U.S. patent application number 12/933766 was filed with the patent office on 2011-11-10 for method of modifying target region in host dna and selectable marker cassette.
This patent application is currently assigned to Kao Corporation. Invention is credited to Katsutoshi ARA, Takuya MORIMOTO, Naotake OGASAWARA.
Application Number | 20110275158 12/933766 |
Document ID | / |
Family ID | 40863423 |
Filed Date | 2011-11-10 |
United States Patent
Application |
20110275158 |
Kind Code |
A2 |
ARA; Katsutoshi ; et
al. |
November 10, 2011 |
Method of Modifying Target Region in Host DNA and Selectable Marker
Cassette
Abstract
A method of modifying a target region in a host DNA using a
donor DNA: wherein the donor DNA having regions homologous to a
5'-side region outside of the target region in the host DNA, a
3'-side region outside of the target region in the host DNA and a
first homologous recombination region inside of the target region
in the host DNA, respectively, in this order, and further having a
first selectable marker gene, an expression-inducing promoter and a
second selectable marker gene expressed under the control of the
expression-inducing promoter between the region homologous to the
3'-side region and the region homologous to the first homologous
recombination region; which method has the steps of: a first step
of performing homologous recombination between the donor DNA and
the host DNA at the regions of the 5'-side region and the first
homologous recombination region, to conduct selection of a host
integrated with the donor DNA based on expression of the first
selectable marker gene; and a second step of performing homologous
recombination, within the host DNA integrated with the donor DNA by
the first step, between two regions of the 3'-side region derived
from the host DNA and the 3'-side region derived from the donor
DNA, to conduct selection of a host whose target region is modified
based on expression of the second selectable marker gene under an
expression-inducing condition for the expression-inducing promoter;
and a selectable marker cassette for use in the method.
Inventors: |
ARA; Katsutoshi; (Haga-gun,
Tochigi, JP) ; MORIMOTO; Takuya; (Haga-gun, Tochigi,
JP) ; OGASAWARA; Naotake; (Ikoma-shi, Nara,
JP) |
Assignee: |
Kao Corporation
14-10, Nihonbashi Kayabacho 1-chome Chuo-ku
Tokyo
JP
103-8210
|
Prior
Publication: |
|
Document Identifier |
Publication Date |
|
US 20110014709 A1 |
January 20, 2011 |
|
|
Family ID: |
40863423 |
Appl. No.: |
12/933766 |
Filed: |
October 4, 2010 |
Current U.S.
Class: |
435/490;
435/320.1 |
Current CPC
Class: |
C12N 15/102 20130101;
C12N 15/102 20130101; C12N 15/1082 20130101; C12N 15/1082
20130101 |
Class at
Publication: |
435/490;
435/320.1 |
International
Class: |
C12N 15/87 20060101
C12N015/87; C12N 15/63 20060101 C12N015/63 |
Foreign Application Data
Date |
Code |
Application Number |
Feb 26, 2009 |
JP |
2009-044193 |
Mar 24, 2008 |
JP |
2008-076008 |
Claims
1. A method of modifying a target region in a host DNA using a
donor DNA: wherein the donor DNA comprising regions homologous to a
5'-side region outside of the target region in the host DNA, a
3'-side region outside of the target region in the host DNA and a
first homologous recombination region inside of the target region
in the host DNA, respectively, in this order, and further
comprising a first selectable marker gene, an expression-inducing
promoter and a second selectable marker gene expressed under the
control of the expression-inducing promoter between the region
homologous to the 3'-side region and the region homologous to the
first homologous recombination region; which method comprises the
steps of: a first step of performing homologous recombination
between the donor DNA and the host DNA at the regions of the
5'-side region and the first homologous recombination region, to
conduct selection of a host integrated with the donor DNA based on
expression of the first selectable marker gene; and a second step
of performing homologous recombination, within the host DNA
integrated with the donor DNA by the first step, between two
regions of the 3'-side region derived from the host DNA and the
3'-side region derived from the donor DNA, to conduct selection of
a host whose target region is modified based on expression of the
second selectable marker gene under an expression-inducing
condition for the expression-inducing promoter.
2. A method of deleting a target region for deletion in a host DNA
using a donor DNA: wherein the donor DNA comprising regions
homologous to a 5'-side region outside of the target region for
deletion in the host DNA, a 3'-side region outside of the target
region for deletion in the host DNA and a first homologous
recombination region inside of the target region for deletion in
the host DNA, respectively, in this order, and further comprising a
first selectable marker gene, an expression-inducing promoter and a
second selectable marker gene expressed under the control of the
expression-inducing promoter between the region homologous to the
3'-side region and the region homologous to the first homologous
recombination region; which method comprises the steps of: a first
step of performing homologous recombination between the donor DNA
and the host DNA at the regions of the 5'-side region and the first
homologous recombination region, to conduct selection of a host
integrated with the donor DNA based on expression of the first
selectable marker gene; and a second step of performing homologous
recombination, within the host DNA integrated with the donor DNA by
the first step, between two regions of the 3'-side region derived
from the host DNA and the 3'-side region derived from the donor
DNA, to conduct selection of a host whose target region is deleted
based on expression of the second selectable marker gene under an
expression-inducing condition for the expression-inducing
promoter.
3. The method of deleting a target region for deletion in a host
DNA according to claim 2, wherein, in the second step, the host
whose target region is deleted is selected by positive selection
based on expression of the second selectable marker gene.
4. The method of deleting a target region for deletion in a host
DNA according to claim 2 or 3, wherein the second selectable marker
gene is a gene encoding a protein that induces death of a host
cell.
5. The method of deleting a target region for deletion in a host
DNA according to any one of claims 2 to 4, wherein the second
selectable marker gene is chpA gene.
6. The method of deleting a target region for deletion in a host
DNA according to any one of claims 2 to 5, wherein the
expression-inducing promoter is a promoter which induces expression
of a downstream gene in the presence of an expression inducer.
7. The method of deleting a target region for deletion in a host
DNA according to any one of claims 2 to 6, wherein the first
selectable marker gene is a drug-resistance gene.
8. The method of deleting a target region for deletion in a host
DNA according to any one of claims 2 to 7, wherein the host is
Bacillus subtilis.
9. A method of replacing a target region for replacement in a host
DNA using a donor DNA: wherein the donor DNA comprising regions
homologous to a 5'-side region outside of the target region for
replacement in the host DNA, a 3'-side region outside of the target
region for replacement in the host DNA and a first homologous
recombination region inside of the target region for replacement in
the host DNA, respectively, in this order, comprising a desired DNA
sequence between the region homologous to the 5'-side region and
the region homologous to the 3'-side region, and further comprising
a first selectable marker gene, an expression-inducing promoter and
a second selectable marker gene expressed under the control of the
expression-inducing promoter between the region homologous to the
3'-side region and the region homologous to the first homologous
recombination region; which method comprises the steps of: a first
step of performing homologous recombination between the donor DNA
and the host DNA at the regions of the 5'-side region and the first
homologous recombination region, to conduct selection of a host
integrated with the donor DNA based on expression of the first
selectable marker gene; and a second step of performing homologous
recombination, within the host DNA integrated with the donor DNA by
the first step, between two regions of the 3'-side region derived
from the host DNA and the 3'-side region derived from the donor
DNA, to conduct selection of a host whose target region is replaced
with the desired DNA sequence based on expression of the second
selectable marker gene under an expression-inducing condition for
the expression-inducing promoter.
10. The method of replacing a target region for replacement in a
host DNA according to claim 9, wherein, in the second step, the
host whose target region is replaced is selected by positive
selection based on expression of the second selectable marker
gene.
11. The method of replacing a target region for replacement in a
host DNA according to claim 9 or 10, wherein the second selectable
marker gene is a gene encoding a protein that induces death of a
host cell.
12. The method of replacing a target region for replacement in a
host DNA according to any one of claims 9 to 11, wherein the second
selectable marker gene is chpA gene.
13. The method of replacing a target region for replacement in a
host DNA according to any one of claims 9 to 12, wherein the
expression-inducing promoter is a promoter which induces expression
of a downstream gene in the presence of an expression inducer.
14. The method of replacing a target region for replacement in a
host DNA according to any one of claims 9 to 13, wherein the first
selectable marker gene is a drug-resistance gene.
15. The method of replacing a target region for replacement in a
host DNA according to any one of claims 9 to 14, wherein the host
is Bacillus subtilis.
16. A selectable marker cassette for use in the method according to
any one of claims 1, 2 and 9, comprising the first selectable
marker gene, the expression-inducing promoter and the second
selectable marker gene expressed under the expression-inducing
promoter, wherein, in the donor DNA, the selectable marker cassette
lies between the region homologous to the 3'-side region and the
region homologous to the first homologous recombination region.
17. The selectable marker cassette according to claim 16, wherein
the second selectable marker gene is a gene encoding a protein that
induces death of a host cell.
18. The selectable marker cassette according to claim 16 or 17,
wherein the second selectable marker gene is chpA gene.
19. The selectable marker cassette according to any one of claims
16 to 18, wherein the expression-inducing promoter is a promoter
which induces expression of a downstream gene in the presence of an
expression inducer.
20. The selectable marker cassette according to any one of claims
16 to 19, wherein the first selectable marker gene is a
drug-resistance gene.
21. The selectable marker cassette according to any one of claims
16 to 20, wherein the selectable marker cassette is incorporated in
Bacillus subtilis genome.
22. A method of producing a host, which comprises modifying a
target region in a host DNA by using the method according to claim
1.
23. A method of producing a host, which comprises deleting a target
region for deletion in a host DNA by using the method according to
any one of claims 2 to 8.
24. A method of producing a host, which comprises replacing a
target region for replacement in a host DNA by using the method
according to any one of claims 9 to 15.
Description
TECHNICAL FIELD
[0001] The present invention relates to a method of modifying a
target region in a host DNA and relates to a selectable marker
cassette.
BACKGROUND ART
[0002] Drug-resistance genes have been used as a means for
artificial selection of transformants in the genetic engineering
field. Specifically, a desired transformant can be selected based
on a drug-resistance gene whose expression confers drug resistance.
Not only the drug-resistance genes but also, for example,
auxotrophic genes are used as means for selecting transformants.
These genes usable for selecting transformants are generally called
selectable markers (selectable marker genes).
[0003] Selectable marker genes are useful for selecting
transformants. However, such a selectable marker gene, depending on
its kind, unfavorably exhibits adverse effects on the environment,
such as biological pollution of a wild-type microorganism by the
selectable marker gene, if the selectable marker gene remains in a
host cell. In addition, if multiple gene manipulations are
performed on the same host, the kind of selectable marker genes
that can be used may be limited. For that reason, it is desired to
develop a means for removing the selectable marker gene from the
transformant.
[0004] The selectable marker gene is also used when a mutant is
constructed by deleting a particular region from a host genome or
by inserting a foreign DNA into a host cell.
[0005] For example, JP-A-2007-111015 discloses a method for
deleting a particular region in host genome by using a repressor
and a promoter regulated by the repressor. Specifically, the method
discloses that a DNA segment (donor DNA) is integrated into a host
genome by homologous recombination, and then both of the donor DNA
and the particular region of the host genome are deleted from the
host genome by homologous recombination between a region of the
donor DNA and a region of the host genome. In this method, the
donor DNA contains a selectable marker and a gene encoding a
repressor, and the host genome contains a promoter under the
control of the repressor and a drug-resistance gene under the
control of the promoter. A transformant in which the donor DNA is
incorporated into the host genome can be selected by the selectable
marker derived from the donor DNA. In addition, when the donor DNA
is integrated into the host genome, the host cell develops a
drug-sensitivity by repressing expression of the drug-resistance
gene. After the donor DNA is removed from the host genome, the
expression of the drug-resistance gene is restored to give the
drug-resistant host cell. As a result, it is possible to delete the
particular region of the host genome without leaving the selectable
marker derived from the donor DNA in the host genome.
[0006] As explained above, the method of JP-A-2007-111015 is
advantageous in that the selectable marker gene can be used
effectively. However, the method requires the additional step of
introducing into the host genome beforehand an expression cassette
which contains the promoter under the control of the repressor and
the drug-resistance gene expressed under the control of the
promoter.
[0007] In cloning a gene or a DNA segment, it is very difficult to
insert a gene encoding a membrane protein, a gene encoding a
protein that functions as a fatal factor in a host when the protein
is present in a large amount (the presence of the protein in a
large amount functions as a lethal factor in a host cell), a very
large-sized DNA segment, and the like into a plasmid. When a
plurality of genes are involved in a particular biosynthesis or a
plurality of genes constituting a subunit, it is also difficult to
insert these genes and express them in a cell, simultaneously. To
overcome the problem of cloning such a gene or a DNA segment, a
method of using a low-copy plasmid, a method of using a
bacteriophage or a cosmid generally used for preparation of a
genome library as a vector, and the like have been proposed. In
addition, a method of using a promoter that can strictly regulate
gene expression and a method of improving chaperone function of the
host Escherichia coli have also been proposed.
[0008] However, the method of improving the host often depends on
the specificity of the desired product, and requires the selection
and adjustment of a cloning process suitable for the specificity.
In the method of using the phage or cosmid, it is also difficult to
insert a plurality of genes into a plurality of gene loci of a
cell.
[0009] Accordingly, there is a desire for development of a method
of inserting a plurality of and relatively large-sized DNA
fragments into a single cell with a simple procedure compared with
the conventional method of using a phage. In recent years, DNAs
obtained from environmental materials are eagerly studied by means
of metagenome analysis. There is a need for a new tool and a new
method of cloning genes and DNA segments that are hard to clone by
conventional methods.
SUMMARY OF INVENTION
[0010] As described above, the conventional genetic manipulation
method for modifying a host DNA and obtaining a transformant has a
problem that a selectable marker is left in the transformant.
[0011] The method of JP-A-2007-111015 contains the necessary step
of introducing into the host genome beforehand the expression
cassette. Thus, the method is not entirely satisfactory for
improvement of operational efficiency. In addition, the expression
cassette previously introduced is left behind in the host genome,
even after the particular region is deleted from the host
genome.
[0012] In the conventional genetic manipulation method using a
plasmid, it is difficult to introduce a large-size DNA segment or a
lethal gene into a desired region of a host DNA. Further, in the
conventional method using a phage or cosmid, it is impossible to
insert a plurality of genes into plural loci of a single cell.
[0013] The present invention is to provide a method of modifying a
target region in a host DNA; in which the method enables to modify
the target region in the host DNA with a simple procedure without
limiting the kind of a selectable marker (selectable marker gene)
that can be used, and to modify the target region in the host DNA
without leaving the selectable marker and the like used in
modification steps in the modified host DNA; and to provide a
selectable marker cassette for used therein.
[0014] Specifically, the present invention is to provide a method
of modifying the host DNA by deleting the desired region in the
host DNA, and, after deletion, yet not leaving the selectable
marker gene and others in the host DNA. The present invention is
also to provide a method of modifying the host DNA by replacing any
region in the host DNA with a desired DNA sequence (particularly,
for example, a large-sized DNA fragment, a DNA fragment that is
hard to introduce into a host, or a plurality of genes (multiple
genes)), and, after replacement, leaving only the desired DNA
sequence inserted into the host DNA but not leaving the selectable
marker gene and others.
[0015] According to the present invention, there is provided the
following means:
[0016] A method of modifying a target region in a host DNA
according to the present invention (hereinafter, referred to as the
modification method of the present invention) is a method of
modifying a target region in a host DNA using a donor DNA:
[0017] wherein the donor DNA comprising regions homologous to a
5'-side region outside of the target region in the host DNA, a
3'-side region outside of the target region in the host DNA and a
first homologous recombination region inside of the target region
in the host DNA, respectively, in this order, and further
comprising a first selectable marker gene, an expression-inducing
promoter and a second selectable marker gene expressed under the
control of the expression-inducing promoter between the region
homologous to the 3'-side region and the region homologous to the
first homologous recombination region;
which method comprises the steps of:
[0018] a first step of performing homologous recombination between
the donor DNA and the host DNA at the regions of the 5'-side region
and the first homologous recombination region, to conduct selection
of a host integrated with the donor DNA based on expression of the
first selectable marker gene; and
[0019] a second step of performing homologous recombination, within
the host DNA integrated with the donor DNA by the first step,
between two regions of the 3'-side region derived from the host DNA
and the 3'-side region derived from the donor DNA, to conduct
selection of a host whose target region is modified based on
expression of the second selectable marker gene under an
expression-inducing condition for the expression-inducing
promoter.
[0020] A method of deleting a target region for deletion in a host
DNA according to the present invention (hereinafter, referred to as
the deletion method of the present invention) is a method of
deleting a target region for deletion in a host DNA using a donor
DNA:
[0021] wherein the donor DNA comprising regions homologous to a
5'-side region outside of the target region for deletion in the
host DNA, a 3'-side region, outside of the target region for
deletion in the host DNA and a first homologous recombination
region inside of the target region for deletion in the host DNA,
respectively, in this order, and further comprising a first
selectable marker gene, an expression-inducing promoter and a
second selectable marker gene expressed under the control of the
expression-inducing promoter between the region homologous to the
3'-side region and the region homologous to the first homologous
recombination region;
which method comprises the steps of:
[0022] a first step of performing homologous recombination between
the donor DNA and the host DNA at the regions of the 5'-side region
and the first homologous recombination region, to conduct selection
of a host integrated with the donor DNA based on expression of the
first selectable marker gene; and
[0023] a second step of performing homologous recombination, within
the host DNA integrated with the donor DNA by the first step,
between two regions of the 3'-side region derived from the host DNA
and the 3'-side region derived from the donor DNA, to conduct
selection of a host whose target region is deleted based on
expression of the second selectable marker gene under an
expression-inducing condition for the expression-inducing
promoter.
[0024] A method of replacing a target region for replacement in a
host DNA according to the present invention (hereinafter, referred
to as the replacement method of the present invention) is a method
of replacing a target region for replacement in a host DNA using a
donor DNA:
[0025] wherein the donor DNA comprising regions homologous to a
5'-side region outside of the target region for replacement in the
host DNA, a 3'-side region outside of the target region for
replacement in the host DNA and a first homologous recombination
region inside of the target region for replacement in the host DNA,
respectively, in this order, comprising a desired DNA sequence
between the region homologous to the 5'-side region and the region
homologous to the 3'-side region, and further comprising a first
selectable marker gene, an expression-inducing promoter and a
second selectable marker gene expressed under the control of the
expression-inducing promoter between the region homologous to the
3'-side region and the region homologous to the first homologous
recombination region;
which method comprises the steps of:
[0026] a first step of performing homologous recombination between
the donor DNA and the host DNA at the regions of the 5'-side region
and the first homologous recombination region, to conduct selection
of a host integrated with the donor DNA based on expression of the
first selectable marker gene; and
[0027] a second step of performing homologous recombination, within
the host DNA integrated with the donor DNA by the first step,
between two regions of the 3'-side region derived from the host DNA
and the 3'-side region derived from the donor DNA, to conduct
selection of a host whose target region is replaced with the
desired DNA sequence based on expression of the second selectable
marker gene under an expression-inducing condition for the
expression-inducing promoter.
[0028] In the modification method, the deletion method and the
replacement method of the present invention, the selection of the
host in the second step based on expression of the second
selectable marker gene can be made, for example, by positive
selection.
[0029] Hereinafter, the host whose target region is modified, the
host whose target region is deleted or the host whose target region
is replaced with the desired DNA sequence will be referred to
simply as "transformant" or "mutant".
[0030] In the modification method, the deletion method and the
replacement method of the present invention, the second selectable
marker gene is not particularly limited, but may be, for example, a
gene encoding a protein that induces death of a host cell. The gene
encoding a protein that induces death of a host cell is not
particularly limited, but may be, for example, chpA gene.
[0031] In such a case, the host in which the selectable marker gene
derived from the donor DNA is deleted from the host DNA through the
second step can proliferate. On the other hand, the host having a
genome retaining the selectable marker gene derived from the donor
DNA is unable to proliferate under the expression inducing
condition. The positive selection allows the selection of host
having no selectable marker gene derived from the donor DNA.
[0032] In the modification method, the deletion method and the
replacement method of the present invention, the
expression-inducing promoter is not particularly limited, but may
be a promoter which induces expression of a downstream gene in the
presence of an expression inducer.
[0033] Further, in the modification method, the deletion method and
the replacement method of the present invention, the first
selectable marker gene is not particularly limited, but may be, for
example, a drug-resistance gene. In particular, it is possible to
prevent the selectable marker gene remaining in the host DNA,
because the selectable marker gene is removed from the host DNA
according to the modification method, the deletion method and the
replacement method of the present invention.
[0034] Furthermore, in the modification method, the deletion method
and the replacement method of the present invention, the kind of
the host that can be used is not particularly limited, but may be,
for example, Bacillus subtilis.
[0035] The selectable marker cassette for use in the present
invention has the first selectable marker gene, the
expression-inducing promoter and the second selectable marker gene
expressed under the expression-inducing promoter. In the donor DNA,
the selectable marker cassette lies between the region homologous
to the 3'-side region outside the target region and the region
homologous to the first homologous recombination region inside the
target region.
[0036] The second selectable marker gene preferably encodes a
protein that induces death of a host cell. In particular, chpA gene
is preferably used as the second selectable marker gene. The
expression-inducing promoter is preferably a promoter which induces
expression of a downstream gene in the presence of an expression
inducer. As the first selectable marker gene, a drug-resistance
gene can be preferably used. The selectable marker cassette
according to the present invention may be in the state incorporated
in Bacillus subtilis genome.
[0037] Further, the present invention is to provide a method of
producing a host modified a target region by using the above the
modification method, the deletion method and the replacement method
of the present invention.
[0038] According to the methods of the present invention, it is
possible to modify the desired region in the host DNA with a simple
procedure.
[0039] According to the present invention, neither the first
selectable marker gene nor second selectable marker gene used in
the modification process (including the deleting process and the
replacing process) remain in the host DNA after modification.
Accordingly, it is possible to prepare a desired transformant
without limiting the range of the selectable marker genes that can
be used. In particular when a plurality of regions in the host DNA
are modified, the modifying process according to the present
invention can be much simplified, compared with that by the
conventional gene modification method that the selectable marker
gene remains in the host, because any selectable marker gene can be
used without restriction. In addition to the selectable marker
gene, according to the present invention, the other regions (such
as first homologous recombination region, promoter sequence, and
the like) used in the modification process do not remain in the
host DNA after modification. Thus, when a plurality of modification
are repeatedly performed in the same host, the modification process
according to the present invention can also be simplified.
[0040] Also, according to the present invention, it is possible to
prevent the adverse effects on environment caused by residual of
the selectable marker gene in the host. For example, if a
drug-resistance gene is carried in a pathogenic strain (i.e.,
drug-resistant microbe), there is a concern about contamination of
environment. The strain introduced with the drug-resistance gene is
usually treated as a recombinant organism, and it demands to
prevent the strain from spreading into the environment. Thus, the
operation steps using such a strain more complicated, such as
restriction in handling in production, use and storage of the
strain, and demand to prevent diffusion of the strain. The present
invention is effectively used for such the environmental
containment caused by residual of the selectable marker gene.
[0041] Further, according to the present invention, the target
region for modifying is not restricted to a particular position in
the host DNA, and any region in the host DNA can be modified as the
target region for modifying.
[0042] Furthermore, according to the present invention, over a wide
region in the host DNA can be used as the target region for
modifying. More specifically, a wide region in the host DNA can be
deleted or replaced.
BRIEF DESCRIPTION OF DRAWINGS
[0043] FIG. 1 is a flow diagram showing one embodiment of the
method of deleting the target region in the host DNA according to
the present invention.
[0044] FIG. 2 is a flow diagram showing one embodiment of the
method of replacing the target region in the host DNA according to
the present invention.
[0045] FIG. 3 is a flow diagram showing a process of introducing a
drug-resistance gene by a double crossover method using a SOE-PCR
fragment.
[0046] FIG. 4 is a flow diagram showing a process of inserting a
desired DNA sequence into a host DNA introduced with a
drug-resistance gene, as one embodiment of the method of modifying
the target region in the host DNA according to the present
invention.
[0047] FIG. 5 is a flow diagram showing a process in preparing
Bacillus subtilis 168 (aprE::spec, lacI, Pspac-chpA) and Bacillus
subtilis 168 (aprE::Km, lacI, Pspac-chpA) used in Example 1 and
2.
[0048] FIG. 6 is a flow diagram showing a process of deleting a
target region from a host DNA in Example 1.
[0049] FIG. 7 is a flow diagram showing a process of inserting a
DNA sequence into a host DNA in Example 2.
[0050] Other and further features and advantages of the invention
will appear more fully from the following description,
appropriately referring to the accompanying drawings.
MODE FOR CARRYING OUT THE INVENTION
[0051] Hereinafter, the present invention will be described in
detail with reference to drawings.
[0052] In the present invention, the term "modifying a target
region in a host DNA" means that a DNA sequence of the target
region in the host DNA is altered or modified. Specifically, it
means that the DNA sequence of the target region is deleted from
the host DNA, or that the DNA sequence of the target region in the
host DNA is replaced with the desired DNA sequence to insert the
desired DNA sequence into the host DNA. Therefore, the modifying
method of the present invention includes the deletion method of the
present invention and the replacement method of the present
invention as preferable embodiments. Hereinafter, in the present
specification, the modifying method of the present invention
including the deletion method and the replacement method of the
present invention is referred to simply as "the present invention"
or "the method of the present invention".
[0053] An embodiment of the method of deleting the target region
for deletion in the host DNA of the present invention is shown in
FIG. 1.
[0054] An embodiment of the method of replacing the target region
for replacement in the host DNA of the present invention is shown
in FIG. 2. According to the embodiment showing FIG. 2, the DNA
sequence of the target region in host DNA can be replaced with the
desired DNA sequence and the desired DNA sequence can be inserted
into the host DNA.
[0055] First, the target region according to the present invention
will be explained.
[0056] In the present invention, the term "target region in a host
DNA" means any region present in the host DNA where the DNA
sequence is to be modified. Specifically, in the case of the
deletion method of the present invention, the target region is the
target region for deletion, that is, the region to be desirably
deleted from the host DNA. In the case of the replacement method of
the present invention, the target region is the target region for
replacement, that is, the region in the host DNA to be desirably
replaced with the desired DNA sequence. Hereinafter, the term
"target region" in the present specification includes the target
region for deletion and the target region for the replacement.
[0057] Examples of the target region include an unneeded region of
host DNA such as a region unneeded for production of substance in
the host (e.g., sporulation-related gene), a region inhibiting
growth of the host or productions of substances (e.g., phage
region), a gene or a gene group duplicated in the host (e.g.,
two-component regulating gene), or the like.
[0058] In the present invention, the target region may be any
region if it is presented in the host DNA before application of the
method of the present invention. The target region includes may be
an inherent region or a region introduced artificially before
application of the method of the present invention. Examples of the
artificially introduced regions include a region including a
selectable marker gene, a region including a reporter gene, and the
like.
[0059] In the method of the present invention, the size of the
target region is not particularly limited, but preferably 1 bp or
more, more preferably, 0.2 kb or more, and most preferably 0.5 kb
or more. The size of the target region is preferably 200 kb or
less, more preferably 160 kb or less, still more preferably 120 kb
or less, particularly preferably 80 kb or less, and most preferably
40 kb or less. If the size of the target region is 200 kb or less,
it is highly possible that there is no gene essential for growth in
the target region. As used herein, the "gene essential for growth"
means a gene leading to death of the host cell if it is deleted
from the host genome and a gene encoding a protein with a function
that cannot be compensated, for example, by exogenously adding the
material to the medium. In other words, if the host can
proliferates by adding any complementary substance (e.g.,
metabolism-related substance) to the medium, a gene leading to
death of the host cell if it is deleted from the host genome may be
contained in the target region. The maximum region containing no
gene essential for growth in Bacillus subtilis is a region from
dltA gene to yycH gene of approximately 200 kb (Proc. Natl. Acad.
Sci. USA, 100, 4679 (2003)).
[0060] First, in the method of the present invention, the 5'-side
region outside of the target region and 3'-side region outside of
the target region in the host DNA are identified. In the present
invention, each of the 5'-side region outside of the target region
and 3'-side region outside of the target region means a region
adjacent to the target region, but do not contain the target
region. That is, the target region lies between the 5'-side region
outside of the target region and 3'-side region outside of the
target region. Hereinafter, the 5'-side region outside of the
target region will be referred to as "5'-outside-region", and the
3'-side region outside of the target region will be referred to as
"3'-outside-region". The nucleotide sequences of the
5'-outside-region and the 3'-outside-region can be identified by
using a database containing the nucleotide sequence information of
the organism genome, and can also be identified by analyzing the
nucleotide sequence of the target region and a neighboring
nucleotide sequence thereof. In the present specification, the
terms 5' and 3' are to be understood that they are associated with
one of the strands of the double-stranded nucleic acid. In FIG. 1
and FIG. 2, the 5'-outside-region is represented by A, while the
3'-outside-region is represented by B.
[0061] Next, the first homologous recombination region is
identified. The first homologous recombination region is located
inside the targeted region in the host DNA. In the present
invention, the first homologous recombination region means a region
that can perform the first homologous recombination between the
Donor DNA and the host DNA together with the 5'-outside-region
described above. In FIG. 1 and FIG. 2, the first homologous
recombination region is represented by C. The first homologous
recombination region C may be located close to the
5'-outside-region, but is preferably a region separated from the
5'-outside-region in the direction toward 3' region by 0 kb to 200
kb, particularly preferable 0 kb to 140 kb.
[0062] Similarly to the targeted region described above, the first
homologous recombination region may be any region if it is
presented in the host DNA before application of the method of the
present invention, because the first homologous recombination
region is located inside the targeted region. The first homologous
recombination region includes may be an inherent region or a region
introduced artificially before application of the method of the
present invention. Examples of the artificially introduced regions
include a region including a selectable marker gene, a region
including a reporter gene, and the like.
[0063] If there is no first homologous recombination region having
sufficient length between the 5'-outside-region and the
3'-outside-region of the host DNA; alternatively, if there is no
DNA sequence at all between the 5'-outside-region and the
3'-outside-region, it is possible to form a first homologous
recombination region by inserting a known DNA sequence (e.g., a DNA
sequence of drug-resistance gene, etc.) into the host DNA by using
a common genetic manipulation method. For example, as shown in FIG.
3, a region A derived from host DNA, a region B derived from host
DNA, and a drug-resistance gene sequence are constructed by SOE
(splicing by overlap extension)-PCR method (see, for example,
Horton, R M., et al.: Gene, 77, pp. 61-68 (1989)) and the
drug-resistance gene can be introduced into the host DNA by
double-crossover homologous recombination between the region A and
the region B of the host DNA.
[0064] By using a host DNA previously introduced with a DNA
sequence such as drug-resistance gene as the first homologous
recombination region as described above, it is possible to insert
only a desired DNA sequence into the host DNA while the native
sequence of the host DNA is retained by the replacement method of
the present invention (see FIG. 4). In such a case, the DNA
sequence previously inserted as the first homologous recombination
region is removed from the host DNA through the second homologous
recombination step described later and does not remain in the host
DNA after modification (see FIG. 4(iv)). The method of the present
invention includes such a method of the insertion of a desired DNA
sequence into a target region while the host DNA sequence is
retained.
[0065] After the determination of the 5'-outside-region, the
3'-outside-region and the first homologous recombination region in
the host DNA, the donor DNA using the present invention is
identified.
[0066] In the present invention, the donor DNA can be used for
modifying, deleting and replacing the target region (the target
region for deletion and the target region for replacement) placed
between the 5'-outside-region and the 3'-outside-region in the host
DNA. The donor DNA that can be used in the present invention has
the region homologous to the 5'-outside-region A of the host DNA,
the region homologous to the 3'-outside-region B of the host DNA
and the region homologous to the first homologous recombination
region C of the host DNA in that order. (Hereinafter, each of these
regions is referred to as "homologous region".) In addition to the
three homologous regions, the donor DNA has the selectable marker
cassette between the homologous regions of the 3'-outside-region B
and the first homologous recombination region C (see Donor DNA in
FIG. 1(i) and FIG. 2(i)). Hereinafter, these homologous regions of
donor DNA will also be simply referred to as 5'-outside-region of
donor DNA, 3'-outside-region of donor DNA, and the first homologous
recombination region of donor DNA. In FIGS. 1 and 2, the
5'-outside-region of the donor DNA is represented by A; the
3'-outside-region is represented by B; and the first homologous
recombination region of the donor DNA is represented by C.
[0067] The selectable marker cassette is a nucleotide fragment
having the first selectable marker gene M1, the expression-inducing
promoter and the second selectable marker gene M2 expressed under
the control of the expression-inducing promoter.
[0068] In the present invention, the 5'-outside-region of the donor
DNA, the 3'-outside-region of the donor DNA and the first
homologous recombination region of the donor DNA are involved in
genetic exchange between two strands of DNA in the process of
homologous recombination between the host DNA and the donor DNA or
in the process of homologous recombination in the host DNA after
incorporation of the donor DNA into the host DNA. Thus, each of the
5'-outside-region of the donor DNA, the 3'-outside-region of the
donor DNA and the first homologous recombination region of the
donor DNA has a sufficiently high sequence homology (identity) to
perform the homologous recombination between these regions and the
corresponding regions of the host DNA.
[0069] The nucleotide sequence homology between respective regions
is calculated, for example, by Lipman-Pearson method (Science, 227,
1435, (1985)). Specifically, it can be calculated by performing
analysis using a homology analysis (Search homology) program of
genetic information processing software Genetyx-Win (Software
Development) while the unit size to compare (ktup) is set to 2. The
calculation results show that the nucleotide sequences of
respective regions preferably has an homology of 60% or more, more
preferably 80% or more, still more preferably 90% or more,
particularly preferably 95% or more, and most preferably 99% or
more.
[0070] The size of the 5'-outside-region, the 3'-outside-region and
the first homologous recombination region in the donor DNA or the
host DNA is not particularly limited, if the size is suitable for
formation of the interchain exchange structure, and, for example,
preferably 0.1 kb to 3 kb, more preferably 0.5 kb to 3 kb, and
particularly preferably 0.5 kb to 2 kb.
[0071] Next, the selectable marker cassette according to the
present invention will be described. The selectable marker cassette
according to the present invention has the first selectable marker
gene M1, the expression-inducing promoter, and the second
selectable marker gene M2 expressed under regulation of the
expression-inducing promoter. The selectable marker cassette is
located between the 3'-outside-region of the donor DNA and the
first homologous recombination region of the donor DNA.
[0072] The size of the selectable marker cassette is not
particularly limited, but preferably 3 kb to 10 kb, more preferably
3 kb to 5 kb.
[0073] The first selectable marker gene M1 that can be used in the
present invention is not particularly limited, and examples thereof
include a drug-resistance gene (chloramphenicol-resistance gene,
erythromycin-resistance gene, neomycin-resistance gene,
spectinomycin-resistance gene, kanamycin-resistance gene
tetracycline-resistance gene and blasticidin S-resistance gene,
etc.). Alternatively, a nutrition requirement-related gene may be
used as the first selectable marker gene M1.
[0074] In the present invention, the first selectable marker gene
M1 is preferably a drug-resistance gene, most preferably a
spectinomycin-resistance gene or a kanamycin-resistance gene.
[0075] The second selectable marker gene M2 according to the
present invention is not particularly limited, as long as it is a
gene different from the first selectable marker gene M1 described
above and a gene showing a phenotype selectable if it is eliminated
from the host DNA.
[0076] As the second selectable marker gene M2, for example, a LacZ
gene (.beta.-lactamase-coding gene) can be used. When lacZ
gene-expressing cells are cultured in a x-gal-containing medium,
x-gal is decomposed, and thus, blue colonies can be observed.
Accordingly if the lacZ gene is used as the second selectable
marker gene M2, the cells lacking the second selectable marker gene
M2 form colonies in normal color, thereby selecting desired
transformed cells by observing the color of colonies. If lacZ
gene-expressing cells are cultured in lactose-containing MacConkey
medium, decomposition of lactose can be observed. Therefore, if the
lacZ gene is used as the second selectable marker gene M2, cells
lacking the second selectable marker gene M2 do not lead to lactose
decomposition, thereby selecting cells lacking the marker gene by
observing the concentration of lactose in the medium.
[0077] As the second selectable marker gene M2, an amyE gene
(amylase-coding gene) can be used. Culture of amyE gene-expressing
cells in a starch-containing medium allows observation of halo
formation by decomposition of starch components. Thus, if the amyE
gene is used as the second selectable marker gene M2, the cell
lacking the second selectable marker gene M2 does not lead to
decomposition of starch components, thereby selecting desired cells
by observing presence of halo formation.
[0078] As the second selectable marker gene M2, a gene encoding a
protein emitting light by excitation light, such as gfp gene (yfp
gene, cfp gene, bfp gene, or rfp gene), can be used. For example,
if a gfp gene is used as the second selectable marker gene M2, the
cell having the second selectable marker gene M2 allows observation
of fluorescence, while the cell lacking the second selectable
marker gene M2 does not allow observation of fluorescence. It is
thus possible to select the cell lacking the second selectable
marker gene M2 by observing the fluorescence of cell.
[0079] The second selectable marker gene M2 is preferably is
preferably a gene leading to the death of cells (hereinafter,
referred to as lethal gene). Examples of the lethal gene include a
gene encoding a cell proliferation-inhibiting protein such as chpA
gene (ribonuclease-coding gene) or ccdB gene (DNA gyrase
inhibitor-coding gene), Kid gene, RelE gene, SymE gene
(Endoribonuclease-coding gene), Hok gene, TxpA gene (Lytic
peptide-coding gene), Doc gene (Protein synthesis
inhibition-related gene), and PerE gene (DNA gyrase
inhibition-related gene). Among these, a lethal gene that can be
used in the present invention is more preferably the gene encoding
a cell proliferation-inhibiting protein such as chpA gene
(ribonuclease-coding gene) or ccdB gene (DNA gyrase
inhibitor-coding gene). The cell expressing the lethal gene such as
chpA gene does not proliferate and dies. If the lethal gene such as
chpA gene is used as the second selectable marker gene M2, the cell
lacking the second selectable marker gene M2 can proliferate and
grow, and thus, it is possible to select the desired transformant
by observing colony formation.
[0080] The chpA gene is known as a gene encoding mazF toxin, a kind
of toxin to Escherichia coli. The nucleotide sequence of the chpA
gene is shown as SEQ ID No. 1, and the amino acid sequence of the
toxin coded by the chpA gene is shown as SEQ ID No. 2.
[0081] The second selectable marker gene M2 in the donor DNA or the
selectable marker cassette is placed at a position where it is
expressed under the control of the expression-inducing promoter. In
the present invention, the term "expression-inducing promoter"
means a promoter having a function to induce gene expression only
under a particular condition. Examples of the particular conditions
include presence of an induction substance (inducer), presence of a
medium component such as carbon source, temperature, and
others.
[0082] The expression-inducing promoter that can be used in the
present invention is preferably a promoter having a function to
induce downstream gene expression in the presence of an induction
substance (inducer).
[0083] Examples of the expression-inducing promoters include, but
are not limited to, a lac promoter and a spac promoter inducing
expression in the presence of
isopropyl-.beta.-D-thio-galactopyranoside (IPTG), a
xylose-inducible promoter, an arabinose-inducible promoter, a ECF
sigma factor-specific promoter (see, for example, Bacillus subtilis
and its closest relatives. pp. 289-312, RNA polimerase and Sigma
factors, J. Helmann and C. Moran Jr., Editors: A. Sonenshein, J
Hoch, R Losick: ASM Press), a promoter regulated by Mg/Cu
two-component regulation system, and the like. Among there, a spac
promoter is preferably used in the present invention.
[0084] If the lac promoter or spac promoter is used, the donor DNA
or the selectable marker cassette contains a lacI gene encoding the
repressor inhibiting these promoters in the absence of IPTG. The
repressor-coding gene, lacI gene, is also placed between the
3'-outside-region B and the first homologous recombination region C
of the donor DNA.
[0085] The donor DNA, including the 5'-outside-region A, the
3'-outside-region B, the first selectable marker gene M1, the
expression-inducing promoter, the second selectable marker gene M2
and the first homologous recombination region C, can be prepared by
using the conventional gene manipulation techniques. For preparing
the donor DNA, for example, a DNA fragment such as a PCR product,
entire genome or a part of it, a plasmid, a shuttle vector, a
helper plasmid, a phage DNA, a virus vector, a BAC DNA (Proc. Natl.
Acad. Sci. USA 87, 8242 (1990)) and a YAC DNA (Science 236, 806
(1987)) and the like can be used. Further, a DNA fragment, a part
of genome DNA and the like cloned in a plasmid, a shuttle vector, a
helper plasmid, a phage DNA, a virus vector, a BAC and YAC DNAs,
and the like can be used.
[0086] Examples of the plasmid include a Escherichia coli-derived
plasmid (e.g., pET plasmids such as pET30b, pBR plasmids such as
pBR322 and pBR325, pUC plasmids such as pUC118, pUC119, pUC18 and
pUC19, a pBluescript plasmid, etc.), a Bacillus subtilis-derived
plasmid (e.g., pUB110, pTP5, etc.), a yeast-derived plasmid (e.g.,
YEp plasmids such as YEp13, YCp plasmids such as YCp50, etc.) and
the like. Examples of the phage DNA include a .lamda.phage (e.g.,
Charon4A, Charon21A, EMBL3, EMBL4, .lamda.gt10, .lamda.gt11,
.lamda.ZAP, etc.) and a PBS1 phage (see, for example, J. Bacteriol.
90, 1575 (1965)). Further, an animal virus vector such as
retrovirus or vaccinia virus, a plant virus vector such as
cauliflower mosaic virus, and an insect virus vector such as
baculovirus can be used. Alternatively, if LP (lysis of
protoplasts) transformation method (see, for example, T. Akamatsu
and J. Sekiguchi, Archives of Microbiology, 1987, 146, p. 353-357;
T. Akamatsu and H. Taguchi, Bioscience, Biotechnology, and
Biochemistry, 2001, 65, 4, p. 823-829) is used, for example, a
microorganism having a donor DNA itself such as Bacillus subtilis
may be used.
[0087] The donor DNA used in the replacement method of the present
invention will be described below more in detail.
[0088] The donor DNA used in the replacement method of the present
invention has the desired DNA sequence between 5'-outside-region of
the donor DNA and the 3'-outside-region of the donor DNA, in
addition to the configuration of the donor DNA described above (see
FIG. 2(i): donor DNA).
[0089] In the present invention, the "desired DNA sequence
(hereinafter, also referred to as "DNA sequence of interest")" may
be any DNA sequence, if it can be inserted into the target region
of host DNA. Examples thereof include a gene encoding a protein, a
gene encoding a regulator such as promoter, and the like. The
desired DNA sequence may contain a plurality of these genes. For
example, the desired DNA sequence may have a promoter sequence and
a protein-coding gene sequence, or a plurality of regulator
sequences and a plurality of gene sequences.
[0090] In the replacement method of the present invention, the size
of the desired DNA sequence inserted is not particularly limited,
if the donor DNA can be introduced into the host cell, but
preferably 1 bp or more and 10 kb or less, more preferably 1 bp or
more and 5 kb or less.
[0091] The method of preparing the desired DNA sequence that can be
used in the present invention is not particularly limited, and the
desired DNA sequence may be designed and prepared by the known
method such as a PCR method and a method using a DNA ligase. For
example, a DNA sequence in combination of any promoter sequence and
any gene sequence may be prepared as the desired DNA sequence and
then inserted into a desired region of host DNA.
[0092] The desired DNA sequence or the donor DNA is not always a
PCR product. For example, an desired DNA sequence digested with a
restriction enzyme may be ligated into a region between the
5'-outside-region and 3'-outside-region of donor DNA by using a DNA
ligase, and the obtained DNA fragment (5'-outside-region-desired
DNA sequence-3'-outside-region) may be amplified by PCR method, and
then, the amplified product and a selectable marker cassette may be
connected to each other by using a DNA ligase, to prepare a donor
DNA.
[0093] According to the replacement method of the present
invention, it is possible to insert the desired DNA sequence into
the host by replacing the target region in the host DNA with the
desired DNA sequence. By using the replacement method of the
present invention, it is possible to insert a DNA fragment that is
hard to clone by a conventional method of using a plasmid (e.g.,
large-sized DNA sequence, membrane protein-coding gene, gene
showing toxicity when introduced in host cell and resistant to
insertion into a multi-copy plasmid, or DNA sequence containing a
plurality of gene groups, a plurality of regulators and others)
into the host DNA with simple and easy procedure. It is also
possible by the replacement method of the present invention to
insert a plurality of large-sized DNA fragments into a plurality of
sites (loci) in the host DNA.
[0094] It is thus possible by the replacement method of the present
invention to insert a gene group such as gene group encoding
proteins forming a biosynthetic system and gene group encoding
proteins functioning as a protein complex as they are expressed, in
the same cell. As a result, it is possible to perform functional
analysis of the gene group in cell by expressing the inserted genes
of the gene group simultaneously in the cell. In metagenome
analysis in recent years, DNAs recovered from environmental samples
are cloned into a plasmid for sequencing. The DNAs present in an
environment contains many DNA fragments that can not be cloned into
plasmid. The replacement method of the present invention is also
useful for cloning such DNA fragments and functional analysis of
the genes in the DNA fragments.
[0095] In the present invention, the donor DNA is constructed by
the above described procedure and is introduced into the host DNA
for the modification, deletion or replacement of the target region
in the host DNA.
[0096] The host DNA according to the present invention includes a
genome DNA, a mitochondrial DNA and the like in an organism.
[0097] Examples of the host (recipient) according to the present
invention include Bacillus species such as Bacillus subtilis,
Escherichia species such as Escherichia coli, and Pseudomonas
species such as Pseudomonas putida; yeasts such as Saccharomyces
cerevisiae and Schizosaccharomyces pombe; animal cells such as
simian cell COS-7, Vero, Chinese hamster oval cell (CHO cell) and
mouse L cell; insect cells such as Sf9; plants such as Poaceae
(rice (Oryza sativa), corn (Zea mays)), Brassicaceae (Thale Cress
(Arabidopsis thaliana)), Solanaceae (tobacco (Nicotiana tabacum)
and Fabaceae (soybean (Glycine max)); and the like. In particular,
Bacillus subtilis is preferably used as the host according to the
present invention.
[0098] In the present invention, the method of introducing the
donor DNA into the host is not particularly limited, if it is a
method of introducing DNA into cell. For example, a method of using
calcium ion, electroporation method, and the like may be used.
[0099] When Bacillus subtilis is used as the host, competent cell
transformation method (see, for example, J. Bacterial. 93, 1925
(1967)) or LP transformation method (see, for example, T. Akamatsu
and J. Sekiguchi, Archives of Microbiology, 1987, 146, p. 353-357;
T. Akamatsu and H. Taguchi, Bioscience, Biotechnology, and
Biochemistry, 2001, 65, 4, p. 823-829) may be used.
[0100] When yeast is used as the host, the method of introducing
DNA is not particularly limited, if it can introduce DNA into
yeast. For example, an electroporation method, spheroplast method,
lithium acetate method and the like may be used.
[0101] When an animal cell is used as the host, examples of the
method of introducing DNA into animal cell include an
electroporation method, calcium phosphate method, lipofection
method and the like. When an insect cell is used as the host,
examples of the method of introducing DNA into insect cell include
a calcium phosphate method, lipofection method, electroporation
method and the like. When a plant is used as the host, examples of
the method of introducing DNA into plant cell include an
electroporation method, agrobacterium method, particle gun method,
PEG method and the like.
[0102] In the present invention, after introduction of the donor
DNA into the host by the method described above, the donor DNA and
the host DNA are brought close to each other under the condition of
homologous recombination, thereby causing double-crossover
homologous recombination between the donor DNA and the host DNA at
the regions of the 5'-outside-region A and the first homologous
recombination region C (in FIGS. 1 and 2, "first homologous
recombination"). As the result of the double-crossover homologous
recombination (the first homologous recombination), in the deletion
method of the present invention, the 3'-outside-region B of the
donor DNA, the first selectable marker gene M1 and the second
selectable marker gene M2 can be introduced to the position between
the 5'-outside-region A of the host DNA and the first homologous
recombination region C of the host DNA (see FIG. 1(ii)). In the
replacement method of the present invention, the desired DNA
sequence of the donor DNA, the 3'-outside-region B of the donor
DNA, the first selectable marker gene M1 and the second selectable
marker gene M2 can be introduced into the position between the
5'-outside-region A of the host DNA and the first homologous
recombination region C of the host DNA (see FIG. 2(ii)).
[0103] The term "condition of homologous recombination" means a
condition in which the inherent functions of the host such as a
function of recombination reaction-related enzymes are not
lost.
[0104] Examples of the methods of carrying out the recombination
between the donor DNA and host DNA include general competent cell
transformation method (see, for example, J. Bacterial. 93, 1925
(1967)), protoplast transformation method (see, for example, Mol.
Gen. Genet. 168, 111 (1979)), electroporation method (see, for
example, FEMS Microbiol. Lett. 55, 135 (1990)), and LP
transformation method (see, for example, T. Akamatsu and J.
Sekiguchi, Archives of Microbiology, 1987, 146, p. 353-357; T.
Akamatsu and H. Taguchi, Bioscience, Biotechnology, and
Biochemistry, 2001, 65, 4, p. 823-829).
[0105] If the host is Bacillus subtilis, for example, the
transformation can be performed according to the competent cell
transformation method (see, for example, J. Bacterial. 93, 1925
(1967)) in the following manner.
[0106] The host cells are shake-cultured in SPI medium (0.20% (W/V)
ammonium sulfate, 1.40% (W/V) dipotassium hydrogen phosphate, 0.60%
(W/V) potassium dihydrogen phosphate, 0.10% (W/V) trisodium citrate
dihydrate, 0.50% (W/V) glucose, 0.02% (W/V) casamino acid (Difco),
5 mM magnesium sulfate, 0.25 .mu.M manganese chloride, and 50
.mu.g/ml tryptophan) at 37.degree. C., for example to growth rate
(O.D. 600) of about 1. After the shake culture, part of the culture
solution is inoculated in a 9-time volume of SPII medium (0.20%
ammonium sulfate, 1.40% (W/V) dipotassium hydrogen phosphate, 0.60%
(W/V) potassium dihydrogen phosphate, 0.10% (W/V) trisodium citrate
dihydrate, 0.50% (W/V) glucose, 0.01% (W/V) casamino acid (Difco),
5 mM magnesium sulfate, 0.40 .mu.M manganese chloride, 5 .mu.g/ml
tryptophan), and the mixture was shake-cultured, for example to
growth rate (O.D. 600) of about 0.4, to prepare competent cells of
the host cells.
[0107] Then, the donor DNA is added to the competent cells of the
host strain. The amount of the donor DNA added is not particularly
limited, but preferably 100 pg to 100 .mu.g, and more preferably 1
ng to 10 .mu.g. The competent cells are preferably used at 10.sup.5
to 10.sup.9 CFU, and more preferably 10.sup.6 to 10.sup.8 CFU. The
donor DNA is added to the competent cells of the host strain, and
the cells are cultured for 1 hour to 2 hours.
[0108] In the steps above, the donor DNA is introduced into the
host cell, thereby causing the first homologous recombination
between the donor DNA and the host DNA (see FIG. 1(i) to (ii) and
FIG. 2(i) to (ii), "First homologous recombination").
[0109] After the first homologous recombination, recombinant hosts
can be selected based on expression of the first selectable marker
gene derived from the donor DNA. Because the first selectable
marker gene is expressed in the recombinant host after the first
homologous recombination, it is possible to select the recombinant
hosts after the first homologous recombination from the other hosts
by observing the phenotype of the marker gene. For example, when a
drug-resistance gene described above is used as the first
selectable marker gene, host cells with the drug resistance may be
selected.
[0110] After single colony isolation, the recombinant hosts (e.g.,
transformants of Bacillus subtilis) obtained by the first
homologous recombination are cultured for 0 to 48 hours (preferably
1 to 24 hours, particularly preferably 2 to 3 hours), to perform
homologous recombination between the two 3'-outside-regions in the
host DNA (second homologous recombination; see FIG. 1(iii) and FIG.
2(iii)). The second homologous recombination leads to the
modification of the target region in the host DNA and the deletion
of the first selectable marker gene and the second selectable
marker gene from the host DNA (see FIG. 1(iv) and FIG. 2(iv)).
Because of the deletion of the first selectable marker gene, a
phenotype of transformant obtained after the second homologous
recombination has been changed. when a drug-resistance gene is used
as the first selectable marker gene, the drug resistance obtained
by the first homologous recombination is lost and thus, the
transformant shows a drug-sensitive phenotype.
[0111] After the second homologous recombination, the second
selectable marker gene expressed under the control of the
expression-inducing promoter is also deleted from the host DNA.
Accordingly, no second selectable marker gene is expressed in the
host which is modified by the second homologous recombination, even
if the host cells are cultured under expression-inducing
condition.
[0112] If the second homologous recombination is unsuccessful, the
expression-inducing promoter and the second selectable marker gene
remain in the host DNA. In this case, the second selectable marker
gene is expressed in the host under expression-inducing
condition.
[0113] In this way, it is possible to select the host with second
homologous recombination from the other hosts based on expression
of the second selectable marker gene.
[0114] When lacZ gene is used as the second selectable marker gene,
it is possible to select the hosts with second homologous
recombination from other hosts based on the blue color development
by x-gal decomposition on x-gal-containing medium. Specifically,
the hosts with second homologous recombination give colonies in
normal color, because the lacZ gene is not expressed. It is thus
possible to select only the hosts with second homologous
recombination by selecting non-blue normal colored colonies.
[0115] When amyE gene is used as the second selectable marker gene,
it is possible to select the hosts with second homologous
recombination from other hosts based on the halo formation on
starch-containing medium. Thus, the hosts with second homologous
recombination do not form halo because the amyE gene is not
expressed. It is thus possible to select only the hosts with second
homologous recombination by selecting hosts giving normal colonies
without halo formation.
[0116] When gfp gene is used as the second selectable marker gene,
it is possible to select the hosts with second homologous
recombination from other hosts based on fluorescence. Specifically,
the hosts with second homologous recombination do not show
fluorescence, because the gfp gene is not expressed. It is thus
possible to select only the hosts with second homologous
recombination from other hosts by selecting hosts giving colonies
with no observed fluorescence.
[0117] In the present invention, the second selectable marker gene
is preferably a selectable marker gene which allows the selection
of the transformant after the second homologous recombination by
positive selection. It is possible by using such a selectable
marker gene to select only the transformant which is modified by
the second homologous recombination, at high accuracy without
selection of pseudopositive clones.
[0118] In the present invention, the term "positive selection"
means a method of selecting a desired transformant based on the
proliferation potency only of the desired transformant in a
particular medium.
[0119] In the present invention, the term "negative selection"
means a method of selecting a desired transformant based on the
defect in the proliferation potency only of the desired
transformant in a particular medium, or a method of selecting a
desired transformant based on the defect in production potency of a
particular protein. As used herein, the "defect in proliferation
potency in a particular medium" means, for example, that the
desired transformant loses its potency to produce a particular
protein and does not proliferate or remain alive in the particular
medium.
[0120] In the present invention, the second selectable marker gene
which allows selection of a desired transformant by positive
selection is preferably the lethal gene described above such as
chpA gene, ccdB gene, Kid gene, RelE gene, SymE gene, Hok gene,
TxpA gene, Doc gene, PerE gene and the like.
[0121] If the lethal gene is used as the second selectable marker
gene, only the host lacking the second selectable marker gene
through the second homologous recombination can proliferate and
grow in normal medium. While the host which fails to the second
homologous recombination can not proliferate and dies due to of the
expression of the lethal gene. Using the above lethal gene as the
second selectable marker gene, it is possible to select the desired
transformant with second homologous recombination by positive
selection at high accuracy.
[0122] On the other hand, if the transformants with the second
homologous recombination are to be selected by negative selection,
pseudopositive individuals may be erroneously selected as the
desired transformants. For example, if the first selectable marker
gene used in the first homologous recombination is used also as the
selectable marker in the second homologous recombination,
individuals while the first homologous recombination are chosen by
positive selection, while individuals with the second homologous
recombination are to be chosen by negative selection.
[0123] In the present invention, two kinds of selectable marker
genes (i.e., first and second selectable marker genes) are used,
and the second selectable marker gene expression is controlled by
the expression-inducing promoter. By selecting the kinds of these
selectable marker genes appropriately, it is possible to select the
transformant after first homologous recombination by positive
selection and the transformant after second homologous
recombination by positive selection. The first and second positive
selection leads to select the desired transformant at extremely
high accuracy without erroneously selecting pseudopositive
clones.
[0124] For example, the desired transformant with the second
homologous recombination can be selected from the other hosts by
adding IPTG to the medium when a promoter inducing gene expression
in the presence of IPTG such as spac promoter is used as the
expression-inducing promoter. In this case, only the desired
transformant with the second homologous recombination can grow in
the medium containing IPTG, while the other hosts are killed by the
lethal gene expression induced by IPTG.
[0125] In the above selection using IPTG, it is preferable to
repeat doubling of the cell concentration in a liquid medium (such
as LB medium) about 6 to 10 times, inoculate the culture on an agar
flat plate medium containing 100 .mu.M or more of IPTG, and thus,
obtain the colony-forming clones, because it suppose that the
second homologous recombination occurs simultaneously with
chromosomal duplication. Further, for preventing pseudopositive
clones caused by the spac promoter mutation due to selection
pressure, it is preferable to examine the change in phenotype
resulting from deletion of the first selectable marker gene,
simultaneously. Specifically, when the spectinomycin-resistance
gene is used as the first selectable marker gene, it is preferable
to select clones not growing on the agar plate containing 100
.mu.g/ml spectinomycin for confirming their spectinomycin
sensitivity. By using the change in phenotype resulting from the
deletion of the first selectable marker gene as an additional
indicator, it is possible to obtain desired transformant at very
high accuracy (almost at 100%).
EXAMPLES
[0126] Hereinafter, the present invention will be described more in
detail with reference to Examples, but it should be understood that
the technological scope of the present invention is not
particularly limited by the following Examples.
Example 1
[0127] In the present Example, the pro5 region (20,485 bp), which
is the region from 1,879,258 bp to 1,899,742 bp on the genome of
Bacillus subtilis 168, was deleted as the target region for
deletion. The sequences of the primers used in the present Example
are shown in Table 1. The flow diagrams of the present Example are
shown in FIG. 5 and FIG. 6. TABLE-US-00001 TABLE 1 Primer sequences
SEQ ID Primer Nucleotide sequence NO: pO2HC-lacF
CTCACATTAATTGCGTTGCG 3 pO2HC-lacR CTTACCATAGTTAATTTCTCCTCTTTAATG 4
chpA-F GAAATTAACTATGGTAAGCCGATACGTACC 5 chpA-R
CGCGGATCCTACCCAATCAGTACGTTAATTTTG 6 APNC-F CGACAGCGGAATTGACTCAAGC 7
pro5-DF1 GAGCAAAGAAGAGCGCATGG 8 pro5-DR1
CAGCATGGAGAAGATTTCAACGTAATTATGG 9 pro5-DF2
CGTTGAAATCTTCTCCATGCTGTGTGATTGATC 10 pro5-DR2
CTGATTGGGTAGGATCCGCGATATTTATCGACGAACTCAGAT 11 pro5-IF
GAGTCAATTCCGCTGTCGATCAATCACAATGGAGGAC 12 pro5-IR
TACGTAAGTATCAGCACAGG 13 pro5-checkF CTGCAAACCCATACCTTGCAC 14
pro5-checkR CATCACTAAATCTCTTAAACGTC 15
<Preparation of Donor DNA>
[0128] First, mutant strains, Bacillus subtilis 168 (aprE::spec,
lacI, Pspac-chpA) and Bacillus subtilis 168 (aprE::Km, lacI,
Pspac-chpA), were constructed in the following manner from Bacillus
subtilis 168 strain by inserted a DNA fragment containing the
spectinomycin-resistance gene or the kanamycin-resistance gene, the
lacI gene and the Pspac-chpA gene into the aprE locus of Bacillus
subtilis 168.
[0129] As shown in FIG. 5, the region from the lacI gene to the SD
sequence downstream of the spac promoter in Bacillus subtilis
expression vector pO2HC was amplified by PCR using the vector as a
template and using a primer set of pO2HC-lacF (SEQ ID NO: 3) and
pO2HC-lacR (SEQ ID NO: 4). An other region from the initiation
codon to the termination codon of chpA gene in the genome of E.
coli W3110 was also amplified by PCR using the genome of E. coli
W3110 as a template and a primer set of chpA-F (SEQ ID NO: 5) and
chpA-R (SEQ ID NO: 6). The two amplified DNA fragments were ligated
by SOE-PCR method (Gene, 77, 61 (1989)), to give a ligated DNA
fragment.
[0130] Then, the ligated DNA fragment was digested with restriction
enzymes ApaI and BamHI, to obtain restriction enzyme-digested
fragments. Similarly, pAPNC213 (including the
spectinomycin-resistance gene: spec.sup.R) or pAPNCK (including the
kanamycin-resistance gene: Km.sup.R) was digested with the
restriction enzymes ApaI and BamHI, to obtain restriction
enzyme-digested fragments. These restriction enzyme-digested
fragments were ligated by using DNA ligase, to obtain a circular
DNA.
[0131] Bacillus subtilis 168 was transformed with the circular DNA,
and then plated on LB medium plate containing 100 .mu.g/ml of
spectinomycin or 5 .mu.g/ml of kanamycin to select desired
transformants. The desired transformants were designated as 168
(aprE::spec, lacI, Pspac-chpA) and 168 (aprE::Km, lacI,
Pspac-chpA).
[0132] By using the chromosomal DNA of the strain 168 (aprE::spec,
lacI, Pspac-chpA) or 168 (aprE::Km, lacI, Pspac-chpA) as a
template, a DNA fragment was amplified by PCR using APNC-F primer
(SEQ ID NO: 7) and chpA-R primer (SEQ ID NO: 6) (see FIG. 5). The
amplified DNA fragment was referred to as selectable marker gene
cassette.
[0133] In addition, the 5'-outside-region (fragment A) of the
target region for deletion, 3'-outside-region (fragment B) of the
target region for deletion and the first homologous recombination
region (fragment C) were amplified by PCR from the chromosomal DNA
of Bacillus subtilis 168 using primer sets of pro5-DF1 (SEQ ID NO:
8) and pro5-DR1 (SEQ ID NO: 9), pro5-DF2 (SEQ ID NO: 10) and
pro5-DR2 (SEQ ID NO: 11), and pro5-IF (SEQ ID NO: 12) and pro5-IR
(SEQ ID NO: 13), respectively (see FIG. 6 (i)).
[0134] Using the thus-obtained PCR fragments, i.e. the selectable
marker gene cassette, the 5'-outside-region (fragment A), the
3'-outside-region (fragment B) and the first homologous
recombination region (fragment C), SOE-PCR (Gene, 77, 61 (1989))
were performed with the primer set of pro5-DF1 (SEQ ID NO: 8) and
pro5-IR (SEQ ID NO: 13). As a result, a DNA fragment which has the
5'-outside-region (fragment A), the 3'-outside-region (fragment B),
the selected marker gene cassette and the first homologous
recombination region (fragment C) aligned in that order, was
obtained as shown in FIG. 6 (i). This DNA fragment was used in the
following transformation as a donor DNA.
<Transformation>
1. First Homologous Recombination
[0135] Using the PCR product (the donor DNA obtained above) in an
amount of 20 .mu.g or more, Bacillus subtilis 168 was transformed
according to the competent cell transformation method (J.
Bacterial. 93, 1925 (1967)). 1 .mu.g of the PCR product (donor DNA)
is added to 400 .mu.l of competent cells of Bacillus subtilis 168,
and the mixture was cultured for 1.5 hours (the first homologous
recombination (see FIG. 6 (i) to (ii)).
[0136] After the transformation (first homologous recombination),
the transformants were selected based on expression of the
spectinomycin-resistance gene or kanamycin-resistance gene.
Specifically, the cells after the transformation were plated on a
LB medium plate containing 100 .mu.g/ml of spectinomycin or 5
.mu.g/ml of kanamycin overnight at 37.degree. C., and then colonies
grown on the LB medium plate were collected as transformants. Only
the mutant Bacillus subtilis strain having spectinomycin-resistance
or the kanamycin-resistance resulting from the integration of the
donor DNA into Bacillus subtilis 168 strain through the first
homologous recombination, can grow and form colonies on the LB
medium plate containing spectinomycin or kanamycin.
2. Second Homologous Recombination
[0137] The transformant having the spectinomycin resistance or the
kanamycin resistance was cultured overnight in LB liquid medium.
After dilution of the culture, the culture solution was applied on
a LB medium plate supplemented with 1 mM IPTG. As a result, 48
colonies were obtained. These colonies growing on IPTG-containing
LB medium plate are the Bacillus subtilis transformants in which
the target region for deletion and the donor DNA were both deleted
from the host DNA by the second homologous recombination (see FIG.
6 (iii) to (iv)).
[0138] Further, for confirming the deletion of the pro5 region (the
target region for deletion), the obtained 48 single colonies of
Bacillus subtilis transformants were examined by PCR using
pro5-checkF primer (SEQ ID NO: 14) and pro5-checkR primer (SEQ ID
NO: 15). As a result, all 48 transformants did not have the pro5
region.
[0139] As is apparent from the above results, it is possible to
delete a desired region in Bacillus subtilis genome at high
accuracy by the method of the present invention using the donor DNA
and the selectable marker cassette contained therein.
[0140] Further, neither the spectinomycin-resistance gene nor the
kanamycin-resistance gene used in the transformation steps as the
selectable marker gene remains in the resultant transformant.
Therefore, the transformant obtained by the method of the present
invention can be repeatedly used for further transformation with
the spectinomycin-resistance gene or the kanamycin-resistance gene
as the selectable marker gene.
Example 2
[0141] In the present Example, the flgB-fliH region (4,708 bp)
corresponding to 1,690,526 bp to 1,695,233 bp in the genome of
Bacillus subtilis 168 was used as the desired DNA sequence, and the
DNA sequence was inserted into the target regio for replacement in
the host DNA. The sequences of the primers used in the present
Example are shown in Table 2. The flow diagram of the present
Example is shown in FIG. 7. TABLE-US-00002 TABLE 2 Primer sequences
SEQ ID Primer Nucleotide sequence NO: chpA-R
CGCGGATCCTACCCAATCAGTACGTTAATTTTG 6 APNC-F CGACAGCGGAATTGACTCAAGC 7
flgB-F GCGTTCAGCAACATGTCTGTTTCTCGACAAGGATATTGAGG 16 fliH-R
GCAGCTGCTTGTACGTTGATCCGTACCGTTTATACGAGTC 17 aprEclone-fF
TCTGATGTCTTTGCTTGGCG 18 aprEclone-fR ACAGACATGTTGCTGAACGC 19
aprEclone-bF ATCAACGTACAAGCAGCTGC 20 aprEclone-bR
CTGATTGGGTAGGATCCGCGCCATTATGTCATGAAGCACG 21 aprEclone-mF
GAGTCAATTCCGCTGTCGTTCTCACGGTACGCATGTAG 22 aprEclone-mR
AGAATTAACGCTGCTGCTCC 23 aprEclone-checkF TTGCAAATCGGATGCCTGTC 24
aprEclone-checkR TATTGTGGGATACGACGCTG 25
<Preparation of Donor DNA>
[0142] By using the chromosomal DNA of the strain 168 (aprE::spec,
lacI, Pspac-chpA) obtained in Example 2 as a template, a DNA
fragment was amplified by PCR using APNC-F primer (SEQ ID NO: 7)
and chpA-R primer (SEQ ID NO: 6) (see FIG. 5). The amplified DNA
fragment was referred to as selectable marker gene cassette.
[0143] In addition, the flgB-fliH region (desired DNA sequence),
the 5'-outside-region (fragment A) of the target region for
deletion, 3'-outside-region (fragment B) of the target region for
deletion and the first homologous recombination region (fragment C)
were amplified by PCR from the chromosomal DNA of Bacillus subtilis
168 using primer sets of flgB-F (SEQ ID NO: 16) and fliH-R (SEQ ID
NO: 17), aprEclone-fF (SEQ ID NO: 18) and aprEclone-fR (SEQ ID NO:
19), aprEclone-bF (SEQ ID NO: 20) and aprEclone-bR (SEQ ID NO: 21),
and aprEclone-mF (SEQ ID NO: 22) and aprEclone-mR (SEQ ID NO: 23),
respectively (see FIG. 7 (i)).
[0144] Using the thus-obtained PCR fragments, i.e. the selectable
marker gene cassette, the 5'-outside-region (fragment A), the
flgB-fliH region (desired DNA sequence), the 3'-outside-region
(fragment B) and the first homologous recombination region
(fragment C), SOE-PCR (Gene, 77, 61 (1989)) were performed with the
primer set of aprEclone-fF (SEQ ID NO: 18) and aprEclone-mR (SEQ ID
NO: 23). As a result, a DNA fragment which has the
5'-outside-region (fragment A), the flgB-fliH region (desired DNA
sequence), the 3'-outside-region (fragment B), the selected marker
gene cassette and the first homologous recombination region
(fragment C) aligned in that order, was obtained as shown in FIG. 7
(i). This DNA fragment was used in the following transformation as
a donor DNA.
<Transformation>
1. First Homologous Recombination
[0145] The transformation (first homologous recombination) and the
selection of transformants after the first homologous recombination
were performed in a similar manner to Example 1 above.
2. Second Homologous Recombination
[0146] The transformant having the spectinomycin resistance was
cultured overnight in LB liquid medium. After dilution of the
culture, the culture solution was applied on a LB medium plate
supplemented with 1 mM IPTG. As a result, 100 or more colonies were
obtained. These colonies growing on IPTG-containing LB medium plate
are the Bacillus subtilis transformants. In the transformant, the
flgB-fliH region (desired DNA sequence) was inserted into the
target region for replacement in the host DNA and the selectable
marker gene cassette was deleted from the host DNA through the
second homologous recombination (see FIG. 7 (iii) to (iv)).
[0147] Further, for confirming the insertion of the flgB-fliH
region (desired DNA sequence) and the deletion of the selectable
marker gene cassette, the obtained 24 single colonies of Bacillus
subtilis transformants were examined by PCR using aprEclone-checkF
primer (SEQ ID NO: 24) and aprEclone-checkR primer (SEQ ID NO: 25).
As a result, all 24 transformants have no selectable marker gene
cassette and have the flgB-fliH region.
[0148] As is apparent from the above results, it is possible to
introduce the desired DNA sequence into the target region for
replacement in Bacillus subtilis genome at high accuracy by the
method of the present invention using the donor DNA and the
selectable marker cassette contained therein.
[0149] Further, neither the spectinomycin-resistance gene nor the
kanamycin-resistance gene used in the transformation steps as the
selectable marker gene remains in the resultant transformant.
Therefore, the transformant obtained by the method of the present
invention can be repeatedly used for further transformation with
the spectinomycin-resistance gene or the kanamycin-resistance gene
as the selectable marker gene.
[0150] Having described our invention as related to the present
embodiments, it is our intention that the invention not be limited
by any of the details of the description, unless otherwise
specified, but rather be construed broadly within its spirit and
scope as set out in the accompanying claims.
[0151] This non-provisional application claims priority under 35
U.S.C. .sctn.119 (a) on Patent Application No. 2008-076008 filed in
Japan on Mar. 24, 2008, and Patent Application No. 2009-044193
filed in Japan on Feb. 26, 2009, each of which is entirely herein
incorporated by reference.
Sequence CWU 1
1
25 1 336 DNA Escherichia coli CDS (1)..(336) 1 atg gta agc cga tac
gta ccc gat atg ggc gat ctg att tgg gtt gat 48 Met Val Ser Arg Tyr
Val Pro Asp Met Gly Asp Leu Ile Trp Val Asp 1 5 10 15 ttt gac ccg
aca aaa ggt agc gag caa gct gga cat cgt cca gct gtt 96 Phe Asp Pro
Thr Lys Gly Ser Glu Gln Ala Gly His Arg Pro Ala Val 20 25 30 gtc
ctg agt cct ttc atg tac aac aac aaa aca ggt atg tgt ctg tgt 144 Val
Leu Ser Pro Phe Met Tyr Asn Asn Lys Thr Gly Met Cys Leu Cys 35 40
45 gtt cct tgt aca acg caa tca aaa gga tat ccg ttc gaa gtt gtt tta
192 Val Pro Cys Thr Thr Gln Ser Lys Gly Tyr Pro Phe Glu Val Val Leu
50 55 60 tcc ggt cag gaa cgt gat ggc gta gcg tta gct gat cag gta
aaa agt 240 Ser Gly Gln Glu Arg Asp Gly Val Ala Leu Ala Asp Gln Val
Lys Ser 65 70 75 80 atc gcc tgg cgg gca aga gga gca acg aag aaa gga
aca gtt gcc cca 288 Ile Ala Trp Arg Ala Arg Gly Ala Thr Lys Lys Gly
Thr Val Ala Pro 85 90 95 gag gaa tta caa ctc att aaa gcc aaa att
aac gta ctg att ggg tag 336 Glu Glu Leu Gln Leu Ile Lys Ala Lys Ile
Asn Val Leu Ile Gly 100 105 110 2 111 PRT Escherichia coli 2 Met
Val Ser Arg Tyr Val Pro Asp Met Gly Asp Leu Ile Trp Val As 1 5 10
15 Phe Asp Pro Thr Lys Gly Ser Glu Gln AlaGly His Arg Pro Ala Val
20 25 30 Val Leu Ser Pro Phe Met Tyr Asn Asn Lys Thr Gly Met Cys
Leu Cys 35 40 45 Val Pro Cys Thr Thr Gln Ser Lys Gly Tyr Pro Phe
Glu Val Val Leu 50 55 60 Ser Gly Gln Glu Arg Asp Gly Val Ala Leu
Ala Asp Gln Val Lys Ser 65 70 75 80 Ile Ala Trp Arg Ala Arg Gly Ala
Thr Lys Lys Gly Thr Val Ala Pro 85 90 95 Glu Glu Leu Gln Leu Ile
Lys Ala Lys Ile Asn Val Leu Ile Gly 100 105 110 3 20 DNA Artificial
Oligonucleotide as PCR primer pO2HC-lacF for amplification of lacI
gene including a promoter 3 ctcacattaa ttgcgttgcg 20 4 30 DNA
Artificial Oligonucleotide as PCR primer pO2HC-lacR for
amplification of lacI gene including a promoter 4 cttaccatag
ttaatttctc ctctttaatg 30 5 30 DNA Artificial Oligonucleotide as PCR
primer chpA-F for amplification of chpA gene 5 gaaattaact
atggtaagcc gatacgtacc 30 6 33 DNA Artificial Oligonucleotide as PCR
primer chpA-R for amplification of chpA gene 6 cgcggatcct
acccaatcag tacgttaatt ttg 33 7 22 DNA Artificial Oligonucleotide as
PCR primer APNC-F for amplification of a cassette comprising a
selection marker gene 7 cgacagcgga attgactcaa gc 22 8 20 DNA
Artificial Oligonucleotide as PCR primer pro5-DF1 for amplification
of 5' outer region 8 gagcaaagaa gagcgcatgg 20 9 31 DNA Artificial
Oligonucleotide as PCR primer pro5-DR1 for amplification of 5'
outer region 9 cagcatggag aagatttcaa cgtaattatg g 31 10 33 DNA
Artificial Oligonucleotide as PCR primer pro5-DF2 for amplification
of 3' outer region 10 cgttgaaatc ttctccatgc tgtgtgattg atc 33 11 42
DNA Artificial Oligonucleotide as PCR primer pro5-DR2 for
amplification of 3' outer region 11 ctgattgggt aggatccgcg
atatttatcg acgaactcag at 42 12 37 DNA Artificial Oligonucleotide as
PCR primer pro5-IF for amplification of first recombination region
12 gagtcaattc cgctgtcgat caatcacaat ggaggac 37 13 20 DNA Artificial
Oligonucleotide as PCR primer pro5-IR for amplification of first
recombination region 13 tacgtaagta tcagcacagg 20 14 21 DNA
Artificial Oligonucleotide as PCR primer pro5-checkF for
amplification of a region to check a deletion of interest 14
ctgcaaaccc ataccttgca c 21 15 23 DNA Artificial Oligonucleotide as
PCR primer pro5-checkR for amplification of a region to check a
deletion of interest 15 catcactaaa tctcttaaac gtc 23 16 41 DNA
Artificial Oligonucleotide as PCR primer flgB-F for amplification
of flgB-fliH region 16 gcgttcagca acatgtctgt ttctcgacaa ggatattgag
g 41 17 40 DNA Artificial fOligonucleotide as PCR primer fliH-R for
amplification of flgB-fliH region 17 gcagctgctt gtacgttgat
ccgtaccgtt tatacgagtc 40 18 20 DNA Artificial Oligonucleotide as
PCR primer aprEclone-fF for amplification of 5' outer region 18
tctgatgtct ttgcttggcg 20 19 20 DNA Artificial Oligonucleotide as
PCR primer aprEclone-fR for amplification of 5' outer region 19
acagacatgt tgctgaacgc 20 20 20 DNA Artificial Oligonucleotide as
PCR primer aprEclone-bF for amplification of 3' outer region 20
atcaacgtac aagcagctgc 20 21 40 DNA Artificial Oligonucleotide as
PCR primer aprEclone-bR for amplification of 3' outer region 21
ctgattgggt aggatccgcg ccattatgtc atgaagcacg 40 22 38 DNA Artificial
Oligonucleotide as PCR primer aprEclone-mF for amplification of
first recombination region 22 gagtcaattc cgctgtcgtt ctcacggtac
gcatgtag 38 23 20 DNA Artificial Oligonucleotide as PCR primer
aprEclone-mR for amplification of first recombination region 23
agaattaacg ctgctgctcc 20 24 20 DNA Artificial Oligonucleotide as
PCR primer aprEclone-checkF for amplification of a region to check
a deletion of selective marker and a insertion of flgB-fliH region
24 ttgcaaatcg gatgcctgtc 20 25 20 DNA Artificial Oligonucleotide as
PCR primer aprEclone-checkR for amplification of a region to check
a deletion of selective marker and a insertion of flgB-fliH region
25 tattgtggga tacgacgctg 20
* * * * *