Method For Predicting The Athletic Performance Potential Of A Subject

Abstract

A method for predicting the athletic performance potential of a subject comprising the step of assaying a biological sample from a subject for a genetic variant in linkage disequilibrium with MSTN-66493737 (T/C) SNP. The invention also provides an assay for determining the athletic performance potential of a subject.

Description

[0001] The invention relates to a method for predicting the athletic performance potential of a subject.

INTRODUCTION

[0002] Myostatin gene (MSTN) variants have previously been shown to contribute to muscle hypertrophy in a range of mammalian species (Grobet et al. 1997; McPherron et al. 1997; McPherron & Lee 1997; Schuelke et al. 2004; Mosher et al. 2007). In particular, whippet racing dogs that are heterozygote for a MSTN polymorphism have significantly greater racing ability than both homozygote wild-type dogs and homozygotes for the mutation that have an increased musculature that is detrimental to performance (Mosher et al. 2007). Horses, in particular Thoroughbreds, have a very high muscle mass to body weight ratio (55%) compared to other mammalian species (30-40%) (Gunn 1987) and the Thoroughbred genome contains evidence for selection for muscle strength phenotypes (Gu et al. 2009).

[0003] The Thoroughbred horse industry is a multi-billion dollar international enterprise engaged in the breeding, training and racing of elite racehorses. A Thoroughbred is a registered racehorse that can trace its ancestry to one of three foundation stallions and the approximately 30 foundation mares entered in The General Studbook, 1791 (Weatherby and Sons 1791). During the 300-year development of the breed racehorses have been intensely selected for athletic phenotypes that enable superior racecourse performance in particular types of races. There are two types of Thoroughbred race: National Hunt races are run over hurdles or steeplechase fences over distances of up to 4.5 miles (7,200 m), while Flat races have no obstacles and are run over distances ranging from five furlongs (5/8 mile or 1,006 m) to 20 furlongs (4,024 m). The International Federation of Horseracing Authorities recognizes five race distance categories: Sprint (5-6.5 f, <1,300 m), Mile (6.51-9.49 f, 1,301-1,900 m), Intermediate (9.5-10.5 f, 1,901-2,112 m), Long (10.51-13.5 f, 2,114-2,716 m) and Extended (>13.51 f, >2,717 m) races (International Federation of Horseracing Authorities Classifications, www.horseracingintfed.com) [Note: 1 furlong=1/8 mile=201.2 meters] and horses that compete in these races are generally termed `sprinters` (<6 furlongs), `middle distance` or `milers` (7-8 f) or `stayers` (>8 f). Similar to their human counterparts, sprint racing Thoroughbreds are generally more compact and muscular than horses suited to longer distance races.

[0004] A range of approaches has been taken to investigate measurable associations with athletic performance phenotypes in Thoroughbred racehorses including assessment of heart size (Young et al 2005), muscle fibre type (Rivero et al. 2007) musculoskeletal conformation (Love et al 2006), speed at maximum heart rate (Gramkow & Evans 2006), haematological (Revington 1983) and other physiological variables (Harkins et al 1993).

[0005] WO2006003436 describes the association between performance and gene variants encoded by the mitochondrial genome. However, mitochondrial DNA (mtDNA) haplotypes are inherited strictly from the maternal parent and therefore relate solely to female contributions to the phenotype. As there is a limited number of mtDNA haplotypes (n=17) in the Thoroughbred population and just 10 females contribute to 74% of present maternal lineages (Cunningham et al 2002) it is unlikely that these haplotype variants have a significant effect as the favourable haplotypes would become `fixed` quickly in a population where there is targeted selection for performance; in addition, the effective population size (of mtDNA variants) is one third of nuclear-encoded variants (Ballard and Dean 2001, Blier et al 2001, Das 2006, Meiklejohn et al 2007). Also, mtDNA haplotypes can be directly inferred from pedigree information.

[0006] It is an object of the invention to provide a method for predicting the athletic performance potential of a subject.

STATEMENTS OF INVENTION

[0007] The invention provides a method for predicting the athletic performance potential of a subject comprising the step of: [0008] assaying a biological sample from a subject for a genetic variant in linkage disequilibrium with MSTN-66493737 (T/C) SNP.

[0009] The subject may be an equine. The genetic variant may be located in equine chromosome 18. The genetic variant may be located in the MSTN gene region. The genetic variant may be located in the MSTN gene flanking region. The genetic variant may be chosen from one or more of: BIEC2-417495 SNP, BIEC2-417372 SNP, MSTN Ins227 bp mutation, MSTN 3'UTR SNP1, MSTN 3'UTR SNP2, MSTN 3'UTR SNP3, or MSTN 3'UTR SNP4. The genetic variant may be BIEC2417495 SNP. The presence of a C allele may be indicative of elite athletic performance. The presence of a heterozygous CT genotype may be indicative of elite athletic performance. The presence of a homozygous CC genotype may be indicative of elite athletic performance.

[0010] The elite athletic performance may be elite sprinting performance.

[0011] The biological sample of the subject may be chosen from one or more of: blood, saliva, skeletal muscle, hair, semen, bone marrow, soft tissue, internal organ biopsy sample or skin.

[0012] The invention also provides an assay for determining the athletic performance potential of a subject comprising the steps of: [0013] obtaining a biological sample from the subject; [0014] extracting or releasing DNA from the biological sample; and [0015] identifying a genetic variant in linkage disequilibrium with MSTN-66493737 (T/C) SNP in the biological sample [0016] wherein the athletic performance potential of the subject is associated with the genetic variant and/or the MSTN-66493737 (T/C) SNP.

[0017] The DNA may be genomic DNA.

[0018] The assay may further comprise the step of [0019] amplifying a target sequence in the extracted or released DNA [0020] prior to the step of identifying a genetic variant in linkage disequilibrium with MSTN-66493737 (T/C) SNP

[0021] The subject may be an equine. The genetic variant may be located in equine chromosome 18. The genetic variant may be located in the MSTN gene region. The genetic variant may be located in the MSTN gene flanking region. The genetic variant may be chosen from one or more of: BIEC2-417495 SNP, BIEC2-417372 SNP, MSTN Ins227 bp mutation, MSTN 3'UTR SNP1, MSTN 3'UTR SNP2, MSTN 3'UTR SNP3, or MSTN 3'UTR SNP4.

[0022] The genetic variant may be BIEC2417495 SNP. The presence of a C allele may be indicative of elite athletic performance. The presence of a heterozygous CT genotype may be indicative of elite athletic performance. The presence of a homozygous CC genotype may be indicative of elite athletic performance.

[0023] The elite athletic performance may be elite sprinting performance.

[0024] The biological sample of the subject may be chosen from one or more of blood, saliva, skeletal muscle, hair, semen, bone marrow, soft tissue, internal organ biopsy sample or skin.

[0025] The invention further provides a method for predicting the athletic performance potential of a subject comprising the step of: [0026] assaying a biological sample from a subject for the presence of (i) a MSTN-66493737 (T/C) SNP and (ii) a genetic variant in linkage disequilibrium with the MSTN-66493737 (T/C) SNP.

[0027] The subject may be an equine. The genetic variant may be located in equine chromosome 18. The genetic variant may be located in the MSTN gene region. The genetic variant may be located in the MSTN gene flanking region. The genetic variant may be chosen from one or more of: BIEC2-417495 SNP, BIEC2-417372 SNP, MSTN Ins227 bp mutation, MSTN 3'UTR SNP1, MSTN 3'UTR SNP2, MSTN 3'UTR SNP3, or MSTN 3'UTR SNP4.

[0028] The genetic variant may be BIEC2417495 SNP. The presence of a C allele in the BIEC2417495 SNP may be indicative of elite athletic performance. The presence of a heterozygous CT genotype in the BIEC2417495 SNP may be indicative of elite athletic performance. The presence of a homozygous CC genotype in the BIEC2417495 SNP may be indicative of elite athletic performance.

[0029] The presence of C allele in the MSTN-66493737 (T/C) SNP may be indicative of elite athletic performance. The presence of a heterozygous CT genotype in the MSTN-66493737 (T/C) SNP may be indicative of elite athletic performance. The presence of a homozygous CC genotype in the MSTN-66493737 (T/C) SNP may be indicative of elite athletic performance.

[0030] The elite athletic performance may be elite sprinting performance.

[0031] The biological sample of the subject may be chosen from one or more of: blood, saliva, skeletal muscle, hair, semen, bone marrow, soft tissue, internal organ biopsy sample or skin.

[0032] The invention also provides an assay for determining the athletic performance potential of a subject comprising the steps of: [0033] obtaining a biological sample from the subject; [0034] extracting or releasing DNA from the biological sample; and [0035] identifying (i) a MSTN-66493737 (T/C) SNP and (ii) a genetic variant in linkage disequilibrium with the MSTN-66493737 (T/C) SNP in the biological sample [0036] wherein the athletic performance potential of the subject is associated with the MSTN-66493737 (T/C) SNP and/or the genetic variant.

[0037] The DNA may be genomic DNA.

[0038] The assay may further comprise the step of [0039] amplifying a target sequence in the extracted or released DNA [0040] prior to the step of identifying (i) a MSTN-66493737 (T/C) SNP and (ii) a genetic variant in linkage disequilibrium with the MSTN-66493737 (T/C) SNP in the biological sample.

[0041] The subject may be an equine. The genetic variant may be located in equine chromosome 18. The genetic variant may be located in the MSTN gene region. The genetic variant may be located in the MSTN gene flanking region. The genetic variant may be chosen from one or more of: BIEC2-417495 SNP, BIEC2-417372 SNP, MSTN Ins227 bp mutation, MSTN 3'UTR SNP1, MSTN 3'UTR SNP2, MSTN 3'UTR SNP3, or MSTN 3'UTR SNP4.

[0042] The genetic variant may be BIEC2417495 SNP. The presence of a C allele in the BIEC2417495 SNP may be indicative of elite athletic performance. The presence of a heterozygous CT genotype in the BIEC2417495 SNP may be indicative of elite athletic performance. The presence of a homozygous CC genotype in the BIEC2417495 SNP may be indicative of elite athletic performance.

[0043] The presence of C allele in the MSTN-66493737 (T/C) SNP may be indicative of elite athletic performance. The presence of a heterozygous CT genotype in the MSTN-66493737 (T/C) SNP may be indicative of elite athletic performance. The presence of a homozygous CC genotype in the MSTN-66493737 (T/C) SNP may be indicative of elite athletic performance.

[0044] The elite athletic performance may be elite sprinting performance.

[0045] The biological sample of the subject may be chosen from one or more of: blood, saliva, skeletal muscle, hair, semen, bone marrow, soft tissue, internal organ biopsy sample or skin.

[0046] The invention further provides a method for predicting the athletic performance potential of a subject comprising the step of assaying a biological sample from a subject for the presence of a DNA polymorphism (SNP or insertion) in the MSTN gene and/or flanking sequences.

[0047] The DNA polymorphism may be an insertion polymorphism. The polymorphism may be Chr18g.66495327Ins227 bp66495326. The presence of a Ins227 bp allele may be indicative of elite athletic performance. The presence of a homozygous Ins227 bp/Ins227 bp genotype may be indicative of elite athletic performance. The elite athletic performance may be elite sprinting performance. The biological sample of the subject may be selected from the group comprising: blood, saliva, skeletal muscle, hair, semen, bone marrow, soft tissue, internal organ biopsy sample and skin.

[0048] The subject may be from a competitive racing species. The subject may be an equine. The subject may be chosen from one or more of a thoroughbred race horse, a standardbred trotter, a French trotter, a Quarter horse, or a competitive jumping horse.

[0049] The invention further provides an assay for determining the athletic performance potential of a subject comprising the steps of: [0050] obtaining a sample; [0051] extracting or releasing DNA from the sample; and [0052] identifying a polymorphism (SNP or insertion) in a target sequence from an MSTN gene associated with athletic performance in the extracted or released DNA [0053] wherein the athletic performance potential of a subject is associated with the polymorphism.

[0054] The polymorphism may be an insertion polymorphism. The polymorphism may be Chr18g.66495327Ins227 bp66495326. The presence of a Ins227 bp allele may be indicative of elite athletic performance. The presence of a homozygous Ins227 bp/Ins227 bp genotype may be indicative of elite athletic performance. The elite athletic performance may be elite sprinting performance

[0055] The assay may comprise the step of: [0056] amplifying a target sequence from a gene associated with athletic performance in the extracted or released DNA [0057] prior to the step of identifying a DNA polymorphism.

[0058] The DNA may be genomic DNA

[0059] The invention also provides an assay for use in determining the athletic performance potential of a subject comprising a detector for detecting the presence of a polymorphism (SNP or insertion) in the MSTN gene and/or flanking sequences.

[0060] The polymorphism may be an insertion polymorphism. The polymorphism may be Chr18g.664953271 ns227 bp66495326. The presence of a Ins227 bp allele may be indicative of elite athletic performance. The presence of a homozygous Ins227 bp/Ins227 bp genotype may be indicative of elite athletic performance. The elite athletic performance may be elite sprinting performance.

[0061] The invention further provides an assay for determining the athletic potential of a subject comprising the step of: [0062] obtaining a sample; [0063] extracting or releasing DNA from the sample; and [0064] identifying the genotype of the Chr18g.66495327Ins227 bp66495326 polymorphism in the extracted or released DNA [0065] wherein the presence of a Ins227 bp allele in the Chr18g.664953271 ns227 bp66495326 polymorphism is indicative of elite athletic performance.

[0066] The assay may comprise the step of: [0067] amplifying a target sequence encoding the Chr18g.66495327Ins227 bp66495326 polymorphism in the extracted or released DNA [0068] prior to the step of identifying the genotype of the Chr18g.66495327Ins227 bp66495326 polymorphism.

[0069] The presence of a homozygous Ins227 bp/Ins227 bp genotype may be indicative of elite athletic performance. The elite athletic performance may be elite sprinting performance.

[0070] The DNA may be genomic DNA.

[0071] The subject may be from a competitive racing species. The subject may be an equine. The subject may be chosen from one or more of a thoroughbred race horse, a standardbred trotter, a French trotter, a Quarter horse, or a competitive jumping horse.

[0072] The invention further provides a MSTN insertion mutation encoded by the DNA sequence of SEQ ID No. 23.

[0073] This invention provides DNA-based tests for detecting structural genetic variation in nuclear-encoded genes.

[0074] The methods and assays described herein are performed ex vivo and can be considered to be ex vivo or in vitro methods and assays.

[0075] Any suitable biological sample which contains genetic material for example, blood, saliva, hair, skin, bone marrow, soft tissue, internal organs, biopsy sample, semen, skeletal muscle tissue and the like, may be used as a biological sample for the methods described herein. Blood and hair samples are particularly suitable as a biological sample.

[0076] "Athletic performance" as used herein includes racing such as competitive racing and equestrian sports such as racing, showjumping, trotting, eventing, dressage, endurance events, riding, hunting and the like. The equestrian sports may be competitive sports. Of particular importance is sprint racing performance.

[0077] Competitive racing species include equines (horses), camels, dogs, elephants, hares, kangaroos, ostriches, pigeons, Homo sapiens and birds of prey such as hawks or falcons. The competitive racing species may be a competition horse such as a Thoroughbred race horse, Standardbred Trotter, French Trotter, Quarter Horse or a competitive jumping horse.

[0078] By "primer" we mean a nucleic acid sequence containing between about 15 to about 40 for example between about 18 to about 25 contiguous nucleotides from a nucleic acid sequence of interest. The primer may be a forward (5' or 3') or reverse (3' to 5') primer or a primer designed on a complementary nucleic acid sequence to the sequence of interest. In the present invention, the sequence of interest is the genomic sequence of a gene associated with athletic performance, for example myostatin. In one embodiment, the primer may comprise between about 15 to about 40 nucleotides. By "complementary sequence" we mean a sequence that binds to the sequence of interest using conventional Watson-Crick base pairing i.e. adenine binds to thymine and cytosine binds to guanine.

[0079] In our PCT/IE2009/000062, the entire contents of which is incorporated herein by reference, we describe the association between athletic performance and single nucleotide polymorphisms for example a single polymorphism (g.66493737C>T) in the myostatin gene. Novel sequence variants were identified by re-sequencing the equine MSTN gene in 24 unrelated Thoroughbred horses using 13 overlapping primer pairs spanning all three exons and 288 by of the 5' upstream region. Although no exonic sequence variants were detected, six SNPs were detected in intron 1 of MSTN [nt 66492979-66494807]. There was a highly significant (P=3.70.times.10.sup.-5) association with g.66493737C>T and elite short distance (.ltoreq.8 f) racing performance and this association became marginally stronger (P=1.88.times.10.sup.-5) when the short distance cohort was further subdivided into animals (n=43) that had won their best race over distances.ltoreq.7 f. The C allele was twice as frequent in the short distance (<7 f) than in the long distance (>8 f) cohort (0.72 and 0.36 respectively) corresponding to an odds ratio of 4.54 (95% C.I. 2.23-9.23). The most parsimonious model was the genotypic model (P=1.18.times.10.sup.-6) indicating that genotypes are predictive of optimum racing distance. Considering best race distance (BRD) as a quantitative trait, we analyzed the data for the elite cohort using the distance (furlongs) of the highest grade or most valuable Group race won as the phenotype (n=79). BRD was highly significantly associated (P=4.85.times.10.sup.-8) with the g.66493737C>T SNP. This result was independently validated (P=1.91.times.10.sup.-6) in a re-sampled group of unrelated elite (Group and Listed race winners) Thoroughbreds (n=62) and in a cohort of 37 elite racehorses (P=0.0047) produced by the same trainer. For each genotype we determined the mean BRD in the original sample: C/C mean=6.2.+-.0.8 f; C/T mean=9.1.+-.2.4 f; and T/T mean=10.5.+-.2.7 f.

[0080] The invention provides structural DNA polymorphisms (including insertion polymorphisms and single nucleotide polymorphisms) that are associated with elite athletic performance. The invention provides a method of predicting the athletic performance of a subject comprising the step of assaying a biological sample from the subject for the presence of a structural DNA polymorphism (SNP or insertion) in MSTN wherein the polymorphism has a significant association with athletic performance, especially sprint racing.

[0081] According to the invention there is provided a method for predicting the athletic performance potential of a subject comprising the step of assaying a biological sample from a subject for the presence of a polymorphism in the MSTN gene and/or flanking sequences. The polymorphism may be an insertion polymorphism.

[0082] The polymorphism may be Chr18g.66495327Ins227 bp66495326. The presence of the Ins227 bp allele is indicative of elite athletic performance. The presence of a homozygous Ins227 bp genotype may indicative of elite athletic performance. The elite athletic performance may be elite sprinting performance. The elite athletic performance may be early two-year old performance.

[0083] The biological sample of the subject may be selected from the group comprising: blood, saliva, skeletal muscle, skin, semen, biopsy, bone marrow, soft tissue, internal organs and hair.

[0084] The subject may be from a competitive racing species. The subject may be an equine such as a Thoroughbred race horse, Standardbred Trotter, French Trotter or Quarter Horse.

[0085] The invention further provides an assay for determining the athletic performance potential of a subject comprising the steps of: [0086] obtaining a sample; [0087] extracting or releasing DNA from the sample; and [0088] identifying a polymorphism (SNP or insertion) in a target sequence from an MSTN gene associated with athletic performance in the extracted or released DNA wherein the athletic performance potential of a subject is associated with the polymorphism.

[0089] The polymorphism may be an insertion polymorphism.

[0090] The assay may comprise the step of: [0091] amplifying a target sequence from a gene or upstream region of a gene associated with athletic performance in the extracted or released DNA prior to the step of identifying a DNA polymorphism.

[0092] The DNA may be genomic DNA

[0093] The invention further provides an assay for use in determining the athletic performance potential of a subject comprising means for detecting the presence of a polymorphism (SNP or insertion) in the MSTN gene and/or flanking sequences.

[0094] The polymorphism may be Chr18g.664953271 ns227 bp66495326. The presence of a Ins227 bp allele is indicative of elite athletic performance. The presence of a homozygous Ins227 bp genotype may indicative of elite athletic performance. The elite athletic performance may be elite sprinting performance. The elite athletic performance may be early two-year old performance.

[0095] The invention also provides an assay for determining the athletic potential of a subject comprising the step of: [0096] obtaining a sample; [0097] extracting or releasing DNA from the sample; [0098] identifying the genotype of the Chr18g.66495327Ins227 bp66495326 polymorphism in the extracted or released DNA wherein the presence of a Ins227 bp allele in the Chr18g.664953271 ns227 bp66495326 polymorphism is indicative of elite athletic performance.

[0099] The assay may comprise the step of: [0100] amplifying a target sequence encoding the Chr18g.664953271 ns227 bp66495326 polymorphism in the extracted or released DNA prior to the step of identifying the genotype of the Chr18g.664953271 ns227 bp66495326 polymorphism.

[0101] The presence of a homozygous Ins227 bp genotype indicative of elite athletic performance.

[0102] The elite athletic performance may be elite sprinting performance.

[0103] The DNA may be genomic DNA.

[0104] The sample from the subject may be selected from the group comprising: blood, saliva, skeletal muscle skin, bone marrow, biopsy, soft tissue, semen, internal organ and hair.

[0105] The subject may be from a competitive racing species. The subject may be an equine such as a Thoroughbred race horse.

BRIEF DESCRIPTION OF THE DRAWINGS

[0106] The invention will be more clearly understood from the following description of an embodiment thereof, given by way of example only, with reference to the accompanying drawings, in which:--

[0107] FIG. 1 is a schematic of the best race distance for each of the three MSTN 66493737 (T/C) SNP genotypes;

[0108] FIG. 2 is a bar chart showing the distribution of MSTN 66493737 (T/C) SNP genotypes in Thoroughbred subpopulations;

[0109] FIG. 3 is a Manhattan plot of P-value for genotype-phenotype GWAS in short (<8 f) and middle-long (>8 f) distance elite race winners. The y-axis plots -log.sub.10(P-values) and the x-axis plots the physical position of the SNPs sorted by chromosome and chromosome position. The most significant SNP was on chromosome 18 (BIEC2-417495). No SNP remained statistically significant following correction for multiple-testing;

[0110] FIG. 4 is a Manhattan plot of P-value for quantitative trait GWAS using best race distance as phenotype. The y-axis plots -log.sub.10(P-values) and the x-axis plots the physical position of the SNPs sorted by chromosome and chromosome position. A peak of association on chromosome 18 (chr18:65809482-67545806) encompassed a .about.1.7 Mb region (shown in FIG. 5). Seven of the chromosome 18 SNPs remained significant following correction for multiple testing. The most significant SNP was BIEC2-417495 (P.sub.Bonf.=6.58.times.10.sup.-5);

[0111] FIG. 5 is a regional plot for the 1.8 Mb peak of association on chromosome 18 containing the MSTN and NAB1 genes. Association plot of the 1.8 Mb region encompassing 40 SNPs (diamonds) and the Ins227 bp polymorphism (circle) ranging from one SNP upstream and one SNP downstream of the seven SNPs significantly associated with optimum racing distance following correction for multiple testing. The y-axes plot -log.sub.10(P-values) for each SNP (diamonds) and r.sup.2 (blue line (solid line)) between g.66493737C>T and all other SNPs. The x-axis plots the physical position of each SNP in the region. The best SNP, g.66493737C>T, is indicated with a blue diamond (indicated with B). Each SNP is color coded according to the strength of LD with g.66493737C>T: r.sup.2.gtoreq.0.8, red (indicated with R); r.sup.2.gtoreq.0.5<0.8, orange (indicated with O); r.sup.2.gtoreq.0.2<0.5, yellow (indicated with Y); r.sup.2<0.2, white (indicated with W);

[0112] FIG. 6 is a visual representation of haplotype blocks across a 1.7 Mb region on chromosome 18. The g.66493737 C>T SNP was included in block 3, BIEC2-417495 was included in block 6; and

[0113] FIG. 7A is a visual representation of haplotype blocks across a 1.7 Mb region on chromosome 18 generated from samples that are C/C (to represent C-chromosomes), T/T (to represent T-chromosomes) and ALL (i.e. reconstructed from genotypes for C/C, C/T and T/T individuals). Recombinant events are shown in FIG. 7B.

DETAILED DESCRIPTION

[0114] Intense selection for elite racing performance in the Thoroughbred horse (Equus caballus) has resulted in a number of adaptive physiological phenotypes relevant to exercise, however the underlying molecular mechanisms responsible for these characteristics are not well understood.

[0115] Thoroughbred horses have been selected for structural and functional variation contributing to speed and stamina during the three century development of the breed. The International Federation of Horseracing Authorities recognizes five distance categories: Sprint (5-6.5 furlongs [f], <1,300 m), Mile (6.51-9.49 f, 1,301-1,900 m), Intermediate (9.5-10.5 f, 1,901-2,112 m), Long (10.51-13.5 f, 2,114-2,716 m) and Extended (>13.51 f, >2,717 m) races (www.horseracingintfed.com) and it is widely recognized among horse breeders that variation in physical and physiological characteristics are responsible for variation in individual aptitude for race distance (Willett 1981). Although environment and training may contribute to the race distance for which a horse is best suited, the genetic contribution to the ability to perform optimally at certain distances is large; the heritability of best distance among Australian racehorses has been estimated as 0.94.+-.0.03 (Williamson & Beilharz 1998).

[0116] A principal characteristic contributing to the ability of a Thoroughbred to perform well in short distance, sprint races is the extent and maturity of the skeletal musculature. Sprinters are generally shorter, stockier animals with greater muscle mass than animals suited to endurance performance, and generally mature earlier. Performance aptitude for speed and stamina has also been associated with muscle fibre type phenotypes (Rivero et al. 1993; Barrey et al. 1999) and metabolic adaptations to training (Rivero & Piercy 2008). Variation in cardiovascular function contributing to aerobic capacity may also play a role in distinguishing individuals suited to shorter or longer distance races.

[0117] We have previously reported a sequence polymorphism (g.66493737C>T) in the equine myostatin (MSTN) gene strongly associated (P=4.85.times.10.sup.-8) with optimum racing distance in Thoroughbred racehorses (Hill et al. 2010, the entire contents of which is incorporated herein by reference). In several mammalian species, including cattle, sheep, dogs and horses, muscle hypertrophy phenotypes are associated with sequence variants in the MSTN gene (Grobet et al. 1997; McPherron et al. 1997; McPherron & Lee 1997; Schuelke et al. 2004; Mosher et al. 2007). Among horses that compete preferably in short distance (.ltoreq.7 f) races requiring exceptional speed, the C allele OF G.66493737 C>T is twice as common than among horses that perform optimally in longer distance (>8 f) races that require more stamina (0.72 and 0.36 respectively). On average the optimum racing distance for C:C horses was 6.2.+-.0.8 f, for C:T horses was 9.1.+-.2.4 f and for T:T horses was 10.5.+-.2.7 f. Furthermore, C:C horses have significantly greater muscle mass than T:T horses at two-years-old.

[0118] Skeletal muscle phenotypes clearly play a role in distinguishing distance aptitude, and there is a strong effect of MSTN genotype on distance (Hill et al. 2010, the entire contents of which is incorporated herein by reference. However, heretofore, the effects of additional nuclear gene variants that may contribute to equine performance-related phenotypes have not been investigated. Therefore, we performed a genome-wide SNP-association study using the EquineSNP50 Bead Chip genotyping array in a cohort of elite race winning Thoroughbred horses. Animals were separated into two distinct phenotypic cohorts comprising short distance (<8 f) and middle-long distance (>8 f) race winners and genetic associations were evaluated using best race distance as a quantitative phenotype. This study was designed to identify additional genetic loci as indicators of race distance aptitude and to establish whether variation at the g.66493737C>T SNP was associated with inter-locus epistatic effects for race distance performance.

[0119] The present invention relates to a previously unknown relationship between sequence variants (such as SNPs and insertion polymorphism) in the MSTN gene and retrospective athletic performance (given as racecourse success i.e. Group winner or non-winner, handicap rating (RPR) and best race distance for Group winners) in Thoroughbred race horses. In some aspects, the invention relates to sequence variants in the MSTN gene and flanking sequences. In some aspects the invention relates to sequence variants in linkage disequilibrium with sequence variants in the MSTN gene.

MSTN

[0120] Myostatin is also known as growth/differentiation factor 8 precursor (GDF-8). In several mammalian species (including cattle, sheep and dogs), the double muscling trait is caused by mutations in the myostatin (MSTN) gene. In dogs, MSTN gene mutations in racing whippets have been associated with the `bully` phenotype and heterozygous individuals are significantly faster than individuals carrying the wild-type genotype (Mosher et al 2007). Mutations in the MSTN gene may be associated with athletic power.

[0121] We have analysed a number of polymorphisms (including SNPs and insertion polymorphisms) in the MSTN gene for association with athletic performance and have developed a simple DNA based method of predicting the athletic performance potential of a subject based on the novel polymorphisms.

[0122] A genome-wide SNP-association study for optimum racing distance was performed using the EquineSNP50 Bead Chip genotyping array in a cohort of n=118 elite Thoroughbred racehorses divergent for race distance aptitude. In a cohort-based association test we evaluated genotypic variation at 40,977 SNPs between horses suited to short distance (.ltoreq.8 f) and middle-long distance (>8 f) races. The most significant SNP was located on chromosome 18: BIEC2-417495 .about.690 kb from the gene encoding myostatin (MSTN) [P.sub.unadj.=6.96.times.10.sup.-6]. Considering best race distance as a quantitative phenotype, a peak of association on chromosome 18 (chr18:65809482-67545806) comprising eight SNPs encompassing a 1.7 Mb region was observed. Again, similar to the cohort-based analysis, the most significant SNP was BIEC2-417495 (P.sub.unadj.=1.61.times.10.sup.-9; P.sub.Bonf.=6.58.times.10.sup.-5). In a candidate gene study we have previously reported a SNP (g.66493737C>T) in MSTN associated with best race distance in Thoroughbreds; however, its functional and genome-wide relevance were uncertain. Additional re-sequencing in the flanking regions of the MSTN gene revealed four novel 3' UTR SNPs and a 227 bp SINE insertion polymorphism in the 5' UTR promoter sequence. Linkage disequilibrium was highest between g.66493737C>T and BIEC2-417495 (r.sup.2=0.86). Comparative association tests consistently demonstrated the g.66493737C>T SNP as the superior variant in the prediction of distance aptitude in racehorses (g.66493737C>T, P=1.02.times.10.sup.-10; BIEC2-417495, P.sub.unadj.=1.61.times.10.sup.-9). Functional investigations will be required to determine whether this polymorphism affects putative transcription-factor binding and gives rise to variation in gene and protein expression. Nonetheless, these data demonstrate that the g.66493737C>T SNP provides the most powerful genetic marker for prediction of race distance aptitude in Thoroughbreds.

[0123] The invention will be more clearly understood from the following examples.

EXAMPLES

Materials and Methods

Subjects

[0124] A Thoroughbred is a registered racehorse that can trace its ancestry to one of three foundation stallions and the approximately 30 foundation mares entered in The General Studbook, 1791 (Weatherby and Sons 1791). There are two types of Thoroughbred race: National Hunt races are run over hurdles or steeplechase fences over distances of up to 4.5 miles (7,200 m), while Flat races have no obstacles and are run over distances ranging from five furlongs (5/8 mile or 1,006 m) to 20 furlongs (4,024 m). The highest standard and most valuable elite Flat races are known as Group (Europe and Australasia) or Stakes races (North America). The most prestigious of these races include The Breeders' Cup races (United States), The Kentucky Derby (United States), The Epsom Derby (United Kingdom) et cetera.

[0125] Three hundred and fifty Group races are run in Europe (Britain, Ireland (incl. Northern Ireland), France, Germany, Italy) annually including 84 Group 1, 93 Group 2 and 173 Group 3 races. In the United Kingdom and Ireland 196 Group races are competed annually (43 Group 1, 50 Group 2 and 103 Group 3). Britain has the highest number of Group races (139) in Europe per annum, with 57% run over distances<1 mile (1609 meters) and 43% run over distances>1 mile. Australia has approximately 540-550 Group races per season from a total of almost 21,000 races and New Zealand hosts 78 Group races per season. After Group races, Listed races are the next highest grade of race.

[0126] Horses that compete over distances.ltoreq.1 mile are known as `sprinters` whereas horses that compete over distances>1 mile are known as `stayers`. Horses competing in 1 mile races (`milers` and `middle distance`) may be considered either sprinters or stayers and the way in which a race is executed by the rider often reflects the trainers perceived ability (`sprinter` or `stayer`) of the horse. The International Federation of Horseracing Authorities recognizes five race distance categories: Sprint (5-6.5 f, .ltoreq.1,300 m), Mile (6.51-9.49 f, 1,301-1,900 m), Intermediate (9.5-10.5 f, 1,901-2,112 m), Long (10.51-13.5 f, 2,114-2,716 m) and Extended (>13.51 f, >2,717 m); S-M-I-L-E [Note: 1 furlong=1/8 mile=201.2 meters].

[0127] A repository of registered Thoroughbred horse blood or hair samples (n>1,400) was collected from stud farms, racing yards and sales establishments in Ireland, Great Britain and New Zealand during 1997 to 2008. Each sample was categorized based on retrospective racecourse performance records. Only horses with performance records in Flat races were included in the study. The study cohort comprised elite Thoroughbreds that had won at least one Group race (Group 1, Group 2 or Group 3) or a Listed race--the highest standard and most valuable elite Flat races are known as Group (Stakes) races and Listed races are the next in status. Only elite race winning horses were included as elite races are most likely to reflect the truest test for distance. Race records were derived from three sources [Europe race records: The Racing Post on-line database (www.racingpost.co.uk); Australasia and South East Asia race records: Arion Pedigrees (www.arion co.nz); North America race records: Pedigree Online Thoroughbred database (www.pedigreequery.com)].

[0128] Each sample was assigned a best race distance which was defined as the distance (furlongs, f) of the highest grade of race won [note: 1 furlong=1/8 mile=201.2 meters]. When multiple races of the same grade were won, then the distance of the most valuable race, in terms of prize money, was used. A set of elite Thoroughbred samples (n=118) was selected from the repository, mostly comprising samples procured in Ireland and Great Britain (i.e. n=5 samples [n=3.ltoreq.8 f, n=2>8 f] were collected in New Zealand); though some had won their best race in North America. Animals with excessive consanguinity (within two generations) were avoided and over-representation of popular sires within the pedigrees was minimized as far as possible. One hundred and seven sires were represented in the total sample set.

[0129] For the case-control investigation we compared two cohorts: samples were subdivided into short (.ltoreq.8 f, n=68) and middle-long (>8 f, n=50) distance elite race winning cohorts (Table 1 below).

TABLE-US-00001 TABLE 1 Description of phenotype cohorts No. Mean Range Mean Range N sires RPR RPR BRD BRD All TBs 118 107 116 84-138 8.6 5-16 Short (.ltoreq.8 f) 68 63 114 84-129 6.8 5-8 Middle-long (>8 f) 50 48 120 107-138 11.3 9-16

[0130] All TBs (Thoroughbreds) were used for the quantitative association test analysis. Racing Post Ratings (RPR) represent handicap ratings (best lifetime RPR) that are indicative of performance ability. Best race distance (BRD) was the distance (f) of the highest grade of race (Group 1, 2, 3, Listed) won.

DNA Extraction

[0131] Genomic DNA was extracted from either fresh whole blood or hair samples using a modified version of a standard phenol/chloroform method (Sambrook & Russell 2001) or the Maxwell 16 automated DNA purification system (Promega, WI, USA). DNA samples were quantified using Quant-iT PicoGreen dsDNA kits (Invitrogen, Carlsbad, Calif.) according to the manufactures instructions and the DNA concentrations were adjusted to 20 ng/.mu.l.

Detection of Polymorphism

[0132] The sequence variant may be determined by any genotyping method including for example the following non limiting methods: direct DNA sequencing; allele size discrimination using gel based assays; single-strand conformation polymorphisms; high-resolution melting of PCR amplicons; matrix-assisted laser-desorption-ionization mass spectrometry.

Genotyping and Quality Control

[0133] Samples were genotyped using EquineSNP50 Genotyping BeadChips (Illumina, San Diego, Calif.). This array contains approximately 54,000 SNPs ascertained from the EquCab2 SNP database of the horse genome (Wade et al. 2009) and has an average density of one SNP per 43.2 kb. Genotyping was performed by AROS Applied Biotechnology AS, Denmark. The samples that were genotyped for this study were a subset of n=187 samples genotyped in two separate batches (Batch 1, n=96; Batch 2, n=91). We included four pairs of duplicate samples in Batch 2 for QC purposes and observed greater than 99.9% concordance in the four pairs. In total, we successfully genotyped 53,795 loci. All samples had a genotyping rate of greater than 90%. We omitted SNPs which had a genotyping completion rate of less than 90%, were monomorphic or had minor allele frequencies (MAF) less than 5% in our samples from further analysis. We omitted 12,818 SNPs leaving 40,977 SNPs in our working build of the data and the overall genotype completion rate was 99.8%.

Re-Sequencing MSTN Flanking Sequences

[0134] PCR primers were designed to cover .about.2 kb of the 5'UTR and .about.2 kb of the 3' UTR of MSTN genomic sequence using the PCR Suite extension to the Primer3 web-based primer design tool (Rozen & Skaletsky 2000; van Baren & Heutink 2004) (Table 2 below). Fifteen unrelated Thoroughbred DNA samples (g.66493737C>T, n=5 C:C; n=5 C:T, n=5 T:T) were included in a re-sequencing panel to identify novel sequence variants. Bidirectional DNA sequencing of PCR products was performed by Macrogen Inc. (Seoul, Korea) using AB 3730.times.1 sequencers (Applied Biosystems, Foster City, Calif.). Sequence variants were detected by visual examination of sequences following alignment using Consed version 19.0 (Gordon et al. 1998).

TABLE-US-00002 TABLE 2 PCR and sequencing primers for re-sequencing MSTN flanking sequences Forward and reverse primers for MSTN 3' UTR PCR and sequencing Oligonucleotide Primer SEQ ID Oligonucleotide Name Sequence 5'-3' No PCR Primer 3'UTR (Forward) TACTCCCACAAAGATGTCTCCAAT 1 PCR Primer 3'UTR (Reverse) TGAATCACCTCCTGCATTAGACT 2 Sequencing Primer 1 3'UTR GAATGGCTGATGTCATCAGG 3 (Forward) Sequencing Primer 1 3'UTR CCTGATGACATCAGCCATTC 4 (Reverse) Sequencing Primer 2 3'UTR CAAATCTCAACGTTCCATTG 5 (Forward) Sequencing Primer 2 3'UTR CAATGGAACGTTGAGATTTG 6 (Reverse) Forward and reverse primers for MSTN 5' UTR PCR and sequencing Oligonucleotide Primer SEQ ID Oligonucleotide Name Sequence 5'-3' No Structure PCR Primer 5'UTR (Forward) CTGGTTTGTGTCTGGTTTTC 7 PCR Primer 5'UTR (Reverse) CTTTTCCTTCCTGCTTACATAC 8 Sequencing Primer 1 5'UTR AACAAAACAAACAGGCACCC 9 5' upstream (Forward) Sequencing Primer 1 5'UTR GGGTGCCTGTTTGTTTTGTT 10 5' upstream (Reverse) Sequencing Primer 2 5'UTR GTCAGGAAAACAAGTTTCTCAAA 11 5' upstream (Forward) Sequencing Primer 2 5'UTR TTTGAGAAACTTGTTTTCCTGAC 12 5' upstream (Reverse) Sequencing Primer 3 5'UTR GACAGCGAGATTCATTGTGG 13 5' upstream + (Forward) part Exon 1 Sequencing Primer 3 5'UTR CCACAATGAATCTCGCTGTC 14 5' upstream + (Reverse) part Exon 1 Sequencing Primer 4 5'UTR CCTGTTTGTGCTGATTCTTG 15 5' upstream + (Forward) part Exon 1 Sequencing Primer 4 5'UTR CAAGAATCAGCACAAACAGG 16 5' upstream + (Reverse) part Exon 1

Bioinformatics

[0135] The software tool MatInspector (Cartharius et al. 2005) was used to search for transcription factor binding site consensus sequences present in 300 by of the MSTN 5' UTR region in which a novel SINE insertion (Ins227 bp) polymorphism was detected. To investigate possible microRNA (miRNA) regulation of MSTN gene expression we screened the equine MSTN gene and flanking sequences for putative miRNA binding sites. A list of 407 predicted equine miRNAs (Zhou et al. 2009) were inputted into the online tool DIANA microtest (http://diana.pcbi.upenn.edu/cgi-bin/micro_t.cgi) and a 14.7 kb segment containing the equine MSTN gene and .about.5 kb of upstream and downstream sequence was inputted as the target sequence. SNPlnspector (Cartharius et al. 2005) was used to investigate transcription factor binding sites at the g.66493737C>T locus.

Genotyping the Chr18g.66495327Ins227 bp66495326 (Ins227 bp) Polymorphism

[0136] A PCR-based assay for allele size discrimination was used to genotype the Ins227 bp polymorphism in n=165 samples. The following primers were used: forward 5'-ATCAGCTCACCCTTGACTGTAAC-3'(SEQ ID No. 17) and reverse 5'-TCATCTCTCTGGACATCGTACTG-3' (SEQ ID No. 18). Alleles were determined as follows: Normal allele--600 bp; and Insertion227 bp allele--827 bp.

Statistical Analyses

[0137] All statistical analyses, including tests of association were performed using PLINK Version 1.05 (Purcell et al. 2007). We compared genotype frequencies in short and middle-long distance cohorts, testing for trait association using .chi..sup.2 tests with two degrees of freedom. To test for population stratification, the pairwise identity-by-state (IBS) distance was calculated for all individuals. A permutation test was performed to investigate IBS differences among the short and middle-long distance cohorts. The linear regression model was used to evaluate quantitative trait association using best race distance (f) as the phenotype. We report uncorrected P-values (P.sub.unadj.) and P-values following correction for multiple testing using the Bonferroni method (P.sub.Bonf.). Manhattan and Q-Q plots were generated in R using a modified version of code. The regional association plot was generated in R using a modified version of code available at http://www.broadinstitute.org.

[0138] Cohort-based association (short vs middle-long distance) and quantitative trait association tests were also performed for the g.66493737C>T SNP (Hill et al. 2010) and a novel 5'UTR MSTN SINE insertion (Ins227 bp) polymorphism identified in this study. In addition, an analysis of genome-wide epistasis was performed in which the g.66493737C>T SNP was tested against all SNPs on the EquineSNP50 Genotyping BeadChip for epistatic interactions influencing best race distance. This test involved a linear regression analysis to investigate whether gene by gene interactions had a significant influence on best race distance. Linkage disequilibrium (LD) between g.66493737C>T and Ins227 bp and between g.66493737C>T and all chromosome 18 SNPs on the EquineSNP50 Genotyping BeadChip was quantified as r.sup.2. A visual representation of haplotype blocks across a 1.7 Mb region on chromosome 18 was generated using Haploview (FIG. 6) (Barrett et al. 2005; Barrett 2009).

Ethics

[0139] This work has been approved by the University College Dublin, Ireland, Animal Research Ethics Committee.

Example 1

Genome-Wide SNP-Association Study & Candidate Performance-Associated Genes

Genome-Wide SNP-Association Study

[0140] We have previously described an association between optimum racing distance and a SNP (g.66493737C>T) in the equine MSTN gene in Thoroughbred Flat racehorses (Hill et al. 2010, the entire contents of which is incorporated herein by reference). Candidate gene approaches are designed considering a priori hypotheses and do not allow the opportunity for evaluation of the effect of the gene in the context of the entire genome, nor do they allow for the identification of other genes contributing to the phenotype (Tabor et al. 2002; Jorgensen et al. 2009). Therefore, employing a hypothesis-free approach we investigated genome-wide influences on optimum racing distance by conducting a genome-wide SNP-association study in a cohort of elite Thoroughbred racehorses.

[0141] In a cohort-based genotype-phenotype investigation we compared two cohorts: short (.ltoreq.8 f) and middle-long (>8 f) distance elite race winners. The genome-wide association study (GWAS) results, sorted by chromosome, are shown in FIG. 3. The most significant SNP was on chromosome 18 (BIEC2-417495, P.sub.unadj.=6.96.times.10.sup.-6) and five of the top ten SNPs were located together spanning a 2.4 Mb region on chromosome 18 (chr18:64725066-67186093). However, no SNP in this analysis reached genome-wide significance following correction for multiple-testing.

[0142] The SNPs identified in chromosome 18 during the horse genome sequencing project and those that are found on the EquineSNP50 BeadChip can be viewed at http://www.broadinstitute.org/ftp/distribution/horse_snp_release/v2/(file- equcab2.0_chr18_snps.xls), the entire contents of which is incorporated herein by reference. Pairwise IBS values were used to investigate population stratification between the short and middle-long cohorts. While on average phenotypically concordant pairs of individuals were more similar than phenotypically discordant pairs (P=0.034), the overall difference between the two groups was negligible (<0.0002).

[0143] Using the linear regression model, we considered best race distance as a quantitative phenotype and observed the same peak of association on chromosome 18 (chr18:65809482-67545806) (FIG. 4). The unadjusted and FDR corrected P values for quantitative association test result for best race distance are given in additional file 1 which can be downloaded at http://www.biomedcentral.com/1471-2164/11/552, the entire contents of which are incorporated herein by reference. The top eight SNPs encompassed a 1.7 Mb region on chromosome 18 (FIG. 5) and seven reached genome-wide significance following correction for multiple testing (P.sub.Bonf.<0.05). The most significant SNP was also the most significant in the cohort-based analysis: BIEC2-417495 (P.sub.unadj.=1.61.times.10.sup.-9; P.sub.Bonf.=6.58.times.10.sup.-5).

Candidate Performance-Associated Genes

[0144] We investigated candidate genes in the 1.7 Mb (Chr18:65809482-67545806) region on chromosome 18 that encompassed the seven SNPs that reached genome-wide significance. Eleven protein coding genes were identified, including the myostatin gene (MSTN) and the NGFI-A binding protein 1 (EGR1 binding protein 1) gene (NAB1).

[0145] The genomic region on chromosome 18 containing the MSTN gene was the highest ranked region in the GWAS for best racing distance, reaching genome-wide significance for a set of seven SNPs within a 1.7 Mb region. The best SNP (BIEC2-417495) and the second best SNP (BIEC2-417372) were 692 kb and 28 kb from the MSTN gene, respectively. We searched the region for other plausible candidate genes and identified the NGFI-A binding protein 1 (EGR1 binding protein 1) gene (NAB1) located .about.170 kb from BIEC2-417495. The product of the NAB1 gene is highly expressed in cardiac muscle and has been reported to be a transcriptional regulator of cardiac growth (Buitrago et al. 2005). Its principal role is in its interaction with the early growth response 1 (EGR-1) transcriptional activator that is involved in regulation of cellular growth and differentiation (Thiel et al. 2000).

[0146] We considered NAB1 as a strong candidate gene to influence an athletic performance phenotype as we have previously identified EGR-1 mRNA transcript alterations (+1.6-fold, P=0.014) in skeletal muscle immediately following a bout of treadmill exercise in untrained Thoroughbred horses (McGivney et al. 2009). Twelve SNPs located within the NAB1 genomic sequence (chr18:g.66995249-67021729) are documented in the EquCab2 SNP database, and three are contained on the EquineSNP50 Genotyping BeadChip. After correction for multiple testing, there were no detectable associations between the three NAB1 SNPs and the trait (BIEC2-417453, P.sub.unadj.=0.0007, rank 144; BIEC2-417454, P.sub.unadj.=0.0012, rank 210; and BIEC2-417458, P.sub.unadj.=0.0032, rank 421). Therefore, we did not further consider NAB1 as a potential major contributor to variation in optimum racing distance.

Example 2

Polymorphism Detection in Equine MSTN Flanking Sequences

[0147] We have previously identified SNPs in intron 1 of the equine MSTN gene by re-sequencing the coding and intronic sequence [PCT/IE2009/000062 and Hill et al. 2010, the entire contents of which are incorporated herein by reference]. Details of two of the SNPs identified in Intron 1 are shown in Table 3 below.

TABLE-US-00003 TABLE 3 SNPs in intron 1 of the MSTN gene Location (bp)on ECA 18 Flanking SNP ID SNP (EquCab2) Structure Sequence MSTN- T:C 66493737 Intron 1 AGCTAAGCAAGTAATTAGCACAAAAA 66493737 TTTGAATGTTATATTCAGGCTATCTCA (T/C) AAAGTTAGAAAATACTGTCTTTAGAGC SNP CAGGCTGTCATTGTGAGCAAAATCACT AGCAATTTCTTTTATTTTGGTTCCCCAA GATTGTTTATAAATAAGGTAAATCTAC TCCAGGACTATTTGATAGCAGAGTCAT AAAGGAAAATTA[T/C]TTGGTGCATTA TAACCTGATTACTTAATAAGGAGAAC AATATTTTGAAACTGTTGTGTCCTGTT TAAAGTAGATAAAGCACTGGGTAAAG CAGGATCGCAGACACATGGCACAGAA GGTGTCTGTCTCCCTTTCCTTGAGTGT AGTTATGAACTGACTGCAAAAAGAAT ATATG (SEQ ID No. 19) MSTN- A:C 66494218 Intron 1 AGGAGATTATTAAGCAATGTGCCTGCC 66494218 TGGAAATGTGCACCCCGGGTGCTCTCA (A/C) ACAATAGTACTATGGTCAAGGTGTAA SNP GCAGGACTCTGAGC TATAACCTCTTTG ATTAAAATGTTTATTTATTAGGCATTT TATGATAATTAGCTCATGATTATCATT ATGCTATGTTTACTTCATCATTTTTCTT ACTAATACATTA[A/C]ATTTTAAAAAA TATTTTTCTAATCTCCAGGGGAATAAC TTTCAAAATCTAATATGTTAATTTGTG AAGAACATAAAAACACTATGAGAAAT AGTTTTGAGTAACAGAAGTCATTTTGG TGTTCAGCAAATGCTCAAATGACCTAA ACGTCTACAAATTTCTTCCTTCTCTATT ATTAGTGAAAAAAACTTGTTATTATAA (SEQ ID No. 20)

[0148] Details of two SNPs in the genomic region on chromosome 18 containing the MSTN gene that ranked highly in the GWAS for best racing distance are shown in Table 4 below.

TABLE-US-00004 TABLE 4 SNPs from Equine SNP50 Genotyping Bead Chips that ranked highly in the GWAS for best racing distance. Location (bp) on ECA 18 SNP ID SNP (EquCab2) Structure Flanking Sequence BIEC2- C:T 67186093 Intergenic CATAAGGTCAAATATTTTTCCCATTTCCCTCTTTTATTA 417495 AAATACCACATTTATTTGGAAAATCATTACTCAGCTCT ATTGCTTACTAATTATTTTAAGATAGAAAAAATATTTT GTCGCAAAGAAAGATTTCAAGACATCTTTATGGCTAT ATAAATATTTATGCATCTTTTTAAATACCTTGATTGAT TGGTTTTAGA[C/T]TGTCTCAGATTCCATCTGATTTCTC TGCCTCCCTGATAAACCTTCTTCAATCTCTGTTCCCTGG CCTATGAAGGTCACCTTCAAAATATTATCACCTTTATGT AATGATCAGACACAAAGTCTAACCATCATCTAAATTATT TCAATATGAAGCATGACTAATAAACCAGTATGAGTAGT TTTCAAAGTGAACAGGATTT (SEQ ID No. 21) BIEC2- A:G 66539967 Intergenic GCCTGGATATGAAGCCCATAAGAAATGTCTGGCAGTG 417372 GTCTCTTGAGATCAGAAAGAGAATGGGAGATTAGGAA GTTAGAATAGGAAGCAAGTGAGGCAGCAGGTAGYGG AGGCTAGGTGGCCCATCTGTGAGTTTTTTCCTTCTGAA CTCCTTACAATTCTTTATAAAATTCCATGAAGGCCTCA TTTCAAGATAAAGG+G/A+GAAGAAAATATTTTCTCCTA AAAAAGCTTAAACTTAATATTCTACTTCTCAAAAAAAA TTCAAAGAGGCCTAATAGATTGACTGGAACTCTAACTG AAATTTGCCTCGCTTTCCCAAATTCTTACTGGAGAAGGG CAAGGCCTCGCCCCTCTCAGAACTCTTACATGAGATTGC TGCTTTCCTTAGTTTCTGATCACTGT (SEQ ID No. 22)

[0149] The structure of the MSTN gene is predicted as follows (Ensembl data) (Table 5)

TABLE-US-00005 TABLE 5 Structure of the MSTN gene Length Start bp End bp bp 5' upstream 66,495,181 Exon 1 66,494,808 66,495,180 373 Intron 1 66,492,979 66,494,807 1829 Exon 2 66,492,605 66,492,978 374 Intron 2 66,490,589 66,492,604 2016 Exon 3 66,490,208 66,490,588 381 3' 66,490,207 downstream

[0150] We re-sequenced 2,155 bp (chri8:66488052-66490207) of the 3'UTR sequence of MSTN sequence of the equine myostatin (MSTN) gene in 15 unrelated Thoroughbred horses and identified 4 novel SNPs. (Table 6)

TABLE-US-00006 TABLE 6 SNPs identified in 3' UTR sequence of MSTN Location (in Location in the downstream Location Contig (full of the protein on ECA18 SNP length coding region (EquCab2) ID SNP 2139 bp) bp of MSTN) bp bp Structure SNP1 A:C 701 595 66,489,613 3' UTR SNP2 C:T 943 837 66,489,371 3' UTR SNP3 A:G 954 848 66,489,360 3' UTR SNP4 A:T 2001 1895 66,488,313 3' UTR

[0151] Polymorphisms in the 3' UTR of the MSTN gene have been associated with muscle hypertrophy in sheep and are considered likely to function via creation of de novo target sites for the microRNAs (miRNA) miR-1 and miR-206 (Clop et al. 2006). Therefore, using a set of equine miRNAs (n=407) described by Zhou and colleagues (Zhou et al. 2009) we investigated the presence of putative miRNA binding sites within .about.5 kb upstream and downstream flanking sequences of the MSTN gene. Five putative miRNA binding sites were identified, though none was polymorphic: i.e. no putative miRNA binding site was associated with any of the eight SNP alleles.

[0152] We re-sequenced 2,151 by (chr18:66494683-66496834) of the 5' UTR sequence of the equine myostatin (MSTN) gene in 15 unrelated Thoroughbred horses.

[0153] Re-sequencing was performed using four internal sequencing primers following PCR using the 5' UTR PCR and sequencing primers listed in Table 2 above (SEQ ID No. 7-16).

[0154] Following re-sequencing in the 5' UTR of the MSTN gene, we identified a 227 by insertion polymorphism at chr18:66495327-[Insertion227 bp]-66495326, located 146 by from the start of Exon 1 (Exon1Start: 66495180).

[0155] The insertion sequence is as follows:

TABLE-US-00007 (SEQ ID No. 23) GGGGCTGGCCCCGTGGCCGAGTGGTTAAGTTCGTGCGCT CCGCTGCAGGCGGCCCAGTGTTTCGTCGGTTCGAGTCCTG GGCGCGGACATGGCACTGCTCGTCGGACCACGCTGAGGC AGCGTCCCACATGCCACAACTAGAGGAACCCACAACGAA GAATACACAACTATGTACCGGGGGGCTTTGGGGAGAAAA AGGAAAATAAAATCTTTAAAAAGCCACTTGG

[0156] A BLAST search identified the insertion sequence as a horse-specific repetitive DNA sequence element (SINE) known as ERE-1 (Sakagami et al J. Mol. Biol. 239 (5), 731-735 (1994). Also MatInspector analysis indicated that the insertion may disrupt on E-box motif.

Summary of Polymorphisms in the MSTN Flaking Region

[0157] We have identified five polymorphisms in the upstream and downstream untranslated (UTR) regions of the MSTN gene. We have identified four novel SNPs (i.e. not documented in the EquCab2.0 SNP database) and an insertion polymorphism (not previously documented). Details for these polymorphisms are provided in the Table 7 below.

TABLE-US-00008 TABLE 7 Details of polymorphisms identified in the MSTN flanking region. Location (bp) on ECA18 SNP ID SNP (EquCab2) Structure Flanking sequences Insertion Insertion 66495327 5' UTR TTGTGACAGACAGGGTTTTAACCTCTGACAGCG 227 bp 227 bp [Insertion2 AGATTCATTGTGGAGCAGGAGCCAATCATAGAT 27 bp] CCTGACGACACTTGTCTCATCAAAGTTGGAATA 66495326 TAAAAAGCCACTTGG[GGGGCTGGCCCCGTGGC CGAGTGGTTAAGTTCGTGCGCTCCGCTGCAGGC GGCCCAGTGTTTCGTCGGTTCGAGTCCTGGGCG CGGACATGGCACTGCTCGTCGGACCACGCTGAG GCAGCGTCCCACATGCCACAACTAGAGGAACCC ACAACGAAGAATACACAACTATGTACCGGGGG GCTTTGGGGAGAAAAAGGAAAATAAAATCTTTA AAAAGCCACTTGG]AATACAGTATAAAAGATTC ACTGGTGTGGCAAGTTGTCTCTCAGACTGTACA GGCATTAAAATTTTGCTTGGCATTGCTCAAAAG CAAAAGAAAAGTAAAAGGAAGAAATAAGAGCA AGGAAAAAG (SEQ ID No. 38) SNP1 A:C 66489613 3' UTR TATATACCATCATTTTGATTATCCTTATACACTT GAATTTATATTGTATAATAGCATACTTGGTAAG ATGAAATTCCACAAAAATAGGAATGGTACACCA TATGCAAGTTTCCATTCCTATTGTGATTGATACA GTACATTAACAATCCACACCAATGGTGCTAATA CAAATAGGCTGAATGGCTGATGTCATCAGGTTT AT[C/A]AAATAAAAACATCCAATAAAATAATGT TTCTCCTTTCTTCAGGTGCATTTTCCAAATGGGG AATGGATTTTCTTTAATGAAAGAAGAATCATTT TTCTAGAGGTCAGGATTTAATTCTGTAGCATACT TGGAGAAACTGCATTACCTTAAAAGGCAGCCAA AAAGTATTCATTTTTATCAAAATTTCAAAATTGC AGCCTGCTTTTGCAACATTGCAGT (SEQ ID No. 24) SNP2 C:T 66489371 3' UTR ATCCAATAAAATAATGTTTCTCCTTTCTTCAGGT GCATTTTCCAAATGGGGAATGGATTTTCTTTAAT GAAAGAAGAATCATTTTTCTAGAGGTCAGGATT TAATTCTGTAGCATACTTGGAGAAACTGCATTA CCTTAAAAGGCAGCCAAAAAGTATTCATTTTTA TCAAAATTTCAAAATTGCAGCCTGCTTTTGCAA CATTGCAGTTTTTATGATAAAATAATGGAAA[C/ T]GACTGATTCTGTCAATATTGTATAAAAAGACT TTGAGACAATTGCATTTATATAATATGTATACA ATATTGTTTTTGTAAATAAGCGTCTCCTTTTTTA TTTACTTTGGTATATTTTTACAGTCAGAACATTT CAAATTAAGTATTAAGGCACAAAGACATGTCAT GTATGACAGAAAAGCAACTGCTTATATTTCGGG GCAAATTAGCAGATTAAATAGTGGTCTTAAAAC TCCATATGCTAATGGTTAGA (SEQ ID No. 25) SNP3 A:G 66489360 3' UTR ATCCAATAAAATAATGTTTCTCCTTTCTTCAGGT GCATTTTCCAAATGGGGAATGGATTTTCTTTAAT GAAAGAAGAATCATTTTTCTAGAGGTCAGGATT TAATTCTGTAGCATACTTGGAGAAACTGCATTA CCTTAAAAGGCAGCCAAAAAGTATTCATTTTTA TCAAAATTTCAAAATTGCAGCCTGCTTTTGCAA CATTGCAGTTTTTATGATAAAATAATGGAAATG ACTGATTCT[G/A]TCAATATTGTATAAAAAGACT TTGAGACAATTGCATTTATATAATATGTATACA ATATTGTTTTTGTAAATAAGCGTCTCCTTTTTTA TTTACTTTGGTATATTTTTACAGTCAGAACATTT CAAATTAAGTATTAAGGCACAAAGACATGTCAT GTATGACAGAAAAGCAACTGCTTATATTTCGGG GCAAATTAGCAGATTAAATAGTGGTCTTAAAAC TCCATATGCTAATGGTTAGATGGTTATATTACA ATCATTTTATATTTTTTTACATTATTAACATTCA CTTATAGATTC (SEQ ID No. 26) TCAATTTCCAAATGCATTGCAGTTGGCAAGGGT ATATGGTCCTAGAGTTACAAGTTCTACTGAAGC SNP4 A:T 66488313 3' UTR CACAGGAACACAGGGAAGCTGCATCTTTTTTTC TAGCACTTAATGATACCAGCACATTTATCTGAG CTTTGGGGGTACCAATTTTCA[A/T]ATTGAATTG AAAAATAATCATAAAGTGCCTAGAAATTCTTAA GTGCAACACTGTACATAAATGTTTTTGAAGTGA ACTCTCTTCTCTACTGCTTATCAGTTTAGTAAGT TAGCTATAAAGCAGTGACTAAGTCTATGAG (SEQ ID No. 27)

Example 3

MSTN Ins227 bp Polymorphism (Chr182.66495327Ins227 bp66495326)

[0158] This insertion polymorphism is located on Chromosome 18 of Equus caballus at position 66495327Ins227 bp66495326 reverse strand of the Horse Genome Sequence (Equus caballus Version 2.0) which can be viewed at www.broad.mit.edu/mammals/horse/.

[0159] The horse genome EquCab2 assembly is a Whole Genome Shotgun (WGS) assembly at 6.79.times. and was released in September 2007. A female Thoroughbred named "Twilight" was selected as the representative horse for genome sequencing. (Wade C. M., et al Science 326, 865-7).

[0160] The project coordination and genome sequencing and assembly is provided by the Broad Institute. The N50 size is the length such that 50% of the assembled genome lies in blocks of the N50 size or longer. The N50 size of the contigs is 112.38 kb, and the total length of all contigs is 2.43 Gb. When the gaps between contigs in scaffolds are included, the total span of the assembly is 2.68 Gb. The horse EquCab2 was annotated using a standard Ensembl mammalian pipeline. Predictions from vertebrate mammals as well as horse proteins have been given priority over predictions from non-vertebrate mammals. The set of predictions was been compared to 1:1 homologues genes in human and mouse, and missing homologs in the horse annotation have been recovered using exonerate. Horse and human cDNAs have been used to add UTRs to protein based predictions. The final gene-set comprises 20,737 protein-coding genes, 2,863 identified as pseudogenes and 1,580 classified as retro-transposed genes.

[0161] Further details of the Ins227 bp structural polymorphism are as follows: [0162] Polymorphism: 66495327Ins227 bp66495326 [0163] EquCab2.0 SNP JD: not detected in EquCab2.0 database. No report of insertion in on-line bioinformatics resources. [0164] Genomic location of polymorphism: 5'UTR [0165] Polymorphism type: Insertion

PCR Gel-Based Assay

[0166] A PCR-based assay for allele size discrimination may be designed using the following primers:

TABLE-US-00009 MI_F ATCAGCTCACCCTTGACTGTAAC (SEQ ID No. 17) MI_R TCATCTCTCTGGACATCGTACTG (SEQ ID No. 18)

[0167] Normal allele--Product Size 600 bp

[0168] Insertion227 bp allele--Product size 827 bp

Example 4

Polymorphisms in Linkage Disequilibrium with MSTN-66493737 SNP

3'UTR MSTN SNPs

[0169] Four SNPs in the 3'UTR of MSTN (SNPs 1 to 4--see Tables 6 and 7 above) are in linkage disequilibrium with MSTN 66493737 (T/C) and may be used as alternative predictive tests for racing performance, either alone or in combination with MSTN-66493737 and/or other polymorphisms.

Ins227 bp Polymorphism

[0170] Pairwise tests of linkage disequilibrium (LD) were performed between MSTN-g.66493737C/T and Ins227 bp.

[0171] The LD between MSTN-66493737 and Ins227 bp was r.sup.2=0.73

[0172] In the example below, with one exception (Sample 12) the Ins227 bp polymorphism was in complete linkage disequilibrium with the C-allele at MSTN.sub.--66493737 (T/C). Sample 12 may represent the result of a recombination event (evidence from heterozygous state at SNP2).

TABLE-US-00010 TABLE 8 Linkage disequilibrium of 3'UTR SNPs, and MSTN - 66493737(T/C) Sample MSTN_66493737 SNP1 SNP3 ID (T/C). (Real) SNP2 (Real) SNP4 Insertion 7 C:C C:C T:T A:A A:A Insertion 227 bp/Insertion 227 bp 8 C:C C:C T:T A:A A:A Insertion 227 bp/Insertion 227 bp 9 C:C C:C T:T A:A A:A Insertion 227 bp/Insertion 227 bp 11 C:C C:C T:T A:A A:A Insertion 227 bp/Insertion 227 bp 12 C:C C:C C:T A:A A:A Insertion 227 bp/Normal 3 C:T A:C T:T A:G A:A Insertion 227 bp/Normal 4 C:T A:C T:T A:G A:A Insertion 227 bp/Normal 10 C:T A:C T:T A:G A:A Insertion 227 bp/Normal 13 C:T A:C T:T A:G A:A Insertion 227 bp/Normal 14 C:T A:C T:T A:G A:A Insertion 227 bp/Normal 2 T:T A:A T:T G:G A:A Normal/Normal 5 T:T A:A T:T G:G A:A Normal/Normal 6 T:T A:A T:T G:G A:A Normal/Normal 15 T:T A:A T:T G:G A:A Normal/Normal 1 T:T A:C T:T A:G A:T Normal/Normal

[0173] In 14 of the 15 sequenced samples, the Ins227 bp allele was in concordance with the C-allele at g.66493737C>T. As complete concordance was not observed, we genotyped a set of n=165 samples to determine the extent of concordance between the Ins227 bp and g.66493737C>T polymorphisms. We performed parallel association tests for the same set of samples to evaluate the relative performance of the two polymorphisms as predictors of optimum racing distance.

[0174] The g.66493737C>T SNP performed better in an association test with best race distance (P=5.24.times.10.sup.-13) than the Ins227 bp polymorphism (P=5.54.times.10.sup.-10). Analysis of the sequence surrounding g.66493737C>T indicated that alternate alleles may result in the gain of a putative Homeobox C8/Hox-3alpha transcription factor binding site and/or the disruption of putative Distal-less homeobox 3, E2F and Pdx1 transcription factor binding sites.

Chromosome 18 SNPs

[0175] Pairwise tests of linkage disequilibrium (LD) were performed between g.66493737C>T and the 1,373 chromosome 18 SNPs represented on the genotyping array (Equine SNP50 genotyping BeadChips). LD was highest between g.66493737C>T and BIEC2-417495 (r.sup.2=0.86). Seven discrete haplotype blocks were identified in the 1.7 Mb peak of association on chromosome 18. The g.66493737C>T SNP was included in block 3; BIEC2-417495 was included in block 6 (FIG. 6).

SUMMARY

[0176] We focused on comprehensively evaluating variation in the MSTN gene by re-sequencing .about.2 kb of the 3' and 5' flanking sequences. Four novel 3' UTR SNPs and a 227 by SINE insertion (Ins227 bp) polymorphism located 146 by upstream of the coding region start site were identified (see Example 2 above). We investigated whether the 3' UTR SNPs may abrogate existing or create de novo putative miRNA binding sites, as has been described for MSTN influenced phenotypic variation in Texel sheep (Clop et al. 2006). However, there was no evidence for alterations in putative miRNA binding sites. Next, because of the close proximity to the transcriptional start site, we considered the Ins227 bp polymorphism as a strong functional candidate contributing to variation in racing performance. However, a comparative evaluation of association using the same set of samples (n=165) demonstrated that the g.66493737C>T SNP displayed a stronger association (P=5.24.times.10.sup.-13) with best race distance than the Ins227 bp polymorphism (P=5.54.times.10.sup.-10).

[0177] An evaluation of LD showed that the strongest association was between g.66493737C>T and the most significant SNP in the GWAS study, BIEC2-417495. A comparison of trait association in the same set of samples (n=118) confirmed the superior power of the g.66493737C>T SNP (P=1.02.times.10.sup.-10) in the prediction of best race distance when compared with BIEC2-417495 (P.sub.unadj.=1.61.times.10.sup.-9). The significance values and genotype frequencies for the top SNPs in the GWAS and the g.66493737C>T SNP are shown in Table 9. In addition, we investigated whether g.66493737C>T may interact with other SNPs represented on the EquineSNP50 genotyping array; however, no significant interaction was observed to influence best race distance (P>0.0001 for all interactions). Therefore, the effect of genotype on racing phenotype is highly likely a result of the previously reported variation in the MSTN gene at locus g.66493737C>T.

TABLE-US-00011 TABLE 2 Significance values (unadjusted and Bonferroni corrected P values) for the top SNPs associated with optimum race distance. CHR SNP UNADJ P BONF. P A1 A2 A11 A12 A22 18 g.66493737C > T 1.02E-10 N/A T C 0.1538 0.5962 0.2500 18 BIEC2-417495 1.61E-09 6.58E-05 T C 0.1709 0.5983 0.2308 18 BIEC2-417423 3.55E-08 0.001454 G A 0.1017 0.5169 0.3814 18 BIEC2-417372 6.21E-08 0.002545 G A 0.0932 0.5424 0.3644 18 BIEC2-417274 8.08E-08 0.003312 T G 0.1864 0.6017 0.2119 18 BIEC2-417210 3.13E-07 0.01281 C T 0.2119 0.5763 0.2119 18 BIEC2-417524 4.87E-07 0.01995 G A 0.1186 0.5763 0.3051 18 BIEC2-417507 5.09E-07 0.02086 C A 0.1368 0.5897 0.2735 A11: genotype frequency for homozygotes (allele 1) in the population (n = 118); A12: genotype frequency for heterozygotes; A22 genotype frequency for homozygotes (allele 2). Correction for multiple testing was not applied for g.66493737C > T; however, the association remains stronger (P.sub.Bonf. = 4.18 .times. 10.sup.-6) after application of a correction factor.

[0178] It is important to note that the sample size used for the present study is relatively small. However, the results of the quantitative trait GWAS demonstrate that the sample size used was sufficient to detect a major genetic effect such as that manifested at the MSTN locus. A lower sample size requirement for GWAS in the Thoroughbred is supported by population genomics analyses of this population in comparison to other horse breeds. These demonstrate that the extent of LD in the Thoroughbred is significantly greater than that measured in other horse populations, being comparable to LD estimates in inbred dog breeds (Wade et al. 2009). The high LD in Thoroughbreds is a reflection of low effective population size, which enables detection of associations with smaller sample sizes.

Example 5

Haplotype Analysis in the Region of MSTN

[0179] Genotypes for a subset of n=182 (C/C n=102, T/T n=80) horses were extracted from data generated for a sample of n=368 Thoroughbred DNA samples genotyped using EquineSNP50 Genotyping BeadChips (Illumina, San Diego, Calif.). DNA was quantified using Quant-iT PicoGreen dsDNA kits (Invitrogen, Carlsbad, Calif.) according to the manufacturer's instructions and the DNA concentrations were adjusted to 20 ng/.mu.l. The EquineSNP50 Genotyping BeadChip (Illumina, San Diego, Calif.) contains approximately 54,000 SNPs ascertained from the EquCab2 SNP database of the horse genome and has an average spacing of 43.2 kb between adjacent variants. Genotyping was performed by laboratories at AROS Applied Biotechnology, Denmark and GeneSeek, USA. The samples genotyped for the present study were a subset of samples genotyped in three separate batches (Batch 1, n=96; Batch 2, n=92; Batch 3, n=228). We included four pairs of duplicate samples between Batch 1 and Batch 2, two additional pairs of duplicate samples between Batch 2 and Batch 3 and two pairs of duplicate samples within Batch 3 for QC purposes and observed greater than 99.9% concordance in seven of the eight pairs. A parent offspring trio was also included to verify Mendelian transmission of SNPs. We successfully genotyped 53,922 loci. All samples had a genotyping rate>90%. We omitted SNPs which had a genotyping completion rate<90% were monomorphic or had minor allele frequencies (MAF)<5% in our samples. We omitted 18,109 SNPs leaving 35,813 SNPs in our working build of the data and the overall genotype completion rate was 99.9%.

[0180] SNPs spanning a 1.7 Mb region on ECA18 containing the MSTN gene were extracted from the data. Haploview was used to calculate pairwise measures of LD among the 47 SNPs and was employed to create a visual representation of the data. Using the default method, the region was divided into blocks of strong LD using a standard block definition (Gabriel et al., 2002) based on confidence intervals for strong LD and minor allele frequencies>0.05.

[0181] We re-constructed haplotypes in n=204 C-chromosomes and n=160 T-chromosomes in C/C and T/T Thoroughbreds only, for 46 SNPs (BIEC2-417187-BIEC2-417520) extracted from the Equine SNP50BeadChip and the MSTN g.66493737C/T variant. The 47 SNP-haplotypes (FIG. 7) spanned the 1.7 Mb region at the MSTN gene locus that contained a set of eight SNPs with genome-wide significance of association with best race distance in a previous GWAS (Hill et al 2010, the entire contents of which is included herein by reference). The C-allele was observed on a single haplotypic background spanning 273 kb (i.e. no variation was detected between BIEC2-417333-BIEC-417372), and only minimal variation was detected in a single proximal region (Block 1) located 439 kb upstream of the MSTN g.66493737C/T locus. This indicates haplotype conservation between the Ins227 bp and g.66493737C/T polymorphisms on g.66493737C-chromosomes. In contrast, the T-allele arises on a complex genetic background, with multiple haplotype blocks across the region, and considerable variation (FIG. 7) within the haplotype block (Block 4, spanning 484 kb) containing the MSTN g.66493737C/T SNP (see FIG. 7). These data are consistent with a single introduction of the C-allele at the foundation stages of the Thoroughbred.

[0182] Further haplotype analysis detected no background variation (MAF>0.05) on C-chromosomes (i.e. g.66493737C) between BIEC2-417333 and BIEC2-417372. i.e. an invariable 273096 kb haplotype block, containing both the Ins227 bp polymorphism and g.66493737C>T SNP.

Example 6

Assays for Predicting the Athletic Performance Potential of a Subject

[0183] The test for speed/stamina described in PCT/IE2009/000062, the entire contents of which is incorporated herein by reference, may be designed alternatively using an assay for any genetic variants in linkage disequilibrium with locus MSTN.sub.--66493737 (T/C). For example, the Ins227 bp polymorphism or BIEC2-417495. Alternatively, an assay for predicting the athletic performance potential of a subject may be based on a combination of more than one polymorphism.

[0184] Validation of a test for association may be performed by genotyping 192 samples for validation of linkage between Ins227 bp and MSTN.sub.--66493737 (T/C) and association with retrospective racing performance traits (e.g. Best race distance). The Ins227 bp genotypes will similarly be predictive of best race distance and may correlate with predictions based on the MSTN.sub.--66493737(T/C) SNP. Examples of prediction of phenotypes are given in FIGS. 1 and 2.

[0185] The Ins227 bp polymorphism is located 1590 by from the g.66493737C>T SNP.

[0186] The greater association between g.66493737C>T and best race distance than the Ins227 bp polymorphism does not preclude the Ins227 bp polymorphism being the functional variant. Functional studies will need to be performed to determine the functional variant.

[0187] Notwithstanding this, both/either of these polymorphisms may be used to predict best race distance.

[0188] Thoroughbred horses excel in both sprint (<1,500 m) and longer distance (>1,800 m) races. Horses competing in middle distance races (`milers` and `middle distance`) may be considered either `sprinters` or `stayers` and the way in which a race is executed by the rider often reflects the trainer's perceived sprinting and endurance ability of the horse. Within the industry horses may be described as sprinters based on their conformation and usually have a stockier and more muscular stature and are faster maturing. They usually race as 2 year olds and over shorter distances as 3 year olds. Individuals perceived to be longer distance animals may be referred to as `backward` requiring more time to mature and running over longer distances as 3 year olds. In some regions (e.g. Australia) breeders attempt to breed only faster `sprint` type horses. For example, in the USA Group 1 races>10 f are limited (9% USA, 23% Australia, 28% Britain,) and in Australia 37% of Group 1 races are competed over distances 5-7 f compared to 20% in USA and just 12% in Britain. These selection pressures favour C-alleles, which is reflected in the distribution of genotypes among a sample of elite mares and stallions sampled in Australia (n=43; C/C, 0.41; Ca, 0.47; T/T, 0.12).

[0189] In some aspects, the invention provides a simple DNA based method (genotype test) for predicting the elite sprint race performance of a thoroughbred race horse based on the presence or absence of a SNP or other structural DNA variant (e.g. insertion polymorphism) in one or more exercise response gene. For example the genotype test may be based on a SNP or insertion polymorphism in the MSTN gene and flanking sequences. Details of the SNPs and insertion polymorphism that may be used to predict the elite sprint race performance of a thoroughbred race horse are given in the appendices. It will be appreciated that the genotypic test may be based on a combination of any one or more of these polymorphisms.

Applications of the Assay

[0190] Considering the association between DNA variants such as Chr18g.66495327Ins227 bp66495326 and MSTN 66493737 (T/C) the test may be applied in practice in the following ways:

1. Young stock (foals and yearlings) Informed selection and sales decisions can be made to: [0191] identify sprinters [0192] identify middle-distance/potential Derby winners with speed [0193] identify individuals with enhanced stamina

2. Horses-in-training

[0194] Operating costs can be reduced and racing strategy can be fine tuned by: [0195] identifying the most precocious two-year olds [0196] horses can be trained and raced for optimal racing distance

3. Broodmares

[0197] Breeding outcomes can be optimised by: [0198] focusing on optimal breeding mares [0199] selecting compatible stallions

4. Stallions

[0200] A stallions potential can be promoted by: [0201] predicting stamina index for young stallions (5 year advantage) [0202] attracting compatible mares to enhance stallion profile

[0203] For example, for the Ins227 bp polymorphism for foals, young stock and horses-in-training selection of individuals may be made for individuals most likely to perform well as two year olds (Ins227 bp/Ins227 bp and Ins227 bp/Normal) and against `backward` individuals (industry terminology for less physically developed young Thoroughbreds) that may benefit from waiting to race until they are three years old (Normal/Normal). Breeding objectives may be more confidently met by selecting Ins227 bp/Ins227 bp individuals for short distance racing, Ins227 bp/Normal individuals for middle-distance racing and Normal/Normal individuals for racing requiring greater stamina. For stallion owners, prediction of a stallion's genetic stamina index at the outset of a stud career (five years are required to estimate S.I. from retrospective three year old progeny racing performance) will immediately enhance a young stallion's profile and promote their genetic potential to mare owners. This in turn will enable mare owners, with targeted breeding strategies, to better select stallions to achieve specific breeding objectives. To eliminate uncertainty from a mating outcome (unless both sire and dam are homozygous) it will be necessary to genotype the foal, enabling selection of individuals for a targeted breeding outcome.

Example 7

Application of the Assay to Determine Speed Measured by GPS

[0204] We hypothesized that speed parameters measured using field technologies (GPS) in a cohort of horses-in-training may be influenced by g.66493737C>T genotypes at the myostatin locus.

Study Animals and Training Protocol

[0205] A subset of horses (n=85) from a group of Thoroughbred Flat racehorses (n=102) previously evaluated from a single training stable for physiological performance parameters during training (March-November) in 2007 and 2008 (Fonseca et al., 2010) were included in the current study. The horses included were chosen based on their training stage and fitness in order to make up the most homogeneous group. The study cohort comprised of 55 two-year-olds (18 males and 37 females) and 30 three-year-olds (11 males and 19 females). The criteria for inclusion in the study cohort were each horse must have completed at least 2 WDs prior to the GPS recording (i.e. GPS recordings were taken for .gtoreq.3 accWD) and had for which satisfactory GPS and HR recordings for work days (WD, an exercise workout which simulates a race) in the training period (March to November 2007 or March to November 2008); the GPS and HR data associated with the greatest number of accumulated WD (accWD) for each horse was used.

[0206] The training protocol for the horses has been described previously (Fonseca et al., 2010). Briefly, horses were trained six days per week on an outdoor all-weather gallop 1,500 m in length with a 2.7% incline for the final 800 m. The training program consisted of progressive stages gradually introducing `fast` workouts (WD) as training progressed. WD generally consisted of gallop distances 800-1,000 m. Training was modified and adapted to each individual animal based on soundness, fitness and aptitude. Following the onset of WD, horses were entered into competitive races dependant on their perceived fitness and performance. All decisions on the training and racing schedule were made by a single trainer.

Experimental Protocol and Data Collection

[0207] Measured data were only recorded for horses undergoing a WD which has been previously described (Fonseca et al. 2010). Each jockey carried a hand-sized GPS unit (GPSports Systems SPI10). After data collection and at the end of each day the GPS data were downloaded to an equine-specific software programme (Race watch Software, GPSports Systems SPI10). The GPS unit recorded variables including speed, time and distance as well as the exact map of each horse's exercise. Prior to the onset of the study, the entire gallop had been pre-recorded using one of the GPS units as previously described (Fonseca et al. 2010).

Phenotypes

[0208] All speed measurements were recorded from a distance of 800 m from the finish line as the total distance exercised on a WD differed slightly for each horse. Speed indices evaluated were based on previous work by Fonseca et al. (2010) and included maximal velocity (V.sub.max), duration at V.sub.max (V.sub.maxt), distance (m) travelled during six seconds before V.sub.max (V.sub.maxD6b), distance (m) travelled during six seconds after V.sub.max (V.sub.maxD6a) and distance (m) travelled during six seconds before and after V.sub.max (V.sub.maxD6).

DNA Extraction and MSTN Polymorphism Genotyping.

[0209] Genomic DNA was extracted from fresh whole blood using the Maxwell 16 automated DNA purification system (Promega, WI, USA). Genotyping was carried out using Taqman chemistry on the StepOnePlus.TM. Real-Time PCR System (Applied Biosystems, CA, USA). The assay consisted of forward primer 5'-CCAGGACTATTTGATAGCAGAGTCA (SEQ ID No. 28), reverse primer 3'-GACACAACAGTTTCAAAATATTGTTCTCCTT (SEQ ID No. 29) and two allelic-specific fluorescent dye labeled probes (VIC-AATGCACCAAGTAATTT (SEQ ID No. 30); 6-FAM-ATGCACCAAATAATTT) (SEQ ID No. 31).

Statistical Analyses

[0210] Tests of association were performed using the PLINK Version 1.05 software package (Purcell; Purcell et al. 2007). The linear regression model was used to evaluate quantitative trait association at MSTNg.66493737C>T with the phenotypes: V.sub.max, V.sub.maxt, V.sub.maxD6b, V.sub.maxD6a and V.sub.maxD6. The following were included as covariates in the analyses as they had all been found to contribute to variation in speed indices (Fonseca et al., 2010): Age, Sex, accWD, Jockey and Going.

Results

MSTN Genotypes

[0211] MSTNg.66493737C>T genotypes were determined for all individuals in the study. There were 21 (24.7%) C/C, 44 (51.7%) C/T and 20 (23.5%) T/T individuals, representing a normal distribution of the genotypes previously observed among a large cohort of Flat racehorses (Hill et al., 2010, the entire contents of which is incorporated herein by reference).

MSTN Genotype Association with Speed Indices

[0212] MSTNg.66493737C>T genotypes were significantly associated with V.sub.maxD6 (P=0.0040), V.sub.maxt (P=0.0249), V.sub.max (P=0.0265) and V.sub.maxD6a (P=0.0317) (Table 10). For each speed index the C/C cohort out-performed the C/T and T/T cohorts (Table 11). The mean distance (m) traveled was 3.8 m and 1.2 m greater in the C/C (195.7 m; 98.2 m) than the T/T (191.9 m; 96.9) cohort during the 6 seconds before and after V.sub.max (V.sub.maxD6) and during the 6 seconds after V.sub.max(V.sub.maxD6a). V.sub.max was 0.31 m/s faster in the C/C (16.6 m/s) cohort than the T/T (16.29 m/s) cohort and V.sub.max was maintained (V.sub.maxt) for 2.05 s longer in the C/C (7.3 s) than the T/T (5.25 s) cohort.

TABLE-US-00012 TABLE 10 Association test results between measured speed variables and the MSTNg.66493737C > T SNP TEST NMISS BETA STAT P Acc6b ADD 78 0.0074 0.5426 0.5893 GENO_2DF 78 0.2990 0.8611 Dist6 ADD 74 -2.4790 -3.1470 0.0026 GENO_2DF 74 11.0500 0.0040 Dist6a ADD 78 -0.7972 -1.9090 0.0608 GENO_2DF 78 6.9040 0.0317 Dist6b ADD 75 0.8968 0.1695 0.8660 GENO_2DF 75 1.3920 0.4985 Tvmax ADD 81 -1.0640 -2.1040 0.0392 GENO_2DF 81 7.3850 0.0249 Vmax ADD 85 -0.1613 -2.5260 0.0138 GEN0_2DF 85 7.2620 0.0265

TABLE-US-00013 TABLE 11 Mean values for speed parameters for each genotype. GENO T/T T/C C/C CC:TT Dist6 (m) MEAN 191.9 194.7 195.7 3.8 Dist6a (m) MEAN 96.93 98.23 98.16 1.23 TVmax (s) MEAN 5.25 7.366 7.3 2.05 Vmax (m/s) MEAN 16.29 16.48 16.6 0.31

[0213] These data have demonstrated that genotypes at the MSTNg.66493737C>T locus have a significant influence in the determination of individual differences in speed

Example 8

MSTN Gene Expression in Resting Skeletal Muscle Before and After Training

[0214] The MSTNg.66493737C>T SNP has been found to be significantly associated with Thoroughbred horse racing phenotypes and significant reductions in Thoroughbred skeletal muscle gene expression for three 17 by transcripts 400-1,500 base pairs downstream of the MSTN gene following a period of training have been observed (McGivney et al 2010 BMC Genomics, the entire contents of which is incorporated herein by reference). Together these findings demonstrate that the identified MSTN genotypes may influence MSTN gene expression. To investigate this, MSTN mRNA expression was measured in biopsies from the middle gluteal muscle from 60 untrained yearling Thoroughbreds (C/C, n=15; C/T, n=28; T/T, n=17) using two independent real time qRT-PCR assays. MSTN gene expression was also evaluated in a subset (n=33) of these animals using muscle RNA samples collected after a ten-month period of training. A significant association was observed between genotype and mRNA abundance for the untrained horses (assay I, P=0.0237; assay II, P=0.003559), with the C/C cohort having the highest MSTN mRNA levels, the T/T group the lowest levels and the C/T group intermediate levels. Following training there was a significant decrease in MSTN mRNA (-3.35-fold; P=6.9.times.10.sup.-7) which was most apparent for the C/C cohort (-5.88-fold, P=0.001). These results show a significant association between phenotype, genotype and gene expression at the MSTN gene in Thoroughbred racehorses.

MSTN Gene Expression

[0215] MSTN mRNA expression in two independent real-time qRT-PCR assays (Table 12) has been investigated in resting skeletal muscle (gluteus medius) from biopsy samples that had been collected for n=60 untrained yearlings (C/C, n=15; C/T, n=28; T/T, n=17).

TABLE-US-00014 TABLE 12 Primer sequences for qRT-PCR assays for MSTN gene expression and TTN reference gene expression Primer Name Target Gene Location Sequence TTN_FOR Titin (TTN) Exon 357 gcatgacacaactggaaagc (SEQ ID No. 32) TTN_REV Titin (TTN) Exon 357 aactttgccctcatcaatgc (SEQ ID No. 33) MSTN1-2_FOR Myostatin (MSTN) Exon 1 tgacagcagtgatggctctt (SEQ ID No. 34) MSTN1-2_REV Myostatin (MSTN) Exon 2 ttgggttttccttccacttg (SEQ ID No. 35) MSTN2-3_FOR Myostatin (MSTN) Exon 2 ttcccaagaccaggagaaga (SEQ ID No. 36) MSTN2-3_REV Myostatin (MSTN) Exon 3 cagcatcgagattctgtgga (SEQ ID No. 37)

[0216] We found a significant association with genotype for the MSTN 66493737 (T/C) SNP (P=0.003559). The C/C genotype cohort had higher MSTN mRNA levels (654.3.+-.354.3; 613.7.+-.327.0) than either of the C/T (405.7.+-.234.1; 368.6.+-.213.6) and T/T (350.1.+-.185.5; 348.1.+-.167.2) cohorts (FIG. 10).

[0217] It was also found that MSTN gene expression is significantly down-regulated (-4.2-fold, P=0.0043) following a period of training. In the Thoroughbred horse skeletal muscle transcriptome the greatest reduction in gene expression following a period of training is MSTN gene expression.

[0218] Results from analyses of gene expression generated since our initial report [Hill et al, 2010, the entire contents of which is incorporated herein by reference] of an association between MSTN genomic variation and optimum racing distance in Thoroughbreds support the hypothesis that the MSTN gene is functionally relevant to racing performance variation. In a transcriptome-wide investigation using digital gene expression (DGE) technology, we identified the greatest alteration in mRNA abundance in transcripts from MSTN in Thoroughbred skeletal muscle following a ten-month period of exercise training. Seventy-four annotated transcripts were differentially expressed between pre- and post-training states and among the 58 genes with decreased expression, MSTN mRNA transcripts were the most significantly reduced (-4.2-fold, P=0.0043) (McGivney et al. 2010, the entire contents of which is incorporated herein by reference).

Example 9

[0219] The mechanism by which the g.66493737C>T sequence variant may affect the muscle phenotype in horses is not clear; however we propose a direct effect of the SNP on the control of myocyte development. Myostatin is a growth and differentiation factor (GDF8) that functions as a negative regulator of skeletal muscle mass development and results in hypertrophied muscle phenotypes in a range of mammalian species, including horse. Consistent with this role myostatin has been shown to repress the proliferation and differentiation of cultured myocytes (Thomas et al. 2000; Langley et al. 2002; Joulia et al. 2003). The proliferation of myoblasts is determined by the control and progression of the cell cycle, a role which has been assigned to members of the E2F family of transcription factors (Polager & Ginsberg 2009). The g.66493737C>T SNP is located within the sequence of a putative E2F transcription factor binding site in intron 1 of the MSTN gene. It may therefore be plausible to propose a mechanism by which allele-specific binding of E2F to myostatin influences the growth and development of myocytes following signalling from upstream effector proteins such as retinoblastoma protein (Hallstrom & Nevins 2009). Genotype-specific gene expression studies will shed light on the allele-specific effect on function.

[0220] The predictive tests described herein may be applied to select individuals with high or low genetic potential for racing success. These tests can be performed on an individual at any stage in the life cycle e.g. Day 1 (birth), prior to sales (i.e. yearlings, 2 year olds etc), during racing career (i.e. from 2 years old), during breeding (i.e. up to approx 25 years). Also, the tests may be applied to select appropriate stallion--mare matches for mating based on the genetic make-up of mare and stallion.

[0221] Modifications and additions can be made to the embodiments of the invention described herein without departing from the scope of the invention. For example, while the embodiments described herein refer to particular features, the invention includes embodiments having different combinations of features. The invention also includes embodiments that do not include all of the specific features described.

[0222] The invention is not limited to the embodiments hereinbefore described, which may be varied in construction and detail.

REFERENCES

[0223] Ballard J. W. & Dean M. D. (2001) The mitochondrial genome: mutation, selection and recombination. Curr Opin Genet Dev 11, 667-72. [0224] Barrett J. C., Fry B., Mailer J. & Daly M. J. (2005) Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics 21, 263-5. [0225] Barrett J. C. (2009) Haploview: Visualization and analysis of SNP genotype data. Cold Spring Harb Protoc 2009, pdb ip71. [0226] Barrey E., Valette J. P., Jouglin M., Blouin C. & Langlois B. (1999) Heritability of percentage of fast myosin heavy chains in skeletal muscles and relationship with performance. Equine Vet J Suppl 30, 289-92. [0227] Blier P. U., Dufresne F. & Burton R. S. (2001) Natural selection and the evolution of mtDNA-encoded peptides: evidence for intergenomic co-adaptation. Trends Genet 17, 400-6. [0228] Bray M S, Hagberg J M, Perusse L, Rankinen T, Roth S M, Wolfarth B, Bouchard C. The human gene map for performance and health-related fitness phenotypes: the 2006-2007 update. Med Sci Sports Exerc. 2009 January; 41(1):35-73. [0229] Buitrago M., Lorenz K., Maass A. H., Oberdorf-Maass S., Keller U., Schmitteckert E. M., Ivashchenko Y., Lohse M. J. & Engelhardt S. (2005) The transcriptional repressor Nabl is a specific regulator of pathological cardiac hypertrophy. Nat Med 11, 837-44. [0230] Cartharius K., Frech K., Grote K., Klocke B., Haltmeier M., Klingenhoff A., Frisch M., Bayerlein M. & Werner T. (2005) MatInspector and beyond: promoter analysis based on transcription factor binding sites. Bioinformatics 21, 2933-42. [0231] Clop A., Marcq F., Takeda H., Pirottin D., Tordoir X., Bibe B., Bouix J., Caiment F., Eisen J. M., Eychenne F., Larzul C., Laville E., Meish F., Milenkovic D., Tobin J., Charlier C. & Georges M. (2006) A mutation creating a potential illegitimate microRNA target site in the myostatin gene affects muscularity in sheep. Nat Genet 38, 813-8. [0232] Cunningham E P, Dooley J J, Splan R K, Bradley D G. Microsatellite diversity, pedigree relatedness and the contributions of founder lineages to Thoroughbred horses. Anim Genet. 2001 December; 32(6):360-4. [0233] Das J. (2006) The role of mitochondrial respiration in physiological and evolutionary adaptation. Bioessays 28, 890-901. [0234] Dempsey and Wagner 1999 Exercise-induced arterial hypoxemia. J Appl Physiol. 1999 December; 87(6):1997-2006. Review. PMID: 10601141 [0235] Fukuda R, Zhang H, Kim J W, Shimoda L, Dang C V, Semenza G L. HIF-1 regulates cytochrome oxidase subunits to optimize efficiency of respiration in hypoxic cells. Cell. 2007 Apr. 6; 129(1):111-22. [0236] Gordon D, Abajian C, Green P. Consed: a graphical tool for sequence finishing. Genome Res. 1998 March; 8(3):195-202. [0237] Gramkow and Evans 2006 Gramkow H L, Evans D L. Correlation of race earnings with velocity at maximal heart rate during a field exercise test in Thoroughbred racehorses. Equine Vet J Suppl. 2006 August; (36):118-22. PMID: 17402405. [0238] Grobet L., Martin L. J., Poncelet D., Pirottin D., Brouwers B., Riquet J., Schoeberlein A., Dunner S., Menissier F., Massabanda J., Fries R., Hanset R. & Georges M. (1997) A deletion in the bovine myostatin gene causes the double-muscled phenotype in cattle. Nat Genet 17, 71-4. [0239] Gu J, Orr N, Park S D, Katz L M, Sulimova G, MacHugh D E, Hill E W. A genome scan for positive selection in thoroughbred horses. PLoS One. 2009 Jun. 2; 4(6):e5767. [0240] Gunn H M. Muscle, bone and fat proportions and muscle distribution of thoroughbreds and quarter horses. In: Gillespie J R, Robinson N E eds. Equine exercise physiology 2. Davis, C A: ICEEP; 1987:253-264. [0241] Gunn H. M. (1987) Muscle, bone and fat proportions and muscle distribution of thoroughbreds and quarter horses. In: Equine exercise physiology 2 Proceedings of the Second International Conference on Equine Exercise Physiology; San Diego, Calif. Aug. 7-11, 1986 (eds. By Gillespie J R & Robinson N E), pp. xiii, 810p. ICEEP Publications, Davis, Calif. [0242] Harkins et al., 1993 Harkins J D, Hackett R P, Ducharme N G. Effect of furosemide on physiologic variables in exercising horses. Am J Vet Res. 1993 December; 54(12):2104-9. PMID: 8116946 [0243] Hallstrom T. C. & Nevins J. R. (2009) Balancing the decision of cell proliferation and cell fate. Cell Cycle 8, 532-5. [0244] Hill E. W., McGivney B. A., Gu J., Whiston R. & Machugh D. E. (2010) A genome-wide SNP-association study confirms a sequence variant (g.66493737C>T) in the equine myostatin (MSTN) gene as the most powerful predictor of optimum racing distance for Thoroughbred racehorses. BMC Genomics 11, 552. [0245] Hoppeler and Vogt, 2001 Muscle tissue adaptations to hypoxia. J Exp Biol. 2001 September; 204(Pt 18):3133-9. Review. PMID: 11581327 [0246] Jorgensen T. J., Ruczinski I., Kessing B., Smith M. W., Shugart Y. Y. & Alberg A. J. (2009) Hypothesis-driven candidate gene association studies: practical design and analytical considerations. Am J Epidemiol 170, 986-93. [0247] Joulia D., Bernardi H., Garandel V., Rabenoelina F., Vernus B. & Cabello G. (2003) Mechanisms involved in the inhibition of myoblast proliferation and differentiation by myostatin. Exp Cell Res 286, 263-75. [0248] Langley B., Thomas M., Bishop A., Sharma M., Gilmour S. & Kambadur R. (2002) Myostatin inhibits myoblast differentiation by down-regulating MyoD expression. J Biol Chem 277, 49831-40. [0249] Love S, Wyse C A, Stirk A J, Stear M J, Calver P, Voute L C, Mellor D J. Prevalence, heritability and significance of musculoskeletal conformational traits in Thoroughbred yearlings. Equine Vet J. 2006 November; 38(7):597-603. PMID: 17228572 [0250] Martin Fluck 2006 Functional, structural and molecular plasticity of mammalian skeletal muscle in response to exercise stimuli. The Journal of Experimental Biology 209, 2239-2248 [0251] Matoba S, Kang J G, Patino W D, Wragg A, Boehm M, Gavrilova O, Hurley P J, Bunz F, Hwang P M. p53 regulates mitochondrial respiration. Science. 2006 Jun. 16; 312(5780):1650-3. Epub 2006 May 25. [0252] McGivney B. A., Eivers S. S., MacHugh D. E., MacLeod J. N., O'Gorman G. M., Park S. D., Katz L. M. & Hill E. W. (2009) Transcriptional adaptations following exercise in thoroughbred horse skeletal muscle highlights molecular mechanisms that lead to muscle hypertrophy. BMC Genomics 10, 638. [0253] McGivney B. A., McGettigan P. A., Browne J. A., Evans A. C., Fonseca R. G., Loftus B. J., Lohan A., MacHugh D. E., Murphy B. A., Katz L. M. & Hill E. W. (2010) Characterization of the equine skeletal muscle transcriptome identifies novel functional responses to exercise training. BMC Genomics 11, 398. [0254] McPherron A. C., Lawler A. M. & Lee S. J. (1997) Regulation of skeletal muscle mass in mice by a new TGF-beta superfamily member. Nature 387, 83-90. [0255] McPherron A. C. & Lee S. J. (1997) Double muscling in cattle due to mutations in the myostatin gene. Proc Natl Acad Sci USA 94, 12457-61. [0256] Meiklejohn C. D., Montooth K. L. & Rand D. M. (2007) Positive and negative selection on the mitochondrial genome. Trends Genet 23, 259-63. [0257] Mosher DS, Quignon P, Bustamante CD, Sutter NB, Mellersh CS, Parker HG, Ostrander EA. A mutation in the myostatin gene increases muscle mass and enhances racing performance in heterozygote dogs. PLoS Genet. 2007 May 25; 3(5):e79. Epub 2007 Apr. 30. [0258] Polager S. & Ginsberg D. (2009) p53 and E2f: partners in life and death. Nat Rev Cancer 9, 738-48. [0259] Purcell S. PLINK version 1.05. URL http://pngu.mgh.harvard.edu/purcell/plink/. [0260] Purcell S., Neale B., Todd-Brown K., Thomas L., Ferreira M. A., Bender D., Mailer J., Sklar P., de Bakker P. I., Daly M. J. & Sham P. C. (2007) PLINK: a tool set for whole-genome association and population-based linkage analyses. Am J Hum Genet 81, 559-75. [0261] Revington M. Haematology of the racing Thoroughbred in Australia 2: haematological values compared to performance. Equine Vet J. 1983 April; 15(2):145-8. PMID: 6873047 [0262] Rivero J L, Ruz A, Marti-Koff S, Estepa JC, Aguilera-Tejero E, Werkman J, Sobotta M, Lindner A. Effects of intensity and duration of exercise on muscular responses to training of Thoroughbred racehorses. J Appl Physiol. 2007 May; 102(5):1871-82. Epub 2007 Jan. 25. PMID: 17255370. [0263] Rivero J.-L., L, & Piercy R. J. (2008) Muscle physiology: responses to exercise and training. In: Equine exercise physiology: the science of exercise in the athletic horse (eds. by Hinchcliff K W, Kaneps A J & Geor R J), pp. ix, 463 p. Elsevier Saunders, Edinburgh. [0264] Rivero J. L., Serrano A. L., Henckel P. & Aguera E. (1993) Muscle fiber type composition and fiber size in successfully and unsuccessfully endurance-raced horses. J Appl Physiol 75, 1758-66. [0265] Rozen S. & Skaletsky H. (2000) Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol 132, 365-86. [0266] Saleem A, Adhihetty PJ, Hood DA. Role of p53 in mitochondrial biogenesis and apoptosis in skeletal muscle. Physiol Genomics. 2009 Mar. 3; 37(1):58-66. Epub 2008 Dec. 23. Links [0267] Sambrook, J. and D. Russell (2001). Molecular Cloning; A Laboratory Manual, Cold Spring Harbor Laboratory. [0268] Schuelke M., Wagner K. R., Stolz L. E., Hubner C., Riebel T., Komen W., Braun T., Tobin J. F. & Lee S. J. (2004) Myostatin mutation associated with gross muscle hypertrophy in a child. N Engl J Med 350, 2682-8. [0269] Seaman J, Erickson B K, Kubo K, Hiraga A, Kai M, Yamaya Y, Wagner PD. Exercise induced ventilation/perfusion inequality in the horse. Equine Vet J. 1995 March; 27(2):104-9. PMID: 7607141 [0270] Suzanne S. Eivers, Beatrice A. McGivney, Rita G. Fonseca, David E. MacHugh, Katie Menson, Stephen D. Park, Jose-Luis L. Rivero, Cormac T. Taylor, Lisa M. Katz and Emmeline W. Hill* Exercise-induced skeletal muscle gene expression in unconditioned and conditioned Thoroughbred horses and associations with physiological variables. Physiological Genomics, In Preparation (2009) [0271] Taylor C T, Colgan S P. Therapeutic targets for hypoxia-elicited pathways. Pharm Res. 1999 October; 16(10):1498-505. Review. PMID: 10554089. [0272] Tabor H. K., Risch N. J. & Myers R. M. (2002) Opinion: Candidate-gene approaches for studying complex genetic traits: practical considerations. Nat Rev Genet 3, 391-7. [0273] Thiel G., Kaufmann K., Magin A., Lietz M., Bach K. & Cramer M. (2000) The human transcriptional repressor protein NAB1: expression and biological activity. Biochim Biophys Acta 1493, 289-301. [0274] Thomas M., Langley B., Berry C., Sharma M., Kirk S., Bass J. & Kambadur R. (2000) Myostatin, a negative regulator of muscle growth, functions by inhibiting myoblast proliferation. J Biol Chem 275, 40235-43. [0275] van Baren M. J. & Heutink P. (2004) The PCR suite. Bioinformatics 20, 591-3. [0276] van Deursen et al. 1993 Skeletal muslces of mice deficient in muscle creatine kinase lack burst activity Cell 74: 621-631. [0277] Wade C. M., Giulotto E., Sigurdsson S., Zoli M., Gnerre S., Imsland F., Lear T. L., Adelson D. L., Bailey E., Bellone R. R., Blocker H., Distl O., Edgar R. C., Garber M., Leeb T., Mauceli E., MacLeod J. N., Penedo M. C., Raison J. M., Sharpe T., Vogel J., Andersson L., Antczak D. F., Biagi T., Binns M. M., Chowdhary B. P., Coleman S. J., Della Valle G., Fryc S., Guerin G., Hasegawa T., Hill E. W., Jurka J., Kiialainen A., Lindgren G., Liu J., Magnani E., Mickelson J. R., Murray J., Nergadze S. G., Onofrio R., Pedroni S., Piras M. F., Raudsepp T., Rocchi M., Roed K. H., Ryder O. A., Searle S., Skow L., Swinburne J. E., Syvanen A. C., Tozaki T., Valberg S. J., Vaudin M., White J. R., Zody M. C., Lander E. S. & Lindblad-Toh K. (2009) Genome sequence, comparative analysis, and population genetics of the domestic horse. Science 326, 865-7. [0278] Weatherby and Sons (1791) An Introduction to a General Stud Book. Weatherby and Sons, London. [0279] Weber K, Bruck P, Mikes Z, Kiipper J H, Klingenspor M, Wiesner R J. Glucocorticoid hormone stimulates mitochondrial biogenesis specifically in skeletal muscle. Endocrinology. 2002 January; 143(1):177-84. [0280] Willett P. (1981) The classic racehorse. Stanley Paul, London. [0281] Williamson S. A. & Beilharz R. G. (1998) The inheritance of speed, stamina and other racing performance characters in the Australian Thoroughbred. J Anim Breed Genet 115, 1-16. [0282] Yang Q, Khoury M J, Botto L, Friedman J M, Flanders W D. Improving the prediction of complex diseases by testing for multiple disease-susceptibility genes. Am J Hum Genet. 2003 March; 72(3):636-49. Epub 2003 Feb. 14. [0283] Young L E, Rogers K, Wood J L. Left ventricular size and systolic function in Thoroughbred racehorses and their relationships to race performance. J Appl Physiol. 2005 October; 99(4):1278-85. Epub 2005 May 26. PMID: 15920096 [0284] Zhou M., Wang Q., Sun J., Li X., Xu L., Yang H., Shi H., Ning S., Chen L., Li Y., He T. & Zheng Y. (2009) In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach. Genomics 94, 125-31.

Sequence CWU 1

1

38124DNAEquus caballusmisc_featureMSTN 3'UTR PCR Forward Primer 1tactcccaca aagatgtctc caat 24223DNAEquus caballusmisc_featureMSTN 3'UTR PCR Reverse Primer 2tgaatcacct cctgcattag act 23320DNAEquus caballusmisc_featureMSTN 3'UTR Sequencing Primer 1 (Forward) 3gaatggctga tgtcatcagg 20420DNAEquus caballusmisc_featureMSTN 3'UTR Sequencing Primer 1 (Reverse) 4cctgatgaca tcagccattc 20520DNAEquus caballusmisc_featureMSTN 3'UTR Sequencing Primer 2 (Forward) 5caaatctcaa cgttccattg 20620DNAEquus caballusmisc_featureMSTN 3'UTR Sequencing Primer 2 (Reverse) 6caatggaacg ttgagatttg 20720DNAEquus caballusmisc_featureMSTN 5'UTR PCR Forward Primer 7ctggtttgtg tctggttttc 20822DNAEquus caballusmisc_featureMSTN 5'UTR PCR Reverse Primer 8cttttccttc ctgcttacat ac 22920DNAEquus caballusmisc_featureMSTN 5'UTR Sequencing Primer 1 (Forward) 9aacaaaacaa acaggcaccc 201020DNAEquus caballusmisc_featureMSTN 5'UTR Sequencing Primer 1 (Reverse) 10gggtgcctgt ttgttttgtt 201123DNAEquus caballusmisc_featureMSTN 5'UTR Sequencing Primer 2 (Forward) 11gtcaggaaaa caagtttctc aaa 231223DNAEquus caballusmisc_featureMSTN 5'UTR Sequencing Primer 2 (Reverse) 12tttgagaaac ttgttttcct gac 231320DNAEquus caballusmisc_featureMSTN 5'UTR Sequencing Primer 3 (Forward) 13gacagcgaga ttcattgtgg 201420DNAEquus caballusmisc_featureMSTN 5'UTR Sequencing Primer 3 (Reverse) 14ccacaatgaa tctcgctgtc 201520DNAEquus caballusmisc_featureMSTN 5'UTR Sequencing Primer 4 (Forward) 15cctgtttgtg ctgattcttg 201620DNAEquus caballusmisc_featureMSTN 5'UTR Sequencing Primer 4 (Reverse) 16caagaatcag cacaaacagg 201723DNAEquus caballusmisc_featureForward primer for genotyping the Ins227bp polymorphism 17atcagctcac ccttgactgt aac 231823DNAEquus caballusmisc_featurereverse primer for genotyping the Ins227bp polymorphism 18tcatctctct ggacatcgta ctg 2319403DNAEquus caballusmisc_featureMSTN EquCab2.0 66493737_T/C SNP 19agctaagcaa gtaattagca caaaaatttg aatgttatat tcaggctatc tcaaaagtta 60gaaaatactg tctttagagc caggctgtca ttgtgagcaa aatcactagc aatttctttt 120attttggttc cccaagattg tttataaata aggtaaatct actccaggac tatttgatag 180cagagtcata aaggaaaatt ayttggtgca ttataacctg attacttaat aaggagaaca 240atattttgaa actgttgtgt cctgtttaaa gtagataaag cactgggtaa agcaggatcg 300cagacacatg gcacagaatc ttccgtgtca tgccttctct gtgaaggtgt ctgtctccct 360ttccttgagt gtagttatga actgactgca aaaagaatat atg 40320403DNAEquus caballusmisc_featureMSTN EquCab2.0 66494218_A/C SNP 20aggagattat taagcaatgt gcctgcctgg aaatgtgcac cccgggtgct ctcaacaata 60gtactatggt caaggtgtaa gcaggactct gagctataac ctctttgatt aaaatgttta 120tttattaggc attttatgat aattagctca tgattatcat tatgctatgt ttacttcatc 180atttttctta ctaatacatt amattttaaa aaatattttt cctaatctcc aggggaataa 240ctttcaaaat ctaatatgtt aatttgtgaa gaacataaaa acactatgag aaatagtttt 300gagtaacaga agtcattttg gtgttcagca aatgctcaaa tgacctaaac gtctacaaat 360ttcttccttc tctattatta gtgaaaaaaa cttgttatta taa 40321401DNAEquus caballusmisc_featureBIEC2-417495 C/T SNP 21cataaggtca aatatttttc ccatttccct cttttattaa aataccacat ttatttggaa 60aatcattact cagctctatt gcttactaat tattttaaga tagaaaaaat attttgtcgc 120aaagaaagat ttcaagacat ctttatggct atataaatat ttatgcatct ttttaaatac 180cttgattgat tggttttaga ytgtctcaga ttccatctga tttctctgcc tccctgataa 240accttcttca atctctgttc cctggcctat gaaggtcacc ttcaaaatat tatcaccttt 300atgtaatgat cagacacaaa gtctaaccat catctaaatt atttcaatat gaagcatgac 360taataaacca gtatgagtag ttttcaaagt gaacaggatt t 40122401DNAEquus caballusmisc_featureBIEC2-417372 G/A SNP 22gcctggatat gaagcccata agaaatgtct ggcagtggtc tcttgagatc agaaagagaa 60tgggagatta ggaagttaga ataggaagca agtgaggcag caggtagygg aggctaggtg 120gcccatctgt gagttttttc cttctgaact ccttacaatt ctttataaaa ttccatgaag 180gcctcatttc aagataaagg rgaagaaaat attttctcct aaaaaagctt aaacttaata 240ttctacttct caaaaaaaat tcaaagaggc ctaatagatt gactggaact ctaactgaaa 300tttgcctcgc tttcccaaat tcttactgga gaagggcaag gcctcgcccc tctcagaact 360cttacatgag attgctgctt tccttagttt ctgatcactg t 40123227DNAEquus caballusmisc_featureMSTN Ins227bp 23ggggctggcc ccgtggccga gtggttaagt tcgtgcgctc cgctgcaggc ggcccagtgt 60ttcgtcggtt cgagtcctgg gcgcggacat ggcactgctc gtcggaccac gctgaggcag 120cgtcccacat gccacaacta gaggaaccca caacgaagaa tacacaacta tgtaccgggg 180ggctttgggg agaaaaagga aaataaaatc tttaaaaagc cacttgg 22724422DNAEquus caballusmisc_featureMSTN 3'UTR SNP 1 24tatataccat cattttgatt atccttatac acttgaattt atattgtata atagcatact 60tggtaagatg aaattccaca aaaataggaa tggtacacca tatgcaagtt tccattccta 120ttgtgattga tacagtacat taacaatcca caccaatggt gctaatacaa ataggctgaa 180tggctgatgt catcaggttt atmaaataaa aacatccaat aaaataatgt ttctcctttc 240ttcaggtgca ttttccaaat ggggaatgga ttttctttaa tgaaagaaga atcatttttc 300tagaggtcag gatttaattc tgtagcatac ttggagaaac tgcattacct taaaaggcag 360ccaaaaagta ttcattttta tcaaaatttc aaaattgcag cctgcttttg caacattgca 420gt 42225484DNAEquus caballusmisc_featureMSTN 3'UTR SNP 2 25atccaataaa ataatgtttc tcctttcttc aggtgcattt tccaaatggg gaatggattt 60tctttaatga aagaagaatc atttttctag aggtcaggat ttaattctgt agcatacttg 120gagaaactgc attaccttaa aaggcagcca aaaagtattc atttttatca aaatttcaaa 180attgcagcct gcttttgcaa cattgcagtt tttatgataa aataatggaa aygactgatt 240ctgtcaatat tgtataaaaa gactttgaga caattgcatt tatataatat gtatacaata 300ttgtttttgt aaataagcgt ctcctttttt atttactttg gtatattttt acagtcagaa 360catttcaaat taagtattaa ggcacaaaga catgtcatgt atgacagaaa agcaactgct 420tatatttcgg ggcaaattag cagattaaat agtggtctta aaactccata tgctaatggt 480taga 48426542DNAEquus caballusmisc_featureMSTN 3'UTR SNP 3 26atccaataaa ataatgtttc tcctttcttc aggtgcattt tccaaatggg gaatggattt 60tctttaatga aagaagaatc atttttctag aggtcaggat ttaattctgt agcatacttg 120gagaaactgc attaccttaa aaggcagcca aaaagtattc atttttatca aaatttcaaa 180attgcagcct gcttttgcaa cattgcagtt tttatgataa aataatggaa atgactgatt 240ctrtcaatat tgtataaaaa gactttgaga caattgcatt tatataatat gtatacaata 300ttgtttttgt aaataagcgt ctcctttttt atttactttg gtatattttt acagtcagaa 360catttcaaat taagtattaa ggcacaaaga catgtcatgt atgacagaaa agcaactgct 420tatatttcgg ggcaaattag cagattaaat agtggtctta aaactccata tgctaatggt 480tagatggtta tattacaatc attttatatt tttttacatt attaacattc acttatagat 540tc 54227293DNAEquus caballusmisc_featureMSTN 3'UTR SNP 4 27tcaatttcca aatgcattgc agttggcaag ggtatatggt cctagagtta caagttctac 60tgaagccaca ggaacacagg gaagctgcat ctttttttct agcacttaat gataccagca 120catttatctg agctttgggg gtaccaattt tcawattgaa ttgaaaaata atcataaagt 180gcctagaaat tcttaagtgc aacactgtac ataaatgttt ttgaagtgaa ctctcttctc 240tactgcttat cagtttagta agttagctat aaagcagtga ctaagtctat gag 2932825DNAEquus caballusmisc_featureMSTN polymorphism genotyping forward primer 28ccaggactat ttgatagcag agtca 252931DNAEquus caballusmisc_featureMSTN polymorphism genotyping reverse primer 29gacacaacag tttcaaaata ttgttctcct t 313017DNAEquus caballusmisc_featureMSTN polymorphism genotyping probe 30aatgcaccaa gtaattt 173116DNAEquus caballusmisc_featureMSTN polymorphism genotyping probe 31atgcaccaaa taattt 163220DNAEquus caballusmisc_featureTTN forward primer 32gcatgacaca actggaaagc 203320DNAEquus caballusmisc_featureTTN reverse primer 33aactttgccc tcatcaatgc 203420DNAEquus caballusmisc_featureMSTN1-2 forward primer 34tgacagcagt gatggctctt 203520DNAEquus caballusmisc_featureMSTN1-2 reverse primer 35ttgggttttc cttccacttg 203620DNAEquus caballusmisc_featureMSTN2-3 forward primer 36ttcccaagac caggagaaga 203720DNAEquus caballusmisc_featureMSTN2-3 reverse primer 37cagcatcgag attctgtgga 2038467DNAEquus caballusmisc_featureMSTN Ins227bp and flanking sequences 38ttgtgacaga cagggtttta acctctgaca gcgagattca ttgtggagca ggagccaatc 60atagatcctg acgacacttg tctcatcaaa gttggaatat aaaaagccac ttggggggct 120ggccccgtgg ccgagtggtt aagttcgtgc gctccgctgc aggcggccca gtgtttcgtc 180ggttcgagtc ctgggcgcgg acatggcact gctcgtcgga ccacgctgag gcagcgtccc 240acatgccaca actagaggaa cccacaacga agaatacaca actatgtacc ggggggcttt 300ggggagaaaa aggaaaataa aatctttaaa aagccacttg gaatacagta taaaagattc 360actggtgtgg caagttgtct ctcagactgt acaggcatta aaattttgct tggcattgct 420caaaagcaaa agaaaagtaa aaggaagaaa taagagcaag gaaaaag 467

Claims

1. A method for predicting the athletic performance potential of a subject comprising the step of: assaying a biological sample from a subject for a genetic variant in linkage disequilibrium with MSTN-66493737 (T/C) SNP.

2. A method as claimed in claim 1 wherein the subject is an equine.

3. A method as claimed in claim 2 wherein the genetic variant is located in equine chromosome 18.

4. A method as claimed in claim 3 wherein the genetic variant is located in the MSTN gene region.

5. A method as claimed in claim 4 wherein the genetic variant is located in the MSTN gene flanking region.

6. A method as claimed in claim 3 wherein the genetic variant is chosen from one or more of: BIEC2-417495 SNP, BIEC2-417372 SNP, MSTN Ins227 bp mutation, MSTN 3'UTR SNP1, MSTN 3'UTR SNP2, MSTN 3'UTR SNP3, or MSTN 3'UTR SNP4.

7. A method as claimed in claim 3 wherein the genetic variant is BIEC2417495 SNP.

8. A method as claimed in claim 7 wherein the presence of a C allele is indicative of elite athletic performance.

9. A method as claimed in claim 7 wherein the presence of a homozygous CC genotype is indicative of elite athletic performance.

10. A method as claimed in claim 1 wherein the elite athletic performance is elite sprinting performance.

11. A method as claimed in claim 1 wherein the biological sample of the subject is chosen from one or more of: blood, saliva, skeletal muscle, hair, semen, bone marrow, soft tissue, internal organ biopsy sample or skin.

12. An assay for determining the athletic performance potential of a subject comprising the steps of: obtaining a biological sample from the subject; extracting or releasing DNA from the biological sample; and identifying a genetic variant in linkage disequilibrium with MSTN-66493737 (T/C) SNP in the biological sample wherein the athletic performance potential of the subject is associated with the genetic variant and/or the MSTN-66493737 (T/C) SNP.

13. An assay as claimed in claim 12 wherein the DNA is genomic DNA.

14. An assay as claimed in claim 12 comprising the step of: amplifying a target sequence in the extracted or released DNA prior to the step of identifying a genetic variant in linkage disequilibrium with MSTN-66493737 (T/C) SNP

15. An assay as claimed in claim 12 wherein the subject is an equine.

16. A method for predicting the athletic performance potential of a subject comprising the step of: assaying a biological sample from a subject for the presence of (i) a MSTN-66493737 (T/C) SNP and (ii) a genetic variant in linkage disequilibrium with the MSTN-66493737 (T/C) SNP.

17. An assay for determining the athletic performance potential of a subject comprising the steps of: obtaining a biological sample from the subject; extracting or releasing DNA from the biological sample; and identifying (i) a MSTN-66493737 (T/C) SNP and (ii) a genetic variant in linkage disequilibrium with the MSTN-66493737 (T/C) SNP in the biological sample wherein the athletic performance potential of the subject is associated with the MSTN-66493737 (T/C) SNP and/or the genetic variant.

18. A method for predicting the athletic performance potential of a subject comprising the step of assaying a biological sample from a subject for the presence of a DNA polymorphism (SNP or insertion) in the MSTN gene and/or flanking sequences.

19. A method as claimed in claim 18 wherein the DNA polymorphism is an insertion polymorphism.

20. A method as claimed in claim 18 wherein the polymorphism is Chr18g.66495327Ins227 bp66495326.

21. A method as claimed in claim 20 wherein the presence of a Ins227 bp allele is indicative of elite athletic performance.

22. A method as claimed in claim 20 wherein the presence of a homozygous Ins227 bp/Ins227 bp genotype is indicative of elite athletic performance.

23. A method as claimed in claim 18 wherein the elite athletic performance is elite sprinting performance.

24. A method as claimed in claim 18 wherein the biological sample of the subject is selected from the group comprising: blood, saliva, skeletal muscle, hair, semen, bone marrow, soft tissue, internal organ biopsy sample and skin.

25. A method as claimed in claim 18 wherein the subject is from a competitive racing species.

26. A method as claimed in claim 18 wherein the subject is an equine

27. A method as claimed in claim 18 wherein the subject is chosen from one or more of a thoroughbred race horse, a standardbred trotter, a French trotter, a Quarter horse, or a competitive jumping horse.

28. An assay for determining the athletic performance potential of a subject comprising the steps of: obtaining a sample; extracting or releasing DNA from the sample; and identifying a polymorphism (SNP or insertion) in a target sequence from an MSTN gene associated with athletic performance in the extracted or released DNA wherein the athletic performance potential of a subject is associated with the polymorphism.

29. An assay for use in determining the athletic performance potential of a subject comprising a detector for detecting the presence of a polymorphism (SNP or insertion) in the MSTN gene and/or flanking sequences.

30. An assay for determining the athletic potential of a subject comprising the step of: obtaining a sample; extracting or releasing DNA from the sample; and identifying the genotype of the Chr18g.66495327Ins227 bp66495326 polymorphism in the extracted or released DNA wherein the presence of a Ins227 bp allele in the Chr18g.664953271 ns227 bp66495326 polymorphism is indicative of elite athletic performance.