by the agency of manufacture, use or sale for
human administration. In one preferred embodiment the kit comprises
a vial containing B lymphocyte stimulator binding polypeptides
conjugated to a toxin or a label (as described herein). Such
conjugated binding polypeptide may be used to kill a particular
population of cells or to quantitate a particular population of
cells. In a preferred embodiment, such conjugated B lymphocyte
stimulator binding polypeptides are used to kill monocyte cells
expressing the membrane-bound form of B lymphocyte stimulator. In
another preferred embodiment, such conjugated B lymphocyte
stimulator binding polypeptides are used to quantitate monocyte
cells expressing the membrane-bound form of B lymphocyte
stimulator. In another preferred embodiment, such conjugated B
lymphocyte stimulator binding polypeptides are used to kill B cells
expressing B lymphocyte stimulator receptor on their surface. In
another preferred embodiment, such conjugated B lymphocyte
stimulator binding polypeptides are used to quantitate B cells
expressing B lymphocyte stimulator receptor on their surface.
[0457] The present invention provides kits that can be used in the
above methods. In one embodiment, a kit comprises a B lymphocyte
stimulator binding polypeptide, preferably a purified B lymphocyte
stimulator binding polypeptide, in one or more containers. In an
alternative embodiment, a kit comprises a B lymphocyte stimulator
binding polypeptide fragment that specifically binds to B
lymphocyte stimulator. In a specific embodiment, the kits of the
present invention contain a substantially isolated B lymphocyte
stimulator polypeptide as a control. Preferably, the kits of the
present invention further comprise a control binding polypeptide
which does not react with B lymphocyte stimulator. In another
specific embodiment, the kits of the present invention contain a
means for detecting the binding of a B lymphocyte stimulator
binding polypeptide to B lymphocyte stimulator (e.g., the B
lymphocyte stimulator binding polypeptide may be conjugated to a
detectable substrate such as a fluorescent compound, an enzymatic
substrate, a radioactive compound or a luminescent compound, or a
second antibody which recognizes the B lymphocyte stimulator
binding polypeptide may be conjugated to a detectable substrate).
In specific embodiments, the kit may include a recombinantly
produced or chemically synthesized B lymphocyte stimulator. The B
lymphocyte stimulator provided in the kit may also be attached to a
solid support. In a more specific embodiment the detecting means of
the above-described kit includes a solid support to which B
lymphocyte stimulator is attached. Such a kit may also include a
non-attached reporter-labeled anti-B lymphocyte stimulator binding
polypeptide antibody. In this embodiment, binding of the B
lymphocyte stimulator binding polypeptide to B lymphocyte
stimulator can be detected by binding of the said reporter-labeled
antibody. Alternatively, or in addition, the detecting means may
include a labeled, competing antigen.
[0458] In an additional embodiment, the invention includes a
diagnostic kit for use in screening serum containing B lymphocyte
stimulator or B lymphocyte stimulator-like polypeptides. The
diagnostic kit includes a substantially isolated B lymphocyte
stimulator binding polypeptide specifically reactive with B
lymphocyte stimulator target, and means for detecting the binding
of B lymphocyte stimulator target to the B lymphocyte stimulator
binding polypeptide. In one embodiment, the B lymphocyte stimulator
binding polypeptide is attached to a solid support.
[0459] In one diagnostic configuration, test serum is reacted with
a solid phase reagent having a surface-bound B lymphocyte
stimulator binding polypeptide according to the present invention.
After B lymphocyte stimulator binds to a specific B lymphocyte
stimulator binding polypeptide, the unbound serum components are
removed by washing, reporter-labeled anti-B lymphocyte stimulator
binding polypeptide antibody is added, unbound anti-B lymphocyte
stimulator binding polypeptide antibody is removed by washing, and
a reagent is reacted with reporter-labeled anti-B lymphocyte
stimulator binding polypeptide antibody to bind reporter to the
reagent in proportion to the amount of bound B lymphocyte
stimulator binding polypeptide on the solid support. Typically, the
reporter is an enzyme which is detected by incubating the solid
phase in the presence of a suitable fluorometric, luminescent or
colorimetric substrate.
[0460] The solid surface reagent in the above assay is prepared by
known techniques for attaching protein material to solid support
material, such as polymeric beads, dip sticks, 96-well plate or
filter material. These attachment methods generally include
non-specific adsorption of the protein to the support or covalent
attachment of the protein, typically through a free amine group, to
a chemically reactive group on the solid support, such as an
activated carboxyl, hydroxyl, or aldehyde group. Alternatively,
streptavidin coated plates can be used in conjunction with
biotinylated B lymphocyte stimulator binding polypeptides.
[0461] Thus, the invention provides an assay system or kit for
carrying out this diagnostic method. The kit generally includes a
support with surface-bound recombinant B lymphocyte stimulator, and
a reporter-labeled anti-B lymphocyte stimulator binding polypeptide
antibody for detecting surface-bound anti-B lymphocyte stimulator
binding polypeptide.
Methods of Screening for B Lymphocyte Stimulator Binding
Molecules
[0462] The invention also encompasses screening methods for
identifying polypeptides and nonpolypeptides that bind B lymphocyte
stimulator, and the B lymphocyte stimulator binding molecules
identified thereby. This method comprises the steps of:
(a) contacting B lymphocyte stimulator or B lymphocyte
stimulator-like polypeptide with a plurality of molecules; and (b)
identifying molecule(s) that binds the B lymphocyte stimulator or B
lymphocyte stimulator-like polypeptide.
[0463] The step of contacting the B lymphocyte stimulator protein
or B lymphocyte stimulator-like protein with the plurality of
molecules may be effected in a number of ways. For example, one may
contemplate immobilizing B lymphocyte stimulator target on a solid
support and bringing a solution of the plurality of molecules in
contact with the immobilized B lymphocyte stimulator target. Such a
procedure would be akin to an affinity chromatographic process,
with the affinity matrix being comprised of the immobilized B
lymphocyte stimulator protein or B lymphocyte stimulator-like
polypeptide. The molecules having a selective affinity for the B
lymphocyte stimulator or B lymphocyte stimulator-like polypeptide
can then be purified by affinity selection. The nature of the solid
support, process for attachment of the B lymphocyte stimulator or B
lymphocyte stimulator-like polypeptide to the solid support,
solvent, and conditions of the affinity isolation or selection are
largely conventional and well known to those of ordinary skill in
the art.
[0464] Alternatively, one may also separate a plurality of
polypeptides into substantially separate fractions comprising a
subset of or individual polypeptides. For instance, one can
separate the plurality of polypeptides by gel electrophoresis,
column chromatography, or like method known to those of ordinary
skill for the separation of polypeptides. The individual
polypeptides can also be produced by a transformed host cell in
such a way as to be expressed on or about its outer surface (e.g.,
a recombinant phage). Individual isolates can then be "probed"
using a B lymphocyte stimulator target protein, optionally in the
presence of an inducer should one be required for expression, to
determine if any selective affinity interaction takes place between
the B lymphocyte stimulator target protein and the individual
clone. Prior to contacting the B lymphocyte stimulator target
protein with each fraction comprising individual polypeptides, the
polypeptides could first be transferred to a solid support for
additional convenience. Such a solid support may simply be a piece
of filter membrane, such as one made of nitrocellulose or nylon. In
this manner, positive clones could be identified from a collection
of transformed host cells of an expression library, which harbor a
DNA construct encoding a polypeptide having a selective affinity
for B lymphocyte stimulator or B lymphocyte stimulator-like
polypeptide. Furthermore, the amino acid sequence of the
polypeptide having a selective affinity for the B lymphocyte
stimulator protein or B lymphocyte stimulator-like protein can be
determined directly by conventional means, or the coding sequence
of the DNA encoding the polypeptide can frequently be determined
more conveniently. The primary amino acid sequence can then be
deduced from the corresponding DNA sequence. If the amino acid
sequence is to be determined from the polypeptide itself, one may
use microsequencing techniques. The sequencing technique may
include mass spectroscopy.
[0465] In certain situations, it may be desirable to wash away any
B lymphocyte stimulator or B lymphocyte stimulator-like
polypeptide, or alternatively, unbound polypeptides, from a mixture
of B lymphocyte stimulator or B lymphocyte stimulator-like
polypeptide and the plurality of polypeptides prior to attempting
to determine or to detect the presence of a selective affinity
interaction. One or more such a wash steps may be particularly
desirable when the B lymphocyte stimulator or B lymphocyte
stimulator-like polypeptide or the plurality of polypeptides is
bound to a solid support.
[0466] The plurality of molecules provided according to this method
may be provided by way of diversity libraries, such as random or
combinatorial peptide or non-peptide libraries which can be
screened for molecules that specifically bind to B lymphocyte
stimulator. Peptide libraries may be designed such that the
polypeptides encoded by the libraries are automatically fused to a
polypeptide linker moiety, for example. Many libraries are known in
the art that can be used, e.g., chemically synthesized libraries,
recombinant (e.g., phage display libraries), and in vitro
translation-based libraries. Examples of chemically synthesized
libraries are described in Fodor et al., Science, 251:767-773
(1991); Houghten et al., Nature, 354:84-86 (1991); Lam et al.,
Nature, 354:82-84 (1991); Medynski, Bio/Technology, 12:709-710
(1994); Gallop et al., J. Medicinal Chemistry, 37(9):1233-1251
(1994); Ohlmeyer et al., Proc. Natl. Acad. Sci. USA, 90:10922-10926
(1993); Erb et al., Proc. Natl. Acad. Sci. USA, 91:11422-11426
(1994); Houghten et al., Biotechniques, 13:412 (1992); Jayawickreme
et al., Proc. Natl. Acad. Sci. USA, 91:1614-1618 (1994); Salmon et
al., Proc. Natl. Acad. Sci. USA, 90:11708-11712 (1993); PCT
publication WO 93/20242; and Brenner and Lerner, Proc. Natl. Acad.
Sci. USA, 89:5381-5383 (1992).
[0467] Examples of phage display libraries are described in Scott
and Smith, Science, 249:386-390 (1990); Devlin et al., Science,
249:404-406 (1990); Christian et al., J. Mol. Biol., 227:711-718
(1992); Lenstra, J. Immunol. Meth., 152:149-157 (1992); Kay et al.,
Gene, 128:59-65 (1993); and PCT publication WO 94/18318.
[0468] In vitro translation-based libraries include but are not
limited to those described in PCT publication WO 91/05058 and
Mattheakis et al., Proc. Natl. Acad. Sci. USA, 91:9022-9026
(1994).
[0469] By way of examples of non-peptide libraries, a
benzodiazepine library (see, e.g., Bunin et al., Proc. Natl. Acad.
Sci. USA, 91:4708-4712 (1994) can be adapted for use. Peptoid
libraries (Simon et al., Proc. Natl. Acad. Sci. USA, 89:9367-9371
(1992)) can also be used. Another example of a library that can be
used, in which the amide functionalities in peptides have been
permethylated to generate a chemically transformed combinatorial
library, is described by Ostresh et al. (Proc. Natl. Acad. Sci.
USA, 91:11138-11142 (1994)).
[0470] The variety of non-peptide libraries that are useful in the
present invention is great. For example, Ecker and Crooke,
Bio/Technology, 13:351-360 (1995) list benzodiazepines, hydantoins,
piperazinediones, biphenyls, sugar analogs, beta-mercaptoketones,
arylacetic acids, acylpiperidines, benzopyrans, cubanes, xanthines,
aminimides, and oxazolones as among the chemical species that form
the basis of various libraries.
[0471] Non-peptide libraries can be classified broadly into two
types: decorated monomers and oligomers. Decorated monomer
libraries employ a relatively simple scaffold structure upon which
a variety functional groups is added. Often the scaffold will be a
molecule with a known useful pharmacological activity. For example,
the scaffold might be the benzodiazepine structure.
[0472] Non-peptide oligomer libraries utilize a large number of
monomers that are assembled together in ways that create new shapes
that depend on the order of the monomers. Among the monomer units
that have been used are carbamates, pyrrolinones, and morpholinos.
Peptoids, peptide-like oligomers in which the side chain is
attached to the alpha amino group rather than the alpha carbon,
form the basis of another version of non-peptide oligomer
libraries. The first non-peptide oligomer libraries utilized a
single type of monomer and thus contained a repeating backbone.
Recent libraries have utilized more than one monomer, giving the
libraries added flexibility.
[0473] Screening the libraries can be accomplished by any of a
variety of commonly known methods. See, e.g., the following
references, which disclose screening of peptide libraries: Parmley
and Smith, Adv. Exp. Med. Biol., 251:215-218 (1989); Scott and
Smith, Science, 249:386-390 (1990); Fowlkes et al., BioTechniques,
13:422-427 (1992); Oldenburg et al., Proc. Natl. Acad. Sci. USA,
89:5393-5397 (1992); Yu et al., Cell, 76:933-945 (1994); Staudt et
al., Science, 241:577-580 (1988); Bock et al., Nature, 355:564-566
(1992); Tuerk et al., Proc. Natl. Acad. Sci. USA, 89:6988-6992
(1992); Ellington et al., Nature, 355:850-852 (1992); U.S. Pat. No.
5,096,815; U.S. Pat. No. 5,223,409; and U.S. Pat. No. 5,198,346,
all to Ladner et al.; Rebar and Pabo, Science, 263:671-673 (1993);
and PCT publication WO 94/18318.
[0474] In a specific embodiment, screening to identify a molecule
that binds B lymphocyte stimulator can be carried out by contacting
the library members with B lymphocyte stimulator or B lymphocyte
stimulator-like polypeptide immobilized on a solid phase and
harvesting those library members that bind to the B lymphocyte
stimulator or B lymphocyte stimulator-like polypeptide. Examples of
such screening methods, termed "panning" techniques are described
by way of example in Parmley and Smith, Gene, 73:305-318 (1998);
Fowlkes et al., BioTechniques, 13:422-427 (1992); PCT publication
WO 94/18318; and in references cited therein.
[0475] In another embodiment, the two-hybrid system for selecting
interacting proteins in yeast (Fields and Song, Nature, 340:245-246
(1989); Chien et al., Proc. Natl. Acad. Sci. USA, 88:9578-9582
(1991)) can be used to identify molecules that specifically bind to
B lymphocyte stimulator or B lymphocyte stimulator-like
polypeptides.
[0476] Where the B lymphocyte stimulator binding molecule is a
polypeptide, the polypeptide can be conveniently selected from any
peptide library, including random peptide libraries, combinatorial
peptide libraries, or biased peptide libraries. The term "biased"
is used herein to mean that the method of generating the library is
manipulated so as to restrict one or more parameters that govern
the diversity of the resulting collection of molecules, in this
case peptides.
[0477] Thus, a truly random peptide library would generate a
collection of peptides in which the probability of finding a
particular amino acid at a given position of the peptide is the
same for all 20 amino acids. A bias can be introduced into the
library, however, by specifying, for example, that a lysine occur
every fifth amino acid, that certain amino acid positions in a
peptide remain fixed (e.g., as cysteine), or that positions 4, 8,
and 9, for example, of a decapeptide library be limited to permit
several but less than all of the twenty naturally-occurring amino
acids. Clearly, many types of biases can be contemplated, and the
present invention is not restricted to any particular bias.
Furthermore, the present invention contemplates specific types of
peptide libraries, such as phage displayed peptide libraries and
those that utilize a DNA construct comprising a lambda phage vector
with a DNA insert.
[0478] As mentioned above, in the case of a B lymphocyte stimulator
binding molecule that is a polypeptide, the polypeptide may have
about 6 to less than about 60 amino acid residues, preferably about
6 to about 10 amino acid residues, and most preferably, about 6 to
about 22 amino acids. In another embodiment, a B lymphocyte
stimulator binding polypeptide has in the range of 15-100 amino
acids, or 20-50 amino acids.
[0479] The selected B lymphocyte stimulator binding polypeptide can
be obtained by chemical synthesis or recombinant expression.
[0480] The specific B lymphocyte stimulator binding polypeptides
disclosed herein were isolated using phage display technology, to
identify B lymphocyte stimulator binding polypeptides exhibiting
particular preselected binding properties. These B lymphocyte
stimulator binding polypeptides were isolated initially by
screening nine phage display libraries, that is, populations of
recombinant bacteriophage transformed to express an exogenous
recombinant polypeptide on their surface. In order to isolate new
polypeptide binding moieties for a particular target, such as B
lymphocyte stimulator, screening of peptide libraries, for example
using phage display techniques, is especially advantageous, in that
very large numbers (e.g., 5.times.10.sup.9) of potential binders
can be tested and successful binders isolated in a short period of
time.
[0481] In order to prepare a phage library of potential binding
polypeptides to screen for members of the library that are B
lymphocyte stimulator binding polypeptides, a candidate binding
domain is selected to serve as a structural template for the
polypeptides to be displayed in the library. The phage library is
made up of polypeptide analogues of this template or "parental
binding domain." The parental binding domain is a polypeptide
molecule that may be a naturally occurring or synthetic protein or
polypeptide, or polypeptide region or domain of a protein. The
parental binding domain may be selected based on knowledge of a
known interaction between the parental binding domain and a target
protein, but this is not critical. In fact, it is not essential
that the parental binding domain have any affinity for a target at
all because its purpose is to provide a structure from which a
multiplicity of polypeptide analogues (a "library") can be
generated, which multiplicity of polypeptide analogues will include
one or more binding polypeptides that exhibit the desired binding
and release properties with respect to B lymphocyte stimulator
target proteins (and any other properties selected).
[0482] Knowledge of the exact polypeptide that will serve as the
parental binding domain, or knowledge of a class of proteins or
domains to which the parental binding domain belongs can be useful
in determining the conditions under which B lymphocyte stimulator
binding polypeptides optimally bind B lymphocyte stimulator target
proteins as well as the conditions under which B lymphocyte
stimulator binding polypeptides optimally release B lymphocyte
stimulator target proteins. Similarly, the binding and/or release
conditions may be selected with regard to known interactions
between a binding domain and the B lymphocyte stimulator target
protein, for example, to favor the interaction under the binding
and/or release conditions, or they may be selected without regard
to such known interactions. Likewise, the parental binding domain
can be selected taking into account a desired binding and/or
release condition or not. It is understood that if the binding
domain analogues of a library are unstable under a proposed or
desired binding or release condition, no useful binding
polypeptides may be obtained.
[0483] In selecting the parental binding domain, the most important
consideration is how the analogue domains will be presented to the
B lymphocyte stimulator target protein, that is, in what
conformations the B lymphocyte stimulator target and the
polypeptide analogues will contact one another. In preferred
embodiments, for example, the polypeptide analogues will be
generated by insertion of synthetic DNA encoding the polypeptide
analogue into a replicable genetic package, resulting in display of
the domain on the surface of a microorganism, such as M13 phage,
using techniques as described in Kay et al., Phage Display of
Peptides and Proteins: A Laboratory Manual (Academic Press, Inc.;
San Diego 1996) and U.S. Pat. No. 5,223,409 (Ladner et al.),
incorporated herein by reference. For formation of phage display
libraries, it is preferred to use structured polypeptides as the
parental binding domain or template, as opposed to unstructured,
linear peptides. Mutation of surface residues in a protein domain
or polypeptide molecule will usually have little effect on the
overall structure or general properties (such as size, stability,
and temperature of denaturation) of the protein; while at the same
time mutation of surface residues may profoundly affect the binding
properties of the molecule. The more tightly a polypeptide segment
is constrained, the less likely it is to bind to any particular
target. If it does bind, however, the binding is likely to be
tighter and more specific. Thus, it is preferred to select a
parental binding domain wherein the parental polypeptide has
structure and, thereby in turn, select a structure for the
polypeptide analogues of the library, which is constrained within a
framework having some degree of rigidity.
[0484] Preferably the protein domain that is used as the template
or parental domain for generating the library of domain analogues
will be a peptide molecule that is a relatively small protein or
polypeptide. Small polypeptides offer several advantages over large
proteins: First, the mass per binding site is reduced. Highly
stable protein domains having low molecular weights, for example,
Kunitz domains (.about.7 kilodaltons, kDa), Kazal domains (.about.7
kDa), Cucurbida maxima trypsin inhibitor (CMTI) domains (.about.3.5
kDa), and endothelin (.about.2 kDa), can show much higher binding
per gram than do antibodies (150 kDa) or single chain scFv
antibodies (30 kDa). Second, the possibility of non-specific
binding is reduced because there is less molecular surface
available for nonspecific binding. Third, small polypeptides can be
engineered to have unique tethering sites in a way that is
impracticable for larger proteins or antibodies. For example, small
proteins and polypeptides can be engineered to have lysines only at
sites suitable for tethering to a chromatography matrix. This is
not feasible for antibodies. Fourth, a constrained polypeptide
structure is more likely to retain its functionality when
transferred (with the structural domain intact) from one framework
to another. For instance, the binding domain structure is likely to
be transferable from the framework used for presentation in a
library, such as displayed on a phage, to an isolated protein
removed from the presentation framework or immobilized on a
chromatographic substrate.
[0485] In specific embodiments, the B lymphocyte stimulator binding
polypeptides are immobilized. B lymphocyte stimulator binding
polypeptide molecules according to the invention may be
immobilized, for example, on chromatographic support materials to
form efficient B lymphocyte stimulator separation or affinity
chromatographic media. Immobilized B lymphocyte stimulator binding
polypeptides have uses that include, but are not limited to,
detecting, isolating or removing B lymphocyte stimulator target
proteins from solutions. One strategy for generating B lymphocyte
stimulator binding polypeptide molecules that can be immobilized,
for example, on matrices, resins, or supports, involves selecting
appropriate binding domain templates such that B lymphocyte
stimulator binding polypeptide molecules are generated that have
one or more amino acids that may be used to covalently link the B
lymphocyte stimulator binding polypeptide to a chromatographic
resin or substrate to form an affinity resin. Similarly, the
N-terminal amino group or the C-terminal carboxyl group of a
peptide molecule may be modified by adding a capping group to
render it inert or a functional group, which permits linkage to a
support medium. For example, the C-terminal carboxyl group of a
protein domain may be converted to an amide or a hydrazide
(--NH--NH.sub.2) group for reaction with an aldehyde-functional
substrate or other amine-reactive substrate. This technique is
preferred. Another preferred modification of B lymphocyte
stimulator binding polypeptides useful for linking a B lymphocyte
stimulator binding polypeptide molecule to a chromatography
material is a polypeptide linker comprising, or alternatively
consisting of, the amino acid sequence
Pro-Gly-Pro-Glu-Gly-Gly-Gly-Lys (SEQ ID NO:13).
[0486] In one non-limiting example of a screening procedure to
obtain B lymphocyte stimulator binding polypeptides encompassed by
the invention, the phage in a phage display library are contacted
with and allowed to bind a B lymphocyte stimulator target protein
that is immobilized on a solid support. Those phage that display
non-binding polypeptides are separated from those that bind the B
lymphocyte stimulator target protein. Any of various techniques
known in the art may be applied to dissociate the bound phage from
the immobilized B lymphocyte stimulator protein, and to collect
and/or amplify the phage and/or their nucleic acid contents. Using
these techniques it is possible to identify a B lymphocyte
stimulator binding phage that is about 1 in 20 million in the
population. Libraries, displaying 10-20 million or more potential
binding peptide molecules each, are rapidly screened to find
high-affinity B lymphocyte stimulator binding polypeptides.
[0487] In each round of screening, the diversity of a population
falls until only efficient binding polypeptides remain, that is,
the process converges. Typically, a phage display library will
contain several closely related binding polypeptides (10 to 50
different binding polypeptides out of 10 million). Indications of
convergence include increased binding (measured by phage titers)
and recovery of closely related sequences. After a first set of
binding polypeptide molecules is identified, the sequence
information can be used to design other libraries biased for
members having additional desired properties, for example,
discrimination between different forms of B lymphocyte stimulator
(e.g., the membrane form and the soluble form of B lymphocyte
stimulator) and fragments thereof, or discrimination between B
lymphocyte stimulator and closely related impurities in a feed
stream.
[0488] Such techniques make it possible not only to screen a large
number of potential binding polypeptides, but make it practical to
repeat the binding and elution cycles and to build secondary,
biased libraries for screening polypeptide analogue-displaying
phage that meet specific criteria. Using these techniques, a
polypeptide analogue biased library may be screened to reveal
members that bind tightly, that is, have high affinity for B
lymphocyte stimulator target protein, under the screening
conditions.
[0489] In the present invention target B lymphocyte stimulator
protein molecules were biotinylated and then bound to
streptavidin-coated magnetic particles. Nine phage display
libraries of different design were screened for the ability to bind
the immobilized B lymphocyte stimulator. Each library was
characterized by M13 phage displaying variegated peptides of
different lengths and overall structure: A library designated TN6/6
(2.times.10.sup.8 variants) displayed a variegated 12-mer with two
internal invariant cyteines to form a hexamer loop structure. A
library designated TN7/4 (2.3.times.10.sup.9 variants) presented a
variegated 13-mer having two internal invariant cyteines to form a
heptamer loop structure. A library designated TN8/9
(5.times.10.sup.9 variants) displayed a variegated 14-mer with two
internal invariant cyteines to form an octamer loop structure. A
library designated TN9/4 (3.2.times.10.sup.9 variants) presented a
variegated 16-mer having two internal invariant cyteines to form a
nonamer loop structure. A library designated TN10/9
(2.5.times.10.sup.9 variants) displayed a variegated 16-mer with
two internal invariant cyteines to form a decamer loop structure. A
library designated TN12/1 (1.4.times.10.sup.9 variants) presented a
variegated 18-mer having two internal invariant cyteines to form a
dodecamer loop structure. A library designated as Substrate Phage
Library #2, having a diversity of about 2.times.10.sup.8 amino acid
sequences, was designed to include a linear peptide-variegated
region in the display polypeptide consisting of 13 consecutive
amino acids, and the display polypeptide design allowed any amino
acid residue except cysteine to occur at each position. Finally,
two commercially available linear phage display libraries were also
screened, designated PhD 7 and PhD 12, respectively (New England
Biolabs). The PhD 7 library displayed a linear random-sequence
7-mer; the PhD 12 library displayed a random-sequence 12-mer.
[0490] B lymphocyte stimulator binding phage were isolated and
collected from all of the libraries except PhD 7.
[0491] After analysis of the sequences isolated from the library
screenings, several families of B lymphocyte stimulator binding
peptides were defined (see, consensus sequences A-G and H-L,
above). The amino acid sequences of the B lymphocyte
stimulator-binding "hits" from the first rounds of screening are
set forth in Tables 1-8 (infra).
[0492] In order to obtain B lymphocyte stimulator binding
polypeptides having an even higher affinity for B lymphocyte
stimulator targets, a specialized library was prepared, i.e., a B
lymphocyte stimulator affinity maturation library, based on
variegation of high affinity examplars of the PhD 12 library (see
Example 6). This library was designed to provide a population
enriched with polypeptides likely to show high affinity for B
lymphocyte stimulator. The selections from this library were
performed to eliminate, by prolonged competition with soluble
eluants of soluble B lymphocyte stimulator or other B lymphocyte
stimulator binding polypeptides, all but the polypeptides having
the highest affinity for B lymphocyte stimulator. A large family of
high affinity B lymphocyte stimulator binding polypeptides was
isolated from four rounds of screening the affinity maturation
library, and their amino acid sequences appear in Table 13
(infra).
[0493] As it within the scope of the present invention to screen
phage libraries that bind one or more of the various forms of B
lymphocyte stimulator, the following outlines some assays that may
be used in screening for B lymphocyte stimulator binding
polypeptides that bind the soluble form of B lymphocyte stimulator,
the membrane-bound form of B lymphocyte stimulator, or both the
soluble and the membrane-bound forms of B lymphocyte stimulator.
Assays to determine the specificity of binding polypeptides for
different forms of a protein are commonly known in the art and may
be readily adapted for determining the specificity of B lymphocyte
stimulator binding polypeptides for different forms of B lymphocyte
stimulator.
[0494] B lymphocyte stimulator binding polypeptides (including
molecules comprising, or alternatively consisting of, B lymphocyte
stimulator binding polypeptide fragments or variants thereof) may
be screened in a variety of assays to identify those B lymphocyte
stimulator binding polypeptides that specifically bind to the
soluble form of B lymphocyte stimulator. B lymphocyte stimulator
binding polypeptides may be assayed in neutralization assays
described herein (see Examples 7 and 8) or otherwise known in the
art. For example, B lymphocyte stimulator binding polypeptides may
be tested for their ability to inhibit soluble B lymphocyte
stimulator from binding a B lymphocyte stimulator receptor. The B
lymphocyte stimulator receptor used in these assays may be an
isolated B lymphocyte stimulator receptor (e.g., B lymphocyte
stimulator receptor conjugated to agaorose beads) or may be present
on the cell surface of cell lines that express B lymphocyte
stimulator receptors which include, but are not limited to,
peripheral CD20+ B cells, IM-9, REH, ARH-77, Namalwa, and RPMI-8226
B cell tumor lines.
[0495] B lymphocyte stimulator binding polypeptides (including
molecules comprising, or alternatively consisting of, B lymphocyte
stimulator binding polypeptide fragments or variants thereof) may
be screened in a variety of assays commonly known in the art to
identify those B lymphocyte stimulator binding polypeptides that
specifically bind to the membrane-bound form of B lymphocyte
stimulator. For example, B lymphocyte stimulator binding
polypeptides may be assayed for binding B lymphocyte stimulator
protein present on cell membranes of cells that express B
lymphocyte stimulator. Cell lines that express B lymphocyte
stimulator that might be useful for testing B lymphocyte stimulator
binding polypeptide binding to membrane-bound form of B lymphocyte
stimulator include, K-562, HL-60, THP-1, and U937 cells.
[0496] Additionally, B lymphocyte stimulator binding polypeptides
may be screened against cells engineered to express an
"uncleavable" form of B lymphocyte stimulator in order to determine
their specificity for the membrane-bound form of B lymphocyte
stimulator. Mutations in B lymphocyte stimulator which may achieve
this result include, but are not limited to, the mutation or
deletion of amino acid residues Lys-132 and/or Arg-133 of the B
lymphocyte stimulator sequence shown in SEQ ID NO:173. A typical
mutagenesis might include mutation of one or both of residues
Lys-132 or Arg-133 to alanine residues. Cells expressing such an
"uncleavable" form of B lymphocyte stimulator provide a profound
reagent to use in assaying the ability of B lymphocyte stimulator
binding polypeptides to bind the membrane-bound form of B
lymphocyte stimulator.
[0497] B lymphocyte stimulator binding polypeptides (including
molecules comprising, or alternatively consisting of, B lymphocyte
stimulator binding polypeptide fragments or variants) may be
screened in a variety of assays to identify those B lymphocyte
stimulator binding polypeptides or B lymphocyte stimulator binding
polypeptide fragments or variants that specifically bind to the
soluble form and membrane-bound form of B lymphocyte stimulator.
This can readily be determined by performing assays to distinguish
binding to the soluble form and assays to distinguish binding to
the membrane-bound form (such as the assays described herein or
otherwise known in the art), and identifying the B lymphocyte
stimulator binding polypeptides that bind both forms.
[0498] Additionally, B lymphocyte stimulator binding polypeptides
may be screened for the ability to inhibit, stimulate or not
significantly alter B lymphocyte stimulator activity, e.g., the
ability of B lymphocyte stimulator: to bind to its receptor (e.g.,
TACI and BCMA), to stimulate B cell proliferation, to stimulate
immunoglobulin secretion by B cells, to activate B cells, to
increase B cell lifespan and/or to stimulate a B lymphocyte
stimulator receptor signaling cascade (e.g., to activate
calcium-modulator and cyclophilin ligand ("CAML"), calcineurin,
nuclear factor of activated T cells transcription factor ("NF-AT"),
nuclear factor-kappa B ("NF-kappa B"; NF-.kappa.B), activator
protein-1 (AP-1), SRF, extracellular-signal regulated kinase 1
(ERK-1), polo like kinases (PLK), ELF-1, high mobility group I
(HMG-I), and/or high mobility group Y (HMG-Y)). Assays that may be
used to screen for the effects on B lymphocyte stimulator activity
are described herein (see, for example, Examples 7, 8, and 12) and
are commonly known in the art.
Anti-B Lymphocyte Stimulator Binding Polypeptide Antibodies
[0499] Further polypeptides useful herein relate to antibodies and
T-cell antigen receptors (TCR) which immunospecifically bind a B
lymphocyte stimulator binding polypeptide (as determined by
immunoassays well known in the art for assaying specific
antibody-antigen binding). Antibodies include, but are not limited
to, polyclonal, monoclonal, multispecific, human, humanized or
chimeric antibodies, single chain antibodies, Fab fragments, F(ab')
fragments, fragments produced by a Fab expression library,
anti-idiotypic (anti-id) antibodies (including, e.g., anti-id
antibodies to antibodies), and epitope-binding fragments of any of
the above. The term "antibody," as used herein, refers to
immunoglobulin molecules and immunologically active portions of
immunoglobulin molecules, i.e., molecules that contain an antigen
binding site that immunospecifically binds an antigen. The
immunoglobulin molecules can be of any type (e.g., IgG, IgE, IgM,
IgD, IgA and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and
IgA2) or subclass of immunoglobulin molecule. Immunoglobulins may
have both a heavy and light chain. In specific embodiments, the
immunoglobulin molecules are IgG1. In other specific embodiments,
the immunoglobulin molecules are IgG4. An array of IgG, IgE, IgM,
IgD, IgA, and IgY heavy chains may be paired with a light chain of
the kappa or lambda forms.
[0500] Most preferably the antibodies are human antigen-binding
antibody fragments of the present invention and include, but are
not limited to, Fab, Fab' and F(ab')2, Fd, single-chain Fvs (scFv),
single-chain antibodies, disulfide-linked Fvs (sdFv) and fragments
comprising either a VL or VH domain. Antigen-binding antibody
fragments, including single-chain antibodies, may comprise the
variable region(s) alone or in combination with the entirety or a
portion of the following: hinge region, CH1, CH2, and CH3 domains.
Also included in the invention are antigen-binding fragments also
comprising any combination of variable region(s) with a hinge
region, CH1, CH2, and CH3 domains. The antibodies may be from any
animal origin including birds and mammals. Preferably, the
antibodies are human, murine (e.g., mouse and rat), donkey, ship
rabbit, goat, guinea pig, camel, horse, or chicken. As used herein,
"human" antibodies include antibodies having the amino acid
sequence of a human immunoglobulin and include antibodies isolated
from human immunoglobulin libraries or from animals transgenic for
one or more human immunoglobulin and that do not express endogenous
immunoglobulins, as described infra and, for example in, U.S. Pat.
No. 5,939,598 to Kucherlapati et al.
[0501] The antibodies of the present invention may be monospecific,
bispecific, trispecific or of greater multispecificity.
Multispecific antibodies may be specific for different epitopes of
a polypeptide of the present invention or may be specific for both
a polypeptide of the present invention as well as for a
heterologous epitope, such as a heterologous polypeptide or solid
support material. See, e.g., PCT publications WO 93/17715, WO
92/08802, WO 91/00360, WO 92/05793; Tutt et al., J. Immunol.,
147:60-69 (1991); U.S. Pat. Nos. 4,474,893; 4,714,681; 4,925,648;
5,573,920; 5,601,819; Kostelny et al., J. Immunol., 148:1547-1553
(1992).
[0502] Antibodies of the present invention may be described or
specified in terms of the epitope(s) or portion(s) of a B
lymphocyte stimulator binding polypeptide of the present invention
which they recognize or specifically bind. Antibodies which
specifically bind any epitope or polypeptide of the present
invention may also be excluded. Therefore, the present invention
includes antibodies that specifically bind B lymphocyte stimulator
binding polypeptides of the present invention, and allows for the
exclusion of the same.
[0503] In further preferred, nonexclusive embodiments, the
antibodies (e.g., anti-idiotypic antibodies) inhibit one or more
biological activities of B lymphocyte stimulator through specific
binding to B lymphocyte stimulator. In more preferred embodiments,
the antibody inhibits B lymphocyte stimulator-mediated B cell
proliferation.
[0504] Antibodies of the present invention may also be described or
specified in terms of their cross-reactivity. Antibodies that do
not bind any other B lymphocyte stimulator binding polypeptide are
included. Antibodies that bind polypeptides with at least 95%, at
least 90%, at least 85%, at least 80%, at least 75%, at least 70%,
at least 65%, at least 60%, at least 55%, and at least 50% identity
(as calculated using methods known in the art and described herein)
to a B lymphocyte stimulator binding polypeptide of the present
invention are also included in the present invention. Antibodies
that do not bind polypeptides with less than 95%, less than 90%,
less than 85%, less than 80%, less than 75%, less than 70%, less
than 65%, less than 60%, less than 55%, and less than 50% identity
(as calculated using methods known in the art and described herein)
to a B lymphocyte stimulator binding polypeptide of the present
invention are also included in the present invention. Further
included in the present invention are antibodies which bind
polypeptides encoded by polynucleotides, the complement of which
hybridize to a polynucleotides of the present invention under
stringent hybridization conditions (as described herein).
Antibodies of the present invention may also be described or
specified in terms of their binding affinity to a B lymphocyte
stimulator binding polypeptide. Preferred binding affinities
include those with a dissociation constant or Kd less than
5.times.10.sup.-5 M, 10.sup.-5 M, 5.times.10.sup.-6 M, 10.sup.-6M,
5.times.10.sup.-7 M, 10.sup.7 M, 5.times.10.sup.-8 M, 10.sup.-8 M,
5.times.10.sup.-9 M, 10.sup.-9 M, 5.times.10.sup.-10 M,
10.sup.-10M, 5.times.10.sup.-11 M, 10.sup.-11 M, 5.times.10.sup.-12
M, 10.sup.-12 M, 5.times.10.sup.-13 M, 10.sup.-13 M,
5.times.10.sup.-14 M, 10.sup.-14 M, 5.times.10.sup.-15 M, or
10.sup.-15 M.
[0505] The invention also provides antibodies that competitively
inhibit binding of an antibody to a B lymphocyte stimulator binding
polypeptide as determined by any method known in the art for
determining competitive binding. In preferred embodiments, the
antibody competitively inhibits binding to the B lymphocyte
stimulator binding polypeptide by at least 95%, at least 90%, at
least 85%, at least 80%, at least 75%, at least 70%, at least 60%,
or at least 50%.
[0506] Antibodies of the present invention (e.g., anti-idiotypic
antibodies) may act as agonists or antagonists of B lymphocyte
stimulator or alternatively may not significantly alter B
lymphocyte stimulator mediated activity. For example, the present
invention includes antibodies (e.g., anti-idiotypic antibodies)
which disrupt B lymphocyte stimulator/B lymphocyte stimulator
receptor (e.g., TACI and BCMA) interactions either partially or
fully. In another example, antibodies of the invention enhance B
lymphocyte stimulator/B lymphocyte stimulator receptor interactions
either partially or fully. Such activity may be the result of, for
example, the antibody binding to a B lymphocyte stimulator binding
polypeptide, or alternatively as a result of direct binding of the
antibody (e.g., an anti-idiotypic antibody to B lymphocyte
stimulator).
[0507] Preferrably, antibodies of the present invention bind a B
lymphocyte stimulator binding polypeptide disclosed herein, a
portion thereof, or an antibody that binds a B lymphocyte
stimulator binding polypeptide disclosed herein, or a portion
thereof. The invention features both B lymphocyte stimulator
binding polypeptide-specific antibodies and antibodies that are
specific to B lymphocyte stimulator binding polypeptide/B
lymphocyte stimulator complexes. The invention features antibodies
that enhance B lymphocyte stimulator/B lymphocyte stimulator
binding polypeptide binding and/or B lymphocyte stimulator/B
lymphocyte stimulator receptor binding. The invention also features
antibodies that do not inhibit or reduce B lymphocyte stimulator/B
lymphocyte stimulator binding polypeptide binding and/or B
lymphocyte stimulator/B lymphocyte stimulator receptor binding. The
invention also features B lymphocyte stimulator binding polypeptide
specific antibodies that inhibit binding of the B lymphocyte
stimulator binding polypeptide to B lymphocyte stimulator or B
lymphocyte stimulator binding to B lymphocyte stimulator receptor.
In specific embodiments, antibodies are provided that inhibit B
lymphocyte stimulator activity or B lymphocyte stimulator receptor
activity by at least 95%, at least 90%, at least 85%, at least 80%,
at least 75%, at least 70%, at least 60%, or at least 50% of the
activity in absence of the antibody. Receptor activation (i.e.,
signaling) may be determined by techniques described herein or
otherwise known in the art. For example, receptor activation can be
determined by detecting the phosphorylation (e.g., tyrosine or
serine/threonine) of the receptor or its substrate by
immunoprecipitation followed by western blot analysis (for example,
as described supra).
[0508] The antibodies of the present invention may be used, for
purposes including, but not limited to, purify, detect, and target
the B lymphocyte stimulator binding polypeptides of the present
invention, including both in vitro and in vivo diagnostic and
therapeutic methods. For example, the antibodies have use in
immunoassays for qualitatively and quantitatively measuring levels
of B lymphocyte stimulator in biological samples. See, e.g., Harlow
et al., Antibodies: A Laboratory Manual (Cold Spring Harbor
Laboratory Press, Cold Spring Harbor 1988).
[0509] As discussed in more detail below, the antibodies of the
present invention may be used either alone or in combination with
other compositions. The antibodies may further be recombinantly
fused to a heterologous polypeptide at the N- or C-terminus or
chemically conjugated (including covalently and non-covalently
conjugated) to polypeptides or other compositions. For example,
antibodies of the present invention may be recombinantly fused or
conjugated to molecules useful as labels in detection assays and
effector molecules such as heterologous polypeptides, drugs,
radionuclides, or toxins. See, e.g., PCT publications WO 92/08495;
WO 91/14438; WO 89/12624; U.S. Pat. No. 5,314,995; and EP 396
387.
[0510] The antibodies of the invention include derivatives that are
modified, i.e, by the covalent attachment of any type of molecule
to the antibody such that covalent attachment does not prevent the
antibody from generating an anti-idiotypic response. For example,
but not by way of limitation, the antibody derivatives include
antibodies that have been modified, e.g., by glycosylation,
acetylation, pegylation, phosphorylation, amidation, derivatization
by known protecting/blocking groups, proteolytic cleavage, linkage
to a cellular ligand or other protein, etc. Any of numerous
chemical modifications may be carried out by known techniques,
including, but not limited to, specific chemical cleavage,
acetylation, formylation, metabolic synthesis of tunicamycin, etc.
Additionally, the derivative may contain one or more non-classical
amino acids.
[0511] The antibodies of the present invention may be generated by
any suitable method known in the art. Polyclonal antibodies to an
antigen-of-interest can be produced by various procedures well
known in the art. For example, a polypeptide can be administered to
various host animals including, but not limited to, rabbits, mice,
rats, etc. to induce the production of sera containing polyclonal
antibodies specific for the antigen. Various adjuvants may be used
to increase the immunological response, depending on the host
species, and include but are not limited to, Freund's (complete and
incomplete), mineral gels such as aluminum hydroxide, surface
active substances such as lysolecithin, pluronic polyols,
polyanions, peptides, oil emulsions, keyhole limpet hemocyanins,
dinitrophenol, and potentially useful human adjuvants such as BCG
(bacille Calmette-Guerin) and corynebacterium parvum. Such
adjuvants are also well known in the art.
[0512] According to certain embodiments of the invention,
multivalent B lymphocyte stimulator binding polypeptides are
administered to the host animal. Multivalent B lymphocyte
stimulator binding polypeptide complexes may be prepared using
techniques and materials known in the art such as, for example, by
cross-linking the polypeptide to a carrier protein (e.g., bovine
serum albumin (BSA), human albumin, keyhole limpet hemocyanin
(KLH), or succinylated KLH) by use of conventional cross-linking
reagents.
[0513] In specific embodiments multivalent B lymphocyte stimulator
binding polypeptides are administered in the form of multiple
antigen peptides (MAP) (Tam, J. Imm. Meth., 124:53-61 (1989); Tam,
Proc. Natl. Acad. Sci. USA, 85:5409-5413 (1988)). In this form, the
multivalent B lymphocyte stimulator binding polypeptide is
synthesized on a branching lysyl matrix using solid-phase peptide
synthesis methods. Recognition units in the form of MAP may be
prepared by methods known in the art (Tam, 1989, supra; Tam, 1988,
supra), or, for example, by a stepwise solid-phase procedure on MAP
resins (Applied Biosystems), utilizing methodology established by
the manufacturer. MAP peptides may be synthesized comprising (B
lymphocyte stimulator binding polypeptide).sub.2 Lys.sub.1, (B
lymphocyte stimulator binding polypeptide).sub.4 Lys.sub.3, (B
lymphocyte stimulator binding polypeptide).sub.8 Lys.sub.6 or more
levels of branching.
[0514] Monoclonal antibodies can be prepared using a wide variety
of techniques known in the art including the use of hybridoma,
recombinant, and phage display technologies, or a combination
thereof. For example, monoclonal antibodies can be produced using
hybridoma techniques including those known in the art and taught,
for example, in Harlow et al., Antibodies: A Laboratory Manual
(Cold Spring Harbor Laboratory Press, Cold Spring Harbor 1988);
Hammerling et al., in Monoclonal Antibodies and T-Cell Hybridomas
(Elsevier, N.Y. 1981), pp. 563-681 (said references incorporated by
reference in their entireties). The term "monoclonal antibody" as
used herein is not limited to antibodies produced through hybridoma
technology. The term "monoclonal antibody" refers to an antibody
that is derived from a single clone, including any eukaryotic,
prokaryotic, or phage clone, and not the method by which it is
produced.
[0515] A "monoclonal antibody" may comprise, or alternatively
consist of, two proteins, i.e., a heavy and a light chain.
[0516] Methods for producing and screening for specific antibodies
using hybridoma technology are routine and well known in the art
and are discussed in detail in the Examples (e.g., Example 9). In a
non-limiting example, mice can be immunized with a polypeptide or a
cell expressing such peptide. Once an immune response is detected,
e.g., antibodies specific for the antigen are detected in the mouse
serum, the mouse spleen is harvested and splenocytes isolated. The
splenocytes are then fused by well-known techniques to any suitable
myeloma cells, for example cells from cell line SP20 available from
the American Type Culture Collection (ATCC), to form hybridoma
cells. Hybridomas are selected and cloned by limited dilution. The
hybridoma clones are then assayed by methods known in the art for
cells that secrete antibodies capable of binding a polypeptide.
Ascites fluid, which generally contains high levels of antibodies,
can be generated by immunizing mice with positive hybridoma
clones.
[0517] Accordingly, the present invention provides methods of
generating monoclonal antibodies as well as antibodies produced by
the method comprising culturing a hybridoma cell secreting an
antibody of the invention wherein, preferably, the hybridoma is
generated by fusing splenocytes isolated from a mouse immunized
with an antigen according to the invention with myeloma cells and
then screening the hybridomas resulting from the fusion for
hybridoma clones that secrete an antibody able to bind a B
lymphocyte stimulator binding polypeptide.
[0518] Antibody fragments that recognize specific epitopes may be
generated by known techniques. For example, Fab and F(ab').sub.2
fragments of the invention may be produced by proteolytic cleavage
of immunoglobulin molecules, using enzymes such as papain (to
produce Fab fragments) or pepsin (to produce F(ab').sub.2
fragments). F(ab').sub.2 fragments contain the variable region, the
light chain constant region and the CH1 domain of the heavy
chain.
[0519] For example, the antibodies of the present invention can
also be generated using various phage display methods known in the
art. In phage display methods, functional antibody domains are
displayed on the surface of phage particles that carry the
polynucleotide sequences encoding them. In a particular embodiment,
such phage can be utilized to display antigen-binding domains
expressed from a repertoire or combinatorial antibody library
(e.g., human or murine). Phage expressing an antigen binding domain
that binds the antigen of interest can be selected or identified
with antigen, e.g., using labeled antigen or antigen bound or
captured to a solid surface or bead. Phage used in these methods
are typically filamentous phage including fd and M13 binding
domains expressed from phage with Fab, Fv or disulfide stabilized
Fv antibody domains recombinantly fused to either the phage gene
III or gene VIII protein. Examples of phage display methods that
can be used to make the antibodies of the present invention include
those disclosed in Brinkman et al., J. Immunol. Methods, 182:41-50
(1995); Ames et al., J. Immunol. Methods, 184:177-186 (1995);
Kettleborough et al., Eur. J. Immunol., 24:952-958 (1994); Persic
et al., Gene, 187 9-18 (1997); Burton et al., Advances in
Immunology, 57:191-280 (1994); PCT international application No.
PCT/GB91/01134; PCT publications WO 90/02809; WO 91/10737; WO
92/01047; WO 92/18619; WO 93/11236; WO 95/15982; WO 95/20401; and
U.S. Pat. Nos. 5,698,426; 5,223,409; 5,403,484; 5,580,717;
5,427,908; 5,750,753; 5,821,047; 5,571,698; 5,427,908; 5,516,637;
5,780,225; 5,658,727; 5,733,743 and 5,969,108; each of which is
incorporated herein by reference in its entirety.
[0520] As described in the above references, after phage selection,
the antibody coding regions from the phage can be isolated and used
to generate whole antibodies, including human antibodies, or any
other desired antigen binding fragment, and expressed in any
desired host, including mammalian cells, insect cells, plant cells,
yeast, and bacteria, e.g., as described in detail below. For
example, techniques to recombinantly produce Fab, Fab' and
F(ab').sub.2 fragments can also be employed using methods known in
the art such as those disclosed in PCT publication WO 92/22324;
Mullinax et al., BioTechniques, 12(6):864-869 (1992); and Sawai et
al., AJRI, 34:26-34 (1995); and Better et al., Science,
240:1041-1043 (1988) (said references incorporated herein by
reference in their entireties).
[0521] Examples of techniques which can be used to produce
single-chain Fvs and antibodies include those described in U.S.
Pat. Nos. 4,946,778 and 5,258,498; Huston et al., Methods in
Enzymology, 203:46-88 (1991); Shu et al., Proc. Natl. Acad. Sci.
USA, 90:7995-7999 (1993); and Skerra et al., Science, 240:1038-1040
(1988). For some uses, including in vivo use of antibodies in
humans and in vitro detection assays, it may be preferable to use
chimeric, humanized, or human antibodies. A chimeric antibody is a
molecule in which different portions of the antibody are derived
from different animal species, such as antibodies having a variable
region derived from a murine monoclonal antibody and a human
immunoglobulin constant region. Methods for producing chimeric
antibodies are known in the art. See e.g., Morrison, Science,
229:1202 (1985); Oi et al., BioTechniques, 4:214 (1986); Gillies et
al., J. Immunol. Methods, 125:191-202 (1989); U.S. Pat. Nos.
5,807,715; 4,816,567; and 4,816397, which are incorporated herein
by reference in their entirety. A humanized antibody is an antibody
molecule made using one or more complementarity determining regions
(CDRs) from a non-human species antibody that binds the desired
antigen and framework regions from a human immunoglobulin molecule.
Often, framework residues in the human framework regions will be
substituted with the corresponding residue from the CDR donor
antibody to alter, preferably improve, antigen binding. These
framework substitutions are identified by methods well known in the
art, e.g., by modeling of the interactions of the CDR and framework
residues to identify framework residues important for antigen
binding and sequence comparison to identify unusual framework
residues at particular positions. (See, e.g., Queen et al., U.S.
Pat. No. 5,585,089; Riechmann et al., Nature, 332:323 (1988), which
are incorporated herein by reference in their entireties.)
Antibodies can be humanized using a variety of techniques known in
the art including, for example, CDR-grafting (EP 239 400; PCT
publication WO 91/09967; U.S. Pat. Nos. 5,225,539; 5,530,101; and
5,585,089), veneering or resurfacing (EP 592 106; EP 519 596;
Padlan, Molecular Immunology, 28(4/5):489-498 (1991); Studnicka et
al., Protein Engineering, 7(6):805-814 (1994); Roguska. et al.,
Proc. Natl. Acad. Sci. USA, 91:969-973 (1994)), and chain shuffling
(U.S. Pat. No. 5,565,332).
[0522] Completely human antibodies are particularly desirable for
therapeutic treatment of human patients. Human antibodies can be
made by a variety of methods known in the art including phage
display methods described above using antibody libraries derived
from human immunoglobulin sequences. See also, U.S. Pat. Nos.
4,444,887 and 4,716,111; and PCT publications WO 98/46645, WO
98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO 96/33735, and
WO 91/10741; each of which is incorporated herein by reference in
its entirety.
[0523] Human antibodies can also be produced using transgenic mice
which are incapable of expressing functional endogenous
immunoglobulins, but which can express human immunoglobulin genes.
For example, the human heavy and light chain immunoglobulin gene
complexes may be introduced randomly or by homologous recombination
into mouse embryonic stem cells. Alternatively, the human variable
region, constant region, and diversity region may be introduced
into mouse embryonic stem cells in addition to the human heavy and
light chain genes. The mouse heavy and light chain immunoglobulin
genes may be rendered non-functional separately or simultaneously
with the introduction of human immunoglobulin loci by homologous
recombination. In particular, homozygous deletion of the JH region
prevents endogenous antibody production. The modified embryonic
stem cells are expanded and microinjected into blastocysts to
produce chimeric mice. The chimeric mice are then bred to produce
homozygous offspring that express human antibodies. The transgenic
mice are immunized in the normal fashion with a selected antigen,
e.g., all or a portion of a binding polypeptide. Monoclonal
antibodies directed against the antigen can be obtained from the
immunized, transgenic mice using conventional hybridoma technology.
The human immunoglobulin transgenes harbored by the transgenic mice
rearrange during B cell differentiation, and subsequently undergo
class switching and somatic mutation. Thus, using such a technique,
it is possible to produce therapeutically useful IgG, IgA, IgM and
IgE antibodies. For an overview of this technology for producing
human antibodies, see Lonberg and Huszar, Int. Rev. Immunol.,
13:65-93 (1995). For a detailed discussion of this technology for
producing human antibodies and human monoclonal antibodies and
protocols for producing such antibodies, see, e.g., PCT
publications WO 98/24893; WO 92/01047; WO 96/34096; WO 96/33735;
European Patent 598 877; U.S. Pat. Nos. 5,413,923; 5,625,126;
5,633,425; 5,569,825; 5,661,016; 5,545,806; 5,814,318; 5,885,793;
5,916,771; and 5,939,598, each of which is incorporated by
reference herein in its entirety. In addition, companies such as
Abgenix, Inc. (Freemont, Calif.) and GenPharm (San Jose, Calif.)
can be engaged to provide human antibodies directed against a
selected antigen using technology similar to that described
above.
[0524] Completely human antibodies that recognize a selected
epitope can be generated using a technique referred to as "guided
selection." In this approach, a selected non-human monoclonal
antibody, e.g., a mouse antibody, is used to guide the selection of
a completely human antibody recognizing the same epitope. (See,
Jespers et al., Bio/technology, 12:899-903 (1988).)
[0525] Further, antibodies to the B lymphocyte stimulator binding
polypeptides can, in turn, be utilized to generate anti-idiotype
antibodies that "mimic" B lymphocyte stimulator binding
polypeptides, using techniques well known to those skilled in the
art. (See, e.g., Greenspan & Bona, FASEB J., 7(5):437-444
(1989) and Nissinoff, J. Immunol., 147(8):2429-2438 (1991).) For
example, antibodies which bind to and competitively inhibit the
binding of B lymphocyte stimulator binding polypeptide to B
lymphocyte stimulator can be used to generate anti-idiotypes that
"mimic" the B lymphocyte stimulator/B lymphocyte stimulator binding
polypeptide binding domain and, as a consequence, bind to and
neutralize or enhance B lymphocyte stimulator binding to B
lymphocyte stimulator receptor (e.g., TACI and BCMA). Such
neutralizing anti-idiotypes or Fab fragments of such anti-idiotypes
can be used in therapeutic regimens to bind B lymphocyte stimulator
and/or neutralize or enhance B lymphocyte stimulator mediated
activity. In a specific embodiment, anti-idiotypic antibodies can
be used to bind B lymphocyte stimulator, and thereby block its
biological activity. In another specific embodiment, anti-idiotypic
antibodies can be used to bind B lymphocyte stimulator, and thereby
enhance its biological activity (e.g., via multimerization of B
lymphocyte stimulator).
Polynucleotides Encoding Antibodies
[0526] The invention further provides polynucleotides comprising a
nucleotide sequence encoding an antibody of the invention and
fragments thereof. The invention also encompasses polynucleotides
that hybridize under stringent hybridization conditions, e.g., as
defined supra, to polynucleotides that encode an antibody,
preferably, that specifically binds to B lymphocyte stimulator or a
B lymphocyte stimulator binding polypeptide.
[0527] The polynucleotides may be obtained, and the nucleotide
sequence of the polynucleotides determined, by any method known in
the art. For example, if the nucleotide sequence of the antibody is
known, a polynucleotide encoding the antibody may be assembled from
chemically synthesized oligonucleotides (e.g., as described in
Kutmeier et al., BioTechniques, 17:242 (1994)), which, briefly,
involves the synthesis of overlapping oligonucleotides containing
portions of the sequence encoding the antibody, annealing and
ligating of those oligonucleotides, and then amplification of the
ligated oligonucleotides by PCR.
[0528] Alternatively, a polynucleotide encoding an antibody may be
generated from nucleic acid from a suitable source. If a clone
containing a nucleic acid encoding a particular antibody is not
available, but the sequence of the antibody molecule is known, a
nucleic acid encoding the immunoglobulin may be chemically
synthesized or obtained from a suitable source (e.g., an antibody
cDNA library, or a cDNA library generated from, or nucleic acid,
preferably poly A+ RNA, isolated from, any tissue or cells
expressing the antibody, such as hybridoma cells selected to
express an antibody of the invention) by PCR amplification using
synthetic primers hybridizable to the 3' and 5' ends of the
sequence or by cloning using an oligonucleotide probe specific for
the particular gene sequence to identify, e.g., a cDNA clone from a
cDNA library that encodes the antibody. Amplified nucleic acids
generated by PCR may then be cloned into replicable cloning vectors
using any method known in the art.
[0529] Once the nucleotide sequence and corresponding amino acid
sequence of the antibody is determined, the nucleotide sequence of
the antibody may be manipulated using methods well known in the art
for the manipulation of nucleotide sequences, e.g., recombinant DNA
techniques, site directed mutagenesis, PCR, etc. (see, for example,
the techniques described in Sambrook et al., Molecular Cloning: A
Laboratory Manual, 2d Ed. (Cold Spring Harbor Laboratory, Cold
Spring Harbor, N.Y. 1990) and Current Protocols in Molecular
Biology, Ausubel et al., eds. (John Wiley & Sons, NY 1993),
which are both incorporated by reference herein in their
entireties), to generate antibodies having a different amino acid
sequence, for example to create amino acid substitutions,
deletions, and/or insertions.
[0530] In a specific embodiment, the amino acid sequence of the
heavy and/or light chain variable domains may be inspected to
identify the sequences of the complementarity determining regions
(CDRs) by methods that are well known in the art, e.g., by
comparison to known amino acid sequences of other heavy and light
chain variable regions to determine the regions of sequence
hypervariability. Using routine recombinant DNA techniques, one or
more of the CDRs may be inserted within framework regions, e.g.,
into human framework regions to humanize a non-human antibody, as
described supra. The framework regions may be naturally occurring
or consensus framework regions, and preferably human framework
regions (see, e.g., Chothia et al., J. Mol. Biol., 278: 457-479
(1998) for a listing of human framework regions). Preferably, the
polynucleotide generated by the combination of the framework
regions and CDRs encodes an antibody that specifically binds B
lymphocyte stimulator or a B lymphocyte stimulator binding
polypeptide. Preferably, as discussed supra, one or more amino acid
substitutions may be made within the framework regions, and,
preferably, the amino acid substitutions improve binding of the
antibody to its antigen. Additionally, such methods may be used to
make amino acid substitutions or deletions of one or more variable
region cysteine residues participating in an intrachain disulfide
bond to generate antibody molecules lacking one or more intrachain
disulfide bonds. Other alterations to the polynucleotide are
encompassed by the present invention and within the skill of the
art.
[0531] In addition, techniques developed for the production of
"chimeric antibodies" (Morrison et al., Proc. Natl. Acad. Sci. USA,
81:851-855 (1984); Neuberger et al., Nature, 312:604-608 (1984);
Takeda et al., Nature, 314:452-454 (1985)) by splicing genes from a
mouse antibody molecule of appropriate antigen specificity together
with genes from a human antibody molecule of appropriate biological
activity can be used. As described supra, a chimeric antibody is a
molecule in which different portions are derived from different
animal species, such as those having a variable region derived from
a murine antibody and a human immunoglobulin constant region, e.g.,
humanized antibodies.
[0532] Alternatively, techniques described for the production of
single chain antibodies (U.S. Pat. No. 4,946,778; Bird, Science,
242:423-42 (1988); Huston et al., Proc. Natl. Acad. Sci. USA,
85:5879-5883 (1988); and Ward et al., Nature, 334:544-54 (1989))
can be adapted to produce single chain antibodies. Single chain
antibodies are formed by linking the heavy and light chain
fragments of the Fv region via an amino acid bridge, resulting in a
single chain polypeptide. Techniques for the assembly of functional
Fv fragments in E. coli may also be used (Skerra et al., Science,
242:1038-1041 (1988)).
Methods of Producing Antibodies
[0533] The antibodies of the invention can be produced by any
method known in the art for the synthesis of antibodies, in
particular, by chemical synthesis or preferably, by recombinant
expression techniques.
[0534] Recombinant expression of an antibody, or fragment,
derivative or analog thereof, (e.g., a heavy or light chain of an
antibody or a single chain antibody), requires construction of an
expression vector containing a polynucleotide that encodes the
antibody. Once a polynucleotide encoding an antibody molecule or a
heavy or light chain of an antibody or portion thereof (preferably
containing the heavy or light chain variable domain) has been
obtained, the vector for the production of the antibody molecule
may be produced by recombinant DNA technology using techniques well
known in the art. Thus, methods for preparing a protein by
expressing a polynucleotide containing an antibody-encoding
nucleotide sequence are described herein. Methods which are well
known to those skilled in the art can be used to construct
expression vectors containing antibody coding sequences and
appropriate transcriptional and translational control signals.
These methods include, for example, in vitro recombinant DNA
techniques, synthetic techniques, and in vivo genetic
recombination. The invention, thus, provides replicable vectors
comprising a nucleotide sequence encoding an antibody molecule, or
a heavy or light chain thereof, or a heavy or light chain variable
domain, operably linked to a promoter. Such vectors may include the
nucleotide sequence encoding the constant region of the antibody
molecule (see, e.g., PCT publication WO 86/05807; PCT publication
WO 89/01036; and U.S. Pat. No. 5,122,464) and the variable domain
of the antibody may be cloned into such a vector for expression of
the entire heavy or light chain.
[0535] The expression vector is transferred to a host cell by
conventional techniques and the transfected cells are then cultured
by conventional techniques to produce an antibody. Thus, the
invention includes host cells containing a polynucleotide encoding
an antibody, or a heavy or light chain thereof, or a single chain
antibody, operably linked to a heterologous promoter. In preferred
embodiments for the expression of double-chained antibodies,
vectors encoding both the heavy and light chains may be
co-expressed in the host cell for expression of the entire
immunoglobulin molecule, as detailed below.
[0536] A variety of host-expression vector systems may be utilized
to express the antibody molecules. Such host-expression systems
represent vehicles by which the coding sequences of interest may be
produced and subsequently purified, but also represent cells which
may, when transformed or transfected with the appropriate
nucleotide coding sequences, express an antibody molecule in situ.
These include but are not limited to microorganisms such as
bacteria (e.g., E. coli, B. subtilis) transformed with recombinant
bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors
containing antibody coding sequences; yeast (e.g., Saccharomyces,
Pichia) transformed with recombinant yeast expression vectors
containing antibody coding sequences; insect cell systems infected
with recombinant virus expression vectors (e.g., baculovirus)
containing antibody coding sequences; plant cell systems infected
with recombinant virus expression vectors (e.g., cauliflower mosaic
virus, CaMV; tobacco mosaic virus, TMV) or transformed with
recombinant plasmid expression vectors (e.g., Ti plasmid)
containing antibody coding sequences; or mammalian cell systems
(e.g., COS, CHO, BHK, 293, 3T3 cells) harboring recombinant
expression constructs containing promoters derived from the genome
of mammalian cells (e.g., metallothionein promoter) or from
mammalian viruses (e.g., the adenovirus late promoter; the vaccinia
virus 7.5K promoter). Preferably, bacterial cells such as
Escherichia coli, and more preferably, eukaryotic cells, especially
for the expression of whole recombinant antibody molecule, are used
for the expression of a recombinant antibody molecule. For example,
mammalian cells such as Chinese hamster ovary cells (CHO), in
conjunction with a vector such as the major intermediate early gene
promoter element from human cytomegalovirus is an effective
expression system for antibodies (Foecking et al., Gene, 45:101
(1986); Cockett et al., Bio/Technology, 8:2 (1990)).
[0537] In bacterial systems, a number of expression vectors may be
advantageously selected depending upon the use intended for the
antibody molecule being expressed. For example, when a large
quantity of such a protein is to be produced, for the generation of
pharmaceutical compositions of an antibody molecule, vectors which
direct the expression of high levels of fusion protein products
that are readily purified may be desirable. Such vectors include,
but are not limited, to the E. coli expression vector pUR278
(Ruther et al., EMBO J., 2:1791 (1983)), in which the antibody
coding sequence may be ligated individually into the vector in
frame with the lacZ coding region so that a fusion protein is
produced; pIN vectors (Inouye & Inouye, Nucleic Acids Res.,
13:3101-3109 (1985); Van Heeke & Schuster, J. Biol. Chem.,
24:5503-5509 (1989)); and the like. pGEX vectors may also be used
to express foreign polypeptides as fusion proteins with glutathione
S-transferase (GST). In general, such fusion proteins are soluble
and can easily be purified from lysed cells by adsorption and
binding to matrix glutathione-agarose beads followed by elution in
the presence of free glutathione. The pGEX vectors are designed to
include thrombin or factor Xa protease cleavage sites so that the
cloned target gene product can be released from the GST moiety.
[0538] In an insect system, Autographa californica nuclear
polyhedrosis virus (AcNPV) is used as a vector to express foreign
genes. The virus grows in Spodoptera frugiperda cells. The antibody
coding sequence may be cloned individually into non-essential
regions (for example the polyhedrin gene) of the virus and placed
under control of an AcNPV promoter (for example the polyhedrin
promoter).
[0539] In mammalian host cells, a number of viral-based expression
systems may be utilized. In cases where an adenovirus is used as an
expression vector, the antibody coding sequence of interest may be
ligated to an adenovirus transcription/translation control complex,
e.g., the late promoter and tripartite leader sequence. This
chimeric gene may then be inserted in the adenovirus genome by in
vitro or in vivo recombination. Insertion in a non-essential region
of the viral genome (e.g., region E1 or E3) will result in a
recombinant virus that is viable and capable of expressing the
antibody molecule in infected hosts. See, e.g., Logan & Shenk,
Proc. Natl. Acad. Sci. USA, 81:355-359 (1984). Specific initiation
signals may also be required for efficient translation of inserted
antibody coding sequences. These signals include the ATG initiation
codon and adjacent sequences. Furthermore, the initiation codon
must be in phase with the reading frame of the desired coding
sequence to ensure translation of the entire insert. These
exogenous translational control signals and initiation codons can
be of a variety of origins, both natural and synthetic. The
efficiency of expression may be enhanced by the inclusion of
appropriate transcription enhancer elements, transcription
terminators, etc. (see, Bittner et al., Methods in Enzymol.,
153:51-544 (1987)).
[0540] In addition, a host cell strain may be chosen which
modulates the expression of the inserted sequences, or modifies and
processes the gene product in the specific fashion desired. Such
modifications (e.g., glycosylation) and processing (e.g., cleavage)
of protein products may be important for the function of the
protein. Different host cells have characteristic and specific
mechanisms for the post-translational processing and modification
of proteins and gene products. Appropriate cell lines or host
systems can be chosen to ensure the correct modification and
processing of the foreign protein expressed. To this end,
eukaryotic host cells which possess the cellular machinery for
proper processing of the primary transcript, glycosylation, and
phosphorylation of the gene product may be used. Such mammalian
host cells include but are not limited to CHO, VERY, BHK, Hela,
COS, MDCK, NSO, 293, 3T3, WI38, and in particular, breast cancer
cell lines such as, for example, BT483, Hs578T, HTB2, BT20 and
T47D, and normal mammary gland cell line such as, for example,
CRL7030 and Hs578Bst.
[0541] For long-term, high-yield production of recombinant
proteins, stable expression is preferred. For example, cell lines
which stably express the antibody molecule may be engineered.
Rather than using expression vectors which contain viral origins of
replication, host cells can be transformed with DNA controlled by
appropriate expression control elements (e.g., promoter, enhancer,
sequences, transcription terminators, polyadenylation sites, etc.),
and a selectable marker. Following the introduction of the foreign
DNA, engineered cells may be allowed to grow for 1-2 days in an
enriched media, and then are switched to a selective media. The
selectable marker in the recombinant plasmid confers resistance to
the selection and allows cells to stably integrate the plasmid into
their chromosomes and grow to form foci which in turn can be cloned
and expanded into cell lines. This method may advantageously be
used to engineer cell lines which express the antibody molecule.
Such engineered cell lines may be particularly useful in screening
and evaluation of compounds that interact directly or indirectly
with the antibody molecule.
[0542] A number of selection systems may be used, including but not
limited to the herpes simplex virus thymidine kinase (Wigler et
al., Cell, 11:223 (1977)), hypoxanthine-guanine
phosphoribosyltransferase (Szybalska & Szybalski, Proc. Natl.
Acad. Sci. USA, 48:202 (1992)), and adenine
phosphoribosyltransferase (Lowy et al., Cell, 22:817 (1980)) genes
can be employed in tk-, hgprt- or aprt-cells, respectively. Also,
antimetabolite resistance can be used as the basis of selection for
the following genes: dhfr, which confers resistance to methotrexate
(Wigler et al., Proc. Natl. Acad. Sci. USA, 77:357 (1980); O'Hare
et al., Proc. Natl. Acad. Sci. USA, 78:1527 (1981)); gpt, which
confers resistance to mycophenolic acid (Mulligan & Berg, Proc.
Natl. Acad. Sci. USA, 78:2072 (1981)); neo, which confers
resistance to the aminoglycoside G-418; Wu and Wu, Biotherapy,
3:87-95 (1991); Tolstoshev, Ann. Rev. Pharmacol. Toxicol.,
32:573-596 (1993); Mulligan, Science, 260:926-932 (1993); and
Morgan and Anderson, Ann. Rev. Biochem., 62:191-217 (1993); May,
1993, TIB TECH 11(5):155-215); and hygro, which confers resistance
to hygromycin (Santerre et al., Gene, 30:147 (1984)). Methods
commonly known in the art of recombinant DNA technology may be
routinely applied to select the desired recombinant clone, and such
methods are described, for example, in Current Protocols in
Molecular Biology, Ausubel et al., eds. (John Wiley & Sons, NY
1993); Kriegler, Gene Transfer and Expression, A Laboratory Manual
(Stockton Press, NY 1990); and Current Protocols in Human Genetics,
Dracopoli et al., eds. (John Wiley & Sons, NY 1994), Chapters
12 and 13; Colberre-Garapin et al., J. Mol. Biol., 150:1 (1981),
which are incorporated by reference herein in their entireties.
[0543] The expression levels of an antibody molecule can be
increased by vector amplification (for a review, see Bebbington and
Hentschel, The use of vectors based on gene amplification for the
expression of cloned genes in mammalian cells in DNA cloning, Vol.
3. (Academic Press, New York, 1987)). When a marker in the vector
system expressing antibody is amplifiable, increase in the level of
inhibitor present in culture of host cell will increase the number
of copies of the marker gene. Since the amplified region is
associated with the antibody gene, production of the antibody will
also increase (Crouse et al., Mol. Cell. Biol., 3:257 (1983)).
[0544] The host cell may be co-transfected with two expression
vectors, the first vector encoding a heavy chain derived
polypeptide and the second vector encoding a light chain derived
polypeptide. The two vectors may contain identical selectable
markers which enable equal expression of heavy and light chain
polypeptides. Alternatively, a single vector may be used which
encodes, and is capable of expressing, both heavy and light chain
polypeptides. In such situations, the light chain should be placed
before the heavy chain to avoid an excess of toxic free heavy chain
(Proudfoot, Nature, 322:52 (1986); Kohler, Proc. Natl. Acad. Sci.
USA, 77:2197 (1980)). The coding sequences for the heavy and light
chains may comprise cDNA or genomic DNA.
[0545] Once an antibody molecule has been produced by an animal,
chemically synthesized, or recombinantly expressed, it may be
purified by any method known in the art for purification of an
immunoglobulin molecule, for example, by chromatography (e.g., ion
exchange, affinity, particularly by affinity for the specific
antigen after Protein A, and sizing column chromatography),
centrifugation, differential solubility, or by any other standard
technique for the purification of proteins. In addition, the
antibodies of the present invention or fragments thereof can be
fused to heterologous polypeptide sequences described herein or
otherwise known in the art, to facilitate purification.
[0546] The present invention encompasses antibodies recombinantly
fused or chemically conjugated (including both covalent and
non-covalent conjugations) to a polypeptide (or portion thereof,
preferably at least 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 amino
acids of the polypeptide) of the present invention to generate
fusion proteins. The fusion does not necessarily need to be direct,
but may occur through linker sequences. The antibodies may be
specific for antigens other than B lymphocyte stimulator binding
polypeptides of the present invention. For example, antibodies may
be used to target the polypeptides of the present invention to
particular cell types, either in vitro or in vivo, by fusing or
conjugating the polypeptides of the present invention to antibodies
specific for particular cell surface receptors. Antibodies fused or
conjugated to the polypeptides of the present invention may also be
used in in vitro immunoassays and purification methods using
methods known in the art. See e.g., Harbor et al., supra, and PCT
publication WO 93/21232; EP 439,095; Naramura et al., Immunol.
Lett., 39:91-99 (1994); U.S. Pat. No. 5,474,981; Gillies et al.,
Proc. Natl. Acad. Sci. USA, 89:1428-1432 (1992); Fell et al., J.
Immunol., 146:2446-2452 (1991), which are incorporated by reference
in their entireties.
[0547] The present invention further includes compositions
comprising the polypeptides of the present invention fused or
conjugated to antibody domains other than the variable regions. For
example, the polypeptides of the present invention may be fused or
conjugated to an antibody Fc region, or portion thereof. The
antibody portion fused to a polypeptide of the present invention
may comprise the constant region, hinge region, CH1 domain, CH2
domain, and CH3 domain or any combination of whole domains or
portions thereof. The polypeptides may also be fused or conjugated
to the above antibody portions to form multimers. For example, Fc
portions fused to the polypeptides of the present invention can
form dimers through disulfide bonding between the Fc portions.
Higher multimeric forms can be made by fusing the polypeptides to
portions of IgA and IgM. Methods for fusing or conjugating the
polypeptides of the present invention to antibody portions are
known in the art. See, e.g., U.S. Pat. Nos. 5,336,603; 5,622,929;
5,359,046; 5,349,053; 5,447,851; 5,112,946; EP 307 434; EP 367 166;
PCT publications WO 96/04388; WO 91/06570; Ashkenazi et al., Proc.
Natl. Acad. Sci. USA, 88:10535-10539 (1991); Zheng et al., J.
Immunol. 154:5590-5600 (1995); and Vil et al., Proc. Natl. Acad.
Sci. USA, 89:11337-11341 (1992) (said references incorporated by
reference in their entireties). As discussed, supra, the
polypeptides corresponding to a B lymphocyte stimulator binding
polypeptide may be fused or conjugated to the above antibody
portions to increase the in vivo half life of the polypeptides or
for use in immunoassays using methods known in the art. Further,
the B lymphocyte stimulator binding polypeptides may be fused or
conjugated to the above antibody portions to facilitate
purification. One reported example describes chimeric proteins
consisting of the first two domains of the human CD4-polypeptide
and various domains of the constant regions of the heavy or light
chains of mammalian immunoglobulins. (EP 394 827; Traunecker et
al., Nature, 331:84-86 (1988). The polypeptides of the present
invention fused or conjugated to an antibody having
disulfide-linked dimeric structures (due to the IgG) may also be
more efficient in binding and neutralizing other molecules, than
the monomeric secreted protein or protein fragment alone.
(Fountoulakis et al., J. Biochem., 270:3958-3964 (1995)). In many
cases, the Fc part in a fusion protein is beneficial in therapy and
diagnosis, and thus can result in, for example, improved
pharmacokinetic properties (see, EP-A-232 262). Alternatively,
deleting the Fc part after the fusion protein has been expressed,
detected, and purified, would be desired. For example, the Fc
portion may hinder therapy and diagnosis if the fusion protein is
used as an antigen for immunizations. In drug discovery, for
example, human proteins, such as hIL-5, have been fused with Fc
portions for the purpose of high-throughput screening assays to
identify antagonists of hIL-5 (See, Bennett et al., J. Molecular
Recognition, 8:52-58 (1995); Johanson et al., J. Biol. Chem.,
270:9459-9471 (1995).
[0548] Moreover, the antibodies or fragments thereof of the present
invention can be fused to marker sequences, such as a peptide to
facilitate purification. In preferred embodiments, the marker amino
acid sequence is a hexa-histidine peptide, such as the tag provided
in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth,
Calif., 91311), among others, many of which are commercially
available. As described in Gentz et al., Proc. Natl. Acad. Sci.
USA, 86:821-824 (1989), for instance, hexa-histidine provides for
convenient purification of the fusion protein. Other peptide tags
useful for purification include, but are not limited to, the "HA"
tag, which corresponds to an epitope derived from the influenza
hemagglutinin protein (Wilson et al., Cell, 37:767 (1984)) and the
"flag" tag.
[0549] The present invention further encompasses antibodies or
fragments thereof conjugated to a diagnostic or therapeutic agent.
The antibodies can be used diagnostically to, for example, monitor
the development or progression of a tumor as part of a clinical
testing procedure to, e.g., determine the efficacy of a given
treatment regimen. Detection can be facilitated by coupling the
antibody to a detectable substance. Examples of detectable
substances include various enzymes, prosthetic groups, fluorescent
materials, luminescent materials, bioluminescent materials,
radioactive materials, positron emitting metals using various
positron emission tomographies, and nonradioactive paramagnetic
metal ions. The detectable substance may be coupled or conjugated
either directly to the antibody (or fragment thereof) or
indirectly, through an intermediate (such as, for example, a linker
known in the art) using techniques known in the art. See, for
example, U.S. Pat. No. 4,741,900 for metal ions which can be
conjugated to antibodies for use as diagnostics according to the
present invention. Examples of suitable enzymes include horseradish
peroxidase, alkaline phosphatase, beta-galactosidase, or
acetylcholinesterase; examples of suitable prosthetic group
complexes include streptavidin/biotin and avidin/biotin; examples
of suitable fluorescent materials include umbelliferone,
fluorescein, fluorescein isothiocyanate, rhodamine,
dichlorotriazinylamine fluorescein, dansyl chloride or
phycoerythrin; an example of a luminescent material includes
luminol; examples of bioluminescent materials include luciferase,
luciferin, and aequorin; and examples of suitable radioactive
material include .sup.125I, .sup.131I, .sup.111In or .sup.99Tc.
[0550] Further, an antibody or fragment thereof may be conjugated
to a therapeutic moiety such as a cytotoxin, e.g., a cytostatic or
cytocidal agent, a therapeutic agent or a radioactive metal ion,
e.g., alpha-emitters such as, for example, .sup.213Bi. A cytotoxin
or cytotoxic agent includes any agent that is detrimental to cells.
Examples include paclitaxol, cytochalasin B, gramicidin D, ethidium
bromide, emetine, mitomycin, etoposide, tenoposide, vincristine,
vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy
anthracin dione, mitoxantrone, mithramycin, actinomycin D,
1-dehydrotestosterone, glucocorticoids, procaine, tetracaine,
lidocaine, propranolol, and puromycin and analogs or homologs
thereof. Therapeutic agents include, but are not limited to,
antimetabolites (e.g., methotrexate, 6-mercaptopurine,
6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating
agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan,
carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan,
dibromomannitol, streptozotocin, mitomycin C, and
cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines
(e.g., daunorubicin (formerly daunomycin) and doxorubicin),
antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin,
mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g.,
vincristine and vinblastine).
[0551] The conjugates can be used for modifying a given biological
response, the therapeutic agent or drug moiety is not to be
construed as limited to classical chemical therapeutic agents.
[0552] For example, the drug moiety may be a protein or polypeptide
possessing a desired biological activity. Such proteins may
include, for example, a toxin such as abrin, ricin A, pseudomonas
exotoxin, or diphtheria toxin; a protein such as tumor necrosis
factor, alpha-interferon, beta-interferon, nerve growth factor,
platelet derived growth factor, tissue plasminogen activator, an
apoptotic agent, e.g., TNF-alpha, TNF-beta, AIM I (See, PCT
publication WO 97/33899), AIM II (See, PCT publication WO
97/34911), Fas Ligand (Takahashi et al., Int. Immunol., 6:1567-1574
(1994)), VEGI (See, PCT publication WO 99/23105), CD40 Ligand, a
thrombotic agent or an anti-angiogenic agent, e.g., angiostatin or
endostatin; or, biological response modifiers such as, for example,
lymphokines, interleukin-1 ("IL-1"), interleukin-2 ("IL-2"),
interleukin-6 ("IL-6"), granulocyte macrophage colony stimulating
factor ("GM-CSF"), granulocyte colony stimulating factor ("G-CSF"),
or other growth factors.
[0553] Techniques for conjugating such therapeutic moiety to
antibodies are well known, see, e.g., Arnon et al., "Monoclonal
Antibodies For Immunotargeting Of Drugs In Cancer Therapy", in
Monoclonal Antibodies And Cancer Therapy, Reisfeld et al., eds.
(Alan R. Liss, Inc. 1985), pp. 243-56; Hellstrom et al.,
"Antibodies For Drug Delivery", in Controlled Drug Delivery (2nd
Ed.), Robinson et al., eds. (Marcel Dekker, Inc. 1987), pp. 623-53;
Thorpe, "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A
Review", in Monoclonal Antibodies '84: Biological And Clinical
Applications, Pinchera et al., eds., pp. 475-506 (1985); "Analysis,
Results, And Future Prospective Of The Therapeutic Use Of
Radiolabeled Antibody in Cancer Therapy", in Monoclonal Antibodies
For Cancer Detection And Therapy, Baldwin et al., eds. (Academic
Press 1985), pp. 303-16; and Thorpe et al., "The Preparation And
Cytotoxic Properties Of Antibody-Toxin Conjugates", Immunol. Rev.,
62:119-58 (1982).
[0554] Antibodies may also be attached to solid supports, which are
particularly useful for immunoassays or purification of the B
lymphocyte stimulator binding polypeptide. Such solid supports
include, but are not limited to, glass, cellulose, polyacrylamide,
nylon, polystyrene, polyvinyl chloride or polypropylene.
[0555] Alternatively, an antibody can be conjugated to a second
antibody to form an antibody heteroconjugate as described by Segal
in U.S. Pat. No. 4,676,980, which is incorporated herein by
reference in its entirety.
[0556] An antibody, with or without a therapeutic moiety conjugated
to it, administered alone or in combination with cytotoxic
factor(s) and/or cytokine(s) can be used as a therapeutic.
Assays For Antibody Binding
[0557] The antibodies of the invention may be assayed for
immunospecific binding by any method known in the art. The
immunoassays which can be used include but are not limited to
competitive and non-competitive assay systems using techniques such
as western blots, radioimmunoassays, ELISA (enzyme linked
immunosorbent assay), "sandwich" immunoassays, immunoprecipitation
assays, precipitin reactions, gel diffusion precipitin reactions,
immunodiffusion assays, agglutination assays, complement-fixation
assays, immunoradiometric assays, fluorescent immunoassays, protein
A immunoassays, to name but a few. Such assays are routine and well
known in the art (see, e.g., Current Protocols in Molecular
Biology, Ausubel et al., eds. (John Wiley & Sons, NY 1993),
which is incorporated by reference herein in its entirety).
Exemplary immunoassays are described briefly below (but are not
intended by way of limitation).
[0558] Immunoprecipitation protocols generally comprise lysing a
population of cells in a lysis buffer such as RIPA buffer (1% NP-40
or Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 0.15 M NaCl,
0.01 M sodium phosphate at pH 7.2, 1% Trasylol) supplemented with
protein phosphatase and/or protease inhibitors (e.g., EDTA, PMSF,
aprotinin, sodium vanadate), adding the antibody of interest to the
cell lysate, incubating for a period of time (e.g., 1-4 hours) at
4.degree. C., adding protein A and/or protein G sepharose beads to
the cell lysate, incubating for about an hour or more at 4.degree.
C., washing the beads in lysis buffer and resuspending the beads in
SDS/sample buffer. The ability of the antibody of interest to
immunoprecipitate a particular antigen can be assessed by, e.g.,
western blot analysis. One of skill in the art would be
knowledgeable as to the parameters that can be modified to increase
the binding of the antibody to an antigen and decrease the
background (e.g., pre-clearing the cell lysate with sepharose
beads). For further discussion regarding immunoprecipitation
protocols see, e.g., Current Protocols in Molecular Biology,
Ausubel et al., eds. (John Wiley & Sons, NY 1993) at
10.16.1.
[0559] Western blot analysis generally comprises preparing protein
samples, electrophoresis of the protein samples in a polyacrylamide
gel (e.g., 8%-20% SDS-PAGE depending on the molecular weight of the
antigen), transferring the protein sample from the polyacrylamide
gel to a membrane such as nitrocellulose, PVDF or nylon, blocking
the membrane in blocking solution (e.g., PBS with 3% BSA or non-fat
milk), washing the membrane in washing buffer (e.g., PBS-Tween 20),
blocking the membrane with primary antibody (the antibody of
interest) diluted in blocking buffer, washing the membrane in
washing buffer, blocking the membrane with a secondary antibody
(which recognizes the primary antibody, e.g., an anti-human
antibody) conjugated to an enzymatic substrate (e.g., horseradish
peroxidase or alkaline phosphatase) or radioactive molecule (e.g.,
.sup.32P or .sup.125I) diluted in blocking buffer, washing the
membrane in wash buffer, and detecting the presence of the antigen.
One of skill in the art would be knowledgeable as to the parameters
that can be modified to increase the signal detected and to reduce
the background noise. For further discussion regarding western blot
protocols see, e.g., Current Protocols in Molecular Biology,
Ausubel et al., eds. (John Wiley & Sons, NY 1993) at
10.8.1.
[0560] ELISAs comprise preparing antigen, coating the well of a
96-well microtiter plate with the antigen, adding the antibody of
interest conjugated to a detectable compound such as an enzymatic
substrate (e.g., horseradish peroxidase or alkaline phosphatase) to
the well and incubating for a period of time, and detecting the
presence of the antigen. In ELISAs the antibody of interest does
not have to be conjugated to a detectable compound; instead, a
second antibody (which recognizes the antibody of interest)
conjugated to a detectable compound may be added to the well.
Further, instead of coating the well with the antigen, the antibody
may be coated to the well. In this case, a second antibody
conjugated to a detectable compound may be added following the
addition of the antigen of interest to the coated well. One of
skill in the art would be knowledgeable as to the parameters that
can be modified to increase the signal detected as well as other
variations of ELISAs known in the art. For further discussion
regarding ELISAs see, e.g., Current Protocols in Molecular Biology,
Ausubel et al., eds. (John Wiley & Sons, NY 1993) at
11.2.1.
[0561] The binding affinity of an antibody to an antigen and the
off-rate of an antibody-antigen interaction can be determined by
competitive binding assays. One example of a competitive binding
assay is a radioimmunoassay comprising the incubation of labeled
antigen (e.g., .sup.3H or .sup.125I) with the antibody of interest
in the presence of increasing amounts of unlabeled antigen, and the
detection of the antibody bound to the labeled antigen. The
affinity of the antibody of interest for a particular antigen and
the binding off-rates can be determined from the data by scatchard
plot analysis. Competition with a second antibody can also be
determined using radioimmunoassays. In this case, the antigen is
incubated with antibody of interest conjugated to a labeled
compound (e.g., .sup.3H or .sup.125I) in the presence of increasing
amounts of an unlabeled second antibody.
Therapeutic Uses of Antibodies
[0562] The present invention is further directed to antibody-based
therapies which involve administering antibodies of the invention
to an animal, preferably a mammal, and most preferably a human,
patient for treating one or more of the diseases, disorders, or
conditions disclosed herein. Therapeutic compounds of the invention
include, but are not limited to, antibodies of the invention
(including fragments, analogs and derivatives thereof as described
herein) and nucleic acids encoding antibodies of the invention
(including fragments, analogs and derivatives thereof and
anti-idiotypic antibodies as described herein). The antibodies of
the invention can be used to treat, inhibit or prevent diseases,
disorders or conditions associated with aberrant B lymphocyte
stimulator expression and/or activity, including, but not limited
to, any one or more of the diseases, disorders, or conditions
described herein.
[0563] The treatment and/or prevention of diseases, disorders, or
conditions associated with aberrant expression and/or activity of B
lymphocyte stimulator or B lymphocyte stimulator receptor includes,
but is not limited to, alleviating symptoms associated with those
diseases, disorders or conditions. The antibodies of the invention
may also be used to target and kill cells expressing B lymphocyte
stimulator on their surface and/or cells having B lymphocyte
stimulator bound to their surface. This targeting may be the result
of binding of the antibody to B lymphocyte stimulator binding
polypeptides that have been coadministered, or alternatively, the
result of direct binding of the antibody to B lymphocyte
stimulator. Antibodies of the invention may be provided in
pharmaceutically acceptable compositions as known in the art or as
described herein.
[0564] Non-limiting examples of the ways in which the antibodies of
the present invention may be used therapeutically includes binding
B lymphocyte stimulator binding polypeptides of the present
invention that have been coadministered in order to bind or
neutralize B lymphocyte stimulator, or by direct cytotoxicity of
the antibody, e.g., as mediated by complement (CDC) or by effector
cells (ADCC). B lymphocyte stimulator binding polypeptides and
anti-B lymphocyte stimulator binding polypeptide antibodies may be
administered either locally or systemically. Some of these
approaches are described in more detail below. Armed with the
teachings provided herein, one of ordinary skill in the art will
know how to use the antibodies of the present invention for
diagnostic, monitoring or therapeutic purposes without undue
experimentation.
[0565] The antibodies of this invention may be advantageously
utilized in combination with other monoclonal or chimeric
antibodies, or with lymphokines or hematopoietic growth factors
(such as, e.g., IL-2, IL-3 and IL-7), for example, which serve to
increase the number or activity of effector cells which interact
with the antibodies.
[0566] The antibodies of the invention may be administered alone or
in combination with other types of treatments (e.g., radiation
therapy, chemotherapy, hormonal therapy, immunotherapy, anti-tumor
agents, antibiotics, and immunoglobulin). Generally, administration
of products of a species origin or species reactivity (in the case
of antibodies) that is the same species as that of the patient is
preferred. Thus, in a preferred embodiment, human antibodies,
fragments derivatives, analogs, or nucleic acids, are administered
to a human patient for therapy or prophylaxis.
[0567] It is preferred to use high affinity and/or potent in vivo
inhibiting and/or neutralizing antibodies against polypeptides of
the present invention, fragments or regions thereof, for both
immunoassays directed to and therapy of disorders related to
polypeptides, including fragments thereof, of the present
invention. Such antibodies, fragments, or regions, will preferably
have an affinity for polypeptides, including fragments thereof.
Preferred binding affinities include those with a dissociation
constant or K.sub.D less than 5.times.10.sup.-5 M, 10.sup.-5 M,
5.times.10.sup.-6 M, 10.sup.-6 M, 5.times.10.sup.-7 M, 10.sup.-7 M,
5.times.10.sup.-8M, 10.sup.-8M, 5.times.10.sup.-9 M, 10.sup.-9 M,
5.times.10.sup.-10 M, 10.sup.-10 M, 5.times.10.sup.-11 M,
10.sup.-11 M, 5.times.10.sup.-12 M, 10.sup.-12 M,
5.times.10.sup.-13 M, 10.sup.-13 M, 5.times.10.sup.-14 M,
10.sup.-14 M, 5.times.10.sup.-15 M, and 10.sup.-15 M.
Demonstration of Therapeutic or Prophylactic Activity of
Antibodies
[0568] The compounds or pharmaceutical compositions of the
invention are preferably tested in vitro, and then in vivo for the
desired therapeutic or prophylactic activity, prior to use in
humans. For example, in vitro assays to demonstrate the therapeutic
or prophylactic utility of a compound or pharmaceutical composition
include, the effect of a compound on a cell line or a patient
tissue sample. The effect of the compound or composition on the
cell line and/or tissue sample can be determined utilizing
techniques known to those of skill in the art including, but not
limited to, rosette formation assays and cell lysis assays. In
accordance with the invention, in vitro assays which can be used to
determine whether administration of a specific compound is
indicated, include in vitro cell culture assays in which a patient
tissue sample is grown in culture, and exposed to or otherwise
administered a compound, and the effect of such compound upon the
tissue sample is observed.
Therapeutic and/or Prophylactic Administration and Composition
[0569] The invention provides methods of treatment, inhibition and
prophylaxis by administration to a subject of an effective amount
of a B lymphocyte stimulator binding compound or pharmaceutical
composition, preferably an antibody. In a preferred embodiment, the
compound is substantially purified (e.g., substantially free from
substances that limit its effect or produce undesired side
effects). The subject is preferably an animal, including but not
limited to animals such as cows, pigs, horses, chickens, cats,
dogs, etc., and is preferably a mammal, and most preferably
human.
[0570] Formulations and methods of administration that can be
employed when the compound comprises a nucleic acid or an
immunoglobulin are described above; additional appropriate
formulations and routes of administration can be selected from
among those described herein below.
[0571] Various delivery systems are known and can be used to
administer a compound, e.g., encapsulation in liposomes,
microparticles, microcapsules, recombinant cells capable of
expressing the compound, receptor-mediated endocytosis (see, e.g.,
Wu and Wu, J. Biol. Chem., 262:4429-4432 (1987)), construction of a
nucleic acid as part of a retroviral or other vector, etc. Methods
of introduction include but are not limited to intradermal,
intramuscular, intraperitoneal, intravenous, subcutaneous,
intranasal, epidural, and oral routes. The compounds or
compositions may be administered by any convenient route, for
example by infusion or bolus injection, by absorption through
epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and
intestinal mucosa, etc.) and may be administered together with
other biologically active agents. Administration can be systemic or
local. In addition, it may be desirable to introduce the
pharmaceutical compounds or compositions into the central nervous
system by any suitable route, including intraventricular and
intrathecal injection; intraventricular injection may be
facilitated by an intraventricular catheter, for example, attached
to a reservoir, such as an Ommaya reservoir. Pulmonary
administration can also be employed, e.g., by use of an inhaler or
nebulizer, and formulation with an aerosolizing agent.
[0572] In a specific embodiment, it may be desirable to administer
the pharmaceutical compounds or compositions locally to the area in
need of treatment; this may be achieved by, for example, and not by
way of limitation, local infusion during surgery, topical
application, e.g., in conjunction with a wound dressing after
surgery, by injection, by means of a catheter, by means of a
suppository, or by means of an implant, said implant being of a
porous, non-porous, or gelatinous material, including membranes,
such as sialastic membranes, or fibers. Preferably, when
administering a protein, including an antibody, care must be taken
to use materials to which the protein does not absorb.
[0573] In another embodiment, the compound or composition can be
delivered in a vesicle, in particular a liposome (see Langer,
Science, 249:1527-1533 (1990); Treat et al., in Liposomes in the
Therapy of Infectious Disease and Cancer, Lopez-Berestein and
Fidler, eds. (Liss, New York 1989), pp. 353-365; Lopez-Berestein,
ibid., pp. 317-327; see generally ibid.)
[0574] In yet another embodiment, the compound or composition can
be delivered in a controlled release system. In one embodiment, a
pump may be used (see Langer, supra; Sefton, CRC Crit. Ref. Biomed.
Eng., 14:201 (1987); Buchwald et al., Surgery, 88:507 (1980);
Saudek et al., N. Engl. J. Med., 321:574 (1989)). In another
embodiment, polymeric materials can be used (see Medical
Applications of Controlled Release, Langer and Wise, eds. (CRC
Press, Boca Raton, Fla. 1974); Controlled Drug Bioavailability,
Drug Product Design and Performance, Smolen and Ball, eds. (Wiley,
New York 1984); Ranger and Peppas, J. Macromol. Sci. Rev. Macromol.
Chem., 23:61 (1983); see also Levy et al., Science, 228:190 (1985);
During et al., Ann. Neurol., 25:351 (1989); Howard et al., J.
Neurosurg., 71:105 (1989)). In yet another embodiment, a controlled
release system can be placed in proximity of the therapeutic
target, thus requiring only a fraction of the systemic dose (see,
e.g., Goodson, in Medical Applications of Controlled Release,
Langer and Wise, eds. (CRC Press, Boca Raton, Fla. 1974), vol. 2,
pp. 115-138 (1984)).
[0575] Other controlled release systems are discussed in the review
by Langer (Science 249:1527-1533 (1990)).
[0576] In a specific embodiment where the compound is a nucleic
acid encoding a protein, the nucleic acid can be administered in
vivo to promote expression of its encoded protein, by constructing
it as part of an appropriate nucleic acid expression vector and
administering it so that it becomes intracellular, e.g., by use of
a retroviral vector (see U.S. Pat. No. 4,980,286), or by direct
injection, or by use of microparticle bombardment (e.g., a gene
gun; Biolistic, Dupont), or coating with lipids or cell-surface
receptors or transfecting agents, or by administering it in linkage
to a homeobox-like peptide which is known to enter the nucleus (see
e.g., Joliot et al., Proc. Natl. Acad. Sci. USA, 88:1864-1868
(1991)), etc. Alternatively, a nucleic acid can be introduced
intracellularly and incorporated within host cell DNA for
expression, by homologous recombination.
[0577] The present invention also provides pharmaceutical
compositions. Such compositions comprise a therapeutically
effective amount of a compound, and a pharmaceutically acceptable
carrier. In a specific embodiment, the term "pharmaceutically
acceptable" means approved by a regulatory agency of the Federal or
a state government or listed in the U.S. Pharmacopeia or other
generally recognized pharmacopeia for use in animals, and more
particularly in humans. The term "carrier" refers to a diluent,
adjuvant, excipient, or vehicle with which the therapeutic is
administered. Such pharmaceutical carriers can be sterile liquids,
such as water and oils, including those of petroleum, animal,
vegetable or synthetic origin, such as peanut oil, soybean oil,
mineral oil, sesame oil and the like. Water is a preferred carrier
when the pharmaceutical composition is administered intravenously.
Saline solutions and aqueous dextrose and glycerol solutions can
also be employed as liquid carriers, particularly for injectable
solutions. Suitable pharmaceutical excipients include starch,
glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk,
silica gel, sodium stearate, glycerol monostearate, talc, sodium
chloride, dried skim milk, glycerol, propylene, glycol, water,
ethanol and the like. The composition, if desired, can also contain
minor amounts of wetting or emulsifying agents, or pH buffering
agents. These compositions can take the form of solutions,
suspensions, emulsion, tablets, pills, capsules, powders,
sustained-release formulations and the like. The composition can be
formulated as a suppository, with traditional binders and carriers
such as triglycerides. Oral formulation can include standard
carriers such as pharmaceutical grades of mannitol, lactose,
starch, magnesium stearate, sodium saccharine, cellulose, magnesium
carbonate, etc. Examples of suitable pharmaceutical carriers are
described in Remington's Pharmaceutical Sciences, 18th Ed.,
Gennaro, ed. (Mack Publishing Co., 1990). Such compositions will
contain a therapeutically effective amount of the compound,
preferably in purified form, together with a suitable amount of
carrier so as to provide the form for proper administration to the
patient. The formulation should suit the mode of
administration.
[0578] In a preferred embodiment, the composition is formulated in
accordance with routine procedures as a pharmaceutical composition
adapted for intravenous administration to human beings. Typically,
compositions for intravenous administration are solutions in
sterile isotonic aqueous buffer. Where necessary, the composition
may also include a solubilizing agent and a local anesthetic such
as lignocaine to ease pain at the site of the injection. Generally,
the ingredients are supplied either separately or mixed together in
unit dosage form, for example, as a dry lyophilized powder or water
free concentrate in a hermetically sealed container such as an
ampoule or sachette indicating the quantity of active agent. Where
the composition is to be administered by infusion, it can be
dispensed with an infusion bottle containing sterile pharmaceutical
grade water or saline. Where the composition is administered by
injection, an ampoule of sterile water for injection or saline can
be provided so that the ingredients may be mixed prior to
administration.
[0579] The compounds for use in the methods of the invention can be
formulated as neutral or salt forms. Pharmaceutically acceptable
salts include those formed with anions such as those derived from
hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and
those formed with cations such as those derived from sodium,
potassium, ammonium, calcium, ferric hydroxides, isopropylamine,
triethylamine, 2-ethylamino ethanol, histidine, procaine, etc.
[0580] The amount of the compound used which will be effective in
the treatment, inhibition and prevention of a disease or disorder
associated with aberrant expression and/or activity of a
polypeptide can be determined by standard clinical techniques. In
addition, in vitro assays may optionally be employed to help
identify optimal dosage ranges. The precise dose to be employed in
the formulation will also depend on the route of administration,
and the seriousness of the disease or disorder, and should be
decided according to the judgment of the practitioner and each
patient's circumstances. Effective doses may be extrapolated from
dose-response curves derived from in vitro or animal model test
systems.
[0581] For antibodies, the dosage administered to a patient is
typically 0.1 mg/kg to 100 mg/kg of the patient's body weight.
Preferably, the dosage administered to a patient is between 0.1
mg/kg and 20 mg/kg of the patient's body weight, more preferably 1
mg/kg to 10 mg/kg of the patient's body weight. Generally, human
antibodies have a longer half-life within the human body than
antibodies from other species due to the immune response to the
foreign polypeptides. Thus, lower dosages of human antibodies and
less frequent administration is often possible. Further, the dosage
and frequency of administration of antibodies may be reduced by
enhancing uptake and tissue penetration (e.g., into the brain) of
the antibodies by modifications such as, for example,
lipidation.
[0582] The invention also provides a pharmaceutical pack or kit
comprising one or more containers filled with one or more of the
ingredients of the pharmaceutical compositions. Optionally
associated with such container(s) can be a notice in the form
prescribed by a governmental agency regulating the manufacture, use
or sale of pharmaceuticals or biological products, which notice
reflects approval by the agency of manufacture, use or sale for
human administration.
Diagnosis and Imaging
[0583] Labeled antibodies, and derivatives and analogs thereof,
which specifically bind to a B lymphocyte stimulator binding
polypeptide of interest can be used for diagnostic purposes to
detect, diagnose, or monitor diseases and/or disorders associated
with the aberrant expression and/or activity of B lymphocyte
stimulator. The invention provides for the detection of aberrant
expression of B lymphocyte stimulator, comprising (a) contacting
cells or body fluid with a B lymphocyte stimulator binding
polypeptide; (b) assaying the expression of B lymphocyte stimulator
in cells or body fluid of an individual using one or more
antibodies specific to the B lymphocyte stimulator binding
polypeptide and (c) comparing the level of B lymphocyte stimulator
expression with a standard B lymphocyte stimulator expression
level, whereby an increase or decrease in the assayed B lymphocyte
stimulator expression level compared to the standard expression
level is indicative of aberrant expression.
[0584] The invention provides a diagnostic assay for diagnosing a
disorder, comprising (a) contacting cells or body fluid with a B
lymphocyte stimulator binding polypeptide; (b) assaying the
expression of B lymphocyte stimulator in cells or body fluid of an
individual using one or more antibodies specific to the B
lymphocyte stimulator binding polypeptide of interest and (c)
comparing the level of B lymphocyte stimulator expression with a
standard B lymphocyte stimulator expression level, whereby an
increase or decrease in the assayed B lymphocyte stimulator
expression level compared to the standard expression level is
indicative of a particular disorder. With respect to cancer, the
presence of a relatively high amount of B lymphocyte stimulator in
biopsied tissue from an individual may indicate a predisposition
for the development of the disease, or may provide a means for
detecting the disease prior to the appearance of actual clinical
symptoms. A more definitive diagnosis of this type may allow health
professionals to employ preventative measures or aggressive
treatment earlier thereby preventing the development or further
progression of the cancer.
[0585] Antibodies can be used to assay B lymphocyte stimulator
protein levels in a biological sample using or routinely modifying
classical immunohistological methods known to those of skill in the
art (e.g., see Jalkanen et al., J. Cell. Biol., 101:976-985 (1985);
Jalkanen et al., J. Cell. Biol., 105:3087-3096 (1987)). Other
antibody-based methods useful for detecting protein gene expression
include immunoassays, such as the enzyme linked immunosorbent assay
(ELISA) and the radioimmunoassay (RIA). Suitable antibody assay
labels are known in the art and include enzyme labels, such as,
glucose oxidase; radioisotopes, such as iodine (.sup.131I,
.sup.125I, .sup.123I, .sup.121I), carbon (.sup.14C), sulfur
(.sup.35S), tritium (.sup.3H), indium (.sup.115mIn, .sup.113mIn,
.sup.112In, .sup.111In), and technetium (.sup.99Tc, .sup.99mTc),
thallium (.sup.201Ti), gallium (.sup.68Ga, .sup.67Ga), palladium
(.sup.103Pd), molybdenum (.sup.99Mo), xenon (.sup.133Xe), fluorine
(.sup.18F), .sup.153Sm, .sup.177Lu, .sup.159Gd, .sup.149Pm,
.sup.140La, .sup.175Yb, .sup.166Ho, .sup.90Y, .sup.47Sc,
.sup.186Re, .sup.188Re, .sup.142Pr, .sup.105Rh, .sup.97Ru;
luminescent labels, such as luminol; and fluorescent labels, such
as fluorescein and rhodamine, and biotin.
[0586] Techniques known in the art may be applied to label
antibodies. Such techniques include, but are not limited to, the
use of bifunctional conjugating agents (see, e.g., U.S. Pat. Nos.
5,756,065; 5,714,631; 5,696,239; 5,652,361; 5,505,931; 5,489,425;
5,435,990; 5,428,139; 5,342,604; 5,274,119; 4,994,560; and
5,808,003; the contents of each of which are hereby incorporated by
reference in its entirety).
[0587] One embodiment of the invention is the detection and
diagnosis of a disease or disorder associated with aberrant
expression of B lymphocyte stimulator in an animal, preferably a
mammal and most preferably a human. In one embodiment, diagnosis
comprises: (a) administering (for example, parenterally,
subcutaneously, or intraperitoneally) to a subject an effective
amount of a labeled molecule which specifically binds to B
lymphocyte stimulator (e.g., a B lymphocyte stimulator binding
polypeptide) or which specifically binds to a molecule that
specifically binds to B lymphocyte stimulator (e.g., an anti-B
lymphocyte stimulator binding polypeptide antibody); (b) waiting
for a time interval following the administering for permitting the
labeled molecule to preferentially concentrate at sites in the
subject where the polypeptide is expressed (and for unbound labeled
molecule to be cleared to background level); (c) determining
background level; and (d) detecting the labeled molecule in the
subject, such that detection of labeled molecule above the
background level indicates that the subject has a particular
disease or disorder associated with aberrant expression of the
polypeptide of interest. Background level can be determined by
various methods including, comparing the amount of labeled molecule
detected to a standard value previously determined for a particular
system. As described herein, specific embodiments of the invention
are directed to the use of the antibodies to quantitate or
qualitate concentrations of cells of B cell lineage or cells of
monocytic lineage.
[0588] It will be understood by those skilled in the art that the
size of the subject and the imaging system used will determine the
quantity of imaging moiety needed to produce diagnostic images. In
the case of a radioisotope moiety, for a human subject, the
quantity of radioactivity injected will normally range from about 5
to 20 millicuries of .sup.99mTc. The labeled antibody or antibody
fragment will then preferentially accumulate at the location of
cells which contain the specific polypeptide. In vivo tumor imaging
is described in S. W. Burchiel et al., "Immunopharmacokinetics of
Radiolabeled Antibodies and Their Fragments." (Chapter 13 in Tumor
Imaging: The Radiochemical Detection of Cancer, S. W. Burchiel and
B. A. Rhodes, eds. (Masson Publishing Inc. 1982).
[0589] Depending on several variables, including the type of label
used and the mode of administration, the time interval following
the administration for permitting the labeled molecule to
preferentially concentrate at sites in the subject and for unbound
labeled molecule to be cleared to background level is 6 to 48 hours
or 6 to 24 hours or 6 to 12 hours. In another embodiment the time
interval following administration is 5 to 20 days or 5 to 10
days.
[0590] In a further embodiment, monitoring of the disease or
disorder is carried out by repeating the method for diagnosing the
disease or disorder, for example, one month after initial
diagnosis, six months after initial diagnosis, one year after
initial diagnosis, etc. and comparing the results.
[0591] Presence of the labeled molecule can be detected in the
patient using methods known in the art for in vivo scanning. These
methods depend upon the type of label used. Skilled artisans will
be able to determine the appropriate method for detecting a
particular label. Methods and devices that may be used in the
diagnostic methods of the invention include but are not limited to
computed tomography (CT), whole body scan such as position emission
tomography (PET), magnetic resonance imaging (MRI), and
sonography.
[0592] In a specific embodiment, the molecule is labeled with a
radioisotope and is detected in the patient using a radiation
responsive surgical instrument (Thurston et al., U.S. Pat. No.
5,441,050). In another embodiment, the molecule is labeled with a
fluorescent compound and is detected in the patient using a
fluorescence responsive scanning instrument. In another embodiment,
the molecule is labeled with a positron emitting metal and is
detected in the patent using positron emission-tomography. In yet
another embodiment, the molecule is labeled with a paramagnetic
label and is detected in a patient using magnetic resonance imaging
(MRI).
Antibody Kits
[0593] The present invention provides kits that can be used in the
above methods. In one embodiment, a kit comprises an antibody,
preferably a purified antibody, in one or more containers. In a
specific embodiment, the kits of the present invention contain a
substantially isolated polypeptide comprising an epitope which is
specifically immunoreactive with an antibody included in the kit.
Preferably, the kits of the present invention further comprise a
control antibody which does not react with the polypeptide of
interest. In another specific embodiment, the kits of the present
invention comprise two or more antibodies (monoclonal and/or
polyclonal) that recognize the same and/or different sequences or
regions of a polypeptide according to the invention. In another
specific embodiment, the kits of the present invention contain a
means for detecting the binding of an antibody to a polypeptide of
interest (e.g., the antibody may be conjugated to a detectable
substrate such as a fluorescent compound, an enzymatic substrate, a
radioactive compound or a luminescent compound, or a second
antibody which recognizes the first antibody may be conjugated to a
detectable substrate).
[0594] In another specific embodiment of the present invention, the
kit is a diagnostic kit for use in screening serum containing
antibodies specific against proliferative and/or cancerous
polynucleotides and polypeptides. Such a kit may include a control
antibody that does not react with the polypeptide of interest. Such
a kit may include a substantially isolated polypeptide antigen
comprising an epitope which is specifically immunoreactive with at
least one anti-polypeptide antigen antibody. Further, such a kit
includes means for detecting the binding of said antibody to the
antigen (e.g., the antibody may be conjugated to a fluorescent
compound such as fluorescein or rhodamine which can be detected by
flow cytometry). In specific embodiments, the kit may include a
recombinantly produced or chemically synthesized polypeptide
antigen. The polypeptide antigen of the kit may also be attached to
a solid support.
[0595] In a more specific embodiment the detecting means of the
above-described kit includes a solid support to which said
polypeptide antigen is attached. Such a kit may also include a
non-attached reporter-labeled anti-human antibody. In this
embodiment, binding of the antibody to the polypeptide antigen can
be detected by binding of the said reporter-labeled antibody.
[0596] In an additional embodiment, the invention includes a
diagnostic kit for use in screening serum containing antigens of
the polypeptide. The diagnostic kit includes a substantially
isolated antibody specifically immunoreactive with polypeptide or
polynucleotide antigens, and means for detecting the binding of the
polynucleotide or polypeptide antigen to the antibody. In one
embodiment, the antibody is attached to a solid support. In a
specific embodiment, the antibody may be a monoclonal antibody. The
detecting means of the kit may include a second, labeled monoclonal
antibody. Alternatively, or in addition, the detecting means may
include a labeled, competing antigen.
[0597] In one diagnostic configuration, test serum is reacted with
a solid phase reagent having a surface-bound antigen obtained by
the methods of the present invention. After binding with specific
antigen antibody to the reagent and removing unbound serum
components by washing, the reagent is reacted with reporter-labeled
anti-human antibody to bind reporter to the reagent in proportion
to the amount of bound anti-antigen antibody on the solid support.
The reagent is again washed to remove unbound labeled antibody, and
the amount of reporter associated with the reagent is determined.
Typically, the reporter is an enzyme which is detected by
incubating the solid phase in the presence of a suitable
fluorometric, luminescent or colorimetric substrate (Sigma, St.
Louis, Mo.).
[0598] The solid surface reagent in the above assay is prepared by
known techniques for attaching protein material to solid support
material, such as polymeric beads, dip sticks, 96-well plate or
filter material. These attachment methods generally include
non-specific adsorption of the protein to the support or covalent
attachment of the protein, typically through a free amine group, to
a chemically reactive group on the solid support, such as an
activated carboxyl, hydroxyl, or aldehyde group. Alternatively,
streptavidin coated plates can be used in conjunction with
biotinylated protein(s).
[0599] Thus, the invention provides an assay system or kit for
carrying out this diagnostic method. The kit generally includes a
support with surface-bound recombinant antigens, and a
reporter-labeled anti-human antibody for detecting surface-bound
anti-antigen antibody.
[0600] In another specific embodiment, any of the antibodies listed
above are conjugated to a toxin or a label (as described supra).
Such conjugated antibodies are used to kill a particular population
of cells or to quantitate a particular population of cells. In a
preferred embodiment, such conjugated antibodies are used to kill B
cells expressing B lymphocyte stimulator receptor on their surface.
In another preferred embodiment, such conjugated antibodies are
used to quantitate B cells expressing B lymphocyte stimulator
receptor on their surface.
[0601] In another specific embodiment, any of the antibodies listed
above are conjugated to a toxin or a label (as described supra).
Such conjugated antibodies are used to kill a particular population
of cells or to quantitate a particular population of cells. In a
preferred embodiment, such conjugated antibodies are used to kill
monocyte cells expressing the membrane-bound form of B lymphocyte
stimulator. In another preferred embodiment, such conjugated
antibodies are used to quantitate monocyte cells expressing the
membrane-bound form of B lymphocyte stimulator.
[0602] The antibodies of the invention also have uses as
therapeutics and/or prophylactics which include, but are not
limited to, in activating monocytes or blocking monocyte activation
and/or killing monocyte lineages that express the membrane bound
form of B lymphocyte stimulator on their cell surfaces (e.g., to
treat, prevent, and/or diagnose myeloid leukemias, monocyte based
leukemias and lymphomas, monocytosis, monocytopenia, rheumatoid
arthritis, and other diseases or conditions associated with
activated monocytes). In a specific embodiment, the antibodies fix
complement. In other specific embodiments, as further described
herein, the antibodies (or fragments thereof) are associated with
heterologous polypeptides or nucleic acids (e.g. toxins, such as,
compounds that bind and activate endogenous cytotoxic effecter
systems, and radioisotopes; and cytotoxic prodrugs).
[0603] As discussed above, antibodies to the B lymphocyte
stimulator binding polypeptides can, in turn, be utilized to
generate anti-idiotype antibodies that "mimic" the B lymphocyte
stimulator binding polypeptide, using techniques well known to
those skilled in the art. (See, e.g., Greenspan & Bona, FASEB
J., 7(5):437-444 (1989), and Nissinoff, J. Immunol.,
147(8):2429-2438 (1991)). For example, antibodies which bind to B
lymphocyte stimulator binding polypeptides and competitively
inhibit B lymphocyte stimulator/B lymphocyte stimulator binding
polypeptide binding can be used to generate anti-idiotypes that
"mimic" the B lymphocyte stimulator binding polypeptide/B
lymphocyte stimulator binding domain and, as a consequence, bind to
and, for example, neutralize B lymphocyte stimulator. Such
neutralizing anti-idiotypes or Fab fragments of such anti-idiotypes
can be used in therapeutic regimens to neutralize B lymphocyte
stimulator. For example, such anti-idiotypic antibodies can be used
to bind B lymphocyte stimulator and thereby block B lymphocyte
stimulator mediated B cell activation, proliferation, survival
and/or differentiation.
EXAMPLES
[0604] Isolation of B lymphocyte stimulator binding polypeptides
and their use in accordance with this invention will be further
illustrated below. The specific parameters included in the
following examples are intended to illustrate the practice of the
invention, and they are not presented to in any way limit the scope
of the invention.
Example 1
Screening of Phage Display Libraries
[0605] Streptavidin-coated magnetic beads (Dynal M-280) were chosen
for presentation of the target during screening because of their
superior binding capacity compared to that of a 96 well plate. The
binding capacity of the beads for biotinylated antibodies was 5-10
.mu.g/mg of beads as stated by the manufacturer. For this study and
the screening to follow, 5 .mu.g of biotinylated recombinant B
lymphocyte stimulator (obtained from Human Genome Sciences, Inc.)
was allowed for each mg of beads. This amount of biotinylated B
lymphocyte stimulator represents a 10-fold excess of target, for
saturation of the beads. Unbound B lymphocyte stimulator was washed
away. Bound biotinylated B lymphocyte stimulator was confirmed with
detection using Mab 16C9 (murine anti-B lymphocyte stimulator,
Human Genome Sciences) primary antibody and a goat anti-mouse HRP
conjugate as the secondary antibody. An irrelevant monoclonal
antibody (anti-TNF.alpha.) was used to probe a second set of beads
to control for nonspecific binding. The color reagent TMB was used
and the assay read at OD 630 nm.
[0606] Nine phage display libraries, TN6/6, TN7/4, TN8/9, TN9/4,
TN10/9, TN12/1, and Substrate Phage #2 (Dyax Corp., Cambridge,
Mass. (US)), and PhD7 and PhD12 (New England Biolabs), were
screened for B lymphocyte stimulator binders. The makeup of these
libraries was as follows:
[0607] The TN6/6 phage display library was composed of recombinant
M13 phage displaying variegated peptides with the potential to form
loop structures based on a polypeptide template having the
structure Xaa-Xaa-Xaa-Cys-Xaa-Xaa-Xaa-Xaa-Cys-Xaa-Xaa-Xaa (SEQ ID
NO:14) and providing 2.0.times.10.sup.8 peptide diversity.
[0608] The TN7/4 phage display library was composed of recombinant
M13 phage displaying variegated peptides with the potential to form
loop structures based on a polypeptide template having the
structure Xaa-Xaa-Xaa-Cys-Xaa-Xaa-Xaa-Xaa-Xaa-Cys-Xaa-Xaa-Xaa (SEQ
ID NO:15) and providing 2.3.times.10.sup.9 peptide diversity.
[0609] The TN8/9 phage display library was composed of recombinant
M13 phage displaying variegated peptides with the potential to form
loop structures based on a polypeptide template having the
structure Xaa-Xaa-Xaa-Cys-Xaa-Xaa-Xaa-Xaa-Xaa-Xaa-Cys-Xaa-Xaa-Xaa
(SEQ ID NO:16) and providing about 5.times.10.sup.9 peptide
diversity. The TN9/4 phage display library was composed of
recombinant M13 phage displaying variegated peptides with the
potential to form loop structures based on a polypeptide template
having the structure
Xaa-Xaa-Xaa-Cys-Xaa-Xaa-Xaa-Xaa-Xaa-Xaa-Xaa-Cys-Xaa-Xaa-Xaa (SEQ ID
NO:17) and providing about 3.2.times.10.sup.9 peptide
diversity.
[0610] The TN10/9 phage display library was composed of recombinant
M13 phage displaying variegated peptides with the potential to form
loop structures based on a polypeptide template having the
structure
Xaa-Xaa-Xaa-Cys-Xaa-Xaa-Xaa-Xaa-Xaa-Xaa-Xaa-Xaa-Cys-Xaa-Xaa-Xaa
(SEQ ID NO:18) and providing 2.5.times.10.sup.9 peptide
diversity.
[0611] The TN12/1 phage display library was composed of recombinant
M13 phage displaying variegated peptides with the potential to form
loop structures based on a polypeptide template having the
structure
Xaa-Xaa-Xaa-Cys-Xaa-Xaa-Xaa-Xaa-Xaa-Xaa-Xaa-Xaa-Xaa-Xaa-Cys-Xaa-Xaa-Xaa
(SEQ ID NO:19) and providing 1.4.times.10.sup.9 peptide
diversity.
[0612] Substrate Phage Library #2 was composed of recombinant M13
phage displaying a polypeptide insert of approximately 80 amino
acids, having two streptavidin binding domains, a linear variegated
segment of thirteen amino acids where all amino acids except Cys
were permitted at each position, and a Factor Xa cleavage site,
linked together with peptide linkers. This library provided a
diversity of 2.times.10.sup.8 display polypeptides.
[0613] Libraries PhD7 and PhD12 were composed of recombinant M13
phage displaying randomized linear seven- and twelve-amino acid
peptides, respectively.
[0614] Screening was performed as described in PCT/US01/[ ],
entitled "Binding Polypeptides for B Lymphocyte Stimulator Protein
(BLyS.TM.)", filed concurrently herewith.
[0615] At the conclusion of screening individual phage isolates
were randomly selected and tested by ELISA for binding to B
lymphocyte stimulator. The same isolates were submitted for DNA
sequence analysis to identify the nucleotide and deduced amino acid
sequence of the displayed peptide. Isolates were also tested for
their ability to bind to recombinant B lymphocyte stimulator in
feed streams of CHO supernatant and Sf9 supernatant (supplied by
Human Genome Sciences, Inc.).
[0616] Each isolate was tested for binding to B lymphocyte
stimulator by standard ELISA techniques where bound phage were
detected with a monoclonal anti-phage antibody/HRP conjugate.
[0617] Amino acid sequences of the displayed peptides were derived
from sequencing the phage isolate DNA inserts. Sequence data from
the phage isolates were grouped by library and sorted according to
the degree of similarity. The B lymphocyte stimulator binding phage
isolate peptides are shown in Tables 1-8 below. These peptides
represent the translation of the DNA sequences across the varied
regions of the genes encoding the phage display fusion/peptide.
TABLE-US-00029 TABLE 1 TN6/6 Library B lymphocyte
stimulator-binding Sequences Phage Isolate Amino Acid Sequence SEQ
ID NO: 453-01-B06 HLRCWSTNCRYD 20 453-01-A04 VMDCLINRCDTV 21
TABLE-US-00030 TABLE 2 TN7/4 Library B lymphocyte
stimulator-binding Sequences Phage Isolate Amino Acid Sequence SEQ
ID NO: 453-01-B04 KSKCFFPWECQQA 22 453-01-D11 AMKCYFPWECANG 23
453-01-A05 NVACYFPWECHHP 24 453-01-D01 NAPCYFPWECFSI 25 453-01-D03
SVNCWFPWECVGN 26 453-01-A08 KEPCYFYWECAVS 27
TABLE-US-00031 TABLE 3 TN8/9 Library B lymphocyte
stimulator-binding Sequences Phage Isolate Amino Acid Sequence SEQ
ID NO: 453-01-D04 DTNCDLLTKMCGPQ 28 453-01-C06 GTPCDLLTKLCLLW 29
453-01-D10 MSECDLLTKICLMG 30 453-01-B07 VPFCDLLTKHCFEA 31
453-01-B09 VPFCDLLTKHCFEA 32 453-01-C02 WSACDLLTKQCVQV 33
453-01-A06 -DGCDELTKICGMK 34 453-01-B03 KSWCDELTKVCFDP 35
453-01-B11 KWMCDELTKQCQYV 36 453-01-A02 MKYCDELTKICVGW 37
453-01-B05 YFQCDELTKMCWQK 38 453-01-A11 AMHCDKLTKHCKFH 39
453-01-A03 VPYCDKLTKICQW- 40 453-01-A07 EVFCDVLTKVCFHD 41
453-01-C09 KPKCDVLTKMCDWL 42 453-01-B02 TQHCDVLTKQCFTI 43
453-01-C01 GHFCDRLTKYCFEP 44 453-01-A09 HIQCDRLTKSCLSV 45
453-01-D05 IKACDILTKVCWPP 46 453-01-A01 QFDCDPLTKYCGEF 47
453-01-C07 KMYCDHLTGYCWPE 48 453-01-C11 MQSCDILTGYCFKR 49
453-01-D12 GPWCDILTGFCLAQ 50 453-01-C04 SVRCDLLTGWCPVW 51
453-01-B10 PADCDPLTNICFWK 52 453-01-D02 TNVCDPLTNVCFMN 53
453-01-C05 EHWCDDLTHLCFRL 54 453-01-D08 GYWCDVLTNNCWKI 55
453-01-C10 LYNCDYLTRLCFEP 56 453-01-C08 HVDCLLHPKACYKY 57
453-01-D07 VQDCLLHPKACQMQ 58 453-01-D09 KFDCLLKPMFCSNH 59
453-01-C12 FADCLIHPKSCKPL 60 453-01-D06 HGNCYPFPWECESK 61
453-01-B01 MIIVLLLLRFAISR 62 453-01-A12 SLLVIFLLIGAGSL 63
TABLE-US-00032 TABLE 4 TN9/4 Library B lymphocyte
stimulator-binding Sequences Phage Isolate Amino Acid Sequence SEQ
ID NO: 453-01-G06 FHPCDMLTGIWCQPN 64 453-01-H01 SKRCDLLTKMWCETE 65
453-01-F02 TKFCDRLTMPKCVWK 66 453-01-E03 NTFCPDPLTGRCVNP 67
453-01-E11 DWTCDPLFHRECIFE 68 453-01-H09 PQPCDLLFEKKCSIK 69
453-01-H02 RWHCDMLINPSCLPD 70 453-01-E04 KIQCDIVNLSSCVYP 71
453-01-G11 LNACDIVHPNYCSGM 72 453-01-F01 AKACSIVNLESCEYL 73
453-01-H06 RQACSIITPWGCPIP 74 453-01-F10 ADNCTVATLDFCYWT 75
453-01-E05 KPECNITKPQFCFGE 76
TABLE-US-00033 TABLE 5 TN10 Library B lymphocyte stimulator-binding
Sequences Phage Isolate Amino Acid Sequence SEQ ID NO: 453-01-H07
-NNCQWDELTSMCDPF 77 453-01-F05 SRLCHMDELTHVCVHF 78 453-01-F09
SRPCQIDELTKACFYN 79 453-01-G09 DRVCKLDFLTYNCLNH 80 453-01-F04
HSNCIMDLLTNRCFYD 81 453-01-H03 PFNCFHDPLTGLCLHS 82 453-01-F03
YDSCTYDRLTKQCYPS 83 453-01-F07 FHDCMYDALLGYCLPY 84 453-01-G08
NRSCDPLTRPKSCGL 85 453-01-G04 LSNCDWDDLIRQCLHD 86 453-01-E01
FWDCLFHPNSRYCVLS 87 453-01-E10 SRDCLLSPAMAWCGLD 88
TABLE-US-00034 TABLE 6 TN12/1 Library B lymphocyte
stimulator-binding Sequences Phage Isolate Amino Acid Sequence SEQ
ID NO: 453-01-H05 GGNCYTDSLTKLHFCMGD 89 453-01-H04
--MCPRDPLTKAKLCNWH 90 453-01-G03 PNQCQDDLTKQWYSCHYH 91 453-01-F11
FDMCFDALTKQNFYCRFH 92 453-01-F06 RNMCVDRLTKLQHGCEGA 93 453-01-G07
DPECLTSFDRLTKMCWPW 94 453-01-H11 DDECHYDYLTHYMRCDYR 95 453-01-G05
FGGCNIDLLTNTMMCHRN 96 453-01-G10 HGPCYWDELTMQWHCNHH 97 453-01-H12
GAMCVDLLTYTFRPCMYA 98 453-01-E07 SNKCWDELTHAWAECGRF 99 453-01-E09
RPVCYKGYDILTTQCMPW 100 453-01-G01 PSRCWFDLLFNKFVCKRN 101 453-01-H08
RSGCVYDMLLMTMYCPSN 102 453-01-H10 SNRCEGDQLMRPPSCRHL 103 453-01-F08
YRMCWWDDLLRGFVCDFH 104 453-01-E06 HDGCYDELLYRWTRCEHR 105 453-01-E08
WAWCFDELVQRYFTCFDH 106 453-01-E02 LPECRQYFPWEKQVCSYW 107
TABLE-US-00035 TABLE 7 PhD 12 Library B lymphocyte
stimulator-binding Sequences Phage Isolate Amino Acid Sequence SEQ
ID NO: 453-02-B05 VHYDSLTKMWTR 108 453-02-D09 FTDPLTKMSLHS 109
453-02-C12 GYDVLTKLYFVP 110 453-02-A05 YYDRLTKLYSSM 111 453-02-B06
LXKDPLTKLYIS 112 453-02-A04 GYDVLTKLXFVP 113 453-02-B03
RLYDPLTKLVLS 114 453-02-B01 MFDPLTKIAFPA 115 453-02-D04
FYDSLTKTNLRD 116 453-02-B02 GIYDKLTRAWLP 117 453-02-B08
KYDPLTRARXPL 118 453-02-D06 YIDQLTRLSLPS 119 453-02-A09
HqTFDILTRLHF 120 453-02-B04 WQFDVLTRSWTP 121 453-02-A02
GAAYDHLTRTWL 122 453-02-D05 YFDQLTHLSIKK 123 453-02-A06
AWDPLTMLVLPW 124 453-02-D03 ALWMDPLTGLAF 125 453-02-B12
WQFDVLTXSWTP 126 453-02-A01 WTDPLTHMEIYH 127 453-02-C04
WTDSLTGLWFPD 128 453-02-C05 YTDPLTGIVXPF 129 453-02-D08
YWDKLTMLHLGV 130 453-02-D02 YYDFLTRTVLPS 131 453-02-A03
RLDPLSKNDFPR 132 453-02-A11 LRYDPLLKSXIY 133 453-02-D07
LRYDPLLKSYIY 134 453-02-A07 YFDQFTHLSIKK 135 453-02-C08
YFDQXTHLSIKK 136
TABLE-US-00036 TABLE 8 Substrate Phage Library B lymphocyte
stimulator-binding Sequences Phage Isolate Amino Acid Sequence SEQ
ID NO: 453-02-E04 EHYYTDPLTGARI 137 453-02-F01 EHYXTDPLTGARI 138
453-02-E09 EHYSTDPLTGARI 139 453-02-E07 EHYYTDPLXGXRI 140
453-02-G05 EHYYTDPLXGXRX 141 453-02-G09 EHYYTDPLXGARX 142
453-02-E06 EHXYTDPLNGARX 143 453-02-E05 EHYYNDPLNGARX 144
453-02-F04 XHXYNDPLNGARX 145 453-02-G07 KPYYDPITKMTHH 146
453-02-F06 KPYYDPITKMSHH 147 453-02-E08 KPYYDPISKMTHH 148
453-02-G08 KPXXDPISKMTHH 149 453-02-E01 QIGYDELTKAWVT 150
453-02-G02 QLGYDELTKAWVT 151 453-02-H06 KIDELXMQNIIIW 152
453-02-F08 DHTDPLIQGLTKR 153 453-02-H01 WHDPLKHMHFHHE 154
453-02-F03 KHIDMETGLILQN 155 453-02-G03 MQVDPETGLKYEH 156
453-02-E03 XLDQHVNXXXYQS 157 453-02-F10 EXXXTXXLTGARX 158
453-02-F02 GPYNIXRLXGErX 159 453-02-E02 HIKMLHQGSFVGV 160
453-02-H08 HPTNTXXHQXVYS 161 453-02-H05 HRGQVXXLNGMvX 162 X = amino
acid unknown (all tables) lower case = amino acid identity probable
but not completely characterized
Example 2
Immobilization of B Lymphocyte Stimulator Binding Polypeptides on
Sepharose-4FF Beads
[0618] On the basis of the above results, six display phage
sequences were chosen for further study: TN7-01-A08 (SEQ ID NO:27),
TN8-01-B07 (SEQ ID NO:31), TN10-01-F05 (SEQ ID NO:78), TN12-01-H05
(SEQ ID NO:89), PhD-02-C04 (SEQ ID NO:128), and PhD-02-C12 (SEQ ID
NO:110).
[0619] In order to develop a suitable B lymphocyte stimulator
affinity ligand, the identified display peptides were synthesized
to order by a commercial vendor, with slight modifications:
[0620] Two amino acids of leader were added to each binding peptide
at the N-terminus, in order to avoid leaving a free amine at the
first amino acid of the sequence corresponding to the variegated
region of the phage display template; the N-terminus was acetylated
to prevent immobilization of the peptide to the chromatographic
matrix through that position; a C-terminal linker was added (i.e.,
-PGPEGGGK; SEQ ID NO:13); and any internal lysines in the peptide
were blocked with the group: ivDde (i.e.,
1-(4,4-dimethyl-2,6-dioxocyclohex-1-ylidene)-3-methyl
butyl-L-lysine). This group was intact on the finished synthesized
peptides and was removed after immobilization or fluorescein
labeling. As an alternative modification, peptides with internal
lysines were also synthesized with C-terminal hydrazide functional
groups, which could be immobilized onto activated aldehyde
chromatographic media.
[0621] The peptides were immobilized onto NHS-activated SEPHAROSE-4
Fast Flow agarose media (Pharmaceia) at ligand densities targeted
to 2 .mu.mol/ml. Actual ligand densities of peptides on the media
ranged from 0.76 .mu.mol/ml to 1.98 .mu.mol/ml, as determined by
amino acid analysis of immobilized peptide. All but one peptide was
immobilized in aqueous conditions of 100 mM KH.sub.2PO.sub.4/150 mM
NaCl/0.05% Tween 20, pH 7.5. For solubility reasons, the peptide
DX217 (see, Table 9, below) was immobilized in 30% dimethyl
formamide(DMF)/100 mM KH.sub.2PO.sub.4/150 mM NaCl/0.05% Tween 20.
pH 7.5. Immobilization reactions were allowed to proceed for 2
hours at ambient temperature, followed by brief washing with pH 7.5
buffer. The Fast Flow SEPHAROSE media was then allowed to tumble at
ambient temperature overnight to hydrolyze remaining NHS esters
after which the media was washed to remove any unbound peptide. A
solution of 2% hydrazine/DMF was used to de-block ligands
containing ivDde-lysine. Media was then further washed with aqueous
buffers and stored at 4.degree. C. until packed into columns. Table
9 shows the sequences of the synthesized peptides and their
measured densities on the agarose media.
TABLE-US-00037 TABLE 9 B lymphocyte stimulator Binding Peptides
Synthesizes as Affinity Ligands Peptide Isolate Sequence Name
source (potential disulfide loop underlined) SEQ ID NO: DX212
01-A08 Ac-AGKEPCYFYWECAVSGPGPEGGGK 163 DX214 01-B07
Ac-AGVPFCDLLTKHCFEAGPGPEGGGK 164 DX216 01-F-5
Ac-GSSRLCHMDELTHVCVHFAPPGPEGGGK 165 DX217 01-H05
Ac-GDGGNCYTDSLTKLHFCMGDEPGPEGGGK 166 DX219 02-C12
Ac-GYDVLTKLYFVPGGPGPEGGGK 167 DX221 02-C04
Ac-WTDSLTGLWFPDGGPGPEGGGK 168 Ac denotes N-terminal acetylation
B Lymphocyte Stimulator-Ligand Affinity Determination (Overview of
Procedure)
[0622] Dissociation constants between the synthetic peptides and B
lymphocyte stimulator (free in solution) were measured by
fluorescence anisotropy (FA). In these experiments, the
concentration of the fluorescein-labeled peptide is held constant
and the B lymphocyte stimulator protein concentration was varied.
The observed change in anisotropy is fit to the following equation
via nonlinear regression to obtain the apparent K.sub.D.
Peptide + BLyS K D Peptide BLyS ##EQU00001## r obs = r free + ( r
bound - r free ) ( K D + BLYS + P ) - ( K D + BLYS + P ) 2 - 4 BLYS
P 2 P ##EQU00001.2##
where: r.sub.obs=observed anisotropy, r.sub.free=anisotropy of free
peptide, r.sub.bound=anisotropy of bound peptide,
K.sub.D=dissociation constant, BLyS.TM.=total BLyS.TM.
concentration, and P=total fluorescein labeled peptide
concentration.
[0623] Binding reactions containing 50 nM fluorescein-labeled
peptide and a varied concentration of B lymphocyte stimulator in a
volume between 10 and 20 .mu.L per well were performed in 384 well
microplates. Reactions were assayed using a Tecan Polarion
fluorescence polarization plate reader. Cross-competition studies
between peptides were performed using 50 nM fluorescein-labeled
peptide and 1-2 .mu.M B lymphocyte stimulator in the presence and
absence of 100 .mu.M unlabeled peptide. The influence of pH on the
observed K.sub.D was investigated at pH 6.0 using the primary
binding buffer [15 mM sodium citrate, 120 mM NaCl, 0.01% Tween 20]
and at pH 9.0 using 200 mM sodium bicarbonate, 125 mM sodium
chloride. Other buffers in which dissociation constants of B
lymphocyte stimulator Binding polypeptides were determined include:
[pH 6.0, 0.01% Tween], [pH 6.0, 0.1% gelatin], [pH5.0, 0.01%
Tween], [pH9.0, 0.1% Tween], [pH6.0, 15% ethylene glycol, 0.01%
Tween],], [pH5.0, 15% ethylene glycol, 0.01% Tween], and [pH9.0,
15% ethylene glycol, 0.01% Tween]. All six of the peptides (DX212,
DX214, DX216, DX217, DX219, and DX221) bound B lymphocyte
stimulator in solution with approximately the same affinity
(K.sub.D=0.5-2 .mu.M). Cross-competition studies demonstrated that
all peptides compete with each other for B lymphocyte stimulator
binding, which suggests that they all bind to the same site on B
lymphocyte stimulator.
Example 3
Design of Modified B Lymphocyte Stimulator Binding Peptides
[0624] Once a promising B lymphocyte stimulator binding polypeptide
has been isolated, improvements to that polypeptide can be made by
changing, adding or removing individual or multiple amino acid
residues from the polypeptide. Amino acid substitutions can be
conservative or non conservative. Conservative amino acids
exchanges include, for example, the exchange of aromatic residues
(e.g., phenylalanine, tryptophan, and tyrosine) for one another,
the exchange of hydrophobic residues (e.g, leucine, isoleucine, and
valine) for one another, the exchange of polar residues (e.g.,
glutamine and asparagine) for one another, the exchange of acidic
residues (e.g., arginine, lysine, and histidine) for one another,
and the exchange of small residues (e.g., alanine, serine,
threonine, methionine, and glycine) for one another, the exchange
of aromatic residues for one another. Additionally, nonclassical
amino acids, chemical amino acid analogs, or chemically modified
classical amino acids can be introduced as a substitution or
addition to a B lymphocyte stimulator binding polypeptide of the
invention. Non-classical amino acids include, but are not limited
to, the D-isomers of the common amino acids, 2,4-diaminobutyric
acid (Dbu), 4-aminobutyric acid (bAbu), 2-aminobutyric acid (Abu),
6-amino hexanoic acid (epsilon-Ahx), 2-aminoisobutyric acid (Aib),
3-aminoisobutyric acid (bAib), 3-aminopropanoic acid (bAla),
ornithine (Orn), norleucine (Nle), norvaline (Nva),
3-hydroxyproline (3Hyp), 4-hydroxyproline (4Hyp), sarcosine
(MeGly), citrulline, homocitrulline, cysteic acid, t-butylglycine,
t-butylalanine, phenylglycine, cyclohexylalanine, fluoro-amino
acids, designer amino acids such as .beta.-methyl amino acids,
C.alpha.-methyl amino acids, N.alpha.-methyl amino acids, and amino
acid analogs in general. By way of example, four modified peptides
based on the DX212 sequence have been designed:
TABLE-US-00038 (SEQ ID NO: 169) 1. Ac-AGK(Ac)EPCYFYWECAVSGPGPEGGGK
-- internal lysine side chain acetylated; (SEQ ID NO: 170) 2.
Ac-AGREPCYFYWECAVSGPGPEGGGK -- arginine substitution; (SEQ ID NO:
171) 3. Ac-AGQEPCYFYWECAVSGPGPEGGGK -- glutamine substitution; (SEQ
ID NO: 172) 4. Ac-AGNleEPCYFYWECAVSGPGPEGGGK -- norleucine
substitution. Ac denotes N-terminal acetylation.
Example 4
Biacore Analysis of the Affinity of B Lymphocyte Stimulator Binding
Polypeptides
[0625] Binding of B lymphocyte stimulator binding polypeptides to B
lymphocyte stimulator, for example, can be analyzed by BIAcore
analysis. Either B lymphocyte stimulator (or another antigen for
which one wants to know the affinity of a B lymphocyte stimulator
binding polypeptide) or B lymphocyte stimulator binding polypeptide
can be covalently immobilized to a BIAcore sensor chip (CM5 chip)
via amine groups using
N-ethyl-N'-(dimethylaminopropyl)carbodiimide/N-hydroxysuccinimide
chemistry. Various dilutions of B lymphocyte stimulator binding
polypeptides or B lymphocyte stimulator (or other antigen for which
one wants to know the affinity of a B lymphocyte stimulator binding
polypeptide), respectively are flowed over the derivatized CM5 chip
in flow cells at 15 microliters/min. for a total volume of 50
microliters. The amount of bound protein is determined during
washing of the flow cell with HBS buffer (10 mM HEPES, pH7.4, 150
mM NaCl, 3.4 mM EDTA, 0.005% surfactant P20). Binding specificity
for the protein of interest is determined by competition with
soluble competitor in the presence the protein of interest.
[0626] The flow cell surface can be regenerated by displacing bound
protein by washing with 20 microliters of 10 mM glycine-HCl, pH2.3.
For kinetic analysis, the flow cells are tested at different flow
rates and different polypeptide densities on the CM5 chip. The
on-rates and off-rates can be determined using the kinetic
evaluation program in BIAevaluation 3 software.
Example 5
B Lymphocyte Stimulator Binding Polypeptide Neutralization of
Murine Splenocyte Proliferation
[0627] To determine if an B lymphocyte stimulator binding
polypeptide inhibits B lymphocyte stimulator mediated B cell
proliferation, a splenocyte proliferation assay can be performed
Briefly, murine splenocytes are isolated by flushing spleen with
complete medium using a 25 g needle and 10 ml of complete medium
(RPMI 1640 with 10% FBS containing 100 U/ml penicillin, 100
.mu.g/ml streptomycin, 4 mM glutamine, 5.times.10.sup.-5M
.beta.-mercaptoethanol). The cells are passed through a 100 micron
nylon filter to remove cell clumps. The cell suspension is then
separated by gradient centrifugation at 400.times.g for 25 minutes
at room temperature (one 15 ml conical tube/spleen; 3 ml Ficol, 10
ml cell suspension/spleen; Ficol 1083 from Sigma). The recovered
cells are washed 3 times in complete medium and counted. Recovered
cells are then diluted to a concentration of 3.times.10.sup.6/ml in
complete medium containing a 3.times. concentration of SAC
(3.times.=1:33,333 dilution of stock Staph. aureus Cowan strain;
Calbiochem).
[0628] For each B lymphocyte stimulator binding polypeptide, 50
microliters of dilutions at 30 .mu.g/ml, 3.0 .mu.g/ml, and 0.3
.mu.g/ml concentrations are aliquotted into individual wells of a
96 well plate in triplicate. Suitable positive controls, such as,
for example monoclonal antibody 15C10, can also be used. Medium
containing no B lymphocyte stimulator binding polypeptide is used
as negative control. B lymphocyte stimulator protein is diluted in
complete medium to concentrations of 300 ng/ml, 90 ng/ml and 30
ng/ml. 50 microliters of each of the B lymphocyte stimulator
dilutions were then added to the B lymphocyte stimulator binding
polypeptide dilution series in the plates. The plate containing the
B lymphocyte stimulator binding polypeptide and B lymphocyte
stimulator dilutions are then incubated for 30 minutes at
37.degree. C., 5% CO.sub.2, after which 50 microliters of the
splenocyte cell suspension containing SAC is added to all wells.
The plates are then incubated for 72 hours (37.degree. C., 5%
CO.sub.2).
[0629] After 72 hours, each well is supplemented with 50 .mu.l of
complete medium containing 0.5 .mu.Ci of .sup.3H-thymidine (6.7
Ci/mM; Amersham) and cells are incubated for an additional 20-24
hours at (37.degree. C., 5% CO.sub.2). Following incubation cells
are harvested using a Tomtec Cell Harvester and filters counted in
a TopCount Scintillation counter (Packard).
Example 6
In Vitro Screening of B Lymphocyte Stimulator Antagonists
[0630] The bioassay for assessing the effects of putative B
lymphocyte stimulator antagonists is performed in triplicate in 96
well format by mixing equal volumes of B lymphocyte stimulator,
responder cells, and putative antagonist each of which is prepared
as a 3.times. stock reagent.
[0631] B-lymphocytes are purified from human tonsil by MACS
(anti-CD3 depletion), washed, and resuspended in complete medium
(CM) (RPMI 1640 with 10% FBS containing 100 U/ml penicillin, 100
.mu.g/ml streptomycin, 4 mM glutamine, 5.times.10E-5 M
beta-mercaptoethanol) at a concentration of 3.times.10e6 cells/mL.
Staphylococcus aureus, Cowan I (SAC, CalBiochem) is added to cells
at 3.times. concentration (3.times.=1:33,333 dilution of
stock).
[0632] Meanwhile, eight serial dilutions (3-fold) of potential
antagonists are prepared in CM such that the diluted antagonists
are at 3.times. the final concentrations to be tested in the assay.
B lymphocyte stimulator binding polypeptides are routinely tested
starting at a final concentration of 10 .mu.g/mL and going down to
about 1.5 ng/mL.
[0633] Human rBLyS was prepared in CM to 3.times. concentration
(3.times.=300 ng/mL, 30 ng/mL, and 3 ng/mL) in CM. Potential
inhibitors are routinely tested at several concentrations of B
lymphocyte stimulator to avoid false negatives due to unexpectedly
low affinity or antagonist concentration.
[0634] Fifty microliters of diluted antagonist and 50 .mu.l of
diluted B lymphocyte stimulator are added to the putative
antagonist dilution series. Cells are then incubated for 72 hours
(37.degree. C., 5% CO.sub.2) in a fully humidified chamber. After
72 hrs., the cells are supplemented with 0.5 .mu.Ci/well
3H-thymidine (e.g., 6.7 Ci/mmol) and incubated for an additional 24
hours. Plates are harvested using a Tomtec Cell Harvester and
filters counted in a TopCount Scintillation counter (Packard).
Example 7
Protein Fusions of B Lymphocyte Stimulator Binding Polypeptides
[0635] B lymphocyte stimulator binding polypeptides of the
invention are optionally fused to other proteins. These fusion
proteins can be used for a variety of applications. For example,
fusion of B lymphocyte stimulator binding polypeptides to His-tag,
HA-tag, protein A, IgG domains, and maltose binding protein
facilitates purification. (See, EP A 394 827; Traunecker et al.,
Nature, 331:84-86 (1988)). Similarly, fusion to IgG-1, IgG-3, and
albumin increases the half-life time in vivo. Nuclear localization
signals fused to B lymphocyte stimulator binding polypeptides can
target the protein to a specific subcellular localization, while
covalent heterodimer or homodimers can increase or decrease the
activity of a fusion protein. Fusion proteins can also create
chimeric molecules having more than one function. Finally, fusion
proteins can increase solubility and/or stability of the fused
protein compared to the non-fused protein. All of the types of
fusion proteins described above can be made using techniques known
in the art or by using or routinely modifying the following
protocol, which outlines the fusion of a polypeptide to an IgG
molecule.
[0636] Briefly, the human Fc portion of the IgG molecule can be PCR
amplified, using primers that span the 5' and 3' ends of the
sequence described below (SEQ ID NO:447). These primers also
preferably contain convenient restriction enzyme sites that will
facilitate cloning into an expression vector, preferably a
mammalian expression vector.
[0637] For example, if the pC4 (Accession No. 209646) expression
vector is used, the human Fc portion can be ligated into the BamHI
cloning site. Note that the 3' BamHI site should be destroyed.
Next, the vector containing the human Fc portion is re-restricted
with BamHI, linearizing the vector, and B lymphocyte stimulator
binding polynucleotide is ligated into this BamHI site. Note that
the polynucleotide is cloned without a stop codon, otherwise a
fusion protein will not be produced.
[0638] If the naturally occurring signal sequence is used to
produce the secreted protein, pC4 does not need a second signal
peptide. Alternatively, if the naturally occurring signal sequence
is not used, the vector can be modified to include a heterologous
signal sequence. (See, e.g., WO 96/34891.)
TABLE-US-00039 Human IgG Fc region: (SEQ ID NO: 449)
GGGATCCGGAGCCCAAATCTTCTGACAAAACTCACACATGCCCACCGTGCCCAGCACCTGAATTCGAGGGTGCA-
C
CGTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGACACCCTCATGATCTCCCGGACTCCTGAGGTCACATGCGTG-
G
TGGTGGACGTAAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGGACGGCGTGGAGGTGCATAATGCC-
A
AGACAAAGCCGCGGGAGGAGCAGTACAACAGCACGTACCGTGTGGTCAGCGTCCTCACCGTCCTGCACCAGGAC-
T
GGCTGAATGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGCCCTCCCAACCCCCATCGAGAAAACCATCTCC-
A
AAGCCAAAGGGCAGCCCCGAGAACCACAGGTGTACACCCTGCCCCCATCCCGGGATGAGCTGACCAAGAACCAG-
G
TCAGCCTGACCTGCCTGGTCAAAGGCTTCTATCCAAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCG-
G
AGAACAACTACAAGACCACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTACAGCAAGCTCACCGTG-
G
ACAAGAGCAGGTGGCAGCAGGGGAACGTCTTCTCATGCTCCGTGATGCATGAGGCTCTGCACAACCACTACACG-
C AGAAGAGCCTCTCCCTGTCTCCGGGTAAATGAGTGCGACGGCCGCGACTCTAGAGGAT
Example 8
Isolation of scFV Molecules Recognizing B Lymphocyte Stimulator
Binding Polypeptides
[0639] Naturally occurring V-genes isolated from human PBLs are
constructed into a large library of antibody fragments which
contain reactivities against polypeptides of the present invention
to which the donor may or may not have been exposed (see, e.g.,
U.S. Pat. No. 5,885,793, incorporated herein by reference in its
entirety).
Rescue of the Library
[0640] A library of scFvs is constructed from the RNA of human PBLs
as described in WO 92/01047. To rescue phage displaying antibody
fragments, approximately 10.sup.9 E. coli harbouring the phagemid
are used to inoculate 50 ml of 2.times.TY containing 1% glucose and
100 .mu.g/ml of ampicillin (2.times.TY-AMP-GLU) and grown to an
O.D. of 0.8 with shaking Five ml of this culture is used to
innoculate 50 ml of 2.times.TY-AMP-GLU, 2.times.10.sup.8 TU of
.DELTA. gene 3 helper phage (M13 .DELTA. gene III, see WO 92/01047)
are added and the culture incubated at 37.degree. C. for 45 minutes
without shaking and then at 37.degree. C. for 45 minutes with
shaking. The culture is centrifuged at 4000 r.p.m. for 10 minutes
and the pellet resuspended in 2 liters of 2.times.TY containing 100
ug/ml ampicillin and 50 ug/ml kanamycin and grown overnight. Phage
are prepared as described in WO92/01047.
[0641] M13 .DELTA. gene III is prepared as follows: M13 .DELTA.
gene III helper phage does not encode gene III protein, hence the
phage(mid) displaying antibody fragments have a greater avidity of
binding to antigen. Infectious M13 .DELTA. gene III particles are
made by growing the helper phage in cells harboring a pUC19
derivative supplying the wild type gene III protein during phage
morphogenesis. The culture is incubated for 1 hour at 37.degree. C.
without shaking and then for a further hour at 37.degree. C. with
shaking Cells are pelleted (IEC-Centra 8, 4000 revs/min. for 10
min.), resuspended in 300 ml 2.times.TY broth containing 100 .mu.g
ampicillin/ml and 25 .mu.g kanamycin/ml (2.times.TY-AMP-KAN) and
grown overnight, shaking at 37.degree. C. Phage particles are
purified and concentrated from the culture medium by two
PEG-precipitations (Sambrook et al., 1990), resuspended in 2 ml PBS
and passed through a 0.45 .mu.m filter (Minisart NML; Sartorius) to
give a final concentration of approximately 1013 transducing
units/ml (ampicillin-resistant clones).
Panning of the Library
[0642] Immunotubes (Nunc) are coated overnight in PBS with 4 ml of
either 100 mg/ml or 10 mg/ml of a polypeptide of the present
invention. Tubes are blocked with 2% Marvel-PBS for 2 hours at
37.degree. C. and then washed 3 times in PBS. Approximately 1013 TU
of phage are applied to the tube and incubated for 30 minutes at
room temperature tumbling on an over and under turntable and then
left to stand for another 1.5 hours. Tubes are washed 10 times with
PBS 0.1% Tween-20 and 10 times with PBS. Phage are eluted by adding
1 ml of 100 mM triethylamine and rotating 15 minutes on an under
and over turntable after which the solution is immediately
neutralized with 0.5 ml of 1.0M Tris-HCl, pH 7.4. Phage are then
used to infect 10 ml of mid-log E. coli TG1 by incubating eluted
phage with bacteria for 30 minutes at 37.degree. C. The E. coli are
then plated on TYE plates containing 1% glucose and 100 .mu.g/ml
ampicillin. The resulting bacterial library is then rescued with
.DELTA. gene III helper phage as described above to prepare phage
for a subsequent round of selection. This process is then repeated
for a total of 4 rounds of affinity purification with tube-washing
increased to 20 times with PBS, 0.1% Tween-20 and 20 times with PBS
for rounds 3 and 4.
Characterization of Binders
[0643] Eluted phage from the 3rd and 4th rounds of selection are
used to infect E. coli HB 2151 and soluble scFv is produced (Marks
et al., 1991) from single colonies for assay. ELISAs are performed
with microtitre plates coated with either 10 pg/ml of the
polypeptide of the present invention in 50 mM bicarbonate, pH 9.6.
Clones positive in ELISA are further characterized by PCR
fingerprinting (see, e.g., WO 92/01047) and then by sequencing.
[0644] Additionally, scFvs may be converted to complete Ig
molecules using techniques which are commonly known in the art.
Example 9
Production of an Anti-B Lymphocyte Stimulator Binding Polypeptide
Antibody
[0645] The antibodies of the present invention can be prepared by a
variety of methods. (See, Current Protocols, Chapter 2.) As one
example of such methods, cells expressing B lymphocyte stimulator
binding polypeptides are administered to an animal to induce the
production of sera containing polyclonal antibodies. In a preferred
method, a preparation of B lymphocyte stimulator binding
polypeptide is prepared and purified to render it substantially
free of natural contaminants which is then conjugated to a carrier
molecule such as keyhole limpet hemocyanin (KLH), succinylated KLH,
or chicken gamma globulin (CGG). Such a preparation is then
introduced into an animal in order to produce polyclonal antisera
of greater specific activity.
[0646] In the most preferred method, the antibodies of the present
invention are monoclonal antibodies (or B lymphocyte stimulator
protein binding fragments thereof). Such monoclonal antibodies can
be prepared using hybridoma technology. (Kohler et al., Nature,
256:495 (1975); Kohler et al., Eur. J. Immunol., 6:511 (1976);
Kohler et al., Eur. J. Immunol., 6:292 (1976); Hammerling et al.,
in Monoclonal Antibodies and T-Cell Hybridomas (Elsevier, N.Y.
1981), pp. 563-681.) In general, such procedures involve immunizing
an animal (preferably a mouse) with B lymphocyte stimulator binding
polypeptide or, more preferably, with a secreted B lymphocyte
stimulator binding polypeptide-expressing cell. Such cells may be
cultured in any suitable tissue culture medium; however, it is
preferable to culture cells in Earle's modified Eagle's medium
supplemented with 10% fetal bovine serum (inactivated at about
56.degree. C.), and supplemented with about 10 g/l of nonessential
amino acids, about 1,000 U/ml of penicillin, and about 100 .mu.g/ml
of streptomycin.
[0647] The splenocytes of such mice are extracted and fused with a
suitable myeloma cell line. Any suitable myeloma cell line may be
employed in accordance with the present invention; however, it is
preferable to employ the parent myeloma cell line (SP2/0),
available from the ATCC. After fusion, the resulting hybridoma
cells are selectively maintained in HAT medium, and then cloned by
limiting dilution as described by Wands et al. (Gastroenterology,
80:225-232 (1981).) The hybridoma cells obtained through such a
selection are then assayed to identify clones which secrete
antibodies capable of binding the B lymphocyte stimulator binding
polypeptide.
[0648] Alternatively, additional antibodies capable of binding to B
lymphocyte stimulator binding polypeptide can be produced in a
two-step procedure using anti-idiotypic antibodies. Such a method
makes use of the fact that antibodies are themselves antigens, and
therefore, it is possible to obtain an antibody which binds to a
second antibody. In accordance with this method, protein specific
antibodies are used to immunize an animal, preferably a mouse. The
splenocytes of such an animal are then used to produce hybridoma
cells, and the hybridoma cells are screened to identify clones
which produce an antibody whose ability to bind to the B lymphocyte
stimulator binding polypeptide-specific antibody can be blocked by
B lymphocyte stimulator binding polypeptide. Such antibodies
comprise anti-idiotypic antibodies to the B lymphocyte stimulator
binding protein-specific antibody and can be used to immunize an
animal to induce formation of further B lymphocyte stimulator
binding polypeptide-specific antibodies.
[0649] It will be appreciated that Fab and F(ab').sub.2 and other
fragments of the antibodies of the present invention may be used
according to the methods disclosed herein. Such fragments are
typically produced by proteolytic cleavage, using enzymes such as
papain (to produce Fab fragments) or pepsin (to produce
F(ab').sub.2 fragments). Alternatively, secreted B lymphocyte
stimulator binding protein-binding fragments can be produced
through the application of recombinant DNA technology or through
synthetic chemistry.
[0650] For in vivo use of antibodies in humans, it may be
preferable to use "humanized" chimeric monoclonal antibodies. Such
antibodies can be produced using genetic constructs derived from
hybridoma cells producing the monoclonal antibodies described
above. Methods for producing chimeric antibodies are known in the
art. (See, for review, Morrison, Science, 229:1202 (1985); Oi et
al., BioTechniques, 4:214 (1986); Cabilly et al., U.S. Pat. No.
4,816,567; Taniguchi et al., EP 171 496; Morrison et al., EP 173
494; Neuberger et al., WO 86/01533; Robinson et al., WO 87/02671;
Boulianne et al., Nature, 312:643 (1984); Neuberger et al., Nature,
314:268 (1985).)
Example 10
B Lymphocyte Stimulator-Induced Signalling in B Cells
[0651] Total RNA was prepared from tonsillar B cells unstimulated
or stimulated with SAC or SAC plus B lymphocyte stimulator (100
ng/mL) for 12 hours. Messenger RNA levels of ERK-1 and PLK was
determined by real time quantitative PCR using ABI 7700 Taqman
sequence detector. Amplification primers and probes were designed
to span the region from nucleotides 252-332 of the human PLK
sequence and nucleotides 373 to 446 of the human ERK-1 mRNA
(GenBank accession numbers X75932 and X60188, respectively). For
quantitation of RNA, the comparative delta CT method was used
(Perkin-Elmer user Bulletin #2 and #4, 1997) using an 18S ribosomal
RNA probe as endogenous reference. Expression levels were
characterized relative to observed levels in unstimulated
B-cells.
Example 11
Affinity Maturation of B Lymphocyte Stimulator Binding
Polypeptides
[0652] In order to identify high affinity B lymphocyte
stimulator-binding polypeptides, a B lymphocyte stimulator Affinity
Maturation Library (BAML) was designed around a 14-mer linear
peptide template sequence having fixed amino acid residues at 5 of
the 14 positions. 3 of the 5 fixed residues corresponded to a
highly conserved D.times.LT tetrapeptide amino acid motif (SEQ ID
NO:446) isolated from both the constrained and linear peptide
libraries. The design of the 14-mer allowed for some amino acid
variation at each of the remaining 9 positions, however, preference
was given for a particular amino acid at each of these positions.
Analysis of binding affinity of the newly isolated peptides for B
lymphocyte stimulator was evaluated by direct and indirect phage
ELISA and fluorescence anisotropy.
[0653] BAML was designed on a 14-mer linear (non-constrained)
template peptide sequence having fixed residues at positions 1
(Ala), 5 (Asp), 7 (Leu), 8 (Thr), and 10 (Leu). The amino acid
sequence of positions 3-14 in the BAML template most closely
resembles a binding polypeptide isolated from the PhD 12 linear
polypeptide library (see Table 7, supra). Residues at position 1
(fixed Ala) and position 2 (variable) were included to extend the
length and presentation of the B lymphocyte stimulator-binding
sequence. Positions 5-8 correspond to the D.times.LT motif found in
peptide isolates from both the constrained and linear peptide
libraries (see Tables 1-8, supra). Since hydrophobic amino acids
(L, M, I, A, and G) were found at position 10 in 85% of the
original isolates, a Leu residue, occurring in 42% of the isolates,
was fixed at that position in the BAML template peptide.
[0654] Table 10 shows the design of the 14-mer BAML template
sequence.
TABLE-US-00040 TABLE 10 BAML template sequence (14-mer) SEQ ID
amino acid position NO: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 184 A n w
y D s L T k L w l p d
[0655] Referring to Table 10, the upper case letters indicate the
fixed residues at positions 1, 5, 7, 8, and 10 of the template.
Lower case letters designate preferred amino acids at those
positions, however the design of the variegated DNA template
encoding the 14-mer allows for some sequence variation at these
positions.
[0656] Table 11 shows the design of the variegated DNA template
used to generate the BAML peptides.
TABLE-US-00041 TABLE 11 BAML DNA template sequence (14-mer) codon
position 1 2 3 4 5 6 7 8 9 10 11 12 13 14 codons* GCT eez zij zez
GAT zqz CTT ACT eej CTC zjj qzz qqz jez *The sequence of codons is
SEQ ID NO: 185.
[0657] Referring to Table 11, the nucleotide coding sequences for
the fixed amino acids in the BAML 14-mer template are shown in
upper case letters. The letters "e", "j", "q", and "z" in the
variegated DNA template each represent a particular mixture of
nucleoside bases present in the input dNTPs for each position:
[0658] j=79% guanine, 7% cytosine, 7% adenine, 7% thymine
[0659] q=7% guanine, 79% cytosine, 7% adenine, 7% thymine
[0660] e=7% guanine, 7% cytosine, 79% adenine, 7% thymine
[0661] z=7% guanine, 7% cytosine, 7% adenine, 79% thymine.
The codons of the DNA template were designed to skew the encoded
variable amino acid toward the preferred amino acid at each
position shown in SEQ ID NO:184 (Table 10, lower case). Later
sequencing of phage isolates showed that, at any particular
position, preferred residues occurred at a frequency of from 44% to
70%.
[0662] Synthetic DNA sequences fitting the DNA template were
amplified by large scale PCR. The amplified DNAs were restriction
digested for insertion into a M13 phage expression vector (MANP
vector, Dyax Corp., Cambridge, Mass.), and vectors bearing the
inserts were used to transform M13 phage by electroporation, to
produce the BAML. Recombinant phage were collected and purified by
PEG precipitation and titered. A total of 3.2.times.10.sup.13 PFU
were amplified in BAML from 1.6.times.10.sup.9 transformants.
Screening BAML
[0663] As outlined in Table 12 below, a two-step competition
method, starting with the original BAML library, was used over 4
rounds of screening to isolate the highest affinity B lymphocyte
stimulator-binding polypeptides from the BAML. Prior to screening,
the amplified BAML was contacted with Seradyn streptavidin-coated
magnetic beads (MG-SA, Seradyn, Indianapolis, Ind.), to remove
bead- and streptavidin-binding phage.
[0664] For screening BAML, phage were incubated in solution with
biotinylated B lymphocyte stimulator (b-B lymphocyte stimulator) in
200 .mu.l PBS, pH 7.4, Tween-20 (0.1%), to form phage/b-B
lymphocyte stimulator binding complexes. For the first competition
step, unlabeled B lymphocyte stimulator (1-2 .mu.M) was added to
the phage/b-B lymphocyte stimulator binding complex mixture in
solution and incubated for 1-20 hrs. (See Table 12.) The phage/b-B
lymphocyte stimulator complexes remaining in solution after
incubation with unlabeled B lymphocyte stimulator were captured by
brief (10 min. on rotator) incubation with MG-SA streptavidin beads
(50 .mu.l). After capture of the phage/b-B lymphocyte stimulator
complexes on streptavidin beads, the unbound fraction was removed
and beads were washed 15-20 times with 1 ml PBS-Tween 20 prior to
the second competition step. The phage/unlabeled B lymphocyte
stimulator complexes from the round 1 competition step only, were
collected and used as a fraction of the input phage for the second
round of screening along with the bead-captured phage/b-B
lymphocyte stimulator complexes, however, in each subsequent round
of screening only the bead-associated phage were collected after
the first competition step for further screening, and the
phage/unlabeled B lymphocyte stimulator complexes were
discarded.
[0665] For the second competition step, the competitor peptide was
a polypeptide (DX221; SEQ ID NO:168) based on a B lymphocyte
stimulator-binding polypeptide isolated from the PhD 12 library in
the initial screenings described above. The phage/b-B lymphocyte
stimulator complexes bound to streptavidin, collected after the
first competition incubation step, were serially diluted with 50
.mu.M DX221 B lymphocyte stimulator-binding peptide (K.sub.D=3
.mu.M) in 300 .mu.l PBS-Tween-20 (0.1%). A series of short
incubations (3-4 per round, for 1 hour) of the phage/b-B lymphocyte
stimulator complexes with DX221 followed by a final incubation of
from overnight (O/N, for rounds 1, 2, and 4) to 3 days (for round
3). (See Table 12.) The second competition step in round 4 included
an incubation with 67 nM B lymphocyte stimulator for 1 hour prior
to incubation with DX221. The streptavidin bead-associated
phage/b-B lymphocyte stimulator binding complexes remaining after
the DX221 competition step in round 4 were collected for further
analysis.
TABLE-US-00042 TABLE 12 B lymphocyte stimulator affinity maturation
library (BAML) screening conditions First Second Competition
Competition Screening Input Incubation Competitor Incubation
Peptide Round phage.sup.1 b-BLyS .TM..sup.2 Time (hrs) (BLyS .TM.)
Time (hrs) Elutions 1 1.5 .times. 10.sup.11 100 nM 2 2 .mu.M 1 50
.mu.M DX221, 4 .times. 1 hr, then O/N 2 .sup. 2 .times. 10.sup.10
100 nM 1 1 .mu.M 20 50 .mu.M DX221, 3 .times. 1 hr, then O/N 3 6.5
.times. 10.sup.10 100 pM 16 1 .mu.M 3 50 .mu.M DX221, 4 .times. 1
hr, then 3 days 4 6.0 .times. 10.sup.10 10 pM 16 1 .mu.M 2 67 nM
BLyS .TM., 1 hr; 50 .mu.M DX221 + 67 nM BLyS .TM. 3 .times. 1 hr,
O/N, then add'l 4 hrs .sup.1Input phage for round 1 was original
BAML; for round 2 was amplified output phage from overnight (final)
peptide elution and bead-associated phage from round 1; for round 3
was amplified bead-associated output phage from round 2; and for
round 4 was amplified bead-associated output phage from round 3.
All amplified phage samples were pre-cleared on streptavidin beads
before incubation with biotin-B lymphocyte stimulator in solution.
.sup.2b-BLyS .TM. = biotinylated B lymphocyte stimulator
ELISA Analysis
[0666] Approximately four hundred BAML isolates from rounds 2, 3
and 4 of the above screening were analyzed by direct and indirect
phage ELISA assays.
[0667] For indirect phage ELISA, Immulon-2HB plates (Dynex
Technologies, Inc., Chantilly, Va.) were coated with 100 .mu.l of 1
.mu.g/ml Immunopure streptavidin (Pierce, Rockford, Ill.) diluted
in PBS. 100 .mu.l of a series of 10-fold dilutions of b-B
lymphocyte stimulator (0-0.1 .mu.g/ml in PBS) were immobilized in
the streptavidin-coated wells (1 hr, 37.degree. C.). After washing,
1-25 .mu.l of overnight culture of E. coli infected with the
individual phage plaques were added to the appropriate wells and
incubated for 1 hour, followed by 10 washes with PBS-Tween-20.
Anti-M13 antibody conjugated to horseradish peroxidase (1:10,000 in
PBS-Tween-20) was added to the wells (30 min., room temperature),
the color reagent TMB was used and the plates read at OD 630
nm.
[0668] Individual phage isolates binding to immobilized B
lymphocyte stimulator were sequenced and the sequences analyzed.
The unique sequences of the BAML B lymphocyte stimulator-binding
14-mer display peptides are shown in Table 13.
[0669] Analysis of the peptides reveals a significant sequence
"collapse" around one motif: W.sub.3YDPLTKLWL.sub.12 (SEQ ID
NO:436) (subscripts indicate amino acid position in the 14-mer
display peptide sequence). This most numerous core motif includes
the four fixed residues from the original BAML template, i.e., Asp
(D) at position 5, Leu (L) at position 7, Thr (T) at position 8,
and Leu (L) at position 10. In addition, 5 of the 6 preferred
residues from the original BAML template sequence were included in
this motif (see Table 10).
[0670] 73% (143 of 197) of the round 4 isolates included this core
motif (SEQ ID NO:436). Single residue substitutions within the
10-mer core motif centered on positions 4 (Y.fwdarw.F) and 12
(L.fwdarw.F, I, or V), with the substitutions at position 12 being
alternative hydrophobic residues for Leu.
[0671] For the three remaining variable positions (i.e., 2, 13, and
14), selection was not as stringent, although some preferences were
apparent, being either built into the library or persisting through
rounds of selection. For example, in round 4 isolates, 51% included
Asn at position 2; 77% included Pro at position 13; and 32%
included Asp at position 14. The presence of Val (27%) or Glu (19%)
at position 14 was among the most highly selected in the round 4
isolates, in comparison to their theoretical proportion (4% each)
at position 14 in BAML.
[0672] The sequences in Table 13 are grouped according to their
degree of difference from the core sequence (SEQ ID NO:436).
TABLE-US-00043 TABLE 13 Sequences of BAML Phage Isolates (from
Rounds 2, 3, 4) 14-mer amino acid position 1 2 3 4 5 6 7 8 9 10 11
12 13 14 SEQ ID NO: A n w y D s L T k L w l p d consensus; 184 A N
W Y D P L T K L W L P D 186 A N W Y D P L T K L W L P E 187 A N W Y
D P L T K L W L P G 188 A N W Y D P L T K L W L P V 189 A N W Y D P
L T K L W L S D 190 A N W Y D P L T K L W L N D 191 A N W Y D P L T
K L W L P T 192 A N W Y D P L T K L W L P A 193 A N W Y D P L T K L
W L P N 194 A N W Y D P L T K L W L V D 195 A N W Y D P L T K L W L
H D 196 A N W Y D P L T K L W L T D 197 A N W Y D P L T K L W L P H
198 A N W Y D P L T K L W L T V 199 A N W Y D P L T K L W L L D 200
A N W Y D P L T K L W L L E 201 A N W Y D P L T K L W L H E 202 A N
W Y D P L T K L W L P R 203 A N W Y D P L T K L W L A D 204 A N W Y
D P L T K L W L P Y 205 A N W Y D P L T K L W L P I 206 A N W Y D P
L T K L W L I D 207 A N W Y D P L T K L W L R D 208 A Y W Y D P L T
K L W L P D 209 A Y W Y D P L T K L W L L E 210 A Y W Y D P L T K L
W L R V 211 A Y W Y D P L T K L W L P E 212 A Y W Y D P L T K L W L
P V 213 A Y W Y D P L T K L W L H Q 214 A Y W Y D P L T K L W L P A
215 A Y W Y D P L T K L W L R V 216 A Y W Y D P L T K L W L P G 217
A Y W Y D P L T K L W L R Y 218 A Y W Y D P L T K L W L P Y 219 A Y
W Y D P L T K L W L L Y 220 A Y W Y D P L T K L W L R D 221 A Y W Y
D P L T K L W L P V 222 A Y W Y D P L T K L W L L G 223 A Y W Y D P
L T K L W L T H 224 A Y W Y D P L T K L W L P T 225 A Y W Y D P L T
K L W L L V 226 A Y W Y D P L T K L W L Y Y 227 A Y W Y D P L T K L
W L S D 228 A S W Y D P L T K L W L P A 229 A S W Y D P L T K L W L
H D 230 A S W Y D P L T K L W L P G 231 A S W Y D P L T K L W L P Q
232 A S W Y D P L T K L W L P Y 233 A S W Y D P L T K L W L P H 234
A S W Y D P L T K L W L P V 235 A S W Y D P L T K L W L P I 236 A S
W Y D P L T K L W L P E 237 A F W Y D P L T K L W L R V 238 A F W Y
D P L T K L W L P E 239 A F W Y D P L T K L W L L E 240 A F W Y D P
L T K L W L P V 241 A I W Y D P L T K L W L P E 242 A I W Y D P L T
K L W L P D 243 A I W Y D P L T K L W L H D 244 A I W Y D P L T K L
W L T D 245 A I W Y D P L T K L W L P F 246 A I W Y D P L T K L W L
L D 247 A I W Y D P L T K L W L P R 248 A I W Y D P L T K L W L P A
249 A I W Y D P L T K L W L T A 250 A I W Y D P L T K L W L A V 251
A I W Y D P L T K L W L P G 252 A I W Y D P L T K L W L R V 253 A I
W Y D P L T K L W L P H 254 A I W Y D P L T K L W L R E 255 A I W Y
D P L T K L W L S D 256 A T W Y D P L T K L W L P A 257 A T W Y D P
L T K L W L A D 258 A T W Y D P L T K L W L T S 259 A T W Y D P L T
K L W L P G 260 A T W Y D P L T K L W L P Y 261 A T W Y D P L T K L
W L S G 262 A T W Y D P L T K L W L P V 263 A T W Y D P L T K L W L
P D 264 A D W Y D P L T K L W L P V 265 A D W Y D P L T K L W L P K
266 A D W Y D P L T K L W L P D 267 A D W Y D P L T K L W L P E 268
A D W Y D P L T K L W L H Q 269 A E W Y D P L T K L W L R D 270 A E
W Y D P L T K L W L P D 271 A E W Y D P L T K L W L P Y 272 A L W Y
D P L T K L W L P A 273 A L W Y D P L T K L W L P D 274 A L W Y D P
L T K L W L R G 275 A L W Y D P L T K L W L L G 276 A M W Y D P L T
K L W L P A 277 A M W Y D P L T K L W L Q V 278 A M W Y D P L T K L
W L L G 279 A A W Y D P L T K L W L P D 280 A A W Y D P L T K L W L
A D 281 A A W Y D P L T K L W L L D 282 A H W Y D P L T K L W L T D
283 A H W Y D P L T K L W L P V 284 A H W Y D P L T K L W L H D 285
A H W Y D P L T K L W L P D 286 A P W Y D P L T K L W L H D 287 A P
W Y D P L T K L W L P V 288 A Q W Y D P L T K L W L P E 289 A Q W Y
D P L T K L W L P Y 290 A Q W Y D P L T K L W L P R 291 A K W Y D P
L T K L W L P D 292 A K W Y D P L T K L W L P V 293 A K W Y D P L T
K L W L P V 294 A K W Y D P L T K L W L N G 295 A W W Y D P L T K L
W L P A 296 A V W Y D P L T K L W L T D 297 A N W Y D P L T K L W L
P D 186 A Y E Y D P L T K L W L L Y 298 A T K Y D P L T K L W L P D
299 A T L Y D P L T K L W L P G 300 A I R Y D P L T K L W L P Y 301
A E R Y D P L T K L W L P H 302 A D R Y D P L T K L W L P Q 303 A N
S Y D P L T K L W L P E 304 A I L Y D P L T K L W L P D 305
A N W Y D P L T K L W L P D 186 A N W F D P L T K L W L P Q 306 A N
W F D P L T K L W L P V 307 A N W F D P L T K L W L T D 308 A N W F
D P L T K L W L P D 309 A N W F D P L T K L W L P G 310 A N W F D P
L T K L W L P E 311 A N W F D P L T K L W L P A 312 A N W F D P L T
K L W L P N 313 A N W F D P L T K L W L S E 314 A N W F D P L T K L
W L H D 315 A N W F D P L T K L W L V D 316 A Y W F D P L T K L W L
P D 317 A Y W F D P L T K L W L P V 318 A Y W F D P L T K L W L P A
319 A Q W F D P L T K L W L P D 320 A H W F D P L T K L W L P D 321
A T W F D P L T K L W L P V 322 A N W Y D P L T K L W L P D 186 A Y
W Y D S L T K L W L P V 323 A Y W Y D S L T K L W L H D 324 A N W Y
D S L T K L W I P D 325 A N W Y D S L T K L W L P V 326 A N W Y D S
L T K L W L P D 327 A N W Y D S L T K L W L A D 328 A N W Y D S L T
K L W L P A 329 A N W Y D S L T K L W L Y E 330 A N W Y D P L T K L
W L P D 186 A G W Y D S L T K L W L P D 331 A V W Y D S L T K L W L
T D 332 A N W Y D A L T K L W L P V 333 A Y W Y D T L T K L W L P N
334 A N W Y D P L T K L W L P D 186 A F W Y D P L T N L W L L E 335
A Y W Y D P L T G L W L L V 336 A Y W Y D P L T G L W L L Y 337 A Y
W Y D P L T G L W L R V 338 A Y W Y D P L T E L W L R L 339 A N W Y
D P L T K L W L P D 186 A M W Y D P L T K L S L P D 340 A Y W Y D P
L T K L S L L V 341 A I W Y D P L T K L S L T V 342 A I W Y D P L T
K L S L L V 343 A D W Y D P L T K L S L L L 344 A Y W Y D P L T K L
R L L E 345 A D W Y D P L T K L R L L V 346 A D W Y D P L T K L R L
I V 347 A I W Y D P L T K L Y L P D 348 A I W Y D P L T K L G L L V
349 A N W Y D P L T K L T L L V 350 A N W Y D P L T K L L L P N 351
A N W Y D P L T K L W L P D 186 A S W Y D P L T K L W F P D 352 A N
W Y D P L T K L W F P D 353 A N W Y D P L T K L W F S D 354 A S W Y
D P L T K L W F P V 355 A D W Y D P L T K L W F P V 356 A S W Y D P
L T K L W F P K 357 A K W Y D P L T K L W F P D 358 A S W Y D P L T
K L W F L E 359 A N W Y D P L T K L W F P A 360 A T W Y D P L T K L
W F P D 361 A I W Y D P L T K L W F P E 362 A I W Y D P L T K L W F
P D 363 A I W Y D P L T K L W F P G 364 A Y W Y D P L T K L W F P H
365 A N W Y D P L T K L W F P V 366 A Y W Y D P L T K L W F P D 367
A G W Y D P L T K L W F P D 368 A I W Y D P L T K L W F P T 369 A K
W Y D P L T K L W F P A 370 A Y W Y D P L T K L W F F D 371 A N W Y
D P L T K L W F A D 372 A N W Y D P L T K L W L P D 186 A N W Y D P
L T K L W F P Y 373 A D W Y D P L T K L W F R D 374 A N W Y D P L T
K L W V P D 375 A D W Y D P L T K L W V P A 376 A N W Y D P L T K L
W V P N 377 A N W Y D P L T K L W V P E 378 A N W Y D P L T K L W V
P Q 379 A E W Y D P L T K L W V P K 380 A Q W Y D P L T K L W V P V
381 A N W Y D P L T K L W V P Y 382 A L W Y D P L T K L W V P Y 383
A N W Y D P L T K L W V P G 384 A S W Y D P L T K L W I P Y 385 A D
W Y D P L T K L W I P G 386 A N W Y D P L T K L W I P Y 387 A K W Y
D P L T K L W I P Y 388 A I W Y D P L T K L W I P N 389 A T W Y D P
L T K L W I P Q 390 A N W Y D P L T K L W L P D 186 A S W Y D P L T
N L W V P D 391 A Y E Y D P L T N L W L L Y 392 A Y W Y D P L T N L
S L L V 393 A Y W Y D P L T K L S I L E 394 A N W Y D S L T K L W I
P Y 395 A H W F D P L T Q L K I R V 396 A Y W C D P L T K L C I L E
397 A N S Y D P L T K L W F P Y 398 A N L Y D P L T K L W V P Y 399
A N W Y D A L T K L W L H D 400 A N W Y D S L T K L W F P D 401 A T
S Y D S L T K L W L P A 402 A C W Y D S L T K L C H R E 403 A I G N
D P L T K L W I P Y 404 A N W Q D C L T K L C L A G 405 A Y W F D P
L T N L W L L E 406 A Y W Y D P L T N L S L L V 407 A N C F D S L T
R L W L C D 408 A C A Y D A L T K L C L P A 409 A N W Y D P L T N L
S L L L 410 A Y W Y D P L T Q L S L L V 411 A Y R Y D A L T G L W L
L Y 412 A Y W N D P L T K L K L R L 413 A Y W Y D P L T Q L S L L V
414 A Y R Y D A L T G L W L L Y 415 A Y R Y D S L T N L W L L Y 416
A Y W Y D P L T K L S I L E 417 A S C Y D P L T K L C F P V 418 A F
W F D P L T G L W L L E 419 A N W Y D P L T K L W L P D 186 A H W Y
D P L T K L S I R V 420 A P W Y D S L T K L W F P S 421
A N C Y D T L T K L W L T C 422 A N W Y D S L T K L S L P D 423 A Y
A Y D F L T Q L S L P D 424 A F R Y D S L T G L W L R Y 425 A N C Y
D S L T K L W L P C 426 A N G Y D L L T N L S V S D 427 A N W Y D P
L T R L W I P V 428 A L K F D Y L T K L W L P D 429 A Y R Y D S L T
K L W L P G 430 A Y C Y D S L T K L W I P D 431 A S W E D S L T K L
W L S K 432 A Y W Y D S L T G L S L L V 433 A Y W Y D P L T Y L R L
R V 434 A K C Y D S L T N L W L C D 435
[0673] Nearly all of the ELISA signals of the BAML isolates were
higher than those isolated in the initial screen (see Example 1).
For comparison, peptide 453-01-B07 (SEQ ID NO:31) (K.sub.D=700 nM)
was used as a reference (positive control). Negative control MAEX
(M13 phage with no insert) did not bind b-B lymphocyte stimulator
at any concentration tested.
[0674] For direct phage ELISA, the signal measured is a reflection
of the ability of a set number of phage to bind to various
concentrations of b-B lymphocyte stimulator. Peptides tested by the
direct phage ELISA assay were chosen based on high affinity for B
lymphocyte stimulator as determined in the indirect phage ELISA
assay. For this assay, Immulon-2HB plates were coated with 0 or
1000 ng anti-Fd antibody (Sigma, St. Louis, Mo.). After washing
(PBS-Tween-20), phage dilutions were added to saturate the
available antibody and incubated for 1 hour, washed, then incubated
with 100 .mu.l of 10-fold dilutions of b-B lymphocyte stimulator
(0-1 .mu.g/ml) for 1 hour at room temperature. Streptavidin-HRP
(1:1000 in PBS-tween-20; Endogen, Woburn, Mass.) was added to the
wells and incubated for 1 hour, developed using TMB and reading at
OD 630 nm.
Determination of BAML Peptide KD by Fluorescence Anisotropy
[0675] Several peptides containing the 10-mer core structural motif
or single-position variants of that motif identified by sequence
analysis were synthesized with a short Gly-Gly-Lys linker sequence
and the C-terminal lysine was labeled with fluorescein. These
peptides, shown in Table 14, below, were synthesized by solid phase
synthesis for determination of dissociation constant with respect
to B lymphocyte stimulator. The DX815 and DX876 polypeptides were
derived from DX814 (SEQ ID NO:186) by deletion of two N-terminal
amino acids or the two amino acids N-terminal and C-terminal to the
core peptide at (positions 3-12). DX816, DX817, DX819, and DX822
correspond to other BAML isolates (SEQ ID NOs:189, 309, 353, 327,
respectively). DX818 corresponds to isolate SEQ ID NO:340, except
that Asn has been substituted for Met at position 2. The K.sub.D of
several B lymphocyte stimulator binding BAML peptides was
determined by fluorescence anisotropy, performed as previously
described. The sequence of DX822 without the -GGK linker (see SEQ
ID NO:327) matches the BAML template sequence (see Table 10). The
BAML consensus sequence found in DX822 resulted in a more than
10-fold improvement in binding affinity for B lymphocyte
stimulator, as compared to one of the highest affinity binders
isolated in the initial screen (453-01-B07, SEQ ID NO:31).
TABLE-US-00044 TABLE 14 Dissociation Constants of Synthetic
BLyS.TM.-binding Polypeptides Peptide Sequence SEQ ID NO: K.sub.D
(nM) DX814 Ac-ANWYDPLTKLWLPDGGK-fitc 437 26 .+-. 7 DX815
Ac-WYDPLTKLWLPDGGK-fitc 438 31 .+-. 13 DX876 Ac-WYDPLTKLWLGGK-fitc
439 171 .+-. 90 DX816 Ac-ANWYDPLTKLWLPVGGK-fitc 440 44 .+-. 15
DX817 Ac-ANWFDPLTKLWLPDGGK-fitc 441 32 .+-. 26 DX818
Ac-ANWYDPLTKLSLPDGGK-fitc 442 342 .+-. 108 DX819
Ac-ANWYDPLTKLWFPDGGK-fitc 443 69 .+-. 38 DX822
Ac-ANWYDSLTKLWLPDGGK-fitc 444 79 .+-. 54
[0676] Analysis of the BAML isolates revealed a lack of sequence
conservation at position 2 (varied in the BAML template, see Table
10). To examine whether the N-terminal residues at positions 1 and
2 in the BAML sequence were necessary for binding to B lymphocyte
stimulator, a truncated version of DX814 comprising only residues
3-14 (DX815; see Table 14) was synthesized and analyzed by
fluorescence anisotropy. The K.sub.D for DX815 was
indistinguishable from that of DX814, suggesting that residues 1-2
are not required for high affinity binding to B lymphocyte
stimulator. Further truncation of DX814 to the minimal core
(residues 1-10, DX876) increased the K.sub.D to 171 nM, indicating
a contribution from Pro at position 13 and/or Asp at position 14 of
the 14-mer to high affinity B lymphocyte stimulator binding.
Substitution of Val in DX816 at that position had little effect on
the K.sub.D (see Table 14). In comparing the B lymphocyte
stimulator-binding polypeptide DX221 (Ac-WTDSLTGLWFPDGGPGPEGGGK;
K.sub.D=3 .mu.M; SEQ ID NO:168) with the BAML peptide closest in
sequence (DX819, Ac-ANWYDPLTKLWFPDGGK; K.sub.D=69 nM; SEQ ID
NO:443), differences are seen at three positions 4 (T.fwdarw.Y), 6
(S.fwdarw.P), and 9 (G.fwdarw.K), indicating the contribution of
these residues in binding affinity.
[0677] The synthesized BAML peptides exhibited K.sub.D values in
the low nanomolar range, two orders of magnitude lower than primary
isolate-derived peptides (see Example 1). Phenylalanine
substitutions (F.sub.4.fwdarw.Y.sub.4; F.sub.12.fwdarw.L.sub.12;
Table 14) were the most common minor variations to the core
sequence and these changes failed to significantly affect the
dissociation constants of the synthesized peptides. A change at
position 11 (W.sub.11.fwdarw.S.sub.11; DX818), however, resulted in
an approximately 10-fold decrease in affinity compared to
DX814.
[0678] Following the foregoing description, the characteristics
important for using various affinity binding polypeptides for
targeting of B lymphocyte stimulator or B lymphocyte
stimulator-like polypeptides (B lymphocyte stimulator target
protein) in vitro or in vivo can be appreciated. Additional binding
polypeptide uses of the invention and alternative methods adapted
to a particular use will be evident from studying the foregoing
description. For instance, any spacer or linker sequences
associated with B lymphocyte stimulator binding polypeptides
discussed above may be removed or substituted to yield additional B
lymphocyte stimulator binding polypeptides for use in the methods
of this invention. All such embodiments and obvious alternatives
are intended to be within the scope of this invention, as defined
by the claims that follow.
[0679] Publications referred to above are hereby incorporated by
reference.
Sequence CWU 1
1
465113PRTArtificial SequenceBLyS binding polypeptide 1Xaa Xaa Xaa
Cys Xaa Phe Xaa Trp Glu Cys Xaa Xaa Xaa1 5 10214PRTArtificial
SequenceBLyS binding polypeptide 2Xaa Xaa Xaa Cys Xaa Xaa Xaa Xaa
Xaa Xaa Cys Xaa Xaa Xaa1 5 10315PRTArtificial SequenceBLyS binding
polypeptide 3Xaa Xaa Xaa Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Cys Xaa
Xaa Xaa1 5 10 15416PRTArtificial SequenceBLyS binding polypeptide
4Xaa Xaa Xaa Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Cys Xaa Xaa Xaa1 5
10 15518PRTArtificial SequenceBLyS binding polypeptide 5Xaa Xaa Xaa
Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Cys Xaa1 5 10 15Xaa
Xaa612PRTArtificial SequenceBLyS binding polypeptide 6Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa1 5 10713PRTArtificial
SequenceBLyS binding polypeptide 7Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa1 5 1087PRTArtificial SequenceBLyS binding
polypeptide 8Cys Xaa Phe Xaa Trp Glu Cys1 598PRTArtificial
SequenceBLyS binding polypeptide 9Cys Xaa Xaa Xaa Xaa Xaa Xaa Cys1
5109PRTArtificial SequenceBLyS binding polypeptide 10Cys Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Cys1 51110PRTArtificial SequenceBLyS binding
polypeptide 11Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Cys1 5
101212PRTArtificial SequenceBLyS binding polypeptide 12Cys Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Cys1 5 10138PRTArtificial
Sequencec-terminal linker 13Pro Gly Pro Glu Gly Gly Gly Lys1
51412PRTArtificial Sequencephage display library template 14Xaa Xaa
Xaa Cys Xaa Xaa Xaa Xaa Cys Xaa Xaa Xaa1 5 101513PRTArtificial
Sequencephage display library template 15Xaa Xaa Xaa Cys Xaa Xaa
Xaa Xaa Xaa Cys Xaa Xaa Xaa1 5 101614PRTArtificial Sequencephage
display library template 16Xaa Xaa Xaa Cys Xaa Xaa Xaa Xaa Xaa Xaa
Cys Xaa Xaa Xaa1 5 101715PRTArtificial Sequencephage display
library template 17Xaa Xaa Xaa Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Cys
Xaa Xaa Xaa1 5 10 151816PRTArtificial Sequencephage display library
template 18Xaa Xaa Xaa Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Cys Xaa
Xaa Xaa1 5 10 151918PRTArtificial Sequencephage display library
template 19Xaa Xaa Xaa Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Cys Xaa1 5 10 15Xaa Xaa2012PRTArtificial SequenceBLyS binding
polypeptide 20His Leu Arg Cys Trp Ser Thr Asn Cys Arg Tyr Asp1 5
102112PRTArtificial SequenceBLyS binding polypeptide 21Val Met Asp
Cys Leu Ile Asn Arg Cys Asp Thr Val1 5 102213PRTArtificial
SequenceBLyS binding polypeptide 22Lys Ser Lys Cys Phe Phe Pro Trp
Glu Cys Gln Gln Ala1 5 102313PRTArtificial SequenceBLyS binding
polypeptide 23Ala Met Lys Cys Tyr Phe Pro Trp Glu Cys Ala Asn Gly1
5 102414PRTArtificial SequenceBLyS binding polypeptide 24Glu Asn
Val Ala Cys Tyr Phe Pro Trp Glu Cys His His Pro1 5
102513PRTArtificial SequenceBLyS binding polypeptide 25Asn Ala Pro
Cys Tyr Phe Pro Trp Glu Cys Phe Ser Ile1 5 102613PRTArtificial
SequenceBLyS binding polypeptide 26Ser Val Asn Cys Trp Phe Pro Trp
Glu Cys Val Gly Asn1 5 102713PRTArtificial SequenceBLyS binding
polypeptide 27Lys Glu Pro Cys Tyr Phe Tyr Trp Glu Cys Ala Val Ser1
5 102814PRTArtificial SequenceBLyS binding polypeptide 28Asp Thr
Asn Cys Asp Leu Leu Thr Lys Met Cys Gly Pro Gln1 5
102914PRTArtificial SequenceBLyS binding polypeptide 29Gly Thr Pro
Cys Asp Leu Leu Thr Lys Leu Cys Leu Leu Trp1 5 103014PRTArtificial
SequenceBLyS binding polypeptide 30Met Ser Glu Cys Asp Leu Leu Thr
Lys Ile Cys Leu Met Gly1 5 103114PRTArtificial SequenceBLyS binding
polypeptide 31Val Pro Phe Cys Asp Leu Leu Thr Lys His Cys Phe Glu
Ala1 5 103214PRTArtificial SequenceBLyS binding polypeptide 32Val
Pro Phe Cys Asp Leu Leu Thr Lys His Cys Phe Glu Ala1 5
103314PRTArtificial SequenceBLyS binding polypeptide 33Trp Ser Ala
Cys Asp Leu Leu Thr Lys Gln Cys Val Gln Val1 5 103413PRTArtificial
SequenceBLyS binding polypeptide 34Asp Gly Cys Asp Glu Leu Thr Lys
Ile Cys Gly Met Lys1 5 103514PRTArtificial SequenceBLyS binding
polypeptide 35Lys Ser Trp Cys Asp Glu Leu Thr Lys Val Cys Phe Asp
Pro1 5 103614PRTArtificial SequenceBLyS binding polypeptide 36Lys
Trp Met Cys Asp Glu Leu Thr Lys Gln Cys Gln Tyr Val1 5
103714PRTArtificial SequenceBLyS binding polypeptide 37Met Lys Tyr
Cys Asp Glu Leu Thr Lys Ile Cys Val Gly Trp1 5 103814PRTArtificial
SequenceBLyS binding polypeptide 38Tyr Phe Gln Cys Asp Glu Leu Thr
Lys Met Cys Trp Gln Lys1 5 103914PRTArtificial SequenceBLyS binding
polypeptide 39Ala Met His Cys Asp Lys Leu Thr Lys His Cys Lys Phe
His1 5 104013PRTArtificial SequenceBLyS binding polypeptide 40Val
Pro Tyr Cys Asp Lys Leu Thr Lys Ile Cys Gln Trp1 5
104114PRTArtificial SequenceBLyS binding polypeptide 41Glu Val Phe
Cys Asp Val Leu Thr Lys Val Cys Phe His Asp1 5 104214PRTArtificial
SequenceBLyS binding polypeptide 42Lys Pro Lys Cys Asp Val Leu Thr
Lys Met Cys Asp Trp Leu1 5 104314PRTArtificial SequenceBLyS binding
polypeptide 43Thr Gln His Cys Asp Val Leu Thr Lys Gln Cys Phe Thr
Ile1 5 104414PRTArtificial SequenceBLyS binding polypeptide 44Gly
His Phe Cys Asp Arg Leu Thr Lys Tyr Cys Phe Glu Pro1 5
104514PRTArtificial SequenceBLyS binding polypeptide 45His Ile Gln
Cys Asp Arg Leu Thr Lys Ser Cys Leu Ser Val1 5 104614PRTArtificial
SequenceBLyS binding polypeptide 46Ile Lys Ala Cys Asp Ile Leu Thr
Lys Val Cys Trp Pro Pro1 5 104714PRTArtificial SequenceBLyS binding
polypeptide 47Gln Phe Asp Cys Asp Pro Leu Thr Lys Tyr Cys Gly Glu
Phe1 5 104814PRTArtificial SequenceBLyS binding polypeptide 48Lys
Met Tyr Cys Asp His Leu Thr Gly Tyr Cys Trp Pro Glu1 5
104914PRTArtificial SequenceBLyS binding polypeptide 49Met Gln Ser
Cys Asp Ile Leu Thr Gly Tyr Cys Phe Lys Arg1 5 105014PRTArtificial
SequenceBLyS binding polypeptide 50Gly Pro Trp Cys Asp Ile Leu Thr
Gly Phe Cys Leu Ala Gln1 5 105114PRTArtificial SequenceBLyS binding
polypeptide 51Ser Val Arg Cys Asp Leu Leu Thr Gly Trp Cys Pro Val
Trp1 5 105214PRTArtificial SequenceBLyS binding polypeptide 52Pro
Ala Asp Cys Asp Pro Leu Thr Asn Ile Cys Phe Trp Lys1 5
105314PRTArtificial SequenceBLyS binding polypeptide 53Thr Asn Val
Cys Asp Pro Leu Thr Asn Val Cys Phe Met Asn1 5 105414PRTArtificial
SequenceBLyS binding polypeptide 54Glu His Trp Cys Asp Asp Leu Thr
His Leu Cys Phe Arg Leu1 5 105514PRTArtificial SequenceBLyS binding
polypeptide 55Gly Tyr Trp Cys Asp Val Leu Thr Asn Asn Cys Trp Lys
Ile1 5 105614PRTArtificial SequenceBLyS binding polypeptide 56Leu
Tyr Asn Cys Asp Tyr Leu Thr Arg Leu Cys Phe Glu Pro1 5
105714PRTArtificial SequenceBLyS binding polypeptide 57His Val Asp
Cys Leu Leu His Pro Lys Ala Cys Tyr Lys Tyr1 5 105814PRTArtificial
SequenceBLyS binding polypeptide 58Val Gln Asp Cys Leu Leu His Pro
Lys Ala Cys Gln Met Gln1 5 105914PRTArtificial SequenceBLyS binding
polypeptide 59Lys Phe Asp Cys Leu Leu Lys Pro Met Phe Cys Ser Asn
His1 5 106014PRTArtificial SequenceBLyS binding polypeptide 60Phe
Ala Asp Cys Leu Ile His Pro Lys Ser Cys Lys Pro Leu1 5
106114PRTArtificial SequenceBLyS binding polypeptide 61His Gly Asn
Cys Tyr Pro Phe Pro Trp Glu Cys Glu Ser Lys1 5 106214PRTArtificial
SequenceBLyS binding polypeptide 62Met Ile Ile Val Leu Leu Leu Leu
Arg Phe Ala Ile Ser Arg1 5 106314PRTArtificial SequenceBLyS binding
polypeptide 63Ser Leu Leu Val Ile Phe Leu Leu Ile Gly Ala Gly Ser
Leu1 5 106415PRTArtificial SequenceBLyS binding polypeptide 64Phe
His Pro Cys Asp Met Leu Thr Gly Ile Trp Cys Gln Pro Asn1 5 10
156515PRTArtificial SequenceBLyS binding polypeptide 65Ser Lys Arg
Cys Asp Leu Leu Thr Lys Met Trp Cys Glu Thr Glu1 5 10
156615PRTArtificial SequenceBLyS binding polypeptide 66Thr Lys Phe
Cys Asp Arg Leu Thr Met Pro Lys Cys Val Trp Lys1 5 10
156715PRTArtificial SequenceBLyS binding polypeptide 67Asn Thr Phe
Cys Pro Asp Pro Leu Thr Gly Arg Cys Val Asn Pro1 5 10
156815PRTArtificial SequenceBLyS binding polypeptide 68Asp Trp Thr
Cys Asp Pro Leu Phe His Arg Glu Cys Ile Phe Glu1 5 10
156915PRTArtificial SequenceBLyS binding polypeptide 69Pro Gln Pro
Cys Asp Leu Leu Phe Glu Lys Lys Cys Ser Ile Lys1 5 10
157015PRTArtificial SequenceBLyS binding polypeptide 70Arg Trp His
Cys Asp Met Leu Ile Asn Pro Ser Cys Leu Pro Asp1 5 10
157115PRTArtificial SequenceBLyS binding polypeptide 71Lys Ile Gln
Cys Asp Ile Val Asn Leu Ser Ser Cys Val Tyr Pro1 5 10
157215PRTArtificial SequenceBLyS binding polypeptide 72Leu Asn Ala
Cys Asp Ile Val His Pro Asn Tyr Cys Ser Gly Met1 5 10
157315PRTArtificial SequenceBLyS binding polypeptide 73Ala Lys Ala
Cys Ser Ile Val Asn Leu Glu Ser Cys Glu Tyr Leu1 5 10
157415PRTArtificial SequenceBLyS binding polypeptide 74Arg Gln Ala
Cys Ser Ile Ile Thr Pro Trp Gly Cys Pro Ile Pro1 5 10
157515PRTArtificial SequenceBLyS binding polypeptide 75Ala Asp Asn
Cys Thr Val Ala Thr Leu Asp Phe Cys Tyr Trp Thr1 5 10
157615PRTArtificial SequenceBLyS binding polypeptide 76Lys Pro Glu
Cys Asn Ile Thr Lys Pro Gln Phe Cys Phe Gly Glu1 5 10
157715PRTArtificial SequenceBLyS binding polypeptide 77Asn Asn Cys
Gln Trp Asp Glu Leu Thr Ser Met Cys Asp Pro Phe1 5 10
157816PRTArtificial SequenceBLyS binding polypeptide 78Ser Arg Leu
Cys His Met Asp Glu Leu Thr His Val Cys Val His Phe1 5 10
157916PRTArtificial SequenceBLyS binding polypeptide 79Ser Arg Pro
Cys Gln Ile Asp Glu Leu Thr Lys Ala Cys Phe Tyr Asn1 5 10
158016PRTArtificial SequenceBLyS binding polypeptide 80Asp Arg Val
Cys Lys Leu Asp Phe Leu Thr Tyr Asn Cys Leu Asn His1 5 10
158116PRTArtificial SequenceBLyS binding polypeptide 81His Ser Asn
Cys Ile Met Asp Leu Leu Thr Asn Arg Cys Phe Tyr Asp1 5 10
158216PRTArtificial SequenceBLyS binding polypeptide 82Pro Phe Asn
Cys Phe His Asp Pro Leu Thr Gly Leu Cys Leu His Ser1 5 10
158316PRTArtificial SequenceBLyS binding polypeptide 83Tyr Asp Ser
Cys Thr Tyr Asp Arg Leu Thr Lys Gln Cys Tyr Pro Ser1 5 10
158416PRTArtificial SequenceBLyS binding polypeptide 84Phe His Asp
Cys Met Tyr Asp Ala Leu Leu Gly Tyr Cys Leu Pro Tyr1 5 10
158515PRTArtificial SequenceBLyS binding polypeptide 85Asn Arg Ser
Cys Asp Pro Leu Thr Arg Pro Lys Ser Cys Gly Leu1 5 10
158616PRTArtificial SequenceBLyS binding polypeptide 86Leu Ser Asn
Cys Asp Trp Asp Asp Leu Ile Arg Gln Cys Leu His Asp1 5 10
158716PRTArtificial SequenceBLyS binding polypeptide 87Phe Trp Asp
Cys Leu Phe His Pro Asn Ser Arg Tyr Cys Val Leu Ser1 5 10
158816PRTArtificial SequenceBLyS binding polypeptide 88Ser Arg Asp
Cys Leu Leu Ser Pro Ala Met Ala Trp Cys Gly Leu Asp1 5 10
158918PRTArtificial SequenceBLyS binding polypeptide 89Gly Gly Asn
Cys Tyr Thr Asp Ser Leu Thr Lys Leu His Phe Cys Met1 5 10 15Gly
Asp9016PRTArtificial SequenceBLyS binding polypeptide 90Met Cys Pro
Arg Asp Pro Leu Thr Lys Ala Lys Leu Cys Asn Trp His1 5 10
159118PRTArtificial SequenceBLyS binding polypeptide 91Pro Asn Gln
Cys Gln Asp Asp Leu Thr Lys Gln Trp Tyr Ser Cys His1 5 10 15Tyr
His9218PRTArtificial SequenceBLyS binding polypeptide 92Phe Asp Met
Cys Phe Asp Ala Leu Thr Lys Gln Asn Phe Tyr Cys Arg1 5 10 15Phe
His9318PRTArtificial SequenceBLyS binding polypeptide 93Arg Asn Met
Cys Val Asp Arg Leu Thr Lys Leu Gln His Gly Cys Glu1 5 10 15Gly
Ala9418PRTArtificial SequenceBLyS binding polypeptide 94Asp Pro Glu
Cys Leu Thr Ser Phe Asp Arg Leu Thr Lys Met Cys Trp1 5 10 15Pro
Trp9518PRTArtificial SequenceBLyS binding polypeptide 95Asp Asp Glu
Cys His Tyr Asp Tyr Leu Thr His Tyr Met Arg Cys Asp1 5 10 15Tyr
Arg9618PRTArtificial SequenceBLyS binding polypeptide 96Phe Gly Gly
Cys Asn Ile Asp Leu Leu Thr Asn Thr Met Met Cys His1 5 10 15Arg
Asn9718PRTArtificial SequenceBLyS binding polypeptide 97His Gly Pro
Cys Tyr Trp Asp Glu Leu Thr Met Gln Trp His Cys Asn1 5 10 15His
His9818PRTArtificial SequenceBLyS binding polypeptide 98Gly Ala Met
Cys Val Asp Leu Leu Thr Tyr Thr Phe Arg Pro Cys Met1 5 10 15Tyr
Ala9918PRTArtificial SequenceBLyS binding polypeptide 99Ser Asn Lys
Cys Trp Asp Glu Leu Thr His Ala Trp Ala Glu Cys Gly1 5 10 15Arg
Phe10018PRTArtificial SequenceBLyS binding polypeptide 100Arg Pro
Val Cys Tyr Lys Gly Tyr Asp Ile Leu Thr Thr Gln Cys Met1 5 10 15Pro
Trp10118PRTArtificial SequenceBLyS binding polypeptide 101Pro Ser
Arg Cys Trp Phe Asp Leu Leu Phe Asn Lys Phe Val Cys Lys1 5 10 15Arg
Asn10218PRTArtificial SequenceBLyS binding polypeptide 102Arg Ser
Gly Cys Val Tyr Asp Met Leu Leu Met Thr Met Tyr Cys Pro1 5 10 15Ser
Asn10318PRTArtificial SequenceBLyS binding polypeptide 103Ser Asn
Arg Cys Glu Gly Asp Gln Leu Met Arg Pro Pro Ser Cys Arg1 5 10 15His
Leu10418PRTArtificial SequenceBLyS binding polypeptide 104Tyr Arg
Met Cys Trp Trp Asp Asp Leu Leu Arg Gly Phe Val Cys Asp1 5 10 15Phe
His10518PRTArtificial SequenceBLyS binding polypeptide 105His Asp
Gly Cys Tyr Asp Glu Leu Leu Tyr Arg Trp Thr Arg Cys Glu1 5 10 15His
Arg10618PRTArtificial SequenceBLyS binding polypeptide 106Trp Ala
Trp Cys Phe Asp Glu Leu Val Gln Arg Tyr Phe Thr Cys Phe1 5 10 15Asp
His10718PRTArtificial SequenceBLyS binding polypeptide 107Leu Pro
Glu Cys Arg Gln Tyr Phe Pro Trp Glu Lys Gln Val Cys Ser1 5 10 15Tyr
Trp10812PRTArtificial SequenceBLyS binding polypeptide 108Val His
Tyr Asp Ser Leu Thr Lys Met Trp Thr Arg1 5 1010912PRTArtificial
SequenceBLyS binding polypeptide 109Phe Thr Asp Pro Leu Thr Lys Met
Ser Leu His Ser1 5 1011012PRTArtificial SequenceBLyS binding
polypeptide 110Gly Tyr Asp Val Leu Thr Lys Leu Tyr Phe Val Pro1 5
1011112PRTArtificial SequenceBLyS binding polypeptide 111Tyr Tyr
Asp Arg Leu Thr Lys Leu Tyr Ser Ser Met1 5 1011212PRTArtificial
SequenceBLyS binding polypeptide 112Leu Xaa Lys Asp Pro Leu Thr Lys
Leu Tyr Ile Ser1 5 1011312PRTArtificial SequenceBLyS binding
polypeptide 113Gly Tyr Asp Val Leu Thr Lys Leu Xaa Phe Val Pro1 5
1011412PRTArtificial SequenceBLyS binding polypeptide 114Arg Leu
Tyr Asp Pro Leu Thr Lys Leu Val Leu Ser1 5 1011512PRTArtificial
SequenceBLyS binding polypeptide 115Met Phe Asp Pro Leu Thr Lys Ile
Ala Phe Pro Ala1 5 1011612PRTArtificial SequenceBLyS binding
polypeptide 116Phe Tyr Asp Ser Leu Thr Lys Thr Asn Leu Arg Asp1 5
1011712PRTArtificial SequenceBLyS binding polypeptide 117Gly Ile
Tyr Asp Lys Leu Thr Arg Ala Trp Leu Pro1 5 1011812PRTArtificial
SequenceBLyS binding polypeptide 118Lys Tyr Asp Pro Leu Thr Arg Ala
Arg Xaa Pro Leu1 5 1011912PRTArtificial SequenceBLyS binding
polypeptide 119Tyr Ile Asp Gln Leu Thr Arg Leu Ser Leu Pro Ser1 5
1012012PRTArtificial SequenceBLyS binding polypeptide 120His Gln
Thr Phe Asp Ile Leu Thr Arg Leu His Phe1 5 1012112PRTArtificial
SequenceBLyS binding polypeptide 121Trp Gln Phe Asp Val Leu Thr Arg
Ser Trp Thr Pro1 5 1012212PRTArtificial SequenceBLyS binding
polypeptide 122Gly Ala Ala Tyr Asp His Leu Thr Arg Thr Trp Leu1 5
1012312PRTArtificial SequenceBLyS binding polypeptide 123Tyr Phe
Asp Gln Leu Thr His Leu Ser Ile Lys Lys1 5 1012412PRTArtificial
SequenceBLyS binding polypeptide 124Ala Trp Asp Pro Leu Thr Met Leu
Val Leu Pro Trp1 5 1012512PRTArtificial SequenceBLyS binding
polypeptide 125Ala Leu Trp Met Asp Pro Leu Thr Gly Leu Ala Phe1 5
1012612PRTArtificial SequenceBLyS binding polypeptide 126Trp Gln
Phe Asp Val Leu Thr Xaa Ser Trp Thr Pro1 5 1012712PRTArtificial
SequenceBLyS binding polypeptide 127Trp Thr Asp Pro Leu Thr His Met
Glu Ile Tyr His1 5 1012812PRTArtificial SequenceBLyS binding
polypeptide 128Trp Thr Asp Ser Leu Thr Gly Leu Trp Phe Pro Asp1 5
1012912PRTArtificial SequenceBLyS binding polypeptide 129Tyr Thr
Asp Pro Leu Thr Gly Ile Val Xaa Pro Phe1 5 1013012PRTArtificial
SequenceBLyS binding polypeptide 130Tyr Trp Asp Lys Leu Thr Met Leu
His Leu Gly Val1 5 1013112PRTArtificial SequenceBLyS binding
polypeptide 131Tyr Tyr Asp Phe Leu Thr Arg Thr Val Leu Pro Ser1 5
1013212PRTArtificial SequenceBLyS binding polypeptide 132Arg Leu
Asp Pro Leu Ser Lys Asn Asp Phe Pro Arg1 5 1013312PRTArtificial
SequenceBLyS binding polypeptide 133Leu Arg Tyr Asp Pro Leu Leu Lys
Ser Xaa Ile Tyr1 5 1013412PRTArtificial SequenceBLyS binding
polypeptide 134Leu Arg Tyr Asp Pro Leu Leu Lys Ser Tyr Ile Tyr1 5
1013512PRTArtificial SequenceBLyS binding polypeptide 135Tyr Phe
Asp Gln Phe Thr His Leu Ser Ile Lys Lys1 5 1013612PRTArtificial
SequenceBLyS binding polypeptide 136Tyr Phe Asp Gln Xaa Thr His Leu
Ser Ile Lys Lys1 5 1013713PRTArtificial SequenceBLyS binding
polypeptide 137Glu His Tyr Tyr Thr Asp Pro Leu Thr Gly Ala Arg Ile1
5 1013813PRTArtificial SequenceBLyS binding polypeptide 138Glu His
Tyr Xaa Thr Asp Pro Leu Thr Gly Ala Arg Ile1 5 1013913PRTArtificial
SequenceBLyS binding polypeptide 139Glu His Tyr Ser Thr Asp Pro Leu
Thr Gly Ala Arg Ile1 5 1014013PRTArtificial SequenceBLyS binding
polypeptide 140Glu His Tyr Tyr Thr Asp Pro Leu Xaa Gly Xaa Arg Ile1
5 1014113PRTArtificial SequenceBLyS binding polypeptide 141Glu His
Tyr Tyr Thr Asp Pro Leu Xaa Gly Xaa Arg Xaa1 5 1014213PRTArtificial
SequenceBLyS binding polypeptide 142Glu His Tyr Tyr Thr Asp Pro Leu
Xaa Gly Ala Arg Xaa1 5 1014313PRTArtificial SequenceBLyS binding
polypeptide 143Glu His Xaa Tyr Thr Asp Pro Leu Asn Gly Ala Arg Xaa1
5 1014413PRTArtificial SequenceBLyS binding polypeptide 144Glu His
Tyr Tyr Asn Asp Pro Leu Asn Gly Ala Arg Xaa1 5 1014513PRTArtificial
SequenceBLyS binding polypeptide 145Xaa His Xaa Tyr Asn Asp Pro Leu
Asn Gly Ala Arg Xaa1 5 1014613PRTArtificial SequenceBLyS binding
polypeptide 146Lys Pro Tyr Tyr Asp Pro Ile Thr Lys Met Thr His His1
5 1014713PRTArtificial SequenceBLyS binding polypeptide 147Lys Pro
Tyr Tyr Asp Pro Ile Thr Lys Met Ser His His1 5 1014813PRTArtificial
SequenceBLyS binding polypeptide 148Lys Pro Tyr Tyr Asp Pro Ile Ser
Lys Met Thr His His1 5 1014913PRTArtificial SequenceBLyS binding
polypeptide 149Lys Pro Xaa Xaa Asp Pro Ile Ser Lys Met Thr His His1
5 1015013PRTArtificial SequenceBLyS binding polypeptide 150Gln Ile
Gly Tyr Asp Glu Leu Thr Lys Ala Trp Val Thr1 5 1015113PRTArtificial
SequenceBLyS binding polypeptide 151Gln Leu Gly Tyr Asp Glu Leu Thr
Lys Ala Trp Val Thr1 5 1015213PRTArtificial SequenceBLyS binding
polypeptide 152Lys Ile Asp Glu Leu Xaa Met Gln Asn Ile Ile Ile Trp1
5 1015313PRTArtificial SequenceBLyS binding polypeptide 153Asp His
Thr Asp Pro Leu Ile Gln Gly Leu Thr Lys Arg1 5 1015413PRTArtificial
SequenceBLyS binding polypeptide 154Trp His Asp Pro Leu Lys His Met
His Phe His His Glu1 5 1015513PRTArtificial SequenceBLyS binding
polypeptide 155Lys His Ile Asp Met Glu Thr Gly Leu Ile Leu Gln Asn1
5 1015613PRTArtificial SequenceBLyS binding polypeptide 156Met Gln
Val Asp Pro Glu Thr Gly Leu Lys Tyr Glu His1 5 1015713PRTArtificial
SequenceBLyS binding polypeptide 157Xaa Leu Asp Gln His Val Asn Xaa
Xaa Xaa Tyr Gln Ser1 5 1015813PRTArtificial SequenceBLyS binding
polypeptide 158Glu Xaa Xaa Xaa Thr Xaa Xaa Leu Thr Gly Ala Arg Xaa1
5 1015913PRTArtificial SequenceBLyS binding polypeptide 159Gly Pro
Tyr Asn Ile Xaa Arg Leu Xaa Gly Glu Arg Xaa1 5 1016013PRTArtificial
SequenceBLyS binding polypeptide 160His Ile Lys Met Leu His Gln Gly
Ser Phe Val Gly Val1 5 1016113PRTArtificial SequenceBLyS binding
polypeptide 161His Pro Thr Asn Thr Xaa Xaa His Gln Xaa Val Tyr Ser1
5 1016213PRTArtificial SequenceBLyS binding polypeptide 162His Arg
Gly Gln Val Xaa Xaa Leu Asn Gly Met Val Xaa1 5 1016324PRTArtificial
SequenceBLyS binding polypeptide 163Ala Gly Lys Glu Pro Cys Tyr Phe
Tyr Trp Glu Cys Ala Val Ser Gly1 5 10 15Pro Gly Pro Glu Gly Gly Gly
Lys 2016425PRTArtificial SequenceBLyS binding polypeptide 164Ala
Gly Val Pro Phe Cys Asp Leu Leu Thr Lys His Cys Phe Glu Ala1 5 10
15Gly Pro Gly Pro Glu Gly Gly Gly Lys 20 2516528PRTArtificial
SequenceBLyS binding polypeptide 165Gly Ser Ser Arg Leu Cys His Met
Asp Glu Leu Thr His Val Cys Val1 5 10 15His Phe Ala Pro Pro Gly Pro
Glu Gly Gly Gly Lys 20 2516629PRTArtificial SequenceBLyS binding
polypeptide 166Gly Asp Gly Gly Asn Cys Tyr Thr Asp Ser Leu Thr Lys
Leu His Phe1 5 10 15Cys Met Gly Asp Glu Pro Gly Pro Glu Gly Gly Gly
Lys 20 2516722PRTArtificial SequenceBLyS binding polypeptide 167Gly
Tyr Asp Val Leu Thr Lys Leu Tyr Phe Val Pro Gly Gly Pro Gly1 5 10
15Pro Glu Gly Gly Gly Lys 2016822PRTArtificial SequenceBLyS binding
polypeptide 168Trp Thr Asp Ser Leu Thr Gly Leu Trp Phe Pro Asp Gly
Gly Pro Gly1 5 10 15Pro Glu Gly Gly Gly Lys 2016924PRTArtificial
Sequencemodified BLyS binding polypeptide 169Ala Gly Lys Glu Pro
Cys Tyr Phe Tyr Trp Glu Cys Ala Val Ser Gly1 5 10 15Pro Gly Pro Glu
Gly Gly Gly Lys 2017024PRTArtificial Sequencemodified BLyS binding
polypeptide 170Ala Gly Arg Glu Pro Cys Tyr Phe Tyr Trp Glu Cys Ala
Val Ser Gly1 5 10 15Pro Gly Pro Glu Gly Gly Gly Lys
2017124PRTArtificial Sequencemodified BLyS binding polypeptide
171Ala Gly Gln Glu Pro Cys Tyr Phe Tyr Trp Glu Cys Ala Val Ser Gly1
5 10 15Pro Gly Pro Glu Gly Gly Gly Lys 2017225PRTArtificial
Sequencemodified BLyS binding polypeptide 172Ala Gly Asn Xaa Glu
Pro Cys Tyr Phe Tyr Trp Glu Cys Ala Val Ser1 5 10 15Gly Pro Gly Pro
Glu Gly Gly Gly Lys 20 25173285PRTHomo Sapiens 173Met Asp Asp Ser
Thr Glu Arg Glu Gln Ser Arg Leu Thr Ser Cys Leu1 5 10 15Lys Lys Arg
Glu Glu Met Lys Leu Lys Glu Cys Val Ser Ile Leu Pro 20 25 30Arg Lys
Glu Ser Pro Ser Val Arg Ser Ser Lys Asp Gly Lys Leu Leu 35 40 45Ala
Ala Thr Leu Leu Leu Ala Leu Leu Ser Cys Cys Leu Thr Val Val 50 55
60Ser Phe Tyr Gln Val Ala Ala Leu Gln Gly Asp Leu Ala Ser Leu Arg65
70 75 80Ala Glu Leu Gln Gly His His Ala Glu Lys Leu Pro Ala Gly Ala
Gly 85 90 95Ala Pro Lys Ala Gly Leu Glu Glu Ala Pro Ala Val Thr Ala
Gly Leu 100 105 110Lys Ile Phe Glu Pro Pro Ala Pro Gly Glu Gly Asn
Ser Ser Gln Asn 115 120 125Ser Arg Asn Lys Arg Ala Val Gln Gly Pro
Glu Glu Thr Val Thr Gln 130 135 140Asp Cys Leu Gln Leu Ile Ala Asp
Ser Glu Thr Pro Thr Ile Gln Lys145 150 155 160Gly Ser Tyr Thr Phe
Val Pro Trp Leu Leu Ser Phe Lys Arg Gly Ser 165 170 175Ala Leu Glu
Glu Lys Glu Asn Lys Ile Leu Val Lys Glu Thr Gly Tyr 180 185 190Phe
Phe Ile Tyr Gly Gln Val Leu Tyr Thr Asp Lys Thr Tyr Ala Met 195 200
205Gly His Leu Ile Gln Arg Lys Lys Val His Val Phe Gly Asp Glu Leu
210 215 220Ser Leu Val Thr Leu Phe Arg Cys Ile Gln Asn Met Pro Glu
Thr Leu225 230 235 240Pro Asn Asn Ser Cys Tyr Ser Ala Gly Ile Ala
Lys Leu Glu Glu Gly 245 250 255Asp Glu Leu Gln Leu Ala Ile Pro Arg
Glu Asn Ala Gln Ile Ser Leu 260 265 270Asp Gly Asp Val Thr Phe Phe
Gly Ala Leu Lys Leu Leu 275 280 285174266PRTHomo Sapiens 174Met Asp
Asp Ser Thr Glu Arg Glu Gln Ser Arg Leu Thr Ser Cys Leu1 5 10 15Lys
Lys Arg Glu Glu Met Lys Leu Lys Glu Cys Val Ser Ile Leu Pro 20 25
30Arg Lys Glu Ser Pro Ser Val Arg Ser Ser Lys Asp Gly Lys Leu Leu
35 40 45Ala Ala Thr Leu Leu Leu Ala Leu Leu Ser Cys Cys Leu Thr Val
Val 50 55 60Ser Phe Tyr Gln Val Ala Ala Leu Gln Gly Asp Leu Ala Ser
Leu Arg65 70 75 80Ala Glu Leu Gln Gly His His Ala Glu Lys Leu Pro
Ala Gly Ala Gly 85 90 95Ala Pro Lys Ala Gly Leu Glu Glu Ala Pro Ala
Val Thr Ala Gly Leu 100 105 110Lys Ile Phe Glu Pro Pro Ala Pro Gly
Glu Gly Asn Ser Ser Gln Asn 115 120 125Ser Arg Asn Lys Arg Ala Val
Gln Gly Pro Glu Glu Thr Gly Ser Tyr 130 135 140Thr Phe Val Pro Trp
Leu Leu Ser Phe Lys Arg Gly Ser Ala Leu Glu145 150 155 160Glu Lys
Glu Asn Lys Ile Leu Val Lys Glu Thr Gly Tyr Phe Phe Ile 165 170
175Tyr Gly Gln Val Leu Tyr Thr Asp Lys Thr Tyr Ala Met Gly His Leu
180 185 190Ile Gln Arg Lys Lys Val His Val Phe Gly Asp Glu Leu Ser
Leu Val 195 200 205Thr Leu Phe Arg Cys Ile Gln Asn Met Pro Glu Thr
Leu Pro Asn Asn 210 215 220Ser Cys Tyr Ser Ala Gly Ile Ala Lys Leu
Glu Glu Gly Asp Glu Leu225 230 235 240Gln Leu Ala Ile Pro Arg Glu
Asn Ala Gln Ile Ser Leu Asp Gly Asp 245 250 255Val Thr Phe Phe Gly
Ala Leu Lys Leu Leu 260 265175309PRTmouse 175Met Asp Glu Ser Ala
Lys Thr Leu Pro Pro Pro Cys Leu Cys Phe Cys1 5 10 15Ser Glu Lys Gly
Glu Asp Met Lys Val Gly Tyr Asp Pro Ile Thr Pro 20 25 30Gln Lys Glu
Glu Gly Ala Trp Phe Gly Ile Cys Arg Asp Gly Arg Leu 35 40 45Leu Ala
Ala Thr Leu Leu Leu Ala Leu Leu Ser Ser Ser Phe Thr Ala 50 55 60Met
Ser Leu Tyr Gln Leu Ala Ala Leu Gln Ala Asp Leu Met Asn Leu65 70 75
80Arg Met Glu Leu Gln Ser Tyr Arg Gly Ser Ala Thr Pro Ala Ala Ala
85 90 95Gly Ala Pro Glu Leu Thr Ala Gly Val Lys Leu Leu Thr Pro Ala
Ala 100 105 110Pro Arg Pro His Asn Ser Ser Arg Gly His Arg Asn Arg
Arg Ala Phe 115 120 125Gln Gly Pro Glu Glu Thr Glu Gln Asp Val Asp
Leu Ser Ala Pro Pro 130 135 140Ala Pro Cys Leu Pro Gly Cys Arg His
Ser Gln His Asp Asp Asn Gly145 150 155 160Met Asn Leu Arg Asn Ile
Ile Gln Asp Cys Leu Gln Leu Ile Ala Asp 165 170 175Ser Asp Thr Pro
Thr Ile Arg Lys Gly Thr Tyr Thr Phe Val Pro Trp 180 185 190Leu Leu
Ser Phe Lys Arg Gly Asn Ala Leu Glu Glu Lys Glu Asn Lys 195 200
205Ile Val Val Arg Gln Thr Gly Tyr Phe Phe Ile Tyr Ser Gln Val Leu
210 215 220Tyr Thr Asp Pro Ile Phe Ala Met Gly His Val Ile Gln Arg
Lys Lys225 230 235 240Val His Val Phe Gly Asp Glu Leu Ser Leu Val
Thr Leu Phe Arg Cys 245 250 255Ile Gln Asn Met Pro Lys Thr Leu Pro
Asn Asn Ser Cys Tyr Ser Ala 260 265 270Gly Ile Ala Arg Leu Glu Glu
Gly Asp Glu Ile Gln Leu Ala Ile Pro 275 280 285Arg Glu Asn Ala Gln
Ile Ser Arg Asn Gly Asp Asp Thr Phe Phe Gly 290 295 300Ala Leu Lys
Leu Leu305176290PRTmouse 176Met Asp Glu Ser Ala Lys Thr Leu Pro Pro
Pro Cys Leu Cys Phe Cys1 5 10 15Ser Glu Lys Gly Glu Asp Met Lys Val
Gly Tyr Asp Pro Ile Thr Pro 20 25 30Gln Lys Glu Glu Gly Ala Trp Phe
Gly Ile Cys Arg Asp Gly Arg Leu 35 40 45Leu Ala Ala Thr Leu Leu Leu
Ala Leu Leu Ser Ser Ser Phe Thr Ala 50 55 60Met Ser Leu Tyr Gln Leu
Ala Ala Leu Gln Ala Asp Leu Met Asn Leu65 70 75 80Arg Met Glu Leu
Gln Ser Tyr Arg Gly Ser Ala Thr Pro Ala Ala Ala 85 90 95Gly Ala Pro
Glu Leu Thr Ala Gly Val Lys Leu Leu Thr Pro Ala Ala 100 105 110Pro
Arg Pro His Asn Ser Ser Arg Gly His Arg Asn Arg Arg Ala Phe 115 120
125Gln Gly Pro Glu Glu Thr Glu Gln Asp Val Asp Leu Ser Ala Pro Pro
130 135 140Ala Pro Cys Leu Pro Gly Cys Arg His Ser Gln His Asp Asp
Asn Gly145 150 155 160Met Asn Leu Arg Asn Arg Thr Tyr Thr Phe Val
Pro Trp Leu Leu Ser 165 170 175Phe Lys Arg Gly Asn Ala Leu Glu Glu
Lys Glu Asn Lys Ile Val Val 180 185 190Arg Gln Thr Gly Tyr Phe Phe
Ile Tyr Ser Gln Val Leu Tyr Thr Asp 195 200 205Pro Ile Phe Ala Met
Gly His Val Ile Gln Arg Lys Lys Val His Val 210 215 220Phe Gly Asp
Glu Leu Ser Leu Val Thr Leu Phe Arg Cys Ile Gln Asn225 230 235
240Met Pro Lys Thr Leu Pro Asn Asn Ser Cys Tyr Ser Ala Gly Ile Ala
245 250 255Arg Leu Glu Glu Gly Asp Glu Ile Gln Leu Ala Ile Pro Arg
Glu Asn 260 265 270Ala Gln Ile Ser Arg Asn Gly Asp Asp Thr Phe Phe
Gly Ala Leu Lys 275 280 285Leu Leu 290177239PRTrat 177Ala Val Gln
Ala Asp Leu Met Ser Leu Arg Met Glu Leu Gln Ser Tyr1 5 10 15Arg Ser
Ser Ala Thr Pro Ala Ala Pro Gly Ala Pro Gly Leu Ser Ala 20 25 30Gly
Val Lys Leu Pro Thr Pro Ala Ala Pro Gly Pro His Asn Ser
Ser 35 40 45Arg Gly Gln Arg Asn Arg Arg Ala Phe Gln Gly Pro Glu Glu
Thr Glu 50 55 60Gln Asp Val Asp Leu Ser Ala Thr Pro Ala Pro Ser Leu
Pro Gly Asn65 70 75 80Cys His Ala Ser His His Asp Glu Asn Gly Leu
Asn Leu Arg Thr Ile 85 90 95Ile Gln Asp Cys Leu Gln Leu Ile Ala Asp
Ser Asn Thr Pro Thr Ile 100 105 110Arg Lys Gly Thr Tyr Thr Phe Val
Pro Trp Leu Leu Ser Phe Lys Arg 115 120 125Gly Asn Ala Leu Glu Glu
Lys Glu Asn Lys Ile Val Val Arg Gln Thr 130 135 140Gly Tyr Phe Phe
Ile Tyr Ser Gln Val Leu Tyr Thr Asp Pro Ile Phe145 150 155 160Ala
Met Gly His Val Ile Gln Arg Lys Lys Ile His Val Phe Gly Asp 165 170
175Glu Leu Ser Leu Val Thr Leu Phe Arg Cys Ile Gln Asn Met Pro Lys
180 185 190Thr Leu Pro Asn Asn Ser Cys Tyr Ser Ala Gly Ile Ala Lys
Leu Glu 195 200 205Glu Gly Asp Glu Ile Gln Leu Ala Ile Pro Arg Glu
Asn Ala Gln Ile 210 215 220Ser Arg Asn Gly Asp Asp Thr Phe Phe Gly
Ala Leu Lys Leu Leu225 230 235178220PRTrat 178Ala Val Gln Ala Asp
Leu Met Ser Leu Arg Met Glu Leu Gln Ser Tyr1 5 10 15Arg Ser Ser Ala
Thr Pro Ala Ala Pro Gly Ala Pro Gly Leu Ser Ala 20 25 30Gly Val Lys
Leu Pro Thr Pro Ala Ala Pro Gly Pro His Asn Ser Ser 35 40 45Arg Gly
Gln Arg Asn Arg Arg Ala Phe Gln Gly Pro Glu Glu Thr Glu 50 55 60Gln
Asp Val Asp Leu Ser Ala Thr Pro Val Pro Ser Leu Pro Gly Asn65 70 75
80Cys His Ala Ser His His Asp Glu Asn Gly Leu Asn Leu Arg Thr Arg
85 90 95Thr Tyr Thr Phe Val Pro Trp Leu Leu Ser Phe Lys Arg Gly Asn
Ala 100 105 110Leu Glu Glu Lys Glu Asn Lys Ile Val Val Arg Gln Thr
Gly Tyr Phe 115 120 125Phe Ile Tyr Ser Gln Val Leu Tyr Thr Asp Pro
Ile Phe Ala Met Gly 130 135 140His Val Ile Gln Arg Lys Lys Ile His
Val Phe Gly Asp Glu Leu Ser145 150 155 160Leu Val Thr Leu Phe Arg
Cys Ile Gln Asn Met Pro Lys Thr Leu Pro 165 170 175Asn Asn Ser Cys
Tyr Ser Ala Gly Ile Ala Lys Leu Glu Glu Gly Asp 180 185 190Glu Ile
Gln Leu Ala Ile Pro Arg Glu Asn Ala Gln Ile Ser Arg Asn 195 200
205Gly Asp Asp Thr Phe Phe Gly Ala Leu Lys Leu Leu 210 215
220179207PRTrat 179Ala Val Gln Ala Asp Leu Met Ser Leu Arg Met Glu
Leu Gln Ser Tyr1 5 10 15Arg Ser Ser Ala Thr Pro Ala Ala Pro Gly Ala
Pro Gly Leu Ser Ala 20 25 30Gly Val Lys Leu Pro Thr Pro Ala Ala Pro
Gly Pro His Asn Ser Ser 35 40 45Arg Gly Gln Arg Asn Arg Arg Ala Phe
Gln Gly Pro Glu Glu Thr Val 50 55 60Ile Gln Asp Cys Leu Gln Leu Ile
Ala Asp Ser Asn Thr Pro Thr Ile65 70 75 80Arg Lys Gly Thr Tyr Thr
Phe Val Pro Trp Leu Leu Ser Phe Lys Arg 85 90 95Gly Asn Ala Leu Glu
Glu Lys Glu Asn Lys Ile Val Val Arg Gln Thr 100 105 110Gly Tyr Phe
Phe Ile Tyr Ser Gln Val Leu Tyr Thr Asp Pro Ile Phe 115 120 125Ala
Met Gly His Val Ile Gln Arg Lys Lys Ile His Val Phe Gly Asp 130 135
140Glu Leu Ser Leu Val Thr Leu Phe Arg Cys Ile Gln Asn Met Pro
Lys145 150 155 160Thr Leu Pro Asn Asn Ser Cys Tyr Ser Ala Gly Ile
Ala Lys Leu Glu 165 170 175Glu Gly Asp Glu Val Gln Leu Ala Ile Pro
Arg Glu Asn Ala Gln Ile 180 185 190Ser Arg Asn Gly Asp Asp Thr Phe
Phe Gly Ala Leu Lys Leu Leu 195 200 205180188PRTrat 180Ala Val Gln
Ala Asp Leu Met Ser Leu Arg Met Glu Leu Gln Ser Tyr1 5 10 15Arg Ser
Ser Ala Thr Pro Ala Ala Pro Gly Ala Pro Gly Leu Ser Ala 20 25 30Gly
Val Lys Leu Pro Thr Pro Ala Ala Pro Gly Pro His Asn Ser Ser 35 40
45Arg Gly Gln Arg Asn Arg Arg Ala Phe Gln Gly Pro Glu Glu Thr Gly
50 55 60Thr Tyr Thr Phe Val Pro Trp Leu Leu Ser Phe Lys Arg Gly Asn
Ala65 70 75 80Leu Glu Glu Lys Glu Asn Lys Ile Val Val Arg Gln Thr
Gly Tyr Phe 85 90 95Phe Ile Tyr Ser Gln Val Leu Tyr Thr Asp Pro Ile
Phe Ala Met Gly 100 105 110His Val Ile Gln Arg Lys Lys Ile His Val
Phe Gly Asp Glu Leu Ser 115 120 125Leu Val Thr Leu Phe Arg Cys Ile
Gln Asn Met Pro Lys Thr Leu Pro 130 135 140Asn Asn Ser Cys Tyr Ser
Ala Gly Ile Ala Lys Leu Glu Glu Gly Asp145 150 155 160Glu Ile Gln
Leu Ala Ile Pro Arg Glu Asn Ala Gln Ile Ser Arg Asn 165 170 175Gly
Asp Asp Thr Phe Phe Gly Ala Leu Lys Leu Leu 180 185181243PRTmonkey
181Lys Asp Arg Lys Leu Leu Ala Ala Ala Leu Leu Leu Ala Leu Leu Ser1
5 10 15Cys Cys Leu Met Val Val Ser Phe Tyr Gln Val Ala Ala Leu Gln
Gly 20 25 30Asp Leu Ala Ser Leu Arg Ala Glu Leu Gln Gly His His Ala
Glu Lys 35 40 45Leu Pro Ala Arg Ala Arg Ala Pro Lys Ala Gly Leu Gly
Glu Ala Pro 50 55 60Ala Val Thr Ala Gly Leu Lys Ile Phe Glu Pro Pro
Ala Pro Gly Glu65 70 75 80Gly Asn Ser Ser Gln Ser Ser Arg Asn Lys
Arg Ala Ile Gln Gly Ala 85 90 95Glu Glu Thr Val Ile Gln Asp Cys Leu
Gln Leu Ile Ala Asp Ser Glu 100 105 110Thr Pro Thr Ile Gln Lys Gly
Ser Tyr Thr Phe Val Pro Trp Leu Leu 115 120 125Ser Phe Lys Arg Gly
Ser Ala Leu Glu Glu Lys Glu Asn Lys Ile Leu 130 135 140Val Lys Glu
Thr Gly Tyr Phe Phe Ile Tyr Gly Gln Val Leu Tyr Thr145 150 155
160Asp Lys Thr Tyr Ala Met Gly His Leu Ile Gln Arg Lys Lys Val His
165 170 175Val Phe Gly Asp Glu Leu Ser Leu Val Thr Leu Phe Arg Cys
Ile Gln 180 185 190Asn Met Pro Glu Thr Leu Pro Asn Asn Ser Cys Tyr
Ser Ala Gly Ile 195 200 205Ala Lys Leu Glu Glu Gly Asp Glu Leu Gln
Leu Ala Ile Pro Arg Glu 210 215 220Asn Ala Gln Ile Ser Leu Asp Gly
Asp Val Thr Phe Phe Gly Ala Leu225 230 235 240Lys Leu
Leu182219PRTmonkey 182Tyr Gln Val Ala Ala Val Gln Gly Asp Leu Ala
Ser Leu Arg Ala Glu1 5 10 15Leu Gln Ser His His Ala Glu Lys Leu Pro
Ala Arg Ala Arg Ala Pro 20 25 30Lys Ala Gly Leu Gly Glu Ala Pro Ala
Val Thr Ala Gly Leu Lys Ile 35 40 45Phe Glu Pro Pro Ala Pro Gly Glu
Gly Asn Ser Ser Gln Ser Ser Arg 50 55 60Asn Lys Arg Ala Ile Gln Gly
Ala Glu Glu Thr Val Ile Gln Asp Cys65 70 75 80Leu Gln Leu Ile Ala
Asp Ser Glu Thr Pro Thr Ile Gln Lys Gly Ser 85 90 95Tyr Thr Phe Val
Pro Trp Leu Leu Ser Phe Lys Arg Gly Ser Ala Leu 100 105 110Glu Glu
Lys Glu Asn Lys Ile Leu Val Lys Glu Thr Gly Tyr Phe Phe 115 120
125Ile Tyr Gly Gln Val Leu Tyr Thr Asp Lys Thr Tyr Ala Met Gly His
130 135 140Leu Ile Gln Arg Lys Lys Val His Val Phe Gly Asp Glu Leu
Ser Leu145 150 155 160Val Thr Leu Phe Arg Cys Ile Gln Asn Met Pro
Glu Thr Leu Pro Asn 165 170 175Asn Ser Cys Tyr Ser Ala Gly Ile Ala
Lys Leu Glu Glu Gly Asp Glu 180 185 190Leu Gln Leu Ala Ile Pro Arg
Glu Asn Ala Gln Ile Ser Leu Asp Gly 195 200 205Asp Val Thr Phe Phe
Gly Ala Leu Lys Leu Leu 210 2151838PRTArtificial Sequenceepitope
tag 183Asp Tyr Lys Asp Asp Asp Asp Lys1 518414PRTArtificial
Sequenceconcensus BLyS binding polypeptide 184Ala Asn Trp Tyr Asp
Ser Leu Thr Lys Leu Trp Leu Pro Asp1 5 1018542DNAArtificial
Sequencecoding sequence for BLyS affinity maturation library
template 185gctnnnnnnn nngatnnnct tactnnnctc nnnnnnnnnn nn
4218614PRTArtificial SequenceBLyS binding polypeptide 186Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Asp1 5
1018714PRTArtificial SequenceBLyS binding polypeptide 187Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Glu1 5
1018814PRTArtificial SequenceBLyS binding polypeptide 188Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Gly1 5
1018914PRTArtificial SequenceBLyS binding polypeptide 189Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Val1 5
1019014PRTArtificial SequenceBLyS binding polypeptide 190Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Ser Asp1 5
1019114PRTArtificial SequenceBLyS binding polypeptide 191Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Asn Asp1 5
1019214PRTArtificial SequenceBLyS binding polypeptide 192Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Thr1 5
1019314PRTArtificial SequenceBLyS binding polypeptide 193Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Ala1 5
1019414PRTArtificial SequenceBLyS binding polypeptide 194Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Asn1 5
1019514PRTArtificial SequenceBLyS binding polypeptide 195Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Val Asp1 5
1019614PRTArtificial SequenceBLyS binding polypeptide 196Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu His Asp1 5
1019714PRTArtificial SequenceBLyS binding polypeptide 197Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Thr Asp1 5
1019814PRTArtificial SequenceBLyS binding polypeptide 198Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro His1 5
1019914PRTArtificial SequenceBLyS binding polypeptide 199Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Thr Val1 5
1020014PRTArtificial SequenceBLyS binding polypeptide 200Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Leu Asp1 5
1020114PRTArtificial SequenceBLyS binding polypeptide 201Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Leu Glu1 5
1020214PRTArtificial SequenceBLyS binding polypeptide 202Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu His Glu1 5
1020314PRTArtificial SequenceBLyS binding polypeptide 203Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Arg1 5
1020414PRTArtificial SequenceBLyS binding polypeptide 204Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Ala Asp1 5
1020514PRTArtificial SequenceBLyS binding polypeptide 205Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Tyr1 5
1020614PRTArtificial SequenceBLyS binding polypeptide 206Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Ile1 5
1020714PRTArtificial SequenceBLyS binding polypeptide 207Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Ile Asp1 5
1020814PRTArtificial SequenceBLyS binding polypeptide 208Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Arg Asp1 5
1020914PRTArtificial SequenceBLyS binding polypeptide 209Ala Tyr
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Asp1 5
1021014PRTArtificial SequenceBLyS binding polypeptide 210Ala Tyr
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Leu Glu1 5
1021114PRTArtificial SequenceBLyS binding polypeptide 211Ala Tyr
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Arg Val1 5
1021214PRTArtificial SequenceBLyS binding polypeptide 212Ala Tyr
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Glu1 5
1021314PRTArtificial SequenceBLyS binding polypeptide 213Ala Tyr
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Val1 5
1021414PRTArtificial SequenceBLyS binding polypeptide 214Ala Tyr
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu His Gln1 5
1021514PRTArtificial SequenceBLyS binding polypeptide 215Ala Tyr
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Ala1 5
1021614PRTArtificial SequenceBLyS binding polypeptide 216Ala Tyr
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Arg Val1 5
1021714PRTArtificial SequenceBLyS binding polypeptide 217Ala Tyr
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Gly1 5
1021814PRTArtificial SequenceBLyS binding polypeptide 218Ala Tyr
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Arg Tyr1 5
1021914PRTArtificial SequenceBLyS binding polypeptide 219Ala Tyr
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Tyr1 5
1022014PRTArtificial SequenceBLyS binding polypeptide 220Ala Tyr
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Leu Tyr1 5
1022114PRTArtificial SequenceBLyS binding polypeptide 221Ala Tyr
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Arg Asp1 5
1022214PRTArtificial SequenceBLyS binding polypeptide 222Ala Tyr
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Val1 5
1022314PRTArtificial SequenceBLyS binding polypeptide 223Ala Tyr
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Leu Gly1 5
1022414PRTArtificial SequenceBLyS binding polypeptide 224Ala Tyr
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Thr His1 5
1022514PRTArtificial SequenceBLyS binding polypeptide 225Ala Tyr
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Thr1 5
1022614PRTArtificial SequenceBLyS binding polypeptide 226Ala Tyr
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Leu Val1 5
1022714PRTArtificial SequenceBLyS binding polypeptide 227Ala Tyr
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Tyr Tyr1 5
1022814PRTArtificial SequenceBLyS binding polypeptide 228Ala Tyr
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Ser Asp1 5
1022914PRTArtificial SequenceBLyS binding polypeptide 229Ala Ser
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Ala1 5
1023014PRTArtificial SequenceBLyS binding polypeptide 230Ala Ser
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu His Asp1 5
1023114PRTArtificial SequenceBLyS binding polypeptide 231Ala Ser
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Gly1 5
1023214PRTArtificial SequenceBLyS binding polypeptide 232Ala Ser
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Gln1 5
1023314PRTArtificial SequenceBLyS binding polypeptide 233Ala Ser
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Tyr1 5
1023414PRTArtificial SequenceBLyS binding polypeptide 234Ala Ser
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro His1 5
1023514PRTArtificial SequenceBLyS binding polypeptide 235Ala Ser
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Val1 5
1023614PRTArtificial SequenceBLyS binding polypeptide 236Ala Ser
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Ile1 5
1023714PRTArtificial SequenceBLyS binding polypeptide 237Ala Ser
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Glu1 5
1023814PRTArtificial SequenceBLyS binding polypeptide 238Ala Phe
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Arg Val1 5
1023914PRTArtificial SequenceBLyS binding polypeptide 239Ala Phe
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Glu1 5
1024014PRTArtificial SequenceBLyS binding polypeptide 240Ala Phe
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Leu Glu1 5
1024114PRTArtificial SequenceBLyS binding polypeptide 241Ala Phe
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Val1 5
1024214PRTArtificial SequenceBLyS binding polypeptide 242Ala Ile
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Glu1 5
1024314PRTArtificial SequenceBLyS binding polypeptide 243Ala Ile
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Asp1
5 1024414PRTArtificial SequenceBLyS binding polypeptide 244Ala Ile
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu His Asp1 5
1024514PRTArtificial SequenceBLyS binding polypeptide 245Ala Ile
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Thr Asp1 5
1024614PRTArtificial SequenceBLyS binding polypeptide 246Ala Ile
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Phe1 5
1024714PRTArtificial SequenceBLyS binding polypeptide 247Ala Ile
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Leu Asp1 5
1024814PRTArtificial SequenceBLyS binding polypeptide 248Ala Ile
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Arg1 5
1024914PRTArtificial SequenceBLyS binding polypeptide 249Ala Ile
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Ala1 5
1025014PRTArtificial SequenceBLyS binding polypeptide 250Ala Ile
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Thr Ala1 5
1025114PRTArtificial SequenceBLyS binding polypeptide 251Ala Ile
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Ala Val1 5
1025214PRTArtificial SequenceBLyS binding polypeptide 252Ala Ile
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Gly1 5
1025314PRTArtificial SequenceBLyS binding polypeptide 253Ala Ile
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Arg Val1 5
1025414PRTArtificial SequenceBLyS binding polypeptide 254Ala Ile
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro His1 5
1025514PRTArtificial SequenceBLyS binding polypeptide 255Ala Ile
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Arg Glu1 5
1025614PRTArtificial SequenceBLyS binding polypeptide 256Ala Ile
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Ser Asp1 5
1025714PRTArtificial SequenceBLyS binding polypeptide 257Ala Thr
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Ala1 5
1025814PRTArtificial SequenceBLyS binding polypeptide 258Ala Thr
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Ala Asp1 5
1025914PRTArtificial SequenceBLyS binding polypeptide 259Ala Thr
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Thr Ser1 5
1026014PRTArtificial SequenceBLyS binding polypeptide 260Ala Thr
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Gly1 5
1026114PRTArtificial SequenceBLyS binding polypeptide 261Ala Thr
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Tyr1 5
1026214PRTArtificial SequenceBLyS binding polypeptide 262Ala Thr
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Ser Gly1 5
1026314PRTArtificial SequenceBLyS binding polypeptide 263Ala Thr
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Val1 5
1026414PRTArtificial SequenceBLyS binding polypeptide 264Ala Thr
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Asp1 5
1026514PRTArtificial SequenceBLyS binding polypeptide 265Ala Asp
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Val1 5
1026614PRTArtificial SequenceBLyS binding polypeptide 266Ala Asp
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Lys1 5
1026714PRTArtificial SequenceBLyS binding polypeptide 267Ala Asp
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Asp1 5
1026814PRTArtificial SequenceBLyS binding polypeptide 268Ala Asp
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Glu1 5
1026914PRTArtificial SequenceBLyS binding polypeptide 269Ala Asp
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu His Gln1 5
1027014PRTArtificial SequenceBLyS binding polypeptide 270Ala Glu
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Arg Asp1 5
1027114PRTArtificial SequenceBLyS binding polypeptide 271Ala Glu
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Asp1 5
1027214PRTArtificial SequenceBLyS binding polypeptide 272Ala Glu
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Tyr1 5
1027314PRTArtificial SequenceBLyS binding polypeptide 273Ala Leu
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Ala1 5
1027414PRTArtificial SequenceBLyS binding polypeptide 274Ala Leu
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Asp1 5
1027514PRTArtificial SequenceBLyS binding polypeptide 275Ala Leu
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Arg Gly1 5
1027614PRTArtificial SequenceBLyS binding polypeptide 276Ala Leu
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Leu Gly1 5
1027714PRTArtificial SequenceBLyS binding polypeptide 277Ala Met
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Ala1 5
1027814PRTArtificial SequenceBLyS binding polypeptide 278Ala Met
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Gln Val1 5
1027914PRTArtificial SequenceBLyS binding polypeptide 279Ala Met
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Leu Gly1 5
1028014PRTArtificial SequenceBLyS binding polypeptide 280Ala Ala
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Asp1 5
1028114PRTArtificial SequenceBLyS binding polypeptide 281Ala Ala
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Ala Asp1 5
1028214PRTArtificial SequenceBLyS binding polypeptide 282Ala Ala
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Leu Asp1 5
1028314PRTArtificial SequenceBLyS binding polypeptide 283Ala His
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Thr Asp1 5
1028414PRTArtificial SequenceBLyS binding polypeptide 284Ala His
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Val1 5
1028514PRTArtificial SequenceBLyS binding polypeptide 285Ala His
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu His Asp1 5
1028614PRTArtificial SequenceBLyS binding polypeptide 286Ala His
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Asp1 5
1028714PRTArtificial SequenceBLyS binding polypeptide 287Ala Pro
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu His Asp1 5
1028814PRTArtificial SequenceBLyS binding polypeptide 288Ala Pro
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Val1 5
1028914PRTArtificial SequenceBLyS binding polypeptide 289Ala Gln
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Glu1 5
1029014PRTArtificial SequenceBLyS binding polypeptide 290Ala Gln
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Tyr1 5
1029114PRTArtificial SequenceBLyS binding polypeptide 291Ala Gln
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Arg1 5
1029214PRTArtificial SequenceBLyS binding polypeptide 292Ala Lys
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Asp1 5
1029314PRTArtificial SequenceBLyS binding polypeptide 293Ala Lys
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Val1 5
1029414PRTArtificial SequenceBLyS binding polypeptide 294Ala Lys
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Val1 5
1029514PRTArtificial SequenceBLyS binding polypeptide 295Ala Lys
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Asn Gly1 5
1029614PRTArtificial SequenceBLyS binding polypeptide 296Ala Trp
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Ala1 5
1029714PRTArtificial SequenceBLyS binding polypeptide 297Ala Val
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Thr Asp1 5
1029814PRTArtificial SequenceBLyS binding polypeptide 298Ala Tyr
Glu Tyr Asp Pro Leu Thr Lys Leu Trp Leu Leu Tyr1 5
1029914PRTArtificial SequenceBLyS binding polypeptide 299Ala Thr
Lys Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Asp1 5
1030014PRTArtificial SequenceBLyS binding polypeptide 300Ala Thr
Leu Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Gly1 5
1030114PRTArtificial SequenceBLyS binding polypeptide 301Ala Ile
Arg Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Tyr1 5
1030214PRTArtificial SequenceBLyS binding polypeptide 302Ala Glu
Arg Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro His1 5
1030314PRTArtificial SequenceBLyS binding polypeptide 303Ala Asp
Arg Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Gln1 5
1030414PRTArtificial SequenceBLyS binding polypeptide 304Ala Asn
Ser Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Glu1 5
1030514PRTArtificial SequenceBLyS binding polypeptide 305Ala Ile
Leu Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Asp1 5
1030614PRTArtificial SequenceBLyS binding polypeptide 306Ala Asn
Trp Phe Asp Pro Leu Thr Lys Leu Trp Leu Pro Gln1 5
1030714PRTArtificial SequenceBLyS binding polypeptide 307Ala Asn
Trp Phe Asp Pro Leu Thr Lys Leu Trp Leu Pro Val1 5
1030814PRTArtificial SequenceBLyS binding polypeptide 308Ala Asn
Trp Phe Asp Pro Leu Thr Lys Leu Trp Leu Thr Asp1 5
1030914PRTArtificial SequenceBLyS binding polypeptide 309Ala Asn
Trp Phe Asp Pro Leu Thr Lys Leu Trp Leu Pro Asp1 5
1031014PRTArtificial SequenceBLyS binding polypeptide 310Ala Asn
Trp Phe Asp Pro Leu Thr Lys Leu Trp Leu Pro Gly1 5
1031114PRTArtificial SequenceBLyS binding polypeptide 311Ala Asn
Trp Phe Asp Pro Leu Thr Lys Leu Trp Leu Pro Glu1 5
1031214PRTArtificial SequenceBLyS binding polypeptide 312Ala Asn
Trp Phe Asp Pro Leu Thr Lys Leu Trp Leu Pro Ala1 5
1031314PRTArtificial SequenceBLyS binding polypeptide 313Ala Asn
Trp Phe Asp Pro Leu Thr Lys Leu Trp Leu Pro Asn1 5
1031414PRTArtificial SequenceBLyS binding polypeptide 314Ala Asn
Trp Phe Asp Pro Leu Thr Lys Leu Trp Leu Ser Glu1 5
1031514PRTArtificial SequenceBLyS binding polypeptide 315Ala Asn
Trp Phe Asp Pro Leu Thr Lys Leu Trp Leu His Asp1 5
1031614PRTArtificial SequenceBLyS binding polypeptide 316Ala Asn
Trp Phe Asp Pro Leu Thr Lys Leu Trp Leu Val Asp1 5
1031714PRTArtificial SequenceBLyS binding polypeptide 317Ala Tyr
Trp Phe Asp Pro Leu Thr Lys Leu Trp Leu Pro Asp1 5
1031814PRTArtificial SequenceBLyS binding polypeptide 318Ala Tyr
Trp Phe Asp Pro Leu Thr Lys Leu Trp Leu Pro Val1 5
1031914PRTArtificial SequenceBLyS binding polypeptide 319Ala Tyr
Trp Phe Asp Pro Leu Thr Lys Leu Trp Leu Pro Ala1 5
1032014PRTArtificial SequenceBLyS binding polypeptide 320Ala Gln
Trp Phe Asp Pro Leu Thr Lys Leu Trp Leu Pro Asp1 5
1032114PRTArtificial SequenceBLyS binding polypeptide 321Ala His
Trp Phe Asp Pro Leu Thr Lys Leu Trp Leu Pro Asp1 5
1032214PRTArtificial SequenceBLyS binding polypeptide 322Ala Thr
Trp Phe Asp Pro Leu Thr Lys Leu Trp Leu Pro Val1 5
1032314PRTArtificial SequenceBLyS binding polypeptide 323Ala Tyr
Trp Tyr Asp Ser Leu Thr Lys Leu Trp Leu Pro Val1 5
1032414PRTArtificial SequenceBLyS binding polypeptide 324Ala Tyr
Trp Tyr Asp Ser Leu Thr Lys Leu Trp Leu His Asp1 5
1032514PRTArtificial SequenceBLyS binding polypeptide 325Ala Asn
Trp Tyr Asp Ser Leu Thr Lys Leu Trp Ile Pro Asp1 5
1032614PRTArtificial SequenceBLyS binding polypeptide 326Ala Asn
Trp Tyr Asp Ser Leu Thr Lys Leu Trp Leu Pro Val1 5
1032714PRTArtificial SequenceBLyS binding polypeptide 327Ala Asn
Trp Tyr Asp Ser Leu Thr Lys Leu Trp Leu Pro Asp1 5
1032814PRTArtificial SequenceBLyS binding polypeptide 328Ala Asn
Trp Tyr Asp Ser Leu Thr Lys Leu Trp Leu Ala Asp1 5
1032914PRTArtificial SequenceBLyS binding polypeptide 329Ala Asn
Trp Tyr Asp Ser Leu Thr Lys Leu Trp Leu Pro Ala1 5
1033014PRTArtificial SequenceBLyS binding polypeptide 330Ala Asn
Trp Tyr Asp Ser Leu Thr Lys Leu Trp Leu Tyr Glu1 5
1033114PRTArtificial SequenceBLyS binding polypeptide 331Ala Gly
Trp Tyr Asp Ser Leu Thr Lys Leu Trp Leu Pro Asp1 5
1033214PRTArtificial SequenceBLyS binding polypeptide 332Ala Val
Trp Tyr Asp Ser Leu Thr Lys Leu Trp Leu Thr Asp1 5
1033314PRTArtificial SequenceBLyS binding polypeptide 333Ala Asn
Trp Tyr Asp Ala Leu Thr Lys Leu Trp Leu Pro Val1 5
1033414PRTArtificial SequenceBLyS binding polypeptide 334Ala Tyr
Trp Tyr Asp Thr Leu Thr Lys Leu Trp Leu Pro Asn1 5
1033514PRTArtificial SequenceBLyS binding polypeptide 335Ala Phe
Trp Tyr Asp Pro Leu Thr Asn Leu Trp Leu Leu Glu1 5
1033614PRTArtificial SequenceBLyS binding polypeptide 336Ala Tyr
Trp Tyr Asp Pro Leu Thr Gly Leu Trp Leu Leu Val1 5
1033714PRTArtificial SequenceBLyS binding polypeptide 337Ala Tyr
Trp Tyr Asp Pro Leu Thr Gly Leu Trp Leu Leu Tyr1 5
1033814PRTArtificial SequenceBLyS binding polypeptide 338Ala Tyr
Trp Tyr Asp Pro Leu Thr Gly Leu Trp Leu Arg Val1 5
1033914PRTArtificial SequenceBLyS binding polypeptide 339Ala Tyr
Trp Tyr Asp Pro Leu Thr Glu Leu Trp Leu Arg Leu1 5
1034014PRTArtificial SequenceBLyS binding polypeptide 340Ala Met
Trp Tyr Asp Pro Leu Thr Lys Leu Ser Leu Pro Asp1 5
1034114PRTArtificial SequenceBLyS binding polypeptide 341Ala Tyr
Trp Tyr Asp Pro Leu Thr Lys Leu Ser Leu Leu Val1 5
1034214PRTArtificial SequenceBLyS binding polypeptide 342Ala Ile
Trp Tyr Asp Pro Leu Thr Lys Leu Ser Leu Thr Val1 5
1034314PRTArtificial SequenceBLyS binding polypeptide 343Ala Ile
Trp Tyr Asp Pro Leu Thr Lys Leu Ser Leu Leu Val1 5
1034414PRTArtificial SequenceBLyS binding polypeptide 344Ala Asp
Trp Tyr Asp Pro Leu Thr Lys Leu Ser Leu Leu Leu1 5
1034514PRTArtificial SequenceBLyS binding polypeptide 345Ala Tyr
Trp Tyr Asp Pro Leu Thr Lys Leu Arg Leu Leu Glu1 5
1034614PRTArtificial SequenceBLyS binding polypeptide 346Ala Asp
Trp Tyr Asp Pro Leu Thr Lys Leu Arg Leu Leu Val1 5
1034714PRTArtificial SequenceBLyS binding polypeptide 347Ala Asp
Trp Tyr Asp Pro Leu Thr Lys Leu Arg Leu Ile Val1 5
1034814PRTArtificial SequenceBLyS binding polypeptide 348Ala Ile
Trp Tyr Asp Pro Leu Thr Lys Leu Tyr Leu Pro Asp1 5
1034914PRTArtificial SequenceBLyS binding polypeptide 349Ala Ile
Trp Tyr Asp Pro Leu Thr Lys Leu Gly Leu Leu Val1 5
1035014PRTArtificial SequenceBLyS binding polypeptide 350Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Thr Leu Leu Val1 5
1035114PRTArtificial SequenceBLyS binding polypeptide 351Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Leu Leu Pro Asn1 5
1035214PRTArtificial SequenceBLyS binding polypeptide 352Ala Ser
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Phe Pro Asp1 5
1035314PRTArtificial SequenceBLyS binding polypeptide 353Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Phe Pro Asp1 5
1035414PRTArtificial SequenceBLyS binding polypeptide 354Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Phe Ser Asp1 5
1035514PRTArtificial SequenceBLyS binding polypeptide 355Ala Ser
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Phe Pro Val1 5
1035614PRTArtificial SequenceBLyS binding polypeptide 356Ala Asp
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Phe Pro Val1 5
1035714PRTArtificial SequenceBLyS binding polypeptide 357Ala Ser
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Phe Pro Lys1 5
1035814PRTArtificial SequenceBLyS binding polypeptide 358Ala Lys
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Phe Pro Asp1 5
1035914PRTArtificial SequenceBLyS binding polypeptide 359Ala Ser
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Phe Leu Glu1 5
1036014PRTArtificial SequenceBLyS binding polypeptide 360Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Phe Pro Ala1 5
1036114PRTArtificial SequenceBLyS binding polypeptide 361Ala Thr
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Phe Pro Asp1 5
1036214PRTArtificial SequenceBLyS binding polypeptide 362Ala Ile
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Phe Pro Glu1 5
1036314PRTArtificial SequenceBLyS binding polypeptide 363Ala Ile
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Phe Pro Asp1 5
1036414PRTArtificial SequenceBLyS binding polypeptide 364Ala Ile
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Phe Pro Gly1 5
1036514PRTArtificial SequenceBLyS binding polypeptide 365Ala Tyr
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Phe Pro His1 5
1036614PRTArtificial SequenceBLyS binding polypeptide 366Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Phe Pro Val1 5
1036714PRTArtificial SequenceBLyS binding polypeptide 367Ala Tyr
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Phe Pro Asp1 5
1036814PRTArtificial SequenceBLyS binding polypeptide 368Ala Gly
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Phe Pro Asp1 5
1036914PRTArtificial SequenceBLyS binding
polypeptide 369Ala Ile Trp Tyr Asp Pro Leu Thr Lys Leu Trp Phe Pro
Thr1 5 1037014PRTArtificial SequenceBLyS binding polypeptide 370Ala
Lys Trp Tyr Asp Pro Leu Thr Lys Leu Trp Phe Pro Ala1 5
1037114PRTArtificial SequenceBLyS binding polypeptide 371Ala Tyr
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Phe Phe Asp1 5
1037214PRTArtificial SequenceBLyS binding polypeptide 372Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Phe Ala Asp1 5
1037314PRTArtificial SequenceBLyS binding polypeptide 373Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Phe Pro Tyr1 5
1037414PRTArtificial SequenceBLyS binding polypeptide 374Ala Asp
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Phe Arg Asp1 5
1037514PRTArtificial SequenceBLyS binding polypeptide 375Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Val Pro Asp1 5
1037614PRTArtificial SequenceBLyS binding polypeptide 376Ala Asp
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Val Pro Ala1 5
1037714PRTArtificial SequenceBLyS binding polypeptide 377Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Val Pro Asn1 5
1037814PRTArtificial SequenceBLyS binding polypeptide 378Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Val Pro Glu1 5
1037914PRTArtificial SequenceBLyS binding polypeptide 379Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Val Pro Gln1 5
1038014PRTArtificial SequenceBLyS binding polypeptide 380Ala Glu
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Val Pro Lys1 5
1038114PRTArtificial SequenceBLyS binding polypeptide 381Ala Gln
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Val Pro Val1 5
1038214PRTArtificial SequenceBLyS binding polypeptide 382Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Val Pro Tyr1 5
1038314PRTArtificial SequenceBLyS binding polypeptide 383Ala Leu
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Val Pro Tyr1 5
1038414PRTArtificial SequenceBLyS binding polypeptide 384Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Val Pro Gly1 5
1038514PRTArtificial SequenceBLyS binding polypeptide 385Ala Ser
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Ile Pro Tyr1 5
1038614PRTArtificial SequenceBLyS binding polypeptide 386Ala Asp
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Ile Pro Gly1 5
1038714PRTArtificial SequenceBLyS binding polypeptide 387Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Ile Pro Tyr1 5
1038814PRTArtificial SequenceBLyS binding polypeptide 388Ala Lys
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Ile Pro Tyr1 5
1038914PRTArtificial SequenceBLyS binding polypeptide 389Ala Ile
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Ile Pro Asn1 5
1039014PRTArtificial SequenceBLyS binding polypeptide 390Ala Thr
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Ile Pro Gln1 5
1039114PRTArtificial SequenceBLyS binding polypeptide 391Ala Ser
Trp Tyr Asp Pro Leu Thr Asn Leu Trp Val Pro Asp1 5
1039214PRTArtificial SequenceBLyS binding polypeptide 392Ala Tyr
Glu Tyr Asp Pro Leu Thr Asn Leu Trp Leu Leu Tyr1 5
1039314PRTArtificial SequenceBLyS binding polypeptide 393Ala Tyr
Trp Tyr Asp Pro Leu Thr Asn Leu Ser Leu Leu Val1 5
1039414PRTArtificial SequenceBLyS binding polypeptide 394Ala Tyr
Trp Tyr Asp Pro Leu Thr Lys Leu Ser Ile Leu Glu1 5
1039514PRTArtificial SequenceBLyS binding polypeptide 395Ala Asn
Trp Tyr Asp Ser Leu Thr Lys Leu Trp Ile Pro Tyr1 5
1039614PRTArtificial SequenceBLyS binding polypeptide 396Ala His
Trp Phe Asp Pro Leu Thr Gln Leu Lys Ile Arg Val1 5
1039714PRTArtificial SequenceBLyS binding polypeptide 397Ala Tyr
Trp Cys Asp Pro Leu Thr Lys Leu Cys Ile Leu Glu1 5
1039814PRTArtificial SequenceBLyS binding polypeptide 398Ala Asn
Ser Tyr Asp Pro Leu Thr Lys Leu Trp Phe Pro Tyr1 5
1039914PRTArtificial SequenceBLyS binding polypeptide 399Ala Asn
Leu Tyr Asp Pro Leu Thr Lys Leu Trp Val Pro Tyr1 5
1040014PRTArtificial SequenceBLyS binding polypeptide 400Ala Asn
Trp Tyr Asp Ala Leu Thr Lys Leu Trp Leu His Asp1 5
1040114PRTArtificial SequenceBLyS binding polypeptide 401Ala Asn
Trp Tyr Asp Ser Leu Thr Lys Leu Trp Phe Pro Asp1 5
1040214PRTArtificial SequenceBLyS binding polypeptide 402Ala Thr
Ser Tyr Asp Ser Leu Thr Lys Leu Trp Leu Pro Ala1 5
1040314PRTArtificial SequenceBLyS binding polypeptide 403Ala Cys
Trp Tyr Asp Ser Leu Thr Lys Leu Cys His Arg Glu1 5
1040414PRTArtificial SequenceBLyS binding polypeptide 404Ala Ile
Gly Asn Asp Pro Leu Thr Lys Leu Trp Ile Pro Tyr1 5
1040514PRTArtificial SequenceBLyS binding polypeptide 405Ala Asn
Trp Gln Asp Cys Leu Thr Lys Leu Cys Leu Ala Gly1 5
1040614PRTArtificial SequenceBLyS binding polypeptide 406Ala Tyr
Trp Phe Asp Pro Leu Thr Asn Leu Trp Leu Leu Glu1 5
1040714PRTArtificial SequenceBLyS binding polypeptide 407Ala Tyr
Trp Tyr Asp Pro Leu Thr Asn Leu Ser Leu Leu Val1 5
1040814PRTArtificial SequenceBLyS binding polypeptide 408Ala Asn
Cys Phe Asp Ser Leu Thr Arg Leu Trp Leu Cys Asp1 5
1040914PRTArtificial SequenceBLyS binding polypeptide 409Ala Cys
Ala Tyr Asp Ala Leu Thr Lys Leu Cys Leu Pro Ala1 5
1041014PRTArtificial SequenceBLyS binding polypeptide 410Ala Asn
Trp Tyr Asp Pro Leu Thr Asn Leu Ser Leu Leu Leu1 5
1041114PRTArtificial SequenceBLyS binding polypeptide 411Ala Tyr
Trp Tyr Asp Pro Leu Thr Gln Leu Ser Leu Leu Val1 5
1041214PRTArtificial SequenceBLyS binding polypeptide 412Ala Tyr
Arg Tyr Asp Ala Leu Thr Gly Leu Trp Leu Leu Tyr1 5
1041314PRTArtificial SequenceBLyS binding polypeptide 413Ala Tyr
Trp Asn Asp Pro Leu Thr Lys Leu Lys Leu Arg Leu1 5
1041414PRTArtificial SequenceBLyS binding polypeptide 414Ala Tyr
Trp Tyr Asp Pro Leu Thr Gln Leu Ser Leu Leu Val1 5
1041514PRTArtificial SequenceBLyS binding polypeptide 415Ala Tyr
Arg Tyr Asp Ala Leu Thr Gly Leu Trp Leu Leu Tyr1 5
1041614PRTArtificial SequenceBLyS binding polypeptide 416Ala Tyr
Arg Tyr Asp Ser Leu Thr Asn Leu Trp Leu Leu Tyr1 5
1041714PRTArtificial SequenceBLyS binding polypeptide 417Ala Tyr
Trp Tyr Asp Pro Leu Thr Lys Leu Ser Ile Leu Glu1 5
1041814PRTArtificial SequenceBLyS binding polypeptide 418Ala Ser
Cys Tyr Asp Pro Leu Thr Lys Leu Cys Phe Pro Val1 5
1041914PRTArtificial SequenceBLyS binding polypeptide 419Ala Phe
Trp Phe Asp Pro Leu Thr Gly Leu Trp Leu Leu Glu1 5
1042014PRTArtificial SequenceBLyS binding polypeptide 420Ala His
Trp Tyr Asp Pro Leu Thr Lys Leu Ser Ile Arg Val1 5
1042114PRTArtificial SequenceBLyS binding polypeptide 421Ala Pro
Trp Tyr Asp Ser Leu Thr Lys Leu Trp Phe Pro Ser1 5
1042214PRTArtificial SequenceBLyS binding polypeptide 422Ala Asn
Cys Tyr Asp Thr Leu Thr Lys Leu Trp Leu Thr Cys1 5
1042314PRTArtificial SequenceBLyS binding polypeptide 423Ala Asn
Trp Tyr Asp Ser Leu Thr Lys Leu Ser Leu Pro Asp1 5
1042414PRTArtificial SequenceBLyS binding polypeptide 424Ala Tyr
Ala Tyr Asp Phe Leu Thr Gln Leu Ser Leu Pro Asp1 5
1042514PRTArtificial SequenceBLyS binding polypeptide 425Ala Phe
Arg Tyr Asp Ser Leu Thr Gly Leu Trp Leu Arg Tyr1 5
1042614PRTArtificial SequenceBLyS binding polypeptide 426Ala Asn
Cys Tyr Asp Ser Leu Thr Lys Leu Trp Leu Pro Cys1 5
1042714PRTArtificial SequenceBLyS binding polypeptide 427Ala Asn
Gly Tyr Asp Leu Leu Thr Asn Leu Ser Val Ser Asp1 5
1042814PRTArtificial SequenceBLyS binding polypeptide 428Ala Asn
Trp Tyr Asp Pro Leu Thr Arg Leu Trp Ile Pro Val1 5
1042914PRTArtificial SequenceBLyS binding polypeptide 429Ala Leu
Lys Phe Asp Tyr Leu Thr Lys Leu Trp Leu Pro Asp1 5
1043014PRTArtificial SequenceBLyS binding polypeptide 430Ala Tyr
Arg Tyr Asp Ser Leu Thr Lys Leu Trp Leu Pro Gly1 5
1043114PRTArtificial SequenceBLyS binding polypeptide 431Ala Tyr
Cys Tyr Asp Ser Leu Thr Lys Leu Trp Ile Pro Asp1 5
1043214PRTArtificial SequenceBLyS binding polypeptide 432Ala Ser
Trp Glu Asp Ser Leu Thr Lys Leu Trp Leu Ser Lys1 5
1043314PRTArtificial SequenceBLyS binding polypeptide 433Ala Tyr
Trp Tyr Asp Ser Leu Thr Gly Leu Ser Leu Leu Val1 5
1043414PRTArtificial SequenceBLyS binding polypeptide 434Ala Tyr
Trp Tyr Asp Pro Leu Thr Tyr Leu Arg Leu Arg Val1 5
1043514PRTArtificial SequenceBLyS binding polypeptide 435Ala Lys
Cys Tyr Asp Ser Leu Thr Asn Leu Trp Leu Cys Asp1 5
1043610PRTArtificial Sequencecore peptide of high affinity BLyS
binders 436Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu1 5
1043717PRTArtificial SequenceBLyS binding polypeptide 437Ala Asn
Trp Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Asp Gly Gly1 5 10
15Lys43815PRTArtificial SequenceBLyS binding polypeptide 438Trp Tyr
Asp Pro Leu Thr Lys Leu Trp Leu Pro Asp Gly Gly Lys1 5 10
1543913PRTArtificial SequenceBLyS binding polypeptide 439Trp Tyr
Asp Pro Leu Thr Lys Leu Trp Leu Gly Gly Lys1 5 1044017PRTArtificial
SequenceBLyS binding polypeptide 440Ala Asn Trp Tyr Asp Pro Leu Thr
Lys Leu Trp Leu Pro Val Gly Gly1 5 10 15Lys44117PRTArtificial
SequenceBLyS binding polypeptide 441Ala Asn Trp Phe Asp Pro Leu Thr
Lys Leu Trp Leu Pro Asp Gly Gly1 5 10 15Lys44217PRTArtificial
SequenceBLyS binding polypeptide 442Ala Asn Trp Tyr Asp Pro Leu Thr
Lys Leu Ser Leu Pro Asp Gly Gly1 5 10 15Lys44317PRTArtificial
SequenceBLyS binding polypeptide 443Ala Asn Trp Tyr Asp Pro Leu Thr
Lys Leu Trp Phe Pro Asp Gly Gly1 5 10 15Lys44417PRTArtificial
SequenceBLyS binding polypeptide 444Ala Asn Trp Tyr Asp Ser Leu Thr
Lys Leu Trp Leu Pro Asp Gly Gly1 5 10 15Lys445585PRTHomo Sapiens
445Asp Ala His Lys Ser Glu Val Ala His Arg Phe Lys Asp Leu Gly Glu1
5 10 15Glu Asn Phe Lys Ala Leu Val Leu Ile Ala Phe Ala Gln Tyr Leu
Gln 20 25 30Gln Cys Pro Phe Glu Asp His Val Lys Leu Val Asn Glu Val
Thr Glu 35 40 45Phe Ala Lys Thr Cys Val Ala Asp Glu Ser Ala Glu Asn
Cys Asp Lys 50 55 60Ser Leu His Thr Leu Phe Gly Asp Lys Leu Cys Thr
Val Ala Thr Leu65 70 75 80Arg Glu Thr Tyr Gly Glu Met Ala Asp Cys
Cys Ala Lys Gln Glu Pro 85 90 95Glu Arg Asn Glu Cys Phe Leu Gln His
Lys Asp Asp Asn Pro Asn Leu 100 105 110Pro Arg Leu Val Arg Pro Glu
Val Asp Val Met Cys Thr Ala Phe His 115 120 125Asp Asn Glu Glu Thr
Phe Leu Lys Lys Tyr Leu Tyr Glu Ile Ala Arg 130 135 140Arg His Pro
Tyr Phe Tyr Ala Pro Glu Leu Leu Phe Phe Ala Lys Arg145 150 155
160Tyr Lys Ala Ala Phe Thr Glu Cys Cys Gln Ala Ala Asp Lys Ala Ala
165 170 175Cys Leu Leu Pro Lys Leu Asp Glu Leu Arg Asp Glu Gly Lys
Ala Ser 180 185 190Ser Ala Lys Gln Arg Leu Lys Cys Ala Ser Leu Gln
Lys Phe Gly Glu 195 200 205Arg Ala Phe Lys Ala Trp Ala Val Ala Arg
Leu Ser Gln Arg Phe Pro 210 215 220Lys Ala Glu Phe Ala Glu Val Ser
Lys Leu Val Thr Asp Leu Thr Lys225 230 235 240Val His Thr Glu Cys
Cys His Gly Asp Leu Leu Glu Cys Ala Asp Asp 245 250 255Arg Ala Asp
Leu Ala Lys Tyr Ile Cys Glu Asn Gln Asp Ser Ile Ser 260 265 270Ser
Lys Leu Lys Glu Cys Cys Glu Lys Pro Leu Leu Glu Lys Ser His 275 280
285Cys Ile Ala Glu Val Glu Asn Asp Glu Met Pro Ala Asp Leu Pro Ser
290 295 300Leu Ala Ala Asp Phe Val Glu Ser Lys Asp Val Cys Lys Asn
Tyr Ala305 310 315 320Glu Ala Lys Asp Val Phe Leu Gly Met Phe Leu
Tyr Glu Tyr Ala Arg 325 330 335Arg His Pro Asp Tyr Ser Val Val Leu
Leu Leu Arg Leu Ala Lys Thr 340 345 350Tyr Glu Thr Thr Leu Glu Lys
Cys Cys Ala Ala Ala Asp Pro His Glu 355 360 365Cys Tyr Ala Lys Val
Phe Asp Glu Phe Lys Pro Leu Val Glu Glu Pro 370 375 380Gln Asn Leu
Ile Lys Gln Asn Cys Glu Leu Phe Glu Gln Leu Gly Glu385 390 395
400Tyr Lys Phe Gln Asn Ala Leu Leu Val Arg Tyr Thr Lys Lys Val Pro
405 410 415Gln Val Ser Thr Pro Thr Leu Val Glu Val Ser Arg Asn Leu
Gly Lys 420 425 430Val Gly Ser Lys Cys Cys Lys His Pro Glu Ala Lys
Arg Met Pro Cys 435 440 445Ala Glu Asp Tyr Leu Ser Val Val Leu Asn
Gln Leu Cys Val Leu His 450 455 460Glu Lys Thr Pro Val Ser Asp Arg
Val Thr Lys Cys Cys Thr Glu Ser465 470 475 480Leu Val Asn Arg Arg
Pro Cys Phe Ser Ala Leu Glu Val Asp Glu Thr 485 490 495Tyr Val Pro
Lys Glu Phe Asn Ala Glu Thr Phe Thr Phe His Ala Asp 500 505 510Ile
Cys Thr Leu Ser Glu Lys Glu Arg Gln Ile Lys Lys Gln Thr Ala 515 520
525Leu Val Glu Leu Val Lys His Lys Pro Lys Ala Thr Lys Glu Gln Leu
530 535 540Lys Ala Val Met Asp Asp Phe Ala Ala Phe Val Glu Lys Cys
Cys Lys545 550 555 560Ala Asp Asp Lys Glu Thr Cys Phe Ala Glu Glu
Gly Lys Lys Leu Val 565 570 575Ala Ala Ser Gln Ala Ala Leu Gly Leu
580 5854464PRTArtificial Sequencerecurring structural motif of BLyS
binding polypeptides 446Asp Xaa Leu Thr144714PRTArtificial
SequenceBLyS binding polypeptide 447Ala Xaa Xaa Xaa Asp Xaa Leu Thr
Xaa Leu Xaa Xaa Xaa Xaa1 5 1044810PRTArtificial SequenceBLyS
binding polypeptide 448Xaa Xaa Asp Xaa Leu Thr Xaa Leu Xaa Xaa1 5
10449733DNAHomo Sapiens 449gggatccgga gcccaaatct tctgacaaaa
ctcacacatg cccaccgtgc ccagcacctg 60aattcgaggg tgcaccgtca gtcttcctct
tccccccaaa acccaaggac accctcatga 120tctcccggac tcctgaggtc
acatgcgtgg tggtggacgt aagccacgaa gaccctgagg 180tcaagttcaa
ctggtacgtg gacggcgtgg aggtgcataa tgccaagaca aagccgcggg
240aggagcagta caacagcacg taccgtgtgg tcagcgtcct caccgtcctg
caccaggact 300ggctgaatgg caaggagtac aagtgcaagg tctccaacaa
agccctccca acccccatcg 360agaaaaccat ctccaaagcc aaagggcagc
cccgagaacc acaggtgtac accctgcccc 420catcccggga tgagctgacc
aagaaccagg tcagcctgac ctgcctggtc aaaggcttct 480atccaagcga
catcgccgtg gagtgggaga gcaatgggca gccggagaac aactacaaga
540ccacgcctcc cgtgctggac tccgacggct ccttcttcct ctacagcaag
ctcaccgtgg 600acaagagcag gtggcagcag gggaacgtct tctcatgctc
cgtgatgcat gaggctctgc 660acaaccacta cacgcagaag agcctctccc
tgtctccggg taaatgagtg cgacggccgc 720gactctagag gat
73345016PRTArtificial SequenceBLyS binding polypeptide 450Ala Gly
Lys Glu Pro Cys Tyr Phe Tyr Trp Glu Cys Ala Val Ser Gly1 5 10
1545117PRTArtificial SequenceBLyS binding polypeptide 451Ala Gly
Val Pro Phe Cys Asp Leu Leu Thr Lys His Cys Phe Glu Ala1 5 10
15Gly45220PRTArtificial SequenceBLyS binding polypeptide 452Gly Ser
Ser Arg Leu Cys His Met Asp Glu Leu Thr His Val Cys Val1 5 10 15His
Phe Ala Pro 2045321PRTArtificial SequenceBLyS binding polypeptide
453Gly Asp Gly Gly Asn Cys Tyr Thr Asp Ser Leu Thr Lys Leu His Phe1
5 10 15Cys Met Gly Asp Glu 2045414PRTArtificial SequenceBLyS
binding polypeptide 454Gly Tyr Asp Val Leu Thr Lys Leu Tyr Phe Val
Pro Gly Gly1 5 1045514PRTArtificial SequenceBLyS binding
polypeptide 455Trp Thr Asp Ser Leu Thr Gly Leu Trp Phe Pro Asp Gly
Gly1 5 1045612PRTArtificial SequenceBLyS binding polypeptide 456Trp
Tyr Asp Pro Leu Thr Lys Leu Trp Leu Pro Asp1 5 1045710PRTArtificial
SequenceBLyS binding polypeptide 457Trp Tyr Asp Pro
Leu Thr Lys Leu Trp Leu1 5 1045814PRTArtificial SequenceBLyS
binding polypeptide 458Ala Asn Trp Tyr Asp Pro Leu Thr Lys Leu Ser
Leu Pro Asp1 5 1045918PRTArtificial SequenceBLyS binding
polypeptide 459Leu Pro Gly Cys Arg Trp Asp Leu Leu Ile Lys Gln Trp
Val Cys Asp1 5 10 15Pro Leu46018PRTArtificial SequenceBLyS binding
polypeptide 460Xaa Xaa Xaa Cys Xaa Xaa Xaa Leu Leu Xaa Xaa Xaa Xaa
Xaa Cys Xaa1 5 10 15Xaa Xaa46118PRTArtificial SequenceBLyS binding
polypeptide 461Xaa Pro Xaa Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Cys Xaa1 5 10 15Pro Xaa46218PRTArtificial SequenceBLyS binding
polypeptide 462Xaa Xaa Xaa Cys Xaa Trp Xaa Xaa Xaa Xaa Xaa Xaa Trp
Xaa Cys Xaa1 5 10 15Xaa Xaa46318PRTArtificial SequenceBLyS binding
polypeptide 463Xaa Xaa Xaa Cys Xaa Xaa Asp Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Cys Asp1 5 10 15Xaa Xaa46418PRTArtificial SequenceBLyS binding
polypeptide 464Xaa Xaa Xaa Cys Xaa Trp Asp Xaa Leu Xaa Xaa Gln Trp
Xaa Cys Xaa1 5 10 15Xaa Xaa46518PRTArtificial SequenceBLyS binding
polypeptide 465Xaa Xaa Xaa Cys Xaa Trp Asp Xaa Leu Xaa Xaa Xaa Xaa
Val Cys Asp1 5 10 15Xaa Xaa
* * * * *
References