U.S. patent application number 13/143935 was filed with the patent office on 2011-11-10 for oligonucleotide-coated affinity membranes and uses thereof.
Invention is credited to William James, Vladimir Rait.
Application Number | 20110275077 13/143935 |
Document ID | / |
Family ID | 42317203 |
Filed Date | 2011-11-10 |
United States Patent
Application |
20110275077 |
Kind Code |
A1 |
James; William ; et
al. |
November 10, 2011 |
Oligonucleotide-Coated Affinity Membranes and Uses Thereof
Abstract
A method of analyzing tissue sections in a manner that provides
information about the presence and expression levels of multiple
biomarkers at each location within the tissue section. The method
comprises the preparation of membranes having covalently bound
oligonucleotides and the use of those membranes for evaluation of
various markers in the sample. The membranes may be arranged in
stacks, wherein each layer has a different oligonucleotide capture
strand. Transfer oligonucleotides complementary to the capture
strands are attached through a cleavable bond to antibodies that
recognize and bind to specific biomarkers present in the tissue
sample. The tissue sample is exposed to the antibody-transfer
strand conjugate and then treated with a cleaving reagent. Upon
cleavage, the transfer strand migrates through the stack and binds
to the capture strand. The level of expression of the biomarker may
be determined by measuring expression of a reporter on the transfer
strand.
Inventors: |
James; William; (Potomac,
MD) ; Rait; Vladimir; (Rockville, MD) |
Family ID: |
42317203 |
Appl. No.: |
13/143935 |
Filed: |
January 11, 2010 |
PCT Filed: |
January 11, 2010 |
PCT NO: |
PCT/US10/20680 |
371 Date: |
July 11, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61193946 |
Jan 12, 2009 |
|
|
|
Current U.S.
Class: |
435/6.11 ;
525/54.2; 536/22.1; 536/25.4 |
Current CPC
Class: |
C12Q 1/6834 20130101;
C12Q 1/6816 20130101; C12Q 1/6816 20130101; G01N 33/54306 20130101;
C12Q 2563/179 20130101; C12Q 2563/179 20130101; C12Q 1/6834
20130101; C12Q 2565/515 20130101; C12Q 2565/515 20130101 |
Class at
Publication: |
435/6.11 ;
536/22.1; 536/25.4; 525/54.2 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C08G 73/10 20060101 C08G073/10; C08G 64/42 20060101
C08G064/42; C07H 21/00 20060101 C07H021/00; C08G 63/91 20060101
C08G063/91 |
Goverment Interests
GOVERNMENT SUPPORT
[0002] This invention was made with government support under
Cooperative Agreement #70NANB7H7028 awarded by the U.S. Department
of Commerce, National Institute of Standards and Technology. The
U.S. Government has certain rights in the invention.
Claims
1. A method of analyzing biomolecules in a tissue section
comprising the steps of: providing a stack of membranes, wherein
each of said membranes has a different oligonucleotide attached
thereto; providing a set of antibodies that have specific affinity
to the biomolecules in the tissue section, wherein each of said
antibodies has conjugated thereto a cleavable oligonucleotide that
can hybridize to the oligonucleotide attached to said membranes;
applying said antibodies to said tissue section in a manner that
permits the antibodies to bind to the biomolecules; cleaving said
oligonucleotides from said antibodies; transferring said cleaved
oligonucleotides from said antibodies to said membrane stack
whereupon the transferred oligonucleotide binds to complimentary
oligonucleotides attached to the membranes; detecting the
hybridization of the transferred oligonucleotides.
2. An oligonucleotide coated track etched membrane comprising: a
track etched membrane; and aminated oligonucleotides covalently
bound at their amino group to a carboxyl or carbonic group of the
track etched membrane.
3. An oligonucleotide coated track etched membrane comprising
either of the two structures: ##STR00001## Wherein X is a
structural component of the track etched membrane; N is an alkyl
amine connecting the oligonucleotide to the structural component of
the track etched membrane; R.sup.1 is a substituent of the alkyl
amine; and R.sup.2 is a linker that may be connected to a phosphate
group at a 5' or 3' terminal end of the
oligonucleotide/oligodeoxynucleotide; and ODN is an
oligodeoxynucleotide.
4. A method of capturing oligonucleotides from a sample comprising
the steps of: providing a stack of two or more track-etched
membranes, wherein each of said track-etched membrane has a
different oligonucleotide attached thereto that can hybridize with
an oligonucleotide in the sample; transferring said sample
oligonucleotides to said track-etched membrane stack wherein the
sample oligonucleotides hybridize to the oligonucleotides attached
to membranes.
5. The method according to claim 4 wherein said oligonucleotide is
attached to said membrane by a covalent bond.
6. The method according to claim 4, wherein said track etched
membranes are selected from the group consisting of polyimide track
etched membranes, polycarbonate track etched membranes, and
polyethylene terephthalate track etched membranes.
7. A method of making oligonucleotide coated track etched
membranes, said method comprising the steps of: obtaining track
etched membranes; obtaining aminated oligonucleotides; obtaining a
condensing agent; reacting said track etched membranes in the
presence of said condensing agent, thereby forming said
oligonucleotide coated track etched membranes.
8. The method according to claim 7, wherein said condensing agent
is a carbodiimide.
9. The method according to claim 8, wherein carbodiimide is
selected from the group consisting of
Dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride,
1-cyclohexyl-3-(2-morpholinoethyl)carbodiimide, and
1-benzyl-3-dimethylaminopropylcarbodiimide.
10. The method according to claim 7, wherein said track etched
membranes are selected from the group consisting of polyimide track
etched membranes, polycarbonate track etched membranes, and
polyethylene terephthalate track etched membranes.
11. The method according to claim 8, further comprising washing
said oligonucleotide bound track etched membrane in a solvent
having the capability to remove virtually any adsorbed aminated
oligonucleotides.
12. The method according to claim 11, wherein said solvent is a
polar aprotic solvent.
13. The method according to claim 12, wherein said polar aprotic
solvent comprises acetonitrile.
14. The method according claim 7, further comprising the step of
degassing said track etched membranes prior to exposing them to
said aminated oligonucleotides.
15. The method according to claim 14, wherein said degassing occurs
under vacuum pressure.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application is a continuation in part, and claims the
benefit of, U.S. Patent Application No. 61/193,946 filed Jan. 12,
2009. That application is incorporated herein in its entirety.
BACKGROUND
[0003] Membranes are employed in a wide variety of biological
assays and in-vitro diagnostics products in laboratory, field, and
point-of-care settings. These include, for example, various gel
blotting procedures as well as "dip-stick" lateral flow tests for
pathogens and other analytes. These devices and approaches
typically employ fibrous membranes made from nitrocellulose or
PVDF.
[0004] More recently, an alternative to fibrous membranes has been
employed for a variety of diagnostics and biodetection
applications. These membranes, known as "track-etched" membranes
("TEMs") comprise thin films with discrete pores that are formed
through a combination of charged-particle bombardment (or
irradiation) followed by chemical etching (see photograph FIG. 17).
The particle bombardment results in the formation of damaged areas
in the film (tracks) which are subsequently etched to form pores
with a defined size. Recent uses of TEMs in various biological
assays are described for example by Hanot et al. in "Industrial
applications of ion track technology," Nucl. Instrum. Methods Phys.
Res. Sect. B, 267: 1019-1022 (2009) and by Jones et al. in
"Expanding the use of track-etched membranes," IVD Technology
November/December/2002. The authors describe the employment of TEMs
in biosensors, cytology, bacterial detection, and a variety of
other biological fields. The aforementioned references describe use
of "off the shelf" TEMs in their native form. A few other
applications use TEMs as substrates that are coated with various
probes and capture moieties. For example U.S. Pat. No. 5,968,745 to
Thorp et al. describes a polymer electrode for detecting nucleic
acid hybridization that that utilizes oligonucleotide probes bound
to a single track-etched membrane via carbodiimide
condensation.
[0005] One highly innovative use of TEMs for the analysis of tissue
sections is the "Layered Peptide Array" ("LPA") as described by
Emmert-Buck, et al. in U.S. Patent Application Pub. No.
2009/0215073 A1 (application Ser. No. 12/289,736) and in Clinica
Chimica Acta 376 (2007) 9-16 and the Journal of Molecular
Diagnostics, Vol. 9, No. 3, July 2007 pgs. 297-304 (each of these
references are incorporated herein in their entirely). An LPA is a
stack of TEMs, each of which is coated with a different peptide or
protein antigen; each layer in the stack has a specific affinity to
a different antibody. Antibodies to target proteins are applied to
the tissue section in much the same manner as in
immunohistochemistry. After washing, the antibodies are released
from the tissue section and passed vertically through the
peptide-coated TEMs while maintaining their two-dimensional
position. The antibodies are specifically captured by the target
layer to which a mimic of the natural target antigen has been
coated. Alternatively, Emmert-Buck et al. disclose use of a
cocktail of conjugated antibodies (a primary antibody attached to a
transfer or "shuttle" antibody) that can be applied to the tissue;
the shuttle antibody is then cleaved and captured on a
complementary affinity ligand coated upon a layer of the stack. The
layers of the stack are then separated, and the transfers are
read.
[0006] The Layered Peptide Array approach, which is a subset of
related techniques known in the literature as "Layered Expression
Scanning (LES)", significantly increases the number of markers
quantifiable per tissue section. (See U.S. Pat. Nos. 7,214,477,
6,969,615, 6,602,661, U.S. patent application Ser. No. 11/189,038;
Englert C R et al., Layered expression scanning: rapid molecular
profiling of tumor samples. Cancer Res. 2000; 1526-30; Tangrea M A
et al., Layered expression scanning: multiplex analysis of RNA and
protein gels. Biotechniques 2003; 1280-5; Gillespie J W et al.
Molecular profiling of cancer. Toxicol. Pathol. 2004; 67-71;
Galperin M M, et al., Multimembrane dot-blotting: a cost-effective
tool for proteome analysis. Biotechniques 2004; 1046-51; Gannot G
et al. Layered peptide arrays: high-throughput antibody screening
of clinical samples. J. Mol. Diagn. 2005; 427-36; Patel V et al.
Profiling EGFR activity in head and neck squamous cell carcinoma by
using a novel layered membrane Western blot technology. Oral Oncol.
2005; 503-8; all incorporated herein by reference).
[0007] Importantly, LPAs and LES permit the analysis of multiple
biomarkers in various 2-D samples such as tissue sections while
preserving the localization of these biomarkers. In other words,
when used with tissue sections this approach combines classical
pathology with multiplex array based technologies. These techniques
address important unmet needs in the emerging field of
"Personalized Medicine"--the development and use of therapies
specifically targeted to the disease characteristics of individual
patients is widely predicted to be the key driver of 21.sup.st
century medicine. Better diagnostics linked to drugs are
anticipated to significantly improve patient outcomes while
reducing healthcare costs by avoiding prescriptions of expensive
drugs that prove ineffective for many patients. Many of the new
targeted therapies that have come to market in recent years cost
over $75,000 per patient per year but are effective in only a
narrow subset of patients (.about.15%) to whom they are
administered. Thus, there is an urgent and compelling need for new
diagnostic tests that can accurately predict whether a particular
targeted therapy will work for a particular patient. Unfortunately,
neither conventional techniques for tumor analysis nor newer
detection technologies have proven adequate to meet this need.
These techniques typically fail either in their multiplex
capability or their ability to preserve the shape and morphology of
the tissue section which is often needed for accurate
diagnosis.
[0008] Newer multiplex technologies such as DNA microarrays or mass
spectrometry (MS), as well as older ELISA based techniques, require
that samples be homogenized. Yet, a typical biopsy sample would
present only a small minority of infiltrating tumor cells of
interest. Those cells would be surrounded by numerous other types
of cells (normal cells, fibroblasts, lymphocytes, vascular cells
etc.) presenting dissimilar gene expression and cell signaling
profiles, which are potential biomarkers and drug targets. In a
visual field of an invasive tumor, an important issue to a
pathologist is whether the tumor cell population is molecularly
homogeneous or whether there exist sub-clones within it with
distinct transcriptomic or proteomic profiles (Uhlen M et al.,
2005, A human protein atlas for normal and cancer tissues based on
antibody proteomics. Mol. Cell Proteomics. 4:1920-1932,
incorporated herein by reference).
[0009] Very small tissue samples such as core needle biopsies are
currently being taken from small tumors for performing a
tumor-specific molecular diagnosis to enable personalized drug
treatments. Additionally, advancement of personalized medicine has
been stymied by a paucity of technologies that can effectively
derive predictive biomarkers from diseased tissues. In the case of
cancer, there is a particular need for techniques that can profile
multiple biomarkers in tumor sections, since most of the newer
targeted therapies interact with numerous signaling proteins
(Faivre S et al., New paradigms in anticancer therapy: targeting
multiple signaling pathways with kinase inhibitors. Semin. Oncol.
2006; 407-20, incorporated herein by reference.).
[0010] It would therefore be desirable to have an approach for
analyzing multiple biomarkers in tissue and other biological
samples that overcomes the aforementioned limitations of the LPA
method by providing TEMs coated with capture probes that remain
more permanently bound thereto, that can be manufactured in an
efficient, cost-effective, and reproducible manner, and that can be
engineered for the properties of highly specific ligand binding in
predictable and variable ways.
SUMMARY
[0011] Disclosed is method of analyzing tissue sections (and other
2-D samples) in a manner that provides information about the
presence and expression levels of multiple biomarkers (or other
targets) at each location within the tissue section.
[0012] In short, the method utilizes a plurality or stack of
permeable layers (TEMs or gels) each having a specific
oligonucleotide (capture strand) covalently bound thereto so as to
create affinity layers. A plurality of antibodies (primary or
secondary) are also provided, each of which is conjugated via a
cleavable bond to an oligonucleotide (transfer strand) that is
complementary to the capture strand. A fluorophore or other
detectable moiety may be attached to the transfer strand.
[0013] These conjugated antibodies are applied to the tissue
section (or other sample of interest) and unbound antibodies are
washed or otherwise removed. The affinity membrane stack is then
applied to the tissue section. The transfer oligonucleotide is then
cleaved from the conjugate antibody and migrates through the stack
until the transfer oligonucleotide hybridizes to the layer coated
with its complementary capture strand.
[0014] When used with tissue sections, the layers may then be
analyzed by a number of imaging modalities to generate data showing
the presence and expression levels of multiple biomarkers (or other
targets) at a given location within the tissue section.
[0015] Included in the disclosure is a method of covalently binding
fixed oligonucleotides to TEM layers that prevents their migration
to adjacent layers when the transfer of corresponding transfer
oligonucleotides through the stack is underway.
[0016] Also disclosed are methods that use capture oligonucleotides
conjugated to layers that are formed from transparent, hydrophilic,
polymeric hydrogel types of materials, such as those of natural
origin (e.g. an agarose) or of synthetic origin (e.g. a
polyacrylamide).
[0017] Also disclosed are methods of imaging the processed layers
following transfer including a method for the serial analysis of an
entire stack that need not be separated.
[0018] Also disclosed are methods of analyzing images generated
with the present invention using software and the like in a manner
that, when used with tissue sections, can assist a clinician with
medical decision making.
[0019] With the foregoing and other objects, advantages, and
features of the disclosure that will become hereinafter apparent,
the nature of the disclosure may be more clearly understood by
reference to the following detailed description of the disclosure,
the appended claims and to the several views illustrated in the
drawings.
BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Other objects and advantages of the present disclosure will
be evident from the following detailed description, with like
reference numbers referring to like items throughout.
[0021] FIG. 1 provides enlarged perspective views of the affinity
membranes (frame A) as well an enlarged illustration of the
antibody-oligonucleotide conjugates (frame B) and use of the same
for analysis of tissue sections (frames C-E).
[0022] FIG. 2 is an enlarged illustration showing typical
antibody-oligonucleotide conjugates that may be used with the
affinity membranes disclosed herein.
[0023] FIG. 3 shows the chemical structures of three polymers
commonly used as substrates for making commercially available
track-etched membranes.
[0024] FIG. 4 is an illustration showing conversion products after
etching of a polyester [poly(ethylene terephthalate)], a
polycarbonate, or a polyimide to an oxoacid (B) in the course of
the alkaline etching. Two kinds of functional groups are formed
from the polymer: carboxylic acid end groups and alcohol end
groups.
[0025] FIG. 5 (A) shows the reaction of an aminated
oligodeoxynucleotide which may be primary or secondary with an
oxoacid of a track-etched poly(ethylene terephthalate) via
carbodiimide condensation. (B) shows an example of that reaction
with a polycarbonate membrane.
[0026] FIG. 6 illustrates the structure of one of
oligodeoxynucleotides used in EXAMPLES. The 24-mer (named ATP17)
bears a primary amino group, attached through a particular spacer
to the 3' end, and a fluorescent label, Cy5, attached to the
oligodeoxynucleotide's 5' end. Other used modifications are also
shown.
[0027] FIG. 7 is a bar graph with the results of a reaction in
which a transfer oligonucleotide was used to probe for a hybridized
interaction with a capture oligonucleotide coated on track-etched
poly(ethylene terephthalate) membranes in the presence (A) or
absence (B) of a water-soluble carbodiimide, EDC.
[0028] FIG. 8 is a bar graph showing the results of oligonucleotide
(ATP17) interaction with track-etched polycarbonate membranes in
the presence (A) or absence (B) of a water-soluble carbodiimide,
EDC.
[0029] FIG. 9 is a bar graph comparing the amounts of capture
oligonucleotides that can be adsorbed or covalently coupled to
Polyimide, poly(ethylene terephthalate) and polycarbonate track
etched membranes.
[0030] FIG. 10 is a bar graph showing the results of the joint (A)
and sequential (B) incubation of the track-etched polycarbonate
membranes with ATP17 and EDC. Bars correspond to the red
fluorescence intensity detected either in the complete incubation
mixture (A1) or in a membrane withdrawn after the incubation from
the mixture contained only ATP17 (B1), in membrane sequential
washings with MES buffer (2-4), 10% acetonitrile (5-7),
6.times.SSPE buffer (8), and in a pair of the resulting membranes
(9 and 10).
[0031] FIG. 11 shows fluorescent images of track-etched
polycarbonate membranes coated with ATP17 according to the joint
(A) or sequential (B) procedure of the oligodeoxynucleotide
immobilization. Graphs C and D characterize the fluorescence
intensity distribution along diameters of membranes A and B
respectively.
[0032] FIG. 12 is a bar graph comparing ATP25 interactions with the
plain track-etched polycarbonate membrane (A) and the membrane with
the immobilized complementary ATP60 (B). Bars correspond to the red
fluorescence intensity detected in the membranes after washings
with 6.times.SSPE buffer (1), in the last washing with that buffer
(2), in following washings with 10% (3-5) and 30% (6) acetonitrile,
and in the resulting membranes (7) washed again with the SSPE
buffer.
[0033] FIG. 13 is a bar graph showing results of the thermal
dissociation of a complementary duplex formed by the
fluorescein-labeled ATP95 and ATP17 immobilized on the track-etched
polycarbonate membrane. Bars correspond to the green fluorescence
intensity detected in the membrane upon hybridization and washings
with 6.times.SSPE buffer (1), released at 60.degree. C. into 25 mM
phosphate buffer, pH 7 (2) and following hot washings with the
buffer (3 and 4), and retained on the membrane (5).
[0034] FIG. 14 illustrates the results of an induced release of a
the Cy5-labeled oligodeoxynucleotide induced from an
antigen-antibody-streptavidin construct and the oligonucleotide
spontaneous distribution in a stack of membranes that contained
single membrane with the complementary immobilized oligonucleotide
and two membranes with non-complementary oligonucleotides.
Fluorescent images of membranes (0-8) and Whatman 3MM paper (9)
kept in a stack for 1 hr at 45.degree. C. are shown. Numbers below
images correspond to positions of the membranes in the stack.
0--Track-etched, coated with poly(vinylpyrrolidone) polycarbonate
membrane; 1--irregular shaped track-etched polycarbonate membrane
with a complex composed of the adsorbed rabbit IgG, goat
anti-rabbit Ab conjugated with streptavidin, and transfer
oligonucleotide ATP73; layers 2, 4, 6, and 8--as 0; 3, 5, and
7--track-etched polycarbonate membranes with the immobilized
capture oligonucleotides ATP62, ATP61, and ATP 60, respectively.
The Whatman filter was wetted with 4.times.SSC buffer contained
0.1% SDS, and 25 mM TCEP.
[0035] FIG. 15 is an illustration showing serially imaging of a
transparent membrane stack that may be optionally used with the
affinity membranes disclosed herein.
[0036] FIG. 16 is a scanning electron micrograph of a typical
track-etched membrane.
[0037] FIG. 17 is a set of image data and quantitative analysis to
demonstrate a comparison of non-multiplex to 3-fold multiplex
analysis of three target analytes in a pathology tissue section,
and includes a quantitative analysis of the intensity of signals in
the images.
[0038] FIG. 18 is a set of image data and quantitative analysis to
demonstrate a comparison of 2-fold multiplex to 3-fold multiplex
analysis of three target analytes in a pathology tissue section,
and includes a quantitative analysis of the intensity of signals in
the images.
[0039] FIG. 19 is a demonstration of the replication of an
intensity pattern of an assay target in a tissue specimen on three
detection layers after transfer of transfer oligonucleotides, and
includes a quantitative analysis of the intensity of signals in the
images.
DETAILED DESCRIPTION OF A PREFERRED EMBODIMENT
[0040] 1. Overview
[0041] A preferred embodiment of the present invention is
illustrated in FIG. 1. With reference to frames A and B of FIG. 1
this embodiment preferably includes an affinity membrane stack 12
which comprises multiple layers of track-etched membranes ("TEMs")
14 (a-c) each coated with a different, specific oligonucleotide 16
(a-c), typically a capture strand, which may be referred to as a
"capture oligonucleotide" that is covalently bound to membranes 14.
A plurality of oligonucleotide/antibodies conjugates 18 (a-c) are
also provided, each of which comprises an antibody 20 (a-c), which
may be a primary or secondary antibody, attached to a cleavable
transfer oligonucleotide 22 (a-c) which is complimentary to capture
strand oligonucleotides 16. A fluorescent-tag 21 may be attached to
each oligonucleotide 22. While only a three layer stack 12 and
three oligonucleotide/antibodies conjugates 18 are illustrated in
FIG. 1 it should be appreciated that substantially more layers and
conjugates can be employed depending on the number of targets
sought to be identified. Ten, 20, or even 30 or more layers can be
employed, for example.
[0042] With reference to frames C-E of FIG. 1 use of a preferred
embodiment of the present invention to analyze multiple biomarkers
in a tissue section is illustrated. Oligonucleotide-antibody
conjugates 18 (a-c) are applied to a tissue section 24 that is
mounted to a glass slide 26. In the illustration shown in FIG. 1,
tissue section 24 has three distinct targets or biomarkers 28 (a-c)
of interest although 10, 20, or even 30 or more biomarkers (e.g.
cell signaling proteins) can be analyzed using the present
invention. After conjugates 18 bind to targets 28 unbound
antibodies are washed or otherwise removed from tissue section 24
(not shown). Affinity membrane stack 12 is then applied to tissue
section 24. Transfer oligonucleotides 22 (a-c) are then cleaved
from conjugate antibodies 20 (a-c) and migrate (upward) through
stack 12 (a-c) until transfer oligonucleotides hybridize to their
complementary capture strands 16 (a-c) on a particular layer 14
(a-c).
[0043] Following transfer and binding of transfer oligonucleotides
22 to the appropriate layer in stack 12 and washing of unbound
oligonucleotides, the membranes are separated and scanned or imaged
using one of several imaging devices discussed in the sections that
follow. The fluorescence intensity per unit area and location on
the membrane may then be recorded. These images may then be
overlaid upon one another and on a corresponding bright field image
of the histochemically stained tissue section using image analysis
software and analyzed.
[0044] In an alternative embodiment affinity membranes stack 12 may
be comprised of generally transparent TEMs enabling them to be
imaged together as a stack without the need for separation (FIG.
16) as described in the sections that follow.
[0045] It should be readily apparent that while FIG. 1 shows use of
the present invention for analysis of tissue sections, affinity
membrane stack 12 can be employed for a variety of other
applications including use in biosensors to detect pathogens or
other environmental analytes.
[0046] 2. Definitions
[0047] The following terms shall have the following meanings as
used in this Specification:
[0048] "Antibodies" means here in general, any of the following
types of analyte-specific reagents: a classical antibody produced
in an animal host or a fragment thereof such as a Fab fragment; a
variety of recombinant antibody proteins either incorporating or
consisting of an antibody fragment or a synthetic ligand selected
for its target-binding specificity; synthetic nucleic acid aptamers
that performs an analogous function; or in general any kinds of
synthetic or semi-synthetic reagents that are engineered or
selected to provide an appropriate functionality, namely, to enable
the delivery of a signaling oligonucleotide to a specific target
molecule in a specimen.
[0049] "Antigens" means those target molecules that are used to
elicit in vivo, or simulate in vitro, a humoral immune response of
an animal, with the intention of obtaining specific antibodies
therefrom that recognize one or more of the most characteristic
epitopes in that target molecule.
[0050] "Capture strand" means an oligonucleotide that is covalently
bonded to an assay-specific supportive layer. The capture strand
comprises a complementary sequence to the specific transfer strand
of an assay in accordance with one embodiment herein.
[0051] "Epitopes" means those characteristic portions of an
antigenic target molecule to which target-specific antibodies make
physical contact in the act of specific binding to that
molecule.
[0052] "Multiplex" means a capability to perform more than one
assay on the same specimen at the same time and, in particular, the
use of a set of chemically distinctive physical layers as a
substrate upon a set of assays is organized and performed in
parallel.
[0053] "Oligonucleotides" or "ODNs" means a linear sequence of
nucleotides joined by phosphodiester bonds. DNA polymers containing
up to 50 nucleotides (or base pairs if double stranded) are
generally termed oligonucleotides, and longer polymers are called
polynucleotides. "Oligonucleotides" is used synonymously with
"polynucleotides" for the present purposes. The oligonucleotides of
the invention can range up to a few hundred nucleotides but are
generally of a minimum of around 18-25 nucleotides in length if
only naturally occurring chemical types are used. The nucleotides
can be as short or as long as desired, and they may include protein
binding segments such as aptamers, as long as self-hybridization
and extrinsic molecular binding activities do not impair the
reagent's functionality The oligonucleotides may also comprise
peptide nucleic acids (PNAs), locked nucleic acids (LNAs), or other
types of chemically modified nucleic acids including a cleavable
disulfide bond. The oligonucleotide may be single stranded, or it
may incorporate an internal duplex segment that is formed by the
hybridization of its own self-complementary sequences. The
oligonucleotide also may incorporate fluorescent tags and optional
fluorescence quencher units.
[0054] "Transfer strand" means an oligonucleotide that is released
from an analyte- or target-specific reagent (such as an antibody)
that carries information about the position on the specimen surface
of the target-specific reagent which is also the position of the
target. The transfer strand comprises a complementary sequence to
the specific capture strand of an assay.
[0055] "Sense" and "antisense" are terms which may be used here
solely to distinguish two complementary oligonucleotide sequence
tags, without meaning any biological connotations.
[0056] "Track-etched membranes" means membranes formed by a process
that creates well-defined pores by exposing a dense film to
ionizing radiation forming damage tracks. This is followed by
etching of the damaged tracks into pores by a strong alkaline
solution.
[0057] 3. Methods of Preparing and Coating the Membranes
[0058] a. Membranes
[0059] The membranes employed as substrates are preferably
"track-etched` membranes (TEMs). TEMs were invented and patented by
General Electric (GE) in the 1960s (see U.S. Pat. No. 3,303,085).
Methods of making and using TEMs and are described by Hanot et al.
in "Industrial applications of ion track technology," Nucl.
Instrum. Methods Phys. Res. Sect. B, 267: 1019-1022 (2009) and
"Expanding the use of track-etched membranes" in IVD Technology
November/December/2002 as well as on the Internet websites of GE's
Water and Healthcare business units. Examples of membranes that may
be employed for use with the present invention include the
Isopore.TM. (polycarbonate film membrane available from Millipore
(Bedford, Mass.), the Poretics.RTM. polycarbonate or polyester
membranes available from Osmonics (Minnetonka, Minn.) or the
Cyclopore.TM. Polycarbonate or Polyester membranes available from
Whatman (Clifton, N.J.). Importantly, the etching process results
in pores with carboxylic acid residues or other groups that can be
covalently bonded to the oligonucleotides as modified herein.
[0060] The pore density of the TEM may be between about 10.sup.7
and 10.sup.9 but is preferably about 10.sup.8. The pore size of the
TEM may be between about 0.1 .mu.m and 3 .mu.m but is preferably
0.2 or 0.4 .mu.m. The membrane thickness may be between about 5
.mu.m and 20 .mu.m but is preferably about 10 .mu.m. The total
surface area including the interiors of the pores may be between
about 10 and 50 cm.sup.2/cm.sup.2 of membrane surface but is
preferably about 15 cm.sup.2/cm.sup.2.
[0061] In an alternative embodiment transparent TEMs may be
employed in lieu of conventional opaque membranes. A representative
transparent membrane that may be used is Cyclopore Polycarbonate
Thin Clear Membranes 1.0 .mu.m Pore Size (cat. no. 7091-4710)
available from GE Healthcare Whatman (www.whatman.com). As
illustrated in FIG. 15 transparent membranes 38 (which could also
be hydrogel layers) may be used in conjunction with an imaging
device (e.g. a confocal microscope 32) that can optically penetrate
a stack of membranes 38 and ascertain the location (3 dimensions)
of signals. In FIG. 15 (A) confocal microscope 32 is used to
perform an x-y scan of a first layer of the layered sample set 38a,
which provides a single two-dimensional image 34a of all transfer
molecules captured in that layer. Subsequent scans at advancing
perpendicular depths (B & C) provide additional second 34b and
third 34c image layers which are aligned with respect to the common
x-y plane. Digital image stacks of the data set are subsequently
analyzed to quantitate the local signal intensity of each assay
target, also serving to allow for orientation of all assays with
respect to an image of the target cells (such as tumor cells)
present in the same tissue section 36 as obtained after subsequent
conventional staining (i.e. with hematoxylin and eosin).
[0062] Inert layers may be used to separate some or all assay
layers (to facilitate an optical analysis without disassembling the
layers), and one or more layers may be used to release reagents
that cleave the oligonucleotides from antibodies, or that alter the
effective stringency of the oligonucleotide hybridization
conditions. The layers may be supported on a firm substrate, which
may be both transparent and thin enough so that it does not
interfere with a microscopic examination (i.e. less than 120
microns); also the layers may be joined at one or more edges (e.g.
by a process of local heating, use of an adhesive or ultrasound,
etc.) to facilitate further treatments subsequent to transfer while
preserving their alignment.
[0063] In another embodiment of the disclosure, the material of the
layers can be composed of a hydrogel type of substance such as
polyacrylamide or agarose layers. These layers may be transparent,
and thus the entire stack of layers can be examined by the use of a
confocal microscopy without separation of the layers. The
microscopy instrument 32 may be used with transparent hydrogel
layers.
[0064] b. Oligonucleotides
[0065] Capture oligonucleotides 16 are preferably linked to one (or
more) primary amino groups through a carbon spacer positioned at
the 3' and/or 5' terminals (FIG. 5). The oligonucleotides are
preferably between 18 and 28 nucleotides in length (if composed of
natural nucleotides only) and most preferably between about 20-24
nt long with an amino linkage having the formula:
H.sub.2N--(CH.sub.2).sub.n--PO.sub.4--ODN
[0066] with n=2-7.
[0067] The amino linkage is to either the 3'- or 5'-phosphate end
of the oligonucleotide. At the opposite end, some oligonucleotides
may also contain a linked fluorophore, Cy5 or fluorescein.
Fluorophore-labeled oligonucleotides may be purified by HPLC, or by
a standard desalting upon their synthesis. These amino linked
oligonucleotides can be ordered from one of many companies or they
can be prepared by one who is skilled in the art of oligonucleotide
synthesis.
[0068] c. Attaching the Oligonucleotides to the Membranes
[0069] It is a particular feature of the present invention that the
aminated oligonucleotide is attached to the TEM in the presence of
a carbodiimide (FIG. 5) or an equivalent condensing agent such as
triphenylphosphine/dipyridyl disulfide or triphenylphosphine/carbon
tetrachloride To increase the efficiency and quality of the
carbodiimide attachment process the TEMs are preferably pre-treated
in the following manner.
[0070] First, it may be advantageous to de-gas the TEMs. When these
membranes are manufactured, about 90 percent of their surface area
is comprised of air-filled pores. De-gassing may be accomplished by
submerging the membrane in a base buffer, for example, 0.1 M
4-Morpholineethanesulfonic acid (MES) hemisodium salt solution,
using a sterile, nuclease free Molecular Biology grade water, and
the membrane degassing proceeds under vacuum for 30 min. This step
should be repeated, preferably using a fresh salt solution.
Alternatively, other solutions may be used for degassing the
membrane. These solutions tend to be base solutions that do not
adversely affect the membrane. Another buffer that may be used is a
1-methylimidazole buffer.
[0071] The buffer solution system is designed to keep the pH
constant in the course of a reaction. In the present case, beside
the ability to keep pH 5.8-6.2, the buffer must not react with
carbodiimide or intermediates it forms with a carboxylic acid. The
base pH range may be broader than that presented supra, depending
on the conditions and chemicals used. Quoting from "Bioconjugate
Techniques," it should be noted that "other (then MES) buffers may
be used as long as they don't contain groups that can participate
in the carbodiimide reaction. Generally, it helpful to avoid
carboxylate- or amine-containing buffers such as citrate, acetate,
glycine, or Tris." Alternatively, the reaction can be conducted
without any buffer by controlling the pH with pH-meter and adding
HCl manually.
[0072] Other methods of degassing may be used, as long as the
integrity of the track etched membrane is kept intact, and provided
that the solution used does not interfere with the condensation
reaction.
[0073] Following membrane degassing and oligonucleotide preparation
the TEMs are saturated with the oligonucleotides and given time to
adsorb to the degassed track etched membranes. (See Example 1)
[0074] After several hours, the amino groups of the aminated
oligonucleotides are coupled to the carboxyl groups of the track
etched membranes via condensation, and a condensing agent. The
preferred condensing agent is a carbodiimide. A number of different
carbodiimides may be used for the reaction, including, but not
limited to, N-(3-Dimethylaminopropyl)-N'-ethylcarbodiimide
hydrochloride, (EDC) (Sigma, Cat. No. E1769). EDC belongs to a
class of cold water-soluble carbodiimides. Other cold water
carbodiimides that can be used include CMC
(1-cyclohexyl-3-(2-morpholinoethyl)carbodiimide and BDC
(1-benzyl-3-dimethylaminopropylcarbodiimide). Other
non-carbodiimide condensing agents that may be used include
oxidants such as triphenylphosphine or a reductant such as
dipyridyl disulfide or carbon tetrachloride, preferably used in an
organic solvent.
[0075] The period of incubation of the track etched membrane, the
aminated oligonucleotides, and the condensing agent can range from
six to 14 hours. The number of hours for incubation may vary, as
determined by the thickness of the membrane, the type of track
etched membrane used, and other variables.
[0076] While the condensation reaction is quite thorough, there is
the possibility that unreacted aminated oligonucleotides may remain
adsorbed to the membrane. This is problematic because when the
transfer oligonucleotides 22 pass through the stack they could bind
nonspecifically to the wrong layer if their complementary strands
are not rigidly bound to their assigned layer. Thus, it is
advantageous to remove the adsorbed oligonucleotides by washing
them until all or virtually all of the adsorbed oligonucleotides
are removed from the track etched membranes, thereby leaving behind
only those oligonucleotides covalently bonded to the track etched
membrane. To accomplish, this, a rigorous washing is necessary that
does not chemically adversely affect the covalently bound
oligonucleotides nor the track etched membranes to which the
oligonucleotides are bound. Preferably a solvent, such as a polar
aprotic solvent, is used. In one embodiment, acetonitrile is used.
The acetonitrile can reside in water, or in a phosphate solution.
Similarly, the track etched membranes, can be washed in a phosphate
solution before and/or after the washing in the acetonitrile
solution. It is also advantageous to saturate the membranes with
the aminated oligonucleotide prior to exposure and treatment with
the condensing agent. This is accomplished by adding the
oligonucleotide solution to the buffer solution in which the
membranes were degassed, after which the solution containing the
condensing agent is added.
[0077] 4. Antibody/Oligonucleotide Conjugates
[0078] With reference to FIGS. 1 and 2, antibody/oligonucleotide
("Ab/oligo") conjugates 18, 38 or 40 are designed to work with the
affinity TEMs 14 by detecting the targets 28 in the tissue sample
24 and releasing a fluorescently tagged transfer oligonucleotide
23, 32 or 36 to bind to a corresponding layer 14 in stack 12
containing capture oligonucleotide 16. A preferred assay specific
ligand is an oligonucleotide transfer strand, such that, as in the
figure, a specific oligonucleotide transfer strand is attached to a
specific antibody, which is in turn is uniquely attached to a
specific antigen when applied to tissue 24.
[0079] In a preferred embodiment, the oligonucleotide is linked to
an antibody domain that is not directly involved in binding of the
antibody to its target antigen. Secondary antibody conjugates may
be used to detect unconjugated primary antibodies, provided that
for the use of multiple secondary antibodies in multiplex mode, an
immunological difference between the specificity of the different
secondary antibodies would be required (e.g. anti-rabbit vs.
anti-mouse). In another embodiment, a secondary antibody can be
complexed with a primary antibody before the primary is applied to
the tissue section.
[0080] FIG. 2A illustrates a method in which the transfer strand 22
is linked to the antibody 20 through a direct covalent bond or a
series of such bonds; FIG. 2B exemplifies a method in which there
is a noncovalent linkage of the transfer strand 32 to the antibody
20, as exemplified by a biotin-streptavidin noncovalent bond in
conjugates 38 and 40.
[0081] The link between antibody and oligonucleotide may be through
an intermediate molecule such as streptavidin. In one embodiment
the antibody 20 is linked to streptavidin 34 to form intermediate
conjugate 37 by performing a reaction using a covalent bifunctional
crosslinker. Where the bifunctional crosslinker may contain a
labile bond that as previously described, which bond may be cleaved
by a reducing agent or other means recognized by a person of
ordinary skill in the art. Biotinylated oligonucleotides 32 are
reacted with this to form complex 38. In a related embodiment a
biotinylated primary antibody 30 is used. Biotinylated
oligonucleotides 32 are bound to the tetravalent molecule
streptavidin to form conjugate 36. The biotinylated
oligonucleotides 32 may contain a labile bond, which may be cleaved
by a reducing agent or other means recognized by a person having
ordinary skill in the art. Conjugate 36 is then reacted with
biotinylated antibody 30 to form a complex 40. The link between the
antibody and the transfer oligonucleotide preferably may be
provided with a labile bond, which may be either covalent or
noncovalent. This bond allows the transfer oligonucleotide to be
decoupled from the antibody (or intermediary antibody-binding
ligand) so as to solubilize the oligonucleotide separately from the
tissue for transfer to the capture strand in a layer. Various
chemicals and processes for breaking the antibody-oligonucleotide
bond can be used; for example, beta-mercaptoethanol can be used to
break a disulfide bond; or one could dissociate a duplex consisting
of a linker strand that is covalently linked to the antibody and a
complementary transfer strand by increasing the temperature to
exceeded the melting temperature of that duplex by at about
10-20.degree. C. Interactions of oligonucleotide-conjugated primary
antibodies with tissue and of released transfer oligonucleotides
with capture strand-coated membranes is illustrated in FIG. 1.
[0082] The migration of the transfer oligonucleotide may be
facilitated by cleavage of the bond that attaches the transfer
oligonucleotide to the antibody. There are a number of ways known
in the art to break the bond, which are surveyed in Bioconjugate
Techniques, Second Edition, by G. T. Hermanson, Elsevier 2008 which
is incorporated herein by reference in its entirety). In one
embodiment, the bond may be broken by gentle heating (37-55.degree.
C.) after the stack has been applied to the bound sample, i.e.
during the transfer.
[0083] In another embodiment, an ancillary chemical, which could be
a stabilized reducing agent such as beta-mercaptoethanol or TCEP
(Thermo Pierce cat. no. PI-77720, the manual for which is herein
incorporated by reference) is pre-positioned in the layers at a
working concentration therein, and upon contact of the outermost
layer with the specimen, reacts with the crosslinker, causing rapid
and complete cleavage of the crosslinker structure between the
antibody and the tagged oligonucleotide within 1-60 minutes.
[0084] Alternatively, other linkage structures could be used to
enable solubilization of the oligonucleotide from the antibody.
Such linkages include but are not limited to a photosensitive
linkage, or an oligonucleotide subsequence that could bind a
chemical such as an enzyme that would cause localized cleavage
within the oligonucleotide. There are numerous chemical structures
that would allow for an easily breakable bond between the
oligonucleotide and the antibody. Displacement by competitive
binding of another oligonucleotide could be used to release the
assay-specific ligand.
[0085] In the process, one type of specific capture molecule (the
capture oligonucleotide strand) is attached to each of said
vertically ordered, bioaffinity layers. The assay-specific ligands
(transfer oligonucleotides) that are attached to the primary or
secondary antibodies (which here exemplify the class of
analyte-specific ligands) are released from the tissue sample (by
application of a chemical or by mild heating to 37-55.degree. C.),
and they necessarily diffuse away from the specimen, along a
direction of movement which is determined by the vector of their
chemical concentration gradient. Each of the assay specific ligands
(e.g. a transfer oligonucleotide) passes through the stack until it
meets a bioaffinity ligand (the capture oligonucleotide which is to
it the antisense strand) to which it specifically binds according
to the pertinent type of bioaffinity chemistry (e.g. formation of
duplex DNA). It should be noted that in some cases the antibody,
still attached to the transfer strand, migrates with the transfer
strand, with no adverse effects to the reading of the results.
[0086] If a secondary antibody rather than a primary antibody is
conjugated with an oligonucleotide, normal care must be taken to
avoid cross reactions with different primary antibodies. Either
those primary antibodies must be distinguishable by their
respective secondary antibodies, or a complex of a primary antibody
and monovalent secondary antibody fragment could be formed prior to
application of the mixed antibody complexes to the tissue specimen
(not illustrated).
[0087] A fluorescent tag 21 may be attached to transfer
oligonucleotide 22 for subsequent detection by an imaging
instrument such as fluorescent scanner the Typhoon.RTM. scanner
available from GE Life Sciences. Examples of fluorescent tags that
may be used include dyes such Cy5, Cy3, fluorescein, etc.
Fluorescent tag 21 is preferably added to the oligonucleotide
during stepwise synthesis in a manner commonly known in the art.
Whereas in the examples provided herein a single dye was employed
it should be appreciated that different colors can be employed
which may be advantageous when using the transparent membrane
approach (FIG. 15). In lieu of a fluorescent tag various methods
may be employed to detect duplexes of the oligonucleotides. A
double-strand specific DNA binding dye may be used analogously to a
real time PCR detection method, such as SYBR Green I available from
Invitrogen, Inc. (Carlsbad, Calif.).
[0088] 5. Uses and Applications of Coated Membranes and
Conjugates
[0089] Oligonucleotide coated affinity membranes 12 and Ab/oligo
conjugates 18 may be used in a variety of configurations for a
variety testing purposes. One important application, illustrated in
FIG. 1 and described in Examples 8-10, involves the profiling of
multiple biomarkers in a tumor section. For this application a
tumor is sectioned and prepared according to standard clinical
pathology processes for routine immunohistochemistry (IHC) analysis
(`special staining`) except that Ab/oligo. conjugates 18 are used
in lieu of standard IHC antibodies. (It should be appreciated that
virtually any IHC antibody can be conjugated with an
oligonucleotide according to the processes described herein.)
[0090] Membranes 12 or 14 are then dipped into an oligonucleotide
binding buffer containing a reducing/releasing agent, such as one
that can cleave the disulfide bonds in the Antibody/oligonucleotide
conjugates 18 such as TCEP or beta-mercaptoethanol. The membranes
are assembled into a stack 12 in a chosen order as to the identity
of the oligonucleotides coated on them, which ordering serves to
spatially organize the assays which are to be performed.
[0091] Following application and binding of conjugates 18 to tissue
section 24 the tissue sample is rinsed with binding buffer without
a reducing/releasing agent, and membrane stack 12 is placed
directly on top of the tissue section. The excess buffer volume is
expressed from the stack by enclosing it between protective layers
and applying gentle pressure. In a preferred embodiment, the stack
is first assembled and then applied to a specimen surface where a
remnant of wash buffer persists from the last specimen wash step.
The excess wash buffer is then expressed from the specimen surface
by applying a weight or mechanical pressure to the entire assembly.
Both the tissue section and membrane stack are preferably enveloped
in a fluid impermeable enclosure (e.g. plastic bag) and kept moist
throughout the transfer process. When membrane stack 12 is applied
to the tissue specimen a weight or similar pressuring device such
as spring metal clips (not shown) may be applied to express an
excess buffer volume and assure uniform contact with the tissue
specimen throughout the transfer process. The enclosed stack and
slide mounted tissue section are then incubated for an optimal time
(between about 10 minutes and 4 hours) and a temperature range of
between room temperature and 70.degree. C. depending on the
requirements of the kinetics of the chemical reactions which are
being performed; such requirements could include the concentration
of a reducing agent, the diffusion rate of a transfer strand
through the type of substance used to form the layered supports,
etc.
[0092] In an embodiment in which a transfer strand is linked to an
antibody through a disulfide bond, the reducing agent functions to
cleave the transfer oligonucleotide strands 22 from antibody 20, or
transfer strands 32 from complex 38 or 40, or complex 36 from
antibody 30. The transfer strands then diffuse upward through the
porous membrane stack and bind to the membrane layer 14 supporting
the complimentary oligonucleotide strand as shown in FIG. 1 E.
Examples 5, 8, 9 and 10 exemplify the use of this method.
[0093] Membrane stack 12 is then removed from the enclosure and
washed in a buffer. In one embodiment (opaque or translucent
membranes) the membranes layers are separated from one another,
dried, and arrayed on a flat bed fluorescence scanner (not shown).
The scanner then records the location and intensity of fluorescent
tags 21 on each membrane. This data can be analyzed using a variety
of software programs such as ImageQuant (Molecular Dynamics) to
permit the user to quantitate and correlate the assayed multiple
biomarker expression levels at given locations within the tissue
section.
[0094] A fluorescence quencher can be used in the transfer strand
to suppress light emission of the fluorescent tag until
hybridization to the capture strand occurs on the layer (e.g.
FRET); useful fluorescence tags and fluorophore-quencher pairs can
be used that are well known to one skilled in the art of
fluorescence detection methods (these principles are outlined in
the short report, "Fluorescence and Fluorescence Applications",
2005, available online from Integrated DNA Technologies,
incorporated herein by reference in its entirety). The membrane
stack may be dismantled such that each membrane is read separately,
or the entire stack may be read by use of a confocal microscope if
the individual membranes are transparent or translucent.
[0095] In some embodiments, an antibody may be provided with a
covalently conjugated linker strand that is truncated and forms a
low-affinity duplex with a transfer strand; the transfer strand may
be subjected to thermal dissociation from the antibody during the
transfer step by mild heating (e.g. by 15-30.degree. C.). In
general, persons who are proficient in the art would recognize many
ways to cause dissociation of various types of transfer complexes
on the specimen, while providing for the subsequent binding of the
transfer molecule to the capture layer.
[0096] In some embodiments, an arbitrary number of oligonucleotide
sequence tags (for example, U.S. Pat. No. 5,635,400), sometimes
referred to as bio-barcodes, are identified that do not
cross-hybridize when mixed in solution. In particular, the transfer
oligonucleotides do not cross-hybridize to one another, and they do
not cross-hybridize to the capture oligonucleotides of the other
transfer oligonucleotides that are attached to the capture layers.
These embodiments enable modular expansion of the number of assays
per run and a replicable assay development procedure all based on
the universality of the oligonucleotide transfer/capture system as
here employed. Similar universal multiplex assays have been
developed as biochemical techniques, for example these have been
used in microarray analysis of PCR products (Favis, R. et al (2000)
Universal DNA array detection of small insertions and deletions in
BRCA1 and. BRCA2. Nat. Biotechnol. 18, 561-564).
[0097] In addition to use with tissue sections, oligonucleotide
coated affinity membranes 12 and Ab/oligo conjugates 18 may be used
in other testing formats, for example, assays of blood or other
bodily fluids in a multi-well plate format in the same manner as
that described for the Layered Peptide Arrays as described by
Emmert-Buck, et al. in U.S. Patent Application Pub. No.
2009/0215073 A1 (application Ser. No. 12/289,736) and in Clinica
Chimica Acta 376 (2007) 9-16 and the Journal of Molecular
Diagnostics, Vol. 9, No. 3, July 2007 pgs. 297-304.
[0098] Affinity membranes 12 may also be used without conjugates
18, for example to detect DNA or RNA targets in blood or an
environmental sample (soil, air, or water) as a component of
biosensors. Examples of use of TEMs for various biosensors and
diagnostics for which the present invention may be employed are
described by Hanot et al. in "Industrial applications of ion track
technology," Nucl. Instrum. Methods Phys. Res. Sect. B, 267:
1019-1022 (2009) and by Jones et al. in "Expanding the use of
track-etched membranes" in IVD Technology
November/December/2002.
EXAMPLES
[0099] Introduction to Examples. The covalent immobilization of
single-stranded DNA was demonstrated on commercially available
track-etched membranes using oligodeoxynucleotides 20-24 nt long.
In the Examples below the membranes were mainly circular discs with
a diameter of 6.5 mm that fits the wells of a standard 96 well
plate. Before the use, the membranes were submerged into a
conjugation buffer and degassed under vacuum with two changes of
the buffer. Quantitative and semi-quantitative description of the
immobilization is based on the use of fluorescently labeled
oligonucleotides and measurement of the fluorescence intensity in
reaction mixtures, washings, and on membranes. The measurements and
image acquisitions were done on 1420 Multilabel Counter
Victor.sup.2 (Wallac, Turku, Finland) and Storm 860 Gel and Blot
Imaging System or Typhoon Trio+ Variable Mode Imager (Amersham
Biosciences, Sunnyvale, Calif.). The images were treated with the
Molecular Dynamics software ImageQuant, version 5.2.
[0100] Membranes, DNA, and Reagents. The track-etched membranes in
a sheet format or circular were from two sources: GE Water &
Process Technologies (Trevose, Pa.) and the Belgian company it4ip
(Seneffe, Belgium). Specifications of the membranes are presented
in TABLE 1. The majority of oligodeoxynucleotides was synthesized
by Eurofin MWG Operon (Huntsville, Ala.) and some were obtained
from Integrated DNA Technologies (Coralville, Iowa). Structures of
the oligonucleotides and ways of their purification are shown in
TABLE 2. Other principal reagents were
N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide (EDC) hydrochloride,
4-morpholineethanesulfonic acid (MES) hemisodium salt,
acetonitrile, HPLC grade, and 0.2 M phosphate buffer, pH
.about.7.4, containing 2.98 M NaCl and 0.02 M EDTA (SSPE buffer
20.times. concentrate) (Sigma-Aldrich Corp., St. Louis, Mo.). The
oligonucleotide solutions were prepared using DEPC-treated, sterile
nuclease-free water (EMD Chemicals, Gibbstown, N.J.). Milli-Q water
passed through the BioPak ultrafilter (Millipore, Billerica, Mass.)
was used to prepare other solutions and buffers.
TABLE-US-00001 TABLE 1 Membrane Pore size, Pore Density, Thickness,
& Cat. No. .mu.m cm.sup.-2 .mu.m Vendor Polycarbonate 0.4 .sup.
1 .times. 10.sup.8 10 GE K04SH02500 K04SH81030 K04CP02500*
Polyester 0.4 .sup. 1 .times. 10.sup.8 10 GE T04CP02500
Polycarbonate 0.4 1.6 .times. 10.sup.8 10 it4ip 1000M10/811N400/A4
Poly(ethylene 0.4 1.0 .times. 10.sup.8 12 it4ip terephthalate)
2000M12/811N400/A4 Polyimide 0.4 2.0 .times. 10.sup.8 12 it4ip
3000M12/821N400/A4 *The membranes are coated with a wetting agent,
poly(vinylpyrrolidone).
TABLE-US-00002 TABLE 2 Name Structure hybridizes Purity Vendor
ATP17 [Cy5]TGAT.sub.2GTAGTATGTAT.sub.2GATA.sub.3G[AmC7] ATP95 HPLC
Operon ATP95 [Fl]CT.sub.3ATCA.sub.2TACATACTACA.sub.2TCA ATP17 HPLC
Operon ATP60 [AmC6]TCAT.sub.3AC.sub.2A.sub.2T.sub.3AC.sub.2A.sub.2T
ATP25 desalting IDT ATP25
[Cy5-Sp9]AT.sub.2G.sub.2TA.sub.3T.sub.2G.sub.2TA.sub.3TGA ATP60
PAGE Operon ATP73
[Cy5]AT.sub.2G.sub.2TA.sub.3T.sub.2G.sub.2TA.sub.3TGA ATP60 HPLC
Operon [ThiSS][BioTEG] ATP61
[AmC6]CT.sub.3CT.sub.3CT.sub.3CT.sub.3CT.sub.3 ATP72 desalting
Operon ATP72 [Cy3]AAAGAAAGAAAGAAAGAAAG[AmC7-Q] ATP61 HPLC Operon
ATP62 [AmC6]CTACTATACATCT.sub.2ACTATACT ATP74 desalting Operon
ATP74 [Cy5]AGTATAGTAAGATGTATAGTAG ATP62 HPLC Operon
[ThiSS][BioTEG-Q] ATP80 [AminoC6]AAATCATCAATCACTTTAAT ATP76
desalting Operon ATP76 [Cy5]ATTAAAGTGATTGATGATTT ATP80 HPLC Operon
[ThiSS][BioTEG-Q] ATP82 [AminoC6]CTACAAACAAACAAACATTAT ATP77
desalting Operon ATP77 [Cy5]ATAATGTTTGTTTGTTTGTAG ATP82 HPLC Operon
[ThiSS][BioTEG-Q] Modification abbreviation chemical [Cy5] 5' CY 5
fluorescent dye [Fl] 5' Fluorescein fluorescent dye [AmC6] 5'
primary amine with 6 atom spacer [AmC7] 3' primary amine with 7
atom spacer [Cy5-Sp9] 5' CY5 with 9 atom spacer [ThiSS] Dithiol
(disulfide), internal [BioTEG] Biotin with 22 atom spacer
[0101] Structures of the modifications (Cy5, AmC6, etc.) are shown
in FIG. 6.
Example 1
[0102] Covalent coating of TEMs via their joint incubation with
aminated DNA and carbodiimide. Pairs of the membrane discs degassed
in 0.1 M MES buffer, pH 6.1 were submerged without overlapping in
500-.mu.l vials in 80 .mu.l of 62.5 .mu.M aminated ODN in 0.125 M
MES buffer and kept there at a room temperature light-protected if
the ODN had also an attached fluorophore. Upon 2 hour incubation
vials received 20 .mu.l of the freshly prepared 0.5 M EDC in water
while vials with control membranes received just water. After the
overnight reaction the incubation mixtures were withdrawn and the
membranes were washed with 100 .mu.l of 6.times.SSPE buffer
(thrice, each time for 30 min) and then with 100 .mu.l of 10%
acetonitrile (thrice, each time for 30 min). The coated membranes
were stored in 6.times.SSPE buffer at 4-6.degree. C. For analytical
purposes, the incubation mixtures, washings as well as the
resulting membranes (covered with 100 .mu.l of 6.times.SSPE buffer)
were placed in designated wells of 96 well plates and fluorescence
intensity was recorded usually at 0.1 s exposures. Such acquired
data are presented in FIGS. 7-9.
[0103] FIG. 7 describes results of the ATP17 covalent binding to a
track-etched polyester membrane. In the procedure used, the
membranes were first saturated with the ODN in a prolonged
incubation and only then the immobilization was initiated by the
carbodiimide addition. By comparing bars 1 and 10 in FIG. 7A, one
might conclude that about 10% of the ODN appears covalently bound
to the membrane. When passed through the same treatment but without
carbodiimide, the membrane retains less than 0.3% of the ODN
applied (compare bars 1 and 10 in FIG. 7B). Although polyester
(poly(ethylene terephthalate) or PET) is considered as a naturally
hydrophilic polymer, data in FIG. 7 show that three consecutive
washings with a phosphate buffer (bars 2-4) are less effective in
deleting the non-covalently bound ODN from the polyester membrane
than single washing with 10% acetonitrile (bars 4 in FIGS.
7A&B).
[0104] The ATP17 covalent binding to track-etched polycarbonate
membranes is characterized in FIG. 8. In contradistinction to
polyester, polycarbonate is a highly hydrophobic polymer and its
film etching should presumably result not in carboxylic acid end
groups but carbonic acid end groups. Still, the procedure provides
of the polycarbonate membrane coating (see bar 7 in FIG. 8A)
comparable with that achieved with polyester membranes (bar 10 in
FIG. 7A). Bars 1 in FIGS. 8A&B also show that upon completion
of the treatment with or without the use of carbodiimide and
regular washings the membranes retain almost the same amount of the
ODN. Yet, in the subsequent washings with 10% (bars 2 and 3) and
30% (bars 4 and 5) acetonitrile, the membranes treated without
carbodiimide lose nearly 83% of the ODN while the counterparts
still retain the most of it (compare bars 7 in FIGS. 8A&B).
[0105] Data in FIG. 9 are to confirm that the procedure of ODN
covalent binding to commercially available TEMs works well
irrespectively who manufactured them. As seen in particular, the
use of polyester membranes obtained from Belgium company it4ip (bar
2) and GE Water & Process Technologies (bar 4) resulted in
their nearly identical coating with ATP17. Considering the
intensity of the signals from the bound ODN (gray bars in FIG. 9),
it can be concluded that on average the polyester, polycarbonate,
and polyimide membranes provide correspondingly high, medium, and
small binding capacity. Importantly, that the background signal
caused by the ODN binding independent on carbodiimide decreases in
the inverse relation; this follows from the comparison of the gray
and white bars in FIG. 9.
Example 2
[0106] Covalent coating of TEMs via their sequential incubation
with aminated DNA and carbodiimide. Pairs of the membrane discs
degassed in 0.1 M MES buffer, pH 6.1 were submerged without
overlapping in 500-.mu.l vials in 100 .mu.l of 50 .mu.M aminated
ODN (ATP17) in 0.1 M MES buffer and kept there at a room
temperature light-protected if the ODN had also an attached
fluorophore. Upon 4 hour incubation the membranes were transferred
into the vials with 100 .mu.l of the freshly prepared 0.1 M EDC in
0.1 M MES buffer and the incubation continued overnight. Washing of
the membranes was done as described in Example 1. The comparison of
the two ways of the coating is shown in FIG. 10. This EXAMPLE is to
show that the covalent coating of TEMs via carbodiimide
condensation could be the same if instead of adding carbodiimide in
an ODN solution with a membrane this membrane would be taken out of
the solution upon its saturation and placed in another, containing
only carbodiimide solution. In such a case, the ODN solution would
not be contaminated with added carbodiimide and it could be used
multiple times. Based on the comparison of bars 9 and 10 (which
refer to pairs of membranes treated in parallel) in FIGS. 10A&B
it follows that both variants of the coating lead to practically
identical products.
Example 3
[0107] Demonstration of the evenness of the covalent coating. The
membrane disks coated with the aminated Cy5-labeled oligonucleotide
as in EXAMPLES 1 and 2 and then dried between sheets of Whatman
filter paper were placed on the Typhoon Trio+ platen, covered with
a regular glass slide and their images were acquired at a normal
sensitivity. To avoid saturation of the signal, excitation was done
with a green laser (532 nm) instead of the matching red laser (633
nm), emission was registered at 670 nm at a pixel size of 50. Thus
obtained fluorescent images of the ATP17-coated polycarbonate
membranes are shown in FIGS. 11A&B.
[0108] Distribution of the oligonucleotide along diameters of the
coated disks was revealed with the ImageQuant software and shown in
FIGS. 11 C & D. As seen, both variants of the ODN covalent
binding result in a fairly even coating: the joint incubation
provided variations within .+-.15% (FIG. 11C) and the sequential
incubation gave even better result, .+-.5% (FIG. 11D).
Example 4
[0109] Hybridization and thermal dissociation on a track-etched
membrane. Pair of membrane disks coated with ATP60 as in EXAMPLE 1
and washed with 6.times.SSPE buffer was incubated at a room
temperature for 2 hours in 100 .mu.l of 10 .mu.M complementary
Cy5-labeled ATP25 in the buffer. Another pair of plain membrane
disks was kept in the identical solution to serve as a control.
Upon four 30 min-washings with the buffer the disks were
transferred into designated wells of a 96 well plate and intensity
of their red fluorescence was measured. The disks were further
washed with 10% acetonitrile (thrice), 30% acetonitrile (once), and
6.times.SSPE buffer. The volume of each washing was 100 .mu.l and
intensity of the red fluorescence in the washings and resulting
membranes is shown in FIG. 12. The data show that an
oligonucleotide (ATP60) covalently bound to polycarbonate membrane
preserves its ability to hybridize with a complementary
oligonucleotide (ATP25). Although ATP25 can interact with the plain
membrane non-specifically (FIG. 12A), 93.5% of it can be washed out
by the employed washings (compare bars 1 and 7 in FIG. 12A). The
same washings leave 83% of ATP25 on the membrane coated with ATP60
(FIG. 12B, compare bars 1 and 7).
[0110] Another pair of membrane disks coated with ATP17 and washed
as in EXAMPLE 1 was incubated at 50.degree. C. for 10 min in 100
.mu.l of 25 .mu.M complementary fluorescein-labeled ATP95 in
6.times.SSPE buffer. This was followed by the 3 hr annealing to a
room temperature and washings with the buffer. Upon recording the
green fluorescence intensity retained by the disks they were placed
into a vial with 100 .mu.l of 25 mM phosphate buffer, pH 7 and
heated up to 60.degree. C. In 15 min the solution from the vial was
withdrawn and the heat extraction was performed two times more.
Intensity of the green fluorescence in the discs before and after
thermal dissociation as well as in the hot extracts is shown in
FIG. 13.
[0111] It is supposed that a duplex formed in solution by two
complementary oligonucleotides can be destroyed (melted) at an
elevated temperature. Data in FIG. 13 demonstrate that this is also
happening when one of the two is immobilized on a track-etched
polycarbonate membrane. The pair of ATP17 and ATP95 has an
estimated melting temperature of 54.degree. C. Bars 2-4 in FIG. 13
relate to amount of ATP95 released from the immobilized duplex into
solution at 60.degree. C. while bar 10 shows what remains (less
than 7%) on the membrane after the thermal dissociation.
Example 5
[0112] Hybridization in a stack of track-etched membranes of an
oligonucleotide released from an antibody conjugate bound to an
antigen. The complex of an antigen with an antibody-streptavidin
conjugate and bound biotin-modified ATP73 was prepared on the
irregularly shaped piece of a polycarbonate membrane as follows.
First, the membrane was coated with rabbit IgG and then blocked
with 1% BSA. Second, the membrane was incubated with a conjugate of
the goat anti-rabbit antibody and streptavidin that retained ATP73.
Upon washing with 4.times.SSC buffer contained 0.1% SDS the
membrane was placed on a supporting polycarbonate PVP-coated disc
and covered by a stack in that PVP-coated discs separated the discs
with ATP62, ATP61, and ATP60 immobilized as in EXAMPLE 2. The
concerted release of the ATP73 fragment and its hybridization with
ATP60 were induced by placing on the stack's top a filter paper
disc wetted with 4.times.SSC buffer contained 0.1% SDS and 5 mM
Tris[2-carboxyethyl]phosphine hydrochloride (TCEP). After keeping
the stack at 45.degree. C. for one hour it was disassembled and the
discs were washed thrice with 1.times.SSC buffer contained 0.25%
SDS at 47.degree. C. Fluorescent images of the discs were
registered using Storm 860 scanner (FIG. 14). Intensity of the red
fluorescence associated with each disc in the stack was also
quantified using the microplate reader.
Example 8
Identification of Multiple Biomarkers from Breast Tumor Sections
and Comparison with Immunofluorescence Histochemistry
[0113] Breast cancer pathology specimens in paraffin blocks were
purchased from a commercial tissue bank (Asterand, Inc. or
Bioserve, Inc.), 5 .mu.m sections were cut and prepared for
staining with conventional immunohistochemistry sample preparation
methods. Membranes were prepared by conjugation with
oligonucleotides (ODNs) ATP61, ATP80 and ATP82 by the methods of
Example 2, and were composed into four replicate stacks, also
including an uncoated negative control membrane. Antibodies to
assay targets ErbB2, ER (estrogen receptor) and CK7 (cytokeratins
7) were respectively conjugated with CY5 fluorescent-tagged sense
ODN, in the same manner as described above and shown in complex 40
on FIG. 2B. These conjugates were used to bind conjugates to tissue
sections by following a conventional IHC protocol. Either one or
three conjugated Abs were used per slide. After the last washing
step, coated membranes were equilibrated in release/hybridization
buffer (4.times.SSC/0.1% SDS, 50 mM beta-mercaptoethanol) and
applied on the slide for a 30 min incubation at 47.degree. C. The
stacks were dissociated, membranes washed in 2.times.SSC/0.1% SDS,
rinsed in distilled water and dried before being scanned on bed
flat scanner (Typhoon) with the results shown (FIG. 17A). The data
provide a comparison of the three conditions: a) The amount of
conjugate bound on the slide before transfer of transfer strands
(first image column); b) the amount of transfer strands transferred
to capture membrane when one conjugate is applied to the tissue
(rows 1-3 in image columns 2-5); and the amounts of transfer
strands transferred to tissue when all three conjugates are
incubated on the tissue together (row 4 in image columns 2-5). The
control membrane without any antisense conjugated oligonucleotide
had no signal (image column 2). Selected image areas were
quantitatively measured for CY5 fluorescence using ImageQuant
software and the data were plotted (FIG. 17B). In this experiment,
single-staining data were proportional to multiplex data and were
more intense.
Example 9
Further Comparison of Double Staining Triple Staining
[0114] The same materials and methods of Example 8 were used,
except that either one, two or three conjugates were applied
together to one tissue section. The data (FIG. 18) indicate that
the capture efficiency of the released ODN-cy5 to complementary
membranes is not much affected by the presence of multiple
conjugated antibodies. Quantitative analysis (FIG. 18B) indicated
that the intensity of triple transfers (row 4) was nearly the same
as that of double transfers (rows 2 and 3) or single transfers (row
1).
Example 10
Target Localization in Tissue Using Triple Multiplex Mode
[0115] The same materials and methods of Example 8 were used. In
FIG. 19A, some of the target proteins seem to have been
over-expressed in those manually circumscribed areas are imaged
both on the slide before transfer (row 1) and on the membranes
after transfer, such as: ErbB2 on membrane 60 (row 2) and CK7 on
membrane 62 (row 3). Quantitative analysis in FIG. 19B indicates
that overall intensities as measured in uniplex and triplex modes
were indeed comparable, although those local intensity variations
were less obvious.
* * * * *