U.S. patent application number 12/274770 was filed with the patent office on 2011-12-22 for primers for use in detecting beta-lactamases.
This patent application is currently assigned to CREIGHTON UNIVERSITY. Invention is credited to ANTON F. EHRHARDT, NANCY D. HANSON, CHRISTINE C. SANDERS.
Application Number | 20110311976 12/274770 |
Document ID | / |
Family ID | 27379304 |
Filed Date | 2011-12-22 |
United States Patent
Application |
20110311976 |
Kind Code |
A1 |
HANSON; NANCY D. ; et
al. |
December 22, 2011 |
PRIMERS FOR USE IN DETECTING BETA-LACTAMASES
Abstract
Oliognucleotide primers are provided that are specific for
nucleic acid characteristic of certain beta-lactamases. The primers
can be employed in methods to identify nucleic acid characteristic
of family-specific beta-lactamase enzymes in samples, and
particularly, in clinical isolates of Gram-negative bacteria.
Inventors: |
HANSON; NANCY D.; (GRETNA,
NE) ; SANDERS; CHRISTINE C.; (ENGLEWOOD, FL) ;
EHRHARDT; ANTON F.; (OMAHA, NE) |
Assignee: |
CREIGHTON UNIVERSITY
OMAHA
NE
|
Family ID: |
27379304 |
Appl. No.: |
12/274770 |
Filed: |
November 20, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11084973 |
Mar 21, 2005 |
7476520 |
|
|
12274770 |
|
|
|
|
09814252 |
Mar 21, 2001 |
6893846 |
|
|
11084973 |
|
|
|
|
09407818 |
Sep 28, 1999 |
6242223 |
|
|
09814252 |
|
|
|
|
60102181 |
Sep 28, 1998 |
|
|
|
60121765 |
Feb 26, 1999 |
|
|
|
Current U.S.
Class: |
435/6.12 ;
536/24.33 |
Current CPC
Class: |
C12Q 1/689 20130101;
C12N 9/78 20130101 |
Class at
Publication: |
435/6.12 ;
536/24.33 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C07H 21/00 20060101 C07H021/00 |
Claims
1-89. (canceled)
90. A primer selected from the group of: 5'-CTT GGT CTG ACA GTT
ACC-3' (SEQ ID NO: 3); 5'-TGT CGC CCT TAT TCC-3' (SEQ ID NO: 4);
and 5'-TCG GGG AAA TGT GCG-3' (SEQ ID NO:5); and full length
complements thereof.
91. A method for identifying a beta-lactamase in a clinical sample,
the method comprising: providing a pair of oligonucleotide primers
specific for nucleic acid characteristics of the TEM family of
beta-lactamase enzymes, wherein one primer of the pair is
complementary to at least a portion of the beta-lactamase nucleic
acid in the sense strand and the other primer of each pair is
complementary to at least a portion of the beta-lactamase nucleic
acid in the antisense strand; annealing the primers to the
beta-lactamase nucleic acid; simultaneously extending the annealed
primers from a 3' terminus of each primer to synthesize an
extension product that is complementary to the nucleic acid strands
annealed to each primer wherein each extension product after
separation from the beta-lactamase nucleic acid serves as a
template for the synthesis of an extension product for the other
primer of each pair; separating the amplified products; and
analyzing the separated amplified products for a region
characteristic of the beta-lactamase.
92. A diagnostic kit for detecting a TEM family beta-lactamase
which comprises packaging, containing, separately packaged: (a) at
least one primer pair capable of hybridizing to beta-lactamase
nucleic acid of interest; (b) a positive and negative control; and
(c) a protocol for identification of the beta-lactamase nucleic
acid of interest.
93. A method for identifying a beta-lactamase enzyme in a clinical
sample, the method comprising: providing a pair of oligonucleotide
primers, wherein at least one of the primers is selected from the
primers of claim 90, and further wherein one primer of the pair is
complementary to at least a portion of the beta-lactamase nucleic
acid in the sense strand and the other primer of each pair is
complementary to at least a portion of the beta-lactamase nucleic
acid in the antisense strand; annealing the primers to the
beta-lactamase nucleic acid; simultaneously extending the annealed
primers from a 3' terminus of each primer to synthesize an
extension product that is complementary to the nucleic acid strands
annealed to each primer wherein each extension product after
separation from the beta-lactamase nucleic acid serves as a
template for the synthesis of an extension product for the other
primer of each pair; separating the amplified products; and
analyzing the separated amplified products for a region
characteristic of the beta-lactamase.
94. The method of claim 93 wherein the beta-lactamase enzyme is
found in a Gram-negative bacterium.
95. The method of claim 94 wherein the Gram-negative bacterium is
selected from the group consisting of Enterobacter cloacae,
Citrobacter freundii, Serratia marcescens, Providenceia supp.,
Proteus mirabilis, Yersinia enterocolitica, and combinations
thereof.
96. A diagnostic kit for detecting a beta-lactamase enzyme in a
clinical sample which comprises packaging, containing, separately
packaged: (a) a pair of oligonucleotide primers capable of
hybridizing to beta-lactamase nucleic acid of interest, wherein at
least one of the primers is selected from the primers of claim 90;
(b) a positive and negative control; and (c) a protocol for
identification of the beta-lactamase nucleic acid of interest.
97. The kit of claim 96 wherein the beta-lactamase enzyme is found
in a Gram-negative bacterium.
98. The kit of claim 97 wherein the Gram-negative bacterium is
selected from the group consisting of Enterobacter cloacae,
Citrobacter freundii, Serratia marcescens, Providenceia supp.,
Proteus mirabilis, Yersinia enterocolitica, and combinations
thereof.
99. A method for analyzing a beta-lactamase of the TEM family of
beta-lactamases in a clinical sample, the method comprising:
providing a clinical sample suspected of containing a
beta-lactamase nucleic acid of the TEM family of beta-lactamases;
providing a pair of oligonucleotide primers, wherein the primers
specifically hybridize with a beta-lactamase nucleic acid of the
TEM family of beta-lactamases, wherein one primer of the pair is
complementary to at least a portion of the sense strand of the
beta-lactamase nucleic acid and the other primer of the pair is
complementary to at least a portion of the antisense strand of the
beta-lactamase nucleic acid, and wherein at least one of the
primers is selected from the group consisting of: 5'-CTT GGT CTG
ACA GTT ACC-3' (SEQ ID NO: 3); 5'-TGT CGC CCT TAT TCC-3' (SEQ ID
NO: 4); and 5'-TCG GGG AAA TGT GCG-3' (SEQ ID NO:5); and full
length complements thereof; annealing the primers to the
beta-lactamase nucleic acid of the TEM family of the
beta-lactamases if the beta-lactamase nucleic acid of the TEM
family of beta-lactamases is in the sample; simultaneously
extending the annealed primers from a 3' terminus of each primer of
the pair and synthesizing extension products that are complementary
to the nucleic acid strands of the beta-lactamase nucleic acid
annealed to each primer of the pair wherein the extension products
after separation from one strand of the beta-lactamase nucleic acid
serve as templates for the synthesis of extension products of other
strands of the beta-lactamase nucleic acid; separating the
extension products; and analyzing the separated extension products
for a region characteristic of the beta-lactamase of the TEM family
if the beta-lactamase nucleic acid of the TEM family of
beta-lactamases is in the sample.
100. The method of claim 99 wherein the TEM family of
beta-lactamases are found in a Gram-negative bacterium.
101. The method of claim 100 wherein the Gram-negative bacterium is
selected from the group consisting of Enterobacter cloacae,
Citrobacter, freundii, Serratia marcescens, Providencia spp.,
Proteus mirabilis, and Yersinia enterocolitica.
102. A diagnostic kit for detecting a beta-lactamase in a clinical
sample which comprises: (a) a pair of oligonucleotide primers
capable of hybridizing to a beta-lactamase nucleic acid of
interest, wherein the beta-lactamase nucleic acid of interest is a
beta-lactamase nucleic acid of the TEM family of beta-lactamases;
(b) a positive and negative control; and (c) a protocol for
identification of the beta-lactamase nucleic acid of interest;
wherein at least one of the primers is selected from the group
consisting of: 5'-CTT GGT CTG ACA GTT ACC-3' (SEQ ID NO: 3); 5'-TGT
CGC CCT TAT TCC-3' (SEQ ID NO: 4); and 5'-TCG GGG AAA TGT GCG-3'
(SEQ ID NO:5); and full length complements thereof.
103. The kit of claim 102 wherein the TEM family of beta-lactamases
are found in a Gram-negative bacterium.
104. The kit of claim 103 wherein the Gram-negative bacterium is
selected from the group consisting of Enterobacter cloacae,
Citrobacter freundii, Serratia marcescens, Providencia spp.,
Proteus mirabilis, and Yersinia enterocolitica.
Description
BACKGROUND
[0001] A disturbing consequence of the use, and over-use, of
beta-lactam antibiotics (e.g., penicillins and cephalosporins) has
been the development and spread of beta-lactamases. Beta-lactamases
are enzymes that open the beta-lactam ring of penicillins,
cephalosporins, and related compounds, to inactivate the
antibiotic. The production of beta-lactamases is an important
mechanism of resistance to beta-lactam antibiotics among
Gram-negative bacteria.
[0002] Expanded-spectrum cephalosporins have been specifically
designed to resist degradation by the older broad-spectrum
beta-lactamases such as TEM-1, 2, and SHV-1. Microbial response to
the expanded-spectrum cephalosporins has been the production of
mutant forms of the older beta-lactamases called extended-spectrum
beta-lactamases (ESBLs). Although ESBL-producing Enterobacteriaceae
were first reported in Europe in 1983 and 1984, ESBLs have now been
found in organisms of diverse genera recovered from patients in all
continents except Antarctica. The occurrence of ESBL-producing
organisms varies widely with some types more prevalent in Europe
(TEM-3), others more prevalent in the United States (TEM-10, TEM-12
and TEM-26), while others appear worldwide (SHV-2 and SHV-5). These
enzymes are capable of hydrolyzing the newer cephalosporins and
aztreonam. Studies with biochemical and molecular techniques
indicate that many ESBLs are derivatives of older TEM-1, TEM-2, or
SHV-1 beta-lactamases, some differing from the parent enzyme by one
to four amino acid substitutions.
[0003] In addition, resistance in Klebsiella pneumoniae and
Escherichia coli to cephamycins and inhibitor compounds such as
clavalante have also arisen via acquisition of plasmids containing
the chromosomally derived AmpC beta-lactamase, most commonly
encoded by Enterobacter cloacae, Pseudomonas aeruginosa, and
Citrobacter freundii.
[0004] It is of particular concern that genes encoding the
beta-lactamases are often located on large plasmids that also
contain genes for resistance to other antibiotic classes including
aminoglycosides, tetracycline, sulfonamides, trimethoprim, and
chloramphenicol. Furthermore there is an increasing tendency for
pathogens to produce multiple beta-lactamases. These developments,
which occur over a wide range of Gram-negative genera, represent a
recent evolutionary development in which common Gram-negative
pathogens are availing themselves of increasingly complex
repertoires of antibiotic resistance mechanisms. Clinically, this
increases the difficulty of identifying effective therapies for
infected patients.
[0005] Thus, there is a need for techniques that can quickly and
accurately identify the types of beta-lactamases that may be
present in a clinical isolate or sample, for example. This could
have significant implications in the choice of antibiotic necessary
to treat a bacterial infection.
SUMMARY OF THE INVENTION
[0006] The present invention is directed to the use of
oligonucleotide primers specific to nucleic acids characteristic of
(typically, genes encoding) certain beta-lactamases. More
specifically, the present invention uses primers to identify family
specific beta-lactamase nucleic acids (typically, genes) in
samples, particularly, in clinical isolates of Gram-negative
bacteria. Specific primers of the invention include the primer
sequences set forth in SEQ ID NOs: 1-45. As used herein, a nucleic
acid characteristic of a beta-lactamase enzyme includes a gene or a
portion thereof. A "gene" as used herein, is a segment or fragment
of nucleic acid (e.g., a DNA molecule) involved in producing a
peptide (e.g., a polypeptide and/or protein). A gene can include
regions preceding (upstream) and following (downstream) a coding
region (i.e., regulatory elements) as well as intervening sequences
(introns, e.g., non-coding regions) between individual coding
segments (exons). The term "coding region" is used broadly herein
to mean a region capable of being transcribed to form an RNA, the
transcribed RNA can be, but need not necessarily be, further
processed to yield an mRNA.
[0007] Additionally, a method for identifying a beta-lactamase in a
clinical sample is provided. Preferably, the clinical sample
provided is characterized as a Gram-negative bacteria with
resistance to beta-lactam antibiotics. The method includes,
providing a pair of oligonucleotide primers, wherein one primer of
the pair is complementary to at least a portion of the
beta-lactamase nucleic acid in the sense strand and the other
primer of each pair is complementary to a different portion of the
beta-lactamase nucleic acid in the antisense strand; annealing the
primers to the beta-lactamase nucleic acid; simultaneously
extending the annealed primers from a 3' terminus of each primer to
synthesize an extension product complementary to the strands
annealed to each primer wherein each extension product after
separation from the beta-lactamase nucleic acid serves as a
template for the synthesis of an extension product for the other
primer of each pair; separating the amplified products; and
analyzing the separated amplified products for a region
characteristic of the beta-lactamase.
[0008] The method, described above, can employ oligonucleotide
primers that are specific for nucleic acid of the TEM family of
beta-lactamases, the K1 beta-lactamases, the PSE family of
beta-lactamases, and the SHV family of beta-lactamases. Additional
primers that can be used include those that are specific for
nucleic acid of the AmpC beta-lactamases found in Enterobacter
cloacae, Citrobacter freundii, Serratia marcescens, Pseudomonas
aeruginosa, and E. coli.
[0009] Still other oligonucleotide primers that are suitable for
use in the method of the present invention include primers that are
specific for nucleic acid of the plasmid-mediated AmpC
beta-lactamases designated as FOX-1, FOX-2, or MOX-1; primers
specific for nucleic acid of the OXA-9 beta-lactamase; primers
specific for nucleic acid of the OXA-12 beta-lactamase; primers
specific for the nucleic acid group of OXA beta-lactamases
representing OXA-5, 6, 7, 10, 11, 13, and 14 beta-lactamases;
primers specific for the OXA-1 beta-lactamases; and primers
specific for nucleic acid of the group of OXA beta-lactamases
representing OXA-2, 3, and 15 beta-lactamases.
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
[0010] The present invention is directed to the detection of
nucleic acid that is characteristic of (e.g., at least a segment of
a gene that codes for) family-specific beta-lactamase nucleic acid
in samples (e.g., clinical isolates of Gram-negative bacteria).
Specifically, the present invention is directed to the detection of
beta-lactamase nucleic acid (preferably, a gene or at least a
segment of a gene) using unique primers and the polymerase chain
reaction. Using the primers and methods of the present invention,
beta-lactamases belonging to Bush groups 1 (AmpC) and 2 (TEM-1,
TEM-2, SHV-1, IRTs, K1), for example, can be identified.
[0011] The primers and methods of the present invention are useful
for a variety of purposes, including, for example, the
identification of the primary beta-lactamase(s) responsible for
resistance to third generation cephalosporins among Gram-negative
bacteria such as Escherichia coli and Klebsiella pneumoniae
(Thomson et al., Antimicrob. Agents Chemother 36(9):1887-1882
(1992)). Other sources of beta-lactamases include, for example, a
wide range of Enterobacteriaceae, including Enterobacter spp.,
Citrobacter freundii, Morganella morganii, Providencia spp., and
Serratia marcescens (Jones, Diag. Microbiol. Infect. Disease
31(3):461-466 (1998)). Additional beta-lactamase gene sources
include Pseudomonas aeruginosa (Patrice et al., Antimicrob. Agents
Chemother 37(5):962-969 (1993)); Proteus mirabilis (Bret et al.,
Antimicrob. Agents Chemother 42(5):1110-1114 (1998)); Yersinia
enterocolitica (Barnaud et al., FEMS Microbiol. Letters
148(1):15-20 (1997)); and Klebsiella oxytoca (Marchese et al.,
Antimicrob. Agents Chemother 42(2):464-467 (1998)).
[0012] The methods of the present invention involve the use of the
polymerase chain reaction sequence amplification method (PCR) using
novel primers. U.S. Pat. No. 4,683,195 (Mullis et al.) describes a
process for amplifying, detecting, and/or cloning nucleic acid.
Preferably, this amplification method relates to the treatment of a
sample containing nucleic acid (typically, DNA) of interest from
bacteria, particularly Gram-negative bacteria, with a molar excess
of an oligonucleotide primer pair, heating the sample containing
the nucleic acid of interest to yield two single-stranded
complementary nucleic acid strands, adding the primer pair to the
sample containing the nucleic acid strands, allowing each primer to
anneal to a particular strand under appropriate temperature
conditions that permit hybridization, providing a molar excess of
nucleotide triphosphates and polymerase to extend each primer to
form a complementary extension product that can be employed in
amplification of a desired nucleic acid, detecting the amplified
nucleic acid, and analyzing the amplified nucleic acid for a size
specific amplicon (as indicated below) characteristic of the
specific beta-lactamase of interest. This process of heating,
annealing, and synthesizing is repeated many times, and with each
cycle the desired nucleic acid increases in abundance. Within in a
short period of time, it is possible to obtain a specific nucleic
acid, e.g., a DNA molecule, that can be readily purified and
identified.
[0013] The oligonucleotide primer pair includes one primer that is
substantially complementary to at least a portion of a sense strand
of the nucleic acid and one primer that is substantially
complementary to at least a portion of an antisense strand of the
nucleic acid. The process of forming extension products preferably
involves simultaneously extending the annealed primers from a 3'
terminus of each primer to synthesize an extension product that is
complementary to the nucleic acid strands annealed to each primer
wherein each extension product after separation from the
beta-lactamase nucleic acid serves as a template for the synthesis
of an extension product for the other primer of each pair. The
amplified products are preferably detected by size fractionization
using gel electrophoresis. Variations of the method are described
in U.S. Pat. No. 4,683,194 (Saiki et al.). The polymerase chain
reaction sequence amplification method is also described by Saiki
et al., Science, 230, 1350-1354 (1985) and Scharf et al., Science,
324, 163-166 (1986).
[0014] An "oligonucleotide," as used herein, refers to a polymeric
form of nucleotides of any length, either ribonucleotides or
deoxyribonucleotides. The term oligonucleotide refers particularly
to the primary structure, and thus includes double and
single-stranded DNA molecules and double and single-stranded RNA
molecules.
[0015] A "primer," as used herein, is an oligonucleotide that is
complementary to at least a portion of nucleic acid of interest
and, after hybridization to the nucleic acid, may serve as a
starting-point for the polymerase chain reaction. The terms
"primer" or "oligonucleotide primer," as used herein, further refer
to a primer, having a nucleotide sequence that possess a high
degree of nucleic acid sequence similarity to at least a portion of
the nucleic acid of interest. "High degree" of sequence similarity
refers to a primer that typically has at least about 80% nucleic
acid sequence similarity, and preferably about 90% nucleic acid
sequence similarity. Sequence similarity may be determined, for
example, using sequence techniques such as GCG FastA (Genetics
Computer Group, Madison, Wis.), MacVector 4.5 (Kodak/IBI software
package) or other suitable sequencing programs or methods known in
the art.
[0016] The terms "complement" and "complementary" as used herein,
refer to a nucleic acid that is capable of hybridizing to a
specified nucleic acid molecule under stringent hybridization
conditions. Stringent hybridization conditions include, for
example, temperatures from about 50.degree. C. to about 65.degree.
C., and magnesium chloride (MgCl.sub.2) concentrations from about
1.5 millimolar (mM) to about 2.0 mM. Thus, a specified DNA molecule
is typically "complementary" to a nucleic acid if hybridization
occurs between the specified DNA molecule and the nucleic acid.
"Complementary," further refers to the capacity of purine and
pyrimidine nucleotides to associate through hydrogen bonding in
double stranded nucleic acid molecules. The following base pairs
are complementary: guanine and cytosine; adenine and thymine; and
adenine and uracil.
[0017] As used herein, the terms "amplified molecule," "amplified
fragment," and "amplicon" refer to a nucleic acid molecule
(typically, DNA) that is a copy of at least a portion of the
nucleic acid and its complementary sequence. The copies correspond
in nucleotide sequence to the original molecule and its
complementary sequence. The amplicon can be detected and analyzed
by a wide variety of methods. These include, for example, gel
electrophoresis, single strand conformational polymorphism (SSCP),
restriction fragment length polymorphism (RFLP), capillary zone
electrophoresis (CZE), and the like. Preferably, the amplicon can
be detected, and hence, the type of beta-lactamase identified,
using gel electrophoresis and appropriately sized markers,
according to techniques known to one of skill in the art.
[0018] The primers are oligonucleotides, either synthetic or
naturally occurring, capable of acting as a point of initiating
synthesis of a product complementary to the region of the DNA
molecule containing the beta-lactamase of interest. The primer
includes nucleotides capable of hybridizing under stringent
conditions to at least a portion of at least one strand of a
nucleic acid molecule of a given beta-lactamase. Preferably, the
primers of the present invention typically have at least about 15
nucleotides. Preferably, the primers have no more than about 35
nucleotides, and more preferably, no more than about 22
nucleotides. The primers are chosen such that they preferably
produce a primed product of about 200-1100 base pairs.
[0019] Optionally, a primer used in accordance with the present
invention includes a label constituent. The label constituent can
be selected from the group of an isotopic label, a fluorescent
label, a polypeptide label, and a dye release compound. The label
constituent is typically incorporated in the primer by including a
nucleotide having the label attached thereto. Isotopic labels
preferably include those compounds that are beta, gamma, or alpha
emitters, more preferably isotopic labels are selected from the
group of .sup.32P, .sup.35S, and .sup.1251. Fluorescent labels are
typically dye compounds that emit visible radiation in passing from
a higher to a lower electronic state, typically in which the time
interval between adsorption and emission of energy is relatively
short, generally on the order of about 10.sup.-8 to about 10.sup.-3
second. Suitable fluorescent compounds that can be utilized include
fluorescien and rhodamine, for example. Suitable polypeptide labels
that can be utilized in accordance with the present invention
include antigens (e.g., biotin, digoxigenin, and the like) and
enzymes (e.g., horse radish peroxidase). A dye release compound
typically includes chemiluminescent systems defined as the emission
of absorbed energy (typically as light) due to a chemical reaction
of the components of the system, including oxyluminescence in which
light is produced by chemical reactions involving oxygen.
[0020] Preferred examples of these primers, that are specific for
certain beta-lactamases, are as follows, wherein "F" in the
designations of the primers refers to a 5' upstream primer and "R"
refers to a 3' downstream primer. For those beta-lactamases that
have more than one upstream primer and more than one downstream
primer listed below as preferred primers, various combinations can
be used. Typically, hybridization conditions utilizing primers of
the invention include, for example, a hybridization temperature of
about 50.degree. C. to about 60.degree. C., and a MgCl.sub.2
concentration of about 1.5 mM (millimolar) to about 2.0 mM.
Although lower temperatures and higher concentrations of
MgCl.sub.2, can be employed, this may result in decreased primer
specificity.
[0021] The following primers are specific for nucleic acid
characteristic of the TEM family of beta-lactamase enzymes.
TABLE-US-00001 Primer Name: TEMprime2R Primer Sequence: (SEQ ID NO:
1) 5'-TGC TTA ATC AGT GAG GCA CC-3' Primer Name: TEMprime1F Primer
Sequence: (SEQ ID NO: 2) 5'-AGA TCA GTT GGG TGC ACG AG-3' Primer
Name: TEMprimeEndR Primer Sequence: (SEQ ID NO: 3) 5'-CTT GGT CTG
ACA GTT ACC-3' Primer Name: TEMprime2F Primer Sequence: (SEQ ID NO:
4) 5'-TGT CGC CCT TAT TCC-3' Primer Name: TEMprime15F Primer
Sequence: (SEQ ID NO: 5) 5'-TCG GGG AAA TGT GCG-3'
[0022] Employing a primer pair containing the primer sequences of
SEQ ID NO:1 and SEQ ID NO:2 to a sample known to contain a TEM
family beta-lactamase, a size-specific amplicon of 750 base pairs
will typically be obtained. Employing a primer pair containing the
primer sequences of SEQ ID NO:3 and SEQ ID NO:5 to a sample known
to contain a TEM family beta-lactamase, a size-specific amplicon of
992 base pairs will typically be obtained.
[0023] The following primers are specific for nucleic acid
characteristic of the SHV family of beta-lactamase enzymes.
TABLE-US-00002 Primer Name: SHVprime3R Primer Sequence: 5'-ATC GTC
CAC CAT CCA CTG CA-3' (SEQ ID NO: 6) Primer Name: SHVprime2F Primer
Sequence: 5'-GGG AAA CGG AAC TGA ATG AG-3' (SEQ ID NO: 7) Primer
Name: SHVprime1R Primer Sequence: 5'-TAG TGG ATC TTT CGC TCC AG-3'
(SEQ ID NO: 8) Primer Name: SHVprime4R Primer Sequence: 5'-GCT CTG
CTT TGT TAT TC-3' (SEQ ID NO: 9) Primer Name: SHVprime1F Primer
Sequence: 5'-CAC TCA AGG ATG TAT TGT G-3' (SEQ ID NO: 10) Primer
Name: SHVprimeEndR Primer Sequence: 5'-TTA GCG TTG CCA GTG CTC G-3'
(SEQ ID NO: 11)
[0024] Employing a primer pair containing the primer sequences of
SEQ ID NO:7 and SEQ ID NO: 11 to a sample known to contain a SHV
family beta-lactamase, a size-specific amplicon of 383 base pairs
will typically be obtained.
[0025] The following primers are specific for nucleic acid
characteristic of the AmpC beta-lactamase enzyme (both chromosomal
and plasmid-mediated) found in Enterobacter cloacae.
TABLE-US-00003 Primer Name: EcloC3R Primer Sequence: (SEQ ID NO:
12) 5'-GGA ACA GAC TGG GCT TTC ATC-3' Primer Name: EcloC4F Primer
Sequence: (SEQ ID NO: 13) 5'-GGA CAT CCC CTT GAC-3' Primer Name:
EcloC2R Primer Sequence: (SEQ ID NO: 14) 5'-GTG GAT TCA CTT CTG CCA
CG-3' Primer Name: EcloC1F Primer Sequence: (SEQ ID NO: 15) 5'-CTT
CTG GCA TGC CCT ATG AG-3' Primer Name: EcloCR Primer Sequence: (SEQ
ID NO: 16) 5'-CAT GAC CCA GTT CGC CAT ATC CTG-3' Primer Name:
EcloCF Primer Sequence: (SEQ ID NO: 17) 5'-ATT CGT ATG CTG GAT CTC
GCC ACC-3' Primer Name: EccKF Primer Sequence: (SEQ ID NO: 44)
5'-CGA ACG AAT CAT TCA GCA CCG-3'' Primer Name: EccKR Primer
Sequence: (SEQ ID NO: 45) 5'-CGG CAA TGT TTT ACT GTA GCG CC-3'
[0026] Employing a primer pair containing the primer sequences of
SEQ ID NO:14 and SEQ ID NO:15 to a sample known to contain an AmpC
beta-lactamase found in Enterobacter cloacae, a size-specific
amplicon of 416 base pairs will typically be obtained. Employing a
primer pair containing the primer sequences of SEQ ID NO:16 and SEQ
ID NO:17 to a sample known to contain an AmpC beta-lactamase found
in Enterobacter cloacae, a size-specific amplicon of 396 base pairs
will typically be obtained. Employing a primer pair containing the
primer sequences of SEQ ID NO:14 and SEQ ID NO:17 to a sample known
to contain an AmpC beta-lactamase found in Enterobacter cloacae, a
size-specific amplicon of 601 base pairs will typically be
obtained. Employing a primer pair containing the primer sequences
of SEQ ID NO:17 and SEQ ID NO: 45 to a sample known to contain an
AmpC beta-lactamase found in Enterobacter cloacae, a size-specific
amplicon of 688 base pairs will typically be obtained. Employing a
primer pair containing the primer sequences of SEQ ID NO: 44 and
SEQ ID NO: 45 to a sample known to contain an AmpC beta-lactamase
found in Enterobacter cloacae, a size-specific amplicon of 1529
base pairs will typically be obtained.
[0027] The following primers are specific for nucleic acid
characteristic of the AmpC beta-lactamase enzyme (both chromosomal
and plasmid-mediated) found in Citrobacter freundii. Although these
primers cross-react with the chromosomal AmpC from E. coli, the
band produced from the E. coli AmpC is much larger. Thus, the
primers can be used to differentially identify Citrobacter from E.
coli.
TABLE-US-00004 Primer Name: CFC1F Primer Sequence: (SEQ ID NO: 18)
5'-CTG GCA ACC ACA ATG GAC TCC G-3' Primer Name: CFC1R Primer
Sequence: (SEQ ID NO: 19) 5'-GCC AGT TCA GCA TCT CCC AGC C-3'
[0028] Employing a primer pair containing the primer sequences of
SEQ ID NO:18 and SEQ ID NO:19 to a sample known to contain an AmpC
beta-lactamase found in Citrobacter freundii, a size-specific
amplicon of 419 base pairs will typically be obtained.
[0029] The following primers are specific for nucleic acid
characteristic of the AmpC beta-lactamase enzyme (both chromosomal
and plasmid-mediated) found in Serratia marcescens.
TABLE-US-00005 Primer Name: SMC1F Primer Sequence: 5'-CGT GAC CAA
CAA CGC CCA GC-3' (SEQ ID NO: 20) Primer Name: SMC1R Primer
Sequence: 5'-CCA GAT AGC GAA TCA GAT CGC-3' (SEQ ID NO: 21)
[0030] Employing a primer pair containing the primer sequences of
SEQ ID NO:20 and SEQ ID NO:21 to a sample known to contain an AmpC
beta-lactamase found in Serratia marcescens, a size-specific
amplicon of 335 base pairs will typically be obtained.
[0031] The following primers are specific for nucleic acid
characteristic of the plasmid-mediated AmpC beta-lactamase enzyme
designated as FOX-1, FOX-2, MOX-1, and others in this family.
TABLE-US-00006 Primer Name: FOX1F Primer Sequence: 5'-CCA GCC GAT
GCT CAA GGA G-3' (SEQ ID NO: 22) Primer Name: FOX1R Primer
Sequence: 5'-CAC GAA CGC CAC ATA GGC G-3' (SEQ ID NO: 23)
[0032] Employing a primer pair containing the primer sequences of
SEQ ID NO:22 and SEQ ID NO:23 to a sample known to contain a
plasmid-mediated AmpC beta-lactamase, such as FOX-1, FOX-2, and
MOX-1, a size-specific amplicon of 937 base pairs will typically be
obtained.
[0033] The following primers are specific for nucleic acid
characteristic of the AmpC beta-lactamase enzyme (chromosomal)
found in Pseudomonas aeruginosa.
TABLE-US-00007 Primer Name: PaerugR Primer Sequence: (SEQ ID NO:
24) 5'-GGC ATT GGG ATA GTT GCG GTT G-3' Primer Name: PaerugF Primer
Sequence: (SEQ ID NO: 25) 5'-TTA CTA CAA GGT CGG CGA CAT GAC
C-3'
[0034] Employing a primer pair containing the primer sequences of
SEQ ID NO:24 and SEQ ID NO:25 to a sample known to contain an AmpC
beta-lactamase found in Pseudomonas aeruginosa, a size-specific
amplicon of 268 base pairs will typically be obtained.
[0035] The following primers are specific for nucleic acid
characteristic of the AmpC beta-lactamase enzyme (both chromosomal
and plasmid-mediated) found in E. coli.
TABLE-US-00008 Primer Name: ECOLI C1F Primer Sequence: (SEQ ID NO:
26) 5'-GGA TCA CAC TAT TAC ATC TCG C-3' Primer Name: ECOLI C1R
Primer Sequence: (SEQ ID NO: 27) 5'-CGT ATG GTT GAG TTT GAG TGG
C-3'
[0036] Employing a primer pair containing the primer sequences of
SEQ ID NO:26 and SEQ ID NO:27 to a sample known to contain an AmpC
beta-lactamase found in E. coli., a size-specific amplicon of 254
base pairs will typically be obtained.
[0037] The following primers are specific for nucleic acid
characteristic of the K1 beta-lactamase enzyme.
TABLE-US-00009 Primer Name: TOHO-1F Primer Sequence: (SEQ ID NO:
28) 5'-GCG ACC TGG TTA ACT ACA ATC CC-3' Primer Name: TOHO-1R
Primer Sequence: (SEQ ID NO: 29) 5'-CGG TAG TAT TGC CC TTA AGC C-3'
Primer Name: MEN-1F Primer Sequence: (SEQ ID NO: 30) 5'-CGG AAA AGC
ACG TCG ATG GG-3' Primer Name: MEN-1R Primer Sequence: (SEQ ID NO:
31) 5'-GCG ATA TCG TTG GTG GTG CC-3'
[0038] Employing a primer pair containing the primer sequences of
SEQ ID NO:28 and SEQ ID NO:29 to a sample known to contain a K1
beta-lactamase, a size-specific amplicon of 351 base pairs will
typically be obtained. Employing a primer pair containing the
primer sequences of SEQ ID NO:30 and SEQ ID NO:31 to a sample known
to contain a K1 beta-lactamase, a size-specific amplicon of 415
base pairs will typically be obtained.
[0039] The following primers are specific for nucleic acid
characteristic of the PSE family of beta-lactamase enzymes.
TABLE-US-00010 Primer Name: PSE 1F Primer Sequence: 5'-CTC GAT GAT
GCG TGC TTC GC-3' (SEQ ID NO: 32) Primer Name: PSE 1R Primer
Sequence: 5'-GCG ACT GTG ATG TAT AAA CG-3' (SEQ ID NO: 33)
[0040] Employing a primer pair containing the primer sequences of
SEQ ID NO:32 and SEQ ID NO:33 to a sample known to contain a PSE1,
PSE4, and/or CARB3 beta-lactamase, a size-specific amplicon of 523
base pairs will typically be obtained. If a PSE2 (OXA10)
beta-lactamase is present in the sample, it is possible that some
cross-reactivity with the primer pair may occur.
[0041] The following primers are specific for nucleic acid
characteristic of the OXA-9 beta-lactamase enzyme.
TABLE-US-00011 Primer Name: OXA 91F Primer Sequence: 5'-CGT CGC TCA
CCA TAT CTC CC-3' (SEQ ID NO: 34) Primer Name: OXA 91R Primer
Sequence: 5'-CCT CTC GTG CTT TAG ACC CG-3' (SEQ ID NO: 35)
[0042] Employing a primer pair containing the primer sequences of
SEQ ID NO:34 and SEQ ID NO:35 to a sample known to contain a OXA-9
beta-lactamase, a size-specific amplicon of 315 base pairs will
typically be obtained.
[0043] The following primers are specific for nucleic acid
characteristic of the OXA-12 beta-lactamase enzyme.
TABLE-US-00012 Primer Name: OXA121F Primer Sequence: 5'-CGC TGG GAA
ACC TAT TCG G-3' (SEQ ID NO: 36) Primer Name: OXA121R Primer
Sequence: 5'-CTG CCA TCC AGT TTC TTC GGG-3' (SEQ ID NO: 37)
[0044] Employing a primer pair containing the primer sequences of
SEQ ID NO:36 and SEQ ID NO:37 to a sample known to contain a OXA-12
beta-lactamase, a size-specific amplicon of 341 base pairs will
typically be obtained.
[0045] The following primers are specific for nucleic acid
characteristic of the OXA-5, 6, 7, 10, 11, 13, and 14
beta-lactamase enzymes.
TABLE-US-00013 Primer Name: OXA 711F1 Primer Sequence: (SEQ ID NO:
38) 5'-GGT GGC ATT GAC AAA TTC TGG-3' Primer Name: OXA 711B2 Primer
Sequence: (SEQ ID NO: 39) 5'-CCC ACC ATG CGA CAC CAG-3'
[0046] Employing a primer pair containing the primer sequences of
SEQ ID NO:38 and SEQ ID NO:39 to a sample known to contain an
OXA-5, 6, 7, 10, 11, 13 or 14 beta-lactamase, a size-specific
amplicon of 226 base pairs will typically be obtained.
[0047] The following primers are specific for nucleic acid
characteristic of the OXA-1 beta-lactamase enzyme.
TABLE-US-00014 Primer Name: OXA 1 F2 Primer Sequence: (SEQ ID NO:
40) 5'-TGT GCA ACG CAA ATG GCA C-3' Primer Name: OXA1B14 Primer
Sequence: (SEQ ID NO: 41) 5'-CGA CCC CAA GTT TCC TGT AAG TG-3'
[0048] Employing a primer pair containing the primer sequences of
SEQ ID NO:40 and SEQ ID NO:41 to a sample known to contain a OXA-1
beta-lactamase, a size-specific amplicon of 579 base pairs will
typically be obtained.
[0049] The following primers are specific for nucleic acid
characteristic of the OXA-2, 3, and 15 beta-lactamase enzymes.
TABLE-US-00015 Primer Name: OXA 23 F1 Primer Sequence: 5'-AGG CAC
GAT AGT TGT GGC AGA C-3' (SEQ ID NO: 42) Primer Name: OXA23B3
Primer Sequence: 5'-CAC TCA ACC CAT CCT ACC CAC C-3' (SEQ ID NO:
43)
[0050] Employing a primer pair containing the primer sequences of
SEQ ID NO:42 and SEQ ID NO:43 to a sample known to contain a OXA-2,
3 or 15 beta-lactamase, a size-specific amplicon of 555 base pairs
will typically be obtained.
[0051] Various other primers, or variations of the primers
described above, can also be prepared and used according to methods
of the present invention. For example, alternative primers can be
designed based on targeted beta-lactamases known or suspected to
contain regions possessing high G/C content (i.e., the percentage
of guanine and cytosine residues). As used herein, a "high G/C
content" in a target nucleic acid, typically includes regions
having a percentage of guanine and cytosine residues of about 60%
to about 90%. Thus, changes in a prepared primer will alter, for
example, the hybridization or annealing temperatures of the primer,
the size of the primer employed, and the sequence of the specific
resistance gene or nucleic acid to be identified. Therefore,
manipulation of the G/C content, e.g., increasing or decreasing, of
a primer or primer pair may be beneficial in increasing detection
sensitivity in the method.
[0052] Additionally, depending on the suspected nucleic acid in the
sample, a primer of the invention can be prepared that varies in
size. Typically, primers of the invention are about 12 nucleotides
to about 50 nucleotides in length, preferably the primers are about
15 nucleotides to about 25 nucleotides in length. Oligonucleotides
of the invention can readily be synthesized by techniques known in
the art (see, for example, Crea et al., Proc. Natl. Acad. Sci.
(U.S.A.) 75:5765 (1978)).
[0053] Once the primers are designed, their specificity can be
tested using the following method. Depending on the target nucleic
acid of clinical interest, a nucleic acid is isolated from a
bacterial control strain known to express or contain the resistance
gene. This control strain, as used herein, refers to a "positive
control" nucleic acid (typically, DNA). Additionally, a "negative
control" nucleic acid (typically, DNA) can be isolated from one or
more bacterial strains known to express a resistance gene other
than the target gene of interest. Using the polymerase chain
reaction, the designed primers are employed in a detection method,
as described above, and used in the positive and negative control
samples and in at least one test sample suspected of containing the
resistance gene of interest. The positive and negative controls
provide an effective and qualitative (or grossly quantitative)
means by which to establish the presence or the absence of the gene
of interest of test clinical samples. It should be recognized that
with a small percentage of primer pairs, possible cross-reactivity
with other Beta-lactamase genes might be observed. However, the
size and/or intensity of any cross-reactive amplified product will
be considerably different and can therefore be readily evaluated
and dismissed as a negative result.
[0054] The invention also relates to kits for identifying a family
specific beta-lactamase enzymes by PCR analysis. Kits of the
invention typically include one or more primer pairs specific for a
beta-lactamase of interest, one or more positive controls, one or
more negative controls, and protocol for identification of the
beta-lactamase of interest using polymerase chain reaction. A
negative control includes a nucleic acid (typically, DNA) molecule
encoding a resistant beta-lactamase other that the beta-lactamase
of interest. The negative control nucleic acid may be a naked
nucleic acid (typically, DNA) molecule or inserted into a bacterial
cell. Preferably, the negative control nucleic acid is double
stranded, however, a single stranded nucleic acid may be employed.
A positive control includes a nucleic acid (typically, DNA) that
encodes a beta-lactamase from the family of beta-lactamases of
interest. The positive control nucleic acid may be a naked nucleic
acid molecule or inserted into a bacterial cell, for example.
Preferably, the positive control nucleic acid is double stranded,
however, a single stranded nucleic acid may be employed. Typically,
the nucleic acid is obtained from a bacterial lysate.
[0055] Accordingly, the present invention provides a kit for
characterizing and identifying a family specific beta-lactamase
that would have general applicability. Preferably, the kit includes
a polymerase (typically, DNA polymerase) enzyme, such as Taq
polymerase, and the like. A kit of the invention also preferably
includes at least one primer pair that is specific for a
beta-lactamase. A buffer system compatible with the polymerase
enzyme is also included and are well known in the art. Optionally,
the at least one primer pair may contain a label constituent, a
fluorescent label, a polypeptide label, and a dye release compound.
The kit may further contain at least one internal sample control,
in addition to one or more further means required for PCR analysis,
such as a reaction vessel. If required, a nucleic acid from the
bacterial sample can be isolated and then subjected to PCR analysis
using the provided primer set of the invention.
[0056] In another embodiment, family specific beta-lactamase
enzymes in clinical samples, particularly clinical samples
containing Gram-negative bacteria, can be detected by the primers
described herein in a "microchip" detection method. In a microchip
detection method, nucleic acid, e.g., genes, of multiple
beta-lactamases in clinical samples can be detected with a minimal
requirement for human intervention. Techniques borrowed from the
microelectronics industry are particularly suitable to these ends.
For example, micromachining and photolithographic procedures are
capable of producing multiple parallel microscopic scale components
on a single chip substrate. Materials can be mass produced and
reproducibility is exceptional. The microscopic sizes minimize
material requirements. Thus, human manipulations can be minimized
by designing a microchip type surface capable of immobilizing a
plurality of primers of the invention on the microchip surface.
[0057] Thus, an object of the present invention is to provide a
parallel screening method wherein multiple serial reactions are
automatically performed individually within one reaction well for
each of the plurality of nucleic acid strands to be detected in the
plural parallel sample wells. These serial reactions are performed
in a simultaneous run within each of the multiple parallel lanes of
the device. "Parallel" as used herein means wells identical in
function. "Simultaneous" means within one preprogrammed run. The
multiple reactions automatically performed within the same
apparatus minimize sample manipulation and labor.
[0058] Thus, the present invention provides multiple reaction
wells, the reaction wells being reaction chambers, on a microchip,
each reaction well containing an individualized array to be used
for detecting a beta-lactamase gene uniquely specified by the
substrates provided, the reaction conditions and the sequence of
reactions in that well. The chip can thus be used as a method for
identifying beta-lactamase genes in clinical samples.
[0059] Objects and advantages of this invention are further
illustrated by the following examples, but the particular materials
and amounts thereof recited in these examples, as well as other
conditions and details, should not be construed to unduly limit
this invention.
Example 1
Klebsiella Pneumoniae with ESBLs and a Plasmid-Mediated AmpC
Beta-Lactamase
Materials and Methods
Klebsiella Pneumoniae 225
[0060] Klebsiella pneumoniae 225 was isolated from a 43-year-old
white male patient who was working in a New York City sewage canal
on 26 Apr. 1996. While in a pit containing a layer of sewage, a
screen fell, knocking the patient down in the sewage. The patient
struck his left forehead, sustaining a severe laceration
approximately 20 centimeters (cm) long and down to the skull and
was unconscious for approximately five minutes. The patient was
taken to a local hospital where the wound was surgically debrided,
irrigated, and closed. Intravenous cefazolin and gentamicin were
administered pre-operatively, and cefazolin was continued 24 hours
post-operatively. The patient was discharged and returned to Omaha,
Nebr., four days later.
[0061] On 2 May 1996, the patient was seen by an Omaha surgeon who
diagnosed wound infection, ordered culture of the wound drainage,
and initiated therapy with cephalexin and penicillin. The culture
yielded growth of K. pneumoniae, Aeromonas hydrophila and Proteus
penneri. By 24 May 1996, the patient was experiencing significant
swelling and pain in the left scalp area, significant weakness and
dizziness, and a low grade fever. An infectious disease consult was
ordered, and the patient was hospitalized for further evaluation
and management.
[0062] Laboratory findings included a white blood cell count of
21,000 per cubic millimeter (cmm). Aspiration of a bulging left
temporal mass from the patient yielded 7 milliliter (ml) of
purulent fluid from which K. pneumoniae and A. hydrophila were
cultured.
[0063] The patient was empirically treated with
piperacillin/tazobactam and ciprofloxacin. On 25 May 1996, the
patient had incision drainage and debridement of the wound.
Operative findings as well as preoperative CT scan of the patient's
head did not reveal osteomyelitis. There was an abscess commencing
in the region of the left zygoma and extending superior to the
parietal region, with two small opaque foreign bodies in the caudal
aspect of the collection. On 27 May 1996, following antibiotic
susceptibility results, therapy was changed to imipenem/cilastatin.
The drain was removed and the patient was discharged on 29 May
1996, and treated at home with intravenous imipenem/cilastatin via
a peripheral inserted central catheter. After four weeks of therapy
all signs of inflammation resolved. The patient remained free from
infection at follow-up on 10 Dec. 1996.
Susceptibility Tests
[0064] Susceptibility tests were performed by microdilution
methodology using the MicroScan Walkaway system (Dade MicroScan
Inc., Sacramento, Calif.) and by NCCLS microdilution methodology in
Mueller-Hinton broth (CM 405, Oxoid, Basingstoke, England) using an
inoculum of approximately 5.times.10.sup.5 CFU/ml (National
Committee for Clinical Laboratory Standards, 1997, Approved
Standard M7-A4) and also by NCCLS disk diffusion methodology
(National Committee for Clinical Laboratory Standards, 1997,
Approved Standard M2-A6).
Clavulanate Double-Disk Potentiation Test
[0065] Using the procedure of Brun-Buisson et al., Lancet., ii,
302-306 (1987), a Mueller-Hinton agar plate (CM 337, Oxoid,
Basingstoke, England) was inoculated with K. pneumoniae 255 as for
a standard disk diffusion test. Disks (BBL, Cockeysville, Md.)
containing aztreonam, cefotaxime, ceftriaxone, and ceftazidime were
strategically placed around an amoxicillin-clavulanate disk prior
to incubation at 35.degree. C. ESBL production was inferred by the
presence of characteristic distortions of the inhibition zone
indicative of clavulanate potentiation of the test drug.
Three-Dimensional Test
[0066] Using a modification of the procedure of Thomson and
Sanders, Antimicrob. Agents Chemother., 36:1877-1882 (1992), the
surface of a Mueller-Hinton agar plate was inoculated with E. coli
ATCC 25922 as for a standard disk diffusion test. A slit made in
the agar with a sterile no. 11 scalpel blade was then inoculated
with a heavy suspension of cells of K. pneumoniae 225 that had been
grown to logarithmic phase in 10 ml tryptone soy broth (CM 129,
Oxoid), centrifuged, and resuspended in 100 microliter (.mu.l) TRIS
EDTA buffer (T-9285 Sigma Chemical Co., St. Louis, Mo.) for 40
minutes. Disks containing aztreonam, cefotaxime, ceftriaxone,
ceftazidime and cefoxitin were placed on the agar 3 millimeters
(mm) away from the inoculated slit, and the plate was incubated in
the usual manner.
[0067] Enzymatic inactivation of the antibiotics was inferred if
the margin of the inhibition zone was distorted in the vicinity of
the slit in a manner that indicated loss of drug activity
(hydrolysis) as the drug diffused through the inoculated slit.
Isoelectric Focusing, Cefotaxime Hydrolysis, and Inhibitor
Determinations
[0068] Using a modification of the methods of Sanders et al.,
Antimicrob. Agents Chemother., 30:951-952 (1986), Bauernfeind et
al., Infection, 18; 294-298 (1990), and Thomson et al., Antimicrob.
Agents Chemother., 35; 1001-1003 (1991), sonic extracts of K.
pneumoniae 225 and strains of E. coli that produced reference
beta-lactamases, were characterized by determining the isoelectric
focusing point (pI) of each beta-lactamase, inhibitor profile in
the presence and absence of 1,000 micromolar (.mu.M) clavulanate
and 1,000 .mu.M cloxacillin, and ability to hydrolyze 0.75 .mu.g/ml
cefotaxime solution.
Plasmid Isolations
[0069] Plasmid DNA isolated using alkaline lysis (Manniatis et al.,
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, N.Y.,
1982) was performed with the following modifications. Cell pellets
were washed twice with 3% TRITON-X 100 dissolved in Tris-ethylene
diaminetetraacetate (Tris-EDTA) (pH 8). After neutralization,
supernatant was extracted with phenol plus 1/10 volume 10% sodium
dodecyl sulfate (SDS) followed by one extraction using
phenol:chloroform:isoamyl alcohol (25:24:1) followed by one or more
chloroform:isoamyl (24:1) extractions until supernatant was clear.
When designated, some samples were treated with plasmid-safe DNase
(Epicentre Technologies, Madison, Wis.) as described by the
manufacturer. Plasmid DNA was electrophoresed on the day of
preparation to decrease the possibility of DNA damage (nicking)
during storage. Plasmids were separated by agarose (0.8%) gel
electrophoresis using 1.times. Tris-acetate-EDTA (TAE) as the
buffer system.
[0070] In some cases, plasmids were visualized without previous
isolation by lysing the bacterial cells within the well of the
agarose gel. One colony of Klebsiella pneumoniae 225 was suspended
into 5 .mu.l of protoplasting buffer (30 mM Tris-HCl (pH 8), 5 mM
EDTA, 50 mM NaCl, 20% weight by volume (w/v) sucrose, 50 .mu.g/ml
RNase A and 50 .mu.g/ml lysozyme; the RNase A and lysozyme added
just prior to use) and incubated 30 minutes at 37.degree. C. Into
each well of the agarose gel, 2 .mu.A of room temperature lysis
buffer (89 mM Tris (pH 8.3), 89 mM boric acid, 25 mM EDTA, 2% w/v
SDS, 5% w/v sucrose and 0.04% Bramaphenol blue) was loaded just
prior to the addition of protoplast suspension. The protoplast
suspension was loaded and the gel was run for 15 minutes at 30
volts to lyse the protoplasts. After 15 minutes the voltage was
increased to 120 volts and the gel was run for 1-1.5 hours. Before
staining in ethidium bromide (0.5 .mu.g/ml), the gel was washed in
large volumes of water with at least two changes to remove the SDS.
The plasmid bands were visualized with a UV transilluminator. The
gel consisted of 4.8% agarose, 1.times. Tris-borate-EDTA (TBE) (89
mM Tris, 89 mM boric acid, and 2.5 mM EDTA) (pH 8.3) and 10% SDS.
The running buffer was 1.times.TBE plus 10% SDS.
Southern Analysis
[0071] Plasmid DNA was prepared by alkaline lysis separated as
described above. To achieve high resolution separation, gels were
electrophoresed for 17-18 hours at 35 volts. DNA was transferred
using 0.4 M NaOH to Zeta-Probe blotting membranes using a vacuum
blotter (Bio-RAD) as described by the manufacturer. TEM specific
probes (5'-TGCTTAATCAGTGAGGCACC-3' (SEQ ID NO:1) nucleotides
1062-1042; numbering of Sutcliff, Proc. Nat. Aca. Sci. USA,
75:3737-3741 (1978)) and SHV (5'-TTAGCGTTGCCAGTGCTCG-3' (SEQ ID
NO:11 nucleotides 988-970; numbering of Mercier et al., Antimicrob.
Agents Chemother., 34:1577-1583 (1990)) were labeled using the
Genius System Oligonucleotide 3'-End labeling kit (Boehringer
Mannheim, Indianapolis, Ind.). Prehybridization and hybridization
followed the recommendation of the manufacturer using 1% SDS at
37.degree. C. Initially, blots were washed with 5.times.SSC (twice
at room temperature for 5 minutes and twice at room temperature for
30 minutes followed by washings using tetramethylammonium chloride
(TMAC); once at 37.degree. C. for 15 minutes and twice at
48.degree. C. for 20 minutes. Labeled probe hybridized to plasmid
DNA was detected using the Genius Luminescent detection kit
(Boehringer Mannheim) as described by manufacturer.
Polymerase Chain Reaction (PCR)
[0072] Template was prepared as below in Example 3. Primers used
for amplification are listed in Table 1.
TABLE-US-00016 TABLE 1 PCR Primers Beta- lactamase Gene Sequence
(nucleotide, nt) TEM.sup.1 (Forward) 5'-AGATCAGTTGGGTGCACGAG-3' (nt
313-332) (SEQ ID NO: 2) (Reverse) 5'-TGCTTAATCAGTGAGGCACC-3' (nt
1061-1042) (SEQ ID NO: 1) SHV.sup.2 (Forward)
5'-GGGAAACGGAACTGAATGAG-3' (nt 606-625) (SEQ ID NO: 7) (Reverse)
5'-ATCGTCCACCATCCACTGCA-3' (nt 757-738) (SEQ ID NO: 6) OXA-9.sup.3
(Forward) 5'-CGTCGCTCACCATATCTCCC-3' (nt 2783-2802) (SEQ ID NO: 34)
(Reverse) 5'-CCTCTCGTGCTTTAGACCCG-3' (nt 3097-3078) (SEQ ID NO: 35)
Entero- (Forward) 5'-ATTCGTATGCTGGATCTCGCCACC-3' bacter (nt
413-436) (SEQ ID NO: 17) AmpC.sup.4 (Reverse)
5'-CATGACCCAGTTCGCCATATCCTG-3' (nt 808-785) (SEQ ID NO: 16)
.sup.1Sequence Reference = Sutcliffe et al., Proc.Nat.Aca.Sci.USA,
75, 3737-3741 (1978). .sup.2Sequence Reference = Mercier et al.,
Antimicrob.Agents Chemother., 34, 1577-1583 (1990). .sup.3Sequence
Reference = Tolmasky et al., Plasmid, 24, 218-226 (1990).
.sup.4Sequence Reference = Gallcni et al., Biochem.J., 250, 753-760
(1988).
[0073] PCR amplifications were carried out as described below in
Example 3 with the following modifications. The composition of the
reaction mixture was 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM
MgCl.sub.2, 0.2 mM (each) of the four deoxynucleoside
triphosphates, and 1.2 U of Taq polymerase (GIBCO, Gaithersburg,
Md.) in a total volume of 48 .mu.l. A total of 2 .mu.l of sample
lysate containing the DNA template was added to the reaction
mixture. The PCR parameters consisted of initial denaturation step
at 95.degree. C. for 5 minutes followed by 24 amplification cycles
consisting of a denaturation step of 96.degree. C. for 15 seconds;
primer annealing at 55.degree. C. for 15 seconds and extension at
72.degree. C. for 2 minutes. Amplified product was detected by
agarose (2%) gel electrophoresis using a 1.times. TAE buffering
system. Some of the PCR products were sequenced by automated PCR
cycle-sequencing with dye-terminator chemistry using a DNA stretch
sequencer from Applied Biosystems (Foster City, Calif.).
Restriction Fragment Length Polymorphism (RFLP)
[0074] SHV-specific PCR products (1/5 volume) were used directly in
a restriction endonuclease assay (Nyesch-Inderbinen et al., Eur. J.
Clin. Microbiol. Infect. Dis., 15:398-402 (1996)) using the
restriction endonuclease, NheI (New England Biolabs, Beverly,
Mass.). Enzyme reactions were carried out as directed by the
manufacturer. To ensure that each sample received the same amount
of enzyme, an enzyme mix containing the buffer system and enzyme
was aliquoted to each sample. Samples were resolved using 2%
agarose and a 1.times. TAE buffer system.
Transformation and Conjugation
[0075] Transformations were done using a modified Hanahan method
(TSS) described by CLONTECH(CLONTECH Laboratories, Inc., Palo Alto,
Calif., Transformer site. Directed Mutagenesis Kit-2nd version).
Plasmids were separated as described above, excised from the gel,
and electroeluted from the gel slice. The DNA was transformed into
E. coli HB101.
[0076] Conjugation experiments were carried out by filter mating
using E. coli, strain C600, as the recipient. Transconjugants were
selected on Luria-Bertani agar plates containing 30 .mu.g/ml of
naladixic acid. An endol test was performed on the transconjugant
(E. coli C600) to further differentiate it from the donor (K.
pneumoniae 225).
Results
Susceptibility Tests
[0077] The results of the microdilution tests performed with K.
pneumoniae 225 using the NCCLS microdilution methodology were as
follows: [0078] MIC>64 .mu.g/ml: ticarcillin,
ticarcillin/clavulanate, piperacillin, piperacillin/tazobactam,
ceftazidime, cefixime, loracarbef, cephalothin, cefazolin,
cefoxitin, aztreonam, ampicillin/sulbactam [0079] MIC 64 .mu.g/ml:
amoxicillin/clavulanate, cefpodoxime [0080] MIC 16 .mu.g/ml:
ceftriaxone, cefotaxime [0081] MIC 1 .mu.g/ml: imipenem, cefepime
[0082] MIC 0.5 .mu.g/ml: ciprofloxacin [0083] MIC 0.06 .mu.g/ml:
meropenem Other susceptibility results obtained in MicroScan tests
were (MicroScan MICs shown in parentheses): [0084] Resistant:
cefuroxime (>16 .mu.g/ml), gentamicin (>8 .mu.g/ml),
tobramycin (>8 .mu.g/ml), amikacin (>32 .mu.g/ml),
trimethoprim/sulfamethoxazole (>2/38), tetracycline (>8
.mu.g/ml), nitrofurantoin (>64 .mu.g/ml), chloramphenicol
(>16 .mu.g/ml) [0085] Susceptible: ofloxacin and levofloxacin
(both 2 .mu.g/ml), cefotetan (16 .mu.g/ml) Discrepancies between
MicroScan and conventional NCCLS results were obtained with
ciprofloxacin (0.5 .mu.g/ml in conventional microdilution test,
susceptible by disk test, 2 .mu.g/ml in MicroScan test) and
cefotetan (resistant in disk test with 12 mm zone diameter,
susceptible by MicroScan, 16 .mu.g/ml).
[0086] The susceptibility results for the Aeromonas hydrophila
isolate were not considered unusual and are not reported.
Double Disk and Three Dimensional Tests
[0087] The clavulanate double-disk potentiation test was positive
with each of the antibiotics tested, indicating that K. pneumoniae
possessed one or more clavulanate-sensitive beta-lactamases capable
of hydrolyzing aztreonam, cefotaxime, ceftriaxone, and ceftazidime.
This result was consistent with beta-lactamase activity of Bush
group 2be or, possibly, high level activity of Bush group 2b.
[0088] The three dimensional test was positive for each of the
antibiotics tested, aztreonam, cefotaxime, ceftriaxone,
ceftazidime, and cefoxitin, indicating .beta.-lactamase-mediated
hydrolysis of each drug. The positive result with cefoxitin was
notable, being consistent with production of a Bush group 1
beta-lactamase.
Isoelectric Focusing-Based Tests
[0089] Isoelectric focusing yielded five beta-lactamase bands with
pI values of 5.4, 6.8, 7.6, 8.2, and .sup.39.0, values consistent
with TEM-1 (pI 5.4), PSE-3, OXA-9 or unknown enzyme (pI 6.8),
SHV-1, SHV-2, or SHV-8 (pI 7.6), SHV-5 (pI 8.2) and AmpC (pI
.sup.39.0) (Table 2, below). Only the pI .sup.39.0 enzyme was
resistant to clavulanate, confirming that this was a Bush group 1
(AmpC) beta-lactamase. The beta-lactamase bands which hydrolyzed
cefotaxime, as detected by microbiological assay, were pI 7.6, pI
8.2, and pI .sup.39.0. These results suggested the presence of
clavulanate-sensitive ESBLs of pI values 7.6 and 8.2, and added
support to the identification of an AmpC enzyme with a pI value
.sup.39.0. These results are supported and/or confirmed by PCR (see
below).
TABLE-US-00017 TABLE 2 Isoelectric Focusing pI Ca Sensitive Ctx
Hydrolyzed Possible Enzyme 5.4 S - TEM-1 6.8 S - OXA-9 7.6 S +
SHV-1, SHV-2 8.2 S +/- SHV-5 ~9.3 R + AmpC Ca = clavulanate (1000
.mu.m) Ctx = cefotasime (0.75 .mu.g/ml)
Polymerase Chain Reaction (PCR)
[0090] PCR analysis was used initially to confirm and/or identify
the beta-lactamases observed during isoelectric focusing (Table 2,
above). Primer sets specific for the TEM or SHV gene families,
Enterobacter AmpC, OXA-9 and integron sequences were used in a PCR
(Table 1, above). PCR identified the presence of TEM and SHV-like
genes, an Enterobacter AmpC-like gene, the OXA-9 gene and integron
sequences (data not shown).
Plasmids
[0091] Multiple plasmid isolations from K. pneumoniae 225 revealed
the organism carried only two plasmids. Using a supercoiled DNA
ladder, the estimated sizes of these plasmids were approximately 17
kb and approximately 90 kb. Three different isolation procedures
were used to extract plasmid DNA; alkaline lysis (Manniatis et al.,
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, N.Y.,
1982), lysozymes/SDS (Crosa et al., "Plasmids" In Gerhardt et al.,
Manual of Methods for General Bacteriology, American Society for
Microbiology, Washington, D.C., pages 266-282, 1981), and cell
lysis and extraction within the well of the gel. All procedures
yielded the same two plasmids indicating that plasmids were not
being lost during any one type of isolation procedure. Alkaline
lysis yielded the purest preparation of plasmid DNA and was
therefore used for southern blot analysis. It was possible that
residual chromosomal DNA comigrated and therefore masked a possible
plasmid. To address this, an enzyme, plasmid-safe DNase (Epicentre
Technologies, Madison, Wis.), which does not cleave supercoiled
DNA, was used to treat the DNA plasmid preparations before
electrophoresis. Treatment with plasmid-safe DNase degraded the
chromosomal DNA band while having no effect on the 17 kb and 90 kb
plasmids, indicating no other plasmids were present in K.
pneumoniae 225 (data not shown).
Southern Analysis
[0092] It was surprising that an organism expressing 5 and possibly
6 beta-lactamases would have only two extrachromosomal pieces of
DNA. Therefore, whether beta-lactamase genes were encoded on one or
both plasmids was evaluated. Southern analysis revealed that both
the 90 kb and 17 kb plasmid encoded TEM-like genes, however, only
the 90 kb plasmid encoded the SHV-like genes (data not shown).
Transformation and Conjugation
[0093] It was possible that the plasmid-mediated AmpC gene encoded
by K. pneumoniae 225 cross-hybridized with the TEM-specific probe
and that one or both plasmids encoded the AmpC enzyme observed
during isoelectric focusing. In an attempt to isolate each plasmid
from the other, transformation experiments were carried out. Each
plasmid was extracted and gel purified. The approximately 17 kb
plasmid was transformed into E. coli HB101, and selected using
ampicillin. After confirming that only a 17 kb plasmid was present
in the HB101 transformants, a disk diffusion assay was performed
(Table 3).
TABLE-US-00018 TABLE 3 Disk Diffusion Assay Zone Size (mm) Drug
Kleb 225 Tr (17 kb) Tc Chloramphenical 8 (R) 22 (S) 12 (R)
Gentomicin 8 (R) 25 (S) 8 (R) Cefotetan 12 (R) 30 (S) 11 (R)
Ceftriaxone 13 (R) 32 (S) 12 (R) Cefotaxime 15 (I) 34 (S) 12 (R)
Ceftazidime 8 (R) 33 (S) 7 (R) Pippercillin/Tazpbactam 15 (R) 30
(S) 14 (R) Trimethoprim/ 6 (R) 31 (S) 8 (R) Sulfamethoxazole
Cefoxitin 6 (R) 25 (S) 7 (R) Aztreonam 8 (R) 33 (S) 7 (R)
Ciprofloxacin 22 (S) 31 (S) 31 (S) Imipenem 22 (S) 33 (S) 23 (S)
Amikacin -- 12 (R) -- Ampicillin -- 7 (R) -- Tr = transformant Tc =
transconjugate
[0094] The transformant did not exhibit diminished susceptibility
to any of the drugs in Table 3 except ampicillin and amikacin,
indicating that the 17 kb plasmid did not encode AmpC or extended
spectrum beta-lactamase genes. Several attempts to transform the
large plasmid into E. coli, (strains HB101 and MV1190) failed.
Transformation using the 90 kb plasmid produced transformants that
were resistant only to ampicillin. When plasmid DNA was isolated
from these transformants many sized plasmids, all less than 90 kb,
were present (data not shown).
[0095] The data obtained from the transformation of the 17 kb
plasmid suggested that the plasmid-mediated AmpC gene was encoded
on the 90 kb plasmid. Therefore, conjugation experiments were
performed. Conjugation between K. pneumoniae 225 and E. coli C600
resulted in the transfer of both the 90 kb and 17 kb plasmids.
Cefoxitin resistance of the transconjugant indicated transfer of
the AmpC gene (Table 3). Taken together, these data strongly
suggest that the AmpC gene is located on the 90 kb plasmid.
Restriction Fragment Length Polymorphism (RFLP)
[0096] Some ESBL-SHV enzymes with a pI of 7.6 (SHV-2, SHV-7)
contain a glycine to serine amino acid substitution at position
238. In the structural SHV-gene the nucleotide mutation resulting
in the amino acid substitution creates a new endonuclease
restriction site, NheI. This restriction site is not present in the
structural gene of SHV-1, SHV-6, SHV-8, or SHV-11, but these
enzymes also have a pI of 7.6. Therefore, RFLP analysis using NheI
can help distinguish between these two groups of enzymes
(NYesch-Inderbinen et al., Eur. J. Clin. Microbiol. Infect. Dis.,
39:185-191 (1996)). Isoelectric focusing data suggested that the
identity of the pI 7.6 beta-lactamase could be SHV-2, SHV-6, SHV-8
or a hyperproducer of SHV-1. To help distinguish between SHV-2 and
SHV-6, SHV-8 or a hyperproducer of SHV-1, RFLP analysis on
SHV-specific PCR products from K. pneumoniae 225 were performed
using NheI. The presence of the NheI site in the SHV-specific PCR
product will result in 2 bands: 219 bp and 164 bp. The absence of
the NheI site will result in no cleavage and a full length
fragment: 383 bp. SHV-specific PCR products amplified from template
prepared from K. pneumoniae 225 show both full length and cleaved
products. These data suggest that SHV-1, SHV-6, or SHV-8 as well as
an SHV ESBL is encoded by K. pneumoniae 225 DNA.
Example 2
Beta-Lactamases Responsible for Resistance to Expanded-Spectrum
Cephalosporins Among Klebsiella pneumoniae, Escherichia Coli and
Proteus Mirabilis Isolates Recovered in South Africa
Materials and Methods
Bacterial Strains
[0097] During a period of three months in 1993, 37 strains of
Klebsiella pneumoniae (13 blood, 5 burn, 7 wound, 11 tracheal
isolates), 4 strains of Proteus mirabilis (all wound isolates) and
4 strains of Escherichia coli (1 blood, 1 burn, 2 wound isolates)
were collected from patients at the following medical centers in
South Africa Tygerberg Hospital near Cape Town, King Edward VIII
Hospital in Durban, Chris Hani Baragwanath Hospital in Soweto and
Pretoria Academic Hospital in Pretoria. The strains were provided
in response to a request for all strains of Enterobacteriaceae,
lacking inducible beta-lactamases, that were intermediate or
resistant to cefotaxime or ceftazidime. The total number of strains
screened is unknown, and at this time the referring hospitals did
not perform more sensitive screening tests for ESBL detection.
Therefore accurate prevalence data were not obtained.
[0098] Thirty-four of the 43 patients involved (including all from
whom blood isolates were obtained) had received a third generation
cephalosporin during the four weeks prior to isolation of the above
organisms. Fifteen patients (including 8 blood isolate patients)
were receiving either cefotaxime or ceftazidime at the time the
isolates were cultured and were considered not to be responding to
these agents.
Susceptibility Testing and Antibiotics
[0099] Antibiotic susceptibility was determined by standard disk
diffusion (NCCLS Standard M2-T4, 1994) and agar dilution (NCCLS
Standard M7-T2, 1994) procedures. Standard powders of antimicrobial
agents were kindly provided by the following companies:
piperacillin and tazobactam (Lederle Laboratories, Wayne, N.J.);
cefoxitin and imipenem, (Merck, Rathway, N.J.); cefotaxime,
(Hoechst-Roussel Pharmaceuticals Inc., Somerville, N.J.);
ceftazidime, (Glaxo Group Research Ltd., Greenford, England);
aztreonam and cefepime, (Bristol-Myers Squibb, Princeton, N.J.).
Disks for agar diffusion were obtained from Becton Dickinson
Microbiology Systems (Cockeysville, Md.). For quality control
purposes, the following quality control strains were run
simultaneously with the test organisms E. coli ATCC 25922,
Pseudomonas aeruginosa ATCC 27853, E. coli ATCC 35218, and
Staphylococcus aureus ATCC 29213. Throughout this study, results
were interpreted using NCCLS criteria for disk diffusion (NCCLS
Standard M2-T4, 1994) and broth dilution (NCCLS Standard M7-T2,
1994).
Double-Disk Test
[0100] All the strains were screened for the production of
extended-spectrum beta-lactamases by using the double-disk test as
described by Jarlier et al., Rev. Infect. Dis., 10:867-878 (1988).
A potentiation of the zones of cefotaxime, ceftriaxone, ceftazidime
or aztreonam by clavulanic acid represented a positive test and was
indicative of possible presence of an extended-spectrum
beta-lactamase.
Beta-Lactamase Characterization
[0101] Overnight cultures in 5 ml trypticase soy broth were diluted
with 45 ml fresh broth and incubated with shaking for 4 hours at
37.degree. C. Cells were harvested by centrifugation at 4.degree.
C., washed with 1 M potassium-phosphate buffer (pH 7.0), suspended
and sonicated. After sonication, crude extracts were obtained by
centrifugation at 5,858.times.g for 1 hour. One strain, K.
pneumoniae Pit 68, with a suspected AmpC beta-lactamase, was
induced with cefoxitin as described below in Example 3. The rate of
hydrolysis of 100 .mu.M solutions of nitrocephin, cephalothin,
cefotaxime, ceftazidime and aztreonam was performed by
spectrophotometric assays on crude beta-lactamase extracts
(Palzkill et al., Antimicrob. Agents Chemother., 36:1991-1996
(1992)).
[0102] The beta-lactamases in the sonic extracts were assessed for
isoelectric points (pIs), general substrate and inhibitor
characteristics in polyacrylamide gels. As controls, crude
beta-lactamase preparations from the following organisms possessing
different TEM and SHV enzymes were examined simultaneously with the
K. pneumoniae, E. coli and P. mirabilis strains: TEM-1 [from E.
coli RTEM (R6K)], TEM-2 [from E. coli 1752E (RP1)], TEM-10 [from E.
coli C600. (pK2)], TEM-26 [from E. coli HB101 (pJPQ101), SHV-1
[from E. coli J53 (R1010)], SHV-2 [from Klebsiella ozaenae 2180],
SHV-3 [from E. coli J53 (pUD18)], SHV-4 [from E. coli J53-2
(pUD21)] and SHV-5 [from E. coli ClaNal (pAFF2)].
DNA Amplification Using Polymerase Chain Reaction (PCR)
[0103] The organisms were inoculated into 5 ml of Luria Bertani
(LB) broth (Difco, Detroit, Mich.) and incubated for 20 hours at
37.degree. C. with shaking. Cells from 1.5 ml of overnight culture
were harvested by centrifugation at 17,310.times.g in an Hermle
centrifuge for 5 minutes. After the supernatant was decanted, the
pellet was resuspended in 500 .mu.l of distilled water. The cells
were lysed by heating at 95.degree. C. for 10 minutes and cellular
debris was removed by centrifugation for 5 minutes at
17,310.times.g. The supernatant was used as source of template for
amplification.
[0104] The following oligonucleotide primers specific for the SHV
and TEM genes were designed by using MacVector version 4.5
(Kodak/IBI): SHV genes: A [5'-(CACTCAAGGATGTATTGTG)-3'] (SEQ ID
NO:10) and B [5'-(TTAGCGTTGCCAGTGCTCG)-3'] (SEQ ID NO:11)
corresponding to nucleotide numbers 103 to 121 and 988 to 970,
respectively, of Mercier et al., Antibicrob. Agents Chemother.
34:1577-1583 (1990)); TEM genes: C [5'-(TCGGGGAAATGTGCGCG)-3' (SEQ
ID NO:5) and D [5'-(TGCTTAATCAGTGAGGCACC)-3' (SEQ ID NO:1)
corresponding to nucleotide numbers 90 to 105 and 1062 to 1042,
respectively, of Sutcliff et al., Proc. Nat. Aca. Sci., USA,
75:3737-3741 (1978). Primers A and B amplified a 885 base pair
fragment while primers C and D amplified a 971 base pair fragment.
The specificity of the SHV and TEM primers for amplification of SHV
and TEM genes respectively was tested by using the following
beta-lactamase controls; TEM-1 (pACYC177), MIR-1 (from K.
pneumoniae 96D) and SHV-7 (pCLL3410).
[0105] PCR amplifications were carried out on a DNA Thermal Cycler
480 instrument (Perkin-Elmer, Cetus, Norwalk, Conn.) using the Gene
Amp DNA amplification kit containing AmpliTaq polymerase (Perkin
Elmer, Roche Molecular Systems, Inc., Branchburg, N.J.). The
composition of the reaction mixture was as follows: 10 mM Tris-HCl
(pH 8.3), 50 mM KCl, 0.1% TRITON X-100, 1.5 mM MgCl.sub.2, 0.2 mM
(each) of the four deoxynucleoside triphosphates, and 1.2 U of
AmpliTaq in a total volume of 49 .mu.l. A total of 1 .mu.l of
sample lysate was added to the reaction mixture, and was
centrifuged briefly before 50 .mu.l of mineral oil was layered on
the surface. The PCR program consisted of an initial denaturation
step at 96.degree. C. for 15 seconds; followed by 24 cycles of DNA
denaturation at 96.degree. C. for 15 seconds, primer annealing at
50.degree. C. for 15 seconds and primer extension at 72.degree. C.
for 2 minutes. After the last cycle the products were stored at
4.degree. C. The PCR products ( 1/10 volume) were analyzed by
electrophoresis using 1.4% agarose gels in TAE buffer (0.04 M
Tris-acetate, 0.002 M EDTA [pH 8.5]). The gels were stained with
ethidium bromide and the PCR products were visualized with
ultra-violet light. A single band was observed for TEM amplified
products using a single primer set. Two amplified products were
observed with the SHV primer set. The larger product which
corresponded to the expected size of the SHV specific product was
gel purified using a 1.4% agarose in TAE gel and the purified PCR
product was used for sequence analysis.
[0106] PCR products were sequenced by automated PCR
cycle-sequencing with dye-terminator chemistry using a DNA stretch
sequencer from Applied Biosystems.
Results
Resistance Phenotypes
[0107] All the strains except K. pneumoniae Pit 68, gave a positive
disk potentiation when using cefotaxime, ceftriaxone, aztreonam
and/or ceftazidime disks. Minimum inhibitory concentrations of
piperacillin, piperacillin/tazobactam, cefotaxime, ceftazidime,
aztreonam and cefoxitin revealed 3 different resistance phenotypes
(Kpn1, 2 and 3) in the K. pneumoniae strains, and 2 (Ec1 and 2) in
E. coli strains (Table 4).
TABLE-US-00019 TABLE 4 Minimum Inhibitory Concentrations of the
Different Resistance Phenotypes Observed in K. pneumoniae, E. coli
and P. mirabilis. Resistance No. MIC range (.mu.g/ml).sup.a
phenotype strains pip tzp ctx caz atm fox fep imi K. pneumoniae
Kpn1 8 >128 2-4 0.25-1.sup. >128 16-64 2-4 0.12 0.12 Kpn2 28
>128 2->128 4-64 4-128 1-128 2-8 0.5-4 0.12-1 Kpn3 1 64 16 4
4 2 >128 0.12 0.12 E. coli Ec1 3 >128 1 1 >128 16 4 0.12
0.12 Ec2 1 >128 32 16 4 2 8 2 0.12 P. mirabilis 4 128 0.25-0.5
0.25-0.5 16-64 0.5-2.sup. 2-4 2 0.5-1 .sup.apip--piperacillin,
tzp--piperacillin/tazobactam (4 .mu.g/ml), ctx--cefotaxime,
caz--ceftazidime, atm--aztreonam, fox--cefoxitin, fep--cefepime,
imi--imipenem.
[0108] The phenotypes Kpn1 and Ec1 involved high level resistance
to ceftazidime (MIC>128 .mu.g/ml) but susceptibility to
cefotaxime (MIC range 0.25-1 .mu.g/ml), while Kpn2 and Ec2 involved
decreased susceptibility to both cefotaxime (MIC range 4-64
.mu.g/ml) and ceftazidime (MIC range 4-128 .mu.g/ml). Kpn 3,
represented by K. pneumoniae Pit 68, involved resistance to
cefoxitin (MIC>128 .mu.g/ml) and decreased susceptibility to
cefotaxime, ceftazidime and aztreonam (MIC>2 .mu.g/ml) (Table
4). The P. mirabilis isolates showed decreased susceptibility to
ceftazidime (MIC range 16-64 .mu.g/ml) and susceptibility to
cefotaxime (MIC range 0.25-0.5 .mu.g/ml).
Beta-Lactamases
[0109] Strains representing the Kpn1 and Ec1 phenotypes produced
beta-lactamases with pI values of 5.6 and 7.6 respectively, while
phenotypes Kpn2 and Ec2 involved enzymes with pI's of 5.4, 7.6, and
8.2 (Table 5). K. pneumoniae Pit 68, representing phenotype Kpn3,
produced two beta-lactamases with pIs of 5.4 and 8.0. The P.
mirabilis strains showed a single enzyme with a pI value of 5.6
(Table 5). The enzymes of pI 5.4, 5.6, 7.6 and 8.2 aligned with
TEM-1 (pI 5.4), TEM-10 or 26 (pI 5.57), SHV-1, 2 or 8 (PI 7.6) and
SHV-5 (pI 8.2) respectively (Table 5). It was therefore necessary
to investigate these enzymes further. On isoelectric focusing gels,
all of the beta-lactamases except for the enzymes with a pI of 8.0
were inhibited by clavulanate, a characteristic of Bush group 2
enzymes. The enzyme with a pI of 8.0 was inhibited by cloxacillin
which correlates with Bush group 1 cephalosporinases. The
substrate-based technique showed hydrolysis of 0.75 Fg/ml
cefotaxime at the bands focusing at: 5.6, 8.0, 8.2 and some enzymes
with a pI of 7.6 (Table 5). Control enzymes of TEM-10, TEM-26,
SHV-2 and SHV-5 showed hydrolysis of cefotaxime in this assay
(Table 5).
TABLE-US-00020 TABLE 5 Characteristics of Beta-lactamases Produced
by Different Resistance Phenotypes. Most similar Resistance No. ctx
Inhibited.sup.b by: Beta- phenotype strains pI hydrolysis.sup.a
clox clav lactamases K. pneumoniae Kpn1 8 5.6 Yes No Yes TEM-10 or
26 7.6 No No Yes SHV-1 Kpn2 28 5.4 No No Yes TEM-1 7.6 Yes No Yes
SHV-2 or 8 8.2 Yes Yes No SHV-5 Kpn3 1 5.4 No No Yes TEM-1 8.0 Yes
Yes No AmpC E. coli Ec1 3 5.4 No No Yes TEM-1 5.6 Yes No Yes TEM-10
or 26 Ec2 1 5.4 No No Yes TEM-1 7.6 Yes No Yes SHV-2 or 8 P. 4 5.6
Yes No Yes TEM-10 mirabilis or 26 .sup.aHydrolysis of 0.75 .mu.g/ml
cefotaxime (ctx) used in substrate-based isoelectric focusing
overlay technique (Hibbert-Rodgers et al., J. Antimicrob.
Chemother., 33: 707-720 (1994)). .sup.bInhibitors used in
isoelectric focusing overlay technique were clav, clavulanic acid;
clox, cloxacillin (Huletsky et al., Antimicrob. Agents and
Chemother., 34: 1725-1732 (1990)).
[0110] Hydrolysis assays with nitrocefin, cefotaxime, ceftazidime
and aztreonam were performed on strains possessing single
beta-lactamases. All the strains assayed hydrolyzed cefotaxime,
ceftazidime and aztreonam to some extent (Table 6).
TABLE-US-00021 TABLE 6 Hydrolysis Profiles of Cell Extracts
Containing a Single Beta-lactamase. Hydrolysis (nmol of
substrate.sup.a hydrolyzed/min/mg of protein) Beta- lactamase
Nitro- Cefo- Cefta- Aztre- Strain (pI) cefin taxime zidime onam K.
pneumoniae Pit 16 5.6 114 4 3 0.6 Pit 100 7.6 159 11 0.1 0.9 Pit 82
8.2 136 11 0.2 0.9 E. coli Pit 64 5.6 275 1 2 0.4 Pit 56 7.6 143 9
0.1 0.8 P. mirabilis Pit 85 5.6 138 5 1 0.5 .sup.a100 .mu.M
solution of substrate
DNA Amplification and Sequencing
[0111] The DNA from organisms producing single beta-lactamases were
amplified and sequenced. Strains producing ESBLs with pIs of 5.6,
which aligned with TEM-10 and TEM-26, were amplified with the TEM
primers (Table 7). Amino acids at positions 104, 164 and 240
(Ambler numbering (1)) were utilized to determine that this enzyme
was more similar to TEM-26. Amino acids deduced from amplicon
sequences included lysine at position 104, serine at position 164
and glutamine at position 240 (Table 7). Strains producing ESBLs
with pI values 7.6 and 8.2, which aligned with SHV-2 and SHV-5
respectively, were amplified with SHV primers (Table 7). Amino
acids at positions 205, 238 and 240 (Labia numbering (2)) were used
to identify the ESBL involved. Arginine at position 205, serine at
position 238 and glutamic acid at position 240 of the deduced amino
acid sequence of strains producing an ESBL with a pI of 7.6
indicated the presence of SHV-2 (Table 7). K. pneumoniae Pit 82,
producing an ESBL with a pI 8.2, had a lysine at position 240
indicating the presence of SHV-5 (Table 7).
TABLE-US-00022 TABLE 7 Identification of Extended-Spectrum
Beta-lactamases Occurring in South Africa. Amplification with
TEM.sup.b SHV.sup.c TEM SHV aa aa aa aa Aa aa Strain.sup.a pI
primers primers 104 164 240 205 238 240 beta-lactamase K.
pneumoniae Pit 16 5.6 Yes No Lys Ser Glu -- -- -- TEM-26-type Pit
100 7.6 No Yes -- -- -- Arg Ser Glu SHV-2 Pit 82 8.2 No Yes -- --
-- Arg Ser Lys SHV-5 E. coli Pit 64 5.6 Yes No Lys Ser Glu -- -- --
TEM-26-type Pit 56 7.6 No Yes -- -- -- Arg Ser Glu SHV-2 P.
mirabilis Pit 85 5.6 Yes No Lys Ser Glu -- -- -- TEM-26-type
.sup.aStrains with single beta-lactamases used for sequencing
.sup.bNumbering according to Sutcliffe et al., Proc. Nat. Aca.
Sci., USA, 75, 3737-3741 (1978). .sup.cNumbering according to
Mercier et al., Antimicrob. Agents Chemother., 34, 1577-1583
(1990).
Example 3
Plasmid-Mediated Resistance to Expanded-Spectrum Cephalosporins
Among Enterobacter aerogenes
Materials and Methods
Bacterial Strains
[0112] Among all E. aerogenes recovered from clinical specimens
during an eighteen month period (September 1993 to March 1995),
thirty-one E. aerogenes strains showing a resistance phenotype
different from that observed with derepressed mutants normally
encountered at the Hunter Holmes McGuire Medical Center, Richmond,
Va. were selected for this study. The strains selected were
intermediate to ceftriaxone but resistant to ceftazidime when
tested with the Vitek automated susceptibility system (bioMerieux
Vitek, St. Louis, Mo.). Derepressed mutants previously isolated
from this center were usually resistant to both ceftriaxone and
ceftazidime.
Susceptibility Testing
[0113] Antibiotic susceptibilities were determined by standard
disk-diffusion (NCCLS Standard M2-A6) and agar-dilution (NCCLS
Standard M7-A4) procedures. Disks were obtained from Becton
Dickinson Microbiology Systems (Cockeysville, Md.). Disk-diffusion
susceptibilities to the following antibiotics were determined,
ampicillin; amoxicillin clavulanic acid; aztreonam; cefazolin;
cefoxitin; cefuroxime; cefotaxime; ceftriaxone; ceftazidime;
cefepime; imipenem; gentamicin; trimethoprim/sulfamethoxazole and
ciprofloxacin. Standard powders of antimicrobial agents for minimum
inhibitory concentration (MICs) were kindly provided by the
following companies: cefoxitin and imipenem, (Merck, Rathway N.J.);
cefotaxime, (Hoechst-Roussel Pharmaceuticals Inc., Somerville,
N.J.); ceftazidime, (Glaxo Group Research Ltd., Greenford England);
aztreonam and cefepime, (Bristol-Myers Squibb, Princetown, N.J.)
and gentamicin, (Schering-Plough, Liberty Corner, N.J.). The
following quality control strains were run simultaneously with the
test organisms Escherichia coli ATCC 25922, Pseudomonas aeruginosa
ATCC 27853, and E. coli ATCC 35218. Throughout this study, results
were interpreted using NCCLS criteria for disk diffusion (NCCLS
M2-A6) and broth dilution (NCCLS M7-A4).
Double-Disk Potentiation Test
[0114] This test described by Jarlier et al., Rev. Infect. Dis.,
10:867-878 (1988), using ceftazidime, ceftriaxone, cefotaxime and
aztreonam disks was performed on the strains to screen for possible
ESBL production. This test is a modification of the disk diffusion
susceptibility test in that cefotaxime, ceftriaxone, ceftazidime
and aztreonam disks are placed 30 mm from disks containing
amoxycillin/clavulanic acid. A potentiation of the zones of
cefotaxime, ceftriaxone, ceftazidime or aztreonam by clavulanic
acid represented a positive test and was indicative of possible
ESBL production.
Beta-Lactamase Preparation, Isoelectric Focusing and Assays
[0115] Overnight cultures in 5 mls Mueller-Hinton broth were
diluted with 95 ml fresh broth and incubated with shaking for 90
minutes at 37.degree. C. Cefoxitin, at a concentration of 1/4 of
the MIC, was added for induction while sterile medium was used in
the non-induced cultures and incubated for an additional 2 hours.
The induction process was stopped by adding 1 mM 8-hydroxyquinoline
solution to each culture. Cells were harvested by centrifugation at
4.degree. C., washed with 1M potassium-phosphate buffer (pH 7.0),
suspended and sonicated. After sonication, crude extracts were
obtained by centrifugation at 6,000 rpm for 1 hour. The
beta-lactamases in the sonic extracts were assessed for isoelectric
points (pIs), and substrate and inhibitor profiles in
polyacrylamide gels. The rates of hydrolysis of cephalothin were
determined by ultra-violet spectrophotometric assay (O'Callghan et
al., Antimicrob. Agents and Chemother., 1966, 337-343 (1967)). As
controls, crude beta-lactamase preparations from the following
organisms possessing different SHVenzymes were evaluated
simultaneously with those obtained from the Enterobacter strains:
SHV-1 [from E. coli J53(R1010)], SHV-2 (from Klebsiella ozaenae
2180), SHV-3 [from E. coli J53-2(pUD18)], SHV-4 [from E. coli
J53-2(pUD21)] and SHV-5 [from E. coli Cla Nal (pAFF2)].
Isolation of Plasmids
[0116] The organisms were inoculated into 5 ml of LB (Luria
Bertani) broth [Difco (Detroit, Mich.)] and incubated for 20 hours
at 37.degree. C. with shaking. Cells from 1.5 ml of overnight
culture were harvested by centrifugation in an Eppendorf centrifuge
for 5 minutes. After the supernatant was decanted, the pellet was
resuspended in TRITON X100 1% in TE buffer for 10 minutes. Plasmid
DNA was then isolated by the alkaline extraction method of Birnboim
et al., Nucleic Acids Res., 7:1513 (1979), and separated by
electrophoresis in 0.8% agarose gel (Sigma, St. Louis, Mo.) in TAE
buffer (0.04M Tris-acetate, 0.002M EDTA [pH 8.5]). The gel was
stained with ethidium bromide and plasmid bands were visualized
using ultra-violet light.
Conjugation Experiments
[0117] To determine if the resistance was transferable,
transconjugation experiments were performed using Escherichia coli
C600N(Nal.sup.r) as recipient (Maniatis et al., Molecular Cloning:
A Laboratory Manual, Cold Spring Harbor, N.Y., 1982). The filter
paper mating technique with overnight incubation at 37.degree. C.
were performed as described previously (Philippon et al.,
Antimicrob. Agents Chemother., 33:1131-1136 (1989)).
Transconjugants were selected on LB (Luria Bertani) agar [Difco
(Detroit, Mich.)] plates containing 12 .mu.g per ml nalidixic acid
and 20 .mu.g per ml ampicillin.
DNA Amplification Using the Polymerase Chain Reaction (PCR)
[0118] Organisms were inoculated into 5 ml of LB (Luria Bertani)
broth [Difco (Detroit, Mich.)] and incubated for 20 hours at
37.degree. C. with shaking. Cells from 1.5 ml of overnight culture
were harvested by centrifugation at 13,000 rpm in an Eppendorf
centrifuge for 5 minutes. After the supernatant was decanted, the
pellet was resuspended in 500 .mu.l of sterile deionized water. The
cells were lysed by heating to 95.degree. C. for 10 minutes and
cellular debris were removed by centrifugation for 5 minutes at
13,000 rpm. The supernatant was used as a source of template for
amplification. Oligonucleotide primers specific for SHV genes were
selected from a consensus alignment sequence generated by the
MacVector 4.5 (Kodak/IBI) software package from the published
nucleic acid sequence of SHV-1 (Mercier et al., Antimicrob. Agents
Chemother., 34:1577-1583 (1990)), SHV-2 (Jacoby et al., Antimicrob.
Agents Chemother., 35:1697-1704 (1991)), SHV-5 (Billot-Klein et
al., Antimicrob. Agents Chemother., 34:2439-2441 (1990)) and SHV-7
(Bradford et al., Antimicrob. Agents Chemother., 39:899-905
(1995)). The PCR primers used were A [5'-(CACTCAAGGATGTATTGTG)-3']
(SEQ ID NO:10) and B[5'-(TTAGCGTTGCCAGTGCTCG)-3'] (SEQ ID NO:11)
which amplified a 781 base pair fragment. Primer specificity
controls included the TEM-1, MIR-1 and SHV-7 beta-lactamase genes.
PCR amplifications were carried out on a DNA Thermal Cycler 480
instrument (Perkin-Elmer, Cetus, Norwalk, Conn.) using the
GeneAmp"DNA amplification kit containing AmpliTaq" polymerase
(Perkin Elmer, Roche Molecular Systems, Inc., Branchburg, N.J.).
The composition of the reaction mixture was as follows: 10 mM
Tris-HCl (pH 8.3), 50 mM KCl, 0.1% TRITON X-100, 1.5 mM MgCl.sub.2,
0.2 mM (each) of the four deoxynucleoside triphosphates, and 1.2 U
of AmpliTaq" in a total volume of 49 .mu.l. A total of 1 .mu.l of
sample lysate was added to the reaction mixture, and was
centrifuged briefly before 50 .mu.l of mineral oil was layered on
the surface. The PCR program consisted of an initial denaturation
step at 96.degree. C. for 30 seconds; followed by 24 cycles of DNA
denaturation at 96.degree. C. for 30 seconds, primer annealing at
50.degree. C. for 15 seconds and primer extension at 72.degree. C.
for 2 minutes. After the last cycle the products were stored at
4.degree. C. The PCR products were analyzed by electrophoresis
using 1.4% agarose gels in TAE buffer. The gels were stained with
ethidium bromide and the PCR products were visualized with
ultra-violet light.
Results
Bacterial Strains
[0119] Twenty-four of the 31 strains from Hunter Holmes McGuire
Medical Center originated from patients in 2 spinal cord injury
wards (SCW1, SCW2) while 3 strains were isolated from patients in
the medical intensive care unit, 3 isolates were recovered from
patients attending the surgical outpatient clinic, and 1 isolate
was recovered from a patient in a general surgery ward. Disk
diffusion susceptibility tests showed all the strains to be
resistant to ampicillin, amoxycillin-clavulanate, cefazolin,
cefuroxime, trimethoprim/sulfamethoxazole and susceptible to
ciprofloxacin. MICs for cefoxitin, cefotaxime, ceftazidime,
aztreonam, cefepime, imipenem and gentamicin are summarized in
Table 8, below. All strains were susceptible to cefepime and
imipenem but showed decreased susceptibility to cefotaxime,
ceftazidime and aztreonam. MICs for gentamicin ranged from 8
.mu.g/ml to >128 .mu.g/ml for 25 of 37 (67%) isolates. All the
strains selected for this study showed a positive double disk test
when using cefotaxime and ceftriaxone disks.
TABLE-US-00023 TABLE 8 Minimum Inhibitory Concentrations and
Characteristics of Beta-lactamases Produced by E. aerogenes. Enzyme
Characteristics Inhibited No. of Beta-lactamase.sup.b Ctx by.sup.d:
MIC (.mu.g/ml)range.sup.a Strains Present pI Hydrolysis.sup.c clox
clav Inducible.sup.c fox ctx caz atm fep imi gm 1 Bush group 1 8.3
no yes no yes >256 1 4 1 0.12 0.5 8 Bush group 2be 6.9 yes no
yes no (SHV-3) 29 Bush group 1 8.3 no yes no yes >256 1-2 8-32
32-64 0.12-1 0.5 1-16 Bush group 2be 7.8 yes no yes no (SHV-4) 1
Bush group 1 8.3 no yes no yes >256 1-2 32 64 1 1 >128 Bush
group 2Be 8.0 yes no yes no (SHV-5) .sup.aCefoxitin (fox);
cefotaxime (ctx); ceftazidime (caz); aztreonam (atm); cefepime
(fep); imipenem (imi); gentamicin (gm). .sup.bBased on
Bush-Jacoby-Medeiros classification (Antimicrob. Agents Chemother.,
39: 899-905 (1995)). Beta-lactamase listed in parentheses is the
one most similar to the group 2be enzyme produced by the
Enterobacter strains. .sup.cHydrolysis of 0.75 .mu.g/ml cefotaxime
(ctx) used in substrate-based isoelectric focusing overlay
technique (Bauernfeind et al., Infection, 18: 294-298 (1990)).
.sup.dInhibitors used in isoelectric focusing overlay technique
were clav, clavulanic acid; clox, cloxacillin (Sanders et al.,
Clin. Microbiol. Rev., 10: 220-241 (1997)). .sup.eInducible by
cefoxitin.
Characteristics of Beta-Lactamases.
[0120] All the Enterobacter isolates possessed a Bush group 1
inducible beta-lactamase with an alkaline pI of 8.3 which was
sensitive to inhibition by cloxacillin but not clavulanic acid
(Table 8, above). Additional Bush group 2be enzymes with pIs
resembling SHV beta-lactamases were also present in all the strains
(Table 8). Three different Bush group 2be enzymes were detected in
the species of Enterobacter (Table 8): the majority of isolates (29
of 31) produced an enzyme with a pI of 7.8 which aligned with
SHV-4. One isolate produced an enzyme with a pI of 6.8 which
aligned with SHV-3, and one isolate produced an enzyme with a pI of
8.2 which aligned with SHV-5.
Plasmid Profiles
[0121] A variety of different plasmids with sizes ranging from 10
kb to approximately 60 kb were visualized with electrophoresis
(Table 9, below). Furthermore, eight different plasmid patterns
were observed with the number of plasmids ranging from 0 to 5 per
organism (Table 9). No plasmids were visualized in 3 strains, which
included the strain which produced an enzyme resembling SHV-5
(Table 9). Three different susceptibility profiles were identified
(Table 9). The majority of organisms isolated were resistant to
ceftazidime, aztreonam, trimethoprim/sulfamethoxazole and
gentamicin. This antibiogram was associated with the production of
(.beta.-lactamases resembling SHV-4 and SHV-5 and were isolated
from the spinal cord injury wards 1 and 2, medical intensive care
unit, general surgical ward as well as the outpatient clinic (Table
9). Eight of thirty strains showing 3 different plasmid profiles
(a, b and f) producing an enzyme resembling SHV-4 isolated from
SCW1 as well as the surgical outpatient clinic were susceptible to
gentamicin while the E. aerogenes strain producing an enzyme
resembling SHV-3 appeared susceptible to ceftazidime and aztreonam
(Table 9). Seven different plasmid profiles (b-h) were observed
among E. aerogenes isolated from the spinal cord injury ward SCW1
while only 4 patterns (c, d, g and h) were observed among those
recovered from SCW2 (Table 9). Plasmid profile b, observed in 6
isolates, consisting of 5 plasmids ranging from 50 kb to 10 kb and
plasmid profile f, observed in 1 isolate (3 plasmids ranging from
60 kb to 10 kb) were unique to SCW1 (Table 9). Two of the three
strains isolated from MICU possessed 4 plasmids ranging from 60 kb
to 10 kb (plasmid profile c) while no plasmids were visualized from
the other strain (plasmid profile h) [Table 9]. These organisms
produced an enzyme resembling SHV-4 and were resistant to
ceftazidime, aztreonam, trimethoprim/sulfamethoxazole and
gentamicin. The E. aerogenes strains originating from the surgical
outpatient clinic had 2 different antibiograms and plasmid
profiles. Two of three isolates, possessing plasmid profile e, were
resistant to ceftazidime, aztreonam, trimethoprim/sulfamethoxazole
and gentamicin while the remaining isolate with plasmid profile a,
appeared susceptible to gentamicin (Table 9). All these organisms
produced an enzyme resembling SHV-4.
TABLE-US-00024 TABLE 9 Plasmid Profiles of Enterobacter aerogenes.
Plasmid No. Approximate Most Likely profile plasmids Size
(kilobases) Ward (no. of isolates).sup.a Antibiogram.sup.b ESBL A 5
50, 35, 20, 15, 12 OPC (1) CAZ/ATM/SXT SHV-4 B 5 50, 45, 35, 20, 10
SCW1 (6) CAZ/ATM/SXT SHV-4 C 4 60, 45, 20, 10 SCW1 (5)
CAZ/ATM/SXT/G SHV-4 SCW2 (2) CAZ/ATM/SXT/G SHV-4 MICU (2)
CAZ/ATM/SXT/G SHV-4 D 4 45, 35, 20, 10 SCW1 (2) CAZ/ATM/SXT/G SHV-4
SCW2 (1) CAZ/ATM/SXT/G SHV-4 E 3 60, 50, 14 SCW1 (2) CAZ/ATM/SXT/G
SHV-4 OPC (2) CAZ/ATM/SXT/G SHV-4 F 3 60, 50, 10 SCW1 (1)
CAZ/ATM/SXT SHV-4 G 2 50, 10 SCW1 (1) SXT/G SHV-3 SCW2 (2)
CAZ/ATM/SXT/G SHV-4 SGW (1) CAZ/ATM/SXT/G SHV-4 H 0 -- SCW1 (1)
CAZ/ATM/SXT/G SHV-5 SCW2 (1) CAZ/ATM/SXT/G SHV-4 MICU (1)
CAZ/ATM/SXT/G SHV-4 .sup.aOPC; outpatient clinic, SCW1; spinal cord
injury ward 1, SCW2; spinal cord injury ward 2, MICU; medical
intensive care unit, SGW; surgical general ward. .sup.bResistance
to CAZ; ceftazidime, ATM; aztreonam, SXT;
trimethoprim/sulfamethoxazole, G; gentamicin.
Conjugation Experiments.
[0122] The following strains were selected for conjugation with E.
coli C600N. E. aerogenes 187 producing an enzyme with a pI of 6.8
resembling SHV-3; E. aerogenes 200 and E. aerogenes 220 producing
enzymes with pIs of 7.8 resembling SHV-4; and E. aerogenes 184
producing an enzyme with a pI of 8.2 resembling SHV-5. All the
strains also possessed an inducible Bush group 1 beta-lactamase
with a pI of 8.3. A plasmid of approximately 50 kb was transferred
from E. aerogenes 187, E. aerogenes 200 and E. aerogenes 220 to E.
coli C600N (Table 10, below). No plasmids were visualized in E.
aerogenes 184 or its transconjugant E. coli JP04/tr (Table 10).
Isoelectric focusing performed on the Enterobacter strains and
their respective transconjugants showed the beta-lactamases
resembling SHV-3, SHV-4 and SHV-5 present in both donors and
recipients. The transfer of plasmids encoding SHV beta-lactamase
genes into E. coli C600N was accompanied by resistance to
gentamicin and trimethroprim/sulfamethoxazole and decreased
susceptibility to cefotaxime, ceftazidime and aztreonam (Table
10).
TABLE-US-00025 TABLE 10 Characteristics of Enterobacter Strains and
Respective Transconjugants Plasmids Beta- (approximate size,
lactamases Most likely Beta- Strains.sup.a kilobases) (pI)
lactamase E. coli C600N -- -- -- E. aerogenes 187 50, 10 8.3, 6.8
AmpC, SHV-3 E. coli JP01/tr 50 6.8 SHV-3 E. aerogenes 200 60, 50,
14 8.3, 7.8 AmpC, SHV-4 E. coli JP02/tr 50, 10 7.8 SHV-4 E.
aerogenes 220 60, 50, 10 8.3, 7.8 AmpC, SHV-4 E. coli JP03/tr 50
7.8 SHV-4 E. aerogenes 184 -- 8.3, 8.2 AmpC, SHV-5 E. coli JP04/tr
-- 8.2 SHV-5 .sup.aE. aerogenes 187, 200, 220 and 184 were donors;
E. coli C600N served as recipient and JP01, 2, 3 and 4 were the
respective transconjugants
DNA Amplification
[0123] The strains used in the conjugation experiments were
selected for amplification with PCR; E. aerogenes 187 (pI 6.8), E.
aerogenes 200 (pI 7.8), E. aerogenes 220 (pI 7.8), E. aerogenes 184
(pI of 8.2) as well as their respective transconjugants E. coli
JP01/tr (pI 6.8), E. coli JP02/tr (pI 7.8), E. coli JP03/tr (pI
7.8) JP04/tr (pI 8.2). Control strains producing SHV-3, SHV-4,
SHV-5 and SHV-7 were used as positive controls while E. coli C600N
was used as a negative control. A 781 base pair fragment specific
for SHV beta-lactamases was amplified in E. aerogenes 187, E.
aerogenes 200, E. aerogenes 220, E. aerogenes 184 and their
respective transconjugants as well as the positive controls (Table
10, above). No amplification was observed with E. coli C600N (Table
10). Therefore, the ESBLs produced by these strains are indeed
derivatives of an SHV beta-lactamase.
[0124] The complete disclosures of the patents, patent documents,
and publications cited herein are incorporated by reference in
their entirety as if each were individually incorporated. Various
modifications and alterations to this invention will become
apparent to those skilled in the art without departing from the
scope and spirit of this invention. It should be understood that
this invention is not intended to be unduly limited by the
illustrative embodiments and examples set forth herein and that
such examples and embodiments are presented by way of example only
with the scope of the invention intended to be limited only by the
claims set forth herein as follows.
SEQUENCE LISTING FREE TEXT
[0125] SEQ ID NO:1-45 Primer
Sequence CWU 1
1
45120DNAartificialprimer 1tgcttaatca gtgaggcacc
20220DNAartificialprimer 2agatcagttg ggtgcacgag
20318DNAartificialprimer 3cttggtctga cagttacc
18415DNAartificialprimer 4tgtcgccctt attcc 15515DNAartificialprimer
5tcggggaaat gtgcg 15620DNAartificialprimer 6atcgtccacc atccactgca
20720DNAartificialprimer 7gggaaacgga actgaatgag
20820DNAartificialprimer 8tagtggatct ttcgctccag
20917DNAartificialprimer 9gctctgcttt gttattc
171019DNAartificialprimer 10cactcaagga tgtattgtg
191119DNAartificialprimer 11ttagcgttgc cagtgctcg
191221DNAartificialprimer 12ggaacagact gggctttcat c
211315DNAartificialprimer 13ggacatcccc ttgac
151420DNAartificialprimer 14gtggattcac ttctgccacg
201520DNAartificialprimer 15cttctggcat gccctatgag
201624DNAartificialprimer 16catgacccag ttcgccatat cctg
241724DNAartificialprimer 17attcgtatgc tggatctcgc cacc
241822DNAartificialprimer 18ctggcaacca caatggactc cg
221922DNAartificialprimer 19gccagttcag catctcccag cc
222020DNAartificialprimer 20cgtgaccaac aacgcccagc
202121DNAartificialprimer 21ccagatagcg aatcagatcg c
212219DNAartificialprimer 22ccagccgatg ctcaaggag
192319DNAartificialprimer 23cacgaacgcc acataggcg
192422DNAartificialprimer 24ggcattggga tagttgcggt tg
222525DNAArtificial Sequenceprimer 25ttactacaag gtcggcgaca tgacc
252622DNAartificialprimer 26ggatcacact attacatctc gc
222722DNAartificialprimer 27cgtatggttg agtttgagtg gc
222823DNAartificialprimer 28gcgacctggt taactacaat ccc
232921DNAartificialprimer 29cggtagtatt gcccttaagc c
213020DNAartificialprimer 30cggaaaagca cgtcgatggg
203120DNAartificialprimer 31gcgatatcgt tggtggtgcc
203220DNAartificialprimer 32ctcgatgatg cgtgcttcgc
203320DNAartificialprimer 33gcgactgtga tgtataaacg
203420DNAartificialprimer 34cgtcgctcac catatctccc
203520DNAartificialprimer 35cctctcgtgc tttagacccg
203619DNAartificialprimer 36cgctgggaaa cctattcgg
193721DNAartificialprimer 37ctgccatcca gtttcttcgg g
213821DNAartificialprimer 38ggtggcattg acaaattctg g
213918DNAartificialprimer 39cccaccatgc gacaccag
184019DNAartificialprimer 40tgtgcaacgc aaatggcac
194123DNAartificialprimer 41cgaccccaag tttcctgtaa gtg
234222DNAartificialprimer 42aggcacgata gttgtggcag ac
224322DNAartificialprimer 43cactcaaccc atcctaccca cc
224421DNAartificialprimer 44cgaacgaatc attcagcacc g
214523DNAartificialprimer 45cggcaatgtt ttactgtagc gcc 23
* * * * *