U.S. patent application number 12/674503 was filed with the patent office on 2011-11-17 for site-specific attachment of drugs or other agents to engineered antibodies with c-terminal extensions.
Invention is credited to David King, Jie Liu.
Application Number | 20110280891 12/674503 |
Document ID | / |
Family ID | 40378584 |
Filed Date | 2011-11-17 |
United States Patent
Application |
20110280891 |
Kind Code |
A1 |
Liu; Jie ; et al. |
November 17, 2011 |
SITE-SPECIFIC ATTACHMENT OF DRUGS OR OTHER AGENTS TO ENGINEERED
ANTIBODIES WITH C-TERMINAL EXTENSIONS
Abstract
The present invention provides antibodies (e.g., IgG antibodies)
having C-terminal cysteine-containing extensions that facilitate
antibody conjugation to a partner molecule (e.g. a drug, toxin,
marker molecule, protein, radioisotope, or other therapeutic
agent). Methods of making, screening and selecting the antibodies
of the invention are provided.
Inventors: |
Liu; Jie; (Palo Alto,
CA) ; King; David; (Solana Beach, CA) |
Family ID: |
40378584 |
Appl. No.: |
12/674503 |
Filed: |
August 19, 2008 |
PCT Filed: |
August 19, 2008 |
PCT NO: |
PCT/US08/73569 |
371 Date: |
August 4, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60957271 |
Aug 22, 2007 |
|
|
|
Current U.S.
Class: |
424/181.1 ;
530/387.3; 530/391.1; 530/391.9 |
Current CPC
Class: |
A61K 47/6803 20170801;
A61K 47/6889 20170801; C07K 16/3069 20130101; C07K 2317/21
20130101; A61K 47/6869 20170801; A61K 47/6805 20170801; A61K
47/6819 20170801; A61P 35/00 20180101; C07K 16/2875 20130101 |
Class at
Publication: |
424/181.1 ;
530/391.1; 530/391.9; 530/387.3 |
International
Class: |
A61K 39/395 20060101
A61K039/395; A61P 35/00 20060101 A61P035/00; C07K 16/00 20060101
C07K016/00 |
Claims
1. An antibody-partner molecule conjugate comprising a full-length
antibody conjugated to a partner molecule wherein the conjugation
occurs via a cysteine-containing extension at the C-terminus of a
heavy chain of the antibody.
2. The antibody-partner molecule conjugate of claim 1 wherein the
cysteine-containing extension is introduced by the addition of a
cysteine-containing extension to the heavy chain of the
antibody.
3. The antibody-partner molecule conjugate of claim 1 wherein the
C-terminal cysteine-containing extension is introduced by the
replacement of the original C-terminal amino acid residue of the
heavy chain of the antibody.
4. (canceled)
5. The antibody-partner molecule conjugate of claim 1, wherein the
partner molecule is a cytotoxic drug.
6. The antibody-partner molecule conjugate of claim 5, wherein the
drug is selected from the group consisting of an auristatin, a DNA
minor groove binding agent, a DNA minor groove alkylating agent, an
enediyne, a lexitropsin, a duocarmycin, a taxane, a puromycin, a
dolastatin, a maytansinoid, and a vinca alkaloid.
7-11. (canceled)
12. The antibody-partner molecule conjugate of claim 1, wherein the
C-terminal cysteine-containing extension has an amino acid sequence
selected from a CAA C-terminal extension, a CCAA (SEQ ID NO:9)
C-terminal extension, a AACAA (SEQ ID NO:7) C-terminal extension,
or a GGGGSCAA (SEQ ID NO:8) C-terminal extension of the
antibody.
13. The antibody-partner molecule conjugate of claim 1, further
comprising a cleavable linker.
14. (canceled)
15. The antibody-partner molecule conjugate of claim 13, wherein
the linker is a peptide linker cleavable by an intracellular
protease.
16-17. (canceled)
18. The antibody-partner molecule conjugate of claim 15, wherein
the dipeptide linker is a val-cit linker or a phe-lys linker.
19-21. (canceled)
22. An antibody-drug conjugate comprising: a full length antibody
that: (a) binds to PSMA, and (b) is conjugated to a cytotoxic agent
or an immunosuppressive agent, wherein the antibody-drug conjugate
exerts: (a) a cytotoxic or cytostatic effect on a PSMA-expressing
cancer cell line, or (b) a cytotoxic, cytostatic, or
immunosuppressive effect on a PSMA-expressing immune cell, wherein
the conjugation occurs at an introduced cysteine residue at or near
the C-terminus of a heavy chain of the antibody.
23. A method of making an antibody-partner molecular conjugate,
comprising the steps of: (a) providing a full-length antibody; (b)
modifying the C-terminus of at least one of the heavy chains of the
full-length antibody by adding thereto a cysteine-containing
extension; and (c) conjugating the modified full-length antibody to
a partner molecule via the cysteine residue of the
cysteine-containing extension.
24. The method according to claim 23, wherein the
cysteine-containing extension has an amino acid sequence selected
from a group consisting of CAA, CCAA (SEQ ID NO:9), AACAA (SEQ ID
NO:7), and GGGGSCAA (SEQ ID NO:8).
25-26. (canceled)
27. A full length antibody, wherein the C-terminus of at least one
of its heavy chains has been modified by adding thereto a
cysteine-containing extension.
28. A method for the treatment of a PSMA-expressing cancer in a
subject, the method comprising: administering to the subject, in an
amount effective for the treatment, an antibody-drug conjugate
comprising a full length antibody that binds to PSMA and wherein
the drug is a cytotoxic or cytostatic agent, and the drug is
conjugated to the antibody at a cysteine residue at the C-terminus
of a heavy chain of the antibody.
29. The full length antibody of claim 27, wherein the
cysteine-containing extension has an amino acid sequence selected
from the group consisting of CAA, CCAA (SEQ ID NO:9), AACAA (SEQ ID
NO:7), and GGGGSCAA (SEQ ID NO:8).
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional Patent
Application No. 60/957,271 filed Aug. 22, 2007, which is
incorporated by reference herein in its entirety.
FIELD OF THE INVENTION
[0002] The present invention provides antibodies having
cysteine-containing C-terminal extensions facilitating conjugation
to a wide variety of partner molecules, including drugs,
radioisotopes, toxins, enymes, binding moieties, marker molecules,
proteins and therapeutic agents.
BACKGROUND
[0003] Conjugates of antibodies with drugs, radioisotopes, and
proteins have been widely investigated, and a range of chemical
approaches are available and widely used. Conjugation is normally
carried out to amino acid side chains, for example to lysine
residues, in a random fashion such that a distribution of
chemically modified species is found in each preparation of
conjugate, where different positions in the antibody may be
modified each time. Although successfully used, this approach has
several disadvantages. These include the fact that amino acids
important for function of the antibody, for example in antigen
binding or Fc receptor binding, may be modified and consequently
functionality of the antibody may be modified or lost. In addition,
the heterogeneity of the antibody conjugate in which a population
of molecules exists with different side chains modified complicates
analysis and makes it difficult to ensure that each preparation
contains the same distribution of modified species.
[0004] A potential improvement to conjugation is to attach the drug
or other molecule at a specific site, which is identical each time.
This can be designed such that attachment to the site does not
interfere with antibody functional properties, and allows
simplified analysis and quality control of conjugate preparations.
A number of approaches have been used to accomplish this either
using naturally occurring sites in the antibody molecule or by
specifically introducing additional sites through antibody
engineering.
[0005] The generation of free cysteines by selective reduction of
the hinge region has been used for the attachment of thiol reactive
compounds to both IgG and antibody fragments, for example, to
attach fluorescent compounds (Packard et al., Biochem. 25,
3548-3552 (1986)), for attachment of chelators that can be used for
site-specific radiolabelling (King et al., Cancer Res., 54,
6176-6185 (1994)), and for drug attachment (Doronina et al., Nature
Biotechnol. 21, 778-784 (2003)). Disadvantages of this approach
include the reduction of disulfide bonds which are important for
maintenance of the native antibody structure. This may have
detrimental effects on the functionality or stability of the
resulting conjugate. Also, as several disulfide bonds are present
in the antibody molecule, including two in the hinge region for
human IgG1, one attaching each light chain to heavy chain, and one
internal disulfide in each folded immunoglobulin domain, there
remains potential heterogeneity in the conjugate produced.
[0006] The Fc region carbohydrate also provides a natural specific
attachment site for IgG molecules. The carbohydrate is usually
modified by periodate oxidation to generate reactive aldehydes
which can then be used to attach reactive amine containing
compounds by Schiff base formation. As the aldehydes can react with
amine groups, reactions are carried out at low pH so that the
lysine residues are protonated and unreactive. Hydrazide groups are
most suitable for attachment to the aldehydes generated since they
are reactive at low pH to form a hydrazone linkage. The linkage can
then be further stabilized by reduction with sodium
cyanoborohydride to form a hydrazine linkage (Rodwell et al., Proc.
Natl. Acad. Sci. (USA) 83, 2632-2636 (1986)). The disadvantages of
this approach are the relatively harsh conditions required which
can damage and aggregate some antibody molecules. Methionine
residues present in some antibody variable regions may be
particularly susceptible to oxidation by periodate which can lead
to loss of antigen binding avidity. In some cases histidine or
tryptophan residues might also be affected.
[0007] Antibody engineering can be used to introduce specific
attachment sites into antibody molecules, and this can be
incorporated as part of the design of an engineered molecule. Extra
cysteine residues can be introduced onto the surface of antibody
constant domains to provide a specific attachment site without the
need to disrupt native disulphide bonds. Introduction of specific
cysteine residues in the CH1 domain of the IgG heavy chain has been
shown to result in sites to which ligands can be attached without
any loss of antigen binding (Lyons et al., Protein Engin. 3,
703-708 (1990)). These mutations can be used to produce
site-specifically labeled IgG or Fab antibody fragments (Bodmer et
al., U.S. Pat. No. 5,219,996). Similar work to produce
site-specific drug conjugates has recently been reported by
Genentech (Eigenbrot et al., U.S. Patent Publication No.
2007/0092940).
[0008] Mutations in the Fc region of the antibody have also been
explored. Substitution of a serine residue near the C-terminus of
the CH3 domain (Ser444) to cysteine resulted in the production of
IgG dimer of a chimeric human IgG1. This mutation resulted in 50%
of the molecules forming dimeric IgG (Shopes, 1992). The same
mutation introduced into a humanized IgG1 also resulted in the
formation of IgG dimers (Caron et al., J. Exp. Med. 176, 1191-1195
(1992)). An alternative mutation in the Fc region at position 442
has also been generated and used for site-specific attachment
(Stimmel et al., J. Biol. Chem. 275, 30445-30450 (2000)).
[0009] Antibody fragments such as single-chain Fv and diabodies
have been engineered in which an extra cysteine residue is added at
the C-terminus of the molecule (e.g. Cumber et al., J. Immunol.
149, 120-126 (1992); King et al, Cancer Res., 54, 6176-6185 (1994);
L.sup.1 et al., Bioconjugate Chem. 13, 985-995 (2002); Yang et al.,
Protein Engineering 16, 761-770 (2003); Olafson et al., Protein
Engineering Design & Selection, 17, 21-27 (2004)).
[0010] Alternative methods for site-specific attachment include the
introduction of extra glycosylation sites to allow attachment via
periodate oxidation. Some antibody light chains have an unusual
natural glycosylation site, and thus the light chain has been used
as a site to introduce a glycosylation site into antibodies which
do not normally have a carbohydrate attached to the light chain
(Leung et al., J. Immunol. 154, 5919-5926 (1995)). A third
engineering strategy is to introduce extra lysine residues into the
surface of the constant region domains (Hemminki et al., Protein
Engin. 8, 185-191 (1995)). Although this approach does not
introduce a unique labeling site, lysine reactive reagents are more
likely to modify the antibody at the increased concentration of
lysine residues in the constant region resulting in the retention
of more antigen binding reactivity.
[0011] A more specialized approach is the use of reverse
proteolysis to attach reagents specifically at the C-terminus of
Fab' heavy chains (Fisch et al., Bioconj. Chem. 3, 147-153 (1992)).
After production of a F(ab')2 fragment by the protease lysyl
endopeptidase, experimental conditions can be altered such that the
same protease working in reverse is capable of the specific
attachment of carbohydrazide groups to the C-terminus of the
F(ab')2 heavy chains. These carbohydrazide groups could then be
used as an attachment point for a radiolabelled chelator reacting
via an aldehyde group to form a hydrazone linkage.
[0012] Despite the background art described above, there remains a
need to conjugate partner molecules (e.g. a drug or toxin) to
intact IgG molecules, which are better characterized and more
stable than antibody fragments. The potential benefits of
attachment of partner molecules to the IgG instead of antibody
fragments include retention of Fc region dependent effector
functions, such as Fc receptor-dependent ADCC and phagocytosis, and
also retention of the FcRn binding site which allows a long serum
half-life to be maintained. As described in detail below, the
instant invention satisfies this need.
SUMMARY OF THE INVENTION
[0013] The present invention provides antibodies (e.g., IgG
antibodies) having C-terminal cysteine-containing extensions that
facilitate antibody conjugation to a partner molecule (e.g. a drug,
toxin, marker molecule, protein, radioisotope, or other therapeutic
agent).
[0014] In one embodiment, the antibody-partner molecule conjugate
compries a full-length antibody conjugated to a partner molecule
wherein the conjugation occurs via a cysteine-containing extension
at the C-terminus of a heavy chain of the antibody.
[0015] In some aspects of the invention, the antibody-partner
molecule conjugate is made by adding a cysteine-containing
extension to the heavy chain of the antibody.
[0016] In other aspects of the invention, the antibody-partner
molecule is made by replacing the original C-terminal amino acid
residue of the heavy chain of the antibody with C-terminal
cysteine-containing extension.
[0017] In some embodiments, the partner molecule of the
antibody-partner molecule conjugate is a drug. In some aspects, the
drug is a cytotoxic drug.
[0018] In some aspects of the invention, the cytotoxic drug is
selected from the group consisting of an auristatin, a DNA minor
groove binding agent, a DNA minor groove alkylating agent, an
enediyne, a lexitropsin, a duocarmycin, a taxane, a puromycin, a
dolastatin, a maytansinoid, and a vinca alkaloid.
[0019] In some aspects of the invention, the cytotoxic drug is
formula (m), formula (n), AFP, MMAF, MMAE, AEB, AEVB, auristatin E,
paclitaxel, docetaxel, CC-1065, SN-38, topotecan,
morpholino-doxorubicin, rhizoxin, cyanomorpholino-doxorubicin,
dolastatin-10, echinomycin, combretatstatin, chalicheamicin,
maytansine, DM-1, or netropsin.
[0020] In some aspects of the invention, the cytotoxic drug is an
anti-tubulin agent. In some embodiments, the anti-tubulin agent is
an auristatin, a vinca alkaloid, a podophyllotoxin, a taxane, a
baccatin derivative, a cryptophysin, a maytansinoid, a
combretastatin, or a dolastatin. In other aspects of the invention,
the antitubulin agent is AFP, MMAF, MMAE, AEB, AEVB, auristatin E,
vincristine, vinblastine, vindesine, vinorelbine, VP-16,
camptothecin, paclitaxel, docetaxel, epothilone A, epothilone B,
nocodazole, colchicines, colcimid, estramustine, cemadotin,
discodennolide, maytansine, DM-1, or eleutherobin.
[0021] In other aspects of the invention, the cytotoxic drug of the
antibody-partner molecule conjugate is gancyclovir, etanercept,
cyclosporine, tacrolimus, rapamycin, cyclophosphamide,
azathioprine, mycophenolate mofetil, methotrexate, cortisol,
aldosterone, dexamethasone, a cyclooxygenase inhibitor, a
5-ipoxygenase inhibitor, or a leukotriene receptor antagonist.
[0022] In some embodiments of the invention, the antibody-partner
molecule conjugate of the invention comprises a C-terminal
cysteine-containing extension having an amino acid sequence
selected from a CAA C-terminal extension, a CCAA (SEQ ID NO:9)
C-terminal extension, a AACAA (SEQ ID NO:7) C-terminal extension,
or a GGGGSCAA (SEQ ID NO:8) C-terminal extension of the
antibody.
[0023] In some embodiments, the antibody-partner molecule conjugate
of the invention comprises a linker. In some aspects of the
invention the linker is cleavable under intracellular conditions.
In some aspects of the invention, peptide linker is cleavable by an
intracellular protease. The antibody-partner molecule conjugate of
claim 14, wherein the intracellular protease is a lysosomal
protease or an endosomal protease.
[0024] In some embodiments if the invention, the peptide linker of
the antibody-partner molecule conjugate is a dipeptide linker. In
some aspects of the invention, the dipeptide linker is a val-cit
linker or a phe-lys linker.
[0025] In some embodiments, the cleavable linker of the partner
molecule conjugate is hydrolyzable at a pH of less than 5.5. In
some aspects of the invention, the hydrolyzable linker is a
hydrazone linker. In other aspects of the invention, the cleavable
linker is a disulfide linker.
[0026] In some embodiments, the antibody-drug conjugate of the
invention comprises:
[0027] a full length antibody that: [0028] (a) binds to PSMA, and
[0029] (b) is conjugated to a cytotoxic agent or an
immunosuppressive agent,
[0030] wherein the antibody-drug conjugate exerts: [0031] (a) a
cytotoxic or cytostatic effect on a PSMA-expressing cancer cell
line, or [0032] (b) a cytotoxic, cytostatic, or immunosuppressive
effect on a PSMA-expressing immune cell,
[0033] wherein the conjugation occurs at a an introduced cysteine
residue at or near the C-terminus of a heavy chain of the
antibody.
[0034] Other aspects of the invention include a method of making an
antibody-partner molecular conjugate, comprising the steps of:
[0035] (a) providing a full-length antibody; [0036] (b) modifying
the C-terminus of at least one of the heavy chains of the
full-length antibody by adding thereto a cysteine-containing
extension; and [0037] (c) conjugating the modified
full-lengthantibody to a partner molecule via the cysteine residue
of the cysteine-containing extension.
[0038] Some aspects of the invention include the methods of making
an antibody-partner molecular conjugate method wherein the
cysteine-containing extension has an amino acid sequence selected
from a group consisting of CAA, CCAA (SEQ ID NO:9), AACAA (SEQ ID
NO:7), and GGGGSCAA (SEQ ID NO:8).
[0039] Some embodiments of the invention provide methods of
preparing an antibody for use in an antibody-partner molecular
conjugate, comprising the steps of: [0040] (a) providing a
full-length antibody; and [0041] (b) modifying the C-terminus of at
least one of the heavy chains of the full-length antibody by adding
thereto a cysteine-containing extension.
[0042] In some aspects, the methods are for preparing antibody for
use in an antibody-partner molecular conjugate, wherein the
cysteine-containing extension of the antibody has an amino acid
sequence selected from the group consisting of CAA, CCAA (SEQ ID
NO:9), AACAA (SEQ ID NO:7), and GGGGSCAA (SEQ ID NO:8).
[0043] Other embodiment sof the invention provide a full length
antibody, wherein the C-terminus of at least one of its heavy
chains has been modified by adding thereto a cysteine-containing
extension.
[0044] Some aspects of the invention are methods for the treatment
of a PSMA-expressing cancer in a subject, the method comprising:
administering to the subject, in an amount effective for the
treatment, an antibody-drug conjugate comprising a full length
antibody that binds to PSMA and wherein the drug is a cytotoxic or
cytostatic agent, and the drug is conjugated to the antibody at a
cysteine residue at the C-terminus of a heavy chain of the
antibody.
BRIEF DESCRIPTION OF THE DRAWINGS
[0045] FIG. 1: pICOFs-2A10 plasmid. Starting vector
pICOFs-2A10.
[0046] FIG. 2: pIEFs SRglf-2A10 plasmid. Starting vector pIEFs
SRglf-2A10.
[0047] FIG. 3: 2A10-CAA and 2A10-C442 ELISA Results. Human IgG
expression by 2A10 LC 153-117, 2A10 HC CAA 153-118 and 2A10 HC C442
153-118 constructs.
[0048] FIG. 4: 2A10 Amino Acid Sequences. Comparison of the amino
acid sequences of 2A10 (SEQ ID NO:1), 2A10-CAA (SEQ ID NO:2), and
2A10-C442 (SEQ ID NO:3).
[0049] FIG. 5: 2A10 Nucleic Acid Sequences. Comparison of the
nucleic acid sequences of 2A10 (SEQ ID NO:4), 2A10-CAA (SEQ ID
NO:5), and 2A10-C442 (SEQ ID NO:6).
[0050] FIG. 6: Antigen Binding ELISA. Antigen (PSMA) binding
measured in a standard ELISA format assay. Bound antibody detected
with goat anti-human IgG F(ab').sub.2 fragment conjugated to HRP,
and signal developed using TMB.
[0051] FIG. 7: Cytotoxicity assay. Cytotoxicity of antibodies
determined in a standard tritiated thymidine proliferation assay
using PSMA-expressing LNCaP cells.
[0052] FIG. 8: Antigen Binding ELISA. Antigen binding measured in
using plates coated with recombinant CD70-mouse Fc fusion protein.
Bound antibody detected with anti-human IgG Fc fragment conjugated
to HRP.
[0053] FIG. 9: Antigen Binding ELISA. Antigen binding by antibody
variants with AACAA (SEQ ID N07), GGGGSCAA (SEQ ID NO:8), and CCAA
(SEQ ID NO:9) C-terminal extensions were measured in a standard
ELISA format assay.
[0054] FIG. 10: Cytotoxicity assay. Assay monitoring cytotoxicity
of formula (m)-conjugated antibodies.
[0055] FIG. 11: Antigen Binding ELISA. ELISA assay results for
assay monitoring antigen binding using plates coated with Cd16.
DETAILED DESCRIPTION
Definitions
[0056] Unless defined otherwise, all technical and scientific terms
used herein generally have the same meaning as commonly understood
by one of ordinary skill in the art to which this invention
belongs. Generally, the nomenclature used herein and the laboratory
procedures in cell culture, molecular genetics, organic chemistry
and nucleic acid chemistry and hybridization described below are
those well known and commonly employed in the art. Standard
techniques are used for nucleic acid and peptide synthesis.
Generally, enzymatic reactions and purification steps are performed
according to the manufacturer's specifications. The techniques and
procedures are generally performed according to conventional
methods in the art and various general references (see generally,
Sambrook et al. MOLECULAR CLONING: A LABORATORY MANUAL, 2d ed.
(1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y., which is incorporated herein by reference), which are
provided throughout this document. The nomenclature used herein and
the laboratory procedures in analytical chemistry, and organic
synthetic described below are those well known and commonly
employed in the art. Standard techniques, or modifications thereof,
are used for chemical syntheses and chemical analyses.
[0057] The term "therapeutic agent" is intended to mean a compound
that, when present in a therapeutically effective amount, produces
a desired therapeutic effect on a mammal. For certain indications
(e.g. for treating carcinomas) it is desirable that the therapeutic
agent also be capable of entering the target cell.
[0058] The term "immune response" refers to the action of, for
example, lymphocytes, antigen presenting cells, phagocytic cells,
granulocytes, and soluble macromolecules produced by the above
cells or the liver (including antibodies, cytokines, and
complement) that results in selective damage to, destruction of, or
elimination from the human body of invading pathogens, cells or
tissues infected with pathogens, cancerous cells, or, in cases of
autoimmunity or pathological inflammation, normal human cells or
tissues.
[0059] The term "cytotoxin" is intended to mean a therapeutic agent
having the desired effect of being cytotoxic to cancer cells.
Cytotoxic means that the agent arrests the growth of, or kills the
cells. Exemplary cytotoxins include, by way of example and not
limitation, combretastatins, duocarmycins, the CC-1065 anti-tumor
antibiotics, anthracyclines, and related compounds. Other
cytotoxins include mycotoxins, ricin and its analogues,
calicheamicins, doxorubicin, auristatins and maytansinoids.
[0060] The term "marker" is intended to mean a compound useful in
the characterization of tumors or other medical condition, for
example, diagnosis, progression of a tumor, and assay of the
factors secreted by tumor cells. Markers are considered a subset of
"diagnostic agents."
[0061] The term "selective" as used in connection with enzymatic
cleavage means that the rate of rate of cleavage of the linker
moiety is greater than the rate of cleavage of a peptide having a
random sequence of amino acids.
[0062] The terms "polypeptide," "peptide" and "protein" are used
interchangeably herein to refer to a polymer of amino acid
residues. The terms apply to amino acid polymers in which one or
more amino acid residue is an artificial chemical mimetic of a
corresponding naturally occurring amino acid, as well as to
naturally occurring amino acid polymers and non-naturally occurring
amino acid polymer. These terms also encompass the term "antibody."
The term "amino acid" refers to naturally occurring and synthetic
amino acids, as well as amino acid analogs and amino acid mimetics
that function in a manner similar to the naturally occurring amino
acids. Naturally occurring amino acids are those encoded by the
genetic code, as well as those amino acids that are later modified,
e.g., hydroxyproline, gamma-carboxyglutamate, and O-phosphoserine.
Amino acid analogs refers to compounds that have the same basic
chemical structure as a naturally occurring amino acid, i.e., a
carbon that is bound to a hydrogen, a carboxyl group, an amino
group, and an R group, e.g., homoserine, norleucine, methionine
sulfoxide, methionine methyl sulfonium. Such analogs have modified
R groups (e.g., norleucine) or modified peptide backbones, but
retain the same basic chemical structure as a naturally occurring
amino acid. One amino acid that may be used in particular is
citrulline, which is a precursor to arginine and is involved in the
formation of urea in the liver. Amino acid mimetics refers to
chemical compounds that have a structure that is different from the
general chemical structure of an amino acid, but functions in a
manner similar to a naturally occurring amino acid. The term
"unnatural amino acid" is intended to represent the "D"
stereochemical form of the twenty naturally occurring amino acids
described above. It is further understood that the term unnatural
amino acid includes homologues of the natural amino acids, and
synthetically modified forms of the natural amino acids. The
synthetically modified forms include, but are not limited to, amino
acids having alkylene chains shortened or lengthened by up to two
carbon atoms, amino acids comprising optionally substituted aryl
groups, and amino acids comprised halogenated groups, preferably
halogenated alkyl and aryl groups. When attached to a linker or
conjugate of the invention, the amino acid is in the form of an
"amino acid side chain", where the carboxylic acid group of the
amino acid has been replaced with a keto (C(O)) group. Thus, for
example, an alanine side chain is --C(O)--CH(NH.sub.2)--CH.sub.3,
and so forth.
[0063] Amino acids and peptides may be protected by blocking
groups. A blocking group is an atom or a chemical moiety that
protects the N-terminus of an amino acid or a peptide from
undesired reactions and can be used during the synthesis of a
drug-cleavable substrate conjugate. It should remain attached to
the N-terminus throughout the synthesis, and may be removed after
completion of synthesis of the drug conjugate by chemical
conditions, enzymatic cleavage or other conditions that selectively
achieve its removal. The blocking groups suitable for N-terminus
protection are well known in the art of peptide chemistry.
Exemplary blocking groups include, but are not limited to,
hydrogen, D-amino acid, and carbobenzoxy (Cbz) chloride.
[0064] "Nucleic acid" refers to deoxyribonucleotides or
ribonucleotides and polymers thereof in either single- or
double-stranded form. The term encompasses nucleic acids containing
known nucleotide analogs or modified backbone residues or linkages,
which are synthetic, naturally occurring, and non-naturally
occurring, which have similar binding properties as the reference
nucleic acid, and which are metabolized in a manner similar to the
reference nucleotides. Examples of such analogs include, without
limitation, phosphorothioates, phosphoramidates, methyl
phosphonates, chiral-methyl phosphonates, 2-O-methyl
ribonucleotides, peptide-nucleic acids (PNAs).
[0065] Unless otherwise indicated, a particular nucleic acid
sequence also implicitly encompasses conservatively modified
variants thereof (e.g., degenerate codon substitutions) and
complementary sequences, as well as the sequence explicitly
indicated. Specifically, degenerate codon substitutions may be
achieved by generating sequences in which the third position of one
or more selected (or all) codons is substituted with mixed-base
and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res.
19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260: 2605-2608
(1985); Rossolini et al., Mol. Cell. Probes 8: 91-98 (1994)). The
term nucleic acid is used interchangeably with gene, cDNA, mRNA,
oligonucleotide, and polynucleotide.
[0066] The symbol "--", whether utilized as a bond or displayed
perpendicular to a bond, indicates the point at which the displayed
moiety is attached to the remainder of the molecule, solid support,
etc.
[0067] The term "alkyl," by itself or as part of another
substituent, means, unless otherwise stated, a straight or branched
chain, or cyclic hydrocarbon radical, or combination thereof, which
may be fully saturated, mono- or polyunsaturated and can include
di- and multivalent radicals, having the number of carbon atoms
designated (i.e. C.sub.1-C.sub.10 means one to ten carbons).
Examples of saturated hydrocarbon radicals include, but are not
limited to, groups such as methyl, ethyl, n-propyl, isopropyl,
n-butyl, t-butyl, isobutyl, sec-butyl, cyclohexyl,
(cyclohexyl)methyl, cyclopropylmethyl, homologs and isomers of, for
example, n-pentyl, n-hexyl, n-heptyl, n-octyl, and the like. An
unsaturated alkyl group is one having one or more double bonds or
triple bonds. Examples of unsaturated alkyl groups include, but are
not limited to, vinyl, 2-propenyl, crotyl, 2-isopentenyl,
2-(butadienyl), 2,4-pentadienyl, 3-(1,4-pentadienyl), ethynyl, 1-
and 3-propynyl, 3-butynyl, and the higher homologs and isomers. The
term "alkyl," unless otherwise noted, is also meant to include
those derivatives of alkyl defined in more detail below, such as
"heteroalkyl." Alkyl groups, which are limited to hydrocarbon
groups are termed "homoalkyl".
[0068] The term "alkylene" by itself or as part of another
substituent means a divalent radical derived from an alkane, as
exemplified, but not limited, by
--CH.sub.2CH.sub.2CH.sub.2CH.sub.2--, and further includes those
groups described below as "heteroalkylene." Typically, an alkyl (or
alkylene) group will have from 1 to 24 carbon atoms, with those
groups having 10 or fewer carbon atoms being preferred in the
present invention. A "lower alkyl" or "lower alkylene" is a shorter
chain alkyl or alkylene group, generally having eight or fewer
carbon atoms.
[0069] The term "heteroalkyl," by itself or in combination with
another term, means, unless otherwise stated, a stable straight or
branched chain, or cyclic hydrocarbon radical, or combinations
thereof, consisting of the stated number of carbon atoms and at
least one heteroatom selected from the group consisting of O, N,
Si, and S, and wherein the nitrogen, carbon and sulfur atoms may
optionally be oxidized and the nitrogen heteroatom may optionally
be quaternized. The heteroatom(s) O, N, S, and Si may be placed at
any interior position of the heteroalkyl group or at the position
at which the alkyl group is attached to the remainder of the
molecule. Examples include, but are not limited to,
--CH.sub.2--CH.sub.2--O--CH.sub.3,
--CH.sub.2--CH.sub.2--NH--CH.sub.3,
--CH.sub.2--CH.sub.2--N(CH.sub.3)--CH.sub.3,
--CH.sub.2--S--CH.sub.2--CH.sub.3, --CH.sub.2--CH.sub.2,
--S(O)--CH.sub.3, --CH.sub.2--CH.sub.2--S(O).sub.2--CH.sub.3,
--CH.dbd.CH--O--CH.sub.3, --Si(CH.sub.3).sub.3,
--CH.sub.2--CH.dbd.N--OCH.sub.3, and
--CH.dbd.CH--N(CH.sub.3)--CH.sub.3. Up to two heteroatoms may be
consecutive, such as, for example, --CH.sub.2--NH--OCH.sub.3 and
--CH.sub.2--O--Si(CH.sub.3).sub.3. Similarly, the term
"heteroalkylene" by itself or as part of another substituent means
a divalent radical derived from heteroalkyl, as exemplified, but
not limited by, --CH.sub.2--CH.sub.2--S--CH.sub.2--CH.sub.2-- and
--CH.sub.2--S--CH.sub.2--CH.sub.2--NH--CH.sub.2--. For
heteroalkylene groups, heteroatoms can also occupy either or both
of the chain termini (e.g., alkyleneoxy, alkylenedioxy,
alkyleneamino, alkylenediamino, and the like). The terms
"heteroalkyl" and "heteroalkylene" encompass poly(ethylene glycol)
and its derivatives (see, for example, Shearwater Polymers Catalog,
2001). Still further, for alkylene and heteroalkylene linking
groups, no orientation of the linking group is implied by the
direction in which the formula of the linking group is written. For
example, the formula --C(O).sub.2R'-- represents both
--C(O).sub.2R'-- and --R'C(O).sub.2--.
[0070] The term "lower" in combination with the terms "alkyl" or
"heteroalkyl" refers to a moiety having from 1 to 6 carbon
atoms.
[0071] The terms "alkoxy," "alkylamino," "alkylsulfonyl," and
"alkylthio" (or thioalkoxy) are used in their conventional sense,
and refer to those alkyl groups attached to the remainder of the
molecule via an oxygen atom, an amino group, an SO.sub.2 group or a
sulfur atom, respectively. The term "arylsulfonyl" refers to an
aryl group attached to the remainder ofhte molecule via an SO.sub.2
group, and the term "sulfhydryl" refers to an SH group.
[0072] In general, an "acyl substituent" is also selected from the
group set forth above. As used herein, the term "acyl substituent"
refers to groups attached to, and fulfilling the valence of a
carbonyl carbon that is either directly or indirectly attached to
the polycyclic nucleus of the compounds of the present
invention.
[0073] The terms "cycloalkyl" and "heterocycloalkyl", by themselves
or in combination with other terms, represent, unless otherwise
stated, cyclic versions of substituted or unsubstituted "alkyl" and
substituted or unsubstituted "heteroalkyl", respectively.
Additionally, for heterocycloalkyl, a heteroatom can occupy the
position at which the heterocycle is attached to the remainder of
the molecule. Examples of cycloalkyl include, but are not limited
to, cyclopentyl, cyclohexyl, 1-cyclohexenyl, 3-cyclohexenyl,
cycloheptyl, and the like. Examples of heterocycloalkyl include,
but are not limited to, 1-(1,2,5,6-tetrahydropyridyl),
1-piperidinyl, 2-piperidinyl, 3-piperidinyl, 4-morpholinyl,
3-morpholinyl, tetrahydrofuran-2-yl, tetrahydrofuran-3-yl,
tetrahydrothien-2-yl, tetrahydrothien-3-yl, 1-piperazinyl,
2-piperazinyl, and the like. The heteroatoms and carbon atoms of
the cyclic structures are optionally oxidized.
[0074] The terms "halo" or "halogen," by themselves or as part of
another substituent, mean, unless otherwise stated, a fluorine,
chlorine, bromine, or iodine atom. Additionally, terms such as
"haloalkyl," are meant to include monohaloalkyl and polyhaloalkyl.
For example, the term "halo(C.sub.1-C.sub.4)alkyl" is mean to
include, but not be limited to, trifluoromethyl,
2,2,2-trifluoroethyl, 4-chlorobutyl, 3-bromopropyl, and the
like.
[0075] The term "aryl" means, unless otherwise stated, a
substituted or unsubstituted polyunsaturated, aromatic, hydrocarbon
substituent which can be a single ring or multiple rings
(preferably from 1 to 3 rings) which are fused together or linked
covalently. The term "heteroaryl" refers to aryl groups (or rings)
that contain from one to four heteroatoms selected from N, O, and
S, wherein the nitrogen, carbon and sulfur atoms are optionally
oxidized, and the nitrogen atom(s) are optionally quaternized. A
heteroaryl group can be attached to the remainder of the molecule
through a heteroatom. Non-limiting examples of aryl and heteroaryl
groups include phenyl, 1-naphthyl, 2-naphthyl, 4-biphenyl,
1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 3-pyrazolyl, 2-imidazolyl,
4-imidazolyl, pyrazinyl, 2-oxazolyl, 4-oxazolyl,
2-phenyl-4-oxazolyl, 5-oxazolyl, 3-isoxazolyl, 4-isoxazolyl,
5-isoxazolyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, 2-furyl,
3-furyl, 2-thienyl, 3-thienyl, 2-pyridyl, 3-pyridyl, 4-pyridyl,
2-pyrimidyl, 4-pyrimidyl, 5-benzothiazolyl, purinyl,
2-benzimidazolyl, 5-indolyl, 1-isoquinolyl, 5-isoquinolyl,
2-quinoxalinyl, 5-quinoxalinyl, 3-quinolyl, and 6-quinolyl.
Substituents for each of the above noted aryl and heteroaryl ring
systems are selected from the group of acceptable substituents
described below. "Aryl" and "heteroaryl" also encompass ring
systems in which one or more non-aromatic ring systems are fused,
or otherwise bound, to an aryl or heteroaryl system.
[0076] For brevity, the term "aryl" when used in combination with
other terms (e.g., aryloxy, arylthioxy, arylalkyl) includes both
aryl and heteroaryl rings as defined above. Thus, the term
"arylalkyl" is meant to include those radicals in which an aryl
group is attached to an alkyl group (e.g., benzyl, phenethyl,
pyridylmethyl and the like) including those alkyl groups in which a
carbon atom (e.g., a methylene group) has been replaced by, for
example, an oxygen atom (e.g., phenoxymethyl, 2-pyridyloxymethyl,
3-(1-naphthyloxy)propyl, and the like).
[0077] Each of the above terms (e.g., "alkyl," "heteroalkyl,"
"aryl" and "heteroaryl") include both substituted and unsubstituted
forms of the indicated radical. Preferred substituents for each
type of radical are provided below.
[0078] Substituents for the alkyl, and heteroalkyl radicals
(including those groups often referred to as alkylene, alkenyl,
heteroalkylene, heteroalkenyl, alkynyl, cycloalkyl,
heterocycloalkyl, cycloalkenyl, and heterocycloalkenyl) are
generally referred to as "alkyl substituents" and "heteroalkyl
substituents," respectively, and they can be one or more of a
variety of groups selected from, but not limited to: --OR', .dbd.O,
.dbd.NR', .dbd.N--OR', --NR'R'', --SR', -halogen, --SiR'R''R''',
--OC(O)R', --C(O)R', --CO.sub.2R', --CONR'R'', --OC(O)NR'R'',
--NR''C(O)R', --NR'--C(O)NR''R''', --NR''C(O).sub.2R',
--NR--C(NR'R''R''').dbd.NR'''', --NR--C(NR'R'').dbd.NR''',
--S(O)R', --S(O).sub.2R', --S(O).sub.2NR'R'', --NRSO.sub.2R', --CN
and --NO.sub.2 in a number ranging from zero to (2 m'+1), where m'
is the total number of carbon atoms in such radical. R', R'', R'''
and R'''' each preferably independently refer to hydrogen,
substituted or unsubstituted heteroalkyl, substituted or
unsubstituted aryl, e.g., aryl substituted with 1-3 halogens,
substituted or unsubstituted alkyl, alkoxy or thioalkoxy groups, or
arylalkyl groups. When a compound of the invention includes more
than one R group, for example, each of the R groups is
independently selected as are each R', R'', R''' and R'''' groups
when more than one of these groups is present. When R' and R'' are
attached to the same nitrogen atom, they can be combined with the
nitrogen atom to form a 5, 6, or 7-membered ring. For example,
--NR'R'' is meant to include, but not be limited to, 1-pyrrolidinyl
and 4-morpholinyl. From the above discussion of substituents, one
of skill in the art will understand that the term "alkyl" is meant
to include groups including carbon atoms bound to groups other than
hydrogen groups, such as haloalkyl (e.g., --CF.sub.3 and
--CH.sub.2CF.sub.3) and acyl (e.g., --C(O)CH.sub.3, --C(O)CF.sub.3,
--C(O)CH.sub.2OCH.sub.3, and the like).
[0079] Similar to the substituents described for the alkyl radical,
the aryl substituents and heteroaryl substituents are generally
referred to as "aryl substituents" and "heteroaryl substituents,"
respectively and are varied and selected from, for example:
halogen, --OR', .dbd.O, .dbd.NR', .dbd.N--OR', --NR'R'', --SR',
-halogen, --SiR'R''R''', --OC(O)R', --C(O)R', --CO.sub.2R',
--CONR'R'', --OC(O)NR'R'', --NR''C(O)R', --NR'--C(O)NR''R''',
--NR''C(O).sub.2R', --NR--C(NR'R'').dbd.NR''', --S(O)R',
--S(O).sub.2R', --S(O).sub.2NR'R'', --NRSO.sub.2R', --CN and
--NO.sub.2, --R', --N.sub.3, --CH(Ph).sub.2,
fluoro(C.sub.1-C.sub.4)alkoxy, and fluoro(C.sub.1-C.sub.4)alkyl, in
a number ranging from zero to the total number of open valences on
the aromatic ring system; and where R', R'', R''' and R'''' are
preferably independently selected from hydrogen,
(C.sub.1-C.sub.8)alkyl and heteroalkyl, unsubstituted aryl and
heteroaryl, (unsubstituted aryl)-(C.sub.1-C.sub.4)alkyl, and
(unsubstituted arypoxy-(C.sub.1-C.sub.4)alkyl. When a compound of
the invention includes more than one R group, for example, each of
the R groups is independently selected as are each R', R'', R'''
and R'''' groups when more than one of these groups is present.
[0080] Two of the aryl substituents on adjacent atoms of the aryl
or heteroaryl ring may optionally be replaced with a substituent of
the formula -T-C(O)--(CRR').sub.q--U--, wherein T and U are
independently --NR--, --O--, --CRR'-- or a single bond, and q is an
integer of from 0 to 3. Alternatively, two of the substituents on
adjacent atoms of the aryl or heteroaryl ring may optionally be
replaced with a substituent of the formula -A-(CH.sub.2).sub.rB--,
wherein A and B are independently --CRR'--, --O--, --NR--, --S--,
--S(O)--, --S(O).sub.2--, --S(O).sub.2NR'-- or a single bond, and r
is an integer of from 1 to 4. One of the single bonds of the new
ring so formed may optionally be replaced with a double bond.
Alternatively, two of the substituents on adjacent atoms of the
aryl or heteroaryl ring may optionally be replaced with a
substituent of the formula --(CRR').sub.s--X--(CR''R''').sub.d--,
where s and d are independently integers of from 0 to 3, and X is
--O--, --NR'--, --S--, --S(O)--, --S(O).sub.2--, or
--S(O).sub.2NR'--. Substituents R, R', R'' and R''' are preferably
independently selected from hydrogen or substituted or
unsubstituted (C.sub.1-C.sub.6) alkyl.
[0081] As used herein, the term "diphosphate" includes but is not
limited to an ester of phosphoric acid containing two phosphate
groups. The term "triphosphate" includes but is not limited to an
ester of phosphoric acid containing three phosphate groups. For
example, particular drugs having a diphosphate or a triphosphate
include:
##STR00001##
[0082] As used herein, the term "heteroatom" includes oxygen (O),
nitrogen (N), sulfur (S) and silicon (Si).
[0083] The symbol "R" is a general abbreviation that represents a
substituent group that is selected from substituted or
unsubstituted alkyl, substituted or unsubstituted heteroalkyl,
substituted or unsubstituted aryl, substituted or unsubstituted
heteroaryl, and substituted or unsubstituted heterocyclyl
groups.
[0084] Unless specified otherwise, the term "antibody" refers to a
protein, including a glycoprotein, of the immunoglobulin class
comprising at least two heavy (H) chains and two light (L) chains
inter-connected by disulfide bonds, or an antigen binding portion
thereof. Each heavy chain is comprised of a heavy chain variable
region (abbreviated herein as VH) and a heavy chain constant
region. The heavy chain constant region is comprised of three
domains, CH.sub.1, CH.sub.2 and CH.sub.3. Each light chain is
comprised of a light chain variable region (abbreviated herein as
VL) and a light chain constant region. The light chain constant
region is comprised of one domain, CL. The VH and VL regions can be
further subdivided into regions of hypervariability, termed
complementarity determining regions (CDR), interspersed with
regions that are more conserved, termed framework regions (FR).
Each VH and VL is composed of three CDRs and four FRs, arranged
from amino-terminus to carboxy-terminus in the following order:
FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions of the
heavy and light chains contain a binding domain that interacts with
an antigen. The constant regions of the antibodies may mediate the
binding of the immunoglobulin to host tissues or factors, including
various cells of the immune system (e.g., effector cells) and the
first component (Clq) of the classical complement system.
[0085] The term "antigen-binding portion" of an antibody (or simply
"antibody portion"), as used herein, refers to one or more
fragments of an antibody that retain the ability to specifically
bind to an antigen. It has been shown that the antigen-binding
function of an antibody can be performed by fragments of a
full-length antibody. Examples of binding fragments encompassed
within the term "antigen-binding portion" of an antibody include
(i) a Fab fragment, a monovalent fragment consisting of the VL, VH,
CL and CH1 domains; (ii) a F(ab')2 fragment, a bivalent fragment
comprising two Fab fragments linked by a disulfide bridge at the
hinge region; (iii) a Fab' fragment, which is essentially an Fab
with part of the hinge region (see, FUNDAMENTAL IMMUNOLOGY (Paul
ed., 3.sup.rd ed. 1993); (iv) a Fd fragment consisting of the VH
and CH1 domains; (v) a Fv fragment consisting of the VL and VH
domains of a single arm of an antibody, (vi) a dAb fragment (Ward
et al., (1989) Nature 341:544-546), which consists of a VH domain;
(vii) an isolated complementarity determining region (CDR); and
(viii) a nanobody, a heavy chain variable region containing a
single variable domain and two constant domains. Furthermore,
although the two domains of the Fv fragment, VL and VH, are coded
for by separate genes, they can be joined, using recombinant
methods, by a synthetic linker that enables them to be made as a
single protein chain in which the VL and VH regions pair to form
monovalent molecules (known as single chain Fv (scFv); see e.g.,
Bird et al. (1988) Science 242:423-426; and Huston et al. (1988)
Proc. Natl. Acad. Sci. USA 85:5879-5883). Such single chain
antibodies are also intended to be encompassed within the term
"antigen-binding portion" of an antibody. These antibody fragments
are obtained using conventional techniques known to those with
skill in the art, and the fragments are screened for utility in the
same manner as are intact antibodies.
[0086] An "isolated antibody," as used herein, is intended to refer
to an antibody that is substantially free of other antibodies
having different antigenic specificities (e.g., an isolated
antibody that specifically binds a target antigen that is
substantially free of antibodies that specifically bind antigens
other than the target). An isolated antibody that specifically
binds the target may, however, have cross-reactivity to other
antigens, such as target molecules from other species. Moreover, an
isolated antibody may be substantially free of other cellular
material and/or chemicals.
[0087] The terms "monoclonal antibody" or "monoclonal antibody
composition" as used herein refer to a preparation of antibody
molecules of single molecular composition. A monoclonal antibody
composition displays a single binding specificity and affinity for
a particular epitope.
[0088] The term "human antibody," as used herein, is intended to
include antibodies having variable regions in which both the
framework and CDR regions are derived from human germline
immunoglobulin sequences. Furthermore, if the antibody contains a
constant region, the constant region also is derived from human
germline immunoglobulin sequences. The human antibodies of the
invention may include amino acid residues not encoded by human
germline immunoglobulin sequences (e.g., mutations introduced by
random or site-specific mutagenesis in vitro or by somatic mutation
in vivo). However, the term "human antibody," as used herein, is
not intended to include antibodies in which CDR sequences derived
from the germline of another mammalian species, such as a mouse,
have been grafted onto human framework sequences.
[0089] The term "human monoclonal antibody" refers to antibodies
displaying a single binding specificity which have variable regions
in which both the framework and CDR regions are derived from human
germline immunoglobulin sequences. In one embodiment, the human
monoclonal antibodies are produced by a hybridoma which includes a
B cell obtained from a transgenic nonhuman animal, e.g., a
transgenic mouse, having a genome comprising a human heavy chain
transgene and a light chain transgene fused to an immortalized
cell.
[0090] The term "recombinant human antibody," as used herein,
includes all human antibodies that are prepared, expressed, created
or isolated by recombinant means, such as (a) antibodies isolated
from an animal (e.g., a mouse) that is transgenic or
transchromosomal for human immunoglobulin genes or a hybridoma
prepared therefrom (described further below), (b) antibodies
isolated from a host cell transformed to express the human
antibody, e.g., from a transfectoma, (c) antibodies isolated from a
recombinant, combinatorial human antibody library, and (d)
antibodies prepared, expressed, created or isolated by any other
means that involve splicing of human immunoglobulin gene sequences
to other DNA sequences. Such recombinant human antibodies have
variable regions in which the framework and CDR regions are derived
from human germline immunoglobulin sequences. In certain
embodiments, however, such recombinant human antibodies can be
subjected to in vitro mutagenesis (or, when an animal transgenic
for human Ig sequences is used, in vivo somatic mutagenesis) and
thus the amino acid sequences of the VH and VL regions of the
recombinant antibodies are sequences that, while derived from and
related to human germline VH and VL sequences, may not naturally
exist within the human antibody germline repertoire in vivo.
[0091] As used herein, "isotype" refers to the antibody class
(e.g., IgM or IgGl) that is encoded by the heavy chain constant
region genes.
[0092] The phrases "an antibody recognizing an antigen" and "an
antibody specific for an antigen" are used interchangeably herein
with the term "an antibody which binds specifically to an
antigen."
[0093] The term "antibody derivative" referes to antibodies having
mutated amino acid sequences, as compared to its germline sequence,
where such mutations include substitutions, deletions, and
insertions of amnio acids. This term also refers to antibodies
having post-translational modifications including, but not limited
to, glycosylation, acylation, alkylation, amidation, biotinylation,
lipoylation (e.g., as prenylation, myristoylation, and
farnesylations), and PEGylation, as well as the addition of linker
molecules, such as those described in detail below and those known
in the art.
[0094] The terms "antibody conjugate" and "antibody partner
molecule conjugate" refer to a full-length antibody, i.e., an
antibody comprising at least two heavy (H) chains and two light (L)
chains inter-connected by disulfide bonds, that is conjugated to a
partner molecule.
[0095] The term "humanized antibody" is intended to refer to
antibodies in which CDR sequences derived from the germline of
another mammalian species, such as a mouse, have been grafted onto
human framework sequences. Additional framework region
modifications may be made within the human framework sequences.
[0096] The term "chimeric antibody" is intended to refer to
antibodies in which the variable region sequences are derived from
one species and the constant region sequences are derived from
another species, such as an antibody in which the variable region
sequences are derived from a mouse antibody and the constant region
sequences are derived from a human antibody.
[0097] The term "C-terminal extension" refers to the addition of up
to ten but preferably five or fewer amino acid residues, preferably
composed of small hydrophobic amino acids to the C-terminus of an
antibody chain. In some embodiments, the C-terminal extension adds
one or more terminal cysteine amino acid residues at or near the
C-terminus to an antibody chain naturally lacking a cysteine
residue within the five residues closest to the carboxyl
terminus.
[0098] As used herein, an antibody that "specifically binds to a
target" is intended to refer to an antibody that binds to a target
with a K.sub.D of 1.times.10.sup.-7 M or less, more preferably
5.times.10.sup.-8 M or less, more preferably 3.times.10.sup.-8 M or
less, more preferably 1.times.10.sup.-8 M or less, even more
preferably 5.times.10.sup.-9 M or less.
[0099] The term "does not substantially bind" to a protein or
cells, as used herein, means does not bind or does not bind with a
high affinity to the protein or cells, i.e. binds to the protein or
cells with a K.sub.D of 1.times.10.sup.-6M or more, more preferably
1.times.10.sup.-5 M or more, more preferably 1.times.10.sup.-4 M or
more, more preferably 1.times.10.sup.-3 M or more, even more
preferably 1.times.10.sup.-2 M or more.
[0100] The term "Kassoc" or "K.sub.a," as used herein, is intended
to refer to the association rate of a particular antibody-antigen
interaction, whereas the term "Kdis" or "K.sub.d," as used herein,
is intended to refer to the dissociation rate of a particular
antibody-antigen interaction. The term "K.sub.D," as used herein,
is intended to refer to the dissociation constant, which is
obtained from the ratio of K.sub.d to K.sub.a (i.e.,
K.sub.d/K.sub.a) and is expressed as a molar concentration (M).
K.sub.D values for antibodies can be determined using methods well
established in the art. A preferred method for determining the
K.sub.D of an antibody is by using surface plasmon resonance,
preferably using a biosensor system such as a Biacore.RTM.
system.
[0101] As used herein, the term "high affinity" for an IgG antibody
refers to an antibody having a K.sub.D of 1.times.10.sup.-7 M or
less, more preferably 5.times.10.sup.-8 M or less, even more
preferably 1.times.10.sup.-8 M or less, even more preferably
5.times.10.sup.-9 M or less and even more preferably
1.times.10.sup.-9 M or less for a target antigen. However, "high
affinity" binding can vary for other antibody isotypes. For
example, "high affinity" binding for an IgM isotype refers to an
antibody having a K.sub.D of 10.sup.-6 M or less, more preferably
10.sup.-7 M or less, even more preferably 10.sup.-8 M or less.
[0102] As used herein, the term "subject" includes any human or
nonhuman animal. The term "nonhuman animal" includes all
vertebrates, e.g., mammals and non-mammals, such as nonhuman
primates, sheep, dogs, cats, horses, cows, chickens, amphibians,
reptiles, etc.
[0103] As used herein, the term "partner molecule" refers to the
entity which is conjugated to an antibody in an antibody conjugate.
Examples of partner molecules include drugs, toxins, marker
molecules (e.g. radioisotopes), proteins and therapeutic
agents.
[0104] Various aspects of the invention are described in further
detail in the following subsections.
[0105] Antibodies which Form Conjugates with Partner Molecules
[0106] The antibody-partner molecule conjugates of the present
invention include an antibody, (e.g., a monoclonal antibody, an
antibody fragment, or an antibody derivative) that is selected
based on its specificity for an antigen expressed on a target cell,
or at a target site, of interest. A wide variety of tumor-specific
or other disease-specific antigens have been identified and
antibodies to those antigens have been used or proposed for use in
the treatment of such tumors or other diseases. Poon et al., in the
Journal of Biological Chemistry, 270:8571-8577 (1995), report the
production of chimeric IgM antibodies.
[0107] Greenwood et al., in Ther. Immunol., 1(5):247-55 (1994),
report multiple-domain fon s of the therapeutic monoclonal antibody
CAMPATH-1H, including a homodimeric form of the antibody engineered
by mutation of a serine residue to cysteine near the
carboxy-terminal of the CH3 domain, resulting in improved lysis of
target cells in a cytotoxicity assay.
[0108] Urnovitz et al., in U.S. Pat. No. 4,698,420, describe an
antibody coupled to another moiety, e.g., a toxin such as ricin,
via a naturally occurring cysteine residue in proximity to the
carboxyl terminal end of the antibody heavy chain
[0109] Barn et al., in U.S. Pat. No. 7,311,902, describe human
interleukin-18 (IL-18) polypeptides and substitution mutants
thereof conjugated to water-soluble polymers at specific sites on
the human IL-18 protein via naturally occurring cysteine
residues.
[0110] Kuau et al., in the Journal of Biological Chemistry,
269:7610-7616 (1994), report the replacement of five surface
exposed residues in Pseudomonas exotoxin A with cysteine residues
for site-specific attachment of covalently bound polyethylene
glycol (PEG).
[0111] Chilkoti et al., in Bioconjugate Chem., 5:504-507 (1994),
describe a cytochrome b5 molecule modified by site-directed
mutagenesis to replace the threonine residue at position 8 with a
cysteine residue for use in conjugating an active oligomer
(N-isopropylacrylamide). The antibodies that are known in the art
can be used in the conjugates of the invention, in particular for
the treatment of the disease with which the target antigen is
associated. Non-limiting examples of target antigens (and examples
of their associated diseases) to which an antibody-partner molecule
conjugate of the invention can be targeted include: Her2 (breast
cancer), CD20 (lymphomas), EGFR (solid tumors), CD22 (lymphomas,
including non-Hodgkin's lymphoma), CD52 (chronic lymphocytic
leukemia), CD33 (acute myelogenous leukemia), CD4 (lymphomas,
autoimmune diseases, including rheumatoid arthritis), CD30
(lymphomas, including non-Hodgkin's lymphoma), Muc18 (melanoma),
integrins (solid tumors), PSMA (prostate cancer, benign prostatic
hyperplasia), CEA (colorectal cancer), CD11a (psoriasis), CD70
(autoimmune diseases and cancer, including renal cell carcinoma),
CD80 (psoriasis), CD23 (asthma), CD40L (immune thromobcytopenic
CTLA4 (T cell lymphomas) and BLys (autoimmune diseases, including
systemic lupus erythematosus). Additional non-limiting examples of
target antigens to which an antibody-partner molecule conjugate of
the invention can be targeted include: CD19, Glypican-3, RG-1,
MUC1, MUC16, TMPRSS4, Fibronectin ED-B, IRTA2, IRTA3, IRTA4, IRTA5,
and Ephrin receptors.
[0112] Such antibodies are well known in the art and include, for
example, antibodies to CD30 such as human monoclonal antibodies
17G1, 2H9 and 5E11, which are characterized and described in U.S.
Patent Application Publication No. 2004/0006215. Additional
non-limiting examples include monoclonal antibody 2A10 which
specifically binds PSMA and is described in detail below,
monoclonal antibodies 4C8, 4E10, 4E10.5, 5A8, 5C4, 5C4.1.3, 5D7,
5D7.1, 5E10, 5E10.12, 5G1, 5G1.4, 6A10, 6C9, 6C9.6, 6D9, 6D9.7,
6G4, 7E4, 7E4.4, 7E6, 7H8, 8E8, 8E8.4, 8F8, 8F8.19, 8H1, 9810,
9A10.1, 9B9, 9C1, 9G5, 105B, 10B5.8, 10B9, 10B9.2, 10D1, 10D1.3,
10E11, 10E4, 10E4.5, 11B4, 11D10, 11E4, 11E4.1, 11E8, 11E10, 11F11,
11F9, 11G1, 11G1.5, 1C7, 1H8.8, 2A7, 2A7.6, 2E2, 2E2.7, 2E7, 2E7.2,
2G1, 2G1.2, 3C12, 3E10, 3E10.5, 3E6, 3E6.0, 3F10, 4A1, 4B6 and
4B6.12 which specifically bind to CTLA-4 and are described in U.S.
Patent Publication No. 20050201994, monoclonal antibodies 2G2, 2G5,
5A2, 7G8, 1E5, 4B7, and 7F5 which specifically bind IRTA5 and are
described in US Patent Application Publication No. 20050266008, and
monoclonal antibodies 2H5, 10B4, 8B5, 18E7 and 69A7 which
specifically bind CD70 and are described in PCT Publication Nos. WO
2007/038637 and WO 2008/074004. Each of the patent publications
cited are incorporated herein by reference in their entirety
[0113] Other nonlimiting examples include monoclonal antibodies
which specifically bind CD19, which are characterized and described
in WO 2007/002223, monoclonal antibodies to B7H4, which are
described in WO 2007/067991, monoclonal antibodies to PTK7,
specifically described WO 2007/067730, monoclonal antibodies to
RG1, which are described in U.S. Pat. No. 7,335,748, monoclonal
antibodies to Mesothelin, which are described in U.S. Provisional
Application Nos. 60/976,626 and 60/991,692, monoclonal antibodies
to CD33, which are described in U.S. Pat. No. 7,342,110, monoclonal
antibodies to CD30, which are described in U.S. Pat. No. 7,090,843,
monoclonal antibodies to CD.sub.2O, which are described in U.S.
Publication 2005/0180972, and monoclonal antibodies to C242,
described in Kovtun et al., Cancer Res. 2006, 66, 3214-3221.
Further included are monoclonal antibodies including Trastuzumab
(Herceptin.TM.), described in Beeram et al., J. Clin. Oncol. 26,
1028 (2008, May 20 Supp.), alemtuzumab, abciximab, biciromab
(ReoPrO.TM..), omalizumab, BR96, eculizumab, MH-1, ATM-027, SC-1,
bivatuzumab, BMS-188667, BMS-224818, SGN-15, CAT-213, J-695,
rituximab (Rituxan.TM.), CEA-Scan, sulesomab, palivizumab
(Synagis.TM.), basiliximab (Simulect.TM.), daclizumab
(Zenapax.TM.), Oncolym.TM., CaroRx.TM., apolizumab, fontolizumab,
Nuvion.TM., SMART anti-L-selectin Mab, TMA-15, YM-337, M60.1,
WX-G250, Vitaxin.TM., mepolizumab, pascolizumab, tositumomab,
efalizumab, 99 mTc-fanolesomab, metelimumab, CAL, MRA, MLN-2704,
OncoRad PR356, licilimomab, MAb-81C6, clenoliximab, Melimmune.TM.,
HumaRAD16.88.TM., KW-2871, MLN-02, MDX-210, MDX-37, MDX-H210, 3F8,
EMD-72000, SS (dsFv)PE38, infliximab (Remicade.TM.), 111In-capromab
pendetide; trastuzumab (Herceptin.TM.), TNX-901, 5-D12,
TheraCIM-h-R3.TM., TriAb, TRX-4, TriGem.TM., HRS-3/A9, BTI-322,
siplizumab, Mycograb.TM., 1NG-1(heMAb), HepeX-B, pexelizumab,
orgovomab, natalizumab, bevacizumab, cetuximab, epratuzumab,
afelimomab, MDX-R.sup.A, inolimomab, lintuzumab, CeaVac.TM., mPA7,
and mhoe-4.
[0114] In one embodiment of the instant invention, the antibody
employed in the antibody-partner molecule conjugate specifically
binds prostate-specific membrane antigen (PSMA) and is derived from
the human antibody 2A10, the heavy chain sequence of which is
presented in FIG. 10. In another embodiment the antibody employed
in the antibody-partner molecule conjugate is derived from antibody
2A10 and includes a C-terminal cysteine amino acid residue. In a
further embodiment the antibody employed in the antibody-partner
molecule conjugate is derived from antibody 2A10 and includes a
C-terminal Cys-Ala-Ala-extension to the original 2A10 heavy chain
sequence.
[0115] In addition, one of skill in the art does not need to rely
on previously identified antibodies to practice the instant
invention, but instead can prepare an antibody to a target of
interest for use in the present invention using standard antibody
production techniques. Several of such techniques are described in
detail below and others are well known in the art, for example
those described in Lonberg, N. et al. (1994) Nature 368(6474): 856
859; Fishwild, D. et al. (1996) Nature Biotechnology 14: 845-851;
and PCT Publication WO 98/24884 and WO 01/14424.
[0116] In a preferred embodiment, the antibodies of the instant
invention are Affibodies. Affibody molecules represent a new class
of affinity proteins based on a 58-amino acid residue protein
domain, derived from one of the IgG-binding domains of
staphylococcal protein A. This three helix bundle domain has been
used as a scaffold for the construction of combinatorial phagemid
libraries, from which Affibody variants that target the desired
molecules can be selected using phage display technology (Nord K,
Gunneriusson E, Ringdahl J, Stahl S, Uhlen M, Nygren Pa., Binding
proteins selected from combinatorial libraries of an a-helical
bacterial receptor domain, Nat Biotechnol 1997; 15:772-7. Ronmark
J, Gronlund H, Uhlen M, Nygren P A, Human immunoglobulin A
(IgA)-specific ligands from combinatorial engineering of protein A,
Eur J Biochem 2002; 269:2647-55.). The simple, robust structure of
Affibody molecules in combination with their low molecular weight
(6 kDa), make them suitable for a wide variety of applications, for
instance, as detection reagents (Ronmark J, Hansson M, Nguyen T, et
al, Construction and characterization of affibody-Fc chimeras
produced in Escherichia coli, J Immunol Methods 2002; 261:199-211)
and to inhibit receptor interactions (Sandstorm K, Xu Z, Forsberg
G, Nygren Pa., Inhibition of the CD28-CD80 co-stimulation signal by
a CD28-binding Affibody ligand developed by combinatorial protein
engineering, Protein Eng 2003; 16:691-7). Further details of
Affibodies and methods of production thereof may be obtained by
reference to U.S. Pat. No. 5,831,012 which is herein incorporated
by reference in its entirety.
[0117] In a peferred embodiment, the antibodies of the instant
application are Domain Antibodies (dAbs). dAbs are the smallest
functional binding units of antibodies, corresponding to the
variable regions of either the heavy (VH) or light (VL) chains of
human antibodies. Domain Antibodies have a molecular weight of
approximately 13 kDa. Domantis has developed a series of large and
highly functional libraries of fully human VH and VL dAbs (more
than ten billion different sequences in each library), and uses
these libraries to select dAbs that are specific to therapeutic
targets. In contrast to many conventional antibodies, Domain
Antibodies are well expressed in bacterial, yeast, and mammalian
cell systems. Further details of domain antibodies and methods of
production thereof may be obtained by reference to U.S. Pat. Nos.
6,291,158; 6,582,915; 6,593,081; 6,172,197; 6,696,245; U.S.
Application No. 2004/0110941; European patent application No.
1433846 and European Patents 0368684 & 0616640; WO05/035572,
WO04/101790, WO04/081026, WO04/058821, WO04/003019 and WO03/002609,
each of which is herein incorporated by reference in its
entirety.
[0118] In a preferred embodiment the antibodies of the instant
invention are Nanobodies. Nanobodies are antibody-derived
therapeutic proteins that contain the unique structural and
functional properties of naturally-occurring heavy-chain
antibodies. These heavy-chain antibodies contain a single variable
domain (VHH) and two constant domains (CH2 and CH3). Importantly,
the cloned and isolated VHH domain is a perfectly stable
polypeptide harbouring the full antigen-binding capacity of the
original heavy-chain antibody. Nanobodies have a high homology with
the VH domains of human antibodies and can be further humanised
without any loss of activity. Importantly, Nanobodies have a low
immunogenic potential, which has been confirmed in primate studies
with Nanobody lead compounds.
[0119] Nanobodies combine the advantages of conventional antibodies
with important features of small molecule drugs. Like conventional
antibodies, Nanobodies show high target specificity, high affinity
for their target and low inherent toxicity. However, like small
molecule drugs they can inhibit enzymes and readily access receptor
clefts. Furthermore, Nanobodies are extremely stable, can be
administered by means other than injection (see e.g. WO 04/041867,
which is herein incorporated by reference in its entirety) and are
easy to manufacture. Other advantages of Nanobodies include
recognising uncommon or hidden epitopes as a result of their small
size, binding into cavities or active sites of protein targets with
high affinity and selectivity due to their unique 3-dimensional,
drug format flexibility, tailoring of half-life and ease and speed
of drug discovery.
[0120] Nanobodies are encoded by single genes and are efficiently
produced in almost all prokaryotic and eukaryotic hosts e.g. E.
coli (see e.g. U.S. Pat. No. 6,765,087, which is herein
incorporated by reference in its entirety), moulds (for example
Aspergillus or Trichoderma) and yeast (for example Saccharomyces,
Kluyveromyces, Hansenula or Pichia) (see e.g. U.S. Pat. No.
6,838,254, which is herein incorporated by reference in its
entirety). The production process is scalable and multi-kilogram
quantities of Nanobodies have been produced. Because Nanobodies
exhibit a superior stability compared with conventional antibodies,
they can be formulated as a long shelf-life, ready-to-use
solution.
[0121] The Nanoclone method (see e.g. WO 06/079372, which is herein
incorporated by reference in its entirety) is a proprietary method
for generating Nanobodies against a desired target, based on
automated high-throughout selection of B-cells.
[0122] In a preferred embodiment the antibodies of the instant
invention are UniBodies. UniBody is a new proprietary antibody
technology that creates a stable, smaller antibody format with an
anticipated longer therapeutic window than current small antibody
formats. IgG4 antibodies are considered inert and thus do not
interact with the immune system. Genmab modified fully human IgG4
antibodies by eliminating the hinge region of the antibody. Unlike
the full size IgG4 antibody, the half molecule fragment is very
stable and is termed a UniBody. Halving the IgG4 molecule left only
one area on the UniBody that can bind to disease targets and the
UniBody therefore binds univalently to only one site on target
cells. This univalent binding does not stimulate cancer cells to
grow like bivalent antibodies might and opens the door for
treatment of some types of cancer which ordinary antibodies cannot
treat.
[0123] The UniBody is about half the size of a regular IgG4
antibody. This small size can be a great benefit when treating some
forms of cancer, allowing for better distribution of the molecule
over larger solid tumors and potentially increasing efficacy.
[0124] Fabs typically do not have a very long half-life. UniBodies,
however, were cleared at a similar rate to whole IgG4 antibodies
and were able to bind as well as whole antibodies and antibody
fragments in pre-clinical studies. Other antibodies primarily work
by killing the targeted cells whereas UniBodies only inhibit or
silence the cells.
[0125] Further details of Unibodies may be obtained by reference to
patent WO2007/059782, which is herein incorporated by reference in
its entirety.
[0126] Conjugates
[0127] In another aspect, there is provided an antibody-partner
molecule conjugate, wherein a partner molecule is conjugated to an
antibody having a C-terminal cysteine-bearing extension according
to this invention by a chemical linker (sometimes referred to
herein simply as "linker"). The partner molecule can be a
therapeutic agent or a marker. The therapeutic agent can be, for
example, a cytotoxin, a non-cytotoxic drug (e.g., an
immunosuppressant), a radioactive agent, another antibody, or an
enzyme. Preferably, the partner molecule is a cytotoxin. The marker
can be any label that generates a detectable signal, such as a
radiolabel, a fluorescent label, or an enzyme that catalyzes a
detectable modification to a substrate. The antibody serves a
targeting function: by binding to a target tissue or cell where its
antigen is found, the antibody steers the conjugate to the target
tissue or cell. There, the linker is cleaved, releasing the partner
molecule to perform its desired biological function. In some
instances, the conjugate is internalized within a target cell and
the cleavage occurs therewithin.
[0128] Linkers
[0129] In some embodiments, the linker is a peptidyl linker,
depicted herein as (L.sup.4).sub.p-F-(L.sup.1).sub.m. Other linkers
include hydrazine and disulfide linkers, depicted herein as
(L.sup.4).sub.p-H-(L.sup.1).sub.m and
(L.sup.4).sub.p-J-(L.sup.1).sub.m, respectively. F, H, and J are
peptidyl, hydrazine, and disulfide moieties, respectively, that are
cleavable to release the partner molecule from the antibody, while
L.sup.1 and L.sup.4 are linker groups. F, H, J, L.sup.1, and
L.sup.4 are more fully defined hereinbelow, along with the
subscripts p and m. The preparation and use of these and other
linkers is described in WO 2005/112919, the disclosure of which is
incorporated herein by reference.
[0130] The use of peptidyl and other linkers in antibody-partner
conjugates is described in U.S. Provisional Patent Application Ser.
Nos. 60/295,196; 60/295,259; 60/295,342; 60/304,908; 60/572,667;
60/661,174; 60/669,871; 60/720,499; 60/730,804; and 60/735,657;
published U.S. Patent Applications 2006/0004081, 2006/0024317, and
2006/0247295; U.S. Pat. Nos. 6,989,452, 7,087,800; and 7,129,261;
PCT Patent Application No. PCT/US2007/089100; and published PCT
applications Nos. 2007/038658, 2007/059404, and 2007/089100, all of
which are incorporated herein by reference.
[0131] Additional linkers are described in U.S. Pat. No. 6,214,345
(Bristol-Myers Squibb), U.S. Pat. Appl. 2003/0096743 and U.S. Pat.
Appl. 2003/0130189 (both to Seattle Genetics), de Groot et al., J.
Med. Chem. 42, 5277 (1999); de Groot et al. J. Org. Chem. 43, 3093
(2000); de Groot et al., J. Med. Chem. 66, 8815, (2001); WO
02/083180 (Syntarga); Carl et al., J. Med. Chem. Lett. 24, 479,
(1981); Dubowchik et al., Bioorg & Med. Chem. Lett. 8, 3347
(1998), the disclosures of which are incorporated herein by
reference.
[0132] In addition to connecting the antibody and the partner
molecule, a linker can impart stability to the partner molecule,
reduce its in vivo toxicity, or otherwise favorably affect its
pharmacokinetics, bioavailability and/or pharmacodynamics. It is
generally preferred that the linker is cleaved, releasing the
partner molecule, once the conjugate is delivered to its site of
action. Also preferably, the linkers are traceless, such that once
removed from the partner molecule (such as during activation), no
trace of the linker's presence remains.
[0133] In another embodiment, the linkers are characterized by
their ability to be cleaved at a site in or near a target cell such
as at the site of therapeutic action or marker activity of the
partner molecule. Such cleavage can be enzymatic in nature. This
feature aids in reducing systemic activation of the partner
molecule, reducing toxicity and systemic side effects. Preferred
cleavable groups for enzymatic cleavage include peptide bonds,
ester linkages, and disulfide linkages, such as the aforementioned
F, H, and J moieties. In other embodiments, the linkers are
sensitive to pH and are cleaved through changes in pH.
[0134] An important aspect is the ability to control the speed with
which the linkers cleave. Often a linker that cleaves quickly is
desired. In some embodiments, however, a linker that cleaves more
slowly may be preferred. For example, in a sustained release
formulation or in a formulation with both a quick release and a
slow release component, it may be useful to provide a linker which
cleaves more slowly. The aforecited WO 2005/112919 discloses
hydrazine linkers that can be designed to cleave at a range of
speeds, from very fast to very slow.
[0135] The linkers can also serve to stabilize the partner molecule
against degradation while the conjugate is in circulation, that is,
before it reaches the target tissue or cell. This feature provides
a significant benefit since such stabilization results in a
prolongation of the circulation half-life of the partner molecule.
The linker also serves to attenuate the activity of the partner
molecule so that the conjugate is relatively benign while in
circulation but the partner molecule has the desired effect--for
example is cytotoxic--after activation at the desired site of
action. For therapeutic agent conjugates, this feature of the
linker serves to improve the therapeutic index of the agent.
[0136] In addition to the cleavable peptide, hydrazine, or
disulfide groups F, H, or J, respectively, one or more linker
groups L.sup.1 are optionally introduced between the partner
molecule and F, H, or J, as the case may be. These linker groups
L.sup.1 may also be described as spacer groups and contain at least
two functional groups. Depending on the value of the subscript m
(i.e., the number of L.sup.1 groups present) and the location of a
particular group L.sup.1, a chemical functionality of a group
L.sup.1 can bond to a chemical functionality of the partner
molecule, of F, H or J, as the case may be, or of another linker
group L.sup.1 (if more than one L.sup.1 is present). Examples of
suitable chemical functionalities for spacer groups L.sup.1 include
hydroxy, mercapto, carbonyl, carboxy, amino, ketone, aldehyde, and
mercapto groups.
[0137] The linkers L.sup.1 can be a substituted or unsubstituted
alkyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl or substituted or unsubstituted
heteroalkyl group. In one embodiment, the alkyl or aryl groups may
comprise between 1 and 20 carbon atoms. They may also comprise a
polyethylene glycol moiety.
[0138] Exemplary groups L.sup.1 include, for example,
6-aminohexanol, 6-mercaptohexanol, 10-hydroxydecanoic acid, glycine
and other amino acids, 1,6-hexanediol, .beta.-alanine,
2-aminoethanol, cysteamine (2-aminoethanethiol), 5-aminopentanoic
acid, 6-aminohexanoic acid, 3-maleimidobenzoic acid, phthalide,
a-substituted phthalides, the carbonyl group, aminal esters,
nucleic acids, peptides and the like.
[0139] One function of the groups L.sup.1 is to provide spatial
separation between F, H or J, as the case may be, and the partner
molecule, lest the latter interfere (e.g., via steric or electronic
effects) with the cleavage chemistry at F, H, or J. The groups
L.sup.1 also can serve to introduce additional molecular mass and
chemical functionality into conjugate. Generally, the additional
mass and functionality will affect the serum half-life and other
properties of the conjugate. Thus, through careful selection of
spacer groups, conjugates with a range of serum half-lives can be
produced. Optionally, one or more linkers L.sup.1 can be a
self-immolative group, as described hereinbelow.
[0140] The subscript m is an integer selected from 0, 1, 2, 3, 4,
5, and 6. When multiple L.sup.1 groups are present, they can be the
same or different.
[0141] L.sup.4 is a linker moiety that provides spatial separation
between F, H, or J, as the case may be, and the antibody, lest F,
H, or J interfere with the antigen binding by the antibody or the
antibody interfere with the cleavage chemistry at F, H, or J.
Preferably, L.sup.4 imparts increased solubility or decreased
aggregation properties to conjugates utilizing a linker that
contains the moiety or modifies the hydrolysis rate of the
conjugate. As in the case of L.sup.1, L.sup.4 optionally is a self
immolative group. In one embodiment, the L.sup.4 moiety is
substituted alkyl, unsubstituted alkyl, substituted aryl,
unsubstituted aryl, substituted heteroalkyl, or unsubstituted
heteroalkyl, any of which may be straight, branched, or cyclic. The
substitutions can be, for example, a lower (C.sub.1-C.sub.6) alkyl,
alkoxy, alkylthio, alkylamino, or dialkylamino. In certain
embodiments, L.sup.4 comprises a non-cyclic moiety. In another
embodiment, L.sup.4 comprises a positively or negatively charged
amino acid polymer, such as polylysine or polyarginine. L.sup.4 can
comprise a polymer such as a polyethylene glycol moiety.
Additionally the L.sup.4 linker can comprise, for example, both a
polymer component and a small molecule moiety.
[0142] In a preferred embodiment, L.sup.4 comprises a polyethylene
glycol (PEG) moiety. The PEG portion of L.sup.4 may be between 1
and 50 units long. Preferably, the PEG will have 1-12 repeat units,
more preferably 3-12 repeat units, more preferably 2-6 repeat
units, or even more preferably 3-5 repeat units and most preferably
4 repeat units. L.sup.4 may consist solely of the PEG moiety, or it
may also contain an additional substituted or unsubstituted alkyl
or heteroalkyl. It is useful to combine PEG as part of the L.sup.4
moiety to enhance the water solubility of the complex.
Additionally, the PEG moiety reduces the degree of aggregation that
may occur during the conjugation of the drug to the antibody.
[0143] The subscript p is 0 or 1; that is, the presence of L.sup.4
is optional. Where present, L.sup.4 has at least two functional
groups, with one functional group binding to a chemical
functionality in F, H, or J, as the case may be, and the other
functional group binding to the antibody. Examples of suitable
chemical functionalities of groups L.sup.4 include hydroxy,
mercapto, carbonyl, carboxy, amino, ketone, aldehyde, and mercapto
groups. In the present instance of antibodies having a
cysteine-bearing C-terminal H chain extension, the functional group
for binding to the antibody should be one reactive with sulfhydryl
groups. Examples of suitable ones include another sulfhydryl group
(for formation of a disulfide) or, preferably, a maleimide group
(for addition of the antibody sulfhydryl group across the maleimide
double bond).
[0144] In some embodiments, L.sup.4 comprises
##STR00002##
directly attached to the N-terminus of (AA.sup.1).sub.c. R.sup.20
is a member selected from H, substituted or unsubstituted alkyl,
substituted or unsubstituted heteroalkyl, and acyl. Each R.sup.25,
R.sup.25', R.sup.26, and R.sup.26' is independently selected from
H, substituted or unsubstituted alkyl, substituted or unsubstituted
heteroalkyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, and substituted or unsubstituted
heterocycloalkyl; and s and t are independently integers from 1 to
6. Preferably, R.sup.20, R.sup.25, R.sup.25', R.sup.26 and
R.sup.26' are hydrophobic. In some embodiments, R.sup.20 is H or
alkyl (preferably, unsubstituted lower alkyl). In some embodiments,
R.sup.25, R.sup.25', R.sup.26 and R.sup.26' are independently H or
alkyl (preferably, unsubstituted C.sup.1 to C.sup.4 alkyl). In some
embodiments, R.sup.25, R.sup.25', R.sup.26 and R.sup.26' are all H.
In some embodiments, t is 1 and s is 1 or 2.
Peptide Linkers (F)
[0145] As discussed above, the peptidyl linkers of the invention
can be represented by the general formula:
(L.sup.4).sub.p-F-(L.sup.1).sub.m, wherein F represents the portion
comprising the peptidyl moiety. In one embodiment, the F portion
comprises an optional additional self-immolative linker L.sup.2 and
a carbonyl group, corresponding to a conjugate of formula (a):
##STR00003##
[0146] In this embodiment, L.sup.1, L.sup.4, p, and m are as
defined above. X.sup.4 is an antibody and D is a partner molecule.
The subscript o is 0 or 1 and L.sup.2, if present, represents a
self-immolative linker. The subscript o is 0 or 1. AA.sup.1
represents one or more natural amino acids, and/or unnatural
.alpha.-amino acids; c is an integer from 1 and 20. In some
embodiments, c is in the range of 2 to 5 or c is 2 or 3.
[0147] In formula (a), AA.sup.1 is linked, at its amino terminus,
either directly to L.sup.4 or, when L.sup.4 is absent, directly to
X.sup.4. In some embodiments, when L.sup.4 is present, L.sup.4 does
not comprise a carboxylic acyl group directly attached to the
N-terminus of (AA.sup.1).sub.c.
[0148] In another embodiment, the F portion comprises an amino
group and an optional spacer group L.sup.3 and L.sup.1 is absent
(i.e., m is 0), corresponding to a conjugate of formula (b):
##STR00004##
[0149] In this embodiment, X.sup.4, D, L.sup.4, AA.sup.1, c, and p
are as defined above. The subscript o is 0 or 1. L.sup.3, if
present, is a spacer group comprising a primary or secondary amine
or a carboxyl functional group, and either the amine of L.sup.3
forms an amide bond with a pendant carboxyl functional group of D
or the carboxyl of L.sup.3 forms an amide bond with a pendant amine
functional group of D.
Self-Immolative Linkers
[0150] A self-immolative linker is a bifunctional chemical moiety
which is capable of covalently linking together two spaced chemical
moieties into a normally stable tripartate molecule, releasing one
of said spaced chemical moieties from the tripartate molecule by
means of enzymatic cleavage; and following said enzymatic cleavage,
spontaneously cleaving from the remainder of the molecule to
release the other of said spaced chemical moieties. In accordance
with the present invention, the self-immolative spacer is
covalently linked at one of its ends to the peptide moiety and
covalently linked at its other end to the chemically reactive site
of the drug moiety whose derivatization inhibits pharmacological
activity, so as to space and covalently link together the peptide
moiety and the drug moiety into a tripartate molecule which is
stable and pharmacologically inactive in the absence of the target
enzyme, but which is enzymatically cleavable by such target enzyme
at the bond covalently linking the spacer moiety and the peptide
moiety to thereby effect release of the peptide moiety from the
tripartate molecule. Such enzymatic cleavage, in turn, will
activate the self-immolating character of the spacer moiety and
initiate spontaneous cleavage of the bond covalently linking the
spacer moiety to the drug moiety, to thereby effect release of the
drug in pharmacologically active form. See, for example, Carl et
al., 3. Med. Chem., 24 (3), 479-480 (1981); Carl et al., WO
81/01145 (1981); Toki et al., J. Org. Chem. 67, 1866-1872 (2002);
Boyd et al., WO 2005/112919; and Boyd et al., WO 2007/038658, the
disclosures of which are incorporated herein by reference.
[0151] One particularly preferred self-immolative spacer may be
represented by the formula (c):
##STR00005##
[0152] The aromatic ring of the aminobenzyl group may be
substituted with one or more "K" groups. A "K" group is a
substituent on the aromatic ring that replaces a hydrogen otherwise
attached to one of the four non-substituted carbons that are part
of the ring structure. The "K" group may be a single atom, such as
a halogen, or may be a multi-atom group, such as alkyl,
heteroalkyl, amino, nitro, hydroxy, alkoxy, haloalkyl, and cyano.
Each
[0153] K is independently selected from the group consisting of
substituted alkyl, unsubstituted alkyl, substituted heteroalkyl,
unsubstituted heteroalkyl, substituted aryl, unsubstituted aryl,
substituted heteroaryl, unsubstituted heteroaryl, substituted
heterocycloalkyl, unsubstituted heterocycloalkyl, halogen,
NO.sub.2, NR.sup.21R.sup.22, NR.sup.21COR.sup.22,
OCONR.sup.21R.sup.22, OCOR.sup.21, and OR.sup.21, wherein R.sup.21
and R.sup.22 are independently selected from the group consisting
of H, substituted alkyl, unsubstituted alkyl, substituted
heteroalkyl, unsubstituted heteroalkyl, substituted aryl,
unsubstituted aryl, substituted heteroaryl, unsubstituted
heteroaryl, substituted heterocycloalkyl and unsubstituted
heterocycloalkyl. Exemplary K substituents include, but are not
limited to, F, Cl, Br, I, NO.sub.2, OH, OCH.sub.3, NHCOCH.sub.3,
N(CH.sub.3).sub.2, NHCOCF.sub.3 and methyl. For "K.sub.i", i is an
integer of 0, 1, 2, 3, or 4. In one preferred embodiment, i is
0.
[0154] The ether oxygen atom of the structure shown above is
connected to a carbonyl group. The line from the NR.sup.24
functionality into the aromatic ring indicates that the amine
functionality may be bonded to any of the five carbons that both
form the ring and are not substituted by the --CH.sub.2--O-- group.
Preferably, the NR.sup.24 functionality of X is covalently bound to
the aromatic ring at the para position relative to the
--CH.sub.2--O-- group. R.sup.24 is a member selected from the group
consisting of H, substituted alkyl, unsubstituted alkyl,
substituted heteroalkyl, and unsubstituted heteroalkyl. In a
specific embodiment, R.sup.24 is hydrogen.
[0155] In one embodiment, the invention provides a peptide linker
of formula (a) above, wherein F comprises the structure:
##STR00006##
where R.sup.24, AA.sup.1, K, i, and c are as defined above.
[0156] In another embodiment, the peptide linker of formula (a)
above comprises a --F-(L.sup.1).sub.m- that comprises the
structure:
##STR00007##
where R.sup.24, AA.sup.1, K, i, and c are as defined above.
[0157] In some embodiments, a self-immolative spacer L.sup.1 or
L.sup.2 includes
##STR00008##
where each R.sup.17, R.sup.18, and R.sup.19 is independently
selected from H, substituted or unsubstituted alkyl, substituted or
unsubstituted heteroalkyl and substituted or unsubstituted aryl,
and w is an integer from 0 to 4. In some embodiments, R.sup.17 and
R.sup.18 are independently H or alkyl (preferably, unsubstituted
C.sub.1-C.sub.4 alkyl). Preferably, R.sup.17 and R.sup.18 are C1-4
alkyl, such as methyl or ethyl. In some embodiments, w is 0. It has
been found experimentally that this particular self-immolative
spacer cyclizes relatively quickly.
[0158] In some embodiments, L.sup.1 or L.sup.2 includes
##STR00009##
where R.sup.17, R.sup.18, R.sup.19, R.sup.24, and K are as defined
above.
Spacer Groups
[0159] The spacer group L.sup.3 is characterized in that it
comprises a primary or secondary amine or a carboxyl functional
group, and either the amine of the L.sup.3 group forms an amide
bond with a pendant carboxyl functional group of D or the carboxyl
of L.sup.3 forms an amide bond with a pendant amine functional
group of D. L.sup.3 can be selected from the group consisting of
substituted or unsubstituted alkyl, substituted or unsubstituted
heteroalkyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, or substituted or unsubstituted
heterocycloalkyl. In a preferred embodiment, L.sup.3 comprises an
aromatic group. More preferably, L.sup.3 comprises a benzoic acid
group, an aniline group or indole group. Non-limiting examples of
structures that can serve as an -L.sup.3-NH-- spacer include the
following structures:
##STR00010##
where Z is a member selected from O, S and NR.sup.23, and where
R.sup.23 is a member selected from H, substituted or unsubstituted
alkyl, substituted or unsubstituted heteroalkyl, and acyl.
[0160] Upon cleavage of the linker of the invention containing
L.sup.3, the L.sup.3 moiety remains attached to the drug, D.
Accordingly, the L.sup.3 moiety is chosen such that its attachment
to D does not significantly alter the activity of D. In another
embodiment, a portion of the drug D itself functions as the L.sup.3
spacer. For example, in one embodiment, the drug, D, is a
duocarmycin derivative in which a portion of the drug functions as
the L.sup.3 spacer. Non-limiting examples of such embodiments
include those in which NH.sub.2-(L.sup.3)-D has a structure
selected from the group consisting of:
##STR00011##
where Z is O, S or NR.sup.23, where R.sup.23 is H, substituted or
unsubstituted alkyl, substituted or unsubstituted heteroalkyl, or
acyl; and the NH.sub.2 group on each structure reacts with
(AA.sup.1).sub.c to form -(AA.sup.1).sub.c--NH--.
Peptide Sequence (AA.sup.1).sub.c
[0161] The group AA.sup.1 represents a single amino acid or a
plurality of amino acids that are joined together by amide bonds.
The amino acids may be natural amino acids and/or unnatural
.alpha.-amino acids. They may be in the L or the D configuration.
In one embodiment, at least three different amino acids are used.
In another embodiment, only two amino acids are used.
[0162] The term "amino acid" refers to naturally occurring and
synthetic amino acids, as well as amino acid analogs and amino acid
mimetics that function in a manner similar to the naturally
occurring amino acids. Naturally occurring amino acids are those
encoded by the genetic code, as well as those amino acids that are
later modified, e.g., hydroxyproline, .gamma.-carboxyglutamate,
citrulline, and O-phosphoserine. Amino acid analogs refers to
compounds that have the same basic chemical structure as a
naturally occurring amino acid, i.e., an a carbon that is bound to
a hydrogen, a carboxyl group, an amino group, and an R group, e.g.,
homoserine, norleucine, methionine sulfoxide, methionine methyl
sulfonium. Such analogs have modified R groups (e.g., norleucine)
or modified peptide backbones, but retain the same basic chemical
structure as a naturally occurring amino acid. One amino acid that
may be used in particular is citrulline, which is a precursor to
arginine and is involved in the formation of urea in the liver.
Amino acid mimetics refers to chemical compounds that have a
structure that is different from the general chemical structure of
an amino acid, but functions in a manner similar to a naturally
occurring amino acid. The term "unnatural amino acid" is intended
to represent the "D" stereochemical form of the twenty naturally
occurring amino acids described above. It is further understood
that the term unnatural amino acid includes homologues of the
natural amino acids, and synthetically modified forms of the
natural amino acids. The synthetically modified forms include, but
are not limited to, amino acids having alkylene chains shortened or
lengthened by up to two carbon atoms, amino acids comprising
optionally substituted aryl groups, and amino acids comprised
halogenated groups, preferably halogenated alkyl and aryl groups.
When attached to a linker or conjugate of the invention, the amino
acid is in the form of an "amino acid side chain", where the
carboxylic acid group of the amino acid has been replaced with a
keto (C(O)) group. Thus, for example, an alanine side chain is
--C(O)--CH(NH.sub.2)--CH.sub.3, and so forth.
[0163] The peptide sequence (AA.sup.1).sub.c is functionally the
amidification residue of a single amino acid (when c=1) or a
plurality of amino acids joined together by amide bonds. The
peptide sequence (AA.sup.1).sub.c preferably is selected for
enzyme-catalyzed cleavage by an enzyme in a location of interest in
a biological system. For example, for conjugates that are targeted
to but not internalized by a cell, a peptide is chosen that is
cleaved by a protease that in in the extracellular matrix, e.g., a
protease released by nearby dying cells or a tumor-associated
protease, such that the peptide is cleaved extracellularly. For
conjugates that are designed for internalization by a cell, the
sequence (AA.sup.1).sub.c preferably is selected for cleavage by an
endosomal or lysosomal protease. The number of amino acids within
the peptide can range from 1 to 20; but more preferably there will
be 1-8 amino acids, 1-6 amino acids or 1, 2, 3 or 4 amino acids
comprising (AA.sup.1).sub.c. Peptide sequences that are susceptible
to cleavage by specific enzymes or classes of enzymes are well
known in the art.
[0164] Preferably, (AA.sup.1).sub.c contains an amino acid sequence
("cleavage recognition sequence") that is a cleavage site by the
protease. Many protease cleavage sequences are known in the art.
See, e.g., Matayoshi et al. Science 247: 954 (1990); Dunn et al.
Meth. Enzymol. 241: 254 (1994); Seidah et al. Meth. Enzymol. 244:
175 (1994); Thornberry, Meth. Enzymol. 244: 615 (1994); Weber et
al. Meth. Enzymol. 244: 595 (1994); Smith et al. Meth. Enzymol.
244: 412 (1994); Bouvier et al. Meth. Enzymol. 248: 614 (1995),
Hardy et al., in Amyloid Protein Precursor in Development, Aging,
and Alzheimer's Disease, ed. Masters et al. pp. 190-198 (1994).
[0165] In a preferred embodiment, the peptide sequence
(AA.sup.1).sub.c is chosen based on its ability to be cleaved by a
lysosomal proteases, non-limiting examples of which include
cathepsins B, C, D, H, L and S. Preferably, the peptide sequence
(AA.sup.1).sub.c is capable of being cleaved by cathepsin B in
vitro.
[0166] In another embodiment, the peptide sequence (AA.sup.1).sub.c
is chosen based on its ability to be cleaved by a tumor-associated
protease, such as a protease that is found extracellularly in the
vicinity of tumor cells, examples of which include thimet
oligopeptidase (TOP) and CD10. In other embodiments, the sequence
(AA.sup.1).sub.c is designed for selective cleavage by urokinase or
tryptase.
[0167] Suitable, but non-limiting, examples of peptide sequences
suitable for use in the conjugates of the invention include
Val-Cit, Cit-Cit, Val-Lys, Phe-Lys, Lys-Lys, Ala-Lys, Phe-Cit,
Leu-Cit, Ile-Cit, Trp, Cit, Phe-Ala, Phe-N.sup.9-tosyl-Arg,
Phe-N.sup.9-nitro-Arg, Phe-Phe-Lys, D-Phe-Phe-Lys, Gly-Phe-Lys,
Leu-Ala-Leu, Ile-Ala-Leu, Val-Ala-Val, Ala-Leu-Ala-Leu (SEQ ID
NO:10), .beta.-Ala-Leu-Ala-Leu (SEQ ID NO:11) and Gly-Phe-Leu-Gly
(SEQ. ID NO: 9) Val-Ala, Leu-Leu-Gly-Leu (SEQ ID NO:12),
Leu-Asn-Ala, and Lys-Leu-Val. Preferred peptides sequences are
Val-Cit and Val-Lys.
[0168] In another embodiment, the amino acid located the closest to
the drug moiety is selected from the group consisting of: Ala, Asn,
Asp, Cit, Cys, Gln, Glu, Gly, Ile, Leu, Lys, Met, Phe, Pro, Ser,
Thr, Trp, Tyr, and Val. In yet another embodiment, the amino acid
located the closest to the drug moiety is selected from the group
consisting of: Ala, Asn, Asp, Cys, Gln, Glu, Gly, Ile, Leu, Met,
Phe, Pro, Ser, Thr, Trp, Tyr, and Val.
[0169] One of skill in the art can readily evaluate an array of
peptide sequences to determine their utility in the present
invention without resort to undue experimentation. See for example,
Zimmerman, M., et al., (1977) Analytical Biochemistry 78:47-51;
Lee, D., et al., (1999) Bioorganic and Medicinal Chemistry Letters
9:1667-72; and Rano, T. A., et al., (1997) Chemistry and Biology
4:149-55.
[0170] A conjugate of this invention may optionally contain two or
more linkers. These linkers may be the same or different. For
example, a peptidyl linker may be used to connect the drug to the
ligand and a second peptidyl linker may attach a diagnostic agent
to the complex. Other uses for additional linkers include linking
analytical agents, biomolecules, targeting agents, and detectable
labels to the antibody-partner complex.
Hydrazine Linkers (H)
[0171] In another embodiment, the conjugate of the invention
comprises a hydrazine self-immolative linker, wherein the conjugate
has the structure:
X.sup.4-(L.sup.4).sub.p-H-(L.sup.1).sub.m-D
wherein D, L.sup.1, L.sup.4, p, m, and X.sup.4 are as defined above
and described further herein, and H is a linker comprising the
structure:
##STR00012##
wherein n.sub.1 is an integer from 1-10; n.sub.2 is 0, 1, or 2;
each R.sup.24 is a member independently selected from the group
consisting of H, substituted alkyl, unsubstituted alkyl,
substituted heteroalkyl, and unsubstituted heteroalkyl; and I is
either a bond (i.e., the bond between the carbon of the backbone
and the adjacent nitrogen) or:
##STR00013##
wherein n.sub.3 is 0 or 1, with the proviso that when n.sub.3 is 0,
n.sub.2 is not 0; and n.sub.4 is 1, 2, or 3.
[0172] In one embodiment, the substitution on the phenyl ring is a
para substitution. In preferred embodiments, n.sub.1 is 2, 3, or 4
or n.sub.1 is 3. In preferred embodiments, n.sub.2 is 1. In
preferred embodiments, I is a bond (i.e., the bond between the
carbon of the backbone and the adjacent nitrogen). In one aspect,
the hydrazine linker, H, can form a 6-membered self immolative
linker upon cleavage, for example, when n.sub.3 is 0 and n.sub.4 is
2. In another aspect, the hydrazine linker, H, can form two
5-membered self immolative linkers upon cleavage. In yet other
aspects, H forms a 5-membered self immolative linker, H forms a
7-membered self immolative linker, or H forms a 5-membered self
immolative linker and a 6-membered self immolative linker, upon
cleavage. The rate of cleavage is affected by the size of the ring
formed upon cleavage. Thus, depending upon the rate of cleavage
desired, an appropriate size ring to be formed upon cleavage can be
selected.
[0173] Another hydrazine structure, H, has the formula:
##STR00014##
where q is 0, 1, 2, 3, 4, 5, or 6; and each R.sup.24 is a member
independently selected from the group consisting of H, substituted
alkyl, unsubstituted alkyl, substituted heteroalkyl, and
unsubstituted heteroalkyl. This hydrazine structure can also form
five-, six-, or seven-membered rings and additional components can
be added to form multiple rings.
[0174] The preparation, cleavage chemistry and cyclization kinetics
of the various hydrazine linkers is disclosed in WO 2005/112919,
the disclosure of which is incorporated herein by reference.
Disulfide Linkers (J)
[0175] In yet another embodiment, the linker comprises an
enzymatically cleavable disulfide group. In one embodiment, the
invention provides a cytotoxic antibody-partner compound having a
structure according to Formula (d):
x.sup.4 (L.sup.4).sub.p-J-(L.sup.1).sub.m D
wherein D, L.sup.1, L.sup.4, p, m, and X.sup.4 are as defined above
and described further herein, and J is a disulfide linker
comprising a group having the structure:
##STR00015##
wherein each R.sup.24 is a member independently selected from the
group consisting of H, substituted alkyl, unsubstituted alkyl,
substituted heteroalkyl, and unsubstituted heteroalkyl; each K is a
member independently selected from the group consisting of
substituted alkyl, unsubstituted alkyl, substituted heteroalkyl,
unsubstituted heteroalkyl, substituted aryl, unsubstituted aryl,
substituted heteroaryl, unsubstituted heteroaryl, substituted
heterocycloalkyl, unsubstituted heterocycloalkyl, halogen,
NO.sub.2, NR.sup.21R.sup.22, NR.sup.21cOR.sup.22,
OCONR.sup.21R.sup.22, OCOR.sup.21, and OR.sup.21 wherein R.sup.21
and R.sup.22 are independently selected from the group consisting
of H, substituted alkyl, unsubstituted alkyl, substituted
heteroalkyl, unsubstituted heteroalkyl, substituted aryl,
unsubstituted aryl, substituted heteroaryl, unsubstituted
heteroaryl, substituted heterocycloalkyl and unsubstituted
heterocycloalkyl; i is an integer of 0, 1, 2, 3, or 4; and d is an
integer of 0, 1, 2, 3, 4, 5, or 6.
[0176] The aromatic ring of the disulfides linker may be
substituted with one or more "K" groups. A "K" group is a
substituent on the aromatic ring that replaces a hydrogen otherwise
attached to one of the four non-substituted carbons that are part
of the ring structure. The "K" group may be a single atom, such as
a halogen, or may be a multi-atom group, such as alkyl,
heteroalkyl, amino, nitro, hydroxy, alkoxy, haloalkyl, and cyano.
Exemplary K substituents independently include, but are not limited
to, F, Cl, Br, I, NO.sub.2, OH, OCH.sub.3, NHCOCH.sub.3,
N(CH.sub.3).sub.2, NHCOCF.sub.3 and methyl. For "K.sub.i", i is an
integer of 0, 1, 2, 3, or 4. In a specific embodiment, i is 0.
[0177] In a preferred embodiment, the linker comprises an
enzymatically cleavable disulfide group of the following
formula:
##STR00016##
wherein L.sup.4, X.sup.4, p, and R.sup.24 are as described above,
and d is 0, 1, 2, 3, 4, 5, or 6. In a particular embodiment, d is 1
or 2.
[0178] A more specific disulfide linker is shown in the formula
below:
##STR00017##
[0179] Preferably, d is 1 or 2 and each K is H.
[0180] Another disulfide linker is shown in the formula below:
##STR00018##
[0181] Preferably, d is 1 or 2 and each K is H.
[0182] In various embodiments, the disulfides are ortho to the
amine. In another specific embodiment, a is 0. In preferred
embodiments, R.sup.24 is independently selected from H and
CH.sub.3.
[0183] The preparation and chemistry of disulfide linkers such as
those described above is disclosed in WO 2005/112919, the
disclosure of which is incorporated herein by reference.
[0184] Alternatively, the group L.sup.4 in formula (d) is absent
and a disulfide bond is formed directly with the cysteine
sulfhydryl of the C-terminal heavy chain extension.
[0185] For further discussion of types of cytotoxins, linkers and
other methods for conjugating therapeutic agents to antibodies, see
also U.S. Pat. No. 7,087,600; U.S. Pat. No. 6,989,452; U.S. Pat.
No. 7,129,261; U.S. Patent Publication No. 2006/0004081; U.S.
Patent Publication No. 2006/0247295; WO 02/096910; WO 2007/051081;
WO 2005/112919; WO 2007/059404; PCT application no.
PCT/US2007/089100; PCT application no. PCT/US2008/054362; Saito, G.
et al. (2003) Adv. Drug Deliv. Rev. 55:199-215; Trail, P.A. et al.
(2003) Cancer Immunol. Immunother. 52:328-337; Payne, G. (2003)
Cancer Cell 3:207-212; Allen, T. M. (2002) Nat. Rev. Cancer
2:750-763; Pastan, I. and Kreitman, R. J. (2002) Curr. Opin.
Investig. Drugs 3:1089-1091; Senter, P. D. and Springer, C. J.
(2001) Adv. Drug Deliv. Rev. 53:247-264, each of which is hereby
incorporated by reference in its entirety.
Cytotoxins as Partner Molecules
[0186] In one aspect, the present invention features an antibody
conjugated to a partner molecule, such as a cytotoxin, a drug
(e.g., an immunosuppressant) or a radiotoxin. Such conjugates are
also referred to as "immunotoxins." A cytotoxin or cytotoxic agent
includes any agent that is detrimental to (e.g., kills) cells.
[0187] Examples of partner molecules of the present invention
include taxol, cytochalasin B, gramicidin D, ethidium bromide,
emetine, mitomycin, etoposide, tenoposide, vincristine,
vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy
anthracin dione, mitoxantrone, mithramycin, actinomycin D,
1-dehydrotestosterone, glucocorticoids, procaine, tetracaine,
lidocaine, propranolol, and puromycin and analogs or homologs
thereof. Examples of partner molecules also include, for example,
antimetabolites (e.g., methotrexate, 6-mercaptopurine,
6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating
agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan,
carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan,
tubulysin, dibromomannitol, streptozotocin, mitomycin C, and
cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines
(e.g., daunorubicin (formerly daunomycin) and doxorubicin),
antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin,
mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g.,
vincristine and vinblastine).
[0188] Other preferred examples of partner molecules that can be
conjugated to an antibody of the invention include calicheamicins,
maytansines and auristatins, and derivatives thereof. A
calicheamicin antibody conjugate is commercially available
(Mylotarg.RTM.; American Home Products).
[0189] Preferred examples of partner molecule are analogs and
derivatives of CC-1065 and the structurally related duocarmycins.
Despite its potent and broad antitumor activity, CC-1065 cannot be
used in humans because it causes delayed death in experimental
animals, prompting a search for analogs or derivatives with a
better therapeutic index.
[0190] Many analogues and derivatives of CC-1065 and the
duocarmycins are known in the art. The research into the structure,
synthesis and properties of many of the compounds has been
reviewed. See, for example, Boger et al., Angew. Chem. Int. Ed.
Engl. 35: 1438 (1996); and Boger et al., Chem. Rev. 97: 787 (1997).
Other disclosures relating to CC-1065 analogs or derivatives
include: U.S. Pat. No. 5,101,038; U.S. Pat. No. 5,641,780; U.S.
Pat. No. 5,187,186; U.S. Pat. No. 5,070,092; U.S. Pat. No.
5,703,080; U.S. Pat. No. 5,070,092; U.S. Pat. No. 5,641,780; U.S.
Pat. No. 5,101,038; U.S. Pat. No. 5,084,468; U.S. Pat. No.
5,739,350; U.S. Pat. No. 4,978,757, U.S. Pat. No. 5,332,837 and
U.S. Pat. No. 4,912,227; WO 96/10405; and EP 0,537,575 A1
[0191] In a particularly preferred aspect, the partner molecule is
a CC-1065/duocarmycin analog having a structure according to the
following formula (e):
##STR00019##
in which ring system A is a member selected from substituted or
unsubstituted aryl substituted or unsubstituted heteroaryl and
substituted or unsubstituted heterocycloalkyl groups. Exemplary
ring systems A include phenyl and pyrrole.
[0192] The symbols E and G are independently selected from H,
substituted or unsubstituted alkyl, substituted or unsubstituted
heteroalkyl, a heteroatom, a single bond or E and G are optionally
joined to form a ring system selected from substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl and
substituted or unsubstituted heterocycloalkyl.
[0193] The symbol X represents a member selected from O, S and
NR.sup.23. R.sup.23 is a member selected from H, substituted or
unsubstituted alkyl, substituted or unsubstituted heteroalkyl, and
acyl.
[0194] The symbol R.sup.3 represents a member selected from
(.dbd.O), SR.sup.11, NHR.sup.11 and OR.sup.11, in which R.sup.11 is
H, substituted or unsubstituted alkyl, substituted or unsubstituted
heteroalkyl, monophosphates, diphosphates, triphosphates,
sulfonates, acyl, C(O)R.sup.12R.sup.13, C(O)OR.sup.12,
C(O)NR.sup.12R.sup.13, P(O)(OR.sup.12).sub.2,
C(O)CHR.sup.12R.sup.13, SR.sup.12 or SiR.sup.12R.sup.13R.sup.14.
The symbols R.sup.12, R.sup.13, and R.sup.14 independently
represent H, substituted or unsubstituted alkyl, substituted or
unsubstituted heteroalkyl and substituted or unsubstituted aryl,
where R.sup.12 and R.sup.13 together with the nitrogen or carbon
atom to which they are attached are optionally joined to form a
substituted or unsubstituted heterocycloalkyl ring system having
from 4 to 6 members, optionally containing two or more
heteroatoms.
[0195] R.sup.4, R.sup.4', R.sup.5 and R.sup.5' are members
independently selected from H, substituted or unsubstituted alkyl,
substituted or unsubstituted aryl, substituted or unsubstituted
heteroaryl, substituted or unsubstituted heterocycloalkyl, halogen,
NO.sub.2, NR.sup.15R.sup.16, NC(O)R.sup.15, OC(O)NR.sup.15R.sup.16,
OC(O)OR.sup.15, C(O)R.sup.15, SR.sup.15, OR.sup.15,
CR.sup.15.dbd.NR.sup.16, and O(CH.sub.2).sub.nN(CH.sub.3).sub.2,
where n is an integer from 1 to 20, or any adjacent pair of
R.sup.4, R.sup.4', R.sup.5 and R.sup.5', together with the carbon
atoms to which they are attached, are joined to form a substituted
or unsubstituted cycloalkyl or heterocycloalkyl ring system having
from 4 to 6 members. R.sup.15 and R.sup.16 independently represent
H, substituted or unsubstituted alkyl, substituted or unsubstituted
heteroalkyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, substituted or unsubstituted
heterocycloalkyl and substituted or unsubstituted peptidyl, where
R.sup.15 and R.sup.16 together with the nitrogen atom to which they
are attached are optionally joined to form a substituted or
unsubstituted heterocycloalkyl ring system having from 4 to 6
members, optionally containing two or more heteroatoms. One
exemplary structure is aniline.
[0196] One of R.sup.3, R.sup.4, R.sup.4', R.sup.5, and R.sup.5'
joins the cytotoxin to a linker or enzyme cleavable substrate of
the present invention, as described herein, for example to L.sup.1
or L.sup.3, if present or to F, H, or J.
[0197] R.sup.6 is a single bond which is either present or absent.
When R.sup.6 is present, R.sup.6 and R.sup.7 are joined to form a
cyclopropyl ring. R.sup.7 is CH.sub.2--X.sup.1 or --CH.sub.2--.
When R.sup.7 is --CH.sub.2-- it is a component of the cyclopropane
ring. The symbol X.sup.1 represents a leaving group such as a
halogen, for example Cl, Br or F. The combinations of R.sup.6 and
R.sup.7 are interpreted in a manner that does not violate the
principles of chemical valence.
[0198] X.sup.1 may be any leaving group. Useful leaving groups
include, but are not limited to, halogens, azides, sulfonic esters
(e.g., alkylsulfonyl, arylsulfonyl), oxonium ions, alkyl
perchlorates, ammonioalkanesulfonate esters, alkylfluorosulfonates
and fluorinated compounds (e.g., triflates, nonaflates, tresylates)
and the like. Particular halogens useful as leaving groups are F,
Cl and Br.
[0199] The curved line within the six-membered ring indicates that
the ring may have one or more degrees of unsaturation, and it may
be aromatic. Thus, ring structures such as those set forth below,
and related structures, are within the scope of Formula (f):
##STR00020##
[0200] In one embodiment, R.sup.11 includes a moiety, X.sup.5, that
does not self-cyclize and links the drug to L.sup.1 or L.sup.3, if
present, or to F, H, or J. The moiety, X.sup.5, is preferably
cleavable using an enzyme and, when cleaved, provides the active
drug. As an example, R.sup.11 can have the following structure
(with the right side coupling to the remainder of the drug):
##STR00021##
[0201] In some embodiments, at least one of R.sup.4, R.sup.4',
R.sup.5, and R.sup.5' links said drug to L.sup.1, if present, or to
F, H, J, or X.sup.2, and R.sup.3 is selected from SR.sup.11,
NHR.sup.11 and OR.sup.11. R.sup.11 is selected from --SO(OH).sub.2,
--PO(OH).sub.2, -AA.sub.n, --Si(CH.sub.3).sub.2C(CH.sub.3).sub.3,
--C(O)OPhNH(AA).sub.m,
##STR00022##
or any other sugar or combination of sugars
##STR00023##
and pharmaceutically acceptable salts thereof, where n is any
integer in the range of 1 to 10, m is any integer in the range of 1
to 4, p is any integer in the range of 1 to 6, and AA is any
natural or non-natural amino acid. Where the compound of formula
(e) is conjugated via R.sup.4, R.sup.4', R.sup.5, or R.sup.6,
R.sup.3 preferably comprises a cleavable blocking group whose
presence blocks the cytotoxic activity of the compound but is
cleavable under conditions found at the intended site of action by
a mechanism different from that for cleavage of the linker
conjugating the cytotoxin to the antibody. In this way, if there is
adventitiouis cleavage of the conjugate in the plasma, the blocking
group attenuates the cytotoxicity of the released cytotoxin. For
instance, if the conjugate has a hydrazone or disulfide linker, the
blocking group can be an enzymatically cleavable amide. Or, if the
linker is a peptidyl one cleavable by a protease, the blocking
group can be an ester or carbamate cleavable by a
carboxyesterase.
[0202] For example, in a preferred embodiment, D is a cytotoxin
having a structure (j):
##STR00024##
[0203] In this structure, R.sup.3, R.sup.6, R.sup.7, R.sup.5,
R.sup.5' and X are as described above for Formula (e). Z is a
member selected from O, S and NR.sup.23, where R.sup.23 is a member
selected from H, substituted or unsubstituted alkyl, substituted or
unsubstituted heteroalkyl, and acyl.
[0204] R.sup.1 is H, substituted or unsubstituted lower alkyl,
C(O)R.sup.8, or CO.sub.2R.sup.8, wherein R.sup.8 is a member
selected from NR.sup.9R.sup.10 and OR.sup.9, in which R.sup.9 and
R.sup.10 are members independently selected from H, substituted or
unsubstituted alkyl and substituted or unsubstituted
heteroalkyl.
[0205] R.sup.1' is H, substituted or unsubstituted lower alkyl, or
C(O)R.sup.8, wherein R.sup.8 is a member selected from
NR.sup.9R.sup.10 and OR.sup.9, in which R.sup.9 and R.sup.10 are
members independently selected from H, substituted or unsubstituted
alkyl and substituted or unsubstituted heteroalkyl.
[0206] R.sup.2 is H, or substituted or unsubstituted lower alkyl or
unsubstituted heteroalkyl or cyano or alkoxy; and R.sup.2' is H, or
substituted or unsubstituted lower alkyl or unsubstituted
heteroalkyl.
[0207] One of R.sup.3, R.sup.4, R.sup.4', R.sup.5, or R.sup.5'
links the cytotoxin to L.sup.1 or L.sup.3, if present, or to F, H,
or.
[0208] A further embodiment has the formula:
##STR00025##
[0209] In this structure, A, R.sup.6, R.sup.7, X, R.sup.4,
R.sup.4', R.sup.5, and R.sup.5' are as described above for Formula
(e). Z is a member selected from O, S and NR.sup.23, where R.sup.23
is a member selected from H, substituted or unsubstituted alkyl,
substituted or unsubstituted heteroalkyl, and acyl;
[0210] R.sup.34 is C(.dbd.O)R.sup.33 or C.sub.1-C.sub.6 alkyl,
where R.sup.33 is selected from H, substituted or unsubstituted
alkyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, substituted or unsubstituted
heterocycloalkyl, halogen, NO.sub.2, NR.sup.15R.sup.16,
NC(O)R.sup.15, OC(O)NR.sup.15R.sup.16, OC(O)OR.sup.15,
C(O)R.sup.15, SR.sup.15, OR.sup.15, CR.sup.15.dbd.NR.sup.16, and
O(CH.sub.2).sub.nN(CH.sub.3).sub.2, where n is an integer from 1 to
20. R.sup.15 and R.sup.16 independently represent H, substituted or
unsubstituted alkyl, substituted or unsubstituted heteroalkyl,
substituted or unsubstituted aryl, substituted or unsubstituted
heteroaryl, substituted or unsubstituted heterocycloalkyl and
substituted or unsubstituted peptidyl, where R.sup.15 and R.sup.16
together with the nitrogen atom to which they are attached are
optionally joined to form a substituted or unsubstituted
heterocycloalkyl ring system having from 4 to 6 members, optionally
containing two or more heteroatoms.
[0211] Preferably, A is substituted or unsubstituted phenyl or
substituted or unsubstituted pyrrole. Moreover, any selection of
substituents described herein for R.sup.11 is also applicable to
R.sup.33.
Markers as Partner Molecules
[0212] Where the partner molecule is a marker, it can be any moiety
having or generating a detectable physical or chemical property,
thereby indicating its presence in a particular tissue or cell.
Markers (sometimes also called reporter groups) have been well
developed in the area of immunoassays, biomedical research, and
medical diagnosis. A marker may be detected by spectroscopic,
photochemical, biochemical, immunochemical, electrical, optical or
chemical means. Examples include magnetic beads (e.g.,
DYNABEADS.TM.), fluorescent dyes (e.g., fluorescein isothiocyanate,
Texas red, rhodamine, and the like), radiolabels (e.g., .sup.3H,
.sup.125I, .sup.35S, .sup.14C, or .sup.32P), enzymes (e.g., horse
radish peroxidase, alkaline phosphatase and others commonly used in
an ELISA), and colorimetric labels such as colloidal gold or
colored glass or plastic beads (e.g., polystyrene, polypropylene,
latex, etc.).
[0213] The marker is preferably a member selected from the group
consisting of radioactive isotopes, fluorescent agents, fluorescent
agent precursors, chromophores, enzymes and combinations thereof.
Examples of suitable enzymes are horseradish peroxidase, alkaline
phosphatase, .beta.-galactosidase, and glucose oxidase. Fluorescent
agents include fluorescein and its derivatives, rhodamine and its
derivatives, dansyl, umbelliferone, etc. Chemiluminescent compounds
include luciferin, and 2,3-dihydrophthalazinediones, e.g., luminol.
For a review of various labeling or signal producing systems that
may be used, see, U.S. Pat. No. 4,391,904.
[0214] Markers can be attached by indirect means: a ligand molecule
(e.g., biotin) is covalently bound to an antibody. The ligand then
binds to another molecule (e.g., streptavidin), which is either
inherently detectable or covalently bound to a signal system, such
as a detectable enzyme, a fluorescent compound, or a
chemiluminescent compound.
Examples of Conjugates
[0215] Specific examples of partner molecule-linker combinations
suitable for conjugation to an antibody of this invention are shown
following:
##STR00026## ##STR00027## ##STR00028## ##STR00029## ##STR00030##
##STR00031## ##STR00032## ##STR00033##
[0216] In the foregoing compounds, where the subscript r is present
in a formula, it is an integer in the range of 0 to 24. R, wherever
it occurs, is
##STR00034##
[0217] Each of the foregoing compounds has a maleimide group and is
ready for conjugation to an antibody via a cysteine sulfhydryl
group on the C-terminal heavy chain extension.
Nucleic Acid Molecules Encoding Antibodies of the Invention
[0218] Another aspect of the invention pertains to nucleic acid
molecules that encode the antibodies of the invention. The nucleic
acids may be present in whole cells, in a cell lysate, or in a
partially purified or substantially pure form. A nucleic acid is
"isolated" or "rendered substantially pure" when purified away from
other cellular components or other contaminants, e.g., other
cellular nucleic acids or proteins, by standard techniques,
including alkaline/SDS treatment, CsCl banding, column
chromatography, agarose gel electrophoresis and others well known
in the art. See, F. Ausubel, et al., ed. (1987) Current Protocols
in Molecular Biology, Greene Publishing and Wiley Interscience, New
York. A nucleic acid of the invention can be, for example, DNA or
RNA and may or may not contain intronic sequences. In a preferred
embodiment, the nucleic acid is a cDNA molecule.
[0219] Nucleic acids of the invention can be obtained using
standard molecular biology techniques. For antibodies expressed by
hybridomas (e.g., hybridomas prepared from transgenic mice carrying
human immunoglobulin genes as described further below), cDNAs
encoding the light and heavy chains of the antibody made by the
hybridoma can be obtained by standard PCR amplification or cDNA
cloning techniques. For antibodies obtained from an immunoglobulin
gene library (e.g., using phage display techniques), nucleic acid
encoding the antibody can be recovered from the library.
[0220] Once nucleic acids encoding a heavy chain of the antibody of
interest is obtained, these nucleic acids can be further
manipulated by standard recombinant DNA techniques. For example,
well known site directed mutagenesis techniques, such as those
described in the examples below, can be employed to introduce a
cysteine to the C-terminus of the heavy chain of the antibody.
Introduction of the cysteine can occur at the original C-terminal
position of the heavy chain, or can occur by the incorporation of
an extension to the original C-terminus of the heavy chain. Unless
specified otherwise, a C-terminal extension is not limited so long
as it contains a cysteine residue and allows for the conjugation to
a partner molecule.
[0221] In certain embodiments, the C-terminal extensions will
include, or consist of, a peptide that includes a cysteine residue.
In preferred embodiments, the C-terminal extension peptides will be
selected such that they do not act as protease substrates.
Furthermore, the C-terminal extension peptides can be
preferentially selected so as to not be immunogenic or antigenic to
the intended recipient. In such embodiments the peptide will
contain from about 1 amino acid to about 20 amino acids, with
extensions of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10 amino acids being
preferred. Such extensions preferably comprise, in addition to at
least one cysteine residue, neutral amino acids with small side
chains suc as alanine, glycine, valine, leucine, isoleucine, and
methionine. In preferred embodiments, the C-terminal extension
contains an amino acid sequence motif selected from a group
comprising C, CX, XC, CXX, XCX, XXC, CXXX, XCXX, XXCX, XXXC, CXXXX,
XCXXX, XXCXX, XXXCX, or XXXXC, wherein X is a cysteine residue or a
neutral amino acid with a small side chain.
[0222] In one embodiment, the C-terminal extension is Cys-Ala-Ala.
In another embodiment, the C-terminal extension is Cys-Cys-Ala-Ala
(SEQ ID NO:9). In another embodiment, the C-terminal extension is
Ala-Ala-Cys-Ala-Ala (SEQ ID NO:7). In another embodiment, the
C-terminal extension is Gly-Gly-Gly-Gly-Ser-Cys-Ala-Ala (SEQ ID
NO:8).
Production of Monoclonal Antibodies
[0223] Monoclonal antibodies (mAbs) of the present invention can be
produced by a variety of techniques, including conventional
monoclonal antibody methodology e.g., the standard somatic cell
hybridization technique of Kohler and Milstein (1975) Nature 256:
495. Although somatic cell hybridization procedures are preferred,
in principle, other techniques for producing monoclonal antibody
can be employed e.g., viral or oncogenic transformation of B
lymphocytes.
[0224] The preferred animal system for preparing hybridomas is the
murine system. Hybridoma production in the mouse is a very
well-established procedure. Immunization protocols and techniques
for isolation of immunized splenocytes for fusion are known in the
art. Fusion partners (e.g., murine myeloma cells) and fusion
procedures are also known.
[0225] Chimeric or humanized antibodies of the present invention
can be prepared based on the sequence of a non-human monoclonal
antibody prepared as described above. DNA encoding the heavy and
light chain immunoglobulins can be obtained from the non-human
hybridoma of interest and engineered to contain non-murine (e.g.,
human) immunoglobulin sequences using standard molecular biology
techniques. For example, to create a chimeric antibody, murine
variable regions can be linked to human constant regions using
methods known in the art (see e.g., U.S. Pat. No. 4,816,567 to
Cabilly et al.). To create a humanized antibody, murine CDR regions
can be inserted into a human framework using methods known in the
art (see e.g., U.S. Pat. No. 5,225,539 to Winter, and U.S. Pat.
Nos. 5,530,101; 5,585,089; 5,693,762 and 6,180,370 to Queen et
al.).
[0226] In a preferred embodiment, the antibodies of the invention
are human monoclonal antibodies. Such human monoclonal antibodies
directed against potential targets can be generated using
transgenic or transchromosomic mice carrying parts of the human
immune system rather than the mouse system. These transgenic and
transchromosomic mice include mice referred to herein as the HuMAb
Mouse.RTM. and KM Mouse.RTM., respectively, and are collectively
referred to herein as "human Ig mice."
[0227] The HuMAb Mouse.RTM. (Medarex.RTM., Inc.) contains human
immunoglobulin gene miniloci that encode unrearranged human heavy
(.mu. and .gamma.) and .kappa. light chain immunoglobulin
sequences, together with targeted mutations that inactivate the
endogenous .mu. and .kappa. chain loci (see e.g., Lonberg, et al.
(1994) Nature 368(6474): 856-859). Accordingly, the mice exhibit
reduced expression of mouse IgM or .kappa., and in response to
immunization, the introduced human heavy and light chain transgenes
undergo class switching and somatic mutation to generate high
affinity human IgG.kappa. monoclonal antibodies (Lonberg, N. et al.
(1994), supra; reviewed in Lonberg, N. (1994) Handbook of
Experimental Pharmacology 113:49-101; Lonberg, N. and Huszar, D.
(1995) Intern. Rev. Immunol. 13: 65-93, and Harding, F. and
Lonberg, N. (1995) Ann. N.Y. Acad. Sci. 764:536-546). Preparation
and use of the HuMAb Mouse.RTM., and the genomic modifications
carried by such mice, is further described in Taylor, L. et al.
(1992) Nucleic Acids Research 20:6287-6295; Chen, J. et al. (1993)
International Immunology 5: 647-656; Tuaillon et al. (1993) Proc.
Natl. Acad. Sci. USA 90:3720-3724; Choi et al. (1993) Nature
Genetics 4:117-123; Chen, J. et al. (1993) EMBO J. 12: 821-30;
Tuaillon et al. (1994) J. Immunol. 152:2912-2920; Taylor, L. et al.
(1994) International Immunology 6: 579-591; and Fishwild, D. et al.
(1996) Nature Biotechnology 14: 845-851, the contents of all of
which are hereby specifically incorporated by reference in their
entirety. See further, U.S. Pat. Nos. 5,545,806; 5,569,825;
5,625,126; 5,633,425; 5,789,650; 5,877,397; 5,661,016; 5,814,318;
5,874,299; and 5,770,429; all to Lonberg and Kay; U.S. Pat. No.
5,545,807 to Surani et al.; PCT Publication Nos. WO 92/03918, WO
93/12227, WO 94/25585, WO 97/13852, WO 98/24884 and WO 99/45962,
all to Lonberg and Kay; and PCT Publication No. WO 01/14424 to
Korman et al., each of which is also incorporated by reference.
[0228] In another embodiment, human antibodies of the invention can
be raised using a mouse that carries human immunoglobulin sequences
on transgenes and transchomosomes, such as a mouse that carries a
human heavy chain transgene and a human light chain
transchromosome. This mouse is referred to herein as a "KM
Mouse.RTM.," and is described in detail in PCT Publication WO
02/43478 to Ishida et al.
[0229] Still further, alternative transgenic animal systems
expressing human immunoglobulin genes are available in the art and
can be used to raise the antibodies of the invention. For example,
an alternative transgenic system referred to as the Xenomouse
(Amgen, Inc.) can be used; such mice are described in, for example,
U.S. Pat. Nos. 5,939,598; 6,075,181; 6,114,598; 6,150,584 and
6,162,963 to Kucherlapati et al.
[0230] Moreover, alternative transchromosomic animal systems
expressing human immunoglobulin genes are available in the art and
can be used to raise antibodies to the target of choice. For
example, mice carrying both a human heavy chain transchromosome and
a human light chain tranchromosome, referred to as "TC mice" can be
used; such mice are described in Tomizuka et al. (2000) Proc. Natl.
Acad. Sci. USA 97:722-727. Furthermore, cows carrying human heavy
and light chain transchromosomes have been described in the art
(Kuroiwa et al. (2002) Nature Biotechnology 20:889-894) and PCT
application No. WO/2002/092812 and can be used to raise antibodies
of the invention.
[0231] Human monoclonal antibodies of the invention can also be
prepared using phage display methods for screening libraries of
human immunoglobulin genes. Such phage display methods for
isolating human antibodies are established in the art. See for
example: U.S. Pat. Nos. 5,223,409; 5,403,484; and 5,571,698 to
Ladner et al.; U.S. Pat. Nos. 5,427,908 and 5,580,717 to Dower et
al.; U.S. Pat. Nos. 5,969,108 and 6,172,197 to McCafferty et al.;
and U.S. Pat. Nos. 5,885,793; 6,521,404; 6,544,731; 6,555,313;
6,582,915 and 6,593,081 to Griffiths et al.
[0232] Human monoclonal antibodies of the invention can also be
prepared using SCID mice into which human immune cells have been
reconstituted such that a human antibody response can be generated
upon immunization. Such mice are described in, for example, U.S.
Pat. Nos. 5,476,996 and 5,698,767 to Wilson et al.
[0233] Immunization of Human Ig Mice
[0234] When human Ig mice are used to raise human antibodies of the
invention, such mice can be immunized with a purified or enriched
preparation of target antigen and/or recombinant target protein, or
cells expressing the target protein, or a target fusion protein, as
described by Lonberg, N. et al. (1994) Nature 368(6474): 856 859;
Fishwild, D. et al. (1996) Nature Biotechnology 14: 845-851; and
PCT Publication WO 98/24884 and WO 01/14424. Preferably, the mice
will be 6-16 weeks of age upon the first infusion. For example, a
purified or recombinant preparation (5-50 t.tg) of target antigen
can be used to immunize the human Ig mice intraperitoneally.
[0235] Cumulative experience with various antigens has shown that
the transgenic mice respond when initially immunized
intraperitoneally (IP) with antigen in complete Freund's adjuvant,
followed by every other week IP immunizations (up to a total of 6)
with antigen in incomplete Freund's adjuvant. However, adjuvants
other than Freund's are also found to be effective. In addition,
whole cells in the absence of adjuvant are found to be highly
immunogenic. The immune response can be monitored over the course
of the immunization protocol with plasma samples being obtained by
retroorbital bleeds. The plasma can be screened by ELISA (as
described below), and mice with sufficient titers of anti-target
human immunoglobulin can be used for fusions. Mice can be boosted
intravenously with antigen 3 days before sacrifice and removal of
the spleen. It is expected that 2-3 fusions for each immunization
may need to be performed. Between 6 and 24 mice are typically
immunized for each antigen. Usually both HCo7 and HCo12 strains are
used. In addition, both HCo7 and HCo12 transgene can be bred
together into a single mouse having two different human heavy chain
transgenes (HCo7/HCo12). Alternatively or additionally, the KM
Mouse.RTM. strain can be used.
Generation of Hybridomas Producing Human Monoclonal Antibodies
[0236] To generate hybridomas producing human monoclonal antibodies
of the invention, splenocytes and/or lymph node cells from
immunized mice can be isolated and fused to an appropriate
immortalized cell line, such as a mouse myeloma cell line. The
resulting hybridomas can be screened for the production of
antigen-specific antibodies. For example, single cell suspensions
of splenic lymphocytes from immunized mice can be fused to
one-sixth the number of P3X63-Ag8.653 nonsecreting mouse myeloma
cells (ATCC, CRL 1580) with 50% PEG. Alternatively, the single cell
suspension of splenic lymphocytes from immunized mice can be fused
using an electric field based electrofusion method, using a
CytoPulse large chamber cell fusion electroporator (CytoPulse
Sciences, Inc., Glen Burnie Md.). Cells are plated at approximately
2.times.105 in flat bottom microtiter plate, followed by a two week
incubation in selective medium containing 20% fetal Clone Serum,
18% "653" conditioned media, 5% origen (IGEN), 4 mM L-glutamine, 1
mM sodium pyruvate, 5 mM HEPES, 0.055 mM 2 mercaptoethanol, 50
units/ml penicillin, 50 mg/ml streptomycin, 50 mg/ml gentamycin and
1.times.HAT (Sigma; the HAT is added 24 hours after the fusion).
After approximately two weeks, cells can be cultured in medium in
which the HAT is replaced with HT. Individual wells can then be
screened by ELISA for human monoclonal IgM and IgG antibodies. Once
extensive hybridoma growth occurs, medium can be observed usually
after 10-14 days. The antibody secreting hybridomas can be
replated, screened again, and if still positive for human IgG, the
monoclonal antibodies can be subcloned at least twice by limiting
dilution. The stable subclones can then be cultured in vitro to
generate small amounts of antibody in tissue culture medium for
characterization.
[0237] To purify human monoclonal antibodies, selected hybridomas
can be grown in two-liter spinner-flasks for monoclonal antibody
purification. Supernatants can be filtered and concentrated before
affinity chromatography with protein A-sepharose (Pharmacia,
Piscataway, N.J.). Eluted IgG can be checked by gel electrophoresis
and high performance liquid chromatography to ensure purity. The
buffer solution can be exchanged into PBS, and the concentration
can be determined by OD280 using 1.43 extinction coefficient. The
monoclonal antibodies can be aliquoted and stored at -80.degree.
C.
Generation of Transfectomas Producing Monoclonal Antibodies
[0238] Antibodies of the invention also can be produced in a host
cell transfectoma using, for example, a combination of recombinant
DNA techniques and gene transfection methods as is well known in
the art (e.g., Morrison, S. (1985) Science 229:1202).
[0239] For example, to express the antibodies, or antibody
fragments thereof, DNAs encoding partial or full-length light and
heavy chains, can be obtained by standard molecular biology
techniques (e.g., PCR amplification or cDNA cloning using a
hybridoma that expresses the antibody of interest) and the DNAs can
be inserted into expression vectors such that the genes are
operatively linked to transcriptional and translational control
sequences. In this context, the term "operatively linked" is
intended to mean that an antibody gene is ligated into a vector
such that transcriptional and translational control sequences
within the vector serve their intended function of regulating the
transcription and translation of the antibody gene. The expression
vector and expression control sequences are chosen to be compatible
with the expression host cell used. The antibody light chain gene
and the antibody heavy chain gene can be inserted into separate
vector or, more typically, both genes are inserted into the same
expression vector. The antibody genes are inserted into the
expression vector by standard methods (e.g., ligation of
complementary restriction sites on the antibody gene fragment and
vector, or blunt end ligation if no restriction sites are present).
The light and heavy chain variable regions of the antibodies
described herein can be used to create full-length antibody genes
of any antibody isotype by inserting them into expression vectors
already encoding heavy chain constant and light chain constant
regions of the desired isotype such that the VH segment is
operatively linked to the CH segment(s) within the vector and the
VK segment is operatively linked to the CL segment within the
vector. Additionally or alternatively, the recombinant expression
vector can encode a signal peptide that facilitates secretion of
the antibody chain from a host cell. The antibody chain gene can be
cloned into the vector such that the signal peptide is linked
in-frame to the amino terminus of the antibody chain gene. The
signal peptide can be an immunoglobulin signal peptide or a
heterologous signal peptide (i.e., a signal peptide from a
non-immunoglobulin protein).
[0240] In addition to the antibody chain genes, the recombinant
expression vectors of the invention carry regulatory sequences that
control the expression of the antibody chain genes in a host cell.
The term "regulatory sequence" is intended to include promoters,
enhancers and other expression control elements (e.g.,
polyadenylation signals) that control the transcription or
translation of the antibody chain genes. Such regulatory sequences
are described, for example, in Goeddel (Gene Expression Technology.
Methods in Enzymology 185, Academic Press, San Diego, Calif.
(1990)). It will be appreciated by those skilled in the art that
the design of the expression vector, including the selection of
regulatory sequences, may depend on such factors as the choice of
the host cell to be transformed, the level of expression of protein
desired, etc. Preferred regulatory sequences for mammalian host
cell expression include viral elements that direct high levels of
protein expression in mammalian cells, such as promoters and/or
enhancers derived from cytomegalovirus (CMV), Simian Virus 40
(SV40), adenovirus, (e.g., the adenovirus major late promoter
(AdMLP) and polyoma. Alternatively, nonviral regulatory sequences
may be used, such as the ubiquitin promoter or .beta.-globin
promoter. Still further, regulatory elements composed of sequences
from different sources, such as the SR.alpha. promoter system,
which contains sequences from the SV40 early promoter and the long
terminal repeat of human T cell leukemia virus type 1 (Takebe, Y.
et al. (1988) Mol. Cell. Biol. 8:466-472).
[0241] In addition to the antibody chain genes and regulatory
sequences, the recombinant expression vectors of the invention may
carry additional sequences, such as sequences that regulate
replication of the vector in host cells (e.g., origins of
replication) and selectable marker genes. The selectable marker
gene facilitates selection of host cells into which the vector has
been introduced (see, e.g., U.S. Pat. Nos. 4,399,216, 4,634,665 and
5,179,017, all by Axel et al.). For example, typically the
selectable marker gene confers resistance to drugs, such as G418,
hygromycin or methotrexate, on a host cell into which the vector
has been introduced. Preferred selectable marker genes include the
dihydrofolate reductase (DHFR) gene (for use in dhfr-host cells
with methotrexate selection/amplification) and the neo gene (for
G418 selection).
[0242] For expression of the light and heavy chains, the expression
vector(s) encoding the heavy and light chains is transfected into a
host cell by standard techniques. The various forms of the term
"transfection" are intended to encompass a wide variety of
techniques commonly used for the introduction of exogenous DNA into
a prokaryotic or eukaryotic host cell, e.g., electroporation,
calcium-phosphate precipitation, DEAE-dextran transfection and the
like. Although it is theoretically possible to express the
antibodies of the invention in either prokaryotic or eukaryotic
host cells, expression of antibodies in eukaryotic cells, and most
preferably mammalian host cells, is the most preferred because such
eukaryotic cells, and in particular mammalian cells, are more
likely than prokaryotic cells to assemble and secrete a properly
folded and immunologically active antibody. Prokaryotic expression
of antibody genes has been reported to be ineffective for
production of high yields of active antibody (Boss, M. A. and Wood,
C. R. (1985) Immunology Today 6:12-13).
[0243] Preferred mammalian host cells for expressing the
recombinant antibodies of the invention include Chinese Hamster
Ovary (CHO cells) (including dhfr-CHO cells, described in Urlaub
and ChasM, (1980) Proc. Natl. Acad. Sci. USA 77:4216-4220, used
with a DHFR selectable marker, e.g., as described in R. J. Kaufman
and P. A. Sharp (1982) J. Mol. Biol. 159:601-621), NSO myeloma
cells, COS cells and SP2 cells. In particular, for use with NSO
myeloma cells, another preferred expression system is the GS gene
expression system disclosed in WO 87/04462 (to Wilson), WO 89/01036
(to Bebbington) and EP 338,841 (to Bebbington). When recombinant
expression vectors encoding antibody genes are introduced into
mammalian host cells, the antibodies are produced by culturing the
host cells for a period of time sufficient to allow for expression
of the antibody in the host cells or, more preferably, secretion of
the antibody into the culture medium in which the host cells are
grown. Antibodies can be recovered from the culture medium using
standard protein purification methods.
Bispecific Molecules
[0244] In another aspect, the present invention features bispecific
molecules comprising an antibody of the invention. An antibody of
the invention, or antigen-binding portions thereof, can be
derivatized or linked to another functional molecule, e.g., another
peptide or protein (e.g., another antibody or ligand for a
receptor) to generate a bispecific molecule that binds to at least
two different binding sites or target molecules. The antibody of
the invention may in fact be derivatized or linked to more than one
other functional molecule to generate multispecific molecules that
bind to more than two different binding sites and/or target
molecules; such multispecific molecules are also intended to be
encompassed by the term "bispecific molecule" as used herein. To
create a bispecific molecule of the invention, an antibody of the
invention can be functionally linked (e.g., by chemical coupling,
genetic fusion, noncovalent association or otherwise) to one or
more other binding molecules, such as another antibody, antibody
fragment, peptide or binding mimetic, such that a bispecific
molecule results.
[0245] Accordingly, the present invention includes bispecific
molecules comprising at least one first binding specificity for a
first and a second binding specificity for a second target epitope.
In a particular embodiment of the invention, the second target
epitope is an Fc receptor, e.g., human Fc*RI (CD64) or a human Fca
receptor (CD89). Therefore, the invention includes bispecific
molecules capable of binding both to Fc*R or Fc.alpha.R expressing
effector cells (e.g., monocytes, macrophages or polymorphonuclear
cells (PMNs)), and to target cells expressing the first target.
These bispecific molecules target the first target expressing cells
to effector cell and trigger Fc receptor-mediated effector cell
activities, such as phagocytosis of first target expressing cells,
antibody dependent cell-mediated cytotoxicity (ADCC), cytokine
release, or generation of superoxide anion.
[0246] In another approach, the conjugates of the present invention
are employed in a two-step targeting method. (Kraeber-Bodere et
al., Journal of Nuclear Medicine Vol. 47 No. 2 247-255 (2006); Saga
et al., Cancer Research, 54, 2160-2165 (1994) both of which are
hereby incorporated by reference in their entirety). In exemplary
embodiments of this approach, the antibody of the antibody-partner
conjugate functions to target the conjugate to a specific location
via its binding specificity. The second step is achieved by
introducing a binding molecule specific for the partner molecule of
the antibody-partner conjungate. In such embodiments, high affinity
binding systems, e.g., avidin-biotin, are employed as the partner
molecule/binding molecule. In exemplary embodiments, the binding
molecule specific for the partner molecule is conjugated to a
radioisotope, toxin, marker, or theraputic agent.
[0247] In another approach, referred to as antibody-directed enzyme
prodrug therapy (ADEPT), an enzyme is attached to an antibody
specific for a tumor antigen, to thereby direct the enzyme to the
site of tumor cells. The drug is then conjugated to a substrate
cleavable by the enzyme attached to the tumor-specific antibody.
Thus, these drug-cleavable substrate conjugates have tumor
specificity arising from the localization of the enzyme at the site
of tumor cells through the attachment of the enzyme to the
tumor-specific antibody.
[0248] In an embodiment of the invention in which the bispecific
molecule is multispecific, the molecule can further include a third
binding specificity, in addition to an anti-Fc binding specificity
and a first target binding specificity. In one embodiment, the
third binding specificity is an anti-enhancement factor (EF)
portion, e.g., a molecule which binds to a surface protein involved
in cytotoxic activity and thereby increases the immune response
against the target cell. The "anti-enhancement factor portion" can
be an antibody, functional antibody fragment or a ligand that binds
to a given molecule, e.g., an antigen or a receptor, and thereby
results in an enhancement of the effect of the binding determinants
for the Fc receptor or target cell antigen. The "anti-enhancement
factor portion" can bind an Fc receptor or a target cell antigen.
Alternatively, the anti-enhancement factor portion can bind to an
entity that is different from the entity to which the first and
second binding specificities bind. For example, the
anti-enhancement factor portion can bind a cytotoxic T-cell (e.g.
via CD2, CD3, CD8, CD28, CD4, CD40, ICAM-1 or other immune cell
that results in an increased immune response against the target
cell).
[0249] In one embodiment, the bispecific molecules of the invention
comprise as a binding specificity at least one antibody.
[0250] In one embodiment, the binding specificity for an Fc.gamma.
receptor is provided by a monoclonal antibody, the binding of which
is not blocked by human immunoglobulin G (IgG). As used herein, the
term "IgG receptor" refers to any of the eight *-chain genes
located on chromosome 1. These genes encode a total of twelve
transmembrane or soluble receptor isoforms which are grouped into
three Fc* receptor classes: Fc*RI (CD64), Fc*RII (CD32), and
Fc*RIII (CD16). In one preferred embodiment, the Fc.gamma. receptor
a human high affinity Fc*RI. The human Fc*RI is a 72 kDa molecule,
which shows high affinity for monomeric IgG (108-109 M-1).
[0251] The production and characterization of certain preferred
anti-Fey monoclonal antibodies are described in PCT Publication WO
88/00052 and in U.S. Pat. No. 4,954,617 to Fanger et al., the
teachings of which are fully incorporated by reference herein.
These antibodies bind to an epitope of Fc*RI, Fc*RII or Fc*RIII at
a site which is distinct from the Fc* binding site of the receptor
and, thus, their binding is not blocked substantially by
physiological levels of IgG. Specific anti-Fc*RI antibodies useful
in this invention are mAb 22, mAb 32, mAb 44, mAb 62 and mAb 197.
The hybridoma producing mAb 32 is available from the American Type
Culture Collection, ATCC Accession No. HB9469. In other
embodiments, the anti-Fc* receptor antibody is a humanized form of
monoclonal antibody 22 (H22). The production and characterization
of the H22 antibody is described in Graziano, R. F. et al. (1995)
J. Immunol. 155 (10): 4996-5002 and PCT Publication WO 94/10332 to
Tempest et al. The H22 antibody producing cell line was deposited
at the American Type Culture Collection under the designation
HA022CL1 and has the accession no. CRL 11177.
[0252] In still other preferred embodiments, the binding
specificity for an Fc receptor is provided by an antibody that
binds to a human IgA receptor, e.g., an Fc-alpha receptor (Fc*RI
(CD89)), the binding of which is preferably not blocked by human
immunoglobulin A (IgA). The term "IgA receptor" is intended to
include the gene product of one *-gene (Fc*RI) located on
chromosome 19. This gene is known to encode several alternatively
spliced transmembrane isoforms of 55 to 110 kDa. Fc*RI (CD89) is
constitutively expressed on monocytes/macrophages, eosinophilic and
neutrophilic granulocytes, but not on non-effector cell
populations. Fc*RI has medium affinity (.about.5.times.10.sup.7
M-1) for both IgA1 and IgA2, which is increased upon exposure to
cytokines such as G-CSF or GM-CSF (Morton, H. C. et al. (1996)
Critical Reviews in Immunology 16:423-440). Four Fc*RI-specific
monoclonal antibodies, identified as A3, A59, A62 and A77, which
bind Fc*RI outside the IgA ligand binding domain, have been
described (Monteiro, R. C. et al. (1992) J. Immunol. 148:1764).
[0253] Fc*RI and Fc*RI are preferred trigger receptors for use in
the bispecific molecules of the invention because they are (1)
expressed primarily on immune effector cells, e.g., monocytes,
PMNs, macrophages and dendritic cells; (2) expressed at high levels
(e.g., 5,000-100,000 per cell); (3) mediators of cytotoxic
activities (e.g., ADCC, phagocytosis); and (4) mediate enhanced
antigen presentation of antigens, including self-antigens, targeted
to them.
[0254] While human monoclonal antibodies are preferred, other
antibodies which can be employed in the bispecific molecules of the
invention are murine, chimeric and humanized monoclonal
antibodies.
[0255] The bispecific molecules of the present invention can be
prepared by conjugating the constituent binding specificities,
e.g., the anti-FcR and first target binding specificities, using
methods known in the art. For example, each binding specificity of
the bispecific molecule can be generated separately and then
conjugated to one another. When the binding specificities are
proteins or peptides, a variety of coupling or cross-linking agents
can be used for covalent conjugation. When the binding
specificities are antibodies, they can be conjugated via sulfhydryl
bonding of the C-terminus hinge regions of the two heavy chains. In
a particularly preferred embodiment, the hinge region is modified
to contain an odd number of sulfhydryl residues, preferably one,
prior to conjugation.
[0256] Alternatively, both binding specificities can be encoded in
the same vector and expressed and assembled in the same host cell.
This method is particularly useful where the bispecific molecule is
a mAb.times.mAb. Methods for preparing bispecific molecules are
described for example in U.S. Pat. Nos. 5,260,203; 5,455,030;
4,881,175; 5,132,405; 5,091,513; 5,476,786; 5,013,653; 5,258,498;
and 5,482,858, all of which are expressly incorporated herein by
reference.
[0257] Binding of the bispecific molecules to their specific
targets can be confirmed by, for example, enzyme-linked
immunosorbent assay (ELISA), radioimmunoassay (RIA), FACS analysis,
bioassay (e.g., growth inhibition), or Western Blot assay. Each of
these assays generally detects the presence of protein-antibody
complexes of particular interest by employing a labeled reagent
(e.g., an antibody) specific for the complex of interest. For
example, the FcR-antibody complexes can be detected using e.g., an
enzyme-linked antibody or antibody fragment which recognizes and
specifically binds to the antibody-FcR complexes. Alternatively,
the complexes can be detected using any of a variety of other
immunoassays. For example, the antibody can be radioactively
labeled and used in a radioimmunoassay (RIA) (see, for example,
Weintraub, B., Principles of Radioimmunoassays, Seventh Training
Course on Radioligand Assay Techniques, The Endocrine Society,
March, 1986, which is incorporated by reference herein). The
radioactive isotope can be detected by such means as the use of ay
counter or a scintillation counter or by autoradiography.
Pharmaceutical Compositions
[0258] In another aspect, the present invention provides a
composition, e.g., a pharmaceutical composition, containing one or
a combination of monoclonal antibodies conjugated with a partner
molecule, or antigen-binding portion(s) thereof, of the present
invention, formulated together with a pharmaceutically acceptable
carrier.
[0259] Pharmaceutical compositions of the invention also can be
administered in combination therapy, i.e., combined with other
agents. For example, the combination therapy can include an
antibody of the present invention combined with at least one other
anti-inflammatory or immunosuppressant agent. Examples of
therapeutic agents that can be used in combination therapy are
described in greater detail below in the section on uses of the
antibodies of the invention.
[0260] As used herein, "pharmaceutically acceptable carrier"
includes any and all solvents, dispersion media, coatings,
antibacterial and antifungal agents, isotonic and absorption
delaying agents, and the like that are physiologically compatible.
Preferably, the carrier is suitable for intravenous, intramuscular,
subcutaneous, parenteral, spinal or epidermal administration (e.g.,
by injection or infusion). Depending on the route of
administration, the conjugated antibody and partner molecule may be
coated in a material to protect the compound from the action of
acids and other natural conditions that may inactivate the
compound.
[0261] The pharmaceutical compounds of the invention may include
one or more pharmaceutically acceptable salts. A "pharmaceutically
acceptable salt" refers to a salt that retains the desired
biological activity of the parent compound and does not impart any
undesired toxicological effects (see e.g., Berge, S. M., et al.
(1977) J. Pharm. Sci. 66:1-19). Examples of such salts include acid
addition salts and base addition salts. Acid addition salts include
those derived from nontoxic inorganic acids, such as hydrochloric,
nitric, phosphoric, sulfuric, hydrobromic, hydroiodic, phosphorous
and the like, as well as from nontoxic organic acids such as
aliphatic mono- and dicarboxylic acids, phenyl-substituted alkanoic
acids, hydroxy alkanoic acids, aromatic acids, aliphatic and
aromatic sulfonic acids and the like. Base addition salts include
those derived from alkaline earth metals, such as sodium,
potassium, magnesium, calcium and the like, as well as from
nontoxic organic amines, such as N,N'-dibenzylethylenediamine,
N-methylglucamine, chloroprocaine, choline, diethanolamine,
ethylenediamine, procaine and the like.
[0262] A pharmaceutical composition of the invention also may
include a pharmaceutically acceptable anti-oxidant. Examples of
pharmaceutically acceptable antioxidants include: (1) water soluble
antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium
bisulfate, sodium metabisulfite, sodium sulfite and the like; (2)
oil-soluble antioxidants, such as ascorbyl palmitate, butylated
hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin,
propyl gallate, alpha-tocopherol, and the like; and (3) metal
chelating agents, such as citric acid, ethylenediamine tetraacetic
acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the
like.
[0263] Examples of suitable aqueous and nonaqueous carriers that
may be employed in the pharmaceutical compositions of the invention
include water, ethanol, polyols (such as glycerol, propylene
glycol, polyethylene glycol, and the like), and suitable mixtures
thereof, vegetable oils, such as olive oil, and injectable organic
esters, such as ethyl oleate. Proper fluidity can be maintained,
for example, by the use of coating materials, such as lecithin, by
the maintenance of the required particle size in the case of
dispersions, and by the use of surfactants.
[0264] These compositions may also contain adjuvants such as
preservatives, wetting agents, emulsifying agents and dispersing
agents. Prevention of presence of microorganisms may be ensured
both by sterilization procedures, supra, and by the inclusion of
various antibacterial and antifungal agents, for example, paraben,
chlorobutanol, phenol sorbic acid, and the like. It may also be
desirable to include isotonic agents, such as sugars, sodium
chloride, and the like into the compositions. In addition,
prolonged absorption of the injectable pharmaceutical form may be
brought about by the inclusion of agents which delay absorption
such as aluminum monostearate and gelatin.
[0265] Pharmaceutically acceptable carriers include sterile aqueous
solutions or dispersions and sterile powders for the extemporaneous
preparation of sterile injectable solutions or dispersion. The use
of such media and agents for pharmaceutically active substances is
known in the art. Except insofar as any conventional media or agent
is incompatible with the active compound, use thereof in the
pharmaceutical compositions of the invention is contemplated.
Supplementary active compounds can also be incorporated into the
compositions.
[0266] Therapeutic compositions typically must be sterile and
stable under the conditions of manufacture and storage. The
composition can be formulated as a solution, microemulsion,
liposome, or other ordered structure suitable to high drug
concentration. The carrier can be a solvent or dispersion medium
containing, for example, water, ethanol, polyol (for example,
glycerol, propylene glycol, and liquid polyethylene glycol, and the
like), and suitable mixtures thereof. The proper fluidity can be
maintained, for example, by the use of a coating such as lecithin,
by the maintenance of the required particle size in the case of
dispersion and by the use of surfactants. In many cases, it will be
preferable to include isotonic agents, for example, sugars,
polyalcohols such as mannitol, sorbitol, or sodium chloride in the
composition. Prolonged absorption of the injectable compositions
can be brought about by including in the composition an agent that
delays absorption, for example, monostearate salts and gelatin.
[0267] Sterile injectable solutions can be prepared by
incorporating the active compound in the required amount in an
appropriate solvent with one or a combination of ingredients
enumerated above, as required, followed by sterilization
microfiltration. Generally, dispersions are prepared by
incorporating the active compound into a sterile vehicle that
contains a basic dispersion medium and the required other
ingredients from those enumerated above. In the case of sterile
powders for the preparation of sterile injectable solutions, the
preferred methods of preparation are vacuum drying and
freeze-drying (lyophilization) that yield a powder of the active
ingredient plus any additional desired ingredient from a previously
sterile-filtered solution thereof.
[0268] The amount of active ingredient which can be combined with a
carrier material to produce a single dosage form will vary
depending upon the subject being treated, and the particular mode
of administration. The amount of active ingredient which can be
combined with a carrier material to produce a single dosage form
will generally be that amount of the composition which produces a
therapeutic effect. Generally, out of one hundred percent, this
amount will range from about 0.01 percent to about ninety-nine
percent of active ingredient, preferably from about 0.1 percent to
about 70 percent, most preferably from about 1 percent to about 30
percent of active ingredient in combination with a pharmaceutically
acceptable carrier.
[0269] Dosage regimens are adjusted to provide the optimum desired
response (e.g., a therapeutic response). For example, a single
bolus may be administered, several divided doses may be
administered over time or the dose may be proportionally reduced or
increased as indicated by the exigencies of the therapeutic
situation. It is especially advantageous to formulate parenteral
compositions in dosage unit form for ease of administration and
uniformity of dosage. Dosage unit form as used herein refers to
physically discrete units suited as unitary dosages for the
subjects to be treated; each unit contains a predetermined quantity
of active compound calculated to produce the desired therapeutic
effect in association with the required pharmaceutical carrier. The
specification for the dosage unit forms of the invention are
dictated by and directly dependent on (a) the unique
characteristics of the active compound and the particular
therapeutic effect to be achieved, and (b) the limitations inherent
in the art of compounding such an active compound for the treatment
of sensitivity in individuals.
[0270] For use in the prophylaxis and/or treatment of diseases
related to abnormal cellular proliferation, a circulating
concentration of administered compound of about 0.001 .mu.M to 20
.mu.M is preferred, with about 0.01 .mu.M to 5 .mu.M being
preferred.
[0271] Patient doses for oral administration of the compounds
described herein, typically range from about 1 mg/day to about
10,000 mg/day, more typically from about 10 mg/day to about 1,000
mg/day, and most typically from about 50 mg/day to about 500
mg/day. Stated in terms of patient body weight, typical dosages
range from about 0.01 to about 150 mg/kg/day, more typically from
about 0.1 to about 15 mg/kg/day, and most typically from about 1 to
about 10 mg/kg/day, for example 5 mg/kg/day or 3 mg/kg/day.
[0272] In at least some embodiments, patient doses that retard or
inhibit tumor growth can be 1 .quadrature.mol/kg/day or less. For
example, the patient doses can be 0.9, 0.6, 0.5, 0.45, 0.3, 0.2,
0.15, or 0.1 .mu.mol/kg/day or less (referring to moles of the
drug). Preferably, the antibody-drug conjugate retards growth of
the tumor when administered in the daily dosage amount over a
period of at least five days. In at least some embodiments, the
tumor is a human-type tumor in a SCID mouse. As an example, the
SCID mouse can be a CB17.5CID mouse (available from Taconic,
Germantown, N.Y.).
[0273] Alternatively, the antibody conjugate can be administered as
a sustained release formulation, in which case less frequent
administration is required. Dosage and frequency vary depending on
the half-life of the antibody in the patient. In general, human
antibodies show the longest half life, followed by humanized
antibodies, chimeric antibodies, and nonhuman antibodies. The
dosage and frequency of administration can vary depending on
whether the treatment is prophylactic or therapeutic. In
prophylactic applications, a relatively low dosage is administered
at relatively infrequent intervals over a long period of time. Some
patients continue to receive treatment for the rest of their lives.
In therapeutic applications, a relatively high dosage at relatively
short intervals is sometimes required until progression of the
disease is reduced or terminated, and preferably until the patient
shows partial or complete amelioration of symptoms of disease.
Thereafter, the patient can be administered a prophylactic
regime.
[0274] Actual dosage levels of the active ingredients in the
pharmaceutical compositions of the present invention may be varied
so as to obtain an amount of the active ingredient which is
effective to achieve the desired therapeutic response for a
particular patient, composition, and mode of administration,
without being toxic to the patient. The selected dosage level will
depend upon a variety of pharmacokinetic factors including the
activity of the particular compositions of the present invention
employed, or the ester, salt or amide thereof, the route of
administration, the time of administration, the rate of excretion
of the particular compound being employed, the duration of the
treatment, other drugs, compounds and/or materials used in
combination with the particular compositions employed, the age,
sex, weight, condition, general health and prior medical history of
the patient being treated, and like factors well known in the
medical arts.
[0275] A "therapeutically effective dosage" of an antibody of the
invention preferably results in a decrease in severity of disease
symptoms, an increase in frequency and duration of disease
symptom-free periods, or a prevention of impairment or disability
due to the disease affliction. For example, for the treatment of
tumors, a "therapeutically effective dosage" preferably inhibits
cell growth or tumor growth by at least about 20%, more preferably
by at least about 40%, even more preferably by at least about 60%,
and still more preferably by at least about 80% relative to
untreated subjects. The ability of a compound to inhibit tumor
growth can be evaluated in an animal model system predictive of
efficacy in human tumors. Alternatively, this property of a
composition can be evaluated by examining the ability of the
compound to inhibit cell growth, such inhibition can be measured in
vitro by assays known to the skilled practitioner. A
therapeutically effective amount of a therapeutic compound can
decrease tumor size, or otherwise ameliorate symptoms in a subject.
One of ordinary skill in the art would be able to determine such
amounts based on such factors as the subject's size, the severity
of the subject's symptoms, and the particular composition or route
of administration selected.
[0276] A composition of the present invention can be administered
via one or more routes of administration using one or more of a
variety of methods known in the art. As will be appreciated by the
skilled artisan, the route and/or mode of administration will vary
depending upon the desired results. Preferred routes of
administration for antibodies of the invention include intravenous,
intramuscular, intradermal, intraperitoneal, subcutaneous, spinal
or other parenteral routes of administration, for example by
injection or infusion. The phrase "parenteral administration" as
used herein means modes of administration other than enteral and
topical administration, usually by injection, and includes, without
limitation, intravenous, intramuscular, intraarterial, intrathecal,
intracapsular, intraorbital, intracardiac, intradermal,
intraperitoneal, transtracheal, subcutaneous, subcuticular,
intraarticular, subcapsular, subarachnoid, intraspinal, epidural
and intrasternal injection and infusion.
[0277] Alternatively, an antibody conjugate of the invention can be
administered via a non-parenteral route, such as a topical,
epidermal or mucosal route of administration, for example,
intranasally, orally, vaginally, rectally, sublingually or
topically.
[0278] The active compounds can be prepared with carriers that will
protect the compound against rapid release, such as a controlled
release formulation, including implants, transdermal patches, and
microencapsulated delivery systems. Biodegradable, biocompatible
polymers can be used, such as ethylene vinyl acetate,
polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and
polylactic acid. Many methods for the preparation of such
formulations are patented or generally known to those skilled in
the art. See, e.g., Sustained and Controlled Release Drug Delivery
Systems, J. R. Robinson, ed., Marcel Dekker, Inc., New York,
1978.
[0279] Therapeutic compositions can be administered with medical
devices known in the art. For example, in a preferred embodiment, a
therapeutic composition of the invention can be administered with a
needleless hypodermic injection device, such as the devices
disclosed in U.S. Pat. No. 5,399,163; 5,383,851; 5,312,335;
5,064,413; 4,941,880; 4,790,824; or 4,596,556. Examples of
well-known implants and modules useful in the present invention
include: U.S. Pat. No. 7,201,746, which discloses a variable flow
implantable micro-infusion pump for dispensing medication at a
controlled rate; U.S. Pat. No. 5,466,465, which discloses a
therapeutic device for administering medicants through the skin;
U.S. Pat. No. 6,742,992, which discloses a medication infusion pump
for delivering medication at a precise infusion rate; U.S. Pat. No.
6,976,981, which discloses an osmotic drug delivery system having
multi-chamber compartments. These patents are incorporated herein
by reference. Many other such implants, delivery systems, and
modules are known to those skilled in the art.
[0280] In certain embodiments, the human monoclonal antibodies of
the invention can be formulated to ensure proper distribution in
vivo. For example, the blood-brain barrier (BBB) excludes many
highly hydrophilic compounds. To ensure that the therapeutic
compounds of the invention cross the BBB (if desired), they can be
formulated, for example, in liposomes. For methods of manufacturing
liposomes, see, e.g., U.S. Pat. Nos. 4,522,811; 5,374,548; and
5,399,331. The liposomes may comprise one or more moieties which
are selectively transported into specific cells or organs, thus
enhance targeted drug delivery (see, e.g., V. V. Ranade (1989) J.
Clin. Pharmacol. 29:685). Exemplary targeting moieties include
folate or biotin (see, e.g., U.S. Pat. No. 5,416,016 to Low et
al.); mannosides (Umezawa et al., (1988) Biochem. Biophys. Res.
Commun. 153:1038); antibodies (P. G. Bloeman et al. (1995) FEBS
Lett. 357:140; M. Owais et al. (1995) Antimicrob. Agents Chemother.
39:180); surfactant protein A receptor (Briscoe et al. (1995) Am.
J. Physiol. 1233:134); p120 (Schreier et al. (1994) J. Biol. Chem.
269:9090); see also K. Keinanen; M. L. Laukkanen (1994) FEBS Lett.
346:123; J. J. Killion; I. J. Fidler (1994) Immunomethods
4:273.
Uses and Methods
[0281] The antibody conjugate compositions and methods of the
present invention have numerous in vitro and in vivo diagnostic and
therapeutic utilities involving the diagnosis and treatment of
disorders mediated by the antigen to which the antibody expresses
affinity. For example, these molecules can be administered to cells
in culture, in vitro or ex vivo, or to human subjects, e.g., in
vivo, to treat, prevent and to diagnose a variety of disorders. As
used herein, the term "subject" is intended to include human and
non-human animals. Non-human animals include all vertebrates, e.g.,
mammals and non-mammals, such as non-human primates, sheep, dogs,
cats, cows, horses, chickens, amphibians, and reptiles.
[0282] Suitable routes of administering the antibody conjugate
compositions of the invention in vivo and in vitro are well known
in the art and can be selected by those of ordinary skill. For
example, the antibody compositions can be administered by injection
(e.g., intravenous or subcutaneous). Suitable dosages of the
molecules used will depend on the age and weight of the subject and
the concentration and/or formulation of the antibody
composition.
[0283] As previously described, human antibody conjugates of the
invention can be co-administered with one or other more therapeutic
agents, e.g., a cytotoxic agent, a radiotoxic agent or an
immunosuppressive agent. In addition to the antibody partner
molecule, the partner molecule can also be administered separately.
In the latter case (separate administration), the antibody can be
administered before, after or concurrently with the agent or can be
co-administered with other known therapies, e.g., an anti-cancer
therapy, e.g., radiation. Such therapeutic agents include, among
others, anti-neoplastic agents such as doxorubicin (adriamycin),
cisplatin bleomycin sulfate, carmustine, chlorambucil, and
cyclophosphamide hydroxyurea which, by themselves, are only
effective at levels which are toxic or subtoxic to a patient.
Cisplatin is intravenously administered as a 100 mg/kg dose once
every four weeks and adriamycin is intravenously administered as a
60-75 mg/ml dose once every 21 days. Co-administration of the
antibodies, or antigen binding fragments thereof, of the present
invention with chemotherapeutic agents provides two anti-cancer
agents which operate via different mechanisms which yield a
cytotoxic effect to human tumor cells. Such co-administration can
solve problems due to development of resistance to drugs or a
change in the antigenicity of the tumor cells which would render
them unreactive with the antibody.
[0284] Also within the scope of the present invention are kits
comprising the antibody conjugate compositions of the invention and
instructions for use. The kit can further contain one or more
additional reagents, such as an immunosuppressive reagent, a
cytotoxic agent or a radiotoxic agent, or one or more additional
human antibodies of the invention (e.g., a human antibody having a
complementary activity which binds to an epitope in the antigen
distinct from the first human antibody).
[0285] Accordingly, patients treated with antibody compositions of
the invention can be additionally administered (prior to,
simultaneously with, or following administration of a human
antibody of the invention) with another therapeutic agent, such as
a cytotoxic or radiotoxic agent, which enhances or augments the
therapeutic effect of the human antibodies.
[0286] The present invention is further illustrated by the
following examples which should not be construed as further
limiting. The contents of all figures and all references, patents
and published patent applications cited throughout this application
are expressly incorporated herein by reference.
EXAMPLES
Example 1
Preparation of 2A10 Antibodies Having C-Terminal Cysteine
Residues
[0287] Vectors containing the 2A10 IgG1 antibody sequence were used
as the starting point to make the antibodies having C-terminal
cysteine residues (either near the original C-terminus or via the
addition of a C-terminal extension). The two starting vectors were
pICOFs-2A10 plasmid (FIG. 1) and pIEFs SRg1f-2A10 plasmid (FIG.
2).
[0288] In order to do site-directed mutagenesis on the human G1
constant region, the pICOFs-2A10 plasmid was digested SalI/NotI,
and the band containing the 2A10 sequence was then isolated by
agarose gel electrophoresis, followed by GeneClean purification.
The purified fragment was ligated into the pBlueScript KS+ vector
cut SalI/NotI, which was similarly purified. Clones from the
transformation were screened by restriction digest of miniprep DNA.
The same miniprep DNA was then used for the mutagenesis
procedure.
[0289] Mutagenesis was done to add an extension composed of the
amino acids CAA to the c-terminus of the Cgammalf (2A10-CAA) or
change the serine near the C-terminus (position 442) to a cysteine
(2A10-C442). The Stratagene QuickChange Site-Directed Mutagenesis
Kit was used with the following oligos made by Operon:
2A10S442Cfor: CAGAAGAGCCTCTGCCTGTCCCCGGGTAAATGA (SEQ ID NO: 14),
and 2A10S442Crev: TCATTTACCCGGGGACAGGCAGAGGCTCTTCTG (SEQ ID NO: 15)
for the C442 mutation and 2A10CAAfor:
CTGTCCCCGGGTAAATGTGCAGCTTGAGTGCGACGGCCG (SEQ ID NO: 16), and
2A10CAArev: CGGCCGTCGCACTCAAGCTGCACATTTACCCGGGGACAG (SEQ ID NO: 17)
for the CAA mutation.
[0290] Following the mutagenesis, miniprep DNA from 4 clones from
each mutagenesis was produced by standard methods and sequenced for
confirmation of the mutations. The chromatograms were analyzed
using ChromasPro software and then the sequence was transferred to
VectorNTI for further analysis. Correct clones were then digested
BssHII/KpnI to isolate the 2A10 mutant heavy chain as previously
described. The UCOE expression vector 153-118 was digested with
AscI/PvuI and KpnI/PvuI, and the bands isolated and purified as
before. A three way ligation was then performed using the two
vector fragments and the 2A10 HC BssHII/KpnI fragment to construct
the final expression vectors. Clones were screened by miniprep DNA
restriction digest.
[0291] The 2A10 LC was cloned into the UCOE vector 153-117 in order
to cotransfect with the 2A10 HC constructs. The pIEFs SRglf-2A10
plasmid was digested with BglII/XbaI and the 2A10 LC band was
isolated as previously described. The 153-117 MCS6 vector was
digested with Xba/SspI and SspI/BamHI and bands isolated as before.
A three-way ligation was done using the 2A10 LC band and the two
153-117 vector bands to construct the final 2A10 LC expression
vector. Clone miniprep DNA was screened by restriction digest.
[0292] Qiagen Qiafilter Midipreps were done for each construct:
2A10 LC 153-117, 2A10 HC CAA 153-118 and 2A10 HC C442 153-118. The
resulting DNA was resuspended in sterile dH2O and sequenced.
[0293] CHO--S cells were co-transfected with the 2A10 LC 153-117
plasmid and either the 2A10 HC CAA 153-118 or the 2A10 HC C442
153-118 plasmid, using DMRIE-C transfection reagent and the
manufacturers recommended procedure. CHO--S transfectants were
cultured in CD CHO media containing 8 mM
Glutamine/1.times.HT/PenStrep until day 3 post transfection when
they were placed under dual drug selection with 500 .mu.g/ml each
of G418 and Hygromycin. At this time cells were plated into 96-well
plates and serially diluted in order to raise isolated clones for
each transfectant.
[0294] After the clones in the 96-well plates were nearly
confluent, supernatant was taken from each well and screened for
human IgG expression by ELISA (FIG. 3). CHO 2A10 CAA #1 and CHO
2A10 C442 #14 were expanded to generate supernatant which could be
used for antibody purification.
Example 2
Purification and Conjugation of C-terminal Cysteine Containing
Antibodies to Toxin
[0295] Both C-terminal cysteine containing control antibody
2A10-C442 and the 2A10-CAA antibody) were purified by protein A
chromatography. Supernatant from CHO cells expressing each antibody
was adjusted to approx. p18.8, and loaded onto a protein
A-sepharose column pre-equilibrated with 50 mM glycine/glycinate
buffer p18.8. After washing the column with equilibration buffer,
antibody was eluted with 0.1M citric acid pH3.5, and fractions
containing antibody rapidly adjusted to pH7 and pooled. Antibody
was then buffer exchanged into 50 mM acetate buffer pH5.5 for
storage.
[0296] For site-specific conjugation to formula (n), antibodies
were buffer exchanged into 100 mM phosphate buffer, 50 mMNaCl, 2
mMDTPA, pH6 and the thiol activated with 4.5 mM cysteamine,
followed by incubation for 30 minutes at 37.degree. C. Following
activation antibodies were buffer exchanged into 50 mM HEPES
buffer, containing 5 mM glycine, 2 mMDTPA and 0.5% povidone(10K),
at pH5.5. Thiol activation was verified by assay with
4,4'-dithiodipypridine, measuring thiopyridine released at 324 nM.
Site-specific conjugation of CAA was achieved by addition of
formula (n) at a 3 fold molar excess with a final concentration of
10% DMSO in the reaction mix. After 90 minutes incubation at room
temperature, the resulting conjugate was purified by size exclusion
chromatography on a Superdex-200 column run in 50 mM HEPES, 5 mM
glycine, 100 mM NaCl, pH7.2.
[0297] Thiol assays for the two C-terminal cysteine containing
antibodies revealed comparable values of approx. 2 as expected for
the one cysteine introduced onto each of the two heavy chains of
the assembled antibody.
Example 3
Antigen Binding and Cytotoxicity of 2A10-CAA Antibody
[0298] Antigen binding was measured in a standard ELISA format
assay, using plates coated with 10 .mu.g/ml of PSMA. Bound antibody
was detected with goat anti-human IgG F(ab')2 fragment conjugated
to HRP, and signal developed using TMB. Results showed identical
binding of the CAA antibody to the parental antibody control. In
addition, the conjugated CAA antibody showed identical binding as
the randomly conjugated antibody control (FIG. 6)
[0299] Cytotoxicity was determined in a standard tritiated
thymidine proliferation assay using LNCaP cells. LNCaP express high
levels of PSMA on the cell surface. Incubation of the cells with
conjugate was carried out for 72 hours. Results showed that the CAA
variant conjugate with formula (n) was potent in inhibiting
proliferation of target cells with an EC50 of 0.22 nM in this assay
(FIG. 7).
Example 4
Construction of CD70.1 CAA
[0300] Vector 2A10 CAA pBlueScript KS+ (previously described) was
digested with NotI/NheI to remove the 2A10 VH region, and the
remaining vector band was agarose gel purified. pICO CD70.1.4 was
digested NotI/NheI to cut out the CD70.1 VH region which was
isolated from the vector by agarose gel. CD70.1 VH(NotI/NheI) was
cloned into CAA pBlueScript KS+(NotI/NheI). The resulting CD70.1
CAA IgG heavy chain was then cloned into pICOFSCpurG for heavy
chain expression. The resulting vector was named CD70CAA pFSCG.
[0301] pICO CD70.1.4 was digested with BglII/BsiWI to cut out the
CD70.1 Vk region, which was then gel purified. The human Ig kappa
chain expression vector pICOFSCneok was digested BglII/BsiWI and
the cut vector was gel purified. The CD70.1 Vk BglII/BsiWI fragment
was then cloned into pICOFSCneok (BglII/BsiWI) for light chain
expression. The resulting vector was named CD70VLpFSCN.
[0302] Qiagen Qiafilter Midipreps were done for each construct:
CD70VLpFSCN, and CD70CAA pFSCG. The resulting purified plamids were
resuspended in sterile dH.sub.2O and sequenced to verify the
correct sequences.
[0303] CHO--S cells were co-transfected with the CD70VLpFSCN
plasmid and the CD70CAA pFSCG using the Amaxa suspension CHO cell
program with the manufacturers recommended procedure. CHO--S
transfectants were cultured in CD CHO media containing 8 mM
Glutamine/1.times.HT/PenStrep until day 3 post transfection when
they were placed under dual drug selection with 500 .mu.g/ml G418
and 4 .mu.g/ml Puromycin. At this time cells were plated into
96-well plates and serially diluted in order to raise isolated
clones. After the clones in the 96-well plates were nearly
confluent, supernatant was taken from each well and screened for
human IgG expression by ELISA. A high expressing clone was
identified and expanded to provide supernatant containing the
antibody CD70-CAA. CD70-CAA was purified by standard techniques and
tested for binding to CD70 by ELISA. ELISA was carried out by
standard techniques using plates coated with recombinant CD70-mouse
Fc fusion protein and after titration of anti-CD70 antibody,
detection with anti-human IgG Fc specific antibody conjugated with
horseradish peroxidase. No difference in binding was observed
compared to the parental antibody (FIG. 8).
Example 5
Construction of Antibody Variants with C-Terminal Extensions
[0304] The sequences AACAA, GGGGSCAA and CCAA were also constructed
as C-terminal extensions to the CD70 antibody. In order to
introduce these sequences to the 3' end of the anti-CD70 heavy
chain constant region, the following primers were used:
CD70.1-AACAA (SEQ ID NO:7) anti-sense primer, 5'
cactctcccctggatcctcatgcggcgcaagcggctttacccggggacagggagaggctcttctg-3'
(SEQ ID NO:18); CD70.1-CCAA (SEQ ID NO:9) anti-sense primer,
5'-cactctccectggatectcaagctgcacagcatttacccggggacagggagaggacttctg-3'
(SEQ ID NO:19); and CD70.1-G.sub.4SCAA (SEQ ID NO:8) anti-sense
primer,
5'-cactcteccctggatcctcaagctgcgcaggaaccgcceccacctttacccggggacagggagaggctct-
tctg-3' (SEQ ID NO:20). The forward primers for all above three
variants are the same: 5%
tccaccgcggtggeggccgccaccatggagtttgggctgagctgggnttectcgttgct-3' (SEQ
ID NO:21). The forward primer contained a Nod site and the reverse
primers all contained BamHI sites. PCR was then performed using
cloned pfu DNA polymerase (Invitrogen). These PCR products were
cloned into pICOFSCpurG digested by NotI and BamHI. All constructs
were sequenced to confirm sequence fidelity.
[0305] Stable cell lines expressing the CD70 antibody variants were
established by co-transfection of the light and heavy chain
constructs in an equimolar ratio into CHOS cells, using DMRIEC
transfection reagent (Invitrogen) according to the manufacturer's
instructions. Three days after, transfected cells were selected
under 4 .mu.g/mlpuromycin and 500n/m1 G418. Stable clones were
isolated by limited dilution in 96-well plates. To screen
puromycin/G418-resistant clones for their ability to secrete the
antibody mutants, supernatants of transfectant cells were tested by
ELISA. Briefly, maxisorb 96-well plates (Nunc, Roskilde, Denmark)
were coated with 5 .mu.g/ml rabbit anti-human kappa antibody in 0.5
M sodium carbonate buffer (pH 9.7) for 16 h at 4.degree. C. After
blocking for 1 h with Super Block (ScyTeK Laboratories) at room
temperature, isolated supernatants were added in 1/2 sequential
dilutions, and incubated for 1 h at room temperature. Plates were
subsequently washed three times and incubated with HRP-conjugated
rabbit anti-human gamma specific antibody (Jackson research
laboratories) for 1 h at room temperature. After washing, plates
were developed with TMB peroxidase EIA substrate kit (Bio-Rad). The
reaction was stopped with 2 M H.sub.2SO.sub.4, and OD was measured
at 450 nm. Positive cells were further expanded and the expression
was confirmed by ELISA.
[0306] High expressing stable clones were identified and scaled up
to produce supemanatant containing each antibody, which were then
purified by standard techniques. Binding to CD70 was tested by
ELISA as described above and all variants demonstrated good binding
to the antigen demonstrating no effect of the C-terminal addition
on antigen binding properties (FIG. 9)
[0307] Conjugation to the DNA minor-groove binding alkylating agent
(MGBA) formula (m) was carried out for each antibody in the same
manner as described above for conjugation of MGBA to anti-PSMA
antibody. Compounds reacted specifically with the C-terminal added
sequences. Conjugates with each variant were able to induce
specific cytotoxicity of CD70 positive 786-0 cells in an equivalent
manner to randomly conjugated CD70 antibody (FIG. 3). A control
conjugate with PSMA antibody linked to formula (m) was unable to
induce cytotoxicity of 786-0 cells, demonstrating the specific
manner of the cell killing.
[0308] Human IgG1 antibodies to CD70 are also able to mediate CD16
dependent antibody-dependent cellular cytotoxicty. To verify that
this beneficial property of the antibodies was not altered with
antibodies with C-terminal extensions, a CD16 binding ELISA was
carried out by standard techniques. Results (FIG. 11), demonstrate
no loss of CD16 binding for the variant antibodies.
[0309] The above mentioned patents, published patent applications,
test methods, and non-patent publications are hereby incorporated
by reference in their entirety. Furthermore, any variations of the
present invention will suggest themselves to those skilled in the
art in light of the above detailed description. All such variations
are within the fully intended scope of the appended claims.
Sequence CWU 1
1
211466PRTHomo sapiens 1Met Arg Ala Trp Ile Phe Phe Leu Leu Cys Leu
Ala Gly Arg Ala Leu1 5 10 15Ala Glu Val Gln Leu Val Gln Ser Gly Ala
Glu Val Lys Lys Pro Gly 20 25 30Glu Ser Leu Lys Ile Ser Cys Lys Gly
Ser Gly Tyr Ser Phe Thr Ser 35 40 45Asn Trp Ile Gly Trp Val Arg Gln
Met Pro Gly Lys Gly Leu Glu Trp 50 55 60Met Gly Ile Ile Tyr Pro Gly
Asp Ser Asp Thr Arg Tyr Ser Pro Ser65 70 75 80Phe Gln Gly Gln Val
Thr Ile Ser Ala Asp Lys Ser Ile Ser Thr Ala 85 90 95Tyr Leu Gln Trp
Ser Ser Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr 100 105 110Cys Ala
Arg Gln Thr Gly Phe Leu Trp Ser Ser Asp Leu Trp Gly Arg 115 120
125Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val
130 135 140Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr
Ala Ala145 150 155 160Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu
Pro Val Thr Val Ser 165 170 175Trp Asn Ser Gly Ala Leu Thr Ser Gly
Val His Thr Phe Pro Ala Val 180 185 190Leu Gln Ser Ser Gly Leu Tyr
Ser Leu Ser Ser Val Val Thr Val Pro 195 200 205Ser Ser Ser Leu Gly
Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys 210 215 220Pro Ser Asn
Thr Lys Val Asp Lys Arg Val Glu Pro Lys Ser Cys Asp225 230 235
240Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly
245 250 255Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu
Met Ile 260 265 270Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp
Val Ser His Glu 275 280 285Asp Pro Glu Val Lys Phe Asn Trp Tyr Val
Asp Gly Val Glu Val His 290 295 300Asn Ala Lys Thr Lys Pro Arg Glu
Glu Gln Tyr Asn Ser Thr Tyr Arg305 310 315 320Val Val Ser Val Leu
Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys 325 330 335Glu Tyr Lys
Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu 340 345 350Lys
Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr 355 360
365Thr Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val Ser Leu
370 375 380Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val
Glu Trp385 390 395 400Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys
Thr Thr Pro Pro Val 405 410 415Leu Asp Ser Asp Gly Ser Phe Phe Leu
Tyr Ser Lys Leu Thr Val Asp 420 425 430Lys Ser Arg Trp Gln Gln Gly
Asn Val Phe Ser Cys Ser Val Met His 435 440 445Glu Ala Leu His Asn
His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro 450 455 460Gly
Lys4652469PRTHomo sapiens 2Met Arg Ala Trp Ile Phe Phe Leu Leu Cys
Leu Ala Gly Arg Ala Leu1 5 10 15Ala Glu Val Gln Leu Val Gln Ser Gly
Ala Glu Val Lys Lys Pro Gly 20 25 30Glu Ser Leu Lys Ile Ser Cys Lys
Gly Ser Gly Tyr Ser Phe Thr Ser 35 40 45Asn Trp Ile Gly Trp Val Arg
Gln Met Pro Gly Lys Gly Leu Glu Trp 50 55 60Met Gly Ile Ile Tyr Pro
Gly Asp Ser Asp Thr Arg Tyr Ser Pro Ser65 70 75 80Phe Gln Gly Gln
Val Thr Ile Ser Ala Asp Lys Ser Ile Ser Thr Ala 85 90 95Tyr Leu Gln
Trp Ser Ser Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr 100 105 110Cys
Ala Arg Gln Thr Gly Phe Leu Trp Ser Ser Asp Leu Trp Gly Arg 115 120
125Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val
130 135 140Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr
Ala Ala145 150 155 160Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu
Pro Val Thr Val Ser 165 170 175Trp Asn Ser Gly Ala Leu Thr Ser Gly
Val His Thr Phe Pro Ala Val 180 185 190Leu Gln Ser Ser Gly Leu Tyr
Ser Leu Ser Ser Val Val Thr Val Pro 195 200 205Ser Ser Ser Leu Gly
Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys 210 215 220Pro Ser Asn
Thr Lys Val Asp Lys Arg Val Glu Pro Lys Ser Cys Asp225 230 235
240Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly
245 250 255Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu
Met Ile 260 265 270Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp
Val Ser His Glu 275 280 285Asp Pro Glu Val Lys Phe Asn Trp Tyr Val
Asp Gly Val Glu Val His 290 295 300Asn Ala Lys Thr Lys Pro Arg Glu
Glu Gln Tyr Asn Ser Thr Tyr Arg305 310 315 320Val Val Ser Val Leu
Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys 325 330 335Glu Tyr Lys
Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu 340 345 350Lys
Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr 355 360
365Thr Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val Ser Leu
370 375 380Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val
Glu Trp385 390 395 400Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys
Thr Thr Pro Pro Val 405 410 415Leu Asp Ser Asp Gly Ser Phe Phe Leu
Tyr Ser Lys Leu Thr Val Asp 420 425 430Lys Ser Arg Trp Gln Gln Gly
Asn Val Phe Ser Cys Ser Val Met His 435 440 445Glu Ala Leu His Asn
His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro 450 455 460Gly Lys Cys
Ala Ala4653466PRTHomo sapiens 3Met Arg Ala Trp Ile Phe Phe Leu Leu
Cys Leu Ala Gly Arg Ala Leu1 5 10 15Ala Glu Val Gln Leu Val Gln Ser
Gly Ala Glu Val Lys Lys Pro Gly 20 25 30Glu Ser Leu Lys Ile Ser Cys
Lys Gly Ser Gly Tyr Ser Phe Thr Ser 35 40 45Asn Trp Ile Gly Trp Val
Arg Gln Met Pro Gly Lys Gly Leu Glu Trp 50 55 60Met Gly Ile Ile Tyr
Pro Gly Asp Ser Asp Thr Arg Tyr Ser Pro Ser65 70 75 80Phe Gln Gly
Gln Val Thr Ile Ser Ala Asp Lys Ser Ile Ser Thr Ala 85 90 95Tyr Leu
Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr 100 105
110Cys Ala Arg Gln Thr Gly Phe Leu Trp Ser Ser Asp Leu Trp Gly Arg
115 120 125Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro
Ser Val 130 135 140Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly
Gly Thr Ala Ala145 150 155 160Leu Gly Cys Leu Val Lys Asp Tyr Phe
Pro Glu Pro Val Thr Val Ser 165 170 175Trp Asn Ser Gly Ala Leu Thr
Ser Gly Val His Thr Phe Pro Ala Val 180 185 190Leu Gln Ser Ser Gly
Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro 195 200 205Ser Ser Ser
Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys 210 215 220Pro
Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys Ser Cys Asp225 230
235 240Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly
Gly 245 250 255Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr
Leu Met Ile 260 265 270Ser Arg Thr Pro Glu Val Thr Cys Val Val Val
Asp Val Ser His Glu 275 280 285Asp Pro Glu Val Lys Phe Asn Trp Tyr
Val Asp Gly Val Glu Val His 290 295 300Asn Ala Lys Thr Lys Pro Arg
Glu Glu Gln Tyr Asn Ser Thr Tyr Arg305 310 315 320Val Val Ser Val
Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys 325 330 335Glu Tyr
Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu 340 345
350Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr
355 360 365Thr Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val
Ser Leu 370 375 380Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile
Ala Val Glu Trp385 390 395 400Glu Ser Asn Gly Gln Pro Glu Asn Asn
Tyr Lys Thr Thr Pro Pro Val 405 410 415Leu Asp Ser Asp Gly Ser Phe
Phe Leu Tyr Ser Lys Leu Thr Val Asp 420 425 430Lys Ser Arg Trp Gln
Gln Gly Asn Val Phe Ser Cys Ser Val Met His 435 440 445Glu Ala Leu
His Asn His Tyr Thr Gln Lys Ser Leu Cys Leu Ser Pro 450 455 460Gly
Lys46541401DNAHomo sapiens 4atgagggctt ggatcttctt tctgctctgc
ctggccggga gagcgctcgc agaggtgcag 60ctggtgcagt ctggagcaga ggtgaaaaag
cccggggagt ctctgaagat ctcctgtaag 120ggttctggat acagctttac
cagtaactgg atcggctggg tgcgccagat gcccgggaaa 180ggcctggagt
ggatggggat catctatcct ggtgactctg ataccagata cagcccgtcc
240ttccaaggcc aggtcaccat ctcagccgac aagtccatca gcaccgccta
cctgcagtgg 300agcagcctga aggcctcgga caccgccatg tattactgtg
cgaggcaaac tggtttcctc 360tggtcctccg atctctgggg ccgtggcacc
ctggtcactg tctcctcagc tagcaccaag 420ggcccatcgg tcttccccct
ggcaccctcc tccaagagca cctctggggg cacagcggcc 480ctgggctgcc
tggtcaagga ctacttcccc gaaccggtga cggtgtcgtg gaactcaggc
540gccctgacca gcggcgtgca caccttcccg gctgtcctac agtcctcagg
actctactcc 600ctcagcagcg tggtgaccgt gccctccagc agcttgggca
cccagaccta catctgcaac 660gtgaatcaca agcccagcaa caccaaggtg
gacaagagag ttgagcccaa atcttgtgac 720aaaactcaca catgcccacc
gtgcccagca cctgaactcc tggggggacc gtcagtcttc 780ctcttccccc
caaaacccaa ggacaccctc atgatctccc ggacccctga ggtcacatgc
840gtggtggtgg acgtgagcca cgaagaccct gaggtcaagt tcaactggta
cgtggacggc 900gtggaggtgc ataatgccaa gacaaagccg cgggaggagc
agtacaacag cacgtaccgt 960gtggtcagcg tcctcaccgt cctgcaccag
gactggctga atggcaagga gtacaagtgc 1020aaggtctcca acaaagccct
cccagccccc atcgagaaaa ccatctccaa agccaaaggg 1080cagccccgag
aaccacaggt gtacaccctg cccccatccc gggaggagat gaccaagaac
1140caggtcagcc tgacctgcct ggtcaaaggc ttctatccca gcgacatcgc
cgtggagtgg 1200gagagcaatg ggcagccgga gaacaactac aagaccacgc
ctcccgtgct ggactccgac 1260ggctccttct tcctctatag caagctcacc
gtggacaaga gcaggtggca gcaggggaac 1320gtcttctcat gctccgtgat
gcatgaggct ctgcacaacc actacacgca gaagagcctc 1380tccctgtccc
cgggtaaatg a 140151410DNAHomo sapiens 5atgagggctt ggatcttctt
tctgctctgc ctggccggga gagcgctcgc agaggtgcag 60ctggtgcagt ctggagcaga
ggtgaaaaag cccggggagt ctctgaagat ctcctgtaag 120ggttctggat
acagctttac cagtaactgg atcggctggg tgcgccagat gcccgggaaa
180ggcctggagt ggatggggat catctatcct ggtgactctg ataccagata
cagcccgtcc 240ttccaaggcc aggtcaccat ctcagccgac aagtccatca
gcaccgccta cctgcagtgg 300agcagcctga aggcctcgga caccgccatg
tattactgtg cgaggcaaac tggtttcctc 360tggtcctccg atctctgggg
ccgtggcacc ctggtcactg tctcctcagc tagcaccaag 420ggcccatcgg
tcttccccct ggcaccctcc tccaagagca cctctggggg cacagcggcc
480ctgggctgcc tggtcaagga ctacttcccc gaaccggtga cggtgtcgtg
gaactcaggc 540gccctgacca gcggcgtgca caccttcccg gctgtcctac
agtcctcagg actctactcc 600ctcagcagcg tggtgaccgt gccctccagc
agcttgggca cccagaccta catctgcaac 660gtgaatcaca agcccagcaa
caccaaggtg gacaagagag ttgagcccaa atcttgtgac 720aaaactcaca
catgcccacc gtgcccagca cctgaactcc tggggggacc gtcagtcttc
780ctcttccccc caaaacccaa ggacaccctc atgatctccc ggacccctga
ggtcacatgc 840gtggtggtgg acgtgagcca cgaagaccct gaggtcaagt
tcaactggta cgtggacggc 900gtggaggtgc ataatgccaa gacaaagccg
cgggaggagc agtacaacag cacgtaccgt 960gtggtcagcg tcctcaccgt
cctgcaccag gactggctga atggcaagga gtacaagtgc 1020aaggtctcca
acaaagccct cccagccccc atcgagaaaa ccatctccaa agccaaaggg
1080cagccccgag aaccacaggt gtacaccctg cccccatccc gggaggagat
gaccaagaac 1140caggtcagcc tgacctgcct ggtcaaaggc ttctatccca
gcgacatcgc cgtggagtgg 1200gagagcaatg ggcagccgga gaacaactac
aagaccacgc ctcccgtgct ggactccgac 1260ggctccttct tcctctatag
caagctcacc gtggacaaga gcaggtggca gcaggggaac 1320gtcttctcat
gctccgtgat gcatgaggct ctgcacaacc actacacgca gaagagcctc
1380tccctgtccc cgggtaaatg tgcagcttga 141061401DNAHomo sapiens
6atgagggctt ggatcttctt tctgctctgc ctggccggga gagcgctcgc agaggtgcag
60ctggtgcagt ctggagcaga ggtgaaaaag cccggggagt ctctgaagat ctcctgtaag
120ggttctggat acagctttac cagtaactgg atcggctggg tgcgccagat
gcccgggaaa 180ggcctggagt ggatggggat catctatcct ggtgactctg
ataccagata cagcccgtcc 240ttccaaggcc aggtcaccat ctcagccgac
aagtccatca gcaccgccta cctgcagtgg 300agcagcctga aggcctcgga
caccgccatg tattactgtg cgaggcaaac tggtttcctc 360tggtcctccg
atctctgggg ccgtggcacc ctggtcactg tctcctcagc tagcaccaag
420ggcccatcgg tcttccccct ggcaccctcc tccaagagca cctctggggg
cacagcggcc 480ctgggctgcc tggtcaagga ctacttcccc gaaccggtga
cggtgtcgtg gaactcaggc 540gccctgacca gcggcgtgca caccttcccg
gctgtcctac agtcctcagg actctactcc 600ctcagcagcg tggtgaccgt
gccctccagc agcttgggca cccagaccta catctgcaac 660gtgaatcaca
agcccagcaa caccaaggtg gacaagagag ttgagcccaa atcttgtgac
720aaaactcaca catgcccacc gtgcccagca cctgaactcc tggggggacc
gtcagtcttc 780ctcttccccc caaaacccaa ggacaccctc atgatctccc
ggacccctga ggtcacatgc 840gtggtggtgg acgtgagcca cgaagaccct
gaggtcaagt tcaactggta cgtggacggc 900gtggaggtgc ataatgccaa
gacaaagccg cgggaggagc agtacaacag cacgtaccgt 960gtggtcagcg
tcctcaccgt cctgcaccag gactggctga atggcaagga gtacaagtgc
1020aaggtctcca acaaagccct cccagccccc atcgagaaaa ccatctccaa
agccaaaggg 1080cagccccgag aaccacaggt gtacaccctg cccccatccc
gggaggagat gaccaagaac 1140caggtcagcc tgacctgcct ggtcaaaggc
ttctatccca gcgacatcgc cgtggagtgg 1200gagagcaatg ggcagccgga
gaacaactac aagaccacgc ctcccgtgct ggactccgac 1260ggctccttct
tcctctatag caagctcacc gtggacaaga gcaggtggca gcaggggaac
1320gtcttctcat gctccgtgat gcatgaggct ctgcacaacc actacacgca
gaagagcctc 1380tgcctgtccc cgggtaaatg a 140175PRTArtificial
SequenceC-terminal extension 7Ala Ala Cys Ala Ala1 588PRTArtificial
SequenceC-terminal extension 8Gly Gly Gly Gly Ser Cys Ala Ala1
594PRTArtificial SequenceC-terminal extension 9Cys Cys Ala
Ala1104PRTArtificial SequencePeptide conjugation sequence 10Ala Leu
Ala Leu1114PRTArtificial SequencePeptide conjugation sequence 11Ala
Leu Ala Leu1124PRTArtificial SequencePeptide conjugation sequence
12Gly Phe Leu Gly1134PRTArtificial SequencePeptide conjugation
sequence 13Leu Leu Gly Leu11433DNAArtificial SequenceMutagenesis
oligonucleotide 14cagaagagcc tctgcctgtc cccgggtaaa tga
331533DNAArtificial SequenceMutagenesis oligonucleotide
15tcatttaccc ggggacaggc agaggctctt ctg 331639DNAArtificial
SequenceMutagenesis oligonucleotide 16ctgtccccgg gtaaatgtgc
agcttgagtg cgacggccg 391739DNAArtificial SequenceMutagenesis
oligonucleotide 17cggccgtcgc actcaagctg cacatttacc cggggacag
391865DNAArtificial SequenceAACAA anti-sense primer 18cactctcccc
tggatcctca tgcggcgcaa gcggctttac ccggggacag ggagaggctc 60ttctg
651962DNAArtificial SequenceCCAA anti-sense primer 19cactctcccc
tggatcctca agctgcacag catttacccg gggacaggga gaggctcttc 60tg
622074DNAArtificial SequenceG4SCAA anti-sense primer 20cactctcccc
tggatcctca agctgcgcag gaaccgcccc cacctttacc cggggacagg 60gagaggctct
tctg 742160DNAArtificial SequenceForward primer 21tccaccgcgg
tggcggccgc caccatggag tttgggctga gctgggtttt cctcgttgct 60
* * * * *