U.S. patent application number 13/071677 was filed with the patent office on 2012-01-05 for plastidic phosphoglucomutase genes.
This patent application is currently assigned to E. I. DU PONT DE NEMOURS AND COMPANY. Invention is credited to Stephen M. Allen, Karlene H. Butler, Thomas J. Carlson, William D. Hitz, Johan M. Stoop.
Application Number | 20120005779 13/071677 |
Document ID | / |
Family ID | 22816186 |
Filed Date | 2012-01-05 |
United States Patent
Application |
20120005779 |
Kind Code |
A1 |
Allen; Stephen M. ; et
al. |
January 5, 2012 |
PLASTIDIC PHOSPHOGLUCOMUTASE GENES
Abstract
An isolated nucleic acid fragment encoding a plastidic
phosphoglucomutase protein is disclosed. Also disclosed is the
construction of a chimeric gene encoding all or a substantial
portion of the plastidic phosphoglucomutase, in sense or antisense
orientation, wherein expression of the chimeric gene results in
production of altered levels of the plastidic phosphoglucomutase in
a transformed host cell.
Inventors: |
Allen; Stephen M.;
(Wilmington, DE) ; Butler; Karlene H.; (Newark,
DE) ; Carlson; Thomas J.; (San Diego, CA) ;
Hitz; William D.; (Wilmington, DE) ; Stoop; Johan
M.; (Kennett Square, PA) |
Assignee: |
E. I. DU PONT DE NEMOURS AND
COMPANY
Wilmington
DE
|
Family ID: |
22816186 |
Appl. No.: |
13/071677 |
Filed: |
March 25, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11928914 |
Oct 30, 2007 |
7915486 |
|
|
13071677 |
|
|
|
|
11094586 |
Mar 30, 2005 |
7323560 |
|
|
11928914 |
|
|
|
|
09906209 |
Jul 16, 2001 |
7250557 |
|
|
11094586 |
|
|
|
|
60218712 |
Jul 17, 2000 |
|
|
|
Current U.S.
Class: |
800/281 ;
426/431; 435/233; 435/252.3; 435/254.2; 435/320.1; 435/419;
435/440; 435/6.13; 435/6.18; 536/23.2; 800/278; 800/298;
800/312 |
Current CPC
Class: |
C12N 15/8245 20130101;
C12N 9/90 20130101; C12N 15/8251 20130101; C12N 15/8247 20130101;
C12N 15/8216 20130101 |
Class at
Publication: |
800/281 ;
536/23.2; 435/320.1; 435/440; 800/298; 800/312; 435/233; 435/6.13;
800/278; 435/419; 435/252.3; 435/254.2; 435/6.18; 426/431 |
International
Class: |
C12N 15/82 20060101
C12N015/82; C12N 15/63 20060101 C12N015/63; A01H 5/10 20060101
A01H005/10; A01H 5/00 20060101 A01H005/00; A23L 1/20 20060101
A23L001/20; C12Q 1/68 20060101 C12Q001/68; C12N 5/10 20060101
C12N005/10; C12N 1/21 20060101 C12N001/21; C12N 1/19 20060101
C12N001/19; C07H 21/04 20060101 C07H021/04; C12N 9/90 20060101
C12N009/90 |
Claims
1. An isolated polynucleotide comprising: (a) a first nucleotide
sequence encoding a first polypeptide having phosphoglucomutase
activity, wherein the amino acid sequence of the first polypeptide
and the amino acid sequence of SEQ ID NO:8 have at least 95%
identity based on the Clustal alignment method, (b) a second
nucleotide sequence encoding a second polypeptide having
phosphoglucomutase activity, wherein the amino acid sequence of the
second polypeptide and the amino acid sequence of SEQ ID NO:2 or
SEQ ID NO:4 have at least 85% identity based on the Clustal
alignment method, or (c) the complement of the first or second
nucleotide sequence.
2. The isolated polynucleotide of claim 1 wherein the amino acid
sequence of the second polypeptide and the amino acid sequence of
SEQ ID NO:2 or SEQ ID NO:4 have at least 90% identity based on the
Clustal alignment method.
3. The isolated polynucleotide of claim 1, wherein the amino acid
sequence of the second polypeptide and the amino acid sequence of
SEQ ID NO:2 or SEQ ID NO:4 have at least 95% identity based on the
Clustal alignment method.
4. The isolated polynucleotide of claim 1, wherein the first
polypeptide comprises the amino acid sequence of SEQ ID NO:8,
wherein the second polypeptide comprises the amino acid sequence of
SEQ ID NO:2 or SEQ ID NO:4.
5. The isolated polynucleotide of claim 1, wherein the first
nucleotide sequence comprises the nucleotide sequence of SEQ ID
NO:7, wherein the second nucleotide sequence comprises the
nucleotide sequence of SEQ ID NO:1 or SEQ ID NO:3.
6. A recombinant DNA construct comprising the polynucleotide of
claim 1 operably linked to a regulatory sequence.
7. A method for transforming a cell comprising transforming a cell
with the polynucleotide of claim 1.
8. A cell comprising the recombinant DNA construct of claim 6.
9. A method for producing a transgenic plant comprising
transforming a plant cell with the polynucleotide of claim 1 and
regenerating a plant from the transformed plant cell.
10. A plant comprising the recombinant DNA construct of claim
6.
11. A seed comprising the recombinant DNA construct of claim 6.
12. An isolated polypeptide having phosphoglucomutase activity,
wherein the polypeptide comprises: (a) a first amino acid sequence,
wherein the first amino acid sequence and the amino acid sequence
of SEQ ID NO:8 have at least 95% identity based on the Clustal
alignment method, or (b) a second amino acid sequence, wherein the
second amino acid sequence and the amino acid sequence of SEQ ID
NO:2 or SEQ ID NO:4 have at least 85% identity based on the Clustal
alignment method.
13. The polypeptide of claim 12, wherein the second amino acid
sequence and the amino acid sequence of SEQ ID NO:2 or SEQ ID NO:4
have at least 90% identity based on the Clustal alignment
method.
14. The polypeptide of claim 12, wherein the second amino acid
sequence and the amino acid sequence of SEQ ID NO:2 or SEQ ID NO:4
have at least 95% identity based on the Clustal alignment
method.
15. The polypeptide of claim 12, wherein the first amino acid
sequence comprises the amino acid sequence of SEQ ID NO:8, and
wherein the second amino acid sequence comprises the amino acid
sequence of SEQ ID NO:2 or SEQ ID NO:4.
16. A method of selecting an isolated polynucleotide that decreases
the level of expression of a plastidic polypeptide having
phosphoglucomutase activity in a plant cell, the method comprising
the steps of: (a) constructing the isolated polynucleotide
comprising a nucleotide sequence of at least 30 contiguous
nucleotides derived from the isolated polynucleotide of claim 1;
(b) introducing the isolated polynucleotide into the plant cell;
(c) measuring the level of the polypeptide in the plant cell
containing the polynucleotide; and (d) comparing the level of the
polypeptide in the plant cell containing the isolated
polynucleotide with the level of the polypeptide in a plant cell
that does not contain the isolated polynucleotide; and selecting
the isolated polynucleotide that decreases the level of expression
of the plastidic polypeptide having phosphoglucomutase activity in
the plant cell.
17. The method of claim 16 wherein the isolated polynucleotide
comprises a nucleotide sequence selected from the group consisting
of SEQ ID NOs:1, 3 and 7.
18. The method of claim 16 wherein the isolated polynucleotide
comprising a nucleotide sequence of at least 30 contiguous
nucleotides contains at least 541 nucleotides.
19. The method of claim 16 wherein the isolated polynucleotide
comprises the nucleotide sequence of SEQ ID NO:15.
20. A method of selecting an isolated polynucleotide that increases
the level of expression of a plastidic polypeptide having
phosphoglucomutase activity in a plant cell, the method comprising
the steps of: (a) constructing the isolated polynucleotide of claim
1; (b) introducing the isolated polynucleotide into the plant cell;
(c) measuring the level of the polypeptide in the plant cell
containing the polynucleotide; (d) comparing the level of the
polypeptide in the plant cell containing the isolated
polynucleotide with the level of the polypeptide in a plant cell
that does not contain the polynucleotide; and selecting the
isolated polynucleotide that increases the level of expression of
the plastidic polypeptide having phosphoglucomutase activity in the
plant cell.
21. A method for positive selection of a transformed cell
comprising: (a) transforming a host cell with the recombinant DNA
construct of claim 6; and (b) growing the transformed host cell
under conditions which allow expression of a polynucleotide in an
amount sufficient to complement a null mutant to provide a positive
selection means.
22. The method of claim 21 wherein the host cell is a plant.
23. The method of claim 21 wherein the plant cell is a monocot.
24. The method of claim 21 wherein the plant cell is a dicot.
25. A method of increasing the level of expression of a plastidic
polypeptide having phosphoglucomutase activity in a host cell
comprising: (a) transforming a host cell with the recombinant DNA
construct of claim 6; and (b) growing the transformed host cell
from step (a) under conditions that are suitable for expression of
the recombinant DNA construct; and (c) selecting a transformed cell
wherein expression of the recombinant DNA construct results in
production of higher levels of a plastidic polypeptide having
phosphoglucomutase activity in the transformed host cell.
26. A method for suppressing the level of expression of a gene
encoding a plastidic polypeptide having phosphoglucomutase activity
in a transgenic plant, wherein the method comprises: (a)
transforming a plant cell with a fragment of the isolated
polynucleotide of claim 1; (b) regenerating a transgenic plant from
the transformed plant cell of (a); and (c) selecting a transgenic
plant wherein the level of expression of a gene encoding a
plastidic polypeptide having phosphoglucomutase activity has been
suppressed.
27. A recombinant DNA construct comprising: (a) all or part of the
nucleotide sequence set forth in SEQ ID NO:7 or SEQ ID NO:15; (b)
the complement of (a); wherein (a) or (b) is useful in
co-suppression or antisense suppression of endogenous
phosphoglucomutase activity in a transgenic plant.
28. A method for producing transgenic seed, the method comprising:
(a) transforming a plant cell with the recombinant DNA construct of
claim 27; (b) regenerating a transgenic plant from the transformed
plant cell of (a); and (c) selecting a transgenic plant that
produces a transgenic seed having an increase in the combined oil
and protein content of at least 1.6% and a decrease in the sucrose
content of at least 25% as compared to seed obtained from a
non-transgenic plant.
29. The method of claim 28 wherein the increase in the combined oil
and protein content is at least 1.8%.
30. The method of claim 28 wherein the increase in the combined oil
and protein content is at least 2.0%.
31. A method for producing transgenic seed, the method comprising:
(a) transforming a plant cell with the recombinant DNA construct of
claim 27; (b) regenerating a transgenic plant from the transformed
plant cell of (a); and (c) selecting a transgenic plant that
produces a transgenic seed having a sucrose to raffinose family
oligosaccharide ratio of 1.0 or less as compared to seed obtained
from a non-transgenic plant.
32. The method of claim 31 wherein the transgenic seed differs from
a non-transgenic seed by having an increase in the combined oil and
protein content of at least 1.6%.
33. The method of claim 31 wherein the transgenic seed differs from
a non-transgenic seed by having an increase in the combined oil and
protein content of at least 1.8%.
34. The method of claim 31 wherein the transgenic seed differs from
a non-transgenic seed by having an increase in the combined oil and
protein content of at least 2.0%.
35. A method for producing defatted meal from transgenic seed, the
method comprising: (a) transforming a plant cell with the
recombinant DNA construct of claim 27; (b) regenerating a
transgenic plant from the transformed plant cell of (a); and (c)
selecting a transgenic plant that produces a transgenic seed
wherein said seed is processed into defatted meal having an
increase in the combined oil and protein content of at least 5% and
a decrease in the sucrose content of at least 25% as compared to
defatted meal obtained from seed of a non-transgenic plant.
36. The method of claim 35 wherein the defatted meal of the
transgenic seed has a sucrose to raffinose family oligosaccharide
ratio of 1.0 or less as compared to the sucrose to raffinose family
oligosaccharide ratio of defatted meal obtained from a
non-transgenic seed.
37. The method of any one of claims 28-36 wherein the transgenic
seed is obtained from a transgenic dicot plant comprising in its
genome the recombinant construct.
38. The method of claim 37 wherein the dicot plant is selected from
the group consisting of Arabidopsis, soybean, oilseed Brassica,
peanut, sunflower, safflower, cotton, tobacco, tomato, potato, and
cocoa.
39. The method of claim 37 wherein the dicot plant is soybean.
40. A transgenic seed comprising the recombinant DNA construct of
claim 27 in its genome wherein said transgenic seed has an increase
in the combined oil and protein content of at least 1.6% and a
decrease in the sucrose content of at least 25% when compared to a
non-transgenic seed.
41. The transgenic seed of claim 40 wherein the increase in the
combined oil and protein content is at least 1.8%.
42. The transgenic seed of claim 40 wherein the increase in the
combined oil and protein content is at least 2.0%.
43. A transgenic seed comprising the recombinant DNA construct of
claim 27 in its genome wherein said transgenic seed has a sucrose
to raffinose family oligosaccharide ratio of 1.0 or less when
compared to a non-transgenic seed.
44. The transgenic seed of claim 43 wherein the transgenic seed has
an increase in the combined oil and protein content of at least
1.6% when compared to a non-transgenic seed.
45. The transgenic seed of claim 43 wherein the transgenic seed has
an increase in the combined oil and protein content of at least
1.8% when compared to a non-transgenic seed.
46. The transgenic seed of claim 43 wherein the transgenic seed has
an increase in the combined oil and protein content of at least
2.0% when compared to a non-transgenic seed.
47. Transgenic seed comprising the recombinant construct of claim
27 in its genome wherein said transgenic seed is processed to make
defatted meal having an increase in the combined oil and protein
content of at least 5% and a decrease in the sucrose content of at
least 25% when compared to defatted meal obtained from a
non-transgenic seed.
48. The transgenic seed of claim 47 wherein the defatted meal of
the transgenic seed differs from the defatted meal of a
non-transgenic seed by having a sucrose to raffinose family
oligosaccharide ratio of 1.0 or less.
49. The transgenic seed of any one of claims 40-48 wherein the seed
is a soybean seed.
Description
[0001] This application is a Continuation-in-Part and claims the
benefit of U.S. patent application Ser. No. 09/906,209, filed Jul.
16, 2001, now pending, and U.S. Provisional Application No.
60/218,712, filed Jul. 17, 2000, now expired, the entire contents
of both are herein incorporated by reference.
FIELD OF THE INVENTION
[0002] This invention is in the field of plant molecular biology.
More specifically, this invention pertains to isolated nucleic acid
fragments encoding plastidic phosphoglucomutase proteins in plants
and seeds and the use of such fragments to modulate expression of a
gene encoding plastidic phosphoglucomutase activity.
BACKGROUND OF THE INVENTION
[0003] Starch synthesis occurs in the chloroplast while soluble
carbohydrate (i.e., sucrose) synthesis occurs in the cytosol. These
biosynthetic pathways are competing processes because excess triose
phosphate can be used for either starch synthesis in the
chloroplast or sucrose synthesis in the cytosol. These pathways
have many common steps, however, the enzymes that catalyze similar
steps are unique to each compartment. These enzymes are isozymes;
different forms of the enzymes that catalyze the same reaction. For
example, the plastidic and cytosolic forms of phosphoglucomutase
both catalyze the conversion of glucose-6-phosphate to glucose
1-phosphate in different subcellular locations.
[0004] At maturity, about 40% of soybean seed dry weight is protein
and 20% extractable oil. These constitute the economically valuable
products of the soybean crop. Of the remaining 40% of seed weight,
about 10% is soluble carbohydrate. The soluble carbohydrate portion
contributes little to the economic value of soybean seeds and the
main component of the soluble carbohydrate fraction,
raffinosaccharides, are deleterious both to processing and to the
food value of soybean meal in monogastric animals (Coon et al.,
(1988) Proceedings Soybean Utilization Alternatives, Univ. of
Minnesota, pp. 203-211).
[0005] It may be possible to modulate the size of the starch and
soluble carbohydrate pools in plant cells by altering the catalytic
activity of specific enzymes in the starch and soluble carbohydrate
biosynthetic pathways, such as phosphoglucomutase or one or both of
the large and small subunits of ADP-glucose pyrophosphorylase (Taiz
L., et al. Plant Physiology; The Benjamin/Cummings Publishing
Company: New York, 1991). For example, during soybean seed
maturation a large portion of the glucose which is converted to
soluble carbohydrates (sucrose, raffinose and stachyose) during
soybean seed maturation comes from the break down of a starch pool
which was produced slowly during the primary growth phase.
Elimination of this transient starch pool may be a strategy for
diverting carbon away from the soluble carbohydrate components of
dry soybean seeds (sucrose, raffinose and stachyose) and into the
more economically desirable components such as oil and protein.
This strategy may also be applicable to other plants such as corn,
rice and wheat. Elimination of ADP-glucose pyrophosphorylase
expression in developing maize embryos may decrease the production
of transient starch in that tissue and lead to a concomitant
increase in the oil content of the embryo [Singletary, G et al.
(2001) U.S. Pat. No. 6,232,529].
[0006] There is a great deal of interest in identifying the genes
that encode proteins involved in starch and soluble carbohydrate
biosynthesis in plants. The genes that code for these enzymes may
be used to study the interactions among individuals of the pathways
and develop methods to alter starch and soluble carbohydrate
biosynthesis. Accordingly, the availability of nucleic acid
sequences encoding all or a substantial portion of a plastidic or
cytosolic phosphoglucomutase (PGM) enzyme would facilitate studies
to better understand starch and soluble carbohydrate biosynthesis
in plants and provide genetic tools to enhance or otherwise alter
starch and soluble carbohydrate biosynthesis.
[0007] Previous reports on a plastidic PGM mutant (pgm-1) from the
oilseed plant Arabidopsis (Caspar et al. (1985) Plant Physiol.
79:11-17; Periappuram et al., (2000) Plant Physiol. 122:1193-1199)
indicated that pgm-1 mutant plants showed a decrease in seed lipid
content and an increase in leaf soluble carbohydrates. High levels
of soluble carbohydrates were also observed in starchless Nicotiana
sylvestris plants deficient in the plastidic PGM activity (Huber
and Hanson, (1992) Plant Physiol. 99:1449-1454). Yet another effect
of reduced starch content on carbon partitioning was observed in
pea (Pisum sativum). Seeds from wild type pea typically contain 60%
of the seed dry weight as starch. The rug3 locus of Pisum sativum
encodes the pea plastidic phosphoglucomutase. Pea seeds, of the
rug3rug3 genotype, substantially lacking plastidic
phosphoglucomutase activity, have a wrinkled phenotype, higher
levels of sucrose and an increased lipid content at maturity (EP
1001029A1; Casey et al., (1998) J. Plant Physiol. 152:
636-640).
SUMMARY OF THE INVENTION
[0008] In a first embodiment, the present invention concerns an
isolated polynucleotide comprising: (a) a first nucleotide sequence
encoding a first polypeptide comprising at least 560 amino acids,
wherein the amino acid sequence of the first polypeptide and the
amino acid sequence of SEQ ID NO:8 have at least 95%, 96%, 97%,
98%, 99% or 100% sequence identity, based on the Clustal V method
of alignment, (b) a second nucleotide sequence encoding a second
polypeptide comprising at least 560 amino acids, wherein the amino
acid sequence of the second polypeptide and the amino acid sequence
of SEQ ID NO:2, SEQ ID NO:4, or SEQ ID NO:10 have at least 85%,
90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, based on
the Clustal V method of alignment, or (c) the complement of the
first or second nucleotide sequence, wherein the complement and the
first or second nucleotide sequence contain the same number of
nucleotides and are 100% complementary. The first polypeptide
preferably comprises the amino acid sequence of SEQ ID NO:8, and
the second polypeptide preferably comprises the amino acid sequence
of SEQ ID NO:2, SEQ ID NO:4, or SEQ ID NO:10. The first nucleotide
sequence preferably comprises the nucleotide sequence of SEQ ID
NO:7, the second nucleotide sequence preferably comprises the
nucleotide sequence of SEQ ID NO:1, SEQ ID NO:3, or SEQ ID NO:9.
The first and second polypeptides preferably have
phosphoglucomutase activity.
[0009] In a second embodiment, the present invention relates to a
recombinant DNA construct comprising any of the isolated
polynucleotides of the present invention operably linked to at
least one regulatory sequence.
[0010] In a third embodiment, the present invention relates to a
vector comprising any of the isolated polynucleotides of the
present invention.
[0011] In a fourth embodiment, the present invention relates to an
isolated polynucleotide fragment comprising a nucleotide sequence
comprised by any of the polynucleotides of the present invention,
wherein the nucleotide sequence contains at least 30, 40, 60, 100,
200, 300, 400, 500 or 541 nucleotides.
[0012] In a fifth embodiment, the present invention relates to a
method for transforming a cell comprising transforming a cell with
any of the isolated polynucleotides of the present invention, and
the cell transformed by this method. Advantageously, the cell is
eukaryotic, e.g., a yeast or plant cell, or prokaryotic, e.g., a
bacterium.
[0013] In a sixth embodiment, the invention concerns a method for
transforming a cell, comprising transforming a cell with a
polynucleotide of the present invention.
[0014] In a seventh embodiment, the present invention relates to a
method for producing a transgenic plant comprising transforming a
plant cell with any of the isolated polynucleotides of the present
invention and regenerating a transgenic plant from the transformed
plant cell.
[0015] In an eighth embodiment, the invention concerns a cell,
plant, or seed comprising a recombinant DNA construct of the
present invention.
[0016] In a ninth embodiment, the present invention concerns an
isolated polypeptide comprising: (a) a first amino acid sequence
comprising at least 560 amino acids, wherein the first amino acid
sequence and the amino acid sequence of SEQ ID NO:8 have at least
95%, 96%, 97%, 98%, 99% or 100% sequence identity, based on the
Clustal V method of alignment, and (b) a second amino acid sequence
comprising at least 560 amino acids, wherein the second amino acid
sequence and the amino acid sequence of SEQ ID NO:2, SEQ ID NO:4,
or SEQ ID NO:10 have at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or
100% sequence identity, based on the Clustal V method of alignment.
The first amino acid sequence preferably comprises the amino acid
sequence of SEQ ID NO:8, and the second amino acid sequence
preferably comprises the amino acid sequence SEQ ID NO:2, SEQ ID
NO:4, or SEQ ID NO:10. The polypeptide preferably has
phosphoglucomutase activity.
[0017] In a tenth embodiment, the present invention relates to a
virus, preferably a baculovirus, comprising any of the isolated
polynucleotides of the present invention or any of the recombinant
DNA constructs of the present invention.
[0018] In an eleventh embodiment, the invention relates to a method
of selecting an isolated polynucleotide that alters, i.e.,
increases or decreases, the level of expression of a
phosphoglucomutase gene, protein or enzyme activity in a host cell,
preferably a plant cell, the method comprising the steps of: (a)
constructing an isolated polynucleotide of the present invention or
an isolated recombinant DNA construct of the present invention; (b)
introducing the isolated polynucleotide or the isolated recombinant
DNA construct into a host cell; (c) measuring the level of the
phosphoglucomutase RNA, protein or enzyme activity in the host cell
containing the isolated polynucleotide or recombinant DNA
construct; (d) comparing the level of the phosphoglucomutase RNA,
protein or enzyme activity in the host cell containing the isolated
polynucleotide or recombinant DNA construct with the level of the
phosphoglucomutase RNA, protein or enzyme activity in a host cell
that does not contain the isolated polynucleotide or recombinant
DNA construct, and selecting the isolated polynucleotide or
recombinant DNA construct that alters, i.e., increases or
decreases, the level of expression of the phosphoglucomutase gene,
protein or enzyme activity in the plant cell.
[0019] In a twelfth embodiment, the invention concerns a method of
obtaining a nucleic acid fragment encoding a substantial portion of
a phosphoglucomutase protein, preferably a plant phosphoglucomutase
protein, comprising the steps of: synthesizing an oligonucleotide
primer comprising a nucleotide sequence of at least 30 contiguous
nucleotides, preferably at least 40 contiguous nucleotides, more
preferably at least 60 contiguous nucleotides derived from a
nucleotide sequence selected from the group consisting of SEQ ID
NOs:1, 3, 5, 7, and 9, and the complement of such nucleotide
sequences; and amplifying a nucleic acid fragment (preferably a
cDNA inserted in a cloning vector) using the oligonucleotide
primer. The amplified nucleic acid fragment preferably will encode
a substantial portion of a phosphoglucomutase protein amino acid
sequence.
[0020] In a thirteenth embodiment, the invention relates to a
method of obtaining a nucleic acid fragment encoding all or a
substantial portion of the amino acid sequence encoding a
phosphoglucomutase protein comprising the steps of: probing a cDNA
or genomic library with an isolated polynucleotide of the present
invention; identifying a DNA clone that hybridizes with an isolated
polynucleotide of the present invention; isolating the identified
DNA clone; and sequencing the cDNA or genomic fragment that
comprises the isolated DNA clone.
[0021] In a fourteenth embodiment, the invention concerns a method
for positive selection of a transformed cell comprising: (a)
transforming a host cell with the recombinant DNA construct of the
present invention or an expression cassette of the present
invention; and (b) growing the transformed host cell, preferably a
plant cell, such as a monocot or a dicot, under conditions which
allow expression of the phosphoglucomutase polynucleotide in an
amount sufficient to complement a null mutant to provide a positive
selection means.
[0022] In a fifteenth embodiment, this invention concerns a method
for suppressing the level of expression of a gene encoding a
plastidic polypeptide having phosphoglucomutase activity in a
transgenic plant, wherein the method comprises: [0023] (a)
transforming a plant cell with a fragment of the isolated
polynucleotide of the invention; [0024] (b) regenerating a
transgenic plant from the transformed plant cell of (a); and [0025]
(c) selecting a transgenic plant wherein the level of expression of
a gene encoding a plastidic polypeptide having phosphoglucomutase
activity has been suppressed.
[0026] Preferably, the gene encodes a plastidic polypeptide having
phosphoglucomutase activity, and the plant is a soybean plant.
[0027] In a sixteenth embodiment, the invention concerns a method
for producing transgenic seed, the method comprising: [0028] (a)
transforming a plant cell with the recombinant DNA construct of
[0029] (i) all or part of the nucleotide sequence set forth in SEQ
ID NO:7 or SEQ ID NO:15; or [0030] (ii) the complement of (i);
[0031] wherein (i) or (ii) is useful in co-suppression or antisense
suppression of endogenous phosphoglucomutase activity in a
transgenic plant; [0032] (b) regenerating a transgenic plant from
the transformed plant cell of (a); and [0033] (c) selecting a
transgenic plant that produces a transgenic seed having an increase
in the combined oil and protein content of at least 1.6% and a
decrease in the sucrose content of at least 25% as compared to seed
obtained from a non-transgenic plant.
[0034] Preferably, the seed is a soybean seed.
In a seventeenth embodiment, the invention concerns a method for
producing transgenic seed, the method comprising: [0035] (a)
transforming a plant cell with a recombinant DNA construct
comprising [0036] (i) all or part of the nucleotide sequence set
forth in SEQ ID NO:7 or SEQ ID NO:15; or [0037] (ii) the complement
of (i); [0038] wherein (i) or (ii) is useful in co-suppression or
antisense suppression of endogenous phosphoglucomutase activity in
a transgenic plant; [0039] (b) regenerating a transgenic plant from
the transformed plant cell of (a); and [0040] (c) selecting a
transgenic plant that produces a transgenic seed having a sucrose
to raffinose family oligosaccharide ratio of 1.0 or less as
compared to seed obtained from a non-transgenic plant.
[0041] Preferably, the transgenic seed differs from an
untransformed seed by having an increase in the combined oil and
protein content of at least 1.6%, 1.8% or 2.0%. Preferably, the
seed is a soybean seed.
In an eighteenth embodiment, the invention concerns a method for
producing defatted meal from transgenic seed, comprising: [0042]
(a) transforming a plant cell with a recombinant DNA construct
comprising [0043] (i) all or part of the nucleotide sequence set
forth in SEQ ID NO:7 or SEQ ID NO:15; or [0044] (ii) the complement
of (i); [0045] wherein (i) or (ii) is useful in co-suppression or
antisense suppression of endogenous phosphoglucomutase activity in
a transgenic plant; [0046] (b) regenerating a transgenic plant from
the transformed plant cell of (a); and [0047] (c) selecting a
transgenic plant that produces a transgenic seed wherein said seed
is processed into defatted meal having an increase in the combined
oil and protein content of at least 5% and a decrease in the
sucrose content of at least 25% as compared to defatted meal
obtained from seed of a non-transgenic plant.
[0048] Preferably, the defatted meal of the transgenic seed differs
from the defatted meal of an untransformed seed by having a sucrose
to raffinose family oligosaccharide ratio of 1.0 or less.
Preferably, the seed is a soybean seed.
[0049] In a nineteenth embodiment, the invention concerns a
transgenic seed that differs from an non-transgenic seed by having
an increase in the combined oil and protein content of at least
1.6%, 1.8% or 2.0%, and a decrease in the sucrose content of at
least 25%. Preferably, the seed is a soybean seed.
[0050] In a twentieth embodiment, the invention concerns a
transgenic seed that differs from non-transgenic seed by having a
sucrose to raffinose family oligosaccharide ratio of 1.0 or less.
Preferably, the transgenic seed differs from an untransformed seed
by having an increase in the combined oil and protein content of at
least 1.6%, 1.8% or 2.0%. Preferably, the seed is a soybean
seed.
[0051] In a twenty-first embodiment, the invention concerns a
transgenic seed comprising a recombinant construct comprising (i)
all or part of the nucleotide sequence set forth in SEQ ID NO:7 or
SEQ ID NO:15; or
[0052] (ii) the complement of (i);
[0053] wherein (i) or (ii) is useful in co-suppression or antisense
suppression of endogenous phosphoglucomutase activity in a
transgenic plant;
further wherein said transgenic seed is processed to make defatted
meal having an increase in the combined oil and protein content of
at least 5% and a decrease in the sucrose content of at least 25%
when compared to defatted meal obtained from a non-transgenic
seed.
[0054] Preferably, the defatted meal of the transgenic seed differs
from the defatted meal of an untransformed seed by having a sucrose
to raffinose family oligosaccharide ratio of 1.0 or less.
Preferably, the seed is a soybean seed.
[0055] In a twenty-second embodiment, the invention concerns a
recombinant DNA construct comprising: (a) all or part of the
nucleotide sequence set forth in SEQ ID NO:7 or SEQ ID NO:15; or
(b) the complement of (a); wherein (a) or (b) is useful in
co-suppression or antisense suppression of endogenous
phosphoglucomutase activity in a transgenic plant.
BRIEF DESCRIPTION OF THE FIGURES AND SEQUENCE LISTING
[0056] The invention can be more fully understood from the
following detailed description and the accompanying Drawing and
Sequence Listing which form a part of this application.
[0057] FIGS. 1A-1D show an alignment of the amino acid sequences of
plastidic phosphoglucomutase encoded by the nucleotide sequences
derived from the following: cattail clone etr1c.pk005.f8 (SEQ ID
NO:2); corn contig (SEQ ID NO:4) composed of p0075.cslaf22f (EST),
p0075.cslaf22rb (EST), and p0128.cpicz81r (EST); soybean contig
(SEQ ID NO:8) composed of clone sdp3c.pk003.e22 and PCR fragments;
rice clone rdi1c.pk001.a22 (SEQ ID NO:10); plastidic
phosphoglucomutase from Brassica napus (NCBI General Identifier No.
6272125; SEQ ID NO:11); plastidic phosphoglucomutase from Pisum
sativum (NCBI General Identifier No. 6272283; SEQ ID NO:12); and
plastidic phosphoglucomutase from Pisum sativum described in
European Patent Application EP 1001029-A (NCBI General Identifier
No. 10190529; SEQ ID NO:13). For the consensus alignment, amino
acids which are conserved among all sequences at a given position,
and which are contained in at least two sequences, are indicated
with an asterisk (*). Dashes are used by the program to maximize
alignment of the sequences. Amino acid positions for a given SEQ ID
NO are given to the left of the corresponding line of sequence.
Amino acid positions for the consensus alignment are given below
each section of sequence.
[0058] FIG. 2 shows the starch accumulation expressed as mg/g fresh
weight (top) and mg/seed (bottom) in plastidic PGM-silenced seeds
(ko) as compared to wild-type seeds (wt).
[0059] FIG. 3 shows the soluble carbohydrate concentrations of
growth chamber (GC) or field grown (field) T2 seeds from plastidic
PGM-silenced events (KO) as compared to their null segregants
(WT).
[0060] FIG. 4 shows soluble carbohydrate concentrations of T3 seeds
from plastidic PGM-silenced events as compared to wild-type.
PGM-silenced seeds with a 92B91 genetic background were compared to
a 92B91 null event, while PGM-silenced seeds with a Jack background
were compared to a Jack null event.
[0061] FIG. 5 shows the soluble carbohydrate profile of defatted
soybean meal from T2 seeds.
[0062] Table 1 lists the polypeptides that are described herein,
the designation of the cDNA clones that comprise the nucleic acid
fragments encoding polypeptides representing all or a substantial
portion of these polypeptides, and the corresponding identifier
(SEQ ID NO:) as used in the attached Sequence Listing. Table 1 also
identifies the cDNA clones as individual ESTs ("EST"), the
sequences of the entire cDNA inserts comprising the indicated cDNA
clones ("FIS"), contigs assembled from two or more ESTs ("Contig"),
contigs assembled from an FIS and one or more ESTs ("Contig*"), or
sequences encoding the entire or functional protein derived from an
FIS, a contig, an EST and PCR, or an FIS and PCR ("CGS").
Nucleotide SEQ ID NOs:1, 3, 5, and 7 correspond to nucleotide SEQ
ID NOs:1, 3, 5, and 7, respectively, presented in U.S. Provisional
Application No. 60/218,712, filed Jul. 17, 2000. Amino acid SEQ ID
NOs:2, 4, 6, and 8 correspond to amino acid SEQ ID NOs:2, 4, 6, and
8, respectively, presented in U.S. Provisional Application No.
60/218,712, filed Jul. 17, 2000. The sequence descriptions and
Sequence Listing attached hereto comply with the rules governing
nucleotide and/or amino acid sequence disclosures in patent
applications as set forth in 37 C.F.R. .sctn.1.821-1.825.
TABLE-US-00001 TABLE 1 Plastidic Phosphoglucomutase Proteins SEQ ID
NO: Protein Amino (Plant Source) Clone Designation Status
Nucleotide Acid Plastidic etr1c.pk005.f8 (FIS) CGS 1 2 Phospho-
glucomutase (Cattail) Plastidic Contig Composed of: CGS 3 4
Phospho- p0075.cslaf22f (EST); glucomutase p0075.cslaf22rb (Corn)
(EST); p0128.cpicz81r (EST) Plastidic rth1c.pk009.k14.f EST 5 6
Phospho- (EST) glucomutase (Rice) Plastidic Contig Composed of: CGS
7 8 Phospho- sdp3c.pk003.e22 glucomutase (EST); PCR (Soybean)
Fragments Plastidic rdi1c.pk001.a22 (FIS) CGS 9 10 Phospho-
glucomutase (Rice)
[0063] SEQ ID NO:10 corresponds to a direct translation of the
nucleotide sequence for the full insert of rice clone
rdi1c.pk001.a22. The amino acid sequence in SEQ ID NO:10 includes a
46 amino acid open-reading frame directly in front of, and in frame
with, the methionine start codon.
[0064] SEQ ID NO:11 corresponds to plastidic phosphoglucomutase
from Brassica napus (NCBI General Identifier No. 6272125).
[0065] SEQ ID NO:12 corresponds to plastidic phosphoglucomutase
from Pisum sativum (NCBI General Identifier No. 6272283).
[0066] SEQ ID NO:13 corresponds to and plastidic phosphoglucomutase
from Pisum sativum described in European Patent Application EP
1001029-A (NCBI General Identifier No. 10190529).
[0067] SEQ ID NO:14 corresponds to a 574 nucleotide NotI fragment
from plasmid pTC103; this fragment contains a 541 nucleotide region
of soybean plastidic phosphoglucomutase, a 19 nucleotide artificial
sequence at the 5' end and a 14 nucleotide artificial sequence at
the 3' end.
[0068] SEQ ID NO:15 corresponds to the 541 nucleotide region of
soybean plastidic phosphoglucomutase contained in SEQ ID NO:14.
[0069] SEQ ID NO:16 corresponds to the full-insert sequence (FIS)
of corn clone p0075.cslaf22rb.
[0070] SEQ ID NO:17 corresponds to the nucleotide sequence of
plasmid pKS133.
[0071] SEQ ID NO:18 corresponds to a synthetic DNA linker.
[0072] SEQ ID NO:19 corresponds to synthetic complementary region
of pKS106 and pKS124.
[0073] SEQ ID NO:20 corresponds to a synthetic complementary region
of pKS133.
[0074] SEQ ID NO:21 corresponds to a synthetic PCR primer.
[0075] SEQ ID NO:22 corresponds to a synthetic PCR primer.
[0076] SEQ ID NO:23 corresponds to a nucleotide sequence of a
contig made from the full-insert sequences of the cDNA inserts of
soybean clones ses4d.pk0018.d10 and sdp2c.pk008.m2. The first 107
nucleotides of the contig were obtained from the sequence of clone
ses4d.pk0018.d10.
[0077] SEQ ID NO:24 corresponds to the amino acid sequence of a
large subunit polypeptide of soybean ADP-glucose pyrophosphorylase,
and is encoded by nucleotides 42-1637 of SEQ ID NO:23.
[0078] SEQ ID NO:25 corresponds to the amino acid sequence of the
large subunit of ADP-glucose pyrophosphorylase from chickpea, Cicer
arietinum (NCBI General Identifier No. 13487785).
[0079] SEQ ID NO:26 corresponds to the amino acid sequence of SEQ
ID NO:248406 from U.S. Patent Application US2004031072.
[0080] SEQ ID NO:27 corresponds to a nucleotide sequence obtained
from the full-length sequence of the cDNA insert of soybean clone
ssm.pk0072.e7:fis.
[0081] SEQ ID NO:28 corresponds to the amino acid sequence of a
first small subunit polypeptide, SS1, of the soybean ADP-glucose
pyrophosphorylase, and is encoded by nucleotides 80-1627 of SEQ ID
NO:27.
[0082] SEQ ID NO:29 corresponds to a nucleotide sequence of a
contig made from the EST sequence of soybean clone ssl.pk0021.h3
and the full-insert sequence of soybean clone sgs4c.pk005.b10. The
first 58 nucleotides of the contig were obtained from the sequence
of clone ssl.pk0021.h3.
[0083] SEQ ID NO:30 corresponds to the amino acid sequence of a
second small subunit polypeptide, SS2, of the soybean ADP-glucose
pyrophosphorylase, and is encoded by nucleotides 47-1594 of SEQ ID
NO:29.
[0084] SEQ ID NO:31 corresponds to the amino acid sequence of the
small subunit, PvAGPS1, of ADP-glucose pyrophosphorylase from
Phaseolus vulgaris (NCBI General Identifier No. 29421116).
[0085] SEQ ID NO:32 corresponds to the amino acid sequence of SEQ
ID NO:251944 from U.S. Patent Application US2004031072.
[0086] The Sequence Listing contains the one letter code for
nucleotide sequence characters and the three letter codes for amino
acids as defined in conformity with the IUPAC-IUBMB standards
described in Nucleic Acids Res. 13:3021-3030 (1985) and in the
Biochemical J. 219 (No. 2):345-373 (1984) which are herein
incorporated by reference. The symbols and format used for
nucleotide and amino acid sequence data comply with the rules set
forth in 37 C.F.R. .sctn.1.822.
DETAILED DESCRIPTION OF THE INVENTION
[0087] All patents, patent applications, and publications cited
throughout the application are hereby incorporated by reference in
their entirety.
[0088] In the context of this disclosure, a number of terms shall
be utilized.
[0089] The term "raffinose family oligosaccharides" (RFOs)
indicates a group of D-galactose containing oligosaccharides that
are synthesized by a set of galactosyltransferases. Raffinose
family oligosaccharides are characterized by having the general
formula:
O-.beta.-D-galactopyranosyl-(1.fwdarw.6).sub.n-.alpha.-D-glucopyranosyl-(-
1.fwdarw.2)-.beta.-D-fructofuranoside, where oligosaccharides with
n=1 through n=4 are known respectively as raffinose, stachyose,
verbascose, and ajugose. Examples of raffinose family
oligosaccharides include, but are not limited to, raffinose,
stachyose, verbascose and ajugose.
[0090] The term "plant" includes reference to whole plants, plant
parts or organs (e.g., leaves, stems, roots, etc.), plant cells,
seeds and progeny of same. Plant cell, as used herein includes,
without limitation, cells obtained from or found in the following:
seeds, suspension cultures, embryos, meristematic regions, callus
tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen
and microspores. Plant cells can also be understood to include
modified cells, such as protoplasts, obtained from the
aforementioned tissues. The class of plants which can be used in
the methods of the invention is generally as broad as the class of
higher plants amenable to transformation techniques, including both
monocotyledonous and dicotyledonous plants.
[0091] Examples of monocots include, but are not limited to, corn,
wheat, rice, sorghum, millet, barley, palm, lily, Alstroemeria,
rye, and oat.
[0092] Examples of dicots include, but are not limited to, soybean,
rape, sunflower, canola, grape, guayule, columbine, cotton,
tobacco, peas, beans, flax, safflower, and alfalfa.
[0093] Plant tissue includes differentiated and undifferentiated
tissues or plants, including but not limited to, roots, stems,
shoots, leaves, pollen, seeds, tumor tissue, and various forms of
cells and culture such as single cells, protoplasm, embryos, and
callus tissue. The plant tissue may in plant or in organ, tissue or
cell culture.
[0094] The term "plant organ" refers to plant tissue or group of
tissues that constitute a morphologically and functionally distinct
part of a plant. The term "genome" refers to the following: 1. The
entire complement of genetic material (genes and non-coding
sequences) is present in each cell of an organism, or virus or
organelle. 2. A complete set of chromosomes inherited as a
(haploid) unit from one parent. The term "stably integrated" refers
to the transfer of a nucleic acid fragment into the genome of a
host organism or cell resulting in genetically stable
inheritance.
[0095] The terms "polynucleotide", "polynucleotide sequence",
"nucleic acid", nucleic acid sequence", and "nucleic acid fragment"
are used interchangeably herein. These terms encompass nucleotide
sequences and the like. A polynucleotide may be a polymer of RNA or
DNA that is single- or double-stranded, that optionally contains
synthetic, non-natural or altered nucleotide bases. A
polynucleotide in the form of a polymer of DNA may be comprised of
one or more segments of cDNA, genomic DNA, synthetic DNA, or
mixtures thereof.
[0096] The term "isolated" refers to materials, such as "isolated
nucleic acid fragments" and/or "isolated polypeptides", which are
substantially free or otherwise removed from components that
normally accompany or interact with the materials in a naturally
occurring environment. Isolated polynucleotides may be purified
from a host cell in which they naturally occur. Conventional
nucleic acid purification methods known to skilled artisans may be
used to obtain isolated polynucleotides. The term also embraces
recombinant polynucleotides and chemically synthesized
polynucleotides.
[0097] The term "isolated nucleic acid fragment" is used
interchangeably with "isolated polynucleotide" and is a polymer of
RNA or DNA that is single- or double-stranded, optionally
containing synthetic, non-natural or altered nucleotide bases. An
isolated nucleic acid fragment in the form of a polymer of DNA may
be comprised of one or more segments of cDNA, genomic DNA or
synthetic DNA. Nucleotides (usually found in their 5'-monophosphate
form) are referred to by their single letter designation as
follows: "A" for adenylate or deoxyadenylate (for RNA or DNA,
respectively), "C" for cytidylate or deoxycytidylate, "G" for
guanylate or deoxyguanylate, "U" for uridylate, "T" for
deoxythymidylate, "R" for purines (A or G), "Y" for pyrimidines (C
or T), "K" for G or T, "H" for A or C or T, "I" for inosine, and
"N" for any nucleotide.
[0098] The terms "subfragment that is functionally equivalent" and
"functionally equivalent subfragment" are used interchangeably
herein. These terms refer to a portion or subsequence of an
isolated nucleic acid fragment in which the ability to alter gene
expression or produce a certain phenotype is retained whether or
not the fragment or subfragment encodes an active enzyme. For
example, the fragment or subfragment can be used in the design of
recombinant DNA constructs to produce the desired phenotype in a
transformed plant. Recombinant DNA constructs can be designed for
use in co-suppression or antisense by linking a nucleic acid
fragment or subfragment thereof, whether or not it encodes an
active enzyme, in the appropriate orientation relative to a plant
promoter sequence.
[0099] "Cosuppression" refers to the production of sense RNA
transcripts capable of suppressing the expression of identical or
substantially similar native genes (U.S. Pat. No. 5,231,020).
Cosuppression technology constitutes the subject matter of U.S.
Pat. No. 5,231,020, which issued to Jorgensen et al. on Jul. 27,
1999. The phenomenon observed by Napoli et al. in petunia was
referred to as "cosuppression" since expression of both the
endogenous gene and the introduced transgene were suppressed (for
reviews see Vaucheret et al., Plant J. 16:651-659 (1998); and Gura,
Nature 404:804-808 (2000)).
[0100] Co-suppression constructs in plants previously have been
designed by focusing on overexpression of a nucleic acid sequence
having homology to an endogenous mRNA, in the sense orientation,
which results in the reduction of all RNA having homology to the
overexpressed sequence (see Vaucheret et al. (1998) Plant J
16:651-659; and Gura (2000) Nature 404:804-808). The overall
efficiency of this phenomenon is low, and the extent of the RNA
reduction is widely variable. Recent work has described the use of
"hairpin" structures that incorporate all, or part, of an mRNA
encoding sequence in a complementary orientation that results in a
potential "stem-loop" structure for the expressed RNA (PCT
Publication WO 99/53050 published on Oct. 21, 1999). This increases
the frequency of co-suppression in the recovered transgenic plants.
Another variation describes the use of plant viral sequences to
direct the suppression, or "silencing", of proximal mRNA encoding
sequences (PCT Publication WO 98/36083 published on Aug. 20, 1998).
Both of these co-suppressing phenomena have not been elucidated
mechanistically, although recent genetic evidence has begun to
unravel this complex situation (Elmayan et al. (1998) Plant Cell
10:1747-1757).
[0101] In addition to cosuppression, antisense technology has also
been used to block the function of specific genes in cells.
Antisense RNA is complementary to the normally expressed RNA, and
presumably inhibits gene expression by interacting with the normal
RNA strand. The mechanisms by which the expression of a specific
gene are inhibited by either antisense or sense RNA are on their
way to being understood. However, the frequencies of obtaining the
desired phenotype in a transgenic plant may vary with the design of
the construct, the gene, the strength and specificity of its
promoter, the method of transformation and the complexity of
transgene insertion events (Baulcombe, Curr. Biol. 12(3):R82-84
(2002); Tang et al., Genes Dev. 17(1):49-63 (2003); Yu et al.,
Plant Cell. Rep. 22(3):167-174 (2003)). Cosuppression and antisense
inhibition are also referred to as "gene silencing",
"post-transcriptional gene silencing" (PTGS), RNA interference or
RNAi. See for example U.S. Pat. No. 6,506,559.
[0102] MicroRNAs (miRNA) are small regulatory RNSs that control
gene expression. miRNAs bind to regions of target RNAs and inhibit
their translation and, thus, interfere with production of the
polypeptide encoded by the target RNA. miRNAs can be designed to be
complementary to any region of the target sequence RNA including
the 3' untranslated region, coding region, etc. miRNAs are
processed from highly structured RNA precursors that are processed
by the action of a ribonuclease III termed DICER. While the exact
mechanism of action of miRNAs is unknown, it appears that they
function to regulate expression of the target gene. See, e.g., U.S.
Patent Publication No. 2004/0268441 A1 which was published on Dec.
30, 2004.
[0103] The term "expression", as used herein, refers to the
production of a functional end-product, be it mRNA or translation
of mRNA into a polypeptide. "Antisense inhibition" refers to the
production of antisense RNA transcripts capable of suppressing the
expression of the target protein. "Co-suppression" refers to the
production of sense RNA transcripts capable of suppressing the
expression of identical or substantially similar foreign or
endogenous genes (U.S. Pat. No. 5,231,020).
[0104] "Overexpression" refers to the production of a functional
end-product in transgenic organisms that exceeds levels of
production when compared to expression of that functional
end-product in a normal, wild type or non-transformed organism.
[0105] "Stable transformation" refers to the transfer of a nucleic
acid fragment into a genome of a host organism, including both
nuclear and organellar genomes, resulting in genetically stable
inheritance. In contrast, "transient transformation" refers to the
transfer of a nucleic acid fragment into the nucleus, or
DNA-containing organelle, of a host organism resulting in gene
expression without integration or stable inheritance. Host
organisms containing the transformed nucleic acid fragments are
referred to as "transgenic" organisms. The preferred method of cell
transformation of rice, corn and other monocots is using
particle-accelerated or "gene gun" transformation technology (Klein
et al. (1987) Nature (London) 327:70-73; U.S. Pat. No. 4,945,050),
or an Agrobacterium-mediated method (Ishida Y. et al. (1996) Nature
Biotech. 14:745-750). The term "transformation" as used herein
refers to both stable transformation and transient
transformation.
[0106] "Antisense inhibition" refers to the production of antisense
RNA transcripts capable of suppressing the expression of the target
protein.
[0107] As stated herein, "suppression" refers to the reduction of
the level of enzyme activity or protein functionality detectable in
a transgenic plant when compared to the level of enzyme activity or
protein functionality detectable in a plant with the native enzyme
or protein. The level of enzyme activity in a plant with the native
enzyme is referred to herein as "wild type" activity. The level of
protein functionality in a plant with the native protein is
referred to herein as "wild type" functionality. The term
"suppression" includes lower, reduce, decline, decrease, inhibit,
eliminate and prevent. This reduction may be due to the decrease in
translation of the native mRNA into an active enzyme or functional
protein. It may also be due to the transcription of the native DNA
into decreased amounts of mRNA and/or to rapid degradation of the
native mRNA. The term "native enzyme" refers to an enzyme that is
produced naturally in the desired cell.
[0108] "Gene silencing," as used herein, is a general term that
refers to decreasing mRNA levels as compared to wild-type plants,
does not specify mechanism and is inclusive, and not limited to,
anti-sense, cosuppression, viral-suppression, hairpin suppression
and stem-loop suppression.
[0109] The terms "homology", "homologous", "substantially similar"
and "corresponding substantially" are used interchangeably herein.
They refer to nucleic acid fragments wherein changes in one or more
nucleotide bases does not affect the ability of the nucleic acid
fragment to mediate gene expression or produce a certain phenotype.
These terms also refer to modifications of the nucleic acid
fragments of the instant invention such as deletion or insertion of
one or more nucleotides that do not substantially alter the
functional properties of the resulting nucleic acid fragment
relative to the initial, unmodified fragment. For example,
alterations in a nucleic acid fragment which result in the
production of a chemically equivalent amino acid at a given site,
but do not effect the functional properties of the encoded
polypeptide, are well known in the art. Thus, a codon for the amino
acid alanine, a hydrophobic amino acid, may be substituted by a
codon encoding another less hydrophobic residue, such as glycine,
or a more hydrophobic residue, such as valine, leucine, or
isoleucine. Similarly, changes which result in substitution of one
negatively charged residue for another, such as aspartic acid for
glutamic acid, or one positively charged residue for another, such
as lysine for arginine, can also be expected to produce a
functionally equivalent product. Nucleotide changes that result in
alteration of the N-terminal and C-terminal portions of the
polypeptide molecule would also not be expected to alter the
activity of the polypeptide. Each of the proposed modifications is
well within the routine skill in the art, as is determination of
retention of biological activity of the encoded products. It is
therefore understood, as those skilled in the art will appreciate,
that the invention encompasses more than the specific exemplary
sequences.
[0110] Moreover, the skilled artisan recognizes that substantially
similar nucleic acid sequences encompassed by this invention are
also defined by their ability to hybridize, under moderately
stringent conditions (for example, 1.times.SSC, 0.1% SDS,
60.degree. C.) with the sequences exemplified herein, or to any
portion of the nucleotide sequences reported herein and which are
functionally equivalent to the gene or the promoter of the
invention. Stringency conditions can be adjusted to screen for
moderately similar fragments, such as homologous sequences from
distantly related organisms, to highly similar fragments, such as
genes that duplicate functional enzymes from closely related
organisms. Post-hybridization washes determine stringency
conditions. One set of preferred conditions involves a series of
washes starting with 6.times.SSC, 0.5% SDS at room temperature for
15 min, then repeated with 2.times.SSC, 0.5% SDS at 45.degree. C.
for 30 min, and then repeated twice with 0.2.times.SSC, 0.5% SDS at
50.degree. C. for 30 min. A more preferred set of stringent
conditions involves the use of higher temperatures in which the
washes are identical to those above except for the temperature of
the final two 30 min washes in 0.2.times.SSC, 0.5% SDS was
increased to 60.degree. C. Another preferred set of highly
stringent conditions involves the use of two final washes in
0.1.times.SSC, 0.1% SDS at 65.degree. C.
[0111] With respect to the degree of substantial similarity between
the target (endogenous) mRNA and the RNA region in the construct
having homology to the target mRNA, such sequences should be at
least 25 nucleotides in length, preferably at least 50 nucleotides
in length, more preferably at least 100 nucleotides in length,
again more preferably at least 200 nucleotides in length, and most
preferably at least 300 nucleotides in length; and should be at
least 80% identical, preferably at least 85% identical, more
preferably at least 90% identical, and most preferably at least 95%
identical.
[0112] Substantially similar nucleic acid fragments of the instant
invention may also be characterized by the percent identity of the
amino acid sequences that they encode to the amino acid sequences
disclosed herein, as determined by algorithms commonly employed by
those skilled in this art. Suitable nucleic acid fragments
(isolated polynucleotides of the present invention) encode
polypeptides that are at least 70% identical, preferably at least
80% identical to the amino acid sequences reported herein.
Preferred nucleic acid fragments encode amino acid sequences that
are at least 85% identical to the amino acid sequences reported
herein. More preferred nucleic acid fragments encode amino acid
sequences that are at least 90% identical to the amino acid
sequences reported herein. Most preferred are nucleic acid
fragments that encode amino acid sequences that are at least 95%
identical to the amino acid sequences reported herein.
[0113] It is well understood by one skilled in the art that many
levels of sequence identity are useful in identifying related
polypeptide sequences. Useful examples of percent identities are
50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or any integer
percentage from 55% to 100%.
[0114] Sequence alignments and percent similarity calculations may
be determined using a variety of comparison methods designed to
detect homologous sequences including, but not limited to, the
Megalign program of the LASARGENE bioinformatics computing suite
(DNASTAR Inc., Madison, Wis.). Unless stated otherwise, multiple
alignment of the sequences provided herein were performed using the
Clustal method of alignment (Higgins and Sharp (1989) CABIOS.
5:151-153) with the default parameters (GAP PENALTY=10, GAP LENGTH
PENALTY=10). Default parameters for pairwise alignments and
calculation of percent identity of protein sequences using the
Clustal method are KTUPLE=1, GAP PENALTY=3, WINDOW=5 and DIAGONALS
SAVED=5. For nucleic acids these parameters are KTUPLE=2, GAP
PENALTY=5, WINDOW=4 and DIAGONALS SAVED=4. After alignment of the
sequences, using the Clustal V program, it is possible to obtain a
"percent identity" by viewing the "sequence distances" table on the
same program.
[0115] Unless otherwise stated, "BLAST" sequence
identity/similarity values provided herein refer to the value
obtained using the BLAST 2.0 suite of programs using default
parameters (Altschul et al., Nucleic Acids Res. 25:3389-3402
(1997)). Software for performing BLAST analyses is publicly
available, e.g., through the National Center for Biotechnology
Information. This algorithm involves first identifying high scoring
sequence pairs (HSPs) by identifying short words of length W in the
query sequence, which either match or satisfy some positive-valued
threshold score T when aligned with a word of the same length in a
database sequence. T is referred to as the neighborhood word score
threshold (Altschul et al., supra). These initial neighborhood word
hits act as seeds for initiating searches to find longer HSPs
containing them. The word hits are then extended in both directions
along each sequence for as far as the cumulative alignment score
can be increased. Cumulative scores are calculated using, for
nucleotide sequences, the parameters M (reward score for a pair of
matching residues; always >0) and N (penalty score for
mismatching residues; always <0). For amino acid sequences, a
scoring matrix is used to calculate the cumulative score. Extension
of the word hits in each direction are halted when: the cumulative
alignment score falls off by the quantity X from its maximum
achieved value; the cumulative score goes to zero or below, due to
the accumulation of one or more negative-scoring residue
alignments; or the end of either sequence is reached. The BLAST
algorithm parameters W, T, and X determine the sensitivity and
speed of the alignment. The BLASTN program (for nucleotide
sequences) uses as defaults a wordlength (W) of 11, an expectation
(E) of 10, a cutoff of 100, M=5, N=.sup.-4, and a comparison of
both strands. For amino acid sequences, the BLASTP program uses as
defaults a wordlength (W) of 3, an expectation (E) of 10, and the
BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl.
Acad. Sci. USA 89:10915 (1989)).
[0116] "Sequence identity" or "identity" in the context of nucleic
acid or polypeptide sequences refers to the nucleic acid bases or
amino acid residues in the two sequences that are the same when
aligned for maximum correspondence over a specified comparison
window.
[0117] Thus, "Percentage of sequence identity" refers to the valued
determined by comparing two optimally aligned sequences over a
comparison window, wherein the portion of the polynucleotide
sequence in the comparison window may comprise additions or
deletions (i.e., gaps) as compared to the reference sequence (which
does not comprise additions or deletions) for optimal alignment of
the two sequences. The percentage is calculated by determining the
number of positions at which the identical nucleic acid base or
amino acid residue occurs in both sequences to yield the number of
matched positions, dividing the number of matched positions by the
total number of positions in the window of comparison and
multiplying the results by 100 to yield the percentage of sequence
identity. Useful examples of percent sequence identities include,
but are not limited to, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%,
90%, or 95%, or any integer percentage from 55% to 100%. These
identities can be determined using any of the programs described
herein.
[0118] Sequence alignments and percent identity or similarity
calculations may be determined using a variety of comparison
methods designed to detect homologous sequences including, but not
limited to, the Megalign program of the LASARGENE bioinformatics
computing suite (DNASTAR Inc., Madison, Wis.). Multiple alignment
of the sequences are performed using the Clustal V method of
alignment (Higgins, D. G. and Sharp, P. M. (1989) Comput. Appl.
Biosci. 5:151-153; Higgins, D. G. et al. (1992) Comput. Appl.
Biosci. 8:189-191) with the default parameters (GAP PENALTY=10, GAP
LENGTH PENALTY=10). Default parameters for pairwise alignments and
calculation of percent identity of protein sequences using the
Clustal method are KTUPLE=1, GAP PENALTY=3, WINDOW=5 and DIAGONALS
SAVED=5. For nucleic acids these parameters are KTUPLE=2, GAP
PENALTY=5, WINDOW=4 and DIAGONALS SAVED=4.
[0119] It is well understood by one skilled in the art that many
levels of sequence identity are useful in identifying polypeptides,
from other plant species, wherein such polypeptides have the same
or similar function or activity. Useful examples of percent
identities include, but are not limited to, 50%, 55%, 60%, 65%,
70%, 75%, 80%, 85%, 90%, or 95%, or any integer percentage from 55%
to 100%. Indeed, any integer amino acid identity from 50%-100% may
be useful in describing the present invention. Also, of interest is
any full or partial complement of this isolated nucleotide
fragment.
[0120] The term "recombinant" means, for example, that a nucleic
acid sequence is made by an artificial combination of two otherwise
separated segments of sequence, e.g., by chemical synthesis or by
the manipulation of isolated nucleic acids by genetic engineering
techniques.
[0121] As used herein, "contig" refers to a nucleotide sequence
that is assembled from two or more constituent nucleotide sequences
that share common or overlapping regions of sequence homology. For
example, the nucleotide sequences of two or more nucleic acid
fragments can be compared and aligned in order to identify common
or overlapping sequences. Where common or overlapping sequences
exist between two or more nucleic acid fragments, the sequences
(and thus their corresponding nucleic acid fragments) can be
assembled into a single contiguous nucleotide sequence.
[0122] "Codon degeneracy" refers to divergence in the genetic code
permitting variation of the nucleotide sequence without affecting
the amino acid sequence of an encoded polypeptide. Accordingly, the
instant invention relates to any nucleic acid fragment comprising a
nucleotide sequence that encodes all or a substantial portion of
the amino acid sequences set forth herein. The skilled artisan is
well aware of the "codon-bias" exhibited by a specific host cell in
usage of nucleotide codons to specify a given amino acid.
Therefore, when synthesizing a nucleic acid fragment for improved
expression in a host cell, it is desirable to design the nucleic
acid fragment such that its frequency of codon usage approaches the
frequency of preferred codon usage of the host cell.
[0123] The terms "synthetic nucleic acid" or "synthetic genes"
refer to nucleic acid molecules assembled either in whole or in
part from oligonucleotide building blocks that are chemically
synthesized using procedures known to those skilled in the art.
These building blocks are ligated and annealed to form larger
nucleic acid fragments which may then be enzymatically assembled to
construct the entire desired nucleic acid fragment. "Chemically
synthesized", as related to a nucleic acid fragment, means that the
component nucleotides were assembled in vitro. Manual chemical
synthesis of nucleic acid fragments may be accomplished using well
established procedures, or automated chemical synthesis can be
performed using one of a number of commercially available machines.
Accordingly, the nucleic acid fragments can be tailored for optimal
gene expression based on optimization of the nucleotide sequence to
reflect the codon bias of the host cell. The skilled artisan
appreciates the likelihood of successful gene expression if codon
usage is biased towards those codons favored by the host.
Determination of preferred codons can be based on a survey of genes
derived from the host cell where sequence information is
available.
[0124] "Gene" refers to a nucleic acid fragment that is capable of
directing expression a specific protein or functional RNA.
[0125] "Native gene" refers to a gene as found in nature with its
own regulatory sequences.
[0126] "Chimeric gene" or "recombinant DNA construct" are used
interchangeably herein, and refers any gene that is not a native
gene, comprising regulatory and coding sequences that are not found
together in nature, or to an isolated native gene optionally
modified and reintroduced into a host cell.
[0127] A chimeric gene may comprise regulatory sequences and coding
sequences that are derived from different sources, or regulatory
sequences and coding sequences derived from the same source, but
arranged in a manner different than that found in nature. In one
embodiment, a regulatory region and a coding sequence region are
assembled from two different sources. In another embodiment, a
regulatory region and a coding sequence region are derived from the
same source but arranged in a manner different than that found in
nature. In another embodiment, the coding sequence region is
assembled from at least two different sources. In another
embodiment, the coding region is assembled from the same source but
in a manner not found in nature.
[0128] The term "endogenous gene" refers to a native gene in its
natural location in the genome of an organism.
[0129] The term "foreign gene" refers to a gene not normally found
in the host organism that is introduced into the host organism by
gene transfer.
[0130] The term "transgene" refers to a gene that has been
introduced into a host cell by a transformation procedure.
Transgenes may become physically inserted into a genome of the host
cell (e.g., through recombination) or may be maintained outside of
a genome of the host cell (e.g., on an extrachromasomal array).
[0131] An "allele" is one of several alternative forms of a gene
occupying a given locus on a chromosome. When the alleles present
at a given locus on a pair of homologous chromosomes in a diploid
plant are the same that plant is homozygous at that locus. If the
alleles present at a given locus on a pair of homologous
chromosomes in a diploid plant differ that plant is heterozygous at
that locus. If a transgene is present on one of a pair of
homologous chromosomes in a diploid plant that plant is hemizygous
at that locus.
[0132] The term "coding sequence" refers to a DNA fragment that
codes for a polypeptide having a specific amino acid sequence, or a
structural RNA. The boundaries of a protein coding sequence are
generally determined by a ribosome binding site (prokaryotes) or by
an ATG start codon (eukaryotes) located at the 5' end of the mRNA
and a transcription terminator sequence located just downstream of
the open reading frame at the 3' end of the mRNA. A coding sequence
can include, but is not limited to, DNA, cDNA, and recombinant
nucleic acid sequences.
[0133] "Mature" protein refers to a post-translationally processed
polypeptide; i.e., one from which any pre- or pro-peptides present
in the primary translation product have been removed. "Precursor"
protein refers to the primary product of translation of mRNA; i.e.,
with pre- and pro-peptides still present. Pre- and pro-peptides may
be and are not limited to intracellular localization signals.
[0134] "RNA transcript" refers to the product resulting from RNA
polymerase-catalyzed transcription of a DNA sequence. When the RNA
transcript is a perfect complementary copy of the DNA sequence, it
is referred to as the primary transcript or it may be a RNA
sequence derived from post-transcriptional processing of the
primary transcript and is referred to as the mature RNA. "Messenger
RNA (mRNA)" refers to the RNA that is without introns and that can
be translated into protein by the cell. "cDNA" refers to a DNA that
is complementary to and synthesized from an mRNA template using the
enzyme reverse transcriptase. The cDNA can be single-stranded or
converted into the double-stranded form using the Klenow fragment
of DNA polymerase I. "Sense" RNA refers to RNA transcript that
includes the mRNA and can be translated into protein within a cell
or in vitro. "Antisense RNA" refers to an RNA transcript that is
complementary to all or part of a target primary transcript or mRNA
and that blocks the expression of a target isolated nucleic acid
fragment (U.S. Pat. No. 5,107,065). The complementarity of an
antisense RNA may be with any part of the specific gene transcript,
i.e., at the 5' non-coding sequence, 3' non-coding sequence,
introns, or the coding sequence. "Functional RNA" refers to
antisense RNA, ribozyme RNA, or other RNA that may not be
translated but yet has an effect on cellular processes. The terms
"complement" and "reverse complement" are used interchangeably
herein with respect to mRNA transcripts, and are meant to define
the antisense RNA of the message.
[0135] The term "endogenous RNA" refers to any RNA which is encoded
by any nucleic acid sequence present in the genome of the host
prior to transformation with the recombinant construct of the
present invention, whether naturally-occurring or non-naturally
occurring, i.e., introduced by recombinant means, mutagenesis,
etc.
[0136] The term "non-naturally occurring" means artificial, not
consistent with what is normally found in nature.
[0137] "Messenger RNA (mRNA)" refers to the RNA that is without
introns and that can be translated into protein by the cell.
[0138] "cDNA" refers to a DNA that is complementary to and
synthesized from a mRNA template using the enzyme reverse
transcriptase. The cDNA can be single-stranded or converted into
the double-stranded form using the Klenow fragment of DNA
polymerase I.
[0139] "Sense" RNA refers to RNA transcript that includes the mRNA
and can be translated into protein within a cell or in vitro.
[0140] "Antisense RNA" refers to an RNA transcript that is
complementary to all or part of a target primary transcript or
mRNA, and that blocks the expression of a target gene (U.S. Pat.
No. 5,107,065). The complementarity of an antisense RNA may be with
any part of the specific gene transcript, i.e., at the 5'
non-coding sequence, 3' non-coding sequence, introns, or the coding
sequence.
[0141] "Functional RNA" refers to antisense RNA, ribozyme RNA, or
other RNA that may not be translated, yet has an effect on cellular
processes. The terms "complement" and "reverse complement" are used
interchangeably herein with respect to mRNA transcripts, and are
meant to define the antisense RNA of the message.
[0142] The term "recombinant DNA construct" refers to a DNA
construct assembled from nucleic acid fragments obtained from
different sources. The types and origins of the nucleic acid
fragments may be very diverse.
[0143] A "recombinant expression construct" contains a nucleic acid
fragment operably linked to at least one regulatory element, that
is capable of effecting expression of the nucleic acid fragment.
The recombinant expression construct may also affect expression of
a homologous sequence in a host cell.
[0144] In one embodiment the choice of recombinant expression
construct is dependent upon the method that will be used to
transform host cells. The skilled artisan is well aware of the
genetic elements that must be present on the recombinant expression
construct in order to successfully transform, select and propagate
host cells. The skilled artisan will also recognize that different
independent transformation events may be screened to obtain lines
displaying the desired expression level and pattern. Such screening
may be accomplished by, but is not limited to, Southern analysis of
DNA, Northern analysis of mRNA expression, Western analysis of
protein expression, or phenotypic analysis.
[0145] The term "operably linked" refers to the association of
nucleic acid fragments on a single nucleic acid fragment so that
the function of one is regulated by the other. For example, a
promoter is operably linked with a coding sequence when it is
capable of regulating the expression of that coding sequence (i.e.,
that the coding sequence is under the transcriptional control of
the promoter). Coding sequences can be operably linked to
regulatory sequences in a sense or antisense orientation. In
another example, the complementary RNA regions of the invention can
be operably linked, either directly or indirectly, 5' to the target
mRNA, or 3' to the target mRNA, or within the target mRNA, or a
first complementary region is 5' and its complement is 3' to the
target mRNA.
[0146] "Regulatory sequences" refer to nucleotides located upstream
(5' non-coding sequences), within, or downstream (3' non-coding
sequences) of a coding sequence, and which may influence the
transcription, RNA processing, stability, or translation of the
associated coding sequence. Regulatory sequences may include, and
are not limited to, promoters, translation leader sequences,
introns, and polyadenylation recognition sequences.
[0147] "Promoter" refers to a DNA sequence capable of controlling
the expression of a coding sequence or functional RNA. The promoter
sequence consists of proximal and more distal upstream elements,
the latter elements often referred to as enhancers. Accordingly, an
"enhancer" is a DNA sequence which can stimulate promoter activity
and may be an innate element of the promoter or a heterologous
element inserted to enhance the level or tissue-specificity of a
promoter. Promoter sequences can also be located within the
transcribed portions of genes, and/or downstream of the transcribed
sequences. Promoters may be derived in their entirety from a native
gene, or be composed of different elements derived from different
promoters found in nature, or even comprise synthetic DNA segments.
It is understood by those skilled in the art that different
promoters may direct the expression of an isolated nucleic acid
fragment in different tissues or cell types, or at different stages
of development, or in response to different environmental
conditions. Promoters which cause an isolated nucleic acid fragment
to be expressed in most cell types at most times are commonly
referred to as "constitutive promoters". New promoters of various
types useful in plant cells are constantly being discovered;
numerous examples may be found in the compilation by Okamuro and
Goldberg, (1989) Biochemistry of Plants 15:1-82. It is further
recognized that since in most cases the exact boundaries of
regulatory sequences have not been completely defined, DNA
fragments of some variation may have identical promoter
activity.
[0148] Specific examples of promoters that may be useful in
expressing the nucleic acid fragments of the invention include, but
are not limited to, the oleosin promoter (PCT Publication
WO99/65479, published Dec. 12, 1999), the maize 27 kD zein promoter
(Ueda et al (1994) Mol. Cell. Biol. 14:4350-4359), the ubiquitin
promoter (Christensen et al (1992) Plant Mol. Biol. 18:675-680),
the SAM synthetase promoter (PCT Publication WO00/37662, published
Jun. 29, 2000), the CaMV 35S (Odell et al (1985) Nature
313:810-812), and the promoter described in PCT Publication
WO02/099063 published Dec. 12, 2002.
[0149] The "translation leader sequence" refers to a polynucleotide
fragment located between the promoter of a gene and the coding
sequence. The translation leader sequence is present in the fully
processed mRNA upstream of the translation start sequence. The
translation leader sequence may affect processing of the primary
transcript to mRNA, mRNA stability or translation efficiency.
Examples of translation leader sequences have been described
(Turner, R. and Foster, G. D. (1995) Mol. Biotechnol.
3:225-236).
[0150] An "intron" is an intervening sequence in a gene that does
not encode a portion of the protein sequence. Thus, such sequences
are transcribed into RNA but are then excised and are not
translated. The term is also used for the excised RNA
sequences.
[0151] The "3' non-coding sequences" refer to DNA sequences located
downstream of a coding sequence and include polyadenylation
recognition sequences and other sequences encoding regulatory
signals capable of affecting mRNA processing or gene expression.
The polyadenylation signal is usually characterized by affecting
the addition of polyadenylic acid tracts to the 3' end of the mRNA
precursor. The use of different 3' non-coding sequences is
exemplified by Ingelbrecht, I. L., et al. (1989) Plant Cell
1:671-680.
[0152] Standard recombinant DNA and molecular cloning techniques
used herein are well known in the art and are described more fully
in Sambrook, J., Fritsch, E. F. and Maniatis, T. Molecular Cloning:
A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold
Spring Harbor, 1989. Transformation methods are well known to those
skilled in the art and are described below.
[0153] "PCR" or "Polymerase Chain Reaction" is a technique for the
synthesis of large quantities of specific DNA segments, consists of
a series of repetitive cycles (Perkin Elmer Cetus Instruments,
Norwalk, Conn.). Typically, the double stranded DNA is heat
denatured, the two primers complementary to the 3' boundaries of
the target segment are annealed at low temperature and then
extended at an intermediate temperature. One set of these three
consecutive steps is referred to as a cycle.
[0154] "Stable transformation" refers to the transfer of a nucleic
acid fragment into a genome of a host organism, including nuclear
and organellar genomes, resulting in genetically stable
inheritance.
[0155] In contrast, "transient transformation" refers to the
transfer of a nucleic acid fragment into the nucleus, or
DNA-containing organelle, of a host organism resulting in gene
expression without integration or stable inheritance.
[0156] Host organisms comprising the transformed nucleic acid
fragments are referred to as "transgenic" organisms.
[0157] The term "amplified" means the construction of multiple
copies of a nucleic acid sequence or multiple copies complementary
to the nucleic acid sequence using at least one of the nucleic acid
sequences as a template. Amplification systems include the
polymerase chain reaction (PCR) system, ligase chain reaction (LCR)
system, nucleic acid sequence based amplification (NASBA, Cangene,
Mississauga, Ontario), Q-Beta Replicase systems,
transcription-based amplification system (TAS), and strand
displacement amplification (SDA). See, e.g., Diagnostic Molecular
Microbiology: Principles and Applications, D. H. Persing et al.,
Ed., American Society for Microbiology, Washington, D.C. (1993).
The product of amplification is termed an amplicon.
[0158] The term "chromosomal location" includes reference to a
length of a chromosome which may be measured by reference to the
linear segment of DNA which it comprises. The chromosomal location
can be defined by reference to two unique DNA sequences, i.e.,
markers.
[0159] The term "marker" includes reference to a locus on a
chromosome that serves to identify a unique position on the
chromosome. A "polymorphic marker" includes reference to a marker
which appears in multiple forms (alleles) such that different forms
of the marker, when they are present in a homologous pair, allow
transmission of each of the chromosomes in that pair to be
followed. A genotype may be defined by use of one or a plurality of
markers.
[0160] The present invention includes, inter alia, compositions and
methods for modulating (i.e., increasing or decreasing) the level
of plastidic polypeptides described herein in plants. The size of
the starch and soluble carbohydrate pools in soybean seeds can be
modulated by altering the expression of a specific gene, encoding
plastidic phosphoglucomutase (pPGM), which is involved in the
starch and soluble carbohydrate biosynthetic pathway.
[0161] Silencing of pPGM gene expression in transgenic soybeans
seeds resulted in a drastic decrease of the transient starch pool
accompanied by a reduction in soluble carbohydrates and a
concomitant increase in combined oil and protein content.
Elimination of the transient starch pool by silencing plastidic PGM
gene expression in soybean seeds diverted carbon away from the
soluble carbohydrate components of dry soybean seeds with the major
decrease occurring in the sucrose pool. This is in contrast to PGM
mutants of pea, Arabidopsis, and Nicotiana, where the carbon is
mainly funneled into the soluble carbohydrate pool.
[0162] The data discussed below further indicates that soybean
seeds deficient in plastidic PGM reallocate the carbon destined for
starch biosynthesis toward the biosynthesis oil and protein and
also alters the sucrose to raffinose family oligosaccharide
ratio.
[0163] In contrast, a 40% reduction in storage lipid content was
observed in the Arabidopsis mutant pgm-1, which contains a point
mutation in the AtPGM gene rendering the polypeptide nonfunctional
(Periappuram et al., (2000) Plant Physiol. 122:1193-1199).
[0164] An alteration of plastidic PGM activity affects the
allocation of carbon to the soluble carbohydrate pool as well as
the allocation of carbon to oil and protein biosynthesis. This is
accomplished with no adverse effect on plant and seed phenotype.
Since all known soybean cultivars contain transient starch,
silencing the plastidic PGM gene in any soybean cultivar should
result in a decrease of the transient carbon reserve together with
an increase in the combined oil and protein level. This increase in
the combined oil and protein level is in addition to the oil and
protein levels of the wild-type genotype, regardless of whether the
level is low or high. For example, a soybean variety such as
Sakaii-18 has 56% of its seed dry weight as protein and 14% as oil.
A Pioneer soybean variety, 9306, contains 41% protein and 23% oil
(as seed dry weight). Both genotypes would be expected to have an
increase in the combined oil and protein content as well as altered
sucrose to raffinose family oligosaccharide ratio.
[0165] In one embodiment, the present invention concerns an
isolated
[0166] polynucleotide comprising: (a) a first nucleotide sequence
encoding a first polypeptide comprising at least 560 amino acids,
wherein the amino acid sequence of the first polypeptide and the
amino acid sequence of SEQ ID NO:8 have at least 95%, 96%, 97%,
98%, 99% or 100% sequence identity, based on the Clustal V method
of alignment, (b) a second nucleotide sequence encoding a second
polypeptide comprising at least 560 amino acids, wherein the amino
acid sequence of the second polypeptide and the amino acid sequence
of SEQ ID NO:2, SEQ ID NO:4, or SEQ ID NO:10 have at least 85%,
90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, based on
the Clustal V method of alignment, or (c) the complement of the
first or second nucleotide sequence, wherein the complement and the
first or second nucleotide sequence contain the same number of
nucleotides and are 100% complementary. The first polypeptide
preferably comprises the amino acid sequence of SEQ ID NO:8, and
the second polypeptide preferably comprises the amino acid sequence
of SEQ ID NO:2, SEQ ID NO:4, or SEQ ID NO:10. The first nucleotide
sequence preferably comprises the nucleotide sequence of SEQ ID
NO:7, the second nucleotide sequence preferably comprises the
nucleotide sequence of SEQ ID NO:1, SEQ ID NO:3, or SEQ ID NO:9.
The first and second polypeptides preferably have
phosphoglucomutase activity.
[0167] In another embodiment, the present invention relates to a
recombinant DNA construct comprising any of the isolated
polynucleotides of the present invention operably linked to at
least one regulatory sequence.
[0168] In another preferred embodiment of the present invention, a
recombinant DNA construct of the present invention further
comprises an enhancer.
[0169] In another embodiment, the present invention relates to a
vector comprising any of the isolated polynucleotides of the
present invention.
[0170] In another embodiment, the present invention relates to an
isolated polynucleotide fragment comprising a nucleotide sequence
comprised by any of the polynucleotides of the present invention,
wherein the nucleotide sequence contains at least 30, 40, 60, 100,
200, 300, 400, 500 or 541 nucleotides.
[0171] In another embodiment, the present invention relates to a
method for transforming a cell comprising transforming a cell with
any of the isolated polynucleotides of the present invention, and
the cell transformed by this method. Advantageously, the cell is
eukaryotic, e.g., a yeast or plant cell, or prokaryotic, e.g., a
bacterium.
[0172] In another embodiment, the present invention relates to a
method for transforming a cell, comprising transforming a cell with
a polynucleotide of the present invention.
[0173] In another embodiment, the present invention relates to a
method for producing a transgenic plant comprising transforming a
plant cell with any of the isolated polynucleotides of the present
invention and regenerating a transgenic plant from the transformed
plant cell.
[0174] In another embodiment, a cell, plant, or seed comprising a
recombinant DNA construct of the present invention.
[0175] In another embodiment, the present invention concerns an
isolated polypeptide comprising: (a) a first amino acid sequence
comprising at least 560 amino acids, wherein the first amino acid
sequence and the amino acid sequence of SEQ ID NO:8 have at least
95%, 96%, 97%, 98%, 99% or 100% sequence identity, based on the
Clustal V method of alignment, and (b) a second amino acid sequence
comprising at least 560 amino acids, wherein the second amino acid
sequence and the amino acid sequence of SEQ ID NO:2, SEQ ID NO:4,
or SEQ ID NO:10 have at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or
100% sequence identity, based on the Clustal V method of alignment.
The first amino acid sequence preferably comprises the amino acid
sequence of SEQ ID NO:8, and the second amino acid sequence
preferably comprises the amino acid sequence SEQ ID NO:2, SEQ ID
NO:4, or SEQ ID NO:10. The polypeptide preferably has
phosphoglucomutase activity.
[0176] In another embodiment, the present invention relates to a
virus, preferably a baculovirus, comprising any of the isolated
polynucleotides of the present invention or any of the recombinant
DNA constructs of the present invention.
[0177] In another embodiment, the invention relates to a method of
selecting an isolated polynucleotide that alters, i.e., increases
or decreases, the level of expression of a phosphoglucomutase gene,
protein or enzyme activity in a host cell, preferably a plant cell,
the method comprising the steps of: (a) constructing an isolated
polynucleotide of the present invention or an isolated recombinant
DNA construct of the present invention; (b) introducing the
isolated polynucleotide or the isolated recombinant DNA construct
into a host cell; (c) measuring the level of the phosphoglucomutase
RNA, protein or enzyme activity in the host cell containing the
isolated polynucleotide or recombinant DNA construct; (d) comparing
the level of the phosphoglucomutase RNA, protein or enzyme activity
in the host cell containing the isolated polynucleotide or
recombinant DNA construct with the level of the phosphoglucomutase
RNA, protein or enzyme activity in a host cell that does not
contain the isolated polynucleotide or recombinant DNA construct,
and selecting the isolated polynucleotide or recombinant DNA
construct that alters, i.e., increases or decreases, the level of
expression of the phosphoglucomutase gene, protein or enzyme
activity in the plant cell.
[0178] In another embodiment, the invention concerns a method of
obtaining a nucleic acid fragment encoding a substantial portion of
a phosphoglucomutase protein, preferably a plant phosphoglucomutase
protein, comprising the steps of: synthesizing an oligonucleotide
primer comprising a nucleotide sequence of at least 30 contiguous
nucleotides, preferably at least 40 contiguous nucleotides, more
preferably at least 60 contiguous nucleotides derived from a
nucleotide sequence selected from the group consisting of SEQ ID
NOs:1, 3, 5, 7, and 9, and the complement of such nucleotide
sequences; and amplifying a nucleic acid fragment (preferably a
cDNA inserted in a cloning vector) using the oligonucleotide
primer. The amplified nucleic acid fragment preferably will encode
a substantial portion of a phosphoglucomutase protein amino acid
sequence.
[0179] In another embodiment, the invention relates to a method of
obtaining a nucleic acid fragment encoding all or a substantial
portion of the amino acid sequence encoding a phosphoglucomutase
protein comprising the steps of: probing a cDNA or genomic library
with an isolated polynucleotide of the present invention;
identifying a DNA clone that hybridizes with an isolated
polynucleotide of the present invention; isolating the identified
DNA clone; and sequencing the cDNA or genomic fragment that
comprises the isolated DNA clone.
[0180] In another embodiment, the invention concerns a method for
positive selection of a transformed cell comprising: (a)
transforming a host cell with the recombinant DNA construct of the
present invention or an expression cassette of the present
invention; and (b) growing the transformed host cell, preferably a
plant cell, such as a monocot or a dicot, under conditions which
allow expression of the phosphoglucomutase polynucleotide in an
amount sufficient to complement a null mutant to provide a positive
selection means.
[0181] In another embodiment, this invention concerns a method for
suppressing the level of expression of a gene encoding a plastidic
polypeptide having phosphoglucomutase activity in a transgenic
plant, wherein the method comprises: [0182] (a) transforming a
plant cell with a fragment of the isolated polynucleotide of the
invention; [0183] (b) regenerating a transgenic plant from the
transformed plant cell of (a); and [0184] (c) selecting a
transgenic plant wherein the level of expression of a gene encoding
a plastidic polypeptide having phosphoglucomutase activity has been
suppressed.
[0185] Preferably, the gene encodes a plastidic polypeptide having
phosphoglucomutase activity, and the plant is a soybean plant.
[0186] In another embodiment, the invention concerns a recombinant
DNA construct comprising: (a) all or part of the nucleotide
sequence set forth in SEQ ID NO:7 or SEQ ID NO:15; or (b) the
complement of (a); wherein (a) or (b) is useful in co-suppression
or antisense suppression of endogenous phosphoglucomutase activity
in a transgenic plant.
In another embodiment, the invention concerns a method for
producing transgenic seed, the method comprising: [0187] (a)
transforming a plant cell with the recombinant DNA construct of
[0188] (i) all or part of the nucleotide sequence set forth in SEQ
ID NO:7 or SEQ ID NO:15; or [0189] (ii) the complement of (i);
[0190] wherein (i) or (ii) is useful in co-suppression or antisense
suppression of endogenous phosphoglucomutase activity in a
transgenic plant; [0191] (b) regenerating a transgenic plant from
the transformed plant cell of (a); and [0192] (c) selecting a
transgenic plant that produces a transgenic seed having an increase
in the combined oil and protein content of at least 1.6% and a
decrease in the sucrose content of at least 25% as compared to seed
obtained from a non-transgenic plant. Preferably, the seed is a
soybean seed. In another embodiment, the invention concerns a
method for producing transgenic seed, the method comprising: [0193]
(a) transforming a plant cell with a recombinant DNA construct
comprising [0194] (i) all or part of the nucleotide sequence set
forth in SEQ ID NO:7 or SEQ ID NO:15; or [0195] (ii) the complement
of (i); [0196] wherein (i) or (ii) is useful in co-suppression or
antisense suppression of endogenous phosphoglucomutase activity in
a transgenic plant; [0197] (b) regenerating a transgenic plant from
the transformed plant cell of (a); and [0198] (c) selecting a
transgenic plant that produces a transgenic seed having a sucrose
to raffinose family oligosaccharide ratio of 1.0 or less as
compared to seed obtained from a non-transgenic plant.
[0199] Preferably, the transgenic seed differs from an
untransformed seed by having an increase in the combined oil and
protein content of at least 1.6%, 1.8% or 2.0%. Preferably, the
seed is a soybean seed.
[0200] In another embodiment, the invention concerns a method for
producing defatted meal from transgenic seed, comprising: [0201]
(a) transforming a plant cell with a recombinant DNA construct
comprising (i) all or part of the nucleotide sequence set forth in
SEQ ID NO:7 or SEQ ID NO:15; or [0202] (ii) the complement of (i);
[0203] wherein (i) or (ii) is useful in co-suppression or antisense
suppression of endogenous phosphoglucomutase activity in a
transgenic plant; [0204] (b) regenerating a transgenic plant from
the transformed plant cell of (a); and [0205] (c) selecting a
transgenic plant that produces a transgenic seed wherein said seed
is processed into defatted meal having an increase in the combined
oil and protein content of at least 5% and a decrease in the
sucrose content of at least 25% as compared to defatted meal
obtained from seed of a non-transgenic plant.
[0206] Preferably, the defatted meal of the transgenic seed differs
from the defatted meal of an untransformed seed by having a sucrose
to raffinose family oligosaccharide ratio of 1.0 or less.
Preferably, the seed is a soybean seed.
[0207] In a another embodiment, the invention concerns a transgenic
seed that differs from an non-transgenic seed by having an increase
in the combined oil and protein content of at least 1.6%, 1.8% or
2.0%, and a decrease in the sucrose content of at least 25%.
Preferably, the seed is a soybean seed.
[0208] In another embodiment, the invention concerns a transgenic
seed that differs from non-transgenic seed by having a sucrose to
raffinose family oligosaccharide ratio of 1.0 or less. Preferably,
the transgenic seed differs from an untransformed seed by having an
increase in the combined oil and protein content of at least 1.6%,
1.8% or 2.0%. Preferably, the seed is a soybean seed. [0209] In
another embodiment, the invention concerns a transgenic seed
comprising a recombinant construct comprising (i) all or part of
the nucleotide sequence set forth in SEQ ID NO:7 or SEQ ID NO:15;
or [0210] (ii) the complement of (i); [0211] wherein (i) or (ii) is
useful in co-suppression or antisense suppression of endogenous
phosphoglucomutase activity in a transgenic plant; [0212] further
wherein said transgenic seed is processed to make defatted meal
having an increase in the combined oil and protein content of at
least 5% and a decrease in the sucrose content of at least 25% when
compared to defatted meal obtained from a non-transgenic seed.
[0213] Preferably, the defatted meal of the transgenic seed differs
from the defatted meal of an untransformed seed by having a sucrose
to raffinose family oligosaccharide ratio of 1.0 or less.
Preferably, the seed is a soybean seed.
[0214] Soybeans can be processed into a number of products. For
example, "soy protein products" can include, and are not limited
to, those items listed in Table A. "Soy protein products".
TABLE-US-00002 TABLE A Soy Protein Products Derived from Soybean
Seeds.sup.a Processed Soy Protein Products Whole Soybean Products
Roasted Soybeans Full Fat and Defatted Flours Baked Soybeans Soy
Grits Soy Sprouts Soy Hypocotyls Soy Milk Soybean Meal Soy Milk Soy
Protein Isolates Specialty Soy Foods/Ingredients Soy Milk Soy
Protein Concentrates Tofu Textured Soy Proteins Tempeh Textured
Flours and Concentrates Miso Textured Concentrates Soy Sauce
Textured Isolates Hydrolyzed Vegetable Protein Whipping Protein
.sup.aSee Soy Protein Products: Characteristics, Nutritional
Aspects and Utilization (1987). Soy Protein Council.
[0215] "Processing" refers to any physical and chemical methods
used to obtain the products listed in Table A and includes, and is
not limited to, heat conditioning, flaking and grinding, extrusion,
solvent extraction, or aqueous soaking and extraction of whole or
partial seeds. Furthermore, "processing" includes the methods used
to concentrate and isolate soy protein from whole or partial seeds,
as well as the various traditional Oriental methods in preparing
fermented soy food products. Trading Standards and Specifications
have been established for many of these products (see National
Oilseed Processors Association Yearbook and Trading Rules
1991-1992).
[0216] "White" flakes refer to flaked, dehulled cotyledons that
have been defatted and treated with controlled moist heat to have a
PDI (ASCS: ba10-65) of about 85 to 90. This term can also refer to
a flour with a similar PDI that has been ground to pass through a
No. 100 U.S. Standard Screen size.
[0217] "Grits" refer to defatted, dehulled cotyledons having a U.S.
Standard screen size of between No. 10 and 80.
[0218] "Soy Protein Concentrates" refer to those products produced
from dehulled, defatted soybeans by three basic processes: acid
leaching (at about pH 4.5), extraction with alcohol (about 55-80%),
and denaturing the protein with moist heat prior to extraction with
water. Conditions typically used to prepare soy protein
concentrates have been described by Pass ((1975) U.S. Pat. No.
3,897,574; Campbell et al., (1985) in New Protein Foods, ed. by
Altschul and Wilcke, Academic Press, Vol. 5, Chapter 10, Seed
Storage Proteins, pp 302-338).
[0219] "Extrusion" refers to processes whereby material (grits,
flour or concentrate) is passed through a jacketed auger using high
pressures and temperatures as a means of altering the texture of
the material. "Texturing" and "structuring" refer to extrusion
processes used to modify the physical characteristics of the
material. The characteristics of these processes, including
thermoplastic extrusion, have been described previously (Atkinson
(1970) U.S. Pat. No. 3,488,770, Horan (1985) In New Protein Foods,
ed. by Altschul and Wilcke, Academic Press, Vol. 1A, Chapter 8, pp
367-414). Moreover, conditions used during extrusion processing of
complex foodstuff mixtures that include soy protein products have
been described previously (Rokey (1983) Feed Manufacturing
Technology III, 222-237; McCulloch, U.S. Pat. No. 4,454,804).
[0220] In another embodiment, this invention concerns a method for
suppressing the level of expression of a gene encoding a
polypeptide having ADP-glucose pyrophosphorylase activity in a
transgenic plant, wherein the method comprises: [0221] (a)
transforming a plant cell with a fragment SEQ ID NOs:24, 28 or 30,
or their complement; [0222] (b) regenerating a transgenic plant
from the transformed plant cell of (a); and [0223] (c) selecting a
transgenic plant wherein the level of expression of a gene encoding
a polypeptide having ADP-glucose pyrophosphorylase activity has
been suppressed.
[0224] Preferably, the plant is a soybean plant.
[0225] In another embodiment, the invention concerns a recombinant
DNA construct comprising: (a) all or part of the nucleotide
sequence set forth in SEQ ID NOs:24, 28 or 30; or (b) the
complement of (a); wherein (a) or (b) is useful in co-suppression
or antisense suppression of endogenous ADP-glucose
pyrophosphorylase activity in a transgenic plant.
[0226] In another embodiment, the invention concerns a method for
producing transgenic seed, the method comprising: [0227] (a)
transforming a plant cell with the recombinant DNA construct of:
[0228] (i) all or part of the nucleotide sequence set forth in SEQ
ID NO:24, 28 or 30; or [0229] (ii) the complement of (i); [0230]
wherein (i) or (ii) is useful in co-suppression or antisense
suppression of endogenous ADP-glucose pyrophosphorylase activity in
a transgenic plant; [0231] (b) regenerating a transgenic plant from
the transformed plant cell of (a); and [0232] (c) selecting a
transgenic plant that produces a transgenic seed having an increase
in the combined oil and protein content of at least 1.6% and a
decrease in the sucrose content of at least 25% as compared to seed
obtained from a non-transgenic plant.
[0233] Preferably, the seed is a soybean seed.
[0234] In another embodiment, the invention concerns a method for
producing transgenic seed, the method comprising: [0235] (a)
transforming a plant cell with a recombinant DNA construct
comprising [0236] (i) all or part of the nucleotide sequence set
forth in SEQ ID NOs:24, 28 or 30; or [0237] (ii) the complement of
(i); [0238] wherein (i) or (ii) is useful in co-suppression or
antisense suppression of endogenous ADP-glucose pyrophosphorylase
activity in a transgenic plant; [0239] (b) regenerating a
transgenic plant from the transformed plant cell of (a); and [0240]
(c) selecting a transgenic plant that produces a transgenic seed
having a sucrose to raffinose family oligosaccharide ratio of 1.0
or less as compared to seed obtained from a non-transgenic
plant.
[0241] Preferably, the transgenic seed differs from an
untransformed seed by having an increase in the combined oil and
protein content of at least 1.6%, 1.8% or 2.0%. Preferably, the
seed is a soybean seed.
[0242] In another embodiment, the invention concerns a method for
producing defatted meal from transgenic seed, comprising: [0243]
(a) transforming a plant cell with a recombinant DNA construct
comprising [0244] (i) all or part of the nucleotide sequence set
forth in SEQ ID NOs:24, 28 or 30; or [0245] (ii) the complement of
(i); [0246] wherein (i) or (ii) is useful in co-suppression or
antisense suppression of endogenous ADP-glucose pyrophosphorylase
activity in a transgenic plant; [0247] (b) regenerating a
transgenic plant from the transformed plant cell of (a); and [0248]
(c) selecting a transgenic plant that produces a transgenic seed
wherein said seed is processed into defatted meal having an
increase in the combined oil and protein content of at least 5% and
a decrease in the sucrose content of at least 25% as compared to
defatted meal obtained from seed of a non-transgenic plant.
[0249] Preferably, the defatted meal of the transgenic seed differs
from the defatted meal of an untransformed seed by having a sucrose
to raffinose family oligosaccharide ratio of 1.0 or less.
Preferably, the seed is a soybean seed.
[0250] In a another embodiment, the invention concerns a transgenic
seed produced by any of the above methods. Preferably, the seed is
a soybean seed.
[0251] Regulatory sequences may include, and are not limited to,
promoters, translation leader sequences, introns, and
polyadenylation recognition sequences.
[0252] "Tissue-specific" promoters direct RNA production
preferentially in particular types of cells or tissues. Promoters
which cause a gene to be expressed in most cell types at most times
are commonly referred to as "constitutive promoters". New promoters
of various types useful in plant cells are constantly being
discovered; numerous examples may be found in the compilation by
Okamuro and Goldberg (Biochemistry of Plants 15:1-82 (1989)). It is
further recognized that since in most cases the exact boundaries of
regulatory sequences have not been completely defined, DNA
fragments of some variation may have identical promoter
activity.
[0253] A number of promoters can be used to practice the present
invention. The promoters can be selected based on the desired
outcome. The nucleic acids can be combined with constitutive,
tissue-specific (preferred), inducible, or other promoters for
expression in the host organism. Suitable constitutive promoters
for use in a plant host cell include, for example, the core
promoter of the Rsyn7 promoter and other constitutive promoters
disclosed in WO 99/43838 and U.S. Pat. No. 6,072,050; the core CaMV
35S promoter (Odell et al., Nature 313:810-812 (1985)); rice actin
(McElroy et al., Plant Cell 2:163-171 (1990)); ubiquitin
(Christensen et al., Plant Mol. Biol. 12:619-632 (1989) and
Christensen et al., Plant Mol. Biol. 18:675-689 (1992)); pEMU (Last
et al., Theor. Appl. Genet. 81:581-588 (1991)); MAS (Velten et al.,
EMBO J. 3:2723-2730 (1984)); ALS promoter (U.S. Pat. No.
5,659,026), and the like. Other constitutive promoters include, for
example, those discussed in U.S. Pat. Nos. 5,608,149; 5,608,144;
5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; 5,608,142;
and 6,177,611.
[0254] In choosing a promoter to use in the methods of the
invention, it may be desirable to use a tissue-specific or
developmentally regulated promoter. A tissue-specific or
developmentally regulated promoter is a DNA sequence which
regulates the expression of a DNA sequence selectively in
particular cells/tissues of a plant. Any identifiable promoter may
be used in the methods of the present invention which causes the
desired temporal and spatial expression.
[0255] Promoters which are seed or embryo specific and may be
useful in the invention include patatin (potato tubers)
(Rocha-Sosa, M., et al. (1989) EMBO J. 8:23-29), convicilin,
vicilin, and legumin (pea cotyledons) (Rerie, W. G., et al. (1991)
Mol. Gen. Genet. 259:149-157; Newbigin, E. J., et al. (1990) Planta
180:461-470; Higgins, T. J. V., et al. (1988) Plant. Mol. Biol.
11:683-695), zein (maize endosperm) (Schemthaner, J. P., et al.
(1988) EMBO J. 7:1249-1255), phaseolin (bean cotyledon)
(Segupta-Gopalan, C., et al. (1985) Proc. Natl. Acad. Sci. U.S.A.
82:3320-3324), phytohemagglutinin (bean cotyledon) (Voelker, T. et
al. (1987) EMBO J. 6:3571-3577), B-conglycinin and glycinin
(soybean cotyledon) (Chen, Z-L, et al. (1988) EMBO J. 7:297-302),
glutelin (rice endosperm), hordein (barley endosperm) (Marris, C.,
et al. (1988) Plant Mol. Biol. 10:359-366), glutenin and gliadin
(wheat endosperm) (Colot, V., et al. (1987) EMBO J. 6:3559-3564),
and sporamin (sweet potato tuberous root) (Hattori, T., et al.
(1990) Plant Mol. Biol. 14:595-604). Promoters of seed-specific
genes operably linked to heterologous coding regions in chimeric
gene constructions maintain their temporal and spatial expression
pattern in transgenic plants. Such examples include Arabidopsis
thaliana 2S seed storage protein gene promoter to express
enkephalin peptides in Arabidopsis and Brassica napus seeds
(Vanderkerckhove et al., Bio/Technology 7:L929-932 (1989)), bean
lectin and bean beta-phaseolin promoters to express luciferase
(Riggs et al., Plant Sci. 63:47-57 (1989)), and wheat glutenin
promoters to express chloramphenicol acetyl transferase (Colot et
al., EMBO J. 6:3559-3564 (1987)).
[0256] A plethora of promoters is described in WO 00/18963,
published on Apr. 6, 2000, the disclosure of which is hereby
incorporated by reference. Examples of seed-specific promoters
include, and are not limited to, the promoter for soybean Kunitz
trypsin inhibitor (Kti3, Jofuku and Goldberg, Plant Cell
1:1079-1093 (1989)) .beta.-conglycinin (Chen et al., Dev. Genet.
10:112-122 (1989)), the napin promoter, and the phaseolin
promoter.
[0257] In some embodiments, isolated nucleic acids which serve as
promoter or enhancer elements can be introduced in the appropriate
position (generally upstream) of a non-heterologous form of a
polynucleotide of the present invention so as to up or down
regulate expression of a polynucleotide of the present invention.
For example, endogenous promoters can be altered in vivo by
mutation, deletion, and/or substitution (see, Kmiec, U.S. Pat. No.
5,565,350; Zarling et al., PCT/US93/03868), or isolated promoters
can be introduced into a plant cell in the proper orientation and
distance from a cognate gene of a polynucleotide of the present
invention so as to control the expression of the gene. Gene
expression can be modulated under conditions suitable for plant
growth so as to alter the total concentration and/or alter the
composition of the polypeptides of the present invention in plant
cell. Thus, the present invention includes compositions, and
methods for making, heterologous promoters and/or enhancers
operably linked to a native, endogenous (i.e., non-heterologous)
form of a polynucleotide of the present invention.
[0258] An intron sequence can be added to the 5' untranslated
region or the coding sequence of the partial coding sequence to
increase the amount of the mature message that accumulates in the
cytosol. Inclusion of a spliceable intron in the transcription unit
in both plant and animal expression constructs has been shown to
increase gene expression at both the mRNA and protein levels up to
1000-fold (Buchman and Berg, Mol. Cell. Biol. 8:4395-4405 (1988);
Callis et al., Genes Dev. 1:1183-1200 (1987)). Such intron
enhancement of gene expression is typically greatest when placed
near the 5' end of the transcription unit. Use of maize introns
Adh1-S intron 1, 2, and 6, the Bronze-1 intron are known in the
art. See generally, The Maize Handbook, Chapter 116, Freeling and
Walbot, Eds., Springer, New York (1994). A vector comprising the
sequences from a polynucleotide of the present invention will
typically comprise a marker gene which confers a selectable
phenotype on plant cells. Typical vectors useful for expression of
genes in higher plants are well known in the art and include
vectors derived from the tumor-inducing (Ti) plasmid of
Agrobacterium tumefaciens described by Rogers et al., Meth. in
Enzymol. 153:253-277 (1987).
[0259] If polypeptide expression is desired, it is generally
desirable to include a polyadenylation region at the 3'-end of a
polynucleotide coding region. The polyadenylation region can be
derived from the natural gene, from a variety of other plant genes,
or from T-DNA. The 3' end sequence to be added can be derived from,
for example, the nopaline synthase or octopine synthase genes, or
alternatively from another plant gene, or less preferably from any
other eukaryotic gene.
[0260] Preferred recombinant DNA constructs include the following
combinations: a) a nucleic acid fragment corresponding to a
promoter operably linked to at least one nucleic acid fragment
encoding a selectable marker, followed by a nucleic acid fragment
corresponding to a terminator, b) a nucleic acid fragment
corresponding to a promoter operably linked to a nucleic acid
fragment capable of producing a stem-loop structure, and followed
by a nucleic acid fragment corresponding to a terminator, and c)
any combination of a) and b) above. Preferably, in the stem-loop
structure at least one nucleic acid fragment that is capable of
suppressing expression of a native gene comprises the "loop" and is
surrounded by nucleic acid fragments capable of producing a
stem.
[0261] Preferred methods for transforming dicots and obtaining
transgenic plants have been published, among others, for cotton
(U.S. Pat. No. 5,004,863, U.S. Pat. No. 5,159,135); soybean (U.S.
Pat. No. 5,569,834, U.S. Pat. No. 5,416,011); Brassica (U.S. Pat.
No. 5,463,174); peanut (Cheng et al. (1996) Plant Cell Rep.
15:653-657, McKently et al. (1995) Plant Cell Rep. 14:699-703);
papaya (Ling, K. et al. (1991) Bio/technology 9:752-758); and pea
(Grant et al. (1995) Plant Cell Rep. 15:254-258). For a review of
other commonly used methods of plant transformation see Newell, C.
A. (2000) Mol. Biotechnol. 16:53-65. One of these methods of
transformation uses Agrobacterium rhizogenes (Tepfler, M. and
Casse-Delbart, F. (1987) Microbiol. Sci. 4:24-28). Transformation
of soybeans using direct delivery of DNA has been published using
PEG fusion (PCT publication WO 92/17598), electroporation
(Chowrira, G. M. et al. (1995) Mol. Biotechnol. 3:17-23; Christou,
P. et al. (1987) Proc. Natl. Acad. Sci. U.S.A. 84:3962-3966),
microinjection, or particle bombardment (McCabe, D. E. et. Al.
(1988) Bio/Technology 6:923; Christou et al. (1988) Plant Physiol.
87:671-674).
[0262] There are a variety of methods for the regeneration of
plants from plant tissue. The particular method of regeneration
will depend on the starting plant tissue and the particular plant
species to be regenerated. The regeneration, development and
cultivation of plants from single plant protoplast transformants or
from various transformed explants are well known in the art
(Weissbach and Weissbach, (1988) In.: Methods for Plant Molecular
Biology, (Eds.), Academic Press, Inc., San Diego, Calif.). This
regeneration and growth process typically includes the steps of
selection of transformed cells, culturing those individualized
cells through the usual stages of embryonic development through the
rooted plantlet stage. Transgenic embryos and seeds are similarly
regenerated. The resulting transgenic rooted shoots are thereafter
planted in an appropriate plant growth medium such as soil. The
regenerated plants may be self-pollinated. Otherwise, pollen
obtained from the regenerated plants is crossed to seed-grown
plants of agronomically important lines. Conversely, pollen from
plants of these important lines is used to pollinate regenerated
plants. A transgenic plant of the present invention containing a
desired polypeptide(s) is cultivated using methods well known to
one skilled in the art.
[0263] In addition to the above discussed procedures, practitioners
are familiar with the standard resource materials which describe
specific conditions and procedures for the construction,
manipulation and isolation of macromolecules (e.g., DNA molecules,
plasmids, etc.), generation of recombinant DNA fragments and
recombinant expression constructs and the screening and isolating
of clones, (see for example, Sambrook et al. (1989) Molecular
Cloning: A Laboratory Manual, Cold Spring Harbor Press; Maliga et
al. (1995) Methods in Plant Molecular Biology, Cold Spring Harbor
Press; Birren et al. (1998) Genome Analysis: Detecting Genes, 1,
Cold Spring Harbor, N.Y.; Birren et al. (1998) Genome Analysis:
Analyzing DNA, 2, Cold Spring Harbor, N.Y.; Plant Molecular
Biology: A Laboratory Manual, eds. Clark, Springer, New York
(1997)).
[0264] Assays to detect proteins may be performed by
SDS-polyacrylamide gel electrophoresis or immunological assays.
Assays to detect levels of substrates or products of enzymes may be
performed using gas chromatography or liquid chromatography for
separation and UV or visible spectrometry or mass spectrometry for
detection, or the like. Determining the levels of mRNA of the
enzyme of interest may be accomplished using northern-blotting or
RT-PCR techniques. Once plants have been regenerated, and progeny
plants homozygous for the transgene have been obtained, plants will
have a stable phenotype that will be observed in similar seeds in
later generations.
[0265] In another aspect, this invention includes a polynucleotide
of this invention or a functionally equivalent subfragment thereof
useful in antisense inhibition or cosuppression of expression of
nucleic acid sequences encoding proteins having plastidic
phosphoglucomutase activity, most preferably in antisense
inhibition or cosuppression of an endogenous plastidic
phosphoglucomutase gene.
[0266] Protocols for antisense inhibition or co-suppression are
well known to those skilled in the art.
[0267] Cosuppression constructs in plants have been previously
designed by focusing on overexpression of a nucleic acid sequence
having homology to a native mRNA, in the sense orientation, which
results in the reduction of all RNA having homology to the
overexpressed sequence (see Vaucheret et al. (1998) Plant J.
16:651-659; and Gura (2000) Nature 404:804-808). Another variation
describes the use of plant viral sequences to direct the
suppression of proximal mRNA encoding sequences (PCT Publication WO
98/36083 published on Aug. 20, 1998). Recent work has described the
use of "hairpin" structures that incorporate all, or part, of an
mRNA encoding sequence in a complementary orientation that results
in a potential "stem-loop" structure for the expressed RNA (PCT
Publication WO 99/53050 published on Oct. 21, 1999). In this case
the stem is formed by polynucleotides corresponding to the gene of
interest inserted in either sense or anti-sense orientation with
respect to the promoter and the loop is formed by some
polynucleotides of the gene of interest, which do not have a
complement in the construct. This increases the frequency of
cosuppression or silencing in the recovered transgenic plants. For
review of hairpin suppression see Wesley, S. V. et al. (2003)
Methods in Molecular Biology, Plant Functional Genomics: Methods
and Protocols 236:273-286. A construct where the stem is formed by
at least 30 nucleotides from a gene to be suppressed and the loop
is formed by a random nucleotide sequence has also effectively been
used for suppression (WO 99/61632 published on Dec. 2, 1999). The
use of poly-T and poly-A sequences to generate the stem in the
stem-loop structure has also been described (WO 02/00894 published
Jan. 3, 2002). Yet another variation includes using synthetic
repeats to promote formation of a stem in the stem-loop structure.
Transgenic organisms prepared with such recombinant DNA fragments
have been shown to have reduced levels of the protein encoded by
the nucleotide fragment forming the loop as described in PCT
Publication WO 02/00904, published 3 Jan. 2002.
[0268] The sequences of the polynucleotide fragments used for
suppression do not have to be 100% identical to the sequences of
the polynucleotide fragment found in the gene to be suppressed. For
example, suppression of all the subunits of the soybean seed
storage protein R-conglycinin has been accomplished using a
polynucleotide derived from a portion of the gene encoding the
.alpha. subunit (U.S. Pat. No. 6,362,399). .beta.-conglycinin is a
heterogeneous glycoprotein composed of varying combinations of
three highly negatively charged subunits identified as .alpha.,
.alpha.' and .beta.. The polynucleotide sequences encoding the
.alpha. and .alpha.' subunits are 85% identical to each other while
the polynucleotide sequences encoding the .beta. subunit are 75 to
80% identical to the .alpha. and .alpha.' subunits, respectively.
Thus, polynucleotides that are at least 75% identical to a region
of the polynucleotide that is target for suppression have been
shown to be effective in suppressing the desired target. The
polynucleotide may be at least 80% identical, at least 90%
identical, at least 95% identical, or about 100% identical to the
desired target sequence.
[0269] The isolated nucleic acids and proteins and any embodiments
of the present invention can be used over a broad range of plant
types, particularly dicots such as the species of the genus
Glycine.
[0270] It is believed that the nucleic acids and proteins and any
embodiments of the present invention can be with monocots as well
including, but not limited to, Graminiae including Sorghum bicolor
and Zea mays.
[0271] The isolated nucleic acid and proteins of the present
invention can also be used in species from the following dicot
genera: Cucurbita, Rosa, Vitis, Juglans, Fragaria, Lotus, Medicago,
Onobrychis, Trifolium, Trigonella, Vigna, Citrus, Linum, Geranium,
Manihot, Daucus, Arabidopsis, Brassica, Raphanus, Sinapis, Atropa,
Capsicum, Datura, Hyoscyamus, Lycopersicon, Nicotiana, Solanum,
Petunia, Digitalis, Majorana, Cichorium, Helianthus, Lactuca,
Antirrhinum, Pelargonium, Ranunculus, Senecio, Salpiglossis,
Cucumis, Browallia, Glycine, Pisum, Phaseolus, and from the
following monocot genera: Bromus, Asparagus, Hemerocallis, Panicum,
Pennisetum, Lolium, Oryza, Avena, Hordeum, Secale, Triticum,
Bambusa, Dendrocalamus, and Melocanna.
EXAMPLES
[0272] The present invention is further illustrated in the
following Examples, in which parts and percentages are by weight
and degrees are Celsius, unless otherwise stated. It should be
understood that these Examples, while indicating preferred
embodiments of the invention, are given by way of illustration
only. From the above discussion and these Examples, one skilled in
the art can ascertain the essential characteristics of this
invention, and without departing from the spirit and scope thereof,
can make various changes and modifications of the invention to
adapt it to various usages and conditions. Thus, various
modifications of the invention in addition to those shown and
described herein will be apparent to those skilled in the art from
the foregoing description. Such modifications are also intended to
fall within the scope of the appended claims.
Example 1
Composition of cDNA Libraries; Isolation and Sequencing of cDNA
Clones
[0273] cDNA libraries representing mRNAs from various cattail,
corn, rice and soybean tissues were prepared. The characteristics
of the libraries are described below.
TABLE-US-00003 TABLE 2 cDNA Libraries from Cattail, Corn, Rice and
Soybean Library Tissue Clone etr1c Cattail (Typha latifolia) root
etr1c.pk005.f8 p0075 Corn, root/leaf material from dark-grown
p0075.cslaf22f 7 day old Seedlings p0075.cslaf22rb p0128 Corn,
pooled primary and secondary p0128.cpicz81r immature ear rdi1c Rice
(Oryza sativa, Nipponbare) developing rdi1c.pk001.a22 inflorescence
at mitotic stage rth1c Rice leaf inoculated with Magnaporta grisea
rth1c.pk009.k14f sdp3c Soybean developing pods 8-9 mm
sdp3c.pk003.e22 ses4d Soybean embryogenic suspension 4 days
ses4d.pk0018.d10 after subculture sdp2c Soybean developing pods 6-7
mm sdp2c.pk008.m2 ssm Soybean shoot meristem ssm.pk0072.e7 ssl
Soybean seedling 5-10 day ssl.pk0021.h3 sgs4c Soybean seeds 2 days
after germination sgs4c.pk005.b10
[0274] cDNA libraries may be prepared by any one of many methods
available. For example, the cDNAs may be introduced into plasmid
vectors by first preparing the cDNA libraries in Uni-ZAP.TM. XR
vectors according to the manufacturer's protocol (Stratagene
Cloning Systems, La Jolla, Calif.). The Uni-ZAP.TM. XR libraries
are converted into plasmid libraries according to the protocol
provided by Stratagene. Upon conversion, cDNA inserts will be
contained in the plasmid vector pBluescript. In addition, the cDNAs
may be introduced directly into precut Bluescript II SK(+) vectors
(Stratagene) using T4 DNA ligase (New England Biolabs), followed by
transfection into DH10B cells according to the manufacturer's
protocol (GIBCO BRL Products). Once the cDNA inserts are in plasmid
vectors, plasmid DNAs are prepared from randomly picked bacterial
colonies containing recombinant pBluescript plasmids, or the insert
cDNA sequences are amplified via polymerase chain reaction using
primers specific for vector sequences flanking the inserted cDNA
sequences. Amplified insert DNAs or plasmid DNAs are sequenced in
dye-primer sequencing reactions to generate partial cDNA sequences
(expressed sequence tags or "ESTs"; see Adams et al., (1991)
Science 252:1651-1656). The resulting ESTs are analyzed using a
Perkin Elmer Model 377 fluorescent sequencer.
Example 2
Identification of cDNA Clones
[0275] cDNA clones encoding plastidic phosphoglucomutase proteins
were identified by conducting BLAST (Basic Local Alignment Search
Tool; Altschul et al. (1993) J. Mol. Biol. 215:403-410) searches
for similarity to sequences contained in the BLAST "nr" database
(comprising all non-redundant GenBank CDS translations, sequences
derived from the 3-dimensional structure Brookhaven Protein Data
Bank, the last major release of the SWISS-PROT protein sequence
database, EMBL, and DDBJ databases). The cDNA sequences obtained in
Example 1 were analyzed for similarity to all publicly available
DNA sequences contained in the "nr" database using the BLASTN
algorithm provided by the National Center for Biotechnology
Information (NCBI). The DNA sequences were translated in all
reading frames and compared for similarity to all publicly
available protein sequences contained in the "nr" database using
the BLASTX algorithm (Gish and States (1993) Nat. Genet. 3:266-272)
provided by the NCBI. For convenience, the P-value (probability) of
observing a match of a cDNA sequence to a sequence contained in the
searched databases merely by chance as calculated by BLAST are
reported herein as "pLog" values, which represent the negative of
the logarithm of the reported P-value. Accordingly, the greater the
pLog value, the greater the likelihood that the cDNA sequence and
the BLAST "hit" represent homologous proteins.
Example 3
Characterization of cDNA Clones Encoding Plastidic
Phosphoglucomutase Proteins
[0276] The BLASTX search using the EST sequences from clones listed
in Table 3 revealed similarity of the polypeptides encoded by the
cDNAs to plastidic phosphoglucomutase from Brassica napus (NCBI
General Identifier No. 6272125) and Pisum sativum (NCBI General
Identifier No. 6272283 and NCBI General Identifier No. 10190529).
Shown in Table 3 are the BLAST results for individual ESTs ("EST"),
the sequences of the entire cDNA inserts comprising the indicated
cDNA clones ("FIS"), contigs assembled from two or more ESTs
("Contig"), contigs assembled from an FIS and one or more ESTs
("Contig*"), or sequences encoding the entire protein derived from
an FIS, a contig, an EST and PCR, or an FIS and PCR ("CGS"):
TABLE-US-00004 TABLE 3 BLAST Results for Sequences Encoding
Polypeptides Homologous to Brassica napus and Pisum sativum
Plastidic Phosphoglucomutase Clone Status BLAST pLog Score
etr1c.pk005.f8 (FIS) CGS >254.00 (GI No. 6272125; B. napus)
Contig Composed of: CGS >254.00 (GI No. 6272283; P. sativum)
p0075.cslaf22f (EST) p0075.cslaf22rb (EST) p0128.cpicz81r (EST)
rth1c.pk009.k14f EST 58.00 (GI No. 6272283; P. sativum) (EST)
sdp3c.pk003.e22 CGS >254.00 (GI No. 6272283; P. sativum) (EST
and PCR Fragments) rdi1c.pk001.a22 (FIS) CGS 180.00 (GI No.
10190529; P. sativum)
[0277] The data in Table 4 represents a calculation of the percent
identity of the amino acid sequences set forth in SEQ ID NOs:2, 4,
6, 8, and 10, and the Brassica napus and Pisum sativum
sequences.
TABLE-US-00005 TABLE 4 Percent Identity of Amino Acid Sequences
Deduced From the Nucleotide Sequences of cDNA Clones Encoding
Polypeptides Homologous to Brassica napus and Pisum sativum
Plastidic Phosphoglucomutase SEQ ID NO. Percent Identity to 2 79%
(GI No. 6272125; B. napus) 4 77% (GI No. 6272283; P. sativum) 6 80%
(GI No. 6272283; P. sativum) 8 90% (GI No. 6272283; P. sativum) 10
76% (GI No. 10190529; P. sativum)
[0278] Sequence alignments and percent identity calculations were
performed using the Megalign program of the LASERGENE
bioinformatics computing suite (DNASTAR Inc., Madison, Wis.).
Multiple alignment of the sequences was performed using the Clustal
method of alignment (Higgins and Sharp (1989) CABIOS. 5:151-153)
with the default parameters (GAP PENALTY=10, GAP LENGTH
PENALTY=10). Default parameters for pairwise alignments using the
Clustal method were KTUPLE 1, GAP PENALTY=3, WINDOW=5 and DIAGONALS
SAVED=5. Sequence alignments, BLAST scores and probabilities
indicate that the nucleic acid fragments comprising the instant
cDNA clones encode a substantial portion of a plastidic
phosphoglucomutase.
Example 4
Expression of Chimeric Genes in Monocot Cells
[0279] A chimeric gene comprising a cDNA encoding the instant
polypeptides in sense orientation with respect to the maize 27 kD
zein promoter that is located 5' to the cDNA fragment, and the 10
kD zein 3' end that is located 3' to the cDNA fragment, can be
constructed. The cDNA fragment of this gene may be generated by
polymerase chain reaction (PCR) of the cDNA clone using appropriate
oligonucleotide primers. Cloning sites (NcoI or SmaI) can be
incorporated into the oligonucleotides to provide proper
orientation of the DNA fragment when inserted into the digested
vector pML103 as described below. Amplification is then performed
in a standard PCR. The amplified DNA is then digested with
restriction enzymes NcoI and SmaI and fractionated on an agarose
gel. The appropriate band can be isolated from the gel and combined
with a 4.9 kb NcoI-SmaI fragment of the plasmid pML103. Plasmid
pML103 has been deposited under the terms of the Budapest Treaty at
ATCC (American Type Culture Collection, 10801 University Blvd.,
Manassas, Va. 20110-2209), and bears accession number ATCC 97366.
The DNA segment from pML103 contains a 1.05 kb SalI-NcoI promoter
fragment of the maize 27 kD zein gene and a 0.96 kb SmaI-SalI
fragment from the 3' end of the maize 10 kD zein gene in the vector
pGem9Zf(+) (Promega). Vector and insert DNA can be ligated at
15.degree. C. overnight, essentially as described (Maniatis). The
ligated DNA may then be used to transform E. coli XL1-Blue
(Epicurian Coli XL-1 Blue.TM.; Stratagene). Bacterial transformants
can be screened by restriction enzyme digestion of plasmid DNA and
limited nucleotide sequence analysis using the dideoxy chain
termination method (Sequenase DNA Sequencing Kit; U.S.
Biochemical). The resulting plasmid construct would comprise a
chimeric gene encoding, in the 5' to 3' direction, the maize 27 kD
zein promoter, a cDNA fragment encoding the instant polypeptides,
and the 10 kD zein 3' region.
[0280] The chimeric gene described above can then be introduced
into corn cells by the following procedure. Immature corn embryos
can be dissected from developing caryopses derived from crosses of
the inbred corn lines H99 and LH132. The embryos are isolated 10 to
11 days after pollination when they are 1.0 to 1.5 mm long. The
embryos are then placed with the axis-side facing down and in
contact with agarose-solidified N6 medium (Chu et al. (1975) Sci.
Sin. Peking 18:659-668). The embryos are kept in the dark at
27.degree. C. Friable embryogenic callus consisting of
undifferentiated masses of cells with somatic proembryoids and
embryoids borne on suspensor structures proliferates from the
scutellum of these immature embryos. The embryogenic callus
isolated from the primary explant can be cultured on N6 medium and
sub-cultured on this medium every 2 to 3 weeks.
[0281] The plasmid, p35S/Ac (obtained from Dr. Peter Eckes, Hoechst
Ag, Frankfurt, Germany) may be used in transformation experiments
in order to provide for a selectable marker. This plasmid contains
the Pat gene (see European Patent Publication 0 242 236) which
encodes phosphinothricin acetyl transferase (PAT). The enzyme PAT
confers resistance to herbicidal glutamine synthetase inhibitors
such as phosphinothricin. The pat gene in p35S/Ac is under the
control of the 35S promoter from Cauliflower Mosaic Virus (Odell et
al. (1985) Nature 313:810-812) and the 3' region of the nopaline
synthase gene from the T-DNA of the Ti plasmid of Agrobacterium
tumefaciens.
[0282] The particle bombardment method (Klein et al. (1987) Nature
327:70-73) may be used to transfer genes to the callus culture
cells. According to this method, gold particles (1 .mu.m in
diameter) are coated with DNA using the following technique. Ten
.mu.g of plasmid DNAs are added to 50 .mu.L of a suspension of gold
particles (60 mg per mL). Calcium chloride (50 .mu.L of a 2.5 M
solution) and spermidine free base (20 .mu.L of a 1.0 M solution)
are added to the particles. The suspension is vortexed during the
addition of these solutions. After 10 minutes, the tubes are
briefly centrifuged (5 sec at 15,000 rpm) and the supernatant
removed. The particles are resuspended in 200 .mu.L of absolute
ethanol, centrifuged again and the supernatant removed. The ethanol
rinse is performed again and the particles resuspended in a final
volume of 30 .mu.L of ethanol. An aliquot (5 .mu.L) of the
DNA-coated gold particles can be placed in the center of a
Kapton.TM. flying disc (Bio-Rad Labs). The particles are then
accelerated into the corn tissue with a Biolistic.TM. PDS-1000/He
(Bio-Rad Instruments, Hercules Calif.), using a helium pressure of
1000 psi, a gap distance of 0.5 cm and a flying distance of 1.0
cm.
[0283] For bombardment, the embryogenic tissue is placed on filter
paper over agarose-solidified N6 medium. The tissue is arranged as
a thin lawn and covered a circular area of about 5 cm in diameter.
The petri dish containing the tissue can be placed in the chamber
of the PDS-1000/He approximately 8 cm from the stopping screen. The
air in the chamber is then evacuated to a vacuum of 28 inches of
Hg. The macrocarrier is accelerated with a helium shock wave using
a rupture membrane that bursts when the He pressure in the shock
tube reaches 1000 psi.
[0284] Seven days after bombardment the tissue can be transferred
to N6 medium that contains glufosinate (2 mg per liter) and lacks
casein or proline. The tissue continues to grow slowly on this
medium. After an additional 2 weeks the tissue can be transferred
to fresh N6 medium containing glufosinate. After 6 weeks, areas of
about 1 cm in diameter of actively growing callus can be identified
on some of the plates containing the glufosinate-supplemented
medium. These calli may continue to grow when sub-cultured on the
selective medium.
[0285] Plants can be regenerated from the transgenic callus by
first transferring clusters of tissue to N6 medium supplemented
with 0.2 mg per liter of 2,4-D. After two weeks the tissue can be
transferred to regeneration medium (Fromm et al. (1990)
Bio/Technology 8:833-839).
Example 5
Expression of Chimeric Genes in Dicot Cells
[0286] A seed-specific construct composed of the promoter and
transcription terminator from the gene encoding the subunit of the
seed storage protein phaseolin from the bean Phaseolus vulgaris
(Doyle et al. (1986) J. Biol. Chem. 261:9228-9238) can be used for
expression of the instant polypeptides in transformed soybean. The
phaseolin construct includes about 500 nucleotides upstream (5')
from the translation initiation codon and about 1650 nucleotides
downstream (3') from the translation stop codon of phaseolin.
Between the 5' and 3' regions are the unique restriction
endonuclease sites Nco I (which includes the ATG translation
initiation codon), Sma I, Kpn I and Xba I. The entire construct is
flanked by Hind III sites.
[0287] The cDNA fragment of this gene may be generated by
polymerase chain reaction (PCR) of the cDNA clone using appropriate
oligonucleotide primers. Cloning sites can be incorporated into the
oligonucleotides to provide proper orientation of the DNA fragment
when inserted into the expression vector. Amplification is then
performed as described above, and the isolated fragment is inserted
into a pUC18 vector carrying the seed construct.
[0288] Soybean embryos may then be transformed with the expression
vector comprising sequences encoding the instant polypeptides. To
induce somatic embryos, cotyledons, 3-5 mm in length dissected from
surface sterilized, immature seeds of the soybean cultivar A2872,
can be cultured in the light or dark at 26.degree. C. on an
appropriate agar medium for 6-10 weeks. Somatic embryos which
produce secondary embryos are then excised and placed into a
suitable liquid medium. After repeated selection for clusters of
somatic embryos which multiplied as early, globular staged embryos,
the suspensions are maintained as described below.
[0289] Soybean embryogenic suspension cultures can be maintained in
35 mL of liquid media on a rotary shaker, 150 rpm, at 26.degree. C.
with florescent lights on a 16:8 hour day/night schedule. Cultures
are subcultured every two weeks by inoculating approximately 35 mg
of tissue into 35 mL of liquid medium.
[0290] Soybean embryogenic suspension cultures may then be
transformed by the method of particle gun bombardment (Klein et al.
(1987) Nature (London) 327:70-73, U.S. Pat. No. 4,945,050). A
DuPont Biolistic.TM. PDS1000/HE instrument (helium retrofit) can be
used for these transformations.
[0291] A selectable marker gene which can be used to facilitate
soybean transformation is a chimeric gene composed of the 35S
promoter from Cauliflower Mosaic Virus (Odell et al. (1985) Nature
313:810-812), the hygromycin phosphotransferase gene from plasmid
pJR225 (from E. coli; Gritz et al.(1983) Gene 25:179-188) and the
3' region of the nopaline synthase gene from the T-DNA of the Ti
plasmid of Agrobacterium tumefaciens. The seed construct comprising
the phaseolin 5' region, the fragment encoding the instant
polypeptides and the phaseolin 3' region can be isolated as a
restriction fragment. This fragment can then be inserted into a
unique restriction site of the vector carrying the marker gene.
[0292] To 50 .mu.L of a 60 mg/mL 1 .mu.m gold particle suspension
is added (in order): 5 .mu.L DNA (1 .mu.g/.mu.L), 20 .mu.L
spermidine (0.1 M), and 50 .mu.L CaCl.sub.2 (2.5 M). The particle
preparation is then agitated for three minutes, spun in a microfuge
for 10 seconds and the supernatant removed. The DNA-coated
particles are then washed once in 400 .mu.L 70% ethanol and
resuspended in 40 .mu.L of anhydrous ethanol. The DNA/particle
suspension can be sonicated three times for one second each. Five
.mu.L of the DNA-coated gold particles are then loaded on each
macro carrier disk.
[0293] Approximately 300-400 mg of a two-week-old suspension
culture is placed in an empty 60.times.15 mm petri dish and the
residual liquid removed from the tissue with a pipette. For each
transformation experiment, approximately 5-10 plates of tissue are
normally bombarded. Membrane rupture pressure is set at 1100 psi
and the chamber is evacuated to a vacuum of 28 inches of mercury.
The tissue is placed approximately 3.5 inches away from the
retaining screen and bombarded three times. Following bombardment,
the tissue can be divided in half and placed back into liquid and
cultured as described above.
[0294] Five to seven days post bombardment, the liquid media may be
exchanged with fresh media, and eleven to twelve days post
bombardment with fresh media containing 50 mg/mL hygromycin. This
selective media can be refreshed weekly. Seven to eight weeks post
bombardment, green, transformed tissue may be observed growing from
untransformed, necrotic embryogenic clusters. Isolated green tissue
is removed and inoculated into individual flasks to generate new,
clonally propagated, transformed embryogenic suspension cultures.
Each new line may be treated as an independent transformation
event. These suspensions can then be subcultured and maintained as
clusters of immature embryos or regenerated into whole plants by
maturation and germination of individual somatic embryos.
Example 6
Expression of Chimeric Genes in Microbial Cells
[0295] The cDNAs encoding the instant polypeptides can be inserted
into the T7 E. coli expression vector pBT430. This vector is a
derivative of pET-3a (Rosenberg et al. (1987) Gene 56:125-135)
which employs the bacteriophage T7 RNA polymerase/T7 promoter
system. Plasmid pBT430 was constructed by first destroying the EcoR
I and Hind III sites in pET-3a at their original positions. An
oligonucleotide adaptor containing EcoR I and Hind III sites was
inserted at the BamH I site of pET-3a. This created pET-3aM with
additional unique cloning sites for insertion of genes into the
expression vector. Then, the Nde I site at the position of
translation initiation was converted to an Nco I site using
oligonucleotide-directed mutagenesis. The DNA sequence of pET-3aM
in this region, 5'-CATATGG, was converted to 5'-CCCATGG in
pBT430.
[0296] Plasmid DNA containing a cDNA may be appropriately digested
to release a nucleic acid fragment encoding the protein. This
fragment may then be purified on a 1% NuSieve GTG.TM. low melting
agarose gel (FMC). Buffer and agarose contain 10 .mu.g/mL ethidium
bromide for visualization of the DNA fragment. The fragment can
then be purified from the agarose gel by digestion with GELase.TM.
(Epicentre Technologies) according to the manufacturer's
instructions, ethanol precipitated, dried and resuspended in 20
.mu.L of water. Appropriate oligonucleotide adapters may be ligated
to the fragment using T4 DNA ligase (New England Biolabs, Beverly,
Mass.). The fragment containing the ligated adapters can be
purified from the excess adapters using low melting agarose as
described above. The vector pBT430 is digested, dephosphorylated
with alkaline phosphatase (NEB) and deproteinized with
phenol/chloroform as described above. The prepared vector pBT430
and fragment can then be ligated at 16.degree. C. for 15 hours
followed by transformation into DH5 electrocompetent cells (GIBCO
BRL). Transformants can be selected on agar plates containing LB
media and 100 .mu.g/mL ampicillin. Transformants containing the
gene encoding the instant polypeptides are then screened for the
correct orientation with respect to the T7 promoter by restriction
enzyme analysis.
[0297] For high level expression, a plasmid clone with the cDNA
insert in the correct orientation relative to the T7 promoter can
be transformed into E. coli strain BL21(DE3) (Studier et al. (1986)
J. Mol. Biol. 189:113-130). Cultures are grown in LB medium
containing ampicillin (100 mg/L) at 25.degree. C. At an optical
density at 600 nm of approximately 1, IPTG
(isopropylthio-.beta.-galactoside, the inducer) can be added to a
final concentration of 0.4 mM and incubation can be continued for 3
h at 25.degree. C. Cells are then harvested by centrifugation and
re-suspended in 50 .mu.L of 50 mM Tris-HCl at pH 8.0 containing 0.1
mM DTT and 0.2 mM phenyl methylsulfonyl fluoride. A small amount of
1 mm glass beads can be added and the mixture sonicated 3 times for
about 5 seconds each time with a microprobe sonicator. The mixture
is centrifuged and the protein concentration of the supernatant
determined. One .mu.g of protein from the soluble fraction of the
culture can be separated by SDS-polyacrylamide gel electrophoresis.
Gels can be observed for protein bands migrating at the expected
molecular weight.
Example 7
Transformation of Somatic Soybean Embryo Cultures
[0298] Generic stable soybean transformation protocol:
[0299] Soybean embryogenic suspension cultures are maintained in 35
ml liquid media (SB55 or SBP6) on a rotary shaker, 150 rpm, at
28.degree. C. with mixed fluorescent and incandescent lights on a
16:8 h day/night schedule. Cultures are subcultured every four
weeks by inoculating approximately 35 mg of tissue into 35 ml of
liquid medium.
TABLE-US-00006 TABLE 5 Stock Solutions (g/L): MS Sulfate 100X Stock
MgSO.sub.47H.sub.2O 37.0 MnSO.sub.4H.sub.2O 1.69
ZnSO.sub.47H.sub.2O 0.86 CuSO.sub.45H.sub.2O 0.0025 MS Halides 100X
Stock CaCl.sub.22H.sub.2O 44.0 KI 0.083 CoCl.sub.26H.sub.20 0.00125
KH.sub.2PO.sub.4 17.0 H.sub.3BO.sub.3 0.62
Na.sub.2MoO.sub.42H.sub.2O 0.025 MS FeEDTA 100X Stock Na.sub.2EDTA
3.724 FeSO.sub.47H.sub.2O 2.784 B5 Vitamin Stock 10 g m-inositol
100 mg nicotinic acid 100 mg pyridoxine HCl 1 g thiamine SB55 (per
Liter, pH 5.7) 10 ml each MS stocks 1 ml B5 Vitamin stock 0.8 g
NH.sub.4NO.sub.3 3.033 g KNO.sub.3 1 ml 2,4-D (10 mg/mL stock) 60 g
sucrose 0.667 g asparagine SBP6 same as SB55 except 0.5 ml 2,4-D
SB103 (per Liter, pH 5.7) 1X MS Salts 6% maltose 750 mg MgCl.sub.2
0.2% Gelrite SB71-1 (per Liter, pH 5.7) 1X B5 salts 1 ml B5 vitamin
stock 3% sucrose 750 mg MgCl.sub.2 0.2% Gelrite
[0300] Soybean embryogenic suspension cultures are transformed with
plasmid DNA by the method of particle gun bombardment (Klein et al
(1987) Nature 327:70). A DuPont Biolistic.TM. PDS1000/HE instrument
(helium retrofit) is used for these transformations.
[0301] To 50 ml of a 60 mg/ml 1 .mu.m gold particle suspension is
added (in order); 5 .mu.l DNA(1 .mu.g/.mu.l), 20 .mu.l spermidine
(0.1 M), and 50 .mu.l CaCl.sub.2 (2.5 M). The particle preparation
is agitated for 3 min, spun in a microfuge for 10 sec and the
supernatant removed. The DNA-coated particles are then washed once
in 400 .mu.l 70% ethanol and re suspended in 40 .mu.l of anhydrous
ethanol. The DNA/particle suspension is sonicated three times for 1
sec each. Five .mu.l of the DNA-coated gold particles are then
loaded on each macro carrier disk. For selection, a plasmid
conferring resistance to hygromycin phosphotransferase (HPT) may be
co-bombarded with the silencing construct of interest.
[0302] Approximately 300-400 mg of a four week old suspension
culture is placed in an empty 60.times.15 mm petri dish and the
residual liquid removed from the tissue with a pipette. For each
transformation experiment, approximately 5-10 plates of tissue are
normally bombarded. Membrane rupture pressure is set at 1000 psi
and the chamber is evacuated to a vacuum of 28 inches of mercury.
The tissue is placed approximately 3.5 inches away from the
retaining screen and bombarded three times. Following bombardment,
the tissue is placed back into liquid and cultured as described
above.
[0303] Eleven days post bombardment, the liquid media is exchanged
with fresh SB55 containing 50 mg/ml hygromycin. The selective media
is refreshed weekly. Seven weeks post bombardment, green,
transformed tissue is observed growing from untransformed, necrotic
embryogenic clusters. Isolated green tissue is removed and
inoculated into individual flasks to generate new, clonally
propagated, transformed embryogenic suspension cultures. Thus each
new line is treated as an independent transformation event. These
suspensions can then be maintained as suspensions of embryos
maintained in an immature developmental stage or regenerated into
whole plants by maturation and germination of individual somatic
embryos.
[0304] Independent lines of transformed embryogenic clusters are
removed from liquid culture and placed on a solid agar media
(SB103) containing no hormones or antibiotics. Embryos are cultured
for four weeks at 26.degree. C. with mixed fluorescent and
incandescent lights on a 16:8 h day/night schedule. During this
period, individual embryos are removed from the clusters and
screened for alterations in gene expression.
[0305] It should be noted that any detectable phenotype, resulting
from the co-suppression of a target gene, can be screened at this
stage. This would include, but not be limited to, alterations in
protein content, carbohydrate content, growth rate, viability, or
the ability to develop normally into a soybean plant.
Example 8
Plasmid DNAs for "Complementary Region" Co-Suppression
[0306] The plasmids used in these experiments were made using
standard cloning methods well known to those skilled in the art
(Sambrook et al (1989) Molecular Cloning, CSHL Press, New York). A
starting plasmid pKS18HH (U.S. Pat. No. 5,846,784 the contents of
which are hereby incorporated by reference) contains a hygromycin B
phosphotransferase (HPT) obtained from E. coli strain W677 under
the control of a T7 promoter and the 35S cauliflower mosaic virus
promoter. Plasmid pKS18HH thus contains the T7 promoter/HPT/T7
terminator cassette for expression of the HPT enzyme in certain
strains of E. coli such as NovaBlue(DE3) [from Novagen], that are
lysogenic for lambda DE3 (which carries the T7 RNA Polymerase gene
under lacV5 control). Plasmid pKS18HH also contains the 35S/HPT/NOS
cassette for constitutive expression of the HPT enzyme in plants,
such as soybean. These two expression systems allow selection for
growth in the presence of hygromycin to be used as a means of
identifying cells that contain the plasmid in both bacterial and
plant systems. pKS18HH also contains three unique restriction
endonuclease sites suitable for the cloning other chimeric genes
into this vector. Plasmid ZBL100 (PCT Application No. WO 00/11176
published on Mar. 2, 2000) is a derivative of pKS18HH with a
reduced NOS 3' terminator. Plasmid pKS67 is a ZBL100 derivative
with the insertion of a beta-conglycinin promoter, in front of a
NotI cloning site, followed by a phaseolin 3' terminator (described
in PCT Application No. WO 94/11516, published on May 26, 1994).
[0307] The 2.5 kb plasmid pKS17 contains pSP72 (obtained from
Promega Biosystems) and the T7 promoter/HPT/T7 3' terminator
region, and is the original vector into which the 3.2 kb BamHI-SalI
fragment containing the 35S/HPT/NOS cassette was cloned to form
pKS18HH. The plasmid pKS102 is a pKS17 derivative that is digested
with XhoI and SalI, treated with mung-bean nuclease to generate
blunt ends, and ligated to insert the following linker:
TABLE-US-00007 GGCGCGCCAAGCTTGGATCCGTCGACGGCGCGCC SEQ ID NO: 18
[0308] The plasmid pKS83 has the 2.3 kb BamHI fragment of ML70
containing the Kti3 promoter/NotI/Kti3 3' terminator region
(described in PCT Application No. WO 94/11516, published on May 26,
1994) ligated into the BamHI site of pKS17.
Example 9
Suppression by ELVISLIVES Complementary Region
[0309] Constructs have now been made which have "synthetic
complementary regions" (SCR). In this example the target sequence
is placed between complementary sequences that are not known to be
part of any biologically derived gene or genome (i.e. sequences
that are "synthetic" or conjured up from the mind of the inventor).
The target DNA would therefore be in the sense or antisense
orientation and the complementary RNA would be unrelated to any
known nucleic acid sequence. It is possible to design a standard
"suppression vector" into which pieces of any target gene for
suppression could be dropped. The plasmids pKS106, pKS124, and
pKS133 (SEQ ID NO:17) exemplify this. One skilled in the art will
appreciate that all of the plasmid vectors contain antibiotic
selection genes such as, but not limited to, hygromycin
phosphotransferase with promoters such as the T7 inducible
promoter.
[0310] pKS106 uses the beta-conglycinin promoter while the pKS124
and pKS133 plasmids use the Kti promoter, both of these promoters
exhibit strong tissue specific expression in the seeds of soybean.
pKS106 uses a 3' termination region from the phaseolin gene, and
pKS124 and pKS133 use a Kti 3' termination region. pKS106 and
pKS124 have single copies of the 36 nucleotide EagI-ELVISLIVES
sequence surrounding a NotI site (the amino acids given in
parentheses are back-translated from the complementary strand): SEQ
ID NO:19
TABLE-US-00008 EagIE L V I S L I V E S NotI CGGCCG GAG CTG GTC ATC
TCG CTC ATC GTC GAG TCG GCGGCCGC (S) (E) (V) (I) (L) (S) (I) (V)
(L) (E) EagI CGA CTC GAC GAT GAG CGA GAT GAC CAG CTC CGGCCG
pKS133 has 2.times. copies of ELVISLIVES surrounding the NotI site:
SEQ ID NO:20
TABLE-US-00009 EagI E L V I S L I V E S EagI E L V I S
cggccggagctggtcatctcgctcatcgtcgagtcg gcggccg gag ctggtcatctcg L I V
E S NotI (S)(E (V)(I)(L)(S)(I)(V)(L)(E) ctcatcgtcgagtcg gcggccgc
cgactcgacgatgagcgagat EagI gaccagctc cggccgc
(S)(E)(V)(I)(L)(S)(I)(V)(L)(E)EagI cgactcgacgatgagcgagatgaccagctc
cggccg
[0311] The idea is that the single EL linker (SCR) can be
duplicated to increase stem lengths in increments of approximately
40 nucleotides. A series of vectors will cover the SCR lengths
between 40 bp and the 300 bp. Various target gene lengths are also
under evaluation. It is believed that certain combinations of
target lengths and complementary region lengths will give optimum
suppression of the target, although preliminary results would
indicate that the suppression phenomenon works well over a wide
range of sizes and sequences. It is also believed that the lengths
and ratios providing optimum suppression may vary somewhat given
different target sequences and/or complementary regions.
[0312] The plasmid pKS106 is made by putting the EagI fragment of
ELVISLIVES (SEQ ID NO:19) into the NotI site of pKS67. The
ELVISLIVES fragment is made by PCR using two primers and no other
DNA:
TABLE-US-00010 SEQ ID NO: 21
5'-GAATTCCGGCCGGAGCTGGTCATCTCGCTCATCGTCGAGTC
GGCGGCCGCCGACTCGACGATGAGCGAGATGACCAGCTCCGGCC GGAATTC-3' SEQ ID NO:
22 5'-GAATTCCGGCCGGAG-3'
[0313] The product of the PCR reaction is digested with EagI
(5'-CGGCCG-3') and then ligated into NotI digested pKS67. The term
"ELVISLIVES" and "EL" are used interchangeably herein.
[0314] Additional plasmids can be used to test this example. For
example, pKS121 contains the Kti3 promoter/NotI/Kti3 3' terminator
fragment analogous to pKS83 inserted into the BamHI-SalI digested
pKS102. The EagI digested ELVISLIVES cloning site made from SEQ ID
NOs:14 and 15 is inserted into the NotI site of pKS121 to form
pKS124. The EagI digested EL PCR product can be ligated into NotI
digested pKS124 to form the 2XEL plasmid, pKS133 (SEQ ID NO:17),
containing two copies of ELVISLIVES. An additional 2XEL vector,
pKS151, is similar to pKS133 except for the addition of a second
hygromycin phosphotransferase gene with a 35S-CaMV promoter. Any
synthetic sequence, or naturally occurring sequence, can be used in
an analogous manner. The addition of a 574 base pair NotI fragment
(SEQ ID NO:14) into a NotI-digested pKS133 produces pTC103. The 574
base pair Not I fragment (SEQ ID NO:14) contains a 541 base pair
region (SEQ ID NO:15) of the soybean plastid phosphoglucomutase
coding region (SEQ ID NO:8).
Example 10
Down Regulation of Plastidic Phosphoglucomutase in Soybean
[0315] Soybean was transformed with the plasmid DNA, pTC103, and
transgenic lines were selected. Transgenic lines were screened for
down regulation of plastidic phosphoglucomutase in soybean. The
screening assay involved iodine staining for the presence or
absence of starch in immature seeds (mid-pod stage). The method
involved harvesting half of the seed, and putting that seed on dry
ice and storing at -80 C. The other half of the seed was placed in
100% ethanol overnight, and subsequently stained with water:lugol
(4:1) solution for 10 to 30 minutes at room temperature. Lugol is
an iodine/potassium iodide solution, commercially available from
Sigma.
[0316] Four out of nineteen events showed a clear reduction in
iodine staining indicating a reduction in starch content. This may
reflect a 21% cosuppression success with the hairpin construct.
Three additional events showed potential reduction in iodine
staining, although the differences in staining were subtle. The
segregation patterns of events 100-2-1 and 108-3-1 are consistent
with a theoretical segregation of a dominant co-suppression
(1:3).
TABLE-US-00011 TABLE 6 Summary of Iodine Screen Sum +Events 4
-Events 12 ?Events 3 Total Events Analyzed 19 Events with no 2
plants/sterile/dwarf Total Events 27
TABLE-US-00012 TABLE 7 Seed segregation information of potential
positive pPGM events. Event Plant D:L seed ratio Note 100-2-1 1 1:5
clear positive 100-2-1 2 3:2 clear positive 100-2-1 3 1:5 clear
positive 108-3-1 1 0:6 clear positive 108-3-1 2 2:4 clear positive
108-3-1 3 1:5 clear positive 105-2-3 1 4:0 negative 105-2-3 2 1:5
clear positive 105-1-6 1 4:0 negative 105-1-6 3 2:2 clear positive
105-1-1 1 4:2 D/L 105-1-1 2 0:6 D/L 105-1-1 3 6:0 D/L 101-2-6 1 6:0
D/L 101-2-6 3 2:3 D/L 102-3-3 1 2:3 D/L 102-3-3 2 3:0 D/L D = dark
blue stain, L = light blue or no stain, D/L in between dark and
light stain
Example 11
Silencing of Plastidic Phosphoglucomutase (pPGM) Results in a
Stable Reduction Of Transient Starch Accumulation in Developing
Soybean Seeds
[0317] Transgenic soybean events were produced as described in
Example 10.
[0318] Developing soybean seeds were harvested at approximately
mid-maturity (20 to 30 days after flowering (DAF)) and starch
content was quantified as described in Brown and Huber, Physiologia
Plantarum 72:518-524 (1988). T1 seeds from three transgenic events
showed about an 80% reduction in starch content as compared to
wild-type seeds (Table 8). The starch data correlated with the
iodine staining described in Example 10, i.e., seeds that do not
stain blue have a significant reduction in starch content while
blue-staining seeds have starch contents similar to wild-type
TABLE-US-00013 TABLE 8 Starch Content of T1 Seeds (Approximately
Mid-maturity) Segregating for Co-suppression of pPGM. Iodine Mg
starch/g seed % of Event score mean st. dev. wild-type WT (Jack) B
22.83 5.69 100 108-3-1 W 5.20 2.24 20 108-3-1 B 25.92 -- 100
105-1-8 nd nd nd nd 100-2-1 W 5.27 1.66 22 100-2-1 B 24.27 5.40 100
105-1-6 W 2.69 3.81 14 105-1-6 B 18.87 6.76 100 B = Seeds Staining
Blue. W = Seeds Not Staining. Blue Staining Indicates Presence of
Starch. nd = not determined
[0319] The soluble carbohydrate composition of developing
transgenic seeds was measured by high performance anion exchange
chromatography/pulsed amperometric detection (HPAE/PAD). Individual
seeds from transgenic lines were harvested at mid-maturity (20 to
30 DAF) for detection of carbohydrate composition. The seeds were
frozen in liquid nitrogen, ground with a mortar and pestle, and
transferred to 15 ml microcentrifuge tubes. Ethanol (80%) was added
to the tubes and the samples were heated to 70.degree. C. for 15
minutes. Samples were centrifuged at 4000 rpm for 15 minutes at
4.degree. C. and the supernatant collected. The pellet was
re-extracted two additional times with 80% ethanol at 70.degree. C.
The supernatants were combined, dried down in a speedvac, and the
pellet re-suspended in water. Furthermore, the extracts were
filtered through a 0.2 .mu.m Nylon-66 filter (Rainin, Emeryville,
Calif.) and analyzed by HPAE/PAD using a DX500 anion exchange
analyzer (Dionex, Sunnyvale, Calif.) equipped with a 250.times.4 mm
CarboPac PA1 anion exchange column and a 25.times.4 mm CarboPac PA
guard column. Soluble carbohydrates were separated with a 30 minute
isocratic run of 0.5 mM NaAc in 150 mM NaOH at a flow rate of 1.0
mL/min. A dilution series of glucose, fructose, sucrose, raffinose,
stachyose and verbascose were used as external standards.
[0320] Soluble carbohydrate analysis on 6 seeds per event
segregating for iodine staining (starch presence) indicated no
major change in concentration of sucrose and total soluble
carbohydrates at approximately mid-maturity (Table 9). No raffinose
family oligosaccharides (RFOs) were observed at this stage of
development; hence, no sucrose to RFO ratio could be
determined.
TABLE-US-00014 TABLE 9 Sucrose and Total Soluble Sugar Content
(mg/g seed) of Segregating T1 Seeds Harvested at Mid-maturity.
Plant Seed Sucrose Total Soluble Sugars Event No. Score mean std.
mean std. 108-3-1 1 L 22.8 3.1 26.5 3.8 108-3-1 3 D 13.1 -- 17.2 --
108-3-1 3 L 10.4 5.9 14.7 5.4 105-1-8 nd* nd nd nd nd 100-2-1 2 D
16.0 4.7 21.0 6.0 100-2-1 2 L 18.6 4.7 24.3 5.6 105-1-6 1 D 31.5
12.5 36.4 3.8 105-1-6 3 D 23.1 2.6 27.3 2.6 105-1-6 3 L 18.2 5.2
23.4 5.4 nd* = not determined D = Dark Blue Stain, L = Light Blue
or No Stain
[0321] T1 seeds from event 108-3-1 were planted in a growth chamber
and T2 seeds were harvested at mid-maturity and screened for starch
presence using the iodine screen described in Example 10. Starch
and soluble carbohydrate content of T2 seeds were determined as
described above.
[0322] T2 seeds in which the pPGM gene is silenced (referred to as
PGM-KO) showed an 80% decrease in starch content (Table 10).
Null-segregating T2 seeds were also identified which had wild-type
starch levels (referred to as PGM-WT). No major differences in
soluble carbohydrate concentrations between pPGM-silenced T2 seeds
(PGM-KO) and wild-type seeds (Jack or PGM-WT) were observed at this
stage of development. This data is similar to data obtained from T1
seeds (Table 8 and Table 9) and suggest that the event is inherited
in a stable manner.
TABLE-US-00015 TABLE 10 Starch, Sucrose and Total Soluble
Carbohydrate Content of T2 Seeds (Growth Chamber Grown) from
pPGM-Silenced Seeds Harvested at Mid-maturity. mg mg mg Total
Starch/g Iodine Sucrose/ CHOs/g Seed % of Name Event Score g Seed
Seed (mean) WT Jack Control B 15.9 19.8 22.83 100 PGM-KO 108-3-1 W
14.8 21.3 3.7 22 PGM-WT 108-3-1 B 16.6 19.7 16.89 100 B = Seeds
Staining Blue. W = Seeds Not Staining. Blue Staining Indicates
Presence of Starch.
[0323] Starch quantitation of developing soybean seeds harvested at
20, 30, 40 and 50 DAF indicated that throughout seed development,
the starch accumulation of a pPGM-silenced soybean was reduced by
85% as compared to its null segregant (FIG. 2).
Example 12
Silencing of Plastidic Phosphoglucomutase Decreases Total
Carbohydrate Content and Alters the Sucrose to Raffinose Family
Oliqosaccharide Ratio in Mature Seeds
[0324] Transgenic T2 soybean seeds were harvested at mid-maturity
and screened for reduced starch content using the iodine screen
described in Example 10. In total, three thousand seeds (field and
growth chamber grown) from 436 plants representing 21 different
events were screened. A secondary screen using 20 seeds per plant
was conducted to identify potential homozygotes. Five events
(108-3-1, 105-1-8, 100-2-1, 105-1-7 and 100-3-2) showed a decreased
or no iodine staining.
[0325] Carbohydrate analysis (determined as described in Example
11) of mature T2 seeds from plants grown in a growth chamber (GC)
revealed a decrease in total soluble carbohydrates of approximately
11% with sucrose being the major sugar affected (38% decrease) as
compared to their null segregant (FIG. 3). Carbohydrate analysis of
field grown events revealed a decrease in total soluble
carbohydrates of approximately 14 to 25% together with a 30 to 39%
decrease in sucrose. In both the growth chamber and field grown
plants, mature seeds from the pPGM-silenced events (PGM-KO) were
characterized with a distinctive change in sucrose to RFO ratio.
Under these conditions the sucrose to RFO ratio of wild-type seeds
averaged around 1.3 to 1.7 while the sucrose to RFO ratio of pPGM
co-suppressed seeds averaged around 0.7 to 0.9.
[0326] Seeds from a selected number of events were grown in a
growth chamber to produce T3 seeds. Carbohydrate analysis of T3
seeds from pPGM-silenced events revealed a decrease in total
soluble carbohydrates of approximately 24 to 35% as compared to
their wild-type. Sucrose content decreased by 35 to 48% whereas RFO
decreased by approximately 14% (FIG. 4).
[0327] The carbohydrate profile of these T3 seeds is thus very
similar to R2 seeds and indicates (as was seen with the starch
content) that the pPGM trait is inherited in a stable manner. The
sucrose to RFO ratio of pPGM co-suppressed R3 seeds (ratio of 1.2
to 1.5) was as compared to the null segregant (ratio of 1.6 to
2.0). Although the sucrose to RFO ratio in T3 seeds is somewhat
higher as compared to T2 seeds, the decrease in the sucrose to RFO
ratio between pPGM co-suppressed seeds and wild-type seeds averages
around 0.5.
Example 13
Silencing of Plastidic Phosphoglucomutase (pPGM) Results in an
Increased Accumulation of Oil and/or Protein in Mature Seeds
[0328] Total oil and protein content of mature T2 seeds from event
108-3-1-1 showing a pPGM-silenced phenotype was determined and
compared to the oil and protein content of a pPGM null segregant
(wild-type phenotype) from the same event (Table 11). Percent oil
and percent protein changes were expressed on a seed dry weight
basis. Seed composition of wild-type 92B91 was performed as a
control reference. Protein and oil were measured by Woodson-Tenant
Labs (Des Moines, Iowa), using standard AOAC methods; combustion
method for protein (AOAC Official Method 990.03; 2000 AOAC
International), and ether extraction method for oil (AOAC Official
Method 920.39; 2000 AOAC International).
[0329] Field grown pPGM-silenced seeds showed an increased oil
content of up to 2% on a seed dry wt basis and a slightly increased
protein content (1% on a seed dry wt basis) as compared to seeds
from the null segregant. Total oil content of growth chamber grown
pPGM co-suppressed seeds increased by 4% on a seed dry wt basis.
This high increase in oil content was accompanied with a decreased
protein content (Table 11). No major difference was observed
between the seed composition of PGM-WT and the wild-type cultivar
92B91.
TABLE-US-00016 TABLE 11 Seed Composition of T2 seeds from a
pPGM-Silenced Line (PGM-KO) and a Null Segregant (PGM-WT) for Event
108-3-1-1 % Growth % % Oil & Con- Pheno- Pro- % Oil Protein
Protein ID dition type % Oil tein Increase Increase Increase 2097-7
Growth PGM-KO 23.39 37.08 4.19 -3.04 1.15 Cham- ber 2097-7 Field
PGM-KO 21.22 41.25 2.20 +1.12 3.32 2097-1 Field PGM-WT 19.20 40.12
-- -- -- 92B91 Field wild-type 20.36 40.40 -- -- --
[0330] T2 seeds from event 108-3-1-1 were planted in a growth
chamber to produce T3 seeds. This T3 generation of mature seeds
from pPGM co-suppressed seeds showed the greatest increase in
protein content rather than oil content when compared to their null
segregant (Table 12; percent oil and percent protein changes were
calculated on a seed dry weight basis). Interestingly, the sum of
both increase in oil and protein content was similar for T3 seeds
from both plants, ranging from 1.76 to 1.83%, on a seed dry wt
basis.
TABLE-US-00017 TABLE 12 Seed Composition of T3 Seeds from Two
pPGM-Silenced Plants (PGM-KO) and a Null Segregant (PGM-WT) % % %
Oil & Pheno- Pro- % Oil Protein Protein Event ID type % Oil
tein Increase Increase Increase 108- JS1-261 PGM-KO 22.03 40.09
-0.61 2.37 1.76 3-1-1 108- JS2-265 PGM-KO 22.99 39.21 0.35 1.49
1.83 3-1-1 108- JS3-2642 PGM-WT 22.64 37.72 -- -- -- 3-1-1
[0331] T3 seeds from several other events having cv. Jack as their
genetic background showed similar trends as observed with the event
108-3-1-1, which has cv. 92B91 as its genetic background. The
increase in the sum of oil and protein content ranged from 0.98 to
3.14% as expressed on a seed dry wt basis (Table 13).
TABLE-US-00018 TABLE 13 Seed Composition of T3 Seeds from
pPGM-Silenced (PGM-KO) and PGM Wild-Type (PGM-WT) Events in a cv.
Jack Background % % Oil & Pheno- % Oil Protein Protein Event
type % Oil % Protein Increase Increase Increase 101-2-6-3 PGM-WT
22.36 38.48 -- -- -- 105-1-8-2 PGM-KO 21.29 40.53 -1.07 2.05 0.98
100-2-1-1 PGM-KO 23.92 40.06 1.56 1.58 3.14 100-2-1-1 PGM-KO 21.79
40.69 -0.57 2.21 1.64
[0332] Homozygous pPGM-silenced (PGM-KO) and pPGM-wild-type
(PGM-WT) seeds, originating from crosses between pPGM knockout
event and elite germplasm, were grown in the field in 2003 and in
2004. The seed compositions were determined and are shown in Table
14. The percent oil, percent protein and percent combined oil and
protein changes are expressed on a dry weight basis. The moisture
content of each sample was measured in the 2004 experiment. For the
2003 data, a moisture content of 13% was assumed, to calculate the
dry weight values. For the data shown in Table 14, a range of 1.0%
to 3.5% was observed for the percent increase in oil and
protein.
TABLE-US-00019 TABLE 14 Seed Composition of Field Grown Homozygous
pPGM-Silenced (PGM-KO) and PGM-Wild-Type (PGM-WT) Seeds. % Elite %
Oil & Back- Pheno- % % Oil Protein Protein ground Year type %
Oil Protein Increase Increase Increase 92B63 2003 PGM-KO 22.7 40.6
1.3 -0.3 1.0 92B63 2003 PGM-WT 21.4 40.9 -- -- -- 92B63 2004 PGM-KO
19.1 42.2 1.1 0.5 1.6 92B63 2004 PGM-WT 18.0 41.7 -- -- -- 92B91
2003 PGM-KO 25.7 39.4 2.5 1.0 3.5 92B91 2003 PGM-WT 23.2 38.4 -- --
-- 92B91 2004 PGM-KO 21.4 40.2 1.7 0.3 2.0 92B91 2004 PGM-WT 19.7
39.9 -- -- -- 93B87 2003 PGM-KO 23.1 40.2 0.7 1.2 1.9 93B87 2003
PGM-WT 22.4 39.0 -- -- -- 93B87 2004 PGM-KO 21.5 42.4 1.4 0.8 2.2
93B87 2004 PGM-WT 20.1 41.6 -- -- --
Example 14
Characterization of Defatted Meal from Transgenic Soybean Seeds
with Silenced Plastidic Phosphoglucomutase (pPGM)
[0333] T2 soybean seeds were ground to a fine powder and oil was
extracted using heptane. Approximately 200 mg of soybean seed were
weighed and transferred into pre-weighed 10 ml glass screw cap
tubes. Two ml of heptane were added and the mixture was vortexed
for 15 min at room temperature. The glass tubes were centrifuged at
3500 rpm for 20 minutes and the heptane was carefully decanted into
a new, pre-weighed glass tube. The pellet was re-extracted another
three times as described above and all supernatants were pooled.
The hexane was removed by evaporation using a speedvac. Total oil
content was determined gravimetrically.
[0334] An aliquot of the defatted meal was used for protein
determination. About 60 mg of meal was transferred to a 15 ml
polypropylene tube and 10 ml 0.1 N NaOH were added and the mixture
was incubated at 60.degree. C. for 1 hr. One ml of the suspension
was transferred to a 2 ml eppendorf tube and centrifuged at 14,000
rpm for 3 minutes. The supernatant was diluted several fold and the
protein content was determined using a microplate assay based on
Sigma Total Protein Protocol (Procedure 541-2, Sigma).
[0335] The soluble carbohydrate profile of defatted soybean meal
from T2 seeds is shown in FIG. 5. Sucrose to RFO ratios of 0.82 and
0.87 were observed for the pPGM-suppressed event, 108-3-1-1.
[0336] The percent oil and percent protein content of defatted meal
from T2 Seeds of event 108-3-1-1 was determined on a wet-weight
basis and is presented in Table 15. A percent increase in combined
oil and protein of 3.02% and 4.82% was observed for defatted meal
from a pPGM-suppressed line grown in the growth chamber and in the
field, respectively.
[0337] The percent oil and percent protein content of defatted meal
from T2 Seeds of event 108-3-1-1 was determined on a dry-weight
basis and is presented in Table 16. A percent increase in combined
oil and protein of 3.20% and 5.17% was observed for defatted meal
from a pPGM-suppressed line grown in the growth chamber and in the
field, respectively.
TABLE-US-00020 TABLE 15 Characterization of Defatted Meal
(wet-weight basis) from T2 Seeds of Event 108-3-1-1 from a pPGM
Co-suppressed Events (PGM-KO) and a Null Segregant (PGM-WT) %
Growth % % Oil & Con- Pheno- Pro- % Oil Protein Protein ID
dition type % Oil tein Increase Increase Increase 2097-7 Growth
PGM-KO 18.82 37.54 3.40 -0.38 3.02 Cham- ber 2097-7 Field PGM-KO
17.65 40.51 2.23 2.59 4.82 2097-1 Field PGM-WT 15.42 37.92 -- -- --
92B91 Field wild-type 16.92 36.80 -- -- --
TABLE-US-00021 TABLE 16 Characterization of Defatted Meal
(dry-weight basis) from T2 seeds of Event 108-1-1 from a pPGM
Co-suppressed Event (PGM-KO) and a Null Segregant (PGM-WT) % Growth
% % Oil & Con- Pheno- Pro- % Oil Protein Protein ID dition type
% Oil tein Increase Increase Increase 2097-7 Growth PGM-KO 18.82
40.31 3.40 -0.20 3.20 Cham- ber 2097-7 Field PGM-KO 17.65 43.45
2.23 2.94 5.17 2097-1 Field PGM-WT 15.42 40.51 -- -- -- 92B91 Field
wild-type 16.92 39.35 -- -- --
Example 15
Characterization of cDNA Clones Encoding the Large Subunit and the
Small Subunit Polypeptides of Soybean ADP-Glucose
Pyrophosphorylase
[0338] A BLAST analysis of soybean sequences identified cDNA clones
that encoded proteins with high sequence similarity to the large
subunit of ADP-glucose pyrophosphorylase from chickpea, Cicer
arietinum (NCBI General Identifier No. 13487785), and to the small
subunit, PvAGPS1, of ADP-glucose pyrophosphorylase from Phaseolus
vulgaris (NCBI General Identifier No. 29421116). SEQ ID NO:24,
encoded by SEQ ID NO:23, corresponds to the amino acid sequence of
a large subunit polypeptide of soybean ADP-glucose
pyrophosphorylase and has a pLog score of greater than 254 when
compared to the large subunit of ADP-glucose pyrophosphorylase from
chickpea (SEQ ID NO:25; GI No. 13487785). SEQ ID NO:28, encoded by
SEQ ID NO:27, corresponds to the amino acid sequence of a first
small subunit polypeptide (SS1) of soybean ADP-glucose
pyrophosphorylase and has a pLog score of greater than 254 when
compared to the small subunit polypeptide, PvAGPS1, of ADP-glucose
pyrophosphorylase from Phaseolus vulgaris (SEQ ID NO:31; GI No.
29421116). SEQ ID NO:30, encoded by SEQ ID NO:29, corresponds to
the amino acid sequence of a second small subunit polypeptide (SS2)
of soybean ADP-glucose pyrophosphorylase and has a pLog score of
greater than 254 when compared to the small subunit polypeptide,
PvAGPS1, of ADP-glucose pyrophosphorylase from Phaseolus vulgaris
(SEQ ID NO:31; GI No. 29421116).
[0339] The large subunit amino acid sequences of SEQ ID NOs:24, 25
and 26 were aligned and the percent sequence identities were
calculated for each pair of sequences. The soybean large subunit
amino acid sequence of SEQ ID NO:24 is 79.1% identical to the large
subunit of ADP-glucose pyrophosphorylase from chickpea (SEQ ID
NO:25; GI No. 13487785), and is 99.6% identical to SEQ ID NO:26
(SEQ ID NO:248406 from U.S. Patent Application US2004031072).
[0340] The small subunit amino acid sequences of SEQ ID NOs:28, 30,
31 and 32 were aligned and the percent sequence identities were
calculated for each pair of sequences. The soybean small subunit
SS1 amino acid sequence of SEQ ID NO:28 is 94.6% identical to the
small subunit polypeptide, PvAGPS1, of ADP-glucose
pyrophosphorylase from Phaseolus vulgaris (SEQ ID NO:31; GI No.
29421116), and is 98.3% identical to SEQ ID NO:32 (SEQ ID NO:251944
from U.S. Patent Application US2004031072). The soybean small
subunit SS2 amino acid sequence of SEQ ID NO:30 is 94.0% identical
to the small subunit polypeptide, PvAGPS1, of ADP-glucose
pyrophosphorylase from Phaseolus vulgaris (SEQ ID NO:31; GI No.
29421116), and is 100% identical to SEQ ID NO:32 (SEQ ID NO:251944
from U.S. Patent Application US2004031072). The soybean small
subunit SS1 polypeptide (SEQ ID NO:28) and the SS2 polypeptide (SEQ
ID NO:30) have 98.3% sequence identity with each other.
[0341] Sequence alignments and percent identity calculations were
performed using the Megalign program of the LASERGENE
bioinformatics computing suite (DNASTAR Inc., Madison, Wis.).
Multiple alignment of the sequences was performed using the Clustal
V method of alignment (Higgins and Sharp (1989) CABIOS. 5:151-153)
with the default parameters (GAP PENALTY=10, GAP LENGTH
PENALTY=10). Default parameters for pairwise alignments using the
Clustal method were KTUPLE=1, GAP PENALTY=3, WINDOW=5 and DIAGONALS
SAVED=5.
[0342] Sequence alignments and BLAST scores and probabilities
indicate that the nucleic acid fragments comprising the instant
cDNA clones encode full-length polypeptides for the large and small
subunits of ADP-glucose pyrophosphorylase from soybean.
Sequence CWU 1
1
3212112DNATypha latifolia 1gcaccagctc gttatcgcca cttatcgctc
tctcaatctc tctctccata cttgcaagaa 60atggcaatgt cggtgcctac tatgaggttg
catcccctcg tcccctcttc gaagcttctc 120tctccctcct cttcgtcgcc
ggcggtgctg gtctcttccc ggattcctct cctctctctt 180aggaggccaa
acctgaggtt ctccgtcaag gctaccgctt cttccactcc gtccacggcc
240gaaagcataa agatcaagtc gatacccacc aagccagtag aagggcagaa
gactgggact 300agcggattaa ggaagaaggt taaggttttc cagcaggaga
attacttggc aaactggatt 360caggcactgt ttaattcctt gccgctggag
gattacaaga atggattgct ggttttggga 420ggtgatgggc ggtactttaa
ccgagaggct gcacagataa tcatcaagat tgctgctgga 480aatggtgttg
gaaaaattct tgttggcagg gatggtatca tgtcaactcc tgctgtatct
540gcagtaatac gtaaacagaa ggcaaatggt ggttttatca tgagtgcaag
ccataatcct 600ggtggtccgg actatgattg gggcattaag tttaattaca
gcagtggaca acctgcacct 660gaatcaatta ctgacaaaat ctacggtaac
actctttcga tttctgaaat aaaaatatca 720gatatacctg atattgatct
atccagtcta ggtgttacca attatggcaa cttttctgtg 780gaggtggtag
accctgtttc agattacttg gagttaatgg agaatgtgtt tgattttcag
840ctcatcaaag gtcttctttc tcgatctgat ttcaggttta catttgatgc
gatgcatgca 900gtaacaggtg catatgcaaa acctatcttt gtggaacggc
ttcgagctag cccggattgt 960gttttaaatg gagtgcctct tgaagatttt
ggccatggtc acccagaccc caatctgacg 1020tatgctaagg agcttgttga
tgtaatgtat accacagatg cacctgatct aggagcagca 1080agtgatggtg
atggtgatcg aaacatgatt cttggaagac gtttctttgt tacaccatca
1140gattctgttg caatgattgc cgctaatgca caggcggcta ttccttattt
ccaagctggt 1200cccaaaggac ttgctaggtc tatgccaaca agcggtgctc
ttgatcgtgt agccgaaaaa 1260ttgaaccttc cattctttga ggttccaact
ggttggaagt tttttggaaa tctgatggat 1320gctgggaagt tgtccatctg
tggggaggaa agttttggca caggttctga tcacatccgg 1380gagaaggatg
gcatctgggc tgttttggct tggctttcca taattgcgta cagaaacaag
1440gacaaaaaga ttggagagaa attagtctct gttgaagata ttgctaagga
gcactgggca 1500aaatatggca ggaacttctt ttctcgatat gattacgaag
aatgcgaatc ggaaggagca 1560aataaaatga tgcagcacct tagggacttt
atctcgacaa gcaagcctgg agaacaatat 1620ggaaattata ctcttcaatt
ttcagatgac ttttcctaca ctgaccctgt agacggcagt 1680gtagcatcca
agcaagggct acgatttgtt ttcacagatg gatcaagggt tatctatcgt
1740ctctcgggta ctggatcggc cggtgcaact atacggatat atgttgaaca
attcgagccc 1800gatgtctcca agcatgatgt ggatgcacaa gcagcattaa
agcctttgat agacctcgca 1860ttgtcgatat caaagctgaa ggaatttacc
ggcagggaga agcctacagt cattacatga 1920gctgcatgga tggctaggta
gcacgtatat tcttttattt tatgtgatgg cacgtccatt 1980ttgctaataa
agtaataatg taaagaagtc attacgcaga gtactagtct tttattatgc
2040gatgcaacaa tcactcagtt ttgctattaa aaatgggact cacttctttc
ccagaaaaaa 2100aaaaaaaaaa aa 21122639PRTTypha latifolia 2Ala Pro
Ala Arg Tyr Arg His Leu Ser Leu Ser Gln Ser Leu Ser Pro1 5 10 15Tyr
Leu Gln Glu Met Ala Met Ser Val Pro Thr Met Arg Leu His Pro 20 25
30Leu Val Pro Ser Ser Lys Leu Leu Ser Pro Ser Ser Ser Ser Pro Ala
35 40 45Val Leu Val Ser Ser Arg Ile Pro Leu Leu Ser Leu Arg Arg Pro
Asn 50 55 60Leu Arg Phe Ser Val Lys Ala Thr Ala Ser Ser Thr Pro Ser
Thr Ala65 70 75 80Glu Ser Ile Lys Ile Lys Ser Ile Pro Thr Lys Pro
Val Glu Gly Gln 85 90 95Lys Thr Gly Thr Ser Gly Leu Arg Lys Lys Val
Lys Val Phe Gln Gln 100 105 110Glu Asn Tyr Leu Ala Asn Trp Ile Gln
Ala Leu Phe Asn Ser Leu Pro 115 120 125Leu Glu Asp Tyr Lys Asn Gly
Leu Leu Val Leu Gly Gly Asp Gly Arg 130 135 140Tyr Phe Asn Arg Glu
Ala Ala Gln Ile Ile Ile Lys Ile Ala Ala Gly145 150 155 160Asn Gly
Val Gly Lys Ile Leu Val Gly Arg Asp Gly Ile Met Ser Thr 165 170
175Pro Ala Val Ser Ala Val Ile Arg Lys Gln Lys Ala Asn Gly Gly Phe
180 185 190Ile Met Ser Ala Ser His Asn Pro Gly Gly Pro Asp Tyr Asp
Trp Gly 195 200 205Ile Lys Phe Asn Tyr Ser Ser Gly Gln Pro Ala Pro
Glu Ser Ile Thr 210 215 220Asp Lys Ile Tyr Gly Asn Thr Leu Ser Ile
Ser Glu Ile Lys Ile Ser225 230 235 240Asp Ile Pro Asp Ile Asp Leu
Ser Ser Leu Gly Val Thr Asn Tyr Gly 245 250 255Asn Phe Ser Val Glu
Val Val Asp Pro Val Ser Asp Tyr Leu Glu Leu 260 265 270Met Glu Asn
Val Phe Asp Phe Gln Leu Ile Lys Gly Leu Leu Ser Arg 275 280 285Ser
Asp Phe Arg Phe Thr Phe Asp Ala Met His Ala Val Thr Gly Ala 290 295
300Tyr Ala Lys Pro Ile Phe Val Glu Arg Leu Arg Ala Ser Pro Asp
Cys305 310 315 320Val Leu Asn Gly Val Pro Leu Glu Asp Phe Gly His
Gly His Pro Asp 325 330 335Pro Asn Leu Thr Tyr Ala Lys Glu Leu Val
Asp Val Met Tyr Thr Thr 340 345 350Asp Ala Pro Asp Leu Gly Ala Ala
Ser Asp Gly Asp Gly Asp Arg Asn 355 360 365Met Ile Leu Gly Arg Arg
Phe Phe Val Thr Pro Ser Asp Ser Val Ala 370 375 380Met Ile Ala Ala
Asn Ala Gln Ala Ala Ile Pro Tyr Phe Gln Ala Gly385 390 395 400Pro
Lys Gly Leu Ala Arg Ser Met Pro Thr Ser Gly Ala Leu Asp Arg 405 410
415Val Ala Glu Lys Leu Asn Leu Pro Phe Phe Glu Val Pro Thr Gly Trp
420 425 430Lys Phe Phe Gly Asn Leu Met Asp Ala Gly Lys Leu Ser Ile
Cys Gly 435 440 445Glu Glu Ser Phe Gly Thr Gly Ser Asp His Ile Arg
Glu Lys Asp Gly 450 455 460Ile Trp Ala Val Leu Ala Trp Leu Ser Ile
Ile Ala Tyr Arg Asn Lys465 470 475 480Asp Lys Lys Ile Gly Glu Lys
Leu Val Ser Val Glu Asp Ile Ala Lys 485 490 495Glu His Trp Ala Lys
Tyr Gly Arg Asn Phe Phe Ser Arg Tyr Asp Tyr 500 505 510Glu Glu Cys
Glu Ser Glu Gly Ala Asn Lys Met Met Gln His Leu Arg 515 520 525Asp
Phe Ile Ser Thr Ser Lys Pro Gly Glu Gln Tyr Gly Asn Tyr Thr 530 535
540Leu Gln Phe Ser Asp Asp Phe Ser Tyr Thr Asp Pro Val Asp Gly
Ser545 550 555 560Val Ala Ser Lys Gln Gly Leu Arg Phe Val Phe Thr
Asp Gly Ser Arg 565 570 575Val Ile Tyr Arg Leu Ser Gly Thr Gly Ser
Ala Gly Ala Thr Ile Arg 580 585 590Ile Tyr Val Glu Gln Phe Glu Pro
Asp Val Ser Lys His Asp Val Asp 595 600 605Ala Gln Ala Ala Leu Lys
Pro Leu Ile Asp Leu Ala Leu Ser Ile Ser 610 615 620Lys Leu Lys Glu
Phe Thr Gly Arg Glu Lys Pro Thr Val Ile Thr625 630 63531951DNAZea
mays 3ccacgcgtcc gcacaaactg ccctcgcggc ctcgcccgtc gcccctctcg
atcacttctc 60tcccgacact ctctcactcc cgtgtcgtgt ctagcgccga cggcgttgct
accggagccg 120gccagcggcc acgatgccta caatgcacgc gcttcgccta
tgcccgctgc tctccaccat 180ccgatccaca ccaccgcggg ccactgccgc
agcccgccag ggcgcgctct tcgtcgcccg 240ctgctcctcc gccgggacgc
cgtcagccgc ccaggcgctc aagatcagtt caatcccgac 300caagccagtt
gaggggcaga agactgggac tagtggcctg aggaaaaagg tgaaagtatt
360ccagcaggag aactaccttg ctaattggat tcaggctcta ttcaattcct
tgccccctga 420agattatgtg ggtgcaaccc ttgtacttgg gggtgatggc
cggtacttta acaaggaggc 480tgctcagatc atcattaaga ttgcagctgg
aaatggagtt cagaagatca tagttggcag 540gaatggtcta ctgtcaacac
ctgctgtatc tgctgtaatt cgtaaaagaa aagccaatgg 600cggctttatc
atgagtgcaa gccataatcc aggtggacca gacaatgact ggggtattaa
660gtttaactac agcagtggac agccagcacc ggagacgatt actgatcaaa
tttatggaaa 720cacactatca atttctgaaa taaaaacagc agacattcct
gatactgatt tgtcctctgt 780tggagttgta agctatggtg atttcgccat
agaagtgata gatcctgttt cagattacct 840tgaactaatg gagaatgtgt
ttgacttcca acttatcaag gatttgcttt ctcggcctga 900tttcaggttc
atatttgatg caatgcatgc aattactggt gcgtatgccg gacccatttt
960tgttgagaaa cttggagctg atccggactg catattaaat ggggtgcctc
ttgaagattt 1020tggaaatggc catccagatc caaatctaac ttacgctaag
gagcttgttt ttactatgtt 1080tggaacccat gcacctgact ttggtgcagc
aagtgatggt gatggtgatc ggaacatgat 1140tcttgggaaa aggttcttta
ttaccccatc agactctgtt gcaataattg cagccaatgc 1200acagacagca
attccttatt tccagtttgg tacaaaagga ctcgcgagat caatgccaac
1260cagtggtgct cttgatcgtg ttgccgagaa attgaatgtt ccattctttg
aggttccaac 1320aggctggaaa ttttttggca acctaatgga tgcaggaaaa
ttgtctattt gtggagagga 1380aagttttggg actggatctg atcacatcag
agagaaggat ggcatctggg ctgttctggc 1440ttggctttcc atacttgcac
accggaacaa ggataagaag gtcggagaga gattagtgtc 1500agttgaagat
attgctatgg agcactggaa aacctatgga aggaatttct tttctagata
1560cgattatgag gcgtgtgaat cacacagtgc aaaccagatg atggatcacc
ttagagatgt 1620tatggcaaat agcaagcctg gagagaaata cggaaattac
accctccaat ttgctgatga 1680tttcagctat actgatcctg tagacggtag
tacggtatca aaacaaggac ttcgatttgt 1740tttcactgat ggatctagga
ttatcttccg gctttcggga accggatctg ctggagctac 1800tatccgcctc
tacatagaac aatttgaatc tgatatctcg aagcatagtc tcgatgctca
1860aacagctttg aagcctttaa tagacctggc tttgtctgtt tcgaagctca
aggacttcac 1920aggaagagag aaacctactg tcataacata g 19514605PRTZea
mays 4Met Pro Thr Met His Ala Leu Arg Leu Cys Pro Leu Leu Ser Thr
Ile1 5 10 15Arg Ser Thr Pro Pro Arg Ala Thr Ala Ala Ala Arg Gln Gly
Ala Leu 20 25 30Phe Val Ala Arg Cys Ser Ser Ala Gly Thr Pro Ser Ala
Ala Gln Ala 35 40 45Leu Lys Ile Ser Ser Ile Pro Thr Lys Pro Val Glu
Gly Gln Lys Thr 50 55 60Gly Thr Ser Gly Leu Arg Lys Lys Val Lys Val
Phe Gln Gln Glu Asn65 70 75 80Tyr Leu Ala Asn Trp Ile Gln Ala Leu
Phe Asn Ser Leu Pro Pro Glu 85 90 95Asp Tyr Val Gly Ala Thr Leu Val
Leu Gly Gly Asp Gly Arg Tyr Phe 100 105 110Asn Lys Glu Ala Ala Gln
Ile Ile Ile Lys Ile Ala Ala Gly Asn Gly 115 120 125Val Gln Lys Ile
Ile Val Gly Arg Asn Gly Leu Leu Ser Thr Pro Ala 130 135 140Val Ser
Ala Val Ile Arg Lys Arg Lys Ala Asn Gly Gly Phe Ile Met145 150 155
160Ser Ala Ser His Asn Pro Gly Gly Pro Asp Asn Asp Trp Gly Ile Lys
165 170 175Phe Asn Tyr Ser Ser Gly Gln Pro Ala Pro Glu Thr Ile Thr
Asp Gln 180 185 190Ile Tyr Gly Asn Thr Leu Ser Ile Ser Glu Ile Lys
Thr Ala Asp Ile 195 200 205Pro Asp Thr Asp Leu Ser Ser Val Gly Val
Val Ser Tyr Gly Asp Phe 210 215 220Ala Ile Glu Val Ile Asp Pro Val
Ser Asp Tyr Leu Glu Leu Met Glu225 230 235 240Asn Val Phe Asp Phe
Gln Leu Ile Lys Asp Leu Leu Ser Arg Pro Asp 245 250 255Phe Arg Phe
Ile Phe Asp Ala Met His Ala Ile Thr Gly Ala Tyr Ala 260 265 270Gly
Pro Ile Phe Val Glu Lys Leu Gly Ala Asp Pro Asp Cys Ile Leu 275 280
285Asn Gly Val Pro Leu Glu Asp Phe Gly Asn Gly His Pro Asp Pro Asn
290 295 300Leu Thr Tyr Ala Lys Glu Leu Val Phe Thr Met Phe Gly Thr
His Ala305 310 315 320Pro Asp Phe Gly Ala Ala Ser Asp Gly Asp Gly
Asp Arg Asn Met Ile 325 330 335Leu Gly Lys Arg Phe Phe Ile Thr Pro
Ser Asp Ser Val Ala Ile Ile 340 345 350Ala Ala Asn Ala Gln Thr Ala
Ile Pro Tyr Phe Gln Phe Gly Thr Lys 355 360 365Gly Leu Ala Arg Ser
Met Pro Thr Ser Gly Ala Leu Asp Arg Val Ala 370 375 380Glu Lys Leu
Asn Val Pro Phe Phe Glu Val Pro Thr Gly Trp Lys Phe385 390 395
400Phe Gly Asn Leu Met Asp Ala Gly Lys Leu Ser Ile Cys Gly Glu Glu
405 410 415Ser Phe Gly Thr Gly Ser Asp His Ile Arg Glu Lys Asp Gly
Ile Trp 420 425 430Ala Val Leu Ala Trp Leu Ser Ile Leu Ala His Arg
Asn Lys Asp Lys 435 440 445Lys Val Gly Glu Arg Leu Val Ser Val Glu
Asp Ile Ala Met Glu His 450 455 460Trp Lys Thr Tyr Gly Arg Asn Phe
Phe Ser Arg Tyr Asp Tyr Glu Ala465 470 475 480Cys Glu Ser His Ser
Ala Asn Gln Met Met Asp His Leu Arg Asp Val 485 490 495Met Ala Asn
Ser Lys Pro Gly Glu Lys Tyr Gly Asn Tyr Thr Leu Gln 500 505 510Phe
Ala Asp Asp Phe Ser Tyr Thr Asp Pro Val Asp Gly Ser Thr Val 515 520
525Ser Lys Gln Gly Leu Arg Phe Val Phe Thr Asp Gly Ser Arg Ile Ile
530 535 540Phe Arg Leu Ser Gly Thr Gly Ser Ala Gly Ala Thr Ile Arg
Leu Tyr545 550 555 560Ile Glu Gln Phe Glu Ser Asp Ile Ser Lys His
Ser Leu Asp Ala Gln 565 570 575Thr Ala Leu Lys Pro Leu Ile Asp Leu
Ala Leu Ser Val Ser Lys Leu 580 585 590Lys Asp Phe Thr Gly Arg Glu
Lys Pro Thr Val Ile Thr 595 600 6055573DNAOryza sativa 5tgatggagca
tcttagagat gtgatcgcaa aaagcaagcc tggagagaaa tatggaaact 60atacccttca
gtttgccgat gatttcagtt acactgatcc ggtggatggt agcactgtat
120ctaaacaagg gcttcgattt gtattcaccg atggatctag gattatcttc
cgcctttcgg 180gaaccggatc tgctggagca acaatccgta tatacattga
gcaattcgag tctgatgcct 240caaagcatga tctggatgca caaatagctt
tgaagccttt aatagaccta gctctatctg 300tttcaaagtt gaaggacttc
actgggaaga gataagccta ctgtcataac ataaacatac 360cggtgacatt
agcaatgtta ccacctgggt attcttttat ttccttgttt ttaaaagccc
420cttccaaccg atgaaccaat aatgttatcc taagccaagt tttgtactga
gttgatggca 480aactgtatcc tggggggtac tttcaattga acataagtat
gcaaggaatg aataaagctt 540ttaaaagcaa aaaaaaaaaa aaaaaaaaaa aaa
5736117PRTOryza sativaUNSURE(108)Xaa can be any naturally occurring
amino acid 6Met Glu His Leu Arg Asp Val Ile Ala Lys Ser Lys Pro Gly
Glu Lys1 5 10 15Tyr Gly Asn Tyr Thr Leu Gln Phe Ala Asp Asp Phe Ser
Tyr Thr Asp 20 25 30Pro Val Asp Gly Ser Thr Val Ser Lys Gln Gly Leu
Arg Phe Val Phe 35 40 45Thr Asp Gly Ser Arg Ile Ile Phe Arg Leu Ser
Gly Thr Gly Ser Ala 50 55 60Gly Ala Thr Ile Arg Ile Tyr Ile Glu Gln
Phe Glu Ser Asp Ala Ser65 70 75 80Lys His Asp Leu Asp Ala Gln Ile
Ala Leu Lys Pro Leu Ile Asp Leu 85 90 95Ala Leu Ser Val Ser Lys Leu
Lys Asp Phe Thr Xaa Gly Arg Asp Lys 100 105 110Pro Thr Val Ile Thr
11572204DNAGlycine maxunsure(7)n = A, C, G, or T 7aaaactnttt
ggaaccctcc agcatttcat ttctcatcat caatggcttt ctcttgtaaa 60cttgacagct
tcattctctc tgcctataaa ccccaaaact ccattctccc actttcaatc
120caaccttcct ccttccttcc atctccttct tctttgaagc ctcagaagct
tcccttcaga 180attcgctatg gttctaccat cagagccacg tcatcatcct
caaccccttc cgcaaccatt 240gccgaacctg aaggcattaa gattaaatcg
attccaacca agcccattga tggacaaaag 300actggaacca gtgggcttcg
aaagaaggtg aaagtgttta tgcaagacaa ttaccttgca 360aattggatcc
aggctctgtt taattcattg ccaccggagg actacaagaa tggtttgttg
420gtgttgggag gtgatggtcg atactttaat caggaagctg cacagataat
aatcaaaatt 480gctgctggaa atggtgttgg aaaaattctg gttggaaagg
aaggtatttt gtcaacacca 540gccgtttctg ctgttataag aaagagaaag
gcaaatggtg gatttattat gagtgcaagc 600cataatcctg gcggacctga
atatgattgg ggtattaagt ttaattacag cagtggacaa 660cctgcaccag
aatccatcac tgacaagatt tatggaaata ccctgtcgat ctctgagata
720aagatagctg acattcctga tgttgattta tcaaaagttg gggttacaaa
ttttggaagc 780ttcagtgtgg aagtaataga cccagtttct gactatctgg
agctattgga gacagtattt 840gattttcagc taatcagagg tcttctttca
cgtccagatt ttaggtttat atttgatgcc 900atgcatgcag ttactggtgc
ttatgctaaa cccatcttcg ttgataaact cggtgctagt 960ctggattcaa
tttcaaatgg aatccctttg gaagattttg gacatggcca tcctgatcct
1020aatctaacat atgcgaagga tcttgtcgac attctgtatg ctgaaaatgg
acctgatttt 1080ggagctgcca gtgatgggga tggtgataga aatatgattt
taggaagaag tttctttgta 1140actccttcag actctgtagc agttattgca
gccaatgcaa gagaagcgat tccatacttc 1200aagaacggtg ttaagggtct
tgctcgatca atgccaccaa gcggtgctct ggaccgtgtt 1260gctaaaaaat
tgaacctccc tttctttgag gtccccactg gttggaaatt ttttgggaat
1320cttatggatg cnggaaattt gtccgtttgc ggggaagaga gttttggaac
aggttctgat 1380cacattcgtg agaaagatgg catctgggct gtcttagctt
ggctttctat tattgcacat 1440cgcaacaaag acaagaatcc cggggagaaa
ttgatctccg tatctgacgt tgtgatggag 1500cactgggcaa cttatggaag
gaatttcttc tctagatatg actacgagga atgtgaatct 1560gaaggtgcca
ataagatgat agaataccta cgagatattt tgtctaagag caagcctggt
1620gatcagtatg gaagttatgt tctccagttt gcagatgatt ttacatacac
cgatcctgta 1680gatggaagtg tggtatcaaa acaaggtgtt cggtttgttt
ttacagacgg ttcaaggatt 1740atatatcgtt tatcaggaac tggttctgca
ggggctacgg ttagagtgta cattgaacag 1800tttgaaccag atgtctctaa
acatgatgtt gatgctcaaa ttgccttaaa accattaata 1860gatttggcaa
tatccgtgtc aaagctcaaa gacttcacag ggagggagaa gcctacagtc
1920atcacataat ggacaattcc acaaccactt gatcaagttg ttatatgttc
caaggtgtgc 1980tctaagttga gtgcatacgc aggttgttta ttgcatgcct
atccatatct gagctcgctc 2040gagttcggtc acttttggtt gttcaagaat
tttggagcga taggtcccct gtaaaatatg 2100ctacttatat atttatgtgc
aaagtatgaa gcaccgacgt gcaacaaaat aataataaaa 2160aagaatagtt
tgctgctcta aggagctagg cctttcaaaa aaaa 22048628PRTGlycine max 8Met
Ala Phe Ser Cys Lys Leu Asp Ser Phe Ile Leu Ser Ala Tyr Lys1 5 10
15Pro Gln Asn Ser Ile Leu Pro Leu Ser Ile Gln Pro Ser Ser Phe Leu
20 25 30Pro Ser Pro Ser Ser Leu Lys Pro Gln Lys Leu Pro Phe Arg Ile
Arg 35 40 45Tyr Gly Ser Thr Ile Arg Ala Thr Ser Ser Ser Ser Thr Pro
Ser Ala 50 55 60Thr Ile Ala Glu Pro Glu Gly Ile Lys Ile Lys Ser Ile
Pro Thr Lys65 70 75 80Pro Ile Asp Gly Gln Lys Thr Gly Thr Ser Gly
Leu Arg Lys Lys Val 85 90 95Lys Val Phe Met Gln Asp Asn Tyr Leu Ala
Asn Trp Ile Gln Ala Leu 100 105 110Phe Asn Ser Leu Pro Pro Glu Asp
Tyr Lys Asn Gly Leu Leu Val Leu 115 120 125Gly Gly Asp Gly Arg Tyr
Phe Asn Gln Glu Ala Ala Gln Ile Ile Ile 130 135 140Lys Ile Ala Ala
Gly Asn Gly Val Gly Lys Ile Leu Val Gly Lys Glu145 150 155 160Gly
Ile Leu Ser Thr Pro Ala Val Ser Ala Val Ile Arg Lys Arg Lys 165 170
175Ala Asn Gly Gly Phe Ile Met Ser Ala Ser His Asn Pro Gly Gly Pro
180 185 190Glu Tyr Asp Trp Gly Ile Lys Phe Asn Tyr Ser Ser Gly Gln
Pro Ala 195 200 205Pro Glu Ser Ile Thr Asp Lys Ile Tyr Gly Asn Thr
Leu Ser Ile Ser 210 215 220Glu Ile Lys Ile Ala Asp Ile Pro Asp Val
Asp Leu Ser Lys Val Gly225 230 235 240Val Thr Asn Phe Gly Ser Phe
Ser Val Glu Val Ile Asp Pro Val Ser 245 250 255Asp Tyr Leu Glu Leu
Leu Glu Thr Val Phe Asp Phe Gln Leu Ile Arg 260 265 270Gly Leu Leu
Ser Arg Pro Asp Phe Arg Phe Ile Phe Asp Ala Met His 275 280 285Ala
Val Thr Gly Ala Tyr Ala Lys Pro Ile Phe Val Asp Lys Leu Gly 290 295
300Ala Ser Leu Asp Ser Ile Ser Asn Gly Ile Pro Leu Glu Asp Phe
Gly305 310 315 320His Gly His Pro Asp Pro Asn Leu Thr Tyr Ala Lys
Asp Leu Val Asp 325 330 335Ile Leu Tyr Ala Glu Asn Gly Pro Asp Phe
Gly Ala Ala Ser Asp Gly 340 345 350Asp Gly Asp Arg Asn Met Ile Leu
Gly Arg Ser Phe Phe Val Thr Pro 355 360 365Ser Asp Ser Val Ala Val
Ile Ala Ala Asn Ala Arg Glu Ala Ile Pro 370 375 380Tyr Phe Lys Asn
Gly Val Lys Gly Leu Ala Arg Ser Met Pro Pro Ser385 390 395 400Gly
Ala Leu Asp Arg Val Ala Lys Lys Leu Asn Leu Pro Phe Phe Glu 405 410
415Val Pro Thr Gly Trp Lys Phe Phe Gly Asn Leu Met Asp Ala Gly Asn
420 425 430Leu Ser Val Cys Gly Glu Glu Ser Phe Gly Thr Gly Ser Asp
His Ile 435 440 445Arg Glu Lys Asp Gly Ile Trp Ala Val Leu Ala Trp
Leu Ser Ile Ile 450 455 460Ala His Arg Asn Lys Asp Lys Asn Pro Gly
Glu Lys Leu Ile Ser Val465 470 475 480Ser Asp Val Val Met Glu His
Trp Ala Thr Tyr Gly Arg Asn Phe Phe 485 490 495Ser Arg Tyr Asp Tyr
Glu Glu Cys Glu Ser Glu Gly Ala Asn Lys Met 500 505 510Ile Glu Tyr
Leu Arg Asp Ile Leu Ser Lys Ser Lys Pro Gly Asp Gln 515 520 525Tyr
Gly Ser Tyr Val Leu Gln Phe Ala Asp Asp Phe Thr Tyr Thr Asp 530 535
540Pro Val Asp Gly Ser Val Val Ser Lys Gln Gly Val Arg Phe Val
Phe545 550 555 560Thr Asp Gly Ser Arg Ile Ile Tyr Arg Leu Ser Gly
Thr Gly Ser Ala 565 570 575Gly Ala Thr Val Arg Val Tyr Ile Glu Gln
Phe Glu Pro Asp Val Ser 580 585 590Lys His Asp Val Asp Ala Gln Ile
Ala Leu Lys Pro Leu Ile Asp Leu 595 600 605Ala Ile Ser Val Ser Lys
Leu Lys Asp Phe Thr Gly Arg Glu Lys Pro 610 615 620Thr Val Ile
Thr62592197DNAOryza sativa 9gcacgaggct tgcccgcttc cttccgcggt
gcaagcgcaa caccacctca cctcactccc 60cttctcgcct cttctcccct tctccacctc
ctcttctctc cgcgtggcgg tggcattgcc 120ggccgccgca tcgtctcggg
atggcctcgc acgcgctccg cctccacccg ctgctcttct 180ccgccgccgc
cgcgcgcccg gctccgctcg cggcgcggcc cggtggtggt gcccgccggg
240tccaccgccg ccactctctc gccgtcgtcc ggtgctcctc ctccgccgcc
caggcgctca 300agatcaagtc gattccgacc aagcccgttg aggggcagaa
gaccgggacc agtgggttga 360ggaagaaggt gaaagtgttc cagcaggaga
attacctcgc taattggatt caggctctgt 420tcaattcatt gcccccggag
gattatgttg gtggaaccct tgtgcttggt ggtgatggcc 480gatactttaa
caaggatgct gctcagatta tcactaaaat tgcagctggg aatggtgttg
540ggaagatcct agttggcagg aacggtctgc tgtcaacgcc tgctgtatct
gcagtaattc 600gtaaaagaca agccaatggt ggcttcatca tgagtgcaag
ccataatcca ggtgggccag 660ataatgattg gggtatcaag ttcaactata
gcagtgggca gccagcacca gagacaatta 720ccgaccaaat atatggaaac
acactttcga tttctgaaat aaaaacggca gatattcctg 780atgttgattt
gtcctctcta ggagttgtaa gctatggtga tttcaccgtt gaagtgatag
840accctgtctt ggactacctt gagctaatgg agaatgtgtt tgacttccaa
cttatcaagg 900gcttgttgtc tcggccagat ttcaggtttg tatttgatgc
catgcatgct gtgactggtg 960catatgcgga tcctattttt gttgagaaac
ttggagctga tccggactat atattaaatg 1020gtgttccact tgaagatttt
ggcaatggtc accctgatcc taatttaact tatgccaaag 1080agcttgtgtt
taccatgttt ggaagcggag cacctgactt tggtgcagca agtgatggtg
1140atggtgatcg aaacatgatt cttggaagaa ggttctttgt tacaccatca
gactctgttg 1200caataattgc agcgaatgca caggcagcaa ttccttattt
ccaatctggt ccaaaaggtc 1260ttgctagatc aatgccaacg agtggtgctc
ttgatcgtgt agctgataaa ttgaatgttc 1320cgttctttga ggtaccaaca
ggatggaaat tttttggaaa cctaatggat gcaggtaaat 1380tgtctatatg
tggagaggaa agttttggga caggatctga tcacatcagg gagaaggatg
1440gcatatgggc tgttctagct tggctgtcca tacttgcaca ccggaacaag
gataagaagg 1500ccggggagag attagtgtca gtggaagatg tagctaggga
acactgggca acctatggaa 1560ggaatttctt ctccagatat gattatgagg
agtgtgaatc tgagagtgca aataagatga 1620tggagcatct tagagatgtg
atcgcaaaaa gcaagcctgg agagaaatat ggaaactata 1680cccttcagtt
tgccgatgat ttcagttaca ctgatccggt ggatggtagc actgtatcta
1740aacaagggct tcgatttgta ttcaccgatg gatctaggat tatcttccgc
ctttcgggaa 1800ccggatctgc tggagcaaca atccgtatat acattgagca
attcgagtct gatgcctcaa 1860agcatgatct ggatgcacaa atagctttga
agcctttaat agacctagct ctatctgttt 1920caaagttgaa ggacttcact
ggaagagata agcctactgt cataacataa acataccggt 1980gacattagca
atgttaccac ctgtgtattc ttttatttct ttgtttttat agccccttcc
2040aaccgatgaa ccaataatgt aatcttaggc caagttttgt actgagttga
tggcaaactg 2100tatcttggag gtacctttca ttgaacatag tatgcaggaa
tgaataagct tttagagcaa 2160tggtacatat ttcagaacaa aaaaaaaaaa aaaaaaa
219710655PRTOryza sativa 10Thr Arg Leu Ala Arg Phe Leu Pro Arg Cys
Lys Arg Asn Thr Thr Ser1 5 10 15Pro His Ser Pro Ser Arg Leu Phe Ser
Pro Ser Pro Pro Pro Leu Leu 20 25 30Ser Ala Trp Arg Trp His Cys Arg
Pro Pro His Arg Leu Gly Met Ala 35 40 45Ser His Ala Leu Arg Leu His
Pro Leu Leu Phe Ser Ala Ala Ala Ala 50 55 60Arg Pro Ala Pro Leu Ala
Ala Arg Pro Gly Gly Gly Ala Arg Arg Val65 70 75 80His Arg Arg His
Ser Leu Ala Val Val Arg Cys Ser Ser Ser Ala Ala 85 90 95Gln Ala Leu
Lys Ile Lys Ser Ile Pro Thr Lys Pro Val Glu Gly Gln 100 105 110Lys
Thr Gly Thr Ser Gly Leu Arg Lys Lys Val Lys Val Phe Gln Gln 115 120
125Glu Asn Tyr Leu Ala Asn Trp Ile Gln Ala Leu Phe Asn Ser Leu Pro
130 135 140Pro Glu Asp Tyr Val Gly Gly Thr Leu Val Leu Gly Gly Asp
Gly Arg145 150 155 160Tyr Phe Asn Lys Asp Ala Ala Gln Ile Ile Thr
Lys Ile Ala Ala Gly 165 170 175Asn Gly Val Gly Lys Ile Leu Val Gly
Arg Asn Gly Leu Leu Ser Thr 180 185 190Pro Ala Val Ser Ala Val Ile
Arg Lys Arg Gln Ala Asn Gly Gly Phe 195 200 205Ile Met Ser Ala Ser
His Asn Pro Gly Gly Pro Asp Asn Asp Trp Gly 210 215 220Ile Lys Phe
Asn Tyr Ser Ser Gly Gln Pro Ala Pro Glu Thr Ile Thr225 230 235
240Asp Gln Ile Tyr Gly Asn Thr Leu Ser Ile Ser Glu Ile Lys Thr Ala
245 250 255Asp Ile Pro Asp Val Asp Leu Ser Ser Leu Gly Val Val Ser
Tyr Gly 260 265 270Asp Phe Thr Val Glu Val Ile Asp Pro Val Leu Asp
Tyr Leu Glu Leu 275 280 285Met Glu Asn Val Phe Asp Phe Gln Leu Ile
Lys Gly Leu Leu Ser Arg 290 295 300Pro Asp Phe Arg Phe Val Phe Asp
Ala Met His Ala Val Thr Gly Ala305 310 315 320Tyr Ala Asp Pro Ile
Phe Val Glu Lys Leu Gly Ala Asp Pro Asp Tyr 325 330 335Ile Leu Asn
Gly Val Pro Leu Glu Asp Phe Gly Asn Gly His Pro Asp 340 345 350Pro
Asn Leu Thr Tyr Ala Lys Glu Leu Val Phe Thr Met Phe Gly Ser 355 360
365Gly Ala Pro Asp Phe Gly Ala Ala Ser Asp Gly Asp Gly Asp Arg Asn
370 375 380Met Ile Leu Gly Arg Arg Phe Phe Val Thr Pro Ser Asp Ser
Val Ala385 390 395 400Ile Ile Ala Ala Asn Ala Gln Ala Ala Ile Pro
Tyr Phe Gln Ser Gly 405 410 415Pro Lys Gly Leu Ala Arg Ser Met Pro
Thr Ser Gly Ala Leu Asp Arg 420 425 430Val Ala Asp Lys Leu Asn Val
Pro Phe Phe Glu Val Pro Thr Gly Trp 435 440 445Lys Phe Phe Gly Asn
Leu Met Asp Ala Gly Lys Leu Ser Ile Cys Gly 450 455 460Glu Glu Ser
Phe Gly Thr Gly Ser Asp His Ile Arg Glu Lys Asp Gly465 470 475
480Ile Trp Ala Val Leu Ala Trp Leu Ser Ile Leu Ala His Arg Asn Lys
485 490 495Asp Lys Lys Ala Gly Glu Arg Leu Val Ser Val Glu Asp Val
Ala Arg 500 505 510Glu His Trp Ala Thr Tyr Gly Arg Asn Phe Phe Ser
Arg Tyr Asp Tyr 515 520 525Glu Glu Cys Glu Ser Glu Ser Ala Asn Lys
Met Met Glu His Leu Arg 530 535 540Asp Val Ile Ala Lys Ser Lys Pro
Gly Glu Lys Tyr Gly Asn Tyr Thr545 550 555 560Leu Gln Phe Ala Asp
Asp Phe Ser Tyr Thr Asp Pro Val Asp Gly Ser 565 570 575Thr Val Ser
Lys Gln Gly Leu Arg Phe Val Phe Thr Asp Gly Ser Arg 580 585 590Ile
Ile Phe Arg Leu Ser Gly Thr Gly Ser Ala Gly Ala Thr Ile Arg 595 600
605Ile Tyr Ile Glu Gln Phe Glu Ser Asp Ala Ser Lys His Asp Leu Asp
610 615 620Ala Gln Ile Ala Leu Lys Pro Leu Ile Asp Leu Ala Leu Ser
Val Ser625 630 635 640Lys Leu Lys Asp Phe Thr Gly Arg Asp Lys Pro
Thr Val Ile Thr 645 650 65511629PRTBrassica napus 11Met Ser Ser Thr
Tyr Ala Arg Phe Asp Thr Val Phe Leu Leu Ser Arg1 5 10 15Phe Ala Gly
Ala Lys Tyr Ser Pro Leu Trp Pro Ser Ser Ser Ser Ser 20 25 30Ser His
Ser Ser Leu Leu Ser Ser Gly Ile His Leu Arg Ala Lys Pro 35 40 45Asn
Ser Arg Leu Arg Ser Val Thr Gly Ala Ser Ser Ser Ser Ser Gly 50 55
60Pro Ile Ile Ala Gly Ser Glu Ser Ile Glu Ile Lys Ser Leu Pro Thr65
70 75 80Lys Pro Ile Glu Gly Gln Lys Thr Gly Thr Ser Gly Leu Arg Lys
Lys 85 90 95Val Lys Val Phe Met Gln Asp Asn Tyr Leu Ala Asn Trp Ile
Gln Ala 100 105 110Leu Phe Asn Ser Leu Pro Leu Glu Asp Tyr Lys Asp
Ala Thr Leu Val 115 120 125Leu Gly Gly Asp Gly Arg Tyr Phe Asn Lys
Glu Ala Ser Gln Ile Ile 130 135 140Ile Lys Ile Ala Ala Gly Asn Gly
Val Gly Lys Ile Leu Val Gly Gln145 150 155 160Glu Gly Ile Leu Ser
Thr Pro Ala Val Ser Ala Val Ile Arg Lys Arg 165 170 175Lys Ala Asn
Gly Gly Phe Ile Met Ser Ala Ser His Asn Pro Gly Gly 180 185 190Pro
Glu Tyr Asp Trp Gly Ile Lys Phe Asn Tyr Ser Ser Gly Gln Pro 195 200
205Ala Pro Glu Ser Ile Thr Asp Lys Ile Tyr Gly Asn Thr Leu Ser Ile
210 215 220Ser Glu Ile Lys Val Ala Glu Ile Pro Asp Ile Asp Leu Ser
His Val225 230 235 240Gly Val Thr Lys Tyr Gly Asn Phe Ser Val Glu
Val Ile Asp Pro Ile 245 250 255Ser Asp Tyr Leu Glu Leu Met Glu Asp
Val Phe Asp Phe Asp Leu Ile 260 265 270Arg Gly Leu Leu Ser Arg Ser
Asp Phe Gly Phe Met Phe Asp Ala Met 275 280 285His Ala Val Thr Gly
Ala Tyr Ala Lys Pro Ile Phe Val Asp Asn Leu 290 295 300Glu Ala Lys
Pro Asp Ser Ile Ser Asn Gly Val Pro Leu Glu Asp Phe305 310 315
320Gly His Gly His Pro Asp Pro Asn Leu Thr Tyr Ala Lys Asp Leu Val
325 330 335Asp Val Met Tyr Arg Asp Asp Gly Pro Asp Phe Gly Ala Ala
Ser Asp 340 345 350Gly Asp Gly Asp Arg Asn Met Val Leu Gly Asn Lys
Phe Phe Val Thr 355 360 365Pro Ser Asp Ser Val Ala Ile Ile Ala Ala
Asn Ala Gln Glu Ala Ile 370 375 380Pro Tyr Phe Arg Ala Gly Pro Lys
Gly Leu Ala Arg Ser Met Pro Thr385 390 395 400Ser Gly Ala Leu Asp
Arg Val Ala Glu Lys Leu Lys Leu Pro Phe Phe 405 410 415Glu Val Pro
Thr Gly Trp Lys Phe Phe Gly Asn Leu Met Asp Ala Gly 420 425 430Lys
Leu Ser Ile Cys Gly Glu Glu Ser Phe Gly Thr Gly Ser Asp His 435 440
445Ile Arg Glu Lys Asp Gly Ile Trp Ala Val Leu Ala Trp Leu Ser Ile
450 455 460Leu Ala His Arg Ile Lys Asp Lys Lys Pro Gly Glu Lys Leu
Val Ser465 470 475 480Val Ala Asp Val Val Asn Glu Tyr Trp Ala Thr
Tyr Gly Arg Asn Phe 485 490 495Phe Ser Arg Tyr Asp Tyr Glu Glu Cys
Glu Ser Glu Gly Ala Asn Lys 500 505 510Met Ile Glu Tyr Leu Arg Asp
Ile Val Ala Lys Ser Lys Ala Gly Glu 515 520 525Asn Tyr Gly Asn Tyr
Val Leu Gln Phe Ala Asp Asp Phe Ser Tyr Lys 530 535 540Asp Pro Val
Asp Gly Ser Val Ala Ser Lys Gln Gly Val Arg Phe Val545 550 555
560Phe Thr Asp Gly Ser Arg Ile Ile Tyr Arg Leu Ser Gly Asn Gly Ser
565 570 575Ala Gly Ala Thr Val Arg Ile Tyr Ile Glu Gln Phe Glu Pro
Asp Val 580 585 590Ser Lys His Asp Val Asp Ala Gln Ile Ala Ile Lys
Pro Leu Ile Asp 595 600 605Leu Ala Leu Ser Val Ser Lys Leu Lys Glu
Phe Thr Gly Arg Glu Lys 610 615 620Pro Thr Val Ile
Thr62512626PRTPisum sativum 12Met Ala Phe Cys Tyr Arg Leu Asp Asn
Phe Ile Ile Ser Ala Phe Lys1 5 10 15Pro Lys His Ser Asn Val Pro Leu
Ser Ile His His Ser Ser Ser Asn 20 25 30Phe Pro Ser Phe Lys Val Gln
Asn Phe Pro Phe Arg Val Arg Tyr Asn 35 40 45Ser Ala Ile Arg Ala Thr
Ser Ser Ser Ser Ser Thr Pro Thr Thr Ile 50 55 60Ala Glu Pro Asn Asp
Ile Lys Ile Asn Ser Ile Pro Thr Lys Pro Ile65 70 75 80Glu Gly Gln
Lys Thr Gly Thr Ser Gly Leu Arg Lys Lys Val Lys Val 85 90 95Phe Lys
Gln Glu Asn Tyr Leu Ala Asn Trp Ile Gln Ala Leu Phe Asn 100 105
110Ser Leu Pro Pro Glu Asp Tyr Lys Asn Gly Leu Leu Val Leu Gly Gly
115 120 125Asp Gly
Arg Tyr Phe Asn Lys Glu Ala Ala Gln Ile Ile Ile Lys Ile 130 135
140Ala Ala Gly Asn Gly Val Gly Lys Ile Leu Val Gly Lys Glu Gly
Ile145 150 155 160Leu Ser Thr Pro Ala Val Ser Ala Val Ile Arg Lys
Arg Glu Ala Asn 165 170 175Gly Gly Phe Ile Met Ser Ala Ser His Asn
Pro Gly Gly Pro Glu Tyr 180 185 190Asp Trp Gly Ile Lys Phe Asn Tyr
Ser Ser Gly Gln Pro Ala Pro Glu 195 200 205Ser Ile Thr Asp Lys Ile
Tyr Gly Asn Thr Leu Ser Ile Ser Glu Ile 210 215 220Lys Ile Ala Asp
Ile Pro Asp Val Asp Leu Ser Asn Val Gly Val Thr225 230 235 240Lys
Phe Gly Ser Phe Ser Val Glu Val Ile Asp Pro Val Ser Asp Tyr 245 250
255Leu Glu Leu Leu Glu Thr Val Phe Asp Phe Gln Leu Ile Lys Ser Leu
260 265 270Ile Ser Arg Pro Asp Phe Arg Phe Thr Phe Asp Ala Met His
Ala Val 275 280 285Ala Gly Ala Tyr Ala Thr Pro Ile Phe Val Asp Lys
Leu Ser Ala Ser 290 295 300Leu Asp Ser Ile Ser Asn Gly Ile Pro Leu
Glu Asp Phe Gly His Gly305 310 315 320His Pro Asp Pro Asn Leu Thr
Tyr Ala Lys Asp Leu Val Lys Ile Met 325 330 335Tyr Ala Glu Asn Gly
Pro Asp Phe Gly Ala Ala Ser Asp Gly Asp Gly 340 345 350Asp Arg Asn
Met Ile Leu Gly Thr Ser Phe Phe Val Thr Pro Ser Asp 355 360 365Ser
Val Ala Val Ile Ala Ala Asn Ala Lys Glu Ala Ile Pro Tyr Phe 370 375
380Lys Asp Ser Ile Lys Gly Leu Ala Arg Ser Met Pro Thr Ser Gly
Ala385 390 395 400Leu Asp Arg Val Ala Glu Lys Leu Asn Leu Pro Phe
Phe Glu Val Pro 405 410 415Thr Gly Trp Lys Phe Phe Gly Asn Leu Met
Asp Ala Gly Asn Leu Ser 420 425 430Ile Cys Gly Glu Glu Ser Phe Gly
Thr Gly Ser Asp His Ile Arg Glu 435 440 445Lys Asp Gly Ile Trp Ala
Val Leu Ala Trp Leu Ser Ile Ile Ala His 450 455 460Arg Asn Lys Asp
Thr Lys Pro Gly Glu Lys Leu Val Ser Val Ser Asp465 470 475 480Val
Val Lys Glu His Trp Ala Thr Tyr Gly Arg Asn Phe Phe Ser Arg 485 490
495Tyr Asp Tyr Glu Glu Cys Glu Ser Glu Gly Ala Asn Lys Met Ile Glu
500 505 510Tyr Leu Arg Glu Leu Leu Ser Lys Ser Lys Pro Gly Asp Lys
Tyr Gly 515 520 525Ser Tyr Val Leu Gln Phe Ala Asp Asp Phe Thr Tyr
Thr Asp Pro Val 530 535 540Asp Gly Ser Val Val Ser Lys Gln Gly Val
Arg Phe Val Phe Thr Asp545 550 555 560Gly Ser Arg Ile Ile Tyr Arg
Leu Ser Gly Thr Gly Ser Ala Gly Ala 565 570 575Thr Val Arg Val Tyr
Ile Glu Gln Phe Glu Pro Asp Val Ser Lys His 580 585 590Asp Val Asp
Ala Gln Ile Ala Leu Lys Pro Leu Ile Asp Leu Ala Leu 595 600 605Ser
Val Ser Lys Leu Lys Asp Phe Thr Gly Arg Glu Lys Pro Thr Val 610 615
620Ile Thr62513626PRTPisum sativum 13Met Ala Phe Cys Tyr Arg Leu
Asp Asn Phe Ile Ile Ser Ala Phe Lys1 5 10 15Pro Lys His Ser Asn Val
Pro Leu Ser Ile His His Ser Ser Ser Asn 20 25 30Phe Pro Ser Phe Lys
Val Gln Asn Phe Pro Phe Arg Val Arg Tyr Asn 35 40 45Ser Ala Ile Arg
Ala Thr Ser Ser Ser Ser Ser Thr Pro Thr Thr Ile 50 55 60Ala Glu Pro
Asn Asp Ile Lys Ile Asn Ser Ile Pro Thr Lys Pro Ile65 70 75 80Glu
Gly Gln Lys Thr Gly Thr Ser Gly Leu Arg Lys Lys Val Lys Val 85 90
95Phe Lys Gln Glu Asn Tyr Leu Ala Asn Trp Ile Gln Ala Leu Phe Asn
100 105 110Ser Leu Pro Pro Glu Asp Tyr Lys Asn Gly Leu Leu Val Leu
Gly Gly 115 120 125Asp Gly Arg Tyr Phe Asn Lys Glu Ala Ala Gln Ile
Ile Ile Lys Ile 130 135 140Ala Ala Gly Asn Gly Val Gly Lys Ile Leu
Val Gly Lys Glu Gly Ile145 150 155 160Leu Ser Thr Pro Ala Val Ser
Ala Val Ile Arg Lys Arg Glu Ala Asn 165 170 175Gly Gly Phe Ile Met
Ser Ala Ser His Asn Pro Gly Gly Pro Glu Tyr 180 185 190Asp Trp Gly
Ile Lys Phe Asn Tyr Ser Ser Gly Gln Pro Ala Pro Glu 195 200 205Ser
Ile Thr Asp Lys Ile Tyr Gly Asn Thr Leu Ser Ile Ser Glu Ile 210 215
220Lys Ile Ala Asp Ile Pro Asp Val Asp Leu Ser Asn Val Gly Val
Thr225 230 235 240Lys Phe Gly Ser Phe Ser Val Glu Val Ile Asp Pro
Val Ser Asp Tyr 245 250 255Leu Glu Leu Leu Glu Thr Val Phe Asp Phe
Gln Leu Ile Lys Ser Leu 260 265 270Ile Ser Arg Pro Asp Phe Arg Phe
Thr Phe Asp Ala Met His Ala Val 275 280 285Ala Gly Ala Tyr Ala Thr
Pro Ile Phe Val Asp Lys Leu Gly Ala Ser 290 295 300Pro Asp Ser Ile
Ser Asn Gly Ile Pro Leu Glu Asp Phe Gly His Gly305 310 315 320His
Pro Asp Pro Asn Leu Thr Tyr Ala Lys Asp Leu Val Asn Ile Met 325 330
335Tyr Ala Glu Asn Gly Pro Asp Phe Gly Ala Ala Ser Asp Gly Asp Gly
340 345 350Asp Arg Asn Met Ile Leu Gly Thr Ser Phe Phe Val Thr Pro
Ser Asp 355 360 365Ser Val Ala Val Ile Ala Ala Asn Ala Lys Glu Ala
Ile Pro Tyr Phe 370 375 380Lys Asp Ser Ile Lys Gly Leu Ala Arg Ser
Met Pro Thr Ser Gly Ala385 390 395 400Leu Asp Arg Val Ala Glu Lys
Leu Asn Leu Pro Phe Phe Glu Val Pro 405 410 415Thr Gly Trp Lys Phe
Phe Gly Asn Leu Met Asp Ala Gly Asn Leu Ser 420 425 430Ile Cys Gly
Glu Glu Ser Phe Gly Thr Gly Ser Asp His Ile Arg Glu 435 440 445Lys
Asp Gly Ile Trp Ala Val Leu Ala Trp Leu Ser Ile Ile Ala His 450 455
460Arg Asn Lys Asp Thr Lys Pro Gly Glu Lys Leu Val Ser Val Ser
Asp465 470 475 480Val Val Lys Glu His Trp Ala Thr Tyr Gly Arg Asn
Phe Phe Ser Arg 485 490 495Tyr Asp Tyr Glu Glu Cys Glu Ser Glu Gly
Ala Asn Lys Met Ile Glu 500 505 510Tyr Leu Arg Glu Leu Leu Ser Lys
Ser Lys Pro Gly Asp Lys Tyr Gly 515 520 525Ser Tyr Val Leu Gln Phe
Ala Asp Asp Tyr Thr Tyr Thr Asp Pro Val 530 535 540Asp Gly Ser Val
Val Ser Lys Gln Gly Val Arg Phe Val Phe Thr Asp545 550 555 560Gly
Ser Arg Ile Ile Tyr Arg Leu Ser Gly Thr Gly Ser Ala Gly Ala 565 570
575Thr Val Arg Val Tyr Ile Glu Gln Phe Glu Pro Asp Val Ser Lys His
580 585 590Asp Val Asp Ala Gln Ile Ala Leu Lys Pro Leu Ile Asp Leu
Ala Leu 595 600 605Ser Val Ser Lys Leu Lys Asp Phe Thr Gly Arg Glu
Lys Pro Thr Val 610 615 620Ile Thr62514574DNAArtificial Sequence541
nt Glycine max fragment with 5' and 3' linkers 14ggccgctgag
ctgatttaag atttatcaaa agttggggtt acaaattttg gaagcttcag 60tgtggaagta
atagacccag tttctgacta tctggagcta ttggagacag tatttgattt
120tcagctaatc agaggtcttc tttcacgtcc agattttagg tttatatttg
atgccatgca 180tgcagttact ggtgcttatg ctaaacccat cttcgttgat
aaactcggtg ctagtctgga 240ttcaatttca aatggaatcc ctttggaaga
ttttggacat ggccatcctg atcctaatct 300aacatatgcg aaggatcttg
tcgacattct gtatgctgaa aatggacctg attttggagc 360tgccagtgat
ggggatggtg atagaaatat gattttagga agaagtttct ttgtaactcc
420ttcagactct gtagcagtta ttgcagccaa tgcaagagaa gcgattccat
acttcaagaa 480cggtgttaag ggtcttgctc gatcaatgcc aacaagcggt
gctctggacc gtgctgctaa 540aaaattgaac ctccctttct gagctgattt aagc
57415541DNAGlycine max 15gatttatcaa aagttggggt tacaaatttt
ggaagcttca gtgtggaagt aatagaccca 60gtttctgact atctggagct attggagaca
gtatttgatt ttcagctaat cagaggtctt 120ctttcacgtc cagattttag
gtttatattt gatgccatgc atgcagttac tggtgcttat 180gctaaaccca
tcttcgttga taaactcggt gctagtctgg attcaatttc aaatggaatc
240cctttggaag attttggaca tggccatcct gatcctaatc taacatatgc
gaaggatctt 300gtcgacattc tgtatgctga aaatggacct gattttggag
ctgccagtga tggggatggt 360gatagaaata tgattttagg aagaagtttc
tttgtaactc cttcagactc tgtagcagtt 420attgcagcca atgcaagaga
agcgattcca tacttcaaga acggtgttaa gggtcttgct 480cgatcaatgc
caacaagcgg tgctctggac cgtgctgcta aaaaattgaa cctccctttc 540t
541162401DNAZea mays 16ccacgcgtcc gcacaaactg ccctcgcggc ctcgcccgtc
gcccctctcg atcacttctc 60tcccgacact ctctcactcc cgtgtcgtgt ctagcgccga
cggcgttgct accggagccg 120gccagcggcc acgatgccta caatgcacgc
gcttcgccta tgcccgctgc tctccaccat 180ccgatccaca ccaccgcggg
ccactgccgc agcccgccag ggcgcgctct tcgtcgcccg 240ctgctcctcc
gccgggacgc cgtcagccgc ccaggcgctc aagatcagtt caatcccgac
300caagccagtt gaggggcaga agactgggac tagtggcctg aggaaaaagg
tgaaagtatt 360ccagcaggag aactaccttg ctaattggat tcaggctcta
ttcaattcct tgccccctga 420agattatgtg ggtgcaaccc ttgtacttgg
gggtgatggc cggtacttta acaaggaggc 480tgctcagatc atcattaaga
ttgcagctgg aaatggagtt cagaagatca tagttggcag 540gaatggtcta
ctgtcaacac ctgctgtatc tgctgtaatt cgtaaaagaa aagccaatgg
600cggctttatc atgagtgcaa gccataatcc aggtggacca gacaatgact
ggggtattaa 660gtttaactac agcagtggac agccagcacc ggagacgatt
actgatcaaa tttatggaaa 720cacactatca atttctgaaa taaaaacagc
agacattcct gatactgatt tgtcctctgt 780tggagttgta agctatggtg
atttcgccat agaagtgata gatcctgttt cagattacct 840tgaactaatg
gagaatgtgt ttgacttcca acttatcaag gatttgcttt ctcggcctga
900tttcaggttc atatttgatg caatgcatgc aattactggt gcgtatgccg
gacccatttt 960tgttgagaaa cttggagctg atccggactg catattaaat
ggggtgcctc ttgaagattt 1020tggaaatggc catccagatc caaatctaac
ttacgctaag gagcttgttt ttactatgtt 1080tggaacccat gcacctgact
ttggtgcagc aagtgatggt gatggtgatc ggaacatgat 1140tcttgggaaa
aggttcttta ttaccccatc agactctgtt gcaataattg cagccaatgc
1200acagacagca attccttatt tccagtttgg tacaaaagga ctcgcgagat
caatgccaac 1260cagtggtgct cttgatcgtg ttgccgagaa attgaatgtt
ccattctttg aggttccaac 1320aggctggaaa ttttttggca acctaatgga
tgcaggaaaa ttgtctattt gtggagagga 1380aagttttggg actggatctg
atcacatcag agagaaggat ggcatctggg ctgttctggc 1440ttggctttcc
atacttgcac accggaacaa ggataagaag gtcggagaga gattagtgtc
1500agttgaagat attgctatgg agcactggaa aacctatggc aggaatttct
tttctagata 1560cgattatgag gcgtgtgaat cacacagtgc aaaccagatg
atggatcacc ttagagatgt 1620tatggcaaat agcaagcctg gagagaaata
cggaaattac accctccaat ttgctgatga 1680tttcagctat actgatcctg
tagacggtag tacggtatca aaacaaggac ttcgatttgt 1740tttcactgat
ggatctagga ttatcttccg gctttcggga accggatctg ctggagctac
1800tatccgcctc tacatagaac aatttgaatc tgatatctcg aagcatagtc
tcgatgctca 1860aacagctttg aagcctttaa tagacctggc tttgtctgtt
tcgaagctca aggacttcac 1920aggaagagag aaacctactg tcataacata
ggccctgttt gtttcggctt ttggcagctt 1980ctggccacca aaagctactg
cgtactgtca aacgctcagc ttttcagcca gcttctataa 2040aattcgttgg
gggcaaaaac catctaaaat caaataaaca cataatcggt tgagtcgttg
2100taatagtagg aattcatcac tttctagatc ctgagcctta tgaacaactt
tatcttccta 2160cacacataat cgtaatgata ctcagattct cccacagcca
gattctcccc acagccagat 2220tttcagaaaa gttggtcaga aaaaagctga
accaaacagc cccataatat ttagatgttg 2280ttgtcctcgg ccataccaac
tgagcagcat gggccaagaa ttgaactgat ggaaaatatg 2340tatcattagg
acaaattccg ccagaataag ttgttcctcg gaaaaaaaaa aaaaaaaaaa 2400g
2401174974DNAArtificial Sequenceplasmid pKS133 17ggccgccgac
tcgacgatga gcgagatgac cagctccggc cgcgacacaa gtgtgagagt 60actaaataaa
tgctttggtt gtacgaaatc attacactaa ataaaataat caaagcttat
120atatgccttc cgctaaggcc gaatgcaaag aaattggttc tttctcgtta
tcttttgcca 180cttttactag tacgtattaa ttactactta atcatctttg
tttacggctc attatatccg 240tcgacggcgc gcccgatcat ccggatatag
ttcctccttt cagcaaaaaa cccctcaaga 300cccgtttaga ggccccaagg
ggttatgcta gttattgctc agcggtggca gcagccaact 360cagcttcctt
tcgggctttg ttagcagccg gatcgatcca agctgtacct cactattcct
420ttgccctcgg acgagtgctg gggcgtcggt ttccactatc ggcgagtact
tctacacagc 480catcggtcca gacggccgcg cttctgcggg cgatttgtgt
acgcccgaca gtcccggctc 540cggatcggac gattgcgtcg catcgaccct
gcgcccaagc tgcatcatcg aaattgccgt 600caaccaagct ctgatagagt
tggtcaagac caatgcggag catatacgcc cggagccgcg 660gcgatcctgc
aagctccgga tgcctccgct cgaagtagcg cgtctgctgc tccatacaag
720ccaaccacgg cctccagaag aagatgttgg cgacctcgta ttgggaatcc
ccgaacatcg 780cctcgctcca gtcaatgacc gctgttatgc ggccattgtc
cgtcaggaca ttgttggagc 840cgaaatccgc gtgcacgagg tgccggactt
cggggcagtc ctcggcccaa agcatcagct 900catcgagagc ctgcgcgacg
gacgcactga cggtgtcgtc catcacagtt tgccagtgat 960acacatgggg
atcagcaatc gcgcatatga aatcacgcca tgtagtgtat tgaccgattc
1020cttgcggtcc gaatgggccg aacccgctcg tctggctaag atcggccgca
gcgatcgcat 1080ccatagcctc cgcgaccggc tgcagaacag cgggcagttc
ggtttcaggc aggtcttgca 1140acgtgacacc ctgtgcacgg cgggagatgc
aataggtcag gctctcgctg aattccccaa 1200tgtcaagcac ttccggaatc
gggagcgcgg ccgatgcaaa gtgccgataa acataacgat 1260ctttgtagaa
accatcggcg cagctattta cccgcaggac atatccacgc cctcctacat
1320cgaagctgaa agcacgagat tcttcgccct ccgagagctg catcaggtcg
gagacgctgt 1380cgaacttttc gatcagaaac ttctcgacag acgtcgcggt
gagttcaggc ttttccatgg 1440gtatatctcc ttcttaaagt taaacaaaat
tatttctaga gggaaaccgt tgtggtctcc 1500ctatagtgag tcgtattaat
ttcgcgggat cgagatctga tcaacctgca ttaatgaatc 1560ggccaacgcg
cggggagagg cggtttgcgt attgggcgct cttccgcttc ctcgctcact
1620gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat cagctcactc
aaaggcggta 1680atacggttat ccacagaatc aggggataac gcaggaaaga
acatgtgagc aaaaggccag 1740caaaaggcca ggaaccgtaa aaaggccgcg
ttgctggcgt ttttccatag gctccgcccc 1800cctgacgagc atcacaaaaa
tcgacgctca agtcagaggt ggcgaaaccc gacaggacta 1860taaagatacc
aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctg
1920ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct
ttctcaatgc 1980tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct
ccaagctggg ctgtgtgcac 2040gaaccccccg ttcagcccga ccgctgcgcc
ttatccggta actatcgtct tgagtccaac 2100ccggtaagac acgacttatc
gccactggca gcagccactg gtaacaggat tagcagagcg 2160aggtatgtag
gcggtgctac agagttcttg aagtggtggc ctaactacgg ctacactaga
2220aggacagtat ttggtatctg cgctctgctg aagccagtta ccttcggaaa
aagagttggt 2280agctcttgat ccggcaaaca aaccaccgct ggtagcggtg
gtttttttgt ttgcaagcag 2340cagattacgc gcagaaaaaa aggatctcaa
gaagatcctt tgatcttttc tacggggtct 2400gacgctcagt ggaacgaaaa
ctcacgttaa gggattttgg tcatgacatt aacctataaa 2460aataggcgta
tcacgaggcc ctttcgtctc gcgcgtttcg gtgatgacgg tgaaaacctc
2520tgacacatgc agctcccgga gacggtcaca gcttgtctgt aagcggatgc
cgggagcaga 2580caagcccgtc agggcgcgtc agcgggtgtt ggcgggtgtc
ggggctggct taactatgcg 2640gcatcagagc agattgtact gagagtgcac
catatggaca tattgtcgtt agaacgcggc 2700tacaattaat acataacctt
atgtatcata cacatacgat ttaggtgaca ctatagaacg 2760gcgcgccaag
cttggatcct cgaagagaag ggttaataac acatttttta acatttttaa
2820cacaaatttt agttatttaa aaatttatta aaaaatttaa aataagaaga
ggaactcttt 2880aaataaatct aacttacaaa atttatgatt tttaataagt
tttcaccaat aaaaaatgtc 2940ataaaaatat gttaaaaagt atattatcaa
tattctcttt atgataaata aaaagaaaaa 3000aaaaataaaa gttaagtgaa
aatgagattg aagtgacttt aggtgtgtat aaatatatca 3060accccgccaa
caatttattt aatccaaata tattgaagta tattattcca tagcctttat
3120ttatttatat atttattata taaaagcttt atttgttcta ggttgttcat
gaaatatttt 3180tttggtttta tctccgttgt aagaaaatca tgtgctttgt
gtcgccactc actattgcag 3240ctttttcatg cattggtcag attgacggtt
gattgtattt ttgtttttta tggttttgtg 3300ttatgactta agtcttcatc
tctttatctc ttcatcaggt ttgatggtta cctaatatgg 3360tccatgggta
catgcatggt taaattaggt ggccaacttt gttgtgaacg atagaatttt
3420ttttatatta agtaaactat ttttatatta tgaaataata ataaaaaaaa
tattttatca 3480ttattaacaa aatcatatta gttaatttgt taactctata
ataaaagaaa tactgtaaca 3540ttcacattac atggtaacat ctttccaccc
tttcatttgt tttttgtttg atgacttttt 3600ttcttgttta aatttatttc
ccttctttta aatttggaat acattatcat catatataaa 3660ctaaaatact
aaaaacagga ttacacaaat gataaataat aacacaaata tttataaatc
3720tagctgcaat atatttaaac tagctatatc gatattgtaa aataaaacta
gctgcattga 3780tactgataaa aaaatatcat gtgctttctg gactgatgat
gcagtatact tttgacattg 3840cctttatttt atttttcaga aaagctttct
tagttctggg ttcttcatta tttgtttccc 3900atctccattg tgaattgaat
catttgcttc gtgtcacaaa tacaatttag ntaggtacat 3960gcattggtca
gattcacggt ttattatgtc atgacttaag ttcatggtag tacattacct
4020gccacgcatg cattatattg gttagatttg ataggcaaat ttggttgtca
acaatataaa 4080tataaataat gtttttatat tacgaaataa cagtgatcaa
aacaaacagt tttatcttta 4140ttaacaagat tttgtttttg tttgatgacg
ttttttaatg tttacgcttt cccccttctt 4200ttgaatttag aacactttat
catcataaaa tcaaatacta aaaaaattac atatttcata 4260aataataaca
caaatatttt taaaaaatct gaaataataa tgaacaatat tacatattat
4320cacgaaaatt cattaataaa aatattatat aaataaaatg taatagtagt
tatatgtagg 4380aaaaaagtac tgcacgcata atatatacaa aaagattaaa
atgaactatt ataaataata 4440acactaaatt aatggtgaat catatcaaaa
taatgaaaaa gtaaataaaa tttgtaatta 4500acttctatat gtattacaca
cacaaataat aaataatagt aaaaaaaatt atgataaata 4560tttaccatct
cataagatat ttaaaataat gataaaaata tagattattt tttatgcaac
4620tagctagcca aaaagagaac acgggtatat ataaaaagag tacctttaaa
ttctactgta 4680cttcctttat tcctgacgtt tttatatcaa gtggacatac
gtgaagattt taattatcag 4740tctaaatatt tcattagcac ttaatacttt
tctgttttat tcctatccta taagtagtcc 4800cgattctccc aacattgctt
attcacacaa ctaactaaga aagtcttcca tagcccccca 4860agcggccgga
gctggtcatc tcgctcatcg tcgagtcggc ggccggagct ggtcatctcg
4920ctcatcgtcg agtcggcggc cgccgactcg acgatgagcg agatgaccag ctcc
49741834DNAArtificial SequenceSynthetic DNA Linker 18ggcgcgccaa
gcttggatcc gtcgacggcg cgcc 341980DNAArtificial SequenceSynthetic
Complementary Region of pKS106 and pKS124 19cggccggagc tggtcatctc
gctcatcgtc gagtcggcgg ccgccgactc gacgatgagc 60gagatgacca gctccggccg
8020154DNAArtificial SequenceSynthetic Complementary Region of
pKS133 20cggccggagc tggtcatctc gctcatcgtc gagtcggcgg ccggagctgg
tcatctcgct 60catcgtcgag tcggcggccg ccgactcgac gatgagcgag atgaccagct
ccggccgccg 120actcgacgat gagcgagatg accagctccg gccg
1542192DNAArtificial SequenceSynthetic PCR primer 21gaattccggc
cggagctggt catctcgctc atcgtcgagt cggcggccgc cgactcgacg 60atgagcgaga
tgaccagctc cggccggaat tc 922215DNAArtificial SequenceSynthetic PCR
primer 22gaattccggc cggag 15231874DNAGlycine maxCDS(42)..(1637)
23ccaaatccaa aaaggtttct atttccgtta ttgatttagc a atg gat tca gct tgt
56 Met Asp Ser Ala Cys 1 5gca acc ctg aat ggc cgc cat cta gcc aaa
gtt agt gag gga att gga 104Ala Thr Leu Asn Gly Arg His Leu Ala Lys
Val Ser Glu Gly Ile Gly 10 15 20aga aac aga aca agt ggc ttc tgg ggt
gag agt acg agg gga agt gtg 152Arg Asn Arg Thr Ser Gly Phe Trp Gly
Glu Ser Thr Arg Gly Ser Val 25 30 35aac aca aaa agg ttt ttg agt gtt
caa tca tgc aag act tca cga acc 200Asn Thr Lys Arg Phe Leu Ser Val
Gln Ser Cys Lys Thr Ser Arg Thr 40 45 50aat agg aat ctt aga aac tcc
aag cct gga agt gga att gca cgc gct 248Asn Arg Asn Leu Arg Asn Ser
Lys Pro Gly Ser Gly Ile Ala Arg Ala 55 60 65gtt ctc aca tca gac atc
gac gaa gat tcc atg gca ttt caa ggg gta 296Val Leu Thr Ser Asp Ile
Asp Glu Asp Ser Met Ala Phe Gln Gly Val70 75 80 85ccc act ttt gag
aaa cct gaa gtg gac cca aaa agt gtg gct tcc atc 344Pro Thr Phe Glu
Lys Pro Glu Val Asp Pro Lys Ser Val Ala Ser Ile 90 95 100ata ttg
ggt gga ggt gca gga act cga ctc ttt cct ctt act ggc aga 392Ile Leu
Gly Gly Gly Ala Gly Thr Arg Leu Phe Pro Leu Thr Gly Arg 105 110
115aga gcc aag cca gcg gtt cca att gga ggg tgt tat aga ctc ata gat
440Arg Ala Lys Pro Ala Val Pro Ile Gly Gly Cys Tyr Arg Leu Ile Asp
120 125 130atc ccc atg agc aat tgc atc aat agt ggc atc aga aaa att
ttc atc 488Ile Pro Met Ser Asn Cys Ile Asn Ser Gly Ile Arg Lys Ile
Phe Ile 135 140 145ttg acg cag ttc aat tct ttc tct ctc aac cgc cac
ctg tcc cgt gca 536Leu Thr Gln Phe Asn Ser Phe Ser Leu Asn Arg His
Leu Ser Arg Ala150 155 160 165tac agc ttc gga aat ggc atg act ttt
gga gat ggg ttt gtg gag gtc 584Tyr Ser Phe Gly Asn Gly Met Thr Phe
Gly Asp Gly Phe Val Glu Val 170 175 180ttg gca gct act caa aca ccg
ggt gag gct ggg aag aag tgg ttc caa 632Leu Ala Ala Thr Gln Thr Pro
Gly Glu Ala Gly Lys Lys Trp Phe Gln 185 190 195ggg aca gct gat gct
gta aga caa ttt ata tgg gtt ttt gag gat gcc 680Gly Thr Ala Asp Ala
Val Arg Gln Phe Ile Trp Val Phe Glu Asp Ala 200 205 210aag aac aag
aat gtt gag cat ata ttg ata ctt tct ggc gat cat ctt 728Lys Asn Lys
Asn Val Glu His Ile Leu Ile Leu Ser Gly Asp His Leu 215 220 225tac
cgt atg gac tat atg gac ttt gta cag aga cat gtt gac aca aat 776Tyr
Arg Met Asp Tyr Met Asp Phe Val Gln Arg His Val Asp Thr Asn230 235
240 245gcc gat atc aca gtt tca tgt gta ccc atg gat gac agt cgg gca
tca 824Ala Asp Ile Thr Val Ser Cys Val Pro Met Asp Asp Ser Arg Ala
Ser 250 255 260gac tat gga ctg atg aaa att gat aaa aca gga cgg att
ata cag ttt 872Asp Tyr Gly Leu Met Lys Ile Asp Lys Thr Gly Arg Ile
Ile Gln Phe 265 270 275gca gaa aaa cct aag gga tca gat cta aag gca
atg cgt gtt gac acc 920Ala Glu Lys Pro Lys Gly Ser Asp Leu Lys Ala
Met Arg Val Asp Thr 280 285 290act ctt tta ggg tta ttg cca caa gaa
gca gaa aaa cat cct tat att 968Thr Leu Leu Gly Leu Leu Pro Gln Glu
Ala Glu Lys His Pro Tyr Ile 295 300 305gca tcc atg ggt gtc tac gtg
ttt aga act gaa acc ttg ctg caa cta 1016Ala Ser Met Gly Val Tyr Val
Phe Arg Thr Glu Thr Leu Leu Gln Leu310 315 320 325tta aga tgg aaa
tgt tct tca tgc aat gac ttt gga tct gaa att atc 1064Leu Arg Trp Lys
Cys Ser Ser Cys Asn Asp Phe Gly Ser Glu Ile Ile 330 335 340cca tct
gct gtg aat gag cac aat gtc cag gca tat ttg ttc aat gac 1112Pro Ser
Ala Val Asn Glu His Asn Val Gln Ala Tyr Leu Phe Asn Asp 345 350
355tac tgg gaa gat att gga act ata aag tcc ttc ttt gat gca aat ctt
1160Tyr Trp Glu Asp Ile Gly Thr Ile Lys Ser Phe Phe Asp Ala Asn Leu
360 365 370gct cta aca gaa cag cct cct aaa ttt gaa ttc tat gat cca
aag aca 1208Ala Leu Thr Glu Gln Pro Pro Lys Phe Glu Phe Tyr Asp Pro
Lys Thr 375 380 385cct ttc ttc act tcc ccc aga ttc cta cca cct acc
aaa gta gaa aaa 1256Pro Phe Phe Thr Ser Pro Arg Phe Leu Pro Pro Thr
Lys Val Glu Lys390 395 400 405tgc aag att gtg gat gca att ata tct
cat ggt tgc ttc ttg agg gag 1304Cys Lys Ile Val Asp Ala Ile Ile Ser
His Gly Cys Phe Leu Arg Glu 410 415 420tgc agc gtt caa cat tct att
gtt gga gta cgc tca cgt ttg gag tct 1352Cys Ser Val Gln His Ser Ile
Val Gly Val Arg Ser Arg Leu Glu Ser 425 430 435ggt gtg gag ctt cag
gat acg atg atg atg ggt gct gac tat tat caa 1400Gly Val Glu Leu Gln
Asp Thr Met Met Met Gly Ala Asp Tyr Tyr Gln 440 445 450act gag tat
gaa att gca tct ctg gtg gca gaa ggg aag gtt cca att 1448Thr Glu Tyr
Glu Ile Ala Ser Leu Val Ala Glu Gly Lys Val Pro Ile 455 460 465ggt
gtc ggg gca aat act aaa atc agg aat tgc ata atc gac aag aat 1496Gly
Val Gly Ala Asn Thr Lys Ile Arg Asn Cys Ile Ile Asp Lys Asn470 475
480 485gcc aag ata gga aga aat gtg atc ata gca aac acc gat ggt gtt
caa 1544Ala Lys Ile Gly Arg Asn Val Ile Ile Ala Asn Thr Asp Gly Val
Gln 490 495 500gaa gct gac agg gca aag gaa gga ttc tac att agg tcg
ggc atc aca 1592Glu Ala Asp Arg Ala Lys Glu Gly Phe Tyr Ile Arg Ser
Gly Ile Thr 505 510 515gtt aca tta aaa aat gca aca atc aaa gat gga
aca gtt ata tga 1637Val Thr Leu Lys Asn Ala Thr Ile Lys Asp Gly Thr
Val Ile 520 525 530agcacttcaa gttatccagc aggccacttt ataatagttt
tgacataagt acattcactt 1697ccgacataat agtagatgaa atgctagctc
gtacattaca aagtttctct cgatatatct 1757ctataatagt tatgtttatt
gcatttgtag gacacttcac ttgtaataac aggcaattct 1817tgccactacg
attaagttat aaattaaagt ttctaactca aaaaaaaaaa aaaaaaa
187424531PRTGlycine max 24Met Asp Ser Ala Cys Ala Thr Leu Asn Gly
Arg His Leu Ala Lys Val1 5 10 15Ser Glu Gly Ile Gly Arg Asn Arg Thr
Ser Gly Phe Trp Gly Glu Ser 20 25 30Thr Arg Gly Ser Val Asn Thr Lys
Arg Phe Leu Ser Val Gln Ser Cys 35 40 45Lys Thr Ser Arg Thr Asn Arg
Asn Leu Arg Asn Ser Lys Pro Gly Ser 50 55 60Gly Ile Ala Arg Ala Val
Leu Thr Ser Asp Ile Asp Glu Asp Ser Met65 70 75 80Ala Phe Gln Gly
Val Pro Thr Phe Glu Lys Pro Glu Val Asp Pro Lys 85 90 95Ser Val Ala
Ser Ile Ile Leu Gly Gly Gly Ala Gly Thr Arg Leu Phe 100 105 110Pro
Leu Thr Gly Arg Arg Ala Lys Pro Ala Val Pro Ile Gly Gly Cys 115 120
125Tyr Arg Leu Ile Asp Ile Pro Met Ser Asn Cys Ile Asn Ser Gly Ile
130 135 140Arg Lys Ile Phe Ile Leu Thr Gln Phe Asn Ser Phe Ser Leu
Asn Arg145 150 155 160His Leu Ser Arg Ala Tyr Ser Phe Gly Asn Gly
Met Thr Phe Gly Asp 165 170 175Gly Phe Val Glu Val Leu Ala Ala Thr
Gln Thr Pro Gly Glu Ala Gly 180 185 190Lys Lys Trp Phe Gln Gly Thr
Ala Asp Ala Val Arg Gln Phe Ile Trp 195 200 205Val Phe Glu Asp Ala
Lys Asn Lys Asn Val Glu His Ile Leu Ile Leu 210 215 220Ser Gly Asp
His Leu Tyr Arg Met Asp Tyr Met Asp Phe Val Gln Arg225 230 235
240His Val Asp Thr Asn Ala Asp Ile Thr Val Ser Cys Val Pro Met Asp
245 250 255Asp Ser Arg Ala Ser Asp Tyr Gly Leu Met Lys Ile Asp Lys
Thr Gly 260 265 270Arg Ile Ile Gln Phe Ala Glu Lys Pro Lys Gly Ser
Asp Leu Lys Ala 275 280 285Met Arg Val Asp Thr Thr Leu Leu Gly Leu
Leu Pro Gln Glu Ala Glu 290 295 300Lys His Pro Tyr Ile Ala Ser Met
Gly Val Tyr Val Phe Arg Thr Glu305 310 315 320Thr Leu Leu Gln Leu
Leu Arg Trp Lys Cys Ser Ser Cys Asn Asp Phe 325 330 335Gly Ser Glu
Ile Ile Pro Ser Ala Val Asn Glu His Asn Val Gln Ala 340 345 350Tyr
Leu Phe Asn Asp Tyr Trp Glu Asp Ile Gly Thr Ile Lys Ser Phe 355 360
365Phe Asp Ala Asn Leu Ala Leu Thr Glu Gln Pro Pro Lys Phe Glu Phe
370 375 380Tyr Asp Pro Lys Thr Pro Phe Phe Thr Ser Pro Arg Phe Leu
Pro Pro385 390 395 400Thr Lys Val Glu Lys Cys Lys Ile Val Asp Ala
Ile Ile Ser His Gly 405 410 415Cys Phe Leu Arg Glu Cys Ser Val Gln
His Ser Ile Val Gly Val Arg 420 425 430Ser Arg Leu Glu Ser Gly Val
Glu Leu Gln Asp Thr Met Met Met Gly 435 440 445Ala Asp Tyr Tyr Gln
Thr Glu Tyr Glu Ile Ala Ser Leu Val Ala Glu 450 455 460Gly Lys Val
Pro Ile Gly Val Gly Ala Asn Thr Lys Ile Arg Asn Cys465 470 475
480Ile Ile Asp Lys Asn Ala Lys Ile Gly Arg Asn Val Ile Ile Ala Asn
485 490 495Thr Asp Gly Val Gln Glu Ala Asp Arg Ala Lys Glu Gly Phe
Tyr Ile 500 505 510Arg Ser Gly Ile Thr Val Thr Leu Lys Asn Ala Thr
Ile Lys Asp Gly 515 520 525Thr Val Ile 53025521PRTCicer arietinum
25Met Asp Leu Ala Ile Gly Ser Asn Tyr Ala Ser Leu Arg Ser Ser Val1
5 10 15Phe Leu Gly Glu Thr Leu Lys Gly Asn Leu Ser Thr Lys Phe Leu
Thr 20 25 30Ser Pro Lys Phe Ser Gln Ile His Ile Asn Asn Leu Arg Ser
Phe Asn 35 40 45Pro Arg Asn Gly Ala Ser Tyr Ser Val Leu Thr Ser Gly
Ile Asn Asp 50 55 60Phe Glu Glu Ser Met Thr Phe His Glu Gly Pro Tyr
Phe Asp Thr Pro65 70 75 80Lys Ala Asp Pro Lys Ser Val Ala Ser Ile
Ile Leu Gly Gly Gly Ala 85 90 95Gly Thr Arg Leu Phe Pro Leu Thr Ser
Lys Arg Ala Lys Pro Ala Val 100 105 110Pro Ile Gly Gly Cys Tyr Arg
Leu Ile Asp Ile Pro Met Ser Asn Cys 115 120 125Ile Asn Ser Gly Ile
Arg Lys Ile Phe Ile Leu Thr Gln Phe Asn Ser 130 135 140Phe Ser Leu
Asn Arg His Leu Ser Arg Ser Tyr Asn Phe Gly Asn Val145 150 155
160Ser Thr Phe Gly Glu Gly Phe Val Glu Val Leu Ala Ala Thr Gln Thr
165 170 175Ser Gly Glu Ala Gly Lys Lys Trp Phe Gln Gly Thr Ala Asp
Ala Val 180 185 190Arg Gln Phe Ile Trp Val Phe Glu Asp Ala Lys Thr
Lys Asn Val Glu 195 200 205His Ile Leu Ile Leu Ser Gly Asp His Leu
Tyr Arg Met Asn Tyr Met 210 215 220Asp Phe Val Gln Lys His Ile Asp
Thr Asn Ala Asp Ile Thr Val Ser225 230 235 240Cys Ile Pro Met Asp
Asp Ser Arg Ala Ser Asp Tyr Gly Leu Leu Lys 245 250 255Ile Asp Gly
Lys Gly Arg Ile Ile Gln Phe Ala Glu Lys Pro Lys Gly 260 265 270Ser
Glu Leu Lys Ala Met Arg Val Asp Thr Thr Leu Leu Gly Leu Ser 275 280
285Pro Glu Glu Ala Lys Lys Gln Pro Tyr Ile Ala Ser Met Gly Val Tyr
290 295 300Val Phe Arg Thr Glu Thr Leu Leu Lys Leu Leu Arg Ser Asn
Cys Ser305 310 315 320Thr Cys Asn Asp Phe Gly Ser Glu Ile Ile Pro
Ser Ala Val Asn Asp 325 330 335Asp His Asn Val Gln Ala Tyr Leu Phe
Asn Asp Tyr Trp Glu Asp Ile 340 345 350Gly Thr Ile Lys Ser Phe Phe
Asp Ala Asn Leu Ala Leu Thr Asp Gln 355 360 365Pro Pro Lys Phe Gln
Phe Tyr Asp Pro Asn Thr Pro Phe Tyr Thr Phe 370 375 380Pro Arg Phe
Leu Pro Pro Thr Lys Val Glu Lys Cys Lys Ile Val Asp385 390 395
400Ala Ile Ile Ser His Gly Cys Phe Leu Arg Glu Cys Ser Val Gln His
405 410 415Ser Ile Val Gly Ile Arg Ser Arg Leu Glu Ser Gly Val Glu
Leu Gln 420 425 430Asp Thr Met Met Met Gly Ala Asp Tyr Tyr Gln Thr
Glu Ser Glu Ile 435 440 445Ala Ser Leu Leu Ala Glu Gly Lys Val Pro
Val Gly Val Gly Glu Asn 450 455 460Thr Lys Ile Arg Asn Cys Ile Ile
Asp Lys Asn Ala Arg Ile Gly Arg465 470 475 480Asn Val Ile Ile Thr
Asn Ala Asp Gly Val Glu Glu Ala Asp Arg Thr 485 490 495Lys Glu Gly
Phe Tyr Ile Arg Ser Gly Ile Thr Ala Ile Leu Lys Asn 500 505 510Ala
Thr Ile Lys Asp Gly Thr Val Ile 515 52026531PRTGlycine
maxmisc_feature(404)..(404)Xaa can be any naturally occurring amino
acid 26Met Asp Ser Ala Cys Ala Thr Leu Asn Gly Arg His Leu Ala Lys
Val1 5 10 15Ser Glu Gly Ile Gly Arg Asn Arg Thr Ser Gly Phe Trp Gly
Glu Ser 20 25 30Thr Arg Gly Ser Val Asn Thr Lys Arg Phe Leu Ser Val
Gln Ser Cys 35 40 45Lys Thr Ser Arg Thr Asn Arg Asn Leu Arg Asn Ser
Lys Pro Gly Ser 50 55 60Gly Ile Ala Arg Ala Val Leu Thr Ser Asp Ile
Asp Glu Asp Ser Met65 70 75 80Ala Phe Gln Gly Val Pro Thr Phe Glu
Lys Pro Glu Val Asp Pro Lys 85 90 95Ser Val Ala Ser Ile Ile Leu Gly
Gly Gly Ala Gly Thr Arg Leu Phe 100 105 110Pro Leu Thr Gly Arg Arg
Ala Lys Pro Ala Val Pro Ile Gly Gly Cys 115 120 125Tyr Arg Leu Ile
Asp Ile Pro Met Ser Asn Cys Ile Asn Ser Gly Ile 130 135 140Arg Lys
Ile Phe Ile Leu Thr Gln Phe Asn Ser Phe Ser Leu Asn Arg145 150 155
160His Leu Ser Arg Ala Tyr Ser Phe Gly Asn Gly Met Thr Phe Gly Asp
165 170 175Gly Phe Val Glu Val Leu Ala Ala Thr Gln Thr Pro Gly Glu
Ala Gly 180 185 190Lys Lys Trp Phe Gln Gly Thr Ala Asp Ala Val Arg
Gln Phe Ile Trp 195 200 205Val Phe Glu Asp Ala Lys Asn Lys Asn Val
Glu His Ile Leu Ile Leu 210 215 220Ser Gly Asp His Leu Tyr Arg Met
Asp Tyr Met Asp Phe Val Gln Arg225 230 235 240His Val Asp Thr Asn
Ala Asp Ile Thr Val Ser Cys Val Pro Met Asp 245 250 255Asp Ser Arg
Ala Ser Asp Tyr Gly Leu Met
Lys Ile Asp Lys Thr Gly 260 265 270Arg Ile Ile Gln Phe Ala Glu Lys
Pro Lys Gly Ser Asp Leu Lys Ala 275 280 285Met Arg Val Asp Thr Thr
Leu Leu Gly Leu Leu Pro Gln Glu Ala Glu 290 295 300Lys His Pro Tyr
Ile Ala Ser Met Gly Val Tyr Val Phe Arg Thr Glu305 310 315 320Thr
Leu Leu Gln Leu Leu Arg Trp Lys Gly Ser Ser Cys Asn Asp Phe 325 330
335Gly Ser Glu Ile Ile Pro Ser Ala Val Asn Glu His Asn Val Gln Ala
340 345 350Tyr Leu Phe Asn Asp Tyr Trp Glu Asp Ile Gly Thr Ile Lys
Ser Phe 355 360 365Phe Asp Ala Asn Leu Ala Leu Thr Glu Gln Pro Pro
Lys Phe Glu Phe 370 375 380Tyr Asp Pro Lys Thr Pro Phe Phe Thr Ser
Pro Arg Phe Leu Pro Pro385 390 395 400Thr Lys Val Xaa Lys Cys Lys
Ile Val Asp Ala Ile Ile Ser His Gly 405 410 415Cys Phe Leu Arg Glu
Cys Ser Val Gln His Ser Ile Val Gly Val Arg 420 425 430Ser Arg Leu
Glu Ser Gly Val Glu Leu Gln Asp Thr Met Met Met Gly 435 440 445Ala
Asp Tyr Tyr Gln Thr Glu Tyr Glu Ile Ala Ser Leu Val Ala Glu 450 455
460Gly Lys Val Pro Ile Gly Val Gly Ala Asn Thr Lys Ile Arg Asn
Cys465 470 475 480Ile Ile Asp Lys Asn Ala Lys Ile Gly Arg Asn Val
Ile Ile Ala Asn 485 490 495Thr Asp Gly Val Gln Glu Ala Asp Arg Ala
Lys Glu Gly Phe Tyr Ile 500 505 510Arg Ser Gly Ile Thr Val Thr Leu
Lys Asn Ala Thr Ile Lys Asp Gly 515 520 525Thr Val Ile
530271886DNAGlycine maxCDS(80)..(1627) 27gcacgagtta aagagagtca
caagccaatt ctgaaccaca cactcactta tttgtttctt 60tcaactcact cacagagta
atg gca tcc atg gcg gct ata ggt tct ctg aat 112 Met Ala Ser Met Ala
Ala Ile Gly Ser Leu Asn 1 5 10gtt cct tgt tct gct tct tcg cgt tca
tcg aat gtg gga aga aaa agc 160Val Pro Cys Ser Ala Ser Ser Arg Ser
Ser Asn Val Gly Arg Lys Ser 15 20 25ttt cca cgc agc ctt tca ttc tct
gca tca caa ctt tgt gga gac aag 208Phe Pro Arg Ser Leu Ser Phe Ser
Ala Ser Gln Leu Cys Gly Asp Lys 30 35 40att cac aca gat tca gtt tca
ttc gca cca aaa atc ggt cgc aat cct 256Ile His Thr Asp Ser Val Ser
Phe Ala Pro Lys Ile Gly Arg Asn Pro 45 50 55gta att gtt acc cct aaa
gca gtt tct gat tcc caa aac tcc caa acc 304Val Ile Val Thr Pro Lys
Ala Val Ser Asp Ser Gln Asn Ser Gln Thr60 65 70 75tgt ctt gat ccc
gat gct agc aga agt gtg ctt ggc att ata ctt gga 352Cys Leu Asp Pro
Asp Ala Ser Arg Ser Val Leu Gly Ile Ile Leu Gly 80 85 90ggt ggt gct
ggg act cgt ctt tat cca ctg acc aag aag agg gca aag 400Gly Gly Ala
Gly Thr Arg Leu Tyr Pro Leu Thr Lys Lys Arg Ala Lys 95 100 105cca
gct gtt cct ctt gga gct aac tat agg cta att gac att cct gtt 448Pro
Ala Val Pro Leu Gly Ala Asn Tyr Arg Leu Ile Asp Ile Pro Val 110 115
120agc aac tgc ttg aat agc aac gtc tcc aag atc tat gtt ctc act caa
496Ser Asn Cys Leu Asn Ser Asn Val Ser Lys Ile Tyr Val Leu Thr Gln
125 130 135ttc aat tcc gcc tcg tta aac cga cac ctt tct cgt gct tat
gca agc 544Phe Asn Ser Ala Ser Leu Asn Arg His Leu Ser Arg Ala Tyr
Ala Ser140 145 150 155aac atg ggt ggc tac aaa aat gag gga ttt gtt
gag gtt ctt gct gct 592Asn Met Gly Gly Tyr Lys Asn Glu Gly Phe Val
Glu Val Leu Ala Ala 160 165 170cag cag agt cct gag aat cct aat tgg
ttc cag ggt act gca gat gct 640Gln Gln Ser Pro Glu Asn Pro Asn Trp
Phe Gln Gly Thr Ala Asp Ala 175 180 185gtc agg cag tat ttg tgg ctt
ttt gaa gag cac aat gtt ttg gaa ttc 688Val Arg Gln Tyr Leu Trp Leu
Phe Glu Glu His Asn Val Leu Glu Phe 190 195 200ttg gtt ctg gct ggt
gac cat ttg tat cga atg gat tac gag aaa ttt 736Leu Val Leu Ala Gly
Asp His Leu Tyr Arg Met Asp Tyr Glu Lys Phe 205 210 215atc caa gcg
cat agg gaa act gat gct gat atc act gtg gct gca ttg 784Ile Gln Ala
His Arg Glu Thr Asp Ala Asp Ile Thr Val Ala Ala Leu220 225 230
235cca atg gat gaa aag cgt gcc act gca ttt ggc ctg atg aag att gat
832Pro Met Asp Glu Lys Arg Ala Thr Ala Phe Gly Leu Met Lys Ile Asp
240 245 250gaa gag ggg cgt ata att gaa ttc gcc gaa aag cca aaa gga
gaa cag 880Glu Glu Gly Arg Ile Ile Glu Phe Ala Glu Lys Pro Lys Gly
Glu Gln 255 260 265ttg aaa gct atg aag gtt gat act aca att ttg ggt
ctt gat gac gag 928Leu Lys Ala Met Lys Val Asp Thr Thr Ile Leu Gly
Leu Asp Asp Glu 270 275 280aga gca aag gaa ttg cct tat att gct agc
atg ggt ata tat gtt gtt 976Arg Ala Lys Glu Leu Pro Tyr Ile Ala Ser
Met Gly Ile Tyr Val Val 285 290 295agc aaa aac gtg atg tta gac ctg
ctc cgt gag aag ttt cct ggt gca 1024Ser Lys Asn Val Met Leu Asp Leu
Leu Arg Glu Lys Phe Pro Gly Ala300 305 310 315aat gac ttt ggg agt
gaa gtg att cct ggt gct act tct att gga atg 1072Asn Asp Phe Gly Ser
Glu Val Ile Pro Gly Ala Thr Ser Ile Gly Met 320 325 330agg gtg caa
gct tac ttg tat gat ggc tac tgg gaa gac att ggt aca 1120Arg Val Gln
Ala Tyr Leu Tyr Asp Gly Tyr Trp Glu Asp Ile Gly Thr 335 340 345att
gag gct ttc tat aat gca aat ctg gga atc acc aaa aag cct gtg 1168Ile
Glu Ala Phe Tyr Asn Ala Asn Leu Gly Ile Thr Lys Lys Pro Val 350 355
360cct gac ttc agt ttc tat gat cgt tca tct cca atc tac acc caa cca
1216Pro Asp Phe Ser Phe Tyr Asp Arg Ser Ser Pro Ile Tyr Thr Gln Pro
365 370 375cga tat ttg cct ccc tct aag atg ctt gat gct gat gtc act
gat agt 1264Arg Tyr Leu Pro Pro Ser Lys Met Leu Asp Ala Asp Val Thr
Asp Ser380 385 390 395gtt att ggt gaa gga tgt gtg att aag aac tgc
aaa att cac cat tct 1312Val Ile Gly Glu Gly Cys Val Ile Lys Asn Cys
Lys Ile His His Ser 400 405 410gtg gtt ggg ctg cga tct tgc ata tca
gaa ggt gca att att gaa gac 1360Val Val Gly Leu Arg Ser Cys Ile Ser
Glu Gly Ala Ile Ile Glu Asp 415 420 425acg tta tta atg ggg gca gat
tat tac gag acg gag gct gat aag agg 1408Thr Leu Leu Met Gly Ala Asp
Tyr Tyr Glu Thr Glu Ala Asp Lys Arg 430 435 440ttt ctg gct gct aaa
ggc agt gtt cca att ggt ata ggc agg aac tct 1456Phe Leu Ala Ala Lys
Gly Ser Val Pro Ile Gly Ile Gly Arg Asn Ser 445 450 455cat atc aaa
agg gca att atc gac aag aat gct cga att ggg gaa aat 1504His Ile Lys
Arg Ala Ile Ile Asp Lys Asn Ala Arg Ile Gly Glu Asn460 465 470
475gtc aag att att aac agt gac aat gtc caa gaa gct gca agg gaa aca
1552Val Lys Ile Ile Asn Ser Asp Asn Val Gln Glu Ala Ala Arg Glu Thr
480 485 490gat ggg tat ttc ata aaa agt ggg att gtc aca gta atc aag
gat gct 1600Asp Gly Tyr Phe Ile Lys Ser Gly Ile Val Thr Val Ile Lys
Asp Ala 495 500 505tta att cct agt gga aca gtc atc taa acaccaccac
caccccaaaa 1647Leu Ile Pro Ser Gly Thr Val Ile 510 515aatttcttgt
accccaaatc ctaatggtga ctgcaaagct cattaccacc gctggagagt
1707ttatcaagct atgcttcctc gtctaagata ggcttttgtg tttcatgata
tttatttttg 1767ggcagtggct tgtaaattat agcgggagag aaggcccgct
atgagcaatc acgctgtaaa 1827gttcattatt caattgaata aaagtttctt
cgtttcgtac taaaaaaaaa aaaaaaaaa 188628515PRTGlycine max 28Met Ala
Ser Met Ala Ala Ile Gly Ser Leu Asn Val Pro Cys Ser Ala1 5 10 15Ser
Ser Arg Ser Ser Asn Val Gly Arg Lys Ser Phe Pro Arg Ser Leu 20 25
30Ser Phe Ser Ala Ser Gln Leu Cys Gly Asp Lys Ile His Thr Asp Ser
35 40 45Val Ser Phe Ala Pro Lys Ile Gly Arg Asn Pro Val Ile Val Thr
Pro 50 55 60Lys Ala Val Ser Asp Ser Gln Asn Ser Gln Thr Cys Leu Asp
Pro Asp65 70 75 80Ala Ser Arg Ser Val Leu Gly Ile Ile Leu Gly Gly
Gly Ala Gly Thr 85 90 95Arg Leu Tyr Pro Leu Thr Lys Lys Arg Ala Lys
Pro Ala Val Pro Leu 100 105 110Gly Ala Asn Tyr Arg Leu Ile Asp Ile
Pro Val Ser Asn Cys Leu Asn 115 120 125Ser Asn Val Ser Lys Ile Tyr
Val Leu Thr Gln Phe Asn Ser Ala Ser 130 135 140Leu Asn Arg His Leu
Ser Arg Ala Tyr Ala Ser Asn Met Gly Gly Tyr145 150 155 160Lys Asn
Glu Gly Phe Val Glu Val Leu Ala Ala Gln Gln Ser Pro Glu 165 170
175Asn Pro Asn Trp Phe Gln Gly Thr Ala Asp Ala Val Arg Gln Tyr Leu
180 185 190Trp Leu Phe Glu Glu His Asn Val Leu Glu Phe Leu Val Leu
Ala Gly 195 200 205Asp His Leu Tyr Arg Met Asp Tyr Glu Lys Phe Ile
Gln Ala His Arg 210 215 220Glu Thr Asp Ala Asp Ile Thr Val Ala Ala
Leu Pro Met Asp Glu Lys225 230 235 240Arg Ala Thr Ala Phe Gly Leu
Met Lys Ile Asp Glu Glu Gly Arg Ile 245 250 255Ile Glu Phe Ala Glu
Lys Pro Lys Gly Glu Gln Leu Lys Ala Met Lys 260 265 270Val Asp Thr
Thr Ile Leu Gly Leu Asp Asp Glu Arg Ala Lys Glu Leu 275 280 285Pro
Tyr Ile Ala Ser Met Gly Ile Tyr Val Val Ser Lys Asn Val Met 290 295
300Leu Asp Leu Leu Arg Glu Lys Phe Pro Gly Ala Asn Asp Phe Gly
Ser305 310 315 320Glu Val Ile Pro Gly Ala Thr Ser Ile Gly Met Arg
Val Gln Ala Tyr 325 330 335Leu Tyr Asp Gly Tyr Trp Glu Asp Ile Gly
Thr Ile Glu Ala Phe Tyr 340 345 350Asn Ala Asn Leu Gly Ile Thr Lys
Lys Pro Val Pro Asp Phe Ser Phe 355 360 365Tyr Asp Arg Ser Ser Pro
Ile Tyr Thr Gln Pro Arg Tyr Leu Pro Pro 370 375 380Ser Lys Met Leu
Asp Ala Asp Val Thr Asp Ser Val Ile Gly Glu Gly385 390 395 400Cys
Val Ile Lys Asn Cys Lys Ile His His Ser Val Val Gly Leu Arg 405 410
415Ser Cys Ile Ser Glu Gly Ala Ile Ile Glu Asp Thr Leu Leu Met Gly
420 425 430Ala Asp Tyr Tyr Glu Thr Glu Ala Asp Lys Arg Phe Leu Ala
Ala Lys 435 440 445Gly Ser Val Pro Ile Gly Ile Gly Arg Asn Ser His
Ile Lys Arg Ala 450 455 460Ile Ile Asp Lys Asn Ala Arg Ile Gly Glu
Asn Val Lys Ile Ile Asn465 470 475 480Ser Asp Asn Val Gln Glu Ala
Ala Arg Glu Thr Asp Gly Tyr Phe Ile 485 490 495Lys Ser Gly Ile Val
Thr Val Ile Lys Asp Ala Leu Ile Pro Ser Gly 500 505 510Thr Val Ile
515291856DNAGlycine maxCDS(47)..(1594) 29ctttcaaccg agacactcac
aagtcacaac acacacacac atagca atg gca tct 55 Met Ala Ser 1atg gcg
gct ata ggt tct ctc aat gtt cca cgt tct gct tct tcc cgt 103Met Ala
Ala Ile Gly Ser Leu Asn Val Pro Arg Ser Ala Ser Ser Arg 5 10 15tca
tcc ttt gtg gga aga aaa agc gtt cca cgc agc ctt tcc ttc tct 151Ser
Ser Phe Val Gly Arg Lys Ser Val Pro Arg Ser Leu Ser Phe Ser20 25 30
35gca tca caa ctt tgt gga gac aag att ccc aca gat tca gtt tta ttg
199Ala Ser Gln Leu Cys Gly Asp Lys Ile Pro Thr Asp Ser Val Leu Leu
40 45 50gca cca aaa ata ggt cgc agt cca gtt atc gtt act cct aaa gca
gtt 247Ala Pro Lys Ile Gly Arg Ser Pro Val Ile Val Thr Pro Lys Ala
Val 55 60 65tct gat tcc caa aac tca caa acg tgc ctt gat ccc gat gct
agc aga 295Ser Asp Ser Gln Asn Ser Gln Thr Cys Leu Asp Pro Asp Ala
Ser Arg 70 75 80agt gtg ctt ggc att ata ctt gga ggt ggt gct ggg act
cgg ctt tat 343Ser Val Leu Gly Ile Ile Leu Gly Gly Gly Ala Gly Thr
Arg Leu Tyr 85 90 95cca ctc acc aag aag agg gca aag cca gct gtt cct
ctt gga gct aac 391Pro Leu Thr Lys Lys Arg Ala Lys Pro Ala Val Pro
Leu Gly Ala Asn100 105 110 115tat agg ctt att gat att cct gtt agc
aac tgc ttg aat agc aat gtc 439Tyr Arg Leu Ile Asp Ile Pro Val Ser
Asn Cys Leu Asn Ser Asn Val 120 125 130tcc aag atc tat gtt ctc act
caa ttc aat tct gcg tcg tta aac cga 487Ser Lys Ile Tyr Val Leu Thr
Gln Phe Asn Ser Ala Ser Leu Asn Arg 135 140 145cac ctt tct cgt gct
tat gca agc aac atg ggt ggc tac aaa aat gag 535His Leu Ser Arg Ala
Tyr Ala Ser Asn Met Gly Gly Tyr Lys Asn Glu 150 155 160gga ttt gtt
gag gtt ctt gct gct cag cag agt cct gag aat cct aat 583Gly Phe Val
Glu Val Leu Ala Ala Gln Gln Ser Pro Glu Asn Pro Asn 165 170 175tgg
ttc cag ggt act gca gat gct gtg agg cag tat ttg tgg ctt ttt 631Trp
Phe Gln Gly Thr Ala Asp Ala Val Arg Gln Tyr Leu Trp Leu Phe180 185
190 195gaa gag cac aat gtt ttg gaa ttc ttg gtt ctg gct ggt gac cat
ttg 679Glu Glu His Asn Val Leu Glu Phe Leu Val Leu Ala Gly Asp His
Leu 200 205 210tat cga atg gat tac gag aaa ttt atc caa gcg cat agg
gaa act gat 727Tyr Arg Met Asp Tyr Glu Lys Phe Ile Gln Ala His Arg
Glu Thr Asp 215 220 225gct gat atc act gtg gct gca ttg cca atg gat
gaa gcg cgt gcc act 775Ala Asp Ile Thr Val Ala Ala Leu Pro Met Asp
Glu Ala Arg Ala Thr 230 235 240gca ttt ggt ttg atg aag att gat gaa
gag ggg cgt ata att gaa ttt 823Ala Phe Gly Leu Met Lys Ile Asp Glu
Glu Gly Arg Ile Ile Glu Phe 245 250 255gct gaa aag cca aaa gga gaa
cag ttg aaa gct atg aag gtt gat act 871Ala Glu Lys Pro Lys Gly Glu
Gln Leu Lys Ala Met Lys Val Asp Thr260 265 270 275aca att ttg ggt
ctt gat gac gag aga gca aaa gaa atg cct tat att 919Thr Ile Leu Gly
Leu Asp Asp Glu Arg Ala Lys Glu Met Pro Tyr Ile 280 285 290gct agc
atg ggt ata tat gtt gtt agc aaa aat gtg atg tta gac ctg 967Ala Ser
Met Gly Ile Tyr Val Val Ser Lys Asn Val Met Leu Asp Leu 295 300
305ctc cgt gag aag ttt cct ggt gca aat gac ttt ggg agt gaa gtg att
1015Leu Arg Glu Lys Phe Pro Gly Ala Asn Asp Phe Gly Ser Glu Val Ile
310 315 320cct ggt gct act tct att gga atg aga gtg caa gct tac ttg
tat gat 1063Pro Gly Ala Thr Ser Ile Gly Met Arg Val Gln Ala Tyr Leu
Tyr Asp 325 330 335ggc tac tgg gaa gac att ggt aca atc gag gct ttc
tat aat gca aat 1111Gly Tyr Trp Glu Asp Ile Gly Thr Ile Glu Ala Phe
Tyr Asn Ala Asn340 345 350 355ctg gga atc acc aaa aag cct gtg cct
gac ttc agt ttc tat gat cgt 1159Leu Gly Ile Thr Lys Lys Pro Val Pro
Asp Phe Ser Phe Tyr Asp Arg 360 365 370tca tct cca atc tac acc caa
cca cga tat ttg cct ccc tct aag atg 1207Ser Ser Pro Ile Tyr Thr Gln
Pro Arg Tyr Leu Pro Pro Ser Lys Met 375 380 385ctt gat gct gat gtc
act gat agt gtt att ggt gaa gga tgt gtg att 1255Leu Asp Ala Asp Val
Thr Asp Ser Val Ile Gly Glu Gly Cys Val Ile 390 395 400aag aac tgc
aaa att cac cat tct gtg gtt ggg ctg cga tct tgc ata 1303Lys Asn Cys
Lys Ile His His Ser Val Val Gly Leu Arg Ser Cys Ile 405 410 415tca
gaa ggt gca att att gaa gac acg tta tta atg ggg gca gat tat 1351Ser
Glu Gly Ala Ile Ile Glu Asp Thr Leu Leu Met Gly Ala Asp Tyr420 425
430 435tac gag acg gag gct gat aag agg ttt ctg gct gcc aaa ggc agt
gtt 1399Tyr Glu Thr Glu Ala Asp Lys Arg Phe Leu Ala Ala Lys Gly Ser
Val 440 445 450cca att ggt ata ggc agg aac tct cat atc aaa agg gca
att att gac 1447Pro Ile Gly Ile Gly Arg Asn Ser His Ile Lys Arg Ala
Ile Ile Asp 455 460 465aag aat gct cga att ggg gaa aat gtc aag att
att aac agt gac aat 1495Lys Asn Ala Arg Ile Gly Glu Asn Val Lys Ile
Ile
Asn Ser Asp Asn 470 475 480gtc caa gaa gct gca agg gaa aca gat ggg
tat ttc ata aaa agt ggg 1543Val Gln Glu Ala Ala Arg Glu Thr Asp Gly
Tyr Phe Ile Lys Ser Gly 485 490 495att gtc aca gta atc aag gat gct
tta att cct agt gga aca gtc atc 1591Ile Val Thr Val Ile Lys Asp Ala
Leu Ile Pro Ser Gly Thr Val Ile500 505 510 515taa acacaaccac
ctccccaaaa aatttcttgt accccaaatc ctaatggtga 1644ctgcgaagct
cattaccacc gcaggagagt ttatcaagct ctgcttccac gtctaagata
1704ggcttttgtg tttcatgata tatatttttg ggcagtggct tgtaaataat
agcggaagag 1764aaggcccgct atgagcaatc acgctgtaaa gttcgttaat
caattcaata aaacaagttt 1824ctttatttcg tactaaaaaa aaaaaaaaaa aa
185630515PRTGlycine max 30Met Ala Ser Met Ala Ala Ile Gly Ser Leu
Asn Val Pro Arg Ser Ala1 5 10 15Ser Ser Arg Ser Ser Phe Val Gly Arg
Lys Ser Val Pro Arg Ser Leu 20 25 30Ser Phe Ser Ala Ser Gln Leu Cys
Gly Asp Lys Ile Pro Thr Asp Ser 35 40 45Val Leu Leu Ala Pro Lys Ile
Gly Arg Ser Pro Val Ile Val Thr Pro 50 55 60Lys Ala Val Ser Asp Ser
Gln Asn Ser Gln Thr Cys Leu Asp Pro Asp65 70 75 80Ala Ser Arg Ser
Val Leu Gly Ile Ile Leu Gly Gly Gly Ala Gly Thr 85 90 95Arg Leu Tyr
Pro Leu Thr Lys Lys Arg Ala Lys Pro Ala Val Pro Leu 100 105 110Gly
Ala Asn Tyr Arg Leu Ile Asp Ile Pro Val Ser Asn Cys Leu Asn 115 120
125Ser Asn Val Ser Lys Ile Tyr Val Leu Thr Gln Phe Asn Ser Ala Ser
130 135 140Leu Asn Arg His Leu Ser Arg Ala Tyr Ala Ser Asn Met Gly
Gly Tyr145 150 155 160Lys Asn Glu Gly Phe Val Glu Val Leu Ala Ala
Gln Gln Ser Pro Glu 165 170 175Asn Pro Asn Trp Phe Gln Gly Thr Ala
Asp Ala Val Arg Gln Tyr Leu 180 185 190Trp Leu Phe Glu Glu His Asn
Val Leu Glu Phe Leu Val Leu Ala Gly 195 200 205Asp His Leu Tyr Arg
Met Asp Tyr Glu Lys Phe Ile Gln Ala His Arg 210 215 220Glu Thr Asp
Ala Asp Ile Thr Val Ala Ala Leu Pro Met Asp Glu Ala225 230 235
240Arg Ala Thr Ala Phe Gly Leu Met Lys Ile Asp Glu Glu Gly Arg Ile
245 250 255Ile Glu Phe Ala Glu Lys Pro Lys Gly Glu Gln Leu Lys Ala
Met Lys 260 265 270Val Asp Thr Thr Ile Leu Gly Leu Asp Asp Glu Arg
Ala Lys Glu Met 275 280 285Pro Tyr Ile Ala Ser Met Gly Ile Tyr Val
Val Ser Lys Asn Val Met 290 295 300Leu Asp Leu Leu Arg Glu Lys Phe
Pro Gly Ala Asn Asp Phe Gly Ser305 310 315 320Glu Val Ile Pro Gly
Ala Thr Ser Ile Gly Met Arg Val Gln Ala Tyr 325 330 335Leu Tyr Asp
Gly Tyr Trp Glu Asp Ile Gly Thr Ile Glu Ala Phe Tyr 340 345 350Asn
Ala Asn Leu Gly Ile Thr Lys Lys Pro Val Pro Asp Phe Ser Phe 355 360
365Tyr Asp Arg Ser Ser Pro Ile Tyr Thr Gln Pro Arg Tyr Leu Pro Pro
370 375 380Ser Lys Met Leu Asp Ala Asp Val Thr Asp Ser Val Ile Gly
Glu Gly385 390 395 400Cys Val Ile Lys Asn Cys Lys Ile His His Ser
Val Val Gly Leu Arg 405 410 415Ser Cys Ile Ser Glu Gly Ala Ile Ile
Glu Asp Thr Leu Leu Met Gly 420 425 430Ala Asp Tyr Tyr Glu Thr Glu
Ala Asp Lys Arg Phe Leu Ala Ala Lys 435 440 445Gly Ser Val Pro Ile
Gly Ile Gly Arg Asn Ser His Ile Lys Arg Ala 450 455 460Ile Ile Asp
Lys Asn Ala Arg Ile Gly Glu Asn Val Lys Ile Ile Asn465 470 475
480Ser Asp Asn Val Gln Glu Ala Ala Arg Glu Thr Asp Gly Tyr Phe Ile
485 490 495Lys Ser Gly Ile Val Thr Val Ile Lys Asp Ala Leu Ile Pro
Ser Gly 500 505 510Thr Val Ile 51531515PRTPhaseolus vulgaris 31Met
Ala Ser Met Ala Ser Ile Gly Ser Leu Asn Val Pro Cys Ser Ser1 5 10
15Ser Ser Ser Ser Ser Asn Gly Gly Arg Lys Ile Leu Pro Arg Ala Leu
20 25 30Ser Phe Ser Ala Ser Gln Leu Tyr Gly Asp Lys Ile Ser Thr Asp
Ser 35 40 45Val Ser Val Ala Pro Lys Arg Val Arg Asn Pro Val Val Val
Ser Pro 50 55 60Lys Ala Val Ser Asp Ser Gln Asn Ser Gln Thr Cys Leu
Asp Pro Asp65 70 75 80Ala Ser Lys Ser Val Leu Gly Ile Ile Leu Gly
Gly Gly Ala Gly Thr 85 90 95Arg Leu Tyr Pro Leu Thr Lys Lys Arg Ala
Lys Pro Ala Val Pro Leu 100 105 110Gly Ala Asn Tyr Arg Leu Ile Asp
Ile Pro Val Ser Asn Cys Leu Asn 115 120 125Ser Asn Val Ser Lys Ile
Tyr Val Leu Thr Gln Phe Asn Ser Ala Ser 130 135 140Leu Asn Arg His
Leu Ser Arg Ala Tyr Ala Ser Asn Met Gly Gly Tyr145 150 155 160Lys
Asn Glu Gly Phe Val Glu Val Leu Ala Ala Gln Gln Ser Pro Glu 165 170
175Asn Pro Asn Trp Phe Gln Gly Thr Ala Asp Ala Val Arg Gln Tyr Leu
180 185 190Trp Leu Phe Glu Glu His Asn Val Leu Glu Tyr Leu Val Leu
Ala Gly 195 200 205Asp His Leu Tyr Arg Met Asp Tyr Glu Lys Phe Ile
Gln Val His Arg 210 215 220Glu Ser Asp Ala Asp Ile Thr Val Ala Ala
Leu Pro Met Asp Glu Asn225 230 235 240Arg Ala Thr Ala Phe Gly Leu
Met Lys Ile Asp Glu Glu Gly Arg Ile 245 250 255Ile Glu Phe Ala Glu
Lys Pro Lys Gly Glu Gln Leu Lys Ala Met Lys 260 265 270Val Asp Thr
Thr Ile Phe Gly Leu Asp Asp Glu Arg Ala Lys Glu Met 275 280 285Pro
Tyr Ile Ala Ser Met Gly Ile Tyr Val Val Ser Lys Asn Val Met 290 295
300Leu Asn Leu Leu Arg Glu Lys Phe Pro Ala Ala Asn Asp Phe Gly
Ser305 310 315 320Glu Val Ile Pro Gly Ala Thr Ser Ile Gly Leu Arg
Val Gln Ala Tyr 325 330 335Leu Tyr Asp Gly Tyr Trp Glu Asp Ile Gly
Thr Ile Glu Ala Phe Tyr 340 345 350Asn Ala Asn Leu Gly Ile Thr Lys
Lys Pro Val Pro Asp Phe Ser Phe 355 360 365Tyr Gly Arg Ser Ser Pro
Ile Tyr Thr Gln Pro Arg Tyr Leu Pro Pro 370 375 380Ser Lys Met Leu
Asp Ala Asp Val Thr Asp Ser Val Ile Gly Glu Gly385 390 395 400Cys
Val Ile Lys Asn Cys Lys Ile His His Ser Val Val Gly Leu Arg 405 410
415Ser Cys Ile Ser Glu Gly Ala Ile Ile Glu Asp Thr Leu Leu Met Gly
420 425 430Ala Asp Tyr Tyr Glu Thr Asp Ala Asp Lys Arg Phe Leu Ala
Ala Lys 435 440 445Gly Ser Val Pro Ile Gly Ile Gly Arg Asn Ser His
Val Lys Arg Ala 450 455 460Ile Ile Asp Lys Asn Ala Arg Ile Gly Glu
Asn Val Lys Ile Leu Asn465 470 475 480Ser Asp Asn Val Gln Glu Ala
Ala Arg Glu Thr Asp Gly Tyr Phe Ile 485 490 495Lys Ser Gly Ile Val
Thr Val Ile Lys Asp Ala Leu Ile Pro Ser Gly 500 505 510Thr Val Ile
51532515PRTGlycine max 32Met Ala Ser Met Ala Ala Ile Gly Ser Leu
Asn Val Pro Arg Ser Ala1 5 10 15Ser Ser Arg Ser Ser Phe Val Gly Arg
Lys Ser Val Pro Arg Ser Leu 20 25 30Ser Phe Ser Ala Ser Gln Leu Cys
Gly Asp Lys Ile Pro Thr Asp Ser 35 40 45Val Leu Leu Ala Pro Lys Ile
Gly Arg Ser Pro Val Ile Val Thr Pro 50 55 60Lys Ala Val Ser Asp Ser
Gln Asn Ser Gln Thr Cys Leu Asp Pro Asp65 70 75 80Ala Ser Arg Ser
Val Leu Gly Ile Ile Leu Gly Gly Gly Ala Gly Thr 85 90 95Arg Leu Tyr
Pro Leu Thr Lys Lys Arg Ala Lys Pro Ala Val Pro Leu 100 105 110Gly
Ala Asn Tyr Arg Leu Ile Asp Ile Pro Val Ser Asn Cys Leu Asn 115 120
125Ser Asn Val Ser Lys Ile Tyr Val Leu Thr Gln Phe Asn Ser Ala Ser
130 135 140Leu Asn Arg His Leu Ser Arg Ala Tyr Ala Ser Asn Met Gly
Gly Tyr145 150 155 160Lys Asn Glu Gly Phe Val Glu Val Leu Ala Ala
Gln Gln Ser Pro Glu 165 170 175Asn Pro Asn Trp Phe Gln Gly Thr Ala
Asp Ala Val Arg Gln Tyr Leu 180 185 190Trp Leu Phe Glu Glu His Asn
Val Leu Glu Phe Leu Val Leu Ala Gly 195 200 205Asp His Leu Tyr Arg
Met Asp Tyr Glu Lys Phe Ile Gln Ala His Arg 210 215 220Glu Thr Asp
Ala Asp Ile Thr Val Ala Ala Leu Pro Met Asp Glu Ala225 230 235
240Arg Ala Thr Ala Phe Gly Leu Met Lys Ile Asp Glu Glu Gly Arg Ile
245 250 255Ile Glu Phe Ala Glu Lys Pro Lys Gly Glu Gln Leu Lys Ala
Met Lys 260 265 270Val Asp Thr Thr Ile Leu Gly Leu Asp Asp Glu Arg
Ala Lys Glu Met 275 280 285Pro Tyr Ile Ala Ser Met Gly Ile Tyr Val
Val Ser Lys Asn Val Met 290 295 300Leu Asp Leu Leu Arg Glu Lys Phe
Pro Gly Ala Asn Asp Phe Gly Ser305 310 315 320Glu Val Ile Pro Gly
Ala Thr Ser Ile Gly Met Arg Val Gln Ala Tyr 325 330 335Leu Tyr Asp
Gly Tyr Trp Glu Asp Ile Gly Thr Ile Glu Ala Phe Tyr 340 345 350Asn
Ala Asn Leu Gly Ile Thr Lys Lys Pro Val Pro Asp Phe Ser Phe 355 360
365Tyr Asp Arg Ser Ser Pro Ile Tyr Thr Gln Pro Arg Tyr Leu Pro Pro
370 375 380Ser Lys Met Leu Asp Ala Asp Val Thr Asp Ser Val Ile Gly
Glu Gly385 390 395 400Cys Val Ile Lys Asn Cys Lys Ile His His Ser
Val Val Gly Leu Arg 405 410 415Ser Cys Ile Ser Glu Gly Ala Ile Ile
Glu Asp Thr Leu Leu Met Gly 420 425 430Ala Asp Tyr Tyr Glu Thr Glu
Ala Asp Lys Arg Phe Leu Ala Ala Lys 435 440 445Gly Ser Val Pro Ile
Gly Ile Gly Arg Asn Ser His Ile Lys Arg Ala 450 455 460Ile Ile Asp
Lys Asn Ala Arg Ile Gly Glu Asn Val Lys Ile Ile Asn465 470 475
480Ser Asp Asn Val Gln Glu Ala Ala Arg Glu Thr Asp Gly Tyr Phe Ile
485 490 495Lys Ser Gly Ile Val Thr Val Ile Lys Asp Ala Leu Ile Pro
Ser Gly 500 505 510Thr Val Ile 515
* * * * *