U.S. patent application number 12/984527 was filed with the patent office on 2011-11-03 for directional self-assembly of biological electrical interconnects.
Invention is credited to Pierre Deymier, Roberto Guzman, James B. Hoying, Almoi Nyls Jongewaard, Ian N. Jongewaard, Srini Raghavan.
Application Number | 20110266675 12/984527 |
Document ID | / |
Family ID | 37308725 |
Filed Date | 2011-11-03 |
United States Patent
Application |
20110266675 |
Kind Code |
A1 |
Deymier; Pierre ; et
al. |
November 3, 2011 |
DIRECTIONAL SELF-ASSEMBLY OF BIOLOGICAL ELECTRICAL
INTERCONNECTS
Abstract
A method for controlled nucleation and growth of microtubules on
substrates. The substrate is functionalized with a nucleating agent
for microtubule growth. The method can be employed to generate
nanoscale structures on substrates or between substrates by
additional attachment of MT capture agents which function to
capture the ends of growing MT to form connecting MT structures.
The method can be used to form 2-and 3-D structures on or between
substrates and can function to establish interconnects between
nanoscale devices or molecular electronic devices and electrodes. A
specific method for metallization of biological macromolecules and
structures is provided which can be applied to metallized the MT
formed by the growth and capture method. The metallization method
is biologically benign and is particularly useful for copper
metallization of MTs.
Inventors: |
Deymier; Pierre; (Tucson,
AZ) ; Jongewaard; Ian N.; (Tucson, AZ) ;
Jongewaard; Almoi Nyls; (Castro Valley, CA) ; Hoying;
James B.; (Tucson, AZ) ; Guzman; Roberto;
(Tucson, AZ) ; Raghavan; Srini; (Tucson,
AZ) |
Family ID: |
37308725 |
Appl. No.: |
12/984527 |
Filed: |
January 4, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11418817 |
May 4, 2006 |
7862652 |
|
|
12984527 |
|
|
|
|
60677734 |
May 4, 2005 |
|
|
|
Current U.S.
Class: |
257/746 ;
206/223; 257/E21.158; 257/E23.141; 438/1; 977/762 |
Current CPC
Class: |
C23C 18/2086 20130101;
H01L 2221/1094 20130101; B82Y 5/00 20130101; C23C 18/40 20130101;
C07K 14/47 20130101; B82Y 40/00 20130101; B81B 2207/07 20130101;
B82Y 10/00 20130101; C23C 18/1844 20130101; H01L 21/76838 20130101;
C23C 18/44 20130101; B82B 3/00 20130101; B82Y 30/00 20130101 |
Class at
Publication: |
257/746 ; 438/1;
206/223; 977/762; 257/E21.158; 257/E23.141 |
International
Class: |
H01L 21/28 20060101
H01L021/28; H01L 23/52 20060101 H01L023/52; B65D 71/00 20060101
B65D071/00 |
Goverment Interests
STATEMENT REGARDING U.S. GOVERNMENT FUNDING
[0002] This invention was funded by the United States Government
under National Science Foundation contract No. 0303863. The U.S.
government has certain rights in this invention.
Claims
1. A method for generating a nanoscale structure comprising one or
more microtubules on or between one or more substrates which
comprises the steps of: a. attaching one or more microtubule (MT)
nucleating complexes to a substrate at one or more selected
nucleation sites on the substrate; b. attaching one or more
microtubule (MT) capture complexes to a substrate at one or more
selected capture sites on the substrate; each of the nucleation
sites at a distinct location on the substrate from at least one of
the capture sites; c. contacting the one or more substrates with
attached MT nucleating complexes and capture complexes with a
liquid MT growth composition which comprises GTP, alpha and beta
tubulin and a MT stabilizing agent, under conditions which allow
MTs to grow from the nucleating sites and for a time that is at
least sufficient to grow microtubules having length that will span
the distance separating at least one nucleation site and one
capture such that at least one MT growing from at least one
nucleation site is captured at a capture site at a location on the
substrate distinct from that of the nucleation site from which the
MT was grown to form at least one nanoscale structure on or between
the one or more substrates; d. removing MT that have not been
captured and residual MT nucleating composition to provide one or
more substrates comprising a nanoscale structure comprising one or
more substrate attached MTs.
2. The method of claim 1 wherein steps a-d are repeated a plurality
of times to obtain the nanoscale structure.
3. The method of claim 1 wherein the nanoscale structure is an
interconnect array.
4. The method of claim 1 wherein the nanoscale structure is an
interconnect network.
5. The method of claim 1 wherein the direction of growth of the MT
from at least a portion of the nucleation sites is controlled.
6. The method of claim 5 wherein the direction of growth of the MT
is controlled by application of a directional flow of fluid to one
or more of the substrates.
7. The method of claim 5 wherein the direction of growth of the MT
is controlled by the application of an electric field to the
substrate.
8. The method of claim 5 wherein the direction of growth of the MT
is controlled by the establishment of a concentration gradient of
one or more MT growth composition components required for MT
growth.
9. The method of claim 1 wherein the nanoscale MT structure is
formed between two electrodes on a substrate.
10. The method of claim 1 wherein the nanoscale MT structure is
formed between a nanoscale device or molecular electronic device
and the substrate.
11. The method of claim 1 wherein the contact time of the substrate
with the MT nucleation composition is sufficient to form multiple
MT interconnects on the substrate.
12. The method of claim 1 wherein the MT nucleating complex
comprises gamma-tubulin.
13. (canceled)
14. The method of claim 1 wherein the MT capture complex comprises
alpha-tubulin or CLIP 170.
15. (canceled)
16. (canceled)
17. The method of claim 1 further comprising a step of metallizing
one or more MT on the substrate.
18. The method of claim 17 further comprising a step of fixing or
crosslinking the MTS prior to metallization.
19. (canceled)
20. A method for generating one or more microtubules attached to a
substrate which comprises the steps of: a. attaching one or more
microtubulin (MT) nucleating complexes to a substrate at one or
more selected nucleation sites on the substrate; b. contacting the
substrate with attached MT nucleating complexes with a liquid MT
nucleating composition which comprises GTP, alpha and beta tubulin
and a MT stabilizing agent, for a time sufficient to grow a
microtubules having a desired length.
21. The method of claim 20 wherein the MT nucleating complexes
comprise gamma-tubulin, a GST-gamma-tubulin fusion protein or a
His-tagged gamma-tubulin.
22. (canceled)
24. The method of claim 20 wherein steps a and b are repeated a
plurality of times attaching MT nucleating complexes to distinct
selected locations on the substrate.
25. A nanoscale structure formed by the method of claim 1.
26. A metallized nanostructure formed by metallization of a
nanoscale structure formed by the method of claim 1.
27. (canceled)
28. A kit for preparation of nanoscale structures on or between
substrates which comprises a plurality of MT nucleating complexes
which are selectively tagged with different tags for selective
attachment to a substrate, a plurality of MT capture complexes
which are selectively tagged with different tags for selective
attachment to a substrate wherein MT nucleating complexes having
different tags and MT capture complexes having different tags are
individually packaged for use.
29. (canceled)
30. A method for metallizing a protein comprising the step of
contacting the protein-containing structure with a reducible metal
salt in the presence of a reducing agent for a time sufficient to
achieve a desired level of coating of the protein with the reduced
metal on a surface of the protein.
31.-44. (canceled)
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This continuation application claims the benefit of U.S.
Pat. No. 7,862,652, issued on Jan. 4, 2011, which claims benefit of
U.S. provisional patent application Ser. No. 60/677,734, filed May
4, 2005, the entire contents of both of which are incorporated by
reference herein.
BACKGROUND OF THE INVENTION
[0003] In the semiconductor industry there has been an ongoing
trend towards smaller and smaller electronic circuits and devices.
This technology has been sustained by modifying the capabilities of
manufacturing processes such as photolithography. Such top-bottom
manufacturing methods are reaching their limits in attempts to
develop smaller feature sizes. Implementation of a bottom-up method
is now sought after for the manufacture of nanoscale electronic
circuits. A bottom-up method utilizes the self-assembly nature of
biological structures for the formation of structures from atomic
or molecular constituents. Control of interconnections emerges as
one of the major challenges in the development of these bottom-up
approaches. Research suggests that proteins and assemblies of
proteins offer the control necessary for inexpensive and reliable
fabrication of nanoscale interconnects. One approach to the
fabrication of interconnects for semiconductor application has
involved using biological molecules as templates for
metalization.
[0004] Microtubules (MT) are naturally formed tubular structures,
25 nm in outer diameter with inner diameter of 15 nm and lengths of
several micrometers (Schuyler, S. C.; Pellman, D. Microtubule
`plus-end-tracking proteins`: the end is just the beginning. Cell
2001, 105(4), 421-424). MTs are biopolymers assembled from protein
heterodimers containing both alpha- and beta-tubulin (see FIG. 1).
In the presence of the small molecule guanosine triphosphate (GTP),
the tubulin heterodimer (Tu-GTP) self-assembles into the MT
structure. The MTs' aspect ratio, chemical polarity, reversibility
in assembly and ability to be metalized by electroless plating
(2-3) make them good candidates to serve as templates for the
fabrication of nanoscale systems, including those based on metallic
nanowires (Mertig, M.; Kirsch, R.; Pompe, W. Biomolecular approach
to nanotube fabrication. Applied Physics A. 1998, 66, S723-S727).
In addition, microtubules can provide biological interactions with
a native high specificity (Whaley, S. R.; English, D. S.; Hu, E.
L.; Barbara, P. F. & Belcher, A. M. Selection of peptides with
semiconductor binding specificity for directed nanocrystal
assembly. Nature 2000, 405, 665-668; Sarikaya, M.; Tamerler, C.;
Jen, A. K. Y., et al. Molecular biomimetics: nanotechnology through
biology. Nature Materials 2003, 2(9), 577-585; Antikainen, N. M.;
Martin, S. F. Altering protein specificity: techniques and
applications. Bioorganic & Medicinal Chemistry 2005, 13(8),
2701-2716). The exposure of different tubulin regions at either end
of a microtubule (the plus or minus ends) makes it possible to
control MT attachment to substrates in a specific orientation.
[0005] For example, Limberis et al. took advantage of the polarity
and specificity of biological interactions of MTs to flow-align
pre-grown MTs immobilized onto a silica substrate using a
single-chain antibody that binds only to a portion of
.alpha.-tubulin exposed at the MT minus end (Limberis, L.; Magda,
J. J.; Stewart, R. J. Polarized Alignment and Surface
Immobilization of Microtubules for Kinesin-Powered Nanodevices.
Nano Lett. 2001, 1(5), 277-280).
[0006] MTs are polarized with a slow-growing end (the so-called
minus end exposing .alpha.-tubulin) and fast-growing end (the
.beta.-tubulin terminated plus end). The plus end of a MT typically
grows at a rate 5 to 10 times faster than the minus end. In vitro,
MTs can be grown from solutions containing high concentrations of
purified tubulin (Johnson, K. A.; Borisy, G. G. Kinetic analysis of
microtubule self-assembly in vitro. J. Mol. Biol. 1977, 117, 1-31;
Bayley, P. M.; Martin, S. R. Inhibition of microtubule elongation
by GDP. Biochemical and Biophysical Research Communications 1986,
137(1), 351-358; M. Caplow, J. Shanks, S. Breidenbach, R. L.
Ruhlen, Kinetics and mechanism of microtubule length changes by
dynamic instability. J. Biol. Chem. 1988, 263(22), 10943-10951;
Simon, J. R.; Salmon, E. D. The structure of microtubule ends
during the elongation and shortening phases of dynamic instability
examined by negative-stain electron microscopy. J. Cell Sci. 1990,
96(4), 571-582; Kowalski, R. J.; Williams, R. C. Jr.
Microtubule-associated protein 2 alters the dynamic properties of
microtubule assembly and disassembly. J. Biol. Chem. 1993, 268(13),
9847-9855; Marx, A.; Mandelkow, E. A model of microtubule
oscillations. European Biophysics Journal 1994, 22(6), 405-421;
Caudron, N.; Valiron, O.; Usson, Y.; Valiron, P.; Job, D. A
reassessment of the factors affecting microtubule assembly and
disassembly in vitro. Journal of Molecular Biology 2000, 297(1),
211-220). Microtubules generated from pure tubulin exist in a
dynamic state (called dynamic instability) with net addition of
tubulin to the plus end and net removal of tubulin from the minus
end. This "treadmilling" effect can be controlled via interaction
of the MT with various chemical agents (i.e. microtubule associated
proteins (MAP), taxol) resulting in relatively stable MTs
(Kinoshita, K.; Arnal, I.; Desai, A.; Drechsel, D. N.; Hyman, A. A.
Reconstitution of physiological microtubule dynamics using purified
components. Science 2001, 294, 1340-1343; Arnal, I.; Wade, R. H.
How does taxol stabilize microtubules? Current Biology 1995, 5,
900-908).
[0007] In the absence of these agents and for tubulin
concentrations below a critical value, C.sub.c, MTs will
depolymerize (Lodish, H.; Berk, A.; Zipuski, S. L.; Matsudaira, P.;
Baltimore, D. and Darnell, J. "Molecular Cell Biology," 4.sup.th
Edition, Freeman, 2000.) Tubulin dimers polymerize into MTs for
tubulin concentrations above C.sub.c. At concentrations of tubulin
dimers near C.sub.c, individual MTs exhibit dynamic instability
(Mitchison, T. and Kirschner, M. Microtubule assembly nucleated by
isolated centrosomes. Nature 1984, 312, 237-242.) and undergo
apparently random successive periods of disassembly (catastrophe)
and assembly (rescue). The mechanism for transition between a
growing state and a shrinking state is generally believed to be
associated with hydrolysis of bound GTP when tubulin heterodimers
become incorporated within the microtubule structure. While the
process of MT growth is reasonably well understood, in vivo and in
vitro MT nucleation is, however, still poorly understood. Within
the cell, the minus end is tethered to microtubule-organizing
centers (MTOC) such as centrosomes, and the plus end extends into
the cytoplasm (Job, D.; Valiron, O.; Oakley, B. Microtubule
nucleation. Current Opinion in Cell Biology 2003, 15(1), 111-117).
MT assembly is believed to nucleate from the MTOC through
interaction with a tubulin isoform, gamma-tubulin (Moritz, M.;
Zheng, Y.; Alberts, B. M.; Oegema, K. Recruitment of the
gamma-Tubulin Ring Complex to Drosophila Salt-stripped Centrosome
Scaffolds. J. Cell Biol. 1998, 142, 775-786; Schnackenberg, B. J.;
Khodjakov, A.; Rieder, C. L.; Palazzo, R. E. The disassembly and
reassembly of functional centrosomes in vitro. Proc Natl Acad Sci
USA 1998, 95, 9295-3900; Gunawardane, R. N.; Lizarraga, S. B.;
Wiese, C.; Wilde, A.; Zheng, Y. Gamma-Tubulin complexes and their
role in microtubule nucleation. Curr. Top Dev. Biol. 2000, 49,
55-73). Research in vitro has shown that gamma-tubulin is an
essential component in the centrosome for microtubule nucleation
(Felix, M. A.; Antony, C.; Wright, M.; Maro, B. Centrosome assembly
in vitro: role of gamma-tubulin recruitment in Xenopus sperm aster
formation. J. Cell Biol. 1994, 124, 19-31; Stearns, T.; Kirschner,
M. In vitro reconstitution of centrosome assembly and function: the
central role of gamma-tubulin. Cell 1994, 76, 623-637).
[0008] Monomeric gamma-tubulin and gamma-tubulin protein complexes
can both nucleate MT. The nucleation time of MTs has been shown to
be shorter in the presence of monomeric gamma-tubulin (Leguy, R.;
Melki, R.; Pantaloni, D.; Cartier, M. F. Monomeric gamma-tubulin
nucleates microtubules. J. Bio. Chem. 2000, 275(29), 21975-21980).
In vitro, monomeric gamma-tubulin behaves as a minus-end-specific
protein, with very high binding specificity to the microtubule end.
It caps microtubule minus ends and catalyzes microtubule nucleation
(Leguy, R.; Melki, R.; Pantaloni, D.; Carlier, M. F. Monomeric
gamma-tubulin nucleates microtubules. J. Bio. Chem. 2000, 275(29),
21975-21980; Li, Q.; Joshi, H. C.; Gamma-tubulin is a minus
end-specific microtubule binding protein. J. Cell Biol. 1995, 131,
207-214). Specific peptides and/or complexes of gamma-tubulin have
also been identified to serve as binding sites to interact with
tubulin heterodimers (Llanos, R.; Chevrier, V.; Ronjat, M.;
Meurer-Grob, P.; Martinez, P.; Frank, R.; Bomens, M.; Wade, R. H.;
Wehiand, J.; Job, D. Tubulin binding sites on gamma-tubulin:
identification and molecular characterization. Biochemistry 1999,
38, 15712-15720; Fuller, S. D.; Gowen, B. E.; Reinsch, S.; Sawyer,
A.; Buendia, B.; Wepf, R.; Karsenti, E. The core of the mammalian
centriole contains gamma-tubulin. Curr Biol. 1995, 5(12),
1384-1393; Moritz, M.; Braunfeld, M. B.; Sedat, J. W.; Alberts, B.;
Agard, D. A. Microtubule nucleation by g-tubulin-containing rings
in the centrosome. Nature (London), 1995, 378(6557), 638-640;
Wiese, C.; Zheng, Y. A new function for the g-tubulin complex as a
microtubule minus-end cap. Nature Cell Biology 2000, 3, 358-364;
Oegema, K.; Wiese, C.; Martin, O. C.; Milligan, R. A.; Iwamatsu,
A.; Mitchison, T. J.; Zheng, Y. Characterization of two related
Drosophila gamma-tubulin complexes that differ in their ability to
nucleate microtubules. J. Cell Biol. 1999, 144, 721-733).
Gamma-tubulin ring complex (gamma-TuRC), which also binds to the
minus ends of microtubules, can also work as a nucleation center
for growth of the microtubule both in vivo and in vitro (Fuller, S.
D.; Gowen, B. E.; Reinsch, S.; Sawyer, A.; Buendia, B.; Wepf, R.;
Karsenti, E. The core of the mammalian centriole contains
gamma-tubulin. Curr Biol. 1995, 5(12), 1384-1393; Moritz, M.;
Braunfeld, M. B.; Sedat, J. W.; Alberts, B.; Agard, D. A.
Microtubule nucleation by g-tubulin-containing rings in the
centrosome. Nature (London), 1995, 378(6557), 638-640; Wiese, C.;
Zheng, Y. A new function for the g-tubulin complex as a microtubule
minus-end cap. Nature Cell Biology 2000, 3, 358-364). In addition
to gamma-TuRC, several smaller gamma-tubulin complexes, called
gamma-tubulin small complexes (gamma-TuSCs) are identified as
components of gamma-TuRC(32). Gamma-TuSCs can also nucleate
microtubule in tubulin solutions but with lower efficiency compared
with gamma-TuRCs(32). Besides growing from centrosomal sites, MTs
also can grow from noncentrosomal sites in the cell. In the absence
of a centrosome, other mechanisms must operate to organize free
MTs. One such mechanism is self-organization, which can produce MT
asters, bundles, and bipolar spindles. It has been shown that
microtubules can also grow from some small chromatin-coated beads
(Heald, R.; Tournebize, R.; Blank, T.; Sandaltzopoulos, R.; Becker,
P.; Hyman, A.; Karsenti, E. Self-organization of microtubules into
bipolar spindles around artificial chromosomes in Xenopus egg
extracts. Nature 1996, 382, 420-425).
[0009] This invention relates to the use of microtubules (MT) to
form 2D- and 3D-structures on, between and among substrates.
Creation of such structures relies on in-situ growth of MTs from
selected nucleation sites on substrates and the capture of growing
ends (+ ends) of the MTs at selected capture sites separated from
the nucleation sites. These structures can be generally used as
nanoscale templates, as scaffolds for attachment and location of
nanoscale objects. More specifically the can be used as templates
for fabricating nanoscale interconnects, interconnect arrays, and
networks. The ability to create and use arrays or structures of
MTs, particularly as templates for interconnecting devices on
microchips, necessitates the development of a protocol where MTs
can be nucleated and directionally grown from specific sites on the
microchip toward some target capture site elsewhere on that chip.
As a step in the process of manufacturing MT-based nanostructures
on a silicon wafer, this invention provides an "in situ" approach
to forming MT-based nanostructures comprising functionalizing
selected different sites on a substrate (e.g., a metal pad) with
derivatized MT nucleating complexes and derivatized MT capture
complexes, followed by surface-driven growth of MTs from nucleating
sites followed by capture of growing MTs at capture sites to form
an MT structural link between two selected sites on a substrate.
The advantage of this approach lies not only in the immobilization
of MTs on the surface of a substrate, but more importantly on the
unique ability to initiate MT growth from selected sites and the
ability to generate MT's between selected sites.
[0010] Another requirement in the manufacture of MT-based
nanostructures for forming electrical circuits and devices is the
development of improved metalization techniques. Several biological
templates have already been shown to form nanostructures through
metalization processes. In a study by Braun et al., DNA is used as
a template for creating a 12 .mu.m long and 100 nm wide silver
wire. This was accomplished by first fixing the DNA between gold
electrodes followed by selective localization of silver ions along
the DNA skeleton; the silver-ions were then reduced to silver metal
aggregates along the DNA to yield a nanowire which exhibited
granular morphology and the ability to conduct electrical current
[E. Braun, Y. Eichen, U. Sivan, G. Ben-Yoseph, Nature 1998, 391,
775.]. Similarly, DNA has also been metalized with nanoscale
palladium clusters. The DNA was activated with Pd ions and then
added to a reduction bath containing dimethylamine borane (DMAB) as
the reducing agent. Over time the initial clusters that formed on
the surface become a continuous metallic surface [J. Richter et al,
Adv. Mater. 2000, 12(7), 507].
[0011] Others have used viruses, which are essentially helical RNA,
as the substrate for the plating of nickel and cobalt metal. A
tubular virus, tobacco mosaic virus, was metalized on the inner and
outer surfaces. This selective metallization was regulated by the
absence or presence of phosphate that interacted with functional
groups that differed on the inside and outside surfaces [M. Knez et
al, Nano Letters 2003, 3(8), 1079 and M. Knez et al, Adv. Funct.
Mater. 2004, 14(2), 116].
[0012] Microtubules have also been coated by electroless deposition
of nickel and cobalt. Electroless deposition is a redox reaction,
in which a cation of a metal is chemically reduced onto a surface
to form a metal film. Typically, the metallization of MTs involves
a two step process of activating the MT surface with a noble metal
such as Pd or Pt, which is a catalyst for the electroless
deposition of the desired metal. Nickel plating of MTs was carried
out under physiological conditions, between 30-60.degree. C. and
between pH 6 and 8. The metallization process produced nickel only
in areas where the Pd catalysts were deposited. While Pd and Pt
ions have the capability to diffuse through the MT wall, no
deposition was observed on the inner channel due to the rapid metal
deposition on the outer surface which blocked ion penetration.
Nickel nanowires generated had an overall diameter of 50 to 60 nm.
Similar results were reported for cobalt metallization [R. Kirsch,
M. Mertig, W. Pompe, R. Wahl, G. Sadowski, K. J. Bohm, and E.
Unger, Thin Solid Films 1997, 305, 248; M. Mertig, R. Kirsch, W.
Pompe, Applied Physics A 1998, 66, S723.]. MTs have also been
metalized with Pd which was proposed to proceed by binding of Pd
particles with histidine amino acids on the surface. The surface of
the MTs was covered with palladium particles of 2 to 3 nm to form
quasi-continuous coverage up to 100 nm in diameter [S. Behrens, K.
Rahn, W. Habicht, K. J. Bohm, H. Rosner, E. Dinjus, E. Unger Adv.
Mater. 2002, 14(22), 1621].
[0013] U.S. published patent application 20040063915 relates to
metallization of MTs by reacting "fixed" microtubules with a
reducible metal salt. MTs are fixed by treatment with
glutaraldehyde. Noble metal salts, e.g., HAuCl.sub.4, in
combination with a reducing agent (NaBH.sub.4 or sodium ascorbate)
are used to metalize fixed MTs. Additional salts are said to be
useful in the method, including AgNO.sub.3, HPtCl.sub.3,
CuNO.sub.3, and K.sub.2PdCl.sub.4.
[0014] Copper metallization of templates to produce nanostructures
is of particular interest to the semiconductor industry, because
copper is currently the interconnect metal of choice in integrated
circuits. Copper is a more desired metal than nickel or cobalt due
to its lower resistivity. U.S. published patent application
20040063915 suggests that MTs can be metalized employing CuNO.sub.3
as a reducible salt, but does not demonstrate copper metallization
of MTS. Furthermore, the published application requires fixing of
MTs prior to metallization. Copper plating on bolaamphiphile
nanotubes [H. Matsui, S. Pan, B. Gologan, and S. H. Jonas, J. Phys.
Chem. B 2000, 104, 9576] has been reported. Bolaamphiphiles are
self-assembling, organic structures in the form of a crystalline
tubule with an average diameter of 700 nm and a length of 10 .mu.m.
Metallization with copper and nickel was carried out by exposure to
an electroless nickel or copper bath with the reducing agents
hypophosphite and dimethylamineborane (DMAB), respectively. The
copper coated nanotubes had a diameter of 700 nm and the nickel
coated tubes had a diameter of 1 .mu.m. Metallization occurred with
and without the initial activation of the surface with a Pd
catalyst. The metallization was reported to result from the binding
of ions to available amine groups in the peptide followed by
reduction of these ions to metal in the plating baths.
[0015] Electroless deposition of copper onto the MT surface poses a
challenge, because the commercially available plating baths contain
formaldehyde which damage or destroy MTs. Conditions typically
employed for electroless deposition of copper are very
harsh--alkaline pH values (11.5 to 13) and temperatures from
55.degree. C. to 70.degree. C. which are detrimental to MTs [Y.
Shacham-Diamand, J. Micromech. Microengr., 1991, 1, 66].
[0016] The present invention provides an improved method for
metallization of MTs and other biological templates by electroless
deposition of copper and other metals onto MTs. The method employs
reducible salts, such as CuSO.sub.4, in the presence of a reducing
agent at pH of 4 or less which is not detrimental to MT function
and structure. Furthermore, the metallization method is compatible
with the methods herein for growth of MTs structures on substrates.
Additionally, the method has been found to be useful for forming
metalized MTs having diameters of 15 nm or more. In order to obtain
metalized MTs of such small diameters, it is believed that
metallization of MTs with Cu at least proceeds through deposition
of metal inside of the MTs.
SUMMARY OF THE INVENTION
[0017] The invention provides methods for generating nanoscale
structures comprising microtubules on, between or among one or more
substrates. The method involves the nucleation of MTs from selected
sites on a substrate and the capture of growing MTs to form an
interconnect between the nucleation site and the capture site.
Nucleation sites are typically established on a substrate by
attachment of one or more MT nucleation complexes. Nucleation sites
may be established however on nanoscale devices (e.g., quantum dots
or the like) or at molecular electronic devices (e.g., photovoltaic
molecules or polymer diodes or transistors). MT capture sites can
likewise be established on a substrate or device to which an
attachment can be made by attachment of MT capture complexes.
[0018] More specifically, one or more MT nucleating complexes are
attached on one or more substrates at one or more selected
nucleation sites on the substrates. MT growth is initiated by
contacting the immobilized MT nucleation complex with an MT growth
composition comprising GTP, alpha and beta tubulin and a MT
stabilizing agent. One or more MT capture complexes are attached to
one or more substrates at one or more sites or to a nanoscale or
molecular device. Nucleation sites and/or capture sites can be
established at one or more distinct locations on a substrate.
Growing MTs that encounter a capture site can be captured by the
site to form an interconnect between the nucleation site and the
capture site. After capture, MT which may have initiated and grown,
but which have not been captured can be depolymerized and removed.
This operation of attachment, growth initiation, capture and
removal results in the formation of an nanoscale structure on,
between or among substrates or nanoscale or molecular devices, MT
growth is continued until at least one MT interconnect is formed
and more preferably is continued until a desired 2 or 3-D nanoscale
structure is formed. Non-captured MT and residual MT growth
composition can simply be removed by washing or dilution.
[0019] MT growth is carried out under conditions that are
permissive for that growth. Temperature, pH and concentration of
required MT growth components can be adjusted based on the
teachings herein and what is known in the art to achieve desired MT
growth.
[0020] After initial attachment steps, the growth, capture and
removal steps of the method can be repeated a plurality of times to
achieve a desired structure. Alternatively the attachment, growth,
capture and removal steps can be repeated a plurality of times to
achieve a desired structure. The method can be practiced such that
the direction of growth of the MT from at least a portion of the
nucleation sites is controlled. The direction of MT growth can be
controlled in a variety of ways, e.g., by establishing a
directional fluid flow, by application of electric fields, or by
establishing concentration gradients of required growth components
such ad GTP. The method can be practiced by varying the direction
of MT growth to achieve a desired structure. The growth, capture
and removal steps can be repeated a plurality of times with
different growth directions imposed. The attachment, growth,
capture and removal steps can be repeated a plurality of times with
different growth directions imposed
[0021] In specific embodiments the MT nucleating complex comprises
gamma-tubulin, particularly a gamma tubulin that is tagged for
selective attachment to a substrate or device. A variety of
different tagging, labeling and attachment methods can be employed
of achieve selective attachment to sites on a substrate or to
different devices. GST-tagged and His-tagged gamma-tubulin can be
used as MT nucleating complexes, for example.
[0022] In specific embodiments MT capture complex comprises
alpha-tubulin. In other embodiments the MT capture complex
comprises CLIP 170. The capture proteins are tagged for selective
attachment to a substrate or device. A variety of different
tagging, labeling and attachment methods can be employed to achieve
selective attachment to sites on a substrate or to different
devices. GST-tagged and His-tagged alpha-tubulin and/or GST-tagged
and His-tagged CLIP 170 can be used as MT capture complexes, for
example.
[0023] MT structures formed by the methods herein are immobilized
on, between or among substrates. The MT structures can form
interconnects or interconnect arrays between and among one or more
than one substrate or device.
[0024] MT structures formed by the method herein can be fixed or
crosslinked to further stabilize the MT structure. MT structures
are preferably metallized to provide electrically conductive
interconnects. Any art-known method of metallization that has been
successfully applied to metallization of biological templates can
be employed. Metallization may be preceded by a fixation or
crosslinking step as is known in the art. Alternatively, a
biologically benign metallization, such as that described in
another aspect of this invention can be employed. The metallization
method of this invention is particularly useful for metallization
of the inner surface of MTs to form narrow diameter nanowires. The
metallization method of this invention can be employed, for
example, to metallize the MT structures herein with copper.
[0025] The invention also provides kits for preparation of
nanoscale structures on or between substrates which comprises in
individual packing units (vials and the like) a plurality of MT
nucleating complexes which are selectively tagged with different
tags for selective attachment to a substrate, a plurality of MT
capture complexes which are selectively tagged with different tags
for selective attachment to a substrate wherein MT nucleating
complexes having different tags and MT capture complexes having
different tags are individually packaged for use. These kits may
comprises MT nucleating complex subsets which are differentially
tagged gamma-tubulins and MT capture complex subsets which are
differentially tagged alpha-tubulins and/or subsets of
differentially tagged CLIP 170 proteins. Kits are useful for the
convenient practice of the invention and kits may also comprises
one or more of the following components: instructions for carrying
out the method, MT growth components (individually packaged),
buffers or washing solutions, one or more substrates, one or more
nanoscale devices (e.g., quantum dots), or metallization solution
components.
[0026] In another aspect, the invention relates to a method for
metalization of biological macromolecules and biological
structures, particularly those which self-assemble. The method is
an electroless metal deposition. The method is
biologically-compatible in that it achieves metalization under
conditions (temperature and pH) in which the biological
macromolecule or structure substantially retains its structure
without the need for prior treatment with a fixative or
cross-linking agent. The method is particularly useful for
metalization of biological macromolecules with copper. The method
is particularly useful for metalization of protein-containing
structures, particularly protein structures containing a plurality
of protein subunits. In specific embodiments, the method is
applicable to protein-containing structures including, but not
limited to, self-assembling subcellular structures such as
microtubules and actin filaments, intermediate filaments, collagen
fibers, fibrin, alpha-helical polypeptides, flagella, cilia, pili,
fibrils, as well as viruses (e.g., tobacco mosaic virus (TMV) or
parts thereof (e.g., viral tail fibers).
[0027] Metalization may be conducted to provide a continuous metal
coating over an entire surface or the metal coating may be
discontinuous. In preferred embodiments the metal coating is
continuous. In preferred embodiments, the metal coating is of
uniform thickness. The method is optionally employed to deposit a
mixture of two or more metals onto the biologically macromolecule
or structure. In specific embodiments, the biological macromolecule
or structure is covalently or non-covalently attached to a
substrate. In specific embodiments, the biological macromolecule or
structure is a microtubule.
[0028] More specifically, the method involves contacting the
biological macromolecule or structure with a reducible metal salt
or complex, e.g., a copper salt, in the presence of a reducing
agent. Metal sulfates, nitrates, halides (e.g., chlorides) and
metal acetate complexes are useful in this method. The reducing
agent functions to reduce metal ions which plate out or are
deposited on a surface of the biological macromolecule or
structure. The surface that is coated or plated with metal may be
the outer surface of the biological macromolecule or structure or,
if present, the surface may be an internal or an inner surface of
the biological macromolecule or structure. In specific embodiments,
the method can be employed to metalize the inner surface of
protein-containing hollow tubes, such as microtubules. In specific
embodiment, the metalization method is employed to generate
metalized microtubule nanowires. In specific embodiments, the
metalized microtubule nanowires have diameters of about 15
nanometers or more. In specific embodiments, the metalized
microtubule nanowires are metalized with copper. Nanowires made by
the methods herein are useful for forming nanoscale electrical
interconnects.
[0029] In specific embodiments, metalization is conducted in the
presence of a stabilizing agent which stabilizes the structure of
the biological macromolecule or structure. In specific embodiments,
microtubules are metalized in the presence of taxol or a MAP
(Microtubule Associated Protein).
[0030] In specific embodiments, the metalization employs a copper
(II) salt or complex in the presence of a reducing agent, such as
ascorbate. In specific embodiments, Cu-metalization is initiated at
one or more histidine residues on a surface of the biological
macromolecule. In specific embodiments, Cu-metalization is
initiated on one or more protein surfaces comprising one or more
histidines that are available for complexation to copper ions. In
specific embodiments, the metalization is conducted by contacting
the biological macromolecule or structure with the metalization
components in aqueous solution at a pH and temperature at which the
biological macromolecule or structure is substantially stable
(i.e., is sufficiently stable to allow the macromolecule or
structure to be metalized before it disassembles or is otherwise
damaged). In specific embodiments, the metalization components are
a copper (II) salt, a reducing agent, preferably ascorbic acid or
ascorbate, and a complexant, such as acetic acid (acetate) or other
carboxylic acid (carboxylate).
[0031] In a specific embodiment, the method involves contacting
microtubules with a reducible metal salt or metal complex in the
presence of a reducing agent and optionally in the presence of a
complexant.
BRIEF DESCRIPTION OF THE DRAWINGS
[0032] FIG. 1 is a schematic illustration of the structure of a
microtubule (MT) indicating the alpha-tubulin/beta-tubulin
heterodimer components of the tubule. The microtubule is a hollow
tube (see top view) with an tubular interior cavity defined by an
inner or interior wall. The growing end is illustrated (+ end).
[0033] FIG. 2A: Is a schematic illustration of nano-interconnection
between two test pads by in situ formation of microtubules (in situ
growth) as described herein or pre-grown and stabilized MTs
(pre-grown placement). Specific linker/ligand chemistries mediate
MT connection to the test pads (details described herein below). *
denotes interconnecting MT.
[0034] FIG. 2B: (a) Schematic of a functionalized gold surface
bound by an FSAM and GST-.gamma.-Tubulin fusion protein. S stands
for sulfur and X for carboxylic acid. The fusion protein
GST-.gamma.-Tubulin binds to anti-GST. A specific immunoglobulin,
designated anti-.gamma.-Tubulin, which binds to the
Gold/FSAM/Fusion-Protein complex, bears a fluorescent moiety,
IgG-Cy3, and is incorporated as evidence of the FSAM binding to the
gold and for the formation of the protein complex. (b) Strong
fluorescence of the gold electrode (on the left) indicates complex
formation, as opposed to the benign SiO.sub.2 substrate (on the
right), which lacks fluorescence.
[0035] FIGS. 3A and B are graphs illustrating the length
distribution of MT polymerized for 5 min (A) and 10 min (B) in
solution as described in Example 3 and from a square array of
gamma-tubulin-functionalized gold pads.
[0036] FIG. 4 is a TEM micrograph of Cu-metalized MTs on carbon
coated nickel grid (200 kV magnification). MTs were treated with a
metallizing composition (0.01 copper sulfate, 0.02 acetic acid,
0.02 M ascorbic acid, pH 4.0) for 1 minute.
[0037] FIG. 5 is a high resolution TEM micrograph of a section of
the Cu-metalized MTs of FIG. 4.
[0038] FIG. 6 is a TEM micrograph of metalized MTs for 4 minutes on
carbon coated nickel grid (200 kV magnification). MTs were treated
with a metallizing composition (0.01 copper sulfate, 0.02 acetic
acid, 0.02 M ascorbic acid, pH 4.0) for 4 minute.
[0039] FIG. 7 is a graph illustrating the rate of copper
metalization as a function of time based on the average diameter
(nm) of copper wires formed.
DETAILED DESCRIPTION OF THE INVENTION
[0040] The method of this invention for growth and subsequent
capture of MTs can be employed to create interconnects between or
among defined locations on a single substrate or between or among
two or more substrates, between a substrate and a nanoscale device
or an molecular electronic device (e.g., a molecule which exhibit
desirable electronic properties, such as a photovoltaic molecule),
between or among nanoscale devices or molecular electronic device
optionally attached to a substrate, between or among electrodes on
one or more substrates, and between one or more electrodes on one
or more substrates and one or more nanoscale devices or molecular
electronic devices. The method can be employed to create
interconnects that function as templates for metallization to
provide electrically conductive interconnects. The method can be
used to create 2- and 3-dimensional structures on or between one or
more substrates. These structures can, for example, be used as
scaffolds for attachment of molecules, including biological
molecules, in a selected pattern on the structure. The structures
can be used as templates in any suitable method of nanoscale
manufacture, e.g., for forming nanoscale molds of the structure for
replication of the structure using another material, and as masks
for protecting an underlying substrate during subsequent
processing, as templates for metalization. The methods can be used
to create interconnect arrays and interconnect networks. In
specific embodiments, the method can be used to create an
interconnect between or among two or more substrates. In this case,
the interconnect formed preferably is provided with or formed
within a support matrix, such as a gel, to provide mechanical
support for the interconnection, array, network or other structure
formed. An interconnect formed between or among sites can be formed
comprising a plurality of individually grown MTs.
[0041] The method of this invention can be employed to generate two
connection devices such as diodes or three-connector devices such
as transistors.
[0042] The method allows for parallel synthesis of a plurality of
interconnects. For example, a plurality of MT can be grown from a
single location wherein individual MTs are captured at a particular
capture site among a plurality of different capture sites. In this
case, selective attachment to different substrate locations can be
achieved by used of orthogonal attachment strategies. Orthogonal
attachment strategies can be accomplished, for example, by the use
of selective tagging of subsets of nucleation and capture complexes
with distinguishable tags and the selective attachment of ligands
to distinct locations on the substrates wherein ligands attached at
distinct locations have different specificities for binding to the
tags on the nucleation and capture complexes.
[0043] The method can also be practiced sequentially to form a
series of different interconnects in a plurality of sequential MT
growth and capture operations. Such a method would comprise, for
example, a first step of selective attachment of MT nucleation
complexes and capture complexes followed by growth of MTs, capture
and removal of non-captured MTs, followed by a second step of
selective attachment of nucleation complexes and capture complexes
followed by a second MT growth, capture and removal operation. A
plurality of such sequential steps can be performed.
[0044] The method of this invention can be practiced such that the
direction of growth of MT from at least a portion of the nucleation
sites is controlled. The method can be practiced sequentially in a
plurality of MT growth and capture operations in which the
direction of growth of MTs can be varied from step to step. Such a
method would comprise, for example, a first step of selective
attachment of MT nucleation complexes and capture complexes where
growth of MT is controlled to be in a first direction with capture,
followed by removal and a second growth step where growth of MT is
controlled to be in a second direction with capture, followed by
removal. A plurality of such sequential steps can be performed.
[0045] The method is conducted by contacting a substrate with
attached nucleation and capture complexes with a liquid MT growth
composition which comprises GTP, alpha and beta tubulin and a MT
stabilizing agent. The liquid employed may be an aqueous solution
containing suitable amounts of the listed components. The liquid
employed may be a gel, such as a hydrogel, containing suitable
amounts of the listed components. The use of gels or other high
viscosity liquids as a carrier for MT growth can be used to provide
a support matrix for growth of MTS between two or more substrates
or between a substrate and one more nanoscale devices or molecular
electronic devices. The gel or other high viscosity liquid can
provide mechanical support for any interconnects, arrays or
networks formed therein. Additional, gels or other high viscosity
liquid can be used to establish concentration gradients of MT
growth components, e.g., gradients of GTP, to control growth of MTs
along regions of higher concentrations of GTP.
[0046] Methods of this invention employing in situ growth and
capture of MTS can be combined if desired or useful with selective
attachment of pre-grown MTs to substrates. Methods of this
invention can be beneficially combined with art-known methods for
attachment of nanoscale devices or molecular electronic devices to
substrates. Methods of this invention can be combined with any
suitable art-known method for creating nanoscale structures on a
substrate. The methods herein can for example be employed on
substrates having structured topography created by such art-known
methods to create interconnects between or among distinguishable
structures on a substrate, e.g., from an electrode pad formed on a
substrate to a channel or raised feature on the substrate.
[0047] An MT nucleation complex is the general term used herein for
a nucleation protein or complex of proteins or a microtubule
initiating complex or protein is one which provides a site from
which alpha-tubulin and beta-tubulin subunits can associate
progressively (assemble, polymerize, elongate, more generally grow)
to form a microtubule. Typically the key nucleation protein or
component of the complex is gamma-tubulin or a derivative thereof,
for example, a "tagged" protein, or a truncated (optionally tagged)
gamma-tubulin which retains the ability to serve as a nucleation
protein. Gamma-tubulins can be isolated from natural sources and
purified if needed or can be synthetic. A gamma-tubulin mutant
protein which differs in one or more amino acids from a wild-type
gamma-tubulin, but which retains the function of MT nucleation
alone or in combination with other gamma-tubulins can also be used.
Alpha-tubulin or a derivative thereof, including a tagged
derivative (e.g., a tagged protein), can also mediate initiation of
microtubule assemble. Alpha-tubulin can be similary modified with a
tag or truncation or with amino acid changes from a wild-type
alpha-tubulin, provided that its ability to serve as a nucleation
site for MT growth is retained. The tag facilitates purification
via affinity or immunoaffinity chromatography, and the tag can also
provide the means for selective attachment of the nucleation
protein or complex to a surface. Other nucleation proteins and
complexes are as known to the art.
[0048] A cap (or capture) protein is one which selectively binds to
the growing (plus) end of a microtubule, i.e., to .beta.-tubulin.
It can be provided free in solution and thus stabilize the formed
microtubule by preventing dissociation of subunit tubulin proteins
or it can be fixed to a surface, for example, via a recombinantly
incorporated tag which binds a ligand which can be fixed to the
surface. When the cap protein is fixed to a surface within a
distance from the nucleation protein equal to or less than the
length of an associated microtubule, the plus end of that
microtubule can bind the immobilized cap protein and thus, the
microtubule is stabilized against dissociation and it is bound at
both ends to the surface from which it was assembled. Subsequent
metallization of that microtubule produces an electrical connection
between the nucleation and cap proteins, desirably each attached to
conductive surfaces. Examples of cap proteins useful in the present
invention include, but are not limited to, CLIP170 (also known as
restin, sequences available on NCBI Accession Nos. NM.sub.--019765,
mouse; BC114213 and BC039081, human; see also Akhmanova et al.
2005. Genes Devel. 19:2501-2515; Bilbe et al. 1992. EMBO J.
11:2103-2113) and .alpha.-tubulin or a derivative thereof or an
antibody, single chain antibody or Fab fragment of antibody which
specifically binds .beta.-tubulin. The cap protein can be
immobilized at a discrete site on a surface in ways like those that
are described for the nucleation proteins, but advantageously, the
mechanism for binding the nucleation protein and the cap protein
are not the same, to facilitate control of binding reactions. It is
understood that there can be multiple cycles of cap and nucleation
protein immobilization and microtubule polymerization, washing and
additional cap and nucleation protein immobilizations (optionally
following additions of electrode base materials) and polymerization
so as to produce complex interconnect patterns on the solid
support. As noted above for nucleation proteins, capture proteins
that are modified by tagging, truncation, or amino acid changes
from a wild-type capture protein, and which retain function for
capture of MT can be employed in the methods herein.
[0049] A microtubule stabilizing agent is one which, when added to
a microtubule assembly solution, interacts with the growing or
newly produced microtubule in such a way that dissociation of that
microtubule is reduced, especially in comparison to polymerization
of that microtubule. Microtubule stabilizing agents can include
taxol or certain other small organic molecules, or they can be
proteins which interact with the microtubule, either at the plus
end or along the length of the microtubule, provided that
dissociation is kinetically disfavored in comparison to
polymerization. XMAP215 or XKCM1 are examples of MAPs (microtubule
associated proteins) which can function to enhance polymerization
and/or inhibit net dissociation (see, e.g., Kinoshita et al. 2001.
Science 294:1340-1343; Kinoshita et al. 2002. Trends Cell Biol.
12:267-273).
[0050] The tubulins that mediate microtubule elongation
(polymerization, association or assembly) include both .alpha.- and
.beta.-tubulins. Desirably both of these are from the same
biological source. However, provided that microtubules are formed
the sources need not be the same. Similarly, the nucleation protein
or complex and/or the cap protein or stabilizing protein can be
from different biological sources (organisms) provided that
interactions necessary for initiation, elongation, capping or
stabilization occur. Preferably, however, these are all from
mammalian sources or all from plant sources, for example.
[0051] The applicability of using MTs as templates for
interconnecting devices on microchips necessitates the development
of a protocol where MTs can be nucleated and directionally grown
from specific sites on the microchip toward some target site
elsewhere on that chip. Toward the goal of manufacturing MT-based
nanostructures on a silicon wafer, we report, here an "in situ"
approach consisting of a starting metal pad functionalized with a
derivatized MT nucleating complex, and surface-driven growth of MTs
from the pad. The advantage of this approach lies not only in the
immobilization of MTs on the surface of a substrate but more
importantly on the unique ability to initiate MT growth from
desired sites. In addition, we also report on the effect of the
geometry of the substrate on the morphology of the MTs. Based on
the premise that MT growth may be influenced by the geometry of the
environment, we have conducted additional experiments of MT growth
from .gamma.-tubulin functionalized surfaces with two geometrical
arrangements of the substrates, namely a square lattice of small
gold pads (10 .mu.m.times.10 .mu.m) on a hydrophilic oxidized
silicon wafer and a large flat surface (dramatically larger as
compared to the scale of MTs). Fluorescence microscopy and scanning
electron microscopy are employed to provide a detailed
characterization of the morphology of the nucleated and grown
microtubules.
Synthesis and Purification of End-Specific Capping Proteins
[0052] (a) Synthesis of a Gamma-Tubulin/Glutathione S-Transferase
Fusion Protein for the Nucleation of Microtubules from
Functionalized Electrodes
[0053] We have created a Glutathione S-Transferase (GST)-tagged
.gamma.-Tubulin fusion protein useful as a nucleating agent for the
initiation of microtubule growth. The coding sequence for
GST-.gamma.-Tubulin was created by extracting RNA from human cells,
amplifying the sequence of human .gamma.-Tubulin using Reverse
Transcriptase PCR and cloning the amplification product. The
sequence of the cloned amplification product was verified. The
.gamma.-Tubulin coding sequence was then cloned into a plasmid
containing the sequence encoding the GST tag, which resulted in the
creation of a recombinant GST-.gamma.-Tubulin sequence, with an
IPTG-inducible (lace) promoter sequence for controlled gene
expression. The recombinant plasmid, which confers ampicillin
resistance, was then transformed into Escherichia coli.
[0054] The recombinant E. coli cells were grown in large flasks of
growth media containing Ampicillin, to select for E. coli
containing the plasmid of interest. When the culture reached an
optical density of 0.9, 1 mM
Isopropyl-.beta.-D-thiogalactopyranoside (IPTG) was added to induce
the expression of the GST-.gamma.-Tubulin protein, and the culture
was incubated further to allow expression of the protein. E. coli
cells were then collected via centrifugation and lysed using
lysozyme. Cell debris was removed by centrifugation. The
supernatant was loaded onto an immunoaffinity column specific for
the GST tag, so that the GST-.gamma.-Tubulin protein is bound.
Unbound proteins were washed from the column, and the purified
GST-.gamma.-Tubulin protein was eluted using free glutathione. The
protein quality was verified using SDS-PAGE and the eluted protein
was found to be the correct size, 85 kD. The protein was also
verified using ELISA, and other highly specific antibodies to GST
and .gamma.-Tubulin, which were also used to verify the protein
quality (See Example 1 for additional description).
[0055] While the specifically exemplified gamma-tubulin has been
expressed as a GST-fusion protein to facilitate purification, other
N-terminal sequence tags are known to and readily accessible to the
art. They include a Strep (Streptavidin) tag, c-Myc epitope tag, a
FLAG (flagellar antigen) Epitope tag, GFP Epitope tag (green
fluorescent protein), and a polyhistidine (especially popular is a
hexahistidine) tag. The epitope tagged-proteins are conveniently
purified using commercially available antibodies specific to the
tag of interest and they can also be bound to surfaces to which the
relevant antibodies have been bound. His-tagged proteins are
purified using Nickel-nitrilotriacetate technology, and such
proteins can be bound to appropriately modified surfaces.
[0056] A similar approach is currently used to synthesize a
GST-.alpha.-Tubulin MT plus end cap for a functionalized end-target
electrode.
[0057] For capture of an MT extended from a first electrode (or
other discrete surface or site), there is a "cap" protein attached
to a second electrode surface. The cap protein can be an
.alpha.-tubulin, a CLIP170 protein, MAP protein or MT +
end-specific antibody of or specific binding fragment thereof or
other protein which selectively binds to the growing (+) end of the
MT, with the proviso that it can be immobilized to a surface, for
example with a tag sequence, desirably a tag sequence which differs
from that used to immobilize the nucleation protein. Certain MAP
proteins can be used, in particular, those which selectively bind
to the plus end of the MT. The capture proteins are desirably made
recombinantly as tagged fusion proteins after cloning the
particular coding sequence as an in frame fusion in one of a number
of commercially available vectors designed for tagged fusion
proteins.
Specific Ligands for Various Functionalized Surfaces
(a) A Library of Multifunctional Ligands
[0058] We have developed a process to bind reactive alkanethiols,
conjugated with different ligands, together with genetically
engineered fusion proteins, to develop a protein assembling method
for incorporation of MTs as bio-interconnects. Reactive Gold
surfaces have been modified using Functionalized Self-Assembled
Monolayers (FSAMs). FSAM of a carboxylic acid terminated
alkanethiol is followed by the coupling of specific ligands for
selective binding and attachment of derivative
microtubule-nucleating proteins. A library of different affinity
ligands allows for an immense number of combinations of specific
binding schemes. This library enables multiple sites to be
functionalized differently, leading to the possibility of building
controlled networks of microtubule interconnections. For instance,
a polypeptide with a Histidine amino acid residue binds to a
surface modified with a chelating ligand, while another cap,
bearing Tyrosine residues, will bind to a surface modified with
thiophilic ligands. A library of ligands with alternating
affinities to specific amino acid residues that form various
capping-agent polypeptides is illustrated in the Table 1 below:
TABLE-US-00001 TABLE 1 Library of ligand linkers based upon
chelating derivatives with hydrophobic, thiophilic, and covalent
interactions. Affinity Amino Acid Bifunctional Reagent
Group/Interaction Residue Interaction Chelating ligands Metal Ion
Peptide IDA (iminodiacetate) Cu(II) Histidine (His) residues NTA
(nitrilotriacetate) Ni(II) Multihistidine tags IDA Pd(II)
Methionine (Met) residues, Cysteine (Cys)
TREN(Tris(2aminoethyl)amine) Cu, Ni, Zn Histidine, Tryptophan
(Trp), possibly Proline (Pro) alkyl mercaptans (i.e.,
HS--(CH.sub.2).sub.7--CH.sub.3; Hydrophobic Phenylalanine (Phe),
Leucine (Leu) HS---(CH.sub.2).sub.11--CH.sub.3). interactions
Thiophilic ligands. Thiophilic aromatic amino acid side chains,
(--CH.sub.2--CH.sub.2--SO.sub.2--CH.sub.2--CH.sub.2 --S--CH.sub.2
--CH.sub.2OH) Interactions. with a relative interaction strength in
the order Trp > Tyr > Phe (electron donors). Oxirane gold
derivatives Covalent interaction Amino/thiol containing residues
between gold pads Cysteine (Cys), Lysine (Lys). and amino and thio
groups in amino acid residues (b) Functionalizing
.gamma.-Tubulin
[0059] The nucleating protein, GST-.gamma.-Tubulin, is a fusion
protein in which an N-terminal GST (Glutathione S-Transferase)
sequence is joined to .gamma.-Tubulin. Glutathione binds the GST
protein and serves as a linker to the .gamma.-Tubulin; Glutathione
acts as a ligand. An immunoglobulin specific for the
.gamma.-Tubulin, which immunoglobulin bears a fluorescent moiety
(IgG-Cy3), is used to demonstrate the formation of the
Gold/FSAM/Fusion-Protein complex. Strong fluorescence from a
functionalized gold electrode on a Silicon Oxide substrate, coated
with the FSAM/Fusion-Protein indicates that this complex binds
selectively to the gold surface and not the background of benign
(nonfunctionalized) Silicon Oxide. (See FIG. 2B for further
details.)
Controlled Nucleation and Growth of Microtubules from the
GST/.gamma.-Tubulin Fusion Protein
[0060] In-vitro MT assembly is performed in PEM 80 buffer at pH
.about.6.9, with a final concentration of 1.5 mg/ml Tubulin.
Polymerization commences by the addition of GTP. Taxol is added as
a stabilizing agent during polymerization. Other small organic
molecules that inhibit the disassembly of MTs can also be used as
stabilizing agents, as can MAPs that bind to the length of the MT.
Immersion of the functionalized electrodes into a solution
containing both .alpha. and .beta. Tubulin leads to the nucleation
and assembly of Microtubules from one electrode to the other (as
shown in FIG. 2A). This process results in MTs that are attached,
and also results in the growth of MTs from the electrodes, so that
they can be subsequently aligned and directed by flow, or by any
other means, over the gold surface.
[0061] The tubulins in this invention, .alpha., .beta. and
.gamma.-tubulin, may be from any species and is not limited to
human as the proteins are well conserved among various species and
provide the required structural template base for metallization to
make the interconnects.
Metallization of Microtubules
[0062] Metallization of microtubules can in general be accomplished
by any any art-known method. However it is preferred to use a
biologically-compatible benign chemistry through methods of
electroless deposition. Copper metallization is particularly useful
in preparation of the nanoscale electrical interconnects of this
invention. One aspect of this invention that is described in more
detail below provides a biologically-compatible metallization
method, which functions to metallize MTs, as well as other
biological macromolecules and structures, and which is particularly
useful for metallization with copper.
[0063] The entire process components as described above for making
a bio-based interconnect are shown in the following process flow
diagram (Scheme 1)
[0064] In another aspect of the invention a method for metallizing
biological macromolecules or structures, and particularly MTs,
using a biologically benign electroless deposition chemistry to
form nanoscale conductive wires or related structures, useful for
forming nanoscale electrical interconnects. The method is
particularly useful for metalization with copper.
[0065] The terms biological macromolecules or structures is used
broadly herein to refer to macromolecules (polymers or aggregates)
comprising any one or more type of biological molecule (i.e.,
peptides, proteins, saccharides, lipids, nucleic acids, etc). The
term is more typically used to refer to macromolecules that
composed of multiple subunits which are associated with each other
through covalent or more typically non-covalent interaction.
Typically, such macromolecules define a particular structures, such
as fiber, tubule and the like). Macromolecules and structures are
typically sub-cellular in size. For purposes herein, biological
structures are intended to include viruses and portions thereof.
Biological macromolecules and structures, include among others,
microtubules and actin filaments, intermediate filaments, collagen
fibers, fibrin, alpha-helical polypeptides, flagella, cilia, pili,
fibrils, as well as viruses (e.g., tobacco mosaic virus (TMV) or
parts thereof (e.g., viral tail fibers).
[0066] Typically, prior art metalization of MTs has involved a two
step process of activating the MT surface with a noble metal such
as Pd or Pt, which is a catalyst for the second step, the
electroless deposition of the desired metal. For nickel plating, a
bath containing DMAB as the reducing agent was used. Carried out
under physiological conditions, temperature range of 30-60.degree.
C. and pH between 6 and 8, the metalization process produced nickel
only in areas where the Pd catalysts were deposited. While Pd and
Pt ions have the capability to diffuse through the MT wall, no
deposition was observed on the inner channel due to the rapid metal
deposition on the outer surface which blocked ion penetration.
Nickel nanowires had an overall diameter of 50 to 60 nm. Similar
results were found for cobalt metalization [R. Kirsch, M. Mertig,
W. Pompe, R. Wahl, G. Sadowski, K. J. Bohm, and E. Unger, Thin
Solid Films 1997, 305, 248. and M. Mertig, R. Kirsch, W. Pompe,
Applied Physics A 1998, 66, S723.]. MTs have also been metalized
with Pd. The proposed mechanism for the binding of Pd particles was
the interaction of the ions with histidine amino acids on the
surface. The surface of the MTs was covered with palladium
particles of 2 to 3 nm to form quasi-continuous coverage up to 100
nm in diameter [S. Behrens, K. Rahn, W. Habicht, K. J. Bohm, H.
Rosner, E. Dinjus, E. Unger, Adv. Mater. 2002, 14(22), 1621].
[0067] Copper metalization of templates to produce nanostructures
is of particular interest to the semiconductor industry, because
copper is currently the interconnect metal of choice in integrated
circuits. Copper is a more desirable metal than nickel or cobalt
due to its lower resistivity. While there is currently no published
work demonstrating the copper plating of microtubules, there is one
report on the interaction of copper plating on bolaamphiphile
nanotubes. Electroless deposition of copper onto the surface of
biological macromolecules, such as MTs, poses a significant
challenge, because the commercially available Cu plating baths
contain formaldehyde as a reducing agent, and the plating
conditions are typically carried out at alkaline pH values (11.5 to
13) and temperatures from 55.degree. C. to 70.degree. C. [Y.
Shacham-Diamand, J. Micromech. Microengr., 1991, 1, 66] which are
not conducive to retention of biological structures.
[0068] The metalization process of this invention is performed by
contacting the MTs with metalization components in a metalization
solution or liquid (such as a gel). The metalization solution
contains a reducible metal salt, and a reducing agent that will
reduce the reducible metal. The metalization solution can
optionally contain a complexant. The pH of the metalization
solution is adjusted to obtain metal deposition on the MTs (rather
than metal oxide deposition) at a practical rate without
significant depolymerization or denaturization of the MTs.
[0069] Because metalization is conducted under biologically benign
conditions, there is no need to fix or crosslink the MTs prior to
metalization. Further, the method does not require activation of
the MT surface with a noble metal such as Pd or Pt. Metalization
can be conducted in the presence of a stabilizing agent which
stabilizes the MT structure. Suitable MT stabilizing agents include
taxol and MAPs (microtubule-associated proteins) among other MT
stabilizing agents which are known in the art. MAPs bind to the
exterior surface of the microtubules to increase polymerization and
stability [K. Kinoshita, I. Arnal, A. Desai, D. N. Drechsel and A.
A. Hyman, Science 2001, 294, 1340.]. A previous study has shown
that MAP-stabilized MTs are useful for metallizing MTs with Ni [Y.
Yang et al, Journal of Materials Science 2004, 39, 1927].
[0070] The basic components of the electroless plating bath are: a
salt or complex of a reducible metal (such as noble metals and
transition metals, including among others Cu, Au and Ag), and the
driving force for the metalization, a reducing agent (any suitable
reducing agent can be employed and is selected based at least in
part on the metal to be reduced). Useful reducing agents include
ascorbic acid, mixtures of ascorbic acid and NADH. Choice of
reducing agent is important for retaining biologically benign
metalization conditions (pH and temperature that do not destabilize
the biological template). Ascorbic acid (which can be used in the
form of ascorbate salts) and reducing agents having properties
similar thereto can be employed. Other additives may include
complexants (complexing agents) and stabilizers. Complexants are
used to prevent precipitation of metal salts and limit the free
metal ions in solution whereas stabilizers control the plating rate
and prevent decomposition of solution. Useful complexants include
organic acids or salts thereof, organic amines or salts thereof,
chelating agents such as EDTA, and hydroxylamine. One of ordinary
skill in the art in view of the teachings herein can selected
suitable reducible metal salts, suitable reducing agents, and
suitable complexants to achieve metalization of biological
macromolecules and biological structures. One of ordinary skill in
the art using routine experimentation develop variant metalization
solutions based on the teachings herein and what is generally known
in the art. One of ordinary skill in the art can using the
teachings herein and what is generally known in the art adapt the
specific methods disclosed herein for metalization of MTs with
metals other than copper, particularly gold and silver. The methods
specifically disclosed herein can be readily adapted to metalize
MTs and other biological macromolecules, particularly
protein-containing structures, that are free in solution or that
are attached to a substrate. Substrates suitable for immobilization
or attachment of biological macromolecules or structures are well
known in the art and include, silicon wafers, carbon supports,
aminosilane-treated silica, polylysine-coated glass, and metal
grids and disks (e.g., Ni grids and disks, gold electrode pads),
synthetic polymer supports, polystyrene, agarose, nitrocellulose,
and nylon, ITEM grids and electrodes.
[0071] Metalization using the method of this invention can result
in metalized MTs which can function as nanowires. In general, the
methods herein can be used to generate nanowires with diameters
ranging from 10 to 100 nm. Metalization for shorter times (.about.1
minute) produces uniform small-diameter nanowires (diameter of
approximately 15 nm). The small diameters observed at short
metalization times suggest that metalization can be initiated
selectively from the inner surface of the microtubule. The
metalization method also provides control over the diameter of the
nanowires formed by varying the exposure time of the MTs to the
metalization components or solutions. More than one sequential
metalization step can be applied to a biological macromolecule or
structure to obtain multiple layers of deposited metal.
[0072] Metalization is stopped by discontinuing contact with the
metalizing components or solution. This can be done by any method,
including physical removal, dilution, washing and the like.
Metalized structures can be washed using any suitable method to
remove residual metalization components or solution.
[0073] The metalization method of this invention is particularly
suitable for metalization with copper. In this case a preferred
copper salt is copper (II) sulfate, preferred reducing agents are
ascorbate or a mixture of ascorbate and NADH, a preferred
complexant is acetic acid (acetate) and the metalization is
preferably carried out at pH of 4 for times ranging from 1 minute
to about 5 minutes. In this specific preferred embodiment, pH
control of the metalization solution is important to obtain a
practical rate of MT metalization.
[0074] Cu metalization of MTs for shorter times (.about.1-2
minutes) was shown to produce uniform copper wire with diameters of
approximately 15 nm, indicating that Cu metalization is initiated
selectively from the inner core of the tubule. It is believe that
Cu associates with histidine residues which are found on the inner
core of the tubule.
[0075] The metalization method of this invention is suitable for
metallization of a variety of biological macromolecules and
structures. It is particularly suitable for metalization of
protein-containing structures, particularly those which contain a
plurality of protein subunits, and more particularly those that
contain an ordered protein-containing structure, including
microtubules, actin filaments and the like. The method is
particularly useful for metallization of such species with copper.
Other macromolecules, particularly those having elongated forms
similar to microtubules, such as polynucleic acids or artificial
chromosomes, can also be substrates for electroless plating methods
of this invention.
THE EXAMPLES
Example 1
Cloning and Expression of Tubulin
[0076] We designed and cloned a .gamma.-tubulin fusion protein
could be used to initiate microtubule growth in a precise fashion,
especially after attachment to a surface of interest. Additional
details of the experiments conducted can be found in Yang et al.
(2006) Biotechnology Progress 22: 303-312, which is incorporated by
reference herein in its entirety.
[0077] Analysis of all of the known human .gamma.-tubulin sequences
allowed the design of specific oligonucleotides (oligos) that could
then be used as primers in polymerase chain reaction (PCR) to clone
.gamma.-tubulin. In addition, those oligos that were designed to be
used to PCR amplify the .gamma.-tubulin would also provide the
recombinant form with sequences that allow it to be made as a
recombinant fusion with glutathione -S- transferase (GST) sequence
tag. Specifically, the human sequence that was used to design
primers was from NCBI (NM.sub.--001070, Homo sapiens tubulin,
.gamma.-1, TUBG1). They are:
TABLE-US-00002 5'-GGAATTCTGCCGAGGGAAATCATCACC-3' (SEQ ID NO: 1)
5'-AAGCTTCACTGCTCCTGGGTGCCCCAGG-3' (SEQ ID NO: 2)
5'-ACCACGGTCCIGGATGTCATGAGG-3') (SEQ ID NO: 3)
5'-TCTCGGCCTGTGGACACCATCACG-3' (SEQ ID NO: 4)
[0078] These oligonucleotides were then used in PCR to create two
fragments of the recombinant .gamma.-tubulin DNA. These were DNA
sequenced and then connected to each other appropriately to form
the entire recombinant .gamma.-tubulin coding sequence. Sequence
analysis shows that they are most likely TUBG1, but are slightly
different.
TABLE-US-00003 .gamma. tubulin Clone 1 (SEQ ID NO: 5)
GGAATTggaattctgc cgagggaaat catcacccta cagttgggcc agtgcggcaa
tcagattggg ttcgagttct ggaaacagct gtgcgccgag catggtatca gccccgaggg
catcgtggag gagttcgcca ccgagggcac tgaccgcaag gacgtctttt tctaccaggc
agacgatgag cactacatcc cccgggccgt gctgctggac ttggaacccc gggtgatcca
ctccatcctc aactccccct atgccaagct ctacaaccca gagaacatct acctgtcgga
acatggagga ggagctggca acaactgggc cagcggattc tcccagggag aaaagatcca
tgaggacatt tttgacatca tagaccggga ggcagatggt agtgacagtc tagagggctt
tgtgctgtgt cactccattg ctggggggac aggctctgga ctgggttcct acctcttaga
acggctgaat gacaggtatc ctaagaagct ggtgcagaca tactcagtgt ttcccaacca
ggacgagatg agcgatgtgg tggtccagcc ttacaattca ctcctcacac tcaagaggct
gacgcagaat gcagactgtg tggtggtgct ggacaacaca gccctgaacc ggattgccac
agaccgcctg cacatccaga acccatcctt ctcccagatc aaccagctgg tgtctaccat
catgtcagcc agcaccacca ccctgcgcta ccctggctac atgaacaatg acctcatcgg
cctcatcgcc tcgctcattc ccaccccacg gctccacttc ctcatgaccg gctacacccc
tctcactacg gaccagtcag tggccagcgt gaggaagacc acggtcctgg atgtcatgag
gcggctgctg cagcccaaga acgtgatggt gtccacaggc cgaga .gamma. tubulin
Clone 2 (SEQ ID NO: 6) accacggtcc tggatgtcat gaggcggctg ctgcagccca
agaacgtgat ggtgtccaca ggccgagacc gccagaccaa ccactgctac atcgccatcc
tcaacatcat ccagggagag gtggacccca cccaggtcca caagagcttg cagaggatcc
gggaacgcaa gttggccaac ttcatcccgt ggggccccgc cagcatccag gtggccctgt
cgaggaagtc tccctacctg ccctcggccc accgggtcag cgggctcatg atggccaacc
acaccagcat ctcctcgctc ttcgagagaa cctgtcgcca gtatgacaag ctgcgtaagc
gggaggcctt cctggagcag ttccgcaagg aggacatgtt caaggacaac tttgatgaga
tggacacatc cagggagatt gtgcagcagc tcatcgatga gtaccatgcg gccacacggc
cagactacat ctcctggggc acccaggagc agtgaAGCTT .gamma. tubulin clone 3
(SEQ ID NO: 7, ligation product of clone 1 and clone 2) ggaattctgc
cgagggaaat catcacccta cagttgggcc agtgcggcaa tcagattggg ttcgagttct
ggaaacagct gtgcgccgag catggtatca gccccgaggg catcgtggag gagttcgcca
ccgagggcac tgaccgcaag gacgtctttt tctaccaggc agacgatgag cactacatcc
cccgggccgt gctgctggac ttggaacccc gggtgatcca ctccatcctc aactccccct
atgccaagct ctacaaccca gagaacatct acctgtcgga acatggagga ggagctggca
acaactgggc cagcggattc tcccagggag aaaagatcca tgaggacatt tttgacatca
tagaccggga ggcagatggt agtgacagtc tagagggctt tgtgctgtgt cactccattg
ctggggggac aggctctgga ctgggttcct acctcttaga acggctgaat gacaggtatc
ctaagaagct ggtgcagaca tactcagtgt ttcccaacca ggacgagatg agcgatgtgg
tggtccagcc ttacaattca ctcctcacac tcaagaggct gacgcagaat gcagactgtg
tggtggtgct ggacaacaca gccctgaacc ggattgccac agaccgcctg cacatccaga
acccatcctt ctcccagatc aaccagctgg tgtctaccat catgtcagcc agcaccacca
ccctgcgcta ccctggctac atgaacaatg acctcatcgg cctcatcgcc tcgctcattc
ccaccccacg gctccacttc ctcatgaccg gctacacccc tctcactacg gaccagtcag
tggccagcgt gaggaagacc acggtcctgg atgtcatgag gcggctgctg cagcccaaga
acgtgatggt gtccacaggc cgagaccgcc agaccaacca ctgctacatc gccatcctca
acatcatcca gggagaggtg gaccccaccc aggtccacaa gagcttgcag aggatccggg
aacgcaagtt ggccaacttc atcccgtggg gccccgccag catccaggtg gccctctcga
ggaagtctcc ctacctgccc tcggcccacc gggtcagcgg gctcatgatg gccaaccaca
ccagcatctc ctcgctcttc gagagaacct gtcgccagta tgacaagctg cgtaagcggg
aggccttcct ggagcagttc cgcaaggagg acatgttcaa ggacaacttt gatgagatgg
acacatccag ggagattgtg cagcagctca tcgatgagta ccatgcggcc acacggccag
actacatctc ctggggcacc caggagcagt gaagctt
[0079] The recombinant .gamma.-tubulin DNA was then cloned into
pGEX-KG (Guan and Dixon. 1991. Anal. Biochem. 192:262-267) to
create the final clone, pGEXTUBG, which is then used to express
recombinant GST-tagged .gamma.-tubulin protein. The complete
sequence (SEQ ID NO:8) of that pGEXTUBG clone is provided
herein.
TABLE-US-00004 pGEXTUBG (SEQ ID NO: 8) acgttatcga ctgcacggtg
caccaatgct tctggcgtca ggcagccatc ggaagctgtg gtatggctgt gcaggtcgta
aatcactgca taattcgtgt cgctcaaggc gcactcccgt tctggataat gttttttgcg
ccgacatcat aacggttctg gcaaatattc tgaaatgagc tgttgacaat taatcatcgg
ctcgtataat gtgtggaatt gtgagcggat aacaatttca cacaggaaac agtattcatg
tcccctatac taggttattg gaaaattaag ggccttgtgc aacccactcg acttcttttg
gaatatcttg aagaaaaata tgaagagcat ttgtatgagc gcgatgaagg tgataaatgg
cgaaacaaaa agtttgaatt gggtttggag tttcccaatc ttccttatta tattgatggt
gatgttaaat taacacagtc tatggccatc atacgttata tagctgacaa gcacaacatg
ttgggtggtt gtccaaaaga gcgtgcagag atttcaatgc ttgaaggagc ggttttggat
attagatacg gtgtttcgag aattgcatat agtaaagact ttgaaactct caaagttgat
tttcttagca agctacctga aatgctgaaa atgttcgaag atcgtttatg tcataaaaca
tatttaaatg gtgatcatgt aacccatcct gacttcatgt tgtatgacgc tcttgatgtt
gttttataca tggacccaat gtgcctggat gcgttcccaa aattagtttg ttttaaaaaa
cgtattgaag ctatcccaca aattgataag tacttgaaat ccagcaagta tatagcatgg
cctttgcagg gctggcaagc cacgtttggt ggtggcgacc atcctccaaa atcggatctg
gttccgcgtg gatccccggg aatttccggt ggtggtggtg gaattctgcc gagggaaatc
atcaccctac agttgggcca gtgcggcaat cagattgggt tcgagttctg gaaacagctg
tgcgccgagc atggtatcag ccccgagggc atcgtggagg agttcgccac cgagggcact
gaccgcaagg acgtcttttt ctaccaggca gacgatgagc actacatccc ccgggccgtg
ctgctggact tggaaccccg ggtgatccac tccatcctca actcccccta tgccaagctc
tacaacccag agaacatcta cctgtcggaa catggaggag gagctggcaa caactgggcc
agcggattct cccagggaga aaagatccat gaggacattt ttgacatcat agaccgggag
gcagatggta gtgacagtct agagggcttt gtgctgtgtc actccattgc tggggggaca
ggctctggac tgggttccta cctcttagaa cggctgaatg acaggtatcc taagaagctg
gtgcagacat actcagtgtt tcccaaccag gacgagatga gcgatgtggt ggtccagcct
tacaattcac tcctcacact caagaggctg acgcagaatg cagactgtgt ggtggtgctg
gacaacacag ccctgaaccg gattgccaca gaccgcctgc acatccagaa cccatccttc
tcccagatca accagctggt gtctaccatc atgtcagcca gcaccaccac cctgcgctac
cctggctaca tgaacaatga cctcatcggc ctcatcgcct cgctcattcc caccccacgg
ctccacttcc tcatgaccgg ctacacccct ctcactacgg accagtcagt ggccagcgtg
aggaagacca cggtcctgga tgtcatgagg cggctgctgc agcccaagaa cgtgatggtg
tccacaggcc gagaccgcca gaccaaccac tgctacatcg ccatcctcaa catcatccag
ggagaggtgg accccaccca ggtccacaag agcttgcaga ggatccggga acgcaagttg
gccaacttca tcccgtgggg ccccgccagc atccaggtgg ccctgtcgag gaagtctccc
tacctgccct cggcccaccg ggtcagcggg ctcatgatgg ccaaccacac cagcatctcc
tcgctcttcg agagaacctg tcgccagtat gacaagctgc gtaagcggga ggccttcctg
gagcagttcc gcaaggagga catgttcaag gacaactttg atgagatgga cacatccagg
gagattgtgc agcagctcat cgatgagtac catgcggcca cacggccaga ctacatctcc
tggggcaccc aggagcagtg aagcttattc atcgtgactg actgacgatc tgcctcgcgc
gtttcggtga tgacggtgaa aacctctgac acatgcagct cccggagacg gtcacagctt
gtctgtaagc ggatgccggg agcagacaag cccgtcaggg cgcgtcagcg ggtgttggcg
ggtgtcgggg cgcagccatg acccagtcac gtagcgatag cggagtgtat aattcttgaa
gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt
cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt
tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat
aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt
ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg
ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga
tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc
tatgtggcgc ggtattatcc cgtgttgacg ccgggcaaga gcaactcggt cgccgcatac
actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg
gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca
acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg
gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg
acgagcgtga caccacgatg cctgcagcaa tggcaacaac gttgcgcaaa ctattaactg
gcgaactact tactctagct tcccggcaac aattaataga ctggatggag gcggataaag
ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg
gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct
cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac
agatcgctga gataggtgcc tcactgatta agcattggta actgtcagac caagtttact
catatatact ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga
tcctttttga taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt
cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct
gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc
taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgtcc
ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc
tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg
ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt
cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg
agctatgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg
gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt
atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag
gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt
gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta
ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt
cagtgagcga ggaagcggaa gagcgcctga tgcggtattt tctccttacg catctgtgcg
gtatttcaca ccgcataaat tccgacacca tcgaatggtg caaaaccttt cgcggtatgg
catgatagcg cccggaagag agtcaattca gggtggtgaa tgtgaaacca gtaacgttat
acgatgtcgc agagtatgcc ggtgtctctt atcagaccgt ttcccgcgtg gtgaaccagg
ccagccacgt ttctgcgaaa acgcgggaaa aagtggaagc ggcgatggcg gagctgaatt
acattcccaa ccgcgtggca caacaactgg cgggcaaaca gtcgttgctg attggcgttg
ccacctccag tctggccctg cacgcgccgt cgcaaattgt cgcggcgatt aaatctcgcg
ccgatcaact gggtgccagc gtggtggtgt cgatggtaga acgaagcggc gtcgaagcct
gtaaagcggc ggtgcacaat cttctcgcgc aacgcgtcag tgggctgatc attaactatc
cgctggatga ccaggatgcc attgctgtgg aagctgcctg cactaatgtt ccggcgttat
ttcttgatgt ctctgaccag acacccatca acagtattat tttctcccat gaagacggta
cgcgactggg cgtggagcat ctggtcgcat tgggtcacca gcaaatcgcg ctgttagcgg
gcccattaag ttctgtctcg gcgcgtctgc gtctggctgg ctggcataaa tatctcactc
gcaatcaaat tcagccgata gcggaacggg aaggcgactg gagtgccatg tccggttttc
aacaaaccat gcaaatgctg aatgagggca tcgttcccac tgcgatgctg gttgccaacg
atcagatggc gctgggcgca atgcgcgcca ttaccgagtc cgggctgcgc gttggtgcgg
atatctcggt agtgggatac gacgataccg aagacagctc atgttatatc ccgccgttaa
ccaccatcaa acaggatttt cgcctgctgg ggcaaaccag cgtggaccgc ttgctgcaac
tctctcaggg ccaggcggtg aagggcaatc agctgttgcc cgtctcactg gtgaaaagaa
aaaccaccct ggcgcccaat acgcaaaccg cctctccccg cgcgttggcc gattcattaa
tgcagctggc acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa cgcaattaat
gtgagttagc tcactcatta ggcaccccag gctttacact ttatgcttcc ggctcgtatg
ttgtgtggaa ttgtgagcgg ataacaattt cacacaggaa acagctatga ccatgattac
ggattcactg gccgtcgttt tacaacgtcg tgactgggaa
aaccctggcg ttacccaact taatcgcctt gcagcacatc cccctttcgc cagctggcgt
aatagcgaag aggcccgcac cgatcgccct tcccaacagt tgcgcagcct gaatggcgaa
tggcgctttg cctggtttcc ggcaccagaa gcggtgccgg aaagctggct ggagtgcgat
cttcctgagg ccgatactgt cgtcgtcccc tcaaactggc agatgcacgg ttacgatgcg
cccatctaca ccaacgtaac ctatcccatt acggtcaatc cgccgtttgt tcccacggag
aatccgacgg gttgttactc gctcacattt aatgttgatg aaagctggct acaggaaggc
cagacgcgaa ttatttttga tggcgttgga att
[0080] The GST coding sequence starts at the underlined `atg` and
ends at the underlined Eco RI site (gaattc). The .gamma.-tubulin
sequence starts at this engineered Eco RI site and terminates with
a "tga" just before an engineered Hind III site (aagctt,
underlined). In addition, the start codon for .gamma.-tubulin (atg)
was mutated to a Leu codon (ctg). The underlined `tga` sequence is
the translation stop codon. Proteins were expressed in recombinant
E. coli and purified using an affinity column that specifically
binds the GST-.gamma.-Tubulin protein. Unbound proteins were washed
from the column, and the purified GST-.gamma.-Tubulin protein was
eluted using free glutathione. Protein purity was verified using
SDS-PAGE; the eluted protein of 85 kDa was of the correct size. The
protein was also verified immunologically using ELISA, with
antibodies highly specific to GST and .gamma.-Tubulin.
[0081] As an alternative to immobilization of the nucleation
protein to the Surface via a GST tag, a His-tagged .gamma.-tubulin
was produced recombinantly. The sequence encoding the His-tagged
.gamma.-tubulin is given in SEQ ID NO:9.
TABLE-US-00005 gtuHis complete sequence (SEQ ID NO: 9)
ATGCCGAGGGAAATCATCACCCTACAGTTGGGCCAGTGCG
GCAATCAGATTGGGTTCGAGTTCTGGAAACAGCTGTGCG
CCGAGCATGGTATCAGCCCCGAGGGCATCGTGGAGGAGTT
CGCCACCGAGGGCACTGACCGCAAGGACGTCTTTTTCTACCAG
GCAGACGATGAGCACTACATCCCCCGGGCCGTGCTGCTG
GACTTGGAACCCCGGGTGATCCACTCCATCCTCAACTCC
CCCTATGCCAAGCTCTACAACCCAGAGAACATCTACCTGTCGG
AACATGGAGGAGGAGCTGGCAACAACTGGGCCAGCGGATTCT
CCCAGGGAGAAAAGATCCATGAGGACATTTTTGACATCATAG
ACCGGGAGGCAGATGGTAGTGACAGTCTAGAGGGCTTTGTGC
TGTGTCACTCCATTGCTGGGGGGACAGGCTCTGGACTGGGTT
CCTACCTCTTAGAACGGCTGAATGACAGGTATCCTAAG
AAGCTGGTGCAGACATACTCAGTGITICCCAACCAGGACGA
GATGAGCGATGTGGTGGTCCAGCCTTACAATTCACTCCTCAC
ACTCAAGAGGCTGACGCAGAATGCAGACTGTGTGGTGGTGCTGG
ACAACACAGCCCTGAACCGGATTGCCACAGACCGCCTGCACAT
CCAGAACCCATCCTTCTCCCAGATCAACCAGCTGGTGTCTAC
CATCATGTCAGCCAGCACCACCACCCTGCGCT ACCCTGGCTACATGAACAATGACCTCATC
GGCCTCATCGCCTCGCTCATTCCCACCCCACGGCTCCACTTCC
TCATGACCGGCTACACCCCTCTCACTACGGACCAGTCAGTG
GCCAGCGTGAGGAAGACCACGGTCCTGGATGTCATGAGG
CGGCTGCTGCAGCCCAAGAACGTGATGGTGTCCACAGGCCG
AGACCGCCAGACCAACCACTGCTACATCGCCATCCTCAACATCA
TCCAGGGAGAGGTGGACCCCACCCAGGTCCACAAGAGCTTGC
AGAGGATCCGGGAACGGAAGTTGGCCAACTTCATCCCGTGGGGC
CCCGCCAGCATCCAGGTGGCCCTGTCGAGGAAGTCTCCCTACCTGC
CCTCGGCCCACCGGGTCAGCGGGCTCATGATGGCCAACCACACCAGC
ATCTCCTCGCTCTTCGAGAGAACCTGTCGCCAGTATGACAAGCTGCG
TAAGCGGGAGGCCTTCCTGGAGCAGTTCCGCAAGGAGGACATGTTCA
AGGACAACTTTGATGAGATGGACACATCCAGGGAGATTGTGCAGCAGC
TCATCGATGAGTACCATGCGGCCACACGGCCAGACTACATCTCCTGGGGC
ACCCAGGAGCAGGGAGGAGGAGGAGGACTCGAGCACCACCACCACCACCAC
[0082] The final purification yielded the fusion protein which had
a final concentration of about 4-5 .mu.M and a purification of
greater than 80%.
[0083] For use in extension of microtubules from an immobilized
.gamma.-Tubulin or .gamma.-Tubulin nucleation complex on a surface
of interest, tubulin preparations containing .alpha.-tubulin and
.beta.-tubulin are obtained from commercial sources (e.g.,
Cytoskeleton Inc., Denver, Colo.).
[0084] Recombinant GST-alpha tubulin has also been produced for use
in the present invention. Alpha tubulin was selected as a protein
for the capping of the growing (plus) ends of microtubules and for
the "capture of a microtubule at a discrete position on the
surface. This protein was selected since it participates in
attachment to beta tubulin at the plus end of the microtubule, as
well as interacting with alpha tubulin molecules laterally.
[0085] Alpha tubulin was attached to a GST tag sequence via a
glycine linker consisting of 15 glycine molecules. To create this,
total RNA was isolated from human fibroblasts, and cDNA was made
using RT-PCR. Since the alpha tubulin gene was quite long (1350
base pairs) to be amplified by traditional PCR, its sequence was
split into two halves, both spanning an EcoRV restriction site,
used later to reassemble the two halves.
[0086] Because the amino terminus of the protein provides the most
accessible end for attachment to GST, a series of primers were
designed to elongate the protein with a string of glycine residues.
Primers were designed against the human alpha tubulin sequence
(Accession number NM.sub.--032704) to include the coding region of
the gene. The first half of the gene (segment A), bases 101-794 on
the mRNA sequence (corresponding to bases 1-694 of the coding
region) was engineered with multiple steps. Upstream of the glycine
codons, a BamHI site was added to integration into a plasmid. The
second half of the gene (segment B), bases 714-1450 on the mRNA
sequence (corresponding to bases 614-1350 of the coding region) was
engineered with a HindIII restriction site directly following the
stop codon, to be used for integration into a plasmid. Each PCR
reaction was followed by cloning the gene fragment into the
pBlueScript plasmid and transfected into E. coli. Plasmids were
purified from the E. coli after overnight growth and then the
insert was sequenced to make sure that no mutations were introduced
into the coding sequence that would hamper protein function.
[0087] At each step a clone was selected that contained the correct
amino acid coding sequence, corresponding to the published data for
.alpha.-tubulin. The final cloning step was performed by digestion
with HindIII and EcoRV; inserting segment B into a plasmid already
containing segment A. The insert so produced was also sequenced and
the encoded amino acid sequence was verified. From this, the
plasmid was digested with BamHI and HindIII, and cloned into an
expression vector containing the GST sequence (pGEX-KG). The entire
GST-alpha tubulin clone was then sequenced and verified. Twelve
clones were selected, grown, and induced with IPTG to determine
which clone had the highest expression of the recombinant
GST-.alpha.-tubulin. All twelve showed moderate expression levels
of the protein, at the appropriate size, with some cleavage into
smaller fragments. The cloned segment is further verified by
performing an ELISA using anti-alpha tubulin antibody with the
recombinantly expressed protein.
Example 2
Surface Functionalization
[0088] A protein nucleation method for MT growth from gold
substrates has been developed based on the self-assembly of
reactive alkanethiols together with the engineered fusion protein.
Oxidized silicon wafers were patterned with gold electrodes,
followed by treatment with piranha solution to clean organic
contaminants and to activate the gold surface. An anti-GST antibody
was bound to a SAM of carboxylic acid-terminated alkanethiols on
the gold surface through the carboxylic acid group at the end of
the alkyl chains (FIG. 2B). Anti-GST is a specific antibody for
selective binding of GST attached to recombinant proteins, in our
case, the microtubule-nucleating fusion protein,
GST-.gamma.-tubulin. Additionally, a specific antibody that binds
.gamma.-tubulin is then recognized by a secondary antibody that has
a fluorescent tag (IgG-Cy3) and is used to quantify the extent of
the formation of the protein assembly. Strong fluorescence from a
functionalized gold surface on a SiO.sub.2 substrate coated with
the fusion protein indicates that the approach we have developed
gives a uniform coverage of the electrode (FIG. 2B).
[0089] We have also characterized the morphology of the
functionalized gold substrate by atomic force microscopy (AFM). AFM
data showed the initial localization of a .gamma.-tubulin
functionalized gold surface, and of a pure gold surface. Prior to
imaging, the pure gold surface was treated with piranha solution.
The gold substrate exhibits some roughness with feature size of
approximately 80 to 100 nm. The .gamma.-tubulin localized surface
appears to be morphologically similar to that of the gold substrate
indicating that the nucleating fusion-protein film binds the
substrate.
Example 3
MT Growth
[0090] For this study, we used tubulin (>99% pure) prepared from
bovine brain extracts and modified with covalently linked
fluorescein (Cytoskeleton Inc). The fluorescein-modified tubulin
was stored at -70.degree. C. in storage buffer (pH 6.8; 80 mM
piperazine-N, N'-bis 2-ethanesulfonic acid sequisodium salt
(PIPES), 1 mM magnesium chloride (MgCl.sub.2); 1 mM ethylene
glycol-bis(b-amino-ethyl ether) N,N,N',N'-tetra-acetic acid (EGTA)
and 1 mM guanosine 5'-triphosphate (GTP)).
[0091] In-vitro MT assembly was performed in PEM 80 buffer (80 mM
PIPES, 1 mM EGTA, 4 mM Magnesium chloride (MgCl.sub.2), using KOH
to adjust PH to 6.9) using a final concentration of tubulin at 0.25
mg/ml (2.3.times.10.sup.-6 M). Polymerization was initiated by the
addition of GTP (final concentration is 0.25 mM) in the presence of
taxol (final concentration is 10 .mu.M). Taxol reduces the
competing "depolymerization" process.
[0092] In order to test the specificity of the interaction between
MTs and the .gamma.-tubulin functionalized substrates, we conducted
experiments in which MTs were grown in the presence or absence of
the functionalized Au surfaces. In the first case, patterned
silicon substrates with functionalized Au pads were immersed into
the solution during the polymerization process. The solutions, both
with and without substrates, were transferred from an ice bath to a
heat bath at 37.degree. C. to promote polymerization for a
predetermined time. Because the MT concentration is very high in
the solution, we analyzed the MT growth dynamics in the solution by
diluting it 50 fold into PEM 80 buffer, and immediately fixing the
MTs using the same amount of solution of 3% Glutaradehyde for at
least 3 minutes. The solution containing the fixed MTs was
transferred onto a poly-L-Lysine coated slide for observation. The
microchips were pulled out after polymerization, rinsed with PBS
buffer for approximately 10 seconds, and fixed using Methanol
(-20.degree. C.) for 3 minutes. The microtubules both on the glass
slide and on the microchips were examined using immunofluorescence
microscopy. Detailed structural information was also obtained by
scanning electron microscopy (SEM). The samples were prepared by
super critical CO.sub.2 drying after fixing the MTs with
glutaradehyde (3%) followed by sputtering a thin film of gold.
[0093] Microtubules were grown in the presence of two different
gold surfaces prepared on hydrophilic oxidized silicon wafers. The
gold pads on the first sample were functionalized with the
GST-.gamma.-tubulin as a nucleation protein. The gold pads on the
second sample were not functionalized, and their immersion in a
solution of tubulin served as a control experiment. Sampling of the
solution in which the non-functionalized sample was immersed
indicated the presence of numerous MTs in suspension; however, none
are to be seen on the surface of the non-functionalized substrate.
In contrast the functionalized gold pad appeared to be covered with
MTs. To rule out direct nonspecific interaction between MTs
self-assembled in the solution and the functionalized gold
electrodes, we have compared the growth dynamics of MTs grown in
solution and of MTs that appear to cover the
.gamma.-tubulin-functionalized gold surfaces. Two series of
experiments were conducted for different growth times. In the first
series we investigated the growth dynamics of the MTs that appear
to cover the functionalized gold electrodes. The second series
consisted of a study of the growth dynamics of MTs in the absence
of functionalized substrate under the same growth conditions. Two
polymerization time periods were considered: 5 and 10 min. The
length distributions of MTs grown in the presence of a substrate
that appear to cover the gold electrodes and the length
distribution of MTs nucleated and grown in solution were measured.
We report in FIGS. 3 A and B the length distribution after 5 and 10
min of polymerization. The experiments that lasted 5 min show
trends similar to those that lasted twice as much but of course
lower values of the average MT lengths. FIGS. 3A and B show that
the functionalized gold pad has a strong influence on the growth
dynamics of MTs. The average lengths of MTs grown in solution are
approximately 0.62 and 1.11 micrometer after 5 and 10 min of
polymerization, respectively. In the presence of functionalized
microchips, the average lengths of MTs on the functionalized gold
surfaces increased significantly. Comparing the results of the
polymerization with and without functionalized microchips, the
average MT length increased from 0.62 to 1.68 micron for 5 min of
polymerization and increased from 1.11 to 3.47 micron for the
longer experiments. This result indicates that the
.gamma.-tubulin-functionalized gold surface interacts specifically
with MTs, by promoting the nucleation of MTs and their subsequent
growth. To verify that MTs growing from the functionalized gold
pads are tethered to the .gamma.-tubulin-functionalized gold
surface, we have conducted real-time observations of MT growth
under a fluorescent microscope. For this experiment we have used a
large flat functionalized gold substrate. A droplet of solution
containing fluorescein-tubulin was placed directly onto the
functionalized gold surface for MT assembly and observed using
immuno-fluorescence microscopy. By focusing through different focal
planes, MTs were found both on the gold surface and in the solution
above the surface. The MTs observed in the proximity of the
substrate are anchored by one end to the surface. The microscope is
focused on the pad surface thus the segment of the MT nearest to
the substrate is in focus. The other end of the MT is blurred and
out of focus, indicating that the MT is pointing into the solution.
By applying pressure onto the cover slip of the microscope slide,
we have induced a shear flow of the solution that drags and aligns
the pointing end of the MT in its direction. The end of the MT
closest to the substrate does not undergo any displacement showing
that the MT is indeed bound to the functionalized gold pad. MTs
nucleated and grown from a functionalized surface are shown to be
amenable to orientation by fluid flow.
[0094] Where capture of the plus end of a MT is desired, there is a
cap protein immobilized in a manner analogous to the immobilization
(surface functionalization) of the nucleation protein. When the MT
is sufficiently long, it will come in contact with and bind to the
capture protein, and the MT will then be fixed at both ends to the
solid surface.
Example 4
Characterization by Immuno-Fluorescence Microscopy
[0095] Immunofluorescence microscopy is used to check the existence
and alignment of microtubules either on a glass slide or on the
microchips. As described below, it is performed on a rectangular
poly-L-lysine coated microscope slide.
[0096] First, a small amount of microtubule dilution is transferred
to a poly-L-lysine coated microscope slide (MTs dilution: MTs stock
solution + PEMTAX) and allowed to stand for 20 minutes at room
temperature. Then methanol (-20.degree. C.) is added to the
microscope slide so that methanol covers entire surface where
microtubule dilution is; it is allowed to stand for 2-3 minutes at
-20.degree. C. Then the slide is immersed in the block solution for
20-30 minutes at room temperature. The block solution serves to
block all signals from other proteins (Block solution: PBS
buffer+0.1 wt % dried skim milk +0.1 wt % BSA). The slide is
removed from the block solution; and excess block solution is
removed from the slide. Dilution I, the primary antibody,
commercially available antibody specific for tubulin, is added to
the microscope slide. Dilution I is .beta.-tubulin antibody diluted
1:200 in block solution. It is allowed to stand for 30 minutes at
room temperature.
[0097] The slide is then immersed in the block solution for 2
minutes to wash off excess dilution I solution and shaken gently at
room temperature. The wash and shake steps are repeated twice. Then
Dilution II, Cy-3 (secondary antibody, also commercially available)
is added to the microscope slide. Dilution II is Cy-3 goat
anti-mouse: block solution diluted 1:50 in block solution. The
slide is covered with aluminum foil and allowed to stand for 30
minutes. The microscope slide is then immersed in block solution
for 2 minutes and shaken gently at room temperature; this is
repeated twice. PBS buffer is used to wash one time, for 2
minutes.
[0098] Next the poly-L-Lysine coated slide is covered with a cover
slip and observed using a fluorescence microscope, with a red color
filter and digital camera to take pictures.
[0099] The block solution is prepared as follows. The final volume
is 100 ml, with the following composition: 1 gm nonfat dry milk,
1-gram bovine albumin (BSA) in PBS buffer; it can be stored for a
maximum of 3 days. 1 gm non-fat milk and 1 gm albumin (BSA) are
mixed with PBS buffer, and then the volume is adjusted to 100 ml
with PBS buffer and mixed well. The block solution is stored at
4.degree. C.
[0100] PEM 80 buffer solution is 80 mM PIPES, 1 mM EGTA, and 4 mM
MgCl.sub.2 in H.sub.2O, with KOH (10 N stock) used to adjust the pH
of the solution to 6.9. This buffer is filter-sterilized and stored
at 4.degree. C.
Example 5
Metalization Experiments
[0101] MTs were synthesized from high purity tubulin proteins
(>99% tubulin monomers) and MTs with MAPs were obtained from low
purity MAP-rich tubulin (.about.30% MAPs). These tubulin proteins
were isolated from bovine brain (Cytoskeleton, Inc.) and stored at
-70.degree. C. in G-PEM buffer (pH 6.8). In-vitro MT assembly was
performed in a buffer containing PEM80 buffer (80 mM PIPES, 1 mM
EGTA, 4 mM MgCl.sub.2, using KOH to adjust the pH to 6.9), 10 mM of
GTP and 10 mM of taxol. By adding the specific tubulin to the
buffer, the MT stock solution was prepared. The final concentration
of tubulin in the stock solution was 1.5 mg/ml. Polymerization of
the MTs was completed after rotating the solution in an incubator
at a low speed of 15 rpm for 30 minutes at 37.degree. C.
[0102] Immunolabeling of MTs was used for fluorescence microscopy
imaging. MTs were immobilized on a cationic substrate
(poly-L-lysine coated glass) and allowed to settle for 20 to 25
minutes. The MTs were initially bathed for 30 minutes in an
anti-.beta.-tubulin solution which was the primary antibody (Sigma
Inc.). Next, the labeled MTs were contacted for 30 minutes with a
secondary antibody directed against mouse IgG with a Cy3
fluorescence tag. There were also rinse steps between and after
these stages with either a blocking solution or PBS buffer
(Phosphate-buffered saline with a pH of 7.4).
Preparation of MT Solutions at Low pH
[0103] The procedure for the testing of the stability of MTs in
acidic conditions was performed as follows. MTs were exposed to a
solution at a pH 4 for different times. A control was prepared by
diluting the MT stock solution with PEMTAX (500:1 ratio of PEM80
buffer to taxol) at pH 6.9 and immediately adding a 2%
glutaraldehyde solution (in PEM80) to the mixture. The overall
dilution of the MTs in buffer and glutaraldehyde mixture was 1:50.
Glutaraldehyde is a fixative (or setting agent) and cross-linking
agent used to stabilize the MTs. The MTs were diluted 1:50 in a
0.02 M acetic acid to 0.02 M ascorbic acid solution with pH
adjusted to 4.0 using KOH. This solution is the copper plating
solution with the copper salt omitted. The purpose of this control
was to determine if acetic acid and ascorbic acid had any adverse
effects on the MTs. After 1, 3, and 5 minutes, the glutaraldehyde
solution was introduced to the solution to arrest MT assembly and
disassembly dynamics. This procedure was carried out for MTs and
MTs stabilized with MAPs. The samples were deposited onto a
commercially coated poly-L-lysine microscope slide and allowed to
set for 30 minutes. The samples were treated with fluorescence
immuno-labeling and followed by optical characterization with an
epi-fluorescence microscope. The stability of MTs was measured in
solution of acetic acid and ascorbic acid at pH 4. After 5 minutes,
there was no significant change in the concentration or the
dimension of the MTs. Since, copper deposition initiated after 90
seconds and formed a uniform film after approximately 4 minutes,
the metalization of MTs in an acidic solution was deemed
feasible.
Copper Electroless Plating Solutions
[0104] Electroless copper plating solutions were optimized by
preliminary deposition experiments on platinum foil. The reduction
chemistry for copper metalization was optimized to generate a thin,
uniform film of copper at a physiological useful pH which could
then be applied to microtubules. One useful copper plating solution
identified was an aqueous solution (0.01 M copper sulfate, 0.02 M
acetic acid, 0.02 M ascorbic acid solution at pH 4). This type of
optimization can be employed to optimize conditions for
metalization employing different reducible metal salts, different
reducing agents and different complexants. This type of
optimization can be employed to optimize conditions for
metalization with metals other than copper, and particularly for
metalization with gold.
[0105] The plating or metalization solution was prepared by mixing
appropriate amounts of 0.1 M copper sulfate and 0.1 M acetic acid.
The pH of the ascorbic acid solution was adjusted by addition of 1
M KOH so that the addition of ascorbic acid to the copper sulfate
and acetic acid solution would yield a final pH of 4. KOH was added
to the ascorbic acid rather than the copper sulfate solution to
prevent the formation of copper oxide. Ascorbic acid was added to
the plating solution last yielding a final concentration of 0.01 M
copper sulfate, 0.02 M acetic acid and 0.02 M ascorbic acid at a pH
of 4.
Metalization of MTs
[0106] The Cu plating solution was added to the MT stock solution
in a ratio of 25:1. After time periods of 1, 2 and 4 minutes had
elapsed, a 2% glutaraldehyde solution in PEM80 was added to the
metalized MTs (a 50:1 dilution of the MTs). The glutaraldehyde
solution was added to dilute the plating solution and stop
metalization (under these conditions glutaraldehyde should not fix
or cross-link MTs). To eliminating excess salts for viewing the MTs
under FESEM, TEM, and AFM, the solution containing metalized MTs
was dialyzed by injecting it into a Slide-A-Lyzer dialysis cassette
(Pierce Biotechnology, Inc.) and submerged into a DI water bath
which was more than 200 times the volume inside the cassette for at
least 8 hours. Dialyzed metalized MTs were concentrated by
microcentrifugation for 10 minutes at 13.2 rpm. MTs were collected
and dried onto a carbon coated nickel grid (Ted Pella, Inc.).
Samples were dried for at least 12 hours before imaging. This
method can be used for optimizing the time of metalization needed
for metalization of biological macromolecules and structures other
than MTs. This method can also be used for optimizing the time of
metalization needed employing variant metalization solutions (for
other metalization components and for metalization with metals
other than copper.
[0107] Images of metalized microtubules were analyzed with several
characterization techniques including a Hitachi S-4500 Scanning
Electron Microscope and a Hitachi H8100 Transmission Electron
Microscope. Analysis and presence of the copper film on the
microtubules was confirmed using Thermo-Noran Digital
Imaging/energy-dispersive spectroscopy (EDS) capabilities of the
SEM and TEM.
[0108] The specific copper ion source in the Cu-plating chemistry
herein was a copper sulfate solution. Different source of copper
ion can be employed, e.g., copper nitrate, copper chloride, copper
acetate etc. Several reducing agents were investigated: ascorbic
acid and NADH. Ascorbic acid alone or in combination with NADH was
shown to reduce copper ions to copper. Since ascorbic acid is
sufficient in this electroless plating process, the use of NADH was
discontinued due to its high cost. Additionally, many complexants
and copper ion stabilizers were studied to alter the kinetics of
reduction of copper and control copper particle size. Acetic acid
was incorporated into the chemistry to complex copper. Copper ions
complex with 1 to 3 molecules of acetic acid. For this reason, the
molar concentration of acetic acid used in the metalization
solution was 2 times greater than the concentration of the copper
sulfate.
[0109] At pH higher (more basic) than 4.3, the formation of copper
oxide (cuprite) precipitate was observed to be greater than
metallic copper. Copper oxide formation will generally be higher at
more basic pH values. Therefore, it was determined that the best pH
for this 0.01 M copper sulfate to 0.02 M acetic acid to 0.02 M
ascorbic acid metalization solution was a value of 4. Similar
principles and routine experimentation can be employed to optimize
the pH and temperature of metalization with other copper salts and
other reducible metal salts.
Electroless Plating and Characterization of Metalized MTs
[0110] MTs metalized for 1 minute employing the copper metalization
solution described above were observed by analysis of TEM
micrographs collected employing standard techniques to have uniform
diameters that ranged from 10 to 18 nm as shown in FIG. 4. At
higher magnification, TEM micrographs showed dark regions of the
metalized MT (FIG. 5). Analysis of these TEM micrographs indicates
that at shorter times metalization with copper is occurring on the
inside of the MT (see FIG. 1 for an illustration of the inner
surface of the MD, rather than or on the outside of the MT followed
by collapse of the metalized MT to give the small diameter wires.
The high resolution images consistently show regions along the
nanowire where continuous lattice fringes occupy the entire
diameter of the wire. In FIG. 5 lattice fringes can be observed
which indicate crystalline copper extends over the width of the
entire diameter of the wire and extends more than 60 nm in length.
If the small diameter metalized MT had be formed via collapse of
the MT walls it would be expected that there would be more evidence
in the TEM of voids or spaces between the two copper walls.
[0111] The structures of MTs metalized for 2 minutes were analyzed
using SEM (not shown). The dimensions of the metalized MTs were
found (by TEM) to have diameters ranging from 10-17 nm. The
metalized MTS formed also exhibit uniform metal coating
compared.
[0112] MTs metalized for 4 minutes were observed by analysis of TEM
micrograph collected employing standard techniques to have
non-uniform diameters that ranged from 13 to 32 nm. Along the
length of one MT, the diameter varied as shown in FIG. 6. EDS was
used to confirm that the composition of the coating on the MT was
copper. This is supported by the fact that there were also lattice
fringes along the microtubules indicating portions of crystalline
material.
[0113] It is common for metallic ions to diffuse through the porous
membrane of the MT and adsorb on the interior wall of the MT. The
reduction of the copper ions at the interior wall could be a result
of the oxidation of certain amino acids exposed on that wall or the
oxidation of ascorbic acid. Once metal nuclei are formed, they can
then catalyze metalization of the inside hollow tube of the MT.
Histidine which functions as a ligand towards transition metals is
known to have available binding sites on the inner surface of the
MT and may be the substance responsible for the binding of copper
ions. The presence of the dark copper particles in the TEM images
of the MTs metalized for 1 minute is also of interest. There may be
a periodicity of occurrence of copper particles which may
correspond with a specific binding site. The contrast of these
particles is very similar and indicates that their orientation is
the same or very close to being the same. The distance between
these two particles is about 150 nm. The spacing between an alpha
and beta tubulin is known to be 8 nm, and a sequence of the MTs
repeats itself after 3 or 5 helices are formed (three-start and
five-start helices). It is unclear at this time what the relevance
the periodicity of copper particles is.
Evidence for Copper Deposition on Inside of MT
[0114] The diameters of the copper wires produced by the
metalization of MTs indicate that the inside walls of the MT is
being metalized, simply because of the dimensions observed. From
the TEM micrographs obtained from the samples of MTs metalized for
1 to 4 minutes, the diameters of the copper wires were measured and
recorded. For each sample, the diameters of 5 different MTs were
measured. The diameters were measured approximately every 150 nm
along the length of the MT and included regions of large and small
diameters. As mentioned before, there were large copper particles
that were attached to the ends of some MTs. In this case, the MT
diameter was measured up to the copper particle and usually had a
large diameter value. It should be noted that no preconceived
criterion was made in the TEM imaging of the metalized MTs or the
measurement of the copper wire diameters.
[0115] The average diameters of the 5 nanowires produced from the
metalization of MTs after 1 minute, ranged from 11.5 to 21.4 nm.
The overall average of the 5 MTs was determined to be 15.2 nm with
a standard deviation of 4.7. The same calculations for the
nanowires produced after 2 minutes, were an overall average of 16.8
nm and a standard deviation of 3.0. In the data for metalization
for 4 minutes, the overall average and the standard deviation were
calculated to be 23.9 nm and 6.1, respectively. The latter average
is less than the outside diameter of the uncoated MTs (25 nm),
suggesting that the inside of the MTs is indeed metalized.
[0116] The values obtained for the overall averages were plotted
vs. their respective metalization times. The graph is shown in 7.
The copper deposition rate after 1 minute was calculated to be 15.2
nm/min. This rate is similar to that observed for copper deposition
on a gold electrode determined by QCM using the same metalization
conditions as used for metalization of MTs. As seen in FIG. 7, the
copper deposition rate drops drastically from 1 to 2 minutes and
becomes steady from 2 to 4 minutes. The copper deposition rate
decreases rapidly after 1 minute, when the diameter of the copper
wire is approximately 15 nm, This suggests that copper deposition
is slowed because the tubulin wall acts as an obstacle for further
copper deposition.
[0117] In work by Kirsch et al., MTs were metalized with nickel.
During the initial activation of MTs with Pd.sup.2+ ions it was
proposed that the amino acids cysteine, histidine and tryptophan
were possible ligands for the Pd ions. Once the Pd ions were
adsorbed onto the MT surface, cysteine was responsible for reducing
the Pd ions to metallic Pd. Even though Pd ions were expected to
penetrate the porous membrane of the MT, no metalization was
observed in these experiments on the inner channel of the MT (the
interior wall of the MD. This was believed to result because the
cysteines were expected to only be active on the outer surface of
the MT. The result was the metalization of only the outside of the
MT. It was also postulated that the metalization of the outside of
the MT was too fast to allow the Pd ions to penetrate the MT in the
first place [R. Kirsch, M. Mertig, W. Pompe, R. Wahl, G. Sadowski,
K. J. Bohm, and E. Unger, Thin Solid Films 1997, 305, 248.]
[0118] Three amino acid residues are of particular interest for
binding to copper ions: histidine, cysteine and tryptophan. The
location of these amino acids on the MT structure was considered.
There are about 5 histidines/dimer on the inside surface of the MT.
Histidine, particularly the nitrogen atom of the imidazole group in
histidine, is known to have a high affinity for copper (II) ions.
While copper also has a high affinity for the sulfhydryl group of
cysteine residues, the occurrence of a free cysteine residue is
rare. The expected higher surface density of histidine residues on
the inner surface of the MT may be the reason for the preferred
metalization from that surface. Based on the experimental results,
a mechanism is proposed for the metalization of the inside of the
MTs. First, the Cu (II) ions and copper-acetic acid complex diffuse
through the porous wall of the MT. In the interior chamber of the
MT, the copper ions and copper-acetate ions bind to the imidazole
group of histidine residues and copper-acetate is converted to a
copper-imidazole complex. Next, ascorbic acid penetrates the MT
wall and reduces the copper ions to metallic copper nuclei. These
copper nuclei catalyze further copper metalization on the inside of
the MT.
[0119] When a Markush group or other grouping is used herein, all
individual members of the group and all combinations and possible
subcombinations of the group are intended to be individually
included in the disclosure. Every formulation or combination of
components described or exemplified herein can be used to practice
the invention, unless otherwise stated. One of ordinary skill in
the art will appreciate that methods, device elements, and
materials other than those specifically exemplified can be employed
in the practice of the invention without resort to undue
experimentation. All art-known functional equivalents, of any such
methods, device elements, and materials are intended to be included
in this invention. Whenever a range is given in the specification,
for example, a temperature range, a frequency range, a time range,
or a composition range, all intermediate ranges and all subranges,
as well as, all individual values included in the ranges given are
intended to be included in the disclosure. Any one or more
individual members of a range or group disclosed herein can be
excluded from a claim of this invention. The invention
illustratively described herein suitably may be practiced in the
absence of any element or elements, limitation or limitations which
is not specifically disclosed herein.
[0120] A number of specific groups have been described herein. It
is intended that all combinations and subcombinations of the
specific groups that have been described are individually included
in this disclosure. When a compound is described herein such that a
particular isomer, enantiomer or diastereomer of the compound is
not specified, for example, in a formula or in a chemical name,
that description is intended to include each isomers and enantiomer
of the compound described individual or in any combination.
Additionally, unless otherwise specified, all isotopic variants of
compounds disclosed herein are intended to be encompassed by the
disclosure. For example, it will be understood that any one or more
hydrogens in a molecule disclosed can be replaced with deuterium or
tritium. Isotopic variants of a molecule are generally useful as
standards in assays for the molecule and in chemical and biological
research related to the molecule or its use. Isotopic variants may
also be useful in diagnostic assays and in therapeutics. Methods
for making such isotopic variants are known in the art. Specific
names of compounds are intended to be exemplary, as it is known
that one of ordinary skill in the art can name the same compounds
differently.
[0121] Many of the molecules disclosed herein contain one or more
ionizable groups [groups from which a proton can be removed (e.g.,
--COOH) or added (e.g., amines) or which can be quaternized (e.g.,
amines)]. All possible ionic forms of such molecules and salts
thereof are intended to be included individually in the disclosure
herein. With regard to salts of the compounds herein, one of
ordinary skill in the art can select from among a wide variety of
available counterions those that are appropriate for preparation of
salts of this invention for a given application. In specific
applications, the selection of a given anion or cation for
preparation of a salt may result in increased or decreased
solubility of that salt.
[0122] All patents and publications mentioned in the specification
are indicative of the levels of skill of those skilled in the art
to which the invention pertains. References cited herein are
incorporated by reference herein in their entirity to indicate the
state of the art as of their publication or filing date and it is
intended that this information can be employed herein, if needed,
to exclude specific embodiments that are in the prior art. For
example, when composition of matter are claimed, it should be
understood that compounds known and available in the art prior to
Applicant's invention, including compounds for which an enabling
disclosure is provided in the references cited herein, are not
intended to be included in the composition of matter claims
herein.
[0123] As used herein, "comprising" is synonymous with "including,"
"containing," or "characterized by," and is inclusive or open-ended
and does not exclude additional, unrecited elements or method
steps. As used herein, "consisting of" excludes any element, step,
or ingredient not specified in the claim element. As used herein,
"consisting essentially of" does not exclude materials or steps
that do not materially affect the basic and novel characteristics
of the claim. Any recitation herein of the term "comprising",
particularly in a description of components of a composition or in
a description of elements of a device, can be exchanged with
"consisting essentially of" or "consisting of".
[0124] Although the description herein contains many specificities,
these should not be construed as limiting the scope of the
invention, but as merely providing illustrations of some of the
embodiments of the invention. Each reference cited herein is hereby
incorporated by reference in its entirety. However, if any
inconsistency arises between a cited reference and the present
disclosure, the present disclosure takes precedent. Some references
provided herein are incorporated by reference to provide details
concerning the state of the art prior to the filing of this
application, other references may be cited to provide additional or
alternative sources for materials, device elements, additional or
alternative materials, additional or alternative methods of
analysis or additional or alternative applications of the methods
and materials of the invention.
Sequence CWU 1
1
9127DNAHomo sapiens 1ggaattctgc cgagggaaat catcacc 27228DNAHomo
sapiens 2aagcttcact gctcctgggt gccccagg 28324DNAHomo sapiens
3accacggtcc tggatgtcat gagg 24424DNAHomo sapiens 4tctcggcctg
tggacaccat cacg 245941DNAHomo sapiens 5ggaattggaa ttctgccgag
ggaaatcatc accctacagt tgggccagtg cggcaatcag 60attgggttcg agttctggaa
acagctgtgc gccgagcatg gtatcagccc cgagggcatc 120gtggaggagt
tcgccaccga gggcactgac cgcaaggacg tctttttcta ccaggcagac
180gatgagcact acatcccccg ggccgtgctg ctggacttgg aaccccgggt
gatccactcc 240atcctcaact ccccctatgc caagctctac aacccagaga
acatctacct gtcggaacat 300ggaggaggag ctggcaacaa ctgggccagc
ggattctccc agggagaaaa gatccatgag 360gacatttttg acatcataga
ccgggaggca gatggtagtg acagtctaga gggctttgtg 420ctgtgtcact
ccattgctgg ggggacaggc tctggactgg gttcctacct cttagaacgg
480ctgaatgaca ggtatcctaa gaagctggtg cagacatact cagtgtttcc
caaccaggac 540gagatgagcg atgtggtggt ccagccttac aattcactcc
tcacactcaa gaggctgacg 600cagaatgcag actgtgtggt ggtgctggac
aacacagccc tgaaccggat tgccacagac 660cgcctgcaca tccagaaccc
atccttctcc cagatcaacc agctggtgtc taccatcatg 720tcagccagca
ccaccaccct gcgctaccct ggctacatga acaatgacct catcggcctc
780atcgcctcgc tcattcccac cccacggctc cacttcctca tgaccggcta
cacccctctc 840actacggacc agtcagtggc cagcgtgagg aagaccacgg
tcctggatgt catgaggcgg 900ctgctgcagc ccaagaacgt gatggtgtcc
acaggccgag a 9416500DNAHomo sapiens 6accacggtcc tggatgtcat
gaggcggctg ctgcagccca agaacgtgat ggtgtccaca 60ggccgagacc gccagaccaa
ccactgctac atcgccatcc tcaacatcat ccagggagag 120gtggacccca
cccaggtcca caagagcttg cagaggatcc gggaacgcaa gttggccaac
180ttcatcccgt ggggccccgc cagcatccag gtggccctgt cgaggaagtc
tccctacctg 240ccctcggccc accgggtcag cgggctcatg atggccaacc
acaccagcat ctcctcgctc 300ttcgagagaa cctgtcgcca gtatgacaag
ctgcgtaagc gggaggcctt cctggagcag 360ttccgcaagg aggacatgtt
caaggacaac tttgatgaga tggacacatc cagggagatt 420gtgcagcagc
tcatcgatga gtaccatgcg gccacacggc cagactacat ctcctggggc
480acccaggagc agtgaagctt 50071367DNAHomo sapiens 7ggaattctgc
cgagggaaat catcacccta cagttgggcc agtgcggcaa tcagattggg 60ttcgagttct
ggaaacagct gtgcgccgag catggtatca gccccgaggg catcgtggag
120gagttcgcca ccgagggcac tgaccgcaag gacgtctttt tctaccaggc
agacgatgag 180cactacatcc cccgggccgt gctgctggac ttggaacccc
gggtgatcca ctccatcctc 240aactccccct atgccaagct ctacaaccca
gagaacatct acctgtcgga acatggagga 300ggagctggca acaactgggc
cagcggattc tcccagggag aaaagatcca tgaggacatt 360tttgacatca
tagaccggga ggcagatggt agtgacagtc tagagggctt tgtgctgtgt
420cactccattg ctggggggac aggctctgga ctgggttcct acctcttaga
acggctgaat 480gacaggtatc ctaagaagct ggtgcagaca tactcagtgt
ttcccaacca ggacgagatg 540agcgatgtgg tggtccagcc ttacaattca
ctcctcacac tcaagaggct gacgcagaat 600gcagactgtg tggtggtgct
ggacaacaca gccctgaacc ggattgccac agaccgcctg 660cacatccaga
acccatcctt ctcccagatc aaccagctgg tgtctaccat catgtcagcc
720agcaccacca ccctgcgcta ccctggctac atgaacaatg acctcatcgg
cctcatcgcc 780tcgctcattc ccaccccacg gctccacttc ctcatgaccg
gctacacccc tctcactacg 840gaccagtcag tggccagcgt gaggaagacc
acggtcctgg atgtcatgag gcggctgctg 900cagcccaaga acgtgatggt
gtccacaggc cgagaccgcc agaccaacca ctgctacatc 960gccatcctca
acatcatcca gggagaggtg gaccccaccc aggtccacaa gagcttgcag
1020aggatccggg aacgcaagtt ggccaacttc atcccgtggg gccccgccag
catccaggtg 1080gccctgtcga ggaagtctcc ctacctgccc tcggcccacc
gggtcagcgg gctcatgatg 1140gccaaccaca ccagcatctc ctcgctcttc
gagagaacct gtcgccagta tgacaagctg 1200cgtaagcggg aggccttcct
ggagcagttc cgcaaggagg acatgttcaa ggacaacttt 1260gatgagatgg
acacatccag ggagattgtg cagcagctca tcgatgagta ccatgcggcc
1320acacggccag actacatctc ctggggcacc caggagcagt gaagctt
136786333DNAArtificial SequencepGEXTUBG RECOMBINANT HUMAN
GAMMA-TUBULIN CLONED INTO EXPRESSION VECTOR pGEX-KG 8acgttatcga
ctgcacggtg caccaatgct tctggcgtca ggcagccatc ggaagctgtg 60gtatggctgt
gcaggtcgta aatcactgca taattcgtgt cgctcaaggc gcactcccgt
120tctggataat gttttttgcg ccgacatcat aacggttctg gcaaatattc
tgaaatgagc 180tgttgacaat taatcatcgg ctcgtataat gtgtggaatt
gtgagcggat aacaatttca 240cacaggaaac agtattcatg tcccctatac
taggttattg gaaaattaag ggccttgtgc 300aacccactcg acttcttttg
gaatatcttg aagaaaaata tgaagagcat ttgtatgagc 360gcgatgaagg
tgataaatgg cgaaacaaaa agtttgaatt gggtttggag tttcccaatc
420ttccttatta tattgatggt gatgttaaat taacacagtc tatggccatc
atacgttata 480tagctgacaa gcacaacatg ttgggtggtt gtccaaaaga
gcgtgcagag atttcaatgc 540ttgaaggagc ggttttggat attagatacg
gtgtttcgag aattgcatat agtaaagact 600ttgaaactct caaagttgat
tttcttagca agctacctga aatgctgaaa atgttcgaag 660atcgtttatg
tcataaaaca tatttaaatg gtgatcatgt aacccatcct gacttcatgt
720tgtatgacgc tcttgatgtt gttttataca tggacccaat gtgcctggat
gcgttcccaa 780aattagtttg ttttaaaaaa cgtattgaag ctatcccaca
aattgataag tacttgaaat 840ccagcaagta tatagcatgg cctttgcagg
gctggcaagc cacgtttggt ggtggcgacc 900atcctccaaa atcggatctg
gttccgcgtg gatccccggg aatttccggt ggtggtggtg 960gaattctgcc
gagggaaatc atcaccctac agttgggcca gtgcggcaat cagattgggt
1020tcgagttctg gaaacagctg tgcgccgagc atggtatcag ccccgagggc
atcgtggagg 1080agttcgccac cgagggcact gaccgcaagg acgtcttttt
ctaccaggca gacgatgagc 1140actacatccc ccgggccgtg ctgctggact
tggaaccccg ggtgatccac tccatcctca 1200actcccccta tgccaagctc
tacaacccag agaacatcta cctgtcggaa catggaggag 1260gagctggcaa
caactgggcc agcggattct cccagggaga aaagatccat gaggacattt
1320ttgacatcat agaccgggag gcagatggta gtgacagtct agagggcttt
gtgctgtgtc 1380actccattgc tggggggaca ggctctggac tgggttccta
cctcttagaa cggctgaatg 1440acaggtatcc taagaagctg gtgcagacat
actcagtgtt tcccaaccag gacgagatga 1500gcgatgtggt ggtccagcct
tacaattcac tcctcacact caagaggctg acgcagaatg 1560cagactgtgt
ggtggtgctg gacaacacag ccctgaaccg gattgccaca gaccgcctgc
1620acatccagaa cccatccttc tcccagatca accagctggt gtctaccatc
atgtcagcca 1680gcaccaccac cctgcgctac cctggctaca tgaacaatga
cctcatcggc ctcatcgcct 1740cgctcattcc caccccacgg ctccacttcc
tcatgaccgg ctacacccct ctcactacgg 1800accagtcagt ggccagcgtg
aggaagacca cggtcctgga tgtcatgagg cggctgctgc 1860agcccaagaa
cgtgatggtg tccacaggcc gagaccgcca gaccaaccac tgctacatcg
1920ccatcctcaa catcatccag ggagaggtgg accccaccca ggtccacaag
agcttgcaga 1980ggatccggga acgcaagttg gccaacttca tcccgtgggg
ccccgccagc atccaggtgg 2040ccctgtcgag gaagtctccc tacctgccct
cggcccaccg ggtcagcggg ctcatgatgg 2100ccaaccacac cagcatctcc
tcgctcttcg agagaacctg tcgccagtat gacaagctgc 2160gtaagcggga
ggccttcctg gagcagttcc gcaaggagga catgttcaag gacaactttg
2220atgagatgga cacatccagg gagattgtgc agcagctcat cgatgagtac
catgcggcca 2280cacggccaga ctacatctcc tggggcaccc aggagcagtg
aagcttattc atcgtgactg 2340actgacgatc tgcctcgcgc gtttcggtga
tgacggtgaa aacctctgac acatgcagct 2400cccggagacg gtcacagctt
gtctgtaagc ggatgccggg agcagacaag cccgtcaggg 2460cgcgtcagcg
ggtgttggcg ggtgtcgggg cgcagccatg acccagtcac gtagcgatag
2520cggagtgtat aattcttgaa gacgaaaggg cctcgtgata cgcctatttt
tataggttaa 2580tgtcatgata ataatggttt cttagacgtc aggtggcact
tttcggggaa atgtgcgcgg 2640aacccctatt tgtttatttt tctaaataca
ttcaaatatg tatccgctca tgagacaata 2700accctgataa atgcttcaat
aatattgaaa aaggaagagt atgagtattc aacatttccg 2760tgtcgccctt
attccctttt ttgcggcatt ttgccttcct gtttttgctc acccagaaac
2820gctggtgaaa gtaaaagatg ctgaagatca gttgggtgca cgagtgggtt
acatcgaact 2880ggatctcaac agcggtaaga tccttgagag ttttcgcccc
gaagaacgtt ttccaatgat 2940gagcactttt aaagttctgc tatgtggcgc
ggtattatcc cgtgttgacg ccgggcaaga 3000gcaactcggt cgccgcatac
actattctca gaatgacttg gttgagtact caccagtcac 3060agaaaagcat
cttacggatg gcatgacagt aagagaatta tgcagtgctg ccataaccat
3120gagtgataac actgcggcca acttacttct gacaacgatc ggaggaccga
aggagctaac 3180cgcttttttg cacaacatgg gggatcatgt aactcgcctt
gatcgttggg aaccggagct 3240gaatgaagcc ataccaaacg acgagcgtga
caccacgatg cctgcagcaa tggcaacaac 3300gttgcgcaaa ctattaactg
gcgaactact tactctagct tcccggcaac aattaataga 3360ctggatggag
gcggataaag ttgcaggacc acttctgcgc tcggcccttc cggctggctg
3420gtttattgct gataaatctg gagccggtga gcgtgggtct cgcggtatca
ttgcagcact 3480ggggccagat ggtaagccct cccgtatcgt agttatctac
acgacgggga gtcaggcaac 3540tatggatgaa cgaaatagac agatcgctga
gataggtgcc tcactgatta agcattggta 3600actgtcagac caagtttact
catatatact ttagattgat ttaaaacttc atttttaatt 3660taaaaggatc
taggtgaaga tcctttttga taatctcatg accaaaatcc cttaacgtga
3720gttttcgttc cactgagcgt cagaccccgt agaaaagatc aaaggatctt
cttgagatcc 3780tttttttctg cgcgtaatct gctgcttgca aacaaaaaaa
ccaccgctac cagcggtggt 3840ttgtttgccg gatcaagagc taccaactct
ttttccgaag gtaactggct tcagcagagc 3900gcagatacca aatactgtcc
ttctagtgta gccgtagtta ggccaccact tcaagaactc 3960tgtagcaccg
cctacatacc tcgctctgct aatcctgtta ccagtggctg ctgccagtgg
4020cgataagtcg tgtcttaccg ggttggactc aagacgatag ttaccggata
aggcgcagcg 4080gtcgggctga acggggggtt cgtgcacaca gcccagcttg
gagcgaacga cctacaccga 4140actgagatac ctacagcgtg agctatgaga
aagcgccacg cttcccgaag ggagaaaggc 4200ggacaggtat ccggtaagcg
gcagggtcgg aacaggagag cgcacgaggg agcttccagg 4260gggaaacgcc
tggtatcttt atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg
4320atttttgtga tgctcgtcag gggggcggag cctatggaaa aacgccagca
acgcggcctt 4380tttacggttc ctggcctttt gctggccttt tgctcacatg
ttctttcctg cgttatcccc 4440tgattctgtg gataaccgta ttaccgcctt
tgagtgagct gataccgctc gccgcagccg 4500aacgaccgag cgcagcgagt
cagtgagcga ggaagcggaa gagcgcctga tgcggtattt 4560tctccttacg
catctgtgcg gtatttcaca ccgcataaat tccgacacca tcgaatggtg
4620caaaaccttt cgcggtatgg catgatagcg cccggaagag agtcaattca
gggtggtgaa 4680tgtgaaacca gtaacgttat acgatgtcgc agagtatgcc
ggtgtctctt atcagaccgt 4740ttcccgcgtg gtgaaccagg ccagccacgt
ttctgcgaaa acgcgggaaa aagtggaagc 4800ggcgatggcg gagctgaatt
acattcccaa ccgcgtggca caacaactgg cgggcaaaca 4860gtcgttgctg
attggcgttg ccacctccag tctggccctg cacgcgccgt cgcaaattgt
4920cgcggcgatt aaatctcgcg ccgatcaact gggtgccagc gtggtggtgt
cgatggtaga 4980acgaagcggc gtcgaagcct gtaaagcggc ggtgcacaat
cttctcgcgc aacgcgtcag 5040tgggctgatc attaactatc cgctggatga
ccaggatgcc attgctgtgg aagctgcctg 5100cactaatgtt ccggcgttat
ttcttgatgt ctctgaccag acacccatca acagtattat 5160tttctcccat
gaagacggta cgcgactggg cgtggagcat ctggtcgcat tgggtcacca
5220gcaaatcgcg ctgttagcgg gcccattaag ttctgtctcg gcgcgtctgc
gtctggctgg 5280ctggcataaa tatctcactc gcaatcaaat tcagccgata
gcggaacggg aaggcgactg 5340gagtgccatg tccggttttc aacaaaccat
gcaaatgctg aatgagggca tcgttcccac 5400tgcgatgctg gttgccaacg
atcagatggc gctgggcgca atgcgcgcca ttaccgagtc 5460cgggctgcgc
gttggtgcgg atatctcggt agtgggatac gacgataccg aagacagctc
5520atgttatatc ccgccgttaa ccaccatcaa acaggatttt cgcctgctgg
ggcaaaccag 5580cgtggaccgc ttgctgcaac tctctcaggg ccaggcggtg
aagggcaatc agctgttgcc 5640cgtctcactg gtgaaaagaa aaaccaccct
ggcgcccaat acgcaaaccg cctctccccg 5700cgcgttggcc gattcattaa
tgcagctggc acgacaggtt tcccgactgg aaagcgggca 5760gtgagcgcaa
cgcaattaat gtgagttagc tcactcatta ggcaccccag gctttacact
5820ttatgcttcc ggctcgtatg ttgtgtggaa ttgtgagcgg ataacaattt
cacacaggaa 5880acagctatga ccatgattac ggattcactg gccgtcgttt
tacaacgtcg tgactgggaa 5940aaccctggcg ttacccaact taatcgcctt
gcagcacatc cccctttcgc cagctggcgt 6000aatagcgaag aggcccgcac
cgatcgccct tcccaacagt tgcgcagcct gaatggcgaa 6060tggcgctttg
cctggtttcc ggcaccagaa gcggtgccgg aaagctggct ggagtgcgat
6120cttcctgagg ccgatactgt cgtcgtcccc tcaaactggc agatgcacgg
ttacgatgcg 6180cccatctaca ccaacgtaac ctatcccatt acggtcaatc
cgccgtttgt tcccacggag 6240aatccgacgg gttgttactc gctcacattt
aatgttgatg aaagctggct acaggaaggc 6300cagacgcgaa ttatttttga
tggcgttgga att 633391392DNAArtificial SequenceSYNTHETIC SEQUENCE
ENCODING HIS-TAGGED HUMNA GAMMA-TUBULIN 9atgccgaggg aaatcatcac
cctacagttg ggccagtgcg gcaatcagat tgggttcgag 60ttctggaaac agctgtgcgc
cgagcatggt atcagccccg agggcatcgt ggaggagttc 120gccaccgagg
gcactgaccg caaggacgtc tttttctacc aggcagacga tgagcactac
180atcccccggg ccgtgctgct ggacttggaa ccccgggtga tccactccat
cctcaactcc 240ccctatgcca agctctacaa cccagagaac atctacctgt
cggaacatgg aggaggagct 300ggcaacaact gggccagcgg attctcccag
ggagaaaaga tccatgagga catttttgac 360atcatagacc gggaggcaga
tggtagtgac agtctagagg gctttgtgct gtgtcactcc 420attgctgggg
ggacaggctc tggactgggt tcctacctct tagaacggct gaatgacagg
480tatcctaaga agctggtgca gacatactca gtgtttccca accaggacga
gatgagcgat 540gtggtggtcc agccttacaa ttcactcctc acactcaaga
ggctgacgca gaatgcagac 600tgtgtggtgg tgctggacaa cacagccctg
aaccggattg ccacagaccg cctgcacatc 660cagaacccat ccttctccca
gatcaaccag ctggtgtcta ccatcatgtc agccagcacc 720accaccctgc
gctaccctgg ctacatgaac aatgacctca tcggcctcat cgcctcgctc
780attcccaccc cacggctcca cttcctcatg accggctaca cccctctcac
tacggaccag 840tcagtggcca gcgtgaggaa gaccacggtc ctggatgtca
tgaggcggct gctgcagccc 900aagaacgtga tggtgtccac aggccgagac
cgccagacca accactgcta catcgccatc 960ctcaacatca tccagggaga
ggtggacccc acccaggtcc acaagagctt gcagaggatc 1020cgggaacgga
agttggccaa cttcatcccg tggggccccg ccagcatcca ggtggccctg
1080tcgaggaagt ctccctacct gccctcggcc caccgggtca gcgggctcat
gatggccaac 1140cacaccagca tctcctcgct cttcgagaga acctgtcgcc
agtatgacaa gctgcgtaag 1200cgggaggcct tcctggagca gttccgcaag
gaggacatgt tcaaggacaa ctttgatgag 1260atggacacat ccagggagat
tgtgcagcag ctcatcgatg agtaccatgc ggccacacgg 1320ccagactaca
tctcctgggg cacccaggag cagggaggag gaggaggact cgagcaccac
1380caccaccacc ac 1392
* * * * *