U.S. patent application number 13/167578 was filed with the patent office on 2011-11-24 for therapeutic agents useful for treating pain.
This patent application is currently assigned to Purdue Pharma L.P.. Invention is credited to Qun Sun.
Application Number | 20110288100 13/167578 |
Document ID | / |
Family ID | 34392938 |
Filed Date | 2011-11-24 |
United States Patent
Application |
20110288100 |
Kind Code |
A1 |
Sun; Qun |
November 24, 2011 |
THERAPEUTIC AGENTS USEFUL FOR TREATING PAIN
Abstract
The present invention discloses a compound of formula:
##STR00001## where Ar.sub.1, Ar.sub.2, X, Z.sub.1, Z.sub.2,
R.sub.3, and m are as disclosed herein or a pharmaceutically
acceptable salt thereof (a "Pyridylene Compound"); compositions
comprising an effective amount of a Pyridylene Compound; and
methods for treating or preventing pain or other conditions in an
animal comprising administering to an animal in need thereof an
effective amount of a Pyridylene Compound.
Inventors: |
Sun; Qun; (Princeton,
NJ) |
Assignee: |
Purdue Pharma L.P.
Stamford
CT
|
Family ID: |
34392938 |
Appl. No.: |
13/167578 |
Filed: |
June 23, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12840936 |
Jul 21, 2010 |
7994177 |
|
|
13167578 |
|
|
|
|
11387073 |
Mar 21, 2006 |
7772254 |
|
|
12840936 |
|
|
|
|
PCT/US2004/030825 |
Sep 21, 2004 |
|
|
|
11387073 |
|
|
|
|
60504730 |
Sep 22, 2003 |
|
|
|
Current U.S.
Class: |
514/252.03 ;
435/375; 544/238 |
Current CPC
Class: |
A61P 25/36 20180101;
A61P 25/08 20180101; A61P 9/10 20180101; A61P 15/06 20180101; A61P
25/14 20180101; A61P 1/14 20180101; A61P 27/02 20180101; A61P 25/06
20180101; A61P 25/18 20180101; A61P 25/04 20180101; A61P 17/00
20180101; A61P 11/00 20180101; A61P 15/00 20180101; A61P 31/06
20180101; A61P 31/08 20180101; A61P 37/00 20180101; A61P 25/28
20180101; A61P 41/00 20180101; A61P 3/10 20180101; A61P 31/18
20180101; A61P 17/04 20180101; C07D 213/81 20130101; A61P 1/02
20180101; A61P 21/00 20180101; A61P 29/00 20180101; A61P 31/04
20180101; A61P 1/04 20180101; A61P 1/18 20180101; A61P 9/00
20180101; A61P 13/12 20180101; A61P 25/16 20180101; A61P 25/32
20180101; A61P 1/08 20180101; A61P 27/12 20180101; A61P 25/24
20180101; A61P 25/22 20180101; A61P 25/30 20180101; A61P 43/00
20180101; A61P 25/34 20180101; A61P 39/00 20180101; A61P 27/06
20180101; A61P 1/06 20180101; A61P 17/06 20180101; A61P 19/02
20180101; A61P 3/06 20180101; C07D 213/80 20130101; A61P 25/00
20180101; A61P 1/16 20180101 |
Class at
Publication: |
514/252.03 ;
544/238; 435/375 |
International
Class: |
A61K 31/501 20060101
A61K031/501; C07D 417/14 20060101 C07D417/14; C12N 5/071 20100101
C12N005/071; A61P 29/00 20060101 A61P029/00; C07D 401/04 20060101
C07D401/04; C07D 401/14 20060101 C07D401/14; C07D 413/14 20060101
C07D413/14 |
Claims
1. A compound of formula: ##STR00108## or a pharmaceutically
acceptable salt thereof, wherein: Ar.sub.1 is ##STR00109## Ar.sub.2
is ##STR00110## X is O or S; R.sub.1 is -halo, --CH.sub.3,
--C(halo).sub.3, --CH(halo).sub.2, or --CH.sub.2(halo); each
R.sub.2 is independently: (a) -halo, --OH, --NH.sub.2, --CN, or
--NO.sub.2; (b) --(C.sub.1-C.sub.10)alkyl,
--(C.sub.2-C.sub.10)alkenyl, --(C.sub.2-C.sub.10)alkynyl,
--(C.sub.3-C.sub.10)cycloalkyl, --(C.sub.8-C.sub.14)bicycloalkyl,
--(C.sub.8-C.sub.14)tricycloalkyl,
--(C.sub.5-C.sub.10)cycloalkenyl,
--(C.sub.8-C.sub.14)bicycloalkenyl,
--(C.sub.8-C.sub.14)tricycloalkenyl, -(3- to
7-membered)heterocycle, or -(7- to 10-membered)bicycloheterocycle,
each of which is unsubstituted or substituted with one or more
R.sub.5 groups; or (c) -phenyl, -naphthyl, --(C.sub.14)aryl or -(5-
to 10-membered)heteroaryl, each of which is unsubstituted or
substituted with one or more R.sub.6 groups; each R.sub.3 is
independently: (a) -halo, --CN, --OH, --NO.sub.2, or --NH.sub.2;
(b) --(C.sub.1-C.sub.10)alkyl, --(C.sub.2-C.sub.10)alkenyl,
--(C.sub.2-C.sub.10)alkynyl, --(C.sub.3-C.sub.10)cycloalkyl,
--(C.sub.8-C.sub.14)bicycloalkyl,
--(C.sub.8-C.sub.14)tricycloalkyl,
--(C.sub.5-C.sub.10)cycloalkenyl,
--(C.sub.8-C.sub.14)bicycloalkenyl,
--(C.sub.8-C.sub.14)tricycloalkenyl, -(3- to
7-membered)heterocycle, or -(7- to 10-membered)bicycloheterocycle,
each of which is unsubstituted or substituted with one or more
R.sub.5 groups; or (c) -phenyl, -naphthyl, --(C.sub.14)aryl or -(5-
to 10-membered)heteroaryl, each of which is unsubstituted or
substituted with one or more R.sub.6 groups; each R.sub.5 is
independently --CN, --OH, --(C.sub.1-C.sub.6)alkyl,
--(C.sub.2-C.sub.6)alkenyl, -halo, --N.sub.3, --NO.sub.2,
--N(R.sub.7).sub.2, --CH.dbd.NR.sub.7, --NR.sub.7OH, --OR.sub.7,
--COR.sub.7, --C(O)OR.sub.7, --OC(O)R.sub.7, --OC(O)OR.sub.7,
--SR.sub.S, --S(O)R.sub.7, or --S(O).sub.2R.sub.7; each R.sub.6 is
independently --(C.sub.1-C.sub.6)alkyl, --(C.sub.2-C.sub.6)alkenyl,
--(C.sub.2-C.sub.6)alkynyl, --(C.sub.3-C.sub.8)cycloalkyl,
--(C.sub.5-C.sub.8)cycloalkenyl, -phenyl, -(3- to
5-membered)heterocycle, --C(halo).sub.3, --CH(halo).sub.2,
--CH.sub.2(halo), --CN, --OH, -halo, --N.sub.3, --NO.sub.2,
--N(R.sub.7).sub.2, --CH.dbd.NR.sub.7, --NR.sub.7OH, --OR.sub.7,
--COR.sub.S, --C(O)OR.sub.7, --OC(O)R.sub.7, --OC(O)OR.sub.7,
--SR.sub.S, --S(O)R.sub.7, or --S(O).sub.2R.sub.7; each R.sub.7 is
independently --H, --(C.sub.1-C.sub.6)alkyl,
--(C.sub.2-C.sub.6)alkenyl, --(C.sub.2-C.sub.6)alkynyl,
--(C.sub.3-C.sub.8)cycloalkyl, --(C.sub.5-C.sub.8)cycloalkenyl,
-phenyl, -(3- to 5-membered)heterocycle, --C(halo).sub.3,
--CH(halo).sub.2, or --CH.sub.2(halo); each R.sub.8 is
independently --(C.sub.1-C.sub.6)alkyl, --(C.sub.2-C.sub.6)alkenyl,
--(C.sub.2-C.sub.6)alkynyl, --(C.sub.3-C.sub.8)cycloalkyl,
--(C.sub.5-C.sub.8)cycloalkenyl, -phenyl, --C(halo).sub.3,
--CH(halo).sub.2, --CH.sub.2(halo), --CN, --OH, -halo, --N.sub.3,
--NO.sub.2, --N(R.sub.7).sub.2, --CH.dbd.NR.sub.7, --NR.sub.7OH,
--OR.sub.7, --COR.sub.7, --C(O)OR.sub.7, --OC(O)R.sub.7,
--OC(O)OR.sub.7, --SR.sub.S, --S(O)R.sub.7, or --S(O).sub.2R.sub.7;
each R.sub.11 is independently --(C.sub.1-C.sub.6)alkyl,
--(C.sub.2-C.sub.6)alkenyl, --(C.sub.2-C.sub.6)alkynyl,
--(C.sub.3-C.sub.8)cycloalkyl, --(C.sub.5-C.sub.8)cycloalkenyl,
-phenyl, --C(halo).sub.3, --CH(halo).sub.2, --CH.sub.2(halo), --CN,
--OH, -halo, --N.sub.3, --NO.sub.2, --N(R.sub.7).sub.2,
--CH.dbd.NR.sub.7, --NR.sub.7OH, --OR.sub.7, --COR.sub.S,
--C(O)OR.sub.7, --OC(O)R.sub.7, --OC(O)OR.sub.7, --SR.sub.S,
--S(O)R.sub.B, or --S(O).sub.2R.sub.7; each halo is independently
--F, --Cl, --Br, or --I; m is an integer ranging from 0 to 3; o is
an integer ranging from 0 to 4; p is an integer ranging from 0 to
2; q is an integer ranging from 0 to 6; r is an integer ranging
from 0 to 5; and s is an integer ranging from 0 to 4.
2. The compound of claim 1, wherein p is 1 and R.sub.2 is
--(C.sub.1-C.sub.10)alkyl, --(C.sub.2-C.sub.10)alkenyl,
--(C.sub.2-C.sub.10)alkynyl, --(C.sub.3-C.sub.10)cycloalkyl,
--(C.sub.8-C.sub.14)bicycloalkyl,
--(C.sub.8-C.sub.14)tricycloalkyl,
--(C.sub.5-C.sub.10)cycloalkenyl,
--(C.sub.8-C.sub.14)bicycloalkenyl,
--(C.sub.8-C.sub.14)tricycloalkenyl, -(3- to
7-membered)heterocycle, or -(7- to 10-membered)bicycloheterocycle,
each of which is unsubstituted or substituted with one or more
R.sub.5 groups.
3. The compound of claim 2, wherein R.sub.2 is
--(C.sub.1-C.sub.10)alkyl which is substituted with two R.sub.5
groups.
4. The compound of claim 1, wherein: Ar.sub.2 is ##STR00111## X is
O; and R.sub.1 is --F, --Cl, --CH.sub.3 or --CF.sub.3.
5. The compound of claim 4, wherein p is 1 and R.sub.2 is
--(C.sub.1-C.sub.10)alkyl, --(C.sub.2-C.sub.10)alkenyl,
--(C.sub.2-C.sub.10)alkynyl, --(C.sub.3-C.sub.10)cycloalkyl,
--(C.sub.8-C.sub.14)bicycloalkyl,
--(C.sub.8-C.sub.14)tricycloalkyl,
--(C.sub.5-C.sub.10)cycloalkenyl,
--(C.sub.8-C.sub.14)bicycloalkenyl,
--(C.sub.8-C.sub.14)tricycloalkenyl, -(3- to
7-membered)heterocycle, or -(7- to 10-membered)bicycloheterocycle,
each of which is unsubstituted or substituted with one or more
R.sub.5 groups.
6. The compound of claim 5, wherein R.sub.2 is
--(C.sub.1-C.sub.10)alkyl which is substituted with two R.sub.5
groups.
7. The compound of claim 4, wherein: m is 0; r is 1; and R.sub.8 is
--(C.sub.1-C.sub.6)alkyl, -halo, --OCF.sub.3, or --CF.sub.3.
8. The compound of claim 7, wherein p is 1 and R.sub.2 is
--(C.sub.1-C.sub.10)alkyl, --(C.sub.2-C.sub.10)alkenyl,
--(C.sub.2-C.sub.10)alkynyl, --(C.sub.3-C.sub.10)cycloalkyl,
--(C.sub.8-C.sub.14)bicycloalkyl,
--(C.sub.8-C.sub.14)tricycloalkyl,
--(C.sub.5-C.sub.10)cycloalkenyl,
--(C.sub.8-C.sub.14)bicycloalkenyl,
--(C.sub.8-C.sub.14)tricycloalkenyl, -(3- to
7-membered)heterocycle, or -(7- to 10-membered)bicycloheterocycle,
each of which is unsubstituted or substituted with one or more
R.sub.5 groups.
9. The compound of claim 8, wherein R.sub.2 is
--(C.sub.1-C.sub.10)alkyl which is substituted with two R.sub.5
groups.
10. The compound of claim 7, wherein the --(C.sub.1-C.sub.6)alkyl
is a tert-butyl group, optionally substituted at the para-position
of Ar.sub.2.
11. The compound of claim 1, wherein: Ar.sub.2 is ##STR00112## X is
O; R.sub.1 is --CH.sub.3, --CF.sub.3, --Cl, --Br, --I, or --F; m is
0; (R.sub.8).sub.a is --H; and (R.sub.8).sub.b is --H, --CH.sub.3,
--OCH.sub.3, --CF.sub.3, --OCF.sub.3, --OCH.sub.2CH.sub.3,
iso-propyl, tert-butyl, --Br, --I, or --F.
12. The compound of claim 11, wherein p is 1 and R.sub.2 is
--(C.sub.1-C.sub.10)alkyl, --(C.sub.2-C.sub.10)alkenyl,
--(C.sub.2-C.sub.10)alkynyl, --(C.sub.3-C.sub.10)cycloalkyl,
--(C.sub.8-C.sub.14)bicycloalkyl,
--(C.sub.8-C.sub.14)tricycloalkyl,
--(C.sub.5-C.sub.10)cycloalkenyl,
--(C.sub.8-C.sub.14)bicycloalkenyl,
--(C.sub.8-C.sub.14)tricycloalkenyl, -(3- to
7-membered)heterocycle, or -(7- to 10-membered)bicycloheterocycle,
each of which is unsubstituted or substituted with one or more
R.sub.5 groups.
13. The compound of claim 12, wherein R.sub.2 is
--(C.sub.1-C.sub.10)alkyl which is substituted with two R.sub.5
groups.
14. The compound of claim 11, wherein R.sub.1 is --CH.sub.3,
--CF.sub.3, or --Cl and (R.sub.8).sub.b is --Cl, --F, --CF.sub.3,
--OCF.sub.3 or tert-butyl.
15. The compound of claim 1, wherein: Ar.sub.2 is ##STR00113## X is
O; and R.sub.1 is --F, --Cl, --CH.sub.3 or --CF.sub.3.
16. The compound of claim 15, wherein p is 1 and R.sub.2 is
--(C.sub.1-C.sub.10)alkyl, --(C.sub.2-C.sub.10)alkenyl,
--(C.sub.2-C.sub.10)alkynyl, --(C.sub.3-C.sub.10)cycloalkyl,
--(C.sub.8-C.sub.14)bicycloalkyl,
--(C.sub.8-C.sub.14)tricycloalkyl,
--(C.sub.5-C.sub.10)cycloalkenyl,
--(C.sub.8-C.sub.14)bicycloalkenyl,
--(C.sub.8-C.sub.14)tricycloalkenyl, -(3- to
7-membered)heterocycle, or -(7- to 10-membered)bicycloheterocycle,
each of which is unsubstituted or substituted with one or more
R.sub.5 groups.
17. The compound of claim 16, wherein R.sub.2 is
--(C.sub.1-C.sub.10)alkyl which is substituted with two R.sub.5
groups.
18. The compound of claim 15, wherein: m is 0; o is 1; and R.sub.8
is --(C.sub.1-C.sub.6)alkyl or -halo.
19. The compound of claim 18, wherein p is 1 and R.sub.2 is
--(C.sub.1-C.sub.10)alkyl, --(C.sub.2-C.sub.10)alkenyl,
--(C.sub.2-C.sub.10)alkynyl, --(C.sub.3-C.sub.10)cycloalkyl,
--(C.sub.8-C.sub.14)bicycloalkyl,
--(C.sub.8-C.sub.14)tricycloalkyl,
--(C.sub.5-C.sub.10)cycloalkenyl,
--(C.sub.8-C.sub.14)bicycloalkenyl,
--(C.sub.1-8--C.sub.14)tricycloalkenyl, -(3- to
7-membered)heterocycle, or -(7- to 10-membered)bicycloheterocycle,
each of which is unsubstituted or substituted with one or more
R.sub.5 groups.
20. The compound of claim 19, wherein R.sub.2 is
--(C.sub.1-C.sub.10)alkyl which is substituted with two R.sub.5
groups.
21. A composition comprising the compound or a pharmaceutically
acceptable salt of the compound of claim 1 and a pharmaceutically
acceptable carrier or excipient.
22. An in vitro method for inhibiting VR1 function in a cell
comprising: contacting a cell expressing VR1 in vitro with a
compound of claim 1, or a pharmaceutically acceptable salt thereof,
in an amount sufficient to reduce calcium ion mobilization into
said cell treated with an activator of VR1 as compared to said cell
expressing VR1 in vitro treated with an activator of VR1 and not
contacted with said compound.
23. The method of claim 22, wherein said calcium ion mobilization
is reduced by 50% or more.
24. A method for treating pain in an animal, comprising
administering to an animal in need thereof an effective amount of
the compound or a pharmaceutically acceptable salt of the compound
of claim 1.
25. A compound of formula: ##STR00114## or a pharmaceutically
acceptable salt thereof, wherein: Ar.sub.1 is ##STR00115## Ar.sub.2
is ##STR00116## X is O or S; R.sub.1 is -halo, --CH.sub.3,
--C(halo).sub.3, --CH(halo).sub.2, or --CH.sub.2(halo); each
R.sub.2 is independently: (a) -halo, --OH, --NH.sub.2, --CN, or
--NO.sub.2; (b) --(C.sub.1-C.sub.10)alkyl,
--(C.sub.2-C.sub.10)alkenyl, --(C.sub.2-C.sub.10)alkynyl,
--(C.sub.3-C.sub.10)cycloalkyl, --(C.sub.8-C.sub.14)bicycloalkyl,
--(C.sub.8-C.sub.14)tricycloalkyl,
--(C.sub.5-C.sub.10)cycloalkenyl,
--(C.sub.8-C.sub.14)bicycloalkenyl,
--(C.sub.8-C.sub.14)tricycloalkenyl, -(3- to
7-membered)heterocycle, or -(7- to 10-membered)bicycloheterocycle,
each of which is unsubstituted or substituted with one or more
R.sub.5 groups; or (c) -phenyl, -naphthyl, --(C.sub.14)aryl or -(5-
to 10-membered)heteroaryl, each of which is unsubstituted or
substituted with one or more R.sub.6 groups; each R.sub.3 is
independently: (a) -halo, --CN, --OH, --NO.sub.2, or --NH.sub.2;
(b) --(C.sub.1-C.sub.10)alkyl, --(C.sub.2-C.sub.10)alkenyl,
--(C.sub.2-C.sub.10)alkynyl, --(C.sub.3-C.sub.10)cycloalkyl,
--(C.sub.8-C.sub.14)bicycloalkyl,
--(C.sub.8-C.sub.14)tricycloalkyl,
--(C.sub.5-C.sub.10)cycloalkenyl,
--(C.sub.8-C.sub.14)bicycloalkenyl,
--(C.sub.8-C.sub.14)tricycloalkenyl, -(3- to
7-membered)heterocycle, or -(7- to 10-membered)bicycloheterocycle,
each of which is unsubstituted or substituted with one or more
R.sub.5 groups; or (c) -phenyl, -naphthyl, --(C.sub.14)aryl or -(5-
to 10-membered)heteroaryl, each of which is unsubstituted or
substituted with one or more R.sub.6 groups; each R.sub.5 is
independently --CN, --OH, --(C.sub.1-C.sub.6)alkyl,
--(C.sub.2-C.sub.6)alkenyl, -halo, --N.sub.3, --NO.sub.2,
--N(R.sub.7).sub.2, --CH.dbd.NR.sub.7, --NR.sub.7OH, --OR.sub.7,
--COR.sub.7, --C(O)OR.sub.7, --OC(O)R.sub.7, --OC(O)OR.sub.7,
--SR.sub.7, --S(O)R.sub.T, or --S(O).sub.2R.sub.7; each R.sub.6 is
independently --(C.sub.1-C.sub.6)alkyl, --(C.sub.2-C.sub.6)alkenyl,
--(C.sub.2-C.sub.6)alkynyl, --(C.sub.3-C.sub.8)cycloalkyl,
--(C.sub.5-C.sub.8)cycloalkenyl, -phenyl, -(3- to
5-membered)heterocycle, --C(halo).sub.3, --CH(halo).sub.2,
--CH.sub.2(halo), --CN, --OH, -halo, --N.sub.3, --NO.sub.2,
--N(R.sub.7).sub.2, --CH.dbd.NR.sub.7, --NR.sub.7OH, --OR.sub.7,
--COR.sub.7, --C(O)OR.sub.7, --OC(O)R.sub.7, --OC(O)OR.sub.7,
--SR.sub.7, --S(O)R.sub.B, or --S(O).sub.2R.sub.7; each R.sub.7 is
independently --H, --(C.sub.1-C.sub.6)alkyl,
--(C.sub.2-C.sub.6)alkenyl, --(C.sub.2-C.sub.6)alkynyl,
--(C.sub.3-C.sub.8)cycloalkyl, --(C.sub.5-C.sub.8)cycloalkenyl,
-phenyl, -(3- to 5-membered)heterocycle, --C(halo).sub.3,
--CH(halo).sub.2, or --CH.sub.2(halo); each R.sub.8 is
independently --(C.sub.1-C.sub.6)alkyl, --(C.sub.2-C.sub.6)alkenyl,
--(C.sub.2-C.sub.6)alkynyl, --(C.sub.3-C.sub.8)cycloalkyl,
--(C.sub.5-C.sub.8)cycloalkenyl, -phenyl, --C(halo).sub.3,
--CH(halo).sub.2, --CH.sub.2(halo), --CN, --OH, -halo, --N.sub.3,
--NO.sub.2, --N(R.sub.7).sub.2, --CH.dbd.NR.sub.7, --NR.sub.7OH,
--OR.sub.7, --COR.sub.7, --C(O)OR.sub.7, --OC(O)R.sub.7,
--OC(O)OR.sub.7, --SR.sub.7, --S(O)R.sub.B, or --S(O).sub.2R.sub.7;
each R.sub.11 is independently --(C.sub.1-C.sub.6)alkyl,
--(C.sub.2-C.sub.6)alkenyl, --(C.sub.2-C.sub.6)alkynyl,
--(C.sub.3-C.sub.8)cycloalkyl, --(C.sub.5-C.sub.8)cycloalkenyl,
-phenyl, --C(halo).sub.3, --CH(halo).sub.2, --CH.sub.2(halo), --CN,
--OH, -halo, --N.sub.3, --NO.sub.2, --N(R.sub.7).sub.2,
--CH.dbd.NR.sub.7, --NR.sub.7OH, --OR.sub.7, --COR.sub.7,
--C(O)OR.sub.7, --OC(O)R.sub.7, --OC(O)OR.sub.7, --SR.sub.7,
--S(O)R.sub.7, or --S(O).sub.2R.sub.7; each halo is independently
--F, --Cl, --Br, or --I; m is an integer ranging from 0 to 3; o is
an integer ranging from 0 to 4; p is an integer ranging from 0 to
2; q is an integer ranging from 0 to 6; r is an integer ranging
from 0 to 5; and s is an integer ranging from 0 to 4.
26. The compound of claim 25, wherein p is 1 and R.sub.2 is
--(C.sub.1-C.sub.10)alkyl, --(C.sub.2-C.sub.10)alkenyl,
--(C.sub.2-C.sub.10)alkynyl, --(C.sub.3-C.sub.10)cycloalkyl,
--(C.sub.8-C.sub.14)bicycloalkyl,
--(C.sub.8-C.sub.14)tricycloalkyl,
--(C.sub.5-C.sub.10)cycloalkenyl,
--(C.sub.8-C.sub.14)bicycloalkenyl,
--(C.sub.8-C.sub.14)tricycloalkenyl, -(3- to
7-membered)heterocycle, or -(7- to 10-membered)bicycloheterocycle,
each of which is unsubstituted or substituted with one or more
R.sub.5 groups.
27. The compound of claim 26, wherein R.sub.2 is
--(C.sub.1-C.sub.10)alkyl which is substituted with two R.sub.5
groups.
28. The compound of claim 25, wherein: Ar.sub.2 is ##STR00117## X
is O; and R.sub.1 is --F, --CH.sub.3 or --CF.sub.3.
29. The compound of claim 28, wherein p is 1 and R.sub.2 is
--(C.sub.1-C.sub.10)alkyl, --(C.sub.2-C.sub.10)alkenyl,
--(C.sub.2-C.sub.10)alkynyl, --(C.sub.3-C.sub.10)cycloalkyl,
--(C.sub.8-C.sub.14)bicycloalkyl,
--(C.sub.8-C.sub.14)tricycloalkyl,
--(C.sub.5-C.sub.10)cycloalkenyl,
--(C.sub.8-C.sub.14)bicycloalkenyl,
--(C.sub.8-C.sub.14)tricycloalkenyl, -(3- to
7-membered)heterocycle, or -(7- to 10-membered)bicycloheterocycle,
each of which is unsubstituted or substituted with one or more
R.sub.5 groups.
30. The compound of claim 29, wherein R.sub.2 is
--(C.sub.1-C.sub.10)alkyl which is substituted with two R.sub.5
groups.
31. The compound of claim 28, wherein: m is 0; r is 1; and R.sub.8
is --(C.sub.1-C.sub.6)alkyl, -halo, --OCF.sub.3, or --CF.sub.3.
32. The compound of claim 31, wherein p is 1 and R.sub.2 is
--(C.sub.1-C.sub.10)alkyl, --(C.sub.2-C.sub.10)alkenyl,
--(C.sub.2-C.sub.10)alkynyl, --(C.sub.3-C.sub.10)cycloalkyl,
--(C.sub.8-C.sub.14)bicycloalkyl,
--(C.sub.8-C.sub.14)tricycloalkyl,
--(C.sub.5-C.sub.10)cycloalkenyl,
--(C.sub.8-C.sub.14)bicycloalkenyl,
--(C.sub.8-C.sub.14)tricycloalkenyl, -(3- to
7-membered)heterocycle, or -(7- to 10-membered)bicycloheterocycle,
each of which is unsubstituted or substituted with one or more
R.sub.5 groups.
33. The compound of claim 32, wherein R.sub.2 is
--(C.sub.1-C.sub.10)alkyl which is substituted with two R.sub.5
groups.
34. The compound of claim 31, wherein the --(C.sub.1-C.sub.6)alkyl
is a tert-butyl group, optionally substituted at the para-position
of Ar.sub.2.
35. The compound of claim 25, wherein: Ar.sub.2 is ##STR00118## X
is 0; R.sub.1 is --CH.sub.3, --CF.sub.3, --Cl, --Br, --I, or --F; m
is 0; (R.sub.8).sub.a is --H; and (R.sub.8).sub.b is --H,
--CH.sub.3, --OCH.sub.3, --CF.sub.3, --OCF.sub.3,
--OCH.sub.2CH.sub.3, iso-propyl, tert-butyl, --Cl, --Br, --I, or
--F.
36. The compound of claim 35, wherein p is 1 and R.sub.2 is
--(C.sub.1-C.sub.10)alkyl, --(C.sub.2-C.sub.10)alkenyl,
--(C.sub.2-C.sub.10)alkynyl, --(C.sub.3-C.sub.10)cycloalkyl,
--(C.sub.8-C.sub.14)bicycloalkyl,
--(C.sub.8-C.sub.14)tricycloalkyl,
--(C.sub.5-C.sub.10)cycloalkenyl,
--(C.sub.8-C.sub.14)bicycloalkenyl,
--(C.sub.8-C.sub.14)tricycloalkenyl, -(3- to
7-membered)heterocycle, or -(7- to 10-membered)bicycloheterocycle,
each of which is unsubstituted or substituted with one or more
R.sub.5 groups.
37. The compound of claim 36, wherein R.sub.2 is
--(C.sub.1-C.sub.10)alkyl which is substituted with two R.sub.5
groups.
38. The compound of claim 35, wherein R.sub.1 is --CH.sub.3,
--CF.sub.3, or --Cl and (R.sub.8).sub.b is --Cl, --F, --CF.sub.3,
--OCF.sub.3 or tert-butyl.
39. The compound of claim 25, wherein: Ar.sub.2 is ##STR00119## X
is O; and R.sub.1 is --F, --Cl, --CH.sub.3 or --CF.sub.3.
40. The compound of claim 39, wherein p is 1 and R.sub.2 is
--(C.sub.1-C.sub.10)alkyl, --(C.sub.2-C.sub.10)alkenyl,
--(C.sub.2-C.sub.10)alkynyl, --(C.sub.3-C.sub.10)cycloalkyl,
--(C.sub.8-C.sub.14)bicycloalkyl,
--(C.sub.8-C.sub.14)tricycloalkyl,
--(C.sub.5-C.sub.10)cycloalkenyl,
--(C.sub.8-C.sub.14)bicycloalkenyl,
--(C.sub.8-C.sub.14)tricycloalkenyl, -(3- to
7-membered)heterocycle, or -(7- to 10-membered)bicycloheterocycle,
each of which is unsubstituted or substituted with one or more
R.sub.5 groups.
41. The compound of claim 40, wherein R.sub.2 is
--(C.sub.1-C.sub.10)alkyl which is substituted with two R.sub.5
groups.
42. The compound of claim 39, wherein: m is 0; o is 1; and R.sub.8
is --(C.sub.1-C.sub.6)alkyl or -halo.
43. The compound of claim 42, wherein p is 1 and R.sub.2 is
--(C.sub.1-C.sub.10)alkyl, --(C.sub.2-C.sub.10)alkenyl,
--(C.sub.2-C.sub.10)alkynyl, --(C.sub.3-C.sub.10)cycloalkyl,
--(C.sub.8-C.sub.14)bicycloalkyl,
--(C.sub.8-C.sub.14)tricycloalkyl,
--(C.sub.5-C.sub.10)cycloalkenyl,
--(C.sub.8-C.sub.14)bicycloalkenyl, --(C.sub.r
C.sub.14)tricycloalkenyl, -(3- to 7-membered)heterocycle, or -(7-
to 10-membered)bicycloheterocycle, each of which is unsubstituted
or substituted with one or more R.sub.5 groups.
44. The compound of claim 43, wherein R.sub.2 is
--(C.sub.1-C.sub.10)alkyl which is substituted with two R.sub.5
groups.
45. A composition comprising the compound or a pharmaceutically
acceptable salt of the compound of claim 25 and a pharmaceutically
acceptable carrier or excipient.
46. An in vitro method for inhibiting VR1 function in a cell
comprising: contacting a cell expressing VR1 in vitro with a
compound of claim 25, or a pharmaceutically acceptable salt
thereof, in an amount sufficient to reduce calcium ion mobilization
into said cell treated with an activator of VR1 as compared to said
cell expressing VR1 in vitro treated with an activator of VR1 and
not contacted with said compound.
47. The method of claim 46, wherein said calcium ion mobilization
is reduced by 50% or more.
48. A method for treating pain in an animal, comprising
administering to an animal in need thereof an effective amount of
the compound or a pharmaceutically acceptable salt of the compound
of claim 25.
Description
[0001] This application claims the benefit of U.S. provisional
application No. 60/504,730, filed Sep. 22, 2003, and International
patent application no. PCT/US2004/030825, filed Sep. 21, 2004, the
disclosure of each application being incorporated by reference
herein in its entirety.
1. FIELD OF THE INVENTION
[0002] The present invention relates to Pyridylene Compounds,
compositions comprising an effective amount of a Pyridylene
Compound and methods for treating or preventing a Condition such as
pain comprising administering to an animal in need thereof an
effective amount of a Pyridylene Compound.
2. BACKGROUND OF THE INVENTION
[0003] Pain is the most common symptom for which patients seek
medical advice and treatment. Pain can be acute or chronic. While
acute pain is usually self-limited, chronic pain persists for 3
months or longer and can lead to significant changes in a patient's
personality, lifestyle, functional ability and overall quality of
life (K. M. Foley, Pain, in Cecil Textbook of Medicine 100-107 (J.
C. Bennett and F. Plum eds., 20th ed. 1996)).
[0004] Moreover, chronic pain can be classified as either
nociceptive or neuropathic. Nociceptive pain includes tissue
injury-induced pain and inflammatory pain such as that associated
with arthritis. Neuropathic pain is caused by damage to the
peripheral or central nervous system and is maintained by aberrant
somatosensory processing. There is a large body of evidence
relating activity at both Group I mGluRs (mGluR1 and mGluR5) (M. E.
Fundytus, CNS Drugs 15:29-58 (2001)) and vanilloid receptors (VR1)
(V. Di Marzo et al., Current Opinion in Neurobiology 12:372-379
(2002)) to pain processing. Inhibiting mGluR1 or mGluR5 reduces
pain, as shown by in vivo treatment with antibodies selective for
either mGluR1 or mGluR5, where neuropathic pain in rats was
attenuated (M. E. Fundytus et al., NeuroReport 9:731-735 (1998)).
It has also been shown that antisense oligonucleotide knockdown of
mGluR1 alleviates both neuropathic and inflammatory pain (M. E.
Fundytus et al., British Journal of Pharmacology 132:354-367
(2001); M. E. Fundytus et al., Pharmacology, Biochemistry &
Behavior 73:401-410 (2002)). Small molecule antagonists for
mGluR5-attenuated pain in in vivo animal models are disclosed in,
e.g., K. Walker et al., Neuropharmacology 40:1-9 (2000) and A.
Dogrul et al., Neuroscience Letters 292:115-118 (2000)).
[0005] Nociceptive pain has been traditionally managed by
administering non-opioid analgesics, such as acetylsalicylic acid,
choline magnesium trisalicylate, acetaminophen, ibuprofen,
fenoprofen, diflusinal, and naproxen; or opioid analgesics,
including morphine, hydromorphone, methadone, levorphanol,
fentanyl, oxycodone, and oxymorphone. Id. In addition to the
above-listed treatments, neuropathic pain, which can be difficult
to treat, has also been treated with anti-epileptics (e.g.,
gabapentin, carbamazepine, valproic acid, topiramate, phenyloin),
NMDA antagonists (e.g., ketamine, dextromethorphan), topical
lidocaine (for post-herpetic neuralgia), and tricyclic
antidepressants (e.g., fluoxetine, sertraline and
amitriptyline).
[0006] Pain has been traditionally managed by administering
non-opioid analgesics, such as acetylsalicylic acid, choline
magnesium trisalicylate, acetaminophen, ibuprofen, fenoprofen,
diflusinal, and naproxen; or opioid analgesics, including morphine,
hydromorphone, methadone, levorphanol, fentanyl, oxycodone, and
oxymorphone. Id.
[0007] Urinary incontinence ("UI") is uncontrollable urination,
generally caused by bladder-detrusor-muscle instability. UI affects
people of all ages and levels of physical health, both in health
care settings and in the community at large. Physiologic bladder
contraction results in large part from acetylcholine-induced
stimulation of post-ganglionic muscarinic-receptor sites on bladder
smooth muscle. Treatments for UI include the administration of
drugs having bladder-relaxant properties, which help to control
bladder-detrusor-muscle overactivity. For example, anticholinergics
such as propantheline bromide and glycopyrrolate, and combinations
of smooth-muscle relaxants such as a combination of racemic
oxybutynin and dicyclomine or an anticholinergic, have been used to
treat UI (See, e.g., A. J. Wein, Urol. Clin. N. Am. 22:557-577
(1995); Levin et al., J. Urol. 128:396-398 (1982); Cooke et al., S.
Afr. Med. J. 63:3 (1983); R. K. Mirakhur et al, Anaesthesia
38:1195-1204 (1983)). These drugs are not effective, however, in
all patients having uninhibited bladder contractions.
Administration of anticholinergic medications represent the
mainstay of this type of treatment.
[0008] None of the existing commercial drug treatments for UI has
achieved complete success in all classes of UI patients, nor has
treatment occurred without significant adverse side effects. For
example, drowsiness, dry mouth, constipation, blurred vision,
headaches, tachycardia, and cardiac arrhythmia, which are related
to the anticholinergic activity of traditional anti-UI drugs, can
occur frequently and adversely affect patient compliance. Yet
despite the prevalence of unwanted anticholinergic effects in many
patients, anticholinergic drugs are currently prescribed for
patients having UI. The Merck Manual of Medical Information 631-634
(R. Berkow ed., 1997).
[0009] About 1 in 10 people develop an ulcer. Ulcers develop as a
result of an imbalance between acid-secretory factors, also known
as "aggressive factors," such as stomach acid, pepsin, and
Helicobacter pylori infection, and local mucosal-protective
factors, such as secretion of bicarbonate, mucus, and
prostaglandins.
[0010] Treatment of ulcers typically involves reducing or
inhibiting the aggressive factors. For example, antacids such as
aluminum hydroxide, magnesium hydroxide, sodium bicarbonate, and
calcium bicarbonate can be used to neutralize stomach acids.
Antacids, however, can cause alkalosis, leading to nausea,
headache, and weakness. Antacids can also interfere with the
absorption of other drugs into the blood stream and cause
diarrhea.
[0011] H.sub.2 antagonists, such as cimetidine, ranitidine,
famotidine, and nizatidine, are also used to treat ulcers. H.sub.2
antagonists promote ulcer healing by reducing gastric acid and
digestive-enzyme secretion elicited by histamine and other H.sub.2
agonists in the stomach and duodenum. H.sub.2 antagonists, however,
can cause breast enlargement and impotence in men, mental changes
(especially in the elderly), headache, dizziness, nausea, myalgia,
diarrhea, rash, and fever.
[0012] H.sup.+, K.sup.+ATPase inhibitors such as omeprazole and
lansoprazole are also used to treat ulcers. H.sup.+, K.sup.+ATPase
inhibitors inhibit the production of enzymes used by the stomach to
secrete acid. Side effects associated with H.sup.+, K.sup.+ATPase
inhibitors include nausea, diarrhea, abdominal colic, headache,
dizziness, somnolence, skin rashes, and transient elevations of
plasma activities of aminotransferases.
[0013] Sucraflate is also used to treat ulcers. Sucraflate adheres
to epithelial cells and is believed to form a protective coating at
the base of an ulcer to promote healing. Sucraflate, however, can
cause constipation, dry mouth, and interfere with the absorption of
other drugs.
[0014] Antibiotics are used when Helicobacter pylori is the
underlying cause of the ulcer. Often antibiotic therapy is coupled
with the administration of bismuth compounds such as bismuth
subsalicylate and colloidal bismuth citrate. The bismuth compounds
are believed to enhance secretion of mucous and HCO.sub.3.sup.-,
inhibit pepsin activity, and act as an antibacterial against H.
pylori. Ingestion of bismuth compounds, however, can lead to
elevated plasma concentrations of Bi.sup.+3 and can interfere with
the absorption of other drugs.
[0015] Prostaglandin analogues, such as misoprostal, inhibit
secretion of acid and stimulate the secretion of mucous and
bicarbonate and are also used to treat ulcers, especially ulcers in
patients who require nonsteroidal anti-inflammatory drugs.
Effective oral doses of prostaglandin analogues, however, can cause
diarrhea and abdominal cramping. In addition, some prostaglandin
analogues are abortifacients.
[0016] Carbenoxolone, a mineral corticoid, can also be used to
treat ulcers. Carbenoxolone appears to alter the composition and
quantity of mucous, thereby enhancing the mucosal barrier.
Carbenoxolone, however, can lead to Na.sup.+ and fluid retention,
hypertension, hypokalemia, and impaired glucose tolerance.
[0017] Muscarinic cholinergic antagonists such as pirenzapine and
telenzapine can also be used to reduce acid secretion and treat
ulcers. Side effects of muscarinic cholinergic antagonists include
dry mouth, blurred vision, and constipation. The Merck Manual of
Medical Information 496-500 (R. Berkow ed., 1997) and Goodman and
Gilman's The Pharmacological Basis of Therapeutics 901-915 (J.
Hardman and L. Limbird eds., 9.sup.th ed. 1996).
[0018] Inflammatory-bowel disease ("IBD") is a chronic disorder in
which the bowel becomes inflamed, often causing recurring abdominal
cramps and diarrhea. The two types of IBD are Crohn's disease and
ulcerative colitis.
[0019] Crohn's disease, which can include regional enteritis,
granulomatous ileitis, and ileocolitis, is a chronic inflammation
of the intestinal wall. Crohn's disease occurs equally in both
sexes and is more common in Jews of eastern-European ancestry. Most
cases of Crohn's disease begin before age 30 and the majority start
between the ages of 14 and 24. The disease typically affects the
full thickness of the intestinal wall. Generally the disease
affects the lowest portion of the small intestine (ileum) and the
large intestine, but can occur in any part of the digestive
tract.
[0020] Early symptoms of Crohn's disease are chronic diarrhea,
crampy abdominal pain, fever, loss of appetite, and weight loss.
Complications associated with Crohn's disease include the
development of intestinal obstructions, abnormal connecting
channels (fistulas), and abscesses. The risk of cancer of the large
intestine is increased in people who have Crohn's disease. Often
Crohn's disease is associated with other disorders such as
gallstones, inadequate absorption of nutrients, amyloidosis,
arthritis, episcleritis, aphthous stomatitis, erythema nodosum,
pyoderma gangrenosum, ankylosing spondylitis, sacroilitis, uveitis,
and primary sclerosing cholangitis. There is no known cure for
Crohn's disease.
[0021] Cramps and diarrhea, side effects associated with Crohn's
disease, can be relieved by anticholinergic drugs, diphenoxylate,
loperamide, deodorized opium tincture, or codeine. Generally, the
drug is taken orally before a meal.
[0022] Broad-spectrum antibiotics are often administered to treat
the symptoms of Crohn's disease. The antibiotic metronidazole is
often administered when the disease affects the large intestine or
causes abscesses and fistulas around the anus. Long-term use of
metronidazole, however, can damage nerves, resulting in
pins-and-needles sensations in the arms and legs. Sulfasalazine and
chemically related drugs can suppress mild inflammation, especially
in the large intestine. These drugs, however, are less effective in
sudden, severe flare-ups. Corticosteroids, such as prednisone,
reduce fever and diarrhea and relieve abdominal pain and
tenderness. Long-term corticosteroid therapy, however, invariably
results in serious side effects such as high blood-sugar levels,
increased risk of infection, osteoporosis, water retention, and
fragility of the skin. Drugs such as azathioprine and mercaptourine
can compromise the immune system and are often effective for
Crohn's disease in patients that do not respond to other drugs.
These drugs, however, usually need 3 to 6 months before they
produce benefits and can cause serious side effects such as
allergy, pancreatitis, and low white-blood-cell count.
[0023] When Crohn's disease causes the intestine to be obstructed
or when abscesses or fistulas do not heal, surgery can be necessary
to remove diseased sections of the intestine. Surgery, however,
does not cure the disease, and inflammation tends to recur where
the intestine is rejoined. In almost half of the cases a second
operation is needed. The Merck Manual of Medical Information
528-530 (R. Berkow ed., 1997).
[0024] Ulcerative colitis is a chronic disease in which the large
intestine becomes inflamed and ulcerated, leading to episodes of
bloody diarrhea, abdominal cramps, and fever. Ulcerative colitis
usually begins between ages 15 and 30; however, a small group of
people have their first attack between ages 50 and 70. Unlike
Crohn's disease, ulcerative colitis never affects the small
intestine and does not affect the full thickness of the intestine.
The disease usually begins in the rectum and the sigmoid colon and
eventually spreads partially or completely throughout the large
intestine. The cause of ulcerative colitis is unknown. Treatment of
ulcerative colitis is directed to controlling inflammation,
reducing symptoms, and replacing lost fluids and nutrients.
[0025] Irritable-bowel syndrome ("IBS") is a disorder of motility
of the entire gastrointestinal tract, causing abdominal pain,
constipation, and/or diarrhea. IBS affects three-times more men
than women.
[0026] There are two major types of IBS. The first type,
spastic-colon type, is commonly triggered by eating, and usually
produces periodic constipation and diarrhea with pain. Mucous often
appears in the stool. The pain can come in bouts of continuous dull
aching pain or cramps, usually in the lower abdomen. The person
suffering from spastic-colon type IBS can also experience bloating,
gas, nausea, headache, fatigue, depression, anxiety, and difficulty
concentrating. The second type of IBS usually produces painless
diarrhea or constipation. The diarrhea can begin suddenly and with
extreme urgency. Often the diarrhea occurs soon after a meal and
can sometimes occur immediately upon awakening.
[0027] Treatment of IBS typically involves modification of an
IBS-patient's diet. Often it is recommended that an IBS patient
avoid beans, cabbage, sorbitol, and fructose. A low-fat, high-fiber
diet can also help some IBS patients. Regular physical activity can
also help keep the gastrointestinal tract functioning properly.
Drugs such as propantheline that slow the function of the
gastrointestinal tract are generally not effective for treating
IBS. Antidiarrheal drugs, such as diphenoxylate and loperamide,
help with diarrhea. The Merck Manual of Medical Information 525-526
(R. Berkow ed., 1997).
[0028] Certain pharmaceutical agents have been administered for
treating addiction. U.S. Pat. No. 5,556,838 to Mayer et al.
discloses the use of nontoxic NMDA-blocking agents co-administered
with an addictive substance to prevent the development of tolerance
or withdrawal symptoms. U.S. Pat. No. 5,574,052 to Rose et al.
discloses co-administration of an addictive substance with an
antagonist to partially block the pharmacological effects of the
addictive substance. U.S. Pat. No. 5,075,341 to Mendelson et al.
discloses the use of a mixed opiate agonist/antagonist to treat
cocaine and opiate addiction. U.S. Pat. No. 5,232,934 to Downs
discloses administration of 3-phenoxypyridine to treat addiction.
U.S. Pat. Nos. 5,039,680 and 5,198,459 to Imperato et al. disclose
using a serotonin antagonist to treat chemical addiction. U.S. Pat.
No. 5,556,837 to Nestler et. al. discloses infusing BDNF or NT-4
growth factors to inhibit or reverse neurological adaptive changes
that correlate with behavioral changes in an addicted individual.
U.S. Pat. No. 5,762,925 to Sagan discloses implanting encapsulated
adrenal medullary cells into an animal's central nervous system to
inhibit the development of opioid intolerance. U.S. Pat. No.
6,204,284 to Beer et al. discloses racemic
(.+-.)-1-(3,4-dichlorophenyl)-3-azabicyclo[3.1.0]hexane for use in
the prevention or relief of a withdrawal syndrome resulting from
addiction to drugs and for the treatment of chemical
dependencies.
[0029] Without treatment, Parkinson's disease progresses to a rigid
akinetic state in which patients are incapable of caring for
themselves. Death frequently results from complications of
immobility, including aspiration pneumonia or pulmonary embolism.
Drugs commonly used for the treatment of Parkinson's disease
include carbidopa/levodopa, pergolide, bromocriptine, selegiline,
amantadine, and trihexyphenidyl hydrochloride. There remains,
however, a need for drugs useful for the treatment of Parkinson's
disease and having an improved therapeutic profile.
[0030] Anxiety is a fear, apprehension or dread of impending danger
often accompanied by restlessness, tension, tachycardia and
dyspnea. Currently, benzodiazepines are the most commonly used
anti-anxiety agents for generalized anxiety disorder.
Benzodiazepines, however, carry the risk of producing impairment of
cognition and skilled motor functions, particularly in the elderly,
which can result in confusion, delerium, and falls with fractures.
Sedatives are also commonly prescribed for treating anxiety. The
azapirones, such as buspirone, are also used to treat moderate
anxiety. The azapirones, however, are less useful for treating
severe anxiety accompanied with panic attacks.
[0031] Epilepsy is a disorder characterized by the tendency to have
recurring seizures. Examples of drugs for treating a seizure and
epilepsy include carbamazepine, ethosuximide, gabapentin,
lamotrigine, phenobarbital, phenyloin, primidone, valproic acid,
trimethadione, benzodiazepines, .gamma.-vinyl GABA, acetazolamide,
and felbamate. Anti-seizure drugs, however, can have side effects
such as drowsiness; hyperactivity; hallucinations; inability to
concentrate; central and peripheral nervous system toxicity, such
as nystagmus, ataxia, diplopia, and vertigo; gingival hyperplasia;
gastrointestinal disturbances such as nausea, vomiting, epigastric
pain, and anorexia; endocrine effects such as inhibition of
antidiuretic hormone, hyperglycemia, glycosuria, osteomalacia; and
hypersensitivity such as scarlatiniform rash, morbilliform rash,
Stevens-Johnson syndrome, systemic lupus erythematosus, and hepatic
necrosis; and hematological reactions such as red-cell aplasia,
agranulocytosis, thrombocytopenia, aplastic anemia, and
megaloblastic anemia. The Merck Manual of Medical Information
345-350 (R. Berkow ed., 1997).
[0032] Symptoms of strokes vary depending on what part of the brain
is affected. Symptoms include loss or abnormal sensations in an arm
or leg or one side of the body, weakness or paralysis of an arm or
leg or one side of the body, partial loss of vision or hearing,
double vision, dizziness, slurred speech, difficulty in thinking of
the appropriate word or saying it, inability to recognize parts of
the body, unusual movements, loss of bladder control, imbalance,
and falling, and fainting. The symptoms can be permanent and can be
associated with coma or stupor. Examples of drugs for treating
strokes include anticoagulants such as heparin, drugs that break up
clots such as streptokinase or tissue plasminogen activator, and
drugs that reduce swelling such as mannitol or corticosteroids. The
Merck Manual of Medical Information 352-355 (R. Berkow ed.,
1997).
[0033] Pruritus is an unpleasant sensation that prompts scratching.
Conventionally, pruritus is treated by phototherapy with
ultraviolet B or PUVA or with therapeutic agents such as
naltrexone, nalmefene, danazol, tricyclics, and
antidepressants.
[0034] Selective antagonists of the metabotropic glutamate receptor
5 ("mGluR5") have been shown to exert analgesic activity in in vivo
animal models (K. Walker et al., Neuropharmacology 40:1-9 (2000)
and A. Dogrul et al., Neuroscience Letters, 292(2):115-118
(2000)).
[0035] Selective antagonists of the mGluR5 receptor have also been
shown to exert anxiolytic and anti-depressant activity in in vivo
animal models (E. Tatarczynska et al., Br. J. Pharmacol.
132(7):1423-1430 (2001) and P. J. M. Will et al., Trends in
Pharmacological Sciences 22(7):331-37 (2001)).
[0036] Selective antagonists of the mGluR5 receptor have also been
shown to exert anti-Parkinson activity in vivo (K. J. Ossowska et
al., Neuropharmacology 41(4):413-20 (2001) and P. J. M. Will et
al., Trends in Pharmacological Sciences 22(7):331-37 (2001)).
[0037] Selective antagonists of the mGluR5 receptor have also been
shown to exert anti-dependence activity in vivo (C. Chiamulera et
al., Nature Neuroscience 4(9):873-74 (2001)).
[0038] U.S. Pat. No. 6,495,550 to McNaughton-Smith et al. discloses
pyridine substituted benzanilides useful as openers of potassium
ion channels.
[0039] International publication no. WO 94/05153 discloses
substituted benzene compounds useful as herbicides.
[0040] International publication no. WO 04/058762 discloses
substituted 9-membered bicyclic compounds useful as MK-2
inhibitors.
[0041] United Kingdom Application No. GB 2 276 162 discloses
aniline and benzanilide compounds useful for treating disorders of
the central nervous system, endocrine disorders, and sexual
dysfunction.
[0042] United Kingdom Application No. GB 2 276 163 discloses
pyridine compounds useful for treating disorders of the central
nervous system, endocrine disorders, and sexual dysfunction.
[0043] European Application No. EP 533267 discloses benzanilide
compounds useful as 5-HT1D antagonists.
[0044] There remains a need in the art for compounds useful for
treating or preventing pain, UI, an ulcer, IBD, IBS, an addictive
disorder, Parkinson's disease, parkinsonism, anxiety, epilepsy,
stroke, a seizure, a pruritic condition, psychosis, a cognitive
disorder, a memory deficit, restricted brain function, Huntington's
chorea, amyotrophic lateral sclerosis, dementia, retinopathy, a
muscle spasm, a migraine, vomiting, dyskinesia, or depression in an
animal.
[0045] Citation of any reference in Section 2 of this application
is not to be construed as an admission that such reference is prior
art to the present application.
3. SUMMARY OF THE INVENTION
[0046] The present invention encompasses compounds of formula
(I):
##STR00002##
and pharmaceutically acceptable salts thereof, where
[0047] Ar.sub.1 is
##STR00003##
[0048] Ar.sub.2 is
##STR00004##
[0049] X is O or S;
[0050] R.sub.1 is -halo, --CH.sub.3, --C(halo).sub.3,
--CH(halo).sub.2, or --CH.sub.2(halo);
[0051] each R.sub.2 is independently: [0052] (a) -halo, --OH,
--NH.sub.2, --CN, or --NO.sub.2; [0053] (b)
-(C.sub.1-C.sub.10)alkyl, --(C.sub.2-C.sub.10)alkenyl,
--(C.sub.2-C.sub.10)alkynyl, --(C.sub.3-C.sub.10)cycloalkyl,
--(C.sub.8-C.sub.14)bicycloalkyl,
--(C.sub.8-C.sub.14)tricycloalkyl,
--(C.sub.5-C.sub.10)cycloalkenyl,
--(C.sub.8-C.sub.14)bicycloalkenyl,
--(C.sub.8-C.sub.14)tricycloalkenyl, -(3- to
7-membered)heterocycle, or -(7- to 10-membered)bicycloheterocycle,
each of which is unsubstituted or substituted with one or more
R.sub.5 groups; or [0054] (c) -phenyl, -naphthyl, --(C.sub.14)aryl
or -(5- to 10-membered)heteroaryl, each of which is unsubstituted
or substituted with one or more R.sub.6 groups;
[0055] each R.sub.3 is independently: [0056] (a) -halo, --CN, --OH,
--NO.sub.2, or --NH.sub.2; [0057] (b) -(C.sub.1-C.sub.10)alkyl,
--(C.sub.2-C.sub.10)alkenyl, --(C.sub.2-C.sub.10)alkynyl,
--(C.sub.3-C.sub.10)cycloalkyl, --(C.sub.8-C.sub.14)bicycloalkyl,
--(C.sub.8-C.sub.14)tricycloalkyl,
--(C.sub.5-C.sub.10)cycloalkenyl,
--(C.sub.8-C.sub.14)bicycloalkenyl,
(C.sub.8-C.sub.14)tricycloalkenyl, -(3- to 7-membered)heterocycle,
or -(7- to 10-membered)bicycloheterocycle, each of which is
unsubstituted or substituted with one or more R.sub.5 groups; or
[0058] (c) -phenyl, -naphthyl, --(C.sub.14)aryl or -(5- to
10-membered) heteroaryl, each of which is unsubstituted or
substituted with one or more R.sub.6 groups;
[0059] each R.sub.5 is independently --CN, --OH,
--(O--C.sub.6)alkyl, --(C.sub.2-C.sub.6)alkenyl, -halo, --N.sub.3,
--NO.sub.2, --N(R.sub.7).sub.2, --CH.dbd.NR.sub.7, --NR.sub.7OH,
--OR.sub.7, --COR.sub.7, --C(O)OR.sub.7, --OC(O)R.sub.7,
--OC(O)OR.sub.7, --SR.sub.7, --S(O)R.sub.7, or
--S(O).sub.2R.sub.7;
[0060] each R.sub.6 is independently --(C.sub.1-C.sub.6)alkyl,
--(C.sub.2-C.sub.6)alkenyl, --(C.sub.2-C.sub.6)alkynyl,
--(C.sub.3-C.sub.8)cycloalkyl, --(C.sub.5-C.sub.8)cycloalkenyl,
-phenyl, -(3- to 5-membered)heterocycle, --C(halo).sub.3,
--CH(halo).sub.2, --CH.sub.2(halo), --CN, --OH, -halo, --N.sub.3,
--NO.sub.2, N(R.sub.7).sub.2, --CH.dbd.NR.sub.7, --NR.sub.7OH,
--OR.sub.7, --COR.sub.7, --C(O)OR.sub.7, --OC(O)R.sub.7,
--OC(O)OR.sub.7, --SR.sub.7, --S(O)R.sub.7, or
--S(O).sub.2R.sub.7;
[0061] each R.sub.7 is independently --H, --(C.sub.1-C.sub.6)alkyl,
--(C.sub.2-C.sub.6)alkenyl, --(C.sub.2-C.sub.6)alkynyl,
--(C.sub.3-C.sub.8)cycloalkyl, --(C.sub.5-C.sub.8)cycloalkenyl,
-phenyl, -(3- to 5-membered)heterocycle, --C(halo).sub.3,
--CH(halo).sub.2, or CH.sub.2(halo);
[0062] each R.sub.8 is independently --(C.sub.1-C.sub.6)alkyl,
--(C.sub.2-C.sub.6)alkenyl, --(C.sub.2-C.sub.6)alkynyl,
--(C.sub.3-C.sub.8)cycloalkyl, --(C.sub.5-C.sub.8)cycloalkenyl,
-phenyl, --C(halo).sub.3, --CH(halo).sub.2, --CH.sub.2(halo), --CN,
--OH, -halo, --N.sub.3, --NO.sub.2, --N(R.sub.7).sub.2,
--CH.dbd.NR.sub.7, --NR.sub.7OH, --OR.sub.7, --COR.sub.7,
--C(O)OR.sub.7, --OC(O)R.sub.7, --OC(O)OR.sub.7, --SR.sub.7,
--S(O)R.sub.7, or --S(O).sub.2R.sub.7;
[0063] each R.sub.11 is independently --(C.sub.1-C.sub.6)alkyl,
--(C.sub.2-C.sub.6)alkenyl, --(C.sub.2-C.sub.6)alkynyl,
(C.sub.3-C.sub.8)cycloalkyl, --(C.sub.5-C.sub.8)cycloalkenyl,
-phenyl, --C(halo).sub.3, --CH(halo).sub.2, --CH.sub.2(halo), --CN,
--OH, -halo, --N.sub.3, --NO.sub.2, --N(R.sub.7).sub.2,
--CH.dbd.NR.sub.7, --NR.sub.7OH, --OR.sub.7, --COR.sub.7,
--C(O)OR.sub.7, --OC(O)R.sub.7, --OC(O)OR.sub.7, --SR.sub.7,
--S(O)R.sub.7, or --S(O).sub.2R.sub.7;
[0064] each halo is independently --F, --Cl, --Br, or --I;
[0065] m is an integer ranging from 0 to 3;
[0066] n is an integer ranging from 0 to 3;
[0067] o is an integer ranging from 0 to 4;
[0068] p is an integer ranging from 0 to 2;
[0069] q is an integer ranging from 0 to 6;
[0070] r is an integer ranging from 0 to 5; and
[0071] s is an integer ranging from 0 to 4.
[0072] The invention further encompasses compounds of formula
(II):
##STR00005##
and pharmaceutically acceptable salts thereof, where
[0073] Ar.sub.1 is
##STR00006##
[0074] Ar.sub.2 is
##STR00007##
[0075] X is O or S;
[0076] R.sub.1 is -halo, --CH.sub.3, --C(halo).sub.3,
--CH(halo).sub.2, or --CH.sub.2(halo);
[0077] each R.sub.2 is independently: [0078] (a) -halo, --OH,
--NH.sub.2, --CN, or --NO.sub.2; [0079] (b)
-(C.sub.1-C.sub.10)alkyl, --(C.sub.2-C.sub.10)alkenyl,
--(C.sub.2-C.sub.10)alkynyl, --(C.sub.3-C.sub.10)cycloalkyl,
--(C.sub.8-C.sub.14)bicycloalkyl,
--(C.sub.8-C.sub.14)tricycloalkyl,
--(C.sub.5-C.sub.10)cycloalkenyl,
--(C.sub.8-C.sub.14)bicycloalkenyl,
--(C.sub.8-C.sub.14)tricycloalkenyl, -(3- to
7-membered)heterocycle, or -(7- to 10-membered)bicycloheterocycle,
each of which is unsubstituted or substituted with one or more
R.sub.5 groups; or [0080] (c) -phenyl, -naphthyl, --(C.sub.14)aryl
or -(5- to 10-membered)heteroaryl, each of which is unsubstituted
or substituted with one or more R.sub.6 groups;
[0081] each R.sub.3 is independently: [0082] (a) -halo, --CN, --OH,
--NO.sub.2, or --NH.sub.2; [0083] (b) -(C.sub.2-C.sub.10)alkenyl,
--(C.sub.2-C.sub.10)alkynyl, --(C.sub.3-C.sub.10)cycloalkyl,
--(C.sub.8-C.sub.14)bicycloalkyl,
--(C.sub.8-C.sub.14)tricycloalkyl,
--(C.sub.5-C.sub.10)cycloalkenyl,
--(C.sub.8-C.sub.14)bicycloalkenyl,
(C.sub.8-C.sub.14)tricycloalkenyl, -(3- to 7-membered)heterocycle,
or -(7- to 10-membered)bicycloheterocycle, each of which is
unsubstituted or substituted with one or more R.sub.5 groups; or
[0084] (c) -phenyl, -naphthyl, --(C.sub.14)aryl or -(5- to
10-membered) heteroaryl, each of which is unsubstituted or
substituted with one or more R.sub.6 groups;
[0085] each R.sub.5 is independently --CN, --OH,
--(C.sub.1-C.sub.6)alkyl, --(C.sub.2-C.sub.6)alkenyl, -halo,
--N.sub.3, --NO.sub.2, --N(R.sub.7).sub.2, --CH.dbd.NR.sub.7,
--NR.sub.7OH, --OR.sub.7, --COR.sub.7, --C(O)OR.sub.7,
--OC(O)R.sub.7, --OC(O)OR.sub.7, --SR.sub.7, --S(O)R.sub.7, or
--S(O).sub.2R.sub.7;
[0086] each R.sub.6 is independently --(C.sub.1-C.sub.6)alkyl,
--(C.sub.2-C.sub.6)alkenyl, --(C.sub.2-C.sub.6)alkynyl,
--(C.sub.3-C.sub.8)cycloalkyl, --(C.sub.5-C.sub.8)cycloalkenyl,
-phenyl, -(3- to 5-membered)heterocycle, --C(halo).sub.3,
--CH(halo).sub.2, --CH.sub.2(halo), --CN, --OH, -halo, --N.sub.3,
--NO.sub.2, N(R.sub.7).sub.2, --CH.dbd.NR.sub.7, --NR.sub.7OH,
--OR.sub.7, --COR.sub.7, --C(O)OR.sub.7, --OC(O)R.sub.7,
--OC(O)OR.sub.7, --SR.sub.7, --S(O)R.sub.7, or
--S(O).sub.2R.sub.7;
[0087] each R.sub.7 is independently --H, --(C.sub.1-C.sub.6)alkyl,
--(C.sub.2-C.sub.6)alkenyl, --(C.sub.2-C.sub.6)alkynyl,
--(C.sub.3-C.sub.8)cycloalkyl, --(C.sub.5-C.sub.8)cycloalkenyl,
-phenyl, -(3- to 5-membered)heterocycle, --C(halo).sub.3,
--CH(halo).sub.2, or CH.sub.2(halo);
[0088] each R.sub.8 is independently --(C.sub.1-C.sub.6)alkyl,
--(C.sub.2-C.sub.6)alkenyl, --(C.sub.2-C.sub.6)alkynyl,
--(C.sub.3-C.sub.8)cycloalkyl, --(C.sub.5-C.sub.8)cycloalkenyl,
-phenyl, --C(halo).sub.3, --CH(halo).sub.2, --CH.sub.2(halo), --CN,
OH, -halo, --N.sub.3, --NO.sub.2, --N(R.sub.7).sub.2,
--CH.dbd.NR.sub.7, --NR.sub.7OH, --OR.sub.7, --COR.sub.7,
--C(O)OR.sub.7, --OC(O)R.sub.7, --OC(O)OR.sub.7, --SR.sub.7,
--S(O)R.sub.B, or --S(O).sub.2R.sub.7;
[0089] each R.sub.11 is independently --(C.sub.1-C.sub.6)alkyl,
--(C.sub.2-C.sub.6)alkenyl, --(C.sub.2-C.sub.6)alkynyl,
(C.sub.3-C.sub.8)cycloalkyl, --(C.sub.5-C.sub.8)cycloalkenyl,
-phenyl, --C(halo).sub.3, --CH(halo).sub.2, --CH.sub.2(halo), --CN,
--OH, -halo, --N.sub.3, --NO.sub.2, --N(R.sub.7).sub.2,
--CH.dbd.NR.sub.7, --NR.sub.7OH, --OR.sub.7, --COR.sub.7,
--C(O)OR.sub.7, --OC(O)R.sub.7, --OC(O)OR.sub.7, --SR.sub.7,
--S(O)R.sub.B, or --S(O).sub.2R.sub.7;
[0090] each halo is independently --F, --Cl, --Br, or --I;
[0091] m is an integer ranging from 0 to 3;
[0092] n is an integer ranging from 0 to 3;
[0093] o is an integer ranging from 0 to 4;
[0094] p is an integer ranging from 0 to 2;
[0095] q is an integer ranging from 0 to 6;
[0096] r is an integer ranging from 0 to 5; and
[0097] s is an integer ranging from 0 to 4.
[0098] A compound of formula (I) or (II) or a pharmaceutically
acceptable salt thereof (a "Pyridylene Compound") is useful for
treating or preventing pain, UI, an ulcer, IBD, IBS, an addictive
disorder, Parkinson's disease, parkinsonism, anxiety, epilepsy,
stroke, a seizure, a pruritic condition, psychosis, a cognitive
disorder, a memory deficit, restricted brain function, Huntington's
chorea, ALS, dementia, retinopathy, a muscle spasm, a migraine,
vomiting, dyskinesia, or depression (each being a "Condition") in
an animal.
[0099] The invention also relates to compositions comprising an
effective amount of a Pyridylene Compound and a pharmaceutically
acceptable carrier or excipient. The compositions are useful for
treating or preventing a Condition in an animal.
[0100] The invention further relates to methods for treating a
Condition, comprising administering to an animal in need thereof an
effective amount of a Pyridylene Compound.
[0101] The invention further relates to methods for preventing a
Condition, comprising administering to an animal in need thereof an
effective amount of a Pyridylene Compound.
[0102] The invention still further relates to methods for
inhibiting Vanilloid Receptor 1 ("VR1") function in a cell,
comprising contacting a cell capable of expressing VR1 with an
effective amount of a Pyridylene Compound.
[0103] The invention still further relates to methods for
inhibiting mGluR5 function in a cell, comprising contacting a cell
capable of expressing mGluR5 with an effective amount of a
Pyridylene Compound.
[0104] The invention still further relates to methods for
inhibiting metabotropic glutamate receptor 1 ("mGluR1") function in
a cell, comprising contacting a cell capable of expressing mGluR1
with an effective amount of a Pyridylene Compound.
[0105] The invention still further relates to methods for preparing
a composition, comprising the step of admixing a Pyridylene
Compound and a pharmaceutically acceptable carrier or
excipient.
[0106] The invention still further relates to a kit comprising a
container containing an effective amount of a Pyridylene
Compound.
[0107] The present invention can be understood more fully by
reference to the following detailed description and illustrative
examples, which are intended to exemplify non-limiting embodiments
of the invention.
4. DETAILED DESCRIPTION OF THE INVENTION
4.1 Pyridylene Compounds of Formula (I)
[0108] As stated above, the present invention encompasses compounds
of Formula (I)
##STR00008##
and pharmaceutically acceptable salts thereof, where Ar.sub.1,
Ar.sub.2, R.sub.3, X, and m are defined above for the Pyridylene
Compounds of formula (I).
[0109] In one embodiment, Ar.sub.1 is a pyridyl group;
[0110] In another embodiment, Ar.sub.1 is a pyrimidinyl group.
[0111] In another embodiment, Ar.sub.1 is a pyrazinyl group.
[0112] In another embodiment, Ar.sub.1 is a pyridazinyl group.
[0113] In another embodiment, Ar.sub.1 is a thiadiazolyl group.
[0114] In another embodiment, X is O.
[0115] In another embodiment, X is S.
[0116] In another embodiment, Ar.sub.2 is a benzoimidazolyl
group.
[0117] In another embodiment, Ar.sub.2 is a benzothiazolyl
group.
[0118] In another embodiment, Ar.sub.2 is a benzooxazolyl
group.
[0119] In another embodiment, Ar.sub.2 is
##STR00009##
[0120] In another embodiment, Ar.sub.2 is
##STR00010##
[0121] In another embodiment, Ar.sub.2 is
##STR00011##
[0122] In another embodiment, Ar.sub.2 is
##STR00012##
[0123] In another embodiment, m is 0.
[0124] In another embodiment, m is 1.
[0125] In another embodiment, m is 2.
[0126] In another embodiment, m is 3.
[0127] In another embodiment, p is 0.
[0128] In another embodiment, p is 1.
[0129] In another embodiment, p is 2.
[0130] In another embodiment, n is 0.
[0131] In another embodiment, n is 1.
[0132] In another embodiment, n is 2.
[0133] In another embodiment, n is 3.
[0134] In another embodiment, o is 0.
[0135] In another embodiment, o is 1.
[0136] In another embodiment, o is 2.
[0137] In another embodiment, o is 3.
[0138] In another embodiment, o is 4.
[0139] In another embodiment, q is 0.
[0140] In another embodiment, q is 1.
[0141] In another embodiment, q is 2.
[0142] In another embodiment, q is 3.
[0143] In another embodiment, q is 4.
[0144] In another embodiment, q is 5.
[0145] In another embodiment, q is 6.
[0146] In another embodiment, r is 0.
[0147] In another embodiment, r is 1.
[0148] In another embodiment, r is 2
[0149] In another embodiment, r is 3
[0150] In another embodiment, r is 4
[0151] In another embodiment, r is 5
[0152] In another embodiment, s is 0.
[0153] In another embodiment, s is 1.
[0154] In another embodiment, s is 2.
[0155] In another embodiment, s is 3.
[0156] In another embodiment, s is 4.
[0157] In another embodiment, R.sub.1 is -halo.
[0158] In another embodiment, R.sub.1 is --Cl.
[0159] In another embodiment, R.sub.1 is --Br.
[0160] In another embodiment, R.sub.1 is --I.
[0161] In another embodiment, R.sub.1 is --F.
[0162] In another embodiment, R.sub.1 is --CH.sub.3.
[0163] In another embodiment, R.sub.1 is --C(halo).sub.3.
[0164] In another embodiment, R.sub.1 is --CH(halo).sub.2.
[0165] In another embodiment, R.sub.1 is --CH.sub.2(halo).
[0166] In another embodiment, n or p is 1 and R.sub.2 is -halo,
--OH, --NH.sub.2, --CN, or --NO.sub.2.
[0167] In another embodiment, n or p is 1 and R.sub.2 is
--(C.sub.1-C.sub.10)alkyl, --(C.sub.2-C.sub.10)alkenyl,
--(C.sub.2-C.sub.10)alkynyl, --(C.sub.3-C.sub.10)cycloalkyl,
--(C.sub.8-C.sub.14)bicycloalkyl,
--(C.sub.8-C.sub.14)tricycloalkyl,
--(C.sub.5-C.sub.10)cycloalkenyl,
--(C.sub.8-C.sub.14)bicycloalkenyl,
--(C.sub.8-C.sub.14)tricycloalkenyl, -(3- to
7-membered)heterocycle, or -(7- to 10-membered)bicycloheterocycle,
each of which is unsubstituted or substituted with one or more
R.sub.5 groups.
[0168] In another embodiment, n or p is 1 and R.sub.2 is -phenyl,
-naphthyl, --(C.sub.14)aryl or -(5- to 10-membered)heteroaryl, each
of which is unsubstituted or substituted with one or more R.sub.6
groups.
[0169] In another embodiment, m is 1 and R.sub.3 is -halo, --CN,
--OH, --NO.sub.2, or --NH.sub.2.
[0170] In another embodiment, m is 1 and R.sub.3 is
--(C.sub.1-C.sub.10)alkyl, --(C.sub.2-C.sub.10)alkenyl,
--(C.sub.2-C.sub.10)alkynyl, --(C.sub.3-C.sub.10)cycloalkyl,
--(C.sub.8-C.sub.14)bicycloalkyl,
--(C.sub.8-C.sub.14)tricycloalkyl,
--(C.sub.1-5--C.sub.10)cycloalkenyl,
--(C.sub.8-C.sub.14)bicycloalkenyl,
--(C.sub.8-C.sub.14)tricycloalkenyl, -(3- to
7-membered)heterocycle, or -(7- to 10-membered)bicycloheterocycle,
each of which is unsubstituted or substituted with one or more
R.sub.5 groups.
[0171] In another embodiment, m is 1 and R.sub.3 is -phenyl,
-naphthyl, --(C.sub.14)aryl or -(5- to 10-membered)heteroaryl, each
of which is unsubstituted or substituted with one or more R.sub.6
groups.
[0172] In another embodiment, m is 1 and R.sub.3 is
--(C.sub.1-C.sub.1n)alkyl.
[0173] In another embodiment, m is 1 and R.sub.3 is --CH.sub.3.
[0174] In another embodiment, m is 1 and R.sub.3 is -halo.
[0175] In another embodiment, m is 1 and R.sub.3 is --Cl.
[0176] In another embodiment, m is 1 and R.sub.3 is --Br.
[0177] In another embodiment, m is 1 and R.sub.3 is --I.
[0178] In another embodiment, m is 1 and R.sub.3 is --F.
[0179] In another embodiment, Ar.sub.2 is a benzothiazolyl group
and s is 1.
[0180] In another embodiment, Ar.sub.2 is a benzoimidazolyl group
and s is 1.
[0181] In another embodiment, Ar.sub.2 is a benzooxazolyl group and
s is 1.
[0182] In another embodiment, Ar.sub.2 is
##STR00013##
[0183] and o is 1.
[0184] In another embodiment, Ar.sub.2 is
##STR00014##
and o is 1.
[0185] In another embodiment, Ar.sub.2 is
##STR00015##
and q is 1.
[0186] In another embodiment, Ar.sub.2 is
##STR00016##
and r is 1.
[0187] In another embodiment, Ar.sub.2 is a benzothiazolyl group, s
is 1, and R.sub.8 is -halo or --(C.sub.1-C.sub.6) alkyl.
[0188] In another embodiment, Ar.sub.2 is a benzoimidazolyl group,
s is 1, and R.sub.8 is -halo or --(C.sub.1-C.sub.6) alkyl.
[0189] In another embodiment, Ar.sub.2 is a benzooxazolyl group, s
is 1, and R.sub.8 is -halo or --(C.sub.1-C.sub.6) alkyl.
[0190] In another embodiment, Ar.sub.2 is
##STR00017##
o is 1, and R.sub.8 is -halo or --(C.sub.1-C.sub.6) alkyl.
[0191] In another embodiment, Ar.sub.2 is
##STR00018##
o is 1, and R.sub.8 is -halo or --(C.sub.1-C.sub.6) alkyl.
[0192] In another embodiment, Ar.sub.2 is
##STR00019##
r is 1, and R.sub.8 is -halo or --(C.sub.1-C.sub.6) alkyl.
[0193] In another embodiment, Ar.sub.2 is
##STR00020##
q is 1, and R.sub.11 is -halo or --(C.sub.1-C.sub.6) alkyl.
[0194] In another embodiment, Ar.sub.2 is
##STR00021##
r is 1, and R.sub.8 is at the para-position of the phenyl ring.
[0195] In another embodiment, Ar.sub.1 is a pyridyl group, X is O,
m is 0, and Ar.sub.2 is a benzothiazolyl group.
[0196] In another embodiment, Ar.sub.1 is a pyridyl group, X is O,
m is 0, and Ar.sub.2 is a benzooxazolyl group.
[0197] In another embodiment, Ar.sub.1 is a pyridyl group, X is O,
m is 0, and Ar.sub.2 is a benzoimidazolyl group.
[0198] In another embodiment, Ar.sub.1 is a pyridyl group, X is O,
m is 0, and Ar.sub.2 is
##STR00022##
[0199] In another embodiment, Ar.sub.1 is a pyridyl group, X is O,
m is 0, and Ar.sub.2 is
##STR00023##
[0200] In another embodiment, Ar.sub.1 is a pyridyl group, X is O,
m is 0, Ar.sub.2 is
##STR00024##
and R.sub.8 is a --(C.sub.1-C.sub.6)alkyl. In another embodiment, r
is 1, the --(C.sub.1-C.sub.6)alkyl is substituted at the phenyl
group's para-position. In another embodiment, r is 1, the
--(C.sub.1-C.sub.6)alkyl is a tert-butyl group. In another
embodiment, r is 1, the --(C.sub.1-C.sub.6)alkyl is a tert-butyl
group and is substituted at the phenyl group's para-position. In
another embodiment, r is 1, the --(C.sub.1-C.sub.6)alkyl is an
iso-propyl group. In another embodiment, the
--(C.sub.1-C.sub.6)alkyl is a iso-propyl group and is substituted
at the phenyl group's para-position.
[0201] In another embodiment, Ar.sub.1 is a pyridyl group, X is O,
m is 0, Ar.sub.2 is
##STR00025##
r is 1, and R.sub.8 is --CF.sub.3. In another embodiment, r is 1
and the --CF.sub.3 is substituted at the phenyl group's
para-position.
[0202] In another embodiment, Ar.sub.1 is a pyridyl group, X is O,
m is 0, Ar.sub.2 is
##STR00026##
r is 1, and R.sub.8 is -halo. In another embodiment, r is 1 and the
-halo is substituted at the phenyl group's para-position. In
another embodiment, r is 1 and -halo is --Cl. In another
embodiment, r is 1 and -halo is --Cl and is substituted at the
phenyl group's para-position. In another embodiment, r is 1 and
-halo is --Br. In another embodiment, r is 1 and -halo is --Br and
is substituted at the phenyl group's para-position. In another
embodiment, r is 1 and -halo is --I. In another embodiment, r is 1
and -halo is --I and is substituted at the phenyl group's
para-position. In another embodiment, r is 1 and -halo is --F. In
another embodiment, r is 1 and -halo is --F and is substituted at
the phenyl group's para-position.
[0203] In another embodiment, Ar.sub.1 is a pyrazinyl group, X is
O, m is 0, and Ar.sub.2 is a benzothiazolyl group.
[0204] In another embodiment, Ar.sub.1 is a pyrazinyl group, X is
O, m is 0, and Ar.sub.2 is a benzooxazolyl group.
[0205] In another embodiment, Ar.sub.1 is a pyrazinyl group, X is
O, m is 0, and Ar.sub.2 is a benzoimidazolyl group.
[0206] In another embodiment, Ar.sub.1 is a pyrazinyl group, X is
O, m is 0, and Ar.sub.2 is
##STR00027##
[0207] In another embodiment, Ar.sub.1 is a pyrazinyl group, X is
O, m is 0, and Ar.sub.2 is
##STR00028##
[0208] In another embodiment, Ar.sub.1 is a pyrazinyl group, X is
O, m is 0, Ar.sub.2 is
##STR00029##
r is 1, and R.sub.8 is a --(C.sub.1-C.sub.6)alkyl. In another
embodiment, r is 1 and the --(C.sub.1-C.sub.6)alkyl is substituted
at the phenyl group's para-position. In another embodiment, r is 1
and the --(C.sub.1-C.sub.6)alkyl is a tert-butyl group. In another
embodiment, r is 1, the --(C.sub.1-C.sub.6)alkyl is a tert-butyl
group, and is substituted at the phenyl group's para-position. In
another embodiment, r is 1 and the --(C.sub.1-C.sub.6)alkyl is an
iso-propyl group. In another embodiment, r is 1, the
--(C.sub.1-C.sub.6)alkyl is a iso-propyl group and is substituted
at the phenyl group's para-position.
[0209] In another embodiment, Ar.sub.1 is a pyrazinyl group, X is
O, m is 0, Ar.sub.2 is
##STR00030##
r is 1, and R.sub.8 is --CF.sub.3. In another embodiment, the
--CF.sub.3 is substituted at the phenyl group's para-position.
[0210] In another embodiment, Ar.sub.1 is a pyrazinyl group, X is
O, m is 0, Ar.sub.2 is
##STR00031##
r is 1, and R.sub.8 is -halo. In another embodiment, r is 1 and the
-halo is substituted at the phenyl group's para-position. In
another embodiment, r is 1 and -halo is --Cl. In another
embodiment, r is 1 and -halo is --Cl and is substituted at the
phenyl group's para-position. In another embodiment, r is 1 and
-halo is --Br. In another embodiment, r is 1 and -halo is --Br and
is substituted at the phenyl group's para-position. In another
embodiment, r is 1 and -halo is --I. In another embodiment, r is 1,
-halo is --I and is substituted at the phenyl group's
para-position. In another embodiment, r is 1 and -halo is --F. In
another embodiment, r is 1, -halo is --F and is substituted at the
phenyl group's para-position.
[0211] In another embodiment, Ar.sub.1 is a pyrimidinyl group, X is
O, m is 0, and Ar.sub.2 is a benzothiazolyl group.
[0212] In another embodiment, Ar.sub.1 is a pyrimidinyl group, X is
O, m is 0, and Ar.sub.2 is a benzooxazolyl group.
[0213] In another embodiment, Ar.sub.1 is a pyrimidinyl group, X is
O, m is 0, and Ar.sub.2 is a benzoimidazolyl group.
[0214] In another embodiment, Ar.sub.1 is a pyrimidinyl group, X is
O, m is 0, and Ar.sub.2 is
##STR00032##
[0215] In another embodiment, Ar.sub.1 is a pyrimidinyl group, X is
O, m is 0, and Ar.sub.2 is
##STR00033##
[0216] In another embodiment, Ar.sub.1 is a pyrimidinyl group, X is
O, m is 0, Ar.sub.2 is
##STR00034##
r is 1, and R.sub.8 is a --(C.sub.1-C.sub.6)alkyl. In another
embodiment, r is 1 and the --(C.sub.1-C.sub.6)alkyl is substituted
at the phenyl group's para-position. In another embodiment, r is 1
and the --(C.sub.1-C.sub.6)alkyl is a tert-butyl group. In another
embodiment, r is 1 and the --(C.sub.1-C.sub.6)alkyl is a tert-butyl
group and is substituted at the phenyl group's para-position. In
another embodiment, r is 1 and the --(C.sub.1-C.sub.6)alkyl is an
iso-propyl group. In another embodiment, r is 1 and the
--(C.sub.1-C.sub.6)alkyl is a iso-propyl group and is substituted
at the phenyl group's para-position.
[0217] In another embodiment, Ar.sub.1 is a pyrimidinyl group, X is
O, m is 0, Ar.sub.2 is
##STR00035##
r is 1, and R.sub.8 is --CF.sub.3. In another embodiment, the
--CF.sub.3 is substituted at the phenyl group's para-position.
[0218] In another embodiment, Ar.sub.1 is a pyrimidinyl group, X is
O, m is 0, Ar.sub.2 is
##STR00036##
r is 1, and R.sub.8 is -halo. In another embodiment, r is 1 and the
-halo is substituted at the phenyl group's para-position. In
another embodiment, r is 1 and -halo is --Cl. In another
embodiment, r is 1 and -halo is --Cl and is substituted at the
phenyl group's para-position. In another embodiment, r is 1 and
-halo is --Br. In another embodiment, r is 1 and -halo is --Br and
is substituted at the phenyl group's para-position. In another
embodiment, r is 1 and -halo is --I. In another embodiment, r is 1
and -halo is --I and is substituted at the phenyl group's
para-position. In another embodiment, r is 1 and -halo is --F. In
another embodiment, r is 1 and -halo is --F and is substituted at
the phenyl group's para-position.
[0219] In another embodiment, Ar.sub.1 is a pyridazinyl group, X is
O, m is 0, and Ar.sub.2 is a benzothiazolyl group.
[0220] In another embodiment, Ar.sub.1 is a pyridazinyl group, X is
O, m is 0, and Ar.sub.2 is a benzooxazolyl group.
[0221] In another embodiment, Ar.sub.1 is a pyridazinyl group, X is
O, m is 0, and Ar.sub.2 is a benzoimidazolyl group.
[0222] In another embodiment, Ar.sub.1 is a pyridazinyl group, X is
O, m is 0, and Ar.sub.2 is
##STR00037##
[0223] In another embodiment, Ar.sub.1 is a pyridazinyl group, X is
O, m is 0, and Ar.sub.2 is
##STR00038##
[0224] In another embodiment, Ar.sub.1 is a pyridazinyl group, X is
O, m is 0, Ar.sub.2 is
##STR00039##
r is 1, and R.sub.8 is a --(C.sub.1-C.sub.6)alkyl. In another
embodiment, r is 1 and the --(C.sub.1-C.sub.6)alkyl is substituted
at the phenyl group's para-position. In another embodiment, r is 1
and the --(C.sub.1-C.sub.6)alkyl is a tert-butyl group. In another
embodiment, r is 1 and the --(C.sub.1-C.sub.6)alkyl is a tert-butyl
group and is substituted at the phenyl group's para-position. In
another embodiment, r is 1 and the --(C.sub.1-C.sub.6)alkyl is an
iso-propyl group. In another embodiment, r is 1 and the
--(C.sub.1-C.sub.6)alkyl is a iso-propyl group and is substituted
at the phenyl group's para-position.
[0225] In another embodiment, Ar.sub.1 is a pyridazinyl group, X is
O, m is 0, Ar.sub.2 is
##STR00040##
r is 1, and R.sub.8 is --CF.sub.3. In another embodiment, the
--CF.sub.3 is substituted at the phenyl group's para-position.
[0226] In another embodiment, Ar.sub.t is a pyridazinyl group, X is
O, m is 0, Ar.sub.2 is
##STR00041##
r is 1, and R.sub.8 is -halo. In another embodiment, r is 1 and the
-halo is substituted at the phenyl group's para-position. In
another embodiment, r is 1 and -halo is --Cl. In another
embodiment, r is 1 and -halo is --Cl and is substituted at the
phenyl group's para-position. In another embodiment, r is 1 and
-halo is --Br. In another embodiment, r is 1 and -halo is --Br and
is substituted at the phenyl group's para-position. In another
embodiment, r is 1 and -halo is --I. In another embodiment, r is 1
and -halo is --I and is substituted at the phenyl group's
para-position. In another embodiment, r is 1 and -halo is --F. In
another embodiment, r is 1 and -halo is --F and is substituted at
the phenyl group's para-position.
[0227] In another embodiment, Ar.sub.1 is a thiadiazolyl group, X
is O, m is 0, and Ar.sub.2 is a benzothiazolyl group.
[0228] In another embodiment, Ar.sub.1 is a thiadiazolyl group, X
is O, m is 0, and Ar.sub.2 is a benzooxazolyl group.
[0229] In another embodiment, Ar.sub.1 is a thiadiazolyl group, X
is O, m is 0, and Ar.sub.2 is a benzoimidazolyl group.
[0230] In another embodiment, Ar.sub.1 is a thiadiazolyl group, X
is O, m is 0, and Ar.sub.2 is
##STR00042##
[0231] In another embodiment, Ar.sub.1 is a thiadiazolyl group, X
is O, m is 0, Ar.sub.2 is
##STR00043##
r is 1, and R.sub.8 is a --(C.sub.1-C.sub.6)alkyl. In another
embodiment, r is 1 and the --(C.sub.1-C.sub.6)alkyl is substituted
at the phenyl group's para-position. In another embodiment, r is 1
and the --(C.sub.1-C.sub.6)alkyl is a tert-butyl group. In another
embodiment, r is 1 and the --(C.sub.1-C.sub.6)alkyl is a tert-butyl
group and is substituted at the phenyl group's para-position. In
another embodiment, r is 1 and the --(C.sub.1-C.sub.6)alkyl is an
iso-propyl group. In another embodiment, r is 1 and the
--(C.sub.1-C.sub.6)alkyl is a iso-propyl group and is substituted
at the phenyl group's para-position.
[0232] In another embodiment, Ar.sub.1 is a thiadiazolyl group, X
is O, m is 0, Ar.sub.2 is
##STR00044##
r is 1, and R.sub.8 is --CF.sub.3. In another embodiment, the
--CF.sub.3 is substituted at the phenyl group's para-position.
[0233] In another embodiment, Ar.sub.1 is a thiadiazolyl group, X
is O, m is 0, Ar.sub.2 is
##STR00045##
r is 1, and R.sub.8 is -halo. In another embodiment, r is 1 and the
-halo is substituted at the phenyl group's para-position. In
another embodiment, r is 1 and -halo is --Cl. In another
embodiment, r is 1 and -halo is --Cl and is substituted at the
phenyl group's para-position. In another embodiment, r is 1 and
-halo is --Br. In another embodiment, r is 1 and -halo is --Br and
is substituted at the phenyl group's para-position. In another
embodiment, r is 1 and -halo is --I. In another embodiment, r is 1
and -halo is --I and is substituted at the phenyl group's
para-position. In another embodiment, r is 1 and -halo is --F. In
another embodiment, r is 1 and -halo is --F and is substituted at
the phenyl group's para-position.
4.2 Pyridylene Compounds of Formula (II)
[0234] The invention also relates to Pyridylene Compounds of
formula (II)
##STR00046##
and pharmaceutically acceptable salts thereof, where Ar.sub.1,
Ar.sub.2, X, R.sub.3, and m are defined above for the Pyridylene
Compounds of formula (II).
[0235] In one embodiment, Ar.sub.1 is a pyridyl group;
[0236] In another embodiment, pyrimidinyl group.
[0237] In another embodiment, Ar.sub.1 is a pyrazinyl group.
[0238] In another embodiment, Ar.sub.1 is a pyridazinyl group.
[0239] In another embodiment, Ar.sub.1 is a thiadiazolyl group.
[0240] In another embodiment, X is O.
[0241] In another embodiment, X is S.
[0242] In another embodiment, Ar.sub.2 is a benzoimidazolyl
group.
[0243] In another embodiment, Ar.sub.2 is a benzothiazolyl
group.
[0244] In another embodiment, Ar.sub.2 is a benzooxazolyl
group.
[0245] In another embodiment, Ar.sub.2 is
##STR00047##
[0246] In another embodiment, Ar.sub.2 is
##STR00048##
[0247] In another embodiment, Ar.sub.2 is
##STR00049##
[0248] In another embodiment, Ar.sub.2 is
##STR00050##
[0249] In another embodiment, m is 0.
[0250] In another embodiment, m is 1.
[0251] In another embodiment, m is 2.
[0252] In another embodiment, m is 3.
[0253] In another embodiment, p is 0.
[0254] In another embodiment, p is 1.
[0255] In another embodiment, p is 2.
[0256] In another embodiment, n is 0.
[0257] In another embodiment, n is 1.
[0258] In another embodiment, n is 2.
[0259] In another embodiment, n is 3.
[0260] In another embodiment, o is 0.
[0261] In another embodiment, o is 1.
[0262] In another embodiment, o is 2.
[0263] In another embodiment, o is 3.
[0264] In another embodiment, o is 4.
[0265] In another embodiment, q is 0.
[0266] In another embodiment, q is 1.
[0267] In another embodiment, q is 2.
[0268] In another embodiment, q is 3.
[0269] In another embodiment, q is 4.
[0270] In another embodiment, q is 5.
[0271] In another embodiment, q is 6.
[0272] In another embodiment, r is 0.
[0273] In another embodiment, r is 1.
[0274] In another embodiment, r is 2
[0275] In another embodiment, r is 3
[0276] In another embodiment, r is 4
[0277] In another embodiment, r is 5
[0278] In another embodiment, s is 0.
[0279] In another embodiment, s is 1.
[0280] In another embodiment, s is 2.
[0281] In another embodiment, s is 3.
[0282] In another embodiment, s is 4.
[0283] In another embodiment, R.sub.1 is -halo.
[0284] In another embodiment, R.sub.1 is --Cl.
[0285] In another embodiment, R.sub.1 is --Br.
[0286] In another embodiment, R.sub.1 is --I.
[0287] In another embodiment, R.sub.1 is --F.
[0288] In another embodiment, R.sub.1 is --CH.sub.3.
[0289] In another embodiment, R.sub.1 is --C(halo).sub.3.
[0290] In another embodiment, R.sub.1 is --CH(halo).sub.2.
[0291] In another embodiment, R.sub.1 is --CH.sub.2(halo).
[0292] In another embodiment, n or p is 1 and R.sub.2 is -halo,
--OH, --NH.sub.2, --CN, or --NO.sub.2.
[0293] In another embodiment, n or p is 1 and R.sub.2 is
--(C.sub.1-C.sub.10)alkyl, --(C.sub.2-C.sub.10)alkenyl,
--(C.sub.2-C.sub.10)alkynyl, --(C.sub.3-C.sub.10)cycloalkyl,
--(C.sub.8-C.sub.14)bicycloalkyl,
--(C.sub.8-C.sub.14)tricycloalkyl,
--(C.sub.5-C.sub.10)cycloalkenyl,
--(C.sub.8-C.sub.14)bicycloalkenyl,
--(C.sub.8-C.sub.14)tricycloalkenyl, -(3- to
7-membered)heterocycle, or -(7- to 10-membered)bicycloheterocycle,
each of which is unsubstituted or substituted with one or more
R.sub.5 groups.
[0294] In another embodiment, n or p is 1 and R.sub.2 is -phenyl,
-naphthyl, --(C.sub.14)aryl or -(5- to 10-membered)heteroaryl, each
of which is unsubstituted or substituted with one or more R.sub.6
groups.
[0295] In another embodiment, m is 1 and R.sub.3 is -halo, --CN,
--OH, --NO.sub.2, or --NH.sub.2.
[0296] In another embodiment, m is 1 and R.sub.3 is
--(C.sub.1-C.sub.10)alkyl, --(C.sub.2-C.sub.10)alkenyl,
--(C.sub.2-C.sub.10)alkynyl, --(C.sub.3-C.sub.10)cycloalkyl,
--(C.sub.8-C.sub.14)bicycloalkyl,
--(C.sub.8-C.sub.14)tricycloalkyl,
--(C.sub.5-C.sub.10)cycloalkenyl,
--(C.sub.8-C.sub.14)bicycloalkenyl,
--(C.sub.8-C.sub.14)tricycloalkenyl, -(3- to
7-membered)heterocycle, or -(7- to 10-membered)bicycloheterocycle,
each of which is unsubstituted or substituted with one or more
R.sub.5 groups.
[0297] In another embodiment, m is 1 and R.sub.3 is -phenyl,
-naphthyl, --(C.sub.14)aryl or -(5- to 10-membered)heteroaryl, each
of which is unsubstituted or substituted with one or more R.sub.6
groups.
[0298] In another embodiment, m is 1 and R.sub.3 is
--(C.sub.1-C.sub.10)alkyl.
[0299] In another embodiment, m is 1 and R.sub.3 is --CH.sub.3.
[0300] In another embodiment, m is 1 and R.sub.3 is -halo.
[0301] In another embodiment, m is 1 and R.sub.3 is --Cl.
[0302] In another embodiment, m is 1 and R.sub.3 is --Br.
[0303] In another embodiment, m is 1 and R.sub.3 is --I.
[0304] In another embodiment, m is 1 and R.sub.3 is --F.
[0305] In another embodiment, Ar.sub.2 is a benzothiazolyl group
and s is 1.
[0306] In another embodiment, Ar.sub.2 is a benzoimidazolyl group
and s is 1.
[0307] In another embodiment, Ar.sub.2 is a benzooxazolyl group and
s is 1.
[0308] In another embodiment, Ar.sub.2 is
##STR00051##
and o is 1.
[0309] In another embodiment, Ar.sub.2 is
##STR00052##
and o is 1.
[0310] In another embodiment, Ar.sub.2 is
##STR00053##
and q is 1.
[0311] In another embodiment, Ar.sub.2 is
##STR00054##
and r is 1.
[0312] In another embodiment, Ar.sub.2 is a benzothiazolyl group, s
is 1, and R.sub.8 is -halo or --(C.sub.1-C.sub.6) alkyl.
[0313] In another embodiment, Ar.sub.2 is a benzoimidazolyl group,
s is 1, and R.sub.8 is -halo or --(C.sub.1-C.sub.6) alkyl.
[0314] In another embodiment, Ar.sub.2 is a benzooxazolyl group, s
is 1, and R.sub.8 is -halo or --(C.sub.1-C.sub.6) alkyl.
[0315] In another embodiment, Ar.sub.2 is
##STR00055##
o is 1, and R.sub.8 is -halo or --(C.sub.1-C.sub.6) alkyl.
[0316] In another embodiment, Ar.sub.2 is
##STR00056##
o is 1, and R.sub.8 is -halo or --(C.sub.1-C.sub.6) alkyl.
[0317] In another embodiment, Ar.sub.2 is
##STR00057##
r is 1, and R.sub.8 is -halo or --(C.sub.1-C.sub.6) alkyl.
[0318] In another embodiment, Ar.sub.2 is
##STR00058##
q is 1, and R.sub.11 is -halo or --(C.sub.1-C.sub.6) alkyl.
[0319] In another embodiment, Ar.sub.2 is
##STR00059##
r is 1, and R.sub.8 is at the para-position of the phenyl ring.
[0320] In another embodiment, Ar.sub.1 is a pyridyl group, X is O,
m is 0, and Ar.sub.2 is a benzothiazolyl group.
[0321] In another embodiment, Ar.sub.1 is a pyridyl group, X is O,
m is 0, and Ar.sub.2 is a benzooxazolyl group.
[0322] In another embodiment, Ar.sub.1 is a pyridyl group, X is O,
m is 0, and Ar.sub.2 is a benzoimidazolyl group.
[0323] In another embodiment, Ar.sub.1 is a pyridyl group, X is O,
m is 0, and Ar.sub.2 is
##STR00060##
[0324] In another embodiment, Ar.sub.1 is a pyridyl group, X is O,
m is 0, and Ar.sub.2 is
##STR00061##
[0325] In another embodiment, Ar.sub.1 is a pyridyl group, X is O,
m is 0, Ar.sub.2 is
##STR00062##
r is 1, and R.sub.8 is a --(C.sub.1-C.sub.6)alkyl. In another
embodiment, r is 1 and the --(C.sub.1-C.sub.6)alkyl is substituted
at the phenyl group's para-position. In another embodiment, r is 1
and the --(C.sub.1-C.sub.6)alkyl is a tert-butyl group. In another
embodiment, r is 1 and the --(C.sub.1-C.sub.6)alkyl is a tert-butyl
group and is substituted at the phenyl group's para-position. In
another embodiment, r is 1 and the --(C.sub.1-C.sub.6)alkyl is an
iso-propyl group. In another embodiment,
[0326] r is 1 and the --(C.sub.1-C.sub.6)alkyl is a iso-propyl
group and is substituted at the phenyl group's para-position.
[0327] In another embodiment, Ar.sub.1 is a pyridyl group, X is O,
m is 0, Ar.sub.2 is
##STR00063##
r is 1, and R.sub.8 is --CF.sub.3. In another embodiment, the
--CF.sub.3 is substituted at the phenyl group's para-position.
[0328] In another embodiment, Ar.sub.1 is a pyridyl group, X is O,
m is 0, Ar.sub.2 is
##STR00064##
r is 1, and R.sub.8 is -halo. In another embodiment, r is 1 and the
-halo is substituted at the phenyl group's para-position. In
another embodiment, r is 1 and -halo is --Cl. In another
embodiment, r is 1 and -halo is --Cl and is substituted at the
phenyl group's para-position. In another embodiment, r is 1 and
-halo is --Br. In another embodiment, r is 1 and -halo is --Br and
is substituted at the phenyl group's para-position. In another
embodiment, r is 1 and -halo is --I. In another embodiment, r is 1
and -halo is --I and is substituted at the phenyl group's
para-position. In another embodiment, r is 1 and -halo is --F. In
another embodiment, r is 1 and -halo is --F and is substituted at
the phenyl group's para-position.
[0329] In another embodiment, Ar.sub.1 is a pyrazinyl group, X is
O, m is 0, and Ar.sub.2 is a benzothiazolyl group.
[0330] In another embodiment, Ar.sub.1 is a pyrazinyl group, X is
O, m is 0, and Ar.sub.2 is a benzooxazolyl group.
[0331] In another embodiment, Ar.sub.1 is a pyrazinyl group, X is
O, m is 0, and Ar.sub.2 is a benzoimidazolyl group.
[0332] In another embodiment, Ar.sub.1 is a pyrazinyl group, X is
O, m is 0, and Ar.sub.2 is
##STR00065##
[0333] In another embodiment, Ar.sub.1 is a pyrazinyl group, X is
O, m is 0, and Ar.sub.2 is
##STR00066##
[0334] In another embodiment, Ar.sub.1 is a pyrazinyl group, X is
O, m is 0, Ar.sub.2 is
##STR00067##
r is 1, and R.sub.8 is a --(C.sub.1-C.sub.6)alkyl. In another
embodiment, r is 1 and the --(C.sub.1-C.sub.6)alkyl is substituted
at the phenyl group's para-position. In another embodiment, r is 1
and the --(C.sub.1-C.sub.6)alkyl is a tert-butyl group. In another
embodiment, r is 1 and the --(C.sub.1-C.sub.6)alkyl is a tert-butyl
group and is substituted at the phenyl group's para-position. In
another embodiment, r is 1 and the --(C.sub.1-C.sub.6)alkyl is an
iso-propyl group. In another embodiment, r is 1 and the
--(C.sub.1-C.sub.6)alkyl is a iso-propyl group and is substituted
at the phenyl group's para-position.
[0335] In another embodiment, Ar.sub.1 is a pyrazinyl group, X is
O, m is 0, Ar.sub.2 is
##STR00068##
r is 1, and R.sub.8 is --CF.sub.3. In another embodiment, the
--CF.sub.3 is substituted at the phenyl group's para-position.
[0336] In another embodiment, Ar.sub.1 is a pyrazinyl group, X is
O, m is 0, Ar.sub.2 is
##STR00069##
r is 1, and R.sub.8 is -halo. In another embodiment, r is 1 and the
-halo is substituted at the phenyl group's para-position. In
another embodiment, r is 1 and -halo is --Cl. In another
embodiment, r is 1 and -halo is --Cl and is substituted at the
phenyl group's para-position. In another embodiment, r is 1 and
-halo is --Br. In another embodiment, r is 1 and -halo is --Br and
is substituted at the phenyl group's para-position. In another
embodiment, r is 1 and -halo is --I. In another embodiment, r is 1
and -halo is --I and is substituted at the phenyl group's
para-position. In another embodiment, r is 1 and -halo is --F. In
another embodiment, r is 1 and -halo is --F and is substituted at
the phenyl group's para-position.
[0337] In another embodiment, Ar.sub.1 is a pyrimidinyl group, X is
O, m is 0, and Ar.sub.2 is a benzothiazolyl group.
[0338] In another embodiment, Ar.sub.1 is a pyrimidinyl group, X is
O, m is 0, and Ar.sub.2 is a benzooxazolyl group.
[0339] In another embodiment, Ar.sub.1 is a pyrimidinyl group, X is
O, m is 0, and Ar.sub.2 is a benzoimidazolyl group.
[0340] In another embodiment, Ar.sub.1 is a pyrimidinyl group, X is
O, m is 0, and Ar.sub.2 is
##STR00070##
[0341] In another embodiment, Ar.sub.1 is a pyrimidinyl group, X is
O, m is 0, and Ar.sub.2 is
##STR00071##
[0342] In another embodiment, Ar.sub.1 is a pyrimidinyl group, X is
O, m is 0, Ar.sub.2 is
##STR00072##
r is 1, and R.sub.8 is a --(C.sub.1-C.sub.6)alkyl. In another
embodiment, r is 1 and the --(C.sub.1-C.sub.6)alkyl is substituted
at the phenyl group's para-position. In another embodiment, r is 1
and the --(C.sub.1-C.sub.6)alkyl is a tert-butyl group. In another
embodiment, r is 1 and the --(C.sub.1-C.sub.6)alkyl is a tert-butyl
group substituted at the phenyl group's para-position. In another
embodiment, r is 1 and the --(C.sub.1-C.sub.6)alkyl is an
iso-propyl group. In another embodiment, r is 1 and the
--(C.sub.1-C.sub.6)alkyl is a iso-propyl group substituted at the
phenyl group's para-position.
[0343] In another embodiment, Ar.sub.1 is a pyrimidinyl group, X is
O, m is 0, Ar.sub.2 is
##STR00073##
r is 1, and R.sub.8 is --CF.sub.3. In another embodiment, the
--CF.sub.3 is substituted at the phenyl group's para-position.
[0344] In another embodiment, Ar.sub.1 is a pyrimidinyl group, X is
O, m is 0, Ar.sub.2 is
##STR00074##
r is 1, and R.sub.8 is -halo. In another embodiment, r is 1 and the
-halo is substituted at the phenyl group's para-position. In
another embodiment, r is 1 and -halo is --Cl. In another
embodiment, r is 1 and -halo is --Cl and is substituted at the
phenyl group's para-position. In another embodiment, r is 1 and
-halo is --Br. In another embodiment, r is 1 and -halo is --Br and
is substituted at the phenyl group's para-position. In another
embodiment, r is 1 and -halo is --I. In another embodiment, r is 1
and -halo is --I and is substituted at the phenyl group's
para-position. In another embodiment, r is 1 and -halo is --F. In
another embodiment, r is 1 and -halo is --F and is substituted at
the phenyl group's para-position.
[0345] In another embodiment, Ar.sub.1 is a pyridazinyl group, X is
O, m is 0, and Ar.sub.2 is a benzothiazolyl group.
[0346] In another embodiment, Ar.sub.1 is a pyridazinyl group, X is
O, m is 0, and Ar.sub.2 is a benzooxazolyl group.
[0347] In another embodiment, Ar.sub.1 is a pyridazinyl group, X is
O, m is 0, and Ar.sub.2 is a benzoimidazolyl group.
[0348] In another embodiment, Ar.sub.1 is a pyridazinyl group, X is
O, m is 0, and Ar.sub.2 is
##STR00075##
[0349] In another embodiment, Ar.sub.1 is a pyridazinyl group, X is
O, m is 0, and Ar.sub.2 is
##STR00076##
[0350] In another embodiment, Ar.sub.1 is a pyridazinyl group, X is
O, m is 0, Ar.sub.2 is
##STR00077##
r is 1, and R.sub.8 is a --(C.sub.1-C.sub.6)alkyl. In another
embodiment, r is 1 and the --(C.sub.1-C.sub.6)alkyl is substituted
at the phenyl group's para-position. In another embodiment, r is 1
and the --(C.sub.1-C.sub.6)alkyl is a tert-butyl group. In another
embodiment, r is 1 and the --(C.sub.1-C.sub.6)alkyl is a tert-butyl
group and is substituted at the phenyl group's para-position. In
another embodiment, r is 1 and the --(C.sub.1-C.sub.6)alkyl is an
iso-propyl group. In another embodiment, r is 1 and the
--(C.sub.1-C.sub.6)alkyl is a iso-propyl group and is substituted
at the phenyl group's para-position.
[0351] In another embodiment, Ar.sub.1 is a pyridazinyl group, X is
O, m is 0, Ar.sub.2 is
##STR00078##
r is 1, and R.sub.8 is --CF.sub.3. In another embodiment, the
--CF.sub.3 is substituted at the phenyl group's para-position.
[0352] In another embodiment, Ar.sub.1 is a pyridazinyl group, X is
O, m is 0, Ar.sub.2 is
##STR00079##
r is 1, and R.sub.8 is -halo. In another embodiment, r is 1 and the
-halo is substituted at the phenyl group's para-position. In
another embodiment, r is 1 and -halo is --Cl. In another
embodiment, r is 1 and -halo is --Cl and is substituted at the
phenyl group's para-position. In another embodiment, r is 1 and
-halo is --Br. In another embodiment, r is 1 and -halo is --Br and
is substituted at the phenyl group's para-position. In another
embodiment, r is 1 and -halo is --I. In another embodiment, r is 1
and -halo is --I and is substituted at the phenyl group's
para-position. In another embodiment, r is 1 and -halo is --F. In
another embodiment, r is 1 and -halo is --F and is substituted at
the phenyl group's para-position.
[0353] In another embodiment, Ar.sub.1 is a thiadiazolyl group, X
is O, m is 0, and Ar.sub.2 is a benzothiazolyl group.
[0354] In another embodiment, Ar.sub.1 is a thiadiazolyl group, X
is O, m is 0, and Ar.sub.2 is a benzooxazolyl group.
[0355] In another embodiment, Ar.sub.1 is a thiadiazolyl group, X
is O, m is 0, and Ar.sub.2 is a benzoimidazolyl group.
[0356] In another embodiment, Ar.sub.1 is a thiadiazolyl group, X
is O, m is 0, and Ar.sub.2 is
##STR00080##
[0357] In another embodiment, Ar.sub.1 is a thiadiazolyl group, X
is O, m is 0, Ar.sub.2 is
##STR00081##
r is 1, and R.sub.8 is a --(C.sub.1-C.sub.6)alkyl. In another
embodiment, r is 1 and the --(C.sub.1-C.sub.6)alkyl is substituted
at the phenyl group's para-position. In another embodiment, r is 1
and the --(C.sub.1-C.sub.6)alkyl is a tert-butyl group. In another
embodiment, r is 1 and the --(C.sub.1-C.sub.6)alkyl is a tert-butyl
group and is substituted at the phenyl group's para-position. In
another embodiment, r is 1 and the --(C.sub.1-C.sub.6)alkyl is an
iso-propyl group. In another embodiment, r is 1 and the
--(C.sub.1-C.sub.6)alkyl is a iso-propyl group and is substituted
at the phenyl group's para-position.
[0358] In another embodiment, Ar.sub.1 is a thiadiazolyl group, X
is O, m is 0, Ar.sub.2 is
##STR00082##
r is 1, and R.sub.8 is --CF.sub.3. In another embodiment, the
--CF.sub.3 is substituted at the phenyl group's para-position.
[0359] In another embodiment, Ar.sub.1 is a thiadiazolyl group, X
is O, m is 0, Ar.sub.2 is
##STR00083##
r is 1, and R.sub.8 is -halo. In another embodiment, r is 1 and the
-halo is substituted at the phenyl group's para-position. In
another embodiment, r is 1 and -halo is --Cl. In another
embodiment, r is 1 and -halo is --Cl and is substituted at the
phenyl group's para-position. In another embodiment, r is 1 and
-halo is --Br. In another embodiment, r is 1 and -halo is --Br and
is substituted at the phenyl group's para-position. In another
embodiment, r is 1 and -halo is --I. In another embodiment, r is 1
and -halo is --I and is substituted at the phenyl group's
para-position. In another embodiment, r is 1 and -halo is --F. In
another embodiment, r is 1 and -halo is --F and is substituted at
the phenyl group's para-position.
4.3 Pyridylene Compounds of Formula (I) and (II)
[0360] In the Pyridylene Compounds that have an R.sub.3 group, the
R.sub.3 group can be attached to the carbon atom at the 3-, 4-, or
6-position of the pyridylene ring of the Pyridylene Compound of
formula (I) or (II). In one embodiment, the R.sub.3 group is
attached to the carbon at the 3-position of the pyridylene ring of
the Pyridylene Compound of formula (I) or (II). In another
embodiment, the R.sub.3 group is attached to the carbon at the
4-position of the pyridylene ring of the Pyridylene Compound of
formula (I) or (II). In another embodiment, the R.sub.3 group is
attached to the carbon at the 6-position of the pyridylene ring of
the Pyridylene Compound of formula (I) or (II).
[0361] In another embodiment, the R.sub.3 group is --CH.sub.3 and
the R.sub.3 group is attached to the carbon at the 3-position of
the pyridylene ring of the Pyridylene Compound of formula (I) or
(II). In another embodiment, the R.sub.3 group is --CH.sub.3 and
the R.sub.3 group is attached to the carbon at the 4-position of
the pyridylene ring of the Pyridylene Compound of formula (I) or
(II). In another embodiment, the R.sub.3 group is --CH.sub.3 and
the R.sub.3 group is attached to the carbon at the 6-position of
the pyridylene ring of the Pyridylene Compound of formula (I) or
(II).
[0362] In another embodiment, the R.sub.3 group is -halo and the
R.sub.3 group is attached to the carbon at the 3-position of the
pyridylene ring of the Pyridylene Compound of formula (I) or (II).
In another embodiment, the R.sub.3 group is -halo and the R.sub.3
group is attached to the carbon at the 4-position of the pyridylene
ring of the Pyridylene Compound of formula (I) or (II). In another
embodiment, the R.sub.3 group is -halo and the R.sub.3 group is
attached to the carbon at the 6-position of the pyridylene ring of
the Pyridylene Compound of formula (I) or (II).
[0363] In another embodiment, the R.sub.3 group is --Cl and the
R.sub.3 group is attached to the carbon at the 3-position of the
pyridylene ring of the Pyridylene Compound of formula (I) or (II).
In another embodiment, the R.sub.3 group is --Cl and the R.sub.3
group is attached to the carbon at the 4-position of the pyridylene
ring of the Pyridylene Compound of formula (I) or (II). In another
embodiment, the R.sub.3 group is --Cl and the R.sub.3 group is
attached to the carbon at the 6-position of the pyridylene ring of
the Pyridylene Compound of formula (I) or (II).
[0364] In another embodiment, the R.sub.3 group is --Br and the
R.sub.3 group is attached to the carbon at the 3-position of the
pyridylene ring of the Pyridylene Compound of formula (I) or (II).
In another embodiment, the R.sub.3 group is --Br and the R.sub.3
group is attached to the carbon at the 4-position of the pyridylene
ring of the Pyridylene Compound of formula (I) or (II). In another
embodiment, the R.sub.3 group is --Br and the R.sub.3 group is
attached to the carbon at the 6-position of the pyridylene ring of
the Pyridylene Compound of formula (I) or (II).
[0365] In another embodiment, the R.sub.3 group is --F and the
R.sub.3 group is attached to the carbon at the 3-position of the
pyridylene ring of the Pyridylene Compound of formula (I) or (II).
In another embodiment, the R.sub.3 group is --F and the R.sub.3
group is attached to the carbon at the 4-position of the pyridylene
ring of the Pyridylene Compound of formula (I) or (II). In another
embodiment, the R.sub.3 group is --F and the R.sub.3 group is
attached to the carbon at the 6-position of the pyridylene ring of
the Pyridylene Compound of formula (I) or (II).
[0366] In another embodiment, the R.sub.3 group is --I and the
R.sub.3 group is attached to the carbon at the 3-position of the
pyridylene ring of the Pyridylene Compound of formula (I) or (II).
In another embodiment, the R.sub.3 group is --I and the R.sub.3
group is attached to the carbon at the 4-position of the pyridylene
ring of the Pyridylene Compound of formula (I) or (II). In another
embodiment, the R.sub.3 group is --I and the R.sub.3 group is
attached to the carbon at the 6-position of the pyridylene ring of
the Pyridylene Compound of formula (I) or (II).
[0367] Optical isomers of the Pyridylene Compounds can be obtained
by known techniques such as chiral chromatography or formation of
diastereomeric salts from an optically active acid or base.
[0368] In addition, one or more hydrogen, carbon or other atoms of
a Pyridylene Compound can be replaced by an isotope of the
hydrogen, carbon or other atoms. Such compounds, which are
encompassed by the present invention, are useful as research and
diagnostic tools in metabolism pharmacokinetic studies and in
binding assays.
[0369] Illustrative Pyridylene Compounds are listed below in Tables
1-10.
[0370] For the chemical structure depicted, e.g., at the head of
each of Tables 1-5, a is independently 0 or 1. When a=0, the group
at the "a" position is --H. When a=1, the group at the "a" position
(R.sub.8a) is other than --H, i.e., is R.sub.8.
[0371] For the chemical structure depicted, e.g., at the head of
each of Tables 6-10, a is independently 0 or 1. When a=0, the group
at the "a" position is --H. When a=1, the group at the "a" position
((R.sub.8).sub.a) is other than --H, i.e., is R.sub.8.
[0372] For the chemical structure depicted, e.g., at the head of
each of Tables 6-10, b is independently 0 or 1. When b=0, the group
at the "b" position is --H. When b=1, the group at the "b" position
((R.sub.8).sub.b) is other than --H, i.e., is R.sub.8.
TABLE-US-00001 TABLE 1 (III) ##STR00084## and pharmaceutically
acceptable salts thereof, where: Compound R.sub.1 R.sub.8a A1(a and
b) --Cl --H A2(a and b) --Cl -tert-butyl A3(a and b) --Cl
-iso-butyl A4(a and b) --Cl -sec-butyl A5(a and b) --Cl -iso-propyl
A6(a and b) --Cl -n-propyl A7(a and b) --Cl -cyclohexyl A8(a and b)
--Cl -tert-butoxy A9(a and b) --Cl -iso-propoxy A10(a and b) --Cl
--CF.sub.3 A11(a and b) --Cl --OCF.sub.3 A12(a and b) --Cl --Cl
A13(a and b) --Cl --Br A14(a and b) --Cl --I A15(a and b) --Cl
-n-butyl A16(a and b) --Cl -n-propyl A17(a and b) --F --H A18(a and
b) --F -tert-butyl A19(a and b) --F -iso-butyl A20(a and b) --F
-sec-butyl A21(a and b) --F -iso-propyl A22(a and b) --F -n-propyl
A23(a and b) --F -cyclohexyl A24(a and b) --F -tert-butoxy A25(a
and b) --F -iso-propoxy A26(a and b) --F --CF.sub.3 A27(a and b)
--F --OCF.sub.3 A28(a and b) --F --Cl A29(a and b) --F --Br A30(a
and b) --F --I A31(a and b) --F -n-butyl A32(a and b) --F -n-propyl
A33(a and b) --CH.sub.3 --H A34(a and b) --CH.sub.3 -iso-butyl
A35(a and b) --CH.sub.3 -tert-butyl A36(a and b) --CH.sub.3
-sec-butyl A37(a and b) --CH.sub.3 -iso-propyl A38(a and b)
--CH.sub.3 -n-propyl A39(a and b) --CH.sub.3 -cyclohexyl A40(a and
b) --CH.sub.3 -tert-butoxy A41(a and b) --CH.sub.3 -iso-propoxy
A42(a and b) --CH.sub.3 --CF.sub.3 A43(a and b) --CH.sub.3
--OCF.sub.3 A44(a and b) --CH.sub.3 --Cl A45(a and b) --CH.sub.3
--Br A46(a and b) --CH.sub.3 --I A47(a and b) --CH.sub.3 -n-butyl
A48(a and b) --CH.sub.3 -n-propyl A49(a and b) --CF.sub.3 --H A50(a
and b) --CF.sub.3 -tert-butyl A51(a and b) --CF.sub.3 -iso-butyl
A52(a and b) --CF.sub.3 -sec-butyl A53(a and b) --CF.sub.3
-iso-propyl A54(a and b) --CF.sub.3 -n-propyl A55(a and b)
--CF.sub.3 -cyclohexyl A56(a and b) --CF.sub.3 -tert-butoxy A57(a
and b) --CF.sub.3 -iso-propoxy A58(a and b) --CF.sub.3 --CF.sub.3
A59(a and b) --CF.sub.3 --OCF.sub.3 A60(a and b) --CF.sub.3 --Cl
A61(a and b) --CF.sub.3 --Br A62(a and b) --CF.sub.3 --I A63(a and
b) --CF.sub.3 -n-butyl A64(a and b) --CF.sub.3 -n-propyl A65(a and
b) --CHF.sub.2 -tert-butyl A66(a and b) --CHF.sub.2 --H A67(a and
b) --CHF.sub.2 -iso-butyl A68(a and b) --CHF.sub.2 -sec-butyl A69(a
and b) --CHF.sub.2 -iso-propyl A70(a and b) --CHF.sub.2 -n-propyl
A71(a and b) --CHF.sub.2 -cyclohexyl A72(a and b) --CHF.sub.2
-tert-butoxy A73(a and b) --CHF.sub.2 -iso-propoxy A74(a and b)
--CHF.sub.2 --CF.sub.3 A75(a and b) --CHF.sub.2 --OCF.sub.3 A76(a
and b) --CHF.sub.2 --Cl A77(a and b) --CHF.sub.2 --Br A78(a and b)
--CHF.sub.2 --I A79(a and b) --CHF.sub.2 -n-butyl A80(a and b)
--CHF.sub.2 -n-propyl A81(a and b) --Br --H A82(a and b) --Br
-tert-butyl A83(a and b) --Br -iso-butyl A84(a and b) --Br
-sec-butyl A85(a and b) --Br -iso-propyl A86(a and b) --Br
-n-propyl A87(a and b) --Br -cyclohexyl A88(a and b) --Br
-tert-butoxy A89(a and b) --Br -iso-propoxy A90(a and b) --Br
--CF.sub.3 A91(a and b) --Br --OCF.sub.3 A92(a and b) --Br --Cl
A93(a and b) --Br --Br A94(a and b) --Br --I A95(a and b) --Br
-n-butyl A96(a and b) --Br -n-propyl A97(a and b) --I -tert-butyl
A98(a and b) --I --H A99(a and b) --I -iso-butyl A100(a and b) --I
-sec-butyl A101(a and b) --I -iso-propyl A102(a and b) --I
-n-propyl A103(a and b) --I -cyclohexyl A104(a and b) --I
-tert-butoxy A105(a and b) --I -iso-propoxy A106(a and b) --I
--CF.sub.3 A107(a and b) --I --OCF.sub.3 A108(a and b) --I --Cl
A109(a and b) --I --Br A110(a and b) --I --I A111(a and b) --I
-n-butyl A112(a and b) --I -n-propyl In the column labeled
"Compound": (a) means Z.sub.1 is CH and Z.sub.2 is N; and (b) means
Z.sub.1 is N and Z.sub.2 is CH.
TABLE-US-00002 TABLE 2 (IV) ##STR00085## and pharmaceutically
acceptable salts thereof, where: Compound R.sub.1 R.sub.8a B1(a and
b) --Cl --H B2(a and b) --Cl -tert-butyl B3(a and b) --Cl
-iso-butyl B4(a and b) --Cl -sec-butyl B5(a and b) --Cl -iso-propyl
B6(a and b) --Cl -n-propyl B7(a and b) --Cl -cyclohexyl B8(a and b)
--Cl -tert-butoxy B9(a and b) --Cl -iso-propoxy B10(a and b) --Cl
--CF.sub.3 B11(a and b) --Cl --OCF.sub.3 B12(a and b) --Cl --Cl
B13(a and b) --Cl --Br B14(a and b) --Cl --I B15(a and b) --Cl
-n-butyl B16(a and b) --Cl -n-propyl B17(a and b) --F --H B18(a and
b) --F -tert-butyl B19(a and b) --F -iso-butyl B20(a and b) --F
-sec-butyl B21(a and b) --F -iso-propyl B22(a and b) --F -n-propyl
B23(a and b) --F -cyclohexyl B24(a and b) --F -tert-butoxy B25(a
and b) --F -iso-propoxy B26(a and b) --F --CF.sub.3 B27(a and b)
--F --OCF.sub.3 B28(a and b) --F --Cl B29(a and b) --F --Br B30(a
and b) --F --I B31(a and b) --F -n-butyl B32(a and b) --F -n-propyl
B33(a and b) --CH.sub.3 --H B34(a and b) --CH.sub.3 -iso-butyl
B35(a and b) --CH.sub.3 -tert-butyl B36(a and b) --CH.sub.3
-sec-butyl B37(a and b) --CH.sub.3 -iso-propyl B38(a and b)
--CH.sub.3 -n-propyl B39(a and b) --CH.sub.3 -cyclohexyl B40(a and
b) --CH.sub.3 -tert-butoxy B41(a and b) --CH.sub.3 -iso-propoxy
B42(a and b) --CH.sub.3 --CF.sub.3 B43(a and b) --CH.sub.3
--OCF.sub.3 B44(a and b) --CH.sub.3 --Cl B45(a and b) --CH.sub.3
--Br B46(a and b) --CH.sub.3 --I B47(a and b) --CH.sub.3 -n-butyl
B48(a and b) --CH.sub.3 -n-propyl B49(a and b) --CF.sub.3 --H B50(a
and b) --CF.sub.3 -tert-butyl B51(a and b) --CF.sub.3 -iso-butyl
B52(a and b) --CF.sub.3 -sec-butyl B53(a and b) --CF.sub.3
-iso-propyl B54(a and b) --CF.sub.3 -n-propyl B55(a and b)
--CF.sub.3 -cyclohexyl B56(a and b) --CF.sub.3 -tert-butoxy B57(a
and b) --CF.sub.3 -iso-propoxy B58(a and b) --CF.sub.3 --CF.sub.3
B59(a and b) --CF.sub.3 --OCF.sub.3 B60(a and b) --CF.sub.3 --Cl
B61(a and b) --CF.sub.3 --Br B62(a and b) --CF.sub.3 --I B63(a and
b) --CF.sub.3 -n-butyl B64(a and b) --CF.sub.3 -n-propyl B65(a and
b) --CHF.sub.2 -tert-butyl B66(a and b) --CHF.sub.2 --H B67(a and
b) --CHF.sub.2 -iso-butyl B68(a and b) --CHF.sub.2 -sec-butyl B69(a
and b) --CHF.sub.2 -iso-propyl B70(a and b) --CHF.sub.2 -n-propyl
B71(a and b) --CHF.sub.2 -cyclohexyl B72(a and b) --CHF.sub.2
-tert-butoxy B73(a and b) --CHF.sub.2 -iso-propoxy B74(a and b)
--CHF.sub.2 --CF.sub.3 B75(a and b) --CHF.sub.2 --OCF.sub.3 B76(a
and b) --CHF.sub.2 --Cl B77(a and b) --CHF.sub.2 --Br B78(a and b)
--CHF.sub.2 --I B79(a and b) --CHF.sub.2 -n-butyl B80(a and b)
--CHF.sub.2 -n-propyl B81(a and b) --Br --H B82(a and b) --Br
-tert-butyl B83(a and b) --Br -iso-butyl B84(a and b) --Br
-sec-butyl B85(a and b) --Br -iso-propyl B86(a and b) --Br
-n-propyl B87(a and b) --Br -cyclohexyl B88(a and b) --Br
-tert-butoxy B89(a and b) --Br -iso-propoxy B90(a and b) --Br
--CF.sub.3 B91(a and b) --Br --OCF.sub.3 B92(a and b) --Br --Cl
B93(a and b) --Br --Br B94(a and b) --Br --I B95(a and b) --Br
-n-butyl B96(a and b) --Br -n-propyl B97(a and b) --I -tert-butyl
B98(a and b) --I --H B99(a and b) --I -iso-butyl B100(a and b) --I
-sec-butyl B101(a and b) --I -iso-propyl B102(a and b) --I
-n-propyl B103(a and b) --I -cyclohexyl B104(a and b) --I
-tert-butoxy B105(a and b) --I -iso-propoxy B106(a and b) --I
--CF.sub.3 B107(a and b) --I --OCF.sub.3 B108(a and b) --I --Cl
B109(a and b) --I --Br B110(a and b) --I --I B111(a and b) --I
-n-butyl B112(a and b) --I -n-propyl In the column labeled
"Compound": (a) means Z.sub.1 is CH and Z.sub.2 is N; and (b) means
Z.sub.1 is N and Z.sub.2 is CH.
TABLE-US-00003 TABLE 3 (V) ##STR00086## and pharmaceutically
acceptable salts thereof, where: Compound R.sub.1 R.sub.8a C1(a and
b) --Cl --H C2(a and b) --Cl -tert-butyl C3(a and b) --Cl
-iso-butyl C4(a and b) --Cl -sec-butyl C5(a and b) --Cl -iso-propyl
C6(a and b) --Cl -n-propyl C7(a and b) --Cl -cyclohexyl C8(a and b)
--Cl -tert-butoxy C9(a and b) --Cl -iso-propoxy C10(a and b) --Cl
--CF.sub.3 C11(a and b) --Cl --OCF.sub.3 C12(a and b) --Cl --Cl
C13(a and b) --Cl --Br C14(a and b) --Cl --I C15(a and b) --Cl
-n-butyl C16(a and b) --Cl -n-propyl C17(a and b) --F --H C18(a and
b) --F -tert-butyl C19(a and b) --F -iso-butyl C20(a and b) --F
-sec-butyl C21(a and b) --F -iso-propyl C22(a and b) --F -n-propyl
C23(a and b) --F -cyclohexyl C24(a and b) --F -tert-butoxy C25(a
and b) --F -iso-propoxy C26(a and b) --F --CF.sub.3 C27(a and b)
--F --OCF.sub.3 C28(a and b) --F --Cl C29(a and b) --F --Br C30(a
and b) --F --I C31(a and b) --F -n-butyl C32(a and b) --F -n-propyl
C33(a and b) --CH.sub.3 --H C34(a and b) --CH.sub.3 -iso-butyl
C35(a and b) --CH.sub.3 -tert-butyl C36(a and b) --CH.sub.3
-sec-butyl C37(a and b) --CH.sub.3 -iso-propyl C38(a and b)
--CH.sub.3 -n-propyl C39(a and b) --CH.sub.3 -cyclohexyl C40(a and
b) --CH.sub.3 -tert-butoxy C41(a and b) --CH.sub.3 -iso-propoxy
C42(a and b) --CH.sub.3 --CF.sub.3 C43(a and b) --CH.sub.3
--OCF.sub.3 C44(a and b) --CH.sub.3 --Cl C45(a and b) --CH.sub.3
--Br C46(a and b) --CH.sub.3 --I C47(a and b) --CH.sub.3 -n-butyl
C48(a and b) --CH.sub.3 -n-propyl C49(a and b) --CF.sub.3 --H C50(a
and b) --CF.sub.3 -tert-butyl C51(a and b) --CF.sub.3 -iso-butyl
C52(a and b) --CF.sub.3 -sec-butyl C53(a and b) --CF.sub.3
-iso-propyl C54(a and b) --CF.sub.3 -n-propyl C55(a and b)
--CF.sub.3 -cyclohexyl C56(a and b) --CF.sub.3 -tert-butoxy C57(a
and b) --CF.sub.3 -iso-propoxy C58(a and b) --CF.sub.3 --CF.sub.3
C59(a and b) --CF.sub.3 --OCF.sub.3 C60(a and b) --CF.sub.3 --Cl
C61(a and b) --CF.sub.3 --Br C62(a and b) --CF.sub.3 --I C63(a and
b) --CF.sub.3 -n-butyl C64(a and b) --CF.sub.3 -n-propyl C65(a and
b) --CHF.sub.2 -tert-butyl C66(a and b) --CHF.sub.2 --H C67(a and
b) --CHF.sub.2 -iso-butyl C68(a and b) --CHF.sub.2 -sec-butyl C69(a
and b) --CHF.sub.2 -iso-propyl C70(a and b) --CHF.sub.2 -n-propyl
C71(a and b) --CHF.sub.2 -cyclohexyl C72(a and b) --CHF.sub.2
-tert-butoxy C73(a and b) --CHF.sub.2 -iso-propoxy C74(a and b)
--CHF.sub.2 --CF.sub.3 C75(a and b) --CHF.sub.2 --OCF.sub.3 C76(a
and b) --CHF.sub.2 --Cl C77(a and b) --CHF.sub.2 --Br C78(a and b)
--CHF.sub.2 --I C79(a and b) --CHF.sub.2 -n-butyl C80(a and b)
--CHF.sub.2 -n-propyl C81(a and b) --Br --H C82(a and b) --Br
-tert-butyl C83(a and b) --Br -iso-butyl C84(a and b) --Br
-sec-butyl C85(a and b) --Br -iso-propyl C86(a and b) --Br
-n-propyl C87(a and b) --Br -cyclohexyl C88(a and b) --Br
-tert-butoxy C89(a and b) --Br -iso-propoxy C90(a and b) --Br
--CF.sub.3 C91(a and b) --Br --OCF.sub.3 C92(a and b) --Br --Cl
C93(a and b) --Br --Br C94(a and b) --Br --I C95(a and b) --Br
-n-butyl C96(a and b) --Br -n-propyl C97(a and b) --I -tert-butyl
C98(a and b) --I --H C99(a and b) --I -iso-butyl C100(a and b) --I
-sec-butyl C101(a and b) --I -iso-propyl C102(a and b) --I
-n-propyl C103(a and b) --I -cyclohexyl C104(a and b) --I
-tert-butoxy C105(a and b) --I -iso-propoxy C106(a and b) --I
--CF.sub.3 C107(a and b) --I --OCF.sub.3 C108(a and b) --I --Cl
C109(a and b) --I --Br C110(a and b) --I --I C111(a and b) --I
-n-butyl C112(a and b) --I -n-propyl In the column labeled
"Compound": (a) means Z.sub.1 is CH and Z.sub.2 is N; and (b) means
Z.sub.1 is N and Z.sub.2 is CH.
TABLE-US-00004 TABLE 4 (VI) ##STR00087## Compound R.sub.1 R.sub.8a
D1(a and b) --Cl --H D2(a and b) --Cl -tert-butyl D3(a and b) --Cl
-iso-butyl D4(a and b) --Cl -sec-butyl D5(a and b) --Cl -iso-propyl
D6(a and b) --Cl -n-propyl D7(a and b) --Cl -cyclohexyl D8(a and b)
--Cl -tert-butoxy D9(a and b) --Cl -iso-propoxy D10(a and b) --Cl
--CF.sub.3 D11(a and b) --Cl --OCF.sub.3 D12(a and b) --Cl --Cl
D13( a and b) --Cl --Br D14( a and b) --Cl --I D15(a and b) --Cl
-n-butyl D16(a and b) --Cl -n-propyl D17(a and b) --F --H D18(a and
b) --F -tert-butyl D19(a and b) --F -iso-butyl D20(a and b) --F
-sec-butyl D21(a and b) --F -iso-propyl D22(a and b) --F -n-propyl
D23(a and b) --F -cyclohexyl D24(a and b) --F -tert-butoxy D25(a
and b) --F -iso-propoxy D26(a and b) --F --CF.sub.3 D27(a and b)
--F --OCF.sub.3 D28(a and b) --F --Cl D29(a and b) --F --Br D30(a
and b) --F --I D31(a and b) --F -n-butyl D32(a and b) --F -n-propyl
D33(a and b) --CH.sub.3 --H D34(a and b) --CH.sub.3 -iso-butyl
D35(a and b) --CH.sub.3 -tert-butyl D36(a and b) --CH.sub.3
-sec-butyl D37(a and b) --CH.sub.3 -iso-propyl D38(a and b)
--CH.sub.3 -n-propyl D39(a and b) --CH.sub.3 -cyclohexyl D40(a and
b) --CH.sub.3 -tert-butoxy D41(a and b) --CH.sub.3 -iso-propoxy
D42(a and b) --CH.sub.3 --CF.sub.3 D43(a and b) --CH.sub.3
--OCF.sub.3 D44(a and b) --CH.sub.3 --Cl D45(a and b) --CH.sub.3
--Br D46(a and b) --CH.sub.3 --I D47(a and b) --CH.sub.3 -n-butyl
D48(a and b) --CH.sub.3 -n-propyl D49(a and b) --CF.sub.3 --H D50(a
and b) --CF.sub.3 -tert-butyl D51(a and b) --CF.sub.3 -iso-butyl
D52(a and b) --CF.sub.3 -sec-butyl D53(a and b) --CF.sub.3
-iso-propyl D54(a and b) --CF.sub.3 -n-propyl D55(a and b)
--CF.sub.3 -cyclohexyl D56(a and b) --CF.sub.3 -tert-butoxy D57(a
and b) --CF.sub.3 -iso-propoxy D58(a and b) --CF.sub.3 --CF.sub.3
D59(a and b) --CF.sub.3 --OCF.sub.3 D60(a and b) --CF.sub.3 --Cl
D61(a and b) --CF.sub.3 --Br D62(a and b) --CF.sub.3 --I D63(a and
b) --CF.sub.3 -n-butyl D64(a and b) --CF.sub.3 -n-propyl D65(a and
b) --CHF.sub.2 -tert-butyl D66(a and b) --CHF.sub.2 --H D67(a and
b) --CHF.sub.2 -iso-butyl D68(a and b) --CHF.sub.2 -sec-butyl D69(a
and b) --CHF.sub.2 -iso-propyl D70(a and b) --CHF.sub.2 -n-propyl
D71(a and b) --CHF.sub.2 -cyclohexyl D72(a and b) --CHF.sub.2
-tert-butoxy D73(a and b) --CHF.sub.2 -iso-propoxy D74(a and b)
--CHF.sub.2 --CF.sub.3 D75(a and b) --CHF.sub.2 --OCF.sub.3 D76(a
and b) --CHF.sub.2 --Cl D77(a and b) --CHF.sub.2 --Br D78(a and b)
--CHF.sub.2 --I D79(a and b) --CHF.sub.2 -n-butyl D80(a and b)
--CHF.sub.2 -n-propyl D81(a and b) --Br --H D82(a and b) --Br
-tert-butyl D83(a and b) --Br -iso-butyl D84(a and b) --Br
-sec-butyl D85(a and b) --Br -iso-propyl D86(a and b) --Br
-n-propyl D87(a and b) --Br -cyclohexyl D88(a and b) --Br
-tert-butoxy D89(a and b) --Br -iso-propoxy D90(a and b) --Br
--CF.sub.3 D91(a and b) --Br --OCF.sub.3 D92(a and b) --Br --Cl
D93(a and b) --Br --Br D94(a and b) --Br --I D95(a and b) --Br
-n-butyl D96(a and b) --Br -n-propyl D97(a and b) --I -tert-butyl
D98(a and b) --I --H D99(a and b) --I -iso-butyl D100(a and b) --I
-sec-butyl D101(a and b) --I -iso-propyl D102(a and b) --I
-n-propyl D103(a and b) --I -cyclohexyl D104(a and b) --I
-tert-butoxy D105(a and b) --I -iso-propoxy D106(a and b) --I
--CF.sub.3 D107(a and b) --I --OCF.sub.3 D108(a and b) --I --Cl
D109(a and b) --I --Br D110(a and b) --I --I D111(a and b) --I
-n-butyl D112(a and b) --I -n-propyl In the column labeled
"Compound": (a) means Z.sub.1 is CH and Z.sub.2 is N; and (b) means
Z.sub.1 is N and Z.sub.2 is CH.
TABLE-US-00005 TABLE 5 (VII) ##STR00088## Compound R.sub.1 R.sub.8a
E1(a and b) --Cl --H E2(a and b) --Cl -tert-butyl E3(a and b) --Cl
-iso-butyl E4(a and b) --Cl -sec-butyl E5(a and b) --Cl -iso-propyl
E6(a and b) --Cl -n-propyl E7(a and b) --Cl -cyclohexyl E8(a and b)
--Cl -tert-butoxy E9(a and b) --Cl -iso-propoxy E10(a and b) --Cl
--CF.sub.3 E11(a and b) --Cl --OCF.sub.3 E12(a and b) --Cl --Cl
E13(a and b) --Cl --Br E14(a and b) --Cl --I E15(a and b) --Cl
-n-butyl E16(a and b) --Cl -n-propyl E17(a and b) --F --H E18(a and
b) --F -tert-butyl E19(a and b) --F -iso-butyl E20(a and b) --F
-sec-butyl E21(a and b) --F -iso-propyl E22(a and b) --F -n-propyl
E23(a and b) --F -cyclohexyl E24(a and b) --F -tert-butoxy E25(a
and b) --F -iso-propoxy E26(a and b) --F --CF.sub.3 E27(a and b)
--F --OCF.sub.3 E28(a and b) --F --Cl E29(a and b) --F --Br E30(a
and b) --F --I E31(a and b) --F -n-butyl E32(a and b) --F -n-propyl
E33(a and b) --CH.sub.3 --H E34(a and b) --CH.sub.3 -iso-butyl
E35(a and b) --CH.sub.3 -tert-butyl E36(a and b) --CH.sub.3
-sec-butyl E37(a and b) --CH.sub.3 -iso-propyl E38(a and b)
--CH.sub.3 -n-propyl E39(a and b) --CH.sub.3 -cyclohexyl E40(a and
b) --CH.sub.3 -tert-butoxy E41(a and b) --CH.sub.3 -iso-propoxy
E42(a and b) --CH.sub.3 --CF.sub.3 E43(a and b) --CH.sub.3
--OCF.sub.3 E44(a and b) --CH.sub.3 --Cl E45(a and b) --CH.sub.3
--Br E46(a and b) --CH.sub.3 --I E47(a and b) --CH.sub.3 -n-butyl
E48(a and b) --CH.sub.3 -n-propyl E49(a and b) --CF.sub.3 --H E50(a
and b) --CF.sub.3 -tert-butyl E51(a and b) --CF.sub.3 -iso-butyl
E52(a and b) --CF.sub.3 -sec-butyl E53(a and b) --CF.sub.3
-iso-propyl E54(a and b) --CF.sub.3 -n-propyl E55(a and b)
--CF.sub.3 -cyclohexyl E56(a and b) --CF.sub.3 -tert-butoxy E57(a
and b) --CF.sub.3 -iso-propoxy E58(a and b) --CF.sub.3 --CF.sub.3
E59(a and b) --CF.sub.3 --OCF.sub.3 E60(a and b) --CF.sub.3 --Cl
E61(a and b) --CF.sub.3 --Br E62(a and b) --CF.sub.3 --I E63(a and
b) --CF.sub.3 -n-butyl E64(a and b) --CF.sub.3 -n-propyl E65(a and
b) --CHF.sub.2 -tert-butyl E66(a and b) --CHF.sub.2 --H E67(a and
b) --CHF.sub.2 -iso-butyl E68(a and b) --CHF.sub.2 -sec-butyl E69(a
and b) --CHF.sub.2 -iso-propyl E70(a and b) --CHF.sub.2 -n-propyl
E71(a and b) --CHF.sub.2 -cyclohexyl E72(a and b) --CHF.sub.2
-tert-butoxy E73(a and b) --CHF.sub.2 -iso-propoxy E74(a and b)
--CHF.sub.2 --CF.sub.3 E75(a and b) --CHF.sub.2 --OCF.sub.3 E76(a
and b) --CHF.sub.2 --Cl E77(a and b) --CHF.sub.2 --Br E78(a and b)
--CHF.sub.2 --I E79(a and b) --CHF.sub.2 -n-butyl E80(a and b)
--CHF.sub.2 -n-propyl E81(a and b) --Br --H E82(a and b) --Br
-tert-butyl E83(a and b) --Br -iso-butyl E84(a and b) --Br
-sec-butyl E85(a and b) --Br -iso-propyl E86(a and b) --Br
-n-propyl E87(a and b) --Br -cyclohexyl E88(a and b) --Br
-tert-butoxy E89(a and b) --Br -iso-propoxy E90(a and b) --Br
--CF.sub.3 E91(a and b) --Br --OCF.sub.3 E92(a and b) --Br --Cl
E93(a and b) --Br --Br E94(a and b) --Br --I E95(a and b) --Br
-n-butyl E96(a and b) --Br -n-propyl E97(a and b) --I -tert-butyl
E98(a and b) --I --H E99(a and b) --I -iso-butyl E100(a and b) --I
-sec-butyl E101(a and b) --I -iso-propyl E102(a and b) --I
-n-propyl E103(a and b) --I -cyclohexyl E104(a and b) --I
-tert-butoxy E105(a and b) --I -iso-propoxy E106(a and b) --I
--CF.sub.3 E107(a and b) --I --OCF.sub.3 E108(a and b) --I --Cl
E109(a and b) --I --Br E110(a and b) --I --I E111(a and b) --I
-n-butyl E112(a and b) --I -n-propyl In the column labeled
"Compound": (a) means Z.sub.1 is CH and Z.sub.2 is N; and (b) means
Z.sub.1 is N and Z.sub.2 is CH.
TABLE-US-00006 TABLE 6 (VIII) ##STR00089## Compound Y R.sub.1
(R.sub.8).sub.a (R.sub.8).sub.b F1(a and b) S --Cl --Cl --H F2(a
and b) S --Cl --Br --H F3(a and b) S --Cl --F --H F4(a and b) S
--Cl --CH.sub.3 --H F5(a and b) S --Cl --CF.sub.3 --H F6(a and b) S
--Cl --OCH.sub.3 --H F7(a and b) S --Cl --OCH.sub.2CH.sub.3 --H
F8(a and b) S --Cl --OCF.sub.3 --H F9(a and b) S --Cl -tert-butyl
--H F10(a and b) S --Cl -iso-propyl --H F11(a and b) S --Cl
--CH.sub.3 --CH.sub.3 F12(a and b) S --Cl --H --H F13(a and b) S
--Cl --H --Cl F14(a and b) S --Cl --H --Br F15(a and b) S --Cl --H
--F F16(a and b) S --Cl --H --CH.sub.3 F17(a and b) S --Cl --H
--CF.sub.3 F18(a and b) S --Cl --H --OCH.sub.3 F19(a and b) S --Cl
--H --OCH.sub.2CH.sub.3 F20(a and b) S --Cl --H --OCF.sub.3 F21(a
and b) S --Cl --H -tert-butyl F22(a and b) S --Cl --H -iso-propyl
F23(a and b) S --CH.sub.3 --Cl --H F24(a and b) S --CH.sub.3 --Br
--H F25(a and b) S --CH.sub.3 --F --H F26(a and b) S --CH.sub.3
--CH.sub.3 --H F27(a and b) S --CH.sub.3 --CF.sub.3 --H F28(a and
b) S --CH.sub.3 --OCH.sub.3 --H F29(a and b) S --CH.sub.3
--OCH.sub.2CH.sub.3 --H F30(a and b) S --CH.sub.3 --OCF.sub.3 --H
F31(a and b) S --CH.sub.3 -tert-butyl --H F32(a and b) S --CH.sub.3
-iso-propyl --H F33(a and b) S --CH.sub.3 --CH.sub.3 --CH.sub.3
F34(a and b) S --CH.sub.3 --H --H F35(a and b) S --CH.sub.3 --H
--Cl F36(a and b) S --CH.sub.3 --H --Br F37(a and b) S --CH.sub.3
--H --F F38(a and b) S --CH.sub.3 --H --CH.sub.3 F39(a and b) S
--CH.sub.3 --H --CF.sub.3 F40(a and b) S --CH.sub.3 --H --OCH.sub.3
F41(a and b) S --CH.sub.3 --H --OCH.sub.2CH.sub.3 F42(a and b) S
--CH.sub.3 --H --OCF.sub.3 F43(a and b) S --CH.sub.3 --H
-tert-butyl F44(a and b) S --CH.sub.3 --H -iso-propyl F45(a and b)
S --CF.sub.3 --Cl --H F46(a and b) S --CF.sub.3 --Br --H F47(a and
b) S --CF.sub.3 --F --H F48(a and b) S --CF.sub.3 --CH.sub.3 --H
F49(a and b) S --CF.sub.3 --CF.sub.3 --H F50(a and b) S --CF.sub.3
--OCH.sub.3 --H F51(a and b) S --CF.sub.3 --OCH.sub.2CH.sub.3 --H
F52(a and b) S --CF.sub.3 --OCF.sub.3 --H F53(a and b) S --CF.sub.3
-tert-butyl --H F54(a and b) S --CF.sub.3 -iso-propyl --H F55(a and
b) S --CF.sub.3 --CH.sub.3 --CH.sub.3 F56(a and b) S --CF.sub.3 --H
--H F57(a and b) S --CF.sub.3 --H --Cl F58(a and b) S --CF.sub.3
--H --Br F59(a and b) S --CF.sub.3 --H --F F60(a and b) S
--CF.sub.3 --H --CH.sub.3 F61(a and b) S --CF.sub.3 --H --CF.sub.3
F62(a and b) S --CF.sub.3 --H --OCH.sub.3 F63(a and b) S --CF.sub.3
--H --OCH.sub.2CH.sub.3 F64(a and b) S --CF.sub.3 --H --OCF.sub.3
F65(a and b) S --CF.sub.3 --H -tert-butyl F66(a and b) S --CF.sub.3
--H -iso-propyl F67(a and b) S --CHF.sub.2 --Cl --H F68(a and b) S
--CHF.sub.2 --Br --H F69(a and b) S --CHF.sub.2 --F --H F70(a and
b) S --CHF.sub.2 --CH.sub.3 --H F71(a and b) S --CHF.sub.2
--CF.sub.3 --H F72(a and b) S --CHF.sub.2 --OCH.sub.3 --H F73(a and
b) S --CHF.sub.2 --OCH.sub.2CH.sub.3 --H F74(a and b) S --CHF.sub.2
--OCF.sub.3 --H F75(a and b) S --CHF.sub.2 -tert-butyl --H F76(a
and b) S --CHF.sub.2 -iso-propyl --H F77(a and b) S --CHF.sub.2
--CH.sub.3 --CH.sub.3 F78(a and b) S --CHF.sub.2 --H --H F79(a and
b) S --CHF.sub.2 --H --Cl F80(a and b) S --CHF.sub.2 --H --Br F81(a
and b) S --CHF.sub.2 --H --F F82(a and b) S --CHF.sub.2 --H
--CH.sub.3 F83(a and b) S --CHF.sub.2 --H --CF.sub.3 F84(a and b) S
--CHF.sub.2 --H --OCH.sub.3 F85(a and b) S --CHF.sub.2 --H
--OCH.sub.2CH.sub.3 F86(a and b) S --CHF.sub.2 --H --OCF.sub.3
F87(a and b) S --CHF.sub.2 --H -tert-butyl F88(a and b) S
--CHF.sub.2 --H -iso-propyl F89(a and b) S --Br --Br --H F90(a and
b) S --Br --Cl --H F91(a and b) S --Br --F --H F92(a and b) S --Br
--CH.sub.3 --H F93(a and b) S --Br --CF.sub.3 --H F94(a and b) S
--Br --OCH.sub.3 --H F95(a and b) S --Br --OCH.sub.2CH.sub.3 --H
F96(a and b) S --Br --OCF.sub.3 --H F97(a and b) S --Br -tert-butyl
--H F98(a and b) S --Br -iso-propyl --H F99(a and b) S --Br
--CH.sub.3 --CH.sub.3 F100(a and b) S --Br --H --H F101(a and b) S
--Br --H --Cl F102(a and b) S --Br --H --Br F103(a and b) S --Br
--H --F F104(a and b) S --Br --H --CH.sub.3 F105(a and b) S --Br
--H --CF.sub.3 F106(a and b) S --Br --H --OCH.sub.3 F107(a and b) S
--Br --H --OCH.sub.2CH.sub.3 F108(a and b) S --Br --H --OCF.sub.3
F109(a and b) S --Br --H -tert-butyl F110(a and b) S --Br --H
-iso-propyl F111(a and b) S --I --Cl --H F112(a and b) S --I --Br
--H F113(a and b) S --I --F --H F114(a and b) S --I --CH.sub.3 --H
F115(a and b) S --I --CF.sub.3 --H F116(a and b) S --I --OCH.sub.3
--H F117(a and b) S --I --OCH.sub.2CH.sub.3 --H F118(a and b) S --I
--OCF.sub.3 --H F119(a and b) S --I -tert-butyl --H F120(a and b) S
--I -iso-propyl --H F121(a and b) S --I --CH.sub.3 --CH.sub.3
F122(a and b) S --I --H --H F123(a and b) S --I --H --Cl F124(a and
b) S --I --H --Br F125(a and b) S --I --H --F F126(a and b) S --I
--H --CH.sub.3 F127(a and b) S --I --H --CF.sub.3 F128(a and b) S
--I --H --OCH.sub.3 F129(a and b) S --I --H --OCH.sub.2CH.sub.3
F130(a and b) S --I --H --OCF.sub.3 F131(a and b) S --I --H
-tert-butyl F132(a and b) S --I --H -iso-propyl F133(a and b) O
--Cl --Cl --H F134(a and b) O --Cl --Br --H F135(a and b) O --Cl
--F --H F136(a and b) O --Cl --CH.sub.3 --H F137(a and b) O --Cl
--CF.sub.3 --H F138(a and b) O --Cl --OCH.sub.3 --H F139(a and b) O
--Cl --OCH.sub.2CH.sub.3 --H F140(a and b) O --Cl --OCF.sub.3 --H
F141(a and b) O --Cl -tert-butyl --H F142(a and b) O --Cl
-iso-propyl --H F143(a and b) O --Cl --CH.sub.3 --CH.sub.3 F144(a
and b) O --Cl --H --H F145(a and b) O --Cl --H --CH.sub.3 F146(a
and b) O --Cl --H --Cl F147(a and b) O --Cl --H --Br F148(a and b)
O --Cl --H --F F149(a and b) O --Cl --H --CF.sub.3 F150(a and b) O
--Cl --H --OCH.sub.3 F151(a and b) O --Cl --H --OCH.sub.2CH.sub.3
F152(a and b) O --Cl --H --OCF.sub.3 F153(a and b) O --Cl --H
-tert-butyl F154(a and b) O --Cl --H -iso-propyl F155(a and b) O
--CH.sub.3 --Cl --H F156(a and b) O --CH.sub.3 --Br --H F157(a and
b) O --CH.sub.3 --F --H F158(a and b) O --CH.sub.3 --CH.sub.3 --H
F159(a and b) O --CH.sub.3 --CF.sub.3 --H F160(a and b) O
--CH.sub.3 --OCH.sub.3 --H F161(a and b) O --CH.sub.3
--OCH.sub.2CH.sub.3 --H F162(a and b) O --CH.sub.3 --OCF.sub.3 --H
F163(a and b) O --CH.sub.3 -tert-butyl --H F164(a and b) O
--CH.sub.3 -iso-propyl --H F165(a and b) O --CH.sub.3 --CH.sub.3
--CH.sub.3 F166(a and b) O --CH.sub.3 --H --H F167(a and b) O
--CH.sub.3 --H --Cl F168(a and b) O --CH.sub.3 --H --Br F169(a and
b) O --CH.sub.3 --H --F F170(a and b) O --CH.sub.3 --H --CH.sub.3
F171(a and b) O --CH.sub.3 --H --CF.sub.3 F172(a and b) O
--CH.sub.3 --H --OCH.sub.3 F173(a and b) O --CH.sub.3 --H
--OCH.sub.2CH.sub.3 F174(a and b) O --CH.sub.3 --H --OCF.sub.3
F175(a and b) O --CH.sub.3 --H -tert-butyl F176(a and b) O
--CH.sub.3 --H -iso-propyl F177(a and b) O --CF.sub.3 --Cl --H
F178(a and b) O --CF.sub.3 --Br --H F179(a and b) O --CF.sub.3 --F
--H F180(a and b) O --CF.sub.3 --CH.sub.3 --H F181(a and b) O
--CF.sub.3 --CF.sub.3 --H F182(a and b) O --CF.sub.3 --OCH.sub.3
--H F183(a and b) O --CF.sub.3 --OCH.sub.2CH.sub.3 --H F184(a and
b) O --CF.sub.3 --OCF.sub.3 --H F185(a and b) O --CF.sub.3
-tert-butyl --H F186(a and b) O --CF.sub.3 -iso-propyl --H F187(a
and b) O --CF.sub.3 --CH.sub.3 --CH.sub.3 F188(a and b) O
--CF.sub.3 --H --H F189(a and b) O --CF.sub.3 --H --Cl F190(a and
b) O --CF.sub.3 --H --Br F191(a and b) O --CF.sub.3 --H --F F192(a
and b) O --CF.sub.3 --H --CH.sub.3 F193(a and b) O --CF.sub.3 --H
--CF.sub.3 F194(a and b) O --CF.sub.3 --H --OCH.sub.3 F195(a and b)
O --CF.sub.3 --H --OCH.sub.2CH.sub.3 F196(a and b) O --CF.sub.3 --H
--OCF.sub.3 F197(a and b) O --CF.sub.3 --H -tert-butyl F198(a and
b) O --CF.sub.3 --H -iso-propyl F199(a and b) O --CHF.sub.2 --Cl
--H F200(a and b) O --CHF.sub.2 --Br --H F201(a and b) O
--CHF.sub.2 --F --H F202(a and b) O --CHF.sub.2 --CH.sub.3 --H
F203(a and b) O --CHF.sub.2 --CF.sub.3 --H F204(a and b) O
--CHF.sub.2 --OCH.sub.3 --H F205(a and b) O --CHF.sub.2
--OCH.sub.2CH.sub.3 --H F206(a and b) O --CHF.sub.2 --OCF.sub.3 --H
F207(a and b) O --CHF.sub.2 -tert-butyl --H F208(a and b) O
--CHF.sub.2 -iso-propyl --H F209(a and b) O --CHF.sub.2 --CH.sub.3
--CH.sub.3 F210(a and b) O --CHF.sub.2 --H --H F211(a and b) O
--CHF.sub.2 --H --Cl F212(a and b) O --CHF.sub.2 --H --Br F213(a
and b) O --CHF.sub.2 --H --F F214(a and b) O --CHF.sub.2 --H
--CH.sub.3 F215(a and b) O --CHF.sub.2 --H --CF.sub.3 F216(a and b)
O --CHF.sub.2 --H --OCH.sub.3 F217(a and b) O --CHF.sub.2 --H
--OCH.sub.2CH.sub.3 F218(a and b) O --CHF.sub.2 --H --OCF.sub.3
F219(a and b) O --CHF.sub.2 --H -tert-butyl F220(a and b) O
--CHF.sub.2 --H -iso-propyl F221(a and b) O --Br --Br --H F222(a
and b) O --Br --Cl --H F223(a and b) O --Br --F --H F224(a and b) O
--Br --CH.sub.3 --H F225(a and b) O --Br --CF.sub.3 --H F226(a and
b) O --Br --OCH.sub.3 --H F227(a and b) O --Br --OCH.sub.2CH.sub.3
--H F228(a and b) O --Br --OCF.sub.3 --H F229(a and b) O --Br
-tert-butyl --H F230(a and b) O --Br -iso-propyl --H F231(a and b)
O --Br --CH.sub.3 --CH.sub.3 F232(a and b) O --Br --H --H F233(a
and b) O --Br --H --Cl F234(a and b) O --Br --H --Br F235(a and b)
O --Br --H --F F236(a and b) O --Br --H --CH.sub.3 F237(a and b) O
--Br --H --CF.sub.3 F238(a and b) O --Br --H --OCH.sub.3 F239(a and
b) O --Br --H --OCH.sub.2CH.sub.3 F240(a and b) O --Br --H
--OCF.sub.3 F241(a and b) O --Br --H -tert-butyl F242(a and b) O
--Br --H -iso-propyl F243(a and b) O --I --Cl --H
F244(a and b) O --I --Br --H F245(a and b) O --I --F --H F246(a and
b) O --I --CH.sub.3 --H F247(a and b) O --I --CF.sub.3 --H F248(a
and b) O --I --OCH.sub.3 --H F249(a and b) O --I
--OCH.sub.2CH.sub.3 --H F250(a and b) O --I --OCF.sub.3 --H F251(a
and b) O --I -tert-butyl --H F252(a and b) O --I -iso-propyl --H
F253(a and b) O --I --CH.sub.3 --CH.sub.3 F254(a and b) O --I --H
--H F255(a and b) O --I --H --Cl F256(a and b) O --I --H --Br
F257(a and b) O --I --H --F F258(a and b) O --I --H --CH.sub.3
F259(a and b) O --I --H --CF.sub.3 F260(a and b) O --I --H
--OCH.sub.3 F261(a and b) O --I --H --OCH.sub.2CH.sub.3 F262(a and
b) O --I --H --OCF.sub.3 F263(a and b) O --I --H -tert-butyl F264(a
and b) O --I --H -iso-propyl F265(a and b) NH --Cl --Cl --H F266(a
and b) NH --Cl --Br --H F267(a and b) NH --Cl --F --H F268(a and b)
NH --Cl --CH.sub.3 --H F269(a and b) NH --Cl --CF.sub.3 --H F270(a
and b) NH --Cl --OCH.sub.3 --H F271(a and b) NH --Cl
--OCH.sub.2CH.sub.3 --H F272(a and b) NH --Cl --OCF.sub.3 --H
F273(a and b) NH --Cl -tert-butyl --H F274(a and b) NH --Cl
-iso-propyl --H F275(a and b) NH --Cl --CH.sub.3 --CH.sub.3 F276(a
and b) NH --Cl --H --H F277(a and b) NH --Cl --H --CH.sub.3 F278(a
and b) NH --Cl --H --Cl F279(a and b) NH --Cl --H --Br F280(a and
b) NH --Cl --H --F F281(a and b) NH --Cl --H --CF.sub.3 F282(a and
b) NH --Cl --H --OCH.sub.3 F283(a and b) NH --Cl --H
--OCH.sub.2CH.sub.3 F284(a and b) NH --Cl --H --OCF.sub.3 F285(a
and b) NH --Cl --H -tert-butyl F286(a and b) NH --Cl --H
-iso-propyl F287(a and b) NH --CH.sub.3 --Cl --H F288(a and b) NH
--CH.sub.3 --Br --H F289(a and b) NH --CH.sub.3 --F --H F290(a and
b) NH --CH.sub.3 --CH.sub.3 --H F291(a and b) NH --CH.sub.3
--CF.sub.3 --H F292(a and b) NH --CH.sub.3 --OCH.sub.3 --H F293(a
and b) NH --CH.sub.3 --OCH.sub.2CH.sub.3 --H F294(a and b) NH
--CH.sub.3 --OCF.sub.3 --H F295(a and b) NH --CH.sub.3 -tert-butyl
--H F296(a and b) NH --CH.sub.3 -iso-propyl --H F297(a and b) NH
--CH.sub.3 --CH.sub.3 --CH.sub.3 F298(a and b) NH --CH.sub.3 --H
--H F299(a and b) NH --CH.sub.3 --H --Cl F300(a and b) NH
--CH.sub.3 --H --Br F301(a and b) NH --CH.sub.3 --H --F F302(a and
b) NH --CH.sub.3 --H --CH.sub.3 F303(a and b) NH --CH.sub.3 --H
--CF.sub.3 F304(a and b) NH --CH.sub.3 --H --OCH.sub.3 F305(a and
b) NH --CH.sub.3 --H --OCH.sub.2CH.sub.3 F306(a and b) NH
--CH.sub.3 --H --OCF.sub.3 F307(a and b) NH --CH.sub.3 --H
-tert-butyl F308(a and b) NH --CH.sub.3 --H -iso-propyl F309(a and
b) NH --CF.sub.3 --Cl --H F310(a and b) NH --CF.sub.3 --Br --H
F311(a and b) NH --CF.sub.3 --F --H F312(a and b) NH --CF.sub.3
--CH.sub.3 --H F313(a and b) NH --CF.sub.3 --CF.sub.3 --H F314(a
and b) NH --CF.sub.3 --OCH.sub.3 --H F315(a and b) NH --CF.sub.3
--OCH.sub.2CH.sub.3 --H F316(a and b) NH --CF.sub.3 --OCF.sub.3 --H
F317(a and b) NH --CF.sub.3 -tert-butyl --H F318(a and b) NH
--CF.sub.3 -iso-propyl --H F319(a and b) NH --CF.sub.3 --CH.sub.3
--CH.sub.3 F320(a and b) NH --CF.sub.3 --H --H F321(a and b) NH
--CF.sub.3 --H --Cl F322(a and b) NH --CF.sub.3 --H --Br F323(a and
b) NH --CF.sub.3 --H --F F324(a and b) NH --CF.sub.3 --H --CH.sub.3
F325(a and b) NH --CF.sub.3 --H --CF.sub.3 F326(a and b) NH
--CF.sub.3 --H --OCH.sub.3 F327(a and b) NH --CF.sub.3 --H
--OCH.sub.2CH.sub.3 F328(a and b) NH --CF.sub.3 --H --OCF.sub.3
F329(a and b) NH --CF.sub.3 --H -tert-butyl F330(a and b) NH
--CF.sub.3 --H -iso-propyl F331(a and b) NH --CHF.sub.2 --Cl --H
F332(a and b) NH --CHF.sub.2 --Br --H F333(a and b) NH --CHF.sub.2
--F --H F334(a and b) NH --CHF.sub.2 --CH.sub.3 --H F335(a and b)
NH --CHF.sub.2 --CF.sub.3 --H F336(a and b) NH --CHF.sub.2
--OCH.sub.3 --H F337(a and b) NH --CHF.sub.2 --OCH.sub.2CH.sub.3
--H F338(a and b) NH --CHF.sub.2 --OCF.sub.3 --H F339(a and b) NH
--CHF.sub.2 -tert-butyl --H F340(a and b) NH --CHF.sub.2
-iso-propyl --H F341(a and b) NH --CHF.sub.2 --CH.sub.3 --CH.sub.3
F342(a and b) NH --CHF.sub.2 --H --H F343(a and b) NH --CHF.sub.2
--H --Cl F344(a and b) NH --CHF.sub.2 --H --Br F345(a and b) NH
--CHF.sub.2 --H --F F346(a and b) NH --CHF.sub.2 --H --CH.sub.3
F347(a and b) NH --CHF.sub.2 --H --CF.sub.3 F348(a and b) NH
--CHF.sub.2 --H --OCH.sub.3 F349(a and b) NH --CHF.sub.2 --H
--OCH.sub.2CH.sub.3 F350(a and b) NH --CHF.sub.2 --H --OCF.sub.3
F351(a and b) NH --CHF.sub.2 --H -tert-butyl F352(a and b) NH
--CHF.sub.2 --H -iso-propyl F353(a and b) NH --Br --Br --H F354(a
and b) NH --Br --Cl --H F355(a and b) NH --Br --F --H F356(a and b)
NH --Br --CH.sub.3 --H F357(a and b) NH --Br --CF.sub.3 --H F358(a
and b) NH --Br --OCH.sub.3 --H F359(a and b) NH --Br
--OCH.sub.2CH.sub.3 --H F360(a and b) NH --Br --OCF.sub.3 --H
F361(a and b) NH --Br -tert-butyl --H F362(a and b) NH --Br
-iso-propyl --H F363(a and b) NH --Br --CH.sub.3 --CH.sub.3 F364(a
and b) NH --Br --H --H F365(a and b) NH --Br --H --Cl F366(a and b)
NH --Br --H --Br F367(a and b) NH --Br --H --F F368(a and b) NH
--Br --H --CH.sub.3 F369(a and b) NH --Br --H --CF.sub.3 F370(a and
b) NH --Br --H --OCH.sub.3 F371(a and b) NH --Br --H
--OCH.sub.2CH.sub.3 F372(a and b) NH --Br --H --OCF.sub.3 F373(a
and b) NH --Br --H -tert-butyl F374(a and b) NH --Br --H
-iso-propyl F375(a and b) NH --I --Cl --H F376(a and b) NH --I --Br
--H F377(a and b) NH --I --F --H F378(a and b) NH --I --CH.sub.3
--H F379(a and b) NH --I --CF.sub.3 --H F380(a and b) NH --I
--OCH.sub.3 --H F381(a and b) NH --I --OCH.sub.2CH.sub.3 --H F382(a
and b) NH --I --OCF.sub.3 --H F383(a and b) NH --I -tert-butyl --H
F384(a and b) NH --I -iso-propyl --H F385(a and b) NH --I
--CH.sub.3 --CH.sub.3 F386(a and b) NH --I --H --H F387(a and b) NH
--I --H --Cl F388(a and b) NH --I --H --Br F389(a and b) NH --I --H
--F F390(a and b) NH --I --H --CH.sub.3 F391(a and b) NH --I --H
--CF.sub.3 F392(a and b) NH --I --H --OCH.sub.3 F393(a and b) NH
--I --H --OCH.sub.2CH.sub.3 F394(a and b) NH --I --H --OCF.sub.3
F395(a and b) NH --I --H -tert-butyl F396(a and b) NH --I --H
-iso-propyl In the column labeled "Compound": (a) means Z.sub.1 is
CH and Z.sub.2 is N; and (b) means Z.sub.1 is N and Z.sub.2 is
CH.
TABLE-US-00007 TABLE 7 (IX) ##STR00090## Compound Y R.sub.1
(R.sub.8).sub.a (R.sub.8).sub.b G1(a and b) S --Cl --Cl --H G2(a
and b) S --Cl --Br --H G3(a and b) S --Cl --F --H G4(a and b) S
--Cl --CH.sub.3 --H G5(a and b) S --Cl --CF.sub.3 --H G6(a and b) S
--Cl --OCH.sub.3 --H G7(a and b) S --Cl --OCH.sub.2CH.sub.3 --H
G8(a and b) S --Cl --OCF.sub.3 --H G9(a and b) S --Cl -tert-butyl
--H G10(a and b) S --Cl -iso-propyl --H G11(a and b) S --Cl
--CH.sub.3 --CH.sub.3 G12(a and b) S --Cl --H --H G13(a and b) S
--Cl --H --Cl G14(a and b) S --Cl --H --Br G15(a and b) S --Cl --H
--F G16(a and b) S --Cl --H --CH.sub.3 G17(a and b) S --Cl --H
--CF.sub.3 G18(a and b) S --Cl --H --OCH.sub.3 G19(a and b) S --Cl
--H --OCH.sub.2CH.sub.3 G20(a and b) S --Cl --H --OCF.sub.3 G21(a
and b) S --Cl --H -tert-butyl G22(a and b) S --Cl --H -iso-propyl
G23(a and b) S --CH.sub.3 --Cl --H G24(a and b) S --CH.sub.3 --Br
--H G25(a and b) S --CH.sub.3 --F --H G26(a and b) S --CH.sub.3
--CH.sub.3 --H G27(a and b) S --CH.sub.3 --CF.sub.3 --H G28(a and
b) S --CH.sub.3 --OCH.sub.3 --H G29(a and b) S --CH.sub.3
--OCH.sub.2CH.sub.3 --H G30(a and b) S --CH.sub.3 --OCF.sub.3 --H
G31(a and b) S --CH.sub.3 -tert-butyl --H G32(a and b) S --CH.sub.3
-iso-propyl --H G33(a and b) S --CH.sub.3 --CH.sub.3 --CH.sub.3
G34(a and b) S --CH.sub.3 --H --H G35(a and b) S --CH.sub.3 --H
--Cl G36(a and b) S --CH.sub.3 --H --Br G37(a and b) S --CH.sub.3
--H --F G38(a and b) S --CH.sub.3 --H --CH.sub.3 G39(a and b) S
--CH.sub.3 --H --CF.sub.3 G40(a and b) S --CH.sub.3 --H --OCH.sub.3
G41(a and b) S --CH.sub.3 --H --OCH.sub.2CH.sub.3 G42(a and b) S
--CH.sub.3 --H --OCF.sub.3 G43(a and b) S --CH.sub.3 --H
-tert-butyl G44(a and b) S --CH.sub.3 --H -iso-propyl G45(a and b)
S --CF.sub.3 --Cl --H G46(a and b) S --CF.sub.3 --Br --H G47(a and
b) S --CF.sub.3 --F --H G48(a and b) S --CF.sub.3 --CH.sub.3 --H
G49(a and b) S --CF.sub.3 --CF.sub.3 --H G50(a and b) S --CF.sub.3
--OCH.sub.3 --H G51(a and b) S --CF.sub.3 --OCH.sub.2CH.sub.3 --H
G52(a and b) S --CF.sub.3 --OCF.sub.3 --H G53(a and b) S --CF.sub.3
-tert-butyl --H G54(a and b) S --CF.sub.3 -iso-propyl --H G55(a and
b) S --CF.sub.3 --CH.sub.3 --CH.sub.3 G56(a and b) S --CF.sub.3 --H
--H G57(a and b) S --CF.sub.3 --H --Cl G58(a and b) S --CF.sub.3
--H --Br G59(a and b) S --CF.sub.3 --H --F G60(a and b) S
--CF.sub.3 --H --CH.sub.3 G61(a and b) S --CF.sub.3 --H --CF.sub.3
G62(a and b) S --CF.sub.3 --H --OCH.sub.3 G63(a and b) S --CF.sub.3
--H --OCH.sub.2CH.sub.3 G64(a and b) S --CF.sub.3 --H --OCF.sub.3
G65(a and b) S --CF.sub.3 --H -tert-butyl G66(a and b) S --CF.sub.3
--H -iso-propyl G67(a and b) S --CHF.sub.2 --Cl --H G68(a and b) S
--CHF.sub.2 --Br --H G69(a and b) S --CHF.sub.2 --F --H G70(a and
b) S --CHF.sub.2 --CH.sub.3 --H G71(a and b) S --CHF.sub.2
--CF.sub.3 --H G72(a and b) S --CHF.sub.2 --OCH.sub.3 --H G73(a and
b) S --CHF.sub.2 --OCH.sub.2CH.sub.3 --H G74(a and b) S --CHF.sub.2
--OCF.sub.3 --H G75(a and b) S --CHF.sub.2 -tert-butyl --H G76(a
and b) S --CHF.sub.2 -iso-propyl --H G77(a and b) S --CHF.sub.2
--CH.sub.3 --CH.sub.3 G78(a and b) S --CHF.sub.2 --H --H G79(a and
b) S --CHF.sub.2 --H --Cl G80(a and b) S --CHF.sub.2 --H --Br G81(a
and b) S --CHF.sub.2 --H --F G82(a and b) S --CHF.sub.2 --H
--CH.sub.3 G83(a and b) S --CHF.sub.2 --H --CF.sub.3 G84(a and b) S
--CHF.sub.2 --H --OCH.sub.3 G85(a and b) S --CHF.sub.2 --H
--OCH.sub.2CH.sub.3 G86(a and b) S --CHF.sub.2 --H --OCF.sub.3
G87(a and b) S --CHF.sub.2 --H -tert-butyl G88(a and b) S
--CHF.sub.2 --H -iso-propyl G89(a and b) S --Br --Br --H G90(a and
b) S --Br --Cl --H G91(a and b) S --Br --F --H G92(a and b) S --Br
--CH.sub.3 --H G93(a and b) S --Br --CF.sub.3 --H G94(a and b) S
--Br --OCH.sub.3 --H G95(a and b) S --Br --OCH.sub.2CH.sub.3 --H
G96(a and b) S --Br --OCF.sub.3 --H G97(a and b) S --Br -tert-butyl
--H G98(a and b) S --Br -iso-propyl --H G99(a and b) S --Br
--CH.sub.3 --CH.sub.3 G100(a and b) S --Br --H --H G101(a and b) S
--Br --H --Cl G102(a and b) S --Br --H --Br G103(a and b) S --Br
--H --F G104(a and b) S --Br --H --CH.sub.3 G105(a and b) S --Br
--H --CF.sub.3 G106(a and b) S --Br --H --OCH.sub.3 G107(a and b) S
--Br --H --OCH.sub.2CH.sub.3 G108(a and b) S --Br --H --OCF.sub.3
G109(a and b) S --Br --H -tert-butyl G110(a and b) S --Br --H
-iso-propyl G111(a and b) S --I --Cl --H G112(a and b) S --I --Br
--H G113(a and b) S --I --F --H G114(a and b) S --I --CH.sub.3 --H
G115(a and b) S --I --CF.sub.3 --H G116(a and b) S --I --OCH.sub.3
--H G117(a and b) S --I --OCH.sub.2CH.sub.3 --H G118(a and b) S --I
--OCF.sub.3 --H G119(a and b) S --I -tert-butyl --H G120(a and b) S
--I -iso-propyl --H G121(a and b) S --I --CH.sub.3 --CH.sub.3
G122(a and b) S --I --H --H G123(a and b) S --I --H --Cl G124(a and
b) S --I --H --Br G125(a and b) S --I --H --F G126(a and b) S --I
--H --CH.sub.3 G127(a and b) S --I --H --CF.sub.3 G128(a and b) S
--I --H --OCH.sub.3 G129(a and b) S --I --H --OCH.sub.2CH.sub.3
G130(a and b) S --I --H --OCF.sub.3 G131(a and b) S --I --H
-tert-butyl G132(a and b) S --I --H -iso-propyl G133(a and b) O
--Cl --Cl --H G134(a and b) O --Cl --Br --H G135(a and b) O --Cl
--F --H G136(a and b) O --Cl --CH.sub.3 --H G137(a and b) O --Cl
--CF.sub.3 --H G138(a and b) O --Cl --OCH.sub.3 --H G139(a and b) O
--Cl --OCH.sub.2CH.sub.3 --H G140(a and b) O --Cl --OCF.sub.3 --H
G141(a and b) O --Cl -tert-butyl --H G142(a and b) O --Cl
-iso-propyl --H G143(a and b) O --Cl --CH.sub.3 --CH.sub.3 G144(a
and b) O --Cl --H --H G145(a and b) O --Cl --H --CH.sub.3 G146(a
and b) O --Cl --H --Cl G147(a and b) O --Cl --H --Br G148(a and b)
O --Cl --H --F G149(a and b) O --Cl --H --CF.sub.3 G150(a and b) O
--Cl --H --OCH.sub.3 G151(a and b) O --Cl --H --OCH.sub.2CH.sub.3
G152(a and b) O --Cl --H --OCF.sub.3 G153(a and b) O --Cl --H
-tert-butyl G154(a and b) O --Cl --H -iso-propyl G155(a and b) O
--CH.sub.3 --Cl --H G156(a and b) O --CH.sub.3 --Br --H G157(a and
b) O --CH.sub.3 --F --H G158(a and b) O --CH.sub.3 --CH.sub.3 --H
G159(a and b) O --CH.sub.3 --CF.sub.3 --H G160(a and b) O
--CH.sub.3 --OCH.sub.3 --H G161(a and b) O --CH.sub.3
--OCH.sub.2CH.sub.3 --H G162(a and b) O --CH.sub.3 --OCF.sub.3 --H
G163(a and b) O --CH.sub.3 -tert-butyl --H G164(a and b) O
--CH.sub.3 -iso-propyl --H G165(a and b) O --CH.sub.3 --CH.sub.3
--CH.sub.3 G166(a and b) O --CH.sub.3 --H --H G167(a and b) O
--CH.sub.3 --H --Cl G168(a and b) O --CH.sub.3 --H --Br G169(a and
b) O --CH.sub.3 --H --F G170(a and b) O --CH.sub.3 --H --CH.sub.3
G171(a and b) O --CH.sub.3 --H --CF.sub.3 G172(a and b) O
--CH.sub.3 --H --OCH.sub.3 G173(a and b) O --CH.sub.3 --H
--OCH.sub.2CH.sub.3 G174(a and b) O --CH.sub.3 --H --OCF.sub.3
G175(a and b) O --CH.sub.3 --H -tert-butyl G176(a and b) O
--CH.sub.3 --H -iso-propyl G177(a and b) O --CF.sub.3 --Cl --H
G178(a and b) O --CF.sub.3 --Br --H G179(a and b) O --CF.sub.3 --F
--H G180(a and b) O --CF.sub.3 --CH.sub.3 --H G181(a and b) O
--CF.sub.3 --CF.sub.3 --H G182(a and b) O --CF.sub.3 --OCH.sub.3
--H G183(a and b) O --CF.sub.3 --OCH.sub.2CH.sub.3 --H G184(a and
b) O --CF.sub.3 --OCF.sub.3 --H G185(a and b) O --CF.sub.3
-tert-butyl --H G186(a and b) O --CF.sub.3 -iso-propyl --H G187(a
and b) O --CF.sub.3 --CH.sub.3 --CH.sub.3 G188(a and b) O
--CF.sub.3 --H --H G189(a and b) O --CF.sub.3 --H --Cl G190(a and
b) O --CF.sub.3 --H --Br G191(a and b) O --CF.sub.3 --H --F G192(a
and b) O --CF.sub.3 --H --CH.sub.3 G193(a and b) O --CF.sub.3 --H
--CF.sub.3 G194(a and b) O --CF.sub.3 --H --OCH.sub.3 G195(a and b)
O --CF.sub.3 --H --OCH.sub.2CH.sub.3 G196(a and b) O --CF.sub.3 --H
--OCF.sub.3 G197(a and b) O --CF.sub.3 --H -tert-butyl G198(a and
b) O --CF.sub.3 --H -iso-propyl G199(a and b) O --CHF.sub.2 --Cl
--H G200(a and b) O --CHF.sub.2 --Br --H G201(a and b) O
--CHF.sub.2 --F --H G202(a and b) O --CHF.sub.2 --CH.sub.3 --H
G203(a and b) O --CHF.sub.2 --CF.sub.3 --H G204(a and b) O
--CHF.sub.2 --OCH.sub.3 --H G205(a and b) O --CHF.sub.2
--OCH.sub.2CH.sub.3 --H G206(a and b) O --CHF.sub.2 --OCF.sub.3 --H
G207(a and b) O --CHF.sub.2 -tert-butyl --H G208(a and b) O
--CHF.sub.2 -iso-propyl --H G209(a and b) O --CHF.sub.2 --CH.sub.3
--CH.sub.3 G210(a and b) O --CHF.sub.2 --H --H G211(a and b) O
--CHF.sub.2 --H --Cl G212(a and b) O --CHF.sub.2 --H --Br G213(a
and b) O --CHF.sub.2 --H --F G214(a and b) O --CHF.sub.2 --H
--CH.sub.3 G215(a and b) O --CHF.sub.2 --H --CF.sub.3 G216(a and b)
O --CHF.sub.2 --H --OCH.sub.3 G217(a and b) O --CHF.sub.2 --H
--OCH.sub.2CH.sub.3 G218(a and b) O --CHF.sub.2 --H --OCF.sub.3
G219(a and b) O --CHF.sub.2 --H -tert-butyl G220(a and b) O
--CHF.sub.2 --H -iso-propyl G221(a and b) O --Br --Br --H G222(a
and b) O --Br --Cl --H G223(a and b) O --Br --F --H G224(a and b) O
--Br --CH.sub.3 --H G225(a and b) O --Br --CF.sub.3 --H G226(a and
b) O --Br --OCH.sub.3 --H G227(a and b) O --Br --OCH.sub.2CH.sub.3
--H G228(a and b) O --Br --OCF.sub.3 --H G229(a and b) O --Br
-tert-butyl --H G230(a and b) O --Br -iso-propyl --H G231(a and b)
O --Br --CH.sub.3 --CH.sub.3 G232(a and b) O --Br --H --H G233(a
and b) O --Br --H --Cl G234(a and b) O --Br --H --Br G235(a and b)
O --Br --H --F G236(a and b) O --Br --H --CH.sub.3 G237(a and b) O
--Br --H --CF.sub.3 G238(a and b) O --Br --H --OCH.sub.3 G239(a and
b) O --Br --H --OCH.sub.2CH.sub.3 G240(a and b) O --Br --H
--OCF.sub.3 G241(a and b) O --Br --H -tert-butyl G242(a and b) O
--Br --H -iso-propyl G243(a and b) O --I --Cl --H
G244(a and b) O --I --Br --H G245(a and b) O --I --F --H G246(a and
b) O --I --CH.sub.3 --H G247(a and b) O --I --CF.sub.3 --H G248(a
and b) O --I --OCH.sub.3 --H G249(a and b) O --I
--OCH.sub.2CH.sub.3 --H G250(a and b) O --I --OCF.sub.3 --H G251(a
and b) O --I -tert-butyl --H G252(a and b) O --I -iso-propyl --H
G253(a and b) O --I --CH.sub.3 --CH.sub.3 G254(a and b) O --I --H
--H G255(a and b) O --I --H --Cl G256(a and b) O --I --H --Br
G257(a and b) O --I --H --F G258(a and b) O --I --H --CH.sub.3
G259(a and b) O --I --H --CF.sub.3 G260(a and b) O --I --H
--OCH.sub.3 G261(a and b) O --I --H --OCH.sub.2CH.sub.3 G262(a and
b) O --I --H --OCF.sub.3 G263(a and b) O --I --H -tert-butyl G264(a
and b) O --I --H -iso-propyl G265(a and b) NH --Cl --Cl --H G266(a
and b) NH --Cl --Br --H G267(a and b) NH --Cl --F --H G268(a and b)
NH --Cl --CH.sub.3 --H G269(a and b) NH --Cl --CF.sub.3 --H G270(a
and b) NH --Cl --OCH.sub.3 --H G271(a and b) NH --Cl
--OCH.sub.2CH.sub.3 --H G272(a and b) NH --Cl --OCF.sub.3 --H
G273(a and b) NH --Cl -tert-butyl --H G274(a and b) NH --Cl
-iso-propyl --H G275(a and b) NH --Cl --CH.sub.3 --CH.sub.3 G276(a
and b) NH --Cl --H --H G277(a and b) NH --Cl --H --CH.sub.3 G278(a
and b) NH --Cl --H --Cl G279(a and b) NH --Cl --H --Br G280(a and
b) NH --Cl --H --F G281(a and b) NH --Cl --H --CF.sub.3 G282(a and
b) NH --Cl --H --OCH.sub.3 G283(a and b) NH --Cl --H
--OCH.sub.2CH.sub.3 G284(a and b) NH --Cl --H --OCF.sub.3 G285(a
and b) NH --Cl --H -tert-butyl G286(a and b) NH --Cl --H
-iso-propyl G287(a and b) NH --CH.sub.3 --Cl --H G288(a and b) NH
--CH.sub.3 --Br --H G289(a and b) NH --CH.sub.3 --F --H G290(a and
b) NH --CH.sub.3 --CH.sub.3 --H G291(a and b) NH --CH.sub.3
--CF.sub.3 --H G292(a and b) NH --CH.sub.3 --OCH.sub.3 --H G293(a
and b) NH --CH.sub.3 --OCH.sub.2CH.sub.3 --H G294(a and b) NH
--CH.sub.3 --OCF.sub.3 --H G295(a and b) NH --CH.sub.3 -tert-butyl
--H G296(a and b) NH --CH.sub.3 -iso-propyl --H G297(a and b) NH
--CH.sub.3 --CH.sub.3 --CH.sub.3 G298(a and b) NH --CH.sub.3 --H
--H G299(a and b) NH --CH.sub.3 --H --Cl G300(a and b) NH
--CH.sub.3 --H --Br G301(a and b) NH --CH.sub.3 --H --F G302(a and
b) NH --CH.sub.3 --H --CH.sub.3 G303(a and b) NH --CH.sub.3 --H
--CF.sub.3 G304(a and b) NH --CH.sub.3 --H --OCH.sub.3 G305(a and
b) NH --CH.sub.3 --H --OCH.sub.2CH.sub.3 G306(a and b) NH
--CH.sub.3 --H --OCF.sub.3 G307(a and b) NH --CH.sub.3 --H
-tert-butyl G308(a and b) NH --CH.sub.3 --H -iso-propyl G309(a and
b) NH --CF.sub.3 --Cl --H G310(a and b) NH --CF.sub.3 --Br --H
G311(a and b) NH --CF.sub.3 --F --H G312(a and b) NH --CF.sub.3
--CH.sub.3 --H G313(a and b) NH --CF.sub.3 --CF.sub.3 --H G314(a
and b) NH --CF.sub.3 --OCH.sub.3 --H G315(a and b) NH --CF.sub.3
--OCH.sub.2CH.sub.3 --H G316(a and b) NH --CF.sub.3 --OCF.sub.3 --H
G317(a and b) NH --CF.sub.3 -tert-butyl --H G318(a and b) NH
--CF.sub.3 -iso-propyl --H G319(a and b) NH --CF.sub.3 --CH.sub.3
--CH.sub.3 G320(a and b) NH --CF.sub.3 --H --H G321(a and b) NH
--CF.sub.3 --H --Cl G322(a and b) NH --CF.sub.3 --H --Br G323(a and
b) NH --CF.sub.3 --H --F G324(a and b) NH --CF.sub.3 --H --CH.sub.3
G325(a and b) NH --CF.sub.3 --H --CF.sub.3 G326(a and b) NH
--CF.sub.3 --H --OCH.sub.3 G327(a and b) NH --CF.sub.3 --H
--OCH.sub.2CH.sub.3 G328(a and b) NH --CF.sub.3 --H --OCF.sub.3
G329(a and b) NH --CF.sub.3 --H -tert-butyl G330(a and b) NH
--CF.sub.3 --H -iso-propyl G331(a and b) NH --CHF.sub.2 --Cl --H
G332(a and b) NH --CHF.sub.2 --Br --H G333(a and b) NH --CHF.sub.2
--F --H G334(a and b) NH --CHF.sub.2 --CH.sub.3 --H G335(a and b)
NH --CHF.sub.2 --CF.sub.3 --H G336(a and b) NH --CHF.sub.2
--OCH.sub.3 --H G337(a and b) NH --CHF.sub.2 --OCH.sub.2CH.sub.3
--H G338(a and b) NH --CHF.sub.2 --OCF.sub.3 --H G339(a and b) NH
--CHF.sub.2 -tert-butyl --H G340(a and b) NH --CHF.sub.2
-iso-propyl --H G341(a and b) NH --CHF.sub.2 --CH.sub.3 --CH.sub.3
G342(a and b) NH --CHF.sub.2 --H --H G343(a and b) NH --CHF.sub.2
--H --Cl G344(a and b) NH --CHF.sub.2 --H --Br G345(a and b) NH
--CHF.sub.2 --H --F G346(a and b) NH --CHF.sub.2 --H --CH.sub.3
G347(a and b) NH --CHF.sub.2 --H --CF.sub.3 G348(a and b) NH
--CHF.sub.2 --H --OCH.sub.3 G349(a and b) NH --CHF.sub.2 --H
--OCH.sub.2CH.sub.3 G350(a and b) NH --CHF.sub.2 --H --OCF.sub.3
G351(a and b) NH --CHF.sub.2 --H -tert-butyl G352(a and b) NH
--CHF.sub.2 --H -iso-propyl G353(a and b) NH --Br --Br --H G354(a
and b) NH --Br --Cl --H G355(a and b) NH --Br --F --H G356(a and b)
NH --Br --CH.sub.3 --H G357(a and b) NH --Br --CF.sub.3 --H G358(a
and b) NH --Br --OCH.sub.3 --H G359(a and b) NH --Br
--OCH.sub.2CH.sub.3 --H G360(a and b) NH --Br --OCF.sub.3 --H
G361(a and b) NH --Br -tert-butyl --H G362(a and b) NH --Br
-iso-propyl --H G363(a and b) NH --Br --CH.sub.3 --CH.sub.3 G364(a
and b) NH --Br --H --H G365(a and b) NH --Br --H --Cl G366(a and b)
NH --Br --H --Br G367(a and b) NH --Br --H --F G368(a and b) NH
--Br --H --CH.sub.3 G369(a and b) NH --Br --H --CF.sub.3 G370(a and
b) NH --Br --H --OCH.sub.3 G371(a and b) NH --Br --H
--OCH.sub.2CH.sub.3 G372(a and b) NH --Br --H --OCF.sub.3 G373(a
and b) NH --Br --H -tert-butyl G374(a and b) NH --Br --H
-iso-propyl G375(a and b) NH --I --Cl --H G376(a and b) NH --I --Br
--H G377(a and b) NH --I --F --H G378(a and b) NH --I --CH.sub.3
--H G379(a and b) NH --I --CF.sub.3 --H G380(a and b) NH --I
--OCH.sub.3 --H G381(a and b) NH --I --OCH.sub.2CH.sub.3 --H G382(a
and b) NH --I --OCF.sub.3 --H G383(a and b) NH --I -tert-butyl --H
G384(a and b) NH --I -iso-propyl --H G385(a and b) NH --I
--CH.sub.3 --CH.sub.3 G386(a and b) NH --I --H --H G387(a and b) NH
--I --H --Cl G388(a and b) NH --I --H --Br G389(a and b) NH --I --H
--F G390(a and b) NH --I --H --CH.sub.3 G391(a and b) NH --I --H
--CF.sub.3 G392(a and b) NH --I --H --OCH.sub.3 G393(a and b) NH
--I --H --OCH.sub.2CH.sub.3 G394(a and b) NH --I --H --OCF.sub.3
G395(a and b) NH --I --H -tert-butyl G396(a and b) NH --I --H
-iso-propyl In the column labeled "Compound": (a) means Z.sub.1 is
CH and Z.sub.2 is N; and (b) means Z.sub.1 is N and Z.sub.2 is
CH.
TABLE-US-00008 TABLE 8 (X) ##STR00091## Compound Y R.sub.1
(R.sub.8).sub.a (R.sub.8).sub.b H1 (a) and (b) S --Cl --Cl --H H2
(a) and (b) S --Cl --Br --H H3 (a) and (b) S --Cl --F --H H4 (a)
and (b) S --Cl --CH.sub.3 --H H5 (a) and (b) S --Cl --CF.sub.3 --H
H6 (a) and (b) S --Cl --OCH.sub.3 --H H7 (a) and (b) S --Cl
--OCH.sub.2CH.sub.3 --H H8 (a) and (b) S --Cl --OCF.sub.3 --H H9
(a) and (b) S --Cl -tert-butyl --H H10 (a) and (b) S --Cl
-iso-propyl --H H11 (a) and (b) S --Cl --CH.sub.3 --CH.sub.3 H12
(a) and (b) S --Cl --H --H H13 (a) and (b) S --Cl --H --Cl H14 (a)
and (b) S --Cl --H --Br H15 (a) and (b) S --Cl --H --F H16 (a) and
(b) S --Cl --H --CH.sub.3 H17 (a) and (b) S --Cl --H --CF.sub.3 H18
(a) and (b) S --Cl --H --OCH.sub.3 H19 (a) and (b) S --Cl --H
--OCH.sub.2CH.sub.3 H20 (a) and (b) S --Cl --H --OCF.sub.3 H21 (a)
and (b) S --Cl --H -tert-butyl H22 (a) and (b) S --Cl --H
-iso-propyl H23 (a) and (b) S --CH.sub.3 --Cl --H H24 (a) and (b) S
--CH.sub.3 --Br --H H25 (a) and (b) S --CH.sub.3 --F --H H26 (a)
and (b) S --CH.sub.3 --CH.sub.3 --H H27 (a) and (b) S --CH.sub.3
--CF.sub.3 --H H28 (a) and (b) S --CH.sub.3 --OCH.sub.3 --H H29 (a)
and (b) S --CH.sub.3 --OCH.sub.2CH.sub.3 --H H30 (a) and (b) S
--CH.sub.3 --OCF.sub.3 --H H31 (a) and (b) S --CH.sub.3 -tert-butyl
--H H32 (a) and (b) S --CH.sub.3 -iso-propyl --H H33 (a) and (b) S
--CH.sub.3 --CH.sub.3 --CH.sub.3 H34 (a) and (b) S --CH.sub.3 --H
--H H35 (a) and (b) S --CH.sub.3 --H --Cl H36 (a) and (b) S
--CH.sub.3 --H --Br H37 (a) and (b) S --CH.sub.3 --H --F H38 (a)
and (b) S --CH.sub.3 --H --CH.sub.3 H39 (a) and (b) S --CH.sub.3
--H --CF.sub.3 H40 (a) and (b) S --CH.sub.3 --H --OCH.sub.3 H41 (a)
and (b) S --CH.sub.3 --H --OCH.sub.2CH.sub.3 H42 (a) and (b) S
--CH.sub.3 --H --OCF.sub.3 H43 (a) and (b) S --CH.sub.3 --H
-tert-butyl H44 (a) and (b) S --CH.sub.3 --H -iso-propyl H45 (a)
and (b) S --CF.sub.3 --Cl --H H46 (a) and (b) S --CF.sub.3 --Br --H
H47 (a) and (b) S --CF.sub.3 --F --H H48 (a) and (b) S --CF.sub.3
--CH.sub.3 --H H49 (a) and (b) S --CF.sub.3 --CF.sub.3 --H H50 (a)
and (b) S --CF.sub.3 --OCH.sub.3 --H H51 (a) and (b) S --CF.sub.3
--OCH.sub.2CH.sub.3 --H H52 (a) and (b) S --CF.sub.3 --OCF.sub.3
--H H53 (a) and (b) S --CF.sub.3 -tert-butyl --H H54 (a) and (b) S
--CF.sub.3 -iso-propyl --H H55 (a) and (b) S --CF.sub.3 --CH.sub.3
--CH.sub.3 H56 (a) and (b) S --CF.sub.3 --H --H H57 (a) and (b) S
--CF.sub.3 --H --Cl H58 (a) and (b) S --CF.sub.3 --H --Br H59 (a)
and (b) S --CF.sub.3 --H --F H60 (a) and (b) S --CF.sub.3 --H
--CH.sub.3 H61 (a) and (b) S --CF.sub.3 --H --CF.sub.3 H62 (a) and
(b) S --CF.sub.3 --H --OCH.sub.3 H63 (a) and (b) S --CF.sub.3 --H
--OCH.sub.2CH.sub.3 H64 (a) and (b) S --CF.sub.3 --H --OCF.sub.3
H65 (a) and (b) S --CF.sub.3 --H -tert-butyl H66 (a) and (b) S
--CF.sub.3 --H -iso-propyl H67 (a) and (b) S --CHF.sub.2 --Cl --H
H68 (a) and (b) S --CHF.sub.2 --Br --H H69 (a) and (b) S
--CHF.sub.2 --F --H H70 (a) and (b) S --CHF.sub.2 --CH.sub.3 --H
H71 (a) and (b) S --CHF.sub.2 --CF.sub.3 --H H72 (a) and (b) S
--CHF.sub.2 --OCH.sub.3 --H H73 (a) and (b) S --CHF.sub.2
--OCH.sub.2CH.sub.3 --H H74 (a) and (b) S --CHF.sub.2 --OCF.sub.3
--H H75 (a) and (b) S --CHF.sub.2 -tert-butyl --H H76 (a) and (b) S
--CHF.sub.2 -iso-propyl --H H77 (a) and (b) S --CHF.sub.2
--CH.sub.3 --CH.sub.3 H78 (a) and (b) S --CHF.sub.2 --H --H H79 (a)
and (b) S --CHF.sub.2 --H --Cl H80 (a) and (b) S --CHF.sub.2 --H
--Br H81 (a) and (b) S --CHF.sub.2 --H --F H82 (a) and (b) S
--CHF.sub.2 --H --CH.sub.3 H83 (a) and (b) S --CHF.sub.2 --H
--CF.sub.3 H84 (a) and (b) S --CHF.sub.2 --H --OCH.sub.3 H85 (a)
and (b) S --CHF.sub.2 --H --OCH.sub.2CH.sub.3 H86 (a) and (b) S
--CHF.sub.2 --H --OCF.sub.3 H87 (a) and (b) S --CHF.sub.2 --H
-tert-butyl H88 (a) and (b) S --CHF.sub.2 --H -iso-propyl H89 (a)
and (b) S --Br --Br --H H90 (a) and (b) S --Br --Cl --H H91 (a) and
(b) S --Br --F --H H92 (a) and (b) S --Br --CH.sub.3 --H H93 (a)
and (b) S --Br --CF.sub.3 --H H94 (a) and (b) S --Br --OCH.sub.3
--H H95 (a) and (b) S --Br --OCH.sub.2CH.sub.3 --H H96 (a) and (b)
S --Br --OCF.sub.3 --H H97 (a) and (b) S --Br -tert-butyl --H H98
(a) and (b) S --Br -iso-propyl --H H99 (a) and (b) S --Br
--CH.sub.3 --CH.sub.3 H100 (a) and (b) S --Br --H --H H101 (a) and
(b) S --Br --H --Cl H102 (a) and (b) S --Br --H --Br H103 (a) and
(b) S --Br --H --F H104 (a) and (b) S --Br --H --CH.sub.3 H105 (a)
and (b) S --Br --H --CF.sub.3 H106 (a) and (b) S --Br --H
--OCH.sub.3 H107 (a) and (b) S --Br --H --OCH.sub.2CH.sub.3 H108
(a) and (b) S --Br --H --OCF.sub.3 H109 (a) and (b) S --Br --H
-tert-butyl H110 (a) and (b) S --Br --H -iso-propyl H111 (a) and
(b) S --I --Cl --H H112 (a) and (b) S --I --Br --H H113 (a) and (b)
S --I --F --H H114 (a) and (b) S --I --CH.sub.3 --H H115 (a) and
(b) S --I --CF.sub.3 --H H116 (a) and (b) S --I --OCH.sub.3 --H
H117 (a) and (b) S --I --OCH.sub.2CH.sub.3 --H H118 (a) and (b) S
--I --OCF.sub.3 --H H119 (a) and (b) S --I -tert-butyl --H H120 (a)
and (b) S --I -iso-propyl --H H121 (a) and (b) S --I --CH.sub.3
--CH.sub.3 H122 (a) and (b) S --I --H --H H123 (a) and (b) S --I
--H --Cl H124 (a) and (b) S --I --H --Br H125 (a) and (b) S --I --H
--F H126 (a) and (b) S --I --H --CH.sub.3 H127 (a) and (b) S --I
--H --CF.sub.3 H128 (a) and (b) S --I --H --OCH.sub.3 H129 (a) and
(b) S --I --H --OCH.sub.2CH.sub.3 H130 (a) and (b) S --I --H
--OCF.sub.3 H131 (a) and (b) S --I --H -tert-butyl H132 (a) and (b)
S --I --H -iso-propyl H133 (a) and (b) O --Cl --Cl --H H134 (a) and
(b) O --Cl --Br --H H135 (a) and (b) O --Cl --F --H H136 (a) and
(b) O --Cl --CH.sub.3 --H H137 (a) and (b) O --Cl --CF.sub.3 --H
H138 (a) and (b) O --Cl --OCH.sub.3 --H H139 (a) and (b) O --Cl
--OCH.sub.2CH.sub.3 --H H140 (a) and (b) O --Cl --OCF.sub.3 --H
H141 (a) and (b) O --Cl -tert-butyl --H H142 (a) and (b) O --Cl
-iso-propyl --H H143 (a) and (b) O --Cl --CH.sub.3 --CH.sub.3 H144
(a) and (b) O --Cl --H --H H145 (a) and (b) O --Cl --H --CH.sub.3
H146 (a) and (b) O --Cl --H --Cl H147 (a) and (b) O --Cl --H --Br
H148 (a) and (b) O --Cl --H --F H149 (a) and (b) O --Cl --H
--CF.sub.3 H150 (a) and (b) O --Cl --H --OCH.sub.3 H151 (a) and (b)
O --Cl --H --OCH.sub.2CH.sub.3 H152 (a) and (b) O --Cl --H
--OCF.sub.3 H153 (a) and (b) O --Cl --H -tert-butyl H154 (a) and
(b) O --Cl --H -iso-propyl H155 (a) and (b) O --CH.sub.3 --Cl --H
H156 (a) and (b) O --CH.sub.3 --Br --H H157 (a) and (b) O
--CH.sub.3 --F --H H158 (a) and (b) O --CH.sub.3 --CH.sub.3 --H
H159 (a) and (b) O --CH.sub.3 --CF.sub.3 --H H160 (a) and (b) O
--CH.sub.3 --OCH.sub.3 --H H161 (a) and (b) O --CH.sub.3
--OCH.sub.2CH.sub.3 --H H162 (a) and (b) O --CH.sub.3 --OCF.sub.3
--H H163 (a) and (b) O --CH.sub.3 -tert-butyl --H H164 (a) and (b)
O --CH.sub.3 -iso-propyl --H H165 (a) and (b) O --CH.sub.3
--CH.sub.3 --CH.sub.3 H166 (a) and (b) O --CH.sub.3 --H --H H167
(a) and (b) O --CH.sub.3 --H --Cl H168 (a) and (b) O --CH.sub.3 --H
--Br H169 (a) and (b) O --CH.sub.3 --H --F H170 (a) and (b) O
--CH.sub.3 --H --CH.sub.3 H171 (a) and (b) O --CH.sub.3 --H
--CF.sub.3 H172 (a) and (b) O --CH.sub.3 --H --OCH.sub.3 H173 (a)
and (b) O --CH.sub.3 --H --OCH.sub.2CH.sub.3 H174 (a) and (b) O
--CH.sub.3 --H --OCF.sub.3 H175 (a) and (b) O --CH.sub.3 --H
-tert-butyl H176 (a) and (b) O --CH.sub.3 --H -iso-propyl H177 (a)
and (b) O --CF.sub.3 --Cl --H H178 (a) and (b) O --CF.sub.3 --Br
--H H179 (a) and (b) O --CF.sub.3 --F --H H180 (a) and (b) O
--CF.sub.3 --CH.sub.3 --H H181 (a) and (b) O --CF.sub.3 --CF.sub.3
--H H182 (a) and (b) O --CF.sub.3 --OCH.sub.3 --H H183 (a) and (b)
O --CF.sub.3 --OCH.sub.2CH.sub.3 --H H184 (a) and (b) O --CF.sub.3
--OCF.sub.3 --H H185 (a) and (b) O --CF.sub.3 -tert-butyl --H H186
(a) and (b) O --CF.sub.3 -iso-propyl --H H187 (a) and (b) O
--CF.sub.3 --CH.sub.3 --CH.sub.3 H188 (a) and (b) O --CF.sub.3 --H
--H H189 (a) and (b) O --CF.sub.3 --H --Cl H190 (a) and (b) O
--CF.sub.3 --H --Br H191 (a) and (b) O --CF.sub.3 --H --F H192 (a)
and (b) O --CF.sub.3 --H --CH.sub.3 H193 (a) and (b) O --CF.sub.3
--H --CF.sub.3 H194 (a) and (b) O --CF.sub.3 --H --OCH.sub.3 H195
(a) and (b) O --CF.sub.3 --H --OCH.sub.2CH.sub.3 H196 (a) and (b) O
--CF.sub.3 --H --OCF.sub.3 H197 (a) and (b) O --CF.sub.3 --H
-tert-butyl H198 (a) and (b) O --CF.sub.3 --H -iso-propyl H199 (a)
and (b) O --CHF.sub.2 --Cl --H H200 (a) and (b) O --CHF.sub.2 --Br
--H H201 (a) and (b) O --CHF.sub.2 --F --H H202 (a) and (b) O
--CHF.sub.2 --CH.sub.3 --H H203 (a) and (b) O --CHF.sub.2
--CF.sub.3 --H H204 (a) and (b) O --CHF.sub.2 --OCH.sub.3 --H H205
(a) and (b) O --CHF.sub.2 --OCH.sub.2CH.sub.3 --H H206 (a) and (b)
O --CHF.sub.2 --OCF.sub.3 --H H207 (a) and (b) O --CHF.sub.2
-tert-butyl --H H208 (a) and (b) O --CHF.sub.2 -iso-propyl --H H209
(a) and (b) O --CHF.sub.2 --CH.sub.3 --CH.sub.3 H210 (a) and (b) O
--CHF.sub.2 --H --H H211 (a) and (b) O --CHF.sub.2 --H --Cl H212
(a) and (b) O --CHF.sub.2 --H --Br H213 (a) and (b) O --CHF.sub.2
--H --F H214 (a) and (b) O --CHF.sub.2 --H --CH.sub.3 H215 (a) and
(b) O --CHF.sub.2 --H --CF.sub.3 H216 (a) and (b) O --CHF.sub.2 --H
--OCH.sub.3 H217 (a) and (b) O --CHF.sub.2 --H --OCH.sub.2CH.sub.3
H218 (a) and (b) O --CHF.sub.2 --H --OCF.sub.3 H219 (a) and (b) O
--CHF.sub.2 --H -tert-butyl H220 (a) and (b) O --CHF.sub.2 --H
-iso-propyl H221 (a) and (b) O --Br --Br --H H222 (a) and (b) O
--Br --Cl --H H223 (a) and (b) O --Br --F --H H224 (a) and (b) O
--Br --CH.sub.3 --H H225 (a) and (b) O --Br --CF.sub.3 --H H226 (a)
and (b) O --Br --OCH.sub.3 --H H227 (a) and (b) O --Br
--OCH.sub.2CH.sub.3 --H H228 (a) and (b) O --Br --OCF.sub.3 --H
H229 (a) and (b) O --Br -tert-butyl --H H230 (a) and (b) O --Br
-iso-propyl --H H231 (a) and (b) O --Br --CH.sub.3 --CH.sub.3 H232
(a) and (b) O --Br --H --H H233 (a) and (b) O --Br --H --Cl H234
(a) and (b) O --Br --H --Br H235 (a) and (b) O --Br --H --F H236
(a) and (b) O --Br --H --CH.sub.3 H237 (a) and (b) O --Br --H
--CF.sub.3 H238 (a) and (b) O --Br --H --OCH.sub.3 H239 (a) and (b)
O --Br --H --OCH.sub.2CH.sub.3 H240 (a) and (b) O --Br --H
--OCF.sub.3 H241 (a) and (b) O --Br --H -tert-butyl H242 (a) and
(b) O --Br --H -iso-propyl H243 (a) and (b) O --I --Cl --H
H244 (a) and (b) O --I --Br --H H245 (a) and (b) O --I --F --H H246
(a) and (b) O --I --CH.sub.3 --H H247 (a) and (b) O --I --CF.sub.3
--H H248 (a) and (b) O --I --OCH.sub.3 --H H249 (a) and (b) O --I
--OCH.sub.2CH.sub.3 --H H250 (a) and (b) O --I --OCF.sub.3 --H H251
(a) and (b) O --I -tert-butyl --H H252 (a) and (b) O --I
-iso-propyl --H H253 (a) and (b) O --I --CH.sub.3 --CH.sub.3 H254
(a) and (b) O --I --H --H H255 (a) and (b) O --I --H --Cl H256 (a)
and (b) O --I --H --Br H257 (a) and (b) O --I --H --F H258 (a) and
(b) O --I --H --CH.sub.3 H259 (a) and (b) O --I --H --CF.sub.3 H260
(a) and (b) O --I --H --OCH.sub.3 H261 (a) and (b) O --I --H
--OCH.sub.2CH.sub.3 H262 (a) and (b) O --I --H --OCF.sub.3 H263 (a)
and (b) O --I --H -tert-butyl H264 (a) and (b) O --I --H
-iso-propyl H265 (a) and (b) NH --Cl --Cl --H H266 (a) and (b) NH
--Cl --Br --H H267 (a) and (b) NH --Cl --F --H H268 (a) and (b) NH
--Cl --CH.sub.3 --H H269 (a) and (b) NH --Cl --CF.sub.3 --H H270
(a) and (b) NH --Cl --OCH.sub.3 --H H271 (a) and (b) NH --Cl
--OCH.sub.2CH.sub.3 --H H272 (a) and (b) NH --Cl --OCF.sub.3 --H
H273 (a) and (b) NH --Cl -tert-butyl --H H274 (a) and (b) NH --Cl
-iso-propyl --H H275 (a) and (b) NH --Cl --CH.sub.3 --CH.sub.3 H276
(a) and (b) NH --Cl --H --H H277 (a) and (b) NH --Cl --H --CH.sub.3
H278 (a) and (b) NH --Cl --H --Cl H279 (a) and (b) NH --Cl --H --Br
H280 (a) and (b) NH --Cl --H --F H281 (a) and (b) NH --Cl --H
--CF.sub.3 H282 (a) and (b) NH --Cl --H --OCH.sub.3 H283 (a) and
(b) NH --Cl --H --OCH.sub.2CH.sub.3 H284 (a) and (b) NH --Cl --H
--OCF.sub.3 H285 (a) and (b) NH --Cl --H -tert-butyl H286 (a) and
(b) NH --Cl --H -iso-propyl H287 (a) and (b) NH --CH.sub.3 --Cl --H
H288 (a) and (b) NH --CH.sub.3 --Br --H H289 (a) and (b) NH
--CH.sub.3 --F --H H290 (a) and (b) NH --CH.sub.3 --CH.sub.3 --H
H291 (a) and (b) NH --CH.sub.3 --CF.sub.3 --H H292 (a) and (b) NH
--CH.sub.3 --OCH.sub.3 --H H293 (a) and (b) NH --CH.sub.3
--OCH.sub.2CH.sub.3 --H H294 (a) and (b) NH --CH.sub.3 --OCF.sub.3
--H H295 (a) and (b) NH --CH.sub.3 -tert-butyl --H H296 (a) and (b)
NH --CH.sub.3 -iso-propyl --H H297 (a) and (b) NH --CH.sub.3
--CH.sub.3 --CH.sub.3 H298 (a) and (b) NH --CH.sub.3 --H --H H299
(a) and (b) NH --CH.sub.3 --H --Cl H300 (a) and (b) NH --CH.sub.3
--H --Br H301 (a) and (b) NH --CH.sub.3 --H --F H302 (a) and (b) NH
--CH.sub.3 --H --CH.sub.3 H303 (a) and (b) NH --CH.sub.3 --H
--CF.sub.3 H304 (a) and (b) NH --CH.sub.3 --H --OCH.sub.3 H305 (a)
and (b) NH --CH.sub.3 --H --OCH.sub.2CH.sub.3 H306 (a) and (b) NH
--CH.sub.3 --H --OCF.sub.3 H307 (a) and (b) NH --CH.sub.3 --H
-tert-butyl H308 (a) and (b) NH --CH.sub.3 --H -iso-propyl H309 (a)
and (b) NH --CF.sub.3 --Cl --H H310 (a) and (b) NH --CF.sub.3 --Br
--H H311 (a) and (b) NH --CF.sub.3 --F --H H312 (a) and (b) NH
--CF.sub.3 --CH.sub.3 --H H313 (a) and (b) NH --CF.sub.3 --CF.sub.3
--H H314 (a) and (b) NH --CF.sub.3 --OCH.sub.3 --H H315 (a) and (b)
NH --CF.sub.3 --OCH.sub.2CH.sub.3 --H H316 (a) and (b) NH
--CF.sub.3 --OCF.sub.3 --H H317 (a) and (b) NH --CF.sub.3
-tert-butyl --H H318 (a) and (b) NH --CF.sub.3 -iso-propyl --H H319
(a) and (b) NH --CF.sub.3 --CH.sub.3 --CH.sub.3 H320 (a) and (b) NH
--CF.sub.3 --H --H H321 (a) and (b) NH --CF.sub.3 --H --Cl H322 (a)
and (b) NH --CF.sub.3 --H --Br H323 (a) and (b) NH --CF.sub.3 --H
--F H324 (a) and (b) NH --CF.sub.3 --H --CH.sub.3 H325 (a) and (b)
NH --CF.sub.3 --H --CF.sub.3 H326 (a) and (b) NH --CF.sub.3 --H
--OCH.sub.3 H327 (a) and (b) NH --CF.sub.3 --H --OCH.sub.2CH.sub.3
H328 (a) and (b) NH --CF.sub.3 --H --OCF.sub.3 H329 (a) and (b) NH
--CF.sub.3 --H -tert-butyl H330 (a) and (b) NH --CF.sub.3 --H
-iso-propyl H331 (a) and (b) NH --CHF.sub.2 --Cl --H H332 (a) and
(b) NH --CHF.sub.2 --Br --H H333 (a) and (b) NH --CHF.sub.2 --F --H
H334 (a) and (b) NH --CHF.sub.2 --CH.sub.3 --H H335 (a) and (b) NH
--CHF.sub.2 --CF.sub.3 --H H336 (a) and (b) NH --CHF.sub.2
--OCH.sub.3 --H H337 (a) and (b) NH --CHF.sub.2 --OCH.sub.2CH.sub.3
--H H338 (a) and (b) NH --CHF.sub.2 --OCF.sub.3 --H H339 (a) and
(b) NH --CHF.sub.2 -tert-butyl --H H340 (a) and (b) NH --CHF.sub.2
-iso-propyl --H H341 (a) and (b) NH --CHF.sub.2 --CH.sub.3
--CH.sub.3 H342 (a) and (b) NH --CHF.sub.2 --H --H H343 (a) and (b)
NH --CHF.sub.2 --H --Cl H344 (a) and (b) NH --CHF.sub.2 --H --Br
H345 (a) and (b) NH --CHF.sub.2 --H --F H346 (a) and (b) NH
--CHF.sub.2 --H --CH.sub.3 H347 (a) and (b) NH --CHF.sub.2 --H
--CF.sub.3 H348 (a) and (b) NH --CHF.sub.2 --H --OCH.sub.3 H349 (a)
and (b) NH --CHF.sub.2 --H --OCH.sub.2CH.sub.3 H350 (a) and (b) NH
--CHF.sub.2 --H --OCF.sub.3 H351 (a) and (b) NH --CHF.sub.2 --H
-tert-butyl H352 (a) and (b) NH --CHF.sub.2 --H -iso-propyl H353
(a) and (b) NH --Br --Br --H H354 (a) and (b) NH --Br --Cl --H H355
(a) and (b) NH --Br --F --H H356 (a) and (b) NH --Br --CH.sub.3 --H
H357 (a) and (b) NH --Br --CF.sub.3 --H H358 (a) and (b) NH --Br
--OCH.sub.3 --H H359 (a) and (b) NH --Br --OCH.sub.2CH.sub.3 --H
H360 (a) and (b) NH --Br --OCF.sub.3 --H H361 (a) and (b) NH --Br
-tert-butyl --H H362 (a) and (b) NH --Br -iso-propyl --H H363 (a)
and (b) NH --Br --CH.sub.3 --CH.sub.3 H364 (a) and (b) NH --Br --H
--H H365 (a) and (b) NH --Br --H --Cl H366 (a) and (b) NH --Br --H
--Br H367 (a) and (b) NH --Br --H --F H368 (a) and (b) NH --Br --H
--CH.sub.3 H369 (a) and (b) NH --Br --H --CF.sub.3 H370 (a) and (b)
NH --Br --H --OCH.sub.3 H371 (a) and (b) NH --Br --H
--OCH.sub.2CH.sub.3 H372 (a) and (b) NH --Br --H --OCF.sub.3 H373
(a) and (b) NH --Br --H -tert-butyl H374 (a) and (b) NH --Br --H
-iso-propyl H375 (a) and (b) NH --I --Cl --H H376 (a) and (b) NH
--I --Br --H H377 (a) and (b) NH --I --F --H H378 (a) and (b) NH
--I --CH.sub.3 --H H379 (a) and (b) NH --I --CF.sub.3 --H H380 (a)
and (b) NH --I --OCH.sub.3 --H H381 (a) and (b) NH --I
--OCH.sub.2CH.sub.3 --H H382 (a) and (b) NH --I --OCF.sub.3 --H
H383 (a) and (b) NH --I -tert-butyl --H H384 (a) and (b) NH --I
-iso-propyl --H H385 (a) and (b) NH --I --CH.sub.3 --CH.sub.3 H386
(a) and (b) NH --I --H --H H387 (a) and (b) NH --I --H --Cl H388
(a) and (b) NH --I --H --Br H389 (a) and (b) NH --I --H --F H390
(a) and (b) NH --I --H --CH.sub.3 H391 (a) and (b) NH --I --H
--CF.sub.3 H392 (a) and (b) NH --I --H --OCH.sub.3 H393 (a) and (b)
NH --I --H --OCH.sub.2CH.sub.3 H394 (a) and (b) NH --I --H
--OCF.sub.3 H395 (a) and (b) NH --I --H -tert-butyl H396 (a) and
(b) NH --I --H -iso-propyl In the column labeled "Compound": (a)
means Z.sub.1 is CH and Z.sub.2 is N; and (b) means Z.sub.1 is N
and Z.sub.2 is CH.
TABLE-US-00009 TABLE 9 (XI) ##STR00092## and pharmaceutically
acceptable salts thereof, where: Compound Y R.sub.1 (R.sub.8).sub.a
(R.sub.8).sub.b I1(a and b) S --Cl --Cl --H I2(a and b) S --Cl --Br
--H I3(a and b) S --Cl --F --H I4(a and b) S --Cl --CH.sub.3 --H
I5(a and b) S --Cl --CF.sub.3 --H I6(a and b) S --Cl --OCH.sub.3
--H I7(a and b) S --Cl --OCH.sub.2CH.sub.3 --H I8(a and b) S --Cl
--OCF.sub.3 --H I9(a and b) S --Cl -tert-butyl --H I10(a and b) S
--Cl -iso-propyl --H I11(a and b) S --Cl --CH.sub.3 --CH.sub.3
I12(a and b) S --Cl --H --H I13(a and b) S --Cl --H --Cl I14(a and
b) S --Cl --H --Br I15(a and b) S --Cl --H --F I16(a and b) S --Cl
--H --CH.sub.3 I17(a and b) S --Cl --H --CF.sub.3 I18(a and b) S
--Cl --H --OCH.sub.3 I19(a and b) S --Cl --H --OCH.sub.2CH.sub.3
I20(a and b) S --Cl --H --OCF.sub.3 I21(a and b) S --Cl --H
-tert-butyl I22(a and b) S --Cl --H -iso-propyl I23(a and b) S
--CH.sub.3 --Cl --H I24(a and b) S --CH.sub.3 --Br --H I25(a and b)
S --CH.sub.3 --F --H I26(a and b) S --CH.sub.3 --CH.sub.3 --H I27(a
and b) S --CH.sub.3 --CF.sub.3 --H I28(a and b) S --CH.sub.3
--OCH.sub.3 --H I29(a and b) S --CH.sub.3 --OCH.sub.2CH.sub.3 --H
I30(a and b) S --CH.sub.3 --OCF.sub.3 --H I31(a and b) S --CH.sub.3
-tert-butyl --H I32(a and b) S --CH.sub.3 -iso-propyl --H I33(a and
b) S --CH.sub.3 --CH.sub.3 --CH.sub.3 I34(a and b) S --CH.sub.3 --H
--H I35(a and b) S --CH.sub.3 --H --Cl I36(a and b) S --CH.sub.3
--H --Br I37(a and b) S --CH.sub.3 --H --F I38(a and b) S
--CH.sub.3 --H --CH.sub.3 I39(a and b) S --CH.sub.3 --H --CF.sub.3
I40(a and b) S --CH.sub.3 --H --OCH.sub.3 I41(a and b) S --CH.sub.3
--H --OCH.sub.2CH.sub.3 I42(a and b) S --CH.sub.3 --H --OCF.sub.3
I43(a and b) S --CH.sub.3 --H -tert-butyl I44(a and b) S --CH.sub.3
--H -iso-propyl I45(a and b) S --CF.sub.3 --Cl --H I46(a and b) S
--CF.sub.3 --Br --H I47(a and b) S --CF.sub.3 --F --H I48(a and b)
S --CF.sub.3 --CH.sub.3 --H I49(a and b) S --CF.sub.3 --CF.sub.3
--H I50(a and b) S --CF.sub.3 --OCH.sub.3 --H I51(a and b) S
--CF.sub.3 --OCH.sub.2CH.sub.3 --H I52(a and b) S --CF.sub.3
--OCF.sub.3 --H I53(a and b) S --CF.sub.3 -tert-butyl --H I54(a and
b) S --CF.sub.3 -iso-propyl --H I55(a and b) S --CF.sub.3
--CH.sub.3 --CH.sub.3 I56(a and b) S --CF.sub.3 --H --H I57(a and
b) S --CF.sub.3 --H --Cl I58(a and b) S --CF.sub.3 --H --Br I59(a
and b) S --CF.sub.3 --H --F I60(a and b) S --CF.sub.3 --H
--CH.sub.3 I61(a and b) S --CF.sub.3 --H --CF.sub.3 I62(a and b) S
--CF.sub.3 --H --OCH.sub.3 I63(a and b) S --CF.sub.3 --H
--OCH.sub.2CH.sub.3 I64(a and b) S --CF.sub.3 --H --OCF.sub.3 I65(a
and b) S --CF.sub.3 --H -tert-butyl I66(a and b) S --CF.sub.3 --H
-iso-propyl I67(a and b) S --CHF.sub.2 --Cl --H I68(a and b) S
--CHF.sub.2 --Br --H I69(a and b) S --CHF.sub.2 --F --H I70(a and
b) S --CHF.sub.2 --CH.sub.3 --H I71(a and b) S --CHF.sub.2
--CF.sub.3 --H I72(a and b) S --CHF.sub.2 --OCH.sub.3 --H I73(a and
b) S --CHF.sub.2 --OCH.sub.2CH.sub.3 --H I74(a and b) S --CHF.sub.2
--OCF.sub.3 --H I75(a and b) S --CHF.sub.2 -tert-butyl --H I76(a
and b) S --CHF.sub.2 -iso-propyl --H I77(a and b) S --CHF.sub.2
--CH.sub.3 --CH.sub.3 I78(a and b) S --CHF.sub.2 --H --H I79(a and
b) S --CHF.sub.2 --H --Cl I80(a and b) S --CHF.sub.2 --H --Br I81(a
and b) S --CHF.sub.2 --H --F I82(a and b) S --CHF.sub.2 --H
--CH.sub.3 I83(a and b) S --CHF.sub.2 --H --CF.sub.3 I84(a and b) S
--CHF.sub.2 --H --OCH.sub.3 I85(a and b) S --CHF.sub.2 --H
--OCH.sub.2CH.sub.3 I86(a and b) S --CHF.sub.2 --H --OCF.sub.3
I87(a and b) S --CHF.sub.2 --H -tert-butyl I88(a and b) S
--CHF.sub.2 --H -iso-propyl I89(a and b) S --Br --Br --H I90(a and
b) S --Br --Cl --H I91(a and b) S --Br --F --H I92(a and b) S --Br
--CH.sub.3 --H I93(a and b) S --Br --CF.sub.3 --H I94(a and b) S
--Br --OCH.sub.3 --H I95(a and b) S --Br --OCH.sub.2CH.sub.3 --H
I96(a and b) S --Br --OCF.sub.3 --H I97(a and b) S --Br -tert-butyl
--H I98(a and b) S --Br -iso-propyl --H I99(a and b) S --Br
--CH.sub.3 --CH.sub.3 I100(a and b) S --Br --H --H I101(a and b) S
--Br --H --Cl I102(a and b) S --Br --H --Br I103(a and b) S --Br
--H --F I104(a and b) S --Br --H --CH.sub.3 I105(a and b) S --Br
--H --CF.sub.3 I106(a and b) S --Br --H --OCH.sub.3 I107(a and b) S
--Br --H --OCH.sub.2CH.sub.3 I108(a and b) S --Br --H --OCF.sub.3
I109(a and b) S --Br --H -tert-butyl I110(a and b) S --Br --H
-iso-propyl I111(a and b) S --I --Cl --H I112(a and b) S --I --Br
--H I113(a and b) S --I --F --H I114(a and b) S --I --CH.sub.3 --H
I115(a and b) S --I --CF.sub.3 --H I116(a and b) S --I --OCH.sub.3
--H I117(a and b) S --I --OCH.sub.2CH.sub.3 --H I118(a and b) S --I
--OCF.sub.3 --H I119(a and b) S --I -tert-butyl --H I120(a and b) S
--I -iso-propyl --H I121(a and b) S --I --CH.sub.3 --CH.sub.3
I122(a and b) S --I --H --H I123(a and b) S --I --H --Cl I124(a and
b) S --I --H --Br I125(a and b) S --I --H --F I126(a and b) S --I
--H --CH.sub.3 I127(a and b) S --I --H --CF.sub.3 I128(a and b) S
--I --H --OCH.sub.3 I129(a and b) S --I --H --OCH.sub.2CH.sub.3
I130(a and b) S --I --H --OCF.sub.3 I131(a and b) S --I --H
-tert-butyl I132(a and b) S --I --H -iso-propyl I133(a and b) O
--Cl --Cl --H I134(a and b) O --Cl --Br --H I135(a and b) O --Cl
--F --H I136(a and b) O --Cl --CH.sub.3 --H I137(a and b) O --Cl
--CF.sub.3 --H I138(a and b) O --Cl --OCH.sub.3 --H I139(a and b) O
--Cl --OCH.sub.2CH.sub.3 --H I140(a and b) O --Cl --OCF.sub.3 --H
I141(a and b) O --Cl -tert-butyl --H I142(a and b) O --Cl
-iso-propyl --H I143(a and b) O --Cl --CH.sub.3 --CH.sub.3 I144(a
and b) O --Cl --H --H I145(a and b) O --Cl --H --CH.sub.3 I146(a
and b) O --Cl --H --Cl I147(a and b) O --Cl --H --Br I148(a and b)
O --Cl --H --F I149(a and b) O --Cl --H --CF.sub.3 I150(a and b) O
--Cl --H --OCH.sub.3 I151(a and b) O --Cl --H --OCH.sub.2CH.sub.3
I152(a and b) O --Cl --H --OCF.sub.3 I153(a and b) O --Cl --H
-tert-butyl I154(a and b) O --Cl --H -iso-propyl I155(a and b) O
--CH.sub.3 --Cl --H I156(a and b) O --CH.sub.3 --Br --H I157(a and
b) O --CH.sub.3 --F --H I158(a and b) O --CH.sub.3 --CH.sub.3 --H
I159(a and b) O --CH.sub.3 --CF.sub.3 --H I160(a and b) O
--CH.sub.3 --OCH.sub.3 --H I161(a and b) O --CH.sub.3
--OCH.sub.2CH.sub.3 --H I162(a and b) O --CH.sub.3 --OCF.sub.3 --H
I163(a and b) O --CH.sub.3 -tert-butyl --H I164(a and b) O
--CH.sub.3 -iso-propyl --H I165(a and b) O --CH.sub.3 --CH.sub.3
--CH.sub.3 I166(a and b) O --CH.sub.3 --H --H I167(a and b) O
--CH.sub.3 --H --Cl I168(a and b) O --CH.sub.3 --H --Br I169(a and
b) O --CH.sub.3 --H --F I170(a and b) O --CH.sub.3 --H --CH.sub.3
I171(a and b) O --CH.sub.3 --H --CF.sub.3 I172(a and b) O
--CH.sub.3 --H --OCH.sub.3 I173(a and b) O --CH.sub.3 --H
--OCH.sub.2CH.sub.3 I174(a and b) O --CH.sub.3 --H --OCF.sub.3
I175(a and b) O --CH.sub.3 --H -tert-butyl I176(a and b) O
--CH.sub.3 --H -iso-propyl I177(a and b) O --CF.sub.3 --Cl --H
I178(a and b) O --CF.sub.3 --Br --H I179(a and b) O --CF.sub.3 --F
--H I180(a and b) O --CF.sub.3 --CH.sub.3 --H I181(a and b) O
--CF.sub.3 --CF.sub.3 --H I182(a and b) O --CF.sub.3 --OCH.sub.3
--H I183(a and b) O --CF.sub.3 --OCH.sub.2CH.sub.3 --H I184(a and
b) O --CF.sub.3 --OCF.sub.3 --H I185(a and b) O --CF.sub.3
-tert-butyl --H I186(a and b) O --CF.sub.3 -iso-propyl --H I187(a
and b) O --CF.sub.3 --CH.sub.3 --CH.sub.3 I188(a and b) O
--CF.sub.3 --H --H I189(a and b) O --CF.sub.3 --H --Cl I190(a and
b) O --CF.sub.3 --H --Br I191(a and b) O --CF.sub.3 --H --F I192(a
and b) O --CF.sub.3 --H --CH.sub.3 I193(a and b) O --CF.sub.3 --H
--CF.sub.3 I194(a and b) O --CF.sub.3 --H --OCH.sub.3 I195(a and b)
O --CF.sub.3 --H --OCH.sub.2CH.sub.3 I196(a and b) O --CF.sub.3 --H
--OCF.sub.3 I197(a and b) O --CF.sub.3 --H -tert-butyl I198(a and
b) O --CF.sub.3 --H -iso-propyl I199(a and b) O --CHF.sub.2 --Cl
--H I200(a and b) O --CHF.sub.2 --Br --H I201(a and b) O
--CHF.sub.2 --F --H I202(a and b) O --CHF.sub.2 --CH.sub.3 --H
I203(a and b) O --CHF.sub.2 --CF.sub.3 --H I204(a and b) O
--CHF.sub.2 --OCH.sub.3 --H I205(a and b) O --CHF.sub.2
--OCH.sub.2CH.sub.3 --H I206(a and b) O --CHF.sub.2 --OCF.sub.3 --H
I207(a and b) O --CHF.sub.2 -tert-butyl --H I208(a and b) O
--CHF.sub.2 -iso-propyl --H I209(a and b) O --CHF.sub.2 --CH.sub.3
--CH.sub.3 I210(a and b) O --CHF.sub.2 --H --H I211(a and b) O
--CHF.sub.2 --H --Cl I212(a and b) O --CHF.sub.2 --H --Br I213(a
and b) O --CHF.sub.2 --H --F I214(a and b) O --CHF.sub.2 --H
--CH.sub.3 I215(a and b) O --CHF.sub.2 --H --CF.sub.3 I216(a and b)
O --CHF.sub.2 --H --OCH.sub.3 I217(a and b) O --CHF.sub.2 --H
--OCH.sub.2CH.sub.3 I218(a and b) O --CHF.sub.2 --H --OCF.sub.3
I219(a and b) O --CHF.sub.2 --H -tert-butyl I220(a and b) O
--CHF.sub.2 --H -iso-propyl I221(a and b) O --Br --Br --H I222(a
and b) O --Br --Cl --H I223(a and b) O --Br --F --H I224(a and b) O
--Br --CH.sub.3 --H I225(a and b) O --Br --CF.sub.3 --H I226(a and
b) O --Br --OCH.sub.3 --H I227(a and b) O --Br --OCH.sub.2CH.sub.3
--H I228(a and b) O --Br --OCF.sub.3 --H I229(a and b) O --Br
-tert-butyl --H I230(a and b) O --Br -iso-propyl --H I231(a and b)
O --Br --CH.sub.3 --CH.sub.3 I232(a and b) O --Br --H --H I233(a
and b) O --Br --H --Cl I234(a and b) O --Br --H --Br I235(a and b)
O --Br --H --F I236(a and b) O --Br --H --CH.sub.3 I237(a and b) O
--Br --H --CF.sub.3 I238(a and b) O --Br --H --OCH.sub.3 I239(a and
b) O --Br --H --OCH.sub.2CH.sub.3 I240(a and b) O --Br --H
--OCF.sub.3 I241(a and b) O --Br --H -tert-butyl I242(a and b) O
--Br --H -iso-propyl
I243(a and b) O --I --Cl --H I244(a and b) O --I --Br --H I245(a
and b) O --I --F --H I246(a and b) O --I --CH.sub.3 --H I247(a and
b) O --I --CF.sub.3 --H I248(a and b) O --I --OCH.sub.3 --H I249(a
and b) O --I --OCH.sub.2CH.sub.3 --H I250(a and b) O --I
--OCF.sub.3 --H I251(a and b) O --I -tert-butyl --H I252(a and b) O
--I -iso-propyl --H I253(a and b) O --I --CH.sub.3 --CH.sub.3
I254(a and b) O --I --H --H I255(a and b) O --I --H --Cl I256(a and
b) O --I --H --Br I257(a and b) O --I --H --F I258(a and b) O --I
--H --CH.sub.3 I259(a and b) O --I --H --CF.sub.3 I260(a and b) O
--I --H --OCH.sub.3 I261(a and b) O --I --H --OCH.sub.2CH.sub.3
I262(a and b) O --I --H --OCF.sub.3 I263(a and b) O --I --H
-tert-butyl I264(a and b) O --I --H -iso-propyl I265(a and b) NH
--Cl --Cl --H I266(a and b) NH --Cl --Br --H I267(a and b) NH --Cl
--F --H I268(a and b) NH --Cl --CH.sub.3 --H I269(a and b) NH --Cl
--CF.sub.3 --H I270(a and b) NH --Cl --OCH.sub.3 --H I271(a and b)
NH --Cl --OCH.sub.2CH.sub.3 --H I272(a and b) NH --Cl --OCF.sub.3
--H I273(a and b) NH --Cl -tert-butyl --H I274(a and b) NH --Cl
-iso-propyl --H I275(a and b) NH --Cl --CH.sub.3 --CH.sub.3 I276(a
and b) NH --Cl --H --H I277(a and b) NH --Cl --H --CH.sub.3 I278(a
and b) NH --Cl --H --Cl I279(a and b) NH --Cl --H --Br I280(a and
b) NH --Cl --H --F I281(a and b) NH --Cl --H --CF.sub.3 I282(a and
b) NH --Cl --H --OCH.sub.3 I283(a and b) NH --Cl --H
--OCH.sub.2CH.sub.3 I284(a and b) NH --Cl --H --OCF.sub.3 I285(a
and b) NH --Cl --H -tert-butyl I286(a and b) NH --Cl --H
-iso-propyl I287(a and b) NH --CH.sub.3 --Cl --H I288(a and b) NH
--CH.sub.3 --Br --H I289(a and b) NH --CH.sub.3 --F --H I290(a and
b) NH --CH.sub.3 --CH.sub.3 --H I291(a and b) NH --CH.sub.3
--CF.sub.3 --H I292(a and b) NH --CH.sub.3 --OCH.sub.3 --H I293(a
and b) NH --CH.sub.3 --OCH.sub.2CH.sub.3 --H I294(a and b) NH
--CH.sub.3 --OCF.sub.3 --H I295(a and b) NH --CH.sub.3 -tert-butyl
--H I296(a and b) NH --CH.sub.3 -iso-propyl --H I297(a and b) NH
--CH.sub.3 --CH.sub.3 --CH.sub.3 I298(a and b) NH --CH.sub.3 --H
--H I299(a and b) NH --CH.sub.3 --H --Cl I300(a and b) NH
--CH.sub.3 --H --Br I301(a and b) NH --CH.sub.3 --H --F I302(a and
b) NH --CH.sub.3 --H --CH.sub.3 I303(a and b) NH --CH.sub.3 --H
--CF.sub.3 I304(a and b) NH --CH.sub.3 --H --OCH.sub.3 I305(a and
b) NH --CH.sub.3 --H --OCH.sub.2CH.sub.3 I306(a and b) NH
--CH.sub.3 --H --OCF.sub.3 I307(a and b) NH --CH.sub.3 --H
-tert-butyl I308(a and b) NH --CH.sub.3 --H -iso-propyl I309(a and
b) NH --CF.sub.3 --Cl --H I310(a and b) NH --CF.sub.3 --Br --H
I311(a and b) NH --CF.sub.3 --F --H I312(a and b) NH --CF.sub.3
--CH.sub.3 --H I313(a and b) NH --CF.sub.3 --CF.sub.3 --H I314(a
and b) NH --CF.sub.3 --OCH.sub.3 --H I315(a and b) NH --CF.sub.3
--OCH.sub.2CH.sub.3 --H I316(a and b) NH --CF.sub.3 --OCF.sub.3 --H
I317(a and b) NH --CF.sub.3 -tert-butyl --H I318(a and b) NH
--CF.sub.3 -iso-propyl --H I319(a and b) NH --CF.sub.3 --CH.sub.3
--CH.sub.3 I320(a and b) NH --CF.sub.3 --H --H I321(a and b) NH
--CF.sub.3 --H --Cl I322(a and b) NH --CF.sub.3 --H --Br I323(a and
b) NH --CF.sub.3 --H --F I324(a and b) NH --CF.sub.3 --H --CH.sub.3
I325(a and b) NH --CF.sub.3 --H --CF.sub.3 I326(a and b) NH
--CF.sub.3 --H --OCH.sub.3 I327(a and b) NH --CF.sub.3 --H
--OCH.sub.2CH.sub.3 I328(a and b) NH --CF.sub.3 --H --OCF.sub.3
I329(a and b) NH --CF.sub.3 --H -tert-butyl I330(a and b) NH
--CF.sub.3 --H -iso-propyl I331(a and b) NH --CHF.sub.2 --Cl --H
I332(a and b) NH --CHF.sub.2 --Br --H I333(a and b) NH --CHF.sub.2
--F --H I334(a and b) NH --CHF.sub.2 --CH.sub.3 --H I335(a and b)
NH --CHF.sub.2 --CF.sub.3 --H I336(a and b) NH --CHF.sub.2
--OCH.sub.3 --H I337(a and b) NH --CHF.sub.2 --OCH.sub.2CH.sub.3
--H I338(a and b) NH --CHF.sub.2 --OCF.sub.3 --H I339(a and b) NH
--CHF.sub.2 -tert-butyl --H I340(a and b) NH --CHF.sub.2
-iso-propyl --H I341(a and b) NH --CHF.sub.2 --CH.sub.3 --CH.sub.3
I342(a and b) NH --CHF.sub.2 --H --H I343(a and b) NH --CHF.sub.2
--H --Cl I344(a and b) NH --CHF.sub.2 --H --Br I345(a and b) NH
--CHF.sub.2 --H --F I346(a and b) NH --CHF.sub.2 --H --CH.sub.3
I347(a and b) NH --CHF.sub.2 --H --CF.sub.3 I348(a and b) NH
--CHF.sub.2 --H --OCH.sub.3 I349(a and b) NH --CHF.sub.2 --H
--OCH.sub.2CH.sub.3 I350(a and b) NH --CHF.sub.2 --H --OCF.sub.3
I351(a and b) NH --CHF.sub.2 --H -tert-butyl I352(a and b) NH
--CHF.sub.2 --H -iso-propyl I353(a and b) NH --Br --Br --H I354(a
and b) NH --Br --Cl --H I355(a and b) NH --Br --F --H I356(a and b)
NH --Br --CH.sub.3 --H I357(a and b) NH --Br --CF.sub.3 --H I358(a
and b) NH --Br --OCH.sub.3 --H I359(a and b) NH --Br
--OCH.sub.2CH.sub.3 --H I360(a and b) NH --Br --OCF.sub.3 --H
I361(a and b) NH --Br -tert-butyl --H I362(a and b) NH --Br
-iso-propyl --H I363(a and b) NH --Br --CH.sub.3 --CH.sub.3 I364(a
and b) NH --Br --H --H I365(a and b) NH --Br --H --Cl I366(a and b)
NH --Br --H --Br I367(a and b) NH --Br --H --F I368(a and b) NH
--Br --H --CH.sub.3 I369(a and b) NH --Br --H --CF.sub.3 I370(a and
b) NH --Br --H --OCH.sub.3 I371(a and b) NH --Br --H
--OCH.sub.2CH.sub.3 I372(a and b) NH --Br --H --OCF.sub.3 I373(a
and b) NH --Br --H -tert-butyl I374(a and b) NH --Br --H
-iso-propyl I375(a and b) NH --I --Cl --H I376(a and b) NH --I --Br
--H I377(a and b) NH --I --F --H I378(a and b) NH --I --CH.sub.3
--H I379(a and b) NH --I --CF.sub.3 --H I380(a and b) NH --I
--OCH.sub.3 --H I381(a and b) NH --I --OCH.sub.2CH.sub.3 --H I382(a
and b) NH --I --OCF.sub.3 --H I383(a and b) NH --I -tert-butyl --H
I384(a and b) NH --I -iso-propyl --H I385(a and b) NH --I
--CH.sub.3 --CH.sub.3 I386(a and b) NH --I --H --H I387(a and b) NH
--I --H --Cl I388(a and b) NH --I --H --Br I389(a and b) NH --I --H
--F I390(a and b) NH --I --H --CH.sub.3 I391(a and b) NH --I --H
--CF.sub.3 I392(a and b) NH --I --H --OCH.sub.3 I393(a and b) NH
--I --H --OCH.sub.2CH.sub.3 I394(a and b) NH --I --H --OCF.sub.3
I395(a and b) NH --I --H -tert-butyl I396(a and b) NH --I --H
-iso-propyl In the column labeled "Compound": (a) means Z.sub.1 is
CH and Z.sub.2 is N; and (b) means Z.sub.1 is N and Z.sub.2 is
CH.
TABLE-US-00010 TABLE 10 (XII) ##STR00093## and pharmaceutically
acceptable salts thereof, where: Compound Y R.sub.1 (R.sub.8).sub.a
(R.sub.8).sub.b J1(a and b) S --Cl --Cl --H J2(a and b) S --Cl --Br
--H J3(a and b) S --Cl --F --H J4(a and b) S --Cl --CH.sub.3 --H
J5(a and b) S --Cl --CF.sub.3 --H J6(a and b) S --Cl --OCH.sub.3
--H J7(a and b) S --Cl --OCH.sub.2CH.sub.3 --H J8(a and b) S --Cl
--OCF.sub.3 --H J9(a and b) S --Cl -tert-butyl --H J10(a and b) S
--Cl -iso-propyl --H J11(a and b) S --Cl --CH.sub.3 --CH.sub.3
J12(a and b) S --Cl --H --H J13(a and b) S --Cl --H --Cl J14(a and
b) S --Cl --H --Br J15(a and b) S --Cl --H --F J16(a and b) S --Cl
--H --CH.sub.3 J17(a and b) S --Cl --H --CF.sub.3 J18(a and b) S
--Cl --H --OCH.sub.3 J19(a and b) S --Cl --H --OCH.sub.2CH.sub.3
J20(a and b) S --Cl --H --OCF.sub.3 J21(a and b) S --Cl --H
-tert-butyl J22(a and b) S --Cl --H -iso-propyl J23(a and b) S
--CH.sub.3 --Cl --H J24(a and b) S --CH.sub.3 --Br --H J25(a and b)
S --CH.sub.3 --F --H J26(a and b) S --CH.sub.3 --CH.sub.3 --H J27(a
and b) S --CH.sub.3 --CF.sub.3 --H J28(a and b) S --CH.sub.3
--OCH.sub.3 --H J29(a and b) S --CH.sub.3 --OCH.sub.2CH.sub.3 --H
J30(a and b) S --CH.sub.3 --OCF.sub.3 --H J31(a and b) S --CH.sub.3
-tert-butyl --H J32(a and b) S --CH.sub.3 -iso-propyl --H J33(a and
b) S --CH.sub.3 --CH.sub.3 --CH.sub.3 J34(a and b) S --CH.sub.3 --H
--H J35(a and b) S --CH.sub.3 --H --Cl J36(a and b) S --CH.sub.3
--H --Br J37(a and b) S --CH.sub.3 --H --F J38(a and b) S
--CH.sub.3 --H --CH.sub.3 J39(a and b) S --CH.sub.3 --H --CF.sub.3
J40(a and b) S --CH.sub.3 --H --OCH.sub.3 J41(a and b) S --CH.sub.3
--H --OCH.sub.2CH.sub.3 J42(a and b) S --CH.sub.3 --H --OCF.sub.3
J43(a and b) S --CH.sub.3 --H -tert-butyl J44(a and b) S --CH.sub.3
--H -iso-propyl J45(a and b) S --CF.sub.3 --Cl --H J46(a and b) S
--CF.sub.3 --Br --H J47(a and b) S --CF.sub.3 --F --H J48(a and b)
S --CF.sub.3 --CH.sub.3 --H J49(a and b) S --CF.sub.3 --CF.sub.3
--H J50(a and b) S --CF.sub.3 --OCH.sub.3 --H J51(a and b) S
--CF.sub.3 --OCH.sub.2CH.sub.3 --H J52(a and b) S --CF.sub.3
--OCF.sub.3 --H J53(a and b) S --CF.sub.3 -tert-butyl --H J54(a and
b) S --CF.sub.3 -iso-propyl --H J55(a and b) S --CF.sub.3
--CH.sub.3 --CH.sub.3 J56(a and b) S --CF.sub.3 --H --H J57(a and
b) S --CF.sub.3 --H --Cl J58(a and b) S --CF.sub.3 --H --Br J59(a
and b) S --CF.sub.3 --H --F J60(a and b) S --CF.sub.3 --H
--CH.sub.3 J61(a and b) S --CF.sub.3 --H --CF.sub.3 J62(a and b) S
--CF.sub.3 --H --OCH.sub.3 J63(a and b) S --CF.sub.3 --H
--OCH.sub.2CH.sub.3 J64(a and b) S --CF.sub.3 --H --OCF.sub.3 J65(a
and b) S --CF.sub.3 --H -tert-butyl J66(a and b) S --CF.sub.3 --H
-iso-propyl J67(a and b) S --CHF.sub.2 --Cl --H J68(a and b) S
--CHF.sub.2 --Br --H J69(a and b) S --CHF.sub.2 --F --H J70(a and
b) S --CHF.sub.2 --CH.sub.3 --H J71(a and b) S --CHF.sub.2
--CF.sub.3 --H J72(a and b) S --CHF.sub.2 --OCH.sub.3 --H J73(a and
b) S --CHF.sub.2 --OCH.sub.2CH.sub.3 --H J74(a and b) S --CHF.sub.2
--OCF.sub.3 --H J75(a and b) S --CHF.sub.2 -tert-butyl --H J76(a
and b) S --CHF.sub.2 -iso-propyl --H J77(a and b) S --CHF.sub.2
--CH.sub.3 --CH.sub.3 J78(a and b) S --CHF.sub.2 --H --H J79(a and
b) S --CHF.sub.2 --H --Cl J80(a and b) S --CHF.sub.2 --H --Br J81(a
and b) S --CHF.sub.2 --H --F J82(a and b) S --CHF.sub.2 --H
--CH.sub.3 J83(a and b) S --CHF.sub.2 --H --CF.sub.3 J84(a and b) S
--CHF.sub.2 --H --OCH.sub.3 J85(a and b) S --CHF.sub.2 --H
--OCH.sub.2CH.sub.3 J86(a and b) S --CHF.sub.2 --H --OCF.sub.3
J87(a and b) S --CHF.sub.2 --H -tert-butyl J88(a and b) S
--CHF.sub.2 --H -iso-propyl J89(a and b) S --Br --Br --H J90(a and
b) S --Br --Cl --H J91(a and b) S --Br --F --H J92(a and b) S --Br
--CH.sub.3 --H J93(a and b) S --Br --CF.sub.3 --H J94(a and b) S
--Br --OCH.sub.3 --H J95(a and b) S --Br --OCH.sub.2CH.sub.3 --H
J96(a and b) S --Br --OCF.sub.3 --H J97(a and b) S --Br -tert-butyl
--H J98(a and b) S --Br -iso-propyl --H J99(a and b) S --Br
--CH.sub.3 --CH.sub.3 J100(a and b) S --Br --H --H J101(a and b) S
--Br --H --Cl J102(a and b) S --Br --H --Br J103(a and b) S --Br
--H --F J104(a and b) S --Br --H --CH.sub.3 J105(a and b) S --Br
--H --CF.sub.3 J106(a and b) S --Br --H --OCH.sub.3 J107(a and b) S
--Br --H --OCH.sub.2CH.sub.3 J108(a and b) S --Br --H --OCF.sub.3
J109(a and b) S --Br --H -tert-butyl J110(a and b) S --Br --H
-iso-propyl J111(a and b) S --I --Cl --H J112(a and b) S --I --Br
--H J113(a and b) S --I --F --H J114(a and b) S --I --CH.sub.3 --H
J115(a and b) S --I --CF.sub.3 --H J116(a and b) S --I --OCH.sub.3
--H J117(a and b) S --I --OCH.sub.2CH.sub.3 --H J118(a and b) S --I
--OCF.sub.3 --H J119(a and b) S --I -tert-butyl --H J120(a and b) S
--I -iso-propyl --H J121(a and b) S --I --CH.sub.3 --CH.sub.3
J122(a and b) S --I --H --H J123(a and b) S --I --H --Cl J124(a and
b) S --I --H --Br J125(a and b) S --I --H --F J126(a and b) S --I
--H --CH.sub.3 J127(a and b) S --I --H --CF.sub.3 J128(a and b) S
--I --H --OCH.sub.3 J129(a and b) S --I --H --OCH.sub.2CH.sub.3
J130(a and b) S --I --H --OCF.sub.3 J131(a and b) S --I --H
-tert-butyl J132(a and b) S --I --H -iso-propyl J133(a and b) O
--Cl --Cl --H J134(a and b) O --Cl --Br --H J135(a and b) O --Cl
--F --H J136(a and b) O --Cl --CH.sub.3 --H J137(a and b) O --Cl
--CF.sub.3 --H J138(a and b) O --Cl --OCH.sub.3 --H J139(a and b) O
--Cl --OCH.sub.2CH.sub.3 --H J140(a and b) O --Cl --OCF.sub.3 --H
J141(a and b) O --Cl -tert-butyl --H J142(a and b) O --Cl
-iso-propyl --H J143(a and b) O --Cl --CH.sub.3 --CH.sub.3 J144(a
and b) O --Cl --H --H J145(a and b) O --Cl --H --CH.sub.3 J146(a
and b) O --Cl --H --Cl J147(a and b) O --Cl --H --Br J148(a and b)
O --Cl --H --F J149(a and b) O --Cl --H --CF.sub.3 J150(a and b) O
--Cl --H --OCH.sub.3 J151(a and b) O --Cl --H --OCH.sub.2CH.sub.3
J152(a and b) O --Cl --H --OCF.sub.3 J153(a and b) O --Cl --H
-tert-butyl J154(a and b) O --Cl --H -iso-propyl J155(a and b) O
--CH.sub.3 --Cl --H J156(a and b) O --CH.sub.3 --Br --H J157(a and
b) O --CH.sub.3 --F --H J158(a and b) O --CH.sub.3 --CH.sub.3 --H
J159(a and b) O --CH.sub.3 --CF.sub.3 --H J160(a and b) O
--CH.sub.3 --OCH.sub.3 --H J161(a and b) O --CH.sub.3
--OCH.sub.2CH.sub.3 --H J162(a and b) O --CH.sub.3 --OCF.sub.3 --H
J163(a and b) O --CH.sub.3 -tert-butyl --H J164(a and b) O
--CH.sub.3 -iso-propyl --H J165(a and b) O --CH.sub.3 --CH.sub.3
--CH.sub.3 J166(a and b) O --CH.sub.3 --H --H J167(a and b) O
--CH.sub.3 --H --Cl J168(a and b) O --CH.sub.3 --H --Br J169(a and
b) O --CH.sub.3 --H --F J170(a and b) O --CH.sub.3 --H --CH.sub.3
J171(a and b) O --CH.sub.3 --H --CF.sub.3 J172(a and b) O
--CH.sub.3 --H --OCH.sub.3 J173(a and b) O --CH.sub.3 --H
--OCH.sub.2CH.sub.3 J174(a and b) O --CH.sub.3 --H --OCF.sub.3
J175(a and b) O --CH.sub.3 --H -tert-butyl J176(a and b) O
--CH.sub.3 --H -iso-propyl J177(a and b) O --CF.sub.3 --Cl --H
J178(a and b) O --CF.sub.3 --Br --H J179(a and b) O --CF.sub.3 --F
--H J180(a and b) O --CF.sub.3 --CH.sub.3 --H J181(a and b) O
--CF.sub.3 --CF.sub.3 --H J182(a and b) O --CF.sub.3 --OCH.sub.3
--H J183(a and b) O --CF.sub.3 --OCH.sub.2CH.sub.3 --H J184(a and
b) O --CF.sub.3 --OCF.sub.3 --H J185(a and b) O --CF.sub.3
-tert-butyl --H J186(a and b) O --CF.sub.3 -iso-propyl --H J187(a
and b) O --CF.sub.3 --CH.sub.3 --CH.sub.3 J188(a and b) O
--CF.sub.3 --H --H J189(a and b) O --CF.sub.3 --H --Cl J190(a and
b) O --CF.sub.3 --H --Br J191(a and b) O --CF.sub.3 --H --F J192(a
and b) O --CF.sub.3 --H --CH.sub.3 J193(a and b) O --CF.sub.3 --H
--CF.sub.3 J194(a and b) O --CF.sub.3 --H --OCH.sub.3 J195(a and b)
O --CF.sub.3 --H --OCH.sub.2CH.sub.3 J196(a and b) O --CF.sub.3 --H
--OCF.sub.3 J197(a and b) O --CF.sub.3 --H -tert-butyl J198(a and
b) O --CF.sub.3 --H -iso-propyl J199(a and b) O --CHF.sub.2 --Cl
--H J200(a and b) O --CHF.sub.2 --Br --H J201(a and b) O
--CHF.sub.2 --F --H J202(a and b) O --CHF.sub.2 --CH.sub.3 --H
J203(a and b) O --CHF.sub.2 --CF.sub.3 --H J204(a and b) O
--CHF.sub.2 --OCH.sub.3 --H J205(a and b) O --CHF.sub.2
--OCH.sub.2CH.sub.3 --H J206(a and b) O --CHF.sub.2 --OCF.sub.3 --H
J207(a and b) O --CHF.sub.2 -tert-butyl --H J208(a and b) O
--CHF.sub.2 -iso-propyl --H J209(a and b) O --CHF.sub.2 --CH.sub.3
--CH.sub.3 J210(a and b) O --CHF.sub.2 --H --H J211(a and b) O
--CHF.sub.2 --H --Cl J212(a and b) O --CHF.sub.2 --H --Br J213(a
and b) O --CHF.sub.2 --H --F J214(a and b) O --CHF.sub.2 --H
--CH.sub.3 J215(a and b) O --CHF.sub.2 --H --CF.sub.3 J216(a and b)
O --CHF.sub.2 --H --OCH.sub.3 J217(a and b) O --CHF.sub.2 --H
--OCH.sub.2CH.sub.3 J218(a and b) O --CHF.sub.2 --H --OCF.sub.3
J219(a and b) O --CHF.sub.2 --H -tert-butyl J220(a and b) O
--CHF.sub.2 --H -iso-propyl J221(a and b) O --Br --Br --H J222(a
and b) O --Br --Cl --H J223(a and b) O --Br --F --H J224(a and b) O
--Br --CH.sub.3 --H J225(a and b) O --Br --CF.sub.3 --H J226(a and
b) O --Br --OCH.sub.3 --H J227(a and b) O --Br --OCH.sub.2CH.sub.3
--H J228(a and b) O --Br --OCF.sub.3 --H J229(a and b) O --Br
-tert-butyl --H J230(a and b) O --Br -iso-propyl --H J231(a and b)
O --Br --CH.sub.3 --CH.sub.3 J232(a and b) O --Br --H --H J233(a
and b) O --Br --H --Cl J234(a and b) O --Br --H --Br J235(a and b)
O --Br --H --F J236(a and b) O --Br --H --CH.sub.3 J237(a and b) O
--Br --H --CF.sub.3 J238(a and b) O --Br --H --OCH.sub.3 J239(a and
b) O --Br --H --OCH.sub.2CH.sub.3 J240(a and b) O --Br --H
--OCF.sub.3 J241(a and b) O --Br --H -tert-butyl J242(a and b) O
--Br --H -iso-propyl
J243(a and b) O --I --Cl --H J244(a and b) O --I --Br --H J245(a
and b) O --I --F --H J246(a and b) O --I --CH.sub.3 --H J247(a and
b) O --I --CF.sub.3 --H J248(a and b) O --I --OCH.sub.3 --H J249(a
and b) O --I --OCH.sub.2CH.sub.3 --H J250(a and b) O --I
--OCF.sub.3 --H J251(a and b) O --I -tert-butyl --H J252(a and b) O
--I -iso-propyl --H J253(a and b) O --I --CH.sub.3 --CH.sub.3
J254(a and b) O --I --H --H J255(a and b) O --I --H --Cl J256(a and
b) O --I --H --Br J257(a and b) O --I --H --F J258(a and b) O --I
--H --CH.sub.3 J259(a and b) O --I --H --CF.sub.3 J260(a and b) O
--I --H --OCH.sub.3 J261(a and b) O --I --H --OCH.sub.2CH.sub.3
J262(a and b) O --I --H --OCF.sub.3 J263(a and b) O --I --H
-tert-butyl J264(a and b) O --I --H -iso-propyl J265(a and b) NH
--Cl --Cl --H J266(a and b) NH --Cl --Br --H J267(a and b) NH --Cl
--F --H J268(a and b) NH --Cl --CH.sub.3 --H J269(a and b) NH --Cl
--CF.sub.3 --H J270(a and b) NH --Cl --OCH.sub.3 --H J271(a and b)
NH --Cl --OCH.sub.2CH.sub.3 --H J272(a and b) NH --Cl --OCF.sub.3
--H J273(a and b) NH --Cl -tert-butyl --H J274(a and b) NH --Cl
-iso-propyl --H J275(a and b) NH --Cl --CH.sub.3 --CH.sub.3 J276(a
and b) NH --Cl --H --H J277(a and b) NH --Cl --H --CH.sub.3 J278(a
and b) NH --Cl --H --Cl J279(a and b) NH --Cl --H --Br J280(a and
b) NH --Cl --H --F J281(a and b) NH --Cl --H --CF.sub.3 J282(a and
b) NH --Cl --H --OCH.sub.3 J283(a and b) NH --Cl --H
--OCH.sub.2CH.sub.3 J284(a and b) NH --Cl --H --OCF.sub.3 J285(a
and b) NH --Cl --H -tert-butyl J286(a and b) NH --Cl --H
-iso-propyl J287(a and b) NH --CH.sub.3 --Cl --H J288(a and b) NH
--CH.sub.3 --Br --H J289(a and b) NH --CH.sub.3 --F --H J290(a and
b) NH --CH.sub.3 --CH.sub.3 --H J291(a and b) NH --CH.sub.3
--CF.sub.3 --H J292(a and b) NH --CH.sub.3 --OCH.sub.3 --H J293(a
and b) NH --CH.sub.3 --OCH.sub.2CH.sub.3 --H J294(a and b) NH
--CH.sub.3 --OCF.sub.3 --H J295(a and b) NH --CH.sub.3 -tert-butyl
--H J296(a and b) NH --CH.sub.3 -iso-propyl --H J297(a and b) NH
--CH.sub.3 --CH.sub.3 --CH.sub.3 J298(a and b) NH --CH.sub.3 --H
--H J299(a and b) NH --CH.sub.3 --H --Cl J300(a and b) NH
--CH.sub.3 --H --Br J301(a and b) NH --CH.sub.3 --H --F J302(a and
b) NH --CH.sub.3 --H --CH.sub.3 J303(a and b) NH --CH.sub.3 --H
--CF.sub.3 J304(a and b) NH --CH.sub.3 --H --OCH.sub.3 J305(a and
b) NH --CH.sub.3 --H --OCH.sub.2CH.sub.3 J306(a and b) NH
--CH.sub.3 --H --OCF.sub.3 J307(a and b) NH --CH.sub.3 --H
-tert-butyl J308(a and b) NH --CH.sub.3 --H -iso-propyl J309(a and
b) NH --CF.sub.3 --Cl --H J310(a and b) NH --CF.sub.3 --Br --H
J311(a and b) NH --CF.sub.3 --F --H J312(a and b) NH --CF.sub.3
--CH.sub.3 --H J313(a and b) NH --CF.sub.3 --CF.sub.3 --H J314(a
and b) NH --CF.sub.3 --OCH.sub.3 --H J315(a and b) NH --CF.sub.3
--OCH.sub.2CH.sub.3 --H J316(a and b) NH --CF.sub.3 --OCF.sub.3 --H
J317(a and b) NH --CF.sub.3 -tert-butyl --H J318(a and b) NH
--CF.sub.3 -iso-propyl --H J319(a and b) NH --CF.sub.3 --CH.sub.3
--CH.sub.3 J320(a and b) NH --CF.sub.3 --H --H J321(a and b) NH
--CF.sub.3 --H --Cl J322(a and b) NH --CF.sub.3 --H --Br J323(a and
b) NH --CF.sub.3 --H --F J324(a and b) NH --CF.sub.3 --H --CH.sub.3
J325(a and b) NH --CF.sub.3 --H --CF.sub.3 J326(a and b) NH
--CF.sub.3 --H --OCH.sub.3 J327(a and b) NH --CF.sub.3 --H
--OCH.sub.2CH.sub.3 J328(a and b) NH --CF.sub.3 --H --OCF.sub.3
J329(a and b) NH --CF.sub.3 --H -tert-butyl J330(a and b) NH
--CF.sub.3 --H -iso-propyl J331(a and b) NH --CHF.sub.2 --Cl --H
J332(a and b) NH --CHF.sub.2 --Br --H J333(a and b) NH --CHF.sub.2
--F --H J334(a and b) NH --CHF.sub.2 --CH.sub.3 --H J335(a and b)
NH --CHF.sub.2 --CF.sub.3 --H J336(a and b) NH --CHF.sub.2
--OCH.sub.3 --H J337(a and b) NH --CHF.sub.2 --OCH.sub.2CH.sub.3
--H J338(a and b) NH --CHF.sub.2 --OCF.sub.3 --H J339(a and b) NH
--CHF.sub.2 -tert-butyl --H J340(a and b) NH --CHF.sub.2
-iso-propyl --H J341(a and b) NH --CHF.sub.2 --CH.sub.3 --CH.sub.3
J342(a and b) NH --CHF.sub.2 --H --H J343(a and b) NH --CHF.sub.2
--H --Cl J344(a and b) NH --CHF.sub.2 --H --Br J345(a and b) NH
--CHF.sub.2 --H --F J346(a and b) NH --CHF.sub.2 --H --CH.sub.3
J347(a and b) NH --CHF.sub.2 --H --CF.sub.3 J348(a and b) NH
--CHF.sub.2 --H --OCH.sub.3 J349(a and b) NH --CHF.sub.2 --H
--OCH.sub.2CH.sub.3 J350(a and b) NH --CHF.sub.2 --H --OCF.sub.3
J351(a and b) NH --CHF.sub.2 --H -tert-butyl J352(a and b) NH
--CHF.sub.2 --H -iso-propyl J353(a and b) NH --Br --Br --H J354(a
and b) NH --Br --Cl --H J355(a and b) NH --Br --F --H J356(a and b)
NH --Br --CH.sub.3 --H J357(a and b) NH --Br --CF.sub.3 --H J358(a
and b) NH --Br --OCH.sub.3 --H J359(a and b) NH --Br
--OCH.sub.2CH.sub.3 --H J360(a and b) NH --Br --OCF.sub.3 --H
J361(a and b) NH --Br -tert-butyl --H J362(a and b) NH --Br
-iso-propyl --H J363(a and b) NH --Br --CH.sub.3 --CH.sub.3 J364(a
and b) NH --Br --H --H J365(a and b) NH --Br --H --Cl J366(a and b)
NH --Br --H --Br J367(a and b) NH --Br --H --F J368(a and b) NH
--Br --H --CH.sub.3 J369(a and b) NH --Br --H --CF.sub.3 J370(a and
b) NH --Br --H --OCH.sub.3 J371(a and b) NH --Br --H
--OCH.sub.2CH.sub.3 J372(a and b) NH --Br --H --OCF.sub.3 J373(a
and b) NH --Br --H -tert-butyl J374(a and b) NH --Br --H
-iso-propyl J375(a and b) NH --I --Cl --H J376(a and b) NH --I --Br
--H J377(a and b) NH --I --F --H J378(a and b) NH --I --CH.sub.3
--H J379(a and b) NH --I --CF.sub.3 --H J380(a and b) NH --I
--OCH.sub.3 --H J381(a and b) NH --I --OCH.sub.2CH.sub.3 --H J382(a
and b) NH --I --OCF.sub.3 --H J383(a and b) NH --I -tert-butyl --H
J384(a and b) NH --I -iso-propyl --H J385(a and b) NH --I
--CH.sub.3 --CH.sub.3 J386(a and b) NH --I --H --H J387(a and b) NH
--I --H --Cl J388(a and b) NH --I --H --Br J389(a and b) NH --I --H
--F J390(a and b) NH --I --H --CH.sub.3 J391(a and b) NH --I --H
--CF.sub.3 J392(a and b) NH --I --H --OCH.sub.3 J393(a and b) NH
--I --H --OCH.sub.2CH.sub.3 J394(a and b) NH --I --H --OCF.sub.3
J395(a and b) NH --I --H -tert-butyl J396(a and b) NH --I --H
-iso-propyl In the column labeled "Compound": (a) means Z.sub.1 is
CH and Z.sub.2 is N; and (b) means Z.sub.1 is N and Z.sub.2 is
CH.
4.4 Definitions
[0373] As used in connection with the Pyridylene Compounds herein,
the terms used above having following meaning:
[0374] "--(C.sub.1-C.sub.10)alkyl" means a straight chain or
branched non-cyclic hydrocarbon having from 1 to 10 carbon atoms.
Representative straight chain --(C.sub.1-C.sub.10)alkyls include
-methyl, -ethyl, -n-propyl, -n-butyl, -n-pentyl, -n-hexyl,
-n-heptyl, -n-octyl, -n-nonyl, and -n-decyl. Representative
branched --(C.sub.1-C.sub.10)alkyls include -iso-propyl,
-sec-butyl, -iso-butyl, -tert-butyl, -iso-pentyl, -neopentyl,
1-methylbutyl, 2-methylbutyl, 3-methylbutyl, 1,1-dimethylpropyl,
1,2-dimethylpropyl, 1-methylpentyl, 2-methylpentyl, 3-methylpentyl,
4-methylpentyl, 1-ethylbutyl, 2-ethylbutyl, 3-ethylbutyl,
1,1-dimethylbutyl, 1,2-dimethylbutyl, 1,3-dimethylbutyl,
2,2-dimethylbutyl, 2,3-dimethylbutyl, 3,3-dimethylbutyl,
1-methylhexyl, 2-methylhexyl, 3-methylhexyl, 4-methylhexyl,
5-methylhexyl, 1,2-dimethylpentyl, 1,3-dimethylpentyl,
1,2-dimethylhexyl, 1,3-dimethylhexyl, 3,3-dimethylhexyl,
1,2-dimethylheptyl, 1,3-dimethylheptyl, and 3,3-dimethylheptyl.
[0375] "--(C.sub.1-C.sub.6)alkyl" means a straight chain or
branched non-cyclic hydrocarbon having from 1 to 6 carbon atoms.
Representative straight chain --(C.sub.1-C.sub.6)alkyls include
-methyl, -ethyl, -n-propyl, -n-butyl, -n-pentyl, and -n-hexyl.
Representative branched --(C.sub.1-C.sub.6)alkyls include
-iso-propyl, -sec-butyl, -iso-butyl, -tert-butyl, -iso-pentyl,
-neopentyl, 1-methylbutyl, 2-methylbutyl, 3-methylbutyl,
1,1-dimethylpropyl, 1,2-dimethylpropyl, 1-methylpentyl,
2-methylpentyl, 3-methylpentyl, 4-methylpentyl, 1-ethylbutyl,
2-ethylbutyl, 3-ethylbutyl, 1,1-dimethylbutyl, 1,2-dimethylbutyl,
1,3-dimethylbutyl, 2,2-dimethylbutyl, 2,3-dimethylbutyl, and
3,3-dimethylbutyl.
[0376] "--(C.sub.1-C.sub.4)alkyl" means a straight chain or
branched non-cyclic hydrocarbon having from 1 to 4 carbon atoms.
Representative straight chain --(C.sub.1-C.sub.4)alkyls include
-methyl, -ethyl, -n-propyl, and -n-butyl. Representative branched
--(C.sub.1-C.sub.4)alkyls include -iso-propyl, -sec-butyl,
-iso-butyl, and -tert-butyl.
[0377] "--(C.sub.2-C.sub.10)alkenyl" means a straight chain or
branched non-cyclic hydrocarbon having from 2 to 10 carbon atoms
and including at least one carbon-carbon double bond.
Representative straight chain and branched
(C.sub.2-C.sub.10)alkenyls include -vinyl, -allyl, -1-butenyl,
-2-butenyl, -iso-butylenyl, -1-pentenyl, -2-pentenyl, -3-methyl
1-butenyl, -methyl-2-butenyl, -2,3-dimethyl-2-butenyl, -1-hexenyl,
-2-hexenyl, -3-hexenyl, -1-heptenyl, -2-heptenyl, -3-heptenyl,
-1-octenyl, -2-octenyl, -3-octenyl, -1-nonenyl, -2-nonenyl,
-3-nonenyl, -1-decenyl, -2-decenyl, -3-decenyl and the like.
[0378] "--(C.sub.2-C.sub.6)alkenyl" means a straight chain or
branched non-cyclic hydrocarbon having from 2 to 6 carbon atoms and
including at least one carbon-carbon double bond. Representative
straight chain and branched (C.sub.2-C.sub.6)alkenyls include
-vinyl, -allyl, -1-butenyl, -2-butenyl, -iso-butylenyl,
-1-pentenyl, -2-pentenyl, -3-methyl-1-butenyl, -2-methyl-2-butenyl,
-2,3-dimethyl-2-butenyl, -1-hexenyl, 2-hexenyl, 3-hexenyl and the
like.
[0379] "--(C.sub.2-C.sub.10)alkynyl" means a straight chain or
branched non-cyclic hydrocarbon having from 2 to 10 carbon atoms
and including at least one carbon-carbon triple bond.
Representative straight chain and branched
--(C.sub.2-C.sub.10)alkynyls include -acetylenyl, -propynyl,
-1-butynyl, -2-butynyl, -1-pentynyl, -2-pentynyl,
-3-methyl-1-butynyl, -4-pentynyl, -1-hexynyl, -2-hexynyl,
-5-hexynyl, -1-heptynyl, -2-heptynyl, -6-heptynyl, -1-octynyl,
-2-octynyl, -7-octynyl, -1-nonynyl, -2-nonynyl, -8-nonynyl,
-1-decynyl, -2-decynyl, -9-decynyl and the like.
[0380] "--(C.sub.2-C.sub.6)alkynyl" means a straight chain or
branched non-cyclic hydrocarbon having from 2 to 6 carbon atoms and
including at least one carbon-carbon triple bond. Representative
straight chain and branched (C.sub.2-C.sub.6)alkynyls include
-acetylenyl, -propynyl, -1-butynyl, -2-butynyl, -1-pentynyl,
-2-pentynyl, -3-methyl-1-butynyl, -4-pentynyl, -1-hexynyl,
-2-hexynyl, -5-hexynyl and the like.
[0381] "--(C.sub.3-C.sub.10)cycloalkyl" means a saturated cyclic
hydrocarbon having from 3 to 10 carbon atoms. Representative
(C.sub.3-C.sub.10)cycloalkyls are -cyclopropyl, -cyclobutyl,
-cyclopentyl, -cyclohexyl, -cycloheptyl, -cyclooctyl, -cyclononyl,
and -cyclodecyl.
[0382] "--(C.sub.3-C.sub.8)cycloalkyl" means a saturated cyclic
hydrocarbon having from 3 to 8 carbon atoms. Representative
(C.sub.3-C.sub.8)cycloalkyls include -cyclopropyl, -cyclobutyl,
-cyclopentyl, -cyclohexyl, -cycloheptyl, and -cyclooctyl.
[0383] "--(C.sub.8-C.sub.14)bicycloalkyl" means a bi-cyclic
hydrocarbon ring system having from 8 to 14 carbon atoms and at
least one saturated cyclic alkyl ring. Representative
--(C.sub.8-C.sub.14)bicycloalkyls include -indanyl,
-1,2,3,4-tetrahydronaphthyl, -5,6,7,8-tetrahydronaphthyl,
-perhydronaphthyl and the like.
[0384] "--(C.sub.8-C.sub.14)tricycloalkyl" means a tri-cyclic
hydrocarbon ring system having from 8 to 14 carbon atoms and at
least one saturated cyclic alkyl ring. Representative
--(C.sub.8-C.sub.14)tricycloalkyls include -pyrenyl,
-1,2,3,4-tetrahydroanthracenyl, -perhydroanthracenyl-aceanthreneyl,
-1,2,3,4-tetrahydropenanthrenyl, -5,6,7,8-tetrahydrophenanthrenyl,
-perhydrophenanthrenyl and the like.
[0385] "--(C.sub.5-C.sub.10)cycloalkenyl" means a cyclic
non-aromatic hydrocarbon having at least one carbon-carbon double
bond in the cyclic system and from 5 to 10 carbon atoms.
Representative (C.sub.5-C.sub.10)cycloalkenyls include
-cyclopentenyl, -cyclopentadienyl, -cyclohexenyl, -cyclohexadienyl,
-cycloheptenyl, -cycloheptadienyl, -cycloheptatrienyl,
-cyclooctenyl, -cyclooctadienyl, -cyclooctatrienyl,
-cyclooctatetraenyl, -cyclononenyl, -cyclononadienyl,
-cyclodecenyl, -cyclodecadienyl and the like.
[0386] "--(C.sub.5-C.sub.8)cycloalkenyl" means a cyclic
non-aromatic hydrocarbon having at least one carbon-carbon double
bond in the cyclic system and from 5 to 8 carbon atoms.
Representative (C.sub.5-C.sub.8)cycloalkenyls include
-cyclopentenyl, -cyclopentadienyl, -cyclohexenyl, -cyclohexadienyl,
-cycloheptenyl, -cycloheptadienyl, -cycloheptatrienyl,
-cyclooctenyl, -cyclooctadienyl, -cyclooctatrienyl,
-cyclooctatetraenyl and the like.
[0387] "--(C.sub.8-C.sub.14)bicycloalkenyl" means a bi-cyclic
hydrocarbon ring system having at least one carbon-carbon double
bond in each ring and from 8 to 14 carbon atoms. Representative
--(C.sub.8-C.sub.14)bicycloalkenyls include -indenyl, -pentalenyl,
-naphthalenyl, -azulenyl, -heptalenyl,
-1,2,7,8-tetrahydronaphthalenyl and the like.
[0388] "--(C.sub.8-C.sub.14)tricycloalkenyl" means a tri-cyclic
hydrocarbon ring system having at least one carbon-carbon double
bond in each ring and from 8 to 14 carbon atoms. Representative
--(C.sub.8-C.sub.14)tricycloalkenyls include -anthracenyl,
-phenanthrenyl, -phenalenyl, -acenaphthalenyl, as-indacenyl,
s-indacenyl and the like.
[0389] "--(3- to 7-membered)heterocycle" or "-(3- to
7-membered)heterocyclo" means a 3- to 7-membered monocyclic
heterocyclic ring which is either saturated, unsaturated
non-aromatic, or aromatic. A 3- or a 4-membered heterocycle can
contain up to 3 heteroatoms, a 5-membered heterocycle can contain
up to 4 heteroatoms, a 6-membered heterocycle can contain up to 6
heteroatoms, and a 7-membered heterocycle can contain up to 7
heteroatoms. Each heteroatom is independently selected from
nitrogen, which can be quaternized; oxygen; and sulfur, including
sulfoxide and sulfone. The -(3- to 7-membered)heterocycle can be
attached via a nitrogen or carbon atom. Representative (3- to
7-membered)heterocycles include pyridyl, furyl, thiophenyl,
pyrrolyl, oxazolyl, imidazolyl, thiazolyl, thiadiazolyl,
isoxazolyl, pyrazolyl, isothiazolyl, pyridazinyl, pyrimidinyl,
triazinyl, morpholinyl, pyrrolidinonyl, pyrrolidinyl, piperidinyl,
piperazinyl, hydantoinyl, valerolactamyl, oxiranyl, oxetanyl,
tetrahydrofuranyl, tetrahydropyranyl, tetrahydropyrindinyl,
tetrahydropyrimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl
and the like.
[0390] "-(3- to 5-membered)heterocycle" or "-(3- to
5-membered)heterocyclo" means a 3- to 5-membered monocyclic
heterocyclic ring which is either saturated, unsaturated
non-aromatic, or aromatic. A 3- or a 4-membered heterocycle can
contain up to 3 heteroatoms, and a 5-membered heterocycle can
contain up to 4 heteroatoms. Each heteroatom is independently
selected from nitrogen, which can be quaternized; oxygen; and
sulfur, including sulfoxide and sulfone. The -(3- to
5-membered)heterocycle can be attached via a nitrogen or carbon
atom. Representative -(3- to 5-membered)heterocycles include furyl,
thiophenyl, pyrrolyl, oxazolyl, imidazolyl, thiazolyl, isoxazolyl,
pyrazolyl, isothiazolyl, triazinyl, pyrrolidinonyl, pyrrolidinyl,
hydantoinyl, oxiranyl, oxetanyl, tetrahydrofuranyl,
tetrahydrothiophenyl and the like.
[0391] "-(7- to 10-membered)bicycloheterocycle" or "-(7- to
10-membered)bicycloheterocyclo" means a 7- to 10-membered bicyclic,
heterocyclic ring which is either saturated, unsaturated
non-aromatic, or aromatic. A -(7- to 10-membered)bicycloheterocycle
contains from 1 to 4 heteroatoms independently selected from
nitrogen, which can be quaternized; oxygen; and sulfur, including
sulfoxide and sulfone. The -(7- to 10-membered)bicycloheterocycle
can be attached via a nitrogen or carbon atom. Representative -(7-
to 10-membered)bicycloheterocycles include -quinolinyl,
-isoquinolinyl, -chromonyl, -coumarinyl, -indolyl, -indolizinyl,
-benzo[b]furanyl, -benzo[b]thiophenyl, -indazolyl, -purinyl,
-4H-quinolizinyl, -isoquinolyl, -quinolyl, -phthalazinyl,
-naphthyridinyl, -carbazolyl, -.beta.-carbolinyl and the like.
[0392] "--(C.sub.14)aryl" means a 14-membered aromatic carbocyclic
moiety such as -anthryl or -phenanthryl.
[0393] "-(5- to 10-membered)heteroaryl" means an aromatic
heterocycle ring of 5 to 10 members, including both mono- and
bicyclic ring systems, where at least one carbon atom of one or
both of the rings is replaced with a heteroatom independently
selected from nitrogen, oxygen, and sulfur. In one embodiment, one
of the -(5- to 10-membered)heteroaryl's rings contain at least one
carbon atom. In another embodiment, both of the -(5- to
10-membered)heteroaryl's rings contain at least one carbon atom.
Representative -(5- to 10-membered)heteroaryls include pyridyl,
furyl, benzofuranyl, thiophenyl, benzothiophenyl, quinolinyl,
pyrrolyl, indolyl, oxazolyl, benzoxazolyl, imidazolyl,
benzimidazolyl, thiazolyl, benzothiazolyl, isoxazolyl, pyrazolyl,
isothiazolyl, pyridazinyl, pyrimidyl, pyrimidinyl, thiadiazolyl,
triazinyl, cinnolinyl, phthalazinyl, and quinazolinyl.
[0394] "--CH.sub.2(halo)" means a methyl group where one of the
hydrogens of the methyl group has been replaced with a halogen.
Representative --CH.sub.2(halo) groups include --CH.sub.2F,
--CH.sub.2Cl, --CH.sub.2Br, and --CH.sub.2I.
[0395] "--CH(halo).sub.2" means a methyl group where two of the
hydrogens of the methyl group have been replaced with a halogen.
Representative --CH(halo).sub.2 groups include --CHF.sub.2,
--CHCl.sub.2, --CHBr.sub.2, --CHBrCl, --CHClI, and --CHI.sub.2.
[0396] "--C(halo).sub.3" means a methyl group where each of the
hydrogens of the methyl group has been replaced with a halogen.
Representative --C(halo).sub.3 groups include --CF.sub.3,
--CCl.sub.3, --CBr.sub.3, and --CI.sub.3.
[0397] "-Halogen" or "-halo" means --F, --Cl, --Br, or --I.
[0398] The phrase "pyridyl group" means
##STR00094##
where R.sub.1, R.sub.2, and n are defined above for the Pyridylene
Compounds of formula (I) and (II).
[0399] The phrase "pyrazinyl group" means,
##STR00095##
where R.sub.1, R.sub.2, and p are defined above for the Pyridylene
Compounds of formula (I) and (II).
[0400] The phrase "pyrimidinyl group" means
##STR00096##
where R.sub.1, R.sub.2, and p are defined above for the Pyridylene
Compounds of formula (I) and (II).
[0401] The phrase "pyridazinyl group" means
##STR00097##
where R.sub.1, R.sub.2, and p are defined above for the Pyridylene
Compounds of formula (I) and (II).
[0402] The phrase "thiadiazolyl group" means
##STR00098##
where R.sub.1 is defined above for the Pyridylene Compounds of
formula (I) and (II).
[0403] The phrase "benzoimidiazolyl group" means
##STR00099##
where R.sub.8 and s are defined above for the Pyridylene Compounds
of formula (I) and (II).
[0404] The phrase "benzothiazolyl group" means
##STR00100##
where R.sub.8 and s are defined above for the Pyridylene Compounds
of formula (I) and (II).
[0405] The phrase "benzooxazolyl group" means
##STR00101##
where R.sub.8 and s are defined above for the Pyridylene Compounds
of formula (I) and (II).
[0406] The phrase "pyridylene ring" in connection with the
Pyridylene Compounds of formula (I) means
##STR00102##
where R.sub.3 and m are defined above for the Pyridylene Compounds
of formula (I) and (II) and the numbers designate the position of
each atom of the pyridylene ring of formula (I).
[0407] The phrase "pyridylene ring" in connection with the
Pyridylene Compounds of formula (II) means
##STR00103##
where R.sub.3 and m are defined above for the Pyridylene Compounds
of formula (I) and (II) and the numbers designate the position of
each atom of the pyridylene ring of formula (II).
[0408] The term "animal" includes, but is not limited to, a cow,
monkey, baboon, chimpanzee, horse, sheep, pig, chicken, turkey,
quail, cat, dog, mouse, rat, rabbit, guinea pig, and human.
[0409] The phrase "pharmaceutically acceptable salt," as used
herein, is any pharmaceutically acceptable salt that can be
prepared from a Pyridylene Compound including a salt formed from an
acid and a basic functional group, such as a nitrogen group, of one
of the Pyridylene Compounds. Illustrative salts include, but are
not limited, to sulfate, citrate, acetate, oxalate, chloride,
bromide, iodide, nitrate, bisulfate, phosphate, acid phosphate,
isonicotinate, lactate, salicylate, acid citrate, tartrate, oleate,
tannate, pantothenate, bitartrate, ascorbate, succinate, maleate,
gentisinate, fumarate, gluconate, glucoronate, saccharate, formate,
benzoate, glutamate, methanesulfonate, ethanesulfonate,
benzenesulfonate, p-toluenesulfonate, and pamoate (i.e.,
1,1'-methylene-bis-(2-hydroxy-3-naphthoate)) salts. The term
"pharmaceutically acceptable salt" also includes a salt prepared
from a Pyridylene Compound having an acidic functional group, such
as a carboxylic acid functional group, and a pharmaceutically
acceptable inorganic or organic base. Suitable bases include, but
are not limited to, hydroxides of alkali metals such as sodium,
potassium, and lithium; hydroxides of alkaline earth metal such as
calcium and magnesium; hydroxides of other metals, such as aluminum
and zinc; ammonia and organic amines, such as unsubstituted or
hydroxy-substituted mono-, di-, or trialkylamines;
dicyclohexylamine; tributyl amine; pyridine; N-methyl,N-ethylamine;
diethylamine; triethylamine; mono-, bis-, or tris-(2-hydroxy-lower
alkyl amines), such as mono-, bis-, or tris-(2-hydroxyethyl)amine,
2-hydroxy-tert-butylamine, or tris-(hydroxymethyl)methylamine,
N,N-di-lower alkyl-N-(hydroxy lower alkyl)-amines, such as
N,N-dimethyl-N-(2-hydroxyethyl)amine, or tri-(2-hydroxyethyl)amine;
N-methyl-D-glucamine; and amino acids such as arginine, lysine and
the like.
[0410] The phrase "effective amount," when used in connection with
a Pyridylene Compound means an amount effective for: (a) treating
or preventing a Condition; or (b) inhibiting VR1, mGluR1, or mGluR5
function in a cell.
[0411] The phrase "effective amount," when used in connection with
the another therapeutic agent means an amount for providing the
therapeutic effect of the therapeutic agent.
[0412] When a first group is "substituted with one or more" second
groups, one or more hydrogen atoms of the first group is replaced
with a corresponding number of second groups. When the number of
second groups is two or greater, each second group can be the same
or different. In one embodiment, the number of second groups is one
or two.
[0413] In another embodiment, the number of second groups is
one.
[0414] The term "THF" means tetrahydrofuran.
[0415] The term "DMF" means dimethylformamide.
[0416] The term "HOBT" means 1-hydroxybenzotriazole hydrate.
[0417] The term "EDCI" means
1-ethyl-3-[3-(dimethylamino)propyl]carbodiimide.
[0418] The term "IBD" means inflammatory-bowel disease.
[0419] The term "IBS" means irritable-bowel syndrome.
[0420] The term "ALS" means amyotrophic lateral sclerosis.
[0421] The phrases "treatment of," "treating" and the like include
the amelioration or cessation of a Condition or a symptom
thereof.
[0422] In one embodiment, treating includes inhibiting, for
example, decreasing the overall frequency of episodes of a
Condition or a symptom thereof.
[0423] The phrases "prevention of," "preventing" and the like
include the avoidance of the onset of a Condition or a symptom
thereof.
4.5 Methods for Making the Pyridylene Compounds
[0424] The Pyridylene Compounds can be made using conventional
organic synthesis or by the following illustrative methods shown in
the schemes below.
4.5.1 Methods for Making the Pyridylene Compounds of Formula (I)
where X is O
[0425] The Pyridylene Compounds of formula (I) where X is O can be
obtained by the following illustrative method shown below in Scheme
1.
##STR00104## ##STR00105##
where Ar.sub.2, R.sub.1, R.sub.2, R.sub.3, m, n, and p are defined
above; Y is a halogen; and either Z.sub.1 is N and Z.sub.2 is CH or
Z.sub.1 is CH and Z.sub.2 is N.
[0426] To a solution of a halogenated benzoic acid 1 in DMF (0.33
M) is added about 1.1 equivalents of amine, Ar.sub.2--NH.sub.2, and
the resulting solution is allowed to stir for about min at a
temperature of about 25.degree. C. To the resulting solution is
then added about 0.5 equivalent of HOBT and about 1 equivalent of
EDCI and the resulting mixture is allowed to stir for about 2 h at
about 25.degree. C. The reaction mixture is then diluted with about
100 mL 2N aqueous sodium hydroxide and extracted with ethyl acetate
(3 extractions, about 100 mL/extraction). The ethyl acetate layers
are combined and the ethyl acetate is removed under reduced
pressure to provide a compound of formula 2. The compound of
formula 2 is dissolved in DMF (0.04M) and about 3 equivalents of
zinc bromide 3a-e and about 0.05 equivalents of Pd(PPh.sub.3).sub.4
are added to the suspension under a nitrogen atmosphere. The
resulting reaction mixture is allowed to stir for about 2 h at a
temperature of about 100.degree. C. The solvent is then removed
under reduced pressure to provide a Pyridylene Compound where X is
O. The Pyridylene Compound where X is O can be purified by means
known to those skilled in the art. Representative methods to purify
the Pyridylene Compound where X is O include, but are not limited
to column chromatography, preparative thin-layer chromatography,
preparative high pressure liquid chromatography (HPLC), and
recrystallization.
[0427] If the compound of formula 2 is substituted with a hydroxyl
or amino group, the hydroxyl or amino group is protected using a
suitable protecting group before being reacted with zinc bromide
3a-e. Similarly, if R.sub.2 is a hydroxyl or amino group, the
hydroxyl or amino group is protected before forming the zinc
bromide reagent. Suitable protecting groups for hydroxyl group
include, but are not limited to, methyl ether, methoxymethyl ether,
methoxythiomethyl ether, 2-methoxyethoxymethyl ether,
bis(2-chloroethoxy)ethyl ether, tetrahydropyranyl ether,
tetrahydrothiopyranyl ether, 4-methoxytetrahydropyranyl ether,
methoxytetrahydrothiopyranyl ether, tetrahydrofuranyl ether,
tetrahydrothiofuranyl ether, 1-ethoxyethyl ether,
1-methyl-1-methoxyethyl ether, 2-(phenylselenyl ether), tert-butyl
ether, allyl ether, benzyl ether, o-nitrobenzyl ether,
triphenylmethyl ether, o-napthyldiphenylmethyl ether,
p-methoxydiphenylmethyl ether, 9-(9-phenyl-10-oxo)anthryl ether
(tritylone), trimethylsilyl ether, iso-propyldimethylsilyl ether,
tert-butyldimethylsilyl ether, tert-butyldiphenylsilyl ether,
tribenzylsilyl ether, tri-iso-propylsilyl ether, formate ester,
acetate ester, trichloroacetate ester, phenoxyacetate ester,
iso-butyrate ester, pivaloate ester, adamantoate ester, benzoate
ester, 2,4,6-trimethyl (mesitoate) ester, methyl carbonate,
2,2,2-trichlorocarbonate, allyl carbonate, p-nitrophenyl carbonate,
benzyl carbonate, p-nitrobenzyl carbonate, S-benzylthiocarbonate,
N-phenylcarbamate, nitrate ester, and 2,4-dinitrophenylsulfenate
ester (See, e.g., T. W. Greene, Protective Groups in Organic
Synthesis, John Wiley-Interscience Publication, New York, (1981)).
Suitable protecting groups for an amino group include, but are not
limited to, 1,1-dimethyl-2,2,2-trichloroethyl carbamate,
1-methyl-1-(4-biphenylyl)ethyl carbamate, 2-trimethylsilylethyl
carbamate, 9-fluorenylmethyl carbamate, and tert-butyl carbamate
(T. W. Greene et al., Protective Groups in Organic Synthesis,
309-405 (2d ed. 1991)).
[0428] The halo acids 1 and the amines of formula Ar.sub.2NH.sub.2
are commercially available or can be prepared by methods known to
those skilled in the art. Compounds of formula 3a-e can be prepared
by methods known to those skilled in the art (See M. B. Smith and
J. March, March's Advanced Organic Chemistry: Reaction Mechanisms
and Structure, 805-807 (5.sup.th ed. 2001); H. Fillon et al., Tett.
Lett. 42:3843-46 (2001); M. Amadji et al., Tettrahedron 9:1657-60
(1998); and S. Billotte, Synlett. 379-380 (1998)).
4.5.2 Methods for Making the Pyridylene Compounds where X is S
[0429] The Pyridylene Compounds where X is S can be obtained by
reacting a Pyridylene Compound where X is O, prepared as described
above in section 4.5.1, with Lawesson's reagent at a temperature of
about 100.degree. C. (See, e.g., J. March, Advanced Organic
Chemistry, Reactions, Mechanisms, and Structure, 891-892 (4.sup.th
ed. 1992)).
4.6 Therapeutic Uses of the Pyridylene Compounds
[0430] In accordance with the invention, the Pyridylene Compounds
are administered to an animal in need of treatment or prevention of
a Condition.
[0431] In one embodiment, an effective amount of a Pyridylene
Compound can be used to treat or prevent any condition treatable or
preventable by inhibiting VR1. Examples of conditions that are
treatable or preventable by inhibiting VR1 include, but are not
limited to, pain, UI, an ulcer, IBD, and IBS.
[0432] In another embodiment, an effective amount of a Pyridylene
Compound can be used to treat or prevent any condition treatable or
preventable by inhibiting mGluR5. Examples of conditions that are
treatable or preventable by inhibiting mGluR5 include, but are not
limited to, pain, an addictive disorder, Parkinson's disease,
parkinsonism, anxiety, a pruritic condition, and psychosis.
[0433] In another embodiment, an effective amount of a Pyridylene
Compound can be used to treat or prevent any condition treatable or
preventable by inhibiting mGluR1. Examples of conditions that are
treatable or preventable by inhibiting mGluR1 include, but are not
limited to, pain, UI, an addictive disorder, Parkinson's disease,
parkinsonism, anxiety, epilepsy, stroke, a seizure, a pruritic
condition, psychosis, a cognitive disorder, a memory deficit,
restricted brain function, Huntington's chorea, ALS, dementia,
retinopathy, a muscle spasm, a migraine, vomiting, dyskinesia, and
depression.
[0434] The Pyridylene Compounds can be used to treat or prevent
acute or chronic pain. Examples of pain treatable or preventable
using the Pyridylene Compounds include, but are not limited to,
cancer pain, labor pain, myocardial infarction pain, pancreatic
pain, colic pain, post-operative pain, headache pain, muscle pain,
arthritic pain, and pain associated with a periodontal disease,
including gingivitis and periodontitis.
[0435] The Pyridylene Compounds can also be used for treating or
preventing pain associated with inflammation or with an
inflammatory disease in an animal. Such pain can arise where there
is an inflammation of the body tissue which can be a local
inflammatory response and/or a systemic inflammation. For example,
the Pyridylene Compounds can be used to treat or prevent pain
associated with inflammatory diseases including, but not limited
to: organ transplant rejection; reoxygenation injury resulting from
organ transplantation (see Grupp et al., J. Mol, Cell Cardiol.
31:297-303 (1999)) including, but not limited to, transplantation
of the heart, lung, liver, or kidney; chronic inflammatory diseases
of the joints, including arthritis, rheumatoid arthritis,
osteoarthritis and bone diseases associated with increased bone
resorption; inflammatory bowel diseases, such as ileitis,
ulcerative colitis, Barrett's syndrome, and Crohn's disease;
inflammatory lung diseases, such as asthma, adult respiratory
distress syndrome, and chronic obstructive airway disease;
inflammatory diseases of the eye, including corneal dystrophy,
trachoma, onchocerciasis, uveitis, sympathetic ophthalmitis and
endophthalmitis; chronic inflammatory disease of the gum, including
gingivitis and periodontitis; tuberculosis; leprosy; inflammatory
diseases of the kidney, including uremic complications,
glomerulonephritis and nephrosis; inflammatory disease of the skin,
including sclerodermatitis, psoriasis and eczema; inflammatory
diseases of the central nervous system, including chronic
demyelinating diseases of the nervous system, multiple sclerosis,
AIDS-related neurodegeneration and Alzheimer's disease, infectious
meningitis, encephalomyelitis, Parkinson's disease, Huntington's
disease, amyotrophic lateral sclerosis and viral or autoimmune
encephalitis; autoimmune diseases, including Type I and Type II
diabetes mellitus; diabetic complications, including, but not
limited to, diabetic cataract, glaucoma, retinopathy, nephropathy
(such as microaluminuria and progressive diabetic nephropathy),
polyneuropathy, mononeuropathies, autonomic neuropathy, gangrene of
the feet, atherosclerotic coronary arterial disease, peripheral
arterial disease, nonketotic hyperglycemic-hyperosmolar coma, foot
ulcers, joint problems, and a skin or mucous membrane complication
(such as an infection, a shin spot, a candidal infection or
necrobiosis lipoidica diabeticorum); immune-complex vasculitis, and
systemic lupus erythematosus (SLE); inflammatory disease of the
heart, such as cardiomyopathy, ischemic heart disease
hypercholesterolemia, and artherosclerosis; as well as various
other diseases that can have significant inflammatory components,
including preeclampsia, chronic liver failure, brain and spinal
cord trauma, and cancer. The Pyridylene Compounds can also be used
for treating or preventing pain associated with inflammatory
disease that can, for example, be a systemic inflammation of the
body, exemplified by gram-positive or gram negative shock,
hemorrhagic or anaphylactic shock, or shock induced by cancer
chemotherapy in response to pro-inflammatory cytokines, e.g., shock
associated with pro-inflammatory cytokines. Such shock can be
induced, e.g., by a chemotherapeutic agent that is administered as
a treatment for cancer.
[0436] The Pyridylene Compounds can be used to treat or prevent UI.
Examples of UI treatable or preventable using the Pyridylene
Compounds include, but are not limited to, urge incontinence,
stress incontinence, overflow incontinence, neurogenic
incontinence, and total incontinence.
[0437] The Pyridylene Compounds can be used to treat or prevent an
ulcer. Examples of ulcers treatable or preventable using the
Pyridylene Compounds include, but are not limited to, a duodenal
ulcer, a gastric ulcer, a marginal ulcer, an esophageal ulcer, and
a stress ulcer.
[0438] The Pyridylene Compounds can be used to treat or prevent
IBD, including Crohn's disease and ulcerative colitis.
[0439] The Pyridylene Compounds can be used to treat or prevent
IBS. Examples of IBS treatable or preventable using the Pyridylene
Compounds include, but are not limited to, spastic-colon-type IBS
and constipation-predominant IBS.
[0440] The Pyridylene Compounds can be used to treat or prevent an
addictive disorder, including but not limited to, an eating
disorder, an impulse-control disorder, an alcohol-related disorder,
a nicotine-related disorder, an amphetamine-related disorder, a
cannabis-related disorder, a cocaine-related disorder, an
hallucinogen-related disorder, an inhalant-related disorders, and
an opioid-related disorder, all of which are further sub-classified
as listed below.
[0441] Eating disorders include, but are not limited to, Bulimia
Nervosa, Nonpurging Type; Bulimia Nervosa, Purging Type; Anorexia;
and Eating Disorder not otherwise specified (NOS).
[0442] Impulse control disorders include, but are not limited to,
Intermittent Explosive Disorder, Kleptomania, Pyromania,
Pathological Gambling, Trichotillomania, and Impulse Control
Disorder not otherwise specified (NOS).
[0443] Alcohol-related disorders include, but are not limited to,
Alcohol-Induced Psychotic Disorder with delusions, Alcohol Abuse,
Alcohol Intoxication, Alcohol Withdrawal, Alcohol Intoxication
Delirium, Alcohol Withdrawal Delirium, Alcohol-Induced Persisting
Dementia, Alcohol-Induced Persisting Amnestic Disorder, Alcohol
Dependence, Alcohol-Induced Psychotic Disorder with hallucinations,
Alcohol-Induced Mood Disorder, Alcohol-Induced Anxiety Disorder,
Alcohol-Induced Sexual Dysfunction, Alcohol-Induced Sleep Disorder,
and Alcohol-Related Disorder not otherwise specified (NOS).
[0444] Nicotine-related disorders include, but are not limited to,
Nicotine Dependence, Nicotine Withdrawal, and Nicotine-Related
Disorder not otherwise specified (NOS).
[0445] Amphetamine-related disorders include, but are not limited
to, Amphetamine Dependence, Amphetamine Abuse, Amphetamine
Intoxication, Amphetamine Withdrawal, Amphetamine Intoxication
Delirium, Amphetamine-Induced Psychotic Disorder with delusions,
Amphetamine-Induced Psychotic Disorders with hallucinations,
Amphetamine-Induced Mood Disorder, Amphetamine-Induced Anxiety
Disorder, Amphetamine-Induced Sexual Dysfunction,
Amphetamine-Induced Sleep Disorder, and Amphetamine Related
Disorder not otherwise specified (NOS).
[0446] Cannabis-related disorders include, but are not limited to,
Cannabis Dependence, Cannabis Abuse, Cannabis Intoxication,
Cannabis Intoxication Delirium, Cannabis-Induced Psychotic Disorder
with delusions, Cannabis-Induced Psychotic Disorder with
hallucinations, Cannabis-Induced Anxiety Disorder, and Cannabis
Related Disorder not otherwise specified (NOS).
[0447] Cocaine-related disorders include, but are not limited to,
Cocaine Dependence, Cocaine Abuse, Cocaine Intoxication, Cocaine
Withdrawal, Cocaine Intoxication Delirium, Cocaine-Induced
Psychotic Disorder with delusions, Cocaine-Induced Psychotic
Disorders with hallucinations, Cocaine-Induced Mood Disorder,
Cocaine-Induced Anxiety Disorder, Cocaine-Induced Sexual
Dysfunction, Cocaine-Induced Sleep Disorder, and Cocaine Related
Disorder not otherwise specified (NOS).
[0448] Hallucinogen-related disorders include, but are not limited
to, Hallucinogen Dependence, Hallucinogen Abuse, Hallucinogen
Intoxication, Hallucinogen Withdrawal, Hallucinogen Intoxication
Delirium, Hallucinogen Persisting Perception Disorder (Flashbacks),
Hallucinogen-Induced Psychotic Disorder with delusions,
Hallucinogen-Induced Psychotic Disorders with hallucinations,
Hallucinogen-Induced Mood Disorder, Hallucinogen-Induced Anxiety
Disorder, Hallucinogen-Induced Sexual Dysfunction,
Hallucinogen-Induced Sleep Disorder, Hallucinogen Related Disorder
not otherwise specified (NOS).
[0449] Inhalant-related disorders include, but are not limited to,
Inhalant Dependence, Inhalant Abuse, Inhalant Intoxication,
Inhalant Intoxication Delirium, Inhalant-Induced Psychotic Disorder
with delusions, Inhalant-Induced Psychotic Disorder with
hallucinations, Inhalant-Induced Anxiety Disorder, and Inhalant
Related Disorder not otherwise specified (NOS).
[0450] Opioid-related disorders include, but are not limited to,
Opioid Dependence, Opioid Abuse, Opioid Withdrawal, Opioid
Intoxication, Opioid Intoxication Delirium, Opioid-Induced
Psychotic Disorder with delusions, Opioid-Induced Psychotic
Disorder with hallucinations, Opioid-Induced Anxiety Disorder, and
Opioid Related Disorder not otherwise specified (NOS).
[0451] The Pyridylene Compounds can be used to treat or prevent
Parkinson's disease and parkinsonism and the symptoms associated
with Parkinson's disease and parkinsonism, including but not
limited to, bradykinesia, muscular rigidity, resting tremor, and
impairment of postural balance.
[0452] The Pyridylene Compounds can be used to treat or prevent
generalized anxiety or severe anxiety and the symptoms associated
with anxiety, including but not limited to, restlessness; tension;
tachycardia; dyspnea; depression, including chronic "neurotic"
depression; panic disorder; agoraphobia and other specific phobias;
eating disorders; and personality disorders.
[0453] The Pyridylene Compounds can be used to treat or prevent
epilepsy, including but not limited to, partial epilepsy,
generalized epilepsy, and the symptoms associated with epilepsy,
including but not limited to, simple partial seizures, jacksonian
seizures, complex partial (psychomotor) seizures, convulsive
seizures (grand mal or tonic-clonic seizures), petit mal (absence)
seizures, and status epilepticus.
[0454] The Pyridylene Compounds can be used to treat or prevent
strokes, including but not limited to, ischemic strokes and
hemorrhagic strokes.
[0455] The Pyridylene Compounds can be used to treat or prevent a
seizure, including but not limited to, infantile spasms, febrile
seizures, and epileptic seizures.
[0456] The Pyridylene Compounds can be used to treat or prevent a
pruritic condition, including but not limited to, pruritus caused
by dry skin, scabies, dermatitis, herpetiformis, atopic dermatitis,
pruritus vulvae et ani, miliaria, insect bites, pediculosis,
contact dermatitis, drug reactions, urticaria, urticarial eruptions
of pregnancy, psoriasis, lichen planus, lichen simplex chronicus,
exfoliative dermatitis, folliculitis, bullous pemphigoid, or
fiberglass dermatitis.
[0457] The Pyridylene Compounds can be used to treat or prevent
psychosis, including but not limited to, schizophrenia, including
paranoid schizophrenia, hebephrenic or disorganized schizophrenia,
catatonic schizophrenia, undifferentiated schizophrenia, negative
or deficit subtype schizophrenia, and non-deficit schizophrenia; a
delusional disorder, including erotomanic subtype delusional
disorder, grandiose subtype delusional disorder, jealous subtype
delusional disorder, persecutory subtype delusional disorder, and
somatic subtype delusional disorder; and brief psychosis.
[0458] The Pyridylene Compounds can be used to treat or prevent a
cognitive disorder, including but not limited to, delirium and
dementia such as multi-infarct dementia, dementia pugilistica,
dementia caused by AIDS, and dementia caused by Alzheimer's
disease.
[0459] The Pyridylene Compounds can be used to treat or prevent a
memory deficiency, including but not limited to, dissociative
amnesia and dissociative fugue.
[0460] The Pyridylene Compounds can be used to treat or prevent
restricted brain function, including but not limited to, that
caused by surgery or an organ transplant, restricted blood supply
to the brain, a spinal cord injury, a head injury, hypoxia, cardiac
arrest, or hypoglycemia.
[0461] The Pyridylene Compounds can be used to treat or prevent
Huntington's chorea.
[0462] The Pyridylene Compounds can be used to treat or prevent
ALS.
[0463] The Pyridylene Compounds can be used to treat or prevent
retinopathy, including but not limited to, arteriosclerotic
retinopathy, diabetic arteriosclerotic retinopathy, hypertensive
retinopathy, non-proliferative retinopathy, and proliferative
retinopathy.
[0464] The Pyridylene Compounds can be used to treat or prevent a
muscle spasm.
[0465] The Pyridylene Compounds can be used to treat or prevent a
migraine including, but not limited to, migraine without aura
("common migraine"), migraine with aura ("classic migraine"),
migraine without headache, basilar migraine, familial hemiplegic
migraine, migrainous infarction, and migraine with prolonged
aura.
[0466] The Pyridylene Compounds can be used to treat or prevent
vomiting, including but not limited to, nausea vomiting, dry
vomiting (retching), and regurgitation.
[0467] The Pyridylene Compounds can be used to treat or prevent
dyskinesia, including but not limited to, tardive dyskinesia and
biliary dyskinesia.
[0468] The Pyridylene Compounds can be used to treat or prevent
depression, including but not limited to, major depression and
bipolar disorder.
[0469] Applicants believe that the Pyridylene Compounds are
antagonists for VR1.
[0470] The invention also relates to methods for inhibiting VR1
function in a cell, comprising contacting a cell capable of
expressing VR1 with an amount of a Pyridylene Compound effective to
inhibit VR1 function in a cell. This method can be used in vitro,
for example, as an assay to select cells that express VR1 and,
accordingly, are useful as part of an assay to select compounds
useful for treating or preventing pain, UI, an ulcer, IBD, or IBS.
The method is also useful for inhibiting VR1 function in a cell in
vivo, in an animal (e.g., a human), by contacting a cell of the
animal with an effective amount of a Pyridylene Compound. In one
embodiment, the method is useful for treating or preventing pain in
an animal in need thereof. In another embodiment, the method is
useful for treating or preventing UI in an animal in need thereof.
In another embodiment, the method is useful for treating or
preventing an ulcer in an animal in need thereof. In another
embodiment, the method is useful for treating or preventing IBD in
an animal in need thereof. In another embodiment, the method is
useful for treating or preventing IBS in an animal in need
thereof.
[0471] Examples of tissue comprising cells capable of expressing
VR1 include, but are not limited to, neuronal, brain, kidney,
urothelium, and bladder tissue. Methods for assaying cells that
express VR1 are known in the art.
[0472] Applicants believe that the Pyridylene Compounds are
antagonists for mGluR5.
[0473] The invention further relates to methods for inhibiting
mGluR5 function in a cell, comprising contacting a cell capable of
expressing mGluR5 with an amount of a Pyridylene Compound effective
to inhibit mGluR5 function in the cell. This method can be used in
vitro, for example, as an assay to select cells that express mGluR5
and, accordingly, are useful as part of an assay to select
compounds useful for treating or preventing pain, an addictive
disorder, Parkinson's disease, parkinsonism, anxiety, a pruritic
condition, or psychosis. The method is also useful for inhibiting
mGluR5 function in a cell in vivo, in an animal (e.g., a human), by
contacting a cell, in an animal, with an amount of a Pyridylene
Compound effective to inhibit mGluR5 function in the cell. In one
embodiment, the method is useful for treating or preventing pain in
an animal in need thereof. In another embodiment, the method is
useful for treating or preventing an addictive disorder in an
animal in need thereof. In another embodiment, the method is useful
for treating or preventing Parkinson's disease in an animal in need
thereof. In another embodiment, the method is useful for treating
or preventing parkinsonism in an animal in need thereof. In another
embodiment, the method is useful for treating or preventing anxiety
in an animal in need thereof. In another embodiment, the method is
useful for treating or preventing a pruritic condition in an animal
in need thereof. In another embodiment, the method is useful for
treating or preventing psychosis in an animal in need thereof.
[0474] Examples of cells capable of expressing mGluR5 are neuronal
and glial cells of the central nervous system, particularly the
brain, especially in the nucleus accumbens. Methods for assaying
cells that express mGluR5 are known in the art.
[0475] Applicants believe that the Pyridylene Compounds are
antagonists for mGluR1.
[0476] The invention also relates to methods for inhibiting mGluR1
function in a cell, comprising contacting a cell capable of
expressing mGluR1 with an amount of a Pyridylene Compound effective
to inhibit mGluR1 function in the cell. This method can be used in
vitro, for example, as an assay to select cells that express mGluR1
and, accordingly, are useful as part of an assay to select
compounds useful for treating or preventing pain, UI, an addictive
disorder, Parkinson's disease, parkinsonism, anxiety, epilepsy,
stroke, a seizure, a pruritic condition, psychosis, a cognitive
disorder, a memory deficit, restricted brain function, Huntington's
chorea, ALS, dementia, retinopathy, a muscle spasm, a migraine,
vomiting, dyskinesia, or depression. The method is also useful for
inhibiting mGluR1 function in a cell in vivo, in an animal (e.g., a
human), by contacting a cell in an animal with an effective amount
of a Pyridylene Compound. In one embodiment, the method is useful
for treating or preventing pain in an animal in need thereof. In
another embodiment, the method is useful for treating or preventing
UI in an animal in need thereof. In another embodiment, the method
is useful for treating or preventing an addictive disorder in an
animal in need thereof. In another embodiment, the method is useful
for treating or preventing Parkinson's disease in an animal in need
thereof. In another embodiment, the method is useful for treating
or preventing parkinsonism in an animal in need thereof. In another
embodiment, the method is useful for treating or preventing anxiety
in an animal in need thereof. In another embodiment, the method is
useful for treating or preventing epilepsy in an animal in need
thereof. In another embodiment, the method is useful for treating
or preventing stroke in an animal in need thereof. In another
embodiment, the method is useful for treating or preventing a
seizure in an animal in need thereof. In another embodiment, the
method is useful for treating or preventing a pruritic condition in
an animal in need thereof. In another embodiment, the method is
useful for treating or preventing psychosis in an animal in need
thereof. In another embodiment, the method is useful for treating
or preventing a cognitive disorder in an animal in need thereof. In
another embodiment, the method is useful for treating or preventing
a memory deficit in an animal in need thereof. In another
embodiment, the method is useful for treating or preventing
restricted brain function in an animal in need thereof. In another
embodiment, the method is useful for treating or preventing
Huntington's chorea in an animal in need thereof. In another
embodiment, the method is useful for treating or preventing ALS in
an animal in need thereof. In another embodiment, the method is
useful for treating or preventing dementia in an animal in need
thereof. In another embodiment, the method is useful for treating
or preventing retinopathy in an animal in need thereof. In another
embodiment, the method is useful for treating or preventing a
muscle spasm in an animal in need thereof. In another embodiment,
the method is useful for treating or preventing a migraine in an
animal in need thereof. In another embodiment, the method is useful
for treating or preventing vomiting in an animal in need thereof.
In another embodiment, the method is useful for treating or
preventing dyskinesia in an animal in need thereof. In another
embodiment, the method is useful for treating or preventing
depression in an animal in need thereof.
[0477] Examples of cells capable of expressing mGluR1 include, but
are not limited to, cerebellar Purkinje neuron cells, Purkinje cell
bodies (punctate), cells of spine(s) of the cerebellum; neurons and
neurophil cells of olfactory-bulb glomeruli; cells of the
superficial layer of the cerebral cortex; hippocampus cells;
thalamus cells; superior colliculus cells; and spinal trigeminal
nucleus cells. Methods for assaying cells that express mGluR1 are
known in the art.
4.7 Therapeutic/Prophylactic Administration and Compositions of the
Invention
[0478] Due to their activity, the Pyridylene Compounds are
advantageously useful in veterinary and human medicine. As
described above, the Pyridylene Compounds are useful for treating
or preventing a Condition in an animal in need thereof.
[0479] When administered to an animal, the Pyridylene Compounds are
administered as a component of a composition that comprises a
pharmaceutically acceptable carrier or excipient. The present
compositions, which comprise a Pyridylene Compound, can be
administered orally. The Pyridylene Compounds of the invention can
also be administered by any other convenient route, for example, by
infusion or bolus injection, by absorption through epithelial or
mucocutaneous linings (e.g., oral, rectal, and intestinal mucosa,
etc.) and can be administered together with another therapeutically
active agent. Administration can be systemic or local. Various
delivery systems are known, e.g., encapsulation in liposomes,
microparticles, microcapsules, capsules, etc., and can be used to
administer the Pyridylene Compound.
[0480] Methods of administration include, but are not limited to,
intradermal, intramuscular, intraperitoneal, intravenous,
subcutaneous, intranasal, epidural, oral, sublingual,
intracerebral, intravaginal, transdermal, rectal, by inhalation, or
topical, particularly to the ears, nose, eyes, or skin. The mode of
administration is left to the discretion of the practitioner. In
most instances, administration will result in the release of the
Pyridylene Compounds into the bloodstream.
[0481] In specific embodiments, it can be desirable to administer
the Pyridylene Compounds locally. This can be achieved, for
example, and not by way of limitation, by local infusion during
surgery, topical application, e.g., in conjunction with a wound
dressing after surgery, by injection, by means of a catheter, by
means of a suppository or enema, or by means of an implant, said
implant being of a porous, non-porous, or gelatinous material,
including membranes, such as sialastic membranes, or fibers.
[0482] In certain embodiments, it can be desirable to introduce the
Pyridylene Compounds into the central nervous system or
gastrointestinal tract by any suitable route, including
intraventricular, intrathecal, and epidural injection, and enema.
Intraventricular injection can be facilitated by an
intraventricular catheter, for example, attached to a reservoir,
such as an Ommaya reservoir.
[0483] Pulmonary administration can also be employed, e.g., by use
of an inhaler or nebulizer, and formulation with an aerosolizing
agent, or via perfusion in a fluorocarbon or synthetic pulmonary
surfactant. In certain embodiments, the Pyridylene Compounds can be
formulated as a suppository, with traditional binders and
excipients such as triglycerides.
[0484] In another embodiment, the Pyridylene Compounds can be
delivered in a vesicle, in particular a liposome (see Langer,
Science 249:1527-1533 (1990); and Treat et al., Liposomes in the
Therapy of Infectious Disease and Cancer 317-327 and 353-365
(1989)).
[0485] In yet another embodiment, the Pyridylene Compounds can be
delivered in a controlled-release system or sustained-release
system (see, e.g., Goodson, in Medical Applications of Controlled
Release, supra, vol. 2, pp. 115-138 (1984)). Other controlled- or
sustained-release systems discussed in the review by Langer,
Science 249:1527-1533 (1990) can be used. In one embodiment, a pump
can be used (Langer, Science 249:1527-1533 (1990); Sefton, CRC
Crit. Ref Biomed. Eng. 14:201 (1987); Buchwald et al., Surgery
88:507 (1980); and Saudek et al., N Engl. J. Med. 321:574 (1989)).
In another embodiment, polymeric materials can be used (see Medical
Applications of Controlled Release (Langer and Wise eds., 1974);
Controlled Drug Bioavailability, Drug Product Design and
Performance (Smolen and Ball eds., 1984); Ranger and Peppas, J.
Macromol. Sci. Rev. Macromol. Chem. 23:61 (1983); Levy et al.,
Science 228:190 (1985); During et al., Ann. Neurol. 25:351 (1989);
and Howard et al., J. Neurosurg. 71:105 (1989)). In yet another
embodiment, a controlled- or sustained-release system can be placed
in proximity of a target of the Pyridylene Compounds, e.g., the
spinal column, brain, or gastrointestinal tract, thus requiring
only a fraction of the systemic dose.
[0486] The present compositions can optionally comprise a suitable
amount of a pharmaceutically acceptable excipient so as to provide
the form for proper administration to the animal. Such a
pharmaceutical excipient can be a liquid, such as water or an oil,
including those of petroleum, animal, vegetable, or synthetic
origin, such as peanut oil, soybean oil, mineral oil, sesame oil
and the like. The pharmaceutical excipient can be saline, gum
acacia, gelatin, starch paste, talc, keratin, colloidal silica,
urea and the like. In addition, auxiliary, stabilizing, thickening,
lubricating, and coloring agents can be used. In one embodiment,
the pharmaceutically acceptable excipient is sterile when
administered to an animal. Water is a particularly useful excipient
when the Pyridylene Compound is administered intravenously. Saline
solutions and aqueous dextrose and glycerol solutions can also be
employed as liquid excipients, particularly for injectable
solutions. Suitable pharmaceutical excipients also include starch,
glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk,
silica gel, sodium stearate, glycerol monostearate, talc, sodium
chloride, dried skim milk, glycerol, propylene, glycol, water,
ethanol and the like. The present compositions, if desired, can
also contain minor amounts of wetting or emulsifying agents, or pH
buffering agents.
[0487] The present compositions can take the form of solutions,
suspensions, emulsions, tablets, pills, pellets, capsules, capsules
containing liquids, powders, sustained-release formulations,
suppositories, emulsions, aerosols, sprays, suspensions, or any
other form suitable for use. In one embodiment, the composition is
in the form of a capsule (see, e.g., U.S. Pat. No. 5,698,155).
Other examples of suitable pharmaceutical excipients are described
in Remington's Pharmaceutical Sciences 1447-1676 (Alfonso R.
Gennaro ed., 19th ed. 1995), incorporated herein by reference.
[0488] In one embodiment, the Pyridylene Compounds are formulated
in accordance with routine procedures as a composition adapted for
oral administration to human beings. Compositions for oral delivery
can be in the form of tablets, lozenges, aqueous or oily
suspensions, granules, powders, emulsions, capsules, syrups, or
elixirs, for example. Orally administered compositions can contain
one or more agents, for example, sweetening agents such as
fructose, aspartame or saccharin; flavoring agents such as
peppermint, oil of wintergreen, or cherry; coloring agents; and
preserving agents, to provide a pharmaceutically palatable
preparation. Moreover, where in tablet or pill form, the
compositions can be coated to delay disintegration and absorption
in the gastrointestinal tract thereby providing a sustained action
over an extended period of time. Selectively permeable membranes
surrounding an osmotically active driving compound are also
suitable for orally administered compositions. In these latter
platforms, fluid from the environment surrounding the capsule is
imbibed by the driving compound, which swells to displace the agent
or agent composition through an aperture. These delivery platforms
can provide an essentially zero order delivery profile as opposed
to the spiked profiles of immediate release formulations. A
time-delay material such as glycerol monostearate or glycerol
stearate can also be used. Oral compositions can include standard
excipients such as mannitol, lactose, starch, magnesium stearate,
sodium saccharin, cellulose, and magnesium carbonate. In one
embodiment, the excipients are of pharmaceutical grade.
[0489] In another embodiment, the Pyridylene Compounds can be
formulated for intravenous administration. Typically, compositions
for intravenous administration comprise sterile isotonic aqueous
buffer. Where necessary, the compositions can also include a
solubilizing agent. Compositions for intravenous administration can
optionally include a local anesthetic such as lidocaine to lessen
pain at the site of the injection. Generally, the ingredients are
supplied either separately or mixed together in unit dosage form,
for example, as a dry lyophilized powder or water free concentrate
in a hermetically sealed container such as an ampule or sachette
indicating the quantity of active agent. Where the Pyridylene
Compounds are to be administered by infusion, they can be
dispensed, for example, with an infusion bottle containing sterile
pharmaceutical grade water or saline. Where the Pyridylene
Compounds are administered by injection, an ampule of sterile water
for injection or saline can be provided so that the ingredients can
be mixed prior to administration.
[0490] The Pyridylene Compounds can be administered by
controlled-release or sustained-release means or by delivery
devices that are known to those in the art. Examples include, but
are not limited to, those described in U.S. Pat. Nos. 3,845,770;
3,916,899; 3,536,809; 3,598,123; 4,008,719; 5,674,533; 5,059,595;
5,591,767; 5,120,548; 5,073,543; 5,639,476; 5,354,556; and
5,733,566, each of which is incorporated herein by reference. Such
dosage forms can be used to provide controlled- or
sustained-release of one or more active ingredients using, for
example, hydropropylmethyl cellulose, other polymer matrices, gels,
permeable membranes, osmotic systems, multilayer coatings,
microparticles, liposomes, microspheres, or a combination thereof
to provide the desired release profile in varying proportions.
Suitable controlled- or sustained-release formulations known to
those in the art, including those described herein, can be readily
selected for use with the active ingredients of the invention. The
invention thus encompasses single unit dosage forms suitable for
oral administration such as, but not limited to, tablets, capsules,
gelcaps, and caplets that are adapted for controlled- or
sustained-release.
[0491] Controlled- or sustained-release pharmaceutical compositions
can have a common goal of improving drug therapy over that achieved
by their non-controlled or non-sustained-release counterparts. In
one embodiment, a controlled- or sustained-release composition
comprises a minimal amount of a Pyridylene Compound to treat or
prevent the Condition or a symptom thereof in a minimum amount of
time. Advantages of controlled- or sustained-release compositions
include extended activity of the drug, reduced dosage frequency,
and increased patient compliance. In addition, controlled- or
sustained-release compositions can favorably affect the time of
onset of action or other characteristics, such as blood levels of
the Pyridylene Compound, and can thus reduce the occurrence of
adverse side effects.
[0492] Controlled- or sustained-release compositions can initially
release an amount of a Pyridylene Compound that promptly produces
the desired therapeutic or prophylactic effect, and gradually and
continually release other amounts of the Pyridylene Compound to
maintain this level of therapeutic or prophylactic effect over an
extended period of time. To maintain a constant level of the
Pyridylene Compound in the body, the Pyridylene Compound can be
released from the dosage form at a rate that will replace the
amount of Pyridylene Compound being metabolized and excreted from
the body. Controlled- or sustained-release of an active ingredient
can be stimulated by various conditions, including but not limited
to, changes in pH, changes in temperature, concentration or
availability of enzymes, concentration or availability of water, or
other physiological conditions or compounds.
[0493] The amount of the Pryidylene Compound that is effective for
the treatment or prevention of a condition can be determined by
standard clinical techniques. In addition, in vitro or in vivo
assays can optionally be employed to help identify optimal dosage
ranges. The precise dose to be employed will also depend on the
route of administration, and the seriousness of the Condition and
can be decided according to the judgment of a practitioner and/or
each animal's circumstances. Suitable effective dosage amounts,
however, range from about 0.01 mg/kg of body weight to about 2500
mg/kg of body weight, although they are typically about 100 mg/kg
of body weight or less. In one embodiment, the effective dosage
amount ranges from about 0.01 mg/kg of body weight to about 100
mg/kg of body weight of a Pryidylene Compound, in another
embodiment, about 0.02 mg/kg of body weight to about 50 mg/kg of
body weight, and in another embodiment, about 0.025 mg/kg of body
weight to about 20 mg/kg of body weight. In one embodiment, an
effective dosage amount is administered about every 24 h until the
Condition is abated. In another embodiment, an effective dosage
amount is administered about every 12 h until the Condition is
abated. In another embodiment, an effective dosage amount is
administered about every 8 h until the Condition is abated. In
another embodiment, an effective dosage amount is administered
about every 6 h until the Condition is abated. In another
embodiment, an effective dosage amount is administered about every
4 h until the Condition is abated. The effective dosage amounts
described herein refer to total amounts administered; that is, if
more than one Pryidylene Compound is administered, the effective
dosage amounts correspond to the total amount administered.
[0494] Where a cell capable of expressing VR1, mGluR5, or mGluR1 is
contacted with a Pryidylene Compound in vitro, the amount effective
for inhibiting the VR1, mGluR5, or mGluR1 receptor function in a
cell will typically range from about 0.01 .mu.g/L to about 5 mg/L,
in one embodiment, from about 0.01 .mu.g/L to about 2.5 mg/L, in
another embodiment, from about 0.01 .mu.g/L to about 0.5 mg/L, and
in another embodiment, from about 0.01 .mu.g/L to about 0.25 mg/L
of a solution or suspension of a pharmaceutically acceptable
carrier or excipient. In one embodiment, the volume of solution or
suspension comprising the Pryidylene Compound is from about 0.01
.mu.L to about 1 mL. In another embodiment, the volume of solution
or suspension is about 200 .mu.L.
[0495] Where a cell capable of expressing VR1, mGluR5, or mGluR1 is
contacted with a Pryidylene Compound in vivo, the amount effective
for inhibiting the receptor function in a cell will typically range
from about 0.01 mg/kg of body weight to about 2500 mg/kg of body
weight, although it typically ranges from about 100 mg/kg of body
weight or less. In one embodiment, the effective dosage amount
ranges from about 0.01 mg/kg of body weight to about 100 mg/kg of
body weight of a Pryidylene Compound, in another embodiment, about
0.02 mg/kg of body weight to about 50 mg/kg of body weight, and in
another embodiment, about 0.025 mg/kg of body weight to about 20
mg/kg of body weight. In one embodiment, an effective dosage amount
is administered about every 24 h. In another embodiment, an
effective dosage amount is administered about every 12. In another
embodiment, an effective dosage amount is administered about every
8. In another embodiment, an effective dosage amount is
administered about every 6 h. In another embodiment, an effective
dosage amount is administered about every 4 h.
[0496] The Pyridylene Compounds can be assayed in vitro or in vivo
for the desired therapeutic or prophylactic activity prior to use
in humans. Animal model systems can be used to demonstrate safety
and efficacy.
[0497] The present methods for treating or preventing a Condition
in an animal in need thereof can further comprise administering to
the animal being administered a Pyridylene Compound another
therapeutic agent. In one embodiment, the other therapeutic agent
is administered in an effective amount.
[0498] The present methods for inhibiting VR1 function in a cell
capable of expressing VR1 can further comprise contacting the cell
with an effective amount of another therapeutic agent that may or
may not inhibit VR1.
[0499] The present methods for inhibiting mGluR5 function in a cell
capable of expressing mGluR5 can further comprise contacting the
cell with an effective amount of another therapeutic agent that may
or may not inhibit mGluR5.
[0500] The present methods for inhibiting mGluR1 function in a cell
capable of expressing mGluR1 can further comprise contacting the
cell with an effective amount of another therapeutic agent that may
or may not inhibit mGluR1.
[0501] Effective amounts of the other therapeutic agents are known
to those skilled in the art. However, it is well within the skilled
artisan's purview to determine the other therapeutic agent's
optimal effective-amount range. In one embodiment of the invention,
where another therapeutic agent is administered to an animal, the
minimal effective amount of the Pyridylene Compound is less than
its minimal effective amount would be where the other therapeutic
agent is not administered. In this embodiment, without being bound
by theory, it is believed that the Pyridylene Compounds and the
other therapeutic agent act synergistically to treat or prevent a
Condition.
[0502] The other therapeutic agent can be, but is not limited to,
an opioid agonist, a non-opioid analgesic, a non-steroidal
anti-inflammatory agent, an antimigraine agent, a Cox-II inhibitor,
an antiemetic, a .beta.-adrenergic blocker, an anticonvulsant, an
antidepressant, a Ca2+-channel blocker, an anticancer agent, an
agent for treating or preventing UI, an agent for treating or
preventing an ulcer, an agent for treating or preventing IBD, an
agent for treating or preventing IBS, an agent for treating
addictive disorder, an agent for treating Parkinson's disease and
parkinsonism, an agent for treating anxiety, an agent for treating
epilepsy, an agent for treating a stroke, an agent for treating a
seizure, an agent for treating a pruritic condition, an agent for
treating psychosis, an agent for treating Huntington's chorea, an
agent for treating ALS, an agent for treating a cognitive disorder,
an agent for treating a migraine, an agent for inhibiting vomiting,
an agent for treating dyskinesia, or an agent for treating
depression, and mixtures thereof.
[0503] Examples of useful opioid agonists include, but are not
limited to, alfentanil, allylprodine, alphaprodine, anileridine,
benzylmorphine, bezitramide, buprenorphine, butorphanol,
clonitazene, codeine, desomorphine, dextromoramide, dezocine,
diampromide, diamorphone, dihydrocodeine, dihydromorphine,
dimenoxadol, dimepheptanol, dimethylthiambutene, dioxaphetyl
butyrate, dipipanone, eptazocine, ethoheptazine,
ethylmethylthiambutene, ethylmorphine, etonitazene fentanyl,
heroin, hydrocodone, hydromorphone, hydroxypethidine, isomethadone,
ketobemidone, levorphanol, levophenacylmorphan, lofentanil,
meperidine, meptazinol, metazocine, methadone, metopon, morphine,
myrophine, nalbuphine, narceine, nicomorphine, norlevorphanol,
normethadone, nalorphine, normorphine, norpipanone, opium,
oxycodone, oxymorphone, papavereturn, pentazocine, phenadoxone,
phenomorphan, phenazocine, phenoperidine, piminodine, piritramide,
proheptazine, promedol, properidine, propiram, propoxyphene,
sufentanil, tilidine, tramadol, pharmaceutically acceptable salts
thereof, and mixtures thereof.
[0504] In certain embodiments, the opioid agonist is selected from
codeine, hydromorphone, hydrocodone, oxycodone, dihydrocodeine,
dihydromorphine, morphine, tramadol, oxymorphone, pharmaceutically
acceptable salts thereof, and mixtures thereof.
[0505] Examples of useful non-opioid analgesics include
non-steroidal anti-inflammatory agents, such as aspirin, ibuprofen,
diclofenac, naproxen, benoxaprofen, flurbiprofen, fenoprofen,
flubufen, ketoprofen, indoprofen, piroprofen, carprofen, oxaprozin,
pramoprofen, muroprofen, trioxaprofen, suprofen, aminoprofen,
tiaprofenic acid, fluprofen, bucloxic acid, indomethacin, sulindac,
tolmetin, zomepirac, tiopinac, zidometacin, acemetacin, fentiazac,
clidanac, oxpinac, mefenamic acid, meclofenamic acid, flufenamic
acid, niflumic acid, tolfenamic acid, diflurisal, flufenisal,
piroxicam, sudoxicam, isoxicam, and pharmaceutically acceptable
salts thereof, and mixtures thereof. Other suitable non-opioid
analgesics include the following, non-limiting, chemical classes of
analgesic, antipyretic, nonsteroidal anti-inflammatory drugs:
salicylic acid derivatives, including aspirin, sodium salicylate,
choline magnesium trisalicylate, salsalate, diflunisal,
salicylsalicylic acid, sulfasalazine, and olsalazin;
para-aminophenol derivatives including acetaminophen and
phenacetin; indole and indene acetic acids, including indomethacin,
sulindac, and etodolac; heteroaryl acetic acids, including
tolmetin, diclofenac, and ketorolac; anthranilic acids (fenamates),
including mefenamic acid and meclofenamic acid; enolic acids,
including oxicams (piroxicam, tenoxicam), and pyrazolidinediones
(phenylbutazone, oxyphenthartazone); and alkanones, including
nabumetone. For a more detailed description of the NSAIDs, see Paul
A. Insel, Analgesic-Antipyretic and Anti-inflammatory Agents and
Drugs Employed in the Treatment of Gout, in Goodman & Gilman's
The Pharmacological Basis of Therapeutics 617-57 (Perry B.
Molinhoff and Raymond W. Ruddon eds., 9.sup.th ed 1996); and Glen
R. Hanson, Analgesic, Antipyretic and Anti-Inflammatory Drugs in
Remington: The Science and Practice of Pharmacy Vol II 1196-1221
(A. R. Gennaro ed. 19.sup.th ed. 1995), which are hereby
incorporated by reference in their entireties.
[0506] Examples of useful Cox-II inhibitors and 5-lipoxygenase
inhibitors, as well as combinations thereof, are described in U.S.
Pat. No. 6,136,839, which is hereby incorporated by reference in
its entirety. Examples of useful Cox-II inhibitors include, but are
not limited to, rofecoxib and celecoxib.
[0507] Examples of useful antimigraine agents include, but are not
limited to, alpiropride, bromocriptine, dihydroergotamine,
dolasetron, ergocornine, ergocorninine, ergocryptine, ergonovine,
ergot, ergotamine, flumedroxone acetate, fonazine, ketanserin,
lisuride, lomerizine, methylergonovine, methysergide, metoprolol,
naratriptan, oxetorone, pizotyline, propranolol, risperidone,
rizatriptan, sumatriptan, timolol, trazodone, zolmitriptan, and
mixtures thereof.
[0508] The other therapeutic agent can also be an antiemetic agent.
Examples of useful antiemetic agents include, but are not limited
to, metoclopromide, domperidone, prochlorperazine, promethazine,
chlorpromazine, trimethobenzamide, odansteron, granisetron,
hydroxyzine, acetylleucine monoethanolamine, alizapride, azasetron,
benzquinamide, bietanautine, bromopride, buclizine, clebopride,
cyclizine, dimenhydrinate, diphenidol, dolasetron, meclizine,
methallatal, metopimazine, nabilone, oxyperndyl, pipamazine,
scopolamine, sulpiride, tetrahydrocannabinol, thiethylperazine,
thioproperazine, tropisetron, and mixtures thereof.
[0509] Examples of useful .beta.-adrenergic blockers include, but
are not limited to, acebutolol, alprenolol, amosulabol, arotinolol,
atenolol, befunolol, betaxolol, bevantolol, bisoprolol, bopindolol,
bucumolol, bufetolol, bufuralol, bunitrolol, bupranolol, butidrine
hydrochloride, butofilolol, carazolol, carteolol, carvedilol,
celiprolol, cetamolol, cloranolol, dilevalol, epanolol, esmolol,
indenolol, labetalol, levobunolol, mepindolol, metipranolol,
metoprolol, moprolol, nadolol, nadoxolol, nebivalol, nifenalol,
nipradilol, oxprenolol, penbutolol, pindolol, practolol,
pronethalol, propranolol, sotalol, sulfinalol, talinolol,
tertatolol, tilisolol, timolol, toliprolol, and xibenolol.
[0510] Examples of useful anticonvulsants include, but are not
limited to, acetylpheneturide, albutoin, aloxidone,
aminoglutethimide, 4-amino-3-hydroxybutyric acid, atrolactamide,
beclamide, buramate, calcium bromide, carbamazepine, cinromide,
clomethiazole, clonazepam, decimemide, diethadione, dimethadione,
doxenitroin, eterobarb, ethadione, ethosuximide, ethotoin,
felbamate, fluoresone, gabapentin, 5-hydroxytryptophan,
lamotrigine, magnesium bromide, magnesium sulfate, mephenyloin,
mephobarbital, metharbital, methetoin, methsuximide,
5-methyl-5-(3-phenanthryl)-hydantoin, 3-methyl-5-phenylhydantoin,
narcobarbital, nimetazepam, nitrazepam, oxcarbazepine,
paramethadione, phenacemide, phenetharbital, pheneturide,
phenobarbital, phensuximide, phenylmethylbarbituric acid,
phenyloin, phethenylate sodium, potassium bromide, pregabaline,
primidone, progabide, sodium bromide, solanum, strontium bromide,
suclofenide, sulthiame, tetrantoin, tiagabine, topiramate,
trimethadione, valproic acid, valpromide, vigabatrin, and
zonisamide.
[0511] Examples of useful antidepressants include, but are not
limited to, binedaline, caroxazone, citalopram, (S)-citalopram,
dimethazan, fencamine, indalpine, indeloxazine hydrocholoride,
nefopam, nomifensine, oxitriptan, oxypertine, paroxetine,
sertraline, thiazesim, trazodone, benmoxine, iproclozide,
iproniazid, isocarboxazid, nialamide, octamoxin, phenelzine,
cotinine, rolicyprine, rolipram, maprotiline, metralindole,
mianserin, mirtazepine, adinazolam, amitriptyline,
amitriptylinoxide, amoxapine, butriptyline, clomipramine,
demexiptiline, desipramine, dibenzepin, dimetacrine, dothiepin,
doxepin, fluacizine, imipramine, imipramine N-oxide, iprindole,
lofepramine, melitracen, metapramine, nortriptyline, noxiptilin,
opipramol, pizotyline, propizepine, protriptyline, quinupramine,
tianeptine, trimipramine, adrafinil, benactyzine, bupropion,
butacetin, dioxadrol, duloxetine, etoperidone, febarbamate,
femoxetine, fenpentadiol, fluoxetine, fluvoxamine, hematoporphyrin,
hypericin, levophacetoperane, medifoxamine, milnacipran, minaprine,
moclobemide, nefazodone, oxaflozane, piberaline, prolintane,
pyrisuccideanol, ritanserin, roxindole, rubidium chloride,
sulpiride, tandospirone, thozalinone, tofenacin, toloxatone,
tranylcypromine, L-tryptophan, venlafaxine, viloxazine, and
zimelidine.
[0512] Examples of useful Ca2+-channel blockers include, but are
not limited to, bepridil, clentiazem, diltiazem, fendiline,
gallopamil, mibefradil, prenylamine, semotiadil, terodiline,
verapamil, amlodipine, aranidipine, barnidipine, benidipine,
cilnidipine, efonidipine, elgodipine, felodipine, isradipine,
lacidipine, lercanidipine, manidipine, nicardipine, nifedipine,
nilvadipine, nimodipine, nisoldipine, nitrendipine, cinnarizine,
flunarizine, lidoflazine, lomerizine, bencyclane, etafenone,
fantofarone, and perhexyline.
[0513] Examples of useful anticancer agents include, but are not
limited to, acivicin, aclarubicin, acodazole hydrochloride,
acronine, adozelesin, aldesleukin, altretamine, ambomycin,
ametantrone acetate, aminoglutethimide, amsacrine, anastrozole,
anthramycin, asparaginase, asperlin, azacitidine, azetepa,
azotomycin, batimastat, benzodepa, bicalutamide, bisantrene
hydrochloride, bisnafide dimesylate, bizelesin, bleomycin sulfate,
brequinar sodium, bropirimine, busulfan, cactinomycin, calusterone,
caracemide, carbetimer, carboplatin, carmustine, carubicin
hydrochloride, carzelesin, cedefingol, chlorambucil, cirolemycin,
cisplatin, cladribine, crisnatol mesylate, cyclophosphamide,
cytarabine, dacarbazine, dactinomycin, daunorubicin hydrochloride,
decitabine, dexormaplatin, dezaguanine, dezaguanine mesylate,
diaziquone, docetaxel, doxorubicin, doxorubicin hydrochloride,
droloxifene, droloxifene citrate, dromostanolone propionate,
duazomycin, edatrexate, eflornithine hydrochloride, elsamitrucin,
enloplatin, enpromate, epipropidine, epirubicin hydrochloride,
erbulozole, esorubicin hydrochloride, estramustine, estramustine
phosphate sodium, etanidazole, etoposide, etoposide phosphate,
etoprine, fadrozole hydrochloride, fazarabine, fenretinide,
floxuridine, fludarabine phosphate, fluorouracil, fluorocitabine,
fosquidone, fostriecin sodium, gemcitabine, gemcitabine
hydrochloride, hydroxyurea, idarubicin hydrochloride, ifosfamide,
ilmofosine, interleukin II (including recombinant interleukin II or
rIL2), interferon alpha-2a, interferon alpha-2b, interferon
alpha-n1, interferon alpha-n3, interferon beta-I a, interferon
gamma-I b, iproplatin, irinotecan hydrochloride, lanreotide
acetate, letrozole, leuprolide acetate, liarozole hydrochloride,
lometrexol sodium, lomustine, losoxantrone hydrochloride,
masoprocol, maytansine, mechlorethamine hydrochloride, megestrol
acetate, melengestrol acetate, melphalan, menogaril,
mercaptopurine, methotrexate, methotrexate sodium, metoprine,
meturedepa, mitindomide, mitocarcin, mitocromin, mitogillin,
mitomalcin, mitomycin, mitosper, mitotane, mitoxantrone
hydrochloride, mycophenolic acid, nocodazole, nogalamycin,
ormaplatin, oxisuran, paclitaxel, pegaspargase, peliomycin,
pentamustine, peplomycin sulfate, perfosfamide, pipobroman,
piposulfan, piroxantrone hydrochloride, plicamycin, plomestane,
porfimer sodium, porfiromycin, prednimustine, procarbazine
hydrochloride, puromycin, puromycin hydrochloride, pyrazofurin,
riboprine, rogletimide, safingol, safingol hydrochloride,
semustine, simtrazene, sparfosate sodium, sparsomycin,
spirogermanium hydrochloride, spiromustine, spiroplatin,
streptonigrin, streptozotocin, sulofenur, talisomycin, tecogalan
sodium, tegafur, teloxantrone hydrochloride, temoporfin,
teniposide, teroxirone, testolactone, thiamiprine, thioguanine,
thiotepa, tiazofurin, tirapazamine, toremifene citrate, trestolone
acetate, triciribine phosphate, trimetrexate, trimetrexate
glucuronate, triptorelin, tubulozole hydrochloride, uracil mustard,
uredepa, vapreotide, verteporfin, vinblastine sulfate, vincristine
sulfate, vindesine, vindesine sulfate, vinepidine sulfate,
vinglycinate sulfate, vinleurosine sulfate, vinorelbine tartrate,
vinrosidine sulfate, vinzolidine sulfate, vorozole, zeniplatin,
zinostatin, zorubicin hydrochloride.
[0514] Examples of other anti-cancer drugs include, but are not
limited to, 20-epi-1,25 dihydroxyvitamin D3; 5-ethynyluracil;
abiraterone; aclarubicin; acylfulvene; adecypenol; adozelesin;
aldesleukin; ALL-TK antagonists; altretamine; ambamustine; amidox;
amifostine; aminolevulinic acid; amrubicin; amsacrine; anagrelide;
anastrozole; andrographolide; angiogenesis inhibitors; antagonist
D; antagonist G; antarelix; anti-dorsalizing morphogenetic
protein-1; antiandrogen, prostatic carcinoma; antiestrogen;
antineoplaston; antisense oligonucleotides; aphidicolin glycinate;
apoptosis gene modulators; apoptosis regulators; apurinic acid;
ara-CDP-DL-PTBA; arginine deaminase; asulacrine; atamestane;
atrimustine; axinastatin 1; axinastatin 2; axinastatin 3;
azasetron; azatoxin; azatyrosine; baccatin III derivatives;
balanol; batimastat; BCR/ABL antagonists; benzochlorins;
benzoylstaurosporine; beta lactam derivatives; beta-alethine;
betaclamycin B; betulinic acid; bFGF inhibitor; bicalutamide;
bisantrene; bisaziridinylspermine; bisnafide; bistratene A;
bizelesin; breflate; bropirimine; budotitane; buthionine
sulfoximine; calcipotriol; calphostin C; camptothecin derivatives;
canarypox IL-2; capecitabine; carboxamide-amino-triazole;
carboxyamidotriazole; CaRest M3; CARN 700; cartilage derived
inhibitor; carzelesin; casein kinase inhibitors (ICOS);
castanospermine; cecropin B; cetrorelix; chlorins;
chloroquinoxaline sulfonamide; cicaprost; cis-porphyrin;
cladribine; clomifene analogues; clotrimazole; collismycin A;
collismycin B; combretastatin A4; combretastatin analogue;
conagenin; crambescidin 816; crisnatol; cryptophycin 8;
cryptophycin A derivatives; curacin A; cyclopentanthraquinones;
cycloplatam; cypemycin; cytarabine ocfosfate; cytolytic factor;
cytostatin; dacliximab; decitabine; dehydrodidemnin B; deslorelin;
dexamethasone; dexifosfamide; dexrazoxane; dexverapamil;
diaziquone; didemnin B; didox; diethylnorspermine;
dihydro-5-azacytidine; 9-dihydrotaxol; dioxamycin; diphenyl
spiromustine; docetaxel; docosanol; dolasetron; doxifluridine;
droloxifene; dronabinol; duocarmycin SA; ebselen; ecomustine;
edelfosine; edrecolomab; eflornithine; elemene; emitefur;
epirubicin; epristeride; estramustine analogue; estrogen agonists;
estrogen antagonists; etanidazole; etoposide phosphate; exemestane;
fadrozole; fazarabine; fenretinide; filgrastim; finasteride;
flavopiridol; flezelastine; fluasterone; fludarabine;
fluorodaunorunicin hydrochloride; forfenimex; formestane;
fostriecin; fotemustine; gadolinium texaphyrin; gallium nitrate;
galocitabine; ganirelix; gelatinase inhibitors; gemcitabine;
glutathione inhibitors; hepsulfam; heregulin; hexamethylene
bisacetamide; hypericin; ibandronic acid; idarubicin; idoxifene;
idramantone; ilmofosine; ilomastat; imidazoacridones; imiquimod;
immunostimulant peptides; insulin-like growth factor-1 receptor
inhibitor; interferon agonists; interferons; interleukins;
iobenguane; iododoxorubicin; 4-ipomeanol; iroplact; irsogladine;
isobengazole; isohomohalicondrin B; itasetron; jasplakinolide;
kahalalide F; lamellarin-N triacetate; lanreotide; leinamycin;
lenograstim; lentinan sulfate; leptolstatin; letrozole; leukemia
inhibiting factor; leukocyte alpha interferon;
leuprolide+estrogen+progesterone; leuprorelin; levamisole;
liarozole; linear polyamine analogue; lipophilic disaccharide
peptide; lipophilic platinum compounds; lissoclinamide 7;
lobaplatin; lombricine; lometrexol; lonidamine; losoxantrone;
lovastatin; loxoribine; lurtotecan; lutetium texaphyrin;
lysofylline; lytic peptides; maitansine; mannostatin A; marimastat;
masoprocol; maspin; matrilysin inhibitors; matrix metalloproteinase
inhibitors; menogaril; merbarone; meterelin; methioninase;
metoclopramide; MIF inhibitor; mifepristone; miltefosine;
mirimostim; mismatched double stranded RNA; mitoguazone;
mitolactol; mitomycin analogues; mitonafide; mitotoxin fibroblast
growth factor-saporin; mitoxantrone; mofarotene; molgramostim;
monoclonal antibody, human chorionic gonadotrophin; monophosphoryl
lipid A+myobacterium cell wall sk; mopidamol; multiple drug
resistance gene inhibitor; multiple tumor suppressor 1-based
therapy; mustard anticancer agent; mycaperoxide B; mycobacterial
cell wall extract; myriaporone; N-acetyldinaline; N-substituted
benzamides; nafarelin; nagrestip; naloxone+pentazocine; napavin;
naphterpin; nartograstim; nedaplatin; nemorubicin; neridronic acid;
neutral endopeptidase; nilutamide; nisamycin; nitric oxide
modulators; nitroxide antioxidant; nitrullyn; O6-benzylguanine;
octreotide; okicenone; oligonucleotides; onapristone; odansteron;
oracin; oral cytokine inducer; ormaplatin; osaterone; oxaliplatin;
oxaunomycin; paclitaxel; paclitaxel analogues; paclitaxel
derivatives; palauamine; palmitoylrhizoxin; pamidronic acid;
panaxytriol; panomifene; parabactin; pazelliptine; pegaspargase;
peldesine; pentosan polysulfate sodium; pentostatin; pentrozole;
perflubron; perfosfamide; perillyl alcohol; phenazinomycin;
phenylacetate; phosphatase inhibitors; picibanil; pilocarpine
hydrochloride; pirarubicin; piritrexim; placetin A; placetin B;
plasminogen activator inhibitor; platinum complex; platinum
compounds; platinum-triamine complex; porfimer sodium;
porfiromycin; prednisone; propyl bis-acridone; prostaglandin J2;
proteasome inhibitors; protein A-based immune modulator; protein
kinase C inhibitor; protein kinase C inhibitors, microalgal;
protein tyrosine phosphatase inhibitors; purine nucleoside
phosphorylase inhibitors; purpurins; pyrazoloacridine;
pyridoxylated hemoglobin polyoxyethylene conjugate; raf
antagonists; raltitrexed; ramosetron; ras farnesyl protein
transferase inhibitors; ras inhibitors; ras-GAP inhibitor;
retelliptine demethylated; rhenium Re 186 etidronate; rhizoxin;
ribozymes; RII retinamide; rogletimide; rohitukine; romurtide;
roquinimex; rubiginone B1; ruboxyl; safingol; saintopin; SarCNU;
sarcophytol A; sargramostim; Sdi 1 mimetics; semustine; senescence
derived inhibitor 1; sense oligonucleotides; signal transduction
inhibitors; signal transduction modulators; single chain antigen
binding protein; sizofuran; sobuzoxane; sodium borocaptate; sodium
phenylacetate; solverol; somatomedin binding protein; sonermin;
sparfosic acid; spicamycin D; spiromustine; splenopentin;
spongistatin 1; squalamine; stem cell inhibitor; stem-cell division
inhibitors; stipiamide; stromelysin inhibitors; sulfinosine;
superactive vasoactive intestinal peptide antagonist; suradista;
suramin; swainsonine; synthetic glycosaminoglycans; tallimustine;
tamoxifen methiodide; tauromustine; tazarotene; tecogalan sodium;
tegafur; tellurapyrylium; telomerase inhibitors; temoporfin;
temozolomide; teniposide; tetrachlorodecaoxide; tetrazomine;
thaliblastine; thiocoraline; thrombopoietin; thrombopoietin
mimetic; thymalfasin; thymopoietin receptor agonist; thymotrinan;
thyroid stimulating hormone; tin ethyl etiopurpurin; tirapazamine;
titanocene bichloride; topsentin; toremifene; totipotent stem cell
factor; translation inhibitors; tretinoin; triacetyluridine;
triciribine; trimetrexate; triptorelin; tropisetron; turosteride;
tyrosine kinase inhibitors; tyrphostins; UBC inhibitors; ubenimex;
urogenital sinus-derived growth inhibitory factor; urokinase
receptor antagonists; vapreotide; variolin B; vector system,
erythrocyte gene therapy; velaresol; veramine; verdins;
verteporfin; vinorelbine; vinxaltine; vitaxin; vorozole;
zanoterone; zeniplatin; zilascorb; and zinostatin stimalamer.
[0515] Examples of useful therapeutic agents for treating or
preventing UI include, but are not limited to, propantheline,
imipramine, hyoscyamine, oxybutynin, and dicyclomine.
[0516] Examples of useful therapeutic agents for treating or
preventing an ulcer include, antacids such as aluminum hydroxide,
magnesium hydroxide, sodium bicarbonate, and calcium bicarbonate;
sucraflate; bismuth compounds such as bismuth subsalicylate and
bismuth subcitrate; H2 antagonists such as cimetidine, ranitidine,
famotidine, and nizatidine; H+, K+-ATPase inhibitors such as
omeprazole, iansoprazole, and lansoprazole; carbenoxolone;
misprostol; and antibiotics such as tetracycline, metronidazole,
timidazole, clarithromycin, and amoxicillin.
[0517] Examples of useful therapeutic agents for treating or
preventing IBD include, but are not limited to, anticholinergic
drugs; diphenoxylate; loperamide; deodorized opium tincture;
codeine; broad-spectrum antibiotics such as metronidazole;
sulfasalazine; olsalazine; mesalamine; prednisone; azathioprine;
mercaptopurine; and methotrexate.
[0518] Examples of useful therapeutic agents for treating or
preventing IBS include, but are not limited to, propantheline;
muscarine receptor antogonists such as pirenzapine, methoctramine,
ipratropium, tiotropium, scopolamine, methscopolamine, homatropine,
homatropine methylbromide, and methantheline; and antidiarrheal
drugs such as diphenoxylate and loperamide.
[0519] Examples of useful therapeutic agents for treating or
preventing an addictive disorder include, but are not limited to,
methadone, desipramine, amantadine, fluoxetine, buprenorphine, an
opiate agonist, 3-phenoxypyridine, levomethadyl acetate
hydrochloride, and serotonin antagonists.
[0520] Examples of useful therapeutic agents for treating or
preventing Parkinson's disease and parkinsonism include, but are
not limited to, carbidopa/levodopa, pergolide, bromocriptine,
ropinirole, pramipexole, entacapone, tolcapone, selegiline,
amantadine, and trihexyphenidyl hydrochloride.
[0521] Examples of useful therapeutic agents for treating or
preventing anxiety include, but are not limited to,
benzodiazepines, such as alprazolam, brotizolam, chlordiazepoxide,
clobazam, clonazepam, clorazepate, demoxepam, diazepam, estazolam,
flumazenil, flurazepam, halazepam, lorazepam, midazolam,
nitrazepam, nordazepam, oxazepam, prazepam, quazepam, temazepam,
and triazolam; non-benzodiazepine agents, such as buspirone,
gepirone, ipsapirone, tiospirone, zolpicone, zolpidem, and
zaleplon; tranquilizers, such as barbituates, e.g., amobarbital,
aprobarbital, butabarbital, butalbital, mephobarbital,
methohexital, pentobarbital, phenobarbital, secobarbital, and
thiopental; and propanediol carbamates, such as meprobamate and
tybamate.
[0522] Examples of useful therapeutic agents for treating or
preventing epilepsy include, but are not limited to, carbamazepine,
ethosuximide, gabapentin, lamotrigine, phenobarbital, phenyloin,
primidone, valproic acid, trimethadione, benzodiazepines,
.gamma.-vinyl GABA, acetazolamide, and felbamate.
[0523] Examples of useful therapeutic agents for treating or
preventing stroke include, but are not limited to, anticoagulants
such as heparin, agents that break up clots such as streptokinase
or tissue plasminogen activator, agents that reduce swelling such
as mannitol or corticosteroids, and acetylsalicylic acid.
[0524] Examples of useful therapeutic agents for treating or
preventing a seizure include, but are not limited to,
carbamazepine, ethosuximide, gabapentin, lamotrigine,
phenobarbital, phenyloin, primidone, valproic acid, trimethadione,
benzodiazepines, gabapentin, lamotrigine, .gamma.-vinyl GABA,
acetazolamide, and felbamate.
[0525] Examples of useful therapeutic agents for treating or
preventing a pruritic condition include, but are not limited to,
naltrexone; nalmefene; danazol; tricyclics such as amitriptyline,
imipramine, and doxepin; antidepressants such as those given below,
menthol; camphor; phenol; pramoxine; capsaicin; tar; steroids; and
antihistamines.
[0526] Examples of useful therapeutic agents for treating or
preventing psychosis include, but are not limited to,
phenothiazines such as chlorpromazine hydrochloride, mesoridazine
besylate, and thoridazine hydrochloride; thioxanthenes such as
chloroprothixene and thiothixene hydrochloride; clozapine;
risperidone; olanzapine; quetiapine; quetiapine fumarate;
haloperidol; haloperidol decanoate; loxapine succinate; molindone
hydrochloride; pimozide; and ziprasidone.
[0527] Examples of useful therapeutic agents for treating or
preventing Huntington's chorea include, but are not limited to,
haloperidol and pimozide.
[0528] Examples of useful therapeutic agents for treating or
preventing ALS include, but are not limited to, baclofen,
neurotrophic factors, riluzole, tizanidine, benzodiazepines such as
clonazepan and dantrolene.
[0529] Examples of useful therapeutic agents for treating or
preventing cognitive disorders include, but are not limited to,
agents for treating or preventing dementia such as tacrine;
donepezil; ibuprofen; antipsychotic drugs such as thioridazine and
haloperidol; and antidepressant drugs such as those given
below.
[0530] Examples of useful therapeutic agents for treating or
preventing a migraine include, but are not limited to, sumatriptan;
methysergide; ergotamine; caffeine; and beta-blockers such as
propranolol, verapamil, and divalproex.
[0531] Examples of useful therapeutic agents for treating,
inhibiting, or preventing vomiting include, but are not limited to,
5-HT3 receptor antagonists such as odansteron, dolasetron,
granisetron, and tropisetron; dopamine receptor antagonists such as
prochlorperazine, thiethylperazine, chlorpromazin, metoclopramide,
and domperidone; glucocorticoids such as dexamethasone; and
benzodiazepines such as lorazepam and alprazolam.
[0532] Examples of useful therapeutic agents for treating or
preventing dyskinesia include, but are not limited to, reserpine
and tetrabenazine.
[0533] Examples of useful therapeutic agents for treating or
preventing depression include, but are not limited to, tricyclic
antidepressants such as amitryptyline, amoxapine, bupropion,
clomipramine, desipramine, doxepin, imipramine, maprotiline,
nefazadone, nortriptyline, protriptyline, trazodone, trimipramine,
and venlafaxine; selective serotonin reuptake inhibitors such as
citalopram, (S)-citalopram, fluoxetine, fluvoxamine, paroxetine,
and setraline; monoamine oxidase inhibitors such as isocarboxazid,
pargyline, phenelzine, and tranylcypromine; and psychostimulants
such as dextroamphetamine and methylphenidate.
[0534] A Pyridylene Compound and the other therapeutic agent
combined can act additively or, in one embodiment, synergistically.
In one embodiment, a Pyridylene Compound is administered
concurrently with another therapeutic agent, for example, a
composition comprising an effective amount of a Pyridylene Compound
and an effective amount of another therapeutic agent can be
administered. Alternatively, a composition comprising an effective
amount of a Pyridylene Compound and a different composition
comprising an effective amount of another therapeutic agent can be
concurrently administered. In another embodiment, an effective
amount of a Pyridylene Compound is administered prior or subsequent
to administration of an effective amount of another therapeutic
agent. In this embodiment, the Pyridylene Compound is administered
while the other therapeutic agent exerts its therapeutic effect, or
the other therapeutic agent is administered while the Pyridylene
Compound exerts its therapeutic effect for treating or preventing a
Condition.
[0535] A composition of the invention is prepared by a method
comprising admixing a Pyridylene Compound or a pharmaceutically
acceptable salt and a pharmaceutically acceptable carrier or
excipient. Admixing can be accomplished using methods known for
admixing a compound (or salt) and a pharmaceutically acceptable
carrier or excipient. In one embodiment, the Pyridylene Compound is
present in the composition in an effective amount.
4.8 Kits
[0536] The invention encompasses kits that can simplify the
administration of a Pyridylene Compound to an animal.
[0537] A typical kit of the invention comprises a unit dosage form
of a Pyridylene
[0538] Compound. In one embodiment, the unit dosage form is a
container, which can be sterile, containing an effective amount of
a Pyridylene Compound and a pharmaceutically acceptable carrier or
excipient. The kit can further comprise a label or printed
instructions instructing the use of the Pyridylene Compound to
treat or prevent a Condition. The kit can also further comprise a
unit dosage form of another therapeutic agent, for example, a
second container containing an effective amount of the other
therapeutic agent and a pharmaceutically acceptable carrier or
excipient. In another embodiment, the kit comprises a container
containing an effective amount of a Pyridylene Compound, an
effective amount of another therapeutic agent and a
pharmaceutically acceptable carrier or excipient. Examples of other
therapeutic agents include, but are not limited to, those listed
above.
[0539] Kits of the invention can further comprise a device that is
useful for administering the unit dosage forms. Examples of such a
device include, but are not limited to, a syringe, a drip bag, a
patch, an inhaler, and an enema bag.
[0540] The following examples are set forth to assist in
understanding the invention and should not be construed as
specifically limiting the invention described and claimed herein.
Such variations of the invention, including the substitution of all
equivalents now known or later developed, which would be within the
purview of those skilled in the art, and changes in formulation or
changes in experimental design, are to be considered to fall within
the scope of the invention incorporated herein.
5. EXAMPLES
5.1 Example 1
Synthesis of Pyridylene Compound E35(a)
##STR00106##
[0542] To a solution of 5-bromopyridine-2-carbonitrile
(commercially available from Sigma-Aldrich, St. Louis, Mo.) in
ethanol (1.4 M) was added 3 equivalents of sodium hydroxide as a
1.5 M aqueous solution and the resulting solution was allowed to
reflux at a temperature of about 85.degree. C. until no further
evolution of ammonia gas was detected. The resulting solution was
then concentrated under reduced pressure to provide a residue. The
residue was dissolved in water, acidified with acetic acid, and
allowed to stir for about 16 h at a temperature of about 25.degree.
C. to provide a solid precipitate. The solid was collected by
vacuum filtration and washed with acetone to provide
5-bromopyridine-2-carboxylic acid (Compound B) as a solid.
5-bromopyridine-2-carboxylic acid (Compound B), 0.5 equivalents of
HOBT, and 1 equivalent of EDCI were dissolved in DMF and combined
with about 1.1 equivalents of 4-tert-butylaniline (Compound C;
commercially available from Sigma-Aldrich) dissolved in DMF (0.8 M)
and the resulting mixture was allowed to stir for about 2 h at
about 25.degree. C. The reaction mixture was then diluted with
about 80 mL of 2N aqueous sodium hydroxide and extracted with ethyl
acetate (3 extractions, 80 mL/extraction). The ethyl acetate layers
were combined and the ethyl acetate was removed under reduced
pressure to provide a solid. The resulting solid was suspended in
water and filtered using vacuum filtration to provide Compound D as
a solid. Compound D was dissolved in DMF (0.04M) and about 3
equivalents of the zinc bromide Compound F (commercially available
from Sigma-Aldrich) and about 0.05 equivalents of
Pd(PPh.sub.3).sub.4 (commercially available from Sigma-Aldrich)
were added to the solution under a nitrogen atmosphere, and the
resulting reaction mixture was allowed to stir for about 2 h at a
temperature of about 100.degree. C. The solvent was then removed
under reduced pressure to provide Pyridylene Compound E35(a).
Pyridylene Compound E35(a) was purified using preparative
thin-layer chromatography with a 1:1 ethyl acetate:hexane mobile
phase to provide purified Pyridylene Compound E35(a) as an
off-white solid (yield 47%).
[0543] The identity of Pyridylene Compound E35(a) was confirmed
using .sup.1H NMR.
[0544] Compound E35(a): .sup.1H NMR (CDCl.sub.3) .delta.: 10.000
(s, 1H), 8.807 (s, 1H), 8.596 (d, 1H), 8.389 (d, 1H), 8.094 (dd,
1H), 7.732 (d, 2H), 7.654 (d, 1H), 7.421 (d, 2H), 7.279 (m,
1H+CDCl.sub.3), 2.418 (s, 3H), 1.341 (s, 9H).
5.2 Example 2
Synthesis of Pyridylene Compound E35(b)
[0545] Pyridylene Compound E35(b) was made by a procedure analogous
to that used to make Pyridylene Compound E35(a) in Example 1 except
that 6-chloronicotinic acid (Compound G), shown below:
##STR00107##
was used in place of 5-bromopyridine-2-carboxylic acid (Compound
B). 6-Chloronicotinic acid (Compound G) was obtained by hydrolyzing
6-chloronicotinic acid ethyl ester (commercially available from
Sigma-Aldrich).
[0546] Pyridylene Compound E35(b) was obtained as a white solid
(yield 22%).
[0547] The identity of Pyridylene Compound E35(b) was confirmed
using .sup.1H NMR.
[0548] Compound E35(b): .sup.1H NMR (CDCl.sub.3) S: 9.167-9.128 (s,
1H), 8.588-8.546 (d, 1H), 8.322-8.277 (dd, 1H), 8.022-7.972 (d,
1H), 7.929-7.880 (s, 1H), 7.675-7.634 (d, 1H), 7.614-7.556 (d, 1H),
7.453-7.395 (d, 1H), 7.307-7.264 (m, 1H), 2.581-2.536 (s, 3H),
1.607-1.540 (s, 9H).
5.3 Example 3
Binding of Pyridylene Compounds to mGluR5
[0549] The following assay can be used to demonstrate that
Pyridylene Compounds bind to and modulate the activity of
mGluR5.
[0550] Cell Cultures: Primary glial cultures are prepared from
cortices of Sprague-Dawley 18 days old embryos. The cortices are
dissected and then dissociated by trituration. The resulting cell
homogenate is plated onto poly-D-lysine precoated T175 flasks
(BIOCOAT, commercially available from Becton Dickinson and Company
Inc. of Franklin Lakes, N.J.) in Dulbecco's Modified Eagle's Medium
("DMEM," pH 7.4), buffered with 25 mM HEPES, and supplemented with
15% fetal calf serum ("FCS," commercially available from Hyclone
Laboratories Inc. of Omaha, Nebr.), and incubated at 37.degree. C.
and 5% CO.sub.2. After 24 hours, FCS supplementation is reduced to
10%. On day six, oligodendrocytes and microglia are removed by
strongly tapping the sides of the flasks. One day following this
purification step, secondary astrocyte cultures are established by
subplating onto 96 poly-D-lysine precoated T175 flasks (BIOCOAT) at
a density of 65,000 cells/well in DMEM and 10% FCS. After 24 hours,
the astrocytes are washed with serum free medium and then cultured
in DMEM, without glutamate, supplemented with 0.5% FCS, 20 mM
HEPES, 10 ng/mL epidermal growth factor ("EGF"), 1 mM sodium
pyruvate, and 1.times. penicillin/streptomycin at pH 7.5 for 3 to 5
days at 37.degree. C. and 5% CO.sub.2. The procedure allows the
expression of the mGluR5 receptor by astrocytes, as demonstrated by
S. Miller et al., J. Neuroscience 15(9):6103-6109 (1995).
[0551] Assay Protocol: After 3-5 days incubation with EGF, the
astrocytes are washed with 127 mM NaCl, 5 mM KCl, 2 mM MgCl.sub.2,
700 mM NaH.sub.2PO.sub.4, 2 mM CaCl.sub.2, 5 mM NaHCO.sub.3, 8 mM
HEPES, 10 mM Glucose at pH 7.4 ("Assay Buffer") and loaded with the
dye Fluo-4 (commercially available from Molecular Probes Inc. of
Eugene, Oreg.) using 0.1 mL of Assay Buffer containing Fluo-4 (3 mM
final). After 90 minutes of dye loading, the cells are then washed
twice with 0.2 mL Assay Buffer and resuspended in 0.1 mL of Assay
Buffer. The plates containing the astrocytes are then transferred
to a Fluorometric Imaging Plate reader ("FLIPR," commercially
available from Molecular Devices Corporation of Sunnyvale, Calif.)
for the assessment of calcium mobilization flux in the presence of
glutamate and in the presence or absence of antagonist. After
monitoring fluorescence for 15 seconds to establish a baseline,
DMSO solutions containing various concentrations of a Pyridylene
Compound diluted in Assay Buffer (0.05 mL of 4.times. dilutions for
competition curves) are added to the cell plate and fluorescence is
monitored for 2 minutes. 0.05 mL of a 4.times. glutamate solution
(agonist) is then added to each well to provide a final glutamate
concentration in each well of 10 mM. Plate fluorescence is then
monitored for an additional 60 seconds after agonist addition. The
final DMSO concentration in the assay is 1.0%. In each experiment,
fluorescence is monitored as a function of time and the data
analyzed using Microsoft Excel and GraphPad Prism. Dose-response
curves are fit using a non-linear regression to determine the
IC.sub.50 value. In each experiment, each data point is determined
two times.
5.4 Example 4
In Vivo Assays for Prevention or Treatment of Pain
[0552] Test Animals: Each experiment uses rats weighing between
200-260 g at the start of the experiment. The rats are group-housed
and have free access to food and water at all times, except prior
to oral administration of a Pyridylene Compound when food is
removed for 16 hours before dosing. A control group acts as a
comparison to rats treated with a Pyridylene Compound. The control
group is administered the carrier for the Pyridylene Compound. The
volume of carrier administered to the control group is the same as
the volume of carrier and Pyridylene Compound administered to the
test group.
[0553] Acute Pain: To assess the actions of the Pyridylene
Compounds for the treatment or prevention of acute pain, the rat
tail flick test can be used. Rats are gently restrained by hand and
the tail exposed to a focused beam of radiant heat at a point 5 cm
from the tip using a tail flick unit (Model 7360, commercially
available from Ugo Basile of Italy). Tail flick latencies are
defined as the interval between the onset of the thermal stimulus
and the flick of the tail. Animals not responding within 20 seconds
are removed from the tail flick unit and assigned a withdrawal
latency of 20 seconds. Tail flick latencies are measured
immediately before (pre-treatment) and 1, 3, and 5 hours following
administration of a Pyridylene Compound. Data are expressed as tail
flick latency(s) and the percentage of the maximal possible effect
(% MPE), i.e., 20 seconds, is calculated as follows:
% M P E = [ ( post administration latency ) - ( pre -
administration latency ) ] ( 20 s pre - administration latency )
.times. 100 ##EQU00001##
[0554] The rat tail flick test is described in F. E. D'Amour et
al., "A Method for Determining Loss of Pain Sensation," J.
Pharmacol. Exp. Ther. 72:74-79 (1941).
[0555] Acute pain can also be assessed by measuring the animal's
response to noxious mechanical stimuli by determining the paw
withdrawal threshold ("PWT"), as described below.
[0556] Inflammatory Pain: To assess the actions of the Pyridylene
Compounds for the treatment or prevention of inflammatory pain, the
Freund's complete adjuvant ("FCA") model of inflammatory pain is
used. FCA-induced inflammation of the rat hind paw is associated
with the development of persistent inflammatory mechanical
hyperalgesia and provides reliable prediction of the
anti-hyperalgesic action of clinically useful analgesic drugs (L.
Bartho et al., "Involvement of Capsaicin-sensitive Neurones in
Hyperalgesia and Enhanced Opioid Antinociception in Inflammation,"
Naunyn-Schmiedeberg's Archives of Pharmacol. 342:666-670 (1990)).
The left hind paw of each animal is administered a 50 .mu.L
intraplantar injection of 50% FCA. 24 hour post injection, the
animal is assessed for response to noxious mechanical stimuli by
determining the PWT, as described below. Rats are then administered
a single injection of 1, 3, 10 or 30 mg/kg of either a Pyridylene
Compound; 30 mg/kg of a control selected from Celebrex,
indomethacin or naproxen; or carrier. Responses to noxious
mechanical stimuli are then determined 1, 3, 5 and 24 hours post
administration. Percentage reversal of hyperalgesia for each animal
is defined as:
% Reversal = [ ( post administration P W T ) - ( pre -
administration P W T ) ] [ ( baseline P W T ) - ( pre -
administration P W T ) ] .times. 100 ##EQU00002##
[0557] Neuropathic Pain: To assess the actions of the Pyridylene
Compounds for the treatment or prevention of neuropathic pain,
either the Seltzer model or the Chung model can be used.
[0558] In the Seltzer model, the partial sciatic nerve ligation
model of neuropathic pain is used to produce neuropathic
hyperalgesia in rats (Z. Seltzer et al., "A Novel Behavioral Model
of Neuropathic Pain Disorders Produced in Rats by Partial Sciatic
Nerve Injury," Pain 43:205-218 (1990)). Partial ligation of the
left sciatic nerve is performed under isoflurane/O.sub.2 inhalation
anaesthesia. Following induction of anesthesia, the left thigh of
the rat is shaved and the sciatic nerve exposed at high thigh level
through a small incision and is carefully cleared of surrounding
connective tissues at a site near the trocanther just distal to the
point at which the posterior biceps semitendinosus nerve branches
off of the common sciatic nerve. A 7-0 silk suture is inserted into
the nerve with a 3/8 curved, reversed-cutting mini-needle and
tightly ligated so that the dorsal 1/3 to 1/2 of the nerve
thickness is held within the ligature. The wound is closed with a
single muscle suture (4-0 nylon (Vicryl)) and vetbond tissue glue.
Following surgery, the wound area is dusted with antibiotic powder.
Sham-treated rats undergo an identical surgical procedure except
that the sciatic nerve is not manipulated. Following surgery,
animals are weighed and placed on a warm pad until they recover
from anesthesia. Animals are then returned to their home cages
until behavioral testing begins. The animal is assessed for
response to noxious mechanical stimuli by determining PWT, as
described below, prior to surgery (baseline), then immediately
prior to and 1, 3, and 5 hours after drug administration for rear
paw of the animal. Percentage reversal of neuropathic hyperalgesia
is defined as:
% Reversal = [ ( post administration P W T ) - ( pre -
administration P W T ) ] [ ( baseline P W T ) - ( pre -
administration P W T ) ] .times. 100 ##EQU00003##
In the Chung model, the spinal nerve ligation model of neuropathic
pain is used to produce mechanical hyperalgesia, thermal
hyperalgesia and tactile allodynia in rats. Surgery is performed
under isoflurane/O.sub.2 inhalation anaesthesia. Following
induction of anaesthesia, a 3 cm incision is made and the left
paraspinal muscles are separated from the spinous process at the
L.sub.4S.sub.2 levels. The L.sub.6 transverse process is carefully
removed with a pair of small rongeurs to identify visually the
L.sub.4-L.sub.6 spinal nerves. The left L.sub.5 (or L.sub.5 and
L.sub.6) spinal nerve(s) is isolated and tightly ligated with silk
thread. A complete hemostasis is confirmed and the wound is sutured
using non-absorbable sutures, such as nylon sutures or stainless
steel staples. Sham-treated rats undergo an identical surgical
procedure except that the spinal nerve(s) is not manipulated.
Following surgery animals are weighed, administered a subcutaneous
(s.c.) injection of saline or ringers lactate, the wound area is
dusted with antibiotic powder and they are kept on a warm pad until
they recover from the anesthesia. Animals are then returned to
their home cages until behavioral testing begins. The animals are
assessed for response to noxious mechanical stimuli by determining
PWT, as described below, prior to surgery (baseline), then
immediately prior to and 1, 3, and 5 hours after being administered
a Pyridylene Compound for the left rear paw of the animal. The
animal can also be assessed for response to noxious thermal stimuli
or for tactile allodynia, as described below. The Chung model for
neuropathic pain is described in S. H. Kim, "An Experimental Model
for Peripheral Neuropathy Produced by Segmental Spinal Nerve
Ligation in the Rat," Pain 50(3):355-363 (1992).
[0559] Response to Mechanical Stimuli as an Assessment of
Mechanical Hyperalgesia: The paw pressure assay can be used to
assess mechanical hyperalgesia. For this assay, hind paw withdrawal
thresholds (PWT) to a noxious mechanical stimulus are determined
using an analgesymeter (Model 7200, commercially available from Ugo
Basile of Italy) as described in C. Stein, "Unilateral Inflammation
of the Hindpaw in Rats as a Model of Prolonged Noxious Stimulation:
Alterations in Behavior and Nociceptive Thresholds," Pharmacol.
Biochem. and Behavior 31:451-455 (1988). The maximum weight that
can be applied to the hind paw is set at 250 g and the end point is
taken as complete withdrawal of the paw. PWT is determined once for
each rat at each time point and only the affected (ipsilateral) paw
is tested.
[0560] Response to Thermal Stimuli as an Assessment of Thermal
Hyperalgesia: The plantar test can be used to assess thermal
hyperalgesia. For this test, hind paw withdrawal latencies to a
noxious thermal stimulus are determined using a plantar test
apparatus (commercially available from Ugo Basile of Italy)
following the technique described by K. Hargreaves et al., "A New
and Sensitive Method for Measuring Thermal Nociception in Cutaneous
Hyperalgesia," Pain 32(1):77-88 (1988). The maximum exposure time
is set at 32 seconds to avoid tissue damage and any directed paw
withdrawal from the heat source is taken as the end point. Three
latencies are determined at each time point and averaged. Only the
affected (ipsilateral) paw is tested.
[0561] Assessment of Tactile Allodynia: To assess tactile
allodynia, rats are placed in clear, plexiglass compartments with a
wire mesh floor and allowed to habituate for a period of at least
15 minutes. After habituation, a series of von Frey monofilaments
are presented to the plantar surface of the left (operated) foot of
each rat. The series of von Frey monofilaments consists of six
monofilaments of increasing diameter, with the smallest diameter
fiber presented first. Five trials are conducted with each filament
with each trial separated by approximately 2 minutes. Each
presentation lasts for a period of 4-8 seconds or until a
nociceptive withdrawal behavior is observed. Flinching, paw
withdrawal or licking of the paw are considered nociceptive
behavioral responses.
5.5 Example 5
In Vivo Assays for Prevention or Treatment of Anxiety
[0562] The elevated plus maze test or the shock-probe burying test
can be used to assess the anxiolytic activity of Pyridylene
Compounds in rats or mice.
[0563] The Elevated Plus Maze Test: The elevated plus maze consists
of a platform with 4 arms, two open and two closed
(50.times.10.times.50 cm enclosed with an open roof). Rats (or
mice) are placed in the center of the platform, at the crossroad of
the 4 arms, facing one of the closed arms. Time spent in the open
arms vs the closed arms and number of open arm entries during the
testing period are recorded. This test is conducted prior to drug
administration and again after drug administration. Test results
are expressed as the mean time spent in open arms and the mean
number of entries into open arms. Known anxiolytic drugs increase
both the time spent in open arms and number of open arm entries.
The elevated plus maze test is described in D. Treit, "Animal
Models for the Study of Anti-anxiety Agents: A Review,"
Neuroscience & Biobehavioral Reviews 9(2):203-222 (1985).
[0564] The Shock-Probe Burying Test: For the shock-probe burying
test the testing apparatus consists of a plexiglass box measuring
40.times.30.times.40 cm, evenly covered with approximately 5 cm of
bedding material (odor absorbent kitty litter) with a small hole in
one end through which a shock probe (6.5 cm long and 0.5 cm in
diameter) is inserted. The plexiglass shock probe is helically
wrapped with two copper wires through which an electric current is
administered. The current is set at 2 mA. Rats are habituated to
the testing apparatus for 30 min on 4 consecutive days without the
shock probe in the box. On test day, rats are placed in one corner
of the test chamber following drug administration. The probe is not
electrified until the rat touches it with its snout or fore paws,
at which point the rat receives a brief 2 mA shock. The 15 min
testing period begins once the rat receives its first shock and the
probe remains electrified for the remainder of the testing period.
The shock elicits burying behavior by the rat. Following the first
shock, the duration of time the rat spends spraying bedding
material toward or over the probe with its snout or fore paws
(burying behavior) is measured as well as the number of
contact-induced shocks the rat receives from the probe. Known
anxiolytic drugs reduce the amount of burying behavior. In
addition, an index of the rat's reactivity to each shock is scored
on a 4 point scale. The total time spent immobile during the 15 min
testing period is used as an index of general activity. The
shock-probe burying test is described in D. Treit, 1985, supra.
5.6 Example 6
In Vivo Assays for Prevention or Treatment of an Addictive
Disorder
[0565] The conditioned place preference test or drug
self-administration test can be used to assess the ability of
Pyridylene Compounds to attenuate the rewarding properties of known
drugs of abuse.
[0566] The Conditioned Place Preference Test: The apparatus for the
conditioned place preference test consists of two large
compartments (45.times.45.times.30 cm) made of wood with a
plexiglass front wall. These two large compartments are distinctly
different. Doors at the back of each large compartment lead to a
smaller box (36.times.18.times.20 cm) made of wood, painted grey,
with a ceiling of wire mesh. The two large compartments differ in
terms of shading (white vs black), level of illumination (the
plexiglass door of the white compartment is covered with aluminum
foil except for a window of 7.times.7 cm), texture (the white
compartment has a 3 cm thick floor board (40.times.40 cm) with nine
equally spaced 5 cm diameter holes and the black has a wire mesh
floor), and olfactory cues (saline in the white compartment and 1
mL of 10% acetic acid in the black compartment). On habituation and
testing days, the doors to the small box remain open, giving the
rat free access to both large compartments.
[0567] The first session that a rat is placed in the apparatus is a
habituation session and entrances to the smaller grey compartment
remain open giving the rat free access to both large compartments.
During habituation, rats generally show no preference for either
compartment. Following habituation, rats are given 6 conditioning
sessions. Rats are divided into 4 groups: carrier
pre-treatment+carrier (control group), Pyridylene Compound
pre-treatment+carrier, carrier pre-treatment+morphine, Pyridylene
Compound pre-treatment+morphine. During each conditioning session
the rat is injected with one of the drug combinations and confined
to one compartment for 30 min. On the following day, the rat
receives a carrier+carrier treatment and is confined to the other
large compartment. Each rat receives three conditioning sessions
consisting of 3 drug combination-compartment and 3
carrier-compartment pairings. The order of injections and the
drug/compartment pairings are counterbalanced within groups. On the
test day, rats are injected prior to testing (30 min to 1 hour)
with either morphine or carrier and the rat is placed in the
apparatus, the doors to the grey compartment remain open and the
rat is allowed to explore the entire apparatus for 20 min. The time
spent in each compartment is recorded. Known drugs of abuse
increase the time spent in the drug-paired compartment during the
testing session. If the Pyridylene Compound blocks or reduces the
acquisition of morphine conditioned place preference (reward),
there will be no difference or less of a difference in time spent
in each side in rats pre-treated with a Pyridylene Compound and the
group will not be different from the group of rats that was given
carrier+carrier in both compartments. Data will be analyzed as time
spent in each compartment (drug combination-paired vs
carrier-paired). Generally, the experiment is repeated with a
minimum of 3 doses of a Pyridylene Compound.
[0568] The Drug Self-Administration Test: The apparatus for the
drug self-administration test is a standard commercially available
operant conditioning chamber. Before drug trials begin rats are
trained to press a lever for a food reward. After stable lever
pressing behavior is acquired, rats are tested for acquisition of
lever pressing for drug reward. Rats are implanted with chronically
indwelling jugular catheters for i.v. administration of compounds
and are allowed to recover for 7 days before training begins.
Experimental sessions are conducted daily for 5 days in 3 hour
sessions. Rats are trained to self-administer a known drug of
abuse, such as morphine. Rats are then presented with two levers,
an "active" lever and an "inactive" lever. Pressing of the active
lever results in drug infusion on a fixed ratio 1 (FR1) schedule
(i.e., one lever press gives an infusion) followed by a 20 second
time out period (signaled by illumination of a light above the
levers). Pressing of the inactive lever results in infusion of
excipient. Training continues until the total number of morphine
infusions stabilizes to within .+-.10% per session. Trained rats
are then used to evaluate the effect of Pyridylene Compounds
pre-treatment on drug self-administration. On test day, rats are
pre-treated with a Pyridylene Compound or excipient and then are
allowed to self-administer drug as usual. If the Pyridylene
Compound blocks or reduces the rewarding effects of morphine, rats
pre-treated with the Pyridylene Compound will show a lower rate of
responding compared to their previous rate of responding and
compared to excipient pre-treated rats. Data are analyzed as the
change in number of drug infusions per testing session (number of
infusions during test session-number of infusions during training
session).
5.7 Example 7
Functional Assay for Characterizing mGluR1 Antagonistic
Properties
[0569] Functional assays for the characterization of mGluR1
antagonistic properties are known in the art. For example, the
following procedure can be used.
[0570] A CHO-rat mGluR1 cell line is generated using cDNA encoding
rat mGluR1 receptor (M. Masu and S, Nakanishi, Nature 349: 760-765
(1991)). The cDNA encoding rat mGluR1 receptor can be obtained
from, e.g., Prof. S, Nakanishi (Kyoto, Japan).
[0571] 40,000 CHO-rat mGluR1 cells/well are plated into a Costar
3409, black, clear bottom, 96 well, tissue culture treated plate
(commercially available from Fisher Scientific of Chicago, Ill.)
and are incubated in Dulbecco's Modified Eagle's Medium (DMEM, pH
7.4) supplemented with glutamine, 10% FBS, 1% Pen/Strep, and 500
.mu.g/mL Geneticin for about 12 h. The CHO-rat mGluR1 cells are
then washed and treated with Optimem medium (commercially available
from Invitrogen, Carlsbad, Calif.) and incubated for a time period
ranging from 1 to 4 hours prior to loading the cells with the dye
Fluo-4. After incubation, the cell plates are washed with loading
buffer (127 mM NaCl, 5 mM KCl, 2 mM MgCl.sub.2, 700 .mu.M,
NaH.sub.2PO.sub.4, 2 mM CaCl.sub.2, 5 mMNaHCO.sub.3, 8 mM HEPES,
and 10 mM glucose, pH 7.4) and incubated with 3 .mu.M Fluo-4 in 0.1
mL loading buffer for 90 mM. The cells are then washed twice with
0.2 mL loading buffer, resuspended in 0.1 mL of loading buffer, and
transferred to a FLIPR for measurement of calcium mobilization flux
in the presence of glutamate and in the presence or absence of a
Pyridylene Compound.
[0572] To measure calcium mobilization flux, fluoresence is
monitored for about 15 s to establish a baseline and DMSO solutions
containing various concentrations of a Pyridylene Compound ranging
from about 50 .mu.M to about 0.8 nM diluted in loading buffer (0.05
mL of a 4.times. dilution) are added to the cell plate and
fluoresence is monitored for about 2 min. 0.05 mL of a 4.times.
Glutamate solution (agonist) is then added to each well to provide
a final glutamate concentration in each well of 10 .mu.M and
fluoresence is monitored for about 1 additional mM. The final DMSO
concentration in the assay is 1%. In each experiment fluoresence is
monitored as a function of time and the data is analyzed using a
non-linear regression to determine the IC.sub.50 value. In each
experiment each data point is determined twice.
5.8 Example 8
Binding of Pyridylene Compounds to VR1
[0573] Methods for assaying compounds capable of inhibiting VR1 are
known to those skilled in the art, for example, those methods
disclosed in U.S. Pat. No. 6,239,267 to Duckworth et al.; U.S. Pat.
No. 6,406,908 to McIntyre et al.; or U.S. Pat. No. 6,335,180 to
Julius et al.
Binding of Compound E35(a) to VR1: Assay Protocol
[0574] Human VR1 Cloning: Human spinal cord RNA (commercially
available from Clontech, Palo Alto, Calif.) was used. Reverse
transcription was conducted on 1.0 .mu.g total RNA using
Thermoscript Reverse Transcriptase (commercially available from
Invitrogen) and oligo dT primers as detailed in its product
description. Reverse transcription reactions were incubated at
55.degree. C. for 1 h, heat-inactivated at 85.degree. C. for 5 min,
and RNase H-treated at 37.degree. C. for 20 min.
[0575] Human VR1 cDNA sequence was obtained by comparison of the
human genomic sequence, prior to annotation, to the published rat
sequence. Intron sequences were removed and flanking exonic
sequences were joined to generate the hypothetical human cDNA.
Primers flanking the coding region of human VR1 were designed as
follows: forward primer, GAAGATCTTCGCTGGTTGCACACTGGGCCACA; and
reverse primer, GAAGATCTTCGGGGACAGTGACGGTTGGATGT.
[0576] PCR of VR1 was performed on one tenth of the Reverse
transcription reaction mixture using Expand Long Template
Polymerase and Expand Buffer 2 in a final volume of 50 .mu.L
according to the manufacturer's instructions (Roche Applied
Sciences, Indianapolis, Ind.). After denaturation at 94.degree. C.
for 2 min, PCR amplification was performed for 25 cycles at
94.degree. C. for 15 sec, 58.degree. C. for 30 sec, and 68.degree.
C. for 3 min followed by a final incubation at 72.degree. C. for 7
min to complete the amplification. A PCR product of .about.2.8 kb
was gel-isolated using a 1.0% agarose, Tris-Acetate gel containing
1.6 .mu.g/mL of crystal violet and purified with a S.N.A.P. UV-Free
Gel Purification Kit (commercially available from Invitrogen). The
VR1 PCR product was cloned into the pIND/V5-His-TOPO vector
(commercially available from Invitrogen) according to the
manufacturer's instructions. DNA preparations, restriction enzyme
digestions, and preliminary DNA sequencing were performed according
to standard protocols. Full-length sequencing confirmed the
identity of the human VR1.
[0577] Generation of Inducible Cell Lines: Unless noted otherwise,
cell culture reagents were purchased from Life Technologies of
Rockville, Md. HEK 293-EcR cells expressing the ecdysone receptor
(commercially available from Invitrogen) were cultured in Growth
Medium (Dulbecco's Modified Eagles Medium containing 10% fetal
bovine serum (commercially available from HYCLONE, Logan, Utah),
1.times. penicillin/streptomycin, 1.times. glutamine, 1 mM sodium
pyruvate and 400 .mu.g/mL Zeocin (commercially available from
Invitrogen)). The VR1-pIND constructs were transfected into the
HEK293-EcR cell line using Fugene transfection reagent
(commercially available from Roche Applied Sciences, Basel,
Switzerland). After 48 h, cells were transferred to Selection
Medium (Growth Medium containing 300 .mu.g/mL G418 (commercially
available from Invitrogen)). Approximately 3 weeks, later
individual Zeocin/G418 resistant colonies were isolated and
expanded. To identify functional clones, multiple colonies were
plated into 96-well plates and expression was induced for 48 h
using Selection Medium supplemented with 5 .mu.M ponasterone A
("PonA") (commercially available from Invitrogen). On the day of
assay, cells were loaded with Fluo-4 (a calcium-sensitive dye that
is commercially available from Molecular Probes) and CAP-mediated
calcium influx was measured using a FLIPR as described below.
Functional clones were re-assayed, expanded, and cryopreserved.
[0578] pH-Based Assay: Two days prior to performing this assay,
cells were seeded on poly-D-lysine-coated 96-well clear-bottom
black plates (commercially available from Becton-Dickinson) at
75,000 cells/well in growth media containing 5 .mu.M PonA to induce
expression. On the day of the assay, the plates were washed with
0.2 mL 1.times. Hank's Balanced Salt Solution (commercially
available from Life Technologies) containing 1.6 mM CaCl.sub.2 and
20 mM HEPES, pH 7.4 ("wash buffer"), and loaded using 0.1 mL of
wash buffer containing Fluo-4 (3 .mu.M final concentration,
commercially available from Molecular Probes). After 1 h, the cells
were washed twice with 0.2 mL wash buffer and resuspended in 0.05
mL 1.times. Hank's Balanced Salt Solution containing 3.5 mM
CaCl.sub.2 and 10 mM Citrate, pH 7.4 ("assay buffer"). Plates were
then transferred to a FLIPR for assay. Compound E35(a) was diluted
in assay buffer, and 50 mL of the resultant solution were added to
the cell plates and the solution monitored for two minutes. The
final concentration of Compound E35(a) ranged from about 50 .mu.M
to about 3 .mu.M. Agonist buffer (wash buffer titrated with 1N HCl
to provide a solution having a pH of 5.5 when mixed 1:1 with assay
buffer) (0.1 mL) was then added to each well, and the plates were
incubated for 1 additional minute. Data were collected over the
entire time course and analyzed using Excel and Graph Pad Prism.
Compound E35(a) when assayed according to this protocol had an
IC.sub.50 of 825.5.+-.247.8 nM (n=4).
[0579] Capsaicin-Based Assay: Two days prior to performing this
assay, cells were seeded in poly-D-lysine-coated 96-well
clear-bottom black plates (50,000 cells/well) in growth media
containing 5 .mu.M PonA to induce expression. On the day of the
assay, the plates were washed with 0.2 mL 1.times. Hank's Balanced
Salt Solution containing 1 mM CaCl.sub.2 and 20 mM HEPES, pH 7.4,
and cells were loaded using 0.1 mL of wash buffer containing Fluo-4
(3 .mu.M final). After one hour, the cells were washed twice with
0.2 mL of wash buffer and resuspended in 0.1 mL of wash buffer. The
plates were transferred to a FLIPR for assay. 50 .mu.L of Compound
E35(a) diluted with assay buffer were added to the cell plates and
incubated for 2 min. The final concentration of Compound E35(a)
ranged from about 50 .mu.M to about 3 .mu.M. Human VR1 was
activated by the addition of 50 .mu.L of capsaicin (400 nM), and
the plates were incubated for an additional 3 min. Data were
collected over the entire time course and analyzed using Excel and
GraphPad Prism. Compound E35(a) when assayed according to this
protocol had an IC.sub.50 of 65.5.+-.17.3 nM (n=3).
[0580] The results of the pH-based assay and the capsaicin-based
assay demonstrate that Compound E35(a), an illustrative Pyridylene
Compound, binds to and modulates the activity of human VR1 and
accordingly is useful for treating or preventing pain, UI, an
ulcer, IBD, or IBS in an animal.
[0581] The present invention is not to be limited in scope by the
specific embodiments disclosed in the examples which are intended
as illustrations of a few aspects of the invention and any
embodiments that are functionally equivalent are within the scope
of this invention. Indeed, various modifications of the invention
in addition to those shown and described herein will become
apparent to those skilled in the art and are intended to fall
within the scope of the appended claims.
[0582] A number of references have been cited, the entire
disclosures of which are incorporated herein by reference.
Sequence CWU 1
1
2132DNAArtificial SequenceHuman VR1 forward primer 1gaagatcttc
gctggttgca cactgggcca ca 32232DNAArtificial SequenceHuman VR1
reverse primer 2gaagatcttc ggggacagtg acggttggat gt 32
* * * * *