U.S. patent application number 12/982352 was filed with the patent office on 2011-11-03 for ligand-directed covalent modification of protein.
Invention is credited to Charles F. Jewell, Kwangho Lee, Aravind Prasad Medikonda, Deqiang Niu, Russell C. Petter, Lixin Qiao, Juswinder Singh, Zhendong Zhu.
Application Number | 20110269244 12/982352 |
Document ID | / |
Family ID | 44226810 |
Filed Date | 2011-11-03 |
United States Patent
Application |
20110269244 |
Kind Code |
A1 |
Petter; Russell C. ; et
al. |
November 3, 2011 |
LIGAND-DIRECTED COVALENT MODIFICATION OF PROTEIN
Abstract
The present invention relates to enzyme inhibitors. More
specifically, the present invention relates to ligand-directed
covalent modification of proteins; method of designing same;
pharmaceutical formulation of same; and method of use.
Inventors: |
Petter; Russell C.; (Stow,
MA) ; Jewell; Charles F.; (Columbia, MD) ;
Lee; Kwangho; (Waltham, MA) ; Medikonda; Aravind
Prasad; (Arlington, MA) ; Niu; Deqiang;
(Lexington, MA) ; Qiao; Lixin; (Andover, MA)
; Singh; Juswinder; (Ashland, MA) ; Zhu;
Zhendong; (Westborough, MA) |
Family ID: |
44226810 |
Appl. No.: |
12/982352 |
Filed: |
December 30, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61335043 |
Dec 30, 2009 |
|
|
|
Current U.S.
Class: |
436/501 ;
530/402; 703/11 |
Current CPC
Class: |
A61P 31/14 20180101;
C12Y 603/02 20130101; C07D 519/00 20130101; C07D 239/49 20130101;
C07D 491/08 20130101; C07D 401/04 20130101; C12N 9/93 20130101;
C12Q 1/485 20130101; C07D 417/14 20130101; C07D 401/14 20130101;
C07D 409/12 20130101; C12Y 207/11001 20130101; C07D 487/04
20130101; G01N 33/68 20130101; C07D 405/14 20130101; A61P 43/00
20180101; C12Q 1/37 20130101; C07D 495/04 20130101; C07D 405/12
20130101; C12Y 304/21098 20130101; C12N 9/96 20130101; C07D 403/14
20130101; C07D 513/04 20130101; G16C 20/50 20190201; C12N 9/12
20130101; C07D 403/12 20130101; C07D 493/04 20130101; G16B 15/00
20190201; C12N 9/506 20130101; C07D 207/16 20130101; C07D 417/06
20130101; C12Q 1/25 20130101 |
Class at
Publication: |
436/501 ;
530/402; 703/11 |
International
Class: |
G01N 33/68 20060101
G01N033/68; G06G 7/58 20060101 G06G007/58; C07K 1/107 20060101
C07K001/107 |
Claims
1. A method for designing a ligand that covalently binds a target
protein, the method comprising: A) providing a structural model of
a reversible ligand docked within, or in proximity to, a
ligand-binding site in a target protein; B) identifying a lysine
residue of the target protein in, or in proximity to, the
ligand-binding site that is less than about 15 .ANG. from the
reversible ligand when the reversible ligand is docked in, or in
proximity to, the ligand-binding site; C) producing at least a
structural model of at least one ligand-warhead compound docked
within, or in proximity to, the ligand-binding site wherein the
ligand-warhead compound comprises the reversible ligand in step B)
or a portion thereof, a warhead comprising a reactive chemical
moiety, and optionally a Tether; and D) identifying a
ligand-warhead compound whose structural model allows the lysine
residue in step B) to readily assume a conformation that brings the
side chain primary amine group of the lysine residue within
bond-forming proximity of the warhead electrophile.
2. The method of claim 1, further comprising: E) forming, for the
ligand-warhead compound identified in step D), a ligand-protein
covalent adduct by forming a covalent bond between the side chain
primary amine group of the lysine residue identified in step B) and
the warhead electrophile in ligand-warhead compound identified in
step D) while substantially maintaining the non-covalent
interactions between the pharmacophore of the ligand and the
ligand-binding site.
3. The method of claim 2, further comprising: F) evaluating the
conformation of the resulting ligand-protein covalent adduct formed
in step E) by analyzing the global energy of the resulting
conformation, or by analyzing the energy of the conformation of the
Tether.
4. The method of claim 3, wherein steps A)-F) are iterated with
changes to the Tether and the global energy of the resulting
conformation is less than the previous iteration.
5. The method of claim 2, further comprising: F) determining
whether the ligand-binding site is occluded when the covalent bond
is formed between the side chain primary amine group of the lysine
residue in, or in proximity to, the ligand-binding site and the
warhead electrophile.
6. The method of claim 2, wherein the covalent bond formed in step
E) is formed using a computational method in which the warhead and
the side chain of the lysine residue are flexible and the remainder
of the structures of the ligand-warhead compound and the
ligand-binding site are fixed.
7. The method of claim 1, wherein in step B) each of the lysine
residues in, or in proximity to, the ligand-binding site of the
target protein, which is less than about 15 .ANG. from the
reversible ligand when the reversible ligand is docked in, or in
proximity to, the ligand-binding site, is identified.
8. The method of claim 1, wherein step C) comprises providing a
plurality of models of the ligand-warhead compound, wherein the
warhead is bonded to a different substitutable position of the
ligand or a portion of the ligand in each model of the
ligand-warhead compound, optionally with the Tether in between the
warhead and the substitutable position.
9. The method of claim 1, wherein the target protein is an
identified member of an identified protein family and the lysine
residue is not conserved across the identified members of the
protein family.
10. The method of claim 1, wherein the target protein is an
identified member of an identified protein family and the lysine
residue is conserved among more than one identified member of the
identified protein family.
11. The method of claim 10, wherein the lysine residue is conserved
across the identified members of the protein family.
12. The method of claim 1, wherein the target protein has catalytic
activity.
13. The method of claim 1, wherein the protein family is selected
from the group consisting of BCL-2, Calpains, Caspases, Cathepsins,
HCV, HDAC, HSP70, HSP90, IAP, Kinase, MDM2, MMP, NHR, PI3K,
Phosphatase, PARP, and HIV Protease.
14. The method of claim 13, wherein the target protein is selected
from the group consisting of XIAP, cIAP1 and cIAP2,
PI3K.beta./.gamma., PDPK1, and HCV-NS3.
15. The method of claim 1, wherein the ligand-binding site is a
ligand-binding site for a substrate or cofactor.
16. The method of claim 1, wherein the lysine residue is not a
catalytic residue.
17. The method of claim 1, wherein the ligand-warhead compound has
a structure of Formula I: ##STR00568## wherein Scaffold is a) a
radical resulting from the removal of a hydrogen of a ligand
capable of binding to, or in proximity to, the ligand-binding site;
or b) a portion of a pharmacophore of a ligand resulting from
truncation of the pharmacophore, such that the Scaffold is capable
of binding to, or in proximity to, the ligand-binding site; Warhead
is an organic moiety optionally containing one or more heteroatoms
selected from O, N, and S; the organic moiety having a molecular
weight of about 14 daltons to about 200 daltons; Warhead being
capable of reaction with a side chain primary amine group of a
lysine residue; and Warhead being attached to Scaffold through
Tether; and Tether is null, a bond, or a bivalent C.sub.1-C.sub.15
saturated, unsaturated, straight, branched, cyclic, bicyclic,
tricyclic alkyl, alkenyl, alkynyl; bridged bicyclic, heterocycle,
heteroaryl, or aryl moiety; wherein optionally one or more
methylene units of the hydrocarbon chain are independently replaced
by --NR.sub.1--, --O--, --C(O)--, --S--, --SO--, --C(.dbd.S)--, or
C(.dbd.NR.sub.1)--; optionally one or more hydrogens are
independently replaced by heteroatoms; and optionally one or more
methine groups of the C.sub.1-C.sub.15 alkyl, when present, are
independently replaced by ##STR00569## x is 0, 1, or 2; y is 1, 2,
or 3; and R.sub.1 is hydrogen or C.sub.1-C.sub.8 alkyl; with the
proviso that the compound of Formula I is not wortmannin:
##STR00570## or known analogues of wortmannin that covalently
modify lysine through substantially the same mechanism as
wortmannin: ##STR00571## ##STR00572## ##STR00573## ##STR00574## or
any mechanism-based irreversible inhibitors.
18. The method of claim 17, wherein the ligand-warhead compound has
a structure of Formula I': ##STR00575##
19. The method of claim 18, wherein Warhead is a radical resulting
from the removal of a hydrogen of a compound of Formula I-a, I-b,
I-c, I-d, I-e, I-f, I-g, I-h, I-j, I-k, I-l, I-m, I-n, I-o, I-p,
I-q, I-r, I-s, and I-t: ##STR00576## ##STR00577## ##STR00578##
wherein each X.sub.1 and X.sub.8 is independently --O--, --S--, or
--NR.sub.6--; each X.sub.2 is independently --R.sub.6, --OR.sub.6,
or --NR.sub.6R.sub.7; each X.sub.9 is independently ##STR00579##
each R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7, and
R.sub.8 is independently hydrogen or C.sub.1-C.sub.6 alkyl; wherein
one or more methylene groups of the C.sub.1-C.sub.6 alkyl can be
replaced by --NR.sub.1--, --O--, --C(O)--, --S--, --SO--,
--SO.sub.2--, or --C(.dbd.S)--; one or more methine groups of the
C.sub.1-C.sub.6 alkyl, when present, can be independently replaced
by ##STR00580## R.sub.1 is hydrogen or C.sub.1-C.sub.8 alkyl;
wherein optionally when proper any two of R.sub.2, R.sub.3,
R.sub.4, R.sub.5, R.sub.6, R.sub.7, and R.sub.8 when taken together
form a 3- to 8-membered carbocyclic or heterocyclic ring or an aryl
or heteroaryl group; and optionally X.sub.2 and any one of R.sub.2,
R.sub.3, and R.sub.4 when taken together form a 3- to 8-membered
carbocyclic or heterocyclic ring or an aryl or heteroaryl group; A
and B are each independently an optionally substituted monocyclic,
bicyclic, or tricyclic aryl or heteroaryl; and n is an integer from
2-4; each n.sub.1 and n.sub.2 is independently an integer from 0-2;
n.sub.3 is an integer from 1-2; n.sub.4 is an integer from 1-3; and
each one of n.sub.9, n.sub.10, n.sub.11, and n.sub.12 is an integer
from 0-1; and n.sub.13 is an integer from 0-2, wherein when any one
of the foregoing n integers is more than 1, the adjacent carbons
represented by the integer can form a single or double bond.
20. The method of claim 19, wherein as least one of R.sub.2 and
R.sub.3 of the compounds of Formulas I-b and I-c is hydrogen.
21. The method of claim 19, wherein the compound of Formula I-a,
I-d, I-e, I-j, I-k, or I-l is a compound of Formula II-a, II-b,
II-c, II-d, II-e, II-f, II-g, II-h, II-i, II-j, II-k, II-l, II-m,
II-n, II-o, II-p, II-q, II-r, II-s, II-t, II-u, II-v, II-w, II-x,
II-y, II-z, II-aa, II-bb, II-cc, II-dd, II-ee, II-ff, II-gg, II-hh,
II-jj, II-kk, II-ll, II-mm, II-nn, II-oo, or II-pp; ##STR00581##
##STR00582## ##STR00583## ##STR00584## ##STR00585## ##STR00586##
wherein each m is independently an integer from 0-4; each m.sub.5
is independently an integer from 0-3; each m.sub.4 is independently
an integer from 0-5; each n.sub.2 is independently an integer from
0-2; each R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7,
R.sub.8, R.sub.9, R.sub.10, R.sub.11, R.sub.12, R.sub.13, R.sub.14,
and R.sub.15 is independently hydrogen or C.sub.1-C.sub.6 alkyl;
R.sub.z is hydrogen, C.sub.1-C.sub.6 alkyl, halogen, CF.sub.3, or
nitro; wherein one or more methylene groups of the C.sub.1-C.sub.6
alkyl can be replaced by --NR.sub.1--, --O--, --C(O)--, --S--,
--SO--, --SO.sub.2--, or --C(.dbd.S)--; one or more methine groups
of the C.sub.1-C.sub.6alkyl, when present, can be independently
replaced by ##STR00587## R.sub.1 is hydrogen or C.sub.1-C.sub.8
alkyl; and optionally when proper any two of R.sub.2, R.sub.3,
R.sub.4, R.sub.5, R.sub.6, R.sub.7, R.sub.8, R.sub.9, R.sub.10,
R.sub.11, R.sub.12, R.sub.13, R.sub.14, and R.sub.15 when taken
together form a 3- to 8-membered carbocyclic or heterocyclic ring
or an aryl or heteroaryl group.
22. The method of claim 19, wherein the compound of Formula I-d, or
I-h is a compound of Formula III-a, III-b, III-h, or III-i;
##STR00588## wherein n.sub.3 is an integer from 0-2; each R.sub.2,
R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7, and R.sub.8 is
independently hydrogen or C.sub.1-C.sub.6 alkyl; each B.sub.1,
B.sub.2, B.sub.4, and B.sub.5 is independently CR.sub.7 or N and
each B.sub.3 is NR.sub.7, O, or S; each R.sub.z1, R.sub.z2,
R.sub.z3, R.sub.z4, and R.sub.z5 is hydrogen, C.sub.1-C.sub.6
alkyl, halogen, CF.sub.3, or nitro; one or more methylene groups of
the C.sub.1-C.sub.6 alkyl can be optionally replaced by --O--,
--C(O)--, --S--, --SO--, --SO.sub.2--, or --C(.dbd.S)--; one or
more methine groups of the C.sub.1-C.sub.6 alkyl, when present, can
be independently replaced by ##STR00589## R.sub.1 is hydrogen or
C.sub.1-C.sub.8 alkyl; and optionally when proper any two of
R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7, and R.sub.8
when taken together form a 3- to 8-membered carbocyclic or
heterocyclic ring or an aryl or heteroaryl group.
23. The method of claim 19, wherein the compound of Formula I-h is
a compound of Formula IV-a, IV-b, IV-c, IV-d, IV-e, IV-f, IV-g,
IV-h, or IV-i: ##STR00590## wherein any of the substitutable
hydrogens on the nitrogen heterocycle of the compound can be
substituted with alkyl, alkoxy, amido, acyl, acyloxy, oxoacyl,
halogen.
24. The method of claim 19, wherein the radical resulting from the
removal of a hydrogen of a compound of Formula I-a, I-d, I-k, or
I-m is a radical of Formula V-a, V-b, V-c, V-d, V-e, V-f, V-g, V-h,
V-i, or V-j; ##STR00591## ##STR00592## wherein m.sub.1 and m.sub.2
are each independently an integer from 0 to 2; each R.sub.2,
R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7, R.sub.8, R.sub.9,
R.sub.10, and R.sub.11 is independently hydrogen or C.sub.1-C.sub.6
alkyl; one or more methylene groups of the C.sub.1-C.sub.6 alkyl
can be optionally replaced by --NR.sub.1--, --O--, --C(O)--, --S--,
--SO--, --SO.sub.2--, or --C(.dbd.S)--; one or more methine groups
of the C.sub.1-C.sub.6 alkyl, when present, can be independently
replaced by ##STR00593## R.sub.1 is hydrogen or C.sub.1-C.sub.8
alkyl; and optionally when proper any two of R.sub.2, R.sub.3,
R.sub.4, R.sub.5, R.sub.6, R.sub.7, R.sub.8, R.sub.9, R.sub.10, and
R.sub.11 when taken together form a 3- to 8-membered carbocyclic or
heterocyclic ring or an aryl or heteroaryl group.
25. The method of claim 19, wherein the compounds of Formulae I-a,
I-b, I-c, I-d, I-e, I-f, I-g, I-h, I-j, I-k, I-l, I-m, I-n, I-o,
I-p, I-q, I-r, I-s, and I-t are selected from the group consisting
of: ##STR00594## ##STR00595## ##STR00596## ##STR00597##
##STR00598## wherein any substitutable hydrogen may be substituted
with the substituents as those defined by R.sub.2-R.sub.8 in
formulas I-a, I-b, I-c, I-d, I-e, I-f, I-g, I-h, I-j, I-k, I-l,
I-m, I-n, I-o, I-p, I-q, I-r, I-s, and I-t.
26. The method of claim 19, wherein the radical resulting from the
removal of a hydrogen of a compound of Formula I-a, I-d, I-k, or
I-m is a radical of Formula VI-a, VI-b, VI-c, VI-d, VI-e, VI-f,
VI-g, VI-h, VI-i, VI-j, VI-k, VI-l, VI-m, VI-n, VI-o, VI-p, or
VI-q: ##STR00599## ##STR00600## wherein R.sub.zz is hydrogen,
methyl, ethyl, propyl, isopropyl, cyclopropyl, --CH.sub.2OCH.sub.3,
and --CH.sub.2CH.sub.2OCH.sub.3.
27. The method of claim 19, wherein Scaffold is selected from the
group consisting of Formulas VII, VIII, IX-a, IX-b, XI, XII, XVI,
XVII, XVIII, XIX, XX, XXI, XXII, XXIII, XXXIV, XXV, XXVI, XXVII,
XXVIII, XXIX, XXXVI, and XXXVII.
28. The method of claim 18, wherein Scaffold is a radical resulting
from the removal of one or more hydrogens of a compound of Formula
VII: ##STR00601## wherein V and W are each independently
--(CR.sub.14R.sub.15).sub.qX.sub.3(CR.sub.16R.sub.17).sub.r--; q
and r are each independently 0, 1, 2, 3, or 4; X.sub.3 is
--CR.sub.18R.sub.19--, or --NR.sub.20--; and R.sub.x, R.sub.y,
R.sub.12, R.sub.13, R.sub.14, R.sub.15, R.sub.16, R.sub.17,
R.sub.18, R.sub.19, and R.sub.20 are each independently hydrogen or
C.sub.1-C.sub.6 alkyl; wherein one or more methylene groups of the
C.sub.1-C.sub.6 alkyl can be replaced by --NR.sub.1--, --O--,
--C(O)--, --SO--, --C(.dbd.S)--, optionally substituted aryl or
heteroaryl groups; one or more methine groups of the
C.sub.1-C.sub.6 alkyl, when present, can be independently replaced
by ##STR00602## and R.sub.1 is hydrogen or C.sub.1-C.sub.8
alkyl.
29. The method of claim 28, wherein the compound of Formula VII is
a compound of Formula VII-a: ##STR00603## wherein V and W are each
independently
--(CR.sub.14R.sub.15).sub.qX.sub.3(CR.sub.16R.sub.17).sub.r--; q
and r are each independently 0, 1, 2, 3, or 4; X.sub.3 is
--CR.sub.18R.sub.19--, or --NR.sub.20--; p is 0, 1, 2, 3, or 4;
R.sub.12, R.sub.13, R.sub.14, R.sub.15, R.sub.16, R.sub.17,
R.sub.18, R.sub.19, and R.sub.20 are each independently hydrogen or
C.sub.1-C.sub.6 alkyl; wherein one or more methylene groups of the
C.sub.1-C.sub.6 alkyl can be replaced by --NR.sub.1--, --O--,
--C(O)--, --S--, --SO--, --SO.sub.2--, --C(.dbd.S)--, optionally
substituted aryl or heteroaryl groups; one or more methine groups
of the C.sub.1-C.sub.6 alkyl, when present, can be independently
replaced by ##STR00604## R.sub.1 is hydrogen or C.sub.1-C.sub.8
alkyl; and; R.sub.23 is hydrogen, C.sub.1-C.sub.6 alkyl, halogen,
amino, or nitro; wherein one or more methylene groups of
C.sub.1-C.sub.6 alkyl can be optionally replaced by --NR.sub.1--,
--O--, --C(O)--, --S--, --SO--, --SO.sub.2--, or --C(.dbd.S)--; one
or more methine groups of the C.sub.1-C.sub.6 alkyl, when present,
can be independently replaced by ##STR00605## and optionally
R.sub.21 and R.sub.23 taken together can form a 4- to 8-membered
carbocyclic or heterocyclic ring.
30. The method of claim 19, wherein the compound of Formula I' is a
compound of Formula VII-b: ##STR00606## wherein V and W are each
independently
--(CR.sub.14R.sub.15).sub.qX.sub.3(CR.sub.16R.sub.17).sub.r--; q
and r are each independently 0, 1, 2, 3, or 4; X.sub.3 is
--CR.sub.18R.sub.19--, or --NR.sub.20--; p is 0, 1, 2, 3, or 4;
R.sub.12, R.sub.13, R.sub.14, R.sub.15, R.sub.16, R.sub.17,
R.sub.18, R.sub.19, and R.sub.20 are each independently hydrogen or
C.sub.1-C.sub.6 alkyl; wherein one or more methylene groups of the
C.sub.1-C.sub.6 alkyl can be replaced by --NR.sub.1--, --O--,
--C(O)--, --S--, --SO--, --SO.sub.2--, --C(.dbd.S)--, optionally
substituted aryl or heteroaryl groups; one or more methine groups
of the C.sub.1-C.sub.6 alkyl, when present, can be independently
replaced by ##STR00607## R.sub.1 is hydrogen or C.sub.1-C.sub.8
alkyl; and; R.sub.23 is hydrogen, C.sub.1-C.sub.6 alkyl, halogen,
amino, or nitro; wherein one or more methylene groups of
C.sub.1-C.sub.6 alkyl can be optionally replaced by --NR.sub.1--,
--O--, --C(O)--, --S--, --SO--, --SO.sub.2--, or --C(.dbd.S)--; one
or more methine groups of the C.sub.1-C.sub.6 alkyl, when present,
can be independently replaced by ##STR00608## and optionally
R.sub.21 and R.sub.23 taken together can form a 4- to 8-membered
carbocyclic or heterocyclic ring; T is Tether; and R.sub.wh is
Warhead.
31. The method of claim 30, wherein the compound of Formula VII-b
is a compound of Formula VII-h; ##STR00609##
32. The method of claim 31, wherein the compound of Formula VII-h
is a compound of Formula VII-j, VII-k, VII-l, VII-m, VII-n, or
VII-o: ##STR00610## ##STR00611##
33. The method of claim 31, wherein the compound is selected from
the group consisting of: ##STR00612## ##STR00613## ##STR00614##
##STR00615## ##STR00616## ##STR00617## ##STR00618## ##STR00619##
##STR00620## ##STR00621## ##STR00622## ##STR00623##
##STR00624##
34. The method of claim 19, wherein Scaffold is a radical resulting
from the removal of a hydrogen of a compound of Formula VIII:
##STR00625## wherein X.sub.4 is --CR.sub.33-- or --N--; s and p are
each independently 0, 1, 2, 3, or 4; R.sub.12, R.sub.13, R.sub.21,
R.sub.22, R.sub.24, R.sub.25, R.sub.26, R.sub.27, R.sub.28,
R.sub.29, R.sub.30, R.sub.31, R.sub.32, and R.sub.33 are each
independently hydrogen or C.sub.1-C.sub.6 alkyl; R.sub.23 is
hydrogen, C.sub.1-C.sub.6 alkyl, halogen, amino, or nitro; wherein
one or more methylene groups of C.sub.1-C.sub.6 alkyl can be
optionally replaced by --NR.sub.1--, --O--, --C(O)--, --S--,
--SO--, --SO.sub.2--, or --C(.dbd.S)--; one or more methine groups
of the C.sub.1-C.sub.6 alkyl, when present, can be independently
replaced by ##STR00626## R.sub.1 is hydrogen or C.sub.1-C.sub.8
alkyl; and optionally R.sub.21 and R.sub.23 taken together can form
a 4- to 8-membered carbocyclic or heterocyclic ring.
35. The method of claim 18, wherein the compound of Formula I' is a
compound of Formula VIII-a or VIII-b: ##STR00627## wherein X.sub.4
is --CR.sub.33-- or --N--; s and p are each independently 0, 1, 2,
3, or 4; R.sub.12, R.sub.13, R.sub.21, R.sub.22, R.sub.24,
R.sub.25, R.sub.26, R.sub.27, R.sub.28, and R.sub.33 are each
independently hydrogen or C.sub.1-C.sub.6 alkyl; R.sub.23 is
hydrogen, C.sub.1-C.sub.6 alkyl, halogen, amino, or nitro; wherein
one or more methylene groups of C.sub.1-C.sub.6 alkyl can be
optionally replaced by --NR.sub.1--, --O--, --C(O)--, --S--,
--SO--, --SO.sub.2--, or --C(.dbd.S)--; one or more methine groups
of the C.sub.1-C.sub.6 alkyl, when present, can be independently
replaced by ##STR00628## R.sub.1 is hydrogen or C.sub.1-C.sub.8
alkyl; and optionally R.sub.21 and R.sub.23 taken together can form
a 4- to 8-membered carbocyclic or heterocyclic ring; and Warhead is
a radical resulting from the removal of a hydrogen of a compound of
Formula I-a, I-b, I-c, I-d, I-e, I-f, I-g, I-h, I-j, I-k, I-l, I-m,
I-n, I-o, I-p, I-q, I-r, I-s, and I-t: ##STR00629## ##STR00630##
wherein each X.sub.1 and X.sub.8 is independently --O--, --S--, or
--NR.sub.6--; each X.sub.2 is independently --R.sub.6, --OR.sub.6,
or --NR.sub.6R.sub.7; each X.sub.9 is independently ##STR00631##
each R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7, and
R.sub.8 is independently hydrogen or C.sub.1-C.sub.6 alkyl; wherein
one or more methylene groups of the C.sub.1-C.sub.6 alkyl can be
replaced by --NR.sub.1--, --O--, --C(O)--, --S--, --SO--,
--SO.sub.2--, or --C(.dbd.S)--; one or more methine groups of the
C.sub.1-C.sub.6 alkyl, when present, can be independently replaced
by ##STR00632## R.sub.1 is hydrogen or C.sub.1-C.sub.8 alkyl;
wherein optionally when proper any two of R.sub.2, R.sub.3,
R.sub.4, R.sub.5, R.sub.6, R.sub.7, and R.sub.8 when taken together
form a 3- to 8-membered carbocyclic or heterocyclic ring or an aryl
or heteroaryl group; and optionally X.sub.2 and any one of R.sub.2,
R.sub.3, and R.sub.4 when taken together form a 3- to 8-membered
carbocyclic or heterocyclic ring or an aryl or heteroaryl group; A
and B are each independently an optionally substituted monocyclic,
bicyclic, or tricyclic aryl or heteroaryl; and n is an integer from
2-4; each n.sub.1 and n.sub.2 is independently an integer from 0-2;
n.sub.3 is an integer from 1-2; n.sub.4 is an integer from 1-3; and
each one of n.sub.9, n.sub.10, n.sub.11, and n.sub.12 is an integer
from 0-1; and n.sub.13 is an integer from 0-2, wherein when any one
of the foregoing n integers is more than 1, the adjacent carbons
represented by the integer can form a single or double bond.
36. The method of claim 35, wherein the compound of Formula VIII-a
or VIII-b is selected from the group consisting of: ##STR00633##
##STR00634##
37. The method of claim 19, wherein Scaffold is a radical resulting
from the removal of a hydrogen of a compound of Formula IX-a or
IX-b, ##STR00635## wherein X.sub.5 is --O--, --CR.sub.42R.sub.43--
or --NR.sub.42--; R.sub.12, R.sub.13, R.sub.27, R.sub.28, R.sub.29,
R.sub.30, R.sub.31, R.sub.32, R.sub.33, R.sub.34, R.sub.35,
R.sub.36, R.sub.37, R.sub.38, R.sub.39, R.sub.40, R.sub.41,
R.sub.42, and R.sub.43 are each independently hydrogen or
C.sub.1-C.sub.6 alkyl; wherein one or more methylene groups of
C.sub.1-C.sub.6 alkyl can be optionally replaced by --NR.sub.1--,
--O--, --C(O)--, --S--, --SO--, --SO.sub.2--, or --C(.dbd.S)--; one
or more methine groups of the C.sub.1-C.sub.6 alkyl, when present,
can be independently replaced by ##STR00636## R.sub.1 is hydrogen
or C.sub.1-C.sub.8 alkyl; D, E, F, G, and H are each independently
optionally substituted aryl or heteroaryl; wherein F and G are
fused together to form a bicyclic optionally substituted aryl or
heteroaryl.
38. The method of claim 18, wherein the compound of Formula I' is a
compound of Formula IX-c or IX-d: ##STR00637## wherein R.sub.12,
R.sub.13, R.sub.31, are each independently hydrogen or
C.sub.1-C.sub.6 alkyl; wherein one or more methylene groups of
C.sub.1-C.sub.6 alkyl can be optionally replaced by --NR.sub.1--,
--O--, --C(O)--, --S--, --SO--, --SO.sub.2--, or --C(.dbd.S)--; one
or more methine groups of the C.sub.1-C.sub.6 alkyl, when present,
can be independently replaced by ##STR00638## R.sub.1 is hydrogen
or C.sub.1-C.sub.8 alkyl; F, G, and H are each independently
optionally substituted aryl or heteroaryl; wherein F and G are
fused together to form a bicyclic optionally substituted aryl or
heteroaryl; T is Tether; R.sub.wh is Warhead which is a radical
resulting from the removal of a hydrogen of a compound of Formula
I-a, I-b, I-c, I-d, I-e, I-f, I-g, I-h, I-j, I-k, I-l, I-m, I-n,
I-o, I-p, I-q, I-r, I-s, and I-t: ##STR00639## ##STR00640##
##STR00641## wherein each X.sub.1 and X.sub.8 is independently
--O--, --S--, or --NR.sub.6--; each X.sub.2 is independently
--R.sub.6, --OR.sub.6, or --NR.sub.6R.sub.7; each X.sub.9 is
independently ##STR00642## each R.sub.2, R.sub.3, R.sub.4, R.sub.5,
R.sub.6, R.sub.7, and R.sub.8 is independently hydrogen or
C.sub.1-C.sub.6 alkyl; wherein one or more methylene groups of the
C.sub.1-C.sub.6 alkyl can be replaced by --NR.sub.1--, --O--,
--C(O)--, --S--, --SO--, --SO.sub.2--, or --C(.dbd.S)--; one or
more methine groups of the C.sub.1-C.sub.6 alkyl, when present, can
be independently replaced by ##STR00643## R.sub.1 is hydrogen or
C.sub.1-C.sub.8 alkyl; wherein optionally when proper any two of
R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7, and R.sub.8
when taken together form a 3- to 8-membered carbocyclic or
heterocyclic ring or an aryl or heteroaryl group; and optionally
X.sub.2 and any one of R.sub.2, R.sub.3, and R.sub.4 when taken
together form a 3- to 8-membered carbocyclic or heterocyclic ring
or an aryl or heteroaryl group; A and B are each independently an
optionally substituted monocyclic, bicyclic, or tricyclic aryl or
heteroaryl; and n is an integer from 2-4; each n.sub.1 and n.sub.2
is independently an integer from 0-2; n.sub.3 is an integer from
1-2; n.sub.4 is an integer from 1-3; and each one of n.sub.9,
n.sub.10, n.sub.11, and n.sub.12 is an integer from 0-1; and
n.sub.13 is an integer from 0-2, wherein when any one of the
foregoing n integers is more than 1, the adjacent carbons
represented by the integer can form a single or double bond.
39. The method of claim 18, wherein the compound of Formula I' is a
compound of Formula XI: ##STR00644## wherein p is an integer from 0
to 4, u is an integer from 1 to 4; B.sub.6 and B.sub.7 are each
independently CR.sub.7 or N; R.sub.69 is hydrogen, C.sub.1-C.sub.6
alkyl, halogen, amino, nitro, or --NH(CO)NR.sub.78R.sub.79;
R.sub.70 is hydrogen, C.sub.1-C.sub.6 alkyl, halogen, amino, nitro;
R.sub.7, R.sub.71, R.sub.72, R.sub.73, R.sub.74, R.sub.75,
R.sub.76, R.sub.77, R.sub.78, and R.sub.79 are each independently
hydrogen or C.sub.1-C.sub.6 alkyl; R.sub.1 is hydrogen or
C.sub.1-C.sub.8 alkyl; wherein one or more methylene groups of the
C.sub.1-C.sub.6 alkyl can be replaced by --NR.sub.1--, --O--,
--C(O)--, --S--, --SO--, --SO.sub.2--, or --C(.dbd.S)--; one or
more methine groups of the C.sub.1-C.sub.6 alkyl, when present, can
be independently replaced by ##STR00645## optionally R.sub.78, and
R.sub.79 taken together form a 4- to 8-membered carbocyclic or
heterocyclic ring; T is Tether; and R.sub.wh is Warhead which is a
radical resulting from the removal of a hydrogen of a compound of
Formula I-a, I-b, I-c, I-d, I-e, I-f, I-g, I-h, I-j, I-k, I-l, I-m,
I-n, I-o, I-p, I-q, I-r, I-s, and I-t: ##STR00646## ##STR00647##
##STR00648## wherein each X.sub.1 and X.sub.8 is independently
--O--, --S--, or --NR.sub.6--; each X.sub.2 is independently
--R.sub.6, --OR.sub.6, or --NR.sub.6R.sub.7; each X.sub.9 is
independently ##STR00649## each R.sub.2, R.sub.3, R.sub.4, R.sub.5,
R.sub.6, R.sub.7, and R.sub.8 is independently hydrogen or
C.sub.1-C.sub.6 alkyl; wherein one or more methylene groups of the
C.sub.1-C.sub.6 alkyl can be replaced by --NR.sub.1--, --O--,
--C(O)--, --S--, --SO--, --SO.sub.2--, or --C(.dbd.S)--; one or
more methine groups of the C.sub.1-C.sub.6 alkyl, when present, can
be independently replaced by ##STR00650## R.sub.1 is hydrogen or
C.sub.1-C.sub.8 alkyl; wherein optionally when proper any two of
R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7, and R.sub.8
when taken together form a 3- to 8-membered carbocyclic or
heterocyclic ring or an aryl or heteroaryl group; and optionally
X.sub.2 and any one of R.sub.2, R.sub.3, and R.sub.4 when taken
together form a 3- to 8-membered carbocyclic or heterocyclic ring
or an aryl or heteroaryl group; A and B are each independently an
optionally substituted monocyclic, bicyclic, or tricyclic aryl or
heteroaryl; and n is an integer from 2-4; each n.sub.1 and n.sub.2
is independently an integer from 0-2; n.sub.3 is an integer from
1-2; n.sub.4 is an integer from 1-3; and each one of n.sub.9,
n.sub.10, n.sub.11, and n.sub.12 is an integer from 0-1; and
n.sub.13 is an integer from 0-2, wherein when any one of the
foregoing n integers is more than 1, the adjacent carbons
represented by the integer can form a single or double bond.
40. The method of claim 39, wherein the compound of Formula XI is a
compound of Formula XI-a, XI-b, or XI-c: ##STR00651##
41. The method of claim 40, wherein the compound of Formula XI-a,
XI-b or XI-c is a compound of Formula XI-d, XI-e, XI-f, XI-g, XI-h,
XI-i, or XI-j: ##STR00652## ##STR00653##
42. The method of claim 41, wherein the compound of Formula XI-d,
XI-e, XI-f, XI-g, XI-h, XI-i, or XI-j is a compound of Formula
XI-k, XI-l, XI-m, XI-n, XI-o, XI-p, or XI-q; ##STR00654##
##STR00655## wherein R.sub.88, and R.sub.89 are each independently
hydrogen or C.sub.1-C.sub.6 alkyl; R.sub.1 is hydrogen or
C.sub.1-C.sub.8 alkyl; one or more methylene groups of the
C.sub.1-C.sub.6 alkyl can be replaced by --NR.sub.1--, --O--,
--C(O)--, --S--, --SO--, --SO.sub.2--, or --C(.dbd.S)--; one or
more methine groups of the C.sub.1-C.sub.6 alkyl, when present, can
be independently replaced by ##STR00656## and n.sub.5 is an integer
from 0 to 3.
43. The method of claim 42, wherein the compound of Formula XI-d,
XI-e, XI-f, XI-g, XI-h, XI-i, or XI-j is a compound of Formula
XI-r, XI-s, XI-t, XI-u, XI-v, XI-w, or XI-x; ##STR00657##
##STR00658##
44. The method of claim 41, wherein the compound of Formula XI-d,
XI-e, XI-f, XI-g, XI-h, XI-i, or XI-j is a compound of Formula
XI-y, XI-z, XI-aa, or XI-bb; ##STR00659##
45. The method of claim 41, wherein the compound of Formula XI-d,
XI-e, XI-f, XI-g, XI-h, XI-i, or XI-j is a compound of Formula
XI-cc, XI-dd, XI-ee, or XI-ff: ##STR00660##
46. The method of claim 39, wherein the compound of Formula XI is
selected from the group consisting of: ##STR00661## ##STR00662##
##STR00663## ##STR00664## ##STR00665## ##STR00666## ##STR00667##
##STR00668## ##STR00669## ##STR00670## ##STR00671## ##STR00672##
##STR00673## ##STR00674##
47. The method of claim 18, wherein the compound of Formula I' is a
compound of Formula XII: ##STR00675## wherein R.sub.1 and R.sub.2
are each independently hydrogen or C.sub.1-C.sub.8 alkyl; wherein
one or more methylene groups of the C.sub.1-C.sub.6 alkyl can be
replaced by --NR.sub.1--, --O--, --C(O)--, --S--, --SO--,
--SO.sub.2--, or --C(.dbd.S)--; one or more methine groups of the
C.sub.1-C.sub.6 alkyl, when present, can be independently replaced
by ##STR00676## T is Tether; R.sub.wh is Warhead which is a radical
resulting from the removal of a hydrogen of a compound of Formula
I-a, I-b, I-c, I-d, I-e, I-f, I-g, I-h, I-j, I-k, I-l, I-m, I-n,
I-o, I-p, I-q, I-r, I-s, and I-t: ##STR00677## ##STR00678##
##STR00679## wherein each X.sub.1 and X.sub.8 is independently
--O--, --S--, or --NR.sub.6--; each X.sub.2 is independently
--R.sub.6, --OR.sub.6, or --NR.sub.6R.sub.7; each X.sub.9 is
independently ##STR00680## each R.sub.2, R.sub.3, R.sub.4, R.sub.5,
R.sub.6, R.sub.7, and R.sub.8 is independently hydrogen or
C.sub.1-C.sub.6 alkyl; wherein one or more methylene groups of the
C.sub.1-C.sub.6 alkyl can be replaced by --NR.sub.1--, --O--,
--C(O)--, --S--, --SO--, --SO.sub.2--, or --C(.dbd.S)--; one or
more methine groups of the C.sub.1-C.sub.6 alkyl, when present, can
be independently replaced by ##STR00681## R.sub.1 is hydrogen or
C.sub.1-C.sub.8 alkyl; wherein optionally when proper any two of
R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7, and R.sub.8
when taken together form a 3- to 8-membered carbocyclic or
heterocyclic ring or an aryl or heteroaryl group; and optionally
X.sub.2 and any one of R.sub.2, R.sub.3, and R.sub.4 when taken
together form a 3- to 8-membered carbocyclic or heterocyclic ring
or an aryl or heteroaryl group; A and B are each independently an
optionally substituted monocyclic, bicyclic, or tricyclic aryl or
heteroaryl; and n is an integer from 2-4; each n.sub.1 and n.sub.2
is independently an integer from 0-2; n.sub.3 is an integer from
1-2; n.sub.4 is an integer from 1-3; and each one of n.sub.9,
n.sub.10, n.sub.11, and n.sub.12 is an integer from 0-1; and
n.sub.13 is an integer from 0-2, wherein when any one of the
foregoing n integers is more than 1, the adjacent carbons
represented by the integer can form a single or double bond.
48. The method of claim 18, wherein the compound of Formula I' is a
compound of Formula XXXVI: ##STR00682## wherein R.sub.v is H,
optionally substituted C.sub.1-C.sub.3 branched or straight chain
alkyl, or optionally substituted C.sub.1-C.sub.3 branched or
straight chain acyl; T is Tether; and R.sub.wh is Warhead which is
a radical resulting from the removal of a hydrogen of a compound of
Formula I-a, I-b, I-c, I-d, I-e, I-f, I-g, I-h, I-j, I-k, I-l, I-m,
I-n, I-o, I-p, I-q, I-r, I-s, and I-t: ##STR00683## ##STR00684##
##STR00685## wherein each X.sub.1 and X.sub.8 is independently
--O--, --S--, or --NR.sub.6--; each X.sub.2 is independently
--R.sub.6, --OR.sub.6, or --NR.sub.6R.sub.7; each X.sub.9 is
independently ##STR00686## each R.sub.2, R.sub.3, R.sub.4, R.sub.5,
R.sub.6, R.sub.7, and R.sub.8 is independently hydrogen or
C.sub.1-C.sub.6 alkyl; wherein one or more methylene groups of the
C.sub.1-C.sub.6 alkyl can be replaced by --NR.sub.1--, --O--,
--C(O)--, --S--, --SO--, --SO.sub.2--, or --C(.dbd.S)--; one or
more methine groups of the C.sub.1-C.sub.6 alkyl, when present, can
be independently replaced by ##STR00687## R.sub.1 is hydrogen or
C.sub.1-C.sub.8 alkyl; wherein optionally when proper any two of
R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7, and R.sub.8
when taken together form a 3- to 8-membered carbocyclic or
heterocyclic ring or an aryl or heteroaryl group; and optionally
X.sub.2 and any one of R.sub.2, R.sub.3, and R.sub.4 when taken
together form a 3- to 8-membered carbocyclic or heterocyclic ring
or an aryl or heteroaryl group; A and B are each independently an
optionally substituted monocyclic, bicyclic, or tricyclic aryl or
heteroaryl; and n is an integer from 2-4; each n.sub.1 and n.sub.2
is independently an integer from 0-2; n.sub.3 is an integer from
1-2; n.sub.4 is an integer from 1-3; and each one of n.sub.9,
n.sub.10, n.sub.11, and n.sub.12 is an integer from 0-1; and
n.sub.13 is an integer from 0-2, wherein when any one of the
foregoing n integers is more than 1, the adjacent carbons
represented by the integer can form a single or double bond.
49. The method of claim 18, wherein the compound of Formula I' is
selected from the group consisting of: ##STR00688##
50. The method of claim 19, wherein Scaffold is a radical resulting
from the removal of a hydrogen of a compound of Formula XVI-a,
XVI-b, or XVI-c: ##STR00689## wherein R.sub.90, R.sub.91, R.sub.92,
R.sub.93, R.sub.94, R.sub.95, R.sub.96, R.sub.97, R.sub.98,
R.sub.99, R.sub.100, R.sub.102, R.sub.104, R.sub.105, R.sub.106,
R.sub.107, R.sub.108, R.sub.109, R.sub.110, R.sub.111, R.sub.112,
R.sub.113, and R.sub.114 are each independently hydrogen or
C.sub.1-C.sub.6 alkyl; wherein one or more methylene groups of
C.sub.1-C.sub.6 alkyl can be optionally replaced by --NR.sub.1--,
--O--, --C(O)--, --SO--, --SO.sub.2--, or --C(.dbd.S)--; R.sub.103
is hydrogen, C.sub.1-C.sub.6 alkyl, or C.sub.2-C.sub.8 alkenyl; one
or more methine groups of the C.sub.1-C.sub.6 alkyl, when present,
can be independently replaced by ##STR00690## R.sub.1 is hydrogen
or C.sub.1-C.sub.8 alkyl; each R.sub.101 and R.sub.101 is
independently hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.8
alkenyl, halogen, amino, nitro, optionally substituted aryl or
heteroaryl; and n.sub.6 and n.sub.7 are each independently integer
from 0 to 4; and n.sub.8 is an integer from 0 to 2.
51. The method of claim 18, wherein the compound of Formula I' is a
compound of Formula XVI-d, XVI-e, or XVI-f: ##STR00691## wherein
R.sub.90 and R.sub.114 are each independently hydrogen or
C.sub.1-C.sub.6 alkyl; R.sub.103 is hydrogen, C.sub.1-C.sub.6
alkyl, or C.sub.2-C.sub.8 alkenyl; R.sub.101 is hydrogen,
C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.8 alkenyl, halogen, amino,
nitro, optionally substituted aryl or heteroaryl; and n.sub.6 is an
integer from 0 to 4; n.sub.8 is an integer from 0 to 2; wherein one
or more methylene groups of C.sub.1-C.sub.6 alkyl can be optionally
replaced by --NR.sub.1--, --O--, --C(O)--, --S--, --SO--,
--SO.sub.2--, or --C(.dbd.S)--; and R.sub.wh is Warhead which is a
radical resulting from the removal of a hydrogen of a compound of
Formula I-a, I-b, I-c, I-d, I-e, I-f, I-g, I-h, I-j, I-k, I-l, I-m,
I-n, I-o, I-p, I-q, I-r, I-s, and I-t: ##STR00692## ##STR00693##
##STR00694## wherein each X.sub.1 and X.sub.8 is independently
--O--, --S--, or --NR.sub.6--; each X.sub.2 is independently
--R.sub.6, --OR.sub.6, or --NR.sub.6R.sub.7; each X.sub.9 is
independently ##STR00695## each R.sub.2, R.sub.3, R.sub.4, R.sub.5,
R.sub.6, R.sub.7, and R.sub.8 is independently hydrogen or
C.sub.1-C.sub.6 alkyl; wherein one or more methylene groups of the
C.sub.1-C.sub.6 alkyl can be replaced by --NR.sub.1--, --O--,
--C(O)--, --S--, --SO--, --SO.sub.2--, or --C(.dbd.S)--; one or
more methine groups of the C.sub.1-C.sub.6 alkyl, when present, can
be independently replaced by ##STR00696## R.sub.1 is hydrogen or
C.sub.1-C.sub.8 alkyl; wherein optionally when proper any two of
R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7, and R.sub.8
when taken together form a 3- to 8-membered carbocyclic or
heterocyclic ring or an aryl or heteroaryl group; and optionally
X.sub.2 and any one of R.sub.2, R.sub.3, and R.sub.4 when taken
together form a 3- to 8-membered carbocyclic or heterocyclic ring
or an aryl or heteroaryl group; A and B are each independently an
optionally substituted monocyclic, bicyclic, or tricyclic aryl or
heteroaryl; and n is an integer from 2-4; each n.sub.1 and n.sub.2
is independently an integer from 0-2; n.sub.3 is an integer from
1-2; n.sub.4 is an integer from 1-3; and each one of n.sub.9,
n.sub.10, n.sub.11, and n.sub.12 is an integer from 0-1; and
n.sub.13 is an integer from 0-2, wherein when any one of the
foregoing n integers is more than 1, the adjacent carbons
represented by the integer can form a single or double bond; and T
is Tether.
52. The method of claim 51, wherein the compound of Formula XVI-d,
XVI-e, or XVI-f is a compound of Formula XVI-g, XVI-h, or XVI-i:
##STR00697##
53. The method of claim 18, wherein the compound of Formula XVI-d,
XVI-e, or XVI-f is selected from the group consisting of:
##STR00698## ##STR00699## ##STR00700## ##STR00701## ##STR00702##
##STR00703## ##STR00704## ##STR00705## ##STR00706## ##STR00707##
##STR00708##
54. The method of claim 18 wherein the compound of Formula I' is a
compound of Formula XXII-a, Formula XXII-b, or Formula XXII-c:
##STR00709## wherein n, m, p, and q for Formula XXII-a and Formula
XXII-b are each independently 0, 1, 2, 3; provided that n and q are
not 0 at the same time, and m and q are not 0 at the same time; T
is tether; R.sub.wh is Warhead and is a radical resulting from the
removal of a hydrogen of a compound of Formula I-a, I-b, I-c, I-d,
I-e, I-f, I-g, I-h, I-j, I-k, I-l, I-m, I-n, I-o, I-p, I-q, I-r,
I-s, and I-t: ##STR00710## ##STR00711## ##STR00712## wherein each
X.sub.1 and X.sub.8 is independently --O--, --S--, or --NR.sub.6--;
each X.sub.2 is independently --R.sub.6, --OR.sub.6, or
--NR.sub.6R.sub.7; each X.sub.9 is independently ##STR00713## each
R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7, and R.sub.8
is independently hydrogen or C.sub.1-C.sub.6 alkyl; wherein one or
more methylene groups of the C.sub.1-C.sub.6 alkyl can be replaced
by --NR.sub.1--, --O--, --C(O)--, --S--, --SO--, --SO.sub.2--, or
--C(.dbd.S)--; one or more methine groups of the C.sub.1-C.sub.6
alkyl, when present, can be independently replaced by ##STR00714##
R.sub.1 is hydrogen or C.sub.1-C.sub.8 alkyl; wherein optionally
when proper any two of R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6,
R.sub.7, and R.sub.8 when taken together form a 3- to 8-membered
carbocyclic or heterocyclic ring or an aryl or heteroaryl group;
and optionally X.sub.2 and any one of R.sub.2, R.sub.3, and R.sub.4
when taken together form a 3- to 8-membered carbocyclic or
heterocyclic ring or an aryl or heteroaryl group; A and B are each
independently an optionally substituted monocyclic, bicyclic, or
tricyclic aryl or heteroaryl; and n is an integer from 2-4; each
n.sub.1 and n.sub.2 is independently an integer from 0-2; n.sub.3
is an integer from 1-2; n.sub.4 is an integer from 1-3; and each
one of n.sub.9, n.sub.10, n.sub.11, and n.sub.12 is an integer from
0-1; and n.sub.13 is an integer from 0-2, wherein when any one of
the foregoing n integers is more than 1, the adjacent carbons
represented by the integer can form a single or double bond;
A.sup.2 is an optionally substituted ring selected from a 4-8
membered saturated or partially unsaturated heterocyclic ring
having one or two heteroatoms independently selected from nitrogen,
oxygen, or sulfur, or a 5-10 membered saturated or partially
unsaturated bridged bicyclic heterocyclic ring having at least one
nitrogen, at least one oxygen, and optionally 1-2 additional
heteroatoms independently selected from nitrogen, oxygen, or
sulfur; B' is an optionally substituted group selected from phenyl,
an 8- to 10-membered bicyclic aryl ring, a 5- to 6-membered
heteroaryl ring having 1-4 heteroatoms independently selected from
nitrogen, oxygen, or sulfur, or an 8- to 10-membered bicyclic
heteroaryl ring having 1-4 heteroatoms independently selected from
nitrogen, oxygen, or sulfur; or -T-Rwh; and C.sup.2 is hydrogen or
an optionally substituted ring selected from a 3- to 7-membered
saturated or partially unsaturated carbocyclic ring, a 7- to
10-membered saturated or partially unsaturated bicyclic carbocyclic
ring, a 4- to 7-membered saturated or partially unsaturated
heterocyclic ring having 1-2 heteroatoms independently selected
from nitrogen, oxygen, or sulfur, a 7- to 10-membered saturated or
partially unsaturated bicyclic heterocyclic ring having 1-3
heteroatoms independently selected from nitrogen, oxygen, or
sulfur, phenyl, an 8- to 10-membered bicyclic aryl ring, a 5- to
6-membered heteroaryl ring having 1-3 heteroatoms independently
selected from nitrogen, oxygen, or sulfur, or an 8- to 10-membered
bicyclic heteroaryl ring having 1-4 heteroatoms independently
selected from nitrogen, oxygen, or sulfur.
55. The method of claim 54, wherein the compound of Formula XXII-a,
XXII-b, XXII-c is selected from the group consisting of:
##STR00715## ##STR00716## ##STR00717## ##STR00718## ##STR00719##
##STR00720## ##STR00721## ##STR00722## ##STR00723##
##STR00724##
56. The method of claim 18, wherein the compound of Formula I' is a
compound of Formula XXIII: ##STR00725## wherein: R.sub.wh is
Warhead which is a radical resulting from the removal of a hydrogen
of a compound of Formula I-a, I-b, I-c, I-d, I-e, I-f, I-g, I-h,
I-j, I-k, I-l, I-m, I-n, I-o, I-p, I-q, I-r, I-s, and I-t:
##STR00726## ##STR00727## ##STR00728## wherein each X.sub.1 and
X.sub.8 is independently --O--, --S--, or --NR.sub.6--; each
X.sub.2 is independently --R.sub.6, --OR.sub.6, or
--NR.sub.6R.sub.7; each X.sub.9 is independently ##STR00729## each
R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7, and R.sub.8
is independently hydrogen or C.sub.1-C.sub.6 alkyl; wherein one or
more methylene groups of the C.sub.1-C.sub.6 alkyl can be replaced
by --NR.sub.1--, --O--, --C(O)--, --S--, --SO--, --SO.sub.2--, or
--C(.dbd.S)--; one or more methine groups of the C.sub.1-C.sub.6
alkyl, when present, can be independently replaced by ##STR00730##
R.sub.1 is hydrogen or C.sub.1-C.sub.8 alkyl; wherein optionally
when proper any two of R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6,
R.sub.7, and R.sub.8 when taken together form a 3- to 8-membered
carbocyclic or heterocyclic ring or an aryl or heteroaryl group;
and optionally X.sub.2 and any one of R.sub.2, R.sub.3, and R.sub.4
when taken together form a 3- to 8-membered carbocyclic or
heterocyclic ring or an aryl or heteroaryl group; A and B are each
independently an optionally substituted monocyclic, bicyclic, or
tricyclic aryl or heteroaryl; and n is an integer from 2-4; each
n.sub.1 and n.sub.2 is independently an integer from 0-2; n.sub.3
is an integer from 1-2; n.sub.4 is an integer from 1-3; and each
one of n.sub.9, n.sub.10, n.sub.11, and n.sub.12 is an integer from
0-1; and n.sub.13 is an integer from 0-2, wherein when any one of
the foregoing n integers is more than 1, the adjacent carbons
represented by the integer can form a single or double bond;
R.sub.201 is hydrogen or C.sub.1-6 alkyl; R.sub.202 is hydrogen or
an optionally substituted group selected from C.sub.1-6 alkyl,
C.sub.1-6 alkoxy, or (C.sub.1-6 alkylene)-R.sub.203; or R.sub.201
and R.sub.202 are taken together with the intervening carbon to
form an optionally substituted ring selected from a 3- to
7-membered carbocyclic ring or a 4- to 7-membered heterocyclic ring
having 1-2 heteroatoms independently selected from nitrogen,
oxygen, or sulfur; R.sub.203 is a 3- to 7-membered saturated or
partially unsaturated carbocyclic ring, a 7- to 10-membered
saturated or partially unsaturated bicyclic carbocyclic ring, a 4-
to 7-membered saturated or partially unsaturated heterocyclic ring
having 1-2 heteroatoms independently selected from nitrogen,
oxygen, or sulfur, a 7- to 10-membered saturated or partially
unsaturated bicyclic heterocyclic ring having 1-3 heteroatoms
independently selected from nitrogen, oxygen, or sulfur, phenyl, a
8- to 10-membered bicyclic aryl ring, a 5- to 6-membered heteroaryl
ring having 1-3 heteroatoms independently selected from nitrogen,
oxygen, or sulfur, or a 8- to 10-membered bicyclic heteroaryl ring
having 1-4 heteroatoms independently selected from nitrogen,
oxygen, or sulfur; and Ring A.sup.6 is absent or an optionally
substituted group selected from a 4- to 7-membered heterocyclic
ring having 1-2 heteroatoms independently selected from nitrogen,
oxygen, or sulfur, or a 5- to 6-membered heteroaryl ring having 1-3
heteroatoms independently selected from nitrogen, oxygen, or
sulfur.
57. The method of claim 56, where the compound of Formula XXIII is
selected from the group consisting of: ##STR00731##
##STR00732##
58. The method of claim 18, wherein the compound of Formula I' is a
compound of Formula XXIV-a or Formula XXIV-b: ##STR00733## wherein
R.sub.wh is Warhead which is a radical resulting from the removal
of a hydrogen of a compound of Formula I-a, I-b, I-c, I-d, I-e,
I-f, I-g, I-h, I-j, I-k, I-l, I-m, I-n, I-o, I-p, I-q, I-r, I-s,
and I-t: ##STR00734## ##STR00735## ##STR00736## wherein each
X.sub.1 and X.sub.8 is independently --O--, --S--, or --NR.sub.6--;
each X.sub.2 is independently --R.sub.6, --OR.sub.6, or
--NR.sub.6R.sub.7; each X.sub.9 is independently ##STR00737## each
R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7, and R.sub.8
is independently hydrogen or C.sub.1-C.sub.6 alkyl; wherein one or
more methylene groups of the C.sub.1-C.sub.6 alkyl can be replaced
by --NR.sub.1--, --O--, --C(O)--, --S--, --SO--, --SO.sub.2--, or
--C(.dbd.S)--; one or more methine groups of the C.sub.1-C.sub.6
alkyl, when present, can be independently replaced by ##STR00738##
R.sub.1 is hydrogen or C.sub.1-C.sub.8 alkyl; wherein optionally
when proper any two of R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6,
R.sub.7, and R.sub.8 when taken together form a 3- to 8-membered
carbocyclic or heterocyclic ring or an aryl or heteroaryl group;
and optionally X.sub.2 and any one of R.sub.2, R.sub.3, and R.sub.4
when taken together form a 3- to 8-membered carbocyclic or
heterocyclic ring or an aryl or heteroaryl group; A and B are each
independently an optionally substituted monocyclic, bicyclic, or
tricyclic aryl or heteroaryl; and n is an integer from 2-4; each
n.sub.1 and n.sub.2 is independently an integer from 0-2; n.sub.3
is an integer from 1-2; n.sub.4 is an integer from 1-3; and each
one of n.sub.9, n.sub.10, n.sub.11, and n.sub.12 is an integer from
0-1; and n.sub.13 is an integer from 0-2, wherein when any one of
the foregoing n integers is more than 1, the adjacent carbons
represented by the integer can form a single or double bond;
R.sub.204 is an hydrogen or an optionally substituted group
selected from C.sub.1-6 aliphatic, --(CH.sub.2).sub.m-(3- to
7-membered saturated or partially unsaturated carbocyclic ring),
--(CH.sub.2).sub.m-(7- to 10-membered saturated or partially
unsaturated bicyclic carbocyclic ring), --(CH.sub.2).sub.m-(4- to
7-membered saturated or partially unsaturated heterocyclic ring
having 1-2 heteroatoms independently selected from nitrogen,
oxygen, or sulfur), --(CH.sub.2).sub.m-(7- to 10-membered saturated
or partially unsaturated bicyclic heterocyclic ring having 1-3
heteroatoms independently selected from nitrogen, oxygen, or
sulfur), --(CH.sub.2).sub.m-phenyl, --(CH.sub.2).sub.m-(8- to
10-membered bicyclic aryl ring), --(CH.sub.2).sub.m-(5- to
6-membered heteroaryl ring having 1-3 heteroatoms independently
selected from nitrogen, oxygen, or sulfur), or
--(CH.sub.2).sub.m-(8- to 10-membered bicyclic heteroaryl ring
having 1-4 heteroatoms independently selected from nitrogen,
oxygen, or sulfur); each R.sub.205 and R.sub.206 is independently
--R'', halogen, --NO.sub.2, --CN, --OR'', --SR'', --N(R'').sub.2,
--C(O)R'', --CO.sub.2R'', --C(O)C(O)R'', --C(O)CH.sub.2C(O)R'',
--S(O)R'', --S(O).sub.2R'', --C(O)N(R'').sub.2,
--SO.sub.2N(R'').sub.2, --OC(O)R'', --N(R'')C(O)R'',
--N(R'')N(R'').sub.2, --N(R'')C(.dbd.NR'')N(R'').sub.2,
--C(.dbd.NR'')N(R'').sub.2, --C.dbd.NOR'',
--N(R'')C(O)N(R'').sub.2, --N(R'')SO.sub.2N(R'').sub.2,
--N(R'')SO.sub.2R'', or --OC(O)N(R'').sub.2; each R'' is
independently hydrogen or an optionally substituted group selected
from C.sub.1-6 aliphatic, a 3- to 7-membered saturated or partially
unsaturated carbocyclic ring, a 7- to 10-membered saturated or
partially unsaturated bicyclic carbocyclic ring, a 4- to 7-membered
saturated or partially unsaturated heterocyclic ring having 1-2
heteroatoms independently selected from nitrogen, oxygen, or
sulfur, a 7- to 10-membered saturated or partially unsaturated
bicyclic heterocyclic ring having 1-3 heteroatoms independently
selected from nitrogen, oxygen, or sulfur, phenyl, an 8- to
10-membered bicyclic aryl ring, a 5- to 6-membered heteroaryl ring
having 1-3 heteroatoms independently selected from nitrogen,
oxygen, or sulfur, or an 8- to 10-membered bicyclic heteroaryl ring
having 1-4 heteroatoms independently selected from nitrogen,
oxygen, or sulfur; or two R'' groups on the same nitrogen are taken
together with the nitrogen to which they are attached to form an
optionally substituted 5-8 membered saturated, partially
unsaturated, or aromatic ring having 1-4 heteroatoms independently
selected from nitrogen, oxygen, or sulfur; m is an integer from 0
to 6, inclusive; each n for Formula XXIV-a or Formula XXIV-b is
independently 0, 1, or 2; and Ring A.sup.5 is an optionally
substituted 6-membered heterocyclic or heteroaryl ring having 1-2
nitrogens.
59. The method of claim 58, wherein the compound of Formula XXIV-a
or Formula XXIV-b is selected from the group consisting of
##STR00739##
60. The method of claim 18, wherein the compound of Formula I' is a
compound of Formula XXV: ##STR00740## wherein R.sub.wh is Warhead
which is a radical resulting from the removal of a hydrogen of a
compound of Formula I-a, I-b, I-c, I-d, I-e, I-f, I-g, I-h, I-j,
I-k, I-l, I-m, I-n, I-o, I-p, I-q, I-r, I-s, and I-t: ##STR00741##
##STR00742## wherein each X.sub.1 and X.sub.8 is independently
--O--, --S--, or --NR.sub.6--; each X.sub.2 is independently
--R.sub.6, --OR.sub.6, or --NR.sub.6R.sub.7; each X.sub.9 is
independently ##STR00743## each R.sub.2, R.sub.3, R.sub.4, R.sub.5,
R.sub.6, R.sub.7, and R.sub.8 is independently hydrogen or
C.sub.1-C.sub.6 alkyl; wherein one or more methylene groups of the
C.sub.1-C.sub.6 alkyl can be replaced by --NR.sub.1--, --O--,
--C(O)--, --S--, --SO--, --SO.sub.2--, or --C(.dbd.S)--; one or
more methine groups of the C.sub.1-C.sub.6 alkyl, when present, can
be independently replaced by ##STR00744## R.sub.1 is hydrogen or
C.sub.1-C.sub.8 alkyl; wherein optionally when proper any two of
R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7, and R.sub.8
when taken together form a 3- to 8-membered carbocyclic or
heterocyclic ring or an aryl or heteroaryl group; and optionally
X.sub.2 and any one of R.sub.2, R.sub.3, and R.sub.4 when taken
together form a 3- to 8-membered carbocyclic or heterocyclic ring
or an aryl or heteroaryl group; A and B are each independently an
optionally substituted monocyclic, bicyclic, or tricyclic aryl or
heteroaryl; and n is an integer from 2-4; each n.sub.1 and n.sub.2
is independently an integer from 0-2; n.sub.3 is an integer from
1-2; n.sub.4 is an integer from 1-3; and each one of n.sub.9,
n.sub.10, n.sub.11, and n.sub.12 is an integer from 0-1; and
n.sub.13 is an integer from 0-2, wherein when any one of the
foregoing n integers is more than 1, the adjacent carbons
represented by the integer can form a single or double bond; each
R.sub.205 and R.sub.206 is independently --R'', halogen,
--NO.sub.2, --CN, --OR'', --SR'', --N(R'').sub.2, --C(O)R'',
--CO.sub.2R'', --C(O)C(O)R'', --C(O)CH.sub.2C(O)R'', --S(O)R'',
--S(O).sub.2R'', --C(O)N(R'').sub.2, --SO.sub.2N(R'').sub.2,
--OC(O)R'', --N(R'')C(O)R'', --N(R'')N(R'').sub.2,
--N(R'')C(.dbd.NR'')N(R'').sub.2, --C(.dbd.NR'')N(R'').sub.2,
--C.dbd.NOR'', --N(R'')C(O)N(R'').sub.2,
--N(R'')SO.sub.2N(R'').sub.2, --N(R'')SO.sub.2R'', or
--OC(O)N(R'').sub.2; each R'' is independently hydrogen or an
optionally substituted group selected from C.sub.1-6 aliphatic, a
3- to 7-membered saturated or partially unsaturated carbocyclic
ring, a 7- to 10-membered saturated or partially unsaturated
bicyclic carbocyclic ring, a 4- to 7-membered saturated or
partially unsaturated heterocyclic ring having 1-2 heteroatoms
independently selected from nitrogen, oxygen, or sulfur, a 7- to
10-membered saturated or partially unsaturated bicyclic
heterocyclic ring having 1-3 heteroatoms independently selected
from nitrogen, oxygen, or sulfur, phenyl, an 8- to 10-membered
bicyclic aryl ring, a 5- to 6-membered heteroaryl ring having 1-3
heteroatoms independently selected from nitrogen, oxygen, or
sulfur, or an 8- to 10-membered bicyclic heteroaryl ring having 1-4
heteroatoms independently selected from nitrogen, oxygen, or
sulfur; or optionally, two R'' groups on the same nitrogen are
taken together with the nitrogen to which they are attached to form
an optionally substituted 5-8 membered saturated, partially
unsaturated, or aromatic ring having 1-4 heteroatoms independently
selected from nitrogen, oxygen, or sulfur; m is an integer from 0
to 6, inclusive; each n for Formula XXV is independently 0, 1, or
2; and Ring A.sup.5 is an optionally substituted 6-membered
heterocyclic or heteroaryl ring having 1-2 nitrogens.
61. The method of claim 60, wherein the compound of Formula XXV is
selected from the group consisting of: ##STR00745## ##STR00746##
##STR00747## ##STR00748##
62. The method of claim 18, wherein the compound of Formula I' is a
compound of Formula XXVII: ##STR00749## wherein: T is Tether;
R.sub.wh is Warhead which is a radical resulting from the removal
of a hydrogen of a compound of Formula I-a, I-b, I-c, I-d, I-e,
I-f, I-g, I-h, I-j, I-k, I-l, I-m, I-n, I-o, I-p, I-q, I-r, I-s,
and I-t: ##STR00750## ##STR00751## wherein each X.sub.1 and X.sub.8
is independently --O--, --S--, or --NR.sub.6--; each X.sub.2 is
independently --R.sub.6, --OR.sub.6, or --NR.sub.6R.sub.7; each
X.sub.9 is independently ##STR00752## each R.sub.2, R.sub.3,
R.sub.4, R.sub.5, R.sub.6, R.sub.7, and R.sub.8 is independently
hydrogen or C.sub.1-C.sub.6 alkyl; wherein one or more methylene
groups of the C.sub.1-C.sub.6 alkyl can be replaced by
--NR.sub.1--, --O--, --C(O)--, --S--, --SO--, --SO.sub.2--, or
--C(.dbd.S)--; one or more methine groups of the C.sub.1-C.sub.6
alkyl, when present, can be independently replaced by ##STR00753##
R.sub.1 is hydrogen or C.sub.1-C.sub.8 alkyl; wherein optionally
when proper any two of R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6,
R.sub.7, and R.sub.8 when taken together form a 3- to 8-membered
carbocyclic or heterocyclic ring or an aryl or heteroaryl group;
and optionally X.sub.2 and any one of R.sub.2, R.sub.3, and R.sub.4
when taken together form a 3- to 8-membered carbocyclic or
heterocyclic ring or an aryl or heteroaryl group; A and B are each
independently an optionally substituted monocyclic, bicyclic, or
tricyclic aryl or heteroaryl; and n is an integer from 2-4; each
n.sub.1 and n.sub.2 is independently an integer from 0-2; n.sub.3
is an integer from 1-2; n.sub.4 is an integer from 1-3; and each
one of n.sub.9, n.sub.10, n.sub.11, and n.sub.12 is an integer from
0-1; and n.sub.13 is an integer from 0-2, wherein when any one of
the foregoing n integers is more than 1, the adjacent carbons
represented by the integer can form a single or double bond.
63. The method of claim 62, wherein the compound of Formula XXVII
is selected from the group consisting of: ##STR00754## ##STR00755##
##STR00756##
64. The method of claim 18, wherein the compound of Formula I' is a
compound of Formula XXXVII: ##STR00757## wherein T is Tether;
R.sub.wh is Warhead which is a radical resulting from the removal
of a hydrogen of a compound of Formula I-a, I-b, I-c, I-d, I-e,
I-f, I-g, I-h, I-j, I-k, I-l, I-m, I-n, I-o, I-p, I-q, I-r, I-s,
and I-t: ##STR00758## ##STR00759## wherein each X.sub.1 and X.sub.8
is independently --O--, --S--, or --NR.sub.6--; each X.sub.2 is
independently --R.sub.6, --OR.sub.6, or --NR.sub.6R.sub.7; each
X.sub.9 is independently ##STR00760## each R.sub.2, R.sub.3,
R.sub.4, R.sub.5, R.sub.6, R.sub.7, and R.sub.8 is independently
hydrogen or C.sub.1-C.sub.6 alkyl; wherein one or more methylene
groups of the C.sub.1-C.sub.6 alkyl can be replaced by
--NR.sub.1--, --O--, --C(O)--, --S--, --SO--, --SO.sub.2--, or
--C(.dbd.S)--; one or more methine groups of the C.sub.1-C.sub.6
alkyl, when present, can be independently replaced by ##STR00761##
R.sub.1 is hydrogen or C.sub.1-C.sub.8 alkyl; wherein optionally
when proper any two of R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6,
R.sub.7, and R.sub.8 when taken together form a 3- to 8-membered
carbocyclic or heterocyclic ring or an aryl or heteroaryl group;
and optionally X.sub.2 and any one of R.sub.2, R.sub.3, and R.sub.4
when taken together form a 3- to 8-membered carbocyclic or
heterocyclic ring or an aryl or heteroaryl group; A and B are each
independently an optionally substituted monocyclic, bicyclic, or
tricyclic aryl or heteroaryl; and n in Warhead is an integer from
2-4; each n.sub.1 and n.sub.2 is independently an integer from 0-2;
n.sub.3 is an integer from 1-2; n.sub.4 is an integer from 1-3; and
each one of n.sub.9, n.sub.10, n.sub.11, and n.sub.12 is an integer
from 0-1; and n.sub.13 is an integer from 0-2, wherein when any one
of the foregoing n integers is more than 1, the adjacent carbons
represented by the integer can form a single or double bond; and
each n in Formula XXXVII is 0, 1, or 2.
65. The method of claim 64, wherein the compound of Formula XXXVII
is selected from the group consisting of: ##STR00762##
##STR00763##
66-184. (canceled)
Description
PRIORITY CLAIM
[0001] This application claims the benefit of U.S. provisional
application 61/335,043, filed Dec. 30, 2009, the disclosure of
which is relied on and incorporated by reference into the present
application in its entirety. All patents, patent applications and
referenced articles are hereby incorporated by reference into this
application in their entireties.
DESCRIPTION OF THE TEXT FILE SUBMITTED ELECTRONICALLY
[0002] The contents of the text file submitted electronically
herewith are incorporated herein by reference in their entirety: A
computer readable format copy of the Sequence Listing (filename:
AVIL.sub.--001.sub.--01US_SeqList_ST25.txt, date recorded: Feb. 27,
2011, file size 26 kilobytes).
FIELD OF THE INVENTION
[0003] The present invention relates to enzyme inhibitors. More
specifically, the present invention relates to ligand-directed
covalent modification of lysine-containing proteins.
BACKGROUND OF THE INVENTION
[0004] Compounds that inhibit the activity of proteins, such as
enzymes, are important therapeutic agents. Most inhibitors
reversibly bind to their target protein and therefore reversibly
inhibit the activity of their target protein. Although reversible
inhibitors have been developed that are efficacious therapeutic
agents, reversible inhibitors have certain disadvantages. For
example, many reversible inhibitors of kinases interact with the
ATP-binding site. Because the structure of the ATP-binding site is
highly conserved among kinases, it has been very challenging to
develop reversible inhibitors that selectively inhibit one or more
desired kinases. In addition, because reversible inhibitors
dissociate from their target protein, the duration of inhibition
may be shorter than desired. Thus, when reversible inhibitors are
used as therapeutic agents higher quantities and/or more frequent
dosing than is desired may be required in order to achieve the
intended biological effect. This dosing requirement may produce
toxicity or result in other undesirable effects.
[0005] Irreversible inhibitors that covalently bind to their target
protein have been described in the art. Covalent irreversible
inhibitors of drug targets have a number of important advantages
over their reversible counterparts as therapeutics. Prolonged
suppression of the drug targets may be necessary for maximum
pharmacodynamic effect and an irreversible inhibitor can provide
this advantage by permanently eliminating existing drug target
activity, which will return only when new target protein is
synthesized. When an irreversible inhibitor is administered, the
therapeutic plasma concentration of the irreversible inhibitor
would need to be attained only long enough to briefly expose the
target protein to the inhibitor, which would irreversibly suppress
activity of the target and plasma levels could then rapidly decline
while the target protein would remain inactivated. This
irreversible binding has the potential advantage of lowering the
minimal blood plasma concentration at which therapeutic activity
occurs, minimizing multiple dosing requirements and eliminating the
requirement for long plasma half-lives without compromising
efficacy. All of these considerations could reduce toxicity due to
any nonspecific off-target interactions that may occur at high or
prolonged blood plasma levels. Irreversible inhibitors also likely
have advantages in overcoming drug resistance requirements in two
ways. First, irreversible inhibitors eliminate the requirement for
long blood plasma half-lives without compromising efficacy. Second,
because resistance mutations may compromise non-covalent binding,
but even in the face of reduced non-covalent affinity, the
inactivation mechanism will often, nonetheless, lead to protein
target modification and irreversible inhibition. All of these
considerations could reduce toxicity due to any nonspecific
off-target interactions that may occur at high or prolonged blood
plasma levels. Another advantage of irreversible inhibitors is that
the inactivation mechanism that drives potency will often lead to a
selectivity profile that is "orthogonal" to those readily achieved
using only non-covalent binding interactions--a profile that is
both pharmacologically advantageous and difficult to achieve using
non-covalent inhibition.
[0006] Many reversible inhibitors of proteins are presently known,
as are many of their binding sites in the proteins to which the
reversible inhibitors bind. The binding sites of these reversible
inhibitors are sometimes populated with amino acids that are
capable of covalent modification with suitably reactive ligands. In
other instances, amino acids are located near the binding sites of
reversible inhibitors that are capable of covalent modification
with suitably reactive ligands. Amino acids capable of covalent
modification are typically those which have a heteroatom such as O,
S, or N in the side chain, such as threonine, cysteine, histidine,
serine, tyrosine, and lysine. Sulfur is amenable to covalent
modification due to the nucleophilicty of sulfur, and as such there
are examples of ligands that modify cysteine in proteins of
interest. However, amino acids such as lysine are usually
sufficiently unreactive that ligands do not react in vivo with
lysine. In fact, highly reactive indiscriminate reagents are
usually employed for lysine modification. And, as such,
ligand-directed modification of lysine has heretofore remained
unrealized. For this reason and others, there is a need for
irreversible inhibitors of proteins of medicinal interest, which
inhibitors exert their biological influence through a
ligand-directed modification of lysine.
I. SUMMARY OF INVENTION
[0007] In one aspect, the invention provides a method for designing
a ligand that covalently binds a target protein. The method
comprises (a) providing a structural model of a reversible ligand
docked within, or in proximity to, a ligand-binding site in a
target protein, (b) identifying a lysine residue of the target
protein in, or in proximity to, the ligand-binding site that is
less than about 15 .ANG. from the reversible ligand when the
reversible ligand is docked in, or in proximity to, the
ligand-binding site, (c) producing at least a structural model of
at least one ligand-warhead compound docked within, or in proximity
to, the ligand-binding site wherein the ligand-warhead compound
comprises the reversible ligand in step (b) or a portion thereof, a
warhead comprising a reactive chemical moiety, and optionally a
Tether, and (d) identifying a ligand-warhead compound whose
structural model allows the lysine residue in step (b) to readily
assume a conformation that brings the side chain primary amine
group of the lysine residue within bond-forming proximity of the
warhead electrophile.
[0008] In another aspect, the invention provides a method for
designing a ligand that covalently binds a lysine residue of a
target protein. The method comprises (a) providing a structural
model of a reversible ligand docked in, or in proximity to, a
ligand-binding site in a target protein, wherein the reversible
ligand makes at least one non-covalent contact with the
ligand-binding site; (b) identifying a lysine residue in, or in
proximity to, the ligand-binding site of the target protein that is
adjacent to the reversible ligand when the reversible ligand is
docked in, or in proximity to, the ligand-binding site; (c)
producing structural models of a plurality of ligand-warhead
compounds docked in, or in proximity to, the ligand-binding site
wherein each ligand-warhead compound comprises a warhead covalently
attached to a substitutable position of the reversible ligand in
step (b) the warhead comprising a reactive chemical moiety and
optionally a linker; (d) identifying among the structural models in
step (c) at least one ligand-warhead compound whose structural
model allows the side chain primary amine group of the lysine
residue in step (b) to be within bonding distance of the warhead
electrophile; and (e) further identifying among the structural
models identified in step (d) a hydrogen-bond donor-containing
amino acid residue in, or in the proximity to, the ligand-binding
site, wherein the hydrogen-bond donor amino acid residue is within
hydrogen-bonding distance of the warhead.
[0009] In another aspect, the invention provides a method for
identifying at least one lysine residue within at least one protein
that can be modified covalently. The method comprises (a)
identifying at least one protein having a ligand-binding site, (b)
providing a three-dimensional structural model for the identified
protein, (c) docking a reversible ligand in, or in proximity to,
the identified protein's ligand-binding site in the structural
model, wherein the reversible ligand makes at least one
non-covalent contact with the ligand-binding site, thereby creating
a structural model of a reversible ligand bound to, or in proximity
to, an identified protein's ligand-binding site; and (d)
identifying in the structural model of a reversible ligand bound
to, or in proximity to, an identified protein's ligand-binding site
one or more lysine residues in, or in proximity to, the
ligand-binding site of the identified protein which is less than
about 15 .ANG. from the reversible ligand.
[0010] In yet another aspect, the invention provides a method of
covalently modifying a lysine residue in, or in proximity to, a
ligand-binding site of a protein, comprising contacting a compound
of Formula I:
##STR00001##
wherein Scaffold, Tether, Warhead, x and y are as defined
herein;
[0011] with the protein containing a lysine residue in, or in
proximity to, the ligand-binding site of the protein and forming a
covalent bond between the side chain primary amine group of the
lysine residue and the Warhead of the compound.
[0012] In another aspect, the invention provides compounds of
Formula I:
##STR00002##
wherein Scaffold, Warhead, Tether, x and y are as defined
herein.
[0013] In a further aspect, the invention provides
protein-modifier-ligand conjugates of Formula XIII:
##STR00003##
wherein Scaffold, Polypeptide, Tether, M, Y.sub.1, x and y are as
defined herein.
[0014] In yet another aspect of the disclosure, a method for
selecting a warhead that binds to a target lysine within a ligand
binding site of a protein is disclosed. The method comprises (a)
identifying at least one protein having a ligand-binding site, (b)
providing a three-dimensional structural model for the identified
protein, (c) identifying the locations of at least one lysine in,
or in proximity to, the ligand-binding site of step (a); (d)
providing at least one warhead in proximity to the at least one
identified lysine; (e) aligning the electrophilic atom of the
warhead within bonding distance of the primary amine of the at
least one identified lysine; (f) forming a covalent bond between
the electrophilic atom of the warhead and the primary amine of the
at least one lysine; (g) docking a reversible ligand in the
identified protein's ligand-binding site within 15 .ANG. of the
covalently attached warhead of step (f), wherein the reversible
ligand maintains most of its known noncovalent interactions with
the ligand binding site; (h) aligning the closest atom of the
ligand with the covalently bound warhead of step (f) and
determining the geometric requirements for a Tether between the
ligand and the covalently bound warhead of step (f).
II. BRIEF DESCRIPTION OF THE FIGURES
[0015] FIG. 1 shows the X-ray co-crystal structure (2JK7) with key
lysines in XIAP proximal to bound Smac-mimetic ligand.
[0016] FIG. 2 depicts non-limiting examples of weaponizing the
Smac-mimetic ligand.
[0017] FIG. 3 depicts the mass spectrometric analysis of Compound
XVI-26 contacted with HCV NS3 Protease.
[0018] FIG. 4 depicts the mass spectrometric analysis of Compound
XVI-26 treated with HCV NS3 Protease (WT); HCV NS3 Protease
(C159S); and HCV NS3 protease (C159S/K136A).
[0019] FIG. 5 depicts the mass spectrometric analysis of compound
XVI-1 treated with HCV NS3 Protease (WT1b).
[0020] FIG. 6 depicts the mass spectrometric analysis of compound
VII-1 contacted with XIAP.
[0021] FIG. 7 depicts the mass spectrometric analysis of
chymotrypsin digestion of XIAP (top) and XIAP contacted with
compound VII-1 (bottom).
[0022] FIG. 8 depicts the mass spectrometric analysis of compound
VII-21 contacted with XIAP.
[0023] FIG. 9 depicts the mass spectrometric analysis of
chymotrypsin digestion of XIAP (top) and XIAP contacted with
compound VII-21 (bottom).
[0024] FIG. 10 depicts that the probe compound XVI-27 modifies
NS3/4A C159S.
[0025] FIG. 11 depicts the prolonged duration of action of
XVI-26.
[0026] FIG. 12 depicts the mass spectrometric analysis of Compound
XI-27 contacted with PDPK-1 (whole protein).
[0027] FIG. 13 depicts the mass spectrometric analysis of the
trypsin digestion of PDPK-1 (whole protein) contacted with Compound
XI-27 identifying the peptide .sup.164NGELLKYIR.sup.172 (SEQ ID
NO.:1).
[0028] FIG. 14 depicts the MSMS analysis of the peptide
.sup.164NGELLKYIR.sup.172 (SEQ ID NO.:1) modified by XI-27 from the
digest depicted in FIG. 13 and identifying K169 as the lysine
modified by XI-27.
[0029] FIG. 15 depicts the mass spectrometric analysis of Compound
XI-21 contacted with PDPK-1 (whole protein).
[0030] FIG. 16 depicts the mass spectrometric analysis of the
trypsin digestion of PDPK-1 (whole protein) contacted with Compound
XI-21 identifying three peptides .sup.164NGELLKYIR.sup.172 (SEQ ID
NO.:1), .sup.173KIGSFDETCTR.sup.183 (SEQ ID NO.:2), and
.sup.84FGKILGEGSFSTVVLAR.sup.100 (SEQ ID NO.:3).
[0031] FIG. 17 depicts the MSMS analysis of the peptide
.sup.164NGELLKYIR.sup.172 (SEQ ID NO.:1) from the digest depicted
in FIG. 16 and identifying K169 as the lysine modified by
XI-21.
[0032] FIG. 18 depicts the MSMS analysis of the peptide
.sup.173KIGSFDETCTR.sup.183 (SEQ ID NO.:2) from the digest depicted
in FIG. 16 and identifying K173 as the lysine modified by
XI-21.
[0033] FIG. 19 depicts the MSMS analysis of the peptide
.sup.84FGKILGEGSFSTVVLAR.sup.100 (SEQ ID NO.:3) from the digest
depicted in FIG. 16 and identifying K86 as the lysine modified by
XI-21.
[0034] FIG. 20 depicts the mass spectrometric analysis of Compound
XXXVI-2 contacted with PDPK-1 (whole protein).
[0035] FIG. 21 depicts the mass spectrometric analysis of Compound
XXXVI-1 contacted with PDPK-1 (whole protein).
[0036] FIG. 22 depicts the mass spectrometric analysis of Compound
XXII-33 contacted with PI3K.gamma. (whole protein).
III. DETAILED DESCRIPTION OF INVENTION
A. Definitions
[0037] Compounds of this invention include those described
generally above, and are further illustrated by the classes,
subclasses, and species disclosed herein. As used herein, the
following definitions shall apply unless otherwise indicated. For
purposes of this invention, the chemical elements are identified in
accordance with the Periodic Table of the Elements, CAS version,
Handbook of Chemistry and Physics, 75.sup.th Ed. Additionally,
general principles of organic chemistry are described in "Organic
Chemistry," Thomas Sorrell, University Science Books, Sausalito:
1999, and "March's Advanced Organic Chemistry," 5.sup.th Ed., Ed.:
Smith, M. B. and March, J., John Wiley & Sons, New York: 2001,
the entire contents of which are hereby incorporated by reference.
The biochemical definitions can be found in Structure and Mechanism
in Protein Science: A Guide to Enzyme Catalysis and Protein
Folding, Alan Fersht, W. H. Freeman, 1998, 1st Edition; Enzymatic
Reaction Mechanisms, Perry A. Frey and Adrian D. Hegeman, Perry A.
Frey (Author), Oxford University Press, 2007, 1st Edition; and
Biochemistry, 6th Edition, Jeremy M. Berg, W. H. Freeman, 2007; the
entire contents of which are hereby incorporated by reference.
[0038] As used herein the term "protein" means linear polymers made
up of the 20 different naturally occurring L-.alpha.-amino acids,
as well as other less common amino acids. The amino acids in a
polymer are joined together by peptide bonds between the carboxyl
and amino groups of adjacent amino acid residues. The term
polypeptide can be used interchangeably herein with the term
protein. Polypeptides can be full length proteins, as well as any
portion of a protein. As used herein the terms protein and
polypeptide are used to describe proteins containing ligand binding
sites. Any protein or polypeptide contemplated herein will be large
enough to fold and constitute a ligand binding site.
[0039] The term "aliphatic" or "aliphatic group," as used herein,
means a straight-chain (i.e., unbranched) or branched, substituted
or unsubstituted hydrocarbon chain that is completely saturated or
that contains one or more units of unsaturation, or a monocyclic
hydrocarbon or bicyclic hydrocarbon that is completely saturated or
that contains one or more units of unsaturation, but which is not
aromatic (also referred to herein as "carbocycle," "carbocyclic,"
"cycloaliphatic" or "cycloalkyl"), that has a single point of
attachment to the rest of the molecule. Unless otherwise specified,
aliphatic groups contain 1-8 aliphatic carbon atoms. In some
embodiments, aliphatic groups contain 1-5 aliphatic carbon atoms.
In other embodiments, aliphatic groups contain 1-4 aliphatic carbon
atoms. In still other embodiments, aliphatic groups contain 1-3
aliphatic carbon atoms, and in yet other embodiments, aliphatic
groups contain 1-2 aliphatic carbon atoms. In some embodiments,
"carbocyclic" (or "cycloaliphatic" or "carbocycle" or "cycloalkyl")
refers to a monocyclic C.sub.3-C.sub.8 hydrocarbon that is
completely saturated or that contains one or more units of
unsaturation, but which is not aromatic, that has a single point of
attachment to the rest of the molecule. Suitable aliphatic groups
include, but are not limited to, linear or branched, substituted or
unsubstituted alkyl, alkenyl, alkynyl groups and hybrids thereof
such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl or
(cycloalkyl)alkenyl.
[0040] As used herein, the term "bridged bicyclic" refers to any
bicyclic ring system, i.e., carbocyclic or heterocyclic, saturated
or partially unsaturated, having at least one bridge. As defined by
IUPAC, a "bridge" is an optionally substituted chain of atoms or an
atom or a valence bond connecting two bridgeheads, where a
"bridgehead" is any skeletal atom of the ring system which is
bonded to three or more skeletal atoms (excluding hydrogen). In
some embodiments, a bridged bicyclic group has 7- to 12-ring
members and 0-4 heteroatoms independently selected from nitrogen,
oxygen, or sulfur. Such bridged bicyclic groups are well known in
the art and include those groups set forth below where each group
is attached to the rest of the molecule at any substitutable carbon
or nitrogen atom. Unless otherwise specified, a bridged bicyclic
group or the bridge is optionally substituted with one or more
substituents as set forth for aliphatic groups. Additionally or
alternatively, any substitutable nitrogen of a bridged bicyclic
group is optionally substituted. Exemplary bridged bicyclics
include:
##STR00004##
[0041] The term "lower alkyl" refers to a C.sub.1-4 straight or
branched alkyl group. Exemplary lower alkyl groups are methyl,
ethyl, propyl, isopropyl, butyl, isobutyl, and tert-butyl.
[0042] The term "lower haloalkyl" refers to a C.sub.1-4 straight or
branched alkyl group that is substituted with one or more halogen
atoms.
[0043] The term "heteroatom" means one or more of oxygen, sulfur,
nitrogen, phosphorus, or silicon (including, any oxidized form of
nitrogen, sulfur, phosphorus, or silicon; the quaternized form of
any basic nitrogen or; a substitutable nitrogen of a heterocyclic
ring, for example N (as in 3,4-dihydro-2H-pyrrolyl), NH (as in
pyrrolidinyl) or NR.sup.+ (as in N-substituted pyrrolidinyl)).
[0044] The term "unsaturated," as used herein, means that a moiety
has one or more units of unsaturation.
[0045] As used herein, the term "bivalent C.sub.1-8 (or C.sub.1-6)
saturated or unsaturated, straight or branched, hydrocarbon chain,"
refers to bivalent alkylene, alkenylene, and alkynylene chains that
are straight or branched as defined herein.
[0046] The term "alkylene" refers to a bivalent alkyl group. An
"alkylene chain" is a polymethylene group, i.e.,
--(CH.sub.2).sub.n--, wherein n is a positive integer, preferably
from 1 to 6, from 1 to 4, from 1 to 3, from 1 to 2, or from 2 to 3.
A substituted alkylene chain is a polymethylene group in which one
or more methylene hydrogen atoms are replaced with a substituent.
Suitable substituents include those described below for a
substituted aliphatic group.
[0047] The term "alkenylene" refers to a bivalent alkenyl group. A
substituted alkenylene chain is a polymethylene group containing at
least one double bond in which one or more hydrogen atoms are
replaced with a substituent. Suitable substituents include those
described below for a substituted aliphatic group.
[0048] As used herein, the term "cyclopropylenyl" refers to a
bivalent cyclopropyl group of the following structure:
##STR00005##
[0049] The term "halogen" means F, Cl, Br, or I.
[0050] The term "aryl" used alone or as part of a larger moiety as
in "aralkyl," "aralkoxy," or "aryloxyalkyl," refers to monocyclic
or bicyclic ring systems having a total of five to fourteen ring
members, wherein at least one ring in the system is aromatic and
wherein each ring in the system contains 3 to 7 ring members. The
term "aryl" may be used interchangeably with the term "aryl ring."
In certain embodiments of the present invention, "aryl" refers to
an aromatic ring system which includes, but not limited to, phenyl,
biphenyl, naphthyl, anthracyl and the like, which may bear one or
more substituents. Also included within the scope of the term
"aryl," as it is used herein, is a group in which an aromatic ring
is fused to one or more non-aromatic rings, such as indanyl,
phthalimidyl, naphthimidyl, phenanthridinyl, or tetrahydronaphthyl,
and the like.
[0051] The terms "heteroaryl" and "heteroar-," used alone or as
part of a larger moiety, e.g., "heteroaralkyl," or
"heteroaralkoxy," refer to groups having 5 to 10 ring atoms,
preferably 5, 6, or 9 ring atoms; having 6, 10, or 14 .pi.
electrons shared in a cyclic array; and having, in addition to
carbon atoms, from one to five heteroatoms. The term "heteroatom"
as used within this definition refers to nitrogen, oxygen, or
sulfur, and includes any oxidized form of nitrogen or sulfur, and
any quaternized form of a basic nitrogen. Heteroaryl groups
include, without limitation, thienyl, furanyl, pyrrolyl,
imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl,
oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridyl,
pyridazinyl, pyrimidinyl, pyrazinyl, indolizinyl, purinyl,
naphthyridinyl, and pteridinyl. The terms "heteroaryl" and
"heteroar-," as used herein, also include groups in which a
heteroaromatic ring is fused to one or more aryl, cycloaliphatic,
or heterocyclyl rings, where the radical or point of attachment is
on the heteroaromatic ring. Nonlimiting examples include indolyl,
isoindolyl, benzothienyl, benzofuranyl, dibenzofuranyl, indazolyl,
benzimidazolyl, benzthiazolyl, quinolyl, isoquinolyl, cinnolinyl,
phthalazinyl, quinazolinyl, quinoxalinyl, 4H-quinolizinyl,
carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl,
tetrahydroquinolinyl, tetrahydroisoquinolinyl, and
pyrido[2,3-b]-1,4-oxazin-3(4H)-one. A heteroaryl group may be mono-
or bicyclic. The term "heteroaryl" may be used interchangeably with
the terms "heteroaryl ring," "heteroaryl group," or
"heteroaromatic," any of which terms include rings that are
optionally substituted. The term "heteroaralkyl" refers to an alkyl
group substituted by a heteroaryl, wherein the alkyl and heteroaryl
portions independently are optionally substituted.
[0052] As used herein, the terms "heterocycle," "heterocyclyl,"
"heterocyclic radical," and "heterocyclic ring" are used
interchangeably and refer to a stable 5- to 7-membered monocyclic
or 7- to 10-membered bicyclic heterocyclic moiety that is either
saturated or partially unsaturated, and having, in addition to
carbon atoms, one or more, preferably one to four, heteroatoms, as
defined above. When used in reference to a ring atom of a
heterocycle, the term "nitrogen" includes a substituted nitrogen.
As an example, in a saturated or partially unsaturated ring having
0-3 heteroatoms selected from oxygen, sulfur or nitrogen, the
nitrogen may be N (as in 3,4-dihydro-2H-pyrrolyl), NH (as in
pyrrolidinyl), or .sup.+NR (as in N-substituted pyrrolidinyl).
[0053] A heterocyclic ring can be attached to its pendant group at
any heteroatom or carbon atom that results in a stable structure
and any of the ring atoms can be optionally substituted. Examples
of such saturated or partially unsaturated heterocyclic radicals
include, without limitation, tetrahydrofuranyl,
tetrahydrothiophenyl pyrrolidinyl, piperidinyl, pyrrolinyl,
tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl,
oxazolidinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl,
oxazepinyl, thiazepinyl, morpholinyl, and quinuclidinyl. The terms
"heterocycle," "heterocyclyl," "heterocyclyl ring," "heterocyclic
group," "heterocyclic moiety," and "heterocyclic radical," are used
interchangeably herein, and also include groups in which a
heterocyclyl ring is fused to one or more aryl, heteroaryl, or
cycloaliphatic rings, such as indolinyl, 3H-indolyl, chromanyl,
phenanthridinyl, or tetrahydroquinolinyl, where the radical or
point of attachment is on the heterocyclyl ring. A heterocyclyl
group may be mono- or bicyclic. The term "heterocyclylalkyl" refers
to an alkyl group substituted by a heterocyclyl, wherein the alkyl
and heterocyclyl portions independently are optionally
substituted.
[0054] As used herein, the term "partially unsaturated" refers to a
ring moiety that includes at least one double or triple bond. The
term "partially unsaturated" is intended to encompass rings having
multiple sites of unsaturation, but is not intended to include aryl
or heteroaryl moieties, as herein defined.
[0055] As described herein, compounds of the invention may contain
"optionally substituted" moieties. In general, the term
"substituted," whether preceded by the term "optionally" or not,
means that one or more hydrogens of the designated moiety are
replaced with a suitable substituent. Unless otherwise indicated,
an "optionally substituted" group may have a suitable substituent
at each substitutable position of the group, and when more than one
position in any given structure may be substituted with more than
one substituent selected from a specified group, the substituent
may be either the same or different at every position. Combinations
of substituents envisioned by this invention are preferably those
that result in the formation of stable or chemically feasible
compounds. The term "stable," as used herein, refers to compounds
that are not substantially altered when subjected to conditions to
allow for their production, detection, and, in certain embodiments,
their recovery, purification, and use for one or more of the
purposes disclosed herein.
[0056] Suitable monovalent substituents on a substitutable carbon
atom of an "optionally substituted" group are independently
halogen; --(CH.sub.2).sub.0-4R.sup.o; --(CH.sub.2).sub.0-4OR.sup.o;
--O(CH.sub.2).sub.0-4R.sup.o, --O--(CH.sub.2).sub.0-4C(O)OR.sup.o;
--(CH.sub.2).sub.0-4CH(OR.sup.o).sub.2;
--(CH.sub.2).sub.0-4SR.sup.o; --(CH.sub.2).sub.0-4Ph, which may be
substituted with R.sup.o; --(CH.sub.2).sub.0-4O(CH.sub.2).sub.0-1Ph
which may be substituted with R.sup.o; --CH.dbd.CHPh, which may be
substituted with R.sup.o;
--(CH.sub.2).sub.0-4O(CH.sub.2).sub.0-1-pyridyl which may be
substituted with R.sup.o; --NO.sub.2; --CN; --N.sub.3;
--(CH.sub.2).sub.0-4N(R.sup.o).sub.2;
--(CH.sub.2).sub.0-4N(R.sup.o)C(O)R.sup.o; --N(R.sup.o)C(S)R.sup.o;
--(CH.sub.2).sub.0-4N(R.sup.o)C(O)NR.sup.o.sub.2;
--N(R.sup.o)C(S)NR.sup.o.sub.2;
--(CH.sub.2).sub.0-4N(R.sup.o)C(O)OR.sup.o;
--N(R.sup.o)N(R.sup.o)C(O)R.sup.o;
--N(R.sup.o)N(R.sup.o)C(O)NR.sup.o.sub.2;
--N(R.sup.o)N(R.sup.o)C(O)OR.sup.o;
--(CH.sub.2).sub.0-4C(O)R.sup.o; --C(S)R.sup.o;
--(CH.sub.2).sub.0-4C(O)OR.sup.o; --(CH.sub.2).sub.0-4C(O)SR.sup.o;
--(CH.sub.2).sub.0-4C(O)OSiR.sup.o.sub.3;
--(CH.sub.2).sub.0-4OC(O)R.sup.o; --OC(O)(CH.sub.2).sub.0-4SR--,
SC(S)SR.sup.o; --(CH.sub.2).sub.0-4SC(O)R.sup.o;
--(CH.sub.2).sub.0-4C(O)NR.sup.o.sub.2; --C(S)NR.sup.o.sub.2;
--C(S)SR.sup.o; --SC(S)SR.sup.o,
--(CH.sub.2).sub.0-4OC(O)NR.sup.o.sub.2; --C(O)N(OR.sup.o)R.sup.o;
--C(O)C(O)R.sup.o; --C(O)CH.sub.2C(O)R.sup.o;
--C(NOR.sup.o)R.sup.o; --(CH.sub.2).sub.0-4SSR.sup.o;
--(CH.sub.2).sub.0-4S(O).sub.2R.sup.o;
--(CH.sub.2).sub.0-4S(O).sub.2OR.sup.o;
--(CH.sub.2).sub.0-4OS(O).sub.2R.sup.o; --S(O).sub.2NR.sup.o.sub.2;
--(CH.sub.2).sub.0-4S(O)R.sup.o;
--N(R.sup.o)S(O).sub.2NR.sup.o.sub.2;
--N(R.sup.o)S(O).sub.2R.sup.o; --N(OR.sup.o)R.sup.o;
--C(NH)NR.sup.o.sub.2; --P(O).sub.2R.sup.o; --P(O)R.sup.o.sub.2;
--OP(O)R.sup.o.sub.2; --OP(O)(OR.sup.o).sub.2; SiR.sup.o.sub.3;
--(C.sub.1-4 straight or branched)alkylene)O--N(R.sup.o).sub.2; or
--(C.sub.1-4 straight or branched
alkylene)C(O)O)--N(R.sup.o).sub.2, wherein each R.sup.o may be
substituted as defined below and is independently hydrogen,
C.sub.1-6 aliphatic, --CH.sub.2Ph, --O(CH.sub.2).sub.0-1Ph,
--CH.sub.2-(5- to 6-membered heteroaryl ring), or a 5- to
6-membered saturated, partially unsaturated, or aryl ring having
0-4 heteroatoms independently selected from nitrogen, oxygen, or
sulfur, or, notwithstanding the definition above, two independent
occurrences of R.sup.o, taken together with their intervening
atom(s), form a 3- to 12-membered saturated, partially unsaturated,
or aryl mono- or bicyclic ring having 0-4 heteroatoms independently
selected from nitrogen, oxygen, or sulfur, which may be substituted
as defined below.
[0057] Suitable monovalent substituents on R.sup.o (or the ring
formed by taking two independent occurrences of R.sup.o together
with their intervening atoms), are independently halogen,
--(CH.sub.2).sub.0-2R.sup..cndot., -(haloR.sup..cndot.),
--(CH.sub.2).sub.0-2OR.sup..cndot.,
--(CH.sub.2).sub.0-2OR.sup..cndot.,
--(CH.sub.2).sub.0-2CH(OR.sup..cndot.).sub.2;
--O(haloR.sup..cndot.), --CN, --N.sub.3,
--(CH.sub.2).sub.0-2C(O)R.sup..cndot., --(CH.sub.2).sub.0-2C(O)OH,
--(CH.sub.2).sub.0-2C(O)OR.sup..cndot.,
--(CH.sub.2).sub.0-2SR.sup..cndot., --(CH.sub.2).sub.0-2SH,
--(CH.sub.2).sub.0-2NH.sub.2, --(CH.sub.2).sub.0-2NHR.sup..cndot.,
--(CH.sub.2).sub.0-2NR.sup..cndot..sub.2, --NO.sub.2,
--SiR.sup..cndot..sub.3, --OSiR.sup..cndot..sub.3,
--C(O)SR.sup..cndot., --(C.sub.1-4 straight or branched
alkylene)C(O)OR.sup..cndot., or --SSR.sup..cndot. wherein each
R.sup..cndot. is unsubstituted or where preceded by "halo" is
substituted only with one or more halogens, and is independently
selected from C.sub.1-4 aliphatic, --CH.sub.2Ph,
--O(CH.sub.2).sub.0-1Ph, or a 5- to 6-membered saturated, partially
unsaturated, or aryl ring having 0-4 heteroatoms independently
selected from nitrogen, oxygen, or sulfur. Suitable divalent
substituents on a saturated carbon atom of R.sup.o include .dbd.O
and .dbd.S.
[0058] Suitable divalent substituents on a saturated carbon atom of
an "optionally substituted" group include the following: .dbd.O
("oxo"), .dbd.S, .dbd.NNR*.sub.2, .dbd.NNHC(O)R*, .dbd.NNHC(O)OR*,
.dbd.NNHS(O).sub.2R*, .dbd.NR*, .dbd.NOR*,
--O(C(R*.sub.2)).sub.2-3O--, or --S(C(R*.sub.2)).sub.2-3S--,
wherein each independent occurrence of R* is selected from
hydrogen, C.sub.1-6 aliphatic which may be substituted as defined
below, or an unsubstituted 5- to 6-membered saturated, partially
unsaturated, or aryl ring having 0-4 heteroatoms independently
selected from nitrogen, oxygen, or sulfur. Suitable divalent
substituents that are bound to vicinal substitutable carbons of an
"optionally substituted" group include: --O(CR*.sub.2).sub.2-3O--,
wherein each independent occurrence of R* is selected from
hydrogen, C.sub.1-6 aliphatic which may be substituted as defined
below, or an unsubstituted 5-6-membered saturated, partially
unsaturated, or aryl ring having 0-4 heteroatoms independently
selected from nitrogen, oxygen, or sulfur.
[0059] Suitable substituents on the aliphatic group of
R.sup..cndot. include halogen, --R.sup..cndot.,
-(haloR.sup..cndot.), --OH, --OR.sup..cndot.,
--O(haloR.sup..cndot.), --CN, --C(O)OH, --C(O)OR.sup..cndot.,
--NH.sub.2, --NHR.sup..cndot., --NR.sup..cndot..sub.2, or
--NO.sub.2, wherein each R.sup..cndot. is unsubstituted or where
preceded by "halo" is substituted only with one or more halogens,
and is independently C.sub.1-4 aliphatic, --CH.sub.2Ph,
--O(CH.sub.2).sub.0-1Ph, or a 5- to 6-membered saturated, partially
unsaturated, or aryl ring having 0-4 heteroatoms independently
selected from nitrogen, oxygen, or sulfur.
[0060] Suitable substituents on a substitutable nitrogen of an
"optionally substituted" group include --R.sup..dagger.,
--C(O)R.sup..dagger..sub.2, --C(O)R.sup..dagger.,
--C(O)C(O)R.sup..dagger., --C(O)CH.sub.2C(O)R.sup..dagger.,
--S(O).sub.2R.sup..dagger., --S(O).sub.2NR.sup..dagger..sub.2,
--C(S)NR.sup..dagger..sub.2, --C(NH)NR.sup..dagger..sub.2, or
--N(R.sup..dagger.)S(O).sub.2R.sup..dagger.; wherein each
R.sup..dagger. is independently hydrogen, C.sub.1-6 aliphatic which
may be substituted as defined below, unsubstituted --OPh, or an
unsubstituted 5- to 6-membered saturated, partially unsaturated, or
aryl ring having 0-4 heteroatoms independently selected from
nitrogen, oxygen, or sulfur, or, notwithstanding the definition
above, two independent occurrences of R.sup..dagger., taken
together with their intervening atom(s) form an unsubstituted 3- to
12-membered saturated, partially unsaturated, or aryl mono- or
bicyclic ring having 0-4 heteroatoms independently selected from
nitrogen, oxygen, or sulfur.
[0061] Suitable substituents on the aliphatic group of
R.sup..cndot. are independently halogen, --R.sup..cndot.,
-(haloR.sup..cndot.), --OH, --OR.sup..cndot.,
--O(haloR.sup..cndot.), --CN, --C(O)OH, --C(O)OR.sup..cndot.,
--NH.sub.2, --NHR.sup..cndot., --NR.sup..cndot..sub.2, or
--NO.sub.2, wherein each R.sup..cndot. is unsubstituted or where
preceded by "halo" is substituted only with one or more halogens,
and is independently C.sub.1-4 aliphatic, --CH.sub.2Ph,
--O(CH.sub.2).sub.0-1Ph, or a 5- to 6-membered saturated, partially
unsaturated, or aryl ring having 0-4 heteroatoms independently
selected from nitrogen, oxygen, or sulfur.
[0062] As used herein, the term "pharmaceutically acceptable salt"
refers to those salts which are, within the scope of sound medical
judgment, suitable for use in contact with the tissues of humans
and lower animals without undue toxicity, irritation, allergic
response and the like, and are commensurate with a reasonable
benefit/risk ratio. Pharmaceutically acceptable salts are well
known in the art. For example, S. M. Berge et al., describe
pharmaceutically acceptable salts in detail in J. Pharmaceutical
Sciences, 66, 1-19 (1977), incorporated herein by reference.
Pharmaceutically acceptable salts of the compounds of this
invention include those derived from suitable inorganic and organic
acids and bases. Examples of pharmaceutically acceptable, nontoxic
acid addition salts are salts of an amino group formed with
inorganic acids such as hydrochloric acid, hydrobromic acid,
phosphoric acid, sulfuric acid and perchloric acid or with organic
acids such as acetic acid, oxalic acid, maleic acid, tartaric acid,
citric acid, succinic acid or malonic acid or by using other
methods used in the art such as ion exchange. Other
pharmaceutically acceptable salts include adipate, alginate,
ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate,
borate, butyrate, camphorate, camphorsulfonate, citrate,
cyclopentanepropionate, digluconate, dodecylsulfate,
ethanesulfonate, formate, fumarate, glucoheptonate,
glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate,
hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate,
laurate, lauryl sulfate, malate, maleate, malonate,
methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate,
oleate, oxalate, palmitate, pamoate, pectinate, persulfate,
3-phenylpropionate, phosphate, pivalate, propionate, stearate,
succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate,
undecanoate, valerate salts, and the like.
[0063] Salts derived from appropriate bases include alkali metal,
alkaline earth metal, ammonium and N.sup.+(C.sub.1-4alkyl).sub.4
salts. Representative alkali or alkaline earth metal salts include
sodium, lithium, potassium, calcium, magnesium, and the like.
Further pharmaceutically acceptable salts include, when
appropriate, nontoxic ammonium, quaternary ammonium, and amine
cations formed using counterions such as halide, hydroxide,
carboxylate, sulfate, phosphate, nitrate, loweralkyl sulfonate and
aryl sulfonate.
[0064] Unless otherwise stated, structures depicted herein are also
meant to include all isomeric (e.g., enantiomeric, diastereomeric,
and geometric (or conformational)) forms of the structure; for
example, the R and S configurations for each asymmetric center, Z
and E double bond isomers, and Z and E conformational isomers.
Therefore, single stereochemical isomers as well as enantiomeric,
diastereomeric, and geometric (or conformational) mixtures of the
present compounds are within the scope of the invention. Unless
otherwise stated, all tautomeric forms of the compounds of the
invention are within the scope of the invention. Additionally,
unless otherwise stated, structures depicted herein are also meant
to include compounds that differ only in the presence of one or
more isotopically enriched atoms. For example, compounds having the
present structures including the replacement of hydrogen by
deuterium or tritium, or the replacement of a carbon by a .sup.13C-
or .sup.14C-enriched carbon are within the scope of this invention.
Such compounds are useful, for example, as analytical tools, as
probes in biological assays, or as therapeutic agents in accordance
with the present invention.
[0065] As used herein, the term "irreversible" or "irreversible
inhibitor" refers to an inhibitor (i.e., a compound) that is able
to covalently binds to an enzyme, or portion thereof in a
substantially non-reversible manner. That is, whereas a reversible
inhibitor is able to bind to (but is generally unable to form a
covalent bond with) an enzyme, and therefore can become dissociated
from the enzyme an irreversible inhibitor will remain substantially
bound to an enzyme once covalent bond formation has occurred.
Irreversible inhibitors usually display time dependency, whereby
the degree of inhibition increases with the length of time with
which the inhibitor is in contact with the enzyme. In certain
embodiments, an irreversible inhibitor will remain substantially
bound to an enzyme once covalent bond formation has occurred and
will remain bound for a time period that is longer than the life of
the enzyme.
[0066] Methods for identifying if a compound is acting as an
irreversible inhibitor are known to one of ordinary skill in the
art. Such methods include, but are not limited to, enzyme kinetic
analysis of the inhibition profile of the compound with the enzyme,
the use of mass spectrometry of the protein drug target modified in
the presence of the inhibitor compound, discontinuous exposure,
also known as "washout," experiments, and the use of labeling, such
as radiolabelled inhibitor, to show covalent modification of the
enzyme, as well as other methods known to one of skill in the
art.
[0067] One of ordinary skill in the art will recognize that certain
reactive functional groups can act as "warheads." As used herein,
the term "warhead" or "warhead group" refers to a functional group
present on a compound of the present invention wherein that
functional group is capable of covalently binding to lysine,
present in or near the binding pocket of a target protein, thereby
irreversibly inhibiting the protein. It will be appreciated that in
some embodiments the Tether-Warhead group, as defined and described
herein, provides such warhead groups for covalently, and
irreversibly, inhibiting the protein.
[0068] As used herein, the term "inhibitor" is defined as a
compound that binds to and/or inhibits an enzyme with measurable
affinity. In certain embodiments, an inhibitor has an IC.sub.50
and/or binding constant of less about 10 .mu.M, less than about 1
.mu.M, less than about 100 nM, or less than about 10 nM.
[0069] The terms "measurable affinity" and "measurably inhibit," as
used herein, means a measurable change in any lysing-containing
protein, such as, e.g., XIAP, PI3K.beta./.gamma., PDPK1 and HCV-NS3
protease activity between a sample comprising a compound of the
present invention, or composition thereof, and at least one of
XIAP, PI3K.beta./.gamma., PDPK1 and HCV-NS3 protease, and an
equivalent sample comprising at least one of XIAP,
PI3K.beta./.gamma., PDPK1 and HCV-NS3 protease, in the absence of
said compound, or composition thereof.
[0070] The disclosure of U.S. application Ser. No. 12/554,433,
filed Sep. 4, 2009, entitled "Design Algorithm", is hereby
incorporated by reference into the subject application in its
entirety. As described therein, the incorporated application
describes design methods and algorithms for the modification of one
or more cysteine residues in a protein target, which design methods
and algorithms are equally applicable to the modification of one or
more lysine residues in a protein target. Any structural and
computational modeling, as well as the software used to generate
that modeling described therein, are equally useful in the instant
design of covalent inhibitors of lysine and, accordingly are herein
incorporated by reference in their entireties into this
application.
B. Protein Families Containing Targetable Lysine Residues
[0071] In general, lysine residues located in, or in proximity to,
a ligand binding site in any targeted family of proteins can be
targeted for ligand-directed lysine modification. For example,
lysine residues of protein family members targeted for
ligand-directed modification by irreversible inhibitors include,
without limitation, those summarized in Table 1, below, where
"Family" column refers to a family of proteins of interest; the
"UniProtAC" column refers to the accession number identifier of a
particular protein in accordance with UniProt Knowledgebase
(UniProtKB) accession numbers (www.uniprot.org); the "Sequence"
column refers to an identifying fragment of the Family member
protein's amino acid sequence which includes the lysine of
interest; and the "Residue Number" column refers to the lysine
residue number as set forth in the sequence. However, antibodies,
as a family of proteins, are not contemplated within the present
invention and therefore are excluded. (See e.g., Carlos F. Barbas,
III, et al., Science 278, 2085-2092 (1997); Popkov et al., Proc
Natl Acad Sci USA, 106, 4378-4383, (2009); Doppalapudi et al.,
Bioorganic & Medicinal Chemistry Letters 17, 501-506, (2007);
Li et al., J. Med. Chem., 47, 5630-5640, (2004); Guo et al., Proc.
Natl. Acad. Sci. USA, 103, 11009-11014, (2006); Rader et al., Proc
Natl Acad Sci USA, 100, 5396-5400, (2003).
TABLE-US-00001 1. TABLE OF PROTEIN FAMILIES UniProt Residue Family
KB AC Protein Name Sequence Number BCL-2 Q9BXK5 Bcl-2-like protein
13 107-LGEKVSQ-113 K110 (BCL2L13 aka** (SEQ ID NO.: 4) MIL1)
118-PLHKALQ-124 K121 (SEQ ID NO.: 5) 149-GWNKILV-155 K152 (SEQ ID
NO.: 6) Q16548 Bcl-2-related protein 043-SVQKEVE-049 K046 A1
(BCL2A1 aka (SEQ ID NO.:7) BCL2L5 aka BFL1 aka 047-EVEKNLK-053 K050
GRS aka HBPA1) (SEQ ID NO.: 8) 074-VMEKEFE-080 K077 (SEQ ID NO.: 9)
144-FVKKEEP-150 K147 (SEQ ID NO.: 10) Q9UMX3 Bcl-2-related ovarian
119-TWGKVVS-125 K122 killer protein (BOK aka (SEQ ID NO.: 11)
BCL2L9) Calpains P20807 Calpain-3 (CAPN3 aka 217-EALKGGN-223 K220
CANP3 aka CANPL3 (SEQ ID NO.: 12) aka NCL1) 417-HFTKLEI-413 K410
(SEQ ID NO.: 13) O15484 Calpain-5 (ITIH2 aka 230-ASIKAVT-236 K233
IGHEP2) (SEQ ID NO.: 14) Q9Y6Q1 Calpain-6 (CAPN5 aka
078-LGHKPMV-084 K081 NCL3) (SEQ ID NO.: 15) 333-NFHKLNV-339 K336
(SEQ ID NO.: 16) O14815 Calpain-9 (CAPN9 aka 185-EALKGGS-191 K188
NCL4) (SEQ ID NO.: 17) 327-HFDKVEI-333 K330 (SEQ ID NO.: 18)
Caspases P42575 Caspase-2 (CASP2 aka 378-RNTKRGS-384 K381 ICH1 aka
NEDD2) (SEQ ID NO.: 19) P42574 Caspase-3 (CASP3 aka 207-RNSKDGS-213
K210 CPP32) (SEQ ID NO.: 20) P55212 Caspase-6 (CASP6 aka
262-DFCKDPS-268 K265 MCH2) (SEQ ID NO.: 21) Q14790 Caspase-8 (CASP8
aka 250-KVPKLHS-256 K253 MCH5) (SEQ ID NO.: 22) 450-VSNKDDK-456
K453 (SEQ ID NO.: 23) 453-KDDKKNM-459 K456 (SEQ ID NO.: 24)
454-DDKKNMG-460 K457 (SEQ ID NO.: 25) P55211 Caspase-9 (CASP9 aka
355-RDPKSGS-361 K358 MCH6) (SEQ ID NO.: 26) 391-VSVKGIY-397 K394
(SEQ ID NO.: 27) Q92851 Caspase-10 (CASP10 295-TSLKDRQ-301 K298 aka
MCH4) (SEQ ID NO.: 28) P31944 Caspase-14 (CASP14) 093-GFLKGED-099
K096 (SEQ ID NO.:29) Q9UDY8 Mucosa-associated 355-EHPKLKA-361 K358
lymphoid tissue (SEQ ID NO.: 30) lymphoma 357-PKLKAPL-363 K360
translocation protein 1 (SEQ ID NO.: 31) (MALT1 aka MLT)
463-MCRKRND-469 K466 (SEQ ID NO.: 32) 510-IFMKFLK-516 K513 (SEQ ID
NO.: 33) Cathepsins Q9UBX1 Cathepsin F (CTSF) 325-DCDKMDK-331 K328
(SEQ ID NO.: 34) 328-KMDKACM-334 K331 (SEQ ID NO.: 35)
371-EKAKVYI-377 K374 (SEQ ID NO.: 36) P09668 Cathepsin H (CTSH
275-TPDKVNH-281 K278 aka CPSB) (SEQ ID NO.: 37) P56202 Cathepsin W
(CTSW) 264-INMKPLQ-270 K267 (SEQ ID NO.: 38) HCV P26663 Genome
polyprotein 1233-GSGKSTK-1239 K1236.sup.1 (NS3 Protease) (SEQ ID
NO.: 39) P26663 Genome polyprotein 2013-RGYKGVW-2019 K2016 (NSSA
aka p56) (SEQ ID NO.: 40) P26663 Genome polyprotein
2557-IMAKNEV-2563 K2560 (NS5B aka RNA- (SEQ ID NO.: 41) directed
RNA polymerase aka p68) HDAC Q13547 Histone deacetylase 1
028-HPMKPHR-034 K031 (HDAC1 aka RPD3L1) (SEQ ID NO.: 42) Q96DB2
Histone deacetylase 11 303-GYQKRTA-309 K306 (HDAC11) (SEQ ID NO.:
43) Q92769 Histone deacetylase 2 029-HPMKPHR-035 K032 (HDAC2) (SEQ
ID NO.: 44) O15379 Histone deacetylase 3 022-HPMKPHR-028 K025
(HDAC3) (SEQ ID NO.: 45) Q9UBN7 Histone deacetylase 6
350-GDPKGEM-356 K353 (HDAC6) (SEQ ID NO.: 46) Q9BY41 Histone
deacetylase 8 030-SLAKIPK-036 K033 (HDAC8 aka (SEQ ID NO.:47)
HDACL1) HSP70 P17066 Heat shock 70 kDa 055-DAAKSQA-061 K058 protein
6 (HSPA6 aka (SEQ ID NO.: 48) HSP70B' 070-FDAKRLI-076 K073 (SEQ ID
NO.: 49) 270-ERAKRTL-276 K273 (SEQ ID NO.: 50) P11142 Heat shock
cognate 71 058-DAAKNQV-064 K061 kDa protein (HSPA8 (SEQ ID NO.: 51)
aka HSC70 aka HSP73 068-FDAKRLI-074 K071 aka HSPA10) (SEQ ID
NO.:52) 268-ERAKRTL-274 K271 (SEQ ID NO.: 53) HSP90 P07900 Heat
shock protein 055-ALDKIRY-061 K058 HSP 90-alpha (SEQ ID NO.:54)
(HSP90AA1 aka HSP90A aka HSPC1 aka HSPCA) P08238 Heat shock protein
050-ALDKIRY-056 K053 HSP 90-beta (SEQ ID NO.: 55) (HSP90AB1 aka
HSP90B aka HSPC2 aka HSPCB) IAP Q13075 Baculoviral IAP
188-FTGKQDT-194 K191 repeat-containing (SEQ ID NO.: 56) protein 1
(NAIP aka 216-EHAKWFP-222 K199 BIRC1) (SEQ ID NO.: 57) Q13490
Baculoviral IAP 302-DDVKCFC-308 K305 repeat-containing (SEQ ID NO.:
58) protein 2 (BIRC2 aka C-IAP1 aka API1 aka IAP2 aka MIHB) Q13489
Baculoviral IAP 288-DDVKCFC-294 K291 repeat-containing (SEQ ID NO.:
59) protein 3 (BIRC3 aka C-IAP2 aka API2 aka IAP1 aka MIHC) P98170
Baculoviral IAP 294-EGDKVKC-300 K297 repeat-containing (SEQ ID NO.:
60) protein 4 (XIAP aka 296-DKCKCFH-302 K299 ILP1 aka HILP aka (SEQ
ID NO.: 61) API3 aka BIRC4 aka 308-TDWKPSE-314 K311 IAP3) (SEQ ID
NO.: 62) O15392 Baculoviral IAP 059-FCFKELE-065 K062
repeat-containing (SEQ ID NO.: 63) protein 5 (BIRC5 aka
076-EKHKKSS-082 K079 Survivin aka API4 aka (SEQ ID NO.: 64) IAP4)
Q6R308 Baculoviral IAP 118-HQDKVRC-124 K121 repeat-containing (SEQ
ID NO.: 65) protein 7 (BIRC7 aka 132-QSWKRGD-138 K135 ML-IAP aka
livin aka (SEQ ID NO.: 66) K-IAP) 143-EHAKWPF-149 K146 (SEQ ID NO.:
67) Q96P09 Baculoviral IAP 033-QEDKVQC-039 K036 repeat-containing
(SEQ ID NO.: 68) protein 8 (BIRC8 aka 047-ANWKPKE-053 K050 ILP2 aka
TsIAP) (SEQ ID NO.: 69) 058-QHAKWYP-064 K061 (SEQ ID NO.: 70)
Kinase P15056 B-Raf proto-oncogene 480-VAVKMLN-486 K483
serine/threonine- (SEQ ID NO.: 71) protein kinase (BRAF aka BRAF1
aka RAFB1) O96017 Serine/threonine- 221-IMSKTLG-227 K224 protein
kinase Chk2 (SEQ ID NO.: 72) (CHEK2 aka CHK2 242-TCKKVAI-248 K245
aka RAD53) (SEQ ID NO.:73) 249-VAIKISK-256 K252 (SEQ ID NO.:74)
346-RDLKPEN-352 K349 (SEQ ID NO.: 75) P00533 Epidermal growth
713-KKIKVLG-719 K716 factor receptor (EGFR (SEQ ID NO.: 76) aka
ERBB1) 725-TVYKGLW-731 K728 (SEQ ID NO.: 77) 742-VAIKELR-748 K745
(SEQ ID NO.: 78) P08581 Hepatocyte growth 1107-CAVKSLN-1113 K1110
factor receptor (MET (SEQ ID NO.: 79) aka c-MET) 1158-PYMKHGD-1164
K1161 (SEQ ID NO.: 80) O15530 3-phosphoinositide- 083-KFGKILG-089
K086 dependent protein (SEQ ID NO.: 81) kinase 1 (PDPK1 aka
160-SYAKNGE-166 K163 PDK-1) (SEQ ID NO.: 82) 166-ELLKYIR-172 K169
(SEQ ID NO.: 83) 170-YIRKIGS-176 K173 (SEQ ID NO.: 84)
204-RDLKPEN-210 K207 (SEQ ID NO.: 85) P11309 Proto-oncogene
257-RDIKDEN-263 K260 serine/threonine- (SEQ ID NO.: 86) protein
kinase Pim-1 (PIM1) P11362 Basic fibroblast growth 511-VAVKMLK-517
K514 factor receptor 1 (SEQ ID NO.: 87) (FGFR1) 563-YASKGNL-569
K566 (SEQ ID NO.: 88) P21802 Fibroblast growth 514-VAVKMLK-520 K517
factor receptor 2 (SEQ ID NO.: 89) (FGFR2) 566-YASKGNL-572 K569
(SEQ ID NO.: 90) P22607 Fibroblast growth 557-YAAKGNL-563 K560
factor receptor 3 (SEQ ID NO.: 91) (FGFR3) 505-VAVKMLK-511 K508
(SEQ ID NO.: 92) P22455 Fibroblast growth 500-VAVKMLK-506 K503
factor receptor 4 (SEQ ID NO.: 93) (FGFR4) 552-CAAKGNL-558 K555
(SEQ ID NO.: 94) P15056 Serine/threonine- 470-TVYKGKW-476 K473
protein kinase B-raf (b- (SEQ ID NO.: 95) RAF) P04049 RAF
proto-oncogene 362-TVYKGKW-368 K365 serine/threonine- (SEQ ID
NO.:96) protein kinase (RAF1 372-VAVKILK-378 K375 aka c-RAF) (SEQ
ID NO.: 97) 428-SLYKHLH-434 K431 (SEQ ID NO.: 98) P43405
Tyrosine-protein kinase 372-LEDKELG-378 K375 SYK (SEQ ID NO.: 99)
384-TVKKGYY-390 K387 (SEQ ID NO.: 100) 455-PLNKYLQ-461 K458 (SEQ ID
NO.: 101) MDM2 Q00987 E3 ubiquitin-protein 048-YTMKEVL-064 K051
ligase Mdm2 (MDM2) (SEQ ID NO.: 102) 091-FSVKEHR-097 K094 (SEQ ID
NO.: 103) O15151 Protein Mdm4 (MDM4 047-FTVKEVM-053 K050 aka MDMX)
(SEQ ID NO.: 104) 090-FSVKDPS-096 K093 (SEQ ID NO.: 105) Q96GM5
SWI/SNF-related 324-KTHKLQD-330 K327 matrix-associated (SEQ ID NO.:
106) actin-dependent regulator of chromatin subfamily D member 1
(SMARCD1 aka BAF60A) Q92925 SWI/SNF-related 298-IPMKLAG-304 K301
matrix-associated (SEQ ID NO.: 107) actin-dependent regulator of
chromatin subfamily D member 2 (SMARCD2 aka BAF60B) Q6STE5
SWI/SNF-related 299-SHDKEYI-305 K302 matrix-associated (SEQ ID NO.:
108) actin-dependent regulator of chromatin subfamily D member 3
(SMARCD3 aka BAF60C) MMP P39900 Macrophage 230-SDPKAVM-236 P233
metalloelastase (SEQ ID NO.: 109) (MMP12 aka HME) 238-PTYKYVD-244
P241 (SEQ ID NO.: 110) P45452 Collagenase 3 147-AFKKAFK-153 K150
(MMP13) (SEQ ID NO.: 111) 246-YTGKSHF-252 K249 (SEQ ID NO.: 112)
P50281 Matrix 143-AIRKAFR-149 K146 metalloproteinase-14 (SEQ ID
NO.: 113) (MMP14 aka MMP-X1) P51511 Matrix 281-YQWKDVD-287 K284
metalloproteinase-15 (SEQ ID NO.: 114) (MMP15 aka SMCP-2) O60882
Matrix 248-YKYKNPY-254 K251 metalloproteinase-20 (SEQ ID NO.: 115)
(MMP20) NHR P03372 Estrogen receptor 526-YSMKCKN-532 K529 (ESR1 aka
ESR aka (SEQ ID NO.: 116) NR3A1) Q92731 Estrogen receptor beta
311-SWAKKIP-317 K314 (ESR2 aka ESTRB aka (SEQ ID NO.: 117) NR3A2)
Q07869 Peroxisome 249-MAEKTLV-264 K252 proliferator-activated (SEQ
ID NO.: 118) receptor alpha (PPARA 355-MEPKFDF-361 K358 aka NR1C1
aka PPAR) (SEQ ID NO.: 119) P06401 Progesterone receptor
916-QLPKILA-922 K919 (PGR aka NR3C3) (SEQ ID NO.: 120) PI3K P42336
Phosphatidylinositol- 773-SSAKRPL-779 K776 4,5-bisphosphate 3- (SEQ
ID NO.: 121) kinase catalytic subunit 799-IIFKNGD-805 K802 alpha
isoform (PI3K- (SEQ ID NO.: 122) alpha aka PIK3CA) P42338
Phosphatidylinositol- 774-EKCKYMD-780 K777 4,5-bisphosphate 3- (SEQ
ID NO.: 123) kinase catalytic subunit 802-VIFKNGD-808 K805 beta
isoform (PI3K- (SEQ ID NO.:124) beta aka PIK3CB aka PIK3C1) P48736
Phosphatidylinositol- 799-EKCKVMA-805 K802 4,5-bisphosphate 3- (SEQ
ID NO.:125) kinase catalytic subunit 804-MASKKKP-810 K807 gamma
isoform (PI3K (SEQ ID NO.: 126) gamma aka PIK3CG) 830-IIFKHGD-836
K833 (SEQ ID NO.: 127) 880-EIVKDAT-886 K883 (SEQ ID NO.: 128)
887-TIAKIQQ-893 K890 (SEQ ID NO.: 129) Phospha- P08575 Leukocyte
common 620-DDEKQLM-626 K623 tase antigen (PTPRC aka (SEQ ID NO.:
130) CD45) 756-NRNKCAE-762 K759 (SEQ ID NO.: 131) P18031
Tyrosine-protein 117-GSLKCAQ-123 K120 phosphatase non- (SEQ ID NO.:
132) receptor type 1 (PTPN1 aka PTP1B) Q06124 Tyrosine-protein
257-QECKLLY-263 K260 phosphatase non- (SEQ ID NO.: 133) receptor
type 11 277-NRYKNIL-283 K280 (PTPN11 aka PTP2C (SEQ ID NO.: 134)
aka SHPTP2) 361-ERGKSKC-367 K364 (SEQ ID NO.: 135) 363-GKSKCVK-369
K366 (SEQ ID NO.: 136) Q12923 Tyrosine-protein 2221-QELKPLD-2227
K2224 phosphatase non- (SEQ ID NO.: 137) receptor type 13
2241-NRYKNIL-2247 K2244 (PTPN13 aka PNP1 (SEQ ID NO.: 138) aka
PTP1E aka PTPL1) 2313-EGEKIKC-2319 K2316 (SEQ ID NO.: 139)
2315-EKIKCQR-2321 K2318 (SEQ ID NO.: 140) Q15678 Tyrosine-protein
1015-GRTKSHR-1021 K1018 phosphatase non- (SEQ ID NO.: 141) receptor
type 14 915-QIPKKKA-921 K918 (PTPN14 aka PEZ) (SEQ ID NO.: 142)
916-IPKKKAN-922 K919 (SEQ ID NO.: 143) Q99952 Tyrosine-protein
038-AAWKADG-044 K041 phosphatase non- (SEQ ID NO.: 144) receptor
type 18 060-NRYKDVL-066 K063 (PTPN18 aka BDP1) (SEQ ID NO.: 145)
P17706 Tyrosine-protein 035-RVAKFPE-041 K038 phosphatase non- (SEQ
ID NO.: 146) receptor type 2 (PTPN2 aka PTPT) Q9Y2R2
Tyrosine-protein 029-LKLKRQS-035 K032 phosphatase non- (SEQ ID NO.:
147) receptor type 22 036-TKYKADK-042 K039 (PTPN22 aka PTPN8) (SEQ
ID NO.: 148) 133-EMGKKKC-139 K136 (SEQ ID NO.: 149) 135-GKKKCER-141
K138 (SEQ ID NO.: 150) P26045 Tyrosine-protein 653-LYRKKPG-659 K656
phosphatase non- (SEQ ID NO.: 151) receptor type 3 (PTPN3
663-TFAKLPQ-669 K666 aka PTPH1) (SEQ ID NO.: 152) 674-NRYKDVL-680
K677 (SEQ ID NO.: 153) 750-GRTKCHQ-756 K753 (SEQ ID NO.: 154)
P29074 Tyrosine-protein 662-LYRKKPG-668 L665 phosphatase non- (SEQ
ID NO.: 155) receptor type 4 (PTPN4 759-GRVKCHQ-765 K762 aka MEG)
(SEQ ID NO.: 156) P54829 Tyrosine-protein 326-NRYKTIL-332 K329
phosphatase non- (SEQ ID NO.: 157) receptor type 5 404-MNEKCTE-410
K407 (PTPN5) (SEQ ID NO.: 158) P29350 Tyrosine-protein
274-NRYKNIL-2280 K277 phosphatase non- (SEQ ID NO.: 159) receptor
type 6 (PTPN6 aka HCP aka PTP1C) P35236 Tyrosine-protein
123-DRYKTIL-129 K126 phosphatase non- (SEQ ID NO.: 160) receptor
type 7 (PTPN7) P43378 Tyrosine-protein 408-GRRKCGQ-414 K411
phosphatase non- (SEQ ID NO.: 161) receptor type 9 (PTPN9) P23467
Receptor-type tyrosine- 1808-GRVKCDH-1814 K1811 protein phosphatase
(SEQ ID NO.: 162) beta (PTPRB aka PTPB) Transthy- P02766
Transthyretin 032-LMVKVLD-038 K035 retin (Prealbumin aka TBPA (SEQ
ID NO.: 163) aka TTR aka ATTR aka PALB) PARP P09874 Poly
[ADP-ribose] 900-MVSKSAN-906 K903 polymerase 1 (PARP1 (SEQ ID NO.:
164) aka ADPRT aka PPOL aka ADPRT) Q9Y6F1 Poly [ADP-ribose]
418-ENSKSAG-424 K421 polymerase 3 (PARP3 (SEQ ID NO.: 165) aka
ADPRT3 aka ADPRTL3 aka IRT1) Q53GL7 Poly [ADP ribose]
938-DGHKAVF-944 K941 polymerase 10 (SEQ ID NO.: 166) (PARP10)
Q9H0J9 Poly [ADP-ribose] 606-HYSKSDT-612 K609 polymerase 12 (SEQ ID
NO.: 167) (PARP12 aka ZC3HDC1) Q460N3 Poly [ADP-ribose]
563-SYGKGTY-569 k566 polymerase 15 (SEQ ID NO.: 168) (PARP15 aka
BAL3) 576-YSAKDTY-582 K579 (SEQ ID NO.: 169) 633-RSPKLFV-639 K636
(SEQ ID NO.: 170) O95271 Tankyrase-1 (TNKS 1217-NSSKSNQ-1223 K1220
aka PARPSA, PARPL (SEQ ID NO.: 171) aka TIN1 aka TINF1
1264-STIKMAH-1270 K1269 aka TNKS1) (SEQ ID NO.: 172) HIV P03369
Gag-Pol polyprotein 532-WKPKMIG-538 K535
Protease (HIV protease aka (SEQ ID NO.: 173) Retropepsin aka PR)
.sup.1In Protein Databank (PDB; www.pdb.org): alternatively
numbered as K136.
[0072] In some embodiments, the family of proteins having
targetable lysine residues according to the present invention is
BCL-2. In other embodiments, the family of proteins is Calpains. In
other embodiments, the family of proteins is Caspases. In other
embodiments, the family of proteins is Cathepsins. In other
embodiments, the family of proteins is HCV. In other embodiments,
the family of proteins is HDAC. In other embodiments, the family of
proteins is HSP70. In other embodiments, the family of proteins is
HSP90. In other embodiments, the family of proteins is IAP. In
other embodiments, the family of proteins is Kinase. In other
embodiments, the family of proteins is MDM2. In other embodiments,
the family of proteins is MMP. In other embodiments, the family of
proteins is NHR. In other embodiments, the family of proteins is
PI3K. In other embodiments, the family of proteins is Phosphatase.
In other embodiments, the family of proteins is Transthyretin. In
other embodiments, the family of proteins is PARP. In other
embodiments, the family of proteins is HIV Protease.
[0073] In some embodiments, the members of the BCL-2 family of
proteins comprise Bcl-2-like protein 13, Bcl-2-related protein A1,
and Bcl-2-related ovarian killer protein. In these embodiments, the
target lysines are K110, K121, and K152 in Bcl-2-like protein 13;
K046, K050, K077, and K147 in Bcl-2-related protein A1; and K122 in
Bcl-2-related ovarian killer protein.
[0074] In other embodiments, the members of the Calpains family of
proteins comprise Calpain-3, Calpain-5, Calpain-6, and Calpain-9.
In these embodiments, the target lysines are K220, and K410 in
Calpain 3; K233 in Calpain-5; K081 and K336 in Calpain-6; and K188
and K330 in Calpain-9.
[0075] In some embodiments, the members of the Caspases family of
proteins comprises Caspase-2, Caspase-3, Caspase-6, Caspase-8,
Caspase-9, Caspase-10, Caspase-14, and Mucosa-associated lymphoid
tissue lymphoma translocation protein 1. In these embodiments, the
target lysines are K381 in Caspase-2; K210 in Caspase-3; K265 in
Caspase-6; K253, K453, K456, and K457 in Caspase-8; K358 and K394
in Caspase-9; K298 in Caspase-10; K096 in Caspase-14, and K358,
K360, K466, and K513 in Mucosa-associated lymphoid tissue lymphoma
translocation protein 1.
[0076] In some embodiments, the members of the Cathepsin family of
proteins comprise Cathepsin F, Cathepsin H, and Cathepsin W. In
these embodiments, the target lysines are K238, K331, and K374 in
Cathepsin F; K278 in Cathepsin H; and K267 in Cathepsin W.
[0077] In some embodiments, the members of the HCV family of
proteins comprises Genome polyprotein (NS3), Genome polyprotein
(NS5A), and Genome polyprotein (NS5B). In these embodiments, the
target lysines are K1236 in Genome polyprotein (NS3); K2016 in
Genome polyprotein (NS5A); and K2560 in Genome polyprotein
(NS5B).
[0078] In some embodiments, the members of the HCV family of
proteins comprises HCV-NS3, HCV-NS5A, and HCV-NS5B.
[0079] In some embodiments, the members of the HDAC family of
proteins comprise Histone deacetylase 1, Histone deacetylase 11,
Histone deacetylase 2, Histone deacetylase 3, Histone deacetylase
6, and Histone deacetylase 8. In these embodiments, the target
lysines are K031 in Histone deacetylase 1; K306 in Histone
deacetylase 11; K032 in Histone deacetylase 2; K025 in Histone
deacetylase 3; K353 in Histone deacetylase 6; and K033 in Histone
deacetylase 8.
[0080] In some embodiments, the members of the HSP70 family of
proteins comprise Heat shock 70 kDa protein 6, and Heat shock
cognate 71 kDa protein. In these embodiments, the target lysines
are K058, K073, and K273 in Heat shock 70 kDa protein 6; and K061,
K071, and K271 in Heat shock cognate 71 kDa protein.
[0081] In some embodiments, the members of the HSP90 family of
proteins comprise Heat shock protein HSP 90-alpha, and Heat shock
protein HSP 90-beta. In these embodiments, the target lysines are
K058 in Heat shock protein HSP 90-alpha; and K053 in Heat shock
protein HSP 90-beta.
[0082] In some embodiments, the members of the IAP family of
proteins comprise Baculoviral IAP repeat-containing protein 1 (NAIP
aka BIRC1), Baculoviral IAP repeat-containing protein 2 (BIRC2 aka
C-IAP1 aka API1 aka IAP2 aka MIHB), Baculoviral IAP
repeat-containing protein 3 (BIRC3 aka C-IAP2 aka API2 aka IAP1 aka
MIHC), Baculoviral IAP repeat-containing protein 4 (XIAP aka ILP1
aka HILP aka API3 aka BIRC4 aka IAP3), Baculoviral IAP
repeat-containing protein 5 (BIRC5 aka Survivin aka API4 aka IAP4),
Baculoviral IAP repeat-containing protein 7 (BIRC7 aka ML-IAP aka
livin aka K-IAP), and Baculoviral IAP repeat-containing protein 8
(BIRC8 aka ILP2 aka TsIAP). In these embodiments, the target
lysines are K191 and K199 in Baculoviral IAP repeat-containing
protein 1; K305 in Baculoviral IAP repeat-containing protein 2;
K291 in Baculoviral IAP repeat-containing protein 3; K297, K299,
and K311 in Baculoviral IAP repeat-containing protein 4; K062 and
K079 in Baculoviral IAP repeat-containing protein 5; K121, K135,
and K146 in Baculoviral IAP repeat-containing protein 7; and K036,
K050, and K061 in Baculoviral IAP repeat-containing protein 8.
[0083] In some embodiments, the members of the IAP family of
proteins comprises XIAP, cIAP1, cIAP2, and ML-IAP.
[0084] In some embodiments, the members of the Kinases family of
proteins comprise B-Raf proto-oncogene serine/threonine-protein
kinase, Serine/threonine-protein kinase Chk2, Epidermal growth
factor receptor, Hepatocyte growth factor receptor,
3-phosphoinositide-dependent protein kinase 1 (PDPK1),
Proto-oncogene serine/threonine-protein kinase Pim-1. Basic
fibroblast growth factor receptor 1 (FGFR1), Fibroblast growth
factor receptor 2 (FGFR2), Fibroblast growth factor receptor 3
(FGFR3), Fibroblast growth factor receptor 4 (FGFR4),
3-phosphoinositide-dependent protein kinase 1 (PDPK1),
Serine/threonine-protein kinase B-raf (b-RAF), RAF proto-oncogene
serine/threonine-protein kinase (RAF1 aka c-RAF), and
Tyrosine-protein kinase SYK. In these embodiments, the target
lysines are K483 in B-Raf proto-oncogene serine/threonine-protein
kinase; K224, K245, K252, and K349 in Serine/threonine-protein
kinase Chk2; K716, K728, and K745 in Epidermal growth factor
receptor; K1110 and K1161 in Hepatocyte growth factor receptor;
K086, K163, K169, and K207 in PDPK1; K260 in Proto-oncogene
serine/threonine-protein kinase Pim-1; K514, K566 in basic
fibroblast growth factor receptor 1 (FGFR1), K517, K569 in basic
fibroblast growth factor receptor 2 (FGFR2); K560, K508 in basic
fibroblast growth factor receptor 3 (FGFR3); K503, K555 in basic
fibroblast growth factor receptor 4 (FGFR4); K173 in
3-phosphoinositide-dependent protein kinase 1 (PDPK1); K473 in
Serine/threonine-protein kinase B-raf (b-RAF); K365 in RAF
proto-oncogene serine/threonine-protein kinase (RAF1 aka c-RAF);
K375 and K431 in RAF proto-oncogene serine/threonine-protein kinase
(RAF1 aka c-RAF); and K375, K387, and K458 in Tyrosine-protein
kinase SYK.
[0085] In some embodiments, the members of the PDK family of
proteins comprises PDPK1.
[0086] In some embodiments, the members of the MDM2 family of
proteins comprise E3 ubiquitin-protein ligase Mdm2, Protein Mdm4,
SWI/SNF-related matrix-associated actin-dependent regulator of
chromatin subfamily D member 1, SWI/SNF-related matrix-associated
actin-dependent regulator of chromatin subfamily D member 2, and
SWI/SNF-related matrix-associated actin-dependent regulator of
chromatin subfamily D member 3. In these embodiments, the target
lysines are K051 and K094 in E3 ubiquitin-protein ligase Mdm2; K050
and K093 in Protein Mdm4; K327 in SWI/SNF-related matrix-associated
actin-dependent regulator of chromatin subfamily D member 1; K301
in SWI/SNF-related matrix-associated actin-dependent regulator of
chromatin subfamily D member 2; and K302 in SWI/SNF-related
matrix-associated actin-dependent regulator of chromatin subfamily
D member 3.
[0087] In some embodiments, the members of the MMP family of
proteins comprise Macrophage metalloelastase, Collagenase 3, Matrix
metalloproteinase-14, Matrix metalloproteinase-15, and Matrix
metalloproteinase-20. In these embodiments, the target lysines are
K233 and K241 in Macrophage metalloelastase; K150 and K249 in
Collagenase 3; K146 in Matrix metalloproteinase-14; K284 in Matrix
metalloproteinase-15; and K251 in Matrix metalloproteinase-20.
[0088] In some embodiments, the members of the NHR family of
proteins comprise Estrogen receptor, Estrogen receptor beta,
Peroxisome proliferator-activated receptor alpha, and Progesterone
receptor. In these embodiments, the target lysines are K529 in
Estrogen receptor; K314 in Estrogen receptor beta; K252 and K358 in
Peroxisome proliferator-activated receptor alpha; and K919 in
Progesterone receptor.
[0089] In some embodiments, the members of the PI3K protein family
comprise Phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic
subunit alpha isoform (PI3K-alpha aka PIK3CA),
Phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit
beta isoform (PI3K-beta aka PIK3CB aka PIK3C1), and
Phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit
gamma isoform (PI3K gamma aka PIK3CG). In these embodiments, the
target lysines are K776 and K802 in
Phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit
alpha isoform; K777 and K805 in
Phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit
beta isoform; and K802, K807, K833, K883, and K890 in
Phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit
gamma isoform.
[0090] In some embodiments, the members of the PI3K family of
proteins comprises PI3K.alpha., PI3K.beta. and PI3K.gamma.. The
term PI3K, as used herein, refers to PI3K.beta. and PI3K.gamma.
interchangeably as the ligand-directed warhead of the present
invention, directed to PI3K will modify both PI3K.beta. as well as
PI3K.gamma..
[0091] In some embodiments, the members of the Phosphatase family
of proteins comprise Leukocyte common antigen, Tyrosine-protein
phosphatase non-receptor type 1, Tyrosine-protein phosphatase
non-receptor type 11, Tyrosine-protein phosphatase non-receptor
type 13, Tyrosine-protein phosphatase non-receptor type 14,
Tyrosine-protein phosphatase non-receptor type 18, Tyrosine-protein
phosphatase non-receptor type 2, Tyrosine-protein phosphatase
non-receptor type 22, Tyrosine-protein phosphatase non-receptor
type 3, Tyrosine-protein phosphatase non-receptor type 4,
Tyrosine-protein phosphatase non-receptor type 5, Tyrosine-protein
phosphatase non-receptor type 6, Tyrosine-protein phosphatase
non-receptor type 7, Tyrosine-protein phosphatase non-receptor type
9, and Receptor-type tyrosine-protein phosphatase beta. In these
embodiments, the target lysines are K623 and K759 in Leukocyte
common antigen; K120 in Tyrosine-protein phosphatase non-receptor
type 1; K260, K280, K364, K366 in Tyrosine-protein phosphatase
non-receptor type 11; K2224, K2244, K2316, and K2318 in
Tyrosine-protein phosphatase non-receptor type 13; K918, K919, and
K1018 in Tyrosine-protein phosphatase non-receptor type 14; K041
and K063 in Tyrosine-protein phosphatase non-receptor type 18; K038
in Tyrosine-protein phosphatase non-receptor type 2; K032, K039,
K136, and K138 in Tyrosine-protein phosphatase non-receptor type
22, K656, K666, K677, and K753 in Tyrosine-protein phosphatase
non-receptor type 3; K665 and K762 in Tyrosine-protein phosphatase
non-receptor type 4; K329 and K407 in Tyrosine-protein phosphatase
non-receptor type 5; K277 in Tyrosine-protein phosphatase
non-receptor type 6; K126 in Tyrosine-protein phosphatase
non-receptor type 7; K411 in Tyrosine-protein phosphatase
non-receptor type 9; and K1811 in Receptor-type tyrosine-protein
phosphatase beta.
[0092] In some embodiments, the member of the Transthyretin family
of proteins comprises Transthyretin (Prealbumin aka TBPA aka TTR
aka ATTR aka PALB). In these embodiments, the target lysine is K035
in Transthyretin.
[0093] In some embodiments, the members of the PARP family of
proteins comprise Poly [ADP-ribose] polymerase 1 (PARP1 aka ADPRT
aka PPOL aka ADPRT), Poly [ADP-ribose] polymerase 3 (PARP3 aka
ADPRT3 aka ADPRTL3 aka IRT1), Poly [ADP-ribose] polymerase 10
(PARP10), Poly [ADP-ribose] polymerase 12 (PARP12 aka ZC3HDC1),
Poly [ADP-ribose] polymerase 15 (PARP15 aka BAL3), and Tankyrase-1
(TNKS aka PARPSA, PARPL aka TIN1 aka TINF1 aka TNKS1). In these
embodiments, the target lysines are K903 in Poly [ADP-ribose]
polymerase 1; K421 in Poly [ADP-ribose] polymerase 3; K941 in Poly
[ADP-ribose] polymerase 10; K609 in Poly [ADP-ribose] polymerase
12; K566, K579 and K636 in Poly [ADP-ribose] polymerase 15; and
K1220 and K1269 in Tankyrase-1.
[0094] In some embodiments, the member of the HIV Protease family
of proteins comprises Gag-Pol polyprotein (HIV protease aka
Retropepsin aka PR). In these embodiments, the target lysine is
K535 in Gag-Pol polyprotein.
IV. METHODS FOR DESIGNING A LIGAND THAT COVALENTLY BINDS A TARGET
PROTEIN
[0095] One aspect of the present disclosure is a method for
designing a ligand that covalently binds a target protein. The
method comprises (a) providing a structural model of a reversible
ligand docked within, or in proximity to, a ligand-binding site in
a target protein, (b) identifying a lysine residue of the target
protein in, or in proximity to, the ligand-binding site that is
less than about 15A from the reversible ligand when the reversible
ligand is docked in, or in proximity to, the ligand-binding site,
(c) producing at least a structural model of at least one
ligand-warhead compound docked within, or in proximity to, the
ligand-binding site wherein the ligand-warhead compound comprises
the reversible ligand in step (b) or a portion thereof, a warhead
comprising a reactive chemical moiety, and optionally a Tether, and
(d) identifying a ligand-warhead compound whose structural model
allows the lysine residue in step (b) to readily assume a
conformation that brings the side chain primary amine group of the
lysine residue within bond-forming proximity of the warhead
electrophile.
[0096] A non-limiting example of steps (a) and (b) of the method
described above is depicted in FIG. 1. FIG. 1 shows X-ray
co-crystal structure (2JK7) showing key lysines in XIAP proximal to
bound Smac-mimetic ligand. Review of the space occupied by
Smac-mimetic ligand in relation to protein XIAP, allowed lysines
299 and 297 to be identified that were about 5.2 .ANG. and 4.5
.ANG., respectively, from portions of the Smac-mimetic ligand. FIG.
2 depicts non-limiting lysine-targeted warheads installed on
scaffolds such that they are directed toward the targeted lysines
positioned strategically at portions of compounds based on the
pharmacophore of the Smac-mimetic ligand which are in proximity to
the identified lysines, above. The reactive warheads (along with a
Tether when required) are positioned in silico such that docking of
a modified pharmacophore of the ligand in the structural model of
the protein binding site (provided in step (a) above), as described
in step (c) above, allows for determination of the spatial
arrangement of the reactive warhead vis a vis the identified lysine
of step (b).
[0097] The disclosure of U.S. application Ser. No. 12/554,433,
filed Sep. 4, 2009, entitled "Design Algorithm", is hereby
incorporated by reference into the subject application in its
entirety. As described therein, the incorporated application
describes design methods and algorithms for the modification of one
or more cysteine residues in a protein target, which design methods
and algorithms are equally applicable to the modification of one or
more lysine residues in a protein target. Any structural and
computational modeling, as well as the software used to generate
that modeling described therein, are equally useful in the instant
design of covalent inhibitors of lysine and, accordingly are herein
incorporated by reference in their entireties into this
application.
[0098] In certain embodiments, the method further comprises step
(e): forming, for the ligand-warhead compound identified in step
(d), a ligand-protein, covalent adduct by forming a covalent bond
between the side chain primary amine group of the lysine residue
identified in step (b) and the warhead electrophile in
ligand-warhead compound identified in step (d) while maintaining
the binding elements of the pharmacophore required for non-covalent
binding to the ligand's target protein.
[0099] In some embodiments, the method further comprises step (f):
evaluating the conformation of the resulting ligand-protein
covalent adduct formed in step (e) by analyzing the global energy
of the resulting conformation, or by analyzing the energy of the
conformation of the Tether. In other embodiments, the method
comprises alternate step (f): determining whether the
ligand-binding site is occluded when the covalent bond is formed
between the side chain primary amine group of the lysine residue
in, or in proximity to, the ligand-binding site and the warhead
electrophile.
[0100] In other embodiments, the method comprising steps (a)-(f) is
iterated with changes to the Tether and the global energy of the
resulting conformation is less than the previous iteration.
[0101] In certain embodiments, the covalent bond formed in step (e)
is formed using a computational method in which the warhead and the
side chain of the lysine residue are flexible and the remainder of
the structures of the ligand-warhead compound and the
ligand-binding site are fixed.
[0102] In some embodiments, in step (b) of the method, each of the
lysine residues in, or in proximity to, the ligand-binding site of
the target protein, which is less than about 15 .ANG. from the
reversible ligand, when the reversible ligand is docked in, or in
proximity to, the ligand-binding site, is identified.
[0103] In other embodiments, step (c) of the method further
comprises providing a plurality of models of the ligand-warhead
compound, wherein the warhead is bonded to a different
substitutable position of the ligand or a portion of the ligand in
each model of the ligand-warhead compound, optionally with the
Tether in between the warhead and the substitutable position.
[0104] In certain embodiments of the method disclosed, the target
protein, is an identified member of an identified protein family
and the lysine residue is not conserved across the identified
members of the protein family.
[0105] In other embodiments of the method, the target protein is an
identified member of an identified protein family and the lysine
residue is conserved among more than one identified member of the
identified protein family.
[0106] In some embodiments, the lysine residue is conserved across
identified members of the protein family.
[0107] In some embodiments of the method disclosed herein, the
target protein has catalytic activity.
[0108] In other embodiments, the target protein family is selected
from the group consisting of BCL-2, Calpains, Caspases, Cathepsins,
HCV, HDAC, HSP70, HSP90, IAP, Kinase, MDM2, MMP, NHR,
PI3K.beta./.gamma., Phosphatase, Transthyretin, PARP, and HIV
Protease.
[0109] In some embodiments, the target family of proteins is
selected from the group consisting of IAP, PI3K, PDPK1, and
HCV.
[0110] In other embodiments, the target protein is selected from
the group consisting of XIAP, PI3K.beta./.gamma., PDPK1, and
HCV.
[0111] In certain embodiments of the method disclosed, the
ligand-binding site is a ligand-binding site for a substrate or
cofactor.
[0112] In other embodiments of the methods, the lysine residue for
covalent modification is not a catalytic residue.
[0113] In another aspect, the disclosure provides a method for
designing a ligand that covalently binds a lysine residue of a
target protein. The method comprises (a) providing a structural
model of a reversible ligand docked in, or in proximity to, a
ligand-binding site in a target protein, wherein the reversible
ligand makes at least one non-covalent contact with the
ligand-binding site, (b) identifying a lysine residue in, or in
proximity to, the ligand-binding site of the target protein that is
adjacent to the reversible ligand when the reversible ligand is
docked in, or in proximity to, the ligand-binding site, (c)
producing one or more structural models of a plurality of
ligand-warhead compounds docked in, or in proximity to, the
ligand-binding site wherein each ligand-warhead compound comprises
a warhead covalently attached to a substitutable position of the
reversible ligand in step, (b) the warhead comprising a reactive
chemical moiety and optionally a linker; (d) identifying among the
structural models in step (c) at least one ligand-warhead compound
whose structural model allows the side chain primary amine group of
the lysine residue in step (b) to be within bonding distance of the
warhead electrophile, and (e) further identifying among the
structural models identified in step (d) a
hydrogen-bond-donor-containing amino acid residue in, or in
proximity to, the ligand-binding site, wherein the hydrogen-bond
donor group is within hydrogen-bonding distance of the warhead.
[0114] In some embodiments, the hydrogen-bond donor amino acid can
participate in the chemical reaction between the warhead of the
ligand-warhead and the targeted lysine of the protein. For example,
when the hydrogen bond donating amino acid is either lysine or
arginine, the interaction between lysine and lysine or lysine and
arginine are repulsive interactions that lower the pKa of the
targeted lysine, thus enhancing its nucleophilicity. In other
examples, hydrogen bond donation, either by a sidechain, or even a
mainchain amide can, in many cases, enhance the electrophilicity of
a warhead. When such a hydrogen bond donor is also positively
charged, Coulombic attraction can accelerate the reaction, for
example, by stabilizing the formation of an enolate. In a specific
embodiment, when the warhead of the ligand-warhead comprises an
acrylamide, the warhead requires a hydrogen bond donor amino acid
residue in, or in proximity to, the ligand-binding site, wherein
the hydrogen-bond donor group is within hydrogen-bonding distance
of the warhead comprising acrylamide.
[0115] In certain embodiments, the method further comprises step
(f) forming, for the ligand-warhead compound identified in step
(e), a ligand-protein covalent adduct by forming a covalent bond
between the side chain primary amine group of the lysine residue
identified in step (b) and the warhead electrophile; and also
forming a hydrogen bond between the hydrogen-bond donor moiety and
the warhead electrophile; or a hydrogen bond between the
hydrogen-bond donor moiety and the side chain primary amine group
of the lysine residue identified in step (d) while substantially
maintaining the non-covalent interactions between the pharmacophore
of the ligand and the ligand-binding site.
[0116] In certain embodiments of the method of designing a ligand,
the method further comprises step (g) evaluating a resulting
conformation of the ligand-protein covalent adduct by analyzing the
global energy of the resulting conformation.
[0117] In some embodiments of the method, steps (a) through (g) are
iterated with changes to the linker and the global energy of the
resulting conformation is less than the previous iteration.
[0118] In other embodiments of the method, the hydrogen-bond
donor-containing amino acid residue is any amino acid residue that
is capable of acting as a hydrogen bond donor. In yet other
embodiments of the method, the hydrogen-bond donor-containing amino
acid residue is selected from the group consisting of arginine,
lysine, threonine, serine, histidine, and tyrosine.
[0119] In certain embodiments of the method, the target protein is
selected from the group consisting of XIAP, PDPK1,
PI3K.beta./.gamma., and HCV. In other embodiments, when the warhead
comprises an acrylamide moiety, the warhead requires a
hydrogen-bond donor-containing amino acid residue in, or in
proximity to, the ligand-binding site, wherein the hydrogen-bond
donor group is within hydrogen-bonding distance of the warhead
comprising acrylamide to facilitate the warhead covalently binding
to the target lysine. In some embodiments, the hydrogen-bond
donor-containing amino acid residue is lysine.
[0120] In yet another aspect, a method for identifying at least one
lysine residue within at least one protein that can be modified
covalently is disclosed. The method comprises (a) identifying at
least one protein having a ligand-binding site, (b) providing a
three-dimensional structural model for the identified protein, (c)
docking a reversible ligand in, or in proximity to, the identified
protein's ligand-binding site in the structural model, wherein the
reversible ligand makes at least one non-covalent contact with the
ligand-binding site, thereby creating a structural model of a
reversible ligand bound to, or in proximity to, an identified
protein's ligand-binding site; and (d) identifying in the
structural model of the reversible ligand bound to, or in proximity
to, an identified protein's ligand-binding site one or more lysine
residues in, or in proximity to, the ligand-binding site of the
identified protein which is less than about 15 .ANG. from the
reversible ligand.
[0121] In certain embodiments, the method further comprises
identifying a plurality of proteins having ligand-binding sites
that are structurally homologous. Herein, the method further
comprises (a) providing a three-dimensional structural model for at
least one of the identified proteins, (b) docking a reversible
ligand in, or in proximity to, the structural model of the
ligand-binding site of at least one of the identified proteins,
wherein the reversible ligand makes at least one non-covalent
interaction with the ligand-binding site, thereby creating a
structural model of a reversible ligand bound to, or in proximity
to, the identified protein's ligand-binding site; and (c)
identifying in the structural model of a reversible ligand bound
to, or in proximity to, the identified protein's ligand-binding
site one or more lysine residues in, or in proximity to, the
ligand-binding site of the identified protein which is less than
about 15 .ANG. from the reversible ligand.
[0122] In some embodiments of the method, the method comprises
comparing the three-dimensionally equivalent amino acid positions
of the homologous ligand-binding sites of more than one of the
plurality of identified proteins and determining the prevalence of
lysine residues in, or in proximity to, the ligand binding sites of
the identified proteins.
[0123] In other embodiments of the method, the prevalence of lysine
residues in, or in proximity to, the ligand binding sites of the
identified proteins is in only one of the identified proteins.
[0124] In certain embodiments, the prevalence of lysine residues
in, or in proximity to, the ligand binding sites of the identified
proteins are in more than one of the identified proteins.
[0125] In some of these embodiments, the prevalence of lysine
residues in, or in proximity to, the ligand binding sites of the
identified proteins, is in less than 10% of the identified proteins
of a family at the ligand binding site position. In other
embodiments, the prevalence of lysine residues in, or in proximity
to, the ligand binding sites of the identified proteins is in less
than or greater than 50% of the identified proteins. More than 50%,
in some embodiments, the prevalence of lysine residues in, or in
proximity to, the ligand binding sites of the identified proteins
is in more than 75% of the identified proteins, while in other
embodiments, the prevalence of lysine residues in, or in proximity
to, the ligand binding sites of the identified proteins is in all
of the identified proteins.
[0126] In certain embodiments of the method, the protein is
selected from the group consisting of BCL-2, Calpains, Caspases,
Cathepsins, HCV, HDAC, HSP70, HSP90, IAP, Kinase, MDM2, MMP, NHR,
PI3K.beta./.gamma., Phosphatase, Transthyretin, PARP, and HIV
Protease.
[0127] In other embodiments, the protein is selected from the group
consisting of XIAP, PI3K.beta./.gamma., PDPK1, and HCV.
V. METHODS FOR DESIGNING WARHEADS THAT BIND TO A TARGET LYSINE
WITHIN A LIGAND BINDING SITE OF A PROTEIN
[0128] In yet another aspect of the disclosure, a method for
selecting a warhead that binds to a target lysine within a ligand
binding site of a protein is disclosed. The method comprises (a)
identifying at least one protein having a ligand-binding site, (b)
providing a three-dimensional structural model for the identified
protein, (c) identifying the location of at least one lysine in, or
in proximity to, the ligand-binding site of step (a); (d) providing
at least one warhead in proximity to the at least one identified
lysine; (e) aligning the electrophilic atom of the warhead within
bonding distance of the primary amine of the at least one
identified lysine; (f) forming a covalent bond between the
electrophilic atom of the warhead and the primary amine of the at
least one lysine; (g) docking a reversible ligand in the identified
protein's ligand-binding site within 15 .ANG. of the covalently
attached warhead of step (f), wherein the reversible ligand
maintains noncovalent interactions with the ligand binding site;
and (h) aligning the closest atom of the ligand with the covalently
bound warhead of step (f) and providing the spatial requirements
necessary for designing a tether between the ligand and the
covalently bound warhead of step (f). In step (h), it is
advantageous when the area between the tether and the ligand is
complementary with the protein surface in the region between the
warhead and the ligand.
VI. METHODS OF COVALENTLY MODIFYING LYSINE
[0129] In another aspect, the method comprises contacting a
compound of Formula I with a protein containing a lysine residue
in, or in proximity to, a ligand-binding site of a protein and
forming a covalent bond between the side chain primary amine group
of the lysine residue and Warhead of the compound. The method
encompasses compounds of Formula I:
##STR00006##
wherein
[0130] Scaffold is [0131] a) a radical resulting from the removal
of a hydrogen of a ligand capable of binding to, or in proximity
to, the ligand-binding site; or [0132] b) a portion of a
pharmacophore of a ligand resulting from truncation of the
pharmacophore, such that the Scaffold is capable of binding to, or
in proximity to, the ligand-binding site;
[0133] Warhead is an organic moiety optionally containing one or
more heteroatoms selected from O, N, and S, and has a molecular
weight of about 14 daltons to about 200 daltons, the Warhead is
capable of reacting with a side chain primary amine group of a
lysine residue and attaches to the Scaffold through the Tether;
[0134] Tether is null, a bond, or a bivalent C.sub.1-C.sub.15
saturated, unsaturated, straight, branched, cyclic, bicyclic,
tricyclic alkyl, alkenyl, alkynyl; bridged bicyclic, heterocycle,
heteroaryl, or aryl moiety; wherein optionally one or more
methylene units of the hydrocarbon chain are independently replaced
by --O--, --C(O)--, --S--, --SO--, --C(.dbd.S)--, or
C(.dbd.NR.sub.1)--; optionally, one or more hydrogens are
independently replaced by heteroatoms, and optionally, one or more
methine groups of the C.sub.1-C.sub.15 alkyl, when present, are
independently replaced by
##STR00007##
[0135] x is 0, 1, or 2;
[0136] y is 1, 2, or 3; and
[0137] R.sub.1 is hydrogen or C.sub.1-C.sub.8 alkyl.
[0138] In some embodiments, the compound of Formula I is a compound
of Formula I',
##STR00008##
[0139] It is to be understood that naturally occurring compounds
that exert their biological effects through an inherent ability to
covalently modify lysine are not contemplated or claimed in this
disclosure, nor are synthetically modified analogues of the same,
where the inherent lysine covalent modifying mechanism has not been
substantially altered. Furthermore, compounds which are based
primarily on single amino acids, nucleoside/nucleotide derived
drugs, anhydrides, compounds comprising an yne-one, are also not
contemplated in the present invention. Further, compounds that are
mechanism-based irreversible inhibitors, i.e. suicide inhibitors,
such as, for example Vigabatrin, or carbaglucose-6-phosphate
(pseudo-DL-glucose, C-6-P) are not contemplated in the present
invention. (See Structure and Mechanism in Protein Science: A Guide
to Enzyme Catalysis and Protein Folding, Alan Fersht, W. H.
Freeman, 1998, 1st Edition; Enzymatic Reaction Mechanisms, Perry A.
Frey and Adrian D. Hegeman, Perry A. Frey (Author), Oxford
University Press, 2007, 1st Edition, for a definition of the term
mechanism-based irreversible inhibitors.) Antibodies, as a family
of proteins, are not contemplated within the present invention and
therefore are excluded. (See e.g., Carlos F. Barbas, III, et al.,
Science 278, 2085-2092 (1997); Popkov et al., Proc Natl Acad Sci
USA, 106, 4378-4383, (2009); Doppalapudi et al., Bioorganic &
Medicinal Chemistry Letters 17, 501-506, (2007); Li et al., J. Med.
Chem., 47, 5630-5640, (2004); Guo et al., Proc. Natl. Acad. Sci.
USA, 103, 11009-11014, (2006); Rader et al., Proc Natl Acad Sci
USA, 100, 5396-5400, (2003).
[0140] For example, the natural product wortmannin is known to
covalently modify lysine in the protein phosphatidylinositol
3-kinase (PI3K). Thus, wortmannin is a naturally occurring compound
known to covalently modify lysine and exert its biological effects
through its inherent ability to covalently bind to lysine. Known
analogues of wortmannin that covalently modify lysine through
substantially the same mechanism as wortmannin, are also excluded
from the present invention. Examples of such wortmannin analogues
include, without limitation:
##STR00009## ##STR00010##
[0141] Another example of a naturally occurring compound that is
believed to covalently modify lysine and is not encompassed within
the present invention is Liphagal:
##STR00011##
[0142] Other compounds not encompassed within the present invention
are the following compounds disclosed in Choi et al., Nature
Chemical Biology, advance online publication, December 20,
(2009):
##STR00012##
[0143] Additional compounds not encompassed within the present
invention are the following compounds disclosed in Lawate et al.,
J. Med. Chem. 33, 2319, (1990):
##STR00013##
[0144] Other compound not encompassed within the present invention
is the following compound disclosed in Nango et al., J. Org. Chem.
69, 593-600, (2004):
##STR00014##
[0145] Compounds based primarily on amino acids such as tyrosine
derived DpaTyr-Ni (II) complex that binds to FLAG (Bioorganic and
Medicinal Chemistry Letters, 19, 6696, (2009) and Vigabatrin (also
known as 4-aminohex-5-enoate or vinylGABA (Daniela De Biase, D., et
al., J. Biol. Chem., 266, 20056, 1991)) are also not contemplated
in the present invention.
[0146] Nucleoside/nucleotide derived drugs, such as, for example,
those disclosed in Statsuk, A. V., et al., JACS, 130, 17568, (2008)
and Guillerm, G., et al., J. Med. Chem., 49, 1223, (2006), and the
like, are also not contemplated in the present invention.
[0147] Another example of a natural product and analogues thereof
that are not encompassed in the present invention is manolide and
its analogues which are believed to covalently modify lysine, such
as manoalogue (Reynolds, L. J., et al., J. Am. Chem. Soc., 1988,
110, 5172-5177):
##STR00015##
[0148] A further example of a compound and analogues thereof that
are not encompassed in the present invention is neratinib (aka
HKI-272) which covalently modify lysine in intact proteins (Wang,
J., et al., Drug Metabolism and Disposition, 2010, 38,
1083-1093):
##STR00016##
[0149] Another example of a natural product and analogues thereof
that are not encompassed in the present invention is azaphilone and
its analogues which are believed to covalently modify lysine. Non
limiting illustrative examples of azaphilone cores are described
below:
##STR00017##
[0150] In certain embodiments, the Warhead of Formula I is a
radical resulting from the removal of a hydrogen of a compound of
Formula I-a, I-b, I-c, I-d, I-e, I-f, I-g, I-h, I-j, I-k, I-l, I-m,
I-n, I-o, I-p, I-q, I-r, I-s, and I-t:
##STR00018## ##STR00019##
wherein
[0151] each X.sub.1 and X.sub.8 is independently --O--, --S--, or
--NR.sub.6--;
[0152] each X.sub.2 is independently --R.sub.6, --OR.sub.6, or
--NR.sub.6R.sub.7;
[0153] each X.sub.9 is independently
##STR00020##
[0154] each R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7,
and R.sub.8 is independently hydrogen or C.sub.1-C.sub.6 alkyl;
wherein one or more methylene groups of the C.sub.1-C.sub.6 alkyl
can be replaced by --NR.sub.1--, --O--, --C(O)--, --S--, --SO--,
--SO.sub.2--, or --C(.dbd.S)--; one or more methine groups of the
C.sub.1-C.sub.6 alkyl, when present, can be independently replaced
by
##STR00021##
[0155] R.sub.1 is hydrogen or C.sub.1-C.sub.8 alkyl;
[0156] wherein optionally when proper any two of R.sub.2, R.sub.3,
R.sub.4, R.sub.5, R.sub.6, R.sub.7, and R.sub.8 when taken together
form a 3- to 8-membered carbocyclic or heterocyclic ring or an aryl
or heteroaryl group; and optionally X.sub.2 and any one of R.sub.2,
R.sub.3, and R.sub.4 when taken together form a 3- to 8-membered
carbocyclic or heterocyclic ring or an aryl or heteroaryl
group;
[0157] A and B are each independently an optionally substituted
monocyclic, bicyclic, or tricyclic aryl or heteroaryl; and
[0158] n is an integer from 2-4; each n.sub.1 and n.sub.2 is
independently an integer from 0-2; n.sub.3 is an integer from 1-2;
n.sub.4 is an integer from 1-3; and each one of n.sub.9, n.sub.10,
n.sub.11, and n.sub.12 is an integer from 0-1; and n.sub.13 is an
integer from 0-2, wherein when any one of the foregoing n integers
is more than 1, the adjacent carbons represented by the integer can
form a single or double bond.
[0159] In some embodiments, at least one of R.sub.2 and R.sub.3 of
the compounds of Formula I-b and I-c is hydrogen.
[0160] In other embodiments, the compound of Formula I-a, I-d, I-e,
I-j, I-k, or I-l is a compound of Formula II-a, II-b, II-c, II-d,
II-e, II-f, II-g, II-h, II-j, II-k, II-l, II-m, II-n, II-o, II-p,
II-q, II-r, II-s, II-t, II-u, II-v, II-w, II-x, II-y, II-z, II-aa,
II-bb, II-cc, II-dd, II-ee, II-ff, II-gg, II-hh, II-jj, II-kk,
II-ll, II-mm, II-nn, II-oo, or II-pp:
##STR00022## ##STR00023## ##STR00024## ##STR00025## ##STR00026##
##STR00027##
wherein
[0161] each m is independently an integer from 0-4;
[0162] each m.sub.5 is independently an integer from 0-3;
[0163] each m.sub.4 is independently an integer from 0-5;
[0164] each n.sub.2 is independently an integer from 0-2;
[0165] each R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7,
R.sub.8, R.sub.9, R.sub.10, R.sub.11, R.sub.12, R.sub.13, R.sub.14,
and R.sub.15 is independently hydrogen or C.sub.1-C.sub.6 alkyl and
R.sub.1 is hydrogen, C.sub.1-C.sub.6 alkyl, halogen, CF.sub.3, or
nitro, wherein one or more methylene groups of the C.sub.1-C.sub.6
alkyl can be replaced by --NR.sub.1--, --O--, --C(O)--, --SO--,
--SO.sub.2--, or --C(.dbd.S)--, one or more methine groups of the
C.sub.1-C.sub.6 alkyl, when present, can be independently replaced
by
##STR00028##
[0166] R.sub.1 is hydrogen or C.sub.1-C.sub.8 alkyl; and,
[0167] optionally, when proper any two of R.sub.2, R.sub.3,
R.sub.4, R.sub.5, R.sub.6, R.sub.7, R.sub.8, R.sub.9, R.sub.10,
R.sub.11, R.sub.12, R.sub.13, R.sub.14, and R.sub.15, when taken
together, form a 3- to 8-membered carbocyclic or heterocyclic ring
or an aryl or heteroaryl group.
[0168] In yet another embodiment, the compound of Formula I-d, or
I-h is a compound of Formula III-a, III-b, III-h, or III-i:
##STR00029##
wherein
[0169] n.sub.3 is an integer from 0-2;
[0170] each R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7,
and R.sub.8 is independently hydrogen or C.sub.1-C.sub.6 alkyl;
[0171] each B.sub.1, B.sub.2, B.sub.4, and B.sub.5 is independently
CR.sub.7 or N;
[0172] each B.sub.3 is NR.sub.7, O, or S;
[0173] each R.sub.z1, R.sub.z2, R.sub.z3, R.sub.z4, and R.sub.z5 is
hydrogen, C.sub.1-C.sub.6 alkyl, halogen, CF.sub.3, or nitro,
wherein one or more methylene groups of the C.sub.1-C.sub.6 alkyl
can be optionally replaced by --O--, --C(O)--, --SO--,
--SO.sub.2--, or --C(.dbd.S)--, one or more methine groups of the
C.sub.1-C.sub.6 alkyl, when present, can be independently replaced
by
##STR00030##
[0174] R.sub.1 is hydrogen or C.sub.1-C.sub.8 alkyl; and,
[0175] optionally, when proper any two of R.sub.2, R.sub.3,
R.sub.4, R.sub.5, R.sub.6, R.sub.7, and R.sub.8 when taken together
form a 3- to 8-membered carbocyclic or heterocyclic ring or an aryl
or heteroaryl group.
[0176] In certain embodiments, the compound of Formula I-h is a
compound of Formula IV-a, IV-b, IV-c, IV-d, IV-e, IV-f, IV-g, IV-h,
or IV-i:
##STR00031##
wherein
[0177] R.sub.1, R.sub.2, and R.sub.3 are as defined above for
Formula I-h; and
[0178] any of the substitutable hydrogens on the nitrogen
heterocycle of the compound can be substituted with alkyl, alkoxy,
amido, acyl, acyloxy, oxoacyl, or halogen.
[0179] In other embodiments, the radical resulting from the removal
of a hydrogen of a compound of Formula I-a, I-d, I-k, or I-m is a
radical of Formula V-a, V-b, V-c, V-d, V-e, V-f, V-g, V-h, V-i, or
V-j:
##STR00032## ##STR00033##
wherein
[0180] m.sub.1 and m.sub.2 are each independently an integer from 0
to 2;
[0181] each R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7,
R.sub.8, R.sub.9, R.sub.10, and R.sub.11 is independently hydrogen
or C.sub.1-C.sub.6 alkyl, wherein one or more methylene groups of
the C.sub.1-C.sub.6 alkyl can be optionally replaced by
--NR.sub.1--, --O--, --C(O)--, --S--, --SO--, --SO.sub.2--, or
--C(.dbd.S)--; one or more methine groups of the C.sub.1-C.sub.6
alkyl, when present, can be independently replaced by
##STR00034##
[0182] R.sub.1 is hydrogen or C.sub.1-C.sub.8 alkyl; and
[0183] optionally when proper any two of R.sub.2, R.sub.3, R.sub.4,
R.sub.5, R.sub.6, R.sub.7, R.sub.8, R.sub.9, R.sub.10, and
R.sub.11, when taken together, form a 3- to 8-membered carbocyclic
or heterocyclic ring or an aryl or heteroaryl group.
[0184] In some illustrative embodiments, the compounds of Formulae
I-a, I-b, I-c, I-d, I-e, I-f, I-g, I-h, I-j, I-k, I-l, I-m, I-n,
I-o, I-p, I-q, I-r, I-s, and I-t are described below:
##STR00035## ##STR00036## ##STR00037## ##STR00038##
##STR00039##
[0185] In the foregoing compounds aa-ooo, any substitutable
hydrogen may be substituted with the substituents as those defined
by R.sub.2-R.sub.8.
[0186] In certain embodiments, the radical resulting from the
removal of a hydrogen of a compound of Formula I-a, I-d, I-k, or
I-m is a radical of Formula VI-a, VI-b, VI-c, VI-d, VI-e, VI-f,
VI-g, VI-h, VI-i, VI-j, VI-k, VI-l, VI-m, VI-n, VI-o, VI-p, VI-q,
VI-r, VI-s, or VI-t:
##STR00040## ##STR00041## ##STR00042##
[0187] wherein, R.sub.zz is hydrogen, methyl, ethyl, propyl,
isopropyl, cyclopropyl, --CH.sub.2OCH.sub.3, or
--CH.sub.2CH.sub.2OCH.sub.3.
[0188] In some embodiments, Tether is null, a bond, or a bivalent
C.sub.1-C.sub.15 saturated, unsaturated, straight, branched,
cyclic, bicyclic, tricyclic alkyl, alkenyl, alkynyl; bridged
bicyclic, heterocycle, heteroaryl, or aryl moiety; wherein
optionally one or more methylene units of the hydrocarbon chain are
independently replaced by --NR.sub.1--, --O--, --C(O)--, --S--,
--SO--, --SO.sub.2--, --C(.dbd.S)--, or C(.dbd.NR.sub.1)--; R.sub.1
is hydrogen or C.sub.1-C.sub.8 alkyl; and optionally one or more
hydrogens are independently replaced by heteroatoms; and optionally
one or more methine groups of the C.sub.1-C.sub.15 alkyl, when
present, are independently replaced by
##STR00043##
[0189] In certain embodiments, the Scaffold is selected from the
group consisting of Formulas VII, VIII, IX-a, IX-b, XI, XII, XVI,
XVII, XVIII, XIX, XX, XXI, XXII, XXIII, XXXIV, XXV, XXVI, XXVII,
XXVIII, XXIX, XXXVI, and XXXVII.
VII. COMPOUNDS OF THE INVENTION
[0190] The present disclosure provides compounds capable of
covalently binding to lysine residues of a protein thereby
inhibiting the function of the protein. Described herein are
compounds of the Formula I:
##STR00044##
and pharmaceutically acceptable salts thereof;
[0191] wherein Scaffold, Warhead, Tether, x, y are as defined above
for Formula I, with the proviso that the compound of Formula I is
not: wortmannin:
##STR00045##
known analogues of wortmannin that covalently modify lysine through
substantially the same mechanism as wortmannin:
##STR00046## ##STR00047## ##STR00048## ##STR00049##
azaphilone core analogues such as
##STR00050##
and any mechanism-based irreversible inhibitors.
[0192] In certain embodiments, the compound of Formula I is a
compound of Formula I',
##STR00051##
[0193] wherein Scaffold, Warhead and Tether are as defined above in
the embodiments of Formula I.
[0194] In certain embodiments, the Warhead is a radical resulting
from the removal of a hydrogen of a compound of Formula I-a, I-b,
I-c, I-d, I-e, I-f, I-g, I-h, I-j, I-k, I-l, I-m, I-n, I-o, I-p,
I-q, I-r, I-s, and I-t:
##STR00052## ##STR00053##
wherein
[0195] each X.sub.1 and X.sub.8 is independently --O--, --S--, or
--NR.sub.6--;
[0196] each X.sub.2 is independently --R.sub.6, --OR.sub.6, or
--NR.sub.6R.sub.7;
[0197] each X.sub.9 is independently
##STR00054##
[0198] each R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7,
and R.sub.8 is independently hydrogen or C.sub.1-C.sub.6 alkyl;
wherein one or more methylene groups of the C.sub.1-C.sub.6 alkyl
can be replaced by --NR.sub.1--, --O--, --C(O)--, --S--, --SO--,
--SO.sub.2--, or --C(.dbd.S)--; one or more methine groups of the
C.sub.1-C.sub.6 alkyl, when present, can be independently replaced
by
##STR00055##
[0199] R.sub.1 is hydrogen or C.sub.1-C.sub.8 alkyl;
[0200] wherein optionally when proper any two of R.sub.2, R.sub.3,
R.sub.4, R.sub.5, R.sub.6, R.sub.7, and R.sub.8 when taken together
form a 3- to 8-membered carbocyclic or heterocyclic ring or an aryl
or heteroaryl group; and optionally X.sub.2 and any one of R.sub.2,
R.sub.3, and R.sub.4 when taken together form a 3- to 8-membered
carbocyclic or heterocyclic ring or an aryl or heteroaryl
group;
[0201] A and B are each independently an optionally substituted
monocyclic, bicyclic, or tricyclic aryl or heteroaryl; and
[0202] n is an integer from 2-4; each n.sub.1 and n.sub.2 is
independently an integer from 0-2; n.sub.3 is an integer from 1-2;
n.sub.4 is an integer from 1-3; and each one of n.sub.9, n.sub.10,
n.sub.11, and n.sub.12 is an integer from 0-1; and n.sub.13 is an
integer from 0-2, wherein when any one of the foregoing n integers
is more than 1, the adjacent carbons represented by the integer can
form a single or double bond.
[0203] In some embodiments, at least one of R.sub.2 and R.sub.3 of
the compounds of Formula I-b and I-c is hydrogen.
[0204] In other embodiments, the compound of Formula I-a, I-d, I-e,
I-j, I-k, or I-l is a compound of Formula II-a, II-b, II-c, II-d,
II-e, II-f, II-g, II-h, II-j, II-k, II-l, II-m, II-II-o, II-p,
II-q, II-r, II-s, II-t, II-u, II-v, II-w, II-x, II-y, II-z, II-aa,
II-bb, II-cc, II-dd, II-ee, II-ff, II-gg, II-hh, II-jj, II-kk,
II-ll, II-mm, II-nn, II-oo, or II-pp.
##STR00056## ##STR00057## ##STR00058## ##STR00059## ##STR00060##
##STR00061##
wherein
[0205] each m is independently an integer from 0-4;
[0206] each m.sub.5 is independently an integer from 0-3;
[0207] each m.sub.4 is independently an integer from 0-5;
[0208] each n.sub.2 is independently an integer from 0-2;
[0209] each R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7,
R.sub.8, R.sub.9, R.sub.10, R.sub.11, R.sub.12, R.sub.13, R.sub.14,
and R.sub.15 is independently hydrogen or C.sub.1-C.sub.6 alkyl;
R.sub.1 is hydrogen, C.sub.1-C.sub.6 alkyl, halogen, CF.sub.3, or
nitro; wherein one or more methylene groups of the C.sub.1-C.sub.6
alkyl can be replaced by --NR.sub.1--, --O--, --C(O)--, --S--,
--SO--, --SO.sub.2--, or --C(.dbd.S)--; one or more methine groups
of the C.sub.1-C.sub.6 alkyl, when present, can be independently
replaced by
##STR00062##
optionally when proper any two of R.sub.2, R.sub.3, R.sub.4,
R.sub.5, R.sub.6, R.sub.7, R.sub.8, R.sub.9, R.sub.10, R.sub.11,
R.sub.12, R.sub.13, R.sub.14, and R.sub.15 when taken together form
a 3- to 8-membered carbocyclic or heterocyclic ring or an aryl or
heteroaryl group; and
[0210] R.sub.1 is hydrogen or C.sub.1-C.sub.8 alkyl.
[0211] In yet another embodiment, the compound of Formula I-d or
I-h is a compound of Formula III-a, III-b, III-h, or III-i:
##STR00063##
wherein
[0212] n.sub.3 is an integer from 0-2;
[0213] each R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7,
and R.sub.8 is independently hydrogen or C.sub.1-C.sub.6 alkyl;
[0214] each B.sub.1, B.sub.2, B.sub.4, and B.sub.5 is independently
CR.sub.7 or N and each B.sub.3 is NR.sub.S, O, or S;
[0215] each R.sub.z1, R.sub.z2, R.sub.z3, R.sub.z4, and R.sub.z5 is
hydrogen, C.sub.1-C.sub.6 alkyl, halogen, CF.sub.3, or nitro;
[0216] one or more methylene groups of the C.sub.1-C.sub.6 alkyl
can be optionally replaced by --O--, --C(O)--, --S--, --SO--,
--SO.sub.2--, or --C(.dbd.S)--; one or more methine groups of the
C.sub.1-C.sub.6 alkyl, when present, can be independently replaced
by
##STR00064##
[0217] R.sub.1 is hydrogen or C.sub.1-C.sub.8 alkyl; and
[0218] optionally when proper any two of R.sub.2, R.sub.3, R.sub.4,
R.sub.5, R.sub.6, R.sub.7, and R.sub.8 when taken together form a
3- to 8-membered carbocyclic or heterocyclic ring or an aryl or
heteroaryl group.
[0219] In certain embodiments, the compound of Formula I-h is a
compound of Formula IV-a, IV-b, IV-c, IV-d, IV-e, IV-f, IV-h, or
IV-i:
##STR00065##
[0220] wherein R.sub.2, R.sub.3 and R.sub.4 are defined above for
Formula I-d or I-h; and the hydrogen on the nitrogen heterocycle of
the compound of Formula IV-a, IV-b, and IV-c can be substituted
with alkyl, alkoxy, amido, acyl, acyloxy, oxoacyl, and halogen.
[0221] In other embodiments, the radical resulting from the removal
of a hydrogen of a compound of Formula I-a, I-d, I-k, or I-m is a
radical of Formula V-a, V-b, V-c, V-d, V-e, V-f, V-g, V-h, V-i, or
V-j:
##STR00066## ##STR00067##
[0222] wherein
[0223] m.sub.1 and m.sub.2 are each independently an integer from 0
to 2;
[0224] each R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7,
R.sub.8, R.sub.9, R.sub.10, and R.sub.11 is independently hydrogen
or C.sub.1-C.sub.6 alkyl, wherein one or more methylene groups of
the C.sub.1-C.sub.6 alkyl can be optionally replaced by
--NR.sub.1--, --O--, --C(O)--, --S--, --SO--, --SO.sub.2--, or
--C(.dbd.S)--; one or more methine groups of the C.sub.1-C.sub.6
alkyl, when present, can be independently replaced by
##STR00068##
[0225] R.sub.1 is hydrogen or C.sub.1-C.sub.8 alkyl; and
[0226] optionally when proper any two of R.sub.2, R.sub.3, R.sub.4,
R.sub.5, R.sub.6, R.sub.7, R.sub.8, R.sub.9, R.sub.10, and
R.sub.11, when taken together, form a 3- to 8-membered carbocyclic
or heterocyclic ring or an aryl or heteroaryl group.
[0227] In some illustrative embodiments, the compounds of Formulae
I-a, I-b, I-c, I-d, I-e, I-f, I-g, I-h, I-j, I-k, I-l, I-m, I-n,
I-o, I-p, I-q, I-r, I-s, and I-t are described below:
##STR00069## ##STR00070## ##STR00071## ##STR00072##
##STR00073##
[0228] In the foregoing compounds aa-ooo, any substitutable
hydrogen may be substituted with the substituents as those defined
by R.sub.2-R.sub.8.
[0229] In certain embodiments, the radical resulting from the
removal of a hydrogen of a compound of Formula I-a, I-d, I-k, or
I-m is a radical of Formula VI-a, VI-b, VI-c, VI-d, VI-e, VI-f,
VI-g, VI-h, VI-i, VI-j, VI-k, VI-l, VI-m, VI-n, VI-o, VI-p, or
VI-q:
##STR00074## ##STR00075##
wherein
[0230] R.sub.zz is hydrogen, methyl, ethyl, propyl, isopropyl,
cyclopropyl, --CH.sub.2OCH.sub.3, or
--CH.sub.2CH.sub.2OCH.sub.3.
[0231] In some embodiments of the compound of Formula I, the Tether
is null, a bond, or a bivalent C.sub.1-C.sub.15 saturated,
unsaturated, straight, branched, cyclic, bicyclic, tricyclic alkyl,
alkenyl, alkynyl; bridged bicyclic, heterocycle, heteroaryl, or
aryl moiety; wherein optionally one or more methylene units of the
hydrocarbon chain are independently replaced by --NR.sub.1--,
--O--, --C(O)--, --S--, --SO--, --SO.sub.2--, --C(.dbd.S)--, or
C(.dbd.NR.sub.1)--; optionally, one or more hydrogens are
independently replaced by heteroatoms, and optionally, one or more
methine groups of the C.sub.1-C.sub.15 alkyl, when present, are
independently replaced by
##STR00076##
and R.sub.1 is hydrogen or C.sub.1-C.sub.8 alkyl.
[0232] In certain embodiments, the Tether is null, a bond, or a
bivalent C.sub.1-C.sub.15 saturated, unsaturated, straight,
branched, cyclic, bicyclic, tricyclic alkyl, alkenyl, alkynyl;
wherein optionally one or more methylene units of the hydrocarbon
chain are independently replaced by --NR.sub.1--, --O--, --C(O)--,
--S--, --SO--, --SO.sub.2--, --C(.dbd.S)--, or C(.dbd.NR.sub.1)--;
optionally, one or more hydrogens are independently replaced by
heteroatoms, and optionally, one or more methine groups of the
C.sub.1-C.sub.15 alkyl, when present, are independently replaced
by
##STR00077##
and
[0233] R.sub.1 is hydrogen or C.sub.1-C.sub.8 alkyl.
[0234] In certain embodiments, the Scaffold is selected from the
group consisting of Formulas VII, VIII, IX-a, IX-b, XI, XII, XVI,
XVII, XVIII, XIX, XX, XXI, XXII, XXIII, XXXIV, XXV, XXVI, XXVII,
XXVIII, XXIX, XXXVI, and XXXVII.
A. IAP Protein Scaffolds
[0235] 1. Compounds of Formula I Based on Compounds of Formula
VII
[0236] In some embodiments, the compounds of Formula I are
described wherein Scaffold is a radical resulting from the removal
of one or more hydrogens of a compound of Formula VII:
##STR00078##
wherein
[0237] V and W are each independently
--(CR.sub.14R.sub.15).sub.qX.sub.3(CR.sub.16R.sub.17).sub.r--;
[0238] q and r are each independently 0, 1, 2, 3, or 4;
[0239] X.sub.3 is --CR.sub.18R.sub.19--, or --NR.sub.20--;
[0240] R.sub.x, R.sub.y, R.sub.12, R.sub.13, R.sub.14, R.sub.15,
R.sub.16, R.sub.17, R.sub.18, R.sub.19, and R.sub.20 are each
independently hydrogen or C.sub.1-C.sub.6 alkyl; wherein one or
more methylene groups of the C.sub.1-C.sub.6 alkyl can be replaced
by --NR.sub.1--, --O--, --C(O)--, --S--, --SO--, --SO.sub.2--,
--C(.dbd.S)--, optionally substituted aryl or heteroaryl groups;
one or more methine groups of the C.sub.1-C.sub.6 alkyl, when
present, can be independently replaced by
##STR00079##
[0241] R.sub.1 is hydrogen or C.sub.1-C.sub.8 alkyl; and
[0242] Tether and Warhead are as defined above in the embodiments
of Formula I.
[0243] In some embodiments, the compound of Formula VII is a
compound of Formula VII-a:
##STR00080##
wherein
[0244] V and W are each independently
--(CR.sub.14R.sub.15).sub.qX.sub.3(CR.sub.16R.sub.17).sub.r--;
[0245] q and r are each independently 0, 1, 2, 3, or 4;
[0246] X.sub.3 is --CR.sub.18R.sub.19--, or --NR.sub.20--;
[0247] p is 0, 1, 2, 3, or 4;
[0248] R.sub.12, R.sub.13, R.sub.14, R.sub.15, R.sub.16, R.sub.17,
R.sub.18, R.sub.19, and R.sub.20 are each independently hydrogen or
C.sub.1-C.sub.6 alkyl; wherein one or more methylene groups of the
C.sub.1-C.sub.6 alkyl can be replaced by --NR.sub.1--, --O--,
--C(O)--, --S--, --SO--, --SO.sub.2--, --C(.dbd.S)--, optionally
substituted aryl or heteroaryl groups; one or more methine groups
of the C.sub.1-C.sub.6 alkyl, when present, can be independently
replaced by
##STR00081##
[0249] R.sub.1 is hydrogen or C.sub.1-C.sub.8 alkyl; and;
[0250] R.sub.23 is hydrogen, C.sub.1-C.sub.6 alkyl, halogen, amino,
or nitro; wherein one or more methylene groups of C.sub.1-C.sub.6
alkyl can be optionally replaced by --NR.sub.1--, --O--, --C(O)--,
--S--, --SO--, --SO.sub.2--, or --C(.dbd.S)--; one or more methine
groups of the C.sub.1-C.sub.6 alkyl, when present, can be
independently replaced by
##STR00082##
and
[0251] optionally R.sub.21 and R.sub.23 taken together can form a
4- to 8-membered carbocyclic or heterocyclic ring.
[0252] In other embodiments, the compound of Formula I' is a
compound of Formula VII-b:
##STR00083##
[0253] wherein R.sub.12, R.sub.13, R.sub.21, R.sub.22, R.sub.23, V,
W, p, are as defined above for Formula VII-a and T and R.sub.wh are
as defined above in the embodiments of Formula I.
[0254] In certain embodiments, the compound of Formula VII-b is a
compound of Formula VII-h:
##STR00084##
[0255] wherein T, R.sub.wh, p, R.sub.12, R.sub.13, R.sub.23, and p
are as described above for Formula VII-b.
[0256] In other embodiments, the compound of Formula VII-h is a
compound of Formula VII-j, VII-k, VII-l, VII-m, VII-n, or
VII-o:
##STR00085## ##STR00086##
[0257] wherein, R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6,
R.sub.7 are as described above for embodiments of Formula I, and
R.sub.12, R.sub.13, R.sub.23, and p are as described above for
Formulas VII and VII-h.
[0258] Non-limiting examples of compounds of Formula VII are as set
forth below.
##STR00087## ##STR00088## ##STR00089## ##STR00090## ##STR00091##
##STR00092## ##STR00093## ##STR00094## ##STR00095## ##STR00096##
##STR00097## ##STR00098## ##STR00099##
[0259] 2. Compounds of Formula I Based on Compounds of Formula
VIII
[0260] In other embodiments, compounds of Formula I are described
wherein Scaffold is a radical resulting from the removal of a
hydrogen of a compound of Formula VIII:
##STR00100##
wherein
[0261] X.sub.4 is --CR.sub.33-- or --N--;
[0262] p and s are each independently 0, 1, 2, 3, or 4;
[0263] R.sub.12, R.sub.13, R.sub.21, R.sub.22, R.sub.24, R.sub.25,
R.sub.26, R.sub.27, R.sub.28, R.sub.29, R.sub.30, R.sub.31,
R.sub.32, and R.sub.33 are each independently hydrogen or
C.sub.1-C.sub.6 alkyl;
[0264] R.sub.23 is hydrogen, C.sub.1-C.sub.6 alkyl, halogen, amino,
or nitro; wherein one or more methylene groups of C.sub.1-C.sub.6
alkyl can be optionally replaced by --NR.sub.1--, --O--, --C(O)--,
--S--, --SO--, --SO.sub.2--, or --C(.dbd.S)--; one or more methine
groups of the C.sub.1-C.sub.6 alkyl, when present, can be
independently replaced by
##STR00101##
[0265] R.sub.1 is hydrogen or C.sub.1-C.sub.8 alkyl; and
[0266] optionally R.sub.21 and R.sub.23 taken together can form a
4- to 8-membered carbocyclic or heterocyclic ring; and
[0267] Tether and Warhead are as defined above in the embodiments
of Formula I.
[0268] In certain embodiments, the compound of Formula I is a
compound of Formula VIII-a or VIII-b.
##STR00102##
[0269] wherein X.sub.4, p, s, R.sub.12, R.sub.13, R.sub.21,
R.sub.22, R.sub.23, R.sub.24, R.sub.25, R.sub.26, R.sub.27,
R.sub.28, R.sub.31, R.sub.32, are as defined above for Formula
VIII, and T and R.sub.wh are as defined above in the embodiments of
Formula I.
[0270] Non-limiting examples of compounds of Formula VIII are as
set forth below.
##STR00103## ##STR00104##
[0271] 3. Compounds of Formula I Based on Compounds of Formulas
IX-a and IX-b
[0272] In other embodiments, compounds of Formula I are described
wherein Scaffold is a radical resulting from the removal of a
hydrogen of a compound of Formula IX-a or IX-b:
##STR00105##
wherein
[0273] X.sub.5 is --O--, --CR.sub.42R.sub.43-- or
--NR.sub.42--;
[0274] R.sub.12, R.sub.13, R.sub.27, R.sub.28, R.sub.29, R.sub.30,
R.sub.31, R.sub.32, R.sub.33, R.sub.34, R.sub.35, R.sub.36,
R.sub.37, R.sub.38, R.sub.39, R.sub.40, R.sub.41, R.sub.42, and
R.sub.43 are each independently hydrogen or C.sub.1-C.sub.6 alkyl;
wherein one or more methylene groups of C.sub.1-C.sub.6 alkyl can
be optionally replaced by --NR.sub.1--, --O--, --C(O)--, --S--,
--SO--, --SO.sub.2--, or --C(.dbd.S)--;
[0275] R.sub.1 is hydrogen or C.sub.1-C.sub.8 alkyl; one or more
methine groups of the C.sub.1-C.sub.6 alkyl, when present, can be
independently replaced by
##STR00106##
[0276] D, E, F, G, and H are each independently optionally
substituted aryl or heteroaryl;
[0277] wherein F and G are fused together to form a bicyclic
optionally substituted aryl or heteroaryl; and
[0278] Tether and Warhead are as defined above in the embodiments
of Formula I.
[0279] In yet another embodiment, the compound of Formula I' is a
compound of Formula IX-c or IX-d:
##STR00107##
wherein R.sub.12, R.sub.13, R.sub.31, F, G, and H are as defined
above for Formulas IX-a and IX-b, and T and R.sub.wh are Tether and
Warhead, respectively, and are as defined above in the embodiments
of Formula I.
[0280] 4. Compounds of Formula XVII
[0281] In some embodiments, compounds of Formula I' are described
by compounds of the Formula XVII:
##STR00108##
[0282] wherein T is Tether and R.sub.wh is Warhead and are as
defined above in the embodiments of Formula I.
[0283] Nonlimiting examples of the compounds of Formula XVII are
set forth below.
##STR00109## ##STR00110##
[0284] 5. Compounds of Formula XVIII
[0285] In some embodiments, compounds of Formula I are described by
compounds of the Formula XVIII:
##STR00111##
[0286] wherein T is Tether and R.sub.wh is Warhead and are as
defined above in the embodiments of Formula I.
[0287] Nonlimiting examples of the compounds of Formula XVIII are
set forth below.
##STR00112## ##STR00113##
[0288] 6. Compounds of Formula XIX
[0289] In some embodiments, compounds of Formula I are described by
compounds of Formula XIX:
##STR00114##
[0290] wherein T is Tether and R.sub.wh is Warhead and are as
defined above in the embodiments of Formula I.
[0291] Nonlimiting examples of the compounds of Formula XIX are set
forth below.
##STR00115## ##STR00116##
[0292] 7. Compounds of Formula XX-a AND XX-b
[0293] In some embodiments, compounds of Formula I are described by
compounds of Formula XX-a and Formula XX-b:
##STR00117##
wherein
[0294] R.sub.1000 is C(H) or N, wherein -T-R.sub.wh can be attached
to any carbon or the NH of the heteroaryl moiety of Formula XX-a
and Formula XX-b; and
[0295] T and R.sub.wh are Tether and Warhead, respectively, and are
as defined above in the embodiments of Formula I.
[0296] Nonlimiting examples of the compounds of Formula XX-a and
Formula XX-b are set forth below.
##STR00118## ##STR00119##
[0297] 8. Compounds of Formula XXI-a, XXI-b, and XXI-c
[0298] In some embodiments, compounds of Formula I' are described
by compounds of Formula XXI-a, Formula XXI-b, and Formula
XXI-c:
##STR00120##
[0299] wherein T and R.sub.wh are Tether and Warhead, respectively,
and are as defined above in the embodiments of Formula I.
[0300] Nonlimiting examples of the compounds of Formula XXI-a,
Formula XXI-b, and Formula XXI-c are set forth below.
##STR00121## ##STR00122##
B. PDPK1 Protein Scaffolds
[0301] 1. Compounds of Formula XI
[0302] In some embodiments, compounds of Formula I' are described
by compounds of Formula XI:
##STR00123##
wherein
[0303] B.sub.6 and B.sub.7 are each independently CR.sub.7 or
N;
[0304] R.sub.69 is hydrogen, C.sub.1-C.sub.6 alkyl, halogen, amino,
nitro, or --NH(CO)NR.sub.78R.sub.79;
[0305] R.sub.70 is hydrogen, C.sub.1-C.sub.6 alkyl, halogen, amino,
nitro;
[0306] R.sub.7, R.sub.71, R.sub.72, R.sub.73, R.sub.74, R.sub.75,
R.sub.76, R.sub.77, R.sub.78, and R.sub.79 are each independently
hydrogen or C.sub.1-C.sub.6 alkyl;
[0307] R.sub.1 is hydrogen or C.sub.1-C.sub.8 alkyl; wherein one or
more methylene groups of the C.sub.1-C.sub.6 alkyl can be replaced
by --NR.sub.1--, --O--, --C(O)--, --S--, --SO--, --SO.sub.2--, or
--C(.dbd.S)--; one or more methine groups of the C.sub.1-C.sub.6
alkyl, when present, can be independently replaced by
##STR00124##
[0308] optionally R.sub.78, and R.sub.79 taken together form a 4-
to 8-membered carbocyclic or heterocyclic ring;
[0309] p is an integer from 0 to 4, u is an integer from 1 to 4;
and
[0310] T and R.sub.wh are Tether and Warhead respectively, and are
as defined above in the embodiments of Formula I;
[0311] In other embodiments, the compound of Formula XI is a
compound of Formula XI-a, XI-b, or XI-c.
##STR00125##
[0312] In yet another embodiment, the compound of Formula XI-a,
XI-b or XI-c is a compound of Formula XI-d, XI-e, XI-f, XI-g, XI-h,
XI-i, or XI-j.
##STR00126## ##STR00127##
[0313] wherein
[0314] R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6,
R.sub.80, R.sub.81, R.sub.82, R.sub.83, R.sub.84, R.sub.85,
R.sub.86, and R.sub.87 are each independently hydrogen or
C.sub.1-C.sub.6 alkyl, wherein one or more methylene groups of the
C.sub.1-C.sub.6 alkyl can be replaced by --O--, --C(O)--, --S--,
--SO--, --SO.sub.2--, or --C(.dbd.S)--, R.sub.1 is hydrogen or
C.sub.1-C.sub.8 alkyl, and one or more methine groups of the
C.sub.1-C.sub.6 alkyl, when present, can be independently replaced
by
##STR00128##
[0315] In certain embodiments, the compound of Formula XI-d, XI-e,
XI-f, XI-g, XI-h, XI-i, or XI-j is a compound of Formula XI-k,
XI-l, XI-m, XI-n, XI-o, XI-p, or XI-q.
##STR00129## ##STR00130##
[0316] wherein R.sub.1-R.sub.8, R.sub.70, R.sub.88, and R.sub.89
are as defined above for Formula XI-a, XI-b or XI-c;
[0317] X.sub.6 is CH.sub.2, NH, O, or S; and
[0318] n.sub.5 is an integer from 0 to 3.
[0319] In some embodiments, the compound of Formula XI-e or XI-j is
a compound of Formula XI-r, XI-s, XI-t, XI-u, XI-v, XI-w, or
XI-x:
##STR00131## ##STR00132##
[0320] wherein R.sub.2, R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are
as defined above for Formula XI-a, XI-b, and XI-c.
[0321] In other embodiments, the compound of Formula XI-e, XI-h,
XI-i, or XI-j is a compound of Formula XI-y, XI-z, XI-aa, or
XI-bb.
##STR00133##
wherein
[0322] R.sub.2-R.sub.9 are as defined above for Formula II-a above;
and
[0323] X.sub.6 is as defined above for Formula XI-t above.
[0324] In certain embodiments, the compound of Formula XI-h or XI-i
is a compound of Formula XI-cc, XI-dd, XI-ee, or XI-ff.
##STR00134##
[0325] wherein R.sub.2-R.sub.7, R.sub.8, R.sub.9, are as defined
above for Formula II-a.
[0326] Nonlimiting examples of compounds of the Formula XI are set
forth below.
##STR00135## ##STR00136## ##STR00137## ##STR00138## ##STR00139##
##STR00140## ##STR00141## ##STR00142## ##STR00143## ##STR00144##
##STR00145## ##STR00146## ##STR00147##
[0327] 2. Compounds of Formula XII
[0328] In some embodiments, compounds of Formula I are described by
compounds of Formula XII:
##STR00148##
[0329] wherein T and R.sub.wh are Tether and Warhead, respectively,
and are as defined above in the embodiments of Formula I; and
[0330] R.sub.1 and R.sub.2 are each independently hydrogen or
C.sub.1-C.sub.8 alkyl; wherein one or more methylene groups of the
C.sub.1-C.sub.6 alkyl can be replaced by --NR.sub.1--, --O--,
--C(O)--, --S--, --SO--, --SO.sub.2--, or --C(.dbd.S)--; one or
more methine groups of the C.sub.1-C.sub.6 alkyl, when present, can
be independently replaced by
##STR00149##
[0331] 3. Compounds of Formula XXXVI
[0332] In some embodiments, compounds of Formula I are described by
compounds of Formula XXXVI:
##STR00150##
wherein
[0333] Rv is H, optionally substituted C.sub.1-C.sub.3 branched or
straight chain alkyl, or optionally substituted C.sub.1-C.sub.3
branched or straight chain acyl; and
[0334] T and R.sub.wh are Tether and Warhead, respectively, and are
as defined above in the embodiments of Formula I.
[0335] Nonlimiting examples of compounds of the Formula XXXVI are
set forth below:
##STR00151##
C. HCV Protease
[0336] 1. Compounds of Formula I Based on Compounds of Formula
XVI-a, XVI-b, and XVI-c
[0337] In other embodiments, compounds of Formula I are described
wherein Scaffold is a radical resulting from the removal of a
hydrogen of a compound of Formula XVI-a, XVI-b, or XVI-c:
##STR00152##
wherein
[0338] R.sub.90, R.sub.91, R.sub.92, R.sub.93, R.sub.94, R.sub.95,
R.sub.96, R.sub.97, R.sub.98, R.sub.99, R.sub.100, R.sub.102,
R.sub.104, R.sub.105, R.sub.106, R.sub.107, R.sub.108, R.sub.109,
R.sub.110, R.sub.111, R.sub.112, R.sub.113, and R.sub.114 are each
independently hydrogen or C.sub.1-C.sub.6 alkyl; wherein one or
more methylene groups of C.sub.1-C.sub.6 alkyl can be optionally
replaced by --O--, --C(O)--, --SO--, --SO.sub.2--, or
--C(.dbd.S)--;
[0339] R.sub.103 is hydrogen, C.sub.1-C.sub.6 alkyl, or
C.sub.2-C.sub.8 alkenyl;
[0340] one or more methine groups of the C.sub.1-C.sub.6 alkyl,
when present, can be independently replaced by
##STR00153##
[0341] R.sub.1 is hydrogen or C.sub.1-C.sub.8 alkyl;
[0342] each R.sub.101 is independently hydrogen, C.sub.1-C.sub.6
alkyl, C.sub.2-C.sub.8 alkenyl, halogen, amino, nitro, optionally
substituted aryl or heteroaryl;
[0343] n.sub.6 and n.sub.7 are each independently integer from 0 to
4; n.sub.8 is an integer from 0 to 2; and
[0344] Warhead is a radical resulting from the removal of a
hydrogen of a compound of Formula I-b, I-c, I-e, I-j, I-k, I-l,
I-n, or I-o;
##STR00154##
wherein
[0345] each X.sub.1 and X.sub.8 is independently --O--, or
--NR.sub.6--;
[0346] each X.sub.9 is independently
##STR00155##
[0347] each R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7,
and R.sub.8 is independently hydrogen or C.sub.1-C.sub.6 alkyl;
wherein one or more methylene groups of the C.sub.1-C.sub.6 alkyl
can be replaced by --NR.sub.1--, --O--, --C(O)--, --S--, --SO--,
--SO.sub.2--, or --C(.dbd.S)--;
[0348] one or more methine groups of the C.sub.1-C.sub.6 alkyl,
when present, can be independently replaced by
##STR00156##
[0349] optionally when proper any two of R.sub.2, R.sub.3, R.sub.4,
R.sub.5, R.sub.6, R.sub.7, and R.sub.8 when taken together form a
3- to 8-membered carbocyclic or heterocyclic ring or an aryl or
heteroaryl group;
[0350] A and B are each independently an optionally substituted
monocyclic, bicyclic, or tricyclic aryl or heteroaryl;
[0351] n is an integer from 2-4;
[0352] each n.sub.1 and n.sub.2 are independently an integer from
0-2;
[0353] n.sub.3 is an integer from 1-2;
[0354] n.sub.4 is an integer from 1-3;
[0355] T is Tether and is null, a bond, or a bivalent
C.sub.1-C.sub.15 saturated, unsaturated, straight, branched,
cyclic, bicyclic, tricyclic alkyl, alkenyl, alkynyl; bridged
bicyclic, heterocycle, heteroaryl, or aryl moiety; wherein
optionally one or more methylene units of the hydrocarbon chain are
independently replaced by --NR.sub.1--, --O--, --C(O)--, --S--,
--SO--, --C(.dbd.S)--, or C(.dbd.NR.sub.1)--; optionally, one or
more hydrogens are independently replaced by heteroatoms, and
optionally, one or more methine groups of the C.sub.1-C.sub.15
alkyl, when present, are independently replaced by
##STR00157##
and
[0356] R.sub.1 is hydrogen or C.sub.1-C.sub.8 alkyl.
[0357] In some embodiments, the compound of Formula I' is a
compound of Formula XVI-d, XVI-e, or XVI-f:
##STR00158##
wherein
[0358] R.sub.90, R.sub.101, R.sub.114, n.sub.6, n.sub.8, T and
R.sub.wh are as defined above for Formula XV-a; and
[0359] R.sub.103 is hydrogen or C.sub.2-C.sub.8 alkenyl.
[0360] In certain embodiments, the compound of Formulas XVI-d,
XVI-e, or XVI-f is a compound of Formula XVI-g, XVI-h, or
XVI-i:
##STR00159##
[0361] wherein, R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.101,
R.sub.114 are as defined above for Formulas XVI-a.
[0362] Non-limiting examples of compounds of Formula XVI-a, Formula
XVI-b, and Formula XVI-c are as set forth below.
##STR00160## ##STR00161## ##STR00162## ##STR00163## ##STR00164##
##STR00165## ##STR00166## ##STR00167## ##STR00168##
##STR00169##
D. PI3K.beta. and PI3K.gamma. Protein Scaffolds
[0363] 1. Compounds of Formula XXII-a, Formula XXII-b, or Formula
XXII-c
[0364] In some embodiments, the compound of Formula I' is a
compound of Formula XXII-a, Formula XXII-b, or Formula XXII-c:
##STR00170##
wherein
[0365] n, m, p, and q for Formula XXII-a and Formula XXII-b are
each independently 0, 1, 2, 3; provided that n and q are not 0 at
the same time, and m and q are not 0 at the same time;
[0366] T and R.sub.wh are as defined in embodiments of Formula
I;
[0367] A.sup.2 is an optionally substituted ring selected from a
4-8 membered saturated or partially unsaturated heterocyclic ring
having one or two heteroatoms independently selected from nitrogen,
oxygen, or sulfur, or a 5-10 membered saturated or partially
unsaturated bridged bicyclic heterocyclic ring having at least one
nitrogen, at least one oxygen, and optionally 1-2 additional
heteroatoms independently selected from nitrogen, oxygen, or
sulfur;
[0368] B' is an optionally substituted group selected from phenyl,
an 8- to 10-membered bicyclic aryl ring, a 5- to 6-membered
heteroaryl ring having 1-4 heteroatoms independently selected from
nitrogen, oxygen, or sulfur, or an 8- to 10-membered bicyclic
heteroaryl ring having 1-4 heteroatoms independently selected from
nitrogen, oxygen, or sulfur; or -T-Rwh; and
[0369] C.sup.2 is hydrogen or an optionally substituted ring
selected from a 3- to 7-membered saturated or partially unsaturated
carbocyclic ring, a 7- to 10-membered saturated or partially
unsaturated bicyclic carbocyclic ring, a 4- to 7-membered saturated
or partially unsaturated heterocyclic ring having 1-2 heteroatoms
independently selected from nitrogen, oxygen, or sulfur, a 7- to
10-membered saturated or partially unsaturated bicyclic
heterocyclic ring having 1-3 heteroatoms independently selected
from nitrogen, oxygen, or sulfur, phenyl, an 8- to 10-membered
bicyclic aryl ring, a 5- to 6-membered heteroaryl ring having 1-3
heteroatoms independently selected from nitrogen, oxygen, or
sulfur, or an 8- to 10-membered bicyclic heteroaryl ring having 1-4
heteroatoms independently selected from nitrogen, oxygen, or
sulfur.
[0370] Nonlimiting examples of compounds for Formula XXII-a and
Formula XXII-b are set forth below.
##STR00171## ##STR00172## ##STR00173## ##STR00174## ##STR00175##
##STR00176## ##STR00177## ##STR00178## ##STR00179##
[0371] 2. Compounds of Formula XXIII
[0372] In some embodiments, the compound of Formula I is a compound
of Formula XXIII:
##STR00180##
wherein:
[0373] R.sub.wh is a warhead group and is as defined above in the
embodiments of Formula I;
[0374] R.sub.201 is hydrogen or C.sub.1-6 alkyl;
[0375] R.sub.202 is hydrogen or an optionally substituted group
selected from C.sub.1-6 alkyl, C.sub.1-6 alkoxy, or (C.sub.1-6
alkylene)-R.sub.203; or
[0376] R.sub.201 and R.sub.202 are taken together with the
intervening carbon to form an optionally substituted ring selected
from a 3- to 7-membered carbocyclic ring or a 4- to 7-membered
heterocyclic ring having 1-2 heteroatoms independently selected
from nitrogen, oxygen, or sulfur;
[0377] R.sub.203 is a 3- to 7-membered saturated or partially
unsaturated carbocyclic ring, a 7- to 10-membered saturated or
partially unsaturated bicyclic carbocyclic ring, a 4- to 7-membered
saturated or partially unsaturated heterocyclic ring having 1-2
heteroatoms independently selected from nitrogen, oxygen, or
sulfur, a 7- to 10-membered saturated or partially unsaturated
bicyclic heterocyclic ring having 1-3 heteroatoms independently
selected from nitrogen, oxygen, or sulfur, phenyl, a 8- to
10-membered bicyclic aryl ring, a 5- to 6-membered heteroaryl ring
having 1-3 heteroatoms independently selected from nitrogen,
oxygen, or sulfur, or a 8- to 10-membered bicyclic heteroaryl ring
having 1-4 heteroatoms independently selected from nitrogen,
oxygen, or sulfur; and
[0378] Ring A.sup.6 is absent or an optionally substituted group
selected from a 4- to 7-membered heterocyclic ring having 1-2
heteroatoms independently selected from nitrogen, oxygen, or
sulfur, or a 5- to 6-membered heteroaryl ring having 1-3
heteroatoms independently selected from nitrogen, oxygen, or
sulfur.
[0379] Non-limiting examples of the compounds of Formula XXIII are
listed below:
##STR00181## ##STR00182##
[0380] 3. Compounds of Formula XXIV-a and XXIV-b
[0381] In some embodiments, the compound of Formula I is a compound
of Formula XXIV-a or XXIV-b:
##STR00183##
wherein
[0382] R.sub.wh is a warhead group;
[0383] R.sub.204 is an hydrogen or an optionally substituted group
selected from C.sub.1-6 aliphatic, --(CH.sub.2).sub.m-(3- to
7-membered saturated or partially unsaturated carbocyclic ring),
--(CH.sub.2).sub.m-(7- to 10-membered saturated or partially
unsaturated bicyclic carbocyclic ring), --(CH.sub.2).sub.m-(4- to
7-membered saturated or partially unsaturated heterocyclic ring
having 1-2 heteroatoms independently selected from nitrogen,
oxygen, or sulfur), --(CH.sub.2).sub.m-(7- to 10-membered saturated
or partially unsaturated bicyclic heterocyclic ring having 1-3
heteroatoms independently selected from nitrogen, oxygen, or
sulfur), --(CH.sub.2).sub.m-phenyl, --(CH.sub.2).sub.m-(8- to
10-membered bicyclic aryl ring), --(CH.sub.2).sub.m-(5- to
6-membered heteroaryl ring having 1-3 heteroatoms independently
selected from nitrogen, oxygen, or sulfur), or
--(CH.sub.2).sub.m-(8- to 10-membered bicyclic heteroaryl ring
having 1-4 heteroatoms independently selected from nitrogen,
oxygen, or sulfur);
[0384] each R.sub.205 and R.sub.206 is independently --R'',
halogen, --NO.sub.2, --CN, --OR'', --SR'', --N(R'').sub.2,
--C(O)R'', --CO.sub.2R'', --C(O)C(O)R'', --C(O)CH.sub.2C(O)R'',
--S(O)R'', --S(O).sub.2R'', --C(O)N(R'').sub.2,
--SO.sub.2N(R'').sub.2, --OC(O)R'', --N(R'')C(O)R'',
--N(R'')N(R'').sub.2, --N(R'')C(.dbd.NR'')N(R'').sub.2,
--C(.dbd.NR'')N(R'').sub.2, --C.dbd.NOR'',
--N(R'')C(O)N(R'').sub.2, --N(R'')SO.sub.2N(R'').sub.2,
--N(R'')SO.sub.2R'', or --OC(O)N(R'').sub.2;
[0385] each R'' is independently hydrogen or an optionally
substituted group selected from C.sub.1-6 aliphatic, a 3- to
7-membered saturated or partially unsaturated carbocyclic ring, a
7- to 10-membered saturated or partially unsaturated bicyclic
carbocyclic ring, a 4- to 7-membered saturated or partially
unsaturated heterocyclic ring having 1-2 heteroatoms independently
selected from nitrogen, oxygen, or sulfur, a 7- to 10-membered
saturated or partially unsaturated bicyclic heterocyclic ring
having 1-3 heteroatoms independently selected from nitrogen,
oxygen, or sulfur, phenyl, an 8- to 10-membered bicyclic aryl ring,
a 5- to 6-membered heteroaryl ring having 1-3 heteroatoms
independently selected from nitrogen, oxygen, or sulfur, or an 8-
to 10-membered bicyclic heteroaryl ring having 1-4 heteroatoms
independently selected from nitrogen, oxygen, or sulfur; or
[0386] two R'' groups on the same nitrogen are taken together with
the nitrogen to which they are attached to form an optionally
substituted 5-8 membered saturated, partially unsaturated, or
aromatic ring having 1-4 heteroatoms independently selected from
nitrogen, oxygen, or sulfur;
[0387] m is an integer from 0 to 6, inclusive;
[0388] each n for Formula XXIV-a or Formula XXIV-b is independently
0, 1, or 2; and
[0389] Ring A.sup.5 is an optionally substituted 6-membered
heterocyclic or heteroaryl ring having 1-2 nitrogens.
[0390] Non-limiting examples of compounds of Formula XXIV-a and
XXIV-b are set forth below:
##STR00184##
[0391] 4. Compounds of Formula XXV
[0392] In some embodiments, the compound of Formula I' is a
compound of Formula XXV:
##STR00185##
wherein
[0393] R.sub.wh is a warhead group
[0394] each R.sub.205 and R.sub.206 is independently --R'',
halogen, --NO.sub.2, --CN, --OR'', --SR'', --N(R'').sub.2,
--C(O)R'', --CO.sub.2R'', --C(O)C(O)R'', --C(O)CH.sub.2C(O)R'',
--S(O)R'', --S(O).sub.2R'', --C(O)N(R'').sub.2,
--SO.sub.2N(R'').sub.2, --OC(O)R'', --N(R'')C(O)R'',
--N(R'')N(R'').sub.2, --N(R'')C(.dbd.NR'')N(R'').sub.2,
--C(.dbd.NR'')N(R'').sub.2, --C.dbd.NOR'',
--N(R'')C(O)N(R'').sub.2, --N(R'')SO.sub.2N(R'').sub.2,
--N(R'')SO.sub.2R'', or --OC(O)N(R'').sub.2;
[0395] each R'' is independently hydrogen or an optionally
substituted group selected from C.sub.1-6 aliphatic, a 3- to
7-membered saturated or partially unsaturated carbocyclic ring, a
7- to 10-membered saturated or partially unsaturated bicyclic
carbocyclic ring, a 4- to 7-membered saturated or partially
unsaturated heterocyclic ring having 1-2 heteroatoms independently
selected from nitrogen, oxygen, or sulfur, a 7- to 10-membered
saturated or partially unsaturated bicyclic heterocyclic ring
having 1-3 heteroatoms independently selected from nitrogen,
oxygen, or sulfur, phenyl, an 8- to 10-membered bicyclic aryl ring,
a 5- to 6-membered heteroaryl ring having 1-3 heteroatoms
independently selected from nitrogen, oxygen, or sulfur, or an 8-
to 10-membered bicyclic heteroaryl ring having 1-4 heteroatoms
independently selected from nitrogen, oxygen, or sulfur; or
[0396] optionally, two R'' groups on the same nitrogen are taken
together with the nitrogen to which they are attached to form an
optionally substituted 5-8 membered saturated, partially
unsaturated, or aromatic ring having 1-4 heteroatoms independently
selected from nitrogen, oxygen, or sulfur;
[0397] m is an integer from 0 to 6, inclusive;
[0398] each n is independently 0, 1, or 2; and
[0399] Ring A.sup.5 is an optionally substituted 6-membered
heterocyclic or heteroaryl ring having 1-2 nitrogens.
[0400] In other nonlimiting illustrative embodiments, compounds of
Formula XXV are shown below:
##STR00186## ##STR00187## ##STR00188## ##STR00189##
[0401] 5. Compounds of Formula XXVI
[0402] In some embodiments, the compound of Formula I is a compound
of Formula XXVI:
##STR00190##
or a pharmaceutically acceptable salt thereof; wherein:
[0403] R.sub.wh is a warhead group and is as defined above in the
embodiments of Formula I;
[0404] Ring A.sup.7 is an optionally substituted ring selected from
a 4- to 8-membered saturated or partially unsaturated heterocyclic
ring having one or two heteroatoms independently selected from
nitrogen, oxygen, or sulfur, or a 5-10 membered saturated or
partially unsaturated bridged bicyclic heterocyclic ring having at
least one nitrogen, at least one oxygen, and optionally 1-2
additional heteroatoms independently selected from nitrogen,
oxygen, or sulfur;
[0405] R.sub.207 is R''', halogen, --OR'' --CN, --NO.sub.2,
--SO.sub.2R''', --SOR''', --C(O)R''', --CO.sub.2R''',
--C(O)N(R''').sub.2, --NRC(O)R''', --NR'''C(O)N(R''').sub.2,
--NRSO.sub.2R''', or --N(R''').sub.2;
[0406] each R''' is independently hydrogen or an optionally
substituted group selected from C.sub.1-6 aliphatic, aryl, a 4- to
7-membered heterocylic ring having 1-2 heteroatoms independently
selected from nitrogen, oxygen, or sulfur, or a 5- to 6-membered
monocyclic heteroaryl ring having 1-4 heteroatoms independently
selected from nitrogen, oxygen, or sulfur, or:
[0407] optionally two R''' groups on the same nitrogen are taken
together with the nitrogen atom to which they are attached to form
a 4- to 7-membered saturated, partially unsaturated, or heteroaryl
ring having 1-4 heteroatoms independently selected from nitrogen,
oxygen, or sulfur;
[0408] Ring B.sup.7 is an optionally substituted group selected
from phenyl, an 8- to 10-membered bicyclic aryl ring, a 5- to
6-membered heteroaryl ring having 1-4 heteroatoms independently
selected from nitrogen, oxygen, or sulfur, or an 8- to 10-membered
bicyclic heteroaryl ring having 1-4 heteroatoms independently
selected from nitrogen, oxygen, or sulfur;
[0409] T.sup.7 is a covalent bond or a bivalent straight or
branched, saturated or unsaturated C.sub.1-6 hydrocarbon chain
wherein one or more methylene units of T.sup.7 are optionally
replaced by --O--, --S--, --C(O)--, --OC(O)--, --C(O)O--,
--C(O)N(R''')--, --N(R''')C(O)--, --N(R''')C(O)N(R''')--,
--SO.sub.2--, --SO.sub.2N(R''')--, --N(R''')SO.sub.2--, or
--N(R''')SO.sub.2N(R''')--;
[0410] Ring C.sup.7 is an optionally substituted ring selected from
a 3- to 7-membered saturated or partially unsaturated carbocyclic
ring, a 7- to 10-membered saturated or partially unsaturated
bicyclic carbocyclic ring, a 7- to 12-membered saturated or
partially unsaturated bridged bicyclic ring having 0-4 heteroatoms
independently selected from nitrogen, oxygen, or sulfur, a 4- to
7-membered saturated or partially unsaturated heterocyclic ring
having 1-2 heteroatoms independently selected from nitrogen,
oxygen, or sulfur, a 7- to 10-membered saturated or partially
unsaturated bicyclic heterocyclic ring having 1-3 heteroatoms
independently selected from nitrogen, oxygen, or sulfur, phenyl, an
8- to 10-membered bicyclic aryl ring, a 5- to 6-membered heteroaryl
ring having 1-3 heteroatoms independently selected from nitrogen,
oxygen, or sulfur, or an 8- to 10-membered bicyclic heteroaryl ring
having 1-4 heteroatoms independently selected from nitrogen,
oxygen, or sulfur; and
[0411] Ring D.sup.7 is absent or an optionally substituted ring
selected from a 3- to 7-membered saturated or partially unsaturated
carbocyclic ring, a 7- to 10-membered saturated or partially
unsaturated bicyclic carbocyclic ring, a 7- to 12-membered
saturated or partially unsaturated bridged bicyclic ring having 0-4
heteroatoms independently selected from nitrogen, oxygen, or
sulfur, a 4- to 7-membered saturated or partially unsaturated
heterocyclic ring having 1-2 heteroatoms independently selected
from nitrogen, oxygen, or sulfur, a 7- to 10-membered saturated or
partially unsaturated bicyclic heterocyclic ring having 1-3
heteroatoms independently selected from nitrogen, oxygen, or
sulfur, phenyl, an 8- to 10-membered bicyclic aryl ring, a 5- to
6-membered heteroaryl ring having 1-3 heteroatoms independently
selected from nitrogen, oxygen, or sulfur, or an 8- to 10-membered
bicyclic heteroaryl ring having 1-4 heteroatoms independently
selected from nitrogen, oxygen, or sulfur.
[0412] Nonlimiting examples of the compounds of Formula XXVI are
set forth below.
##STR00191## ##STR00192## ##STR00193## ##STR00194##
[0413] 6. Compounds of Formula XXVII
[0414] In some embodiments, the compound of Formula I is a compound
of Formula XXVII:
##STR00195##
or a pharmaceutically acceptable salt thereof; wherein:
[0415] T and R.sub.wh are as defined above in the embodiments of
Formula I.
[0416] R is H, alkyl, or alkoxy.
[0417] Nonlimiting examples of the compounds of the Formula XXVII
are set forth below.
##STR00196## ##STR00197## ##STR00198##
[0418] 7. Compounds of Formula XXVIII
[0419] In some embodiments, the compound of Formula I is a compound
of Formula XXVIII:
##STR00199##
and pharmaceutically acceptable salts thereof; wherein
[0420] T and R.sub.wh and are as defined above in the embodiments
of Formula I.
[0421] Non-limiting examples of the compounds of Formula XXVIII are
set forth below:
##STR00200## ##STR00201##
[0422] 8. Compounds of Formula XXIX
[0423] In some embodiments, the compound of Formula I is a compound
of Formula XXIX:
##STR00202##
and pharmaceutically acceptable salts thereof; wherein
[0424] T and R.sub.wh are Tether and Warhead, respectively, and are
as defined as above for Formula I; and
[0425] A.sup.8 is an optionally substituted aryl, biaryl, or
heteroaryl.
[0426] Non-limiting examples of the compounds of Formula XXIX are
set forth below:
##STR00203##
[0427] 9. Compounds of Formula XXXVII
[0428] In some embodiments, the compound of Formula I is a compound
of Formula XXXVII:
##STR00204##
and pharmaceutically acceptable salts thereof; wherein
[0429] T and R.sub.wh are Tether and Warhead, respectively, and are
as defined as above for Formula I.
[0430] Non-limiting examples of the compounds of Formula XXXVII are
set forth below:
##STR00205## ##STR00206##
[0431] One of ordinary skill in the art will recognize that a
variety of warhead groups, as defined herein, are suitable for
covalent bonding to lysine. Such R.sub.wh groups include, but are
not limited to, those described herein and depicted in Formulas
VI-a-VI-t, and aa-ooo, inclusive, supra. That these warheads are
suitable for covalent bonding to the primary amine of a lysine
residue was determined by performing mass spectrometric experiments
using the protocol described in detail in Examples 50-54, 88,
163-164, and 174-175, infra, the results of which are depicted in
FIGS. 3-9, and 12-22. These experiments show that the compounds
described herein covalently modify a target lysine residue in
HCV-NS3 protease, XIAP, PDPK-1, and PI3K.beta./.gamma..
VIII. IN A FURTHER ASPECT, THE INVENTION PROVIDES
PROTEIN-MODIFIER-LIGAND CONJUGATES OF THE FORMULA XIII
##STR00207##
[0432] wherein
[0433] Scaffold is [0434] a) a radical resulting from the removal
of a hydrogen of a ligand capable of binding to, or in proximity
to, the ligand-binding site; or [0435] b) a portion of a
pharmacophore of a ligand resulting from truncation of the
pharmacophore, such that the Scaffold is capable of binding to, or
in proximity to, the ligand-binding site;
[0436] Warhead is an organic moiety optionally containing one or
more heteroatoms selected from O, N, and S; the organic moiety
having a molecular weight of about 14 daltons to about 200 daltons;
Warhead being capable of reaction with a side chain primary amine
group of a lysine residue; and Warhead being attached to Scaffold
through Tether; and
[0437] Tether is null, a bond, or a bivalent C.sub.1-C.sub.15
saturated, unsaturated, straight, branched, cyclic, bicyclic,
tricyclic alkyl, alkenyl, alkynyl; bridged bicyclic, heterocycle,
heteroaryl, or aryl moiety; wherein optionally one or more
methylene units of the hydrocarbon chain are independently replaced
by --NR.sub.1--, --O--, --C(O)--, --S--, --SO--, --C(.dbd.S)--, or
C(.dbd.NR.sub.1)--; optionally, one or more hydrogens are
independently replaced by heteroatoms, and optionally, one or more
methine groups of the C.sub.1-C.sub.6 alkyl, when present, are
independently replaced by
##STR00208##
[0438] x is 0, 1, or 2;
[0439] y is 1, 2, or 3;
[0440] R.sub.1 is hydrogen or C.sub.1-C.sub.8 alkyl; and
[0441] Y.sub.1 is a bivalent or trivalent moiety resulting from the
removal of a hydrogen of a radical of Formula XIV-a, XIV-b, XIV-c,
XIV-d, XIV-e, XIV-f, XIV-g, XIV-h, or XIV-i,
##STR00209## ##STR00210##
wherein
[0442] each X.sub.1 and X.sub.2 is independently
--CR.sub.2R.sub.3R.sub.4, --OR.sub.2, or --NR.sub.2R.sub.3;
[0443] each R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7,
and R.sub.8 is independently hydrogen or C.sub.1-C.sub.6 alkyl;
[0444] optionally when proper any two of R.sub.2, R.sub.3, R.sub.4,
R.sub.5, R.sub.6, R.sub.7, and R.sub.8 can be linked together to
form a 3- to 8-membered carbocyclic or heterocyclic ring;
[0445] one or more methylene groups of the C.sub.1-C.sub.6 alkyl
can be replaced by --NR.sub.1--, --O--, --C(O)--, --S--, --SO--,
--SO.sub.2--, or --C(.dbd.S)--; one or more methine groups of the
C.sub.1-C.sub.6 alkyl, when present, can be independently replaced
by and
##STR00211##
[0446] n is an integer from 2-4, m.sub.4 is an integer from 1 to
2;
[0447] A is an optionally substituted aryl or heteroaryl;
is a single or a double bond;
[0448] a hydrogen of a radical of Formula XIV-a, XIV-b, XIV-c,
XIV-d, XIV-e, XIV-f, XIV-g, XIV-h, or XIV-i, is substituted by
Tether-Scaffold; and
[0449] M is connected to the position labeled as "*" and is --NH--
or .dbd.N--, the nitrogen atom of M being a nitrogen from the side
chain primary amine group of the lysine residue of the protein.
[0450] In some embodiments, the conjugate of Formula XIII, is a
conjugate of Formula XIII',
##STR00212##
[0451] In some embodiments, the Scaffold is selected from the group
consisting of Formulas VII, VIII, IX-a, IX-b, XI, XII, XVI, XVII,
XVIII, XIX, XX, XXI, XXII, XXIII, XXXIV, XXV, XXVI, XXVII, XXVIII,
XXIX, XXXVI, and XXXVII.
[0452] In other embodiments, M(CH.sub.2).sub.4-Protein, is selected
from the group consisting of M(CH.sub.2).sub.4-K1236-HCV-NS3
.mu.M(CH.sub.2).sub.4-K2016-HCV-NS3,
M(CH.sub.2).sub.4-K2560-HCV-NS3,
M(CH.sub.2).sub.4-K191-(Baculoviral IAP repeat-containing protein
1), M(CH.sub.2).sub.4-K199-(Baculoviral IAP repeat-containing
protein 1), M(CH.sub.2).sub.4-K305-(Baculoviral IAP
repeat-containing protein 2), M(CH.sub.2).sub.4-K291-(Baculoviral
IAP repeat-containing protein 3),
M(CH.sub.2).sub.4-K297-(Baculoviral IAP repeat-containing protein
4), M(CH.sub.2).sub.4-K299-(Baculoviral IAP repeat-containing
protein 4), M(CH.sub.2).sub.4-K311-(Baculoviral IAP
repeat-containing protein 4), M(CH.sub.2).sub.4-K062-(Baculoviral
IAP repeat-containing protein 5),
M(CH.sub.2).sub.4-K079-(Baculoviral IAP repeat-containing protein
5), M(CH.sub.2).sub.4-K121-(Baculoviral IAP repeat-containing
protein 7), M(CH.sub.2).sub.4-K135-(Baculoviral IAP
repeat-containing protein 7), M(CH.sub.2).sub.4-K146-(Baculoviral
IAP repeat-containing protein 7),
M(CH.sub.2).sub.4-K036-(Baculoviral IAP repeat-containing protein
8), M(CH.sub.2).sub.4-K050-(Baculoviral IAP repeat-containing
protein 8), M(CH.sub.2).sub.4-K061-(Baculoviral IAP
repeat-containing protein 8),
M(CH.sub.2).sub.4-K776-(Phosphatidylinositol-4,5-bisphosphate
3-kinase catalytic subunit alpha isoform),
M(CH.sub.2).sub.4-K802-(Phosphatidylinositol-4,5-bisphosphate
3-kinase catalytic subunit alpha isoform),
M(CH.sub.2).sub.4-K777-(Phosphatidylinositol-4,5-bisphosphate
3-kinase catalytic subunit beta isoform),
M(CH.sub.2).sub.4-K805-(Phosphatidylinositol-4,5-bisphosphate
3-kinase catalytic subunit beta isoform),
M(CH.sub.2).sub.4-K802-(Phosphatidylinositol-4,5-bisphosphate
3-kinase catalytic subunit gamma isoform),
M(CH.sub.2).sub.4-K807-(Phosphatidylinositol-4,5-bisphosphate
3-kinase catalytic subunit gamma isoform),
M(CH.sub.2).sub.4-K833-(Phosphatidylinositol-4,5-bisphosphate
3-kinase catalytic subunit gamma isoform),
M(CH.sub.2).sub.4-K890-(Phosphatidylinositol-4,5-bisphosphate
3-kinase catalytic subunit gamma isoform),
M(CH.sub.2).sub.4-K086-(3-phosphoinositide-dependent protein kinase
1), M(CH.sub.2).sub.4-K163-(3-phosphoinositide-dependent protein
kinase 1), M(CH.sub.2).sub.4-K169-(3-phosphoinositide-dependent
protein kinase 1), and
M(CH.sub.2).sub.4-K207-(3-phosphoinositide-dependent protein kinase
1).
[0453] In other embodiments, the bivalent or trivalent moiety
resulting from the removal of a hydrogen of a radical of Formula
XIV-a, XIV-d, XIV-h, or XIV-i is a moiety of Formula XV-a, XV-b,
XV-c, XV-d, XV-e, XV-f, or XV-g;
##STR00213##
wherein
[0454] m.sub.4 is an integer from 1 to 2;
[0455] each R.sub.2, R.sub.3, R.sub.4, R.sub.5 and R.sub.6 is
independently hydrogen or C.sub.1-C.sub.6 alkyl; wherein [0456]
optionally when proper any two of R.sub.2, R.sub.3, R.sub.4,
R.sub.5 and R.sub.6 can be linked together to form a 3- to
8-membered carbocyclic or heterocyclic ring; and [0457] one or more
methylene groups of the C.sub.1-C.sub.6 alkyl can be replaced by
--O--, --C(O)--, --S--, --SO--, --SO.sub.2--, or --C(.dbd.S)--;
[0458] one or more methine groups of the C.sub.1-C.sub.6 alkyl,
when present, can be independently replaced by
[0458] ##STR00214## [0459] M is connected to the position of
Y.sub.1 labeled as "*"; and [0460] Tether is connected to the
position of Y.sub.1 labeled as "**".
[0461] In some embodiments, the bivalent moiety of Formula XV-a,
XV-b, XV-c, XV-d, XV-e, XV-f, or XV-g is a bivalent moiety of
Formula XV-h, XV-i, XV-j, XV-k, XV-1, XV-m, XV-n, XV-o, XV-p, XV-q,
XV-r, XV-s, or XV-t;
##STR00215## ##STR00216##
wherein
[0462] M is connected to the position of Y.sub.1 labeled as "*";
and
[0463] Tether is connected to the position of Y.sub.1 labeled as
"**".
[0464] As defined generally above, R.sub.wh is a warhead group.
Without wishing to be bound by any particular theory, it is
believed that such R.sub.wh groups, i.e. warhead groups, are
particularly suitable for covalently binding to a key lysine
residue in the binding domain of, for example, but not limited to,
XIAP, PDPK-1, HCV protease, and PI3K. One of ordinary skill in the
art will appreciate that XIAP, PDPK-1, HCV protease, and PI3K, and
mutants thereof, have at least one lysine residue in the binding
domain of each protein.
[0465] In certain embodiments, compounds of the present invention
have a warhead group characterized in that inventive compounds may
target the K297 lysine residue of XIAP. In certain embodiments,
compounds of the present invention have a warhead group
characterized in that inventive compounds target the K86 lysine
residue of PDPK-1. In certain embodiments, compounds of the present
invention have a warhead group characterized in that inventive
compounds target the K169 lysine residue of PDPK-1. In certain
embodiments, compounds of the present invention have a warhead
group characterized in that inventive compounds target the K173
lysine residue of PDPK-1. In other embodiments, compounds of the
present invention have a warhead group characterized in that
inventive compounds target the K136 lysine residue of HCV protease.
In other embodiments, compounds of the present invention have a
warhead group characterized in that inventive compounds target the
K777 lysine residue of PI3K.beta.. In other embodiments, compounds
of the present invention have a warhead group characterized in that
inventive compounds target the K802 lysine residue of PI3K.gamma..
In other embodiments, compounds of the present invention have a
warhead group characterized in that inventive compounds target the
K890 lysine residue of PI3K.gamma..
[0466] Thus, in some embodiments, R.sub.wh is characterized in that
the -T-R.sub.wh moiety is capable of covalently binding to a lysine
residue thereby irreversibly inhibiting the enzyme.
[0467] According to another aspect, the present invention provides
a conjugate comprising XIAP, or a mutant thereof, covalently bonded
to an inhibitor at K297. In some embodiments, the inhibitor moiety
is bonded via a linker moiety. In certain embodiments, the present
invention provides a conjugate of the Formula K297-linker-inhibitor
moiety. One of ordinary skill in the art will recognize that the
"linker" group corresponds to a -T-R.sub.wh as described herein.
Accordingly, in certain embodiments, the linker group is as defined
for -T-R.sub.wh was defined above and described in classes and
subclasses herein. It will be appreciated, however, that the linker
group is bivalent and, therefore, the corresponding -T-R.sub.wh
group is also intended to be bivalent resulting from the reaction
of the warhead with the K297 of XIAP, or a mutant thereof.
[0468] In certain embodiments for XIAP, the inhibitor moiety is a
compound of Formula A:
##STR00217##
wherein
[0469] V and W are each independently
--(CR.sub.14R.sub.15).sub.qX.sub.3(CR.sub.16R.sub.17).sub.r;
[0470] p, q and r are each independently 0, 1, 2, 3, or 4;
[0471] X.sub.3 is --CR.sub.18R.sub.19--, or --NR.sub.20--; and
[0472] R.sub.21 and R.sub.22 are each independently hydrogen or
C.sub.1-C.sub.6 alkyl;
[0473] R.sub.23 is hydrogen, C.sub.1-C.sub.6 alkyl, halogen, amino,
or nitro; wherein one or more methylene groups of C.sub.1-C.sub.6
alkyl can be optionally replaced by --NR.sub.1--, --O--, --C(O)--,
--S--, --SO--, --SO.sub.2--, or --C(.dbd.S)--; one or more methine
groups of the C.sub.1-C.sub.6 alkyl, when present, can be
independently replaced by
##STR00218##
[0474] R.sub.1 is hydrogen or C.sub.1-C.sub.8 alkyl; and
[0475] optionally R.sub.21 and R.sub.23 taken together can form a
4- to 8-membered carbocyclic or heterocyclic ring.
[0476] Thus, in certain embodiments, the present invention provides
a conjugate of the formula:
##STR00219##
[0477] wherein R.sub.12, R.sub.13, R.sub.21, R.sub.22, R.sub.23, V,
W, and p are as defined above for formula A.
[0478] In certain embodiments, the inhibitor moiety is a compound
of formula B:
##STR00220##
wherein
[0479] X.sub.4 is --CR.sub.33-- or --N--;
[0480] p and s are each independently 0, 1, 2, 3, or 4;
[0481] R.sub.12, R.sub.13, R.sub.21, R.sub.22, R.sub.24, R.sub.25,
R.sub.26, R.sub.27, R.sub.28, R.sub.29, R.sub.30, R.sub.31,
R.sub.32, and R.sub.33 are each independently hydrogen or
C.sub.1-C.sub.6 alkyl;
[0482] R.sub.23 is hydrogen, C.sub.1-C.sub.6 alkyl, halogen, amino,
or nitro; wherein one or more methylene groups of C.sub.1-C.sub.6
alkyl can be optionally replaced by --O--, --C(O)--, --SO--,
--SO.sub.2--, or --C(.dbd.S)--; one or more methine groups of the
C.sub.1-C.sub.6 alkyl, when present, can be independently replaced
by
##STR00221##
[0483] R.sub.1 is hydrogen or C.sub.1-C.sub.8 alkyl; and
[0484] optionally R.sub.21 and R.sub.23 taken together can form a
4- to 8-membered carbocyclic or heterocyclic ring.
[0485] Thus, in certain embodiments, the present invention provides
a conjugate of the formula:
##STR00222##
[0486] wherein X.sub.4, p, s, R.sub.12, R.sub.13, R.sub.21,
R.sub.22, R.sub.24, R.sub.25, R.sub.26, R.sub.27, R.sub.28,
R.sub.29, R.sub.30, R.sub.31, R.sub.32, R.sub.33, and R.sub.23 are
as defined above for Formula B.
[0487] In certain embodiments, compounds of the present invention
have a warhead group characterized in that inventive compounds
target the K86 lysine residue of PDPK-1. In certain embodiments,
compounds of the present invention have a warhead group
characterized in that inventive compounds target the K169 lysine
residue of PDPK-1. In certain embodiments, compounds of the present
invention have a warhead group characterized in that inventive
compounds target the K173 lysine residue of PDPK-1.
[0488] In some embodiments, R.sub.wh is characterized in that the
-T-R.sub.wh moiety is capable of covalently binding to a lysine
residue thereby irreversibly inhibiting the enzyme. In certain
embodiments, the lysine residue is K86 lysine residue of PDPK-1, or
a mutant thereof.
[0489] According to another aspect, the present invention provides
a conjugate comprising PDPK-1, or a mutant thereof, covalently
bonded to an inhibitor at K86. In some embodiments, the inhibitor
is covalently bonded via a linker moiety.
[0490] In certain embodiments, the present invention provides a
conjugate of the formula K86-linker-inhibitor moiety. In certain
embodiments, the present invention provides a conjugate of the
formula K169-linker-inhibitor moiety. In certain embodiments, the
present invention provides a conjugate of the formula
K173-linker-inhibitor moiety. One of ordinary skill in the art will
recognize that the "linker" group corresponds to a -T-R.sub.wh as
described herein. Accordingly, in certain embodiments, the linker
group is as defined for -T-R.sub.wh was defined above and described
in classes and subclasses herein. It will be appreciated, however,
that the linker group is bivalent and, therefore, the corresponding
-T-R.sub.wh group is also intended to be bivalent resulting from
the reaction of the warhead with the K86, K169, or K173 of PDPK-1,
or a mutant thereof.
[0491] In certain embodiments for PDPK-1, the inhibitor moiety is a
compound of Formula C:
##STR00223##
wherein
[0492] B.sub.6 and B.sub.7 are each independently CR.sub.7 or
N;
[0493] R.sub.69 is hydrogen, C.sub.1-C.sub.6 alkyl, halogen, amino,
nitro, or --NH(CO)NR.sub.78R.sub.79;
[0494] R.sub.70 is hydrogen, C.sub.1-C.sub.6 alkyl, halogen, amino,
nitro;
[0495] R.sub.7, R.sub.71, R.sub.72, R.sub.73, R.sub.74, R.sub.75,
R.sub.76, R.sub.77, R.sub.78, and R.sub.79 are each independently
hydrogen or C.sub.1-C.sub.6 alkyl;
[0496] R.sub.1 is hydrogen or C.sub.1-C.sub.8 alkyl; wherein one or
more methylene groups of the C.sub.1-C.sub.6 alkyl can be replaced
by --NR.sub.1--, --O--, --C(O)--, --S--, --SO--, --SO.sub.2--, or
--C(.dbd.S)--; one or more methine groups of the C.sub.1-C.sub.6
alkyl, when present, can be independently replaced by
##STR00224##
[0497] optionally R.sub.78, and R.sub.79 taken together form a 4-
to 8-membered carbocyclic or heterocyclic ring; and
[0498] p is an integer from 0 to 4, u is an integer from 1 to
4.
[0499] Thus, in certain embodiments, the present invention provides
a conjugate of the formula:
##STR00225##
[0500] wherein B.sub.6, B.sub.7, R.sub.69, R.sub.70, R.sub.7,
R.sub.71, R.sub.72, R.sub.73, R.sub.74, R.sub.75, R.sub.76,
R.sub.77, R.sub.78, R.sub.79, R.sub.1 and p are as defined above
for Formula C and Kxxx is K86, K169, or K173.
[0501] In some embodiments, Kxxx is K86 of PDPK-1.
[0502] In some embodiments, Kxxx is K169 of PDPK-1.
[0503] In some embodiments, Kxxx is K173 of PDPK-1.
[0504] In certain embodiments for PDPK-1, the inhibitor moiety is a
compound of Formula D:
##STR00226##
[0505] wherein R.sub.v is H, optionally substituted C.sub.1-C.sub.3
branched or straight chain alkyl, or optionally substituted
C.sub.1-C.sub.3 branched or straight chain acyl.
[0506] Thus, in certain embodiments, the present invention provides
a conjugate of the formula:
##STR00227##
[0507] wherein R.sub.v is as defined above for Formula D.
[0508] Thus, in certain embodiments, the present invention provides
a conjugate of the formula:
##STR00228##
[0509] wherein R.sub.v is as defined above for Formula D.
[0510] Thus, in certain embodiments, the present invention provides
a conjugate of the formula:
##STR00229##
[0511] wherein R.sub.v is as defined above for Formula D.
[0512] In certain embodiments, compounds of the present invention
have a warhead group characterized in that inventive compounds
target the K136 lysine residue of HCV protease.
[0513] In some embodiments, R.sub.wh is characterized in that the
-T-R.sub.wh moiety is capable of covalently binding to a lysine
residue thereby irreversibly inhibiting the enzyme. In certain
embodiments, the lysine residue is K136 lysine residue of HCV
protease, or a mutant thereof.
[0514] According to another aspect, the present invention provides
a conjugate comprising HCV protease, or a mutant thereof,
covalently bonded to an inhibitor at K136. In some embodiments, the
inhibitor is covalently bonded via a linker moiety.
[0515] In certain embodiments, the present invention provides a
conjugate of the formula K136-linker-inhibitor moiety. One of
ordinary skill in the art will recognize that the "linker" group
corresponds to a -T-R.sub.wh as described herein. Accordingly, in
certain embodiments, the linker group is as defined for -T-R.sub.wh
was defined above and described in classes and subclasses herein.
It will be appreciated, however, that the linker group is bivalent
and, therefore, the corresponding -T-R.sub.wh group is also
intended to be bivalent resulting from the reaction of the warhead
with the K136 of HCV protease, or a mutant thereof.
[0516] In certain embodiments for HCV protease, the inhibitor
moiety is a compound of E, F, or G:
##STR00230##
wherein
[0517] R.sub.90, R.sub.94, R.sub.95, R.sub.96, R.sub.97, R.sub.98,
R.sub.99, R.sub.100, R.sub.102, R.sub.104, R.sub.105, R.sub.106,
R.sub.107, R.sub.108, R.sub.109, R.sub.110, R.sub.111, R.sub.112,
R.sub.113, and R.sub.114 are each independently hydrogen or
C.sub.1-C.sub.6 alkyl; wherein one or more methylene groups of
C.sub.1-C.sub.6 alkyl can be optionally replaced by --NR.sub.1--,
--O--, --C(O)--, --S--, --SO--, --SO.sub.2--, or --C(.dbd.S)--;
[0518] R.sub.103 is hydrogen, C.sub.1-C.sub.6 alkyl, or
C.sub.2-C.sub.8 alkenyl;
[0519] one or more methine groups of the C.sub.1-C.sub.6 alkyl,
when present, can be independently replaced by
##STR00231##
[0520] R.sub.1 is hydrogen or C.sub.1-C.sub.8 alkyl;
[0521] each R.sub.101 is independently hydrogen, C.sub.1-C.sub.6
alkyl, C.sub.2-C.sub.8 alkenyl, halogen, amino, nitro, optionally
substituted aryl or heteroaryl; n.sub.6 is an integer from 0 to 4;
and n.sub.8 is an integer from 0 to 2.
[0522] Thus, in certain embodiments, the present invention provides
a conjugate of the formula:
##STR00232##
[0523] where R.sub.1, R.sub.90, R.sub.94, R.sub.95, R.sub.96,
R.sub.97, R.sub.98, R.sub.99, R.sub.100, R.sub.101, R.sub.102,
R.sub.103, R.sub.104, R.sub.105, R.sub.106, R.sub.107, R.sub.108,
R.sub.109, R.sub.110, R.sub.111, R.sub.112, R.sub.113, R.sub.114,
n.sub.6, and n.sub.8 are as defined above for Formula E.
[0524] Thus, in certain embodiments, the present invention provides
a conjugate of the formula:
##STR00233##
[0525] where R.sub.1, R.sub.90, R.sub.94, R.sub.95, R.sub.96,
R.sub.97, R.sub.98, R.sub.99, R.sub.100, R.sub.101, R.sub.102,
R.sub.103, R.sub.104, R.sub.105, R.sub.106, R.sub.107, R.sub.108,
R.sub.109, R.sub.110, R.sub.111, R.sub.112, R.sub.113, R.sub.114,
n.sub.6, and n.sub.8 are as defined above for Formula F.
[0526] Thus, in certain embodiments, the present invention provides
a conjugate of the formula:
##STR00234##
[0527] where R.sub.1, R.sub.90, R.sub.94, R.sub.95, R.sub.96,
R.sub.97, R.sub.98, R.sub.99, R.sub.100, R.sub.101, R.sub.102,
R.sub.103, R.sub.104, R.sub.105, R.sub.106, R.sub.107, R.sub.108,
R.sub.109, R.sub.110, R.sub.111, R.sub.112, R.sub.113, R.sub.114,
n.sub.6, and n.sub.8 are as defined above for Formula G.
[0528] In certain embodiments, compounds of the present invention
have a warhead group characterized in that inventive compounds
target the K777 lysine residue of PI3K.beta.. In certain
embodiments, compounds of the present invention have a warhead
group characterized in that inventive compounds target the K802
lysine residue of PI3K.gamma.. In certain embodiments, compounds of
the present invention have a warhead group characterized in that
inventive compounds target the K890 lysine residue of
PI3K.gamma..
[0529] In some embodiments, R.sub.wh is characterized in that the
-T-R.sub.wh moiety is capable of covalently binding to a lysine
residue thereby irreversibly inhibiting the enzyme. In certain
embodiments, the lysine residue is K777 lysine residue of
PI3K.beta., or a mutant thereof.
[0530] According to another aspect, the present invention provides
a conjugate comprising PI3K.beta., or a mutant thereof, covalently
bonded to an inhibitor at K777. In some embodiments, the inhibitor
is covalently bonded via a linker moiety.
[0531] In certain embodiments, the present invention provides a
conjugate of the formula K777-linker-inhibitor moiety. In certain
embodiments, the present invention provides a conjugate of the
formula K802-linker-inhibitor moiety. In certain embodiments, the
present invention provides a conjugate of the formula
K890-linker-inhibitor moiety. One of ordinary skill in the art will
recognize that the "linker" group corresponds to a -T-R.sub.wh as
described herein. Accordingly, in certain embodiments, the linker
group is as defined for -T-R.sub.wh was defined above and described
in classes and subclasses herein. It will be appreciated, however,
that the linker group is bivalent and, therefore, the corresponding
-T-R.sub.wh group is also intended to be bivalent resulting from
the reaction of the warhead with the K777 of PI3K.beta., or from
the reaction of the warhead with the K802 or K890 of PI3K.gamma.,
or a mutant thereof.
[0532] In certain embodiments for PI3K, the inhibitor moiety is a
compound of Formula H, J or K:
##STR00235##
wherein
[0533] n, m, p, and q are each independently 0, 1, 2, 3; provided
that n and q are not 0 at the same time, and m and q are not 0 at
the same time;
[0534] A.sup.2 is an optionally substituted ring selected from a
4-8 membered saturated or partially unsaturated heterocyclic ring
having one or two heteroatoms independently selected from nitrogen,
oxygen, or sulfur, or a 5-10 membered saturated or partially
unsaturated bridged bicyclic heterocyclic ring having at least one
nitrogen, at least one oxygen, and optionally 1-2 additional
heteroatoms independently selected from nitrogen, oxygen, or
sulfur;
[0535] B' is an optionally substituted group selected from phenyl,
an 8- to 10-membered bicyclic aryl ring, a 5- to 6-membered
heteroaryl ring having 1-4 heteroatoms independently selected from
nitrogen, oxygen, or sulfur, or an 8- to 10-membered bicyclic
heteroaryl ring having 1-4 heteroatoms independently selected from
nitrogen, oxygen, or sulfur; or -T-Rwh; and
[0536] C.sup.2 is hydrogen or an optionally substituted ring
selected from a 3- to 7-membered saturated or partially unsaturated
carbocyclic ring, a 7- to 10-membered saturated or partially
unsaturated bicyclic carbocyclic ring, a 4- to 7-membered saturated
or partially unsaturated heterocyclic ring having 1-2 heteroatoms
independently selected from nitrogen, oxygen, or sulfur, a 7- to
10-membered saturated or partially unsaturated bicyclic
heterocyclic ring having 1-3 heteroatoms independently selected
from nitrogen, oxygen, or sulfur, phenyl, an 8- to 10-membered
bicyclic aryl ring, a 5- to 6-membered heteroaryl ring having 1-3
heteroatoms independently selected from nitrogen, oxygen, or
sulfur, or an 8- to 10-membered bicyclic heteroaryl ring having 1-4
heteroatoms independently selected from nitrogen, oxygen, or
sulfur.
[0537] Thus, in certain embodiments, the present invention provides
a conjugate of the formula:
##STR00236##
[0538] wherein m, n, o, p and B' are as defined above for Formula
H, and Kxxx is K777 of PI3K.beta., or K802 or K890 of
PI3K.gamma..
[0539] In some embodiments, Kxxx is K777 of PI3K.beta..
[0540] In some embodiments, Kxxx is K802 of PI3K.gamma..
[0541] In other embodiments, Kxxx is K890 of PI3K.gamma..
[0542] Thus, in certain embodiments, the present invention provides
a conjugate of the formula:
##STR00237##
[0543] wherein B' and A.sub.2 are as defined above for Formula J,
and K.sub.xxx is K777 of PI3K.beta., or K802 or K890 of
PI3K.gamma..
[0544] In some embodiments, Kxxx is K777 of PI3K.beta..
[0545] In some embodiments, Kxxx is K802 of PI3K.gamma..
[0546] In other embodiments, Kxxx is K890 of PI3K.gamma..
[0547] Thus, in certain embodiments, the present invention provides
a conjugate of the formula:
##STR00238##
[0548] wherein A.sub.2 and C.sub.2 are as defined above for Formula
K, and K.sub.xxx is K777 of PI3K.beta., or K802 or K890 of
PI3K.gamma..
[0549] In some embodiments, Kxxx is K777 of PI3K.beta..
[0550] In some embodiments, Kxxx is K802 of PI3K.gamma..
[0551] In other embodiments, Kxxx is K890 of PI3K.gamma..
[0552] In certain embodiments for PI3K, the inhibitor moiety is a
compound of Formula L or M:
##STR00239##
wherein
[0553] R.sub.204 is an hydrogen or an optionally substituted group
selected from C.sub.1-6 aliphatic, --(CH.sub.2).sub.m-(3- to
7-membered saturated or partially unsaturated carbocyclic ring),
--(CH.sub.2).sub.m-(7- to 10-membered saturated or partially
unsaturated bicyclic carbocyclic ring), --(CH.sub.2).sub.m-(4- to
7-membered saturated or partially unsaturated heterocyclic ring
having 1-2 heteroatoms independently selected from nitrogen,
oxygen, or sulfur), --(CH.sub.2).sub.m-(7- to 10-membered saturated
or partially unsaturated bicyclic heterocyclic ring having 1-3
heteroatoms independently selected from nitrogen, oxygen, or
sulfur), --(CH.sub.2).sub.m-phenyl, --(CH.sub.2).sub.m-(8- to
10-membered bicyclic aryl ring), --(CH.sub.2).sub.m-(5- to
6-membered heteroaryl ring having 1-3 heteroatoms independently
selected from nitrogen, oxygen, or sulfur), or
--(CH.sub.2).sub.m-(8- to 10-membered bicyclic heteroaryl ring
having 1-4 heteroatoms independently selected from nitrogen,
oxygen, or sulfur);
[0554] each R.sub.205 and R.sub.206 is independently --R'',
halogen, --NO.sub.2, --CN, --OR'', --SR'', --N(R'').sub.2,
--C(O)R'', --CO.sub.2R'', --C(O)C(O)R'', --C(O)CH.sub.2C(O)R'',
--S(O)R'', --S(O).sub.2R'', --C(O)N(R'').sub.2,
--SO.sub.2N(R'').sub.2, --OC(O)R'', --N(R'')C(O)R'',
--N(R'')N(R'').sub.2, --N(R'')C(.dbd.NR'')N(R'').sub.2,
--C(.dbd.NR'')N(R'').sub.2, --C.dbd.NOR'',
--N(R'')C(O)N(R'').sub.2, --N(R'')SO.sub.2N(R'').sub.2,
--N(R'')SO.sub.2R'', or --OC(O)N(R'').sub.2;
[0555] each R'' is independently hydrogen or an optionally
substituted group selected from C.sub.1-6 aliphatic, a 3- to
7-membered saturated or partially unsaturated carbocyclic ring, a
7- to 10-membered saturated or partially unsaturated bicyclic
carbocyclic ring, a 4- to 7-membered saturated or partially
unsaturated heterocyclic ring having 1-2 heteroatoms independently
selected from nitrogen, oxygen, or sulfur, a 7- to 10-membered
saturated or partially unsaturated bicyclic heterocyclic ring
having 1-3 heteroatoms independently selected from nitrogen,
oxygen, or sulfur, phenyl, an 8- to 10-membered bicyclic aryl ring,
a 5- to 6-membered heteroaryl ring having 1-3 heteroatoms
independently selected from nitrogen, oxygen, or sulfur, or an 8-
to 10-membered bicyclic heteroaryl ring having 1-4 heteroatoms
independently selected from nitrogen, oxygen, or sulfur; or
[0556] two R'' groups on the same nitrogen are taken together with
the nitrogen to which they are attached to form an optionally
substituted 5-8 membered saturated, partially unsaturated, or
aromatic ring having 1-4 heteroatoms independently selected from
nitrogen, oxygen, or sulfur;
[0557] m is an integer from 0 to 6, inclusive;
[0558] each n is independently 0, 1, or 2; and
[0559] Ring A.sup.5 is an optionally substituted 6-membered
heterocyclic or heteroaryl ring having 1-2 nitrogens.
[0560] Thus, in certain embodiments, the present invention provides
a conjugate of the formula:
##STR00240##
[0561] wherein R.sub.204, R.sub.205, R.sub.206, n, and A.sup.5
defined as above for Formula L and K.sub.xxx is K777 of PI3K.beta.,
or K802 or K890 of PI3K.gamma..
[0562] In some embodiments, K.sub.xxx is K777 of PI3K.beta..
[0563] In some embodiments, K.sub.xxx is K802 of PI3K.gamma..
[0564] In other embodiments, K.sub.xxx is K890 of PI3K.gamma..
[0565] Thus, in certain embodiments, the present invention provides
a conjugate of the formula:
##STR00241##
[0566] wherein R.sub.204, R.sub.205, R.sub.206, n, and A.sup.5
defined as above for Formula M and K.sub.xxx is K777 of PI3K.beta.,
or K802 or K890 of PI3K.gamma..
[0567] In some embodiments, Kxxx is K777 of PI3K.beta..
[0568] In some embodiments, Kxxx is K802 of PI3K.gamma..
[0569] In other embodiments, Kxxx is K890 of PI3K.gamma..
[0570] In certain embodiments for PI3K, the inhibitor moiety is a
compound of Formula N:
##STR00242##
wherein:
[0571] R.sub.201 is hydrogen or C.sub.1-6 alkyl;
[0572] R.sub.202 is hydrogen or an optionally substituted group
selected from C.sub.1-6 alkyl, C.sub.1-6 alkoxy, or (C.sub.1-6
alkylene)-R.sub.203; or
[0573] R.sub.201 and R.sub.202 are taken together with the
intervening carbon to form an optionally substituted ring selected
from a 3- to 7-membered carbocyclic ring or a 4- to 7-membered
heterocyclic ring having 1-2 heteroatoms independently selected
from nitrogen, oxygen, or sulfur;
[0574] R.sub.203 is a 3- to 7-membered saturated or partially
unsaturated carbocyclic ring, a 7- to 10-membered saturated or
partially unsaturated bicyclic carbocyclic ring, a 4- to 7-membered
saturated or partially unsaturated heterocyclic ring having 1-2
heteroatoms independently selected from nitrogen, oxygen, or
sulfur, a 7- to 10-membered saturated or partially unsaturated
bicyclic heterocyclic ring having 1-3 heteroatoms independently
selected from nitrogen, oxygen, or sulfur, phenyl, a 8- to
10-membered bicyclic aryl ring, a 5- to 6-membered heteroaryl ring
having 1-3 heteroatoms independently selected from nitrogen,
oxygen, or sulfur, or a 8- to 10-membered bicyclic heteroaryl ring
having 1-4 heteroatoms independently selected from nitrogen,
oxygen, or sulfur; and
[0575] Ring A.sup.6 is absent or an optionally substituted group
selected from a 4- to 7-membered heterocyclic ring having 1-2
heteroatoms independently selected from nitrogen, oxygen, or
sulfur, or a 5- to 6-membered heteroaryl ring having 1-3
heteroatoms independently selected from nitrogen, oxygen, or
sulfur.
[0576] Thus, in certain embodiments, the present invention provides
a conjugate of the formula:
##STR00243##
[0577] wherein R.sub.201, R.sub.202, R.sub.203 and A.sup.6 are as
defined above for Formula N, and Kxxx is K777 of PI3K.beta., or
K802 or K890 of PI3K.gamma..
[0578] In some embodiments, Kxxx is K777 of PI3K.beta..
[0579] In some embodiments, Kxxx is K802 of PI3K.gamma..
[0580] In other embodiments, Kxxx is K890 of PI3K.gamma..
[0581] In certain embodiments for PI3K, the inhibitor moiety is a
compound of Formula O:
##STR00244##
wherein
[0582] each R.sub.205 and R.sub.206 is independently --R'',
halogen, --NO.sub.2, --CN, --OR'', --SR'', --N(R'').sub.2,
--C(O)R'', --CO.sub.2R'', --C(O)C(O)R'', --C(O)CH.sub.2C(O)R'',
--S(O)R'', --S(O).sub.2R'', --C(O)N(R'').sub.2,
--SO.sub.2N(R'').sub.2, --OC(O)R'', --N(R'')C(O)R'',
--N(R'')N(R'').sub.2, --N(R'')C(.dbd.NR'')N(R'').sub.2,
--C(.dbd.NR'')N(R'').sub.2, --C.dbd.NOR'',
--N(R'')C(O)N(R'').sub.2, --N(R'')SO.sub.2N(R'').sub.2,
--N(R'')SO.sub.2R'', or --OC(O)N(R'').sub.2;
[0583] each R'' is independently hydrogen or an optionally
substituted group selected from C.sub.1-6 aliphatic, a 3- to
7-membered saturated or partially unsaturated carbocyclic ring, a
7- to 10-membered saturated or partially unsaturated bicyclic
carbocyclic ring, a 4- to 7-membered saturated or partially
unsaturated heterocyclic ring having 1-2 heteroatoms independently
selected from nitrogen, oxygen, or sulfur, a 7- to 10-membered
saturated or partially unsaturated bicyclic heterocyclic ring
having 1-3 heteroatoms independently selected from nitrogen,
oxygen, or sulfur, phenyl, an 8- to 10-membered bicyclic aryl ring,
a 5- to 6-membered heteroaryl ring having 1-3 heteroatoms
independently selected from nitrogen, oxygen, or sulfur, or an 8-
to 10-membered bicyclic heteroaryl ring having 1-4 heteroatoms
independently selected from nitrogen, oxygen, or sulfur; or
[0584] optionally, two R'' groups on the same nitrogen are taken
together with the nitrogen to which they are attached to form an
optionally substituted 5-8 membered saturated, partially
unsaturated, or aromatic ring having 1-4 heteroatoms independently
selected from nitrogen, oxygen, or sulfur;
[0585] m is an integer from 0 to 6, inclusive;
[0586] each n is independently 0, 1, or 2; and
[0587] Ring A.sup.5 is an optionally substituted 6-membered
heterocyclic or heteroaryl ring having 1-2 nitrogens.
[0588] Thus, in certain embodiments, the present invention provides
a conjugate of the formula:
##STR00245##
[0589] wherein R.sub.205, R.sub.206, n and A.sup.5 are as defined
above for formula O, and Kxxx is K777 of PI3K.beta., or K802 or
K890 of PI3K.gamma..
[0590] In some embodiments, Kxxx is K777 of PI3K.beta..
[0591] In some embodiments, Kxxx is K802 of PI3K.gamma..
[0592] In other embodiments, Kxxx is K890 of PI3K.gamma..
[0593] In certain embodiments for PI3K, the inhibitor moiety is a
compound of Formula P:
##STR00246##
[0594] Thus, in certain embodiments, the present invention provides
a conjugate of the formula:
##STR00247##
[0595] wherein K.sub.xxx is K777 of PI3K.beta., or K802 or K890 of
PI3K.gamma..
[0596] In some embodiments, Kxxx is K777 of PI3K.beta..
[0597] In some embodiments, Kxxx is K802 of PI3K.gamma..
[0598] In other embodiments, Kxxx is K890 of PI3K.gamma..
[0599] As used herein, the term "inhibitor moiety" refers to a
Scaffold group that binds in the active site of a protein. Such
Scaffold groups are well known in the art and include those
described in, for example, but not limited to, Formulae VII, VIII,
IX-a, IX-b, XI, XII, XVI, XVII, XVIII, XIX, XX, XXI, XXII, XXIII,
XXXIV, XXV, XXVI, XXVII, XXVIII, XXIX, XXXVI, and XXXVII.
[0600] One of ordinary skill in the art will recognize that certain
compounds described herein are reversible inhibitors. In certain
embodiments, such compounds are useful as assay comparator
compounds. In some embodiments, such reversible compounds are
useful as inhibitors of the proteins disclosed herein, or a mutants
thereof, and are therefore useful for treating one or more
disorders as described herein. In some embodiments, provided
compounds are reversible counterparts of provided irreversible
inhibitors.
A. Truncation of Pharmacophores
[0601] In some embodiments, when truncating a pharmacophore, the
key elements of the pharmacophore required for non-covalent binding
to the target protein are retained. Whether the key elements of the
pharmacophore are retained for binding is demonstrated when the
non-covalent affinity conferred by the Scaffold is sufficient to
further confer selective binding of the ligand and also covalent
bonding.
[0602] 1. The Pharmacophore is GDC-0941
[0603] Non-limiting examples of Scaffolds derived from the
truncation of a pharmacophore, as described in the present
disclosure, are set forth below in Formulas XXX, XXXI, XXXII,
XXXIII, XXXIV, and XXXV.
[0604] In Formulas XXX, XXXI, and XXXII, the Scaffolds are based on
truncating the pharmacophore GDC-0941:
##STR00248##
[0605] wherein the arrows indicate the possible sites of
truncation.
[0606] One non-limiting example of a truncated form of GDC-0941 is
described by Formula XXX:
##STR00249##
wherein
[0607] R.sub.200 is located at the site of truncation and is
-Tether-R.sub.wh, where Tether and R.sub.wh are as defined for
Formula I; and
[0608] Ring B is an optionally substituted group selected from
phenyl, an 8- to 10-membered bicyclic aryl ring, a 5- to 6-membered
heteroaryl ring having 1-4 heteroatoms independently selected from
nitrogen, oxygen, or sulfur, or an 8- to 10-membered bicyclic
heteroaryl ring having 1-4 heteroatoms independently selected from
nitrogen, oxygen, or sulfur.
[0609] Non-limiting examples of Scaffold of the Formula XXX above
are set forth below:
##STR00250## ##STR00251##
[0610] Another non-limiting example of a Scaffold that has been
truncated as described in the present disclosure is set forth below
in Formula XXXI:
##STR00252##
wherein
[0611] R.sub.200 is located at the site of truncation and is
-Tether-R.sub.WH, where Tether and R.sub.wh are as defined in
Formula I; and
[0612] Ring B is an optionally substituted group selected from
phenyl, an 8- to 10-membered bicyclic aryl ring, a 5- to 6-membered
heteroaryl ring having 1-4 heteroatoms independently selected from
nitrogen, oxygen, or sulfur, or an 8- to 10-membered bicyclic
heteroaryl ring having 1-4 heteroatoms independently selected from
nitrogen, oxygen, or sulfur.
[0613] Non-limiting examples of Scaffolds of the Formula XXXI above
are set forth below:
##STR00253## ##STR00254##
[0614] Another non-limiting example of a Scaffold that has been
truncated as described in the present disclosure is set forth below
in Formula XXXII:
##STR00255##
wherein
[0615] R.sub.200 is at the site of truncation and is
-Tether-R.sub.WH, where Tether and R.sub.wh are as defined above in
the embodiments of Formula I;
[0616] T.sup.2 is a covalent bond or a bivalent straight or
branched, saturated or unsaturated C.sub.1-6 hydrocarbon chain
wherein one or more methylene units of T.sup.2 are optionally
replaced by --O--, --S, --N(R.sub.1)--, --C(O)--, --OC(O)--,
--C(O)O--, --C(O)N(R.sub.1)--, --N(R.sub.1)C(O)--,
--N(R.sub.1)C(O)N(R.sub.1)--, --SO.sub.2--, --SO.sub.2N(R.sub.1)--,
--N(R.sub.1)SO.sub.2--, or --N(R.sub.1)SO.sub.2N(R.sub.1)--;
[0617] C.sup.2 is hydrogen or an optionally substituted ring
selected from a 3- to 7-membered saturated or partially unsaturated
carbocyclic ring, a 7- to 10-membered saturated or partially
unsaturated bicyclic carbocyclic ring, a 4- to 7-membered saturated
or partially unsaturated heterocyclic ring having 1-2 heteroatoms
independently selected from nitrogen, oxygen, or sulfur, a 7- to
10-membered saturated or partially unsaturated bicyclic
heterocyclic ring having 1-3 heteroatoms independently selected
from nitrogen, oxygen, or sulfur, phenyl, an 8- to 10-membered
bicyclic aryl ring, a 5- to 6-membered heteroaryl ring having 1-3
heteroatoms independently selected from nitrogen, oxygen, or
sulfur, or an 8- to 10-membered bicyclic heteroaryl ring having 1-4
heteroatoms independently selected from nitrogen, oxygen, or
sulfur; and
[0618] B' is an optionally substituted group selected from phenyl,
an 8- to 10-membered bicyclic aryl ring, a 5- to 6-membered
heteroaryl ring having 1-4 heteroatoms independently selected from
nitrogen, oxygen, or sulfur, or an 8- to 10-membered bicyclic
heteroaryl ring having 1-4 heteroatoms independently selected from
nitrogen, oxygen, or sulfur.
[0619] Non-limiting examples of Scaffolds of the Formula XXXII
above include:
##STR00256##
[0620] 2. Scaffolds of Formula XXXIII through the Truncation OF
Dihydroimidazoquinazoline:
[0621] In another embodiment, the Scaffolds described by Formula
XXXIII are based on truncating the pharmacophore
dihydroimidazoquinazoline:
##STR00257##
[0622] wherein the arrows indicate the possible sites of
truncation.
[0623] Another non-limiting example of a Scaffold that has been
truncated as described in the present disclosure is set forth below
in Formula XXXIII
##STR00258##
wherein
[0624] R.sub.200 is at the site of truncation and is
-Tether-R.sub.WH, where Tether and R.sub.wh are as defined
previously;
[0625] X.sub.10 is hydrogen, alkoxy, heterocycloalkyl,
heterocycloalkoxy;
[0626] X.sub.11 is an optionally substituted group selected from
phenyl, an 8- to 10-membered bicyclic aryl ring, a 5- to 6-membered
heteroaryl ring having 1-4 heteroatoms independently selected from
nitrogen, oxygen, or sulfur, or an 8- to 10-membered bicyclic
heteroaryl ring having 1-4 heteroatoms independently selected from
nitrogen, oxygen, or sulfur.
[0627] 3. IAP Scaffolds of Formula XXXIV and Formula XXXV through
the Truncation of SM-337 and SM-122
[0628] In another embodiment, the Scaffolds described by Formula
XXXIV and Formula XXXV are based on truncating the pharmacophore
SM-337 and SM-122.
##STR00259##
[0629] wherein the arrows indicate the possible sites of
truncation; and
R** is phenylacetamide.
[0630] Compounds of the truncated form of SM-337 are described by
the formula XXXIV:
##STR00260##
[0631] wherein R** is phenylacetamide and the arrow denotes the
site of attachment for T-R.sub.WH, both of which are as described
herein.
[0632] Compounds of the truncated form of SM-122 are described by
the formula XXXV:
##STR00261##
wherein the arrow denotes the site of attachment of T-R.sub.wh;
where T is Tether; and R.sub.wh is Warhead, both of which are as
defined herein.
[0633] B. Methods of Using
[0634] 1. IAP
[0635] X-linked Inhibitor of Apoptosis Protein (XIAP) is a member
of the inhibitor of apoptosis family of proteins (IAP). Other
family members of IAP include cIAP1, cIAP2 and ML-IAP. IAPs were
initially identified in baculoviruses, but XIAP is one of the
homologous proteins found in mammals. It is so called because it
was first discovered by a 273 base pair site on the X
chromosome.
[0636] Deregulation of XIAP can result in cancer, neurodegenerative
disorders, and autoimmunity. High proportions of XIAP may function
as a tumor marker. In the development of lung cancer NCI-H460, the
overexpression of XIAP not only inhibits caspase, but also stops
the apoptotic activity of cytochrome c (Apoptosis). In developing
prostate cancer, XIAP is one of four IAPs overexpressed in the
prostatic epithelium, indicating that a molecule that inhibits all
IAPs may be necessary for effective treatment.
[0637] Among the diseases and disorders associated with XIAP
deregulation include, but are not limited to, acute myelogenous
leukemia (AML), Addison's disease, adrenoleukodystrophy (ALD),
alcoholism, Alexander's disease, alopecia greata, Alper's disease,
Alzheimer's disease, amyotrophic lateral sclerosis (Lou Gehrig's
Disease), angiitis, ankylosing spondylitis, antiphospholipid
syndrome, ataxia telangiectasia, autism, autoimmune haemolytic
anaemia, autoimmune hepatitis, Batten disease (also known as
Spielmeyer-Vogt-Sjogren-Batten disease), Behcet's syndrome,
Berger's disease, bovine spongiform encephalopathy (BSE), bullous
pemphigoid, Canavan disease, cardiomyopathy, Chagas disease,
chronic fatigue syndrome (CFS, CFIDS), chronic inflammatory
polyneuropathy, chronic obstructive pulmonary disease,
Churg-Strauss syndrome, Cockayne syndrome, coeliac disease,
corticobasal degeneration, CREST syndrome, Creutzfeldt-Jakob
disease, Crohns Disease (one of two types of idiopathic
inflammatory bowel disease or IBD), dermatomyositis, diabetes
mellitus type 1, endometriosis, familial fatal insomnia,
fibromyalgia, giant cell arteritis, frontotemporal lobar
degeneration, Goodpasture's syndrome, Graves' disease,
Guillain-Barre syndrome (GBS), Hashimoto's thyroiditis,
hidradenitis suppurativa, HIV-associated dementia, Huntington's
disease, idiopathic pulmonary fibrosis, idiopathic thrombocytopenia
purpura (ITP), idiopathic thrombocytopenic purpura, IgA
nephropathy, interstitial cystitis, Kawasaki disease, Kennedy's
disease, Krabbe's disease, lactic acidosis and stroke (MELAS), Lewy
body dementia, lichen planus, lung cancer, lupus erythematosus,
Machado-Joseph disease (Spinocerebellar ataxia type 3), malignant
lymphoma, malignant gliomas, Meniere's disease, mitochondrial
encephalopathy, mixed connective tissue disease, morphea, multiple
system atrophy, multiple sclerosis, myasthenia gravis, narcolepsy,
neuroborreliosis, neuromyotonia, Niemann Pick disease, Parkinson's
disease, Pelizaeus-Merzbacher disease, Pemphigus vulgaris
pernicious anaemia, Pick's disease, polyarteritis nodosa,
polymyalgia rheumatica, polymyositis, primary biliary cirrhosis,
primary lateral sclerosis, prion diseases, psoriasis, psoriatic
arthritis, Raynaud's disease, Refsum's disease, Reiter's syndrome,
relapsing polychondritis, progressive supranuclear palsy, rheumatic
fever, rheumatoid arthritis (RA), Sandhoff disease, sarcoidosis,
Schilder's disease, schizophrenia, scleroderma, Sjogren's syndrome,
Spielmeyer-Vogt-Sjogren-Batten disease (also known as Batten
disease), spinal muscular atrophy, spinocerebellar ataxia (multiple
types with varying characteristics), Steele-Richardson-Olszewski
disease, stiff person syndrome, subacute combined degeneration of
spinal cord secondary to pernicious anaemia, Tabes dorsalis,
temporal arteritis (also known as giant cell arteritis), toxic
encephalopathy and X-linked lymphoproliferative disease (XLP),
ulcerative colitis (one of two types of idiopathic inflammatory
bowel disease or IBD), uveitis, vasculitis, vitiligo, and Wegener's
granulomatosis.
[0638] In some embodiments, the invention provides compositions
useful for treating or preventing a proliferative disorder or an
autoimmune disease. The compositions are suitable for internal use
and comprise an effective amount of a IAP inhibitor and a
physiologically acceptable carrier or vehicle, useful for treating
or preventing cancer, neurodegenerative disorders, and
autoimmunity.
[0639] A XIAP inhibitor can be administered in amounts that are
effective to treat or prevent or reduce the severity of a
proliferative disorder in a subject. Proliferative disorders
include, but are not limited to, solid tumor cancers such as
malignant lymphoma, malignant gliomas, X-linked lymphoproliferative
disease (XLP), acute myelogenous leukemia (AML), fibrosarcoma,
myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma,
chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma,
lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's
tumor, Leiomyosarcoma, rhabdomyosarcoma, brain cancer, colon
cancer, colorectal cancer, kidney cancer, liver cancer, pancreatic
cancer, bone cancer, breast cancer, ovarian cancer, prostate
cancer, esophageal cancer, stomach cancer, oral cancer, nasal
cancer, throat cancer, head and neck cancer, squamous cell
carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland
carcinoma, sebaceous gland carcinoma, papillary carcinoma,
papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma,
bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct
carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms'
tumor, cervical cancer, uterine cancer, testicular cancer, small
cell lung carcinoma, bladder carcinoma, lung cancer, cancer of the
central nervous system, epithelial carcinoma, skin cancer,
melanoma, neuroblastoma, and retinoblastoma.
[0640] In some embodiments, the invention provides compositions of
a IAP inhibitor useful for treating or preventing an autoimmune
disease. Autoimmune diseases include, but are not limited to,
autoimmune hematological disorders (e.g. hemolytic anemia, aplastic
anemia, pure red cell anemia and idiopathic thrombocytopenia),
systemic lupus erythematosus, rheumatoid arthritis, polychondritis,
sclerodoma, Wegener granulamatosis, dermatomyositis, chronic active
hepatitis, myasthenia gravis, Steven-Johnson syndrome, idiopathic
sprue, acute pancreatitis, autoimmune inflammatory bowel disease
(e.g. ulcerative colitis and Crohn's disease), endocrine
opthalmopathy, Grave's disease, sarcoidosis, alveolitis, chronic
hypersensitivity pneumonitis, multiple sclerosis, primary biliary
cirrhosis, uveitis (anterior and posterior), keratoconjunctivitis
sicca and vernal keratoconjunctivitis, interstitial lung fibrosis,
psoriatic arthritis and glomerulonephritis (with and without
nephrotic syndrome, e.g. including idiopathic nephrotic syndrome or
minal change nephropathy).
[0641] A XIAP inhibitor can be administered in amounts that are
effective to treat or prevent an autoimmune disease in a subject.
Neurodegenerative disease which can be treated according to the
methods of this invention include, but are not limited to,
Alzheimer's disease, Parkinson's disease, amyotrophic lateral
sclerosis, Huntington's disease, and cerebral ischemia, and
neurodegenerative disease caused by traumatic injury, glutamate
neurotoxicity and hypoxia.
[0642] A cIAP inhibitor can be administered in amounts that are
effective to treat or prevent or reduce the severity of a
proliferative disorder in a subject. Proliferative disorders
include, but are not limited to, mucosa associated lymphoid tissue
lymphoma (MALT lymphoma) which is a subset of non-Hodgkin's
lymphoma, breast cancer, prostate cancer, pancreatic cancer, lung
cancer, ovarian cancer, colon cancer, malignant gliomas, and acute
myelogenous leukemia (AML).
[0643] 2. PI3K.beta./.gamma.
[0644] The phosphatidylinositol 3-kinase ("PI3K.beta./.gamma.")
pathway is a central signaling pathway that exerts its effect on
numerous cellular functions including cell cycle progression,
proliferation, motility, metabolism and survival (Marone, et al.
Biochim. Biophys. Acta (2008) 1784: 159-185). Activation of
receptor tyrosine kinases in the case of Class IA PI3Ks, or
G-proteins in the case of Class IB PI3K.gamma., causes
phosphorylation of phosphatidylinositol-(4,5)-diphosphate,
resulting in membrane-bound
phosphatidylinositol-(3,4,5)-triphosphate. The latter promotes the
transfer of a variety of protein kinases from the cytoplasm to the
plasma membrane by binding of
phosphatidylinositol-(3,4,5)-triphosphate to the
pleckstrin-homology (PH) domain of the kinase.
[0645] Kinases that are downstream targets of PI3K include
phosphatidylinositide-dependent kinase 1 (PI3K) and Akt (also known
as Protein Kinase B or PKB). Phosphorylation of such kinases then
allows for the activation or deactivation of numerous other
pathways, involving mediators such as GSK3, mTOR, PRAS40, FKHD,
NF-.kappa.B, BAD, Caspase-9, and others. These pathways are
involved in many cellular processes, such as cell cycle
progression, cell survival and apoptosis, cell growth,
transcription, translation, metabolism, degranulation, and cell
motility.
[0646] An important negative feedback mechanism for the PI3K
pathway is PTEN, a phosphatase that catalyzes the dephosphorylation
of phosphatidylinositol-(3,4,5)-triphosphate to
phosphatidylinositol-(4,5)-diphosphate. In more than 60% of all
solid tumors, PTEN is mutated into an inactive form, permitting a
constitutive activation of the PI3K pathway. As many cancers are
solid tumors, such an observation provides evidence that a
targeting of PI3K itself or individual downstream kinases in the
PI3K pathway provide a promising approach to mitigate or even
abolish the disregulation in many cancers and thus restore normal
cell function and behavior.
[0647] Diseases and disorders treatable by regulating the function
of PI3K include, but are not limited to, cancer, neurofibromatosis,
ocular angiogenesis, stroke, diabetes, hepatomegaly, cardiovascular
disease, Alzheimer's disease, cystic fibrosis, viral diseases,
autoimmune diseases, atherosclerosis, restenosis, psoriasis,
allergic disorders, inflammation, neurological disorders,
angiogenic disorders, a hormone-related disease, conditions
associated with organ transplantation, immunodeficiency disorders,
destructive bone disorders, proliferative disorders, infectious
diseases, conditions associated with cell death, thrombin-induced
platelet aggregation, chronic myelogenous leukemia (CML), liver
disease, pathologic immune conditions involving T cell activation,
and CNS disorders in a patient. Such proliferative
diseases/disorders include, but are not limited to, solid tumor
cancers such as fibrosarcoma, myxosarcoma, liposarcoma,
chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma,
endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma,
synovioma, mesothelioma, Ewing's tumor, Leiomyosarcoma,
rhabdomyosarcoma, brain cancer, colon cancer, colorectal cancer,
kidney cancer, liver cancer, pancreatic cancer, bone cancer, breast
cancer, ovarian cancer, prostate cancer, esophageal cancer, stomach
cancer, oral cancer, nasal cancer, throat cancer, head and neck
cancer, squamous cell carcinoma, basal cell carcinoma,
adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma,
papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma,
medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma,
hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal
carcinoma, Wilms' tumor, cervical cancer, uterine cancer,
testicular cancer, small cell lung carcinoma, bladder carcinoma,
lung cancer, cancer of the central nervous system, epithelial
carcinoma, skin cancer, melanoma, neuroblastoma, and
retinoblastoma.
[0648] A PI3K inhibitor can be administered in amounts that are
effective to treat or prevent or reduce the severity of a
proliferative disorder in a subject. More specifically, compounds
of the current invention are useful in the treatment of a
proliferative disease selected from a benign or malignant tumor,
carcinoma of the brain, kidney, liver, bile duct, adrenal gland,
bladder, breast, esophagus, stomach, gastric tumors, ovaries,
colon, rectum, prostate, pancreas, lung (including small cell lung
cancer, non-small cell lung cancer and bronchioalveolar cancer),
stomach, vagina, endometrial, uterus, cervix and vulva, testes,
genitourinary tract, larynx, skin, bone or thyroid, sarcoma,
glioblastomas, neuroblastomas, multiple myeloma and lymphomas,
gastrointestinal cancer, especially colon carcinoma or colorectal
adenoma, a tumor of the neck and head, a cancer of the central
nervous system, an epidermal hyperproliferation, psoriasis,
prostate hyperplasia, a neoplasia, a neoplasia of epithelial
character, adenoma, adenocarcinoma, keratoacanthoma, epidermoid
carcinoma, large cell carcinoma, non-small-cell lung carcinoma,
lymphomas, Hodgkins, a mammary carcinoma, follicular carcinoma,
undifferentiated carcinoma, papillary carcinoma, seminoma,
melanoma, or leukemias (including ALL and CML). Other diseases
include Cowden syndrome, Lhermitte-Dudos disease and
Bannayan-Zonana syndrome, or diseases in which the PI3K/PKB pathway
is aberrantly activated.
[0649] A PI3K inhibitor can be administered in amounts that are
effective to treat or prevent or reduce the severity of a
neurodegenerative disease/disorder in a subject. Neurodegenerative
disease which can be treated according to the methods of this
invention include, but are not limited to, Alzheimer's disease,
Parkinson's disease, amyotrophic lateral sclerosis, Huntington's
disease, and cerebral ischemia, and neurodegenerative disease
caused by traumatic injury, glutamate neurotoxicity and
hypoxia.
[0650] A PI3K inhibitor can be administered in amounts that are
effective to treat or prevent an autoimmune disease in a subject.
Autoimmune diseases include, but are not limited to, autoimmune
hematological disorders (e.g. hemolytic anemia, aplastic anemia,
pure red cell anemia and idiopathic thrombocytopenia), systemic
lupus erythematosus, rheumatoid arthritis, polychondritis,
sclerodoma, Wegener granulamatosis, dermatomyositis, chronic active
hepatitis, myasthenia gravis, Steven-Johnson syndrome, idiopathic
sprue, acute pancreatitis, autoimmune inflammatory bowel disease
(e.g. ulcerative colitis and Crohn's disease), endocrine
opthalmopathy, Grave's disease, sarcoidosis, alveolitis, chronic
hypersensitivity pneumonitis, multiple sclerosis, primary biliary
cirrhosis, uveitis (anterior and posterior), keratoconjunctivitis
sicca and vernal keratoconjunctivitis, interstitial lung fibrosis,
psoriatic arthritis and glomerulonephritis (with and without
nephrotic syndrome, e.g. including idiopathic nephrotic syndrome or
minal change nephropathy).
[0651] In certain embodiments, the present invention provides a
method of using the disclosed compounds to prevent, treat, or
reduce the severity of neurofibromatosis type I (NF1),
neurofibromatosis type II (NF2) Schwann cell neoplasms (e.g.
MPNST's), or Schwannomas.
[0652] Furthermore, compounds disclosed herein are useful to
prevent, treat, or reduce the severity of inflammatory or
obstructive airways diseases associated with PI3K. Inflammatory or
obstructive airways diseases to which the present invention is
applicable include asthma of whatever type or genesis including
both intrinsic (non-allergic) asthma and extrinsic (allergic)
asthma, mild asthma, moderate asthma, severe asthma, bronchitic
asthma, exercise-induced asthma, occupational asthma and asthma
induced following bacterial infection. Treatment of asthma is also
to be understood as embracing treatment of subjects, e.g. of less
than 4 or 5 years of age, exhibiting wheezing symptoms and
diagnosed or diagnosable as "wheezy infants", an established
patient category of major medical concern and now often identified
as incipient or early-phase asthmatics.
[0653] Prophylactic efficacy in the treatment of asthma will be
evidenced by reduced frequency or severity of symptomatic attack,
e.g. of acute asthmatic or bronchoconstrictor attack, improvement
in lung function or improved airways hyperreactivity. It may
further be evidenced by reduced requirement for other, symptomatic
therapy, such as therapy for or intended to restrict or abort
symptomatic attack when it occurs, for example antiinflammatory or
bronchodilatory. Prophylactic benefit in asthma may in particular
be apparent in subjects prone to "morning dipping." "Morning
dipping" is a recognized asthmatic syndrome, common to a
substantial percentage of asthmatics and characterised by asthma
attack, e.g. between the hours of about 4 to 6 am, i.e. at a time
normally substantially distant form any previously administered
symptomatic asthma therapy.
[0654] In yet another embodiment, compounds of the current
invention can be used to prevent, treat, or reduce the severity of
other inflammatory or obstructive airways diseases and conditions
associated with PI3K including, but not limited to, acute lung
injury (ALI), adult/acute respiratory distress syndrome (ARDS),
chronic obstructive pulmonary, airways or lung disease (COPD, COAD
or COLD), including chronic bronchitis or dyspnea associated
therewith, emphysema, as well as exacerbation of airways
hyperreactivity consequent to other drug therapy, in particular
other inhaled drug therapy. The invention is also applicable to the
treatment of bronchitis of whatever type or genesis including, but
not limited to, acute, arachidic, catarrhal, croupus, chronic or
phthinoid bronchitis. Further inflammatory or obstructive airways
diseases to which the present invention is applicable include
pneumoconiosis (an inflammatory, commonly occupational, disease of
the lungs, frequently accompanied by airways obstruction, whether
chronic or acute, and occasioned by repeated inhalation of dusts)
of whatever type or genesis, including, for example, aluminosis,
anthracosis, asbestosis, chalicosis, ptilosis, siderosis,
silicosis, tabacosis and byssinosis.
[0655] With regard to their anti-inflammatory activity, in
particular in relation to inhibition of eosinophil activation, the
methods disclosed herein may be used to treat eosinophil related
disorders associated with PI3K, e.g. eosinsophilia, in particular
eosinophil related disorders of the airways (e.g. involving morbid
eosinophilic infiltration of pulmonary tissues) including
hypereosinophilia as it effects the airways and/or lungs as well
as, for example, eosinophil-related disorders of the airways
consequential or concomitant to Loffler's syndrome, eosinophilic
pneumonia, parasitic (in particular metazoan) infestation
(including tropical eosinophilia), bronchopulmonary aspergillosis,
polyarteritis nodosa (including Churg-Strauss syndrome),
eosinophilic granuloma and eosinophil-related disorders affecting
the airways occasioned by drug-reaction.
[0656] As PI3K has been implicated in inflammatory and allergies,
the methods disclosed herein are also useful to prevent, treat, or
reduce the severity of psoriasis, contact dermatitis, atopic
dermatitis, alopecia greata, erythema multiforma, dermatitis
herpetiformis, scleroderma, vitiligo, hypersensitivity angiitis,
urticaria, bullous pemphigoid, systemic lupus erythematosus,
pemphisus, epidermolysis bullosa acquisita, and other inflammatory
or allergic conditions of the skin.
[0657] Furthermore, diseases or conditions having an inflammatory
component caused by aberrant PI3K may also be prevented, treated,
or used to reduce the severity by the methods disclosed herein.
These diseases and disorders include, but are not limited to,
diseases and conditions of the eye such as conjunctivitis,
keratoconjunctivitis sicca, and vernal conjunctivitis, diseases
affecting the nose including allergic rhinitis, and inflammatory
disease in which autoimmune reactions are implicated or having an
autoimmune component or etiology, including autoimmune
hematological disorders (e.g. hemolytic anemia, aplastic anemia,
pure red cell anemia and idiopathic thrombocytopenia), systemic
lupus erythematosus, rheumatoid arthritis, polychondritis,
sclerodoma, Wegener granulamatosis, dermatomyositis, chronic active
hepatitis, myasthenia gravis, Steven-Johnson syndrome, idiopathic
sprue, acute pancreatitis, autoimmune inflammatory bowel disease
(e.g. ulcerative colitis and Crohn's disease), endocrine
opthalmopathy, Grave's disease, sarcoidosis, alveolitis, chronic
hypersensitivity pneumonitis, multiple sclerosis, primary biliary
cirrhosis, uveitis (anterior and posterior), keratoconjunctivitis
sicca and vernal keratoconjunctivitis, interstitial lung fibrosis,
psoriatic arthritis and glomerulonephritis (with and without
nephrotic syndrome, e.g. including idiopathic nephrotic syndrome or
minal change nephropathy).
[0658] Cardiovascular diseases which can be prevent, treated, or
used to reduce the severity according to the methods of this
invention include, but are not limited to, restenosis,
cardiomegaly, atherosclerosis, myocardial infarction, ischemic
stroke and congestive heart failure.
[0659] In one embodiment, the invention provides compositions
useful for treating or preventing cancer, neurofibromatosis, ocular
angiogenesis, stroke, diabetes, hepatomegaly, cardiovascular
disease, Alzheimer's disease, cystic fibrosis, viral diseases,
autoimmune diseases, atherosclerosis, restenosis, psoriasis,
allergic disorders, inflammation, neurological disorders,
angiogenic disorders, a hormone-related disease, conditions
associated with organ transplantation, immunodeficiency disorders,
destructive bone disorders, proliferative disorders, infectious
diseases, conditions associated with cell death, thrombin-induced
platelet aggregation, chronic myelogenous leukemia (CML), liver
disease, pathologic immune conditions involving T cell activation,
and CNS disorders in a patient.
[0660] Because PI3K is pro-angiogenic (Graupera et al. Nature
(2008) 453(7195):662-6), the methods of the present invention may
be advantageous for inhibiting angiogenesis, for example, to treat
eye disease associated with ocular angiogenesis, such as by topical
administration of the subject compounds. Compounds according to the
invention can be formulated for topical administration. For
example, the irreversible inhibitor can be formulated for topical
delivery to the lung (e.g., as an aerosol, such as a dry powder or
liquid formulation) to treat asthma, as a cream, ointment, lotion
or the like for topical application to the skin to treat psoriasis,
or as an ocular formulation for topical application to the eye to
treat an ocular disease. Such a formulation will contain a subject
inhibitor and a pharmaceutically acceptable carrier. Additional
components, such as preservatives, and agents to increase viscosity
of the formulation such as natural or synthetic polymers may also
be present. The ocular formulation can be in any suitable form,
such as a liquid, an ointment, a hydrogel or a powder. Compounds of
the current invention can be administered together with another
therapeutic agent, such as an anti-VEGF agent, for example
ranibizumab a Fab fragment of an antibody that binds VEGFA, or
another anti-angiogenic compound as described further below.
[0661] 3. PDPK1
[0662] 3-Phosphoinositide-dependent kinase 1 (PDPK1) phosphorylates
the activation loop of a number of protein serine/threonine kinases
of the AGC kinase superfamily, including protein kinase B (PKB;
also called Akt), serum and glucocorticoid-induced kinase, protein
kinase C isoforms, and the p70 ribosomal S6 kinase. The
phosphoinositide 3-kinase/3-phosphoinositide-dependent kinase 1
(PDPK1)/Akt signaling pathway plays a key role in cancer cell
growth, survival, and tumor angiogenesis and represents a promising
target for anti-cancer drugs.
[0663] A proliferative disorder can be prevented, treated, or
reduce the severity of by administration of an effective amount of
a PDPK1 inhibitor to a subject in need thereof. Proliferative
disorders that can be prevented, treated, or reduce the severity of
by administering an effective amount of a PDPK1 inhibitor include,
but are not limited to, cancer, uterine fibroids, benign prostatic
hyperplasia, familial adenomatosis polyposis, neuro-fibromatosis,
atherosclerosis, pulmonary fibrosis, arthritis, psoriasis,
glomerulonephritis, restenosis following angioplasty or vascular
surgery, hypertrophic scar formation, an inflammatory bowel
disease, transplantation rejection, endotoxic shock, a fungal
infection, a defective apoptosis-associated condition, or a
proliferative disease that is dependent on PDPK1 activity.
[0664] Because PDPK1 is a downstream target of PI3K, diseases and
disorders that are regulated by PI3K are also implicated in
aberrant PDPK1 function. Accordingly diseases treatable by
regulating PDPK1 activity include, but are not limited to, cancer,
neurofibromatosis, ocular angiogenesis, stroke, diabetes,
hepatomegaly, cardiovascular disease, Alzheimer's disease, cystic
fibrosis, viral diseases, autoimmune diseases, atherosclerosis,
restenosis, psoriasis, allergic disorders, inflammation,
neurological disorders, angiogenic disorders, a hormone-related
disease, conditions associated with organ transplantation,
immunodeficiency disorders, destructive bone disorders,
proliferative disorders, infectious diseases, conditions associated
with cell death, thrombin-induced platelet aggregation, chronic
myelogenous leukemia (CML), liver disease, pathologic immune
conditions involving T cell activation, and CNS disorders in a
patient. Such proliferative diseases/disorders include, but are not
limited to, solid tumor cancers such as fibrosarcoma, myxosarcoma,
liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma,
angiosarcoma, endotheliosarcoma, lymphangiosarcoma,
lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's
tumor, Leiomyosarcoma, rhabdomyosarcoma, brain cancer, colon
cancer, colorectal cancer, kidney cancer, liver cancer, pancreatic
cancer, bone cancer, breast cancer, ovarian cancer, prostate
cancer, esophageal cancer, stomach cancer, oral cancer, nasal
cancer, throat cancer, head and neck cancer, squamous cell
carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland
carcinoma, sebaceous gland carcinoma, papillary carcinoma,
papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma,
bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct
carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms'
tumor, cervical cancer, uterine cancer, testicular cancer, small
cell lung carcinoma, bladder carcinoma, lung cancer, cancer of the
central nervous system, epithelial carcinoma, skin cancer,
melanoma, neuroblastoma, and retinoblastoma.
[0665] A PDPK1 inhibitor can be administered in amounts that are
effective to treat or prevent or reduce the severity of a
proliferative disorder in a subject. More specifically, compounds
of the current invention are useful in the treatment of a
proliferative disease selected from a benign or malignant tumor,
carcinoma of the brain, kidney, liver, bile duct, adrenal gland,
bladder, breast, esophagus, stomach, gastric tumors, ovaries,
colon, rectum, prostate, pancreas, lung (including small cell lung
cancer, non-small cell lung cancer and bronchioalveolar cancer),
stomach, vagina, endometrial, uterus, cervix and vulva, testes,
genitourinary tract, larynx, skin, bone or thyroid, sarcoma,
glioblastomas, neuroblastomas, multiple myeloma and lymphomas,
gastrointestinal cancer, especially colon carcinoma or colorectal
adenoma, a tumor of the neck and head, a cancer of the central
nervous system, an epidermal hyperproliferation, psoriasis,
prostate hyperplasia, a neoplasia, a neoplasia of epithelial
character, adenoma, adenocarcinoma, keratoacanthoma, epidermoid
carcinoma, large cell carcinoma, non-small-cell lung carcinoma,
lymphomas, Hodgkins, a mammary carcinoma, follicular carcinoma,
undifferentiated carcinoma, papillary carcinoma, seminoma,
melanoma, or leukemias (including ALL and CML). Other diseases
include Cowden syndrome, Lhermitte-Dudos disease and
Bannayan-Zonana syndrome, or diseases in which the PI3K/PKB pathway
is aberrantly activated.
[0666] A PDPK1 inhibitor can be administered in amounts that are
effective to treat or prevent or reduce the severity of a
neurodegenerative disease/disorder in a subject. Neurodegenerative
disease which can be treated according to the methods of this
invention include, but are not limited to, Alzheimer's disease,
Parkinson's disease, amyotrophic lateral sclerosis, Huntington's
disease, and cerebral ischemia, and neurodegenerative disease
caused by traumatic injury, glutamate neurotoxicity and
hypoxia.
[0667] A PDPK1 inhibitor can be administered in amounts that are
effective to treat or prevent an autoimmune disease in a subject.
Autoimmune diseases include, but are not limited to, autoimmune
hematological disorders (e.g. hemolytic anemia, aplastic anemia,
pure red cell anemia and idiopathic thrombocytopenia), systemic
lupus erythematosus, rheumatoid arthritis, polychondritis,
sclerodoma, Wegener granulamatosis, dermatomyositis, chronic active
hepatitis, myasthenia gravis, Steven-Johnson syndrome, idiopathic
sprue, acute pancreatitis, autoimmune inflammatory bowel disease
(e.g. ulcerative colitis and Crohn's disease), endocrine
opthalmopathy, Grave's disease, sarcoidosis, alveolitis, chronic
hypersensitivity pneumonitis, multiple sclerosis, primary biliary
cirrhosis, uveitis (anterior and posterior), keratoconjunctivitis
sicca and vernal keratoconjunctivitis, interstitial lung fibrosis,
psoriatic arthritis and glomerulonephritis (with and without
nephrotic syndrome, e.g. including idiopathic nephrotic syndrome or
minal change nephropathy).
[0668] Blood-borne cancers implicated in aberrant PDPK1 expression
include, but are not limited to, acute lymphoblastic leukemia,
acute lymphoblastic B-cell leukemia, acute lymphoblastic T-cell
leukemia, acute myeloblastic leukemia, acute promyelocytic
leukemia, acute monoblastic leukemia, acute erythroleukemic
leukemia, acute megakaryoblastic leukemia, acute myelomonocytic
leukemia, acute nonlymphocyctic leukemia, acute undifferentiated
leukemia, chronic myelocytic leukemia ("CML"), chronic lymphocytic
leukemia ("CLL"), hairy cell leukemia, and myeloma.
[0669] Lymphomas where PDPK1 is implicated include, but are not
limited to, Hodgkin's disease, non-Hodgkin's lymphomas, multiple
myeloma, Waldenstrom's macroglobulinemia, heavy chain disease, and
polycythemia vera.
[0670] CNS and brain cancers where aberrant PDPK1 expression
include, but not limited to, glioma, pilocytic astrocytoma,
astrocytoma, anaplastic astrocytoma, glioblastoma multiforme,
medulloblastoma, craniopharyngioma, ependymoma, pinealoma,
hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma,
vestibular schwannoma, adenoma, metastatic brain tumor, and
meningioma.
[0671] Virally-mediated cancers have also been implicated in
overexpression of PDPK1. Such viruses include human papilloma
virus, which can lead to cervical cancer (see, e.g.,
Hernandez-Avila et al., Archives of Medical Research (1997)
28:265-271); Epstein-Barr virus (EBV), which can lead to lymphoma
(see, e.g., Herrmann et al., J Pathol (2003) 199(2):140-5);
hepatitis B or C virus, which can lead to liver carcinoma (see,
e.g., El-Serag, J Clin Gastroenterol (2002) 35(5 Suppl 2):572-8);
human T cell leukemia virus (HTLV)-I, which can lead to T-cell
leukemia (see e.g., Mortreux et al., Leukemia (2003) 17(1):26-38);
human herpesvirus-8 infection, which can lead to Kaposi's sarcoma
(see, e.g., Kadow et al., Curr Opin Investig Drugs (2002) 3(11):
1574-9); and Human Immune deficiency Virus (HIV) infection, which
can lead to cancer as a consequence of immunodeficiency (see, e.g.,
Dal Maso et al., Lancet Oncol (2003) 4(2):110-9).
[0672] The invention provides methods for treating or preventing
these aforementioned cancers, disorders and diseases, comprising
administering to a subject in need of such treatment or prevention
an effective amount of a PDPK1 inhibitor.
[0673] 4. HCV
[0674] HCV is a positive-stranded RNA virus whose genome encodes a
polyprotein of approximately 3000 amino acids. This precursor
protein is processed into at least 10 viral structural and
nonstructural proteins: C, E1, E2, p7, NS2, NS3, NS4A, NS4B, NS5A,
and NS5B (Blight, K. J., et al., Antiviral Ther. 3, Suppl. 3:
71-81, 1998). HCV nonstructural (NS) proteins are derived by
proteolytic cleavage of the polyprotein and are presumed to provide
the essential catalytic machinery for viral replication.
[0675] NS3 is an approximately 68 Kda protein, and has both an
N-terminal serine protease domain and an RNA-dependent ATPase
domain at its C-terminus. It has been shown that the NS4A protein
serves as a co-factor for the serine protease activity of NS3. NS3
functions as a proteolytic enzyme that cleaves sites liberating
other nonstructural proteins necessary for HCV replication and is a
validated therapeutic target for antiviral chemotherapy.
[0676] No vaccines are available for HCV, and the established
therapy of interferon treatment is effective in only 15-20% of
patients (Weiland, O., FEMS Microbiol. Rev. 14: 279-88, 1994), and
has significant side effects (Walker, M. A., et al., DDT 4: 518-29,
1999; Moradpour, D., et al., Eur. J. Gastroenterol. Hepatol. 11:
1199-1202, 1999). While the current standard of care, pegylated
interferon .alpha. in combination with ribavirin, is more
efficacious and appears to decrease hepatocellular carcinoma in
patients with HCV-related cirrhosis (Hung, C. H., et al., J Viral
Hepatitis 13(6): 409-414, 2006), this treatment has also been shown
to produce side effects such as thyroid dysfunction (Huang, J. F.,
et al., J Viral Hepatitis 13(6): 396-401, 2006).
[0677] Symptoms of HCV infection can either be acute or chronic.
Acute symptoms include decreased appetite, fatigue, abdominal pain,
jaundice, itching, and flu-like symptoms. Most patients diagnosed
with HCV infection with acute symptoms eventually develop chronic
symptoms, which include fatigue, flu-like symptoms, joint pains,
itching, sleep disturbances, appetite changes, nausea, and
depression. Chronic HCV infection eventually leads to liver
inflammation, fibrosis, and eventually cirrhosis all of which lead
to decreased liver function and eventually liver failure. Chronic
hepatitis C can also be associated with extrahepatic manifestations
associated with the presence of HCV such as porphyria cutanea
tarda, cryoglobulinemia (a form of small-vessel vasculitis) and
glomerulonephritis (inflammation of the kidney), specifically
membranoproliferative glomerulonephritis (MPGN).
[0678] In one embodiment, the invention provides compositions
useful for treating or preventing a an HCV infection. The
compositions are suitable for internal use and comprise an
effective amount of a HCV inhibitor and a physiologically
acceptable carrier or vehicle.
[0679] A HCV inhibitor can be administered in amounts that are
effective to treat or prevent or reduce the severity of an HCV
infection in a subject.
[0680] Depending upon the particular condition, or disease, to be
treated, additional therapeutic agents, which are normally
administered to treat that condition, may be administered in
combination with compounds and compositions of this invention. As
used herein, additional therapeutic agents that are normally
administered to treat a particular disease, or condition, are known
as "appropriate for the disease, or condition, being treated".
[0681] In certain embodiments, a provided compound, or composition
thereof, is administered in combination with another inhibitor of
HCV protease, or a variant thereof. In some embodiments, a provided
compound, or composition thereof, is administered in combination
with another antiviral agent. Such antiviral agents include, but
are not limited to, immunomodulatory agents, such as .alpha.-,
.beta.-, and .gamma.-interferons, pegylated derivatized
interferon-.alpha. compounds, and thymosin; other anti-viral
agents, such as ribavirin, amantadine, and telbivudine; other
inhibitors of hepatitis C proteases (NS2-NS3 inhibitors and
NS3-NS4A inhibitors, e.g. BILN 2061 and VX-950); inhibitors of
other targets in the HCV life cycle, including helicase and
polymerase inhibitors; inhibitors of internal ribosome entry;
broad-spectrum viral inhibitors, such as IMPDH inhibitors (e.g.,
mycophenolic acid and derivatives thereof); or combinations of any
of the above.
[0682] In certain embodiments, a combination of 2 or more antiviral
agents may be administered. In certain embodiments, a combination
of 3 or more antiviral agents may be administered. In some
embodiments, the antiviral agents are selected from ribavirin or
interferon. In other embodiments, the antiviral agent is
.alpha.-interferon.
[0683] Other examples of agents the inhibitors of this invention
may also be combined with include, without limitation: treatments
for Alzheimer's Disease such as Aricept.RTM. and Excelon.RTM.;
treatments for HIV such as ritonavir; treatments for Parkinson's
Disease such as L-DOPA/carbidopa, entacapone, ropinrole,
pramipexole, bromocriptine, pergolide, trihexephendyl, and
amantadine; agents for treating Multiple Sclerosis (MS) such as
beta interferon (e.g., Avonex.RTM. and Rebif.RTM.), Copaxone.RTM.,
and mitoxantrone; treatments for asthma such as albuterol and
Singulair.RTM.; agents for treating schizophrenia such as zyprexa,
risperdal, seroquel, and haloperidol; anti-inflammatory agents such
as corticosteroids, TNF blockers, IL-1 RA, azathioprine,
cyclophosphamide, and sulfasalazine; immunomodulatory and
immunosuppressive agents such as cyclosporin, tacrolimus,
rapamycin, mycophenolate mofetil, interferons, corticosteroids,
cyclophophamide, azathioprine, and sulfasalazine; neurotrophic
factors such as acetylcholinesterase inhibitors, MAO inhibitors,
interferons, anti-convulsants, ion channel blockers, riluzole, and
anti-Parkinsonian agents; agents for treating cardiovascular
disease such as beta-blockers, ACE inhibitors, diuretics, nitrates,
calcium channel blockers, and statins; agents for treating liver
disease such as corticosteroids, cholestyramine, interferons, and
anti-viral agents; agents for treating blood disorders such as
corticosteroids, anti-leukemic agents, and growth factors; agents
that prolong or improve pharmacokinetics such as cytochrome P450
inhibitors (i.e., inhibitors of metabolic breakdown) and CYP3A4
inhibitors (e.g., ketokenozole and ritonavir), and agents for
treating immunodeficiency disorders such as gamma globulin.
[0684] In certain embodiments, compounds of the present invention,
or a pharmaceutically acceptable composition thereof, are
administered in combination with a monoclonal antibody or an siRNA
therapeutic.
[0685] Those additional agents may be administered separately from
an inventive compound-containing composition, as part of a multiple
dosage regimen. Alternatively, those agents may be part of a single
dosage form, mixed together with a compound of this invention in a
single composition. If administered as part of a multiple dosage
regime, the two active agents may be submitted simultaneously,
sequentially or within a period of time from one another normally
within five hours from one another.
[0686] 5. Dosage
[0687] The methods of the present invention may be used to prevent,
treat, or reduce the severity of cancer, an autoimmune disorder, a
neurodegenerative or neurological disorder, schizophrenia, a
bone-related disorder, liver disease, or a cardiac disorder. The
exact amount required will vary from subject to subject, depending
on the species, age, and general condition of the subject, the
severity of the infection, the particular agent, its mode of
administration, and the like. The compounds of the invention are
preferably formulated in dosage unit form for ease of
administration and uniformity of dosage. The expression "dosage
unit form" as used herein refers to a physically discrete unit of
agent appropriate for the patient to be treated. It will be
understood, however, that the total daily usage of the compounds
and compositions of the present invention will be decided by the
attending physician within the scope of sound medical judgment. The
specific effective dose level for any particular patient or
organism will depend upon a variety of factors including the
disorder being treated and the severity of the disorder; the
activity of the specific compound employed; the specific
composition employed; the age, body weight, general health, sex and
diet of the patient; the time of administration, route of
administration, and rate of excretion of the specific compound
employed; the duration of the treatment; drugs used in combination
or coincidental with the specific compound employed, and like
factors well known in the medical arts. The term "patient", as used
herein, means an animal, preferably a mammal, and most preferably a
human.
[0688] Administration of an inhibitor or pharmaceutically active
agent described herein can be accomplished via any mode of
administration for therapeutic agents. These modes include systemic
or local administration such as oral, nasal, parenteral,
transdermal, subcutaneous, vaginal, buccal, rectal or topical
administration modes. In some instances, administration will result
in the release of the inhibitor or pharmaceutically active agent
described herein into the bloodstream.
[0689] In one embodiment, the inhibitor or pharmaceutically active
agent described herein is administered orally.
[0690] Depending on the intended mode of administration, the
compositions can be in solid, semi-solid or liquid dosage form,
such as, for example, injectables, tablets, suppositories, pills,
time-release capsules, elixirs, tinctures, emulsions, syrups,
powders, liquids, suspensions, or the like, preferably in unit
dosages and consistent with conventional pharmaceutical practices.
Likewise, they can also be administered in intravenous (both bolus
and infusion), intraperitoneal, subcutaneous or intramuscular form,
all using forms well known to those skilled in the pharmaceutical
arts.
[0691] Liquid dosage forms for oral administration include, but are
not limited to, pharmaceutically acceptable emulsions,
microemulsions, solutions, suspensions, syrups and elixirs. In
addition to the active compounds, the liquid dosage forms may
contain inert diluents commonly used in the art such as, for
example, water or other solvents, solubilizing agents and
emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl
carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate,
propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (in
particular, cottonseed, groundnut, corn, germ, olive, castor, and
sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene
glycols and fatty acid esters of sorbitan, and mixtures thereof.
Besides inert diluents, the oral compositions can also include
adjuvants such as wetting agents, emulsifying and suspending
agents, sweetening, flavoring, and perfuming agents.
[0692] Injectable preparations, for example, sterile injectable
aqueous or oleaginous suspensions may be formulated according to
the known art using dissolution or suitable dispersing or wetting
agents and suspending agents. The sterile injectable preparation
may also be a sterile injectable solution, suspension or emulsion
in a nontoxic parenterally acceptable diluent or solvent, for
example, as a solution in 1,3-butanediol. Among the acceptable
vehicles and solvents that may be employed are water, aqueous
dextrose, glycerol, ethanol, Ringer's solution, U.S.P. and isotonic
sodium chloride solution. In addition, sterile, fixed oils are
conventionally employed as a solvent or suspending medium. For this
purpose any bland fixed oil can be employed including synthetic
mono- or diglycerides. In addition, fatty acids such as oleic acid
are used in the preparation of injectables.
[0693] The injectable formulations can be sterilized, for example,
by filtration through a bacterial-retaining filter, or by
incorporating sterilizing agents in the form of sterile solid
compositions which can be dissolved or dispersed in sterile water
or other sterile injectable medium prior to use.
[0694] In order to prolong the effect of a compound of the present
invention, it is often desirable to slow the absorption of the
compound from subcutaneous or intramuscular injection. This may be
accomplished by the use of a liquid suspension of crystalline or
amorphous material with poor water solubility. The rate of
absorption of the compound then depends upon its rate of
dissolution that, in turn, may depend upon crystal size and
crystalline form. Alternatively, delayed absorption of a
parenterally administered compound form is accomplished by
dissolving or suspending the compound in an oil vehicle. Injectable
depot forms are made by forming microencapsule matrices of the
compound in biodegradable polymers such as
polylactide-polyglycolide. Depending upon the ratio of compound to
polymer and the nature of the particular polymer employed, the rate
of compound release can be controlled. Examples of other
biodegradable polymers include poly(orthoesters) and
poly(anhydrides). Depot injectable formulations are also prepared
by entrapping the compound in liposomes or microemulsions that are
compatible with body tissues.
[0695] Compositions of the inhibitor or pharmaceutically active
agent described herein for rectal or vaginal administration are
preferably suppositories which can be prepared by mixing the
compounds of this invention with suitable non-irritating excipients
or carriers such as cocoa butter, polyethylene glycol or a
suppository wax which are solid at ambient temperature but liquid
at body temperature and therefore melt in the rectum or vaginal
cavity and release the active compound.
[0696] Solid dosage forms for oral administration include capsules,
tablets, pills, powders, and granules. In such solid dosage forms,
the active compound is mixed with at least one inert,
pharmaceutically acceptable excipient or carrier such as sodium
citrate or dicalcium phosphate and/or a) fillers or extenders or
diluents such as starches, lactose, sucrose, glucose, mannitol,
cellulose, saccharin, glycine, and silicic acid, b) binders such
as, for example, magnesium aluminum silicate, starch paste,
tragacanth, carboxymethylcellulose, methyl cellulose, alginates,
gelatin, polyvinylpyrrolidinone, magnesium carbonate, natural
sugars, corn sweeteners, sucrose, waxes and natural or synthetic
gums such as acacia, c) humectants such as glycerol, d)
disintegrating agents such as agar-agar, calcium carbonate, potato
or tapioca starch, alginic acid, certain silicates, and sodium
carbonate, e) solution retarding agents such as paraffin, f)
absorption accelerators or disintegrants such as quaternary
ammonium compounds, starches, agar, methyl cellulose, bentonite,
xanthangum, algiic acid, and effervescent mixtures, g) wetting
agents such as, for example, cetyl alcohol and glycerol
monostearate, h) absorbents such as kaolin and bentonite clay, and
i) lubricants such as talc, silica, stearic acid, calcium stearate,
magnesium stearate, sodium oleate, sodium acetate, sodium chloride,
solid polyethylene glycols, sodium lauryl sulfate, and mixtures
thereof. In the case of capsules, tablets and pills, the dosage
form may also comprise buffering agents.
[0697] Solid compositions of a similar type may also be employed as
fillers in soft and hard-filled gelatin capsules using such
excipients as lactose or milk sugar as well as high molecular
weight polyethylene glycols and the like. The solid dosage forms of
tablets, dragees, capsules, pills, and granules can be prepared
with coatings and shells such as enteric coatings and other
coatings well known in the pharmaceutical formulating art. They may
optionally contain opacifying agents and can also be of a
composition that they release the active ingredient(s) only, or
preferentially, in a certain part of the intestinal tract,
optionally, in a delayed manner. Examples of embedding compositions
that can be used include polymeric substances and waxes. Solid
compositions of a similar type may also be employed as fillers in
soft and hard-filled gelatin capsules using such excipients as
lactose or milk sugar as well as high molecular weight polethylene
glycols and the like.
[0698] The active compounds can also be in micro-encapsulated form
with one or more excipients as noted above. The solid dosage forms
of tablets, dragees, capsules, pills, and granules can be prepared
with coatings and shells such as enteric coatings, release
controlling coatings and other coatings well known in the
pharmaceutical formulating art. In such solid dosage forms the
active compound may be admixed with at least one inert diluent such
as sucrose, lactose or starch. Such dosage forms may also comprise,
as is normal practice, additional substances other than inert
diluents, e.g., tableting lubricants and other tableting aids such
a magnesium stearate and microcrystalline cellulose. In the case of
capsules, tablets and pills, the dosage forms may also comprise
buffering agents. They may optionally contain opacifying agents and
can also be of a composition that they release the active
ingredient(s) only, or preferentially, in a certain part of the
intestinal tract, optionally, in a delayed manner. Examples of
embedding compositions that can be used include polymeric
substances and waxes.
[0699] The inhibitor or pharmaceutically active agent described
herein can also be administered in the form of liposome delivery
systems, such as small unilamellar vesicles, large unilamellar
vesicles and multilamellar vesicles. Liposomes can be formed from a
variety of phospholipids, containing cholesterol, stearylamine or
phosphatidylcholines. In some embodiments, a film of lipid
components is hydrated with an aqueous solution of drug to a form
lipid layer encapsulating the drug, as described in U.S. Pat. No.
5,262,564.
[0700] The inhibitor or pharmaceutically active agent described
herein can also be delivered by the use of monoclonal antibodies as
individual carriers to which the inhibitor or pharmaceutically
active agent described herein are coupled. The inhibitor or
pharmaceutically active agent described herein can also be coupled
with soluble polymers as targetable drug carriers. Such polymers
can include polyvinylpyrrolidone, pyran copolymer,
polyhydroxypropylmethacrylamide-phenol,
polyhydroxyethylaspanamidephenol, or polyethyleneoxidepolylysine
substituted with palmitoyl residues. Furthermore, the inhibitor or
pharmaceutically active agent described herein can be coupled to a
class of biodegradable polymers useful in achieving controlled
release of a drug, for example, polylactic acid, polyepsilon
caprolactone, polyhydroxy butyric acid, polyorthoesters,
polyacetals, polydihydropyrans, polycyanoacrylates and cross-linked
or amphipathic block copolymers of hydrogels.
[0701] Parenteral injectable administration can be used for
subcutaneous, intramuscular or intravenous injections and
infusions. Injectables can be prepared in conventional forms,
either as liquid solutions or suspensions or solid forms suitable
for dissolving in liquid prior to injection.
[0702] One embodiment, for parenteral administration employs the
implantation of a slow-release or sustained-released system,
according to U.S. Pat. No. 3,710,795, incorporated herein by
reference.
[0703] The compositions can be sterilized or contain non-toxic
amounts of adjuvants, such as preserving, stabilizing, wetting or
emulsifying agents, solution promoters, salts for regulating the
osmotic pressure, pH buffering agents, and other substances,
including, but not limited to, sodium acetate or triethanolamine
oleate. In addition, they can also contain other therapeutically
valuable substances.
[0704] Dosage forms for topical or transdermal administration of a
compound of this invention include ointments, pastes, creams,
lotions, gels, powders, solutions, sprays, inhalants or patches.
The active component is admixed under sterile conditions with a
pharmaceutically acceptable carrier and any needed preservatives or
buffers as may be required. Ophthalmic formulation, ear drops, and
eye drops are also contemplated as being within the scope of this
invention. Additionally, the present invention contemplates the use
of transdermal patches, which have the added advantage of providing
controlled delivery of a compound to the body. Such dosage forms
can be made by dissolving or dispensing the compound in the proper
medium. Absorption enhancers can also be used to increase the flux
of the compound across the skin. The rate can be controlled by
either providing a rate controlling membrane or by dispersing the
compound in a polymer matrix or gel.
[0705] Compositions can be prepared according to conventional
mixing, granulating or coating methods, respectively, and the
present pharmaceutical compositions can contain from about 0.1% to
about 99%, preferably from about 1% to about 70% of the inhibitor
or pharmaceutically active agent described herein by weight or
volume.
[0706] The dosage regimen utilizing the inhibitor or
pharmaceutically active agent described herein can be selected in
accordance with a variety of factors including type, species, age,
weight, sex and medical condition of the subject; the severity of
the condition to be treated; the route of administration; the renal
or hepatic function of the subject; and the particular inhibitor or
pharmaceutically active agent described herein employed. A person
skilled in the art can readily determine and prescribe the
effective amount of the drug useful for treating or preventing a
proliferative disorder.
[0707] Effective dosage amounts of the inhibitor or
pharmaceutically active agent described herein, when administered
to a subject, range from about 0.05 to about 1000 mg of inhibitor
or pharmaceutically active agent described herein per day.
Compositions for in vivo or in vitro use can contain about 0.5,
1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100.0, 250.0, 500.0 or
1000.0 mg of the inhibitor described herein. In one embodiment, the
compositions are in the form of a tablet that can be scored.
Effective plasma levels of the inhibitor or pharmaceutically active
agent described herein can range from about 0.002 mg to about 50 mg
per kg of body weight per day. The amount of an inhibitor or
pharmaceutically active agent described herein that is effective in
the treatment or prevention of cancer can be determined by clinical
techniques that are known to those of skill in the art. In
addition, in vitro and in vivo assays can optionally be employed to
help identify optimal dosage ranges. The precise dose to be
employed can also depend on the route of administration, and the
seriousness of the proliferative disorder being treated and can be
decided according to the judgment of the practitioner and each
subject's circumstances in view of, e.g., published clinical
studies. Suitable effective dosage amounts, however, can range from
about 10 micrograms to about 5 grams about every 4 h, although they
are typically about 500 mg or less per every 4 hours. In one
embodiment the effective dosage is about 0.01 mg, 0.5 mg, about 1
mg, about 50 mg, about 100 mg, about 200 mg, about 300 mg, about
400 mg, about 500 mg, about 600 mg, about 700 mg, about 800 mg,
about 900 mg, about 1 g, about 1.2 g, about 1.4 g, about 1.6 g,
about 1.8 g, about 2.0 g, about 2.2 g, about 2.4 g, about 2.6 g,
about 2.8 g, about 3.0 g, about 3.2 g, about 3.4 g, about 3.6 g,
about 3.8 g, about 4.0 g, about 4.2 g, about 4.4 g, about 4.6 g,
about 4.8 g, and about 5.0 g, every 4 hours. Equivalent dosages can
be administered over various time periods including, but not
limited to, about every 2 hours, about every 6 hours, about every 8
hours, about every 12 hours, about every 24 hours, about every 36
hours, about every 48 hours, about every 72 hours, about every
week, about every two weeks, about every three weeks, about every
month, and about every two months. The effective dosage amounts
described herein refer to total amounts administered; that is, if
more than one inhibitor or pharmaceutically active agent described
herein is administered, the effective dosage amounts correspond to
the total amount administered.
[0708] The dosage regimen utilizing the inhibitor or
pharmaceutically active agent described herein can be selected in
accordance with a variety of factors including type, species, age,
weight, sex and medical condition of the subject; the severity of
the proliferative disorder to be treated; the route of
administration; the renal or hepatic function of the subject; and
the particular inhibitor or pharmaceutically active agent described
herein employed. A person skilled in the art can readily determine
and prescribe the effective amount of the drug required to prevent,
counter or arrest the progress of the proliferative disorder.
[0709] The inhibitor or pharmaceutically active agent described
herein can be administered in a single daily dose, or the total
daily dosage can be administered in divided doses of two, three or
four times daily. Furthermore, the inhibitor or pharmaceutically
active agent described herein can be administered in intranasal
form via topical use of suitable intranasal vehicles, or via
transdermal routes, using those forms of transdermal skin patches
well known to those of ordinary skill in that art. To be
administered in the form of a transdermal delivery system, the
dosage administration can be continuous rather than intermittent
throughout the dosage regimen. Other illustrative topical
preparations include creams, ointments, lotions, aerosol sprays and
gels, wherein the concentration of the inhibitor or
pharmaceutically active agent described herein ranges from about
0.1% to about 15%, w/w or w/v.
[0710] 6. Combination
[0711] Depending upon the particular condition, or disease, to be
treated, additional therapeutic agents, which are normally
administered to treat that condition, may be administered in
combination with compounds and compositions of this invention. As
used herein, additional therapeutic agents that are normally
administered to treat a particular disease, or condition, are known
as "appropriate for the disease, or condition, being treated". In a
combination of an inhibitor described herein and additional
therapeutic agent, the additional therapeutic agent is not a
competitive binder for the active binding site within the target
protein for the inhibitor used in the combination.
[0712] In certain embodiments, an inhibitor or pharmaceutically
active agent provided herein, or composition thereof, is
administered in combination with another pharmaceutically active
agent, or a variant thereof. In some embodiments, a provided
compound, or composition thereof, is administered in combination
with one or more additional pharmaceutically active agent. Such
additional pharmaceutically active agents include, but are not
limited to, treatments for Alzheimer's Disease such as Aricept.RTM.
and Excelon.RTM.; treatments for HIV such as ritonavir; treatments
for Parkinson's Disease such as L-DOPA/carbidopa, entacapone,
ropinrole, pramipexole, bromocriptine, pergolide, trihexephendyl,
and amantadine; agents for treating Multiple Sclerosis (MS) such as
beta interferon (e.g., Avonex.RTM. and Rebif.RTM.), Copaxone.RTM.,
and mitoxantrone; treatments for asthma such as albuterol and
Singulair.RTM.; agents for treating schizophrenia such as zyprexa,
risperdal, seroquel, and haloperidol; anti-inflammatory agents such
as corticosteroids, TNF blockers, IL-1 RA, azathioprine,
cyclophosphamide, and sulfasalazine; immunomodulatory and
immunosuppressive agents such as cyclosporin, tacrolimus,
rapamycin, mycophenolate mofetil, interferons, corticosteroids,
cyclophophamide, azathioprine, and sulfasalazine; neurotrophic
factors such as acetylcholinesterase inhibitors, MAO inhibitors,
interferons, anti-convulsants, ion channel blockers, riluzole, and
anti-Parkinsonian agents; agents for treating cardiovascular
disease such as beta-blockers, ACE inhibitors, diuretics, nitrates,
calcium channel blockers, and statins; agents for treating liver
disease such as corticosteroids, cholestyramine, interferons, and
anti-viral agents; agents for treating blood disorders such as
corticosteroids, anti-leukemic agents, and growth factors; agents
that prolong or improve pharmacokinetics such as cytochrome P450
inhibitors (i.e., inhibitors of metabolic breakdown) and CYP3A4
inhibitors (e.g., ketokenozole and ritonavir), and agents for
treating immunodeficiency disorders such as gamma globulin.
[0713] In certain embodiments, compounds of the present invention,
or a pharmaceutically acceptable composition thereof, are
administered in combination with a monoclonal antibody or an siRNA
therapeutic.
[0714] Those additional agents may be administered separately from
an inventive compound-containing composition, as part of a multiple
dosage regimen. Alternatively, those agents may be part of a single
dosage form, mixed together with a compound of this invention in a
single composition. If administered as part of a multiple dosage
regime, the two active agents may be submitted simultaneously,
sequentially or within a period of time from one another normally
within five hours from one another.
[0715] As used herein, the term "combination," "combined," and
related terms refers to the simultaneous or sequential
administration of therapeutic agents in accordance with this
invention. For example, a compound of the present invention may be
administered with another therapeutic agent simultaneously or
sequentially in separate unit dosage forms or together in a single
unit dosage form. Accordingly, the present invention provides a
single unit dosage form comprising a compound of the invention, an
additional therapeutic agent, and a pharmaceutically acceptable
carrier, adjuvant, or vehicle.
[0716] The amount of both, an inventive compound and additional
therapeutic agent (in those compositions which comprise an
additional therapeutic agent as described above) that may be
combined with the carrier materials to produce a single dosage form
will vary depending upon the host treated and the particular mode
of administration. Preferably, compositions of this invention
should be formulated so that a dosage of between 0.01-100 mg/kg
body weight/day of an inventive can be administered.
[0717] In those compositions which comprise an additional
therapeutic agent, that additional therapeutic agent and the
compound of this invention may act synergistically. Therefore, the
amount of additional therapeutic agent in such compositions will be
less than that required in a monotherapy utilizing only that
therapeutic agent. In such compositions a dosage of between
0.01-100 mg/kg body weight/day of the additional therapeutic agent
can be administered.
[0718] The amount of additional therapeutic agent present in the
compositions of this invention will be no more than the amount that
would normally be administered in a composition comprising that
therapeutic agent as the only active agent. Preferably the amount
of additional therapeutic agent in the presently disclosed
compositions will range from about 50% to 100% of the amount
normally present in a composition comprising that agent as the only
therapeutically active agent.
[0719] In some embodiments, the compositions comprise an amount of
an anticancer inhibitor described herein, e.g., a XIAP inhibitor,
and another anticancer agent which together are effective to treat
or prevent cancer. In another embodiment, the amount of the
anticancer inhibitor described herein and another anticancer agent
is at least about 0.01% of the combined combination chemotherapy
agents by weight of the composition. When intended for oral
administration, this amount can be varied from about 0.1% to about
80% by weight of the composition. Some oral compositions can
comprise from about 4% to about 50% of the anticancer inhibitor
described herein and another anticancer agent. Other compositions
of the present invention are prepared so that a parenteral dosage
unit contains from about 0.01% to about 2% by weight of the
composition.
[0720] The present methods for treating or preventing cancer in a
subject in need thereof can further comprise administering another
prophylactic or therapeutic agent to the subject being administered
an anticancer inhibitor described herein. In one embodiment the
other prophylactic or therapeutic agent is administered in an
effective amount. The other prophylactic or therapeutic agent
includes, but is not limited to, an anti-inflammatory agent, an
anti-renal failure agent, an anti-diabetic agent, an
anti-cardiovascular disease agent, an antiemetic agent, a
hematopoietic colony stimulating factor, an anxiolytic agent, and
an opioid or non-opioid analgesic agent.
[0721] In a further embodiment, the anticancer inhibitor described
herein can be administered prior to, concurrently with, or after an
antiemetic agent, or on the same day, or within 1 hour, 2 hours, 12
hours, 24 hours, 48 hours or 72 hours of each other.
[0722] In another embodiment, the anticancer inhibitor described
herein can be administered prior to, concurrently with, or after a
hematopoietic colony stimulating factor, or on the same day, or
within 1 hour, 2 hours, 12 hours, 24 hours, 48 hours, 72 hours, 1
week, 2 weeks, 3 weeks or 4 weeks of each other.
[0723] In still another embodiment, the anticancer inhibitor
described herein can be administered prior to, concurrently with,
or after an opioid or non-opioid analgesic agent, or on the same
day, or within 1 hour, 2 hours, 12 hours, 24 hours, 48 hours or 72
hours of each other.
[0724] In yet another embodiment, the anticancer inhibitor
described herein can be administered prior to, concurrently with,
or after an anxiolytic agent, or on the same day, or within 1 hour,
2 hours, 12 hours, 24 hours, 48 hours or 72 hours of each
other.
[0725] Effective amounts of the other therapeutic agents are well
known to those skilled in the art. However, it is well within the
skilled artisan's purview to determine the other therapeutic
agent's optimal effective amount range. In one embodiment of the
invention, where, another therapeutic agent is administered to a
subject, the effective amount of the anticancer inhibitor described
herein is less than its effective amount would be where the other
therapeutic agent is not administered. In this case, without being
bound by theory, it is believed that the anticancer inhibitor
described herein and the other therapeutic agent act
synergistically to treat or prevent cancer.
[0726] Antiemetic agents useful in the methods of the present
invention include, but are not limited to, metoclopromide,
domperidone, prochlorperazine, promethazine, chlorpromazine,
trimethobenzamide, ondansetron, granisetron, hydroxyzine,
acetylleucine monoethanolamine, alizapride, azasetron,
benzquinamide, bietanautine, bromopride, buclizine, clebopride,
cyclizine, dimenhydrinate, diphenidol, dolasetron, meclizine,
methallatal, metopimazine, nabilone, oxyperndyl, pipamazine,
scopolamine, sulpiride, tetrahydrocannabinol, thiethylperazine,
thioproperazine, and tropisetron.
[0727] Hematopoietic colony stimulating factors useful in the
methods of the present invention include, but are not limited to,
filgrastim, sargramostim, molgramostim and epoietin alfa.
[0728] Opioid analgesic agents useful in the methods of the present
invention include, but are not limited to, morphine, heroin,
hydromorphone, hydrocodone, oxymorphone, oxycodone, metopon,
apomorphine, normorphine, etorphine, buprenorphine, meperidine,
lopermide, anileridine, ethoheptazine, piminidine, betaprodine,
diphenoxylate, fentanil, sufentanil, alfentanil, remifentanil,
levorphanol, dextromethorphan, phenazocine, pentazocine,
cyclazocine, methadone, isomethadone and propoxyphene.
[0729] Non-opioid analgesic agents useful in the methods of the
present invention include, but are not limited to, aspirin,
celecoxib, rofecoxib, diclofinac, diflusinal, etodolac, fenoprofen,
flurbiprofen, ibuprofen, ketoprofen, indomethacin, ketorolac,
meclofenamate, mefanamic acid, nabumetone, naproxen, piroxicam and
sulindac.
[0730] Anxiolytic agents useful in the methods of the present
invention include, but are not limited to, buspirone, and
benzodiazepines such as diazepam, lorazepam, oxazapam,
chlorazepate, clonazepam, chlordiazepoxide and alprazolam.
[0731] The invention encompasses kits that can simplify the
administration of a ligand that covalently binds to a target
polypeptide having a lysine residue present in the active site to a
subject.
[0732] A typical kit of the invention comprises a unit dosage form
of a ligand that covalently binds to a target polypeptide having a
lysine residue present in the active site. In one embodiment the
unit dosage form is a container, which can be sterile, containing
an effective amount of a ligand that covalently binds to a target
polypeptide having a lysine residue present in the active site and
a physiologically acceptable carrier or vehicle. The kit can
further comprise a label or printed instructions instructing the
use of the ligand that covalently binds to a target polypeptide
having a lysine residue present in the active site to treat or
prevent cancer. The kit can also further comprise a unit dosage
form of another prophylactic or therapeutic agent, for example, a
container containing an effective amount of another prophylactic or
therapeutic agent or another anticancer agent. In one embodiment
the kit comprises a container containing an effective amount of a
ligand that covalently binds to a target polypeptide having a
lysine residue present in the active site and an effective amount
of another prophylactic or therapeutic agent. Examples of other
prophylactic or therapeutic agents and other anticancer agents
include, but are not limited to, those listed above.
C. Probe Compounds
[0733] A compound of the present invention may be tethered to a
detectable moiety. One of ordinary skill in the art will recognize
that a detectable moiety may be attached to a provided compound via
a suitable substituent. As used herein, the term "suitable
substituent" refers to a moiety that is capable of covalent
attachment to a detectable moiety. Such moieties are well known to
one of ordinary skill in the art and include groups containing,
e.g., a carboxylate moiety, an amino moiety, a thiol moiety, or a
hydroxyl moiety, to name but a few. It will be appreciated that
such moieties may be directly attached to a provided compound or
via a tethering group, such as a bivalent saturated or unsaturated
hydrocarbon chain. In some embodiments, such moieties may be
attached via click chemistry. In some embodiments, such moieties
may be attached via a 1,3-cycloaddition of an azide with an alkyne,
optionally in the presence of a copper catalyst. Methods of using
click chemistry are known in the art and include those described by
Rostovtsev et al., Angew. Chem. Int. Ed. 2002, 41, 2596-99 and Sun
et al., Bioconjugate Chem., 2006, 17, 52-57.
[0734] As used herein, the term "detectable moiety" is used
interchangeably with the term "label" and "reporter" and relates to
any moiety capable of being detected, e.g., primary labels and
secondary labels. A presence of a detectable moiety can be measured
using methods for quantifying (in absolute, approximate or relative
terms) the detectable moiety in a system under study. In some
embodiments, such methods are well known to one of ordinary skill
in the art and include any methods that quantify a reporter moiety
(e.g., a label, a dye, a photocrosslinker, a cytotoxic compound, a
drug, an affinity label, a photoaffinity label, a reactive
compound, an antibody or antibody fragment, a biomaterial, a
nanoparticle, a spin label, a fluorophore, a metal-containing
moiety, a radioactive moiety, quantum dot(s), a novel functional
group, a group that covalently or noncovalently interacts with
other molecules, a photocaged moiety, an actinic radiation
excitable moiety, a ligand, a photoisomerizable moiety, biotin, a
biotin analog (e.g., biotin sulfoxide), a moiety incorporating a
heavy atom, a chemically cleavable group, a photocleavable group, a
redox-active agent, an isotopically labeled moiety, a biophysical
probe, a phosphorescent group, a chemiluminescent group, an
electron dense group, a magnetic group, an intercalating group, a
chromophore, an energy transfer agent, a biologically active agent,
a detectable label, and any combination of the above).
[0735] Nonlimiting exemplary probe compounds are as set forth
below.
##STR00262## ##STR00263##
[0736] Primary labels, such as radioisotopes (e.g., tritium,
.sup.32P, .sup.33P, .sup.35S, .sup.14C, .sup.123I, .sup.124I,
.sup.125I, or .sup.131I), mass-tags including, but not limited to,
stable isotopes (e.g., .sup.13C, .sup.2H, .sup.17O, .sup.18O,
.sup.15N, .sup.19F, and .sup.127I), positron emitting isotopes
(e.g., .sup.11C, .sup.18F, .sup.13N, .sup.124I, and .sup.15O), and
fluorescent labels are signal generating reporter groups which can
be detected without further modifications. Detectable moities may
be analyzed by methods including, but not limited to fluorescence,
positron emission tomography, SPECT medical imaging,
chemiluminescence, electron-spin resonance, ultraviolet/visible
absorbance spectroscopy, mass spectrometry, nuclear magnetic
resonance, magnetic resonance, flow cytometry, autoradiography,
scintillation counting, phosphoimaging, and electrochemical
methods.
[0737] The term "secondary label" as used herein refers to moieties
such as biotin and various protein antigens that require the
presence of a second intermediate for production of a detectable
signal. For biotin, the secondary intermediate may include
streptavidin-enzyme conjugates. For antigen labels, secondary
intermediates may include antibody-enzyme conjugates. Some
fluorescent groups act as secondary labels because they transfer
energy to another group in the process of nonradiative fluorescent
resonance energy transfer (FRET), and the second group produces the
detected signal.
[0738] The terms "fluorescent label", "fluorescent dye", and
"fluorophore" as used herein refer to moieties that absorb light
energy at a defined excitation wavelength and emit light energy at
a different wavelength. Examples of fluorescent labels include, but
are not limited to: Alexa Fluor dyes (Alexa Fluor 350, Alexa Fluor
488, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 568, Alexa Fluor
594, Alexa Fluor 633, Alexa Fluor 660 and Alexa Fluor 680), AMCA,
AMCA-S, BODIPY dyes (BODIPY FL, BODIPY R6G, BODIPY TMR, BODIPY TR,
BODIPY 493/503, BODIPY 530/550, BODIPY 558/568, BODIPY 564/570,
BODIPY 576/589, BODIPY 581/591, BODIPY 630/650, BODIPY 650/665),
Carboxyrhodamine 6G, carboxy-X-rhodamine (ROX), Cascade Blue,
Cascade Yellow, Coumarin 343, Cyanine dyes (Cy3, Cy5, Cy3.5,
Cy5.5), Dansyl, Dapoxyl, Dialkylaminocoumarin,
4',5'-Dichloro-2',7'-dimethoxy-fluorescein, DM-NERF, Eosin,
Erythrosin, Fluorescein, FAM, Hydroxycoumarin, IRDyes (IRD40, IRD
700, IRD 800), JOE, Lissamine rhodamine B, Marina Blue,
Methoxycoumarin, Naphthofluorescein, Oregon Green 488, Oregon Green
500, Oregon Green 514, Pacific Blue, PyMPO, Pyrene, Rhodamine B,
Rhodamine 6G, Rhodamine Green, Rhodamine Red, Rhodol Green,
2',4',5',7'-Tetra-bromosulfone-fluorescein, Tetramethyl-rhodamine
(TMR), Carboxytetramethylrhodamine (TAMRA), Texas Red, Texas Red-X,
5(6)-Carboxyfluorescein, 2,7-Dichlorofluorescein,
N,N-Bis(2,4,6-trimethylphenyl)-3, 4:9,
10-perylenebis(dicarboximide, HPTS, Ethyl Eosin, DY-490XL
MegaStokes, DY-485XL MegaStokes, Adirondack Green 520, ATTO 465,
ATTO 488, ATTO 495, YOYO-1,5-FAM, BCECF, dichlorofluorescein,
rhodamine 110, rhodamine 123, YO-PRO-1, SYTOX Green, Sodium Green,
SYBR Green I, Alexa Fluor 500, FITC, Fluo-3, Fluo-4,
fluoro-emerald, YoYo-1 ssDNA, YoYo-1 dsDNA, YoYo-1, SYTO RNASelect,
Diversa Green-FP, Dragon Green, EvaGreen, Surf Green EX, Spectrum
Green, NeuroTrace 500525, NBD-X, MitoTracker Green FM, LysoTracker
Green DND-26, CBQCA, PA-GFP (post-activation), WEGFP
(post-activation), FLASH-CCXXCC, Azami Green monomeric, Azami
Green, green fluorescent protein (GFP), EGFP (Campbell Tsien 2003),
EGFP (Patterson 2001), Kaede Green,
7-Benzylamino-4-Nitrobenz-2-Oxa-1,3-Diazole, Bex1, Doxorubicin,
Lumio Green, and SuperGlo GFP.
[0739] The term "mass-tag" as used herein refers to any moiety that
is capable of being uniquely detected by virtue of its mass using
mass spectrometry (MS) detection techniques. Examples of mass-tags
include electrophore release tags such as
N-[3-[4'-[(p-Methoxytetrafluorobenzyl)oxy]phenyl]-3-methylglyceronyl]ison-
ipecotic Acid,
4'-[2,3,5,6-Tetrafluoro-4-(pentafluorophenoxyl)]methyl
acetophenone, and their derivatives. The synthesis and utility of
these mass-tags is described in U.S. Pat. Nos. 4,650,750,
4,709,016, 5,360,8191, 5,516,931, 5,602,273, 5,604,104, 5,610,020,
and 5,650,270. Other examples of mass-tags include, but are not
limited to, nucleotides, dideoxynucleotides, oligonucleotides of
varying length and base composition, oligopeptides,
oligosaccharides, and other synthetic polymers of varying length
and monomer composition. A large variety of organic molecules, both
neutral and charged (biomolecules or synthetic compounds) of an
appropriate mass range (100-2000 Daltons) may also be used as
mass-tags. Stable isotopes (e.g., .sup.13C, .sup.2H, .sup.17O,
.sup.18O, and .sup.15N) may also be used as mass-tags.
[0740] The term "chemiluminescent group," as used herein, refers to
a group which emits light as a result of a chemical reaction
without the addition of heat. By way of example, luminol
(5-amino-2,3-dihydro-1,4-phthalazinedione) reacts with oxidants
like hydrogen peroxide (H.sub.2O.sub.2) in the presence of a base
and a metal catalyst to produce an excited state product
(3-aminophthalate, 3-APA).
[0741] The term "chromophore," as used herein, refers to a molecule
which absorbs light of visible wavelengths, UV wavelengths or IR
wavelengths.
[0742] The term "dye," as used herein, refers to a soluble,
coloring substance which contains a chromophore.
[0743] The term "electron dense group," as used herein, refers to a
group which scatters electrons when irradiated with an electron
beam. Such groups include, but are not limited to, ammonium
molybdate, bismuth subnitrate, cadmium iodide, carbohydrazide,
ferric chloride hexahydrate, hexamethylene tetramine, indium
trichloride anhydrous, lanthanum nitrate, lead acetate trihydrate,
lead citrate trihydrate, lead nitrate, periodic acid,
phosphomolybdic acid, phosphotungstic acid, potassium ferricyanide,
potassium ferrocyanide, ruthenium red, silver nitrate, silver
proteinate (Ag Assay: 8.0-8.5%) "Strong", silver tetraphenylporphin
(S-TPPS), sodium chloroaurate, sodium tungstate, thallium nitrate,
thiosemicarbazide (TSC), uranyl acetate, uranyl nitrate, and
vanadyl sulfate.
[0744] The term "energy transfer agent," as used herein, refers to
a molecule which either donates or accepts energy from another
molecule. By way of example only, fluorescence resonance energy
transfer (FRET) is a dipole-dipole coupling process by which the
excited-state energy of a fluorescence donor molecule is
non-radiatively transferred to an unexcited acceptor molecule which
then fluorescently emits the donated energy at a longer
wavelength.
[0745] The term "moiety incorporating a heavy atom," as used
herein, refers to a group which incorporates an ion of atom which
is usually heavier than carbon. In some embodiments, such ions or
atoms include, but are not limited to, silicon, tungsten, gold,
lead, and uranium.
[0746] The term "photoaffinity label," as used herein, refers to a
label with a group, which, upon exposure to light, forms a linkage
with a molecule for which the label has an affinity.
[0747] The term "photocaged moiety," as used herein, refers to a
group which, upon illumination at certain wavelengths, covalently
or non-covalently binds other ions or molecules.
[0748] The term "photoisomerizable moiety," as used herein, refers
to a group wherein upon illumination with light changes from one
isomeric form to another.
[0749] The term "radioactive moiety," as used herein, refers to a
group whose nuclei spontaneously give off nuclear radiation, such
as alpha, beta, or gamma particles; wherein, alpha particles are
helium nuclei, beta particles are electrons, and gamma particles
are high energy photons.
[0750] The term "spin label," as used herein, refers to molecules
which contain an atom or a group of atoms exhibiting an unpaired
electron spin (i.e. a stable paramagnetic group) that in some
embodiments are detected by electron spin resonance spectroscopy
and in other embodiments are attached to another molecule. Such
spin-label molecules include, but are not limited to, nitryl
radicals and nitroxides, and in some embodiments are single
spin-labels or double spin-labels.
[0751] The term "quantum dots," as used herein, refers to colloidal
semiconductor nanocrystals that in some embodiments are detected in
the near-infrared and have extremely high quantum yields (i.e.,
very bright upon modest illumination).
[0752] One of ordinary skill in the art will recognize that a
detectable moiety may be attached to a provided compound via a
suitable substituent. As used herein, the term "suitable
substituent" refers to a moiety that is capable of covalent
attachment to a detectable moiety. Such moieties are well known to
one of ordinary skill in the art and include groups containing,
e.g., a carboxylate moiety, an amino moiety, a thiol moiety, or a
hydroxyl moiety, to name but a few. It will be appreciated that
such moieties may be directly attached to a provided compound or
via a tethering moiety, such as a bivalent saturated or unsaturated
hydrocarbon chain.
[0753] In some embodiments, detectable moieties are attached to a
provided compound via click chemistry. In some embodiments, such
moieties are attached via a 1,3-cycloaddition of an azide with an
alkyne, optionally in the presence of a copper catalyst. Methods of
using click chemistry are known in the art and include those
described by Rostovtsev et al., Angew. Chem. Int. Ed. 2002, 41,
2596-99 and Sun et al., Bioconjugate Chem., 2006, 17, 52-57. In
some embodiments, a click ready inhibitor moiety is provided and
reacted with a click ready -T.sup.p-R.sup.p moiety. As used herein,
"click ready" refers to a moiety containing an azide or alkyne for
use in a click chemistry reaction. In some embodiments, the click
ready inhibitor moiety comprises an azide. In certain embodiments,
the click ready -T.sup.p-R.sup.p moiety comprises a strained
cyclooctyne for use in a copper-free click chemistry reaction (for
example, using methods described in Baskin et al., Proc. Natl.
Acad. Sci. USA 2007, 104, 16793-16797).
[0754] 9. Exemplification
[0755] The disclosure is further illustrated by the following
examples, which are not to be construed as limiting this disclosure
in scope or spirit to the specific procedures herein described. It
is to be understood that the examples are provided to illustrate
certain embodiments and that no limitation to the scope of the
disclosure is intended thereby. It is to be further understood that
resort may be had to various other embodiments, modifications, and
equivalents thereof which may suggest themselves to those skilled
in the art without departing from the spirit of the present
disclosure and/or scope of the appended claims.
A. Design of an Irreversible Inhibitor of XIAP
Example 1
[0756]
(3S,6S,10aR)-6-((S)-2-(methylamino)propanamido)-5-oxo-N-((R)-1,2,3,-
4-tetrahydronaphthalen-1-yl)decahydropyrrolo[1,2-a]azocine-3-carboxamide
(Compound A) is a reversible inhibitor of XIAP (Ki 26 nM) (Sun et
al., J. Med. Chem. 52, 593-596 (2009). Using the structure-based
design algorithm described herein, Compound A was converted from a
reversible inhibitor into Compound VII-1, a potent and irreversible
inhibitor of XIAP. The process for the conversion of Compound A to
Compound VII-1 is described below.
##STR00264##
[0757] The X-ray crystal structure of XIAP complexed with Compound
B, a related compound to Compound A, has been reported (Sun, H., et
al., J. Med. Chem. 51, 7169-7180 (2008)) and was obtained from the
protein databank (pdbcode 2JK7 at www.resb.org). The X-ray complex
of Compound B bound to XIAP was used to
##STR00265##
design covalent inhibitors of XIAP using the design algorithm
described herein. The three-dimensional structure of Compound B was
docked into the XIAP ligand-binding site using the CDOCKER method
in Discovery Studio (www.accelrys.com). The ligand-binding site of
XIAP was defined using the sphere that has a 7.5 angstroms radius
around the reference ligand. The docking results demonstrated that
the inhibitor Compound A, bound to XIAP in a similar fashion to
that seen in the X-ray complex of Compound B bound to XIAP. After
docking Compound B in the ligand-binding site of XIAP, all lysine
residues (Lys) of XIAP within 15 angstroms in the XIAP-Compound B
complex were identified: Lys281, Lys297, Lys299, Lys311, Lys322,
Lys328 and Lys334.
[0758] Using the modeled coordinates of Compound A, a library of
virtual covalent inhibitors was created by building an acrylamide
warhead at each of the A.sub.1 (ortho-, meta- and para-), A.sub.2
and A.sub.3 positions shown below in Template X.
##STR00266##
[0759] To sample the flexibility of the warheads and the side chain
positions, a molecular dynamics simulation of the warheads and XIAP
side chain positions was performed and analyzed to determine if the
warhead was within 6 angstroms of any of the Lys residues in the
binding site. Additionally, an analysis of possible steric clashes
between the warheads and the residues was performed. Standard
settings were used in the Standard Dynamics Cascade Simulations
protocol of Discovery Studio, along with Merck Molecular Force
Field, for the molecular dynamics simulations (www.accelrys.com).
The coordinates of the non-warhead positions and the Lys main-chain
atoms were held fixed during the molecular dynamics simulation. The
modeling demonstrated that the VII-1 (A.sub.1=meta-substituted
acrylamide) was close to Lys297 and also Lys299 in XIAP. To confirm
that VII-1 was able to form a bond with either of these Lys
residues, a model of the reaction product between XIAP and Lys297
or Lys299 was built. In both cases, the reaction product could be
formed without any significant change in the geometry of the model,
thereby supporting bond formation.
[0760] Subsequently, VII-1 was synthesized and inhibited XIAP at a
Ki of 161 nM, (see Table 2 below), while Compound VII-2, an
inactive control compound demonstrated a Ki of >10,000 nM. Mass
spectrometric analysis of the reaction product of VII-1 incubated
with XIAP demonstrates that VII-1 covalently modifies XIAP (see
Examples 50 and 51, below).
##STR00267##
B. XIAP Inhibitors Synthetic Examples
Example 1A
##STR00268##
[0762]
(3S,6S,10aS)-N-(3-acrylamidobenzyl)-6-(S)-2-(methylamino)propanamid-
o)-5-oxodecahydropyrrolo[1,2-a]azocine-3-carboxamide: The title
compound was prepared according to the steps and intermediates as
described below.
##STR00269## ##STR00270## ##STR00271##
(S)-2-benzyl 1-tert-butyl 5-oxopyrrolidine-1,2-dicarboxylate
(1a)
##STR00272##
[0764] To a stirred solution of L-pyroglutamic acid (75 g, 0.58
mol) and N,N-diisopropyl-ethylamine (87.3 g, 0.676 mol) in dry
dichloromethane (1.0 L) at 0.degree. C. was added benzyl bromide
(98.84 g, 0.58 mol) dropwise. The reaction mixture was heated under
reflux for 5 h, cooled to RT and washed with aqueous
NaH.sub.2PO.sub.4. The aqueous layer was extracted with
CH.sub.2Cl.sub.2; the combined organic layers were washed with
brine, dried over Na.sub.2SO.sub.4, filtered and concentrated under
reduced pressure. The residue obtained was then taken in
acetonitrile (1.5 L) and 4-dimethylaminopyridine (7.09 g, 58.0
mmol) and Boc-anhydride (150.0 g, 0.688 mol) were added and stirred
at RT for 3 hrs. The reaction mixture was concentrated; the residue
obtained was treated with water and extracted with ethyl acetate.
The ethyl acetate layer was washed with aqueous NaH.sub.2PO.sub.4
and brine, dried over Na.sub.2SO.sub.4, filtered, and concentrated
under reduced pressure to give pale yellow viscous oil. It was
crystallized with ethyl acetate-petroleum ether to give 1a (150 g,
80.8%) as a pale yellow solid.
(2S)-2-benzyl 1-tert-butyl 5-hydroxypyrrolidine-1,2-dicarboxylate
(1b)
##STR00273##
[0766] To a stirred solution of 1a (100.0 g, 313.1 mmol) in THF
(1000 mL) at -78.degree. C. under nitrogen was added Super
Hydride.RTM. (1M in THF, 469 mL, 469 mmol) slowly and the mixture
was stirred at -78.degree. C. for 2 h. Saturated aq. sodium
hydrogen carbonate (300 mL) was added and the reaction mixture was
stirred at 0.degree. C. for 30 min. The reaction mixture was
concentrated to remove most of THF and the residue was extracted
with ethyl acetate. The combined organic extracts were dried over
Na.sub.2SO.sub.4, filtered, and concentrated under reduced pressure
to get 1b (100 g, 99.3%) as colorless oil. It was taken for the
next step without further purification.
(2S)-2-benzyl 1-tert-butyl 5-methoxypyrrolidine-1,2-dicarboxylate
(1c)
##STR00274##
[0768] To a stirred solution of 1b (100 g, 311.1 mmol) in methanol
(1000 mL) was added p-toluenesulfonic acid monohydrate (5.89 g,
30.96 mmol) and stirred at RT for 16 h. Sat. sodium hydrogen
carbonate solution (500 mL) was added and then concentrated under
reduced pressure to remove most of methanol. The residue was
extracted with MTBE and the combined MTBE extract was washed with
brine, dried over Na.sub.2SO.sub.4, filtered, and concentrated
under reduced pressure to get 1c (88 g, 84.3%) as colorless oil. It
was taken for the next step without further purification.
(2S)-2-benzyl 1-tert-butyl 5-allylpyrrolidine-1,2-dicarboxylate
(1d)
##STR00275##
[0770] To a stirred solution of 1c (25 g, 74.4 mmol) in
dichloromethane (250 mL) at -78.degree. C. was added
borontrifluoride-diethyletherate (9.2 mL, 74.5 mmol) slowly and the
solution was stirred at -78.degree. C. for 1 h.
Allytributylstannane (28 mL, 90.3 mmol) was added slowly and the
reaction mixture was stirred further at -78.degree. C. for 3 h.
De-ionized water (300 mL) was added and the solution was allowed to
warm to RT. It was filtered through Celite, layers were separated
and the aqueous layer was extracted with dichloromethane. The
combined organic extracts were washed with water and brine, dried
over Na.sub.2SO.sub.4, filtered, and concentrated under reduced
pressure to get the crude. The crude product obtained was purified
by column chromatography (SiO.sub.2, ethyl acetate: petroleum
ether, 8:92) to get 1d (15 g, 58.3%) as colorless oil.
(2S)-benzyl 5-allylpyrrolidine-2-carboxylate (1e)
##STR00276##
[0772] To a stirred solution of 1d (30 g, 86.7 mmol) in
dichloromethane (300 mL) at 0.degree. C. was added trifluoroacetic
acid (45 mL) slowly and the solution was stirred at RT for 2 h
under nitrogen. The reaction mixture was concentrated under reduced
pressure and the residue obtained was taken in
dichloromethane-water (2:1, 150 mL), stirred vigorously and
triethylamine (50 mL, 356.4 mmol) was added. Stirring was continued
at RT for 2 h. The phases were separated and the aqueous phase was
extracted with dichloromethane. The combined organic extracts were
dried over Na.sub.2SO.sub.4, filtered, and concentrated under
reduced pressure to get 1e (20 g, 93.9%) as a pale yellow oil and
was taken for the next step without further purification.
(2S)-benzyl
5-allyl-1-((S)-2-(tert-butoxycarbonylamino)pent-4-enoyl)pyrrolidine-2-car-
boxylate (1f)
##STR00277##
[0774] To a stirred solution of 1e (11 g, 44.9 mmol) in DMF (110
mL) were added (S)-2-(tert-butoxycarbonylamino)pent-4-enoic acid
(9.65 g, 44.9 mmol), EDC.HCl (12.87 g, 67.35 mmol), HOBt (2.42 g,
17.96 mmol) and DIPEA (11.63 mL, 67.35 mmol). The reaction mixture
was stirred at room temperature for 18 h under nitrogen atmosphere.
It was diluted with cold water and extracted with ethyl acetate.
The combined organic extracts were washed with water and brine,
dried over Na.sub.2SO.sub.4, filtered, and concentrated under
reduced pressure to get a residue. The crude product obtained was
mixed with the crude obtained from another similar batch and
purified by column chromatography (SiO.sub.2, 15-20% ethyl acetate
in petroleum ether) to get 1f (25 g, 62.9%) as a pale yellow
oil.
(3S,6S,10aR,Z)-benzyl
6-(tert-butoxycarbonylamino)-5-oxo-1,2,3,5,6,7,10,10a-octahydropyrrolo[1,-
2-a]azocine-3-carboxylate (1g)
##STR00278##
[0776] To a solution of 1f (25 g, 56.49 mmol) in dichloromethane
(500 mL) was added
bis(tricyclohexylphosphine)benzylideneruthenium(IV) dichloride
(Grubbs' catalyst) (9.3 g, 11.29 mmol) and stirred at reflux for 24
h. Cooled to RT, concentrated under reduced pressure, the residue
was taken in MTBE and filtered through Celite, filtrate
concentrated under reduced pressure to get 1g (50 g) as dark green
residue. It was taken for the next step without further
purification.
(3S,6S,10aR,Z)-benzyl
6-amino-5-oxo-1,2,3,5,6,7,10,10a-octahydropyrrolo[1,2-a]azocine-3-carboxy-
late (1h)
##STR00279##
[0778] To a stirred solution of 1g (.about.50 g, crude) in
dichloromethane (500 mL) at 0.degree. C. was added trifluoroacetic
acid (50 mL) slowly and the solution was stirred at RT for 2 h
under nitrogen. The reaction mixture was concentrated under reduced
pressure and the residue obtained was taken up in water. It was
washed with MTBE; the aqueous layer was basified with 10% NaOH
solution and extracted with ethyl acetate. Combined ethyl acetate
extracts were washed with water and brine, dried over
Na.sub.2SO.sub.4, filtered, and concentrated under reduced pressure
to get 1h (9 g, 50.7% yield in two steps) as yellow oil which was
found to be sufficiently pure.
(3S,6S,10aR,Z)-benzyl
6-((S)-2-(tert-butoxycarbonyl(methyl)amino)propanamido)-5-oxo-1,2,3,5,6,7-
,10,10a-octahydropyrrolo[1,2-a]azocine-3-carboxylate (1i)
##STR00280##
[0780] To a stirred solution of 1h (7.3 g, 23.22 mmol) in
dichloromethane (150 mL) were added
(R)-2-(tert-butoxycarbonyl(methyl)amino)propanoic acid (4.71 g,
23.22 mmol), EDC.HCl (6.59 g, 34.5 mmol), HOBt (1.55 g, 11.5 mmol)
and DIPEA (5.96 mL, 34.5 mmol) and stirred at room temperature for
18 h under nitrogen atmosphere. The reaction mixture was
concentrated under reduced pressure and the residue obtained was
taken up in water and extracted with ethyl acetate. The combined
organic extracts were washed with water and brine, dried over
Na.sub.2SO.sub.4, filtered, and concentrated under reduced pressure
to get a residue. It was purified by column chromatography
(SiO.sub.2, 1-2% methanol in chloroform) to get 1i (10 g, 86.2%) as
a pale oil.
(3S,6S,10aS)-6-((S)-2-(tert-butoxycarbonyl(methyl)amino)propanamido)-5-oxo-
decahydropyrrolo[1,2-a]azocine-3-carboxylic acid (1j)
##STR00281##
[0782] To a solution of 1i (2.5 g, 5.01 mmol) in ethanol (100 mL)
was added 10% palladium on carbon (1.0 g) and stirred at RT for 6 h
using a hydrogen balloon. The reaction mixture was filtered through
Celite and the filtrate was concentrated under reduced pressure to
get a residue. It was dissolved in dichloromethane and filtered
through Celite to remove any undissolved material and the filtrate
was concentrated under reduced pressure to get 1j (1.8 g, 87.8%) as
a white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6):
.quadrature.=1.21 (d, J=7.16 Hz, 3H), 1.39 (s, 9H), 1.53-1.92 (m,
10H), 1.99-2.10 (m, 1H), 2.18-2.28 (m, 1H), 2.73 (s, 3H), 4.16-4.24
(m, 2H), 4.33-4.75 (m, 2H), 7.76 (d, J=7 Hz, 1H), 12.45 (brs,
1H).
tert-butyl
(S)-1-(3S,6S,10aS)-3-(3-aminobenzylcarbamoyl)-5-oxodecahydropyr-
rolo[1,2-a]azocin-6-ylamino)-1-oxopropan-2-ylmethyl)carbamate
(1k)
##STR00282##
[0784] A mixture of 1j (488 mg), 3-aminobenzylamine (173 mg),
EDC.HCl (272 mg), HOBt (192 mg), N-methylmorpholine (0.39 mL) in
acetonitrile (16 mL) was stirred overnight at RT. After
concentrating under reduced pressure, the residue was directly
purified by column chromatography (SiO.sub.2, isopropanol:
dichloromethane, 7:93) to afford 420 mg of the desired aniline 1k
as white solid. .sup.1H NMR (400 MHz, CDCl.sub.3):
.quadrature.=7.08 (m, 2H), 6.59 (m, 3 H), 4.88 (m, 1H), 4.55 (t,
J=6.9 Hz, 1H), 4.34 (ddd, J=2.8, 6.0, 14.7 Hz, 2H), 4.18 (t, J=10.0
Hz, 1H), 2.79 (s, 2H), 2.5 (m, 1H), 2.1-1.4 (m), 1.48 (s, 9H), 1.32
(d, J=7.3 Hz, 3H); LCMS: m/e 516.3 (M+1).
(3S,6S,10aS)-N-(3-acrylamidobenzyl)-6-(S)-2-(methylamino)propanamido)-5-ox-
odecahydropyrrolo[1,2-a]azocine-3-carboxamide (VII-1)
##STR00283##
[0786] To a mixture of the aniline 1k (60 mg) and triethylamine (80
.mu.l) in dry dichloromethane (2 mL) was added acryloyl chloride
(19 .mu.l) dropwise at 0.degree. C. After stirring for 10 min at
0.degree. C., trifluoroacetic acid (1 mL) was added to the reaction
mixture and stirred 10 min at rt. The reaction mixture was
concentrated and the residue was purified using semi-prep HPLC (TFA
modifier) to give a white solid (VII-1) as TFA salt. .sup.1H NMR
(400 MHz, DMSO-d.sub.6): .quadrature.=10.1 (s, 1H), 8.70 (m, 2H),
8.47 (t, J=5.5 Hz, 1H), 7.57 (s, 1H), 7.50 (d, J=9.2 Hz, 1H), 7.24
(t, J=7.8 Hz, 1H), 6.98 (d, J=7.8 Hz, 1H), 6.42 (dd, J=10.1, 14.6
Hz, 1H), 6.23 (dd, J=2.3, 17.0 Hz, 1H), 5.72 (dd, J=2.3 Hz, 10.1
Hz, 1H), 4.78 (m, 1H), 4.31 (m, 2H), 4.17 (m, 2H), 3.7-1.3 (m),
1.31 (d, J=6.9 Hz, 3H); LCMS: m/e 470.2 (M+1).
Example 2
##STR00284##
[0788] tert-Butyl
(S)-1-(3S,6S,10aS)-3-(3-acrylamidobenzylcarbamoyl)-5-oxodecahydropyrrolo[-
1,2-a]azocin-6-ylamino)-1-oxopropan-2-yl(methyl)carbamate: The
title compound was prepared according to the steps and
intermediates as described below.
[0789] To a mixture of the aniline 1k (60 mg) and triethylamine (80
.mu.l) in dry dichloromethane (2 mL) was added acryloyl chloride
(19 .mu.l) dropwise at 0.degree. C. The reaction mixture was
concentrated and the residue was purified using semi-prep HPLC (TFA
modifier) to give a white solid. LCMS: m/e 470.3
(M+1-.sup.tBu).
Example 3
##STR00285##
[0791]
(3S,6S,10aS)-6-((S)-2-(methylamino)propanamido)-5-oxo-N-(3-((S)-5-o-
xotetrahydrofuran-2-carboxamido)benzyl)decahydropyrrolo[1,2-a]azocine-3-ca-
rboxamide: The title compound was prepared according to the steps
and intermediates as described below.
[0792] To a mixture of the aniline 1k (19.8 mg),
(S)-5-oxo-2-tetrahydrofurancarboxylic acid (6 mg), EDC.HCl (12 mg),
HOBt (9 mg), N-methylmorpholine (20 .mu.l) in dichloromethane (1
mL) was stirred overnight at RT. After stirring for 10 min at
0.degree. C., trifluoroacetic acid (0.3 mL) was added to the
reaction mixture and stirred 10 min at rt. The reaction mixture was
concentrated and the residue was purified using semi-prep HPLC (TFA
modifier) to give a white solid as TFA salt. LCMS: m/e 528.3
(M+1).
Example 4
##STR00286##
[0794]
(3S,6S,10aS)-6-((S)-2-(methylamino)propanamido)-5-oxo-N-(3-((S)-4-o-
xoazetidine-2-carboxamido)benzyl)decahydropyrrolo[1,2-a]azocine-3-carboxam-
ide: The title compound was prepared according to the steps and
intermediates as described below.
[0795] To a mixture of the aniline 1k (24.5 mg),
(S)-4-oxo-2-azetidinecarboxylic acid (6.6 mg), EDC.HCl (12 mg),
HOBt (9 mg), N-methylmorpholine (20 .mu.l) in dichloromethane (1
mL) was stirred overnight at RT. After stirring for 10 min at
0.degree. C., trifluoroacetic acid (0.3 mL) was added to the
reaction mixture and stirred 10 min at rt. The reaction mixture was
concentrated and the residue was purified using semi-prep HPLC (TFA
modifier) to give a white solid as TFA salt. LCMS: m/e 513.3
(M+1).
Example 5
##STR00287##
[0797]
(3S,6S,10aS)-N-(3-(2-isopropoxy-3,4-dioxocyclobut-1-enylamino)benzy-
l)-6-((S)-2-(methylamino)propanamido)-5-oxodecahydropyrrolo[1,2-a]azocine--
3-carboxamide: The title compound was prepared according to the
steps and intermediates as described below.
[0798] To a mixture of the aniline 1k (37.7 mg),
3,4-diisopropyl-3-cyclobutene-1,2-dione (16 mg), triethylamine (20
.mu.l) in dichloromethane (1 mL) was stirred overnight at RT. After
stirring for 10 min at 0.degree. C., trifluoroacetic acid (0.3 mL)
was added to the reaction mixture and stirred 10 min at rt. The
reaction mixture was concentrated and the residue was purified
using semi-prep HPLC (TFA modifier) to give a white solid as TFA
salt. LCMS: m/e 554.2 (M+1).
Example 6
##STR00288##
[0800]
(3S,6S,10aS)-6-((S)-2-(methylamino)propanamido)-5-oxo-N-(3-(3-oxobu-
tanamido)benzyl)decahydropyrrolo[1,2-a]azocine-3-carboxamide: The
title compound was prepared according to the steps and
intermediates as described below.
[0801] To a mixture of the aniline 1k (20 mg),
2,2,4-trimethyl-6-keto-1,3-dioxin (10 .mu.l) in dioxane (1 mL) was
stirred overnight at 80.degree. C. The mixture was concentrated and
diluted with dichloromethane (1 mL). Trifluoroacetic acid (0.3 mL)
was added to the reaction mixture and stirred 10 min at rt. The
reaction mixture was concentrated and the residue was purified
using semi-prep HPLC (TFA modifier) to give a white solid as TFA
salt. LCMS: m/e 500.3 (M+1).
Example 7
##STR00289##
[0803]
(3S,6S,10aS)-6-((S)-2-(methylamino)propanamido)-5-oxo-N-(3-(4,4,4-t-
rifluoro-3-oxobutanamido)benzyl)decahydropyrrolo[1,2-a]azocine-3-carboxami-
de: The title compound was prepared according to the steps and
intermediates as described below.
[0804] To a mixture of the aniline 1k (12 mg), ethyl
4,4,4-trifluoroacetoacetate (100 .mu.l) in toluene (1 mL) was
stirred for 2 h at 80.degree. C. The mixture was concentrated and
diluted with dichloromethane (1 mL). Trifluoroacetic acid (0.3 mL)
was added to the reaction mixture and stirred 10 min at rt. The
reaction mixture was concentrated and the residue was purified
using semi-prep HPLC (TFA modifier) to give a white solid as TFA
salt. LCMS: m/e 554.2 (M+1).
Example 8
##STR00290##
[0806]
(3S,6S,10aS)-N-(3-((E)-4-(dimethylamino)but-2-enamido)benzyl)-6-((S-
)-2-(methylamino)propanamido)-5-oxodecahydropyrrolo[1,2-a]azocine-3-carbox-
amide: The title compound was prepared according to the steps and
intermediates as described below.
[0807] To a mixture of the aniline 1k (12.7 mg) and
diisopropylethylamine (100 .mu.l) in dry dichloromethane (1 mL) was
added (E)-4-(dimethylamino)but-2-enoyl chloride (20 .mu.l) dropwise
at 0.degree. C. After stirring for 10 min at 0.degree. C.,
trifluoroacetic acid (1 mL) was added to the reaction mixture and
stirred 10 min at rt. The reaction mixture was concentrated and the
residue was purified using semi-prep HPLC (TFA modifier) to give a
white solid as TFA salt. LCMS: m/e 527.3 (M+1).
Example 9
##STR00291##
[0809]
(3S,6S,10aS)-N-(3-methacrylamidobenzyl)-6-((S)-2-(methylamino)propa-
namido)-5-oxodecahydropyrrolo[1,2-a]azocine-3-carboxamide: The
title compound was prepared according to the steps and
intermediates as described below.
[0810] To a mixture of the aniline 1k (10 mg) and
diisopropylethylamine (50 .mu.l) in dry dichloromethane (1 mL) was
added methacryloyl chloride (20 .mu.l) dropwise at 0.degree. C.
After stirring for 10 min at 0.degree. C., trifluoroacetic acid (1
mL) was added to the reaction mixture and stirred 10 min at rt. The
reaction mixture was concentrated and the residue was purified
using semi-prep HPLC (TFA modifier) to give a white solid as TFA
salt. LCMS: m/e 484.4 (M+1).
Example 10
##STR00292##
[0812]
(3S,6S,10aS)-6-((S)-2-(methylamino)propanamido)-N-(3-(3-methylbut-2-
-enamido)benzyl)-5-oxodecahydropyrrolo[1,2-a]azocine-3-carboxamide:
The title compound was prepared according to the steps and
intermediates as described below.
[0813] To a mixture of the aniline 1k (10 mg) and
diisopropylethylamine (50 .mu.l) in dry dichloromethane (1 mL) was
added 3-methylbut-2-enoyl chloride (20 .mu.l) dropwise at 0.degree.
C. After stirring for 10 min at 0.degree. C., trifluoroacetic acid
(1 mL) was added to the reaction mixture and stirred 10 min at rt.
The reaction mixture was concentrated and the residue was purified
using semi-prep HPLC (TFA modifier) to give a white solid as TFA
salt. LCMS: m/e 498.3 (M+1).
Example 11
##STR00293##
[0815] VII-16 was prepared according to the steps and intermediates
as described below.
[0816] To a mixture of the aniline 1k (13.2 mg), acrylic acid-d4
(1.7 .mu.l), EDC.HCl (8 mg), HOBt (6 mg), N-methylmorpholine (13
.mu.l) in dichloromethane (1 mL) was stirred overnight at RT. After
stirring for 10 min at 0.degree. C., trifluoroacetic acid (0.3 mL)
was added to the reaction mixture and stirred 10 min at rt. The
reaction mixture was concentrated and the residue was purified
using semi-prep HPLC (TFA modifier) to give a white solid as TFA
salt. LCMS: m/e 473.2 (M+1).
Example 12
##STR00294##
[0818]
(3S,6S,10aS)-6-((S)-2-(methylamino)propanamido)-5-oxo-N-(3-((R)-5-o-
xotetrahydrofuran-2-carboxamido)benzyl)decahydropyrrolo[1,2-a]azocine-3-ca-
rboxamide: The title compound was prepared according to the steps
and intermediates as described below.
[0819] To a mixture of the aniline 1k (8.1 mg),
(R)-5-oxo-2-tetrahydrofurancarboxylic acid (2.4 mg), EDC.HCl (5
mg), HOBt (4 mg), N-methylmorpholine (10 .mu.l) in dichloromethane
(1 mL) was stirred overnight at RT. After stirring for 10 min at
0.degree. C., trifluoroacetic acid (0.3 mL) was added to the
reaction mixture and stirred 10 min at rt. The reaction mixture was
concentrated and the residue was purified using semi-prep HPLC (TFA
modifier) to give a white solid as TFA salt. LCMS: m/e 528.3
(M+1).
Example 13
##STR00295##
[0821]
(3S,6S,10aS)-6-((S)-2-(methylamino)propanamido)-5-oxo-N-(3-(vinylsu-
lfonamido)benzyl)decahydropyrrolo[1,2-a]azocine-3-carboxamide: The
title compound was prepared according to the steps and
intermediates as described below.
[0822] To a mixture of the aniline 1k (30 mg) and
diisopropylethylamine (50 .mu.l) in dry dichloromethane (1 mL) was
added 2-chloro-1-ethanesulfonyl chloride (5 .mu.l) dropwise at
0.degree. C. After stirring for 30 min at 0.degree. C. to rt,
trifluoroacetic acid (1 mL) was added to the reaction mixture and
stirred 10 min at rt. The reaction mixture was concentrated and the
residue was purified using semi-prep HPLC (TFA modifier) to give a
white solid as TFA salt. LCMS: m/e 506.2 (M+1).
Example 14
##STR00296##
[0824]
(3S,6S,10aS)-6-((S)-2-(methylamino)propanamido)-5-oxo-N-(3-((4R)-4,-
7,7-trimethyl-3-oxo-2-oxabicyclo[2.2.1]heptane-1-carboxamido)benzyl)decahy-
dropyrrolo[1,2-a]azocine-3-carboxamide: The title compound was
prepared according to the steps and intermediates as described
below.
[0825] To a mixture of the aniline 1k (8.0 mg), (1S)-(-)-camphanic
acid (6.0 mg), EDC.HCl (8 mg), HOBt (6 mg), N-methylmorpholine (10
.mu.l) in dichloromethane (1 mL) was stirred 2 days at RT. After
stirring for 10 min at 0.degree. C., trifluoroacetic acid (0.3 mL)
was added to the reaction mixture and stirred 10 min at rt. The
reaction mixture was concentrated and the residue was purified
using semi-prep HPLC (TFA modifier) to give a white solid as TFA
salt. LCMS: m/e 596.4 (M+1).
Example 15
##STR00297##
[0827]
(3S,6S,10aS)-6-((S)-2-(methylamino)propanamido)-5-oxo-N-(3-((4S)-4,-
7,7-trimethyl-3-oxo-2-oxabicyclo[2.2.1]heptane-1-carboxamido)benzyl)decahy-
dropyrrolo[1,2-a]azocine-3-carboxamide: The title compound was
prepared according to the steps and intermediates as described
below.
[0828] To a mixture of the aniline 1k (8.1 mg), (1R)-(+)-camphanic
acid (12 mg), EDC.HCl (16 mg), HOBt (12 mg), N-methylmorpholine (10
.mu.l) in dichloromethane (1 mL) was stirred 3 days at RT. After
stirring for 10 min at 0.degree. C., trifluoroacetic acid (0.3 mL)
was added to the reaction mixture and stirred 10 min at rt. The
reaction mixture was concentrated and the residue was purified
using semi-prep HPLC (TFA modifier) to give a white solid as TFA
salt. LCMS: m/e 596.3 (M+1).
Example 16
##STR00298##
[0830]
(3S,6S,10aS)-N-(3-(1-acetylcyclopropanecarboxamido)benzyl)-6-0S)-2--
(methylamino)propanamido)-5-oxodecahydropyrrolo[1,2-a]azocine-3-carboxamid-
e: The title compound was prepared according to the steps and
intermediates as described below.
[0831] To a mixture of the aniline 1k (14.2 mg),
1-acetylcyclopropanecarboxylic acid (10 mg), HATU (20 mg),
diisopropylethylamine (10 .mu.l) in dichloromethane (1 mL) was
stirred overnight at RT. After stirring for 10 min at 0.degree. C.,
trifluoroacetic acid (0.3 mL) was added to the reaction mixture and
stirred 10 min at rt. The reaction mixture was concentrated and the
residue was purified using semi-prep HPLC (TFA modifier) to give a
white solid as TFA salt. LCMS: m/e 526.3 (M+1).
Example 17
##STR00299##
[0833]
(3S,6S,10aS)-6-((S)-2-(methylamino)propanamido)-5-oxo-N-(3-((S)-5-o-
xopyrrolidine-2-carboxamido)benzyl)decahydropyrrolo[1,2-a]azocine-3-carbox-
amide: The title compound was prepared according to the steps and
intermediates as described below.
[0834] To a mixture of the aniline 1k (8 mg),
(S)-2-pyrrolidine-5-carboxylic acid (5 mg), EDC.HCl (10 mg), HOBt
(7 mg), diisopropylethylamine (10 .mu.l) in dichloromethane (1 mL)
was stirred overnight at RT. After stirring for 10 min at 0.degree.
C., trifluoroacetic acid (0.3 mL) was added to the reaction mixture
and stirred 10 min at rt. The reaction mixture was concentrated and
the residue was purified using semi-prep HPLC (TFA modifier) to
give a white solid as TFA salt. LCMS: m/e 527.2 (M+1).
Example 18
##STR00300##
[0836]
(3S,6S,10aS)-6-((S)-2-(methylamino)propanamido)-5-oxo-N-(3-((R)-5-o-
xopyrrolidine-2-carboxamido)benzyl)decahydropyrrolo[1,2-a]azocine-3-carbox-
amide: The title compound was prepared according to the steps and
intermediates as described below.
[0837] To a mixture of the aniline 1k (8 mg),
(R)-2-pyrrlidine-5-carboxylic acid (5 mg), EDC.HCl (10 mg), HOB t
(7 mg), diisopropylethylamine (10 .mu.l) in dichloromethane (1 mL)
was stirred overnight at RT. After stirring for 10 min at 0.degree.
C., trifluoroacetic acid (0.3 mL) was added to the reaction mixture
and stirred 10 min at rt. The reaction mixture was concentrated and
the residue was purified using semi-prep HPLC (TFA modifier) to
give a white solid as TFA salt. LCMS: m/e 527.2 (M+1).
Example 19
##STR00301##
[0839]
(3S,6S,10aS)-6-((S)-2-(methylamino)propanamido)-5-oxo-N-(3-(2-oxote-
trahydrofuran-3-carboxamido)benzyl)decahydropyrrolo[1,2-a]azocine-3-carbox-
amide: The title compound was prepared according to the steps and
intermediates as described below.
[0840] To a mixture of the aniline 1k (8 mg),
2-oxo-3-tetrahydrofurancarboxylic acid (10 mg), EDC.HCl (10 mg),
HOBt (7 mg), diisopropylethylamine (10 .mu.l) in dichloromethane (1
mL) was stirred overnight at RT. After stirring for 10 min at
0.degree. C., trifluoroacetic acid (0.3 mL) was added to the
reaction mixture and stirred 10 min at rt. The reaction mixture was
concentrated and the residue was purified using semi-prep HPLC (TFA
modifier) to give a white solid as TFA salt. LCMS: m/e 528.3
(M+1).
Example 20
##STR00302##
[0842]
(3S,6S,10aS)-6-((S)-2-(methylamino)propanamido)-5-oxo-N-(3-(5-oxote-
trahydrofuran-3-carboxamido)benzyl)decahydropyrrolo[1,2-a]azocine-3-carbox-
amide: The title compound was prepared according to the steps and
intermediates as described below.
[0843] To a mixture of the aniline 1k (8 mg),
2-oxo-4-tetrahydrofurancarboxylic acid (10 mg), EDC.HCl (10 mg),
HOBt (7 mg), diisopropylethylamine (10 .mu.l) in dichloromethane (1
mL) was stirred overnight at RT. After stirring for 10 min at
0.degree. C., trifluoroacetic acid (0.3 mL) was added to the
reaction mixture and stirred 10 min at rt. The reaction mixture was
concentrated and the residue was purified using semi-prep HPLC (TFA
modifier) to give a white solid as TFA salt. LCMS: m/e 528.3
(M+1).
Example 21
##STR00303##
[0845]
(3S,6S,10aS)-6-((S)-2-(methylamino)propanamido)-5-oxo-N-(3-((R)-4-o-
xoazetidine-2-carboxamido)benzyl)decahydropyrrolo[1,2-a]azocine-3-carboxam-
ide: The title compound was prepared according to the steps and
intermediates as described below.
[0846] To a mixture of the aniline 1k (16 mg),
(R)-4-oxo-2-azetidinecarboxylic acid (12 mg), EDC.HCl (20 mg), HOBt
(14 mg), disoppropylethylamine (20 .mu.l) in dichloromethane (1 mL)
was stirred overnight at RT. After stirring for 10 min at 0.degree.
C., trifluoroacetic acid (0.3 mL) was added to the reaction mixture
and stirred 10 min at rt. The reaction mixture was concentrated and
the residue was purified using semi-prep HPLC (TFA modifier) to
give a white solid as TFA salt. LCMS: m/e 513.3 (M+1).
Example 22
##STR00304##
[0848] tert-butyl
(S)-1-03S,6S,10aS)-3-(3-(2,4-dioxopentan-3-yl)benzylcarbamoyl)-5-oxodecah-
ydropyrrolo[1,2-a]azocin-6-ylamino)-1-oxopropan-2-yl(methyl)carbamate:
The title compound was prepared according to the steps and
intermediates as described below.
[0849] A mixture of 1j (250 mg), 3-iodobenzylamine (97 ul), EDC.HCl
(152 mg), HOBt (99 mg), N-methylmorpholine (0.20 mL) in
acetonitrile (10 mL) was stirred overnight at RT. After
concentrating under reduced pressure, the residue was directly
purified by column chromatography (SiO.sub.2, isopropanol:
dichloromethane, 7:93) to afford 300 mg of the desired iodide.
LCMS: m/e 527.2 (M+1-.sup.tBu).
[0850] To the prepared iodide (32 mg) in DMSO (1 mL) were added
copper iodide (1.0 mg), L-proline (1.2 mg), cesium carbonate (66
mg) and acetyl acetone (10 ul) and stirred at 90.degree. C. for 2
h. The reaction mixture was filtered and the filtrate was purified
using semi-prep HPLC (TFA modifier) to give a solid. LCMS: m/e
499.2 (M+1-.sup.tBu).
Example 23
##STR00305##
[0852]
(3S,6S,10aS)-N-(3-(2,4-dioxopentan-3-yl)benzyl)-6-((S)-2-(methylami-
no)propanamido)-5-oxodecahydropyrrolo[1,2-a]azocine-3-carboxamide:
The title compound was prepared according to the steps and
intermediates as described below.
[0853] To the tert-butyl
(S)-1-((3S,6S,10aS)-3-(3-(2,4-dioxopentan-3-yl)benzylcarbamoyl)-5-oxodeca-
hydropyrrolo[1,2-a]azocin-6-ylamino)-1-oxopropan-2-yl(methyl)carbamate
(VII-7) (7 mg) in dichloromethane (1 mL) was added trifluoroacetic
acid (0.3 mL) and stirred 10 min at rt. The reaction mixture was
concentrated and the residue was purified using semi-prep HPLC (TFA
modifier) to give a white solid as TFA salt. LCMS: m/e 499.2
(M+1).
Example 24
##STR00306##
[0855]
(3S,6S,10aS)-6-((S)-2-(methylamino)propanamido)-5-oxo-N-(3-((S)-2-o-
xotetrahydrofuran-3-ylcarbamoyl)benzyl)decahydropyrrolo[1,2-a]azocine-3-ca-
rboxamide: The title compound was prepared according to the steps
and intermediates as described below.
##STR00307##
(S)-tert-butyl
3-(2-oxotetrahydrofuran-3-ylcarbamoyl)benzylcarbamate (2a)
##STR00308##
[0857] A mixture of 3-((tert-butoxycarbonylamino)methyl)benzoic
acid (100 mg), (S)-3-aminodihydrofuran-2(3H)-one hydrochloride (55
mg), EDC.HCl (92 mg), HOBt (64 mg), N-methylmorpholine (0.13 mL) in
acetonitrile (2 mL) was stirred overnight at RT. After
concentrating under reduced pressure, the residue was directly
purified by column chromatography (SiO.sub.2, heptane:ethyl
acetate, 10:90) to afford 120 mg of the desired aniline 2a as white
solid. .sup.1H NMR (400 MHz, CDCl.sub.3): .quadrature.=7.7-7.2 (m,
6H), 5.21 (s, 1H), 4.96 (m, 1H), 4.54 (t, J=9.2 Hz, 1H), 4.32 (m,
3H), 2.86 (m, 1H), 2.31 (m, 1H), 1.47 (s, 9H).
##STR00309##
(3S,6S,10aS)-6-((S)-2-(methylamino)propanamido)-5-oxo-N-(3-((S)-2-oxotetr-
ahydrofuran-3-ylcarbamoyl)benzyl)decahydropyrrolo[1,2-a]azocine-3-carboxam-
ide
[0858] To a lactone 2a (40 mg) in dry dichloromethane (1 mL) was
added trifluoroacetic acid (0.3 mL) dropwise at rt. After stirring
for 10 min at rt, the reaction mixture was completely concentrated
under reduced pressure. To this residue 2b in dry dichloromethane
(1 mL) were added 1j (12 mg), EDC.HCl (5.6 mg), HOBt (4.3 mg),
N-methylmorpholine (9.6 .mu.l) and the resulting mixture was
stirred overnight at rt. Trifluoroacetic acid (0.3 mL) was added to
the reaction mixture and stirred 10 min at rt. The reaction mixture
was concentrated and the residue was purified using semi-prep HPLC
(TFA modifier) to give a white solid VII-13 as TFA salt. .sup.1H
NMR (400 MHz, DMSO-d.sub.6): .quadrature.=8.95 (d, J=8.2 Hz, 1 H),
8.75 (m, 2H), 8.70 (d, J=6.8 Hz, 1H), 8.55 (t, J=6.0 Hz, 1H), 7.72
(m, 2H), 7.44 (m, 2H), 4.76 (m, 2H), 4.43-4.15 (m, 5H), 3.80 (q,
J=6.4 Hz, 1H), 2.5-1.4 (m), 1.31 (d, J=6.8 Hz, 3H); LCMS: m/e 528.3
(M+1).
Example 25
##STR00310##
[0860]
(3S,6S,10aS)-6-((S)-2-(methylamino)propanamido)-5-oxo-N-(3-(6-oxote-
trahydro-2H-pyran-2-carboxamido)benzyl)decahydropyrrolo[1,2-a]azocine-3-ca-
rboxamide: The title compound was prepared according to the steps
and intermediates as described below.
[0861] To a tert-butyl
3-(6-oxotetrahydro-2H-pyran-2-carboxamido)benzylcarbamate (20 mg)
in dry dichloromethane (1 mL) was added trifluoroacetic acid (0.3
mL) dropwise at rt. After stirring for 10 min at rt, the reaction
mixture was completely concentrated under reduced pressure. To this
residue in dry dichloromethane (1 mL) were added 1j (12 mg),
EDC.HCl (20 mg), HOBt (14 mg), N-methylmorpholine (20 .mu.l) and
the resulting mixture was stirred overnight at rt. Trifluoroacetic
acid (0.3 mL) was added to the reaction mixture and stirred 10 min
at rt. The reaction mixture was concentrated and the residue was
purified using semi-prep HPLC (TFA modifier) to give a white solid
as TFA salt. LCMS: m/e 542.3 (M+1).
Example 26
##STR00311##
[0863] 4,4-dimethyl-2-oxotetrahydrofuran-3-yl
3-(((3S,6S,10aS)-6-((S)-2-(methylamino)propanamido)-5-oxodecahydropyrrolo-
[1,2-a]azocine-3-carboxamido)methyl)benzoate: The title compound
was prepared according to the steps and intermediates as described
below.
[0864] To a 4,4-dimethyl-2-oxotetrahydrofuran-3-yl
3-((tert-butoxycarbonylamino)methyl)benzoate (40 mg) in dry
dichloromethane (1 mL) was added trifluoroacetic acid (0.3 mL)
dropwise at rt. After stirring for 10 min at rt, the reaction
mixture was completely concentrated under reduced pressure. To this
residue in dry dichloromethane (1 mL) were added 1j (12 mg),
EDC.HCl (5.6 mg), HOBt (4.3 mg), N-methylmorpholine (9.6 .mu.l) and
the resulting mixture was stirred overnight at rt. Trifluoroacetic
acid (0.3 mL) was added to the reaction mixture and stirred 10 min
at rt. The reaction mixture was concentrated and the residue was
purified using semi-prep HPLC (TFA modifier) to give a white solid
as TFA salt. LCMS: m/e 557.3 (M+1).
Example 27
##STR00312##
[0866] 2-oxotetrahydrofuran-3-yl
3-(((3S,6S,10aS)-6-((S)-2-(methylamino)propanamido)-5-oxodecahydropyrrolo-
[1,2-a]azocine-3-carboxamido)methyl)benzoate: The title compound
was prepared according to the steps and intermediates as described
below.
[0867] To a 2-oxotetrahydrofuran-3-yl
3-((tert-butoxycarbonylamino)methyl)benzoate (40 mg) in dry
dichloromethane (1 mL) was added trifluoroacetic acid (0.3 mL)
dropwise at rt. After stirring for 10 min at rt, the reaction
mixture was completely concentrated under reduced pressure. To this
residue in dry dichloromethane (1 mL) were added 1j (12 mg),
EDC.HCl (5.6 mg), HOBt (4.3 mg), N-methylmorpholine (9.6 .mu.l) and
the resulting mixture was stirred overnight at rt. Trifluoroacetic
acid (0.3 mL) was added to the reaction mixture and stirred 10 min
at rt. The reaction mixture was concentrated and the residue was
purified using semi-prep HPLC (TFA modifier) to give a white solid
as TFA salt. LCMS: m/e 529.3 (M+1).
Example 28
##STR00313##
[0869]
(3S,6S,10aS)-6-((S)-2-(methylamino)propanamido)-5-oxo-N-(3-(2-oxote-
trahydrofuran-3-yloxy)benzyl)decahydropyrrolo[1,2-a]azocine-3-carboxamide:
The title compound was prepared according to the steps and
intermediates as described below.
[0870] To 3-(3-(aminomethyl)phenoxy)dihydrofuran-2(3H)-one (10 mg)
in dry dichloromethane (1 mL) were added 1j (12 mg), EDC.HCl (5.6
mg), HOBt (4.3 mg), N-methylmorpholine (9.6 .mu.l) and the
resulting mixture was stirred overnight at rt. Trifluoroacetic acid
(0.3 mL) was added to the reaction mixture and stirred 10 min at
rt. The reaction mixture was concentrated and the residue was
purified using semi-prep HPLC (TFA modifier) to give a white solid
as TFA salt. LCMS: m/e 501.3 (M+1).
Example 29
##STR00314##
[0872]
(3S,6S,10aS)-N-(3-(acrylamidomethyl)benzyl)-6-((S)-2-(methylamino)p-
ropanamido)-5-oxodecahydropyrrolo[1,2-a]azocine-3-carboxamide: The
title compound was prepared according to the steps and
intermediates as described below.
[0873] To 1,3-phenylenedimethanamine (0.1 mL) in dry
dichloromethane (1 mL) were added 1j (12 mg), EDC.HCl (5.6 mg),
HOBt (4.3 mg), N-methylmorpholine (9.6 .mu.l) and the resulting
mixture was stirred overnight at rt. At 0.degree. C., acryloyl
chloride was added and stirred for 10 min at 0.degree. C.
Trifluoroacetic acid (0.3 mL) was added to the reaction mixture and
stirred 10 min at rt. The reaction mixture was concentrated and the
residue was purified using semi-prep HPLC (TFA modifier) to give a
white solid as TFA salt. LCMS: m/e 484.3 (M+1).
Example 30
##STR00315##
[0875]
(3S,6S,10aS)-6-((S)-2-(methylamino)propanamido)-N-(3-(3-methylbut-2-
-enoyl)benzyl)-5-oxodecahydropyrrolo[1,2-a]azocine-3-carboxamide:
The title compound was prepared according to the steps and
intermediates as described below.
[0876] To a tert-butyl 3-(3-methylbut-2-enoyl)benzylcarbamate (40
mg) in dry dichloromethane (1 mL) was added trifluoroacetic acid
(0.3 mL) dropwise at rt. After stirring for 10 min at rt, the
reaction mixture was completely concentrated under reduced
pressure. To this residue in dry dichloromethane (1 mL) were added
1j (28 mg), EDC.HCl (17.3 mg), HOBt (12.2 mg), N-methylmorpholine
(25 .mu.l) and the resulting mixture was stirred overnight at rt.
Trifluoroacetic acid (0.3 mL) was added to the reaction mixture and
stirred 10 min at rt. The reaction mixture was concentrated and the
residue was purified using semi-prep HPLC (TFA modifier) to give a
white solid as TFA salt. LCMS: m/e 483.3 (M+1).
Example 31
##STR00316##
[0878]
(3S,6S,10aS)-6-((S)-2-(methylamino)propanamido)-5-oxo-N-(3-((1S,4S)-
-3-oxo-2-oxa-5-azabicyclo[2.2.1]heptane-5-carbonyl)benzyl)decahydropyrrolo-
[1,2-a]azocine-3-carboxamide: The title compound was prepared
according to the steps and intermediates as described below.
[0879] To a tert-butyl
3-((1S,4S)-3-oxo-2-oxa-5-azabicyclo[2.2.1]heptane-5-carbonyl)benzylcarbam-
ate (55 mg) in dry dichloromethane (1 mL) was added trifluoroacetic
acid (0.3 mL) dropwise at rt. After stirring for 10 min at rt, the
reaction mixture was completely concentrated under reduced
pressure. To this residue in dry dichloromethane (1 mL) were added
1j (28 mg), EDC.HCl (17.3 mg), HOBt (12.2 mg), N-methylmorpholine
(25 .mu.l) and the resulting mixture was stirred overnight at rt.
Trifluoroacetic acid (0.3 mL) was added to the reaction mixture and
stirred 10 min at rt. The reaction mixture was concentrated and the
residue was purified using semi-prep HPLC (TFA modifier) to give a
white solid as TFA salt. LCMS: m/e 540.3 (M+1). VII-20
Example 32
##STR00317##
[0881]
(3S,6S,10aS)-6-((S)-2-(methylamino)propanamido)-5-oxo-N-(3-((S)-5-o-
xotetrahydrofuran-3-ylcarbamoyl)benzyl)decahydropyrrolo[1,2-a]azocine-3-ca-
rboxamide: The title compound was prepared according to the steps
and intermediates as described below.
[0882] To a (S)-tert-butyl
3-(5-oxotetrahydrofuran-3-ylcarbamoyl)benzylcarbamate (20 mg) in
dry dichloromethane (1 mL) was added trifluoroacetic acid (0.3 mL)
dropwise at rt. After stirring for 10 min at rt, the reaction
mixture was completely concentrated under reduced pressure. To this
residue in dry dichloromethane (1 mL) were added 1j (20 mg),
EDC.HCl (17.3 mg), HOBt (12.2 mg), N-methylmorpholine (50 .mu.l)
and the resulting mixture was stirred overnight at rt.
Trifluoroacetic acid (0.3 mL) was added to the reaction mixture and
stirred 10 min at rt. The reaction mixture was concentrated and the
residue was purified using semi-prep HPLC (TFA modifier) to give a
white solid as TFA salt. LCMS: m/e 528.3 (M+1).
Example 33
##STR00318##
[0884]
(3S,6S,10aS)-6-((S)-2-(methylamino)propanamido)-5-oxo-N-(3-((1R,4R)-
-3-oxo-2-oxa-5-azabicyclo[2.2.1]heptane-5-carbonyl)benzyl)decahydropyrrolo-
[1,2-a]azocine-3-carboxamide: The title compound was prepared
according to the steps and intermediates as described below.
[0885] To a tert-butyl
3-((1R,4R)-3-oxo-2-oxa-5-azabicyclo[2.2.1]heptane-5-carbonyl)benzylcarbam-
ate (30 mg) in dry dichloromethane (1 mL) was added trifluoroacetic
acid (0.3 mL) dropwise at rt. After stirring for 10 min at rt, the
reaction mixture was completely concentrated under reduced
pressure. To this residue in dry dichloromethane (1 mL) were added
1j (11.5 mg), EDC.HCl (17 mg), HOBt (12 mg), N-methylmorpholine (10
.mu.l) and the resulting mixture was stirred overnight at rt.
Trifluoroacetic acid (0.3 mL) was added to the reaction mixture and
stirred 10 min at rt. The reaction mixture was concentrated and the
residue was purified using semi-prep HPLC (TFA modifier) to give a
white solid as TFA salt. LCMS: m/e 540.3 (M+1).
Example 34
##STR00319##
[0887]
(3S,6S,10aS)-6-((S)-2-(methylamino)propanamido)-5-oxo-N-(3-((R)-2-o-
xotetrahydrofuran-3-ylcarbamoyl)benzyl)decahydropyrrolo[1,2-a]azocine-3-ca-
rboxamide: The title compound was prepared according to the steps
and intermediates as described below.
[0888] To a (R)-tert-butyl
3-(5-oxotetrahydrofuran-3-ylcarbamoyl)benzylcarbamate (37 mg) in
dry dichloromethane (1 mL) was added trifluoroacetic acid (0.3 mL)
dropwise at rt. After stirring for 10 min at rt, the reaction
mixture was completely concentrated under reduced pressure. To this
residue in dry dichloromethane (1 mL) were added 1j (10 mg),
EDC.HCl (17.3 mg), HOBt (12.2 mg), N-methylmorpholine (10 .mu.l)
and the resulting mixture was stirred overnight at rt.
Trifluoroacetic acid (0.3 mL) was added to the reaction mixture and
stirred 10 min at rt. The reaction mixture was concentrated and the
residue was purified using semi-prep HPLC (TFA modifier) to give a
white solid as TFA salt. LCMS: m/e 528.3 (M+1).
Example 35
##STR00320##
[0890]
3-(((3S,6S,10aS)-6-((S)-2-(methylamino)propanamido)-5-oxodecahydrop-
yrrolo[1,2-a]azocine-3-carboxamido)methyl)benzyl 3-oxobutanoate:
The title compound was prepared according to the steps and
intermediates as described below.
[0891] To (3-(aminomethyl)phenyl)methanol (10 mg) in dry
dichloromethane (1 mL) were added 1j (13.7 mg), EDC.HCl (7 mg),
HOBt (5.0 mg), N-methylmorpholine (10 .mu.l) and the resulting
mixture was purified using semi-prep HPLC (TFA modifier). To a
mixture of the isolated product (5 mg),
2,2,4-trimethyl-6-keto-1,3-dioxin (10 .mu.l) in dimethoxyethane (1
mL) was stirred overnight at 80.degree. C. The mixture was
concentrated and diluted with dichloromethane (1 mL).
Trifluoroacetic acid (0.3 mL) was added to the reaction mixture and
stirred 10 min at rt. The reaction mixture was concentrated and the
residue was purified using semi-prep HPLC (TFA modifier) to give a
white solid as TFA salt. LCMS: m/e 515.2 (M+1).
Example 36
##STR00321##
[0893]
3S,6S,10aS)-6-((S)-2-(methylamino)propanamido)-5-oxo-N-(3-(2-oxomor-
pholine-4-carbonyl)benzyl)decahydropyrrolo[1,2-a]azocine-3-carboxamide:
The title compound was prepared according to the steps and
intermediates as described below.
[0894] To a tert-butyl
3-(2-oxomorpholine-4-carbonyl)benzylcarbamate (20 mg) in dry
dichloromethane (1 mL) was added trifluoroacetic acid (0.3 mL)
dropwise at rt. After stirring for 10 min at rt, the reaction
mixture was completely concentrated under reduced pressure. To this
residue in dry dichloromethane (1 mL) were added 1j (10 mg),
EDC.HCl (10 mg), HOBt (7 mg), N-methylmorpholine (10 .mu.l) and the
resulting mixture was stirred overnight at rt. Trifluoroacetic acid
(0.3 mL) was added to the reaction mixture and stirred 10 min at
rt. The reaction mixture was concentrated and the residue was
purified using semi-prep HPLC (TFA modifier) to give a white solid
as TFA salt. LCMS: m/e 528.3 (M+1).
Example 37
##STR00322##
[0896]
3S,6S,10aS)-6-((S)-2-(methylamino)propanamido)-5-oxo-N-(3-(((S)-5-o-
xotetrahydrofuran-2-carboxamido)methyl)benzyl)decahydropyrrolo[1,2-a]azoci-
ne-3-carboxamide: The title compound was prepared according to the
steps and intermediates as described below.
[0897] To a (S)-tert-butyl
3-((5-oxotetrahydrofuran-2-carboxamido)methyl)benzylcarbamate (10
mg) in dry dichloromethane (1 mL) was added trifluoroacetic acid
(0.3 mL) dropwise at rt. After stirring for 10 min at rt, the
reaction mixture was completely concentrated under reduced
pressure. To this residue in dry dichloromethane (1 mL) were added
1j (10 mg), EDC.HCl (10 mg), HOBt (7 mg), N-methylmorpholine (10
.mu.l) and the resulting mixture was stirred overnight at rt.
Trifluoroacetic acid (0.3 mL) was added to the reaction mixture and
stirred 10 min at rt. The reaction mixture was concentrated and the
residue was purified using semi-prep HPLC (TFA modifier) to give a
white solid as TFA salt. LCMS: m/e 542.3 (M+1).
Example 38
##STR00323##
[0899]
3S,6S,10aS)-6-((S)-2-(methylamino)propanamido)-5-oxo-N-(3-(((R)-5-o-
xotetrahydrofuran-2-carboxamido)methyl)benzyl)decahydropyrrolo[1,2-a]azoci-
ne-3-carboxamide: The title compound was prepared according to the
steps and intermediates as described below.
[0900] To a (R)-tert-butyl
3-((5-oxotetrahydrofuran-2-carboxamido)methyl)benzylcarbamate (10
mg) in dry dichloromethane (1 mL) was added trifluoroacetic acid
(0.3 mL) dropwise at rt. After stirring for 10 min at rt, the
reaction mixture was completely concentrated under reduced
pressure. To this residue in dry dichloromethane (1 mL) were added
1j (10 mg), EDC.HCl (10 mg), HOBt (7 mg), N-methylmorpholine (10
.mu.l) and the resulting mixture was stirred overnight at rt.
Trifluoroacetic acid (0.3 mL) was added to the reaction mixture and
stirred 10 min at rt. The reaction mixture was concentrated and the
residue was purified using semi-prep HPLC (TFA modifier) to give a
white solid as TFA salt. LCMS: m/e 542.3 (M+1).
Example 39
##STR00324##
[0902]
3S,6S,10aS)-6-((S)-2-(methylamino)propanamido)-5-oxo-N-(3-(((R)-5-o-
xotetrahydrofuran-2-yl)methylcarbamoyl)benzyl)decahydropyrrolo[1,2-a]azoci-
ne-3-carboxamide: The title compound was prepared according to the
steps and intermediates as described below.
[0903] To a (R)-tert-butyl
3-((5-oxotetrahydrofuran-2-yl)methylcarbamoyl)benzylcarbamate (20
mg) in dry dichloromethane (1 mL) was added trifluoroacetic acid
(0.3 mL) dropwise at rt. After stirring for 10 min at rt, the
reaction mixture was completely concentrated under reduced
pressure. To this residue in dry dichloromethane (1 mL) were added
1j (10 mg), EDC.HCl (20 mg), HOBt (14 mg), N-methylmorpholine (20
.mu.l) and the resulting mixture was stirred overnight at rt.
Trifluoroacetic acid (0.3 mL) was added to the reaction mixture and
stirred 10 min at rt. The reaction mixture was concentrated and the
residue was purified using semi-prep HPLC (TFA modifier) to give a
white solid as TFA salt. LCMS: m/e 542.3 (M+1).
Example 40
##STR00325##
[0905]
3S,6S,10aS)-6-((S)-2-(methylamino)propanamido)-5-oxo-N-(3-(((S)-5-o-
xotetrahydrofuran-2-yl)methylcarbamoyl)benzyl)decahydropyrrolo[1,2-a]azoci-
ne-3-carboxamide: The title compound was prepared according to the
steps and intermediates as described below.
[0906] To a (S)-tert-butyl
3-((5-oxotetrahydrofuran-2-yl)methylcarbamoyl)benzylcarbamate (20
mg) in dry dichloromethane (1 mL) was added trifluoroacetic acid
(0.3 mL) dropwise at rt. After stirring for 10 min at rt, the
reaction mixture was completely concentrated under reduced
pressure. To this residue in dry dichloromethane (1 mL) were added
1j (10 mg), EDC.HCl (20 mg), HOBt (14 mg), N-methylmorpholine (20
.mu.l) and the resulting mixture was stirred overnight at rt.
Trifluoroacetic acid (0.3 mL) was added to the reaction mixture and
stirred 10 min at rt. The reaction mixture was concentrated and the
residue was purified using semi-prep HPLC (TFA modifier) to give a
white solid as TFA salt. LCMS: m/e 542.3 (M+1).
Example 41
##STR00326##
[0908]
3S,6S,10aS)-6-((S)-2-(methylamino)propanamido)-5-oxo-N-(3-(3-oxo-2--
oxa-5-azabicyclo[2.2.2]octane-5-carbonyl)benzyl)decahydropyrrolo[1,2-a]azo-
cine-3-carboxamide: The title compound was prepared according to
the steps and intermediates as described below.
[0909] To a tert-butyl
3-((1S,4S)-3-oxo-2-oxa-5-azabicyclo[2.2.2]octane-5-carbonyl)benzylcarbama-
te (20 mg) in dry dichloromethane (1 mL) was added trifluoroacetic
acid (0.3 mL) dropwise at rt. After stirring for 10 min at rt, the
reaction mixture was completely concentrated under reduced
pressure. To this residue in dry dichloromethane (1 mL) were added
1j (10 mg), EDC.HCl (20 mg), HOBt (14 mg), N-methylmorpholine (20
.mu.l) and the resulting mixture was stirred overnight at rt.
Trifluoroacetic acid (0.3 mL) was added to the reaction mixture and
stirred 10 min at rt. The reaction mixture was concentrated and the
residue was purified using semi-prep HPLC (TFA modifier) to give a
white solid as TFA salt. LCMS: m/e 544.3 (M+1).
Example 42
##STR00327##
[0911]
3S,6S,10aS)-6-((S)-2-(methylamino)propanamido)-5-oxo-N-(3-((1S)-7-o-
xo-6-oxa-2-azabicyclo[3.2.1]octane-2-carbonyl)benzyl)decahydropyrrolo[1,2--
a]azocine-3-carboxamide: The title compound was prepared according
to the steps and intermediates as described below.
[0912] To a tert-butyl
3-((1R,5S)-7-oxo-6-oxa-2-azabicyclo[3.2.1]octane-2-carbonyl)benzylcarbama-
te (18 mg) in dry dichloromethane (1 mL) was added trifluoroacetic
acid (0.3 mL) dropwise at rt. After stirring for 10 min at rt, the
reaction mixture was completely concentrated under reduced
pressure. To this residue in dry dichloromethane (1 mL) were added
1j (10 mg), EDC.HCl (20 mg), HOBt (14 mg), N-methylmorpholine (20
.mu.l) and the resulting mixture was stirred overnight at rt.
Trifluoroacetic acid (0.3 mL) was added to the reaction mixture and
stirred 10 min at rt. The reaction mixture was concentrated and the
residue was purified using semi-prep HPLC (TFA modifier) to give a
white solid as TFA salt. LCMS: m/e 554.3 (M+1).
##STR00328##
Example 43
[0913]
3S,6S,10aS)-6-((S)-2-(methylamino)propanamido)-5-oxo-N-(3-(7-oxo-6--
oxa-2-azabicyclo[3.2.1]octane-2-carbonyl)benzyl)decahydropyrrolo[1,2-a]azo-
cine-3-carboxamide: The title compound was prepared according to
the steps and intermediates as described below.
[0914] To a tert-butyl
3-((1S,5R)-7-oxo-6-oxa-2-azabicyclo[3.2.1]octane-2-carbonyl)benzylcarbama-
te (9.0 mg) in dry dichloromethane (1 mL) was added trifluoroacetic
acid (0.3 mL) dropwise at rt. After stirring for 10 min at rt, the
reaction mixture was completely concentrated under reduced
pressure. To this residue in dry dichloromethane (1 mL) were added
1j (10 mg), EDC.HCl (10 mg), HOBt (7 mg), N-methylmorpholine (10
.mu.l) and the resulting mixture was stirred overnight at rt.
Trifluoroacetic acid (0.3 mL) was added to the reaction mixture and
stirred 10 min at rt. The reaction mixture was concentrated and the
residue was purified using semi-prep HPLC (TFA modifier) to give a
white solid as TFA salt. LCMS: m/e 554.3 (M+1).
Example 44
##STR00329##
[0916]
(S)-N-(3-acrylamidobenzyl)-1-(S)-3,3-dimethyl-2-((S)-2-(methylamino-
)propanamido)butanoyl)pyrrolidine-2-carboxamide: The title compound
was prepared according to the steps and intermediates as described
below.
##STR00330##
(S)-benzyl
1-((S)-2-(tert-butoxycarbonylamino)-3,3-dimethylbutanoyl)pyrrolidine-2-ca-
rboxylate (3a)
##STR00331##
[0918] A mixture of proline benzyl ester (1.0 g), Boc-Tle-OH (1.05
g), HATU (1.73 g), diisopropylethylamine (0.5 mL) in DMF (10 mL)
was stirred overnight at RT. After concentrating under reduced
pressure, the residue was partitioned into EtOAc and saturated
sodium bicarbonate. The organic layer was dried over sodium sulfate
and filtered. The residue was purified by column chromatography
(SiO.sub.2, heptane:ethyl acetate, 60:40) to afford the desired 3a
as white solid. LCMS: m/e 319.1 (M+1-.sup.tBu).
(S)-benzyl
1-((S)-2-(S)-2-(tert-butoxycarbonylmethyl)amino)propanamido)-3,-
3-dimethylbutanoyl)pyrrolidine-2-carboxylate (3b)
##STR00332##
[0920] To 3a (110 mg) in dry dichloromethane (2 mL) was added
trifluoroacetic acid (1 mL) dropwise at rt. After stirring for 10
min at rt, the mixture was concentrated under reduced pressure. To
the residue in dry dichloromethane (3 mL) was treated with
Boc-N-Me-Ala-OH (59 mg), EDC.HCl (61 mg), HOBt (39 mg),
diisopropylethylamine (0.10 mL), and the resulting mixture was
stirred overnight at rt. The reaction mixture was partitioned into
EtOAc and washed with saturated sodium bicarbonate. The organic
layer was dried over sodium sulfate and filtered. The residue was
purified by column chromatography (SiO.sub.2, heptane:ethyl
acetate, 40:60) to give the desired 3b as colorless oil. .sup.1H
NMR (400 MHz, CDCl.sub.3): .quadrature.=7.34 (m, 5H), 5.19 (d,
J=11.9 Hz, 1H), 5.12 (d, J=11.9 Hz, 1H), 4.7 (m, 1 H), 4.61 (d,
J=14.0 Hz, 1H), 4.57 (m, 1H), 3.86 (m, 1H), 3.69 (m, 1H), 2.79 (s,
3H), 2.22 (m, 1H), 1.97 (m, 2H), 1.48 (s, 9H), 1.35 (m, 1H), 0.98
(s, 9H); LCMS: m/e 404.3 (M+1-.sup.tBu).
tert-butyl
(S)-1-(S)-1-(S)-2-(3-aminobenzylcarbamoyl)pyrrolidin-1-yl)-3,3--
dimethyl-1-oxobutan-2-ylamino)-1-oxopropan-2-yl)-methyl)carbamate
(3c)
##STR00333##
[0922] Benzyl ester 3b (100 mg) in dry methanol (10 mL) was
hydrogenated in the presence of palladium on carbon (10%, wet type)
for 2 h. The mixture was filtered and the filtrate was concentrated
under reduced pressure. To the residue in dry dichloromethane (3
mL) was treated with 3-aminobenzylamine (30 mg), EDC.HCl (61 mg),
HOBt (39 mg), diisopropylethylamine (0.10 mL), and the resulting
mixture was stirred overnight at rt. The reaction mixture was
partitioned into EtOAc and washed with saturated sodium
bicarbonate. The organic layer was dried over sodium sulfate and
filtered. The residue was purified by column chromatography
(SiO.sub.2, dichloromethane:isopropanol, 90:10) to give the desired
3c as colorless oil. .sup.1H NMR (400 MHz, CDCl.sub.3): LCMS: m/e
418.2 (M+1-.sup.tBu).
##STR00334##
S)-N-(3-acrylamidobenzyl)-1-((S)-3,3-dimethyl-2-((S)-2-(methylamino)propa-
namido)butanoyl)pyrrolidine-2-carboxamide
[0923] To a mixture of the aniline 3c (14 mg) and triethylamine (20
.mu.l) in dry dichloromethane (1 mL) was added acryloyl chloride
(10 .mu.l) dropwise at 0.degree. C. After stirring for 10 min at
0.degree. C., trifluoroacetic acid (0.3 mL) was added to the
reaction mixture and stirred 10 min at rt. The reaction mixture was
concentrated and the residue was purified using semi-prep HPLC (TFA
modifier) to give a white solid 4 as TFA salt. .sup.1H NMR (400
MHz, DMSO-d.sub.6): .quadrature.=10.0 (s, 1H), 8.75 (m, 2H), 8.53
(d, J=8.7 Hz, 1H), 8.37 (t, J=6.0 Hz, 1H), 7.52 (s, 1H), 7.45 (d,
J=8.2 Hz, 1H), 7.17 (t, J=8.2 Hz, 1H), 6.95 (d, J=7.8 Hz, 1H), 6.38
(dd, J=10.1, 16.9 Hz, 1H), 6.19 (dd, J=2.3, 16.9 Hz, 1H), 5.69 (dd,
J=2.3 Hz, 10.1 Hz, 1H), 4.46 (d, J=8.7 Hz, 1H), 4.29 (m, 1H), 4.19
(m, 1H), 3.87 (m, 1H), 3.65 (m, 2H), 2.04 (m, 1H), 1.93 (m, 1H),
1.78 (m, 2H), 1.25 (d, J=6.9 Hz, 3H), 0.95 (s, 9H); LCMS: m/e 472.2
(M+1).
Example 45
##STR00335##
[0925] tert-butyl
(S)-1-((S)-1-((S)-2-(3-acrylamidobenzylcarbamoyl)pyrrolidin-1-yl)-3,3-dim-
ethyl-1-oxobutan-2-ylamino)-1-oxopropan-2-yl(methyl)carbamate: The
title compound was prepared according to the steps and
intermediates as described below.
[0926] To a mixture of the aniline 3c (14 mg) and triethylamine (20
.mu.l) in dry dichloromethane (1 mL) was added acryloyl chloride
(10 .mu.l) dropwise at 0.degree. C. After stirring for 10 min at
0.degree. C., the reaction mixture was concentrated and the residue
was purified using semi-prep HPLC (TFA modifier) to give a white
solid 4. LCMS: m/e 472.2 (M+1-.sup.tBu).
Example 46
##STR00336##
[0928]
(S)-1-((S)-3,3-dimethyl-2-((S)-2-(methylamino)propanamido)butanoyl)-
-N-(3-((R)-5-oxotetrahydrofuran-2-carboxamido)benzyl)pyrrolidine-2-carboxa-
mide: The title compound was prepared according to the steps and
intermediates as described below.
[0929] To a mixture of the aniline 3c (12 mg),
(R)-5-oxo-2-tetrahydrofurancarboxylic acid (6 mg), EDC.HCl (10 mg),
HOBt (7 mg), diisopropylethylamine (10 .mu.l) in dichloromethane (1
mL) was stirred overnight at RT. After stirring for 10 min at
0.degree. C., trifluoroacetic acid (0.3 mL) was added to the
reaction mixture and stirred 10 min at rt. The reaction mixture was
concentrated and the residue was purified using semi-prep HPLC (TFA
modifier) to give a white solid as TFA salt. LCMS: m/e 530.3
(M+1).
Example 47
##STR00337##
[0931]
(S)-1-((S)-3,3-dimethyl-2-0S)-2-(methylamino)propanamido)butanoyl)--
N-(3-((R)-4-oxoazetidine-2-carboxamido)benzyl)pyrrolidine-2-carboxamide:
The title compound was prepared according to the steps and
intermediates as described below.
[0932] To a mixture of the aniline 3c (12 mg),
(R)-4-oxo-2-azetidinecarboxylic acid (6 mg), EDC.HCl (10 mg), HOBt
(7 mg), diisopropylethylamine (10 .mu.l) in dichloromethane (1 mL)
was stirred overnight at RT. After stirring for 10 min at 0.degree.
C., trifluoroacetic acid (0.3 mL) was added to the reaction mixture
and stirred 10 min at rt. The reaction mixture was concentrated and
the residue was purified using semi-prep HPLC (TFA modifier) to
give a white solid as TFA salt. LCMS: m/e 515.3 (M+1).
Example 48
##STR00338##
[0934]
(S)-1-((S)-3-acrylamido-2-0S)-2-(methylamino)propanamido)propanoyl)-
-N-(3-acrylamidobenzyl)pyrrolidine-2-carboxamide: The title
compound was prepared according to the steps and intermediates as
described below.
##STR00339##
(S)-benzyl
1-((S)-3-(benzyloxycarbonylamino)-2-(tert-butoxycarbonylamino)propanoyl)p-
yrrolidine-2-carboxylate (4a)
##STR00340##
[0936] A mixture of proline benzyl ester (0.66 g), Boc-Dap(Z)-OH
(1.1 g), EDC.HCl (0.58 g), HOBt (370 mg), diisopropylethylamine
(1.0 mL), in DCM (10 mL) was stirred overnight at RT. After
concentrating under reduced pressure, the residue was partitioned
into EtOAc and saturated sodium bicarbonate. The organic layer was
dried over sodium sulfate and filtered. The residue was purified by
column chromatography (SiO.sub.2, heptane:ethyl acetate, 60:40) to
afford the desired 4a as white foam. LCMS: m/e 426.2
(M+1-.sup.tBu).
(S)-benzyl
1-((S)-3-(benzyloxycarbonylamino)-2-((S)-2-(tert-butoxycarbonyl-
(methyl)amino)propanamido)propanoyl)pyrrolidine-2-carboxylate
(4b)
##STR00341##
[0938] To 4a (1.15 g) in dry dichloromethane (10 mL) was added
trifluoroacetic acid (3 mL) dropwise at rt. After stirring for 10
min at rt, the mixture was concentrated under reduced pressure. To
the residue in dry dichloromethane (10 mL) was treated with
Boc-N-Me-Ala-OH (489 mg), EDC.HCl (505 mg), HOBt (325 mg),
diisopropylethylamine (0.60 mL), and the resulting mixture was
stirred overnight at rt. The reaction mixture was partitioned into
EtOAc and washed with saturated sodium bicarbonate. The organic
layer was dried over sodium sulfate and filtered. The residue was
purified by column chromatography (SiO.sub.2, heptane:ethyl
acetate, 40:60) to give the desired 4b as white solid. LCMS: m/e
511.2 (M+1-.sup.tBu).
tert-butyl
(S)-1-(S)-3-(benzyloxycarbonylamino)-1-(S)-2-(3-aminobenzylcarb-
amoyl)pyrrolidin-1-yl)-1-oxopropan-2-ylamino)-1-oxopropan-2-yl(methyl)carb-
amate (4c)
##STR00342##
[0940] To 4b (540 mg) in water (3 mL) was added 74 mg of lithium
hydroxide in 3 mL of methanol at 0.degree. C. After 30 min, the
mixture was acidified to pH 3.0 using 1 N-HCl and partitioned into
ethyl acetate The organic layer was dried over sodium sulfate. The
mixture was filtered and the filtrate was concentrated under
reduced pressure. To the residue in dry dichloromethane (10 mL) was
treated with 3-aminobenzylamine (130 mg), EDC.HCl (204 mg), HOBt
(131 mg), diisopropylethylamine (0.60 mL), and the resulting
mixture was stirred overnight at rt. The reaction mixture was
partitioned into EtOAc and washed with saturated sodium
bicarbonate. The organic layer was dried over sodium sulfate and
filtered. The residue was purified by column chromatography
(SiO.sub.2, dichloromethane:isopropanol, 90:10) to give the desired
4c as white solid. .sup.1H NMR (400 MHz, CDCl.sub.3): LCMS: m/e
625.3 (M+1).
tert-butyl
(S)-1-(S)-3-amino-1-((S)-2-(3-aminobenzylcarbamoyl)pyrrolidin-1-
-yl)-1-oxopropan-2-ylamino)-1-oxopropan-2-yl(methyl)carbamate
(4d)
##STR00343##
[0942] To 4b (30 mg) in dry methanol (5 mL) was hydrogenated in the
presence of palladium on carbon (10%, wet type) for 2 h. The
mixture was filtered and the filtrate was concentrated under
reduced pressure to provide 4d. LCMS: m/e 491.3 (M+1).
(S)-1-((S)-3-acrylamido-2-((S)-2-(methylamino)propanamido)propanoyl)-N-(3--
acrylamidobenzyl)pyrrolidine-2-carboxamide (VIII-5)
##STR00344##
[0944] To a mixture of the aniline 4d (14 mg) and triethylamine (20
.mu.l) in dry dichloromethane (1 mL) was added acryloyl chloride
(10 .mu.l) dropwise at 0.degree. C. After stirring for 10 min at
0.degree. C., trifluoroacetic acid (0.3 mL) was added to the
reaction mixture and stirred 10 min at rt. The reaction mixture was
concentrated and the residue was purified using semi-prep HPLC (TFA
modifier) to give a white solid VIII-5 as TFA salt. LCMS: m/e 499.2
(M+1).
Example 49
##STR00345##
[0946] tert-butyl
(S)-1-((S)-3-acrylamido-1-((S)-2-(3-acrylamidobenzylcarbamoyl)pyrrolidin--
1-yl)-1-oxopropan-2-ylamino)-1-oxopropan-2-yl(methyl)carbamate: The
title compound was prepared according to the steps and
intermediates as described below.
[0947] To a mixture of the aniline 4d (14 mg) and triethylamine (20
.mu.l) in dry dichloromethane (1 mL) was added acryloyl chloride
(10 .mu.l) dropwise at 0.degree. C. After stirring for 10 min at
0.degree. C., the reaction mixture was concentrated and the residue
was purified using semi-prep HPLC (TFA modifier) to give a white
solid. LCMS: m/e 499.2 (M+1-.sup.tBu).
C. XIAP Biological Data
Example 50
Homogeneous, Fluorescence Polarization, Competition Binding Assay
Protocol for Affinity Assessment of Compound Binding to XIAP,
cIAP-1 and ML-IAP.beta. BIR3 Domains
[0948] 1.times. stocks of recombinant human XIAP; BIR3 domain
(895-XB), recombinant human cIAP-1 (818-IA) or recombinant human
ML-IAP.beta. (818-IA) from R&D Systems and Fluorescence
Polarization (FP) assay tracer (Atto-647 tagged IAP inhibitor probe
compound) were prepared in assay buffer consisting of 25 mM
Tris-HCL, pH 7.5 (Sigma), 10 mM NaCl.sub.2 (Sigma), 1 mM DTT
(Fluka) and 0.005% TritonX-100 (Pierce). While IAP protein and
tracer equilibrated at ambient temp in the dark (30-60 min),
100.times. stocks of test compound were prepared in 50%
DMSO:H.sub.2O, serially diluted and spotted (0.5
.quadrature.L/well) in duplicate wells of a 384-well, flat bottom,
polypropylene, black assay plate (Greiner #781209). Amounts used
with respect to each protein were as follows: [XIAP]=120 nM, [Assay
Tracer]=20 nM (Tracer:Protein K.sub.d=83-61 nM; 0-3 hr);
[cIAP-1]=30 nM, [Assay Tracer]=10 nM (Tracer:Protein K.sub.d=37-14
nM; 0-1 hr); and [ML-IAP.beta.]=100 nM, [Assay Tracer]=15 nM
(Tracer:Protein K.sub.d=43-55 nM; 0-3 hr). Competition binding
between test compounds and assay tracer was initiated by the
addition of 50 .quadrature.L/well of pre-equilibrated IAP protein
and assay tracer. Displacement of the assay tracer was measured in
a Synergy plate reader from BioTek (Winooski, Vt.) at
.lamda..sub.ex620/.lamda..sub.em680 through a 660 nm half-sized
dicroich mirror and S/P polarizing filters every 30 min for 3 hr.
(See Huang, X., Journal of Biomolecular Screening 8, 2003). The
resulting compound dose response data were fit to a one-site
binding K.sub.i model in GraphPad Prism from GraphPad Software (San
Diego, Calif.).
[0949] Table 2 shows the activity of selected compounds of this
invention in the Ki (XIAP), Ki (c-IAP-1, 3 h), and Ki (ML-IAP, 2 h)
Assays. Compounds having an activity designated as "A" provide an
IC50.ltoreq.10 nM; compounds having an activity designated as "B"
provide an IC50>10 nM and .ltoreq.100 nM; compounds having an
activity designated as "C" provide an IC50>100 nM and
.ltoreq.1000 nM; compounds having an activity designated as "D"
provide an IC50>1000 nM and <10,000 nM; and compounds having
an activity designated as "E" provide an IC50.gtoreq.10,000 nM.
TABLE-US-00002 TABLE 2 Inhibition Compound Enzyme/Ki Designation
VII-1 XIAP C c-IAP-1 C ML-IAP C VII-2 XIAP E c-IAP-1 E ML-IAP E
VII-3 XIAP C c-IAP-1 C VII-4 XIAP C c-IAP-1 C VII-5 XIAP B c-IAP-1
C VII-6 XIAP C c-IAP-1 B VII-7 XIAP E c-IAP-1 E VII-8 XIAP B
c-IAP-1 C VII-9 XIAP B c-IAP-1 C VII-10 XIAP C c-IAP-1 C VII-11
XIAP C c-IAP-1 C VII-12 XIAP C c-IAP-1 B VII-13 XIAP C c-IAP-1 C
VII-14 XIAP C c-IAP-1 D VII-15 XIAP B c-IAP-1 C VII-16 XIAP C
c-IAP-1 C ML-IAP C VII-17 XIAP B c-IAP-1 C VII-18 XIAP C c-IAP-1 C
VII-19 XIAP C c-IAP-1 B VII-20 XIAP B c-IAP-1 C VII-21 XIAP C
c-IAP-1 C ML-IAP D VII-22 XIAP C c-IAP-1 C VII-23 XIAP B c-IAP-1 A
ML-IAP B VII-24 XIAP C c-IAP-1 C VII-25 XIAP C c-IAP-1 C VII-26
XIAP C c-IAP-1 C VII-27 XIAP C c-IAP-1 C VII-28 XIAP B c-IAP-1 B
VII-29 XIAP C c-IAP-1 D ML-IAP B VII-30 XIAP B c-IAP-1 B ML-IAP B
VII-31 XIAP C c-IAP-1 C VII-32 XIAP C c-IAP-1 C VII-33 XIAP C
c-IAP-1 D VII-34 XIAP C c-IAP-1 C VII-35 XIAP B c-IAP-1 A VII-36
XIAP C c-IAP-1 C ML-IAP D VII-37 XIAP C c-IAP-1 C VII-38 XIAP C
c-IAP-1 D VII-39 XIAP C c-IAP-1 C VII-40 XIAP C c-IAP-1 C VII-41
XIAP C c-IAP-1 C VII-42 XIAP C c-IAP-1 C VII-43 XIAP C c-IAP-1 D
ML-IAP E VII-44 XIAP C c-IAP-1 C VII-45 XIAP C c-IAP-1 D VII-46
XIAP B c-IAP-1 C VII-47 XIAP C c-IAP-1 D VII-48 XIAP C c-IAP-1
C
D. Mass Spectrometric Analysis of XIAP Contacted with Compounds of
the Invention
Example 51
[0950] Intact XIAP was incubated for 18 hr at a 10-fold excess of
VII-1 to protein. 3 ul aliquots of the samples were diluted with 10
ul of 0.1% TFA prior to micro C4 ZipTipping directly onto the MALDI
target using Sinapinic acid as the desorption matrix (10 mg/mL in
0.1% TFA:Acetonitrile 50:50). The top panel of FIG. 6 shows mass
spectrometric trace of the intact XIAP protein (m/z 13,096 Da). The
bottom panel of FIG. 6 shows mass spectrometric trace of XIAP
incubated with VII-1 (mw=469.59) for 18 hr (m/z of 13,513), which
shows a mass shift of 417 Da, with no m/z of 13,096, which
indicates complete modification of XIAP by VII-1 within 18 h.
Example 52
[0951] Intact XIAP was incubated for 18 hr at a 10-fold excess of
VII-1 to protein. After incubation, the protein was cleaned using a
low volume ZEBA desalting column and then diluted with an equal
volume of 0.2M ammonium bicarbonate with 1 mM DTT. The protein was
then reduced by heating at 56.degree. C. for 45 min. After
incubation, the sample was allowed to cool to room temperature and
a 1.9 .mu.g/.mu.L iodoacetamide solution was added and incubated
for 30 min at room temperature to alkylate cysteine residues.
Sequencing grade trypsin (promega) was added at a 1:20
(protease:protein) ratio and incubated at 37.degree. C. for 16
hours. Peptides are then purified and enriched using C4 packed
pipette tips (Millipore) and spotted directly on the MALDI target
plate with alpha-cyano-4-hydroxy-cinnamic acid as the matrix (10
mg/mL in 0.1% TFA:Acetonitrile 50:50).
[0952] The top panel of FIG. 7 shows the mass spectrometric trace
of the mass region for the control XIAP digest, and the bottom
panel of FIG. 7 shows the mass spectrometric trace for the digest
of XIAP incubated with VII-1. A peptide with a m/z of 1,826 Da is
identified in the XIAP+VII-21 digest, but was not observed in the
control XIAP digest, which corresponds to the mass of the peptide
amino acids 287-299 (AGFYALGEGDKVK (SEQ ID NO.:174)) from XIAP
containing a single VII-1 modification. Modification of the peptide
occurred at lysine K297 and not at K299, because if the
modification had occurred at K299, the trypsin digest would not
occur at that site, indicating that VII-1 binds to K297 of
XIAP.
Example 53
[0953] Intact XIAP was incubated for 18 hr at a 10-fold excess of
VII-21 to protein. 3 ul aliquots of the samples were diluted with
10 ul of 0.1% TFA prior to micro C4 ZipTipping directly onto the
MALDI target using Sinapinic acid as the desorption matrix (10
mg/mL in 0.1% TFA:Acetonitrile 50:50). Results: The top panel of
FIG. 8 shows the mass spectrometric trace of intact XIAP protein
(m/z 12,994 Da). The bottom panel of FIG. 8 shows the mass
spectrometric trace of XIAP incubated with VII-21 (mw=572.62) for
18 hr (m/z of 13,516), which shows a mass shift of 522 Da, and no
m/z at 12,994 Da, indicating complete modification of XIAP by
VII-21 within 18 h.
Example 54
[0954] Intact XIAP was incubated for 18 hr at a 10-fold excess of
VII-21 to protein. After incubation the protein was cleaned using a
low volume ZEBA desalting column and then diluted with an equal
volume of 100 mM TrisHCl, 10 mM CaCl.sub.2, with 1 mM DTT pH 7.8.
The protein was then reduced by heating at 56.degree. C. for 45
min. After incubation, the sample was then allowed to cool to room
temperature and then a 1.9 .mu.g/.mu.L iodoacetamide solution was
added and incubated for 30 min at room temperature to alkylate
cysteine residues. Finally, chymotrypsin (Roche) was added at a
1:20 (protease:protein) ratio and incubated at room temperature for
16 hours. Peptides were then purified and enriched using C4 packed
pipette tips (Millipore) and spotted directly on the MALDI target
plate with alpha-cyano-4-hydroxy-cinnamic acid as the matrix (10
mg/mL in 0.1% TFA:Acetonitrile 50:50).
[0955] The top panel of FIG. 9 shows the mass spectrometric trace
of the mass region of the molecular weight for the control XIAP
digest, and the bottom panel of FIG. 9 shows the mass spectrometric
trace of the digest of XIAP incubated with VII-21. A peptide with
an m/z of 1,750 Da is identified in the XIAP+VII-21 digest that is
absent in the control XIAP digest. This peptide corresponds to the
mass of the peptide of amino acids 291-301 (ALGEGDKVKCF (SEQ ID
NO.:175)) from XIAP containing a single VII-21 modification and the
cysteine alkylated iodoacetamide.
E. HCV Protease Synthetic Examples
Example 55
##STR00346##
[0957]
(5S)-1-((S)-2-(tert-butoxycarbonylamino)-5-oxo-5-((1R,4R)-3-oxo-2-o-
xa-5-azabicyclo[2.2.1]heptan-5-yl)pentanoyl)-5-((1R,2S)-1-(cyclopropylsulf-
onylcarbamoyl)-2-vinylcyclopropylcarbamoyl)pyrrolidin-3-yl
4-fluoroisoindoline-2-carboxylate: The title compound was prepared
according to the steps and intermediates as described below.
Intermediate 1a
##STR00347##
[0959] To a solution of (1R,2S)-1-amino-2-vinylcyclopropane
carboxylic acid ethyl ester toluenesulfonic acid (0.33 g, 1.0 mmol)
and
(2S,4R)-1-(tert-butoxycarbonyl)-4-(4-fluoroisoindoline-2-carbonyloxy)pyrr-
olidine-2-carboxylic acid (0.4 g, 1.0 mmol) in 10 mL of
acetonitrile was added HATU (0.44 g, 1.2 mmol) and then DIEA (0.46
mL, 2.5 mmol) under stirring. The mixture was stirred at r.t. for
two hours. After the complete consumption of starting materials,
the reaction mixture was evaporated. The residue was dissolved in
30 mL ethyl acetate and washed with water and brine twice and dried
over Na.sub.2SO.sub.4. After removal of solvent, the crude product
was subjected to chromatography on silica gel (hexane:EtOAc=1:1).
0.35 g of the title compound was obtained: MS m/z: 532.0 (ES+).
Intermediate 1b
##STR00348##
[0961] To a solution of the product of step 1a (0.35 g, 0.66 mmol)
in 5 mL of THF/MeOH (1:1) was added 1N LiOH aqueous solution (2 mL,
2.0 mmol). After stirring at r.t. for 10 hours, the reaction
mixture was neutralized with 1.0 N HCl. The organic solvents were
evaporated under vacuum, and the remaining aqueous phase was
acidified to pH.about.3 using 1.0 N HCl and was extracted with
EtOAc. The organic layer was washed with brine, and was dried over
anhydrous magnesium sulfate. After removal of solvent, 0.3 g of the
title compound was obtained: MS m/z: 526.2 (M+Na.sup.+).
Intermediate 1c
##STR00349##
[0963] To a solution of the product of step 1b (0.30 g, 0.6 mmol)
in 10 mL of DCM was added CDI (0.16 g, 1.0 mmol) and the resulting
solution was stirred at 40.degree. C. for 1 hour.
cyclopropylsulfonamide (0.18 g, 1.5 mmol) and DBU (0.16 g, 1.0
mmol) were added to the reaction mixture. The mixture was stirred
at 40.degree. C. for additional 10 hours. The solvent was then
removed and the residue was diluted with EtOAc and was washed with
aqueous NaOAc buffer (pH.about.5, 2.times.10 mL), NaHCO.sub.3
solution and brine. After drying over Na.sub.2SO.sub.4 and removal
of solvent, the residue was subjected to chromatography on silica
gel using hexane/EtOAc (1:1-1:2). A total of 0.30 g of the title
compound was obtained: R.sub.f 0.1 (EtOAc:hexane=1:1), MS m/z:
605.0 (ES-).
Intermediate 1d
##STR00350##
[0965] The product from step 1c (0.25 g, 0.41 mmol) was dissolved
in 4 N HCl in dioxane. The mixture was stirred at r.t. for 1 hour.
After removal of solvents, a 10-mL portion of DCM was poured in
followed by evaporation to dryness. This process of DCM addition
followed by evaporation was repeated four times to give a residue
solid which was used directly for the next step: MS m/z: 507.0
(M+H.sup.+).
Intermediate 1e
##STR00351##
[0967] To a stirring solution of 213 mg
(1R,4R)-3-oxo-2-oxa-5-aza-bicyclo[2.2.1]heptane-5-carboxylic acid
tert-butyl ester (213 mg, 1 mmol) in 1 mL of DCM, was added 2.0 mL
of 4 M HCl in dioxane. The resulting mixture was stirred at rt for
30 min, and evaporated to dryness, giving desired HCl salt used
directly for the following step.
Intermediate 1f
##STR00352##
[0969] To a stirring mixture of 1-benzyl-N-Boc-L-glutamate (170 mg,
0.5 mmol), 0.5 mmol of intermediate 1e, and 250 .mu.l of Hunig's
base in 2 mL of DCM, was added 1.5 mL of 0.5 M
2-chloro-1,3-dimethyl-imidazolidinium chlorides solution in DCM.
The resulting mixture was stirred at rt for 30 min, and
concentrate. The residue was subject to routine workup with EtOAc,
1N aqueous HCl, dried over anhydrous sodium sulfate. After
filtration and concentration, the product was purified by flash
column chromatography on silica gel with heptane/EtOAc 1/4, giving
146 mg of color less oil (67%). LC-MS: 333.2 (ES+, M-Boc)
Intermediate 1g
##STR00353##
[0971] 140 mg of benzyl ester from previous step was subject to
hydrogenation with 20 mg of Pd(OH).sub.2 as catalyst in anhydrous
MeOH. After 1 hr at rt, LC-MS showed completion of the removal of
benzyl group. The reaction mixture was filtered through celite, and
concentrated to give desired acid as foamy solid. LC-MS: 243.2
(ES+, M-Boc).
Intermediate 1h
##STR00354##
[0973] Intermediate 1h was synthesized in the same way as for
preparing intermediate 1g while using enantiomeric bicyclic lactone
as starting material in the step for making intermediate 1e.
Intermediate 1i
##STR00355##
[0975] Intermediate 1i was synthesized in the same way for
preparing intermediate 1g using 1-benzyl-N-Boc-aspartate for making
intermediate if instead of 1-benzyl-N-boc-L-glutamate.
Intermediate 1j
##STR00356##
[0977] Intermediate 1j was synthesized in the same way for
preparing intermediate 1h using 1-benzyl-N-Boc-L-aspartate for
making intermediate if instead of 1-benzyl-N-boc-L-glutamate.
##STR00357##
[0978]
(5S)-1-((S)-2-(tert-butoxycarbonylamino)-5-oxo-5-((1R,4R)-3-oxo-2-o-
xa-5-azabicyclo[2.2.1]heptan-5-yl)pentanoyl)-5-((1R,2S)-1-(cyclopropylsulf-
onyl-carbamoyl)-2-vinylcyclopropylcarbamoyl)pyrrolidin-3-yl
4-fluoroisoindoline-2-carboxylate (XVI-16): To a mixture of 15 mg
of intermediate 1d, 8 mg of intermediate 1g, and 20 .mu.l of
Hunig's base in 1 mL of DMA, was added 20 mg of HATU. After
stirring at rt for 20 min, the resulting mixture was purified by
Prep-HPLC, giving XVI-16. LC-MS: 829.2 (ES-).
Example 56
##STR00358##
[0980]
(5S)-1-(S)-2-(tert-butoxycarbonylamino)-5-oxo-5-((1S,4S)-3-oxo-2-ox-
a-5-azabicyclo[2.2.1]heptan-5-yl)pentanoyl)-5-(1R,2S)-1-(cyclopropylsulfon-
ylcarbamoyl)-2-vinylcyclopropylcarbamoyl)pyrrolidin-3-yl
4-fluoroisoindoline-2-carboxylate: The title compound was prepared
according to the steps and intermediates as described below.
[0981]
(5S)-1-((S)-2-(tert-butoxycarbonylamino)-5-oxo-5-((1S,4S)-3-oxo-2-o-
xa-5-azabicyclo[2.2.1]heptan-5-yl)pentanoyl)-5-((1R,2S)-1-(cyclopropylsulf-
onylcarbamoyl)-2-vinylcyclopropylcarbamoyl)pyrrolidin-3-yl
4-fluoroisoindoline-2-carboxylate (XVI-17): The title compound was
prepared in the same manner as for XVI-16, using intermediate 1h
for the final step instead of intermediate 1g. LC-MS: 829.2
(ES-).
Example 57
##STR00359##
[0983]
(5S)-1-(S)-2-(tert-butoxycarbonylamino)-4-oxo-4-41S,4S)-3-oxo-2-oxa-
-5-azabicyclo[2.2.1]heptan-5-yl)butanoyl)-5-((1R,2S)-1-(cyclopropylsulfony-
lcarbamoyl)-2-vinylcyclopropylcarbamoyl)pyrrolidin-3-yl
4-fluoroisoindoline-2-carboxylate: The title compound was prepared
according to the steps and intermediates as described below.
[0984]
(5S)-1-((S)-2-(tert-butoxycarbonylamino)-4-oxo-4-((1S,4S)-3-oxo-2-o-
xa-5-azabicyclo[2.2.1]heptan-5-yl)butanoyl)-5-((1R,2S)-1-(cyclopropylsulfo-
nyl carbamoyl)-2-vinylcyclopropylcarbamoyl)pyrrolidin-3-yl
4-fluoroisoindoline-2-carboxylate (XVI-15): The title compound was
prepared in the same manner as for XVI-16, using intermediate 11
for the final step instead of intermediate 1g. LC-MS: 815.3
(ES-).
Example 58
##STR00360##
[0986]
(5S)-1-(S)-2-(tert-butoxycarbonylamino)-4-oxo-4-((1R,4R)-3-oxo-2-ox-
a-5-azabicyclo[2.2.1]heptan-5-yl)butanoyl)-5-((1R,2S)-1-(cyclopropylsulfon-
ylcarbamoyl)-2-vinylcyclopropylcarbamoyl)pyrrolidin-3-yl
4-fluoroisoindoline-2-carboxylate: The title compound was prepared
according to the steps and intermediates as described below.
[0987]
(5S)-1-((S)-2-(tert-butoxycarbonylamino)-4-oxo-4-((1R,4R)-3-oxo-2-o-
xa-5-azabicyclo[2.2.1]heptan-5-yl)butanoyl)-5-((1R,2S)-1-(cyclopropylsulfo-
nyl carbamoyl)-2-vinylcyclopropylcarbamoyl)pyrrolidin-3-yl
4-fluoroisoindoline-2-carboxylate (XVI-14): The title compound was
prepared in the same manner as for XVI-16, using intermediate 1j
for the final step instead of intermediate 1g. LC-MS: 815.3
(ES-).
Example 59
##STR00361##
[0989]
(5S)-5-((1R,2S)-1-(cyclopropylsulfonylcarbamoyl)-2-vinylcyclopropyl-
carbamoyl)-1-(S)-5-oxotetrahydrofuran-2-carbonyl)pyrrolidin-3-yl
4-fluoroisoindoline-2-carboxylate (XVI-23): The title compound was
synthesized in the same chemistry as preparation for XVI-16 using
intermediate 1d to couple with
(2S)-5-oxo-tetrahydro-furan-2-carboxylic acid. LC-MS: 617.2
(ES-).
Example 60
##STR00362##
[0991]
(5S)-5-((1R,2S)-1-(cyclopropylsulfonylcarbamoyl)-2-vinylcyclopropyl-
carbamoyl)-1-(R)-5-oxotetrahydrofuran-2-carbonyl)pyrrolidin-3-yl
4-fluoroisoindoline-2-carboxylate (XVI-22): The title compound was
synthesized in the same chemistry as preparation for XVI-16 using
intermediate 1d to couple with
(2R)-5-oxo-tetrahydro-furan-2-carboxylic acid. LC-MS: 617.2
(ES-).
Example 61
##STR00363##
[0993]
(5S)-5-((1R,2S)-1-(cyclopropylsulfonylcarbamoyl)-2-vinylcyclopropyl-
carbamoyl)-1-(2-((S)-5-oxotetrahydrofuran-2-carboxamido)acetyl)pyrrolidin--
3-yl 4-fluoroisoindoline-2-carboxylate: The title compound was
prepared according to the steps and intermediates as described
below.
Intermediate 2a
##STR00364##
[0995] To a solution of intermediate 1d (0.12 g, 0.22 mmol) and
N-Boc-glycine (0.054 g, 0.31 mmol) in 4.0 mL of acetonitrile was
added HATU (133 mg, 0.35 mmol) and DIEA (0.12 mL, 0.66 mmol) at
r.t. under stirring. The reaction mixture was stirred for 2 h.
LC-MS and TLC analysis indicated completion of the coupling
reaction. A 20-mL of EtOAc was poured in and the mixture was washed
with a buffer (pH.about.4, AcONa/AcOH), NaHCO.sub.3 and brine, and
was dried over Na.sub.2SO.sub.4. After removal of solvent, the
crude product was subjected to chromatography on silica gel
(eluents: EtOAc/hexane). A total of 0.10 g of the title compound
was obtained: R.sub.f 0.2 (EtOAc); MS m/z: 664.0 (M+H.sup.+).
Intermediate 2b
##STR00365##
[0997] The intermediate 2a (0.10 g, 0.15 mmol) was dissolved in 2
mL of 4 N HCl in dixoxane and the reaction was stirred for 1 hour
at RT. After removal of solvents, a 3-mL portion of DCM was poured
in followed by evaporation to dryness. This process of DCM addition
followed by evaporation was repeated three times to give the title
compound Intermediate 2b as its HCl salt (0.10 g). MS m/z: 564.0
(M+H.sup.+).
Example 62
##STR00366##
[0999]
(5S)-5-((1R,2S)-1-(cyclopropylsulfonylcarbamoyl)-2-vinylcyclopropyl-
carbamoyl)-1-(2-((S)-5-oxotetrahydrofuran-2-carboxamido)acetyl)pyrrolidin--
3-yl 4-fluoroisoindoline-2-carboxylate (XVI-13): The title compound
was synthesized in the same chemistry as preparation for XVI-23
using intermediate 2b to couple with
(2S)-5-oxo-tetrahydro-furan-2-carboxylic acid. LC-MS: 676.2 (ES+),
674.1 (ES-).
Example 63
##STR00367##
[1001]
(5S)-5-((1R,2S)-1-(cyclopropylsulfonylcarbamoyl)-2-vinylcyclopropyl-
carbamoyl)-1-(2-((R)-5-oxotetrahydrofuran-2-carboxamido)acetyl)pyrrolidin--
3-yl 4-fluoroisoindoline-2-carboxylate (XVI-12): The title compound
was synthesized in the same chemistry as preparation for XVI-13
using intermediate 2b to couple with
(2R)-5-oxo-tetrahydro-furan-2-carboxylic acid. LC-MS: 676.2 (ES+),
674.1 (ES-).
Example 64
##STR00368##
[1003]
(5S)-1-(S)-2-(tert-butoxycarbonylamino)-3-(S)-5-oxotetrahydrofuran--
2-carboxamido)propanoyl)-5-((1R,2S)-1-(cyclopropylsulfonylcarbamoyl)-2-vin-
ylcyclopropylcarbamoyl)pyrrolidin-3-yl
4-fluoroisoindoline-2-carboxylate: The title compound was prepared
according to the steps and intermediates as described below.
Intermediate 3a
##STR00369##
[1005] To a solution of intermediate 1d (0.16 g, 0.28 mmol) and
N-Boc-3-(Fmoc)amino-L-alanine (0.15 g, 0.35 mmol) in 5.0 mL of DMF
was added HATU (125 mg, 0.33 mmol) and DIEA (130 mg, 1.0 mmol) at
r.t. under stirring. TLC analysis indicated completion of the
coupling reaction had occurred after one hour. A 20-mL portion of
EtOAc was poured in and the mixture was washed with a buffer
(pH.about.4, AcONa/AcOH), NaHCO.sub.3 and brine, and was dried over
MgSO.sub.4. After removal of solvent, the crude oil product was
subjected to chromatography on silica gel (eluents: EtOAc/hexane).
A total of 0.14 g of the title compound was obtained. LC-MS: 915.9
(ES+)
Intermediate 3b
##STR00370##
[1007] A solution of 0.10 g of the product of intermediate 3a in 1
mL of DMF with 12% piperidine was stirred for 1.5 hours at r.t. and
then was evaporated to dryness under high vacuum. The residue was
trituated with hexane/ether (4:1) to yield 70 mg of the title
compound. LC-MS: 693.2 (ES+), 691.2 (ES-).
Example 65
##STR00371##
[1009]
(5S)-1-(S)-2-(tert-butoxycarbonylamino)-3-(S)-5-oxotetrahydrofuran--
2-carboxamido)propanoyl)-5-((1R,2S)-1-(cyclopropylsulfonylcarbamoyl)-2-vin-
ylcyclopropylcarbamoyl)pyrrolidin-3-yl
4-fluoroisoindoline-2-carboxylate (XVI-21): The title compound was
synthesized in the same chemistry as preparation for XVI-23 using
intermediate 3b to couple with
(2S)-5-oxo-tetrahydro-furan-2-carboxylic acid. LC-MS: 803.2
(ES-).
Example 66
##STR00372##
[1011]
(5S)-1-(S)-2-(tert-butoxycarbonylamino)-3-(R)-5-oxotetrahydrofuran--
2-carboxamido)propanoyl)-5-((1R,2S)-1-(cyclopropylsulfonylcarbamoyl)-2-vin-
ylcyclopropylcarbamoyl)pyrrolidin-3-yl
4-fluoroisoindoline-2-carboxylate (XVI-20): The title compound was
synthesized in the same chemistry as preparation for XVI-21 using
intermediate 3b to couple with
(2R)-5-oxo-tetrahydro-furan-2-carboxylic acid. LC-MS: 803.2
(ES-).
Example 67
##STR00373##
[1013]
(5S)-1-((S)-2-(tert-butoxycarbonylamino)-3-((S)-N-methyl-5-oxotetra-
hydrofuran-2-carboxamido)propanoyl)-5-(1R,2S)-1-(cyclopropylsulfonylcarbam-
oyl)-2-vinylcyclopropylcarbamoyl)pyrrolidin-3-yl
4-fluoroisoindoline-2-carboxylate: The title compound was prepared
according to the steps and intermediates as described below.
Intermediate 4a
##STR00374##
[1015] To a solution of
(S)-3-amino-2-(tert-butoxycarbonylamino)propanoic acid (2.04 g, 10
mmol), TEA (4.5 mL, 30 mmol) in 50 mL CH.sub.2Cl.sub.2 was added
nitrobenzenesulfonyl chloride (2.9 g, 13.0 mmol) at RT. The mixture
was stirred for 10 hours at RT. The solvent was removed under
vacuum followed by the addition of 100 mL EtOAc. The organic layer
was washed with 1N HCl (to pH 3), water and brine. The organic
layer was dried over Na.sub.2SO.sub.4, filtered and the solvent was
removed to afford the crude Intermediate 4a (4.0 g).
Intermediate 4b
##STR00375##
[1017] The crude Intermediate 4a (2.0 g), K.sub.2CO.sub.3 (1.5, 4
equiv.) were dissolved in 10 mL DMF. MeI (0.8 mL, 4 eqiv.) was
added to the reaction at RT. The resulting mixture was stirred for
20 hours. The DMF was mostly removed under vacuum and 100 mL EtOAc
was added and the mixture was washed with water and brine. The
organic layer was dried over Na.sub.2SO.sub.4. After removal of
solvent, the crude product was subject to a short silica gel column
(eluents: EtOAc/hexane) to produce 1.62 g of the Intermediate 4b.
MS m/z: 439.9 (M+Na.sup.+).
Intermediate 4c
##STR00376##
[1019] To a solution of Intermediate 4b (1.6 g, 3.8 mmol) in 10 mL
of THF/MeOH (1:1) was added 1 N LiOH aqueous solution (5.8 mL, 5.8
mmol). After stirring at r.t. for 10 hours, the reaction mixture
was neutralized with 1.0 N HCl. The organic solvent was evaporated
under vacuum, and the remaining aqueous phase was acidified to
pH.about.3 using 1.0 N HCl and was extracted with EtOAc. The
organic layer was washed with brine, and was dried over anhydrous
sodium sulfate. After removal of solvent, 1.5 g of Intermediate 4c
was obtained. MS m/z: 402.0 (ES-).
Intermediate 4d
##STR00377##
[1021] To a solution of Intermediate 1d (0.12 g, 0.20 mmol) and
Intermediate 4c (0.12 g, 0.3 mmol) in 5.0 mL of anhydrous
acetonitrile was added HATU (0.11 g, 0.3 mmol) and DIEA (0.14 mL,
0.9 mmol) at r.t. under stirring. TLC analysis and LC-MS indicated
completion of the coupling reaction after one hour. A 20-mL portion
of EtOAc was poured in and the mixture was washed with a buffer
(pH.about.4, AcONa/AcOH), NaHCO.sub.3 and brine. The organic layer
was dried over Na.sub.2SO.sub.4. After removal of solvent, the
crude product was subjected to chromatography on silica gel
(eluents: EtOAc/hexane). A total of 0.10 g of Intermediate 4d was
obtained: R.sub.f 0.1 (EtOAc); MS m/z: 891.8 (M+H.sup.+).
Intermediate 4e
##STR00378##
[1023] To a solution of Intermediate 4d (0.10 g, 0.11 mmol) in 3 mL
DMF was added phenylthiol (30 mg, 0.26 mmol) and K.sub.2CO.sub.3
(40 mg, 0.3 mmol). The resulting mixture was stirred for 20 hours
at RT. 30 mL EtOAc was added and the mixture was washed with water
and brine and water. The organic layer was dried over
Na.sub.2SO.sub.4. After removal of solvent, the crude product was
subjected to chromatography on silica gel (eluents: EtOAc/hexane)
to produce 0.1 g of crude Intermediate 4e. MS m/z: 706.9
(M+H.sup.+).
Example 68
##STR00379##
[1025]
(5S)-1-((S)-2-(tert-butoxycarbonylamino)-3-((S)-N-methyl-5-oxotetra-
hydrofuran-2-carboxamido)propanoyl)-5-((1R,2S)-1-(cyclopropylsulfonylcarba-
moyl)-2-vinylcyclopropylcarbamoyl)pyrrolidin-3-yl
4-fluoroisoindoline-2-carboxylate (XVI-19): The title compound was
synthesized in the same chemistry as preparation for XVI-21 using
intermediate 4e instead of intermediate 3b to couple with
(2R)-5-oxo-tetrahydro-furan-2-carboxylic acid. LC-MS: 817.2
(ES-).
Example 69
##STR00380##
[1027]
(5S)-1-(S)-2-(tert-butoxycarbonylamino)-3-((R)-N-methyl-5-oxotetrah-
ydrofuran-2-carboxamido)propanoyl)-5-(1R,2S)-1-(cyclopropylsulfonylcarbamo-
yl)-2-vinylcyclopropylcarbamoyl)pyrrolidin-3-yl
4-fluoroisoindoline-2-carboxylate (XVI-18): The title compound was
synthesized in the same chemistry as preparation for XVI-20 using
intermediate 4e instead of intermediate 3b to couple with
(2S)-5-oxo-tetrahydro-furan-2-carboxylic acid. LC-MS: 817.2
(ES-).
Example 70
##STR00381##
[1029]
(5S)-1-((S)-2-(tert-butoxycarbonylamino)-4-((S)-5-oxotetrahydrofura-
n-2-carboxamido)butanoyl)-5-((1R,2S)-1-(cyclopropylsulfonylcarbamoyl)-2-vi-
nylcyclopropylcarbamoyl)pyrrolidin-3-yl
4-fluoroisoindoline-2-carboxylate: The title compound was prepared
according to the steps and intermediates as described below.
Intermediate 5a
##STR00382##
[1031] Intermediate 5a was prepared in the same way as for
intermediate 3b using
(S)-4-(((9H-fluoren-9-yl)methoxy)carbonylamino)-2-(tert-butoxycarbo-
nylamino)butanoic acid instead of N-Boc-3-(Fmoc)amino-L-alanine.
LC-MS: 707.2 (ES+)
Example 71
##STR00383##
[1033]
(5S)-1-(S)-2-(tert-butoxycarbonylamino)-4-((S)-5-oxotetrahydrofuran-
-2-carboxamido)butanoyl)-5-((1R,2S)-1-(cyclopropylsulfonylcarbamoyl)-2-vin-
ylcyclopropylcarbamoyl)pyrrolidin-3-yl
4-fluoroisoindoline-2-carboxylate (XVI-11): The title compound was
synthesized in the same chemistry as preparation for XVI-19 using
intermediate 5a instead of intermediate 4e to couple with
(2S)-5-oxo-tetrahydro-furan-2-carboxylic acid. LC-MS: 817.2
(ES-).
Example 72
##STR00384##
[1035]
(5S)-1-((S)-2-(tert-butoxycarbonylamino)-4-((R)-5-oxotetrahydrofura-
n-2-carboxamido)butanoyl)-5-((1R,2S)-1-(cyclopropylsulfonylcarbamoyl)-2-vi-
nylcyclopropylcarbamoyl)pyrrolidin-3-yl
4-fluoroisoindoline-2-carboxylate (XVI-10): The title compound was
synthesized in the same chemistry as preparation for XVI-18 using
intermediate 5a instead of intermediate 4e to couple with
(2S)-5-oxo-tetrahydro-furan-2-carboxylic acid. LC-MS: 817.2
(ES-).
Example 73
##STR00385##
[1037] tert-butyl
(2S)-1-((2S)-2-((1R,2S)-1-(cyclopropylsulfonylcarbamoyl)-2-vinylcycloprop-
ylcarbamoyl)-4-(6-methoxyisoquinolin-1-yloxy)pyrrolidin-1-yl)-1,5-dioxo-5--
((1S,4S)-3-oxo-2-oxa-5-azabicyclo[2.2.1]heptan-5-yl)pentan-2-ylcarbamate:
The title compound was prepared according to the steps and
intermediates as described below.
Intermediate 6a
##STR00386##
[1039] Intermediate 6a was prepared following the procedure
published in WO 2006086381.
Intermediate 6b
##STR00387##
[1041] Intermediate 6b was synthesized in the same way for
preparing intermediate 1g using (1S,4S)-tert-butyl
3-oxo-2-oxa-5-azabicyclo[2.2.2]octane-5-carboxylate as starting
material in preparing intermediate 1e instead of
(1R,4R)-3-oxo-2-oxa-5-aza-bicyclo[2.2.1]heptane-5-carboxylic acid
tert-butyl ester. LC-MS: 355.1 (ES-).
Intermediate 6c
##STR00388##
[1043] Intermediate 6c was synthesized in the same way for
preparing intermediate 1g using
(1S,5S)-6-oxa-2-aza-bicyclo[3.2.1]octan-7-one in preparing
intermediate 1e instead of
(1R,4R)-3-Oxo-2-oxa-5-aza-bicyclo[2.2.1]heptane-5-carboxylic acid
tert-butyl ester. LC-MS: 355.1 (ES-).
Example 74
##STR00389##
[1045] tert-butyl
(2S)-1-((2S)-2-((1R,2S)-1-(cyclopropylsulfonylcarbamoyl)-2-vinylcycloprop-
ylcarbamoyl)-4-(6-methoxyisoquinolin-1-yloxy)pyrrolidin-1-yl)-1,5-dioxo-5--
((1S,4S)-3-oxo-2-oxa-5-azabicyclo[2.2.1]heptan-5-yl)pentan-2-ylcarbamate
(XVI-9): The title compound was synthesized in the same way as for
XVI-17 using intermediate 6a as starting material instead of
intermediate 1d. LC-MS: 825.3 (ES+), 823.2 (ES-).
Example 75
##STR00390##
[1047] tert-butyl
(2S)-1-((2S)-2-((1R,2S)-1-(cyclopropylsulfonylcarbamoyl)-2-vinylcycloprop-
ylcarbamoyl)-4-(6-methoxyisoquinolin-1-yloxy)pyrrolidin-1-yl)-1,5-dioxo-5--
((1R,4R)-3-oxo-2-oxa-5-azabicyclo[2.2.1]heptan-5-yl)pentan-2-ylcarbamate
(XVI-8): The title compound was synthesized in the same way as for
XVI-16 using intermediate 6a as starting material instead of
intermediate 1d. LC-MS: 825.3 (ES+), 823.2 (ES-).
Example 76
##STR00391##
[1049] tert-butyl
(2S)-1-((2S)-2-((1R,2S)-1-(cyclopropylsulfonylcarbamoyl)-2-vinylcycloprop-
ylcarbamoyl)-4-(6-methoxyisoquinolin-1-yloxy)pyrrolidin-1-yl)-1,4-dioxo-4--
((1S,4S)-3-oxo-2-oxa-5-azabicyclo[2.2.1]heptan-5-yl)butan-2-ylcarbamate
(XVI-7): The title compound was synthesized in the same way as for
XVI-15 using intermediate 6a as starting material instead of
intermediate 1d. LC-MS: 811.2 (ES+), 809.1 (ES-).
Example 77
##STR00392##
[1051]
N1-((2S)-1-((2S)-2-((1S,2R)-1-(cyclopropylsulfonylcarbamoyl)-2-viny-
lcyclopropylcarbamoyl)-4-(6-methoxyisoquinolin-1-yloxy)pyrrolidin-1-yl)-1,-
5-dioxo-5-((1S,4S)-3-oxo-2-oxa-5-azabicyclo[2.2.1]heptan-5-yl)pentan-2-yl)-
-N-5-(15-oxo-19-((3aS,4S,6aR)-2-oxohexahydro-1H-thieno[3,4-d]imidazol-4-yl-
)-4,7,10-trioxa-14-azanonadecyl)glutaramide (XVI-27): To a solution
of 2 mg of XVI-7 in 100 uL of anhydrous DCM, was added 50 uL of
TFA. After stirring at rt for 1 hr, the solvent was removed under
reduced pressure, and the residue was dried in vacuum for 2 hr. 0.5
mL of anhydrous acetonitrile was then added, followed by 50 uL of
Hunig's base, 5 mg of
5,21-dioxo-25-((3aS,4S,6aR)-2-oxohexahydro-1H-thieno[3,4-d]imidazol-4-yl)-
-10,13,16-trioxa-6,20-diazapentacosan-1-oic acid and 6 mg of HATU.
The reaction mixture was stirred at rt for 1 hr, then purified by
prep-HPLC, giving desired tool compound XVI-27 as white powder
after lyophilization. LC-MS: 1267.5 (ES+), 1265.6 (ES-)
Example 78
##STR00393##
[1053] tert-butyl
(2S)-1-((2S)-2-((1R,2S)-1-(cyclopropylsulfonylcarbamoyl)-2-vinylcycloprop-
ylcarbamoyl)-4-(6-methoxyisoquinolin-1-yloxy)pyrrolidin-1-yl)-1,4-dioxo-4--
((1R,4R)-3-oxo-2-oxa-5-azabicyclo[2.2.1]heptan-5-yl)butan-2-ylcarbamate
(XVI-6): The title compound was synthesized in the same way as for
XVI-14 using intermediate 6a as starting material instead of
intermediate 1d. LC-MS: 811.2 (ES+), 809.1 (ES-).
Example 79
##STR00394##
[1055] tert-butyl
(2S)-1-((2S)-2-((1R,2S)-1-(cyclopropylsulfonylcarbamoyl)-2-vinylcycloprop-
ylcarbamoyl)-4-(6-methoxyisoquinolin-1-yloxy)pyrrolidin-1-yl)-1,5-dioxo-5--
((1S,4S)-3-oxo-2-oxa-5-azabicyclo[2.2.2]octan-5-yl)pentan-2-ylcarbamate
(XVI-3): The title compound was synthesized in the same way as for
XVI-9 using intermediate 6b as coupling acid of intermediate 1h.
LC-MS: 839.3 (ES+), 837.3 (ES).
Example 80
##STR00395##
[1057] tert-butyl
(2S)-1-((2S)-2-((1R,2S)-1-(cyclopropylsulfonylcarbamoyl)-2-vinylcycloprop-
ylcarbamoyl)-4-(6-methoxyisoquinolin-1-yloxy)pyrrolidin-1-yl)-1,5-dioxo-5--
((1R,5S)-7-oxo-6-oxa-2-azabicyclo[3.2.1]octan-2-yl)pentan-2-ylcarbamate
(XVI-2): The title compound was synthesized in the same way as for
XVI-3 using intermediate 6c as coupling acid of intermediate 6b.
LC-MS: 839.3 (ES+), 837.3 (ES-).
Example 81
##STR00396##
[1059] tert-butyl
(2S)-1-((2S)-2-((1R,2S)-1-(cyclopropylsulfonylcarbamoyl)-2-vinylcycloprop-
ylcarbamoyl)-4-(7-methoxy-2-phenylquinolin-4-yloxy)pyrrolidin-1-yl)-1,5-di-
oxo-5-(2-oxoazetidin-1-yl)pentan-2-ylcarbamate: The title compound
was prepared according to the steps and intermediates as described
below.
Intermediate 7a
##STR00397##
[1061] Intermediate 7a was prepared following the published
procedure as in WO2006086381.
Intermediate 7b
##STR00398##
[1063] To a stirring solution of azetidin-2-one (36 mg, 0.5 mmol)
in 5 mL anhydrous THF was added n-BuLi (1.6 M, 0.31 mL) at
-78.degree. C. The solution was stirred for 0.5 h at -78.degree. C.
and warmed up to RT. This solution was then transferred into a
stirred solution of
(S)-5-(benzyloxy)-4-(tert-butoxycarbonylamino)-5-oxopentanoic acid
(0.25 g, 0.75 mmol) and DCC (0.16 g, 0.75 mmol) in 5 mL
dichloromethane (pre stirred for 10 minutes). To the mixture was
then added DIEA (0.55 mmol) and DMAP (0.2 mmol) and the solution
was stirred at RT for 10 hours. The solvent was removed and the
crude was purified by flash column chromatography on silica gel
with heptane/EtOAc (1:1) to afford 30 mg of white solid (20%) as
intermediate 7b. LC-MS: 291.1 (ES+, M-Boc).
Intermediate 7c
##STR00399##
[1065] Intermediate 7b (30 mg) was hydrogenated in ethyl acetate
(H.sub.2, Pd/C, 1 h) to give the de-protected carboxylic acid 30 mg
(100%). LC-MS: 299.1 (ES-).
Example 82
##STR00400##
[1067] tert-butyl
(2S)-1-((2S)-2-((1R,2S)-1-(cyclopropylsulfonylcarbamoyl)-2-vinylcycloprop-
ylcarbamoyl)-4-(7-methoxy-2-phenylquinolin-4-yloxy)pyrrolidin-1-yl)-1,5-di-
oxo-5-(2-oxoazetidin-1-yl)pentan-2-ylcarbamate (XVI-26): The title
compound was synthesized using intermediate 7a and intermediate 7c
via the chemistry as described for XVI-16. LC-MS: 859.3 (ES+).
Example 83
##STR00401##
[1069] tert-butyl
(S)-1-((2S,4R)-2-(1R,2S)-1-(cyclopropylsulfonylcarbamoyl)-2-vinylcyclopro-
pylcarbamoyl)-4-(6-methoxyisoquinolin-1-yloxy)pyrrolidin-1-yl)-1,5-dioxo-5-
-(2-oxoazetidin-1-yl)pentan-2-ylcarbamate (XVI-1): The title
compound was synthesized in a similar way as for XVI-26 using
intermediate 6a and intermediate 7c as reactants. LC-MS: 783.3
(ES+).
Example 84
##STR00402##
[1071]
(5S)-1-0S)-2-(tert-butoxycarbonylamino)-3-((2R,3S)-2-methyl-4-oxoox-
etan-3-ylcarbamoyloxy)propanoyl)-5-((1R,2S)-1-(cyclopropylsulfonylcarbamoy-
l)-2-vinylcyclopropylcarbamoyl)pyrrolidin-3-yl
4-fluoroisoindoline-2-carboxylate: The title compound was prepared
according to the steps and intermediates as described below.
Intermediate 8a
##STR00403##
[1073] Intermediate 8a was prepared through HATU coupling reaction
using intermediate 1d with N-Boc-L-serine. LC-MS: 692.2 (ES-).
Example 85
##STR00404##
[1075]
(5S)-1-(S)-2-(tert-butoxycarbonylamino)-3-((2R,3S)-2-methyl-4-oxoox-
etan-3-ylcarbamoyloxy)propanoyl)-5-((1R,2S)-1-(cyclopropylsulfonylcarbamoy-
l)-2-vinylcyclopropylcarbamoyl)pyrrolidin-3-yl
4-fluoroisoindoline-2-carboxylate (XVI-25): Intermediate 8a was
treated with 2 equivalent of phosgene in DCM at 0.degree. C. for 1
hr. The resulting mixture was evaporated under reduced pressure. 1
equivalent (3S,4R)-3-amino-4-methyloxetan-2-one and 2 equiv of
Hunig's base in acetonitrile was added in, the resulting mixture
was stirred at rt for 1 hr. After concentration, the resulting
residue was subject to prep-HPLC purification, giving desired
XVI-25. LC-MS: 843.1 (ES+, M+Na)
Example 86
##STR00405##
[1077] tert-butyl
(2S)-1-((2S)-2-((1R,2S)-1-(cyclopropylsulfonylcarbamoyl)-2-vinylcycloprop-
ylcarbamoyl)-4-(7-methoxy-2-phenylquinolin-4-yloxy)pyrrolidin-1-yl)-1-oxo--
3-((S)-5-oxotetrahydrofuran-2-carboxamido)propan-2-ylcarbamate: The
title compound was prepared according to the steps and
intermediates as described below.
Intermediate 9a
##STR00406##
[1079] Intermediate 9a was prepared in the same way as for
intermediate 3b starting from intermediate 7a instead of
intermediate 1d. LC-MS: 763.3 (ES+).
Example 87
##STR00407##
[1081] tert-butyl
(2S)-1-((2S)-2-((1R,2S)-1-(cyclopropylsulfonylcarbamoyl)-2-vinylcycloprop-
ylcarbamoyl)-4-(7-methoxy-2-phenylquinolin-4-yloxy)pyrrolidin-1-yl)-1-oxo--
3-((S)-5-oxotetrahydrofuran-2-carboxamido)propan-2-ylcarbamate
(XVI-24): The title compound was made in the same way as for XVI-21
using intermediate 9a instead of intermediate 3b. LC-MS: 875.3.
(ES+).
HCV-NS3 Biological Data
[1082] Table 3 shows the activity of selected compounds of this
invention in the NS3/4A_App (nM), MS_HCVNS3_INTACT_NS3 WT 1b 1HR,
MS_HCVNS3_INTACT_C139S.sub.--3HR, MS_HCVNS3_INTACT_K136A.sub.--3HR
Assays. Compounds having an activity designated as "A" provide an
IC50.ltoreq.1 nM; compounds having an activity designated as "B"
provide an IC50>1 nM and .ltoreq.10 nM; compounds having an
activity designated as "C" provide an IC50>10 nM and .ltoreq.100
nM; compounds having an activity designated as "D" provide an
IC50>100 nM and <1000 nM; and compounds having an activity
designated as "E" provide an IC50.gtoreq.1000 nM.
[1083] Compounds having an activity designated as "F" provide
complete modification; compounds having an activity designated as
"G" provide >70% modification; compounds having an activity
designated as "H" provide >50% and .ltoreq.70% modification;
compounds having an activity designated as "I" provide >30% and
.ltoreq.50% modification; and compounds having an activity
designated as "K" provide .ltoreq.30% modification.
TABLE-US-00003 TABLE 3 Inhibition/ Compound Modification
Designation Enzyme/Assay Designation XVI-1 NS3/4A_App (nM) A
MS_HCVNS3_INTACT_NS3 WT 1b 1HR G MS_HCVNS3_INTACT_C139S_3HR F
MS_HCVNS3_INTACT_K136A_3HR K XVI-2 NS3/4A_App (nM) A
MS_HCVNS3_INTACT_NS3 WT 1b 1HR K XVI-3 NS3/4A_App (nM) A
MS_HCVNS3_INTACT_NS3 WT 1b 1HR K MS_HCVNS3_INTACT_K136A_3HR K XVI-4
NS3/4A_App (nM) D MS_HCVNS3_INTACT_NS3 WT 1b 1HR K XVI-5 NS3/4A_App
(nM) D MS_HCVNS3_INTACT_NS3 WT 1b 1HR K XVI-6 NS3/4A_App (nM) B
MS_HCVNS3_INTACT_NS3 WT 1b 1HR H XVI-7 NS3/4A_App (nM) B
MS_HCVNS3_INTACT_NS3 WT 1b 1HR H XVI-8 NS3/4A_App (nM) A
MS_HCVNS3_INTACT_NS3 WT 1b 1HR G XVI-9 NS3/4A_App (nM) A
MS_HCVNS3_INTACT_NS3 WT 1b 1HR H MS_HCVNS3_INTACT_K136A_3HR K
XVI-10 NS3/4A_App (nM) D XVI-11 NS3/4A_App (nM) D XVI-12 NS3/4A_App
(nM) D XVI-13 NS3/4A_App (nM) D XVI-14 NS3/4A_App (nM) A
MS_HCVNS3_INTACT_NS3 WT 1b 1HR H MS_HCVNS3_INTACT_C139S_3HR I
MS_HCVNS3_INTACT_K136A_3HR I XVI-15 NS3/4A_App (nM) A
MS_HCVNS3_INTACT_NS3 WT 1b 1HR H MS_HCVNS3_INTACT_C139S_3HR H
MS_HCVNS3_INTACT_K136A_3HR H XVI-16 NS3/4A_App (nM) A
MS_HCVNS3_INTACT_NS3 WT 1b 1HR H MS_HCVNS3_INTACT_C139S_3HR F
MS_HCVNS3_INTACT_K136A_3HR F XVI-17 NS3/4A_App (nM) A
MS_HCVNS3_INTACT_NS3 WT 1b 1HR G MS_HCVNS3_INTACT_C139S_3HR F
MS_HCVNS3_INTACT_K136A_3HR F XVI-18 NS3/4A_App (nM) B XVI-19
NS3/4A_App (nM) B MS_HCVNS3_INTACT_C139S_3HR K XVI-20 NS3/4A_App
(nM) B XVI-21 NS3/4A_App (nM) B XVI-22 NS3/4A_App (nM) E XVI-23
NS3/4A_App (nM) D XVI-24 NS3/4A_App (nM) B MS_HCVNS3_INTACT_NS3 WT
1b 1HR K XVI-25 NS3/4A_App (nM) A MS_HCVNS3_INTACT_NS3 WT 1b 1HR K
XVI-26 NS3/4A_App (nM) A MS_HCVNS3_INTACT_NS3 WT 1b 1HR H
MS_HCVNS3_INTACT_C139S_3HR F
[1084] Some of the HCV Protease inhibitors, such as compounds
XVI-1, XVI-8, XVI-17, XVI-16, and XVI-26, provide >70%
modification of HCV Protease, or mutants thereof. Some of the HCV
Protease inhibitors, such as compounds XVI-6, XVI-7, XVI-9, XVI-14,
XVI-15, XV-16, and XVI-26 provide >50% up to <70%
modification of HCV Protease, or mutants thereof. Some of the HCV
Protease inhibitors, such as compound XVI-14 provide >30% and
.ltoreq.50% modification of HCV Protease, or mutants thereof. Some
of the HCV Protease inhibitors, such as compounds XVI-1, XVI-2,
XVI-3, XVI-4, XVI-5, XVI-9, XVI-19, XVI-24, and XVI-25 provide
.ltoreq.30% modification of HCV Protease, or mutants thereof.
F. Mass Spectrometric Analysis of HCV Protease Contacted with
Compounds of the Invention
Example 88
[1085] Intact HCV (protease) 1bWT was incubated for 1 hr at a
10.times. fold excess of XVI-26 to protein. 3 ul aliquots of the
samples were diluted with 10 ul of 0.1% TFA prior to micro C4
ZipTipping directly onto the MALDI target using Sinapinic acid as
the desorption matrix (10 mg/mL in 0.1% TFA:Acetonitrile 50:50).
The top panel in FIG. 3 shows the mass spectrometric trace of the
intact HCV 1bWT protein (m/z 24,529 Da). The middle panel in FIG. 3
shows the mass spectrometric trace when HCV 1bWT was incubated with
XVI-26 (mw=858.9). The centroid mass (m/z=25,340 Da) shows a
positive shift of about 811 Da, indicating modification of HCV 1bWT
by XVI-26. Due to likely protein misfolding during protein
purification, a small portion of the misfolded protein was not
modified.
[1086] In order to determine whether the modification of the
protein occurred at lysine, the pH from the above experiment was
increased from 7.4 to 10.0. Because the compound lysine adduct
would be an amide any increase in pH would have minimal effect on
the modified protein. If however, the modification occurred at
cysteine the resultant thioester bond would be unstable and the
compound would hydrolyze off the protein. The bottom panel of FIG.
3 shows a mass spectrometric trace of HCV 1bWT reaction with XVI-26
for 1 hour at pH 7.4 followed by 2 hours at pH 10, and XVI-26 did
not come off of the protein implying the adduct was occurring on a
lysine.
[1087] Intact HCV (protease) 1bWT, C159S, and C159S/K136A were
incubated for 1 hr at a 10.times. fold excess of XVI-26 to protein.
3 .mu.l aliquots of the samples were diluted with 10 .mu.l of 0.1%
TFA prior to micro C4 ZipTipping directly onto the MALDI target
using Sinapinic acid as the desorption matrix (10 mg/mL in 0.1%
TFA:Acetonitrile 50:50). The first panel of FIG. 4 shows the mass
spectrometric trace of the intact HCV 1bWT protein (m/z 24,460 Da).
The second panel of FIG. 4 shows the mass spectrometric trace when
HCV 1bWT was incubated with XVI-26 (mw=858.9), the centroid mass
(m/z=25,320 Da) shows a positive shift of about 860 Da, indicating
modification of HCV 1bWT by XVI-26. The third panel of FIG. 4 shows
the mass spectrometric trace when HCV C159S mutant was incubated
with XVI-26 and the centroid mass (m/z=25,237 Da) shows a positive
shift of 770 Da, indicating modification of HCV C159S by XVI-26.
The fourth panel of FIG. 4 shows the mass spectrometric trace when
HCV C159S/K136A double mutant was incubated with XVI-26, the
centroid mass (m/z=24,412 Da) is consistent with the mass of
unmodified HCV C159S/K136A, indicating no modification of HCV
C159S/K136A by XVI-26. This data shows that K136 is the amino acid
modified by XVI-26.
[1088] Intact HCV (protease) WT1b was incubated for 1 hr at a
10.times. fold excess of XVI-1 (mw=782.87) to protein. 3 .mu.A
aliquots of the samples were diluted with 10 .mu.A of 0.1% TFA
prior to micro C4 ZipTipping directly onto the MALDI target using
Sinapinic acid as the desorption matrix (10 mg/mL in 0.1%
TFA:Acetonitrile 50:50). The top panel of FIG. 5 shows the mass
spectrometric trace of HCV NS3 protein (m/z 24,550 Da) and the
bottom panel of FIG. 5 shows the 1 hr time point (m/z of 24,611
& 25,372), which shows a mass shift of +755 (.about.72%
conversion) showing that XVI-1 modified HCV NS3 WT1b. Due to some
protein misfolding during the purification of the protein, the
unfolded portion of the protein can not react with XVI-1.
Example 89
Single Chain HCV Protease (wt) Peptide Expression and
Purification
[1089] The single-chain proteolytic domain
(NS4A.sub.21-32-GSGS-NS.sub.33-631) was cloned into pET-14b
(Novagen, Madison, Wis.) and transformed into DH10B cells
(Invitrogen). The resulting plasmid was transferred into
Escherichia coli BL21 (Novagen) for protein expression and
purification. Briefly, the cultures were grown at 37.degree. C. in
LB medium containing 100 .mu.g/ml of ampicillin until the optical
density at 600 nm (OD600) reached 1.0 and were induced by addition
of isopropyl-.beta.-D-thiogalactopyranoside (IPTG) to 1 mM. After
an additional incubation at 18.degree. C. for 20 h, bacteria were
harvested by centrifugation at 6,000.times.g for 10 minutes and
resuspended in a lysis buffer containing 50 mM Na.sub.3PO.sub.4, pH
8.0, 300 mM NaCl, 5 mM 2-mercaptoethanol, 10% glycerol, 0.5% Igepal
CA630, and a protease inhibitor cocktail consisting of 1 mM
phenylmethylsulfonyl fluoride, 0.5 .mu.g/ml leupeptin, pepstatin A,
and 2 mM benzamidine. Cells were lysed by freezing and thawing,
followed by sonication. Cell debris was removed by centrifugation
at 12,000.times.g for 30 min. The supernatant was further clarified
by passing through a 0.45-.mu.m filter (Corning) and then loaded
onto a HiTrap chelating column charged with NiSO.sub.4 (Amersham
Pharmacia Biotech). The bound protein was eluted with an imidazole
solution in a 100-to-500 mM linear gradient. Selected fractions
were run through Ni.sup.2+column chromatography and were analyzed
on a 10% sodium dodecyl sulfate (SDS)-polyacrylamide gel. The
purified protein was resolved by electrophoresis in a 12% SDS-PAGE
gel and then transferred onto a nitrocellulose membrane. The
protein was analyzed by Western blot analysis using monoclonal
antibodies against NS3. Proteins were visualized by using a
chemiluminescence kit (Roche) with horseradish
peroxidase-conjugated goat anti-mouse antibodies (Pierce) as
secondary antibodies. The protein was aliquoted and stored at
-80.degree. C.
Example 90
Cloning and Expression of HCV Protease A156S, A156T, D168A, D168V
Drug-Resistance Mutants and C159S Variant
[1090] The mutant DNA fragments of NS4A/NS3 were generated by PCR
and cloned into pET expression vector. After transformation into
BL21 competent cells, the expression was induced with IPTG for 2
hours. The His-tagged fusion proteins were purified using affinity
column followed by size exclusion chromatography.
Example 91
Plasmids Used for Lys Washout and Covalent Probe
[1091] FIG. 10 depicts lysine covalent probe compound XVI-27
modifying NS3/4A C159S. The pCI-Neo-FLAG-NS3/4a-WT plasmid was
constructed by amplifying the NS3 and 4a sequence from the
pFK-1389-luc-ubi-neo-NS3-3'ET vector using Accuprime Pfx
(Invitrogen) according to manufacturer's instructions and with
primers that added an NheI site and FLAG epitope tag to the 5' end
and an XbaI site to the 3' end.
TABLE-US-00004 (SEQ ID NO.: 176)
(FTAATAAGCTAGCACCATGGACTACAAAGATGATGACGATAAAGGAG
CGCCTATTACGGCCTACTCCCAACAG, (SEQ ID NO.: 177))
R-TTATTATCTAGACTAGCACTCTTCCATCTCATCGAACTCCCGGTAA AG.
[1092] The resulting PCR product was then digested with NheI and
XbaI and ligated into the same sites of the pCI-Neo vector
(Invitrogen). The WT construct was then used as a template for
site-directed mutagenesis using the Quickchange II Site-Directed
Mutagenesis kit (Qiagen) and primers containing the K136R or C159S
mutations (below).
TABLE-US-00005 NS3-C159S-F (SEQ ID NO.: 178)
ATCTTTCGGGCTGCCGTGAGCACCCGAGGGGTTGCGAAG NS3-C159S-R (SEQ ID NO.:
179) CTTCGCAACCCCTCGGGTGCTCACGGCAGCCCGAAAGAT NS3-K136R-F (SEQ ID
NO.: 180) GTCTCCTACTTGAGGGGCTCTTCGGGCGGT NS3-K136R-R (SEQ ID NO.:
181) ACCGCCCGAAGAGCCCCTCAAGTAGGAGAC
Example 92
Demonstration of Prolonged Duration of Action (Washout)
[1093] FIG. 11 depicts the prolonged duration of action with
XVI-26. Parental Huh-7 cells were plated at a density of
1.75.times.10.sup.6 cells per 100 mm dish in media with 10% FBS.
The following day, cells were transfected in OptiMEM using 28 ug of
plasmid and 112 ul of Lipfectamine 2000 (Invitrogen), according to
manufacturer's instructions. After 4 hours incubation with the
transfection complex, the media was changed to Replicon Assay
Medium (RPMI supplemented with 5% FBS, 1.times. non-essential amino
acids and pen/strep). The next morning, the cells were trypsinized,
counted and replated in Replicon Media at a density of 20,000
cells/well of a 12 well plate (4 wells per genotype). Cells were
allowed to adhere to the plate, then the media was removed and
replaced with 1 ml media containing XVI-26, (3 wells per compound)
and 0.02% DMSO and returned to the incubator overnight. Sixteen
hours later 1 treated well from each genotype (0 hr sample) and 1
untreated well were washed with PBS, then lysed and scraped into 30
ul of Cell Extraction Buffer (Biosource, Camarillo, Calif.) plus
Complete Protease Inhibitor (Roche, Indianapolis, Ind.). The
remaining wells were rinsed 2.times. with PBS then fed with
Replicon Media and returned to the incubator. Cells were washed
once every hour by removing the old media and replacing it with
fresh media and were lysed and collected at 1 and 6 hours following
the first collection. Lysates were resolved using standard
immunoblotting methods and NS3 self-cleavage activity was assessed
and quantified relative to untreated samples.
Example 93
Demonstration of Lysine Modification Using Covalent Probe
[1094] As illustrated in FIG. 11, 200 .mu.g of total cell lysate
was used for either NS3/4A WT, C159S or K136R respectively. Lysates
were treated with 1 .mu.M of biotinylated covalent probe, XVI-27,
for 1 h and immunopercipitated with anti-NS3 antibody (mouse).
Immunoblots were probed with streptavidin and anti-NS3 antibody
(goat). Successful modification by the covalent probe was assessed
and quantified relative to WT NS3.
Example 94
[1095] Assay buffer: 2% CHAPS, 50 mM Tris pH 7.5, 50% glycerol, 2
uM M-2235 (Bachem) substrate. In a 50 ul reaction, add 49 ul assay
buffer, 1 ul (1 U) HCV serine protease (Bioenza). Incubate 20
minutes at room temperature. The plate was read at either 350/460
nm (excitation/emission) on a fluorescent micro-plate reader or
monitored at one-minute intervals to achieve the kinetic curve.
[1096] The enzyme tolerated 1% DMSO and 2% methanol. In the
experiments of testing compounds, the compounds in pure DMSO were
diluted 10 times with 20% methanol (10% DMSO and 20% methanol).
This compound solution was added to the reaction (not exceeding 10%
of the final reaction volume). The final concentration of the
organic solvents was: 1% DMSO and 2% methanol.
Example 95
HCV Protease FRET Assay for WT and Mutated NS3/4A 1b Enzymes
(IC.sub.50.sub.--.sub.APP)
[1097] The following protocol was used to generate "apparent"
IC.sub.50 (IC.sub.50.sub.--.sub.APP) values as depicted in Table 6,
below. Without wishing to be bound by any particular theory, it is
believed that IC.sub.50.sub.--.sub.APP, contrasted with IC.sub.50
values, may provide a more useful indication of time-dependent
inhibition, and are thus more representative of binding affinity.
The protocol is a modified FRET-based assay (v.sub.--03) developed
to evaluate compound potency, rank-order and resistance profiles
against wild type and C159S, A156S, A156T, D168A, D168V, R155K
mutants of the HCV NS3/4A 1b protease enzyme as follows: 10.times.
stocks of NS3/4A protease enzyme from Bioenza (Mountain View,
Calif.) and 1.13.times.5-FAM/QXL.TM.520 FRET peptide substrate from
Anaspec (San Jose, Calif.) were prepared in 50 mM Tris-HCl, pH 7.5,
5 mM DTT, 2% CHAPS and 20% glycerol. 5 .mu.L of each enzyme were
added to Corning (#3575) 384-well, black, microtiter plates
(Corning, N.Y.) after spotting a 0.5 .mu.L volume of 50% DMSO and
serially diluted compounds prepared in 50% DMSO. Protease reactions
were immediately started after enzyme addition with the addition of
45 .mu.L of the FRET substrate and monitored for 60-90 minutes at
.lamda..sub.ex485/.lamda..sub.em520 in a Synergy plate reader from
BioTek (Winooski, Vt.). At the conclusion of each assay, progress
curves from each well were examined for linear reaction kinetics
and fit statistics (R.sup.2, 95% confidence intervals, absolute sum
of squares). Initial velocity (0 minutes to 15+minutes) from each
reaction was determined from the slope of a plot of relative
fluorescence units vs time (minutes) and then plotted against
inhibitor concentration as a percent of the no inhibitor and no
enzyme controls to estimate apparent IC.sub.50 from log[Inhibitor]
vs Response. (Variable Slope model in GraphPad Prism from GraphPad
Software (San Diego, Calif.).)
G. PI3 Kinase Inhibitors (LYS) Synthetic Examples
Example 96
##STR00408##
[1099]
1-(4-((2-(1H-indazol-4-yl)-4-morpholinothieno[3,2-d]pyrimidin-6-yl)-
methyl)piperazin-1-yl)prop-2-en-1-one: The title compound was
prepared according to the steps and intermediates as described
below.
##STR00409## ##STR00410##
Step 1a: 4-(2-chlorothieno[3,2-d]pyrimidin-4-yl)morpholine
(Intermediate 1a)
##STR00411##
[1101] To a solution of 2,4-dichlorothieno[3,2-d]pyrimidine (2.0 g,
9.7 mmol) in 30 mL MeOH was added 1.9 mL morpholine. After stirring
at room temperature for one hour, the reaction mixture was
filtered; the solid was washed with water and methanol to provide
2.0 g of the title compound. MS m/z: 256.0, 258.1 (M+1). .sup.1H
NMR (400 MHz, CDCl.sub.3): .quadrature.: 7.78 (1H, d, J=5.48 Hz),
7.38 (1H, d, J=5.48 Hz), 4.02 (4H, t, J=4.80 Hz), 3.85 (4H, t,
J=4.82 Hz).
Step 1b:
2-chloro-4-morpholinothieno[3,2-d]pyrimidine-6-carbaldehyde
(Intermediate 1b)
##STR00412##
[1103] To a suspension of Intermediate 1a (1.02 g, 4.0 mmol) in 30
mL THF at -78.degree. C. was added LiHMDS (1.0 N, 6.0 mL, 6.0 mmol)
slowly. The reaction mixture was stirred at -78.degree. C. for 1 h,
DMF (0.5 mL) was added and reaction mixture was allowed to warm up
to room temperature over 2 hours. The reaction was quenched with
NH.sub.4Cl aqueous solution and the THF was removed under vacuum. A
50-mL portion of EtOAc was added in and the mixture was washed with
aqueous NaHCO.sub.3 and brine. The organic layer was separated and
was dried over Na.sub.2SO.sub.4. After removal of solvent, the
crude product was subjected to chromatography on silica gel
(eluents: EtOAc/hexane). A total of 0.6 g of the title compound was
obtained (60%). MS m/z: 284.2 (ES+, M+1).
Step 1c: tert-butyl
4-((2-chloro-4-morpholinothieno[3,2-d]pyrimidin-6-yl)methyl)piperazine-1--
carboxylate (Intermediate 1c)
##STR00413##
[1105] Intermediate 1b (0.40 g, 1.5 mmol), tert-butyl
piperazine-1-carboxylate and 0.2 mL acetic acid were dissolved in
12 mL dichloroethane. The mixture was stirred at room temperature
for 2 hours. NaBH(OAc).sub.3 (0.54 g, 2.5 mmol) was added to the
reaction mixture and the resulting mixture was stirred at room
temperature for 10 hours. A 20-mL of NaHCO.sub.3 aqueous solution
and 10 mL of DCM were added. The organic layer was separated and
dried over Na.sub.2SO.sub.4. After removal of solvent, the crude
product was subjected to chromatography on silica gel (eluents:
EtOAc/hexane 3:7). A total of 0.30 g of the title compound was
obtained. MS m/z: 454.2 (ES+, M+1).
Step 1d: tert-butyl
4-((2-(1H-indazol-4-yl)-4-morpholinothieno[3,2-d]pyrimidin-6-yl)methyl)pi-
perazine-1-carboxylate (Intermediate 1d)
##STR00414##
[1107] Intermediate 1c (0.14 g, 0.31 mmol),
4-(trimethylstannyl)-1H-indazole (0.10 g, 0.37 mmol) and
tetrakis(triphenylphosphine)palladium (35 mg, 0.03 mmol) were
dissolved in 5 mL toluene. The solution was degassed and flushed
with N.sub.2. The reaction mixture was heated to 135.degree. C. for
40 hours in a sealed vial. The solvent was removed under vacuum and
the residue was purified by chromatography on silica gel (eluents:
EtOAc/hexane 5:5). A total of 0.10 g of the title compound was
obtained. MS m/z: 536.1 (M+1).
[1108] Alternatively, Intermediate 1d can be prepared by the
following Suzuki coupling procedures: Intermediate 1c (70 mg, 0.15
mmol), 4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-indazole
(56 mg, 0.23 mmol), Pd(PPh.sub.3).sub.2Cl.sub.2 (10 mg, 0.015 mmol)
and sodium carbonate (60 mg, 0.56 mmoL) were dissolved in
toluene/ethanol/water (2.5 mL/1.5 mL/0.7 mL). The solution was
degassed and flushed with argon. The reaction mixture was heated to
125.degree. C. for 10 hours in a sealed vial. The reaction was then
worked up by adding ethyl acetate 10 mL and washed with water and
brine. The organic layer was separated and was dried over
Na.sub.2SO.sub.4. After removal of solvent, the crude product was
subjected to chromatography on silica gel (eluents: EtOAc/hexane
1:1 to 4:1) to give the title compound. MS m/z: 536.1 (M+1).
Step 1e:
4-(2-(1H-indazol-4-yl)-6-(piperazin-1-ylmethyl)thieno[3,2-d]pyrim-
idin-4-yl)morpholine (Intermediate 1e)
##STR00415##
[1110] Intermediate 1d (100 mg, 0.18 mmol) was dissolved in 3 mL of
4N HCl in dixoxane and the reaction was stirred for 3 hours at room
temperature. After removal of solvents, a 3-mL portion of DCM was
poured in followed by evaporation to dryness. This process of DCM
addition followed by evaporation was repeated three times to give a
white solid and was used directly for the next step. MS m/z: 436.2
(M+H.sup.+).
Step 1f:
1-(4-((2-(1H-indazol-4-yl)-4-morpholinothieno[3,2-d]pyrimidin-6-y-
l)methyl)piperazin-1-yl)prop-2-en-1-one
##STR00416##
[1112] To a solution of Intermediate 1e (10 mg, 0.02 mmol) and
acrylic acid (2.0 mg, 0.025 mmol) in 1.0 mL of anhydrous
acetonitrile was added HATU (9.1 mg, 0.024 mmol) and DIEA (15 mg,
0.1 mmol) at -40.degree. C. while stirring. The reaction mixture
was stirred for 10 min at .about.-10.degree. C. A 10-mL portion of
EtOAc and 5 mL of NaHCO.sub.3 aqueous solution were added. The
organic layer was separated and was dried over Na.sub.2SO.sub.4.
After removal of solvent, the crude product was subjected to
chromatography on silica gel (eluents: EtOAc/hexane 9:1). A total
of 6 mg of the title compound was obtained. MS m/z: 490.2
(M+H.sup.+). .sup.1H NMR (400 MHz, CDCl.sub.3): .quadrature.: 9.01
(1H d, J=0.88 Hz), 8.27 (1H d, J=7.32 Hz), 7.58 (1H d, J=7.0 Hz),
7.51 (1H t, J=6.84 Hz), 7.39 (1H, s), 6.56 (1H dd, J=10.56, 16.96
Hz), 6.32 (1H d, 16.96 Hz), 5.70 (1H d, 10.52 Hz), 4.09 (4H, m),
3.93 (6H, m), 3.79 (2H, s), 3.62 (2H, s), 2.60 (4H, s).
[1113] In similar fashion, using Intermediate 1e and coupling with
(R)-5-oxotetrahydrofuran-2-carboxylic acid, the following compound
was prepared:
##STR00417##
[1114] In similar fashion, using Intermediate 1e and coupling with
(S)-5-oxotetrahydrofuran-2-carboxylic acid, the following compound
was prepared:
##STR00418##
Example 97
##STR00419##
[1116]
1-(4-((2-(1H-indazol-4-yl)-4-morpholinothieno[3,2-d]pyrimidin-6-yl)-
methyl)piperazin-1-yl)butane-1,3-dione: In similar fashion, using
Intermediate 1e and suitable carboxylic acids, the title compound
was prepared: MS m/z: 520.1 (M+H.sup.+).
Example 98
##STR00420##
[1118]
4-((2-(1H-indazol-4-yl)-4-morpholinothieno[3,2-d]pyrimidin-6-yl)met-
hyl)-N-((2R,3S)-2-methyl-4-oxooxetan-3-yl)piperazine-1-carboxamide.
In similar fashion, using Intermediate 1e and suitable carboxylic
acids, the title compound was prepared: MS m/z: 563.3
(M+H.sup.+).
Example 99
##STR00421##
[1120]
(R)-5-(4-((2-(1H-indazol-4-yl)-4-morpholinothieno[3,2-d]pyrimidin-6-
-yl)methyl)piperazine-1-carbonyl)dihydrofuran-2(3H)-one: In similar
fashion, using Intermediate 1e and suitable carboxylic acids, the
titled compounds was prepared: MS m/z: 548.1 (M+H.sup.+).
Example 100
##STR00422##
[1122]
(S)-5-(4-((2-(1H-indazol-4-yl)-4-morpholinothieno[3,2-d]pyrimidin-6-
-yl)methyl)piperazine-1-carbonyl)dihydrofuran-2(3H)-one: In similar
fashion, using Intermediate 1e and suitable carboxylic acids, the
titled compounds was prepared: MS m/z: 548.1 (M+H.sup.+).
Example 101
##STR00423##
[1124] (R)-methyl
2-(4-((2-(2-aminopyrimidin-5-yl)-4-morpholinothieno[3,2-d]pyrimidin-6-yl)-
methyl)piperazine-1-carbonyl)-5-oxopyrrolidine-1-carboxylate. In
similar fashion, using Intermediate 1e and suitable carboxylic
acids, the titled compounds was prepared: MS m/z: 582.2
(M+H.sup.+).
Example 102
##STR00424##
[1126] (S)-methyl
2-(4-((2-(2-aminopyrimidin-5-yl)-4-morpholinothieno[3,2-d]pyrimidin-6-yl)-
methyl)piperazine-1-carbonyl)-5-oxopyrrolidine-1-carboxylate
(XXII-29). In similar fashion, using Intermediate 1e and suitable
carboxylic acids, the titled compounds was prepared: MS m/z: 582.2
(M+H.sup.+).
Example 103
##STR00425##
[1128]
3-(4-((2-(2-aminopyrimidin-5-yl)-4-morpholinothieno[3,2-d]pyrimidin-
-6-yl)methyl)piperazine-1-carbonyl)dihydrothiophen-2(3H)-one
(XXII-30). In similar fashion, using Intermediate 1e and suitable
carboxylic acids, the titled compounds was prepared: MS m/z: 541.1
(M+H.sup.+).
Example 104
##STR00426##
[1130]
4-(4-((2-(2-aminopyrimidin-5-yl)-4-morpholinothieno[3,2-d]pyrimidin-
-6-yl)methyl)piperazine-1-carbonyl)dihydrothiophen-2(3H)-one
(XXII-31). In similar fashion, using Intermediate 1e and suitable
carboxylic acids, the titled compounds was prepared: MS m/z: 541.1
(M+H.sup.+).
Example 105
##STR00427##
[1132]
5-(4-((2-(2-aminopyrimidin-5-yl)-4-morpholinothieno[3,2-d]pyrimidin-
-6-yl)methyl)piperazine-1-carbonyl)dihydrothiophen-2(3H)-one
(XXII-32). In similar fashion, using Intermediate 1e and suitable
carboxylic acids, the titled compounds was prepared: MS m/z: 541.1
(M+H.sup.+).
Example 106
##STR00428##
[1134]
5-(4-((2-(2-aminopyrimidin-5-yl)-4-morpholinothieno[3,2-d]pyrimidin-
-6-yl)methyl)piperazine-1-carbonyl)cyclohexane-1,3-dione (XXII-33).
In similar fashion, using Intermediate 1e and suitable carboxylic
acids, the titled compounds was prepared: MS m/z: 551.2
(M+H.sup.+).
Example 107
##STR00429##
[1136]
(4-((2-(1H-indazol-4-yl)-4-morpholinothieno[3,2-d]pyrimidin-6-yl)me-
thyl)piperazin-1-yl)(1H-imidazol-1-yl)methanone: In similar
fashion, using Intermediate 1e and coupling with CDI at the
presence of TEA in dichloromethane,
(4-((2-(1H-indazol-4-yl)-4-morpholinothieno[3,2-d]pyrimidin-6-yl)methyl)p-
iperazin-1-yl)(1H-imidazol-1-yl)methanone (XXII-16) was prepared:
MS m/z: 530.2 (M+H.sup.+).
Example 108
##STR00430##
[1138]
4-(2-(1H-indazol-4-yl)-6-(4-(vinylsulfonyl)piperazin-1-yl)methyl)th-
ieno[3,2-d]pyrimidin-4-yl)morpholine: In similar fashion, using
Intermediate 1e and coupling with 2-chloroethanesulfonyl chloride
in the presence of TEA,
4-(2-(1H-indazol-4-yl)-6-((4-(vinylsulfonyl)piperazin-1-yl)methyl)thieno[-
3,2-d]pyrimidin-4-yl)morpholine (XXII-8) was prepared: MS m/z:
526.2 (M+H.sup.+).
Example 109
##STR00431##
[1140]
(E)-5-(4-morpholino-6-((4-(prop-1-enylsulfonyl)piperazin-1-yl)methy-
l)thieno[3,2-d]pyrimidin-2-yl)pyrimidin-2-amine (XXII-25). In
similar fashion, using Intermediate 1e and
(E)-prop-1-ene-1-sulfonyl chloride, the titled compounds was
prepared: MS m/z: 517.2 (M+H.sup.+).
Example 110
##STR00432##
[1142]
2-(2-(4-((2-(1H-indazol-4-yl)-4-morpholinothieno[3,2-d]pyrimidin-6--
yl)methyl)piperazin-1-ylsulfonyl)ethyl)isoindoline-1,3-dione: In
similar fashion, using Intermediate 1e and coupling with
2-(1,3-dioxoisoindolin-2-yl)ethanesulfonyl chloride in the presence
of TEA, the following compound was prepared: MS m/z: 673.2
(M+H.sup.+).
Example 111
##STR00433##
[1144]
3-(4-((2-(1H-indazol-4-yl)-4-morpholinothieno[3,2-d]pyrimidin-6-yl)-
methyl)piperazin-1-yl)-4-isopropoxycyclobut-3-ene-1,2-dione: In
similar fashion, treating Intermediate 1e with
3,4-diisopropoxycyclobut-3-ene-1,2-dione in the presence of TEA in
acetonitrile, the following compound was prepared: MS m/z: 574.2
(M+H.sup.+).
Example 112
##STR00434##
[1146]
3-(4-((2-(2-aminopyrimidin-5-yl)-4-morpholinothieno[3,2-d]pyrimidin-
-6-yl)methyl)piperazin-1-yl)-4-isopropoxycyclobut-3-ene-1,2-dione
(XXII-26). In a similar way, the title compound was prepared. MS
m/z: 551.2 (M+1).
Example 113
##STR00435##
[1148]
3-(2-(4-((2-(2-aminopyrimidin-5-yl)-4-morpholinothieno[3,2-d]pyrimi-
din-6-yl)methyl)piperazin-1-yl)-2-oxoethylamino)-4-isopropoxycyclobut-3-en-
e-1,2-dione (XXII-27). In a similar way, the title compound was
prepared. MS m/z: 608.3 (M+1).
Example 114
##STR00436##
[1150]
1-(4-((4-morpholino-2-phenylthieno[3,2-d]pyrimidin-6-yl)methyl)pipe-
razin-1-yl)prop-2-en-1-one: In similar fashion as described above,
when using phenylboronic acid in step 1d instead of
4-(trimethylstannyl)-1H-indazole under a standard Suzuki coupling
condition, the following compounds were prepared: MS m/z: 450.2
(M+H.sup.+).
Example 115
##STR00437##
[1152]
(1H-imidazol-1-yl)(4-((4-morpholino-2-phenylthieno[3,2-d]pyrimidin--
6-yl)methyl)piperazin-1-yl)methanone: MS m/z: 490.2
(M+H.sup.+).
Example 116
##STR00438##
[1154]
N-((2-(3-hydroxyphenyl)-4-morpholinothieno[3,2-d]pyrimidin-6-yl)met-
hyl)-N-methylacrylamide: The title compound was prepared according
to the steps and intermediates as described below.
##STR00439## ##STR00440##
Step 2a: (2-chloro-4-morpholinothieno[3,2-d]pyrimidin-6-yl)methanol
(Intermediate 2a)
##STR00441##
[1156] To a solution of compound 1b (5 g, 17.6 mmol) in MeOH (50
mL) was added NaBH.sub.4 (0.98 g, 26.4 mmol) portion wise at
0.degree. C. and stirred for 5 h at RT. After the completion of
reaction (monitored by TLC), the volatiles were removed under
reduced pressure, residue dissolved in water and extracted with DCM
(3.times.75 mL). The combined organic phases were washed with
water, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in
vacuo to afford intermediate 6a (3 g, 60%) as a light yellow solid.
TLC: 80% EtOAc/Hexane (R.sub.f: 0.3); .sup.1H-NMR (CDCl.sub.3, 200
MHz): .delta. 7.21 (s, 1H), 4.98 (s, 2H), 4.0 (t, J=4.2 Hz, 4H),
3.83 (t, J=4.8 Hz, 4H); Mass: 286 [M.sup.++1]
Step 2b: (2-chloro-4-morpholinothieno[3,2-d]pyrimidin-6-yl)methyl
methanesulfonate (Intermediate 2b)
##STR00442##
[1158] To a solution of Intermediate 2a (1 g, 3.5 mmol) in DCM (10
mL) was added TEA (1.06 g, 10.5 mmol) over a period of 10 minutes
and followed by addition of mesyl chloride (0.48 g, 4.2 mmol) at
0.degree. C. The reaction mixture was stirred for 1 h at RT. After
the completion of reaction (monitored by TLC), water (25 mL) was
added, extracted with DCM (2.times.50 mL). The combined organic
phases were dried over anhydrous Na.sub.2SO.sub.4 and concentrated
in vacuo. The crude compound was purified by silicagel column
chromatography (50% EtOAc/hexane) to afford intermediate 2b (0.8 g,
62%) as a yellow solid. TLC: 80% EtOAc/Hexane (R.sub.f: 0.6);
.sup.1H-NMR (CDCl.sub.3, 500 MHz) (SAV-A9008-009): .delta. 7.39 (s,
1H), 5.46 (s, 2H), 4.0 (t, J=4.5 Hz, 4H), 3.84 (t, J=5.0 Hz, 4H),
3.05 (s, 3H); Mass: 364 [M.sup.++1]; Mp: 151.4.degree. C.
Step 2c:
1-(2-chloro-4-morpholinothieno[3,2-d]pyrimidin-6-yl)-N-methylmeth-
anamine (Intermediate 2c)
##STR00443##
[1160] A solution of Intermediate 2b (0.24 g, 0.67 mmol), 2M
methylamine in THF (2.0 mL, 4.0 mmol) and DIEA (0.35 mL, 2.0 mmol)
in THF (5 mL) was stirred at RT for 2 hours. LC-MS showed the
complete conversion to the product. The solvent was removed in
vacuo and the crude was used directly for the next step. MS m/z:
299.1 (M+1).
Step 2d: tert-butyl
(2-chloro-4-morpholinothieno[3,2-d]pyrimidin-6-yl)methyl(methyl)carbamate
(Intermediate 2d)
##STR00444##
[1162] The crude Intermediate 2c, Boc.sub.2O (0.22 g, 1.0 mmol),
and TEA (0.2 mL) were dissolved in 10 mL dichloromethane and the
solution was stirred for 10 hours. LC-MS showed the complete
conversion to the product. The solvent was removed in vacuo and the
crude was used directly for the next step. MS m/z: 399.1 (M+1).
Step 2e: tert-butyl
(2-(3-hydroxyphenyl)-4-morpholinothieno[3,2-d]pyrimidin-6-yl)methyl(methy-
l)carbamate (Intermediate 2e)
##STR00445##
[1164] Intermediate 2d (0.20 g, 0.50 mmol), 3-hydroxyphenylboronic
acid (139 mg, 1.0 mmol), Pd(PPh.sub.3).sub.2Cl.sub.2 (50 mg, 0.067
mmol) and sodium carbonate (0.5 g, 4.1 mmoL) were dissolved in
toluene/ethanol/water (5 mL/3 mL/1.5 mL). The solution was degassed
and flushed with N.sub.2. The reaction mixture was heated to
120.degree. C. for 3 hours in a sealed vial. The solvent was
removed under vacuum and the residue was purified by chromatography
on silica gel (eluents: EtOAc/hexane 1:1). A total of 190 mg (66%)
of the title compound was obtained.
[1165] MS m/z: 457.1 (M+1).
Step 2f:
3-(6-((methylamino)methyl)-4-morpholinothieno[3,2-d]pyrimidin-2-y-
l)phenol (Intermediate 2f)
##STR00446##
[1167] Intermediate 2e was treated with 4N HCl following the
procedure described in Example 102, step 1e to afford the title
compound. MS m/z: 357.1 (M+1).
##STR00447##
Step 2g:
N-((2-(3-hydroxyphenyl)-4-morpholinothieno[3,2-d]pyrimidin-6-yl)-
methyl)-N-methylacrylamide (XXII-5)
[1168] The title compound was prepared by coupling acrylic acid
with Intermediate 2f using HATU following the procedure described
in Step 1f. MS m/z: 411.1 (M+H.sup.+).
Example 117
##STR00448##
[1170]
N-((2-(3-hydroxyphenyl)-4-morpholinothieno[3,2-d]pyrimidin-6-yl)met-
hyl)-N-methylethenesulfonamide: In similar fashion, using
Intermediate 2f, the following compounds were prepared: MS m/z:
447.1 (M+1).
Example 118
##STR00449##
[1172]
3-(6-((N-methylvinylsulfonamido)methyl)-4-morpholinothieno[3,2-d]py-
rimidin-2-yl)phenyl ethenesulfonate: MS m/z: 537.2 (M+1).
Example 119
##STR00450##
[1174]
3-(((2-(3-hydroxyphenyl)-4-morpholinothieno[3,2-d]pyrimidin-6-yl)me-
thyl)(methyl)amino)-4-isopropoxycyclobut-3-ene-1,2-dione: MS m/z:
495.1 (M+1).
Example 120
##STR00451##
[1176]
(R)-N-((2-(3-hydroxyphenyl)-4-morpholinothieno[3,2-d]pyrimidin-6-yl-
)methyl)-N-methyl-5-oxotetrahydrofuran-2-carboxamide: MS m/z: 469.2
(M+1).
Example 121
##STR00452##
[1178]
(S)-N-((2-(3-hydroxyphenyl)-4-morpholinothieno[3,2-d]pyrimidin-6-yl-
)methyl)-N-methyl-5-oxotetrahydrofuran-2-carboxamide: MS m/z: 469.2
(M+1).
Example 122
##STR00453##
[1180]
(E)-N-((2-(3-hydroxyphenyl)-4-morpholinothieno[3,2-d]pyrimidin-6-yl-
)methyl)-N-methyl-4-oxohept-5-enamide: MS m/z: 481.2 (M+1).
##STR00454##
[1181]
N-((2-(3-hydroxyphenyl)-4-morpholinothieno[3,2-d]pyrimidin-6-yl)met-
hyl)-N-methyl-4-oxo-4-(2-oxoazetidin-1-yl)butanamide (XXII-24). In
similar fashion, using Intermediate 2f, the titled compounds was
prepared: MS m/z: 510.2 (M+1).
Example 123
##STR00455##
[1183]
(R)-5-(4-(2-(3-hydroxyphenyl)-4-morpholinothieno[3,2-d]pyrimidin-6--
yl)-1,2,3,6-tetrahydropyridine-1-carbonyl)dihydrofuran-2(3H)-one:
The title compound was prepared according to the steps and
intermediates as described below.
##STR00456##
Step 3a: 4-(2-chloro-6-iodothieno[3,2-d]pyrimidin-4-yl)morpholine
(Intermediate 3a)
[1184] To a stirred solution of Intermediate 1a (5 g, 0.019 mol) in
THF (100 mL) was added n-BuLi (2.5 g, 0.03 mol) at -78.degree. C.
over a period of 30 minutes, stirred for 2 h at -40.degree. C.
followed by addition of iodine (9.9 g, 0.03 mol) in THF (5 mL) at
-78.degree. C. The reaction mixture was stirred for 8 h at RT.
After the completion of reaction (monitored by TLC), the reaction
was quenched with saturated ammonium chloride (100 mL) and
extracted with EtOAc (4.times.200 mL). The organic layer was washed
with sodium thiosulphate solution, dried over anhydrous
Na.sub.2SO.sub.4 and concentrated in vacuo. The crude product was
washed with diethyl ether to afford intermediate 3a (7 g, 94%) as
off white solid. TLC: 30% Ethyl acetate/hexane (R.sub.f: 0.3);
.sup.1H-NMR (CDCl.sub.3, 500 MHz): .delta. 7.57 (s, 1H), 3.94-3.91
(m, 4H), 3.85-3.80 (m, 4H); Mass: 382 [M.sup.++1], MP:
173.5.degree. C.
Step 3b: tert-butyl
4-(2-chloro-4-morpholinothieno[3,2-d]pyrimidin-6-yl)-5,6-dihydropyridine--
1(2H)-carboxylate (Intermediate 3b)
##STR00457##
[1186] To a stirred solution of
4-(2-chloro-6-iodothieno[3,2-d]pyrimidin-4-yl)morpholine
(Intermediate 3a) (0.57 g, 1.5 mmol) in toluene (10 mL), EtOH (6.0
mL), H.sub.2O (3.0 mL) was added tert-butyl
4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-5,6-dihydropyridine-1(2H)-
-carboxylate (0.5 g, 1.6 mmol), Na.sub.2CO.sub.3 (0.7 g) and
Pd(PPh.sub.3).sub.2Cl.sub.2 (56 mg, 0.08 mmol) at RT. The reaction
mixture was degassed with argon and stirred at 40.degree. C. for 3
h. LC-MS showed the completion of the conversion: MS m/z: 437.1
(M+1). The reaction mixture was used directly for the next
step.
Step 3c: tert-butyl
4-(2-(3-hydroxyphenyl)-4-morpholinothieno[3,2-d]pyrimidin-6-yl)-5,6-dihyd-
ropyridine-1(2H)-carboxylate (Intermediate 3c)
##STR00458##
[1188] To the reaction mixture from step 3b was added
3-hydroxyphenylboronic acid (0.35 g, 2.5 mmol), Na.sub.2CO.sub.3
(1.0 g) and Pd(PPh.sub.3).sub.2Cl.sub.2 (30 mg, 0.04 mmol) at RT.
The reaction mixture was degassed with argon and stirred at
130.degree. C. for 3 h. The reaction was then worked up by adding
ethyl acetate 50 mL and washed with water and brine. The organic
layer was separated and was dried over Na.sub.2SO.sub.4. After
removal of solvent, the crude product was subjected to
chromatography on silica gel (eluents: EtOAc/hexane 1:1 to 4:1) to
give the title compound. MS m/z: 495.1 (M+1).
##STR00459##
Step 3d:
(R)-5-(4-(2-(3-hydroxyphenyl)-4-morpholinothieno[3,2-d]pyrimidin-
-6-yl)-1,2,3,6-tetrahydropyridine-1-carbonyl)dihydrofuran-2(3H)-one
[1189] The title compound was prepared by following the de-boc and
the coupling procedures described in example 1. MS m/z: 507.1
(M+H.sup.+).
Example 124
##STR00460##
[1191] In similar fashion,
(S)-5-(4-(2-(3-hydroxyphenyl)-4-morpholinothieno[3,2-d]pyrimidin-6-yl)-1,-
2,3,6-tetrahydropyridine-1-carbonyl)dihydrofuran-2(3H)-one, XXII-1,
was prepared: MS m/z: 507.1 (M+H.sup.+).
Example 125
##STR00461##
[1193]
1-(4-(3-(2-(3-hydroxyphenyl)-4-morpholinothieno[3,2-d]pyrimidin-6-y-
l)prop-2-ynyl)piperazin-1-yl)prop-2-en-1-one: The title compound
was prepared according to the steps and intermediates as described
below.
##STR00462##
Step 4a: tert-butyl
4-(3-(2-chloro-4-morpholinothieno[3,2-d]pyrimidin-6-yl)prop-2-ynyl)pipera-
zine-1-carboxylate (Intermediate 4a)
##STR00463##
[1195] To a stirred solution of Intermediate 3a (1.0 g, 2.6 mmol),
tert-butyl 4-(prop-2-ynyl)piperazine-1-carboxylate (880 mg, 3.8
mmol) in THF (40 mL) were added TEA (16 mL) followed by
Pd(PPh.sub.3).sub.2Cl.sub.2 (184 mg, 0.26 mmol) at RT, degassed
with argon for 30 minutes and CuI (496 mg, 2.6 mmol) was added to
the reaction mixture. The reaction mixture was again degassed with
argon for 30 minutes. The resulting reaction mixture was refluxed
for 3 h. After the completion of reaction (monitored by TLC), the
reaction mixture was diluted with DCM. The organic layer was washed
with water and dried over anhydrous Na.sub.2SO.sub.4 and
concentrated under reduced pressure. The crude material was
purified by silica gel column chromatography (20% EtOAc/Hexane) to
afford intermediate 4a (0.60 g). Mass: 478 [M.sup.++1].
Step 4b: tert-butyl
4-(3-(2-(3-hydroxyphenyl)-4-morpholinothieno[3,2-d]pyrimidin-6-yl)prop-2--
ynyl)piperazine-1-carboxylate (Intermediate 4b)
##STR00464##
[1197] The title compound was prepared by coupling intermediate 4a
and 3-hydroxyphenylboronic acid following the procedures described
in step 3c of Example 123. MS m/z: 536.2 (M+H.sup.+).
##STR00465##
Step 4c:
1-(4-(3-(2-(3-hydroxyphenyl)-4-morpholinothieno[3,2-d]pyrimidin--
6-yl)prop-2-ynyl)piperazin-1-yl)prop-2-en-1-one
[1198] The title compound was prepared by following the procedures
described in Example 96, step 1e and 1f. MS m/z: 490.1
(M+H.sup.+).
Example 126
##STR00466##
[1200]
(R)-5-(4-(3-(2-(3-hydroxyphenyl)-4-morpholinothieno[3,2-d]pyrimidin-
-6-yl)prop-2-ynyl)piperazine-1-carbonyl)dihydrofuran-2(3H)-one: In
similar fashion, starting from intermediate 4b, using a suitable
carboxylic acid, the following compounds are made.
Example 127
##STR00467##
[1202]
(S)-5-(4-(3-(2-(3-hydroxyphenyl)-4-morpholinothieno[3,2-d]pyrimidin-
-6-yl)prop-2-ynyl)piperazine-1-carbonyl)dihydrofuran-2(3H)-one: In
similar fashion, starting from intermediate 4b, using a suitable
carboxylic acid, the following compounds are made.
Example 128
##STR00468##
[1204]
2-(6-(1-acryloyl-1H-pyrazol-4-yl)-2H-benzo[b][1,4]oxazin-4(3H)-yl)--
6,6-dimethyl-6,7-dihydrothiazolo[5,4-c]pyridin-4(5H)-one: The title
compound was prepared according to the steps and intermediates as
described below.
Synthesis of Intermediate 5-I
##STR00469##
[1205] Step 5-I-a: Ethyl 3-amino-3-methylbutanoate hydrochloride
salt (5-I-a)
[1206] To a solution of ethyl 3-methylbut-2-enoate (15 g, 117 mmol)
in EtOH (40 mL) was added liquid ammonia (80 mL) at -70.degree. C.
and the reaction mixture stirred in a autoclave (200 Psi) at
45.degree. C. for 16 h. After completion of the reaction (monitored
by TLC), excess ammonia was removed by flashing N.sub.2, cooled to
0.degree. C. and HCl in dioxane (pH.about.2) was added. The
reaction mixture was stirred for 30 minutes at 0.degree. C., the
volatiles were removed under reduced pressure and the obtained
solid was washed with diethyl ether to afford 5-I-a-HCl salt (10 g,
58.8%) as white solid; TLC: 10% MeOH/DCM (R.sub.f: 0.1);
.sup.1H-NMR (DMSO d.sub.6, 200 MHz): .delta. 8.33 (bs, 1H), 4.09
(q, J=7.0 Hz, 2H), 2.70 (s, 2H), 1.33 (s, 6H), 1.20 (t, J=7.0 Hz,
3H); Mass: 146 [M.sup.++1].
Step 5-I-b: Ethyl 3-(ethyl 2-carbamoylacetyl)-3-methylbutanoate
(5-I-b)
[1207] To a solution of compound 5-I-a (11 g, 68.9 mmol) in DCM
(150 mL) was added TEA (38.1 mL, 275 mmol) and ethyl malonoyl
chloride (8.8 mL, 68.9 mmol) at 0.degree. C. The reaction mixture
was stirred at RT for 3 h. After completion of the reaction
(monitored by TLC), the reaction was quenched water and extracted
with DCM (2.times.200 mL). The combined organic layer was washed
with 1N HCl (100 mL), saturated NaHCO.sub.3 (100 mL), dried over
anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to afford
5-I-b (11 g, 62%) as brown syrup. TLC: 30% EtOAc/Hexane (R.sub.f:
0.3); .sup.1H-NMR (CDCl.sub.3, 200 MHz): .delta. 4.28-4.07 (m, 4H),
3.24 (s, 2H), 2.74 (s, 2H), 1.45 (s, 6H), 1.35-1.20 (m, 6H); Mass:
260 [M.sup.++1].
Steps 5-I-c and 5-I-d: 6,6-Dimethylpiperidine-2,4-dione (5-I-d)
[1208] To a stirred solution of compound 5-I-b (11 g, 42.6 mmol) in
toluene (120 mL) was added NaOEt (4.34 g, 63.9 mmol) in toluene (30
mL) and the reaction mixture was stirred at 80.degree. C. for 4 h.
After completion of the reaction (monitored by TLC), the reaction
was quenched water, and the aqueous layer was extracted with
diethyl ether (100 mL). The organic layer was separated; aqueous
layer was acidified with 1N HCl and extracted with DCM (2.times.200
mL). The combined organic layer was dried over Na.sub.2SO.sub.4 and
concentrated in vacuo. The obtained crude 5-I-c was dissolved in 1%
H.sub.2O/ACN (80 mL) and refluxed for 3 h. After completion of the
reaction (monitored by TLC), the volatiles were removed under
reduced pressure and the obtained residue was washed with diethyl
ether to afford 5-I-d (3.2 g, 53.3%) as off white solid. TLC: 10%
MeOH/DCM (R.sub.f: 0.3); .sup.1H-NMR (CDCl.sub.3+DMSO-d.sub.6, 200
MHz): .delta. 7.28 (bs, NH), 3.21 (s, 2H), 2.56 (s, 2H), 1.34 (s,
6H); Mass: 142 [M.sup.++1].
Step 5-I-e:
2-Amino-6,7-dihydro-6,6-dimethylthiazolo[5,4-c]pyridin-4(5H)-one
(5-I-e)
[1209] To a stirred solution of compound 5-I-d (3.2 g, 22.7 mmol)
in THF (100 mL) was added Br.sub.2 (1.13 mL, 22.7 mmol) and the
reaction mixture was stirred for 10 minutes at RT followed by
addition of thiourea (1.72 g, 22.7 mmol) and DIPEA (12 mL, 68.0
mmol). The reaction mixture was stirred at 80.degree. C. for 2 h.
After completion of the reaction (monitored by TLC), the reaction
was quenched water and extracted with EtOAc (2.times.150 mL). The
combined organic layer was dried over Na.sub.2SO.sub.4,
concentrated in vacuo and the crude residue was washed with diethyl
ether to afford 5-I-e (2.5 g, 56%) as yellow solid. TLC: 10%
MeOH/DCM (R.sub.f: 0.2); .sup.1H-NMR (DMSO d.sub.6, 200 MHz):
.delta. 7.63 (bs, 2H), 7.17 (bs, 1H), 2.61 (s, 2H), 1.22 (s, 6H);
Mass: 198 [M.sup.++1].
Intermediate 5-I:
2-bromo-6,7-dihydro-6,6-dimethylthiazolo[5,4-c]pyridin-4(5H)-one
[1210] To a solution of compound 5-I-e (2.5 g, 12.7 mmol) in
acetonitrile (70 mL) was added CuBr.sub.2 (2.26 g, 10.15 mmol) and
tert-butyl nitrite (1.3 g, 12.8 mmol) at RT. The reaction mixture
was stirred for 2 h at RT. After completion of reaction (monitored
by TLC), the reaction was quenched with 1N HCl and extracted with
DCM (2.times.150 mL). The combined organic layer was dried over
Na.sub.2SO.sub.4, concentrated in vacuo and the crude residue was
washed with diethyl ether to afford 5-I (2 g, 60%) as brown solid;
TLC: 10% MeOH/DCM (R.sub.f: 0.5); .sup.1H-NMR (CDCl.sub.3, 500
MHz): .delta. 5.48 (bs, NH), 3.02 (s, 2H), 1.4 (s, 6H); Mass: 283
[M.sup.++Na].
Synthesis of Intermediate 5-II
##STR00470##
[1211] 4-Bromo-1-(1-ethoxyethyl)-1H-pyrazole (5-II-a)
[1212] To a solution of 4-bromo-1H-pyrazole (3 g, 20.4 mmol), ethyl
vinyl ether (1.76 g, 24.5 mmol) in DCM (30 mL) was added HCl (4M in
dioxane, 0.16 mL), and the reaction mixture was stirred for 3 h at
RT. After completion of the reaction (monitored by TLC), the
reaction was neutralized with saturated NaHCO.sub.3 solution and
extracted with DCM (3.times.100 mL). The combined organic layers
were dried over anhydrous Na.sub.2SO.sub.4 and concentrated in
vacuo to afford 5-II-a (4.46 g, 89%) as colorless liquid; TLC: 30%
EtOAc/Hexane (R.sub.f: 0.7); .sup.1H-NMR (CDCl.sub.3, 200 MHz):
.delta. 7.60 (s, 1H), 7.46 (s, 1H), 5.46 (q, J=6.0 Hz, 1H),
3.55-3.25 (m, 2H), 1.63 (d, J=6.0 Hz, 3H), 1.15 (t, J=7.2 Hz, 3H);
MS: 221 [M.sup.++2].
1-(1-ethoxyethyl)-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyraz-
ole (5-II)
[1213] To a solution of compound 5-II-a (600 mg, 2.73 mmol) in
dioxane (15 mL) was added KOAc (800 mg, 8.2 mmol),
bis(pinacolato)diboran (1.39 g, 5.4 mmol) and Pd(dppf)Cl.sub.2
(0.06 g, 0.08 mmol) at RT. The reaction mixture was degassed by
purging with argon for 30 minutes and stirred at 50.degree. C. for
16 h. After completion of the reaction (monitored by TLC), the
reaction was quenched with H.sub.2O and extracted with EtOAc
(3.times.100 mL). The combined organic layers were dried over
anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The crude
compound was purified by column chromatography (15% EtOAc/Hexane)
to afford 5-II (500 mg, 68.5%) as off white solid. TLC: 30%
EtOAc/Hexane (R.sub.f: 0.4); .sup.1H-NMR (CDCl.sub.3, 200 MHz):
.delta. 7.90 (s, 1H), 7.79 (s, 1H), 5.56 (q, J=6.0 Hz, 1H),
3.55-3.25 (m, 2H), 1.63 (d, J=6.0 Hz, 3H), 1.35 (s, 12H), 1.15 (t,
J=7.2 Hz, 3H); Mass: 267 [M.sup.++1].
Synthesis of XXIII-5
2-(6-(1-acryloyl-1H-pyrazol-4-yl)-2H-benzo[b][1,4]oxazin-4(3H)-yl)-6,6-dim-
ethyl-6,7-dihydrothiazolo[5,4-c]pyridin-4(5H)-one
[1214] The title compound was prepared according to the steps and
intermediates as described below:
##STR00471##
2-(6-bromo-2,3-dihydrobenzo[b][1,4]oxazin-4-yl)-6,7-dihydro-6,6-dimethylt-
hiazolo[5,4-c]pyridin-4(5H)-one (5-III-1)
[1215] To a solution of compound 5-I (2.7 g, 10.3 mmol) in
acetonitrile (100 mL) were added Cs.sub.2CO.sub.3 (6.71 g, 20.6
mmol), Xanthophos (476 mg, 0.82 mmol) and Pd(OAc).sub.2 (139 mg,
0.61 mmol) at room temperature. The reaction mixture was degassed
by purging with argon and
6-bromo-3,4-dihydro-2H-benzo[b][1,4]oxazine (2.31 g, 10.3 mmol) in
acetonitrile was added. The reaction mixture was degassed for 45
minutes at RT and at 85.degree. C. for 16 h. After completion of
the reaction (monitored by TLC), the reaction mixture was filtered
through a pad of celite, washed with 5% MeOH/DCM and the filtrate
was concentrated in vacuo. The crude compound was purified by
washing with diethyl ether to afford compound 5-III-1 (3.24 g, 80%)
as brown solid. TLC: EtOAc (R.sub.f: 0.4); .sup.1H-NMR (CDCl.sub.3,
200 MHz): .delta. 8.24 (d, J=2.2 Hz, 1H), 7.14 (dd, J=2.4, 8.8 Hz,
1H), 6.83 (d, J=9.0 Hz, 1H), 5.29 (bs, NH), 4.38-4.30 (m, 2H),
4.10-4.02 (m, 2H), 2.90 (s, 2H), 1.40 (s, 6H); Mass: 394.5
[M.sup.++1]; MP: 154.7.degree. C.
2-(6-(1-(1-ethoxyethyl)-1H-pyrazol-4-yl)-2H-benzo[b][1,4]oxazin-4(3H)-yl)--
6,6-dimethyl-6,7-dihydrothiazolo[5,4-c]pyridin-4(5H)-one
(5-III-2)
[1216] To a solution of compound 5-III-1 (2.0 g, 5.0 mmol) in THF
(70 mL) were added boronate ester 5-II (3.37 g, 12.7 mmol),
Na.sub.2CO.sub.3 (1.6 g, 15.2 mmol), TBAB (653 mg, 20.3 mmol) and
Pd(PPh.sub.3).sub.4 (470 mg, 0.4 mmol) at room temperature. The
reaction mixture was degassed by purging with argon for 45 minutes
and stirred at 100.degree. C. for 36 h. After completion of the
reaction (monitored by TLC), the volatiles were removed under
reduced pressure and water was added. The aqueous layer was
extracted with DCM (3.times.100 mL), the combined organic layers
was dried over anhydrous Na.sub.2SO.sub.4 and concentrated in
vacuo. The crude compound was purified by column chromatography (3%
MeOH/DCM) to afford 5-III-2 (850 mg, 37%) as brown solid. TLC: 5%
MeOH/DCM (R.sub.f: 0.4); .sup.1H-NMR (CDCl.sub.3, 200 MHz): .delta.
8.03 (s, 1H), 7.75 (d, J=8.4 Hz, 2H), 7.20 (d, J=2.4, 8.4 Hz, 1H),
6.95 (d, J=8.4 Hz, 1H), 5.55 (q, J=6.0 Hz, 1H), 5.26 (bs, 1H),
4.40-4.30 (m, 2H), 4.25-4.15 (m, 2H), 3.55-3.35 (m, 2H), 2.90 (s,
2H), 1.73 (d, J=6.0 Hz, 3H), 1.43 (s, 6H), 1.15 (t, J=7.2 Hz, 3H);
Mass: 476 [M.sup.++Na] and 382 [M-71].
2-(6-(1H-pyrazol-4-yl)-2H-benzo[b][1,4]oxazin-4(3H)-yl)-6,6-dimethyl-6,7-d-
ihydrothiazolo[5,4-c]pyridin-4(5H)-one (5-III-3)
[1217] To a solution of compound 5-III-2 (0.85 g, 1.87 mmol) in DCM
(10 mL) was added HCl/dioxane (2 mL) at 0.degree. C. and the
reaction mixture was stirred for 2 h at RT. After completion of the
reaction (monitored by TLC), the volatiles were removed under
reduced pressure and the residue was washed with diisopropyl ether
followed by 20% EtOAc/hexane to afford 5-III-3 (600 mg, 84%) as off
white solid. TLC: 10% MeOH/DCM (R.sub.f: 0.3); .sup.1H-NMR (DMSO
d.sub.6, 200 MHz): .delta. 8.28 (d, J=8.4 Hz, 1H), 7.98 (s, 1H),
7.53 (s, 1H), 7.3 (dd, J=2.2, 8.4 Hz, 1H), 6.94 (d, J=8.4 Hz, 1H),
4.35-4.25 (m, 2H), 4.14-4.05 (m, 2H), 2.83 (s, 2H), 1.28 (s, 6H).
Mass: 382 [M.sup.++1].
2-(6-(1-acryloyl-1H-pyrazol-4-yl)-2H-benzo[b][1,4]oxazin-4(3H)-yl)-6,6-dim-
ethyl-6,7-dihydrothiazolo[5,4-c]pyridin-4(5H)-one (XXIII-5)
[1218] To a stirred solution of the above compound 5-III-3 (0.01 g,
0.024 mmol) in DCM (1.0 mL) was added TEA (0.008 g, 0.08 mmol)
followed by acryloyl chloride (0.0025 g, 0.029 mmol) at RT. The
reaction mixture was stirred for 0.5 h. The solvent was removed in
vacuo. The crude compound was purified by prep. HPLC (25% to 90%
CH3CN aqueous containing 0.1% TFA) to give 7.0 mg of the title
compound. MS m/z: 436.0 (M+1).
Example 129
##STR00472##
[1219]
(1S,4S)-5-(4-(4-(6,6-dimethyl-4-oxo-4,5,6,7-tetrahydrothiazolo[5,4--
c]pyridin-2-yl)-3,4-dihydro-2H-benzo[b][1,4]oxazin-6-yl)benzoyl)-2-oxa-5-a-
zabicyclo[2.2.1]heptan-3-one
[1220] The title compound was prepared according to the steps and
intermediates as described below.
##STR00473##
Step 6a:
4-(4-(6,6-dimethyl-4-oxo-4,5,6,7-tetrahydrothiazolo[5,4-c]pyridi-
n-2-yl)-3,4-dihydro-2H-benzo[b][1,4]oxazin-6-yl)benzoic acid
##STR00474##
[1222]
2-(6-bromo-2H-benzo[b][1,4]oxazin-4(3H)-yl)-6,6-dimethyl-6,7-dihydr-
othiazolo[5,4-c]pyridin-4(5H)-one (compound 5-III-1) and
4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzoic acid were
coupled following the Suzuki coupling procedure described in step
3c to afford the title compound (30 mg). MS m/z: 436.2 (M+1).
Step 6b:
(1S,4S)-5-(4-(4-(6,6-dimethyl-4-oxo-4,5,6,7-tetrahydrothiazolo[5,-
4-c]pyridin-2-yl)-3,4-dihydro-2H-benzo[b][1,4]oxazin-6-yl)benzoyl)-2-oxa-5-
-azabicyclo[2.2.1]heptan-3-one (XXIII-8)
[1223] To a solution of intermediate 6a (22 mg, 0.05 mmol) and
(1S,4S)-2-oxa-5-azabicyclo[2.2.1]heptan-3-one HCl salt (10 mg, 0.06
mmol) in 2 mL dichloromethane was added EDCI.HCl (15 mg, 0.08
mmol), HOBT (11 mg, 0.08 mmol) and DIEA (0.05 mL). The reaction
mixture was stirred at RT for 1 hour. After removal of solvent, the
crude product was subject to prep. HPLC (40% to 90% CH.sub.3CN
aqueous containing 0.1% TFA) to give 15 mg of the title compound.
MS m/z: 531.2 (M+1).
Example 130
##STR00475##
[1225]
(1R,4R)-5-(4-(4-(6,6-dimethyl-4-oxo-4,5,6,7-tetrahydrothiazolo[5,4--
c]pyridin-2-yl)-3,4-dihydro-2H-benzo[b][1,4]oxazin-6-yl)benzoyl)-2-oxa-5-a-
zabicyclo[2.2.1]heptan-3-one. In similar fashion, when using
(1R,4R)-2-oxa-5-azabicyclo[2.2.1]heptan-3-one HCl salt in step 6b,
the following compound was prepared: MS m/z: 531.2 (M+1).
Example 131
##STR00476##
[1227]
(R)-N-(4-(6,6-dimethyl-4-oxo-4,5,6,7-tetrahydrothiazolo[5,4-c]pyrid-
in-2-yl)-3,4-dihydro-2H-benzo[b][1,4]oxazin-6-yl)-5-oxotetrahydrofuran-2-c-
arboxamide. The title compound was prepared according to the steps
and intermediates as described below.
##STR00477##
Step 7a: 6-nitro-2H-benzo[b][1,4]oxazin-3(4H)-one (Intermediate
7a)
[1228] To a stirred solution of 2-amino-4-nitrophenol (3 g, 19.4
mmol) in DMF (25 mL) was added pyridine (1.6 mL, 19.4 mmol) and
chloroacetyl chloride (1.53 mL, 19.4 mmol) at 0.degree. C. The
reaction mixture was stirred for 1 h at RT followed by addition of
60% NaH (780 mg, 19.4 mmol) and continued stirring for another 2 h
at RT. After the completion of reaction (monitored by TLC), the
reaction was quenched with ice cold water (150 mL), precipitated
solid was filtered and dried to afford 7a (2 g, 54%) as off white
solid. TLC: 60% Ethyl acetate/hexane (R.sub.f: 0.4); .sup.1H NMR
(500 MHz, CDCl.sub.3): .delta. 8.05 (bs, 1H), 7.93 (d, J=9.0 Hz,
1H), 7.73 (s, 1H), 7.08 (d, J=9.0 Hz, 1H), 4.75 (s, 2H).
Step 7b: 3,4-dihydro-6-nitro-2H-benzo[b][1,4]oxazine (Intermediate
7b)
[1229] To a stirred solution of 7a (1.7 g, 8.85 mmol) in THF (30
mL) was added BF.sub.3 etharate (2.8 mL, 22.13 mmol) at 0.degree.
C., the reaction mixture was stirred for 1 h at RT and followed by
addition of NaHB.sub.4 (836 mg, 22.13 mmol) at 0.degree. C. under
inert atmosphere. The reaction mixture was stirred for 16 h at RT.
After the completion of reaction (monitored by TLC), the reaction
mixture was diluted with EtOAc/H.sub.2O and aqueous layer was
extracted with EtOAc (2.times.100 mL). The combined organic layer
was dried over anhydrous Na.sub.2SO.sub.4 and concentrated in
vacuo. The obtained solid was purified by ether washing to afford
7b (1 g, 63%) as off white solid. TLC: 50% Ethyl acetate/hexane
(R.sub.f: 0.3); .sup.1H NMR (500 MHz, CDCl.sub.3): .delta. 7.56
(dd, J=2.5, 9.0 Hz, 1H), 7.47 (d, J=5.3 Hz, 1H), 6.8 (d, J=9.0 Hz,
1H), 4.33 (t, J=4.0 Hz, 2H), 3.48-3.44 (m, 2H); Mass: 178
[M.sup.++1].
Step 7c:
6,7-Dihydro-2-(2,3-dihydro-6-nitrobenzo[b][1,4]oxazin-4-yl)-6,6-d-
imethylthiazolo[5,4-c]pyridin-4(5H)-one (Intermediate 7c)
[1230] To a stirred solution of 5-I (1 g, 3.8 mmol, from Example
128) in acetonitrile (25 mL) was added compound 7b (680 mg, 3.8
mmol), Xanthophos (176 mg, 0.3 mmol), Pd(OAc).sub.2 (52 mg, 0.2
mmol) and Cs.sub.2CO.sub.3 (2.5 g, 7.6 mmol) at RT. The reaction
mixture was degassed with argon for 45 minutes and stirred for 6 h
at 80.degree. C. After the completion of reaction (monitored by
TLC), the volatiles were removed in vacuo, diluted with water and
extracted with DCM (2.times.100 mL). The combined organic layer was
dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo.
The crude residue was washed with diethyl ether to afford 7c (1 g,
73%) as light brown solid. TLC: Ethyl acetate (R.sub.f: 0.3);
.sup.1H NMR (200 MHz, CDCl.sub.3): .delta. 9.32 (d, J=2.6 Hz, 1H),
7.94 (dd, J=2.6, 9.0 Hz, 1H), 7.04 (d, J=9.0 Hz, 1H), 5.33 (bs,
1H), 4.46 (t, J=4.4 Hz, 2H), 4.07 (t, J=4.6 Hz, 2H), 2.95 (s, 2H)
and 1.41 (s, 6H).
Step 7d:
2-(6-amino-2,3-dihydrobenzo[b][1,4]oxazin-4-yl)-6,7-dihydro-6,6-d-
imethylthiazolo[5,4-c]pyridin-4(5H)-one (Intermediate 7d)
[1231] To a stirred solution of 7c (1 g, 2.7 mmol) in EtOAc/MeOH
(1:1, 40 mL) was added Pd/C (100 mg). The reaction mixture was
stirred under hydrogen atmosphere (60 Psi) for 36 h at RT. After
the completion of reaction (monitored by TLC), the reaction mixture
was filtered through a pad of celite and filtrate was concentrated
in vacuo. The crude residue was recrystallised from DCM/hexane to
afford 7d (520 mg, 57%) as off white solid. TLC: 10% MeOH/DCM
(R.sub.f: 0.4); .sup.1H NMR (500 MHz, CDCl.sub.3): .delta. 7.34 (d,
J=3.0 Hz, 1H), 6.76 (d, J=8.5 Hz, 1H), 6.42 (dd, J=2.5, 8.0 Hz,
1H), 5.17 (bs, 2H), 4.25 (t, J=4.0 Hz, 2H), 4.11 (t, J=5.5 Hz, 2H),
3.5 (bs, 2H), 2.87 (s, 2H), 1.39 (s, 6H); Mass: 331 [M.sup.++1];
MP: 244.8.degree. C.
Step 7e:
(R)-N-(4-(6,6-dimethyl-4-oxo-4,5,6,7-tetrahydrothiazolo[5,4-c]pyr-
idin-2-yl)-3,4-dihydro-2H-benzo[b][1,4]oxazin-6-yl)-5-oxotetrahydrofuran-2-
-carboxamide
[1232] The title compound was prepared by coupling intermediate 7d
and (R)-5-oxotetrahydrofuran-2-carboxylic acid using HATU as
described in step 1f, example 1. MS m/z: 443.2 (M+H.sup.+).
##STR00478##
Example 132
[1233]
(S)-N-(4-(6,6-dimethyl-4-oxo-4,5,6,7-tetrahydrothiazolo[5,4-c]pyrid-
in-2-yl)-3,4-dihydro-2H-benzo[b][1,4]oxazin-6-yl)-5-oxotetrahydrofuran-2-c-
arboxamide. The following compound was prepared by starting with
Intermediate 7d and (S)-5-oxotetrahydrofuran-2-carboxylic acid:MS
m/z: 443.2 (M+H.sup.+).
Example 133
##STR00479##
[1235]
(1S,4S)-5-(4-(6,6-dimethyl-4-oxo-4,5,6,7-tetrahydrothiazolo[5,4-c]p-
yridin-2-yl)-3,4-dihydro-2H-benzo[b][1,4]oxazine-6-carbonyl)-2-oxa-5-azabi-
cyclo[2.2.1]heptan-3-one. The title compound was prepared according
to the steps and intermediates as described below.
##STR00480##
Step 8a: methyl
4-(6,6-dimethyl-4-oxo-4,5,6,7-tetrahydrothiazolo[5,4-c]pyridin-2-yl)-3,4--
dihydro-2H-benzo[b][1,4]oxazine-6-carboxylate (Intermediate 8a)
[1236] To a stirred solution of compound 5-I (1 g, 3.8 mmol) in
acetonitrile (40 mL) was added methyl
3,4-dihydro-2H-benzo[b][1,4]oxazine-6-carboxylate (0.73 g, 3.8
mmol), Cs.sub.2CO.sub.3 (2.5 g, 7.6 mmol), Pd(OAc).sub.2 (51 mg,
0.2 mmol) and Xanthophos (176 mg, 0.3 mmol) at room temperature.
The reaction mixture was degassed with argon for 45 minutes and
stirred for 16 h at 80.degree. C. After completion of the reaction
(monitored by TLC), the reaction mixture was filtered through a pad
of celite and washed with DCM (100 mL) and the filtrate was washed
with water (100 mL), dried over anhydrous Na.sub.2SO.sub.4 and
concentrated in vacuo. The crude compound was purified by washings
with diethyl ether to afford compound 8a (880 mg, 62%) as brown
solid. TLC: EtOAc (R.sub.f: 0.3). .sup.1H-NMR (CDCl.sub.3, 200
MHz): .delta. 8.64 (d, J=2.0 Hz, 1H), 7.76 (dd, J=2.0, 8.6 Hz, 1H),
6.99 (d, J=8.8 Hz, 1H), 5.21 (bs, 1H), 4.43-4.38 (m, 2H), 4.20-4.14
(m, 2H), 3.9 (s, 3H), 2.89 (s, 2H), 1.4 (s, 6H). MS: 374
[M.sup.++1].
Step 8b:
4-(6,6-dimethyl-4-oxo-4,5,6,7-tetrahydrothiazolo[5,4-c]pyridin-2--
yl)-3,4-dihydro-2H-benzo[b][1,4]oxazine-6-carboxylic acid
(Intermediate 8b)
[1237] To a stirred solution of compound 8a (0.87 g, 2.3 mmol) in
THF (7 mL) and H.sub.2O (4.6 mL) was added LiOH.H.sub.2O (195 mg,
4.6 mmol) at 0.degree. C. and the reaction mixture was stirred for
16 h at RT. After completion of the reaction (monitored by TLC),
the aqueous layer was extracted with diethyl ether (2.times.30 mL)
and organic layer was separated. The aqueous layer was acidified
with 10% aqueous KHSO.sub.4 (pH.about.2), stirred for 15 minutes
and the obtained solid was filtered and dried to afford
intermediate 8b (520 mg, 62%) as an off white solid. TLC: EtOAc
(R.sub.f: 0.1). .sup.1H-NMR (DMSO-d.sub.6, 500 MHz): .delta. 12.80
(bs, 1H), 8.76 (s, 1H), 7.63 (d, J=9.0 Hz, 1H), 7.55 (s, 1H), 7.04
(d, J=8.5 Hz, 1H), 4.39 (t, J=4.0 Hz, 2H), 4.1 (t, J=5.0 Hz, 2H),
2.82 (s, 2H), 1.28 (s, 6H). MS: 360 [M.sup.++1]. IR: 3402, 3193,
2973, 2529, 1892, 1677, 1646, 1525, 1373, 1251, 1104, 751
cm.sup.-1. MP: 300.5.degree. C.
Step 8c:
(1S,4S)-5-(4-(6,6-dimethyl-4-oxo-4,5,6,7-tetrahydrothiazolo[5,4-c-
]pyridin-2-yl)-3,4-dihydro-2H-benzo[b][1,4]oxazine-6-carbonyl)-2-oxa-5-aza-
bicyclo[2.2.1]heptan-3-one (XXIII-4)
[1238] The title compound was prepared by coupling intermediate 8b
and (1S,4S)-2-oxa-5-azabicyclo[2.2.1]heptan-3-one TFA salt using
HATU as described in step 1f, example 1. MS m/z: 455.1
(M+H.sup.+).
Example 134
##STR00481##
[1240]
(1R,4R)-5-(4-(6,6-dimethyl-4-oxo-4,5,6,7-tetrahydrothiazolo[5,4-c]p-
yridin-2-yl)-3,4-dihydro-2H-benzo[b][1,4]oxazine-6-carbonyl)-2-oxa-5-azabi-
cyclo[2.2.1]heptan-3-one. The following compound was prepared by
starting with intermediate 8b and
(1R,4R)-2-oxa-5-azabicyclo[2.2.1]heptan-3-one TFA salt: MS m/z:
455.1 (M+H.sup.+).
Example 135
##STR00482##
[1242]
6,6-dimethyl-2-(6-(2-oxopyrrolidine-1-carbonyl)-2H-benzo[b][1,4]oxa-
zin-4(3H)-yl)-6,7-dihydrothiazolo[5,4-c]pyridin-4(5H)-one. The
title compounds are prepared by starting with intermediate 8b and
coupling with a suitable amine or amide.
Example 136
##STR00483##
[1244]
6,6-dimethyl-2-(6-(2-oxoazetidine-1-carbonyl)-2H-benzo[b][1,4]oxazi-
n-4(3H)-yl)-6,7-dihydrothiazolo[5,4-c]pyridin-4(5H)-one. The title
compounds are prepared by starting with intermediate 8b and
coupling with a suitable amine or amide.
Example 137
##STR00484##
[1246]
(R)-4-(6,6-dimethyl-4-oxo-4,5,6,7-tetrahydrothiazolo[5,4-c]pyridin--
2-yl)-N-(1-methoxy-2-oxoazetidin-3-yl)-3,4-dihydro-2H-benzo[b][1,4]oxazine-
-6-carboxamide. The title compounds are prepared by starting with
intermediate 8b and coupling with a suitable amine or amide.
Example 138
##STR00485##
[1248]
(S)-4-(6,6-dimethyl-4-oxo-4,5,6,7-tetrahydrothiazolo[5,4-c]pyridin--
2-yl)-N-(1-methoxy-2-oxoazetidin-3-yl)-3,4-dihydro-2H-benzo[b][1,4]oxazine-
-6-carboxamide. The title compounds are prepared by starting with
intermediate 8b and coupling with a suitable amine or amide.
Example 139
##STR00486##
[1250]
6,6-dimethyl-2-(6-(4-oxo-4H-chromen-6-yl)-2H-benzo[b][1,4]oxazin-4(-
3H)-yl)-6,7-dihydrothiazolo[5,4-c]pyridin-4(5H)-one: The title
compound was prepared according to the steps and intermediates as
described below.
##STR00487##
Step 9a:
6,6-dimethyl-2-(6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)--
2H-benzo[b][1,4]oxazin-4(3H)-yl)-6,7-dihydrothiazolo[5,4-c]pyridin-4(5H)-o-
ne (9a)
[1251] To a stirred solution of compound 5-III-1 from example 5
(1.5 g, 3.8 mmol) in dioxane (30 mL) was added KOAc (1.16 g, 4.5
mmol), his (pinacolato) diboran (1.12 g, 11.4 mmol) and
Pd(dppf)Cl.sub.2 (556 mg, 0.7 mmol) at RT. The reaction mixture was
degassed by purging with argon for 30 minutes and stirred at
90.degree. C. for 2 h. After completion of the reaction (monitored
by TLC), the reaction was quenched with H.sub.2O and extracted with
EtOAc (3.times.100 mL). The combined organic layer was dried over
anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The crude
compound was purified by column chromatography (40% EtOAc/Hexane)
to afford compound 9a (900 mg, 53%) as off white solid. TLC: EtOAc
(R.sub.f: 0.5). .sup.1H-NMR (CDCl.sub.3, 200 MHz): .delta. 8.16 (s,
1H), 7.52 (d, J=8.4 Hz, 1H), 6.94 (d, J=8.0 Hz, 1H), 5.19 (bs, NH),
4.40-4.31 (m, 2H), 4.24-4.14 (m, 2H), 2.86 (s, 2H), 1.39 (s, 6H),
1.27 (s, 12H).
[1252] MS: 442 [M.sup.++1]
Step 9b:
6,6-dimethyl-2-(6-(4-oxo-4H-chromen-6-yl)-2H-benzo[b][1,4]oxazin--
4(3H)-yl)-6,7-dihydrothiazolo[5,4-c]pyridin-4(5H)-one
[1253] The title compound was prepared by treating compound 9a with
6-bromo-4H-chromen-4-one under the standard Suzuki coupling
conditions described in step 3c in example 3. MS m/z: 460.1
(M+H.sup.+).
Example 140
##STR00488##
[1255]
(S,Z)-2-(2,6-dichlorophenylamino)-5-(4-(4-(5-oxotetrahydrofuran-2-c-
arbonyl)piperazin-1-yl)quinolin-6-yl)methylene)thiazol-4(5H)-one:
The title compound was prepared according to the steps and
intermediates as described below.
Step 10a: Methyl
4-(4-(tert-butoxycarbonyl)piperazin-1-yl)quinoline-6-carboxylate
[1256] To methyl 4-chloroquinoline-6-carboxylate (synthesized
according to WO 2007099326) (1.5 g, 6.8 mmol) in isopropanol (30
mL) was added n-Boc-piperazine (1.3 g, 7.0 mmol), and the solution
was heated to 90.degree. C. for three days. The reaction was cooled
to ambient temperature, filtered and the solvent removed by rotary
evaporation. The product was purified by silica chromatography
(DCM/EtOAc) to give the title compound (0.51 g, 1.4 mmol). .sup.1H
NMR (d.sub.6DMSO) .delta. ppm: 8.78 (d, J=5.1 Hz, 1H), 8.66 (d,
J=1.9 Hz, 1H), 8.14 (dd, J=8.7, 1.9 Hz, 1H), 8.02 (d, J=8.7 Hz,
1H), 3.91 (s, 3H), 3.64-3.58 (m, 4H), 3.20-3.14 (m, 4H), 1.43 (s,
9H); m/z 372 (M+1).
Step 10b: Tert-butyl
4-(6-(hydroxymethyl)quinolin-4-yl)piperazine-1-carboxylate
[1257] To methyl
4-(4-(tert-butoxycarbonyl)piperazin-1-yl)quinoline-6-carboxylate
(0.51 g, 1.4 mmol) in THF (10 mL) cooled to 0.degree. C. was added
lithium aluminum hydride (0.10 g, 2.7 mmol) and the reaction
stirred for 30 min. The reaction was quenched by addition of excess
water and the product extracted with EtOAc (3.times.30 mL). The
combined organics were dried (MgSO.sub.4), filtered, and the
solvent removed by rotary evaporation to give the title compound as
a yellow oil (0.45 g, 1.3 mmol). .sup.1H NMR (d.sub.6DMSO) .delta.
ppm: 8.64 (d, J=5.0 Hz, 1H), 7.94 (d, J=0.9 Hz, 1H), 7.89 (d, J=8.7
Hz, 1H), 7.62 (dd, J=8.3, 1.9 Hz, 1H), 6.97 (d, J=5.0 Hz, 1H), 5.38
(dd, J=6.0, 5.5 Hz, 1H), 4.67 (d, J=6.0 Hz, 1H), 3.63-3.57 (m, 4H),
3.14-3.08 (m, 4H), 1.43 (s, 9H). m/z 344 (M+1).
Step 10c: Tert-butyl
4-(6-formylquinolin-4-yl)piperazine-1-carboxylate
[1258] To tert-butyl
4-(6-(hydroxymethyl)quinolin-4-yl)piperazine-1-carboxylate (0.45 g,
1.3 mmol) in DCM (10 mL) was added Dess-Martin periodinane (0.62 g,
1.5 mmol). The solution was stirred at ambient temperature
overnight. The solution was filtered and the volatiles removed by
rotary evaporation. The product was purified by silica
chromatography (DCM/EtOAc) to provide the title compound as a
yellow foam (0.31 g, 0.91 mmol). .sup.1H NMR (d.sub.6DMSO) .delta.
ppm: 10.20 (s, 1H), 8.80 (d, J=5.0 Hz, 1H), 8.62 (dd, J=1.4, 0.9
Hz, 1H), 8.06 (s, 1H), 8.05 (s, 1H), 7.10 (d, J=5.0 Hz, 1H),
3.67-3.62 (m, 4H), 3.24-3.21 (m, 4H), 1.44 (s, 9H). m/z 342
(M+1).
Step 10d: (Z)-tert-butyl
4-(6-((2-(2,6-dichlorophenylamino)-4-oxothiazol-5(4H)-ylidene)methyl)quin-
olin-4-yl)piperazine-1-carboxylate
[1259] Tert-butyl 4-(6-formylquinolin-4-yl)piperazine-1-carboxylate
(0.17 g, 0.50 mmol), 2-(2,6-dichlorophenylamino)thiazol-4(5H)-one
(see WO 2006132739) (0.13 g, 0.50 mmol), and piperidine (0.040 g,
0.50 mmol) were combined in a microwave vial and ethanol (2 mL)
added. The solution was heated at 150.degree. C. for 30 min in the
microwave. The volatiles were removed on a rotary evaporator and
the residue purified by silica chromatography (EtOAc/MeOH).
Step 10e:
(S,Z)-2-(2,6-dichlorophenylamino)-5-(4-(4-(5-oxotetrahydrofuran--
2-carbonyl)piperazin-1-yl)quinolin-6-yl)methylene)thiazol-4(5H)-one
[1260] The purified material from above was dissolved in MeOH and
treated with 4 N HCl in dioxane. After stirring for 1 h, the
volatiles were removed by rotary evaporation. The residue was taken
up in EtOAc and washed with saturated NaHCO.sub.3 solution. The
solution was dried (MgSO4), filtered and the solvent removed by
rotary evaporation. The residue was coupled with
(S)-5-oxotetrahydrofuran-2-carboxylic acid with HATU following the
procedure described in step 1f in Example 96. MS m/z: 597.2
(M+H.sup.+).
Example 141
##STR00489##
[1262]
(R,Z)-2-(2,6-dichlorophenylamino)-5-((4-(4-(5-oxotetrahydrofuran-2--
carbonyl)piperazin-1-yl)quinolin-6-yl)methylene)thiazol-4(5H)-one.
In similar fashion, the following compound was prepared when using
(R)-5-oxotetrahydrofuran-2-carboxylic acid in step 10e: MS m/z:
597.2 (M+H.sup.+).
Example 142
##STR00490##
[1264]
(S,Z)-5-((4-(4-(5-oxotetrahydrofuran-2-carbonyl)piperazin-1-yl)quin-
olin-6-yl)methylene)thiazolidine-2,4-dione. In similar fashion,
when using thiazolidine-2,4-dione to couple with tert-butyl
4-(6-formylquinolin-4-yl)piperazine-1-carboxylate in step 10d,
followed by step 10e, the title compound can be prepared.
Example 143
##STR00491##
[1266]
(R,Z)-5-((4-(4-(5-oxotetrahydrofuran-2-carbonyl)piperazin-1-yl)quin-
olin-6-yl)methylene)thiazolidine-2,4-dione. In similar fashion,
when using thiazolidine-2,4-dione to couple with tert-butyl
4-(6-formylquinolin-4-yl)piperazine-1-carboxylate in step 10d,
followed by step 10e, but using acrylic acid instead, the title
compound can be prepared.
Example 144
##STR00492##
[1267]
(Z)-5-((4-(4-acryloylpiperazin-1-yl)quinolin-6-yl)methylene)thiazol-
idine-2,4-dione
Example 145
##STR00493##
[1269]
N-(3-(4-morpholinothieno[3,2-d]pyrimidin-2-yl)phenyl)acrylamide.
The title compound was prepared according to the steps and
intermediates as described below.
##STR00494##
Step 11a: tert-butyl
3-(4-morpholinothieno[3,2-d]pyrimidin-2-yl)phenylcarbamate
(Intermediate 11a)
##STR00495##
[1271] Intermediate 11a was prepared by coupling Intermediate 1a
and tert-butyl
3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenylcarbamate
following the standard Suzuki coupling conditions described in step
3c, Example 3. MS m/z: 413.3 (M+1).
Step 11b:
N-(3-(4-morpholinothieno[3,2-d]pyrimidin-2-yl)phenyl)acrylamide
[1272] The title compound was prepared by following the procedures
described in Example 96, step 1e and 1f. MS m/z: 367.2
(M+H.sup.+).
Example 146
##STR00496##
[1274]
(1S,4S)-5-(3-hydroxy-5-(4-morpholinothieno[3,2-d]pyrimidin-2-yl)ben-
zyl)-2-oxa-5-azabicyclo[2.2.1]heptan-3-one: The title compound was
prepared according to the steps and intermediates as described
below.
##STR00497##
Step 12a:
3-(4-morpholinothieno[3,2-d]pyrimidin-2-yl)-5-propoxybenzaldehy- de
(Intermediate 12a)
##STR00498##
[1276] Intermediate 12a was prepared by coupling Intermediate 1a
and 3-formyl-5-propoxyphenylboronic acid following the standard
Suzuki coupling conditions described in step 3c, Example 3. MS m/z:
384.1 (M+1).
Step 12b:
3-hydroxy-5-(4-morpholinothieno[3,2-d]pyrimidin-2-yl)benzaldehyd- e
(Intermediate 12b)
##STR00499##
[1278] The title compound was prepared by treating intermediate 12a
with 2 equivalents BBr3 in dichloromethane at -78.degree. C. to RT
for 1 hour. MS m/z: 342.1 (M+H.sup.+).
Step 12c:
(1S,4S)-5-(3-hydroxy-5-(4-morpholinothieno[3,2-d]pyrimidin-2-yl)-
benzyl)-2-oxa-5-azabicyclo[2.2.1]heptan-3-one
[1279] The title compound was prepared by treating intermediate 12b
with (1S,4S)-2-oxa-5-azabicyclo[2.2.1]heptan-3-one TFA salt (2
equivalents), NaBH3CN (4 equivalent) in acetonitrile/acetic acid
(3:1). MS m/z: 439.2 (M+H.sup.+).
Example 147
##STR00500##
[1281]
(1R,4R)-5-(3-hydroxy-5-(4-morpholinothieno[3,2-d]pyrimidin-2-yl)ben-
zyl)-2-oxa-5-azabicyclo[2.2.1]heptan-3-one. In similar fashion,
when using (1R,4R)-2-oxa-5-azabicyclo[2.2.1]heptan-3-one TFA salt,
the following compound can be prepared:
Example 148
##STR00501##
[1283]
(1S,4S)-5-(3-hydroxy-5-(4-morpholinothieno[3,2-d]pyrimidin-2-yl)ben-
zoyl)-2-oxa-5-azabicyclo[2.2.1]heptan-3-one. The title compound can
be prepared from compound 12b by a two-step sequence: 1) oxidation
to the carboxylic acid by a suitable oxidant, 2) coupling of the
resulting acid with an appropriate amine.
Example 149
##STR00502##
[1285]
(1R,4R)-5-(3-hydroxy-5-(4-morpholinothieno[3,2-d]pyrimidin-2-yl)ben-
zoyl)-2-oxa-5-azabicyclo[2.2.1]heptan-3-one. The title compound can
be prepared from compound 12b by a two-step sequence: 1) oxidation
to the carboxylic acid by a suitable oxidant, 2) coupling of the
resulting acid with an appropriate amine.
Example 150
##STR00503##
[1287]
2-(1H-indazol-4-yl)-N-(1-methoxy-2-oxoazetidin-3-yl)-4-morpholinoth-
ieno[3,2-d]pyrimidine-6-carboxamide. Using the intermediates
described in the above examples and the chemistry outlined in the
procedures, the title compound can be prepared accordingly.
Example 151
[1288]
2,4-difluoro-N-(2-methoxy-5-(4-(4-((1S,4S)-3-oxo-2-oxa-5-azabicyclo-
[2.2.1]heptane-5-carbonyl)phenyl)quinolin-6-yl)pyridin-3-yl)benzenesulfona-
mide (XXV-13). The title compound was prepared through the
following intermediate as described below.
##STR00504##
[1289]
4-(6-(5-(2,4-difluorophenylsulfonamido)-6-methoxypyridin-3-yl)quino-
lin-4-yl)benzoic acid: The title acid was prepared by following the
similar chemistry as published in patents WO2008144463 and
WO20081444464.
##STR00505##
[1290]
2,4-difluoro-N-(2-methoxy-5-(4-(4-((1S,4S)-3-oxo-2-oxa-5-azabicyclo-
[2.2.1]heptane-5-carbonyl)phenyl)quinolin-6-yl)pyridin-3-yl)benzenesulfona-
mide (XXV-13). The title compound was prepared through standard
HATU coupling of the benzoic acid above and
(1S,4S)-2-oxa-5-azabicyclo[2.2.1]heptan-3-one.
[1291] .sup.1H-NMR (CDCl.sub.3, 500 MHz): .delta. 8.99 (d, J=4.0
Hz, 1H), 8.27 (d, J=8.5 Hz, 1H), 8.15 (s, 1H), 7.98-7.88 (m, 5H),
7.78-7.75 (m, 1H), 7.66 (d, J=7.5 Hz, 1H), 7.39 (d, J=3.5 Hz, 1H),
7.29-7.25 (m, 1H), 6.91 (d, J=5.5 Hz, 2H), 5.26 (bs, 1H), 4.95-4.91
(m, 1H), 3.96-3.93 (m, 4H), 2.36 (d, J=10 Hz, 1H), 2.17 (d, J=10.5
Hz, 1H), 2.05-2.03 (m, 1H).
[1292] MS: m/z=643.1 [M+H]
Example 152
##STR00506##
[1294]
2,4-difluoro-N-(2-methoxy-5-(4-(4-((1R,4R)-3-oxo-2-oxa-5-azabicyclo-
[2.2.1]heptane-5-carbonyl)phenyl)quinolin-6-yl)pyridin-3-yl)benzenesulfona-
mide (XXV-15): The title compound was prepared in the same way as
for XXV-13 using enantiomeric amine in the final coupling step.
[1295] .sup.1H-NMR (CDCl.sub.3, 500 MHz): .delta. 8.99 (d, J=4.0
Hz, 1H), 8.27 (d, J=8.5 Hz, 1H), 8.15 (s, 1H), 7.98-7.88 (m, 5H),
7.78-7.75 (m, 1H), 7.66 (d, J=7.5 Hz, 1H), 7.39 (d, J=3.5 Hz, 1H),
7.29-7.25 (m, 1H), 6.91 (d, J=5.5 Hz, 2H), 5.26 (bs, 1H), 4.95-4.91
(m, 1H), 3.96-3.93 (m, 4H), 2.36 (d, J=10 Hz, 1H), 2.17 (d, J=10.5
Hz, 1H), 2.05-2.03 (m, 1H).
[1296] MS: m/z 643.1 [M+H].
Example 153
[1297]
N-(4-(6-(5-(2,4-difluorophenylsulfonamido)-6-methoxypyridin-3-yl)qu-
inolin-4-yl)phenyl)acrylamide (XXV-14). The title compound was
prepared through the following intermediate as described below.
##STR00507##
[1298]
N-(5-(4-(4-aminophenyl)quinolin-6-yl)-2-methoxypyridin-3-yl)-2,4-di-
fluorobenzene-sulfonamide: The title acid was prepared by following
the similar chemistry as published in patents WO2008144463 and
WO20081444464.
##STR00508##
[1299]
N-(4-(6-(5-(2,4-difluorophenylsulfonamido)-6-methoxypyridin-3-yl)qu-
inolin-4-yl)phenyl)acrylamide. The title compound was prepared
through the standard HATU coupling of the aniline above and acrylic
acid.
[1300] .sup.1H-NMR (CDCl.sub.3+CD.sub.3OD, 500 MHz): .delta. 8.88
(d, J=5.0 Hz, 1H), 8.22 (d, J=9.0 Hz, 1H), 8.11 (d, J=2.0 Hz, 1H),
8.02 (s, 1H), 7.97 (d, J=2.0 Hz, 1H), 7.91-7.88 (m, 3H), 7.78-7.73
(m, 1H), 7.54 (d, J=8.5 Hz, 2H), 7.42 (d, J=4.5 Hz, 1H), 6.95-6.84
(m, 2H), 6.48-6.40 (m, 2H), 5.79 (d, J=9.5 Hz, 1H), 3.93 (s,
3H).
[1301] LCMS: 595 [M+Na], 573 [M+H]
Example 154
##STR00509##
[1303]
(1R,4R)-5-(3-(2-((9H-purin-6-ylthio)methyl)-5-chloro-4-oxoquinazoli-
n-3(4H)-yl)-4-methoxybenzoyl)-2-oxa-5-azabicyclo[2.2.1]heptan-3-one
(XXXVII-5): The title compound was prepared according to the steps
and intermediates as described below.
##STR00510##
Step 8b: Ethyl
3-(5-chloro-2-(chloromethyl)-4-oxoquinazolin-3(4H)-yl)-4-methoxybenzoate
##STR00511##
[1305] To a mixture of 2-chloro-6-(2-chloroacetamido)benzoic acid
(5.7 g, 22.97 mmol), ethyl 3-amino-4-methoxybenzoate (4.0 g, 20.67
mmol) in THF (24 mL) at 0.degree. C., was added PCl.sub.3 (4.7 mL,
34.45 mmol). The reaction mixture was then refluxed at 65.degree.
C. for 1-2 h. After completion of reaction, reaction mixture was
poured into water and extracted with EtOAc. Organic layer was
washed with dilute HCl (2.times.25 mL) and saturated NaHCO.sub.3
(2.times.25 mL), brine solution and dried over anhydrous
Na.sub.2SO.sub.4. After filtration and concentration, the crude
product was purified by column chromatography using 17% EtOAc in
Hexane, giving compound 8b as a white solid (5.4 g, 65% yield).
[1306] .sup.1H NMR: (DMSO, 400 MHz): .delta. 1.280 (t, 3H), 3.831
(s, 3H), 4.254 (m, 4H), 7.359-8.145 (m, 6H).
[1307] Mass: 407.0 (M+1)
Step 8c: ethyl
3-(2-((9H-purin-6-ylthio)methyl)-5-chloro-4-oxoquinazolin-3(4H)-yl)-4-met-
hoxybenzoate
##STR00512##
[1309] To a solution of 6-mercaptopurine (0.459 g, 2.70 mmol) in
DMF (10 mL), was added anhydrous K.sub.2CO.sub.3 (0.397 g. 2.94
mmol). After stirring for 15-20 min, compound 8b (1.0 g, 2.45 mmol)
was added and the reaction was continued under for 1-1.5 hr. The
reaction mixture was then poured in water (150 mL), and the
precipitated was filtered out, giving white solid (1.1 g, 86%
yield).
[1310] .sup.1H NMR: (DMSO, 400 MHz): .delta. 1.233 (t, 3H), 3.801
(s, 3H), 4.182 (m, 2H), 4.227 (q, 2H), 7.143-8.392 (m, 8H).
[1311] Mass: 523.0 (M.sup.++1).
Step 8d:
3-(2-((9H-purin-6-ylthio)methyl)-5-chloro-4-oxoquinazolin-3(4H)-y-
l)-4-methoxybenzoic acid
##STR00513##
[1313] Compound 8c (1.4 g, 2.67 mmol) and NaOH (0.214 g, 5.35 mmol)
was stirred in a mixed solvent of in ethanol (5 mL) and water (15
mL). Reaction was monitored by TLC/mass periodically, and stopped
at .about.50% conversion. Reaction mixture was worked up by
removing ethanol-water then, water (15 mL) was added and then HCl
was added at 0-5.degree. C. up to acidic pH. The white solid was
filtered out, giving 560 mg of desired acid (41% yield).
[1314] Mass: 495.0 (M+1).
Step 8e:
(1R,4R)-5-(3-(2-((9H-purin-6-ylthio)methyl)-5-chloro-4-oxoquinazo-
lin-3(4H)-yl)-4-methoxybenzoyl)-2-oxa-5-azabicyclo[2.2.1]heptan-3-one
##STR00514##
[1316] To a mixture of Compound 8d (0.4 g, 0.81 mmol),
(1R,4R)-2-oxa-5-azabicyclo[2.2.1]heptan-3-one (0.179 g, 1.21 mmol),
DIPEA (0.628 g, 4.86 mmol) in 5 mL of acetonitrile was HATU (0.456
g, 1.21 mmol). After 10 min, the reaction mixture was concentrated,
and purified by prep-HPLC.
[1317] .sup.1H NMR: (DMSO, 400 MHz): .delta. 2.143 (t, 2H), 2.287
(t, 2H), 3.769 (s, 3H), 4.482 (dd, 2H), 5.303 (s, 1H), 7.137-8.480
(m, 8H), 13.508 (s, 1H).
[1318] Mass: 590.1 (M+1).
Example 155
##STR00515##
[1320]
(1S,4S)-5-(3-(2-((9H-purin-6-ylthio)methyl)-5-chloro-4-oxoquinazoli-
n-3(4H)-yl)-4-methoxybenzoyl)-2-oxa-5-azabicyclo[2.2.1]heptan-3-one
(XXXVII-1). The title compound was made in the same way as for
using enantiomeric amine in the final step.
[1321] .sup.1H NMR: (DMSO, 400 MHz): .delta. 2.143 (t, 2H), 2.287
(t, 2H), 3.769 (s, 3H), 4.482 (dd, 2H), 5.303 (s, 1H), 7.137-8.480
(m, 8H), 13.508 (s, 1H).
[1322] Mass: 590.1 (M+1).
Example 156
##STR00516##
[1324]
(S)-N-(3-(2-((9H-purin-6-ylthio)methyl)-5-chloro-4-oxoquinazolin-3(-
4H)-yl)-4-methoxyphenyl)-5-oxotetrahydrofuran-2-carboxamide
(XXXVII-3). The title compound was made through the intermediates
as described below.
##STR00517##
[1325]
5-chloro-2-(chloromethyl)-3-(2-methoxy-5-nitrophenyl)quinazolin-4(3-
H)-one: The title intermediate was made in a similar way as
describe in step 8b using 2-methoxy-5-nitroaniline as aniline
counterpart.
[1326] .sup.1H NMR: (DMSO, 400 MHz): .delta. 3.336 (s, 3H), 4.366
(dd, 2H), 7.460-8.575 (m, 6H).
[1327] Mass: 380 (M.sup.+).
##STR00518##
[1328]
2-((9H-purin-6-ylthio)methyl)-5-chloro-3-(2-methoxy-5-nitrophenyl)q-
uinazolin-4(3H)-one: The title intermediate was made in the same
way as describe in step 8c. Mass: 496 (M+1), 498 (M+2).
##STR00519##
[1329]
2-((9H-purin-6-ylthio)methyl)-3-(5-amino-2-methoxyphenyl)-5-chloroq-
uinazolin-4(3H)-one: The nitro group was reduced by Fe powder in
the presence of catalytic amount of HCl, giving the desired aniline
as brownish solid.
[1330] .sup.1H NMR: (DMSO, 400 MHz): .delta. 3.596 (s, 3H), 4.420
(dd, 2H), 4.892 (s, 2H), 6.624-8.552 (m, 8H).
[1331] Mass: 466 (M+1).
Example 157
##STR00520##
[1333]
(S)-N-(3-(2-((9H-purin-6-ylthio)methyl)-5-chloro-4-oxoquinazolin-3(-
4H)-yl)-4-methoxyphenyl)-5-oxotetrahydrofuran-2-carboxamide
(XXXVII-3). The title compound was made through standard HATU
coupling of the aniline above with (R)-5-oxo-2-tetrahydrofuran
carboxylic acid.
[1334] .sup.1H NMR: (DMSO, 400 MHz): .delta. 2.309 (m, 2H), 2.474
(m, 2H), 3.582 (s, 3H), 4.430 (dd, 2H), 4.976 (t, 1H), 7.059-8.425
(m, 8H), 10.100 (s, 1H).
[1335] Mass: 578.1 (M+1).
Example 158
##STR00521##
[1337]
(R)-N-(3-(2-((9H-purin-6-ylthio)methyl)-5-chloro-4-oxoquinazolin-3(-
4H)-yl)-4-methoxyphenyl)-5-oxotetrahydrofuran-2-carboxamide
(XXXVII-2). The title compound was made in the same way as for
XXXVII-3 using (S)-5-Oxo-2-tetrahydrofuran carboxylic acid in the
final step.
[1338] .sup.1H NMR: (DMSO, 400 MHz): .delta. 2.309 (m, 2H), 2.474
(m, 2H), 3.582 (s, 3H), 4.430 (dd, 2H), 4.976 (t, 1H), 7.059-8.425
(m, 8H), 10.100 (s, 1H).
[1339] Mass: 578.1 (M+1).
Example 159
##STR00522##
[1341]
(1S,4S)-N-(3-(2-((9H-purin-6-ylthio)methyl)-5-chloro-4-oxoquinazoli-
n-3(4H)-yl)-4-methoxyphenyl)-3-oxo-2-oxa-5-azabicyclo[2.2.1]heptane-5-carb-
oxamide (XXXVII-4). The title compound was made using the aniline
as for XXXVII-3, triphosgene,
(1S,4S)-2-oxa-5-azabicyclo[2.2.1]heptan-3-one in the presence of
triethylamine.
[1342] .sup.1H NMR: (DMSO, 400 MHz): .delta. 2.044 (t, 2H), 2.219
(t, 2H), 3.678 (s, 3H), 4.492 (dd, 2H), 4.784 (s, 1H), 4.875 (s,
1H), 7.003-8.746 (m, 8H).
[1343] Mass: 605.1 (M+1).
Example 160
[1344]
N-(7-methoxy-8-(4-oxo-4-((1R,4R)-3-oxo-2-oxa-5-azabicyclo[2.2.1]hep-
tan-5-yl)butoxy)-2,3-dihydroimidazo[1,2-c]quinazolin-5-yl)nicotinamide
(XXVII-13). The title compound was prepared through the following
intermediate as described below.
##STR00523##
[1345]
4-(7-methoxy-5-(nicotinamido)-2,3-dihydroimidazo[1,2-c]quinazolin-8-
-yloxy)butanoic acid. The title acid was prepared by following the
similar chemistry as published in patents WO2009091550.
##STR00524##
[1346]
N-(7-methoxy-8-(4-oxo-4-((1R,4R)-3-oxo-2-oxa-5-azabicyclo[2.2.1]hep-
tan-5-yl)butoxy)-2,3-dihydroimidazo[1,2-c]quinazolin-5-yl)nicotinamide
(XXVII-13). The title compound was prepared by standard HATU
coupling of the carboxylic acid above and
(1R,4R)-2-oxa-5-azabicyclo[2.2.1]heptan-3-one.
[1347] .sup.1H-NMR (CDCl.sub.3, 500 MHz): .delta. 12.82 (bs, 1H),
9.47 (s, 1H), 8.70 (d, J=4.0 Hz, 1H), 8.46 (d, J=7.5 Hz, 1H), 7.70
(d, J=6.0 Hz, 1H), 7.35-7.31 (m, 1H), 6.81 (d, J=9.5 Hz, 1H),
5.11-5.15 (m, 1H), 4.20-4.17 (m, 5H), 4.04 (s, 3H), 3.70-3.50 (m,
4H), 2.65-2.60 (m, 2H), 2.50-2.45 (m, 2H), 2.22-2.20 (m, 2H).
[1348] MS: m/z 519.1 (M.sup.++1)
Example 161
##STR00525##
[1350]
N-(7-methoxy-8-(4-oxo-4-((1S,4S)-3-oxo-2-oxa-5-azabicyclo[2.2.1]hep-
tan-5-yl)butoxy)-2,3-dihydroimidazo[1,2-c]
quinazolin-5-yl)nicotinamide (XXVII-14). The title compound was
prepared in the same way as for XXVII-13 using
(1R,4R)-2-oxa-5-azabicyclo[2.2.1]heptan-3-one in the final coupling
step.
[1351] .sup.1H-NMR (CDCl.sub.3, 500 MHz): .delta. 12.82 (bs, 1H),
9.47 (s, 1H), 8.70 (d, J=4.0 Hz, 1H), 8.46 (d, J=7.5 Hz, 1H), 7.70
(d, J=6.0 Hz, 1H), 7.35-7.31 (m, 1H), 6.81 (d, J=9.5 Hz, 1H),
5.11-5.15 (m, 1H), 4.20-4.17 (m, 5H), 4.04 (s, 3H), 3.70-3.50 (m,
4H), 2.65-2.60 (m, 2H), 2.50-2.45 (m, 2H), 2.22-2.20 (m, 2H).
[1352] MS: m/z 519.1 (M+H)
E. PI3K Biological Data
[1353] Compounds of the present invention are assayed as inhibitors
of PI3 kinases using the following general protocol.
Example 162
HTRF Assay Protocol for Potency Assessment Against the Active Form
of p110.alpha./p85.alpha.
[1354] The protocol below describes an end-point,
competition-binding HTRF assay used to measure inherent potency of
test compounds against active p110.alpha./p85.alpha.
p110.beta./p85.alpha., p120.gamma. enzymes. The mechanics of the
assay platform are best described by the vendor (Millipore,
Billerica, Mass.) on their website at the following URL:
http://www.millipore.com/coa/tech1/74jt4z.
[1355] Briefly, Stop solution (Stop A, #33-007 and Stop B, #33-009;
3:1 ratio) and Detection Mix (DMC, #33-015 with DMA, #33-011 and
DMB, #33-013; 18:1:1 ratio) were prepared as recommended by the
manufacturer .about.2 hrs prior to use. Additionally, 1.times.
reaction buffer (4.times. buffer stock #33-003), a 1.4.times. stock
of enzyme from BPS Bioscience (San Diego, Calif.) or Millipore
(Billerica, Mass.) with di-C8-PIP2 lipid substrate (#33-005), and a
4.times.ATP solution (#A7699) Sigma/Aldrich (St. Louis, Mo.) were
prepared in 1.times. reaction buffer. 15 .mu.L of enzyme and lipid
substrate mix were pre-incubated in a Corning (#3573) 384-well,
black, non-treated microtiter plate (Corning, N.Y.) for 30 min at
25.degree. C. with a 0.5 .mu.L volume of 50% DMSO and serially
diluted compounds prepared in 50%-75% DMSO. Lipid kinase reactions
were started with the addition of 5 .mu.L of ATP solution, mixed
for 15 sec on a rotary plate shaker and incubated for 15-30 minutes
at 25.degree. C. Next, reactions were stopped with a 5 .mu.L
addition of Stop solution followed by a 5 .mu.L volume of Detection
Mix. Stopped reactions were equilibrated for 1 and 18 hrs at room
temperature and then read in a Synergy4 plate reader from BioTek
(Winooski, Vt.) at .lamda.ex330-80/.lamda.em620-35 and
.lamda.em665-7.5. At the conclusion of each assay, the HTRF ratio
from fluorescence emission values for each well was calculated and
% Inhibition determined from averaged controls wells. % Inhibition
values for each compound are then plotted against inhibitor
concentration to estimate IC50 from log[Inhibitor] vs Response,
Variable Slope model in GraphPad Prism from GraphPad Software (San
Diego, Calif.).
[1356] Reagents used in optimized protocol: [1357]
[p110.alpha./p85.alpha.]=500-750 pM, [ATP]=50 .mu.M,
[di-C8-PIP2]=10 .mu.M [1358] (40620; BPS Bioscience or 14-602;
Millipore)
[1359] Reference Inhibitor IC.sub.50s: [1360] LY294002=1.3 .mu.M
(published IC50's=0.7-3 .mu.M)
[1361] Wortmannin=2.9 nM (published IC50's=1-5 nM)
[1362] Reagents used in optimized protocol: [1363]
[p110.beta./p85.alpha.]=750 pM-1.25 nM, [ATP]=50 .mu.M,
[di-C8-PIP2]=10 .mu.M [1364] (14-603; Millipore)
[1365] Reference Inhibitor IC50s: [1366] PIK75=249 nM (published
IC50's=343 nM)
[1367] AZ-REF=21 nM
[1368] Reagents used in optimized protocol: [1369]
[p120.gamma.]=1-4 nM, [ATP]=50 .mu.M, [di-C8-PIP2]=10 .mu.M [1370]
(40625; BPS Bioscience)
[1371] Reference Inhibitor IC50s: [1372] PIK75=55 nM [1373]
AZ-REF=14 nM
[1374] [ATP] and [PIP.sub.2] were kept static at or below
K.sub.Mapp for each.
[1375] Table 4 shows the activity of selected compounds of this
invention in the PI3Ka-HTRF-IC50 nM, PI3KBg-HTRF-IC50 nM, and
HCT116-WB Assays. Compounds having an activity designated as "A"
provide an IC50.ltoreq.10 nM; compounds having an activity
designated as "B" provide an IC50>10 nM and .ltoreq.100 nM;
compounds having an activity designated as "C" provide an
IC50>100 nM and .ltoreq.1000 nM; compounds having an activity
designated as "D" provide an IC50>1000 nM and <10,000 nM; and
compounds having an activity designated as "E" provide an
IC50.ltoreq.10,000 nM.
TABLE-US-00006 TABLE 4 Compound Inhibition Designation Enzyme/Assay
Designation XXII-1 PI3K.alpha. B PI3K.gamma. C XXII-2 PI3K.alpha. B
PI3K.gamma. C HCT116-WB C XXIV-1 PI3K.alpha. B PI3K.gamma. C XXIV-2
PI3K.alpha. C PI3K.gamma. C XXIII-1 PI3K.alpha. C PI3K.gamma. C
XXIII-2 PI3K.alpha. C PI3K.gamma. C XXII-3 PI3K.alpha. B
PI3K.gamma. C HCT116-WB C XXIII-3 PI3K.alpha. C PI3K.gamma. C
XXIII-4 PI3K.alpha. C PI3K.gamma. C XXIII-5 PI3K.alpha. C
PI3K.gamma. C XXII-4 PI3K.alpha. B PI3K.gamma. C XXII-5 PI3K.alpha.
B PI3K.gamma. C XXIII-6 PI3K.alpha. C PI3K.gamma. C XXII-6
PI3K.alpha. B PI3K.gamma. C HCT116-WB B XXII-7 PI3K.alpha. C
PI3K.gamma. C HCT116-WB B XXIII-7 PI3K.alpha. D PI3K.gamma. D
XXII-8 PI3K.alpha. C PI3K.gamma. C XXII-9 PI3K.alpha. C PI3K.gamma.
C XXII-10 PI3K.alpha. B PI3K.gamma. C HCT116-WB C XXII-11
PI3K.alpha. B PI3K.gamma. C HCT116-WB B XXIII-8 PI3K.alpha. C
PI3K.gamma. C HCT116-WB D XXII-12 PI3K.alpha. B PI3K.gamma. C
XXII-13 PI3K.alpha. C PI3K.gamma. C XXII-14 PI3K.alpha. B XXII-15
PI3K.alpha. B PI3K.gamma. C XXII-16 PI3K.alpha. B XXII-17
PI3K.alpha. B XXII-18 PI3K.alpha. D XXII-19 PI3K.alpha. D XXII-20
PI3K.alpha. C PI3K.gamma. D XXII-21 PI3K.alpha. D PI3K.gamma. D
XXII-22 PI3K.beta. C PI3K.gamma. C XXII-23 PI3K.beta. D PI3K.gamma.
C XXII-24 PI3K.beta. C PI3K.gamma. XXII-25 PI3K.beta. C PI3K.gamma.
B XXII-26 PI3K.beta. C PI3K.gamma. C XXII-27 PI3K.beta. C
PI3K.gamma. C XXII-28 PI3K.beta. C PI3K.gamma. C XXII-29 PI3K.beta.
C PI3K.gamma. C XXII-30 PI3K.beta. C PI3K.gamma. B XXII-31
PI3K.beta. C PI3K.gamma. C XXII-32 PI3K.beta. C PI3K.gamma. C
XXII-33 PI3K.beta. C PI3K.gamma. C XXXVII-1 PI3K.beta. C XXXVII-2
PI3K.beta. C XXXVII-3 PI3K.beta. C XXXVII-4 PI3K.beta. C XXV-13
PI3K.beta. A XXV-14 PI3K.beta. A XXV-15 PI3K.beta. A XXVII-13
PI3K.beta. C XXVII-14 PI3K.beta. C
I. Mass Spectrometric Analysis of PI3K Contacted with Compounds of
the Invention
Example 163
[1376] Intact PI3K.beta. was incubated for 3 hr at a 10.times. fold
access of compound to protein. 5 .mu.L aliquots of the samples were
diluted with 15 .mu.L of 0.1% TFA prior to micro C4 ZipTipping
directly onto the MALDI target using Sinapinic acid as the
desorption matrix (10 mg/mL in 0.1% TFA:Acetonitrile 50:50). Spots
were then analyzed via MALDI-MS. XXII-10 modified PI3K.beta. 100%
by 3 h. XXII-8, XXII-6, XXIII-4, and XXIII-3 each provided between
about 35% to about 55% modification.
Example 164
[1377] Intact PI3K.gamma.was incubated for 1 hr at a 10-fold excess
of compound XXII-33 to protein at 37.degree. C. 5 .mu.L aliquots of
the samples were diluted with 10 .mu.L of 0.1% TFA prior to micro
C4 Ziptipping directly onto the MALDI target plate using sinapinic
acid as the desorption matrix (10 mg/mL in 0.1% TFA:Acetonitrile
50:50). The top panel of FIG. 22 shows the mass spectral trace of
the intact PI3K.gamma. protein (m/z=131,963 Da). The bottom panel
of FIG. 22 shows the mass spectral trace when PI3K.gamma.was
incubated with compound XXII-33 (mw=550.64). The centroid mass
(m/z=132,455 Da) shows a mass shift of 492 Da (90%), indicating
complete modification of PI3K.gamma. by compound XXII-33.
J. PDPK-1 Inhibitors Synthetic Examples
Example 165
Synthetic Scheme for Intermediate A
##STR00526## ##STR00527##
[1378] Step-1: Compound 1
##STR00528##
[1380] To a stirred solution of propane-1,3-diamine (10 g, 134.9
mmol) in chloroform (250 ml) at 0.degree. C. was added
boc-anhydride (6.2 ml, 26.9 mmol) in chloroform (250 ml) dropwise
and the reaction mixture was stirred at room temperature overnight.
(5 parallel reactions were carried out). Then the reaction mixtures
were mixed together, concentrated to .about.50% of its total volume
and filtered. The filtrate was washed with brine, dried over sodium
sulphate and concentrated. The residue was taken in petroleum ether
and the undissolved portion was removed by filtration. The filtrate
was concentrated to obtain compound 1 (19 g, 80.8%) as colorless
liquid.
Step-2: Compound 2
##STR00529##
[1382] To a stirred solution of 1 (19 g, 109 mmol) in acetonitrile
(120 mL) at 0.degree. C. was added triethylamine (23 ml, 165 mmol)
followed by 5-bromo-2,4-dichloropyrimidine (35 g, 153.5 mmol).
Stirring continued at room temperature for 16 h. The reaction
mixture was concentrated completely and the residue obtained was
diluted with ethyl acetate, washed with water and brine solution,
dried over anhydrous Na.sub.2SO.sub.4, filtered and concentrated.
The crude was then purified using column chromatography (SiO.sub.2,
petroleum ether:ethyl acetate, 9:1) to obtain compound 2 as pale
brown solid (26.5 g, 66.5%).
Step-3: Compound 3
##STR00530##
[1384] A cooled solution of HCl in dioxane (4M, 150 mL) was added
to compound 2 (30 g, 82 mmol) and then stirred at room temperature
for 5 h. The solid obtained was collected by filtration, washed
with petroleum ether and dried (25 g, quantitative).
Step-4: Compound 4
##STR00531##
[1386] To a stirred solution of
3-ethoxy-2,2-dimethyl-3-oxopropanoic acid (10 g, 62.4 mmol) in
dichloromethane (100 ml) at 0.degree. C. was added oxalyl chloride
(6.4 g, 75.6 mmol) followed by two drops DMF. The reaction mixture
was stirred at room temperature for 2 h and then concentrated under
vacuum to obtain brown oil. This was then added dropwise into a
solution of 3 (15.5 g, 51.3 mmol) and DIPEA (36 ml, 206.7 mmol) in
acetonitrile (100 ml) at 0.degree. C. and stirred at room
temperature for 16 h. The reaction mixture was completely
concentrated under vacuum to obtain a residue. One more similar
batch of reaction was carried out in parallel and both the residues
were taken together in ethyl acetate. The ethyl acetate layer was
washed with 1.5 N HCl, 10% NaHCO.sub.3 solution and brine, dried
over anhydrous Na.sub.2SO.sub.4, filtered and concentrated. The
crude was purified using column chromatography (SiO.sub.2, 15-20%
ethyl acetate in petroleum ether) to yield compound 4 as white
solid (25 g, 59.7%).
Step-5: Compound 5
##STR00532##
[1388] To a stirred solution of 4 (10 g, 24.5 mmol) in ethanol (200
mL) were added 3-nitroaniline (4.4 g, 31.85 mmol) and conc. HCl
(0.2 ml). The reaction mixture then stirred at 60.degree. C. in a
sealed tube for 16 h during which time pale yellow solid separated
out. The solid obtained (compound 5) was collected by filtration,
washed with petroleum ether and dried (11.7 g, 93.6%).
Step-6: Compound 6
##STR00533##
[1390] To a stirred solution of 5 (11.7 g, 23 mmol) in ethyl
acetate (120 mL) was added stannous chloride (26 g, 115 mmol) in
portions. Then the reaction mixture was refluxed for 3 h. It was
cooled to r.t., diluted with ethyl acetate and washed with sodium
bicarbonate solution. Filtered to remove the insolubles; the
filtrate was washed with brine, dried over anhydrous
Na.sub.2SO.sub.4 and concentrated to obtain compound 6 as pale
brown viscous oil (9.98 g, 90.6%).
Step-7: Intermediate A
##STR00534##
[1392] To a solution of 6 (9.98 g, 20.8 mmol) in dry methanol (50
mL) at 0.degree. C. was added saturated methanolic ammonia (50 mL)
in a sealed tube. Then the reaction mixture was heated at
80.degree. C. for 4 days. The reaction mixture was concentrated and
the crude product obtained was purified by column chromatography
(SiO.sub.2, 4% methanol in chloroform) to obtain Intermediate A as
white solid (6.2 g, 66%). MS m/z: 450.1, 452.0 (M+H.sup.+).
Preparation of Intermediate B
##STR00535##
[1394] Intermediate B was prepared similarly following the
synthetic procedures described for Intermediate A, except using
4-nitroaniline in step 5. MS m/z: 450.1, 452.0 (M+H.sup.+).
[1395] In similar fashion, Intermediate C and Intermediate D were
prepared:
##STR00536##
Example 166
##STR00537##
[1397] To a solution of intermediate A (0.5 g, 1.11 mmol),
(S)-5-oxotetrahydrofuran-2-carboxylic acid (0.29 g, 2.23 mmol) and
DIPEA (0.3 ml, 1.72 mmol) in dichloromethane (2.5 ml) at 0.degree.
C. was added T3P (2-Propanephosphonic acid anhydride, 50% solution
in ethyl acetate, 1.8 ml, 2.83 mmol) and the reaction mixture was
stirred at room temperature for 16 h. The reaction mixture was
directly adsorbed on basic alumina and subjected to column
chromatography (eluted with dichloromethane). The residue obtained
after evaporating the column fractions was treated with sodium
bicarbonate solution and extracted with dichloromethane. The
organic layer was dried over sodium sulphate and concentrated to
obtain pale yellow solid. The product was further washed with
diethyl ether and dried under vacuum to obtain the title compound
as pale yellow solid (0.13 g, 20.8%).
[1398] .sup.1H NMR (DMSO-d.sub.6): .delta.=1.28 (s, 6H), 1.65 (m,
2H), 2.22 (m, 1H), 2.54 (m, 3H), 3.11 (m, 2H), 3.41 (m, 2H), 5.06
(m, 1H), 7.08-7.21 (m, 5H), 7.45 (m, 1H), 7.64 (t, J=6 Hz, 1H),
7.99 (s, 1H), 8.03 (s, 1H), 9.34 (s, 1H), 10.18 (s, 1H); LCMS: m/e:
562.0, 564.0 (M+1).
Example 167
##STR00538##
[1399] Step-1: tert-butyl
2-(3-(4-(3-(3-amino-2,2-dimethyl-3-oxopropanamido)propylamino)-5-bromopyr-
imidin-2-ylamino)phenylamino)-2-oxoethylcarbamate
##STR00539##
[1401] Intermediate A (102 mg, 0.23 mmoL), Boc-glycine (44 mg, 0.25
mmoL) was dissolved in DMF (1 mL). Hydroxybenzotriazole (38 mg,
0.25 mmoL) was added followed by
N-ethyl-N.sup.1-(3-dimethylaminopropyl)carbodiimide hydrochloride
salt (48 mg, 0.25 mmoL) and N-methyl morpholine (75 uL, 0.68 mmoL).
Stir at room temperature for 1 h, partition with saturated Sodium
bicarbonate solution (2 mL) and ethyl acetate (5 mL). The layers
were separated and the organic layer was dried over sodium sulfate;
filtration and the solvent was removed via rotary evaporation gave
a yellow oil 164 mg. LC/MS: RT=2.27 min, m/e 607.0/609.2 (M+1).
Step-2:
N1-(3-(2-(3-(2-aminoacetamido)phenylamino)-5-bromopyrimidin-4-ylam-
ino)propyl)-2,2-dimethylmalonamide (HCl salt)
##STR00540##
[1403] To a solution of tert-butyl
2-(3-(4-(3-(3-amino-2,2-dimethyl-3-oxopropanamido)propylamino)-5-bromopyr-
imidin-2-ylamino)phenylamino)-2-oxoethylcarbamate (164 mg, 0.27
mmol) in DCM (5 mL) was added HCl (4N in dioxane 1 mL). Stir
overnight at rt; remove solvent via rotary evaporation to give a
white solid 170 mg. LC/MS: RT=2.13 min, m/e: 507.1/509.1 (M+1).
Step-3: XI-26
##STR00541##
[1405]
N1-(3-(2-(3-(2-aminoacetamido)phenylamino)-5-bromopyrimidin-4-ylami-
no)propyl)-2,2-dimethylmalonamide (HCl salt from step 2) (31 mg,
0.06 mmol) was charged in DMF (500 uL). To this was added
5-oxotetrahydrothiophene-3-carboxylic acid (8 mg, 0.06 mmoL), DIPEA
(40 uL, 0.23 mmoL), and HATU (22 mg, 0.06 mmoL) and stirred for 30
min at room temperature. The mixture was purified directly using
prep HPLC to give a white solid 9 mg as the TFA salt LC/MS: RT=2.02
m/e 635.1/637.0 (M+1).
Example 168
##STR00542##
[1407] To a solution of intermediate D (125 mg, 0.25 mmol), HATU
(0.50 mmol) and DIPEA (excess) in DMF was added
(1S,4S)-2-oxa-5-azabicyclo[2.2.1]heptan-3-one (TFA salt, 0.50 mmol)
at room temperature for 16 h. After work-up, the crude product was
obtained as a gummy material (125 mg, LCMS purity .about.58%). The
title compound was obtained after purification over preparative
HPLC (20 mg). LCMS: m/e: 599.6, 601.6 (M-1).
[1408] In similar fashion, the compounds in the following table
were made according to the procedures described above and from an
appropriate intermediate A, B, C, or D.
TABLE-US-00007 TABLE 5 Compound From Structures MS (M + 1)
Intermediate XI-21 578.1/580.0 A XI-22 635.1/637.0 A XI-23
578.1/580.0 A XI-24 635.1/637.0 A XI-25 626.1/628.0 A XI-26
635.1/637.0 A XI-27 578.1/580.0 A XI-28 617.1/619.0 A XI-29
588.2/590.1 A XI-30 602.1/604.0 A XI-31 561.0/563.1 A XI-32
691.0/693.2 A XI-33 660.2/662.1 A XI-34 649.0/651.0 A XI-35
624.1/626.1 B XI-36 623.6/625.6 (M - 1) A XI-37 -- A XI-38
619.2/621.2 A XI-39 504.1/506.1 B XI-40 602.1/604.1 D XI-41
599.6/601.6 (M - 1) D XI-42 562.1/564.1 B XI-43 562.1/564.1 B XI-44
602.1/604.1 C XI-45 602.1/604.1 C XI-46 532.0/534.0 A XI-47
648.1/650.0 A XI-48 645.0/647.0 A XI-49 645.0/647.0 A XI-50
562.0/564.0 A XI-51 547.0/549.0 A XI-52 562.0, 564.0 A XI-53
504.2/506.2 A XI-55 603.2/605.2 A XI-56 1202.4/1204.3 A XI-57
716.1/718.0 A XI-58 627.2/629.1 A XI-59 590.0/592.2 A
Example 169
##STR00543##
[1409] Example 170
Synthetic Scheme for Intermediate E
##STR00544##
[1410] Step-1: Preparation of Ethyl 4-tert-butoxy-3-oxobutanoate
(E-1)
##STR00545##
[1412] To a suspension of NaH (39 g, 1.61 mmol) in DMF (200 mL) was
added Ethyl 4-chloro-3-oxobutanoate (50 g, 0.303 mmol) slowly drop
wise at 0.degree. C., followed by t-BuOH (58 mL, 0.607 mmol) and
stirred for 14 h at ambient temperature. After completion of the
reaction, reaction mixture was acidified up to pH=4 to 5 and
diluted with ethyl acetate, washed with water and brine solution,
dried over Na.sub.2SO.sub.4 and evaporated. The crude compound was
purified by column chromatography [silica gel (60-120 mesh), 7%
ethyl acetate in hexane] to afford compound E-1 as a yellow oily
liquid (27 g, 45.7%). TLC System: 5% Ethyl acetate in hexane,
(R.sub.f): 0.4. .sup.1H NMR (CDCl.sub.3): .quadrature.=1.20 (s,
9H), 1.29 (t, 3H), 3.55 (s, 2H), 4.01 (s, 2H), 4.20 (q, 2H).
Step-2: Preparation of Ethyl 2-acetyl-4-tert-butoxy-3-oxobutanoate
(E-2)
##STR00546##
[1414] To a solution of Ethyl 4-tert-butoxy-3-oxobutanoate (75 g,
0.37 mmol) in DCM (300 mL) was added pyridine (292 mL, 4.455 mmol)
followed by acetyl chloride (30 mL, 0.44 mmol) and MgCl.sub.2 (17.5
g, 0.185 mmol) at 0.degree. C. and stirred for 16 h at room
temperature. The reaction mixture was poured into ethyl acetate,
washed with water, dilute HCl and brine solution to afford compound
E-2 (40 g, 44%) as a pale yellow liquid. (R.sub.f):0.5, TLC System:
10% Ethyl acetate in hexane.
Step-3: Preparation of Ethyl
3-(tert-butoxymethyl)-5-methyl-1H-pyrazole-4-carboxylate (E-3)
##STR00547##
[1416] To a solution of Ethyl-2-acetyl-4-tert-butoxy-3-oxobutanoate
(26 g, 0.106 mmol) in glacial acetic acid (100 mL) was added
hydrazine hydrate (6.1 g, 0.12 mmol) drop wise at 5-10.degree. C.
and stirred for 30 min. After completion of the reaction, reaction
mixture was neutralized with saturated NaHCO.sub.3, extracted with
ethyl acetate and washed with NaHCO.sub.3, brine solution, dried
over Na.sub.2SO.sub.4 and evaporated. The crude compound was
purified by column chromatography (Silica gel (60-120), 27% ethyl
acetate in hexane) to afford compound E-3 (8 g, 32%) as a pale
yellow solid. (R.sub.f): 0.2, TLC System: 10% Ethyl acetate in
hexane. .sup.1H NMR (CDCl.sub.3): .quadrature.=1.28 (s, 9H), 1.35
(t, 3H), 2.50 (s, 3H), 4.30 (q, 2H), 4.78 (s, 2H), 7.60 (br,
1H).
Step-4: Preparation of
3-(Tert-butoxymethyl)-5-methyl-1H-pyrazole-4-carboxylic acid
(E-4)
##STR00548##
[1418] To a solution of Ethyl
3-(tert-butoxymethyl)-5-methyl-1H-pyrazole-4-carboxylate (19 g,
0.07 mmol) in ethanol (130 mL) was added 10% NaOH (31 g, 0.79 mmol)
solution and reflux for 16 h at 82.degree. C. After completion of
the reaction, reaction mixture was acidified, adjusted to pH<1
and filtered the solid to afford compound E-4 (14 g, 87%) as a
colorless solid. (R.sub.f): 0.5, TLC System: 10% Methanol in
chloroform. .sup.1H NMR (DMSO-d.sub.6): .quadrature.=1.20 (s, 9H),
2.31 (s, 3H), 4.54 (s, 2H), 12.6 (br, 2H).
Step-5: Preparation of Benzyl
3-(hydroxymethyl)-5-methyl-1H-pyrazole-4-carboxylate (E-5)
##STR00549##
[1420] To a 3-(Tert-butoxymethyl)-5-methyl-1H-pyrazole-4-carboxylic
acid (5 g, 0.0235 mmol) in methanol (30 mL) was added
Cs.sub.2CO.sub.3 (7.66 g, 0.23 mmol) and stirred for 1 h at ambient
temperature, then methanol was removed completely and to this DMF
(25 mL) was added followed by benzyl bromide (4.03 g, 0.023 mmol)
under N.sub.2 atmosphere and stirred for 4 h at room temperature.
After completion of the reaction, reaction mixture was diluted with
ethyl acetate, washed with water, 1N HCl, NaHCO.sub.3 and brine
solution, dried over Na.sub.2SO.sub.4 and evaporated under reduced
pressure. The crude compound was purified by column chromatography
(silica gel (60-120), 3% Methanol in chloroform). The obtained
crude compound was treated with TFA at ambient temperature for 24
h. Then the reaction mixture was concentrated and triturated with
pentane to afford compound E-5 (1.8 g, 37%) as a colorless solid.
(R.sub.f): 0.6, TLC System: 10% Methanol in chloroform.
Step-6: Preparation of Benzyl
3-formyl-5-methyl-1H-pyrazole-4-carboxylate (E-6)
##STR00550##
[1422] To a stirred solution of Benzyl
3-(hydroxymethyl)-5-methyl-1H-pyrazole-4-carboxylate (8.5 g, 0.034
mmol) in Dimethoxy ethane (200 mL) was added MnO.sub.2(29.7 g) and
heated to 80.degree. C. for 2 h. After completion of the reaction,
reaction mixture was filtered through celite bed and concentrated.
The obtained crude compound was triturated with pentane to afford
compound E-6 (7 g, 83%) as a gray solid. (R.sub.f): 0.6, TLC
System: 40% ethyl acetate in hexane.
Step-7: Preparation of Ethyl
2-(4-(benzyloxycarbonyl)-5-methyl-1H-pyrazol-3-yl)-1H-benzo[d]imidazole-5-
-carboxylate (E-7)
##STR00551##
[1424] To a stirred solution of Ethyl 3,4-diaminobenzoate (3.8 g,
0.022 mmol) In Acetonitrile (100 mL) was added NaHSO.sub.4 (3.61 g,
0.43 mmol) and heated to reflux, then Benzyl
3-formyl-5-methyl-1H-pyrazole-4-carboxylate (7 g, 0.0286 mmol) was
added slowly and maintained the same temperature for 3 h. After
completion of the reaction, reaction mixture was concentrated and
diluted with ethyl acetate, washed with water, dried over
Na.sub.2SO.sub.4 and concentrated. The obtained crude compound was
triturated with diethyl ether to afford compound E-7 (5.5 g, 43.5%)
as a white solid. (R.sub.f): 0.7, TLC System: 10% Ethyl acetate in
hexane. LCMS: m/e: 405.0 (M+1).
Step-8: Preparation of
3-(5-(Ethoxycarbonyl)-1H-benzo[d]imidazol-2-yl)-5-methyl-1H-pyrazole-4-ca-
rboxylic acid (E-8)
##STR00552##
[1426] To a solution of Ethyl
2-(4-(benzyloxycarbonyl)-5-methyl-1H-pyrazol-3-yl)-1H-benzo[d]imidazole-5-
-carboxylate (5.5 g, 13.6 mmol) in THF:MeOH (1:1, 100 mL) was added
10% Pd/C (1 g) and stirred for 16 h at 100 psi pressure of hydrogen
at rt. After completion of the reaction, reaction mixture was
filtered through celite bed and concentrated. The obtained crude
compound was purified by triturating with diethyl ether to afford
compound E-8 (3 g, 71%) as a brownish solid. (R.sub.f): 0.1, TLC
System: 10% Methanol in chloroform. LCMS: m/e: 315.0 (M+1).
Step-9: Preparation of Ethyl
2-(4-(1-(tert-butoxycarbonyl)piperidin-4-ylcarbamoyl)-5-methyl-1H-pyrazol-
-3-yl)-1H-benzo[d]imidazole-5-carboxylate (E-9)
##STR00553##
[1428] To a solution of
3-(5-(Ethoxycarbonyl)-1H-benzo[d]imidazol-2-yl)-5-methyl-1H-pyrazole-4-ca-
rboxylicacid (500 mg, 0.00159 mol) in DMF (2 mL) was added
tert-butyl 4-aminopiperidine-1-carboxylate (637 mg, 0.00318 mol)
followed by EDC.HCl (606 mg, 0.00318 mol), HOBT (434 mg, 0.00138
mol), DIPEA (404 g, 0.00318 mol) and stirred for 2 h at room
temperature. After completion of the reaction, reaction mixture was
poured into water and stirred for 1 hour, the solid precipitated
was filtered off and dried over Na.sub.2SO.sub.4. The obtained
crude compound was purified by column chromatography(silica
gel(60-120 mesh), 3% methanol in chloroform) to afford compound E-9
(600 mg, 76%) as white solid. (R.sub.f): 0.4, TLC System: 10%
Methanol in chloroform. LCMS: m/e: 497.1 (M+1).
Step-10: Preparation of
2-(4-(1-(tert-butoxycarbonyl)piperidin-4-ylcarbamoyl)-5-methyl-1H-pyrazol-
-3-yl)-1H-benzo[d]imidazole-5-carboxylic acid (E-10)
##STR00554##
[1430] To a solution of Ethyl
2-(4-(1-(tert-butoxycarbonyl)piperidin-4-ylcarbamoyl)-5-methyl-1H-pyrazol-
-3-yl)-1H-benzo[d]imidazole-5-carboxylate (600 mg, 1.909 mmol) in
THF (15 mL) was added NaOH (484 mg, 12.9 mmol) and heated reflux
for 16 h. After completion of the reaction, reaction mixture was
concentrated and diluted with water and acidified with dil HCl to
pH=4-5, the solid precipitated was filtered off and dried under
vacuum to afford compound E-10 (480 mg, 42.5%) as a white solid.
(R.sub.f): 0.2, TLC System: 10% Methanol in chloroform with
NH.sub.3. LCMS: m/e: 469.1 (M+1).
Step-11: Preparation of Tert-butyl
4-(5-methyl-3-(5-methyl-1H-benzo[d]imidazol-2-yl)-1H-pyrazole-4-carboxami-
do)piperidine-1-carboxylate (E)
##STR00555##
[1432] To a solution of
2-(4-(1-(tert-butoxycarbonyl)piperidin-4-ylcarbamoyl)-5-methyl-1H-pyrazol-
-3-yl)-1H-benzo[d]imidazole-5-carboxylic acid (450 mg, 0.9615 mol)
in toluene (8 mL) was added DPPA (0.318 g, 1.44 mmol) followed by
DIPEA (183 mg, 1.44 mmol) and stirred for 2 h at ambient
temperature, then benzyl alcohol was added and heated to reflux for
16 h. After completion of the reaction, reaction mixture was
concentrated. The obtained crude compound was purified by column
chromatography (silica gel (60-120 mesh), 3% methanol in chloroform
with NH.sub.3) to afford the cbz-protected compound E (270 mg, 49%)
as an off white solid. (R.sub.f): 0.4, TLC System: 10% Methanol in
chloroform with NH.sub.3. LCMS: m/e: 574.1 (M+1).
[1433] The above compound was added to a mixture of THF:MeOH (1:1,
20 mL) followed by 10% Pd/C (27 mg) and stirred for 16 h at 100PSI
pressure of hydrogen. After completion of the reaction, reaction
mixture was filtered through celite bed and concentrated. The
obtained crude compound was triturated with diethyl ether to afford
compound E (130 mg, 63%) as a black solid. (R.sub.f): 0.1, TLC
System: 10% Methanol in chloroform with NH.sub.3. LCMS: m/e: 440.1
(M+1).
Example 171
##STR00556##
[1434] Step-12: Preparation of (S)-tert-butyl
2-(5-oxotetrahydrofuran-2-carboxamido)acetate (E-12)
##STR00557##
[1436] To a solution of (S)-5-Oxotetrahydrofuran-2-carboxylic acid
(300 mg, 00230 mol) in DMF (4 ml) was added HATU (2.622 g, 0.0069
mol), DIPEA (584 mg, 0.0046 mol), followed by Glycine tert butyl
ester (578 mg, 0.0034 mol) and stirred for 20 min at ambient
temperature. After completion of the reaction, reaction mixture was
poured into water, extracted with ethyl acetate, dried and
concentrated to afford compound E-12 (120 mg, 21%) as a pale yellow
liquid. (R.sub.f): 0.8, System: 10% acetone in chloroform. LCMS:
m/e: 242.1 (M-1).
Step-13: Preparation of
(S)-2-(5-oxotetrahydrofuran-2-carboxamido)acetic acid (E-13)
##STR00558##
[1438] To a solution of (S)-Tert-butyl
2-(5-oxotetrahydrofuran-2-carboxamido)acetate (120 mg, 0.493 mmol)
was treated with TFA (7 eq) in DCM (5 ml) for 3 h at ambient
temperature. After completion of the reaction, DCM was evaporated
along with excess of TFA. The obtained crude compound was purified
by triturating with diethyl ether to afford compound E-13 (107 mg,
90%) as a pale yellow liquid. (R.sub.f): 0.1, TLC System: 10%
acetone in chloroform. LCMS: m/e: 186.1 (M-1).
Step-14: Preparation of
(S)-5-methyl-3-(5-(2-(5-oxotetrahydrofuran-2-carboxamido)acetamido)-1H-be-
nzo[d]imidazol-2-yl)-N-(piperidin-4-yl)-1H-pyrazole-4-carboxamide
(XXXVI-1)
##STR00559##
[1440] To a solution of
(S)-2-(5-oxotetrahydrofuran-2-carboxamido)acetic acid (30 mg, 0.16
mmol) in DMF (2 ml) was added tert-butyl
4-(3-(5-amino-1H-benzo[d]imidazol-2-yl)-5-methyl-1H-pyrazole-4-carboxamid-
o)piperidine-1-carboxylate (70 mg, 0.11 mmol) followed by EDC.HCl
(44 mg, 0.23 mmol), HOBt (31 mg, 0.23 mmol) and DIPEA (30 mg, 0.23
mmol), then stirred for 3 h at ambient temperature. After
completion of the reaction, reaction mixture was poured into water;
solid precipitated was filtered off and dried under vacuum. The
crude compound was purified by preparative HPLC to afford the
Boc-title compound as a solid. The solid was treated with trifluoro
acetic acid in DCM at RT for 2 h to remove the Boc group. The
reaction solution was concentrated and the residue was triturated
with diethyl ether to afford the title compound as a solid (40 mg,
HPLC purity: 93%). LCMS: m/e: 509.0 (M+1).
Example 172
[1441] In similar fashion, starting from intermediate E, the
following compound was prepared:
##STR00560##
[1442]
(R)-5-methyl-3-(5-(2-(5-oxotetrahydrofuran-2-carboxamido)acetamido)-
-1H-benzo[d]imidazol-2-yl)-N-(piperidin-4-yl)-1H-pyrazole-4-carboxamide:
5.0 mg, HPLC purity: 95%. LCMS: m/e: 509.1 (M+1).
C. PDPK-1 Biological Data
Example 173
[1443] Briefly, a 10.times. stock of PDPK1 enzyme from Invitrogen
(P3001) or BPS (40080) or SignalChem (P14-10H), 1.13.times.ATP
(AS001A) and ST28-Sox peptide substrate (KNZ1281C) were prepared in
1.times. kinase reaction buffer consisting of 20 mM Tris, pH 7.5, 5
mM MgCl.sub.2, 1 mM EGTA, 5 mM .beta.-glycerophosphate, 5% glycerol
(10.times. stock, KB002A) and 0.2 mM DTT (DS001A). 5 .mu.L of
enzyme were pre-incubated in a Corning (#3574) 384-well, white,
non-binding surface microtiter plate (Corning, N.Y.) for 30 min at
25.degree. C. with a 0.5 .mu.L volume of 50% DMSO and serially
diluted compounds prepared in 50% DMSO. Kinase reactions were
started with the addition of 45 .lamda.L of the ST28-Sox peptide
substrate and monitored every 71 seconds for 30-60 minutes at
.lamda.ex360/.lamda.em485 in a Synergy4 plate reader from BioTek
(Winooski, Vt.). At the conclusion of each assay, progress curves
from each well were examined for linear reaction kinetics and fit
statistics (R.sup.2, 95% confidence interval, absolute sum of
squares). Post-lag velocity (+10 minutes to 20+minutes) from each
reaction was estimated from the slope of a plot of relative
fluorescence units vs time (minutes) and normalized to the no
enzyme and no inhibitor control groups for % Inhibition. The
resulting inhibition values were then plotted against inhibitor
concentration to estimate IC50 from log[Inhibitor] vs Response,
Variable Slope model in GraphPad Prism from GraphPad Software (San
Diego, Calif.).
[Reagent] used in provisional protocol(s): Invitrogen--[PDPK1]=5-10
nM, [ATP]=5 .mu.M and [ST28-Sox]=5 .mu.M or 10 .mu.M (ATP KMapp=4-6
.mu.M); BPS--[PDPK1]=10-15 nM, [ATP]=5 .mu.M and [ST28-Sox]=10
.mu.M (ATP KMapp=3-5 .mu.M); SignalChem--[PDPK1]=5-10 nM, [ATP]=5
.mu.M and [ST28-Sox]=5 .mu.M or 10 .mu.M (ATP KMapp ND)
[1444] Table 6 shows the activity of selected compounds in the
PDK1-OMNIA Assays. Compounds having an activity designated as "A"
provide an IC50.ltoreq.10 nM; compounds having an activity
designated as "B" provide an IC50>10 nM and .ltoreq.100 nM;
compounds having an activity designated as "C" provide an
IC50>100 nM and .ltoreq.1000 nM; compounds having an activity
designated as "D" provide an IC50>1000 nM and .ltoreq.10,000 nM;
and compounds having an activity designated as "E" provide an
IC50.ltoreq.10,000 nM.
TABLE-US-00008 TABLE 6 Compound Inhibition Designation Enzyme/Assay
Designation XI-21 PDK1-OMNIA A XI-22 PDK1-OMNIA A XI-23 PDK1-OMNIA
B XI-24 PDK1-OMNIA B XXXVI-1 PDK1-OMNIA XXXVI-2 PDK1-OMNIA XI-25
PDK1-OMNIA A XI-26 PDK1-OMNIA B XI-27 PDK1-OMNIA A XI-28 PDK1-OMNIA
XI-29 PDK1-OMNIA B XI-30 PDK1-OMNIA B XI-31 PDK1-OMNIA B XI-32
PDK1-OMNIA C XI-33 PDK1-OMNIA B XI-56 PDK1-OMNIA C XI Non covalent
PDK1-OMNIA B XI-34 PDK1-OMNIA B XI-35 PDK1-OMNIA XI-36 PDK1-OMNIA B
XI-37 PDK1-OMNIA B XI-38 PDK1-OMNIA B XI-39 PDK1-OMNIA B XI-40
PDK1-OMNIA A XI-41 PDK1-OMNIA A XI-42 PDK1-OMNIA B XI-43 PDK1-OMNIA
C XI-44 PDK1-OMNIA B XI-45 PDK1-OMNIA B XI-46 PDK1-OMNIA B XI-47
PDK1-OMNIA A XI-48 PDK1-OMNIA A XI-49 PDK1-OMNIA A XI-50 PDK1-OMNIA
B XI-51 PDK1-OMNIA XI-52 PDK1-OMNIA B XI-53 PDK1-OMNIA XI-55
PDK1-OMNIA A
K. Mass Spectrometric Analysis of PDPK-1 Contacted with Compounds
of the Invention
Example 174
[1445] Intact PDPK1 was incubated for 3 hr at a 10-fold excess of
compound XI-27 to protein. 3 .mu.L aliquots of the samples were
diluted with 10 .mu.L of 0.1% TFA prior to micro C4 Ziptipping
directly onto the MALDI target plate using sinapinic acid as the
desorption matrix (10 mg/mL in 0.1% TFA:Acetonitrile 50:50). The
top panel of FIG. 12 shows mass spectrometric trace of the intact
PDPK-1 protein (m/z 59,255 Da). The bottom panel of FIG. 12 shows
mass spectrometric trace of PDPK-1 incubated with XI-27 (mw=578.5)
for 3 hr (m/z of 59,823), which shows a mass shift of 568 Da, with
no m/z of 59255 Da, which indicates complete modification of PDPK1
by XI-27 within 3 h.
[1446] Compound XI-27 modifies the peptide
.sup.164NGELLKYIR.sup.172 (SEQ ID NO.:1) on PDPK1, as confirmed by
peptide MS analysis after trypsin digestion in solution. Intact
PDPK1 (Millipore, 14-452) was incubated for 3 hr at a 10-fold
excess of compound D to protein. Following the reaction,
approximately 5 .mu.gs of protein was subjected to a standard
trypsin solution digestion by reducing the protein with DTT,
alkylating thiols with iodoacetamide, adding trypsin (1:20,
protease: protein), and incubation at 37.degree. C. for 1.5 hr.
After digestion, the peptides were purified using C18 ziptips,
spotted on the MALDI target plate with alpha cyano
4-hydroxycinnamic acid as the desorption matrix (10 mg/mL in 0.1%
TFA:acetonitrile 50:50), and analyzed in reflectron mode. The top
panel of FIG. 13 shows the trypsin digest profile for the control
PDPK1 digest. Panel B shows the trypsin digest profile for PDPK1
treated with compound XI-27 prior to digestion. The arrows in FIG.
13 are pointing to a peak at 1,741 Da that corresponds to the mass
of 164NGELLKYIR.sup.172 (SEQ ID NO.:1) (1,106Da), compound XI-27
(mw 578.50), and an iodoacetamide (+57) that alkylates the compound
at the thiol. The peptide was selected for MSMS analysis to confirm
the exact amino acid being modified.
[1447] Compound XI-27 modifies K169 on PDPK1, as confirmed by MSMS
analysis. The peptide of interest, 1,741 Da, was selected for MSMS
analysis from the compound XI-27 treated PDPK1 trypsin digest. FIG.
14 shows the MSMS spectrum of the peptide 164NGELLKYIR172 (SEQ ID
NO.:1) modified by compound XI-27. The alignment of b and y ions
confirms that K169 is the amino acid modified by compound
XI-27.
Example 175
[1448] Intact PDPK1 was incubated for 3 hr at a 10-fold excess of
compound XI-21 to protein. 3 .mu.L aliquots of the samples were
diluted with 10 .mu.L of 0.1% TFA prior to micro C4 Ziptipping
directly onto the MALDI target plate using sinapinic acid as the
desorption matrix (10 mg/mL in 0.1% TFA:Acetonitrile 50:50). The
top panel of FIG. 15 shows the mass spec trace of the intact PDPK1
protein (m/z 59,275 Da). The bottom panel FIG. 15 shows the mass
spec trace when PDPK1 was incubated with compound XI-21
(mw=578.50). The centroid mass (m/z=60,284 Da) shows a mass shift
of 1,009 Da (175%), indicating complete multiple modification of
PDPK1 by compound XI-21.
[1449] Compound XI-21 modifies three peptides,
.sup.164NGELLKYIR.sup.172 (SEQ ID NO.:1),
.sup.173KIGSFDETC(IAA)TR.sup.183 (SEQ ID NO.:182),
.sup.84FGKILGEGSFSTVVLAR.sup.100 (SEQ ID NO.:3) on PDPK1, as
confirmed by peptide MS analysis after trypsin digestion in
solution. Intact PDPK1 (Millipore, 14-452) was incubated for 3 hr
at a 10-fold excess of compound XI-21 to protein. Following the
reaction, approximately 5 .mu.gs of protein was subjected to a
standard trypsin solution digestion by reducing the protein with
DTT, alkylating thiols with iodoacetamide, adding trypsin (1:20,
protease: protein), and incubation at 37.degree. C. for 1.5 hr.
After digestion, the peptides were purified using C18 ziptips,
spotted on the MALDI target plate with alpha cyano
4-hydroxycinnamic acid as the desorption matrix (10 mg/mL in 0.1%
TFA:acetonitrile 50:50), and analyzed in reflectron mode. The top
panel of FIG. 16 shows the trypsin digest profile for the control
PDPK1 digest. The bottom panel of FIG. 16 shows the trypsin digest
profile for PDPK1 treated with compound XI-21 prior to digestion.
The arrows in the top panel of FIG. 16 are pointing to a peak at
1,740 Da that corresponds to the mass of
.sup.164NGELLKYIR.sup.172 (SEQ ID NO.:1) (1,106Da) and compound
XI-21 (mw 578.50), a peak at 1,950 Da that corresponds to the mass
of .sup.173KIGSFDETC(IAA)TR.sup.183 (SEQ ID NO.:182) (1,313Da) and
compound XI-21 with 2 iodoacetamides, and a peak at 2,417 Da
corresponding to the mass of .sup.84FGKILGEGSFSTVVLAR.sup.100 (SEQ
ID NO.:3) (1,780 Da) with compound XI-21 and iodacetamide. All
three peptides were selected for MSMS analysis to confirm the exact
amino acid being modified.
[1450] Compound XI-21 modifies K169 on PDPK1, as confirmed by MSMS
analysis. The peptide of interest, 1,740 Da, was selected for MSMS
analysis from the compound XI-21 treated PDPK1 trypsin digest. FIG.
17 shows the MSMS spectrum of the peptide .sup.164NGELLKYIR.sup.172
(SEQ ID NO.:1) modified by compound XI-21. The alignment of b and y
ions confirms that K169 is the amino acid modified by compound
XI-21.
[1451] Compound XI-21 modifies K173 on PDPK1, as confirmed by MSMS
analysis. The peptide of interest, 1,950 Da, was selected for MSMS
analysis from the compound B treated PDPK1 trypsin digest. FIG. 18
shows the MSMS spectrum of the peptide .sup.173KIGSFDETCTR.sup.183
(SEQ ID NO.:2) modified by compound XI-21. The alignment of b and y
ions confirms that K173 is the amino acid modified by compound
XI-21.
[1452] Compound XI-21 modifies K86 on PDPK1, as confirmed by MSMS
analysis. The peptide of interest, 2,417 Da, was selected for MSMS
analysis from the compound B treated PDPK1 trypsin digest. FIG. 19
shows the MSMS spectrum of the peptide
.sup.84FGKILGEGSFSTVVLAR.sup.100 (SEQ ID NO.:3) modified by
compound XI-21. The alignment of b and y ions confirms that K86 is
the amino acid modified by compound XI-21.
[1453] Other examples of PDPK1 inhibitors disclosed herein
demonstrate covalent modification of PDPK1 similar to the mass
shift and digestion results described above. For example, Table 7
lists non-limiting examples of compounds that modify PDPK1 whole
protein, the number of modifications per protein and the lysines
modified within the protein. Compounds XI-27, XI-26, XI-22, and
XI-21 each have a thiolactone warhead, yet demonstrate different
modification profiles on the protein. Also, the lysine modified in
PDPK-1 by XI-27, XI-26, XI-22, and XI-21 are not the same for each
compound. Without wishing to be bound to any particular theory, the
position of the warhead, as presented by the scaffold and tether to
the lysines in the binding site, effects different results on the
modification of the different lysines in the binding site of
PDPK-1.
TABLE-US-00009 TABLE 7 Number of Modifications on Whole Lys Lys Lys
Compound Structure Protein 86 169 173 XI-49 ##STR00561## 1 X XI-53
##STR00562## 1 X X XI-39 ##STR00563## 1 X X XI-27 ##STR00564## 1 X
XI-26 ##STR00565## 1 X X XI-22 ##STR00566## 2 X X X XI-21
##STR00567## 2 X X X
EQUIVALENTS
[1454] Those skilled in the art will recognize, or be able to
ascertain, using no more than routine experimentation, numerous
equivalents to the specific embodiments described specifically
herein. Such equivalents are intended to be encompassed in the
scope of the following claims.
Sequence CWU 1
1
18219PRTHomo sapiens 1Asn Gly Glu Leu Leu Lys Tyr Ile Arg1
5211PRTHomo sapiens 2Lys Ile Gly Ser Phe Asp Glu Thr Cys Thr Arg1 5
10317PRTHomo sapiens 3Phe Gly Lys Ile Leu Gly Glu Gly Ser Phe Ser
Thr Val Val Leu Ala1 5 10 15Arg47PRTHomo sapiens 4Leu Gly Glu Lys
Val Ser Gln1 557PRTHomo sapiens 5Pro Leu His Lys Ala Leu Gln1
567PRTHomo sapiens 6Gly Trp Asn Lys Ile Leu Val1 577PRTHomo sapiens
7Ser Val Gln Lys Glu Val Glu1 587PRTHomo sapiens 8Glu Val Glu Lys
Asn Leu Lys1 597PRTHomo sapiens 9Val Met Glu Lys Glu Phe Glu1
5107PRTHomo sapiens 10Phe Val Lys Lys Phe Glu Pro1 5117PRTHomo
sapiens 11Thr Trp Gly Lys Val Val Ser1 5127PRTHomo sapiens 12Glu
Ala Leu Lys Gly Gly Asn1 5137PRTHomo sapiens 13His Phe Thr Lys Leu
Glu Ile1 5147PRTHomo sapiens 14Ala Ser Ile Lys Ala Val Thr1
5157PRTHomo sapiens 15Leu Gly His Lys Pro Met Val1 5167PRTHomo
sapiens 16Asn Phe His Lys Leu Asn Val1 5177PRTHomo sapiens 17Glu
Ala Leu Lys Gly Gly Ser1 5187PRTHomo sapiens 18His Phe Asp Lys Val
Glu Ile1 5197PRTHomo sapiens 19Arg Asn Thr Lys Arg Gly Ser1
5207PRTHomo sapiens 20Arg Asn Ser Lys Asp Gly Ser1 5217PRTHomo
sapiens 21Asp Phe Cys Lys Asp Pro Ser1 5227PRTHomo sapiens 22Lys
Val Pro Lys Leu His Ser1 5237PRTHomo sapiens 23Val Ser Asn Lys Asp
Asp Lys1 5247PRTHomo sapiens 24Lys Asp Asp Lys Lys Asn Met1
5257PRTHomo sapiens 25Asp Asp Lys Lys Asn Met Gly1 5267PRTHomo
sapiens 26Arg Asp Pro Lys Ser Gly Ser1 5277PRTHomo sapiens 27Val
Ser Val Lys Gly Ile Tyr1 5287PRTHomo sapiens 28Thr Ser Leu Lys Asp
Arg Gln1 5297PRTHomo sapiens 29Gly Phe Leu Lys Gly Glu Asp1
5307PRTHomo sapiens 30Glu His Pro Lys Leu Lys Ala1 5317PRTHomo
sapiens 31Pro Lys Leu Lys Ala Pro Leu1 5327PRTHomo sapiens 32Met
Cys Arg Lys Arg Asn Asp1 5337PRTHomo sapiens 33Ile Phe Met Lys Phe
Leu Lys1 5347PRTHomo sapiens 34Asp Cys Asp Lys Met Asp Lys1
5357PRTHomo sapiens 35Lys Met Asp Lys Ala Cys Met1 5367PRTHomo
sapiens 36Glu Lys Ala Lys Val Tyr Ile1 5377PRTHomo sapiens 37Thr
Pro Asp Lys Val Asn His1 5387PRTHomo sapiens 38Ile Asn Met Lys Pro
Leu Gln1 5397PRTHepatitis C virus genotype 1b 39Gly Ser Gly Lys Ser
Thr Lys1 5407PRTHepatitis C virus genotype 1b 40Arg Gly Tyr Lys Gly
Val Trp1 5417PRTHepatitis C virus genotype 1b 41Ile Met Ala Lys Asn
Glu Val1 5427PRTHomo sapiens 42His Pro Met Lys Pro His Arg1
5437PRTHomo sapiens 43Gly Tyr Gln Lys Arg Thr Ala1 5447PRTHomo
sapiens 44His Pro Met Lys Pro His Arg1 5457PRTHomo sapiens 45His
Pro Met Lys Pro His Arg1 5467PRTHomo sapiens 46Gly Asp Pro Lys Gly
Glu Met1 5477PRTHomo sapiens 47Ser Leu Ala Lys Ile Pro Lys1
5487PRTHomo sapiens 48Asp Ala Ala Lys Ser Gln Ala1 5497PRTHomo
sapiens 49Phe Asp Ala Lys Arg Leu Ile1 5507PRTHomo sapiens 50Glu
Arg Ala Lys Arg Thr Leu1 5517PRTHomo sapiens 51Asp Ala Ala Lys Asn
Gln Val1 5527PRTHomo sapiens 52Phe Asp Ala Lys Arg Leu Ile1
5537PRTHomo sapiens 53Glu Arg Ala Lys Arg Thr Leu1 5547PRTHomo
sapiens 54Ala Leu Asp Lys Ile Arg Tyr1 5557PRTHomo sapiens 55Ala
Leu Asp Lys Ile Arg Tyr1 5567PRTHomo sapiens 56Phe Thr Gly Lys Gln
Asp Thr1 5577PRTHomo sapiens 57Glu His Ala Lys Trp Phe Pro1
5587PRTHomo sapiens 58Asp Asp Val Lys Cys Phe Cys1 5597PRTHomo
sapiens 59Asp Asp Val Lys Cys Phe Cys1 5607PRTHomo sapiens 60Glu
Gly Asp Lys Val Lys Cys1 5617PRTHomo sapiens 61Asp Lys Cys Lys Cys
Phe His1 5627PRTHomo sapiens 62Thr Asp Trp Lys Pro Ser Glu1
5637PRTHomo sapiens 63Phe Cys Phe Lys Glu Leu Glu1 5647PRTHomo
sapiens 64Glu Lys His Lys Lys Ser Ser1 5657PRTHomo sapiens 65His
Gln Asp Lys Val Arg Cys1 5667PRTHomo sapiens 66Gln Ser Trp Lys Arg
Gly Asp1 5677PRTHomo sapiens 67Glu His Ala Lys Trp Pro Phe1
5687PRTHomo sapiens 68Gln Glu Asp Lys Val Gln Cys1 5697PRTHomo
sapiens 69Ala Asn Trp Lys Pro Lys Glu1 5707PRTHomo sapiens 70Gln
His Ala Lys Trp Tyr Pro1 5717PRTHomo sapiens 71Val Ala Val Lys Met
Leu Asn1 5727PRTHomo sapiens 72Ile Met Ser Lys Thr Leu Gly1
5737PRTHomo sapiens 73Thr Cys Lys Lys Val Ala Ile1 5747PRTHomo
sapiens 74Val Ala Ile Lys Ile Ser Lys1 5757PRTHomo sapiens 75Arg
Asp Leu Lys Pro Glu Asn1 5767PRTHomo sapiens 76Lys Lys Ile Lys Val
Leu Gly1 5777PRTHomo sapiens 77Thr Val Tyr Lys Gly Leu Trp1
5787PRTHomo sapiens 78Val Ala Ile Lys Glu Leu Arg1 5797PRTHomo
sapiens 79Cys Ala Val Lys Ser Leu Asn1 5807PRTHomo sapiens 80Pro
Tyr Met Lys His Gly Asp1 5817PRTHomo sapiens 81Lys Phe Gly Lys Ile
Leu Gly1 5827PRTHomo sapiens 82Ser Tyr Ala Lys Asn Gly Glu1
5837PRTHomo sapiens 83Glu Leu Leu Lys Tyr Ile Arg1 5847PRTHomo
sapiens 84Tyr Ile Arg Lys Ile Gly Ser1 5857PRTHomo sapiens 85Arg
Asp Leu Lys Pro Glu Asn1 5867PRTHomo sapiens 86Arg Asp Ile Lys Asp
Glu Asn1 5877PRTHomo sapiens 87Val Ala Val Lys Met Leu Lys1
5887PRTHomo sapiens 88Tyr Ala Ser Lys Gly Asn Leu1 5897PRTHomo
sapiens 89Val Ala Val Lys Met Leu Lys1 5907PRTHomo sapiens 90Tyr
Ala Ser Lys Gly Asn Leu1 5917PRTHomo sapiens 91Tyr Ala Ala Lys Gly
Asn Leu1 5927PRTHomo sapiens 92Val Ala Val Lys Met Leu Lys1
5937PRTHomo sapiens 93Val Ala Val Lys Met Leu Lys1 5947PRTHomo
sapiens 94Cys Ala Ala Lys Gly Asn Leu1 5957PRTHomo sapiens 95Thr
Val Tyr Lys Gly Lys Trp1 5967PRTHomo sapiens 96Thr Val Tyr Lys Gly
Lys Trp1 5977PRTHomo sapiens 97Val Ala Val Lys Ile Leu Lys1
5987PRTHomo sapiens 98Ser Leu Tyr Lys His Leu His1 5997PRTHomo
sapiens 99Leu Glu Asp Lys Glu Leu Gly1 51007PRTHomo sapiens 100Thr
Val Lys Lys Gly Tyr Tyr1 51017PRTHomo sapiens 101Pro Leu Asn Lys
Tyr Leu Gln1 51027PRTHomo sapiens 102Tyr Thr Met Lys Glu Val Leu1
51037PRTHomo sapiens 103Phe Ser Val Lys Glu His Arg1 51047PRTHomo
sapiens 104Phe Thr Val Lys Glu Val Met1 51057PRTHomo sapiens 105Phe
Ser Val Lys Asp Pro Ser1 51067PRTHomo sapiens 106Lys Thr His Lys
Leu Gln Asp1 51077PRTHomo sapiens 107Ile Pro Met Lys Leu Ala Gly1
51087PRTHomo sapiens 108Ser His Asp Lys Glu Tyr Ile1 51097PRTHomo
sapiens 109Ser Asp Pro Lys Ala Val Met1 51107PRTHomo sapiens 110Pro
Thr Tyr Lys Tyr Val Asp1 51117PRTHomo sapiens 111Ala Phe Lys Lys
Ala Phe Lys1 51127PRTHomo sapiens 112Tyr Thr Gly Lys Ser His Phe1
51137PRTHomo sapiens 113Ala Ile Arg Lys Ala Phe Arg1 51147PRTHomo
sapiens 114Tyr Gln Trp Lys Asp Val Asp1 51157PRTHomo sapiens 115Tyr
Lys Tyr Lys Asn Pro Tyr1 51167PRTHomo sapiens 116Tyr Ser Met Lys
Cys Lys Asn1 51177PRTHomo sapiens 117Ser Trp Ala Lys Lys Ile Pro1
51187PRTHomo sapiens 118Met Ala Glu Lys Thr Leu Val1 51197PRTHomo
sapiens 119Met Glu Pro Lys Phe Asp Phe1 51207PRTHomo sapiens 120Gln
Leu Pro Lys Ile Leu Ala1 51217PRTHomo sapiens 121Ser Ser Ala Lys
Arg Pro Leu1 51227PRTHomo sapiens 122Ile Ile Phe Lys Asn Gly Asp1
51237PRTHomo sapiens 123Glu Lys Cys Lys Tyr Met Asp1 51247PRTHomo
sapiens 124Val Ile Phe Lys Asn Gly Asp1 51257PRTHomo sapiens 125Glu
Lys Cys Lys Val Met Ala1 51267PRTHomo sapiens 126Met Ala Ser Lys
Lys Lys Pro1 51277PRTHomo sapiens 127Ile Ile Phe Lys His Gly Asp1
51287PRTHomo sapiens 128Glu Ile Val Lys Asp Ala Thr1 51297PRTHomo
sapiens 129Thr Ile Ala Lys Ile Gln Gln1 51307PRTHomo sapiens 130Asp
Asp Glu Lys Gln Leu Met1 51317PRTHomo sapiens 131Asn Arg Asn Lys
Cys Ala Glu1 51327PRTHomo sapiens 132Gly Ser Leu Lys Cys Ala Gln1
51337PRTHomo sapiens 133Gln Glu Cys Lys Leu Leu Tyr1 51347PRTHomo
sapiens 134Asn Arg Tyr Lys Asn Ile Leu1 51357PRTHomo sapiens 135Glu
Arg Gly Lys Ser Lys Cys1 51367PRTHomo sapiens 136Gly Lys Ser Lys
Cys Val Lys1 51377PRTHomo sapiens 137Gln Glu Leu Lys Pro Leu Asp1
51387PRTHomo sapiens 138Asn Arg Tyr Lys Asn Ile Leu1 51397PRTHomo
sapiens 139Glu Gly Glu Lys Ile Lys Cys1 51407PRTHomo sapiens 140Glu
Lys Ile Lys Cys Gln Arg1 51417PRTHomo sapiens 141Gly Arg Thr Lys
Ser His Arg1 51427PRTHomo sapiens 142Gln Ile Pro Lys Lys Lys Ala1
51437PRTHomo sapiens 143Ile Pro Lys Lys Lys Ala Asn1 51447PRTHomo
sapiens 144Ala Ala Trp Lys Ala Asp Gly1 51457PRTHomo sapiens 145Asn
Arg Tyr Lys Asp Val Leu1 51467PRTHomo sapiens 146Arg Val Ala Lys
Phe Pro Glu1 51477PRTHomo sapiens 147Leu Lys Leu Lys Arg Gln Ser1
51487PRTHomo sapiens 148Thr Lys Tyr Lys Ala Asp Lys1 51497PRTHomo
sapiens 149Glu Met Gly Lys Lys Lys Cys1 51507PRTHomo sapiens 150Gly
Lys Lys Lys Cys Glu Arg1 51517PRTHomo sapiens 151Leu Tyr Arg Lys
Lys Pro Gly1 51527PRTHomo sapiens 152Thr Phe Ala Lys Leu Pro Gln1
51537PRTHomo sapiens 153Asn Arg Tyr Lys Asp Val Leu1 51547PRTHomo
sapiens 154Gly Arg Thr Lys Cys His Gln1 51557PRTHomo sapiens 155Leu
Tyr Arg Lys Lys Pro Gly1 51567PRTHomo sapiens 156Gly Arg Val Lys
Cys His Gln1 51577PRTHomo sapiens 157Asn Arg Tyr Lys Thr Ile Leu1
51587PRTHomo sapiens 158Met Asn Glu Lys Cys Thr Glu1 51597PRTHomo
sapiens 159Asn Arg Tyr Lys Asn Ile Leu1 51607PRTHomo sapiens 160Asp
Arg Tyr Lys Thr Ile Leu1 51617PRTHomo sapiens 161Gly Arg Arg Lys
Cys Gly Gln1 51627PRTHomo sapiens 162Gly Arg Val Lys Cys Asp His1
51637PRTHomo sapiens 163Leu Met Val Lys Val Leu Asp1 51647PRTHomo
sapiens 164Met Val Ser Lys Ser Ala Asn1 51657PRTHomo sapiens 165Glu
Asn Ser Lys Ser Ala Gly1 51667PRTHomo sapiens 166Asp Gly His Lys
Ala Val Phe1 51677PRTHomo sapiens 167His Tyr Ser Lys Ser Asp Thr1
51687PRTHomo sapiens 168Ser Tyr Gly Lys Gly Thr Tyr1 51697PRTHomo
sapiens 169Tyr Ser Ala Lys Asp Thr Tyr1 51707PRTHomo sapiens 170Arg
Ser Pro Lys Leu Phe Val1 51717PRTHomo sapiens 171Asn Ser Ser Lys
Ser Asn Gln1 51727PRTHomo sapiens 172Ser Thr Ile Lys Met Ala His1
51737PRTHuman immunodeficiency virus type 1 group M subtype B
173Trp Lys Pro Lys Met Ile Gly1 517413PRTHomo sapiens 174Ala Gly
Phe Tyr Ala Leu Gly Glu Gly Asp Lys Val Lys1 5 1017511PRTHomo
sapiens 175Ala Leu Gly Glu Gly Asp Lys Val Lys Cys Phe1 5
1017672DNAArtificial Sequenceoligonucleotide primer 176taataagcta
gcaccatgga ctacaaagat gatgacgata aaggagcgcc tattacggcc 60tactcccaac
ag 7217748DNAArtificial Sequenceoligonucleotide primer
177ttattatcta gactagcact cttccatctc atcgaactcc cggtaaag
4817839DNAArtificial Sequenceoligonucleotide primer 178atctttcggg
ctgccgtgag cacccgaggg gttgcgaag 3917939DNAArtificial
Sequenceoligonucleotide primer 179cttcgcaacc cctcgggtgc tcacggcagc
ccgaaagat 3918030DNAArtificial Sequenceoligonucleotide primer
180gtctcctact tgaggggctc ttcgggcggt 3018130DNAArtificial
Sequenceoligonucleotide primer 181accgcccgaa gagcccctca agtaggagac
3018214PRTHomo sapiens 182Lys Ile Gly Ser Phe Asp Glu Thr Cys Ile
Ala Ala Thr Arg1 5 10
* * * * *
References