U.S. patent application number 12/962899 was filed with the patent office on 2012-01-12 for compositions comprising multiple bioactive agents, and methods of using the same.
Invention is credited to JUDD M. BERMAN, NACHUM KAPLAN, JOHN D. MENDLEIN, MOLLY B. SCHMID.
Application Number | 20120010127 12/962899 |
Document ID | / |
Family ID | 33033147 |
Filed Date | 2012-01-12 |
United States Patent
Application |
20120010127 |
Kind Code |
A1 |
BERMAN; JUDD M. ; et
al. |
January 12, 2012 |
Compositions Comprising Multiple Bioactive Agents, and Methods of
Using the Same
Abstract
In part, the present invention is directed to compositions
comprising a FabI inhibitor and at least one other bioactive agent.
In another part, the present invention is directed to antibacterial
compositions comprising a compound of formulas I-III and at least
one other antibacterial agent.
Inventors: |
BERMAN; JUDD M.; (TORONTO,
CA) ; SCHMID; MOLLY B.; (TORONTO, CA) ;
MENDLEIN; JOHN D.; (TORONTO, CA) ; KAPLAN;
NACHUM; (TORONTO, CA) |
Family ID: |
33033147 |
Appl. No.: |
12/962899 |
Filed: |
December 8, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11231298 |
Sep 19, 2005 |
7879872 |
|
|
12962899 |
|
|
|
|
PCT/IB04/01261 |
Mar 17, 2004 |
|
|
|
11231298 |
|
|
|
|
60455189 |
Mar 17, 2003 |
|
|
|
60476970 |
Jun 9, 2003 |
|
|
|
60488379 |
Jul 18, 2003 |
|
|
|
Current U.S.
Class: |
514/2.4 ;
514/154; 514/192; 514/200; 514/220; 514/221; 514/23; 514/235.2;
514/264.1; 514/300; 514/302; 514/333; 514/343 |
Current CPC
Class: |
A61K 31/5375 20130101;
A61K 31/4965 20130101; A61K 31/4422 20130101; A61K 31/5377
20130101; A61K 31/4745 20130101; A61K 31/4965 20130101; A61K
31/5375 20130101; A61K 31/5377 20130101; A61K 31/517 20130101; A61K
31/496 20130101; A61K 31/554 20130101; A61K 31/55 20130101; A61K
31/381 20130101; A61P 43/00 20180101; A61P 31/04 20180101; A61K
31/381 20130101; A61K 45/06 20130101; A61K 31/5513 20130101; A61K
31/5513 20130101; A61K 2300/00 20130101; A61K 31/4422 20130101;
A61K 2300/00 20130101; A61K 2300/00 20130101; A61K 2300/00
20130101; A61K 2300/00 20130101; A61K 2300/00 20130101 |
Class at
Publication: |
514/2.4 ;
514/221; 514/302; 514/300; 514/343; 514/235.2; 514/333; 514/264.1;
514/220; 514/200; 514/192; 514/154; 514/23 |
International
Class: |
A61K 38/14 20060101
A61K038/14; A61K 31/437 20060101 A61K031/437; A61K 31/4375 20060101
A61K031/4375; A61K 31/4439 20060101 A61K031/4439; A61P 31/04
20060101 A61P031/04; A61K 31/444 20060101 A61K031/444; A61K 31/519
20060101 A61K031/519; A61K 31/545 20060101 A61K031/545; A61K 31/65
20060101 A61K031/65; A61K 31/70 20060101 A61K031/70; A61K 31/551
20060101 A61K031/551; A61K 31/5377 20060101 A61K031/5377 |
Claims
1. A composition comprising an antibacterial agent and an
anti-infective agent wherein said antibacterial agent substantially
inhibits Fab I.
2. The composition of claim 1, wherein a fractional inhibitory
concentration for the combination of said antibacterial agent and
anti-infective agent is less than or equal to 4 as calculated
against antibiotic resistant strains of bacteria.
3. The pharmaceutical composition of claim 1, wherein said
fractional inhibitory concentration is less than or equal to 2.
4. The composition of claim 2, wherein said bacteria is
Staphylococcus.
5. The composition of claim 3, wherein said antibacterial agent
inhibits Fab I with a MIC of less than about 64 ug/ml.
6. The composition of claim 1 wherein the ratio of antibacterial
agent to anti-infective agent is about 0.01:100 to about
100:0.01.
7. The composition of claim 1 further comprising a pharmaceutically
acceptable carrier or excipient.
8. The composition of claim 1 wherein said anti-infective agent is
an antibiotic.
9. The composition of claim 8, wherein said anti-infective agent
does not substantially inhibit Fab I.
10. The composition of claim 8, wherein said antibiotic is selected
from one or more of the group consisting of cephalosporins,
quinolones, fluoroquinolones, penicillins, penicillins and beta
lactamase inhibitors, carbepenems, monobactams, macrolides,
lincosamines, glycopeptides, rifampin, oxazolidonones,
tetracyclines, aminoglycosides, streptogramins, or
sulfonamides.
11. The composition of claim 8, wherein said antibiotic is a
cephalosporin.
12.-36. (canceled)
37. A method for treating a bacterial infection potentially caused
by a drug resistant bacteria in a patient comprising administering
to a patient in need of such treatment a composition comprising an
antibacterial agent that substantially inhibits Fab I and at least
one additional anti-infective agent.
38. The method of claim 37 wherein said treatment is carried out
for 1 to 60 days.
39. The method of claim 37, wherein said bacterial infection is a
condition selected from the group consisting of endocarditis,
osteomylelitis, meningitis, skin infections, pneumonias,
bacteremias, intra-abdominal infections, genitourinary tract
infections, abscesses, and necrotizing infections.
40. The method of claim 37, wherein the antibacterial agent
inhibits the Fab I activity of a microbe with a K, at least 1 order
of magnitude lower than the K, for inhibiting enoyl CoA hydratase
of a mammal.
41. The method of claim 40, wherein the mammal is a human.
42. A kit comprising the pharmaceutical composition of claim 7 and
instructions for use thereof.
Description
RELATED APPLICATION INFORMATION
[0001] This application is a continuation-in-part of
PCT/IB2004/001261, filed Mar. 17, 2004, which claims priority to
U.S. Provisional Patent Application Nos. 60/455,189, filed Mar. 17,
2003, 60/476,970, filed Jun. 9, 2003, and 60/488,379, filed Jul.
18, 2003. Each of these applications is incorporated herein in
their entirety.
INTRODUCTION
[0002] Infections caused by or related to bacteria are a major
cause of human illness worldwide, and the frequency of resistance
to standard antibiotics has risen dramatically over the last
decade. In particular, the extensive use of methicillin, a
penicillin derivative, has led to the development of
methicillin-resistant bacterial strains. Such methicillin-resistant
microbes, including methicillin-resistant Staphylococcus aureus
(MRSA) and methicillin-resistant Staphlyococcus epidermidis (MRSE),
pose serious threats to hospitalized patients, newborns, and the
elderly. Organisms resistant to methicillin are frequently
resistant to multiple drug classes including cephalosporins,
fluoroquinolones or glycopeptides, thus removing antibacterial
agents of these classes as therapeutic options. For example, in
hospital settings, MRSA is resistant to almost all antibiotics. Of
the approximately 150 marketed antibiotics used today, only five
are approved by the FDA for use against MRSA infections. Hence,
there exists an urgent, unmet medical need and demand for new
agents acting against bacterial targets.
[0003] Examples of potential bacterial targets are those enzymes
involved in fatty acid biosynthesis. While the overall pathway of
saturated fatty acid biosynthesis is similar in all organisms, the
fatty acid synthase (FAS) systems vary considerably with respect to
their structural organization. It is believed that vertebrates and
yeast possess a FAS in which all the enzymatic activities are
encoded on one or two polypeptide chains, respectively, and in both
cases the acyl carrier protein (ACP) participates as part of the
complex. In bacterial, however, it is known that each of the FAS
reactions is catalyzed by a distinct, mono-functional enzyme with
the ACP remaining as a discrete protein. Therefore, it may be
possible to achieve selective inhibition of the bacterial system by
appropriate agents that, for example, target one or more of the FAS
catalyzed systems.
[0004] One such potential bacterial target is the FabI protein.
FabI (previously designated EnvM) is believed to function as an
enoyl-ACP reductase in the final step of the four reactions
involved in each cycle of bacterial fatty acid biosynthesis. It is
believed that in this pathway, the first step is catalyzed by
.beta.-ketoacyl-ACP synthase, which condenses malonyl-ACP with
acetyl-CoA (FabH, synthase III). It is believed that in subsequent
rounds, malonyl-ACP is condensed with the growing-chain acyl-ACP
(FabB and FabF, synthases I and II, respectively). The second step
in the elongation cycle is thought to be ketoester reduction by
NADPH-dependent .beta.-ketoacyl-ACP reductase (FabG). Subsequent
dehydration by .beta.-hydroxyacyl-ACP dehydrase (either FabA or
FabZ) leads to trans-2-enoyl-ACP. Finally, in step four,
trans-2-enoyl-ACP is converted to acyl-ACP by an NADH (or
NADPH)-dependent enoyl-ACP reductase (Fab I). Further rounds of
this cycle, adding two carbon atoms per cycle, would eventually
lead to palmitoyl-ACP (16C), where upon the cycle is stopped
largely due to feedback inhibition of Fab I by palmitoyl-ACP. Thus,
Fab I is believed to be a major biosynthetic enzyme and is a key
regulatory point in the overall synthetic pathway of bacterial
fatty acid biosynthesis.
[0005] In some bacteria it is believed that the final step of fatty
acid biosynthes is catalyzed by Fab I only, in others by FabK, an
NADH and FMN dependent reductase, still others utilize both FabI
and FabK.
[0006] The present invention provides, in part, compositions with
FabI inhibiting properties.
SUMMARY OF INVENTION
[0007] In part, the present invention is directed towards
compositions comprising a FabI inhibitor and at least one other
bioactive agent, such as for example, an anti-infective agent.
[0008] For example, a composition is provided that comprises an
antibacterial agent and an anti-infective agent wherein said
antibacterial agent substantially inhibits Fab I. Compositions
contemplated herein include those where a fractional inhibitory
concentration for the combination of the antibacterial agent and
the anti-infective agent is less than or equal to 4, or less than
or equal to 2, as calculated against antibiotic resistant strains
of bacteria, for example Staphylococcus. Any antibacterial agent of
a composition disclose herein may inhibit FabI with a MIC of less
than about 64 .mu.g/ml. Such compositions may include those where
the ratio of antibacterial agent to anti-infective agent is about
0.01:100 to about 100:0.01.
[0009] In some embodiments, the compositions of the invention
further comprise a pharmaceutically acceptable carrier or
excipient.
[0010] In one embodiment, the present invention relates to
anti-infective compositions comprising a compound of formulas
I-III, disclosed herein, and at least one other anti-infective
agent.
[0011] In some embodiments, fractional amounts of the MIC of each
compound are combined such that the total amount is less than about
one times the MIC of either compound, and the anti-infective
composition of the present invention still inhibit, for example,
bacterial growth. As a non-limiting example, the anti-infective
compositions of the present invention may comprise a compound of
formula I at half its MIC and another anti-infective compound at a
quarter of its MIC, with the combined composition inhibiting
bacterial growth. Other examples using other fractional amounts can
be envisioned by of ordinary skill in the art.
[0012] In one embodiment, the dosage amount of the at least one
other bioactive agent in the compositions of the present invention
is about half the dosage amount when the FabI inhibitor is absent.
In another embodiment, the amount of the at least one other
bioactive agent is less than about half of the amount in the dosage
when the FabI inhibitor is absent. In another embodiment, the
amount of the at least one other bioactive agent is less than about
a quarter of the amount in the dosage when the FabI inhibitor is
absent. In another embodiment, the amount of the at least one other
bioactive agent is less than about a tenth of the amount in the
dosage when the FabI inhibitor is absent.
[0013] In part, the present invention is directed towards
compositions that will affect multiple species, so-called "wide
spectrum" anti-bacterials. Alternatively, subject compositions that
are selective for one or more bacterial or other non-mammalian
species, and not for one or more mammalian species (especially
human), may be identified.
[0014] In one embodiment, the dosage amount of the FabI inhibitor
in the compositions of the present invention is about half the
dosage amount when the at least one other bioactive agent is
absent. In another embodiment, the amount of the FabI inhibitor is
less than about half of the amount in the dosage when the at least
one other bioactive agent is absent. In another embodiment, the
amount of the FabI inhibitor is less than about a quarter of the
amount in the dosage when the at least one other bioactive agent is
absent. In another embodiment, the amount of the FabI inhibitor is
less than about a tenth of the amount in the dosage when the at
least one other bioactive agent is absent.
[0015] The subject compositions may be administered by one of a
variety of means known to those of skill in the art.
[0016] In one embodiment, the anti-infective compositions of the
present invention have a MIC of less than 256 .mu.g/mL against, for
example, one or more drug-resistant bacteria. In other embodiments,
the anti-infective compositions of the present invention may have a
MIC value of less than 128 .mu.g/mL, or even less than 64
.mu.g/mL.
[0017] Non-limiting examples of bacteria that the antibacterial
compositions of the present invention may be used to either destroy
or inhibit the growth of include a member of the genus
Streptococcus, Staphylococcus, Bordetella, Corynebacterium,
Mycobacterium, Neisseria, Haemophilus, Actinomycetes,
Streptomycetes, Nocardia, Enterobacter, Yersinia, Fancisella,
Pasturella, Moraxella, Acinetobacter, Erysipelothrix, Branhamella,
Actinobacillus, Streptobacillus, Listeria, Calymmatobacterium,
Brucella, Bacillus, Clostridium, Treponema, Escherichia,
Salmonella, Kleibsiella, Vibrio, Proteus, Erwinia, Borrelia,
Leptospira, Spirillum, Campylobacter, Shigella, Legionella,
Pseudomonas, Aeromonas, Rickettsia, Chlamydia, Borrelia and
Mycoplasma, and further including, but not limited to, a member of
the species or group, Group A Streptococcus, Group B Streptococcus,
Group C Streptococcus, Group D Streptococcus, Group G
Streptococcus, Streptococcus pneumoniae, Streptococcus pyogenes,
Streptococcus agalactiae, Streptococcus faecalis, Streptococcus
faecium, Streptococcus durans, Neisseria gonorrheae, Neisseria
meningitidis, Staphylococcus aureus, Staphylococcus epidermidis,
Corynebacterium diptheriae, Gardnerella vaginalis, Mycobacterium
tuberculosis, Mycobacterium bovis, Mycobacterium ulcerans,
Mycobacterium leprae, Actinomyctes israelii, Listeria
monocytogenes, Bordetella pertusis, Bordatella parapertusis,
Bordetella bronchiseptica, Escherichia coli, Shigella dysenteriae,
Haemophilus influenzae, Haemophilus aegyptius, Haemophilus
parainfluenzae, Haemophilus ducreyi, Bordetella, Salmonella typhi,
Citrobacter freundii, Proteus mirabilis, Proteus vulgaris, Yersinia
pestis, Kleibsiella pneumoniae, Serratia marcessens, Serratia
liquefaciens, Vibrio cholera, Shigella dysenterii, Shigella
flexneri, Pseudomonas aeruginosa, Franscisella tularensis, Brucella
abortis, Bacillus anthracis, Bacillus cereus, Clostridium
perfringens, Clostridium tetani, Clostridium botulinum, Treponema
pallidum, Rickettsia rickettsii, Helicobacter pylori, Escherichia
coli, Propionibacterium acnes, or Chlamydia trachomitis.
[0018] Non-limiting examples of illnesses caused by a bacterial
infection include otitis media, conjunctivitis, pneumonia,
bacteremia, meningitis, sinusitis, pleural empyema and
endocarditis, and meningitis, such as for example infection of
cerebrospinal fluid.
[0019] In another aspect, the subject compositions may be used to
treat bacterial infections.
[0020] In certain embodiments, the present invention provides
antibacterial compositions of the present invention, and methods of
using the same, for the reduction and abatement of at least one of
the bacteria caused disorders or conditions based on a therapeutic
regimen. In certain aspects, the present invention contemplates
monitoring such disorders or conditions as part of any therapeutic
regimen, which may be administered over the short-term and/or
long-term. These aspects of the invention may be particularly
helpful in preventive care regimes. In certain embodiments, the
present invention is directed to a method for formulating
compositions of the present invention in a pharmaceutically
acceptable excipient.
[0021] In another embodiment of the invention it will be desirable
to include monitoring or diagnostic regimes or kits with subject
antibacterial compositions or methods based on FabI inhibitors and
at least one other bioactive agent described herein, and
instructions for use of these compositions or methods. In yet
another embodiment, a method of disinfecting an inanimate surface
is provided comprising applying to the inanimate surface a
composition of the invention.
[0022] As explained herein in greater detail, the invention will
readily enable the design and implementation of trials in
warm-blooded animals, including humans and mammals, necessary for
easily determining or tailoring the form and dose for any
composition of the present invention.
[0023] These embodiments of the present invention, other
embodiments, and their features and characteristics, will be
apparent from the description, drawings and claims that follow.
BRIEF DESCRIPTION OF DRAWINGS
[0024] FIG. 1 depicts the bacterial fatty acid biosynthesis cycle
via a Type II or dissociated fatty acid synthase system.
[0025] FIG. 2 depicts a simplified view of ene-amide core flanked
by LHS (left-hand side) and RHS (right-hand side) moieties.
[0026] FIGS. 3a-f depict the structures of some of the compounds of
the present invention from the representative list.
[0027] FIG. 4 depicts a 96-well plate layout for assays of
antimicrobial combinations.
[0028] FIG. 5 depicts the compounds of the antibacterial
compositions of the present invention used in the combination
efficacy experiments.
DETAILED DESCRIPTION
Introduction
[0029] The present invention is directed in part towards novel
compositions that inhibit bacterial and/or infective enzymes and/or
enzymes within infectious agents, and methods of making and using
the same. In certain aspects, inhibitors and other compounds of the
invention may be found by a structure-guided medicinal chemistry
effort.
[0030] Bacterial fatty acid biosynthesis is believed to proceed via
a Type II or dissociated fatty acid synthase system, in contrast to
the mammalian Type I system. The overall process is believed to
proceed in two stages--initiation and cyclical elongation.
Enoyl-ACP reductase is part of the elongation cycle, in which
malonyl-ACP is condensed with a growing acyl chain by
.beta.-ketoacyl-ACP synthase (FabB, FabF, FabH). The
.beta.-ketoester is reduced by .beta.-ketoacyl-ACP reductase, which
is then dehydrated to the trans-unsaturated acyl-ACP. The
trans-unsaturated acyl-ACP is then reduced by enoyl-ACP reductase.
(See FIG. 1).
[0031] The enoyl-ACP reductase step is believed to be accomplished
by FabI in E. coli and other gram negative organisms and
Staphylococci. In certain gram-positive organisms, FabI paralogs
exist. In Streptococcus pneumoniae, the enzymatic step is believed
to be accomplished by the FabK protein. In B. subtilis and E.
faecalis, genes encoding both FabI and FabK exist. In Mycobacterium
tuberculosis a FabI paralog termed InhA exists. Enoyl-ACP reductase
is believed to be the enzymatic target of the antimicrobial product
triclosan.
[0032] In certain embodiments, the design of new analogs having
FabI inhibiting properties is based on viewing the analogs as
consisting of a central acrylamide flanked by two relatively
hydrophobic groups, conveniently denoted as left-hand side (LHS)
and right-hand side (RHS). Schematically this is depicted in FIG.
2, where a dumbbell like structure provides one way of viewing
certain of the subject compositions (the central bond
disconnections that is envisioned in a retrosynthetic sense are
shown with dashed lines).
[0033] The invention is also directed to compositions for treating
and preventing infections, including bacterial, viral, fungal,
parasitic or protozal infections. In certain aspects, the
inhibitors and compounds of the invention may be used to treat
bacterial infections, including infections caused by
methicillin-resistant bacterial strains.
[0034] In certain embodiments, the FabI inhibitors and compounds
described herein may be used alone or in combination with
antibiotics, such as cephalosporins, quinolones, penicillins,
macrolides and others, to treat all strains of Staphylococci,
including methicillin-resistant Staphylococcus aureus (MRSA) and
methicillin-resistant Staphylococcus epidermis (MRSE) strains.
[0035] Infectious diseases are an important cause of patient
morbidity and mortality. Bacterial pathogens, in particular, give
rise to a variety of acute and chronic conditions including skin
and skin structure infections, upper and lower respiratory tract
infections and urinary tract infections, and a significant
incidence of life-threatening illnesses such as pneumonia and blood
stream infections. Depending on the severity of illnesses,
diagnosis and treatment may occur in either the community
(outpatient) setting or hospital (inpatient) setting.
[0036] In the community setting, Staphylococcus aureus is an
important causative pathogen for uncomplicated skin and skin
structure infections and for mild to moderately severe upper and
lower respiratory tract infections. Oral treatment of these
conditions has traditionally been managed by penicillins and
macrolides, and more recently by more potent agents such as broad
spectrum cephalosporins, ketolides, and fluoroquinolones. However,
increasing bacterial resistance, most acute among staphylococci,
has rendered many therapeutic options ineffective against infection
caused by resistant staphylococci. The most commonly encountered
staphylococcal phenotype, classified as MRSA (methicillin-resistant
Staphylococcus aureus) is a pathogen frequently resistant to 3 or
more different classes of antimicrobials.
[0037] In the hospital environment, drug resistant staphylococci
exhibit a higher prevalence than in the community and are
implicated in a range of serious to life-threatening illnesses
including complicated skin and skin structure infections, blood
stream infections, upper and lower respiratory tract infections and
disease requiring longer term therapy, e.g., endocarditis and
osteomyelitis. Broad spectrum intravenous agents including
cephalosporins, carbapenems, glyco-and lipopeptides,
fluoroquinolones, and oxazolidinones are often utilized as therapy
for hospitalized patients. Fluoroquinolones and oxazolidinones are
also available as oral formulations.
[0038] The FabI inhibitors and compounds described herein may be
used to treat susceptible and resistant strains of staphylococci
including MRSA. Use of either an oral or an intravenous formulation
of the FabI inhibitors and compounds described herein in a fixed
does combination with agents used to treat infections both in the
community and the hospital setting would afford the following
advantages: fulfill a growing medical need for novel therapies in
the treatment of staphylococcal infections; address medical and
market need for an oral agent in the treatment of community based
staphylococcal infections; provide and augment coverage of
susceptible and resistant strains of staphylococci to currently
used antimicrobials prolonging their clinical utility; provide a
novel bacterial target and mechanism of action; provide no
antagonism of partner antibiotic spectrum of activity; provide the
decreased likelihood of resistance development; provide the
decreased requirement for additional courses of antibiotics due to
initial therapeutic failures; and lower overall incidence of
adverse events due to multiple courses of broad spectrum
antibiotics.
DEFINITIONS
[0039] For convenience, before further description of the present
invention, certain terms employed in the specification, examples
and appended claims are collected here. These definitions should be
read in light of the remainder of the disclosure and understood as
by a person of skill in the art. Unless defined otherwise, all
technical and scientific terms used herein have the same meaning as
commonly understood by a person of ordinary skill in the art.
[0040] The articles "a" and "an" are used herein to refer to one or
to more than one (i.e., to at least one) of the grammatical object
of the article. By way of example, "an element" means one element
or more than one element.
[0041] The terms "comprise" and "comprising" are used in the
inclusive, open sense, meaning that additional elements may be
included.
[0042] The term "including" is used to mean "including but not
limited to". "Including" and "including but not limited to" are
used interchangeably.
[0043] The term "FabI" is art-recognized and refers to bacterial
enzymes believed to function as an enoyl-acyl carrier protein (ACP)
reductase in the final step of the four reactions involved in each
cycle of bacterial fatty acid biosynthesis. The enzyme is believed
to be widely distributed in bacteria and plants.
[0044] The term "enzyme inhibitor" refers to any compound that
prevents an enzyme from effectively carrying out its biochemical
role(s). Therefore a "FabI inhibitor" is any compound that inhibits
FabI from carrying out its biochemical role(s). The amount of
inhibition of the enzyme by any such compound will vary and is
described herein and elsewhere.
[0045] The term "antibiotic agent" shall mean any drug that is
useful in treating, preventing, or otherwise reducing the severity
of any bacterial disorder, or any complications thereof, including
any of the conditions, disease, or complications arising therefrom
and/or described herein. Antibiotic agents include, for example,
cephalosporins, quinolones and fluoroquinolones, penicillins,
penicillins and beta lactamase inhibitors, carbepenems,
monobactams, macrolides and lincosamines, glycopeptides, rifampin,
oxazolidonones, tetracyclines, aminoglycosides, streptogramins,
sulfonamides, and the like. Other general categories of bioactive
agents which may be part of a subject composition include those
agents known to those of skill in the art as antibiotics and that
qualify as (with defined terms being in quotation marks): "drug
articles" recognized in the official United States Pharmacopoeia or
official National Formulary (or any supplement thereto); "new drug"
and "new animal drug" approved by the FDA of the U.S. as those
terms are used in Title 21 of the United States Code; any drug that
requires approval of a government entity, in the U.S. or abroad
("approved drug"); any drug that it is necessary to obtain
regulatory approval so as to comply with 21 U.S.C. .sctn.355(a)
("regulatory approved drug"); any agent that is or was subject to a
human drug application under 21 U.S.C. .sctn.379(g) ("human drug").
(All references to statutory code for this definition refer to such
code as of the original filing date of this provisional
application.) Other bioactive agents are disclosed herein, and are
known to those of skill in the art. In certain embodiments, the
term "bioactive agent," "antibiotic agent," or "anti-infective
agent" does not include an agent that is a FabI inhibitor, so that
the combinations of the present invention in certain instances will
include one agent that is a FabI inhibitor and another agent that
is not.
[0046] The term "synergistic" is art recognized and refers to two
or more components working together so that the total effect is
greater than the sum of the components. One measure of synergism
for antibacterial compounds and other enzyme inhibiting compounds
is described under the section Method for Checkerboard Combination
Studies.
[0047] The term "illness" as used herein refers to any illness
caused by or related to infection by an organism.
[0048] The term "bacterial illness" as used herein refers to any
illness caused by or related to infection by bacteria.
[0049] The term "polynucleotide(s)" is art recognized and refers to
any polyribonucleotide or polydeoxyribonucleotide that may be
unmodified RNA or DNA or modified RNA or DNA. "Polynucleotide(s)"
include, without limitation, single- and double-stranded DNA, DNA
that is a mixture of single- and double-stranded regions or
single-, double- and triple-stranded regions, single- and
double-stranded RNA, and RNA that is mixture of single- and
double-stranded regions, hybrid molecules comprising DNA and RNA
that may be single-stranded or, more typically, double-stranded, or
triple-stranded regions, or a mixture of single- and
double-stranded regions. In addition, "polynucleotide" as used
herein refers to triple-stranded regions comprising RNA or DNA or
both RNA and DNA. The strands in such regions may be from the same
molecule or from different molecules. The regions may include all
of one or more of the molecules, but more typically involve only a
region of some of the molecules. One of the molecules of a
triple-helical region often is an oligonucleotide. As used herein,
the term "polynucleotide(s)" also includes DNAs or RNAs as
described above that comprise one or more modified bases. Thus,
DNAs or RNAs with backbones modified for stability or for other
reasons are "polynucleotide(s)" as that term is intended herein.
Moreover, DNAs or RNAs comprising unusual bases, such as inosine,
or modified bases, such as tritylated bases, to name just two
examples, are polynucleotides as the term is used herein. It will
be appreciated that a great variety of modifications have been made
to DNA and RNA that serve many useful purposes known to those of
skill in the art. The term "polynucleotide(s)" as it is employed
herein embraces such chemically, enzymatically or metabolically
modified forms of polynucleotides, as well as the chemical forms of
DNA and RNA characteristic of viruses and cells, including, for
example, simple and complex cells. "Polynucleotide(s)" also
embraces short polynucleotides often referred to as
oligonucleotide(s).
[0050] The term "polypeptide(s)" is art recognized and refers to
any peptide or protein comprising two or more amino acids joined to
each other by peptide bonds or modified peptide bonds.
"Polypeptide(s)" refers to both short chains, commonly referred to
as peptides, oligopeptides and oligomers and to longer chains
generally referred to as proteins. Polypeptides may comprise amino
acids other than the 20 gene encoded amino acids. "Polypeptide(s)"
include those modified either by natural processes, such as
processing and other post-translational modifications, but also by
chemical modification techniques. Such modifications are well
described in basic texts and in more detailed monographs, as well
as in a voluminous research literature, and they are well known to
those of skill in the art. It will be appreciated that the same
type of modification may be present in the same or varying degree
at several sites in a given polypeptide. Also, a given polypeptide
may comprise many types of modifications. Modifications can occur
anywhere in a polypeptide, including the peptide backbone, the
amino acid side-chains, and the amino or carboxyl termini.
Modifications include, for example, acetylation, acylation,
ADP-ribosylation, amidation, covalent attachment of flavin,
covalent attachment of a heme moiety, covalent attachment of a
nucleotide or nucleotide derivative, covalent attachment of a lipid
or lipid derivative, covalent attachment of phosphotidylinositol,
cross-linking, cyclization, disulfide bond formation,
demethylation, formation of covalent cross-links, formation of
cysteine, formation of pyroglutamate, formylation,
gamma-carboxylation, GPI anchor formation, hydroxylation,
iodination, methylation, myristoylation, oxidation, proteolytic
processing, phosphorylation, prenylation, racemization,
glycosylation, lipid attachment, sulfation, gamma-carboxylation of
glutamic acid residues, hydroxylation and ADP-ribosylation,
selenoylation, sulfation, transfer-RNA mediated addition of amino
acids to proteins, such as arginylation, and ubiquitination. See,
for instance, PROTEINS--STRUCTURE AND MOLECULAR PROPERTIES, 2nd
Ed., T. E. Creighton, W.H. Freeman and Company, New York (1993) and
Wold, F., Posttranslational Protein Modifications: Perspectives and
Prospects, pgs. 1-12 in POSTTRANSLATIONAL COVALENT MODIFICATION OF
PROTEINS, B. C. Johnson, Ed., Academic Press, New York (1983);
Seifter et al., Meth. Enzymol. 182:626-646 (1990) and Rattan et
al., Protein Synthesis: Posttranslational Modifications and Aging,
Ann. N.Y. Acad. Sci. 663: 48-62 (1992). Polypeptides may be
branched or cyclic, with or without branching. Cyclic, branched and
branched circular polypeptides may result from post-translational
natural processes and may be made by entirely synthetic methods, as
well.
[0051] The term "cis" is art-recognized and refers to the
arrangement of two atoms or groups around a double bond such that
the atoms or groups are on the same side of the double bond. C is
configurations are often labeled as (Z) configurations.
[0052] The term "trans" is art-recognized and refers to the
arrangement of two atoms or groups around a double bond such that
the atoms or groups are on the opposite sides of a double bond.
Trans configurations are often labeled as (E) configurations.
[0053] The term "covalent bond" is art-recognized and refers to a
bond between two atoms where electrons are attracted
electrostatically to both nuclei of the two atoms, and the net
effect of increased electron density between the nuclei
counterbalances the internuclear repulsion. The term covalent bond
includes coordinate bonds when the bond is with a metal ion.
[0054] The term "therapeutic agent" is art-recognized and refers to
any chemical moiety that is a biologically, physiologically, or
pharmacologically active substance that acts locally or
systemically in a subject. Examples of therapeutic agents, also
referred to as "drugs", are described in well-known literature
references such as the Merck Index, the Physicians Desk Reference,
and The Pharmacological Basis of Therapeutics, and they include,
without limitation, medicaments; vitamins; mineral supplements;
substances used for the treatment, prevention, diagnosis, cure or
mitigation of a disease or illness; substances which affect the
structure or function of the body; or pro-drugs, which become
biologically active or more active after they have been placed in a
physiological environment. Bioactive agents, such as for example,
anti-infective agents, and Fab I inhibitors are examples of
therapeutic agents.
[0055] The term "therapeutic effect" is art-recognized and refers
to a local or systemic effect in animals, particularly mammals, and
more particularly humans caused by a pharmacologically active
substance. The term thus means any substance intended for use in
the diagnosis, cure, mitigation, treatment or prevention of disease
or in the enhancement of desirable physical or mental development
and/or conditions in an animal or human. The phrase
"therapeutically-effective amount" means that amount of such a
substance that produces some desired local or systemic effect at a
reasonable benefit/risk ratio applicable to any treatment. The
therapeutically effective amount of such substance will vary
depending upon the subject and disease condition being treated, the
weight and age of the subject, the severity of the disease
condition, the manner of administration and the like, which can
readily be determined by one of ordinary skill in the art. For
example, certain compositions of the present invention may be
administered in a sufficient amount to produce a at a reasonable
benefit/risk ratio applicable to such treatment.
[0056] The terms "combinatorial library" or "library" are
art-recognized and refer to a plurality of compounds, which may be
termed "members," synthesized or otherwise prepared from one or
more starting materials by employing either the same or different
reactants or reaction conditions at each reaction in the library.
There are a number of other terms of relevance to combinatorial
libraries (as well as other technologies). The term "identifier
tag" is art-recognized and refers to a means for recording a step
in a series of reactions used in the synthesis of a chemical
library. The term "immobilized" is art-recognized and, when used
with respect to a species, refers to a condition in which the
species is attached to a surface with an attractive force stronger
than attractive forces that are present in the intended environment
of use of the surface, and that act on the species. The term "solid
support" is art-recognized and refers to a material which is an
insoluble matrix, and may (optionally) have a rigid or semi-rigid
surface. The term "linker" is art-recognized and refers to a
molecule or group of molecules connecting a support, including a
solid support or polymeric support, and a combinatorial library
member. The term "polymeric support" is art-recognized and refers
to a soluble or insoluble polymer to which a chemical moiety can be
covalently bonded by reaction with a functional group of the
polymeric support. The term "functional group of a polymeric
support" is art-recognized and refers to a chemical moiety of a
polymeric support that can react with an chemical moiety to form a
polymer-supported amino ester.
[0057] The term "synthetic" is art-recognized and refers to
production by in vitro chemical or enzymatic synthesis.
[0058] The term "meso compound" is art-recognized and refers to a
chemical compound which has at least two chiral centers but is
achiral due to a plane or point of symmetry.
[0059] The term "chiral" is art-recognized and refers to molecules
which have the property of non-superimposability of the mirror
image partner, while the term "achiral" refers to molecules which
are superimposable on their mirror image partner. A "prochiral
molecule" is a molecule which has the potential to be converted to
a chiral molecule in a particular process.
[0060] The term "stereoisomers" is art-recognized and refers to
compounds which have identical chemical constitution, but differ
with regard to the arrangement of the atoms or groups in space. In
particular, "enantiomers" refer to two stereoisomers of a compound
which are non-superimposable mirror images of one another.
"Diastereomers", on the other hand, refers to stereoisomers with
two or more centers of dissymmetry and whose molecules are not
mirror images of one another.
[0061] Furthermore, a "stereoselective process" is one which
produces a particular stereoisomer of a reaction product in
preference to other possible stereoisomers of that product. An
"enantioselective process" is one which favors production of one of
the two possible enantiomers of a reaction product.
[0062] The term "regioisomers" is art-recognized and refers to
compounds which have the same molecular formula but differ in the
connectivity of the atoms. Accordingly, a "regioselective process"
is one which favors the production of a particular regioisomer over
others, e.g., the reaction produces a statistically significant
increase in the yield of a certain regioisomer.
[0063] The term "epimers" is art-recognized and refers to molecules
with identical chemical constitution and containing more than one
stereocenter, but which differ in configuration at only one of
these stereocenters.
[0064] The term "ED.sub.50" is art-recognized. In certain
embodiments, ED.sub.50 means the dose of a drug which produces 50%
of its maximum response or effect, or alternatively, the dose which
produces a pre-determined response in 50% of test subjects or
preparations. The term "LD.sub.50" is art-recognized. In certain
embodiments, LD.sub.50 means the dose of a drug which is lethal in
50% of test subjects. The term "therapeutic index" is an
art-recognized term which refers to the therapeutic index of a
drug, defined as LD.sub.50/ED.sub.50.
[0065] The term "structure-activity relationship" or "(SAR)" is
art-recognized and refers to the way in which altering the
molecular structure of a drug or other compound alters its
interaction with a receptor, enzyme, nucleic acid or other target
and the like.
[0066] The term "agonist" is art-recognized and refers to a
compound that mimics the action of natural transmitter or, when the
natural transmitter is not known, causes changes at the receptor
complex in the absence of other receptor ligands.
[0067] The term "antagonist" is art-recognized and refers to a
compound that binds to a receptor site, but does not cause any
physiological changes unless another receptor ligand is
present.
[0068] The term "competitive antagonist" is art-recognized and
refers to a compound or that binds to a receptor site; its effects
may be overcome by increased concentration of the agonist.
[0069] The term "partial agonist" is art-recognized and refers to a
compound or that binds to a receptor site but does not produce the
maximal effect regardless of its concentration.
[0070] The term "aliphatic" is art-recognized and refers to a
linear, branched, cyclic alkane, alkene, or alkyne. In certain
embodiments, aliphatic groups in the present invention are linear
or branched and have from 1 to about 20 carbon atoms.
[0071] The term "alkyl" is art-recognized, and includes saturated
aliphatic groups, including straight-chain alkyl groups,
branched-chain alkyl groups, cycloalkyl (alicyclic) groups, alkyl
substituted cycloalkyl groups, and cycloalkyl substituted alkyl
groups. In certain embodiments, a straight chain or branched chain
alkyl has about 30 or fewer carbon atoms in its backbone (e.g.,
C.sub.1-C.sub.30 for straight chain, C.sub.3-C.sub.30 for branched
chain), and alternatively, about 20 or fewer. Likewise, cycloalkyls
have from about 3 to about 10 carbon atoms in their ring structure,
and alternatively about 5, 6 or 7 carbons in the ring structure.
The term "alkyl" is also defined to include halosubstituted
alkyls.
[0072] Moreover, the term "alkyl" (or "lower alkyl") includes
"substituted alkyls", which refers to alkyl moieties having
substituents replacing a hydrogen on one or more carbons of the
hydrocarbon backbone. Such substituents may include, for example, a
hydroxyl, a carbonyl (such as a carboxyl, an alkoxycarbonyl, a
formyl, or an acyl), a thiocarbonyl (such as a thioester, a
thioacetate, or a thioformate), an alkoxyl, a phosphoryl, a
phosphonate, a phosphinate, an amino, an amido, an amidine, an
imine, a cyano, a nitro, an azido, a sulfhydryl, an alkylthio, a
sulfate, a sulfonate, a sulfamoyl, a sulfonamido, a sulfonyl, a
heterocyclyl, an aralkyl, or an aromatic or heteroaromatic moiety.
It will be understood by those skilled in the art that the moieties
substituted on the hydrocarbon chain may themselves be substituted,
if appropriate. For instance, the substituents of a substituted
alkyl may include substituted and unsubstituted forms of amino,
azido, imino, amido, phosphoryl (including phosphonate and
phosphinate), sulfonyl (including sulfate, sulfonamido, sulfamoyl
and sulfonate), and silyl groups, as well as ethers, alkylthios,
carbonyls (including ketones, aldehydes, carboxylates, and esters),
--CN and the like. Exemplary substituted alkyls are described
below. Cycloalkyls may be further substituted with alkyls,
alkenyls, alkoxys, alkylthios, aminoalkyls, carbonyl-substituted
alkyls, --CN, and the like.
[0073] The term "aralkyl" is art-recognized and refers to an alkyl
group substituted with an aryl group (e.g., an aromatic or
heteroaromatic group).
[0074] The terms "alkenyl" and "alkynyl" are art-recognized and
refer to unsaturated aliphatic groups analogous in length and
possible substitution to the alkyls described above, but that
contain at least one double or triple bond respectively.
[0075] Unless the number of carbons is otherwise specified, "lower
alkyl" refers to an alkyl group, as defined above, but having from
one to about ten carbons, alternatively from one to about six
carbon atoms in its backbone structure. Likewise, "lower alkenyl"
and "lower alkynyl" have similar chain lengths.
[0076] The term "heteroatom" is art-recognized and refers to an
atom of any element other than carbon or hydrogen. Illustrative
heteroatoms include boron, nitrogen, oxygen, phosphorus, sulfur and
selenium.
[0077] The term "aryl" is art-recognized and refers to 5-, 6- and
7-membered single-ring aromatic groups that may include from zero
to four heteroatoms, for example, benzene, pyrrole, furan,
thiophene, imidazole, oxazole, thiazole, triazole, pyrazole,
pyridine, pyrazine, pyridazine and pyrimidine, and the like. Those
aryl groups having heteroatoms in the ring structure may also be
referred to as "aryl heterocycles" or "heteroaromatics." The
aromatic ring may be substituted at one or more ring positions with
such substituents as described above, for example, halogen, azide,
alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, alkoxyl,
amino, nitro, sulfhydryl, imino, amido, phosphonate, phosphinate,
carbonyl, carboxyl, silyl, ether, alkylthio, sulfonyl, sulfonamido,
ketone, aldehyde, ester, heterocyclyl, aromatic or heteroaromatic
moieties, --CF.sub.3, --CN, or the like. The term "aryl" also
includes polycyclic ring systems having two or more cyclic rings in
which two or more carbons are common to two adjoining rings (the
rings are "fused rings") wherein at least one of the rings is
aromatic, e.g., the other cyclic rings may be cycloalkyls,
cycloalkenyls, cycloalkynyls, aryls and/or heterocyclyls.
[0078] The terms ortho, meta and para are art-recognized and refer
to 1,2-, 1,3- and 1,4-disubstituted benzenes, respectively. For
example, the names 1,2-dimethylbenzene and ortho-dimethylbenzene
are synonymous.
[0079] The terms "heterocyclyl" or "heterocyclic group" are
art-recognized and refer to 3- to about 10-membered ring
structures, alternatively 3- to about 7-membered rings, whose ring
structures include one to four heteroatoms. Heterocycles may also
be polycycles. Heterocyclyl groups include, for example, thiophene,
thianthrene, furan, pyran, isobenzofuran, chromene, xanthene,
phenoxanthene, pyrrole, imidazole, pyrazole, isothiazole,
isoxazole, pyridine, pyrazine, pyrimidine, pyridazine, indolizine,
isoindole, indole, indazole, purine, quinolizine, isoquinoline,
quinoline, phthalazine, naphthyridine, quinoxaline, quinazoline,
cinnoline, pteridine, carbazole, carboline, phenanthridine,
acridine, pyrimidine, phenanthroline, phenazine, phenarsazine,
phenothiazine, furazan, phenoxazine, pyrrolidine, oxolane,
thiolane, oxazole, piperidine, piperazine, morpholine, lactones,
lactams such as azetidinones and pyrrolidinones, sultams, sultones,
and the like. The heterocyclic ring may be substituted at one or
more positions with such substituents as described above, as for
example, halogen, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl,
hydroxyl, amino, nitro, sulfhydryl, imino, amido, phosphonate,
phosphinate, carbonyl, carboxyl, silyl, ether, alkylthio, sulfonyl,
ketone, aldehyde, ester, a heterocyclyl, an aromatic or
heteroaromatic moiety, --CF.sub.3, --CN, or the like.
[0080] The terms "polycyclyl" or "polycyclic group" are
art-recognized and refer to two or more rings (e.g., cycloalkyls,
cycloalkenyls, cycloalkynyls, aryls and/or heterocyclyls) in which
two or more carbons are common to two adjoining rings, e.g., the
rings are "fused rings". Rings that are joined through non-adjacent
atoms are termed "bridged" rings. Each of the rings of the
polycycle may be substituted with such substituents as described
above, as for example, halogen, alkyl, aralkyl, alkenyl, alkynyl,
cycloalkyl, hydroxyl, amino, nitro, sulfhydryl, imino, amido,
phosphonate, phosphinate, carbonyl, carboxyl, silyl, ether,
alkylthio, sulfonyl, ketone, aldehyde, ester, a heterocyclyl, an
aromatic or heteroaromatic moiety, --CF.sub.3, --CN, or the
like.
[0081] The term "carbocycle" is art-recognized and refers to an
aromatic or non-aromatic ring in which each atom of the ring is
carbon.
[0082] The term "nitro" is art-recognized and refers to --NO.sub.2;
the term "halogen" is art-recognized and refers to --F, --Cl, --Br
or --I; the term "sulfhydryl" is art-recognized and refers to --SH;
the term "hydroxyl" means --OH; and the term "sulfonyl" is
art-recognized and refers to --SO.sub.2.sup.-. "Halide" designates
the corresponding anion of the halogens, and "pseudohalide" has the
definition set forth on 560 of "Advanced Inorganic Chemistry" by
Cotton and Wilkinson.
[0083] The terms "amine" and "amino" are art-recognized and refer
to both unsubstituted and substituted amines, e.g., a moiety that
may be represented by the general formulas:
##STR00001##
wherein R50, R51 and R52 each independently represent a hydrogen,
an alkyl, an alkenyl, --(CH.sub.2).sub.m--R61, or R50 and R51,
taken together with the N atom to which they are attached complete
a heterocycle having from 4 to 8 atoms in the ring structure; R61
represents an aryl, a cycloalkyl, a cycloalkenyl, a heterocycle or
a polycycle; and m is zero or an integer in the range of 1 to 8. In
certain embodiments, only one of R50 or R51 may be a carbonyl,
e.g., R50, R51 and the nitrogen together do not form an imide. In
other embodiments, R50 and R51 (and optionally R52) each
independently represent a hydrogen, an alkyl, an alkenyl, or
--(CH.sub.2).sub.m--R61. Thus, the term "alkylamine" includes an
amine group, as defined above, having a substituted or
unsubstituted alkyl attached thereto, i.e., at least one of R50 and
R51 is an alkyl group.
[0084] The term "acylamino" is art-recognized and refers to a
moiety that may be represented by the general formula:
##STR00002##
wherein R50 is as defined above, and R54 represents a hydrogen, an
alkyl, an alkenyl or --(CH.sub.2).sub.m--R61, where m and R61 are
as defined above.
[0085] The term "amido" is art recognized as an amino-substituted
carbonyl and includes a moiety that may be represented by the
general formula:
##STR00003##
wherein R50 and R51 are as defined above. Certain embodiments of
the amide in the present invention will not include imides which
may be unstable.
[0086] The term "alkylthio" refers to an alkyl group, as defined
above, having a sulfur radical attached thereto. In certain
embodiments, the "alkylthio" moiety is represented by one of
--S-alkyl, --S-alkenyl, --S-alkynyl, and
--S--(CH.sub.2).sub.m--R61, wherein m and R61 are defined above.
Representative alkylthio groups include methylthio, ethyl thio, and
the like.
[0087] The term "carbonyl" is art recognized and includes such
moieties as may be represented by the general formulas:
##STR00004##
wherein X50 is a bond or represents an oxygen or a sulfur, and R55
and R56 represents a hydrogen, an alkyl, an alkenyl,
--(CH.sub.2).sub.m--R61 or a pharmaceutically acceptable salt, R56
represents a hydrogen, an alkyl, an alkenyl or
--(CH.sub.2).sub.m--R61, where m and R61 are defined above. Where
X50 is an oxygen and R55 or R56 is not hydrogen, the formula
represents an "ester". Where X50 is an oxygen, and R55 is as
defined above, the moiety is referred to herein as a carboxyl
group, and particularly when R55 is a hydrogen, the formula
represents a "carboxylic acid". Where X50 is an oxygen, and R56 is
hydrogen, the formula represents a "formate". In general, where the
oxygen atom of the above formula is replaced by sulfur, the formula
represents a "thiolcarbonyl" group. Where X50 is a sulfur and R55
or R56 is not hydrogen, the formula represents a "thiolester."
Where X50 is a sulfur and R55 is hydrogen, the formula represents a
"thiolcarboxylic acid." Where X50 is a sulfur and R56 is hydrogen,
the formula represents a "thiolformate." On the other hand, where
X50 is a bond, and R55 is not hydrogen, the above formula
represents a "ketone" group. Where X50 is a bond, and R55 is
hydrogen, the above formula represents an "aldehyde" group.
[0088] The terms "alkoxyl" or "alkoxy" are art-recognized and refer
to an alkyl group, as defined above, having an oxygen radical
attached thereto. Representative alkoxyl groups include methoxy,
ethoxy, propyloxy, tert-butoxy and the like. An "ether" is two
hydrocarbons covalently linked by an oxygen. Accordingly, the
substituent of an alkyl that renders that alkyl an ether is or
resembles an alkoxyl, such as may be represented by one of
--O-alkyl, --O-alkenyl, --O-alkynyl, --O--(CH.sub.2).sub.m--R61,
where m and R61 are described above.
[0089] The term "sulfonate" is art recognized and refers to a
moiety that may be represented by the general formula:
##STR00005##
in which R57 is an electron pair, hydrogen, alkyl, cycloalkyl, or
aryl.
[0090] The term "sulfate" is art recognized and includes a moiety
that may be represented by the general formula:
##STR00006##
in which R57 is as defined above.
[0091] The term "sulfonamido" is art recognized and includes a
moiety that may be represented by the general formula:
##STR00007##
in which R50 and R56 are as defined above.
[0092] The term "sulfamoyl" is art-recognized and refers to a
moiety that may be represented by the general formula:
##STR00008##
in which R50 and R51 are as defined above.
[0093] The term "sulfonyl" is art-recognized and refers to a moiety
that may be represented by the general formula:
##STR00009##
in which R58 is one of the following: hydrogen, alkyl, alkenyl,
alkynyl, cycloalkyl, heterocyclyl, aryl or heteroaryl.
[0094] The term "sulfoxido" is art-recognized and refers to a
moiety that may be represented by the general formula:
##STR00010##
in which R58 is defined above.
[0095] The term "phosphoryl" is art-recognized and may in general
be represented by the formula:
##STR00011##
wherein Q50 represents S or O, and R59 represents hydrogen, a lower
alkyl or an aryl. When used to substitute, e.g., an alkyl, the
phosphoryl group of the phosphorylalkyl may be represented by the
general formulas:
##STR00012##
wherein Q50 and R59, each independently, are defined above, and Q51
represents O, S or N. When Q50 is S, the phosphoryl moiety is a
"phosphorothioate".
[0096] The term "phosphoramidite" is art-recognized and may be
represented in the general formulas:
##STR00013##
wherein Q51, R50, R51 and R59 are as defined above.
[0097] The term "phosphonamidite" is art-recognized and may be
represented in the general formulas:
##STR00014##
wherein Q51, R50, R51 and R59 are as defined above, and R60
represents a lower alkyl or an aryl.
[0098] Analogous substitutions may be made to alkenyl and alkynyl
groups to produce, for example, aminoalkenyls, aminoalkynyls,
amidoalkenyls, amidoalkynyls, iminoalkenyls, iminoalkynyls,
thioalkenyls, thioalkynyls, carbonyl-substituted alkenyls or
alkynyls.
[0099] The definition of each expression, e.g. alkyl, m, n, and the
like, when it occurs more than once in any structure, is intended
to be independent of its definition elsewhere in the same
structure.
[0100] The term "selenoalkyl" is art-recognized and refers to an
alkyl group having a substituted seleno group attached thereto.
Exemplary "selenoethers" which may be substituted on the alkyl are
selected from one of --Se-alkyl, --Se-alkenyl, --Se-alkynyl, and
--Se--(CH.sub.2).sub.m--R61, m and R61 being defined above.
[0101] The terms triflyl, tosyl, mesyl, and nonaflyl are
art-recognized and refer to trifluoromethanesulfonyl,
p-toluenesulfonyl, methanesulfonyl, and nonafluorobutanesulfonyl
groups, respectively. The terms triflate, tosylate, mesylate, and
nonaflate are art-recognized and refer to trifluoromethanesulfonate
ester, p-toluenesulfonate ester, methanesulfonate ester, and
nonafluorobutanesulfonate ester functional groups and molecules
that contain said groups, respectively.
[0102] The abbreviations Me, Et, Ph, Tf, Nf, Ts, and Ms represent
methyl, ethyl, phenyl, trifluoromethanesulfonyl,
nonafluorobutanesulfonyl, p-toluenesulfonyl and methanesulfonyl,
respectively. A more comprehensive list of the abbreviations
utilized by organic chemists of ordinary skill in the art appears
in the first issue of each volume of the Journal of Organic
Chemistry; this list is typically presented in a table entitled
Standard List of Abbreviations.
[0103] Certain compounds contained in compositions of the present
invention may exist in particular geometric or stereoisomeric
forms. In addition, polymers of the present invention may also be
optically active. The present invention contemplates all such
compounds, including cis- and trans-isomers, R- and S-enantiomers,
diastereomers, (D)-isomers, (L)-isomers, the racemic mixtures
thereof, and other mixtures thereof, as falling within the scope of
the invention. Additional asymmetric carbon atoms may be present in
a substituent such as an alkyl group. All such isomers, as well as
mixtures thereof, are intended to be included in this
invention.
[0104] If, for instance, a particular enantiomer of compound of the
present invention is desired, it may be prepared by asymmetric
synthesis, or by derivation with a chiral auxiliary, where the
resulting diastereomeric mixture is separated and the auxiliary
group cleaved to provide the pure desired enantiomers.
Alternatively, where the molecule contains a basic functional
group, such as amino, or an acidic functional group, such as
carboxyl, diastereomeric salts are formed with an appropriate
optically-active acid or base, followed by resolution of the
diastereomers thus formed by fractional crystallization or
chromatographic means well known in the art, and subsequent
recovery of the pure enantiomers.
[0105] It will be understood that "substitution" or "substituted
with" includes the implicit proviso that such substitution is in
accordance with permitted valence of the substituted atom and the
substituent, and that the substitution results in a stable
compound, e.g., which does not spontaneously undergo transformation
such as by rearrangement, cyclization, elimination, or other
reaction.
[0106] The term "substituted" is also contemplated to include all
permissible substituents of organic compounds. In a broad aspect,
the permissible substituents include acyclic and cyclic, branched
and unbranched, carbocyclic and heterocyclic, aromatic and
nonaromatic substituents of organic compounds. Illustrative
substituents include, for example, those described herein above.
The permissible substituents may be one or more and the same or
different for appropriate organic compounds. For purposes of this
invention, the heteroatoms such as nitrogen may have hydrogen
substituents and/or any permissible substituents of organic
compounds described herein which satisfy the valences of the
heteroatoms. This invention is not intended to be limited in any
manner by the permissible substituents of organic compounds.
[0107] For purposes of this invention, the chemical elements are
identified in accordance with the Periodic Table of the Elements,
CAS version, Handbook of Chemistry and Physics, 67th Ed., 1986-87,
inside cover. Also for purposes of this invention, the term
"hydrocarbon" is contemplated to include all permissible compounds
having at least one hydrogen and one carbon atom. In a broad
aspect, the permissible hydrocarbons include acyclic and cyclic,
branched and unbranched, carbocyclic and heterocyclic, aromatic and
nonaromatic organic compounds that may be substituted or
unsubstituted.
[0108] The term "protecting group" is art-recognized and refers to
temporary substituents that protect a potentially reactive
functional group from undesired chemical transformations. Examples
of such protecting groups include esters of carboxylic acids, silyl
ethers of alcohols, and acetals and ketals of aldehydes and
ketones, respectively. The field of protecting group chemistry has
been reviewed by Greene and Wuts in Protective Groups in Organic
Synthesis (2.sup.nd ed., Wiley: New York, 1991).
[0109] The term "hydroxyl-protecting group" is art-recognized and
refers to those groups intended to protect a hydrozyl group against
undesirable reactions during synthetic procedures and includes, for
example, benzyl or other suitable esters or ethers groups known in
the art.
[0110] The term "carboxyl-protecting group" is art-recognized and
refers to those groups intended to protect a carboxylic acid group,
such as the C-terminus of an amino acid or peptide or an acidic or
hydroxyl azepine ring substituent, against undesirable reactions
during synthetic procedures and includes. Examples for protecting
groups for carboxyl groups involve, for example, benzyl ester,
cyclohexyl ester, 4-nitrobenzyl ester, t-butyl ester,
4-pyridylmethyl ester, and the like.
[0111] The term "amino-blocking group" is art-recognized and refers
to a group which will prevent an amino group from participating in
a reaction carried out on some other functional group, but which
can be removed from the amine when desired. Such groups are
discussed by in Ch. 7 of Greene and Wuts, cited above, and by
Barton, Protective Groups in Organic Chemistry ch. 2 (McOmie, ed.,
Plenum Press, New York, 1973). Examples of suitable groups include
acyl protecting groups such as, to illustrate, formyl, dansyl,
acetyl, benzoyl, trifluoroacetyl, succinyl, methoxysuccinyl, benzyl
and substituted benzyl such as 3,4-dimethoxybenzyl, o-nitrobenzyl,
and triphenylmethyl; those of the formula --COOR where R includes
such groups as methyl, ethyl, propyl, isopropyl,
2,2,2-trichloroethyl, 1-methyl-1-phenylethyl, isobutyl, t-butyl,
t-amyl, vinyl, allyl, phenyl, benzyl, p-nitrobenzyl, o-nitrobenzyl,
and 2,4-dichlorobenzyl; acyl groups and substituted acyl such as
formyl, acetyl, chloroacetyl, dichloroacetyl, trichloroacetyl,
trifluoroacetyl, benzoyl, and p-methoxybenzoyl; and other groups
such as methanesulfonyl, p-toluenesulfonyl, p-bromobenzenesulfonyl,
p-nitrophenylethyl, and p-toluenesulfonyl-aminocarbonyl. Preferred
amino-blocking groups are benzyl (--CH.sub.2C.sub.6H.sub.5), acyl
[C(O)R1] or SiR1.sub.3 where R1 is C.sub.1-C.sub.4 alkyl,
halomethyl, or 2-halo-substituted-(C.sub.2-C.sub.4 alkoxy),
aromatic urethane protecting groups as, for example,
carbonylbenzyloxy (Cbz); and aliphatic urethane protecting groups
such as t-butyloxycarbonyl (Boc) or 9-fluorenylmethoxycarbonyl
(FMOC).
[0112] The definition of each expression, e.g. lower alkyl, m, n, p
and the like, when it occurs more than once in any structure, is
intended to be independent of its definition elsewhere in the same
structure.
[0113] The term "electron-withdrawing group" is art-recognized, and
refers to the tendency of a substituent to attract valence
electrons from neighboring atoms, i.e., the substituent is
electronegative with respect to neighboring atoms. A quantification
of the level of electron-withdrawing capability is given by the
Hammett sigma (.sigma.) constant. This well known constant is
described in many references, for instance, March, Advanced Organic
Chemistry 251-59 (McGraw Hill Book Company: New York, 1977). The
Hammett constant values are generally negative for electron
donating groups (.sigma.(P)=-0.66 for NH.sub.2) and positive for
electron withdrawing groups (.sigma.(P)=0.78 for a nitro group),
.sigma.(P) indicating para substitution. Exemplary
electron-withdrawing groups include nitro, acyl, formyl, sulfonyl,
trifluoromethyl, cyano, chloride, and the like. Exemplary
electron-donating groups include amino, methoxy, and the like.
[0114] The term "amino acid" is art-recognized and refers to all
compounds, whether natural or synthetic, which include both an
amino functionality and an acid functionality, including amino acid
analogs and derivatives.
[0115] The terms "amino acid residue" and "peptide residue" are
art-recognized and refer to an amino acid or peptide molecule
without the --OH of its carboxyl group.
[0116] The term "amino acid residue" further includes analogs,
derivatives and congeners of any specific amino acid referred to
herein, as well as C-terminal or N-terminal protected amino acid
derivatives (e.g. modified with an N-terminal or C-terminal
protecting group).
[0117] The names of the natural amino acids are abbreviated herein
in accordance with the recommendations of IUPAC-IUB.
[0118] A "reversed" or "retro" peptide sequence as disclosed herein
refers to that part of an overall sequence of covalently-bonded
amino acid residues (or analogs or mimetics thereof) wherein the
normal carboxyl-to amino direction of peptide bond formation in the
amino acid backbone has been reversed such that, reading in the
conventional left-to-right direction, the amino portion of the
peptide bond precedes (rather than follows) the carbonyl portion.
See, generally, Goodman et al. Accounts of Chem. Res. 12:423
(1979).
[0119] The reversed orientation peptides described herein include
(a) those wherein one or more amino-terminal residues are converted
to a reversed ("rev") orientation (thus yielding a second "carboxyl
terminus" at the left-most portion of the molecule), and (b) those
wherein one or more carboxyl-terminal residues are converted to a
reversed ("rev") orientation (yielding a second "amino terminus" at
the right-most portion of the molecule). A peptide (amide) bond
cannot be formed at the interface between a normal orientation
residue and a reverse orientation residue.
[0120] Therefore, certain reversed peptide compounds of the
invention may be formed by utilizing an appropriate amino acid
mimetic moiety to link the two adjacent portions of the sequences
depicted above utilizing a reversed peptide (reversed amide)
bond.
[0121] The reversed direction of bonding in such compounds will
generally, in addition, require inversion of the enantiomeric
configuration of the reversed amino acid residues in order to
maintain a spatial orientation of side chains that is similar to
that of the non-reversed peptide. The configuration of amino acids
in the reversed portion of the peptides is usually (D), and the
configuration of the non-reversed portion is usually (L). Opposite
or mixed configurations are acceptable when appropriate to optimize
a binding activity.
[0122] The term "nucleic acid" is art-recognized and refers to
polynucleotides such as deoxyribonucleic acid (DNA), and, where
appropriate, ribonucleic acid (RNA). The term should also be
understood to include, as equivalents, analogs of either RNA or DNA
made from nucleotide analogs, and, as applicable to the embodiment
being described, single-stranded (such as sense or antisense) and
double-stranded polynucleotides.
[0123] The terms "gene" or "recombinant gene" are art-recognized
and refer to a nucleic acid comprising an open reading frame
encoding a polypeptide, including both exonic and (optionally)
intronic sequences.
[0124] The term "gene construct" is art-recognized and refers to a
vector, plasmid, viral genome or the like which includes an "coding
sequence" for a polypeptide or which is otherwise transcribable to
a biologically active RNA (e.g., antisense, decoy, ribozyme, etc),
can transfect cells, in certain embodiments mammalian cells, and
may cause expression of the coding sequence in cells transfected
with the construct.
[0125] The term "homology" is art-recognized and refers to sequence
similarity between two peptides or between two nucleic acid
molecules.
[0126] The term "operably linked" is art-recognized and refers to
the relationship between two nucleic acid regions, means that they
are functionally related to each other.
[0127] The term "antisense" nucleic acid is art-recognized and
refers to oligonucleotides which specifically hybridize (e.g.,
bind) under cellular conditions with a gene sequence, such as at
the cellular mRNA and/or genomic DNA level, so as to inhibit
expression of that gene, e.g., by inhibiting transcription and/or
translation. The binding may be by conventional base pair
complementarily, or, for example, in the case of binding to DNA
duplexes, through specific interactions in the major groove of the
double helix.
[0128] The term "host cell" is art-recognized and refers to a cell
transduced with a specified transfer vector. The cell is optionally
selected from in vitro cells such as those derived from cell
culture, ex vivo cells, such as those derived from an organism, and
in vivo cells, such as those in an organism. "Recombinant host
cells" refers to cells which have been transformed or transfected
with vectors constructed using recombinant DNA techniques.
[0129] The terms "recombinant protein," "heterologous protein" and
"exogenous protein" are art-recognized and are used interchangeably
to refer to a polypeptide which is produced by recombinant DNA
techniques, wherein generally, DNA encoding the polypeptide is
inserted into a suitable expression vector which is in turn used to
transform a host cell to produce the heterologous protein. That is,
the polypeptide is expressed from a heterologous nucleic acid.
[0130] The term "regulatory element" is art-recognized and refers
to nucleotide sequences (such as DNA sequences) that induce or
control transcription of protein coding sequences with which they
are operably linked. Examples of regulatory elements categorized by
function include initiation signals, enhancers, promoters and the
like. Exemplary regulatory elements are described in Goeddel;
Methods in Enzymology 185 (1990). In certain embodiments,
transcription of a gene or other DNA is under the control of a
promoter sequence (or other regulatory element) which controls the
expression of a coding sequence in a cell-type in which expression
is intended. A variety of promoters categorized by function are
known. The term "tissue-specific promoter" means a DNA sequence
that serves as a promoter, i.e., regulates expression of a selected
DNA sequence operably linked to the promoter, and which effects
expression of the selected DNA sequence in specific cells of a
tissue, such as cells of a urogenital origin, e.g., renal cells, or
cells of a neural origin, e.g., neuronal cells. The term also
covers so-called "leaky" promoters, which regulate expression of a
selected DNA primarily in one tissue, but cause expression in other
tissues as well. The term "inducible" promoter refers to a promoter
which is under environmental or developmental regulation. The term
"constitutive" promoter refers to a promoter which is active under
most environmental and developmental conditions.
[0131] The term "transfection" is art-recognized and refers to the
introduction of a nucleic acid, e.g., an expression vector, into a
recipient cell, which in certain embodiments may be by nucleic
acid-mediated gene transfer. "Transformation," as used with respect
to transfected nucleic acid, is an art-recognized term and refers
to a process in which a cell's genotype is changed as a result of
the cellular uptake of exogenous nucleic acid.
[0132] The term "transfer vector" is art-recognized and refers to a
first nucleic acid molecule to which a second nucleic acid has been
linked, and includes for example plasmids, cosmids or phages (as
discussed in greater detail below). In certain embodiments of the
present invention, the therapeutic agent is the second nucleic
acid. One type of transfer vector is an episome, i.e., a nucleic
acid capable of extra-chromosomal replication.
[0133] In certain embodiments, a transfer vector may be an
"expression vector," which refers to a replicable DNA construct
used to express DNA which encodes the desired protein and which
includes a transcriptional unit comprising an assembly of (i)
genetic element(s) having a regulatory role in gene expression, for
example, promoters, operators, or enhancers, operatively linked to
(ii) a DNA sequence encoding a desired protein which is transcribed
into mRNA and translated into protein, and (iii) appropriate
transcription and translation initiation and termination sequences.
In certain embodiments, the therapeutic agent is the DNA sequence.
The choice of promoter and other regulatory elements generally
varies according to the intended host cell. In general, expression
vectors of utility in recombinant DNA techniques are often in the
form of "plasmids," which refer to circular double stranded DNA
loops which, in their vector form are not bound to the chromosome.
The invention is intended to include such other forms of expression
vectors which serve equivalent functions and which become known in
the art subsequently hereto.
[0134] Certain transfer vectors may contain regulatory elements for
controlling transcription or translation, which may be generally
derived from mammalian, microbial, viral or insect genes. The
ability to replicate in a host, usually conferred by an origin of
replication, and a selection gene to facilitate recognition of
transformants, may additionally be incorporated.
[0135] The design of any transfer vector may depend on such factors
as the choice of the host cell to be transformed and/or the type of
protein desired to be expressed. Moreover, the vector's copy
number, the ability to control that copy number and the expression
of any other proteins encoded by the vector, such as antibiotic
markers (e.g., ampicillin), may also be considered.
[0136] The term "transgenic animal" is art-recognized and refers to
any animal, often a non-human mammal, a bird or an amphibian, in
which one or more of the cells of the animal contain nucleic acid
introduced by way of human intervention, such as by transgenic
techniques well known in the art. Such nucleic acid may be referred
to as a "transgene." The nucleic acid is introduced into the cell,
directly or indirectly by introduction into a precursor of the
cell, by way of deliberate genetic manipulation, such as by
microinjection or by infection with a recombinant virus. The term
genetic manipulation does not include classical cross-breeding, or
in vitro fertilization, but rather is directed to the introduction
of a recombinant DNA molecule. This molecule may be integrated
within a chromosome, or it may be extrachromosomally replicating
DNA. A transgene may be partly or entirely heterologous, i.e.,
foreign, to the transgenic animal or cell into which it is
introduced, or, is homologous to an endogenous gene of the
transgenic animal or cell into which it is introduced, but which is
designed to be inserted, or is inserted, into the animal's genome
in such a way as to alter the genome of the cell into which it is
inserted (e.g., it is inserted at a location which differs from
that of the natural gene or its insertion results in a knockout). A
transgene may also be present in a cell in the form of an episome.
A transgene may include one or more regulatory elements and any
other nucleic acid, such as introns, that may be necessary for
optimal expression of a selected nucleic acid. In certain
embodiments, a transgene comprises a nucleic acid sequence of
interest and one or more regulatory elements for controlling
transcription of the nucleotide sequence encoded by such nucleic
acid sequence, e.g., the regulatory element is operably linked to a
nucleic acid.
[0137] In certain embodiments, the transgene or other therapeutic
agent may be a "gene therapy construct," which is an expression
vector which may alter the phenotype of a cell when taken up by the
cell, or a gene construct. In certain embodiments, the gene therapy
construct may be a "recombinant coding sequence" which encodes a
polypeptide, or is transcribable to an antisense nucleic acid, a
ribozyme, or any other RNA product which alters the phenotype of
the cell in which it is produced. "Recombinant gene" refers to a
genetic construct including a "recombinant coding sequence."
[0138] The term "antibody" is art-recognized and refers to whole
antibodies, e.g., of any isotype (IgG, IgA, IgM, IgE, etc.), and
includes fragments thereof which are also specifically reactive
with a vertebrate, e.g., mammalian, protein. Antibodies may be
fragmented using conventional techniques and the fragments screened
for utility in the same manner as described above for whole
antibodies. Thus, the term includes segments of
proteolytically-cleaved or recombinantly-prepared portions of an
antibody molecule that are capable of selectively reacting with a
certain protein. Non-limiting examples of such proteolytic and/or
recombinant fragments include Fab, F(ab')2, Fab', Fv, and single
chain antibodies (scFv) containing a V[L] and/or V[H] domain joined
by a peptide linker. The scFv's may be covalently or non-covalently
linked to form antibodies having two or more binding sites. The
subject invention includes polyclonal, monoclonal or other purified
preparations of antibodies and recombinant antibodies.
[0139] "Human monoclonal antibodies" or "humanized" murine
antibodies, as the terms are used herein, refer to murine
monoclonal antibodies "humanized" by genetically recombining the
nucleotide sequence encoding the murine Fv region (i.e., containing
the antigen binding site) or the complementarity-determining
regions thereof with the nucleotide sequence encoding at least a
human constant domain region and an Fc region, e.g., in a manner
similar to that disclosed in European Patent Application
Publication No. 0,411,893 A3. Some additional murine residues may
also be retained within the human variable region framework domains
to ensure proper target site binding characteristics. In certain
embodiments, humanized antibodies may decrease the immunoreactivity
of the antibody or polypeptide in the host recipient, permitting an
increase in the half-life and a reduction in the possibility of
adverse immune reactions.
[0140] The term "small molecule" is art-recognized and refers to a
composition which has a molecular weight of less than about 2000
amu, or less than about 1000 amu, and even less than about 500 amu.
Small molecules may be, for example, nucleic acids, peptides,
polypeptides, peptide nucleic acids, peptidomimetics,
carbohydrates, lipids or other organic (carbon containing) or
inorganic molecules. Many pharmaceutical companies have extensive
libraries of chemical and/or biological mixtures, often fungal,
bacterial, or algal extracts, which can be screened with any of the
assays of the invention. The term "small organic molecule" refers
to a small molecule that is often identified as being an organic or
medicinal compound, and does not include molecules that are
exclusively nucleic acids, peptides or polypeptides.
[0141] A "target" shall mean a site to which targeted constructs
bind. A target may be either in vivo or in vitro. In certain
embodiments, a target may be a tumor (e.g., tumors of the brain,
lung (small cell and non-small cell), ovary, prostate, breast and
colon as well as other carcinomas and sarcomas). In other
embodiments, a target may be a site of infection (e.g., by
bacteria, viruses (e.g., HIV, herpes, hepatitis) and pathogenic
fungi (Candida sp.). In still other embodiments, a target may refer
to a molecular structure to which a targeting moiety binds, such as
a hapten, epitope, receptor, dsDNA fragment, carbohydrate or
enzyme. Additionally, a target may be a type of tissue, e.g.,
neuronal tissue, intestinal tissue, pancreatic tissue etc.
[0142] The term "targeting moiety" refers to any molecular
structure which assists the construct in localizing to a particular
target area, entering a target cell(s), and/or binding to a target
receptor. For example, lipids (including cationic, neutral, and
steroidal lipids, virosomes, and liposomes), antibodies, lectins,
ligands, sugars, steroids, hormones, nutrients, and proteins may
serve as targeting moieties.
[0143] The term "modulation" is art-recognized and refers to up
regulation (i.e., activation or stimulation), down regulation
(i.e., inhibition or suppression) of a response, or the two in
combination or apart.
[0144] The term "treating" is art-recognized and refers to curing
as well as ameliorating at least one symptom of any condition or
disease.
[0145] The term "prophylactic" or "therapeutic" treatment is
art-recognized and refers to administration to the host of one or
more of the subject compositions. If it is administered prior to
clinical manifestation of the unwanted condition (e.g., disease or
other unwanted state of the host animal) then the treatment is
prophylactic, i.e., it protects the host against developing the
unwanted condition, whereas if administered after manifestation of
the unwanted condition, the treatment is therapeutic (i.e., it is
intended to diminish, ameliorate or maintain the existing unwanted
condition or side effects therefrom).
[0146] A "patient," "subject" or "host" to be treated by the
subject method may mean either a human or non-human animal.
[0147] The term "mammal" is known in the art, and exemplary mammals
include humans, primates, bovines, porcines, canines, felines, and
rodents (e.g., mice and rats).
[0148] The term "bioavailable" is art-recognized and refers to a
form of the subject invention that allows for it, or a portion of
the amount administered, to be absorbed by, incorporated to, or
otherwise physiologically available to a subject or patient to whom
it is administered.
[0149] The term "pharmaceutically-acceptable salts" is
art-recognized and refers to the relatively non-toxic, inorganic
and organic acid addition salts of compounds, including, for
example, those contained in compositions of the present
invention.
[0150] The term "pharmaceutically acceptable carrier" is
art-recognized and refers to a pharmaceutically-acceptable
material, composition or vehicle, such as a liquid or solid filler,
diluent, excipient, solvent or encapsulating material, involved in
carrying or transporting any subject composition or component
thereof from one organ, or portion of the body, to another organ,
or portion of the body. Each carrier must be "acceptable" in the
sense of being compatible with the subject composition and its
components and not injurious to the patient. Some examples of
materials which may serve as pharmaceutically acceptable carriers
include: (1) sugars, such as lactose, glucose and sucrose; (2)
starches, such as corn starch and potato starch; (3) cellulose, and
its derivatives, such as sodium carboxymethyl cellulose, ethyl
cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt;
(6) gelatin; (7) talc; (8) excipients, such as cocoa butter and
suppository waxes; (9) oils, such as peanut oil, cottonseed oil,
safflower oil, sesame oil, olive oil, corn oil and soybean oil;
(10) glycols, such as propylene glycol; (11) polyols, such as
glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters,
such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering
agents, such as magnesium hydroxide and aluminum hydroxide; (15)
alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18)
Ringer's solution; (19) ethyl alcohol; (20) phosphate buffer
solutions; and (21) other non-toxic compatible substances employed
in pharmaceutical formulations.
[0151] The terms "systemic administration," "administered
systemically," "peripheral administration" and "administered
peripherally" are art-recognized and refer to the administration of
a subject composition, therapeutic or other material other than
directly into the central nervous system, such that it enters the
patient's system and, thus, is subject to metabolism and other like
processes, for example, subcutaneous administration.
[0152] The terms "parenteral administration" and "administered
parenterally" are art-recognized and refer to modes of
administration other than enteral and topical administration,
usually by injection, and includes, without limitation,
intravenous, intramuscular, intraarterial, intrathecal,
intracapsular, intraorbital, intracardiac, intradermal,
intraperitoneal, transtracheal, subcutaneous, subcuticular,
intra-articulare, subcapsular, subarachnoid, intraspinal, and
infrasternal injection and infusion.
[0153] As used herein, "synergy" refers to the in vitro effect of
administration of a combination of an antibacterial agent such as a
Fab I inhibiter, and antiinfective agent such that (1) the
fractional inhibitory concentration (FIC) is less than or equal to
0.5 in an FIC assay described herein; or (2) there is at least a
100-fold (2 log.sub.10) increase in killing at 24 hours for the
combination as compared with the bioactive agent alone in a time
kill curve assay as described herein. An FIC of .ltoreq.0.5 is
evidence of synergy. An additive response has an FIC value of
>0.5 and less than or equal to 1, while an indifferent response
has an FIC value of >1 and .ltoreq.2. An additive effect may
still indicate that the combination of bioactive agent and cationic
peptide are therapeutically useful.
[0154] Contemplated equivalents of the compositions described
herein include compositions which otherwise correspond thereto, and
which have the same general properties thereof (such as other
compositions comprising FabI/Fab K inhibitors), wherein one or more
simple variations of substituents or components are made which do
not adversely affect the characteristics of the compositions of
interest. In general, the components of the compositions of the
present invention may be prepared by the methods illustrated in the
general reaction schema as, for example, described below, or by
modifications thereof, using readily available starting materials,
reagents and conventional synthesis procedures. In these reactions,
it is also possible to make use of variants which are in themselves
known, but are not mentioned here.
FabI Inhibitors
[0155] In one embodiment, the enzyme inhibiting compositions or
compounds, such as Fab I inhibiting compositions or compounds of
the present invention comprise a compound depicted by formula
I:
##STR00015##
[0156] wherein, independently for each occurrence,
[0157] L is a bond, or L is alkyl, alkenyl, or cycloalkyl which may
be substituted with one or more R.sub.1;
[0158] A is a monocyclic ring of 4-7 atoms containing 0-2
heteroatoms, a bicyclic ring of 8-12 atoms containing 0-4
heteroatoms or a tricyclic ring of 8-12 atoms containing 0-6
heteroatoms wherein the rings are independently aliphatic,
aromatic, heteroaryl or heterocyclic in nature, the heteroatoms are
selected from N, S or O and the rings are optionally substituted
with one or more groups selected from C.sub.1-4 alkyl, CH.sub.2OH,
OR'', SR'', CN, N(R'').sub.2, CH.sub.2N(R'').sub.2, NO.sub.2,
CF.sub.3, CO.sub.2R'', CON(R'').sub.2, COR'', NR''C(O)R'', F, Cl,
Br, I and --S(O).sub.rCF.sub.3; wherein R'' is H, alkyl or
alkaryl;
[0159] R.sub.1 is, independently for each occurrence, H, alkyl,
cycloalkyl, aryl, or aralkyl;
[0160] R.sub.2 is
##STR00016## ##STR00017##
[0161] wherein, independently for each occurrence, [0162] B is a
bond, C(R.sub.1).sub.2 or C.dbd.O; [0163] E is O or S; [0164] D is
C(R.sub.1).sub.2, NR.sub.1, C.dbd.O,
##STR00018##
[0164] providing that the two Ds are different; [0165] G is O,
NR.sub.1,
[0165] ##STR00019## [0166] J is NR.sub.1, CH.sub.2,
CH.sub.2CH.sub.2, or O; [0167] M is CR.sub.1 or N; [0168] Q is N or
CH; [0169] U is O, H.sub.2, or CH.sub.2; [0170] X is H, C.sub.1-4
alkyl, CH.sub.2OH, OR.sub.1, SR.sub.1, CN, N(R.sub.1).sub.2,
CH.sub.2N(R.sub.1).sub.2, NO.sub.2, CF.sub.3, CO.sub.2R.sub.1,
CON(R.sub.1).sub.2, COR.sub.1, NR.sub.1C(O)R.sub.1, F, Cl, Br, I,
--S(O).sub.rCF.sub.3,
[0170] ##STR00020## [0171] Z is H, C.sub.1-4 alkyl,
N(R.sub.1).sub.2, NHC(O)R.sub.1, NHCH.sub.2C(O)R.sub.1 or
NHC(O)CH.dbd.CHR.sub.1; [0172] r is 0, 1, or 2; [0173] R.sub.6 is
C(O)OR.sub.1; [0174] R.sub.1 is as previously defined; and [0175] b
is an integer from 0-4;
[0176] R.sub.3 is alkyl or cycloalkyl;
[0177] a is an integer from 0-4; and
[0178] Y.sub.1 is
##STR00021## [0179] wherein, [0180] R.sub.4 is a water solubilizing
group; [0181] R.sub.5 is H, alkyl, or cycloalkyl; and [0182] n is
an integer from 0 to 4, or pharmaceutically acceptable salts
thereof.
[0183] In another embodiment, the enzyme inhibiting compositions of
the present invention may comprise a compound depicted by formula
II:
##STR00022##
[0184] wherein, independently for each occurrence: [0185] A is a
bicyclic or tricyclic heteroaryl ring system of 8-12 atoms, wherein
said bicyclic or tricyclic heteroaryl ring system contains 1-4
heteroatoms selected from [0186] N, S, and O; [0187] R.sub.2 is
alkyl or cycloalkyl; [0188] R.sub.3 is one of the following:
[0188] ##STR00023## [0189] R.sub.4 is H or C.sub.1-4 alkyl; [0190]
R.sub.5 is CH.sub.2 when the bond to which it is attached is a
double bond; or R.sub.5 is H or C.sub.1-4 alkyl when the bond to
which it is attached is a single bond; [0191] R.sub.7 each
independently is H, C.sub.1-4 alkyl, --C.sub.0-6 alkyl-Ar,
--(CH.sub.2).sub.1-3N(R').sub.2, or --(CH.sub.2).sub.1-3O(R');
[0192] R.sub.8 is H or C.sub.1-4 alkyl; [0193] R.sub.10 is
C.sub.1-4 alkyl, N(R').sub.2, NHC(O)R', NHCH.sub.2C(O)R' or
NHC(O)CH.dbd.CHR' [0194] indicates that one of two designated bonds
is a double bond and the other a single bond; [0195] Y is
independently for each occurrence H, C.sub.1-4 alkyl, N(R').sub.2,
NHC(O)R', NHCH.sub.2C(O)R' or NHC(O)CH.dbd.CHR'; [0196] X is H,
C.sub.1-4 alkyl, CH.sub.2OH, OR', SR', CN, N(R').sub.2,
CH.sub.2N(R').sub.2, NO.sub.2, CF.sub.3, CO.sub.2R', CON(R').sub.2,
COR', NR'C(O)R', F, Cl, Br, I or --S(O).sub.rCF.sub.3; [0197] M is
CH.sub.2, --CH.sub.2--CH.sub.2--, or O; [0198] L is CH.sub.2 or
C(O); [0199] E is O or NR'; [0200] R' is independently for each
occurrence H, C.sub.1-6 alkyl, --C.sub.0-6 alkyl-Het or --C.sub.0-6
alkyl-Ar; and [0201] r is 0, 1 or 2; or pharmaceutically acceptable
salts thereof.
[0202] In certain embodiments, A may be one of the following:
##STR00024##
where R.sub.4 is independently for each occurrence H,
C.sub.1-4alkyl, or --N(R').sub.2. In other embodiments, A is an
indole moiety.
[0203] In another embodiment, the enzyme inhibiting compositions of
the present invention may comprise is a compound depicted by
formula III:
##STR00025##
wherein X.sub.1 is
##STR00026##
[0204] A is a bicyclic or tricyclic heteroaryl ring system of 8-12
atoms, wherein said bicyclic or tricyclic heteroaryl ring system
contains 1-4 heteroatoms selected from N, S, and O;
[0205] R.sub.2 is alkyl or cycloalkyl;
[0206] R.sub.3 is one of the following:
##STR00027##
[0207] R.sub.4 is H or C.sub.1-4 alkyl;
[0208] R.sub.7 each independently is H, C.sub.1-4 alkyl,
--C.sub.0-6 alkyl-Ar, --(CH.sub.2).sub.1-3N(R').sub.2, or
--(CH.sub.2).sub.1-3O(R');
[0209] R.sub.8 is H or C.sub.1-4 alkyl;
[0210] R.sub.10 is C.sub.1-4 alkyl, N(R').sub.2, NHC(O)R',
NHCH.sub.2C(O)R' or NHC(O)CH.dbd.CHR'
[0211] indicates that one of two designated bonds is a double bond
and the other a single bond;
[0212] Y is independently for each occurrence H, C.sub.1-4 alkyl,
N(R').sub.2, NHC(O)R', NHCH.sub.2C(O)R' or NHC(O)CH.dbd.CHR';
[0213] X is H, C.sub.1-4 alkyl, CH.sub.2OH, OR', SR', CN,
N(R').sub.2, CH.sub.2N(R').sub.2, NO.sub.2, CF.sub.3, CO.sub.2R',
CON(R').sub.2, COR', NR'C(O)R', F, Cl, Br, I or
--S(O).sub.rCF.sub.3;
[0214] M is CH.sub.2, --CH.sub.2--CH.sub.2--, or O;
[0215] L is CH.sub.2 or C(O);
[0216] E is O or NR';
[0217] R' is independently for each occurrence H, C.sub.1-6 alkyl
--C.sub.0-6 alkyl-Het or --C.sub.0-6 alkyl-Ar;
[0218] R.sub.1 is a water solubilizing group;
[0219] n is an integer in the range 0 to 4;
[0220] r is 0, 1 or 2; or pharmaceutically acceptable salts
thereof.
[0221] In a further embodiment, the present invention includes
antibacterial compositions comprising compounds of formula I and
the attendant definitions, wherein L is a C.sub.2 alkenyl.
[0222] In a further embodiment, the present invention includes
antibacterial compositions comprising compounds of formula I and
the attendant definitions, wherein L is a C.sub.2 alkenyl and
R.sub.2 is
##STR00028##
wherein B is C.dbd.O.
[0223] In a further embodiment, the present invention includes
antibacterial compositions comprising compounds of formula I and
the attendant definitions, wherein L is a C.sub.2 alkenyl and
R.sub.2 is
##STR00029##
wherein G is
##STR00030##
[0224] In a further embodiment, the present invention includes
antibacterial compositions comprising compounds of formula I and
the attendant definitions, wherein L is a C.sub.2 alkenyl and
R.sub.2 is
##STR00031##
wherein R.sub.1 is H.
[0225] In a further embodiment, the present invention includes
antibacterial compositions comprising compounds of formula I and
the attendant definitions, wherein L is a C.sub.2 alkenyl and
R.sub.2 is
##STR00032##
wherein R.sub.1 is H and the D adjacent to B is NR.sub.1.
[0226] In a further embodiment, the present invention includes
antibacterial compositions comprising compounds of formula I and
the attendant definitions, wherein L is a C.sub.2 alkenyl and
R.sub.2 is
##STR00033##
wherein Z is N(R.sub.1).sub.2.
[0227] In a further embodiment, the present invention includes
antibacterial compositions comprising compounds of formula I and
the attendant definitions, wherein L is a C.sub.2 alkenyl and
R.sub.2 is
##STR00034##
wherein Z is N(R.sub.1).sub.2 and Q is
##STR00035##
[0228] In a further embodiment, the present invention includes
antibacterial compositions comprising compounds of formula I and
the attendant definitions, wherein A is a 6 membered monocyclic
aryl.
[0229] In a further embodiment, the present invention includes
antibacterial compositions comprising compounds of formula I and
the attendant definitions, wherein A is a 10 membered bicyclic
aryl.
[0230] In a further embodiment, the present invention includes
antibacterial compositions comprising compounds of formula I and
the attendant definitions, wherein A is a 12 membered tricyclic
aryl.
[0231] In a further embodiment, the present invention includes
antibacterial compositions comprising compounds of formula I and
the attendant definitions, wherein A is an 8 membered bicyclic
heteroaryl.
[0232] In a further embodiment, the present invention includes
antibacterial compositions comprising compounds of formula I and
the attendant definitions, wherein A is a 9 membered bicyclic
heteroaryl.
[0233] In a further embodiment, the present invention includes
antibacterial compositions comprising compounds of formula I and
the attendant definitions, wherein A comprises at least 1
heteroatom.
[0234] In a further embodiment, the present invention includes
antibacterial compositions comprising compounds of formula I and
the attendant definitions, wherein A comprises at least 2
heteroatoms.
[0235] In a further embodiment, the present invention includes
antibacterial compositions comprising compounds of formula I and
the attendant definitions, wherein A comprises at least 1 nitrogen
atom.
[0236] In a further embodiment, the present invention includes
antibacterial compositions comprising compounds of formula I and
the attendant definitions, wherein A comprises at least 1 oxygen
atom.
[0237] In a further embodiment, the present invention includes
antibacterial compositions comprising compounds of formula I and
the attendant definitions, wherein A comprises at least 1 sulfur
atom.
[0238] In a further embodiment, the present invention includes
antibacterial compositions comprising compounds of formula I and
the attendant definitions, wherein A comprises at least 2 sulfur
atoms.
[0239] The antibacterial compositions of the present invention
comprise, but are not limited to, the following compounds: [0240]
(E)-3-(6-aminopyridin-3-yl)-N-(4,6-dichloro-1-methyl-1H-indol-2-ylmethyl)-
-N-methylacrylamide; [0241]
(E)-3-(2-aminopyrimidin-5-yl)-N-(2-methyl-1H-indol-3-ylmethyl)-N-methylac-
rylamide; [0242]
(E)-3-(6-aminopyridin-3-yl)-N-(1-ethyl-1H-indol-3-ylmethyl)-N-methylacryl-
amide; [0243]
(E)-3-(6-aminopyridin-3-yl)-N-(1-isopropyl-1H-indol-3-ylmethyl)-N-methyla-
crylamide; [0244]
(E)-N-methyl-N-(1-methyl-1H-indol-3-ylmethyl)-3-[6-(pyridin-2-ylamino)pyr-
idin-3-yl]acrylamide; [0245]
(E)-3-(6-aminopyridin-3-yl)-N-(1,4-dimethyl-1H-indol-3-ylmethyl)-N-methyl-
acrylamide; [0246]
(E)-3-(6-aminopyridin-3-yl)-N-(3,3-dimethyl-3H-indene-1-ylmethyl)-N-methy-
lacrylamide; [0247]
(E)-3-(2-aminopyrimidin-5-yl)-N-methyl-N-(1-methyl-1H-pyrrolo[2,3-b]pyrid-
in-3-ylmethyl)acrylamide; [0248]
(E)-N-methyl-N-(1-methyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-3-(7-oxo-5,-
6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylamide; [0249]
(E)-N-methyl-N-(2-methylbenzo[b]thiophen-3-ylmethyl)-3-(7-oxo-5,6,7,8-tet-
rahydro-1,8-naphthyridin-3-yl)acrylamide; [0250]
(E)-N-methyl-N-(2-methyl-1H-indol-3-ylmethyl)-3-(3-methyl-2-oxo-1,2,3,4-t-
etrahydropyrido[2,3-d]pyrimidin-6-yl)acrylamide; [0251]
(E)-3-(3H-imidazo[4,5-b]pyridin-6-yl)-N-methyl-N-(1-methyl-1H-indol-3-ylm-
ethyl)acrylamide; [0252]
(E)-3-(3,4-dihydro-2H-pyrido[3,2-b]-1,4-oxazin-7-yl)-N-methyl-N-(1-methyl-
-1H-indol-3-ylmethyl)acrylamide; [0253]
(E)-N-(1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naph-
thyridin-3-yl)acrylamide; [0254]
(E)-3-(6-aminopyridin-3-yl)-N-(5-methoxy-1-methyl-1H-indol-3-ylmethyl)-N--
methylacrylamide; [0255]
(E)-3-(6-aminopyridin-3-yl)-N-(4-methoxy-1-methyl-1H-indol-3-ylmethyl)-N--
methylacrylamide; [0256]
(E)-3-(6-aminopyridin-3-yl)-N-(1H-indol-3-ylmethyl)-N-methylacrylamide
[0257]
(E)-3-(6-aminopyridin-3-yl)-N-(7-chloro-1-methyl-1H-indol-3-ylmeth-
yl)-N-methylacrylamide; [0258]
(E)-N-methyl-N-(1-methyl-1H-indol-2-ylmethyl)-3-[6-[N-(methylaminocarbony-
lmethyl)amino]pyridin-3-yl]acrylamide; [0259]
(E)-3-(6-amino-5-(methoxycarbonyl)pyridin-3-yl)-N-(1-methyl-1H-indol-3-yl-
methyl)-N-methylacrylamide; [0260]
(E)-N-(1-benzyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-
-1,8-naphthyridin-3-yl)acrylamide; [0261]
(E)-3-(6-aminopyridin-3-yl)-N-(7-methoxy-1-methyl-1H-indol-3-ylmethyl)-N--
methylacrylamide; [0262]
(E)-N-methyl-N-(1-methyl-1H-indol-3-ylmethyl)-3-(3-methyl-2-oxo-1,2,3,4-t-
etrahydropyrido[2,3-d]pyrimidin-6-yl)acrylamide; [0263]
(E)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)-N-(1,2,7--
trimethyl-1H-indol-3-ylmethyl)acrylamide; [0264]
(E)-N-[1-(2.sup.1-dimethylaminoethyl)-1H-indol-3-ylmethyl]-N-methyl-3-(7--
oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylamide; [0265]
(E)-N-(7-chloro-1-methyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-t-
etrahydro-1,8-naphthyridin-3-yl)acrylamide; [0266]
(E)-3-[6-amino-5-[[N-methyl-N-(2-methyl-1H-indol-3-ylmethyl)amino]carbony-
lethyl]pyridin-3-yl]-N-methyl-N-(2-methyl-1H-indol-3-ylmethyl)acrylamide;
[0267]
(E)-N-(2,3-dihydro-1H-3a-azacyclopenta[a]indene-8-ylmethyl)-N-meth-
yl-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylamide;
[0268]
(E)-N-methyl-N-(2-methyl-1H-indol-3-ylmethyl)-3-(2-oxo-2,3-dihydro-1H-pyr-
rolo[2,3-b]pyridin-5-yl)acrylamide; [0269]
(E)-N-(1-ethyl-5-fluoro-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-te-
trahydro-1,8-naphthyridin-3-yl)acrylamide; [0270]
(E)-N-(7-chloro-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-
-1,8-naphthyridin-3-yl)acrylamide; [0271]
(E)-3-(6-aminopyridin-3-yl)-N-(6-chloro-1-methyl-1H-indol-3-ylmethyl)-N-m-
ethylacrylamide; [0272]
(E)-N-(5-fluoro-1-methyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-t-
etrahydro-1,8-naphthyridin-3-yl)acrylamide; [0273]
(E)-N-(6-fluoro-1-methyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-t-
etrahydro-1,8-naphthyridin-3-yl)acrylamide; [0274]
(E)-N-(7-fluoro-1-methyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-t-
etrahydro-1,8-naphthyridin-3-yl)acrylamide; [0275]
(E)-3-(6-aminopyridin-3-yl)-N-(7-hydroxy-1-methyl-1H-indol-3-ylmethyl)-N--
methylacrylamide; [0276]
(E)-3-(6-aminopyridin-3-yl)-N-(6-fluoro-1-methyl-1H-indol-3-ylmethyl)-N-m-
ethylacrylamide; [0277]
(E)-3-(6-aminopyridin-3-yl)-N-(5-chloro-1-methyl-1H-indol-3-ylmethyl)-N-m-
ethylacrylamide; [0278]
(E)-3-(6-aminopyridin-3-yl)-N-(4-chloro-1-methyl-1H-indol-3-ylmethyl)-N-m-
ethylacrylamide; [0279]
(E)-N-methyl-3-(8-oxo-6,7,8,9-tetrahydro-5H-pyrido[2,3-b]azepin-3-yl)acry-
lamide; [0280]
(E)-3-[6-[N-(methoxycarbonylmethyl)amino]pyridin-3-yl]-N-methyl-N-(2-meth-
yl-1H-indol-3-ylmethyl)acrylamide; [0281]
(E)-3-[6-[N-(carboxymethyl)amino]pyridin-3-yl]-N-methyl-N-(2-methyl-1H-in-
dol-3-ylmethyl)acrylamide; [0282]
(E)-N-methyl-N-(2-methyl-1H-indol-3-ylmethyl)-3-[6-[N-(methylaminocarbony-
lmethyl)amino]pyridin-3-yl]acrylamide; [0283]
(E)-N-(7-chloro-1-methyl-1H-indol-3-ylmethyl)-3-[6-[N-(methoxycarbonylmet-
hyl)amino]pyridin-3-yl]-N-methylacrylamide; [0284]
(E)-2,N-dimethyl-N-(2-methyl-1H-indol-3-ylmethyl)-3-(7-oxo-5,6,7,8-tetrah-
ydro-1,8-naphthyridin-3-yl)acrylamide; [0285]
(E)-3-[6-[N-(carboxymethyl)amino]pyridin-3-yl]-N-(7-chloro-1-methyl-1H-in-
dol-3-ylmethyl)-N-methylacrylamide; [0286]
(E)-N-(7-chloro-1-methyl-1H-indol-3-ylmethyl)-N-methyl-3-[6-[N-(methylami-
nocarbonylmethyl)amino]pyridin-3-yl]acrylamide; [0287]
(E)-3,N-dimethyl-N-(2-methyl-1H-indol-3-ylmethyl)-3-(7-oxo-5,6,7,8-tetrah-
ydro-1,8-naphthyridin-3-yl)acrylamide; [0288]
(E)-3-(6-aminopyridin-3-yl)-N-(4-fluoro-1-methyl-1H-indol-3-ylmethyl)-N-m-
ethylacrylamide; [0289]
(E)-3-(6-aminopyridin-3-yl)-N-(5-fluoro-1-methyl-1H-indol-3-ylmethyl)-N-m-
ethylacrylamide; [0290]
(E)-3-(6-aminopyridin-3-yl)-N-(7-fluoro-1-methyl-1H-indol-3-ylmethyl)-N-m-
ethylacrylamide; [0291]
(E)-3-(6-aminopyridin-3-yl)-N-(7-methoxycarbonyl-1-methyl-1H-indol-3-ylme-
thyl)-N-methylacrylamide; [0292]
(E)-3-(6-aminopyridin-3-yl)-N-(7-fluoro-1H-indol-3-ylmethyl)-N-methylacry-
lamide; [0293]
(E)-3-(6-aminopyridin-3-yl)-N-methyl-N-(1,2,7-trimethyl-1H-indol-3-ylmeth-
yl)acrylamide; [0294]
(E)-N-methyl-N-(2-methyl-1H-indol-3-ylmethyl)-3-(8-oxo-6,7,8,9-tetrahydro-
-5H-pyrido[2,3-b]azepin-3-yl)acrylamide; [0295]
(E)-3-(6-aminopyridin-3-yl)-N-(7-chloro-1H-indol-3-ylmethyl)-N-methylacry-
lamide; [0296]
(E)-3-(6-aminopyridin-3-yl)-N-(2-chloro-1-methyl-1H-indol-3-ylmethyl)-N-m-
ethylacrylamide; [0297]
(E)-N-(2-chloro-1-methyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-t-
etrahydro-1,8-naphthyridin-3-yl)acrylamide; [0298]
(E)-N-(5-chloro-1-methyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-t-
etrahydro-1,8-naphthyridin-3-yl)acrylamide; [0299]
(E)-N-(4-fluoro-1-methyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-t-
etrahydro-1,8-naphthyridin-3-yl)acrylamide; [0300]
(E)-N-(6-chloro-1-methyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-t-
etrahydro-1,8-naphthyridin-3-yl)acrylamide; [0301]
(E)-3-(6-aminopyridin-3-yl)-N-(4-fluoro-1H-indol-3-ylmethyl)-N-methylacry-
lamide; [0302]
(E)-3-(6-aminopyridin-3-yl)-N-(7-carboxy-1-methyl-1H-indol-3-ylmethyl)-N--
methylacrylamide; [0303]
(E)-N-(1,7-dimethyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrah-
ydro-1,8-naphthyridin-3-yl)acrylamide; [0304]
(E)-N-(1,6-dimethyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrah-
ydro-1,8-naphthyridin-3-yl)acrylamide; [0305]
(E)-N-(1,4-dimethyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrah-
ydro-1,8-naphthyridin-3-yl)acrylamide; [0306]
(E)-N-(3,3-dimethyl-3H-indene-1-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetra-
hydro-1,8-naphthyridin-3-yl)acrylamide; [0307]
(E)-N-(1,5-dimethyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrah-
ydro-1,8-naphthyridin-3-yl)acrylamide; [0308]
(E)-N-(7-methoxy-1-methyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8--
tetrahydro-1,8-naphthyridin-3-yl)acrylamide; [0309]
(E)-N-(7-hydroxy-1-methyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8--
tetrahydro-1,8-naphthyridin-3-yl)acrylamide; [0310]
N-Methyl-N-(2-methyl-1H-indol-3-ylmethyl)-3-(4-methyl-3-oxo-2,3,4,5-tetra-
hydro-1H-pyrido[2,3-e]-1,4-diazepin-7-yl)acrylamide; [0311]
(E)-N-[1-(2-hydroxyethyl)-1H-indol-3-ylmethyl]-N-methyl-3-(7-oxo-5,6,7,8--
tetrahydro-1,8-naphthyridin-3-yl)acrylamide; [0312]
(E)-N-(4-chloro-1-methyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-t-
etrahydro-1,8-naphthyridin-3-yl)acrylamide; [0313]
(E)-N-methyl-N-(1-methyl-1H-indol-3-ylmethyl)-3-(8-oxo-6,7,8,9-tetrahydro-
-5H-pyrido[2,3-b]azepin-3-yl)acrylamide; [0314]
(E)-N-(4-methoxy-1-methyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8--
tetrahydro-1,8-naphthyridin-3-yl)acrylamide; [0315]
(E)-N-(5-methoxy-1-methyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8--
tetrahydro-1,8-naphthyridin-3-yl)acrylamide; [0316]
(E)-N-(6-methoxy-1-methyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8--
tetrahydro-1,8-naphthyridin-3-yl)acrylamide; [0317]
(E)-N-(naphthalen-2-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-1,8-na-
phthyridin-3-yl)acrylamide; [0318]
(E)-N-(quinolin-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naph-
thyridin-3-yl)acrylamide; [0319]
(E)-N-(1-methyl-1H-indol-3-ylmethyl)-N-methyl-3-(6-amino-7-oxo-5,6,7,8-te-
trahydro-1,8-naphthyridin-3-yl)acrylamide; [0320]
(E)-N-(1-ethyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro--
1,8-naphthyridin-3-yl)acrylamide; [0321]
(E)-N-(naphthalen-1-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-1,8-na-
phthyridin-3-yl)acrylamide; [0322]
(E)-N-(benzofuran-2-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-1,8-na-
phthyridin-3-yl)acrylamide; [0323]
(E)-3-(6-aminopyridin-3-yl)-N-(6-methoxycarbonyl-1-methyl-1H-indol-3-ylme-
thyl)-N-methylacrylamide; [0324]
(E)-N-methyl-N-(2-methyl-1H-indol-3-ylmethyl)-3-[3-(2-methoxyethyl)-2-oxo-
-1,2,3,4-tetrahydropyrido[2,3-d]pyrimidin-6-yl]acrylamide; [0325]
(E)-N-(1-methyl-1H-indol-3-ylmethyl)-N-methyl-3-[6-(methoxycarbonyl)-7-ox-
o-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl]acrylamide; [0326]
(E)-3-(6-aminopyridin-3-yl)-N-(1,3-dimethyl-1H-pyrrolo[2,3-b]pyridin-3-yl-
methyl)-N-methylacrylamide; [0327]
(E)-N-(1,3-dimethyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-N-methyl-3-(7-ox-
o-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylamide; [0328]
(E)-3-(6-aminopyridin-3-yl)-N-methyl-N-(1-methyl-1H-pyrrolo[2,3-c]pyridin-
-3-ylmethyl)acrylamide; [0329]
(E)-3-(6-aminopyridin-3-yl)-N-methyl-N-(1-methyl-1H-pyrrolo[3,2-c]pyridin-
-3-ylmethyl)acrylamide; [0330]
(E)-3-(6-aminopyridin-3-yl)-N-methyl-N-(1-methyl-1H-pyrrolo[3,2-b]pyridin-
-3-ylmethyl)acrylamide; [0331]
(E)-N-methyl-N-(1-methyl-1H-pyrrolo[2,3-c]pyridin-3-ylmethyl)-3-(7-oxo-5,-
6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylamide; [0332]
(E)-N-methyl-N-(1-methyl-1H-pyrrolo[3,2-c]pyridin-3-ylmethyl)-3-(7-oxo-5,-
6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylamide; [0333]
(E)-N-methyl-N-(1-methyl-1H-pyrrolo[3,2-b]pyridin-3-ylmethyl)-3-(7-oxo-5,-
6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylamide; [0334]
(E)-3-(6-aminopyridin-3-yl)-N-(benzofuran-3-ylmethyl)-N-methylacrylamide;
[0335]
(E)-3-(6-aminopyridin-3-yl)-N-methyl-N-(3-methylbenzofuran-2-ylmet-
hyl)acrylamide; [0336]
(E)-3-(6-aminopyridin-3-yl)-N-methyl-N-(2-methylbenzofuran-3-ylmethyl)acr-
ylamide; [0337]
(E)-N-(benzofuran-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-1,8-na-
phthyridin-3-yl)acrylamide; [0338]
(E)-N-methyl-N-(3-methylbenzofuran-2-ylmethyl)-3-(7-oxo-5,6,7,8-tetrahydr-
o-1,8-naphthyridin-3-yl)acrylamide; [0339]
(E)-N-methyl-N-(2-methylbenzofuran-3-ylmethyl)-3-(7-oxo-5,6,7,8-tetrahydr-
o-1,8-naphthyridin-3-yl)acrylamide; [0340]
(E)-(6-aminopyridin-3-yl)-N-methyl-N-[1-(1-methyl-1H-indol-2-yl)ethyl]acr-
ylamide; [0341]
(E)-(6-aminopyridin-3-yl)-N-methyl-N-[1-(1-methyl-1H-indol-3-yl)ethyl]acr-
ylamide; [0342]
(E)-N-methyl-N-[1-(1-methyl-1H-indol-2-yl)ethyl]-3-(7-oxo-5,6,7,8-tetrahy-
dro-1,8-naphthyridin-3-yl)acrylamide; [0343]
(E)-N-methyl-N-[1-(1-methyl-1H-indol-3-yl)ethyl]-3-(7-oxo-5,6,7,8-tetrahy-
dro-1,8-naphthyridin-3-yl)acrylamide; [0344]
(E)-N-Methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]di-
azepin-7-yl)-N-(1-propyl-naphthalen-2-ylmethyl)acrylamide
hydrochloride; [0345]
(E)-3-(3,3-Dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]-
diazepin-7-yl)-N-methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)acrylamide
hydrochloride; [0346]
(E)-N-Methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]di-
azepin-7-yl)-N-naphthalen-2-ylmethyl-acrylamide hydrochloide;
[0347]
(E)-N-Methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]di-
azepin-7-yl)-N-naphthalen-1-ylmethyl-acrylamide hydrochloride;
[0348]
(E)-N-(4-Acetylamino-benzyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]na-
phthyridin-3-yl)acrylamide; [0349]
(E)-N-(4-Methanesulfonyl-benzyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-[1,-
8]naphthyridin-3-yl)acrylamide; [0350]
(E)-N-(2-Methoxy-naphthalen-1-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahy-
dro-[1,8]naphthyridin-3-yl)acrylamide; [0351]
(E)-N-Methyl-N-(4-methyl-naphthalen-1-ylmethyl)-3-(7-oxo-5,6,7,8-tetrahyd-
ro-[1,8]naphthyridin-3-yl)acrylamide; [0352]
(E)-N-(2,3-Dimethyl-benzyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]nap-
hthyridin-3-yl)acrylamide; [0353]
(E)-N-(4-Isopropyl-benzyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naph-
thyridin-3-yl)acrylamide; [0354]
(E)-N-Indan-5ylmethyl-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyri-
din-3-yl)acrylamide; [0355]
(E)-N-Indan-5ylmethyl-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-py-
rido[2,3-e][1,4]diazepin-7-yl)acrylamide hydrochloide; [0356]
(E)-N-Methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)-3-(4-methyl-2-oxo-2-
,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride; [0357]
(E)-N-(3,5-Dimethoxy-benzyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydr-
o-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide hydrochloride;
[0358]
(E)-N-[2-(1H-Indol-3-yl)-ethyl]-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrah-
ydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide hydrochloride;
[0359]
(E)-N-Methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]di-
azepin-7-yl)-N-(2,4,5-trimethoxy-benzyl)acrylamide hydrochloride;
[0360]
(E)-N-Methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]di-
azepin-7-yl)-N-phenanthren-9-ylmethyl-acrylamide hydrochloride;
[0361]
(E)-N-Acenaphthen-5-ylmethyl-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydr-
o-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide hydrochloride;
[0362]
(E)-N-(4-Methoxy-naphthalen-1ylmethyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-
-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride; [0363]
(E)-N-Benzo[1,3]dioxol-5-ylmethyl-N-methyl-3-(4-methyl-2-oxo-2,3,4-
,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride; [0364]
(E)-N-(2,5-Dimethoxy-benzyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-te-
trahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride; [0365]
(E)-N-Methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e]-
[1,4]diazepin-7-yl)-N-quinolin-4-ylmethyl-acrylamide hydrochloride;
[0366]
(E)-N-(4-Ethoxy-3-methoxy-benzyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetr-
ahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide hydrochloride;
[0367]
(E)-N-(2-Ethoxy-3-methoxy-benzyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetr-
ahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride;
[0368]
(E)-N-(3,4-Dimethyl-benzyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tet-
rahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride; [0369]
(E)-N-Methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e]-
[1,4]diazepin-7-yl)-N-(2,4,6-trimethyl-benzyl)acrylamide
hydrochloride; [0370]
(E)-N-Methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e]-
[1,4]diazepin-7-yl)-N-(2,4,5-trimethyl-benzyl)acrylamide
hydrochloride; [0371]
(E)-N-Methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e]-
[1,4]diazepin-7-yl)-N-quinolin-3-ylmethyl-acrylamide hydrochloride;
[0372]
(E)-N-(3,4-Dimethoxy-benzyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydr-
o-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide hydrochloride;
[0373]
(E)-N-Benzofuran-2-ylmethyl-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-
-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide hydrochloride;
[0374]
(E)-N-Methyl-N-(2-methyl-naphthalen-1-ylmethyl)-3-(4-methyl-2-oxo-2,3,4,5-
-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride; [0375]
(E)-N-Biphenyl-2-ylmethyl-methyl-N-methyl-3-(4-methyl-2-oxo-2,3,4,-
5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride; [0376]
(E)-N-Biphenyl-3-ylmethyl-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetra-
hydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide hydrochloride;
[0377]
(E)-N-(2-Ethoxy-napthalen-1-ylmethyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5--
tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride; [0378]
(E)-N-(2-Ethoxy-benzyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahy-
dro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide hydrochloride;
[0379]
(E)-N-Methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]di-
azepin-7-yl)-N-(2,3,4-trimethoxy-benzyl)acrylamide hydrochloride;
[0380]
(E)-N-(2,3-Dihydro-benzo[1,4]dioxin-6ylmethyl)-N-methyl-3-(4-methyl-2-oxo-
-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride; [0381]
(E)-N-(2,3-Diethoxy-benzyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-
-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide hydrochloride;
[0382]
(E)-N-(3-Ethoxy-2-methoxy-benzyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetr-
ahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide hydrochloride;
[0383]
(E)-N-(2-Ethoxy-3-methyl-benzyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetra-
hydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide hydrochloride;
[0384]
(E)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]di-
azepin-7-yl)-N-quinolin-5ylmethyl-acrylamide hydrochloride; [0385]
(E)-N-(3-Methoxy-2-propoxy-benzyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tet-
rahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride; [0386]
(E)-N-(3-Methoxy-2-isopropoxy-benzyl)-N-methyl-3-(4-methyl-2-oxo-2-
,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride; [0387]
(E)-N-methyl-N-(3-methyl-benzofuran-2-ylmethyl)-3-(4-methyl-2-oxo-2,3,4,5-
-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride; [0388]
(E)-N-(3-Chloro-2-methoxy-benzyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4-
,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride; [0389]
(E)-N-(3-Chloro-2-ethoxy-benzyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,-
5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride; [0390]
(E)-N-(2,3-Dihydro-benzo[1,4]dioxin-5-ylmethyl)-N-methyl-3-(4-meth-
yl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride; [0391]
(E)-N-(4,5-Dimethyl-naphthalen-1-ylmethyl)-N-methyl-3-(4-methyl-2-oxo-2,3-
,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride; [0392]
(E)-N-Methyl-N-(2-methyl-benzofuran-3-ylmethyl)-3-(4-methyl-2-oxo-2,3,4,5-
-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride; [0393]
(E)-N-Methyl-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3-yl)-N-
-quinolin-5-ylmethyl-acrylamide hydrochloride; [0394]
(E)-N-benzyl-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3-yl)-
acrylamide; [0395]
(E)-N-methyl-N-(1-methyl-1H-indol-2-ylmethyl)-3-(4-methyl-2-oxo-2,3,4,5-t-
etrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride; [0396]
(E)-(7-{2-[Methyl-(1-methyl-1H-indol-2-ylmethyl)carbamoyl]vinyl}-2-
-oxo-1,2,3,5-tetrahydro-pyrido[2,3-e][1,4]diazepin-4-yl)acetic acid
ethyl ester hydrochloride; [0397]
(E)-N-(2,3-Dimethoxy-benzyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydr-
o-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide hydrochloride;
[0398]
(E)-N-Methyl-N-(4-methyl-naphthalen-1-ylmethyl)-3-(4-methyl-2-oxo-2,3,4,5-
-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride; [0399]
(E)-N-(2-Methoxy-naphthalen-1-ylmethyl)-N-methyl-3-(4-methyl-2-oxo-
-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride; [0400]
I-(+)-(E)-N-Methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][-
1,4]diazepin-7-yl)-N-(1-naphthalen-1-yl-ethyl)acrylamide
hydrochloride; [0401]
(S)-(-)-(E)-N-Methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrid-
o[2,3-e][1,4]diazepin-7-yl)-N-(1-naphthalen-1-yl-ethyl)acrylamide
hydrochloride; [0402]
(E)-N-Benzo[b]thiophen-2-ylmethyl-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetr-
ahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide hydrochloride;
[0403]
(E)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]di-
azepin-7-yl)-N-(3-trifluoromethyl-benzyl)acrylamide hydrochloride;
[0404]
(E)-N-(2-Chloro-benzyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H--
pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide hydrochloride; [0405]
(E)-N-Methyl-N-(4-methyl-benzyl)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H--
pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide hydrochloride; [0406]
(R)-(-)-(E)-N-Methyl-N-(1-methyl-1H-indol-2-ylmethyl)-3-(10-oxo-2,3,4,9,1-
0,10.sup.a-hexahydro-1H-3.sup.a,8,9-triaza-benzo[f]azulen-6-yl)acrylamide
hydrochloride; [0407]
(S)-(+)-(E)-N-Methyl-N-(1-methyl-1H-indol-2-ylmethyl)-3-(10-oxo-2,3,4,9,1-
0,10.sup.a-hexahydro-1H-3.sup.a,8,9-triaza-benzo[f]azulen-6-yl)acrylamide
hydrochloride; [0408]
(E)-3-[4-(4-Methoxy-benzyl)-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4-
]diazepin-7-yl]-N-methyl-N-(1-methyl-1H-indol-2-ylmethyl)acrylamide
hydrochloride; [0409]
(E)-N-Methyl-N-(1-methyl-1H-indol-2-ylmethyl)-3-(2-oxo-2,3,4,5-tetrahydro-
-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide hydrochloride;
[0410]
(E)-N-Methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)-3-[4-(2-morpholin-4-
-yl-ethyl)-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acr-
ylamide hydrochloride; [0411]
(E)-N-Methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)-3-{4-[2-(4-methyl-p-
iperazin-1-yl)-2-oxo-ethyl]-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]-
diazepin-7-yl)acrylamide hydrochloride; [0412]
(E)-N-Methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)-3-[4-(3-morpholin-4-
-yl-propyl)-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]ac-
rylamide hydrochloride; [0413]
(E)-N-(2-Ethoxy-3-methoxy-benzyl)-N-methyl-3-{4-[2-(4-methyl-piperazin-1--
yl)-2-oxo-ethyl]-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl}acrylamide hydrochloride; [0414]
(S)-(+)-(E)-N-Methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)-3-(10-oxo-2-
,3,4,9,10,10.sup.a-hexahydro-1H-3.sup.a,8,9-triaza-benzo[f]azulen-6-yl)acr-
ylamide hydrochloride; [0415]
(R)-(-)-(E)-N-Methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)-3-(10-oxo-2-
,3,4,9,10,10.sup.a-hexahydro-1H-3.sup.a,8,9-triaza-benzo[f]azulen-6-yl)acr-
ylamide hydrochloride; [0416]
(E)-N-(4-Fluoro-naphthalen-1-ylmethyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-
-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride; [0417]
(E)-N-(4-Chloro-naphthalen-1-ylmethyl)-N-methyl-3-(4-methyl-2-oxo--
2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride; [0418]
(E)-N-Methyl-N-(3-methyl-benzofuran-2-ylmethyl)-3-[4-(3-morpholin-4-yl-pr-
opyl)-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylami-
de hydrochloride; [0419]
(E)-N-(2-Isopropoxy-3-methoxy-benzyl)-N-methyl-3-[4-(3-morpholin-4-yl-pro-
pyl)-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamid-
e hydrochloride; [0420]
(E)-N-Methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)-3-{4-[3-(4-methyl-p-
iperazin-1-yl)propyl]-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazep-
in-7-yl)acrylamide hydrochloride; [0421]
(E)-N-Methyl-N-(2-methyl-benzofuran-3-ylmethyl)-3-[4-(3-morpholin-4-yl-pr-
opyl)-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylami-
de hydrochloride; [0422]
(E)-N-(3-Chloro-benzo[b]thiophen-2-ylmethyl)-N-methyl-3-(4-methyl-2-oxo-2-
,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride; [0423]
(E)-N-(5-Chloro-1-methyl-1H-indol-2-ylmethyl)-N-methyl-3-(4-methyl-2-oxo--
2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride; [0424]
(E)-N-(1,7-Dimethyl-1H-indol-2-ylmethyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4-
,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride; [0425]
(E)-N-(5-Fluoro-3-methyl-benzo[b]thiophen-2-ylmethyl)-N-methyl-3-(-
4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acryl-
amide hydrochloride; [0426]
(E)-N-(5-Chloro-3-methyl-benzo[b]thiophen-2-ylmethyl)-N-methyl-3-(4-methy-
l-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride; [0427]
(E)-3-(6-Amino-5-morpholin-4-ylmethyl-pyridin-3-yl)-N-(1,7-dimethyl-1H-in-
dol-2-ylmethyl)-N-methyl-acrylamide hydrochloride; [0428]
(E)-3-(6-Amino-5-morpholin-4-ylmethyl-pyridin-3-yl)-N-(2-ethoxy-3-methoxy-
-benzyl)-N-methyl-acrylamide hydrochloride; [0429]
(E)-N-Methyl-N-(1-methyl-1H-indol-3-ylmethyl)-3-(4-methyl-2-oxo-2,3,4,5-t-
etrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide; [0430]
(E)-7-{2-[Methyl-(1-methyl-1H-indol-3-ylmethyl)-carbamoyl]-vinyl}-2-oxo-1-
,2,3,5-tetrahydro-pyrido[2,3-e][1,4]diazepine-4-carboxylic acid
benzyl ester; [0431]
(E)-3-(2,4-Dioxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl)-N-methyl-
-N-(1-methyl-1H-indol-3-ylmethyl)acrylamide; [0432]
(E)-N-Methyl-N-(1-methyl-1H-indol-2-ylmethyl)-3-(2-oxo-2,3-dihydro-oxazol-
o[4,5-b]pyridin-6-yl)acrylamide; [0433]
(E)-N-Methyl-N-(1-methyl-1H-indol-3-ylmethyl)-3-(2-oxo-2,3-dihydro-oxazol-
o[4,5-b]pyridin-6-yl)acrylamide; [0434]
(E)-3-(6-Amino-5-{2-[methyl-(1-methyl-1H-indol-2-ylmethyl)carbamoyl]ethyl-
}pyridin-3-yl)-N-methyl-N-(1-methyl-1H-indol-2-ylmethyl)acrylamide;
[0435]
(E)-3-(6-Amino-5-piperidin-1-ylmethyl-pyridin-3-yl)-N-methyl-N-(1-methyl--
1H-indol-2-ylmethyl)acrylamide; [0436]
(E)-3-(6-Amino-5-pyrrolidin-1-ylmethyl-pyridin-3-yl)-N-methyl-N-(1-methyl-
-1H-indol-2-ylmethyl)acrylamide hydrochloride; [0437]
(E)-3-[6-Amino-5-(4-methyl-piperazin-1-ylmethyl)pyridin-3-yl]-N-methyl-N--
(1-methyl-1H-indol-2-ylmethyl)acrylamide hydrochloride; [0438]
(E)-3-[6-Amino-5-(4-benzyl-piperidin-1-ylmethyl)pyridin-3-yl]-N-methyl-N--
(1-methyl-1H-indol-2-ylmethyl)acrylamide hydrochloride; [0439]
(E)-3-(6-Amino-5-pyrrolidin-1-ylmethyl-pyridin-3-yl)-N-methyl-N-naphthale-
n-2-ylmethyl-acrylamide hydrochloride; [0440]
(E)-3-[6-Amino-5-(4-methyl-piperazin-1-ylmethyl)pyridin-3-yl]-N-methyl-N--
(3-methyl-benzo[b]thiophen-2-ylmethyl)acrylamide hydrochloride;
[0441]
(E)-3-(6-Amino-5-morpholin-4-ylmethyl-pyridin-3-yl)-N-methyl-N-(4-methyl--
naphthalen-1-ylmethyl)acrylamide hydrochloride; [0442]
(E)-3-(6-Amino-5-morpholin-4-ylmethyl-pyridin-3-yl)-N-methyl-N-(3-methyl--
benzo[b]thiophen-2-ylmethyl)acrylamide hydrochloride; [0443]
(E)-3-(6-Amino-5-morpholin-4-ylmethyl-pyridin-3-yl)-N-(3,4-dimethyl-thien-
o[2,3-b]thiophen-2-ylmethyl)-N-methyl-acrylamide hydrochloride;
[0444]
(E)-3-[6-Amino-5-(4-methyl-piperazin-1-ylmethyl)pyridin-3-yl]-N-(2-ethoxy-
-3-methoxy-benzyl)-N-methyl-acrylamide hydrochloride; [0445]
(E)-3-[6-Amino-5-(4-methyl-piperazin-1-ylmethyl)pyridin-3-yl]-N-methyl-N--
(4-methyl-naphthalen-1-ylmethyl)acrylamide hydrochloride; [0446]
(E)-3-[6-Amino-5-(4-methyl-piperazin-1-ylmethyl)pyridin-3-yl]-N-benzofura-
n-2-ylmethyl-N-methyl-acrylamide hydrochloride; [0447]
(E)-3-[6-Amino-5-(4-methyl-piperazin-1-ylmethyl)pyridin-3-yl]-N-(3-methox-
y-2-propoxy-benzyl)-N-methyl-acrylamide hydrochloride; [0448]
(E)-3-[6-Amino-5-(4-methyl-piperazin-1-ylmethyl)pyridin-3-yl]-N-(2-ethoxy-
-3-methyl-benzyl)-N-methyl-acrylamide hydrochloride; [0449]
(E)-N-(3-Methoxy-2-propoxy-benzyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-[-
1,8]naphthyridin-3-yl)acrylamide hydrochloride; [0450]
(E)-N-(2-Isopropoxy-3-methoxy-benzyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydr-
o-[1,8]naphthyridin-3-yl)acrylamide hydrochloride; [0451]
(E)-N-(2-Ethoxy-3-methoxy-benzyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-[1-
,8]naphthyridin-3-yl)acrylamide hydrochloride; [0452]
(E)-3-[6-(2,5-Dioxo-pyrrolidin-1-yl)pyridin-3-yl]-N-methyl-N-(1-methyl-1H-
-indol-2-ylmethyl)acrylamide; [0453]
(E)-N-(5-{2-[Methyl-(1-methyl-1H-indol-2-ylmethyl)carbamoyl]vinyl}pyridin-
-2-yl)succinamide; [0454]
(E)-N-(5-{2-[Methyl-(1-methyl-1H-indol-2-ylmethyl)carbamoyl]vinyl
pyridin-2-yl)-4-(4-methyl-piperazin-1-yl)-4-oxo-butyramide; [0455]
(E)-N-(5-{2-[Methyl-(1-methyl-1H-indol-2-ylmethyl)carbamoyl]vinyl}pyridin-
-2-yl)-4-morpholin-4-yl-4-oxo-butyramide; [0456]
(E)-1-Methyl-piperidine-4-carboxylic acid
(5-{2-[methyl-(1-methyl-1H-indol-2-ylmethyl)carbamoyl]vinyl}pyridin-2-yl)-
amide; [0457]
(E)-N-Methyl-N-(1-methyl-1H-indol-2-ylmethyl)-3-[6-(2-pyridin-4-yl-acetyl-
amino)pyridin-3-yl]acrylamide; [0458]
(E)-1-Acetyl-piperidine-4-carboxylic acid
(5-{2-[methyl-(1-methyl-1H-indol-2-ylmethyl)carbamoyl]vinyl}pyridin--
2-yl)amide; [0459]
(E)-3-(6-Amino-pyridin-3-yl)-N-(2,3-dimethoxy-benzyl)-N-methyl-acrylamide-
; [0460]
(E)-N-(4-Acetylamino-benzyl)-3-(6-amino-pyridin-3-yl)-N-methyl-ac-
rylamide; [0461]
(E)-3-[3-(2-Dimethylamino-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-e]py-
rimidin-6-yl]-N-methyl-N-(1-methyl-1H-indol-2-ylmethyl)acrylamide;
[0462]
(E)-N-Methyl-N-(1-methyl-1H-indol-2-ylmethyl)-3-[3-(2-morpholin-4-yl-ethy-
l)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl]acrylamide
hydrochloride; [0463]
(E)-N-Methyl-N-(4-methyl-naphthalen-1-ylmethyl)-3-[3-(2-morpholin-4-yl-et-
hyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl]acrylamide
hydrochloride; [0464]
(E)-N-Acenaphthen-5-ylmethyl-N-methyl-3-[3-(2-morpholin-4-yl-ethyl)-2-oxo-
-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl]acrylamide
hydrochloride; [0465]
(E)-N-(2-Ethoxy-3-methoxy-benzyl)-N-methyl-3-[3-(2-morpholin-4-yl--
ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl]acrylamide
hydrochloride; [0466]
(E)-N-Methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)-3-[3-(2-morpholin-4-
-yl-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl]acrylamide
hydrochloride; [0467]
(E)-(6-{2-[Methyl-(1-methyl-1H-indol-2-ylmethyl)carbamoyl]vinyl}-2-oxo-1,-
4-dihydro-2H-pyrido[2,3-d]pyrimidin-3-yl)acetic acid; [0468] Sodium
(E)-(6-{2-[methyl-(1-methyl-1H-indol-2-ylmethyl)carbamoyl]vinyl}-2-oxo-1,-
4-dihydro-2H-pyrido[2,3-d]pyrimidin-3-yl)acetate; [0469] Sodium
(E)-(6-{2-[methyl-(3-methyl-benzo[b]thiophen-2-ylmethyl)carbamoyl]vinyl}--
2-oxo-1,4-dihydro-2H-pyrido[2,3-d]pyrimidin-3-yl)acetate; [0470]
(E)-N-Methyl-N-(1-methyl-1H-indol-2-ylmethyl)-3-{3-[2-(4-methyl-piperazin-
-1-yl)-2-oxo-ethyl]-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl}a-
crylamide hydrochloride; [0471]
(E)-N-Methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)-3-{3-[2-(4-methyl-p-
iperazin-1-yl)-2-oxo-ethyl]-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidi-
n-6-yl}acrylamide hydrochloride;
[0472]
(E)-N-Methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)-3-{3-[2-(4-m-
ethyl-piperazin-1-yl)-2-oxo-ethyl]-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]p-
yrimidin-6-yl}acrylamide hydrochloride; [0473]
(E)-2-Amino-5-{2-[methyl-(1-methyl-1H-indol-2-ylmethyl)carbamoyl]vinyl}-N-
-(2-morpholin-4-yl-ethyl)nicotinamide hydrochloride; [0474]
(E)-N-(3-Methyl-benzo[b]thiophen-2-ylmethyl)-3-[3-(3-morpholin-4-yl-propy-
l)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl]acrylamide
hydrochloride; [0475]
(E)-N-(2-Ethoxy-3-methoxy-benzyl)-N-methyl-3-[3-(3-morpholin-4-yl-propyl)-
-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl]acrylamide
hydrochloride; [0476]
(E)-N-(5-{2-[Methyl-(3-methyl-benzo[b]thiophen-2-ylmethyl)carbamoyl]vinyl-
}pyridin-2-yl)-4-(4-methyl-piperazin-1-yl)-4-oxo-butyramide; [0477]
(E)-N-(2,3-Diethoxy-benzyl)-N-methyl-3-[3-(2-morpholin-4-yl-ethyl)-2-oxo--
1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl]acrylamide
hydrochloride; [0478]
(E)-N-(2-Isopropoxy-3-methoxy-benzyl)-N-methyl-3-[3-(2-morpholin-4-
-yl-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl]acrylamide
hydrochloride; [0479]
(E)-N-(3-Methoxy-2-propoxy-benzyl)-N-methyl-3-[3-(2-morpholin-4-yl-ethyl)-
-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl]acrylamide
hydrochloride; [0480]
(E)-N-Methyl-N-(3-methyl-benzofuran-2-ylmethyl)-3-[3-(2-morpholin-4-yl-et-
hyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl]acrylamide
hydrochloride; [0481]
(E)-N-Methyl-N-(2-methyl-benzofuran-3-ylmethyl)-3-[3-(2-morpholin-4-yl-et-
hyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl]acrylamide
hydrochloride; [0482]
(E)-N-(3-Chloro-2-ethoxy-benzyl)-N-methyl-3-[3-(2-morpholin-4-yl-ethyl)-2-
-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl]acrylamide
hydrochloride; [0483]
(E)-N-(4-Fluoro-naphthalen-1-ylmethyl)-N-methyl-3-[3-(2-morpholin-4-yl-et-
hyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl]acrylamide
hydrochloride; [0484]
(E)-N-(2,3-Dimethoxy-benzyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]na-
phthyridin-3-yl)acrylamide; [0485]
(E)-3-(6-Amino-5-morpholin-4-ylmethyl-pyridin-3-yl)-N-methyl-N-(1-methyl--
1H-indol-3-ylmethyl)acrylamide; [0486]
(E)-3-(6-Amino-pyridin-3-yl)-N-methyl-N-thieno[3,2-c]pyridin-2-ylmethyl-a-
crylamide; [0487]
(E)-N-Methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]di-
azepin-7-yl)-N-thieno[3,2-c]pyridin-2-ylmethyl-acrylamide; [0488]
(E)-N-Methyl-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3-yl)-N-thieno-
[3,2-c]pyridin-2-ylmethyl-acrylamide; [0489]
(E)-3-(6-Amino-pyridin-3-yl)-N-(2-ethoxy-3-methoxy-benzyl)-N-methyl-acryl-
amide hydrochloride; [0490]
(E)-3-(6-Amino-pyridin-3-yl)-N-(2-propoxy-3-methoxy-benzyl)-N-methyl-acry-
lamide hydrochloride; [0491]
(E)-3-(6-amino-pyridin-3-yl)-N-(2-isopropoxy-3-methoxy-benzyl)-N-methyl-a-
crylamide hydrochloride; [0492]
(E)-N-Acenaphthen-5-ylmethyl-3-(6-amino-pyridin-3-yl)-N-methyl-acrylamide
hydrochloride; [0493]
(E)-N-(1H-Indol-5-ylmethyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-
-1H-pyrido[2,3-e][1,4]diazepin-7-yl)-acrylamide; [0494]
(E)-N-Methyl-N-(1-methylindol-5-ylmethyl)-3-(4-methyl-2-oxo-2,3,4,5-tetra-
hydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)-acrylamide; [0495]
(E)-N-(1H-Indol-7-ylmethyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-
-1H-pyrido[2,3-e][1,4]diazepin-7-yl)-acrylamide; [0496]
(E)-N-Methyl-N-(1-methylindol-7-ylmethyl)-3-(4-methyl-2-oxo-2,3,4,5-tetra-
hydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)-acrylamide; [0497]
(E)-N-(1H-Indol-6-ylmethyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-
-1H-pyrido[2,3-e][1,4]diazepin-7-yl)-acrylamide; [0498]
(E)-N-3-(6-Amino-pyridin-3-yl)-N-methyl-N-(2-methyl-benzofuran-3-ylmethyl-
)-acrylamide hydrochloride; [0499]
(E)-3-(3,3-Dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepi-
n-7-yl)-N-methyl-N-(3-methyl-benzofuran-2-ylmethyl)acrylamide
hydrochloride; [0500]
(E)-N-Methyl-N-(3-methyl-1H-inden-2-ylmethyl)-3-(4-methyl-2-oxo-2,3,4,5-t-
etrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride; [0501]
(E)-3-(6-{2-[Methyl-(3-methyl-benzo[b]thiophen-2-ylmethyl)carbamoy-
l]vinyl}2-oxo-1,4-dihydro-2H-pyrido[2,3-d]pyrimidin-3-yl)propionic
acid ethyl ester; [0502]
(E)-3-(6-amino-5-cyano-pyridin-3-yl)-N-methyl-N-(1-methyl-1H-indol-2-ylme-
thyl)-acrylamide hydrochloroide; [0503]
(E)-N-methyl-N-(1-methyl-1H-indol-2-ylmethyl)-3-(2-oxo-1,2,3,4-tetrahydro-
-pyrido-[2,3-b]pyrazin-7-yl)-acrylamide; [0504]
N-Methyl-N-(1-methyl-1H-indol-2-ylmethyl)-3-(7-oxo-5,6,7,8-tetrahydro-[1,-
8]naphthyridin-3-yl)-acrylamide; [0505]
N-Methyl-N-(1-methyl-1H-indol-3-ylmethyl)-3-(7-oxo-5,6,7,8-tetrahydro-[1,-
8]naphthyridin-3-yl)-acrylamide; [0506]
N-Methyl-N-(2-methyl-1H-indol-3-ylmethyl)-3-(7-oxo-5,6,7,8-tetrahydro-[1,-
8]naphthyridin-3-yl)-acrylamide; [0507]
N-Methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)-3-(4-methyl-2-oxo-2,3,4-
,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)-acrylamide;
[0508]
N-Acenaphthen-5-ylmethyl-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-
-pyrido[2,3-e][1,4]diazepin-7-yl)-acrylamide; or [0509]
N-Methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)-3-[3-(2-morpholin-4-yl--
ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl]-acrylamide.
[0510] Also included in the antibacterial compositions of the
present invention are pharmaceutically acceptable addition salts
and complexes of the FabI inhibitors. In cases wherein the
inhibitors may have one or more chiral centers, unless specified,
the present invention comprises each unique racemic compound, as
well as each unique nonracemic compound.
[0511] In cases in which the inhibitors have unsaturated
carbon-carbon double bonds, both the cis (Z) and trans (E) isomers
are within the scope of this invention. In cases wherein inhibitors
may exist in tautomeric forms, such as keto-enol tautomers, such
as
##STR00036##
each tautomeric form is contemplated as being included within this
invention, whether existing in equilibrium or locked in one form by
appropriate substitution with R'. The meaning of any substituent at
any one occurrence is independent of its meaning, or any other
substituent's meaning, at any other occurrence.
[0512] Also included in the antibiotic compounds of the present
invention are prodrugs of the FabI inhibitors.
[0513] It is believed that the compositions of the present
invention comprising compounds of formulas I-III are antibacterial
because the compounds inhibit FabI, FabK, or both. It may be,
however, that for some or all of the compounds, they inhibit other
enzymes in addition or inhibit completely different enzymes. The
exact mechanism by which the compositions of the present invention
achieve their antibacterial properties is not meant to be
limiting.
[0514] A variety of subject compounds and intermediates of them may
be made by a person of ordinary skill in the art using conventional
reaction techniques. Non-limiting examples of compounds and methods
of making them may be found in U.S. patent application Ser. Nos.
08/790,043, 10/009,219, 10/089,019, 09/968,129, 09/968,123,
09/968,236, 09/959,172, 09/979,560, 09/980,369, 10/089,755,
10/089,739, 10/089,740, PCT Published Patent Application Nos. WO
0027628 and WO 0210332; and PCT Patent Application
PCT/US03/38706.
Synthetic Routes to Compounds of Formula I
[0515] A generalized chemical approach to assembling compounds of
formula I is based on viewing the analogs as consisting of a
central ene-amide flanked left-hand side (LHS) and right-hand side
(RHS) moieties. Schematically, this is depicted in FIG. 2. Two
possible bond disconnections envisioned in a retrosynthetic sense
are shown with dashed lines. Schemes Ito XXXV illustrate some of
the general methods that can be used in the synthesis of compounds
of formula I. It will be recognized by one skilled in the art that
other disconnections are possible resulting in alternative modes of
assembly of the compounds of the invention.
[0516] Schemes I to VIII disclose the basic chemistry involved in
the synthesis of the left hand side moieties of formula I wherein
the requisite LHS coupling partners are amines and the late stage
chemistry involves formation of the amide linkage. The amines are
typically arylalky-amines which are most conveniently prepared from
comercially available arylcarbaldehydes by the action of a reducing
agent such as sodium borohydride in the presence of an alkyl amine
such as methyl amine (Scheme I).
##STR00037##
When the arylcarbaldehydes are not comercially available their
synthesis can be effected by a number of general methods including
the action of dimethylformamide on the lithium salt of aryl anions
(Scheme Iib and IIIa).
##STR00038##
##STR00039##
Other methods of obtaining the desired arylcarbaldehydes include
the widely employed oxidation of alcohols (Scheme Ivb) and a
variety of miscellaneous methods (Scheme Va and Via).
##STR00040##
##STR00041##
##STR00042##
[0517] During the course of these syntheses it may be desirable to
alkylate indole-like nitrogens This can be accomplished either
prior to (Scheme IIa) or after formation of said carbaldehydes
(Scheme Ivc) by the action of strong bases such as sodium hydride
and the addition of alkylating agents such as alkyl halides.
Likewise oxygen atoms appended to the aromatic systems (e.g.
phenols) can be alkylated by the action of base (potassium
carbonate) and an alkylhalide (Scheme VIIa).
##STR00043##
[0518] Yet another approach to the formation of the desired amines
can be from the reduction of precursor amides (Scheme VIII)
##STR00044##
[0519] Scheme IX describes the basic chemistry involved in the
synthesis of the left hand side moieties of formula I wherein the
requisite LHS coupling partners are ene-amides and the late stage
chemistry involves formation of a carbon-carbon bond. The
carbon-carbon bond formation is usually accomplished by Heck type
chemistry which will be described subsequently. The ene-amide is
prepared by activation of acylic acid to undergo coupling reaction
(with an amine) by any one of the known methods for amide bond
formation. One typically used procedure is to treat acrylic acid
with a solution of a tertiary amine in DMF followed by the addition
of 1-hydroxybenzotriazole hydrate and a carbodiimde such as
1-(3-dimethylaminopropyl)-3-ethyl-carbodiimide hydrochloride. The
reaction mixture is then treated with the desired arylalkylamine
such as methyl-(1-methyl-1H-indol-3-ylmethyl)-amine (Scheme
IX).
##STR00045##
[0520] Schemes X to XXIV disclose the basic chemistry involved in
the synthesis of the right hand side moieties of formula I wherein
the requisite RHS coupling partners are carboxylic acids and the
late stage chemistry involves formation of the amide linkage. The
carboxylic acids are typically arylalkenyl carboxylic acids whose
preparation is illustrated by the schemes described below. A common
starting material, 5-bromo-3-bromomethyl-pyridin-2-ylamine
hydrobromide, is used in the construction of the right hand side
moieties described in Schemes X-XVII. In some embodiments of the
invention, this material is reacted with a commercial secondary
amine (Schemes X-XII) or reacted with a secondary amine which is
prepared in the manner illustrated (Schemes XIII-XIV). In either
case, a tertiary base is employed. A common feature of the
resultant products are compounds incorporating a pendent alkyl
ester and an aminopyridine moiety which react in the presence of a
base like sodium hydride to form the pyridodiazepinone bicyclic
unit.
[0521] The pyridodiazepinones prepared in this manner have in
common a bromine substitution in the pyridine ring. As will be seen
from inspection of the Schemes X-XIV synthesis of arylalkenyl acids
proceeds from intermediary bromo-pyridodiazepinones via Heck
chemistry (e.g. Scheme Xc). Heck chemistry is carried out by
admixture of an arylbromide with an alkylacrylate, such as
tert-butylacrylate, in the presence of a palladium catalyst
(Pd(OAc).sub.2, P(o-tol).sub.3) and a tertiary base such as
di-(isopropyl)ethylamine in an appropriate solvent or solvents
(e.g. DMF and EtCN). The desired carboxylic acid is obtained by
acid-catalysed hydrolysis of the tert-butyl ester (e.g. Scheme
Xd).
##STR00046##
##STR00047##
##STR00048##
##STR00049##
##STR00050##
##STR00051##
[0522] In an analogous way to the chemistry described above,
5-bromo-3-bromomethyl-pyridin-2-ylamine hydrobromide, may be
reacted with primary amines (Scheme XVI, XVII, XVIII); subsequent
cyclization with sodium hydride yields a pyridodiazepinone in which
the nitrogen at the four position is unsubstituted. In Scheme XVI
the final product represents a right hand side moiety of formula I
wherein the requisite RHS coupling partners is an aryl bromide and
the late stage chemistry involves formation of a carbon-carbon bond
via Heck chemistry. One skilled in the art will recognize that the
intermediate aryl bromides described in Schemes X-XX may also be
used in late stage carbon-carbon bond forming chemistry.
[0523] Alternatively, the nitrogen at position four may be
derivatized by reaction with alkylating (Scheme XVIIc) or acylating
agents (Scheme XVIIIc). In the former case, further elaboration
(Scheme XVIId,e) yields a derivatized bromopyridodiazepinone which
is subjected to standard Heck coupling/deprotection sequence to
give the desired acid. In the latter case, the CBz-protected
pyridodiazepinone is similarly treated (Scheme XVIII).
##STR00052##
##STR00053##
##STR00054##
[0524] 5-Bromo-3-bromomethyl-pyridin-2-ylamine hydrobromide, may
also be reacted with cyclic secondary amines (Scheme XIX); the
desired acid is obtained in the usual way.
##STR00055##
[0525] Right hand sides in which an aminopyridine ring is
derivatized via an amide linkage may be realized by reaction of
2-amino-5-bromonicotinic acid hydrobromide with primary amines.
Heck coupling and hydrolysis gives the desired acid (Scheme XX)
##STR00056##
[0526] Schemes XXI-XXIV are illustrative of methods use for
preparing RHS moieties wherein
3,4-dihydro-1H-pyrido[2,3-d]pyrimidin-2-ones are incorporated as
RHS moieties. Schemes XXI-XXIII show preparations wherein
carboxylic acids are prepared and end stage chemistry involves
amide bond formation, scheme XXIV shows preparation of an aryl
bromide employed in carbon-carbon bond forming end stage
chemistry.
[0527] In each case an intermediate aminomethyl aminopyridine is
prepared by amide bond reduction (Scheme XXI), reductive amination
of aldehydes (Scheme XXII and Scheme XXIV) or, as described above
in Scheme XVII, by displacement of an benzylic bromide with the
desired primary amine. The latter method yields the starting
material for Scheme XXIII. The subsequent step, common to all
cases, is cyclization using carbonyl diimidazole to form the
3,4-dihydro-1H-pyrimidin-2-one ring. Other activated carbonyl
equivalents are expected to affect a similar cyclization. In
Schemes XXI-XXIII further elaboration using Heck coupling and
hydrolysis gives the desired carboxylic acid RHS moieties.
##STR00057##
##STR00058##
##STR00059##
##STR00060##
[0528] Schemes XXV and XXVI are illustrative of the methods used
for preparing
(E)-3-(2,4-dioxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl-
)-acrylic acid and
(E)-3-(2-oxo-2,3-dihydro-oxazolo[4,5-b]pyridin-6-yl)-acrylic acid
right hand sides respectivley.
##STR00061##
##STR00062##
[0529] Schemes XXVII describes a specific example of a general
method for assembly of compounds of formula I wherein the LHS
coupling partners are amines, the RHS coupling partners are acids
and the late stage chemistry involves formation of the amide
linkage. There are many common methods for formation of amide
linkages. In the example depicted in Scheme XXVII an acid
((E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]di-
azepin-7-yl)-acrylic acid) is activated by treatment with a
carbodiimide (EDC) and hydroxybenzotriazole (HOBt) in the presence
of a polar aprotic solvent (DMF) and reacted with a suitable amine
(N-methyl-N-(1-methyl-1H-indol-3-ylmethyl)amine) in the presence of
a tertiary amine base like diisopropylethylamine.
##STR00063##
[0530] An alternative method for assembling compounds of formula I,
generally referred to as Heck coupling, is depicted in Scheme
XVIII. An acrylic amide such as
N-methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)-acrylamide is
treated with an aryl bromide such as
7-bromo-3,3-dimethyl-1,3,4,5-tetrahydro-pyrido[2,3-e][1,4]diazepin-2-one
in the presence of a palladium catalyst (Pd(OAc).sub.2,
P(o-tol).sub.3), a tertiary amine ((I--Pr).sub.2EtN) and an aprotic
solvent or solvents (EtCN, DMF).
##STR00064##
[0531] To access certain compounds of the invention it may be
necessary to perform synthetic manipulations after the right hand
side and left hand side units have been assembled. Scheme XXIX for
example outlines the conversion of an aminopyridine moiety to a
cyclic imide followed by ring opening with ammonia.
##STR00065##
[0532] Additional examples of aminopyridine derivatization are
given in Schemes XXX and XXXI which describe the acylation of the
amine moeity to form amide linkages.
##STR00066##
##STR00067##
[0533] In certain aspects of the invention it is desirable to have
pyridodiazepinones in place on the right hand side with
unsubstituted 4-position nitrogen. In these instances a suitable
protecting group such as methoxybenzyl can temporarily mask the
nitrogen. This protecting group may be removed in a two-step
procedure by treatment with 1-chloroethyl chloroformate followed by
hydrolysis of the intermediate carbamate. The hydrochloride salt
may be prepared, if desired, through treatment with dilute acid
(HCl) in an aprotic solvent such as ether (Scheme XXXII).
##STR00068##
[0534] Schemes XXXIII and XXXIV respectively show methods for
conversion of ester and dimethylether ether groups pendent on a
3,4-dihydro-1H-pyrido[2,3-d]pyrimidin-2-one right hand side to
piperidine-containing tethers. These chemical manipulations are
caned out after the standard coupling reactions described above are
applied (e.g. Scheme XXVII or XXVIII).
##STR00069##
##STR00070##
[0535] Scheme XXXV illustrates a method of compound construction
falling outside the general methods described above in that a
dicarboxylic acid, prepared as in Scheme XXXIVa, is reacted with
two equivalents of arylmethylamine using the standard amide couping
conditions.
##STR00071##
Synthetic Routes to Compounds of Formulas II and III
[0536] Examples of the compounds of formulas II and III in the
antibacterial compositions of the present invention may be prepared
by the general methods described in the Schemes hereinafter.
##STR00072##
[0537] A suitable haloaromatic derivative, for instance
2-amino-5-bromopyridine (XXXVI-1), reacts with an appropriate
.alpha.,.beta.-unsaturated ester, for example benzyl acrylate, in a
Heck-type reaction to afford XXXVI-2. The reaction is mediated by a
palladium(0) species, and generally is conducted in an inert
solvent, such as CH.sub.3CN, propionitrile, or toluene, in the
presence of an appropriate acid scavenger, such as triethylamine
(Et.sub.3N) or diisopropylethylamine ((i-Pr).sub.2NEt). Typical
sources of the palladium(0) species include palladium (II) acetate
(Pd(OAc).sub.2) and palladium(II) chloride (PdCl.sub.2), and
oftentimes phosphine ligands, for instance triphenylphosphine
(PPh.sub.3) or tri-ortho-tolylphosphine (P(tol).sub.3), are
included. The ethyl ester of XXXVI-2 is hydrolyzed using aqueous
base, for example, LiOH in aqueous THF or NaOH in aqueous methanol
or ethanol, and the intermediate carboxylate salt is acidified with
a suitable acid, for instance TFA or HCl, to afford the carboxylic
acid XXXVI-3. The carboxylic acid of XXXVI-3 is converted to an
activated form using, for example, EDC and HOBt, or SOCl.sub.2, and
the activated form is subsequently reacted with an appropriate
amine, for instance 1-methyl-2-(methylaminomethyl)indole, in a
suitable solvent such as DMF, CH.sub.2Cl.sub.2, or CH.sub.3CN, to
afford XXXVI-4. Depending on whether acid neutralization is
required, an added base, such as triethylamine (Et.sub.3N),
diisopropylethylamine ((i-Pr).sub.2NEt), or pyridine, may be used.
Many additional methods for converting a carboxylic acid to an
amide are known, and can be found in standard reference books, such
as "Compendium of Organic Synthetic Methods", Vol. I-VI (published
by Wiley-Interscience), or Bodansky, "The Practice of Peptide
Synthesis" (published by Springer-Verlag).
##STR00073##
[0538] The amine coupling partners used in the present invention
were prepared by established methods well-known to those of skill
in the art. For example, amine XXXVII-4 is prepared by the
straightforward procedure outlined in Scheme II. Commercially
available ethyl indole-2-carboxylate (XXXVII-1) is deprotonated
with a suitable base, generally sodium hydride (NaH), and the
intermediate sodium salt is reacted with an appropriate alkylating
agent, for instance methyl iodide, to afford XXXVII-2. Polar
solvents such as DMF, THF, or mixtures thereof are generally
preferred for this reaction. Compound XXXVII-2 can be conveniently
converted to XXXVII-3 by reaction with an excess of an amine, such
as methylamine, in a polar solvent, generally H.sub.2O or a mixture
of H.sub.2O and methanol. Alternatively, the ester of XXXVII-2 can
be saponified under standard conditions, typically with an alkali
metal hydroxide such as LiOH, NaOH, or KOH, in an aqueous solvent,
such as THF, ethanol, or methanol, and the resulting carboxylic
acid can be converted to the desired amide. Typical methods for
forming amides are described in Scheme I. Reduction of the amide
XXXVII-3 to the amine XXXVII-4 is typically accomplished with
lithium aluminum hydride (LiAlH.sub.4) in refluxing THF, although
many other methods can be used to reduce amides to amines. Such
methods are well-known to those of skill in the art, and can be
found in standard reference volumes, such as "Compendium of Organic
Synthetic Methods" (published by Wiley-Interscience).
##STR00074##
[0539] The amine coupling partners used in the present invention
can also be prepared by the reductive amination of an appropriate
aldehyde (Scheme III). This method, which is well-known to those of
skill in the art, involves the initial conversion of an aldehyde to
an intermediate imine, which is subsequently reduced, oftentimes in
situ, to afford the amine. For example, the commercially-available
aldehyde XXXVIII-1 reacts with an appropriate amine, for instance
methylamine, in a suitable solvent, typically methanol, to afford
the imine XXXVIII-2. Reaction of XXXVIII-2 with a suitable reducing
agent, for example sodium borohydride, sodium cyanoborohydride or
sodium (triacetoxy)borohydride, gives the amine XXXVIII-3.
##STR00075## ##STR00076##
[0540] Commercially available 2-aminonicotinic acid (XXXIX-1) is
reduced to alcohol XXXIX-2 under standard conditions (LiAlH.sub.4,
THF), and the aromatic ring of XXXIX-2 is brominated using, for
example, bromine or N-bromosuccinimide (NBS), in a suitable solvent
such as CH.sub.2Cl.sub.2, acetic acid (AcOH), or mixtures thereof,
to afford XXXIX-3. On reaction with 48% aqueous HBr, XXXIX-3 is
converted to bromide XXXIX-4, which reacts with a diester of
malonic acid, for instance dimethyl malonate, under basic
conditions, to afford the naphthyridone derivative XXXIX-5. Typical
basic conditions include an alkali metal hydride, for instance
sodium hydride, in a neutral solvent such as DMF, THF, or mixtures
thereof, or an alkali metal alkoxide, such as sodium methoxide or
sodium ethoxide, in an alcoholic solvent such as with methanol or
ethanol. Saponification and neutralization under standard
conditions affords an intermediate carboxylic acid (not shown),
which is typically not isolated, but is subject to decarboxylation
on gentle warming to afford the naphthyridone XXXIX-6. This
compound reacts with acrylamide XXXIX-8 in a Heck-type reaction as
described in Scheme Ito afford XXXIX-9. Alternatively, XXXIX-6
might be converted to XXXIX-9 according to the general procedure
described in Scheme I for the conversion of XXXVI-1 to XXXVI-4. The
acrylamide XXXIX-8 is conveniently prepared by reaction of amine
XXXIX-7 (see Scheme I) with an activated form of acrylic acid in an
amide bond-forming reaction. Typical conditions for the formation
of amides are described in Scheme I, and are well-known to those of
skill in the art.
##STR00077##
[0541] Benzylic bromide XL-1, prepared as described in Scheme
XXXIX, reacts with an amine, for example aqueous methylamine, to
afford benzylic amine XL-2. Polar solvents such as THF, DMF, DMSO,
or mixture thereof, are generally preferred for this reaction. XL-2
reacts with a dialkyl carbonate, preferably dimethyl carbonate, in
the presence of a suitable base, typically sodium methoxide, in an
alcoholic solvent, generally methanol, to afford the cyclic urea
derivative XL-3. This compound is converted to XL-4 by reaction
with compound XXXIX-8 as described in Scheme XXXIX.
##STR00078##
[0542] The nitro group of commercially available
2-amino-5-bromo-3-nitropyridine (XLI-1) is reduced under standard
conditions using, for example, tin (II) chloride in EtOH. The
resulting diamine, XLI-2, reacts with formic acid, or an
appropriate equivalent, to afford the imidazopyridine derivative
XLI-3. This compound is converted to a suitably protected
derivative, for instance the N-trityl protected derivative XLI-4,
by reaction with trityl chloride in the presence of an appropriate
base, typically triethylamine or diisopropylethylamine. Typical
solvents for this reaction include CH.sub.2Cl.sub.2, DMF, or
mixtures thereof. The protecting group for the amine must be
compatible with subsequent chemistry, and must be readily removable
when desired. Methods for the protection of amines are well-known
to those of skill in the art, and are described in standard
reference volumes, such as Greene "Protective Groups in Organic
Synthesis" (published by Wiley-Interscience). XLI-4 is converted to
XLI-5 according to the general procedure described in Scheme I. The
trityl protecting group is removed under standard acidic conditions
(see Greene above), and the ester is saponified as in Scheme Ito
afford XLI-6.
##STR00079## ##STR00080##
[0543] Commercially-available tetrahydroquinoline (XLII-1) is
condensed with an appropriate aldehyde, typically benzaldehyde
(PhCHO), under standard conditions to afford the olefinic
derivative XLII-2. Oxidative cleavage of the exocyclic olefin
affords ketone XLII-3. Generally, ozonolysis in a neutral solvent,
such as methylene chloride (CH.sub.2Cl.sub.2), methanol (MeOH), or
mixtures thereof, followed by in situ reduction of the intermediate
ozonide with an appropriate reducing agent, usually
dimethylsulfide, is the method of choice for this transformation.
Compound XLII-3 is converted to the 7-membered lactam derivative
XLII-6 as described by Jossang-Yanagida and Gansser. This procedure
involves conversion of the ketone of XLII-3 to the corresponding
oxime XLII-4, which is subsequently converted to the O-tosyl
derivative XLII-5. A Beckmann-type rearrangement of XLII-5 affords
the lactam XLII-6. Bromination of XLII-6 with a suitable
brominating agent, such as bromine (Br.sub.2) or N-bromosuccinimide
(NBS), affords the bromo derivative XLII-7. Typical solvents for a
bromination reaction include CH.sub.2Cl.sub.2, CCl.sub.4, MeOH,
AcOH, or mixtures thereof. Bromide VII-7 reacts with an appropriate
a4-unsaturated ester, for example tert-butyl acrylate, in a
Heck-type reaction as described in Scheme Ito afford XLII-8. The
tert-butyl ester of XLII-8 is cleaved to the corresponding
carboxylic acid XLII-9 under standard acidic conditions. Typical
conditions for this transformation are described in standard
reference volumes, such as Greene "Protective Groups in Organic
Synthesis" (published by Wiley-Interscience). XLII-9 is converted
to XLII-10 by the general method described in Scheme I.
##STR00081##
[0544] Compound XLIII-1, prepared as described in Scheme XL, reacts
with two equivalents of an appropriate acylating agent, preferably
di-tert-butyl dicarbonate, to afford XLIII-2. As discussed in
Scheme XLI, the protecting group for the amines must be compatible
with subsequent chemistry, and must be readily removable when
desired. XLIII-2 is deprotonated with a suitable base, generally
sodium hydride (NaH), and the intermediate sodium salt is reacted
with an appropriate alkylating agent, for instance ethyl
bromoacetate, to afford XLIII-3. Polar solvents such as DMF, THE,
or mixtures thereof are generally preferred for this reaction. The
Boc protecting groups are removed under standard acidic conditions
(see Greene above) to afford XLIII-4, which undergoes cyclization
to compound XLIII-5 on exposure to a suitable base, typically
triethylamine (Et.sub.3N) or diisopropylethylamine
((i-Pr).sub.2NEt). An inert solvent, such as toluene, is preferred.
XLIII-5 is converted to XLIII-6 by the general method described in
Scheme XXXIX.
##STR00082##
[0545] Commercially available 2,5-dibromopyridine (XLIV-1) reacts
with 2-aminopyridine in the presence of a suitable base, typically
sodium tert-butoxide, to afford the dipyridylamine derivative
XLIV-2. The reaction is mediated by a suitable palladium (0)
catalyst, such as tris(dibenzylideneacetone)dipalladium(0), in the
presence of an appropriate ligand, for example
1,3-bis(diphenylphosphino)propane. A neutral solvent such as
toluene is preferred.
##STR00083##
[0546] Benzylic bromide XLV-1, prepared as described in Scheme
XXXIX, reacts with an appropriate a-aminoester equivalent, for
example N-(diphenylmethylene)glycine ethyl ester, under basic
conditions, to provide XLV-2. A polar, aprotic solvent, such as
DMF, THF, DME, or mixtures thereof, is generally preferred, and
sodium hydride is typically the base of choice, although LDA or
LiN(TMS).sub.2 might also be used. Alternatively, the reaction
might be conducted in an alcoholic solvent, such as methanol or
ethanol, with an alkali metal alkoxide, for example sodium
methoxide or sodium ethoxide, as the base. The diphenylmethylene
group is conveniently removed under acidic conditions, such as HCl
in aqueous dioxane. Other conditions for the removal of a
diphenylmethylene group are known to those of skill in the art, and
can be found in the chemical literature or in standard reference
volumes, such as Greene (see above).
[0547] It will be recognized by one skilled in the art that other
methods of LHS and RHS synthesis can be employed in the preparation
of said intermediates. Likewise other methods of amide and/or
carbon-carbon bond formation may be used to assemble the compounds
of the invention. It is also apparent that combinations of LHS and
RHS other than those described above can be envisioned to prepare
compounds falling within the scope of the invention as represented
by formulas I-III. These possibilities are further detailed in the
preparations and examples section to follow.
[0548] Acid addition salts of the compounds of formulas I-III can
be prepared in a standard manner in a suitable solvent from the
parent compound and an excess of an acid, such as hydrochloric,
hydrobromic, hydrofluoric, sulfuric, phosphoric, acetic,
trifluoroacetic, maleic, succinic or methanesulfonic. Certain of
the compounds form inner salts or zwitterions which may be
acceptable. Cationic salts may be prepared by treating the parent
compound with an excess of an alkaline reagent, such as a
hydroxide, carbonate or alkoxide, containing the appropriate
cation; or with an appropriate organic amine. Cations such as
Li.sup.+, Nat K.sup.+, Ca.sup.++, Mg.sup.++ and NH.sub.4.sup.+are
some non-limiting examples of cations present in pharmaceutically
acceptable salts.
Anti-Infective Agents
[0549] A second component in the compositions of the present
invention may be an anti-infective agent, other than, for example,
a Fab I inhibitor, such as other than a Fab I inhibitor disclosed
herein. Such anti-infective agents include antibiotic or
ant-bacterial agents, antivirals, anitfungals, enzyme inhibitors,
antiparastic agents, and/or antiprotozoal agents.
[0550] Anti-fungal agents include, but are not limited to,
terbinafine hydrochloride, nystatin, amphotericin B, griseofulvin,
ketoconazole, miconazole nitrate, flucytosine, fluconazole,
itraconazole, clotrimazole, benzoic acid, salicylic acid, and
selenium sulfide.
[0551] Anti-viral agents include, but are not limited to,
amantadine hydrochloride, rimantadin, acyclovir, famciclovir,
foscarnet, ganciclovir sodium, idoxuridine, ribavirin, sorivudine,
trifluridine, valacyclovir, vidarabin, didanosine, stavudine,
zalcitabine, zidovudine, interferon alpha, and edoxudine.
[0552] Anti-parasitic agents include, but are not limited to,
pirethrins/piperonyl butoxide, permethrin, iodoquinol,
metronidazole, diethylcarbamazine citrate, piperazine, pyrantel
pamoate, mebendazole, thiabendazole, praziquantel, albendazole,
proguanil, quinidine gluconate injection, quinine sulfate,
chloroquine phosphate, mefloquine hydrochloride, primaquine
phosphate, atovaquone, co-trimoxazole
(sulfamethoxazole/trimethoprim), and pentamidine isethionate.
[0553] Other non-limiting examples of bioactive agents that may be
used in the compositions of the present invention include
antibiotics suchs as cephalosporins, quinolones and
fluoroquinolones, penicillins, penicillins and beta lactamase
inhibitors, carbepenems, monobactams, macrolides and lincosamines,
glycopeptides, rifampin, oxazolidonones, tetracyclines,
aminoglycosides, streptogramins, sulfonamides, peptide antibiotics
and derivatives such as glycopeptides and lipopeptides,
oxasolidinones, streptogramins, trimethoprim-sulfomethoxazole,
quinupristin-dalfopristin, lincosamides, aminoglycosides,
tetracyclins, glycylcyclines, and others. Each family comprises
many members.
Cephalosporins
[0554] Cephalosporins are a class of .beta.-lactam antibiotics
derived from 7-aminocephalosporanic acid (7-ACA). .beta.-lactam
antibiotics disrupt cell wall synthesis by interfering with the
final crosslinking (transpeptidation) step of the peptidoglycan
layer. Cephalosporins have the same mechanism of action as
penicillins, but have a broader antibacterial spectrum and are
resistant to .beta.-lactamase. Cephalosporins may be commonly used
when the sensitivity of the bacterium is not known or when there is
a known allergy to penicillins.
[0555] Cephalosporins are further categorized by generation.
Non-limiting examples of cephalosporins by generation include the
following. Examples of generation I cephalosporins include
cefadroxil, cefazolin, cephalexin, cephalothin, cephapirin, and
cephradine. Examples of generation II cephalosporins include
cefaclor, cefamandol, cefonicid, cefotetan, cefoxitin, cefprozil,
ceftmetazole, cefuroxime, cefuroxime axetil, and loracarbef.
Examples of generation III cephalosporins include cefdinir,
ceftibuten, cefditoren, cefetamet, cefotiam HCl, cefpodoxime,
cefprozil, cefuroxime (axetil), cefuroxime (sodium), cefoperazone,
cefixime, cefotaxime, cefpodoxime proxetil, ceftazidime,
ceftizoxime, ceftriaxone, and moxalactam. Examples of generation IV
cephalosporins include cefepime and ceftobiprole.
Quinolones and Fluoroquinolones
[0556] Quinolones and fluoroquinolones are a class of
broad-spectrum antibiotics that are derived from nalidixic acid.
Quinolones and fluoroquinolones act bacteriocidically by inhibiting
DNA replication, synthesis, and transcription by inhibiting
bacterial DNA gyrases and topoisomerases.
[0557] Non-limiting examples of quinolones and fluoroquinolones
include amifloxacin, cinoxacin, ciprofloxacin, enrofloxacin,
enoxacin, fleroxacin, flumequine, garenoxacin, gatifloxacin,
gemifloxacin, grepafloxacin, levofloxacin, lomefloxacin,
moxifloxacin, nalidixic acid, norfloxacin, oxolinic acid,
ofloxacin, olamufloxacin, perfloxacin, pipemidic, rosoxacin,
rufloxacin, sparfloxacin, trovafloxacin, and tosufloxacin.
Penicillins
[0558] Penicillins are a class of .beta.-lactam antibiotics derived
from 6-aminopenicillanic acid (6-APA). Similar to cephalosporins,
penicillins interfere with the synthesis of the bacterial cell wall
by inhibiting a final crosslinking step in the peptidoglycan layer.
Penicillins has a molecular formula
R--C.sub.9H.sub.11N.sub.2O.sub.4S, where R is a variable side
chain.
[0559] Non-limiting examples of penicillins include amoxicillin,
ampicillin, bacampicillin, carbenicillin, carbenicillin indanyl,
mezlocillin, piperacillin, and ticarcillin.
Penicillins and Beta Lactamase Inhibitors
[0560] Bacteria may become resistant to penicillins because some
penicillins are sensitive to .beta.-lactamase. .beta.-lactamase is
a bacterial enzyme that can hydrolyze the .beta.-lactam bond of
.beta.-lactam antibiotics. Beta-lactamase inhibitors, including but
not limited to clavulanic acid and sulbactam, irreversibly bind to
and inhibit bacterial .beta.-lactamases. Inhibition of
.beta.-lactamases prevents the hydrolysis of the .beta.-lactam bond
present in .beta.-lactam antibiotics, such that the .beta.-lactam
antibiotic may enter the cell and disrupt bacterial cell wall
synthesis.
[0561] Non-limiting examples of penicillins and beta-lactamase
inhibitors include amoxicillin-clavulanic acid,
ampicillin-sulbactam, benzylpenicillin, cloxacillin, dicloxacillin,
methicillin, oxacillin, penicillin G (benzathine, potassium,
procaine), penicillin V, piperacillin+tazobactam,
ticarcillin+clavulanic acid, and nafcillin.
Carbepenems
[0562] Carbapenems are broad spectrum .beta.-lactam antibiotics
that may be used to treat both gram-positive and gram-negative
bacteria.
[0563] Non-limiting examples of carbepenems include doripenem,
imipenem-cilastatin, and meropenem.
Monobactams
[0564] Monobactams are monocyclic .beta.-lactam antibiotics.
Monobactams are narrow-spectrum antibiotics that may be used to
treat gram-negative bacteria (e.g., Psuedomonas,
Enterobacteriaceae).
[0565] A non-limiting example of a monobactam includes
aztreonam.
Macrolides, Ketolides, and Lincosamines
[0566] Macrolides are a class of antibiotics that contain a
macrolide ring, which is a large lactone ring comprising one or
more deoxy sugars such as cladinose and desoamine. The lactone ring
may be either 14, 15, or 16-membered. Macrolides are broad spectrum
antibiotics and are commonly used to treat respiratory and soft
tissue infections. Macrolides may also be used to treat patients
infected with a gram-positive organism who are allergic to
penicillins. Macrolides bind to 50S ribosomal subunit and disrupt
protein synthesis.
[0567] Ketolides are a class of macrolide antibiotics that are
derived from erythromycin. Ketolides are formed by substituting the
cladinose sugar of erythromycin with a keto-group and attaching a
cyclic carbamate group to the lactone ring. Ketolides inhibit
protein synthesis by binding to ribosomes and are broader spectrum
antibiotics compared to macrolides.
[0568] Lincosamines have similar mechanism of action to macrolides
and inhibit protein synthesis by binding to the 50S subunit of the
ribosome.
[0569] Non-limiting examples of macrolides and lincosamines include
azithromycin, clarithromycin, clindamycin, dirithromycin,
erythromycin, lincomycin, telithromycin, and troleandomycin.
Glycopeptides
[0570] Glycopeptides are a class of antibiotics that consist of
glycosylated cyclic or polycyclic nonribosomal peptide.
Glycopeptides inhibit the biosynthesis of the bacterial cell wall
by binding to peptidoglycan precursors.
[0571] Non-limiting examples of glycopeptides include dalbavancin,
oritavancin, telavancin, teicoplanin and vancomycin.
Rifamycins
[0572] Rifamycins are a class of antibiotics that bind to
DNA-dependent RNA polymerase and inhibit the initiation of RNA
synthesis.
[0573] Non-limiting examples of rifamycins include rifabutin,
rifampin, and rifapentine.
Oxazolidonones
[0574] Oxazolidinones are a class of antibiotics that inhibits
protein synthesis by binding to the 50S subunit of the ribosome to
prevent translation.
[0575] A non-limiting example of oxazolidinones includes
linezolid.
Tetracyclines
[0576] Tetracyclines are a class of antibiotics that inhibit cell
growth by inhibiting protein synthesis, specifically translation
(i.e., blocking the binding of tRNA to the 30S ribosomal subunit).
Tetracyclines are broad spectrum antibiotics, but because the
interaction of tetracyclines with the ribosome is weak and
reversible, tetracycline is a bacteriostatic antibiotic. Resistance
to tetracyclines results from one of two mechanisms: efflux or
ribosomal protection. Efflux occurs when a resistance gene encodes
a membrane protein that can actively pump tetracycline out of the
cell. Ribosomal protection occurs when a resistance gene encodes a
protein that binds to the ribosome and prevents tetracycline from
binding to the ribosome.
[0577] Non-limiting examples of tetracyclines include
demeclocycline, doxycycline, doxycycline hyclate, methacycline,
minocycline, oxytetracycline, tetracycline, and
chlortetracycline.
Aminoglycosides
[0578] Aminoglycosides are class of antibiotics containing an
aminocyclitol ring and one or more amino sugars. Aminoglycosides
inhibit bacterial protein synthesis by irreversibly binding to the
ribosomes (e.g., the interface between the 30S and 50S subunit and
additional sites on the individual subunits). Depending on where
the aminoglycoside binds the ribosome, the antibiotic may prevent
polysome formation or misreading of the mRNA. Aminoglycosides may
be used to treat many gram-negative and gram-positive bacteria.
Resistance to aminoglycosides may occur if there is a mutation in a
ribosome binding site, decreased uptake of the antibiotic into the
bacterial cell, or enzymatic modification (e.g., phosphorylation or
acetylation) of the antibiotic.
[0579] Non-limiting examples of aminoglycosides include amikacin,
amikacin sulfate, gentamicin, gentamicin sulfate, kanamycin,
metilmicin, neomycin, netilmicin, streptomycin, tobramycin, and
paromomycin.
Streptogramins
[0580] Streptogramins are a class of natural cyclic peptide
antibiotics that inhibit bacterial growth. Streptogramins consist
of at least two structurally unrelated molecules: group A
streptogramins (macrolactones) and group B streptrogramins (cycli
hexadepsipeptides). In some embodiments, Groups A and B act
synergistically to inhibit protein synthesis.
[0581] A non-limiting example of streptogramins includes
quinopristin+dalfopristin.
Sulfonamides
[0582] Sulfonamides, which are also known as sulfa drugs, are a
class of antibiotics derived from sulfonic acid. Sulfonamides are
competitive inhibitors of para-aminobenzoic acid (PABA), a
substrate of the enzyme dihyropteroate synthetase, and thus,
inhibit bacterial synthesis of folic acid. Sulfonamides are
bacteriostatic against a wide-spectrum of gram-positive and
gram-negative bacteria.
[0583] Non-limiting examples of sulfonamides include mafenide,
silver sulfadiazine, sulfacetamide, sulfadiazine, sulfamethoxazole,
sulfasalazine, sulfanilamide, sulfisoxazole,
trimethoprim-sulfamethoxazole, and sulfamethizole.
Others
[0584] Non-limiting examples of other antibiotic agents include
bacitracin, chloramphenicol, colistemetate, fosfomycin, isoniazid,
methenamine, metronidazol, mupirocin, nitrofurantoin,
nitrofurazone, novobiocin, polymyxin B, spectinomycin,
trimethoprim, colistin, cycloserine, capreomycin, pyrazinamide,
para-aminosalicyclic acid, erythromycin
ethylsuccinate+sulfisoxazole, and tigecycline.
[0585] The anti-infective agents described herein may also be used
to inhibit aspartate semidlehyde dehydrogenase, deoxyuridine
5'-triphosphate nucleotidohydrolase, farnesyl disphosphate
synthase, guanylate kinase, NH3-dependent NAD synthetase,
hydroxymethyglutaryl-CoA reductase, peptide deformylase,
peptidyl-tRNA hydrolase, phosphodiesterase, putative methylase
yhhF, ribose-phosphate 3-epimerase, ribose-phosphate
pryo-phosphokinase, thymidylate kinase, and xanthine phosphoribosyl
transferase.
Toxicology of Compounds
[0586] Acute toxicity can be assessed using increasing doses in
mice and rodents. Exploratory acute toxicity in mice and/or rats
after single dose may be undertaken to begin estimation of the
therapeutic window of inhibitors and to identify the potential
target organis of toxicity. These studies may be combined with
routine PK measurements to assure proper dosages were achieved.
Generally 3-4 doses will be chosen that are estimated to span a
range having no effect through to higher doses that cause major
toxic, but non-lethal, effects.
Resistance Frequencies and Mechanisms of Compounds
[0587] In vitro resistance frequencies in bacteria of interest can
be estimated for compounds of formula I. Experiments can determine
whether resistant isolates arise when challenged to grow on solid
media at 1.times., 2.times. and 4.times.MIC concentrations. For
example with respect to S. aureus or E. coli, the experiments may
use several recent clinical isolates of methicillin-sensitive and
methicillin-resistant S. aureus and a laboratory strain of E. coli
with acrA efflux pump defect. In addition, experiments may use
several characterized triclosan-resistant S. aureus strains. The
MICs of resistant strains isolated in this manner can then be
determined. Subsequent experiments can determine whether resistant
strains arise after serial passage of the strains in 0.5.times.MIC
concentrations of each lead compound.
[0588] Mechanism of resistance may be determined in S. aureus
laboratory strain, RN450 and in an E. coli laboratory strain
carrying an acrA efflux pump mutation. Both high dose challenge
(4.times.MIC) and sub-MIC serial passage may be used to obtain
spontaneously arising resistant isolates. If no isolates are
obtained with reasonable frequencies, chemical and physical
mutagenesis methods can be used to obtain resistant isolates. The
fabI gene from the chromosome of resistant isolates may be PCR
amplified, then may be sequenced to determine whether changes in
the FabI protein caused resistance. Triplicate PCR amplifications
and sequences may be performed to assure that the observed sequence
changes are correct, and did not arise from PCR errors during
amplification. Strains carrying resistance mutations outside of the
gene of interest may be documented and saved, characterized for
their effects on susceptibilities of other antibiotics as evidence
of possible efflux-mediated resistance mechanisms, characterized
for their ability to alter compounds characterized for their
effects on the expression of the specific mRNA and FabI
protein.
Cloning of S. aureus FabI
[0589] The fabI gene was cloned from the chromosomal DNA of S.
aureus strain WCUH29 using the polymerase chain reaction.
Amplification was performed using Taq DNA polymerase (BRL) and the
following primers: 5'-CGCCTCGAGATGTTAAATCTTGAAAACAAAACATATGTC-3'
and 5'-CGCGGATCCAATCAAGTCAGGTTGAAATATCCA-3' (XhoI and BamHI sites
underlined). The resulting fragment was then digested with XhoI and
BamHI and ligated into XhoI- and BamHI-digested expression vector
pET-16b (Novagen), producing pET-His.sub.10-fabI. The gene sequence
of fabI was confirmed by automated cycle sequencing using an
Applied Biosystems model 377 machine. The untagged version of
pET-fabI was constructed by digesting pET-His.sub.10-fabI with NcoI
and NdeI to remove a 97 by fragment encoding the His 10 tag, the
factor Xa cleavage site and the first 8 amino acids of FabI, and
replacing it with a linker encoding the first 8 amino acids of FabI
plus a glycine residue between the initiator methionine and the
lysine at position 2. This plasmid was called pET-fabI. The linker
was made by annealing the following two oligonucleotides:
5'-CATGGGCTTAAATCTTGAAAACAAAACA-3' and
5'-TATGTTTTGTTTTCAAGATTTAAGCC-3'. The linker sequence in pET-fabI
was confirmed by dideoxy sequencing. Only native FabI was used for
compound evaluation. For overproduction of native FabI, plasmid
pET-fabI was transformed into BL21(DE3) (Novagen) cells, to form
strain BL21(DE3):pET-fabI.
Purification of S. aureus FabI
[0590] S. aureus FabI was expressed as soluble protein to 10% of
total cell protein, 400 g cells being recovered from 15 L
fermentation in tryptone phosphate medium. The cells were lysed and
the sample centrifuged. The resulting supernatant was filtered and
purified using three consecutive chromatography columns:
ion-exchange (Sourse 15Q), dye-affinity (Blue sepharose), and size
exclusion chromatography columns (Superose 12). After each column
the FabI containing fractions were pooled, concentrated, and
checked for purity and biological activity.
Cloning/Expression Haemophilus influenzae FabI
[0591] The FabI gene was PCR amplified from Haemophilus influenzae
(Q1) genomic DNA. Oligonucleotide primers were designed with unique
restriction sites at both the N' and C' terminal ends of the gene
to allow efficient sub-cloning into the expression vector
pPROLar.
TABLE-US-00001 FORWARD PRIMER KpnI 5'
GCGGTACCCATGCGCTTGGTTTTCTTAGAAATATTG '3 REVERSE PRIMER NotI 5'
GCGGCCGCTTATTCTTCGCCTAATTCGCCCATTGC '3
[0592] PCR amplification was performed using Pfu Turbo DNA
polymerase as per the instructions of the manufacturer
(Stratagene). The following cycling conditions were used:
95.degree. C. for 3 minutes followed by 30 cycles of 94.degree. C.
1 minute, 55.degree. C. 1 minute and 72.degree. C. 3 minutes. A
final extension at 72.degree. C. for 5 minutes was carried out. PCR
products of expected size for Haemophilus influenzae FabI were
cloned into the PCR cloning vector TOPO TA 2.1 as per instructions
of the manufacturer (Invitrogen). The fidelity of the presumptive
PCR amplified Haemophilus influenzae FabI gene was confirmed by DNA
sequencing on both strands using an ABI 377 Automative DNA
Sequencer (Applied Biosystems). pPROLar was digested with KpnI and
Nod restriction endonucleases using conditions as recommended by
the supplier (New England Biolabs). Purification of the linear
plasmid, was achieved using agarose gel purification and the
Qia-quick gel purification kit as per the protocol supplied by the
manufacturer (Qiagen). The Haemophilus influenzae FabI gene was
excised from TOPO TA 2.1 by KpnI and Nod restriction endonuclease
digestion and purified as above. Subsequent fragment/vector
ligations were carried out using T4 DNA ligase, using conditions
supplied by the manufacturer (Promega).
[0593] Transformations into E. coli TOP 10 competent cells are
performed using the protocol as supplied by the manufacturer
(Invitrogen). Verification of the resultant clones are carried out
using colony PCR and restriction endonuclease digestion. Positive
clones were then transformed into the expression strain E. coli
DH5.alpha.PRO, which expresses AraC in addition to the lac
repressor.
[0594] Subsequent clones are then evaluated for expression at
small-scale using the conditions as recommended by the manufacturer
(Clontech). Expression analysis showed over-expressed protein bands
of correct size for Haemophilus influenzae FabI clearly visible by
SDS PAGE. Protein identity was further confirmed by peptide mass
fingerprinting. Further analysis by N-terminal Amino Acid
sequencing of the purified protein showed that the N-terminus
starts 35 residues downstream of the presumptive initiation codon.
DNA sequence analysis also highlighted the presence of a ribosome
binding site upstream and correctly spaced from the new initiation
codon. These findings match perfectly with E. coli FabI and the
protein is also now a similar size to other FabIs. The
over-expression construct has managed to use the correct ribosome
binding site and start at the correct ATG to give the correct
protein.
Purification of H. influenzae FabI
[0595] One liter of cells containing the H. influenzae FabI
expression construct were grown to an OD600 of 0.6. Expression was
induced as described above and the cells were grown for a further 3
h and then harvested. The cell pellet was re-suspended in 10 ml 50
mM Tris pH 7.5, 1 mM PMSF, 1 mM benzamidine, 1 mM DTT (buffer A)
and lysed by sonication. Cell debris was removed by centrifugation.
The supernatant was loaded onto a Hi-load Q (16/10) column
(Pharmacia) equilibrated in buffer A. Protein was eluted over a 200
mL gradient of 0-100% buffer B, where buffer B is buffer A+1 M KCl.
Fractions containing FabI were identified by SDS PAGE and by their
FabI activity and pooled.
[0596] 1.5 M ammonium sulfate was added to the pooled fractions and
these were then loaded onto a Hi-load phenyl sepharose (16/10)
column (Pharmacia) equilibrated in 50 mM Tris pH 7.5, 1 mM PMSF, 1
mM benzamidine, 1 mM DTT, 1.5 M ammonium sulfate. Proteins were
eluted with a gradient of ammonium sulfate (1.5 to 0 M) over 200
mL. Fractions containing FabI were identified as above and pooled.
The pooled fractions were buffer exchanged into 100 mM Tris, pH
7.5, 2 mM DTT and glycerol was then added to 50%. The protein was
stored at -20.degree. C. The identity of the protein was confirmed
by N-terminal sequencing and MALDI mass spectrometry.
Cloning of E. coli FabI
[0597] A PCR fragment of correct size for E. coli FabI was PCR
amplified from E. coli chromosomal DNA, subcloned into the TOPO TA
cloning vector, and verified by colony PCR+restriction endonuclease
analysis. The presumptive E. coli FabI PCR fragment was subcloned
into the expression vector pBluePet. The FabI clone was transformed
into E. coli strain BL21(DE3). Small Scale expression studies show
an over-expressed protein band of correct molecular weight
(.about.28 Kda) for E. coli FabI clearly visible following
Coomassie staining of SDS PAGE gels. DNA sequencing of the E. coli
FabI expression constructs illustrated that no errors were
apparent. N' terminal amino acid sequencing has confirmed the
over-expressed protein band to be E. coli FabI.
Purification of E. coli FabI
[0598] E. coli FabI was expressed as soluble protein to 15% of
total cell protein, 120 g cells being recovered from 3 L
fermentation in shake flasks in modified terrific broth. The cells
were lysed and the sample centrifuged. The resulting supernatant
was filtered and purified using three consecutive chromatography
columns: ion-exchange (Sourse 15Q), dye-affinity (blue sepharose),
and size exclusion (superose 12). After each column the FabI
containing fractions were pooled, concentrated and checked for
purity and biological activity.
S aureus FabI Enzyme Inhibition Assay (NADH)
[0599] Assays were carried out in half-area, 96-well microtitre
plates. Compounds were evaluated in 50-uL assay mixtures containing
100 mM NaADA, pH 6.5 (ADA=N-[2-acetamido]-2-iminodiacetic acid), 4%
glycerol, 0.25 mM crotonoyl CoA, 1 mM NADH, and an appropriate
dilution of S. aureus FabI. Inhibitors were typically varied over
the range of 0.01-10 uM. The consumption of NADH was monitored for
20 minutes at 30.degree. C. by following the change in absorbance
at 340 nm. Initial velocities were estimated from an exponential
fit of the non-linear progress curves represented by the slope of
the tangent at t=0 min. IC.sub.50's were estimated from a fit of
the initial velocities to a standard, 4-parameter model and are
typically reported as the mean.+-.S.D. of duplicate determinations.
Triclosan, a commercial antibacterial agent and inhibitor of FabI,
is included in all assays as a positive control. Compounds of this
invention have IC.sub.50's from about 5.0 micromolar to about 0.05
micromolar or less.
H. influenzae FabI Enzyme Inhibition Assay
[0600] Assays are carried out in half-area, 96-well microliter
plates. Compounds are evaluated in 150-uL assay mixtures containing
100 mM MES, 51 mM diethanolamine, 51 mM triethanolamine, pH 6.5
(MES=2-(N-morpholino)ethanesulfonic acid), 4% glycerol, 25 uM
crotonoyl-ACP, 50 uM NADH, and an appropriate dilution of H.
influenzae FabI (approximately 20 nM). Inhibitors are typically
varied over the range of 0.01-10 uM. The consumption of NADH is
monitored for 20 minutes at 30.degree. C. by following the change
in absorbance at 340 nm. Initial velocities are estimated from an
exponential fit of the non-linear progress curves. IC.sub.50's are
estimated from a fit of the initial velocities to a standard,
4-parameter model, and are typically reported as the mean.+-.S.D.
of duplicate determinations. The apparent Ki is calculated assuming
the inhibition is competitive with crotonoyl-ACP. A proprietary
lead compound is currently included in all assays as a positive
control.
E. coli FabI Enzyme Inhibition Assay
[0601] Assays were carried out in half-area, 96-well microtitre
plates. Compounds were evaluated in 150-uL assay mixtures
containing 100 mM NaADA, pH 6.5
(ADA=N-[2-acetamido]-2-iminodiacetic acid), 4% glycerol, 0.25 mM
crotonoyl CoA, 50 uM NADH, and an appropriate dilution of E. coli
FabI. Inhibitors were typically varied over the range of 0.01-10
uM. The consumption of NADH was monitored for 20 minutes at
30.degree. C. by following the change in absorbance at 340 nm.
Initial velocities were estimated from an exponential fit of the
non-linear progress curves represented by the slope of the tangent
at t=0 min. IC.sub.50's were estimated from a fit of the initial
velocities to a standard, 4-parameter model and are typically
reported as the mean.+-.S.D. of duplicate determinations.
Triclosan, a commercial antibacterial agent and inhibitor of FabI,
is currently included in all assays as a positive control.
Compounds of this invention may have IC.sub.50's from about 100.0
micromolar to about 0.05 micromolar.
Preparation and Purification of Crotonoyl-ACP
[0602] Reactions contained 5 mg/mL E. coli apo-ACP, 0.8 mM
crotonoyl-CoA (Fluka), 10 mM MgCl.sub.2, and 30 uM S. pneumoniae
ACP synthase in 50 mM NaHEPES, pH 7.5. The mixture was gently mixed
on a magnetic stirrer at 23.degree. C. for 2 hr, and the reaction
was terminated by the addition of 15 mM EDTA. The reaction mixture
was filtered through a 0.2 micron filter (Millipore) and applied to
a MonoQ column (Pharmacia) equilibrated with 20 mM Tris-Cl, pH 7.5.
The column was washed with buffer until all non-adherent material
was removed (as observed by UV detection), and the crotonoyl-ACP
was eluted with a linear gradient of 0 to 400 mM NaCl.
S. aureus FabI Enzyme Inhibition Assay Using Crotonoyl-ACP
[0603] Assays are carried out in half-area, 96-well microtitre
plates. Compounds are evaluated in 150 uL assay mixtures containing
100 mM NaADA, pH 6.5 (ADA=N-(2-acetamido)-2-iminodiacetic acid), 4%
glycerol, 25 uM crotonoyl-ACP, 50 uM NADPH, and an appropriate
dilution of S. aureus Fab I (approximately 20 nM). Inhibitors are
typically varied over the range of 0.01-10 uM. The consumption of
NADPH is monitored for 20 minutes at 30.degree. C. by following the
change in absorbance at 340 nm. Initial velocities are estimated
from a linear fit of the progress curves. IC50's are estimated from
a fit of the initial velocities to a standard, 4-parameter model
(Equation 1) and are typically reported as the mean.+-.S.D. of
duplicate determinations. Compounds of this invention in this assay
have IC.sub.50's from about 100.0 micromolar to about 0.04
micromolar. The apparent Ki is calculated from Equation 2 assuming
the inhibition is competitve with crotonoyl-ACP.
v=Range/(1+[I]/IC50)s+Background Equation 1
Ki(app)=IC50/(1+[S]/Ks) Equation 2
Antimicrobial Activity Assay
[0604] Whole-cell antimicrobial activity was determined by broth
microdilution using the National Committee for Clinical Laboratory
Standards (NCCLS) recommended procedure, Document M7-A4, "Methods
for Dilution Susceptibility Tests for Bacteria that Grow
Aerobically". The compound was tested in serial two-fold dilutions
ranging from 0.06 to 64 mcg/mL. A panel of 12 strains were
evaluated in the assay. This panel consisted of the following
laboratory strains: Staphylococcus aureus Oxford, Streptococcus
pneumoniae R6, Streptococcus pyogenes CN10, Enterococcus faecalis
I, Haemophilus influenzae Q1, Escherichia coli DCO, E. coli ESS, E.
coli 7623 (AcrAB.sup.+) E. coli 120 (AcrAB.sup.-) Klebsiella
pneumoniae E70, Pseudomonas aeruginosa K799 wt and Candida albicans
GRI 681. The minimum inhibitory concentration (MIC) was determined
as the lowest concentration of compound that inhibited visible
growth. A mirror reader was used to assist in determining the MIC
endpoint.
[0605] One skilled in the art would consider any antibacterial
compositions of the present invention with a MIC of less than 256
.mu.g/mL to be a potential lead composition. The antibacterial
compositions used in the antimicrobial assays may have a MIC value
of less than 128 .mu.g/mL. Said compositions may have a MIC value
of less than 64 .mu.g/mL.
Method for Checkerboard Combination Studies
[0606] The combination experiments were performed and the results
were interpreted using the checkerboard method as described in
Eliopoulous, G. M., and R. C. Moellering, 1996, Antimicrobial
combinations, p. 330-396, In V. Lorian (ed.), Antibiotics in
laboratory medicine, 4th ed., The Williams & Wilkins Co.,
Baltimore, Md., in 96-well microliter plates. Compound A was
serially diluted along the x-axis of the test plate to a final
volume of 50 .mu.l, and compound B was serially diluted in a
separate transfer plate. Dilutions in both plates were made in
CAMHB (cation-adjusted Mueller Hinton broth) for Staphylococci and
in CAMHB+5% sheep blood for Streptococci. Aliquots (50 .mu.l) of
Compound B were transferred to the test plate along the y-axis
thereby achieving a checkerboard matrix of antimicrobial
combinations (100 .mu.l total volume) as in FIG. 4. The first
column and last row (shaded in FIG. 4) contained only compound B or
compound A, respectively. Plates were then inoculated with 10 .mu.l
of the test microorganism and MICs were determined according to
NCCLS guidelines (see National Committee for Clinical Laboratory
Standards, 2000, Methods for Dilution Antimicrobial Susceptibility
Tests for Bacteria That Grow Aerobically--Fifth Edition, Approved
Standard M7-A5, NCCLS, Wayne, Pa., USA.)
[0607] Data analysis was performed as follows and according to
Eliopoulous, G. M., and R. C. Moellering, 1996, Antimicrobial
combinations, p. 330-396, In V. Lorian (ed.), Antibiotics in
laboratory medicine, 4th ed., The Williams & Wilkins Co.,
Baltimore, Md. First individual FIC values for each combination in
a plate were calculated:
FIC (Fractional Inhibitory Concentration)=FICA+FICB [0608]
FICA=MICA+B/MICA i.e. the MIC of combination of compound A+compound
B divided by the MIC of compound A alone. [0609] FICB=MICB+A/MICB
i.e. the MIC of combination of compound B+compound A divided by the
MIC of compound B alone.
[0610] FIC values were calculated only for combinations that
enabled determination of a true MIC (e.g. not > or <=values).
FIC indexes were then calculated as the average of individual FIC
values for each combination plate.
[0611] A summary of the FIC index values is presented below in
Tables 1 and 2. Table 3 indicates combination time-kill kinetics
for two bacterial strains.
TABLE-US-00002 TABLE 1 Summary of combination MICs with compounds
of formulas I-III and other antibiotics using the checkerboard
method. FIC Index Antibiotic Strains.sup.a A B C D E F G Vancomycin
S. aureus 29213 .gtoreq.0.5 .ltoreq. 2 ND .gtoreq.0.5 .ltoreq. 2
.gtoreq.0.5 .ltoreq. 2 .gtoreq.0.5 .ltoreq. 2 ND 1 S. aureus
43300.sup.b .gtoreq.0.5 .ltoreq. 2 ND .gtoreq.0.5 .ltoreq. 2
.gtoreq.0.5 .ltoreq. 2 .gtoreq.0.5 .ltoreq. 2 .gtoreq.0.5 .ltoreq.
2 0.75 S. epidermidis 39 <0.5 ND ND <0.5 .gtoreq.0.5 .ltoreq.
2 ND ND Rifampicin S. aureus 29213 .gtoreq.0.5 .ltoreq. 2 ND ND
.gtoreq.0.5 .ltoreq. 2 .gtoreq.0.5 .ltoreq. 2 ND 0.8 S. aureus
43300.sup.b .gtoreq.0.5 .ltoreq. 2 ND ND .gtoreq.0.5 .ltoreq. 2
.gtoreq.0.5 .ltoreq. 2 ND 0.75 S. epidermidis 39 <0.5 ND ND
.gtoreq.0.5 .ltoreq. 2 .gtoreq.0.5 .ltoreq. 2 ND ND Gentamcin S.
aureus 29213 ND ND ND ND ND ND 0.3 S. aureus 43300.sup.b
.gtoreq.0.5 .ltoreq. 2 ND ND <0.5 ND ND 0.4 Tetracycline S.
aureus 29213 .gtoreq.0.5 .ltoreq. 2 ND ND .gtoreq.0.5 .ltoreq. 2 ND
ND 2 S. aureus 43300.sup.b ND ND ND ND ND ND 1 Ceftriaxone S.
aureus 29213 .gtoreq.0.5 .ltoreq. 2 .gtoreq.0.5 .ltoreq. 2
.gtoreq.0.5 .ltoreq. 2 ND ND ND S. aureus 43300.sup.b ND ND
.gtoreq.0.5 .ltoreq. 2 ND ND ND S. pneumoniae 49619 ND ND
.gtoreq.0.5 .ltoreq. 2 ND ND ND Cefuroxime S. aureus 29213
.gtoreq.0.5 .ltoreq. 2 .gtoreq.0.5 .ltoreq. 2 .gtoreq.0.5 .ltoreq.
2 ND ND ND 0.8 S. aureus 43300.sup.b ND ND .gtoreq.0.5 .ltoreq. 2
ND ND ND 0.5 S. pneumoniae 49619 ND ND .gtoreq.0.5 .ltoreq. 2 ND ND
ND ND Cefotaxime S. aureus 29213 .gtoreq.0.5 .ltoreq. 2 .gtoreq.0.5
.ltoreq. 2 .gtoreq.0.5 .ltoreq. 2 ND ND ND S. aureus 43300.sup.b ND
ND .gtoreq.0.5 .ltoreq. 2 ND ND ND S. pneumoniae 49619 ND ND
.gtoreq.0.5 .ltoreq. 2 ND ND ND Linezolid S. aureus 29213 ND ND ND
ND ND ND 0.5 S. aureus 43300.sup.b ND ND ND ND ND ND 0.5
Erythromycin S. aureus 29213 ND ND ND ND ND ND 2 Nafcillin S.
aureus 29213 ND ND ND ND ND ND 0.8 S. aureus 43300.sup.b ND ND ND
ND ND ND 0.7 Cloxacillin S. aureus 29213 ND ND ND ND ND ND 2 S.
aureus 43300.sup.b ND ND ND ND ND ND 0.75 Levofloxacin S. aureus
29213 ND ND ND ND ND ND 1 S. aureus 43300.sup.b ND ND ND ND ND ND 2
.sup.aBacterial species are Staphylococcus aureus, Staphylococcus
epidermidis and Streptococcus pneumoniae. .sup.bS. aureus strain
43300 is a methicillin-resistant (MRSA) strain. FIC index
intrepretation is .ltoreq.0.5 = synergy; >0.5 .ltoreq. 2 =
additivity; >2 .ltoreq. 4 = indifference; and >4 =
antagonism.
TABLE-US-00003 TABLE 2 Summary of combination MIC with compound G
and commercial antibiotics against clinical bacterial isolates.
Azithro- Ceftri- Cefuro- Gati- Levo- Mero- Peni- mycin axone xime
fioxacin floxacin penem cillin Species Strain FIC.sup.a E. coli
EC_25922 0.7 <2 0.6 E. faecalis EF_A6221420.sup.b <2 <2
<2 <2 H. influenzae HI_49247 <2 P. aeruginosa PA_27853
<2 <2 S. aureus SA_29213.sup.b 0.6 <2 <2 1 0.7
SA_A6250596.sup.b <2 <2 <2 1 1 <2 <2
SA_A7080336.sup.b 0.6 0.6 S. epidermidis SE_A7100750.sup.b 1 <2
0.6 S. mitis SMI_116 <2 <2 <2 <2 S. pneumoniae
SP_22257.sup.b <2 SP_22425.sup.b <2 <2 <2 <2 <2
S. pyogenes SPY_20015 <2 SPY_20061.sup.b <2 <2 .sup.aFIC
index: .ltoreq.0.5 = synergy; >0.5 .ltoreq. 2 = additivity;
>2 .ltoreq. 4 indifference; >4 = antagonism .sup.bPhenotype
of indicated strain: E. faecalis strain EF_A6221420, VRE; S. aureus
strain SA_29213, MSSA; S. aureus strain SA_A6250596, MRSA-MDR; S.
aureus strain SA_A7080336, MRSA; S. epidermidis strain SE_A7100750,
MRSE CipR; S. pneumoniae strain SP_22257, PenR EryS ClinS; S.
pneumoniae strain SP_22425, PenR EryR ClinR; and S. pyogenes strain
SPY_20061, EryS.
TABLE-US-00004 TABLE 3 Summary of combination time-kill kinetics
for S. pneumoniae and E. faecalis strains. Combination Time-kill
kinetics for S. pneumoniae 22425 logCFU/ml at Time (hr):
.DELTA.logCFU/ml Compound Combination 0 2 6 24 (24-0 hr) Growth
Control 5.10 5.68 7.11 7.55 2.46 Compound G (0.03 ug/ml) 5.20 5.63
7.25 7.61 2.41 Compound G (1 ug/ml) 5.12 5.61 7.18 7.58 2.45
Gatifloxacin - 4xMIC (2 ug/ml) 5.18 4.26 2.77 1.70* -3.48
Gatifloxacin - 4xMIC + Compound G (0.03 ug/ml) 5.14 4.17 2.58 1.70*
-3.44 Gatifloxacin - 4xMIC + Compound G (1 ug/ml) 5.19 4.23 2.67
1.70* -3.49 Combination Time-kill kinetics for S. pneumoniae 22257
logCFU/ml at Time (hr): .DELTA.logCFU/ml Compound Combination 0 3 6
8 24 (24-0 hr) Growth Control 6.45 8.35 9.03 9.61 9.69 3.24
Compound G (0.03 ug/ml) 6.41 8.31 9.23 9.32 9.68 3.26 Compound G (1
ug/ml) 6.43 8.30 9.33 9.47 9.68 3.25 Azithromycin - 4xMIC (0.12
ug/ml) 6.35 4.53 3.39 1.70* 1.70* -4.65 Azithromycin - 4xMIC +
Compound G (0.03 ug/ml) 6.41 4.49 3.47 1.70* 1.70* -4.72
Azithromycin - 4xMIC + Compound G (1 ug/ml) 6.32 4.58 3.46 1.70*
1.70* -4.62 Growth Control 6.39 8.23 9.47 9.36 9.70 3.31 Compound G
(0.03 ug/ml) 6.20 8.15 9.35 9.32 9.65 3.45 Compound G (1 ug/ml)
6.30 8.17 9.20 9.41 9.71 3.40 Cefuroxime - 4xMIC (8 ug/ml) 6.39
1.92 1.70 1.70* 1.70* -4.69 Cefuroxime - 4xMIC + Compound G (0.03
ug/ml) 6.32 2.00 1.70 1.70* 1.70* -4.62 Cefuroxime - 4xMIC +
Compound G (1 ug/ml) 6.25 1.92 1.70 1.70* 1.70* -4.55 Combination
Time-kill kinetics for S. pneumoniae 22257 logCFU/ml at Time (hr):
.DELTA.logCFU/ml Compound Combination 0 3 6 8 24 (24-0 hr) Growth
Control 6.39 8.23 9.47 9.36 9.70 3.31 Compound G (0.03 ug/ml) 6.20
8.15 9.35 9.32 9.65 3.45 Compound G (1 ug/ml) 6.30 8.17 9.20 9.41
9.71 3.40 Cefuroxime - 4xMIC (8 ug/ml) 6.39 1.92 1.70 1.70* 1.70*
-4.69 Cefuroxime - 4xMIC + Compound G (0.03 ug/ml) 6.32 2.00 1.70
1.70* 1.70* -4.62 Cefuroxime - 4xMIC + Compound G (1 ug/ml) 6.25
1.92 1.70 1.70* 1.70* -4.55 Combination Time-kill kinetics for E.
faecalis A6221420 logCFU/ml at Time (hr): .DELTA.logCFU/ml Compound
Combination 0 2 4 8 24 (24-0 hr) Growth Control 5.09 6.12 6.49 9.88
9.91 4.82 Compound G (0.03 ug/ml) 5.10 6.03 6.42 9.88 9.91 4.81
Compound G (1 ug/ml) 5.12 5.93 6.53 9.76 9.91 4.79 Meropenem -
4xMIC (16 ug/ml) 5.12 4.31 3.41 2.67 1.70* -3.43 Meropenem - 4xMIC
+ Compound G (0.03 ug/ml) 5.05 4.24 3.38 2.64 1.92 -3.13 Meropenem
- 4xMIC + Compound G (1 ug/ml) 5.07 4.26 3.34 2.60 1.82 -3.25 *at
lower limit of detection
Dosages
[0612] The dosage of any compositions of the present invention will
vary depending on the symptoms, age and body weight of the patient,
the nature and severity of the disorder to be treated or prevented,
the route of administration, and the form of the subject
composition. Any of the subject formulations may be administered in
a single dose or in divided doses. Dosages for the compositions of
the present invention may be readily determined by techniques known
to those of skill in the art or as taught herein.
[0613] In certain embodiments, the dosage of the subject compounds
will generally be in the range of about 0.01 ng to about 10 g per
kg body weight, specifically in the range of about 1 ng to about
0.1 g per kg, and more specifically in the range of about 100 ng to
about 10 mg per kg.
[0614] An effective dose or amount, and any possible affects on the
timing of administration of the formulation, may need to be
identified for any particular composition of the present invention.
This may be accomplished by routine experiment as described herein,
using one or more groups of animals (preferably at least 5 animals
per group), or in human trials if appropriate. The effectiveness of
any subject composition and method of treatment or prevention may
be assessed by administering the composition and assessing the
effect of the administration by measuring one or more applicable
indices, and comparing the post-treatment values of these indices
to the values of the same indices prior to treatment.
[0615] The precise time of administration and amount of any
particular subject composition that will yield the most effective
treatment in a given patient will depend upon the activity,
pharmacokinetics, and bioavailability of a subject composition,
physiological condition of the patient (including age, sex, disease
type and stage, general physical condition, responsiveness to a
given dosage and type of medication), route of administration, and
the like. The guidelines presented herein may be used to optimize
the treatment, e.g., determining the optimum time and/or amount of
administration, which will require no more than routine
experimentation consisting of monitoring the subject and adjusting
the dosage and/or timing.
[0616] While the subject is being treated, the health of the
patient may be monitored by measuring one or more of the relevant
indices at predetermined times during the treatment period.
Treatment, including composition, amounts, times of administration
and formulation, may be optimized according to the results of such
monitoring. The patient may be periodically reevaluated to
determine the extent of improvement by measuring the same
parameters. Adjustments to the amount(s) of subject composition
administered and possibly to the time of administration may be made
based on these reevaluations.
[0617] Treatment may be initiated with smaller dosages which are
less than the optimum dose of the compound. Thereafter, the dosage
may be increased by small increments until the optimum therapeutic
effect is attained.
[0618] The use of the subject compositions may reduce the required
dosage for any individual agent contained in the compositions
(e.g., the FabI inhibitor) because the onset and duration of effect
of the different agents may be complimentary. For example, the
dosage may be selected to modulate metabolism of the bacteria in
such a way as to inhibit or stop growth of said bacteria or by
killing said bacteria. The skilled artisan may identify this amount
as provided herein as well as by using other methods known in the
art.
[0619] Toxicity and therapeutic efficacy of subject compositions
may be determined by standard pharmaceutical procedures in cell
cultures or experimental animals, e.g., for determining the
LD.sub.50 and the ED.sub.50.
[0620] The data obtained from the cell culture assays and animal
studies may be used in formulating a range of dosage for use in
humans. The dosage of any subject composition lies preferably
within a range of circulating concentrations that include the
ED.sub.50 with little or no toxicity. The dosage may vary within
this range depending upon the dosage form employed and the route of
administration utilized. For compositions of the present invention,
the therapeutically effective dose may be estimated initially from
cell culture assays.
Formulation
[0621] The antibacterial compositions of the present invention may
be administered by various means, depending on their intended use,
as is well known in the art. For example, if compositions of the
present invention are to be administered orally, they may be
formulated as tablets, capsules, granules, powders or syrups.
Alternatively, formulations of the present invention may be
administered parenterally as injections (intravenous, intramuscular
or subcutaneous), drop infusion preparations or suppositories. For
application by the ophthalmic mucous membrane route, compositions
of the present invention may be formulated as eyedrops or eye
ointments, for example, formulated as micronized suspensions in
isotonic, pH adjusted saline, with optionally, for example a
preservative, or formulated in an ointment such as petrolatum.
These formulations may be prepared by conventional means, and, if
desired, the compositions may be mixed with any conventional
additive, such as an excipient, a binder, a disintegrating agent, a
lubricant, a corrigent, a solubilizing agent, a suspension aid, an
emulsifying agent or a coating agent.
[0622] The ratio between the FabI inhibitor and the at least one
other antibacterial agent may vary within relatively broad ranges
and will be dependent on the intended use. It is contemplated that
the compositions of the present invention may comprise a ratio in
the range of about 0.01:1 to 1:100 between the FabI inhibitor and
the bioactive agent. In other embodiments, ratios of Fab I
inhibitor to anti-infective agent by weight may range from about
1:10 to about 50:1, or from about 1:5 to about 20:1, or about 1:1
to about 15:1, e.g. about 12:1. In certain embodiments, the two or
more agents in the subject compositions work synergistically.
[0623] In formulations of the subject invention, wetting agents,
emulsifiers and lubricants, such as sodium lauryl sulfate and
magnesium stearate, as well as coloring agents, release agents,
coating agents, sweetening, flavoring and perfuming agents,
preservatives and antioxidants may be present in the formulated
compositions. Such formulations may include further various
antibacterial and antifungal agents, for example, paraben,
chlorobutanol, phenol sorbic acid, and the like.
[0624] Subject compositions may be suitable for oral, nasal,
topical (including buccal and sublingual), rectal, vaginal, aerosol
and/or parenteral administration. The formulations may conveniently
be presented in unit dosage form and may be prepared by any methods
well known in the art of pharmacy. The amount of composition that
may be combined with a carrier material to produce a single dose
vary depending upon the subject being treated, and the particular
mode of administration. For administration by inhalation for
example, compositions disclosed hereing may be delivered through an
aerosol spray in the form of for example, a solution, dry powder or
cream.
[0625] Methods of preparing these formulations include the step of
bringing into association compositions of the present invention
with the carrier and, optionally, one or more accessory
ingredients. In general, the formulations are prepared by uniformly
and intimately bringing into association agents with liquid
carriers, or finely divided solid carriers, or both, and then, if
necessary, shaping the product.
[0626] Formulations suitable for oral administration may be in the
form of capsules, cachets, pills, tablets, lozenges (using a
flavored basis, usually sucrose and acacia or tragacanth), powders,
granules, or as a solution or a suspension in an aqueous or
non-aqueous liquid, or as an oil-in-water or water-in-oil liquid
emulsion, or as an elixir or syrup, or as pastilles (using an inert
base, such as gelatin and glycerin, or sucrose and acacia), each
containing a predetermined amount of a subject composition thereof
as an active ingredient. Compositions of the present invention may
also be administered as a bolus, electuary, or paste.
[0627] In solid dosage forms for oral administration (capsules,
tablets, pills, dragees, powders, granules and the like), the
subject composition is mixed with one or more pharmaceutically
acceptable carriers, such as sodium citrate or dicalcium phosphate,
and/or any of the following: (1) fillers or extenders, such as
starches, lactose, sucrose, glucose, mannitol, and/or silicic acid;
(2) binders, such as, for example, carboxymethylcellulose,
alginates, gelatin, polyvinyl pyrrolidone, sucrose and/or acacia;
(3) humectants, such as glycerol; (4) disintegrating agents, such
as agar-agar, calcium carbonate, potato or tapioca starch, alginic
acid, certain silicates, and sodium carbonate; (5) solution
retarding agents, such as paraffin; (6) absorption accelerators,
such as quaternary ammonium compounds; (7) wetting agents, such as,
for example, acetyl alcohol and glycerol monostearate; (8)
absorbents, such as kaolin and bentonite clay; (9) lubricants, such
a talc, calcium stearate, magnesium stearate, solid polyethylene
glycols, sodium lauryl sulfate, and mixtures thereof; and (10)
coloring agents. In the case of capsules, tablets and pills, the
compositions may also comprise buffering agents. Solid compositions
of a similar type may also be employed as fillers in soft and
hard-filled gelatin capsules using such excipients as lactose or
milk sugars, as well as high molecular weight polyethylene glycols
and the like.
[0628] A tablet may be made by compression or molding, optionally
with one or more accessory ingredients. Compressed tablets may be
prepared using binder (for example, gelatin or hydroxypropylmethyl
cellulose), lubricant, inert diluent, preservative, disintegrant
(for example, sodium starch glycolate or cross-linked sodium
carboxymethyl cellulose), surface-active or dispersing agent.
Molded tablets may be made by molding in a suitable machine a
mixture of the subject composition moistened with an inert liquid
diluent. Tablets, and other solid dosage forms, such as dragees,
capsules, pills and granules, may optionally be scored or prepared
with coatings and shells, such as enteric coatings and other
coatings well known in the pharmaceutical-formulating art.
[0629] Liquid dosage forms for oral administration include
pharmaceutically acceptable emulsions, microemulsions, solutions,
suspensions, syrups and elixirs. In addition to the subject
composition, the liquid dosage forms may contain inert diluents
commonly used in the art, such as, for example, water or other
solvents, solubilizing agents and emulsifiers, such as ethyl
alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl
alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol,
oils (in particular, cottonseed, groundnut, corn, germ, olive,
castor and sesame oils), glycerol, tetrahydrofuryl alcohol,
polyethylene glycols and fatty acid esters of sorbitan, and
mixtures thereof.
[0630] Suspensions, in addition to the subject composition, may
contain suspending agents as, for example, ethoxylated isostearyl
alcohols, polyoxyethylene sorbitol and sorbitan esters,
microcrystalline cellulose, aluminum metahydroxide, bentonite,
agar-agar and tragacanth, and mixtures thereof.
[0631] Formulations for rectal or vaginal administration may be
presented as a suppository, which may be prepared by mixing a
subject composition with one or more suitable non-irritating
excipients or carriers comprising, for example, cocoa butter,
polyethylene glycol, a suppository wax or a salicylate, and which
is solid at room temperature, but liquid at body temperature and,
therefore, will melt in the body cavity and release the active
agent. Formulations which are suitable for vaginal administration
also include pessaries, tampons, creams, gels, pastes, foams or
spray formulations containing such carriers as are known in the art
to be appropriate.
[0632] Dosage forms for transdermal administration of a subject
composition includes powders, sprays, ointments, pastes, creams,
lotions, gels, solutions, patches and inhalants. The active
component may be mixed under sterile conditions with a
pharmaceutically acceptable carrier, and with any preservatives,
buffers, or propellants which may be required.
[0633] The ointments, pastes, creams and gels may contain, in
addition to a subject composition, excipients, such as animal and
vegetable fats, oils, waxes, paraffins, starch, tragacanth,
cellulose derivatives, polyethylene glycols, silicones, bentonites,
silicic acid, talc and zinc oxide, or mixtures thereof.
[0634] Powders and sprays may contain, in addition to a subject
composition, excipients such as lactose, talc, silicic acid,
aluminum hydroxide, calcium silicates and polyamide powder, or
mixtures of these substances. Sprays may additionally contain
customary propellants, such as chlorofluorohydrocarbons and
volatile unsubstituted hydrocarbons, such as butane and
propane.
[0635] Compositions of the present invention may alternatively be
administered by aerosol. This is accomplished by preparing an
aqueous aerosol, liposomal preparation or solid particles
containing the compound. A non-aqueous (e.g., fluorocarbon
propellant) suspension could be used. Sonic nebulizers may be used
because they minimize exposing the agent to shear, which may result
in degradation of the compounds contained in the subject
compositions.
[0636] Ordinarily, an aqueous aerosol is made by formulating an
aqueous solution or suspension of a subject composition together
with conventional pharmaceutically acceptable carriers and
stabilizers. The carriers and stabilizers vary with the
requirements of the particular subject composition, but typically
include non-ionic surfactants (Tweens, Pluronics, or polyethylene
glycol), innocuous proteins like serum albumin, sorbitan esters,
oleic acid, lecithin, amino acids such as glycine, buffers, salts,
sugars or sugar alcohols. Aerosols generally are prepared from
isotonic solutions.
[0637] Pharmaceutical compositions of this invention suitable for
parenteral administration comprise a subject composition in
combination with one or more pharmaceutically-acceptable sterile
isotonic aqueous or non-aqueous solutions, dispersions, suspensions
or emulsions, or sterile powders which may be reconstituted into
sterile injectable solutions or dispersions just prior to use,
which may contain antioxidants, buffers, bacteriostats, solutes
which render the formulation isotonic with the blood of the
intended recipient or suspending or thickening agents.
[0638] Examples of suitable aqueous and non-aqueous carriers which
may be employed in the pharmaceutical compositions of the invention
include water, ethanol, polyols (such as glycerol, propylene
glycol, polyethylene glycol, and the like), and suitable mixtures
thereof, vegetable oils, such as olive oil, and injectable organic
esters, such as ethyl oleate. Proper fluidity may be maintained,
for example, by the use of coating materials, such as lecithin, by
the maintenance of the required particle size in the case of
dispersions, and by the use of surfactants.
[0639] A pharmaceutical composition is therefore provided
comprising a composition of this disclosure and a pharmaceutically
acceptable carrier or excipient. Such a composition may be
formulated for example, for intraveneous administration, injectable
administration, topical application, and/or as suppository.
Compositions disclosed herein may formulated, for example, for
systemic administration and/or oral administration. For example,
such a composition may be formulated in tablets such that the
amount of composition provided in 20 tablets, if taken together,
provides a dose of at least the ED.sub.50 but no more than ten
times the ED.sub.50. In some embodiments, the composition may be
formulated for parenteral administration such that the amount of
amount of antibacterial agent substantially inhibiting FabI
provided in 20 cc bolus injection provides a dose of at least the
ED.sub.50 but no more that ten times the ED.sub.50. In other
embodiments, the composition may be formulated for intravenous
infusion such that the amount of antibacterial agent substantially
inhibiting FabI provided in one liter of intravenous injectable
solution provides a dose of at least the ED.sub.50 but no more that
ten times the ED.sub.50.
[0640] A pill is also contemplated for reducing bacterial levels in
a subject with a bacteria related illness, comprising a composition
of this disclosure. In some embodiments, a pill provides effective
bacterial treatment for at least about 8 hours, at least about 12
hours, aat least about 24 hours, and/or at least about one week. A
pack of pills in number sufficient for treatment of a bacterial
illness is also contemplated, comprising a plurality of pills
wherein each pill comprises a composition or a compound disclosed
herein. In some embodiments, the pack contains at least 5 pills, at
least 10 pills, and/or at least 20 pills.
Efficacy of Treatment
[0641] The efficacy of treatment with the subject compositions may
be determined in a number of fashions known to those of skill in
the art.
[0642] In one exemplary method, the median survival rate of the
bacteria or bacteria median survival time or life span for
treatment with a subject composition may be compared to other forms
of treatment with the particular FabI inhibitor or bioactive agent
contained in the subject composition, or with other bioactive
agents. The decrease in median bacteria survival rate or time or
life span for treatment with a subject composition as compared to
treatment with another method may be 10, 25, 50, 75, 100, 150, 200,
300, 400% less or even more. The period of time for observing any
such decrease may be about 3, 5, 10, 15, 390, 60 or 90 or more
days. The comparison may be made against treatment with the
particular FabI inhibitor or bioactive agent contained in the
subject composition, or with other bioactive agents, or
administration of the same or different agents by a different
method, or administration as part of a different drug delivery
device than a subject composition. The comparison may be made
against the same or a different effective dosage of the various
agents. The different regiments compared may use bacterial
levels.
[0643] Alternatively, a comparison of the different treatment
regimens described above may be based on the effectiveness of the
treatment, using standard indicies for bacterial infections known
to those of skill in the art. One method of treatment may be 10%,
20%, 30%, 50%, 75%, 100%, 150%, 200%, 300% more effective, than
another method.
[0644] Alternatively, the different treatment regimens may be
analyzed by comparing the therapeutic index for each of them, with
treatment with a subject composition as compared to another regimen
having a therapeutic index two, three, five or seven times that of,
or even one, two, three or more orders of magnitude greater than,
treatment with another method using the same or different FabI
inhibitor, bioactive agent or combinations thereof.
Kits
[0645] This invention also provides kits for conveniently and
effectively implementing the methods of this invention. Such kits
comprise any subject composition, and a means for facilitating
compliance with methods of this invention. Such kits may provide a
convenient and effective means for assuring that the subject to be
treated takes the appropriate active in the correct dosage in the
correct manner. The compliance means of such kits includes any
means which facilitates administering the actives according to a
method of this invention. Such compliance means include
instructions, packaging, and dispensing means, and combinations
thereof. Kit components may be packaged for either manual or
partially or wholly automated practice of the foregoing methods. In
other embodiments involving kits, this invention contemplates a kit
including compositions of the present invention, and optionally
instructions for their use.
[0646] The present invention also provides for kits containing at
least one dose of a subject composition, and often many doses, and
other materials for a treatment regimen. For example, in one
embodiment, a kit of the present invention contains sufficient
subject composition for from five to thirty days and optionally
equipment and supplies necessary to measure one or more indices
relevant to the treatment regiment. In another embodiment, kits of
the present invention contain all the materials and supplies,
including subject compositions, for carrying out any methods of the
present invention. In still another embodiment, kits of the present
invention, as described above, additionally include instructions
for the use and administration of the subject compositions.
[0647] For example, a kit contemplated herein may comprise at least
two compartments, wherein a first compartment comprises an Fab I
inhibiting agent and a second compartment comprises a
anti-infective agent, and optionally wherein a combination of the
said Fab I inhibiting agent and said anti-infective agent are
present in amounts that are non-antagonist. The compartments may
comprise a single bottle, which together form a twin-bottle
kit.
[0648] In another embodiment, the first or second compartment may
be in the form of an infusion bag and the first or second
compartment may be in the form of a bottle or ampoule. The first
and/or the second compartment may be in the form of a syringe.
Exemplification
General
[0649] Proton nuclear magnetic resonance (.sup.1H NMR) spectra were
recorded at either 300 or 400 MHz, and chemical shifts are reported
in parts per million (8) downfield from the internal standard
tetramethylsilane (TMS). Abbreviations for NMR data are as follows:
s=singlet, d=doublet, t=triplet, q=quartet, m=multiplet, dd=doublet
of doublets, dt=doublet of triplets, app=apparent, br=broad. J
indicates the NMR coupling constant measured in Hertz. CDCl.sub.3
is deuteriochloroform, DMSO-d.sub.6 is
hexadeuteriodimethylsulfoxide, and CD.sub.3OD is
tetradeuteriomethanol. Mass spectra were obtained using
electrospray (ES) ionization techniques. Elemental analyses were
performed by Quantitative Technologies Inc., Whitehouse, N.J.
Melting points were obtained on a Thomas-Hoover melting point
apparatus and are uncorrected. All temperatures are reported in
degrees Celsius. Analtech Silica Gel GF and E. Merck Silica Gel 60
F-254 thin layer plates were used for thin layer chromatography.
Flash chromatography was carried out on E. Merck Kieselgel 60
(230-400 mesh) silica gel. Analytical HPLC was performed on Beckman
chromatography systems. Preparative HPLC was performed using Gilson
chromatography systems. ODS refers to an octadecylsilyl derivatized
silica gel chromatographic support. YMC ODS-AQ.RTM. is an ODS
chromatographic support and is a registered trademark of YMC Co.
Ltd., Kyoto, Japan. PRP-1.RTM. is a polymeric
(styrene-divinylbenzene) chromatographic support, and is a
registered trademark of Hamilton Co., Reno, Nev. Celite.RTM. is a
filter aid composed of acid-washed diatomaceous silica, and is a
registered trademark of Manville Corp., Denver, Colo. General
abbreviations are as follows:
EDC=1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride,
HOBt=1-hydroxybenzotriazole hydrate, (I--Pr).sub.2EtN.dbd.N,
N-diisopropylethylamine, DMF=N,N-dimethylformamide, MeOH=methanol,
EtOH=ethanol, THF=tetrahydrofuran, DMSO=dimethylsulfoxide,
Et.sub.2O=diethyl ether, Ar=argon,
Pd(OAc).sub.2=palladium(II)acetate,
P(o-tol).sub.3=tri-ortho-tolylphoshine, EtOAc=ethyl acetate,
ACE-Cl=1-chloroethyl chloroformate, satd=saturated,
Et.sub.3N=triethylamine, TFA=trifluoroacetic acid,
NaBH(OAc).sub.3=sodium triacetoxyborohydride, HOAc=acetic acid,
EtCN=proprionitrile, CBzCl=benzyl chloroformate,
MeCN=acetonitrile.
[0650] Preparation of Intermediates for Compounds of Formula I and
the Synthesis of compounds of formula I, as described in part in
Schemes I-XXXV, have been disclosed in PCT Patent Application
PCT/US03/38706, filed Dec. 5, 2003, and hereby are incorporated
herein in their entirety.
Preparation 1
Preparation of (E)-3-(6-aminopyridin-3-yl)acrylic acid (Method
A)
a) Benzyl (E)-3-(6-aminopyridin-3-yl)acrylate
[0651] A solution of 2-amino-5-bromopyridine (2.25 g, 13.0 mmole),
benzyl acrylate (3.2 g, 19.7 mmole), Pd(OAc).sub.2 (0.31 g, 1.4
mmole), tri-ortho-tolylphosphine (0.73 g, 2.4 mmole), and
diisopropylethylamine (3.5 mL, 20.0 mmole) in propionitrile (50 mL)
was heated at reflux overnight. The dark mixture was filtered
through Celite.RTM., and the filtrate was concentrated. Flash
chromatography on silica gel (3% MeOH/CH.sub.2Cl.sub.2) gave the
title compound (1.3 g, 39%): MS (ES) m/e 255 (M+H).sup.+.
b) (E)-3-(6-Aminopyridin-3-yl)acrylic acid
[0652] A solution of benzyl (E)-3-(6-aminopyridin-3-yl)acrylate
(1.3 g, 5.1 mmole) (E)-3-(6-aminopyridin-3-yl)acrylate (1.3 g, 5.1
mmole) and 1.0 N NaOH (10 mL, 10 mmole) in MeOH was heated at
reflux overnight. The solution was concentrated in vacuo, and the
residue was dissolved in H.sub.2O. The pH was adjusted to 6 with
dilute HCl, and the solid precipitate was collected by suction
filtration and dried to give the title compound (0.6 g, 72%) as a
white solid: MS (ES) m/e 165 (M+H).sup.+.
Preparation 2
Preparation of (E)-3-(6-aminopyridin-3-yl)acrylic acid (Method
B)
a) (E)-3-(6-Aminopyridin-3-yl)acrylic acid
[0653] Acrylic acid (23 mL, 0.33 mole) was added carefully to a
solution of 2-amino-5-bromopyridine (25.92 g, 0.15 mole) and
Na.sub.2CO.sub.3 (55.64 g, 0.53 mole) in H.sub.2O (600 mL).
PdCl.sub.2 (0.53 g, 0.003 mole) was then added, and the mixture was
heated at reflux. After 24 hr, the reaction was cooled to RT and
filtered, and the filtrate was adjusted to pH 6 with aqueous HCl.
Additional H.sub.2O (0.5 L) was added to improve mixing, and the
mixture was stirred for 1 hr. The pH was readjusted to 6, then the
solid was collected by suction filtration. The filter pad was
washed sequentially with H.sub.2O (2.times.0.5 L), cold absolute
EtOH (100 mL), and Et.sub.2O (2.times.250 mL). Drying in high
vacuum at elevated temperature gave the title compound (15.38 g,
62%) as a tan solid: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
8.11 (d, J=2.0 Hz, 1H), 7.75 (dd, J=8.7, 2.0 Hz, 1H), 7.43 (d,
J=15.8 Hz, 1H), 6.53 (s, 2H), 6.45 (d, J=8.7 Hz, 1H), 6.22 (d,
J=15.8 Hz, 1H); MS (ES) m/e 165 (M+H).sup.+.
Preparation 3
Preparation of (E)-3-(2-aminopyrimidin-5-yl)acrylic acid
a) Benzyl (E)-3-(2-aminopyrimidin-5-yl)acrylate
[0654] According to the procedure of Preparation 1(a), except
substituting 5-bromo-2-aminopyrimidine (1.95 g, 11.2 mmole) for
2-amino-5-bromopyridine, the title compound (2.25 g, 79%) was
prepared as a light orange solid: MS (ES) m/e 256 (M+H).sup.+.
b) (E)-3-(2-Aminopyrimidin-5-yl)acrylic acid
[0655] According to the procedure of Preparation 1(b), except
substituting benzyl (E)-3-(2-aminopyrimidin-5-yl)acrylate (2.93 g,
11.5 mmole) for benzyl (E)-3-(6-aminopyridin-3-yl)acrylate, the
title compound (1.71 g, 90%) was prepared as an off-white solid: MS
(ES) m/e 166 (M+
Preparation 4
Preparation of 6-bromo-3,4-dihydro-1H-1,8-naphthyridin-2-one
a) 2-Amino-3-(hydroxymethyl)pyridine
[0656] Solid 2-aminonicotinic acid (199 g, 1.44 mole) was added in
portions over 4 hr to 1.0 M LiAlH.sub.4 in THF (3 L, 3 mole) with
stirring under Argon. An ice-bath was applied to control the
temperature below 30.degree. C. After the addition was complete,
the reaction was heated at reflux for 16 hr, then was cooled to
0.degree. C. and carefully quenched by sequential addition of
H.sub.2O (120 mL), 15% NaOH in H.sub.2O (120 mL), and H.sub.2O (350
mL). The resulting thick suspension was stirred for 1 hr, then was
filtered through a pad of Celite.RTM.. The filter pad was rinsed
with THF (1 L), and the filtrate was concentrated to dryness to
give the title compound (156 g, 87%) as a pale yellow waxy solid:
MS (ES) ink 125.1 (M+H).sup.+; .sup.1H NMR (400 MHz, DMSO-d.sub.6)
.quadrature. 7.84 (dd, 1H), 7.37 (m, 1H), 6.53 (dd, 1H), 5.65 (br
s, 2H), 5.16 (t, 1H), 4.34 (d, J=4.6 Hz, 2H).
b) 2-Amino-5-bromo-3-(hydroxymethyl)pyridine hydrobromide
[0657] To a stirred solution of 2-amino-3-(hydroxymethyl)pyridine
(156 g, 1.257 mole) in HOAc (2.5 L) at ambient temperature was
added bromine (64.1 mL, 1.257 mole) dropwise over 1 hr. A
suspension began to form during the addition. An exotherm to
36.degree. C. was controlled with an ice bath. After the addition,
the reaction mixture was stirred at ambient temperature overnight.
The yellow precipitate was filtered, washed with ether and
air-dried to give the title compound (289 g, 81%): MS (ES) m/e
203.2 (M+H).sup.+; .sup.1H NMR (400 MHz, DMSO-d.sub.6, free base)
.delta. 7.89 (d, J=2.3 Hz, 1H), 7.52 (s, 1H), 5.92 (br s, 2H), 5.29
(br s, 1H), 4.30 (s, 2H).
c) 2-Amino-5-bromo-3-(bromomethyl)pyridine hydrobromide
[0658] A suspension of 2-amino-5-bromo-3-(hydroxymethyl)pyridine
hydrobromide (289 g, 1.02 mole) in 48% aqueous HBr (2.9 L) was
heated at reflux for 12 hrs. Complete solution occurred during
heating. The reaction mixture was cooled and a crystalline
precipitate formed. This was filtered and washed with ethyl acetate
and air dried to give the title compound (305 g, 86%).
d) Methyl
(.+-.)-6-bromo-2-oxo-1,2,3,4-tetrahydro-1H-1,8-naphthyridine-3-c-
arboxylate
[0659] To a solution of dimethyl malonate (224 g, 1.7 mole) in DMF
(2 L) and THF (2 L) stirred under argon and chilled to 3.degree. C.
with an ice-acetone bath was added NaH (60% Nujol dispersion, 69.2
g, 1.7 mole) in portions over 1.5 hr. The anion solution was
stirred for 15 min at ca. 5.degree. C., then
2-amino-5-bromo-3-(bromomethyl)pyridine hydrobromide (200 g, 0.56
mole) was added in portions over 15 min. The reaction mixture was
allowed to warm to ambient temperature during overnight stirring
and then was heated to 80.degree. C. for 2 hr. The reaction was
then cooled and filtered and the precipitate was washed with ethyl
acetate. This solid was then vigorously stirred in 2 L water for 15
min and again filtered and air-dried to give the title compound
(113 g, 71%): MS (ES) m/e 286 (M+H).sup.+.
e) 6-Bromo-3,4-dihydro-1H-1,8-naphthyridin-2-one
[0660] To a suspension of methyl
(.+-.)-6-bromo-2-oxo-1,2,3,4-tetrahydro-1H-1,8-naphthyridine-3-carboxylat-
e (170 g, 0.596 mole) in CH.sub.3OH (10 L) was added 1.0 M NaOH
(2.5 L). The reaction mixture was stirred and heated at reflux for
5 hrs and then cooled to ambient temperature. The suspension was
acidified with 1.0 M HCl (3.0 L) and then was stirred and heated at
reflux overnight. The reaction slurry was cooled and filtered and
the solid was washed with water and vacuum dried to give the title
compound (122 g of the hydrate, 90%) as an off-white solid, HPLC
purity, 94%: MS (ES) m/e 228 (M+H).sup.+.
Preparation 5
Preparation of
6-bromo-3-methyl-3,4-dihydro-1H-pyrido[2,3-d]pyrimidin-2-one
a) 2-Amino-5-bromo-3-(methylaminomethyl)pyridine
[0661] A solution of 2-amino-5-bromo-3-(hydroxymethyl)pyridine
(5.00 g, 24.6 mmole), from Preparation 4 (b), in 48% aqueous HBr
(50 mL) was heated at reflux for 12 hrs. The reaction was
concentrated and toluene was used to azeotrope the residual
H.sub.2O. The resulting light brown solid was placed under high
vacuum overnight and used directly.
[0662] A solution of the 2-amino-3-(bromomethyl)-5-bromopyridine
hydrobromide salt (prepared above) in 40% aqueous methylamine (50
mL) and THF (50 mL) was stirred at RT overnight in a pressure
bottle. The reaction solution was concentrated and extracted with
EtOAc (2.times.100 mL). The combined organic phases were washed
with H.sub.2O, dried over Na.sub.2SO.sub.4 and concentrated.
Purification on silica gel afforded the title compound (4.25 g,
80%) as a yellow oil: MS (ES) m/e 217 (M+H).sup.+.
b) 6-Bromo-3-methyl-3,4-dihydro-1H-pyrido[2,3-d]pyrimidin-2-one
[0663] To a solution of
2-amino-5-bromo-3-(methylaminomethyl)pyridine (2.0 g, 9.3 mmole) in
dichloroethane (50 mL) was added 1,1'-carbonyldiimidazole (1.9 g,
11.5 mmole). The reaction was heated at 50.degree. C. overnight and
concentrated. The residue was purified on silica gel (9:1
CHCl.sub.3/CH.sub.3OH containing 5% NH.sub.4OH) to give the title
compound (1.72 g, 77%) as an off-white solid: MS (ES) m/e 243
(M+H).sup.+.
Preparation 6
Preparation of (E)-3-(3H-imidazo[4,5-b]pyridin-6-yl)acrylic
acid
a) 5-Bromo-2,3-diaminopyridine
[0664] To a suspension of 2-amino-5-bromo-3-nitropyridine (2.0 g,
9.17 mmole) in absolute EtOH (50 mL) was added SnCl.sub.2 hydrate
(9.3 g, 41.3 mmole), then the mixture was heated to reflux. After 3
hr the mixture was cooled to RT and concentrated. The residue was
taken up in 2.0 M NaOH and extracted with EtOAc (3.times.). The
combined organic layers were dried (MgSO.sub.4), filtered, and
concentrated to give the title compound (1.69 g, 98%) which was
sufficiently pure for use in the next step: MS (ES) m/e 188/190
(M+H).sup.+.
b) 6-Bromo-3H-imidazo[4,5-b]pyridine
[0665] 5-Bromo-2,3-diaminopyridine (1.69 g, 8.99 mmole) was taken
up in 96% formic acid (50 mL) and heated to reflux. After 18 hr the
mixture was cooled to RT and concentrated. The residue was taken up
in H.sub.2O and the pH was adjusted to 7 with 2.0 M NaOH. The title
compound (1.54 g, 87%) was collected as a solid by filtration,
washed with H.sub.2O, and dried in vacuo: MS (ES) m/e 198/200
(M+H).sup.+.
c) 6-Bromo-4-trityl-3H-imidazo[4,5-b]pyridine
[0666] To a suspension of 6-bromo-3H-imidazo[4,5-b]pyridine (1.2 g,
6.06 mmole) in CH.sub.2Cl.sub.2 (30 mL) was added Et.sub.3N (1.3
mL, 9.09 mmole) then trityl chloride (2.03 g, 7.27 mmole) at RT.
After 72 hr the mixture was washed with H.sub.2O (2.times.) and
brine, then was dried (MgSO.sub.4), filtered, and concentrated
under reduced pressure to afford the title compound. This was used
directly in the next step.
d) Benzyl
(E)-3-(4-trityl-3H-imidazo[4,5-b]pyridin-6-yl)acrylate
[0667] A solution of 6-bromo-4-trityl-3H-imidazo[4,5-b]pyridine
(from step a) (6.06 mmole), benzyl acrylate (1.18 g, 7.27 mmole),
Pd(OAc).sub.2 (67 mg, 0.30 mmole), P(o-tolyl).sub.3 (183 mg, 0.6
mmole), and (i-Pr).sub.2NEt (2.64 mL, 15.15 mmole) in propionitrile
(30 mL) was degassed (3.times.N.sub.2/vacuum) then heated to
reflux. After 4 hr the mixture was cooled to RT and concentrated.
Flash chromatography on silica gel (30% EtOAc/hexanes) gave the
title compound (1.75 g, 55% over 2 steps) as an off-white foam:
.sup.1H NMR (400 MHz, CDCl.sub.3) .delta. 8.24 (d, J=2.0 Hz, 1H),
8.19 (d, J=2.0 Hz, 1H), 8.06 (s, 1H), 7.77 (d, J=16.0 Hz, 1H),
7.42-7.11 (m, 20H), 6.48 (d, J=16.0 Hz, 1H), 5.25 (s, 2H).
d) (E)-3-(3H-Imidazo[4,5-b]pyridin-6-yl)acrylic acid
[0668] Benzyl
(E)-3-(4-trityl-3H-imidazo[4,5-b]pyridin-6-yl)acrylate (1.75 g,
3.35 mmole) was dissolved in 4 N HCl in dioxane (20 mL). After 1 hr
the mixture was concentrated. The residue was taken up in 1:1
MeOH/H.sub.2O (15 mL). 2.0 N NaOH (15 mL, 15 mmole) was added and
the mixture was heated to reflux. After 18 hr the mixture was
cooled to RT and concentrated to approximately 1/3 volume. The
mixture was adjusted to pH 4 using 10% HCl. The solid was collected
by filtration, washed with H.sub.2O, and dried in vacuo to give the
title compound (329 mg, 52% over 2 steps) as a white solid: .sup.1H
NMR (400 MHz, d.sup.6-DMSO) .delta. 9.10 (s, 1H), 8.94 (s, 1H),
8.84 (s, 1H), 8.20 (d, J=16.0 Hz, 1H), 7.10 (d, J=16.0 Hz, 1H).
Preparation 7
Preparation of
(E)-3-(3,4-dihydro-2H-pyrido[3,2-b]-1,4-oxazin-7-yl)acrylic
acid
a) 3,4-Dihydro-2H-pyrido[3,2-b]-1,4-oxazine
[0669] To a suspension of 2H-pyrido[3,2-b]-1,4-oxazin-3(4H)-one
(2.0 g, 13.3 mmole) in dry THF (40 mL) was added a solution of
LiAlH.sub.4 in THF (1.0 M, 26.6 mL, 26.6 mmole) slowly at 0.degree.
C. After 1 hr the mixture was quenched with 2.0 M NaOH until a
solid formed. The mixture was dried (MgSO.sub.4), filtered, and
concentrated under reduced pressure to give the title compound
(1.44 g, 79%) as a white solid which was sufficiently pure for use
in the next step: MS (ES) m/e 137 (M+H).sup.+.
b)
4-(tert-Butoxycarbonyl)-3,4-dihydro-2H-pyrido[3,2-b]-1,4-oxazine
[0670] To a solution of 3,4-dihydro-2H-pyrido[3,2-b]-1,4-oxazine
(1.44 g, 10.6 mmole) and di-tert-butyl dicarbonate (2.78 g, 12.7
mmole) in dry THF (50 mL) was added a solution of LiHMDS in THF
(1.0 M, 12.7 mL, 12.7 mmole) dropwise at 0.degree. C. After 30 min
the mixture was quenched with saturated NH.sub.4Cl and extracted
with EtOAc (3.times.). The combined organic layers were dried
(MgSO.sub.4), filtered, and concentrated. Flash chromatography on
silica gel (40% EtOAc/hexanes) gave the title compound (2.0 g, 80%)
as a clear oil: MS (ES) m/e 237 (M+H).sup.+.
c)
4-(tert-Butoxycarbonyl)-7-bromo-3,4-dihydro-2H-pyrido[3,2-b]1,4-oxazine
[0671] To a solution of
4-(tert-butoxycarbonyl)-3,4-dihydro-2H-pyrido[3,2-b]-1,4-oxazine
(2.0 g, 8.46 mmole) in MeOH (40 mL) was added Br.sub.2 (0.53 mL,
10.2 mmole) dropwise at 0.degree. C. After 1 hr the mixture was
concentrated. The residue was taken up in 1:1 Et.sub.2O/hexanes and
filtered. The filtrate was concentrated under reduced pressure to
give the title compound (1.27 g, 48%) as an oil which solidified
under vacuum: .sup.1H NMR (400 MHz, CDCl.sub.3) .delta. 8.10 (s,
1H), 7.33 (s, 1H), 4.25 (m, 2H), 3.92 (m, 2H), 1.54 (s, 9H).
d)
(E)-3-[4-(tert-Butoxycarbonyl)-3,4-dihydro-2H-pyrido[3,2-b]-1,4-oxazin--
7-yl]acrylic acid
[0672] A solution of
4-(tert-butoxycarbonyl)-7-bromo-3,4-dihydro-2H-pyrido[3,2-b]1,4-oxazine
(1.27 g, 4.03 mmole), benzyl acrylate (785 mg, 4.84 mmole),
Pd(OAc).sub.2 (45 mg, 0.20 mmole), P(o-tolyl).sub.3 (122 mg, 0.4
mmole), and (i-Pr).sub.2NEt (1.76 mL, 10.1 mmole) in propionitrile
(20 mL) was degassed (3.times.N.sub.2/vacuum) then heated to
reflux. After 18 hr the mixture was cooled to RT and concentrated.
Flash chromatography on silica gel (25% EtOAc/hexanes) gave the
title compound (1.17 g, 73%) as a yellow oil: MS (ES) ink 397
(M+H).sup.+.
e) (E)-3-(3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)acrylic
acid
[0673]
(E)-3-[4-(tert-Butoxycarbonyl)-3,4-dihydro-2H-pyrido[3,2-b]-1,4-oxa-
zin-7-yl]acrylic acid (1.17 g, 2.95 mmole) was dissolved in 4 N HCl
in dioxane (15 mL). After 72 hr the mixture was concentrated. The
residue was taken up in 1:1 MeOH/H.sub.2O (20 mL). 1.0 N LiOH (15
mL, 15 mmole) was added and the mixture was heated to reflux. After
18 hr the mixture was cooled to RT and concentrated to
approximately 1/3 volume. The mixture was adjusted to pH 6 using
10% HCl. The solid was collected by filtration, washed with
H.sub.2O and dried in vacuo to give the title compound (315 mg, 52%
over 2 steps): MS (ES) m/e 207 (M+H).sup.+.
Preparation 8
Preparation of 5-bromo-2,2'-dipyridylamine
[0674] To a stirred solution of 2,5-dibromopyridine (2.4 g, 10.1
mmole) in dry toluene (75 mL) were added 2-aminopyridine (1.0 g,
10.6 mmole), tris(dibenzylideneacetone)dipalladium(0) (183 mg, 0.2
mmole), 1,3-bis(diphenylphosphino)propane (165 mg, 0.4 mmole) and
sodium tert-butoxide (1.35 g, 14 mmole). The reaction was purged
with Ar then heated with stirring at 70.degree. C. After 4 h the
reaction was cooled to RT, taken up in Et.sub.2O (200 mL), washed
with brine, dried (MgSO.sub.4) and concentrated to dryness. The
remaining residue was purified by flash chromatography on silica
gel (0.5% (5% NH.sub.4OH/MeOH)/CHCl.sub.3), triturated with hexane
and dried under vacuum to give the title product (1.31 g, 52%) as a
pale yellow solid: .sup.1H NMR (400 MHz, CDCl.sub.3) .delta. 9.88
(s, 1H), 8.31 (s, 1H), 8.23 (d, J=4.8 Hz, 1H), 7.83 (m, 2H), 7.67
(t, 1H), 7.62 (d, J=8.4 Hz, 1H), 6.90 (t, 1H); MS (ES) m/e 250.0
(M+H).sup.+.
Preparation 9
Preparation of 1-methyl-2-(methylaminomethyl)-1H-indole
a) Ethyl 1-methyl-1H-indole-2-carboxylate
[0675] NaH (60% dispersion in mineral oil, 8.02 g, 200.49 mmole)
was washed with hexanes, then was suspended in dry DMF (530 mL).
Solid ethyl indole-2-carboxylate (25.29 g, 133.66 mmole) was added
portionwise over 5-10 min, allowing gas evolution to subside
between additions. When the addition was complete, the yellow
mixture was stirred for 15 min, then methyl iodide (42 mL, 668.3
mmole) was added all at once. The reaction was exothermic, and the
internal temperature rose to 40-45.degree. C. After 1 hr, the
reaction was quenched with 10% NH.sub.4Cl (100 mL) and concentrated
on the rotavap (high vacuum). The residue was partitioned between
Et.sub.2O (500 mL) and H.sub.2O (100 mL), and the layers were
separated. The Et.sub.2O layer was washed with H.sub.2O (100 mL),
dried (MgSO.sub.4), and concentrated to leave the title compound
(27.10 g, quantitative) as a light yellow solid. This was used
without further purification: TLC (10% EtOAc/hexanes) Rf=0.39.
b) N,1-Dimethyl-1H-indole-2-carboxamide
[0676] A suspension of ethyl 1-methyl-1H-indole-2-carboxylate
(27.10 g, 133.34 mmole) in 40% aqueous CH.sub.3NH.sub.2 (300 mL)
and MeOH (30 mL) was stirred at RT. A solid tended to gradually
creep up the walls of the flask, and was washed down periodically
with MeOH. The flask was tightly stoppered to keep the material
inside the flask. As the reaction proceeded, the solid dissolved,
but eventually the product began to precipitate. The reaction was
stirred at RT for 5 days, then was concentrated to remove
approximately 200 mL of the solvent. The remaining residue was
diluted with H.sub.2O (300 mL), and the solid was collected by
suction filtration and washed with H.sub.2O. Drying at
50-60.degree. C. in high vacuum left the title compound (23.45 g,
93%) as a faintly yellow solid: .sup.1H NMR (300 MHz, CDCl.sub.3)
.delta. 7.63 (d, J=8.0 Hz, 1H), 7.27-7.43 (m, 2H), 7.10-7.20 (m,
1H), 6.80 (s, 1H), 6.10-6.30 (m, 1H), 4.06 (s, 3H), 3.01 (d, J=4.9
Hz, 3H).
c) 1-Methyl-2-(methylaminomethyl)-1H-indole
[0677] A 3-liter 3-necked roundbottom flask equipped with overhead
stirring was charged with N,1-dimethyl-1H-indole-2-carboxamide
(23.45 g, 124.58 mmole) and anhydrous THF (170 mL). The solution
was stirred while a solution of LiAlH.sub.4 in THF (1.0 M, 250 mL,
250 mmole) was added via syringe. Gas was evolved during the
addition of the first 50 mL of LiAlH.sub.4 solution. When the
addition was complete, the resulting light yellow solution was
heated at gentle reflux. After 23 hr, the reaction was cooled in
ice and quenched by the sequential dropwise addition of H.sub.2O
(9.5 mL), 15% NaOH (9.5 mL), and H.sub.2O (28.5 mL). The mixture
was stirred for 15 min, then was filtered through Celite.RTM., and
the filter pad was washed thoroughly with THF. The filtrate was
concentrated and the residue was flash chromatographed on silica
gel (10% MeOH/CHCl.sub.3 containing 0.5% conc. NH.sub.4OH). The
title compound (20.17 g, 93%) was obtained as a light yellow oil:
.sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 7.56 (d, J=7.8 Hz, 1H),
7.02-7.35 (m, 3H), 6.38 (s, 1H), 3.88 (s, 2H), 3.75 (s, 3H), 2.49
(s, 3H).
Preparation 10
Preparation of 1-methyl-3-(methylaminomethyl)-1H-indole (Method
A)
a) Methyl 1-methyl-1H-indole-3-carboxylate
[0678] NaH (60% dispersion in mineral oil, 8.56 g, 214.0 mmole) was
added portionwise, allowing for gas evolution, to a solution of
methyl 1H-indole-3-carboxylate (25.00 g, 142.7 mmole) in DMF (350
mL) at 0.degree. C. When the NaH addition was complete, methyl
iodide (44.4 mL, 713.5 mmole) was added at 0.degree. C. The
reaction was stirred at 0.degree. C. for 15 minutes then at RT
overnight. The reaction was diluted with water and extracted with
ethyl acetate. The combined extracts were dried over
K.sub.2CO.sub.3 and concentrated to afford the title compound
(26.00 g, 96%) as an orange solid: MS (ES) m/e 190 (M+H).sup.+.
b) N,1-Dimethyl-1H-indole-3-carboxamide
[0679] A suspension of methyl 1-methyl-1H-indole-3-carboxylate
(4.30 g, 22.74 mmole) in 40% aqueous CH.sub.3NH.sub.2 (400 mL) was
stirred at RT. The flask was tightly stoppered to keep the material
inside the flask. As the reaction proceeded the product began to
precipitate. The reaction was stirred at RT for 3 days, then was
concentrated to remove approximately 200 mL of the solvent. The
remaining residue was diluted with H.sub.2O (500 mL), and the solid
was collected by suction filtration and washed with H.sub.2O. Flash
chromatography on silica gel (ethyl acetate) gave the title
compound (2.4 g, 56%) as a white solid: MS (ES) m/e 189
(M+H).sup.+.
c) 1-Methyl-3-(methylaminomethyl)-1H-indole
[0680] A solution of LiAlH.sub.4 in THF (1.0 M, 5.20 mL, 5.2 mmole)
was slowly added via syringe to a solution of
N,1-dimethyl-1H-indole-3-carboxamide (0.50 g, 2.6 mmole) in
anhydrous THF (15 mL). Gas was evolved during the addition of the
first 2 mL of LiAlH.sub.4 solution. When the addition was complete,
the resulting light yellow solution was heated at gentle reflux.
After 23 hr, the reaction was cooled in ice and quenched by the
sequential dropwise addition of H.sub.2O (0.5 mL), 1.0 N NaOH (0.5
mL), and H.sub.2O (0.5 mL). The mixture was stirred for 15 min,
then was filtered through Celite.RTM., and the filter pad was
washed thoroughly with THF. The filtrate was concentrated and the
residue was flash chromatographed on silica gel (10%
MeOH/CHCl.sub.3 containing 0.5% conc. NH.sub.4OH) to afford the
title compound (0.30 g, 67%) as a light yellow oil: MS (ES) m/e 175
(M+H).sup.+.
Preparation 11
Preparation of 1-methyl-3-(methylaminomethyl)-1H-indole (Method
B)
[0681] To a solution of 1-methylindole-3-carboxaldehyde (10.0 g,
62.8 mmole) in MeOH (100 mL) was added a solution of 2.0 M
CH.sub.3NH.sub.2 in MeOH (126 mL, 252.0 mmole). The reaction was
stirred at RT for 2 hrs, then was concentrated to a light yellow
oil. This oil was dissolved in EtOH (300 mL), and NaBH.sub.4 (2.38
g; 62.8 mmole) was added. After 2 hrs the reaction was concentrated
to a slurry and dissolved in 1.0 N NaOH (75 mL). The aqueous
solution was extracted with Et.sub.2O (2.times.200 mL) and the
combined organic fractions were dried over Na.sub.2SO.sub.4 and
concentrated. Flash chromatography on silica gel (9:1
CHCl.sub.3/MeOH containing 5% NH.sub.4OH) and drying in high vacuum
left the title compound (10.1 g, 92%) as a faintly yellow oil: MS
(ES) m/e 175 (M+H).sup.+.
Preparation 12
Preparation of 2-methyl-3-(methylaminomethyl)indole
[0682] To a solution of 2-methylindole-3-carboxaldehyde (10.00 g,
62.84 mmole) in MeOH (100 mL) was added 2 M CH.sub.3NH.sub.2 in
MeOH (200 mL). After stirring for 3 hours at RT, the reaction
solution was concentrated to a yellow oil which solidified under
vacuum. This solid was dissolved in ethanol (350 mL) and NaBH.sub.4
(2.38 g, 62.8 mmole) was added. The reaction was stirred at RT for
6 hours, then was concentrated under vacuum. The remaining residue
was diluted with saturated aqueous Na.sub.2CO.sub.3 (50 mL) and
extracted with EtOAc (2.times.200 mL). The organic phase was
separated, washed with brine, and dried over Na.sub.2SO.sub.4.
Flash chromatography on silica gel (9:1 CHCl.sub.3/MeOH containing
5% NH.sub.4OH) and drying under high vacuum gave the title compound
(6.88 g, 63%) as a faintly yellow viscous solid: MS (ES) m/e 175
(M+H).sup.+.
Preparation 13
Preparation of 1,3-dimethyl-2-(methylaminomethyl)-1H-indole
a) 1,3-Dimethyl-1H-indole
[0683] To a stirred solution of 3-methylindole (15.0 g, 114 mmole)
in dry DMF (200 mL) was added NaH (60% dispersion in oil, 5.0 g,
125 mmole) in portions. Gas evolution was observed. The mixture was
stirred for 30 min, then iodomethane (8 mL, 129 mmole) was added in
one portion. The reaction became exothermic and was cooled in an
ice bath. After 16 hr at RT, the reaction was concentrated under
vacuum and the residue was taken up in ethyl acetate. The solution
was washed with H.sub.2O then with brine, dried (MgSO.sub.4), and
concentrated to dryness. Purification by short path distillation
under vacuum (bp 88-92.degree. C., 0.5 mmHg) gave the title
compound (16.10 g, 97%) as a pale yellow oil: .sup.1H NMR (400 MHz,
CDCl.sub.3) .delta. 7.47 (d, J=7.9 Hz, 1H), 7.35 (d, J=8.2 Hz, 1H),
7.13 (t, 1H), 7.06 (s, 1H), 7.00 (t, 1H), 3.71 (s, 3H), 2.24 (s,
3H).
b) 1,3-Dimethyl-1H-indole-2-carboxaldehyde
[0684] To a stirred solution of phosphorus oxychloride (7.0 mL, 75
mmole) in DMF (25 mL) was added dropwise a solution of
1,3-dimethylindole (12.0 g, 83 mmole) in dry DMF (6.0 mL). The
reaction was stirred at RT for 2 hr then was poured onto ice. The
mixture was basified with a solution of NaOH (13.2 g, 330 mmole) in
H.sub.2O (44 mL), then was extracted with Et.sub.2O (2.times.50
mL). The combined organic layers were washed with brine, dried
(MgSO.sub.4), and concentrated under vacuum. Flash chromatography
on silica gel (10% ethyl acetate/hexanes) gave the title compound
(13.03 g, 91%) as an off-white solid: LCMS (ES) m/e 174.2
(M+H).sup.+; .sup.1H NMR (400 MHz, CDCl.sub.3) .delta. 10.16 (s,
1H), 7.68 (d, J=8.1 Hz, 1H), 7.42 (t, 1H), 7.32 (d, J=8.5 Hz, 1H),
7.15 (t, 1H), 4.04 (s, 3H), 2.63 (s, 3 H).
c) 1,3-Dimethyl-2-(methylaminomethyl)-1H-indole
[0685] To 1,3-dimethyl-1H-indole-2-carboxaldehyde (13.0 g, 75
mmole) was added a solution of 2.0 M methylamine in methanol (150
mL, 300 mmole) and HOAc (4.3 mL, 75 mmole). The solution was
stirred at RT for 4 hr, then was cooled to 0.degree. C., and sodium
cyanoborohydride (5.0 g, 80 mmole) was added portionwise over 5
min. The reaction was then allowed to warm to RT. After 16 hr, the
reaction was concentrated under vacuum and the residue was taken up
in Et.sub.2O. The solution was washed with 1.0 N NaOH then with
brine, dried (Na.sub.2SO.sub.4), and concentrated to dryness. Flash
chromatography on silica gel (95:5 CHCl.sub.3/methanol containing
5% NH.sub.4OH) gave the title compound (7.34 g, 52%) as a yellow
oil: .sup.1H NMR (400 MHz, CDCl.sub.3) .delta. 7.53 (d, J=7.8 Hz,
1H), 7.26 (d, J=7.8 Hz, 1 H), 7.20 (t, 1H), 7.09 (t, 1H), 3.88 (s,
2H), 3.76 (s, 3H), 2.46 (s, 3H), 2.32 (s, 3H), 1.36 (br s, 1H).
Preparation 14
Preparation of
1-methyl-3-(methylaminomethyl)-1H-pyrrolo[2,3-b]pyridine
a) 1-Methyl-1H-pyrrolo[2,3-b]pyridine
[0686] According to the procedure of Preparation 13 (a), except
substituting 7-azaindole (2.28 g, 1.83 mmole) for the
3-methylindole, the title compound (1.4 g, 58%) was prepared as a
yellow oil: MS (ES) m/e 133 (M+H).sup.+.
b) 1-Methyl-1H-pyrrolo[2,3-b]pyridine-3-carboxaldehyde
[0687] According to the procedure of Preparation 13 (b), except
substituting 1-methyl-1H-pyrrolo[2,3-b]pyridine (0.7 g, 5.3 mmole)
for the 1,3-dimethylindole, the title compound (0.4 g, 47%) was
prepared as a white solid: MS (ES) m/e 161 (M+H).sup.+.
c) 1-Methyl-3-(methylaminomethyl)-1H-pyrrolo[2,3-b]pyridine
[0688] According to the procedure of Preparation 13 (c), except
substituting 1-methyl-1H-pyrrolo[2,3-b]pyridine-3-carboxaldehyde
(0.4 g, 2.5 mmole) for the 1,3-dimethyl-1H-indole-2-carboxaldehyde,
the title compound (0.2 g, 45%) was prepared as a yellow oil: MS
(ES) m/e 176 (M+H).sup.+.
Preparation 15
Preparation of 2-methyl-3-(methylaminomethyl)benzo[b]thiophene
a) 2-Methylbenzo[b]thiophene-3-carboxaldehyde
[0689] SnCl.sub.4 (20 mL, 67 mmole) was added over 5 min to a
stirred solution of 2-methylbenzo[b]thiophene (5.0 g, 33.7 mmole)
in CH.sub.2Cl.sub.2 (75 mL) at 0.degree. C. under argon. After 15
minutes, dichloromethyl methyl ether (3.7 mL, 41 mmole) was added.
The reaction became a yellowish colored suspension. The reaction
was allowed to warm to RT and stirred for 16 h, then was poured
onto ice water (200 mL). The aqueous mixture was acidified with 1.0
N HCl (100 mL) and stirred until the suspension dissolved. The
organic phase was separated, dried (MgSO.sub.4), and concentrated
under vacuum. Purification by flash chromatography on silica gel
(10% ethyl acetate/hexane) gave the title compound (5.83 g, 98%) as
a white crystalline solid: .sup.1H NMR (400 MHz, CDCl.sub.3)
.delta.10.38 (s, 1H), 8.61 (d, J=8.1 Hz, 1H), 7.77 (d, J=8.0 Hz,
1H), 7.48 (t, 1H), 7.39 (t, 1H), 2.93 (s, 3H)
b) 2-Methyl-3-(methylaminomethyl)benzo[b]thiophene
[0690] According to the procedures of Preparation 1, except
substituting 2-methylbenzo[b]thiophene-3-carboxaldehyde (5.0 g,
28.4 mmole) for 1-methylindole-3-carboxaldehyde, the title compound
(4.89 g, 90%) was prepared as an oil which solidified in the
freezer: .sup.1H NMR (400 MHz, CDCl.sub.3) .delta.7.78 (d, J=7.9
Hz, 1H), 7.75 (d, J=7.9 Hz, 1H), 7.37 (t, 1H), 7.29 (t, 1H), 3.95
(s, 2H), 2.60 (s, 3H), 2.50 (s, 3H)
Preparation 16
Preparation of 3-(methylaminomethyl)-1H-indole
a) 3-(Methylaminomethyl)-1H-indole
[0691] To a solution of indole-3-carboxaldehyde (5.4 g, 34.1 mmole)
in MeOH (30 mL) was added a solution of 2.0 M CH.sub.3NH.sub.2 in
MeOH (51.3 mL, 102.6 mmole). The reaction was stirred at RT
overnight, then was concentrated to a light yellow oil. This oil
was dissolved in EtOH (40 mL), and NaBH.sub.4 (1.3 g, 34.1 mmole)
was added. After 16 hrs the reaction was concentrated to a slurry
and dissolved in 10% Na.sub.2CO.sub.3 (100 mL). The aqueous
solution was extracted with EtOAc (2.times.200 mL) and the combined
organic fractions were dried over Na.sub.2SO.sub.4 and
concentrated. Drying in high vacuum left the title compound (5.2 g,
94%) as a faintly yellow oil: MS (ES) m/e 161 (M+H).sup.+.
Preparation 17
Preparation of 1-benzyl-3-(methylaminomethyl)-1H-indole
a) 3[N-(Benzyloxycarbonyl)-N-methylaminomethyl]-1H-indole
[0692] N-(Benzyloxycarbonyloxy)succinimide (8.9 g, 35.7 mmole) was
added to a solution of 3-(methylaminomethyl)-1H-indole (5.2 g, 32.5
mmole), from Preparation 16, and triethylamine (5.0 mL, 65.7 mmole)
in DMF (100 mL) at RT. The reaction was stirred overnight then was
concentrated in vacuo. The residue was diluted with water and the
mixture was extracted with ethyl acetate. The combined extracts
were dried over Na.sub.2SO.sub.4 and concentrated. Flash
chromatography on silica gel (33% ethyl acetate/hexanes) gave the
title compound (7.0 g, 74%) as an off-white solid: MS (ES) m/e 295
(M+H).sup.+.
b)
3-[N-(Benzyloxycarbonyl)-N-methylaminomethyl]-1-benzyl-1H-indole
[0693] NaH (60% dispersion in mineral oil, 0.15 g, 3.8 mmole) was
added portionwise, allowing for gas evolution, to a solution of
3-[N-(benzyloxycarbonyl)-N-methylaminomethyl]-1H-indole (0.7 g, 2.5
mmole) in DMF (25 mL) at 0.degree. C. When the NaH addition was
complete, benzyl bromide (1.2 mL, 10.0 mmole) was added at
0.degree. C. The reaction was stirred at 0.degree. C. for 15
minutes then at RT overnight. The reaction was diluted with water
and extracted with ethyl acetate. The combined extracts were dried
over Na.sub.2SO.sub.4 and concentrated. Flash chromatography on
silica gel (33% ethyl acetate/hexanes) gave the title compound (0.9
g, 93%) as an off white solid: MS (ES) m/e 385 (M+H).sup.+.
c) 1-Benzyl-3-(methylaminomethyl)-1H-indole
[0694]
3-[N-(Benzyloxycarbonyl)-N-methylaminomethyl]-1-benzyl-1H-indole
(0.9 g, 2.3 mmole) was added to a suspension of Pearlman's catalyst
(about 0.30 g) in MeOH at RT in a Parr flask. The reaction was
placed under 50 p.s.i. of H.sub.2 and shaken for 5 hr. The mixture
was filtered through Celite.RTM. and the filter pad was washed with
MeOH. The filtrate was concentrated to afford the title compound
(0.5 g, 86%) as a light yellow solid: MS (ES) m/e 251
(M+H).sup.+.
Preparation 18
Preparation of
2,3-dihydro-8-(methylaminomethyl)-1H-3a-azacyclopenta[a]indene
a) 2,3-Dihydro-1H-3a-azacyclopenta[a]indene-8-carboxaldehyde
[0695] According to the procedure of Preparation 13 (b), except
substituting 2,3-dihydro-1H-3a-azacyclopenta[a]indene (J. Med.
Chem. 1965, 8, 700; 0.24 g, 1.53 mmole) for the 1,3-dimethylindole,
the title compound (0.17 g, 60%) was prepared as a yellow solid: MS
(ES) m/e 186 (M+H).sup.+.
b)
2,3-Dihydro-8-(methylaminomethyl)-1H-3a-azacyclopenta[a]indene
[0696] According to the procedure of Preparation 13 (c), except
substituting
2,3-dihydro-1H-3a-azacyclopenta[a]indene-8-carboxaldehyde (0.17 g,
0.92 mmole) for the 1,3-dimethyl-1H-indole-2-carboxaldehyde, the
title compound (0.1 g, 54%) was prepared as a yellow oil: MS (ES)
m/e 201 (M+H).sup.+.
Preparation 19
Preparation of 1,4-dimethyl-3-(methylaminomethyl)-1H-indole
a) 1,4-Dimethyl-1H-indole
[0697] According to the procedure of Preparation 9 (a), except
substituting 4-methylindole for ethyl indole-2-carboxylate, the
title compound (1.5 g, 94%) was prepared as an amber oil: MS (ES)
m/e 146.2 (M+H).sup.+.
b) 1,4-Dimethyl-1H-indole-3-carboxaldehyde
[0698] According to the procedure of Preparation 9 (b), except
substituting 1,4-dimethyl-1H-indole for 1,3-dimethylindole, the
title compound (1.8 g, 95%) was prepared as an amber oil: MS (ES)
m/e 174.2 (M+H).sup.+.
c) 1,4-Dimethyl-3-(methylaminomethyl)-1H-indole
[0699] According to the procedure of Preparation 11, except
substituting 1,4-dimethyl-1H-indole-3-carboxaldehyde for
1,3-dimethyl-1H-indole-1-carboxaldehyde, the title compound (1.9 g,
99%) was prepared as an oil: MS (ES) m/e 189.0 (M+H).sup.+.
Preparation 20
Preparation of (E)-3-(2-oxo-2,3-dihydro-1H-indol-5-yl)acrylic acid
hydrochloride salt
a) 3,3,5-Tribromo-1,3-dihydropyrrolo[2,3-b]pyridin-2-one
[0700] To a solution of 7-azaindole (5.0 g, 42.3 mmole) in H.sub.2O
(210 mL) and tert-butanol (210 mL) at RT was added Br.sub.2 (27 mL,
529.0 mmole) over 20 minutes. The reaction was stirred for 12 hr at
RT and concentrated to an aqueous slurry. The reaction contents
were made basic with solid NaHCO.sub.3 and the remaining solid was
filtered and washed with H.sub.2O. The filtered mass was dried
under high vacuum to give the title compound (14.0 g, 89%) as a
brown solid: MS (ES) m/e 370 (M+H).sup.+.
b) 5-Bromo-1,3-dihydropyrrolo[2,3-b]pyridin-2-one
[0701] To a stirred solution of
3,3,5-tribromo-1,3-dihydropyrrolo[2,3-b]pyridin-2-one (2.0 g, 5.4
mmole) in acetic acid (50 mL) at RT was added Zn metal. The
reaction became exothermic and was cooled by the use of an ice bath
during the initial 30 minutes. After 5 hr the reaction was filtered
through Celite.RTM., and the filter pad was washed with EtOAc. The
filtrate was concentrated under vacuum and neutralized with
saturated aqueous NaHCO.sub.3 solution. The neutralized aqueous
filtrate was then extracted with EtOAc (2.times.200 mL), and the
combined organic extracts were dried over Na.sub.2SO.sub.4 and
concentrated to a solid. The solid was washed with hexanes and
dried under high vacuum to give the title compound (0.36 g, 32%):
MS (ES) m/e 215 (M+H).sup.+. This was used without further
purification.
c) tert-Butyl (E)-3-(2-oxo-2,3-dihydro-1H-indol-5-yl)acrylate
[0702] A solution of 5-bromo-1,3-dihydropyrrolo[2,3-b]pyridin-2-one
(2.0 g, 9.49 mmole), tert-butyl acrylate (1.8 g, 14.1 mmole),
Pd(OAc).sub.2 (0.32 g, 1.4 mmole), tri-ortho-tolylphosphine (0.57
g, 1.9 mmole), and diisopropylethylamine (4.9 mL, 28.2 mmole) in
propionitrile (100 mL) and DMF (10 mL) was heated at reflux
overnight. The dark mixture was filtered through Celite.RTM., and
the filtrate was concentrated. Flash chromatography on silica (9:1
CHCl.sub.3/CH.sub.3OH containing 5% NH.sub.4OH) gave the title
compound (0.80 g, 33%) as a light yellow solid. MS (ES) m/e 261
(M+H).sup.+.
d) (E)-3-(2-Oxo-2,3-dihydro-1H-indol-5-yl)acrylic acid
hydrochloride salt
[0703] To a stirred solution of tert-butyl
(E)-3-(2-oxo-2,3-dihydro-1H-indol-5-yl)acrylate (0.80 g, 3.1 mmole)
in CH.sub.2Cl.sub.2 (50 mL) at RT was added trifluoroacetic acid
(20 mL). After 1 hr the reaction solution was concentrated and the
residue was dried under vacuum. An HCl solution (20 mL, 4 M in
dioxane) was added and the mixture was concentrated under vacuum.
The remaining solid was triturated with diethyl ether and filtered
giving the title compound (0.74 g, 33%) as a white solid: MS (ES)
m/e 205 (M+H--HCl).sup.+.
Preparation 21
Preparation of 1-ethyl-3-(methylaminomethyl)-1H-indole
a)
3-[N-(Benzyloxycarbonyl)-N-methylaminomethyl]-1-ethyl-1H-indole
[0704] According to the procedure of Preparation 17 (b), except
substituting ethyl iodide (0.92 mL, 11.44 mmole) for the benzyl
bromide, the title compound (0.90 g, 98%) was prepared as a white
solid: MS (ES) m/e 323 (M+H).sup.+.
b) 1-Ethyl-3-(methylaminomethyl)-1H-indole
[0705] According to the procedure of Preparation 17 (c), except
substituting
3-[N-(benzyloxycarbonyl)-N-methylaminomethyl]-1-ethyl-1H-indole
(0.90 g, 2.80 mmole) for the
3-[N-(benzyloxycarbonyl)-N-methylaminomethyl]-1-benzyl-1H-indole,
the title compound (0.50 g, 94%) was prepared as a white solid: MS
(ES) m/e 189 (M+H).sup.+.
Preparation 22
Preparation of 1-isopropyl-3-(methylaminomethyl)-1H-indole
a)
3-[N-(Benzyloxycarbonyl)-N-methylaminomethyl]-1-isopropyl-1H-indole
[0706] According to the procedure of Preparation 17 (b), except
substituting isopropyl iodide (1.34 mL, 11.84 mmole) for the benzyl
bromide, the title compound (0.99 g, 99%) was prepared as a white
solid: MS (ES) m/e'337 (M+H).sup.+.
b) 1-ethyl-3-(methylaminomethyl)-1H-indole
[0707] According to the procedure of Preparation 17 (c), except
substituting
3-[N-(Benzyloxycarbonyl)-N-methylaminomethyl]-1-isopropyl-1H-indole
(0.99 g, 2.98 mmole) for the
3-[N-(Benzyloxycarbonyl)-N-methylaminomethyl]-1-benzyl-1H-indole,
the title compound (0.49 g, 82%) was prepared as a white solid: MS
(ES) m/e 405 (2M+H).sup.+.
Preparation 23
Preparation of 1-acetyl-3-(methylaminomethyl)-1H-indole
a) 1-Acetyl-3-(methylaminomethyl)indole
[0708] According to the procedure of Preparation 16 (a), except
substituting N-acetyl-3-indole carboxaldehyde (1.33 g, 7.10 mmole),
the title compound (1.40 g, 99%) was prepared as a light yellow
oil: MS (ES) m/e 203 (M+H).sup.+.
Preparation 24
Preparation of N-(1H-indol-3-ylmethyl)-N-methylacrylamide
a) N-(1H-Indol-3-ylmethyl)-N-methylacrylamide
[0709] Acryloyl chloride (0.33 mL, 4.10 mmole) was added to a
solution of 3-(methylaminomethyl)-1H-indole (0.60 g, 3.70 mmole)
and Et.sub.3N (1.03 mL, 7.40 mmole) in CH.sub.2Cl.sub.2 (30 mL) at
0.degree. C. The reaction was held at 0.degree. C. for ten minutes,
then was stirred overnight at RT. The solution was concentrated in
vacuo and the residue was diluted with water. The solution was
extracted with ethyl acetate, and the combined organic extracts
were washed with brine and dried over Na.sub.2SO.sub.4. The title
compound (0.64 g, 80%) was obtained as a light yellow solid: MS
(ES) m/e 215 (M+H).sup.+.
Preparation 25
Preparation of
N-(1-benzyl-1H-indol-3-ylmethyl)-N-methylacrylamide
a) N-(1-Benzyl-1H-indol-3-ylmethyl)-N-methylacrylamide
[0710] According to the procedure of Preparation 24 (a), except
substituting 1-benzyl-3-(methylaminomethyl)-1H-indole (1.30 g, 5.20
mmole) for of 3-(methylaminomethyl)-1H-indole, the title compound
(1.40 g, 89%) was a brown solid: MS (ES) m/e 305 (M+H).sup.+.
Preparation 26
Preparation of
N-[1-(2-dimethylamino)-1H-indol-3-ylmethyl]-N-methylacrylamide
a)
N-[1-(2-dimethylamino)-1H-indol-3-ylmethyl]-N-methylacrylamide
[0711] According to the procedure of Preparation 25 (a), except
substituting [1-(2-dimethylamino)]-3-(methylaminomethyl)-1H-indole
(1.00 g, 2.74 mmole) for of 3-(methylaminomethyl)-1H-indole, the
title compound (0.50 g, 79%) was a yellow solid: MS (ES) m/e 463
(2M+H).sup.+.
Preparation 27
Preparation of
3-bromo-5,6,7,9-tetrahydro-pyrido[2,3-b]azepin-8-one
a) 8-Benzylidene-5,6,7,8-tetrahydro-quinoline
[0712] Benzaldehyde (3.59 mL, 35.30 mmole) was added to a solution
of 5,6,7,8-tetrahydro-quinoline (4.70 g, 35.30 mmole) in acetic
anhydride (25 mL), and the solution was heated to reflux under a
nitrogen atmosphere. After overnight at reflux, the reaction was
concentrated in vacuo. The residue was diluted with water and
extracted with ethyl acetate. The combined organic extracts were
washed with brine, dried over Na.sub.2SO.sub.4, and concentrated.
The residue was purified by flash chromatography on silica gel (33%
EtOAc/hexanes) to give the title compound (4.50 g, 58%) as a waxy
yellow solid after drying in vacuo: MS (ES) m/e 222
(M+H).sup.+.
b) 6,7-Dihydro-5H-quinolin-8-one
[0713] A solution of 8-benzylidene-5,6,7,8-tetrahydro-quinoline
(4.30 g, 19.4 mmole) in CH.sub.2Cl.sub.2 (150 mL) was reacted with
ozone at -78.degree. C. for 30 minutes. Dimethyl sulfide (5 mL) was
added, and the reaction was warmed to RT and stirred overnight. The
mixture was concentrated in vacuo and the residue was purified by
flash chromatography on silica gel (EtOAc). The title compound
(2.20 g, 79%) was obtained as an off-white solid after drying in
vacuo: MS (ES) m/e 148 (M+H).sup.+.
c) 6,7-Dihydro-5H-quinolin-8-one oxime
[0714] According to the reported procedure (J. Het. Chem. 1978, 15,
249-251), 6,7-dihydro-5H-quinolin-8-one was reacted with
hydroxylamine hydrochloride to afford the title compound (2.40 g,
96%) as a white solid after drying in vacuo: MS (ES) m/e 163
(M+H).sup.+.
d) 6,7-Dihydro-5H-quinolin-8-one, O-toluenesulfonyloxime
[0715] According to the reported procedure (J. Het. Chem. 1978, 15,
249-251), 6,7-dihydro-5H-quinolin-8-one oxime was reacted with
p-toluenesulfonyl chloride to afford the title compound (4.00 g,
85%) as a white solid after drying in vacuo: MS (ES) m/e 317
(M+H).sup.+.
e) 5,6,7,9-Tetrahydro-pyrido[2,3-b]azepin-8-one
[0716] According to the reported procedure (J. Het. Chem. 1978, 15,
249-251), 6,7-dihydro-5H-quinolin-8-one, O-toluenesulfonyloxime was
reacted to afford the title compound (1.00 g, 50%) as a white solid
after drying in vacuo: MS (ES) m/e 163 (M+H).sup.+.
f) 3-Bromo-5,6,7,9-tetrahydro-pyrido[2,3-b]azepin-8-one
[0717] A 10% solution of bromine (0.57 mL, 11.1 mmole) in
CH.sub.2Cl.sub.2 was added dropwise over 1 hr to a solution of
5,6,7,9-tetrahydro-pyrido[2,3-b]azepin-8-one (1.20 g, 7.4 mmole) in
CH.sub.2Cl.sub.2 at RT. The mixture was stirred at RT overnight,
then was concentrated in vacuo. The residue was diluted with 10%
Na.sub.2CO.sub.3 and extracted with EtOAc. The combined organics
were dried over Na.sub.2SO.sub.4 and concentrated. Flash
chromatography on silica gel (EtOAc) gave the title compound (1.00
g, 56%) as a light yellow solid after drying in vacuo: MS (ES) m/e
241/243.
Preparation 28
Preparation of
5-bromo-2-(methylaminocarbonylmethyl)aminopyridine
a) 5-Bromo-2-(tert-butoxycarbonyl)aminopyridine
[0718] To a solution of 2-amino-5-bromopyridine (27.56 g, 159
mmole) in THF (150 mL) was added di-tert-butyl dicarbonate (38 g,
174 mmole). The reaction was gradually heated to reflux. Vigorous
gas evolution was observed initially, which subsided after
approximately 10 min. After 18 hr at reflux, the reaction was
concentrated to dryness. The residue was triturated with 1:1
Et.sub.2O/petroleum ether, filtered and dried under vacuum to give
the title compound (34.79 g, 80%) as a white solid: .sup.1H NMR
(400 MHz, CDCl.sub.3) .quadrature. 8.49 (s, 1H), 8.37 (dd, 1H),
7.94 (d, J=9.0 Hz, 1H), 7.77 (dd, 1H), 1.57 (s, 9H).
b)
5-Bromo-2-[N-(tert-butoxycarbonyl)-N-(methoxycarbonylmethyl)amino]pyrid-
ine
[0719] To a solution of
5-bromo-2-(tert-butoxycarbonyl)aminopyridine (25.0 g, 91.5 mmole)
in DMF (400 mL) was added portionwise with stirring a 60%
dispersion of NaH in mineral oil (4.0 g, 100 mmole). The reaction
was stirred for 15 min, then methyl bromoacetate (15 mL, 158.5
mmole) was added dropwise over 15 min. After stirring for 18 h at
room temperature the reaction was concentrated to dryness. The
remaining residue was taken up in EtOAc (200 mL) and H.sub.2O (200
mL) and filtered to remove insoluble material. The EtOAc phase was
separated, washed with brine, dried (Na.sub.2SO.sub.4) and
concentrated to dryness. Purification by flash chromatography on
silica gel (10% EtOAc/Hexane) gave the title compound (16.56 g,
50%): .sup.1H NMR (400 MHz, CDCl.sub.3) .delta. 8.33 (s, 1H), 7.73
(d, J=2.5 Hz, 1H), 7.71 (d, J=2.5 Hz, 1H), 4.69 (s, 2H), 3.75 (s,
3H), 1.51 (s, 9H).
c) 5-Bromo-2-(methoxycarbonylmethyl)aminopyridine
[0720] A 50% solution of TFA in CH.sub.2Cl.sub.2 (200 mL) was added
to
5-bromo-2-[N-(tert-butoxycarbonyl)-N-(methoxycarbonylmethyl)amino]pyridin-
e (16.5 g, 46 mmole). After stirring for 45 min the reaction was
concentrated to dryness, and the residue was diluted with 1.0 N
Na.sub.2CO.sub.3 (300 mL). The mixture was extracted with EtOAc
(300 mL), and the organic layer was washed with brine, dried
(Na.sub.2SO.sub.4), and concentrated to dryness under vacuum. The
title compound (11.32 g, 100%) was obtained as a white solid:
.sup.1H NMR (400 MHz, CDCl.sub.3) .quadrature. 8.13 (d, J=2.3 Hz,
1H), 7.48 (dd, 1H), 6.40 (d, J=8.8 Hz, 1H), 4.95 (br s, 1H), 4.12
(d, J=5.5 Hz, 2H), 3.78 (s, 3H).
d) 5-Bromo-2-(methylaminocarbonylmethyl)aminopyridine
[0721] A solution of 2.0 M methylamine in MeOH (75 mL) was added to
5-bromo-2-(methoxycarbonylmethyl)aminopyridine (2.9 g, 12 mmole).
The reaction was stirred for 24 h then was concentrated to dryness.
The residue was triturated with 10% petroleum ether/Et.sub.2O (100
mL), then was collected and dried under vacuum to give the title
compound (2.96 g, 100%) as an off-white solid: MS (ES) m/e 244.2
(M+H).sup.+.
Preparation 29
Preparation of methyl 2-amino-5-bromonicotinate
a) Methyl 2-aminonicotinate
[0722] Concentrated H.sub.2SO.sub.4 (20 mL, 360 mmole) was added
dropwise over 5 minutes to a suspension of 2-aminonicotinic acid
(25 g, 181 mmole) in MeOH (400 mL), and the mixture was heated at
reflux; a homogeneous solution formed within 5 min. After 72 h, the
reaction was cooled to room temperature and concentrated under
vacuum. The residue was basified with 1.0 N Na.sub.2CO.sub.3 (500
mL) (Gas evolution!) and extracted with EtOAc (500 mL). The organic
layer was washed with brine, dried (Na.sub.2SO.sub.4), and
concentrated to dryness to give the title compound (19.6 g, 71%) as
a white solid: .sup.1H NMR (400 MHz, CDCl.sub.3) .quadrature. 8.22
(dd, 1H), 8.13 (dd, 1H), 6.63 (dd, 1H), 6.30 (br s, 2H), 3.89 (s,
3H).
b) Methyl 2-amino-5-bromonicotinate
[0723] Bromine (0.7 mL, 14 mmole) was added dropwise to a stirred
solution of methyl 2-aminonicotinate (2.0 g, 13 mmole) in HOAc (50
mL). A suspension formed within 30 min. The reaction was allowed to
stir at room temperature for 2 h, then was concentrated under
vacuum. The residue was triturated with 1.0 N Na.sub.2CO.sub.3 (50
mL) and the solid was collected by suction filtration. The solid
was washed with H.sub.2O (50 mL) and dried under vacuum to give the
title compound (2.95 g, 98%) as a pale yellow solid: .sup.1H NMR
(400 MHz, CDCl.sub.3) .delta. 8.24 (d, J=2.5 Hz, 1H), 8.23 (d,
J=2.5 Hz, 1H), 6.40 (br s, 2H), 3.90 (s, 3H).
Preparation 30
Preparation of
(E)-3-[6-[N-(methoxycarbonylmethyl)amino]pyridin-3-yl]acrylic acid
hydrochloride salt
a) tert-Butyl
(E)-3-[6-[N-(methoxycarbonylmethyl)amino]pyridin-3-yl]acrylate
[0724] A solution of 5-bromo-2-(methoxycarbonylmethyl)aminopyridine
(4.69 g, 19.1 mmole, from Preparation 28 (c)), tert-butyl acrylate
(11.2 mL, 76.5 mmole), DIEA (6.7 mL, 38.5 mmole), Pd(OAc).sub.2
(215 mg, 1 mmole), and P(o-tol).sub.3 (583 mg, 2 mmole) in
propionitrile (100 mL) was purged with Ar, then was heated at
reflux. After 18 h, the reaction was allowed to cool to room
temperature then was concentrated to dryness. The residue was
purified by flash chromatography on silica gel (40% EtOAc/hexane)
to give the title compound (5.21 g, 93%) as a white solid: .sup.1H
NMR (400 MHz, CDCl.sub.3) .delta. 8.19 (s, 1H), 7.62 (dd, 1H), 7.47
(d, J=16.0 Hz, 1H), 6.48 (d, J=8.7 Hz, 1H), 6.17 (d, J=15.9 Hz,
1H), 5.21 (br s, 1H), 4.20 (d, J=5.4 Hz, 2H), 3.79 (s, 3H), 1.52
(s, 1H).
b) (E)-3-[6-[N-(Methoxycarbonylmethyl)amino]pyridin-3-yl]acrylic
acid hydrochloride salt
[0725] A solution of 50% TFA in CH.sub.2Cl.sub.2 (75 mL) was added
to tert-butyl
(E)-3-[6-[N-(methoxycarbonylmethyl)amino]pyridin-3-yl]acrylate
(5.20 g, 17.8 mmole). The reaction was stirred at room temperature
for 45 min then was concentrated under vacuum. The residue was
taken up in 4.0 N HCl in dioxane (75 mL), stirred for 5 min, then
concentrated to dryness under vacuum. The remaining solid was
triturated with 1:1 Et.sub.2O/petroleum ether, filtered and dried
under vacuum to give the title compound (4.87 g, 100%) as a white
solid: MS (ES) m/e 237.2 (M+H).sup.+.
Preparation 31
Preparation of
(E)-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylic acid
hydrochloride salt
a) tert-Butyl
(E)-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylate
[0726] A solution of 6-bromo-3,4-dihydro-1H-1,8-naphthyridin-2-one
(12.99 g, 57 mmole), tert-butyl acrylate (34 mL, 232 mmole), DIEA
(21.2 mL, 122 mmole), Pd(OAc).sub.2 (1.3 g, 5.8 mmole) and
P(o-tol).sub.3 (3.5 g, 11.5 mmole) in propionitrile (200 mL) and
DMF (50 mL) was purged with Ar, then was heated at reflux. After 18
h the reaction was allowed to cool to room temperature and was
concentrated to dryness. The residue was purified by flash
chromatography on silica gel (2-4% MeOH/CHCl.sub.3). The resulting
residue was triturated with 1:1 Et.sub.2O/petroleum ether,
collected, and dried, and the resulting material was triturated
with 1:1 MeOH/H.sub.2O, collected, and dried, to give the title
compound (7.09 g, 45%) as an off-white solid: .sup.1H NMR (400 MHz,
d.sub.6-DMSO) .delta. 10.70 (s, 1H), 8.35 (d, J=2.0 Hz, 1H), 8.04
(s, 1H), 7.50 (d, J=16.0 Hz, 1H), 6.51 (d, J=16.0 Hz, 1H), 2.89 (t,
2 H), 2.53 (t, 2H), 1.48 (s, 9H); MS (ES) m/e 275.2
(M+H).sup.+.
b) (E)-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylic
acid hydrochloride salt
[0727] To tert-butyl
(E)-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylate (7.0
g, 25.5 mmole) was added 1:1 TFA/CH.sub.2Cl.sub.2 (100 mL). The
reaction was stirred for 30 min, then was concentrated under
vacuum. The residue was suspended in 4 N HCl/dioxane (100 mL),
triturated, and concentrated to dryness. The resulting solid was
triturated with Et.sub.2O, collected, and dried under vacuum to
give the title compound (6.55 g, 100%) as a off-white solid:
.sup.1H NMR (400 MHz, d.sub.6-DMSO) .quadrature. 10.72 (s, 1H),
8.35 (d, J=2.0 Hz, 1H), 8.04 (s, 1H), 7.54 (d, J=16.0 Hz, 1H), 6.51
(d, J=16.0 Hz, 1H), 2.91 (t, 2H), 2.53 (t, 2H); MS (ES) m/e 219.0
(M+H).sup.+.
Preparation 32
Preparation of
N-methyl-N-(1-methyl-1H-pyrrolo[2,3-b]pyridin-ylmethyl)acrylamide
[0728] A solution of acryloyl chloride (0.43 g, 5.58 mmole) in
CH.sub.2Cl.sub.2 (10 mL) was added dropwise with stirring to a
solution of
1-methyl-3-(methylaminomethyl)-1H-pyrrolo[2,3-b]pyridine (0.93 g,
5.28 mmole) and triethylamine (0.8 mL, 5.8 mmole) in
CH.sub.2Cl.sub.2 (40 mL) at 0.degree. C. under N.sub.2. The
reaction was allowed to warm to RT and stir for 1 hr, then was
concentrated in vacuo. The residue was dissolved in 10% NaOH and
extracted with CH.sub.2Cl.sub.2 (3.times.20 mL). The extracts were
dried (MgSO.sub.4), filtered, and concentrated. The residual oil
was flash chromatographed on silica gel (5% MeOH/CH.sub.2Cl.sub.2)
to give the title compound (1.0 g, 80%) as a colorless oil: MS (ES)
m/e 216 (M+H).sup.+.
Preparation 33
Preparation of
7-fluoro-1-methyl-3-(methylaminomethyl)-1H-indole
a) 7-Fluoro-1H-indole-3-carboxaldehyde
[0729] According to the procedure of Preparation 11(b), except
substituting 7-fluoroindole (0.5 g, 3.7 mmole) for the 1,3
dimethylindole, the title compound (0.5 g, 83%) was prepared as a
waxy solid: MS (ES) m/e 164 (M+H).sup.+.
b) 7-Fluoro-1-methyl-1H-indole-3-carboxaldehyde
[0730] According to the procedure of Preparation 9 (a), except
substituting 7-fluoro-1H-indole-3-carboxaldehyde (0.5 g, 3.1 mmole)
for the ethyl indole-2-carboxylate, the title compound (0.23 g,
43%) was prepared as a viscous oil: MS (ES) m/e 178
(M+H).sup.+.
c) 7-Fluoro-1-methyl-3-(methylaminomethyl)-1H-indole
[0731] According to the procedure of Preparation 11(c), except
substituting 7-fluoro-1-methyl-1H-indole-3-carboxaldehyde (0.23,
1.3 mmole) for the 1,3-dimethyl-1H-indole-2-carboxaldehyde, the
title compound (0.18 g, 72%) was prepared as a viscous oil: MS (ES)
m/e 193 (M+H).sup.+.
Preparation 34
Preparation of
6-fluoro-1-methyl-3-(methylaminomethyl)-1H-indole
a) 6-Fluoro-1H-indole-3-carboxaldehyde
[0732] According to the procedure of Preparation 11(b), except
substituting 6-fluoroindole (0.5 g, 3.7 mmole) for the
1,3-dimethylindole, the title compound (0.3 g, 50%) was prepared as
a waxy solid: MS (ES) m/e 164 (M+H).sup.+.
b) 6-Fluoro-1-methyl-1H-indole-3-carboxaldehyde
[0733] According to the procedure of Preparation 9 (a), except
substituting 6-fluoro-1H-indole-3-carboxaldehyde (0.3 g, 1.8 mmole)
for the ethyl indole-2-carboxylate, the title compound (0.3 g, 94%)
was prepared as a viscous oil: MS (ES) m/e 178 (M+H).sup.+.
c) 6-Fluoro-1-methyl-3-(methylaminomethyl)-1H-indole
[0734] According to the procedure of Preparation 11(c), except
substituting 6-fluoro-1-methyl-1H-indole-3-carboxaldehyde (0.3 g,
1.69 mmole) for the 1,3-dimethyl-1H-indole-2-carboxaldehyde, the
title compound (0.11 g, 35%) was prepared as a viscous oil: MS (ES)
m/e 193 (M+H).sup.+.
Preparation 35
Preparation of
5-fluoro-1-methyl-3-(methylaminomethyl)-1H-indole
a) 5-Fluoro-1H-indole-3-carboxaldehyde
[0735] According to the procedure of Preparation 11(b), except
substituting 5-fluoroindole (0.5 g, 3.7 mmole) for the
1,3-dimethylindole, the title compound (0.3 g, 50%) was prepared as
a waxy solid: MS (ES) m/e 164 (M+H).sup.+.
b) 5-Fluoro-1-methyl-1H-indole-3-carboxaldehyde
[0736] According to the procedure of Preparation 9 (a), except
substituting 5-fluoro-1H-indole-3-carboxaldehyde (0.3 g, 1.8 mmole)
for the ethyl indole-2-carboxylate, the title compound (0.16 g,
50%) was prepared as a viscous oil: MS (ES) m/e 178
(M+H).sup.+.
c) 5-Fluoro-1-methyl-3-(methylaminomethyl)-1H-indole
[0737] According to the procedure of Preparation 11(c), except
substituting 5-fluoro-1-methyl-1H-indole-3-carboxaldehyde (0.3 g,
1.69 mmole) for the 1,3 dimethyl-1H-2-carboxaldehyde, the title
compound (0.11 g, 35%) was prepared as a viscous oil: MS (ES) m/e
193 (M+H).sup.+.
Preparation 36
Preparation of
4-fluoro-1-methyl-3-(methylaminomethyl)-1H-indole
a) 4-Fluoro-1H-indole-3-carboxaldehyde
[0738] According to the procedure of Preparation 11(b), except
substituting 4-fluoroindole (0.5 g, 3.7 mmole) for the
1,3-dimethylindole, the title compound (0.41 g, 68%) was prepared
as a waxy solid: MS (ES) m/e 164 (M+H).sup.+.
b) 4-Fluoro-1-methyl-1H-indole-3-carboxaldehyde
[0739] According to the procedure of Preparation 9 (a), except
substituting 4-fluoro-1H-indole-3-carboxaldehyde (0.41 g, 2.5
mmole) for the ethyl-indole-2-carboxylate, the title compound (0.24
g, 54%) was prepared as a viscous oil: MS (ES) m/e 178
(M+H).sup.+.
c) 4-Fluoro-1-methyl-3-(methylaminomethyl)-1H-indole
[0740] According to the procedure of Preparation 11(c), except
substituting 4-fluoro-1-methyl-1H-indole-3-carboxaldehyde (0.3 g,
1.69 mmole) for the 1,3-dimethyl-1H-indole-2-carboxaldehyde, the
title compound (0.2 g, 77%) was prepared as a viscous oil: MS (ES)
m/e 193 (M+H).sup.+.
Preparation 37
Preparation of
(1-ethyl-5-fluoro-3-(methylaminomethyl)-1H-indole
a) 5-Fluoro-1H-indole-3-carboxaldehyde
[0741] According to the procedure of Preparation 11(b), except
substituting 5-fluoroindole (0.5 g, 3.7 mmole) for the
1,3-dimethylindole, the title compound (0.3 g, 50%) was prepared as
a waxy solid: MS (ES) m/e 164 (M+H).sup.+.
b) 1-Ethyl-5-fluoro-1H-indole-3-carboxaldehyde
[0742] According to the procedure of Preparation 9 (a), except
substituting 5-fluoro-1H-indole-3-carboxaldehyde (0.41 g, 2.5
mmole) for the ethylindole-2-carboxylate, the title compound (0.20
g, 57%) was prepared as a viscous oil: MS (ES) m/e 191
(M+H).sup.+.
c) 1-Ethyl-5-fluoro-3-(methylaminomethyl)-1H-indole
[0743] According to the procedure of Preparation 11(c), except
substituting 1-ethyl-5-fluoro-1H-indole-3-carboxaldehyde (0.2 g,
1.9 mmole) for the 1,3-dimethyl-1H-indole-2-carboxaldehyde, the
title compound (0.1 g, 50%) was prepared as a viscous oil: MS (ES)
ink 207 (M+H).sup.+.
Preparation 38
Preparation of
4,6-dichloro-1-methyl-2-(methylaminomethyl)-1H-indole
a) Ethyl 4,6-dichloro-1-methyl-1H-indole-2-carboxylate
[0744] NaH (60% dispersion in mineral oil, 0.24 g, 6 mmole) was
washed with hexanes, then was suspended in anhydrous DMF (16 mL).
The mixture was cooled to 0.degree. C., and ethyl
4,6-dichloroindole-2-carboxylate (1.03 g, 4 mmole) was added. After
2-3 min, iodomethane (1.3 mL, 20 mmole) was added, and the mixture
was warmed to RT. The mixture became thick, and stirring became
difficult for several minutes. After 0.5 hr, the reaction was
cooled to 0.degree. C. and quenched with 10% NH.sub.4Cl (2 mL). The
mixture was concentrated to dryness, and the residue was
partitioned between Et.sub.2O (50 mL) and H.sub.2O (10 mL). The
layers were separated and the organic layer was washed with
H.sub.2O (5 mL), dried (MgSO.sub.4), and filtered, and the filter
pad was washed with a little CH.sub.2Cl.sub.2. Concentration
afforded the title compound (1.06 g, 97%) as an off-white solid:
.sup.1H NMR (400 MHz, CDCl.sub.3) .delta. 7.34 (s, 1H), 7.30 (s,
1H), 7.17 (d, J=1.5 Hz, 1H), 4.39 (q, J=7.1 Hz, 2H), 4.05 (s, 3H),
1.42 (t, J=7.1 Hz, 3H); MS (ES) m/e 272 and 274 (M+H).sup.+.
b) N,1-Dimethyl-1H-indole-2-carboxamide
[0745] A suspension of ethyl
4,6-dichloro-1-methyl-1H-indole-2-carboxylate (1.06 g, 3.90 mmole)
in 2.0 M CH.sub.3NH.sub.2/CH.sub.3OH (40 mL) in a sealed pressure
bottle was heated in an oil bath preset at 50.degree. C. A
homogeneous solution formed within 2.5 hr. The reaction was kept at
50.degree. C. for 17.5 hr, during which time a solid precipitated.
The mixture was cooled to RT and poured into H.sub.2O (40 mL). The
resulting mixture was concentrated on the rotavap to remove the
methanol, and the solid was collected by suction filtration. This
was washed with plenty of H.sub.2O and dried in high vacuum at
45-50.degree. C. to afford the title compound (0.99 g, 99%) as an
off-white solid: .sup.1H NMR (400 MHz, CDCl.sub.3) .delta. 7.29 (s,
1H), 7.16 (d, J=1.5 Hz, 1H), 6.86 (s, 1H), 6.21 (br s, 1H), 4.02
(s, 3H), 3.02 (d, J=4.9 Hz, 3H); MS (ES) m/e 257 and 259 (M+
c) 4,6-Dichloro-1-methyl-2-(methylaminomethyl)-1H-indole
[0746] A solution of 2.0 M BH.sub.3.DMS in THF (3.6 mL, 7.2 mmole)
was added to a solution of N,1-dimethyl-1H-indole-2-carboxamide
(0.74 g, 2.88 mmole) in anhydrous THF (25 mL), and the reaction was
heated at reflux. After 18 hr, the reaction was cooled to 0.degree.
C. and quenched with MeOH (5 mL). The solution was warmed to RT,
stirred for 0.5 hr, then concentrated on the rotavap. The residue
was re-concentrated from MeOH, then was purified by flash
chromatography on silica gel (5% MeOH/CHCl.sub.3 containing 0.5%
conc. NH.sub.4OH). The title compound (197.5 mg, 28%) was obtained
as a white solid: .sup.1H NMR (400 MHz, CDCl.sub.3) .delta. 7.19
(dd, J=1.5, 0.8 Hz, 1H), 7.09 (d, J=1.5 Hz, 1H), 6.45 (s, 1H), 3.88
(s, 2H), 3.74 (s, 3H), 2.50 (s, 3H); MS (ES) m/e 212 and 214
(M+H--CH.sub.3NH.sub.2).sup.+.
Preparation 39
Preparation of 1,7-dimethyl-3-(methylaminomethyl)-1H-indole
a) 1,7-Dimethyl-1H-indole
[0747] According to the procedure of Preparation 13 (a), except
substituting 7-methylindole for the 3-methylindole, the title
compound (1.95 g, 90%) was obtained as a light-colored oil: MS (ES)
m/e 146.2 (M+H).sup.+.
b) 1,7-Dimethyl-1H-indole-3-carboxaldehyde
[0748] According to the procedure of Preparation 13 (b), except
substituting 1,7-dimethylindole for the 1,2-dimethylindole, the
title compound (1.85 g, 82%) was obtained as an off white solid: MS
(ES) m/e 174.2 (M+H).sup.+.
c) 1,7-Dimethyl-3-(methylaminomethyl)-1H-indole
[0749] According to the procedure of Preparation 13 (c), except
substituting 1,7-dimethyl-1H-indole-3-carboxylate for the
1,3-dimethyl-1H-indole-2-carboxylate, the title compound (0.74 g,
98%) was obtained as an amber oil: MS (ES) m/e 189.2
(M+H).sup.+.
Preparation 40
Preparation of
4-methoxy-1-methyl-3-(methylaminomethyl)-1H-indole
a) 4-Methoxy-1-methyl-1H-indole-3-carboxaldehyde
[0750] According to the procedure of Preparation 13 (b), except
substituting 1-methyl-4-methoxyindole for the 1,2-dimethylindole,
the title compound (2.17 g, 93%) was obtained as an off white
solid: MS (ES) m/e 190.2 (M+H).sup.+.
b) 4-Methoxy-1-methyl-3-(methylaminomethyl)-1H-indole
[0751] According to the procedure of Preparation 13 (c), except
substituting 1-methyl-4-methoxy-1H-indole-3-carboxaldehyde for the
1,3-dimethyl-1H-indole-2-carboxaldehyde, the title compound (2.0 g,
95%) was obtained as a white solid: MS (ES) m/e 205.2 (M+
[0752] H).sup.+.
Preparation 41
Preparation of
5-methoxy-1-methyl-3-(methylaminomethyl)-1H-indole
a) 5-Methoxy-1-methyl-1H-indole-3-carboxaldehyde
[0753] According to the procedure of Preparation 13 (a), except
substituting 5-methoxy-1H-indole-3-carboxaldehyde for the
3-methyl-1H-indole-3-carboxaldehyde, the title compound (0.86 g,
92%) was obtained as a light tan solid: MS (ES) m/e 190.2
(M+H).sup.+.
b) 5-Methoxy-1-methyl-3-(methylaminomethyl)-1H-indole
[0754] According to the procedure of Preparation 13 (c), except
substituting 5-methoxy-1-methyl-1H-indole-3-carboxaldehyde for the
1,3-dimethyl-1H-indole-2-carboxaldehyde, the title compound (0.85
g, 98%) was obtained as a light yellow oil: MS (ES) m/e 205.2
(M+H).sup.+.
Preparation 42
Preparation of
7-methoxy-1-methyl-3-(methylaminomethyl)-1H-indole
a) 7-Methoxy-1-methyl-1H-indole
[0755] According to the procedure of Preparation 13 (a), except
substituting 7-methoxyindole for 3-methylindole, the title compound
(1.55 g, 96%) was obtained as a tan solid: MS (ES) m/e 162.2
(M+H).sup.+.
b) 7-Methoxy-1-methyl-1H-indole-3-carboxaldehyde
[0756] According to the procedure of Preparation 13(b), except
substituting 7-methoxy-1-methyl-1H-indole for the
1,2-dimethylindole, the title compound (1.6 g, 91%) was obtained as
an off white solid: MS (ES) m/e 190.2 (M+H).sup.+.
c) 7-Methoxy-1-methyl-3-(methylaminomethyl)-1H-indole
[0757] According to the procedure of Preparation 13(c), except
substituting 7-methoxy-1-methyl-1H-indole-3-carboxaldehyde for the
1,3-dimethyl-1H-indole-2-carboxaldehyde, the title compound (1.6 g,
94%) was obtained as an amber oil: MS (ES) m/e 205.2
(M+H).sup.+.
Preparation 43
Preparation of
7-chloro-1-methyl-3-(methylaminomethyl)-1H-indole
a) 7-Chloro-1-methyl-1H-indole
[0758] According to the procedure of Preparation 13 (a), except
substituting 7-chloroindole for the 3-methylindole, the title
compound (2.2 g, 100%) was obtained as a white solid: MS (ES) m/e
166.2 (M+H).sup.+.
b) 7-Chloro-1-methyl-1H-indole-3-carboxaldehyde
[0759] According to the procedure of Preparation 13 (b), except
substituting 7-chloro-1-methyl-1H-indole for the
1,2-dimethylindole, title compound (2.1 g, 84%) was obtained as a
white solid: MS (ES) m/e 194.0 (M+H).sup.+.
c) 7-Chloro-1-methyl-3-(methylaminomethyl)-1H-indole
[0760] According to the procedure of Preparation 13 (c), except
substituting 7-chloro-1-methyl-1H-indole-3-carboxaldehyde for the
1,3-dimethyl-1H-indole-2-carboxaldehyde, the title compound (2.0 g,
93%) was obtained as an amber oil: MS (ES) m/e 209.2
(M+H).sup.+.
Preparation 44
Preparation of
6-chloro-1-methyl-3-(methylaminomethyl)-1H-indole
a) 6-Chloro-1-methyl-1H-indole
[0761] According to the procedure of Preparation 13 (a), except
substituting 6-chloroindole for the 3-methylindole, the title
compound (2.2 g, 100%) was obtained as a white solid: MS (ES) m/e
166.2.0 (M+H).sup.+.
b) 6-Chloro-1-methyl-1H-indole-3-carboxaldehyde
[0762] According to the procedure of Preparation 13 (b), except
substituting 6-chloro-1-methyl-1H-indole for the
1,2-dimethylindole, title compound (2.2 g, 88%) was obtained as an
amber oil: MS (ES) m/e 194.2 (M+H).sup.+.
c) 6-Chloro-1-methyl-3-(methylaminomethyl)-1H-indole
[0763] According to the procedure of Preparation 13 (c), except
substituting 6-chloro-1-methyl-1H-indole-3-carboxaldehyde for the
1,3-dimethyl-1H-indole-2-carboxaldehyde, the title compound (2.1 g,
93%) was obtained as an amber oil: MS (ES) m/e 209.2
(M+H).sup.+.
Preparation 45
Preparation of
5-chloro-1-methyl-3-(methylaminomethyl)-1H-indole
a) 5-Chloro-1-methyl-1H-indole
[0764] According to the procedure of Preparation 13 (a), except
substituting 5-chloroindole for the 3-methylindole, the title
compound (2.0 g, 91%) was obtained as an amber oil: MS (ES) m/e
166.0 (M+H).sup.+.
b) 5-Chloro-1-methyl-1H-indole-3-carboxaldehyde
[0765] According to the procedure of Preparation 13 (b), except
substituting 5-chloro-1-methyl-1H-indole for the
1,2-dimethylindole, title compound (2.0 g, 83%) was obtained as an
white solid: MS (ES) m/e 194.0 (M+H).sup.+.
c) 5-Chloro-1-methyl-3-(methylaminomethyl)-1H-indole
[0766] According to the procedure of Preparation 13 (c), except
substituting 5-chloro-1-methyl-1H-indole-3-carboxaldehyde for the
,3-dimethyl-1H-indole-2-carboxaldehyde, the title compound (2.1 g,
93%) was obtained as an amber oil: MS (ES) m/e 209.0
(M+H).sup.+.
Preparation 46
Preparation of
4-chloro-1-methyl-3-(methylaminomethyl)-1H-indole
a) 4-Chloro-1-methyl-1H-indole
[0767] According to the procedure of Preparation 13 (a), except
substituting 4-chloroindole for the 3-methylindole, the title
compound (2.2 g, 100%) was obtained as an amber oil: MS (ES) m/e
166.0 (M+H).sup.+.
b) 4-Chloro-1-methyl-1H-indole-3-carboxaldehyde
[0768] According to the procedure of Preparation 13 (b), except
substituting 4-chloro-1-methyl-1H-indole for the
1,2-dimethylindole, title compound (1.9 g, 76%) was obtained as an
off-white solid: MS (ES) m/e 194.0 (M+H).sup.+.
c) 4-Chloro-1-methyl-3-(methylaminomethyl)-1H-indole
[0769] According to the procedure of Preparation 13 (c), except
substituting 4-chloro-1-methyl-1H-indole-3-carboxaldehyde for the
1,3-dimethyl-1H-indole-2-carboxaldehyde, the title compound (1.75
g, 78%) was obtained as a yellow solid: MS (ES) m/e 209.0
(M+H).sup.+.
Preparation 47
Preparation of 1,1-dimethyl-3-(methylaminomethyl)-3H-indene
a) 1,1-Dimethyl-3H-indene-3-carboxaldehyde
[0770] The title compound was obtained in quantitative yield
according to established literature procedures (Chem. Pharm. Bull.
1986, 34, 390-395; Tet. Lett. 1993, 34, 2979): .sup.1H NMR (400
MHz, CDCl.sub.3) .delta.10.05 (s, 1H), 8.05 (d, 2H), 7.35 (m, 4H),
1.40 (s, 6H).
b) 1,1-Dimethyl-3-(methylaminomethyl)-3H-indene
[0771] According to the procedure of Preparation 12, except
substituting 1,1-dimethyl-3H-indene-3-carboxaldehyde for the
2-methylindole-3-carboxaldehyde, the title compound (3 g, 81%) was
obtained as a reddish oil: MS (ES) m/e 188.2 (M+H).sup.+.
Preparation 48
Preparation of
7-hydroxy-1-methyl-3-(methylaminomethyl)-1H-indole
a) 7-Benzyloxy-1-methyl-1H-indole
[0772] According to the procedure of Preparation 13 (a), except
substituting 7-benzyloxyindole for the 3-methylindole, the title
compound (4.8 g, 100%) was obtained as an amber oil: MS (ES) We
238.0 (M+H).sup.+.
b) 7-Benzyloxy-1-methyl-1H-indole-3-carboxaldehyde
[0773] According to the procedure of Preparation 13 (b), except
substituting 7-benzyloxy-1-methyl-1H-indole for the
1,2-dimethylindole, title compound (4.5 g, 85%) was obtained as an
oil: MS (ES) m/e 266.0 (M+H).sup.+.
c) 7-Benzyloxy-1-methyl-3-(methylaminomethyl)-1H-indole
[0774] According to the procedure of Preparation 13 (c), except
substituting 7-benzyloxy-1-methyl-1H-indole-3-carboxaldehyde for
the 1,3-dimethyl-1H-indole-2-carboxaldehyde, the title compound
(3.7 g, 88%) was obtained as an oil: MS (ES) ink 281.2
(M+H).sup.+.
d) 7-Hydroxy-1-methyl-3-(methylaminomethyl)-1H-indole
[0775] According to the literature procedure (J. Org. Chem. 1978,
43, 4195-96), 7-benzyloxy-1-methyl-3-(methylaminomethyl)-1H-indole
was hydrogenated to afford the title compound (300 mg, 79%) as a
brown solid: MS (ES) m/e 191.2 (M+H).sup.+.
Preparation 49
Preparation of 3-(methylaminomethyl)-1,2,7-trimethyl-1H-indole
a) 1,2,7-Trimethyl-1H-indole
[0776] According to the procedure of Preparation 13 (a), except
substituting 2,7-dimethylindole for the 3-methylindole, the title
compound (960 mg, 87%) was obtained as an oil: MS (ES) m/e 160.2
(M+H).sup.+.
b) 1,2,7-Trimethylindole-3-carboxaldehyde
[0777] According to the procedure of Preparation 13 (b), except
substituting 1,2,7-trimethyl-1H-indole for the 1,4-dimethylindole,
the title compound (800 mg, 62%) was obtained as a light tan solid:
MS (ES) m/e 188.2 (M+H).sup.+.
c) 3-(Methylaminomethyl)-1,2,7-trimethyl-1H-indole
[0778] According to the procedure of Preparation 13 (c) except
substituting 1,2,7-trimethyl-1H-indole-3-carboxaldehyde for the
1,3-dimethyl-1H-indole-2-carboxaldehyde, the title compound (570
mg, 71%) was obtained as an oil which slowly crystallized: MS (ES)
m/e 405.4 (2M+H).sup.+.
Preparation 50
Preparation of 7-chloro-3-(methylaminomethyl)-1H-indole
a) 7-Chloro-1H-indole-3-carboxaldehyde
[0779] According to the procedure of Preparation 13 (b), except
substituting 7-chloroindole for the 1,2-dimethylindole, the title
compound (0.48 g, 44%) was obtained as a white solid after
recrystallization from hot EtOAc: MS (ES) m/e 180.0
(M+H).sup.+.
b) 7-Chloro-3-(methylaminomethyl)-1H-indole
[0780] According to the procedure of Preparation 13 (c), except
substituting 7-chloro-1H-indole-3-carboxaldehyde for the
1,3-dimethyl-1H-indole-2-carboxaldehyde, the title compound (440
mg, 92%) was obtained as an off white solid: MS (ES) m/e 195.2
(M+H).sup.+.
Preparation 51
Preparation of 2-(methylaminomethyl)naphthalene
[0781] To a stirred solution of 40 wt % methylamine in H.sub.2O (50
mL, 581 mmole) in THF (50 mL) at 0.degree. C. was added
2-(bromomethyl)naphthalene (10 g, 43 mmole) in one portion. The
reaction was allowed to warm to RT and stirred for 16 hr, then was
then concentrated under vacuum. The residue was taken up in
Et.sub.2O and washed with 1.0 N NaOH then with brine, dried
(Na.sub.2SO.sub.4), and concentrated to dryness. Purification by
flash chromatography on silica gel (98:2 to 9:1 CHCl.sub.3/methanol
containing 5% NH.sub.4OH) gave the title compound (3.95 g, 54%) as
a clear oil: .sup.1H NMR (400 MHz, CDCl.sub.3) .delta. 7.85 (m,
3H), 7.79 (s, 1H), 7.49 (m, 3H), 3.94 (s, 2H), 2.53 (s, 3H).
Preparation 52
Preparation of 3-(methylaminomethyl)quinoline
[0782] A solution of 3-quinolinecarboxaldehyde (1.5 g, 10 mmole),
2.0 M CH.sub.3NH.sub.2/MeOH (10 mL, 20 mmole), glacial AcOH (0.6
mL, 10 mmole), and NaBH.sub.3CN (0.35 g, 11 mmole) in MeOH (20 mL)
was stirred at RT overnight, then was concentrated in vacuo. The
residue was diluted with 5% NaOH and extracted with
CH.sub.2Cl.sub.2. The combined organic extracts were washed with
brine, dried over MgSO.sub.4, and concentrated. Flash
chromatography on silica gel (10% MeOH/CH.sub.2Cl.sub.2) gave the
title compound (0.83 g, 24%) as a slightly yellow viscous oil: MS
(ES) m/e 173 (M+H).sup.+.
Preparation 53
Preparation of
(E)-2-methyl-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylic
acid hydrochloride salt
a) tert-Butyl
(E)-2-methyl-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylate
[0783] According to the procedure of Preparation 31(a), except
substituting tert-butyl methacrylate (4.7 g, 33.2 mmole) for the
tert-butyl acrylate, the title compound (2.7 g, 42%) was prepared
as a yellow solid: MS (ES) m/e 289 (M+H).sup.+.
b)
(E)-2-methyl-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylic
acid hydrochloride salt
[0784] According to the procedure of Preparation 31(b), except
substituting tert-butyl
(E)-2-methyl-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylate
(2.7 g, 9.3 mmole) for the tert-butyl
(E)-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylate, the
title compound (2.5 g, 99%) was prepared as a white solid: MS (ES)
m/e 232 (M+H).sup.+.
Preparation 54
Preparation of
(E)-3-methyl-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylic
acid hydrochloride salt
a) tert-Butyl
(E)-3-methyl-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylate
[0785] According to the procedure of Preparation 31(a), except
substituting tert-butyl crotonate (4.7 g, 33.2 mmole) for the
tert-butyl acrylate, the title compound (3.7 g, 58%) was prepared
as a yellow solid: MS (ES) m/e 289 (M+H).sup.+.
b)
(E)-3-methyl-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylic
acid hydrochloride salt
[0786] According to the procedure of Preparation 31(b), except
substituting tert-butyl
(E)-3-methyl-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylate
(3.7 g, 12.8 mmole) for the tert-butyl
(E)-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylate, the
title compound (3.4 g, 99%) was prepared as a white solid: MS (ES)
m/e 232 (M+H).sup.+.
Preparation 55
Preparation of
7-bromo-4-methyl-1,2,4,5-tetrahydropyrido[2,3-e]-1,4-diazepin-3-one
a)
5-Bromo-3-[N-(tert-butoxycarbonyl)-N-methylaminomethyl]-2-[N-(tert-buto-
xycarbonyl)amino]pyridine
[0787] To a solution of
2-amino-5-bromo-3-(methylaminomethyl)pyridine (3.8 g, 17.6 mmole),
from Preparation 5 (a), in THF was added di-tert-butyl dicarbonate
(8.8 g, 40.5 mmole). The reaction was heated to reflux for 12 hr
then was concentrated under vacuum. Flash chromatography on silica
gel (1:1 hexanes/EtOAc) gave the title compound (6.2 g, 85%) as a
white waxy solid: MS (ES) m/e 416 (M+H).sup.+.
b)
5-Bromo-2-[(ethoxycarbonyl)methylamino]-3-(methylaminomethyl)-2-[N-(ter-
t-butoxycarbonyl)amino]pyridine bis-trifluoroacetic acid salt
[0788] To a suspension of 60% NaH (0.46 g, 11.5 mmole) in THF (100
mL) at RT was added
5-bromo-3-[N-(tert-butoxycarbonyl)-N-methylaminomethyl]-2-[N-(tert-butoxy-
carbonyl)amino]pyridine (4.0 g, 9.61 mmole). After 30 min, ethyl
bromoacetate (1.8 g, 10.6 mmole) was added. The reaction was
stirred at RT for 12 hr, then was quenched with H.sub.2O (5 mL) and
concentrated. The residue was dissolved in EtOAc (200 mL), and the
solution was washed with H.sub.2O (100 mL), dried over
Na.sub.2SO.sub.4, and concentrated under high vacuum to a light
yellow solid. This was dissolved in CH.sub.2Cl.sub.2 (50 mL) and
trifluoroacetic acid (20 mL). After 2 hr, the reaction was
concentrated under vacuum and the residue was purified flash
chromatography on silica gel (95:5 CHCl.sub.3/CH.sub.3OH). The
title compound (4.1 g, 80%) was obtained as a yellow solid: MS (ES)
m/e 302 (M+H).sup.+.
c)
7-Bromo-4-methyl-1,2,4,5-tetrahydropyrido[2,3-e]-1,4-diazepin-3-one
[0789] To a solution of
5-bromo-2-[(ethoxycarbonyl)methylamino]-3-(methylaminomethyl)-2-[N-(tert--
butoxycarbonyl)amino]pyridine bis-trifluoroacetic acid salt (4.1 g,
7.7 mmole) in toluene was added triethylamine (3.3 mL, 23.7 mmole).
The reaction was heated at reflux for 72 hr then concentrated under
vacuum. Flash chromatography on silica gel (9:1
CHCl.sub.3/CH.sub.3OH containing 5% NH.sub.4OH) gave the title
compound (1.4 g, 72%) as a tan solid: MS (ES) m/e 256
(M+H).sup.+.
Preparation 56
Preparation of
(E)-3-(8-oxo-6,7,8,9-tetrahydro-5H-pyrido[2,3-b]azepin-3-0)-acrylic
acid hydrochloride salt
a) tert-butyl
(E)-3-(8-oxo-6,7,8,9-tetrahydro-5H-pyrido[2,3-b]azepin-3-yl)acrylate
[0790] A solution of
3-bromo-5,6,7,9-tetrahydro-pyrido[2,3-b]azepin-8-one (1.00 g, 4.15
mmole), tert-butyl acrylate (0.67 mL, 4.60 mmole), DIEA (1.45 mL,
8.30 mmole), Pd(OAc).sub.2 (0.09 g, 0.42 mmole) and P(o-tol).sub.3
(0.25 g, 0.85 mmole) in propionitrile (25 mL) was purged with
N.sub.2 and then heated at reflux overnight. The dark mixture was
filtered through a pad of Celite.RTM., and the filter pad was
rinsed with acetonitrile (250 mL). The filtrate was concentrated in
vacuo, and the residue was purified by flash chromatography on
silica gel (ethyl acetate). The title compound (0.70 g, 58%) was
obtained as a light yellow solid after drying in vacuo: MS (ES) m/e
289 (M+H).sup.+.
b)
(E)-3-(8-oxo-6,7,8,9-tetrahydro-5H-pyrido[2,3-b]azepin-3-yl)-acrylic
acid hydrochloride salt
[0791] According to the procedure of Preparation 31(b), except
substituting tert-butyl
(E)-3-(8-oxo-6,7,8,9-tetrahydro-5H-pyrido[2,3-b]azepin-3-yl)acrylate
(0.70 g, 2.40 mmole) for the tert-butyl
(E)-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylate, the
title compound (0.49 g, 77%) was obtained as an off-white solid
after drying in vacuo: MS (ES) m/e 233 (M+H).sup.+.
Preparation 57
Preparation of
1-(2-hydroxyethyl)-3-(methylaminomethyl)-1H-indole
[0792] According to the reported literature procedure (J. Org.
Chem. 1998, 63, 6721-6726) except substituting
3-[N-(benzyloxycarbonyl)-N-methylaminomethyl]-1H-indole (3.70 g,
12.60 mmole) for the 5-bromoindole, the title compound (4.00 g,
93%) was obtained as a yellow solid after drying in vacuo: MS (ES)
m/e 338 (M+H).sup.+.
Preparation 58
Preparation of
2-chloro-1-methyl-2-(methylaminomethyl)-1H-indole
a) 2-Chloro-1H-indole-3-carboxaldehyde
[0793] To DMF (30 mL) with stirring at 0.degree. C. was added
dropwise phosphorus oxychloride (10 mL, 107 mmole) over 5 minutes.
The reaction was stirred for an additional 15 minutes, then
oxindole (6.0 g, 45 mmole) was added portionwise over 5 min. The
reaction was allowed to warm to RT and stirred for 18 h then was
carefully poured into ice water (350 mL). The solution was stirred
for 6 h after which time a suspension formed. The solids were
filtered off, washed with cold water, pressed dry and dried under
vacuum to give the title compound (6.83 g, 84%) as a yellowish
solid: .sup.1H NMR (400 MHz, d.sub.6-DMSO) .quadrature. 10.0 (s,
1H), 8.05 (dd, 1H), 7.43 (dd, 1H), 7.23-7.31 (m, 2H); MS (ES) m/e
179.0 (M+H).sup.+.
b) 2-Chloro-1-methyl-1H-indole-3-carboxaldehyde
[0794] NaH (60% dispersion in mineral oil) (0.9 g, 22.5 mmole) was
added portionwise over 5 min to a solution of
2-chloro-1H-indole-3-carboxaldehyde (3.8 g, 21.2 mmole) and
iodomethane (1.5 mL, 24 mmole) in DMF (50 mL) with stirring at
0.degree. C. The reaction was allowed to warm to RT and stir for 4
h, then was concentrated under vacuum. The remaining residue was
taken up in EtOAc, and the solution was washed with water then
brine, dried (MgSO.sub.4), and concentrated to dryness. Trituration
with 1:1 Et.sub.2O/petroleum ether, filtration, and drying under
vacuum gave the title compound (3.10 g, 76%) as an off-white solid:
.sup.1H NMR (400 MHz, CDCl.sub.3) .delta. 10.12 (s, 1H), 8.29 (m,
1H), 7.33 (m, 3H), 3.81 (s, 3H); MS (ES) m/e 194.0 (M+H).sup.+.
c) 2-Chloro-1-methyl-2-(methylaminomethyl)-1H-indole
[0795] According to the procedure of Preparation 12, except
substituting 2-chloro-1-methyl-1H-indole-3-carboxaldehyde (3.0 g,
15.5 mmole) for the 1-methylindole-3-carboxaldehyde, the title
compound (2.91 g, 90%) was prepared as an oil: .sup.1H NMR (400
MHz, CDCl.sub.3) .delta. 7.60 (d, J=7.9 Hz, 1H), 7.22 (m, 2H), 7.13
(m, 1H), 3.92 (s, 2H), 3.71 (s, 3H), 2.44 (s, 3H).
Preparation 59
Preparation of
3-(benzhydrylideneamino)-6-bromo-3,4-dihydro-1H-1,8-naphthyridin-2-one
[0796] NaH (60% dispersion in mineral oil, 1.2 g, 30 mmole) was
added portionwise over 10 min to a solution of
N-(diphenylmethylene)glycine ethyl ester (8.0 g, 30 mmole) in DMF
(150 mL) with stirring under Ar at 0.degree. C. The reaction was
stirred for 15 min, then 2-amino-5-bromo-3-(bromomethyl)pyridine
hydrobromide (5.0 g, 14.4 mmole) was added in one portion. The
reaction was allowed to warm to RT and stir for 18 h, then was
concentrated under vacuum. The remaining residue was taken up in
EtOAc (150 mL), hexane (150 mL), and H.sub.2O (150 mL). The
resulting suspension was triturated and filtered, and the solid was
dried under vacuum to give the title compound (3.27 g, 56%) as an
off-white solid: .sup.1H NMR (400 MHz, d.sub.6-DMSO) .delta. 10.92
(s, 1H), 8.23 (s, 1H), 7.86 (s, 1H), 7.26-7.55 (m, 10H), 4.05 (dd,
1H), 3.10 (t, 2H); MS (ES) m/e 406.0 (M+H).sup.+.
Preparation 60
Preparation of 2-(methylaminomethyl)benzofuran
[0797] To a stirred solution of 2-benzofurancarboxaldehyde (2.22 g,
15.2 mmole) in MeOH (5 mL) was added 2 M methylamine in MeOH (15
mL), HOAc (0.86 mL, 15 mmole), and NaBH.sub.3CN (1.0 g, 15.9
mmole). The reaction was stirred for 18 h at RT then concentrated
under vacuum. The remaining residue was taken up in Et.sub.2O, and
the solution was washed with 1 N NaOH then brine, dried
(Na.sub.2SO.sub.4), and concentrated to dryness. Purification by
flash chromatography on silica gel (5% (5% NH.sub.4OH in
MeOH)/CHCl.sub.3) gave the title compound (1.23 g, 50%) as a pale
yellow oil: MS (ES) m/e 162.4 (M+H).sup.+.
Preparation 61
Preparation of methyl
1-methyl-3-(methylaminomethyl)-1H-indole-7-carboxylate
a) Methyl 1-methyl-1H-indole-7-carboxylate
[0798] According to the procedure of Preparation 9 (a), except
substituting methyl indole-7-carboxylate for the ethyl
indole-2-carboxylate, the title compound (2.4 g, 90%) was obtained
as an oil: MS (ES) m/e 190.2 (M+H).sup.+.
b) N-Methyl-7-methoxycarbonyl-1H-indole-3-carboxaldehyde
[0799] According to the procedure of Preparation 13 (b), except
substituting methyl 1-methyl-1H-indole-7-carboxylate for the
1,3-dimethylindole, the title compound (1.8 g, 70%) was obtained as
a white solid: MS (ES) m/e 218.2 (M+H).sup.+.
c) Methyl
1-methyl-3-(methylaminomethyl)-1H-indole-7-carboxylate
[0800] According to the procedure of Preparation 12, except
substituting 1-methyl-7-methoxycarbonyl-1H-indole 3-carboxaldehyde
for the 2-methylindole-3-carboxaldehyde, the title compound (1.7 g,
92%) was obtained as an oil: MS (ES) m/e 233.2 (M+H).sup.+.
Preparation 62
Preparation of methyl
1-methyl-3-(methylaminomethyl)-1H-indole-6-carboxylate
a) Methyl 1-methyl-1H-indole-6-carboxylate
[0801] According to the procedure of Preparation 9 (a), except
substituting methyl indole-6-carboxylate for the ethyl
indole-2-carboxylate, the title compound (2.5 g, 95%) was obtained
as white solid: MS (ES) m/e 190.2 (M+H).sup.+.
b) N-Methyl-7-methoxycarbonyl-1H-indole-3-carboxaldehyde
[0802] According to the procedure of Preparation 13 (b), except
substituting methyl 1-methyl-1H-indole-6-carboxylate for the
1,3-dimethylindole, the title compound (2.6 g, 98%) was obtained as
a white solid: MS (ES) m/e 218.2 (M+H).sup.+.
c) Methyl
1-methyl-3-(methylaminomethyl)-1H-indole-6-carboxylate
[0803] According to the procedure of Preparation 12, except
substituting 1-methyl-7-methoxycarbonyl-1H-indole 3-carboxaldehyde
for the 2-methylindole-3-carboxaldehyde, the title compound (1.9 g,
63%) was obtained as an oil: MS (ES) m/e 233.2 (M+H).sup.+.
Preparation 63
Preparation of
6-methoxy-1-methyl-3-(methylaminomethyl)-1H-indole
a) 6-Methoxy-1-methyl-1H-indole
[0804] According to the procedure of Preparation 9 (a), except
substituting 6-methoxy-1H-indole for the ethyl
indole-2-carboxylate, the title compound (2.3 g, 95%) was obtained
as an oil: MS (ES) m/e 162.2 (M+H).sup.+.
b) 6-Methoxy-1-methyl-1H-indole-3-carboxaldehyde
[0805] According to the procedure of Preparation 13 (b), except
substituting 6-methoxy-1-methyl-1H-indole for the
1,3-dimethylindole, the title compound (2.3 g, 82%) was obtained as
a tan solid: MS (ES) m/e 190.2 (M+
c) 6-Methoxy-1-methyl-3-(methylaminomethyl)-1H-indole
[0806] According to the procedure of Preparation 12, except
substituting 6-methoxy-1-methyl-1H-indole-3-carboxaldehyde for the
2-methylindole-3-carboxaldehyde, the title compound (2.1 g, 87%)
was obtained as an oil: MS (ES) m/e 205.2 (M+H).sup.+.
Preparation 64
Preparation of 7-fluoro-3-(methylaminomethyl)-1H-indole
a) 7-Fluoro-1H-indole-3-carboxaldehyde
[0807] According to the procedure of Preparation 13 (b), except
substituting 7-fluoroindole (0.5 g, 3.7 mmole) for the
1,3-dimethylindole, the title compound (0.3 g, 55%) was prepared as
a waxy solid: MS (ES) m/e 164 (M+H).sup.+.
b) 7-Fluoro-3-(methylaminomethyl)-1H-indole
[0808] According to the procedure of Preparation 13 (c), except
substituting 7-fluoro-1H-indole-3-carboxaldehyde (0.5 g, 3.1 mmole)
for the 1,3-dimethyl-1H-indole-2-carboxaldehyde, the title compound
(0.5 g, 90%) was prepared as a viscous oil: MS (ES) m/e 179
(M+H).sup.+.
Preparation 65
Preparation of 4-fluoro-3-(methylaminomethyl)-1H-indole
a) 4-Fluoro-1H-indole-3-carboxaldehyde
[0809] According to the procedure of Preparation 13 (b), except
substituting 4-fluoroindole (0.4 g, 2.45 mmole) for the
1,3-dimethylindole, the title compound (0.31 g, 72%) was prepared
as a viscous oil: MS (ES) m/e 164 (M+H).sup.+.
b) 4-Fluoro-3-(methylaminomethyl)-1H-indole
[0810] According to the procedure of Preparation 13 (c), except
substituting 4-fluoro-1H-indole-3-carboxaldehyde for the
1,3-dimethyl-1H-indole-2-carboxaldehyde, the title compound was
prepared as a viscous oil: MS (ES) m/e 179 (M+H).sup.+.
Preparation 66
Preparation of
6-bromo-3-(2-methoxyethyl)-3,4-dihydro-1H-pyrido[2,3-d]pyrimidin-2-one
a) 2-Amino-5-bromo-3-[(2-methoxyethyl)aminomethyl]pyridine
[0811] 2-Methoxyethylamine (1.49 mL, 17.16 mmole) was added to a
solution of 2-amino-5-bromo-3-(bromomethyl)pyridine hydrobromide
(1.49 g, 4.29 mmole) and DIEA (2.24 mL, 12.87 mmole) in
CH.sub.2Cl.sub.2 (10 mL) at RT. The reaction was stirred overnight
then was concentrated in vacuo. The residue was diluted with water
and the solution was extracted with ethyl acetate. The combined
organic extracts were washed with brine, dried over
Na.sub.2SO.sub.4, and concentrated to afford the title compound
(1.00 g, 90%) as a light brown liquid after drying in vacuo: MS
(ES) m/e 260/262 (M+H).sup.+.
b)
6-Bromo-3-(2-methoxyethyl)-3,4-dihydro-1H-pyrido[2,3-d]pyrimidin-2-one
[0812] 1,1'-Carbonyldiimidazole (0.74 g, 4.60 mmole) was added to a
solution of 2-amino-5-bromo-3-[(2-methoxyethyl)aminomethyl]pyridine
(1.00 g, 3.80 mmole) in 1,2-dichloroethane (35 mL) at RT. The
reaction was heated at 65.degree. C. with stirring overnight, then
was concentrated in vacuo. Flash chromatography on silica gel (5%
MeOH/CHCl.sub.3) gave title compound (0.90 g, 83%) as a yellow
solid after drying in vacuo: MS (ES) m/e 286/288 (M+H).sup.+.
Preparation 67
Preparation of Methyl-(1-propyl-naphthalen-2-ylmethyl)amine
[0813] A solution of 2.0 M methylamine in methanol (20 mL) was
added to 1-propyl-naphthalene-2-carbaldehyde (0.983 g, 4.95 mmol)
under N.sub.2 and allowed to stir for 18 h. The solution was
concentrated under reduced pressure. Then the resulting dark yellow
oil was solvated in EtOH (20 mL) under N.sub.2. To the solution was
added NaBH.sub.4 (0.187 g, 4.95 mmol) and the mixture allowed to
stir for 6.5 h. The reaction was concentrated under reduced
pressure, then solvated in 1 N NaOH (20 mL) and extracted with
Et.sub.2O (3.times.50 mL). The organics were combined, washed with
brine (2.times.100 mL), dried over Na.sub.2SO.sub.4, filtered and
concentrated to yield the title compound (0.94 g, 89%) as a yellow
oil: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 7.87-7.73 (m, 4H),
7.51-7.43 (m, 3H), 3.53 (m, 1H), 2.09 (s, 3H), 1.70-1.52 (m, 2H),
1.26-1.12 (m, 2H), 0.87-0.79 (m, 3H).
Preparation 68
Preparation of (4-Fluoro-naphthalen-1-ylmethyl)methylamine
a) 4-Fluoro-naphthalene-1-carbaldehyde
[0814] A solution of .alpha.,.alpha.-dichloromethyl methyl ether
(5.9 mL, 65 mmol) in CH.sub.2Cl.sub.2 (30 mL) was cooled in an ice
bath and then treated dropwise over 15 min with SnCl.sub.4 (7.6 mL,
65 mmol). After stirring for 45 min, a solution of
1-fluoronaphthalene (5.5 mL, 50 mmol) in CH.sub.2Cl.sub.2 (30 mL)
was added. The mixture was allowed to slowly warm to room
temperature while stirring overnight. The mixture was poured in ice
water (100 mL) and diluted with CH.sub.2Cl.sub.2 (50 mL). The
layers were separated. The organic layer was diluted with
CH.sub.2Cl.sub.2 (100 mL), washed with H.sub.2O (3.times.50 mL),
dried over Na.sub.2SO.sub.4, filtered, and the solvent was removed
in vacuo to give the title compound (7.62 g, 87%) as a pale yellow
solid: MS (ESI) m/e 175 (M+H).sup.+.
b) (4-Fluoro-naphthalen-1-ylmethyl)methylamine
[0815] According to the procedure of Preparation 67, except
substituting 4-fluoro-naphthalene-1-carbaldehyde for the
1-propyl-naphthalene-2-carbaldehyde, the title compound (3.18 g,
98%) was prepared as a golden oil: MS (ESI) m/e 190
(M+H).sup.+.
Preparation 69
Preparation of (4-Chloro-naphthalen-1-ylmethyl)methylamine
a) 4-Chloro-naphthalene-1-carbaldehyde
[0816] According to the procedure of Preparation 2(a), except
substituting 1-chloronaphthalene for 1-fluoronaphthalene, the title
compound (5.36 g, 55%) was prepared as a pale yellow oil: MS (ESI)
m/e 191 (M+H).sup.+.
b) (4-Chloro-naphthalen-1-ylmethyl)methylamine
[0817] According to the procedure of Preparation 67, except
substituting 4-chloro-naphthalene-1-carbaldehyde for the
1-propyl-naphthalene-2-carbaldehyde, the title compound (1.06 g,
60%) was prepared as a pale yellow oil: MS (ESI) m/e 206
(M+H).sup.+.
Preparation 70
Preparation of (3-chlorobenzo[b]thiophen-2-ylmethyl)methylamine
a) 3-chloro-benzo[b]thiophene-2-carbaldehyde
[0818] Vilsmeier reagent was prepared via the dropwise addition of
POCl.sub.3 (7.9 mL, 84 mmol) into ice-cold DMF (14 mL). A solution
of 2-carboxymethylsulfanyl-benzoic acid (3.0 g, 14 mmol) in DMF (15
mL) was added dropwise to the Vilsmeier reagent. The resulting
mixture was warmed to room temperature and then heated to
80.degree. C. for 3.5 h. The reaction mixture was cooled to ambient
temperature. Crushed ice was added until a bright yellow
precipitate appeared. The solid was isolated by filtration.
Purification by flash column chromatography (silica gel,
hexanes/ethyl acetate 3:2) gave the title compound (1.87 g, 68%) as
a yellow powder: .sup.1H NMR (300 MHz, CDCl.sub.a) .delta. 10.36
(s, 1H), 8.03 (m, 1H), 7.86 (m, 1H), 7.59-7.53 (m, 2H).
b) (3-chlorobenzo[b]thiophen-2-ylmethyl)methylamine
[0819] To 3-chloro-benzo[b]thiophene-2-carbaldehyde (1.9 g, 9.5
mmol) was added a solution of 2 M methylamine in methanol (32 mL)
and the resulting mixture was stirred overnight at room
temperature. The mixture was concentrated under reduced pressure
and the residue taken up in ethanol (32 mL). The solution was
cooled to 0.degree. C., NaBH.sub.4 (0.54 g, 14 mmol) was added in
one portion and stirring continued overnight. The mixture was
concentrated under reduced pressure and the residue solvated in 1 M
NaOH (200 mL). The mixture was extracted with diethyl ether
(3.times.150 mL) and the combined organics were washed with brine
(100 mL), dried over Na.sub.2SO.sub.4, filtered and concentrated
under reduced pressure to give a yellow oil. Purification by flash
column chromatography (silica gel, hexanes/ethyl acetate 1:1) gave
the title compound (1.62 g, 80%) as a pale yellow oil which
crystallized under vacuum: .sup.1H NMR (300 MHz, CDCl.sub.3)
.delta. 7.70 (m, 2H), 7.45 (m, 2H), 4.08 (s, 2H), 2.51 (s, 3H).
Preparation 71
Preparation of
(5-Chloro-1-methyl-1H-indol-2-ylmethyl)methylamine
a) 5-Chloro-1-methyl-1H-indole-2-carboxylic acid methylamide
[0820] To a solution of 5-chloro-1-methyl-1H-indole-2-carboxylic
acid ethyl ester (1.27 g, 5.3 mmol) in toluene (10 mL) was added
0,N-dimethyl-hydroxylamine (9.6 mL of a 1 M solution in toluene,
9.6 mmol). The resulting mixture was heated to reflux overnight
after which the reaction was cooled to room temperature and
quenched by the addition of 10% aqueous K.sub.2CO.sub.3 (50 mL).
The mixture was extracted with ethyl acetate (3.times.200 mL). The
combined organic layers were washed with brine (100 mL), dried over
Na.sub.2SO.sub.4, filtered and concentrated to give the title
compound (2.12 g, 96%) as a yellow solid: .sup.1H NMR (300 MHz,
CDCl.sub.3) .delta. 7.59 (s, 1H), 7.27 (m, 2H), 6.73 (s, 1H), 6.13
(s, 1H), 4.03 (s, 3H), 3.01 (d, J=4.9 Hz, 3H); MS (ESI) m/e 222
(M+H).sup.+.
b) (5-Chloro-1-methyl-1H-indol-2-ylmethyl)methylamine
[0821] To an ice-cold solution of
5-chloro-1-methyl-1H-indole-2-carboxylic acid methylamide (2.12 g,
9.5 mmol) in THF (15 mL) was added lithium aluminum hydride (19 mL
of a 1 M solution in THF, 19.0 mmol). Once the addition was
complete, the resulting slurry was heated to reflux overnight. The
mixture was cooled in an ice bath and carefully quenched by the
consecutive addition of water (0.90 mL), 15% aqueous NaOH (0.90 mL)
and water (2.5 mL). The resulting mixture was filtered through
diatomaceous earth and the filtrate concentrated to give the title
(2.00 g, quantitative) compound as an orange oil: .sup.1H NMR (300
MHz, CDCl.sub.3) .delta. 7.51 (d, J=1.8 Hz, 1H), 7.25-1.14 (m, 2H),
6.32 (s, 1H), 3.86 (s, 2H), 3.73 (d, J=4.8 Hz, 3H), 2.49 (s,
3H).
Preparation 72
Preparation of (1,7-dimethyl-1H-indol-2-ylmethyl)methylamine
a) 1,7-Dimethyl-1H-indole
[0822] Sodium hydride (1.15 g, 28.7 mmol, 60% in mineral oil) was
rinsed with hexanes and then suspended in DMF (20 mL). To this
suspension was added 7-methylindole (2.5 g, 19 mmol) portionwise.
Gas evolution was allowed to subside between additions. The
resulting brown mixture was stirred at room temperature for 15 min
and then CH.sub.3I (2.71 g, 95.5 mmol) was added in one portion.
The exothermic reaction was cooled to 30.degree. C. and stirred for
1 h. Saturated aqueous NH.sub.4Cl (10 mL) was added and the mixture
was concentrated under reduced pressure. The residue was combined
with water (100 mL) and the mixture was then extracted with diethyl
ether (3.times.100 mL). The combined organics were washed with
brine, dried over Na.sub.2SO.sub.4, filtered and concentrated under
reduced pressure to give the title compound (2.85 g, quantitative)
as a red-pink oil which crystallized upon vacuum drying: .sup.1H
NMR (300 MHz, CDCl.sub.3) .delta. 7.43 (d, J=7.6 Hz, 1H), 6.97-6.87
(m, 3H), 6.41 (d, J=3.1 Hz, 1H), 4.04 (s, 3H), 2.7 (s, 3H).
b) 1,7-Dimethyl-1H-indole-2-carbaldehyde
[0823] To a solution of 1,7-dimethylindole (2.85 g, 19.6 mmol) and
TMEDA (3.3 mL, 21.6 mmol) in diethyl ether (30 mL) at -30.degree.
C. under N.sub.2 was added n-butyllithium (13.5 mL of a 1.6 M
solution in hexanes, 21.6 mmol) dropwise. The resulting orange
solution was heated to reflux for 1 h and then DMF (4.6 mL, 58.8
mmol) was added in one portion. The solution was stirred at room
temperature overnight. Saturated aqueous NH.sub.4Cl solution was
added and the mixture was then extracted with ethyl acetate
(3.times.150 mL). The combined organics were washed with water (100
mL) and brine (100 mL), dried over Na.sub.2SO.sub.4, filtered and
concentrated under reduced pressure to provide an orange oil.
Purification by flash column chromatography (silica gel,
hexanes/ethyl acetate, 95:5) gave the title compound (1.57 g, 46%)
as a yellow solid: .sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 9.83
(s, 1H), 7.54 (d, J=7.8 Hz, 1H), 7.21 (s, 1H), 7.09-7.02 (m, 2H),
4.39 (s, 3H), 2.79 (s, 3H).
c) (1,7-Dimethyl-1H-indol-2-ylmethyl)methylamine
[0824] To 1,7-dimethyl-1H-indole-2-carbaldehyde (1.57 g, 9.06 mmol)
was added a solution of 2 M solution of methylamine in methanol (30
mL) and the resulting mixture stirred overnight at room
temperature. The mixture was concentrated under reduced pressure
and the residue taken up in ethanol (30 mL). The solution was
cooled to 0.degree. C. and then NaBH.sub.4 (0.34 g, 9.1 mmol) was
added in one portion. The mixture was stirred overnight. Additional
NaBH.sub.4 (0.18 g, 4.5 mmol) was added and the mixture was again
stirred overnight. The mixture was concentrated under reduced
pressure and the residue combined with 1 M NaOH (200 mL). The
mixture was extracted with diethyl ether (3.times.150 mL). The
combined organics were washed with brine (100 mL), dried over
Na.sub.2SO.sub.4, filtered and concentrated under reduced pressure
to give the title compound as a pale yellow oil (1.60 g, 94%):
.sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 7.37 (d, J=7.8 Hz, 1H),
6.93-6.87 (m, 2H), 6.34 (s, 1H), 4.02 (s, 3H), 3.84 (s, 2H), 2.77
(s, 3H), 2.50 (s, 3H).
Preparation 73
Preparation of
(5-Fluoro-3-methyl-benzo[b]thiophen-2-ylmethyl)methylamine
a) 5-Fluoro-3-methyl-benzo[b]thiophene-2-carbaldehyde
[0825] To a solution of 5-fluoro-3-methyl-benzo[b]thiophene (4.83
g, 29.1 mmol) in THF (50 mL) at -30.degree. C. under N.sub.2 was
added n-butyllithium (20.0 mL of a 1.6 M solution in hexanes, 32.0
mmol) dropwise. The resulting orange solution was stirred for 1 h
and then DMF (3.4 mL, 43.7 mmol) was added in one portion. The
solution was warmed slowly to room temperature and stirred
overnight. Saturated aqueous NH.sub.4Cl was added and the mixture
was extracted with ethyl acetate (3.times.200 mL). The combined
organics were washed with water (100 mL) and brine (100 mL), dried
over Na.sub.2SO.sub.4, filtered and concentrated under reduced
pressure to give the title compound (5.55 g, 97%) as a yellow
solid: .sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 10.32 (s, 1H),
7.80 (dd, J=9.0, 4.8 Hz, 1H), 7.53 (dd, J=9.3, 2.6 Hz, 1H),
7.31-7.24 (m, 1H), 2.76 (s, 3H).
b) (5-Fluoro-3-methyl-benzo[b]thiophen-2-ylmethyl)methylamine
[0826] To 5-fluoro-3-methyl-benzo[b]thiophene-2-carbaldehyde (5.43
g, 28.0 mmol) was added a solution of 2 M methylamine in methanol
(94 mL) and the resulting mixture was stirred overnight at room
temperature. The mixture was concentrated under reduced pressure
and the residue taken up in ethanol (90 mL). The solution was
cooled to 0.degree. C. and then NaBH.sub.4 (1.06 g, 28.0 mmol) was
added in one portion. The mixture was stirred 4 hr, after which
time NaBH.sub.4 (0.54 g, 14.0 mmol) was added and the mixture was
stirred overnight. The mixture was concentrated under reduced
pressure and the residue combined with 1 M NaOH (200 mL). The
mixture was extracted with diethyl ether (3.times.150 mL) and the
combined organics were washed with brine (100 mL), dried over
Na.sub.2SO.sub.4, filtered and concentrated under reduced pressure
to the title compound (5.26 g, 90%) as a pale yellow oil: .sup.1H
NMR (300 MHz, CDCl.sub.3) .delta. 7.71 (dd, J=9.0, 4.8 Hz, 1H),
7.27 (dd, J=9.3, 2.6 Hz, 1H), 7.09-7.04 (m, 1H), 4.00 (s, 2H), 2.51
(s, 3H), 2.31 (s, 3H).
Preparation 74
Preparation of
(5-Chloro-3-methyl-benzo[b]thiophen-2-ylmethyl)methylamine
a) 5-Chloro-3-methyl-benzo[b]thiophene-2-carbaldehyde
[0827] To a solution of 5-chloro-3-methyl-benzo[b]thiophene (4.98
g, 27.3 mmol) in THF (50 mL) at -40.degree. C. was added
n-butyllithium (18.7 mL of a 1.6 M solution in hexanes, 30.0 mmol)
dropwise. The resulting yellow solution was stirred for 1 h and
then DMF (6.3 mL, 81.9 mmol) was added in one portion. The solution
was warmed slowly to room temperature and stirred overnight.
Saturated aqueous NH.sub.4Cl was added and the mixture was
extracted with ethyl acetate (3.times.200 mL). The combined
organics were washed with water (100 mL) and brine (100 mL), dried
over Na.sub.2SO.sub.4, filtered and concentrated under reduced
pressure to give the title compound (6.62 g, 89%) as a yellow
solid: .sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 10.32 (s, 1H),
7.85 (s, 1H), 7.79 (d, J=8.7 Hz, 1H), 7.46 (dd, J=8.7, 2.0 Hz, 1H),
2.74 (s, 3H).
b) (5-Chloro-3-methyl-benzo[b]thiophen-2-ylmethyl)methylamine
[0828] To 5-chloro-3-methyl-benzo[b]thiophene-2-carbaldehyde (5.10
g, 24.2 mmol) was added a solution of 2 M methylamine in methanol
(81 mL) and the resulting mixture was stirred overnight at room
temperature. The mixture was concentrated under reduced pressure
and the residue taken up in ethanol (81 mL). The solution was
cooled to 0.degree. C., NaBH.sub.4 (1.37 g, 36.3 mmol) was added in
one portion, and stirring was continued overnight. The mixture was
concentrated under reduced pressure and the residue was combined
with 1 M NaOH (200 mL). The mixture was extracted with diethyl
ether (3.times.150 mL). The combined organics were washed with
brine (100 mL), dried over Na.sub.2SO.sub.4, filtered and
concentrated under reduced pressure to the title compound (4.83 g,
88%) as a pale yellow oil which crystallized under vacuum: .sup.1H
NMR (300 MHz, CDCl.sub.3) .delta. 7.69-7.59 (m, 2H), 7.25 (m, 1H),
3.96 (s, 2H), 2.50 (s, 3H), 2.31 (s, 3H).
Preparation 75
Preparation of (3-Methoxy-2-propoxy-benzyl)methylamine
a) 3-Methoxy-2-propoxy-benzaldehyde
[0829] A suspension of 2-hydroxy-3-methoxy-benzaldehyde (10.0 g,
65.6 mmol), 1-bromopropane (60 mL, 657 mmol) and K.sub.2CO.sub.3
(11.3 g, 82.1 mmol) in MeCN (250 mL) was heated to reflux for 12 h.
The mixture was cooled to ambient temperature and the solution
filtered. The filtrate was concentrated to give the title compound
(12.9 g, quantitative) as light yellow oil: MS (ESI) m/e 195
(M+H).sup.+.
b) (3-Methoxy-2-propoxy-benzyl)methylamine
[0830] According to the procedure of Preparation 67, except
substituting 3-methoxy-2-propoxy-benzaldehyde for
1-propyl-naphthalene-2-carbaldehyde, the title compound (13.2 g,
96%) was prepared as a light yellow oil: MS (ESI) m/e 210
(M+H).sup.+.
Preparation 76
Preparation of (2-Isopropoxy-3-methoxy-benzyl)methylamine
a) 2-Isopropoxy-3-methoxy-benzaldehyde
[0831] According to the procedure of Preparation 75(a), except
substituting 2-iodopropane for 1-bromopropane, the title compound
(6.35 g, quantitative) was prepared as light yellow oil: .sup.1H
NMR (300 MHz, CDCl.sub.3) .delta. 10.5 (s, 1H), 7.42 (dd, J=6.6,
2.9 Hz, 1H), 7.16-7.08 (m, 2H), 4.63 (app septet, J=6.2 Hz, 1H),
3.89 (s, 3H), 1.33 (d, J=6.2 Hz, 6H).
b) (2-Isopropoxy-3-methoxy-benzyl)methylamine
[0832] According to the procedure of Preparation 67, except
substituting 2-isopropoxy-3-methoxy-benzaldehyde for
1-propyl-naphthalene-2-carbaldehyde, the title compound (6.39 g,
93%) was prepared as a yellow oil: MS (ESI) m/e 210
(M+H).sup.+.
Preparation 77
Preparation of (2-Ethoxy-3-methyl-benzyl)methylamine
a) 2-Ethoxy-3-methyl-benzaldehyde
[0833] According to the procedure of Preparation 75(a), except
substituting 2-hydroxy-3-methyl-benzaldehyde for
2-hydroxy-3-methoxy-benzaldehyde, and substituting iodoethane for
1-bromopropane, the title compound (10.8 g, 99%) was prepared as a
brown oil: .sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 10.4 (s, 1H),
7.69 (dd, J=7.6, 1.4 Hz, 1H), 7.46-7.43 (m, 1H), 7.13 (dd, J=7.6,
7.6 Hz, 1H), 4.01 (q, J=7.0 Hz, 2H), 2.34 (s, 3H), 1.46 (t, J=7.0
Hz, 3H).
b) (2-Ethoxy-3-methyl-benzyl)methylamine
[0834] According to the procedure of Preparation 67, except
substituting 2-ethoxy-3-methyl-benzaldehyde for
1-propyl-naphthalene-2-carbaldehyde, the title compound (11.2 g,
95%) was prepared as a yellow oil: MS (ESI) m/e 180
(M+H).sup.+.
Preparation 78
Preparation of Methyl-naphthalen-2yl-methylamine
[0835] According to the procedure of Preparation 67, except
substituting naphthalene-2-carbaldehyde for
1-propyl-naphthalene-2-carbaldehyde, the title compound (2.00 g,
91%) was prepared as a clear oil: .sup.1H NMR (300 MHz, CDCl.sub.3)
.delta. 7.84-7.80 (m, 3H), 7.75 (s, 1H), 7.47-7.44 (m, 3H), 3.92
(s, 2H), 2.50 (s, 3H), 1.52 (br s, 1H).
Preparation 79
Preparation of Methyl-Naphthalen-1yl-Methylamine
[0836] According to the procedure of Preparation 67, except
substituting naphthalene-1-carbaldehyde for
1-propyl-naphthalene-2-carbaldehyde, the title compound (2.44 g,
91%) was prepared as an orange oil: .sup.1H NMR (300 MHz,
CDCl.sub.3) .delta. 8.12 (d, J=8.1 Hz, 1H), 7.86 (d, J=7.5 Hz, 1H),
7.77 (d, J=8.4 Hz, 1H), 7.54-7.40 (m, 4H), 4.20 (s, 2H), 2.55 (s,
3H), 1.50 (br s, 1H).
Preparation 80
Preparation of (4-Methanesulfonyl-benzyl)methylamine
[0837] According to the procedure of Preparation 67, except
substituting 4-methanesulfonyl-benzaldehyde for
1-propyl-naphthalene-2-carbaldehyde, the title compound (1.35 g,
63%) was prepared as an off-white solid: MS (ESI) m/e 200
(M+H).sup.+.
Preparation 81
Preparation of Methyl-quinolin-5-yl-methylamine
[0838] According to the procedure of Preparation 67, except
substituting quinoline-5-carbaldehyde for
1-propyl-naphthalene-2-carbaldehyde, the title compound (1.21 g,
84%) was prepared as an orange solid: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 8.90 (d, J=6.0 Hz, 1H), 8.61 (d, J=9.3 Hz,
1H), 7.91 (d, J=8.4 Hz, 1H), 7.68 (t, J=10.2 Hz, 1H), 7.57-7.51 (m,
2H), 4.08 (s, 2H), 2.34 (s, 3H), 2.13 (br s, 1H).
Preparation 82
Preparation of (2,3-Dimethylbenzyl)methylamine
[0839] According to the procedure of Preparation 67, except
substituting 2,3-dimethylbenzaldehyde for
1-propyl-naphthalene-2-carbaldehyde, the title compound (1.69 g,
72%) was prepared as a yellow oil: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 7.09-7.08 (m, 1H), 7.01-6.99 (m, 2H), 3.59
(s, 2H), 3.45 (br s, 1H), 2.29 (s, 3H), 2.22 (s, 3H), 2.16 (s,
3H).
Preparation 83
Preparation of (2,4,5-Trimethoxy-benzyl)methylamine
[0840] According to the procedure of Preparation 67, except
substituting 2,4,5-trimethoxy-benzaldehyde for
1-propyl-naphthalene-2-carbaldehyde, the title compound (1.90 g,
88%) was prepared as a light yellow oil: .sup.1H NMR (300 MHz,
CDCl.sub.3) .delta. 7.11 (s, 1H), 6.84 (s, 1H), 3.94 (s, 6H), 3.86
(s, 3H), 3.71 (s, 2H), 3.53 (br s, 1H), 2.44 (s, 3H).
Preparation 84
Preparation of Benzo[1,3]-dioxol-5-ylmethyl-methylamine
[0841] According to the procedure of Preparation 67, except
substituting benzo[1,3]dioxole-5-carbaldehyde for
1-propyl-naphthalene-2-carbaldehyde, the title compound (3.23 g,
97%) was prepared as a yellow oil: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 6.88-6.75 (m, 3H), 5.96 (s, 2H), 3.52 (s,
2H), 2.20 (s, 3H), 1.95 (br s, 1H).
Preparation 85
Preparation of Benzo[1,3]-dioxol-4-ylmethyl-methylamine
[0842] According to the procedure of Preparation 67, except
substituting benzo[1,3]dioxole-4-carbaldehyde for
1-propyl-naphthalene-2-carbaldehyde, the title compound (1.79 g,
81%) was prepared as a yellow oil: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 6.84-6.82 (m, 1H), 6.79-6.77 (m, 2H), 5.97
(s, 2H), 3.58 (s, 2H), 2.24 (s, 3H), 1.96 (br s, 1H).
Preparation 86
Preparation of (4-Ethoxy-3-methoxy-benzyl)methylamine
[0843] According to the procedure of Preparation 67, except
substituting 4-ethoxy-3-methoxy-benzaldehyde for
1-propyl-naphthalene-2-carbaldehyde, the title compound (1.93 g,
89%) was prepared as a yellow oil: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 6.90-6.76 (m, 3H), 3.97 (q, J=6.9 Hz, 2H),
3.71 (s, 3H), 3.53 (s, 2H), 2.22 (s, 3H), 2.12 (br s, 1H),
1.33-1.29 (t, J=6.9 Hz, 3H).
Preparation 87
Preparation of (2-Ethoxy-3-methoxy-benzyl)methylamine
[0844] According to the procedure of Preparation 67, except
substituting 2-ethoxy-3-methoxy-benzaldehyde for
1-propyl-naphthalene-2-carbaldehyde, the title compound (2.03 g,
93%) was prepared as a yellow oil: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 6.99-6.88 (m, 3H), 3.92 (q, J=6.9 Hz, 2H),
3.77 (s, 3H), 3.61 (s, 2H), 2.25 (s, 3H), 1.87 (br s, 1H), 1.26 (t,
J=6.3 Hz, 3H).
Preparation 88
Preparation of (3,4-Dimethyl-benzyl)methylamine
[0845] According to the procedure of Preparation 67, except
substituting 3,4-dimethyl-benzaldehyde for
1-propyl-naphthalene-2-carbaldehyde, the title compound (1.96 g,
89%) was prepared as a yellow oil: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 6.92-6.80 (m, 3H), 3.71 (s, 6H), 3.55 (s,
2H), 2.23 (s, 3H), 1.94 (br s, 1H).
Preparation 89
Preparation of (2,4,5-Trimethyl-benzyl)methylamine
[0846] According to the procedure of Preparation 67, except
substituting 2,4,5-trimethyl-benzaldehyde for
1-propyl-naphthalene-2-carbaldehyde, the title compound (1.48 g,
67%) was prepared as a yellow oil: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 7.00 (s, 1H), 6.87 (s, 1H), 3.51 (s, 2H),
2.27 (s, 3H), 2.19 (s, 3H), 2.14 (s, 6H), 1.76 (br s, 1H).
Preparation 90
Preparation of Methyl-quinolin-3-yl-methylamine
[0847] According to the procedure of Preparation 67, except
substituting quinoline-3-carbaldehyde for
1-propyl-naphthalene-2-carbaldehyde, the title compound (1.73 g,
73%) was prepared as a yellow oil: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 9.29 (s, 1H), 8.60-8.58 (s, 2H), 8.09-8.04
(m, 2H), 7.85-7.79 (m, 1H), 7.69-7.64 (m, 1H), 3.52 (s, 3H), 3.33
(s, 2H).
Preparation 91
Preparation of (3,4-Dimethoxy-benzyl)methylamine
[0848] According to the procedure of Preparation 67, except
substituting 3,4-dimethoxy-benzaldehyde for
1-propyl-naphthalene-2-carbaldehyde, the title compound (2.10 g,
96%) was prepared as a light yellow oil: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 6.92-6.80 (m, 3H), 3.72 (d, J=4.5 Hz, 6H),
3.54 (s, 2H), 2.71 (br s, 1H), 2.23 (s, 3H).
Preparation 92
Preparation of
(3,4-Dimethyl-thieno[2,3-b]thiophen-2-ylmethyl)methylamine
[0849] According to the procedure of Preparation 67, except
substituting 3,4-dimethyl-thieno[2,3-b]thiophene-2-carbaldehyde for
1-propyl-naphthalene-2-carbaldehyde, the title compound (3.13 g,
97%) was prepared as a yellow oil: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 7.07 (s, 1H), 3.78 (s, 2H), 2.42 (s, 3H),
2.35 (s, 3H), 2.30 (s, 3H), 2.19 (br s, 1H).
Preparation 93
Preparation of Benzofuran-2ylmethyl-methylamine
[0850] According to the procedure of Preparation 67, except
substituting benzofuran-2-carbaldehyde for
1-propyl-naphthalene-2-carbaldehyde, the title compound (4.98 g,
92%) was prepared as an orange oil: NMR (300 MHz, DMSO-d.sub.6)
.delta. 7.58-7.49 (m, 2H), 7.24-7.19 (m, 2H), 6.70 (s, 1H), 3.77
(s, 2H), 2.17 (s, 3H).
Preparation 94
Preparation of Methyl-(2-methyl-naphthalen-1-ylmethyl)amine
[0851] According to the procedure of Preparation 67, except
substituting 2-methyl-naphthalene-1-carbaldehyde for
1-propyl-naphthalene-2-carbaldehyde, the title compound (1.72 g,
79%) was prepared as a yellow oil: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 8.14 (d, J=8.4 Hz, 1H), 7.83 (d, J=8.3 Hz,
1H), 7.72 (d, J=8.1 Hz, 1H), 7.50-7.39 (m, 2H), 7.33 (d, J=8.3 Hz,
1H), 4.02 (s, 2H), 2.51 (s, 3H), 2.41 (s, 3H), 1.74 (br s, 1H).
Preparation 95
Preparation of Biphenyl-3-ylmethyl-methylamine
[0852] According to the procedure of Preparation 67, except
substituting biphenyl-3-carbaldehyde for
1-propyl-naphthalene-2-carbaldehyde, the title compound (0.78 g,
76%) was prepared as a white solid: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 7.66-7.52 (m, 2H), 7.48-7.28 (m, 7H), 3.69
(s, 2H), 2.28 (s, 3H), 2.15 (br s, 1H).
Preparation 96
Preparation of (2-Ethoxy-naphthalen-1-ylmethyl)methylamine
[0853] According to the procedure of Preparation 67, except
substituting 2-ethoxy-naphthalene-1-carbaldehyde for
1-propyl-naphthalene-2-carbaldehyde, the title compound (2.02 g,
94%) was prepared as a yellow-orange oil: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 8.08 (d, J=8.4 Hz, 1H), 7.85-7.82 (d, J=8.8
Hz, 2H), 7.74-7.33 (m, 3H), 4.18 (q, J=6.9 Hz, 2H), 4.06 (s, 2H),
2.31 (s, 3H), 1.62 (br s, 1H), 1.37 (t, J=6.9 Hz, 3H).
Preparation 97
Preparation of (2,3,4-Trimethoxy-benzyl)methylamine
[0854] According to the procedure of Preparation 67, except
substituting 2,3,4-trimethoxy-benzaldehyde for
1-propyl-naphthalene-2-carbaldehyde, the title compound (2.17 g,
quantitative) was prepared as light yellow oil: .sup.1H NMR (300
MHz, DMSO-d.sub.6) .delta. 7.99 (d, J=8.5 Hz 1H), 6.74 (d, J=8.5
Hz, 1H), 3.76 (s, 6H), 3.72 (s, 3H), 2.53 (s, 2H), 2.25 (s, 3H),
1.92 (br s, 1H).
Preparation 98
Preparation of
(2,3-Dihydro-benzo[1,4]dioxin-6-ylmethyl)methylamine
[0855] According to the procedure of Preparation 67, except
substituting 2,3-dihydro-benzo[1,4]dioxine-6-carbaldehyde for
1-propyl-naphthalene-2-carbaldehyde, the title compound (1.28 g,
59%) was prepared as a pale yellow oil: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 6.78-6.73 (m, 3H), 4.20 (s, 4H), 3.48 (s,
2H), 2.20 (s, 3H), 1.96 (br s, 1H).
Preparation 99
Preparation of
(2,3-Dihydro-benzo[1,4]dioxin-5-ylmethyl)methylamine
[0856] According to the procedure of Preparation 67, except
substituting 2,3-dihydro-benzo[1,4]dioxine-5-carbaldehyde for
1-propyl-naphthalene-2-carbaldehyde. The title compound (1.97 g,
91%) was prepared as a yellow oil: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 6.85-6.82 (m, 1H), 6.77-6.70 (m, 2H),
4.25-4.20 (m, 4H), 3.56 (s, 2H), 2.25 (s, 3H), 1.76 (br s, 1H).
Preparation 100
Preparation (4,5-Dimethyl-naphthalen-1-ylmethyl)methylamine
[0857] According to the procedure of Preparation 67, except
substituting 4,5-dimethyl-naphthalene-1-carbaldehyde for
1-propyl-naphthalene-2-carbaldehyde, the title compound (0.88 g,
88%) was prepared as an off-white solid: .sup.1H NMR (500 MHz,
DMSO-d.sub.6) .delta. 8.00 (d, J=8 Hz, 1H), 7.33-7.28 (m, 3H), 7.21
(s, 1H), 3.98 (s, 2H), 2.87 (two s, 6H), 2.33 (s, 3H), 1.96 (br s,
1H).
Preparation 101
Preparation of (2,3-Diethoxy-benzyl)methylamine
[0858] According to the procedure of Preparation 67, except
substituting 2,3-diethoxy-benzaldehyde for
1-propyl-naphthalene-2-carbaldehyde, the title compound (1.81 g,
84%) was prepared as a yellow oil: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 6.96-6.83 (m, 3H), 4.01 (q, J=6.9 Hz, 2H),
3.95 (q, J=6.9 Hz, 2H), 3.61 (s, 2H), 2.25 (s, 3H), 1.81 (br s,
1H), 1.33 (t, J=6.9 Hz, 3H), 1.27 (t, J=6.9 Hz, 3H).
Preparation 102
Preparation of (3-Ethoxy-2-methoxy-benzyl)methylamine
[0859] According to the procedure of Preparation 67, except
substituting 3-ethoxy-2-methoxy-benzaldehyde for
1-propyl-naphthalene-2-carbaldehyde, the title compound (1.60 g,
74%) was prepared as a yellow oil: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 6.95-6.88 (m, 3H), 4.04 (q, J=6.9 Hz, 2H),
3.72 (s, 3H), 3.60 (s, 2H), 2.25 (s, 3H), 1.80 (br s, 1H), 1.34 (t,
J=6.9 Hz, 3H).
Preparation 103
Preparation of Methyl-(3-methyl-benzofuran-2-ylmethyl)amine
[0860] According to the procedure of Preparation 67, except
substituting 3-methyl-benzofuran-2-carbaldehyde for
1-propyl-naphthalene-2-carbaldehyde, the title compound (2.05 g,
quantitative) was prepared as a yellow oil: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 7.52 (dd, J=6.7, 2.1 Hz, 1H), 7.46 (dd,
J=6.5, 2.0 Hz, 1H), 7.25-7.21 (m, 2H), 3.74 (s, 2H), 2.25 (s, 3H),
2.19 (s, 3H), 2.07 (br s, 1H).
Preparation 104
Preparation of (3-Chloro-2-methoxy-benzyl)methylamine
[0861] According to the procedure of Preparation 67, except
substituting 3-chloro-2-methoxy-benzaldehyde for
1-propyl-naphthalene-2-carbaldehyde, the title compound (1.15 g,
55%) was prepared as a yellow oil: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 7.37-7.33 (m, 2H), 7.11 (t, J=7.5 Hz, 1H),
3.77 (s, 3H), 3.68 (s, 2H), 2.27 (s, 3H), 2.01 (br s, 1H).
Preparation 105
Preparation of (3-Choro-2-ethoxy-benzyl)methylamine
a) 3-Chloro-2-ethoxy-benzaldehyde
[0862] Iodoethane (1.54 mL, 19.2 mmol) was added to a stirring
solution of 3-chloro-2-hydroxy-benzaldehyde (2.01 g, 12.8 mmol) and
K.sub.2CO.sub.3 (3.90 g, 28.2 mmol) in DMF (25 mL). The mixture was
heated to 50.degree. C. and stirred for 2.5 h. The heat was removed
and reaction stirred at room temperature for 18 h. The reaction was
quenched with H.sub.2O (70 mL). The mixture was extracted with
EtOAc (3.times.50 mL). The combined organics were washed with brine
(2.times.50 mL), dried over Na.sub.2SO.sub.4, filtered and
concentrated to yield the title compound (2.16 g, 91%) as a yellow
oil: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.27 (s, 1H),
7.85 (dd, J=7.8, 1.5 Hz, 1H), 7.72 (dd, J=7.8, 1.8 Hz, 1H), 7.33
(t, J=7.8 Hz, 1H), 4.14 (q, J=7.2 Hz, 2H), 1.39 (t, J=6.9 Hz,
3H).
b) (3-Chloro-2-ethoxy-benzyl)methylamine
[0863] According to the procedure of Preparation 67, except
substituting 3-chloro-2-ethoxy-benzaldehyde for
1-propyl-naphthalene-2-carbaldehyde, the title compound (1.36 g,
58%) was prepared as a yellow oil: .sup.1H NMR (500 MHz,
DMSO-d.sub.6) .delta. 7.36-7.33 (m, 2H), 7.14-7.08 (m, 1H), 3.93
(q, J=7.0 Hz, 2H), 3.67 (s, 2H), 2.24 (s, 3H), 2.07 (br s, 1H),
1.32 (t, J=6.9 Hz, 3H).
Preparation 106
Preparation of Methyl-thieno[3,2-c]pyridin-2-ylmethyl-amine
a) Thieno[3,2-c]pyridine-2-carbaldehyde
[0864] A solution of thieno[3,2-c]pyridine (500 mg, 3.70 mmol) in
anhydrous THF (10 mL) was stirred under argon and maintained at
-78.degree. C. while a solution of 1.6 M n-butyllithium in hexane
(2.5 mL, 4.07 mmol) was added dropwise. The resulting wine red
solution was stirred for 5 min. then DMF (573 pit, 7.4 mmol) was
added. The cooling bath was removed and the reaction mixture was
stirred at room temperature for 16 hr. The reaction mixture was
treated with 10% aqueous HCl, made alkaline with saturated aqueous
NaHCO.sub.3 and extracted with CH.sub.2Cl.sub.2 (2.times.50 mL) The
combined organic fractions were concentrated in vacuo to give an
oily residue which was subjected to flash chromatography on silica
gel (70% ethyl acetate:hexanes) to give the title compound as a
white solid (41.5%): .sup.1H-NMR (300 MHz, DMSO-d.sub.6) .delta.
10.20 (s, 1H), 9.39 (s, 1H), 8.60 (s, 1H), 8.59 (d, J=5.5 Hz, 1H),
8.19 (d, J=5.6 Hz, 1H); MS (ES) m/e 164 (M+H).sup.+.
b) Methylthieno[3,2-c]pyridine-2-methylamine
[0865] A solution of thieno[3,2-c]pyridine-2-carbaldehyde (720 mg,
4.41 mmol) in a 2.0 M solution of methylamine in methanol (25 mL)
was stirred at room temperature for 5 hours. After this time, the
mixture was concentrated to dryness, dissolved in anhydrous
methanol (10 mL) then cooled to 0.degree. C. To this solution was
added NaBH.sub.4 (167 mg, 4.41 mmol) in one portion. The mixture
was allowed to warm to room temperature and stirred at this
temperature overnight. The mixture was concentrated, dissolved in
CH.sub.2Cl.sub.2 (100 mL) and treated with 1.0 N NaOH (20 mL). The
aqueous layer was extracted with CH.sub.2Cl.sub.2 (2.times.20 mL).
The combined organic fractions were washed with brine, dried over
Na.sub.2SO.sub.4 then concentrated to give a yellow residue which
was subjected to flash chromatography on silica gel (10% 2M
NH.sub.3 in MeOH:CH.sub.2Cl.sub.2). The title compound was obtained
as a white solid in 63.6% yield: .sup.1H-NMR (300 MHz, CDCl.sub.3)
.delta. 9.01 (s, 1H), 8.45 (d, J=5.5 Hz, 1H), 7.76 (d, J=5.5 Hz,
1H), 7.29 (s, 1H), 4.10 (s, 2H), 2.54 (s, 3H); MS (ES) m/e 179
(M+H).sup.+.
Preparation 107
Preparation of (1H-Indol-5-ylmethyl)methylamine
[0866] Indole-5-carbaldehyde (1.0 g, 6.9 mmol) was dissolved in
anhydrous methanol (15 mL). Methylamine (9.9 mL of 2M solution in
methanol, 19.8 mmol) was added and the reaction was stirred for 3
hr. The solution was concentrated to a yellow oil and then
dissolved into anhydrous methanol (20 mL). Sodium borohydride (262
mg, 6.9 mmol) was added and the mixture was stirred overnight.
Water (1 mL) was added and the solution was concentrated. Sodium
hydroxide (5 mL, 1N) was added and the product was extracted with
ethyl acetate (3.times.20 mL), dried over MgSO.sub.4 and
concentrated to afford the title compound as a brown oil (980 mg,
91%). .sup.1H NMR (200 MHz, CDCl.sub.3) .delta. 8.60 (s, 1H), 7.56
(s, 1H), 7.35-7.15 (m, 3H), 6.55 (m, 1H), 3.85 (s, 2H), 2.49 (s,
3H).
Preparation 108
Preparation of Methyl-(1-methylindol-5-ylmethyl)amine
a) 1-Methylindole-5-carbaldehyde
[0867] To a solution of indole-5-carbaldehyde (1.0 g, 6.9 mmol) in
DMF (15 mL) was added sodium hydride (303 mg of 60% dispersion in
oil, 7.59 mmol) in 3 portions. The mixture was stirred for 30 mins.
Methyl iodide (1.96 g, 13.8 mmol) was then added and the mixture
was stirred overnight. Ethyl acetate (200 mL) was added and
solution was washed with H.sub.2O (3.times.20 mL) and brine (25 mL)
dried over MgSO.sub.4 and concentrated to afford
N-methylindole-5-carboxaldehyde as an orange oil (1.0 g, 91%).
.sup.1H NMR (200 MHz, CDCl.sub.3) .delta. 10.05 (s, 1H), 8.09 (s,
1H), 7.90-7.80 (m, 1H), 7.35-7.15 (m, 2H), 6.85-6.80 (m, 1H), 3.95
(s, 3H).
b) Methyl-(1-methylindol-5-ylmethyl)amine
[0868] N-Methylindole-5-carbaldehyde (800 mg, 5.1 mmol) was
dissolved in anhydrous methanol (15 mL). Methylamine (7.15 mL of 2M
solution in methanol, 15.3 mmol) was added and the reaction was
stirred for 3 hr. The solution was concentrated to a yellow oil and
then dissolved into anhydrous methanol (15 mL). Sodium borohydride
(194 mg, 5.1 mmol) was added and the mixture was stirred overnight.
Water (1 mL) was added and the solution was concentrated to an
orange oil. Sodium hydroxide (5 mL, 1N) was added and the product
was extracted with ethyl acetate (3.times.20 mL), dried over
MgSO.sub.4 and concentrated to afford the title compound as an
orange oil (885 mg, 100%). .sup.1H NMR (200 MHz, CDCl.sub.3)
.delta. 7.57 (s, 1H), 7.35-7.11 (m, 3H), 6.51 (d, J=2.9 Hz, 1H),
3.85 (s, 2H), 3.79 (s, 3H), 2.48 (s, 3H).
Preparation 109
Preparation of (1H-Indol-7-ylmethyl)methylamine
[0869] Indole-7-carbaldehyde (500 mg, 3.4 mmol) was dissolved in
anhydrous methanol (10 mL). Methylamine (5.1 mL of 2M solution in
methanol, 9.55 mmol) was added and the reaction was stirred for 3
hr. The solution was concentrated to a yellow oil and then
dissolved into anhydrous methanol (10 mL). Sodium borohydride (131
mg, 3.45 mmol) was added and the mixture was stirred overnight.
Water (1 mL) was added and the solution was concentrated. Sodium
hydroxide (5 mL, 1N) was added and the indole was extracted with
ethyl acetate (3.times.20 mL), dried over MgSO.sub.4 and
concentrated to afford the title compound as a yellow oil (484 mg,
92%). .sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 7.54 (s, 1H),
7.29-7.17 (m, 2H), 7.04 (d, J=3.1 Hz, 1H), 6.44 (d, J=3.1 Hz, 1H),
3.84 (s, 2H), 2.46 (s, 3H).
Preparation 110
Preparation of Methyl-(1-methylindol-7-ylmethyl)amine
[0870] To a solution of indole-7-carboxaldehyde (500 mg, 3.45 mmol)
in DMF (8 mL) was added sodium hydride (152 mg of 60% dispersion in
oil, 3.8 mmol). The mixture was stirred for 30 mins. Methyl iodide
(0.98 g, 6.9 mmol) was then added and the mixture was stirred for 2
hrs. Ethyl acetate (200 mL) was added and solution was washed with
H.sub.2O (3.times.20 mL) and brine (25 mL) dried over MgSO.sub.4
and concentrated to afford N-methylindole-7-carboxaldehyde as a
brown oil which was used without further purification.
[0871] The crude oil was dissolved in anhydrous methanol (10 mL).
Methylamine (5.1 mL of 2M solution in methanol, 9.55 mmol) was
added and the mixture was stirred for 3 hours. The solution was
concentrated to a yellow oil and then dissolved into anhydrous
methanol (10 mL). Sodium borohydride (131 mg, 3.45 mmol) was added
and the mixture was stirred overnight. Water (1 mL) was added and
the solution was concentrated to an orange oil. Sodium hydroxide (5
mL, 1N) was added and the product was extracted with ethyl acetate
(3.times.20 mL), dried over MgSO.sub.4 and concentrated to afford
the title compound as a brown oil (400 mg, 68%). .sup.1H NMR (200
MHz, CDCl.sub.3) .delta. 7.52 (dd, J=7.0, 2.0 Hz, 1H), 7.23-6.94
(m, 3H), 6.44 (d, J=3.1 Hz, 1H), 4.10 (s, 3H), 4.04 (s, 2H), 2.51
(s, 3H).
Preparation 111
Preparation of (1H-Indol-6-ylmethyl)methylamine
a) (1H-Indol-6-yl)methanol
[0872] Indole-6-carboxylic acid (1.0 g, 6.2 mmol) was dissolved
into anhydrous THF (20 mL) under argon. Lithium aluminum hydride
(494 mg, 13 mmol) was added portionwise and the mixture was stirred
overnight. The mixture was cooled to 0.degree. C. and ethyl acetate
(10 mL) was carefully added, followed by methanol (5 mL) and water
(5 mL). The mixture was stirred for 30 min. and filtered through
celite. The solution was concentrated and dissolved into ethyl
acetate (200 mL) and washed with brine (2.times.20 mL), dried over
MgSO.sub.4 and concentrated to afford the title compound as a brown
oil (880 mg, 96%). .sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 8.30
(s, 1H), 7.58 (d, J=8.1 Hz, 1H), 7.23 (d, J=1.1 Hz, 1H), 7.13-7.05
(m, 2H), 6.51-6.49 (m, 1H), 4.70 (s, 2H).
b) 1H-Indole-6-carbaldehyde
[0873] Dess-Martin periodinane (1.53 g, 2.6 mmol) was dissolved
into methylene chloride (15 mL). Indol-6-yl-methanol (500 mg, 3.4
mmol) in methylene chloride (12 mL) was added and the mixture was
stirred for 1 hr. Sodium hydroxide (5 mL of 1 N solution) was added
and the reaction was stirred for 15 min. The organic layer was
separated and washed with H.sub.2O (5 mL), brine (5 mL), dried over
MgSO.sub.4 and concentrated to afford the title compound as a brown
solid (275 mg, 56%). .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
11.7 (s, 1H), 9.98 (s, 1H), 7.97 (s, 1H), 7.70-7.65 (m, 2H), 7.52
(dd, J=8.2, 1.4 Hz, 1H), 6.57-6.5 (m, 1H).
c) (1H-Indol-6-ylmethyl)methylamine
[0874] Indole-6-carboxaldehyde (90 mg, 0.62 mmol) was dissolved in
anhydrous methanol (3 mL). Methylamine (0.95 mL of 2M solution in
methanol, 1.86 mmol) was added and the reaction was stirred for 3
hr. The solution was concentrated to a yellow oil and then
dissolved into anhydrous methanol (3 mL). Sodium borohydride (24
mg, 0.62 mmol) was added and the mixture was stirred overnight.
Water (1 mL) was added and the solution was concentrated. Sodium
hydroxide (2 mL, 1N) was added and the indole was extracted with
ethyl acetate (3.times.10 mL), dried over MgSO.sub.4 and
concentrated to afford the title compound as a yellow oil (98 mg,
100%). .sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 9.02 (s, 1H), 7.57
(d, J=8.1 Hz, 1H), 7.29 (s, 1H), 7.12 (d, J=3.1 Hz, 1H), 7.04 (d,
J=8.1 Hz, 1H), 6.49 (d, J=2.7 Hz, 1H), 3.81 (s, 2H), 2.50 (s,
3H).
Preparation 112
Preparation of
N-Methyl-N-(1-methyl-1H-indol-3-ylmethyl)acrylamide
[0875] According to the procedure of Example 1(a), except
substituting acrylic acid for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, and substituting
methyl-(1-methyl-1H-indol-3-ylmethyl)amine for the
methyl-(1-propyl-napthalen-2-ylmethyl)amine, the title compound
(1.51 g, 58%) was prepared as a white solid: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 7.71-7.50 (s, 1H), 7.34-7.21 (m, 2H),
7.15-6.90 (m, 2H), 6.80-6.53 (m, 1H), 6.45-6.35 (s, 1H), 5.72-5.67
(m, 1H), 4.80-4.75 (m, 2H), 3.77 (s, 3H), 3.05-2.99 (m, 3H).
Preparation 113
Preparation of
N-methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)acrylamide
[0876] A solution of
methyl-(3-methyl-benzo[b]thiophen-2-ylmethyl)amine (1.95 g, 11.4
mmol) in CH.sub.2Cl.sub.2 (40 mL) was treated with acryloyl
chloride (1.2 mL, 14 mmol) and triethylamine (3.2 mL, 22 mmol). The
mixture was stirred at room temperature for 1 h. The reaction
mixture was diluted with CH.sub.2Cl.sub.2 (100 mL). The solution
was washed with water and brine, dried over Na.sub.2SO.sub.4,
filtered and concentrated under reduced pressure. Purification by
column chromatography (silica gel, EtOAc/hexanes, 40/60) gave the
title compound (2.10 g, 75%) as a pale yellow solid: MS (ESI) m/e
246 (M+H).sup.+.
Preparation 114
Preparation of
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid
a) [2-Amino-5-bromo-pyridin-3-ylmethyl)methylamino]acetic acid
ethyl ester
[0877] A solution of 5-bromo-3-bromomethyl-pyridin-2-ylamine
hydrobromide (1.98 g, 5.71 mmol) and sarcosine ethyl ester
hydrochloride (0.90 g, 5.86 mmol) in DMF (60 mL) was treated with
triethylamine (2.6 mL, 18.5 mmol). After stirring at room
temperature under N.sub.2 for 2 h, the cloudy mixture was diluted
with H.sub.2O (100 mL) and extracted with EtOAc (3.times.100 mL).
The combined organic layers were washed with H.sub.2O (3.times.50
mL) and brine (50 mL), dried over Na.sub.2SO.sub.4, filtered, and
the solvent was removed in vacuo. Purification by flash column
chromatography (silica gel, CH.sub.2Cl.sub.2/MeOH, 98:2) gave the
title compound (1.37 g, 79%) as a white solid: .sup.1H NMR (300
MHz, CDCl.sub.3) .delta. 8.03 (d, J=2.3 Hz, 1H), 7.32 (d, J=2.3 Hz,
1H), 5.76 (s, 2H), 4.20 (q, J=7.1 Hz, 2H), 3.47 (s, 2H), 3.24 (s,
2H), 2.28 (s, 3H), 1.29 (t, J=7.1 Hz, 3H); MS (ESI) m/e 302
(M+H).sup.+.
b)
7-Bromo-4-methyl-1,3,4,5-tetrahydro-pyrido[2,3-e][1,4]diazepin-2-one
[0878] A solution of
[2-amino-5-bromo-pyridin-3-ylmethyl)methylamino]acetic acid ethyl
ester (1.37 g, 4.53 mmol) in DMSO (50 mL) was treated with NaH
(0.18 g, 4.5 mmol). After stirring at room temperature under
N.sub.2 for 2 h, the mixture was stored in the freezer overnight.
The mixture was allowed to warm to room temperature, diluted with
H.sub.2O (200 mL), and extracted with EtOAc (3.times.150 mL). The
combined organic layers were washed with H.sub.2O (2.times.50 mL)
and brine (50 mL), dried over Na.sub.2SO.sub.4, filtered, and the
solvent was removed in vacuo. Purification by flash column
chromatography (silica gel, CH.sub.2Cl.sub.2,/MeOH, 98:2) gave the
title compound (0.88 g, 76%) as a white solid: .sup.1H NMR (300
MHz, CDCl.sub.3) .delta. 8.57 (s, 1H), 8.35 (d, J=2.2 Hz, 1H), 7.61
(d, J=2.1 Hz, 1H), 3.91 (s, 2H), 3.74 (s, 2H), 2.49 (s, 3H); MS
(ESI) m/e 256 (M+H).sup.+.
c)
(E)-3-(4-Methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin--
7-yl)acrylic acid tert-butyl ester
[0879] A suspension of
7-bromo-4-methyl-1,3,4,5-tetrahydro-pyrido[2,3-e][1,4]diazepin-2-one
(0.63 g, 2.5 mmol) in propionitrile (10 mL) and DMF (3 mL) was
de-oxygenated with Ar for 25 min. The mixture was treated with
tert-butyl acrylate (1.5 mL, 10 mmol) and (i-Pr).sub.2EtN (0.9 mL,
5 mmol) and was de-oxygenated with Ar for 10 min. Pd(OAc).sub.2 (56
mg, 0.25 mmol) and P(o-tol).sub.3 (150 mg, 0.49 mmol) were added
simultaneously, and the mixture was de-oxygenated a third time for
5 min. The mixture was heated to reflux for 18 h, then allowed to
cool. The resulting precipitate was isolated by filtration,
dissolved in CH.sub.2Cl.sub.2, filtered through Celite, and the
solvent was removed in vacuo to give the title compound (0.60 g,
80%) as an off-white solid: .sup.1H NMR (300 MHz, CDCl.sub.3)
.delta. 8.63 (s, 1H), 8.41 (d, J=2.0 Hz, 1H), 7.62 (d, J=1.7 Hz,
1H), 7.52 (d, J=16.0 Hz, 1H), 6.37 (d, J=16.0 Hz, 1H), 3.96 (s,
2H), 3.77 (s, 2H), 2.49 (s, 3H), 1.53 (s, 9H); MS (ESI) m/e 304
(M+H).sup.+.
d)
(E)-3-(4-Methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin--
7-yl)acrylic acid
[0880] A suspension of
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid tert-butyl ester (0.59 g, 1.9 mmol) in
CH.sub.2Cl.sub.2 (7 mL) was treated with TFA (7 mL). After stirring
at room temperature under N.sub.2 for 45 min, the clear tan
solution was concentrated in vacuo. The resulting oil was treated
with anhydrous HCl in dioxane (10 mL, 4.0 M) and sonicated until
the oil was converted to a fine off-white solid. After stirring
under N.sub.2 for 20 min, the solid was isolated by filtration,
washed with Et.sub.2O, and dried under vacuum for several hours to
give the title compound (0.77 g, quantitative) as an off-white
solid: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 12.27 (bs, 1H),
11.28 (s, 1H), 8.78 (d, J=1.9 Hz, 1H), 8.32 (d, J=1.9 Hz, 1H), 7.65
(d, J=16.1 Hz, 1H), 6.63 (d, J=16.1 Hz, 1H), 4.32 (s, 2H), 3.82 (s,
2H), 2.89 (s, 3H); MS (ESI) ink 248 (M+H).sup.+.
Preparation 115
Preparation of
(E)-3-(4-Ethoxycarbonylmethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1-
,4]diazepin-7-yl)acrylic acid hydrochloride
a)
[(2-Amino-5-bromo-pyridin-3-ylmethyl)ethoxycarbonylmethyl-amino]acetic
acid ethyl ester
[0881] A suspension of 5-bromo-3-bromomethyl-pyridin-2-ylamine
hydrobromide (12.0 g, 34.6 mmol) and diethyl iminodiacetate (7.0
mL, 39.1 mmol) in CH.sub.3CN (350 mL) was treated with
triethylamine (10.7 mL, 76.1 mmol). After stirring at room
temperature under N.sub.2 for 4 h, the solvent was removed in
vacuo. The resulting yellow slurry was partitioned between H.sub.2O
(400 mL) and EtOAc (400 mL), and the aqueous layer was extracted
with EtOAc (200 mL). The combined organic layers were washed with
brine (100 mL), dried over Na.sub.2SO.sub.4, filtered and the
solvent was removed in vacuo. Purification by flash column
chromatography (silica gel, CH.sub.2Cl.sub.2/MeOH, 99:1) gave the
title compound (6.55 g, 51%) as a light tan oil: MS (ESI) m/e 374
(M+H).sup.+.
b)
(7-Bromo-2-oxo-1,2,3,5-tetrahydro-pyrido[2,3-e][1,4]diazepin-4-yl)aceti-
c acid ethyl ester
[0882] A solution of
[(2-amino-5-bromo-pyridin-3-ylmethyl)ethoxycarbonylmethyl-amino]-acetic
acid ethyl ester (6.52 g, 17.4 mmol) in DMSO (170 mL) was treated
with NaH (0.70 g, 17.5 mmol). After stirring at room temperature
overnight, the mixture was diluted with H.sub.2O (300 mL) and
extracted with EtOAc (4.times.200 mL). The combined organic layers
were washed with H.sub.2O (3.times.100 mL) and brine (100 mL),
dried over Na.sub.2SO.sub.4, filtered and the solvent was removed
in vacuo to give the title compound (6.18 g, quantitative) as an
off-white solid: MS (ESI) m/e 328 (M+H).sup.+.
c)
(E)-3-(4-Ethoxycarbonylmethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e]-
[1,4]diazepin-7-yl)acrylic acid tert-butyl ester
[0883] A suspension of
(7-Bromo-2-oxo-1,2,3,5-tetrahydro-pyrido[2,3-e][1,4]diazepin-4-yl)acetic
acid ethyl ester (6.18 g, 17.4 mmol) in propionitrile (70 mL) and
DMF (17 mL) was de-oxygenated with Ar for 30 min. The mixture was
treated with tert-butyl acrylate (10.2 mL, 69.6 mmol) and
(i-Pr).sub.2EtN (6.4 mL, 37 mmol) and was then de-oxygenated with
Ar for 10 min. Pd(OAc).sub.2 (0.39 g, 1.7 mmol) and P(o-tol).sub.3
(1.06 mg, 3.48 mmol) were added simultaneously, and the mixture was
de-oxygenated a third time for 5 min. After heating to reflux for
14 h, the mixture was allowed to cool and then concentrated in
vacuo. The resulting residue was diluted with CH.sub.2Cl.sub.2 and
filtered through Celite. The orange filtrate was concentrated in
vacuo. The resulting residue was diluted with EtOAc (200 mL) and
washed with H.sub.2O (100 mL). The aqueous layer was extracted with
EtOAc (2.times.100 mL). The combined organic layers were washed
with H.sub.2O (2.times.100 mL) and brine (100 mL), dried over
Na.sub.2SO.sub.4, filtered and the solvent was removed in vacuo.
Purification by flash column chromatography (silica gel,
CH.sub.2Cl.sub.2/MeOH, 97:3) and again by flash column
chromatography (silica gel, CH.sub.2Cl.sub.2/MeOH, 99:1) gave the
title compound (2.55 g, 39%) as an off-white solid: MS (ESI) m/e
376 (M+H).sup.+.
d)
(E)-3-(4-Ethoxycarbonylmethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e]-
[1,4]diazepin-7-yl)acrylic acid hydrochloride
[0884] A solution of
(E)-3-(4-ethoxycarbonylmethyl-2-oxo-2,3,4,5-tetrahydro-1H-Pyrido[2,3-e][1-
,4]diazepin-7-yl)acrylic acid tert-butyl ester (1.14 g, 3.04 mmol)
in CH.sub.2Cl.sub.2 (8 mL) was treated with TFA (8 mL). After
stirring at room temperature under N.sub.2 for 45 min, the clear
tan solution was concentrated in vacuo. The resulting oil was
treated with anhydrous HCl in dioxane (10 mL, 4.0 M) and sonicated
until the oil was converted to a fine off-white solid. The
resulting mixture was diluted with Et.sub.2O (100 mL) and stirred
under N.sub.2 for 20 min. The solid was isolated by filtration,
washed with Et.sub.2O, and dried under vacuum at 50.degree. C.
overnight to give the title compound (1.05 g, 88%) as an off-white
solid: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.57 (s, 1H),
8.56-8.55 (m, 1H), 8.10 (s, 1H), 6.57 (d, J=16.0 Hz, 1H), 6.57 (d,
J=16.0 Hz, 1H), 4.14-4.05 (m, 3H), 3.62-3.56 (m, 6H), 1.18 (t,
J=7.1 Hz, 3H); MS (ESI) m/e 320 (M+H).sup.+.
Preparation 116
Preparation of
(R)-(E)-3-(10-oxo-2,3,4,9,10,10a-hexahydro-1H-3a,8,9-triaza-benzo[f]azule-
n-6-yl)acrylic acid hydrochloride
a)
(R)-1-(2-Amino-5-bromo-pyridin-3-ylmethyl)pyrrolidine-2-carboxylic
acid methyl ester
[0885] A suspension of 5-bromo-3-bromomethyl-pyridin-2-ylamine
hydrobromide (8.00 g, 23.1 mmol) and D-proline methyl ester
hydrochloride (4.53 g, 27.4 mmol) in CH.sub.3CN (100 mL) was
treated with a solution of triethylamine (10.4 mL, 74.0 mmol) in
CH.sub.3CN (100 mL). After stirring at room temperature for 5 h,
the cloudy mixture was diluted with H.sub.2O (300 mL) and extracted
with EtOAc (3.times.200 mL). The combined organic layers were
washed with brine (100 mL), dried over Na.sub.2SO.sub.4, filtered
and the solvent was removed in vacuo. Purification by flash column
chromatography (silica gel, CH.sub.2Cl.sub.2/MeOH, 99:1 to 98:2)
gave the title compound (6.55 g, 90%) as a colorless oil: MS (ESI)
m/e 314 (M+H).sup.+
b)
(R)-6-Bromo-1,2,3,4,9,10a-hexahydro-3a,8,9-triaza-benzo[f]azulen-10-one
[0886] A solution of
(R)-1-(2-amino-5-bromo-pyridin-3-ylmethyl)pyrrolidine-2-carboxylic
acid methyl ester (6.52 g, 20.8 mmol) in DMSO (200 mL) was treated
with NaH (60% dispersion in mineral oil, 0.83 g, 20.7 mmol). After
stirring at room temperature for 3 h, the mixture was stored in the
freezer for 3 d. The mixture was allowed to warm to room
temperature, diluted with H.sub.2O (400 mL), and extracted with
EtOAc (4.times.200 mL). The combined organic layers were washed
with H.sub.2O (3.times.100 mL) and brine (100 mL), dried over
Na.sub.2SO.sub.4, filtered and the solvent was removed in vacuo.
Purification by flash column chromatography (silica gel,
CH.sub.2Cl.sub.2,/MeOH, 99:1) gave the title compound (3.94 g, 67%)
as an off-white solid: MS (ESI) m/e 282 (M+H).sup.+.
c)
(R)-(E)-3-(10-Oxo-2,3,4,9,10,10a-hexahydro-1H-3a,8,9-triaza-benzo[f]azu-
len-6-yl)acrylic acid tert-butyl ester
[0887] A suspension of
(R)-6-bromo-1,2,3,4,9,10a-hexahydro-3a,8,9-triaza-benzo[f]azulen-10-one
(3.91 g, 13.8 mmol) in propionitrile (80 mL) and DMF (20 mL) was
de-oxygenated with Ar for 25 min. The mixture was treated with
ten-butyl acrylate (8.1 mL, 55 mmol) and (i-Pr).sub.2EtN (5.1 mL,
29 mmol) and was de-oxygenated with Ar for 15 min. Pd(OAc).sub.2
(0.31 g, 1.4 mmol) and P(o-tol).sub.3 (0.84 mg, 2.8 mmol) were
added simultaneously, and the mixture was de-oxygenated a third
time for 10 min. The mixture was heated to reflux overnight then
allowed to cool. The resulting precipitate was isolated by
filtration, dissolved in CH.sub.2Cl.sub.2, filtered through Celite,
and the solvent was removed in vacuo to give the title compound
(2.53 g, 56%) as an off-white solid: MS (ESI) m/e 330
(M+H).sup.+.
[0888] d)
(R)-(E)-3-(10-Oxo-2,3,4,9,10,10a-hexahydro-1H-3a,8,9-triaza-benz-
o[f]azulen-6-yl)acrylic acid hydrochloride
[0889] A solution of
(R)-(E)-3-(10-oxo-2,3,4,9,10,10a-hexahydro-1H-3a,8,9-triaza-benzo[f]azule-
n-6-yl)acrylic acid tert-butyl ester (2.53 g, 7.68 mmol) in
CH.sub.2Cl.sub.2 (15 mL) was treated with TFA (15 mL). After
stirring at room temperature under N.sub.2 for 45 min, the clear
tan solution was concentrated in vacuo. The resulting oil was
treated with anhydrous HCl (30 mL of a 4.0 M solution in dioxane,
120 mmol). The resulting mixture was sonicated for 10 min, stirred
under N.sub.2 for 20 min, diluted with Et.sub.2O (100 mL),
sonicated for 20 min and stirred for 20 min. The solid was isolated
by filtration, washed with Et.sub.2O, and dried under vacuum at
50.degree. C. overnight to give the title compound (2.66 g,
quantitative) as an off-white solid: MS (ESI) m/e 274
(M+H).sup.+.
Preparation 117
Preparation of
(S)-(E)-3-(10-Oxo-2,3,4,9,10,10a-hexahydro-1H-3a,8,9-triaza-benzo[f]azule-
n-6-yl)acrylic acid hydrochloride
a)
(S)-1-(2-Amino-5-bromo-pyridin-3-ylmethyl)pyrrolidine-2-carboxylic
acid methyl ester
[0890] A solution of 5-bromo-3-bromomethyl-pyridin-2-ylamine
hydrobromide (6.00 g, 17.3 mmol) and L-proline methyl ester
hydrochloride (2.88 g, 17.4 mmol) in DMF (125 mL) was treated with
a solution of triethylamine (7.8 mL, 55.5 mmol) in DMF (75 mL).
After stirring at room temperature under N.sub.2 for 3 h, the
cloudy mixture was diluted with H.sub.2O (300 mL) and extracted
with EtOAc (2.times.300 mL). The combined organic layers were
washed with H.sub.2O (2.times.100 mL) and brine (100 mL), dried
over Na.sub.2SO.sub.4, filtered and the solvent was removed in
vacuo. Purification by flash column chromatography (silica gel,
CH.sub.2Cl.sub.2/MeOH, 99:1 to 98:2) gave the title compound (3.66
g, 67%) as a pale yellow oil: MS (ESI) m/e 314 (M+H).sup.+.
b)
(S)-6-Bromo-1,2,3,4,9,10a-hexahydro-3a,8,9-triaza-benzo[f]azulen-10-one
[0891] A solution of
(S)-1-(2-amino-5-bromo-pyridin-3-ylmethyl)pyrrolidine-2-carboxylic
acid methyl ester (3.66 g, 11.6 mmol) in DMSO (120 mL) was treated
with NaH (60% dispersion in mineral oil, 0.47 g, 11.7 mmol). After
stirring at room temperature for 4 h, the mixture was diluted with
H.sub.2O (2500 mL) and extracted with EtOAc (5.times.150 mL). The
combined organic layers were washed with H.sub.2O (4.times.100 mL)
and brine (100 mL), dried over Na.sub.2SO.sub.4, filtered and the
solvent was removed in vacuo. Purification by flash column
chromatography (silica gel, CH.sub.2Cl.sub.2,/MeOH, 99:1) gave the
title compound (2.75 g, 84%) as an off-white solid: MS (ESI) m/e
282 (M+H).sup.+.
c)
(S)-(E)-3-(10-Oxo-2,3,4,9,10,10a-hexahydro-1H-3a,8,9-triaza-benzo[f]azu-
len-6-yl)acrylic acid tert-butyl ester
[0892] A suspension of
(S)-6-bromo-1,2,3,4,9,10a-hexahydro-3a,8,9-triaza-benzo[f]azulen-10-one
(1.46 g, 5.17 mmol) in propionitrile (40 mL) and DMF (10 mL) was
de-oxygenated with Ar for 30 min. The mixture was treated with
tert-butyl acrylate (3.0 mL, 20 mmol) and (i-Pr).sub.2EtN (1.9 mL,
11 mmol) and was de-oxygenated with Ar for 10 min. Pd(OAc).sub.2
(0.12 g, 0.53 mmol) and P(o-tol).sub.3 (0.34 mg, 1.12 mmol) were
added simultaneously, and the mixture was de-oxygenated a third
time for 5 min. The mixture was heated to reflux overnight then
allowed to cool. The resulting precipitate was isolated by
filtration, dissolved in CH.sub.2Cl.sub.2, filtered through Celite
and the solvent was removed in vacuo to give the title compound
(0.68 g, 40%) as an off-white solid: MS (ESI) m/e 330
(M+H).sup.+.
d)
(S)-(E)-3-(10-Oxo-2,3,4,9,10,10a-hexahydro-1H-3a,8,9-triaza-benzo[f]azu-
len-6-yl)acrylic acid hydrochloride
[0893] A solution of
(S)-(E)-3-(10-oxo-2,3,4,9,10,10a-hexahydro-1H-3a,8,9-triaza-benzo[f]azule-
n-6-yl)acrylic acid tert-butyl ester (0.65 g, 1.97 mmol) in
CH.sub.2Cl.sub.2 (7 mL) was treated with TFA (7 mL). After stirring
at room temperature for 30 min, the clear tan solution was
concentrated in vacuo. The resulting oil was treated with anhydrous
dioxane (20 mL of a 4.0 M solution in dioxane, 80 mmol). The
resulting mixture was sonicated for 5 min, stirred under N.sub.2
for 5 min and diluted with Et.sub.2O. The solid was isolated by
filtration, suspended in Et.sub.2O, concentrated to dryness, and
dried under vacuum overnight to give the title compound (0.60 g,
88%) as an off-white solid: MS (ESI) m/e 274 (M+H).sup.+.
Preparation 118
Preparation of
(E)-3-[4-(4-Methoxy-benzyl)-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4-
]diazepin-7-yl]acrylic acid hydrochloride
a) (4-Methoxy-benzylamino)acetic acid ethyl ester
[0894] A suspension of glycine ethyl ester hydrochloride (10.0 g,
71.6 mmol) and NaBH.sub.3CN (5.00 g, 79.6 mmol) in MeOH (60 mL) was
treated dropwise over 15 min with p-anisaldehyde (11.0 mL, 90.4
mmol). After stirring at room temperature overnight, the solvent
was removed in vacuo. The residue was partitioned between
CH.sub.2Cl.sub.2 (200 mL) and saturated aqueous NaHCO.sub.3 (300
mL). The aqueous layer was extracted with CH.sub.2Cl.sub.2
(2.times.200 mL) and the combined organic layers were washed with
brine, dried over Na.sub.2SO.sub.4, filtered and the solvent was
removed in vacuo. Purification by flash column chromatography
(silica gel, hexanes/EtOAc, 90:10 to 50:50) gave the title compound
(7.77 g, 49%) as a colorless liquid: MS (ESI) m/e 224
(M+H).sup.+.
b)
[(2-Amino-5-bromo-pyridin-3-ylmethyl)-(4-methoxy-benzyl)amino]acetic
acid ethyl ester
[0895] A solution of 5-bromo-3-bromomethyl-pyridin-2-ylamine
hydrobromide (11.9 g, 34.3 mmol) and (4-methoxy-benzylamino)acetic
acid ethyl ester (7.70 g, 34.5 mmol) in DMF (200 mL) was treated
with triethylamine (10.0 mL, 71.2 mmol). After stirring at room
temperature overnight, the cloudy mixture was diluted with H.sub.2O
(400 mL) and extracted with EtOAc (2.times.300 mL). The combined
organic layers were washed with H.sub.2O (3.times.100 mL) and brine
(100 mL), dried over Na.sub.2SO.sub.4, filtered and the solvent was
removed in vacuo to give the title compound (13.0 g, 93%) as a
yellow syrup: MS (ESI) m/e 408 (M+H).sup.+.
c)
7-Bromo-4-(4-methoxy-benzyl)-1,3,4,5-tetrahydro-pyrido[2,3-e][1,4]diaze-
pin-2-one
[0896] A solution of
[(2-amino-5-bromo-pyridin-3-ylmethyl)-(4-methoxy-benzyl)amino]acetic
acid ethyl ester (13.0 g, 31.9 mmol) in DMSO (200 mL) was treated
with NaH (60% dispersion in mineral oil, 1.30 g, 32.5 mmol). After
stirring at room temperature overnight, the mixture was diluted
with H.sub.2O (500 mL) and a precipitate formed. The solid was
isolated by filtration, washed with H.sub.2O, and dried under
vacuum at 50.degree. C. for 6.5 h to give the title compound (7.16
g, 62%) as a tan powder: MS (ESI) m/e 362 (M+H).sup.+.
d)
(E)-3-[4-(4-Methoxy-benzyl)-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1-
,4]diazepin-7-yl]acrylic acid tert-butyl ester
[0897] A suspension of
7-bromo-4-(4-methoxy-benzyl)-1,3,4,5-tetrahydro-pyrido[2,3-e][1,4]diazepi-
n-2-one (5.00 g, 13.8 mmol) in propionitrile (80 mL) and DMF (20
mL) was de-oxygenated with Ar for 25 min. The mixture was treated
with tert-butyl acrylate (8.1 mL, 55 mmol) and (i-Pr).sub.2EtN (5.1
mL, 29 mmol) and was de-oxygenated with Ar for 15 min.
Pd(OAc).sub.2 (0.32 g, 1.43 mmol) and P(o-tol).sub.3 (0.85 g, 2.79
mmol) were added simultaneously, and the mixture was de-oxygenated
a third time for 5 min. The mixture was heated to reflux overnight,
then allowed to cool. The resulting precipitate was isolated by
filtration. Purification by flash column chromatography (silica
gel, CH.sub.2Cl.sub.2/MeOH, 99:1) gave the title compound (3.54 g,
63%) as a white solid: MS (ESI) m/e 410 (M+H).sup.+.
e)
(E)-3-[4-(4-Methoxy-benzyl)-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1-
,4]diazepin-7-yl]acrylic acid hydrochloride
[0898] A suspension of
(E)-3-[4-(4-methoxy-benzyl)-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4-
]diazepin-7-yl]acrylic acid tert-butyl ester (3.54 g, 8.65 mmol) in
CH.sub.2Cl.sub.2 (20 mL) was treated with TFA (20 mL). After
stirring at room temperature under N.sub.2 for 25 min, the clear
tan solution was concentrated in vacuo. The resulting residue was
treated with anhydrous HCl (40 mL of a 4.0 M solution in dioxane,
160 mmol) and sonicated for 15 min. The solid was isolated by
filtration, washed with Et.sub.2O and dried under vacuum at
50.degree. C. for 3 d to give the title compound (3.40 g, 92%) as a
white solid: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 12.38 (br
s, 1H), 11.32 (s, 1H), 8.77 (s, 1H), 8.28 (s, 1H), 7.66-7.58 (m,
3H), 7.02 (d, J=8.6 Hz, 2H), 6.63 (d, J=16.1 Hz, 1H), 4.41-4.27 (m,
5H), 3.79 (s, 3H), 3.68 (s, 2H); MS (ESI) m/e 354 (M+H).sup.+.
Preparation 119
Preparation of
(E)-3-[4-(2-Morpholin-4-yl-ethyl)-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3--
e][1,4]diazepin-7-yl]acrylic acid hydrochloride
a) [tert-Butoxycarbonyl-(2-morpholin-4-yl-ethyl)amino]acetic acid
methyl ester
[0899] A solution of N-tert-butoxycarbonyl glycine methyl ester
(9.4 mL, 63.6 mmol) in DMF (250 mL) was cooled in an ice bath and
treated with NaH (60% dispersion in mineral oil, 2.85 g, 71.2
mmol). After stirring at 0.degree. C. under N.sub.2 for 30 min and
then at room temperature for 30 min, the mixture was cooled in an
ice bath and treated with a solution of 4-(2-chloroethyl)morpholine
(10.5 g, 70 mmol) in DMF (50 mL). After stirring at 0.degree. C.
for 30 min, the mixture was stirred at room temperature overnight.
The mixture was diluted with H.sub.2O (600 mL) and then extracted
with EtOAc (5.times.300 mL). The combined organic layers were
washed with H.sub.2O (4.times.100 mL) and brine (100 mL), dried
over Na.sub.2SO.sub.4, filtered and the solvent was removed in
vacuo. Purification by flash column chromatography (silica gel,
CH.sub.2Cl.sub.2/MeOH, 98:2) gave the title compound (0.79 g, 4%)
as a colorless oil: MS (ESI) m/e 303 (M+H).sup.+.
b) (2-Morpholin-4-yl-ethylamino)acetic acid methyl ester
[0900] A solution of
[tert-butoxycarbonyl-(2-morpholin-4-yl-ethyl)amino]acetic acid
methyl ester (0.79 g, 2.61 mmol) in CH.sub.2Cl.sub.2 (10 mL) was
treated with TFA (10 mL). After stirring at room temperature for 1
h, the solution was concentrated in vacuo. The oil was dissolved in
CH.sub.2Cl.sub.2 (50 mL) and the resulting solution was washed with
saturated aqueous NaHCO.sub.3 (50 mL). The aqueous layer was
extracted with CH.sub.2Cl.sub.2 (10.times.50 mL). The combined
organic layers were dried over Na.sub.2SO.sub.4, filtered and the
solvent was removed in vacuo to give the title compound (0.40 g,
76%) as a yellow oil: NMR (300 MHz, CDCl.sub.3) .delta. 3.69-3.74
(m, 7H), 3.45 (s, 2H), 2.69-2.73 (m, 2H), 2.45-2.52 (m, 6H), 1.84
(s, 1H).
c)
[(2-Amino-5-bromo-pyridin-3-ylmethyl)-(2-morpholin-4-yl-ethyl)amino]ace-
tic acid methyl ester
[0901] A solution of (2-Morpholin-4-yl-ethylamino)acetic acid
methyl ester (0.40 g, 2.0 mmol) and triethylamine (1.0 mL, 7.11
mmol) in DMF (20 mL) was treated with
5-bromo-3-bromomethyl-pyridin-2-ylamine hydrobromide (0.70 g, 2.0
mmol). After stirring at room temperature under for 7 h, the cloudy
mixture was diluted with H.sub.2O (50 mL) and then extracted with
EtOAc (4.times.50 mL). The combined organic layers were washed with
H.sub.2O (3.times.50 mL) and brine (50 mL), dried over
Na.sub.2SO.sub.4, filtered and the solvent was removed in vacuo.
Purification by flash column chromatography (silica gel,
CH.sub.2Cl.sub.2/MeOH, 98:2 to 96:4) gave the title compound (0.46
g, 60%) as a colorless oil: MS (ESI) m/e 387 (M+H).sup.+.
d)
7-Bromo-4-(2-morpholin-4-yl-ethyl)-1,3,4,5-tetrahydro-pyrido[2,3-e][1,4-
]diazepin-2-one
[0902] A solution of
[(2-amino-5-bromo-pyridin-3-ylmethyl)-(2-morpholin-4-yl-ethyl)amino]aceti-
c acid methyl ester (0.34 g, 0.88 mmol) in DMSO (10 mL) was treated
with NaH (60% dispersion in mineral oil, 35 mg, 0.88 mmol). After
stirring at room temperature overnight, the mixture was diluted
with H.sub.2O (20 mL), and then extracted with EtOAc (4.times.50
mL). The combined organic layers were washed with H.sub.2O
(3.times.50 mL) and brine (50 mL), dried over Na.sub.2SO.sub.4,
filtered and the solvent was removed in vacuo. The resulting pale
yellow oil was purified by flash column chromatography (silica gel,
CH.sub.2Cl.sub.2,/MeOH, 97:3 to 90:10) to give the title compound
(0.24 g, 57%) as an off-white solid: MS (ESI) m/e 355
(M+H).sup.+.
e)
(E)-3-[4-(2-Morpholin-4-yl-ethyl)-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,-
3-e][1,4]diazepin-7-yl]acrylic acid tert-butyl ester
[0903] A suspension of
7-bromo-4-(2-morpholin-4-yl-ethyl)-1,3,4,5-tetrahydro-pyrido[2,3-e][1,4]d-
iazepin-2-one (0.18 g, 0.52 mmol) in propionitrile (4 mL) and DMF
(1 mL) was de-oxygenated with Ar for 15 min. The mixture was
treated with tert-butyl acrylate (0.3 mL, 2 mmol) and
(i-Pr).sub.2EtN (0.2 mL, 1 mmol) and was de-oxygenated with Ar for
10 min. Pd(OAc).sub.2 (12 mg, 0.053 mmol) and P(o-tol).sub.3 (32
mg, 0.10 mmol) were added simultaneously, and the mixture was
de-oxygenated a third time for 5 min. The mixture was heated to
reflux overnight, then allowed to cool. The mixture was diluted
with Et.sub.2O (50 mL) and the resulting solution washed with
H.sub.2O (20 mL). The organic layer was dried over
Na.sub.2SO.sub.4, filtered and the solvent was removed in vacuo.
Purification by flash column chromatography (silica gel,
CH.sub.2Cl.sub.2/MeOH, 97:3) gave the title compound (92 mg, 44%)
as an off-white solid: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
9.51 (s, 1H), 8.52 (s, 1H), 7.61-7.49 (m, 2H), 6.36 (d, J=16.0 Hz,
1H), 4.07 (s, 2H), 3.90 (s, 2H), 3.70-3.67 (m, 4H), 2.78-2.74 (m,
2H), 2.52-2.49 (m, 6H), 1.53 (s, 9H); MS (ESI) m/e 403
(M+H).sup.+.
f)
(E)-3-[4-(2-Morpholin-4-yl-ethyl)-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,-
3-e][1,4]diazepin-7-yl]acrylic acid hydrochloride
[0904] A solution of
(E)-3-[4-(2-morpholin-4-yl-ethyl)-2-oxo-2,3,4,5-tetrahydro-1H-Pyrido[2,3--
e][1,4]diazepin-7-yl]acrylic acid tert-butyl ester (92 mg, 0.23
mmol) in CH.sub.2Cl.sub.2 (2 mL) was treated with TFA (2 mL). After
stirring at room temperature for 30 min, the clear tan solution was
concentrated in vacuo. The resulting oil was treated with anhydrous
HCl (4 mL of a 4.0 M solution in dioxane, 16 mmol) and then
sonicated for 15 min. The mixture was diluted with Et.sub.2O and
sonicated for 10 min. The solid was isolated by filtration, washed
with Et.sub.2O and dried under vacuum at 50.degree. C. for 4.5 hr
to give the title compound (0.10 g, 96%) as an off-white solid: MS
(ESI) m/e 347 (M+H).sup.+.
Preparation 120
Preparation of
(E)-3-{4-[2-(4-Methyl-piperazin-1-yl)-2-oxo-ethyl]-2-oxo-2,3,4,5-tetrahyd-
ro-1H-pyrido[2,3-e][1,4]diazepin-7-yl}acrylic acid
hydrochloride
a) [(2-Amino-5-bromo-pyridin-3-ylmethyl)amino]acetic acid ethyl
ester
[0905] A solution of 5-bromo-3-bromomethyl-pyridin-2-ylamine
hydrobromide (6.00 g, 17.3 mmol) and glycine ethyl ester
hydrochloride (2.41 g, 17.3 mmol) in DMF (200 mL) was treated with
triethylamine (7.8 mL, 56 mmol). After stirring at room temperature
for 3.5 h, the cloudy mixture was diluted with H.sub.2O (300 mL)
and then extracted with EtOAc (2.times.300 mL). The combined
organic layers were washed with H.sub.2O (3.times.100 mL) and brine
(100 mL), dried over Na.sub.2SO.sub.4, filtered and the solvent was
removed in vacuo. Purification by flash column chromatography
(silica gel, CH.sub.2Cl.sub.2/MeOH, 98:2) gave the title compound
(2.83 g, 57%) as a white solid: .sup.1H NMR (300 MHz, CDCl.sub.3)
.delta. 8.04 (d, J=2.3 Hz, 1H), 7.36 (d, J=2.3 Hz, 1H), 5.56 (s,
2H), 4.22 (q, J=7.2 Hz, 2H), 3.71 (s, 2H), 3.38 (s, 2H), 1.73 (s,
1H), 1.30 (t, J=7.2 Hz, 3H); MS (ESI) m/e 288 (M+H).sup.+.
b) 7-Bromo-1,3,4,5-tetrahydro-pyrido[2,3-e][1,4]diazepin-2-one
[0906] A solution of
[(2-amino-5-bromo-pyridin-3-ylmethyl)amino]acetic acid ethyl ester
(1.79 g, 6.21 mmol) in DMSO (70 mL) was treated with NaH (60%
dispersion in mineral oil, 0.25 g, 6.2 mmol). After stirring at
room temperature for 27 h, the mixture was diluted with H.sub.2O
(300 mL), and extracted then with EtOAc (4.times.150 mL). The
combined organic layers were washed with H.sub.2O (3.times.50 mL)
and brine (50 mL), dried over Na.sub.2SO.sub.4, filtered and the
solvent was removed in vacuo to give the title compound (1.09 g,
72%) as an off-white solid: .sup.1H NMR (300 MHz, CDCl.sub.3)
.delta. 8.26 (d, J=2.1 Hz, 1H), 8.17 (s, 1H), 7.54 (d, J=1.9 Hz,
1H), 4.03 (s, 2H), 3.93 (s, 2H), 1.85 (br s, 1H); MS (ESI) m/e 242
(M+H).sup.+.
c)
(7-Bromo-2-oxo-1,2,3,5-tetrahydro-pyrido[2,3-e][1,4]diazepin-4-yl)aceti-
c acid tert-butyl ester
[0907] A solution of
7-bromo-1,3,4,5-tetrahydro-pyrido[2,3-e][1,4]diazepin-2-one (2.29
g, 9.46 mmol) in DMF (100 mL) was treated with
tert-butylbromoacetate (1.7 mL, 12 mmol) and triethylamine (1.5 mL,
11 mmol). After stirring at room temperature overnight, the mixture
was diluted with H.sub.2O (300 mL) and then extracted with EtOAc
(3.times.200 mL). The combined organic layers were washed with
H.sub.2O (3.times.100 mL) and brine (100 mL), dried over
Na.sub.2SO.sub.4, filtered and the solvent was removed in vacuo.
Purification by flash column chromatography (silica gel,
hexanes/EtOAc, 2:1) gave the title compound (1.61 g, 48%) as a
white powder: MS (ESI) m/e 356 (M+H).sup.+.
d)
(7-Bromo-2-oxo-1,2,3,5-tetrahydro-pyrido[2,3-e][1,4]diazepin-4-yl)aceti-
c acid hydrochloride
[0908] A solution of
(7-bromo-2-oxo-1,2,3,5-tetrahydro-pyrido[2,3-e][1,4]diazepin-4-yl)acetic
acid tert-butyl ester (1.61 g, 4.52 mmol) in CH.sub.2Cl.sub.2 (20
mL) was treated with TFA (15 mL). After stirring at room
temperature for 1 h, the solution was concentrated in vacuo. The
resulting slurry was treated with anhydrous HCl (40 mL of a 4.0 M)
and sonicated for 1.5 h, diluted with Et.sub.2O and stirred for 1
h. The solid was isolated by filtration, washed with Et.sub.2O, and
dried under vacuum at 50.degree. C. overnight to give the title
compound (1.66 g, 98%) as a white solid: MS (ESI) m/e 300
(M+11).sup.+.
e)
7-Bromo-4-[2-(4-methyl-piperazin-1-yl)-2-oxo-ethyl]-1,3,4,5-tetrahydro--
pyrido[2,3-e][1,4]diazepin-2-one
[0909] A suspension of
(7-bromo-2-oxo-1,2,3,5-tetrahydro-pyrido[2,3-e][1,4]diazepin-4-yl)acetic
acid hydrochloride (1.66 g, 4.45 mmol) in CH.sub.2Cl.sub.2 (50 mL)
was treated sequentially with (i-Pr).sub.2EtN (3.1 mL, 18 mmol),
N-methyl piperazine (0.54 mL, 4.87 mmol), HOBt (0.66 g, 4.88 mmol),
and EDC (0.95 g, 4.96 mmol). After stirring overnight, the mixture
was diluted with CH.sub.2Cl.sub.2 (100 mL) and then washed with
H.sub.2O (100 mL). The aqueous layer was extracted with
CH.sub.2Cl.sub.2 (4.times.100 mL). The combined organic layers were
dried over Na.sub.2SO.sub.4, filtered and the solvent was removed
in vacuo. Purification by flash column chromatography (silica gel,
CH.sub.2Cl.sub.2/MeOH, 97:3 to 95:5) gave the title compound (1.42
g, 83%) as an off-white solid: MS (ESI) m/e 382 (M+H).sup.+.
f)
(E)-3-{4-[2-(4-Methyl-piperazin-1-yl)-2-oxo-ethyl]-2-oxo-2,3,4,5-tetrah-
ydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl}acrylic acid tert-butyl
ester
[0910] A suspension of
7-Bromo-4-[2-(4-methyl-piperazin-1-yl)-2-oxo-ethyl]-1,3,4,5-tetrahydro-py-
rido[2,3-e][1,4]diazepin-2-one (1.39 g, 3.64 mmol) in propionitrile
(32 mL) and DMF (8 mL) was de-oxygenated with Ar for 15 min. The
mixture was treated with tert-butyl acrylate (2.1 mL, 14 mmol) and
(i-Pr).sub.2EtN (1.3 mL, 7.4 mmol) and then was de-oxygenated with
Ar for 10 min. Pd(OAc).sub.2 (83 mg, 0.37 mmol) and P(o-tol).sub.3
(0.22 g, 0.73 mmol) were added simultaneously, and the mixture was
de-oxygenated a third time for 10 min. The mixture was heated to
reflux overnight, then allowed to cool. The resulting precipitate
was isolated by filtration and dissolved in CH.sub.2Cl.sub.2. The
solution was filtered through Celite and the solvent was removed in
vacuo to give the title compound (1.13 g, 72%) as an off-white
solid: MS (ESI) m/e 430 (M+H).sup.+.
g)
(E)-3-{4-[2-(4-Methyl-piperazin-1-yl)-2-oxo-ethyl]-2-oxo-2,3,4,5-tetrah-
ydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl}acrylic acid
hydrochloride
[0911] A suspension of
(E)-3-{4-[2-(4-Methyl-piperazin-1-yl)-2-oxo-ethyl]-2-oxo-2,3,4,5-tetrahyd-
ro-1H-pyrido[2,3-e][1,4]diazepin-7-yl}acrylic acid tert-butyl ester
(1.12 g, 2.61 mmol) in CH.sub.2Cl.sub.2 (10 mL) was treated with
TFA (10 mL). After stirring at room temperature for 35 min, the
solution was concentrated in vacuo. The resulting oil was treated
with anhydrous HCl (20 mL of a 4.0 M solution in dioxane, 80 mmol)
and the resulting mixture was sonicated for 1 h. The mixture was
diluted with Et.sub.2O (50 mL) and sonicated for 10 min. The solid
was isolated by filtration, washed with Et.sub.2O and dried under
vacuum at 50.degree. C. for 4 h to give the title compound (1.72 g,
quantitative) as an off-white solid: .sup.1H NMR (500 MHz,
DMSO-d.sub.6) .delta. 11.60 (br s, 1H), 11.09 (br s, 1H), 8.82 (s,
1H), 8.47 (s, 1H), 7.66 (d, J=19.9 Hz, 1H), 6.65 (d, J=16.1 Hz,
1H), 4.43-4.40 (m, 2H), 4.31 (br s, 2H), 3.95-3.91 (m, 1H), 3.84
(br s, 2H), 3.56 (s, 4H), 3.42 (br s, 2H), 3.23-2.97 (m, 2H), 2.76
(d, J=4.1 Hz, 3H); MS (ESI) m/e 374 (M+H).sup.+.
Preparation 121
Preparation of
(E)-3-[4-(3-Morpholin-4-yl-propyl)-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-
-e][1,4]diazepin-7-yl]acrylic acid hydrochloride
a) (3-Morpholin-4-yl-propylamino)acetic acid ethyl ester
[0912] A solution of 4-(3-aminopropyl)morpholine (10.0 mL, 68.4
mmol) in MeOH (180 mL) was cooled in an ice bath and treated with
ethyl glyoxylate (-50% solution in toluene, 20.0 mL, 98.0 mmol) and
HOAc (12 mL). After stirring for 15 min, NaBH.sub.3CN (4.81 g, 76.5
mmol) was added and the mixture was allowed to stir at 0.degree. C.
for 2 h. The mixture was diluted with saturated aqueous NaHCO.sub.3
(500 mL) and then extracted with EtOAc (5.times.300 mL) followed by
CH.sub.2Cl.sub.2 (9.times.200 mL). The combined CH.sub.2Cl.sub.2
layers were dried over Na.sub.2SO.sub.4, filtered and the solvent
was removed in vacuo to give the title compound (7.44 g, 47%) as a
colorless oil: MS (ESI) m/e 231 (M+H).sup.+.
b)
[(2-Amino-5-bromo-pyridin-3-ylmethyl)-(3-morpholin-4-yl-propyl)amino]ac-
etic acid ethyl ester
[0913] A solution of 5-bromo-3-bromomethyl-pyridin-2-ylamine
hydrobromide (11.2 g, 32.3 mmol) and
(3-morpholin-4-yl-propylamino)acetic acid ethyl ester (7.44 g, 32.3
mmol) in DMF (200 mL) was treated with triethylamine (9.5 mL, 68
mmol). After stirring at room temperature overnight, the mixture
was diluted with H.sub.2O (400 mL) and then extracted with EtOAc
(5.times.250 mL). The combined organic layers were washed with
H.sub.2O (2.times.200 mL) and brine (200 mL), dried over
Na.sub.2SO.sub.4, filtered and the solvent was removed in vacuo to
give the title compound (11.8 g, 87%) as a yellow oil: MS (ESI) m/e
415 (M+H).sup.+.
c)
7-Bromo-4-(3-morpholin-4-yl-propyl)-1,3,4,5-tetrahydro-pyrido[2,3-e][1,-
4]diazepin-2-one
[0914] A solution of
[(2-amino-5-bromo-pyridin-3-ylmethyl)-(3-morpholin-4-yl-propyl)amino]acet-
ic acid ethyl ester (11.8 g, 28.3 mmol) in DMSO (200 mL) was
treated with NaH (60% dispersion in mineral oil, 1.13 g, 28.3
mmol). After stirring at room temperature overnight, the mixture
was diluted with H.sub.2O (400 mL) and then extracted with EtOAc
(7.times.250 mL). The combined organic layers were washed with
H.sub.2O (2.times.200 mL) and brine (200 mL), dried over
Na.sub.2SO.sub.4, filtered and the solvent was removed in vacuo.
Purification by flash column chromatography (silica gel,
CH.sub.2Cl.sub.2/MeOH, 97:3 to 96:4) gave the title compound (5.76
g, 55%) as an off-white powder: MS (ESI) m/e 369 (M+H).sup.+.
d)
(E)-3-[4-(3-Morpholin-4-yl-propyl)-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2-
,3-e][1,4]diazepin-7-yl]acrylic acid tert-butyl ester
[0915] A suspension of
7-bromo-4-(3-morpholin-4-yl-propyl)-1,3,4,5-tetrahydro-pyrido[2,3-e][1,4]-
diazepin-2-one (5.70 g, 15.4 mmol) in propionitrile (120 mL) and
DMF (30 mL) was de-oxygenated with Ar for 15 min. The mixture was
treated with tert-butyl acrylate (9.0 mL, 61 mmol) and
(i-Pr).sub.2EtN (5.7 mL, 33 mmol) and was de-oxygenated with Ar for
10 min. Pd(OAc).sub.2 (0.35 g, 1.6 mmol) and P(o-tol).sub.3 (0.94
g, 3.1 mmol) were added simultaneously, and the mixture was
de-oxygenated a third time for 5 min. The mixture was heated to
reflux overnight, then allowed to cool. The mixture was diluted
with Et.sub.2O (200 mL). The organic solution was filtered through
Celite, washed with H.sub.2O (200 mL), dried over Na.sub.2SO.sub.4,
filtered and then concentrated in vacuo. Purification by flash
column chromatography (silica gel, CH.sub.2Cl.sub.2/MeOH, 97:3 to
96:4) gave the title compound (3.49 g, 55%) as a tan solid: MS
(ESI) m/e 417 (M+H).sup.+.
e)
(E)-3-[4-(3-Morpholin-4-yl-propyl)-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2-
,3-e][1,4]diazepin-7-yl]acrylic acid hydrochloride
[0916] A solution of
(E)-3-[4-(3-Morpholin-4-yl-propyl)-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-
-e][1,4]diazepin-7-yl]acrylic acid tert-butyl ester (2.21 g, 5.30
mmol) in CH.sub.2Cl.sub.2 (20 mL) was treated with TFA (20 mL).
After stirring at room temperature for 30 min, the solution was
concentrated in vacuo. The resulting oil was treated with anhydrous
HCl (50 mL of a 4.0 M solution in dioxane, 200 mmol) and the
mixture was sonicated for 1.5 h. The mixture was diluted with
Et.sub.2O (200 mL) and sonicated for 15 min. The solid was isolated
by filtration, washed with Et.sub.2O, and dried under vacuum at
50.degree. C. for 5 h to give the title compound (3.08 g,
quantitative) as an off-white solid: .sup.1H NMR (500 MHz,
DMSO-d.sub.6) .delta. 11.23 (br s, 2H), 8.74 (s, 1H), 8.36 (s, 1H),
7.63 (d, J=15.9, 1H), 6.63 (d, J=16.0 Hz, 1H), 4.33 (br s, 2H),
3.90 (br s, 6H), 3.24 (m, 8H), 2.22 (br s, 2H); MS (ESI) m/e 361
(M+H).sup.+.
Preparation 122
Preparation of
(E)-7-(2-carboxy-vinyl)-2-oxo-1,2,3,5-tetrahydro-pyrido[2,3-e][1,4]diazep-
ine-4-carboxylic acid benzyl ester hydrochloride
a)
7-Bromo-2-oxo-1,2,3,5-tetrahydro-pyrido[2,3-e][1,4]diazepine-4-carboxyl-
ic acid benzyl ester
[0917] A suspension of
7-bromo-1,3,4,5-tetrahydro-pyrido[2,3-e][1,4]diazepin-2-one (1.08
g, 4.46 mmol) in CH.sub.2Cl.sub.2 (60 mL) was treated with
Et.sub.3N (0.80 mL, 5.7 mmol) and then cooled in an ice bath. The
chilled suspension was treated dropwise with CbzCl (4.5 mmol) to
give a clear solution. The ice bath was removed and the solution
was allowed to stir overnight. The mixture was diluted with
CH.sub.2Cl.sub.2 (90 mL), washed with H.sub.2O (50 mL) and brine
(50 mL), dried over Na.sub.2SO.sub.4, filtered and the solvent was
removed in vacuo. Purification by flash column chromatography
(silica gel, CH.sub.2Cl.sub.2/MeOH, 99.5:0.5 to 99:1) gave the
title compound (0.52 g, 31%) as a white solid: .sup.1H NMR (300
MHz, CDCl.sub.3) .delta. 8.31-8.36 (m, 2H), 7.49-7.71 (m, 1H),
7.34-7.40 (m, 4H), 7.19-7.21 (m, 1H), 5.08-5.12 (m, 2H), 4.43-4.65
(m, 4H); MS (ESI) m/e 376 (M+H).sup.+.
b)
(E)-7-(2-tert-Butoxycarbonyl-vinyl)-2-oxo-1,2,3,5-tetrahydro-pyrido[2,3-
-e][1,4]diazepine-4-carboxylic acid benzyl ester
[0918] A suspension of
7-bromo-2-oxo-1,2,3,5-tetrahydro-pyrido[2,3-e][1,4]diazepine-4-carboxylic
acid benzyl ester (0.52 g, 1.4 mmol) in propionitrile (10 mL) and
DMF (3 mL) was de-oxygenated with Ar for 20 min. The mixture was
treated with tert-butyl acrylate (0.83 mL, 10 mmol) and
(i-Pr).sub.2EtN (0.50 mL, 2.9 mmol) and was de-oxygenated with Ar
for 10 min. Pd(OAc).sub.2 (34 mg, 0.15 mmol) and P(o-tol).sub.3 (84
mg, 0.27 mmol) were added simultaneously, and the mixture was
de-oxygenated a third time for 5 min. The mixture was heated to
reflux overnight, then allowed to cool. The resulting precipitate
was isolated by filtration, washed with EtOAc and dissolved in
CH.sub.2Cl.sub.2. The solution was filtered through Celite and the
solvent was removed in vacuo to give the title compound (0.31 g,
53%) as an off-white solid: .sup.1H NMR (300 MHz, CDCl.sub.3)
.delta. 8.49-8.57 (m, 1H), 8.30 (s, 1H), 7.43-7.73 (m, 2H), 7.33
(s, 4H), 7.17-7.18 (m, 1H), 6.21-6.40 (m, 1H), 5.05-5.11 (m, 2H),
4.46-4.68 (m, 4H), 1.54-1.57 (m, 9H); MS (ESI) m/e 424
(M+H).sup.+.
c)
(E)-7-(2-Carboxy-vinyl)-2-oxo-1,2,3,5-tetrahydro-pyrido[2,3-e][1,4]diaz-
epine-4-carboxylic acid benzyl ester hydrochloride
[0919] A solution of
(E)-7-(2-tert-butoxycarbonyl-vinyl)-2-oxo-1,2,3,5-tetrahydro-pyrido[2,3-e-
][1,4]diazepine-4-carboxylic acid benzyl ester (0.31 g, 0.73 mmol)
in CH.sub.2Cl.sub.2 (5 mL) was treated with TFA (5 mL). After
stirring at room temperature for 30 min, the clear tan solution was
concentrated in vacuo. The resulting oil was treated with anhydrous
HCl (10 mL of a 4.0 M solution in dioxane, 40 mmol) to give a
cloudy mixture. The mixture was diluted with Et.sub.2O (200 mL) to
give an off-white precipitate. After stirring for 15 min, the solid
was isolated by filtration, washed with Et.sub.2O, and dried under
vacuum for 1.5 h to give the title compound (0.27 g, 91%) as an
off-white solid: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
10.50-10.47 (m, 1H), 8.49 (s, 1H), 8.09-8:15 (m, 1H), 7.53-7.59 (m,
1H), 7.15-7.33 (m, 5H), 6.51-6.65 (m, 1H), 5.42 (bs, 2H), 5.05-5.08
(m, 2H), 4.63 (s, 2H), 4.43 (s, 2H); MS (ESI) m/e 368
(M+H).sup.+.
Preparation 123
Preparation of
(E)-3-(2-Oxo-2,3-dihydro-oxazolo[4,5-b]pyridine-6-yl)acrylic acid
hydrochloride
a) (E)-3-(2-Oxo-2,3-dihydro-oxazolo[4,5-b]pyridin-6-yl)acrylic acid
tert-butyl ester
[0920] A stirred solution of 6-bromo-3H-oxazolo[4,5-b]pyridin-2-one
(1.00 g, 4.65 mmol), tert-butyl acrylate (2.7 mL, 18 mmol),
palladium(II) acetate (104 mg, 0.465 mmol), tri-o-tolylphosphine
(283 mg, 0.930 mmol), and N,N-diisopropylethylamine (1.7 mL, 9.7
mmol) in N,N-dimethylformamide (4 mL) and propionitrile (16 mL) was
deoxygenated by bubbling argon through the solution for 20 min. The
mixture was heated to reflux for 21 h, then allowed to cool. The
mixture was concentrated in vacuo. The residue was dissolved in
dichloromethane (100 mL). The solution was washed with water
(2.times.200 mL), dried over sodium sulfate, filtered, and the
solvent removed in vacuo to give a dark brown oil. Purification by
flash column chromatography (silica gel, gradient from 98:2 to 94:6
CHCl.sub.3/MeOH) gave the title compound (283 mg, 23%) as a brown
solid: .sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 8.24 (d, J=1.4 Hz,
1H), 7.64-7.55 (m, 2H), 6.37 (d, J=16.0 Hz, 1H), 1.55 (s, 9H).
b) (E)-3-(2-Oxo-2,3-dihydro-oxazolo[4,5-b]pyridin-6-yl)acrylic acid
hydrochloride
[0921] A solution of
(E)-3-(2-oxo-2,3-dihydro-oxazolo[4,5-b]pyridine-6-yl)acrylic acid
tert-butyl ester (274 mg, 1.04 mmol) in dichloromethane (5 mL) and
trifluoroacetic acid (5 mL) was stirred for 30 min, then the
solvents were removed in vacuo. The residue was suspended in
anhydrous HCl (5 mL of a 4 M solution in 1,4-dioxane, 20 mmol) and
the mixture was sonicated for 1 min. The resulting solid was
collected by filtration, washed with diethyl ether and then dried
in vacuo to give the title compound (194 mg, 77%) as a light brown
solid: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 8.31 (s, 1H),
8.13 (s, 1H), 7.63 (d, J=16.0 Hz, 1H), 6.60 (d, J=16.0 Hz, 1H).
Preparation 124
Preparation of
(E)-3-[6-Amino-5-(2-carboxy-ethyl)pyridin-3-yl]acrylic acid
[0922] A solution of
(E)-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3-yl)acrylic acid
tert-butyl ester (0.86 g, 3.0 mmol) was stirred in methanol (10
mL), dioxane (10 mL) and aq. NaOH (15 mL of a 1 N solution, 15
mmol) for 4 days. The clear solution was neutralized with aq. HCl
(15 mL of a 1 N solution, 15 mmol) and stirred for 20 min. The
white precipitate was collected by filtration to give
(E)-3-[6-amino-5-(2-carboxy-ethyl)pyridin-3-yl]acrylic acid (0.57
g, 78%): MS (ESI) m/e 237 (M+H).sup.+.
Preparation 125
Preparation of
(E)-3-(6-Amino-5-piperidin-1-ylmethyl-pyridin-3-yl)acrylic acid
hydrochloride
a) 5-Bromo-3-piperidin-1-ylmethyl-pyridin-2-ylamine
[0923] An ice-cold suspension of
5-bromo-3-bromomethyl-pyridin-2-ylamine hydrobromide (10.0 g, 28.8
mmol) in MeCN (100 mL) was treated with piperidine (6.4 mL, 64.8
mmol). After stirring at room temperature for 3.5 h, the mixture
was diluted with Et.sub.2O (500 mL). The solution was filtered and
then concentrated to give the title compound (4.16 g, 53%) as a
pale, yellow solid: MS (ESI) m/e 270 (M+H).sup.+.
b) (E)-3-(6-Amino-5-piperidin-1-ylmethyl-pyridin-3-yl)acrylic acid
tert-butyl ester
[0924] A solution of
5-bromo-3-piperidin-1-ylmethyl-pyridin-2-ylamine (500 mg, 1.85
mmol), tert-butyl acrylate (0.3 mL, 2.0 mmol), (i-Pr).sub.2EtN (0.5
mL, 2.8 mmol) and P(o-tol).sub.3 (114 mg, 0.37 mmol) in EtCN (10
mL) was de-oxygenated with argon for 30 min. Pd(OAc).sub.2 (43 mg,
0.19 mmol) was added, and the mixture was de-oxygenated for 15 min.
The mixture was heated to reflux for 18 h and then allowed to cool.
The solvent was removed in vacuo. The residue was partitioned
between EtOAc and H.sub.2O. The organic layer was washed with
H.sub.2O and satd NaCl, dried over Na.sub.2SO.sub.4 and
concentrated. Purification by column chromatography (silica gel,
CH.sub.2Cl.sub.2 to 96:4 CH.sub.2Cl.sub.2/CH.sub.3OH) gave the
title compound (350 mg, 60%) as a yellow solid: MS (ESI) m/e 318
(M+H).sup.+.
c) (E)-3-(6-Amino-5-piperidin-1-ylmethyl-pyridin-3-yl)acrylic acid
hydrochloride
[0925] A suspension of
3-(6-amino-5-piperidin-1-ylmethyl-pyridin-3-yl)acrylic acid
tert-butyl ester (250 mg, 0.79 mmol) in CH.sub.2Cl.sub.2 (3 mL) was
treated with TFA (2 mL). After stirring at room temperature under
N.sub.2 for 45 min, the solution was concentrated. The resulting
oil was treated with anhydrous HCl in dioxane (10 mL, 4.0 M) and
then sonicated until the oil was converted to a fine off-white
solid. After stirring under N.sub.2 for 20 min, the solid was
isolated by filtration, washed with Et.sub.2O, and dried under
vacuum for several hours to give the title compound (282 mg,
quantitative) as an off-white solid: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 10.6 (br s, 1H), 8.53 (d, J=2.1 Hz, 1H),
8.39-8.28 (m, 3H), 7.53 (d, J=15.0 Hz, 1H), 6.46 (d, J=15.0 Hz,
1H), 4.33 (s, 2H), 3.43-3.35 (m, 2H), 2.97 (s, 2H), 1.79-1.69 (m,
5H), 1.35 (s, 1H).
Preparation 126
Preparation of
(E)-3-(6-Amino-5-pyrrolidin-1-ylmethyl-pyridin-3-yl)acrylic acid
hydrochloride
a) 5-Bromo-3-pyrrolidin-1-ylmethyl-pyridin-2-ylamine
[0926] According to the procedure of Preparation 125(a), except
substituting pyrrolidine for piperidine, the title compound (2.40
g, 34%) was prepared as an off-white solid: .sup.1H NMR (300 MHz,
CDCl.sub.3) .delta. 8.01 (d, J=2.3 Hz, 1H), 7.34 (d, J=2.3 Hz, 1H),
5.67 (s, 2H), 3.51 (s, 2H), 2.48-2.44 (m, 4H), 1.80-1.60 (m,
4H).
b) (E)-3-(6-Amino-5-pyrrolidin-1-ylmethyl-pyridin-3-yl)acrylic acid
tert-butyl ester
[0927] According to the procedure of Preparation 125(b), except
substituting 5-bromo-3-pyrrolidin-1-ylmethyl-pyridin-2-ylamine for
5-bromo-3-piperidin-1-ylmethyl-pyridin-2-ylamine, the title
compound (1.60 g, 61%) was prepared as a light yellow solid:
.sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 8.08 (d, J=2.1 Hz, 1H),
7.50-7.44 (m, 2H), 6.17 (d, J=15.9 Hz, 1H), 6.00 (s, 2H), 3.56 (s,
2H), 2.49-2.45 (m, 4H), 1.81-1.76 (m, 4H), 1.52 (s, 9H).
c) (E)-3-(6-Amino-5-pyrrolidin-1-ylmethyl-pyridin-3-yl)acrylic acid
hydrochloride
[0928] According to the procedure of Preparation 125(c), except
substituting
(E)-3-(6-amino-5-pyrrolidin-1-ylmethyl-pyridin-3-yl)acrylic acid
tert-butyl ester for
(E)-3-(6-amino-5-piperidin-1-ylmethyl-pyridin-3-yl)acrylic acid
tert-butyl ester, the title compound (1.68 g, quantitative) was
prepared as an off-white solid: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 11.9 (br s, 1H), 8.66-8.38 (m, 4H), 7.56 (d, J=15.9 Hz,
1H), 6.49 (d, J=15.9 Hz, 1H), 4.46 (s, 2H), 3.57-3.50 (m, 2H),
3.19-3.01 (m, 2H), 1.91-1.88 (m, 4H).
Preparation 127
Preparation of
(E)-3-[6-Amino-5-(4-methyl-piperazin-1-ylmethyl)-pyridin-3-yl]acrylic
acid hydrochloride
a) 5-Bromo-3-(4-methyl-piperazin-1-ylmethyl)pyridin-2-ylamine
[0929] According to the procedure of Preparation 125(a), except
substituting 1-methylpiperizine for piperidine, the title compound
(2.32 g, 30%) was prepared as a light, yellow solid: .sup.1H NMR
(300 MHz, CDCl.sub.3) .delta. 8.03 (d, J=2.3 Hz, 1H), 7.32 (d,
J=2.3 Hz, 1H), 5.63 (s, 2H), 3.42 (s, 2H), 2.46-2.36 (m, 8H), 2.30
(s, 3H).
b)
(E)-3-[6-Amino-5-(4-methyl-piperazin-1-ylmethyl)pyridin-3-yl]acrylic
acid tert-butyl ester
[0930] According to the procedure of Preparation 125(b), except
substituting
5-bromo-3-(4-methyl-piperazin-1-ylmethyl)pyridin-2-ylamine for
5-bromo-3-piperidin-1-ylmethyl-pyridin-2-ylamine, the title
compound (1.18 g, 45%) was prepared as a yellow solid: .sup.1H NMR
(300 MHz, CDCl.sub.3) .delta. 8.09 (d, J=2.2 Hz, 1H), 7.49-7.44 (m,
2H), 6.18 (d, J=15.9 Hz, 1H), 5.95 (br s, 2H), 3.47 (s, 2H),
2.38-2.59 (m, 7H), 2.96 (s, 4H), 1.52 (s, 9H).
c)
(E)-3-[6-Amino-5-(4-methyl-piperazin-1-ylmethyl)pyridin-3-yl]acrylic
acid hydrochloride
[0931] According to the procedure of Preparation 125(c), except
substituting
(E)-3-[6-amino-5-(4-methyl-piperazin-1-ylmethyl)-pyridin-3-yl]acrylic
acid tert-butyl ester (1.18 g, 3.55 mmol) for
(E)-3-(6-amino-5-piperidin-1-ylmethyl-pyridin-3-yl)acrylic acid
Cert-butyl ester, the title compound (1.72 g, quantitative) was
prepared as an off-white solid: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 10.98 (br s, 1H), 8.61-8.34 (m, 4H), 7.53 (d, J=16.0 Hz,
1H), 6.53 (d, J=15.9 Hz, 1H), 3.81 (br s, 2H), 3.56 (s, 3H),
3.45-3.37 (m, 2H), 3.20-3.08 (m, 2H), 2.76 (s, 4H); MS (ESI) m/e
277 (M+H).sup.+.
Preparation 128
Preparation of
(E)-3-[6-Amino-5-(4-benzyl-piperidin-1-ylmethyl)pyridin-3-yl]acrylic
acid hydrochloride
a) 3-(4-Benzyl-piperidin-1-ylmethyl)-5-bromo-pyridin-2-ylamine
[0932] According to the procedure of Preparation 125(a), except
substituting 4-benzylpiperidine (5.6 mL, 31.7 mmol) for piperidine
and adding K.sub.2CO.sub.3 (19.9 g, 144 mmol) as base, the title
compound (9.81 g, 95%) was prepared as a light, yellow solid: MS
(ESI) m/e 36 (M+H).sup.+.
b)
(E)-3-[6-Amino-5-(4-benzyl-piperidin-1-ylmethyl)pyridin-3-yl]acrylic
acid tert-butyl ester
[0933] According to the procedure of Preparation 125(b), except
substituting
3-(4-Benzyl-piperidin-1-ylmethyl)-5-bromo-pyridin-2-ylamine for
5-bromo-3-piperidin-1-ylmethyl-pyridin-2-ylamine, the title
compound (4.48 g, 80%) was prepared as a yellow solid: MS (ESI) m/e
408 (M+H).sup.+.
c)
(E)-3-[6-Amino-5-(4-benzyl-piperidin-1-ylmethyl)pyridin-3-yl]acrylic
acid hydrochloride
[0934] According to the procedure of Preparation 125(c), except
substituting
(E)-3-[6-amino-5-(4-benzyl-piperidin-1-ylmethyl)pyridin-3-yl]acrylic
acid tert-butyl ester for
3-(6-amino-5-piperidin-1-ylmethyl-pyridin-3-yl)acrylic acid
tert-butyl ester, the title compound (5.24 g, quantitative) was
prepared as an off-white solid: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 10.56 (br s, 1H), 8.61-8.37 (m, 3H), 7.51 (d, J=15.9, 1H),
7.32-7.17 (m, 6H), 6.50-6.42 (m, 1H), 4.35 (br s, 2H), 3.45-3.37
(m, 2H), 3.11-2.92 (m, 2H), 1.75-1.51 (m, 6H); MS (ESI) m/e 352
(M+H).sup.+.
Preparation 129
Preparation of
(E)-3-(2,4-dioxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl)acrylic
acid
a) 2-Amino-5-bromo-nicotinic acid hydrobromide
[0935] Bromine (7.5 mL, 146 mmol) was added dropwise over 10 min to
a suspension of 2-amino-nicotinic acid (20.0 g, 145 mmol) in
glacial acetic acid (250 mL) cooled in an ice bath. After the
bromine addition was complete, the mixture was stirred at ambient
temperature for 2 d. The resulting light yellow solid was isolated
by filtration, washed with Et.sub.2O, and dried under high vacuum
(40.degree. C.) for several hours to give the title compound (40.0
g, 93%): .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 8.33 (d, J=2.5
Hz, 1H), 8.20 (d, J=2.5 Hz, 1H), 8.02 (bs, 3H); ESI MS m/e 217
(M+H).sup.+.
b) 2-Amino-5-bromo-nicotinamide
[0936] To an ice-cold suspension of 2-amino-5-bromo-nicotinic acid
hydrobromide (5.11 g, 17.1 mmol) and ammonium chloride (9.15 g, 171
mmol) in dimethoxyethane (170 mL) was added Et.sub.3N (4.8 mL, 34.2
mmol). After 10 min, diethylphosphoryl cyanide was added dropwise
and the cold bath removed. After 4 h, the solution was filtered and
the filtrate concentrated. The resulting residue was partitioned
between EtOAc and water. The organic layer was washed with satd
NaHCO.sub.3 (2.times.) and satd NaCl, dried (Na.sub.2SO.sub.4) and
concentrated under reduced pressure. The yellow solid was dissolved
in EtOAc and then hexanes were added until precipitation occurred.
The solid was collected by filtration and then triturated with
EtOAc to give the title compound (1.62 g, 44%) as a yellow solid:
.sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 8.13 (s, 2H), 8.04 (bs,
1H), 7.46 (bs, 1H), 7.37 (bs, 2H).
c) 6-Bromo-1H-pyrido[2,3-d]pyrimidine-2,4-dione
[0937] Oxalyl chloride (100 mL, 1.16 mmol) was added dropwise to a
suspension of 2-amino-5-bromo-nicotinamide (500 mg, 2.31 mmol) in
toluene (5 mL) and the resulting mixture was heated to reflux for 4
h. The reaction mixture was cooled and the mustard-colored solid
which had formed was collected by filtration. The solid was washed
with a small amount of water, MeOH, and then dried under high
vacuum (40.degree. C.) overnight to give the title compound (435
mg, 77%): .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 11.86 (s,
1H), 11.60 (s, 1H), 8.72 (d, J=2.5 Hz, 1H), 8.35 (d, J=2.5 Hz, 1H);
.sup.13C NMR (126 MHz, DMSO-d.sub.6) .delta. 161.4, 154.8, 151.2,
150.17, 137.8, 112.6, 111.6.
d)
(E)-3-(2,4-Dioxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl)acrylic
acid tert-butyl ester
[0938] A suspension of 6-bromo-1H-pyrido[2,3-d]pyrimidine-2,4-dione
(430 mg, 1.59 mmol) in propionitrile (8 mL) and DMF (2 mL) was
treated with tert-butyl acrylate (0.93 mL, 6.4 mmol),
(i-Pr).sub.2EtN (0.6 mL, 3.3 mmol) and P(o-tol).sub.3 (100 mg, 0.32
mmol). The solution was deoxygenated with Ar for 20 min.
Pd(OAc).sub.2 (36 mg, 0.16 mmol) was added and the mixture was
deoxygenated with a stream of Ar for 10 min. The mixture was heated
to reflux for 17 h, then allowed to cool. The resulting precipitate
was isolated by filtration to give the title compound (384 mg, 83%)
as a gray solid: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 11.88
(s, 1H), 11.54 (s, 1H), 8.96 (d, J=2.2 Hz, 1H), 8.53 (d, J=2.2 Hz,
1H), 7.65 (d, J=16.1 Hz, 1H), 6.72 (d, J=16.1 Hz, 1H), 1.49 (s,
9H); ESI MS m/e 290 (M+H).sup.+.
e)
(E)-3-(2,4-Dioxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl)acrylic
acid
[0939] To a suspension of
(E)-3-(2,4-dioxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl)acrylic
acid tert-butyl ester (379 mg, 1.19 mmol) in CH.sub.2Cl.sub.2 (10
mL) was added trifluoroacetic acid (2 mL). After 6 h, the solvent
was concentrated, the resulting solid was treated with anhydrous
HCl (10 mL of a 4 M solution in dioxane, 40 mmol) and the mixture
was sonicated for 10 min. The mixture was diluted with Et.sub.2O
and the solution was filtered. The olive solid was dried under high
vacuum at 45.degree. C. overnight to give the title compound (323
mg, 91%) as the TFA salt: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 11.89 (s, 1H), 11.56 (s, 1H), 8.94 (d, J=1.8 Hz, 1H), 8.53
(d, J=1.8 Hz, 1H), 7.69 (d, J=16.1 Hz, 1H), 6.72 (d, J=16.1 Hz,
1H), 4.40 (bs, 1H); ESI MS m/e 234
(C.sub.10H.sub.7N.sub.3O.sub.4+
Preparation 130
Preparation of
(E)-3-[3-(2-dimethylamino-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]-p-
yrimidin-6-yl]acrylic acid hydrochloride
a) 2-Amino-5-bromo-N-(2-dimethylamino-ethyl)nicotinamide
[0940] To a suspension of 2-amino-5-bromo-nicotinic acid
hydrobromide (4.00 g, 13.4 mmol) in CH.sub.2Cl.sub.2 (150 mL) was
added Et.sub.3N (2.79 mL, 20.1 mmol), EDC (2.70 g, 14.1 mmol), and
HOBt (1.91 g, 14.1 mmol) at 0.degree. C., and the mixture was
stirred for 10 min. N,N-dimethylethylenediamine was then added, and
the mixture was allowed to stir overnight at room temperature. The
organic solution was washed with 2 N NaOH (2.times.20 mL), H.sub.2O
(2.times.20 mL) and brine, dried over Na.sub.2SO.sub.4 and
filtered. The solvent was concentrated to give the title compound
(2.70 g, 70%) as a yellow solid: MS (ESI) m/e 287 (M+H).sup.+.
b)
5-Bromo-3-[(2-dimethylamino-ethylamino)methyl]pyridin-2-ylamine
[0941] 2-Amino-5-bromo-N-(2-dimethylamino-ethyl)nicotinamide (2.15
g, 7.48 mmol) was added to a BH.sub.3 solution (37.5 mL of a 1 M
solution in THF, 37.5 mmol), and the mixture was heated to reflux
for 6 h. After cooling, the solvent was removed in vacuo. The
residue was dissolved in MeOH (20 mL). Concentrated HCl (3 mL) and
H.sub.2O (3 mL) were added and the mixture was heated to reflux for
2 h. The solvent was then concentrated and the aqueous residue was
basified to pH 12 with aqueous NaOH (6 N). The resulting aqueous
suspension was extracted with CH.sub.2Cl.sub.2 (3.times.60 mL). The
combined organics were washed with brine, dried over
Na.sub.2SO.sub.4, filtered and concentrated under reduced pressure
to give the title compound (0.50 g, 25%) as a colorless oil: MS
(ESI) m/e 273 (M+H).sup.+.
c)
6-Bromo-3-(2-dimethylamino-ethyl)-3,4-dihydro-1H-pyrido[2,3-d]pyrimidin-
-2-one
[0942] A solution of
5-bromo-3-[(2-dimethylamino-ethyl)methyl]pyridin-2-ylamine (490 mg,
1.79 mmol) and 1,1'-carbonyldiimidazole (349 mg, 2.15 mmol) in
1,4-dioxane (15 mL) was heated to 80.degree. C. for 14 h. TLC
analysis indicated remaining starting material. After cooling,
additional 1,1'-carbonyldiimidazole (349 mg, 2.15 mmol) and
1,4-dioxane (10 mL) were added, and the solution was heated to
reflux overnight. The solvent was removed in vacuo. The residue was
dissolved in CH.sub.2Cl.sub.2 (80 mL). The solution was washed with
satd NaHCO.sub.3, water and brine, dried over Na.sub.2SO.sub.4 and
concentrated. Purification by column chromatography (silica gel,
CH.sub.2Cl.sub.2/MeOH/Et.sub.3N, 92:7:1) gave the title compound
(270 mg, 50%) as a tan solid: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 9.83 (s, 1H), 8.16 (d, J=2.1 Hz, 1H), 7.76 (s, 1H), 4.48
(s, 2H), 3.37 (t, J=6.5 Hz, 2H), 2.40 (t, J=6.5 Hz, 2H), 2.16 (s,
6H).
d)
(E)-3-[3-(2-Dimethylamino-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]-
pyrimidin-6-yl]acrylic acid tert-butyl ester
[0943] To a solution of
6-bromo-3-(2-dimethylamino-ethyl)-3,4-dihydro-1H-pyrido[2,3-d]pyrimidin-2-
-one (240 mg, 0.802 mmol) in propionitrile (16 mL) and DMF (4 mL)
was added tert-butyl acrylate (0.46 mL, 3.2 mmol) and
(i-Pr).sub.2EtN (0.28 mL, 1.6 mmol), Pd(OAc).sub.2 (18 mg, 0.080
mmol) and P(o-tol).sub.3 (49 mg, 0.16 mmol). The mixture was
degassed with Ar for 15 min. The mixture was heated to reflux
overnight, and then allowed to cool. The dark solution was filtered
through a pad of Celite. The filtrate was concentrated.
Purification by column chromatography (silica gel,
CH.sub.2Cl.sub.2/MeOH/Et.sub.3N, 94/5.5/0.5) gave the title
compound (150 mg, 54%) as a pale-yellow solid: MS (ESI) m/e 347
(M+H).sup.+.
e)
(E)-3-[3-(2-Dimethylamino-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]-
-pyrimidin-6-yl]acrylic acid hydrochloride
[0944] A solution of
(E)-3-[3-(2-dimethylamino-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]py-
rimidin-6-yl]acrylic acid tert-butyl ester (145 mg, 0.419 mmol) in
CH.sub.2Cl.sub.2 (4 mL) was treated with TFA (2 mL). After stirring
at room temperature for 30 min, the clear tan solution was
concentrated in vacuo. The resulting oil was treated with anhydrous
HCl (4.0 mL of 4 M solution in dioxane, 16 mmol) and stirred until
the oil was converted to a solid. The solid was isolated by
filtration, washed with Et.sub.2O and dried under vacuum over night
to give the title compound (155 mg, quantitative) as a pale yellow
solid: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.18 (s, 1H),
9.70 (br s, 1H), 8.36 (d, J=1.4 Hz, 1H), 7.92 (s, 1H), 7.55 (d,
J=16.0 Hz, 1H), 6.48 (d, J=16.0 Hz, 1H), 4.53 (s, 2H), 4.50 (br s,
2H), 3.71 (t, J=5.6 Hz, 2H), 3.31 (t, J=5.6 Hz, 2H), 2.84 (s, 3H),
2.82 (s, 3H).
Preparation 131
Preparation of
(E)-3-[3-(2-Morpholin-4-yl-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]p-
yrimidin-6-yl]acrylic acid hydrochloride
a) 2-Amino-5-bromo-N-(2-morpholin-4-yl-ethyl)nicotinamide
[0945] According to the procedure of Preparation 130(a), except
substituting 4-(2-aminoethyl)morpholine for the
N,N-dimethylethylenediamine, the title compound (18 g, 82%) was
prepared as a pale yellow solid: MS (ESI) m/e 329 (M+H).sup.+.
b)
5-Bromo-3-[(2-morpholin-4-yl-ethylamino)methyl]pyridin-2-ylamine
[0946] According to the procedure of Preparation 130(b), except
substituting 2-amino-5-bromo-N-(2-morpholin-4-yl-ethyl)nicotinamide
for 2-amino-5-bromo-N-(2-dimethylamino-ethyl)nicotinamide, the
title compound (5.0 g, 35%) was prepared as a colorless oil: MS
(ESI) m/e 315 (M+H).sup.+.
c)
6-Bromo-3-(2-morpholin-4-yl-ethyl)-3,4-dihydro-1H-pyrido[2,3-d]pyrimidi-
n-2-one
[0947] According to the procedure of Preparation 130(c), except
substituting
5-bromo-3-[(2-morpholin-4-yl-ethylamino)methyl]pyridin-2-ylamine
for 5-bromo-3-[(2-dimethylamino-ethyl)methyl]pyridin-2-ylamine, the
title compound (1.1 g, 20%) was prepared as pale yellow solid: MS
(ESI) m/e 341 (M+H).sup.+.
d)
(E)-3-[3-(2-Morpholin-4-yl-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d-
]pyrimidin-6-yl]acrylic acid tert-butyl ester
[0948] According to the procedure of Preparation 130(d), except
substituting
6-bromo-3-(2-morpholin-4-yl-ethyl)-3,4-dihydro-1H-pyrido[2,3-d]pyrimidin--
2-one for
6-bromo-3-(2-dimethylamino-ethyl)-3,4-dihydro-1H-pyrido[2,3-d]py-
rimidin-2-one, the title compound (0.67 g, 54%) was prepared as a
white solid: MS (ES) m/e 389 (M+H).sup.+.
e)
(E)-3-[3-(2-Morpholin-4-yl-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d-
]pyrimidin-6-yl]acrylic acid hydrochloride
[0949] According to the procedure of Preparation 130(e), except
substituting
(E)-3-[3-(2-morpholin-4-yl-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]p-
yrimidin-6-yl]acrylic acid tert-butyl ester for the
(E)-3-[3-(2-dimethylamino-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]py-
rimidin-6-yl]acrylic acid tert-butyl ester, the title compound
(0.71 g, quantitative) was prepared as a white solid: .sup.1H NMR
(300 MHz, DMSO-d.sub.6) .delta. 10.64 (br s, 1H), 10.17 (br s, 1H),
8.36 (s, 1H), 7.93 (s, 1H), 7.54 (d, J=15.9 Hz, 1H), 6.49 (d,
J=16.0 Hz, 1H), 5.95 (br s, 2H), 4.56 (s, 2H), 3.98-3.94 (m, 2H),
3.79-3.72 (m, 4H), 3.56-3.53 (m, 2H), 3.37-3.35 (m, 2H), 3.15-3.05
(m, 2H); MS (ESI) m/e 333 (M+H).sup.+.
Preparation 132
Preparation of
(E)-3-[3-(3-Morpholin-4-yl-propyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]-
pyrimidin-6-yl]acrylic acid hydrochloride
a) 2-Amino-5-bromo-pyridine-3-carbaldehyde hydrobromide
[0950] Bromine (1.1 mL, 20 mmol) in HOAc (20 mL) was added dropwise
to a solution of 2-amino-pyridine-3-carbaldehyde (2.5 g, 20 mmol)
in HOAc (50 mL) while stirring. After the addition, the mixture was
allowed to stir for 2 h at room temperature. The precipitate was
collected by filtration and washed with diethyl ether to afford the
title compound (4.4 g, 77%) as a pale yellow solid: MS (ESI) m/e
201 (M+H).sup.+.
b)
5-Bromo-3-[(3-morpholin-4-yl-propylamino)methyl]pyridin-2-ylamine
[0951] To a solution of 2-amino-5-bromo-pyridine-3-carbaldehyde
hydrobromide (4.30 g, 15.3 mmol) in MeOH (100 mL) was added
triethylamine (4.3 mL, 31 mmol) and the mixture was stirred at room
temperature for 10 min. The resulting suspension was treated with
4-(3-aminopropyl)morpholine (2.5 mL, 17 mmol) and the mixture was
stirred for 7 h. TLC analysis indicated remaining starting
material. Additional 4-(3-aminopropyl)morpholine (1.0 mL, 6.8 mmol)
was added, and the mixture was allowed to stir overnight at room
temperature. The mixture was cooled and then NaBH.sub.4 (0.87 g,
23.0 mmol) was added in two portions. The mixture was stirred at
room temperature for 4 h. The solvent was removed in vacuo.
Purification by column chromatography (silica gel,
CH.sub.2Cl.sub.2/MeOH/Et.sub.3N, 97/2.5/0.5 to 85/14.5/0.5) gave
the title compound (2.70 g, 54%) as a brown oil: MS (ESI) m/e 329
(M+H).sup.+.
c)
6-Bromo-3-(3-morpholin-4-yl-propyl)-3,4-dihydro-1H-pyrido[2,3-d]pyrimid-
in-2-one
[0952] According to the procedure of Preparation 130(c), except
substituting
5-bromo-3-[(3-morpholin-4-yl-propylamino)methyl]pyridin-2-ylamine
for 5-bromo-3-[(2-dimethylamino-ethyl)methyl]pyridin-2-ylamine, the
title compound (2.00 g, 69%) was prepared as pale yellow solid: MS
(ESI) m/e 355 (M+H).sup.+.
d)
(E)-3-[3-(2-Morpholin-4-yl-propyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3--
d]pyrimidin-6-yl]acrylic acid tert-butyl ester
[0953] According to the procedure of Preparation 130(d), except
substituting
6-bromo-3-(3-morpholin-4-yl-propyl)-3,4-dihydro-1H-pyrido[2,3-d]pyrimidin-
-2-one for
6-bromo-3-(2-dimethylamino-ethyl)-3,4-dihydro-1H-pyrido[2,3-d]p-
yrimidin-2-one, the title compound (1.5 g, 66%) was prepared as a
pale yellow solid: MS (ESI) m/e 403 (M+H).sup.+.
e)
(E)-3-[3-(3-Morpholin-4-yl-propyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3--
d]pyrimidin-6-yl]acrylic acid hydrochloride
[0954] According to the procedure of Preparation 130(e), except
substituting
(E)-3-[3-(2-morpholin-4-yl-propyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]-
pyrimidin-6-yl]acrylic acid tert-butyl ester for
(E)-3-[3-(2-dimethylamino-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]py-
rimidin-6-yl]acrylic acid tert-butyl ester, the title compound (1.5
g, 99%) was prepared as a yellow solid: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 10.08 (s, 1H), 8.36 (d, J=1.5 Hz, 1H), 7.96
(s, 1H), 7.59-7.49 (m, 1H), 6.53-6.45 (m, 1H), 4.55-4.48 (m, 2H),
4.00-3.75 (m, 4H), 3.48-3.36 (m, 4H), 3.20-2.95 (m, 4H), 2.10-1.96
(m, 2H); MS (ESI) m/e 347 (M+H).sup.+.
Preparation 133
Preparation of
(E)-3-(3-Ethoxycarbonylmethyl-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrim-
idin-6-yl]acrylic acid hydrochloride
a) (6-Bromo-2-oxo-1,4-dihydro-2H-pyrido[2,3-d]pyrimidin-3-yl)acetic
acid ethyl ester
[0955] According to the procedure of Preparation 130(c), except
substituting [(2-amino-5-bromo-pyridin-3-ylmethyl)amino]acetic acid
ethyl ester for
5-bromo-3-[(2-dimethylamino-ethyl)methyl]pyridin-2-ylamine, the
title compound (6.70 g, 67%) was prepared as a white solid: MS
(ESI) m/e 314 (M+H).sup.+.
b)
(E)-3-(3-Ethoxycarbonylmethyl-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyr-
imidin-6-yl)acrylic acid tert-butyl ester
[0956] According to the procedure of Preparation 130(d), except
substituting
(6-bromo-2-oxo-1,4-dihydro-2H-pyrido[2,3-d]pyrimidin-3-yl)acetic
acid ethyl ester for
6-bromo-3-(2-dimethylamino-ethyl)-3,4-dihydro-1H-pyrido[2,3-d]pyrimidin-2-
-one, the title compound (2.10 g, 76%) was prepared as a white
solid: MS (ESI) m/e 362 (M+H).sup.+.
c)
(E)-3-(3-Ethoxycarbonylmethyl-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyr-
imidin-6-yl]acrylic acid hydrochloride
[0957] According to the procedure of Preparation 130(e), except
substituting
(E)-3-(3-ethoxycarbonylmethyl-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrim-
idin-6-yl]acrylic acid tert-butyl ester for the
(E)-3-[3-(2-dimethylamino-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]py-
rimidin-6-yl]acrylic acid ten-butyl ester, the title compound (1.80
g, 96%) was prepared as a white solid: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 10.90-9.51 (m, 2H), 8.37 (s, 1H), 7.95 (s,
1H), 7.57-7.51 (m, 1H), 6.48 (d, J=16.0 Hz, 1H), 4.53 (s, 2H),
4.18-4.11 (m, 4H), 1.21 (t, J=7.0 Hz, 3H); MS (ESI) m/e 306
(M+H).sup.+.
Preparation 134
Preparation of
(E)-3-[3-(2-Ethoxycarbonyl-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]p-
yrimidin-6-yl]acrylic acid hydrochloride
a) 3-[(2-Amino-5-bromo-pyridin-3-ylmethyl)amino]propionic acid
ethyl ester
[0958] A mixture of 5-bromo-3-bromomethyl-pyridin-2-ylamine
hydrobromide (9.41 g, 27.1 mmol) and .beta.-alanine ethyl ester
hydrochloride (5.00 g, 32.5 mmol) in DMF (75 mL) was treated with
N,N-diisopropylethylamine (16.5 mL, 94.9 mmol). After stirring at
room temperature for 4 h, the cloudy mixture was diluted with
CH.sub.2Cl.sub.2 (100 mL) and H.sub.2O. The aqueous layer was
extracted with CH.sub.2Cl.sub.2 (2.times.150 mL). The combined
organic layers were washed with brine, dried over Na.sub.2SO.sub.4,
filtered and the solvent removed in vacuo. Purification by column
chromatography (silica gel, CH.sub.2Cl.sub.2/MeOH/Et.sub.3N,
95/4.5/0.5 to 80/19.5/0.5) gave the title compound (1.90 g, 23%) as
a tan oil: MS (ESI) m/e 302 (M+H).sup.+.
b)
3-(6-Bromo-2-oxo-1,4-dihydro-2H-pyrido[2,3-d]pyrimidin-3-yl)propionic
acid ethyl ester
[0959] According to the procedure of Preparation 130(c), except
substituting 3-[(2-amino-5-bromo-pyridin-3-ylmethyl)amino]propionic
acid ethyl ester for
5-bromo-3-[(2-dimethylamino-ethyl)methyl]pyridin-2-ylamine, the
title compound (1.7 g, 83%) was prepared as a white solid: MS (ESI)
m/e 328 (M+H).sup.+.
c)
(E)-3-[3-(2-Ethoxycarbonyl-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d-
]pyrimidin-6-yl]acrylic acid tert-butyl ester
[0960] According to the procedure of Preparation 130(d), except
substituting
3-(6-bromo-2-oxo-1,4-dihydro-2H-pyrido[2,3-d]pyrimidin-3-yl)propionic
acid ethyl ester for the
6-bromo-3-(2-dimethylamino-ethyl)-3,4-dihydro-1H-pyrido[2,3-d]pyrimidin-2-
-one, the title compound (0.39 g, 21%) was prepared as a white
solid: MS (ESI) m/e 376 (M+H).sup.+.
d)
(E)-3-[3-(2-Ethoxycarbonyl-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d-
]pyrimidin-6-yl]acrylic acid
[0961] According to the procedure of Preparation 130(e), except
substituting
(E)-3-[3-(2-ethoxycarbonyl-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]p-
yrimidin-6-yl]acrylic acid tert-butyl ester for the
(E)-3-[3-(2-dimethylamino-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]py-
rimidin-6-yl]acrylic acid tert-butyl ester, the title compound
(0.16 g, 44%) was prepared as a yellow solid: .sup.1H NMR (500 MHz,
DMSO-d.sub.6) .delta. 8.30 (d, J=1.5 Hz, 1H), 8.16 (s, 1H),
7.70-7.60 (m, 1H), 6.60-6.50 (m, 1H), 4.70 (s, 2H), 4.13 (q, J=7.0
Hz, 2H), 3.74-3.68 (t, J=6.5 Hz, 2H), 2.74-2.66 (t, J=6.5 Hz, 2H),
1.25 (t, J=5.5 Hz, 3H); MS (ESI)/We 320 (M+H).sup.+.
Preparation 135
Preparation of
6-Bromo-3-(2,2-dimethoxy-ethyl)-3,4-dihydro-1H-pyrido[2,3-d]pyrimidin-2-o-
ne
a)
5-Bromo-3-[(2,2-dimethoxy-ethylamino)methyl]pyridin-2-ylamine
[0962] According to the procedure of Preparation 132(b), except
substituting aminoacetaldehyde diethyl acetal for the
4-(3-aminopropyl)morpholine, the title compound (1.30 g, 45%) was
prepared as a yellow solid: MS (ESI) m/e 290 (M+H).sup.+.
b)
6-Bromo-3-(2,2-dimethoxy-ethyl)-3,4-dihydro-1H-pyrido[2,3-d]pyrimidin-2-
-one
[0963] According to the procedure of Preparation 130(c), except
substituting
5-bromo-3-[(2,2-dimethoxy-ethylamino)methyl]pyridin-2-ylamine for
5-bromo-3-[(2-dimethylamino-ethyl)methyl]pyridin-2-ylamine, the
title compound (6.40 g, 73%) was prepared as a white solid: MS
(ESI) m/e 316 (M+H).sup.+.
Preparation 136
Preparation of
(E)-3-[6-Amino-5-[(2-morpholin-4-yl-ethylamino)methyl]pyridin-3-yl]acryli-
c acid hydrochloride
a)
(E)-3-[6-Amino-5-(2-morpholin-4-yl-ethylcarbamoyl)pyridin-3-yl]acrylic
acid tert-butyl ester
[0964] According to the procedure of Preparation 130(d), except
substituting 2-amino-5-bromo-N-(2-morpholin-4-yl-ethyl)nicotinamide
for
6-bromo-3-(2-dimethylamino-ethyl)-3,4-dihydro-1H-pyrido[2,3-d]pyrimidin-2-
-one, the title compound (2.48 g, 99%) was prepared as a yellow
solid: .sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 8.30 (d, J=2.4 Hz,
1H), 7.75 (d, J=2.1 Hz, 1H), 7.46 (d, J=15.9 Hz, 1H), 7.02-6.83 (m,
1H), 6.65 (br s, 2H), 6.22 (d, J=15.9, 1H), 3.77-3.69 (m, 4H),
3.56-3.50 (m, 2H), 2.62 (t, J=6.0 Hz, 2H), 2.53 (t, J=4.5 Hz, 4H),
1.53 (s, 9H); MS (ESI) m/e 377 (M+H).sup.+.
b)
(E)-3-[6-Amino-5-(2-morpholin-4-yl-ethylcarbamoyl)-pyridin-3-yl]acrylic
acid hydrochloride
[0965] According to the procedure of Preparation 130(e), except
substituting
(E)-3-[6-amino-5-(2-morpholin-4-yl-ethylcarbamoyl)pyridin-3-yl]acrylic
acid tert-butyl ester for
(E)-3-[3-(2-dimethylamino-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]py-
rimidin-6-yl]acrylic acid tert-butyl ester, the title compound
(2.34 g, 91%) was prepared as a white solid: MS (ESI) m/e 321
(M+H).sup.+.
Preparation 137
Preparation of
(E)-3-(6-Amino-5-morpholin-4-ylmethyl-pyridin-3-yl]acrylic acid
hydrochloride
a) 5-Bromo-3-morpholin-4-ylmethyl-pyridin-2-ylamine
[0966] According to the procedure of Preparation 125(a), except
substituting morpholine for piperidine, the title compound (11.5 g,
97%) was prepared as yellow foam: .sup.1H NMR (300 MHz, CDCl.sub.3)
.delta. 8.04 (d, J=2.4 Hz, 1H), 7.35 (d, J=2.3 Hz, 1H), 5.61 (s,
2H), 3.72-3.69 (m, 4H), 3.42 (s, 2H), 2.44-2.41 (m, 4H).
b) (E)-3-(6-Amino-5-morpholin-4-ylmethyl-pyridin-3-yl]acrylic acid
tert-butyl ester
[0967] According to the procedure of Preparation 125(b), except
substituting 5-bromo-3-morpholin-4-ylmethyl-pyridin-2-ylamine for
5-bromo-3-piperidin-1-ylmethyl-pyridin-2-ylamine, the title
compound (11.3 g, 84%) was prepared as a yellow solid: .sup.1H NMR
(300 MHz, CDCl.sub.3) .delta. 8.11 (d, J=2.2 Hz, 1H), 7.49-7.44 (m,
2H), 6.19 (d, J=15.9 Hz, 1H), 5.89 (s, 2H), 3.72-3.69 (m, 4H), 3.47
(s, 2H), 2.45-2.42 (m, 4H), 1.53 (s, 9H).
c) (E)-3-(6-Amino-5-morpholin-4-ylmethyl-pyridin-3-yl]acrylic acid
hydrochloride
[0968] According to the procedure of Preparation 125(c), except
substituting
(E)-3-(6-amino-5-morpholin-4-ylmethyl-pyridin-3-yl]acrylic acid
tert-butyl ester for
(E)-3-(6-amino-5-piperidin-1-ylmethyl-pyridin-3-yl)acrylic acid
tert-butyl ester, the title compound (12.9 g, quantitative) was
prepared as an off-white solid: MS (ESI) m/z 264 [M+H].sup.+.
Preparation 138
Preparation of
7-Bromo-4-[3-(4-methyl-piperazin-1-yl)-propyl]-1,3,4,5-tetrahydro-pyrido[-
2,3-e][1,4]diazepin-2-one
a) [3-(4-Methyl-piperazin-1-yl)propylamino]acetic acid ethyl
ester
[0969] A solution of 4-(3-aminopropyl)-1-methylpiperazine (3.1 mL,
20 mmol) in MeOH (50 mL) was cooled in an ice bath and treated with
ethyl glyoxylate (-50% solution in toluene, 5.6 mL, 27 mmol) and
AcOH (3 mL). After stirring for 15 min, NaBH.sub.3CN (1.37 g, 21.8
mmol) was added and the mixture was allowed to stir for 7 h while
slowly warming to room temperature. The mixture was diluted with
saturated aqueous NaHCO.sub.3 (150 mL) and then extracted with
EtOAc (3.times.100 mL) followed by CH.sub.2Cl.sub.2 (3.times.100
mL). The combined CH.sub.2Cl.sub.2 layers were dried over
Na.sub.2SO.sub.4, filtered and the solvent was removed in vacuo to
give the title compound (1.81 g, 38%) as a colorless oil: MS (ESI)
m/e 244 (M+H).sup.+.
b)
{(2-Amino-5-bromo-pyridin-3-ylmethyl)-[3-(4-methyl-piperazin-1-yl)propy-
l]amino}acetic acid ethyl ester
[0970] A solution of [3-(4-methyl-piperazin-1-yl)propylamino]acetic
acid ethyl ester (1.80 g, 7.41 mmol) and triethylamine (2.3 mL,
16.4 mmol) in DMF (50 mL) was treated with
5-bromo-3-bromomethyl-pyridin-2-ylamine hydrobromide (2.57 g, 7.41
mmol). After stirring at room temperature for 3 d, the mixture was
diluted with H.sub.2O (100 mL) and then extracted with EtOAc
(4.times.100 mL). The combined organic layers were dried over
Na.sub.2SO.sub.4, filtered and the solvent was removed in vacuo.
Purification by flash column chromatography (silica gel,
CH.sub.2Cl.sub.2/MeOH, 97:3 to 90:10) gave the title compound (0.50
g, 16%) as a colorless oil: MS (ESI) m/e 428 (M+H).sup.+.
c)
7-Bromo-4-[3-(4-methyl-piperazin-1-yl)propyl]-1,3,4,5-tetrahydro-pyrido-
[2,3-e][1,4]diazepin-2-one
[0971] A solution of
{(2-amino-5-bromo-pyridin-3-ylmethyl)-[3-(4-methyl-piperazin-1-yl)propyl]-
amino}acetic acid ethyl ester (0.50 g, 1.17 mmol) in DMSO (10 mL)
was treated with NaH (60% dispersion in mineral oil, 47 mg, 1.17
mmol). After stirring at room temperature for 3 d, the mixture was
diluted with H.sub.2O (30 mL) and then extracted with EtOAc
(4.times.50 mL). The combined organic layers were dried over
Na.sub.2SO.sub.4, filtered and the solvent was removed in vacuo.
Purification by flash column chromatography (silica gel,
CH.sub.2Cl.sub.2,/MeOH, 92:8 to 87:13) gave the title compound
(0.23 g, 51%) as a white solid: MS (ESI) m/e 382 (M+H).sup.+.
Preparation 139
Preparation of
7-Bromo-3,3-dimethyl-1,3,4,5-tetrahydro-pyrido[2,3-e][1,4]diazepin-2-one
a) 2-[(2-Amino-5-bromo-pyridin-3-ylmethyl)amino]-2-methylpropionic
acid methyl ester
[0972] A solution of 5-bromo-3-bromomethyl-pyridin-2-ylamine
hydrobromide (11.0 g, 31.7 mmol) and 2-amino-2-methyl-propionic
acid methyl ester (5.80 g, 49.5 mmol) in DMF (220 mL) was treated
with triethylamine (9.0 mL, 18.5 mmol). After stirring at room
temperature for 3 d, the mixture was diluted with H.sub.2O (400 mL)
and then extracted with EtOAc (4.times.200 mL). The combined
organic layers were washed with H.sub.2O (3.times.100 mL) and brine
(100 mL), dried over Na.sub.2SO.sub.4, filtered and the solvent was
removed in vacuo. Purification by flash column chromatography
(silica gel, CH.sub.2Cl.sub.2/MeOH, 99:1) gave the title compound
(3.87 g, 40%) as a light yellow solid: MS (ESI) m/e 302
(M+H).sup.+.
b)
7-Bromo-3,3-dimethyl-1,3,4,5-tetrahydro-pyrido[2,3-e][1,4]diazepin-2-on-
e
[0973] A solution of
2-[(2-amino-5-bromo-pyridin-3-ylmethyl)amino]-2-methylpropionic
acid methyl ester (2.63 g, 8.71 mmol) in DMSO (100 mL) was treated
with NaH (60% dispersion in mineral oil, 0.35 g, 8.7 mmol). After
stirring at room temperature overnight, the mixture was diluted
with H.sub.2O (200 mL) and then extracted with EtOAc (5.times.150
mL). The combined organic layers were washed with H.sub.2O
(3.times.100 mL) and brine (100 mL), dried over Na.sub.2SO.sub.4,
filtered and the solvent was removed in vacuo. Purification by
flash column chromatography (silica gel, CH.sub.2Cl.sub.2,/MeOH,
99:1 to 98:2) gave (0.79 g, 33%) as an off-white solid: MS (ESI)
m/e 270 (M+H).sup.+.
[0974] The following examples illustrate methods for preparing
compounds of the antibacterial compositions of the present
invention from intermediate compounds such as those described in
the foregoing Preparations.
Example 1
Preparation of
(E)-3-(2-aminopyrimidin-5-yl)-N-(2-methyl-1H-indol-3-ylmethyl)-N-methylac-
rylamide
a) N-Methyl-N-(2-methyl-1H-indol-3-ylmethyl)acrylamide
[0975] To a solution of 2-methyl-3-(methylaminomethyl)indole (1.5
g, 8.6 mmole) and triethylamine (1.7 g, 17.3 mmole) in
CH.sub.2Cl.sub.2 at 5.degree. C. under a nitrogen atmosphere was
added acryloyl chloride (0.86 g, 9.48 mmole). After 1 hr the
reaction solution was poured into H.sub.2O (100 mL) and the layers
were separated. The organic fraction was washed with H.sub.2O (100
mL) followed by brine and then dried over Na.sub.2SO.sub.4.
Concentration under vacuum gave the title compound as an orange oil
which solidified under high vacuum: MS (ES) m/e 457 (2M+H).sup.+.
This material was used without further purification.
b)
(E)-3-(2-Aminopyrimidin-5-yl)-N-(2-methyl-1H-indol-3-ylmethyl)-N-methyl-
acrylamide
[0976] A solution of
N-methyl-N-(2-methyl-1H-indol-3-ylmethyl)acrylamide (1.18 g, 6.5
mmole), 2-amino-5-bromopyrimidine (0.5 g, 2.9 mmole), Pd(OAc).sub.2
(0.11 g, 0.49 mmole), tri-ortho-tolylphosphine (0.17 g, 0.55
mmole), and diisopropylethylamine (1.5 mL, 8.6 mmole) in
propionitrile (100 mL) and DMF (10 mL) was heated at reflux
overnight. The dark mixture was filtered through Celite.RTM., and
the filtrate was concentrated. Flash chromatography on silica gel
(9:1 CHCl.sub.3/CH.sub.3OH containing 5% NH.sub.4OH) gave the title
compound (1.2 g, 65%): MS (ES) m/e 372 (M+H).sup.+.
Example 2
Preparation of
(E)-N-methyl-N-(2-methyl-1H-indol-3-ylmethyl)-3-(3-methyl-2-oxo-1,2,3,4-t-
etrahydropyrido[2,3-d]pyrimidin-6-yl)acrylamide
[0977] According to the procedure of Example 1(b), except
substituting
6-bromo-3-methyl-3,4-dihydro-1H-pyrido[2,3-d]pyrimidin-2-one (1.2
g, 5.0 mmole) for the 2-amino-5-bromopyrimidine, the title compound
(73%) was prepared as a light yellow solid: MS (ES) m/e 390
(M+H).sup.+.
Example 3
Preparation of
(E)-N-methyl-N-(1-methyl-1H-indol-3-ylmethyl)-3-(3-methyl-2-oxo-1,2,3,4-t-
etrahydropyrido[2,3-d]pyrimidin-6-1/1)acrylamide
a) N-Methyl-N-(1-methyl-indol-3-ylmethyl)acrylamide
[0978] According to the procedure of Example 1(a), except
substituting 1-methyl-3-(methylaminomethyl)indole for the
2-methyl-3-(methylaminomethyl)indole, the title compound (1.7 g,
99%) was prepared as an orange oil that solidified under vacuum: MS
(ES) m/e 229 (M+H).sup.+. This material was used without further
purification.
b)
(E)-N-methyl-N-(1-methyl-1H-indol-3-ylmethyl)-3-(3-methyl-2-oxo-1,2,3,4-
-tetrahydropyrido[2,3-d]pyrimidin-6-yl)acrylamide
[0979] According to the procedure of Preparation 1(b), except
substituting N-methyl-N-(1-methyl-indol-3-ylmethyl)acrylamide (1.7
g, 7.5 mmole) for
N-methyl-N-(2-methyl-1H-indol-3-ylmethyl)acrylamide, the title
compound (70%) was prepared as a light yellow solid: MS (ES) m/e
390 (M+H).sup.+.
Example 4
Preparation of
(E)-N-methyl-N-(2-methyl-1H-indol-3-ylmethyl)-3-(2-oxo-2,3-dihydro-1H-pyr-
rolo[2,3-b]pyridin-5-yl)acrylamide
[0980] To a solution of
(E)-3-(2-oxo-2,3-dihydro-1H-indol-5-yl)acrylic acid hydrochloride
salt (0.50 g, 2.1 mmole), hydroxybenzotriazole monohydrate (0.31 g,
2.3 mmole), diisopropylethylamine (0.80 mL, 4.6 mmole), and
2-methyl-3-(methylaminomethyl)indole (0.40 g, 2.3 mmole) in DMF (50
mL) at RT was added EDC (0.46, 2.3 mmole). After 12 hr the reaction
solution was concentrated under vacuum and the residue was purified
by flash chromatography on silica gel (9:1 CHCl.sub.3/CH.sub.3OH
containing 5% NH.sub.4OH) to give the title compound (0.66 g, 88%)
as a light yellow solid: MS (ES) m/e 361 (M+H).sup.+.
Example 5
Preparation of
(E)-3-(3H-imidazo[4,5-b]pyridin-6-yl)-N-methyl-N-(1-methyl-1H-indol-3-ylm-
ethyl)acrylamide
[0981] According to the procedure of Example 4, except substituting
(E)-3-(3H-imidazo[4,5-b]pyridin-6-yl)acrylate (0.14 g, 0.74 mmole),
from Preparation 6, for the
(E)-3-(2-oxo-2,3-dihydro-1H-indol-5-yl)acrylic acid hydrochloride
salt, and substituting 1-methyl-3-(methylaminomethyl)indole (0.14
g, 0.81 mmole) for the 2-methyl-3-(methylaminomethyl)-1H-indole,
the title compound (0.23 g, 89%) was prepared as a light yellow
solid: MS (ES) m/e 346 (M+H).sup.+.
Example 6
Preparation of
(E)-3-(3,4-dihydro-2H-pyrido[3,2-b]-1,4-oxazin-7-yl)-N-methyl-N-(1-methyl-
-1H-indol-3-ylmethyl)acrylamide
[0982] According to the procedure of Example 4, except substituting
(E)-3-(3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)acrylic acid
(0.11 g, 0.53 mmole), from Preparation 7, for the
(E)-3-(2-oxo-2,3-dihydro-1H-indol-5-yl)acrylic acid hydrochloride
salt, and substituting 1-methyl-3-(methylaminomethyl)indole (0.10
g, 0.59 mmole) for the 2-methyl-3-(methylaminomethyl)-1H-indole,
the title compound (0.16 g, 82%) was prepared as a light yellow
solid: MS (ES) m/e 363 (M+H).sup.+.
Example 7
Preparation of
(E)-3-[6-amino-5-[[N-methyl-N-(2-methyl-1H-indol-3-ylmethyl)amino]carbony-
lethyl]pyridin-3-yl]-N-methyl-N-(2-methyl-1H-indol-3-ylmethyl)acrylamide
a) Ethyl
(E)-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylate
[0983] A solution of 6-bromo-3,4-dihydro-1H-1,8-naphthyridin-2-one
(5.0 g, 21.9 mmole), from Preparation 4, ethyl acrylate (3.3 g,
32.9 mmole), Pd(OAc).sub.2 (1.1 g, 0.74 mmole),
tri-ortho-tolylphosphine (1.3 g, 4.4 mmole), and
diisopropylethylamine (11.4 mL, 65.7 mmole) in propionitrile (200
mL) and DMF (25 mL) was heated at reflux overnight. The dark
mixture was filtered through Celite.RTM., and the filtrate was
concentrated. Flash chromatography on silica gel (9:1
CHCl.sub.3/CH.sub.3OH containing 5% NH.sub.4OH) gave the title
compound (3.0 g, 59%) as a light yellow solid: MS (ES) m/e 233
(M+H).sup.+.
b) (E)-3-[6-Amino-5-(2-carboxyethyl)pyridin-3-yl]acrylic acid
hydrochloride salt
[0984] Ethyl
(E)-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylate
(1.54 g, 6.6 mmole) was dissolved in acetic acid (25 mL) and
concentrated hydrochloric acid (25 mL) and the solution was heated
to 100.degree. C. After 6 hr the solution was concentrated and the
residue was dried under high vacuum. The resulting solid was
triturated with diethyl ether and filtered to give a 1.46 g of a
mixture of
(E)-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylic acid
hydrochloride salt (82%) and the title compound (18%), both as
white solids: MS (ES) m/e 218 (M+H).sup.+ (major) and MS (ES) ink
236 (M+H).sup.+ (minor). This mixture was used without further
purification.
c)
(E)-3-[6-Amino-5-[[N-methyl-N-(2-methyl-1H-indol-3-ylmethyl)amino]carbo-
nylethyl]pyridin-3-yl]-N-methyl-N-(2-methyl-1H-indol-3-ylmethyl)acrylamide
[0985] According to the procedure of Example 4, except substituting
a mixture (1.46 g) of
(E)-3-[6-amino-5-(2-carboxyethyl)pyridin-3-yl]acrylic acid
hydrochloride salt and
(E)-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl]acrylic acid
hydrochloride salt for the
(E)-3-(2-oxo-2,3-dihydro-1H-indol-5-yl)acrylic acid hydrochloride
salt, the title compound (0.47 g) was prepared as a light yellow
solid: MS (ES) m/e 549 (M+H).sup.+.
(E)-N-Methyl-N-(2-methyl-1H-indol-3-ylmethyl)-3-(7-oxo-5,6,7,8-tetrahydro-
-1,8-naphthyridin-3-yl)acrylamide (1.56 g) was also obtained as a
light yellow solid: MS (ES) m/e 375 (M+H).sup.+.
Example 8
Preparation of
(E)-3-(6-aminopyridin-3-yl)-N-(1-ethyl-1H-indol-3-ylmethyl)-N-methylacryl-
amide
[0986] EDC (0.56 g, 2.93 mmole) was added to a solution of
(E)-3-(6-aminopyridin-3-yl)acrylic acid (0.48 g, 2.93 mmole),
1-ethyl-3-(methylaminomethyl)-1H-indole (0.50 g. 2.66 mmole), HOBt
H.sub.2O (0.40 g, 2.93 mmole) and diisopropylethylamine (0.93 mL,
5.32 mmole) in DMF (30 mL) at RT. The reaction was stirred
overnight then was concentrated in vacuo. The residue was diluted
with water and extracted with ethyl acetate. The combined organic
extracts were washed with brine and dried over Na.sub.2SO.sub.4.
Flash chromatography on silica gel (10% MeOH/CHCl.sub.3) gave title
compound (0.46 g, 52%) as a yellow solid after drying in vacuo: MS
(ES) m/e 335 (M+H).sup.+.
Example 9
Preparation of
(E)-3-(6-aminopyridin-3-yl)-N-(1-isopropyl-1H-indol-3-ylmethyl)-N-methyla-
crylamide
[0987] EDC (0.51 g, 2.64 mmole) was added to a solution of
(E)-3-(6-aminopyridin-3-yl)acrylic acid (0.43 g, 2.64 mmole),
1-isopropyl-3-(methylaminomethyl)indole (0.49 g, 2.40 mmole),
HOBt.H.sub.2O (0.36 g, 2.64 mmole) and diisopropylethylamine (0.84
mL 4.80 mmole) in DMF (40 mL) at RT. The reaction was stirred
overnight then was concentrated in vacuo. The residue was diluted
with water and extracted with ethyl acetate. The combined organic
extracts were washed with brine and dried over Na.sub.2SO.sub.4.
Flash chromatography on silica gel (10% MeOH/CHCl.sub.3) gave the
title compound (0.49 g, 58%) as a yellow solid after drying in
vacuo: MS (ES) m/e 349 (M+H).sup.+.
Example 10
Preparation of
(E)-3-(6-aminopyridin-3-yl)-N-(1H-indol-3-ylmethyl)-N-methylacrylamide
[0988] EDC (1.03 g, 5.40 mmole) was added to a solution of
(E)-3-(6-aminopyridin-3-yl)acrylic acid (0.89 g, 5.40 mmole),
1-acetyl-3-(methylaminomethyl)indole (1.00 g, 4.95 mmole),
HOBt.H.sub.2O (0.73 g., 5.40 mmole) and diisopropylethylamine (1.72
mL, 9.90 mmole) in DMF (50 mL) at RT. The reaction was stirred
overnight then was concentrated in vacuo. The residue was diluted
with water and extracted with ethyl acetate. The combined organic
extracts were washed with brine and dried over Na.sub.2SO.sub.4.
Flash chromatography on silica gel (5% MeOH/CHCl.sub.3) gave the
title compound (0.90 g, 52%) as a light yellow solid after drying
in vacuo: MS (ES) m/e 307 (M+H).sup.+.
Example 11
Preparation of
(E)-N-(1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naph-
thyridin-3-yl)acrylamide
[0989] A solution of 6-bromo-3,4-dihydro-1H-1,8-naphthyridin-2-one
(0.64 g, 2.80 mmole), N-(1H-indol-3-ylmethyl)-N-methylacrylamide
(0.60 g, 2.80 mmole), Pd(OAc).sub.2 (0.06 g, 0.28 mmole),
tri-ortho-tolylphosphine (0.17 g, 0.56 mmole) and
diisopropylethylamine (0.73 mL, 4.2 mmole) in propionitrile (50 mL)
was deoxygenated, then was heated to reflux under N.sub.2
overnight. The dark mixture was filtered through a pad of
Celite.RTM., and the filter pad was rinsed with acetonitrile (250
mL). The filtrate was concentrated in vacuo, and the residue was
purified by flash chromatography on silica gel (10%
MeOH/CHCl.sub.3). The title compound (0.37 g, 37%) was obtained as
a light yellow solid after drying in vacuo: MS (ES) m/e 361
(M+H).sup.+.
Example 12
Preparation of
(E)-N-(1-benzyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-
-1,8-naphthyridin-3-yl)acrylamide
[0990] A solution of 6-bromo-3,4-dihydro-1H-1,8-naphthyridin-2-one
(1.05 g, 4.60 mmole),
N-(1-benzyl-1H-indol-3-ylmethyl)-N-methyl-acrylamide (1.40 g, 4.60
mmole), Pd(OAc).sub.2 (0.10 g, 0.46 mmole),
tri-ortho-tolylphosphine (0.28 g, 0.92 mmole) and
diisopropylethylamine (1.20 mL 6.90 mmole) in propionitrile (75 mL)
was deoxygenated, then was and heated to reflux under a N.sub.2
overnight. The dark mixture was filtered through a pad of
Celite.RTM., and the filter pad was rinsed with acetonitrile (300
mL). The filtrate was concentrated in vacuo, and the residue was
purified by flash chromatography on silica gel (5%
MeOH/CHCl.sub.3). The title compound (0.70 g. 35%) was obtained as
a light yellow solid after drying in vacuo: MS (ES) m/e 451
(M+H).sup.+.
Example 13
Preparation of
(E)-N-[1-(2-dimethylaminoethyl)-1H-indol-3-ylmethyl]-N-methyl-3-(7-oxo-5,-
6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylamide
[0991] A solution of 6-bromo-3,4-dihydro-1H-1,8-naphthyridin-2-one
(0.61 g, 2.70 mmole),
N-[1-(2-dimethylaminoethyl)-1H-indol-3-ylmethyl]-N-methyl-acrylamide
(1.00 g, 3.50 mmole), Pd(OAc).sub.2 (0.08 g, 0.35 mmole),
tri-ortho-tolylphosphine (0.21 g, 0.70 mmole), and
diisopropylethylamine (0.91 mL, 5.25 mmole) in propionitrile (70
mL) was deoxygenated, then was and heated to reflux under a N.sub.2
overnight. The dark mixture was filtered through a pad of
Celite.RTM., and the filter pad was rinsed with acetonitrile (250
mL). The filtrate was concentrated in vacuo, and the residue was
purified by flash chromatography on silica gel (10% MeOH/CHCl.sub.3
containing 5% NH.sub.4OH in the MeOH). The title compound (0.20 g.
13%) was obtained as a light yellow solid after drying in vacuo: MS
(ES) m/e 432 (M+H).sup.+.
Example 14
Preparation of
(E)-N-methyl-3-(8-oxo-6,7,8,9-tetrahydro-5H-pyrido[2,3-b]azepin-3-yl)acry-
lamide
[0992] A solution of
3-bromo-5,6,7,9-tetrahydro-pyrido[2,3-b]azepin-8-one (0.60 g, 2.50
mmole), N-(2-methyl-1H-indol-3-ylmethyl)-N-methylacrylamide (0.85
g, 3.75 mmole), Pd(OAc).sub.2 (0.06 g, 0.25 mmole),
tri-ortho-tolylphosphine (0.15 g, 0.50 mmole) and
diisopropylethylamine (0.87 mL, 5.00 mmole) in propionitrile (50
mL) was deoxygenated, then was and heated to reflux under a N.sub.2
overnight. The dark mixture was filtered through a pad of
Celite.RTM., and the filter pad was rinsed with acetonitrile (200
mL). The filtrate was concentrated in vacuo, and the residue was
purified by flash chromatography on silica gel (10%
MeOH/CHCl.sub.3). The title compound (0.35 g. 35%) was obtained as
a light tan solid after drying in vacuo: MS (ES) m/e 246
(M+H).sup.+.
Example 15
Preparation of
(E)-N-methyl-N-(1-methyl-1H-indol-3-ylmethyl)-3-[6-(pyridin-2-ylamino)pyr-
idin-3-yl]acrylamide
a) N-(1-methyl-1H-indol-3-ylmethyl)-N-methylacrylamide
[0993] To a stirred solution of
1-methyl-3-(methylaminomethyl)-1H-indole (1.0 g, 5.7 mmole) and
Et.sub.3N (0.8 mL, 5.7 mmole) in CH.sub.2Cl.sub.2 (50 mL) at
0.degree. C. was added acryloyl chloride (0.47 mL, 5.8 mmole) in
one portion. After stirring for 1 h the reaction was washed with
cold H.sub.2O and brine, then was dried (MgSO.sub.4) and
concentrated under vacuum. This material was used without further
purification.
b)
(E)-N-Methyl-N-(1-methyl-1H-indol-3-ylmethyl)-3-[6-(pyridin-2-ylamino)p-
yridin-3-yl]acrylamide
[0994] To a solution of
N-(1-methyl-1H-indol-3-ylmethyl)-N-methylacrylamide, from Example
1(a), in propionitrile (50 mL) was added
5-bromo-2,2'-dipyridylamine (1.2 g, 4.8 mmole), DIEA (1.8 mL, 10.3
mmole), Pd(OAc).sub.2 (112 mg, 0.5 mmole), and P(o-tol).sub.3 (304
mg, 1 mmole). The reaction was purged with Ar then stirred at
reflux for 16 h. After cooling to room temperature the reaction was
concentrated to dryness under vacuum. Flash chromatography on
silica gel (3% (5% NH.sub.4OH/MeOH)/CHCl.sub.3), trituration with
1:1 Et.sub.2O/petroleum ether, filtration, and drying under vacuum
gave the title compound (1.24 g, 65%) as an off-white solid: MS
(ES) m/e 398.2 (M+H).sup.+.
Example 16
Preparation of
(E)-N-methyl-N-(2-methylbenzo[b]thiophen-3-ylmethyl)-3-(7-oxo-5,6,7,8-tet-
rahydro-1,8-naphthyridin-3-yl)acrylamide
a) N-(Benzo[b]thiophen-3-ylmethyl)-N-methylacrylamide
[0995] According to the procedure of Example 15 (a), except
substituting 2-methyl-3-(methylaminomethyl)benzo[b]thiophene (1.0
g, 5.2 mmole) for 1-methyl-3-(methylaminomethyl)-1H-indole, the
title compound was prepared. This was used without further
purification.
b)
(E)-N-Methyl-N-(2-methylbenzo[b]thiophen-3-ylmethyl)-3-(7-oxo-5,6,7,8-t-
etrahydro-1,8-naphthyridin-3-yl)acrylamide
[0996] According to the procedure of Example 15 (b), except
substituting 6-bromo-3,4-dihydro-1H-1,8-naphthyridin-2-one (1.3 g,
5.7 mmole) for the 5-bromo-2,2'-dipyridylamine, the title compound
(0.849 g, 42%) was prepared as a white solid: MS (ES) m/e 392.2
(M+H).sup.+.
Example 17
Preparation of
(E)-N-methyl-N-(1-methyl-1H-indol-2-ylmethyl)-3-[6-(N-(methylaminocarbony-
lmethyl)amino]pyridin-3-yl)acrylamide
a) N-(1-methyl-1H-indol-2-ylmethyl)-N-methylacrylamide
[0997] According to the procedure of Example 15 (a), except
substituting 1-methyl-2-(methylaminomethyl)-1H-indole (1.2 g, 6.9
mmole) for the 1-methyl-3-(methylaminomethyl)-1H-indole, the title
compound was prepared. This was used without further
purification.
b)
(E)-N-Methyl-N-(1-methyl-1H-indol-2-ylmethyl)-3-[6-[N-(methylaminocarbo-
nylmethyl)amino]pyridin-3-yl]acrylamide
[0998] According to the procedure of Example 15 (b), except
substituting 5-bromo-2-(methylaminocarbonylmethyl)aminopyridine
(1.5 g, 6.2 mmole) for the 5-bromo-2,2'-dipyridylamine, the title
compound (1.7 g, 72%) was prepared as a white solid: MS (ES) m/e
392.2 (M+H).sup.+.
Example 18
Preparation of
(E)-3-(6-amino-5-(methoxycarbonyl)pyridin-3-yl)-N-(1-methyl-1H-indol-3-yl-
methyl)-N-methylacrylamide
a) N-(1-methyl-1H-indol-2-ylmethyl)-N-methylacrylamide
[0999] According to the procedure of Example 15 (a), except
substituting 1-methyl-2-(methylaminomethyl)-1H-indole (1.2 g, 6.9
mmole) for the 1-methyl-3-(methylaminomethyl)-1H-indole, the title
compound was prepared. This was used without further
purification.
b)
(E)-3-(6-Amino-5-(methoxycarbonyl)pyridin-3-yl)-N-(1-methyl-1H-indol-3--
ylmethyl)-N-methylacrylamide
[1000] According to the procedure of Example 15 (b), except
substituting methyl 2-amino-5-bromonicotinate (1.4 g, 6.1 mmole)
for the 5-bromo-2,2'-dipyridylamine, the title compound (1.78 g,
77%) was prepared as a white solid: MS (ES) m/e 379.2
(M+H).sup.+.
Example 19
Preparation of
(E)-3-[6-IN-(methoxycarbonylmethyl)amino]pyridin-3-yl)-N-methyl-N-(2-meth-
yl-1H-indol-3-ylmethyl)acrylamide
[1001] To a stirred solution of
(E)-3-[6-[N-(methoxycarbonylmethyl)amino]pyridin-3-yl]acrylic acid
hydrochloride salt (2.0 g, 7.3 mmole) in 1:1 DMF/CH.sub.2Cl.sub.2
(100 mL) was added 2-methyl-3-(methylaminomethyl)indole (1.3 g, 7.5
mmole), Et.sub.3N (2.1 mL, 15 mmole), and HOBt.H.sub.2O (1.0 g, 7.4
mmole), followed by EDC (1.4 g, 7.3 mmole). After stirring at room
temperature for 18 h the reaction was concentrated to dryness. The
residue was taken up in EtOAc, and the solution was washed with
H.sub.2O then brine, dried (Na.sub.2SO.sub.4), and concentrated
under vacuum. The remaining residue was purified by flash
chromatography on silica gel (4% MeOH/CHCl.sub.3) to give the title
compound (2.08 g, 73%) as an off-white solid: MS (ES) m/e 393.2
(M+H).sup.+.
Example 20
Preparation of
(E)-3-[6-[N-(carboxymethyl)amino]pyridin-3-yl]-N-methyl-N-(2-methyl-1H-in-
dol-3-ylmethyl)acrylamide
[1002] To a stirred solution of
(E)-3-[6-[N-(methoxycarbonylmethyl)amino]pyridin-3-yl]-N-methyl-N-(2-meth-
yl-1H-indol-3-ylmethyl)acrylamide (0.5 g, 1.3 mmole) in dioxane (30
mL) was added 1 N NaOH (2 mL, 2 mmole). After stirring for 18 h the
reaction was neutralized with 1 N HCl (2 mL, 2 mmole) and
concentrated to near dryness. The resulting suspension was diluted
with H.sub.2O and filtered. The solid was washed with H.sub.2O and
dried under vacuum to give the title compound (505 mg, 100%) as a
off-white solid: MS (ES) m/e 379.2 (M+H).sup.+.
Example 21
Preparation of
(E)-N-methyl-N-(2-methyl-1H-indol-3-ylmethyl)-3-[6-[N-(methylaminocarbony-
lmethyl)amino]pyridin-3-yl]acrylamide
[1003] To
(E)-3-[6-[N-(methoxycarbonylmethyl)amino]pyridin-3-yl]-N-methyl--
N-(2-methyl-1H-indol-3-ylmethyl)acrylamide (0.7 g, 1.8 mmole) was
added a solution of 2.0 M methylamine in MeOH (50 mL). After
stirring for 72 h the reaction was concentrated to dryness. The
residue was triturated with Et.sub.2O, filtered, and dried under
vacuum to give the title compound (0.703 g, 100%) as an off-white
solid: MS (ES) m/e 392.2 (M+H).sup.+.
Example 22
Preparation of
(E)-3-(2-aminopyrimidin-5-yl)-N-methyl-N-(1-methyl-1H-pyrrolo[2,3-b]pyrid-
in-3-ylmethyl)acrylamide
[1004] A solution of 2-amino-5-bromopyrimidine (0.27 g, 1.55
mmole),
N-methyl-N-(1-methyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)acrylamide
(0.5 g, 2.33 mmole), Pd(OAc).sub.2 (0.037 g, 0.163 mmole),
P(o-tolyl).sub.3 (0.085 g, 0.28 mmole), and (i-Pr).sub.2NEt (0.42
mL, 2.33 mmole) in propionitrile (20 mL) was degassed then heated
to reflux. After 18 hr the mixture was cooled to RT and
concentrated. Flash chromatography on silica gel (10%
MeOH/CH.sub.2Cl.sub.2) gave the title compound (0.100 g, 18%): MS
(ES) m/e 363 (M+H).sup.+.
Example 23
Preparation of
(E)-N-methyl-N-(1-methyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-3-(7-oxo-5,-
6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylamide
[1005] According to the procedure of Example 22, except
substituting 6-bromo-3,4-dihydro-1H-1,8-naphthyridin-2-one (0.352
g, 1.55 mmole) for the 2-amino-5-bromopyrimidine, the title
compound (0.14 g, 16%) was prepared as a white powder: MS (ES) m/e
376 (M+H).sup.+.
Example 24
Preparation of
(E)-N-(2,3-dihydro-1H-3a-azacyclopenta[a]indene-8-ylmethyl)-N-methyl-3-(7-
-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylamide
[1006] EDC (0.192 g, 1.0 mmole) was added to a solution of
(E)-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylic acid
hydrochloride salt (0.254 g, 1.0 mmole),
2,3-dihydro-8-(methylaminomethyl)-1H-3a-azacyclopenta[a]indene (0.2
g, 1.0 mmole), HOBt.H.sub.2O (0.135 g, 1.0 mmole), and Et.sub.3N
(0.15 mL, 1.1 mmole) in DMF (20 mL) at RT. The reaction was stirred
overnight, then was poured into H.sub.2O (50 mL) and extracted with
CH.sub.2Cl.sub.2 (2.times.30 mL). The combined extracts were washed
with brine and dried (MgSO.sub.4). Flash chromatography on silica
gel (5% MeOH/CH.sub.2Cl.sub.2) gave the title compound (0.1 g, 25%)
a yellow solid: MS (ES) m/e 401 (M+H).sup.+.
Example 25
Preparation of
(E)-N-(1-ethyl-5-fluoro-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-te-
trahydro-1,8-naphthyridin-3-yl)acrylamide
[1007] According to the procedure of Example 24, except
substituting (1-ethyl-5-fluoro-3-(methylaminomethyl)-1H-indole (0.1
g, 0.49 mmole) for the
2,3-dihydro-8-(methylaminomethyl)-1H-3a-azacyclopenta[a]indene, the
title compound (0.028 g, 15%) was prepared as a white powder: MS
(ES) m/e 407 (M+H).sup.+.
Example 26
Preparation of
(E)-N-(5-fluoro-1-methyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-t-
etrahydro-1,8-naphthyridin-3-yl)acrylamide
[1008] According to the procedure of Example 24, except
substituting 5-fluoro-1-methyl-3-(methylaminomethyl)-1H-indole
(0.13 g, 0.67 mmole) for the
2,3-dihydro-8-(methylaminomethyl)-1H-3a-azacyclopenta[a]indene, the
title compound (0.1 g, 37%) was prepared as a slightly yellow
crystalline solid: MS (ES) m/e 393 (M+H).sup.+.
Example 27
Preparation of
(E)-N-(5-fluoro-1-methyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-t-
etrahydro-1,8-naphthyridin-3-yl)acrylamide
[1009] According to the procedure of Example 24, except
substituting 6-fluoro-1-methyl-3-(methylaminomethyl)-1H-indole
(0.12 g, 0.59 mmole) for the
2,3-dihydro-8-(methylaminomethyl)-1H-3a-azacyclopenta[a]indene, the
title compound (0.1 g, 43%) was prepared as a white crystalline
solid: MS (ES) We 393 (M+H).sup.+.
Example 28
Preparation of
(E)-N-(7-fluoro-1-methyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-t-
etrahydro-1,8-naphthyridin-3-yl)acrylamide
[1010] According to the procedure of Example 24, except
substituting 7-fluoro-1-methyl-3-(methylaminomethyl)-1H-indole
(0.18 g, 0.93 mmole) for the
2,3-dihydro-8-(methylaminomethyl)-1H-3a-azacyclopenta[a]indene, the
title compound (0.1 g, 27%) was prepared as a white powder: MS (ES)
m/e 393 (M+H).sup.+.
Example 29
Preparation of
(E)-3-(6-aminopyridin-3-yl)-N-(6-fluoro-1-methyl-1H-indol-3-ylmethyl)-N-m-
ethylacrylamide
[1011] According to the procedure of Example 24, except
substituting 6-fluoro-1-methyl-3-(methylaminomethyl)-1H-indole
(0.11 g, 0.59 mmole) for the
2,3-dihydro-8-(methylaminomethyl)-1H-3a-azacyclopenta[a]indene, and
substituting (E)-3-(6-amino-pyridin-3-yl)acrylic acid (0.098 g,
0.59 mmole) for the
(E)-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylic acid
hydrochloride salt, the title compound (0.1 g, 27%) was prepared as
a white powder: MS (ES) m/e 339 (M+H).sup.+.
Example 30
Preparation of
(E)-3-(6-aminopyridin-3-yl)-N-(4,6-dichloro-1-methyl-1H-indol-2-ylmethyl)-
-N-methylacrylamide
[1012] EDC (84.4 mg, 0.44 mmole) was added all at once to a
solution of (E)-3-(6-amino-pyridin-3-yl)acrylic acid (65.7 mg, 0.40
mmole), 4,6-dichloro-1-methyl-2-(methylaminomethyl)-1H-indole
(107.0 mg, 0.44 mmole), HOBt.H.sub.2O (59.5 mg, 0.44 mmole), and
Et.sub.3N (0.14 mL, 1.0 mmole) in anhydrous DMF (4 mL) at RT. After
17 hr, the reaction was concentrated to dryness and the residue was
re-concentrated from CHCl.sub.3/xylenes (2.times.). Flash
chromatography on silica gel (7% MeOH in 1:1 EtOAc/CHCl.sub.3) gave
the R.sub.f 0.44 component (10% MeOH in 1:1 EtOAc/CHCl.sub.3) as a
foam. This was solidified by re-concentration from
MeOH/EtOAc/CHCl.sub.3 several times. This material was triturated
with hot EtOAc/MeOH, and the mixture was cooled to 0.degree. C. The
title compound was collected by suction filtration. The filtrate
was concentrated and the residue was triturated with EtOAc to
afford additional title compound. The combined desired solids were
dried in high vacuum at 50-60.degree. C. to afford the title
compound (108.9 mg, 70%) as a light yellow solid: .sup.1H NMR (400
MHz, CDCl.sub.3) 1.8:1 mixture of amide rotamers; .delta.8.08-8.20
(2.times.s, 1H), 7.70-7.90 (2.times.d, 1H), 7.57-7.70 (2.times.s,
1H), 7.46 (d, J=15.2 Hz, 1H), 7.18 (s, 1H), 6.97 (d, J=15.2 Hz,
1H), 6.45 and 6.15 (2.times.m, 4H), 5.02 and 4.82 (2.times.s, 2H),
3.60-3.80 (2.times.s, 3H), 2.99 and 3.11 (2.times.s, 3H); MS (ES)
m/e 239 and 391 (M+H).sup.+.
Example 31
Preparation of
(E)-3-(6-aminopyridin-3-yl)-N-(1,4-dimethyl-1H-indole-3-ylmethyl)-N-methy-
lacrylamide
[1013] To a stirred solution of
1,4-dimethyl-3-(methylaminomethyl)-1H-indole (188.2 mg, 1 mmole)
and (E)-3-(6-aminopyridin-3-yl)acrylic acid (164 mg, 1 mmole) in
dry DMF (12 mL) containing dry Et.sub.3N (4 mL) was added
HOBt.H.sub.2O (153 mg, 1 mmole) and EDC (191.8 mg, 1 mmole). The
reaction was stirred overnight under argon at ambient temperature,
then was concentrated in vacuo. The residue was partitioned between
EtOAc and 5% NaHCO.sub.3 solution, and the layers were separated.
The organic layer was washed with brine, dried (MgSO.sub.4),
filtered, and concentrated. Flash chromatography on silica gel
afforded the title compound (120 mg, 36%) as a white solid: MS (ES)
m/e 335.2 (M+H).sup.+. Anal. Calcd for
C.sub.20H.sub.22N.sub.4O.0.25H.sub.2O: C, 70.88; H, 6.69; N, 16.53.
Found: C, 71.11; H, 6.72; N, 16.36.
Example 32
Preparation of
(E)-3-(6-aminopyridin-3-yl)-N-(4-methoxy-1-methyl-1H-indol-3-ylmethyl)-N--
methylacrylamide
[1014] According to the procedure of Example 31, except
substituting 4-methoxy-1-methyl-3-(methylaminomethyl)-1H-indole for
the 1,4-dimethyl-3-(methylaminomethyl)-indole, the title compound
(100 mg, 29%) was obtained as a light yellow solid: MS (ES) m/e
351.2 (M+H).sup.+. Anal. Calcd for
C.sub.20H.sub.22N.sub.4O.sub.2.0.25H.sub.2O: C, 67.68; H, 6.39; N,
15.79. Found: C, 67.31; H, 6.21; N, 15.97.
Example 33
Preparation of
(E)-3-(6-aminopyridin-3-yl)-N-(5-methoxy-1-methyl-1H-indol-3-ylmethyl)-N--
methylacrylamide
[1015] According to the procedure of Example 31, except
substituting 5-methoxy-1-methyl-3-(methylaminomethyl)-1H-indole for
the 1,4-dimethyl-3-(methylaminomethyl)-1H-indole, the title
compound (110 mg, 31%) was obtained as a light tan solid: MS (ES)
m/e 351.2 (M+H).sup.+. Anal. Calcd for
C.sub.20H.sub.22N.sub.4O.sub.2.0.75H.sub.2O: C, 66.01; H, 6.51; N,
15.39. Found: C, 65.83; H, 6.29; N, 15.60.
Example 34
Preparation of
(E)-3-(6-aminopyridin-3-yl)-N-(7-chloro-1H-indol-3-ylmethyl)-N-methylacry-
lamide
[1016] According to the procedure of Example 31, except
substituting 7-chloro-1-methyl-3-(methylaminomethyl)-1H-indole for
the dimethyl-3-(methylaminomethyl)-1H-indole, the title compound
(180 mg, 52%) as obtained as a yellow solid: MS (ES) m/e 355.2
(M+H).sup.+. Anal. Calcd for
C.sub.19H.sub.19ClN.sub.4O.0.25H.sub.2O: C, 63.51; H, 5.47; N,
15.59. Found: C, 63.55; H, 5.32; N, 15.68.
Example 35
Preparation of
(E)-3-(6-aminopyridin-3-yl)-N-(7-methoxy-1-methyl-1H-indol-3-ylmethyl)-N--
methylacrylamide
[1017] According to the procedure of Example 31, except
substituting 7-methoxy-1-methyl-3-(methylaminomethyl)-1H-indole for
the 1,4-dimethyl-3-(methylaminomethyl)-1H-indole, the title
compound (140 mg, 40%) was obtained as a tan solid: MS (ES) m/e
351.2 (M+H).sup.+. Anal. Calcd for
C.sub.20H.sub.22N.sub.4O.sub.2.0.5H.sub.2O: C, 66.83; H, 6.45; N,
15.58.
[1018] Found: C, 66.81; H, 6.41; N, 15.19.
Example 36
Preparation of
(E)-3-(6-aminopyridin-3-yl)-N-(6-chloro-1H-indol-3-ylmethyl)-N-methylacry-
lamide
[1019] According to the procedure of Example 31, except
substituting 6-chloro-1-methyl-3-(methylaminomethyl)-1H-indole for
the 1,4-dimethyl-3-(methylaminomethyl)-1H-indole, the title
compound (176 mg, 50%) was obtained as a yellow solid: MS (ES) m/e
355.2 (M+H).sup.+. Anal. Calcd for
C.sub.19H.sub.19ClN.sub.4O.0.5H.sub.2O: C, 62.72; H, 5.54; N,
15.40. Found: C, 62.79; H, 5.20; N, 15.85.
Example 37
Preparation of
(E)-3-(6-aminopyridin-3-yl)-N-(5-chloro-1H-indol-3-ylmethyl)-N-methylacry-
lamide
[1020] According to the procedure of Example 31, except
substituting 5-chloro-1-methyl-3-(methylaminomethyl)-1H-indole for
the 1,4-dimethyl-3-(methylaminomethyl)-1H-indole the title compound
was obtained as a tan solid (176 mg, 54%): MS (ES) m/e 355.2
(M+H).sup.+. Anal. Calcd for
C.sub.19H.sub.19ClN.sub.4O.0.25H.sub.2O: C, 63.51; H, 5.47; N,
15.59. Found: C, 63.63; H, 5.84; N, 15.83.
Example 38
Preparation of
(E)-3-(6-aminopyridin-3-yl)-N-(4-chloro-1H-indol-3-ylmethyl)-N-methylacry-
lamide
[1021] According to the procedure of Example 31, except
substituting 4-Chloro-1-methyl-3-(methylaminomethyl)-1H-indole for
the 1,4-dimethyl-3-(methylaminomethyl)-indole the title compound
was obtained as a tan solid (150 mg, 42%): MS (ES) m/e 355.2
(M+H).sup.+. Anal. Calcd for
C.sub.19H.sub.19ClN.sub.4O.0.25H.sub.2O: C, 63.51; H, 5.47; N,
15.59. Found: C, 63.33; H, 5.38; N, 15.34.
Example 39
Preparation of
(E)-3-(6-aminopyridin-3-yl)-N-(3,3-dimethyl-3H-indene-1-ylmethyl)-N-methy-
lacrylamide
[1022] According to the procedure of Example 31, except
substituting 1,1-dimethyl-3-(methylaminomethyl)-3H-indene for the
1,4-dimethyl-3-(methylaminomethyl-1H-indole, the title compound (43
mg, 13%) was obtained as a white solid: MS (ES) m/e 334.2
(M+H).sup.+. Anal. Calcd for C.sub.21H.sub.23N.sub.3O.
0.75H.sub.2O: C, 72.70; H, 7.12; N, 12.11. Found: C, 72.38; H,
6.80; N, 11.69.
Example 40
Preparation of
(E)-3-(6-aminopyridin-3-yl)-N-(7-hydroxy-1-methyl-1H-indol-3-ylmethyl)-N--
methylacrylamide
[1023] According to the procedure of Example 31, except
substituting 7-hydroxy-1-methyl-3-(methylaminomethyl)-1H-indole for
the 1,4-dimethyl-3-(methylaminomethyl)-1H-indole, the title
compound was obtained as a tan solid (60 mg, 17.9%): MS (ES) m/e
337.2 (M+H).+-.. Anal. Calcd for
C.sub.19H.sub.20H.sub.4O.sub.2.1.0H.sub.2O: C, 64.39; H, 6.26; N,
15.81. Found: C, 63.99; H, 5.78; N, 15.54.
Example 41
Preparation of
(E)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)-N-(1,2,7--
trimethyl-1H-indol-3-ylmethyl)-acrylamide
a) N-Methyl-N-(1,2,7-trimethyl-1H-indol-3-ylmethyl)acrylamide
[1024] To a cold solution (ice bath) of
3-(methylaminomethyl)-1,2,7-trimethyl-1H-indole (570 mg, 2.8 mmole)
in dry CH.sub.2Cl.sub.2 (24 mL) was added dry Et.sub.3N (0.25 mL,
2.9 mmole). The reaction was stirred in the cold under argon for 2
h then was poured into H.sub.2O (40 mL). The layers were separated,
and the organic layer was washed with brine, dried (MgSO.sub.4),
filtered, and concentrated. The title compound (0.7 g, 97%) was
obtained as a light orange solid: MS (ES) m/e 257.2
(M+H).sup.+.
b)
(E)-N-Methyl-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)-N-(1,2,-
7-trimethyl-1H-indol-3-ylmethyl)-acrylamide
[1025] A mixture of
N-methyl-N-(1,2,7-trimethyl-1H-indol-3-ylmethyl)acrylamide (256 mg,
1 mmole) and 6-bromo-3,4-dihydro-1H-1,8-naphthyridin-2-one (227 mg,
1 mmole) in propionitrile (20 mL) was treated with DIEA (0.3 mL),
Pd(OAc).sub.2 (29 mg, 0.13 mmole), and tri-o-tolylphosphine (50 mg,
0.16 mmole). The reaction was heated at reflux under argon for 10
h, then was cooled to RT and filtered through supercel. The
filtrate was concentrated and the residue was purified by flash
chromatography on silica gel to afford the title compound (100 mg,
25%) as an off-white solid: MS (ES) m/e 403.2 (M+H).sup.+. Anal.
Calcd for C.sub.24H.sub.26N.sub.4O.sub.2. 2.75H.sub.2O: C, 63.77;
H, 7.02; N, 12.39. Found: C, 63.81; H, 7.25; N, 11.90.
Example 42
Preparation of
(E)-N-(7-chloro-1-methyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-t-
etrahydro-1,8-naphthyridin-3-yl)-acrylamide
[1026] A solution of
7-chloro-1-methyl-3-(methylaminomethyl)-1H-indole (104.3 mg, 0.5
mmole) and
(E)-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)-acrylic acid
(109.1 mg, 0.5 mmole) in dry DMF (8 mL) was treated with dry
Et.sub.3N (0.2 mL), HOBt H.sub.2O (76.5 mg, 0.5 mmole) and EDC (96
mg, 0.5 mmole). The solution was stirred at RT under argon for 20
h, then was concentrated. The oily residue was dissolved in MeOH
and the solution was cooled. The precipitated solid was collected,
washed with cold MeOH, and dried to give the title compound (95 mg,
47%): MS (ES) m/e 409.2 (M+H).sup.+. Anal. Calcd for
C.sub.22H.sub.21ClN.sub.4O.sub.2.0.25H.sub.2O: C, 63.92; H, 5.24;
N, 13.55. Found: C, 63.56; H, 5.14; N, 13.73.
Example 43
Preparation of
(E)-N-(7-chloro-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-
-1,8-naphthyridin-3-yl)-acrylamide
[1027] According to the procedure of Example 42, except
substituting 7-chloro-3-(methylaminomethyl)-1H-indole for the
7-chloro-1-methyl-3-(methylaminomethyl)-1H-indole, the title
compound (25 mg, 13%) was obtained as an off white solid after
chromatography on silica gel: MS (ES) m/e 395.0 (M+H).sup.+
Example 44
Preparation of
(E)-2,N-dimethyl-N-(2-methyl-1H-indol-3-ylmethyl)-3-(7-oxo-5,6,7,8-tetrah-
ydro-1,8-naphthyridin-3-yl)acrylamide
[1028] According to the procedure of Example 4, except substituting
(E)-2-methyl-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl]acrylic
acid hydrochloride salt (0.50 g, 1.8 mmole) for the
(E)-3-(2-oxo-2,3-dihydro-1H-indol-5-yl)acrylic acid hydrochloride
salt, the title compound (0.64 g, 89%) was prepared as a light
yellow solid: MS (ES) m/e 389 (M+H).sup.+.
Example 45
Preparation of
(E)-3,N-dimethyl-N-(2-methyl-1H-indol-3-ylmethyl)-3-(7-oxo-5,6,7,8-tetrah-
ydro-1,8-naphthyridin-3-yl)acrylamide
[1029] According to the procedure of Example 1, except substituting
(E)-3-methyl-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl]acrylic
acid hydrochloride salt (0.50 g, 1.8 mmole) for the
(E)-3-(2-oxo-2,3-dihydro-1H-indol-5-yl)acrylic acid hydrochloride
salt, the title compound (0.67 g, 92%) was prepared as a light
yellow solid: MS (ES) m/e 389 (M+H).sup.+.
Example 46
Preparation of
(E)-N-methyl-N-(2-methyl-1H-indol-3-ylmethyl)-3-(4-methyl-3-oxo-2,3,4,5-t-
etrahydro-1H-pyrido[2,3-e]-1,4-diazepin-7-yl)acrylamide
[1030] According to the procedure of Example 162, except
substituting
7-bromo-4-methyl-1,2,4,5-tetrahydropyrido[2,3-e]-1,4-diazepin-3-one
(0.50 g, 1.9 mmole) for the 2-amino-5-bromopyrimidine, the title
compound (0.30 g, 62%) was prepared as a light yellow solid: MS
(ES) m/e 404 (M+H).sup.+.
Example 47
Preparation of
(E)-N-methyl-N-(2-methyl-1H-indol-3-ylmethyl)-3-(8-oxo-6,7,8,9-tetrahydro-
-5H-pyrido[2,3-b]azepin-3-yl)acrylamide
[1031] EDC (0.18 g, 0.96 mmole) was added to a solution of
(E)-3-(8-oxo-6,7,8,9-tetrahydro-5H-pyrido[2,3-b]azepin-3-yl)acrylic
acid hydrochloride salt (0.24 g, 0.87 mmole),
2-methyl-3-(methylaminomethyl)indole (0.15 g, 0.87 mmole), HOBt
H.sub.2O (0.13 g., 0.96 mmole) and diisopropylethylamine (0.45 mL,
2.61 mmole) in DMF (15 mL) at RT. The reaction was stirred
overnight then was concentrated in vacuo. The residue was diluted
with water and extracted with ethyl acetate. The combined organic
extracts were washed with brine and dried over Na.sub.2SO.sub.4.
Preparative HPLC on a Waters C-18 ODSA column (gradient: 20-100%
H.sub.2O/CH.sub.3CN) gave the title compound (0.13 g, 38%) as a
light yellow solid after drying in vacuo: MS (ES) m/e 389
(M+H).sup.+.
Example 48
Preparation of
(E)-N-[1-(2-hydroxyethyl)-1H-indol-3-ylmethyl]-N-methyl-3-(7-oxo-5,6,7,8--
tetrahydro-1,8-naphthyridin-3-yl)acrylamide
[1032] EDC (0.54 g, 2.80 mmole) was added to a solution of
(E)-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylic acid
hydrochloride salt (0.71 g, 2.80 mmole),
1-(2-hydroxyethyl)-3-(methylaminomethyl)-1H-indole (0.52 g, 2.55
mmole), HOBt.H.sub.2O (0.38 g., 2.80 mmole) and
diisopropylethylamine (1.11 mL, 6.40 mmole) in DMF (25 mL) at RT.
The reaction was stirred overnight then was concentrated in vacuo.
The residue was diluted with water and extracted with ethyl
acetate. The combined organic extracts were washed with brine and
dried over Na.sub.2SO.sub.4. Flash chromatography on silica gel
(20% EtOH/EtOAc) gave title compound (0.28 g, 27%) as an off-white
solid after drying in vacuo: MS (ES) m/e 405 (M+H).sup.+.
Example 49
Preparation of
(E)-N-methyl-N-(1-methyl-1H-indol-3-ylmethyl)-3-(8-oxo-6,7,8,9-tetrahydro-
-5H-pyrido[2,3-b]azepin-3-yl)acrylamide
[1033] EDC (0.06 g, 0.30 mmole) was added to a solution of
(E)-3-(8-oxo-6,7,8,9-tetrahydro-5H-pyrido[2,3-b]azepin-3-yl)acrylic
acid hydrochloride salt (0.07 g, 0.27 mmole),
1-methyl-3-(methylaminomethyl)-1H-indole (0.05 g, 0.27 mmole),
HOBt.H.sub.2O (0.04 g., 0.30 mmole) and diisopropylethylamine (0.14
mL, 0.81 mmole) in DMF (15 mL) at RT. The reaction was stirred
overnight then was concentrated in vacuo. The residue was diluted
with water and extracted with ethyl acetate. The combined organic
extracts were washed with brine and dried over Na.sub.2SO.sub.4.
Flash chromatography on silica gel (20% EtOH/EtOAc) gave title
compound (0.05 g, 48%) as an off-white solid after drying in vacuo:
MS (ES) m/e 389 (M+H).sup.+.
Example 50
Preparation of
(E)-N-[1-(2-hydroxyethyl)-1H-indol-3-ylmethyl]-N-methyl-3-(7-oxo-5,6,7,8--
tetrahydro-1,8-naphthyridin-3-yl)acrylamide
[1034] EDC (0.35 g, 1.81 mmole) was added to a solution of
(E)-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylic acid
hydrochloride salt (0.42 g, 1.65 mmole),
1-ethyl-3-(methylaminomethyl)-1H-indole (0.31 g, 1.65 mmole),
HOBt.H.sub.2O (0.24 g., 1.81 mmole) and diisopropylethylamine (0.86
mL, 4.95 mmole) in DMF (15 mL) at RT. The reaction was stirred
overnight then was concentrated in vacuo. The residue was diluted
with water and extracted with ethyl acetate. The combined organic
extracts were washed with brine and dried over Na.sub.2SO.sub.4.
Flash chromatography on silica gel (10% EtOH/EtOAc) gave title
compound (0.39 g, 61%) as a light yellow solid after drying in
vacuo: MS (ES) m/e 389 (M+H).sup.+.
Example 51
Preparation of
(E)-N-(7-chloro-1-methyl-1H-indol-3-ylmethyl)-3-[6-[N-(methoxycarbonylmet-
hyl)amino]pyridin-3-yl]-N-methylacrylamide
[1035] According to the procedure of Example 19, except
substituting 7-chloro-1-methyl-3-(methylaminomethyl)-1H-indole (1.4
g, 6.7 mmole) for the 2-methyl-3-(methylaminomethyl)indole, the
title compound (2.38 g, 84%) was prepared as a pale yellow solid:
MS (ES) m/e 427.0 (M+H).sup.+.
Example 52
Preparation of
(E)-3-[6-[N-(carboxymethyl)amino]pyridin-3-yl]-N-(7-chloro-1-methyl-1H-in-
dol-3-ylmethyl)-N-methylacrylamide
[1036] According to the procedure of Example 20, except
substituting
(E)-N-(7-chloro-1-methyl-1H-indol-3-ylmethyl)-3-[6-[N-(methoxycarbonylmet-
hyl)amino]pyridin-3-yl]-N-methylacrylamide (0.75 g, 1.8 mmole) for
the
(E)-3-[6-[N-(methoxycarbonylmethyl)amino]pyridin-3-yl]-N-methyl-N-(2-meth-
yl-1H-indol-3-ylmethyl)acrylamide, the title compound (0.746 g,
100%) was prepared as a white solid: MS (ES) m/e 413.2 (M+
Example 53
Preparation of
(E)-N-(7-chloro-1-methyl-1H-indol-3-ylmethyl)-N-methyl-3-[6-[N-(methylami-
nocarbonylmethyl)amino-]pyridin-3-yl]acrylamide
[1037] According to the procedure of Example 21, except
substituting
(E)-N-(7-chloro-1-methyl-1H-indol-3-ylmethyl)-3-[6-[N-(methoxycarbonylmet-
hyl)amino]pyridin-3-yl]-N-methylacrylamide (0.75 g, 1.8 mmole) for
the
(E)-3-[6-[N-(methoxycarbonylmethyl)amino]pyridin-3-yl]-N-methyl-N-(2-meth-
yl-1H-indol-3-ylmethyl)acrylamide, the title compound (0.721 g,
94%) was prepared as a white solid: MS (ES) m/e 426.0
(M+H).sup.+.
Example 54
Preparation of
(E)-3-(6-aminopyridin-3-yl)-N-(2-chloro-1-methyl-1H-indol-3-ylmethyl)-N-m-
ethylacrylamide
[1038] According to the procedure of Example 31, except
substituting 2-chloro-1-methyl-2-(methylaminomethyl)-1H-indole (0.7
g, 3.0 mmole) for the 1,4-dimethyl-3-(methylaminomethyl)-1H-indole,
the title compound (0.935 g, 88%) was obtained as an off-white
solid: MS (ES) m/e 355.2 (M+H).sup.+.
Example 55
Preparation of
(E)-N-(2-chloro-1-methyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-t-
etrahydro-1,8-naphthyridin-3-yl)acrylamide
[1039] According to the procedure of Example 24, except
substituting 2-chloro-1-methyl-2-(methylaminomethyl)-1H-indole (0.7
g, 3.0 mmole) for the
2,3-dihydro-8-(methylaminomethyl)-1H-3a-azacyclopenta[a]indene, the
title compound (1.03 g, 84%) was obtained as a white solid: MS (ES)
m/e 409.0 (M+H).sup.+.
Example 56
Preparation of
(E)-N-(naphthalen-2-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-1,8-na-
phthyridin-3-yl)acrylamide
[1040] According to the procedure of Example 24, except
substituting 2-(methylaminomethyl)naphthalene (0.55 g, 3.2 mmole)
for the
2,3-dihydro-8-(methylaminomethyl)-1H-3a-azacyclopenta[a]indene, the
title compound (0.871 g, 73%) was obtained as a white solid: MS
(ES) m/e 372.2 (M+H).sup.+.
Example 57
Preparation of
(E)-N-(1-methyl-1H-indol-3-ylmethyl)-N-methyl-3-(6-amino-7-oxo-5,6,7,8-te-
trahydro-1,8-naphthyridin-3-yl)acrylamide
a)
(E)-N-(1-Methyl-1H-indol-3-ylmethyl)-N-methyl-3-[6-(benzhydrylideneamin-
o)-7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl]acrylamide
[1041] According to the procedure of Example 15, except
substituting
3-(benzhydrylideneamino)-6-bromo-3,4-dihydro-1H-1,8-naphthyridin-2-one
(3.5 g, 8.6 mmole) for the 5-bromo-2,2'-dipyridylamine, the title
compound (3.72 g, 78%) was obtained as a pale yellow solid: MS (ES)
m/e 554.4 (M+H).sup.+.
b)
(E)-N-(1-Methyl-1H-indol-3-ylmethyl)-N-methyl-3-(6-amino-7-oxo-5,6,7,8--
tetrahydro-1,8-naphthyridin-3-yl)acrylamide
[1042] To a suspension of
(E)-N-(1-methyl-1H-indol-3-ylmethyl)-N-methyl-346-(benzhydrylideneamino)--
7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylamide (0.5 g,
0.9 mmole) in dioxane (15 mL) was added 1 N HCl (10 mL) with
stirring at RT. After approximately 5 min the suspension cleared up
then gradually reformed. After stirring for 1 h the reaction was
neutralized with 1 N NaOH (10 mL) and concentrated to near dryness
under vacuum. The resulting suspension was diluted with H.sub.2O
(20 mL) and filtered, and the solid was rinsed with cold H.sub.2O
and dried under vacuum. The slightly pinkish solid was triturated
with Et.sub.2O, filtered, and dried under vacuum to give the title
compound (248 mg, 71%) as an off-white solid: MS (ES) m/e 390.4
(M+H).sup.+.
Example 58
Preparation of
(E)-N-(benzofuran-2-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-1,8-na-
phthyridin-3-yl)acrylamide
[1043] According to the procedure of Example 4, except substituting
(E)-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylic acid
hydrochloride salt (1.60 g, 6.3 mmole) for the
(E)-3-(2-oxo-2,3-dihydro-1H-indol-5-yl)acrylic acid hydrochloride
salt, and substituting 2-(methylaminomethyl)benzofuran (1.20 g, 6.9
mmole) for the 2-methyl-3-(methylaminomethyl)indole, the title
compound (2.0 g, 90%) was prepared as a tan solid: MS (ES) m/e 363
(M+H).sup.+.
Example 59
Preparation of
(E)-3-(6-aminopyridin-3-yl)-N-(7-methoxycarbonyl-1-methyl-1H-indol-3-ylme-
thyl)-N-methylacrylamide
[1044] According to the procedure of Example 31, except
substituting methyl
1-methyl-3-(methylaminomethyl)-1H-indole-7-carboxylate for the
1,4-dimethyl-3-(methylaminomethyl)-1H-indole, the title compound
(150 mg, 34%) was obtained, after trituration with diethyl ether,
as an off-white solid: MS (ES) m/e 379.2 (M+H).sup.+. Anal. Calcd
for C.sub.21H.sub.22N.sub.4O.sub.3.0.25H.sub.2O: C, 65.87; H, 5.92;
N, 14.63. Found: C, 66.02; H, 5.71; N, 14.29.
Example 60
Preparation of
(E)-3-(aminopyridin-3-yl)-N-methyl-N-(1,2,7-trimethyl-1H-indol-3-Ylmethyl-
)acrylamide
[1045] According to the procedure of Example 31, except
substituting 3-(methylaminomethyl)-1,2,7-trimethyl-1H-indole for
the 1,4-dimethyl-3-(methylaminomethyl)-1H-indole, the title
compound (120 mg, 29%) was obtained, after trituration with ethyl
acetate, as a light yellow solid: MS (ES) m/e 349.0 (M+H).sup.+.
Anal. Calcd for C.sub.21H.sub.24N.sub.4O.H.sub.2O: C, 68.82; H,
7.69; N, 15.29. Found: C, 68.42; H, 6.86; N, 15.61.
Example 61
Preparation of
(E)-3-(6-aminopyridin-3-yl)-N-(7-chloro-1H-indol-3-ylmethyl)-N-methylacry-
lamide
[1046] According to the procedure of Example 31, except
substituting 7-chloro-3-(methylaminomethyl)-1H-indole for the
1,4-dimethyl-3-(methylaminomethyl)-1H-indole, the title compound
(150 mg, 25%) was obtained, after trituration with ethyl acetate,
as a light yellow solid: MS (ES) m/e 341.0 (M+H).sup.+. Anal. Calcd
for C.sub.18H.sub.17N.sub.4O 0.25 H.sub.2O: C, 62.60; H, 5.10; N,
16.22. Found: C, 62.29; H, 5.01; N, 16.32.
Example 62
Preparation of
(E)-N-(5-chloro-1-methyl-1H-indol-3ylmethyl-N-methyl-3-(7-oxo-5,6,7,8-tet-
rahydro-1,8-naphthyridin-3-yl)acrylamide
[1047] According to the procedure of Example 42, except
substituting 5-chloro-1-methyl-3-(methylaminomethyl)-1H-indole for
the 7-chloro-1-methyl-3-(methylaminomethyl)-1H-indole, the title
compound (100 mg, 49%) was obtained as a light tan solid: MS (ES)
m/e 409.0 (M+H).sup.+. Anal. Calcd for
C.sub.22H.sub.21ClN.sub.4O.sub.2. 0.5H.sub.2O: C, 63.23; H, 5.32;
N, 13.40.
[1048] Found: C, 63.19; H, 5.23; N, 13.45.
Example 63
Preparation of
(E)-N-(6-chloro-1-methyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-t-
etrahydro-1,8-naphthyridin-3-yl)acrylamide
[1049] According to the procedure of Example 42, except
substituting 6-chloro-1-methyl-3-(methylaminomethyl)-1H-indole for
the 7-chloro-1-methyl-3-(methylaminomethyl)-1H-indole, the title
compound (125 mg, 61%) was obtained as a light tan solid: MS (ES)
m/e 409.0 (M+H).sup.+. Anal. Calcd for
C.sub.22H.sub.21ClN.sub.4O.sub.2.0.25H.sub.2O: C, 63.92; H, 5.24;
N, 13.55. Found: C, 63.96; H, 4.98; N, 13.66.
Example 64
Preparation of
(E)-N-(1,7-dimethyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrah-
ydro-1,8-naphthyridin-3-yl)acrylamide
[1050] According to the procedure of Example 42, except
substituting 1,7-dimethyl-3-(methylaminomethyl)-1H-indole for the
7-chloro-1-methyl-3-(methylaminomethyl)-1H-indole, the title
compound (100 mg, 51%) was obtained as a white solid: MS (ES) m/e
389.2 (M+H).sup.+. Anal. Calcd for C.sub.23H.sub.24N.sub.4O.sub.2.
0.25H.sub.2O: C, 70.29; H, 6.28; N, 14.25.
[1051] Found: C, 70.06; H, 6.23; N, 14.29
Example 65
Preparation of
(E)-N-(1,6-dimethyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrah-
ydro-1,8-naphthyridin-3-yl)acrylamide
[1052] According to the procedure of Example 42, except
substituting 1,6-dimethyl-3-(methylaminomethyl)-1H-indole for the
7-chloro-1-methyl-3-(methylaminomethyl)-1H-indole, the title
compound (95 mg, 49%) was obtained as a white solid: MS (ES) m/e
389.2 (M+H).sup.+. Anal. Calcd for
C.sub.23H.sub.24N.sub.4O.sub.2.0.75H.sub.2O: C, 68.72; H, 6.39; N,
13.93. Found: C, 68.98; H, 6.07; N, 13.81.
Example 66
Preparation of
(E)-N-(1,4-dimethyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrah-
ydro-1,8-naphthyridin-3-yl)acrylamide
[1053] According to the procedure of Example 42, except
substituting 1,4-dimethyl-3-(methylaminomethyl)-1H-indole for the
7-chloro-1-methyl-3-(methylaminomethyl)-1H-indole, the title
compound (90 mg, 46%) was obtained as a white solid: MS (ES) m/e
389.0 (M+H).sup.+. Anal. Calcd for C.sub.23H.sub.24N.sub.4O.sub.2.
0.5H.sub.2O: C, 69.50; H, 6.33; N, 14.10. Found: C, 69.40; H, 6.24;
N, 14.20.
Example 67
Preparation of
(E)-N-(1,5-dimethyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrah-
ydro-1,8-naphthyridin-3-yl)acrylamide
[1054] According to the procedure of Example 42, except
substituting 1,5-dimethyl-3-(methylaminomethyl)-1H-indole for the
7-chloro-1-methyl-3-(methylaminomethyl)-1H-indole, the title
compound (100 mg, 51%) was obtained as a white solid: MS (ES) m/e
389.2 (M+H).sup.+. Anal. Calcd for C.sub.23H.sub.24N.sub.4O.sub.2.
0.125H.sub.2O: C, 70.70; H, 6.25; N, 14.34.
[1055] Found: C, 70.75; H, 6.15; N, 14.38.
Example 68
Preparation of
(E)-N-(7-methoxy-1-methyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8--
tetrahydro-1,8-naphthyridin-3-yl)acrylamide
[1056] According to the procedure of Example 42, except
substituting 7-methoxy-1-methyl-3-(methylaminomethyl)-1H-indole for
the 7-chloro-1-methyl-3-(methylaminomethyl)-1H-indole, the title
compound (85 mg, 42%) was obtained as an off-white solid: MS (ES)
m/e 405.2 (M+H).sup.+. Anal. Calcd for
C.sub.23H.sub.24N.sub.4O.sub.3: C, 68.30; H, 5.95; N, 13.85. Found:
C, 67.95; H, 5.94; N, 13.94.
Example 69
Preparation of
(E)-N-(7-hydroxy-1-methyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8--
tetrahydro-1,8-naphthyridin-3-yl)acrylamide
[1057] According to the procedure of Example 42, except
substituting 7-hydroxy-1-methyl-3-(methylaminomethyl)-1H-indole for
the 7-chloro-1-methyl-3-(methylaminomethyl)-1H-indole, the title
compound (200 mg, 51%) was obtained as a tan solid: MS (ES) m/e
391.2 (M+H).sup.+. Anal. Calcd for
C.sub.22H.sub.22N.sub.4O.sub.3.0.75H.sub.2O: C, 65.41; H, 5.85; N,
13.86. Found: C, 65.25; H, 5.95; N, 13.79.
Example 70
Preparation of
(E)-N-(4-chloro-1-methyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-t-
etrahydro-1,8-naphthyridin-3-yl)acrylamide
[1058] According to the procedure of Example 42, except
substituting 4-chloro-1-methyl-3-(methylaminomethyl for the
7-chloro-1-methyl-3-(methylaminomethyl)-1H-indole, the title
compound (100 mg, 49%) was obtained as a white solid: MS (ES) m/e
409.0 (M+H).sup.+. Anal. Calcd for
C.sub.22H.sub.21ClN.sub.4O.sub.2: 0.75H.sub.2O: C, 62.55; H, 5.36;
N, 13.26. Found: C, 62.71; H, 5.24; N, 13.15.
Example 71
Preparation of
(E)-N-(4-methoxy-1-methyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8--
tetrahydro-1,8-naphthyridin-3-yl)acrylamide
[1059] According to the procedure of Example 42, except
substituting 4-methoxy-1-methyl-3-(methylaminomethyl)-1H-indole for
the 7-chloro-1-methyl-3-(methylaminomethyl)-1H-indole, the title
compound (65 mg, 32%) was obtained as an off-white solid: MS (ES)
m/e 405.2 (M+H).sup.+. Anal. Calcd for
C.sub.23H.sub.24N.sub.4O.sub.3 1.25H.sub.2O: C, 64.69; H, 6.19; N,
13.33. Found: C, 64.49; H, 5.94; N, 13.76
Example 72
Preparation of
(E)-N-(5-methoxy-1-methyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8--
tetrahydro-1,8-naphthyridin-3-yl)acrylamide
[1060] According to the procedure of Example 402, except
substituting 5-methoxy-1-methyl-3-(methylaminomethyl)-1H-indole for
the 7-chloro-1-methyl-3-(methylaminomethyl)-1H-indole, the title
compound (90 mg, 44%) was obtained as an off-white solid: MS (ES)
m/e 405.2 (M+H).sup.+. Anal. Calcd for
C.sub.23H.sub.24N.sub.4O.sub.3.0.5H.sub.2O: C, 66.81; H, 6.09; N,
13.55. Found: C, 66.67; H, 5.96; N, 13.87.
Example 73
Preparation of
(E)-3-(6-aminopyridin-3-yl)-N-(7-carboxy-1-methyl-1H-indol-3-ylmethyl)-N--
methylacrylamide
[1061] A solution of
(E)-3-(6-aminopyridin-3-yl)-N-(7-methoxycarbonyl-1-methyl-1H-indol-3-ylme-
thyl)-N-methylacrylamide (76 mg, 0.2 mmole) in methanol (4 mL),
water (2 mL), and tetrahydrofuran (2 mL) was treated with LiOH (39
mg, 1.6 mmole), and the reaction was stirred at ambient temperature
for 48 h. The mixture was filtered, and the filtrate was acidified
to pH 4.0-4.5 with 1.0 N HCl. The precipitate was collected, washed
with water and dried giving the title compound (25 mg, 35%) as a
white solid: MS (ES) m/e 365.2 (M+H).sup.+. Anal. Calcd for
C.sub.20H.sub.20N.sub.4O.sub.3.0.25H.sub.2O: C, 65.11: H, 5.60; N,
15.18. Found: C, 64.83; H, 5.52; N, 15.07.
Example 74
Preparation of
(E)-N-(6-methoxy-1-methyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8--
tetrahydro-1,8-naphthyridin-3-yl)acrylamide
[1062] According to the procedure of Example 42, except
substituting 6-methoxy-1-methyl-3-(methylaminomethyl)-1H-indole for
the 7-chloro-1-methyl-3-(methylaminomethyl)-1H-indole, the title
compound (65 mg, 32%) was obtained as a yellow solid: MS (ES) m/e
405.2 (M+H).sup.+. Anal. Calcd for
C.sub.23H.sub.24N.sub.4O.sub.3.H.sub.2O: C, 65.38; H, 6.20; N,
13.26. Found: C, 65.36; H, 5.98; N, 13.16.
Example 75
Preparation of
(E)-3-(6-aminopyridin-3-yl)-N-(6-methoxycarbonyl-1-methyl-1H-indol-3-ylme-
thyl)-N-methylacrylamide
[1063] According to the procedure of Example 31, except
substituting methyl
1-methyl-3-(methylaminomethyl)-1H-indole-6-carboxylate for the
1,4-dimethyl-3-(methylaminomethyl)-1H-indole, the title compound
(168 mg, 39%) was obtained, after silica gel chromatography, as a
white solid: MS (ES) m/e 379.2.degree.(M+H).sup.+. Anal. Calcd for
C.sub.21H.sub.22N.sub.4O.sub.3.0.125H.sub.2O: C, 66.25; H, 5.93; N,
14.71. Found: C, 66.60; H, 6.13; N, 14.18.
Example 76
Preparation of
(E)-N-(3,3-dimethyl-3H-indene-1-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetra-
hydro-1,8-naphthyridin-3-yl)acrylamide
[1064] According to the procedure of Example 42, except
substituting 3,3-dimethyl-1-(methylaminomethyl)-3H-indene for the
7-chloro-1-methyl-3-(methylaminomethyl)-1H-indole, the title
compound (48 mg, 12%) was obtained, after silica gel
chromatography, as a tan solid: MS (ES) m/e 388.2 (M+H).sup.+.
Anal. Calcd for C.sub.23H.sub.24N.sub.4O.sub.3 0.375H.sub.2O: C,
73.31; H, 6.51; N, 10.66. Found: C, 72.91; H, 6.37; N, 11.16.
Example 77
Preparation of
(E)-3-(6-aminopyridin-3-yl)-N-(4-fluoro-1-methyl-1H-indol-3-ylmethyl)-N-m-
ethylacrylamide
[1065] According to the procedure of Example 24, except
substituting 4-fluoro-1-methyl-3-(methylaminomethyl)-1H-indole (0.2
g, 1.04 mmole) for the
2,3-dihydro-8-(methylaminomethyl)-1H-3a-azacyclopenta[a]indene, and
substituting (E)-3-(6-amino-pyridin-3-yl)acrylic acid (0.17 g, 1.04
mmole) for the
(E)-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylic acid
hydrochloride salt, the title compound (0.11 g, 37%) was prepared
as an off-white powder: MS (ES) m/e 339 (M+H).sup.+.
Example 78
Preparation of
(E)-3-(6-aminopyridin-3-yl)-N-(5-fluoro-1-methyl-1H-indol-3-ylmethyl)-N-m-
ethylacrylamide
[1066] According to the procedure of Example 24, except
substituting 5-fluoro-1-methyl-3-(methylaminomethyl)-1H-indole (0.2
g, 1.04 mmole) for the
2,3-dihydro-8-(methylaminomethyl)-1H-3a-azacyclopenta[a]indene, and
substituting (E)-3-(6-amino-pyridin-3-yl)acrylic acid (0.17 g, 1.04
mmole) for the
(E)-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylic acid
hydrochloride salt, the title compound (0.14 g, 41%) was prepared
as an off-white powder: MS (ES) m/e 339 (M+H).sup.+.
Example 79
Preparation of
(E)-3-(6-aminopyridin-3-yl)-N-(7-fluoro-1-methyl-1H-indol-3-ylmethyl)-N-m-
ethylacrylamide
[1067] According to the procedure of Example 24, except
substituting 7-fluoro-1-methyl-3-(methylaminomethyl)-1H-indole (0.2
g, 1.04 mmole) for the
2,3-dihydro-8-(methylaminomethyl)-1H-3a-azacyclopenta[a]indene, and
substituting (E)-3-(6-amino-pyridin-3-yl)acrylic acid (0.17 g, 1.04
mmole) for the
(E)-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylic acid
hydrochloride salt, the title compound (0.1 g, 27%) was prepared as
an off-white powder: MS (ES) m/e 339 (M+H).sup.+.
Example 80
Preparation of
(E)-3-(6-aminopyridin-3-yl)-N-(4-fluoro-1H-indol-3-ylmethyl)-N-methylacry-
lamide
[1068] According to the procedure of Example 24, except
substituting 4-fluoro-3-(methylaminomethyl)-1H-indole (0.31 g, 1.74
mmole) for the
2,3-dihydro-8-(methylaminomethyl)-1H-3a-azacyclopenta[a]indene, and
substituting (E)-3-(6-amino-pyridin-3-yl)acrylic acid (0.285 g,
1.74 mmole) for the
(E)-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylic acid
hydrochloride salt, the title compound (0.2 g, 36%) was prepared as
a white powder: MS (ES) m/e 325 (M+H).sup.+.
Example 81
Preparation of
(E)-3-(6-aminopyridin-3-yl)-N-(7-fluoro-1H-indol-3-ylmethyl)-N-methylacry-
lamide
[1069] According to the procedure of Example 24, except
substituting 7-fluoro-3-(methylaminomethyl)-1H-indole (0.31 g, 1.74
mmole) for the
2,3-dihydro-8-(methylaminomethyl)-1H-3a-azacyclopenta[a]indene, and
substituting (E)-3-(6-amino-pyridin-3-yl)acrylic acid (0.285 g,
1.74 mmole) for the
(E)-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylic acid
hydrochloride salt, the title compound (0.1 g, 18%) was prepared as
a white powder: MS (ES) m/e 325 (M+H).sup.+.
Example 82
Preparation of
(E)-N-(4-fluoro-1-methyl-1H-indol-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-t-
etrahydro-1,8-naphthyridin-3-yl)acrylamide
[1070] According to the procedure of Example 24, except
substituting 4-fluoro-1-methyl-3-(methylaminomethyl)-1H-indole
(0.13 g, 0.68 mmole) for the
2,3-dihydro-8-(methylaminomethyl)-1H-3a-azacyclopenta[a]indene),
the title compound (0.15 g, 56%) was prepared as an off-white
powder: MS (ES) m/e 393 (M+H).sup.+.
Example 83
Preparation of
(E)-N-(quinolin-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naph-
thyridin-3-yl)acrylamide
[1071] According to the procedure of Example 24, except
substituting 3-(methylaminomethyl)quinoline (0.12 g, 0.67 mmole)
for the
2,3-dihydro-8-(methylaminomethyl)-1H-3a-azacyclopenta[a]indene),
the title compound (0.1 g, 40%) was prepared as an off-white
powder: MS (ES) m/e 373 (M+H).sup.+.
Example 84
Preparation of
(E)-N-(naphthalen-1-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-1,8-na-
phthyridin-3-yl)acrylamide
[1072] According to the procedure of Example 24, except
substituting N-methyl-1-naphthalenemethylamine hydrochloride (0.162
g, 0.95 mmole) for the
2,3-dihydro-8-(methylaminomethyl)-1H-3a-azacyclopenta[a]indene),
the title compound (0.15 g, 43%) was prepared as a white powder: MS
(ES) m/e 372 (M+H).sup.+.
Example 85
Preparation of
(E)-N-methyl-N-(2-methyl-1H-indol-3-ylmethyl)-3-[3-(2-methoxyethyl)-2-oxo-
-1,2,3,4-tetrahydropyrido[2,3-d]pyrimidin-6-yl]acrylamide
[1073] A solution of
6-bromo-3-(2-methoxyethyl)-3,4-dihydro-1H-pyrido[2,3-d]pyrimidin-2-one
(0.86 g, 3.00 mmole),
N-(2-methyl-1H-indol-3-ylmethyl)-N-methylacrylamide (see Example
1(a), 0.68 g, 3.00 mmole), Pd(OAc).sub.2 (0.07 g, 0.30 mmole),
tri-ortho-tolylphosphine (0.18 g, 0.60 mmole) and
diisopropylethylamine (1.31 mL, 7.50 mmole) in propionitrile (50
mL) was deoxygenated, then was heated at reflux under N.sub.2
overnight. The dark mixture was filtered through a pad of
Celite.RTM., and the filter pad was rinsed with acetonitrile (250
mL). The filtrate was concentrated in vacuo, and the residue was
purified by flash chromatography on silica gel (10% EtOAc/EtOH).
The title compound (0.46 g, 36%) was obtained as a light yellow
solid after drying in vacuo: MS (ES) m/e 434 (M+H).sup.+.
Example 86
Preparation of
(E)-N-(1-methyl-1H-indol-3-ylmethyl)-N-methyl-3-(6-methoxycarbonyl-7-oxo--
5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylamide
[1074] According to the procedure of Example 15 (b), except
substituting methyl
(.+-.)-6-bromo-2-oxo-1,2,3,4-tetrahydro-1H-1,8-naphthyridine-3-car-
boxylate (2.5 g, 8.8 mmole), from Preparation 4 (d), for the
5-bromo-2,2'-dipyridylamine, the title compound (1.82 g, 48%) was
prepared as an off-white solid: MS (ES) m/e 433.4 (M+H).sup.+.
Example 87
Preparation of
(E)-3-(6-aminopyridin-3-yl)-N-(1,3-dimethyl-1H-pyrrolo[2,3-b]pyridin-3-yl-
methyl)-N-methylacrylamide
[1075] The title compound is prepared following methods analogous
to those described in the previous preparations and examples.
Example 88
Preparation of
(E)-N-(1,3-dimethyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-N-methyl-3-(7-ox-
o-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylamide
[1076] The title compound is prepared following methods analogous
to those described in the previous preparations and examples.
Example 89
Preparation of
(E)-3-(6-aminopyridin-3-yl)-N-methyl-N-(1-methyl-1H-pyrrolo[2,3-c]pyridin-
-3-ylmethyl)acrylamide
[1077] The title compound is prepared following methods analogous
to those described in the previous preparations and examples.
Example 90
Preparation of
(E)-3-(6-aminopyridin-3-yl)-N-methyl-N-(1-methyl-1H-pyrrolo[3,2-c]pyridin-
-3-ylmethyl)acrylamide
[1078] The title compound is prepared following methods analogous
to those described in the previous preparations and examples.
Example 91
Preparation of
(E)-3-(6-aminopyridin-3-yl)-N-methyl-N-(1-methyl-1H-pyrrolo[3,2-b]pyridin-
-3-ylmethyl)acrylamide
[1079] The title compound is prepared following methods analogous
to those described in the previous preparations and examples.
Example 92
Preparation of
(E)-N-methyl-N-(1-methyl-1H-pyrrolo[2,3-c]pyridin-3-ylmethyl)-3-(7-oxo-5,-
6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylamide
[1080] The title compound is prepared following methods analogous
to those described in the previous preparations and examples.
Example 93
Preparation of
(E)-N-methyl-N-(1-methyl-1H-pyrrolo[3,2-c]pyridin-3-ylmethyl)-3-(7-oxo-5,-
6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylamide
[1081] The title compound is prepared following methods analogous
to those described in the previous preparations and examples.
Example 94
Preparation of
(E)-N-methyl-N-(1-methyl-1H-pyrrolo[3,2-b]pyridin-3-ylmethyl)-3-(7-oxo-5,-
6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylamide
[1082] The title compound is prepared following methods analogous
to those described in the previous preparations and examples.
Example 95
Preparation of
(E)-3-(6-aminopyridin-3-yl)-N-(benzofuran-3-ylmethyl)-N-methylacrylamide
[1083] The title compound is prepared following methods analogous
to those described in the previous preparations and examples.
Example 96
Preparation of
(E)-3-(6-aminopyridin-3-yl)-N-methyl-N-(3-methylbenzofuran-2-ylmethyl)acr-
ylamide
[1084] The title compound is prepared following methods analogous
to those described in the previous preparations and examples.
Example 97
Preparation of
(E)-3-(6-aminopyridin-3-yl)-N-methyl-N-(2-methylbenzofuran-3-ylmethyl)acr-
ylamide
[1085] The title compound is prepared following methods analogous
to those described in the previous preparations and examples.
Example 98
Preparation of
(E)-N-(benzofuran-3-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-1,8-na-
phthyridin-3-yl)acrylamide
[1086] The title compound is prepared following methods analogous
to those described in the previous preparations and examples.
Example 99
Preparation of
(E)-N-methyl-N-(3-methylbenzofuran-2-ylmethyl)-3-(7-oxo-5,6,7,8-tetrahydr-
o-1,8-naphthyridin-3-yl)acrylamide
[1087] The title compound, compound G, is prepared following
methods analogous to those described in the previous preparations
and examples.
Example 100
Preparation of
(E)-N-methyl-N-(2-methylbenzofuran-3-ylmethyl)-3-(7-oxo-5,6,7,8-tetrahydr-
o-1,8-naphthyridin-3-yl)acrylamide
[1088] The title compound is prepared following methods analogous
to those described in the previous preparations and examples.
Example 101
Preparation of
(E)-(6-aminopyridin-3-yl)-N-methyl-N-[1-(1-methyl-1H-indol-2-yl)ethyl]acr-
ylamide
[1089] The title compound is prepared following methods analogous
to those described in the previous preparations and examples.
Example 102
Preparation of
(E)-(6-aminopyridin-3-yl)-N-methyl-N-[1-(1-methyl-1H-indol-3-yl)ethyl]acr-
ylamide
[1090] The title compound is prepared following methods analogous
to those described in the previous preparations and examples.
Example 103
Preparation of
(E)-N-methyl-N-[1-(1-methyl-1H-indol-2-yl)ethyl]-3-(7-oxo-5,6,7,8-tetrahy-
dro-1,8-naphthyridin-3-yl)acrylamide
[1091] The title compound is prepared following methods analogous
to those described in the previous preparations and examples.
Example 104
Preparation of
(E)-N-methyl-N-[1-(1-methyl-1H-indol-3-yl)ethyl]-3-(7-oxo-5,6,7,8-tetrahy-
dro-1,8-naphthyridin-3-yl)acrylamide
[1092] The title compound is prepared following methods analogous
to those described in the previous preparations and examples.
Example 105
Preparation of
(E)-N-Methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]di-
azepin-7-yl)-N-(1-propyl-naphthalen-2-ylmethyl)acrylamide
hydrochloride
a)
(E)-N-Methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]-
diazepin-7-yl)-N-(1-propyl-naphthalen-2-ylmethyl)acrylamide
[1093]
(E)-3-(4-Methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diaze-
pin-7-yl)acrylic acid hydrochloride (1.40 g, 1.25 mmol) was added
to a solution of methyl-(1-propyl-naphthalen-2-ylmethyl)amine
(0.292 g, 1.37 mmol) and diisopropylethylamine (0.65 mL, 3.75 mmol)
in DMF (25 mL) followed by the addition of 1-hydroxybenzotriazole
hydrate (0.185 g, 1.37 mmol) and
1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (0.263
g, 1.37 mmol). The reaction was allowed to stir at room temperature
for 18 h. The reaction was quenched with H.sub.2O (70 mL) then
concentrated to a yellow oil. Purification by column chromatography
(silica gel, CH.sub.2Cl.sub.2/MeOH, 99:1 to 95:5) gave the title
compound (0.229 g, 41%) as a glassy orange solid and as a mixture
of amide rotamers: NMR (500 MHz, DMSO-d.sub.6) .delta. 10.35 (s,
1H), 8.55-8.54 (m, 1H), 8.24-8.14 (m, 1H), 7.98-7.86 (m, 5H),
7.72-7.24 (m, 3H), 3.75 (s, 2H), 3.42 (s, 2H), 3.86 (s, 2H),
2.54-2.36 (m, 6H), 2.11-2.02 (m, 2H), 1.40-1.34 (m, 2H), 1.01-0.98
(m, 3H).
b)
(E)-N-Methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]-
diazepin-7-yl)-N-(1-propyl-naphthalen-2-ylmethyl)acrylamide
hydrochloride
[1094] A 2 M solution of hydrogen chloride in Et.sub.2O (0.25 ml,
0.518 mmol) was added to
(E)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]di-
azepin-7-yl)-N-(1-propyl-naphthalen-2-ylmethyl)acrylamide (0.229 g,
0.518 mmol) in CH.sub.2Cl.sub.2 (5 mL) via syringe. The solution
was allowed to stir for 18 h during time which a precipitate fell
out of the solution. The product was collected by filtration and
was washed with Et.sub.2O (100 mL). The product was dried to give
the title compound (0.182 g, 73%) as an orange solid and as a
mixture of amide rotamers: NMR (300 MHz, DMSO-d.sub.6) .delta.
12.00 (br s, 1H), 11.22 (s, 1H), 8.86-8.82 (m, 1H), 8.38-8.32 (m,
1H), 7.94-7.87 (m, 4H), 7.74-7.29 (m, 5H), 6.06-5.64 (m, 1H),
4.40-4.30 (m, 2H), 3.94-3.91 (br s, 2H), 2.93-2.57 (m, 6H),
2.10-2.05 (m, 2H), 1.37-1.32 (m, 2H), 1.02-0.97 (m, 3H); MS (ESI)
m/e 443 (M+H).sup.+.
Example 106
Preparation of
(E)-3-(3,3-Dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepi-
n-7-yl)-N-methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)acrylamide
hydrochloride
a)
(E)-3-(3,3-Dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diaze-
pin-7-yl)-N-methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)acrylamide
[1095] A suspension of
7-bromo-3,3-dimethyl-1,3,4,5-tetrahydro-pyrido[2,3-e][1,4]diazepin-2-one
(0.17 g, 0.63 mmol) in propionitrile (4 mL) and DMF (1 mL) was
de-oxygenated with Ar for 10 min. The mixture was treated with
N-methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)acrylamide (0.20
g, 0.81 mmol) and (i-Pr).sub.2EtN (0.24 mL, 1.3 mmol) and was
de-oxygenated with Ar for 5 min. Pd(OAc).sub.2 (14 mg, 0.062 mmol)
and P(o-tol).sub.3 (38 mg, 0.12 mmol) were added simultaneously,
and the mixture was de-oxygenated a third time for 5 min. The
mixture was heated to reflux for 4 h, then allowed to cool. The
resulting precipitate was isolated by filtration, washed with
EtOAc, dissolved in CH.sub.2Cl.sub.2, and the solvent was removed
in vacuo. Purification by flash column chromatography (silica gel,
CH.sub.2Cl.sub.2/MeOH, 98:2) gave the title compound (0.15 g, 56%)
as a white solid: .sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 8.97
(s, 1H), 8.45 (s, 1H), 7.77-7.65 (m, 3H), 7.53 (s, 1H), 7.40-7.29
(m, 2H), 6.98-6.84 (m, 1H), 4.94-4.89 (m, 2H), 4.02 (s, 2H),
3.15-3.10 (m, 3H), 2.43 (s, 3H), 1.70 (s, 1H), 1.49 (s, 6H); MS
(ESI) m/e 435 (M+H).sup.+.
b)
(E)-3-(3,3-Dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diaze-
pin-7-yl)-N-methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)acrylamide
hydrochloride
[1096] A suspension of
(E)-3-(3,3-dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepi-
n-7-yl)-N-methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)acrylamide
(0.15 g, 0.35 mmol) in CH.sub.2Cl.sub.2 (10 mL) was treated with
anhydrous HCl in Et.sub.2O (0.35 mL, 1.0 M). After stirring for 5
min, the mixture was diluted with Et.sub.2O (50 mL) and allowed to
stir for 1 h. The solid was isolated by filtration, washed with
Et.sub.2O, and dried under vacuum at 60.degree. C. for 4 d to give
the title compound (0.16 g, 96%) as a light yellow powder and as a
mixture of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 10.92 (s, 1H), 10.56 (br s, 2H), 8.66-8.67 (m, 1H), 8.40
(s, 1H), 7.86-7.89 (m, 1H), 7.73-7.75 (m, 1H), 7.58-7.63 (m, 1H),
7.30-7.40 (m, 3H), 4.90-5.13 (m, 2H), 4.39-4.41 (m, 2H), 2.94-3.17
(m, 3H), 2.43 (s, 3H), 1.63 (s, 6H); MS (ESI) m/e 435
(M+H).sup.+.
Example 107
Preparation of
(E)-N-Methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]di-
azepin-7-yl)-N-naphthalen-2-ylmethyl-acrylamide hydrochloride
[1097] According to the procedure of Example 1, except substituting
methyl-naphthalen-2-ylmethyl-amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.397 g, quantitative) was prepared as an off-white solid and as a
mixture of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 11.00-10.86 (br s, 1H), 11.28-11.24 (m, 1H), 8.85-8.81 (m,
1H), 8.35-8.29 (m, 1H), 7.95-7.75 (m, 4H), 7.67-7.62 (m, 1H),
7.54-7.38 (m, 4H), 5.01-4.81 (m, 2H), 4.31 (br s, 2H), 3.73 (br s,
2H), 3.17-2.97 (m, 3H), 2.91-2.87 (m, 3H); MS (ESI) m/e 401
(M+H).sup.+.
Example 108
Preparation of
(E)-N-Methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]di-
azepin-7-yl)-N-naphthalen-1-ylmethyl-acrylamide hydrochloride
[1098] According to the procedure of Example 1, except substituting
methyl-naphthalen-1-ylmethyl-amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.382 g, quantitative) was prepared as an off white solid and as a
mixture of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 12.24-12.15 (br s, 1H), 11.27-11.21 (m, 1H), 8.85-8.76 (m,
1H), 8.36-8.30 (m, 1H), 8.20-7.02 (m, 9H), 5.36-5.12 (m 2H), 4.29
(br s, 2H), 3.86-3.77 (br s, 2H), 3.17-3.10 (m, 3H), 2.90-2.84 (m,
3H); MS (ESI) m/e 401 (M+H).sup.+.
Example 109
Preparation of
(E)-N-(4-Acetylamino-benzyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]na-
phthyridin-3-yl)acrylamide
[1099] According to the procedure of Example 1(a), except
substituting 4-acetamidobenzyl methyl amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3yl)acrylic acid
hydrochloride for
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, the title compound (0.283 g, 53%)
was prepared as an off-white solid and as a mixture of amide
rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.66-10.64
(m, 1H), 9.94-9.92 (m, 1H), 8.36-8.33 (m, 1H), 8.07-8.06 (m, 1H),
7.56-7.48 (m, 3H), 7.33-7.13 (m, 3H), 4.74-4.54 (m, 2H), 3.07-2.86
(m, 5H), 2.53-2.49 (m 2H), 2.01 (s, 3H); MS (ESI) m/e 379
(M+H).sup.+.
Example 110
Preparation of
(E)-N-(4-Methanesulfonyl-benzyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-[1,-
8]naphthyridin-3-yl)acrylamide
[1100] According to the procedure of Example 1(a), except
substituting (4-methanesulfonyl-benzyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-(7-oxo-5,6,7,8-tetrahydro[1,8]naphthyridin-3yl)acrylic acid
hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, the title compound (0.400 g, 71%)
was prepared as an off-white solid and as a mixture of amide
rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.6-10.65
(m, 1H), 8.38-8.34 (m, 1H), 8.10-8.04 (m, 1H), 7.95-7.89 (m, 2H),
7.57-7.46 (m, 3H), 7.28-7.23 (m, 1H), 4.96-4.72 (m, 2H), 3.20-3.16
(m, 5H), 2.94-2.84 (m, 3H) 2.56-2.49 (m, 2H); MS (APCI) m/e 400
(M+H).sup.+.
Example 111
Preparation of
(E)-N-(2-Methoxy-naphthalen-1-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahy-
dro-[1,8]naphthyridin-3-yl]acrylamide
[1101] According to the procedure of Example 1(a), except
substituting (2-methoxy-naphthalen-1-ylmethyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3yl)acrylic acid
hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, the title compound (0.403 g, 71%)
was prepared as an orange-brown solid and as a mixture of amide
rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.66 (s,
1H), 8.37 (s, 1H), 8.08-7.81 (m, 4H), 7.70-7.11 (m, 5H), 5.22-5.09
(m, 2H), 3.98-3.90 (m, 3H), 2.91-2.87 (m, 5H), 2.63-2.49 (m, 2H);
MS (ESI) m/e 402 (M+H).sup.+.
Example 112
Preparation of
(E)-N-Methyl-N-(4-methyl-naphthalen-1-ylmethyl)-3-(7-oxo-5,6,7,8-tetrahyd-
ro-[1,8]naphthyridin-3-yl]acrylamide
[1102] According to the procedure of Example 1(a), except
substituting methyl-(4-methyl-naphthalen-1ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3yl)acrylic acid
hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, the title compound (0.410 g, 76%)
was prepared as an off-white solid and as a mixture of amide
rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.67-10.62
(m, 1H), 8.38-8.29 (m, 1H), 8.15-7.94 (m, 3H), 7.60-7.55 (m, 3H),
7.36-7.02 (m, 3H), 5.30-5.06 (m, 2H), 3.04-2.73 (m, 5H), 2.65-2.45
(m, 5H); MS (ESI) m/e 386 (M+
Example 113
Preparation of
(E)-N-(2,3-Dimethyl-benzyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]nap-
hthyridin-3-yl]acrylamide
[1103] According to the procedure of Example 1(a), except
substituting 2,3-dimethylbenzylmethyl amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3yl)acrylic acid
hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, the title compound (0.368 g, 75%)
was prepared as an off-white solid and as a mixture of amide
rotamers: NMR (300 MHz, DMSO-d.sub.6) .delta. 10.68-10.64 (m, 1H),
8.38-8.32 (m, 1H), 8.10-7.99 (m, 1H), 7.57-7.50 (m, 1H), 7.29-7.04
(m, 3H), 6.94-6.77 (m, 1H); 4.82-4.65 (m, 2H), 3.06-2.85 (m, 5H),
2.57-2.48 (m 2H), 2.28-2.14 (m, 6H); MS (APCI) m/e 350
(M+H).sup.+.
Example 114
Preparation of
(E)-N-(4-Isopropyl-benzyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naph-
thyridin-3-yl]acrylamide
[1104] According to the procedure of Example 1(a), except
substituting (4-isopropyl-benzyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3yl)acrylic acid
hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, the title compound (0.223 g, 61%)
was prepared as a light orange solid and as a mixture of amide
rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.66-10.64
(m, 1H), 8.36-8.33 (m, 1H), 8.07 (s, 1H), 7.55-7.48 (m, 1H),
7.33-7.11 (m, 5H), 4.77-4.56 (m, 2H), 3.09-2.81 (m, 6H), 2.56-2.49
(m 2H), 1.19-1.16 (m, 6H); MS (APCI) m/e 364 (M+H).sup.+.
Example 115
Preparation of
(E)-N-Indan-5ylmethyl-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyri-
din-3-yl]acrylamide
[1105] According to the procedure of Example 1(a), except
substituting indan-5-ylmethyl-methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3yl)acrylic acid
hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl]acrylic acid hydrochloride, the title compound (0.232 g, 45%)
was prepared as an off-white solid and as a mixture of amide
rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.66-10.64
(m, 1H), 8.36-8.33 (m, 1H), 8.07-8.06 (m, 1H), 7.54-7.49 (m, 1H),
7.33-6.89 (m, 4H), 4.75-4.56 (m, 2H), 3.07-2.72 (m, 9H), 2.53-2.49
(m, 2H), 2.04-1.94 (m 2H); MS (APCI) m/e 362 (M+
Example 116
Preparation of
(E)-N-Indan-5ylmethyl-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-py-
rido[2,3-e][1,4]diazepin-7-yl]acrylamide hydrochloride
[1106] According to the procedure of Example 1, except substituting
indan-5-ylmethyl-methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.060 g, 88%) was prepared as a white solid and as a mixture of
amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 12.02
(br s, 1H), 11.20 (s, 1H), 8.82-8.79 (m, 1H), 8.32-8.29 (m, 1H),
7.64-7.57 (m, 1H), 7.45-7.32 (m, 1H), 7.22-6.85 (m, 3H), 4.77-4.58
(m, 2H), 4.42 (br s, 2H), 3.80 (br s, 2H), 3.09-2.73 (m, 10H),
2.04-1.94 (m, 2H); MS (ESI) m/e 391 (M+
[1107] H).sup.+.
Example 117
Preparation of
(E)-N-Methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)-3-(4-methyl-2-oxo-2-
,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide
hydrochloride
[1108] According to the procedure of Example 1, except substituting
methyl-(3-methyl-benzo[b]thiophen-2-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.295 g, 98%) was prepared as a white solid and as a mixture of
amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 12.20
(br s, 1H), 11.22 (s, 1H), 8.83 (s, 1H), 8.34-8.31 (m, 1H),
7.89-7.86 (m, 1H), 7.75-7.72 (m, 1H), 7.65-7.31 (m, 4H), 5.13-4.90
(m, 2H), 4.29 (br s, 2H), 3.80 (br s, 2H), 3.17-2.95 (m, 3H), 2.87
(s, 3H), 2.42 (s, 3H); MS (APCI) m/e 421 (M+H).sup.+.
Example 118
Preparation of
(E)-N-(3,5-Dimethoxy-benzyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydr-
o-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide hydrochloride
[1109] According to the procedure of Example 1, except substituting
(3,5-dimethoxy-benzyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.307 g, quantitative) was prepared as an off-white solid and as a
mixture of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 11.7 (br s, 1H), 10.88 (s, 1H), 8.71-8.68 (m, 1H),
8.25-8.22 (m, 1H), 7.61-7.56 (m, 1H), 7.39-7.31 (m, 1H), 6.42-6.35
(m, 3H), 4.75-4.55 (m, 2H), 4.09 (br s, 2H), 3.72-3.71 (m, 6H),
3.37 (br s, 2H), 3.11-2.89 (m, 3H), 2.73 (br s, 3H); MS (ESI) m/e
411 (M+H).sup.+.
Example 119
Preparation of
(E)-N-[2-(1H-Indol-3-yl)-ethyl]-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrah-
ydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide
hydrochloride
[1110] According to the procedure of Example 1, except substituting
[2-(1H-indole-3yl)-ethyl]methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.027 g, 72%) was prepared as a yellow solid and as a mixture of
amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 12.25
(br s, 1H), 11.26-11.22 (m, 1H), 10.85 (s, 1H), 8.82-8.41 (m, 1H),
8.33-7.82 (m, 1H), 7.64-6.73 (m, 7H), 4.59-4.31 (m, 4H), 3.78-3.64
(m, 3H), 3.17-2.91 (m, 7H); MS (APCI) m/e 404 (M+H).sup.+.
Example 120
Preparation of
(E)-N-Methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]di-
azepin-7-yl)-N-(2,4,5-trimethoxy-benzyl)acrylamide
hydrochloride
[1111] According to the procedure of Example 1, except substituting
methyl-(2,4,5-trimethoxy-benzyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.220 g, 78%) was prepared as a light orange solid and as a
mixture of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 11.75 (br s, 1H), 11.19 (s, 1H), 8.81-8.78 (m, 1H),
8.30-8.26 (m, 1H), 7.60-7.31 (m, 2H), 6.73-6.72 (m, 2H), 4.66-4.52
(m, 2H), 4.27 (br s, 2H), 3.79-3.64 (m, 11H), 3.09-2.86 (m, 6H); MS
(ESI) m/e 441 (M+H).sup.+.
Example 121
Preparation of
(E)-N-Methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e](1,4]di-
azepin-7-yl)-N-phenanthren-9-ylmethyl-acrylamide hydrochloride
[1112] According to the procedure of Example 1, except substituting
methyl-phenanthren-9-ylmethyl-amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.511 g, 95%) was prepared as an off-white solid and as a mixture
of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
11.99 (br s, 1H), 11.23-11.14 (m, 1H), 8.92-8.74 (m, 3H), 8.36-8.04
(m, 2H), 7.99-7.95 (m, 1H), 7.74-7.28 (m, 7H), 5.39-5.17 (m, 2H),
4.30-4.19 (m, 2H), 3.95-3.39 (m, 2H), 3.16-3.01 (m, 3H), 2.89-2.73
(m, 3H); MS (ESI) m/e 451 (M+H).sup.+.
Example 122
Preparation of
(E)-N-Acenaphthen-5-ylmethyl-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydr-
o-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide hydrochloride
[1113] According to the procedure of Example 1, except substituting
acenaphthen-5-ylmethyl-methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.395 g, 91%) was prepared as a off-white solid and as a mixture
of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
12.01 (br s, 1H), 11.19 (s, 1H), 8.82-8.76 (m, 1H), 8.32-8.22 (m,
1H), 7.81-7.63 (m, 2H), 7.55-7.14 (m, 5H), 5.25-5.03 (m, 2H), 4.28
(br s, 2H), 3.79 (m, 2H), 3.36 (br s, 4H), 3.04-2.73 (m, 6H); MS
(ESI) m/e 427 (M+H).sup.+.
Example 123
Preparation of
(E)-N-(4-Methoxy-naphthalen-1ylmethyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-
-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide
hydrochloride
[1114] According to the procedure of Example 1, except substituting
(4-methoxy-naphthalen-1-ylmethyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.369 g, 87%) was prepared as an off-white solid and as a mixture
of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
11.95 (br s, 1H), 11.22 (s, 1H), 8.83-8.76 (m, 1H), 8.32-8.02 (m,
2H), 8.10-8.00 (m, 1H), 7.69-7.32 (m, 5H), 7.11-6.95 (m, 1H),
5.25-5.03 (m, 2H), 4.29 (br s, 2H), 3.98-3.95 (m, 3H), 3.79 (m,
2H), 3.02-2.69 (m, 3H), 2.87-2.72 (m, 3H); MS (ESI) m/e 431
(M+H).sup.+.
Example 124
Preparation of
(E)-N-Benzol-1,3]-dioxol-5-ylmethyl-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-te-
trahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide
hydrochloride
[1115] According to the procedure of Example 1, except substituting
benzo[1,3]dioxol-5-ylmethyl-methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.374 g, 91%) was prepared as an off-white solid and as a mixture
of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
12.25 (br s, 1H), 11.23 (s, 1H), 8.81 (s, 1H), 8.32 (s, 1H),
7.62-6.57 (m, 1H), 7.46-7.31 (m, 1H), 6.93-6.71 (m, 3H), 5.99 (s,
2H), 4.72-4.52 (m, 2H), 4.29 (br s, 2H), 3.81 (br s, 2H), 3.10-2.88
(m, 6H); MS (APCI) m/e 395 (M+H).sup.+.
Example 125
Preparation of
(E)-N-(2,5-Dimethoxy-benzyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydr-
o-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide hydrochloride
[1116] According to the procedure of Example 1, except substituting
(2,5-dimethoxy-benzyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.396 g, 93%) was prepared as an off-white solid and as a mixture
of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
12.05 (br s, 1H), 11.20 (m, 1H), 8.82-8.77 (m, 1H), 8.33-8.27 (m,
1H), 7.61-7.56 (m, 1H), 7.41-7.34 (m, 1H), 6.98-6.93 (m, 1H),
6.86-6.82 (m, 1H), 6.60-6.59 (m, 1H), 4.73-4.55 (m, 2H), 4.28 (br
s, 2H), 3.79-3.74 (m, 5H), 3.66-3.65 (m, 3H), 3.16-2.86 (m, 6H); MS
(ESI) m/e 411 (M+H).sup.+.
Example 126
Preparation of
(E)-N-Methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]di-
azepin-7-yl)-N-quinolin-4-ylmethyl-acrylamide hydrochloride
[1117] According to the procedure of Example 1, except substituting
methyl-quinolin-4-ylmethyl-amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.259 g, 92%) was prepared as an off-white solid and as a mixture
of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
11.22-11.14 (m, 1H), 8.98-8.94 (m, 1H), 8.84-8.74 (m, 1H),
8.37-8.16 (m, 3H), 7.93-7.88 (m, 1H), 7.78-7.73 (m, 1H), 7.69-7.63
(m, 1H), 7.48-7.21 (m, 2H), 5.50-5.24 (m, 2H), 4.30-4.19 (m, 2H),
3.81-3.74 (m, 2H), 3.27 (s, 2H), 3.06 (s, 1H), 2.87-2.80 (m, 3H);
MS (ESI) m/e 402 (M+H).sup.+.
Example 127
Preparation of
(E)-N-(4-Ethoxy-3-methoxy-benzyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetr-
ahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide
hydrochloride
[1118] According to the procedure of Example 1, except substituting
(4-ethoxy-3-methoxy-benzyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.310 g, 95%) was prepared as an off-white solid and as a mixture
of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
11.18 (m, 1H), 8.80-8.79 (m, 1H), 8.30-8.28 (m, 1H), 7.61-7.57 (m,
1H), 7.44-7.30 (m, 1H), 6.95-6.71 (m, 3H), 4.72-4.53 (m, 2H), 4.27
(br s, 2H), 3.99-3.92 (m, 2H), 3.79-3.72 (m, 5H), 3.08-2.72 (m,
6H), 1.33-1.26 (m, 3H); MS (ESI) m/e 425 (M+H).sup.+.
Example 128
Preparation of
(E)-N-(2-Ethoxy-3-methoxy-benzyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetr-
ahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide
hydrochloride
[1119] According to the procedure of Example 1, except substituting
(2-ethoxy-3-methoxy-benzyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.381 g, 89%) was prepared as an off-white solid and as a mixture
of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
12.01 (br s, 1H), 11.21 (s, 1H), 8.82-8.78 (m, 1H), 8.33-8.25 (m,
1H), 7.61-7.56 (m, 1H), 7.40-7.34 (m, 1H), 7.05-6.97 (m, 2H),
6.71-6.61 (m, 1H), 4.80-4.52 (m, 2H), 4.29 (br s, 2H), 4.0-3.94 (m,
2H), 3.79 (m, 5H), 3.11-2.87 (m, 6H), 1.31-1.25 (m, 3H); MS (ESI)
m/e 425 (M+H).sup.+.
Example 129
Preparation of
(E)-N-(3,4-Dimethyl-benzyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-
-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide hydrochloride
[1120] According to the procedure of Example 1, except substituting
(3,4-dimethyl-benzyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.346 g, 91%) was prepared as an off-white solid and as a mixture
of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
12.35 (br s, 1H), 11.23 (s, 1H), 8.82-8.79 (m, 1H), 8.34-8.30 (m,
1H), 7.62-7.57 (m, 1H), 7.44-7.32 (m, 1H), 7.14-7.08 (m, 1H),
7.02-6.92 (m, 2H), 4.74-4.55 (m, 2H), 4.28 (br s, 2H), 3.80 (m,
2H), 3.08-2.86 (m, 6H), 2.20-2.19 (m, 6H); MS (ESI) m/e 379
(M+H).sup.+.
Example 130
Preparation of
(E)-N-Methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]di-
azepin-7-yl)-N-(2,4,6-trimethyl-benzyl)acrylamide hydrochloride
[1121] According to the procedure of Example 1, except substituting
(2,4,6-trimethyl-benzyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.410 g, 94%) was prepared as an off-white solid and as a mixture
of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
11.80 (br s, 1H), 11.20 (m, 1H), 8.84-8.80 (m, 1H), 8.37-8.31 (m,
1H), 7.61-7.56 (m, 1H), 7.32-7.27 (m, 1H), 6.87 (m, 2H), 4.83-4.68
(m, 2H), 4.28 (br s, 2H), 3.80 (m, 2H), 2.87-2.55 (m, 6H),
2.21-2.16 (m, 9H); MS (ESI) m/e 393 (M+H).sup.+.
Example 131
Preparation of
(E)-N-Methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]di-
azepin-7-yl)-N-(2,4,5-trimethyl-benzyl)acrylamide hydrochloride
[1122] According to the procedure of Example 1, except substituting
(2,4,5-trimethyl-benzyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.344 g, 95%) was prepared as an off-white solid and as a mixture
of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
11.91 (br s, 1H), 11.25-11.22 (m, 1H), 8.83-8.78 (m, 1H), 8.34-8.24
(m, 1H), 7.63-7.57 (m, 1H), 7.40-7.32 (m, 1H), 6.97-6.95 (m, 1H),
6.85-6.73 (m, 1H), 4.73-4.57 (m, 2H), 4.30 (br s, 2H), 3.96-3.82
(m, 2H), 3.04-2.87 (m, 6H), 2.21-2.15 (m, 9H); MS (ESI) m/e 393
(M+H).sup.+.
Example 132
Preparation of
(E)-N-Methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]di-
azepin-7-yl)-N-quinolin-3-ylmethyl-acrylamide hydrochloride
[1123] According to the procedure of Example 1, except substituting
methyl-quinolin-3-ylmethyl-amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.360 g, 92%) was prepared as an off-white solid and as a mixture
of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
12.00 (br s, 1H), 11.23-11.20 (m, 1H), 8.92-8.89 (m, 1H), 8.83-8.80
(m, 1H), 8.34-8.24 (m, 2H), 8.08-8.03 (m, 2H), 7.80-7.78 (m, 1H),
7.69-6.61 (m, 2H), 7.52-7.36 (m, 1H), 5.09-4.86 (m, 2H), 4.30-4.25
(m, 2H), 3.81 (br s, 2H), 3.25 (s, 2H), 3.01 (s, 1H), 2.88-2.85 (m,
3H); MS (ESI) m/e 402 (M+H).sup.+.
Example 133
Preparation of
(E)-N-(3,4-Dimethoxy-benzyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydr-
o-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide hydrochloride
[1124] According to the procedure of Example 1, except substituting
(3,4-dimethoxy-benzyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.330 g, 92%) was prepared as a pale yellow solid and as a mixture
of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
11.95 (br s, 1H), 11.23 (s, 1H), 8.82-8.81 (m, 1H), 8.32-8.30 (m,
1H), 7.63-7.57 (m, 1H), 7.45-7.32 (m, 1H), 6.95-6.86 (m, 2H),
6.81-6.71 (m, 1H), 4.74-4.55 (m, 2H), 4.28 (br s, 2H), 3.95-3.72
(m, 8H), 3.10-2.88 (m, 6H); MS (ESI) m/e 411 (M+H).sup.+.
Example 134
Preparation of
(E)-N-Benzofuran-2-ylmethyl-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-
-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide hydrochloride
[1125] According to the procedure of Example 1, except substituting
benzofuran-2-ylmethyl-methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.399 g, 93%) was prepared as an off white solid and as a mixture
of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
11.86 (br s, 1H), 11.22 (s, 1H), 8.83 (s, 1H), 8.32 (s, 1H),
7.63-7.20 (m, 6H), 6.86-6.82 (m, 1H), 5.02-4.81 (m, 2H), 4.28 (s,
2H), 3.80 (s, 2H), 3.24-3.02 (m, 3H), 2.87 (s, 3H); MS (ESI) m/e
391 (M+
Example 135
Preparation of
(E)-N-Methyl-N-(2-methyl-naphthalen-1-ylmethyl)-3-(4-methyl-2-oxo-2,3,4,5-
-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide
hydrochloride
[1126] According to the procedure of Example 1, except substituting
methyl-(2-methyl-naphthalen-1-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.431 g, 95%) was prepared as a white solid and as a mixture of
amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 12.01
(br s, 1H), 11.24 (s, 1H), 8.93-8.83 (m, 1H), 8.44-8.32 (m, 1H),
8.10-8.07 (m, 1H), 7.92-7.82 (m, 2H), 7.71-7.66 (m, 1H), 7.49-7.28
(m, 4H), 5.30-5.18 (m, 2H), 4.29 (br s, 2H), 3.79 (br s, 2H),
2.87-2.81 (m, 6H), 2.55-2.51 (s, 3H); MS (ESI) m/e 415
(M+H).sup.+.
Example 136
Preparation of
(E)-N-Biphenyl-2-ylmethyl-methyl-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetra-
hydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide
hydrochloride
[1127] According to the procedure of Example 1, except substituting
biphenyl-2-ylmethyl-methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.255 g, 88%) was prepared as a white solid and as a mixture of
amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 11.95
(br s, 1H), 11.22 (s, 1H), 8.80-8.76 (m, 1H), 8.31-8.19 (m, 1H),
7.57-7.17 (m, 11H), 4.76-4.59 (m, 2H), 4.29 (br s, 2H), 3.81 (br s,
2H), 2.99-2.73 (m, 6H); MS (ESI) m/e 427 (M+H).sup.4.
Example 137
Preparation of
(E)-N-Biphenyl-3-ylmethyl-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1-
H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide hydrochloride
[1128] According to the procedure of Example 1, except substituting
biphenyl-3-ylmethyl-methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.404 g, 85%) was prepared as an off-white solid and as a mixture
of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
11.95 (br s, 1H), 11.22-11.21 (m, 1H), 8.82-8.81 (m, 1H), 8.32-8.30
(m, 1H), 7.65-7.21 (m, 11H), 7.92-7.82 (m, 2H), 4.92-4.71 (m, 2H),
4.28 (br s, 2H), 3.79 (br s, 2H), 2.17-2.96 (m, 3H), 2.88-2.84 (m,
3H); MS (ESI) We 427 (M+H).sup.4.
Example 138
Preparation of
(E)-N-(2-Ethoxy-napthalen-1-ylmethyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5--
tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide
hydrochloride
[1129] According to the procedure of Example 1, except substituting
methyl-(2-ethoxy-naphthalen-1-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.405 g, 90%) was prepared as a white solid and as a mixture of
amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 12.35
(br s, 1H), 11.25 (s, 1H), 8.84-8.82 (m, 1H), 8.40-8.31 (m, 1H),
8.07-8.05 (m, 1H), 7.96-7.87 (m, 2H), 7.68-7.63 (m, 1H), 7.52-7.25
(m, 4H), 5.26-5.16 (m, 2H), 4.29-4.20 (m, 4H), 4.09 (br s, 2H),
2.91-2.63 (m, 6H), 1.43-1.29 (s, 3H); MS (ESI) m/e 445 (M+H.
Example 139
Preparation of
(E)-N-(2-Ethoxy-benzyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H--
pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide hydrochloride
[1130] According to the procedure of Example 1, except substituting
(2-ethoxy-benzyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.409 g, 87%) was prepared as a white solid and as a mixture of
amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 12.05
(br s, 1H), 11.20 (s, 1H), 8.82-8.77 (m, 1H), 8.32-8.27 (m, 1H),
7.61-7.55 (m, 1H), 7.44-7.35 (m, 1H), 7.27-7.20 (m, 1H), 7.09-6.90
(m, 3H), 4.76-4.59 (m, 2H), 4.28 (br s, 2H), 4.09-4.01 (m, 2H),
3.80 (br s, 2H), 3.16-2.85 (m, 6H), 1.37-1.27 (m, 3H); MS (ESI) m/e
395 (M+H).sup.+.
Example 140
Preparation of
(E)-N-Methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]di-
azepin-7-yl)-N-(2,3,4-trimethoxy-benzyl)acrylamide
hydrochloride
[1131] According to the procedure of Example 1, except substituting
(2,3,4-trimethoxy-benzyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.440 g, 92%) was prepared as a white solid and as a mixture of
amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 12.25
(br s, 1H), 11.23 (s, 1H), 8.82-8.79 (m, 1H), 8.34-8.29 (m, 1H),
7.61-7.55 (m, 1H), 7.46-7.33 (m, 1H), 6.81-6.75 (m, 2H), 4.71-4.56
(m, 2H), 4.30 (br s, 2H), 3.81-3.74 (m, 11H), 3.11-2.85 (m, 6H); MS
(ESI) m/e 441 (M+H).sup.+.
Example 141
Preparation of
(E)-N-(2,3-Dihydro-benzo[1,4]dioxin-6ylmethyl)-N-methyl-3-(4-methyl-2-oxo-
-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide
hydrochloride
[1132] According to the procedure of Example 1, except substituting
(2,3-dihydro-benzo[1,4]dioxin-6-ylmethyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.196 g, 93%) was prepared as a white solid and as a mixture of
amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 12.25
(br s, 1H), 11.25 (s, 1H), 8.82 (s, 1H), 8.32 (s, 1H), 7.63-7.56
(m, 1H), 7.45-7.31 (m, 1H), 6.86-6.68 (m, 3H), 4.70-4.49 (m, 2H),
4.30 (br s, 2H), 4.21 (m, 4H), 3.82 (br s, 2H), 3.09-2.87 (m, 6H);
MS (APCI) m/e 409 (M+H).sub.3.
Example 142
Preparation of
(E)-N-(2,3-Diethoxy-benzyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-
-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide hydrochloride
[1133] According to the procedure of Example 1, except substituting
(2,3-diethoxy-benzyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.331 g, 87%) was prepared as an off-white solid and as a mixture
of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
12.49 (br s, 1H), 11.24-11.22 (m, 1H), 8.83-8.78 (m, 1H), 8.36-8.28
(m, 1H), 7.62-7.56 (m, 1H), 7.42-7.35 (m, 1H), 7.05-6.92 (m, 2H),
6.69-6.63 (m, 1H), 4.80-4.65 (m, 2H), 4.30 (br s, 2H), 4.07-3.93
(m, 4H), 3.81 (br s, 2H), 3.12-2.80 (m, 6H), 1.37-1.25 (m, 6H); MS
(APCI) m/e 439 (M+H).sup.+.
Example 143
Preparation of
(E)-N-(3-Ethoxy-2-methoxy-benzyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetr-
ahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide
hydrochloride
[1134] According to the procedure of Example 1, except substituting
(3-ethoxy-2-methoxy-benzyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.397 g, quantitative) was prepared as an off-white solid and as a
mixture of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 12.25 (br s, 1H), 11.23-11.21 (m, 1H), 8.82-8.78 (m, 1H),
8.34-8.27 (m, 1H), 7.62-7.56 (m, 1H), 7.44-7.34 (m, 1H), 7.04-6.96
(m, 2H), 6.69-6.66 (m, 1H), 4.78-4.63 (m, 2H), 4.30 (br s, 2H),
4.09-4.02 (m, 2H), 3.82-3.76 (m, 5H), 3.12-2.86 (m, 6H), 1.38-1.32
(m, 3H); MS (ESI) m/e 425 (M+H).sup.+.
Example 144
Preparation of
(E)-N-(2-Ethoxy-3-methyl-benzyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetra-
hydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide
hydrochloride
[1135] According to the procedure of Example 1, except substituting
(2-ethoxy-3-methyl-benzyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.358 g, 84%) was prepared as an off-white solid and as a mixture
of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
12.21 (br s, 1H), 11.23-11.21 (m, 1H), 8.82-8.78 (m, 1H), 8.34-8.25
(m, 1H), 7.63-7.56 (m, 1H), 7.41-7.35 (m, 1H), 7.16-7.11 (m, 1H),
7.05-6.87 (m, 2H), 4.82-4.67 (m, 2H), 4.30 (br s, 2H), 3.90-3.80
(m, 4H), 3.18-2.86 (m, 6H), 2.24 (s, 3H), 1.42-1.28 (m, 3H); MS
(ESI) m/e 409 (M+H).sup.+.
Example 145
Preparation of
(E)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]di-
azepin-7-yl)-N-quinolin-5ylmethyl-acrylamide hydrochloride
[1136] According to the procedure of Example 1, except substituting
methyl-quinolin-5-ylmethyl-amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.399 g, quantitative) was prepared as an off-white solid and as a
mixture of amide rotamers: NMR (300 MHz, DMSO-d.sub.6) .delta.
12.30 (br s, 1H), 11.19-11.13 (m, 1H), 8.90-8.98 (m, 1H), 8.82-8.62
(m, 2H), 8.34-8.18 (m, 1H), 8.06-7.99 (m, 1H), 7.83-7.87 (m, 1H),
7.72-7.27 (m, 4H), 5.41-5.15 (m, 2H), 4.28-4.19 (m, 2H), 3.79-3.74
(m, 2H), 3.12-3.01 (m, 3H), 2.85-2.79 (m, 3H); MS (ESI) m/e 402
(M+H).sup.+.
Example 146
Preparation of
(E)-N-(3-Methoxy-2-propoxy-benzyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tet-
rahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide
hydrochloride
[1137] According to the procedure of Example 1, except substituting
(3-methoxy-2-propoxy-benzyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.275 g, 87%) was prepared as an off-white solid and as a mixture
of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
12.21 (m, 1H), 11.23-11.21 (m, 1H), 8.83-8.78 (m, 1H), 8.34-8.25
(m, 1H), 7.63-7.56 (m, 1H), 7.40-7.34 (m, 1H), 7.05-6.97 (m, 2H),
6.69-6.64 (m, 1H), 4.80-4.65 (m, 2H), 4.30 (m, 2H), 3.92-3.85 (m,
2H), 3.79 (s, 3H), 3.49 (br s, 2H), 3.12-2.86 (m, 6H), 1.75-1.68
(m, 2H), 1.01-0.94 (m, 3H); MS (ESI) m/e 439 (M+H].sup.+.
Example 147
Preparation of
(E)-N-(3-Methoxy-2-isopropoxy-benzyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5--
tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide
hydrochloride
[1138] According to the procedure of Example 1, except substituting
(3-methoxy-2-isopropoxy-benzyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.304 g, 85%) was prepared as an off-white solid and as a mixture
of amide rotamers: NMR (300 MHz, DMSO-d.sub.6) .delta. 12.20 (br s,
1H), 11.24-11.21 (m, 1H), 8.82-8.77 (m, 1H), 8.35-8.23 (m, 1H),
7.61-7.56 (m, 1H), 7.40-7.30 (m, 1H), 7.04-6.93 (m, 2H), 6.67-6.61
(m, 1H), 4.79-4.65 (m, 2H), 4.59-4.48 (m, 1H), 4.30-4.28 (br s,
2H), 3.79 (s, 3H), 3.58-3.55 (m, 2H), 3.10-2.86 (m, 6H), 1.24-1.21
(m, 6H); MS (ESI) m/e 439 (M+H).sup.+.
Example 148
Preparation of
(E)-N-methyl-N-(3-methyl-benzofuran-2-ylmethyl)-3-(4-methyl-2-oxo-2,3,4,5-
-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide
hydrochloride
[1139] According to the procedure of Example 1, except substituting
methyl-(3-methyl-benzofuran-2-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.376 g, 87%) was prepared as an off-white solid and as a mixture
of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
12.16 (br s, 1H), 11.23 (s, 1H), 8.85-8.82 (m, 1H), 8.33 (s, 1H),
7.63-7.22 (m, 6H), 5.01-4.81 (m, 2H), 4.30 (m, 2H), 3.58 (br s,
2H), 3.20-2.88 (m, 6H), 2.27 (m, 3H); MS (ESI) m/e 405
(M+H).sup.+.
Example 149
Preparation of
(E)-N-(3-Chloro-2-methoxy-benzyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetr-
ahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide
hydrochloride
[1140] According to the procedure of Example 1, except substituting
(3-chloro-2-methoxy-benzyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.312 g, 92%) was prepared as an off-white solid and as a mixture
of amide rotamers: .sup.1H NMR (500 MHz, DMSO-d.sub.6) .delta.
12.55 (br s, 1H), 11.21-11.19 (m, 1H), 8.82-8.79 (m, 1H), 8.35-8.28
(m, 1H), 7.61-7.57 (m, 1H), 7.45-7.31 (m, 2H), 7.19-7.11 (m, 2H),
4.87-4.70 (m, 2H), 4.30 (m, 2H), 3.82-3.77 (m, 5H), 3.17-2.86 (m,
6H); MS (ESI) m/e 415 (M+H).sup.+.
Example 150
Preparation of
(E)-N-(3-Chloro-2-ethoxy-benzyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetra-
hydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide
hydrochloride
[1141] According to the procedure of Example 1, except substituting
(3-chloro-2-ethoxy-benzyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.169 g, 91%) was prepared as a white solid and as a mixture of
amide rotamers: .sup.1H NMR (500 MHz, DMSO-d.sub.6) .delta. 12.44
(br s, 1H), 11.20-11.18 (m, 1H), 8.82-8.78 (m, 1H), 8.34-8.25 (m,
1H), 7.62-7.57 (m, 1H), 7.44-7.36 (m, 2H), 7.18-7.10 (m, 2H),
4.87-4.70 (m, 2H), 4.30 (m, 2H), 4.05-3.98 (m, 2H), 3.79-3.61 (m,
2H), 3.16-2.85 (m, 6H), 1.39-1.35 (m, 3H); MS (ESI) m/e 429
(M+H).sup.+.
Example 151
Preparation of
(E)-N-(2,3-Dihydro-benzo[1,4]dioxin-5-ylmethyl)-N-methyl-3-(4-methyl-2-ox-
o-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide
hydrochloride
[1142] According to the procedure of Example 1, except substituting
(2,3-dihydro-benzo[1,4]dioxin-5-ylmethyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.058 g, quantitative) was prepared as a white solid and as a
mixture of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 12.15 (br s, 1H), 11.22-11.20 (m, 1H), 8.82-8.76 (m, 1H),
8.34-8.27 (m, 1H), 7.60-7.55 (m, 1H), 7.40-7.33 (m, 1H), 6.84-6.76
(m, 2H), 6.62-6.57 (m, 1H), 4.74-4.57 (m, 2H), 4.30-4.24 (m, 6H),
3.80 (br s, 2H), 3.16-2.87 (m, 6H); MS (ESI) m/e 409
(M+H).sup.+.
Example 152
Preparation of
(E)-N-(4,5-Dimethyl-naphthalen-1-ylmethyl)-N-methyl-3-(4-methyl-2-oxo-2,3-
,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide
hydrochloride
[1143] According to the procedure of Example 1, except substituting
(4,5-dimethyl-naphthalen-1-ylmethyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.244 g, 66%) was prepared as a white solid and as a mixture of
amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 12.08
(br s, 1H), 11.22-11.17 (m, 1H), 8.83-8.73 (m, 1H), 8.33-8.17 (m,
1H), 7.94-7.87 (m, 1H), 7.68-7.62 (m, 1H), 7.45-7.22 (m, 5H),
5.25-5.03 (m, 2H), 4.29-4.21 (m, 2H), 3.80 (br s, 2H), 3.11-3.04
(m, 3H), 2.97-2.81 (m, 9H); MS (ESI) m/e 429 (M+H).sup.+.
Example 153
Preparation of
(E)-N-Methyl-N-(2-methyl-benzofuran-3-ylmethyl)-3-(4-methyl-2-oxo-2,3,4,5-
-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide
hydrochloride
[1144] According to the procedure of Example 1, except substituting
methyl-(2-methyl-benzofuran-3-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.213 g, 53%) was prepared as a white solid and as a mixture of
amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 12.24
(br s, 1H), 11.22 (s, 1H), 8.88-8.82 (m, 1H), 8.38-8.33 (m, 1H),
7.79-7.15 (m, 6H), 4.95-4.75 (m, 2H), 4.29 (br s, 2H), 3.80 (br s,
2H), 3.13-2.83 (m, 6H), 2.59-2.44 (m, 3H); MS (ESI) m/e 405
(M+H).sup.+.
Example 154
Preparation of
(E)-N-Methyl-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3-yl)-N-quinol-
in-5-ylmethyl-acrylamide hydrochloride
[1145] According to the procedure of Example 1, except substituting
methyl-quinolin-5-ylmethyl-amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3-yl)acrylic acid
hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl]acrylic acid hydrochloride, the title compound (0.387 g,
quantitative) was prepared as a tan solid and as a mixture of amide
rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.69-10.63
(m, 1H), 9.26-9.13 (m, 2H), 8.39-8.25 (m, 2H), 8.11-7.93 (m, 3H),
7.77-7.45 (m, 2H), 7.30-7.17 (m, 1H), 5.50-5.22 (m, 2H), 3.15-3.01
(m, 3H), 2.94-2.78 (m, 2H), 2.56-2.44 (m, 2H); MS (ESI) m/e 373
(M+H).sup.+.
Example 155
Preparation of
(E)-N-benzyl-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3-yl]-
acrylamide
[1146] According to the procedure of Example 1(a), except
substituting benzyl-methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3-yl]acrylic acid
hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl]acrylic acid hydrochloride, the title compound (0.462 g, 93%)
was prepared as an off-white solid and as a mixture of amide
rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.64 (s,
1H), 8.37-8.33 (m, 1H), 8.08-8.06 (m, 1H), 7.54-7.49 (m, 1H),
7.37-7.21 (m, 6H), 4.82-4.61 (m, 2H), 3.10-2.85 (m, 5H), 2.56-2.49
(m, 2H); MS (APCI) m/e 322 (M+H].sup.+.
Example 156
Preparation of
(E)-N-methyl-N-(1-methyl-1H-indol-2-ylmethyl)-3-(4-methyl-2-oxo-2,3,4,5-t-
etrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide
hydrochloride
[1147] According to the procedure of Example 1, except substituting
methyl-(1-methyl-1H-indol-2-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.27 g, 86%) was prepared as an off-white powder and as a mixture
of amide rotamers: NMR (300 MHz, DMSO-d.sub.6) .delta. 11.96 (br s,
1H), 11.06-11.22 (m, 1H), 8.80-8.83 (m, 1H), 8.25-8.34 (m, 1H),
7.61-7.66 (m, 1H), 7.33-7.52 (m, 3H), 7.11-7.15 (m, 1H), 6.97-7.04
(m, 1H), 6.18-6.43 (m, 1H), 4.87-5.08 (m, 2H), 4.26-4.29 (m, 2H),
3.69-3.80 (m, 5H), 3.02-3.14 (m, 3H), 2.85-2.88 (m, 3H); MS (ESI)
m/e 404 (M+H).sup.+.
Example 157
Preparation of
(E)-(7-{2-[Methyl-(1-methyl-1H-indol-2-ylmethyl)carbamoyl]vinyl}-2-oxo-1,-
2,3,5-tetrahydro-pyrido[2,3-e][1,4]diazepin-4-yl)acetic acid ethyl
ester hydrochloride
[1148] According to the procedure of Example 1, except substituting
methyl-(1-methyl-1H-indol-2-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-(4-ethoxycarbonylmethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1-
,4]diazepin-7-yl]acrylic acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, the title compound (0.22 g, 56%) was
prepared as a yellow powder and as a mixture of amide rotamers:
.sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.53-10.54 (m, 1H),
8.56-8.59 (m, 1H), 8.09-8.16 (m, 1H), 7.28-7.61 (m, 4H), 7.10-7.15
(m, 1H), 6.99-7.04 (m, 1H), 6.19-6.42 (m, 1H), 4.86-5.06 (m, 2H),
4.00-4.14 (m, 5H), 3.62-3.72 (m, 7H), 2.99-3.12 (m, 3H), 1.12-1.20
(m, 3H); MS (ESI) m/e 476 (M+H).sup.+.
Example 158
Preparation of
(E)-N-(2,3-Dimethoxy-benzyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydr-
o-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide hydrochloride
[1149] According to the procedure of Example 1, except substituting
(2,3-dimethoxy-benzyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.25 g, 58%) was prepared as an off-white powder and as a mixture
of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
11.89 (br s, 1H), 11.21 (s, 1H), 8.78-8.82 (m, 1H), 8.26-8.33 (m,
1H), 7.56-7.61 (m, 1H), 7.34-7.44 (m, 1H), 6.96-7.07 (m, 2H),
6.67-6.71 (m, 1H), 4.64-4.79 (m, 2H), 4.28 (s, 2H), 3.74-3.81 (m,
8H), 2.87-3.13 (m, 6H); MS (ESI) tee 411 (M+H).sup.+.
Example 159
Preparation of
(E)-N-Methyl-N-(4-methyl-naphthalen-1-ylmethyl)-3-(4-methyl-2-oxo-2,3,4,5-
-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide
hydrochloride
[1150] According to the procedure of Example 1, except substituting
methyl-(4-methyl-naphthalen-1-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.41 g, 74%) was prepared as a tan powder and as a mixture of
amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 11.82
(br s, 1H), 11.16-11.20 (m, 1H), 8.74-8.83 (m, 1H), 8.06-8.33 (m,
3H), 7.56-7.69 (m, 3H), 7.33-7.39 (m, 3H), 5.09-5.32 (m, 2H),
4.20-4.28 (m, 2H), 3.80 (s, 2H), 2.99-3.06 (m, 3H), 2.81-2.86 (m,
3H), 2.64-2.66 (m, 3H); MS (ESI) m/e 415 (M+H).sup.+.
Example 160
Preparation of
(E)-N-(2-Methoxy-naphthalen-1-ylmethyl)-N-methyl-3-(4-methyl-2-oxo-2,34,5-
-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide
hydrochloride
[1151] According to the procedure of Example 1, except substituting
(2-methoxy-naphthalen-1-ylmethyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.41 g, 71%) was prepared as an off-white powder and as a mixture
of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
11.88 (br s, 1H), 11.20 (s, 1H), 8.81-8.85 (m, 1H), 8.30-8.36 (m,
1H), 7.88-8.08 (m, 3H), 7.24-7.69 (m, 5H), 5.15-5.24 (m, 2H), 4.28
(s, 2H), 3.80-3.99 (m, 5H), 2.64-2.90 (m, 6H); MS (ESI) m/e 431
(M+H).sup.+.
Example 161
Preparation of
(R)-(+)-(E)-N-Methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e-
][1,4]diazepin-7-yl)-N-(1-naphthalen-1-yl-ethyl)acrylamide
hydrochloride
[1152] According to the procedure of Example 1, except substituting
(R)-(+)-N-methyl-1-(1-naphthyl)ethylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.26 g, 48%) was prepared as an off-white powder and as a mixture
of amide rotamers: [.alpha.].sup.25.sub.D +92.6.degree. (c 1.00,
methanol); .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 12.11 (br s,
1H), 11.22 (s, 1H), 8.81-8.89 (m, 1H), 8.30-8.42 (m, 1H), 7.92-7.98
(m, 3H), 7.67-7.79 (m, 2H), 7.50-7.60 (m, 3H), 7.20-7.25 (m, 1H),
6.53-6.57 (m, 1H), 4.28 (s, 2H), 3.80 (s, 2H), 2.86-2.89 (m, 3H),
2.45-2.73 (m, 3H), 1.60-1.75 (m, 3H); MS (ESI) m/e 415 (M+
Example 162
Preparation of
(S)-(-)-(E)-N-Methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e-
][1,4]diazepin-7-yl)-N-(1-naphthalen-1-yl-ethyl)acrylamide
hydrochloride
[1153] According to the procedure of Example 1, except substituting
(S)-(-)-N-methyl-1-(1-naphthyl)ethylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.34 g, 63%) was prepared as an off-white powder:
[.alpha.].sup.25.sub.D-89.1.degree. (c 1.00, methanol); .sup.1H NMR
(300 MHz, DMSO-d.sub.6) .delta. 12.20 (br s, 1H), 11.21 (s, 1H),
8.88-8.81 (m, 1H), 8.41-8.30 (m, 1H), 7.98-7.92 (m, 3H), 7.72-7.67
(m, 2H), 7.59-7.50 (m, 3H), 7.25-7.19 (m, 1H), 6.57-6.51 (m, 1H),
4.28 (br s, 2H), 3.79 (br s, 2H), 2.89-2.85 (m, 3H), 2.73-2.67 (m,
3H), 1.75-1.59 (m, 3H); MS (ESI) m/e 415 (M+H).sup.+.
Example 163
Preparation of
(E)-N-Benzo[b]thiophen-2-ylmethyl-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetr-
ahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide
hydrochloride
[1154] According to the procedure of Example 1, except substituting
benzo[b]thiophen-2-ylmethyl-methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.40 g, 74%) was prepared as a tan powder: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 11.94 (br s, 1H), 11.14 (s, 1H), 8.89-8.84
(m, 1H), 8.33-8.31 (m, 1H), 7.90-7.87 (m, 1H), 7.81-7.79 (m, 1H),
7.66-7.52 (m, 1H), 7.39-7.31 (m, 4H), 5.13-4.87 (m, 2H), 4.30 (br
s, 2H), 3.81 (br s, 2H), 3.20-3.00 (m, 3H), 2.89 (s, 3H); MS (ESI)
m/e 407 (M+H).sup.+.
Example 164
Preparation of
(E)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]di-
azepin-7-yl)-N-(3-trifluoromethyl-benzyl)acrylamide
hydrochloride
[1155] According to the procedure of Example 1, except substituting
methyl-(3-trifluoromethyl-benzyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.39 g, 69%) was prepared as a tan powder: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 12.08 (br s, 1H), 11.23 (s, 1H), 8.83-8.81
(m, 1H), 8.33-8.27 (m, 1H), 7.66-7.35 (m, 6H), 4.96-4.72 (m, 2H),
4.30 (br s, 2H), 3.80 (br s, 2H), 3.17-2.85 (m, 6H); MS (ESI) m/e
419 (M+H).sup.+.
Example 165
Preparation of
(E)-N-(2-Chloro-benzyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H--
pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide hydrochloride
[1156] According to the procedure of Example 1, except substituting
(2-chlorobenzyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.38 g, 72%) was prepared as an off-white powder: .sup.1H NMR (300
MHz, DMSO-d.sub.6) .delta. 11.90 (br s, 1H), 11.23-11.91 (m, 1H),
8.83-8.78 (m, 1H), 8.34-8.24 (m, 1H), 7.63-7.32 (m, 5H), 7.20-7.16
(m, 1H), 4.92-4.71 (m, 2H), 4.30 (br s, 2H), 3.81 (br s, 2H), 3.20
(s, 2H), 2.91-2.86 (m, 4H); MS (ESI) ink 385 (M+H).sup.+.
Example 166
Preparation of
(E)-N-Methyl-N-(4-methyl-benzyl)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H--
pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide hydrochloride
[1157] According to the procedure of Example 1, except substituting
N-methyl-N-(4-methylbenzyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.24 g, 48%) was prepared as tan powder: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 12.25 (br s, 1H), 11.23-11.22 (m, 1H),
8.82-8.79 (m, 1H), 8.33-8.30 (m, 1H), 7.62-7.58 (m, 1H), 7.57-7.32
(m, 1H), 7.19-7.10 (m, 4H), 4.78-4.58 (m, 2H), 4.29 (br s, 2H),
3.80 (br s, 2H), 3.09-2.87 (m, 6H), 2.28 (s, 3H); MS (ESI) m/e 365
(M+H).sup.+.
Example 167
Preparation of
(R)-(-)-(E)-N-Methyl-N-(1-methyl-1H-indol-2-ylmethyl)-3-(10-oxo-2,3,4,9,1-
0,10a-hexahydro-1H-3a,8,9-triaza-benzo[f]azulen-6-yl]acrylamide
hydrochloride
[1158] According to the procedure of Example 1, except substituting
methyl-(1-methyl-1H-indol-2-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(R)--
(E)-3-(10-oxo-2,3,4,9,10,10a-hexahydro-1H-3a,8,9-triaza-benzo[f]azulen-6--
yl]acrylic acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, the title compound (0.19 g, 35%) was
prepared as a tan powder: [.alpha.].sup.25.sub.D-173.9.degree. (c
1.00, methanol); .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 12.50
(br s, 1H), 11.27 (s, 1H), 8.83-8.74 (m, 1H), 8.32-8.25 (m, 1H),
7.65-7.60 (m, 1H), 7.51-7.32 (m, 3H), 7.15-6.96 (m, 2H), 6.43-6.18
(m, 1H), 5.07-4.86 (m, 2H), 4.47-4.21 (m, 3H), 3.79-2.88 (m, 9H),
2.09-1.88 (m, 3H); MS (ESI) m/e 430 (M+H).sup.+.
Example 168
Preparation of
(S)-(+)-(E)-N-Methyl-N-(1-methyl-1H-indol-2-ylmethyl)-3-(10-oxo-2,3,4,9,1-
0,10a-hexahydro-1H-3a,8,9-triaza-benzo[f]azulen-6-yl]acrylamide
hydrochloride
[1159] According to the procedure of Example 1, except substituting
methyl-(1-methyl-1H-indol-2-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(S)-(E)-3-(10-oxo-2,3,4,9,10,10a-hexahydro-1H-3a,8,9-triaza-benzo[f]azule-
n-6-yl)acrylic acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, the title compound (91 mg, 23%) was
prepared as a tan powder: [.alpha.].sup.25.sub.D +197.7.degree. (c
1.00, methanol); .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 12.51
(br s, 1H), 11.28 (s, 1H), 8.83-8.74 (m, 1H), 8.32-8.25 (m, 1H),
7.65-7.60 (m, 1H), 7.51-7.32 (m, 3H), 7.15-6.98 (m, 2H), 6.43-6.18
(m, 1H), 5.07-4.86 (m, 2H), 4.46-4.21 (m, 3H), 3.73-3.62 (m, 4H),
3.18-2.87 (m, 5H), 2.08-1.88 (m, 3H); MS (ESI) We 430
(M+H).sup.+.
Example 169
Preparation of
(E)-3-[4-(4-Methoxy-benzyl)-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4-
]diazepin-7-yl]-N-methyl-N-(1-methyl-1H-indol-2-ylmethyl)acryl
amide hydrochloride
[1160] According to the procedure of Example 1, except substituting
methyl-(1-methyl-1H-indol-2-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-[4-(4-methoxy-benzyl)-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4-
]diazepin-7-yl]acrylic acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, the title compound (0.20 g, 83%) was
prepared as a tan powder: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 12.07 (br s, 1H), 11.23-11.21 (m, 1H), 8.78 (s, 1H),
8.27-8.20 (m, 1H), 7.64-6.99 (m, 10H), 6.42-6.18 (m, 1H), 5.06-4.86
(m, 2H), 4.32-4.20 (m, 4H), 3.77-3.68 (m, 8H), 3.12-3.00 (m, 3H);
MS (ESI) m/e 510 (M+H).sup.+.
Example 170
Preparation of
(E)-N-Methyl-N-(1-methyl-1H-indol-2-ylmethyl)-3-(2-oxo-2,3,4,5-tetrahydro-
-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide hydrochloride
[AP-501382]
a)
(E)-N-Methyl-N-(1-methyl-1H-indol-2-ylmethyl)-3-(2-oxo-2,3,4,5-tetrahyd-
ro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide
[1161] A solution of
(E)-3-[4-(4-methoxy-benzyl)-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4-
]diazepin-7-yl]-N-methyl-N-(1-methyl-1H-indol-2-ylmethyl)acrylamide
(2.00 g, 3.92 mmol), from Example 65, in dichloroethane (80 mL) was
cooled in an ice bath and treated with 1-chloroethyl chloroformate
(0.47 mL, 4.31 mmol). After stirring at 0.degree. C. under N.sub.2
for 30 min and then at room temperature for 30 min, the mixture was
heated to reflux for 1.5 h. The mixture was allowed to cool and
then concentrated to dryness. Purification by flash column
chromatography (silica gel, CH.sub.2Cl.sub.2/MeOH, 97:3) gave a tan
solid. The solid was suspended in methanol and heated to reflux for
2 h. The mixture was allowed to cool and the solid was isolated by
filtration, dissolved in CH.sub.2Cl.sub.2, washed with 1 N NaOH,
dried over Na.sub.2SO.sub.4, filtered and the solvent was removed
in vacuo. Purification by flash column chromatography (silica gel,
CH.sub.2Cl.sub.2/MeOH, 97:3 to 95:5) gave the title compound (0.70
g, 49%) as an off-white solid: .sup.1H NMR (300 MHz, CDCl.sub.3)
.delta. 8.38-8.33 (m, 2H), 7.72-7.67 (m, 1H), 7.60-7.57 (m, 2H),
7.32-7.20 (m, 3H), 7.14-7.09 (m, 1H), 6.90-6.80 (m, 1H), 6.49-6.38
(m, 1H), 4.93-4.78 (m, 2H), 4.08 (s, 2H), 3.95 (s, 2H), 3.71 (s,
3H), 3.13-3.07 (m, 3H); MS (ESI) m/e 390 (M+H).sup.+.
b)
(E)-N-Methyl-N-(1-methyl-1H-indol-2-ylmethyl)-3-(2-oxo-2,3,4,5-tetrahyd-
ro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide hydrochloride
[1162] According to the procedure of Example 1(b), except
substituting
(E)-N-methyl-N-(1-methyl-1H-indol-2-ylmethyl)-3-(2-oxo-2,3,4,5-tetrahydro-
-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamide for the
(E)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]di-
azepin-7-yl)-N-(1-propyl-naphthalen-2-ylmethyl)acrylamide, the
title compound (0.14 g, 89%) was prepared as a tan solid: .sup.1H
NMR (300 MHz, DMSO-d.sub.6) .delta. 11.09-11.06 (m, 1H), 9.90-9.89
(s, 2H), 8.76-8.73 (m, 1H), 8.31-8.23 (m, 1H), 7.64-7.59 (m, 1H),
7.51-7.31 (m, 3H), 7.15-7.10 (m, 1H), 7.03-6.96 (m, 1H), 6.43-6.16
(m, 1H), 5.07-4.86 (m, 2H), 4.26-4.20 (m, 2H), 3.85-3.80 (m, 2H),
3.73-3.69 (m, 3H), 3.13-3.01 (m, 3H); MS (ESI) m/e 390
(M+H).sup.+.
Example 171
Preparation of
(E)-N-Methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)-3-[4-(2-morpholin-4-
-yl-ethyl)-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acr-
ylamide hydrochloride
[1163] According to the procedure of Example 1, except substituting
methyl-(3-methyl-benzo[b]thiophen-2-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-[4-(2-morpholin-4-yl-ethyl)-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3--
e][1,4]diazepin-7-yl]acrylic acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, the title compound (90 mg, 74%) was
prepared as a tan solid: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 10.58 (br s, 2H), 8.62 (s, 1H), 8.27-8.25 (m, 1H),
7.88-7.86 (m, 1H), 7.75-7.72 (m, 1H), 7.61-7.53 (m, 1H), 7.42-7.29
(m, 3H), 5.15-4.89 (m, 2H), 4.03-3.65 (m, 12H), 3.28-3.17 (m, 4H),
3.01-2.64 (m, 3H), 2.42 (s, 3H); MS (ESI) m/e 520 (M+H).sup.+.
Example 172
Preparation of
(E)-N-Methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)-3-{4-[2-(4-methyl-p-
iperazin-1-yl)-2-oxo-ethyl]-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]-
diazepin-7-yl}acrylamide hydrochloride
[1164] According to the procedure of Example 1, except substituting
methyl-(3-methyl-benzo[b]thiophen-2-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-{4-[2-(4-methyl-piperazin-1-yl)-2-oxo-ethyl]-2-oxo-2,3,4,5-tetrahyd-
ro-1H-pyrido[2,3-e][1,4]diazepin-7-yl}acrylic acid hydrochloride
for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl]acrylic acid hydrochloride, the title compound (0.18 g, 53%) was
prepared as an off-white powder: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 10.91 (br s, 1H), 10.55 (br s, 1H), 8.61 (s,
1H), 8.18 (s, 1H), 7.88-7.86 (m, 1H), 7.75-7.72 (m, 1H), 7.61-7.52
(m, 1H), 7.42-7.28 (m, 3H), 5.14-4.89 (m, 2H), 4.42-4.38 (m, 1H),
4.01 (br s, 3H), 3.65 (s, 4H), 3.39 (br s, 4H), 3.16 (s, 2H),
3.04-2.94 (m, 3H), 2.74 (br s, 3H), 2.42 (s, 3H); MS (ESI) m/e 547
(M+H).sup.+.
Example 173
Preparation of
(E)-N-Methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)-3-[4-(3-morpholin-4-
-yl-propyl)-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]ac-
rylamide hydrochloride
[1165] According to the procedure of Example 1, except substituting
methyl-(3-methyl-benzo[b]thiophen-2-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-[4-(3-morpholin-4-yl-propyl)-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-
-e][1,4]diazepin-7-yl]acrylic acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, the title compound (0.20 g, 56%) was
prepared as an off-white powder: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 10.88 (br s, 1H), 10.48 (br s, 1H), 8.58 (s,
1H), 8.31 (s, 1H), 7.88-7.86 (m, 1H), 7.75-7.72 (m, 1H), 7.60-7.55
(m, 1H), 7.42-7.30 (m, 3H), 5.16-4.89 (m, 2H), 3.98 (br s, 2H),
3.92-3.79 (m, 4H), 3.63 (br s, 2H), 3.37-3.33 (m, 6H), 3.18-3.10
(m, 2H), 2.94 (s, 1H), 2.63 (br s, 2H), 2.42 (s, 3H), 1.92 (br s,
2H); MS (ESI) m/e 534 (M+H).sup.+.
Example 174
Preparation of
(E)-N-(2-Ethoxy-3-methoxy-benzyl)-N-methyl-3-{4-[2-(4-methyl-piperazin-1--
yl)-2-oxo-ethyl]-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl}acrylamide hydrochloride
[1166] According to the procedure of Example 1, except substituting
(2-ethoxy-3-methoxy-benzyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-{4-[2-(4-methyl-piperazin-1-yl)-2-oxo-ethyl]-2-oxo-2,3,4,5-tetrahyd-
ro-1H-pyrido[2,3-e][1,4]diazepin-7-yl}acrylic acid hydrochloride
for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, the title compound (82 mg, 47%) was
prepared as an off-white powder: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 10.97 (br s, 1H), 10.67 (br s, 1H), 8.64-8.60
(m, 1H), 8.23-8.14 (m, 1H), 7.58-7.52 (m, 1H), 7.39-7.33 (m, 1H),
7.07-6.94 (m, 2H), 6.69-6.63 (m, 1H), 4.80-4.64 (m, 2H), 4.42-4.38
(m, 1H), 4.09-3.93 (m, 3H), 3.79 (s, 3H), 3.68 (br s, 2H),
3.47-3.37 (m, 8H), 3.11-2.97 (m, 5H), 2.75 (br s, 3H), 1.31-1.24
(m, 3H); MS (ESI) m/e 551 (M+H).sup.+.
Example 175
Preparation of
(S)-(+)-(E)-N-Methyl-N-(3-methyl-benzo[f]thiophen-2-ylmethyl)-3-(10-oxo-2-
,3,4,9,10,10a-hexahydro-1H-3a,8,9-triaza-benzo[f]azulen-6-yl)acrylamide
hydrochloride
[1167] According to the procedure of Example 1, except substituting
methyl-(3-methyl-benzo[b]thiophen-2-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(S)-(E)-3-(10-oxo-2,3,4,9,10,10a-hexahydro-1H-3a,8,9-triaza-benzo[f]azule-
n-6-yl)acrylic acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, the title compound (0.15 g, 62%) was
prepared as a tan powder: [.alpha.].sup.25.sub.D +167.8.degree. (c
1.05, methanol); .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 12.33
(br s, 1H), 11.30 (br s, 1H), 8.84 (s, 1H), 8.33 (s, 1H), 7.89-7.86
(m, 1H), 7.75-7.72 (m, 1H), 7.65-7.55 (m, 1H), 7.42-7.31 (m, 3H),
5.13-4.90 (m, 2H), 4.47-4.22 (m, 2H), 3.61 (br s, 1H), 3.42-3.39
(br s, 4H), 3.17-2.95 (m, 3H), 2.42 (s, 3H), 2.10-1.88 (2H); MS
(ESI) m/e 447 (M+H).sup.+.
Example 176
Preparation of
(R)-(-)-(E)-N-Methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)-3-(10-oxo-2-
,3,4,9,10,10a-hexahydro-1H-3a,8,9-triaza-benzo[f]azulen-6-yl)acrylamide
hydrochloride
[1168] According to the procedure of Example 1, except substituting
methyl-(3-methyl-benzo[b]thiophen-2-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(R)-(E)-3-(10-oxo-2,3,4,9,10,10a-hexahydro-1H-3a,8,9-triaza-benzo[f]azule-
n-6-yl)acrylic acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, the title compound (96 mg, 57%) was
prepared as a tan powder: [.alpha.].sup.25.sub.D -154.3.degree. (c
1.01, methanol); .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 12.47
(br s, 1H), 11.29 (br s, 1H), 8.84 (s, 1H), 8.33 (s, 1H), 7.89-7.86
(m, 1H), 7.75-7.72 (m, 1H), 7.65-7.60 (m, 1H), 7.42-7.31 (m, 3H),
5.13-4.90 (m, 2H), 4.48-4.25 (m, 2H), 3.59-3.47 (m, 5H), 3.17-2.95
(m, 3H), 2.42 (s, 3H), 2.10-1.89 (m, 2H); MS (ESI) m/e 447
(M+H).sup.+.
Example 177
Preparation of
(E)-N-(4-Fluoro-naphthalen-1-ylmethyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-
-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride
[1169] According to the procedure of Example 1, except substituting
(4-fluoro-naphthalen-1-ylmethyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.20 g, 72%) was prepared as a white powder: .sup.1H NMR (500 MHz,
DMSO-d.sub.6) .delta. 12.22 (br s, 1H), 11.26-11.17 (m, 1H),
8.83-8.76 (m, 1H), 8.34-8.10 (m, 3H), 7.72-7.64 (m, 3H), 7.44-7.32
(m, 3H), 5.32-5.09 (m, 2H), 4.30 (br s, 2H), 3.85 (br s, 2H),
3.12-2.98 (m, 3H), 2.89-2.83 (m, 3H); MS (ESI) m/e 419
(M+H).sup.+.
Example 178
Preparation of
(E)-N-(4-Chloro-naphthalen-1-ylmethyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-
-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride
[1170] According to the procedure of Example 1, except substituting
(4-chloro-naphthalen-1-ylmethyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.28 g, 48%) was prepared as a white powder: .sup.1H NMR (500 MHz,
DMSO-d.sub.6) .delta. 12.29 (br s, 1H), 11.23-11.17 (m, 1H),
8.84-8.75 (m, 1H), 8.33-8.18 (m, 3H), 7.76-7.32 (m, 6H), 5.37-5.12
(m, 2H), 4.31 (br s, 2H), 3.80 (br s, 2H), 3.11-3.00 (m, 3H),
2.89-2.82 (m, 3H); MS (ESI) m/e 435 (M+H).sup.+.
Example 179
Preparation of
(E)-N-Methyl-N-(3-methyl-benzofuran-2-ylmethyl)-3-[4-(3-morpholin-4-yl-pr-
opyl)-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylami-
de hydrochloride
[1171] According to the procedure of Example 1, except substituting
methyl-(3-methyl-benzofuran-2-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-[4-(3-morpholin-4-yl-propyl)-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-
-e][1,4]diazepin-7-yl]acrylic acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, the title compound (0.28 g, 78%) was
prepared as an off-white powder: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 10.74-10.54 (m, 2H), 8.61 (s, 1H), 8.29 (s,
1H), 7.63-7.47 (m, 3H), 7.34-7.23 (m, 3H), 5.03-4.80 (m, 2H), 4.02
(br s, 2H), 3.87-3.79 (m, 4H), 3.65 (br s, 2H), 3.48-3.38 (br s,
4H), 3.20-2.93 (m, 5H), 2.72-2.57 (br s, 2H), 2.26 (s, 3H), 1.95
(s, 2H); MS (ESI) m/e 518 (M+H).sup.+.
Example 180
Preparation of
(E)-N-(2-Isopropoxy-3-methoxy-benzyl)-N-methyl-3-[4-(3-morpholin-4-yl-pro-
pyl)-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylamid-
e hydrochloride
[1172] According to the procedure of Example 1, except substituting
(2-isopropoxy-3-methoxy-benzyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-[4-(3-morpholin-4-yl-propyl)-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-
-e][1,4]diazepin-7-yl]acrylic acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, the title compound (0.17 g, 44%) was
prepared as an off-white powder: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 11.01 (br s, 1H), 10.66 (br s, 1H), 8.62 (br
s, 1H), 8.35-8.22 (m, 1H), 7.57-7.52 (m, 1H), 7.40-7.32 (m, 1H),
7.05-6.93 (m, 2H), 6.66-6.62 (m, 1H), 4.80-4.64 (m, 2H), 4.60-4.45
(m, 1H), 4.08 (br s, 2H), 3.87-3.81 (m, 6H), 3.79 (s, 3H), 3.68 (br
s, 2H), 3.50-3.38 (m, 4H), 3.21 (br s, 2H), 3.10-2.72 (m, 3H), 2.01
(br s, 2H), 1.27-1.15 (m, 6H); MS (ESI) m/e 552 (M+H).sup.+.
Example 181
Preparation of
(E)-N-Methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)-3-{4-[3-(4-methyl-p-
iperazin-1-yl)
propyl]-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl}acryl-
amide hydrochloride
[1173] According to the procedure of Example 2, except substituting
7-bromo-4-[3-(4-methyl-piperazin-1-yl)propyl]-1,3,4,5-tetrahydro-pyrido[2-
,3-e][1,4]diazepin-2-one for the
7-bromo-3,3-dimethyl-1,3,4,5-tetrahydro-pyrido[2,3-e][1,4]diazepin-2-one,
the title compound (0.15 g, 49%) was prepared as a tan powder:
.sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 11.06 (br s, 1H), 10.64
(br s, 1H), 8.63 (s, 1H), 8.29-8.22 (m, 1H), 7.88-7.86 (m, 1H),
7.75-7.72 (m, 1H), 7.61-7.53 (m, 1H), 7.42-7.29 (m, 3H), 5.14-4.89
(m, 2H), 4.04 (br s, 2H), 3.65 (br s, 2H), 3.48-3.31 (m, 13H),
3.24-2.29 (m, 3H), 2.76 (br s, 2H), 2.42 (s, 3H), 1.89 (br s, 2H);
MS (ESI) m/e 547 (M+H).sup.+.
Example 182
Preparation of
(E)-N-Methyl-N-(2-methyl-benzofuran-3-ylmethyl)-3-[4-(3-morpholin-4-yl-pr-
opyl)-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]acrylami-
de hydrochloride
[1174] According to the procedure of Example 1, except substituting
methyl-(2-methyl-benzofuran-3-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-[4-(3-morpholin-4-yl-propyl)-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-
-e][1,4]diazepin-7-yl]acrylic acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, the title compound (0.24 g, 68%) was
prepared as a white powder: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 10.86 (br s, 1H), 10.47 (br s, 1H), 8.54 (br s, 1H),
8.38-8.29 (m, 1H), 7.78-7.46 (m, 3H), 7.32-7.15 (m, 3H), 4.97-4.74
(m, 2H), 4.02-3.91 (m, 5H), 3.87-3.79 (m, 4H), 3.63 (br s, 2H),
3.45-3.29 (m, 4H), 3.27-3.15 (m, 4H), 3.07-2.82 (m, 3H), 1.93 (br
s, 2H); MS (ESI) m/e 518 (M+H).sup.+.
Example 183
Preparation of
(E)-N-(3-Chloro-benzo[b]thiophen-2-ylmethyl)-N-methyl-3-(4-methyl-2-oxo-2-
,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride
[1175] According to the procedure of Example 1, except substituting
(3-chlorobenzo[b]thiophen-2-ylmethyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.39 g, 88%) was prepared as an off-white powder: .sup.1H NMR (300
MHz, DMSO-d.sub.6) .delta. 12.40-11.21 (m, 2H), 8.84 (s, 1H),
8.35-8.30 (m, 1H), 8.04-8.00 (m, 1H), 7.79-7.77 (m, 1H), 7.55-7.34
(m, 4H), 5.21-4.94 (m, 2H), 4.29 (br s, 2H), 3.81 (br s, 2H),
3.24-3.00 (m, 3H), 2.88 (s, 3H); MS (ESI) m/e 441 (M+H).sup.+.
Example 184
Preparation of
(E)-N-(5-Chloro-1-methyl-1H-indol-2-ylmethyl)-N-methyl-3-(4-methyl-2-oxo--
2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride
[1176] According to the procedure of Example 1, except substituting
(5-chloro-1-methyl-1H-indol-2-ylmethyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.32 g, 43%) was prepared as an off-white powder: .sup.1H NMR (300
MHz, DMSO-d.sub.6) .delta. 12.50-11.20 (m, 2H), 8.83-8.80 (m, 1H),
8.35-8.27 (m, 1H), 7.66-7.34 (m, 4H), 7.14-7.11 (m, 1H), 6.41-6.18
(m, 1H), 5.08-4.86 (m, 2H), 4.45-4.15 (m, 2H), 3.80-3.45 (m, 5H),
3.02-2.88 (m, 3H), 2.73 (s, 3H); MS (ESI) m/e 438 (M+
Example 185
Preparation of
(E)-N-(1,7-Dimethyl-1H-indol-2-ylmethyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4-
,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride
[1177] According to the procedure of Example 1, except substituting
(1,7-dimethyl-1H-indol-2-ylmethyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.25 g, 43%) was prepared as an off-white powder: .sup.1H NMR (300
MHz, DMSO-d.sub.6) .delta. 11.85-11.12 (m, 2H), 8.78 (s, 1H),
8.31-8.21 (m, 1H), 7.65-7.60 (m, 1H), 7.38-7.27 (m, 2H), 6.88-6.82
(m, 2H), 6.39-6.11 (m, 1H), 5.03-4.83 (m, 2H), 4.24 (br s, 2H),
3.95-3.44 (m, 5H), 3.17-3.01 (m, 6H), 2.82-2.72 (m, 3H); MS (ESI)
m/e 418 (M+H).sup.+.
Example 186
Preparation of
(E)-N-(5-Fluoro-3-methyl-benzo[f]thiophen-2-ylmethyl)-N-methyl-3-(4-methy-
l-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride
[1178] According to the procedure of Example 1, except substituting
(5-fluoro-3-methyl-benzo[b]thiophen-2-ylmethyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.33 g, 75%) was prepared as a white powder: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 12.15-11.20 (m, 2H), 8.82 (s, 1H), 8.33-8.29
(m, 1H), 7.93-7.89 (m, 1H), 7.65-7.19 (m, 4H), 5.14-4.89 (m, 2H),
4.27 (br s, 2H), 3.80 (br s, 2H), 3.18-2.96 (m, 3H), 2.86 (s, 3H),
2.40 (s, 3H); MS (ESI) m/e 439 (M+H).sup.+.
Example 187
Preparation of
(E)-N-(5-Chloro-3-methyl-benzo[b]thiophen-2-ylmethyl)-N-methyl-3-(4-methy-
l-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride
[1179] According to the procedure of Example 1, except substituting
(5-chloro-3-methyl-benzo[b]thiophen-2-ylmethyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.39 g, 75%) was prepared as an off-white powder: .sup.1H NMR (300
MHz, DMSO-d.sub.6) .delta. 11.90-11.25 (m, 2H), 8.85 (s, 1H),
8.34-8.31 (m, 1H), 7.94-7.32 (m, 5H), 5.15-4.90 (m, 2H), 4.31 (br
s, 2H), 3.83 (br s, 2H), 3.18-2.89 (m, 6H), 2.38 (s, 3H); MS (ESI)
m/e 455 (M+H).sup.+.
Example 188
Preparation of
(E)-3-(6-Amino-5-morpholin-4-ylmethyl-pyridin-3-yl)-N-(1,7-dimethyl-1H-in-
dol-2-ylmethyl)-N-methyl-acrylamide hydrochloride
[1180] According to the procedure of Example 1, except substituting
(1,7-dimethyl-1H-indol-2-ylmethyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-(6-amino-5-morpholin-4-ylmethyl-pyridin-3-yl)acrylic acid
hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, the title compound (0.31 g, 80%) was
prepared as pale yellow powder: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 8.49 (s, 1H), 8.38-8.35 (m, 1H), 7.54-7.49 (m, 1H),
7.31-7.14 (m, 2H), 6.85-6.81 (m, 2H), 6.37-6.08 (m, 1H), 5.03-4.81
(m, 2H), 4.31 (br s, 2H), 3.96-3.72 (m, 7H), 3.42-2.99 (m, 10H),
2.72 (s, 3H); MS (ESI) m/e 434 (M+H).sup.+.
Example 189
Preparation of
(E)-3-(6-Amino-5-morpholin-4-ylmethyl-pyridin-3-yl)-N-(2-ethoxy-3-methoxy-
-benzyl)-N-methyl-acrylamide hydrochloride
[1181] According to the procedure of Example 1, except substituting
(2-ethoxy-3-methoxy-benzyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-(6-amino-5-morpholin-4-ylmethyl-pyridin-3-yl)acrylic acid
hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, the title compound (0.27 g, 70%) was
prepared as pale yellow powder: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 8.83-8.65 (m, 1H), 8.40 (s, 1H), 7.52-7.45 (m, 1H),
7.29-7.24 (m, 1H), 7.04-6.96 (m, 2H), 6.65-6.64 (m, 1H), 4.80-4.64
(m, 2H), 4.35 (br s, 2H), 4.02-3.79 (m, 10H), 3.39-2.83 (m, 8H),
1.31-1.25 (m, 3H); MS (ESI) m/e 441 (M+H).sup.+.
Example 190
Preparation of
(E)-N-Methyl-N-(1-methyl-1H-indol-3-ylmethyl)-3-(4-methyl-2-oxo-2,3,4,5-t-
etrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acryl amide
[1182] According to the procedure of Example 1(a), except
substituting methyl-(1-methyl-1H-indol-3-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(0.70 g, 75%) was prepared as an off-white powder and as a mixture
of amide rotamers: .sup.1H NMR (300 MHz, CDCl.sub.3) .delta.
8.39-8.26 (m, 2H), 7.72-7.53 (m, 3H), 7.36-7.09 (m, 3H), 7.02-6.84
(m, 1H), 4.86-4.84 (m, 2H), 3.95-3.90 (m, 2H), 3.78-3.76 (m, 5H),
3.13-3.08 (m, 3H), 2.49-2.46 (m, 3H); MS (ESI) m/e 404
(M+H).sup.+.
Example 191
Preparation of
(E)-7-{2-[Methyl-(1-methyl-1H-indol-3-ylmethyl)-carbamoyl]-vinyl}-2-oxo-1-
,2,3,5-tetrahydro-pyrido[2,3-e][1,4]diazepine-4-carboxylic acid
benzyl ester
[1183] According to the procedure of Example 1(a), except
substituting methyl-(1-methyl-1H-indol-3-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-7-(2-carboxy-vinyl)-2-oxo-1,2,3,5-tetrahydro-pyrido[2,3-e][1,4]diazep-
ine-4-carboxylic acid benzyl ester hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, the title compound (0.29 g, 73%) was
prepared as an off-white powder and as a mixture of amide rotamers:
.sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.43 (s, 1H), 8.51 (s,
1H), 8.11-8.25 (m, 1H), 7.53-7.64 (m, 2H), 7.30-7.42 (m, 5H),
7.12-7.20 (m, 4H), 6.98-7.03 (m, 1H), 5.03-5.08 (m, 2H), 4.75-4.93
(m, 2H), 4.62 (s, 2H), 4.41 (s, 2H), 3.73-3.77 (m, 3H), 2.91-3.06
(m, 3H); MS (ESI) m/e 524 (M+H).sup.+.
Example 192
Preparation of
(E)-3-(2,4-Dioxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl)-N-methyl-
-N-(1-methyl-1H-indol-3-ylmethyl)acrylamide
[1184] According to the procedure of Example 1(a), except
substituting methyl-(1-methyl-1H-indol-3-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-(2,4-dioxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl)acrylic
acid for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, the title compound (0.16 g, 34%) was
prepared as a tan solid and as a mixture of amide rotamers; .sup.1H
NMR (300 MHz, DMSO-d.sub.6) .delta. 11.84 (s, 1H), 11.53 (s, 1H),
8.91 (s, 1H), 8.73-8.66 (m, 1H), 7.78-7.30 (m, 5H), 7.17-7.12 (m,
1H), 7.03-6.98 (m, 1H), 4.96-4.73 (m, 2H), 3.76 (s, 3H), 3.07-2.90
(m, 3H); MS (ESI) m/e 390 (M+H).sup.+.
Example 193
Preparation of
(E)-N-Methyl-N-(1-methyl-1H-indol-2-ylmethyl)-3-(2-oxo-2,3-dihydro-oxazol-
o[4,5-b]pyridin-6-yl)acrylamide
[1185] According to the procedure of Example 1(a), except
substituting methyl-(1-methyl-1H-indol-2-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-(2-oxo-2,3-dihydro-oxazolo[4,5-b]pyridine-6-yl)acrylic acid
hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, the title compound (0.23 g, 34%) was
prepared as an off-white solid and as a mixture of amide rotamers:
.sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 12.64 (br s, 1H),
8.37-8.12 (m, 2H), 7.64 (d, J=15.3 Hz, 1H), 7.51-7.26 (m, 3H),
7.17-7.07 (m, 1H), 7.04-6.94 (m, 1H), 6.42-6.17 (m, 1H), 5.06-4.85
(m, 2H), 3.73-3.68 (m, 3H), 3.12-2.99 (m, 3H); MS (ESI) m/e 363
(M+H).sup.+.
Example 194
Preparation of
(E)-N-Methyl-N-(1-methyl-1H-indol-3-ylmethyl)-3-(2-oxo-2,3-dihydro-oxazol-
o[4,5-b]pyridin-6-yl)acrylamide
[1186] According to the procedure of Example 1(a), except
substituting methyl-(1-methyl-1H-indol-3-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-(2-oxo-2,3-dihydro-oxazolo[4,5-b]pyridine-6-yl)acrylic acid
hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, the title compound (0.075 g, 23%)
was prepared as a light brown solid: .sup.1H NMR (300 MHz,
CDCl.sub.3) .delta. 8.28-8.24 (m, 1H), 7.82 (d, J=15.4 Hz, 1H),
7.71-7.49 (m, 2H), 7.37-6.87 (m, 5H), 4.88-4.86 (m, 2H), 3.78 (s,
3H), 3.16-3.12 (m, 3H); MS (ESI) m/e 363 (M+H).sup.+.
Example 195
Preparation of
(E)-3-(6-Amino-5-{2-[methyl-(1-methyl-1H-indol-2-ylmethyl)carbamoyl]ethyl-
}pyridin-3-yl)-N-methyl-N-(1-methyl-1H-indol-2-ylmethyl)acrylamide
[1187] According to the procedure of Example 1(a), except
substituting methyl-(1-methyl-1H-indol-2-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-[6-amino-5-(2-carboxy-ethyl)pyridin-3-yl]acrylic acid for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, the title compound (0.37 g, 28%) was
prepared as an off-white powder and as a mixture of amide rotamers:
.sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 8.07 (m, 1H), 7.75-7.68
(m, 1H), 7.49-7.34 (m, 5H), 7.11-6.98 (m, 5H), 6.39-6.12 (m, 4H),
4.95-4.68 (m, 4H), 3.69 (s, 3H), 3.61 (s, 3H), 3.02-2.71 (m, 10H);
MS (ESI) m/e 549 (M+H.
Example 196
Preparation of
(E)-3-(6-Amino-5-piperidin-1-ylmethyl-pyridin-3-yl)-N-methyl-N-(1-methyl--
1H-indol-2-ylmethyl)acrylamide
[1188] According to the procedure of Example 1(a), except
substituting
(E)-3-(6-amino-5-piperidin-1-ylmethyl-pyridin-3-yl)acrylic acid
hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, and substituting
methyl-(1-methyl-1H-indol-2-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(294 mg, 54%) was prepared as an off-white powder and as a mixture
of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 8.12
(s, 1H), 7.78-7.68 (m, 1H), 7.49-7.38 (m, 3H), 7.14-6.97 (m, 3H),
6.63 (s, 2H), 6.41-6.18 (m, 1H), 5.02-4.83 (m, 2H), 3.72-3.67 (m,
3H), 3.39-3.34 (m, 3H), 3.09-2.96 (m, 3H), 2.29 (br s, 3H),
1.49-1.40 (m, 6H); MS (ESI) m/e 418 (M+H).sup.+.
Example 197
Preparation of
(E)-3-(6-Amino-5-pyrrolidin-1-ylmethyl-pyridin-3-yl)-N-methyl-N-(1-methyl-
-1H-indol-2-ylmethyl)acrylamide hydrochloride
[1189] According to the procedure of Example 1, except substituting
(E)-3-(6-amino-5-pyrrolidin-1-ylmethyl-pyridin-3-yl)acrylic acid
hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, and substituting
methyl-(1-methyl-1H-indol-2-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(223 mg, 82%) was prepared as a light, yellow powder and as a
mixture of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 10.2 (br s, 1H), 8.35 (s, 1H), 8.21 (s, 1H), 7.52-7.39 (m,
3H), 7.24-7.01 (m, 4H), 6.41-6.16 (m, 1H), 5.05-4.85 (m, 2H), 4.29
(s, 2H), 3.74-3.68 (m, 3H), 3.10-3.00 (m, 6H), 2.10-1.82 (m, 5H);
MS (ESI) m/e 404 (M+H).sup.+.
Example 198
Preparation of
(E)-3-[6-Amino-5-(4-methyl-piperazin-1-ylmethyl)pyridin-3-yl]-N-methyl-N--
(1-methyl-1H-indol-2-ylmethyl)acrylamide hydrochloride
[1190] According to the procedure of Example 1, except substituting
(E)-3-[6-amino-5-(4-methyl-piperazin-1-ylmethyl)-pyridin-3-yl]acrylic
acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, and substituting
methyl-(1-methyl-1H-indol-2-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(136 mg, 14%) was prepared as an off-white powder and as a mixture
of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.7
(br s, 1H), 8.39 (s, 1H), 8.33 (s, 1H), 8.07 (br s, 2H), 7.55-7.01
(m, 6H), 6.41-6.17 (m, 1H), 5.07-4.85 (m, 2H), 3.73-3.62 (m, 7H),
3.11-2.98 (m, 8H), 2.73 (s, 3H); MS (ESI) m/e 433 (M+H).sup.+.
Example 199
Preparation of
(E)-3-[6-Amino-5-(4-benzyl-piperidin-1-ylmethyl)pyridin-3-yl]-N-methyl-N--
(1-methyl-1H-indol-2-ylmethyl)acrylamide hydrochloride
[1191] According to the procedure of Example 1, except substituting
(E)-3-[6-amino-5-(4-benzyl-piperidin-1-ylmethyl)-pyridin-3-yl]acrylic
acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, and substituting
methyl-(1-methyl-1H-indol-2-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(156 mg, 30%) was prepared as an off-white powder and as a mixture
of amide rotamers: NMR (300 MHz, DMSO-d.sub.6) .delta. 8.36-8.25
(m, 2H), 7.52-6.98 (m, 14H), 6.40-6.15 (m, 1H), 5.05-4.84 (m, 2H),
4.20 (s, 2H), 3.74-3.67 (m, 3H), 3.58-5.30 (m, 8H), 3.10-2.73 (m,
6H); MS (ESI) m/e 508 (M+H).sup.+.
Example 200
Preparation of
(E)-3-(6-Amino-5-pyrrolidin-1-ylmethyl-pyridin-3-yl)-N-methyl-N-naphthale-
n-2-ylmethyl-acrylamide hydrochloride
[1192] According to the procedure of Example 1, except substituting
(E)-3-(6-amino-5-pyrrolidin-1-ylmethyl-pyridin-3-yl)acrylic acid
hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, and substituting
methyl-naphthalen-2-ylmethyl-amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(51 mg, 57%) was prepared as a light, yellow solid and as a mixture
of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
8.36-8.25 (m, 2H), 7.52-6.98 (m, 4H), 6.40-6.15 (m, 1H), 5.05-4.84
(m, 2H), 4.20 (s, 2H), 3.74-3.67 (m, 3H), 3.58-5.30 (m, 8H),
3.10-2.73 (m, 6H); MS (ESI) m/e 401 (M+H).sup.+.
Example 201
Preparation of
(E)-3-[6-Amino-5-(4-methyl-piperazin-1-ylmethyl)pyridin-3-yl]-N-methyl-N--
(3-methyl-benzo[b]thiophen-2-ylmethyl)acrylamide hydrochloride
[1193] According to the procedure of Example 1, except substituting
(E)-3-[6-amino-5-(4-methyl-piperazin-1-ylmethyl)pyridin-3-yl]acrylic
acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, and substituting
methyl-(3-methyl-benzo[b]thiophen-2-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(101 mg, 46%) was prepared as a light, yellow powder and as a
mixture of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 10.6 (br s, 1H), 8.27 (s, 1H), 8.16 (s, 1H), 7.87 (d, J=7.6
Hz, 1H), 7.73 (d, J=7.1 Hz, 1H), 7.52-7.28 (m, 5H), 7.11 (d, J=15.3
Hz, 1H), 5.11-4.89 (m, 2H), 3.55 (br s, 2H), 3.37-3.23 (m, 4H),
3.14 (s, 2H), 3.10-2.92 (m, 5H), 2.72 (s, 3H), 2.42 (s, 3H); MS
(ESI) m/e 450 (M+H).sup.+.
Example 202
Preparation of
(E)-3-(6-Amino-5-morpholin-4-ylmethyl-pyridin-3-yl)-N-methyl-N-(4-methyl--
naphthalen-1-ylmethyl)acrylamide hydrochloride
[1194] According to the procedure of Example 1, except substituting
(E)-3-(6-amino-5-morpholin-4-ylmethyl-pyridin-3-yl)acrylic acid
hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, and substituting
methyl-N-(4-methyl-naphthalen-1-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(66 mg, 62%) was prepared as a pale, yellow powder and as a mixture
of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
8.61-8.35 (m, 2H), 8.14-8.05 (m, 2H), 7.61-7.52 (m, 3H), 7.36-7.03
(m, 3H), 5.30-5.07 (m, 2H), 4.45-4.23 (m, 2H), 3.94-3.65 (m, 6H),
3.45-3.17 (m, 4H), 3.04-2.94 (m, 4H), 2.65 (s, 3H); MS (ESI) m/e
431 (M+H).sup.+.
Example 203
Preparation of
(E)-3-(6-Amino-5-morpholin-4-ylmethyl-pyridin-3-yl)-N-methyl-N-(3-methyl--
benzo[b]thiophen-2-ylmethyl)acrylamide hydrochloride
[1195] According to the procedure of Example 1, except substituting
(E)-3-(6-amino-5-morpholin-4-ylmethyl-pyridin-3-yl)acrylic acid for
the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, and substituting
methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(111 mg, 67%) was prepared as a pale, yellow solid and as a mixture
of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 8.60
(br s, 1H), 8.40 (s, 1H), 7.87 (d, J=7.4 Hz, 1H), 7.73 (d, J=6.9
Hz, 1H), 7.51 (d, J=15.3 Hz, 1H), 7.42-7.15 (m, 3H), 5.12-4.88 (m,
2H), 3.91-3.35 (m, 12H), 3.15 (s, 3H), 2.93 (s, 1H), 2.41 (s, 3H);
MS (ESI) m/e 437 (M+H).sup.+;
Example 204
Preparation of
(E)-3-(6-Amino-5-morpholin-4-ylmethyl-pyridin-3-yl)-N-(3,4-dimethyl-thien-
o[2,3-b]thiophen-2-ylmethyl)-N-methyl-acrylamide hydrochloride
[1196] According the procedure of Example 1, except substituting
(E)-3-(6-amino-5-morpholin-4-ylmethyl-pyridin-3-yl)acrylic acid
hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, and substituting
(3,4-dimethyl-thieno[2,3-b]thiophen-2-ylmethyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
was prepared (70 mg, 13%) as a light, yellow powder and as a
mixture of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 8.63 (s, 1H), 8.40 (s, 1H), 7.51 (d, J=15.1 Hz, 1H),
7.20-7.12 (m, 2H), 5.00-4.77 (m, 2H), 4.40-4.32 (m, 2H), 3.95-3.15
(m, 10H), 3.13 (s, 3H), 2.90 (s, 1H), 2.46 (s, 3H), 2.45 (s, 3H);
MS (ESI) m/e 457 (M+H).sup.+.
Example 205
Preparation of
(E)-3-[6-Amino-5-(4-methyl-piperazin-1-ylmethyl)pyridin-3-yl]-N-(2-ethoxy-
-3-methoxy-benzyl)-N-methyl-acrylamide hydrochloride
[1197] According to the procedure of Example 1, except substituting
(E)-3-[6-amino-5-(4-methyl-piperazin-1-ylmethyl)pyridin-3-yl]acrylic
acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, and substituting
(2-ethoxy-3-methoxy-benzyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(177 mg, 25%) was prepared as a pale, yellow solid and as a mixture
of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.4
(s, 1H), 8.28-8.19 (m, 2H), 7.73 (s, 1H), 7.47 (d, J=15.3 Hz, 1H),
7.21 (dd, J=14.9, 5.4 Hz, 1H), 7.05-6.94 (m, 2H), 6.64 (dd, J=7.2,
7.2 Hz, 1H), 4.78-4.63 (m, 2H), 4.03-3.93 (m, 2H), 3.79 (s, 3H),
3.55-3.33 (m, 7H), 3.09-2.85 (m, 7H), 2.74 (s, 3H), 1.31-1.25 (m,
3H); MS (ESI) m/e 454 (M+H).sup.+.
Example 206
Preparation of
(E)-3-[6-Amino-5-(4-methyl-piperazin-1-ylmethyl)pyridin-3-yl]-N-methyl-N--
(4-methyl-naphthalen-1-ylmethyl)acrylamide hydrochloride
[1198] According to the procedure of Example 1, except substituting
(E)-3-[6-amino-5-(4-methyl-piperazin-1-ylmethyl)pyridin-3-yl]acrylic
acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, and substituting
methyl-(4-methyl-naphthalen-1-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(143 mg, 20%) was prepared as a pale, yellow solid and as a mixture
of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.9
(s, 1H), 8.35-8.29 (m, 2H), 8.18-8.05 (m, 4H), 7.65-7.52 (m, 3H),
7.41-7.03 (m, 3H), 5.30-5.07 (m, 2H), 3.63-3.33 (m, 6H), 3.04-2.95
(m, 7H), 2.72-2.65 (m, 6H); MS (ESI) m/e 444 (M+H).sup.+.
Example 207
Preparation of
(E)-3-[6-Amino-5-(4-methyl-piperazin-1-ylmethyl)pyridin-3-yl]-N-benzofura-
n-2-ylmethyl-N-methyl-acrylamide hydrochloride
[1199] According to the procedure of Example 1, except substituting
(E)-3-[6-amino-5-(4-methyl-piperazin-1-ylmethyl)pyridin-3-yl]acrylic
acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, and substituting
benzofuran-2-ylmethyl-methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(158 mg, 20%) was prepared as an off-white solid and as a mixture
of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.7
(s, 1H), 8.35-8.33 (m, 2H), 7.99 (br s, 2H), 7.62-7.19 (m, 6H),
6.82 (d, J=12.2 Hz, 1H), 5.01-4.80 (m, 2H), 3.62-3.25 (m, 6H), 3.22
(s, 2H), 3.10-2.92 (m, 5H), 2.73 (s, 3H); MS (ESI) m/e 420
(M+H).sup.+.
Example 208
Preparation of
(E)-3-[6-Amino-5-(4-methyl-piperazin-1-ylmethyl)pyridin-3-yl]-N-(3-methox-
y-2-propoxy-benzyl)-N-methyl-acrylamide hydrochloride
[1200] According to the procedure of Example 1, except substituting
(E)-3-[6-amino-5-(4-methyl-piperazin-1-ylmethyl)pyridin-3-yl]acrylic
acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, and substituting
(3-methoxy-2-propoxy-benzyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(50 mg, 6%) was prepared as an off-white solid and as a mixture of
amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.6
(br s, 1H), 8.16 (d, J=9.2 Hz, 1H), 7.86 (s, 1H), 7.43 (d, J=15.2
Hz, 1H), 7.08-6.93 (m, 3H), 6.70-6.63 (m, 3H), 4.77-4.63 (m, 2H),
3.87 (q, J=6.8 Hz, 2H), 3.79 (s, 3H), 3.48-3.31 (m, 5H), 3.09-2.86
(m, 6H), 2.72 (s, 3H), 2.44-2.35 (m, 2H), 1.71 (app sextet, J=7.0
Hz, 2H), 0.98 (t, J=7.3 Hz, 3H); MS (ESI) m/e 468 (M+H).sup.+.
Example 209
Preparation of
(E)-3-[6-Amino-5-(4-methyl-piperazin-1-ylmethyl)pyridin-3-yl]-N-(2-ethoxy-
-3-methyl-benzyl)-N-methyl-acrylamide hydrochloride
[1201] According to the procedure of Example 1, except substituting
(E)-3-[6-amino-5-(4-methyl-piperazin-1-ylmethyl)pyridin-3-yl]acrylic
acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, and substituting
(3-methyl-2-ethoxy-benzyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(114 mg, 17%) was prepared as an off-white solid: .sup.1H NMR (300
MHz, DMSO-d.sub.6) .delta. 8.42 (s, 1H), 8.33 (d, J=6.0 Hz, 1H),
8.13 (br s, 2H), 7.48 (dd, J=10.0, 5.1 Hz, 1H), 7.27 (d, J=9.3 Hz,
1H), 7.13 (dd, J=10.6, 4.4 Hz, 1H), 7.04-6.97 (m, 1H), 6.90-6.87
(m, 1H), 4.81-4.66 (m, 2H), 3.87-3.81 (m, 2H), 3.63-3.36 (m, 7H),
3.10-2.85 (m, 7H), 2.72 (s, 3H), 2.24 (s, 3H), 1.35 (t, J=4.2 Hz,
3H); MS (ESI) m/e 438 (M+H).sup.+.
Example 210
Preparation of
(E)-N-(3-Methoxy-2-propoxy-benzyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-[-
1,8]naphthyridin-3-yl)acrylamide hydrochloride
[1202] According to the procedure of Example 1, except substituting
(E)-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3-yl)acrylic acid
hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, and substituting
(3-methoxy-2-propoxy-benzyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(193 mg, 22%) was prepared as a white solid and as a mixture of
amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.6
(s, 1H), 8.35 (d, J=14.1 Hz, 1H), 8.09-8.01 (m, 1H), 7.50 (dd,
J=15.2, 2.5 Hz, 1H), 7.24 (d, J=15.3 Hz, 1H), 7.07-6.94 (m, 2H),
6.67-6.62 (m, 1H), 5.43 (br s, 1H), 4.79-4.64 (m, 2H), 3.87 (q,
J=6.9 Hz, 2H), 3.79 (s, 3H), 3.10-2.86 (m, 5H), 2.56-2.45 (m, 2H),
1.71 (app sextet, J=7.1 Hz, 2H), 0.97 (q, J=7.3 Hz, 3H); MS (ESI)
m/e 410 (M+H).sup.+.
Example 211
Preparation of
(E)-N-(2-Isopropoxy-3-methoxy-benzyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydr-
o-[1,8]naphthyridin-3-yl)acrylamide hydrochloride. According to the
procedure of Example 1, except substituting
(E)-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3-yl)acrylic acid
hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, and substituting
(2-isopropoxy-3-methoxy-benzyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(326 mg, 83%) was prepared as a white solid and as a mixture of
amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.6
(s, 1H), 8.36 (d, J=17.3 Hz, 1H), 8.10-7.98 (m, 1H), 7.50 (d,
J=15.3 Hz, 1H), 7.28-7.17 (m, 1H), 7.05-6.93 (m, 2H), 6.63 (dd,
J=7.3, 7.3 Hz, 1H), 5.77 (br s, 1H), 4.77-4.63 (m, 2H), 4.59-4.45
(m, 1H), 3.79 (s, 3H), 3.08-2.81 (m, 5H), 2.56-2.44 (m, 2H), 1.23
(t, J=5.7 Hz, 6H); MS (ESI) m/e 410 (M+H).sup.+.
Example 212
Preparation of
(E)-N-(2-Ethoxy-3-methoxy-benzyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-[1-
,8]naphthyridin-3-yl)acrylamide hydrochloride
[1203] According to the procedure of Example 1, except substituting
(E)-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3-yl)acrylic acid
hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, and substituting
(2-ethoxy-3-methoxy-benzyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(429 mg, 88%) was prepared as an off-white solid and as a mixture
of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.6
(s, 1H), 8.34 (d, J=13.2 Hz, 1H), 8.08-8.01 (m, 1H), 7.50 (dd,
J=9.2, 2.0 Hz, 1H), 7.25 (dd, J=9.3, 5.5 Hz, 1H), 7.06-6.94 (m,
2H), 6.67 (dd, J=11.4, 4.7 Hz, 1H), 4.91 (br s, 1H), 4.78-4.64 (m,
2H), 4.02-3.95 (m, 2H), 3.79 (s, 3H), 3.09-2.86 (m, 5H), 2.55-2.49
(m, 2H), 1.30-1.26 (m, 3H); MS (ESI) m/e 396 (M+H).sup.+.
Example 213
Preparation of
(E)-3-[6-(2,5-Dioxo-pyrrolidin-1-yl)pyridin-3-yl]-N-methyl-N-(1-methyl-1H-
-indol-2-ylmethyl)acrylamide
[1204] A solution of
3-(6-aminopyridin-3-yl)-N-methyl-N-(1-methyl-1H-indol-2-ylmethyl)acrylami-
de (1.40 g, 4.37 mol) and succinic anhydride (520 mg, 5.24 mmol) in
1,4-dioxane (50 mL) was heated to reflux for 5 h. Another portion
of succinic anhydride (520 mg, 5.24 mmol) was then added, and the
solution was maintained at reflux overnight. The solvent was
removed in vacuo. The residue was dissolved in CH.sub.2Cl.sub.2,
and the solution was washed with satd NaHCO.sub.3, water and brine,
dried over Na.sub.2SO.sub.4, and concentrated. Purification by
column chromatography (silica gel, CH.sub.2Cl.sub.2/MeOH, 98:2 to
97:3) gave the title compound (1.40 g, 76%) as an off-white solid
and as a mixture of amide rotamers: mp 185-187.degree. C.; .sup.1H
NMR (300 MHz, DMSO-d.sub.6) .delta. 8.92-8.88 (m, 1H), 8.41-8.32
(m, 1H), 7.69-7.64 (m, 1H), 7.52-7.34 (m, 4H), 7.15-7.09 (m, 1H),
7.04-6.99 (m, 1H), 6.44-6.21 (m, 1H), 5.08-4.87 (m, 2H), 3.73-3.70
(m, 3H), 3.14-3.00 (m, 3H), 2.83-2.81 (m, 4H); MS (ESI) m/e 403
(M+H).sup.+.
Example 214
Preparation of
(E)-N-(5-{2-(Methyl-(1-methyl-1H-indol-2-ylmethyl)carbamoyl)
vinyl}pyridin-2-yl)succinamide
[1205] A mixture of
(E)-3-[6-(2,5-dioxo-pyrrolidin-1-yl)pyridin-3-yl]-N-methyl-N-(1-methyl-1H-
-indol-2-ylmethyl)acrylamide (260 mg, 0.645 mmol) and ammonia (12
mL of 0.5M solution in 1,4-dioxane, 6.0 mmol) in a sealed tube was
heated to 60.degree. C. overnight. After cooling to ambient
temperature, the resulting white precipitate was collected by
filtration. The resulting solid was triturated with MeOH, washed
with Et.sub.2O, and dried under high vacuum at 50.degree. C. for 2
d to give the title compound (140 mg, 52%) as a white solid and as
a mixture of amide rotamers: mp 225-227.degree. C.; .sup.1H NMR
(300 MHz, DMSO-d.sub.6) .delta. 10.67-10.63 (m, 1H), 8.62-8.58 (m,
1H), 8.21-8.07 (m, 2H), 7.60-7.25 (m, 5H), 7.12 (dd, J=7.7, 7.4 Hz,
1H), 7.00 (dd, J=7.3, 6.9 Hz, 1H), 6.77 (br s, 1H), 6.42-6.17 (m,
1H), 5.05-4.85 (m, 2H), 3.72-3.68 (m, 3H), 3.12-2.99 (m, 3H),
2.64-2.60 (m, 2H), 2.40-2.36 (m, 2H); MS (ESI) m/e 420
(M+H).sup.+.
Example 215
Preparation of
(E)-N-(5-{2-[Methyl-(1-methyl-1H-indol-2-ylmethyl)carbamoyl]vinyl}pyridin-
-2-yl)-4-(4-methyl-piperazin-1-yl)-4-oxo-butyramide
[1206] According to the procedure of Example 110, except
substituting 1-methylpiperazine for the ammonia, the title compound
(250 mg, 77%) was prepared as a light yellow solid and as a mixture
of amide rotamers, after silica gel chromatography: mp
145-147.degree. C. dec; .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
10.70-10.66 (m, 1H), 8.62-8.58 (m, 1H), 8.21-8.07 (m, 2H),
7.60-7.25 (m, 4H), 7.12-7.10 (m, 1H), 7.03-6.98 (m, 1H), 6.42-6.17
(m, 1H), 5.06-4.85 (m, 2H), 3.72-3.68 (m, 3H), 3.48 (br s, 4H),
3.12-2.99 (m, 3H), 2.63-2.26 (m, 11H); MS (ESI) m/e 503
(M+H).sup.+.
Example 216
Preparation of
(E)-N-(5-{2-[Methyl-(1-methyl-1H-indol-2-ylmethyl)carbamoyl]vinyl}pyridin-
-2-yl)-4-morpholin-4-yl-4-oxo-butyramide
[1207] According to the procedure of Example 110, except
substituting morpholine for the ammonia, the title compound (200
mg, 57%) was prepared as a light yellow solid and as a mixture of
amide rotamers: mp 206-209.degree. C. dec; .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 10.70-10.66 (m, 1H), 8.62-8.58 (m, 1H),
8.21-8.07 (m, 2H), 7.60-7.39 (m, 3H), 7.34-7.25 (m, 1H), 7.12 (dd,
J=7.4, 7.2 Hz, 1H), 7.03 (dd, J=7.3, 7.2 Hz, 1H), 6.42-6.17 (m,
1H), 5.06-4.85 (m, 2H), 3.72-3.68 (m, 3H), 3.57-3.37 (m, 8H),
3.12-2.99 (m, 3H), 2.70-2.56 (m, 4H); MS (ESI) m/e 490
(M+H).sup.+.
Example 217
Preparation of (E)-1-Methyl-piperidine-4-carboxylic acid
(5-{2-[methyl-(1-methyl-1H-indol-2-ylmethyl)carbamoyl]vinyl}pyridin-2-yl)-
amide
[1208] A solution of 1-methylpiperidine-4-carboxylic acid
hydrochloride (184 mg, 1.03 mmol), 1,1'-carbonyldiimidazole (167
mg, 1.03 mmol) and triethylamine (0.26 mL, 1.8 mol) in 1,4-dioxane
(20 mL) was heated to reflux for 3 h.
(E)-3-(6-Aminopyridin-3-yl)-N-methyl-N-(1-methyl-1H-indol-2-ylmethyl)acry-
lamide (300 mg, 0.936 mmol) was then added and the resulting
solution was heated to reflux overnight. TLC analysis indicated
remaining starting material. After cooling, additional
1-methylpiperidine-4-carboxylic acid (184 mg, 1.03 mmol) and
1,1'-carbonyldiimidazole (167 mg, 1.03 mmol) were added, and the
solution was heated to reflux overnight. The solvent was removed in
vacuo. The residue was dissolved in CH.sub.2Cl.sub.2 (100 mL), and
the solution was washed with satd
[1209] NaHCO.sub.3, water and brine, dried over Na.sub.2SO.sub.4
and concentrated. Purification by column chromatography (silica
gel, CH.sub.2Cl.sub.2/MeOH/Et.sub.3N, 94:5:1 to 89:10:1) gave the
title compound (330 mg, 79%) as a pale yellow solid and as a
mixture of amide rotamers: mp 120-135.degree. C. dec; .sup.1H NMR
(300 MHz, DMSO-d.sub.6) .delta. 10.65-10.61 (m, 1H), 8.62-8.57 (m,
1H), 8.23-8.06 (m, 2H), 7.60-7.34 (m, 3H), 7.31-7.25 (m, 1H), 7.12
(dd, J=8.0, 7.2 Hz, 1H), 7.03-6.98 (m, 1H), 6.42-6.16 (m, 1H),
5.06-4.85 (m, 2H), 3.72-3.68 (m, 3H), 3.12-2.99 (m, 3H), 2.85-2.82
(m, 2H), 2.52-2.44 (m, 1H), 2.19 (s, 3H), 1.95-1.88 (m, 2H),
1.74-1.61 (m, 4H); MS (ESI) m/e 446 (M+H).sup.+.
Example 218
Preparation of
(E)-N-Methyl-N-(1-methyl-1H-indol-2-ylmethyl)-3-[6-(2-pyridin-4-yl-acetyl-
amino)pyridin-3-yl]acrylamide
[1210] According to the procedure of Example 113, except
substituting 4-pyridylacetic acid hydrochloride for the
1-methylpiperidine-4-carboxylic acid hydrochloride, the title
compound (140 mg, 34%) was prepared as a light yellow solid:
.sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 11.04-10.99 (m, 1H),
8.66-8.62 (m, 1H), 8.53-8.52 (m, 2H), 8.23-8.02 (m, 2H), 7.61-7.27
(m, 6H), 7.15-7.10 (m, 1H), 7.04-6.99 (m, 1H), 6.42-6.17 (m, 1H),
5.06-4.86 (m, 2H), 3.83-3.68 (m, 5H), 3.12-3.00 (m, 3H); MS (ESI)
m/e 440 (M+H).sup.+.
Example 219
Preparation of (E)-1-Acetyl-piperidine-4-carboxylic acid
(5-{2-[methyl-(1-methyl-1H-indol-2-ylmethyl)carbamoyl]vinyl}pyridin-2-yl)-
amide
a)
(E)-4-(5-{2-[Methyl-(1-methyl-1H-indol-2-ylmethyl)carbamoyl]vinyl}pyrid-
in-2-ylcarbamoyl)piperidine-1-carboxylic acid benzyl ester
[1211] A solution of [1-(carbobenzoxy)-4-piperidine]carboxylic acid
(250 mg, 0.950 mmol) and 1,1'-carbonyldiimidazole (162 mg, 1.00
mmol) in 1,4-dioxane (15 mL) was heated to reflux for 3 h.
(E)-3-(6-Aminopyridin-3-yl)-N-methyl-N-(1-methyl-1H-indol-2-ylmethyl)acry-
lamide (304 mg, 0.950 mol) was then added and the resulting
solution was heated to reflux overnight. TLC analysis indicated
remaining starting material. After cooling, additional
[1-(carbobenzoxy)-4-piperidine]carboxylic acid (250 mg, 0.950 mmol)
and 1,1'-carbonyldiimidazole (162 mg, 1.00 mmol) were added, and
the mixture was heated to reflux overnight. The solvent was removed
in vacuo. The residue was dissolved in CH.sub.2Cl.sub.2 (100 mL),
and the solution was washed with satd NaHCO.sub.3, water and brine,
dried over Na.sub.2SO.sub.4, and concentrated. Purification by
column chromatography (silica gel, CH.sub.2Cl.sub.2/MeOH, 98:2 to
97:3) gave the title compound (420 mg, 78%) a white solid and as a
mixture of amide rotamers: .sup.1H NMR (300 MHz, CDCl.sub.3)
.delta. 8.40 (s, 1H), 8.24 (d, J=8.7 Hz, 1H), 7.97-7.88 (m, 2H),
7.72 (d, J=15.4 Hz, 1H), 7.59 (d, J=7.9 Hz, 1H), 7.36-7.20 (m, 7H),
7.11 (dd, J=7.7, 7.0 Hz, 1H), 6.89 (d, J=15.3 Hz, 1H), 6.50-6.40
(m, 1H), 5.14 (s, 2H), 4.93-4.82 (m, 2H), 4.40-4.10 (m, 2H),
3.72-3.69 (m, 3H), 3.12-3.07 (m, 3H), 2.93-2.88 (m, 2H), 2.50-2.42
(m, 1H), 2.00-1.70 (m, 4H); MS (ESI) m/e 566 (M+H).sup.+.
b) (E)-Piperidine-4-carboxylic acid
(5-{2-[methyl-(1-methyl-1H-indol-2-ylmethyl)
carbamoyl]vinyl}pyridin-2-yl)amide
[1212] To a solution of
(E)-4-(5-{2-[methyl-(1-methyl-1H-indol-2-ylmethyl)carbamoyl]vinyl}pyridin-
-2-ylcarbamoyl)piperidine-1-carboxylic acid benzyl ester (250 mg,
0.442 mmol) in CH.sub.2Cl.sub.2 (15 mL) was added trimethylsilyl
iodide (0.25 mL, 1.8 mmol). The mixture was stirred at ambient
temperature for 2 h, and then quenched by the addition of MeOH. The
solvent was removed in vacuo. Purification by column chromatography
(silica gel, CH.sub.2Cl.sub.2/MeOH/Et.sub.3N, 94.5:5:0.5 to
89.5:10:0.5 to 74.5:35:0.5) gave the title compound (110 mg, 58%)
as a white solid and as a mixture of amide rotamers: .sup.1H NMR
(300 MHz, DMSO-d.sub.6) .delta. 10.59-10.55 (m, 1H), 8.62-8.57 (m,
1H), 8.19-8.09 (m, 2H), 7.60-7.25 (m, 4H), 7.18-7.09 (m, 1H),
7.12-6.98 (m, 1H), 6.42-6.17 (m, 1H), 5.06-4.85 (m, 2H), 3.72-3.68
(m, 3H), 2.99-2.94 (m, 3H), 2.60-2.42 (m, 5H), 1.70-1.65 (m, 2H),
1.50-1.45 (m, 2H).
c) (E)-1-Acetyl-piperidine-4-carboxylic acid
(5-{2-[methyl-(1-methyl-1H-indol-2-ylmethyl)carbamoyl]vinyl}pyridin-2-yl)-
amide
[1213] To a solution of (E)-piperidine-4-carboxylic acid
(5-{2-[methyl-(1-methyl-1H-indol-2-ylmethyl)carbamoyl]vinyl}pyridin-2-yl)-
amide (80 mg, 0.18 mmol) in CH.sub.2Cl.sub.2 (5 mL) was added
excess of triethylamine and acetic anhydride (58 mg, 0.56 mmol).
The reaction mixture was stirred at ambient temperature overnight.
The solvent was removed in vacuo. Purification by column
chromatography (silica gel, CH.sub.2Cl.sub.2/MeOH/Et.sub.3N,
96.5:3:0.5) gave the title compound (87 mg, 99%) as pale yellow
solid and as a mixture of amide rotamers: mp=100-120.degree. C.
dec; .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.72-10.67 (m,
1H), 8.63-8.59 (m, 1H), 8.23-8.06 (m, 2H), 7.60-7.26 (m, 4H), 7.12
(dd, J=7.4, 7.3 Hz, 1H), 7.03-6.98 (m, 1H), 6.42-6.17 (m, 1H),
5.06-4.85 (m, 2H), 4.39 (d, J=11.8 Hz, 1H), 3.86 (d, J=11.6 Hz,
1H), 3.72-3.68 (m, 3H), 3.12-2.99 (m, 4H), 2.76 (m, 1H), 2.00 (s,
3H), 1.81-1.77 (m, 2H), 1.68-1.32 (m, 2H), 1.12-0.95 (m, 1H); MS
(ESI) m/e 474 (M+.sup.1-1).sup.+.
Example 220
Preparation of
(E)-3-(6-Amino-pyridin-3-yl)-N-(2,3-dimethoxy-benzyl)-N-methyl-acrylamide
[1214] According to the procedure of Example 1(a), except
substituting (2,3-dimethoxy-benzyl)methyl-amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-(6-amino-pyridin-3-yl)acrylic acid for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, the title compound was prepared as a
pale yellow solid (434 mg, 53%): .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 8.14 (d, J=11.3 Hz, 1H), 7.89-7.77 (m, 1H),
7.44-7.39 (m, 1H), 7.05-6.94 (m, 3H), 6.68-6.45 (m, 4H), 4.74-4.61
(m, 2H), 3.80 (s, 3H), 3.74 (s, 3H), 3.07-2.86 (m, 3H); MS (ESI)
tee 328 (M+
Example 221
Preparation of
(E)-N-(4-Acetylamino-benzyl)-3-(6-amino-pyridin-3-yl)-N-methyl-acrylamide
[1215] According to the procedure of Example 1(a), except
substituting N-(4-methylaminomethyl-phenyl)acetamide for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-(6-amino-pyridin-3-yl)acrylic acid for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, the title compound was prepared as a
pale yellow solid (200 mg, 25%): .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 9.93 (s, 1H), 8.15-8.13 (m, 1H), 7.86-7.79
(m, 1H), 7.54-7.39 (m, 3H), 7.15 (s, 2H), 7.03-6.93 (m, 1H), 6.46
(s, 3H), 4.70-4.53 (m, 2H), 3.04-2.87 (m, 3H), 2.02 (s, 3H); MS
(ESI) m/e 325 (M+H).sup.+.
Example 222
Preparation of
(E)-3-[3-(2-Dimethylamino-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]py-
rimidin-6-yl]-N-methyl-N-(1-methyl-1H-indol-2-ylmethyl)acrylamide
[1216] According to the procedure of Example 1(a), except
substituting
(E)-3-[3-(2-dimethylamino-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]py-
rimidin-6-yl]acrylic acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, and substituting
methyl-(1-methyl-1H-indol-2-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(40 mg, 22%) was prepared as a pale yellow solid: .sup.1H NMR (300
MHz, DMSO-d.sub.6) .delta. 9.98 (br s, 1H), 8.38-8.33 (m, 1H),
8.00-7.91 (m, 1H), 7.57-7.42 (m, 3H), 7.22-7.01 (m, 3H), 6.42-6.16
(m, 1H), 5.04-4.85 (m, 2H), 4.53-4.47 (m, 2H), 3.72-3.68 (m, 3H),
3.51-3.31 (m, 4H), 3.11-2.99 (m, 4H), 2.72-2.39 (m, 5H); MS (ESI)
m/e 447 (M+H).sup.+.
Example 223
Preparation of
(E)-N-Methyl-N-(1-methyl-1H-indol-2-ylmethyl)-3-[3-(2-morpholin-4-yl-ethy-
l)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl]acrylamide
hydrochloride
[1217] According to the procedure of Example 1, except substituting
(E)-3-[3-(2-morpholin-4-yl-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]p-
yrimidin-6-yl]acrylic acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, and substituting
methyl-(1-methyl-1H-indol-2-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(355 mg, 61%) was prepared as a pale yellow solid: .sup.1H NMR (300
MHz, DMSO-d.sub.6) .delta. 10.16-9.98 (m, 2H), 8.42-8.37 (m, 1H),
8.00-7.92 (m, 1H), 7.58-7.39 (m, 3H), 7.24-6.99 (m, 3H), 6.42-6.15
(m, 1H), 5.06-4.85 (m, 2H), 4.57-4.51 (m, 2H), 4.00-3.97 (m, 2H),
3.73-3.37 (m, 11H), 3.15-2.98 (m, 5H); MS (ESI) m/e 489
(M+H).sup.+.
Example 224
Preparation of
(E)-N-Methyl-N-(4-methyl-naphthalen-1-ylmethyl)-3-[3-(2-morpholin-4-yl-et-
hyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl]acrylamide
hydrochloride
[1218] According to the procedure of Example 1, except substituting
(E)-3-[3-(2-morpholin-4-yl-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]p-
yrimidin-6-yl]acrylic acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, and substituting
methyl-(4-methyl-naphthalen-1-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(175 mg, 50%) was prepared as a white solid: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 10.50 (br s, 1H), 10.14-10.09 (m, 1H),
8.41-8.30 (m, 1H), 8.16-7.85 (m, 3H), 7.69-7.53 (m, 3H), 7.40-7.01
(m, 3H), 5.37-4.85 (m, 4H), 4.65-4.46 (m, 2H), 3.99-3.93 (m, 2H),
3.78-3.31 (m, 6H), 3.20-2.98 (m, 5H), 2.65-2.63 (m, 3H); MS (ESI)
m/e 500 (M+H).sup.+.
Example 225
Preparation of
(E)-N-Acenaphthen-5-ylmethyl-N-methyl-3-[3-(2-morpholin-4-yl-ethyl)-2-oxo-
-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl]acrylamide
hydrochloride
[1219] According to the procedure of Example 1, except substituting
(E)-3-[3-(2-morpholin-4-yl-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]p-
yrimidin-6-yl]acrylic acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, and substituting
acenaphthen-5-ylmethyl-methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(175 mg, 43%) was prepared as a pale yellow solid: .sup.1H NMR (300
MHz, DMSO-d.sub.6) .delta. 10.15-10.11 (m, 2H), 8.41-8.33 (m, 1H),
7.98-7.96 (m, 1H), 7.88-7.74 (m, 1H), 7.60-7.44 (m, 2H), 7.38-7.12
(m, 4H), 5.23-5.01 (m, 2H), 4.55-4.46 (m, 2H), 4.00-3.96 (m, 2H),
3.86-3.36 (m, 10H), 3.12-2.89 (m, 7H); MS (ESI) m/e 512
(M+H).sup.+.
Example 226
Preparation of
(E)-N-(2-Ethoxy-3-methoxy-benzyl)-N-methyl-3-[3-(2-morpholin-4-yl-ethyl)--
2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl]acrylamide
hydrochloride
[1220] According to the procedure of Example 1, except substituting
(E)-3-[3-(2-morpholin-4-yl-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]p-
yrimidin-6-yl]acrylic acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, and substituting
(2-ethoxy-3-methoxy-benzyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(155 mg, 37%) was prepared as a off-white solid: .sup.1H NMR (300
MHz, DMSO-d.sub.6) .delta. 10.15-10.13 (m, 2H), 8.40-8.35 (m, 1H),
8.00-7.92 (m, 1H), 7.54-7.42 (m, 1H), 7.25-7.20 (m, 1H), 7.13-6.68
(m, 2H), 6.66-6.61 (m, 1H), 5.11 (br s, 1H), 4.78-4.63 (m, 2H),
4.57-4.52 (m, 2H), 4.01-3.95 (m, 4H), 3.82-3.58 (m, 9H), 3.37-3.35
(m, 2H), 3.20-2.86 (m, 5H), 1.28-1.18 (m, 3H); MS (ESI) m/e 510
(M+H).sup.+.
Example 227
Preparation of
(E)-N-Methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)-3-[3-(2-morpholin-4-
-yl-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl]acrylamide
hydrochloride
[1221] According to the procedure of Example 1, except substituting
(E)-3-[3-(2-morpholin-4-yl-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]p-
yrimidin-6-yl]acrylic acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, and substituting
methyl-(3-methyl-benzo[b]thiophen-2-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(140 mg, 33%) was prepared as a off-white solid: .sup.1H NMR (300
MHz, DMSO-d.sub.6) .delta. 10.45 (br s, 1H), 10.14 (s, 1H),
8.41-8.39 (m, 1H), 8.01 (s, 1H), 7.88-7.86 (m, 1H), 7.74-7.73 (m,
1H), 7.56-7.53 (m, 1H), 7.41-7.18 (m, 3H), 6.31 (br s, 1H),
5.11-4.88 (m, 2H), 4.57-4.55 (m, 2H), 3.99-3.96 (m, 2H), 3.75-3.71
(m, 4H), 3.57-3.55 (m, 2H), 3.39-3.37 (m, 2H), 3.15-2.94 (m, 5H),
2.42 (s, 3H); MS (ESI) m/e 506 (M+H).sup.+.
Example 228
Preparation of
(E)-(6-{2-[Methyl-(1-methyl-1H-indol-2-ylmethyl)carbamoyl]vinyl}-2-oxo-1,-
4-dihydro-2H-pyrido[2,3-d]pyrimidin-3-yl)acetic acid
a)
(E)-(6-{2-[Methyl-(1-methyl-1H-indol-2-ylmethyl)carbamoyl]vinyl}-2-oxo--
1,4-dihydro-2H-pyrido[2,3-d]pyrimidin-3-yl)acetic acid ethyl
ester
[1222] According to the procedure of Example 1(a), except
substituting
(E)-3-(3-ethoxycarbonylmethyl-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrim-
idin-6-yl)acrylic acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, and substituting
methyl-(1-methyl-1H-indol-2-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(1.20 g, 89%) was prepared as a tan solid and as a mixture of amide
rotomers: .sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 8.34-8.28 (m,
1H), 7.66-7.34 (m, 2H), 7.60-7.53 (m, 2H), 7.33-7.21 (m, 2H), 7.11
(t, J=7.5 Hz, 1H), 6.83 (d, J=15.0 Hz, 1H), 6.50-6.40 (m, 1H),
4.93-4.30 (m, 2H), 4.59-4.52 (m, 2H), 4.27-4.19 (m, 4H), 3.71 (s,
3H), 3.13-3.06 (m, 3H), 1.30 (t, J=7.2 Hz, 3H); MS (ESI) m/e 462
(M+H).sup.+.
b)
(E)-(6-{2-[Methyl-(1-methyl-1H-indol-2-ylmethyl)carbamoyl]vinyl}-2-oxo--
1,4-dihydro-2H-pyrido[2,3-d]pyrimidin-3-yl)acetic acid
[1223] A suspension of
(E)-(6-{2-[methyl-(1-methyl-1H-indol-2-ylmethyl)carbamoyl]vinyl}-2-oxo-1,-
4-dihydro-2H-pyrido[2,3-d]pyrimidin-3-yl)acetic acid ethyl ester
(0.40 g, 0.87 mmol) in methanol (30 mL) was treated with 1N NaOH
(10 mL, 10 mmol). The mixture was heated at reflux for 2 h. After
cooling, the methanol was evaporated. The residue was diluted with
H.sub.2O (15 mL) and neutralized to pH 6 with 2N HCl. The solid was
collected by filtration, and triturated subsequently with a mixture
CH.sub.3CN/H.sub.2O (9:1, v/v), diethyl ether, and methanol to give
the title compound (180 mg, 48%) as a tan solid: .sup.1H NMR (300
MHz, DMSO-d.sub.6) .delta. 12.78 (s, 1H), 10.09-10.06 (m, 1H),
8.39-8.36 (m, 1H), 8.01-7.92 (m, 1H), 7.57-7.39 (m, 3H), 7.26-6.69
(m, 3H), 6.42-6.18 (m, 1H), 5.04-4.85 (m, 2H), 4.53-4.48 (m, 2H),
4.05-4.01 (m, 2H), 3.72-3.68 (m, 3H), 3.11-2.99 (m, 3H); MS (ESI)
m/e 434 (M+H).sup.+.
Example 229
Preparation of Sodium
(E)-(6-{2-[methyl-(1-methyl-1H-indol-2-ylmethyl)carbamoyl]vinyl}-2-oxo-1,-
4-dihydro-2H-pyrido[2,3-d]pyrimidin-3-yl)acetate
[1224] A suspension of
(E)-(6-{2-[methyl-(1-methyl-1H-indol-2-ylmethyl)carbamoyl]vinyl}-2-oxo-1,-
4-dihydro-2H-pyrido[2,3-d]pyrimidin-3-yl)acetic acid ethyl ester
(0.19 g, 0.40 mmol) in methanol (20 mL) was treated with 1N NaOH
(0.80 mL, 0.80 mmol). The mixture was heated at reflux for 2 h.
After cooling, the solid was collected by filtration to give the
title compound (140 mg, 77%) as an off-white solid: .sup.1H NMR
(300 MHz, DMSO-d.sub.6+D.sub.2O) .delta. 8.30-8.25 (m, 1H),
7.97-7.86 (m, 1H), 7.55-7.42 (m, 3H), 7.17-7.05 (m, 3H), 6.46-6.22
(m, 1H), 5.03-4.86 (m, 2H), 4.55 (s, 1H), 4.48 (s, 1H), 3.76-3.67
(m, 5H), 3.13-3.05 (m, 3H); MS (ESI) m/e 434 (M+H).sup.+.
Example 230
Preparation of Sodium
(E)-(6-{2-(methyl-(3-methyl-benzo[b]thiophen-2-ylmethyl)carbamoyl)
vinyl}-2-oxo-1,4-dihydro-2H-pyrido[2,3-d]pyrimidin-3-yl)acetate
a)
(E)-(6-{2-[Methyl-(3-methyl-benzo[b]thiophen-2-ylmethyl)carbamoyl]vinyl-
}-2-oxo-1,4-dihydro-2H-pyrido[2,3-d]pyrimidin-3-yl)acetic acid
ethyl ester
[1225] According to the procedure of Example 1(a), except
substituting
(E)-3-(3-ethoxycarbonylmethyl-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrim-
idin-6-yl)acrylic acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, and substituting
methyl-(3-methyl-benzo[b]thiophen-2-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(380 mg, 59%) was prepared as a tan solid and as a mixture of amide
rotomers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.15 (s,
1H), 8.40 (s, 1H), 8.01 (s, 1H), 7.87 (d, J=7.5 Hz, 1H), 7.43 (d,
J=7.8 Hz, 1H), 7.64 (d, J=15.3 Hz, 1H), 7.42-7.16 (m, 3H),
5.11-4.88 (m, 2H), 4.53 (s, 2H), 4.18-4.11 (m, 4H), 3.14-2.93 (m,
3H), 2.42 (s, 3H), 1.21 (t, J=6.9 Hz, 3H); MS (ESI) m/e 479
(M+H).sup.+.
b) Sodium
(E)-(6-{2-[methyl-(3-methyl-benzo[b]thiophen-2-ylmethyl)carbamoy-
l]vinyl}-2-oxo-1,4-dihydro-2H-pyrido[2,3-d]pyrimidin-3-yl)acetate
[1226] According to the procedure of Example 125, except
substituting
(E)-(6-{2-[methyl-(3-methyl-benzo[b]thiophen-2-ylmethyl)carbamoyl]vinyl}--
2-oxo-1,4-dihydro-2H-pyrido[2,3-d]pyrimidin-3-yl)acetic acid ethyl
ester for the
(E)-(6-{2-[methyl-(1-methyl-1H-indol-2-ylmethyl)carbamoyl]vinyl}--
2-oxo-1,4-dihydro-2H-pyrido[2,3-d]pyrimidin-3-yl)acetic acid ethyl
ester, the title compound (300 mg, 85%) was prepared as a white
solid: .sup.1H NMR (300 MHz, DMSO-d.sub.6+D.sub.2O) .delta.
8.29-8.28 (m, 1H), 7.95-7.84 (m, 2H), 7.77 (d, J=4.8 Hz, 1H),
7.53-7.49 (m, 1H), 7.46-7.43 (m, 1H), 7.40-7.37 (m, 1H), 7.22-7.09
(m, 1H), 5.07-4.89 (m, 2H), 4.55-4.53 (m, 2H), 3.78-3.77 (m, 2H),
3.17-3.01 (m, 3H), 2.42 (s, 3H); MS (ESI) m/e 451 (M+H).sup.+.
Example 231
Preparation of
(E)-N-Methyl-N-(1-methyl-1H-indol-2-ylmethyl)-3-{3-[2-(4-methyl-piperazin-
-1-yl)-2-oxo-ethyl]-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl}a-
crylamide hydrochloride
[1227] According to the procedure of Example 1, except substituting
(E)-(6-{2-[methyl-(1-methyl-1H-indol-2-ylmethyl)carbamoyl]vinyl}-2-oxo-1,-
4-dihydro-2H-pyrido[2,3-d]pyrimidin-3-yl)acetic acid for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, and substituting 1-methylpiperazine
for the methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title
compound (173 mg, 43%) was prepared as a off-white solid: .sup.1H
NMR (300 MHz, DMSO-d.sub.6) .quadrature. 10.78 (br s, 1H),
10.07-10.03 (m, 1H), 8.41-8.37 (m, 1H), 7.98-7.90 (m, 1H),
7.57-7.39 (m, 3H), 7.25-6.99 (m, 3H), 6.42-6.17 (m, 1H), 5.04-4.85
(m, 2H), 4.46-4.03 (m, 5H), 3.72-3.68 (m, 3H), 3.44-3.41 (m, 3H),
3.11-2.91 (m, 7H), 2.78 (s, 3H); MS (ESI) m/e 516 (M+H).sup.+.
Example 232
Preparation of
(E)-N-Methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)-3-{3-[2-(4-methyl-p-
iperazin-1-0)-2-oxo-ethyl]-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-
-6-yl}acrylamide hydrochloride
a)
(E)-(6-{2-{Methyl-(3-methyl-benzo[b]thiophen-2-ylmethyl)carbamoyl)
vinyl}-2-oxo-1,4-dihydro-2H-pyrido[2,3-d]pyrimidin-3-yl)acetic
acid
[1228] According to the procedure of Example 124(b), except
substituting
(E)-(6-{2-[methyl-(3-methyl-benzo[b]thiophen-2-ylmethyl)carbamoyl]vinyl}--
2-oxo-1,4-dihydro-2H-pyrido[2,3-d]pyrimidin-3-yl)acetic acid ethyl
ester for the
(L)-(6-{2-[methyl-(1-methyl-1H-indol-2-ylmethyl)carbamoyl]vinyl}--
2-oxo-1,4-dihydro-2H-pyrido[2,3-d]pyrimidin-3-yl)acetic acid ethyl
ester, the title compound (720 mg, 89%) was prepared as a light
yellow solid and as a mixture of amide rotomers: .sup.1H NMR (300
MHz, DMSO-d.sub.6) .delta. 10.78 (br s, 1H), 10.08 (s, 1H), 8.39
(s, 1H), 8.01 (s, 1H), 7.88 (d, J=7.5 Hz, 1H), 7.74 (d, J=7.4 Hz,
1H), 7.56-7.16 (m, 4H), 5.11-4.88 (m, 2H), 4.52 (s, 2H), 4.04 (s,
2H), 3.14-2.93 (m, 3H), 2.42 (s, 3H); MS (ESI) m/e 451
(M+H).sup.+.
b)
(E)-N-Methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)-3-{3-[2-(4-methyl-
-piperazin-1-yl)-2-oxo-ethyl]-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimi-
din-6-yl}acrylamide hydrochloride
[1229] According to the procedure of Example 1, except substituting
(E)-(6-{2-[methyl-(3-methyl-benzo[b.]thiophen-2-ylmethyl)carbamoyl]vinyl}-
-2-oxo-1,4-dihydro-2H-pyrido[2,3-d]pyrimidin-3-yl)acetic acid for
the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid, and substituting 1-methylpiperazine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(44 mg, 9%) was prepared as a pale-yellow solid, after purification
by preparative HPLC: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
10.60 (br s, 1H), 10.06 (s, 1H), 8.40 (s, 1H), 7.98 (s, 1H), 7.87
(d, J=7.5 Hz, 1H), 7.73 (d, J=8.0 Hz, 1H), 7.56-7.51 (m, 1H),
7.42-7.15 (m, 3H), 5.11-4.88 (m, 2H), 4.46-4.38 (m, 4H), 4.22-4.04
(m, 2H), 3.61-3.42 (m, 4H), 3.17-2.73 (m, 8H), 2.42 (s, 3H); MS
(ESI) m/e 533 (M+H).sup.+.
Example 233
Preparation of
(E)-N-Methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)-3-{3-[2-(4-methyl-p-
iperazin-1-0)-2-oxo-ethyl]-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-
-6-yl}acrylamide hydrochloride
a)
(E)-3-[3-(2,2-Dimethoxy-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]py-
rimidin-6-yl]-N-methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)acrylamide
[1230] According to the procedure of Example 2, except substituting
6-bromo-3-(2,2-dimethoxy-ethyl)-3,4-dihydro-1H-pyrido[2,3-d]pyrimidin-2-o-
ne for the
7-bromo-3,3-dimethyl-1,3,4,5-tetrahydro-pyrido[2,3-e][1,4]diaze-
pin-2-one, the title compound (490 mg, 60%) was prepared as a white
solid and as a mixture of amide rotomers: .sup.1H NMR (300 MHz,
CDCl.sub.3) .delta. 8.33 (br s, 1H), 8.07-8.02 (m, 1H), 7.78-7.76
(m, 1H), 7.71-7.67 (m, 2H), 7.52-7.48 (m, 1H), 7.38-7.22 (m, 2H),
6.89-6.80 (m, 1H), 4.95-4.88 (m, 2H), 4.61-4.58 (m, 3H), 3.52-3.51
(m, 2H), 3.44 (s, 6H), 3.15-3.11 (m, 3H), 2.44 (s, 3H); MS (ESI)
m/e 481 (M+H).sup.+.
b)
(E)-N-Methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)-3-[2-oxo-3-(2-oxo-
-ethyl)-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl]acrylamide
[1231] A suspension of
(E)-3-[3-(2,2-dimethoxy-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyri-
midin-6-yl]-N-methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)acrylamide
(450 mg, 0.937 mmol) in CH.sub.2Cl.sub.2 (20 mL) was treated with
TFA (1 mL) and H.sub.2O (1 mL). The reaction was allowed to stir
overnight at room temperature. The solution was washed with
saturated NaHCO.sub.3 (2.times.15 mL). The aqueous solutions were
extracted with CH.sub.2Cl.sub.2 (40 mL). The combined
CH.sub.2Cl.sub.2 solutions were washed with brine, dried over
Na.sub.2SO.sub.4, and concentrated to give the title compound (440
mg, 99%) as a white solid and as amide rotomers: .sup.1H NMR (300
MHz, DMSO-d.sub.6) .delta. 10.15 (s, 1H), 9.54 (s, 1H), 8.40 (s,
1H), 8.02 (s, 1H), 7.87 (d, J=7.5 Hz, 1H), 7.73 (d, J=7.8 Hz, 1H),
7.53-7.31 (m, 4H), 5.11-4.88 (m, 2H), 4.51 (s, 2H), 4.18 (s, 2H),
3.15-2.93 (m, 3H), 2.42 (s, 3H); MS (ESI) m/e 435 (M+H).sup.+.
c)
(E)-N-Methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)-3-{3-[2-(4-methyl-
-piperazin-1-yl)-ethyl]-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6--
yl}acrylamide hydrochloride
[1232] To a suspension of
(E)-N-methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)-3-[2-oxo-3-(2-oxo-e-
thyl)-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl]acrylamide
(410 mg, 0.945 mmol) in dichloroethane (25 mL) was added
1-methylpiperazine (0.16 mL, 1.4 mmol) and a few drops of HOAc,
followed by the addition of NaBH(OAc).sub.3 (320 mg, 1.51 mmol).
The reaction mixture was allowed to stir over night at room
temperature. The resulting precipitate was collected by filtration
to give a white solid. Purification by column chromatography
(silica gel, CH.sub.2Cl.sub.2/MeOH/Et.sub.3N, 90/9.5/0.5 to
85/14.5/0.5) afforded the free base (400 mg, 82%) of the title
compound. The free base was dissolved in a mixture of
CH.sub.2Cl.sub.2/MeOH (8 mL/0.7 mL). To this was added 1N HCl in
diethyl ether (0.48 mL, 0.48 mmol), and the mixture was stirred at
room temperature for 30 min. The resulting precipitate was
collected by filtration to give the title compound (190 mg, 72%) as
a white solid: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
11.95-10.90 (m, 1H), 10.07 (s, 1H), 8.40 (s, 1H), 7.99 (s, 1H),
7.87 (d, J=4.5 Hz, 1H), 7.73 (d, J=4.5 Hz, 1H), 7.54 (d, J=9.3 Hz,
1H), 7.41-7.17 (m, 3H), 5.11-4.88 (m, 2H), 4.58-4.56 (m, 2H),
3.93-3.29 (m, 11H), 3.17 (s, 3H), 2.94-2.80 (m, 4H), 2.42 (s, 3H);
MS (ESI) m/e 519 (M+H).sup.+.
Example 234
Preparation of
(E)-2-Amino-5-{2-[methyl-(1-methyl-1H-indol-2-ylmethyl)carbamoyl]vinyl}-N-
-(2-morpholin-4-yl-ethyl)nicotinamide hydrochloride
[1233] According to the procedure of Example 1, except substituting
3-[6-amino-5-(2-morpholin-4-yl-ethylcarbamoyl)pyridin-3-yl]acrylic
acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, and
methyl-(1-methyl-1H-indol-2-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, the title compound
(170 mg, 23%) was prepared as a pale yellow solid: .sup.1H NMR (300
MHz, DMSO-d.sub.6) .delta. 10.87-10.61 (m, 1H), 9.69-9.66 (m,
9.40-9.28 (m, 1H), 8.70-8.31 (m, 3H), 7.95-7.39 (m, 4H), 7.15-6.97
(m, 2H), 6.40-6.08 (m, 1H), 5.27-4.85 (m, 2H), 3.94-3.55 (m, 12H),
3.20-2.96 (m, 6H); MS (ESI) m/e 477 (M+H).sup.+.
Example 235
Preparation of
(E)-N-(3-Methyl-benzo[b]thiophen-2-ylmethyl)-3-[3-(3-morpholin-4-yl-propy-
l)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl]acrylamide
hydrochloride
[1234] According to the procedure of Example 1, except substituting
methyl-(3-methyl-benzo[b]thiophen-2-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-[3-(3-morpholin-4-yl-propyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]-
pyrimidin-6-yl]acrylic acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3,-e][1,4]diazepin-7-
-yl)acrylic acid hydrochloride, the title compound (0.86 g, 86%)
was prepared as an off-white solid: .sup.1H NMR (500 MHz,
DMSO-d.sub.6) .delta. 10.96 (br s, 1H), 10.01 (br s, 1H), 8.39 (s,
1H), 8.01 (d, J=7.0 Hz, 1H), 7.86 (d, J=7.5 Hz, 1H), 7.73 (d, J=7.0
Hz, 1H), 7.58-7.51 (m, 1H), 7.40 (t, J=7.5 Hz, 1H), 7.32 (t, J=7.5
Hz, 1H), 7.21-7.12 (m, 1H), 5.16-4.63 (m, 2H), 4.51-4.49 (m, 2H),
3.94-3.92 (m 2H), 3.80-3.75 (m, 2H), 3.43-3.36 (m, 5H), 3.14-2.93
(m, 6H), 2.41 (s, 3H), 1.96-2.09 (m, 2H); MS (ESI) m/e 520
(M+H).sup.+.
Example 236
Preparation of
(E)-N-(2-Ethoxy-3-methoxy-benzyl)-N-methyl-3-[3-(3-morpholin-4-yl-propyl)-
-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl]acrylamide
hydrochloride
[1235] According to the procedure of Example 1, except substituting
(2-ethoxy-3-methoxy-benzyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-[3-(3-morpholin-4-yl-propyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]-
pyrimidin-6-yl]acrylic acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3,-e][1,4]diazepin-7-
-yl)acrylic acid hydrochloride, the title compound (0.67 g, 62%)
was prepared as an off-white solid: .sup.1H NMR (500 MHz,
DMSO-d.sub.6) .delta. 11.16 (br s, 1H), 9.97 (d, J=11 Hz, 1H),
8.40-8.30 (m, 1H), 8.02-7.91 (m, 1H), 7.53-7.46 (m, 1H), 7.24-7.18
(m, 1H), 7.09-6.93 (m, 2H), 6.71-6.63 (m, 1H), 4.79-4.62 (m, 2H),
4.55-4.40 (m, 2H), 4.21-3.85 (m, 2H), 3.80-3.75 (m, 6H), 3.45-3.37
(m, 4H), 3.09-2.86 (m, 8H), 2.08-1.97 (m, 2H), 1.30-1.26 (m, 3H);
MS (ESI) m/e 524 (M+H).sup.+.
Example 237
Preparation of
(E)-N-(5-{2-[Methyl-(3-methyl-benzo[b]thiophen-2-ylmethyl)
carbamoyl]vinyl}pyridin-2-yl)-4-(4-methyl-piperazin-1-yl)-4-oxo-butyramid-
e
a)
(E)-3-(6-Amino-pyridin-3-yl)-N-methyl-N-(3-methyl-benzo[b]thiophen-2-yl-
methyl)acrylamide
[1236] According to the procedure of Example 1, except substituting
methyl-(3-methyl-benzo[b]thiophen-2-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-(6-amino-pyridin-3-yl)acrylic acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3,-e][1,4]diazepin-7-
-yl)acrylic acid hydrochloride, the title compound (2.2 g, 73%) was
prepared as a yellow solid: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
8.21 (s, 1H), 2.81-2.75 (m, 1H), 2.71-2.59 (m, 3H), 7.41-7.25 (m,
2H), 6.85-6.65 (m, 1H), 6.50-6.41 (m, 1H), 5.01-4.81 (m, 2H),
4.78-4.61 (m, 2H), 3.12 (s, 3H), 2.41 (s, 3H); MS (ESI) m/e 338
(M+H).sup.+.
b)
(E)-3-[6-(2,5-Dioxo-pyrrolidin-1-yl)pyridin-3-yl]-N-methyl-N-(3-methyl--
benzo[b]thiophen-2-ylmethyl)acrylamide
[1237] According to the procedure of Example 109, except
substituting
(E)-3-(6-amino-pyridin-3-yl)-N-methyl-N-(3-methyl-benzo[b]thiophen-2-ylme-
thyl)acrylamide (2.2 g, 6.6 mmol) for the
(E)-3-(6-aminopyridin-3-yl)-N-methyl-N-(1-methyl-1H-indol-2-ylmethyl)acry-
lamide, and succinic anhydride (0.80 g, 8.0 mmol) in 1,4-dioxane
(119 mL) was heated to reflux for 15 h overnight. The title
compound (1.7 g, 61%) was prepared as a yellow oil: .sup.1H NMR
(300 MHz, DMSO-d.sub.6) .delta. 8.78 (s, 1H), 8.01-7.91 (m, 1H),
7.80-7.72 (m, 2H), 7.70-7.63 (m, 1H), 7.43-7.39 (m, 3H), 7.01-6.92
(m, 1H), 5.01-4.85 (m, 2H), 3.21-3.10 (m, 3H), 2.90-2.85 (m, 4H),
2.44 (s, 3H); MS (ESI) m/e 420 (M+H).sup.+
c)
(E)-N-(5-{2-[Methyl-(3-methyl-benzo[b]thiophen-2-ylmethyl)carbamoyl]vin-
yl}pyridin-2-yl)-4(4-methyl-piperazin-1-yl)-4-oxo-butyramide
[1238] According to the procedure of Example 110 except
substituting
3-[6-(2,5-dioxo-pyrrolidin-1-yl)pyridin-3-yl]-N-methyl-N-(3-methyl-benzo[-
b]thiophen-2-ylmethyl)acrylamide for the
(E)-3-[6-(2,5-dioxo-pyrrolidin-1-yl)-pyridin-3-yl]-N-methyl-N-(1-methyl-1-
H-indol-2-ylmethyl)acrylamide, and substituting 1-methylpiperazine
for the ammonia, the title compound (0.53 g, 51%) was prepared as a
light yellow solid: .sup.1H NMR 300 MHz, DMSO-d.sub.6) .delta.
10.71 (br s, 1H), 8.74-8.61 (m, 1H), 8.22-8.15 (m, 1H), 8.13-8.05
(m, 1H), 7.91-7.85 (m, 1H), 7.78-7.71 (m, 1H), 7.60-7.50 (m, 1H),
7.39-7.33 (m, 3H), 5.15-4.88 (m, 2H), 3.75-3.61 (m, 2H), 3.38-3.28
(m, 3H), 3.19-3.10 (m, 2H), 3.05-2.75 (m, 4H), 2.71-2.51 (m, 7H),
2.41 (s, 3H); MS (ESI) m/e 520 (M+H).sup.+.
Example 238
Preparation of
(E)-N-(2,3-Diethoxy-benzyl)-N-methyl-3-[3-(2-morpholin-4-yl-ethyl)-2-oxo--
1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl]acrylamide
hydrochloride
[1239] According to the procedure of Example 1, except substituting
2,3-diethoxy-benzyl-methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-[3-(2-morpholin-4-yl-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]p-
yrimidin-6-yl]acrylic acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3,-e][1,4]diazepin-7-
-yl)acrylic acid hydrochloride, the title compound (0.18 g, 56%)
was prepared as an off-white solid: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 10.63-10.49 (m, 1H), 10.14-10.12 (m, 1H),
8.41-8.31 (m, 1H), 8.03-7.91 (m, 1H), 7.52-7.45 (m, 1H), 7.38-7.19
(m, 1H), 7.03-6.90 (m, 2H), 6.70-6.51 (m, 1H), 4.63-4.51 (m, 4H),
4.02-3.91 (m, 6H), 3.81-3.68 (m, 4H), 3.60-3.50 (m, 2H), 3.40-3.28
(m, 2H), 3.20-2.85 (m, 5H), 1.40-1.31 (m, 6H); MS (ESI) m/e 524
(M+H).sup.+.
Example 239
Preparation of
(E)-N-(2-Isopropoxy-3-methoxy-benzyl)-N-methyl-3-[3-(2-morpholin-4-yl-eth-
yl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl]acrylamide
hydrochloride
[1240] According to the procedure of Example 1, except substituting
2-isopropoxy-3-methoxy-benzyl-methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-[3-(2-morpholin-4-yl-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]p-
yrimidin-6-yl]acrylic acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3,-e][1,4]diazepin-7-
-yl)acrylic acid hydrochloride, the title compound (0.15 g, 47%)
was prepared as an off-white solid: .sup.1H NMR (500 MHz,
DMSO-d.sub.6) .delta. 10.41-10.21 (m, 1H), 10.13 (br s, 1H),
8.41-8.31 (m, 1H), 8.01-7.93 (m, 1H), 7.51-7.43 (m, 1H), 7.31-7.11
(m, 1H), 7.01-6.91 (m, 2H), 6.70-6.59 (m, 1H), 4.76-4.52 (m, 5H),
4.11-3.85 (m, 7H), 3.84-3.60 (m, 3H), 3.59-3.51 (m, 2H), 3.40-3.31
(m, 2H), 3.07-2.86 (m, 4H), 1.23 (m, 6H); MS (ESI) m/e 524
(M+H).sup.+.
Example 240
Preparation of
(E)-N-(3-Methoxy-2-propoxy-benzyl)-N-methyl-3-[3-(2-morpholin-4-yl-ethyl)-
-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl]acrylamide
hydrochloride
[1241] According to the procedure of Example 1, except substituting
3-methoxy-2-propoxy-benzyl-methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-[3-(2-morpholin-4-yl-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]p-
yrimidin-6-yl]acrylic acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3,-e][1,4]diazepin-7-
-yl)acrylic acid hydrochloride, the title compound (0.10 g, 35%)
was prepared as an off-white solid: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 10.68 (br s, 1H), 10.13 (m, 1H), 8.40-8.30
(m, 1H), 8.01-7.90 (m, 1H), 7.60-7.42 (m, 1H), 7.29-7.15 (m, 1H),
7.01-6.90 (m, 2H), 6.70-6.60 (m, 1H), 4.80-4.51 (m, 4H), 4.02-3.70
(m, 10H), 3.60-3.50 (m, 2H), 3.42-3.30 (m, 2H), 3.20-2.87 (m, 6H),
1.74-1.67 (m, 2H), 1.00-0.91 (m, 3H); MS (ESI) m/e 524
(M+H).sup.+.
Example 241
Preparation of
(E)-N-Methyl-N-(3-methyl-benzofuran-2-ylmethyl)-3-[3-(2-morpholin-4-yl-et-
hyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl]acrylamide
hydrochloride
[1242] According to the procedure of Example 1, except substituting
methyl-(3-methyl-benzofuran-2-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-[3-(2-morpholin-4-yl-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]p-
yrimidin-6-yl]acrylic acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3,-e][1,4]diazepin-7-
-yl)acrylic acid hydrochloride, the title compound (0.26 g, 91%)
was prepared as an off-white solid: .sup.1H NMR (500 MHz,
DMSO-d.sub.6) .delta. 10.75 (br s, 1H), 10.11 (s, 1H), 8.39 (d,
J=7.5 Hz, 1H), 7.99 (t, J=9.0 Hz, 1H), 7.59-7.47 (m, 3H), 7.29-7.17
(m, 3H), 5.01-4.57 (m, 4H), 3.97-3.95 (m, 2H), 3.81-3.71 (m, 4H),
3.60-3.51 (m, 2H), 3.41-3.31 (m, 2H), 3.21-2.91 (m, 5H), 2.26 (s,
3H); MS (ESI) m/e 490 (M+H).sup.+.
Example 242
Preparation of
(E)-N-Methyl-N-(2-methyl-benzofuran-3-ylmethyl)-3-[3-(2-morpholin-4-yl-et-
hyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl]acrylamide
hydrochloride
[1243] According to the procedure of Example 1, except substituting
methyl-(2-methyl-benzofuran-3-ylmethyl)amine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-[3-(2-morpholin-4-yl-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]p-
yrimidin-6-yl]acrylic acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3,-e][1,4]diazepin-7-
-yl)acrylic acid hydrochloride, the title compound (0.17 g, 82%)
was prepared as an off-white solid: .sup.1H NMR (500 MHz,
DMSO-d.sub.6) .delta. 10.70-10.59 (m, 1H), 10.13 (s, 1H), 8.41-8.35
(m, 1H), 8.10-7.99 (m, 1H), 7.58-7.46 (m, 3H), 7.22-7.15 (m, 3H),
5.31-4.93 (m, 2H), 4.72-4.52 (m, 3H), 4.01-3.91 (m, 2H), 3.81-3.71
(m, 4H), 3.60-3.50 (m, 2H), 3.39-3.30 (m, 2H), 3.19-3.01 (m, 4H),
2.51 (s, 3H); MS (ESI) m/e 490 M+H).sup.+.
Example 243
Preparation of
(E)-N-(3-Chloro-2-ethoxy-benzyl)-N-methyl-3-[3-(2-morpholin-4-yl-ethyl)-2-
-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl]acrylamide
hydrochloride
[1244] According to the procedure of Example 1, except substituting
3-chloro-2-ethoxy-benzyl-methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-[3-(2-morpholin-4-yl-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]p-
yrimidin-6-yl]acrylic acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3,-e][1,4]diazepin-7-
-yl)acrylic acid hydrochloride, the title compound (0.15 g, 60%)
was prepared as an off-white solid: .sup.1H NMR (500 MHz,
DMSO-d.sub.6) .delta. 40.82-10.69 (m, 1H), 10.11-10.09 (m, 1H),
8.41-8.33 (m, 1H), 8.01-7.91 (m, 1H), 7.58-7.48 (m, 1H), 7.47-7.36
(m, 1H), 7.28-7.01 (m, 3H), 4.86-4.68 (m, 2H), 4.60-4.51 (m, 2H),
4.07-3.91 (m, 4H), 3.82-3.71 (m, 4H), 3.59-3.49 (m, 2H), 3.40-3.30
(m, 2H), 3.13-2.88 (m, 4H), 1.38 (t, J=7.0 Hz, 3H); MS (ESI) ink
514 (M+H).sup.+.
Example 244
Preparation of
(E)-N-(4-Fluoro-naphthalen-1-ylmethyl)-N-methyl-3-[3-(2-morpholin-4-yl-et-
hyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl]acrylamide
hydrochloride
[1245] According to the procedure of Example 1, except substituting
4-fluoro-naphthalen-1-ylmethyl-methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-[3-(2-morpholin-4-yl-ethyl)-2-oxo-1,2,3,4-tetrahydro-pyrido[2,3-d]p-
yrimidin-6-yl]acrylic acid hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3,-e][1,4]diazepin-7-
-yl)acrylic acid hydrochloride, the title compound (0.13 g, 43%)
was prepared as an off-white solid: .sup.1H NMR (500 MHz,
DMSO-d.sub.6) .delta. 10.64-10.51 (m, 1H), 10.12 (m, 1H), 8.45-8.30
(m, 1H), 8.22-8.07 (m, 2H), 8.03-7.86 (m, 1H), 7.78-7.62 (m, 2H),
7.63-7.51 (m, 1H), 7.43 (t, J=7.5 Hz, 1H), 7.32 (t, J=8.6 Hz, 1H),
7.21-7.12 (m, 1H), 5.03-5.02 (m, 2H), 4.57-4.42 (m, 2H), 4.01-3.91
(m, 2H), 3.80-3.63 (m, 4H), 3.53-3.43 (m, 2H), 3.40-3.25 (m, 2H),
3.09-2.96 (m, 5H); MS (ESI) m/e 504 (M+H).sup.+.
Example 245
Preparation of
(E)-N-(2,3-Dimethoxy-benzyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]na-
phthyridin-3-yl)acrylamide
[1246] According to the procedure of Example 1(a), except
substituting (2,3-dimethoxy-benzyl)methylamine for the
methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3-yl)acrylic acid
hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride, the title compound (0.362 g, 61%)
was prepared as an orange solid and as a mixture of amide rotamers:
.sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.67-10.64 (m, 1H),
8.36-8.32 (m, 1H), 8.09-8.02 (m, 1H), 7.52-7.47 (m, 1H), 7.31-7.22
(m, 1H), 7.08-6.95 (m, 2H), 6.69-6.64 (m, 1H), 4.78-4.62 (m, 2H),
3.80 (s, 3H), 3.73 (s, 3H), 3.01-2.85 (m, 5H), 2.56-2.49 (m, 2H);
MS (ESI) m/e 382 (M+H).sup.+.
Example 246
Preparation of
(E)-3-(6-Amino-5-morpholin-4-ylmethyl-pyridin-3-yl)-N-methyl-N-(1-methyl--
1H-indol-3-ylmethyl)acrylamide
[1247] According to the procedure of Example 2(a), except
substituting N-methyl-N-(1-methyl-1H-indol-3-ylmethyl)acrylamide
for the
N-methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)acrylamide, and
substituting 5-bromo-3-morpholin-4-ylmethyl-pyridin-2-ylamine for
the
7-bromo-3,3-dimethyl-1,3,4,5-tetrahydro-pyrido[2,3-e][1,4]diazepin-2-one,
the title compound (510 mg, 38%) was prepared as an off-white
powder: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 8.13 (s, 1H),
7.78 (s, 1H), 7.63-6.91 (m, 7H), 6.51 (s, 2H), 4.89-4.72 (m, 2H),
3.76 (s, 3H), 3.57 (br s, 4H), 3.42-3.34 (m, 2H), 3.02-2.90 (m,
3H), 2.33 (br s, 4H); MS (ESI) m/e 420 (M+H).sup.+.
Example 247
Preparation of
(E)-3-(6-Amino-pyridin-3-yl)-N-methyl-N-thieno[3,2-c]pyridin-2-ylmethyl-a-
crylamide
[1248] EDC hydrochloride (118 mg, 0.62 mmol) was added to a
solution of methyl-thieno[3,2-c]pyridine-2-ylmethyl-amine (100 mg,
0.56 mmol), (E)-3-(6-amino-pyridin-3-yl)acrylic acid (101 mg, 0.62
mmol), HOBt H.sub.2O (83 mg, 0.62 mmol) and triethylamine (235
.mu.L, 1.68 mmol) in anhydrous DMF (5 mL). The mixture was stirred
at room temperature overnight then diluted with H.sub.2O (10 mL)
and extracted with CH.sub.2Cl.sub.2 (3.times.50 mL). The combined
organic fractions were dried over MgSO.sub.4, filtered and
evaporated to give a yellow residue which was subjected to flash
chromatography on silica gel (10% MeOH: CH.sub.2Cl.sub.2) to yield
the title compound (61.0%). .sup.1H-NMR (300 MHz, CDCl.sub.3)
.delta. 9.04 (s, 1H), 8.45 (d, J=5.3 Hz, 1H), 8.26 (s, 1H),
7.76-7.67 (m, 3H), 7.32 (d, J=15.0 Hz, 1H), 6.76 (d, J=15.2 Hz,
1H), 6.53 (d, J=8.3 Hz, 1H), 4.95 (s, 2H), 4.76 (br s, 2H), 3.22
(s, 3H); MS (ES) m/e 325.1 (M+H).sup.+.
Example 248
Preparation of
(E)-N-Methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]di-
azepin-7-yl)-N-thieno[3,2-c]pyridin-2-ylmethyl-acrylamide
[1249] EDC hydrochloride (118 mg, 0.62 mmol) was added to a
solution of methyl-thieno[3,2-c]priding-2-ylmethyl-amine (100 mg,
0.56 mmol),
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid dihydrochloride (198 mg, 0.62 mmol), HOBt.H.sub.2O
(83 mg, 0.62 mmol) and triethylamine (470 .mu.L, 3.37 mmol) in
anhydrous DMF (7 mL). The mixture was stirred at room temperature
overnight; subsequent dilution with H.sub.2O (10 mL) resulted in
formation of a precipitate. The precipitate was filtered then
subjected to flash chromatography on silca gel (10% MeOH:
CH.sub.2Cl.sub.2) to yield the title compound (57.0%). .sup.1H-NMR
(300 MHz, DMSO-d.sub.6) .delta. 1:1.8 mixture of amide rotamers
.delta. 10.38 (s, 1H), 9.07 (s, 1H), 8.57 (d, J=2.0 Hz, 1H), 8.39
(d, J=5.6 Hz, 1H), 8.17 (s, 1H), 8.00 (m, 1H), 7.62-7.44 (m, 2H),
7.30 (d, J=15.5 Hz, 1H), 5.19 and 4.91 (2.times.s, 2H), 3.80 (br s,
2H), 3.45 (br s, 2H), 3.22 and 3.00 (2.times.s, 3H), 2.38 (s, 3H);
MS (ES) m/e 408.4 (M+H).sup.+.
Example 249
Preparation of
(E)-N-Methyl-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3-yl)-N-thieno-
[3,2-c]pyridin-2-ylmethyl-acrylamide
[1250] According to the procedure for preparation of Example 144,
except substituting
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid dihydrochloride for
(E)-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3-yl)acryclic
acid (246 mg, 0.62 mmol), the title compound (18.3%) was obtained
as a white solid after purification by flash chromatography on
silica gel (10% MeOH: CH.sub.2Cl.sub.2). .sup.1H-NMR (300 MHz,
DMSO-d.sub.6) .delta. 1:1.8 mixture of amide rotamers .delta. 11.05
and 10.67 (2.times.s, 1H), 9.07 (s, 1H), 8.43-8.38 (m, 2H), 8.12
(d, J=11.7 Hz, 1H), 7.99-7.98 (m, 1H), 7.60-7.20 (m, 3H), 5.17 and
4.90 (2.times.s, 2H), 3.19 and 3.00 (2.times.s, 3H), 2.95-2.90 (m,
2H), 2.57-2.51 (m, 2H),; MS (ES) m/e 379.4 (M+H).sup.+.
Example 250
Preparation of
(E)-3-(6-Amino-pyridin-3-yl)-N-(2-ethoxy-3-methoxy-benzyl)-N-methyl-acryl-
amide hydrochloride
[1251] EDC (231 mg, 1.2 mmol) was added to a solution of
(E)-3-(6-amino-pyridin-3-yl)acrylic acid (164 mg, 1.0 mmol),
(2-ethoxy-3-methoxy-benzyl)methylamine (215 mg, 1.1 mmol),
HOBt.H.sub.2O (149 mg, 1.1 mmol) and DIPEA (525 .mu.L, 3.0 mmol) in
dry DMF (10 mL). After 18 hr of stirring, the mixture was diluted
with water (60 mL) and extracted with EtOAc (2.times.20 mL). The
organic layer was washed with brine (2.times.30 mL), dried and
evaporated. Flash chromatography (silica 1-3% MeOH in
CH.sub.2Cl.sub.2) furnished pure free base which was dissolved in
CH.sub.2Cl.sub.2 (10 mL). After addition of HCl (1.5 mL, 1M in
ether), the solvents were evaporated and the residue was washed
with ether and dried to afford the title compound (172 mg, 46%).
.sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 8.28 (m, 3H), 7.48 and
7.45 (rotamers, 2d, J=15.4 Hz, 1H), 7.25 and 7.23 (rotamers, 2d,
J=15.4 Hz, 1H), 7.00 (m, 3H), 6.62 (m, 1H), 4.78 and 4.63
(rotamers, 2s, 2H), 3.98 (m, 2H), 3.79 (s, 3H), 3.08 and 2.84
(rotamers, 2s, 3H), 1.28 (m, 3H). MS (ESI) m/e 342 (M+H).sup.+.
Example 251
Preparation of
(E)-3-(6-Amino-pyridin-3-yl)-N-(2-propoxy-3-methoxy-benzyl)-N-methyl-acry-
lamide hydrochloride
[1252] EDC (231 mg, 1.2 mmol) was added to a solution of
(E)-3-(6-amino-pyridin-3-yl)acrylic acid (164 mg, 1.0 mmol),
(2-propoxy-3-methoxy-benzyl)methylamine (230 mg, 1.1 mmol),
HOBt.H.sub.2O (149 mg, 1.1 mmol) and DIPEA (525 .mu.L, 3.0 mmol) in
dry DMF (10 mL). After 18 hr of stirring, the mixture was diluted
with water (60 mL) and extracted with EtOAc (2.times.20 mL). The
organic layer was washed with brine (2.times.30 mL), dried and
evaporated. Flash chromatography (silica 1-3% MeOH in
CH.sub.2Cl.sub.2) furnished pure free base which was dissolved in
CH.sub.2Cl.sub.2 (10 mL). After addition of HCl (1.5 mL, 1M in
ether), the solvents were evaporated; the residue was washed with
ether and dried to afford the title compound (185 mg, 47%). .sup.1H
NMR (300 MHz, DMSO-d.sub.6) .delta. 8.16 (m, 3H), 7.48 and 7.45
(rotamers, 2d, J=15.4 Hz, 1H), 7.23 (d, J=15.4 Hz, 1H), 7.00 (m,
3H), 6.61 (m, 1H), 4.78 and 4.63 (rotamers, 2s, 2H), 3.87 (m, 2H),
3.79 (s, 3H), 3.09 and 2.85 (rotamers, 2s, 3H), 1.71 (m, 2H), 0.97
(m, 3H). MS (ESI) m/e 356 (M+H).sup.+.
Example 252
Preparation of
(E)-3-(6-amino-pyridin-3-yl)-N-(2-isopropoxy-3-methoxy-benzyl)-N-methyl-a-
crylamide hydrochloride
[1253] EDC (231 mg, 1.2 mmol) was added to a solution of
(E)-3-(6-amino-pyridin-3-yl)acrylic acid (164 mg, 1.0 mmol),
(2-isopropoxy-3-methoxy-benzyl)methylamine (230 mg, 1.1 mmol),
HOBt.H.sub.2O (149 mg, 1.1 mmol) and DIPEA (525 .mu.L, 3.0 mmol) in
dry DMF (10 mL). After 18 hr of stirring, the mixture was diluted
with water (60 mL) and extracted with EtOAc (2.times.20 mL). The
organic layer was washed with brine (2.times.30 mL), dried and
evaporated. Flash chromatography (silica 1-3% MeOH in
CH.sub.2Cl.sub.2) of the residue furnished pure free base which was
dissolved in CH.sub.2Cl.sub.2 (10 mL). After addition of HCl (1.5
mL, 1M in ether) the solvents were evaporated; the residue was
washed with ether and dried to afford the title compound (180 mg,
46%). .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 8.31 (m, 3H),
7.46 and 7.45 (rotamers, 2d, J=15.4 Hz, 1H), 7.23 and 7.17
(rotamers, 2d, J=15.4 Hz, 1H), 6.99 (m, 3H), 6.62 (m, 1H), 4.76 and
4.63 (rotamers, 2s, 2H), 4.51 (m, 1H), 3.79 (s, 3H), 3.06 and 2.85
(rotamers, 2s, 3H), 1.22 (d, J=6.1 Hz, 3H) 1.21 (d, J=6.1 Hz, 3H).
MS (ESI) m/e 356 (M+H).sup.+.
Example 253
Preparation of
(E)-3-(6-amino-pyridin-3-yl)-N-methyl-N-(3-methyl-benzofuran-2-ylmethyl)a-
crylamide hydrochloride
[1254] EDC (231 mg, 1.2 mmol) was added to a solution of
(E)-3-(6-amino-pyridin-3-yl)acrylic acid (164 mg, 1.0 mmol),
methyl-(3-methyl-benzofuran-2-ylmethyl)amine (193 mg, 1.1 mmol),
HOBt.H.sub.2O (149 mg, 1.1 mmol) and DIPEA (525 .mu.L, 3.0 mmol) in
dry DMF (10 mL). After 18 hr of stirring, the mixture was diluted
with water (60 mL) and extracted with EtOAc (2.times.20 mL). The
oraganic layer was washed with brine (2.times.30 mL), dried and
evaporated. Flash chromatography (silica 1-3% MeOH in
CH.sub.2Cl.sub.2) of the residue furnished pure free base which was
dissolved in CH.sub.2Cl.sub.2 (10 mL). After addition of HCl (1.5
mL, 1M in ether), the solvents were evaporated, washed with ether
and dried to afford the title compound (195 mg, 54%). .sup.1H NMR
(300 MHz, DMSO-d.sub.6) .delta. 8.36 (m, 3H), 7.50 (m, 3H), 7.25
(m, 3H), 7.02 (m, 1H), 4.98 and 4.79 (rotamers, 2s, 2H), 3.17 and
2.92 (rotamers, 2s, 3H), 2.26 (s, 3H). MS (ESI) m/e 322
(M+H).sup.+.
Example 254
Preparation of
(E)-N-Acenaphthen-5-ylmethyl-3-(6-amino-pyridin-3-yl)-N-methyl-acrylamide
hydrochloride
[1255] To a solution of acenaphthen-5-ylmethyl-methylamine (216 mg,
1.1 mmol), (E)-3-(6-amino-pyridin-3-yl)acrylic acid (164 mg, 1
mmol), HOBt (148 mg, 1.1 mmol) and diisopropylethylamine (0.8 mL,
4.4 mmol) in DMF (20 mL) was added EDC hydrochloride (210 mg, 1.1
mmol). The mixture was stirred overnight at room temperature. Water
(100 mL) was added and the solution stirred for 1 hour. The
precipitate was collected by filtration. The yellow solid was
preabsorded onto silica gel and purified by column chromatography
(95:5 CH.sub.2Cl.sub.2/MeOH). The residue was dissolved into
methylene chloride followed by addition of 1M HCl/ether. The
precipitate was collected by filtration to afford
(E)-N-acenaphthen-5-ylmethyl-3-(6-amino-pyridin-3-yl)-N-methyl-acrylamide
hydrochloride (120 mg, 32%) as a white solid and as a mixture of
amide rotomers. .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
8.44-8.28 (m, 3H), 7.84-7.72 (m, 1H), 7.59-7.12 (m, 6H), 7.07-6.92
(m, 1H), 5.15-5.02 (2.times.s, 2H), 3.35-3.15 (bs, 2H), 3.18 (s,
4H), 3.07-2.90 (2.times.s, 3H); ESI MS m/z 344
[C.sub.22H.sub.21N.sub.3O+H].sup.+.
Example 255
Preparation of
(E)-N-(1H-Indol-5-ylmethyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-
-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
[1256] To a solution of (1H-indol-5-ylmethyl)methylamine (143 mg,
0.9 mmol),
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diaz-
epin-7-yl)acrylic acid dihydrochloride (250 mg, 0.8 mmol), HOBt
(121 mg, 0.9 mmol) and diisopropylethylamine (0.61 mL, 3.6 mmol) in
DMF (25 mL) was added EDC hydrochloride (172 mg, 0.9 mmol). The
mixture was stirred overnight at room temperature. Water (100 mL)
was added and the solution was stirred for 1 hr. The precipitate
was collected by filtration. The yellow solid was preabsorded onto
silica gel and purified by column chromatography (95:5
CH.sub.2Cl.sub.2/MeOH) to afford
(E)-N-(1H-indol-5-ylmethyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-
-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide (195 mg, 63%) as a
white solid and as a mixture of amide rotomers. .sup.1H NMR (300
MHz, DMSO-d.sub.6) .delta. 11.07 (d, J=7.6 Hz, 1H), 10.37 (m, 1H),
8.52 (dd, J=7.0, 1.9 Hz, 1H), 8.15 (d, J=2.0 Hz, 1H), 7.59-7.26 (m,
5H), 7.07-6.92 (m, 1H), 6.38 (d, J=1.9 Hz, 1H), 4.66-4.85
(2.times.s, 2H), 3.74-3.77 (m, 2H), 3.42-3.38 (m, 2H), 3.08-2.90
(2.times.s, 3H), 2.37-2.32 (2.times.s, 3H); ESI MS m/z 390
[C.sub.22H.sub.23N.sub.5O.sub.2+H].sup.+.
Example 256
Preparation of
(E)-N-Methyl-N-(1-methylindol-5-ylmethyl)-3-(4-methyl-2-oxo-2,3,4,5-tetra-
hydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
[1257] To a solution of (methyl-(1-methyl-1H-indol-5-ylmethyl)amine
(103 mg, 0.6 mmol),
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid dihydrochloride (160 mg, 0.5 mmol), HOBt (81 mg,
0.5 mmol) and diisopropylethylamine (0.41 mL, 2 mmol) in DMF (12
mL) was added EDC hydrochloride (114 mg, 0.6 mmol). The mixture was
stirred overnight at room temperature. Water (75 mL) was added and
the solution stirred for 1 hr. The precipitate was collected by
filtration. The yellow solid was preabsorded onto silica gel and
purified by column chromatography (95:5 CH.sub.2Cl.sub.21MeOH) to
give a yellow oil. Diethyl ether (100 mL) was added and the mixture
was sonicated. The ether layer was decanted to afford
(E)-N-methyl-N-(1-methylindol-5-ylmethyl)-3-(4-methyl-2-oxo-2,3,4,-
5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide (158 mg,
78%) as a white solid and as a mixture of amide rotomers. .sup.1H
NMR (300 MHz, DMSO-d.sub.6) .delta. 10.33 (d, J=4.3 Hz, 1H), 8.51
(d, J=6.1 Hz, 1H), 8.13 (s, 1H), 7.59-7.25 (m, 5H), 7.09-7.02 (m,
1H), 6.37 (s 1H), 4.67-4.86 (2.times.s, 2H), 3.72-3.79 (m, 5H),
3.42-3.38 (m, 2H), 3.06-2.87 (2.times.s, 3H), 2.37-2.33 (2.times.s,
3H); ESI MS m/z 404 [C.sub.23H.sub.25N.sub.5O.sub.2+H].sup.+.
Example 257
Preparation of
(E)-N-(1H-Indol-7-ylmethyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-
-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
[1258] To a solution of (1H-indol-7-ylmethyl)methylamine (103 mg,
0.6 mmol),
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diaz-
epin-7-yl)acrylic acid dihydrochloride (160 mg, 0.5 mmol), HOBt (81
mg, 0.5 mmol) and diisopropylethylamine (0.41 mL, 2 mmol) in DMF
(12 mL) was added EDC hydrochloride (114 mg, 0.6 mmol). The mixture
was stirred overnight at room temperature. Water (75 mL) was added
and the solution stirred for 1 hr. The precipitate was collected by
filtration and triturated with hexanes to afford
(E)-N-(1H-indol-7-ylmethyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-
-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide (155 mg, 79%) as a
white solid and as a mixture of amide rotomers. .sup.1H NMR (300
MHz, DMSO-d.sub.6) .delta. 10.78-11.23 (m, 1H), 10.34-10.30 (m,
1H), 8.54-8.45 (m, 1H), 8.14-8.00 (m, 1H), 7.64-7.27 (m, 4H),
6.99-6.75 (m, 2H), 6.47-6.45 (m, 1H), 5.10-4.82 (2.times.s, 2H),
3.79-3.71 (2.times.s, 2H), 3.42-3.38 (m, 2H), 3.15-2.95 (2.times.s,
3H), 2.36-2.31 (2.times.s, 3H); ESI MS m/z 390
[C.sub.22H.sub.23N.sub.5O.sub.2+H].sup.+
Example 258
Preparation of
(E)-N-Methyl-N-(1-methylindol-7-ylmethyl)-3-(4-methyl-2-oxo-2,3,4,5-tetra-
hydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
[1259] To a solution of (methyl-(1-methyl-1H-indol-7-ylmethyl)amine
(103 mg, 0.6 mmol),
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid dihydrochloride (160 mg, 0.5 mmol), HOBt (81 mg,
0.5 mmol) and diisopropylethylamine (0.41 mL, 2 mmol) in DMF (12
mL) was added EDC hydrochloride (114 mg, 0.6 mmol). The mixture was
stirred overnight at room temperature. Water (75 mL) was added and
the solution stirred for 1 hr. The precipitate was collected by
filtration and triturated with hexanes to afford
(E)-N-methyl-N-(1-methylindol-7-ylmethyl)-3-(4-methyl-2-oxo-2,3,4,5-tetra-
hydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide (100 mg, 50%)
as a white solid and as a mixture of amide rotomers. .sup.1H NMR
(300 MHz, DMSO-d.sub.6) .delta. 10.33 (m, 1H), 8.54-8.47 (m, 1H),
8.16-7.97 (m, 1H), 7.62-7.19 (m, 4H), 6.92-6.97 (m, 1H), 6.78-6.58
(m, 1H), 6.39 (d, J=3.1 Hz, 1H) 5.48-5.19 (2.times.s, 2H),
3.99-4.11 (2.times.s, 3H), 3.79-3.70 (2.times.s, 2H), 3.42-3.36 (m,
2H), 3.30-3.13 (2.times.s, 3H), 2.36-2.30 (2.times.s, 3H); ESI MS
m/z 404 [C.sub.23H.sub.25N.sub.5O.sub.2+H].sup.+.
Example 259
Preparation of
(E)-N-(1H-Indol-6-ylmethyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-
-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
[1260] To a solution of (1H-indol-6-ylmethyl)methylamine (98 mg,
0.6 mmol),
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diaz-
epin-7-yl)acrylic acid dihydrochloride (160 mg, 0.5 mmol) HOBt (81
mg, 0.5 mmol) and diisopropylethylamine (0.41 mL, 2 mmol) in DMF
(12 mL) was added EDC hydrochloride (114 mg, 0.6 mmol). The mixture
was stirred overnight at room temperature. Water (75 mL) was added
and the solution stirred for 1 hr. The precipitate was collected by
filtration and triturated with hexanes to afford
(E)-N-(1H-indol-6-ylmethyl)-N-methyl-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-
-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide (89 mg, 37%) as a
white solid and as a mixture of amide rotomers. .sup.1H NMR (300
MHz, DMSO-d.sub.6) .delta. 11.03-11.01 (m, 1H), 10.33-10.30 (m,
1H), 8.52 (d, J=7.6 Hz, 1H), 8.13 (d, J=2.4 Hz, 1H), 7.60-7.22 (m,
5H), 6.92-6.86 (m, 1H), 6.37 (s, 1H), 4.88-4.68 (2.times.s, 2H),
3.78-3.74 (m, 2H), 3.42-3.38 (m, 2H), 3.08-2.89 (2.times.s, 3H),
2.36-2.33 (2.times.s, 3H); ESI MS m/z 390
[C.sub.22H.sub.23N.sub.5O.sub.2+H].sup.+.
Example 260
(E)-N-3-(6-Amino-pyridin-3-yl)-N-methyl-N-(2-methyl-benzofuran-3-ylmethyl)-
-acrylamide hydrochloride
[1261] To a solution of
methyl-(2-methylbenzofuran-3-ylmethyl)-amine (176 mg, 1.0 mmol),
3-(6-amino-pyridin-3-yl)-acrylic acid (150 mg, 0.91 mmol), HOBt
(135 mg, 1.0 mmol) and diisopropylethylamine (0.46 mL, 2.7 mmol) in
DMF (10 mL) was added EDC (209 mg, 1.1 mmol). The yellow solution
was stirred overnight at room temperature. The reaction mixture was
cooled to 0.degree. C. then treated with H.sub.2O (40 mL) to form a
precipitate. The precipitate was filtered, washed with H.sub.2O (20
mL) then with a 10% EtOAc:hexanes solution (10 mL). The solid was
dissolved in a 10% MeOH:CH.sub.2Cl.sub.2 solution (20 mL), cooled
to 0.degree. C. then treated with 2 mL of a 1.0 M HCl in Et.sub.2O.
After stirring for 10 minutes, the yellow solution was concentrated
to dryness then triturated with Et.sub.2O (20 mL). The title
compound was collected and dried under vacuo to yield the title
compound (76.9%) as a mixture of amide rotamers. .sup.1H NMR (300
MHz, DMSO-d.sub.6) .delta. 8.41-8.33 (m, 3H), 7.58-7.02 (m, 6H),
4.93 and 4.74 (2.times.s, 2H), 3.05 and 2.82 (2.times.s, 3H), 2.53
and 2.48 (2.times.s, 3H); MS (ESI) m/e 322 (M+H).sup.+.
Example 261
Preparation of
(E)-3-(3,3-Dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepi-
n-7-yl)-N-methyl-N-(3-methyl-benzofuran-2-ylmethyl)acrylamide
hydrochloride
a) N-Methyl-N-(3-methyl-benzofuran-2-ylmethyl)acrylamide
[1262] According to the procedure of Preparation 65, except
substituting methyl-(3-methyl-benzofuran-2-ylmethyl)amine for the
methyl-(3-methyl-benzo[b]thiophen-2-ylmethyl)amine, the title
compound (0.95 g, 73%) was prepared as an white solid: .sup.1H NMR
(300 MHz, CDCl.sub.3) .delta. 7.50-7.47 (m, 1H), 7.42-7.39 (m, 1H),
7.30-7.17 (m, 2H), 6.90-6.55 (m, 1H), 6.41-6.35 (m, 1H), 5.79-5.70
(m, 1H), 4.78-4.64 (m, 2H), 3.14-3.02 (m, 3H), 2.29-2.62 (m,
3H).
b)
(E)-3-(3,3-Dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diaze-
pin-7-yl)-N-methyl-N-(3-methyl-benzofuran-2-ylmethyl)acrylamide
[1263] According to the procedure of Example 2, except substituting
N-methyl-N-(3-methyl-benzofuran-2-ylmethyl)acrylamide for the
N-methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)acrylamide, the
title compound (0.25 g, 60%) was prepared as a white solid and as a
mixture of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 10.92 (s, 1H), 10.55 (br s, 2H), 8.68-8.65 (m, 1H), 8.39
(s, 1H), 7.60-7.24 (m, 6H), 5.01-4.81 (m, 2H), 4.40 (s, 2H),
3.20-2.93 (m, 3H), 2.27 (s, 3H), 1.63 (s, 6H); MS (ESI) m/e 419
(M+H).sup.+.
Example 262
Preparation of
(E)-N-Methyl-N-(3-methyl-1H-inden-2-ylmethyl)-3-(4-methyl-2-oxo-2,3,4,5-t-
etrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride
[1264] According to the procedure of Example 1, except substituting
methyl-(3-methyl-1H-inden-2ylmethyl)amine (0.237 g, 1.37 mmol) for
methyl-(1-propyl-naphthalen-2ylmethyl)amine, the title compound
(0.303 g, 60%) was prepared as light yellow solid and as a mixture
of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
12.32 (br s, 1H), 11.21 (br s, 1H), 8.82-8.81 (m, 1H), 8.34 (s,
1H), 7.61-7.25 (m, 5H), 7.17-7.12 (m, 1H), 4.67-4.51 (m, 2H), 4.29
(br s, 2H), 3.80 (br s, 2H), 3.28-3.26 (m, 2H), 3.12-2.87 (m, 6H),
2.16-2.14 (m, 3H); MS (ESI) m/e 403 (M+H).sup.+.
Example 263
Preparation of
(E)-3-(6-{2-[Methyl-(3-methyl-benzo[b]thiophen-2-ylmethyl)carbamoyl]vinyl-
}-2-oxo-1,4-dihydro-2H-pyrido[2,3-d]pyrimidin-3-yl)propionic acid
ethyl ester
[1265] According to the procedure of Example 2, except substituting
3-(6-bromo-2-oxo-1,4-dihydro-2H-pyrido[2,3-d]pyrimidin-3-yl)propionic
acid ethyl ester for the
7-bromo-3,3-dimethyl-1,3,4,5-tetrahydro-pyrido[2,3-e][1,4]diazepin-2-one,
the title compound (0.40 g, 38%) quantitative) was prepared as an
off-white solid and as a mixture of amide rotamers: .sup.1H NMR
(300 MHz, DMSO-d.sub.6) .delta. 9.97 (s, 1H), 8.36 (s, 1H), 8.00
(s, 1H), 7.87 (d, J=7.5 Hz, 1H), 7.73 (d, J=7.8 Hz, 1H), 7.55-7.50
(m, 1H), 7.41-7.31 (m, 3H), 7.19-7.14 (m, 1H), 5.10-4.88 (m, 2H),
4.50 (s, 2H), 4.08-4.01 (m, 2H), 3.55-3.46 (m, 2H), 3.15-2.93 (m,
3H), 2.62-2.58 (t, J=6.6 Hz, 2H), 2.41 (s, 3H), 1.23-1.03 (m, 3H);
MS (ESI) m/e 493 (M+H).sup.+.
Example 264
Preparation of
(E)-3-(6-amino-5-cyano-pyridin-3-yl)-N-methyl-N-(1-methyl-1H-indol-2-ylme-
thyl)-acrylamide hydrochloroide
a) 2-amino-5-bromo-nicotinonitrile
[1266] Bromine (1.1 mL, 21 mmol) in AcOH (3 mL) was added dropwise
to a solution of 2-amino-nicotinonitrile (1.00 g, 8.4 mmol) in AcOH
(20 mL) at 10.degree. C. The orange mixture was stirred for 22
hours at ambient temperature then diluted with ether (100 mL). The
resultant precipitated salt was filtered, washed with ether and
dried on air. The precipitate was suspended in water (100 mL),
neutralized with 1N NaOH, filtered, washed with water and dried on
air to give 1.29 g (78%) title compound. .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 8.27 (d, J=2.5 Hz, 1H), 8.14 (d, J=2.5 Hz,
1H), 7.13 (s, br, 2H). MS (ESI) m/e: 197.9655 (M+H).sup.+.
b) N-methyl-N-(1-methyl-1H-indol-2-ylmethyl)-acrylamide
[1267] Acryloyl chloride (5.13 mL, 63.1 mmol) was added dropwise to
a stirred CH.sub.2Cl.sub.2 (100 mL) solution of
methyl-(1-methyl-1H-indol-2-ylmethyl)-amine (10.0 g, 57.4 mmol) and
triethylamine (12 mL, 86.1 mmol) at -78.degree. C. The reaction
mixture was warmed to -30.degree. C. over 30 min and quenched with
water. The reaction mixture was diluted with CH.sub.2Cl.sub.2 (100
mL), washed with dilute NaHCO.sub.3, HCl and water, dried and
evaporated to afford 9.91 g (76%) title compound. .sup.1H NMR (300
MHz, DMSO-d.sub.6) .delta. 7.44 (m, 2H), 7.12 (t, J=7.2 Hz, 1H),
7.00 (t, J=7.2 Hz, 1H), 6.81 (dd, J=7.4 and 16.7 Hz, 1H), 6.40 and
6.14 (rotamers, 2s, 1H), 6.20 (dd, J=2.5 and 16.7 Hz, 1H), 5.7 (m,
1H), 4.90 and 4.80 (rotamers, 2s, 2H), 3.68 and 3.66 (rotamers, 2s,
3H), 3.00 and 2.96 (rotamers, 2s, 3H). MS (ESI) m/e: 229.1
(M+H).sup.+.
c)
(E)-3-(6-amino-5-cyano-pyridin-3-yl)-N-methyl-N-(1-methyl-1H-indol-2-yl-
methyl)-acryl-amide hydrochloride
[1268] A propionitrile (15 mL) solution of
2-amino-5-bromo-nicotinonitrile (198 mg, 1 mmol),
N-methyl-N-(1-methyl-1H-indol-2-ylmethyl)-acrylamide (457 mg, 2
mmol) and diisopropyl-ethylamine (523 .mu.L, 3 mmol) was purged
with Argon for 10 min. Pd(OAc).sub.2 (23 mg, 0.1 mmol) and
P(o-Tol).sub.3 (61 mg, 0.2 mmol) was added and the Argon purge was
repeated. The mixture was heated to 100.degree. C. and stirred for
6 hr under Argon. Upon cooling, solvents were removed under vacuo
and the residue was purified by Flash chromatography (silica, 2%
MeOH in CH.sub.2Cl.sub.2). The purified free base was converted to
its HCl salt by addition of HCl (1 mL, 1 mmol, 1M in ether). The
salt was washed with ether and dried to afford 162 mg (43%) of the
title compound. .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 8.50
(m, 2H), 7.55-6.95 (m, 4H), 6.40 and 6.17 (rotamers, 2s, 1H), 5.03
and 4.83 (rotamers, 2s, 2H), 3.71 and 3.67 (rotamers, 2s, 3H), 3.09
and 2.96 (rotamers, 2s, 3H). MS (ESI) m/e: 346.1662
(M-H).sup.+.
Example 265
Preparation of
(E)-N-methyl-N-(1-methyl-1H-indol-2-ylmethyl)-3-(2-oxo-1,2,3,4-tetrahydro-
-pyrido[2,3-b]pyrazin-7-yl)-acrylamide
a) 7-bromo-3,4-dihydro-1H-pyrido[2,3-b]pyrazin-2-one
[1269] A mixture of 5-bromo-2,3-diaminopyridine (11.64 g, 61.9
mmol) and glyoxylic acid monohydrate (22.80 g, 247.7 mmol) in MeOH
(200 mL) was stirred for 62 hours. The precipitate was filtered,
washed with MeOH and dried at 110.degree. C. to give 12.60 g (90%)
of a regioisomeric mixture of the condensation products. The
mixture (4.52 g, 20 mmol) was suspended in DME (300 mL) and, after
addition of NaBH(OAc).sub.3 (11.87 g, 56 mmol), it was stirred for
88 hours at 60.degree. C. Upon cooling, EtOAc (500 mL) and water
(300 mL) was added and the pH was adjusted to 8.0 with 2N NaOH. The
aqueous phase was separated and extracted with EtOAc (2.times.200
mL). The combined organic phases were washed with water and brine,
dried and evaporated. The residue was stirred with CH.sub.2Cl.sub.2
(50 mL) for 24 hr then filtered. The solid cake was stirred with
EtOAc (100 mL) at 75.degree. C. for 14 hours, filtered and dried to
afford the title compound (2.35 g, 52%). NMR (300 MHz,
DMSO-d.sub.6) .delta. 10.47 (s, br, 1H), 7.65 (d, J=2.2 Hz, 1H),
7.01 (t, J=2.2 Hz, 1H), 6.99 (s, br, 1H), 3.93 (d, J=1.5 Hz, 2H).
MS (ESI) We: 227.9764 (M+H).sup.+.
b) 7-bromo-2-oxo-2,3-dihydro-1H-pyrido[2,3-b]pyrazine-4-carboxylic
acid tert-butyl ester
[1270] Boc.sub.2O (3.23 g, 14.8 mmol) was added to a stirred MeCN
(120 mL) suspension containing
7-bromo-3,4-dihydro-1H-pyrido[2,3-b]pyrazin-2-one (2.25 g, 9.85
mmol), triethylamine (4.12 mL, 29.6 mmol) and
N,N-dimethylaminopyridine (120 mg, 1 mmol). After 24 hr stirring,
additional Boc.sub.2O (3.23 g, 14.8 mmol) was added and the
stirring was continued for 2 days. The solvent was removed in vacuo
and the residue was purified by Flash Chromatography (silica, 1-2%
MeOH in CH.sub.2Cl.sub.2) to afford the title compound (499 mg,
16%). .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.82 (s, br,
1H), 8.16 (d, J=2.3 Hz, 1H), 7.45 (t, J=2.3 Hz, 1H), 4.30 (s, 2H),
1.44 (s, 9H). MS (ESI) m/e: 328.0 (M+H).sup.+, 272.0
(M-tert-Bu).sup.+.
c)
(E)-7-{2-[methyl-(1-methyl-1H-indol-2-ylmethyl)-carbamoyl]-vinyl}-2-oxo-
-2,3-dihydro-1H-pyrido[2,3-b]pyrazine-4-carboxylic acid tert-butyl
ester
[1271] A solution of
7-bromo-2-oxo-2,3-dihydro-1H-pyrido[2,3-b]pyrazine-4-carboxylic
acid tert-butyl ester (494 mg, 1.5 mmol) in propionitrile (12 mL)
was treated with
N-methyl-N-(1-methyl-1H-indol-2-ylmethyl)-acrylamide (685 mg, 3
mmol) and diisopropylethylamine (788 .mu.L, 4.5 mmol) and purged
with Argon for 10 min. Pd(OAc).sub.2 (34 mg, 0.15 mmol) and
P(o-Tol).sub.3 (92 mg, 0.3 mmol) was added and the Argon purge was
repeated. The mixture was heated to 100.degree. C. and stirred for
6 hours under Argon. Upon cooling, solvent was removed and the
residue was purified by Flash chromatography (silica, 1-3% MeOH in
CH.sub.2Cl.sub.2) to afford the title compound (480 mg, 67%).
.sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.81 and 10.73
(rotamers, 2s, br, 1H), 8.46 and 8.41 (rotamers, 2s, 1H), 7.58 (d,
J=15.4 Hz, 1H), 7.51 (m, 3H), 7.23 (d, J=15.4 Hz, 1H), 7.11 (m,
1H), 7.03 (m, 1H), 6.45 and 6.20 (rotamers, 2s, 1H), 5.06 and 4.87
(rotamers, 2s, 2H), 4.32 and 4.28 (rotamers, 2s, 2H), 3.74 and 3.71
(rotamers, 2s, 3H), 3.16 and 3.05 (rotamers, 2s, 3H), 1.44 and 1.42
(rotamers, 2s, 9H). MS (ESI) ink: 476.2 (M+H).sup.+, 420.2
(M-tert-Bu).sup.+.
d)
(E)-N-methyl-N-(1-methyl-1H-indol-2-ylmethyl)-3-(2-oxo-1,2,3,4-tetrahyd-
ro-pyrido[2,3-b]pyrazin-7-yl)-acrylamide
[1272] Trifluoroacetic acid (0.5 mL) was added to a solution of
(E)-7-{2-[methyl-(1-methyl-1H-indol-2-ylmethyl)-carbamoyl]-vinyl}-2-oxo-2-
,3-dihydro-1H-pyrido[2,3-b]pyrazine-4-carboxylic acid tert-butyl
ester in CH.sub.2Cl.sub.2 (1 mL) at 10.degree. C. After stirring 1
hr, volatiles were removed in vacuo and the resulting residue was
dissolved in EtOAc (2 mL). Upon addition of dilute NaOH, a
precipitate formed. The solid was collected by filtration, washed
with water (100 mL), MeOH (50 mL), EtOAc (50 mL) and
CH.sub.2Cl.sub.2 (50 mL) to afford the title compound (170 mg).
.sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.42 and 10.33
(rotamers, 2s, br, 1H), 7.90 (m, 1H), 7.45 (m, 3H), 7.22 (m, 1H),
7.12 (m, 1H), 6.83 (d, J=15.4 Hz, 1H), 6.42 and 6.17 (rotamers, 2s,
1H), 4.98 and 4.84 (rotamers, 2s, 2H), 3.99 and 3.95 (rotamers, 2s,
2H), 3.72 and 3.68 (rotamers, 2s, 3H), 3.07 and 3.00 (rotamers, 2s,
3H). MS (ESI) m/e: 376 (M-H).sup.+.
Example 266
Preparation of
(E)-3-(3,3-Dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepi-
n-7-yl)-N-methyl-N-(2-ethoxy-3-trifluoromethoxybenzyl)acrylamide
hydrochloride
a) 2-Hydroxy-3-trifluoromethoxybenzaldehyde
[1273] A solution of 2-trifluoromethoxyphenol (5.13 g, 28.8 mmol)
in anhydrous acetonitrile (150 mL) in oven-dried glassware was
treated with triethylamine (15.0 mL, 108 mmol) and MgCl.sub.2 (4.11
g, 43.2 mmol) which had been dried under vacuum with heat.
Paraformaldehyde (5.18 g, 172 mmol), which had been dried under
vacuum with P.sub.2O.sub.5, was added and the solution was heated
to reflux. After 5 days, the reaction was quenched with 1 N HCl
(200 mL) and the mixture was extracted using Et.sub.2O (2.times.100
mL). The combined organics were washed with brine (2.times.150 mL),
dried (Na.sub.2SO.sub.4) and concentrated to a yellow solid.
Purification by column chromatography (silica gel, 98:2 to 95:5
hexanes/EtOAc) gave the title compound (2.45 g, 41%) as a yellow
powder: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.24 (s, 1H),
7.75-7.65 (m, 2H), 7.08 (t, J=7.9 Hz, 1H).
b) 2-Ethoxy-3-trifluoromethoxybenzaldehyde
[1274] To a solution of 2-hydroxy-3-trifluoromethoxybenzaldehyde
(1.00 g, 4.82 mmol) in DMF (10 mL), was added K.sub.2CO.sub.3 (1.46
g, 10.6 mmol) followed by iodoethane (0.57 mL, 7.24 mmol) and the
mixture was heated to 37.degree. C. for 6 h. The reaction was
quenched by the addition of H.sub.2O (40 mL) and the mixture was
extracted with EtOAc (3.times.100 mL). The combined organics were
washed with brine (2.times.100 mL), dried (Na.sub.2SO.sub.4) and
concentrated to yield the title compound (1.17 g, quant.) as an
orange oil: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.31 (s,
1H), 7.77 (m, 2H), 7.38 (t, J=8.1 Hz, 1H), 4.19 (q, J=6.9 Hz, 2H),
1.36 (t, J=6.9 Hz, 3H).
c) (2-Ethoxy-3-trifluoromethoxybenzyl)methylamine
[1275] A solution of methylamine (20 mL of a 2.0 M solution if
MeOH, 40 mmol) was added to 2-ethoxy-3-trifluoromethoxybenzaldehyde
(1.17 g, 4.95 mmol) under N.sub.2 and the solution was stirred for
18 h. The solution was concentrated under reduced pressure. The
resulting clear oil was dissolved in EtOH (20 mL) and treated with
NaBH.sub.4 (0.187 g, 4.95 mmol). After stirring for 5.5 h, the
reaction mixture was concentrated under reduced pressure, then
dissolved in 1 N NaOH (20 mL) and extracted with Et.sub.2O
(3.times.50 mL). The combined organics were collected, washed with
brine (2.times.100 mL), dried (Na.sub.2SO.sub.4) and concentrated
to yield the title compound (0.72 g, 58%) as a clear oil: .sup.1H
NMR (500 MHz, DMSO-d.sub.6) .delta. 7.40 (dd, J=7.7, 1.55 Hz, 1H),
7.25 (d, J=9.5 Hz, 1H), 7.16 (t, J=7.7 Hz, 1H), 3.97 (t, J=7.0 Hz,
2H), 3.68 (s, 2H), 2.28 (s, 3H), 2.02 (br s, 1H), 1.35-1.30 (m,
3H).
d) N-(2-Ethoxy-3-trifluoromethoxybenzyl)-N-methylacrylamide
[1276] To a solution of
(2-ethoxy-3-trifluoromethoxybenzyl)methylamine (0.720 g, 2.08 mmol)
in CH.sub.2Cl.sub.2 (25 mL), was added acryloyl chloride (0.25 mL,
3.15 mmol) drop-wise. After stirring for five minutes,
triethylamine (0.43 mL, 3.15 mmol) was added. The solution was
allowed to stir under N.sub.2 for 3 h. The solution was diluted
with CH.sub.2Cl.sub.2 (30 mL) and then washed with H.sub.2O
(3.times.50 mL) and brine (2.times.100 mL), dried
(Na.sub.2SO.sub.4) and concentrated to yield the title compound
(0.746 g, 86%) as a yellow oil and as a mixture of amide rotamers:
.sup.1H NMR (500 MHz, CDCl.sub.3) .delta. 7.21-7.02 (m, 3H),
6.67-6.50 (m, 1H), 6.41-6.36 (m, 1H), 5.75-5.58 (m, 1H), 4.75-4.65
(m, 2H), 4.14-4.05 (m, 2H), 3.03-2.99 (m, 3H), 1.43-141 (m,
3H).
e)
(E)-3-(3,3-Dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diaze-
pin-7-yl)-N-methyl-N-(2-ethoxy-3-trifluoromethoxybenzyl)acrylamide
[1277] A solution of
N-(2-ethoxy-3-trifluoromethoxybenzyl)-N-methylacrylamide (0.447 g,
1.47 mmol) in propionitrile (5 mL) and DMF (1 mL) was deoxygenated
with Ar for 20 min and then treated with diisopropylethylamine
(0.40 mL, 2.3 mmol) and
7-bromo-3,3-dimethyl-1,3,4,5-tetrahydro-pyrido[2,3-e][1,4]diazepin-2--
one (0.300 g, 1.11 mmol). The solution was deoxygenated with Ar for
20 minutes. Pd(OAc).sub.2 (0.024 g, 0.111 mmol) and P(o-tol).sub.3
(0.067 g, 0.222 mmol) were added and the solution deoxygenated with
Ar for 20 min. The mixture was heated to reflux for 18 h then,
allowed to cool. The mixture was diluted with EtOAc (30 mL) and was
washed with H.sub.2O (3.times.50 mL) and brine (2.times.50 mL),
dried (Na.sub.2SO.sub.4) and concentrated to a yellow-orange solid.
Purification by column chromatography (silica gel,
CH.sub.2Cl.sub.2/MeOH, 100 to 98:2) gave the title compound (0.25
g, 31%) as an off-white solid and as a mixture of amide rotamers:
.sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 9.80-9.78 (m, 1H),
8.40-8.37 (m, 1H), 8.01-7.93 (m, 1H), 7.56-7.49 (m, 1H), 7.36-7.09
(m, 4H), 4.87-4.68 (m, 2H), 4.06-3.83 (m, 4H), 3.31-2.88 (m, 4H),
1.36-1.29 (m, 9H).
f)
(E)-3-(3,3-Dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diaze-
pin-7-yl)-N-methyl-N-(2-ethoxy-3-trifluoromethoxybenzyl)acrylamide
hydrochloride
[1278] A stirring solution of
(E)-3-(3,3-dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepi-
n-7-yl)-N-methyl-N-(2-ethoxy-3-trifluoromethoxybenzyl)acrylamide
(0.172 g, 0.349 mmol) in CH.sub.2Cl.sub.2 (4 mL) under N.sub.2 was
treated with anhydrous HCl (0.17 mL of a 2 M solution in diethyl
ether, 0.34 mmol). After stirring for 18 h, the resulting solid was
collected by filtration, washed with Et.sub.2O (100 mL) and dried
to yield the title compound (0.11 g, 62%) as an off white solid and
as a mixture of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 10.94 (br s, 1H), 10.38 (br s, 2H), 8.67-8.64 (m, 1H),
8.38-8.30 (m, 1H), 7.62-7.54 (m, 1H), 7.41-7.10 (m, 4H), 4.89-4.70
(m, 2H), 4.41-4.36 (m, 2H), 4.06-4.00 (m, 2H), 3.17-2.87 (m, 3H),
1.61-1.59 (m, 6H), 1.37-1.31 (m, 3H); MS (ESI) m/e 493
(M+H).sup.+.
Example 267
Preparation of
(E)-3-(3,3-Dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepi-
n-7-yl)-N-methyl-N-(2-propoxy-3-trifluoromethoxybenzyl)acrylamide
hydrochloride
a) 2-Hydroxy-3-trifluoromethoxybenzaldehyde
[1279] A solution of 2-trifluoromethoxyphenol (5.13 g, 28.8 mmol)
in anhydrous acetonitrile (150 mL) in oven-dried glassware was
treated with triethylamine (15.0 mL, 108 mmol) and MgCl.sub.2 (4.11
g, 43.2 mmol) which had been dried under vacuum with heating.
Paraformaldehyde (5.18 g, 172 mmol), which had been dried under
vacuum with P.sub.2O.sub.5, was then added and the solution was
heated to reflux. After 5 days, the reaction was quenched with 1 N
HCl (200 mL). The mixture was extracted using Et.sub.2O
(2.times.100 mL). The combined organics were washed with brine
(2.times.150 mL), dried (Na.sub.2SO.sub.4) and concentrated to a
yellow solid. Purification by column chromatography (silica gel,
98:2 to 95:5 hexanes/EtOAc) gave the title compound (2.45 g, 41%)
as a yellow powder: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
10.24 (s, 1H), 7.75-7.65 (m, 2H), 7.08 (t, J=7.9 Hz, 1H).
b) 2-Propoxy-3-trifluoromethoxybenzaldehyde
[1280] To a solution of 2-hydroxy-3-trifluoromethoxybenzaldehyde
(1.00 g, 4.82 mmol) in DMF (10 mL) was added K.sub.2CO.sub.3 (1.46
g, 10.6 mmol) followed by 1-bromopropane (0.65 mL, 7.2 mmol). The
solution was heated to 37.degree. C. for 6 h. The reaction was
quenched with H.sub.2O (40 mL) and the mixture was extracted with
EtOAc (3.times.50 mL). The combined organics were washed with brine
(2.times.100 mL), dried (Na.sub.2SO.sub.4) and concentrated to
yield the title compound (1.15 g, 96%) as a yellow oil: .sup.1H NMR
(300 MHz, DMSO-d.sub.6) .delta. 10.30 (s, 1H), 7.77 (d, J=8.0 Hz,
2H), 7.38 (t, J=7.9 Hz, 1H), 4.09 (t, J=6.4 Hz, 2H), 1.81-1.72 (m,
2H), 1.01 (t, J=7.4 Hz, 3H).
c) Methyl-(2-propoxy-3-trifluoromethoxybenzyl)amine
[1281] A solution of methylamine (19 mL of a 2.0 M solution in
MeOH, 38 mmol) was added to
2-propoxy-3-trifluoromethoxybenzaldehyde (1.15 g, 4.60 mmol). The
mixture was stirred for 18 h. The solution was concentrated under
reduced pressure. The resulting clear oil was dissolved in EtOH (19
mL) and treated with NaBH.sub.4 (0.174 g, 4.60 mmol). After
stirring for 5.5 h, the reaction mixture was concentrated under
reduced pressure, then dissolved in 1 N NaOH (19 mL). The mixture
was extracted with Et.sub.2O (3.times.50 mL). The organics were
collected, washed with brine (2.times.100 mL), dried
(Na.sub.2SO.sub.4) and concentrated to yield the title compound
(0.89 g, 73%) as an orange oil: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 7.41 (dd, J=7.7, 1.6 Hz, 1H), 7.25 (dd, J=6.7, 1.3 Hz, 1H),
7.16 (t, J=7.7 Hz, 1H), 3.87 (t, J=6.3 Hz, 2H), 3.68 (s, 2H), 2.27
(s, 3H), 2.07 (br s, 1H), 1.74 (q, J=6.4 Hz, 2H), 1.02 (t, J=3.1
Hz, 3H).
d) N-Methyl-N-(2-propoxy-3-trifluoromethoxybenzyl)acrylamide
[1282] To a solution of
methyl-(2-propoxy-3-trifluoromethoxybenzyl)amine (0.890 g, 3.35
mmol) in CH.sub.2Cl.sub.2 (30 mL) was added acryloyl chloride (0.30
mL, 3.6 mmol) drop-wise. After stirring for five minutes,
triethylamine (0.51 mL, 3.6 mmol) was added. The solution was
allowed to stir under N.sub.2 for 3 h. The solution was diluted
with CH.sub.2Cl.sub.2 (30 mL), washed with H.sub.2O (3.times.50 mL)
and brine (2.times.50 mL), dried (Na.sub.2SO.sub.4) filtered and
concentrated to yield the title compound (0.95 g, 90%) as a yellow
oil and as a mixture of amide rotamers: .sup.1H NMR (500 MHz,
CDCl.sub.3) .delta. 7.21-7.00 (m, 3H), 6.67-6.48 (m, 1H), 6.41-6.36
(m, 1H), 5.76-5.66 (m, 1H), 4.75-4.65 (m, 2H), 3.99-3.93 (m, 2H),
3.03 (s, 3H), 1.83-1.78 (m, 2H), 1.07-1.03 (m, 3H).
e)
(E)-3-(3,3-Dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diaze-
pin-7-yl)-N-methyl-N-(2-propoxy-3-trifluoromethoxybenzyl)acrylamide
[1283] A solution of
N-methyl-N-(2-propoxy-3-trifluoromethoxybenzyl)acrylamide (0.468 g,
1.47 mmol) in propionitrile (5 mL) and DMF (1 mL) was deoxygenated
with Ar for 20 min. The solution was treated sequentially with
diisopropylethylamine (0.40 mL, 2.3 mmol) and
7-bromo-3,3-dimethyl-1,3,4,5-tetrahydro-pyrido[2,3-e][1,4]diazepin-2-one
(0.300 g, 1.11 mmol). The solution was deoxygenated with Ar for 20
min. Pd(OAc).sub.2 (0.024 g, 0.111 mmol) and P(o-tol).sub.3 (0.067
g, 0.222 mmol) were added and the solution was deoxygenated with Ar
for 20 minutes. The mixture was heated to reflux for 18 h, then
allowed to cool. The mixture was diluted with EtOAc (30 mL) and
then washed with H.sub.2O (3.times.50 mL) and brine (2.times.100
mL), dried (Na.sub.2SO.sub.4) and concentrated to a yellow-orange
solid. Purification by column chromatography (silica gel,
CH.sub.2Cl.sub.2/MeOH, 100 to 98:2) gave the title compound (0.25
g, 31%) as an off-white solid and as a mixture of amide rotamers:
.sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 9.80-9.78 (m, 1H),
8.41-8.36 (m, 1H), 8.01-7.92 (m, 1H), 7.56-7.49 (m, 1H), 7.36-7.08
(m, 4H), 4.87-4.69 (m, 2H), 3.96-3.83 (m, 4H), 3.16-2.88 (m, 4H),
1.78-1.71 (m, 2H), 1.31-1.29 (m, 6H), 1.03-0.98 (m, 3H); MS (ESI)
m/e 507 (M+H).sup.+.
f)
(E)-3-(3,3-Dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diaze-
pin-7-yl)-N-methyl-N-(2-propoxy-3-trifluoromethoxybenzyl)acrylamide
hydrochloride
[1284] A stirring solution of
(E)-3-(3,3-dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepi-
n-7-yl)-N-methyl-N-(2-propoxy-3-trifluoromethoxybenzyl)acrylamide
(0.255 g, 0.503 mmol) in CH.sub.2Cl.sub.2 (5 mL) under N.sub.2, was
treated with anhydrous HCl (0.25 mL of a 2 M solution in diethyl
ether, 0.5 mmol). After stirring for 18 h, the resulting solid was
collected by filtration and washed with Et.sub.2O (150 mL). The
solid was dried under vacuum to yield the target compound (0.21 g,
82%) as an off white solid and as a mixture of amide rotamers:
.sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.93-10.91 (m, 1H),
10.51 (br s, 2H), 8.66-8.64 (m, 1H), 8.40-8.32 (m, 1H), 7.63-7.54
(m, 1H), 7.40-7.09 (m, 4H), 4.89-4.70 (m, 2H), 4.41-4.36 (m, 2H),
3.96-3.90 (m, 2H), 3.18-2.87 (m, 3H), 1.79-1.70 (m, 2H), 1.63-1.61
(m, 6H), 1.09-0.97 (m, 3H); MS (ESI) m/e 507 (M+
Example 268
Preparation of
(E)-N-(3-Chloro-2-ethoxybenzyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-[1,8-
]naphthyridin-3-yl)acrylamide
a) 3-Chloro-2-isopropoxybenzoic acid isopropyl ester
[1285] 2-Iodopropane (1.73 mL, 17.3 mmol) was added to a stirring
solution of 3-chloro-2-hydroxybenzoic acid (2.00 g, 11.5 mmol) and
K.sub.2CO.sub.3 (3.52 g, 25.4 mmol) in DMF (25 mL) under N.sub.2.
After stirring at 70.degree. C. for 18 h, additional 2-iodopropane
(1.73 mL, 17.3 mmol) was added. The solution was allowed to stir
for an additional 48 h. The reaction was quenched with H.sub.2O (70
mL) and the mixture was extracted with Et.sub.2O (2.times.100 mL).
The combined organics were washed with brine (100 mL), dried
(Na.sub.2SO.sub.4) and concentrated to yield the title compound
(2.29 g, 77%) as a clear oil: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 7.68 (dd, J=8.1, 1.8 Hz, 1H), 7.58 (dd, J=7.8, 1.8 Hz, 1H),
7.20 (t, J=7.8 Hz, 1H), 5.16-5.50 (m, 1H), 4.39-4.30 (m, 1H), 1.29
(d, J=7.2 Hz, 6H), 1.22 (d, J=6.0 Hz, 6H).
b) (3-Chloro-2-isopropoxyphenyl)methanol
[1286] Diisobutylaluminum lithium hydride (26.8 mL of a 1.0 M in
hexanes, 26.8 mmol) was added dropwise to a solution of
3-chloro-2-isopropoxybenzoic acid isopropyl ester (2.29 g, 8.94
mmol) in THF (20 mL) under N.sub.2 at 0.degree. C. After the
addition was complete, the ice bath was removed, the solution
warmed to ambient temperature, and the reaction mixture stirred for
5 d. The reaction was cooled to 0.degree. C. and quenched using 1N
HCl (100 mL) until all the solids dissolved. The solution was
extracted with Et.sub.2O (3.times.50 mL). The combined organics
were washed with brine (2.times.100 mL), dried (Na.sub.2SO.sub.4)
and concentrated to yield the title compound (1.60 g, 89%) as an
off-white solid: .sup.1H NMR (500 MHz, DMSO-d.sub.6) .delta. 7.41
(d, J=4.5 Hz, 1H), 7.33 (dd, J=8.0, 1.5 Hz, 1H), 7.11 (t, J=8.0 Hz,
1H), 5.19 (t, J=5.7 Hz, 1H), 4.53 (d, J=5.5 Hz, 1H), 4.44-4.36 (m,
1H), 1.24 (d, J=6.1 Hz, 6H).
c) 3-Chloro-2-isopropoxybenzaldehyde
[1287] MnO.sub.2 (4.86 g, 56.0 mmol) was added to a stirring
solution of (3-chloro-2-isopropoxyphenyl)methanol (1.60 g, 8.00
mmol) in benzene (75 mL), under N.sub.2. After stirring for 48 h,
the solution was filtered over diatomaceous earth, the pad was
rinsed with CH.sub.2Cl.sub.2 (100 mL), and the solution was
concentrated to a yellow oil. Purification by column chromatography
(silica gel hexanes/EtOAc, 98:2) gave the title compound (0.50 g,
31%) as a clear oil: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
10.28 (s, 1H), 7.84 (dd, J=7.8, 1.5 Hz, 1H), 7.72 (dd, J=7.8, 1.5
Hz, 1H), 7.31 (t, J=8.1 Hz, 1H), 4.53-4.48 (m, 1H), 1.32 (d, J=6.0
Hz, 6H).
d) (3-chloro-2-isopropoxybenzyl)methylamine
[1288] Methylamine (10.3 mL of a 2.0 M solution in MeOH, 20.6 mmol)
was added to 3-chloro-2-isopropoxybenzaldehyde (0.500 g, 2.52 mmol)
and the mixture was stirred for 72 h. The solution was concentrated
under reduced pressure. The resulting light yellow oil was
dissolved in EtOH (10.3 mL) and treated with NaBH.sub.4 (0.095 g,
2.52 mmol). After stirring for 18 h, the reaction mixture was
concentrated under reduced pressure, dissolved in 1 N NaOH (20 mL)
and extracted with Et.sub.2O (3.times.50 mL). The combined organics
were washed with brine (2.times.75 mL), dried (Na.sub.2SO.sub.4)
and concentrated to give the title compound (0.50 g, 93%) as a
yellow oil: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 7.40-7.31
(m, 2H), 7.08 (t, J=7.8 Hz, 1H), 4.42 (q, J=6.1 Hz, 1H), 3.66 (s,
2H), 2.25 (s, 3H), 2.02 (br s, 1H), 1.25 (d, J=6.1 Hz, 6H).
e)
(E)-N-(3-Chloro-2-ethoxybenzyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-[1-
,8]naphthyridin-3-yl)acrylamide
[1289] A stirring solution of
(3-chloro-2-isopropoxybenzyl)methylamine (0.229 g, 1.07 mmol) and
diisopropylethylamine (0.51 mL, 2.9 mmol) in DMF (20 mL) under
N.sub.2 was treated sequentially with
(E)-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3-yl)acrylic acid
hydrochloride (0.250 g, 0.980 mmol), 1-hydroxybenzotriazole hydrate
(0.144 g, 1.07 mmol) and
1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (0.205
g, 1.07 mmol). After stirring for 18 h, the reaction mixture was
diluted with H.sub.2O (30 mL). The resulting solids were collected
by filtration and washed with Et.sub.2O (100 mL), suspended in MeOH
(30 mL) and sonicated for 30 minutes. The solids were then
collected by filtration, washed with MeOH and dried to yield the
title compound (0.085 g, 21%) as a white solid and as a mixture of
amide rotamers: NMR (300 MHz, DMSO-d.sub.6) .delta. 10.67-10.64 (m,
1H), 8.37-8.32 (m, 1H), 8.09-7.91 (m, 1H), 7.53-7.48 (m, 1H),
7.42-7.37 (m, 1H), 7.28-7.02 (m, 3H), 4.83-4.68 (m, 2H), 4.53-4.45
(m, 1H), 2.94-2.85 (m, 5H), 2.56-2.49 (m, 2H), 1.33-1.28 (m, 6H);
MS (ESI) m/e 414 (M+H).sup.+.
Example 269
Preparation of
(E)-N-(3-Chloro-2-propoxybenzyl)-3-(3,3-dimethyl-2-oxo-2,3,4,5-tetrahydro-
-1H-pyrido[2,3-e][1,4]diazepin-7-yl)-N-methylacrylamide
hydrochloride
a) 3-Chloro-2-propoxybenzoic acid propyl ester
[1290] To a solution of 3-chlorosalicylic acid (3.42 g, 19.8 mmol)
in DMF (45 mL) was added K.sub.2CO.sub.3 (6.02 g, 43.5 mmol)
followed by 1-bromopropane (5.39 mL, 59.4 mmol). The mixture was
heated to 30.degree. C. After 18 h, additional 1-bromopropane (1.79
mL, 19.6 mmol) was added to ensure the dialkylated product. After
stirring for an additional 48 h, the reaction was quenched with
H.sub.2O (75 mL) and the mixture was extracted with Et.sub.2O
(3.times.100 mL). The combined organics were washed with brine
(2.times.100 mL), dried (Na.sub.2SO.sub.4) and concentrated to
yield the title compound (2.62 g, 51%) as a yellow oil: .sup.1H NMR
(300 MHz, DMSO-d.sub.6) .delta. 7.71 (dd, J=7.9, 1.5 Hz, 1H), 7.64
(dd, J=7.8, 1.6 Hz, 1H), 7.24 (t, J=7.8 Hz, 1H), 4.22 (t, J=6.6 Hz,
2H), 3.92 (t, J=6.5 Hz, 2H), 1.78-1.67 (m, 4H), 1.01-0.93 (m,
6H).
b) (3-Chloro-2-propoxyphenyl)methanol
[1291] Diisobutylaluminum lithium hydride (30.7 mL of a 1.0 M in
hexanes, 30.7 mmol) was added dropwise to an ice-cold solution of
3-chloro-2-propoxybenzoic acid propyl ester (2.63 g, 10.2 mmol) in
THF (20 mL). After the addition was complete, the ice bath was
removed and the mixture stirred at ambient temperature for 18 h.
The reaction was cooled to 0.degree. C. and HCl (1N, 100 mL) was
added until all the resulting solids returned to solution. The
solution was extracted with Et.sub.2O (3.times.100 mL). The
combined organics were washed with brine (2.times.100 mL), dried
(Na.sub.2SO.sub.4) filtered and concentrated to yield the title
compound (1.12 g, 56%) as a light yellow oil: .sup.1H NMR (500 MHz,
DMSO-d.sub.6) .delta. 7.40-7.33 (m, 2H), 7.13 (t, J=7.7 Hz, 1H),
5.22 (t, J=5.6 Hz, 1H), 5.56 (d, J=5.6 Hz, 2H), 3.84 (t, J=6.4 Hz,
2H), 1.76-1.71 (m, 2H), 1.01 (t, J=7.3 Hz, 3H).
c) 3-Chloro-2-propoxybenzaldehyde
[1292] MnO.sub.2 (3.40 g, 39.2 mmol) was added to a stirring
solution of (3-chloro-2-propoxyphenyl)methanol (1.12 g, 5.60 mmol)
in benzene (54 mL) under N.sub.2, After stirring for 48 h, the
solution was filtered over diatomaceous earth, the pad rinsed with
CH.sub.2Cl.sub.2 (100 mL), and the solution concentrated to a clear
oil. Purification by column chromatography (silica gel,
hexanes/EtOAc, 98:2) gave the title compound (0.42 g, 38%) as a
clear oil: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.27 (s,
1H), 7.85 (d, J=1.6 Hz, 1H), 7.73 (d, J=1.6 Hz, 1H), 7.32 (t, J=7.8
Hz, 1H), 4.04 (t, J=6.4 Hz, 2H), 1.85-1.78 (m, 2H), 1.03 (t, J=7.3
Hz, 3H).
d) (3-Chloro-2-propoxybenzyl)methylamine
[1293] A solution of methylamine (8.5 mL of a 2.0 M solution in
MeOH, 17 mmol) was added to 3-chloro-2-propoxybenzaldehyde (0.425
g, 2.14 mmol) and the mixture was stirred for 72 h. The solution
was concentrated under reduced pressure. The resulting clear oil
was dissolved in EtOH (8.5 mL) and treated with NaBH.sub.4 (0.080
g, 2.1 mmol). After stirring for 18 h, the reaction mixture was
concentrated under reduced pressure and then dissolved in 1 N NaOH
(10 mL). The mixture was extracted with Et.sub.2O (3.times.50 mL).
The combined organics were washed with brine (2.times.100 mL),
dried (Na.sub.2SO.sub.4) and concentrated to yield the title
compound (0.441 g, 96%) as a light yellow oil: .sup.1H NMR (300
MHz, DMSO-d.sub.6) .delta. 7.37-7.31 (m, 2H), 7.08 (t, J=7.7 Hz,
1H), 3.85 (t, J=6.4 Hz, 2H), 3.67 (s, 2H), 2.26 (s, 3H), 2.04 (br
s, 1H), 1.82-1.70 (m, 2H), 1.02 (t, J=7.3 Hz, 3H).
d) N-(3-Chloro-2-propoxybenzyl)-N-methylacrylamide
[1294] To a solution of (3-chloro-2-propoxybenzyl)methylamine
(0.435 g, 2.04 mmol) in CH.sub.2Cl.sub.2 (18 mL) was added acryloyl
chloride (0.18 mL, 2.24 mmol) drop-wise. After stirring for five
minutes, triethylamine (0.531 mL, 2.24 mmol) was added. The
solution was stirred under N.sub.2 for 18 h. The solution was
diluted with CH.sub.2Cl.sub.2 (30 mL) and then washed with H.sub.2O
(3.times.50 mL) and brine (2.times.100 mL), dried over
Na.sub.2SO.sub.4, filtered and concentrated to yield the title
compound (0.48 g, 89%) as a light yellow oil and as a mixture of
amide rotamers: .sup.1H NMR (500 MHz, CDCl.sub.3) .delta. 7.31-7.26
(m, 1H), 7.10-6.98 (m, 2H), 6.63-6.37 (m, 2H), 5.77-5.73 (m, 1H),
4.76-4.65 (m, 2H), 3.94-3.89 (m, 2H), 3.01 (s, 3H), 1.89-1.82 (m,
2H), 1.11-1.05 (m, 3H).
e)
(E)-N-(3-Chloro-2-propoxybenzyl)-3-(3,3-dimethyl-2-oxo-2,3,4,5-tetrahyd-
ro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)-N-methylacrylamide
[1295] A solution of
N-(3-chloro-2-propoxybenzyl)-N-methylacrylamide (0.392 g, 1.47
mmol) in propionitrile (5 mL) and DMF (1 mL) was deoxygenated with
Ar for 20 min. The solution was treated with diisopropylethylamine
(0.40 mL, 2.33 mmol) and
7-bromo-3,3-dimethyl-1,3,4,5-tetrahydro-pyrido[2,3-e][1,4]diazepin-2-one
(0.300 g, 1.11 mmol). The solution was deoxygenated with Ar for 20
min. Pd(OAc).sub.2 (0.024 g, 0.111 mmol) and P(o-tol).sub.3 (0.067
g, 0.222 mmol) were then added and the solution was deoxygenated
again with Ar for 20 min. The mixture was heated to reflux for 18
h, then allowed to cool. The mixture was diluted with EtOAc (30 mL)
and was washed with H.sub.2O (3.times.50 mL). The organic layer was
washed with brine (1.times.100 mL), dried (Na.sub.2SO.sub.4) and
concentrated to an orange oil. Purification by column
chromatography (silica gel, CH.sub.2Cl.sub.2/MeOH, 100 to 98:2)
gave the title compound (0.30 g, 59%) as a light yellow solid and
as a mixture of amide rotamers: NMR (300 MHz, DMSO-d.sub.6) .delta.
9.80-9.78 (m, 1H), 8.40-8.37 (m, 1H), 8.01-7.92 (m, 1H), 7.54-7.49
(m, 1H), 7.41-7.25 (m, 2H), 7.15-7.05 (m, 2H), 4.86-4.68 (m, 2H),
3.91-3.84 (m, 4H), 3.14-2.95 (m, 4H), 1.83-1.76 (m, 2H), 1.31-1.29
(m, 6H), 1.05-0.99 (m, 3H).
f)
(E)-N-(3-Chloro-2-propoxybenzyl)-3-(3,3-dimethyl-2-oxo-2,3,4,5-tetrahyd-
ro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)-N-methylacrylamide
hydrochloride
[1296] A stirring solution of
(E)-N-(3-chloro-2-propoxybenzyl)-3-(3,3-dimethyl-2-oxo-2,3,4,5-tetrahydro-
-1H-pyrido[2,3-e][1,4]diazepin-7-yl)-N-methylacrylamide (0.300 g,
0.656 mmol) in CH.sub.2Cl.sub.2 (7 mL) under N.sub.2 was treated
with anhydrous HCl (0.32 mL of a 2 M solution in diethyl ether,
0.64 mmol) After stirring for 7 h, the resulting solid was
collected by filtration, washed with Et.sub.2O (100 mL) and then
dried to yield the target compound (0.25 g, 79%) as an off white
solid and as a mixture of amide rotamers: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 10.93 (br s, 1H), 10.38 (br s, 2H), 8.66-8.63
(m, 1H), 8.37-8.28 (m, 1H), 7.62-7.54 (m, 1H), 7.44-7.32 (m, 2H),
7.19-7.02 (m, 2H), 4.87-4.69 (m, 2H), 4.41-4.37 (m, 2H), 3.94-3.87
(m, 2H), 3.16-2.89 (m, 3H), 1.83-1.76 (m, 2H), 1.61-1.59 (m, 6H),
1.05-0.99 (m, 3H); MS (APCI) m/e 457 (M+H).sup.4.
Example 270
Preparation of
(E)-N-(2-Isobutoxy-3-methoxybenzyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro--
[1,8]naphthyridin-3-yl)acrylamide
a) 2-Isobutoxy-3-methoxybenzaldehyde
[1297] A solution of 2-hydroxy-3-methoxybenzaldehyde (4.00 g, 26.2
mmol) in DMF (50 mL) was treated with K.sub.2CO.sub.3 (8.00 g, 57.9
mmol) followed by iodoisobutane (4.53 mL, 39.4 mmol). The resulting
slurry was stirred for at ambient temperature for 18 h. Additional
DMF (70 mL) was added to help aid stirring, and the mixture was
heated to 40.degree. C. for 18 h. Additional iodoisobutane (2.26
mL, 19.7 mmol) was added and the mixture was stirred at ambient
temperature for 48 h. The reaction was quenched with H.sub.2O (100
mL) and the mixture was extracted with EtOAc (3.times.100 mL). The
combined organics were washed with H.sub.2O (2.times.100 mL) and
brine (2.times.100 mL), dried (Na.sub.2SO.sub.4) and concentrated
to an orange oil. Purification by column chromatography (silica
gel, hexanes/EtOAc, 90:10) gave the title compound (2.46 g, 62%) as
a clear oil: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.34 (s,
1H), 7.36 (dd, J=7.9, 1.7 Hz, 1H), 7.27 (dd, J=7.8, 1.7 Hz, 1H),
7.19 (dt, J=7.8, 0.6 Hz, 1H), 3.85 (m, 5H), 2.09-2.00 (m, 1H), 0.99
(d, J=6.7 Hz, 6H).
b) (2-Isobutoxy-3-methoxybenzyl)methylamine
[1298] A solution of methylamine (64 mL of a 2.0 M solution in
MeOH, 128 mmol) was added to 2-isobutoxy-3-methoxybenzaldehyde
(2.45 g, 11.9 mmol) and the solution was stirred for 18 h. The
solution was concentrated under reduced pressure. The resulting
clear oil was dissolved in EtOH (64 mL) and treated with NaBH.sub.4
(0.616 g, 16.3 mmol). After stirring for 7 h, the mixture was
concentrated under reduced pressure and then dissolved in 1 N NaOH
(57 mL). The mixture was extracted with Et.sub.2O (3.times.75 mL).
The combined organics were washed with brine (2.times.100 mL),
dried (Na.sub.2SO.sub.4) and concentrated to yield the title
compound (2.43 g, 91%) as a light yellow oil: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 7.01-6.88 (m, 3H), 3.76 (s, 3H), 3.63 (t,
J=6.4 Hz, 3H), 2.25 (s, 3H), 2.00-1.93 (m, 1H), 1.84 (br s, 1H),
0.98 (d, J=6.6 Hz, 6H).
c) N-(2-Isobutoxy-3-methoxybenzyl)-N-methylacrylamide
[1299] To a solution of (2-isobutoxy-3-methoxybenzyl)methylamine
(2.00 g, 8.96 mmol) in CH.sub.2Cl.sub.2 (80 mL) was added acryloyl
chloride (0.85 mL, 9.8 mmol) drop-wise. After stirring for five
minutes, triethylamine (1.37 mL, 9.86 mmol) was added. The solution
was stirred for 6 hours. The solution was diluted with
CH.sub.2Cl.sub.2 (30 mL) and then washed with H.sub.2O (3.times.100
mL) and brine (2.times.100 mL), dried (Na.sub.2SO.sub.4) and
concentrated to yield the title compound (2.30 g, 92%) as a light
yellow oil and as a mixture of amide rotamers: .sup.1H NMR (500
MHz, DMSO-d.sub.6) .delta. 7.06-6.93 (m, 2H), 6.85-6.62 (m, 1H),
6.57-6.53 (m, 1H), 6.17-6.13 (m, 1H), 5.73-5.63 (m, 1H), 4.64-4.58
(m, 2H), 3.79-3.78 (m, 3H), 3.69-3.66 (m, 2H), 2.95-2.87 (m, 3H),
2.01-1.98 (m, 1H), 0.99-0.97 (m, 6H).
d)
(E)-N-(2-Isobutoxy-3-methoxybenzyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydr-
o-[1,8]naphthyridin-3-yl)acrylamide
[1300] A solution of
N-(2-isobutoxy-3-methoxybenzyl)-N-methyl-acrylamide (0.475 g, 1.71
mmol) in propionitrile (6 mL) and DMF (1.2 mL) was deoxygenated
with Ar for 20 min. The solution was treated with
diisopropylethylamine (0.48 mL, 2.77 mmol) and
6-bromo-3,4-dihydro-1H-[1,8]naphthyridin-2-one (0.300 g, 1.32
mmol). The solution was deoxygenated with Ar for 20 min.
Pd(OAc).sub.2 (0.029 g, 0.13 mmol) and P(o-tol).sub.3 (0.080 g,
0.26 mmol) were then added and the mixture was deoxygenated with Ar
for 20 min. The mixture was heated to reflux for 18 h. Upon
cooling, a precipitate formed. The solids were collected by
filtration and washed with water. Purification by column
chromatography (silica gel, CH.sub.2Cl.sub.7/MeOH 9:1) gave an
orange solid. The solid was dissolved in CH.sub.2Cl.sub.2 and the
solution was diluted with hexanes. The resulting precipitate was
collected by filtration, washed with Et.sub.2O (50 mL) and dried to
yield the title compound (0.18 g, 32%) as an off-white solid and as
a mixture of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 10.66-10.64 (m, 1H), 8.36-8.32 (m, 1H), 8.09-8.00 (m, 1H),
7.53-7.47 (m, 1H), 7.27-7.20 (m, 1H), 7.04-7.96 (m, 2H), 6.66-6.60
(m, 1H), 4.79-4.64 (m, 2H), 3.79 (s, 3H), 3.72-3.67 (m, 2H),
3.10-2.85 (m, 5H), 2.56-2.49 (m, 2H), 2.03-1.97 (m, 1H), 1.00-0.97
(m, 6H); MS (ESI) m/e 424 (M+H).sup.+.
Example 271
Preparation of
(E)-N-(3-Isopropyl-2-propoxybenzyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro--
[1,8]naphthyridin-3-yl)acrylamide
a) 3-Isopropyl-2-propoxybenzoic acid propyl ester
[1301] 1-Bromopropane (7.55 mL, 83.1 mmol) was added to a stirring
solution of 2-hydroxy-3-isopropylbenzoic acid (5.00 g, 27.7 mmol)
and K.sub.2CO.sub.3 (11.48 g, 83.1 mmol) in DMF (60 mL). After
stirring at 30.degree. C. for 18 h, the reaction was quenched with
H.sub.2O (100 mL) and the mixture extracted with EtOAc (3.times.100
mL). The combined organics were washed with brine (3.times.200 mL),
dried (Na.sub.2SO.sub.4) and concentrated to a clear oil.
Purification by column chromatography (silica gel, hexanes/EtOAc,
100 to 95:5) gave the title compound (3.96 g, 54%) as a clear oil:
.sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 7.60 (dd, J=7.6, 1.7 Hz,
1H), 7.41 (dd, J=7.7, 1.7 Hz, 1H), 7.10 (t, J=7.7 Hz, 1H), 4.26 (t,
J=6.7 Hz, 2H), 3.83 (t, J=6.7 Hz, 2H), 3.46-3.37 (m, 1H), 1.87-1.75
(m, 4H), 1.22 (d, J=6.9 Hz, 6H), 1.06-0.99 (m, 6H).
b) (3-Isopropyl-2-propoxyphenyl)methanol
[1302] Diisobutylaluminum lithium hydride (40.8 mL of a 1.0 M in
hexanes, 40.8 mmol) was added dropwise to an ice-cold solution of
3-isopropyl-2-propoxybenzoic acid propyl ester (3.60 g, 13.6 mmol)
in THF (30 mL). After the addition was complete, the ice bath was
removed and the reaction mixture was stirred at ambient temperature
for 18 h. The reaction was cooled to 0.degree. C. and HCl (1N, 180
mL) was added until all the resulting solids returned to solution.
The mixture was extracted with EtOAc (3.times.150 mL). The combined
organics were washed with brine (2.times.200 mL), dried
(Na.sub.2SO.sub.4) and concentrated to yield the title compound
(2.76 g, 97%) as a yellow oil: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 7.25 (d, J=6.3 Hz, 1H), 7.17 (d, J=5.9 Hz, 1H), 7.10 (t,
J=7.5 Hz, 1H), 5.02 (t, J=5.6 Hz, 1H), 4.52 (d, J=5.5 Hz, 2H), 3.68
(t, J=6.4 Hz, 2H), 3.32-3.25 (m, 1H), 1.77-1.70 (m, 2H), 1.16 (d,
J=6.9, 6H), 1.02 (t, J=7.3 Hz, 3H).
c) 3-Isopropyl-2-propoxybenzaldehyde
[1303] MnO.sub.2 (6.88 g, 79.2 mmol) was added to a stirring
solution of (3-isopropyl-2-propoxyphenyl)methanol (2.75 g, 13.2
mmol) in benzene (130 mL) under N.sub.2. After stirring for 48 h,
the solution was filtered over diatomaceous earth, the pad rinsed
with CH.sub.2Cl.sub.2 (200 mL) and the solution concentrated to a
yellow oil. Purification by column chromatography (silica gel,
hexanes/EtOAc, 100 to 98:2) gave the title compound (1.49 g, 54%)
as a light yellow oil: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
10.26 (s, 1H), 7.67 (dd, J=7.6, 1.7 Hz, 1H), 7.59 (dd, J=7.6, 1.7
Hz, 1H), 7.28 (t, J=7.6 Hz, 1H), 3.87 (t, J=6.4 Hz, 2H), 3.35-3.30
(m, 2H), 1.85-1.78 (m, 2H), 1.21 (t, J=6.9 Hz, 7H), 1.03 (t, J=7.3
Hz, 3H).
d) (3-Isopropyl-2-propoxybenzyl)methylamine
[1304] A solution of methylamine (30 mL of a 2.0 M solution in
MeOH, 60 mmol) was added to 3-isopropyl-2-propoxybenzaldehyde (1.49
g, 7.22 mmol) and the mixture was stirred for 72 h. The solution
was concentrated under reduced pressure. The resulting dark yellow
oil was dissolved in EtOH (30 mL) and treated with NaBH.sub.4
(0.273 g, 7.22 mmol). After 18 h, the reaction mixture was
concentrated under reduced pressure and dissolved in 1 N NaOH (30
mL). The mixture was extracted with Et.sub.2O (3.times.75 mL). The
combined organics were dried (Na.sub.2SO.sub.4) and concentrated to
yield the title compound (1.52 g, 95%) as an orange oil: .sup.1H
NMR (300 MHz, DMSO-d.sub.6) .delta. 7.21-7.14 (m, 2H), 7.04 (t,
J=7.5 Hz, 1H), 3.70 (t, J=6.3 Hz, 2H), 3.63 (s, 2H), 3.32-3.23 (m,
1H), 2.28 (s, 3H), 1.78 (br s, 1H), 1.76-1.71 (m, 2H), 1.16 (d,
J=6.9 Hz, 6H), 1.03 (t, J=7.3 Hz, 3H).
e)
(E)-N-(3-Isopropyl-2-propoxybenzyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydr-
o-[1,8]naphthyridin-3-yl)acrylamide
[1305] A solution of (3-isopropyl-2-propoxybenzyl)methylamine
(0.238 g, 1.07 mmol) and diisopropyl-ethylamine (0.51 mL, 2.9 mmol)
in DMF (20 mL) under N.sub.2 was treated sequentially with
(E)-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3-yl)acrylic acid
hydrochloride (0.250 g, 0.981 mmol), 1-hydroxybenzotriazole hydrate
(0.144 g, 1.07 mmol) and
1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (0.205
g, 1.07 mmol). After stirring for 18 h, the reaction mixture was
diluted with H.sub.2O (30 mL). The resulting solids were collected
by filtration and when washed with Et.sub.2O (50 mL) were
unexpectedly dissolved. The filtrate was extracted with EtOAc
(3.times.50 mL). The combined organics were washed with brine
(2.times.100 mL), dried (Na.sub.2SO.sub.4) and concentrated to a
light yellow solid. Purification by column chromatography (silica
gel, CH.sub.2Cl.sub.2/MeOH, 100 to 99.5:0.5) gave the title
compound (0.26 g, 63%) as a white solid and as a mixture of amide
rotamers: .sup.1H NMR (500 MHz, DMSO-d.sub.6) .delta. 10.64-10.62
(m, 1H), 8.37-8.31 (m, 1H), 8.09-7.98 (m, 1H), 7.52-7.49 (m, 1H),
7.28-7.19 (m, 2H), 7.10-7.06 (m, 1H), 6.89-6.87 (m, 1H), 4.80-4.66
(m, 2H), 3.76-3.70 (m, 2H), 3.31-3.26 (m, 1H), 3.12-2.85 (m, 5H),
2.55-2.49 (m, 2H), 1.82-1.76 (m, 2H), 1.19-1.17 (m, 6H), 1.05-1.02
(m, 3H); MS (ESI) m/e 422 (M+H).sup.+.
Example 272
Preparation of
(E)-N-(2-Ethoxy-3-isopropylbenzyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-[-
1,8]naphthyridin-3-yl)acrylamide
a) Preparation of 2-Ethoxy-3-isopropylbenzoic acid propyl ester
[1306] Iodoethane (6.64 mL, 83.1 mmol) was added to a stirring
solution of 2-hydroxy-3-isopropylbenzoic acid (5.00 g, 27.7 mmol)
and K.sub.2CO.sub.3 (11.48 g, 83.1 mmol) in DMF (60 mL). After
stirring at 30.degree. C. for 18 h, the reaction was quenched with
H.sub.2O (100 mL) and the mixture was extracted with EtOAc
(3.times.100 mL). The combined organics were washed with brine
(3.times.250 mL), dried (Na.sub.2SO.sub.4) and concentrated to a
clear oil. Purification by column chromatography (silica gel,
hexanes/EtOAc, 100 to 98:2) gave the title compound (4.54 g, 69%)
as an orange oil: .sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 7.60
(dd, J=7.6, 1.7 Hz, 1H), 7.41 (dd, J=7.7, 1.7 Hz, 1H), 7.11 (t,
J=7.7 Hz, 1H), 4.37 (q, J=7.1 Hz, 2H), 3.95 (q, J=7.0 Hz, 2H),
3.43-3.39 (m, 1H), 1.45-1.39 (m, 6H), 1.22 (d, J=6.9 Hz, 6H).
b) Preparation of (2-Ethoxy-3-isopropylphenyl)methanol
[1307] Diisobutylaluminum lithium hydride (55.0 mL of a 1.0 M in
hexanes, 55.0 mmol) was added drop-wise to an ice-cold solution of
2-ethoxy-3-isopropylbenzoic acid propyl ester (4.34 g, 18.3 mmol)
in THF (40 mL). After the addition was complete, the ice bath was
removed and reaction mixture was stirred for 18 h. The reaction was
cooled to 0.degree. C. and HCl (1N, 275 mL) was added until all the
resulting solids returned to solution. The mixture was extracted
with EtOAc (3.times.150 mL). The combined organics were washed with
brine (2.times.200 mL), dried (Na.sub.2SO.sub.4) and concentrated
to yield the title compound (3.73 g, quantitative) as a light
yellow oil: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 7.24 (d,
J=5.7 Hz, 1H), 7.16 (d, J=1.7 Hz, 1H), 7.07 (t, J=7.5 Hz, 1H), 5.02
(t, J=5.6 Hz, 1H), 4.52 (d, J=5.6 Hz, 2H), 3.77 (q, J=7.0 Hz, 2H),
3.32-3.25 (m, 1H), 1.33 (t, J=6.9 Hz, 3H), 1.16 (d, J=6.9, 6H).
c) 2-Ethoxy-3-isopropyl-benzaldehyde
[1308] MnO.sub.2 (9.49 g, 109 mmol) was added to a stirring
solution of (2-ethoxy-3-isopropylphenyl)methanol (3.54 g, 18.2
mmol) in benzene (175 mL) under N.sub.2. After stirring for 48 h,
the solution was filtered over diatomaceous earth and the pad
rinsed with CH.sub.2Cl.sub.2 (200 mL), and the solution was
concentrated to a clear oil. Purification by column chromatography
(silica gel, hexanes/EtOAc, 100 to 98:2) gave the title compound
(1.49 g, 42%) as a light yellow oil: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 10.26 (s, 1H), 7.67 (dd, J=7.6, 1.7 Hz, 1H),
7.59 (dd, J=7.6, 1.7 Hz, 1H), 7.28 (t, J=7.6 Hz, 1H), 3.97 (q,
J=6.9 Hz, 2H), 3.32-3.30 (m, 1H), 1.39 (t, J=6.9 Hz, 3H), 1.21 (d,
J=6.9 Hz, 6H).
d) (2-Ethoxy-3-isopropylbenzyl)methylamine
[1309] A solution of methylamine (30 mL of a 2.0 M solution, 60
mmol) was added to 2-ethoxy-3-isopropylbenzaldehyde (1.49 g, 7.75
mmol) and the mixture was stirred for 72 h. The solution was
concentrated under reduced pressure. The residue was dissolved in
EtOH (30 mL) and treated with NaBH.sub.4 (0.293 g, 7.75 mmol).
After stirring for 18 h, the reaction mixture was concentrated
under reduced pressure and then dissolved in 1 N NaOH (30 mL). The
mixture was extracted with Et.sub.2O (3.times.50 mL). The combined
organics were collected, washed with brine (2.times.100 mL), dried
(Na.sub.2SO.sub.4) and concentrated to yield the title compound
(1.51 g, 94%) as a light yellow oil: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 7.21-7.13 (m, 2H), 7.04 (t, J=7.5 Hz, 1H),
3.79 (q, J=7.0 Hz, 2H), 3.63 (s, 2H), 3.28-3.23 (m, 1H), 2.29 (s,
3H), 1.93 (br s, 1H), 1.35 (t, J=3.8 Hz, 3H), 1.16 (d, J=6.9 Hz,
6H).
e)
(E)-N-(2-Ethoxy-3-isopropylbenzyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-
-[1,8]naphthyridin-3-yl)acrylamide
[1310] A solution of (2-ethoxy-3-isopropylbenzyl)methylamine (0.223
g, 1.07 mmol) and diisopropyl-ethylamine (0.51 mL, 2.94 mmol) in
DMF (20 mL) was treated sequentially with
(E)-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3-yl)acrylic acid
hydrochloride (0.250 g, 0.981 mmol), 1-hydroxybenzotriazole hydrate
(0.144 g, 1.07 mmol) and
1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (0.205
g, 1.07 mmol). After stirring for 18 h, the reaction mixture was
diluted with H.sub.2O (30 mL). The resulting solids were collected
by filtration, and when washed with Et.sub.2O (50 mL), unexpectedly
dissolved. The filtrate was extracted with EtOAc (3.times.50 mL).
The combined organics were washed with brine (2.times.100 mL),
dried over Na.sub.2SO.sub.4, filtered and concentrated to a light
orange solid. Purification by column chromatography (silica gel,
CH.sub.2Cl.sub.2/MeOH, 100 to 99.5:0.5) gave the title compound
(0.20 g, 52%) as a white solid and as a mixture of amide rotamers:
.sup.1H NMR (500 MHz, DMSO-d.sub.6) .delta. 10.64-10.61 (m, 1H),
8.37-8.31 (m, 1H), 8.09-7.99 (m, 1H), 7.52-7.49 (m, 1H), 7.28-7.20
(m, 2H), 7.11-7.05 (m, 1H), 6.89-6.86 (m, 1H), 4.81-4.66 (m, 2H),
3.86-3.79 (m, 2H), 3.28-3.25 (m, 1H), 3.11-2.85 (m, 5H), 2.55-2.49
(m, 2H), 1.39-1.35 (m, 3H), 1.19-1.17 (m, 6H); MS (ESI) m/e 408
(M+H).sup.+.
Example 273
Preparation of
(E)-3-(3,3-Dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepi-
n-7-yl)-N-(3-isopropyl-2-propoxybenzyl)-N-methylacrylamide
hydrochloride
a) N-(3-Isopropyl-2-propoxybenzyl)-N-methylacrylamide
[1311] To a solution of (3-isopropyl-2-propoxybenzyl)methylamine
(1.00 g, 4.51 mmol) in CH.sub.2Cl.sub.2 (40 mL) was added acryloyl
chloride (0.43 mL, 4.96 mmol) drop-wise. After stirring for five
minutes, triethylamine (0.69 mL, 4.96 mmol) was added and the
solution was stirred for 5 hours. The solution was diluted with
CH.sub.2Cl.sub.2 (50 mL), washed with H.sub.2O (3.times.50 mL) and
brine (2.times.100 mL), dried (Na.sub.2SO.sub.4) and concentrated
to yield the title compound (1.10 g, 88%) as a light yellow oil and
a mixture of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 7.23-7.19 (m, 1H), 7.10-7.06 (m, 1H), 6.86-6.80 (m, 2H),
6.20-6.13 (m, 1H), 5.61-5.79 (m, 1H), 4.68-4.61 (m, 2H), 3.71-3.67
(m, 2H), 3.34-3.26 (m, 1H), 3.01-2.88 (m, 3H), 1.78-1.76 (m, 2H),
1.19-1.17 (m, 6H), 1.06-1.00 (m, 3H).
b)
(E)-3-(3,3-Dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diaze-
pin-7-yl)-N-(3-isopropyl-2-propoxybenzyl)-N-methylacrylamide
[1312] A solution of
N-(3-isopropyl-2-propoxybenzyl)-N-methylacrylamide (0.397 g, 1.47
mmol) in propionitrile (5 mL) and DMF (1 mL) was deoxygenated with
Ar for 20 min. The solution was treated with diisopropylethylamine
(0.40 mL, 2.33 mmol) and
7-bromo-3,3-dimethyl-1,3,4,5-tetrahydro-pyrido[2,3-e][1,4]diazepin-2-one
(0.300 g, 1.11 mmol). The solution was deoxygenated with Ar for 20
min. Pd(OAc).sub.2 (0.024 g, 0.111 mmol) and P(o-tol).sub.3 (0.067
g, 0.222 mmol) were then added and the mixture deoxygenated with Ar
for 20 min. The mixture was heated to reflux for 18 h, then allowed
to cool. The solution was diluted with EtOAc (30 mL) and H.sub.2O
(50 mL). The aqueous layer was extracted with EtOAc (3.times.50
mL). The combined organics were washed with brine (2.times.100 mL),
dried over Na.sub.2SO.sub.4, filtered and concentrated to an orange
oil. Purification by column chromatography (silica gel,
CH.sub.2Cl.sub.2/MeOH, 100 to 95:5) gave the title compound (0.16
g, 31%) as an off-white solid and as a mixture of amide rotamers:
.sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 9.80-9.77 (m, 1H),
8.40-8.35 (m, 1H), 8.01-7.91 (m, 1H), 7.55-7.48 (m, 1H), 7.31-7.20
(m, 2H), 7.10-7.03 (m, 1H), 6.88-6.85 (m, 1H), 4.81-4.66 (m, 2H),
3.90-3.83 (m, 2H), 3.77-3.69 (m, 2H), 3.32-3.25 (m, 1H), 3.12-2.90
(m, 4H), 1.81-1.77 (m, 2H), 1.31-1.28 (m, 6H), 1.19-1.17 (m, 6H),
1.06-1.01 (3H).
c)
(E)-3-(3,3-Dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diaze-
pin-7-yl)-N-(3-isopropyl-2-propoxybenzyl)-N-methylacrylamide
hydrochloride
[1313] A stirring solution of
(E)-3-(3,3-dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepi-
n-7-yl)-N-(3-isopropyl-2-propoxybenzyl)-N-methylacrylamide (0.164
g, 0.352 mmol) in CH.sub.2Cl.sub.2 (4 mL) under N.sub.2 was treated
with anhydrous HCl (0.17 mL of a 2.0 M solution in diethyl ether,
0.34 mmol) After stirring for 18 h, the resulting solid was
collected by filtration, washed with Et.sub.2O (100 mL) and dried
to yield the title compound (0.12 g, 71%) as an off white solid and
as a mixture of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 10.95 (br s, 1H), 10.25 (br s, 2H), 8.67-8.63 (m, 1H),
8.36-8.26 (m, 1H), 7.62-7.54 (m, 1H), 7.39-7.31 (m, 1H), 7.26-7.20
(m, 1H), 7.13-7.05 (m, 1H), 6.90-6.84 (m, 1H), 4.82-4.67 (m, 2H),
4.41-4.36 (m, 2H), 3.77-3.69 (m, 2H), 3.30-3.25 (m, 1H), 3.16-2.89
(m, 3H), 1.82-1.75 (m, 2H), 1.60-1.58 (m, 6H), 1.23-1.13 (m, 6H),
1.06-1.01 (m, 3H); MS (ESI) m/e 465 (M+H).sup.+.
Example 274
Preparation of
(E)-N-(3-Isopropyl-2-propoxybenzyl)-N-methyl-3-(2-oxo-2,3,4,5-tetrahydro--
1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
a)
(E)-N-(3-Isopropyl-2-propoxybenzyl)-N-methyl-3-(2-oxo-2,3,4,5-tetrahydr-
o-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
[1314] A solution of
N-(3-isopropyl-2-propoxybenzyl)-N-methylacrylamide (0.385 g, 1.40
mmol) in propionitrile (5 mL) and DMF (1 mL) was deoxygenated with
Ar for 20 min. The solution was treated with diisopropylethylamine
(0.39 mL, 2.25 mmol) and
7-bromo-1,3,4,5-tetrahydro-pyrido[2,3-e][1,4]diazepin-2-one (0.300
g, 1.07 mmol). The solution was deoxygenated with Ar for 20 min.
Pd(OAc).sub.2 (0.024 g, 0.10 mmol) and P(o-tol).sub.3 (0.065 g,
0.21 mmol) were then added and the solution deoxygenated with Ar
for 20 min. The solution was heated to reflux for 18 h, then
allowed to cool. The solution was diluted with H.sub.2O (30 mL) and
the mixture was washed with EtOAc (3.times.50 mL). The combined
organics were washed with brine (2.times.100 mL), dried
(Na.sub.2SO.sub.4) and concentrated. Purification by column
chromatography (silica gel, CH.sub.2Cl.sub.2/MeOH, 100 to 95:5)
gave the title compound (0.15 g, 33%) as an off-white solid and as
a mixture of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 10.08-10.05 (m, 1H), 8.45-8.39 (m, 1H), 8.03-7.93 (m, 1H),
7.55-7.49 (m, 1H), 7.32-7.20 (m, 2H), 7.13-7.04 (m, 1H), 6.88-6.86
(m, 1H), 4.81-4.66 (m, 2H), 3.91-3.86 (m, 2H), 3.76-3.69 (m, 2H),
3.63-3.60 (m, 2H), 3.30-3.25 (m, 1H), 3.12-2.90 (m, 4H), 1.83-1.75
(m, 2H), 1.24-1.17 (m, 6H), 1.06-1.01 (m, 3H).
b)
(E)-N-(3-Isopropyl-2-propoxybenzyl)-N-methyl-3-(2-oxo-2,3,4,5-tetrahydr-
o-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide hydrochloride
[1315] A stirring solution of
(E)-N-(3-isopropyl-2-propoxybenzyl)-3-(3,3-dimethyl-2-oxo-2,3,4,5-tetrahy-
dro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)-N-methylacrylamide (0.158
g, 0.362 mmol) in CH.sub.2Cl.sub.2 (4 mL) under N.sub.2 was treated
with anhydrous HCl (0.18 mL of a 2.0 M solution in diethyl ether,
0.36 mmol) After stirring for 18 h, the resulting solid was
collected by filtration, washed with Et.sub.2O (100 mL) and dried
to yield the title compound (0.15 g, 91%) as an off white solid and
as a mixture of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 11.10-11.07 (m, 1H), 10.07 (br s, 2H), 8.77-8.72 (m, 1H),
8.33-8.24 (m, 1H), 7.63-7.55 (m, 1H), 7.40-7.31 (m, 1H), 7.26-7.21
(m, 1H), 7.13-7.05 (m, 1H), 6.90-6.83 (m, 1H), 4.83-4.67 (m, 2H),
4.28-4.22 (m, 2H), 3.85-3.69 (m, 4H), 3.30-3.25 (m, 1H), 3.14-2.89
(m, 3H), 1.81-1.75 (m, 2H), 1.20-1.17 (m, 6H), 1.06-1.01 (m, 3H);
MS (ESI) m/e 437 (M+H).sup.+.
Example 275
Preparation of
(S)-(+)-(E)-N-Methyl-N-(3-methylbenzofuran-2-ylmethyl)-3-(10-oxo-2,3,4,9,-
10,10a-hexahydro-1H-3a,8,9-triazabenzo[f]azulen-6-yl)acrylamide
hydrochloride
a)
(S)-(E)-N-Methyl-N-(3-methylbenzofuran-2-ylmethyl)-3-(10-oxo-2,3,4,9,10-
,10a-hexahydro-1H-3a,8,9-triazabenzo[f]azulen-6-yl)acrylamide
[1316] A solution of
N-methyl-N-(3-methylbenzofuran-2-ylmethyl)acrylamide (0.210 g,
0.920 mmol) in propionitrile (3 mL) and DMF (0.65 mL) was
deoxygenated with Ar for 20 min. The solution was treated with
diisopropylethylamine (0.24 mL, 1.4 mmol) and
(S)-6-bromo-1,2,3,4,9,10a-hexahydro-3a,8,9-triazabenzo[f]azulen-10-one
(0.200 g, 0.708 mmol). The solution was deoxygenated with Ar for 20
min. Pd(OAc).sub.2 (0.015 g, 0.070 mmol) and P(o-tol).sub.3 (0.067
g, 0.14 mmol) were then added and the solution was deoxygenated
with Ar for 20 min. The solution was heated to reflux for 18 h,
then allowed to cool. The solution was diluted with
CH.sub.2Cl.sub.2 (50 mL) and was washed with H.sub.2O (3.times.100
mL). The combined organics were washed with brine (2.times.100 mL),
dried (Na.sub.2SO.sub.4) and concentrated. Purification by column
chromatography (silica gel, CH.sub.2Cl.sub.2/MeOH, 98:2) gave the
title compound (0.25 g, 77%) as a glassy yellow solid and as a
mixture of amide rotamers: .sup.1H NMR (300 MHz, CDCl.sub.3)
.delta. 8.74 (s, 1H), 8.60-8.50 (m, 1H), 7.75-7.67 (m, 2H),
7.49-7.48 (m, 1H), 7.42-7.40 (m, 1H), 7.28-7.16 (m, 3H), 4.83-4.71
(m, 2H), 3.99-3.82 (m, 2H), 3.59-2.57 (m, 1H), 3.23-3.08 (m, 3H),
2.89-2.86 (m, 2H), 2.53-2.44 (m, 1H), 2.31-2.30 (m, 3H), 2.04-1.68
(m, 3H).
b)
(S)-(+)-(E)-N-Methyl-N-(3-methylbenzofuran-2-ylmethyl)-3-(10-oxo-2,3,4,-
9,10,10a-hexahydro-1H-3a,8,9-triazabenzo[f]azulen-6-yl)acrylamide
hydrochloride
[1317] A stirring solution of
(S)-(E)-N-methyl-N-(3-methylbenzofuran-2-ylmethyl)-3-(10-oxo-2,3,4,9,10,1-
0a-hexahydro-1H-3a,8,9-triazabenzo[f]azulen-6-yl)acrylamide (0.235
g, 0.545 mmol) in CH.sub.2Cl.sub.2 (5 mL) under N.sub.2 was treated
with anhydrous HCl (0.27 mL of a 2.0 M solution in diethyl ether,
0.54 mmol) After stirring for 18 h, the resulting solid was
collected by filtration, washed with Et.sub.2O (100 mL) and dried
to yield the title compound (0.22 g, 89%) as a yellow solid and as
a mixture of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 12.15 (br s, 1H), 11.30 (br s, 1H), 8.87-8.83 (m, 1H),
8.36-8.31 (m, 1H), 7.63-7.55 (m, 2H), 7.50-7.48 (m, 1H), 7.35-7.22
(m, 3H), 5.07-4.95 (m, 2H), 4.47-4.26 (m, 3H), 3.63 (br s, 2H),
3.20-2.93 (m, 3H), 2.27 (s, 4H), 2.10 (br s, 1H), 1.88 (m, 2H);
[.alpha.].sup.25.sub.D +66.3.degree. (c 0.90, methanol); MS (ESI)
m/e 431 (M+
Example 276
Preparation of
(R)-(-)-(E)-N-Methyl-N-(3-methylbenzofuran-2-ylmethyl)-3-(10-oxo-2,3,4,9,-
10,10a-hexahydro-1H-3a,8,9-triazabenzo[f]azulen-6-yl)acrylamide
hydrochloride
a)
(R)-(E)-N-Methyl-N-(3-methylbenzofuran-2-ylmethyl)-3-(10-oxo-2,3,4,9,10-
,10a-hexahydro-1H-3a,8,9-triazabenzo[f]azulen-6-yl)acrylamide
[1318] A solution of methyl-(3-methylbenzofuran-2-ylmethyl)amine
(0.166 g, 0.953 mmol) and diisopropylethylamine (0.45 mL, 2.59
mmol) in DMF (20 mL) under N.sub.2 was treated sequentially with
(R)-6-bromo-1,2,3,4,9,10a-hexahydro-3a,8,9-triazabenzo[f]azulen-10-one
(0.300 g, 0.866 mmol), 1-hydroxybenzotriazole hydrate (0.128 g,
0.953 mmol) and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide
hydrochloride (0.182 g, 0.953 mmol). After stirring for 18 h, the
reaction mixture was diluted with H.sub.2O (30 mL). The resulting
solids were collected by filtration, washed with Et.sub.2O and
dried to give the title compound (0.93 g, 31%) as a white solid and
as a mixture of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 10.38 (s, 1H), 8.59-8.56 (m, 1H), 8.23-8.21 (m, 1H),
7.58-7.21 (m, 6H), 5.00-4.79 (m, 2H), 3.96-3.92 (m, 1H), 3.55-3.47
(m, 2H), 3.19-2.84 (m, 4H), 2.61-2.59 (m, 1H), 2.26 (m, 4H),
1.76-1.74 (m, 3H).
b)
(R)-(-)-(E)-N-Methyl-N-(3-methylbenzofuran-2-ylmethyl)-3-(10-oxo-2,3,4,-
9,10,10a-hexahydro-1H-3a,8,9-triazabenzo[f]azulen-6-yl)acrylamide
hydrochloride
[1319] A stirring solution of
(R)-(E)-N-methyl-N-(3-methylbenzofuran-2-ylmethyl)-3-(10-oxo-2,3,4,9,10,1-
0a-hexahydro-1H-3a,8,9-triazabenzo[f]azulen-6-yl)acrylamide (0.090
g, 0.20 mmol) in CH.sub.2Cl.sub.2 (3 mL) under N.sub.2 was treated
with anhydrous HCl (0.10 mL of a 2.0 M solution in diethyl ether,
0.20 mmol) After stirring for 18 h, the resulting solid was
collected by filtration, washed with Et.sub.2O (50 mL) and dried to
yield the target compound (0.066 g, 67%) as an off white solid and
as a mixture of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 12.31 (br s, 1H), 11.29 (br s, 1H), 8.85-8.83 (m, 1H),
8.33-8.31 (m, 1H), 7.62-7.56 (m, 2H), 7.451-7.48 (m, 1H), 7.35-7.22
(m, 3H), 5.07-4.81 (m, 2H), 4.51-4.16 (m, 3H), 3.58 (br s, 3H),
3.20-2.94 (m, 3H), 2.27 (m, 3H), 2.10-1.89 (m, 3H);
[.alpha.].sup.25.sub.D-52.4.degree. (c 0.86, methanol); MS (ESI)
m/e 431 (M+H).sup.+.
Example 277
Preparation of
(E)-3-(3,3-Dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepi-
n-7-yl)-N-(2-isobutoxy-3-methoxybenzyl)-N-methylacrylamide
hydrochloride
a)
(E)-3-(3,3-Dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diaze-
pin-7-yl)-N-(2-isobutoxy-3-methoxybenzyl)-N-methylacrylamide
[1320] A solution of
N-(2-isobutoxy-3-methoxybenzyl)-N-methylacrylamide (0.407 g, 1.47
mmol) in propionitrile (5 mL) and DMF (1 mL) was deoxygenated with
Ar for 20 min. The solution was treated with diisopropylethylamine
(0.40 mL, 2.33 mmol) and
7-bromo-3,3-dimethyl-1,3,4,5-tetrahydro-pyrido[2,3-e][1,4]diazepin-2-one
(0.300 g, 1.11 mmol). The solution was deoxygenated with Ar for 20
min. Pd(OAc).sub.2 (0.024 g, 0.11 mmol) and P(o-tol).sub.3 (0.067
g, 0.22 mmol) were then added and the solution was deoxygenated
with Ar for 20 min. The solution was heated to reflux for 18 h,
then allowed to cool. The solution was diluted with EtOAc (30 mL)
and was washed with H.sub.2O (3.times.50 mL). The organic layer was
washed with brine (2.times.50 mL), dried (Na.sub.2SO.sub.4) and
concentrated to an orange oil. Purification by column
chromatography (silica gel, CH.sub.2Cl.sub.2/MeOH, 100 to 98:2)
gave the title compound (0.19 g, 32%) as an off-white solid and as
a mixture of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 9.79-9.77 (m, 1H), 8.40-8.35 (m, 1H), 8.00-7.92 (m, 1H),
7.54-7.48 (m, 1H), 7.29-7.22 (m, 1H), 7.04-6.96 (m, 2H), 6.66-6.63
(m, 1H), 4.79-4.64 (m, 2H), 3.89-3.83 (m, 2H), 3.79 (s, 3H),
3.72-3.67 (m, 2H), 3.11-2.87 (m, 4H), 2.04-1.99 (m, 1H), 1.31-1.29
(m, 6H), 1.00-0.97 (m, 6H).
b)
(E)-3-(3,3-Dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diaze-
pin-7-yl)-N-(2-isobutoxy-3-methoxybenzyl)-N-methylacrylamide
hydrochloride
[1321] A stirring solution of
(E)-3-(3,3-dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepi-
n-7-yl)-N-(2-isobutoxy-3-methoxybenzyl)-N-methylacrylamide (0.196
g, 0.426 mmol) in CH.sub.2Cl.sub.2 (4 mL) under N.sub.2 was treated
with anhydrous HCl (0.21 mL of a 2.0 M solution in diethyl ether,
0.42 mmol) After stirring for 7 h, the resulting solid was
collected by filtration, washed with Et.sub.2O (100 mL) and dried
to yield the title compound (0.10 g, 47%) as an off white solid and
as a mixture of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 10.93-10.92 (m, 1H), 10.51 (br s, 2H), 8.66-8.62 (m, 1H),
8.40-8.32 (m, 1H), 7.60-7.53 (m, 1H), 7.38-7.33 (m, 1H), 7.05-6.94
(m, 2H), 6.68-6.61 (m, 1H), 4.80-4.65 (m, 2H), 4.42-4.37 (m, 2H),
3.79 (s, 3H), 3.72-3.68 (m, 2H), 3.12-2.86 (m, 3H), 2.04-1.97 (m,
1H), 1.63-1.61 (m, 6H), 1.00-0.97 (m, 6H); MS (ESI) m/e 467
(M+H).sup.+.
Example 278
Preparation of
(E)-3-(6-amino-pyridin-3-yl)-N-(3-chloro-4-fluoro-benzo[b]thiophen-2-Ylme-
thyl)-N-methylacrylamide hydrochloride
a) 3-chloro-4-fluoro-benzo[b]thiophene-2-carbonyl chloride
[1322] A mixture of 3-(2-fluoro-phenyl)acrylic acid (15.0 g, 90.3
mmol), SOCl.sub.2 (40 mL, 542 mmol) and pyridine (0.72 mL, 9.00
mmol) in chlorobenzene (90 mL) was heated to reflux for 3 d. The
mixture was cooled to room temperature and concentrated. The
residue was triturated with hexanes to give the title compound
(5.46 g, 26%) as a yellow solid: .sup.1H NMR (500 MHz, CDCl.sub.3)
.delta. 7.63 (dd, J=8.2, 0.8 Hz, 1H), 7.56 (ddd, J=8.0, 8.0, 4.5
Hz, 1H), 7.16 (ddd, J=11.2, 7.9, 0.8 Hz, 1H).
b) (3-chloro-4-fluoro-benzo[b]thiophen-2-yl)methanol
[1323] To an ice-cold suspension of
3-chloro-4-fluoro-benzo[b]thiophene-2-carbonyl chloride (5.46 g,
23.6 mmol) in THF (120 mL) was added lithium aluminum hydride (11.8
mL of a 1.0 M solution in THF, 11.8 mmol) dropwise. The mixture was
stirred for 2 h then quenched with NaOH (0.35 N solution in
H.sub.2O). The mixture was diluted with Et.sub.2O and the solution
filtered. The filtrate was dried (Na.sub.2SO.sub.4) and
concentrated. Purification by flash column chromatography (silica
gel, hexanes/EtOAc, 8:2) gave the title compound (4.52 g, 96%) as
an off-white solid: .sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 7.57
(d, J=8.1 Hz, 1H), 7.31 (ddd, J=8.0, 8.0, 4.7 Hz, 1H), 7.06 (dd,
J=11.3, 8.0 Hz, 1H), 4.97 (d, J=6.2 Hz, 2H), 2.04 (t, J=6.2 Hz,
1H).
c) 3-chloro-4-fluoro-benzo[b]thiophene-2-carbaldehyde
[1324] A suspension of
(3-chloro-4-fluoro-benzo[b]thiophen-2-yl)methanol (1.00 g, 4.63
mmol) and MnO.sub.2 (3.10 g, 35.2 mmol) in benzene (50 mL) was
stirred at room temperature overnight. The solution was filtered
through diatamaceous earth and the was filtrate was concentrated to
give the title compound (880 mg, 87%) as an off-white solid:
.sup.1H NMR (500 MHz, CDCl.sub.3) .delta. 10.32 (s, 1H), 7.63 (dd,
J=8.2, 0.4 Hz, 1H), 7.50 (ddd, J=8.1, 8.1, 4.7 Hz, 1H), 7.13 (ddd,
J=11.0, 7.9, 0.4 Hz, 1H).
d) (3-chloro-4-fluoro-benzo[1)]thiophen-2-ylmethyl)methylamine
[1325] A solution of
3-chloro-4-fluoro-benzo[b]thiophene-2-carbaldehyde (880 mg, 4.04
mmol) in CH.sub.3NH.sub.2 (20 mL of a 2.0 M solution in MeOH, 40
mmol) was stirred at room temperature overnight. The mixture was
concentrated. The residue was dissolved in EtOH (30 mL), and after
cooling in an ice bath, NaBH.sub.4 (153 mg, 4.04 mmol) was added.
The mixture was slowly warmed to room temperature and then stirred
overnight. The mixture was concentrated. The residue was taken up
in NaOH (30 mL) and the mixture was extracted with Et.sub.2O
(3.times.). The combined organics were washed with satd NaCl, dried
(Na.sub.2SO.sub.4) and concentrated. Purification by column
chromatography (silica gel, 95:5 CH.sub.2Cl.sub.2/MeOH) gave the
title compound (443 mg, 48%) as a yellow oil: .sup.1H NMR (300 MHz,
CDCl.sub.3) .delta. 7.54 (dd, J=8.0, 0.6 Hz, 1H), 7.27 (ddd, J=8.0,
8.0, 4.6 Hz, 1H), 7.03 (ddd, J=11.4, 8.0, 0.6 Hz, 1H), 4.05 (s,
2H), 2.53 (s, 3H), 1.55 (s, 1H).
e)
(E)-3-(6-amino-pyridin-3-yl)-N-(3-chloro-4-fluoro-benzo[b]thiophen-2-yl-
methyl)-N-methylacrylamide
[1326] To a solution of 3-(6-amino-pyridin-3-yl)acrylic acid
trifluoroacetic acid salt (487 mg, 1.75 mmol) in DMF (10 mL) was
added 3-chloro-4-fluoro-benzo[b]thiophen-2-ylmethyl)methylamine
(440 mg, 1.92 mmol), EDC (368 mg, 1.92 mmol), HOBt (260 mg, 1.92
mmol), and DIEA (1.0 mL, 6.1 mmol). The mixture was stirred at room
temperature overnight. The mixture was diluted with H.sub.2O and
the solid was collected by filtration. Purification by
semi-preparative HPLC (Phenomenex Luna C18 (2) 10.mu., 250.times.21
mm, CH.sub.3CN/H.sub.2O/0.05% TFA) gave a solid. The solid was
partitioned between EtOAc and satd NaHCO.sub.3. The organic layer
was concentrated to give the title compound (257 mg, 39%) as a
white solid: MS (ESI) m/e 376 (M+H).sup.+.
f)
(E)-3-(6-amino-pyridin-3-yl)-N-(3-chloro-4-fluoro-benzo[b]thiophen-2-yl-
methyl)-N-methylacrylamide hydrochloride
[1327] A solution of
(E)-3-(6-amino-pyridin-3-yl)-N-(3-chloro-4-fluoro-benzo[b]thiophen-2-ylme-
thyl)-N-methylacrylamide (257 mg, 0.68 mmol) in CH.sub.2Cl.sub.2
(10 mL) was treated with anhydrous HCl (0.68 mL of a 1.0 M solution
in Et.sub.2O, 0.68 mmol). The mixture was stirred overnight at room
temperature and then diluted with Et.sub.2O. The resulting solid
was collected by filtration and then dried under vacuum at
50.degree. C. for 2 d to give the title compound (282 mg, 98%) as
an off-white solid and as a mixture of amide rotamers: .sup.1H NMR
(300 MHz, DMSO-d.sub.6) .delta. 8.43-8.33 (m, 4H), 7.87-7.82 (m,
1H), 7.55-7.20 (m, 4H), 7.04-7.00 (m, 1H), 5.15-4.88 (m, 2H), 3.54
(br s, 1H), 3.22-2.97 (m, 3H); MS (ESI) m/e 376 (M+H).sup.+.
Example 279
Preparation of
(E)-3-(6-amino-pyridin-3-yl)-N-(3-chloro-7-fluoro-benzo[b]thiophen-2-ylme-
thyl)-N-methylacryl amide hydrochloride
a) 3-chloro-7-fluoro-benzo[b]thiophene-2-carbonyl chloride
[1328] A mixture of 3-(3-fluoro-phenyl)acrylic acid (10.2 g, 61.4
mmol), SOCl.sub.2 (22 mL, 301 mmol) and pyridine (0.50 mL, 6.00
mmol) in chlorobenzene (60 mL) was heated to reflux for 3 d. The
mixture was cooled to room temperature and concentrated. The
residue was triturated with hexanes to give the title compound
(7.81 g, 55%) as a yellow solid and as a 6:1 mixture of the
5-fluoro and 7-fluoro isomers. The mixture was used directly in the
next step without further purification.
b) (3-chloro-7-fluoro-benzo[b]thiophen-2-yl)methanol
[1329] To an ice-cold suspension of a 6:1 mixture of
3-chloro-5-fluoro-benzo[b]thiophene-2-carbonyl chloride and
3-chloro-7-fluoro-benzo[b]thiophene-2-carbonyl chloride (5.46 g,
23.6 mmol) in THF (120 mL) was added lithium aluminum hydride (11.8
mL of a 1.0 M solution in THF, 11.8 mmol) dropwise. The mixture was
stirred for 4 h then quenched with NaOH (0.35 N solution in
H.sub.2O). The mixture was diluted with Et.sub.2O and the solution
filtered. The filtrate was dried (Na.sub.2SO.sub.4) and
concentrated. Purification by flash column chromatography (silica
gel, hexanes/EtOAc, 9:1 to hexanes/EtOAc 8:2) gave the title
compound (600 mg, 4% (2 steps), 7-fluoro isomer) as a light, yellow
solid: .sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 7.59 (d, J=8.0 Hz,
1H), 7.41 (ddd, J=8.0, 8.0, 4.9 Hz, 1H), 7.10 (dd, J=9.1, 9.1 Hz,
1H), 5.00 (d, J=6.2 Hz, 2H), 2.04 (t, J=6.5 Hz, 1H).
c) 3-chloro-7-fluoro-benzo[b]thiophene-2-carbaldehyde
[1330] A suspension of
(3-chloro-7-fluoro-benzo[b]thiophen-2-yl)methanol (600 g, 2.78
mmol) and MnO.sub.2 (1.69 g, 19.5 mmol) in benzene (25 mL) was
stirred at room temperature for 2 d. The solution was filtered
through diatomaceous earth and the filtrate concentrated to give
the title compound (610 mg, quantitative) as a light, yellow solid:
.sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 10.35 (s, 1H), 7.83 (d,
J=8.1 Hz, 1H), 7.51 (ddd, J=8.0, 8.0, 4.8 Hz, 1H), 7.32-7.26 (m,
1H).
d) (3-chloro-7-fluoro-benzo[b]thiophen-2-ylmethyl)methylamine
[1331] A solution of
3-chloro-7-fluoro-benzo[b]thiophene-2-carbaldehyde (610 mg, 2.78
mmol) in CH.sub.3NH.sub.2 (20 mL of a 2.0 M solution in MeOH, 40
mmol) was stirred at room temperature overnight. The mixture was
concentrated. The residue was dissolved in EtOH (20 mL), and after
cooling in an ice bath, NaBH.sub.4 (159 mg, 4.20 mmol) was added.
The mixture was slowly warmed to room temperature and then stirred
overnight. The mixture was concentrated. The residue was taken up
in NaOH (20 mL) and the mixture extracted with Et.sub.2O
(3.times.). The combined organics were washed with satd NaCl, dried
(Na.sub.2SO.sub.4) and concentrated. Purification by column
chromatography (silica gel, 95:5 CH.sub.2Cl.sub.2/MeOH) gave the
title compound (460 g, 70%) as a brown oil: .sup.1H NMR (300 MHz,
CDCl.sub.3) .delta. 7.56 (d, J=8.0 Hz, 1H), 7.38 (ddd, J=7.9, 7.9,
4.9 Hz, 1H), 7.06 (dd, J=8.8, 8.8 Hz, 1H), 4.09 (s, 2H), 2.53 (s,
3H), 1.55 (s, 1H).
e)
(E)-3-(6-amino-pyridin-3-yl)-N-(3-chloro-7-fluoro-benzo[b]thiophen-2-yl-
methyl)-N-methylacrylamide
[1332] To a solution of 3-(6-amino-pyridin-3-yl)acrylic acid
trifluoroacetic acid salt (509 mg, 1.83 mmol) in DMF (15 mL) was
added 3-chloro-7-fluoro-benzo[b]thiophen-2-ylmethyl)methylamine
(460 mg, 2.01 mmol), EDC (385 mg, 2.01 mmol), HOBt (272 mg, 2.01
mmol) and DIEA (0.9 mL, 5.5 mmol). The mixture was stirred at room
temperature overnight. The mixture was diluted with H.sub.2O and
the solid collected by filtration. Purification by semi-preparative
HPLC (Phenomenex Luna C18(2) 10.mu. 250 21.20 mm,
CH.sub.3CN/H.sub.2O/0.05% TFA) gave a solid. The solid was
partitioned between EtOAc and satd NaHCO.sub.3. The organic layer
was concentrated to give to give a pale yellow solid. The solid was
dissolved in a minimum amount of hot MeCN. The precipitate was
collected by filtration to give the title compound (105 mg, 15%) as
a white solid: MS (ESI) m/e 376 (M+H).sup.+.
f)
(E)-3-(6-amino-pyridin-3-yl)-N-(3-chloro-7-fluoro-benzo[b]thiophen-2-yl-
methyl)-N-methylacrylamide hydrochloride
[1333] A suspension of
(E)-3-(6-amino-pyridin-3-yl)-N-(3-chloro-7-fluoro-benzo[b]thiophen-2-ylme-
thyl)-N-methylacrylamide (105 mg, 0.28 mmol) in CH.sub.2Cl.sub.2
(10 mL) was treated with anhydrous HCl (0.28 mL of a 1.0 M solution
in Et.sub.2O, 0.28 mmol) and then the mixture was stirred at room
temperature overnight. The mixture was diluted with Et.sub.2O. The
resulting solid was collected by filtration and dried under vacuum
at 50.degree. C. overnight to give the title compound (111 mg, 96%)
as an off-white solid and as a mixture of amide rotamers: .sup.1H
NMR (300 MHz, DMSO-d.sub.6) .delta. 8.43-8.33 (m, 4H), 7.67-7.52
(m, 3H), 7.41-7.35 (m, 1H), 7.25-7.19 (m, 1H), 7.04-7.01 (m, 1H),
5.21-4.92 (m, 2H), 3.63 (br s, 1H), 3.23-2.98 (m, 3H); MS (ESI) m/e
376 (M+H).sup.+.
Example 280
Preparation of
(E)-6-{2-[methyl-(3-methyl-benzo[b]thiophen-2-ylmethyl)-carbamoyl]-vinyl}-
-2-oxo-1,2-dihydro-[1,8]naphthyridine-3-carboxylic acid sodium
salt
a) 6-Bromo-2-oxo-1,2-dihydro-[1,8]naphthyridine-3-carboxylic acid
ethyl ester
[1334] A mixture of 2-amino-5-bromo-pyridine-3-carbaldehyde (4.00
g, 14.2 mmol), diethyl malonate (21.6 mL, 142 mmol) and piperidine
(7.00 mL, 71.0 mmol) in EtOH (70 mL) was heated to reflux
overnight. The mixture was cooled to room temperature and the solid
was collected by filtration to give the title compound (2.41 g,
57%) as an off-white solid: .sup.1H NMR (300 MHz, CDCl.sub.3)
.delta. 12.65 (s, 1H), 8.70 (d, J=2.4 Hz, 1H), 8.56 (d, J=2.4 Hz,
1H), 8.45 (s, 1H), 4.29 (q, J=7.1 Hz, 2H), 1.30 (t, J=7.1 Hz,
3H).
b)
(E)-6-{2-[methyl-(3-methyl-benzo[b]thiophen-2-ylmethyl)carbamoyl]vinyl}-
-2-oxo-1,2-dihydro-[1,8]naphthyridine-3-carboxylic acid ethyl
ester
[1335] A suspension of
N-methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)acrylamide (500
mg, 2.04 mmol),
6-bromo-2-oxo-1,2-dihydro-[1,8]naphthyridine-3-carboxylic acid
ethyl ester (665 mg, 2.24 mmol), (o-tol).sub.3P (135 mg, 0.44 mmol)
and DIEA (0.4 mL, 2.45 mmol) in EtCN (10 mL) and DMF (10 mL) was
deoxygenated with argon for 30 min. Pd(OAc).sub.2 (50 mg, 0.22
mmol) was added, the mixture was deoxygenated with argon for 20 min
and then heated to reflux overnight. The mixture was cooled to room
temperature and concentrated. The residue was partitioned between
CH.sub.2Cl.sub.2 and H.sub.2O. The organic layer was washed with
satd NaCl, dried (Na.sub.2SO.sub.4) and concentrated. Purification
by column chromatography (silica gel, 89:10:1
CH.sub.2Cl.sub.2/MeOH/conc NH.sub.4OH) gave the title compound (530
mg, 56%) as a yellow solid and as a mixture of amide rotamers:
.sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 12.63 (s, 1H), 8.98 (d,
J=2.1 Hz, 1H), 8.67 (s, 1H), 8.44-8.42 (m, 1H), 7.88 (d, J=7.6 Hz,
1H), 7.75-7.52 (m, 2H), 7.43-7.31 (m, 3H), 5.14-4.91 (m, 2H),
4.32-4.25 (m, 2H), 3.18-2.96 (m, 3H), 2.43 (s, 3H), 1.33-1.27 (m,
3H); MS (ESI) m/e 462 (M+H).sup.+.
c)
(E)-6-{2-[methyl-(3-methyl-benzo[b]thiophen-2-ylmethyl)carbamoyl]vinyl}-
-2-oxo-1,2-dihydro-[1,8]naphthyridine-3-carboxylic acid sodium
salt
[1336] To a suspension of
(E)-6-{2[-methyl-(3-methyl-benzo[b]thiophen-2-ylmethyl)carbamoyl]vinyl}-2-
-oxo-1,2-dihydro-[1,8]naphthyridine-3-carboxylic acid ethyl ester
(349 mg, 0.76 mmol) in MeOH (10 mL) and CH.sub.2Cl.sub.2 (5 mL) was
added NaOH (1.53 mL of a 0.995 M solution in H.sub.2O, 1.53 mmol)
dropwise. The mixture was stirred at room temperature overnight.
The solid was collected by filtration and then dried under vacuum
at 50.degree. C. for 2 d. Trituration with 5:1 MeCN/H.sub.2O gave
the title compound (85 mg, 25%) as an off-white solid and as a
mixture of amide rotamers: .sup.1H NMR (300 MHz,
DMSO-d.sub.6+TFA-d) .delta. 9.15 (s, 1H), 8.85 (s, 2H), 7.88 (d,
J=7.5 Hz, 1H), 7.76-7.58 (m, 2H), 7.46-7.34 (m, 3H), 5.15-4.92 (m,
2H), 3.20-2.98 (m, 3H), 2.44 (s, 3H); MS (ESI) m/e 434
(M-Na+2H).sup.+.
Example 281
Preparation of
(E)-spiro[2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-3,1'-cyc-
lopentane]-7-yl-N-(3-methyl-benzofuran-2-ylmethyl)-N-methylacrylamide
hydrochloride
a)
1-[(2-amino-5-bromo-pyridin-3-ylmethyl)amino]cyclopentanecarboxylic
acid methyl ester
[1337] To an ice-cold suspension of
5-bromo-3-bromomethyl-pyridin-2-ylamine hydrobromide (8.64 g, 24.9
mmol) and 1-amino-cyclopentanecarboxylic acid methyl ester (3.56 g,
24.9 mmol) in DMF (100 mL) was added Et.sub.3N (5.30 mL, 37.4 mmol)
slowly. The mixture was stirred for 2 h and then diluted with
H.sub.2O. The solid was collected by filtration to give the title
compound (3.55 g, 43%) as a yellow solid: .sup.1H NMR (300 MHz,
CDCl.sub.3) .delta. 8.02 (d, J=2.3 Hz, 1H), 7.37 (d, J=2.3 Hz, 1H),
5.49 (s, 2H), 3.76 (s, 3H), 3.52 (s, 2H), 2.12-2.05 (m, 2H), 1.79
(br s, 7H).
b)
spiro[7-bromo-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-3,-
1'-cyclopentane]
[1338] A solution of
1-[(2-amino-5-bromo-pyridin-3-ylmethyl)amino]cyclopentanecarboxylic
acid methyl ester (3.45 g, 10.5 mmol) in DMSO (100 mL) was treated
with NaH (60% dispersion in mineral oil, 420 mg, 10.5 mmol) and
stirred at room temperature for 2 d. The mixture was diluted with
H.sub.2O and the solid was collected by filtration. The solid was
triturated with CHCl.sub.3/MeOH to give the title compound (1.79 g,
58%) as an off-white solid: .sup.1H NMR (300 MHz, CDCl.sub.3)
.delta. 8.23 (d, J=2.3 Hz, 1H), 8.13 (br s, 1H), 7.51 (d, J=2.0 Hz,
1H), 3.92 (s, 2H), 2.31-2.22 (m, 2H), 1.86-1.73 (m, 7H).
c)
(E)-spiro[2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-3,1'-c-
yclopentane]-7-yl-N-(3-methyl-benzofuran-2-ylmethyl)-N-methylacrylamide
[1339] A mixture of
spiro[7-bromo-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-3,1'-
-cyclopentane] (456 mg, 1.54 mmol),
N-methyl-N-(3-methyl-benzofuran-2-ylmethyl)acrylamide (320 mg, 1.40
mmol), (o-tol).sub.3P (137 mg, 0.45 mmol) and DIEA (0.35 mL, 2.10
mmol) in DMF (10 mL) was deoxygenated with argon for 30 min.
Pd(OAc).sub.2 (50 mg, 0.22 mmol) was added, the mixture was
deoxygenated with argon again and then heated to 100.degree. C.
overnight. The mixture was cooled to room temperature and
partitioned between CH.sub.2Cl.sub.2/H.sub.2O. The organic layer
was washed with H.sub.2O and satd NaCl, dried (Na.sub.2SO.sub.4)
and concentrated. Purification by column chromatography (silica
gel, 95:5 CH.sub.2Cl.sub.2/MeOH) gave a light yellow solid. The
solid was suspended in MeOH and the mixture sonicated. The solid
was collected by filtration to give the title compound (354 mg,
57%) as an off-white solid and as a mixture of amide rotamers:
.sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 8.84 (m, 1H), 8.45-8.42
(m, 1H), 7.66 (d, J=15.4 Hz, 1H), 7.55-7.48 (m, 2H), 7.41 (d, J=8.0
Hz, 1H), 7.28-7.21 (m, 2H), 7.15-6.84 (m, 1H), 4.83-4.72 (m, 2H),
3.96 (s, 2H), 3.23-3.09 (m, 3H), 2.33-2.25 (m, 5H), 1.84-1.74 (m,
7H).
d)
(E)-spiro[2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-3,1'-c-
yclopentane]-7-yl-N-(3-methyl-benzofuran-2-ylmethyl)-N-methylacrylamide
hydrochloride
[1340] A suspension of
(E)-spiro[2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-3,1'-cyc-
lopentane]-7-yl-N-(3-methyl-benzofuran-2-ylmethyl)-N-methylacrylamide
(354 mg, 0.80 mmol) in CH.sub.2Cl.sub.2 (15 mL) was treated with
anhydrous HCl (0.80 mL of a 1.0 M solution in Et.sub.2O, 0.80 mmol)
and the mixture was stirred at room temperature overnight. The
mixture was diluted with Et.sub.2O and then the solid was collected
by filtration to give the title compound (305 mg, 80%) as an
off-white solid and as a mixture of amide rotamers: .sup.1H NMR
(300 MHz, DMSO-d.sub.6) .delta. 11.02 (s, 1H), 10.6 (s, 2H), 8.73
(d, J=8.6 Hz, 1H), 8.38 (s, 1H), 7.66-7.22 (m, 6H), 5.02-4.81 (m,
2H), 4.29 (s, 2H), 3.21-2.93 (m, 3H), 2.27 (s, 3H), 2.20-2.16 (m,
2H), 1.90-1.76 (m, 4H), 1.62-1.60 (2H); MS (ESI) m/e 445
(M+H).sup.+.
Example 282
Preparation of
(E)-spiro[2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-3,1'-cyc-
lopentane]-7-yl-N-(3-methoxy-2-propoxybenzyl)-N-methylacrylamide
hydrochloride
a)
(E)-spiro[2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-3,1'-c-
yclopentane]-7-yl-N-(3-methoxy-2-propoxybenzyl)-N-methylacrylamide
[1341] A mixture of
spiro[7-bromo-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-3,1'-
-cyclopentane] (450 mg, 1.52 mmol),
N-(3-methoxy-2-propoxybenzyl)-N-methylacrylamide (400 mg, 1.52
mmol), (o-tol).sub.3P (131 mg, 0.43 mmol) and DIEA (0.30 mL, 1.82
mmol) in DMF (10 mL) was deoxygenated with argon for 30 min.
Pd(OAc).sub.2 (50 mg, 0.22 mmol) was added, the mixture was
deoxygenated with argon and then heated to 100.degree. C.
overnight. The mixture was cooled to room temperature and
partitioned between CH.sub.2Cl.sub.2/H.sub.2O. The organic layer
was washed with H.sub.2O and satd NaCl, dried (Na.sub.2SO.sub.4)
and concentrated. Purification by column chromatography (silica
gel, CH.sub.2Cl.sub.2 to 96:4 CH.sub.2Cl.sub.2/MeOH) gave a light
yellow solid. The solid was suspended in MeOH and the mixture
sonicated. The solid was collected by filtration to give the title
compound (333 mg, 46%) as an off-white solid and as a mixture of
amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
8.40-8.28 (m, 2H), 7.69-7.61 (m, 1H), 7.54-7.46 (m, 1H), 7.07-6.71
(m, 4H), 4.81-7.41 (m, 2H), 4.00-3.86 (m, 7H), 3.09 (s, 3H),
2.33-2.26 (m, 2H), 1.84-1.67 (m, 9H), 1.04 (t, J=7.4 Hz, 3H).
b)
(E)-spiro[2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-3,1'-c-
yclopentane]-7-yl-N-(3-methoxy-2-propoxybenzyl)-N-methylacrylamide
hydrochloride
[1342] A suspension of
(E)-spiro[2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-3,1'-cyc-
lopentane]-7-yl-N-(3-methoxy-2-propoxybenzyl)-N-methylacrylamide
hydrochloride (333 mg, 0.70 mmol) in CH.sub.2Cl.sub.2 (10 mL) was
treated with anhydrous HCl (0.70 mL of a 1.0 M solution in
Et.sub.2O, 0.70 mmol) and the mixture was stirred at room
temperature overnight. The mixture was diluted with Et.sub.2O. The
resulting solid was collected by filtration and dried under vacuum
at 50.degree. C. overnight to give the title compound (293 mg, 81%)
as an off-white solid and as a mixture of amide rotamers: .sup.1H
NMR (300 MHz, DMSO-d.sub.6) .delta. 11.00 (s, 1H), 10.58 (s, 2H),
8.71 (d, J=12.0 Hz, 1H), 8.38-8.31 (m, 1H), 7.08-7.54 (m, 1H),
7.41-7.35 (m, 1H), 7.08-6.95 (m, 2H), 6.69-6.63 (m, 1H), 4.81-4.65
(m, 2H), 4.29-4.26 (m, 2H), 3.92-3.85 (m, 2H), 3.80 (s, 3H),
3.12-2.87 (m, 3H), 2.21-2.10 (m, 2H), 1.90-1.58 (m, 8H), 1.01-0.94
(m, 3H); MS (ESI) m/e 479 (M+Hr.
Example 283
Preparation of
(E)-N-(3-ethyl-benzofuran-2-ylmethyl)-N-methyl-3-(2-oxo-2,3,4,5-tetrahydr-
o-1H-pyrido[2,3,-e][1,4]diazepin-7-yl)acrylamide hydrochloride
a) 1-But-2-enyloxy-iodobenzene
[1343] An ice-cold solution of 2-iodophenol (10.0 g, 45.4 mmol) in
DMF (100 mL) was added dropwise to a solution of NaH (2.16 g, 90.8
mmol) in DMF at 0.degree. C. Crotylbromide (7.97 g, 59.0 mmol) was
then added. The mixture was warmed to room temperature and stirred
overnight. The reaction was quenched with water (50 mL) and the
mixture was extracted with CH.sub.2Cl.sub.2 (3.times.). The
combined organics were washed with brine and dried over
Na.sub.2SO.sub.4 to give the title compound (12.2 g, 99%) as a
yellow oil: .sup.1H NMR (500 MHz, DMSO-d.sub.6) .delta. 7.76 (dd,
J=7.8, 1.5 Hz, 1H), 7.27-7.22 (m, 1H), 6.80 (dd, J=8.4, 1.2 Hz,
1H), 6.70-6.65 (m, 1H), 5.95-5.80 (m, 1H), 5.75-5.65 (m, 1H),
4.55-4.45 (m, 2H), 1.76-1.70 (m, 3H); ESI MS m/z 275
(M+H).sup.+.
b) 3-Ethyl-benzofuran
[1344] To a solution of 1-but-2-enyloxy-iodobenzene (7.60 g, 27.7
mmol) in DMF (46 mL) was added n-Bu.sub.4NCl (8.46 g, 30.4 mmol),
Pd(OAc).sub.2 (0.338 g, 1.30 mmol), Na.sub.2CO.sub.3 (6.01 g, 56.7
mmol) and NaOAc (2.77 g, 27.0 mmol). The mixture was heated to
reflux under nitrogen atmosphere overnight. The mixture was diluted
with EtOAc and washed with water. The combined organics were washed
with brine and dried over Na.sub.2SO.sub.4. Purification by column
chromatography (silica gel, hexanes) gave the title compound (1.74
g, 43%) as a yellow oil: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 7.75 (s, 1H), 7.63-7.61 (m, 1H), 7.55 (t, J=6.6 Hz, 1H),
7.34-7.23 (m, 2H), 2.71-2.63 (m, 2H), 1.28 (t, J=7.5 Hz, 3H); ESI
MS m/z 147 (M+H).sup.+.
c) 3-Ethyl-bezofuran-2-carbadehyde
[1345] To a solution of 3-ethyl-benzofuran (1.6 g, 11 mmol) in THF
(30 mL) cooled to -40.degree. C. was added n-butyllithium (10.8 mL
of a 2.5 M solution in hexane, 27.2 mmol). The mixture was stirred
for 15 minutes then DMF (2.78 g, 38.1 mmol) was added. The mixture
slowly warmed to room temperature and was stirred overnight under
nitrogen atmosphere. The reaction was quenched with saturated
NH.sub.4Cl and the resulting mixture was extracted with EtOAc
(3.times.). The combined organics were washed with water and brine,
dried and concentrated. Purification by column chromatography
(silica gel, hexane/EtOAc, 5:1) gave the title compound (1.24 g,
65%) as a yellow oil: .sup.1H NMR (500 MHz, DMSO-d.sub.6) .delta.
9.98 (s, 1H), 6.88-6.65 (m, 1H), 6.54 (d, J=0.5 Hz, 2H), 6.41-6.20
(m, 1H), 2.11 (d, J=7.5 Hz, 2H), 0.375 (t, J=7.5 Hz, 3H); ESI MS
m/z 175 (M+H).sup.+.
d) (3-Ethyl-benzofuran-2-ylmethyl)methylamine
[1346] 3-Ethyl-benzofuran-2-carbaldehyde (1.16 g, 6.65 mmol) was
added to a solution of methylamine (26 mL of a 2M solution in MeOH,
52 mmol) and the resulting mixture was stirred overnight. The
mixture was concentrated under reduced pressure. The residue was
taken up in ethanol (20 mL) and then cooled in an ice-bath.
NaBH.sub.4 (370 mg, 9.90 mmol) was added in one portion. The
mixture was concentrated under reduced pressure and the residue
taken up in 1 M NaOH. The mixture was extracted with Et.sub.2O
(3.times.). The combined organics were washed with brine, dried and
concentrated under reduced pressure to give the title compound
(1.12 g, 89%) as a yellow oil: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 7.58 (dd, J=8.4, 6.6 Hz, 1H), 7.46 (d, J=7.2 Hz, 1H),
7.30-7.25 (m, 2H), 3.75 (s, 2H), 2.68 (t, J=7.5 Hz, 2H), 2.26 (s,
3H), 2.05 (br s, 1H), 1.21 (t, J=7.5 Hz, 3H); ESI MS m/z 190
(M+H).sup.+.
e)
(E)-N-(3-ethyl-benzofuran-2-ylmethyl)-N-methyl-3-(2-oxo-2,3,4,5-tetrahy-
dro-1H-pyrido[2,3,-e][1,4]diazepin-7-yl)acrylamide
[1347] A solution of (3-ethyl-benzofuran-2-ylmethyl)methylamine
(185 mg, 0.979 mmol) and (i-Pr).sub.2EtN (0.427 mL, 2.44 mmol) in
DMF (25 mL) was treated successively with
3-(2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylic
acid hydrochloride (250 mg, 0.8161=01), HOBt (115 mg, 0.856 mmol),
and EDC (316 mg, 2.44 mmol). After stirring overnight at room
temperature, the mixture was diluted with water and then extracted
with EtOAc (3.times.). The combined organics were washed with brine
and dried, filtered and concentrated in vacuo. Purification by
column chromatography (silica gel, CH.sub.2Cl.sub.2/CH.sub.3OH,
40:2 to 35:2) gave the title compound (125 mg, 37%) as a yellow
solid: ESI MS m/z 405 (M+H).sup.+.
f)
(E)-N-(3-ethyl-benzofuran-2-ylmethyl)-N-methyl-3-(2-oxo-2,3,4,5-tetrahy-
dro-1H-pyrido[2,3,-e][1,4]diazepin-7-yl)acrylamide
hydrochloride
[1348] A suspension of
(E)-N-(3-ethyl-benzofuran-2-ylmethyl)-N-methyl-3-(2-oxo-2,3,4,5-tetrahydr-
o-1H-pyrido[2,3,-e][1,4]diazepin-7-yl)acrylamide (100 mg, 0.247
mmol) in CH.sub.2Cl.sub.2 (3 mL) and CH.sub.3OH (0.5 mL) was
treated with anhydrous HCl (0.123 mL of a 2M solution in Et.sub.2O,
0.247 mmol). After stirring for 1 h, the mixture was diluted with
Et.sub.2O (3 mL) and stirred for 10 minutes. The solid was isolated
by filtration, washed with Et.sub.2O and dried under vacuum at
50.degree. C. overnight to give the title compound (81.0 mg, 81%)
as an off-white solid and as a mixture of amide rotamers: .sup.1H
NMR (500 MHz, DMSO-d.sub.6) .delta. 10.0 (br s, 2H), 8.82-8.75 (m,
1H), 8.33-8.27 (m, 1H), 7.68-7.55 (m, 3H), 7.50 (t, J=7.5 Hz, 1H),
7.33-7.24 (m, 3H), 5.01-4.81 (m, 2H), 4.26 (s, 2H), 3.84 (s, 2H),
3.20-2.92 (m, 3H), 2.78-2.74 (m, 2H), 1.23-1.19 (m, 3H); ESI MS m/z
405 (M+H).sup.+.
Example 284
Preparation of (E)-3-(3,3-Dimethyl-2-oxo-2,3,4,5-tetrahydro
1H-pyrido[2,3-e][1,4]dizepin-7-yl)-N-methyl-N-(3-propyl-benzofuran-2-ylme-
thyl)acrylamide hydrochloride
a) 1-Iodo-2-pent-2-enyloxy-benzene
[1349] An ice-cold solution of 2-iodophenol (6.00 g, 272 mmol) in
DMF (100 mL) was added dropwise to a solution of NaH (1.30 g, 54.4
mmol) in DMF. 1-Bromo-pent-2-ene (4.87 g, 327 mmol) was then added.
The mixture slowly warmed to room temperature overnight. The
reaction was quenched with water (50 mL) and the mixture was
extracted with CH.sub.2Cl.sub.2 (3.times.). The combined organics
were washed with brine and dried over Na.sub.2SO.sub.4 to give the
title compound (8.50 g, 99%) as a yellow oil: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 7.75 (dd, J=7.5, 1.2, Hz, 1H), 7.36-7.30 (m,
1H), 6.98 (d, J=8.1 Hz, 1H), 6.76-6.71 (m, 1H), 6.01-5.89 (m, 1H),
5.67 (t, J=5.7 Hz, 1H), 4.54 (d, J=5.7 Hz, 2H), 2.08 (t, J=7.5 Hz,
2H), 0.98 (t, J=7.5 Hz, 3H).
b) 3-Propyl-benzofuran
[1350] To a solution of 1-but-2-enyloxy-iodobenzene (4.00 g, 13.8
mmol) in DMF (46 mL) was added n-Bu.sub.4NCl (5.36 g. 19.3 mmol),
Pd(OAc).sub.2 (0.168 g, 0.690 mmol), Na.sub.2CO.sub.3 (2.99 g, 28.2
mmol) and NaOAc (1.13 g, 13.8 mmol). The mixture was heated to
reflux under nitrogen atmosphere overnight. The mixture was diluted
with EtOAc and washed with water. The aqueous layer was extracted
with EtOAc (3.times.). The combined organics were washed with brine
and dried over Na.sub.2SO.sub.4. Purification by column
chromatography (silica gel, hexanes) gave the title compound (1.79
g, 81%) as a yellow oil: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 7.75 (s, 1H), 7.63-7.60 (m, 1H), 7.54 (d, J=7.5 Hz, 1H),
7.33-7.22 (m, 2H), 2.64-2.59 (m, 2H), 1.72-1.64 (m, 2H), 0.96 (t,
J=7.2 Hz, 3H); ESI MS m/z 161 (M+H).sup.+.
c) 3-Propyl-bezofuran-2-carbadehyde
[1351] To a solution of 3-propyl-benzofuran (1.79 g, 11.1 mmol) in
THF (30 mL) at -30.degree. C. under N.sub.2 was added
n-butyllithium (11 mL of a 2.5 M solution in hexane, 27.5 mmol)
dropwise. The mixture was stirred for 15 minutes then DMF (2.83 g,
38.8 mmol) was added. The mixture was slowly warmed to room
temperature overnight. The reaction was quenched with saturated
NH.sub.4Cl and the resulting mixture was extracted with EtOAc
(3.times.). The combined organics were washed with water and brine,
and then dried over Na.sub.2SO.sub.4. Purification by column
chromatography (silica gel, hexanes/EtOAc, 5:1) gave the title
compound (1.45 g, 70%) as a yellow oil: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 10.0 (s, 1H), 7.93-7.90 (m, 1H), 7.70 (t,
J=8.4 Hz, 1H), 7.62-7.56 (m, 1H), 7.42-7.37 (m, 1H), 3.10 (t, J=7.2
Hz, 2H), 1.77-1.65 (m, 2H), 1.00-0.92 (m, 3H); ESI MS m/z 189
(M+H).sup.+.
d) Methyl-(3-propyl-benzofuran-2-ylmethyl)amine
[1352] To 3-propyl-benzofuran-2-carbaldehyde (1.36 g, 72.2 mmol)
was added methylamine (29 mL of a 2 M solution in methanol, 58
mmol). The resulting mixture was stirred overnight at room
temperature under nitrogen. The mixture was concentrated under
reduced pressure. The residue was taken up in ethanol (20 mL) and
the solution was cooled in an ice-bath. NaBH.sub.4 (490 mg, 10.8
mmol) was added in one portion. The mixture was concentrated under
reduced pressure and the residue taken up in 1 M NaOH. The mixture
was extracted with Et.sub.2O (3.times.). The combined organics were
washed, dried (Na.sub.2SO.sub.4), filtered and concentrated under
reduced pressure to give the title compound (1.68 g, 99%) as a
yellow oil: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 7.60-7.54
(m, 1H), 7.49 (dd, J=7.2, 1.2 Hz, 1H), 7.25-7.20 (m, 2H), 3.76 (s,
2H), 2.65 (t, J=7.2 Hz, 2H), 2.30 (d, J=9.3 Hz, 3H), 1.99 (s, 1H),
1.66-1.58 (m, 2H), 0.94-0.86 (m, 3H); ESI MS m/z 204
(M+H).sup.+.
e) N-Methyl-N-(3-propyl-benzofuran-2-ylmethyl)acrylamide
[1353] A solution of methyl-(3-propyl-benzofuran-2-ylmethyl)amine
(1.10 g, 5.41 mmol) in CH.sub.2Cl.sub.2 (40 mL) was treated with
acryloyl chloride (0.45 mL, 5.68 mmol) and triethylamine (1.5 mL,
10.8 mmol). The mixture was stirred at room temperature for 2 h.
The solution was washed with water and brine, dried
(Na.sub.2SO.sub.4), filtered and concentrated under reduced
pressure to give the title compound (1.46 g, 99%) as a yellow
solid: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 7.59 (d, J=5.4
Hz, 1H), 7.49 (d, J=7.5 Hz, 1H), 7.28-7.15 (m, 2H), 6.89-6.70 (m,
1H), 6.20 (t, J=2.4 Hz, 1H), 5.75 (t, J=4.5 Hz, 1H), 4.83-4.71 (m,
2H), 3.33-3.07 (m, 2H), 2.87-2.67 (m, 3H), 1.65-1.58 (m, 2H),
0.95-0.88 (m, 3H); ESI MS m/z 258 (M+H).sup.+.
f) (E)-3-(3,3-Dimethyl-2-oxo-2,3,4,5-tetrahydro
1H-pyrido[2,3-e][1,4]dizepin-7-yl)-N-methyl-N-(3-propyl-benzofuran-2-ylme-
thyl)acrylamide
[1354] To
7-bromo-3,3-dimethyl-1,3,4,5-tetrahydro-pyrido[2,3-e][1,4]diazep-
in-2-one (400 mg, 1.48 mmol) in propionitrile (40 mL) and DMF (10
mL) was added N-methyl-N-(3-propyl-benzofuran-2-ylmethyl)acrylamide
(410 mg, 1.63 mmol), (i-Pr).sub.2EtN (0.51 mL, 2.96 mmol),
Pd(OAc).sub.2 (332 mg, 0.148 mmol) and P(o-tol).sub.3 (90.1 mg,
0.296 mmol), and the mixture was de-oxygenated with argon for 15
min. The mixture was heated to reflux overnight, allowed to cool
and then filtered. The filtrate was concentrated and the residue
was dissolved in CH.sub.2Cl.sub.2 (150 mL). The organic solution
was washed with water and brine, dried and the solvent was removed
in vacuo. Purification by column chromatography (silica gel,
CH.sub.2Cl.sub.2/MeOH, 20:1) gave the title compound (87.0 mg, 11%)
as an off-white solid: MS m/z 447 (M+H).sup.+.
g) (E)-3-(3,3-Dimethyl-2-oxo-2,3,4,5-tetrahydro
1H-pyrido[2,3-e][1,4]diazepin-7-yl)-N-methyl-N-(3-propyl-benzofuran-2-ylm-
ethyl)acrylamide hydrochloride
[1355] A suspension of (E)-3-(3,3-dimethyl-2-oxo-2,3,4,5-tetrahydro
1H-pyrido[2,3-e][1,4]diazepin-7-yl)-N-methyl-N-(3-propyl-benzofuran-2-ylm-
ethyl)acrylamide (84.0 mg, 0.188 mmol) in CH.sub.2Cl.sub.2 (3 mL)
was treated with anhydrous HCl (0.094 mL of a 2 M solution in
Et.sub.2O, 0.188 mmol). After stirring for 1 h, the mixture was
diluted with Et.sub.2O (5 mL) and then stirred for 10 min. The
solid was isolated by filtration, washed with Et.sub.2O, and dried
under vacuum at 50.degree. C. overnight to give the title compound
(65.0 mg, 72%) as an off-white solid and as a mixture of amide
rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.9 (s, 1H),
10.3 (br s, 2H) 8.71-8.65 (m, 1H), 8.37 (s, 1H), 7.60-7.48 (m, 3H),
7.34-7.20 (m, 3H), 5.01-4.81 (m, 2H), 4.41 (s, 2H), 3.20-2.90 (m,
3H), 2.73 (t, J=7.2 Hz, 2H), 1.70-1.61 (m, 8H), 0.93 (t, J=7.5 Hz,
3H); ESI MS m/z 447 (M+
Example 285
Preparation of
(E)-3-(3,3-dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepi-
n-7-yl)-N-(3-ethyl-benzofuran-2-ylmethyl)-N-methylacrylamide
hydrochloride
a) N-(3-ethyl-benzofuran-2-ylmethyl)-N-methylacrylamide
[1356] A solution of N-(3-ethyl-benzofuran-2-ylmethyl)methylamine
(860 mg, 4.54 mmol) in CH.sub.2Cl.sub.2 (32 mL) was treated with
acryloyl chloride (0.38 mL, 4.77 mmol) and triethylamine (1.3 mL,
9.08 mmol). The mixture was stirred at room temperature for 2 h.
The solution was washed with water and brine, dried
(Na.sub.2SO.sub.4), filtered and concentrated under reduced
pressure to give the title compound (1.10 g, 99%) as a yellow
solid: .sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 7.55 (dd, J=6.9,
1.8 Hz, 1H), 7.41 (d, J=7.5 Hz, 1H), 7.28-7.20 (m, 2H), 6.59 (t,
J=6.6 Hz, 1H), 6.45-6.32 (m, 1H), 5.75-5.70 (m, 1H), 4.78-4.63 (m,
2H), 3.15-3.01 (m, 3H), 2.82-2.70 (m, 2H), 1.35-1.23 (m, 3H); ESI
MS m/z 244 (M+H).sup.+.
b)
(E)-3-(3,3-dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diaze-
pin-7-yl)-N-(3-ethyl-benzofuran-2-ylmethyl)-N-methylacrylamide
[1357] To
7-bromo-3,3-dimethyl-1,3,4,5-tetrahydro-pyrido[2,3-e][1,4]diazep-
in-2-one (400 mg, 1.48 mmol) in propionitrile (40 mL) and DMF (10
mL) was added N-(3-ethyl-benzofuran-2-ylmethyl)-N-methylacrylamide
(410 mg, 1.62 mmol), (i-Pr).sub.2EtN (0.51 mL, 2.96 mmol),
Pd(OAc).sub.2 (332 mg, 0.148 mmol) and P(o-tol).sub.3 (90.1 mg,
0.296 mmol), and the mixture was de-oxygenated with argon for 15
min. The mixture was heated to reflux overnight, allowed to cool
and then filtered. The filtrate was concentrated and the residue
was dissolved in CH.sub.2Cl.sub.2 (150 mL). The organic solution
was washed with water and brine, dried (Na.sub.2SO.sub.4) and the
solvent was removed in vacuo. Purification by column chromatography
(silica gel, CH.sub.2Cl.sub.2/MeOH, 20:1) gave the title compound
(130 mg, 20%) as an off-white solid: MS m/z 433 (M+H).sup.+.
c)
(E)-3-(3,3-dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diaze-
pin-7-yl)-N-(3-ethyl-benzofuran-2-ylmethyl)-N-methylacrylamide
hydrochloride
[1358] A suspension of
(E)-3-(3,3-dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepi-
n-7-yl)-N-(3-ethyl-benzofuran-2-ylmethyl)-N-methylacrylamide (59.0
mg, 0.136 mmol) in CH.sub.2Cl.sub.2 (4 mL) and CH.sub.3OH (0.3 mL)
was treated with anhydrous HCl (0.068 mL of a 2 M solution in
Et.sub.2O, 0.136 mmol). After stirring for 1 h, the mixture was
diluted with Et.sub.2O (5 mL) and stirred for 10 minutes. The solid
was isolated by filtration, washed with Et.sub.2O, and dried under
vacuum at 50.degree. C. overnight to give the title compound (63.0
mg, 99%) as an off-white solid and as a mixture of amide rotamers:
.sup.1H NMR (500 MHz, DMSO-d.sub.6) .delta. 10.9 (s, 1H), 10.5 (br
s, 2H) 8.71-8.60 (m, 1H), 8.39 (d, J=8.0 Hz, 1H), 7.65-7.50 (m,
3H), 7.35-7.20 (m, 3H), 4.80-5.01 (m, 2H), 4.40 (s, 2H), 3.20-2.90
(m, 3H), 2.77 (d, J=7.0 Hz, 2H), 1.62 (s, 6H), 1.22 (t, J=7.0 Hz,
3H); ESI MS m/z 433 (M+H).sup.+.
Example 286
Preparation of
(E)-3-(3,3-Dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepi-
n-7-yl)-N-methyl-N-(3-methylbenzofuran-2-ylmethyl)acrylamide
hydrochloride a)
(E)-3-(3,3-Dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diaz-
epin-7-yl)-N-methyl-N-(3-methylbenzofuran-2-ylmethyl)acrylamide
[1359] A suspension of
7-bromo-3,3-dimethyl-1,3,4,5-tetrahydro-pyrido[2,3-e][1,4]diazepin-2-one
(0.27 g, 1.0 mmol) and
N-methyl-N-(3-methylbenzofuran-2-ylmethyl)acrylamide (0.31 g, 1.4
mmol) in propionitrile (5 mL) and DMF (1.3 mL) was de-oxygenated
with Ar for 10 min. The mixture was treated with (i-Pr).sub.2EtN
(0.37 mL, 2.1 mmol) and was de-oxygenated with Ar for 10 min.
Pd(OAc).sub.2 (22 mg, 0.098 mmol) and P(o-tol).sub.3 (61 mg, 0.20
mmol) were added simultaneously, and the mixture was de-oxygenated
a third time for 5 min. The mixture was heated to reflux overnight,
then allowed to cool. The resulting precipitate was isolated by
filtration, washed with EtOAc, dissolved in CH.sub.2Cl.sub.2/MeOH
(1:1) and the solvent was removed in vacuo. Purification by flash
column chromatography (silica gel, CH.sub.2Cl.sub.2/MeOH, 97:3)
gave the title compound (0.25 g, 60%) as a white solid: MS (ESI)
m/e 419 (M+H).sup.+.
b)
(E)-3-(3,3-Dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diaze-
pin-7-yl)-N-methyl-N-(3-methylbenzofuran-2-ylmethyl)acrylamide
hydrochloride
[1360] A suspension of
(E)-3-(3,3-dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepi-
n-7-yl)-N-methyl-N-(3-methylbenzofuran-2-ylmethyl)acrylamide (0.20
g, 0.48 mmol) in CH.sub.2Cl.sub.2 (10 mL) was treated with
anhydrous HCl (0.48 mL of a 1.0 M solution in Et.sub.2O, 0.48
mmol). After stirring for 45 min, the mixture was diluted with
Et.sub.2O (50 mL) and stirred for 3 h. The solid was isolated by
filtration, washed with Et.sub.2O, and dried under vacuum at
50.degree. C. overnight to give the title compound (0.21 g, 97%) as
a white powder and as a mixture of amide rotamers: .sup.1H NMR (300
MHz, DMSO-d.sub.6) .delta. 10.92 (s, 1H), 10.55 (br s, 2H),
8.68-8.65 (m, 1H), 8.39 (s, 1H), 7.60-7.22 (m, 6H), 5.01-4.81 (m,
2H), 4.40 (s, 2H), 3.20-2.93 (m, 3H), 2.27 (s, 3H), 1.63 (s, 6H);
MS (ESI) m/e 419 (M+H).sup.+.
Example 287
Preparation of
(E)-3-(3,3-Dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepi-
n-7-yl)-N-(3-methoxy-2-propoxybenzyl)-N-methylacrylamide
hydrochloride
a) N-(3-Methoxy-2-propoxybenzyl)-N-methylacrylamide
[1361] A solution of (3-methoxy-2-propoxybenzyl)methylamine (1.00
g, 4.78 mmol) in CH.sub.2Cl.sub.2 (40 mL) was treated with acryloyl
chloride (0.42 mL, 5.2 mmol) followed by Et.sub.3N (0.74 mL, 5.3
mmol). After stirring for 1.5 h, the solution was diluted with
CH.sub.2Cl.sub.2 (50 mL) and washed with saturated aqueous
NaHCO.sub.3 (50 mL). The aqueous layer was extracted with
CH.sub.2Cl.sub.2 (50 mL). The combined organic layers were dried
over Na.sub.2SO.sub.4, filtered and concentrated to give the title
compound (1.11 g, 88%) as a tan oil and as a mixture of amide
rotamers: .sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 7.06-6.94 (m,
2H), 6.85-6.70 (m, 1H), 6.65-6.58 (m, 1H), 6.18-6.13 (m, 1H),
5.73-5.63 (m, 1H), 4.64-4.58 (m, 2H), 3.89-3.84 (m, 2H), 3.79-3.78
(m, 3H), 2.99-2.86 (m, 3H), 1.73-1.66 (m, 2H), 0.97 (t, J=7.4 Hz,
3H).
b)
(E)-3-(3,3-Dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diaze-
pin-7-yl)-N-(3-methoxy-2-propoxybenzyl)-N-methylacrylamide
[1362] A suspension of
7-bromo-3,3-dimethyl-1,3,4,5-tetrahydro-pyrido[2,3-e][1,4]diazepin-2-one
(0.30 g, 1.1 mmol) and
N-(3-methoxy-2-propoxybenzyl)-N-methylacrylamide (0.35 g, 1.3 mmol)
in propionitrile (5 mL) and DMF (1.3 mL) was de-oxygenated with Ar
for 5 min. The mixture was treated with (i-Pr).sub.2EtN (0.41 mL,
2.4 mmol) and was de-oxygenated with Ar for 10 min Pd(OAc).sub.2
(25 mg, 0.11 mmol) and P(o-tol).sub.3 (69 mg, 0.23 mmol) were added
simultaneously, and the mixture was de-oxygenated a third time for
5 min. The mixture was heated to reflux overnight, then allowed to
cool. The mixture was diluted with Et.sub.2O (50 mL) and EtOAc (25
mL), washed with H.sub.2O (25 mL), dried over Na.sub.2SO.sub.4,
filtered and concentrated to an orange residue. Purification by
flash column chromatography (silica gel, CH.sub.2Cl.sub.21MeOH,
98:2 to 97:3) gave the title compound (0.30 g, 60%) as an off-white
solid: MS (ESI) m/e 453 (M+H).sup.+.
c)
(E)-3-(3,3-Dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diaze-
pin-7-yl)-N-(3-methoxy-2-propoxybenzyl)-N-methylacrylamide
hydrochloride
[1363] A suspension of
(E)-3-(3,3-dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepi-
n-7-yl)-N-(3-methoxy-2-propoxybenzyl)-N-methylacrylamide (0.19 g,
0.42 mmol) in CH.sub.2Cl.sub.2 (5 mL) was treated with anhydrous
HCl (0.42 mL of a 1.0 M solution in Et.sub.2O, 0.42 mmol). After
stirring for 1 h, the mixture was diluted with Et.sub.2O (50 mL)
and allowed to stir for 3 h. The solid was isolated by filtration,
washed with Et.sub.2O and dried under vacuum at 50.degree. C. for 3
d to give the title compound (0.17 g, 84%) as an off-white powder
and as a mixture of amide rotamers: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 10.94-10.92 (m, 1H), 10.47 (br s, 2H),
8.67-8.62 (m, 1H), 8.39-8.32 (m, 1H), 7.60-7.53 (m, 1H), 7.39-7.33
(m, 1H), 7.05-6.95 (m, 2H), 6.69-6.62 (m, 1H), 4.80-4.65 (m, 2H),
4.42-4.38 (m, 2H), 3.92-3.85 (m, 2H), 3.80 (s, 3H), 3.12-2.86 (m,
3H), 1.75-1.67 (m, 2H), 1.63-1.61 (m, 6H), 1.01-0.94 (m, 3H); MS
(ESI) We 453 (M+H).sup.+.
Example 288
Preparation of
(E)-3-(3,3-Dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepi-
n-7-yl)-N-methyl-N-(1-methyl-1H-indol-2-ylmethyl)acrylamide
hydrochloride
a) N-Methyl-N-(1-methyl-1H-indol-2-ylmethyl)acrylamide
[1364] A solution of methyl-(1-methyl-1H-indol-2-ylmethyl)amine
(2.00 g, 11.5 mmol) in CH.sub.2Cl.sub.2 (100 mL) was treated with
acryloyl chloride (1.03 mL, 12.7 mmol) followed by Et.sub.3N (1.8
mL, 13 mmol). After stirring for 2 h, the solution was diluted with
CH.sub.2Cl.sub.2 (100 mL) and washed with saturated aqueous
NaHCO.sub.3 (200 mL). The aqueous layer was extracted with
CH.sub.2Cl.sub.2 (200 mL). The combined organic layers were dried
over Na.sub.2SO.sub.4, filtered and concentrated to an orange oil.
Purification by flash column chromatography (silica gel,
CH.sub.2Cl.sub.2/MeOH, 99.5:0.5 to 99:1) gave the title compound
(2.10 g, 80%) as a tan oil: .sup.1H NMR (300 MHz, CDCl.sub.3)
.delta. 7.59-7.56 (m, 1H), 7.32-7.19 (m, 2H), 7.13-7.08 (m, 1H),
6.66-6.57 (m, 1H), 6.47-6.38 (m, 2H), 5.78-5.74 (m, 1H), 4.88-4.74
(m, 2H), 3.69 (s, 3H), 3.06-2.97 (m, 3H); MS (ESI) We 229
(M+H).sup.+.
b)
(E)-3-(3,3-Dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diaze-
pin-7-yl)-N-methyl-N-(1-methyl-1H-indol-2-ylmethyl)acrylamide
[1365] A suspension of
7-bromo-3,3-dimethyl-1,3,4,5-tetrahydro-pyrido[2,3-e][1,4]diazepin-2-one
(0.30 g, 1.1 mmol) and
N-methyl-N-(1-methyl-1H-indol-2-ylmethyl)acrylamide (0.35 g, 1.3
mmol) in propionitrile (5 mL) and DMF (1.3 mL) was de-oxygenated
with Ar for 10 min. The mixture was treated with (i-Pr).sub.2EtN
(0.41 mL, 2.4 mmol) and was de-oxygenated with Ar for 5 min.
Pd(OAc).sub.2 (25 mg, 0.11 mmol) and P(o-tol).sub.3 (70 mg, 0.23
mmol) were added simultaneously, and the mixture was de-oxygenated
a third time for 5 min. The mixture was heated to reflux overnight,
then allowed to cool. The mixture was diluted with EtOAc (100 mL),
washed with H.sub.2O (50 mL), dried over Na.sub.2SO.sub.4, filtered
and concentrated to an orange residue. Purification by flash column
chromatography (silica gel, CH.sub.2Cl.sub.2/MeOH, 98:2 to 97:3)
gave the title compound (0.24 g, 51%) as a light pink solid: MS
(ESI) m/e 418 (M+H).sup.+.
c)
(E)-3-(3,3-Dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diaze-
pin-7-yl)-N-methyl-N-(1-methyl-1H-indol-2-ylmethyl)acrylamide
hydrochloride
[1366] A suspension of
(E)-3-(3,3-dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepi-
n-7-yl)-N-methyl-N-(1-methyl-1H-indol-2-ylmethyl)acrylamide (0.15
g, 0.36 mmol) in CH.sub.2Cl.sub.2 (5 mL) was treated with anhydrous
HCl (0.36 mL of a 1.0 M solution in Et.sub.2O, 0.36 mmol). After
stirring for 10 min, the mixture was diluted with Et.sub.2O (50 mL)
and then stirred for 1.5 h. The solid was isolated by filtration,
washed with Et.sub.2O, and dried under vacuum at 50.degree. C. for
3 d to give the title compound (0.14 g, 83%) as a tan powder and as
a mixture of amide rotamers: .sup.1H NMR (500 MHz, DMSO-d.sub.6)
.delta. 10.90-10.87 (m, 1H), 10.54 (br s, 2H), 8.66-8.63 (m, 1H),
8.39-8.33 (s, 1H), 7.62-7.59 (m, 1H), 7.51-7.32 (m, 3H), 7.14-7.11
(m, 1H), 7.03-6.99 (m, 1H), 6.43-6.19 (m, 1H), 5.07-4.86 (m, 2H),
4.40-4.35 (m, 2H), 3.74-3.69 (m, 3H), 3.13-3.00 (m, 3H), 1.63-1.59
(m, 6H); MS (ESI) m/e 418 (M+H).sup.+.
Example 289
Preparation of
(E)-N-Methyl-N-(3-methylbenzofuran-2-ylmethyl)-3-(2-oxo-2,3,4,5-tetrahydr-
o-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide hydrochloride
a) 7-Bromo-1,3,4,5-tetrahydropyrido[2,3-e][1,4]diazepin-2-one
hydrochloride
[1367] A solution of
7-bromo-4-(4-methoxybenzyl)-1,3,4,5-tetrahydropyrido[2,3-e][1,4]diazepin--
2-one (3.37 g, 9.30 mmol) in dichloroethane (180 mL) was cooled in
an ice bath and treated with ACE-Cl (1.1 mL, 10 mmol). After
stirring at 0.degree. C. under N.sub.2 for 30 min and then at room
temperature for 30 min, the mixture was heated to reflux for 1 h.
The mixture was allowed to cool and then concentrated to dryness.
Purification by flash column chromatography (silica gel,
CH.sub.2Cl.sub.2/MeOH, 99:1) gave a white solid. A portion of the
solid (1.02 g, 2.93 mmol) was suspended in methanol (50 mL) and
heated to reflux for 3 h. The mixture was allowed to cool and the
solid was isolated by filtration, washed with MeOH and dried under
vacuum at 50.degree. C. overnight to give the title compound (0.66
g, 46%) as a white solid: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 11.05 (s, 1H), 10.30 (br s, 2H), 8.57 (d, J=2.3 Hz, 1H),
8.15 (d, J=2.3 Hz, 1H), 4.24 (s, 2H), 3.79 (s, 2H); MS (ESI) m/e
242 (M+H).sup.+.
b)
(E)-N-Methyl-N-(3-methylbenzofuran-2-ylmethyl)-3-(2-oxo-2,3,4,5-tetrahy-
dro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
[1368] A suspension of
7-bromo-1,3,4,5-tetrahydropyrido[2,3-e][1,4]diazepin-2-one
hydrochloride (0.29 g, 1.0 mmol) and
N-methyl-N-(3-methylbenzofuran-2-ylmethyl)acrylamide (0.29 g, 1.3
mmol) in propionitrile (5 mL) and DMF (1.3 mL) was de-oxygenated
with Ar for 10 min. The mixture was treated with (i-Pr).sub.2EtN
(0.56 mL, 3.2 mmol) and was de-oxygenated with Ar for 5 min.
Pd(OAc).sub.2 (24 mg, 0.11 mmol) and P(o-tol).sub.3 (64 mg, 0.21
mmol) were added simultaneously, and the mixture was de-oxygenated
a third time for 5 min. The mixture was heated to reflux overnight,
then allowed to cool. The resulting precipitate was isolated by
filtration, dissolved in CH.sub.2Cl.sub.2/MeOH and the solvent was
removed in vacuo. Purification by flash column chromatography
(silica gel, CH.sub.2Cl.sub.2/MeOH, 98:2 to 96:4) gave the title
compound (0.18 g, 47%) as a white solid: MS (ESI) m/e 391
(M+H).sup.+.
c)
(E)-N-Methyl-N-(3-methylbenzofuran-2-ylmethyl)-3-(2-oxo-2,3,4,5-tetrahy-
dro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide hydrochloride
[1369] A suspension of
(E)-N-Methyl-N-(3-methylbenzofuran-2-ylmethyl)-3-(2-oxo-2,3,4,5-tetrahydr-
o-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide (0.16 g, 0.40 mmol)
in CH.sub.2Cl.sub.2 (10 mL) was treated with anhydrous HCl (0.40 mL
of a 1.0 M solution in Et.sub.2O, 0.40 mmol). After stirring for 45
min, the mixture was diluted with Et.sub.2O (50 mL) and then
stirred for 1 h. The solid was isolated by filtration, washed with
Et.sub.2O, and dried under vacuum at 50.degree. C. for 3 d to give
the title compound (0.15 g, 90%) as a white powder and as a mixture
of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
11.09 (s, 1H), 10.12 (br s, 2H), 8.79-8.76 (m, 1H), 8.33-8.31 (s,
1H), 7.60-7.24 (m, 6H), 5.01-4.81 (m, 2H), 4.26 (s, 2H), 3.85 (s,
2H), 3.20-2.93 (m, 3H), 2.27 (s, 3H); MS (ESI) m/e 391
(M+H).sup.+.
Example 290
Preparation of
(E)-3-(2,2-Dimethyl-3-oxo-3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)-N-
-methyl-N-(3-methylbenzofuran-2-ylmethyl)acrylamide
a) 7-Bromo-2,2-dimethyl-4H-pyrido[3,2-b][1,4]oxazin-3-one
[1370] To a mixture of 2-amino-5-bromopyridin-3-ol (0.500 g, 2.64
mmol) and K.sub.2CO.sub.3 (1.09 g, 7.93 mmol) in acetone (11.0 mL)
was added ethyl bromoisobutyrate (0.50 mL, 3.4 mmol). The solution
was stirred under N.sub.2 for 18 h and then heated to reflux. After
18 h, the solution was cooled and concentrated. The light-pink,
sweet-smelling solid was dissolved in CH.sub.2Cl.sub.2 (50 mL) and
MeOH (5 mL). The solution was diluted with H.sub.2O (150 mL) and
then washed with CH.sub.2Cl.sub.2 (3.times.75 mL). The combined
organic layers were washed with brine (2.times.100 mL), dried
(Na.sub.2SO.sub.4) and concentrated to yield the title compound
(0.57 g, 84%) as an off-white solid: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 11.39 (s, 1H), 8.03 (d, J=1.2 Hz, 1H), 7.66
(d, 0.9 Hz, 1H), 1.43 (s, 6H).
b)
(E)-3-(2,2-Dimethyl-3-oxo-3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)-
-N-methyl-N-(3-methylbenzofuran-2-ylmethyl)acrylamide
[1371] A solution of
N-methyl-N-(3-methylbenzofuran-2-ylmethyl)acrylamide (0.231 g, 1.01
mmol) in propionitrile (4 mL) and DMF (0.8 mL) was deoxygenated
with Ar for 20 min. The solution was treated with
diisopropylethylamine (0.28 mL, 1.64 mmol) and
7-bromo-2,2-dimethyl-4H-pyrido[3,2-b][1,4]oxazin-3-one (0.200 g,
0.775 mmol). The solution was deoxygenated with Ar for 20 min.
Pd(OAc).sub.2 (0.017 g, 0.078 mmol) and P(o-tol).sub.3 (0.047 g,
0.15 mmol) were then added and the solution was deoxygenated again
with Ar for 10 min. The mixture was heated to reflux for 18 h, then
allowed to cool. The mixture was diluted with H.sub.2O (100 mL).
The resulting solids were collected by filtration and washed with
Et.sub.2O (50 mL). Residual palladium was removed by silica gel
plug (silica gel, 95:5, CH.sub.2Cl.sub.2/MeOH) the resulting
solution concentrated to reveal a light orange solid.
[1372] The solid was triturated with Et.sub.2O and dried to give
the title compound (0.14 g, 46%) as a light pink solid and as a
mixture of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 11.41 (s, 1H), 8.20-8.19 (m, 1H), 7.97-7.93 (m, 1H),
7.57-7.48 (m, 3H), 7.28-7.23 (m, 3H), 5.00-4.78 (m, 2H), 3.17-2.92
(m, 3H), 2.62 (s, 3H), 1.44 (m, 6H); MS (ESI) m/e 406
(M+H).sup.+.
Example 291
Preparation of
(E)-3-(2,2-Dimethyl-3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)-N-methy-
l-N-(3-methyl-benzofuran-2-ylmethyl)-acrylamide hydrochloride
a)
7-Bromo-2,2-dimethyl-3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazine
[1373] To a solution of
7-bromo-2,2-dimethyl-4H-pyrido[3,2-b][1,4]oxazin-3-one (0.360 g,
1.39 mmol) in THF (8.9 mL) at 0.degree. C. was added BH.sub.3 (8.43
mL of a 1.0 M solution in THF, 8.43 mmol). The solution was heated
to reflux. After 18 h, the solution was cooled to 0.degree. C. and
the reaction quenched with MeOH (15 mL). The mixture was
concentrated and the resulting off-white solid was dissolved in
MeOH (15 mL) and NaOH (10 mL of a 1 N solution). The mixture was
heated at reflux to 4 h. The MeOH was removed under reduced
pressure. The resulting precipitate was collected by filtration and
washed with H.sub.2O (10 mL). The white solid was dried to give the
title compound (0.260 g, 76%) as white needles: .sup.1H NMR (300
MHz, DMSO-d.sub.6) .delta. 7.62 (d, J=2.1 Hz, 1H), 7.10 (d, J=1.5
Hz, 1H), 7.03 (br s, 1H), 3.14 (d, J=2.4 Hz, 2H), 1.25 (s, 6H); MS
(ESI) m/e 243 (M+H).sup.+.
b)
(E)-3-(2,2-Dimethyl-3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)-N-met-
hyl-N-(3-methylbenzofuran-2-ylmethyl)acrylamide
[1374] A solution of
N-methyl-N-(3-methylbenzofuran-2-ylmethyl)acrylamide (0.190 g,
0.637 mmol) in propionitrile (3 mL) and DMF (0.6 mL) was
deoxygenated with Ar for 20 min. The solution was treated with
diisopropylethylamine (0.23 mL, 1.33 mmol) and
7-bromo-2,2-dimethyl-3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazine
(0.154 g, 0.828 mmol). The solution was deoxygenated with Ar for 20
min. Pd(OAc).sub.2 (0.014 g, 0.063 mmol) and P(o-tol).sub.3 (0.038
g, 0.12 mmol) were then added and the solution was deoxygenated
again with Ar for 10 min. The mixture was heated to reflux for 2 h,
then allowed to cool. The mixture was diluted with H.sub.2O (200
mL) and the solution was washed with EtOAc (3.times.50 mL). The
combined organic layers were washed with brine (2.times.30 mL),
dried (Na.sub.2SO.sub.4) and concentrated to give a dark green oil.
Column chromatography (silica gel, CH.sub.2Cl.sub.2/MeOH, 100 to
98:2) gave the title compound (0.14 g, 59%) as a light yellow solid
and as a mixture of amide rotamers: .sup.1H NMR (500 MHz,
DMSO-d.sub.6) .delta. 7.79 (s, 1H), 7.56-7.54 (m, 1H), 7.51-7.47
(m, 2H), 7.41-7.38 (m, 1H), 7.32 (br s, 1H), 7.29-6.93 (m, 3H),
4.95-4.76 (m, 2H), 3.19 (m, 2H), 3.14-2.90 (m, 3H), 2.25 (s, 3H),
1.26 (s, 6H); MS (ESI) m/e 392 (M+H).sup.+.
c)
(E)-3-(2,2-Dimethyl-3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)-N-met-
hyl-N-(3-methylbenzofuran-2-ylmethyl)acrylamide hydrogen
chloride
[1375] A stirring solution of
(E)-3-(2,2-dimethyl-3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)-N-methy-
l-N-(3-methylbenzofuran-2-ylmethyl)acrylamide (0.147 g, 0.375 mmol)
in CH.sub.2Cl.sub.2 (4 mL) under N.sub.2 was treated with anhydrous
HCl (0.18 mL of a 2 M solution in diethyl ether, 0.37 mmol). After
stirring for 6 h, the resulting solids were collected by
filtration, washed with Et.sub.2O (50 mL) and dried to yield the
title compound (0.14 g, 88%) as an off-white solid and as a mixture
of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 8.69
(br s, 1H), 8.00-7.94 (m, 2H), 7.57-7.55 (m, 1H), 7.49-7.44 (m,
2H), 7.30-7.14 (m, 3H), 4.99-4.77 (m, 2H), 3.37 (br s, 2H),
3.15-2.90 (m, 3H), 2.25 (s, 3H), 1.32 (s, 6H); MS (ESI) m/e 392
(M+H).sup.+.
Example 292
Preparation of
(E)-3-(3,4-Dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)-N-methyl-N-(3-methyl-
benzofuran-2-ylmethyl)acrylamide hydrochloride
a) 3,4-Dihydro-2H-pyrido[3,2-b][1,4]oxazine
[1376] To an ice-cold solution of 4H-pyrido[3,2-b][1,4]oxazin-3-one
(5.00 g, 33.3 mmol) in THF (40 mL) was added lithium aluminum
hydride (66.6 mL of a 1.0 M solution in THF, 66.6 mmol). Following
the addition, the solution was heated to reflux. After 18 h, the
solution was cooled to 0.degree. C. and quenched the reaction with
H.sub.2O (4 mL) followed by NaOH (4 mL, 15%) and H.sub.2O (10 mL).
The resulting slurry was filtered over Celite and the filtrate
concentrated to give the title compound (3.87 g, 85%) as a
blue-gray powder: .sup.1H NMR (500 MHz, DMSO-d.sub.6) .delta. 7.53
(dd, J=4.5, 1.0 Hz, 1H), 6.90-6.89 (m, 1H), 6.61 (br s, 1H), 6.44
(dd, J=8.0, 3.0 Hz, 1H), 4.08 (t, J=4.5 Hz, 2H), 3.39-3.36 (m, 2H);
MS (ESI) m/e 137 (M+H).sup.+.
b) 7-Bromo-2,2-dimethyl-3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazine
hydrogen bromide
[1377] To an ice-cold solution of
3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazine (3.86 g, 28.3 mmol) in
acetic acid (71.7 mL) was added Br.sub.2 (1.83 mL, 35.6 mmol). The
mixture was stirred for 3 h at 0.degree. C. then warmed to ambient
temperature. After 2 h, the resulting solids were collected by
filtration and washed with EtOAc (400 mL). The solids were dried to
give the title compound (6.31 g, 60%) as a dark orange powder:
.sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 12.25 (br s, 1H), 7.77
(t, J=1.8 Hz, 1H), 7.45 (t, J=2.1 Hz, 1H), 4.20 (t, J=4.6 Hz, 2H),
3.48 (t, J=4.6 Hz, 2H); MS (ESI) m/e 215 (M+H).sup.+.
c)
(E)-3-(3,4-Dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)-N-methyl-N-(3-meth-
ylbenzofuran-2-ylmethyl)acrylamide
[1378] A solution of
N-methyl-N-(3-methylbenzofuran-2-ylmethyl)acrylamide (0.190 g,
0.637 mmol) in propionitrile (3 mL) and DMF (0.6 mL) was
deoxygenated with Ar for 20 min. The solution was treated with
diisopropylethylamine (0.34 mL, 1.97 mmol) and
7-bromo-2,2-dimethyl-3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazine
(0.188 g, 0.828 mmol). The solution was deoxygenated with Ar for 20
min. Pd(OAc).sub.2 (0.014 g, 0.078 mmol) and P(o-tol).sub.3 (0.038
g, 0.15 mmol) were then added and the solution was deoxygenated
again with Ar for 20 min. The mixture was heated to reflux for 2 h,
then allowed to cool. The mixture was diluted with H.sub.2O (200
mL) and the resulting solution was washed with EtOAc (3.times.50
mL). The combined organic layers were washed with brine (2.times.30
mL), dried (Na.sub.2SO.sub.4) and concentrated to a dark green oil.
Column chromatography (silica gel, CH.sub.2Cl.sub.2/MeOH, 100 to
98:2) gave the title compound (0.12 g, 52%) as a light yellow solid
and as a mixture of amide rotamers: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 7.83 (br s, 1H), 7.62-7.60 (m, 1H), 7.56-7.51
(m, 2H), 7.48-7.41 (m, 1H), 7.38-7.69 (m, 4H), 5.01-4.95 (m, 2H),
4.03 (s, 2H), 3.48 (s, 2H), 3.06-2.90 (m, 3H), 2.18 (s, 3H); MS
(ESI) m/e 364 (M+H).sup.+.
d)
(E)-3-(3,4-Dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)-N-methyl-N-(3-meth-
ylbenzofuran-2-ylmethyl)acrylamide hydrogen chloride
[1379] A stirring solution of
(E)-3-(3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)-N-methyl-N-(3-methyl-
benzofuran-2-ylmethyl)acrylamide (0.121 g, 0.332 mmol) in
CH.sub.2Cl.sub.2 (4 mL) under N.sub.2 was treated with anhydrous
HCl (0.16 mL of a 2 M solution in diethyl ether, 0.33 mmol). After
stirring for 72 h, the resulting solids were collected by
filtration, washed with Et.sub.2O (50 mL) and dried to yield the
title compound (0.094 g, 71%) as an off-white solid and as a
mixture of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 8.74 (br s, 1H), 7.97-7.93 (m, 2H), 7.57-7.55 (m, 1H),
7.49-7.77 (m, 2H), 7.30-7.13 (m, 3H), 4.99-4.77 (m, 2H), 4.25 (br
s, 2H), 3.57 (m, 2H), 3.16-2.91 (m, 3H), 2.25 (s, 3H); MS (ESI) m/e
364 (M+H).sup.+.
Example 293
Preparation of
(E)-N-(2-Ethoxy-3-isopropylbenzyl)-N-methyl-3-(2-oxo-2,3,4,5-tetrahydro-1-
H-pyrido[2,3-e][1,4]diazepin-7-yl)-acrylamide hydrochloride
a) N-(3-Chloro-2-propoxybenzyl)-N-methylacrylamide
[1380] To a solution of (2-ethoxy-3-isopropylbenzyl)methylamine
(1.00 g, 4.82 mmol) in CH.sub.2Cl.sub.2 (40 mL) was added acryloyl
chloride (0.46 mL, 5.3 mmol) drop-wise. After stirring for five
minutes, triethylamine (0.74 mL, 5.3 mmol) was added. The solution
was stirred under N.sub.2 for 5 hours. The solution was diluted
with CH.sub.2Cl.sub.2 (50 mL) and then washed with H.sub.2O
(3.times.50 mL) and brine (2.times.100 mL), dried over
Na.sub.2SO.sub.4, filtered and concentrated to yield the title
compound (1.15 g, 92%) as a clear oil and as a mixture of amide
rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 7.25-7.19 (m,
1H), 7.13-7.03 (m, 1H), 6.89-6.67 (m, 2H), 6.20-6.12 (m, 1H),
5.79-5.53 (m, 1H), 4.68-4.60 (m, 2H), 3.81-3.76 (m, 2H), 3.28-3.23
(m, 1H), 3.01-2.87 (m, 3H), 1.38-1.33 (m, 3H), 1.19-1.16 (m, 6H);
MS (ESI) m/e 262 (M+H).sup.+.
b)
(E)-N-(2-Ethoxy-3-isopropylbenzyl)-3-[4-(4-methoxybenzyl)-2-oxo-2,3,4,5-
-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]-N-methylacrylamide
[1381] A solution of
N-(2-ethoxy-3-isopropylbenzyl)-N-methylacrylamide (0.281 g, 1.07
mmol) in propionitrile (4 mL) and DMF (0.8 mL) was deoxygenated
with Ar for 20 min. The solution was treated with
diisopropylethylamine (0.30 mL, 1.73 mmol) and
7-bromo-4-(4-methoxy-benzyl)-1,3,4,5-tetrahydro-pyrido[2,3-e][1,4]diazepi-
n-2-one (0.300 g, 0.828 mmol). The solution was deoxygenated with
Ar for 20 min. Pd(OAc).sub.2 (0.018 g, 0.082 mmol) and
P(o-tol).sub.3 (0.050 g, 0.16 mmol) were then added and the
solution was deoxygenated again with Ar for 10 min. The mixture was
heated to reflux for 1.5 h, then allowed to cool. The mixture was
diluted with H.sub.2O (100 mL) and then was washed with EtOAc
(3.times.50 mL). The organic layer was washed with brine
(2.times.100 mL), dried (Na.sub.2SO.sub.4) and concentrated to an
orange oil. Purification by column chromatography (silica gel,
CH.sub.2Cl.sub.2 to CH.sub.2Cl.sub.2/MeOH, 100 to 99.5:0.5) gave
the title compound (0.20 g, 44%) as a light yellow solid and as a
mixture of amide rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 10.43-10.41 (m, 1H), 8.55-8.49 (m, 1H), 8.10-8.01 (m, 1H),
7.55-7.50 (m, 1H), 7.35-7.17 (m, 4H), 7.12-7.04 (m, 1H), 6.91-6.85
(m, 3H), 4.80-4.66 (m, 2H), 3.83-3.70 (m, 7H), 3.65-3.62 (m, 2H),
3.41-3.38 (m, 2H), 3.29-3.90 (m, 1H), 2.56-2.51 (m, 3H), 1.39-1.37
(m, 3H), 1.25-1.11 (m, 6H); MS (ESI) m/e 543 (M+H).sup.+.
c)
(E)-N-(2-Ethoxy-3-isopropylbenzyl)-N-methyl-3-(2-oxo-2,3,4,5-tetrahydro-
-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide hydrochloride
[1382] A suspension of
N-(2-ethoxy-3-isopropylbenzyl)-3-[4-(4-methoxybenzyl)-2-oxo-2,3,4,5-tetra-
hydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl]-N-methylacrylamide (0.200
g, 0.369 mmol) in dichloroethane (8.0 mL) was cooled in an ice bath
and treated with 1-chloroethyl chloroformate (0.044 mL, 0.40 mmol).
After stirring at 0.degree. C. under N.sub.2 for 30 min and then at
room temperature for 30 min, the mixture was heated to reflux for 2
h. The mixture was allowed to cool and then concentrated to
dryness. Purification by flash column chromatography (silica gel,
CH.sub.2Cl.sub.2 to CH.sub.2Cl.sub.2/MeOH, 100 to 99.5:0.5) gave a
white solid (0.128 g, 0.241 mmol). The solid was dissolved in
methanol (4 mL) and heated to reflux for 6.5 h. The mixture was
allowed to cool and the resulting solid was isolated by filtration,
washed with MeOH and Et.sub.2O and dried to give the title compound
(1.28 g, 46%) as a white powder and as a mixture of amide rotamers:
.sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 11.08-11.06 (m, 1H),
9.96 (br s, 2H), 8.77-8.71 (m, 1H), 8.32-8.23 (m, 1H), 7.63-7.55
(m, 1H), 7.40-7.32 (m, 1H), 7.26-7.21 (m, 1H), 7.13-7.04 (m, 1H),
6.91-6.84 (m, 1H), 4.83-4.67 (m, 2H), 4.27-4.22 (m, 2H), 3.88-3.78
(m, 4H), 3.29-2.25 (m, 1H), 3.13-2.89 (m, 3H), 1.40-1.35 (m, 3H),
1.19-1.17 (m, 6H); MS (ESI) m/e 423 (M+H).sup.+.
Example 294
Preparation of
(E)-N-(2-Isobutoxy-3-methoxybenzyl)-N-methyl-3-(2-oxo-2,3,4,5-tetrahydro--
1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide hydrochloride
a)
(E)-N-(2-Isobutoxy-3-methoxybenzyl)-N-methyl-3-(2-oxo-2,3,4,5-tetrahydr-
o-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
[1383] A solution of
N-(2-isobutoxy-3-methoxybenzyl)-N-methylacrylamide (0.387 g, 1.40
mmol) in propionitrile (5 mL) and DMF (1 mL) was deoxygenated with
Ar for 20 min. Then treated with diisopropylethylamine (0.39 mL,
2.25 mmol) and
7-bromo-1,3,4,5-tetrahydro-pyrido[2,3-e][1,4]diazepin-2-one (0.300
g, 1.07 mmol). The solution was deoxygenated with Ar for 20 min.
Then Pd(OAc).sub.2 (0.024 g, 0.10 mmol) and P(o-tol).sub.3 (0.065
g, 0.21 mmol) were added and the solution deoxygenated with Ar for
20 min. The solution was heated to reflux for 18 h, then allowed to
cool. The solution was diluted with H.sub.2O (30 mL) and was washed
with EtOAc (3.times.50 mL). The organics were washed with brine
(2.times.100 mL), dried over Na.sub.2SO.sub.4, filtered and
concentrated to an orange-brown semi-solid. Purification by column
chromatography (silica gel, CH.sub.2Cl.sub.2 to
CH.sub.2Cl.sub.2/MeOH, 100 to 95:5) gave the title compound (0.10
g, 23%) as an yellow-orange solid and as a mixture of amide
rotamers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.08-10.06
(m, 1H), 8.44-8.39 (m, 1H), 8.02-7.95 (m, 1H), 7.53-7.48 (m, 1H),
7.30-7.25 (m, 1H), 7.04-6.93 (m, 2H), 6.66-6.41 (m, 1H), 4.79-4.64
(m, 2H), 3.91-3.87 (m, 2H), 3.79 (s, 3H), 3.71-3.61 (m, 4H),
3.11-2.87 (m, 4H), 2.03-1.99 (m, 1H), 1.00-0.97 (m, 6H); MS (ESI)
We 439 (M+H).sup.+.
b)
(E)-N-(2-Isobutoxy-3-methoxybenzyl)-N-methyl-3-(2-oxo-2,3,4,5-tetrahydr-
o-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide hydrochloride
[1384] A stirring solution of
(E)-N-(2-isobutoxy-3-methoxybenzyl)-N-methyl-3-(2-oxo-2,3,4,5-tetrahydro--
1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide (0.108 g, 0.246 mmol)
in CH.sub.2Cl.sub.2 (3 mL) under N.sub.2 was treated with HCl (0.12
mL of a 2.0 M solution in diethyl ether, 24 mmol). After stirring
for 18 h, the resulting solid was collected by filtration and
washed with Et.sub.2O (100 mL) and dried. The solid was dissolved
in CH.sub.2Cl.sub.2 (2 mL) and layered with hexanes (5 mL). The
resulting solids were collected by filtration, washed with
Et.sub.2O (50 mL) and dried to yield the target compound (0.052 g,
45%) as a tan solid and as a mixture of amide rotamers: .sup.1H NMR
(300 MHz, DMSO-d.sub.6) .delta. 11.09-11.07 (m, 1H), 10.03 (br s,
2H), 8.77-8.71 (m, 1H), 8.31-8.24 (m, 1H), 7.62-7.54 (m, 1H),
7.38-7.31 (m, 1H), 7.05-6.59 (m, 2H), 6.68-6.59 (m, 1H), 4.81-4.65
(m, 2H), 4.27-4.23 (m, 2H), 3.85-3.82 (m, 2H), 3.79 (s, 3H),
3.72-3.68 (m, 2H), 3.12-2.88 (m, 3H), 2.06-1.97 (m, 1H), 1.00-0.98
(m, 6H); MS (ESI) m/e 439 (M+H).sup.+.
Example 295
Preparation of
(E)-3-[6-Amino-5-(1-hydroxy-1-methyl-ethyl)-pyridin-3-yl]-N-methyl-N-(3-m-
ethyl-benzofuran-2-ylmethyl)-acrylamide
a) 2-(2-Amino-5-bromo-pyridin-3-yl)-propan-2-ol
[1385] A solution of 2-Amino-5-bromo-nicotinic acid methyl ester
(2.89 g, 13.5 mmol) in anhydrous THF (50 mL) was cooled to
0.degree. C., then treated with a slow dropwise addition of 3.0 M
methyl magnesium chloride in THF (20.85 mL, 62.5 mmol) over 30 min.
The resulting solution was warmed to room temperature and stirred
for 20 h. The reaction was then cooled to 0.degree. C. and quenched
with saturated NH.sub.4Cl solution (10 mL). The solution was then
diluted with water (100 mL) and extracted with ethyl acetate
(2.times.100 mL). The combined organic fractions were washed with
H.sub.2O (100 mL), brine (100 mL), dried over MgSO.sub.4 then
concentrated to give a yellow residue. This residue was subjected
to flash chromatography on silica gel using 50% ethyl
acetate:hexanes to give the title compound as a yellow crystalline
solid. Yield: 2.74 g (95%); .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 7.89 (s, 1H), 7.40 (s, 1H), 6.27 (br s, 2H), 5.49 (s, 1H),
1.46 (s, 6H); ESI MS m/z 231 (100%); 233(100%)
[C.sub.8K.sub.1N.sub.2OBr+H].sup.+
b)
(E)-3-[6-Amino-5-(1-hydroxy-1-methyl-ethyl)-pyridin-3-yl]-acrylic
acid tert-butyl ester
[1386] A suspension of 2-(2-Amino-5-bromo-pyridin-3-yl)-propan-2-ol
(200 mg, 0.86 mmol), tert-butyl acrylate (628 .mu.L, 4.3 mmol) and
(i-Pr).sub.2EtN (452 .mu.L, 2.6 mmol) in DMF (10 mL) was
de-oxygenated with Ar for 30 min. The mixture was treated with
Pd(OAc).sub.2 (19.4 mg, 0.09 mmol) and P(o-tol).sub.3 (51.7 mg,
0.18 mmol) then heated to 110.degree. C. for 20 h. The hot mixture
was filtered through a pad of celite. The filtrate was diluted with
H.sub.2O (100 mL) then extracted with ethyl acetate (2.times.100
mL). The combined organic fractions were dried over MgSO.sub.4, and
subjected to flash chromatography on silica gel using 50% ethyl
acetate:hexanes. The appropriate fractions were collected and
concentrated to yield a yellow crystalline solid. Yield: 153 mg
(64%); .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 8.09 (d, J=2.1
Hz, 1H), 7.65 (d, J=2.4 Hz, 1H), 7.45 (d, J=15.8 Hz, 1H), 6.69 (s,
2H), 6.32 (d, J=15.8 Hz, 1H), 5.53 (s, 1H), 1.52 (s, 6H), 1.48 (s,
9H); ESI MS m/z 279 [C.sub.15H.sub.22N.sub.2O.sub.3+H].sup.+
c)
(E)-3-[6-Amino-5-(1-hydroxy-1-methyl-ethyl)-pyridin-3-yl]-acrylic
acid hydrochloride
[1387] A suspension of
(E)-3-[6-Amino-5-(1-hydroxy-1-methyl-ethyl)-pyridin-3-yl]-acrylic
acid tert-butyl ester (0.13 g, 0.47 mmol) in CH.sub.2Cl.sub.2 (6
mL) was treated with TFA (6 mL). After stirring at room temperature
for 2 h, the solution was concentrated in vacuo. The resulting oil
was treated with anhydrous HCl in dioxane (3 mL, 4.0 M) and
sonicated until the oil was converted to a fine off-white solid.
After stirring for 20 min, the suspension was concentrated. The
solid was washed with Et.sub.2O, isolated by filtration and dried
under vacuum. Yield: 0.11 g (92%); .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 8.29 (d, J=1.5 Hz, 1H), 8.23 (br, s, 2H),
8.13 (d, J=1.8 Hz, 1H), 7.52 (d, J=16.1 Hz, 1H), 6.65 (d, J=16.1
Hz, 1H), 4.29 (s, 1H), 1.56 (s, 6H); ESI MS m/z 223
[C.sub.11H.sub.10N.sub.2O.sub.4+H].sup.+
d)
(E)-3-[6-Amino-5-(1-hydroxy-1-methyl-ethyl)-pyridin-3-yl]-N-methyl-N-(3-
-methyl-benzofuran-2-ylmethyl)-acrylamide
[1388] EDC (98 mg, 0.51 mmol) was added to a suspension of
3-[6-Amino-5-(1-hydroxy-1-methyl-ethyl)-pyridin-3-yl]-acrylic acid
hydrochloride (110 mg, 0.43 mmol), HOBt (63 mg, 0.47 mmol),
methyl-(3-methyl-benzofuran-2-ylmethyl)-amine (110 mg, 0.47 mmol)
and (i-Pr).sub.2EtN (0.36 mL, 2.1 mmol) in DMF (7 mL). The mixture
was allowed to stir overnight at 40.degree. C. The mixture was
cooled to 0.degree. C. and diluted with H.sub.2O (60 mL) with rapid
stirring. Only a small amount of precipitate was formed, therefore
the product was extracted using EtOAc (2.times.50 mL), the combined
organic layers washed with brine (60 mL), dried over MgSO.sub.4 and
dried under high vacuum. The solid was then subjected to flash
chromatography on silica gel using 10% methanol:dichloromethane.
Yield: 77.6 mg (48%); .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
8.13 (s, 1H), 7.70 (s, 1H), 7.58 (d, J=7.9 Hz, 1H), 7.50 (d, J=7.6
Hz, 1H), 7.44 (s, 1H), 7.23-7.32 (m, 2H), 6.98 (d, J=17.7 Hz, 1H),
6.59 (s, 2H), 5.51 (s, 1H), 5.00 and 4.80 (2.times.s, 2H), 3.20 and
2.99 (2.times.s, 3H), 2.28 (s, 3H), 1.54 (s, 6H); ESI MS m/z 380.2
[C.sub.22H.sub.25N.sub.3O.sub.3+H].sup.+
Example 296
Preparation of
(E)-3-[6-Amino-5-(1-hydroxy-1-methyl-ethyl)-pyridin-3-yl]-N-methyl-N-(1-m-
ethyl-1H-indol-2-ylmethyl)-acrylamide
[1389] EDC (0.13 g, 0.70 mmol) was added to a suspension of
(E)-3-[6-Amino-5-(1-hydroxy-1-methyl-ethyl)-pyridin-3-yl]-acrylic
acid hydrochloride (0.15 g, 0.58 mmol), HOBt (0.09 g, 0.64 mmol),
Methyl-(1-methyl-1H-indol-2-ylmethyl)-amine (0.11 g, 0.64 mmol) and
(i-Pr).sub.2EtN (0.49 mL, 2.9 mmol) in DMF (8 mL). The mixture was
allowed to stir overnight at 35.degree. C. The mixture was cooled
to 0.degree. C. and diluted with H.sub.2O (60 mL) with rapid
stirring. The resulting precipitate was filtered, washed with
H.sub.2O (20 mL) then dried under high vacuum. The solid was then
triturated with Et.sub.2O, and the resultant white solid was
collected, to yield 36 mg of product. An extraction on the original
filtrate was done using EtOAc (2.times.75 mL) and the combined
organic layers were washed with brine (100 mL), dried over
MgSO.sub.4, and concentrated in vacuo. The resulting off-white
solid was subjected to flash chromatography on silica gel using 10%
methanol:dichloromethane. Yield: 138 mg (79.5%); .sup.1H NMR (300
MHz, DMSO-d.sub.6) .delta. 8.14 (s, 1H), 7.68 (s, 1H), 7.52-7.40
(m, 3H), 7.15-6.98 (m, 3H), 6.58 (s, 2H), 6.41 and 6.25 (2.times.s,
1H), 5.49 (s, 1H), 5.04 and 4.85 (2.times.s, 2H), 3.69 (s, 3H),
3.10 and 2.98 (2.times.s, 3H), 1.53 (s, 6H); ESI MS m/z 379
[C.sub.22H.sub.26N.sub.4O.sub.2+H].sup.+
Example 297
Preparation of
(E)-3-[6-Amino-5-(1-hydroxy-1-methyl-ethyl)-pyridin-3-yl]-N-methyl-N-(2-m-
ethyl-benzofuran-3-ylmethyl)-acrylamide
[1390] EDC (0.13 g, 0.70 mmol) was added to a suspension of
(E)-3-[6-Amino-5-(1-hydroxy-1-methyl-ethyl)-pyridin-3-yl]-acrylic
acid hydrochloride (0.15 g, 0.58 mmol), HOBt (0.09 g, 0.64 mmol),
methyl-(2-methyl-benzofuran-3-ylmethyl)-amine (0.11 g, 0.64 mmol)
and (i-Pr).sub.2EtN (0.60 mL, 2.48 mmol) in DMF (6 mL). The mixture
was allowed to stir overnight at room temperature. The mixture was
cooled to 0.degree. C. and diluted with H.sub.2O (15 mL) with rapid
stirring. The resulting precipitate was filtered, washed with
H.sub.2O (20 mL) then dried under high vacuum. The solid was then
triturated with Et.sub.2O, and the resultant beige solid was
collected, to yield 160 mg (73%) of product. .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 8.14 (s, 1H), 7.67-7.47 (m, 4H), 7.26-6.99
(m, 3H), 6.58 (s, 2H), 5.49 (s, 1H), 4.80 and 4.74 (2.times.s, 2H),
3.04 and 2.85 (2.times.s, 3H), 2.52 (s, 3H), 1.53 (s, 6H); ESI MS
m/z 380 [C.sub.22H.sub.25N.sub.3O.sub.3+H].sup.+
Example 298
Preparation of
(E)-3-(6-amino-pyridin-3-yl)-N-(3-cyano-1H-indol-2-ylmethyl)-N-methyl-acr-
ylamide
a) 1-diethoxymethyl-1H-indole-3-carbonitrile
1H-Indole-3-carbonitrile (5.07 g, 35.7 mmol) was heated with
triethylorthoformate (60 mL) in a pressure vessel at 160.degree. C.
for 3 d. Upon cooling, the solvent was evaporated and the residue
was submitted to chromatography (20% ether in hexanes) to afford
the title compound (7.46 g, 86%). NMR (300 MHz, CDCl.sub.3, 8):
7.92 (s, 1H), 7.76 (m, 1H), 7.62 (m, 1H), 7.32 (m, 2H), 6.23 (s,
1H), 3.63 (m, 4H), 1.23 (t, J=7.2 Hz, 6H).
b) 1-diethoxymethyl-2-formyl-1H-indole-3-carbonitrile
[1391] tert-Butyl lithium (18.1 mL, 31 mmol, 1.7M in pentane) was
added to a THF (100 mL) solution of
1-diethoxymethyl-1H-indole-3-carbonitrile (6.83 g, 28 mmol) at
-78.degree. C. The mixture was warmed to 10.degree. C., stirred for
30 min at this temperature, cooled to -78.degree. C. and heated
with DMF (20 mL). The mixture was warmed to 10.degree. C., stirred
for 30 min at this temperature, cooled to -78.degree. C. and
quenched with a saturated aqueous solution of NaHCO.sub.3. The
resulting mixture was treated with ether (200 mL); the organic
layer was washed with water and brine, dried and evaporated to
dryness. NMR (300 MHz, CDCl.sub.3, 8): 10.24 (s, 1H), 8.10 (d,
J=7.7 Hz, 1H), 7.91 (d, J=7.7 Hz, 1H), 7.53 (t, J=7.7 Hz, 1H), 7.43
(t, J=7.5 Hz, 1H), 7.34 (s, 1H), 3.80 (m, 2H), 3.52 (m, 2H), 1.26
(t, J=6.4 Hz, 1H).
c) 2-formyl-1H-indole-3-carbonitrile
[1392] Hydrochloric acid (4 mL, 20%) was added to a THF (100 mL)
solution of 1-diethoxymethyl-2-formyl-1H-indole-3-carbonitrile
(5.33 g, 19.57 mmol) at 0.degree. C. The mixture was stirred at
20.degree. C. for 41 h then treated with 5% aqueous K.sub.2CO.sub.3
(25 mL). The reaction mixture was concentrated to 50 mL and treated
with methylene chloride (200 mL). The organic layer was washed with
water, dried and evaporated to afford the title compound (2.81 g,
84%). .sup.1H NMR (300 MHz, DMSO-d.sub.6, 8): 13.20 (s, br, 1H),
10.02 (s, 1H), 7.82 (d, J=8.0 Hz, 1H), 7.63 (d, J=7.7 Hz, 1H), 7.51
(t, J=7.1 Hz, 1H), 7.37 (t, J=7.5 Hz, 1H).
d) 2-methylaminomethyl-1H-indole-3-carbonitrile
[1393] Methylamine (6.2 mL, 49.4 mmol, 33% in EtOH) was added to a
MeOH (50 mL) solution of 2-formyl-1H-indole-3-carbonitrile (2.80 g,
16.5 mmol) at 0.degree. C. Upon stirring for 5 h at 0.degree. C.,
NaBH.sub.4 (740 mg, 19.8 mmol) was added to the solution and the
stirring was continued for 16 h. The mixture was diluted with
water, extracted with methylene chloride; the organic layer was
dried and evaporated. The crude residue was subjected to
chromatography (1-5% MeOH in methylene chloride). The desired
fractions were collected and concentrated; the residue was
recrystallized from a methylene chloride/hexane mixture to afford
the title compound (2.30 g, 75%). .sup.1H NMR (300 MHz,
DMSO-d.sub.6, .delta.): 7.54 (m, 1H), 7.48 (m 1H), 7.21 (m, 2H),
3.93 (s, 2H), 2.31 (s, 3H). MS (ESI): m/e 186 (M+H).sup.+.
e)
3-(6-amino-pyridin-3-yl)-N-(3-cyano-1H-indol-2-ylmethyl)-N-methyl-acryl-
amide
[1394] EDC (250 mg, 1.3 mmol) was added to a solution of
(E)-3-(6-Amino-pyridin-3-yl)-acrylic acid (172 mg, 1.05 mmol),
2-methylaminomethyl-1H-indole-3-carbonitrile (186 mg, 1.0 mmol),
HOBt.H.sub.2O (135 mg, 1.0 mmol) and DIPEA (510 .mu.L, 3.0 mmol) in
dry DMF (4 mL). After 3 d of stirring, the mixture was diluted with
water (50 mL) at 10.degree. C. The resulting precipitate was
filtered, washed with water and dried to afford the title compound
(277 mg, 84%). .sup.1H NMR (300 MHz, DMSO-d.sub.6, 8): 12.1 (m,
1H), 8.16 (s, 1H), 7.84 (s, 1H), 7.5 (m, 3H), 7.2 (m, 2H), 6.97 (m,
1H), 6.44 (s, 2H), 5.08 and 4.88 (rotamers, 2s, 2H), 3.22 and 2.96
(rotamers, 2s, 3H). MS (ESI): m/e 332 (M+H).sup.+.
Example 299
Preparation of
(E)-N-(3-cyano-1H-indol-2-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro--
[1,8]naphthyridin-3-yl)-acrylamide
[1395] EDC (250 mg, 1.3 mmol) was added to a solution of
3-(7-Oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3-yl)-acrylic acid
hydrochloride (267 mg, 1.05 mmol),
2-methylaminomethyl-1H-indole-3-carbonitrile (186 mg, 1.0 mmol),
HOBt.H.sub.2O (135 mg, 1.0 mmol) and DIPEA (510 .mu.L, 3.0 mmol) in
dry DMF (4 mL). After 3 days of stirring, the mixture was diluted
with water (50 mL) at 10.degree. C. The precipitate was filtered,
washed with water and dried. The solid was stirred in MeOH (10 mL),
filtered and dried to afford 239 mg (62%) title compound. .sup.1H
NMR (300 MHz, DMSO-d.sub.6, 8): 12.28 and 12.09 (rotamers, 2s, 1H),
10.66 (s, 1H), 8.37 (s, 1H), 8.11 and 8.05 (rotamers, 2s, 1H), 7.52
(m, 3H), 7.22 (m, 3H), 5.13 and 4.90 (rotamers, 2s, 2H), 3.27 and
2.97 (rotamers, 2s, 3H), 2.92 (m, 2H), 2.55 (m, 2H). MS (ESI): m/e
386 (M+H).sup.+.
Example 300
Preparation of
(E)-N-Methyl-N-(3-methyl-benzofuran-2-ylmethyl)-3-(3-oxo-2,3,4,5-tetrahyd-
ro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)-acrylamide hydrochloride
a) (3-Cyanopyridin-2-ylamino)-acetic acid ethyl ester
[1396] 2-Chloro-3-cyanopyridine (10.0 g, 72 mmol) was dissolved
into anhydrous DMSO (200 ml). Glycine ethyl ester hydrochloride (11
g, 79 mmol) and sodium carbonate (4.5 g, 42 mmol) were added and
the mixture was stirred for 10 min under argon. Potassium fluoride
(4.2 g, 72 mmol) was added and the mixture was heated to
120.degree. C. for 48 h. The mixture was cooled to room temperature
and added to water (400 mL). The crude product was extracted with
CH.sub.2Cl.sub.2 (4.times.100 mL), dried over MgSO.sub.4 and
concentrated to an orange solid which was purified by silica gel
(CH.sub.2Cl.sub.2) to give an orange solid (7.5 g, 51%). .sup.1H
NMR (300 MHz, CDCl.sub.3) .delta. 8.27 (dd, J=5.0, 2.0 Hz, 1H),
7.69 (dd, J=7.6, 2.0 Hz, 1H), 6.66 (dd, J=7.6, 5.0 Hz, 1H), 5.70
(bs, 1H), 4.21-4.28 (m, 4H), 1.29 (t, J=7.2 Hz, 3H); ESI MS m/z 206
[C.sub.10H.sub.11N.sub.3O.sub.2+H].sup.+.
b) (3-Formylpyridin-2-ylamino)acetic acid ethyl ester
[1397] (3-Cyanopyridin-2-ylamino)acetic acid ethyl ester (2.6 g,
12.6 mmol) was dissolved into a 1:1:2 mixture of
H.sub.2O/CH.sub.3COOH/pyridine (75 mL) under argon. Sodium
hypophosphite (5.0 g) and Raney nickel (2.0 g) were added and the
mixture was stirred at room temperature for 3 h. The slurry was
filtered through a bed of celite and the filter cake was washed
with water. Concentrated NH.sub.4OH was added to the filtrate until
pH 10 was reached. The solution was extracted with ethyl acetate
(4.times.50 mL). The organic phase was washed with brine (50 mL),
dried over MgSO.sub.4 and concentrated. The product was purified by
silica gel chromatography (CH.sub.2Cl.sub.2/EtOAc 9:1) to give the
title compound as a clear yellow oil (2.16 g, 83%). .sup.1H NMR
(300 MHz, CDCl.sub.3) .delta. 9.86 (s, 1H), 8.69 (bs, 1H), 8.31
(dd, J=4.8, 1.9 Hz, 1H), 7.79 (dd, J=7.6, 2.0 Hz, 1H), 6.72 (dd,
J=7.6, 4.8 Hz, 1H), 4.32 (d, J=5.5 Hz, 2H), 4.24 (q, J=7.0 Hz, 2H),
1.29 (t, J=7.2 Hz, 3H).
c) 1,2,4,5-Tetrahydro-pyrido[2,3-e][1,4]diazepin-3-one
[1398] Raney nickel (3 g) was added to anhydrous methanol (50 mL)
under argon and washed with anhydrous methanol (4.times.50 mL).
(3-Cyanopyridin-2-ylamino)-acetic acid ethyl ester (3.35 g, 16.3
mmol) was dissolved in methanol (50 mL) and added to the Raney
nickel slurry. The reaction vessel was purged with argon for 10
min. Sodium methoxide solution (16.3 mmol, 3.75 mL) was added and
the argon purge was reapeated (5 min). The reaction flask was
charged with H.sub.2 and stirred at room temperature for 48 h.
Dilute HCl (16.3 mL of a 1 M solution) was added and the flask was
purged with argon for 30 min. The slurry was filtered through
celite and the filter cake was washed with 1:1 methanol/water. The
filtrate was concentrated and extracted with ethyl acetate
(4.times.100 mL), dried over MgSO.sub.4 and concentrated to afford
the title compound as a beige solid (850 mg, 30%). .sup.1H NMR (300
MHz, DMSO-d.sub.6) .delta. 8.07 (t, J=5.2 Hz, 1H), 7.82 (dd, J=4.9,
1.5 Hz, 1H), 7.21 (dd, J=7.1, 1.6 Hz, 1H), 6.69 (t, J=5.0 Hz, 1H),
6.43 (dd, J=7.2, 5.0 Hz, 1H), 4.24 (d, J=5.9 Hz, 2H), 3.91 (d,
J=5.1 Hz, 2H).
d) 7-Bromo-1,2,4,5-tetrahydro-pyrido[2,3-e][1,4]diazepin-3-one
[1399] 1,2,4,5-Tetrahydro-pyrido[2,3-e][1,4]diazepin-3-one (164 mg,
1.0 mmol) was dissolved into acetic acid (1 mL). Bromine (160 mg,
1.0 mmol) was added dropwise at room temperature and the solution
was stirred overnight. Hexane (5 mL) was added and the orange
precipitate was filtered and dried in vacuo. The title compound was
isolated as an orange solid (190 mg, 78%). .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 8.26 (t, J=5.7 Hz, 1H), 8.06 (d, J=2.1 Hz,
1H), 7.81 (d, J=2.1 Hz, 1H), 4.35 (d, J=5.7 Hz, 2H), 4.08 (s,
2H).
e)
3-(3-Oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)-acrylic
acid tert-butyl ester
[1400] 7-Bromo-1,2,4,5-tetrahydro-pyrido[2,3-e][1,4]diazepin-3-one
(145 mg, 0.6 mmol) and tert-butyl acrylate (307 mg, 2.4 mmol) were
dissolved in DMF (3 mL) and the reaction vessel was purged with
argon for 5 min. Tri-.sigma.-tolylphosphine (37 mg, 0.12 mmol) and
palladium acetate (14 mg, 0.06 mmol) were added and the solution
was degassed with argon. Diisopropylethylamine (0.23 mL, 1.32 mmol)
was added and the solution was degassed with argon, sealed and
heated to 90.degree. C. for 16 h. The reaction was cooled to room
temperature and filtered through a bed of celite. The filter cake
was washed with ethyl acetate (50 mL) and the filtrate was washed
with H.sub.2O (5 mL) and brine (5 mL), dried over MgSO.sub.4 and
concentrated to a brown oil. The oil was subjected to silica gel
chromatography (5% MeOH./CH.sub.2Cl.sub.2 to 10%
MeOH/CH.sub.2Cl.sub.2) to yield the title compound as a yellow
solid (96 mg, 52%). .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
8.18 (t, J=5.7 Hz, 1H), 8.07 (d, J=2.1 Hz, 1H), 7.37 (d, J=15.8 Hz,
1H), 7.35 (t, J=5.3 Hz, 1H), 6.24 (d, J=15.8 Hz, 1H), 4.28 (d,
J=5.7 Hz, 2H), 3.98 (d, J=5.1 Hz, 2H), 1.45 (s, 9H); ESI MS m/z 290
[C.sub.15H.sub.19N.sub.3O.sub.3+H].sup.+.
f)
3-(3-Oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)-acrylic
acid
[1401]
3-(3-Oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)-acr-
ylic acid tert-butyl ester (96 mg, 0.31 mmol) was dissolved into
1:1 CH.sub.2Cl.sub.2/TFA (2 mL) and stirred at room temperature for
30 min. The solvents were removed in vacuo to afford the title
compound as a brown solid (44 mg, 61%) and as a mixture of amide
rotomers. .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 8.18 (t,
J=5.7 Hz, 1H), 8.07 (d, J=2.1 Hz, 1H), 7.37 (d, J=15.8 Hz, 1H),
7.35 (t, J=5.3 Hz, 1H), 6.24 (d, J=15.8 Hz, 1H), 4.28 (d, J=5.7 Hz,
2H), 3.98 (d, J=5.1 Hz, 2H), 1.45 (s, 9H).
g)
(E)-N-Methyl-N-(3-methyl-benzofuran-2-ylmethyl)-3-(3-oxo-2,3,4,5-tetrah-
ydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)-acrylamide
hydrochloride
[1402] EDC (0.05 g, 0.27 mmol) was added to a suspension of
3-(3-Oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)-acrylic
acid (51 mg, 0.22 mmol), HOBt (0.03 g, 0.24 mmol),
methyl-(3-methyl-benzofuran-2-ylmethyl)-amine (53 mg, 0.3 mmol),
and (i-Pr).sub.2EtN (0.22 mL, 1.32 mmol) in DMF (5 mL). The mixture
was allowed to stir overnight at 40.degree. C. The mixture was
cooled to 0.degree. C. and diluted with H.sub.2O (15 mL) with rapid
stirring. The resulting precipitate was filtered, washed with
H.sub.2O (5 mL) then dried under high vacuum. The solid was then
subjected to flash chromatography on silica gel using 5%
methanol:dichloromethane. To yield the product as free base
fractions containing product are combined and concentrated to
dryness.
[1403] To obtain the hydrochloride salt, fractions containing
product were combined and treated with 1.25 mL of 2.0 M HCl in
Et.sub.2O. The resulting suspension was concentrated, triturated
with Et.sub.2O (12 mL) then filtered to give the title compound as
a beige solid (59 mg, 63%). .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 8.42 (bs, 1H), 8.23 (bs, 2H), 7.57-7.43 (m, 4H), 7.30-7.08
(m, 3H), 4.97-4.78 (m, 2H), 4.41-4.39 (m, 2H), 4.19 (s, 2H),
2.88-2.72 (m, 3H), 2.25 (s, 3H); ESI MS m/z 391
[C.sub.22H.sub.22N.sub.4O.sub.3+H].sup.+.
Example 301
Preparation of
(E)-N-(1,2-Dimethyl-1H-indol-3-ylmethyl)-N-methyl-3-(3-oxo-2,3,4,5-tetrah-
ydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)-acrylamide
[1404] According to the method of example 35 g,
3-(3-Oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)-acrylic
acid (100 mg, 0.43 mmol) and
methyl-(2-methyl-1H-indol-3-ylmethyl)-amine (91 mg, 0.52 mmol) were
coupled to yield the title compound as a brown solid (55 mg, 33%)
and as a mixture of amide rotomers. .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 11.03-10.87 (m, 1H), 8.18-8.10 (m, 2H),
7.80-7.72 (m, 1H), 7.53-7.40 (m, 2H), 7.33-7.24 (m, 2H), 7.02-6.86
(m, 2H), 4.84-4.71 (m, 2H), 4.28-4.08 (m, 2H), 3.98-3.82 (s, 2H),
2.92-2.72 (m, 3H), 2.40-2.37 (s, 3H); ESI MS m/z 390
[C.sub.22H.sub.23N.sub.5O.sub.2+H].sup.+.
Example 302
Preparation of
(E)-N-Methyl-N-(2-methyl-benzofuran-3-ylmethyl)-3-(4-methyl-3-oxo-2,3,4,5-
-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)-acrylamide
hydrochloride
a)
7-Bromo-4-methyl-1,2,4,5-tetrahydro-pyrido[2,3-e][1,4]diazepin-3-one
[1405] (3-Cyanopyridin-2-ylamino)-acetic acid ethyl ester (2.16 g,
10.4 mmol) was dissolved in anhydrous methanol (25 mL) under argon.
Methylamine (33% solution in ethanol, 3.9 mL, 31.2 mmol) was added
and the solution was stirred 3 h. The solvent was removed in vacuo
and the residue was dissolved into anhydrous methanol (25 mL).
Sodium borohydride (400 mg, 10.5 mmol) was added and the mixture
was stirred overnight at room temperature. The solvent was removed
in vacuo and the residue was treated with saturated NaHCO.sub.3
solution (25 mL); the aqueous mixture was extracted with ethyl
acetate (3.times.25 mL). The organic phase was washed with brine
(10 mL), dried over MgSO.sub.4 and concentrated to a green solid
(1.2 g, 65%). The solid was dissolved in acetic acid (12 mL) and
bromine (1.03 g, 6.8 mmol) was added dropwise. The reaction was
stirred at room temperature for 72 h and treated with diethyl ether
(50 mL). The resulting orange precipitate was collected by
filtration and purified by silica gel chromatography (5%
MeOH/CH.sub.2Cl.sub.2) to afford the title compound as a yellow
solid (310 mg, 18%). .sup.1H NMR (300 MHz, CD.sub.3OD) .delta. 7.91
(d, J=2.3 Hz, 1H), 7.52 (d, J=2.3 Hz, 1H), 4.62 (s, 2H), 4.21 (s,
2H), 3.07 (s, 3H).
b)
3-(4-Methyl-3-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl-
)-acrylic acid tert-butyl ester
[1406] According to the procedure of Example 35e
7-bromo-4-methyl-1,2,4,5-tetrahydro-pyrido[2,3-e][1,4]diazepin-3-one
(310 mg, 1.22 mmol) was converted via Heck coupling to the title
compound which was isolated as a brown oil (220 mg, 60%). .sup.1H
NMR (300 MHz, DMSO-d.sub.6) .delta. 8.08 (d, J=1.8 Hz, 1H), 7.77
(d, J=2.1 Hz, 1H), 7.44 (t, J=4.8 Hz, 1H), 7.37 (d, J=16.1 Hz, 1H),
6.24 (d, J=15.7 Hz, 1H), 4.54 (s, 2H), 4.09 (d, J=5.5 Hz, 2H), 2.72
(s, 3H), 1.45 (s, 9H).
c)
3-(4-Methyl-3-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl-
)-acrylic acid
[1407] According to the procedure of Example 35f,
3-(4-methyl-3-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)--
acrylic acid tert-butyl ester (220 mg, 0.72 mmol) was converted to
the title compound which was isolated as a brown solid
(quantitative).
d)
(E)-N-Methyl-N-(2-methyl-benzofuran-3-ylmethyl)-3-(4-methyl-3-oxo-2,3,4-
,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)-acrylamide
hydrochloride
[1408] According to the method of example 35 g,
3-(4-Methyl-3-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)--
acrylic acid (69 mg, 0.28 mmol) and
methyl-(2-methyl-benzofuran-3-ylmethyl)amine (60 mg, 0.34 mmol)
were coupled to yield the title compound as a solid (52 mg, 42%)
and as a mixture of amide rotomers. .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 8.75 (bs, 1H), 8.33-8.26 (m, 2H), 7.54-7.44
(m, 3H), 7.22-7.10 (m, 3H), 4.90-4.66 (m, 4H), 4.11 (s, 2H),
3.02-2.72 (m, 9H); ESI MS m/z 405
[C.sub.23H.sub.24N.sub.4O.sub.3+H].sup.+.
Example 303
Preparation of
(E)-N-Methyl-N-(3-methyl-benzofuran-2-ylmethyl)-3-(4-methyl-3-oxo-2,3,4,5-
-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)-acrylamide
hydrochloride
[1409] According to the method of Example 35 g
3-(4-methyl-3-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)--
acrylic acid (190 mg, 0.4 mmol) and
methyl-(3-methyl-benzofuran-2-ylmethyl)-amine (88 mg, 0.5 mmol)
were coupled to yield the title compound as a solid (100 mg, 56%)
and as a mixture of amide rotomers. .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 8.61 (bs, 1H), 8.30-8.24 (m, 2H), 7.59-7.44
(m, 3H), 7.30-7.08 (m, 3H), 4.97-4.67 (m, 4H), 4.31 (s, 2H),
3.17-2.89 (m, 6H), 2.25 (s, 3H); ESI MS m/z 405
[C.sub.23H.sub.24N.sub.4O.sub.3+H].sup.+.
Example 304
Preparation of
(E)-N-(3-Methoxy-2-propoxy-benzyl)-N-methyl-3-(4-methyl-3-oxo-2,3,4,5-tet-
rahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)-acrylamide
[1410] According to the method of example 35 g,
3-(4-methyl-3-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)--
acrylic acid (100 mg, 0.21 mmol) and
(3-methoxy-2-propoxy-benzyl)methylamine (63 mg, 0.3 mmol) were
coupled to yield the title compound as a solid (43 mg, 48%) and as
a mixture of amide rotomers. .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 8.55 (bs, 1H), 8.30-8.20 (m, 2H), 7.49-7.42 (m, 1H),
7.19-7.15 (m, 1H), 7.08-6.90 (m, 2H), 6.63 (t, J=7.2 Hz, 1H),
4.76-4.63 (m, 4H), 4.30 (s, 2H), 3.90-3.84 (m, 2H), 3.78 (s, 3H),
3.09-2.83 (m, 6H), 1.62-1.72 (m, 2H), 0.99-0.95 (m, 3H); ESI MS m/z
439 [C.sub.24H.sub.30N.sub.4O.sub.4+H].sup.+.
Example 305
Preparation of
(E)-N-Methyl-N-(2-methyl-1H-indol-3-ylmethyl)-3-(4-methyl-3-oxo-2,3,4,5-t-
etrahydro-1H-pyrido f 2,3-e) [1,4]diazepin-7-yl)-acrylamide
[1411] According to the method of example 35 g,
3-(4-methyl-3-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)--
acrylic acid (69 mg, 0.28 mmol) and
methyl-(2-methyl-1H-indol-3-ylmethyl)amine (60 mg, 0.34 mmol) were
coupled to yield the title compound as a white powder and as a
mixture of amide rotomers (40 mg, 35%). .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 10.86 (s, 1H), 8.12 (bs, 1H), 7.77 (bs, 1H),
7.49-7.41 (m, 2H), 7.34-7.30 (m, 1H), 7.25-7.22 (m, 1H), 7.00-6.85
(m, 3H), 4.84-4.71 (m, 2H), 4.53 (s, 2H), 4.09-4.07 (m, 2H),
2.93-2.91 (m, 6H), 2.40 (bs, 3H); ESI MS m/z 404.
Example 306
Preparation of
(E)-N-(3-Methoxy-2-propoxy-benzyl)-N-methyl-3-(2-oxo-2,3,4,5-tetrahydro-1-
H-pyrido[2,3-e][1,4]diazepin-7-yl)-acrylamide hydrochloride
[1412] According to the method of Example 35 g,
3-(2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)-acrylic
acid (152 mg, 0.5 mmol) and (3-methoxy-2-propoxy-benzyl)methylamine
(125 mg, 0.6 mmol) were coupled. The resulting free base was
converted to the hydrochloride salt according the method of Example
35 g to yield the title compound as a solid (56 mg, 24%). .sup.1H
NMR (300 MHz, DMSO-d.sub.6) .delta. 11.06-11.04 (m, 1H), 10.29 (bs,
1H), 8.75-8.69 (m, 1H), 8.32-8.24 (m, 1H), 7.60-7.53 (m, 1H),
7.37-7.32 (m, 1H), 7.04-6.93 (m, 2H), 6.69-6.60 (m, 1H), 4.79-4.64
(m, 2H), 4.27-4.22 (m, 2H), 3.91-3.81 (m, 4H), 3.78 (s, 3H),
2.88-2.72 (m, 3H), 1.73-1.66 (m, 2H), 1.00-0.93 (m, 3H); ESI MS m/z
425 [C.sub.23H.sub.28N.sub.4O.sub.4+H].sup.+.
Example 307
Preparation of
(E)-N-Methyl-N-(2-methyl-1H-indol-3-ylmethyl)-3-(4-methyl-2-oxo-2,3,4,5-t-
etrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)-acrylamide
[1413] According to the method of example 35 g,
methyl-(2-methyl-1H-indol-3-ylmethyl)amine (115 mg, 0.66 mmol) and
3-(4-Methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)--
acrylic acid (192 mg, 0.6 mmol) were coupled to give crude product.
Purification by column chromatography (silica gel,
CH.sub.2Cl.sub.2/MeOH/NH.sub.3, 9:4.55:0.05) gave title compound
(24 mg, 9%) as a white solid and as a mixture of amide rotomers.
.sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 8.48 (s, 1H), 7.95-8.01
(m, 2H), 7.56-7.60 (m, 2H), 7.47-7.50 (m, 1H), 7.16-7.26 (m, 2H),
6.92-7.05 (m, 2H), 3.90 (s, 2H), 3.56 (s, 2H), 3.02 (s, 2H), 2.93
(s, 3H), 2.83 (s, 3H), 2.46 (s, 3H); MS (ESI) m/e 404
(C.sub.23H.sub.25N.sub.5O.sub.2+H).sup.+.
Example 308
Preparation of
(E)-3-(6-Amino-pyridin-3-yl)-N-(3-chloro-benzofuran-2-ylmethyl)-N-methyl--
acrylamide hydrochloride
a) 2-Carboxymethoxybenzoic acid
[1414] To a solution of salicylic acid (20 g, 145 mmol) in water
(200 mL) is added carefully sodium hydroxide (60 g, 1.45 mol)
followed by chloroacetic acid (27 g, 290 mmol). The mixture is
refluxed for 5 d, cooled to room temperature and the precipitate is
filtered and dried. Trituration with hexanes yielded the title
compound (6.84 g, 24%) as a pink solid. .sup.1H NMR (400 MHz,
DMSO-d.sub.6) .delta. 7.65-7.66 (dd, 1H, J=8.0, 2.0 Hz), 7.45-7.47
(dd, 1H, J=8.0, 2.0 Hz), 6.97-7.05 (m, 2H), 4.77 (s, 2H).
b) 3-Chlorobenzofuran-2-carboxaldehyde
[1415] To a cooled solution of phosphorus oxychloride (19 mL, 209
mmol) in DMF (40 mL) is slowly added 2-carboxymethoxybenzoic acid
(6.84 g, 35 mmol) in portions. The mixture is warmed to room
temperature for 30 min and then heated to 90.degree. C. overnight.
The mixture is cooled to room temperature and poured carefully into
ice water, extracted with ethyl acetate (3.times.50 mL), dried with
sodium sulfate and concentrated in vacuo. Purification by column
chromatography (silica, hexanes/ethyl acetate, 4:1) gave title
compound (1.62 g, 26%) as an orange solid. .sup.1H NMR (400 MHz,
DMSO-d.sub.6) .delta. 9.98 (s, 1H), 7.82-7.88 (m, 2H), 7.69-7.73
(m, 1H), 5.51-7.56 (m, 1H).
c) (3-Chloro-benzofuran-2-ylmethyl)methylamine
[1416] To a solution of 3-chlorobenzofuran-2-carboxaldehyde (1.62
g, 8.9 mmol) in methanol (50 mL) is added N-methylamine (33%
solution in ethanol, 1.11 g, 35.9 mmol) and stirred overnight at
room temperature. The mixture is concentrated in vacuo, re-solvated
in methanol (50 mL) and cooled in an ice bath. Sodium borohydride
(407 mg, 10.8 mmol) is added in portions and the mixture stirred at
room temperature for 4 h. The mixture is concentrated in vacuo,
re-solvated in 1.3M sodium hydroxide solution, stirred for 20 min,
extracted with ethyl acetate, dried with sodium sulfate and
concentrated. Purification by column chromatography (silica,
CH.sub.2Cl.sub.2/MeOH, 9/1) gave title compound (1.43 g, 82%) as a
colorless oil. .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
7.55-7.63 (m, 2H), 7.33-7.42 (m, 2H), 3.93 (s, 2H), 2.27 (s,
3H).
(d)
(E)-3-(6-Amino-pyridin-3-yl)-N-(3-chloro-benzofuran-2-ylmethyl)-N-meth-
yl-acrylamide hydrochloride
[1417] EDC (0.21 g, 1.08 mmol) was added to a suspension of
3-(6-amino-pyridin-3-yl)-acrylic acid (148 mg, 0.9 mmol), HOBt (134
mg, 1 mmol), (3-chloro-benzofuran-2-ylmethyl)methylamine (194 mg,
0.99 mmol), and (i-Pr).sub.2EtN (0.75 mL, 4.46 mmol) in DMF (16
mL). The mixture was stirred overnight at room temperature then
cooled to 0.degree. C. and diluted with H.sub.2O (32 mL) with rapid
stirring. The resulting precipitate was collected by filtration,
washed with H.sub.2O (32 mL) and dried under high vacuum. The
residue was re-solvated in methylene chloride (5 mL) and a solution
of 2M HCl in ether (2 mL) was added to precipitate the hydrogen
chloride salt. The precipitate was collected by filtration and
dried to give the title compound (295 mg, 89%) as a white solid and
as a mixture of amide rotomers. NMR (300 MHz, DMSO-d.sub.6) .delta.
8.40-8.42 (m, 3H), 7.57-7.65 (m, 2H), 7.38-7.46 (m, 3H), 6.98-7.03
(m, 1H), 4.86-5.05 (rotamers, 2s, 2H), 3.20 (s, 3H); MS (ESI) m/e
342 (C.sub.18H.sub.16ClN.sub.3O.sub.2+H).sup.+.
Example 309
Preparation of
(E)-N-(3-Chloro-benzofuran-2-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahyd-
ro-[1,8]naphthyridin-3-yl)-acrylamide
[1418] According to the method of example 43d,
3-(7-Oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3-yl)-acrylic acid
(203 mg, 0.8 mmol) and (3-chloro-benzofuran-2-ylmethyl)methylamine
(172 mg, 0.88 mmol) were coupled to yield the title compound (176,
56%) as a white solid and as a mixture of amide rotomers. NMR (300
MHz, DMSO-d.sub.6) .delta. 10.63 (s, 1H), 8.40 (s, 1H), 8.09 (s,
1H), 7.21-7.64 (m, 6H), 4.84-5.08 (rotamers, 2s, 2H), 3.22 (s, 3H),
2.91-2.96 (m, 2H), 2.52-2.59 (m, 2H); MS (ESI) m/e 396
(C.sub.21H.sub.18ClN.sub.3O.sub.3+H).sup.+.
Example 310
Preparation of
(E)-N-(3-Chloro-benzofuran-2-ylmethyl)-N-methyl-3-(2-oxo-2,3,4,5-tetrahyd-
ro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)-acrylamide hydrochloride
[1419] According to the method of example 43d,
3-(2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)-acrylic
acid hydrochloride (152 mg, 0.5 mmol) and
(3-chloro-benzofuran-2-ylmethyl)methylamine (108 mg, 0.55 mmol)
were coupled to yeild crude product which was triturated with
methanol and ether several times and dried. The residue was
re-solvated in methylene chloride (5 mL) and a solution of 2M HCl
in ether (2 mL) was added to precipitate the hydrogen chloride
salt. The precipitate was collected by filtration and dried to give
the title compound (42 mg, 19%) as a white solid and as a mixture
of amide rotomers. NMR (400 MHz, DMSO-d.sub.6) .delta. 10.06 (s,
1H), 8.45 (s, 1H), 8.01 (s, 1H), 7.38-7.68 (m, 6H), 4.88-5.08
(rotamers, 2s, 2H), 3.90 (s, 2H), 3.63 (s, 2H), 3.31 (s, 3H); MS
(ESI) m/e 411 (C.sub.21H.sub.19ClN.sub.4O.sub.3+H).sup.+.
Example 311
Preparation of
(E)-N-(1H-Indol-5-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]nap-
hthyridin-3-yl)-acrylamide
[1420] According to the procedure of Example 35 g
(1H-indol-5-yl-methyl)-methyl-amine (257 mg, 1.62 mmol) and
(E)-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3yl)acrylic acid
hydrochloride (312 mg, 1.23 mmol), were coupled to give crude
product. Purification by column chromatography (silica gel, 5%
MeOH/CH.sub.2Cl.sub.2) gave the title compound (172 mg, 39%) as a
white solid and a mixture of amide rotomers: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 11.06-11.05 (m, 1H), 10.63-10.61 (m, 1H),
8.36-8.34 (m, 1H), 8.06 (s, 1H), 7.56-7.19 (m, 5H), 7.02-6.96 (m,
1H), 6.38 (s, 1H), 4.84-4.65 (m, 2H), 3.06-2.85 (m, 5H), 2.55-2.52
(m, 2H); ESI MS m/e 361
[C.sub.21H.sub.20N.sub.4O.sub.2+H].sup.+.
Example 311
Preparation of
(E)-N-Methyl-N-(1-methyl-1H-indol-5-ylmethyl)-3-(7-oxo-5,6,7,8-tetrahydro-
[1,8]naphthyridin-3-yl)-acrylamide
a) Methyl-(1-methyl-1H-indol-5-ylmethyl)-amine
[1421] 1-Methyl-1H-indole-5-carbaldehyde (338 mg, 2.13 mmol) was
dissolved in anhydrous methanol (10 ml). Methylamine (0.80 ml of
33% solution in ethanol, 6.43 mmol) was added and the reaction was
stirred for 3 h. The solution was concentrated to a brown oil and
then dissolved in anhydrous methanol (10 ml). Sodium borohydride
(83.0 mg, 2.19 mmol) was added and the mixture was stirred
overnight at room temperature. Water (4 ml) was added and the
solution was concentrated. Sodium hydroxide (8 ml, 1N) was added
and the aqueous layer was extracted with ethyl acetate (3.times.20
ml). Combined organic layers were dried over MgSO.sub.4, filtered
and concentrated to afford
methyl-(1-methyl-1H-indol-5-ylmethyl)-amine (167 mg, 45%) as an
orange oil: .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta. 7.44 (s,
1H), 7.34 (d, J=8.0 Hz, 1H), 7.261 (d, J=3.2 Hz, 1H), 7.11 (d,
J=12.0 Hz, 1H), 6.345 (d, J=4.0 Hz, 1H), 3.75 (s, 3H), 3.70 (s,
2H), 2.25 (s, 3H).
b) Preparation of
N-Methyl-N-(1-methyl-1H-indol-5-ylmethyl)-3-(7-oxo-5,6,7,8-tetrahydro-[1,-
8]naphthyridin-3-yl)-acrylamide
[1422] According to the procedure of Example 35 g,
(methyl-(1-methyl-1H-indol-5-ylmethyl)-amine (155 mg, 0.89 mmol)
and (E)-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3yl)acrylic
acid hydrochloride (229 mg, 0.90 mmol), were coupled to give crude
product. Purification by column chromatography (silica gel, 5%
MeOH/CH.sub.2Cl.sub.2) gave the title compound (217 mg, 65%) as a
red solid and a mixture of amide rotomers: .sup.1H NMR (400 MHz,
DMSO-d.sub.6) .delta. 10.63-10.62 (m, 1H), 8.36-8.33 (m, 1H), 8.06
(s, 1H), 7.56-7.51 (m, 1H), 7.43-7.19 (m, 4H), 7.08-7.01 (m, 1H),
6.38 (s, 1H), 4.85-4.67 (m, 2H), 3.76 (s, 3H), 3.06-2.85 (m, 5H),
2.54-2.52 (m, 2H); ESI MS m/z 375
[C.sub.22H.sub.22N.sub.4O.sub.2+H].sup.+.
Example 312
Preparation of
(E)-N-(3-tert-Butyl-2-propoxy-benzyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydr-
o-[1,8]naphthyridin-3-yl)-acrylamide
a) 3-tert-Butyl-2-propoxy-benzaldehyde
[1423] To a solution of 3-tert-butyl-2-hydroxy-benzaldehyde (2.04
g, 11.5 mmol) and K.sub.2CO.sub.3 (7.91 g, 57.3 mmol) in anhydrous
DMF (23 ml) was added 1-iodopropane (2.34 ml, 24.0 mmol). The
reaction mixture was left to stir for 48 h at room temperature. The
reaction mixture was diluted with water (100 ml) and extracted with
ethyl acetate (3.times.50 ml). Combined organic layers were washed
with water (50 ml) and brine (50 ml), dried over MgSO.sub.4,
filtered and the solvent was removed in vacuo to give a yellow oil.
Purification by column chromatography (silica gel, gradient elution
of hexanes to 20% EtOAc/hxanes) gave
3-tert-butyl-2-propoxy-benzaldehyde (2.55 g, 99%) as a yellow oil:
.sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta. 10.21 (s, 1H), 7.62 (s,
1H), 7.61 (s, 1H), 7.19 (t J=8.0, 1H), 3.89 (t, J=8.0 Hz, 2H),
1.91-1.82 (m, 2H), 1.37 (s, 9H), 1.03 (t, J=8.0 Hz, 3H).
b) (3-tert-Butyl-2-propoxy-benzyl)-methyl-amine
[1424] 3-tert-Butyl-2-propoxy-benzaldehyde (1.15 g, 5.21 mmol) was
dissolved in anhydrous methanol (25 ml). Methylamine (2.00 ml of
33% solution in ethanol, 16.1 mmol) was added and the reaction was
stirred for 3 h. The solution was concentrated to a yellow oil and
then dissolved in anhydrous methanol (25 ml). Sodium borohydride
(198 mg, 5.23 mmol) was added and the mixture was stirred overnight
at room temperature. Water (10 ml) was added and the solution was
concentrated. Sodium hydroxide (30 ml, 1N) was added and the
aqueous layer was extracted with ethyl acetate (3.times.50 ml).
Combined organic layers were dried over MgSO.sub.4, filtered and
concentrated to afford (3-tert-butyl-2-propoxy-benzyl)-methyl-amine
(1.18 g, 96%) as a clear oil: .sup.1H NMR (400 MHz, DMSO-d.sub.6)
.delta. 7.28 (d, J=8.0 Hz, 1H), 7.15 (d, J=8.0 Hz, 1H), 6.97 (y
J=8.0, y1H), 3.79 (t, J=4.0 Hz, 2H), 3.61 (s, 2H), 2.28 (s, 3H),
1.80-1.75 (m, 2H), 1.33 (s, 9H), 1.03 (t, J=8.0 Hz, 3H).
c)
N-(3-tert-Butyl-2-propoxy-benzyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro--
[1,8]naphthyridin-3-yl)-acrylamide
[1425] According to the procedure of Example 35 g,
3-tert-butyl-2-propoxy-benzyl)-methyl-amine (368 mg, 1.56 mmol) and
(E)-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3yl)acrylic acid
hydrochloride (402 mg, 1.58 mmol), were coupled to give crude
product. Purification by column chromatography (silica gel,
gradient elution of 50% EtOAc/Hexane to EtOAc) gave the title
compound as an off-white solid (519 mg, 76%) as a mixture of amide
rotomers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.65-10.64
(m, 1H), 8.38-8.31 (m, 1H), 8.10-7.93 (m, 1H), 7.55-7.48 (m, 1H),
7.29-7.22 (m, 2H), 7.07-6.90 (m, 2H), 4.80-4.69 (m, 2H), 3.81-3.73
(m, 2H), 3.06-2.85 (m, 5H), 2.57-2.54 (m, 2H), 1.90-1.79 (m, 2H),
1.37 (s, 9H), 1.09-1.02 (m, 3H); ESI MS m/e 436
[C.sub.26H.sub.33N.sub.3O.sub.3/H].sup.+.
Example 313
Preparation of
(E)-N-Methyl-N-(1-methyl-1H-indol-6-ylmethyl)-3-(7-oxo-5,6,7,8-tetrahydro-
-[1,8]naphthyridin-3-yl)-acrylamide
a) 1-Methyl-1H-indole-6-carbaldehyde
[1426] Dess-Martin periodane (2.56 g, 6.04 mmol) was dissolved into
anhydrous CH.sub.2Cl.sub.2 (25 ml). (1H-Indol-6-yl)-methanol (883
mg, 6.04 mmol) in anhydrous CH.sub.2Cl.sub.2 (20 ml) was added and
the mixture was stirred for 1 h. Aqueous sodium hydroxide (12 ml of
1N solution) was added and the reaction was stirred for 30 min. The
organic layer was separated and washed with water (10 ml), brine
(10 ml), dried over MgSO.sub.4, filtered and concentrated to a
thick brown oil. Purification by column chromatography (silica gel,
gradient elution of 2% MeOH/CH.sub.2Cl.sub.2 to 5%
MeOH/CH.sub.2Cl.sub.2) gave 1H-indole-6-carbaldehyde (212 mg, 24%)
as a brown solid: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 11.67
(bs, 1H), 9.99 (s, 1H), 7.97 (s, 1H), 7.70-7.65 (m, 2H), 7.54-7.50
(m, 1H), 6.59-5.54 (m, 1H).
b) 1-Methyl-1H-indole-6-carbaldehyde
[1427] 1-Methyl-1H-indole-6-carbaldehyde (146 mg, 0.91 mmol) was
dissolved in anhydrous methanol (4 ml). Methylamine (0.35 ml of 33%
solution in ethanol, 2.81 mmol) was added and the reaction was
stirred for 3 h. The solution was concentrated to a yellow oil and
then dissolved in anhydrous methanol (4 ml). Sodium borohydride
(34.9 mg, 0.92 mmol) was added and the mixture was stirred
overnight at room temperature. Water (10 ml) was added and the
solution was concentrated. Sodium hydroxide (10 ml, 1N) was added
and the aqueous layer was extracted with ethyl acetate (3.times.20
ml). Combined organic layers were dried over MgSO.sub.4, filtered
and concentrated to afford
methyl-(1-methyl-1H-indol-6-ylmethyl)-amine (139 mg, 87%) as a
yellow oil: .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta. 7.44 (d,
J=8.0 Hz, 1H), 7.34 (s, 1H), 7.240 (d, J=3.6, 1H), 6.98 (d, J=8.0
Hz, 1H), 6.345 (d, J=4.0 Hz, 1H)), 3.75 (s, 3H), 3.73 (s, 2H), 2.27
(s, 3H).
c) Preparation of
N-Methyl-N-(1-methyl-1H-indol-6-ylmethyl)-3-(7-oxo-5,6,7,8-tetrahydro-[1,-
8]naphthyridin-3-yl)-acrylamide
[1428] According to the procedure of Example 35 g
methyl-(1-methyl-1H-indol-6-ylmethyl)-amine (129 mg, 0.74 mmol) and
(E)-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3yl)acrylic acid
hydrochloride (190 mg, 0.75 mmol), were coupled to give crude
product. Purification by column chromatography (silica gel, 5%
MeOH/CH.sub.2Cl.sub.2) gave the title compound (180 mg, 65%) as a
pink solid and a mixture of amide rotomers: .sup.1H NMR (400 MHz,
DMSO-d.sub.6) .delta. 10.64-10.62 (m, 1H), 8.36-8.33 (m, 1H),
8.07-8.06 (m, 1H), 7.55-7.47 (m, 2H), 7.39-7.21 (m, 3H), 6.95-6.88
(m, 1H), 6.38-6.37 (m, 1H), 4.89-4.71 (m, 2H), 3.76-3.74 (m, 3H),
3.08-2.85 (m, 5H), 2.54-2.52 (m, 2H); ESI MS m/z 375
[C.sub.22H.sub.22N.sub.4O.sub.2+H].sup.+.
Example 314
Preparation of
(E)-N-(3,4-Dihydro-2H-benzo[b][1,4]dioxepin-6-ylmethyl)-N-methyl-3-(7-oxo-
-5,6,7,8-tetrahydro-[1,8]naphthyridin-3-yl)-acrylamide
a)
(3,4-Dihydro-2H-benzo[b][1,4]dioxepin-6-ylmethyl)-methyl-amine
[1429] 3,4-Dihydro-2H-benzo[b][1,4]dioxepine-6-carbaldehyde (269
mg, 1.51 mmol) was dissolved in anhydrous methanol (7 ml).
Methylamine (0.60 ml of 33% solution in ethanol, 4.82 mmol) was
added and the reaction was stirred for 3 hours. The solution was
concentrated to a yellow oil and then dissolved in anhydrous
methanol (7 ml). Sodium borohydride (58.3 mg, 1.54 mmol) was added
and the mixture was stirred overnight at room temperature. Water
(10 ml) was added and the solution was concentrated. Sodium
hydroxide (20 ml, 1N) was added and the aqueous layer was extracted
with ethyl acetate (3.times.40 ml). Combined organic layers were
dried over MgSO.sub.4, filtered and concentrated to afford
(3,4-dihydro-2H-benzo[b][1,4]dioxepin-6-ylmethyl)-methyl-amine (251
mg, 86%) as a brown oil: .sup.1H NMR (400 MHz, DMSO-d.sub.6)
.delta. 6.96 (dd, J=8.0, 4.0 Hz, 1H), 6.88-6.82 (m, 2H), 4.10-4.05
(m, 4H), 3.60 (s, 2H), 2.25 (s, 3H), 2.10-2.06 (m, 2H).
b)
N-(3,4-Dihydro-2H-benzo[b][1,4]dioxepin-6-ylmethyl)-N-methyl-3-(7-oxo-5-
,6,7,8-tetrahydro-[1,8]naphthyridin-3-yl)-acrylamide
[1430] According to the procedure of Example 35 g
(3,4-dihydro-2H-benzo[b][1,4]dioxepin-6-ylmethyl)-methyl-amine (239
mg, 1.24 mmol) and
(E)-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3yl)acrylic acid
hydrochloride (318 mg, 1.25 mmol), were coupled to give crude
product. Purification by column chromatography (silica gel, 5%
MeOH/CH.sub.2Cl.sub.2) gave the title compound (385 mg, 79%) as a
yellow solid and a mixture of amide rotomers: .sup.1H NMR (400 MHz,
DMSO-d.sub.6) .delta. 10.66-10.63 (m, 1H), 8.36-8.32 (m, 1H),
8.07-8.03 (m, 1H), 7.51-7.46 (m, 1H), 7.30-721 (m, 1H), 6.93-6.88
(m, 2H), 6.78-6.76 (m, 1H), 4.76-4.59 (m, 2H), 4.13-4.06 (m, 4H),
3.11-2.84 (m, 5H), 2.54-2.52 (m, 2H), 2.11-2.07 (m, 2H); ESI MS m/e
394 [C.sub.22H.sub.23N.sub.3O.sub.4+H].sup.+.
Example 315
Preparation of
(E)-N-(2,2-Dimethyl-2,3-dihydro-benzofuran-7-ylmethyl)-N-methyl-3-(7-oxo--
5,6,7,8-tetrahydro-[1,8]naphthyridin-3-yl)-acrylamide
a)
(2,2-Dimethyl-2,3-dihydro-benzofuran-7-ylmethyl)-methyl-amine
[1431] 2,2-Dimethyl-2,3-dihydro-benzofuran-7-carbaldehyde (281 mg,
1.59 mmol) was dissolved in anhydrous methanol (7 ml). Methylamine
(0.63 ml of 33% solution in ethanol, 4.82 mmol) was added and the
reaction was stirred for 3 h. The solution was concentrated to a
yellow oil and then dissolved in anhydrous methanol (7 ml). Sodium
borohydride (61.5 mg, 1.63 mmol) was added and the mixture was
stirred overnight at room temperature. Water (5 ml) was added and
the solution was concentrated. Sodium hydroxide (20 ml, 1N) was
added and the aqueous layer was extracted with ethyl acetate
(3.times.40 ml). Combined organic layers were dried over
MgSO.sub.4, filtered and concentrated to afford
(2,2-Dimethyl-2,3-dihydro-benzofuran-7-ylmethyl)-methyl-amine (303
mg, 99%) as a yellow oil: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 7.06-7.02 (m, 2H), 6.76-6.71 (m, 1H), 3.52 (s, 2H), 2.97
(s, 2H), 2.24 (s, 3H), 1.39 (s, 6H).
b)
N-(2,2-Dimethyl-2,3-dihydro-benzofuran-7-ylmethyl)-N-methyl-3-(7-oxo-5,-
6,7,8-tetrahydro-[1,8]naphthyridin-3-yl)-acrylamide
[1432] According to the procedure of Example 35 g,
(2,2-dimethyl-2,3-dihydro-benzofuran-7-ylmethyl)-methyl-amine (284
mg, 1.48 mmol) and
(E)-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3yl)acrylic acid
hydrochloride (382 mg, 1.50 mmol), were coupled to give crude
product. Purification by column chromatography (silica gel, 5%
MeOH/CH.sub.2Cl.sub.2) gave the title compound (422 mg, 73%) as an
orange solid and a mixture of amide rotomers. .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 10.65-10.64 (m, 1H), 8.35-8.34 (m, 1H),
8.06-8.01 (m, 1H), 7.51-7.44 (m, 1H), 7.37-7.07 (m, 2H), 6.92-6.89
(m, 1H), 6.81-6.73 (m, 1H), 4.65-4.49 (m, 2H), 3.11-2.87 (m, 7H),
2.55-2.53 (m, 2H), 1.42-1.39 (m, 6H); ESI MS m/e 392
[C.sub.23H.sub.25N.sub.3O.sub.3+H].sup.+.
Example 316
Preparation of
(E)-N-(1H-Indol-4-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]nap-
hthyridin-3-yl)-acrylamide
a) (1H-Indol-4-yl)-methanol
[1433] 1H-Indole-6-carboxylic acid (1.00 g, 6.23 mmol) was
dissolved into anhydrous THF (20 ml) under argon. The solution was
cooled in an ice bath and lithium aluminum hydride (13.1 ml of 1M
solution in THF, 13.1 mmol) was added dropwise. The reaction
mixture was allowed to warm to room temperature and stir overnight.
The reaction mixture was cooled to 0.degree. C. and ethyl acetate
(10 ml) was carefully added, followed by methanol (5 ml) and water
(5 ml). The mixture was stirred for 30 min and filtered through
celite. The solution was concentrated and dissolved in ethyl
acetate (200 ml) and washed with brine (2.times.100 ml), dried over
MgSO.sub.4, filtered and concentrated to yield
(1H-indol-4-yl)-methanol (471 mg, 52%) as an orange oil: .sup.1H
NMR (400 MHz, DMSO-d.sub.6) .delta. 11.04 (bs, 1H), 7.30-7.26 (m,
2H), 7.05-6.98 (m, 2H), 6.48-6.47 (m, 1H), 5.04 (t, J=4.0 Hz, 1H),
4.74 (d, J=8.0 Hz, 2H).
b) 1H-Indole-4-carbaldehyde
[1434] Dess-Martin periodane (1.04 g, 2.46 mmol) was dissolved into
anhydrous CH.sub.2Cl.sub.2 (10 ml). (1H-Indol-4-yl)-methanol (449
mg, 3.07 mmol) in anhydrous CH.sub.2Cl.sub.2 (10 ml) was added and
the mixture was stirred for 1 h. Sodium hydroxide (50 ml of 1N
solution) and ether (50 ml) were added and the reaction was stirred
for 30 min. The organic layer was separated and washed with water
(10 ml), brine (10 ml), dried over MgSO.sub.4, filtered and
concentrated to a thick brown oil. Purification by column
chromatography (silica gel, gradient elution of 2%
MeOH/CH.sub.2Cl.sub.2 to 5% MeOH/CH.sub.2Cl.sub.2) gave
1H-indole-4-carbaldehyde (235 mg, 53%) as a yellow solid: .sup.1H
NMR (300 MHz, DMSO-d.sub.6) .delta. 11.59 (bs, 1H), 10.18 (s, 1H),
7.78-7.75 (m, 1H), 7.66-7.60 (m, 2H), 7.33-7.28 (m, 1H), 7.08 (d,
J=3.0 Hz, 1H).
c) (1H-Indol-4-ylmethyl)-methyl-amine
[1435] 1H-Indole-4-carbaldehyde (219 mg, 1.51 mmol) was dissolved
in anhydrous methanol (7 ml). Methylamine (0.60 ml of 33% solution
in ethanol, 4.82 mmol) was added and the reaction was stirred for 3
h. The solution was concentrated to an orange solid and then
dissolved in anhydrous methanol (7 ml). Sodium borohydride (58.0
mg, 1.53 mmol) was added and the mixture was stirred overnight at
room temperature. Water (10 ml) was added and the solution was
concentrated. Sodium hydroxide (10 ml, 1N) was added and the
aqueous layer was extracted with ethyl acetate (3.times.20 ml).
Combined organic layers were dried over MgSO.sub.4, filtered and
concentrated to afford (1H-indol-4-ylmethyl)-methyl-amine (229 mg,
94%) as a brown solid: .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta.
11.03 (bs, 1H), 7.29-7.24 (m, 2H), 7.03-6.93 (m, 2H), 6.51-6.50 (m,
1H), 3.88 (s, 2H), 2.30 (s, 3H).
d)
N-(1H-Indol-4-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]napht-
hyridin-3-yl)-acrylamide
[1436] According to the procedure of Example 35 g,
(1H-indol-4-ylmethyl)-methyl-amine (223 mg, 1.39 mmol) and
(E)-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3yl)acrylic acid
hydrochloride (359 mg, 1.41 mmol), were coupled to give crude
product. Purification by column chromatography gave the title
compound (369 mg, 73%) as a pink solid and a mixture of amide
rotomers: .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta. 11.20-11.14
(m, 1H), 10.65-10.62 (m, 1H), 8.38-8.32 (m, 1H), 8.08-7.99 (m, 1H),
7.59-7.53 (m, 1H), 7.37-7.21 (m, 3H), 7.09-7.03 (m, 1H), 6.89-6.76
(m, 1H), 6.51 (s, 1H), 5.06-4.88 (m, 2H), 3.04-2.83 (m, 5H),
2.56-2.52 (m, 2H); ESI MS m/z 361
[C.sub.21H.sub.26N.sub.4O.sub.2+H].sup.+.
Example 317
Preparation of
(E)-3-(2,2-Dimethyl-3-oxo-3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)-N-
-methyl-N-(1-methyl-1H-indol-2-ylmethyl)-acrylamide
[1437] According to the procedure of Example 43d,
methyl-(1-methyl-1H-indol-2-ylmethyl)-amine (124 mg, 0.71 mmol) and
3-(2,2-dimethyl-3-oxo-3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)-acryl-
ic acid (160 mg, 0.64 mmol), were coupled to yield the title
compound (167 mg, 64%) as a white solid and as a mixture of amide
rotomers. NMR (400 MHz, DMSO-d.sub.6) .delta. 11.03-11.04 (m, 1H),
8.15-8.20 (m, 1H), 7.89-7.94 (m, 1H), 7.41-7.56 (m, 3H), 7.39-7.41
(m, 1H), 7.00-7.12 (m, 1H), 6.14-6.99 (m, 1H), 4.87-5.05 (m, 2H),
3.68-3.72 (m, 3H), 2.99-3.10 (m, 3H), 1.39-1.44 (m, 6H); MS (ESI)
m/e 405 (C.sub.23H.sub.24N.sub.4O.sub.3+H).sup.+.
Example 318
Preparation of
(E)-3-(2,2-Dimethyl-3-oxo-3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)-N-
-methyl-N-(2-methyl-benzofuran-3-ylmethyl)-acrylamide
[1438] According to the procedure of Example 43d,
methyl-(2-methyl-benzofuran-3-ylmethyl)-amine (124 mg, 0.71 mmol)
and
3-(2,2-dimethyl-3-oxo-3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)-acryl-
ic acid (160 mg, 0.64 mmol) were coupled to yield the title
compound (211 mg, 81%) as a white solid and as a mixture of amide
rotomers. .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta. 11.39 (1s,
1H), 8.20 (1s, 1H), 7.92 (1s, 1H), 7.54-7.58 (m, 2H), 7.46-7.48 (m,
1H), 7.17-7.25 (m, 3H), 4.72-4.93 (m, 2H), 3.32 (s, 3H), 3.04 (s,
2H), 2.47 (s, 3H), 1.43 (1s, 6H); MS (ESI) m/e 406
(C.sub.23H.sub.23N.sub.3O.sub.4+H).sup.+.
Example 319
Preparation of
(E)-3-(2,2-Dimethyl-3-oxo-3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)-N-
-(3-methoxy-2-propoxy-benzyl)-N-methyl-acrylamide
[1439] To a solution of (3-methoxy-2-propoxy-benzyl)-methyl-amine
(115 mg, 0.55 mmol) in DMF (5 mL) were added in sequential order
3-(2,2-dimethyl-3-oxo-3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)-acryl-
ic acid (181 mg, 0.5 mmol), 1-hydroxybenzotriazole (74 mg, 0.55
mmol), diisopropylethylamine (261 uL, 1.5 mmol), and
N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide (110 mg, 0.55 mmol).
The reaction was placed in a microwave at 130.degree. C. for 5 min.
The solution was cooled in an ice bath and water was added with
rapid stirring. The precipitate was filtered, dried and triturated
with diethyl ether to yield the title compound (164 mg, 75%) as a
white solid and as a mixture of amide rotomers: .sup.1H NMR (400
MHz, DMSO-d.sub.6) .delta. 11.37-11.39 (m, 1H), 8.14-8.18 (m, 1H),
7.87-7.93 (m, 1H), 7.47-7.53 (m, 1H), 7.27-7.34 (m, 1H), 6.92-7.09
(m, 3H), 6.60-6.66 (m, 1H), 4.62-4.79 (m, 2H), 3.84-3.90 (m, 2H),
3.78 (s, 3H), 2.88-3.09 (m, 3H), 1.70-1.74 (m, 2H), 1.40-1.49 (m
6H), 0.93-0.99 (m, 3H); MS (ESI) m/e 440
(C.sub.24H.sub.29N.sub.3O.sub.5+H).sup.+.
Example 320
Preparation of
(E)-3-(3,4-Dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)-N-methyl-N-(2-methyl-
-benzofuran-3-ylmethyl)-acrylamide hydrochloride
[1440] To a solution of
methyl-(2-methyl-benzofuran-3-ylmethyl)-amine (159 mg, 0.91 mmol)
in DMF (5 mL) were added in sequential order
3-(3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)-acrylic acid
hydrochloride (171 mg, 0.83 mmol), 1-hydroxybenzotriazole (127 mg,
0.91 mmol), diisopropylethylamine (289 uL, 1.06 mmol), and
N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide (182 mg, 0.91 mmol).
The mixture was stirred at room temperature overnight, cooled in an
ice bath and treated with water under rapid stirring. The resulting
precipitate was collected by filtration, dried and triturated with
diethyl ether to yield a pale yellow solid. The solid was
re-solvated in methylene chloride (5 mL) and a solution of 2M HCl
in ether (2 mL) was added to precipitate an orange solid. The
precipitated solid was collected by filtration, dried and
triturated with diethyl ether to yield the title compound (118 mg,
39%) as a mixture of amide rotamers. .sup.1H NMR (400 MHz,
DMSO-d.sub.6) .delta. 8.76 (1s, 1H), 7.93-7.97 (m, 1H), 7.47-7.59
(m, 3H), 7.12-7.27 (m, 3H), 4.73-4.94 (m, 2H), 4.27 (m, 2H), 3.59
(m, 5H), 3.04 (s, 3H), 2.52 (s, 3H); MS (ESI) m/e 364
(C.sub.21H.sub.21N.sub.3O.sub.3+H).sup.+.
Example 321
Preparation of
(E)-N-Methyl-N-(2-methyl-benzofuran-3-ylmethyl)-3-(3-oxo-3,4-dihydro-2H-p-
yrido[3,2-b][1,4]oxazin-7-yl)-acrylamide
[1441] To a solution of
methyl-(2-methyl-benzofuran-3-ylmethyl)-amine (152 mg, 0.87 mmol)
in DMF (5 mL) were added in sequential order
3-(3-Oxo-3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)-acrylic acid
(175 mg, 0.79 mmol), 1-hydroxybenzotriazole (121 mg, 0.87 mmol),
diisopropylethylamine (412 uL, 2.37 mmol), and
N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide (174 mg, 0.87 mmol).
The mixture was stirred at room temperature overnight, cooled in an
ice bath and treated with water under rapid stirring. The
precipitated product was filtered and dried, triturated with
diethyl ether to yield the title compound (125 mg, 42%) as a light
brown solid and as a mixture of amide rotamers. .sup.1H NMR (400
MHz, DMSO-d6) .delta. 11.46 (s, 1H), 8.21 (s, 1H), 7.89 (s, 1H),
7.50-7.59 (m, 3H), 7.19-7.26 (m, 3H), 4.74 (s, 2H), 4.70 (s, 2H),
3.06 (s, 3H), 2.52 (s, 3H); MS (ESI) m/e 378
(C.sub.21H.sub.19N.sub.3O.sub.4+H).sup.+.
Example 322
Preparation of
(E)-N-Methyl-N-(3-methyl-benzofuran-2-ylmethyl)-3-(3-oxo-3,4-dihydro-2H-p-
yrido[3,2-b][1,4]oxazin-7-yl)-acrylamide
[1442] To a solution of
methyl-(3-methyl-benzofuran-2-ylmethyl)-amine (152 mg, 0.87 mmol)
in DMF (5 mL) were added in sequential order
3-(3-Oxo-3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)-acrylic acid
(175 mg, 0.79 mmol), 1-hydroxybenzotriazole (121 mg, 0.87 mmol),
diisopropylethylamine (412 uL, 2.37 mmol), and
N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide (174 mg, 0.87 mmol).
The mixture was stirred at room temperature overnight, cooled in an
ice bath and treated with water under rapid stirring. The
precipitated product was filtered and dried, triturated with
diethyl ether to yield the title compound (150 mg, 50%) as a light
brown solid and as a mixtures of amide rotamers. .sup.1H NMR (400
MHz, DMSO-d6) .delta. 11.46 (s, 1H), 8.19 (s, 1H), 7.89 (s, 1H),
7.5-7.59 (m, 3H), 7.24-7.32 (m, 3H), 4.8-5.02 (m, 2H), 4.70 (s,
2H), 2.95-3.19 (m, 3H), 2.28 (s, 3H); MS (ESI) m/e 378
(C.sub.21H.sub.19N.sub.3O.sub.4+H).sup.+.
Example 323
Preparation of
(E)-N-(3-Chloro-benzofuran-2-ylmethyl)-3-(2,2-dimethyl-3-oxo-3,4-dihydro--
2H-pyrido[3,2-b][1,4]oxazin-7-yl)-N-methyl-acrylamide
[1443] To a solution of
(3-chloro-benzofuran-2-ylmethyl)-methyl-amine (151 mg, 0.77 mmol)
in DMF (5 mL) were added in sequential order
3-(2,2-dimethyl-3-oxo-3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)-acryl-
ic acid (174 mg, 0.7 mmol), 1-hydroxybenzotriazole (107 mg, 0.77
mmol), diisopropylethylamine (366 uL, 2.1 mmol), and
N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide (154 mg, 0.77 mmol).
The mixture was stirred at room temperature overnight, cooled in an
ice bath and treated with water under rapid stirring. The
precipitated product was filtered and dried, triturated with
diethyl ether to yield the title compound (218 mg, 73%) as a light
yellow solid. .sup.1H NMR (400 MHz, DMSO-d6) .delta. 11.43 (s, 1H),
8.21 (s, 1H), 7.96 (s, 1H), 7.53-7.67 (m, 3H), 7.40-7.44 (m, 3H),
4.89-5.11 (m, 2H), 2.97-3.23 (m, 3H), 1.46 (s, 6H); MS (ESI) m/e
426 (C.sub.22H.sub.20ClN.sub.3O.sub.4+H).sup.+.
Example 324
Preparation of
(E)-N-methyl-(1H-indol-2-ylmethyl)-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]napth-
yridin-3-yl)acrylamide
a) Preparation of 3-methyl-2-(methylaminomethyl)indole
[1444] Methylamine (0.34 mL, 8.4 mmol, 33% in ethanol) was added to
a solution of 3-methylindole-2-carboxaldehyde (447 mg, 2.8 mmol) in
methanol (10 mL) and stirred for 5 hours. Sodium borohydride (104
mg, 2.8 mmol) was slowly added at 0.degree. C. The resultant
mixture was warmed to room temperature and stirred overnight. Water
(2 mL) was added slowly at 0.degree. C. and the mixture was
evaporated to a paste. The paste was partitioned between water (2
mL) and dichloromethane (15 mL). The layers were separated and the
aqueous layer was extracted with dichloromethane (2.times.15 mL).
The combined organic phases were dried and evaporated to afford
title compound (348 mg, 71%). .sup.1H NMR (400 MHz, DMSO-d.sub.6):
10.63 (s, 1H), 7.38 (d, J=7.7 Hz, 1H), 7.25 (d, J=8.0 Hz, 1H), 6.99
(t, J=8.0 Hz, 1H), 6.92 (t, J=6.6 Hz, 1H), 3.73 (s, 2H), 2.25 (s,
3H), 2.19 (s, 3H).
b) Preparation of
N-methyl-(1H-indol-2-ylmethyl)-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]napthyrid-
in-3-yl)acrylamide
[1445] EDC (498 mg, 2.6 mmol) was added to a solution of
3-methyl-2-(methylaminomethyl)indole (348 mg, 2.0 mmol),
3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3-yl)-acrylic acid
hydrochloride (533 mg, 2.1 mmol), HOBT.H.sub.2O (270 mg, 2.0 mmol)
and DIPEA (1.04 mL, 6 mmol) in DMF (5 mL). After stirring
overnight, the mixture was slowly diluted with water (50 mL). The
resulting precipitate was collected by filtration washed with water
and dried. The precipitate was suspended in MeOH (10 mL), stirred
for 60 hours, filtered and dried to afford title compound (203 mg,
27%). .sup.1H NMR (300 MHz, DMSO-d.sub.6, 8): 10.77 and 10.58
(rotamers, 2s, br, 1H), 10.64 (s, br, 1H), 8.37 (d, J=1.9 Hz, 1H),
8.08 (s, 1H), 7.58-6.92 (m, 6H), 4.91 and 4.75 (rotamers, 2s, 2H),
3.09 and 2.91 (rotamers, 2s, 3H), 2.90 (m, 2H), 2.53, (m, 2H), 2.25
(s, 3H). MS (ESI): m/e 375(M+H).sup.+.
Example 325
Preparation of
(E)-3-(2,2-dimethyl-3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)-N-methy-
l-N4(3-methylbenzofuran-2-yl)methyl)acrylamide hydrochloride
[1446] To a solution of
methyl-(3-methyl-benzofuran-2-ylmethyl)-amine (88 mg, 0.5 mmol) in
DMF (5 mL) were added in sequential order
3-(2,2-dimethyl-3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)acrylic
acid hydrochloride (107 mg, 0.46 mmol), 1-hydroxybenzotriazole (68
mg, 0.5 mmol), diisopropylethylamine (240 uL, 1.38 mmol), and
N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide (100 mg, 0.5 mmol).
The mixture was stirred at room temperature overnight, cooled in an
ice bath and water added with rapid stirring. The product was
extracted with ethyl acetate (3.times.10 mL), dried with sodium
sulfate, filtered and concentrated. The free base was re-solvated
in methylene chloride (5 mL) and a solution of 4M HCl in dioxane (1
mL) was added to precipitate the hydrogen chloride salt as a pale
yellow solid (84 mg, 43%): .sup.1H NMR (400 MHz, DMSO-d6) .delta.
8.94 (1s, 1H), 8.01-8.06 (m, 2H), 7.47-7.58 (m, 3H), 7.16-7.25 (m,
3H), 4.73-4.94 (rotamers, 2s, 2H), 3.42 (s, 2H), 3.04 (s, 3H), 2.42
(s, 3H), 1.34 (s, 6H); MS (ESI) m/e 392
(C.sub.23H.sub.25N.sub.3O.sub.3+H).sup.+.
Example 326
Preparation of
(E)-3-(6-aminopyridin-3-yl)-N-((5-fluoro-3-methylbenzo[b]thiophen-2-0)met-
hyl)-N-methylacrylamide hydrochloride
[1447] To a solution of
(5-fluoro-1-methyl-1H-indol-2-yl)-N-methylmethanamine (168 mg, 0.8
mmol) in DMF (5 mL) were added in sequential order
(E)-3-(6-aminopyridin-3-yl)acrylic acid (120 mg, 0.73 mmol),
1-hydroxybenzotriazole (111 mg, 0.8 mmol), diisopropylethylamine
(391 uL, 2.19 mmol), and
N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide (160 mg, 0.8 mmol).
The mixture was stirred at room temperature overnight, cooled in an
ice bath and water added with rapid stirring. The product was
extracted with ethyl acetate (3.times.10 mL), dried, filtered and
concentrated. The crude free base was re-solvated in methylene
chloride (10 mL) to which was added HCl (1 mL, 4M in dioxane), with
the product precipitating out with the addition of ether. The title
compound is triturated with ether (2.times.10 mL) to yield the
product as a pale brown solid (76 mg, 25%): .sup.1H NMR (300 MHz,
DMSO-d6) .delta. 8.2-8.49 (m, 3H), 7.86-7.99 (m, 1H), 7.46-7.64 (m,
2H), 7.16-7.29 (m, 2H), 6.99 (d, J=12.0 Hz, 1H), 4.83-5.13
(rotamers, 2s, 2H), 2.95-3.16 (rotamers, 2s, 3H), 2.41 (s, 3H); MS
(ESI) ink 356 (C.sub.19H.sub.18FN.sub.3OS+H).sup.+.
Example 327
Preparation of
(E)-N-((3-chlorobenzofuran-2-yl)methyl)-N-methyl-3-(3-oxo-3,4-dihydro-2H--
pyrido[3,2-b][1,4]oxazin-7-yl)acrylamide
[1448] To a solution of
(3-chlorobenzofuran-2-yl)-N-methylmethanamine (100 mg, 0.51 mmol)
in DMF (5 mL) were added in sequential order
(E)-3-(3-oxo-3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)acrylic
acid (107 mg, 0.46 mmol), 1-hydroxybenzotriazole (71 mg, 0.51
mmol), diisopropylethylamine (243 uL, 1.39 mmol), and
N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide (102 mg, 0.51 mmol).
The mixture was stirred at room temperature overnight, cooled in an
ice bath and water was added with rapid stirring. The product
precipitated and was filtered, triturated with ether and dried to
yield title compound as a white solid (55 mg, 30%): .sup.1H NMR
(400 MHz, CDCl.sub.3) .delta. 9.21 (s, 1H), 8.12-8.19 (m, 1H),
7.28-7.6 (m, 7H), 4.81-4.95 (rotamers, 2s, 2H), 4.714 (s, 2H); 3.21
(s, 3H); MS (ESI) We 398
(C.sub.20H.sub.16ClN.sub.3O.sub.4+H).sup.+.
Example 328
Preparation of
(E)-N-(3-methoxy-2-propoxybenzyl)-N-methyl-3-(3-oxo-3,4-dihydro-2H-pyrido-
[3,2-b][1,4]oxazin-7-yl)acrylamide
[1449] To a solution of
(3-methoxy-2-propoxyphenyl)-N-methylmethanamine (75 mg, 0.36 mmol)
in DMF (5 mL) were added in sequential order
(E)-3-(3-oxo-3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)acrylic
acid (75 mg, 0.26 mmol), 1-hydroxybenzotriazole (50 mg, 0.36 mmol),
diisopropylethylamine (150 uL, 0.67 mmol), and
N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide (72 mg, 0.36 mmol).
The mixture was placed in a microwave at a temperature of
140.degree. C. for 8 minutes. The product precipitated with the
addition of water and was filtered, triturated with ether and dried
to yield title compound as a white solid (38 mg, 36%): .sup.1H NMR
(400 MHz, CDCl.sub.3) .delta. 8.03-8.12 (rotamers, 2s, 1H),
7.63-7.69 (dd, J=15.2 Hz, J=11.2 Hz, 1H), 7.44-7.35 (rotamers, 2s,
1H), 7.02-7.04 (m, 1H), 6.80-6.91 (m, 2H), 6.72 (d, J=7.2 Hz, 1H),
4.67-4.81 (rotamers, 4s, 4H), 3.91-4.01 (m, 2H), 3.90 (2s,
rotomers, 3H), 3.10 (s, 3H), 1.76-1.89 (m, 2H), 1.05 (t, J=7.2 Hz,
3H); MS (ESI) m/e 412 (C.sub.22H.sub.25N.sub.3O.sub.5+H).sup.+.
Example 329
Preparation of
(E)-N-((3-isopropylbenzofuran-2-yl)methyl)-N-methyl-3-(3-oxo-3,4-dihydro--
2H-pyrido[3,2-b][1,4]oxazin-7-yl)acrylamide
a) 1-iodo-2-(3-methylbut-2-enyloxy)benzene
[1450] To a solution of 2-iodophenol (3.69 g, 16.8 mmol) in THF (50
mL) is added NaH (804 mg, 33.5 mmol) portion wise and stirred for
30 min at room temperature. 3,3-Dimethylallylbromide (3.9 mL, 33.5
mmol) was added and the reaction was stirred over night at room
temperature. The reaction is quenched with water (20 mL) and
extracted with diethyl ether (3.times.25 mL), the organic layers
are dried over magnesium sulfate, filtered and concentrated. The
compound was purified on silica gel using 100% hexanes as the
eluent to yield 4.78 g (98%) of the title compound as a pale yellow
oil: .sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 7.77 (d, J=6.0 Hz,
1H), 7.35 (t, J=9.0 Hz, 1H), 7.02 (d, J=9.0 Hz, 1H), 6.74 (t, J=9.0
Hz, 1H), 5.45 (m, 1H), 4.60 (d, J=6.0 Hz, 2H), 1.75 (2s, 6H)
b) 3-isopropylbenzofuran
[1451] A solution of 1-iodo-2-(3-methylbut-2-enyloxy)benzene (5 g,
17.3 mmol) in propionitrile (10 mL) and diisopropylethylamine (9
mL, 52 mmol) is degassed with argon for 15 min. To this solution is
added palladium acetate (423 mg, 1.73 mmol) and the reaction is
heated to 100.degree. C. overnight. The reaction is then cooled to
room temperature and passed through a pad of celite, washing the
filter cake with ethyl acetate (50 mL). The ethyl acetate and amine
base are then removed under vacuum. The crude reaction mixture is
then chromatographed using 100% hexanes to yield title compound as
a colorless oil in 52% yield (1.3 g): .sup.1H NMR (300 MHz,
CDCl.sub.3) .delta. 7.7 (s, 1H), 7.68 (d, J=9.0 Hz, 1H,), 7.55 (d,
J=9.0 Hz, 1H), 7.32-7.24 (m, 2H), 3.11-3.07 (m, 1H), 1.32 (2s,
6H).
c) 3-isopropylbenzofuran-2-carbaldehyde
[1452] To a cooled (0.degree. C.) solution of 3-isopropylbenzofuran
(250 mg, 1.56 mmol) in THF (1 mL) is added nBuLi (2 mL, 2 mmol)
drop wise and the reaction is stirred for 30 minutes. DMF (1 mL)
was added to the reaction and stirred at room temperature
overnight. The solution is placed in an ice bath and carefully
quenched with 5% aqueous HCl solution (2 mL), and extracted with
ethyl acetate (3.times.5 mL), dried over sodium sulfate and
concentrated. The product was purified on silica with 100% hexanes
to yield title compound in as a colorless oil (250 mg, 85%):
.sup.1H NMR (400 MHz, CDCl.sub.3) .delta. 10.10 (s, 1H), 7.78 (d,
1H, J=9.0 Hz), 7.55 (d, 1H, J=9.0 Hz), 7.32-7.24 (m, 2H), 3.11-3.07
(m, 1H), 1.33-1.31 (2s, 6H).
d) (3-isopropylbenzofuran-2-yl)-N-methylmethanamine
[1453] To a solution of 3-isopropylbenzofuran-2-carbaldehyde (250
mg, 1.33 mmol) in anhydrous methanol (8 mL) is added a solution of
n-methylamine in ethanol (0.281 mL, 5.32 mmol) and the reaction is
stirred at room temperature overnight under an atmosphere of argon.
The solution is then concentrated, and re-solvated in methanol (8
mL) and cooled in an ice bath. Sodium borohydride (0.152 g, 4 mmol)
was added portion wise and the reaction was stirred at room
temperature under argon for 6 h. The solution is concentrated, and
re-solvated in 1.3N NaOH (5 mL) and ether (5 mL) and stirred for 1
h. The ether layer was collected. The aqueous layer was washed with
ether (2.times.10 mL), and the combined organic layers were dried
over magnesium sulfate, filtered and concentrated in vacuo.
Purification by chromatography (silica gel, 9:1 DCM:MeOH) yielded
the title compound as a yellow oil (228 mg, 85%): .sup.1H NMR (400
MHz, DMSO-d.sub.6) .delta. 7.70 (d, J=4.0 Hz, 1H), 7.46 (d, J=8.0
Hz, 1H), 7.25-7.16 (m, 2H), 3.75 (s, 2H), 3.15-3.22 (m, 1H), 2.25
(s, 3H), 1.36-1.34 (2s, 6H).
Preparation of
(E)-N-((3-isopropylbenzofuran-2-yl)methyl)-N-methyl-3-(3-oxo-3,4-dihydro--
2H-pyrido[3,2-b][1,4]oxazin-7-yl)acrylamide
[1454] To a solution of
(3-isopropylbenzofuran-2-yl)-N-methylmethanamine (115 mg, 0.57
mmol) in DMF (5 mL) were added in sequential order
3-(2,2-dimethyl-3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)acrylic
acid hydrochloride (118 mg, 0.51 mmol), 1-hydroxybenzotriazole (77
mg, 0.57 mmol), diisopropylethylamine (289 uL, 1.54 mmol), and
N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide (109 mg, 0.57 mmol).
The mixture was stirred at room temperature overnight, cooled in an
ice bath and water was added with rapid stirring. The product was
extracted with ethyl acetate (3.times.10 mL), dried over sodium
sulfate, filtered and concentrated to give a light brown solid (14
mg, 7%): .sup.1H NMR (400 MHz, CD.sub.3OD) .delta. 11.42 (s, 1H),
8.17-8.16 (m, 1H), 7.89-7.86 (m, 1H), 7.74-7.72 (m, 2H), 7.24-7.30
(m, 2H), 7.22-7.17 (m, 2H), 4.97 (s, 2H), 4.78 (s, 2H), 3.15 (s,
3H), 3.10-3.14 (m, 1H), 1.34 (s, 6H); MS (ESI) m/e 406
(C.sub.23H.sub.23N.sub.3O.sub.4+H).sup.+.
Example 330
Preparation of
(E)-N-((3-ethylbenzofuran-2-yl)methyl)-N-methyl-3-(3-oxo-3,4-dihydro-2H-p-
yrido[3,2-b][1,4]oxazin-7-yl)acrylamide
[1455] To a solution of
(3-ethylbenzofuran-2-yl)-N-methylmethanamine (115 mg, 0.6 mmol) in
DMF (5 mL) were added in sequential order
(E)-3-(3-oxo-3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)acrylic
acid (140 mg, 0.54 mmol), 1-hydroxybenzotriazole (84 mg, 0.6 mmol),
diisopropylethylamine (282 uL, 1.62 mmol), and
N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide (120 mg, 0.6 mmol).
The mixture was stirred at room temperature overnight, cooled in an
ice bath and water added with rapid stirring.
[1456] The product precipitated and was filtered, triturated with
ether and dried to yield the title compound as a white solid (113
mg, 52%): .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta. 11.41 (s,
1H), 8.19 (s, 1H), 7.88 (d, J=6.4 Hz, 1H), 7.66 (d, J=7.6 Hz, 1H),
7.51-7.49 (m, 2H), 7.29-7.25 (m, 3H), 4.99-4.79 (rotamers, 2s, 2H),
4.68 (s, 2H), 3.39 (s, 3H), 2.79-2.73 (m, 2H), 1.23-1.20 (m, 3H);
MS (ESI) m/e 392 (C.sub.22H.sub.21N.sub.3O.sub.4+H).sup.+.
Example 331
Preparation of
(E)-N-((5-fluoro-3-methylbenzo[b]thiophen-2-yl)methyl)-N-methyl-3-(3-oxo--
3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)acrylamide
[1457] To a solution of
(5-fluoro-3-methylbenzo[b]thiophen-2-yl)-N-methyl methanamine (200
mg, 0.96 mmol) in DMF (5 mL) were added in sequential order
(E)-3-(3-oxo-3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)acrylic
acid (185 mg, 0.87 mmol), 1-hydroxybenzotriazole (133 mg, 0.96
mmol), diisopropylethylamine (454 uL, 2.61 mmol), and
N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide (192 mg, 0.96 mmol).
The mixture was stirred at room temperature overnight, cooled in an
ice bath and water added with rapid stirring. The product was
extracted with ethyl acetate (3.times.10 mL), dried with sodium
sulfate, filtered and concentrated. The crude product was purified
using preparative HPLC to give the title compound (45 mg, 13%):
.sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta. 11.42 (bs, 1H), 8.19
(s, 1H), 7.89-7.87 (m, 2H), 7.55-7.51 (m, 2H), 7.22-7.18 (m, 2H),
5.12-4.87 (2s, 2H, rotamers), 4.68 (s, 2H), 3.54 (s, 3H), 2.39 (s,
3H). MS (ESI) m/e 412
(C.sub.21H.sub.18FN.sub.3O.sub.3S+H).sup.+.
Example 332
Preparation of
(E)-N-((5-fluoro-3-methylbenzo[b]thiophen-2-yl)methyl)-N-methyl-3-(7-oxo--
5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylamide
[1458] To a solution of
(5-fluoro-3-methylbenzo[b]thiophen-2-yl)-N-methylmethanamine (168
mg, 0.8 mmol) in DMF (5 mL) were added in sequential order
(E)-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylic acid
(159 mg, 0.73 mmol), 1-hydroxybenzotriazole (111 mg, 0.8 mmol),
diisopropylethylamine (381 uL, 2.19 mmol), and
N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide (160 mg, 0.8 mmol).
The mixture was stirred at room temperature overnight, cooled in an
ice bath and water added with rapid stirring. The product
precipitated and was filtered, triturated with ether and dried to
yield the title compound as a pale brown solid (224 mg, 75%):
.sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.65 (s, 1H), 8.37 (s,
1H), 8.08 (s, 1H), 7.76-8.00 (m, 1H), 7.39-7.63 (m, 2H), 7.02-7.33
(m, 2H), 4.87-5.11 (rotamers, 2s, 2H), 3.16 (s, 3H), 2.56-2.89 (m,
2H), 2.49-2.51 (m, 2H), 2.39 (s, 3H); MS (ESI) m/e 410
(C.sub.22H.sub.20FN.sub.3O.sub.2S+H).sup.+.
Example 333
Preparation of
(E)-N-((5-fluoro-1-methyl-1H-indol-2-yl)methyl)-N-methyl-3-(7-oxo-5,6,7,8-
-tetrahydro-1,8-naphthyridin-3-yl)acrylamide
[1459] To a solution of
(5-fluoro-1-methyl-1H-indol-2-yl)-N-methylmethanamine (70 mg, 0.36
mmol) in DMF (5 mL) were added in sequential order
(E)-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylic acid
(72 mg, 0.33 mmol), 1-hydroxybenzotriazole (49 mg, 0.36 mmol),
diisopropylethylamine (191 uL, 1.1 mmol), and
N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide (72 mg, 0.36 mmol).
The mixture was stirred at room temperature overnight, cooled in an
ice bath and water added with rapid stirring. The product
precipitated and was filtered, triturated with ether and dried to
yield title compound as a pale brown solid (97 mg, 76%): .sup.1H
NMR (300 MHz, DMSO-d.sub.6) .delta. 10.68 (s, 1H), 8.40 (s, 1H),
8.08-8.18 (m, 1H), 7.91-8.08 (m, 1H), 7.52-7.68 (m, 1H), 7.37-7.52
(m, 1H), 7.13-7.36 (m, 2H), 6.42 (s, 1H), 4.86-5.06 (rotamers, 2s,
2H), 3.71 (s, 3H), 3.14 (m, 2H), 2.81-2.97 (m, 2H), 2.75 (s, 3H);
MS (ESI) m/e 393 (C.sub.22H.sub.21FN.sub.4O.sub.2+H).sup.+.
Example 334
Preparation of
(E)-N-((3-ethylbenzofuran-2-yl)methyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahyd-
ro-1,8-naphthyridin-3-yl)acrylamide
[1460] To a solution of
(3-ethylbenzofuran-2-yl)-N-methylmethanamine (89 mg, 0.49 mmol) in
DMF (5 mL) were added in sequential order
(E)-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylic acid
(111 mg, 0.44 mmol), 1-hydroxybenzotriazole (68 mg, 0.49 mmol),
diisopropylethylamine (232 uL, 1.34 mmol), and
N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide (98 mg, 0.49 mmol).
The mixture was stirred at room temperature overnight, cooled in an
ice bath and water added with rapid stirring. The product
precipitated and was filtered, triturated with ether and dried to
yield title compound as a pale brown solid (134 mg, 70%): .sup.1H
NMR (300 MHz, DMSO-d.sub.6) .delta. 10.67 (s, 1H), 8.37 (s, 1H),
8.09 (s, 1H), 7.96 (s, 1H), 7.18-7.64 (m, 5H), 4.81-5.01 (rotamers,
2s, 2H), 3.27-3.61 (m, 2H), 2.90 (d, J=9.0 Hz, 2H), 2.73-2.78 (m,
2H), 2.51-2.59 (m, 3H), 1.23 (t, J=9.0 Hz, 3H); MS (ESI) m/e 390
(C.sub.23H.sub.23N.sub.3O.sub.3+H).sup.+.
Example 335
Preparation of
(E)-N4(3-isopropylbenzofuran-2-yl)methyl)-N-methyl-3-(7-oxo-5,6,7,8-tetra-
hydro-1,8-naphthyridin-3-yl)acrylamide
[1461] To a solution of
(3-isopropylbenzofuran-2-yl)-N-methylmethanamine (115 mg, 0.57
mmol) in DMF (5 mL) were added in sequential order
(E)-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylic acid
(111 mg, 0.51 mmol), 1-hydroxybenzotriazole (77 mg, 0.57 mmol),
diisopropylethylamine (289 uL, 1.54 mmol), and
N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide (109 mg, 0.57 mmol).
The mixture was stirred at room temperature overnight, cooled in an
ice bath and water added with rapid stirring. The product
precipitated and was filtered, triturated with ether and dried to
yield the title compound as a white solid (38 mg, 17%): .sup.1H NMR
(400 MHz, DMSO-d.sub.6) .delta. 10.62 (s, 1H), 8.38 (s, 1H), 8.07
(s, 1H), 7.75-7.73 (d, J=7.6 Hz, 1H), 7.53-7.49 (m, 2H), 7.26-7.18
(m, 3H), 4.99-4.80 (rotamers, 2s, 2H), 3.40-3.35 (m, 1H), 3.32 (s,
3H), 2.91-2.89 (m, 2H), 2.55-2.53 (m, 2H), 1.37-1.36 (d, J=6.8 Hz,
6H); MS (ESI) m/e 404 (C.sub.24H.sub.25N.sub.3O.sub.3+H).sup.+.
Example 336
Preparation of
(E)-N-(benzofuran-5-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-1,8-na-
phthyridin-3-yl)acrylamide
a) benzofuran-5-yl-N-methylmethanamine
[1462] Benzofuran-5-carbaldehyde (315 mg, 2.16 mmol) was dissolved
in anhydrous methanol (10 mL). Methylamine (0.86 mL of 33% solution
in ethanol, 6.91 mmol) was added and the reaction was stirred for 3
h. The solution was concentrated to a brown oil and then dissolved
in anhydrous methanol (10 mL). Sodium borohydride (83.2 mg, 2.20
mmol) was added and the mixture was stirred overnight at room
temperature. Water (5 mL) was added and the solution was
concentrated. Sodium hydroxide (10 mL, 1N) was added and the
aqueous layer was extracted with ethyl acetate (3.times.20 mL).
Combined organic layers were dried over MgSO.sub.4, filtered and
concentrated to afford benzofuran-5-yl-N-methylmethanamine (316 mg,
91%) as a light brown oil: .sup.1H NMR (400 MHz, DMSO-d.sub.6)
.delta. 7.93 (s, 1H), 7.56 (s, 1H), 7.50 (d, J=8.4 Hz, 1H), 7.25
(d, J=8.4 Hz, 1H), 6.90 (s, 1H), 3.70 (s, 2H), 3.17 (s, 3H).
(E)-N-(benzofuran-5-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-1,8-nap-
hthyridin-3-yl)acrylamide
[1463] To a solution of benzofuran-5-yl-N-methylmethanamine (297
mg, 1.84 mmol),
3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3-yl)-acrylic acid
hydrochloride (474 mg, 1.86 mmol), HOBt (252 mg, 1.86 mmol) and
DIPEA (1.32 mL, 7.58 mmol) in anhydrous DMF (30 mL) was added EDC
hydrochloride (357 mg, 1.86 mmol). The mixture was stirred
overnight at 40.degree. C. Water (70 mL) was added and the solution
was stirred for 1 h. The reaction mixture was extracted with ethyl
acetate (3.times.100 mL). Combined organic layers were washed with
water (50 mL) and brine (50 mL) and concentrated to give a red
solid which was purified by column chromatography (silica gel, 5%
MeOH/CH.sub.2Cl.sub.2) to afford
(E)-N-(benzofuran-5-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-1,8-na-
phthyridin-3-yl)acrylamide (381 mg, 57%) as a red solid and a
mixture of amide rotomers: .sup.1H NMR (400 MHz, DMSO-d.sub.6)
.delta. 10.64-10.62 (m, 1H), 8.36-8.33 (m, 1H), 8.07 (s, 1H), 7.97
(s, 1H), 7.59-7.49 (m, 3H), 7.38-7.17 (m, 2H), 6.94 (m, 1H),
4.89-4.69 (m, 2H), 3.10-2.85 (m, 5H), 2.54-2.52 (m, 2H); ESI MS m/z
362 [C.sub.21H.sub.19N.sub.3O.sub.3+H].sup.+.
Example 337
Preparation of
(E)-N-(benzo[b]thiophen-5-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro--
1,8-naphthyridin-3-yl)acrylamide
a) benzo[b]thiophene-5-carbaldehyde
[1464] Benzo[b]thiophen-5-ylmethanol (311 mg, 1.89 mmol) was
dissolved in anhydrous benzene (20 mL). MnO.sub.2 (1317 mg, 15.2
mmol) was added and the reaction was stirred for 12 h. The solution
was filtered through celite and the filter cake was washed with
ethyl acetate (50 mL). The filtrate was concentrated under vacuum
to give the product (284 mg, 92%) as an off-white solid: .sup.1H
NMR (400 MHz, DMSO-d.sub.6) .delta. 10.09 (s, 1H), 8.46-8.45 (m,
1H), 8.21 (d, J=8.4 Hz, 1H), 7.94 (d, J=5.6 Hz, 1H), 7.81 (dd,
J=8.4, 1.2 Hz, 1H), 7.66 (d, J=5.6 Hz, 1H).
b) benzo[b]thiophen-5-yl-N-methylmethanamine
[1465] Benzo[b]thiophene-5-carbaldehyde (276 mg, 1.70 mmol) was
dissolved in anhydrous methanol (8.0 mL). Methylamine (0.68 mL of
33% solution in ethanol, 5.46 mmol) was added and the reaction was
stirred for 3 h. The solution was concentrated to a white solid and
then dissolved in anhydrous methanol (10 mL). Sodium borohydride
(66.0 mg, 1.75 mmol) was added and the mixture was stirred
overnight at room temperature. Water (8.0 mL) was added and the
solution was concentrated. Sodium hydroxide (10 mL, 1N) was added
and the aqueous layer was extracted with ethyl acetate (3.times.20
mL). Combined organic layers were dried over MgSO.sub.4, filtered
and concentrated to afford
benzo[b]thiophen-5-yl-N-methylmethanamine (269 mg, 89%) as a yellow
oil: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 7.90 (d, J=8.7 Hz,
1H), 7.79 (s, 1H), 7.71 (d, J=5.7 Hz, 1H), 7.40 (d, J=5.4 Hz, 1H),
7.32 (d, J=8.1 Hz, 1H), 3.73 (s, 2H), 2.26 (s, 3H).
(E)-N-(benzo[b]thiophen-5-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-1-
,8-naphthyridin-3-yl)acrylamide
[1466] To a solution of benzo[b]thiophen-5-yl-N-methylmethanamine
(260 mg, 1.47 mmol),
3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3-yl)-acrylic acid
hydrochloride (377 mg, 1.48 mmol), HOBt (200 mg, 1.48 mmol) and
DIPEA (1.05 mL, 6.03 mmol) in anhydrous DMF (24 mL) was added EDC
hydrochloride (284 mg, 1.48 mmol). The mixture was stirred
overnight at 40.degree. C. Water (50 mL) was added and the solution
was stirred for 1 h. The reaction mixture was extracted with ethyl
acetate (3.times.80 mL). Combined organic layers were washed with
water (50 mL) and brine (50 mL) and concentrated to give an orange
solid which was purified by column chromatography (silica gel, 5%
MeOH/CH.sub.2Cl.sub.2) to afford
(E)-N-(benzo[b]thiophen-5-ylmethyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro--
1,8-naphthyridin-3-yl)acrylamide (430 mg, 78%) as a pink solid and
a mixture of amide rotomers: .sup.1H NMR (400 MHz, DMSO-d.sub.6)
.delta. 10.67-10.64 (m, 1H), 8.37-8.33 (m, 1H), 8.08-8.05 (m, 1H),
8.00-7.95 (m, 1H), 7.75-7.71 (m, 2H), 7.56-7.52 (m, 1H), 7.45-7.43
(m, 1H), 7.37-7.22 (m, 2H), 4.93-4.73 (m, 2H), 3.12-2.86 (m, 5H),
2.54-2.51 (m, 2H); ESI MS m/z 378
[C.sub.21H.sub.19N.sub.3O.sub.2S+H].sup.+.
Example 338
Preparation of
(E)-N-methyl-N-((1-methyl-1H-indol-4-yl)methyl)-3-(7-oxo-5,6,7,8-tetrahyd-
ro-1,8-naphthyridin-3-yl)acrylamide
a) 1-Methyl-1H-indole-4-carbaldehyde
[1467] To a solution of 1H-indole-4-carbaldehyde (413 mg, 2.85
mmol) in anhydrous DMF (6.5 mL) was added sodium hydride (171 mg of
60% dispersion in oil, 4.27 mmol). The mixture was stirred for 40
min at room temperature. Methyl iodide (0.36 mL, 5.78 mmol) was
then added and the reaction mixture was stirred for 12 h at room
temperature. Water was added (25 mL) and the mixture was extracted
with ethyl acetate (3.times.25 mL). Combined organic layers were
washed with water (20 mL) and brine (20 mL), dried over
Na.sub.2SO.sub.4, filtered and concentrated to a yellow oil.
Purification by column chromatography (silica gel,
CH.sub.2Cl.sub.2) gave 1-methyl-1H-indole-4-carbaldehyde (452 mg g,
99%) as a yellow oil: .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta.
10.20 (s, 1H), 7.84 (d, J=8.0 Hz, 1H), 7.68 (d, J=7.2 Hz, 1H), 7.58
(d, J=2.8 Hz, 1H), 7.38-7.34 (m, 1H), 7.08 (d, J=3.2 Hz, 1H), 3.87
(s, 3H).
b) N-methyl(1-methyl-1H-indol-4-yl)methanamine
[1468] 1-Methyl-1H-indole-4-carbaldehyde (427 mg, 2.68 mmol) was
dissolved in anhydrous methanol (12 mL). Methylamine (1.07 mL of
33% solution in ethanol, 8.59 mmol) was added and the reaction was
stirred for 3 h. The solution was concentrated to a yellow oil and
then dissolved in anhydrous methanol (12 mL). Sodium borohydride
(104 mg, 2.74 mmol) was added and the mixture was stirred overnight
at room temperature. Water (10 mL) was added and the solution was
concentrated. Sodium hydroxide (20 mL, 1N) was added and the
aqueous layer was extracted with ethyl acetate (3.times.30 mL).
Combined organic layers were dried over Na.sub.2SO.sub.4, filtered
and concentrated to afford
N-methyl(1-methyl-1H-indol-4-yl)methanamine (432 mg, 92%) as a
yellow oil: .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta. 7.29-7.26
(m, 2H), 7.10-7.06 (m, 1H), 7.00-6.98 (m, 1H), 6.51 (d, J=3.2 Hz,
1H), 3.87 (s, 2H), 3.76 (s, 3H), 2.29 (s, 3H).
(E)-N-methyl-N-((1-methyl-1H-indol-4-yl)methyl)-3-(7-oxo-5,6,7,8-tetrahydr-
o-1,8-naphthyridin-3-yl)acrylamide
[1469] To a solution of N-methyl(1-methyl-1H-indol-4-yl)methanamine
(418 mg, 2.40 mmol),
3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3-yl)-acrylic acid
hydrochloride (617 mg, 2.42 mmol), HOBt (327 mg, 2.42 mmol) and
DIPEA (1.71 mL, 9.82 mmol) in anhydrous DMF (40 mL) was added EDC
hydrochloride (460 mg, 2.40 mmol). The mixture was stirred
overnight at 40.degree. C. Water (60 mL) was added and the solution
was stirred for 1 h. The reaction mixture was extracted with
CH.sub.2Cl.sub.2 (3.times.100 mL). Combined organic layers were
washed with water (50 mL) and brine (50 mL) and concentrated to
give a red solid which was purified by column chromatography
(silica gel, 5% MeOH/CH.sub.2Cl.sub.2) to afford
(E)-N-methyl-N-((1-methyl-1H-indol-4-yl)methyl)-3-(7-oxo-5,6,7,8-tetrahyd-
ro-1,8-naphthyridin-3-yl)acrylamide (320 mg, 36%) as a pink solid
and a mixture of amide rotomers: .sup.1H NMR (400 MHz,
DMSO-d.sub.6) .delta. 10.64-10.61 (m, 1H), 8.36-8.32 (m, 1H),
8.07-7.98 (m, 1H), 7.56-7.51 (m, 1H), 7.37-7.23 (m, 3H), 7.19-7.09
(m, 1H), 6.92-6.79 (m, 1H), 6.49-6.48 (m, 1H), 5.05-4.87 (m, 2H);
3.78-3.77 (m, 3H), 3.01-2.82 (m, 5H), 2.54-2.52 (m, 2H); ESI MS m/z
375 [C.sub.22H.sub.22N.sub.4O.sub.2+H].sup.+.
Example 339
Preparation of
(E)-N-((1-ethyl-1H-indol-4-yl)methyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydr-
o-1,8-naphthyridin-3-yl)acrylamide
a) 1-ethyl-1H-indole-4-carbaldehyde
[1470] To a solution of 1H-indole-4-carbaldehyde (2.00 g, 13.8
mmol) in anhydrous DMF (6.5 mL) was added sodium hydride (827 mg of
60% dispersion in oil, 20.7 mmol). The mixture was stirred for 30
min at room temperature. Ethyl iodide (2.22 mL, 27.5 mmol) was then
added and the reaction mixture was stirred for 12 h at room
temperature. Water was added (100 mL) and the mixture was extracted
with ethyl acetate (3.times.100 mL). Combined organic layers were
washed with brine (100 mL), dried over Na.sub.2SO.sub.4, filtered
and concentrated to an orange oil. Purification by column
chromatography (silica gel, gradient elution of CH.sub.2Cl.sub.2 to
5% MeOH/CH.sub.2Cl.sub.2) gave the title compound
(1-ethyl-1H-indole-4-carbaldehyde) (2.43 g, 99%) as a yellow oil:
.sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.19 (s, 1H), 7.88 (d,
J=8.1 Hz, 1H), 7.68-7.64 (m, 2H), 7.37-7.32 (m, 1H), 7.08 (d,
J=3.0, 1H), 4.28 (q, J=7.2 Hz, 2H), 1.36 (t, J=7.2 Hz, 3H).
b) ((1-ethyl-1H-indol-4-yl)-N-methylmethanamine)
[1471] 1-Ethyl-1H-indole-4-carbaldehyde (2.40 mg, 13.8 mmol) was
dissolved in anhydrous methanol (62 mL). Methylamine (6.00 mL of
33% solution in ethanol, 48.2 mmol) was added and the reaction was
stirred for 3 h. The solution was concentrated to a greenish brown
oil and then dissolved in anhydrous methanol (62 mL). Sodium
borohydride (539 mg, 14.3 mmol) was added and the mixture was
stirred overnight at room temperature. Water (90 mL) was added and
the solution was concentrated. Sodium hydroxide (15 mL, 1N) was
added and the aqueous layer was extracted with ethyl acetate
(3.times.50 mL). Combined organic layers were dried over
Na.sub.2SO.sub.4, filtered and concentrated to afford the title
compound ((1-ethyl-1H-indol-4-yl)-N-methylmethanamine) (2.36 g,
91%) as a yellow oil: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
7.33-7.30 (m, 2H), 7.10-6.97 (m, 2H), 6.52 (d, J=3.0 Hz, 1H), 4.17
(q, J=7.2 Hz, 2H), 3.88 (s, 2H), 2.30 (s, 3H), 1.33 (t, J=7.2 Hz,
3H).
c) (N-((1-ethyl-1H-indol-4-yl)methyl)-N-methylacrylamide)
[1472] N-((1-ethyl-1H-indol-4-yl)methyl)-N-methylacrylamide was
prepared according to the method of Preparation 47 except
substituting ((1-ethyl-1H-indol-4-yl)-N-methylmethanamine) for
methyl-(3-methyl-benzo[b]thiophen-2-ylmethyl)amine. The title
compound (918 mg, 64%) was obtained as a yellow oil and a mixture
of amide rotomers: .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta.
7.41-7.35 (m, 2H), 7.13-7.07 (m, 1H), 6.88-6.72 (m, 2H), 6.48-6.45
(m, 1H), 6.22-6.16 (m, 1H), 5.73-5.62 (m, 1H), 4.89-4.81 (m, 2H),
4.23-4.15 (m, 2H), 2.91-2.90 (m, 3H), 1.34 (t, J=7.2 Hz, 3H).
(E)-N-((1-ethyl-1H-indol-4-yl)methyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydro-
-1,8-naphthyridin-3-yl)acrylamide
[1473] The title compound was prepared according to the procedure
of Example 2, except substituting
(N-((1-ethyl-1H-indol-4-yl)methyl)-N-methylacrylamide) for
N-methyl-N-(3-methyl-benzo[b]thiophen-2-ylmethyl)acrylamide and
6-bromo-3,4-dihydro-1,8-naphthyridin-2(1H)-one for
7-bromo-3,3-dimethyl-1,3,4,5-tetrahydro-pyrido[2,3-e][1,4]diazepin-2-one.
The title compound (329 mg, 46%) was obtained as an off-white solid
and a mixture of amide rotomers: .sup.1H NMR (400 MHz,
DMSO-d.sub.6) .delta. 10.62-10.58 (m, 1H), 8.38-7.98 (m, 2H),
7.57-7.53 (m, 1H), 7.42-7.08 (m, 4H), 6.92-6.78 (m, 1H), 6.51 (s,
1H), 5.05-4.88 (m, 2H), 4.22-4.19 (m, 2H), 3.04-2.85 (m, 5H),
2.55-2.50 (m, 2H), 1.35 (t, J=7.2 Hz, 3H); ESI MS m/z 389
[C.sub.23H.sub.24N.sub.4O.sub.2+H].sup.+.
Example 340
Preparation of
(E)-N-((1H-benzo[d]imidazol-5-yl)methyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrah-
ydro-1,8-naphthyridin-3-yl)acrylamide
a) ((1H-benzo[d]imidazol-5-yl)methanol)
[1474] 1H-benzo[d]imidazole-5-carboxylic acid (5.39 g, 33.3 mmol)
was dissolved into anhydrous THF (100 ml) under argon. The solution
was cooled in an ice bath and lithium aluminum hydride (70.0 ml of
1M solution in THF, 70.0 mmol) was added dropwise. The reaction
mixture was allowed to warm to room temperature and stir overnight.
The reaction mixture was cooled to 0.degree. C. and ethyl acetate
(90 ml) was carefully added, followed by methanol (15 ml) and water
(15 ml). The mixture was stirred for 1 h and filtered through
celite. The Solution was concentrated and dissolved in THF (200 ml)
and washed with brine (2.times.100 ml), dried over
Na.sub.2SO.sub.4, filtered and concentrated to yield the title
compound ((1H-benzo[d]imidazol-5-yl)methanol) (1.26 g, 26%) as a
yellow solid: .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta. 8.15 (s,
1H), 7.54-7.47 (m, 2H), 7.13 (s, 1H), 5.14 (s, 1H), 4.58 (s,
2H).
b) (1H-benzo[d]imidazole-5-carbaldehyde)
[1475] To a stirring solution of (1H-benzo[d]imidazol-5-yl)methanol
(501 mg, 3.38 mmol) in benzene (35 mL) was added MnO.sub.2 (2.35,
27.0 mmol). After stirring at room temperature for 12 h the
reaction was then filtered through celite and the filter cake was
washed with THF (200 mL). The Filtrate was concentrated to give the
title compound (1H-benzo[d]imidazole-5-carbaldehyde) (201 mg, 41%)
as a white solid: .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta. 12.90
(bs, 1H), 10.04 (s, 1H), 8.43 (s, 1H), 8.19 (s, 1H), 7.75 (s,
2H).
c) ((1H-benzo[d]imidazol-5-yl)-N-methylmethanamine)
[1476] Prepared according to the procedure of Preparation 1, except
substituting (1H-benzo[d]imidazole-5-carbaldehyde) for the
1-propyl-naphthalene-2-carbaldehyde. The title compound (176 mg,
60%) was obtained as an off-white oil: .sup.1H NMR (400 MHz,
DMSO-d.sub.6) .delta. 8.13 (s, 1H), 7.49 (bs, 2H), 7.14 (d, J=7.2
Hz, 1H), 3.72 (s, 2H), 2.27 (s, 3H).
(E)-N-((1H-benzo[d]imidazol-5-yl)methyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahy-
dro-1,8-naphthyridin-3-yl)acrylamide
[1477] According to the procedure of Example 1(a), except
substituting ((1H-benzo[d]imidazol-5-yl)-N-methylmethanamine) for
the methyl-(1-propyl-naphthalen-2-ylmethyl)amine, and substituting
(E)-3-(7-oxo-5,6,7,8-tetrahydro-[1,8]naphthyridin-3yl)acrylic acid
hydrochloride for the
(E)-3-(4-methyl-2-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7--
yl)acrylic acid hydrochloride. Purification by preparative HPLC
(water/acetonitrile/0.05% TFA mixture) gave the title compound
((E)-N-((1H-benzo[d]imidazol-5-yl)methyl)-N-methyl-3-(7-oxo-5,6,7,8-tetra-
hydro-1,8-naphthyridin-3-yl)acrylamide) (143 mg, 37%) as a white
solid and a mixture of amide rotomers: .sup.1H NMR (400 MHz,
DMSO-d.sub.6) .delta. 10.60 (m, 1H), 8.36 (m, 1H), 8.21 (s, 1H),
8.07 (s, 1H), 7.59-7.21 (m, 4H), 7.12-7.08 (m, 1H), 4.91-4.72 (m,
2H), 3.10-2.86 (m, 5H), 2.55-2.49 (m, 2H); ESI MS m/z 362
[C.sub.20H.sub.19N.sub.5O.sub.2+H].sup.+.
Example 341
Preparation of
(E)-N-methyl-N-((3-methylbenzofuran-2-yl)methyl)-3-(2-oxo-4-phenyl-2,3,4,-
5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride
a) ethyl
2-(((2-amino-5-bromopyridin-3-yl)methyl)(phenyl)amino)acetate
[1478] To a solution of phenyl glycine ethyl ester (4.94 g, 27.6
mmol) and K.sub.2CO.sub.3 (11.42 g, 82.7 mmol) in anhydrous DMF
(300 mL) under argon was added
5-bromo-3-(bromomethyl)pyridin-2-amine hydrobromide (9.52 g, 27.6
mmol). The mixture was stirred for 12 h at 40.degree. C. Water (500
mL) was added and the mixture was extracted with ethyl acetate
(3.times.500 mL). Combined organic layers were washed with water
(2.times.400 mL) and brine (400 mL), dried over MgSO.sub.4,
filtered and concentrated to a brown oil. Purification by column
chromatography (silica gel, gradient elution of 30% ethyl
acetate/hexanes to 80% ethyl acetate/hexanes) gave ethyl
2-(((2-amino-5-bromopyridin-3-yl)methyl)(phenyl)amino)acetate (3.41
g, 34%) as a yellow solid: .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 7.89-7.88 (m, 1H), 7.36-7.35 (m, 1H), 7.17-7.11 (m, 2H),
6.68-6.64 (m, 1H), 6.47-6.44 (m, 2H), 6.09 (s, 2H), 4.30-4.29 (m,
4H), 4.12 (q, J=6.9 Hz, 2H), 1.19 (t, J=6.9 Hz, 3H).
b)
7-bromo-4-phenyl-4,5-dihydro-1H-pyrido[2,3-e][1,4]diazepin-2(3H)-one
[1479] Ethyl
2-(((2-amino-5-bromopyridin-3-yl)methyl)(phenyl)amino)acetate (3.29
g, 9.0 mmol) was dissolved in anhydrous DMSO (105 mL) under Argon.
NaH (361 mg of 60% dispersion in oil, 9.00 mmol) was added and the
reaction was stirred for 12 h at room temperature. Water (200 mL)
was added and the mixture was extracted with CH.sub.2Cl.sub.2
(4.times.100 mL). Combined organic layers were washed with water
(200 mL) and brine (100 mL), dried over Na.sub.2SO.sub.4, filtered
and concentrated to afford
7-bromo-4-phenyl-4,5-dihydro-1H-pyrido[2,3-e][1,4]diazepin-2(3H)-o-
ne (2.95 g, 99%) as an orange solid: .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 10.08 (s, 1H), 8.21 (d, J=2.4 Hz, 1H), 8.10
(d, J=2.4 Hz, 1H), 7.17-7.12 (m, 2H), 6.82-6.80 (m, 2H), 6.71-6.66
(m, 1H), 4.79 (s, 2H), 4.47 (s, 2H).
((E)-N-methyl-N-((3-methylbenzofuran-2-yl)methyl)-3-(2-oxo-4-phenyl-2,3,4,-
5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride)
[1480] A solution of
7-bromo-4-phenyl-4,5-dihydro-1H-pyrido[2,3-e][1,4]diazepin-2(3H)-one
(415 mg, 1.31 mmol),
N-methyl-N-((3-methylbenzofuran-2-yl)methyl)acrylamide (473 mg,
2.06 mmol) and DIPEA (0.45 mL, 2.58 mmol) in anhydrous DMF (3.0 mL)
and propionitrile (9.0 mL) was prepared in a pressure flask. Argon
was bubbled into the mixture with stirring for 30 min. Next
P(o-tol).sub.3 (79.4 mg, 0.261 mmol) and Pd(OAc).sub.2 (29.3 mg,
0.131 mmol) were added to the mixture and argon was bubbled into
the reaction for an additional 5 min. The reaction was then sealed
and was left to stir for 12 h at 110.degree. C. The reaction was
then allowed to cool to room temperature and was filtered through
celite. The filter cake was washed with EtOAc (100 mL) and the
filtrate was washed with water (50 mL) and brine (50 mL), dried
over Na.sub.2SO.sub.4 and concentrated to give a brown oil.
Purification by preparative HPLC (water/acetonitrile/0.05% TFA
mixture) gave the desired product as a yellow solid which was
dissolved in CH.sub.2Cl.sub.2 (6.0 mL). To the mixture was added
HCl (142 .mu.l of 1M solution in ether, 0.142 mmol) and the mixture
was stirred for 5 minutes and then concentrated under high vacuum
to give the title compound
((E)-N-methyl-N-((3-methylbenzofuran-2-yl)methyl)-3-(2-oxo-4-phe-
nyl-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
hydrochloride) (41.2 mg, 6.0%) as a yellow solid and a mixture of
amide rotomers: .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 10.10
(s, 1H), 8.44-8.40 (m, 1H), 8.27 (s, 1H), 7.55-7.47 (m, 3H),
7.30-7.21 (m, 3H), 7.7.16-7.10 (m, 2H), 6.82-6.79 (m, 2H),
6.69-6.63 (m, 1H), 5.00-4.80 (m, 4H), 4.49 (s, 2H), 3.19-2.93 (m,
3H), 2.26 (s, 3H); ESI MS m/z 467
[C.sub.28H.sub.26N.sub.4O.sub.3+H].sup.+.
Example 342
Preparation of
(E)-3-((6-aminopyridin-3-yl)-N-methyl-N-((3-methyl-1H-indol-2-yl)
methyl)acrylamide
[1481] EDC (438 mg, 1.1 mmol) was added to a solution of
N-methyl-(3-methyl-1H-indol-2-yl)methanamine (170 mg, 0.9 mmol),
(E)-3-(6-aminopyrid-3-yl)acrylic acid hydrochloride (176 mg, 1.0
mmol), HOBT.H.sub.2O (130 mg, 0.9 mmol) and DIPEA (0.58 mL, 2.7
mmol) in dry DMF (5 mL). After stirring overnight, water was added.
The precipitate that formed was washed with ethyl acetate and dried
to afford the title compound (65 mg, 23%). .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 10.75-0.54 (rotamers, s, 1H), 8.15 (d, J=7.2
Hz, 1H), 7.94 (s, 1H), 7.84 (d, J=7.7 Hz, 1H), 7.40 (d, J=7.0 Hz,
1H), 7.31 (d, J=7.9 Hz, 1H), 7.02-6.97 (m, 2H), 6.47-6.41 (m, 2H),
5.01-4.85 (rotamers, s, 2H), 4.72 (s, 3H), 2.23 (s, 3H); MS (ESI):
m/e 321.3 (C.sub.19H.sub.20N.sub.4O+H).sup.+.
Example 343
Preparation of
(E)-N-methyl-N-((3-methyl-1H-indol-2-yl)methyl)-3-(3-oxo-3,4-dihydro-2H-p-
yrido[3,2-b][1,4]oxazin-7-yl)acrylamide
[1482] EDC (149 mg, 1.3 mmol) was added to a solution of
N-methyl(3-methyl-1H-indol-2-yl)methanamine (110 mg, 1.0 mmol),
(E)-3-(3-oxo-3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)acrylic
acid hydrochloride (220 mg, 1.1 mmol), HOBT.H.sub.2O (81 mg, 1.0
mmol) and DIPEA (0.43 mL, 3.0 mmol) in dry DMF (5 mL). After
stirring overnight, water was added. The precipitate that formed
was washed with ethyl acetate and dried to afford the title
compound (12 mg, 4%). .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
8.25 (s, 1H), 7.97 (s, 1H), 7.77 (d, J=7.1 Hz, 1H), 7.60 (s, 1H),
7.45 (d, J=7.4 Hz, 1H), 7.34 (m, 2H), 7.18 (s, 1H), 7.11 (m, 1H),
4.90-4.79 (rotamers, s, 2H), 4.72 (s, 2H), 4.60 (s, 3H), 2.31 (s,
3H); MS (ESI): m/e 377.2
(C.sub.21H.sub.20N.sub.4O.sub.3+H).sup.+.
Example 344
Preparation of
(E)-N-((3,7-dimethyl-1H-indol-2-yl)methyl)-N-methyl-3-(3-oxo-3,4-dihydro--
2H-pyrido[3,2-b][1,4]oxazin-7-yl)acrylamide
a) ethyl 3,7-dimethyl-1H-indole-2-carboxylate
[1483] A suspension of 1-o-tolylhydrazine (3.8 g, 30.9 mmol) in
ethanol was warmed to 50.degree. C. A solution of
.alpha.-ketobutyric acid (3.16 g, 30.9 mmol) in ethanol was added
and the mixture stirred at rt overnight. Hydrogen chloride was
bubbled through the solution for 30 min and the mixture heated at
reflux for 2 h then evaporated in vacuo. The crude reaction was
chromatographed over silica gel eluting with ethyl acetate/hexane
(5%) to afford the title compound (1.84 g, 27%). .sup.1H NMR (400
MHz, CDCl.sub.3) .delta. 8.55 (s, 1H), 7.50 (d, J=7.8 Hz, 1H), 7.09
(d, J=6.9 Hz, 1H), 7.03 (t, J=7.6 Hz, 1H), 4.41 (q, J=7.1 Hz, 2H),
2.59 (s, 3H), 2.48 (s, 3H), 1.44 (t, J=7.2 Hz, 3H).
b) (3,7-Dimethyl-1H-indol-2-yl)methanol
[1484] A solution of ethyl 3,7-dimethyl-1H-indole-2-carboxylate
(1.84 g, 8.4 mmol) in THF (20 mL) was added to an ice-cooled
solution of 1.0 M LAH in THF (17.8 mL 17.8 mmol) and stirred
overnight. The reaction was quenched with ethyl acetate (5 mL) and
15% aqueous sodium hydroxide (5 mL), filtered through celite and
evaporated in vacuo. The crude reaction was chromatographed over
silica gel eluting with methanol/dichloromethane (1%) to afford the
title compound (440 mg, 30%). .sup.1H NMR (400 MHz, CDCl.sub.3)
.delta. 8.39 (s, 1H), 7.39 (d, J=7.7 Hz, 1H), 7.06 (t, J=7.2 Hz,
1H), 6.99 (d, J=7.1 Hz, 1H), 4.82 (s, 2H), 4.11 (q, J=7.1 Hz, 2H),
2.45 (s, 3H), 2.28 (s, 3H), 1.26 (t, J=7.1 Hz, 3H).
c) 3,7-Dimethyl-1H-indole-2-carbaldehyde
[1485] A mixture of (3,7-dimethyl-1H-indol-2-yl)methanol (440 mg,
2.5 mmol) and manganese dioxide (1.09 g, 12.5 mmol) in
dichloromethane (15 mL) was stirred overnight at rt. The mixture
was filtered and evaporated. The crude was chromatographed over
silica gel eluting with ethyl acetate/hexane (5% and 7.5%) to
afford the title compound (200 mg, 46%). .sup.1H NMR (400 MHz,
CDCl.sub.3) .delta. 10.00 (s, 1H), 8.75 (s, 1H), 7.51 (d, J=7.2 Hz,
1H), 7.15 (d, J=7.4 Hz, 1H), 7.05 (t, J=7.3 Hz, 1H), 2.61 (s, 3H),
2.45 (s, 3H).
d) (3,7-Dimethyl-1H-indol-2-yl)-N-methanamine
[1486] Methylamine (0.43 mL, 3.4 mmol) was added to a solution of
3,7-dimethyl-1H-indole-2-carbaldehyde (200 mg, 1.1 mmol) in
methanol (5 mL) and stirred for 5 h. The mixture was cooled to
0.degree. C. and sodium borohydride (40.7 mg, 1.1 mmol) added
slowly. The mixture was warmed to rt and stirred overnight. Water
(3 mL) was added slowly at 0.degree. C. and evaporated to a paste.
Water was added and the mixture extracted with dichloromethane. The
organic phase was washed with water, dried and evaporated to afford
the title compound (120 mg, 57%). .sup.1H NMR (400 MHz, CDCl.sub.3)
.delta. 8.40 (s, 1H), 7.36 (d, J=7.7 Hz, 1H), 7.00 (t, J=7.6 Hz,
1H), 6.94 (d, J=7.0 Hz, 1H), 3.89 (s, 2H), 2.48 (s, 3H), 2.45 (s,
3H), 2.27 (s, 3H).
(E)-N-((3,7-dimethyl-1H-indol-2-yl)methyl)-N-methyl-3-(3-oxo-3,4-dihydro-2-
H-pyrido[3,2-b][1,4]oxazin-7-yl)acrylamide
[1487] EDC (157 mg, 0.8 mmol) was added to a solution of
(3,7-dimethyl-1H-indol-2-yl)-N-methanamine (120 mg, 0.6 mmol),
(E)-3-(3-oxo-3,4,dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)acrylic
acid hydrochloride (177 mg, 0.7 mmol), HOBT.H.sub.2O (85 mg, 0.6
mmol) and DIPEA (0.45 mL, 2.5 mmol) in dry DMF (5 mL). After
stirring overnight, water was added. The precipitate that formed
was washed with ethyl acetate and dried (14 mg, 6%). .sup.1H NMR
(400 MHz, DMSO-d.sub.6) .delta. 11.41 (s, 1H), 10.60-10.52
(rotamers, s, 1H), 8.19 (s, 1H), 7.87 (s, 1H), 7.50 (d, J=7.6 Hz,
1H), 7.25 (d, J=6.8 Hz, 1H), 6.88 (m, 2H), 4.90-4.77 (rotamers, s,
2H), 4.68 (s, 3H), 3.05 (s, 2H), 2.84 (s, 1H), 2.44 (s, 3H), 2.21
(s, 3H); MS (ESI): m/e 391.1
(C.sub.22H.sub.22N.sub.4O.sub.3+H).sup.+.
Example 345
(E)-N-methyl-N-((3-methyl-7-(trifluoromethyl)-1H-indol-2-yl)methyl-3-(7-ox-
o-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylamide
[1488] EDC (250 mg, 1.3 mmol) was added to a solution of
(3,7-dimethyl-1H-indol-2-yl)-N-methanamine (174 mg, 1.0 mmol),
(E)-3-(2-methylene-1,2,3,4-tetrahydroquinolin-6-yl)acrylic acid
hydrochloride (369 mg, 1.1 mmol), HOBT.H.sub.2O (136 mg, 1.0 mmol)
and DIPEA (0.72 mL, 4.0 mmol) in dry DMF (5 mL). After stirring
overnight, water was added. The precipitate that formed was washed
with ethyl acetate and dried to afford the title compound (3 mg,
0.7%). NMR (400 MHz, DMSO-d.sub.6) .delta. 9.56 (s, 1H), 8.76 (s,
1H), 8.30 (s, 1H), 7.77 (s, 1H), 7.65 (d, J=7.8 Hz, 1H), 7.38 (d,
J=7.2 Hz, 1H), 7.0 (m, 2H), 6.84 (d, J=7.2 Hz, 1H), 4.72 (s, 2H),
3.15 (s, 3H), 3.01 (t, J=6.8 Hz, 2H), 2.71 (t, J=6.9 Hz, 2H), 2.44
(s, 3H), 2.38 (s, 3H); MS (ESI): m/e 389.2
(C.sub.23H.sub.24N.sub.4O.sub.2+H).sup.+.
Example 346
Preparation of
(E)-N-((3-ethyl-1H-indol-2-yl)methyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydr-
o-1,8-naphthyridin-3-yl)acrylamide
a) N-methyl-1H-indole-2-carboxamide
[1489] EDC (7.7 g, 40.3 mmol) was added to a solution of
indole-2-carboxylic acid (5 g, 13.1 mmol), methylamine, 33% in
ethanol (5.6 mL, 15.5 mmol), HOBT (4.1 g, 13.1 mmol) and DIPEA (2.1
mL, 12.4 mmol) in THF, anhydrous (45 mL) and stirred overnight. The
crude mixture was evaporated in vacuo and chromatographed over
silica eluting with methanol dichloromethane (0-2%) to afford the
title compound (3.51 g, 66%). .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 11.53 (s, 1H), 8.43 (s, 1H), 7.57 (d, J=7.9 Hz, 1H), 7.39
(d, J=8.2 Hz, 1H), 7.15 (t, J=8.2 Hz, 1H), 7.03 (s, 1H), 6.98 (t,
J=7.9 Hz, 1H), 2.79 (d, J=4.7 Hz, 3H)
b) 3-formyl-N-methyl-1H-indole-2-carboxamide
[1490] Oxalyl chloride (2.6 mL, 30 mmol) was added drop-wise to an
ice-cooled solution of dimethylformamide (34 mL) and
dichloromethane (90 mL), then N-methyl-1H-indole-2-carboxamide
(3.51 g, 20 mmol) was added and the mixture stirred at rt for 1 h.
Water was added and the resulting precipitate filtered, washed with
water and diethyl ether. The product was dried to afford the title
compound (2.03 g, 50%). .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.
12.58 (s, 1H), 10.2 (s, 1H), 9.51 (s, 1H), 8.26 (d, J=7.5 Hz, 1H),
7.66 (d, J=8.6 Hz, 1H), 7.47-7.10 (m, 2H), 2.73 (d, J=4.6 Hz,
3H).
c) N-methyl-3-vinyl-1H-indole-2-carboxamide
[1491] n-Butyllithium (2.5M in hexanes) (48.6 mL, 121.7 mmol) was
added dropwise to an ice-cooled solution of methyl
triphenylphosphoniumbromide (43.5 g, 121.7 mmol) in THF (500 mL).
The mixture was stirred at 0.degree. C. for 1 h then at rt for 2 h.
3-Formyl-N-methyl-1H-indole-2-carboxamide (1.96 g, 9.7 mmol) in THF
(100 mL) was added and the mixture stirred at rt for 2 h. The
solvent was evaporated and the residue dissolved in ethyl acetate
and washed twice with water. The organic phase was dried over
magnesium bromide and evaporated in vacuo. The crude mixture was
chromatographed over silica gel eluting with 40% ethyl acetate in
hexanes to afford the title compound (730 mg (38%). .sup.1H NMR
(300 MHz, DMSO-d.sub.6) .delta. 11.48 (s, 1H), 8.04 (s, 1H), 7.92
(d, J=8.0 Hz, 1H), 7.42 (d, J=7.9 Hz, 1H), 7.33 (d, J=18 Hz, 1H),
7.22 (t, J=7.6 Hz, 1H), 7.09 (t, J=7.2 Hz, 1H), 5.77 (d, J=18.4 Hz,
1H), 5.27 (d, J=11.6 Hz, 1H), 2.81 (s, 3H).
d) 3-ethyl-N-methyl-1H-indole-2-carboxamide
[1492] A mixture of N-methyl-3-vinyl-1H-indole-2-carboxamide (1.1
g, 5.4 mmol) and 10% Pd/C (55 mg) in ethyl acetate (150 mL) was
stirred for 3 h under an atmosphere of hydrogen. The mixture was
filtered through celite and evaporated to afford the title compound
(970 mg 90%). .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta. 11.05 (s,
1H), 7.80 (s, 1H), 7.59 (d, J=7.6 Hz, 1H), 7.36 (d, J=8.4 Hz, 1H),
7.17 (t, J=6.8 Hz, 1H), 7.04 (t, J=6.0 Hz, 1H), 3.01 (q, J=7.4 Hz,
2H), 2.81 (d, J=4.6 Hz, 3H), 1.17 (t, J=7.4 Hz, 3H).
e) N-methyl(3-vinyl-1H-indol-2-yl)methanamine
[1493] A solution of N-methyl-3-vinyl-1H-indole-2-carboxamide (740
mg, 3.7 mmol) in dioxane was added slowly to an ice-cooled solution
of lithium aluminium hydride (2.1 g, 55.5 mmol) in dioxane (100
mL). The mixture was stirred at reflux overnight. Excess lithium
aluminium hydride was quenched with 15% NaOH (10 mL) and the
mixture separated. The aqueous phase was washed twice with ethyl
acetate and the combined organic phases dried to afford the title
compound (430 mg 61%). .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta.
11.09 (s, 1H), 7.75 (d, J=8 Hz, 1H), 7.49 (d, J=6.4 Hz, 1H),
7.09-7.05 (m, 2H), 7.04-6.90 (m, 1H), 5.54 (d, J=16 Hz, 1H), 5.06
(d, J=10.0 Hz, 1H), 3.84 (s, 2H), 2.27 (s, 3H).
f) (3-ethyl-1H-indol-2-yl)-N-methylmethanamine
[1494] A solution of 3-ethyl-N-methyl-1H-indole-2-carboxamide (970
mg, 4.80 mmol) in dioxane was added slowly to an ice-cooled
solution of lithium aluminium hydride (273 mg, 72 mmol) in dioxane
(10 mL). The mixture was stirred at reflux overnight. Excess
lithium aluminium hydride was quenched with 15% NaOH (2 mL) and the
mixture separated. The aqueous phase was washed twice with ethyl
acetate and the combined organic phases dried to afford the title
compound (550 mg, 61%). .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta.
10.59 (s, 1H), 7.42 (d, J=8 Hz, 1H), 7.25 (d, J=7.6 Hz, 1H), 7.00
(t, J=7.2 Hz, 1H), 6.89 (t, J=7.2 Hz, 1H), 3.75 (s, 2H), 2.66 (q,
J=7.5 Hz, 2H), 2.27 (s, 3H), 1.14 (t, J=7.6 Hz, 3H).
Preparation of
(E)-N-((3-ethyl-1H-indol-2-yl)methyl)-N-methyl-3-(7-oxo-5,6,7,8-tetrahydr-
o-1,8-naphthyridin-3-yl)acrylamide
[1495] EDC (83 mg, 0.4 mmol) was added to a solution of
(3-ethyl-1H-indol-2-yl)-N-methylmethanamine (62.7 mg, 0.3 mmol),
(E)-3-(7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylic acid
hydrochloride (240 mg, 0.8 mmol), HOBT.H.sub.2O (101 mg, 0.7 mmol)
and DIPEA (0.58 mL, 2.7 mmol) in dry DMF (5 mL). After stirring
overnight, water was added. The precipitate that formed was washed
with ethyl acetate and dried to afford the title compound (77.8 mg,
67%). .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta. 10.61-10.59
(rotamers, s, 2H), 8.36 (s, 1H), 8.07 (s, 1H), 7.51-7.46 (m, 3H),
7.30 (d, J=7.8 Hz, 1H), 7.03 (t, J=7.6 Hz, 1H), 6.95 (t, J=7.2 Hz,
1H), 4.94 (s, 2H), 4.90-4.75 (rotamers, s, 3H), 3.29 (m, 2H),
3.08-2.91 (m, 4H), 1.13 (t, J=7.6 Hz, 3H); MS (ESI): We 389.2
(C.sub.23H.sub.24N.sub.4O.sub.2+H).sup.+.
Example 347
Preparation of
(E)-N-((3-ethyl-1H-indol-2-yl)methyl)-N-methyl-3-(3-oxo-3,4-dihydro-2H-py-
rido[3,2-b][1,4]oxazin-7-yl)acrylamide
[1496] EDC (116 mg, 0.6 mmol) was added to a solution of
(3-ethyl-1H-indol-2-yl)-N-methylmethanamine (87 mg, 0.46 mmol),
(E)-3-(3-oxo-3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)acrylic
acid hydrochloride (123.65 mg, 1.05 mmol), HOBT.H.sub.2O (62 mg,
0.46 mmol) and DIPEA (0.33 mL, 1.8 mmol) in dry DMF (5 mL). After
stirring overnight, water was added. The precipitate that formed
was washed with ethyl acetate and dried to afford the title
compound (76.2 mg, 42%). .sup.1H NMR (400 MHz, DMSO-d.sub.6)
.delta. 11.41 (s, 1H), 8.18 (s, 1H), 7.88 (s, 1H), 7.46 (t, J=7.9
Hz, 2H), 7.25 (d, J=7.9 Hz, 1H), 7.03 (t, J=7.6 Hz, 1H), 6.95 (t,
J=7.1 Hz, 2H), 4.92 (s, 2H), 4.90-4.74 (rotamers, s, 2H), 4.68 (s,
3H), 3.08 (m, 2H), 1.13 (t, J=7.4 Hz, 3H); MS (ESI): ink 391.1
(C.sub.22H.sub.22N.sub.4O.sub.3+H).sup.+.
Example 348
Preparation of
(E)-N-methyl-3-(3-oxo-3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)-N-((3-
-vinyl-1H-indol-2-yl)methyl)acrylamide
[1497] EDC (73 mg, 0.3 mmol) was added to a solution of
N-methyl(3-vinyl-1H-indol-2-yl)methanamine (54.7 mg, 0.29 mmol),
(E)-3-(3-oxo-3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)acrylic
acid hydrochloride (79 mg, 0.3 mmol), HOBT.H.sub.2O (39 mg, 0.29
mmol) and DIPEA (0.21 mL, 1.1 mmol) in dry DMF (5 mL). After
stirring overnight, water was added. The precipitate that formed
was washed with ethyl acetate and dried to afford the title
compound (26 mg, 23%). .sup.1H NMR (400 MHz, DMSO-d6) .delta. 11.41
(s, 1H), 11.20-11.05 (rotamers, s, 1H), 8.18 (s, 1H), 7.87 (s, 1H),
7.80 (d, J=7.8 Hz, 1H), 7.51 (d, J=15.6 Hz, 1H), 7.38 (d, J=7.7 Hz,
1H), 7.22 (d, J=15.6 Hz, 1H), 7.10 (t, J=7.1 Hz, 1H), 7.07-6.98 (m,
2H), 5.62 (d, J=17.9 Hz, 1H), 5.12 (d, J=11.0 Hz, 1H), 5.03 (s,
2H), 4.68 (s, 3H), 3.09 (s, 2H); MS (ESI): m/e 389.1
(C.sub.22H.sub.20N.sub.4O.sub.3+H).sup.+.
Example 349
Preparation of
(E)-N-((1,3-dimethyl-1H-indol-2-yl)methyl)-N-methyl-3-(3-oxo-3,4-dihydro--
2H-pyrido[3,2-b][1,4]oxazin-7-yl)acrylamide
a) 1,3-dimethyl-1H indole
[1498] Sodium hydride (600 mg, 16.6 mmol) was added to a solution
of 3-methylindole (2 g, 15.2 mmol) in DMF (10 mL). The mixture was
stirred for 30 min and iodomethane was added in one portion. The
mixture was cooled in an icebath and left to warm to rt overnight.
The mixture was evaporated and the residue dissolved in ethyl
acetate. The solution was washed with water and brine, dried over
magnesium sulfate and evaporated. The crude reaction was
chromatographed over silica gel eluting with hexane and ethyl
acetate/hexane (20 and 50%) to afford the title compound (1.3 g,
59%). .sup.1H NMR (400 MHz, CDCl.sub.3) .delta. 7.46 (d, J=8 Hz,
1H), 7.34 (d, J=8 Hz, 1H), 7.12 (t, J=7.8 Hz, 1H), 7.06 (s, 1H),
7.00 (t, J=7.6 Hz, 1H), 3.70 (s, 3H), 2.23 (s, 3H)
b) 1,3-dimethyl-1H indole-2-carbaldehyde
[1499] Phosphorous oxychloride (0.0.93 mL, 9.7 mmol) was added
dropwise with stirring to DMF (5 mL) at 10.degree. C. over 20 min.
1,3-dimethyl-1H indole (1.3 g mg, 8.9 mmol) in DMF (5 mL) was added
slowly with stirring and the mixture was heated for 3 h at
98-100.degree. C. Excess concentrated aqueous solution of sodium
acetate was added. The mixture was stirred for 30 min at 28.degree.
C. and extracted with ethyl acetate, dried and evaporated. The
crude mixture was chromatographed over silica gel eluting with
hexane/ether to afford the title compound (1.5 g, 97%). .sup.1H NMR
(400 MHz, DMSO-d.sub.6) .delta. 10.15 (s, 1H), 7.74 (d, J=7.6 Hz,
1H), 7.53 (d, J=7.8 Hz, 1H), 7.42 (t, J=8.0 Hz, 1H), 7.15 (t, J=7.6
Hz, 1H), 3.99 (s, 3H), 2.60 (s, 3H)
c) (1,3-dimethyl-1H-indol-2-yl)-N-methylmethanamine
[1500] Methylamine (0.53 mL, 13.1 mmol) was added to a solution of
1,3-dimethyl-1H indole-2-carbaldehyde (760 mg, 4.3 mmol) in
methanol (15 mL) and stirred for 5 h. The mixture was cooled to
0.degree. C. and sodium borohydride (159 mg, 4.3 mmol) added
slowly. The mixture was warmed to rt and stirred overnight. Water
(3 mL) was added slowly at 0.degree. C. and evaporated to a paste.
Water was added and the mixture extracted with dichloromethane.
[1501] The organic phase was washed with water, dried and
evaporated to afford the title compound (690 mg, 85%). .sup.1H NMR
(400 MHz, DMSO-d.sub.6) .delta. 7.44 (d, J=7.8 Hz, 1H), 7.34 (d,
J=8.1 Hz, 1H), 7.10 (t, J=7.6 Hz, 1H), 6.98 (t, J=8.0 Hz, 1H), 3.77
(s, 2H), 3.71 (s, 3H), 2.27 (s, 3H), 2.23 (s, 3H).
[1502] EDC (132.5 mg, 0.6 mmol) was added to a solution of
(1,3-dimethyl-1H-indol-2-yl)-N-methylmethanamine (100 mg, 0.5
mmol),
(E)-3-(3-oxo-3,4,dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)acrylic
acid hydrochloride (143 mg, 0.55 mmol), HOBT.H.sub.2O (72 mg, 0.5
mmol)) and DIPEA (0.38 mL, 2.1 mmol) in dry DMF (5 mL). After
stirring overnight, water was added. The precipitate that formed
was washed with ethyl acetate and dried to afford the title
compound (144 mg, 74%). .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta.
11.51 (s, 1H), 8.24 (s, 1H), 7.94 (d, J=7.6 Hz, 1H), 7.60-7.48 (m,
2H), 7.38 (m, 1H), 7.20-7.28 (m, 1H), 7.14 (t, J=7.8 Hz, 1H), 7.07
(d, J=7.5 Hz, 1H), 5.11 (s, 2H), 5.01-4.98 (rotamers, s, 2H), 4.77
(s, 3H), 3.80 (s, 3H), 2.31 (s, 3H); MS (ESI): m/e 391.2
(C.sub.22H.sub.22N.sub.4O.sub.3+H).sup.+.
Example 350
(E)-N-((1,3-dimethyl-1H-indol-2-yl)methyl)-N-methyl-3-(2-oxo-4-phenyl-2,3,-
4,5-tetrahydro-1H-pyrido[2,3-e][1,4]diazepin-7-yl)acrylamide
[1503] A solution of
N-((1,3-dimethyl-1H-indol-2-yl)methyl)-N-methylacrylamide (92 mg,
0.3 mmol) and DIPEA (0.16 mL, 0.9 mmol) in DMF (5 mL) was purged
with argon for 10 min. Pd(OAc).sub.2 (6 mg, 0.03 mmol) and
P(o-Tol).sub.3 (18 mg, 0.06 mmol) were added and the mixture was
purged with argon and heated to 100.degree. C. The crude mixture
was filtered and water was added. The precipitate that formed was
washed with ethyl acetate and dried to afford the title compound
(144 mg, 74%). .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta.
10.06-9.95 (rotamers, s, 1H), 8.32 (d, J=8.0 Hz, 2H), 7.57 (s, 1H),
7.50 (t, J=7.6 Hz, 2H), 7.38 (m, 3H), 7.12 (t, J=7.6 Hz, 2H), 7.03
(t, J=7.6 Hz, 1H), 6.84-6.35 (m, 2H), 4.90-4.80 (rotamers, s, 2H),
4.80 (s, 2H), 4.50 (s, 3H), 3.63 (s, 3H), 2.98 (s, 2H), 2.32 (s,
3H); MS (ESI): m/e 480.2
(C.sub.29H.sub.29N.sub.5O.sub.2+H).sup.+.
Example 351
Preparation of
(E)-N-methyl-N-((3-methyl-7-(trifluoromethyl)-1H-indol-2-yl)methyl)-3-(3--
oxo-3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)acrylamide
a) Ethyl 3-methyl-7-(trifluoromethyl)-1H-indole-2-carboxylate
[1504] A solution of sodium nitrite (2.3 g, 34 mmol) was added
dropwise to a mixture of trifluoromethyl aniline (3.85 mL, 31
mmol), HCl (7.5 mL) and water (15 mL) at -5.degree. C. After the
addition, the mixture was stirred at 0.degree. C. for 15 min and
brought to pH 3-4 by addition of sodium acetate. In a separate
flask, a solution of ethyl .alpha.-ethylacetoacetate (5 mL, 31
mmol) in ethanol (25 mL) at 0.degree. C. was treated with a
solution of potassium hydroxide (1.74 g, 31 mmol) in water (10 mL)
followed by addition of ice. The diazonium salt was immediately
added to this alkaline solution. The mixture was adjusted to pH 5-6
by adding sodium acetate and stirred at 0.degree. C. for 3 h. The
solution was kept overnight at 4.degree. C. and extracted with
ethyl acetate, washed with brine, dried over magnesium sulfate and
most of the solvent removed. The crude mixture was added dropwise
to a solution of ethanolic HCl (25 mL) at 78.degree. C. and stirred
for 2 h at 78.degree. C. The mixture was evaporated and
chromatographed over silica gel eluting with ethyl acetate/hexane
(3%) to afford the title compound (2.26 g, 26%). .sup.1H NMR (400
MHz, CDCl.sub.3) .delta. 8.92 (s, 1H), 7.79 (d, J=8 Hz, 1H), 7.55
(d, J=7.2 Hz, 1H), 7.15 (t, J=7.6 Hz, 1H), 4.41 (q, J=6.9 Hz, 2H),
2.60 (s, 3H), 1.42 (t, J=6.9 Hz, 3H)
b) (3-Methyl-7-(trifluoromethyl)-1H-indol-2-yl)methanol
[1505] A solution of ethyl
3-methyl-7-(trifluoromethyl)-1H-indole-2-carboxylate (2.2 g, 8.1
mmol) in THF (50 mL) was added to an ice cooled solution of 1M LAH
in TIM (16.2 mL, 16.2 mmol) and stirred overnight. The reaction was
quenched with ethyl acetate and sodium hydroxide, filtered through
celite and evaporated to afford the title compound (1.03 g, 57%).
.sup.1H NMR (400 MHz, CDCl.sub.3) .delta. 8.74 (s, 1H), 7.66 (d,
J=7.9 Hz, 1H), 7.40 (d, J=7.3 Hz, 1H), 7.12 (t, J=4.7 Hz, 1H), 4.81
(s, 2H), 2.26 (s, 3H)
c) 3-Methyl-7-(trifluoromethyl)-1H-indole-2-carbaldehyde
[1506] A mixture of
(3-methyl-7-(trifluoromethyl)-1H-indol-2-yl)methanol (1.03 g, 4.4
mmol) and manganese (IV) oxide (1.95 g, 22.4 mmol) in
dichloromethane (15 mL) was stirred overnight. The mixture was
filtered through celite and evaporated to afford the title compound
(510 mg, 51%). NMR (400 MHz, CDCl.sub.3) .delta. 10.08 (s, 1H),
8.95 (s, 1H), 7.87 (d, J=7.9 Hz, 1H), 7.62 (d, J=7.1 Hz, 1H), 7.20
(t, J=7.7 Hz, 1H), 2.65 (s, 3H)
d)
N-methyl(3-methyl-7-trifluoromethyl)-1H-indol-2-yl)methanamine
[1507] Methylamine (0.28 mL, 6.7 mmol) was added to a solution of
3-methyl-7-(trifluoromethyl)-1H-indole-2-carbaldehyde (510 mg, 2.2
mmol) in methanol (5 mL) and stirred for 5 h. The mixture was
cooled to 0.degree. C. and sodium borohydride (83 mg, 2.2 mmol)
added slowly. The mixture was warmed to rt and stirred overnight.
Water (3 mL) was added slowly at 0.degree. C. and evaporated to a
paste. Water was added and the mixture extracted with
dichloromethane. The organic phase was washed with water, dried and
evaporated to afford the title compound (310 mg, 58%). .sup.1H NMR
(400 MHz, CDCl.sub.3) .delta. 8.93 (s, 1H), 7.66 (d, J=7.8 Hz, 1H),
7.38 (d, J=7.4 Hz, 1H), 7.11 (t, J=7.5 Hz, 1H), 3.90 (s, 2H), 2.48
(s, 3H), 2.28 (s, 3H).
[1508] EDC (160 mg, 0.78 mmol) was added to a solution of
N-methyl(3-methyl-7-trifluoromethyl)-1H-indol-2-yl)methanamine (155
mg, 0.6 mmol),
(E)-3-(3-oxo-3,4,dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)acrylic
acid hydrochloride (180 mg, 0.7 mmol), HOBT.H.sub.2O (86 mg, 0.6
mmol) and DIPEA (0.46 mL, 2.5 mmol) in dry DMF (5 mL). After
stirring overnight, water was added. The precipitate that formed
was washed with ethyl acetate and dried to afford the title
compound (72 mg, 27%). .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta.
11.41 (s, 1H), 11.10-10.89 (rotamers, s, 1H), 8.20 (s, 1H), 7.80
(d, J=8.0 Hz, 1H), 7.76 (d, J=7.5 Hz, 1H), 7.54 (s, 1H), 7.41 (d,
J=7.5 Hz, 1H), 7.31-7.20 (m, 2H), 5.05-4.81 (rotamers, s, 2H), 4.68
(s, 2H), 3.08 (s, 3H), 2.21 (s, 3H); MS (ESI): m/e 445.1
(C.sub.22H.sub.19F.sub.3N.sub.4O.sub.3+H).sup.+.
Example 352
(E)-N-methyl-N-((3-methyl-7-(trifluoromethyl)-1H-indol-2-yl)methyl)-3-(7-o-
xo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylamide
[1509] EDC (159 mg, 0.78 mmol) was added to a solution of
N-methyl(3-methyl-7-trifluoromethyl)-1H-indol-2-yl)methanamine (155
mg, 0.6 mmol),
(E)-3-(2-methylene-1,2,3,4-tetrahydroquinolin-6-yl)acrylic acid
hydrochloride (172 mg, 0.67 mmol), HOBT.H.sub.2O (86 mg, 0.6 mmol)
and DIPEA (0.46 mL, 2.5 mmol) in dry DMF (5 mL).
[1510] After stirring overnight, water was added. The precipitate
that formed was washed with ethyl acetate and dried to afford the
title compound (157 mg, 60%). .sup.1H NMR (400 MHz, DMSO-d.sub.6)
.delta. 11.05-10.90 (rotamers, s, 1H), 10.61 (s, 1H), 8.37 (s, 1H),
8.07 (s, 1H), 7.76 (d, J=7.7 Hz, 1H), 7.56-7.40 (m, 2H), 7.17-7.13
(m, 2H), 5.05-4.82 (rotamers, s, 2H), 3.10 (s, 2H), 2.84 (s, 3H),
2.32 (s, 3H); MS (ESI): m/e 443.1
(C.sub.23H.sub.21F.sub.3N.sub.4O.sub.2+H).sup.+.
Example 353
Preparation of
(E)-N-((7-ethyl-3-methyl-1H-indol-2-yl)methyl)-N-methyl-3-(3-oxo-3,4-dihy-
dro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)acrylamide
a) Ethyl 7-ethyl-3-methyl-1H-indole-2-carboxylate
[1511] A solution of sodium nitrite (6.24 g, 90.64 mmol) was added
dropwise to a mixture of 2-ethyl aniline (10.2 mL, 82.4 mmol),
conc.HCl (20 mL) and water (30 mL) at -5.degree. C. After the
addition, the mixture was stirred at 0.degree. C. for 15 min and
brought to pH 3-4 by addition of sodium acetate. In a separate
flask, a solution of ethyl .alpha.-ethylacetoacetate (14.6 mL,
90.64 mmol) in ethanol (50 mL) at 0.degree. C. was treated with a
solution of potassium hydroxide (5.08 g, 90.64 mmol) in water (20
mL) followed by addition of ice. The diazonium salt was immediately
added to this alkaline solution. The mixture was adjusted to pH 5-6
by adding sodium acetate and stirred at 0.degree. C. for 3 h. The
solution was kept overnight at 4.degree. C. and extracted with
ethyl acetate, washed with brine, dried over magnesium sulfate and
most of the solvent removed. The crude mixture was added dropwise
to a solution of ethanolic HCl (50 mL) at 78.degree. C. and stirred
for 2 h at 78.degree. C. The mixture was evaporated and
chromatographed over silica gel eluting with ethyl acetate/hexane
(3%) to afford the title compound (2.2 g, 11%). .sup.1H NMR (400
MHz, CDCl.sub.3) .delta. 8.52 (s, 1H), 7.48 (d, J=8 Hz, 1H), 7.12
(d, J=6.8 Hz, 1H), 7.06 (t, J=7.2 Hz, 1H), 4.38 (q, J=7.3 Hz, 2H),
2.82 (q, J=7.6 Hz, 2H), 2.58 (s, 3H), 1.40 (t, J=7.2 Hz, 3H), 1.33
(t, J=7.6 Hz, 3H)
b) (7-Ethyl-3-methyl-1H-indol-2-yl)methanol
[1512] A solution of ethyl 7-ethyl-3-methyl-1H-indole-2-carboxylate
(2.2 g, 9.5 mmol) in THF (50 mL) was added to an ice cooled
solution of 1M LAH in THF (19 mL, 19.0 mmol) and stirred overnight.
The reaction was quenched with ethyl acetate and sodium hydroxide,
filtered through celite and evaporated to afford the title compound
(1.6 g, 100%). .sup.1H NMR (400 MHz, CDCl.sub.3) .delta. 8.45 (s,
1H), 7.39 (d, J=6.5 Hz, 1H), 7.04 (m, 2H), 4.80 (s, 2H), 2.83 (q,
J=4.8 Hz, 2H), 2.28 (s, 3H), 1.34 (t, J=4.4 Hz, 3H)
c) 7-Ethyl-3-methyl-1H-indole-2-carbaldehyde
[1513] A mixture of (7-ethyl-3-methyl-1H-indol-2-yl)methanol (1.6
g, 9.1 mmol) and manganese (IV) oxide (3.97 g, 45.7 mmol) in
dichloromethane (15 mL) was stirred overnight. The mixture was
filtered through celite and evaporated to afford the title compound
(1.1 mg, 65%). .sup.1H NMR (400 MHz, CDCl.sub.3) .delta. 10.02 (s,
1H), 8.90 (s, 1H), 7.53 (d, J=8.0 Hz, 1H), 7.19 (d, J=7.6 Hz, 1H),
7.10 (t, J=7.7 Hz, 1H), 2.83 (q, J=7.5 Hz, 2H), 2.62 (s, 3H), 1.31
(t, J=7.5 Hz, 3H)
d) (7-Ethyl-3-methyl-1H-indol-2-yl)-N-methanamine
[1514] Methylamine (0.7 mL, 17.6 mmol) was added to a solution of
7-ethyl-3-methyl-1H-indole-2-carbaldehyde (1.1 mg, 5.8 mmol) in
methanol (5 mL) and stirred for 5 h. The mixture was cooled to
0.degree. C. and sodium borohydride (218 mg, 5.8 mmol) added
slowly. The mixture was warmed to rt and stirred overnight. Water
(3 mL) was added slowly at 0.degree. C. and evaporated to a paste.
Water was added and the mixture extracted with dichloromethane. The
organic phase was washed with water, dried and evaporated to afford
the title compound (826 mg, 75%). .sup.1H NMR (400 MHz, CDCl.sub.3)
.delta. 8.22 (s, 1H), 7.34 (d, J=7.7 Hz, 1H), 7.01 (t, J=7.6 Hz,
1H), 6.96 (d, J=6.8 Hz, 1H), 3.87 (s, 2H), 2.79 (q, J=7.5 Hz, 2H),
2.45 (s, 3H), 2.24 (s, 3H), 1.31 (t, J=7.6 Hz, 3H)
(E)-N-((7-ethyl-3-methyl-1H-indol-2-yl)methyl)-N-methyl-3-(3-oxo-3,4-dihyd-
ro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)acrylamide
[1515] EDC (147 mg, 0.7 mmol) was added to a solution of
(7-ethyl-3-methyl-1H-indol-2-yl)-N-methanamine (108.7 mg, 0.5
mmol),
(E)-3-(3-oxo-3,4,dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)acrylic
acid hydrochloride (151 mg, 0.6 mmol), HOBT.H.sub.2O (73 mg, 0.5
mmol) and DIPEA (0.39 mL, 2.1 mmol) in dry DMF (5 mL). After
stirring overnight, water was added. The precipitate that formed
was washed with ethyl acetate and dried to afford the title
compound (25 mg, 0.001%). .sup.1H NMR (400 MHz, DMSO-d.sub.6)
.delta. 9.34 (s, 1H), 8.92 (s, 1H), 8.15 (s, 1H), 7.65 (d, J=7.6
Hz, 1H), 7.41 (s, 1H), 7.38 (d, J=7.2 Hz, 1H), 7.05 (m, 2H), 6.80
(d, J=7.5 Hz, 1H), 4.70 (s, 2H), 3.15 (s, 3H), 2.88 (q, J=7.0 Hz,
2H), 2.40 (s, 3H), 1.30 (t, J=7.2 Hz, 3H); MS (ESI): We 405.2
(C.sub.23H.sub.24N.sub.4O.sub.3+H).sup.+.
Example 354
(E)-N-((7-ethyl-3-methyl-1H-indol-2-yl)methyl)-N-methyl-3-(7-oxo-5,6,7,8-t-
etrahydro-1,8-naphthyridin-3-yl)acrylamide
[1516] EDC (138 mg, 0.7 mmol) was added to a solution of
(7-ethyl-3-methyl-1H-indol-2-yl)-N-methanamine (112.2 mg, 0.5
mmol), (E)-3-(2-methylene-1,2,3,4-tetrahydroquinolin-6-yl)acrylic
acid hydrochloride (155 mg, 0.6 mmol) HOBT.H.sub.2O (75 mg, 0.5
mmol) and DIPEA (0.4 mL, 2.2 mmol) in dry DMF (5 mL). After
stirring overnight, water was added. The precipitate that formed
was washed with ethyl acetate and dried to afford the title
compound (90 mg, 44.7%). .sup.1H NMR (400 MHz, DMSO-d.sub.6)
.delta. 11.50 (s, 1H), 10.44 (s, 1H), 8.39 (s, 1H), 8.29 (s, 1H),
8.09 (m, 1H), 7.85 (d, J=7.6 Hz, 1H), 7.5 (d, J=7.0 Hz, 1H), 7.34
(d, J=7.8 Hz, 1H), 6.88 (m, 2H), 5.05-4.85 (rotamers, s, 2H), 3.22
(m, 2H), 3.15 (s, 3H), 2.88 (q, J=7.0 Hz, 2H), 2.70 (m, 2H), 2.40
(s, 3H), 1.30 (t, J=7.2 Hz, 3H); MS (ESI): m/e 419
(C.sub.24H.sub.26N.sub.4O.sub.2+H).sup.+.
Example 355
a) Ethyl 5-bromo-3,6-dimethyl-1H-indole-2-carboxylate
[1517] A solution of NaNO.sub.2 (1.52 g, 22 mmol) in water (4 mL)
was added to a vigorously stirred mixture of
4-bromo-3-methylaniline (3.72 g, 20 mmol) at -5.degree. C. After 30
min stirring, the solution was adjusted to pH 5 with NaOAc (1.40
g). A cold solution of ethyl 2-ethyl-3-oxobutanoate (4.0 g, 22
mmol) and KOH (1.36 g, 22 mmol) in EtOH (16 mL) were added followed
by crushed ice (-30 g). NaOAc was added if necessary to adjust the
pH to 5. The mixture was stirred for 5 h at 0.degree. C. then kept
at this temperature overnight. The solution was extracted with
EtOAc, washed with brine, dried and evaporated to 8 mL. This
solution was added to a solution of HCl (25 mL, 7M in EtOH). It was
further refluxed for 3 h. Upon cooling in an ice bath, water (200
mL) was added slowly. The precipitate was filtered, washed with
water and dried to afford 5.36 g (91%) as a 1:1 mixture of the
title compound and its ethyl
5-bromo-3,4-dimethyl-1H-indole-2-carboxylate isomer. .sup.1H NMR
(300 MHz, CDCl.sub.3), 8, mix 8.66 and 8.54 (2s, br, 1H), 7.83 and
7.23 (2s, 2.times.0.5H), 7.42 and 7.05 (2d, J=8.7 Hz,
2.times.0.5H), 4.41 (q, J=7.2 Hz, 2H), 2.81, 2.79, 2.53 and 2.49
(4s, 4.times.1.5H), 1.42 (t, J=7.2 Hz, 3H).
b) 5-Bromo-3,6-dimethyl-1H-indole-2-carboxylic acid
[1518] A 1:1 isomeric mixture of ethyl
5-bromo-3,6-dimethyl-1H-indole-2-carboxylate and
5-bromo-3,4-dimethyl-1H-indole-2-carboxylate (5.36 g, 18.1 mmol)
was dissolved in EtOH (20 mL) and KOH (3.6 g, 54 mmol). The mixture
was refluxed for 3 h and gave 4.67 g (99%) of a 1:1 isomeric
mixture of the corresponding acids. The mixture was acidified and
the precipitate that formed was filtered and dried at 120.degree.
C. to afford the title compound (4.39 g, 90.6%). .sup.1H NMR (300
MHz, DMSO-d.sub.6) .delta., mix 12.96 (s, 1H), 11.50 and 11.40 (2s,
2.times.0.5H), 7.85 and 7.33 (2s, 2.times.0.5H), 7.34 and 7.16 (2d,
J=8.7 Hz, 2.times.0.5H), 2.76, 2.73, 2.49 and 2.47 (4s,
4.times.1.5H).
c) 5-Bromo-3,6-dimethyl-1H-indole
[1519] A 1:1 mixture of 5-bromo-3,6-dimethyl-1H-indole-2-carboxylic
acid and 5-bromo-3,4-dimethyl-1H-indole-2-carboxylic acid (4.39 g,
16.4 mmol) in quinoline (10 mL) with copper powder (250 mg) was
stirred at 240.degree. C. for 3 h to give the corresponding mixture
of the decarboxylated products. Upon cooling, ether (200 mL) was
added and the mixture acidified with 5N HCl. The layers were
separated, the organics were washed with brine, dried and
evaporated. Chromatography (silica, 15% CH.sub.2Cl.sub.2 in hexane)
and crystallization from a CH.sub.2Cl.sub.2/hexane mixture afforded
the title compound (1.35 g 37%). .sup.1H NMR (300 MHz, CDCl.sub.3)
.delta. 7.74 (s, 1H), 7.21 (1s, 1H), 6.90 (s, 1H), 2.48 (s, 3H),
2.27 (s, 3H).
d) 3,6-Dimethyl-1H-indole-5-carbaldehyde
[1520] tert-Butyl lithium (16.7 mL, 28.3 mmol, 1.7 M in pentanes)
was added to a dry ether (20 mL) solution of
5-bromo-3,6-dimethyl-1H-indole (1.27 g, 5.67 mmol) at -78.degree.
C. under Argon. The mixture was stirred at 0.degree. C. for 30 min
then cooled to -78.degree. C. DMF (18 mL) was added and the mixture
was stirred at 0.degree. C. for 1 h. The reaction was quenched with
cold, saturated NH.sub.4Cl solution at -78.degree. C. The mixture
was diluted with ether and hexane, washed with brine, dried and
evaporated. Crystallization from a CH.sub.2Cl.sub.2/hexane mixture
afforded the title compound (810 mg 82%). .sup.1H NMR (300 MHz,
CDCl.sub.3) .delta. 10.29 (s, 1H), 8.06 (s, 1H), 8.00 (s, br, 1H),
7.15 (1s, 1H), 6.97 (s, 1H), 2.76 (s, 3H), 2.36 (s, 3H).
e) 3,6-dimethyl-1H-indol-5-yl)-N-methylmethanamine
[1521] Methylamine (2.4 mL, 19 mmol, 33% in EtOH) was added to a
MeOH (10 mL) solution of 3,6-dimethyl-1H-indole-5-carbaldehyde (810
mg, 4.7 mmol). The mixture was stirred for 5 h at 21.degree. C. The
mixture was cooled to 0.degree. C. and NaBH.sub.4 (180 mg, 4.7
mmol) was added slowly. The mixture was stirred at 21.degree. C.
for 16 h, water (1 mL) was added then it was evaporated to a paste.
This was diluted with CH.sub.2Cl.sub.2, washed with water, dried
over K.sub.2CO.sub.3 and evaporated to afford the title compound
(848 mg 96%). (300 MHz, CDCl.sub.3) .delta. 7.77 (s, br, 1H), 7.47
(s, br, 1H), 7.26 (1s, 1H), 6.87 (s, 1H), 3.83 (s, 2H), 2.54 (s,
3H), 2.45 (s, 3H), 2.31 (s, 3H).
Preparation of
(E)-N-((3,6-dimethyl-1H-indol-5-yl)methyl)-N-methyl-3-(7-oxo-5,6,7,8-tetr-
ahydro-1,8-naphthyridin-3-1)acrylamide
[1522] EDC (132 mg, 0.69 mmol) was added to a solution of
3,6-dimethyl-1H-indol-5-yl)-N-methylmethanamine (100 mg, 0.5 mmol),
(E)-3-(2-methylene-1,2,3,4-tetrahydroquinolin-6-yl)acrylic acid
hydrochloride (148 mg, 0.6 mmol) HOBT.H.sub.2O (71.8 mg, 0.5 mmol)
and DIPEA (0.38 mL, 2.2 mmol) in dry DMF (5 mL). After heating
overnight, water was added. The precipitate that formed was washed
with ethyl acetate and dried to afford the title compound (33 mg,
17%). .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta., 10.70-10.60 (m,
2H), 8.32-8.22 (rotamers, s, 1H), 8.00-7.95 (rotamers, s, 2H), 7.54
(d, J=7.6 Hz, 1H), 7.32 (m, 1H), 7.09 (m, 1H), 6.98 (s, 1H),
4.89-4.72 (rotamers, s, 2H), 3.32 (m, 2H), 3.02 (m, 2H), 2.84 (s,
3H), 2.46 (s, 3H), 2.31 (s, 3H); m/e 389.2
(C.sub.23H.sub.24N.sub.4O.sub.2+H).sup.+.
Example 356
Preparation of
(E)-N-((3,6-dimethyl-1H-indol-5-yl)methyl)-N-methyl-3-(3-oxo-3,4-dihydro--
2H-pyrido[3,2-b][1,4]oxazin-yl)acrylamide
[1523] EDC (198 mg, 1.0 mmol) was added to a solution of
(7-ethyl-3-methyl-1H-indol-2-yl)-N-methanamine (150 mg, 0.8 mmol),
(E)-3-(3-oxo-3,4,dihydro-2H-pyrido[3,2-b][1,4]oxazin-7-yl)acrylic
acid hydrochloride (224 mg, 0.87 mmol) HOBT.H.sub.2O (107 mg, 0.8
mmol) and DIPEA (0.57 mL, 3.1 mmol) in dry DMF (5 mL). After
heating overnight, water was added. The precipitate that formed was
washed with ethyl acetate and dried (184 mg, 59%). .sup.1H NMR (300
MHz, DMSO-d.sub.6) .delta., 11.42 (s, 1H), 10, 45 (s, 1H),
8.24-8.05 (rotamers, s, 1H), 7.98-7.80 (rotamers, s, 2H), 7.54 (d,
J=7.4 Hz, 1H), 7.24 (m, 1H), 7.14 (m, 1H), 6.98 (s, 1H), 4.90-4.78
(rotamers, s, 2H), 3.05 (s, 2H), 2.84 (s, 3H), 2.45 (s, 3H), 2.31
(s, 3H); m/e 391.1 (C.sub.22H.sub.22N.sub.4O.sub.3+H).sup.+.
Example 357
Preparation of
(E)-N-methyl-N-((3-methylbenzofuran-2-yl)methyl)-3-(7-oxo-7,8-dihydro-1,8-
-naphthyridin-3-yl)acrylamide
a) (E)-tert-butyl 3-(2-amino-5-bromopyridin-3-yl)acrylate
[1524] A reaction vessel was charged with
5-bromo-3-iodopyridin-2-amine (1 g, 3.35 mmol), tert-butyl acrylate
(0.97 mL, 6.69 mmol), and (i-Pr).sub.2EtN (1.75 mL, 10.01 mmol)
followed by propionitrile (20 mL) and then DMF (5 mL). The solution
was de-oxygenated with argon for 15 minutes. The mixture was
treated with Pd(OAc).sub.2 (75 mg, 0.34 mmol) and P(o-tol).sub.3
(204 mg, 0.67 mmol) then heated to 90.degree. C. for 16 h
(overnight) then filtered through a pad of silica gel. The filtrate
was concentrated and dried under reduced pressure to give a dark
brown residue which was subjected to flash chromatography on silica
gel using 20% ethyl acetate:hexanes to 40% ethyl acetate:hexanes.
The appropriate fractions were collected and concentrated to give a
yellow solid. Yield: 700 mg (70%); .sup.1H NMR (300 MHz,
DMSO-d.sub.6) .delta. 8.06 (d, 1H, J=2.3 Hz), 8.03 (d, 1H, J=2.3
Hz), 7.61 (d, 1H, J=15.0 Hz), 6.58 (s, 2H), 6.50 (d, 1H, J=15.0
Hz), 1.50 (s, 9H); ESI MS m/z 299 (100%); 301
(100%)[C.sub.12H.sub.15N.sub.2O.sub.2Br+H].sup.+
b) 6-bromo-1,8-naphthyridin-2(1H)-one
[1525] A solution of (E)-tert-butyl
3-(2-amino-5-bromopyridin-3-yl)acrylate (2.5 g, 8.35 mmol) in
anhydrous methanol (50 mL) was treated with sodium methoxide (8.5
mL of a 4.9 M solution, 41.75 mmol). The solution was heated at
reflux for 2 h then cooled to room temperature. The mixture was
cooled in an ice-H.sub.2O bath and treated with H.sub.2O (100 mL)
under rapid stirring to give a precipitate. The solid was filtered
and washed with H.sub.2O (20 mL). The filtrate was neutralized with
1 M HCl(aq) to form a precipitate. The solid was filtered and
washed with H.sub.2O (20 mL). The solids were combined and dried
under reduced pressure to give an off-white solid (1.75 g, 93%).
.sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 8.43 (d, 1H, J=2.5 Hz),
8.06 (d, 1H, J=2.5 Hz), 7.60 (d, 1H, J=9.1 Hz), 6.44 (d, 1H, J=9.1
Hz); ESI MS m/z 225 (100%); 227
(100%)[C.sub.8H.sub.5N.sub.2OBr+H].sup.+
c) (E)-tert-butyl
3-(7-oxo-7,8-dihydro-1,8-naphthyridin-3-yl)acrylate
[1526] A reaction vessel was charged with
6-bromo-1,8-naphthyridin-2(1H)-one (1.5 g, 6.69 mmol), tert-butyl
acrylate (4.86 mL, 33.45 mmol), and (i-Pr).sub.2EtN (3.5 mL, 20.07
mmol) followed by DMF (40 mL). The solution was de-oxygenated with
argon for 20 min. The mixture was treated with Pd(OAc).sub.2 (150
mg, 0.67 mmol) and P(o-tol).sub.3 (407 mg, 1.34 mmol) then heated
to 100.degree. C. for 15 h (overnight). A TLC analysis indicated
that only the starting arylhalide is present. At this time the
mixture was a yellow suspension. To this mixture was added 20 DMSO
(20 mL) and an additional 75 mg of Pd(OAc).sub.2. The mixture was
heated at 100.degree. C. for 24 h. After cooling, the dark mixture
was filtered through celite and the filter cake was rinsed with
EtOAc (100 mL). The filtrate was extracted with EtOAc (2.times.100
mL). The combined organic fractions were washed with brine
(2.times.100 mL), H.sub.2O (100 mL), dried over MgSO.sub.4 and
filtered through a pad of silica gel. The filtrate was concentrated
to about 50 mL then treated with about 150 mL hexanes to form a
precipitate. The precipitate was filtered to give the product as a
light brown solid. Yield: 700 mg (39%); .sup.1H-NMR (300 MHz,
DMSO-d.sub.6) .delta. 12.36 (s, 1H), 8.83 (d, 1H, J=2.3 Hz), 8.53
(d, 1H, J=2.3 Hz), 7.89 (d, 1H, J=9.0 Hz), 7.64 (d, 1H, J=18.0 Hz),
6.65 (d, 1H, J=18.0 Hz), 6.62 (m, 1H), 1.51 (s, 9H); ESI MS m/z 273
[C.sub.15H.sub.16N.sub.2O.sub.3+H].sup.+
d) (E)-3-(7-oxo-7,8-dihydro-1,8-naphthyridin-3-yl)acrylic acid
Hydrochloride
[1527] A suspension of (E)-tert-butyl
3-(7-oxo-7,8-dihydro-1,8-naphthyridin-3-yl)acrylate (500 mg, 1.84
mmol) in CH.sub.2Cl.sub.2 (7 mL) was treated with trifluoroacetic
acid (7 mL). The mixture became homogeneous and it was stirred at
room temperature for 1 h. The solution was concentrated to dryness
and treated with 4M HCl in dioxane (5 mL). The suspension was
sonicated for 20 min, diluted with Et.sub.2O (50 mL) and sonicated
for an additional 20 min. The solid was filtered and dried under
reduced pressure overnight. Yield: 450 mg (96.8%) .sup.1H-NMR (300
MHz, DMSO-d.sub.6) .delta. 12.4 (br s, 1H), 8.82 (s, 1H), 8.52 (s,
1H), 7.91 (d, 1H, J=9.0 Hz), 7.67 (d, 1H, J=15.0 Hz), 6.67 (d, 1H,
J=15.0 Hz), 6.61 (m, 1H); ESI MS m/z 217
[C.sub.11H.sub.8N.sub.2O.sub.3+H].sup.+
(E)-N-methyl-N-((3-methylbenzofuran-2-yl)methyl)-3-(7-oxo-7,8-dihydro-1,8--
naphthyridin-3-yl)acrylamide
[1528] EDC (0.18 g, 0.95 mmol) was added to a suspension of
(E)-3-(7-oxo-7,8-dihydro-1,8-naphthyridin-3-yl)acrylic acid
hydrochloride (0.20 g, 0.79 mmol), HOBt (0.12 g, 0.87 mmol),
Methyl-(3-methyl-benzofuran-2-ylmethyl)-amine (0.15 g, 0.87 mmol)
and (i-Pr).sub.2EtN (0.8 mL, 4.74 mmol) in DMF (10 mL). The mixture
was heated at 40.degree. C. overnight then diluted with H.sub.2O
(30 mL) with rapid stirring. The resulting precipitate was
filtered, washed with H.sub.2O (20 mL) and dried under high vacuum
for 4 hours. The solid was suspended in 50% Et.sub.2O:hexanes (20
mL), sonicated then filtered and dried under vacuum overnight.
Yield: 0.13 g (44.1%) as a mixture of amide rotamers; .sup.1H NMR
(300 MHz, DMSO-d.sub.6) .delta. 12.33 (s, 1H), 8.90 and 8.87
(2.times.s, 1H), 8.53 (s, 1H), 7.91 (d, 1H, J=9 Hz), 7.65-7.25 (m,
6H), 6.63 (d, 1H, J=9.0 Hz), 5.04 and 4.83 (2.times.s, 2H), 3.23
and 2.96 (2.times.s, 3H), 2.29 (s, 3H); ESI MS m/z 374
[C.sub.22H.sub.19N.sub.3O.sub.3+H].sup.+
Example 358
Preparation of
(E)-3-(6,6-dimethyl-7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)-N-met-
hyl-N-((3-methylbenzofuran-2-yl)methyl)acrylamide
6-bromo-3,3-dimethyl-3,4-dihydro-1,8-naphthyridin-2(1H)-one
[1529] A mixture of activated Zn (1.0 g, 15 mmol) and ethyl
2-bromo-2-methylpropanoate (1.24 mL, 6.4 mmol) in THF (8 mL) were
added together at 0.degree. C. and stirred for 6 h while warming to
room temperature. To this mixture a dropwise solution of
5-bromo-3-(bromomethyl)pyridin-2-amine in THF (5 mL) was added via
canula and the reaction mixture was stirred for a further 19 h at
it. The mixture was diluted with ethyl acetate (25 mL) and washed
with saturated aqueous NH.sub.4Cl (50 mL) and brine (50 mL), dried
over magnesium sulphate, and concentrated in vacuo. The crude
yellow solid product was triturated with diethyl ether and filtered
to obtain the white solid product. Yield 158 mg (49%); .sup.1H NMR
(300 MHz, DMSO-d.sub.6) .delta. 10.61 (s, 1H), 8.23 (s, 1H), 7.87
(s, 1H), 2.81 (s, 2H), 1.04 (s, 6H); ESI MS m/z 255, 257
[C.sub.10H.sub.11N.sub.2OBr+H].sup.+
(E)-tert-butyl-3-(6,6-dimethyl-7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-
-yl)acrylate
[1530] A suspension of
6-bromo-3,3-dimethyl-3,4-dihydro-1,8-naphthyridin-2(1H)-one (434
mg, 1,7 mmol), tert-butyl acrylate (1.23 mL, 8.5 mmol) and
(i-Pr).sub.2EtN (0.9 mL, 5.1 mmol) in DMF (25 mL) was de-oxygenated
with Ar for 30 min. The mixture was treated with Pd(OAc).sub.2 (38
mg, 0.17 mmol) and P(o-tol).sub.3 (103 mg, 0.34 mmol) then heated
to 110.degree. C. for 22 h. The hot mixture was filtered through a
pad of celite and washed with ethyl acetate (50 mL). The filtrate
was diluted with H.sub.2O (100 mL) and extracted with ethyl acetate
(2.times.50 mL). The combined organic layers were washed with
water, then brine, dried over magnesium sulphate, and concentrated
in vacuo. The resulting brown solid was then triturated with a
diethyl ether followed by filtration to yield the white solid
product. Yield 178 mg (35%); .sup.1H NMR (300 MHz, DMSO-d.sub.6)
.delta. 10.68 (s, 1H), 8.39 (s, 1H), 8.04 (s, 1H), 7.52 (d, J=16.1
Hz, 1H), 6.52 (d, J=15.8 Hz, 1H), 2.80 (s, 2H), 1.49 (s, 9H), 1.09
(s, 6H); ESI MS m/z 303
[C.sub.17H.sub.22N.sub.2O.sub.3+H].sup.+
(E)-3-(6,6-dimethyl-7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylic
acid hydrochloride
[1531] A solution of (E)-tert-butyl
3-(6,6-dimethyl-7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acrylate
(165 mg, 0.55 mmol) in CH.sub.2Cl.sub.2 (10 mL) was treated with
TFA (10 mL). After stirring at room temperature for 2 h, the
solution was concentrated in vacuo. The resulting crude product was
treated with anhydrous HCl in dioxane (4 mL, 4.0 M) and sonicated
for 15 min. The off-white solid product was then isolated by
filtration and dried under vacuum. Yield: 152 mg (quant); .sup.1H
NMR (300 MHz, DMSO-d.sub.6) .delta. 10.71 (s, 1H), 8.38 (s, 1H),
8.04 (s, 1H), 7.56 (d, J=16.1 Hz, 1H), 6.54 (d, J=16.1 Hz, 1H),
2.81 (s, 2H), 1.09 (s, 6H); ESI MS m/z 247
[C.sub.13H.sub.14N.sub.3O.sub.4+H].sup.+
(E)-3-(6,6-dimethyl-7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)-N-meth-
yl-N-((3-methylbenzofuran-2-yl)methyl)acrylamide
[1532] EDC (102 mg, 0.53 mmol) was added to a suspension of
(E)-3-(6,6-dimethyl-7-oxo-5,6,7,8-tetrahydro-1,8-naphthyridin-3-yl)acryli-
c acid hydrochloride (125 mg, 0.44 mmol), HOBt (66 mg, 0.49 mmol),
N-methyl(3-methylbenzofuran-2-yl)methanamine (92 mg, 0.49 mmol) and
(i-Pr).sub.2EtN (0.37 mL, 2.2 mmol) in DMF (5 mL). The mixture was
allowed to stir for 23 h at 40.degree. C. The mixture was cooled to
room temperature and diluted with water (20 mL) at 0.degree. C. to
yield a brown precipitate, which was collected by suction
filtration. The solid was then triturated with diethyl ether to
obtain an off-white solid product. Yield: 137 mg (81%); .sup.1H NMR
(300 MHz, DMSO-d6) .delta. 10.64 (s, 1H), 8.40 (s, 1H), 8.09 (s,
1H), 7.59-7.19 (m, 6H), 4.91 (s, 2H), 3.09 (s, 3H), 2.81 (s, 2H),
2.28 (s, 3H), 1.09 (s, 6H); ESI MS m/z 404
[C.sub.24H.sub.25N.sub.3O.sub.3+H].sup.+.
Example 359
a) (S)-ethyl 2-(3-cyanopyridin-2-ylamino)propanoate
[1533] A solution of 2-chloro-3-cyanopyridine (2 g, 14.4 mmol),
L-alanine ethyl ester hydrochloride (3.3 g, 21.6 mmol), sodium
carbonate (5.9 g, 43 mmol) in pyridine (1.75 mL) and DMF (20 mL)
was heated to 125.degree. C. for 36 h. The reaction was quenched
with water and extracted with ethyl acetate (3.times.15 mL). The
product was purified using column chromatography (10% MeOH in
CH.sub.2Cl.sub.2) to yield a pale yellow solid (720 mg, 23%):
.sup.1H NMR (400 MHz, CDCl.sub.3) .delta. 8.26 (d, J=4.8 Hz, 1H),
7.69-7.67 (m, 1H), 6.67-6.64 (m, 1H), 4.77-4.74 (m, 1H), 4.23-4.19
(m, 2H), 1.54 (d, J=7.2 Hz, 3H), 1.30-1.26 (m, 3H).
b)
(S)-2-methyl-1,2,4,5-tetrahydropyrido[2,3-e][1,4]diazepin-3-one
[1534] To a solution of (S)-ethyl
2-(3-cyanopyridin-2-ylamino)propanoate (720 mg, 3.28 mmol) in
methanol (10 mL) and sodium methoxide (3.28 mmol) is added a pinch
of Raney nickel and the reaction was stirred under hydrogen for 6
h. Once the reaction was complete, 1 eq of HCl was added and the
solution filtered through celite, and washed with methanol. The
solution was concentrated and re-solvated in ethyl acetate (10 mL)
and washed with water (20 mL), the organic layers were combined,
dried over sodium sulfate and concentrated. The residue was
purified by preparative HPLC to yield a white solid (136 mg, 23%):
.sup.1H NMR (400 MHz, CD.sub.3OD) .delta. 7.87 (s, 1H), 7.32 (s,
1H), 6.60-6.57 (m, 1H), 4.99 (d, J=16.4 Hz, 1H), 4.12-4.10 (m, 1H),
3.87 (d, J=16.4 Hz, 1H), 1.38 (d, J=6.8 Hz, 3H).
c)
(S)-7-bromo-2-methyl-1,2,4,5-tetrahydropyrido[2,3-e][1,4]diazepin-3-one
[1535] Bromine (43 ul, 0.84 mmol) was added drop wise to a solution
of (S)-2-methyl-1,2,4,5-tetrahydropyrido[2,3-e][1,4]diazepin-3-one
(136 mg, 0.77 mmol) in acetic acid (10 mL). The reaction was
stirred at room temperature for 3 h. The reaction was quenched with
sat. NaHCO.sub.3 (10 mL) and extracted with ethyl acetate
(3.times.15 mL), dried over sodium sulfate and concentrated to give
the title compound (140 mg, 71%): .sup.1H NMR (400 MHz, CDCl.sub.3)
.delta. 7.93 (s, 1H), 7.31 (s, 1H), 7.20 (b, 1H), 5.95 (bs, 1H),
4.97-4.91 (m, 1H), 4.72-4.70 (m, 1H), 3.85-3.79 (m, 1H), 1.47 (d,
J=6.4 Hz, 3H).
(S,E)-N-methyl-3-(2-methyl-3-oxo-2,3,4,5-tetrahydro-1H-pyrido[2,3-e][1,4]d-
iazepin-7-yl)-N-((3-methylbenzofuran-2-yl)methyl)acrylamide
trifluoroacetic acid salt
[1536] To a solution of (S)-tert-butyl
7-bromo-3-methyl-2,3-dihydro-1H-pyrido[2,3-e][1,4]diazepine-4(5H)-carboxy-
late (70 mg, 0.27 mmol), tri(o-tolyl)phosphine (17 mg, 0.056 mmol),
diisopropylethylamine (105 uL, 0.56 mmol),
N-methyl-N-((3-methyl-3a,7a-dihydrobenzofuran-2-yl)methyl)acrylamide
(125 mg, 0.55 mmol) in DMF (5 mL) was added palladium acetate (7
mg, 0.027 mmol) and the reaction heated to 90.degree. C. overnight.
The reaction was cooled to room temperature and passed through a
pad of celite. The filter cake was washed with ethyl acetate (10
mL). The reaction was washed with water (10 mL) and extracted with
ethyl acetate (2.times.15 mL), dried over sodium sulfate and
concentrated. The residue was then re-dissolved in methylene
chloride (5 mL) and cooled to 0.degree. C. Trifluoroacetic acid (1
mL) was added and reaction stirred at room temperature for 1 h. The
solution was concentrated and purified using preparative HPLC to
yield a yellow solid (88 mg, 57%) as the TFA salt: .sup.1H NMR (400
MHz, DMSO-d6) .delta. 8.29-8.01 (m, 2H), 7.57 (s, 1H), 7.55-7.42
(m, 3H), 7.30-7.22 (m, 2H), 4.96-4.90 (m, 3H), 4.78 (s, 1H), 3.98
(m, 1H), 3.16 (s, 2H), 2.90 (s, 1H), 2.26 (s, 3H), 1.26 (d, J=6.4
Hz, 3H). MS (ESI) m/e 405
(C.sub.23H.sub.24H.sub.14O.sub.3+H).sup.+.
Example 360
Combination Studies of Compound G and Commercial Antibodies
[1537] Checkerboard experiments were performed and analyzed
according to standard procedures as outlined below.
[1538] As shown in FIG. 6, no antagonism was found with any of the
combinations tested. Gentamicin and linezolid showed a synergistic
effect with compound G against the S. aureus strains tested, and
all other antibiotics showed an additive effect.
[1539] No antagonism was found for any of the compound G
combinations shown in FIG. 7. In all cases where FabI does not
exist in the test species or the commercial antibiotic had no
activity (MIC>32 .mu.g/ml) against a drug resistant strain, no
change in MICs of the active component of the combination was
observed (FIC<2). In cases where both compounds were active
against the tested strain, the effect was highly additive (FIC
values of 0.6-1). These results indicate that for all major
pathogenic species tested compound G did not show antagonism
against antibiotics active against these strains, and commercial
antibiotics did not show any antagonism against compound G
activities.
[1540] Combination time-kill studies were performed as follows.
Bacterial inocula were prepared as for MIC determination according
to CLSI guidelines. Log phase cells (.about.10.sup.6 CFU/ml) were
inoculated into 24 well plates and incubated with the indicated
concentrations of compound G and commercial antibiotics for 24
hours at 35.degree. C. At indicated time points samples were
removed for determination of viable CFU counts. Results are plotted
as log CFU/ml vs. time.
[1541] S. pneumoniae 22425, a penicillin and macrolide resistant
clinical isolate, was tested with compound G and gatifloxacin (FIG.
8). Since S. pneumoniae does not posses the FabI target, compound G
showed no activity against S. pneumoniae at both 0.03 .mu.g/ml and
1 .mu.g/ml. Gatifloxacin alone showed expected bactericidal
activity of -3.5 log reduction in CFU at 24 hours. Addition of
compound G at the above 2 concentrations had no effect on either
the kill kinetics or kill extent of gatifloxacin, and the resulting
time-kill curves were superimposable with the control curves.
Similar results were obtained with compound G was tested in
combination with azithromycin and cefuroxime. These results show
that compound G has no effect on the bactericidal activity of
gatifloxacin, azithromycin or cefuroxime against S. pneumoniae.
REFERENCES
[1542] All publications and patents mentioned herein, including
those items listed below, are hereby incorporated by reference in
their entirety as if each individual publication or patent was
specifically and individually incorporated by reference. In case of
conflict, the present application, including any definitions
herein, will control.
[1543] Heath, et al. Nature 406: 145 (2000); Bergler, et al,
(1994), J. Biol. Chem. 269, 5493-5496; Heath, et al, (1996), J.
Biol. Chem. 271, 1833-1836; Grassberger, et al (1984) J. Med Chem
27 947-953; Turnowsky, et al, (1989), J. Bacteriol., 171,
6555-6565; McMurry, et al, (1998) Nature 394, 531-532; Levy, et al,
(1999) Nature 398, 383-384; Ward, et al ((1999) Biochem. 38,
12514-12525; Heck, Org. Reactions 1982, 27, 345; J. Het. Chem.
1978, 15, 249-251; U.S. patent application Ser. Nos. 08/790,043;
10/009,219, 10/089,019; 09/968,129; 09/968,123; 09/968,236;
09/959,172; 09/979,560; 09/980,369; 10/089,755; 10/089,739;
10/089,740; PCT Application Nos. WO 0027628; WO 0210332; U.S. Pat.
Nos. 6,531,126; 6,527,759; 6,518,270; 6,518,239; 6,517,827;
6,461,829; 6,448,054; 6,423,341; 6,495,551; 6,486,149; 6,441,162;
6,436,980; 6,399,629; 6,518,263; 6,503,881; 6,503,881; 6,486,148;
6,465,429; 6,388,070; 6,531,649; 6,531,465; 6,528,089; 6,521,408;
6,518,487; 6,531,508; 6,514,962; 6,503,953; 6,492,351; 6,486,148;
6,461,607; 6,448,054; 6,495,161; 6,495,158; 6,492,351; 6,486,165;
6,531,465; 6,514,535; 6,489,318; 6,497,886; 6,503,953; 6,503,539,
6,500,459; 6,492,351; 6,500,463; 6,461,829; 6,448,238; 6,432,444;
6,333,045; 6,291,462; 6,221,859; 6,514,986; 6,340,689; 6,309,663;
6,303,572; 6,277,836; 6,367,985; 6,468,964; 6,461,607; 6,448,449;
6,436,980; 6,423,741; 6,406,880; 6,395,746; 6,346,391; 6,294,192;
6,267,985; 6,235,908; 6,515,113; 6,509,327; 6,503,955; 6,525,066;
6,531,291; 6,517,827; 6,514,953; 6,514,541; 6,428,579; 6,451,339;
6,461,607; 6,461,829; 6,503,906; 6,518,239; 6,133,260; 6,174,878;
6,184,380; 6,187,341; 6,194,429; 6,194,441; 6,198,000; 6,221,859;
6,221,864; 6,239,113; 6,239,141; 6,248,363; and U.S. Provisional
Patent Application Nos.: 60/455,189; 60/476,970, and
60/488,379.
EQUIVALENTS
[1544] While specific embodiments of the subject invention have
been discussed, the above specification is illustrative and not
restrictive. Many variations of the invention will become apparent
to those skilled in the art upon review of this specification. The
full scope of the invention should be determined by reference to
the claims, along with their full scope of equivalents, and the
specification, along with such variations.
[1545] Unless otherwise indicated, all numbers expressing
quantities of ingredients, reaction conditions, and so forth used
in the specification and claims are to be understood as being
modified in all instances by the term "about." Accordingly, unless
indicated to the contrary, the numerical parameters set forth in
this specification and attached claims are approximations that may
vary depending upon the desired properties sought to be obtained by
the present invention.
Sequence CWU 1
1
7139DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 1cgcctcgaga tgttaaatct tgaaaacaaa acatatgtc
39233DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 2cgcggatcca atcaagtcag gttgaaatat cca
33328DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 3catgggctta aatcttgaaa acaaaaca
28426DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 4tatgttttgt tttcaagatt taagcc
26536DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 5gcggtaccca tgcgcttggt tttcttagaa atattg
36635DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 6gcggccgctt attcttcgcc taattcgccc attgc
35710PRTArtificial SequenceDescription of Artificial Sequence
Synthetic His 10 tag 7His His His His His His His His His His1 5
10
* * * * *