U.S. patent application number 11/807330 was filed with the patent office on 2011-12-29 for multiple-tumor aberrant growth genes.
This patent application is currently assigned to Vlaams Interuniversitair Instituut Voor. Invention is credited to Jorn Bullerdiek, Rafael Mols, Henricus Franciscus Petrus Maria Schoenmakers, Willem Jan Marie Van de Ven.
Application Number | 20110318834 11/807330 |
Document ID | / |
Family ID | 8220025 |
Filed Date | 2011-12-29 |
![](/patent/app/20110318834/US20110318834A1-20111229-C00001.png)
![](/patent/app/20110318834/US20110318834A1-20111229-D00001.png)
![](/patent/app/20110318834/US20110318834A1-20111229-D00002.png)
![](/patent/app/20110318834/US20110318834A1-20111229-D00003.png)
![](/patent/app/20110318834/US20110318834A1-20111229-D00004.png)
![](/patent/app/20110318834/US20110318834A1-20111229-D00005.png)
![](/patent/app/20110318834/US20110318834A1-20111229-D00006.png)
![](/patent/app/20110318834/US20110318834A1-20111229-D00007.png)
![](/patent/app/20110318834/US20110318834A1-20111229-D00008.png)
![](/patent/app/20110318834/US20110318834A1-20111229-D00009.png)
![](/patent/app/20110318834/US20110318834A1-20111229-D00010.png)
View All Diagrams
United States Patent
Application |
20110318834 |
Kind Code |
A1 |
Bullerdiek; Jorn ; et
al. |
December 29, 2011 |
Multiple-tumor aberrant growth genes
Abstract
The invention relates to the multi-tumor aberrant growth gene
having the nucleotide sequence of any one of the strands of any one
of the members of the High Mobility Group protein genes or LIM
protein genes, including modified versions and derivatives thereof.
The gene and its derivatives may be used in various diagnostic and
therapeutic applications.
Inventors: |
Bullerdiek; Jorn; (Bremen,
DE) ; Van de Ven; Willem Jan Marie; (Leuven, DE)
; Schoenmakers; Henricus Franciscus Petrus Maria;
(Geldrop, NL) ; Mols; Rafael; (Hallaar,
BE) |
Assignee: |
Vlaams Interuniversitair Instituut
Voor
Zwijnaarde
BE
|
Family ID: |
8220025 |
Appl. No.: |
11/807330 |
Filed: |
May 25, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10352615 |
Jan 28, 2003 |
|
|
|
11807330 |
|
|
|
|
08894454 |
Oct 20, 1997 |
6544784 |
|
|
PCT/EP96/00716 |
Feb 19, 1996 |
|
|
|
10352615 |
|
|
|
|
Current U.S.
Class: |
435/375 ;
536/24.5 |
Current CPC
Class: |
C12Q 2600/158 20130101;
C07K 14/4702 20130101; C12Q 2600/156 20130101; A61P 31/00 20180101;
A61K 38/00 20130101; A61P 35/02 20180101; A61P 43/00 20180101; C12Q
2600/112 20130101; C12Q 1/6841 20130101; A61P 9/10 20180101; C07K
14/705 20130101; C12Q 1/6886 20130101; A61P 35/00 20180101 |
Class at
Publication: |
435/375 ;
536/24.5 |
International
Class: |
C12N 5/09 20100101
C12N005/09; C07H 21/00 20060101 C07H021/00 |
Foreign Application Data
Date |
Code |
Application Number |
Feb 17, 1995 |
EP |
95200390.3 |
Jul 14, 1995 |
EP |
95201951.1 |
Claims
1. A method for treating cells having a non-physiological
proliferative capacity or macromolecules derived therefrom
comprising contacting the cells or macromolecules with a nucleic
acid substantially corresponding to or complementary to the HMGI-C
gene, a derivative of the gene or a modulator of expression of the
gene.
2. The method as claimed in claim 1, further comprising a method
for treating cells having a non-physiological proliferative
capacity and including the step of contacting said cells with a
nucleic acid substantially corresponding to or complementary to the
HMGI-C gene, a derivative of the gene, or a modulator of expression
of the gene.
3. The method as claimed in claim 1, wherein said nucleic acid
comprises a derivative of a multi-tumor aberrant growth gene,
wherein the derivative is a nucleic acid substantially
corresponding to a truncated version of the HMGI-C gene selected
from the group consisting of: a) exons 1, 2 and 3 and truncated in
intron 3 after nucleotide sequence TAGGAAATGG (SEQ ID NO: 103); b)
exons 1, 2, 3 and 4 and truncated in intron 4 after nucleotide
sequence GCCTGCTCAG (SEQ ID NO: 134); and c) a complete coding
sequence of HMGI-C and truncated in the 3' untranslated region
after one of the sequences: TABLE-US-00011 TATCCTTTCA (SEQ ID NO:
135) TCTTTCCACT (SEQ ID NO: 136) ATACCACTTA (SEQ ID NO: 137)
TTGCCATGGT (SEQ ID NO: 138) CACTTTCATC (SEQ ID NO: 139) ATAAGGACTA
(SEQ ID NO: 140) NCTTGTNAGC. (SEQ ID NO: 141)
4. A macromolecule for incorporation in a therapeutic composition
for cancer treatment, comprising a derivative of a multi-tumor
aberrant growth gene, wherein the derivative is a nucleic acid
substantially corresponding to a truncated version of the HMGI-C
gene selected from the group consisting of: a) exons 1, 2 and 3 and
truncated in intron 3 after nucleotide sequence TAGGAAATGG (SEQ ID
NO: 103); b) exons 1, 2, 3 and 4 and truncated in intron 4 after
nucleotide sequence GCCTGCTCAG (SEQ ID NO: 134); and c) a complete
coding sequence of HMGI-C and truncated in the 3' untranslated
region after one of the sequences: TABLE-US-00012 TATCCTTTCA (SEQ
ID NO: 135) TCTTTCCACT (SEQ ID NO: 136) ATACCACTTA (SEQ ID NO: 137)
TTGCCATGGT (SEQ ID NO: 138) CACTTTCATC (SEQ ID NO: 139) ATAAGGACTA
(SEQ ID NO: 140) NCTTGTNAGC. (SEQ ID NO: 141)
5. The macromolecule as claimed in claim 4, wherein the derivative
comprises a hybrid of the truncated version of the HMGI-C gene and
its translocation partner, and the 5' end of the translocation
partner is identifiable by one of a sequence selected from the
group consisting of SEQ ID NOs: 104-133 and 142-159.
6. The method as claimed in claim 1, wherein the complementary
nucleic acid is an anti-sense molecule.
Description
[0001] The present invention relates to the identification of the
High Mobility Group (HMG) protein gene family as a family of genes
frequently associated with aberrant cell growth as found in a
variety of both benign and malignant tumors. The invention in
particular relates to the identification of a member of the HMG
family as the broadly acting chromosome 12 breakpoint region gene
involved in a number of tumors, including but not limited to the
mesenchymal tumors hamartomas (e.g. breast and lung), lipomas,
pleomorphic salivary gland adenomas, uterine leiomyomas,
angiomyxomas, fibroadenomas of the breast, polyps of the
endometrium, atherosclerotic plaques, and other benign tumors as
well as various malignant tumors, including but not limited to
sarcomas (e.g. rhabdomyosarcoma, osteosarcoma) and carcinomas (e.g.
of breast, lung, skin, thyroid), as well as leukemias and
lymphomas. The invention also relates to another member of the HMG
gene family that was found to be implicated in breaks in chromosome
6.
[0002] Furthermore, the invention concerns the identification of
members of the LIM protein family as another type of tumor-type
specific breakpoint region genes and frequent fusion partners of
the HMG genes in these tumors. The LPP (Lipoma Preferred Partner)
gene of this family is found to be specific for lipomas. The
invention relates in particular to the use of the members of the
HMG and LIM gene family and their derivatives in diagnosis and
therapy.
[0003] Multiple independent cytogenetic studies have firmly
implicated region % q13-q15 of chromosome 12 in a variety of benign
and malignant solid tumor types. Among benign solid tumors,
involvement of 12q13-q15 is frequently observed in benign adipose
tissue tumors [1], uterine leiomyomas [2,3], and pleomorphic
adenomas of the salivary glands [4,5]. Involvement of the same
region has also been reported for endometrial polyps [6,7] for
hemangio-pericytoma [8], and far chondromatous tumors [9, 10, 11,
12]. Recently, the involvement of chromosome 12q13-q15 was reported
in pulmonary chondroid hamartoma [13, 14]. Finally, several case
reports of solid tumors with involvement of chromosome region
12q13-q15 have been published; e.g. tumors of the breast [15, 16],
diffuse astrocytomas [17], and a giant-cell tumor of the bone [18].
Malignant tumor types with recurrent aberrations in 12813-q15
include myxoid liposarcoma [18], soft tissue clear-cell sarcoma
[20, 21, 22], and a subgroup of rhabdomyosarcoma [23].
[0004] Although these studies indicated that the same cytogenetic
region of chromosome 12 is often involved in chromosome
aberrations, like translocations, in these solid tumors, the
precise nature of the chromosome 12 breakpoints in the various
tumors is still not known. Neither was it established which genes
are affected directly by the translocations.
[0005] In previous physical mapping studies [38], the chromosome
12q breakpoints in lipoma, pleomorphic salivary gland adenoma, and
uterine leiomyoma were mapped between locus D12S8 and the CROP gene
and it was shown that D12S8 is located distal to CHOP. Recently, it
was also found by FISH analysis that the chromosome 12q breakpoints
in a hamartoma of the breast, an angiomyxoma and multiple pulmonary
chondroid hamartomas are mapping within this DNA interval. In an
effort to molecularly clone the genes affected by the chromosome
12q13-q15 aberrations in the various tumors, the present inventors
chose directional chromosome walking as a structural approach to
define the DNA region encompassing these breakpoints.
[0006] As a starting point for chromosome walking, locus D12S8 was
used. During these walking studies, it was shown that the
chromosomal breakpoints as present in a number of uterine
leiomyoma-derived cell lines are clustered within a 445 kb
chromosomal segment which has been designated Uterine Leiomyoma
Cluster Region on chromosome 12 (ULCR12) [24]. Subsequently, it was
found that a 1.7 Mb region on chromosome 12 encompasses the
chromosome 12 breakpoints of uterine leiomyoma-, lipoma-, and
salivary gland adenoma-cells, with the breakpoint cluster regions
of the various tumor types overlapping [25, "ANNEX 1"]. This 1.7 Mb
region on the long arm of chromosome 12, which contains ULCR12
obviously, was designated Multiple Aberration Region (MAR) to
reflect this feature. In a regional fine mapping study, MAR was
recently assigned to 12q15.
[0007] It has thus been found that essentially all breakpoints of
chromosome 12 map in a 1.7 Mb region indicated herein as the
"Multiple Aberration Region" or MAR. Further research revealed that
in this region a member of the High Mobility Group gene family, the
HMGI-C gene, can be identified as a postulated multi-tumor aberrant
growth gene (MAC). The same applies to members of the LIM family
which are also found to be involved in chromosome aberrations. Of
these the chromosome 3-derived Lipoma-Preferred Partner (LPP) gene
is particularly implicated in lipomas.
[0008] LIM proteins are proteins carrying cystein-rich zinc-binding
domains, so-called LIM domains. They are involved in
protein-protein interactions [for a review see ref. 80]. One of the
members of the protein family is the now disclosed LPP protein
mapping at chromosome 3.
[0009] According to the present invention the aberrations in the
HMGI-C gene on chromosome 12 and the LPP gene on chromosome 3 have
been used as a model to reveal the more general concept of the
involvement of members of the HMG and LIM gene families in both
benign and malignant tumors. To demonstrate that there exists a
more general concept of gene families, which, when affected by
chromosome rearrangements, lead to a particular group of tumor
growth, the present inventors demonstrated that the HMGI(Y) gene,
which is a member of the HMG family, is involved in breaks in
chromosome 6.
[0010] Although both the HMG and LIM gene families are known per
se, up till the present invention the correlation between these
families and tumor inducing chromosome aberrations, like
translocations, deletions, insertions and inversions, has not been
anticipated. Furthermore, until now it was not previously
demonstrated that alterations in the physiological expression level
of the members of the gene family are probably also implicated in
tumor development. According to the invention it was demonstrated
that in normal adult cells the expression level of the HMGI-C gene
is practically undetectable, whereas in aberrantly growing cells
the expression level is significantly increased.
[0011] Based on these insights this present invention now provides
for the members of the gene families or derivatives thereof in
isolated form and their use in diagnostic and therapeutic
applications. Furthermore the knowledge on the location and
nucleotide sequence of the genes may be wed to study their
rearrangements or expression and to identify a possible increase or
decrease in their expression level and the affects thereof on cell
growth. Based on this information diagnostic tests or therapeutic
treatments may be designed.
[0012] In this application the term "Multi-tumor Aberrant Growth
(or MAGI gene" will be used to indicate the involvement of these
types of genes in various types of cancer. The term refers to all
members of the HMG and LIM gene families involved in
non-physiological proliferative growth, and in particular involved
in malignant or benign tumors, including atherosclerotic plaques.
However, according to the invention it was furthermore found that
even breaks outside the actual gene but in the vicinity thereof
might result in aberrant growth. The term MAG gene is therefore
also intended to include the immediate vicinity of the gene. The
skilled person will understand that the "immediate vicinity" should
be understood to include the surroundings of the gene in which
breaks or rearrangements will result in the above defined
non-physiological proliferative growth.
[0013] The term "wildtype cell" is used to indicate the cell not
harbouring an aberrant chromosome or to a cell having a
physiological expression level of the relevant gene. "Wildtype" or
"normal" chromosome refers to a non-aberrant chromosome.
[0014] The present invention provides for various diagnostic and
therapeutic applications that are based on the information that may
be derived from the genes. This information not only encompasses
its nucleotide sequence or the amino acid sequence of the gene
product derived from the gene, but also involves the levels of
transcription or translation of the gene.
[0015] The invention is thus two-fold. On the one hand the
aberration in cell growth may be directly or indirectly caused by
the physical breaks that occur in the gene or its vicinity. On the
other hand the aberration in cell growth may be caused by a
non-physiological expression level of the gene. This
non-physiological expression level may be caused by the break, or
may be due to another stimulus that activates or deactivates the
gene. At present the exact mechanism or origin of the aberrant cell
growth is not yet unraveled. However, exact knowledge on this
mechanism is not necessary to define methods of diagnosis or
treatment.
[0016] Diagnostic methods according to the invention are thus based
an the fact that an aberration in a chromosome results in a
detectable alteration in the chromosomes' appearance or biochemical
behaviour. A translocation, for example will result in a first part
of the chromosome (and consequently of the MAG gene) having been
substituted for another (second) part (further-referred to as
"first and second substitution parts"). The first part will often
appear someplace else on another chromosome from which the second
part originates. As a consequence hybrids will be formed between
the remaining parts of both (or in cases of triple translocations,
even more) chromosomes and the substitution parts provided by their
translocation partners. Since it has now been found that the breaks
occur in a NAG gene this will result in hybrid gene products of
that MAG gene. Markers, such as hybridising molecules like RNA, DNA
or DNA/RNA hybrids, or antibodies will be able to detect such
hybrids, both on the DNA level, and on the RNA or protein
level.
[0017] For example, the transcript of a hybrid will still comprise
the region provided by the remaining part of the gene/chromosome
but will miss the region provided by the substitution part that has
been translocated. In the case of inversions, deletions and
insertions the gene may be equally afflicted.
[0018] Translocations are usually also cytogenetically detectable.
The other aberrations are more difficult to find because they are
often not visible on a cytogenetical level. The invention now
provides possibilities for diagnosing all these types of
chromosomal aberrations.
[0019] In translocations markers or probes based on the MAC gene
for the remaining and substitution parts of a chromosome in situ
detect the remaining part on the original chromosome but the
substitution part on another, the translocation partner.
[0020] In the case of inversions for example, two probes will
hybridise at a specific distance in the wildtype gene. This
distance might however change due to an inversion. In situ such
inversion may thus be visualized by labeling a set of suitable
probes with the same or different detectable markers, such as
fluorescent labels. Deletions and insertions may be detected in a
similar manner.
[0021] According to the invention the above in situ applications
can very advantageously be performed by using FISH techniques. The
markers are e.g. two cosmids one of which comprises exons 1 to 3 of
the MAG gene, while the other comprises exons 4 and 5. Both cosmids
are labeled with different fluorescent markers, e.g. blue and
yellow. The normal chromosome will show a combination of both
labels, thus giving a green signal, while the translocation is
visible as a blue signal on the remaining part of one chromosome
(e.g. 12) while the yellow signal is found on another chromosome
comprising the substitution part. In case the same labels are used
for both probes, the intensity of the signal on the normal
chromosome will be 100%, while the signal on the aberrant
chromosomes is 50%. In the case of inversions one of the signals
shifts from one place on the normal chromosome to another on the
aberrant one.
[0022] In the above applications a reference must be included for
comparison. Usually only one of the two chromosomes is afflicted.
It will thus be very convenient to use the normal chromosome as an
internal reference. Furthermore it is important to select one of
the markers on the remaining or unchanging part of the chromosome
and the other on the substitution or inverted part. In the case of
the MAC gene of chromosome 12, breaks are usually found in the big
intron between exons 3 and 4 as is shown by the present invention.
Furthermore breaks were detected between exons 4 and 5. Probes
based on exons 1 to 3 and 4 and 5, or probes based on either exon 4
or on exon 5 are thus very useful. As an alternative a combination
of probes based on both translocation or fusion partners may be
used. For example, for the identification of lipomas one may use
probes based on exons 1 to 3 of the HMGI-C gene on the one hand and
based on the LIM domains of the LPP gene on the other hand.
[0023] Furthermore it was found that breaks might also occur
outside the gene, i.e. 5' or 3' thereof. The choice of the probes
will then of course include at least one probe hybrising to a DNA
sequence located 5' or 31 of the gene.
[0024] "Probes" as used herein should be widely interpreted and
include but are not limited to linear DNA or RNA strands, Yeast
Artificial Chromosomes (YACs), or circular DNA forms; such as
plasmids, phages, cosmids etc.
[0025] These in situ methods may be used on metaphase and
interphase chromosomes.
[0026] Besides the above described in situ methods various
diagnostic techniques may be performed an a more biochemical level,
for example based on alterations in the DNA, RNA or protein, or on
changes in the physiological expression level of the gene.
[0027] Basis for the methods that are based on alterations in the
chromosome's biochemical behaviour is the fact that by choosing
suitable probes, variations in the length or composition in the
gene, transcript or protein may be detected on a gel or blot.
Variations in length are visible because the normal gene,
transcript(s) or protein(s) will appear in another place on the gel
or blot then the aberrant one(s). In case of a translocation more
than the normal number of spots will appear.
[0028] Based on the above principle the invention may thus for
example relate to a method of diagnosing cells having a
non-physiological proliferative capacity, comprising the steps of
taking a biopsy of the cells to be diagnosed, isolating a suitable
NAG gene-related macromolecule therefrom, and analysing the
macromolecule thus obtained by comparison with a reference molecule
originating from cells not showing a non-physiological
proliferative capacity, preferably from the same individual. The
MAG gene-related macromolecule may thus be a DNA, an RNA or a
protein. The MAG gene may be either a member of the HMG family or
of the LIM family.
[0029] In a specific embodiment of this type of diagnostic method
the invention comprises the steps of taking a biopsy of the cells
to be diagnosed, extracting total RNA thereof, preparing a first
strand cDNA of the mRNA species in the total RNA extract or
poly-A-selected fraction(s) thereof, which cDNA comprises a
suitable tail; performing a PCR using a MAG gene specific primer
and a tail-specific primer in order to amplify MAC gene specific
cDNA's; separating the PCR products on a gel to obtain a pattern of
bands; evaluating the presence of aberrant bands by comparison to
wildtype bands, preferably originating from the same
individual.
[0030] As an alternative amplification may be performed by means of
the Nucleic Acid Sequence-Based Amplification (NASBA) technique
[81] or variations thereof.
[0031] In another embodiment the method comprises the steps of
taking a biopsy of the cells to be diagnosed, isolating total
protein therefrom, separating the total protein on a gel to obtain
essentially individual bands, optionally transferring the bands to
a Western blot, hybridising the bands thus obtained with antibodies
directed against a part of the protein encoded by the remaining
part of the MAG gene and against a part of the protein encoded by
the substitution part of the NAG gene; visualizing the
antigen-antibody reactions and establishing the presence of
aberrant bands by comparison with bands from wildtype proteins,
preferably originating from the same individual.
[0032] In a further embodiment the method comprises taking a biopsy
of the cells to be diagnosed; isolating total DNA therefrom;
digesting the DNA with one or more so-called "rare cutter"
restriction enzymes (typically "6- or more cutters"); separating
the digest thus prepared on a gel to obtain a separation pattern;
optionally transferring the separation pattern to a Southern blot;
hybridising the separation pattern in the gel or on the blot with a
set of probes under hybridising conditions; visualizing the
hybridizations and establishing the presence of aberrant bands by
comparison to wildtype bands, preferably originating from the same
individual.
[0033] Changes in the expression level of the gene may be detected
by measuring mRNA levels or protein levels by means of a suitable
probe.
[0034] Diagnostic methods based on abnormal expression levels of
the gene may comprise the steps of taking a sample of the cells to
be diagnosed; isolating mRNA therefrom; and establishing the
presence and/or the (relative) quantity of mRNA transcribed from
the MAG gene of interest in comparison to a control. Establishing
the presence or (relative) quantity of the mRNA may be achieved by
amplifying at least part of the mRNA of the NAG gene by means of
RT-PCR or similar amplification techniques. In an alternative
embodiment the expression level may be established by determination
of the presence or the amount of the gene product (e.g. protein) by
means of for example monoclonal antibodies.
[0035] The diagnostic methods of the invention may be used for
diseases wherein cells having a non-physiological proliferative
capacity are selected from the group consisting of benign tumors,
such as the mesenchymal tumors hamartomas (e.g. breast and lung),
adipose tissue tumors (e.g. Upraises), pleomorphic salivary gland
adenomas, uterine leiomyomas, angiomyxomas, fibroadenomas of the
breast, polyps of the endometrium, atherosclerotic plaques, and
other benign tumors as well as various malignant tumors, including
but not limited to sarcomas (e.g. rhabdomyosarcoma, osteosarcoma)
and carcinomas (e.g. of breast, lung, skin, thyroid). The invention
is not limited to the diagnosis and treatment of so-called benign
and malignant solid tumors, but the principles thereof have been
found to also apply to haematological malignancies like leukemias
and lymphomas.
[0036] Recent publications indicate that atherosclerotic plaques
also involve abnormal proliferation [26] of mainly smooth muscle
cells and it was postulated that atherosclerotic plaques constitute
benign tumors [27]. Therefore, this type of disorder is also to be
understood as a possible indication for the use of the MAG gene
family, in particular in diagnostic and therapeutic
applications.
[0037] As already indicated above it has been found that in certain
malignant tumors the expression level of the HMG genes is increased
[26]. Until now the relevance of this observation was not
understood. Another aspect of the invention thus relates to the
implementation of the identification of the NAG genes in therapy.
The invention for example provides anti-sense molecules or
expression inhibitors of the MAG gene for use in the treatment of
diseases involving cells having a non-physiological proliferative
capacity by modulating the expression of the gene. A
non-physiological high expression may thus be normalized by means
of antisense RNA that is either administered to the cell or
expressed thereby and binds to the mRNA, or antibodies directed to
the gene product, which in turn may result in a normalisation of
the cell growth. The examples will demonstrate that expression of
antisense RNA in leukemic cells results in a re-differentiation of
the cells back to normal.
[0038] The invention thus provides derivatives of the NAG gene
and/or its immediate environment for use in diagnosis and the
preparation of therapeutical compositions, wherein the derivatives
are selected from the group consisting of sense and anti-sense cDNA
or fragments thereof, transcripts of the gene or fragments thereof,
antisense RNA, triple helix inducing molecule or other types of
"transcription clamps", fragments of the gene or its complementary
strand, proteins encoded by the gene or fragments thereof, protein
nucleic acids (PNA), antibodies directed to the gene, the cDNA, the
transcript, the protein or the fragments thereof, as well as
antibody fragments. Besides the use of direct derivatives of the
genes and their surroundings (flanking sequences) in diagnosis and
therapy, other molecules, like expression inhibitors or expression
enhancers, may be used for therapeutic treatment according to the
invention. An example of this type of molecule are ribozymes that
destroy RNA molecules.
[0039] Besides the above described therapeutic and diagnostic
methods the principles of the invention may also be used for
producing a transgenic animal model for testing pharmaceuticals for
treatment of MAC gene related malignant or benign tumors and
atherosclerotic plaques. One of the examples describes the
production of such an animal model.
[0040] It is to be understood that the principles of the present
invention are described herein for illustration purposes only with
reference to the HMGI-C gene mapping at chromosome 12 and the
HMGI(Y) gene mapping at chromosome 6 and the LPP gene on chromosome
3. Based on the information provided in this application the
skilled person will be able to isolate and sequence corresponding
genes of the gene family and apply the principles of this invention
by using the gene and its sequence without departing from the scope
of the general concept of this invention.
[0041] The present invention will thus be further elucidated by the
following examples which are in no way intended to limit the scope
thereof.
EXAMPLES
Example 1
1. Introduction
[0042] This example describes the isolation and analysis of 75
overlapping YAC clones and the establishment of a YAC contig (set
of overlapping clones), which spans about 6 Mb of genomic DNA
around locus D12S8 and includes MAR. The orientation of the YAC
contig on the long arm of chromosome 12 was determined by
double-color FISH analysis. On the basis of STS-content mapping and
restriction enzyme analysis, a long range physical map of this 6 Mb
DNA region was established. The contig represents a useful resource
for cDNA capture aimed at identifying genes located in 12q15,
including the one directly affected by the various chromosome 12
aberrations.
2. Materials and Methods
2.1. Cell Lines
[0043] Cell-lines PK89-12 and LIS-3/SV40/A9-B4 were used for
Chromosome Assignment using Somatic cell Hybrids (CASH)
experiments. PK89-12, which contains chromosome 12 as the sale
human chromosome in a hamster genetic background, has been
described before [29]. PK89-12 cells were grown in DME-F12 medium
supplemented with 10% fetal bovine serum, 200 IU/ml penicillin, and
200 .mu.g/ml streptomycin. Somatic cell hybrid LIS-3/SV40/A9-B4 was
obtained upon fusion of myxoid liposarcoma cell line LIS-3/SV40,
which carries a t(12; 16) (q13; p11.2), and mouse A9 cells and was
previously shown to contain der (16), but neither der (12) nor the
normal chromosome 12 [30]. LIS-3/SV40/A9-B4 cells were grown in
selective AOA-medium (AOA-medium which consisted of DME-F12 medium
supplemented with 10% fetal bovine serum, 0.05 mM adenine, 0.05 mM
ouabain, and 0.01 mM azaserine). Both cell lines were frequently
assayed by standard cytogenetic techniques.
2.2. Nucleotide Sequence Analysis and Oligonucleotides.
[0044] Nucleotide sequences ware determined according to the
dideoxy chain termination method using a T7 polymerase sequencing
kit (Pharmacia/LKB) or a dsDNA Cycle Sequencing System (GIBCO/HRL).
DNA fragments ware subcloned in pGEM-3Zf(+) and sequenced using
FITC-labelled standard SP6 or T7 primers, or specific primers
synthesized based upon newly obtained sequences. Sequencing results
were obtained using an Automated Laser Fluorescent (A.L.F.) DNA
sequencer (Pharmacia Biotech) and standard 30 cm, 6%
Hydrolink.RTM., Long Range.TM. gels Biochem). The nucleotide
sequences were analyzed using the sequence analysis software
Genepro (Riverside Scientific), PC/Gene (IntelliGenetics), the
IntelliGenetics Suite software package (IntelliGenetics, Inc.), and
Oligo [31]. All oligonucleotides were purchased from Pharmacia
Biotech.
2.3. Chromosome Preparations and Fluorescence In Situ Hybridization
(FISH)
[0045] FISH analysis of YAC clones was performed to establish their
chromosomal positions and to identify chimeric clones. FISH
analysis of cosmid clones corresponding to STSs of YAC insert ands
were performed to establish their chromosomal positions. Cosmids
were isolated from human genomic library CMLW-25383 [32] or the
arrayed chromosome 12-specific library constructed at Lawrence
Livermore National Laboratory (LL12NC01, ref. 33) according to
standard procedures [34]. Routine FISH analysis was performed
essentially as described before [30, 35]. DNA was labelled with
biotin-11-dUTP (Boehringer) using the protocol of Kievits et al.
[36]. Antifade medium, consisting of DABCO (2 g/100 ml, Sigma), 0.1
M Tris-HCL pH 8, 0.02% Thimerosal, and glycerol (90%), and
containing propidium iodide (0.5 .mu.g/ml, Sigma) as a
counterstain, was added 15 min before specimens were analyzed on a
Zeiss Axiophot fluorescence microscope using a double band-pass
filter for FITC/Texas red (Omega Optical, Inc.). Results were
recorded on Scotch (3M) 640 ASA film.
[0046] For the double colour FISH experiments, LLNL12NC01-96C11 was
labelled with digoxygenin-11-dUTP (Boehringer) and cosmids
LLNL12NC01-1F6 and -193F10, with biotin-11-dUTP. Equal amounts of
each probe were combined and this mixture was used for
hybridization. After hybridization, slides were incubated for 20
min with Avidin-FITC and then washed as described by Kievits at al.
[36]. Subsequent series of incubations in TNB buffer (0.1 M
Tris-HCl pH 7.5, 0.15 M NaCl, 0.5% Boehringer blocking agent
(Boehringer)) and washing steps were performed in TNT buffer (0.1 M
Tris-HCl pH 7.5, 0.15M NaCl, 0.05% Tween-20); all incubations ware
performed at 37.degree. C. for 30 min. During the second
incubation, Goat-.alpha.-Avidin-biotin (Vector) and
Mouse-.alpha.-digoxygenin (Sigma) were applied simultaneously.
During the third incubation, Avidin-FITC and
Rabbit-.alpha.-Mouse-TRITC (Sigma) were applied. During the last
incubation, Goat-.alpha.-Rabbit-TRITC (Sigma) was applied. After a
last wash in TNT buffer, samples were washed twice in 1.times.PBS
and then dehydrated through an ethanol series (70%, 90%, 100%).
Antifade medium containing 75 ng/.mu.l DAPI (Serva) as counterstain
was used. Specimens ware analyzed on a Zeiss Axiophot fluorescence
microscope as described above.
2.4. Screening of YAC Libraries.
[0047] YAC clones were isolated from CEPH human genomic YAC
libraries mark 1 and 3 [37, 38] made available to us by the Centre
d'Etude du Polyphormisme Humain (CEPH). Screening was carried out
as previously described [39]. Contaminating Candida parapsylosis,
which was sometimes encountered, was eradicated by adding
terbinafin (kindly supplied by Dr. Dieter Romer, Sandoz Pharma LTD,
Basle, Switzerland) to the growth medium (final concentration: 25
.mu.g/ml). The isolated YAC clones were characterized by
STS-content mapping, contour-clamped homogeneous electric field
(CHEF) gel electrophoresis [40], restriction mapping, and
hybridization- and FISH analysis.
2.5. PCR Reactions
[0048] PCR amplification was carried out using a Pharmacia/LKB Gene
ATAQ Controller (Pharmacia/LKB) in final volumes of 100 .mu.l
containing 10 mM Tris-HCl pH 8.3, 50 mM KCl, 1.5 mM MgCl.sub.2,
0.01% gelatine, 2 mM dNTP's, 20 pmole of each amplimer, 2.5 units
of Amplitaq (Perkin-Elmer Cetus), and 100 ng (for superpools) or 20
ng (for pools) of DNA. After initial denaturation for 5 min at
94.degree. C., 35 amplification cycles were performed each
consisting of denaturation for 1 min at 94.degree. C., annealing
for 1 min at the appropriate temperature (see Table I) and
extension for 1 min at 72.degree. C. The PCR reaction was completed
by a final extension at 72.degree. C. for 5 min. Results were
evaluated by analysis of 10 .mu.l of the reaction product on
polyacrylamide minigels.
2.6. Pulsed-Field Gel Electrophoresis and Southern Blot
Analysis
[0049] Pulsed-field gel electrophoresis and Southern blot analysis
were performed exactly as described by Schoenmakers et al. [39].
Agarose plugs containing high-molecular weight YAC DNA (equivalent
to about 1.times.10.sup.8 yeast cells) were twice equilibrated in
approximately 25 ml TE buffer (pH 8.0) for 30 min at 50.degree. C.
followed by two similar rounds of equilibration at roam
temperature. Plugs were subsequently transferred to round-bottom 2
ml eppendorf tubes and equilibrated two times for 30 min in 500
.mu.l of the appropriate 1.times. restriction-buffer at the
appropriate restriction temperature. Thereafter, DNA was digested
in the plugs according to the suppliers (Boehringer) instructions
for 4 h using 30 units of restriction endonuclease per digestion
reaction. After digestion, plugs along with appropriate molecular
weight markers were loaded onto a 1% agarose/0.25.times.TBE gel,
sealed with LMP-agarose and size fractionated on a CHEF apparatus
(Biorad) for 18 h at 6.0 V/cm using a pulse angle of 120 degrees
and constant pulse times varying from 10 sec (separation up to 300
kbp) to 20 sec (separation up to 500 kbp). In the case of large
restriction fragments, additional runs were performed, aiming at
the separation of fragments with sizes above 500 kbp.
Electrophoresis was performed at 14.degree. C. in 0.25.times.TBE.
As molecular weight markers, lambda ladders (Promega) and home-made
plugs containing lambda DNA cut with restriction endonuclease
HindIII were used. After electrophoresis, gels were stained with
ethidium bromide, photographed, and UV irradiated using a
stratalinker (Stratagene) set at 120 mJ. DNA was subsequently
blotted onto Hybond N.sup.+ membranes (Amersham) for 4-16 h using
0.4N NaOH as transfer buffer. After blotting, the membranes were
dried for 15 min at 80.degree. C., briefly neutralised in
2.times.SSPE, and prehybridized for at least 3 h at 42 PC in 50 ml
of a solution consisting of 50% formamide, 5.times.SSPE,
5.times.Denhardts, 0.1% SDS and 200 .mu.g/ml heparin. Filters were
subsequently hybridised for 16 h at 42.degree. C. in 10 ml of a
solution consisting of 50% formamide, 5.times.SSPE,
1.times.Denhardts, 0.1% SDS, 100 .mu.g/ml heparin, 0.5% dextran
sulphate and 2-3.times.10.sup.6 cpm/ml of labelled probe.
Thereafter, membranes were first washed two times for 5 min in
2.times.SSPE/0.1% SDS at room temperature, then for 30 min in
2.times.SSPE/0.1% SDS at 42.degree. C. and, finally, in
0.1.times.SSPE/0.1% SDS for 20 min at 65.degree. C. Kodak XAR-5
films were exposed at -80.degree. C. for 3-16 h, depending on probe
performance. Intensifying screens (Kyokko special 500) were
used.
2.7. Generation of STSs from YAC Insert Ends
[0050] STSs from YAC insert ends were obtained using a
vectorette-PCR procedure in combination with direct DNA sequencing
analysis, essentially as described by Geurts at al. [41]. Primer
sets ware developed and tested on human genomic DNA, basically
according to procedures described above. STSs will be referred to
throughout this application by their abbreviated names (for
instance: RM1 instead of STS 12-RM1) for reasons of
convenience.
3. Results
3.1. Assembly of a YAC Contig Around Locus D12S8
[0051] In previous studies (391, a 800 kb YAC contig around D12S8
was described. This contig consisted of the following three
partially overlapping, non-chimeric CEPH YAC clones: 258F11, 320F6,
and 234G11. This contig was used as starting point for a chromosome
walking project to define the DNA region on the long arm of
chromosome 12 that encompasses the breakpoints of a variety of
benign solid tumors, which are all located proximal to D12S8 and
distal to CHOP. Initially, chromosome walking was performed
bidirectionally until the size of the contig allowed reliable
determination of the orientation of it. In the bidirectional and
subsequent unidirectional chromosome walking steps, the following
general procedure was used. First, rescuing and sequencing the ends
of YAC clones resulted in DNA markers characterizing the left and
right sides of these (Table I). Based on sequence data of the ends
of forty YAC inserts, primer sets were developed for specific
amplification of DNA; establishing STSs (Table II). Their
localization to 12q13-qter was determined by CASH as well as FISH
after corresponding cosmid clones were isolated. It should be noted
that isolated YAC clones were often evaluated by FISH analysis too,
thus not only revealing the chromosomal origin of their inserts but
also, for a number of cases, establishing and defining their
chimeric nature. Moreover, it should be emphasized that data
obtained by restriction endonuclease analysis of overlapping YAC
clones were also taken into account in the YAC clone evaluation and
subsequent alignment. With the sequentially selected and evaluated
primer sets, screening of the YAC and cosmid libraries was
performed to isolate the building blocks for contig-assembly.
Therefore, contig-assembly was performed using data derived from
FISH- and STS-content mapping as well as restriction endonuclease
analysis. Using this approach, we established a YAC contig
consisting of 75 overlapping YAC clones, covering approximately 6
Mb of DNA (FIG. 1). This contig appeared to encompass the
chromosome 12 breakpoints of all tumor-derived cell lines studied
[39]. Characteristics of the YACs that were used to build this
contig are given in Table I.
3.2. Establishment of the Chromosomal Orientation of the YAC
Contig
[0052] To allow unidirectional chromosome walking towards the
centromere of chromosome 12, the orientation of the DNA region
flanked by STSs RM14 and RM26 (approximate size: 1450 kb) was
determined by double-color interphase FISH analysis. Cosmid clones
corresponding to these STSs (i.e. LL12NC01-1F6 (RM14) and
LL12NC01-96C11 (RM26)) were differentially labelled to show green
or red signals, respectively. As a reference locus, cosmid
LL12NC01-193F10 was labelled to show green signals upon detection.
LL12NC01-193F10 had previously been mapped distal to the breakpoint
of LIS-3/SV40 (i.e. CHOP) and proximal to the chromosome 12q
breakpoints in lipoma cell line Li-14/SV40 and uterine leiomyoma
cell line LM-30.1/SV40. LL12NC01-1F6 and LL12NC01-96C11 were found
to be mapping distal to the 12q breakpoints in lipoma cell line
Li-14/SV40 and uterine leiomyoma cell line LM-30.1/SV40. Therefore,
LL12NC01-193F10 was concluded to be mapping proximal to both RM14
and RM26 (unpublished results). Of 150 informative interphases
scored, 18% showed a signal-order of red-green-green whereas 72%
showed a signal order of green-red-green. Based upon these
observations, we concluded that RM26 mapped proximal to RM14, and
therefore we continued to extend the YAC contig from the RM26 (i.e.
proximal) side of our contig only. Only the cosmids containing RM14
and RM26 were ordered by double-color interphase mapping; the order
of all others was deduced from data of the YAC contig. Finally, it
should be noted that the chromosomal orientation of the contig as
proposed on the basis of results of the double-color interphase
FISH studies was independently confirmed after the YAC contig had
been extended across the chromosome 12 breakpoints as present in a
variety of tumor cell lines. This confirmatory information was
obtained in extensive FISH studies in which the positions of YAC
and cosmid clones were determined relative to the chromosome
12q13-q15 breakpoints of primary lipomas, uterine leiomyomas,
pleomorphic salivary gland adenomas, and pulmonary chondroid
hamartomas or derivative cell lines [24, 42, 25, 43].
3.3. Construction of a Rare-Cutter Physical Map from the 6 Mb YAC
Contig Around D12S8
[0053] Southern blots of total yeast plus YAC DNA, digested to
completion with rare-cutter enzymes (see Materials and Methods) and
separated an CHEF gels, were hybridized sequentially with i) the
STS used for the initial screening of the YAC in question, ii)
pYAC4 right arm sequences, iii) pYAC4 left arm sequences, and iv) a
human ALU-repeat probe (BLUR-8). The long-range restriction map
that was obtained in this way, was completed by probing with
PCR-isolated STSs/YAC and probes. Occasionally double-digests were
performed.
[0054] Restriction maps of individual YAC clones were aligned and a
consensus restriction map was established. It is important to note
here that the entire consensus rare-cutter map was supported by at
least two independent clones showing a full internal
consistency.
3.4. Physical Mapping of CA Repeats and Monomorphic STSs/ESTs
[0055] Based upon integrated mapping data as emerged from the
Second International Workshop on Human Chromosome 12 [44], a number
of published markers was expected to be mapping within the YAC
contig presented here. To allow full integration of our mapping
data with those obtained by others, a number of markers were STS
content-mapped on our contig, and the ones found positive were
subsequently sublocalized by (primer-)hybridization on YAC Southern
blots. Among the markers that were found to reside within the
contig presented here were CA repeats D12S313 (AFM207xf2) and
D12S335 (AFM273vg9) [45], 0125375 (CHLC GATA3F02), and D12S56 [46].
Furthermore, the interferon gamma gene (IMO [47], the ras-related
protein gene Rap1B [48], and expressed sequence tag EST01096 [49]
were mapped using primer sets which we developed based on publicly
available sequence data (see Table II). Markers which were tested
and found negative included D12S80 (AFM102xd6), D12S92 (AFM203va7),
D12S329 (AFM249xh9) and D12S344 (AFM296xd9).
4. Discussion
[0056] In the present example the establishment of a YAC contig and
rare-cutter physical map covering approximately 6 Mb on 12q15, a
region on the long arm of human chromosome 12 containing MAR in
which a number of recurrent chromosomal aberrations of benign solid
tumors are known to be mapping was illustrated.
[0057] The extent of overlap between individual YACs has been
carefully determined, placing the total length of the contig at
approximately 6 Mb (FIG. 1). It should be noted that our
sizing-data for some of the YAC clones differ slightly from the
sizes determined by CEPH (50). It is our belief that this is most
probably due to differences in the parameters for running the
pulsed-field gels in the different laboratories.
[0058] Using restriction mapping and STS-content analysis, a
consensus long range physical map (FIG. 1) was constructed. The
entire composite map is supported by at least two-fold coverage. In
total over 30 Mb of YAC DNA was characterized by restriction and
STS content analysis, corresponding to an average contig coverage
of about 5 times. Although the "inborn" limited resolution
associated with the technique of pulsed-field electrophoresis does
not allow very precise size estimations, comparison to restriction
mapping data obtained from a 500 kb cosmid contig contained within
the YAC contig presented here showed a remarkable good correlation.
Extrapolating from the cosmid data, we estimate the accuracy of the
rare-cutter physical map presented here at about 10 kb.
[0059] The results of our physical mapping studies allowed
integration of three gene-specific as well as five anonymous
markers isolated by others (indicated in between arrows in FIG. 1).
The anonymous markers include one monomorphic and four polymorphic
markers. Five previously published YAC-end-derived single copy STSs
(RM1, RM4, RM5, RM7, and RM21) as well as four published CA repeats
(D12S56, D12S313, D12S335, and D12S375) and three published
gene-associated STSs/ESTs (RAP1B, EST01096, and IFNG) have been
placed on the same physical map and this will facilitate (linkage-)
mapping and identification of a number of traits/disease genes that
map in the region. Furthermore, we were able to place onto the same
physical map, seventy two YAC-end-derived (Table I) and eight
cosmid-end- or inter-ALU-derived DNA markers (CH9, RM1, RM110,
RM111, RM130, RM131, RM132, and RM133), which were developed-during
the process of chromosome walking. The PYTHIA automatic mail server
at PYTHIA@anl.gov was used to screen the derived sequences of these
DNA markers for the presence of repeats. For forty three of these
seventy two DNA markers (listed in Table II), primer sets were
developed and the corresponding STSs were determined to be single
copy by PCR as well as Southern blot analysis of human genomic DNA.
The twenty nine remaining DNA markers (depicted in the yellow
boxes) represent YAC-end-derived sequences for which we did not
develop primer sets. These YAC-end sequences are assumed to be
mapping to chromosome 12 on the basis of restriction mapping. The
final picture reveals an overall marker density in this region of
approximately one within every 70 kb.
[0060] The analysis of the contig presented here revealed many
CpG-rich regions, potentially HTF islands, which are known to be
frequently associated with housekeeping genes. These CpG islands
are most probably located at the 5' ends of as yet unidentified
genes: it has been shown that in 90% of cases in which three or
more rare-cutter restriction sites coincide in YAC DNA there is an
associated gene [51]. This is likely to be an underestimate of the
number of genes yet to be identified in this region because 60% of
tissue-specific genes are not associated with CpG islands [52] and
also because it is possible for two genes to be transcribed in
different orientations from a single island [53].
[0061] While several of the YAC clones that were isolated from the
CEPH YAC library mark 1 were found to be chimeric, overlapping YAC
clones that appeared to be non-chimeric based on FISH, restriction
mapping and STS content analysis could be obtained in each
screening, which is in agreement with the reported complexity of
the library. The degree of chimerism for the CEPH YAC library mark
1 was determined at 18% (12 out of 68) for the region under
investigation here. The small number of YACs from the CEPH YAC
library mark 3 (only 7 MEGA YACs were included in this study) did
not allow a reliable estimation of the percentage of chimeric
clones present in this library. The average size of YACs derived
from the mark 1 library was calculated to be 381 kb; non-chimeric
YACs (n=58) had an average size of 366 kb while chimeric YACs
(n=12) were found to have a considerable larger average size; i.e.
454 kb.
[0062] In summary, we present a 6 Mb YAC contig corresponding to a
human chromosomal region which is frequently rearranged in a
variety of benign solid tumors. The contig links over 84 loci,
including 3 gene-associated STSs. Moreover, by restriction mapping
we have identified at least 12 CpG islands which might be
indicative for genes residing there. Finally, four CA repeats have
been sublocalized within the contig. The integration of the
genetic, physical, and transcriptional maps of the region provides
a basic framework for further studies of this region of chromosome
12. Initial studies are likely to focus on MAR and ULCR12, as these
regions contain the breakpoint cluster regions of at least three
distinct types of solid tumors. The various YAC clones we describe
here are valuable resources for such studies. They should
facilitate the search for genes residing in this area and the
identification of those directly affected by the chromosome 12q
aberrations of the various benign solid tumors.
Example 2
1. Introduction
[0063] It was found that the 1.7 Mb Multiple Aberration Region on
human chromosome 12815 harbors recurrent chromosome 12 breakpoints
frequently found in different benign solid tumor types. In this
example the identification of an HMG gene within MAR that appears
to be of pathogenetical relevance is described. Using a positional
cloning approach, the High Mobility Group protein gene HMGI-C was
identified within a 175 kb segment of MAR and its genomic
organization characterized. By FISH, within this gene the majority
of the breakpoints of seven different benign solid tumor types were
pinpointed. By Southern blot and 3'-RACE analysis, consistent
rearrangements in HMGI-C and/or expression of altered HMGI-C
transcripts were demonstrated. These results indicate a link
between a member of the HMG gene family and benign solid tumor
development.
2. Materials and Methods
[0064] 2.1. Cell culture and primary tumor specimens.
[0065] Tumor cell lines listed in FIG. 3 were established by a
transfection procedure [54] and have been described before in [39,
24] and in an article of Van de Ven at al., Genes Chromosom. Cancer
12, 296-303 (1995) enclosed with this application as ANNEX 1. Cells
were grown in TC199 medium supplemented with 20% fetal bovine serum
and were assayed by standard cytogenetic techniques at regular
intervals. The human hepatocellular carcinoma cell lines Hep 3B and
Hep G2 were obtained from the ATCC (accession numbers ATCC HB 8064
and ATCC HE 8065) and cultured in DMEM/F12 supplemented with 4%
Ultroser (Gibco/BRL). Primary solid tumors were obtained from
various University Clinics.
2.2. YAC and Cosmid Clones
[0066] YAC clones were isolated from the CEPH mark 1 [57] and mark
3 [58] YAC libraries using a combination of PCR-based screening
[59] and colony hybridization analysis. Cosmid clones were isolated
from an arrayed human chromosome 12-specific cosmid library
(LL12NC01) [60] obtained from Lawrence Livermore National
Laboratory (courtesy P. de Jong). LL12NC01-derived cosmid clones
are indicated by their microtiter plate addresses; i.e. for
instance 27E12.
[0067] Cosmid DNA was extracted using standard techniques involving
purification over Qiagen tips (Diagen). Agarose plugs containing
high-molecular weight yeast+YAC DNA (equivalent to 1.times.10.sup.9
cells ml.sup.-1) were prepared as described before [61]. Plugs were
thoroughly dialysed against four changes of. 25 ml T.sub.10E.sub.1
(pH 8.0) followed by two changes of 0.5 ml 1.times. restriction
buffer before they were subjected to either pulsed-field
restriction enzyme mapping or YAC-end rescue. YAC-end rescue was
performed using a vectorette-PCR procedure in combination with
direct solid phase DNA sequencing, as described before in reference
61. Inter-Alu PCR products were isolated using published
oligonucleotides TC65 or 517 [62] to which SalI-tails were added to
facilitate cloning. After sequence analysis, primer pairs were
developed using the OLIGO computer algorithm [61].
2.3. DNA Labelling
[0068] DNA from YACs, cosmids, PCR products and oligonucleotides
was labelled using a variety of techniques. For FISH, cosmid clones
or inter-Alu PCR products of YACs were biotinylated with
biotin-11-dUTP (Boehringer) by nick translation. For filter
hybridizations, probes were radio-labelled with
.alpha.-.sup.32P-dCTP using random hexamers [62]. In case of
PCR-products smaller than 200 bp in size, a similar protocol was
applied, but specific oligonucleotides were used to prime labelling
reactions. Oligonucleotides were labelled using
.gamma.-.sup.32P-ATP.
2.4. Nucleotide Sequence Analysis and PCR Amplification
[0069] Nucleotide sequences were determined as described in Example
1. Sequencing results were analyzed using an A.L.F. DNA
Sequencer.TM. (Pharmacia Biotech) on standard 30 cm, 6%
Hydrolink.RTM., Lang Range.TM. gels (AT Biochem). PCR
amplifications were carried out essentially as described before
[39].
2.5. Rapid Amplification of cDNA Ends (RACE)
[0070] Rapid amplification of 3' cDNA-ends (3'-RACE) was performed
using a slight modification of part of the GIBCO/BRL 3'-ET
protocol. For first strand cDNA synthesis, adapter primer (AP2) AAQ
GAT CCG TCG ACA TC(T).sub.17 was used. For both initial and
secondary rounds of PCR, the universal amplification primer (UAP2)
CUA CUA CUA CUA AAG GAT CCG TCG ACA TC was used as "reversed
primer". In the first PCR round the following specific "forward
primers" were used: i) 5'-CTT CAG CCC AGG GAC AAC-3' (exon 1), ii)
5'-CAA GAG GCA GAC CTA GGA-3' (exon 3), or iii) 5'-AAC AAT GCA ACT
TTT AAT TAC TG-3' (3'-UTR). In the second PCR round the following
specific forward primers (nested primers as compared to those used
in the first round) were used: i) 5'-CAU CAU CAU CAU CGC CTC AGA
AGA GAG GAC-3' (exon 1), ii) 5'-CAU CAU CAU CAD GTT CAG AAG AAG CCT
GCT-3' (exon 4), or iii) 5'-CAU CAU CAD CAU TTG ATC TGA TAA GCA AGA
GTG GG-3' (3'-UTR). CUA/CAU-tailing of the nested, specific primers
allowed the use of the directional CloneAmp cloning system
(GIBCO/BRL).
3. Results
3.1. Development of Cosmid Contig and STS Map of MAR Segment
[0071] During the course of a positional cloning effort focusing on
the long arm of human chromosome 12, we constructed a yeast
artificial chromosome (YAC) contig spanning about 6 Mb and
consisting of 75 overlapping YACs. For a description thereof
reference is made to Example 1. This contig encompasses MAR (see
also FIG. 2), in which most of the chromosome 12q13-q15 breakpoints
as present in a variety of primary benign solid tumors (34 tumors
of eight different types tested safer; Table 5) and tumor cell
lines (26 tested so far, derived from lipoma, uterine leiomyoma,
and pleomorphic salivary gland adenoma; FIG. 3) appear to cluster.
We have developed both a long-range STS and rare cutter physical
map of MAR and found, by FISH analysis, most of the breakpoints
mapping within the 445 kb subregion of MAR located between STSs
RM33 and RM98 (see FIGS. 2 and 3). FISH experiments, including
extensive quality control, were performed according to routine
procedures as described before [25, 39, 24, 42, 36] To further
refine the distribution of breakpoints within this 445 kb MAR
segment, a cosmid contig consisting of 54 overlapping cosmid clones
has been developed and a dense STS map (FIG. 2) established. The
cosmid contig was double-checked by comparison to the rare cutter
physical map and by STS content mapping.
3.2. Clustering of the Chromosome 12q Breakpoints within a 175 kb
DNA Segment of MAR
[0072] The chromosome 12q breakpoints in the various tumor cell
lines studied was pinpointed within the cosmid contig by FISH (FIG.
3). As part of our quality control FISH experiments [25, 39, 24,
42], selected cosmids were first tested on metaphase spreads
derived from normal lymphocytes. FISH results indicated that the
majority (at least 18 out of the 26 cases) of the chromosome 12
breakpoints in these tumor cell lines were found to be clustering
within the 175 kb DNA interval between RM99 and RM233, indicating
this interval to constitute the main breakpoint cluster region.
FISH results obtained with Li-501/SV40 indicated that part of MAR
was translocated to an apparently normal chromosome 3; a chromosome
aberration overseen by applied cytogenetics. Of interest to note,
finally, is the fact that the breakpoints of uterine leiomyoma cell
lines LM-5.1/SV40, LM-65/SV40, and LM-608/SV40 were found to be
mapping within the same cosmid clone; i.e. cosmid 27E12.
[0073] We also performed FISH experiments on eight different types
of primary benign solid tumors with chromosome 12q13-q15
aberrations (Table 4). A mixture of cosmid clones 27E12 and 142H1
was used as molecular probe. In summary, the results of the FISH
studies of primary tumors were consistent with those obtained for
the tumor cell lines. The observation that breakpoints of each of
the seven different tumor types tested were found within the same
175 kb DNA interval of MAR suggested that this interval is
critically relevant to the development of these tumors and,
therefore, might harbor the putative MAG locus or critical part(s)
of it.
3.3. Identification of Candidate Genes Mapping within MAR
[0074] In an attempt to identify candidate genes mapping within the
175 kb subregion of MAR between STSs RM99 and RM133, we used
3'-terminal exon trapping and genomic sequence sampling (GSS) [63].
Using the GSS approach, we obtained DNA sequence data of the
termini of a 4.9 kb BamHI subfragment of cosmid 27E12, which was
shown by FISH analysis to be split by the chromosome 12 aberrations
in three of the uterine leiomyoma cell lines tested. A BLAST [64]
search revealed that part of these sequences displayed sequence
identity with a publicly available partial cDNA sequence (EMBL
accession #. Z31595) of the high mobility group (BMG) protein gene
HMGI-C [65], which is a member of the HMG gene family [66]. In
light of these observations, HMGI-C was considered a candidate MAG
gene and studied in further detail.
3.4. Genomic Organization of HMGI-C and Rearrangements in Benign
Solid Tumors
[0075] Since only 1200 nucleotides of the HMGI-C transcript
(reported size approximately 4 kb [65, 67]) were publicly
available, we first determined most of the remaining nucleotide
sequences of the HMGI-C transcript (GenBank, # U28749). This
allowed us to subsequently establish the genomic organization of
the gene. Of interest to note about the sequence data is that a
CT-repeat is present in the 5'-UTR of HMGI-C and a
GGGGT-pentanucleotide repeat in the 3'-UTR, which might be of
regulatory relevance. Comparison of transcribed to genomic DNA
sequences (GenBank, # U28750, U28751, U28752, U28753, and U28754)
of the gene revealed that HMGI-C contains at least 5 axons (FIG.
2). Transcriptional orientation of the gene is directed towards the
telomere of the long arm of the chromosome. Each of the first three
exons encode a putative DNA binding domain (DBD), and exon 5
encodes an acidic domain, which is separated from the three DBDS by
a spacer domain encoded by exon 4. The three DBD-encoding exons are
positioned relatively close together and are separated by a large
intron of about 140 kb from the two other exons, which in turn are
separated about 11 kb from each other. Of particular interest to
emphasize here is that the five exons are dispersed over a genomic
region of at least 160 kb, thus almost covering the entire 175 kb
main MAR breakpoint cluster region described above. Results of
molecular cytogenetic studies, using a mixture of cosmids 142H1
(containing exons 1-3) and 27E12 (containing exons 4 and 5) as
molecular probe, clearly demonstrate that the HMGI-C gene is
directly affected by the observed chromosome 12 aberrations in the
majority of the tumors and tumor cell lines that were evaluated
(FIG. 3; Table 4). These cytogenetic observations were
independently confirmed by Southern blot analysis in the case of
LM-608/SV40 (results not shown) LM-30.1/SV40 [24], and Ad-312/SV40;
probes used included CH76, RM118-A, and EM26. The failure to detect
the breakpoints of LM-65/SV40, LM-609/SV40, Ad-211/SV40,
Ad-263/SV40, Ad-302/SV40, Li-14/SV40, and Li-538/SV40 with any of
these three probes was also consistent with the FISH data
establishing the relative positions of the breakpoints in MAR (cf.
FIG. 3). These results made HMGI-C a prime candidate to be the
postulated MAG gene.
3.5. Expression of Aberrant HMGI-C Transcripts in Benign Solid
Tumor Cells.
[0076] In the context of follow-up studies, it was of interest to
test for possible aberrant HMGI-C expression. Initial Northern blot
studies revealed that transcripts of HMGI-C could not be detected
in a variety of normal tissues (brain, heart, lung, liver, kidney,
pancreas, placenta, skeletal muscle) tested as well as in a number
of the tumor cell lines listed in FIG. 3 (data not shown). It is
known that HMGI-C mRNA levels in normal differentiated tissues are
very much lower than in malignant tissues [85, 57]. As a control in
our Northern studies, we included hepatoma cell line Hep 3B, which
is known to express relatively high levels of HMGI-C. We readily
detected two major HMGI-C transcripts, approximately 3.6 and 3.2 kb
in size; with the differences in molecular weight most likely due
to differences in their 5'-noncoding regions. In an alternative and
more sensitive approach to detect HMGI-C or 3'-aberrant HMGI-C
transcripts, we have performed 3'-RACE experiments. In control
experiments using a number of tissues with varying HMGI-C
transcription levels (high levels in Hep 3B hepatoma cells,
intermediate in Hep G2 hepatoma cells, and low in myometrium,
normal fat tissue, and pseudomyxoma), we obtained 3'-RACE clones
which, upon molecular cloning and nucleotide sequence analysis,
appeared to represent perfect partial cDNA copies of 3'-HMGI-C mRNA
sequences; no matter which of the three selected primer sets was
used (see Methodology). RACE products most likely corresponding to
cryptic or aberrantly spliced HMGI-C transcripts were occasionally
observed; their ectopic sequences were mapped back to HMGI-C intron
3 or 4.
[0077] In similar 3'-RACE analysis of ten different primary tumors
or tumor cell lines derived from lipoma, uterine leiomyoma, and
pleomorphic salivary gland adenoma, we detected both constant and
unique PCR products. The constant PCR products appeared to
represent, in most cases, perfect partial cDNA copies of 3'-HMGI-C
mRNA sequences. They most likely originated from a presumably
unaffected HMGI-C allele and might be considered as internal
controls. The unique PCR products of the ten tumor cell samples
presented here appeared to contain ectopic sequences fused to
HMGI-C sequences. In most cases, the ectopic sequences were found
to be derived from the established translocation partners, thus
providing independent evidence for translocation-induced
rearrangements of the HMGI-C gene. Information concerning
nucleotide sequences, diversion points, and chromosomal origins of
the ectopic sequences of these RACE products is summarized in Table
5. It should be noted that chromosomal origins of ectopic sequences
was established by CASH (Chromosome Assignment using Somatic cell
Hybrids) analysis using the NIGMS Human/Rodent Somatic Hybrid
Mapping Panel 2 obtained from the Coriell Cell Repositories.
Chromosomal assignment was independently confirmed by additional
data for cases pCH1111, pCH172, pCH174, pCH193, and pCH117, as
further outlined in Table 5. Taking into account the limitations of
conventional cytogenetic analysis, especially in cases with complex
karyotypes, the chromosome assignments of the ectopic sequences are
in good agreement with the previous cytogenetic description of the
translocations.
[0078] Somewhat unexpected were the data obtained with Ad-312/SV40,
as available molecular cytogenetic analysis had indicated its
chromosome 12 breakpoint to map far outside the HMGI-C gene; over 1
Mb [42]. The ectopic sequences appeared to originate from
chromosome 1 (more precisely from a segment within M.I.T. YAC
contig WC-511, which is partially mapping at 1p22), the established
translocation partner (FIG. 2). Further molecular analysis is
required to precisely define the effect on functional expression of
the aberrant HMGI-C gene in this particular case. Of further
interest to note here, is that the sequences coming from chromosome
1 apparently remove the GGGGT repeat observed in the 3'-UTR region
of HMGI-C, as this repeat is not present in the RACE product. In
contrast, in primary uterine leiomyoma LM-#58 (t(8; 12) (q24;
q14-q15)), which was shown to have its breakpoint also in the
3'-UTR, this repeat appeared to be present in the RACE product.
Therefore, removal of this repeat is most probably not critical for
tumor development. The results with primary tumor LM-#168.1, in
which the X chromosome is the cytogenetically assigned
translocation partner, revealed that the ectopic sequences were
derived from chromosome 14; the preferential translocation partner
in leiomyoma. It is possible that involvement of chromosome 14
cannot be detected by standard karyotyping in this particular case,
as turned out to be the case for Li-501/SV40. In primary lipoma
Li-#294 (t(8; 12)(q22; q14)), two alternative ectopic sequences
were detected. Additional CASH analysis using a hybrid cell mapping
panel for regional localization of probes to human chromosome 8
[68] revealed that these were both derived from chromosome
8q22-qter (Table 5). It is very well possible that these RACE
products correspond to alternatively spliced transcripts. Finally,
in four of the cases (Table 5, cases pCH114, pCH110, pCH109,
pCH116), the RACE products appeared to correspond to cryptic or
aberrantly spliced HMGI-C transcripts, as the corresponding ectopic
sequences were found to be derived from either HMGI-C intron 3 or
4. Such RACE products have also been observed in the control
experiments described above. In conclusion, the detection of
aberrant HMGI-C transcripts in the tumor cells provides additional
strong support of HMGI-C being consistently rearranged by the
various chromosome 12 aberrations. It should be noted that the
aberrant HMGI-C transcripts in the various cases should be
characterized in full length before any final conclusion can be
drawn about biological implications.
[0079] A first and preliminary evaluation of isolated ectopic
sequences revealed in phase open reading frames of variable length.
In the case of primary tumor LM-#25, for instance, already the
second codon in the ectopic sequences appeared to be a stop codon
(Table 5). A note of caution is appropriate here, as sequence data
have been obtained only for clones that were produced via two
rounds of extensive (probably mutations inducing) PCR. For
Li-501/SV40, it is of interest to note that, in Northern blot
analysis, the isolated ectopic sequences detected a transcript of
over 10 kb in a variety of tissues, including heart, kidney, liver,
lung, pancreas, placenta, and skeletal muscle, but not in brain
(data not shown). As chromosome 3 is the preferred partner in the
chromosome 12q13-q15 translocations in lipomas and the chromosome 3
breakpoints of various lipomas were found to be spanned by YAC
clone CEPH192B10, the detected transcript might correspond to a
putative lipoma-preferred partner gene (LPP).
4. Discussion
[0080] In ANNEX 1 it was demonstrated that the chromosome 12q13-q15
breakpoints of lipoma, pleomorphic salivary gland adenoma, and
uterine leiomyoma, irrespective of their cytogenetic assignments in
the past to segment q13, q14, or q15 of chromosome 12, all cluster
within the 1.7 Mb DNA interval designated MAR. In support of the
claimed clustering of breakpoints is a recent study by Schoenberg
Fejzo et al. [1,4], identifying a CEPH mega-YAC spanning the
chromosome 12 translocation breakpoints in two of the three tumor
types. In the present study, we have conclusively demonstrated by
FISH analysis that chromosome 12 breakpoints of seven different
solid tumor types are clustering within a relatively small (175 kb)
segment of MAR. For some tumor cell lines, Southern blot data were
obtained and these were always in support of the FISH results. From
all these observations, we conclude that this segment of MAR
constitutes a major target area for the chromosome 12 aberrations
in these tumors and that it is likely to represent the postulated
MAG locus: the multi-tumor aberrant growth locus that might be
considered as common denominator in these tumors.
[0081] Within the 175 kb MAR segment, we have identified the HMGI-C
gene and determined characteristics of its genomic organization.
Structurally, the HMGI-C-encoded phosphoprotein consists of three
putative DNA binding domains, a spacer region, and an acidic
carboxy-terminal domain, and contains potential sites of
phosphorylation for both casein kinase II and p34/cdc2 [65, 67]. We
have provided strong evidence that HMGI-C is a prime candidate
target gene involved in the various tumor types studied here. In
FISH studies, the breakpoints of 29 out of 33 primary tumors were
found to be mapping between two highly informative cosmids 142H1
and 27E12; the first one containing the three DBD-encoding exons
and the second one, the remaining exons that code for the two other
domains. Therefore, the majority of the breakpoints map within the
gene, most of them probably within the 140 kb intron (intron 3),
which is also in line with FISH results obtained with the 26 tumor
cell lines that were evaluated. It should also be noted that the
5'-end of the HMGI-C gene is not yet fully characterized. As
HMGI(Y), another member of this gene family, is known to possess
various alternative first exons [69], the size of the HMGI-C gene
might be larger than yet assumed. Further support that HMGI-C is
affected by the chromosome 12 aberrations can be deduced from the
results of the 3'-RACE experiments. Aberrant HMGI-C transcripts
were detected in tumor cells, consisting of transcribed HMGI-C
sequences fused to newly acquired sequences, in most cases clearly
originating from the chromosomes that were cytogenetically
identified as the translocation partners. It is noteworthy that
many chromosomes have been found as translocation partner in the
tumors studied. This observed heterogeneity in the reciprocal
breakpoint regions involved in these translocations resembles that
of a variety of hematological malignancies with chromosome 11q23
rearrangements involving the MLL gene [70], the translational
product of which carries an amino-terminal motif related to the
DNA-binding motifs of HMGI proteins.
[0082] An intriguing issue pertains to the effect of the chromosome
12 aberrations on expression of the HMGI-C gene and the direct
physiological implications. Some functional characteristics of
HMGI-C are known or may be deduced speculatively from studies of
other family members. As it binds in the minor groove of DNA, it
has been suggested that HMGI-C may play a role in organising
satellite chromatin or act as a transcription factor [71,72].
Studies on HMGI(Y), which is the member most closely related to
HMGI-C, have suggested that HMGI(Y) may function as a
promoter-specific accessory factor for NF-.kappa. B transcriptional
activity [73]. HMGI(Y) has also been shown to stimulate or inhibit
DNA binding of distinct transcriptional factor ATF-2 isoforms [74].
Both studies indicate that the protein may simply constitute a
structural component of the transcriptional apparatus functioning
in promoter/enhancer contexts. In a recent report on high mobility
group protein 1 (HMG1), yet another member of the HMG gene family
with a similar domain structure as HMGI-C and acting as a
quasi-transcription factor in gene transcription, a truncated HMG1
protein lacking the acidic carboxy-terminal region was shown to
inhibit gene transcription [75]. It was put forward that the acidic
terminus of the HMG1 molecule is essential for the enhancement of
gene expression in addition to elimination of the repression caused
by the DNA binding. As most of the chromosome 12 breakpoints seem
to occur in the 140 kb intron, separation of the DBDs from the
acidic carboxy-terminal domain seems to occur frequently. In case
the acidic domain in HMGI-C has a similar function as the one in
HMGI(Y), the result of the chromosome 12 aberrations is likely to
affect gene expression. Finally, it should be noted that the fate
of the sequences encoding the acidic carboxy-terminal region is not
yet known.
[0083] As HMGI-C is the first member of the HMG gene family that
might be implicated in the development of benign tumors, the
question arises as to whether other members of this family could
also be involved. The HMG protein family consists of three
subfamilies: i) the HMG1 and 2 type proteins, which have been found
to enhance transcription in vitro and may well be members of a much
larger class of regulators with HMG boxes; ii) the random-coil
proteins HMG14 and 17 with an as yet unknown function; iii) the
HMGI-type proteins, which bind to the minor groove and include
HMGI-C, HMGI, and HMGI-Y; the latter two are encoded by the same
gene. It is of interest to note that published mapping positions of
members of the HMG family coincide with published chromosome
breakpoints of benign solid tumors such as those studied here. The
HMGI(Y) gene, for instance, has been mapped to human chromosome
6p21 [69], which is known to be involved in recurrent
translocations observed in uterine leiomyoma, lipoma, and
pleomorphic salivary gland adenoma [76]. As listed in the Human
Genome Data Base, not all known members of the HMG family have been
chromosomally assigned yet, although for some of them a relatively
precise mapping position has been established. For instance, HMG17
to chromosome 1p36.1-p35, HMG1L to 13q12, and HMG14 to 21q22.3; all
chromosome segments in which chromosome breakpoints of the tumor
types studied here have been reported [76]. Whether HMGI(Y) or any
other of these HMG members are indeed affected in other subgroups
of these tumors remains to be established. Of interest to mention,
furthermore, are syndromes such as Bannayan-Zonana (McKusick
#153480), Proteus (McKusick #176920), and Cowden (McKusick
#158350); the latter syndrome is also called multiple hamartoma
syndrome. In 60% of the individuals with congenital Bannayan-Zonana
syndrome, a familial macrocephaly with mesodermal hamartomas,
discrete lipomas and hemangiomas were found [70].
[0084] Finally, one aspect of our results should not escape
attention. All the tumors that were evaluated in this study were of
mesenchymal origin or contained mesenchymal components. It would be
of great interest to find out whether the observed involvement of
HMGI-C is mesenchyme-specific or may be found also in tumors of
non-mesenchymal origin. The various DNA clones we describe here are
valuable resources to address this important issue and should
facilitate studies to conclusively implicate the HMGI-C gene in
tumorigenesis.
Example 3
Rearrangements of Another Member of the HMG Gene Family
1. Introduction
[0085] This example clearly demonstrates that within a given tumor
entity (e.g. pulmonary chondroid hamartomas, uterine leiomyomas,
endometrial polyps) tumors, histologically practically
indistinguishable from each other, arise if either the HMGI-C gene
or the HMGI (Y) gene is affected by chromosomal rearrangements.
Thus, indeed a group of genes leading to aberrant mesenchymal
growth including but not restricted to HMGI-C and HMGI(Y) can be
defined.
2. Material and Methods
2.1. Chromosome Preparation
[0086] Chromosome preparation followed routine methods. Cells were
treated with 30 .mu.l colcemide (10 .mu.g/ml) for 2-3 h and then
harvested using the trypain method (0.05% trypsin, 0.02% EDTA)
followed by a hypotonic shock in six fold diluted medium TC 199 for
20 minutes at room temperature and methanol:acetic acid (3:1)
fixation. Chromosomes were then GTG-banded.
2.2. In Situ Hybridization
[0087] In situ hybridisation was performed as outlined in one of
the previous examples.
2.3. PAC Library Screening
[0088] The PAC library (Genome Systems Library Screening Service,
St. Louis, Mo., USA) was screened by PCR with a primer set specific
for the HMGI(Y) gene. For screening we designed the forward primer
with the sequence:
TABLE-US-00001 5'-CTC CAA GAC AGG CCT CTG ATG T-3' (intron 3)
and the reverse primer:
TABLE-US-00002 5'-ACC ACA GGT CCC CTT CAA ACT A-3' (intron 3)
giving rise to a fragment of 338 bp. For amplification the
following thermal cycling was used: 94.degree. C., 5 min,
(94.degree. C., 1 min, 59-C, 1 min, 72.degree. C., 2 min).times.30,
72.degree. C., 10 min. 2.4. DNA Preparations from PAC Clones
[0089] Bacterial colonies containing single PAC clones were
inoculated into LB medium and grown overnight at 37.degree. C. 660
.mu.l of the overnight culture were diluted into 25 ml of LB medium
and grown to an OD.sub.550 of 0.05-0.1. By addition of IPTG to a
final concentration of 0.5 mM the P1 lytic replicon was induced.
After addition of IPTG, growth was continued to an OD.sub.550 of
0.5-1.5, and plasmid DNA was extracted using the alkaline lysis
procedure recommended by Genome Systems.
3. Results
[0090] The primer set for screening the human PAC library was
designed from sequences belonging to intron 3 of HMGI(Y). Because
of sequence homology between HMGI-C and HMGI(Y) the amplified
sequence of 338 bp was tested by homology search to be specific
exclusively for HMGI(Y).
[0091] Library screening resulted in three positive PAC clones that
had an average insert length of approximately 100 kb. Two of these
clones (Pac604, Pac605) were used for the following FISH studies.
In order to prove if HMGI(Y) is rearranged in tumors with
translocations involving 6p21.3 in either simple or complex form we
performed FISH analysis on metaphase spreads from four primary
pulmonary chondroid hamartomas and two endometrial polyps all with
6p21.3 abnormalities. For each case 20 metaphases were scored. At
least one of the two PAC clones Pac604 and Pac605 described above
was across the breakpoint in all six cases analyzed. These results
clearly show that the breakpoints of the tumors with 6p21
aberrations investigated herein are clustered either within the
HMGI(Y) gene or its close vicinity.
Example 4
Hybrid HMGI-C in Lipoma Cells
[0092] cDNA clones of the chromosome 3-derived lipoma-preferred
partner gene LPP (>50 kb) were isolated and the nucleotide
sequence thereof established. Data of a composite cDNA are shown in
FIG. 4. An open reading frame for a protein (612 amino acids (aa))
with amino acid sequence similarity (over 50%) to zyxin of chicken
was identified. Zyxin is a member of the LIM protein family, whose
members all possess so-called LIM domains [78]. LIM domains are
cysteine-rich, zinc-binding protein sequences that are found in a
growing number of proteins with divers functions, including
transcription regulators, proto-oncogene products, and adhesion
plaque constituents. Many of the LIM family members have been
postulated to play a role in cell signalling and control of cell
fate during development. Recently, it was demonstrated that LIM
domains are modular protein-binding interfaces [79]. Like zyxin,
which is present at sites of cell adhesion to the extracellular
matrix and to other cells, the deduced LPP-encoded protein (FIG. 6)
possesses three LIM domains and lacks classical DNA-binding
homeodomains.
[0093] In 3'--RACE analysis of Li-501/SV40, a HMG1-C containing
fusion transcript was identified from which a hybrid protein (324
aa) could be predicted and which was subsequently predicted to
consist of the three DBDs (83 aa) of HMG1-C and, carboxy-terminally
of these, the three LIM domains (241 aa) encoded by LPP. In PCR
analysis using appropriate nested amplimer sets similar HMGI-C/LPP
hybrid transcripts were detected in various-primary lipomas and
lipoma cell lines carrying a t(3; 12) and also in a cytogenetically
normal lipoma. These data reveal that the cytogenetically
detectable and also the hidden t(3; 12) translocations in lipomas
seem to result consistently in the in-phase fusion of the
DNA-binding molecules of HMG1-C to the presumptive modular
protein-binding interfaces of the LPP-encoded protein, thereby
replacing the acidic domain of HMG1-C by LIM domains. Consequently,
these protein-binding interfaces are most likely presented in the
nuclear environment of these lipoma cells, where they might affect
gene expression, possibly leading to aberrant growth control. Out
of the large variety of benign mesenchymal tumors with chromosome
12q13-q15 aberrations, this is the first example of a chromosome
translocation partner contributing recurrently and consistently to
the formation of a well-defined tumor-associated HMG1-C fusion
protein.
[0094] FIG. 5 shows the cDNA sequence of the complete isolated LPP
gene.
Example 5
Diagnostic test for lipoma
[0095] A biopsy of a patient having a lipoma was taken. From the
material thus obtained total RNA was extracted using the standard
TRIZOL.TM. LS protocol from GIBCO/BRL as described in the manual of
the manufacturer. This total RNA was used to prepare the first
strand of cDNA using reverse transcriptase (GIBCO/BRL) and an oligo
dT(17) primer containing an attached short additional nucleotide
stretch. The sequence of the primer used is as described in Example
2, under point 2.5. RNase H was subsequently used to remove the RNA
from the synthesized DNA/RNA hybrid molecule. PCR was performed
using a gene specific primer (Example 2, point 2.5.) and a primer
complementary to the attached short additional nucleotide stretch.
The thus obtained PCR product was analysed by gel electrophoresis.
Fusion constructs were detected by comparing them with the
background bands of normal cells of the same individual.
[0096] In an additional experiment a second round of hemi-nested
PCR was performed using one internal primer and the primer
complementary to the short nucleotide stretch. The sensitivity of
the test was thus significantly improved.
[0097] FIG. 8 shows a typical gel.
Example 6
Aberrations of 12q14-15 and 6p21 in Pulmonary Chondroid
Hamartomas
1. Introduction
[0098] Pulmonary chondroid hamartomas (PCH) are often detected
during X-ray examination of the lung as so-called coin lesions.
However, lung metastases of malignant tumors and rarely lung
cancers can also present as coin lesions. This example shows that
FISH requiring a minimal amount of tumor cells can be used to
correctly distinguish between the majority of PCHs and malignant
tumors. Thus the test can successfully be applied e.g. to tumor
cells obtained by fine needle aspiration.
2. Materials and Methods
[0099] Samples from a total of 80 histologically characterized PCHs
were included in this study. Cell cultures, chromosome preparations
and FISH were obtained or performed as described in the previous
examples.
3. Results
[0100] Cytogenetic studies revealed that of the 80 PCHs studied
cytogenetically 51 revealed detectable aberrations involving either
12q14-15 or 6p21. By FISH using either a pool of cosmids belonging
to the HMGI-C gene or using the PAC clones of HMGI(Y) described in
the previous example we were able to detect hidden structural
rearrangements of those regions in 4 additional cases (3 with 12q
and one with 6p involvement). Therefore, the FISH test alone can be
used for a kit to precisely detect the rearrangement of either the
HMGI-C or the HMGI(Y) gene rearrangements in more than 50% of the
PCHs and is thus a valuable additional tool for the diagnosis of
these tumors (without being restricted to this type of tumors as
shown in two of the other examples).
Example 7
Diagnosis of Soft Tissue Tumors Particularly of Adipocytic
Origin
1. Introduction
[0101] Adipocyte tissue tumors often cause diagnostic difficulties
particularly when material taken from fine needle aspiration
biopsies or cyrosections has to be evaluated. This examples
demonstrates the validity of the FISH test for the differential
diagnosis of adipocyte tissue tumors and rare soft tissue
tumors.
2. Materials and Methods
2.1. Tumor Samples
[0102] Tumor samples from three soft tissue tumors were
investigated by FISH. Sample one (1) was from a adipocytic tumor
and histologically it was either an atypical lipoma or a
well-differentiated liposarcoma. The second case (tumor 2) was
diagnosed to be most likely a myxoid liposarcoma but other types of
malignant soft tissue tumors including aggressive angiomyxoma were
also considered. The third tumor (tumor 3) was also of adipocytic
origin and both a lipoma and a well differentiated liposarcoma were
considered.
2.2. Isolation of Cells and FISH
[0103] The tumor samples were enzymatically disaggregated following
routine methods. The resulting single cell suspensions were
centrifuged and the suspensions were fixed using methanol:glacial
acetic acid (3:1) at room temperature for 1 hour. The cell
suspensions were then dropped on clean dry slides and allowed to
age for 6 hours at 60.degree. C. FISH was performed using molecular
probes from the HMGI-C gene as described in the previous
examples.
3. Results
[0104] At the interphase level tumor 1 and 2 both showed split
signals for one of the alleles. These findings are compatible with
the diagnosis of benign tumors i.e. an atypical lipoma in the first
case and an aggressive angiomyxoma in the second case. They allowed
to rule out the presence of malignant adipocytic tissue tumors.
[0105] In the third case the FISH revealed a high degree of
amplification of the MAR region or part of it. Since the
amplification units observed in giant marker or ring chromosomes in
well-differentiated liposarcomas can involve the MAR region these
findings leads to the diagnosis of a well-differentiated
liposarcoma. The three cases presented within this example show the
usefulness of the DNA probes described. They can be used in a kit
for a relatively simple and fast interphase FISH experiment
offering an additional tool for the diagnosis of soft tissue
tumors.
Example 8
Expression of the HMGI-C Gene in Normal Tissue
1. Introduction
[0106] It is the aim of this example to show that the expression of
the HMGI-C gene is mainly restricted to human tissues during
embryonic and fetal development. In contrast, in most normal
tissues of the adult particularly, including those tissues and
organs tumors with HMGI-C rearrangements can arise from, no
expression can be noted. This indicates that even the
transcriptional re-activation of the gene can initiate
tumorigenesis. On the other hand it underlines the usefulness of
antisense strategies (including those antisense molecules directed
towards the normal HMGI-C mRNA) to inhibit or stop tumor
growth.
2. Materials and Methods
2.1. Tissue Samples
[0107] All adult tissue samples used for this study were taken from
surgically removed tissue frozen in liquid nitrogen within a period
of 15 min after removal. Most of the samples were from adjacent
normal tissue removed during tumor surgery. In detail we have used
8 samples taken from fat tissues at various anatomical sites, 20
samples taken from myometrial tissue, 8 samples taken from lung
tissue, 4 samples taken from the salivary glands (Glandula parotis
and Glandula suhmandibularis), one tissue sample taken from the
heart muscle, 25 samples taken from breast tissue from patients of
different ages, 2 samples from the brain, 3 liver samples, 7
samples taken from renal tissue, and embryonic/fetal tissue
(extremities, 6 samples) from embryos/fetuses (10-14th gestational
week) after abortion from socio-economic reasons.
[0108] In addition, three cell lines were used: As a control for
HMGI-C expression we used the hepatoma cell line Hep 3B and the
cell line L14 established from a lipoma with the typical
translocation t(3; 12). HeLa cells were used as a negative control
because RT experiments reproduced for 10 times did not reveal
HMGI-C expression in our own studies.
2.2. RT-PCR for the Expression of HMGI-C
[0109] 100 mg of tissue sample was homogenized, and RNA was
isolated using the trizol reagent (GibcoBRL, Eggenstein, Germany)
containing phenol and isothiocyanate. cDNA was synthesized using a
poly(A)-oligo(dt)17 primer and M-MLV reverse transcriptase
(GibcoBRL, Eggenstein, Germany). Then, a hemi-nested PCR was
performed.
[0110] For first and second PCR the same lower primer (Revex 4)
(5'-TCC TCC TGA GCA GGC TTC-3' (exon 4/5)) was used. In the first
round of PCR the specific upper primer (SE1) (5'-CTT CAG CCC AGG
GAC AAC-3' (exon 1)), and in the second round of PCR the nested
upper primer (P1) (5'-CGC CTC AGA AGA GAG GAC-3' (axon 1)) was
used. Both rounds of PCR were performed in a 100 .mu.l volume
containing 10 mM Tris/HCl pH 8.0, 50 mM KCl, 1.5 mM MgCl.sub.2,
0.001% gelatin, 100 .mu.M dATP, 100 .mu.M dTTP, 100 .mu.M dGTP, 100
.mu.M dCTP, 200 nM upper primer, 200 nM lower primer, and 1
unit/100 .mu.l AmpliTaq polymerase (Perkin Elmer, Weiterstadt,
Germany). Amplification was performed for 30 cycles (1 min
94.degree. C., 1 min 53.degree. C., 2 min 72.degree. C.). As
template in the first round of PCR cDNA derived from 250 ng total
RNA, and in the second round of PCR 1 .mu.l of the first PCR
reaction mix was used.
2.3. Control Assay for Intact mRNA/cDNA
[0111] As control reaction for intact RNA and cDNA PCR a test based
on the amplification of the cDNA of the housekeeping gene
glyceraldehyde 3-phosphate dehydrogenase (GAPDH). PCR reaction was
performed for 35 cycles under the same conditions as described
above for the first round of PCR of HMGI-C expression.
3. Results
[0112] As for the expression studies all experiments were repeated
at least twice. To assure that all RNA and cDNA preparations used
for the RT-PCRs were intact (otherwise resulting in false negative
results) routinely a RT-PCR for expression of the housekeeping gene
GAPDH was performed. A positive GAPDH RT-PCR results in a 299 bp
fragment. Only samples revealing a positive GAPDH RT-PCR were
included in this study. As the result of RT-PCR in HMGI-C positive
cells such as Hep 3B and L14 a specific 220 bp fragment is
detectable. HeLa cells did not show an expression of HMGI-C. Except
for two myometrial samples (most likely due to myomas at a
submicroscopic level) all normal tissue samples taken from adult
individuals did not show any detectable level of HMGI-C expression.
In contrast, all fetal/embryonic tissues tested revealed HMGI-C
expression.
Example 9
Expression of the HMGI-C Gene as a Diagnostic Tool for the Early
Detection of Leukemias
1. Introduction
[0113] Cytogenetically detectable aberrations affecting the HMGI-C
gene have been found in a variety of benign solid tumors of
mesenchymal origin. Apparently, the aberrations also lead to the
transcriptional activation of the gene. Since blood cells are also
of mesenchymal origin, it was tempting to check leukemic cells for
HMGI-C expression. The present example shows that the activation of
the gene in cells of the peripheral blood is a suitable marker
indicating immature cells/abnormal stem cells found in leukemias.
Since the expression of HMGI-C can be determined with a high degree
of sensitivity the RT-PCR for the expression of the gene can be
used for a very early detection of various hematological
diseases.
2. Materials and Methods
[0114] Samples from peripheral blood of. 27 patients with different
types of leukemias including 19 patients with
Philadelphia-chromosome positive CML, 5 patients with AML, and 3
patients with ALL were used for determination of HMGI-C expression.
Blood samples from 15 healthy probands served as controls.
[0115] RT-PCR for the expression of HMGI-C was performed as
outlined in example 8.
3. Results
[0116] Whereas expression of HMGI-C was clearly detectable in all
blood samples from leukemic patients there was no expression noted
in any of the blood samples taken from the control persons. There
is no evidence that the transcriptional activation of the gene is
due to mutations affecting the gene or its surroundings. It is more
reasonable to assume that the activation is rather a secondary
effect related to the immaturity of the cells or their abnormal
proliferation. However, the high and even improvable sensitivity
makes e.g. a kit based on the RT-PCR for the expression of the
HMGI-C gene a very suitable diagnostic tool.
Example 10
The Transcriptional Re-Expression of the HMGI-C Gene can Lead to
the Initiation of the Tumors
1. Introduction
[0117] This example clearly shows that for some tumor entities
chromosomal breakpoints located 5' of the HMGI-C gene do also exist
indicating that the transcriptional up-regulation of the gene is
sufficient to initiate growth of the corresponding tumor types.
2. Materials and Methods
2.1. Cell Culture
[0118] After surgery the tumor samples (three pulmonary chondroid
hamartomas, one uterine leiomyoma) were washed with Hank's solution
supplemented with penicillin (200 IU/ml) and streptomycin (200
.mu.g/ml). Tumors were disaggregated with collagenase for 5-6 h at
37.degree. C. The suspension containing small fragments and single
cells was resuspended in culture medium TC 199 with Earle's salts
supplemented with 20% fetal bovine serum, 200 IU/ml penicillin, and
200 .mu.g/ml streptomycin.
2.2. Chromosome Preparations
[0119] Chromosome preparation followed routine methods. Cells were
treated with 30 .mu.l colcemide (10 .mu.g/ml) for 2-3 h and then
harvested using the trypsin method (0.05% trypsin, 0.02% EDTA)
followed by a hypotonic shock in six fold diluted medium TC 199 for
20 minutes at room temperature and methanol:acetic acid (3:1)
fixation. Chromosomes were then GTG-banded.
2.3. FISH Studies
[0120] To identify the chromosomes unambiguously, FISH was
performed after GTG-banding of the same metaphase spreads. As DNA
probes we used five cosmids belonging to a YAC-contig overspanning
the HMGI-C gene as described in the Legend of FIG. 2. Three of
these cosmids (27E12, 185H2, 142H1) are mapping to the third intron
of HMGI-C, whereas cosmids 260C7 and 245E8 are localized at the 3'
or the 5' end respectively. The slides were analyzed using a Zeiss
(Zeiss, Oberkocham, Germany) Axioplan fluorescence microscope.
Results were processed and recorded with the Power Gene Karyotyping
System (PSI, Halladale, Great Britain). Rapid amplification of cDNA
ends (RACE) was performed as described in one of the former
examples.
3. Results
[0121] All four tumors showed the same type of cytogenetic
abnormality, i.e. the presence of 47 chromosomes including two
apparently normal chromosomes 12 and an additional derivative 14
der (14)t(12; 14) (q14-15; q24) but without a corresponding der
(12). Since the 3'-5' orientation of the HMGI-C is towards the
centromere a single break within the HMGI-C gene would have led to
the loss of its 5' part along with the loss of the der (12). We
have therefore performed a series of FISH experiments in order to
determine the breakpoints more precisely. Using the five cosmids
260C7, 27E12, 185H2, 142H1, and 245E8 hybridization signals of the
same intensity were observed at both normal chromosomes 12 and at
the additional der (14). The FISH results revealed that in all four
cases chromosomal breakpoints were located 5' of the HMGI-C
gene.
[0122] The breakpoint assignment in all four cases 5' of the
HMGI-C, gene fits well with the results of the RACE-PCR. In
addition to the normal HMGI-C transcripts we were able to detect
aberrant transcripts in all three tumors. Sequences showed that
they were not derived from chromosome 14 but from intron 3 of
HMGI-C probably due to cryptic splice sites. However, the RACE
results revealed that there was indeed HMGI-C expression in all
four cases.
Example 11
Re-Differentiation of Leukemic Cells
1. Introduction
[0123] Expression of the HMGI-C gene is frequently strongly
elevated in a wide variety of tumors, solid tumors as well as
leukemias. It was speculated that the HMGI-C protein might play a
key role in transformation of cells. This example shows that
expression of the HMGI-C gene can be strongly reduced by expressing
antisense HMGI-C sequences and that reduction of HMGI-C levels in
tumor cells results in reversion of the transformed phenotype. Thus
the expression or administration of antisense molecules can be
successfully applied therapeutically.
2. Materials and Methods
2.1. Tumor Cell Lines
[0124] Tumor cell lines were generated from a primary malignant
salivary gland tumor and a primary breast carcinoma. Cell lines
were established as described by Kazmierczak, B., Thode, B.,
Bartnitzke, S., Bullerdiek, J. and Schloot, W., "Pleomorphic
adenoma cells vary in their susceptibility to SV40 transformation
depending on the initial karyotype.", Genes Chrom. Cancer 5:35-39
(1992).
2.2. Assay of the Transformed State
[0125] Soft agar colony assays were performed as described by
Macpherson and Montagnier, "Agar suspension culture for the
selective assays of cells transformed by polyoma virus." Virology
23, 291-294 (1964).
[0126] Salivary gland and breast tumor cells were propagated in
TC199 culture medium with Earle's salts, supplemented with 20%
fetal bovine serum (GIBCO), 200 IU/ml penicillin, and 200 .mu.g/ml
streptomycin.
[0127] Tumorigenicity of the transfected salivary gland (AD64) and
breast cell lines was tested by injecting cells subcutaneously into
athymic mice.
2.3. Transfection assay
[0128] Transfections were performed using various protocols,
namely:
1. The calcium phosphate procedure of Graham and Van der Eb ("A new
technique for the assay of the infectivity of human adenovirus."
Virology 52, 456-467 (1973)). 2.3. Lipofection: Transfections were
carried out using liposome-mediated DNA transfer (lipofectamine,
GibcoBRL) according to the guidelines of the manufacturer.
2.4. Antisense Constructs
[0129] Sense and antisense constructs of the HMGI-C gene were
obtained by inserting human HMGI-C cDNA sequences in both the sense
and antisense orientation in expression vectors under the
transcriptional control of various promoter contexts, e.g. the long
terminal repeat of Moloney murine leukemia virus, a CMV promoter,
or the early promoter of SV40. For example, the CMV/HMGI-C plasmid
was constructed by cloning a human HMGI-C cDNA fragment containing
all coding sequences of human HMGI-C in pRC/CMV (Invitrogen)
allowing expression under control of the human cytomegalovirus
early promoter and enhancer, and selection for G418 resistance.
3. Results
3.1. Reversion of the Transformed Phenotype
[0130] Reversion of the transformed phenotype was observed in
breast and salivary gland tumors cells after induction of antisense
HMGI-C expression in these tumor cells. A strong reduction in
tumorigenicity was observed as measured by soft agar colony assay
and in vivo in athymic mice. Immunoprecipitation and Western blot
analysis indicated a strong reduction of HMGI-C protein levels in
the cells expressing antisense HMGI-C sequences. Therefore, this
approach can be used therapeutically in tumors with involvement of
HMGI-C.
Example 12
Animal Tumor Models Involving HMGI-C as Tools in Vivo Therapeutic
Drug Testing
[0131] On the basis of the acquired HMGI-C knowledge, animal tumor
models can be developed as tools for in v iv drug testing. To
achieve this objective (for instance for uterine leiomyoma), two
approaches can be used, namely gene transfer (generation of
transgenic animals) on the one hand and gene targeting technology
(mimicking in vivo of a specific genetic aberration via homologous
recombination in embryonic stem cells (ES cells)) on the other.
[0132] These technologies allow manipulation of the genetic
constitution of complex living systems in specific and pre-designed
ways. For extensive technical details, see B. Hogan, R. Beddington,
F. Constantini, and E. Lacy; In: Manipulating the mouse embryo, A
Laboratory Manual. Cold Spring Harbor Press, 1994; ISBN
0-87969-384-3.
[0133] To aim at the inactivation or mutation of the HMGI-C gene,
specifically in selected cell types and selected moments in time,
the recently described Cre/LoxP system can be used (Gu, H. et al.
Deletion of a DNA polymerase .beta. gene segment in T cells using
cell type-specific gene targeting. Science 265, 103-106, 1994). The
Cre enzyme is a recombinase from bacteriophage P1 whose
physiological role is to separate phage genomes that become joined
to one another during infection. To achieve so, Cre lines up short
sequences of phage DNA, called loxP sites and removes the DNA
between them, leaving one loxP site behind. This system has now
been shown to be effective in mammalian cells in excising at high
efficiency chromosomal DNA. Tissue-specific inactivation or
mutation of a gene using this system can be obtained via
tissue-specific expression of the Cre enzyme.
[0134] As an example, the development of animal model systems for
uterine leiomyoma using a member of the MAG gene family will be
outlined below, such that the models will be instrumental in in
vivo testing of therapeutic drugs.
[0135] Two approaches may be followed:
a) in vivo induction of specific genetic aberrations as observed in
human patients ((conditional) gene (isogenic) targeting approach);
and b) introduction of DNA constructs representative for the
genetic aberrations observed in patients (gene transfer
approach).
[0136] DNA constructs to be used in gene transfer may be generated
on the basis of observations made in patients suffering from
uterine leiomyoma as far as structure and expression control are
concerned; e.g. HMGI-C fusion genes with various translocation
partner genes, especially the preferential translocation partner
gene of chromosome 14 located in the YAC contig represented by CEPH
YACs 6C3, 89C5, 306H7, 336H12, 460A6, 489F4, 902F10, 952F5, 958C2,
961E1, and 971F5, truncated genes encoding basically the three DNA
binding domains of HMGI-C, and complete HMGI-C or derivatives of
HMGI-C under control of a strong promoter.
Example 13
The Preparation of Antibodies Against HMGI-C
[0137] One type of suitable molecules for use in diagnosis and
therapy are antibodies directed against the MAG genes. For the
preparation of rabbit polyclonal antibodies against HMGI-C use was
made of the following three commercially available peptides:
TABLE-US-00003 (H-ARGEGAGQPSTSAQGQPAAPAPQKR)8-Multiple Antigen
Peptide (H-SPSKAAQKKAEATGEKR)8-MAP (H-PRKWPQQVVQKKPAQEE)8-MAP
obtainable from Research Genetics Inc., Huntsville, Ala., USA. The
polyclonal antibodies were made according to standard
techniques.
TABLE-US-00004 TABLE 1 ANALYSIS OF YAC CLONES CEPH- Size Landmark
Landmark Code (kb) left # right # Chimeric 193F3 715 [RM10] YES (L
+ R) 70S1 450 RM29 U27125 ND 95F1 390 RM30 U29034 ND 201H7 320 RM13
U25051 RM14 U29053 ND 186G12 320 ND 354B6 280 YES (R) 126G8 410 ND
258F11 415 RM4 U29052 ND 320F6 250 RM5 U29050 RM21 U29047 ND 234G11
475 RM7 U29046 ND 375H5 290 ND 292E10 510 [RM15] RM15 U29048 YES
(L) 181C3 470 RM25 U29045 ND 107D1 345 RM31 U29043 ND 499C5 320
RM44 U29044 RM48 U29037 ND 340B6 285 ND 532C12 400 RM45 U29041 ND
138C5 510 [RM59] RM65 U29042 YES (L) 145F2 490 RM60 U29030 RM88
U29040 ND 105E8 340 RM57 U29033 RM63 U29038 ND 55G1 385 RM56 U29031
RM62 U29039 ND 103G7 370 RM85 U29025 RM80 U29035 ND 295B10 295 RM77
U29035 RM61 U29026 ND 338C2 200 RM78 U29034 RM82 U29029 ND 391C12
160 [RM79] RM83 U29027 YES (L) 476A11 229 [RM87] RM84 U29032 YES
(L) 138F3 460 RM90 U29028 RM91 U29019 ND 226E7 500 RM48 U29024 RM54
U29015 ND 499E9 375 RM51 U29016 YES (R) 312F10 580 [RM50] RM63
U29021 YES (L) B25G7 950 ND 34B5 315 RM88 U29020 RM89 U29013 ND
94A7 610 YES (R) 30532 660 YES (L) 379H1 280 RM104 U29014 RM105
U29009 ND 444S6 350 RM92 U29017 RM93 U29010 ND 446H3 370 RM94
U29011 RM95 U29018 ND 403B12 380 ND 261E5 500 RM102 U29012 RM103
U26629 ND 78911 425 ND 921B9 1670 ND 939H2 1750 ND 188H7 360 ND
142F4 330 ND 404E12 350 ND 164A3 375 ND 244312 415 RM106 U29007
RM107 U29008 ND 275H4 345 RM108 U29004 RM109 U29005 ND 320F9 370 ND
51F2 450 ND 242A2 160 CH1 U29006 ND 253H1 400 ND 303F11 320 ND
322C8 410 CH2 U29003 ND 208G12 370 RM96 U29002 RM97 U27125 ND 341C1
270 RM98 U26647 RM99 U27130 ND 354F1 270 ND 452E1 270 CH5 U27136 ND
41A2 310 ND 934D2 1370 ND 944E8 1290 CH8 U25792 ND 2G11 350 ND
755D7 1390 YES (L) 385A12 370 ND 803C2 1080 ND 210C1 395 RM70
U28998 RM86 U27133 ND 433C8 360 RM73 U29000 RM76 U27132 ND 402A7
500 RM41 U28994 [RM42] YES (R) 227E8 483 RM53 U27134 RM55 U23998 ND
329F9 275 RM72 U28793 RM75 U28997 ND 261E6 393 [RM71] RM74 U23925
YES (L) 348F2 370 [RM136] YES (R) 8F3 320 RM35 U27140 RM36 U27141
59F12 430 RM34 U28794 RM33 U27131 265H3 300 RM40 U23999 YAC clones
were isolated from CEPH YAC libraries as described in Materials and
Methods. ND: not detected by methods used. Landmarks not mapping
within the 5 Mb contig have been bracketed. GenBank accession
numbers are given (#).
TABLE-US-00005 TABLE II PCR Primers STS name Nucleotide Product
size T (STS 12-) sequence 5'-3' (bp) (.degree. C.) CH1
TGGGACTAACGGATTTTCAA 213 58 TGTGGTTCATTCATGCATTA CH2
TCCATCATCATCTCAAAACA 145 58 CTCTACCAAATGGAATAAACAG CH5 GCAGC
AGGCTCCTTCCCA 143 58 TGGC CTGAAACGCGAGA CH8 TCTCCACTGCTTCCATTCAC
147 58 ACACAAAACCACTGGGGTCT CH9 CAGCTTTGGAATCAGTGAGG 262 58
CCTGGGGAAGAGGAGTAAAG RM1 GAG CCTATCTCATC 309 60 ATGCTTGTGTGTGAGTGG
RM4 TTTG CAAGCTAGGTGCC 235 60 AGCTTCAAGACCCATGAG RM5 CAGTT
TGAGACTGCTTG 324 60 TAATAGCAGGGACTCAGC RM7 CTTGTCTCATTC TTTAAAGGG
533 58 CACC TTTTAGATCCTAC RM13 GAATGTTCATCACAGTGCTG 500 58
AATGTGAGGTTCTGCTGAAG RM14 TTCTCATGGGGTAAGGACAG 1 8 58 AAAGC
TGCTTACATAGGGAATC RM16 CCTTGG TTAGATATGATACAC 252 58 GCT
TTCAGAAATATCCTATGG RM21 CC AGCAG TGCTTGTCTG 2 0 58
TCGTCACAGGACATAGTCAC RM26 TCTATGGTATGTTATACAAGATG 102 58
CAGTGAGATCCTGTCTC A RM31 GTGATGTTTTAAGCCACTTAG 239 5 AA
TCTGTGTCCCTGCCACC RM33 ATT TTCCTCACCTCCCACC 600 60
AATCTGCAGAGAGGTCCAGC RM34 AATT CATCTGGGCCTGG 600 60 GAACG
TAAGCATGTGGGAG RM35 CTCCAACCATGGTCCAAAAC 296 60
GACCTCCAGTGGCTCTTTAG RM45 ACCATCAGATCTGGCACTGA 2 1 57
TTACATTGGAGCTGTCATGC RM48 CCAGGACATCCTGAAAATG 391 58
AGTATCCTGCACTTCTGCAG RM51 GATGAACTCTGAGGTGCCTTC 311 60
TCAAACCCAGCTTTGACTCC RM53 GTCTTCAAAACGCTTTCCTG 333 60 TGG TTGCATAA
GGTGATG RM60 TACACTACTCTGCAGCACAC 94 58 TCTGAGTCAATCACATGTCC RM69
CTCCCCAGATGATCTCTTTC 235 58 CGGTAGGAAATAAAGGAGAG RM72
TATTTACTAGCTGGCCTTGG 101 62 CATCTCAGGCACACACAATG RM76
ATTCAGAGAAGTGGCCAAGT 496 58 GGGATAGGTCTTCTGCAATC RM85
TCCAACAATACTGAGTGACC 435 58 TCCATTTCACTGTAGCACTG RM86
GTAATCAACCATTCCCCTGA 203 56 AAAATAGCTGGTATGGTGGC RM90
ACTGCTCTAGTTTTCAAGGA 257 58 AATTTACCTGACAGTTTCCT RM93
GCATTTGACGTCCAATATTG 347 60 ATTCCAT GGCTAACACAAG RM98
GCAAAACTTTGACTGAAACG 356 58 CACAGAGTATCGCACTGCAT RM99
AAGAGATTTCCCATGTTGTG 240 58 CTAGTGCCTTCACAAGAACC RM103
AATTCTTGAGGGGTTCACTG 199 60 TCCACACTGAGAGCTTTTCA RM108
GTGGTTCTGTACAGCAGTGG 439 60 TGAGAAAATGTCTGCCAAAT RM110
GCTCTACCAGGCATACAGTG 328 58 ATTCCTAGCATCTTTTCACG RM111
ATATGCATTAGGCTCAACCC 312 58 ATCCCACAGGTCAACATGAC RM130
ATCCTTACATTTCCAGTGGCATTCA 336 58 CCCAGAAGACCCACATTCCTCAT RM131
TTTTAAGTTTCTCCAGGGAGGAGAC 225 58 AATAGGCTCTTTGGAAAGCTGGAGT RM132
TCTCAGCTTAATCCAAGAAGGACTTC 376 58 GGCATATTCCTCAACAATTTATGCTT RM133
TGGAGAAGCTATGGTGCTTCCTATG 225 58 TGACAAATAGGTGAGGGAAAGTTGTTAT
EST01096 TCACACGCTGAATCAATCTT 186 58 CAGCAGCTGATACAAGCTTT IFNG
TGTTTTCTTTCCCGATAGGT 150 52 CTGGGATGCTCTTCGACCTC Rap13
CCATCCAACATCTTAAATGGAC 149 58 CAGCTGCAAACTCTAGGACTATT STSs were
isolated as described in Materials and Methods, or retrieved from
literature for EST01096, IFNG, and Rap . indicates data missing or
illegible when filed
TABLE-US-00006 TABLE 3 Genome Data Base accession numbers
(D-numbers) of the various sequences indicated in FIG. 1. Genome
Data Base (11 rows affected) per Locus_symbol per per_gdh_id locus
locus_gdh_id CH1-lower/CH1-upper D1251484 CH1-lower/CH1-upper
G00-595-292 D1251484 G00-595-115 CH2-lower/CH2-upper D1251489
CH2-lower/CH2-upper G00-595-293 D1251489 G00-595-416
CH5-lower/CH5-upper D1251455 CH5-lower/CH5-upper G00-595-298
D1251455 G00-595-417 CH8-lower/CH8-upper D1251487
CH8-lower/CH8-upper G00-595-301 D1251487 G00-595-418
CH9-lower/CH9-upper D1251488 CH9-lower/CH9-upper G00-595-304
D1251488 G00-595-419 EM2-lower/EM2-upper D1251489
EM2-lower/EM2-upper G00-595-307 D1251489 G00-595-420
EM2-lower/EM2-upper D1251490 EM3-lower/EM3-upper G00-595-310
D1251490 G00-595-421 EM1-lower/EM1-upper D1251491
EM4-lower/EM4-upper G00-595-313 D1251491 G00-595-422
RM13-lower/RM13-upper D1251492 RM13-lower/RM13-upper G00-595-316
D1251492 G00-595-423 RM14-lower/RM14-upper D1251493
RM14-lower/RM14-upper G00-595-319 D1251493 G00-595-424
RM15-lower/RM15-upper D1251494 RM15-lower/RM15-upper G00-595-322
D1251494 G00-595-425 RM25-lower/RM25-upper D1251507
RM26-lower/RM26-upper G00-595-325 D1251495 G00-595-426
RM26-lower/RM26-upper D1251495 RM29-lower/RM29-upper G00-595-328
D1251496 G00-595-427 RM31-lower/RM31-upper D1251497
RM31-lower/RM31-upper G00-595-331 D1251497 G00-595-428
RM33-lower/RM33-upper D1251498 RM33-lower/RM33-upper G00-595-334
D1251498 G00-595-429 RM34-lower/RM34-upper D1251499
RM34-lower/RM34-upper G00-595-337 D1251499 G00-595-430
RM36-lower/RM36-upper D1251500 RM36-lower/RM36-upper G00-595-340
D1251500 G00-595-431 RM45-lower/RM45-upper D1251501
RM45-lower/RM45-upper G00-595-343 D1251501 G00-595-432
RM46-lower/RM46-upper D1251502 RM46-lower/RM46-upper G00-595-346
D1251502 G00-595-433 RM51-lower/RM51-upper D1251503
RM51-lower/RM51-upper G00-595-349 D1251503 G00-595-434
RM53-lower/RM53-upper D1251504 RM53-lower/RM53-upper G00-595-352
D1251504 G00-595-435 RM60-lower/RM60-upper D1251505
RM60-lower/RM60-upper G00-595-359 D1251505 G00-595-436
RM69-lower/RM69-upper D1251506 RM69-lower/RM69-upper G00-595-359
D1251506 G00-595-437 RM72-lower/RM72-upper D1251508
RM25-lower/RM25-upper G00-595-361 D1251507 G00-595-438
RM75-lower/RM75-upper D1251509 RM72-lower/RM72-upper G00-595-364
D1251508 G00-595-439 RM85-lower/RM85-upper D1251510
RM76-lower/RM76-upper G00-595-367 D1251509 G00-595-440
RM89-lower/RM89-upper D1251511 RM85-lower/RM85-upper G00-595-370
D1251510 G00-595-441 RM90-lower/RM90-upper D1251512
RM86-lower/RM86-upper G00-595-373 D1251511 G00-595-442
RM93-lower/RM93-upper D1251513 RM90-lower/RM90-upper G00-595-376
D1251512 G00-595-443 RM98-lower/RM98-upper D1251514
RM93-lower/RM93-upper G00-595-378 D1251513 G00-595-444
RM99-lower/RM99-upper D1251515 RM98-lower/RM98-upper G00-595-382
D1251514 G00-595-445 RM-29-lower/RM29-upper D1251495
RM99-lower/RM99-upper G00-595-389 D1251515 G00-595-446
RM102-lower/RM102-upper D1251515 RM102-lower/RM102-upper
G00-595-390 D1251516 G00-595-447 RM108-lower/RM108-upper D1251517
RM108-lower/RM108-upper G00-595-391 D1251517 G00-595-448
RM110-lower/RM110-upper D1251518 RM110-lower/RM110-upper
G00-595-394 D1251518 G00-595-449 RM111-lower/RM111-upper D1251519
RM111-lower/RM111-upper G00-595-397 D1251519 G00-595-450
RM121-lower/RM121-upper D1251520 RM121-lower/RM121-upper
G00-595-400 D1251520 G00-595-451 RM130-lower/RM130-upper D1251521
RM130-lower/RM130-upper G00-595-403 D1251521 G00-595-452
RM131-lower/RM131-upper D1251522 RM131-lower/RM131-upper
G00-595-406 D1251522 G00-595-453 RM132-lower/RM132-upper D1251523
RM132-lower/RM132-upper G00-595-409 D1251523 G00-595-454
RM133-lower/RM133-upper D1251524 RM133-lower/RM133-upper
G00-595-412 D1251524 G00-595-455
TABLE-US-00007 TABLE 4 FISH mapping of chromosome 12 breakpoints in
primary benign solid tumors to a subregion of MAR Fraction of
tumors with breakpoints within Breakpoint main breakpoint Tumor
type within MAR cluster region* Lipoma 6/6 6/6 Pleomorphic salivary
7/7 5/7 gland adenoma Uterine leiomioma 7/8 7/8 Hamartoma of the
breast 1/1 1/1 Fibroadenoma of the breast 1/1 1/1 Hamartoma of the
lung 8/9 8/9 Anglomyxoma 1/1 1/1 *Tumor samples were collected and
analyzed at the histopathology and cytogenetics faculties of the
University of Sremen. A mixture of cosmid clones 27E12 and 142H1
was used as molecular probe in FISH analysis.
TABLE-US-00008 TABLE 5 ##STR00001## N.T.: NOT TESTABLE: N.T..sup.1:
LENGTH OF ECTOPIC SEQUENCE DOES NOT ALLOW DEVELOPMENT OF PRIMER-SET
N.T..sup.2: ECTOPIC SEQUENCE IS MAINLY COMPOSED OF REPETITIVE
SEQUENCES N.D.: NOT DETECTED
LEGENDS TO THE FIGURES
[0138] FIG. 1
[0139] Long range physical map of a 6 Mb region on the long arm of
human chromosome 12 deduced from a YAC contig consisting of 75
overlapping CEPH YAC clones and spanning the chromosome 12q
breakpoints as present in a variety of benign solid tumors. The
long range physical map of the composite genomic DNA covered by the
YAC inserts is represented/by a black solid line with the relative
positions of the various restriction sites of rare cutting enzymes
indicated. DNA regions in which additional cutting sites of a
particular restriction enzyme might be found are indicated by
arrows. Polymorphic restriction endonuclease sites are marked with
asterisks. DNA markers isolated and defined by others are depicted
in green. DNA markers obtained by us are shown in boxes and are
labelled by an acronym (see also Table I and II). The relative
positions of these DNA markers in the long range physical map are
indicated and those corresponding to particular YAC ends are linked
to these by a dotted line. Some of the DNA markers have been
assigned to a DNA interval and this is indicated by arrows. For DNA
markers in white boxes STSs have been developed and primer sets are
given in Table II. For those in yellow boxes, no primer sets were
developed. The DNA intervals containing RAP1B, EST01096, or IFNG
are indicated. Where applicable, D number assignments are
indicated. Below the long range physical map, the sizes and
relative positions of the overlapping YAC clones fitting within the
consensus long range restriction map are given as solid blue lines.
DNA regions of YAC inserts not fitting within the consensus long
range restriction map are represented by dotted blue lines. CEPH
microtiter plate addresses of the YAC clones are listed. The
orientation of the YAC contig on chromosome 12 is given. The
relative positions of ULCR12 and MAR are indicated by red solid
lines labelled by the corresponding acronyms. Accession numbers of
STSs not listed in Table I: CH9 (#U27142); RM1 (#U29049); RM110
(#U29022); RM111 (#U29023); RM130 (#U27139); RM131 (#U29001); RM132
(#127138); RM133 (#U27137). Restriction sites: B: BssHII; K: KspI
(=SacII); M: MluI; N: NotI; P: PvuI; Sf: SfiI.
[0140] FIG. 2
[0141] Contig of overlapping cosmids, long range restriction and
STS map spanning a segment of MAR of about 445 kb. Contig elements
are numbered and defined in the list below. LL12NC01-derived cosmid
clones are named after their microtiter plate addresses. GenBank
accession numbers (#) of the various STSs are listed below. STSs
are given in abbreviated form; e.g. RM33 instead of STS 12-RM33. A
40 kb gap between STSs "K" and "O" in the cosmid contig was covered
by .lamda. clones (clones 38 and 40) and PCR products (clones 37
and 39). The orientation of the contig on the long arm of
chromosome 12 is given as well as the order of 37 STSs (indicated
in boxes or labelled with encircled capital letters). The slanted
lines and arrows around some of the STS symbols at the top of the
figure mark the region to which the particular STS has been
assigned. It should be noted that the cosmid contig is not scaled;
black squares indicate STSs of cosmid ends whereas the presence of
STSs corresponding to internal cosmid sequences are represented by
dots. Long range restriction map: Bs: BssHII; K: KspI (=SacII); M:
MluI; N: NotI; P: PvuI; Sf: SfiI. At the bottom of the figure,
detailed restriction maps are shown of those regions containing
exons (boxes below) of the HMGI-C gene. Noncoding sequences are
represented by open boxes and coding sequences by black boxes.
Estimated sizes (kb) of introns are as indicated. The relative
positions of the translation initiation (ATG) and stop (TAG) codons
in the HMGI-C gene as well as the putative poly-adenylation signal
are indicated by arrows. Detailed restriction map: B: BamHI; E:
EcoRI; H: HindIII. MAR: Multiple Aberration Region; DBD: DNA
Binding Domain.
TABLE-US-00009 1 = 140A3 11 = 142G8 21 = 124D8 31 = 59A1 41 = 128A2
51 = 65E6 2 = 202A1 12 = 154A10 22 = 128A7 32 = 101D8 42 = 142H1 52
= 196E1 3 = 78F11 13 = 163D1 23 = 129F9 33 = 175C7 43 = 204A10 53 =
215A8 4 = 80C9 14 = 42H7 24 = 181C1 34 = 185H2 44 = 145E1 54 =
147G8 5 = 109B12 15 = 113A5 25 = 238E1 35 = 189C2 45 = 245E8 55 =
211A9 6 = 148C12 16 = 191H5 26 = 69B1 36 = 154B12 46 = 154F9 56 =
22D8 7 = 14H6 17 = 248E4 27 = 260C7 37 = pRM150 47 = 62D8 57 =
116B7 8 = 51F8 18 = 33H7 28 = 156A4 38 = pRM144 48 = 104A4 58 =
144D12 9 = 57C3 19 = 50D7 29 = 27E12 39 = FKXL 49 = 184A9 10 =
86A10 20 = 68B12 30 = 46G3 40 = pRM147 50 = 56C2 A = STS 12-EM12
(#U27145) I = STS 12-CH12 (#U27153) Q = STS 12-RM120 (#U27161) B =
STS 12-EM30 (#U27146) J = STS 12-EM10 (#U27154) R = STS 12-RM118
(#U27162) C = STS 12-EM14 (#U27147) K = STS 12-EM37 (#U27155) S =
STS 12-RM119 (#U27163) D = STS 12-EM31 (#U27148) L = STS 12-RM146
(#U27156) T = STS 12-EM2 (#U27164) E = STS 12-CH11 (#U27149) M =
STS 12-RM145 (#U27157) U = STS 12-EM4 (#U27165) F = STS 12-EM18
(#U27150) N = STS 12-RM151 (#U27158) V = STS 12-EM3 (#U27166) G =
STS 12-EM11 (#U27151) O = STS 12-EM16 (#U27159) W = STS 12-EM15
(#U27167) H = STS 12-CH10 (#U27152) P = STS 12-EM1 (#U27160) X =
STS 12-EM17 (#U27168) STS 12-CH5 (#U27136) STS 12-CH9 (#U27142) STS
12-RM33 (#27131) STS 12-RM53 (#U27134) STS 12-RM76 (#U27132) STS
12-RM86 (#U27133) STS 12-RM98 (#U26647) STS 12-RM99 (#U27130) STS
12-RM103 (#U26689) STS 12-RM130 (#U27139) STS 12-RM132 (#U27138)
STS 12-RM133 (#U27137) STS 12-RM151 (#U27158)
[0142] FIG. 3
[0143] Schematic representation of FISH mapping data Obtained for
tumor cell lines with chromosome 12q13-q15 aberrations, including 8
lipoma, 10 uterine leiomyoma, and 8 pleomorphic salivary gland
adenoma cell lines in consecutive experiments following our earlier
FISH studies. Probes used included phage clones pRM144
(corresponding STSs: RM86 and RM130) and pRM3147 (RM151), and
cosmid clones 7D3 or 152F2 (RM103), 154F9 (CH9), 27E12 (EM11),
211A9 (33133), 245E8 (RM153), 185H2 (RM176), 202A1 (RM99), 142H1
(RM99), 154B12 (RM132), and 124 D8 (RM133). The DNA interval
between RM33 and RM98 is estimated to be about 445 kb. Dots
indicate conclusive FISH experiments that were performed on
metaphase chromosomes of a particular cell line using as molecular
probe, a clone containing the STS given in the box above. Solid
lines indicate DNA intervals to which a breakpoint of a particular
cell line was concluded to be mapping. Open triangles indicate
deletions observed during FISH analysis. Open circles indicate
results of FISH experiments on metaphase chromosomes of Li-501/SV40
cells with hybridization signals on a cytogenetically normal
chromosome 3. The positions of chromosome 12 breakpoints of tumor
cell lines mapping outside MAR are indicated by arrows. The
molecularly cloned breakpoints of LM-30.1/SV40 and LM-608/SV40 are
indicated by asterisks. Breakpoints in various uterine leiomyoma
cell lines splitting cosmid 27E12 (EM11) are indicated by
"across".
[0144] FIG. 4
[0145] 3'-RACE product comprising the junction between part of the
HMGI-C gene and part of the LPP gene. The primers used and the
junction are indicated. The cDNA synthesis was internally primed
and not on the true poly(A) tail.
[0146] FIG. 5
[0147] Partial cDNA sequence of the LPP gene.
[0148] FIG. 6
[0149] Amino acid sequence of the LPP gene. LIM domains are boxed.
The breaking point is indicated with an arrow.
[0150] FIG. 7
[0151] Nucleotide sequence if HMGI-C (U28749). The transcription
start site indicated as proposed by Manfioletti et al. [67] was
arbitrarily chosen as a start sits. The sequence contains the
complete coding sequence.
[0152] FIG. 8
[0153] Gel or PCR products obtained as described in Example 5.
REFERENCES
[0154] 1. Sreekantaiah, C., Leong, S. L. P., Karakousis, C. P.,
McGee, D. L., Rappaport, W. D., Villar, H. V., Neal, D., Fleming,
S., Wankel, A., Herrington, P. N., Carmona, R. and Sandberg, A. A.
(1991). Cytogenetic profile of 109 lipomas. Cancer Res. 51:
422-433. [0155] 2. Nilbert, M. and Heim, S. (1990). Uterine
leiomyoma cytogenetics. Genes Chrom. Cancer 2: 3-13. [0156] 3.
Pandis, N., Heai, S., Willen, H., Bardi, G., Floderus, U. M.,
Mandahl, N. and Mitelman, F. (1991). Chromosome analysis of 96
uterine leiomyomas. Cancer Genet. Cytogenet. 55: 11-18. [0157] 4.
Sandros, J., Stenman, G. and Mark, J. (1990). Cytogenetic and
molecular observations in human and experimental salivary gland
tumours. Cancer Genet. Cytogenet. 44: 153-167. [0158] 5.
Bullerdiek, J., Wobst, G., Meyer-Bolte, K., Chilla, R., Haubrich,
J., Thode, B. and Bartnitzke, S. (1993). Cytogenetic subtyping of
220 salivary gland pleomorphic adenomas: correlation to occurrence,
histological subtype, and in vitro cellular behavior. Cancer Genet.
Cytogenet. 65: 27-31. [0159] 6. Walter, T. A., Xuan Fan, S.,
Medchill, M. T., Berger, C. S., Decker, H-J. H. and Sandberg, A. A.
(1989). Inv (12)(p11.2q13) in an endometrial polyp. Cancer Genet.
Cytogenet. 41: 99-103. [0160] 7. Vanni, R., Dal Cin, P., Marras,
S., Moerman, P., Andrtia, A., Valdes, E., Deprest, J., and Van den
Berghe, H., (1993). Endometrial polyp: Another benign tumor
characterized by 12q13-q15 changes. Cancer Genet. Cytogenet. 68:
32-33. [0161] 8. Mandahi, N., Orndal, C., Helm, S., Willen, H.,
Rydholm, A., Bauer, H. C. F. and Mitelman, F. (1993). Aberrations
of chromosome segment 12q13-15 characterize a subgroup of
hemangiopericytomas. Cancer 71: 3009-3013. [0162] 9. Mandahl, N.,
Helm, S., Arheden, K., Rydholm, A., Willen, H. and Mitelman, F.
(1989). Chromosomal rearrangements in chondromatous tumors. Cancer
65:242-248. [0163] 10. Bridge, J. A., Persons, D. L., Neff, J. R.
and Bhatia, P. (1992). Clonal karyotypic aberrations in
enchondroma. Cancer Detect. Prev. 16: 215-219. [0164] 11.
Hirabayashi, Y., Yoshida, M. A., Ikeuchi, T., Ishida, T., Kojima,
T. Higaki, S., Machinami, R. and Tonomura, A. (1992). Chromosome
rearrangements at 12q13 in two cases of chondrosarcomas. Cancer
Genet. Cytogenet. 60: 35-40. [0165] 12. Mandahl, N., Willen, N.,
Rydholm, A. and Mitelman, F. (1993). Rearrangement of band q13 on
both chromosomes 12 in a periosteal chondroma. Genes Chrom. Cancer
6: 121-123. [0166] 13. Dal Cin, P., Kools, P., De Jonge, I.,
Roerman, Ph., Van de Ven W., Van den Berghe H. (1993a).
Rearrangement of. 12q14-15 in Pulmonary Chondroid Hamartoma. Genes
Chrom. Cancer, 8, 131-133. [0167] 14. Schoenberg Fejzo, H., Yoon,
S. J., Montgomery, K. T., Rein, M. S., Weremovicz. S., Krauter, K.
S., Dorman, T. E., Fletcher, J. A., Mao, J., Moir, D. T.,
Kucherlapati, R. S., and Morton, C. C. (1995). Identification of a
YAC spanning the translocation breakpoints in uterine leiomyomata,
pulmonary chondroid hamartoma and lipoma. Physical mapping of the
12q14-15 breakpoint region in uterine leiomyomata. Genomics 26:
265-275. [0168] 15. Birdsal, S. H., MacLennan, K. A. and Gusterson,
B. A. (1992). t(6; 12)(q23; q13) and t(10; 16)(q22; p11) in a
phyllodes tumor of the breast. Cancer Genet. Cytogenet. 60: 74-77.
[0169] 16. Rohen, C., Bonk, U., Staats, B., Bartnizke, S. and
Bullerdiek, J. (1993). Two human breast tumors with translocations
involving 12q13-15 as the sole cytogenetic abnormality. Cancer
Genet. Cytogenet., 69: 68-71. [0170] 17. Jenkins, R. B., Kimmell,
D. W., Moertel, C. A., Schulz, C. A., Menezes, R. M., Scheihauer,
B., Kelly, P. J. and Dewald, G. W. (1989). Recurrent cytogenetic
abnormalities in 80 gliomas. Cytogenet. Cell Genet. 51: 1019.
[0171] 18. Noguera, R., Llombart-Bosch, A., Lopez-Gines, C., Carda,
C. and Fernandez, Cl. (1989). Giant-cell tumor of bone, stage II,
displaying translocation t(12; 19) (q13; q13). Virchows Archiv A
Pathol. Anat. 415: 377-382. [0172] 19. Turc-Carel, C., Limon, J.,
Dal Cin, P., Rao, U., Karakousis, C., and Sandberg, A. A. (1986).
Cytogenetic studies of adipose tissue tumours. II. Recurrent
reciprocal translocation t(12; 16)(q13; p11) in myxoid
liposarcomas. Cancer Genet. Cytogenet. 23: 291-299. [0173] 20.
Rodiguez, E., Sreekantaiah, C., Reuter, V. E., Motzer, R. J. and
Chaganti, R. S. K. (1992). t(12; 22)(q13; q13) and trisomy 8 are
nonrandom aberrations in clear-cell sarcoma. Cancer Genet.
Cytogenet. 64: 107-110. [0174] 21. Reeves, B. R., Fletcher, C. D.
M. and Gusterson, B. A. (1992). Translocation t(12; 22)(q13; q13)
is a nonrandom rearrangement in clear cell sarcoma. Cancer Genet.
Cytogenet. 64: 101-103. [0175] 22. Fletcher, J. A. (1992).
Translocation (12; 22)(q13-14; q12) is a nonrandom aberration in
soft-tissue clear-cell sarcoma. Genes Chrom. Cancer 5: 184. [0176]
23. Roberts, P., Browne, C. F., Lewis, I. J., Bailey, C. C., Spice,
R. D., Williams, J. and Batcup, G. (1992). 12q13 Abnormality in
rhabdomyosarcoma. A nonrandom Occurrence? Cancer Genet. Cytogenet.
60: 135-140. [0177] 24. Schoernmakers, H. F. P. M., Mols, R.,
Wanschura, S., Kools, P. F. J., Geurts, J. M., Bartnitzke, S.,
Bullerdiak, J., Van den Berghe, H., and Van de Ven, W. J. M.
(1994b). Identification, molecular cloning and characterization of
the chromosome 12 breakpoint cluster region of uterine leiomyomas.
Genes Chrom. & Cancer. 11: 106-118. [0178] 25. Van de Ven, W.
J. M., Schoenmakers, H. F. P. M., Wanschura, S., Kazmierczak, B.,
Kools, P. F. J., Geurts, J. M. W., Bartnitzke, S., Van den Berghe,
H., and Bullerdiek, J. (1995). Molecular characterization of MAR, a
multiple aberration region on human chromosome segment 12q13-q15
implicated in various solid tumors. Genes Chrom. & Cancer. 12:
296-303. (Enclosed as "ANNEX 1") [0179] 26. Casalone, r. et al.
(1991) Cytogenetic analysis reveals clonal proliferation of smooth
muscle cells in etherosclerotic plaques. Hum. Gen. 87, 139-143.
[0180] 27. Vanni, R. et al. (1990) Atherosclerotic plaque as a
benign tumor. Cancer Genet. Cytogenet. 47, 273-274. [0181] 28.
Giancotti, V. et al. Elevated levels of a specific class of nuclear
phosphoproteins in cells transformed with ras and v-mos oncogenes
and by co-transfection with c-myc and polyoma middle T genes. EMBO
J. 6, 1981-1987 (1987). [0182] 29. Warburton, D., Gersen, S., Yu,
M-T., Jackson, C., Handelin, B. and Housman, D. (1990).
Monochromosomal rodent-human hybrids from microcell fusion of human
lymphoblastoid cells containing an inserted dominant selectable
marker. Genomics 6: 358-366. [0183] 30. Schoenmakers, H. F. P. M.,
Koaol, P. F. J., Kazmierczak, B., Bullerdiek, J., Claussen, U.,
Horsthemka, B., Van den Berghe, H. and Van de Van, W. J. M. (1993).
Isolation of a somatic cell hybrid retaining the der (16)t(12; 16)
(q13; p11.2) from a myxoid liposarcoma cell line. Cytogenet. Cell
Genet. 62: 159-161. [0184] 31. Rychlik, W. and Rhoads, R. E.
(1989). A computer program for choosing optimal oligonucleotides
for filter hybridization, sequencing and in vitro amplification of
DNA. Nucleic Acids Res. 17: 8543-8551. [0185] 32. Verbeek, J. S.,
Roebroek, A. J. M., Van den Ouweland, A. M. W., Bloemers, H. P. J.
and Van de Ven, W. J. M. (1985). Human c-fms proto-oncogene:
comparative analysis with an abnormal allele. Mol. Cell. Biol. 5:
422-426. [0186] 33. Montgomery, K. T., LeBlanc, J. M., Tsai, P.,
McNinch, J. S., Ward, D. C., De Jong, P. J., Kuchrlapati, R., and
Krauter, K. S. (1993). Characterization of two chromosome 12 cosmid
libraries and development STSs from cosmids mapped by FISH.
Genomics 17: 682-693 [0187] 34. Sambrook, J., Fritsch, E. F. and
Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual. Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. [0188] 35.
Dal Cin, P., Kools, P., Sciot, R., De Wever, I., Van Damme, B., Van
de Ven, W. and Van den Berghe, H. (1993b). Molecular cytogenetic
characterization of ring chromosomes in adipose tissue tumors.
Cancer Genet. Cytogenet., 68, 85-90. [0189] 36. Kievits, T.,
Dauverse, J. G., Wiegant, J., Devilee, P., Breuning, M. H.,
Cornelisse, C. J. and van Ommen, G., Pearson, P. L. (1990). Rapid
subchromosomal localization of cosmids by nonradioactive in situ
hybridization. Cytgenet. Cell Genet. 53: 134-136. [0190] 37.
Albertsen, H. M., Abderrahim, H., Cann, H. M., Dausset, J., L
Paslier, D., and Cohen, D. (1990). Construction and
characterization of a yeast artificial chromosome library
containing seven haploid human genome equivalents. Proc. Natl.
Acad. Sci. USA 87: 4256-4260. [0191] 38. Chumakov, I., Rigault, P.,
Guillou, S., Ougen, P., Billaut, A., Guasconi, G., Gervy, P.,
LeGall, I., Soularue, P., Grinas, L., Bougueleret, L.,
Bellanne-Chantelot, C., Lacroix, B., Barillot, E., Gesnouin, P.,
Pook, S., Vaysseix, G., Frelat, G., Schmitz, A., Sambucy, J. L.,
Bosch, A., Estivill, X., Weissenbach, J., Vignal, A., Riethman, H.,
Cox, D., Patterson, D., Gardiner, K., Hattori, M., Sakaki, Y.,
Ichikawa, H., Ohki, M., L Paslier, D., Heilig, R., Antonarakis, S.,
and Cohen, D. (1992). Continuum of overlapping clones spanning the
entire human chromosome 21q. Nature 359: 380-387. [0192] 39.
Schoenmakers, H. F. P. M., Kools, P. F. J., Mols, R., Kazmierczak,
B., Bartnitzke, S., Bullerdiek, J., Dal Cin, P., De Jong, P. J.,
Van den Berghe, H. and Van de Ven, W. J. M. (1994a). Physical
mapping of chromosome 12q breakpoints in lipoma, pleomorphic
salivary gland adenoma, uterine leiomyoma, and myxoid liposarcoma.
Genomics 20: 210-222. [0193] 40. Chu, G., Vollrath, D. and Davis,
R. W. (1966) Separation of large DNA molecules by contour-clamped
homogeneous electric fields. Science 234: 1582-1585. [0194] 41.
Geurts, J., Schoenmakers H. F. P. M., Mols, R., and Van de Ven, W.
J. M. (1994). Improved procedure for rapid isolation and sequencing
of DNA insert termini in yeast artificial chromosomes. Math. Mol.
Cell. Biol., 4: 257-265. [0195] 42. Kools, P. F. J., Wanschura, S.,
Schoenmakers, E. F. P. M., Geurts, J. W. M., Mols, R., Kazmierczak,
B., Bullerdiek, J., Van den Berghe, H. and Van de Ven, W. J. M.
(1995). Identification of the chromosome 12 translocation
breakpoint region of a pleomorphic salivary gland adenoma with t(1;
12)(p22; q15) as the sole cytogenetic abnormality. Cancer Genet.
Cytogenet., 79; 1-7. (Enclosed as "ANNEX 2") [0196] 43.
Kazmierczak, B., Wanschura, S., Rosigkeit, J., Meyer-Bolte, K.,
Uschinsky, K., Haupt, R., Schoenmakers, E. F. P. M., Bartnitzke,
S., Van de Ven, W. J. M. and Bullerdiek, J. (1995). Molecular
characterization of 12q14-15 rearrangements in three pulmonary
chondroid hamartomas. Cancer Res., in press. [0197] 44.
Kucherlapati, R., Craig, I., and Marynen, P. (1994). Report of the
second international workshop on human chromosome 12 mapping 1994.
Cytogenet. Cell Genet. 67: 246-276 [0198] 45. Gyapay, G.,
Morissette, J., Vignal, A., Dib, C., Fizames, C., Millasseau, P.,
Marc, S., Bernardi, G., Lathrop, M. and Weissenbach, J. (1994). The
1993-94 Genethon human genetic linkage map. Nature Genetics 7:
246-339. [0199] 46. Ulinowski, Z., Taylor, K., Griffin, D.,
Delhanty, J. and Wolfe, J. (1991). D12S56: a highly polymorphic
locus on human chromosome 12q14. Ann. Hum. Genet. 55: 279-282.
[0200] 47. Trent, J. K., Olson, S, and Lawn, R. M. (1982)
Chromosomal localization of human leukocyte, fibroblast, and immune
interferon genes by means of in situ hybridization. Proc. Natl.
Acad. Sci. U.S.A. 79: 7809-7813. [0201] 48. Pizon, V., Lerosey, I.,
Chardin, P. and Tavitian, A. (1988). Nucleotide sequence of a human
cDNA encoding a ras-related protein (rap1B). Nucleic Acids Res. 16:
7719. [0202] 49. Adams, M. D., Dubnick, M., Kerlavage, A. R.,
Moreno, R., Kelley, J. M., Utterback, T. R., Nagle, J. W., Fields,
C., and Venter, J. C. (1992). Sequence identification of 2,375
human brain genes. Nature 355: 632-634. [0203] 50. Cohen, D.,
Chumakov, I., and Weissenbach, J. (1993). A first-generation
physical map of the human genome. Nature 366: 698-701. [0204] 51.
Larsen, F., Gundersen, G., and Prydz, H. (1992a). Choice of enzymes
for mapping based on CpG islands in the human genome. GATA 9:
60-85. [0205] 52. Larsen, F., Gundersen, G., Lopez, R., and Prydz,
H. (1992b). CpG islands as gene markers in the human genome.
Genomics 13: 1095-1107. [0206] 53. Lavia, P., MacLeod, D., and
Bird, A. (1987). Coincident start sites for divergent transcripts
at randomly selected CPG-rich island of mouse. EMBO J. 6:
2773-2779. [0207] 54. Kazmierczak, B., Bartnitzke, S., Hartl, M.
& Bullerdiek, J. In vitro transformation by the SV40 "early
region" of cells from a human benign salivary gland tumor with a
12q13-q15 rearrangement. Cytogenet. Cell Genet. 53, 37-39 (1990).
[0208] 55. Albertsen, H. M., Adderrahim, H., Cann, H. M., Dausset,
J., Le Paslier, D. & Cohen, D. Construction and
characterization of a yeast artificial chromosome library
containing seven haploid human genome equivalents. Proc. natl.
Acad. Sci. U.S.A. 87, 4256-4260 (1990). [0209] 56. Chumakov, I. et
al. Continuum of overlapping clones spanning the entire human
chromosome 21q. Nature 359, 380-387 (1992). [0210] 57. Green, E. D.
& Olson, M. V. Systematic screening of yeast
artificial-chromosome libraries using the polymerase chain
reaction. Proc. natl. Acad. Sci. U.S.A. 87, 1213-1217 (1990).
[0211] 58. Montgomery, K. T. et al. Characterization of two
chromosome 12 cosmid libraries and development of STSs from cosmids
mapped by FISH. Genomics 17, 682-693 (1993). [0212] 59. Geurts, J.
M. W., Schoenmakers E. F. P. M., Mols, R. & Van de Ven, W. J.
M. Improved procedure for rapid isolation and sequencing of DNA
insert termini in yeast artificial chromosomes. Meth. Mol. Cell.
Biol. 4, 257-265 (1994). [0213] 60. Nelson, D. L. et al. Alu
polymerase chain reaction: A method for rapid isolation of
human-specific sequences from complex DNA sources. Proc. natl.
Acad. Sci. U.S.A. 86, 6686-6690 (1989). [0214] 61. Rychlik, W.
& Rhoads, R. E. A computer program for choosing optimal
oligonucleotides for filter hybridization, sequencing and in vitro
amplification of DNA. Nucl. Acids Res. 17, 8543-8551 (1989). [0215]
62. Feinberg, A. P. & Vogelstein, B. A technique for
radiolabelling DNA restriction endonuclease fragments to high
specific activity. Anal. Biochem. 132, 6-13 (1984). [0216] 63.
Smith, M. W., Holmsen, A. L., Wei, Y. H., Peterson, M. & Evans,
G. A. Genomic sequence sampling: a strategy for high resolution
sequence-based physical mapping of complex genomes. Nature Genetics
7, 40-47 (1994). [0217] 64. Altschul, S. F., Gish, W., Miller, W.,
Myers, E. W. & Lipman, D. J. Basic local alignment search tool.
J. Mol. Biol. 215, 403-410 (1990). [0218] 65. Patel, D. A. et al.
Expression and cDNA cloning of human HMGI-C phosphoprotein.
Biochem. Biophys. Res. Commun. 201, 63-70 (1994). [0219] 66.
Bustin, M., Lehn, D. A. & Landsman, D. Structural features of
the HMG chromosomal proteins and their genes. Biochim. Biophys.
Acta 1049, 231-243 (1990). [0220] 67. Manfioletti, G. et al. cDNA
cloning of the HMGI-C phosphoprotein, a nuclear protein associated
with neoplastic and undifferentiated phenotypes. Nucl. Acids Res.
19, 6793-6797 (1991).
[0221] 68. Wagner, M. J., Ge, Y., Siciliano, M. & Wells, D. E.
A hybrid cell mapping panel for regional localization of probes to
human chromosome 8. Genomics 10, 114-125 (1991). [0222] 69.
Friedman, M., Holth, L. T., Zoghbi, H. Y. & Reeves, R.
Organization, inducible-expression and chromosome localization of
the human HMG-I(Y) nonhistone protein gene. Nucl. Acids Res. 21,
4259-4267 (1993). [0223] 70. Rabbitts, T. H. Chromosomal
translocations in human cancer. Nature 372, 143-149 (1994). [0224]
71. Yang-Yen, H. F. & Rothblum, L. I. Purification and
characterization of a high-mobility-group-like DNA-binding protein
that stimulates rRNA synthesis in vitro. Mol. Cell. Biol. 8,
3406-3414 (1988). [0225] 72. Reeves, R., Langan, T. A. &
Nissan, M. S. Phosphorylation of the DNA-binding domain of
nonhistone high-mobility group I protein by cdc2 kinase: reduction
of binding affinity. Proc. natl. Acad. Sci. U.S.A. 88, 1671-1675
(1991). [0226] 73. Thanos, D. & Maniatis, T. The high mobility
group protein HMGI(Y) is required for NF-.box-solid.8-dependent
virus induction of the human IFN--B gene. Cell 71, 777-789 (1992).
[0227] 74. Du, W. & Maniatis, T. The high mobility group
protein HMGI(Y) can stimulate or inhibit DNA binding of distinct
transcriptional factor ATF-2 isoforms. Proc. natl. Acad. Sci.
U.S.A. 91, 11318-11322 (1994). [0228] 75. Aizawa, S., Nishino, H.,
Saito, K., Kimura, K., Shirakawa, H. & Yoshida, M. Stimulation
of transcription in cultured cells by high mobility group protein
1: Essential role of the acidic carboxy-terminal region.
Biochemistry 33, 14690-14695 (1994). [0229] 76. Mitelman F (1994):
Catalog of Chromosome Aberrations in Cancer. 4th ed., New York,
Wiley-Liss. [0230] 77. Miles, J. H., Zonanna, J., Mcfarlane, J.,
Aleck, K. A. & Bawle, E. Macrocephaly with hamartomas:
Bannayan-Zonana syndrome. Am. J. Med. Genet. 19, 225-234 (1984).
[0231] 78. Crawford, A. W., Pino, J. D. & Beckerie, M. C. J.
Cell. Biol., 124, 117-127 (1994) [0232] 79. Schmeichel, K. L. &
Beckerie, M. C. Cell, 79, 211-219 (1994) [0233] 80. Sanchez-Garcia,
I. & Rabbitts, T. (1994) The LIM domain: a new structural motif
found in zinc-finger-like proteins. Trends in Genetics 10(9),
315-320. [0234] 81. Compton, J. (1991). Nucleic acid sequence-based
amplification. Nature 350, 91-92.
ANNEX 1
Genes, Chromosome & Cancer 12:296-303 (1995)
[0235] Molecular characterization of MAR, a Multiple Aberration
Region on Human chromosome Segment 12q13-q15 implicated in Various
Solid Tumors Wim J. M. Van de Van, Eric F. P. M. Schoenmakers,
Sylke Wanschura, Bernd Kazmierczak, Patrick F. J. Kools, Jan M. W.
Geurts, Sabine Bartnitzke, Herman van den Berghe, and Jorn
Bullerdiak
Center for Human Genetics, University of Leuven, Belgiumu (W. J. M.
V. D. V., E. F. P. M. S., P. F. J. K., J. W. M. G., H. V. D.
B.);
Center for Human Genetics, University of Bremen, Germany (S. W., B.
R., S. B., J. B.).
[0236] Chromosome arm 12q breakpoints in seven cell lines derived
from primary pleomorphic salivary gland adenomas were mapped by
FISH analysis relative to nine DNA probes. These probes all reside
in a 2.8 Mb genomic DNA region of chromosome segment 12q13-q15 and
correspond to previously published sequence-tagged sites (STS).
Their relative positions were established on the basis of YAC
cloning and long range physical and STS content mapping. The 12q
breakpoints of five of the cell lines were found to be mapping
within three different subregions of the 445 kb DNA interval that
was recently defined as the uterine leiomyoma cluster region of
chromosome 12 breakpoints (ULCR12) between STS RM33 and RM98. All
seven breakpoints appeared to man within the 1.7 Mb DNA region
between STS Received Sep. 27, 1994: accepted Nov. 7, 1994. Address
reprint to Dr. Wim J. M. Van de Ven. Center for Human Genetics,
University of Leuven, Herestraat 49. B-3000 Leuven, Blegium. RM36
and RM103. Furthermore, the chromosome 12 breakpoints of three
primary pleomorphic salivary gland adenomas were also found to be
mapping between RM36 and RM103. Finally, FISH analysis of two
lipoma cell lines with 12q13-q15 aberrations pinpointed the
breakpoints of these to relatively small and adjacent DNA segments
which, as well as those of two primary lipomas, appeared to be
located also between RM36 and RM103. We conclude from the observed
clustering of the 12q breakpoints of the three distinct solid tumor
types that the 1.7 Mb DNA region of the long arm of chromosome 12
between RM36 and RM103 is a multiple aberration region which we
designate MAR. Genes Chromosom Cancer 12:296-363 (1995).
.COPYRGT.1995 Wiley-Liss, Inc.
INTRODUCTION
[0237] Chromosome translocations involving region q13-q15 of
chromosome 12 have been observed in a wide variety of solid tumors
(Mitelman, 1991). In subgroups of cytogenetically abnormal uterine
leiomyomas (Nilbert and Heim, 1990; Pandis et al., 1991),
pleomorphic salivary gland adenomas (sandros et al., 1990;
Bullerdiek et al., 1993), and benign adipose tissue tumors
(Sreekantaiah at al., 1991), 12q13-q15 aberrations are frequently
observed. In a recent study (Schoenmakers et al., 1994b), we
identified and molecularly characterized ULCR12, the uterine
leiomyoma cluster region of chromosome 12 breakpoints. In the
present study, we focus on the chromosome arm 12q breakpoints in
pleomorphic adenoma of the salivary glands, a benign epithelial
tumor originating from the major or minor salivary glands. It is
the most common type of salivary gland tumor and accounts for
almost 50% of all neoplasms in these organs. About 85% of the
tumors are found in the parotid gland, 10% in the minor salivary
glands, and 5% in the submandibular gland (Seifert et al., 1986).
Although many of these adenomas appear to have a normal karyotype,
cytogenetic studies have also revealed recurrent specific
chromosome anomalies (sandros et al., 1990; Bullerdiak at al.,
1993). Besides chromosome a aberrations, often translocations with
a breakpoint in 8q12 with, as the most common aberration, a t(3; B)
(p21; q12), aberrations of chromosome 12, usually translocations
involving 12q13-q15, are also frequent. Non-recurrent clonal
abnormalities have also been described. The frequent involvement of
region 12q13-q12 in distinct solid tumor types suggests that this
chromosomal region harbors gene(s) that might be implicated in the
evolution of these tumors. Molecular cloning of the chromosome 12
breakpoints of these tumors and characterization of the junction
fragments may therefore lead to the identification of such
gene(s).
[0238] On the basis of fluorescence in situ hybridization (FISH)
data, we have previously reported that the chromosome 12
breakpoints in a number of cell lines derived from primary
pleomorphic salivary gland adenomas (Kazmierczak et al., 1990;
Schoenmakers et al., 1994a), are located on the long arm of
chromosome 12 in the interval between loci D12S19 and D12S8
(Schoenmakers et al., 1994a). This DNA interval has been estimated
to be about 7 cM (Keats et al., 1989; Craig et al., 1993). The
interval containing the chromosome 12 breakpoints of these tumor
cells was narrowed further by showing that all breakpoints mapped
distally to the CHOP gene, which is directly affected by the
characteristic t(12; 16) translocation in myxoid liposarcomas (Aman
et al., 1992; Crozat et al., 1993; Rabbitts et al., 1993) and is
located between D12S19 and D12S8. In more recent studies (Kools et
al., 1995), the chromosome 12 breakpoint of pleomorphic salivary
gland adenoma cell line Ad-312/SV40 was pinpointed to a DNA region
between sequence-tagged sites (STSs) RM110 and RM111, which is less
than 165 kb in size. FISH evaluation of the chromosome 12
breakpoints of the other pleomorphic salivary gland adenoma cell
lines indicated that they must be located proximally to the one in
Ad-312/SV40, at a distance of more than 800 kb (Kools et al.,
1995). These results pointed towards a possible dispersion of the
chromosome 12 breakpoints over a relatively large genomic region on
the long arm of chromosome 12.
[0239] Here, we report physical mapping of the chromosome 12
breakpoints in pleomorphic salivary gland adenoma cells from
primary tumors as well as established tumor cell lines. The
karyotypic anomalies observed in the cells were all different but
always involved region q13-q15 of chromosome 12. Using DNA probes
between D12S8 and CHOP, which corresponded to sequence-tagged sites
(STSs) of a long-range physical map of a 6 Mb DNA region and were
obtained during chromosome walking experiments, we performed FISH
experiments and defined more precisely a major chromosome 12
breakpoint cluster region of pleomorphic salivary gland adenoma.
This breakpoint cluster region appeared to overlap with ULCR12.
Furthermore, we tested whether 12q13-q15 breakpoints of lipomas
might also map within the same region as those of pleomorphic
salivary gland adenoma and uterine leiomyoma.
Materials and Methods
Primary Solid Tumors and Derivative Cell Lines.
[0240] Primary solid tumors including pleomorphic salivary gland
adenomas, lipomas, and uterine leiomyomas were obtained from the
University Clinics in Leaven, Belgium (Dr. I. De Waver); in Bremen,
Germany (Dr. R. Chille); in Krefeld, Germany (Dr. J. Haubrich); and
from the Institute of Pathology in Goteborg, Sweden (Dr. G,
Stenman). For cell culturing and subsequent FISH analysis, tumor
samples were finely minced, treated for 4-6 hours with 0.8%
collagenase (Boehringer, Mannheim, FRG), and processed further for
FISH analysis according to routine procedures.
[0241] Human tumor cell lines used in this study included the
previously described pleomorphic salivary gland adenoma cell lines
Ad-21/SV40, Ad-248/SV40, Ad-263/SV40, Ad-295/SV40, Ad-302/SV40,
AD-366/SV40, and Ad-386/SV40 (Kazmierczak et al., 1.990;
Schoenmakers et al., 1994a) and the lipoma cell lines Li-14/SV40
(Schoenmakers et al., 1994a) and recently developed Li-538/SV40.
Chromosome 12 aberrations found in these cell lines are listed in
Table 1. Cells were propagated in TC199 culture medium with Earle's
salts supplemented with 20% fetal bovine serum.
TABLE-US-00010 TABLE 1 Chromosome 12 Abberrations in Primary Human
Solid Tumors and Cell Lines* Aberration Cell lines Ad-211/SV40 t(8;
12)(q21; 13-q15) Ad-248/SV40 ins(12; 6)(q15; 16q21) Ad-263/SV40
inv(12)(q15q24.1) Ad-295/SV40 t(8; 12; 18)(p12; q14; p11.2)
Ad-302/SV40 t(7; 12)(q31; q14) Ad-366/SV40 inv(12)(p13q15)
Ad-386/SV40 t(12; 14)(q13-q15; q13-q15) Li-14/SV40 t(3; 12)(q28;
q13) Li-538/SV40 t(3; 12)(q27; q14) LM-5.1/SV40 t(12; 15)(q15; q24)
LM-30.1/SV40 t(12; 14)(q15; q24) LM-65/SV40 t(12; 14)(q15; q24)
LM-67/SV40 t(12; 14)(q13-q15; q24) LM-100/SV40 t(12; 14)(q15; q24)
LM-605/SV40 ins(12; 11)(q14; q21qter) LM-608/SV40 t(12; 14)(q15;
q24) LM-609/SV40 t(12; 14)(q15; q24) Primary tumors Ad-386 t(12;
14)(q15; q11.2) Ad-396 t(3; 12) Ad-400 t(12; 16) Li-166 t(12; 12)
Li-167 t(3; 12)(q28; q14-q15) LM-163.1 t(12; 14)(q14; q24) LM-163.1
t(12; 14)(q14-q24) LM-168.3 t(X; 12)(q22; q15) LM-192 t(2; 3;
12)(q35; p21; q14) LM-196.4 t(12; 14)(q14; q24) *Ad, pleomorphic
salivary gland adenoma: Li, lipoma: uterine leiomyoma.
DNA Probes
[0242] In the context of a human genome project focusing on the
long arm of chromosome 12, we isolated cosmid clones cRM33, cRM36,
cRM51, cRM69, cRM72, cRM76, cRM98, cRM103, and cRM133, from
chromosome 12-specific arrayed cosmid library LLNL12NC01
(Montgomery et al., 1993). Further details of these cosmid clones
have been reported at the Second International Chromosome 12
Workshop (1994) and will be described elsewhere (Kucharlapati et
al., 1994). Briefly, initial screenings were performed using a
PCR-based screening strategy (Green and Olson, 1990), followed by
filter hybridization analysis as the final screening step, as
previously described (Schoenmakers et al., 1994b). The cosmid
clones were isolated using STSs derived from YAC clones. STSs were
obtained upon rescue of YAC insert-ends using a methodology
involving vectorette-PCR followed by direct solid phase fluorescent
sequencing of the PCR products (Geurts et al., 1994) or from
inter-Alu PCR (Nelson at al., 1989). Cosmid clones were grown and
handled according to standard procedures (Sambrook et al.,
1989).
[0243] Cosmid clone cPK12qter, which maps to the telomeric region
of the long arm of chromosome 12 (Kools et al., 1995) was used as a
reference marker.
Chromosome Preparations and Fluorescence In Situ Hybridization.
[0244] Metaphase spreads of the pleomorphic salivary gland adenoma
cell lines or normal human lymphocytes were prepared as described
before (Schoenmakers et al., 1993). To unambiguously establish the
identity of chromosomes in the FISH experiments, FISH analysis was
performed after GTG-banding of the same metaphase spreads.
GTG-banding was performed essentially as described by Smit at al.
(1990). In situ hybridizations were carried out according to a
protocol described by Kievits et al. (1990) with some minor
modifications (Kools et al., 1994; Schoenmakers et al., 1994b).
Cosmid and YAC DNA was labelled with biotin-11-dUTP (Boehringer
Mannheim) or biotin-14-dATP (BRL, Gaithersburg) as described before
(Schoenmakers et al., 1994b). Specimens were analyzed on a Zeiss
Axiophot fluorescence microscope using a FITC filter (Zeiss).
Results were recorded on Scotch (3M) 640 asa film.
Results
FISH Mapping of 12q Breakpoints in Cell Lines of Pleomorphic
Salivary Gland Adenoma.
[0245] In previous studies (Schoenmakers et al., 1994a), we mapped
the chromosome 12 breakpoints in a number of pleomorphic adenomas
of the salivary glands relative to various DNA markers and
established that these were all located proximally to locus D12S8
and distal to the CHOP gene. This region is somewhat smaller than
the 7 cM region encompassed by linkage loci D12S8 and D12S19 (Keats
et al., 1989). Using YAC cloning, a long range physical/STS map has
been constructed covering most of that 7 cM region, as recently
reported (Kucherlapati et al., 1994). Furthermore, numerous genomic
clones (cosmid clones) have been isolated and their relative
positions within this map established (Kucherlapati et al., 1994).
Nine of these cosmids, including cRM33, cRM36, cRM51, cRM69, cRM72,
cRM76, cRM98, cRM103, and cRM133, were used in FISH studies to
establish the positions of the chromosome 12 breakpoints of the
seven cell lines derived from pleomorphic adenomas of the salivary
glands (Table 1). The relative mapping order of these nine cosmid
clones, which cover a genomic region an the long arm of chromosome
12 of about 2.8 Mb, is indicated in FIG. 1 and the results of FISH
studies with the various cosmid probes are schematically summarized
in the same figure. As an illustration, FISH results obtained with
metaphase cells of cell line Ad-295/SV40 using cRM76 and cRM103 as
probes are shown in FIG. 2. It should be noted that for the
identification of chromosomes, pre-FISH GTG-banding was used
routinely. On the basis of such banding, hybridization signals
could be assigned conclusively to chromosomes of known identity;
this was of major importance for cases with cross- or background
hybridization signals, as these were occasionally observed. When
GTG-banding in combination with FISH analysis provided inconclusive
results, either because of weak hybridization signals or rather
vague banding, FISH experiments were performed with cosmid clone
cPK2qter (Kools et al., 1995) as a reference probe.
[0246] FISH analysis of metaphase chromosomes of each of the seven
pleomorphic salivary gland adenoma cell lines with cosmid cRM103
revealed that this cosmid mapped distal to the chromosome 12
breakpoints of all seven cell lines studied here. Metaphase
chromosomes of six of the seven cell lines were also tested with
probe cRM69 and, in two cases, with cRM51. The results of the
latter experiments were always consistent with those obtained with
cRM103. Similar FISH analysis with cRM36 as probe indicated that
this probe mapped proximal to all the breakpoints. These results
were always consistent with those obtained for five of the seven
cell lines in experiments using cRM72. Altogether, the results of
our FISH studies indicated that the chromosome 12 breakpoints of
all seven cell lines map between cRM36 and cRM103, which spans a
genomic region of about 1.7 Mb.
Fine Mapping of 12q Breakpoints in Cell Lines Derived from
Pleomorphic Adenomas of the Salivary Glands.
[0247] For subsequent fine mapping of the chromosome 12 breakpoints
of the seven pleomorphic salivary gland adenoma cell lines,
additional FISH studies were performed, as schematically summarized
in FIG. 1. The breakpoints of cell lines Ad-211/SV40, Ad-295/SV40,
and Ad-366/SV40 appeared to be located in the DNA region between
cRM76 and cRM133, which was estimated to be about 75 kb. The
breakpoints of the four other cell lines were found in different
areas of the 1.7 Mb region between cRM36 and cRM103. That of cell
line Ad-248/SV40 in a DNA segment of about 270 kb between cRM33 and
cRM76, that of Ad-263/SV40 in a DNA segment of about 1 Mb between
cRM98 and cRM103, that of Ad-302/SV40 in a DNA segment of about 240
kb between cRM33 and cRM36, and that of Ad-386/SV40 in a DNA
segment of about 100 kb between cRM98 and cRM133. In conclusion,
these results indicated that the chromosome 12 breakpoints of most
(5 out of 7) of the cell lines are dispersed over the 445 kb
genomic region on the long arm of chromosome 12 between cRM33 and
cRM98. It is important to note already here that precisely this
region was recently shown to contain the chromosome 12q breakpoints
in cell lines derived from primary uterine leiomyomas (see FIG. 3)
and was therefore designated ULCR12 (Schoenmakers et al., 1994b).
As this segment of the long arm of chromosome 12 is involved in at
least two types of solid tumors (Schoenmakers et al., 1994b; this
study) and, as we will show below, also in a third solid tumor
type, we will from now on refer to the DNA interval between cRM36
and cRM103 as MAR (multiple aberration region).
FISH Mapping of 12q Breakpoints in Primary Pleomorphic Salivary
Gland Adenomas.
[0248] Our FISH studies on metaphase chromosomes of pleomorphic
adenomas of the salivary glands presented so far were restricted to
cell lines derived from primary tumors. Although it is reasonable
to assume that the chromosome 12 breakpoints in cell lines are
similar if not identical to the ones in the corresponding primary
tumors, differences as a result of the establishment of cell lines
or subsequent cell culturing cannot fully be excluded. Therefore,
we have investigated whether the chromosome 12 breakpoints in three
primary salivary gland adenomas were mapping to MAR as well. To
test this possibility, a combination of cosmid clones cRM33 and
cRM103 were used as molecular probe. In all three cases, this
cosmid pool clearly spanned the chromosome 12 breakpoints (data not
shown), indicating that these breakpoints were indeed localized
within MAR. In a recent study (Wanschura et al., submitted for
publication), it was reported that the chromosome 12 breakpoints of
five primary uterine leiomyomas with 12q14-15 aberrations were all
found to cluster within the 1.5 Mb DNA fragment (between cRM33 and
cRM103), which is known to harbor the breakpoints of various cell
lines derived from primary uterine leiomyomas (schematically
summarized in FIG. 3). Consistent with the results of the
breakpoint mapping studies using cell lines, the results with the
two primary solid tumor types establish that the breakpoints of the
primary tumor cells are located in MAR.
Chromosome Segment 12q13-q15 Breakpoints of Lipomas Mapping within
MAR.
[0249] To test the possibility that the chromosome 12 breakpoints
of other solid tumors with 12q13-q15 aberrations also mapped within
MAR, we studied two lipomas cell lines by FISH analysis--Li-14/SV40
and Li-538/SV40. The chromosome 12 aberrations of these two lipoma
cell lines are given in Table 1. As molecular probes, cosmid clones
cRM33, cRM53, cRM72, cRM76, cRM99, cRM103, and cRM133 were used.
The breakpoint of Li-14/SV40 was mapped to the 75 kb DNA interval
between RM76 and RM133, and that of Li-538/SV40 to the 90 kbp
interval between RM76 and RM99 (data not shown), as schematically
illustrated in FIG. 3. Similar FISH analysis of two primary lipomas
using a mixture of cRM36 and cRM103 as molecular probe resulted in
a hybridization pattern indicating that the mixture of probes
detected sequences on either side of the breakpoints. These results
are the first indications that also in lipoma, chromosome 12q13-q15
breakpoints occur that map within MAR. More lipoma cases should be
tasted to allow proper interpretation of this observation.
DISCUSSION
[0250] In this study, we have mapped the chromosome 12 breakpoints
of three primary pleomorphic salivary gland adenomas as well as
seven established cell lines derived from such tumors. All
breakpoints appeared to be located in a previously molecularly
cloned and characterized chromosome DNA segment on the long arm of
chromosome 12, of about 1.7 Mb in size, with five of them
clustering in a DNA interval of less than 500 kb. The 1.7 Mb DNA
region apparently contains a major breakpoint cluster region for
this type of tumor. In a previous study, we have described the
characterization of the chromosome 12 breakpoint of pleomorphic
salivary gland adenoma cell line Ad-312/SV40 (Kools et al., 1995).
The breakpoint of this cell line is now known to map at a distance
of more than 2 Mb distally to this major breakpoint cluster region
reported here. It is possible that the Ad-312/SV40 breakpoint
involves other pathogenetically relevant genetic sequences than
those affected by the clustered breakpoints. However, the
possibility should not yet be excluded that all the 12q13-q15
breakpoints in pleomorphic salivary gland adenomas mapped so far
belong to the same category and are dispersed over a relatively
large DNA region of this chromosome, reminiscent of the 11q13
breakpoints in B-cell malignancies (Raynaud et al., 1993). More
precise pinpointing of the various breakpoints could shed more
light on this matter.
[0251] Of importance is the observation that the DNA segment that
harbors the clustered 12q breakpoints of pleomorphic salivary gland
adenomas appears to coincide with the DNA region that was recently
defined as the uterine leiomyoma cluster region of chromosome 12
breakpoints, known as ULCR12 (Schoenmakers et al., 1994b). Of
further interest is the fact that this region of chromosome 12 also
harbors breakpoints of primary lipomas and lipoma cell lines
derived from primary tumors with 12q13-q15 aberrations. Altogether,
the results of all these studies now clearly demonstrate that
chromosome 12 breakpoints of three distinct solid tumor types map
to the same 1.7 Mb genomic region on the long arm of chromosome 12,
establishing this region to be a multiple aberration region. To
reflect this characteristic, we have designated this DNA segment
MAR.
[0252] Genetic aberrations involving chromosomal region 12q13-q15
have been implicated by many cytogenetic studies in a variety of
solid tumors other than the three already mentioned. Involvement of
12q13-q15 has also been reported for endometrial polyps (Walter et
al., 1989; Vanni et al., 1993), clear cell sarcomas characterized
by recurrent t(12; 22)(q13; q13) (Fletcher, 1992; Reeves et al.,
1992; Rodriguez et al., 1992), a subgroup of rhabdomyosarcoma
(Roberts et al., 1992) and hemangiopericytoma (Mandahl et al.,
1993a), chondromatous tumors (Mandahl et al., 1989; Bridge et al.,
1992; Hirabayashi et al., 1992; Mandahl et al., 1993b), and
hamartoma of the lung (Dal Cin et al., 1993). Finally, several case
reports of solid tumors with involvement of chromosome region
12q13-q15 have been published--e.g., tumors of the breast (Birdsal
et al., 1992; Rohen et al., 1993), diffuse astrocytomas (Jenkins et
al., 1989), and a giant-cell tumor of the bone (Noguera et al.,
1989). On the basis of results of cytogenetic studies, no
predictions could be made about the relative distribution of the
breakpoints of these tumor types. In light of the results of the
present study, it would be of interest to see whether the
breakpoints of any of these solid tumors also map within or close
to MAR. The various cosmid clones available now provide the means
to test this readily.
[0253] The observation that 12q breakpoints of at least three
different types of solid tumors map to the same DNA region is
intriguing as it could be pointing towards the possibility that the
same genetic sequences in MAR are pathogenetically relevant for
tumor development in different tissues. If so, it is tempting to
speculate that the gene(s) affected by the genetic aberrations
might be involved in growth regulation. On the other hand, one
cannot yet exclude the possibility that genetic sequences in MAR
are not pathogenetically relevant, as the observed clustering of
genetic aberrations in MAR could simply reflect genetic instability
of this region, which becomes apparent in various solid tumors. To
obtain more insight in this matter, the genes residing in MAR
should be identified and characterized, and this can be achieved by
various approaches using several techniques (Parrish and Nelson,
1993).
ACKNOWLEDGMENTS
[0254] The constructive support of managing director G. Everaerts
is greatly acknowledged. The authors would like to thank P. Dal
Cin, J. Haubrich, R. Hille, G. Stanman, and I. De Never for
providing the solid tumor specimens studied in the present report;
C. Huysmans, E. Meyen, K. Meyer-Bolte, R. Mols, and M. Willems for
excellent technical assistance; and M. Leys for artwork. This work
was supported in part by the EC through Biomed 1 program "Molecular
Cytogenetics of Solid Tumours", the "Geconcerteerde Onderzoekacties
1992-1996", the National Fund for Scientific Research (NFWO; Kom op
tegen Kanker), the "ASLK-pragramma voor Kankeronderzoek", the
"Schwerpunktprogramm: Molekulare und Klassische Tuorytogenetik" of
the Deutsche Forschungsgemeinschaft, and the Tonjes-Vagt Stiftunig.
This text presents results of the Belgian programme on
Interuniversity Poles of attraction initiated by the Belgian State,
Prime Minster's Office, Science Policy Programming. The scientific
responsibility is assumed by its authors. J. W. M. Geurts is an
"Aspirant" of the National Fund for Scientific Research (NFWO; Kom
op tegen Kanker).
REFERENCES
[0255] Aman P, Ran D, Mandahl N, Fioretos T, Heim S, Arheden K,
Willen H, Rydholm A, Mitelman F (1992) Rearrangement of the
transcription factor gene CHOP in myxoid liposarcamas with t(12;
16) (q13; p11). Genes Chromosom Cancer 5: 278-285. [0256] Birdsal S
H, MacLennan K A, Gusterson, B A (1992) t(6; 12) (q23; q13) and
t(10; 16) (q22; p11) in a phyllodes tumor of the breast. Cancer
Genet Cytogenet 60: 74-77. [0257] Bridge J A, Persons D L, Neff J
R, Bhatia P (1992) Clonal karyotypic aberrations in enchondroma.
Cancer Detect Prev 16; 215-219. [0258] Bullerdiek J, Wobst G,
Meyer-Bolte K, Chilla R, Haubrich J, Thode B, Bartnitzke S (1993):
Cytogenetic subtyping of 220 salivary gland pleomorphic adenomas:
correlation to occurrence, histological subtype, and in vitro
cellular behavior. Cancer Genet Cytogenet 65; 27-31. [0259] Craig I
W, Gedde-Dahl T, Gemmill R, Kucherlapati R (1993) Report of the
committee on the genetic constitution of chromosome 12. Genome
Prior Rep 1: 402-418. [0260] Crozat A, Aman P, Mandahl N, Ron D
(1993) Fusion of CHOP to a novel RNA-binding protein in human
myxoid liposarcoma. Nature 363: 640-644. [0261] Dal Cin P, Kools P,
De Jonge I, Moerman Ph, Van de Ven W, Van den Berghe H (1993)
Rearrangement of 12q14-15 in pulmonary chondroid hamartoma. Genes
Chromosom Cancer 8: 131-133. [0262] Fletcher JA (1992)
Translocation (12; 22) (q13-14; q12) is a nonrandom aberration in
soft-tissue clear-cell sarcoma. Genes Chromosom Cancer 5: 184.
[0263] Geurts J M W, Schoenmakers H F P M, Mols R, Van de Ven W J M
(1994) An improved procedure to quickly isolate and sequence the
termini of DNA inserts of yeast artificial chromosomes. Meth Mol
Cell Biol 4: 257-265. [0264] Green E D, Olson M V (1990) Systematic
screening of yeast artificial-chromosome libraries using the
polymerase chain reaction. Proc Natl Acad Sci USA 87: 1213-1217.
[0265] Hirabayashi Y, Yoshida M A, Ikeuchi T, Ishida T, Kojima T,
Higaki S, Machinami R, Tonomura A (1992) Chromosome rearrangements
at 12q13 in two cases of chondrosarcomas. Cancer Genet Cytogenet
60: 35-40. [0266] Jenkins R B, Kimmell D W, Moertel C A, Schulz C
A, Menezes R M, Scheihauer B, Kelly P J, Dewald G W (1989)
Recurrent cytogenetic abnormalities in 80 gliomas. Cytogenet Cell
Genet. 51; 1019. [0267] Kazmierczak B, Bartnitzke S, Hartl H,
Bullerdiek J (1990): In vitro transformation by the SV40 "early
region" of cells from a human benign salivary gland tumour with a
12q13-+q15 rearrangement. Cytogenet Cell Genet. 53: 37-39. [0268]
Keats B, Ott J, Conneally M (1989) Report of the committee on
linkage and gene order. Cytogenet Cell Genet. 51: 459-502. [0269]
Kievits T, Dauwerse J G, Wiegant 3, Devilee P, Breuning M H,
Cornelisse CJ, van Ommen G, Pearson P L (1990) Rapid subchromosomal
localization of cosmids by nonradioactive in situ hybridization.
Cytogenet Cell Genet. 53: 134-136. [0270] Kools P F J, Roebroek A J
M, Van de Velde H T K, Marynen P, Bullerdiek J, Van de Ven W J M
(1993): Regional mapping of the human NSP gene to chromosome
14q21-q22 by fluorescence in situ hybridization. Cytogenet Cell
Genet. 66:48-50. [0271] Kools P F J, Wanschura S, Schoenmakers E F
P M, Geurts J W M, Mole R, Kazmierczak B, Bullerdiek 3, Van den
Berghe H, Van de Ven W J M (1995) Identification of the chromosome
12 translocation breakpoint region of a pleomorphic salivary gland
adenoma with t(1; 12)(p22; q15) as the sole cytogenetic
abnormality. Cancer Genet Cytogenet, In press, 1995. [0272]
Kucherlapati R, Craig I, Marynen P (1994) Report of the second
international workshop on human chromosome 12 mapping 1994.
Cytogenet Cell Genet. 67: 245-276. [0273] Mandahl N, Heim S,
Arheden K, Rydholm A, Willen H, Mitelman F (1989) Chromosomal
rearrangements in chondromatous tumors. Cancer 65: 242-248. [0274]
Mandahl N, Orndal C, Heim S, Willen H, Rydholm A, Bauer H C F,
Mitelman F (1993a) Aberrations of chromosome segment 12q13-15
characterize a subgroup of hemangiopericytomas. Cancer 71;
3009-3013. [0275] Mandahl N, Willen H, Rydholm A, Mitelman F
(1993b) Rearrangement of band q13 on both chromosomes 12 in a
periosteal chondroma. Genes Chrom Cancer 6: 121-123. [0276]
Mitelman F (1991): Catalog of Chromosome Aberrations in Cancer. 4th
ed., New York, Alan R. Liss. [0277] Montgomery K T, LeBlanc J M,
Tsai P, McNinch J S, Ward D C, De Jong P J, Kucherlapati R, Krauter
K S (1993) Characterization of two chromosome 12 cosmid libraries
and development of STSs from cosmids mapped by FISH. Genomics
17:682-693. [0278] Nelson D L, Ledbetter S A, Corbo L, Victoria M
F, Ramirez-Solis R, Webster T D, Ledbetter D H, Caskey C T (1989)
Alu polymerase chain reaction: A method for rapid isolation of
human-specific sequences from complex DNA sources. Proc Natl Acad
Sci USA 86: 6686-6690. [0279] Nilbert M, Heim S (1990) Uterine
leiomyoma cytogenetics. Genes Chromosom Cancer 2:3-13. [0280]
Noguera R, Llombart-Bosch A, Lopez-Gines C, Carda C, Fernandez Cl
(1989) Giant-cell tumor of bone, stage II, displaying translocation
t(12; 19)(q13; q13). Virchows Archiv A Pathol Anat 415: 377-382.
[0281] Pandis N, Heim S, Bardi G, Floderus U-M, Willen H, Mandahl
N, Mitelman F (1991) Chromosome analysis of 96 uterine leiomyomas.
Cancer Genet Cytogenet 55:11-18. [0282] Parrish J E, Nelson D L
(1993) Methods for finding genes a major rate-limiting step in
positional cloning. GAT 10: 29-41. [0283] Rabbitts T H, Forster A,
Larson R, Nathan P (1993) Fusion of the dominant negative
transcription regulator CHOP with a novel gene FUS by translocation
t(12; 16) in malignant liposarcoma. Nature Genet 4: 175-180. [0284]
Raynaud S D, Bekri S, Leroux D, Grosgeorge J, Klein B, Bastard C,
Gaudray P, Simon M P (1993) Expanded range of 11q13 breakpoints
with differing patterns of cyclin D1 expression in B-cell
malignancies. Genes Chromosom Cancer 8: 80-87. [0285] Reeves B R,
Fletcher C D M, Gusterson B A (1992) Translocation t(12; 22)(q13;
q13) is a nonrandom rearrangement in clear cell sarcoma. Cancer
Genet Cytogenet 64: 101-103. [0286] Roberts P, Browne C F, Lewis I
J, Bailey C C, Spice R D, Williams 3, Batcup G (1992) 12q13.
Abnormality in rhabdomyosarcoma. A nonrandom Occurrence? Cancer
Genet Cytogenet 60: 135-140. [0287] Rodriguez E, Sreekantaiah C,
Rauter V E, Motzer R J, Chaganti R S K (1992) t(12; 22)(q13; q13)
and trisomy 8 are nonrandom aberrations in clear-cell sarcoma.
Cancer Genet Cytogenet 64: 107-113. [0288] Rohen C, Bonk U, Staats
B, Bartnizke S, Bullerdiek J (1993) Two human breast tumors with
translocations involving 12q13-15 as the sole cytogenetic
abnormality. Cancer Genet Cytogenet 69: 68-71. [0289] Sambrook J,
Fritsch E F, Maniatis T (1989) Molecular Cloning: A Laboratory
Manual. Cold Spring Harbor-Laboratory Press, Cold Spring Harbor,
N.Y. [0290] Sandros J, Stenman G, Mark J (1990): Cytogenetic and
molecular observations in human and experimental salivary gland
tumours. Cancer Genet Cytogenet 44: 153-167. [0291] Schoenmakers H
F P M, Kools P F J, Kazmierczak B, Bullerdiek J, Claussen U,
Horsthemke B, Van den Berghe H, Van de Ven W J M (1993) Isolation
of a somatic cell hybrid retaining the der (16)t(12; 16) (q13;
p11.2) from a myxoid liposarcoma cell line. Cell Genet Cytogenet
62: 159-161. [0292] Schoernmakers H F P M, Kools P F J, Mols R,
Kazmierczak B, Bartnitzke S, Bullerdiek J, Dal Cin P, De Jong P J,
Van den Berghe H, Van de Van W J M (1994a) Physical mapping of
chromosome 12q breakpoints in lipoma, pleomorphic salivary gland
adenoma, uterine leiomyoma, and myxoid liposarcoma. Genomics 20:
210-222. [0293] Schoermakers H F P M, Mols R, Wanschura S, Kools P
F J, Geurts J M W, Bartnitzke S, Bullerdiek J, Van den Berghe H,
Van de Ven W J M (1994b) Identification, molecular cloning and
characterization of the chromosome 12 breakpoint cluster region of
uterine leiomyomas. Genes Chromosom Cancer 11: 106-118. [0294]
Second International Chromosome 12 Workshop, New Haven, Conn., USA,
Jun. 20-22, 1994. [0295] Seifert G, Miehlke A, Haubrich J, Chilla R
(19856): Diseases of the salivary glands. Pathology. Diagnosis.
Treatment. Facial nerve surgery. Translated by P.M. Stell. Thieme,
Stuttgart, N.Y., pp 182-194. [0296] Smit V T N B M, Wessels J W,
Mollevanger P, Schrier P I, Raap A K, Beverstock G C, Cornelisse C
J (1990) Combined GTG-banding and nonradioactive in situ
hybridization improves characterization of complex karyotypes.
Cytogenet Cell Genet. 54:20-23. [0297] Sreekantaiah C, Leong S L P,
Karakousis C P, McGee D L, Rappaport W D, Villar H V, Neal D,
Fleming S, Wankel A, Herrington P N, Carmona R, Sandberg A A (1991)
Cytogenetic profile of 109 lipomas. Cancer Res 51: 422-433. [0298]
Vanni R, Dal Cin P, Marras S, Moerman Ph, Andria M, Valdes E,
Deprest J, and Van den Berghe H (1993) Endometrial polyp: Another
benign tumor characterized by 12q13-15 changes. Cancer Genet
Cytogenet 68:32-33. [0299] Walter T A, Xuan Fan S, Medchill M T,
Berger C S, Decker H-J H, Sandberg A A (1989) Inv (12) (p11-2q13)
in an endometrial polyp. Cancer Genet Cytogenet 41: 99-103. [0300]
Wanschura S, Belge G, Stenman G, Kools P, Dal Chin P, Schoenmakers
E, Huysmans C, Bartnizke S, Van de Ven W, and Bullerdiek J
(submitted for publication) Mapping of the translocation
breakpoints of primary pleomorphic adenomas and lipomas within a
common region of chromosome 12.
Legends of Figures of Annex 1
[0301] FIG. 1. Schematic representation of FISH mapping data
obtained for the seven pleomorphic salivary gland adenoma cell
lines tested in this study. Cosmid clones which were used as probes
in the FISH mapping studies map at sequence-tagged sites obtained
from overlapping YAC clones. They are named after the acronyms of
the STSs, as shown in the boxes, and the relative order of these is
as presented. The DNA interval between RM69 and RM72 is estimated
to be about 2.8 Mb. The solid lines indicate DNA intervals in which
the breakpoints of the various cell lines are located. The dots
indicate FISH experiments that were performed on metaphase
chromosomes of the various cell lines using a cosmid clone
corresponding to the STS indicated above these as molecular probe.
The relative positions of MAR and ULCR12 are indicated in the lower
part of the figure. Ad, pleomorphic salivary gland adenoma; MAR,
multiple aberration region; ULCR12, uterine leiomyoma cluster
region of chromosome 12 breakpoints. FIG. 2. a: Partial karyotype
of Ad-295/SV40 showing der (8), der (12), der (18) and the
corresponding normal chromosomes. b: FISH analysis of metaphase
chromosomes of Ad-295/SV40 cells using DNA of cosmid clone cRM76 as
molecular probe. Hybridization signals on normal chromosome 12
(arrow) and der (12) (arrowhead). c: GTG-banding pattern of
metaphase chromosomes of Ad-295/SV40 shown in b. d: FISH analysis
of metaphase chromosomes of Ad-295/SV40 cells using DNA of cosmid
clone cRM103 as molecular probe. Hybridization signals on normal
chromosome 12 (arrow) and der (18) (arrowhead). FIG. 3. Schematic
representation of chromosome 12 breakpoint mapping data obtained
for primary pleomorphic salivary gland adenomas, uterine
leiomyomas, and lipomas as well as cell lines derived from such
solid tumors. Results are compared to data for primary uterine
leiomyomas (Wanschura et al., submitted for publication) and cell
lines derived from such tumors (Schoenmakers et al., 1994b). Cosmid
clones which were used as probes in the FISH mapping studies
correspond to sequence-tagged sites obtained from overlapping YAC
clones. Cosmid clones were named after the acronyms of the STSs, as
shown in the boxes, and the relative order of these is as
presented. The estimated sizes of DNA intervals between STSs are
indicated. Ad, pleomorphic salivary gland adenoma; Li, lipoma; LM,
uterine leiomyoma.
ANNEX 2
Lead Article
[0302] Identification of the Chromosome 12 Translocation Breakpoint
Region of a Pleomorphic Salivary Gland Adenoma with t(1; 12) (p22;
q3.5) as the Sole Cytogenetic Abnormality Patrick F. J. Kools,
Sylke Wanschura, Eric F. P J. Schoenmakers, Jan W. M. Geurts, Rat
Koa, Bernd Kazmierczak, Jorn Bullerdiek, Herman Van den Berghe and
Wim. J. M. Van de Ven 2ABSTRACT: Cell line Ad-312/SV40, which was
derived from a primary pleomorphic salivary gland adenoma with t(1;
12)(p22; q15), was used in fluorescence in situ hybridization
(FISH) analysis to characterize its translocation breakpoint region
on chromosome 12. Results of previous studies have indicated that
the chromosome 22 breakpoint in Ad-312/SV40 is located proximally
to locus D12S8 and distally to the CROP gene. We here describe two
partially overlapping yeast artificial chromosome (YAC) clones,
Y4854 (500 kbp) and Y9091 (460 kbp), which we isolated in the
context of a chromosome walking project with D12S8 and CROP as
starting points. Subsequently, we have isolated cosmid clones
corresponding to various sequence-tagged sites (STSs) mapping
within the inserts of these YAC clones. These included cRM51,
cRM69, cRM85, cRM90, cRM91, cRM110, and cRM111. From the Center for
Human Genetics (P. F. J. K., E. F. P. M. S., J. W. M. G., R. M., H.
V. D. B., W. J. M. V. D. V.). University of Leuven, Leuven, Belgium
and the Center for Human Genetics (S. W., B. K., J. B.). University
of Bremen, Bremen. Germany. P. F. J. Kools and Sylke Wanschura
contributed equally to this study and must be considered joint
first authors. Address reprint requests to Dr. Wim J. M. Van de
Ven, Center for Human Genetics. University of Leuven. Herestraat
49. B-3000, Leuven. Belgium. Received Apr. 13, 1994: accepted Jul.
6, 1994. We present a composite long-range restriction map
encompassing the inserts of these two YAC clones and show by FISH
analysis, that both YACS span the chromosome 12 breakpoint as
present in Ad-312/SV40 cells. In FISH studies, cosmid clones cRM5,
cRM90 and cRM111 appeared to map distally to the chromosome 12
breakpoint whereas cosmid clones cRM51, cRM69, cRM91, and cRM110
were found to map proximally to it. These results assign the
chromosome 12 breakpoint in Ad-312/SV40 to a DNA region of less
than 165 kbp. FISH evaluation of the chromosome 12 breakpoints in
five other pleomorphic salivary gland adenoma cell lines indicated
that these are located proximally to the one in Ad-312/SV40, at a
distance of more than 0.9 Mb from STS RM91. These results, while
pinpointing a potentially critical region on chromosome 12, also
provide evidence for the possible involvement of chromosome
12q13-q15 sequences located elsewhere.
Introduction
[0303] Pleomorphic salivary gland adenoma constitutes a benign
epithelial tumor that originates from the major and minor salivary
glands. It is the most common type of salivary gland tumor and
accounts for almost 50% of all neoplasms in these organs; 85% of
the tumors are found in the parotid gland, 10% in the minor
salivary glands, and 5% in the submandibular gland [1]. About 50%
of these adenomas appear to have a normal karyotype but cytogenetic
studies have also revealed recurrent specific chromosome anomalies
[2, 3]. Frequently observed anomalies include aberrations of
chromosome 8, usually involving the 8q12-q13 region, with the most
common aberration a t(3; 8)(p21; q12), and aberrations of
chromosome 12, usually translocations involving region 12q13-q15.
Non-recurrent clonal chromosome abnormalities have also been
reported. The highly specific pattern of chromosome rearrangements
with consistent breakpoints at 8q12-q13 and 12q13-q15 suggests that
these chromosomal regions harbour genes that might be implicated in
the development of these tumors. Molecular cloning of the
chromosome breakpoints and characterization of their junction
fragments may lead to the identification of pathogenetically
relevant genes. At present, no such molecular data have yet been
reported for these tumors.
[0304] On the basis of fluorescence in situ hybridization (FISH)
data, the chromosome 12 breakpoints in six pleomorphic salivary
gland adenoma cell lines were recently shown to be mapping to
region 12q13-q15, more precisely, to the genomic interval between
loci D12S19 and D12S8 [4, 5]. The sex-averaged genetic size of this
genomic DNA interval was reported at HGM10 to be 7 cM [6]. We also
reported that the chromosome 12 breakpoints in salivary gland
adenomas map distally to the CHOP gene [5], which supports an
earlier study indicating that the 12q13-q15 translocation
breakpoints in pleomorphic salivary gland adenomas are different
from that in myxoid liposarcoma [7]. Here, we report about the
physical mapping of the chromosome 12 breakpoint in pleomorphic
salivary gland adenoma cell line Ad-312/SV40, which carries a t(1;
12)(p22; q15) as the only cytogenetic abnormality.
Materials and Methods
Tumor Cell Lines.
[0305] Human tumor cell lines used in this study included the
previously described pleomorphic salivary gland adenoma cell lines
Ad-248/SV40, Ad-263/SV40, Ad-295/SV40, Ad-302/SV40, Ad-312/SV40,
and Ad-366/SV40 [5, 8]. Cells were cultivated in TC199 culture
medium with Earle's salts supplemented with 20% fetal bovine serum.
Other cell lines used in this study included somatic cell hybrid
PK89-12, which contains chromosome 12 as the sole human chromosome
in a hamster genetic background [9], and somatic cell hybrid
LIS-3/SV40/A9-B4 [4]. The latter cell line was obtained upon fusion
of myxoid liposarcoma cell line LIS-3/SV40, which carries the
specific t(12; 16) (q13; p11.2), with mouse A9 cells. This somatic
cell hybrid was previously shown to contain der (16) but neither
der (12) nor the normal chromosome 12 [4]. PK89-12 and
LIS-3/SV40/A9-B4 cells were grown in DME-F12 medium supplemented
with 10% fetal bovine serum. Cell lines were analyzed by standard
cytogenetic techniques at regular intervals.
Isolation of YAC and Cosmid Clones
[0306] In the context of human genome mapping studies, which will
be described in detail elsewhere (Schoenmakers et al., in
preparation), we isolated YAC clones Y4854 and Y9091 from the
first-generation CEPH YAC library [10], and cosmid clones cRM51,
cRM69, cRM85, cRM90, cRM91, cMR103, cRM110, and cRM111 from the
chromosome-12-specific, arrayed cosmid library LLNLNC01 [11]. YAC
and cosmid clones were isolated as described before [5]. Initial
screenings of the YAC, as well as the cosmid library, were
performed using a screening strategy involving the polymerase chain
reaction (PCR) [1,2]. Filter hybridization analysis was used as the
final screening step, as previously described [5]. Cosmid clones
were isolated using STSs and those corresponding to STSs within the
inserts of YAC clones Y4854 and Y9091 are indicated in FIG. 1. STSs
were obtained via rescue of YAC insert end-sequences using a
vectorette-PCR procedure [13] or Alu-PCR [14, 15]. PCR products
were sequenced directly via solid-phase fluorescent sequencing.
Cosmid clones were grown and handled according to standard
procedures [16]. YAC clones were characterized by pulsed-field gel
electrophoresis [17], restriction mapping, and hybridization, as
previously described [5].
Chromosome Preparations and Fluorescence In Situ Hybridization
[0307] Cells from the pleomorphic salivary gland adenoma tumor cell
lines were treated with Colcemid (0.04 .mu.g/ml) for 30 min and
then harvested according to routine methods. Metaphase spreads of
the tumor cells were prepared as described before [4]. To establish
the identity of chromosomes in the FISH experiments, FISH analysis
was performed after G-banding of the same metaphase spreads.
G-banding was performed essentially as described by Smit et al.
[18]. In situ hybridizations were carried out according to a
protocol described by Kievits et al. [19] with some minor
modifications [5, 20]. Cosmid and YAC DNA was labelled with
biotin-11-dUTP (Boehringer Mannheim) or biotin-14-dATP (BRL,
Gaithersburg), as described earlier [5]. Chromosomes were
counterstained with propidium iodide and analyzed on a Zeiss
Axiophot fluorescence microscope using a FITC filter (Zeiss).
Results were recorded on scotch (3M) 640 asa film.
Results
[0308] Isolation and Characterisation of YAC Clones Spanning the
Chromosome 12 Breakpoint of Pleomorphic salivary Gland Adenoma Cell
Line Ad-312/SV40.
[0309] In previous studies [5], we mapped the chromosome 12
breakpoints of six pleomorphic salivary gland adenoma cell lines
proximally to locus D12S8 and distally to CHOP. The DNA interval
between these loci is somewhat smaller than 7 cM (estimated
distance between the loci D12S8 and D12S19 [6]) but still
substantially large. To molecularly define the translocation
breakpoint of Ad-312/SV40, we have performed human genome mapping
studies on the DNA interval between locus D12S8 and the CHOP gene.
In the process of directional chromosome walking starting from
D12S8 and the CROP gene, we obtained overlapping YAC clones Y9091
and Y4854. The DNA insert of Y9091 appeared to be 460 kbp and that
of Y4854, 500 kbp. Moreover, as we will demonstrate below, the DNA
insert of each YAC clone appeared to span the chromosome 12
breakpoint of Ad-312/SV40. A long-range restriction map of the
inserts of these YAC clones was made using pulsed-field gel
electrophoresis and hybridization analysis (FIG. 1). On the basis
of STS content mapping and southern blot analysis, the inserts of
YAC clones Y9091 and Y4854 appeared to overlap as indicated in FIG.
1. The tested STSs correspond to end-sequences of other overlapping
YAC clones not shown here or to sequences obtained via
inter-Alu-PCR. Of these, RM90 and RM91 represent such end-clone
STSs of YAC Y9091, and RM48 and RM54 of Y4854, whereas RM110 and
RM111 represent STSs derived from inter-Alu-PCR. For a number of
STSs mapping within the inserts of YAC clones Y4854 and Y9091,
corresponding cosmid clones were isolated for use in FISH analysis,
e.g., cRM51, cRM69, cRM58, cRM50, cRM91, cRM110, and cRM111.
[0310] The inserts of the two overlapping YAC clones are most
likely not chimeric, as was deduced from the following
observations. FISH analysis of metaphase chromosomes of normal
human lymphocytes with Y4854 or Y9091 DNA as molecular probe
revealed hybridization signals only in chromosome region 12q13-q15.
For Y9091, this was confirmed further by observations made in FISH
studies in which cosmid clone cRM90 or cRM91 was used as probe; the
DNA insert of each of these two cosmids corresponds to the
alternative end-sequences of YAC clone Y9091. Finally, the
end-sequence STSs of Y9091 appeared to map to chromosome 12 and
distally to the CHOP gene, as was established by PCR analysis on
PK89-12 DNA, which contains human chromosome 12 as the sole human
chromosome in a hamster genetic background, and LIS-3/SV40/A9-B4
DNA, which was previously shown to contain der (16), from the
specific t(12; 16) of myxoid liposarcoma, but neither der (12) nor
the normal chromosome 12 [4]. From the chromosome walking studies,
we concluded that the overlapping inserts of the two YAC clones
represent a DNA region of about 640-kbp, which is located on
chromosome 12q between D12S8 and CHOP. As the 640-kbp composite
long-range restriction map of the YAC contig was constructed with
at least double coverage of the entire region, it is not
unreasonable to assume that the 640-kbp region is contiguous with
the chromosomal DNA, although microdeletions can not be excluded at
this point.
[0311] Chromosome walking was routinely evaluated by FISH mapping
of YAC clones and/or cosmid clones corresponding to YAC insert
sequences. It should be noted that for the identification of
chromosomes, G-banding was used in most cases. On the basis of such
C-banding, hybridization signals could be assigned conclusively to
chromosomes of known identity; this was also of importance for the
cases with cross- or background hybridization signals that were
occasionally observed. G-banding prior to FISH analysis resulted
sometimes in rather weak hybridization signals or rather vague
banding patterns. Therefore, we performed FISH experiments in which
the YAC and cosmid clones to be evaluated were used in combination
with a reference probe. Cosmid clone cPK12qter, which was
serendipitously obtained during screening of a cosmid library, was
selected as reference marker. FISH analysis of metaphase
chromosomes of normal lymphocytes (FIG. 2A) revealed that cPK12qter
maps to the telomeric region of the long arm of chromosome 12. To
identify chromosome 12 in this experiment, centromere 12-specific
probe p.alpha.12H8 [21] was used. FISH analysis of metaphase
chromosomes of Ad-312/SV40 cells using YAC clone Y4854 (FIG. 2B) or
Y9091 (FIG. 2C) in combination with reference probe cPK12qter
revealed, in both cases, hybridization signals of the YAC insert on
der (1) as well as der (12). We concluded from these results that
the insert DNA of each YAC clone might span the chromosome 12
breakpoint in this cell line. It should be noted that G-banding
revealed a telomeric association involving the short arm of
chromosome 12 in FIG. 2C. The observation that YAC clone Y9091
spanned the chromosome 12 breakpoint in Ad-312/SV40 was confirmed
independently in FISH studies in which cosmid clone cRM90 or cRM91
was used as molecular probe; they were shown to contain the
alternative end-sequences of the Y9091 insert. cRM90 appeared to
map distally to the chromosome 12 breakpoint, whereas cRM91 was
found to map proximally (data not shown). These results also
established the chromosomal orientation of the YAC contig shown in
FIG. 1. In summary, we concluded from these FISH studies that the
chromosome 12 translocation breakpoint in Ad-312/SV40 must be
located in the DNA interval corresponding to the overlapping
sequences (about 300 kbp) of the two YAC clones.
Fine Mapping of the Chromosome 12 Translocation Breakpoint of
Ad-312/SV40.
[0312] In an approach to further narrow the chromosome 12
translocation breakpoint region of Ad-312/SV40, cosmid clones with
different mapping positions within YAC clone Y9091 were isolated.
These included cRM69, cRM85, cRM110, and cRM111. cRM69 and cRM85
were isolated on the basis of STS sequences of YAC clones not shown
here. cRM110 and cRM111 were obtained via inter-Alu-PCR. RM110 was
shown by Southern blot analysis to hybridize to a terminal MluI
fragment of Y9091 and not to the DNA insert of the overlapping YAC
clone with RM69 as telomeric end-sequences. The location of RM110
is as indicated in FIG. 1. RM111 was shown to hybridize to a
BssHII, MluI, PvuI, and SfiI fragment of Y9091 and is therefore
located in the PvuI-SfiI fragment of Y9091, to which STS RM48 was
also mapped (FIG. 1). FISH analysis of metaphase chromosomes of
Ad-312/SV40 with cRM69 or cRM110 as probe indicated that the DNA
insert of these cosmids mapped proximally to the chromosome 12
translocation breakpoint in this cell line, as illustrated for
cRM69 in FIG. 3A. Subsequent FISH analysis of Ad-312/SV40 with
cRM85 or cRM111 as probe revealed hybridization signals distally to
the translocation breakpoint, as illustrated for cRM111 in FIG. 3B.
The results with cRM85 and cRM11 are in agreement with the observed
breakpoint spanning by YAC clone Y4854 as cRM85 maps distally and
cRM111 closely to STS RM48, which marks the telomeric end of YAC
clone Y4854. In conclusion, the chromosome 12 translocation
breakpoint in Ad-312/SV40 must be located in the DNA interval
between cRM110 and cRM111, as schematically summarized in FIG.
4.
FISH Evaluation of Chromosome 12 Breakpoints in Other Pleomorphic
Salivary Gland Adenoma Cell Lines.
[0313] To determine the position of their chromosome 12 breakpoints
relative to that of Ad-312/SV40, five other pleomorphic salivary
gland adenoma cell lines were evaluated by FISH analysis, as
summarized schematically in FIG. 4. These cell lines, which were
developed from primary tumors [5,8], included Ad-248/SV40,
Ad-263/SV40, Ad-295/SV40, Ad-302/SV40, and Ad-366/SV40. The
chromosome 12 aberrations of these cell lines are listed in FIG. 4.
FISH analysis of metaphase chromosomes of these cell lines using
cRM91 revealed that the chromosome 12 breakpoints of all these cell
lines mapped proximally to this cosmid clone (data not shown).
Similar FISH analysis was also performed using a cosmid clone
corresponding to sequence-tagged site RM103 as a probe. RM103 was
found to map proximally to RM91 at a distance of about 0.9 Mbp. In
all cases, cRM103 appeared to map distally to the chromosome 12
translocation breakpoints, indicating that the chromosome 12
breakpoints in these five pleomorphic salivary gland adenoma cell
lines are located at a relatively large distance from that of
Ad-312/SV40 cells.
Discussion
[0314] In the studies presented here, we have identified,
molecularly cloned, and characterized a chromosome region on the
long arm of chromosome 12 in which the translocation breakpoint of
pleomorphic salivary gland adenoma cell line Ad-312/SV40 appears to
map. In previous studies [5], we already provided evidence that the
chromosome 12 breakpoint of this cell line was located between
D12S8 and CROP. Because the two breakpoints spanning YAC clones
described here were obtained in directional chromosome walking
experiments using D12S8 and the CHOP gene as initial starting
points, the chromosome 12 breakpoint mapping results presented here
confirm our previous claim. The FISH results obtained with the
complete YAC insert of Y9091 as molecular probe were confirmed
independently in FISH studies using cosmid clones containing
sequences corresponding to various regions of the insert of this
YAC clone. This is of importance, as the independent confirmatory
results make it rather unlikely that the split signals observed
with the complete insert of Y9091 can be explained otherwise than
by a factual splitting of sequences represented in the YAC. The
presence, for instance, of highly related genetic sequences on both
sides of a chromosome breakpoint could easily lead to erroneous
conclusions if they were based solely on FISH results of a YAC
insert. Finally, our mapping studies have also established
conclusively the chromosomal orientation of the long-range
restriction map we have generated in these studies. This
orientation was already predicted on the basis of two-color FISH
studies (unpublished observations).
[0315] The FISH studies, described here, enabled us to map the
chromosome 12 breakpoint in Ad-312/SV40 cells to the 190-kbp DNA
interval between the established STSs RM48 and RM69. However, the
breakpoint region can be narrowed somewhat further on the basis of
the following. The fact that Y4854 was shown to span the breakpoint
indicates that at least a considerable part of the telomeric half
of this YAC clone must map distally to the breakpoint. Precisely
how much remains to be established. On the other side, STS RM69
appeared to be located in about the middle of the DNA insert of
cosmid clone cRM69, suggesting that the breakpoint is close to 25
kbp distally to RM69. Moreover, cRM69 appeared to lack RM110 (data
not shown) and, as cRM110 was found proximally to the chromosome 12
breakpoint in Ad-312/SV40 cells, the breakpoint should be even
further distal to RM69 than the earlier-mentioned 25 kbp.
Altogether, this narrows the chromosome 12 breakpoint region to a
DNA interval, which must be considerably smaller than 165 kbp.
Further pinpointing of the breakpoint will allow us to molecularly
clone the chromosome 12 breakpoint and to characterize the genetic
sequences in the breakpoint junction region, which might lead to
the identification of pathogenetically relevant sequences.
Identification of the genes present in the DNA inserts of YAC
clones Y4854 and Y9091, via sequencing, direct hybridization,
direct selection or exon-trapping, might constitute a useful
alternative approach for identifying the gene in this region of the
long arm of chromosome 12 that might be pathogenetically critical
far pleomorphic salivary gland adenoma tumorigenesis.
[0316] The observation that the chromosome 12 breakpoints in other
pleomorphic salivary gland adenomas are located in a remote and
more proximal region on the long arm of chromosome 12 is of
interest. It could imply that the chromosome 12 breakpoints in
pleomorphic salivary gland adenomas are dispersed over a relatively
large DNA region of the long arm of chromosome 12, reminiscent to
the 11q13 breakpoints in B-cell malignancies [22]. Elucidation of
the precise location of the chromosome 12 breakpoints in the other
pleomorphic salivary gland adenoma cell lines could shed more light
on this matter. On the other hand, it could point towards
alternative sequences on the long arm of chromosome 12 between
D12S8 and the CHOP gene that might be of importance, presumably for
growth regulation in pleomorphic salivary gland adenoma. The fact
that the chromosome 12 breakpoint region described here has so far
been found only in the Ad-312/SV40 cell line makes it necessary to
analyze a larger number of salivary gland adenomas with chromosome
12q3-q15 aberrations to assess the potential relevance for
tumorigenesis of the chromosome 12 sequences affected in the
studied cell line. If more cases with aberrations in this
particular region of chromosome 12 can be found, it would be of
interest to find out whether these tumors form a clinical subgroup.
Finally, chromosome translocations involving region q13-q15 of
human chromosome 12 have been reported for a variety of other solid
tumors: benign adipose tissue tumors, uterine leiomyoma,
rhabdomyosarcoma, hemangiopericytoma, clear-cell sarcoma,
chondromatous tumors, and hamartoma of the lung. Whether or not the
chromosome 12 breakpoints in some of these tumors map within the
same region as that of Ad-312/SV40 remains to be established. The
YAC and cosmid clones described in this report constitute useful
tools to investigate this.
[0317] The availability of a copy of the first-generation CEPH YAC
library [10] and a copy of the arrayed chromosome 12-specific
cosmid library (LLNL12NC01) [11] is greatly acknowledged. The
cosmid library was constructed as part of the National Laboratory
Gene Library Project under the auspices of the U.S. DOE by LLNL
under contract No. W-7405-Eng-48. The authors acknowledge the
excellent technical assistance of M. Dehaen, C. Huysmans, E. Meyen,
K. Meyer-Bolts, and M. Willems and would like to thank M. Leys for
art work. This work was supported in part by the EC through Biomed
1 program "Molecular Cytogenetics of Solid Tumours", the
"Geconcerteerde Onderzoekacties 1992-1996", the "Association
Luxembourgeoise contre le Cancer", the National Fund for scientific
Research (NFWO; Kom op tegen Kanker), the "ASLK-programma voor
Kankeronderzoek", the "Schwerpunktprogramm: Molekulare und
Klassische Tumorcytogenetik" of the Deutsche
Forschungsgemeinschaft, and the Tonjes-Vagt Stiftung. This text
presents results of the Belgian programme on Interuniversity Poles
of Attraction initiated by the Belgian State, Prime Minister's
Office, Science Policy Programming. The scientific responsibility
is assumed by its authors. J. W. M. Geurts is an "Aspirant" of the
National Fund for Scientific Research (NFWO; Kom op tegen
Kanker).
REFERENCES
[0318] 1. Seifart G, Miehlke A, Haubrich J, Chilla R (1986):
Diseases of the salivary glands. Pathology. Diagnosis. Treatment.
Facial nerve surgery. Translated by P.M. Stell. Thieme, Stuttgart,
N.Y., pp 1820194. [0319] 2. Sandros J, Stenman G, Mark J (1990):
Cytogenetic and molecular observations in human and experimental
salivary gland tumours. Cancer Genet Cytogenet 44: 153-167. [0320]
3. Bullerdiek J, Wobst G, Meyer-Bolte K, Chilla R, Haubrich J,
Thode B, Bartnitzke S (1993): Cytogenetic subtyping of 220 salivary
gland pleomorphic adenomas: correlation to occurrence, histological
subtype, and in vitro cellular behavior. Cancer Genet Cytogenet 65:
27-31. [0321] 4. Schoenmakers H F P M, Kools P F J, Kazmierczak B,
Bullerdiek J, Claussen U, Horsthemke B, Van den Berghe H, Van de
Ven W J M (1993): Isolation of a somatic cell hybrid retaining the
der (16)t(12; 16)(q13; p11.2) from a myxoid liposarcoma cell line.
Cell Genet Cytogenet 62: 159-161. [0322] 5. Schoenmakers H F P M,
Kools P F J, Mole R, Kazmierczak B, Bartnitzke 8, Bullerdiek J, Dal
Cin P, De Jong P J, Van den Berghe H, Van de Ven W J M (1993):
Physical mapping of chromosome 12q breakpoints in lipoma,
pleomorphic salivary gland adenoma, uterine leiomyoma, and myxoid
liposarcoma. Genomics, 20: 210-222. [0323] 6. Keats B, Ott J,
Conneally M (1989): Reports of the committee on linkage and gene
order. Cytogenet Cell Genet. 51: 459-502. [0324] 7. Stanman G,
Sahlin P, Mark 3, Chaganti R K S, Kindblom L S, Aman P (1993): The
12q13-q15 translocation breakpoints in pleomorphic adenoma and
clear-cell sarcoma of tendons and aponeuroses are different from
that in myxoid liposarcoma. Genes Chrom Cancer 7: 178-180. [0325]
8. Kazmierczak B, Bartnitzke S, Hartl M, Bullerdiek J (1990): In
vitro transformation by the SV40 "early region" of cells from a
human benign salivary gland tumour with a 12q13-q15 rearrangement.
Cytogenet Cell Genet. 53: 37-39. [0326] 9. Warburton D, Gersen S,
Yu M-T, Jackson C, Handelin B, Hausman D (1990): Monochromosomal
rodent-human hybrids from microcell fusion of human lymphoblastoid
cells containing an inserted dominant selectable marker. Genomics
6: 358-366. [0327] 10. Albertmen B M, Abderrahim H, Cann H M,
Dausset J, Le Paslier D, Cohen D (1990): Construction and
characterization of a yeast artificial chromosome library
containing seven haploid human genome equivalents. Proc Natl Acad
Sci USA 87: 4256-4260. [0328] 11. Montgomery K T, LeBlanc J M, Tsai
P, McNinch J S, Ward D C, De Jong P J, Kucherlapati R, Krauter K S
(1993): Characterization of two chromosome 12 cosmid libraries and
development of STSs from cosmids mapped by FISH. Genomics
17:682-693. [0329] 12. Green E D, Olson M V (1990): Systematic
screening of yeast artificial-chromosome libraries using the
polymerase chain reaction. Proc Natl Acad Sci USA 87: 1213-1217.
[0330] 13. Geurts J M W, Schoenmakers H F P M, Mole R, Van de Ven W
J M (1994): Improved procedure for rapid isolation and sequencing
of DNAS termini in yeast artificial chromosomes. Meth Mol Cell
Biol, In Press. [0331] 14. Nelson D L, Ledbetter S A, Carbo L,
Victoria M F, Ramirez-Solis R, Webster T D, Ledbetter D H, Caskey C
T (1989): Alu polymerase chain reaction. A method for rapid
isolation of human-specific sequences from complex DNA sources.
Proc Natl Acad Sci USA 86: 6686-6690. [0332] 15. Breukel C, Wijnen
J, Trops C, Van de lift H, Dauwerse H, Meera Khan P (1990):
Vector-Alu PCR: a rapid step in mapping cosmids and YACs. Nucl
Acids Res 18: 3097. [0333] 16. Sambrook J, Fritsch E F, Maniatis T
(1989): Molecular Cloning: A Laboratory Manual. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y. [0334] 17. Chu G,
Vollrath D, Davis R W (1986): Separation of large DNA molecules by
contour-clamped homogeneous electric fields. Science 234:
1582-1585. [0335] 18. Smit V T H B M, Wessels J W, Mollevanger P,
Schrier P I, Raap E K, Beverstock G C, Cornelisse C J (1990):
Combined GTG-banding and nonradipactive in situ hybridozation
improves characterization of complex karyotypes. Cytogenet Cell
Genet. 54: 20-23. [0336] 19. Kievits T, Danwerse J G, Wiegant J,
Devilee P, Breuning M E, Cornelisse C J, van Ommen G, Pearson P L
(1990): Rapid subchromosomal localization of cosmids by
nonradioactive in situ hybridization. Cytogenet Cell Genet. 53:
134-136. [0337] 20. Kools P F J, Rebroek A J M, Van de Velde H J K,
Marynen P, Bullerdiek J, Van de Van W J M (1993): Regional mapping
of the human NSP gene to chromosome 14q21-q22 by fluorescence in
situ hybridization. Cytogenet Cell Genet. 66:48-50. [0338] 21.
Looijenga L H J, Smit V T H B M, Wessels J W, Mollevanger P,
Oosterhuis J W, Cornelisse C J (1990): Localization and
polymorphism of a chromosome 12-specific .alpha. satellite DNA
sequence. Cytogenet Cell Genet. 53: 216-218. [0339] 22. Raynaud S
D, Bekri S, Leroux D, Grosgeorge j, Klein B, Bastard C, Gaudray P,
Simon MP (1993): Expanded range of 11q13 breakpoints with differing
patterns of cyclin D1 expression in B-cell malignancies. Genes
Chrom Cancer 8: 80-87.
Legends of Figures of Annex 2
[0340] FIG. 1. Composite physical map of the overlapping DNA
inserts of YAC clones Y4854 and Y9091. Sizes of the DNA inserts are
indicated. The relative positions of the YAC clones are represented
by bars below the long range physical map. Sequence-tagged sites
(STSs) corresponding to end-clones of YACs, including YACs not
shown here, are indicated by boxed R codes above the restriction
map. STSs obtained from inter-Alu-PCR products are given below the
restriction map and the DNA regions to which they have been mapped
are marked by arrows. B: BssHII; M: MluI; P: PvuI; Sf: SfiI. A
polymorphic MluI site is marked by an asterisk. FIG. 2. A) Mapping
of cosmid clone cPK12qter to the telomeric region of the long arm
of chromosome 12. Centromere 12-specific probe p.alpha.12H8 was
used to establish the identity of chromosome 12. FISH analysis was
performed on metaphase chromosomes of control human lymphocytes.
Hybridization signals of cPK12qter are marked with small
arrowheads, those of the centromere 12-specific probe with
asterisks. B, C) FISH analysis of metaphase chromosomes of
Ad-312/SV40 cells using DNA of YAC clone Y4854 (B) or Y9091 (C) as
molecular probe in combination with cosmid clone cPK12qter as
reference marker. Hybridization signals of the YAC clones on
chromosome 12 are indicated by large arrowheads; those on der (1)
by large arrows, and those on der (12) by small arrows,
respectively. The hybridization signals of cosmid clone cPK12qter
are indicated by small arrowheads. FIG. 3. FISH analysis of
metaphase chromosomes of Ad-312/SV40 cells using DNA of cosmid
clone cRM69 (A) or cRM111 (B) as molecular probe in combination
with cosmid clone cPK12qter as reference marker. The position of
the hybridization signals of cPK12qter are indicated by small
arrowheads. In (A), the position of the hybridization signal of
cRM69 an normal chromosome 12 is indicated by a large arrowhead,
and that on der (12) with a small arrow. In (B), the position of
the hybridization signal of cRM111 on normal chromosome 12 is
indicated by a large arrowhead, and that on der (1) with a large
arrow. FIG. 4. Schematic representation of FISH mapping data
obtained for the six pleomorphic salivary gland adenoma cell lines
tested in this study. The specific chromosome 12 aberrations in the
various cell lines are given. Cosmid clones which were used as
probes in the FISH mapping studies correspond to sequence-tagged
sites obtained from overlapping YAC clones. Individual FISH
experiments are indicated by dots. Cosmid clones were named after
the acronyms of the STSs, as shown in the boxes, and the relative
order of these is as presented. The DNA interval between RM90 and
RM103 is estimated to be about 1.3 Mb. Insert: schematic
representation of the G-banded derivative chromosomes der (1) and
der (12) of the Ad-312/SV40 cell line, which carries a t(1; 12)
(p22; q15). The positions of the chromosome 12 breakpoints of
Ad-248/SV40, Ad-263/SV40, Ad-295/SV40, Ad-302/SV40, and Ad-366/SV40
are distal to RM103 as indicated by the arrow.
Sequence CWU 1
1
* * * * *