U.S. patent application number 12/796573 was filed with the patent office on 2011-10-27 for cationic lipids and methods of use.
This patent application is currently assigned to Protiva Biotherapeutics, Inc.. Invention is credited to James Heyes, Ian MacLachlan, Lorne R. Palmer.
Application Number | 20110262527 12/796573 |
Document ID | / |
Family ID | 35503560 |
Filed Date | 2011-10-27 |
United States Patent
Application |
20110262527 |
Kind Code |
A1 |
Heyes; James ; et
al. |
October 27, 2011 |
CATIONIC LIPIDS AND METHODS OF USE
Abstract
The present invention provides compositions comprising cationic
lipids, liposomes and nucleic acid-lipid particles comprising the
cationic lipids, and methods of using such compositions, liposomes,
and nucleic acid-lipid particles.
Inventors: |
Heyes; James; (Vancouver,
CA) ; MacLachlan; Ian; (Vancouver, CA) ;
Palmer; Lorne R.; (Vancouver, CA) |
Assignee: |
Protiva Biotherapeutics,
Inc.
Burnaby
CA
|
Family ID: |
35503560 |
Appl. No.: |
12/796573 |
Filed: |
June 8, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11148430 |
Jun 7, 2005 |
7745651 |
|
|
12796573 |
|
|
|
|
60679427 |
May 9, 2005 |
|
|
|
60610746 |
Sep 17, 2004 |
|
|
|
60578075 |
Jun 7, 2004 |
|
|
|
Current U.S.
Class: |
424/450 ;
435/375; 435/458; 514/1.1; 514/44A; 514/44R; 564/504 |
Current CPC
Class: |
C12N 15/88 20130101;
A61P 25/00 20180101; A61K 9/1617 20130101; A61P 35/00 20180101;
A61P 37/02 20180101; A61K 47/26 20130101; A61K 9/1271 20130101;
A61K 48/00 20130101; A61K 48/0025 20130101; A61P 43/00 20180101;
A61K 47/6911 20170801; A61P 31/00 20180101; C07C 217/28 20130101;
C07C 217/40 20130101; A61K 9/0019 20130101; A61P 29/00
20180101 |
Class at
Publication: |
424/450 ;
435/458; 435/375; 564/504; 514/1.1; 514/44.R; 514/44.A |
International
Class: |
A61K 9/127 20060101
A61K009/127; C12N 5/071 20100101 C12N005/071; C07C 217/28 20060101
C07C217/28; A61K 38/02 20060101 A61K038/02; A61K 31/7088 20060101
A61K031/7088; A61P 31/00 20060101 A61P031/00; A61K 31/7105 20060101
A61K031/7105; A61P 37/02 20060101 A61P037/02; A61P 29/00 20060101
A61P029/00; A61P 25/00 20060101 A61P025/00; A61P 35/00 20060101
A61P035/00; C12N 15/88 20060101 C12N015/88; A61K 31/713 20060101
A61K031/713 |
Claims
1.-7. (canceled)
8. A liposome, said liposome comprising a cationic lipid of Formula
I having the following structure: ##STR00009## wherein: R.sup.1 and
R.sup.2 are independently selected from the group consisting of: H
and C.sub.1-C.sub.3 alkyls; and R.sup.3 and R.sup.4 are
independently selected from the group consisting of alkyl groups
having from about 10 to about 20 carbon atoms, wherein at least one
of R.sup.3 and R.sup.4 comprises at least two sites of
unsaturation.
9. The liposome in accordance with claim 8, further comprising a
non-cationic lipid.
10. The liposome in accordance with claim 9, wherein said
non-cationic lipid is a member selected from the group consisting
of dioleoylphosphatidylethanolamine (DOPE),
palmitoyloleoylphosphatidylcholine (POPC), egg phosphatidylcholine
(EPC), distearoylphosphatidylcholine (DSPC),
palmitoyloleyolphosphatidylglycerol (POPG), dipalmitoyl
phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine
(DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE),
16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE,
palmitoyloleoyl-phosphatidylethanolamine (POPE),
1-stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), cholesterol,
and a mixture thereof.
11. The liposome in accordance with claim 8, further comprising a
PEG-lipid.
12. The liposome in accordance with claim 10, wherein said
PEG-lipid is selected from the group consisting of: a
polyethyleneglycol-diacylglycerol (PEG-DAG) conjugate, a
polyethyleneglycol-dialkyloxypropyl (PEG-DAA) conjugate, a
PEG-ceramide, a PEG-PE, and mixtures thereof.
13. The liposome in accordance with claim 8, further comprising a
bioactive agent.
14. The liposome in accordance with claim 13, wherein said
bioactive agent is a member selected from the group consisting of:
an antineoplastic agent, an antibiotic, an immunomodulator, an
anti-inflammatory agent, an agent acting on the central nervous
system, a polypeptide, and a nucleic acid.
15. A method of delivering a bioactive agent to a cell, said method
comprising contacting said cell with a liposome of claim 8, wherein
said bioactive agent is encapsulated in said liposome.
16. The method of claim 15, wherein said is in a mammal.
17. A nucleic acid-lipid particle comprising: (a) a nucleic acid;
(b) a cationic lipid of Formula I and having the following
structure: ##STR00010## wherein: R.sup.1 and R.sup.2 are
independently selected from the group consisting of: H and
C.sub.1-C.sub.3 alkyls; and R.sup.3 and R.sup.4 are independently
selected from the group consisting of alkyl groups having from
about 10 to about 20 carbon atoms, wherein at least one of R.sup.3
and R.sup.4 comprises at least two sites of unsaturation; (c) a
non-cationic lipid; and (d) a PEG-lipid conjugate.
18. The nucleic acid-lipid particle in accordance with claim 17,
wherein said cationic lipid is selected from the group consisting
of: 1,2-DiLinoleyloxy-N,N-dimethylaminopropane (DLinDMA) and
1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA).
19. The nucleic acid-lipid particle in accordance with claim 17,
wherein said cationic lipid is DLinDMA.
20. The nucleic acid-lipid particle in accordance with claim 17,
wherein said non-cationic lipid is a member selected from the group
consisting of dioleoylphosphatidylethanolamine (DOPE),
palmitoyloleoylphosphatidylcholine (POPC), egg phosphatidylcholine
(EPC), distearoylphosphatidylcholine (DSPC),
palmitoyloleyolphosphatidylglycerol (POPG), dipalmitoyl
phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine
(DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE),
16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE,
palmitoyloleoyl-phosphatidylethanolamine (POPE),
1-stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), cholesterol,
and a mixture thereof.
21. The nucleic acid-lipid particle in accordance with claim 17,
wherein said non-cationic lipid is DSPC.
22. The nucleic acid-lipid particle in accordance with claim 17,
wherein said PEG-lipid is a member selected from the group
consisting of: a polyethyleneglycol-diacylglycerol (PEG-DAG)
conjugate, a polyethyleneglycol-dialkyloxypropyl (PEG-DAA)
conjugate, a PEG-ceramide, a PEG-PE, and mixtures thereof.
23. The nucleic acid-lipid particle in accordance with claim 17,
wherein said PEG-lipid is a PEG-DAA conjugate.
24. The nucleic acid-lipid particle in accordance with claim 23,
wherein the PEG-DAA conjugate is PEG-dimyristyloxypropyl (C14).
25. The nucleic acid-lipid particle in accordance with claim 17,
further comprising a sterol.
26. The nucleic acid-lipid particle in accordance with claim 25,
wherein the sterol is cholesterol.
27. The nucleic acid-lipid particle in accordance with claim 17,
wherein said nucleic acid is a member selected from the group
consisting of: DNA, RNA, siRNA, a plasmid, an antisense
oligonucleotide, a ribozyme.
28. The nucleic acid-lipid particle in accordance with claim 17,
wherein said nucleic acid encodes a therapeutic product of
interest.
29. The nucleic acid-lipid particle in accordance with claim 28,
wherein said therapeutic product of interest is a member selected
from the group consisting of: a polypeptide and a small interfering
RNA (siRNA).
30. The nucleic acid-lipid particle in accordance with claim 17,
wherein the nucleic acid in said nucleic acid-lipid particle is not
substantially degraded after exposure of said particle to a
nuclease at 37.degree. C. for 20 minutes.
31. The nucleic acid-lipid particle in accordance with claim 17,
wherein the nucleic acid is fully encapsulated in said nucleic
acid-lipid particle.
32. The nucleic acid-lipid particle in accordance with claim 17,
wherein said cationic lipid comprises from about 2% to about 60% of
the total lipid present in said particle.
33. The nucleic acid-lipid particle in accordance with claim 17,
wherein said cationic lipid comprises from about 5% to about 45% of
the total lipid present in said particle.
34. The nucleic acid-lipid particle in accordance with claim 17,
wherein said cationic lipid comprises from about 15% to about 40%
of the total lipid present in said particle.
35. The nucleic acid-lipid particle in accordance with claim 17,
wherein said cationic lipid comprises about 30% of the total lipid
present in said particle.
36. The nucleic acid-lipid particle in accordance with claim 17,
wherein said cationic lipid comprises from about 40% to about 50%
of the total lipid present in said particle.
37. The nucleic acid-lipid particle in accordance with claim 17,
wherein said non-cationic lipid comprises from about 5% to about
90% of the total lipid present in said particle.
38. The nucleic acid-lipid particle in accordance with claim 17,
wherein said non-cationic lipid comprises from about 20% to about
85% of the total lipid present in said particle.
39. The nucleic acid-lipid particle in accordance with claim 17,
wherein said PEG-lipid comprises from 1% to about 20% of the total
lipid present in said particle.
40. The nucleic acid-lipid particle in accordance with claim 17,
wherein said PEG-lipid comprises from 4% to about 15% of the total
lipid present in said particle.
41. The nucleic acid-lipid particle in accordance with claim 25,
wherein the sterol comprises from about 10% to about 60% of the
total lipid present in said particle.
42. The nucleic acid-lipid particle in accordance with claim 25,
wherein the sterol comprises from about 20% to about 45% of the
total lipid present in said particle.
43. A pharmaceutical composition comprising a nucleic acid-lipid
particle in accordance with claim 17 and a pharmaceutically
acceptable carrier.
44. A method of introducing a nucleic acid into a cell, said method
comprising contacting said cell with a nucleic acid-lipid particle
comprising: (a) a cationic lipid of Formula I and having the
following structure: ##STR00011## wherein: R.sup.1 and R.sup.2 are
independently selected from the group consisting of: H and
C.sub.1-C.sub.3 alkyls; and R.sup.3 and R.sup.4 are independently
selected from the group consisting of alkyl groups having from
about 10 to about 20 carbon atoms, wherein at least one of R.sup.3
and R.sup.4 comprises at least two sites of unsaturation. (b) a
non-cationic lipid; (c) a PEG-lipid conjugate; and (d) a nucleic
acid.
Description
CROSS-REFERENCES TO RELATED APPLICATIONS
[0001] This application is a Continuation of U.S. patent
application Ser. No. 11/148,430 filed Jun. 7, 2005 and claims the
benefit of U.S. Provisional Patent Application Nos. 60/ 578,075
filed Jun. 7, 2004, 60/610,746, filed Sep. 17, 2004, and
60/679,427, filed May 9, 2005, the disclosures of each of which is
incorporated by reference in its entirety for all purposes.
BACKGROUND OF THE INVENTION
[0002] An effective and safe gene delivery system is required for
gene therapy to be clinically useful. Viral vectors are relatively
efficient gene delivery systems, but suffer from a variety of
limitations, such as the potential for reversion to the wild type
as well as immune response concerns. As a result, nonviral gene
delivery systems are receiving increasing attention (Worgall, et
al., Human Gene Therapy 8:37-44 (1997); Peeters, et al., Human Gene
Therapy 7:1693-1699 (1996); Yei, et al., Gene Therapy 1:192-200
(1994); Hope, et al., Molecular Membrane Biology 15:1-14 (1998)).
Plasmid DNA-cationic liposome complexes are currently the most
commonly employed nonviral gene delivery vehicles (Felgner,
Scientific American 276:102-106 (1997); Chonn, et al., Current
Opinion in Biotechnology 6:698-708 (1995)). However, complexes are
large, poorly defined systems that are not suited for systemic
applications and can elicit considerable toxic side effects
(Harrison, et al., Biotechniques 19:816-823 (1995); Huang, et al.,
Nature Biotechnology 15:620-621 (1997); Templeton, et al., Nature
Biotechnology 15:647-652 (1997); Hofland, et al., Pharmaceutical
Research 14:742-749 (1997)).
[0003] Recent work has shown that plasmid DNA can be encapsulated
in small (.about.70 nm diameter) "stabilized plasmid-lipid
particles" (SPLP) that consist of a single plasmid encapsulated
within a bilayer lipid vesicle (Wheeler, et al., Gene Therapy
6:271-281 (1999)). These SPLPs typically contain the "fusogenic"
lipid dioleoylphosphatidyl-ethanolamine (DOPE), low levels of
cationic lipid, and are stabilized in aqueous media by the presence
of a poly(ethylene glycol) (PEG) coating. SPLP have systemic
application as they exhibit extended circulation lifetimes
following intravenous (i.v.) injection, accumulate preferentially
at distal tumor sites due to the enhanced vascular permeability in
such regions, and can mediate transgene expression at these tumor
sites. The levels of transgene expression observed at the tumor
site following i.v. injection of SPLP containing the luciferase
marker gene are superior to the levels that can be achieved
employing plasmid DNA-cationic liposome complexes (lipoplexes) or
naked DNA. Still, improved levels of expression may be required for
optimal therapeutic benefit in some applications (see, e.g., Monck,
et al., J. Drug Targ. 7:439-452 (2000)).
[0004] Typically, both liposomes and SPLPs comprise cationic
lipids. Often the cationic lipids have 2 alkyl chains, ether
(oxygen) bonds, and an amine head group such as, e.g., DODAC and
DODMA. Typically the alkyl chains comprise a single site of
unsaturation. Unfortunately, cationic lipids with only a single
site of unsaturation can lack flexibility. Liposomes or SPLP
comprising these cationic lipids can lack sufficient membrane
fluidity, thus impacting the efficiency of delivery of a bioactive
agent to a cell or to a patient.
[0005] Lipid flexibility is important in the development of
liposomal or SPLP drug delivery systems. Therefore, it is desirable
to develop cationic lipids that are more flexible, thereby,
increasing the membrane fluidity of the liposomes or the SPLP. The
present invention addresses this and other needs.
SUMMARY OF THE INVENTION
[0006] The present invention provides novel cationic lipids that
have increased flexibility over commonly used cationic lipids (such
as DODAC and DODMA). More particularly, it has surprisingly been
found that the cationic lipids of the present invention enhance the
properties of liposomes as well as nucleic acid-lipid particles
(SPLPs) by increasing the membrane fluidity of the liposome or
SPLP, thus increasing the efficiency of delivery of bioactive
agents in the liposomes and SPLP. In particular, the present
invention provides compounds of Formula I having the following
structure:
##STR00001##
[0007] In the compounds of Formula I, above, R.sup.1 and R.sup.2
are independently and are H or C.sub.1-C.sub.3 alkyls. R.sup.3 and
R.sup.4 are independently selected in the compounds of Formula I,
and are alkyl groups having from about 10 to about 20 carbon atoms,
and at least one of R.sup.3 and R.sup.4 comprises at least two
sites of unsaturation. R.sup.3 and R.sup.4 may be the same or
different. If different, R.sup.3 and R.sup.4 can differ either in
terms of the alkyl chain length, in terms of the site of
unsaturation, or in terms of the number of sites of unsaturation.
R.sup.3 and R.sup.4 may comprise at least two sites of unsaturation
(e.g., R.sup.3 and R.sup.4 may be, for example, dodecadienyl,
tetradecadienyl, hexadecadienyl, linoleyl, and icosadienyl. In a
preferred embodiment, R.sup.3 and R.sup.4 are both linoleyl.
R.sup.3 and R.sup.4may comprise at least three sites of
unsaturation (e.g., R.sup.3 and R.sup.4 may be, for example,
dodecatrienyl, tetradectrienyl, hexadecatrienyl, linolenyl, and
icosatrienyl).
[0008] The present invention also provides compound of Formula II
having the following structure:
##STR00002##
[0009] In Formula II, above, R.sup.1 and R.sup.2 are independently
selected and are H or C.sub.1-C.sub.3 alkyls. R.sup.3 and R.sup.4
are independently selected and are alkyl groups having from about
10 to about 20 carbon atoms, wherein at least one of R.sup.3 and
R.sup.4 comprises at least two sites of unsaturation. In one
embodiment, R.sup.3 and R.sup.4 are both the same, i.e., R.sup.3
and R.sup.4 are both linoleyl (C18), etc. In another embodiment,
R.sup.3 and R.sup.4 are different, i.e., R.sup.3 is tetradectrienyl
(C14) and R.sup.4 is linoleyl (C18). In a preferred embodiment, the
cationic lipids of the present invention are symmetrical, i.e.,
R.sup.3 and R.sup.4 are both the same. In another preferred
embodiment, both R.sup.3 and R.sup.4 comprise at least two sites of
unsaturation. In some embodiments, R.sup.3 and R.sup.4 are
independently selected from dodecadienyl, tetradecadienyl,
hexadecadienyl, linoleyl, and icosadienyl. In a preferred
embodiment, R.sup.3 and R.sup.4 are both linoleyl. In some
embodiments, R.sup.3 and R.sup.4comprise at least three sites of
unsaturation and are independently selected from, e.g.,
dodecatrienyl, tetradectrienyl, hexadecatrienyl, linolenyl, and
icosatrienyl.
[0010] In another aspect, the present invention provides a
liposome, the liposome comprising a cationic lipid of Formula I,
Formula II, or a combination thereof. The liposome may further
comprise a PEG-lipid (e.g., a PEG-diacylglycerol, a
PEG-dialkyloxypropyl, a PEG-ceramide, a
PEG-phosphatidylethanolamine, or mixtures thereof). The liposome
can be empty or, alternatively, the liposome can further comprise
one or more bioactive agents. Suitable bioactive agents include,
but are not limited to, antineoplastic agents, antibiotics,
immunomodulators, anti-inflammatory agents and agents acting on the
central nervous system. Similarly, suitable bioactive agents
include, but are not limited to, peptides, proteins and nucleic
acids (e.g., single or double stranded DNA, singled stranded or
double stranded RNA, including siRNA).
[0011] In another aspect the present invention provides a method of
delivering a bioactive agent to a cell, the methods comprising
contacting the cell with a liposome comprising a cationic lipid of
Formula I, Formula II, or a combination thereof, wherein the
bioactive agent is encapsulated in the liposome. Similarly, in
another aspect, the present invention provides a method of
delivering a bioactive agent to a patient, the method comprising
administering to the patient a liposome comprising a cationic lipid
of Formula I, Formula II, or a combination thereof, wherein the
bioactive agent is encapsulated in the liposome.
[0012] In another aspect, the present invention provides a nucleic
acid-lipid particle, the nucleic acid-lipid particle comprising: a
nucleic acid; cationic lipid of Formula I, Formula II, or a
combination thereof; a non-cationic lipid; and a PEG-lipid
conjugate.
[0013] In yet another aspect, the present invention provides a
method of introducing a nucleic acid into a cell, the method
comprising contacting the cell with a nucleic acid-lipid particle
comprising a cationic lipid of Formula I, Formula II, or a
combination thereof, a non-cationic lipid, a PEG-lipid conjugate,
and a nucleic acid.
[0014] Other features, objects and advantages of the invention and
its preferred embodiments will become apparent from the detailed
description, examples, claims and figures that follow.
BRIEF DESCRIPTION OF THE DRAWINGS
[0015] FIG. 1 illustrates the structures of two exemplary cationic
lipids of the invention: 1,2-DiLinoleyloxy-N,N-dimethylaminopropane
(DLinDMA) and 1,2-Dilinolenyloxy-N,N-dimethylaminopropane
(DLenDMA).
[0016] FIG. 2 illustrates the synthetic scheme for DLinDMA.
[0017] FIG. 3 illustrates the synthetic scheme for DLenDMA.
[0018] FIG. 4 illustrates data showing the apparent pKa of the
cationic lipid incorporated in SNALP.
[0019] FIG. 5 illustrates data showing the results of .sup.31P-NMR
analysis to determine the effect of unsaturation on phase
transition temperature.
[0020] FIG. 6 illustrates data showing silencing of gene expression
following in vitro transfection of Neuro2a cells stably expressing
luciferase by an SPLP (i.e., SNALP) comprising DODAC, DODMA, or
DLinDMA and encapsulating an anti-luciferase siRNA sequence.
[0021] FIG. 7 illustrates data showing SNALP-mediated gene
silencing in vitro.
[0022] FIG. 8 illustrates data showing luciferase gene expression
in tumors 48 hours following intravenous delivery of SPLP
encapsulating a plasmid encoding luciferase. The SPLP comprised
PEG-C-DMA conjugates and either DODMA or DLinDMA. The PEG moieties
had molecular weight of either 2000 or 750.
[0023] FIG. 9 illustrates data showing showing luciferase gene
expression in Neuro2A tumor bearing male A/J mice 48 hours after
intravenous administration of SPLP encapsulating a plasmid encoding
luciferase. The SPLP comprised varying percentages (i.e., 15%, 10%,
5% or 2.5%) of PEG-C-DMA and either DODMA or DLinDMA.
[0024] FIG. 10 illustrates data showing the percentage of the
injected dose of SPLP, SNALP, or empty vesicles remaining in plasma
of male A/J mice following a single intravenous administration of
.sup.3H-CHE-labeled SPLP or SNALP, or empty vesicles, containing
various percentages (i.e., 2%, 5%, 10%, or 15%) of PEG-C-DMA.
[0025] FIG. 11 illustrates data showing the biodistribution SPLP,
SNALP or empty vesicles in Neuro-2A tumor-bearing male A/J mice 48
hours after a single intravenous administration of
.sup.3H-CHE-labelled formulations comprising varying percentages of
PEG-C-DMA. The SNALP and empty vesicles comprised DLinDMA. The SPLP
comprised DODMA.
[0026] FIG. 12 illustrates data showing silencing of luciferase
expression in distal, stable Neuro2A-G tumors in A/J mice 48 hours
after intravenous administration of SNALP comprising DLinDMA.
[0027] FIG. 13 illustrates data showing silencing of luciferase
expression in Neuro2A-G cells following delivery of SNALP
formulations comprising DLinDMA and encapsulating anti-luciferase
siRNA.
[0028] FIG. 14 illustrates data showing silencing of luciferase
expression in Neuro2A-G cells following delivery of SNALP
formulations comprising DLinDMA and encapsulating anti-luciferase
siRNA. Delivery of the SNALP formulations was performed in the
absence or presence of chloroquine.
[0029] FIG. 15 illustrates data showing cellular uptake of
SNALP.
DETAILED DESCRIPTION OF THE INVENTION
I. Introduction
[0030] The present invention provides novel cationic lipids that
have increased flexibilty over commonly used cationic lipids (such
as DODAC and DODMA). When incorporated into lipid vesicles (e.g.,
liposomes, SPLP, and SNALP), the cationic lipids described herein
confer enhanced fusogenicity.
II. Definitions
[0031] The term "lipid" refers to a group of organic compounds that
include, but are not limited to, esters of fatty acids and are
characterized by being insoluble in water, but soluble in many
organic solvents. They are usually divided into at least three
classes: (1) "simple lipids" which include fats and oils as well as
waxes; (2) "compound lipids" which include phospholipids and
glycolipids; (3) "derived lipids" such as steroids.
[0032] "Lipid vesicle" refers to any lipid composition that can be
used to deliver a compound including, but not limited to,
liposomes, wherein an aqueous volume is encapsulated by an
amphipathic lipid bilayer; or wherein the lipids coat an interior
comprising a large molecular component, such as a plasmid
comprising an interfering RNA sequence, with a reduced aqueous
interior; or lipid aggregates or micelles, wherein the encapsulated
component is contained within a relatively disordered lipid
mixture.
[0033] As used herein, "lipid encapsulated" can refer to a lipid
formulation that provides a compound with full encapsulation,
partial encapsulation, or both. In a preferred embodiment, the
nucleic acid is fully encapsulated in the lipid formulation (e.g.,
to form an SPLP, pSPLP, or other SNALP).
[0034] As used herein, the term "SNALP" refers to a stable nucleic
acid lipid particle, including SPLP. A SNALP represents a vesicle
of lipids coating a reduced aqueous interior comprising a nucleic
acid (e.g., ssDNA, dsDNA, ssRNA, micro RNA (miRNA), short hairpin
RNA (shRNA), dsRNA, siRNA, or a plasmid, including plasmids from
which an interfering RNA is transcribed). As used herein, the term
"SPLP" refers to a nucleic acid lipid particle comprising a nucleic
acid (e.g., a plasmid) encapsulated within a lipid vesicle. SNALPs
and SPLPs typically contain a cationic lipid, a non-cationic lipid,
and a lipid that prevents aggregation of the particle (e.g., a
PEG-lipid conjugate). SNALPs and SPLPs have systemic application as
they exhibit extended circulation lifetimes following intravenous
(i.v.) injection, accumulate at distal sites (e.g., sites
physically separated from the administration site and can mediate
expression of the transfected gene at these distal sites. SPLPs
include "pSPLP" which comprise an encapsulated condensing
agent-nucleic acid complex as set forth in WO 00/03683.
[0035] The term "vesicle-forming lipid" is intended to include any
amphipathic lipid having a hydrophobic moiety and a polar head
group, and which by itself can form spontaneously into bilayer
vesicles in water, as exemplified by most phospholipids.
[0036] The term "vesicle-adopting lipid" is intended to include any
amphipathic lipid that is stably incorporated into lipid bilayers
in combination with other amphipathic lipids, with its hydrophobic
moiety in contact with the interior, hydrophobic region of the
bilayer membrane, and its polar head group moiety oriented toward
the exterior, polar surface of the membrane. Vesicle-adopting
lipids include lipids that on their own tend to adopt a nonlamellar
phase, yet which are capable of assuming a bilayer structure in the
presence of a bilayer-stabilizing component. A typical example is
DOPE (dioleoylphosphatidylethanolamine). Bilayer stabilizing
components include, but are not limited to, conjugated lipids that
inhibit aggregation of the SNALPs, polyamide oligomers (e.g.,
ATTA-lipid derivatives), peptides, proteins, detergents,
lipid-derivatives, PEG-lipid derivatives such as PEG coupled to
dialkyloxypropyls, PEG coupled to diacylglycerols, PEG coupled to
phosphatidyl-ethanolamines, and PEG conjugated to ceramides (see,
U.S. Pat. No. 5,885,613). PEG can be conjugated directly to the
lipid or may be linked to the lipid via a linker moiety. Any linker
moiety suitable for coupling the PEG to a lipid can be used
including, e.g., non-ester containing linker moieties and
ester-containing linker moieties.
[0037] As used herein, the term "non-ester containing linker
moiety" refers to a linker moiety that does not contain a
carboxylic ester bond (--OC(O)--). Suitable non-ester containing
linker moieties include, but are not limited to, amido
(--C(O)NH--), amino (--NR--), carbonyl (--C(O)--), carbamate
(--NHC(O)O--), urea (--NHC(O)NH--), disulphide (--S--S--), ether
(--O--), succinyl (--(O)CCH.sub.2CH.sub.2C(O)--), succinamidyl
(--NHC(O)CH.sub.2CH.sub.2C(O)NH--), ether, disulphide, etc. as well
as combinations thereof (such as a linker containing both a
carbamate linker moiety and an amido linker moiety). In a preferred
embodiment, a carbamate linker is used to couple the PEG to the
lipid.
[0038] In other embodiments, an ester containing linker moiety is
used to couple the PEG to the lipid. Suitable ester containing
linker moieties include, e.g., carbonate (--OC(O)O--), succinoyl,
phosphate esters (--O--(O)POH--O--), sulfonate esters, and
combinations thereof.
[0039] The term "amphipathic lipid" refers, in part, to any
suitable material wherein the hydrophobic portion of the lipid
material orients into a hydrophobic phase, while the hydrophilic
portion orients toward the aqueous phase. Amphipathic lipids are
usually the major component of a lipid vesicle. Hydrophilic
characteristics derive from the presence of polar or charged groups
such as carbohydrates, phosphate, carboxylic, sulfato, amino,
sulfhydryl, nitro, hydroxy and other like groups. Hydrophobicity
can be conferred by the inclusion of apolar groups that include,
but are not limited to, long chain saturated and unsaturated
aliphatic hydrocarbon groups and such groups substituted by one or
more aromatic, cycloaliphatic or heterocyclic group(s). Examples of
amphipathic compounds include, but are not limited to,
phospholipids, aminolipids and sphingolipids. Representative
examples of phospholipids include, but are not limited to,
phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine,
phosphatidylinositol, phosphatidic acid, palmitoyloleoyl
phosphatidylcholine, lysophosphatidylcholine,
lysophosphatidylethanolamine, dipalmitoylphosphatidylcholine,
dioleoylphosphatidylcholine, distearoylphosphatidylcholine or
dilinoleoylphosphatidylcholine. Other compounds lacking in
phosphorus, such as sphingolipid, glycosphingolipid families,
diacylglycerols and .beta.-acyloxyacids, are also within the group
designated as amphipathic lipids. Additionally, the amphipathic
lipid described above can be mixed with other lipids including
triglycerides and sterols.
[0040] The term "neutral lipid" refers to any of a number of lipid
species that exist either in an uncharged or neutral zwitterionic
form at a selected pH. At physiological pH, such lipids include,
for example, diacylphosphatidylcholine,
diacylphosphatidylethanolamine, ceramide, sphingomyelin, cephalin,
cholesterol, cerebrosides and diacylglycerols.
[0041] The term "noncationic lipid" refers to any neutral lipid as
described above as well as anionic lipids.
[0042] The term "anionic lipid" refers to any lipid that is
negatively charged at physiological pH. These lipids include, but
are not limited to, phosphatidylglycerols, cardiolipins,
diacylphosphatidylserines, diacylphosphatidic acids, N-dodecanoyl
phosphatidylethanolamines, N-succinyl phosphatidylethanolamines,
N-glutarylphosphatidylethanolamines, lysylphosphatidylglycerols,
palmitoyloleyolphosphatidylglycerol (POPG), and other anionic
modifying groups joined to neutral lipids.
[0043] The term "cationic lipid" refers to any of a number of lipid
species that carry a net positive charge at a selected pH, such as
physiological pH. Such lipids include, but are not limited to
1,2-DiLinoleyloxy-N,N-dimethylaminopropane ("DLinDMA"),
1,2-Dilinolenyloxy-N,N-dimethylaminopropane ("DLenDMA"),
dioctadecyldimethylammonium ("DODMA"), Distearyldimethylammonium
("DSDMA"), N,N-dioleyl-N,N-dimethylammonium chloride ("DODAC");
N-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride
("DOTMA"); N,N-distearyl-N,N-dimethylammonium bromide ("DDAB");
N-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride
("DOTAP"); 3-(N--(N',N'-dimethylaminoethane)-carbamoyl)cholesterol
("DC-Chol") and
N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethyl ammonium
bromide ("DMRIE"). For example, cationic lipids that have a
positive charge at below physiological pH include, but are not
limited to: DODAP, DODMA, and DMDMA. In some cases, the cationic
lipids comprise a protonatable tertiary amine head group, C18 alkyl
chains, ether linkages between the head group and alkyl chains, and
0 to 3 double bonds. Such lipids include, e.g., DSDMA, DLinDMA,
DLenDMA, and DODMA. The cationic lipids may comprise ether linkages
and pH titratable head groups. Such lipids include, e.g.,
DODMA.
[0044] The term "hydrophobic lipid" refers to compounds having
apolar groups that include, but are not limited to, long chain
saturated and unsaturated aliphatic hydrocarbon groups and such
groups optionally substituted by one or more aromatic,
cycloaliphatic or heterocyclic group(s). Suitable examples include,
but are not limited to, diacylglycerol, dialkylglycerol,
N-N-dialkylamino, 1,2-diacyloxy-3-aminopropane and
1,2-dialkyl-3-aminopropane.
[0045] The term "fusogenic" refers to the ability of a liposome, an
SNALP or other drug delivery system to fuse with membranes of a
cell. The membranes can be either the plasma membrane or membranes
surrounding organelles, e.g., endosome, nucleus, etc.
[0046] The term "nucleic acid" or "polynucleotide" refers to a
polymer containing at least two deoxyribonucleotides or
ribonucleotides in either single- or double-stranded form. Nucleic
acids include nucleic acids containing known nucleotide analogs or
modified backbone residues or linkages, which are synthetic,
naturally occurring, and non-naturally occurring, which have
similar binding properties as the reference nucleic acid, and which
are metabolized in a manner similar to the reference nucleotides.
Examples of such analogs include, without limitation,
phosphorothioates, phosphoramidates, methyl phosphonates,
chiral-methyl phosphonates, 2-O-methyl ribonucleotides,
peptide-nucleic acids (PNAs). Unless specifically limited, the
terms encompasses nucleic acids containing known analogues of
natural nucleotides that have similar binding properties as the
reference nucleic acid and are metabolized in a manner similar to
naturally occurring nucleotides. Unless otherwise indicated, a
particular nucleic acid sequence also implicitly encompasses
conservatively modified variants thereof (e.g., degenerate codon
substitutions), alleles, orthologs, SNPs, and complementary
sequences as well as the sequence explicitly indicated.
Specifically, degenerate codon substitutions may be achieved by
generating sequences in which the third position of one or more
selected (or all) codons is substituted with mixed-base and/or
deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081
(1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); and
Cassol et al. (1992); Rossolini et al., Mol. Cell. Probes 8:91-98
(1994)). "Nucleotides" contain a sugar deoxyribose (DNA) or ribose
(RNA), a base, and a phosphate group. Nucleotides are linked
together through the phosphate groups. Nucleotides include
chemically modified nucleotides as described in, e.g., WO 03/74654.
"Bases" include purines and pyrimidines, which further include
natural compounds adenine, thymine, guanine, cytosine, uracil,
inosine, and natural analogs, and synthetic derivatives of purines
and pyrimidines, which include, but are not limited to,
modifications which place new reactive groups such as, but not
limited to, amines, alcohols, thiols, carboxylates, and
alkylhalides. DNA may be in the form of antisense, plasmid DNA,
parts of a plasmid DNA, pre-condensed DNA, product of a polymerase
chain reaction (PCR), vectors (P1, PAC, BAC, YAC, artificial
chromosomes), expression cassettes, chimeric sequences, chromosomal
DNA, or derivatives of these groups. The term nucleic acid is used
interchangeably with gene, plasmid, cDNA, mRNA, and an interfering
RNA molecule (e.g. a synthesized siRNA or an siRNA expressed from a
plasmid).
III. Cationic Lipids
[0047] The present invention provides novel cationic lipids that
have increased flexibilty over commonly used cationic lipids (such
as DODAC and DODMA). More particularly, the present invention
provides novel cationic lipids of Formula I having the following
structure:
##STR00003##
[0048] In Formula I, above, R.sup.1 and R.sup.2 are independently
selected and are H or C.sub.1-C.sub.3 alkyls. R.sup.3 and R.sup.4
are independently selected and are alkyl groups having from about
10 to about 20 carbon atoms, wherein at least one of R.sup.3 and
R.sup.4 comprises at least two sites of unsaturation. In one
embodiment, R.sup.3 and R.sup.4 are both the same, i.e., R.sup.3
and R.sup.4 are both linoleyl (C18), etc. In another embodiment,
R.sup.3 and R.sup.4 are different, i.e., R.sup.3 is tetradectrienyl
(C14) and R.sup.4 is linoleyl (C18). In a preferred embodiment, the
cationic lipids of the present invention are symmetrical, i.e.,
R.sup.3 and R.sup.4 are both the same. In another preferred
embodiment, both R.sup.3 and R.sup.4 comprise at least two sites of
unsaturation. In some embodiments, R.sup.3 and R.sup.4 are
independently selected from dodecadienyl, tetradecadienyl,
hexadecadienyl, linoleyl, and icosadienyl. In a preferred
embodiment, R.sup.3 and R.sup.4 are both linoleyl. In some
embodiments, R.sup.3 and R.sup.4comprise at least three sites of
unsaturation and are independently selected from, e.g.,
dodecatrienyl, tetradectrienyl, hexadecatrienyl, linolenyl, and
icosatrienyl.
[0049] The present invention also provides novel cationic lipids of
Formula II having the following structure:
##STR00004##
[0050] In Formula II, above, R.sup.1 and R.sup.2 are independently
selected and are H or C.sub.1-C.sub.3 alkyls. R.sup.3 and R.sup.4
are independently selected and are alkyl groups having from about
10 to about 20 carbon atoms; at least one of R.sup.3 and R.sup.4
comprises at least two sites of unsaturation. In one embodiment,
R.sup.3 and R.sup.4 are both the same, i.e., R.sup.3 and R.sup.4
are both linoleyl (C18), etc. In another embodiment, R.sup.3 and
R.sup.4 are different, i.e., R.sup.3 is tetradectrienyl (C14) and
R.sup.4 is linoleyl (C18). In a preferred embodiment, the cationic
lipids of the present invention are symmetrical, i.e., R.sup.3 and
R.sup.4 are both the same. In another preferred embodiment, both
R.sup.3 and R.sup.4 comprise at least two sites of unsaturation. In
some embodiments, R.sup.3 and R.sup.4 are independently selected
from dodecadienyl, tetradecadienyl, hexadecadienyl, linoleyl, and
icosadienyl. In a preferred embodiment, R.sup.3 and R.sup.4 are
both linoleyl. In some embodiments, R.sup.3 and R.sup.4comprise at
least three sites of unsaturation and are independently selected
from, e.g., dodecatrienyl, tetradectrienyl, hexadecatrienyl,
linolenyl, and icosatrienyl.
IV. Lipid-Based Carrier Systems Containing Cationic Lipids
[0051] In one embodiment, the present invention provides stabilized
nucleic acid-lipid particles (SPLPs or SNALPs) and other
lipid-based carrier systems (e.g., a liposome, a micelle, a
virosome, a lipid-nucleic acid particle, a nucleic acid complex and
mixtures thereof) containing cationic lipids of the present
invention, i.e., cationic lipids of Formula I, Formula II, or a
combination thereof. The lipid-nucleic acid particles of the
present invention typically comprise a nucleic acid, a cationic
lipid of Formula I or Formula II, a non-cationic lipid and a
PEG-lipid conjugate. The cationic lipid of Formula I or Formula II
typically comprises from about 2% to about 60%, from about 5% to
about 50%, from about 10% to about 45%, from about 20% to about
40%, or about 30% of the total lipid present in said particle. The
non-cationic lipid typically comprises from about 5% to about 90%,
from about 10% to about 85%, from about 20% to about 80%, from
about 30% to about 70%, from about 40% to about 60% or about 48% of
the total lipid present in said particle. The PEG-lipid conjugate
typically comprises from about 1% to about 20%, from about 1.5% to
about 18%, from about 4% to about 15%, from about 5% to about 12%,
or about 2% of the total lipid present in said particle. The
nucleic acid-lipid particles of the present invention may further
comprise cholesterol. If present, the cholesterol typically
comprises from about 10% to about 60%, from about 12% to about 58%,
from about 20% to about 55%, or about 48% of the total lipid
present in said particle. It will be readily apparent to one of
skill in the art that the proportions of the components of the
nucleic acid-lipid particles may be varied, e.g., using the ERP
assay described herein. For example for systemic delivery, the
cationic lipid may comprise from about 5% to about 15% of the total
lipid present in said particle and for local or regional delivery,
the cationic lipid comprises from about 40% to about 50% of the
total lipid present in said particle.
[0052] The nucleic acid-lipid particles of the present invention
typically have a mean diameter of about 50 nm to about 150 nm, more
typically about 100 nm to about 130 nm, most typically about 110 nm
to about 115 nm, and are substantially nontoxic. In addition, the
nucleic acids when present in the nucleic acid-lipid particles s of
the present invention are resistant to aqueous solution to
degradation with a nuclease. Nucleic acid-lipid particles and their
method of preparation are disclosed in U.S. Pat. Nos. 5,753,613;
5,785,992; 5,705,385; 5,976,567; 5,981,501; 6,110,745; 6,320,017
and WO 96/40964.
[0053] A. Cationic Lipids
[0054] Cationic lipids of Formula I and II may be used in the
present invention, either alone or in combination with one or more
other cationic lipid species or non-cationic lipid species.
[0055] The cationic lipids of Formula I and Formula II described
herein typically carry a net positive charge at a selected pH, such
as physiological pH. It has been surprisingly found that cationic
lipids comprising alkyl chains with multiple sites of unsaturation,
e.g., at least two or three sites of unsaturation, are particularly
useful for forming lipid-nucleic acid particles with increased
membrane fluidity. A number of cationic lipids and related analogs,
which are also useful in the present invention, have been described
in co-pending U.S. Ser. No. 08/316,399; U.S. Pat. Nos. 5,208,036,
5,264,618, 5,279,833 and 5,283,185, and WO 96/10390.
[0056] Additional suitable cationic lipids include, e.g.,
dioctadecyldimethylammonium ("DODMA"), Distearyldimethylammonium
("DSDMA"), N,N-dioleyl-N,N-dimethylammonium chloride ("DODAC");
N-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride
("DOTMA"); N,N-distearyl-N,N-dimethylammonium bromide ("DDAB");
N-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride
("DOTAP"); 3-(N--(N',N'-dimethylaminoethane)-carbamoyl)cholesterol
("DC-Chol") and
N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethyl ammonium
bromide ("DMRIE"). A number of these lipids and related analogs,
which are also useful in the present invention, have been described
in U.S. Pat. Nos. 5,208,036, 5,264,618, 5,279,833, 5,283,185,
5,753,613 and 5,785,992.
[0057] B. Non-cationic Lipids
[0058] The noncationic lipids used in the present invention can be
any of a variety of neutral uncharged, zwitterionic or anionic
lipids capable of producing a stable complex. They are preferably
neutral, although they can alternatively be positively or
negatively charged. Examples of noncationic lipids useful in the
present invention include: phospholipid-related materials, such as
lecithin, phosphatidylethanolamine, lysolecithin,
lysophosphatidylethanolamine, phosphatidylserine,
phosphatidylinositol, sphingomyelin, cephalin, cardiolipin,
phosphatidic acid, cerebrosides, dicetylphosphate,
distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine
(DOPC), dipalmitoylphosphatidylcholine (DPPC),
dioleoylphosphatidylglycerol (DOPG),
dipalmitoylphosphatidylglycerol (DPPG),
dioleoyl-phosphatidylethanolamine (DOPE),
palmitoyloleoylphosphatidylcholine (POPC),
palmitoyloleoyl-phosphatidylethanolamine (POPE) and
dioleoyl-phosphatidylethanolamine
4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal),
dipalmitoyl phosphatidyl ethanolamine (DPPE),
dimyristoylphosphoethanolamine (DMPE),
distearoyl-phosphatidyl-ethanolamine (DSPE), 16-O-monomethyl PE,
16-O-dimethyl PE, 18-1-trans PE,
1-stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE). Noncationic
lipids or sterols such as cholesterol may be present. Additional
nonphosphorous containing lipids are, e.g., stearylamine,
dodecylamine, hexadecylamine, acetyl palmitate,
glycerolricinoleate, hexadecyl stereate, isopropyl myristate,
amphoteric acrylic polymers, triethanolamine-lauryl sulfate,
alkyl-aryl sulfate polyethyloxylated fatty acid amides,
dioctadecyldimethyl ammonium bromide and the like,
diacylphosphatidylcholine, diacylphosphatidylethanolamine,
ceramide, sphingomyelin, cephalin, and cerebrosides. Other lipids
such as lysophosphatidylcholine and lysophosphatidylethanolamine
may be present. Noncationic lipids also include polyethylene
glycol-based polymers such as PEG 2000, PEG 5000 and polyethylene
glycol conjugated to phospholipids or to ceramides (referred to as
PEG-Cer), as described in co-pending U.S. Ser. No. 08/316,429.
[0059] In preferred embodiments, the noncationic lipids are
diacylphosphatidylcholine (e.g., distearoylphosphatidylcholine,
dioleoylphosphatidylcholine, dipalmitoylphosphatidylcholine and
dilinoleoylphosphatidylcholine), diacylphosphatidylethanolamine
(e.g., dioleoylphosphatidylethanolamine and
palmitoyloleoylphosphatidylethanolamine), ceramide or
sphingomyelin. The acyl groups in these lipids are preferably acyl
groups derived from fatty acids having C.sub.10-C.sub.24 carbon
chains. More preferably the acyl groups are lauroyl, myristoyl,
palmitoyl, stearoyl or oleoyl. In particularly preferred
embodiments, the noncationic lipid will be cholesterol,
1,2-sn-dioleoylphosphatidylethanolamine, or egg sphingomyelin
(ESM).
[0060] C. Bilayer Stabilizing Component
[0061] In addition to cationic and non-cationic lipids, the SPLPs
of the present invention comprise bilayer stabilizing component
(BSC) such as an ATTA-lipid or a PEG-lipid, such as PEG coupled to
dialkyloxypropyls (PEG-DAA) as described in, e.g., WO 05/026372,
PEG coupled to diacylglycerol (PEG-DAG) as described in, e.g., U.S.
Patent Publication Nos. 20030077829 and 2005008689), PEG coupled to
phosphatidylethanolamine (PE) (PEG-PE), or PEG conjugated to
ceramides, or a mixture thereof (see, U.S. Pat. No. 5,885,613). In
one preferred embodiment, the BSC is a conjugated lipid that
inhibits aggregation of the SPLPs. Suitable conjugated lipids
include, but are not limited to PEG-lipid conjugates, ATTA-lipid
conjugates, cationic-polymer-lipid conjugates (CPLs) or mixtures
thereof. In one preferred embodiment, the SPLPs comprise either a
PEG-lipid conjugate or an ATTA-lipid conjugate together with a
CPL.
[0062] PEG is a polyethylene glycol, a linear, water-soluble
polymer of ethylene PEG repeating units with two terminal hydroxyl
groups. PEGs are classified by their molecular weights; for
example, PEG 2000 has an average molecular weight of about 2,000
daltons, and PEG 5000 has an average molecular weight of about
5,000 daltons. PEGs are commercially available from Sigma Chemical
Co. and other companies and include, for example, the following:
monomethoxypolyethylene glycol (MePEG-OH), monomethoxypolyethylene
glycol-succinate (MePEG-S), monomethoxypolyethylene
glycol-succinimidyl succinate (MePEG-S-NHS),
monomethoxypolyethylene glycol-amine (MePEG-NH.sub.2),
monomethoxypolyethylene glycol-tresylate (MePEG-TRES), and
monomethoxypolyethylene glycol-imidazolyl-carbonyl (MePEG-IM). In
addition, monomethoxypolyethyleneglycol-acetic acid
(MePEG-CH.sub.2COOH), is particularly useful for preparing the
PEG-lipid conjugates including, e.g., PEG-DAA conjugates.
[0063] In a preferred embodiment, the PEG has an average molecular
weight of from about 550 daltons to about 10,000 daltons, more
preferably of about 750 daltons to about 5,000 daltons, more
preferably of about 1,000 daltons to about 5,000 daltons, more
preferably of about 1,500 daltons to about 3,000 daltons and, even
more preferably, of about 2,000 daltons, or about 750 daltons. The
PEG can be optionally substituted by an alkyl, alkoxy, acyl or aryl
group. PEG can be conjugated directly to the lipid or may be linked
to the lipid via a linker moiety. Any linker moiety suitable for
coupling the PEG to a lipid can be used including, e.g., non-ester
containing linker moieties and ester-containing linker moieties. In
a preferred embodiment, the linker moiety is a non-ester containing
linker moiety. As used herein, the term "non-ester containing
linker moiety" refers to a linker moiety that does not contain a
carboxylic ester bond (--OC(O)--). Suitable non-ester containing
linker moieties include, but are not limited to, amido
(--C(O)NH--), amino (--NR--), carbonyl (--C(O)--), carbamate
(--NHC(O)O--), urea (--NHC(O)NH--), disulphide (--S--S--), ether
(--O--), succinyl (--(O)CCH.sub.2CH.sub.2C(O--), succinamidyl
(--NHC(O)CH.sub.2CH.sub.2C(O)NH--), ether, disulphide, etc. as well
as combinations thereof (such as a linker containing both a
carbamate linker moiety and an amido linker moiety). In a preferred
embodiment, a carbamate linker is used to couple the PEG to the
lipid.
[0064] In other embodiments, an ester containing linker moiety is
used to couple the PEG to the lipid. Suitable ester containing
linker moieties include, e.g., carbonate (--OC(O)O--), succinoyl,
phosphate esters (--O--(O)POH--O--), sulfonate esters, and
combinations thereof.
[0065] Phosphatidylethanolamines having a variety of acyl chain
groups of varying chain lengths and degrees of saturation can be
conjugated to polyethyleneglycol to form the bilayer stabilizing
component. Such phosphatidylethanolamines are commercially
available, or can be isolated or synthesized using conventional
techniques known to those of skilled in the art.
Phosphatidylethanolamines containing saturated or unsaturated fatty
acids with carbon chain lengths in the range of C.sub.10 to
C.sub.20 are preferred. Phosphatidylethanolamines with mono- or
diunsaturated fatty acids and mixtures of saturated and unsaturated
fatty acids can also be used. Suitable phosphatidylethanolamines
include, but are not limited to, the following:
dimyristoylphosphatidylethanolamine (DMPE),
dipalmitoylphosphatidylethanolamine (DPPE),
dioleoylphosphatidylethanolamine (DOPE) and
distearoylphosphatidylethanolamine (DSPE).
[0066] The term "ATTR" or "polyamide" refers to, but is not limited
to, compounds disclosed in U.S. Pat. Nos. 6,320,017 and 6,586,559.
These compounds include a compound having the formula
##STR00005##
wherein: R is a member selected from the group consisting of
hydrogen, alkyl and acyl; R.sup.1 is a member selected from the
group consisting of hydrogen and alkyl; or optionally, R and
R.sup.1 and the nitrogen to which they are bound form an azido
moiety; R.sup.2 is a member of the group selected from hydrogen,
optionally substituted alkyl, optionally substituted aryl and a
side chain of an amino acid; R.sup.3 is a member selected from the
group consisting of hydrogen, halogen, hydroxy, alkoxy, mercapto,
hydrazino, amino and NR.sup.4R.sup.5, wherein R.sup.4 and R.sup.5
are independently hydrogen or alkyl; n is 4 to 80; m is 2 to 6; p
is 1 to 4; and q is 0 or 1. It will be apparent to those of skill
in the art that other polyamides can be used in the compounds of
the present invention.
[0067] The term "diacylglycerol" refers to a compound having
2-fatty acyl chains, R.sup.1 and R.sup.2, both of which have
independently between 2 and 30 carbons bonded to the 1- and
2-position of glycerol by ester linkages. The acyl groups can be
saturated or have varying degrees of unsaturation. Diacylglycerols
have the following general formula:
##STR00006##
[0068] The term "dialkyloxypropyl" refers to a compound having
2-alkyl chains, R.sup.1 and R.sup.2, both of which have
independently between 2 and 30 carbons. The alkyl groups can be
saturated or have varying degrees of unsaturation.
Dialkyloxypropyls have the following general formula:
##STR00007##
[0069] In one preferred embodiment, the PEG-lipid is a PEG-DAA
conjugate has the following formula:
##STR00008##
[0070] In Formula VI, R.sup.1 and R.sup.2 are independently
selected and are long-chain alkyl groups having from about 10 to
about 22 carbon atoms. The long-chain alkyl groups can be saturated
or unsaturated. Suitable alkyl groups include, but are not limited
to, lauryl (C12), myristyl (C14), palmityl (C16), stearyl (C18) and
icosyl (C20). In preferred embodiments, R.sup.1 and R.sup.2 are the
same, i.e., R.sup.1 and R.sup.2 are both myristyl (i.e.,
dimyristyl), R.sup.1 and R.sup.2 are both stearyl (i.e.,
distearyl), etc.
[0071] In Formula VI above, "R' and R.sup.2" are independently
selected and are alkyl groups having from about 10 to about 20
carbon atoms; PEG is a polyethyleneglycol; and L is a
non-ester-containing linker moiety as described above. Suitable
alkyl groups include, but are not limited to, lauryl (C12),
myristyl (C14), palmityl (C16), stearyl (C18) and icosyl (C20). In
a preferred embodiment; R.sup.1 and R.sup.2 are the same, i.e.,
they are both myristyl (C14) or both palmityl (C16) or both stearyl
(C18). In a preferred embodiment, the alkyl groups are
saturated.
[0072] In Formula VI above, "PEG" is a polyethylene glycol having
an average molecular weight ranging of about 550 daltons to about
10,000 daltons, more preferably of about 750 daltons to about 5,000
daltons, more preferably of about 1,000 daltons to about 5,000
daltons, more preferably of about 1,500 daltons to about 3,000
daltons and, even more preferably, of about 2,000 daltons, or about
750 daltons. The PEG can be optionally substituted with alkyl,
alkoxy, acyl or aryl. In a preferred embodiment, the terminal
hydroxyl group is substituted with a methoxy or methyl group.
[0073] In Formula VI, above, "L" is a non-ester containing linker
moiety or an ester containing linker moiety. In a preferred
embodiment, L is a non-ester containing linker moiety. Suitable
non-ester containing linkers include, but are not limited to, an
amido linker moiety, an amino linker moiety, a carbonyl linker
moiety, a carbamate linker moiety, a urea linker moiety, an ether
linker moiety, a disulphide linker moiety, a succinamidyl linker
moiety and combinations thereof. In a preferred embodiment, the
non-ester containing linker moiety is a carbamate linker moiety
(i.e., a PEG-C-DAA conjugate). In another preferred embodiment, the
non-ester containing linker moiety is an amido linker moiety (i.e.,
a PEG-A-DAA conjugate). In a preferred embodiment, the non-ester
containing linker moiety is a succinamidyl linker moiety (i.e., a
PEG-S-DAA conjugate).
[0074] The PEG-DAA conjugates are synthesized using standard
techniques and reagents known to those of skill in the art. It will
be recognized that the PEG-DAA conjugates will contain various
amide, amine, ether, thio, carbamate and urea linkages. T hose of
skill in the art will recognize that methods and reagents for
forming these bonds are well known and readily available. See,
e.g., March, ADVANCED ORGANIC CHEMISTRY (Wiley 1992), Larock,
COMPREHENSIVE ORGANIC TRANSFORMATIONS (VCH 1989); and Furniss,
VOGEL'S TEXTBOOK OF PRACTICAL ORGANIC CHEMISTRY 5th ed. (Longman
1989). It will also be appreciated that any functional groups
present may require protection and deprotection at different points
in the synthesis of the PEG-DAA conjugates. Those of skill in the
art will recognize that such techniques are well known. See, e.g.,
Green and Wuts, PROTECTIVE GROUPS IN ORGANIC SYNTHESIS (Wiley
1991).
[0075] In a presently preferred embodiment, the PEG-DAA conjugate
is a dilauryloxypropyl (C12)-PEG conjugate, dimyristyloxypropyl
(C14)-PEG conjugate, a dipalmitoyloxypropyl (C16)-PEG conjugate or
a disteryloxypropyl (C18)-PEG conjugate. Those of skill in the art
will readily appreciate that other dialkyloxypropyls can be used in
the PEG-DAA conjugates of the present invention.
[0076] In addition to the foregoing, it will be readily apparent to
those of skill in the art that other hydrophilic polymers can be
used in place of PEG. Examples of suitable polymers that can be
used in place of PEG include, but are not limited to,
polyvinylpyrrolidone, polymethyloxazoline, polyethyloxazoline,
polyhydroxypropyl methacrylamide, polymethacrylamide and
polydimethylacrylamide, polylactic acid, polyglycolic acid, and
derivatized celluloses, such as hydroxymethylcellulose or
hydroxyethylcellulose.
[0077] In addition to the foregoing components, the SNALPs and
SPLPs of the present invention can further comprise cationic
poly(ethylene glycol) (PEG) lipids, or CPLs, that have been
designed for insertion into lipid bilayers to impart a positive
charge(see, Chen, et al., Bioconj. Chem. 11:433-437 (2000)).
Suitable SPLPs and SPLP-CPLs for use in the present invention, and
methods of making and using SPLPs and SPLP-CPLs, are disclosed,
e.g., in U.S. Pat. No. 6,852,334 and WO 00/62813. Cationic polymer
lipids (CPLs) useful in the present invention have the following
architectural features: (1) a lipid anchor, such as a hydrophobic
lipid, for incorporating the CPLs into the lipid bilayer; (2) a
hydrophilic spacer, such as a polyethylene glycol, for linking the
lipid anchor to a cationic head group; and (3) a polycationic
moiety, such as a naturally occurring amino acid, to produce a
protonizable cationic head group.
[0078] Suitable CPL include compounds of Formula VII:
A-W--Y (VII)
wherein A, W and Y are as described below.
[0079] With reference to Formula VII, "A" is a lipid moiety such as
an amphipathic lipid, a neutral lipid or a hydrophobic lipid that
acts as a lipid anchor. Suitable lipid examples include
vesicle-forming lipids or vesicle adopting lipids and include, but
are not limited to, diacylglycerolyls, dialkylglycerolyls,
N-N-dialkylaminos, 1,2-diacyloxy-3-aminopropanes and
1,2-dialkyl-3-aminopropanes.
[0080] "W" is a polymer or an oligomer, such as a hydrophilic
polymer or oligomer. Preferably, the hydrophilic polymer is a
biocompatable polymer that is nonimmunogenic or possesses low
inherent immunogenicity. Alternatively, the hydrophilic polymer can
be weakly antigenic if used with appropriate adjuvants. Suitable
nonimmunogenic polymers include, but are not limited to, PEG,
polyamides, polylactic acid, polyglycolic acid, polylactic
acid/polyglycolic acid copolymers and combinations thereof. In a
preferred embodiment, the polymer has a molecular weight of about
250 to about 7000 daltons.
[0081] "Y" is a polycationic moiety. The term polycationic moiety
refers to a compound, derivative, or functional group having a
positive charge, preferably at least 2 positive charges at a
selected pH, preferably physiological pH. Suitable polycationic
moieties include basic amino acids and their derivatives such as
arginine, asparagine, glutamine, lysine and histidine; spermine;
spermidine; cationic dendrimers; polyamines; polyamine sugars; and
amino polysaccharides. The polycationic moieties can be linear,
such as linear tetralysine, branched or dendrimeric in structure.
Polycationic moieties have between about 2 to about 15 positive
charges, preferably between about 2 to about 12 positive charges,
and more preferably between about 2 to about 8 positive charges at
selected pH values. The selection of which polycationic moiety to
employ may be determined by the type of liposome application which
is desired.
[0082] The charges on the polycationic moieties can be either
distributed around the entire liposome moiety, or alternatively,
they can be a discrete concentration of charge density in one
particular area of the liposome moiety e.g., a charge spike. If the
charge density is distributed on the liposome, the charge density
can be equally distributed or unequally distributed. All variations
of charge distribution of the polycationic moiety are encompassed
by the present invention.
[0083] The lipid "A," and the nonimmunogenic polymer "W," can be
attached by various methods and preferably, by covalent attachment.
Methods known to those of skill in the art can be used for the
covalent attachment of "A" and "W." Suitable linkages include, but
are not limited to, amide, amine, carboxyl, carbonate, carbamate,
ester and hydrazone linkages. It will be apparent to those skilled
in the art that "A" and "W" must have complementary functional
groups to effectuate the linkage. The reaction of these two groups,
one on the lipid and the other on the polymer, will provide the
desired linkage. For example, when the lipid is a diacylglycerol
and the terminal hydroxyl is activated, for instance with NHS and
DCC, to form an active ester, and is then reacted with a polymer
which contains an amino group, such as with a polyamide (see, U.S.
Pat. Nos. 6,320,017 and 6,586,559), an amide bond will form between
the two groups.
[0084] In certain instances, the polycationic moiety can have a
ligand attached, such as a targeting ligand or a chelating moiety
for complexing calcium. Preferably, after the ligand is attached,
the cationic moiety maintains a positive charge. In certain
instances, the ligand that is attached has a positive charge.
Suitable ligands include, but are not limited to, a compound or
device with a reactive functional group and include lipids,
amphipathic lipids, carrier compounds, bioaffinity compounds,
biomaterials, biopolymers, biomedical devices, analytically
detectable compounds, therapeutically active compounds, enzymes,
peptides, proteins, antibodies, immune stimulators, radiolabels,
fluorogens, biotin, drugs, haptens, DNA, RNA, polysaccharides,
liposomes, virosomes, micelles, immunoglobulins, functional groups,
other targeting moieties, or toxins.
[0085] D. Products of Interest
[0086] In addition to the above components, the SPLPs and SNALPs of
the present invention comprise a nucleic acid (e.g., single
stranded or double stranded DNA, single stranded or double stranded
RNA, RNAi, siRNA, and the like). Suitable nucleic acids include,
but are not limited to, plasmids, antisense oligonucleotides,
ribozymes as well as other poly- and oligonucleotides. In preferred
embodiments, the nucleic acid encodes a product, e.g., a
therapeutic product, of interest. The SPLP's and SNLPs of the
present invention can be used to deliver the nucleic acid to a cell
(e.g., a cell in a mammal) for, e.g., expression of the nucleic
acid or for silencing of a target sequence expressed by the
cell.
[0087] The product of interest can be useful for commercial
purposes, including for therapeutic purposes as a pharmaceutical or
diagnostic. Examples of therapeutic products include a protein, a
nucleic acid, an antisense nucleic acid, ribozymes, tRNA, snRNA,
siRNA, an antigen, Factor VIII, and Apoptin (Zhuang et al. (1995)
Cancer Res. 55(3): 486-489). Suitable classes of gene products
include, but are not limited to, cytotoxic/suicide genes,
immunomodulators, cell receptor ligands, tumor suppressors, and
anti-angiogenic genes. The particular gene selected will depend on
the intended purpose or treatment. Examples of such genes of
interest are described below and throughout the specification.
[0088] In some embodiments, the nucleic acid is an siRNA molecule
that silences the gene of interest. Such nucleic acids can be
administered alone or in combination with the administration of
conventional agents used to treat the disease or disorder
associated with the gene of interest. In other embodiments, the
nucleic acid encodes a polypeptide expressed or overexpressed in a
subject with a particular disease or disorder (e.g., a pathogenic
infection or a neoplastic disorder) and can conveniently be used to
generate an immune response against the polypeptide expressed by
the gene. Such nucleic acids can be administered alone or in
combination with the administration of conventional agents used to
treat the disease or disorder. In even other embodiments, the
nucleic acid encodes a polypeptide that is underexpressed or not
expressed in subjects with a particular disease or disorder (e.g.,
a metabolic disease or disorder) and can conveniently be used to
express the polypeptides and can be administered alone or in
combination with the administration of conventional agents used to
treat the disease or disorder.
[0089] 1. Genes of Interest
[0090] Genes of interest include, but are not limited to, genes
associated with viral infection and survival, genes associated with
metabolic diseases and disorders (e.g., liver diseases and
disorders), genes associated with tumorigenesis and cell
transformation, angiogenic genes, immunomodulator genes, such as
those associated with inflammatory and autoimmune responses, ligand
receptor genes, and genes associated with neurodegenerative
disorders.
[0091] a) Genes Associated with Viral Infection and Survival
[0092] Genes associated with viral infection and survival include
those expressed by a virus in order to bind, enter and replicate in
a cell. Of particular interest are viral sequences associated with
chronic viral diseases. Viral sequences of particular interest
include sequences of Hepatitis viruses (Hamasaki, et al., FEBS
Lett. 543:51 (2003); Yokota, et al., EMBO Rep. 4:602 (2003);
Schlomai, et al., Hepatology 37:764 (2003); Wilson, et al., Proc.
Natl. Acad. Sci. 100:2783 (2003); Kapadia, et al., Proc. Natl.
Acad. Sci. 100:2014 (2003); and FIELDS VIROLOGY (Knipe et al. eds.
2001)), Human Immunodeficiency Virus (HIV) (Banerjea, et al., Mol.
Ther. 8:62 (2003); Song, et al., J. Virol. 77:7174 (2003);
Stephenson JAMA 289:1494 (2003); Qin, et al., Proc. Natl. Acad.
Sci. 100:183 (2003)), Herpes viruses (Jia, et al., J. Virol.
77:3301 (2003)), and Human Papilloma Viruses (HPV) (Hall, et al.,
J. Virol. 77:6066 (2003); Jiang, et al., Oncogene 21:6041 (2002)).
Examplary hepatitis viral nucleic acid sequences that can be
silenced include, but are not limited to: nucleic acid sequences
involved in transcription and translation (e.g., En1, En2, X, P),
nucleic acid sequences encoding structural proteins (e.g., core
proteins including C and C-related proteins; capsid and envelope
proteins including S, M, and/or L proteins, or fragments thereof)
(see, e.g., FIELDS VIROLOGY, 2001, supra). Exemplary Hepatits C
nucleic acid sequences that can be silenced include, but are not
limited to: serine proteases (e.g., NS3/NS4), helicases (e.g. NS3),
polymerases (e.g., NS5B), and envelope proteins (e.g., E1, E2, and
p7). Hepatitis A nucleic acid sequences are set forth in e.g.,
Genbank Accession No. NC.sub.--001489 ; Hepatitis B nucleic acid
sequences are set forth in, e.g., Genbank Accession No.
NC.sub.--003977; Hepatitis C nucleic acid sequences are set forth
in, e.g., Genbank Accession No. NC.sub.--004102; Hepatitis D
nucleic acid sequence are set forth in, e.g., Genbank Accession No.
NC.sub.--001653; Hepatitis E nucleic acid sequences are set forth
in e.g., Genbank Accession No. NC.sub.--001434;. and Hepatitis G
nucleic acid sequences are set forth in e.g., Genbank Accession No.
NC.sub.--001710.
[0093] b) Genes Associated with Metabolic Diseases and
Disorders
[0094] Genes associated with metabolic diseases and disorders
(e.g., disorders in which the liver is the target and liver
diseases and disorders) include, for example genes expressed in,
for example, dyslipidemia (e.g., liver X receptors (e.g.,
LXR.alpha. and LXR.beta. Genback Accession No. NM.sub.--007121),
farnesoid X receptors (FXR) (Genbank Accession No.
NM.sub.--005123), sterol-regulatory element binding protein
(SREBP), Site-1 protease (SIP), 3-hydroxy-3-methylglutaryl
coenzyme-A reductase (HMG coenzyme-A reductase), Apolipoprotein
(ApoB), and Apolipoprotein (ApoE)) and diabetes (e.g., Glucose
6-phosphatase) (see, e.g., Forman et al., Cell 81:687 (1995); Seol
et al., Mol. Endocrinol. 9:72 (1995), Zavacki et al., PNAS USA
94:7909 (1997); Sakai, et al., Cell 85:1037-1046 (1996); Duncan, et
al., J. Biol. Chem. 272:12778-12785 (1997);, Willy, et al., Genes
Dev. 9(9):1033-45 (1995); Lehmann, et al., J. Biol. Chem.
272(6):3137-3140 (1997); Janowski, et al., Nature 383:728-731
(1996); Peet, et al., Cell 93:693-704 (1998)). One of skill in the
art will appreciate that genes associated with metabolic diseases
and disorders (e.g., diseases and disorders in which the liver is a
target and liver diseases and disorders) include genes that are
expressed in the liver itself as well as and genes expressed in
other organs and tissues.
[0095] c) Genes Associated with Tumorigenesis
[0096] Examples of gene sequences associated with tumorigenesis and
cell transformation include translocation sequences such as MLL
fusion genes, BCR-ABL (Wilda, et al., Oncogene, 21:5716 (2002);
Scherr, et al., Blood 101:1566), TEL-AML1, EWS-FLI1, TLS-FUS,
PAX3-FKHR, BCL-2, AML1-ETO and AML1-MTG8 (Heidenreich, et al.,
Blood 101:3157 (2003)); overexpressed sequences such as multidrug
resistance genes (Nieth, et al., FEBS Lett. 545:144 (2003); Wu, et
al, Cancer Res. 63:1515 (2003)), cyclins (Li, et al., Cancer Res.
63:3593 (2003); Zou, et al., Genes Dev. 16:2923 (2002)),
beta-Catenin (Verma, et al., Clin Cancer Res. 9:1291 (2003)),
telomerase genes (Kosciolek, et al., Mol Cancer Ther. 2:209
(2003)), c-MYC, N-MYC, BCL-2, ERBB1 and ERBB2 (Nagy, et al. Exp.
Cell Res. 285:39 (2003)); and mutated sequences such as RAS
(reviewed in Tuschl and Borkhardt, Mol. Interventions, 2:158
(2002)). For example, silencing of sequences that encode DNA repair
enzymes find use in combination with the administration of
chemotherapeutic agents (Collis, et al., Cancer Res. 63:1550
(2003)). Genes encoding proteins associated with tumor migration
are also target sequences of interest, for example, integrins,
selectins and metalloproteinases. The foregoing examples are not
exclusive. Any whole or partial gene sequence that facilitates or
promotes tumorigenesis or cell transformation, tumor growth or
tumor migration can be included as a gene sequence of interest.
[0097] d) Angiogenic/Anti-Angiogenic Genes
[0098] Angiogenic genes are able to promote the formation of new
vessels. Of particular interest is Vascular Endothelial Growth
Factor (VEGF) (Reich, et al., Mol. Vis. 9:210 (2003)) or VEGFr.
siRNA sequences that target VEGFr are set forth in, e.g., GB
2396864; U.S. Patent Publication No. 20040142895; and
CA2456444.
[0099] Anti-angiogenic genes are able to inhibit
neovascularization. These genes are particularly useful for
treating those cancers in which angiogenesis plays a role in the
pathological development of the disease. Examples of
anti-angiogenic genes include, but are not limited to, endostatin
(see e.g., U.S. Pat. No. 6,174,861), angiostatin (see, e.g., U.S.
Patent No. 5,639,725), and VEGF-R2 (see e.g., Decaussin et al.
(1999) J. Pathol. 188(4): 369-737).
[0100] e) Immonomodulator Genes
[0101] Immunomodulator genes are genes that modulate one or more
immune responses.
[0102] Examples of immunomodulator genes include cytokines such as
growth factors (e.g., TGF-.alpha., TGF-.beta., EGF, FGF, IGF, NGF,
PDGF, CGF, GM-CSF, SCF, etc.), interleukins (e.g., IL-2, IL-3,
IL-4, IL-6, IL-7, IL-10, IL-12, IL-15, IL-20, etc.), interferons
(e.g., IFN-.alpha., IFN-.beta., IFN-.gamma., etc.), TNF (e.g.,
TNF-.alpha.), and Flt3-Ligand. Fas and Fas Ligand genes are also
immunomodulator target sequences of interest (Song, et al., Nat.
Med. 9:347 (2003)). Genes encoding secondary signaling molecules in
hematopoietic and lymphoid cells are also included in the present
invention, for example, Tec family kinases, such as Bruton's
tyrosine kinase (Btk) (Heinonen, et al., FEBS Lett. 527:274
(2002)).
[0103] f) Cell Receptor Ligands
[0104] Cell receptor ligands include ligands that are able to bind
to cell surface receptors (e.g., insulin receptor, EPO receptor,
G-protein coupled receptors, receptors with tyrosine kinase
activity, cytokine receptors, growth factor receptors, etc.), to
modulate (e g, inhibit, activate, etc.) the physiological pathway
that the receptor is involved in (e.g., glucose level modulation,
blood cell development, mitogenesis, etc.). Examples of cell
receptor ligands include cytokines, growth factors, interleukins,
interferons, erythropoietin (EPO), insulin, glucagon, G-protein
coupled receptor ligands, etc.). Templates coding for an expansion
of trinucleotide repeats (e.g., CAG repeats), find use in silencing
pathogenic sequences in neurodegenerative disorders caused by the
expansion of trinucleotide repeats, such as spinobulbular muscular
atrophy and Huntington's Disease (Caplen, et al., Hum. Mol. Genet.
11:175 (2002)).
[0105] g) Tumor Suppressor Genes
[0106] Tumor suppressor genes are genes that are able to inhibit
the growth of a cell, particularly tumor cells. Thus, delivery of
these genes to tumor cells is useful in the treatment of cancers.
Tumor suppressor genes include, but are not limited to, p53 (Lamb
et al., Mol. Cell. Biol. 6:1379-1385 (1986), Ewen et al., Science
255:85-87 (1992), Ewen et al. (1991) Cell 66:1155-1164, and Hu et
al., EMBO J. 9:1147-1155 (1990)), RB1 (Toguchida et al. (1993)
Genomics 17:535-543), WT1 (Hastie, N. D., Curr. Opin. Genet. Dev.
3:408-413 (1993)), NF1 (Trofatter et al., Cell 72:791-800 (1993),
Cawthon et al., Cell 62:193-201 (1990)), VHL (Latif et al., Science
260:1317-1320 (1993)), APC (Gorden et al., Cell 66:589-600 (1991)),
DAP kinase (see e.g., Diess et al. (1995) Genes Dev. 9: 15-30), p16
(see e.g., Marx (1994) Science 264(5167): 1846), ARF (see e.g.,
Quelle et al. (1995) Cell 83(6): 993-1000), Neurofibromin (see
e.g., Huynh et al. (1992) Neurosci. Lett. 143(1-2): 233-236), and
PTEN (see e.g., Li et al. (1997) Science 275(5308): 1943-1947).
[0107] h) Cytotoxic/Suicide Genes
[0108] Cytotoxic/suicide genes are those genes that are capable of
directly or indirectly killing cells, causing apoptosis, or
arresting cells in the cell cycle. Such genes include, but are not
limited to, genes for immunotoxins, a herpes simplex virus
thymidine kinase (HSV-TK), a cytosine deaminase, a
xanthine-guaninephosphoribosyl transferase, a p53, a purine
nucleoside phosphorylase, a carboxylesterase, a deoxycytidine
kinase, a nitroreductase, a thymidine phosphorylase, and a
cytochrome P450 2B1.
[0109] In a gene therapy technique known as gene-delivered enzyme
prodrug therapy ("GDEPT") or, alternatively, the "suicide
gene/prodrug" system, agents such as acyclovir and ganciclovir (for
thymidine kinase), cyclophosphoamide (for cytochrome P450 2B1),
5-fluorocytosine (for cytosine deaminase), are typically
administered systemically in conjunction (e.g., simultaneously or
nonsimultaneously, e.g., sequentially) with a expression cassette
encoding a suicide gene compositions of the present invention to
achieve the desired cytotoxic or cytostatic effect (see, e.g.,
Moolten, F. L., Cancer Res., 46:5276-5281 (1986)). For a review of
the GDEPT system, see, Moolten, F. L., The Internet Book of Gene
Therapy, Cancer Therapeutics, Chapter 11 (Sobol, R. E., Scanlon,
N.J. (Eds) Appelton & Lange (1995)). In this method, a
heterologous gene is delivered to a cell in an expression cassette
containing a RNAP promoter, the heterologous gene encoding an
enzyme that promotes the metabolism of a first compound to which
the cell is less sensitive (i.e., the "prodrug") into a second
compound to which is cell is more sensitive. The prodrug is
delivered to the cell either with the gene or after delivery of the
gene. The enzyme will process the prodrug into the second compound
and respond accordingly. A suitable system proposed by Moolten is
the herpes simplex virus-thymidine kinase (HSV-TK) gene and the
prodrug ganciclovir. This method has recently been employed using
cationic lipid-nucleic aggregates for local delivery (i.e., direct
intra-tumoral injection), or regional delivery (i.e.,
intra-peritoneal) of the TK gene to mouse tumors by Zerrouqui, et
al., Can. Gen. Therapy, 3(6):385-392 (1996); Sugaya, et al., Hum.
Gen. Ther., 7:223-230 (1996) and Aoki, et al., Hum. Gen. Ther.,
8:1105-1113 (1997). Human clinical trials using a GDEPT system
employing viral vectors have been proposed (see, Hum. Gene Ther.,
8:597-613 (1997), and Hum. Gene Ther., 7:255-267 (1996)) and are
underway.
[0110] Any suicide gene/prodrug combination can be used in
accordance with the present invention. Several suicide gene/prodrug
combinations suitable for use in the present invention are cited in
Sikora, K. in OECD Documents, Gene Delivery Systems at pp. 59-71
(1996), include, but are not limited to, the following:
TABLE-US-00001 Suicide Gene Product Less Active ProDrug Activated
Drug Herpes simplex virus ganciclovir(GCV), phosphorylated type 1
thymidine acyclovir, dGTP analogs kinase (HSV-TK) bromovinyl-
deoxyuridine, or other substrates Cytosine Deaminase
5-fluorocytosine 5-fluorouracil (CD) Xanthine-guanine-
6-thioxanthine (6TX) 6-thioguano- phosphoribosyl sinemonophosphate
transferase (XGPRT) Purine nucleoside MeP-dr 6-methylpurine
phosphorylase Cytochrome P450 cyclophosphamide [cytotoxic 2B1
metabolites] Linamarase amygdalin cyanide Nitroreductase CB 1954
nitrobenzamidine Beta-lactamase PD PD mustard Beta-glucuronidase
adria-glu adriamycin Carboxypeptidase MTX-alanine MTX Glucose
oxidase glucose peroxide Penicillin amidase adria-PA adriamycin
Superoxide dismutase XRT DNA damaging agent Ribonuclease RNA
cleavage products
[0111] Any prodrug can be used if it is metabolized by the
heterologous gene product into a compound to which the cell is more
sensitive. Preferably, cells are at least 10-fold more sensitive to
the metabolite than the prodrug.
[0112] Modifications of the GDEPT system that may be useful with
the invention include, for example, the use of a modified TK enzyme
construct, wherein the TK gene has been mutated to cause more rapid
conversion of prodrug to drug (see, for example, Black, et al.,
Proc. Natl. Acad. Sci, U.S.A., 93: 3525-3529 (1996)).
Alternatively, the TK gene can be delivered in a bicistronic
construct with another gene that enhances its effect. For example,
to enhance the "bystander effect" also known as the "neighbor
effect" (wherein cells in the vicinity of the transfected cell are
also killed), the TK gene can be delivered with a gene for a gap
junction protein, such as connexin 43. The connexin protein allows
diffusion of toxic products of the TK enzyme from one cell into
another. The TK/Connexin 43 construct has a CMV promoter operably
linked to a TK gene by an internal ribosome entry sequence and a
Connexin 43-encoding nucleic acid.
[0113] 2. siRNA
[0114] In some embodiments, the nucleic acid is an siRNA. The siRNA
can be used to downregulate or silence the translation (i.e.,
expression) of a gene of interest. Suitable siRNA sequences can be
identified using any means known in the art. Typically, the methods
described in Elbashir, et al., Nature 411:494-498 (2001) and
Elbashir, et al., EMBO J20: 6877-6888 (2001) are combined with
rational design rules set forth in Reynolds et al., Nature Biotech.
22(3):326-330 (2004).
[0115] Typically, the sequence within about 50 to about 100
nucleotides 3' of the AUG start codon of a transcript from the
target gene of interest is scanned for dinucleotide sequences
(e.g., AA, CC, GG, or UU) (see, e.g., Elbashir, et al., EMBO J20:
6877-6888 (2001)). The nucleotides immediately 3' to the
dinucleotide sequences are identified as potential siRNA target
sequences. Typically, the 19, 21, 23, 25, 27, 29, 31, 33, 35 or
more nucleotides immediately 3' to the dinucleotide sequences are
identified as potential siRNA target sites. In some embodiments,
the dinucleotide sequence is an AA sequence and the 19 nucleotides
immediately 3' to the AA dinucleotide are identified as a potential
siRNA target site. Typically siRNA target sites are spaced at
different postitions along the length of the target gene. To
further enhance silencing efficiency of the siRNA sequences,
potential siRNA target sites may be further analyzed to identify
sites that do not contain regions of homology to other coding
sequences. For example, a suitable siRNA target site of about 21
base pairs typically will not have more than 16-17 contiguous base
pairs of homology to other coding sequences. If the siRNA sequences
are to be expressed from an RNA Pol III promoter, siRNA target
sequences lacking more than 4 contiguous A's or T's are
selected.
[0116] Once the potential siRNA target site has been identified
siRNA sequences complementary to the siRNA target sites may be
designed. To enhance their silencing efficiency, the siRNA
sequences may also be analyzed by a rational design algorithm to
identify sequences that have one or more of the following features:
(1) G/C content of about 25% to about 60% G/C; (2) at least 3 A/Us
at positions 15-19 of the sense strand; (3) no internal repeats;
(4) an A at position 19 of the sense strand; (5) an A at position 3
of the sense strand; (6) a U at position 10 of the sense strand;
(7) no G/C at position 19 of the sense strand; and (8) no G at
position 13 of the sense strand. siRNA design tools that
incorporate algorithms that assign suitable values of each of these
features and are useful for selection of siRNA can be found at,
e.g., http://boz094.ust.hk/RNAi/siRNA.
[0117] In some embodiments, once a potential siRNA sequence has
been identified, the sequence is analyzed for the presence or
absence of immunostimulatory motifs (e.g., GU-rich motifs) as
described in, e.g., co-pending U.S. Provisional Patent Application
Nos. 60/585301, filed Jul. 2, 2004; 60/589363, filed Jul. 19, 2004;
60/627326, filed Nov. 12, 2004; and 60/665297, filed Mar. 25, 2005.
Once identified, the immunostimulatory siRNA molecules can be
modified to increase or decrease their immunostimulatory properties
and the non-immunostimulatory molecules can be modified so that
they possess immunostimulatory properties
[0118] 3. Generating siRNA
[0119] siRNA can be provided in several forms including, e.g., as
one or more isolated small-interfering RNA (siRNA) duplexes, longer
double-stranded RNA (dsRNA) or as siRNA or dsRNA transcribed from a
transcriptional cassette in a DNA plasmid. siRNA may also be
chemically synthesized. Preferably, the synthesized or transcribed
siRNA have 3' overhangs of about 1-4 nucleotides, preferably of
about 2-3 nucleotides and 5' phosphate termini. The siRNA sequences
may have overhangs (e.g., 3' or 5' overhangs as described in
(Elbashir, et al., Genes Dev. 15:188 (2001); Nykanen, et al., Cell
107:309 (2001)) or may lack overhangs (i.e., to have blunt
ends).
[0120] An RNA population can be used to provide long precursor
RNAs, or long precursor RNAs that have substantial or complete
identity to a selected target sequence can be used to make the
siRNA. The RNAs can be isolated from cells or tissue, synthesized,
and/or cloned according to methods well known to those of skill in
the art. The RNA can be a mixed population (obtained from cells or
tissue, transcribed from cDNA, subtracted, selected, etc.), or can
represent a single target sequence. RNA can be naturally occurring
(e.g., isolated from tissue or cell samples), synthesized in vitro
(e.g., using T7 or SP6 polymerase and PCR products or a cloned
cDNA); or chemically synthesized.
[0121] To form a long dsRNA, for synthetic RNAs, the complement is
also transcribed in vitro and hybridized to form a dsRNA. If a
naturally occuring RNA population is used, the RNA complements are
also provided (e.g., to form dsRNA for digestion by E. coli RNAse
III or Dicer), e.g., by transcribing cDNAs corresponding to the RNA
population, or by using RNA polymerases. The precursor RNAs are
then hybridized to form double stranded RNAs for digestion. The
dsRNAs can be directly administered to a subject or can be digested
in vitro prior to administration.
[0122] Alternatively, one or more DNA plasmids encoding one or more
siRNA templates are used to provide siRNA. siRNA can be transcribed
as sequences that automatically fold into duplexes with hairpin
loops from DNA templates in plasmids having RNA polymerase III
transcriptional units, for example, based on the naturally
occurring transcription units for small nuclear RNA U6 or human
RNase P RNA H1 (see, Brummelkamp, et al., Science 296:550 (2002);
Donze, et al., Nucleic Acids Res. 30:e46 (2002); Paddison, et al.,
Genes Dev. 16:948 (2002); Yu, et al., Proc. Natl. Acad. Sci.
99:6047 (2002); Lee, et al., Nat. Biotech. 20:500 (2002);
Miyagishi, et al., Nat. Biotech. 20:497 (2002); Paul, et al., Nat.
Biotech. 20:505 (2002); and Sui, et al., Proc. Natl. Acad. Sci.
99:5515 (2002)). Typically, a transcriptional unit or cassette will
contain an RNA transcript promoter sequence, such as an H1-RNA or a
U6 promoter, operably linked to a template for transcription of a
desired siRNA sequence and a termination sequence, comprised of 2-3
uridine residues and a polythymidine (T5) sequence (polyadenylation
signal) (Brummelkamp, Science, supra). The selected promoter can
provide for constitutive or inducible transcription. Compositions
and methods for DNA-directed transcription of RNA interference
molecules is described in detail in U.S. Pat. No. 6,573,099. The
transcriptional unit is incorporated into a plasmid or DNA vector
from which the interfering RNA is transcribed. Plasmids suitable
for in vivo delivery of genetic material for therapeutic purposes
are described in detail in U.S. Pat. Nos. 5,962,428 and 5,910,488.
The selected plasmid can provide for transient or stable delivery
of a target cell. It will be apparent to those of skill in the art
that plasmids originally designed to express desired gene sequences
can be modified to contain a transcriptional unit cassette for
transcription of siRNA.
[0123] Methods for isolating RNA, synthesizing RNA, hybridizing
nucleic acids, making and screening cDNA libraries, and performing
PCR are well known in the art (see, e.g., Gubler & Hoffman,
Gene 25:263-269 (1983); Sambrook et al., supra; Ausubel et al.,
supra), as are PCR methods (see U.S. Pat. Nos. 4,683,195 and
4,683,202; PCR Protocols: A Guide to Methods and Applications
(Innis et al., eds, 1990)). Expression libraries are also well
known to those of skill in the art. Additional basic texts
disclosing the general methods of use in this invention include
Sambrook et al., Molecular Cloning, A Laboratory Manual (2nd ed.
1989); Kriegler, Gene Transfer and Expression: A Laboratory Manual
(1990); and Current Protocols in Molecular Biology (Ausubel et al.,
eds., 1994)).
[0124] A suitable plasmid is engineered to contain, in expressible
form, a template sequence that encodes a partial length sequence or
an entire length sequence of a gene product of interest. Template
sequences can also be used for providing isolated or synthesized
siRNA and dsRNA. Generally, it is desired to downregulate or
silence the transcription and translation of a gene product of
interest.
V. Preparation of Nucleic Acid-Lipid Particles
[0125] The present invention provides a method of preparing
serum-stable nucleic acid-lipid particles in which the plasmid or
other nucleic acid is encapsulated in a lipid bilayer and is
protected from degradation. The particles made by the methods of
this invention typically have a size of about 50 nm to about 150
nm, more typically about 100 nm to about 130 nm, most typically
about 110 nm to about 115 nm. The particles can be formed by any
method known in the art including, but not limited to: a continuous
mixing method, a detergent dialysis method, or a modification of a
reverse-phase method which utilizes organic solvents to provide a
single phase during mixing of the components.
[0126] In preferred embodiments, the cationic lipids are lipids of
Formula I and II or combinations thereof. In other preferred
embodiments, the noncationic lipids are ESM, DOPE, DOPC, DPPE,
DMPE, 16:0 Monomethyl Phosphatidylethanolamine, 16:0 Dimethyl
Phosphatidylethanolamine, 18:1 Trans Phosphatidylethanolamine, 18:0
18:1 Phosphatidylethanolamine (SOPE), 16:0 18:1
Phosphatidylethanolamine, DSPE, polyethylene glycol-based polymers
(e.g., PEG 2000, PEG 5000, PEG-modified diacylglycerols, or
PEG-modified dialkyloxypropyls), distearoylphosphatidylcholine
(DSPC), cholesterol, or combinations thereof. In still other
preferred embodiments, the organic solvents are methanol,
chloroform, methylene chloride, ethanol, diethyl ether or
combinations thereof
[0127] In a particularly preferred embodiment, the nucleic acid is
a plasmid; the cationic lipid is a lipid of Formula I or II or
combinations thereof; the noncationic lipid is ESM, DOPE, PEG-DAAs,
distearoylphosphatidylcholine (DSPC), cholesterol, or combinations
thereof (e.g. DSPC and PEG-DAAs); and the organic solvent is
methanol, chloroform, methylene chloride, ethanol, diethyl ether or
combinations thereof
[0128] In a particularly preferred embodiment, the present
invention provides for nucleic acid-lipid particles produced via a
continuous mixing method, e.g., process that includes providing an
aqueous solution comprising a nucleic acid such as an siRNA or a
plasmid, in a first reservoir, and providing an organic lipid
solution in a second reservoir, and mixing the aqueous solution
with the organic lipid solution such that the organic lipid
solution mixes with the aqueous solution so as to substantially
instantaneously produce a liposome encapsulating the nucleic acid
(e.g., siRNA). This process and the apparatus for carrying this
process is described in detail in U.S. Patent Publication No.
20040142025.
[0129] The action of continuously introducing lipid and buffer
solutions into a mixing environment, such as in a mixing chamber,
causes a continuous dilution of the lipid solution with the buffer
solution, thereby producing a liposome substantially
instantaneously upon mixing. As used herein, the phrase
"continuously diluting a lipid solution with a buffer solution"
(and variations) generally means that the lipid solution is diluted
sufficiently rapidly in a hydration process with sufficient force
to effectuate vesicle generation. By mixing the aqueous solution
comprising a nucleic acid with the organic lipid solution, the
organic lipid solution undergoes a continuous stepwise dilution in
the presence of the buffer solution (i.e., aqueous solution) to
produce a nucleic acid-lipid particle.
[0130] The serum-stable nucleic acid-lipid particles formed using
the continuous mixing method typically have a size of from about 50
nm to about 150 nm, more typically about 100 nm to about 130 nm,
most typically about 110 nm to about 115 nm. The particles thus
formed do not aggregate and are optionally sized to achieve a
uniform particle size.
[0131] In some embodiments, the particles are formed using
detergent dialysis. Without intending to be bound by any particular
mechanism of formation, a plasmid or other nucleic acid (e.g.,
siRNA) is contacted with a detergent solution of cationic lipids to
form a coated nucleic acid complex. These coated nucleic acids can
aggregate and precipitate. However, the presence of a detergent
reduces this aggregation and allows the coated nucleic acids to
react with excess lipids (typically, non-cationic lipids) to form
particles in which the plasmid or other nucleic acid is
encapsulated in a lipid bilayer. Thus, the present invention
provides a method for the preparation of serum-stable nucleic
acid-lipid particles, comprising: [0132] (a) combining a nucleic
acid with cationic lipids in a detergent solution to form a coated
nucleic acid-lipid complex; [0133] (b) contacting non-cationic
lipids with the coated nucleic acid-lipid complex to form a
detergent solution comprising a nucleic acid-lipid complex and
non-cationic lipids; and [0134] (c) dialyzing the detergent
solution of step (b) to provide a solution of serum-stable nucleic
acid-lipid particles, wherein the nucleic acid is encapsulated in a
lipid bilayer and the particles are serum-stable and have a size of
from about 50 to about 150 nm.
[0135] An initial solution of coated nucleic acid-lipid complexes
is formed by combining the nucleic acid with the cationic lipids in
a detergent solution.
[0136] In these embodiments, the detergent solution is preferably
an aqueous solution of a neutral detergent having a critical
micelle concentration of 15-300 mM, more preferably 20-50 mM.
Examples of suitable detergents include, for example,
N,N'-((octanoylimino)-bis-(trimethylene))-bis-(D-gluconamide)
(BIGCHAP); BRIJ 35; Deoxy-BIGCHAP; dodecylpoly(ethylene glycol)
ether; Tween 20; Tween 40; Tween 60; Tween 80; Tween 85; Mega 8;
Mega 9; Zwittergent.RTM. 3-08; Zwittergent.RTM. 3-10; Triton X-405;
hexyl-, heptyl-, octyl- and nonyl-.beta.-D-glucopyranoside; and
heptylthioglucopyranoside; with octyl .beta.-D-glucopyranoside and
Tween-20 being the most preferred. The concentration of detergent
in the detergent solution is typically about 100 mM to about 2 M,
preferably from about 200 mM to about 1.5 M.
[0137] The cationic lipids and nucleic acids will typically be
combined to produce a charge ratio (+/-) of about 1:1 to about
20:1, preferably in a ratio of about 1:1 to about 12:1, and more
preferably in a ratio of about 2:1 to about 6:1. Additionally, the
overall concentration of nucleic acid in solution will typically be
from about 25 .mu.g/mL to about 1 mg/mL, preferably from about 25
.mu.g/mL to about 200 .mu.g/mL, and more preferably from about 50
.mu.g/mL to about 100 .mu.g/mL. The combination of nucleic acids
and cationic lipids in detergent solution is kept, typically at
room temperature, for a period of time which is sufficient for the
coated complexes to form. Alternatively, the nucleic acids and
cationic lipids can be combined in the detergent solution and
warmed to temperatures of up to about 37.degree. C. For nucleic
acids which are particularly sensitive to temperature, the coated
complexes can be formed at lower temperatures, typically down to
about 4.degree. C.
[0138] In a preferred embodiment, the nucleic acid to lipid ratios
(mass/mass ratios) in a formed nucleic acid-lipid particle will
range from about 0.01 to about 0.08. The ratio of the starting
materials also falls within this range because the purification
step typically removes the unencapsulated nucleic acid as well as
the empty liposomes. In another preferred embodiment, the nucleic
acid-lipid particle preparation uses about 400 .mu.g nucleic acid
per 10 mg total lipid or a nucleic acid to lipid ratio of about
0.01 to about 0.08 and, more preferably, about 0.04, which
corresponds to 1.25 mg of total lipid per 50 .mu.g of nucleic
acid.
[0139] The detergent solution of the coated nucleic acid-lipid
complexes is then contacted with non-cationic lipids to provide a
detergent solution of nucleic acid-lipid complexes and non-cationic
lipids. The non-cationic lipids which are useful in this step
include, diacylphosphatidylcholine, diacylphosphatidylethanolamine,
ceramide, sphingomyelin, cephalin, cardiolipin, and cerebrosides.
In preferred embodiments, the non-cationic lipids are
diacylphosphatidylcholine, diacylphosphatidylethanolamine, ceramide
or sphingomyelin. The acyl groups in these lipids are preferably
acyl groups derived from fatty acids having C.sub.10-C.sub.24
carbon chains. More preferably the acyl groups are lauroyl,
myristoyl, palmitoyl, stearoyl or oleoyl. In particularly preferred
embodiments, the non-cationic lipid will be
1,2-sn-dioleoylphosphatidylethanolamine (DOPE), palmitoyl oleoyl
phosphatidylcholine (POPC), egg phosphatidylcholine (EPC),
distearoylphosphatidylcholine (DSPC), cholesterol, or a mixture
thereof. In the most preferred embodiments, the nucleic acid-lipid
particles will be fusogenic particles with enhanced properties in
vivo and the non-cationic lipid will be DSPC or DOPE. In addition,
the nucleic acid-lipid particles of the present invention may
further comprise cholesterol. In other preferred embodiments, the
non-cationic lipids will further comprise polyethylene glycol-based
polymers such as PEG 2000, PEG 5000 and polyethylene glycol
conjugated to a diacylglycerol, a ceramide or a phospholipid, as
described in U.S. Pat. No. 5,820,873 and U.S. Patent Publication
No. 20030077829. In further preferred embodiments, the non-cationic
lipids will further comprise polyethylene glycol-based polymers
such as PEG 2000, PEG 5000 and polyethylene glycol conjugated to a
dialkyloxypropyl.
[0140] The amount of non-cationic lipid which is used in the
present methods is typically about 2 to about 20 mg of total lipids
to 50 .mu.g of nucleic acid. Preferably the amount of total lipid
is from about 5 to about 10 mg per 50 .mu.g of nucleic acid.
[0141] Following formation of the detergent solution of nucleic
acid-lipid complexes and non-cationic lipids, the detergent is
removed, preferably by dialysis. The removal of the detergent
results in the formation of a lipid-bilayer which surrounds the
nucleic acid providing serum-stable nucleic acid-lipid particles
which have a size of from about 50 nm to about 150 nm, more
typically about 100 nm to about 130 nm, most typically about 110 nm
to about 115 nm. The particles thus formed do not aggregate and are
optionally sized to achieve a uniform particle size.
[0142] The serum-stable nucleic acid-lipid particles can be sized
by any of the methods available for sizing liposomes. The sizing
may be conducted in order to achieve a desired size range and
relatively narrow distribution of particle sizes.
[0143] Several techniques are available for sizing the particles to
a desired size. One sizing method, used for liposomes and equally
applicable to the present particles is described in U.S. Pat. No.
4,737,323. Sonicating a particle suspension either by bath or probe
sonication produces a progressive size reduction down to particles
of less than about 50 nm in size. Homogenization is another method
which relies on shearing energy to fragment larger particles into
smaller ones. In a typical homogenization procedure, particles are
recirculated through a standard emulsion homogenizer until selected
particle sizes, typically between about 60 and 80 nm, are observed.
In both methods, the particle size distribution can be monitored by
conventional laser-beam particle size discrimination, or QELS.
[0144] Extrusion of the particles through a small-pore
polycarbonate membrane or an asymmetric ceramic membrane is also an
effective method for reducing particle sizes to a relatively
well-defined size distribution. Typically, the suspension is cycled
through the membrane one or more times until the desired particle
size distribution is achieved. The particles may be extruded
through successively smaller-pore membranes, to achieve a gradual
reduction in size.
[0145] In another group of embodiments, the present invention
provides a method for the preparation of serum-stable nucleic
acid-lipid particles, comprising: [0146] (a) preparing a mixture
comprising cationic lipids and non-cationic lipids in an organic
solvent; [0147] (b) contacting an aqueous solution of nucleic acid
with said mixture in step (a) to provide a clear single phase; and
[0148] (c) removing said organic solvent to provide a suspension of
nucleic acid-lipid particles, wherein said nucleic acid is
encapsulated in a lipid bilayer, and said particles are stable in
serum and have a size of from about 50 to about 150 nm.
[0149] The nucleic acids (or plasmids), cationic lipids and
non-cationic lipids which are useful in this group of embodiments
are as described for the detergent dialysis methods above.
[0150] The selection of an organic solvent will typically involve
consideration of solvent polarity and the ease with which the
solvent can be removed at the later stages of particle formation.
The organic solvent, which is also used as a solubilizing agent, is
in an amount sufficient to provide a clear single phase mixture of
nucleic acid and lipids. Suitable solvents include, but are not
limited to, chloroform, dichloromethane, diethylether, cyclohexane,
cyclopentane, benzene, toluene, methanol, or other aliphatic
alcohols such as propanol, isopropanol, butanol, tert-butanol,
iso-butanol, pentanol and hexanol. Combinations of two or more
solvents may also be used in the present invention.
[0151] Contacting the nucleic acid with the organic solution of
cationic and non-cationic lipids is accomplished by mixing together
a first solution of nucleic acid, which is typically an aqueous
solution, and a second organic solution of the lipids. One of skill
in the art will understand that this mixing can take place by any
number of methods, for example by mechanical means such as by using
vortex mixers.
[0152] After the nucleic acid has been contacted with the organic
solution of lipids, the organic solvent is removed, thus forming an
aqueous suspension of serum-stable nucleic acid-lipid particles.
The methods used to remove the organic solvent will typically
involve evaporation at reduced pressures or blowing a stream of
inert gas (e.g., nitrogen or argon) across the mixture.
[0153] The serum-stable nucleic acid-lipid particles thus formed
will typically be sized from about 50 nm to about 150 nm, more
typically about 100 nm to about 130 nm, most typically about 110 nm
to about 115 nm. To achieve further size reduction or homogeneity
of size in the particles, sizing can be conducted as described
above.
[0154] In other embodiments, the methods will further comprise
adding nonlipid polycations which are useful to effect the delivery
to cells using the present compositions. Examples of suitable
nonlipid polycations include, but are limited to, hexadimethrine
bromide (sold under the brandname POLYBRENE.RTM., from Aldrich
Chemical Co., Milwaukee, Wis., USA) or other salts of
heaxadimethrine. Other suitable polycations include, for example,
salts of poly-L-ornithine, poly-L-arginine, poly-L-lysine,
poly-D-lysine, polyallylamine and polyethyleneimine.
[0155] In certain embodiments, the formation of the nucleic
acid-lipid particles can be carried out either in a mono-phase
system (e.g., a Bligh and Dyer monophase or similar mixture of
aqueous and organic solvents) or in a two-phase system with
suitable mixing.
[0156] When formation of the complexes is carried out in a
mono-phase system, the cationic lipids and nucleic acids are each
dissolved in a volume of the mono-phase mixture. Combination of the
two solutions provides a single mixture in which the complexes
form. Alternatively, the complexes can form in two-phase mixtures
in which the cationic lipids bind to the nucleic acid (which is
present in the aqueous phase), and "pull" it into the organic
phase.
[0157] In another embodiment, the present invention provides a
method for the preparation of nucleic acid-lipid particles,
comprising: [0158] (a) contacting nucleic acids with a solution
comprising non-cationic lipids and a detergent to form a nucleic
acid-lipid mixture; [0159] (b) contacting cationic lipids with the
nucleic acid-lipid mixture to neutralize a portion of the negative
charge of the nucleic acids and form a charge-neutralized mixture
of nucleic acids and lipids; and [0160] (c) removing the detergent
from the charge-neutralized mixture to provide the nucleic
acid-lipid particles in which the nucleic acids are protected from
degradation.
[0161] In one group of embodiments, the solution of non-cationic
lipids and detergent is an aqueous solution. Contacting the nucleic
acids with the solution of non-cationic lipids and detergent is
typically accomplished by mixing together a first solution of
nucleic acids and a second solution of the lipids and detergent.
One of skill in the art will understand that this mixing can take
place by any number of methods, for example, by mechanical means
such as by using vortex mixers. Preferably, the nucleic acid
solution is also a detergent solution. The amount of non-cationic
lipid which is used in the present method is typically determined
based on the amount of cationic lipid used, and is typically of
from about 0.2 to 5 times the amount of cationic lipid, preferably
from about 0.5 to about 2 times the amount of cationic lipid
used.
[0162] In some embodiments, the nucleic acids are precondensed as
described in, e.g., U.S. patent application Ser. No.
09/744,103.
[0163] The nucleic acid-lipid mixture thus formed is contacted with
cationic lipids to neutralize a portion of the negative charge
which is associated with the nucleic acids (or other polyanionic
materials) present. The amount of cationic lipids used will
typically be sufficient to neutralize at least 50% of the negative
charge of the nucleic acid. Preferably, the negative charge will be
at least 70% neutralized, more preferably at least 90% neutralized.
Cationic lipids which are useful in the present invention, include,
for example, DLinDMA and, DLenDMA. These lipids and related analogs
have been described in U.S. Provisional Patent Application Nos.
60/578,075, filed Jun. 7, 2004; 60/610,746, filed Sep. 17, 2004;
and 60/679,427, filed May 9, 2005.
[0164] Contacting the cationic lipids with the nucleic acid-lipid
mixture can be accomplished by any of a number of techniques,
preferably by mixing together a solution of the cationic lipid and
a solution containing the nucleic acid-lipid mixture. Upon mixing
the two solutions (or contacting in any other manner), a portion of
the negative charge associated with the nucleic acid is
neutralized. Nevertheless, the nucleic acid remains in an
uncondensed state and acquires hydrophilic characteristics.
[0165] After the cationic lipids have been contacted with the
nucleic acid-lipid mixture, the detergent (or combination of
detergent and organic solvent) is removed, thus forming the nucleic
acid-lipid particles. The methods used to remove the detergent will
typically involve dialysis. When organic solvents are present,
removal is typically accomplished by evaporation at reduced
pressures or by blowing a stream of inert gas (e.g., nitrogen or
argon) across the mixture.
[0166] The particles thus formed will typically be sized from about
50 nm to several microns, more typically about 50 nm to about 150
nm, even more typically about 100 nm to about 130 nm, most
typically about 110 nm to about 115 nm. To achieve further size
reduction or homogeneity of size in the particles, the nucleic
acid-lipid particles can be sonicated, filtered or subjected to
other sizing techniques which are used in liposomal formulations
and are known to those of skill in the art.
[0167] In other embodiments, the methods will further comprise
adding nonlipid polycations which are useful to effect the
lipofection of cells using the present compositions. Examples of
suitable nonlipid polycations include, hexadimethrine bromide (sold
under the brandname POLYBRENE.RTM., from Aldrich Chemical Co.,
Milwaukee, Wis., USA) or other salts of hexadimethrine. Other
suitable polycations include, for example, salts of
poly-L-ornithine, poly-L-arginine, poly-L-lysine, poly-D-lysine,
polyallylamine and polyethyleneimine. Addition of these salts is
preferably after the particles have been formed.
[0168] In another aspect, the present invention provides methods
for the preparation of nucleic acid-lipid particles, comprising:
[0169] (a) contacting an amount of cationic lipids with nucleic
acids in a solution; the solution comprising from about 15-35%
water and about 65-85% organic solvent and the amount of cationic
lipids being sufficient to produce a +/- charge ratio of from about
0.85 to about 2.0, to provide a hydrophobic nucleic acid-lipid
complex; [0170] (b) contacting the hydrophobic, nucleic acid-lipid
complex in solution with non-cationic lipids, to provide a nucleic
acid-lipid mixture; and [0171] (c) removing the organic solvents
from the nucleic acid-lipid mixture to provide nucleic acid-lipid
particles in which the nucleic acids are protected from
degradation.
[0172] The nucleic acids, non-cationic lipids, cationic lipids and
organic solvents which are useful in this aspect of the invention
are the same as those described for the methods above which used
detergents. In one group of embodiments, the solution of step (a)
is a mono-phase. In another group of embodiments, the solution of
step (a) is two-phase.
[0173] In preferred embodiments, the non-cationic lipids are ESM,
DOPE, DOPC, polyethylene glycol-based polymers (e.g., PEG 2000, PEG
5000, PEG-modified diacylglycerols, or PEG-modified
dialkyloxypropyls), distearoylphosphatidylcholine (DSPC), DPPE,
DMPE, 16:0 Monomethyl Phosphatidylethanolamine, 16:0 Dimethyl
Phosphatidylethanolamine, 18:1 Trans Phosphatidylethanolamine, 18:0
18:1 Phosphatidylethanolamine (SOPE), 16:0 18:1
Phosphatidylethanolamine, DSPE, cholesterol, or combinations
thereof. In still other preferred embodiments, the organic solvents
are methanol, chloroform, methylene chloride, ethanol, diethyl
ether or combinations thereof
[0174] In one embodiment, the nucleic acid is a plasmid from which
an interfering RNA is transcribed; the cationic lipid is DLindMA,
DLenDMA, DODAC, DDAB, DOTMA, DOSPA, DMRIE, DOGS or combinations
thereof; the non-cationic lipid is ESM, DOPE, DAG-PEGs,
distearoylphosphatidylcholine (DSPC), DPPE, DMPE, 16:0 Monomethyl
Phosphatidylethanolamine, 16:0 Dimethyl Phosphatidylethanolamine,
18:1 Trans Phosphatidylethanolamine, 18:0 18:1
Phosphatidylethanolamine (SOPE), 16:0 18:1 Phosphatidylethanolamine
DSPE, cholesterol, or combinations thereof (e.g. DSPC and PEG-DAA);
and the organic solvent is methanol, chloroform, methylene
chloride, ethanol, diethyl ether or combinations thereof.
[0175] As above, contacting the nucleic acids with the cationic
lipids is typically accomplished by mixing together a first
solution of nucleic acids and a second solution of the lipids,
preferably by mechanical means such as by using vortex mixers. The
resulting mixture contains complexes as described above. These
complexes are then converted to particles by the addition of
non-cationic lipids and the removal of the organic solvent. The
addition of the non-cationic lipids is typically accomplished by
simply adding a solution of the non-cationic lipids to the mixture
containing the complexes. A reverse addition can also be used.
Subsequent removal of organic solvents can be accomplished by
methods known to those of skill in the art and also described
above.
[0176] The amount of non-cationic lipids which is used in this
aspect of the invention is typically an amount of from about 0.2 to
about 15 times the amount (on a mole basis) of cationic lipids
which was used to provide the charge-neutralized nucleic acid-lipid
complex. Preferably, the amount is from about 0.5 to about 9 times
the amount of cationic lipids used.
[0177] In yet another aspect, the present invention provides
nucleic acid-lipid particles which are prepared by the methods
described above. In these embodiments, the nucleic acid-lipid
particles are either net charge neutral or carry an overall charge
which provides the particles with greater gene lipofection
activity. Preferably, the nucleic acid component of the particles
is a nucleic acid which interferes with the production of an
undesired protein. In a preferred embodiment, the nucleic acid
comprises an interfering RNA, the non-cationic lipid is egg
sphingomyelin and the cationic lipid is DLinDMA or DLenDMA. In a
preferred embodiment, the nucleic acid comprises an interfering
RNA, the non-cationic lipid is a mixture of DSPC and cholesterol,
and the cationic lipid is DLinDMA or DLenDMA. In other preferred
embodiments, the non-cationic lipid may further comprise
cholesterol.
[0178] A variety of general methods for making SNALP-CPLs
(CPL-containing SNALPs) are discussed herein. Two general
techniques include "post-insertion" technique, that is, insertion
of a CPL into for example, a pre-formed SNALP, and the "standard"
technique, wherein the CPL is included in the lipid mixture during
for example, the SNALP formation steps. The post-insertion
technique results in SNALPs having CPLs mainly in the external face
of the SNALP bilayer membrane, whereas standard techniques provide
SNALPs having CPLs on both internal and external faces. The method
is especially useful for vesicles made from phospholipids (which
can contain cholesterol) and also for vesicles containing
PEG-lipids (such as PEG-DAAs and PEG-DAGs). Methods of making
SNALP-CPL, are taught, for example, in U.S. Pat. Nos. 5,705,385,
6,586,410, 5,981,501 6,534,484; 6,852,334; U.S. Patent Publivation
No. 20020072121, as well as in WO 00/62813.
[0179] A. Administration of the Nucleic Acid-Lipid Particles
[0180] The nucleic acid-lipid particles of the present invention
can be administered either alone or in mixture with a
physiologically-acceptable carrier (such as physiological saline or
phosphate buffer) selected in accordance with the route of
administration and standard pharmaceutical practice. Generally,
normal saline will be employed as the pharmaceutically acceptable
carrier. Other suitable carriers include, e.g., water, buffered
water, 0.4% saline, 0.3% glycine, and the like, including
glycoproteins for enhanced stability, such as albumin, lipoprotein,
globulin, etc.
[0181] The pharmaceutical carrier is generally added following
particle formation. Thus, after the particle is formed, the
particle can be diluted into pharmaceutically acceptable carriers
such as normal saline.
[0182] The concentration of particles in the pharmaceutical
formulations can vary widely, i.e., from less than about 0.05%,
usually at or at least about 2-5% to as much as 10 to 30% by weight
and will be selected primarily by fluid volumes, viscosities, etc.,
in accordance with the particular mode of administration selected.
For example, the concentration may be increased to lower the fluid
load associated with treatment. This may be particularly desirable
in patients having atherosclerosis-associated congestive heart
failure or severe hypertension. Alternatively, particles composed
of irritating lipids may be diluted to low concentrations to lessen
inflammation at the site of administration.
[0183] As described above, in some embodiments, the nucleic
acid-lipid particles of the present invention comprise PEG-DAA
conjugates. It is often desirable to include other components that
act in a manner similar to the PEG-DAA conjugates and that serve to
prevent particle aggregation and to provide a means for increasing
circulation lifetime and increasing the delivery of the nucleic
acid-lipid particles to the target tissues. Such components
include, but are not limited to, PEG-lipid conjugates, such as
PEG-diacylglycerols, PEG-ceramides or PEG-phospholipids (such as
PEG-PE), ganglioside G.sub.M1-modified lipids or ATTA-lipids to the
particles. Typically, the concentration of the component in the
particle will be about 1-20% and, more preferably from about
3-10%.
[0184] The pharmaceutical compositions of the present invention may
be sterilized by conventional, well known sterilization techniques.
Aqueous solutions can be packaged for use or filtered under aseptic
conditions and lyophilized, the lyophilized preparation being
combined with a sterile aqueous solution prior to administration.
The compositions can contain pharmaceutically acceptable auxiliary
substances as required to approximate physiological conditions,
such as pH adjusting and buffering agents, tonicity adjusting
agents and the like, for example, sodium acetate, sodium lactate,
sodium chloride, potassium chloride, and calcium chloride.
Additionally, the particle suspension may include lipid-protective
agents which protect lipids against free-radical and
lipid-peroxidative damages on storage. Lipophilic free-radical
quenchers, such as alphatocopherol and water-soluble iron-specific
chelators, such as ferrioxamine, are suitable.
[0185] In another example of their use, lipid-nucleic acid
particles can be incorporated into a broad range of topical dosage
forms including, but not limited to, gels, oils, emulsions and the
like. For instance, the suspension containing the nucleic
acid-lipid particles can be formulated and administered as topical
creams, pastes, ointments, gels, lotions and the like.
[0186] Once formed, the serum-stable nucleic acid-lipid particles
of the present invention are useful for the introduction of nucleic
acids into cells. Accordingly, the present invention also provides
methods for introducing a nucleic acids (e.g., a plasmid or and
siRNA) into a cell. The methods are carried out in vitro or in vivo
by first forming the particles as described above and then
contacting the particles with the cells for a period of time
sufficient for delivery of the nucleic acid to the cell to
occur.
[0187] The nucleic acid-lipid particles of the present invention
can be adsorbed to almost any cell type with which they are mixed
or contacted. Once adsorbed, the particles can either be
endocytosed by a portion of the cells, exchange lipids with cell
membranes, or fuse with the cells. Transfer or incorporation of the
nucleic acid portion of the particle can take place via any one of
these pathways. In particular, when fusion takes place, the
particle membrane is integrated into the cell membrane and the
contents of the particle combine with the intracellular fluid.
[0188] Using the ERP assay of the present invention, the
transfection efficiency of the SPLP or other lipid-based carrier
system can be optimized. More particularly, the purpose of the ERP
assay is to distinguish the effect of various cationic lipids and
helper lipid components of SPLPs based on their relative effect on
binding/uptake or fusion with/destabilization of the endosomal
membrane. This assay allows one to determine quantitatively how
each component of the SPLP or other lipid-based carrier system
effects transfection efficacy, thereby optimizing the SPLPs or
other lipid-based carrier systems. As explained herein, the
Endosomal Release Parameter or, alternatively, ERP is defined
as:
REPORTER GENE EXPRESS / CELL SPLP UPTAKE / CELL ##EQU00001##
[0189] It will be readily apparent to those of skill in the art
that any reporter gene (e.g., luciferase, .beta.-galactosidase,
green fluorescent protein, etc.) can be used. In addition, the
lipid component (or, alternatively, any component of the SPLP or
lipid-based formulation) can be labeled with any detectable label
provided the does inhibit or interfere with uptake into the cell.
Using the ERP assay of the present invention, one of skill in the
art can assess the impact of the various lipid components (e.g.,
cationic lipid, non-cationic lipid, PEG-lipid derivative, PEG-DAA
conjugate, ATTA-lipid derivative, calcium, CPLs, cholesterol, etc.)
on cell uptake and transfection efficiencies, thereby optimizing
the SPLP or other lipid-based carrier system. By comparing the ERPs
for each of the various SPLPs or other lipid-based formulations,
one can readily determine the optimized system, e.g., the SPLP or
other lipid-based formulation that has the greatest uptake in the
cell coupled with the greatest transfection efficiency.
[0190] Suitable labels for carrying out the ERP assay of the
present invention include, but are not limited to, spectral labels,
such as fluorescent dyes (e.g., fluorescein and derivatives, such
as fluorescein isothiocyanate (FITC) and Oregon Green.sup..theta.;
rhodamine and derivatives, such Texas red, tetrarhodimine
isothiocynate (TRITC), etc., digoxigenin, biotin, phycoerythrin,
AMCA, CyDyes.sup..theta., and the like; radiolabels, such as
.sup.3H, .sup.125I, .sup.35S, .sup.14C, .sup.32P, .sup.33P, etc.;
enzymes, such as horse radish peroxidase, alkaline phosphatase,
etc.; spectral colorimetric labels, such as colloidal gold or
colored glass or plastic beads, such as polystyrene, polypropylene,
latex, etc. The label can be coupled directly or indirectly to a
component of the SNALP, SPLP, or other lipid-based carrier system
using methods well known in the art. As indicated above, a wide
variety of labels can be used, with the choice of label depending
on sensitivity required, ease of conjugation with the SNALP
component, stability requirements, and available instrumentation
and disposal provisions.
VI. Liposomes Containing Cationic Lipids
[0191] In addition to the SNALP formulations described above, the
cationic lipids of the present invention (i.e., cationic lipids of
Formula I or Formula II) can be used in the preparation of either
empty liposomes or liposomes containing one or more bioactive
agents.
[0192] A. Liposome Preparation
[0193] A variety of methods are available for preparing liposomes
as described in, e.g., Szoka, et al., Ann. Rev. Biophys. Bioeng.,
9:467 (1980), U.S. Pat. Nos. 4,186,183, 4,217,344, 4,235,871,
4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028, 4,946,787,
WO 91/17424, Deamer and Bangham, Biochim. Biophys. Acta,
443:629-634 (1976); Fraley, et al., PNAS. USA, 76:3348-3352 (1979);
Hope, et al., Biochim. Biophys. Acta, 812:55-65 (1985); Mayer, et
al., Biochim. Biophys. Acta, 858:161-168 (1986); Williams, et al.,
Proc. Natl. Acad. Sci., 85:242-246 (1988), the text Liposomes, Marc
J. Ostro, ed., Marcel Dekker, Inc., New York, 1983, Chapter 1, and
Hope, et al., Chem. Phys. Lip., 40:89 (1986). Suitable methods
include, but are not limited to, sonication, extrusion, high
pressure/homogenization, microfluidization, detergent dialysis,
calcium-induced fusion of small liposome vesicles, and
ether-infusion methods, all of which are well known in the art.
[0194] One method produces multilamellar vesicles of heterogeneous
sizes. In this method, the vesicle-forming lipids are dissolved in
a suitable organic solvent or solvent system and dried under vacuum
or an inert gas to form a thin lipid film. If desired, the film may
be redissolved in a suitable solvent, such as tertiary butanol, and
then lyophilized to form a more homogeneous lipid mixture which is
in a more easily hydrated powder-like form. This film is covered
with an aqueous buffered solution and allowed to hydrate, typically
over a 15-60 minute period with agitation. The size distribution of
the resulting multilamellar vesicles can be shifted toward smaller
sizes by hydrating the lipids under more vigorous agitation
conditions or by adding solubilizing detergents, such as
deoxycholate.
[0195] Unilamellar vesicles can be prepared by sonication or
extrusion. Sonication is generally performed with a tip sonifier,
such as a Branson tip sonifier, in an ice bath. Typically, the
suspension is subjected to severe sonication cycles. Extrusion may
be carried out by biomembrane extruders, such as the Lipex
Biomembrane Extruder. Defined pore size in the extrusion filters
may generate unilamellar liposomal vesicles of specific sizes. The
liposomes may also be formed by extrusion through an asymmetric
ceramic filter, such as a Ceraflow Microfilter, commercially
available from the Norton Company, Worcester Mass. Unilamellar
vesicles can also be made by dissolving phospholipids in ethanol
and then injecting the lipids into a buffer, causing the lipids to
spontaneously form unilamellar vesicles. Also, phospholipids can be
solubilized into a detergent, e.g., cholates, Triton X, or
n-alkylglucosides. Following the addition of the drug to the
solubilized lipid-detergent micelles, the detergent is removed by
any of a number of possible methods including dialysis, gel
filtration, affinity chromatography, centrifugation, and
ultrafiltration.
[0196] Following liposome preparation, the liposomes which have not
been sized during formation may be sized to achieve a desired size
range and relatively narrow distribution of liposome sizes. A size
range of about 0.2-0.4 microns allows the liposome suspension to be
sterilized by filtration through a conventional filter. The filter
sterilization method can be carried out on a high through-put basis
if the liposomes have been sized down to about 0.2-0.4 microns.
[0197] Several techniques are available for sizing liposomes to a
desired size. One sizing method is described in U.S. Pat. No.
4,737,323. Sonicating a liposome suspension either by bath or probe
sonication produces a progressive size reduction down to small
unilamellar vesicles less than about 0.05 microns in size.
Homogenization is another method that relies on shearing energy to
fragment large liposomes into smaller ones. In a typical
homogenization procedure, multilamellar vesicles are recirculated
through a standard emulsion homogenizer until selected liposome
sizes, typically between about 0.1 and 0.5 microns, are observed.
The size of the liposomal vesicles may be determined by
quasi-electric light scattering (QELS) as described in Bloomfield,
Ann. Rev. Biophys. Bioeng., 10:421-450 (1981). Average liposome
diameter may be reduced by sonication of formed liposomes.
Intermittent sonication cycles may be alternated with QELS
assessment to guide efficient liposome synthesis.
[0198] Extrusion of liposome through a small-pore polycarbonate
membrane or an asymmetric ceramic membrane is also an effective
method for reducing liposome sizes to a relatively well-defined
size distribution. Typically, the suspension is cycled through the
membrane one or more times until the desired liposome size
distribution is achieved. The liposomes may be extruded through
successively smaller-pore membranes, to achieve gradual reduction
in liposome size. For use in the present invention, liposomes
having a size ranging from about 0.05 microns to about 0.40 microns
are preferred. In particularly preferred embodiments, liposomes are
between about 0.05 and about 0.2 microns.
[0199] In preferred embodiments, empty liposomes are prepared using
conventional methods known to those of skill in the art.
[0200] B. Use of Liposomes as Delivery Vehicles
[0201] The drug delivery compositions of the present invention
(e.g., liposomes, micelles, lipid-nucleic acid particles,
virosomes, etc.) are useful for the systemic or local delivery of
therapeutic agents or bioactive agents and are also useful in
diagnostic assays.
[0202] The following discussion refers generally to liposomes;
however, it will be readily apparent to those of skill in the art
that this same discussion is fully applicable to the other drug
delivery systems of the present invention (e.g., micelles,
virosomes, lipoplexes, lipid-nucleic acid particles, etc., all of
which can be advantageous formed using the cationic lipids of
Formula I or II as described herein).
[0203] For the delivery of therapeutic or bioactive agents, the
cationic lipid-containing liposome compositions can be loaded with
a therapeutic agent and administered to the subject requiring
treatment. The therapeutic agents which are administered using the
compositions and methods of the present invention can be any of a
variety of drugs that are selected to be an appropriate treatment
for the disease to be treated. Often the drug will be an
antineoplastic agent, such as vincristine (as well as the other
vinca alkaloids), doxorubicin, mitoxantrone, camptothecin,
cisplatin, bleomycin, cyclophosphamide, methotrexate,
streptozotocin, and the like. Especially preferred antitumor agents
include, for example, actinomycin D, vincristine, vinblastine,
cystine arabinoside, anthracyclines, alkylative agents, platinum
compounds, antimetabolites, and nucleoside analogs, such as
methotrexate and purine and pyrimidine analogs. It may also be
desirable to deliver anti-infective agents to specific tissues
using the compounds and methods of the present invention. The
compositions of the present invention can also be used for the
selective delivery of other drugs including, but not limited to,
local anesthetics, e.g., dibucaine and chlorpromazine;
beta-adrenergic blockers, e.g., propranolol, timolol and labetolol;
antihypertensive agents, e.g., clonidine and hydralazine;
anti-depressants, e.g., imipramine, amitriptyline and doxepim;
anti-conversants, e.g., phenytoin; antihistamines, e.g.,
diphenhydramine, chlorphenirimine and promethazine;
antibiotic/antibacterial agents, e.g., gentamycin, ciprofloxacin,
and cefoxitin; antifungal agents, e.g., miconazole, terconazole,
econazole, isoconazole, butaconazole, clotrimazole, itraconazole,
nystatin, naftifine and amphotericin B; antiparasitic agents,
hormones, hormone antagonists, immunomodulators, neurotransmitter
antagonists, antiglaucoma agents, vitamins, narcotics, and imaging
agents.
[0204] As mentioned above, cationic lipids can be used in the
delivery of therapeutic genes or oligonucleotides intended to
induce or to block production of some protein within the cell.
Nucleic acid is negatively charged and may be combined with a
positively charged entity to form an SPLP suitable for formulation
and cellular delivery of nucleic acid as described above.
[0205] Another clinical application of the cationic lipids of this
invention is as an adjuvant for immunization of both animals and
humans. Protein antigens, such as diphtheria toxoid, cholera toxin,
parasitic antigens, viral antigens, immunoglobulins, enzymes and
histocompatibility antigens, can be incorporated into or attached
onto the liposomes containing the cationic lipids of the present
invention for immunization purposes.
[0206] Liposomes containing the cationic lipids of the present
invention are also particularly useful as carriers for vaccines
that will be targeted to the appropriate lymphoid organs to
stimulate an immune response.
[0207] Liposomes containing the cationic lipids of the present
invention can also be used as a vector to deliver immunosuppressive
or immunostimulatory agents selectively to cells of interest. For
example, glucocorticoids useful to suppress macrophage activity and
lymphokines that activate macrophages can be delivered using the
liposomes of the present invention.
[0208] Liposomes containing the cationic lipids of the present
invention and containing targeting molecules can be used to
selectively modulate many biological activities. For example,
liposomes incorporating a particular antigen can be employed to
stimulate the proliferation of B cells displaying surface
antibodies that specifically bind the antigen, thus inducing an
immune response specific for the antigen. As another example,
liposomes incorporating growth factors or lymphokines on their
surface can be directed to stimulate cells expressing the
appropriate receptors for these factors. Using this approach,
proliferation of bone marrow cells can be stimulated as part of a
therapeutic regimen (e.g., treatment of cancer).
[0209] Liposomes containing the cationic lipids of the present
invention can be used to deliver any product (e.g., therapeutic
agents including nucleic acids, diagnostic agents, labels or other
compounds) to a cell or tissue, including cells and tissues in
mammals.
[0210] In certain embodiments, it is desirable to target the
liposomes of this invention using targeting moieties that are
specific to a cell type or tissue. Targeting of liposomes using a
variety of targeting moieties, such as ligands, cell surface
receptors, glycoproteins, vitamins (e.g., riboflavin) and
monoclonal antibodies, has been previously described (see, e.g.,
U.S. Pat. Nos. 4,957,773 and 4,603,044). The targeting moieties can
comprise the entire protein or fragments thereof.
[0211] Targeting mechanisms generally require that the targeting
agents be positioned on the surface of the liposome in such a
manner that the target moiety is available for interaction with the
target, for example, a cell surface receptor. In one embodiment,
the liposome is designed to incorporate a connector portion into
the membrane at the time of liposome formation. The connector
portion must have a lipophilic portion that is firmly embedded and
anchored into the membrane. It must also have a hydrophilic portion
that is chemically available on the aqueous surface of the
liposome. The hydrophilic portion is selected so as to be
chemically suitable with the targeting agent, such that the portion
and agent form a stable chemical bond. Therefore, the connector
portion usually extends out from the liposome's surface and is
configured to correctly position the targeting agent. In some
cases, it is possible to attach the target agent directly to the
connector portion, but in many instances, it is more suitable to
use a third molecule to act as a "molecular bridge." The bridge
links the connector portion and the target agent off of the surface
of the liposome, thereby making the target agent freely available
for interaction with the cellular target.
[0212] Standard methods for coupling the target agents can be used.
For example, phosphatidylethanolamine, which can be activated for
attachment of target agents, or derivatized lipophilic compounds,
such as lipid-derivatized bleomycin, can be used. Antibody-targeted
liposomes can be constructed using, for instance, liposomes that
incorporate protein A (see, Renneisen, et al., J. Bio. Chem.,
265:16337-16342 (1990) I:and Leonetti, et al., PNAS USA
87:2448-2451 (1990)). Examples of targeting moieties can also
include other proteins, specific to cellular components, including
antigens associated with neoplasms or tumors. Proteins used as
targeting moieties can be attached to the liposomes via covalent
bonds. See, Heath, Covalent Attachment of Proteins to Liposomes,
149 Methods in Enzymology 111-119 (Academic Press, Inc. 1987).
Other targeting methods include the biotin-avidin system.
[0213] In some cases, the diagnostic targeting of the liposome can
subsequently be used to treat the targeted cell or tissue. For
example, when a toxin is coupled to a targeted liposome, the toxin
can then be effective in destroying the targeted cell, such as a
neoplastic cell.
[0214] C. Use of the Liposomes as Diagnostic Agents
[0215] The drug delivery compositions, e.g., liposomes, prepared
using the cationic lipids of the present invention can be labeled
with markers that will facilitate diagnostic imaging of various
disease states including tumors, inflamed joints, lesions, etc.
Typically, these labels will be radioactive markers, although
fluorescent labels can also be used. The use of gamma-emitting
radioisotopes is particularly advantageous as they can easily be
counted in a scintillation well counter, do not require tissue
homogenization prior to counting and can be imaged with gamma
cameras.
[0216] Gamma- or positron-emitting radioisotopes are typically
used, such as ..sup.99Tc, .sup.24 Na, .sup.51Cr, .sub.59Fe,
.sup.67Ga, .sup.86Rb, .sub.111In, .sup.125I, and .sup.195Pt as
gamma-emitting; and such as .sup.68Ga, .sup.82Rb, .sup.22Na,
.sup.75Br, .sup.122I and .sup.18F as positron-emitting. The
liposomes can also be labelled with a paramagnetic isotope for
purposes of in vivo diagnosis, as through the use of magnetic
resonance imaging (MRI) or electron spin resonance (ESR). See, for
example, U.S. Pat. No. 4,728,575.
[0217] D. Loading the Liposomes
[0218] Methods of loading conventional drugs into liposomes
include, for example, an encapsulation technique, loading into the
bilayer and a transmembrane potential loading method.
[0219] In one encapsulation technique, the drug and liposome
components are dissolved in an organic solvent in which all species
are miscible and concentrated to a dry film. A buffer is then added
to the dried film and liposomes are formed having the drug
incorporated into the vesicle walls. Alternatively, the drug can be
placed into a buffer and added to a dried film of only lipid
components. In this manner, the drug will become encapsulated in
the aqueous interior of the liposome. The buffer which is used in
the formation of the liposomes can be any biologically compatible
buffer solution of, for example, isotonic saline, phosphate
buffered saline, or other low ionic strength buffers. Generally,
the drug will be present in an amount of from about 0.01 ng/mL to
about 50 mg/mL. The resulting liposomes with the drug incorporated
in the aqueous interior or in the membrane are then optionally
sized as described above.
[0220] Transmembrane potential loading has been described in detail
in U.S. Pat. Nos. 4,885,172, 5,059,421, and 5,171,578. Briefly, the
transmembrane potential loading method can be used with essentially
any conventional drug which can exist in a charged state when
dissolved in an appropriate aqueous medium. Preferably, the drug
will be relatively lipophilic so that it will partition into the
liposome membranes. A transmembrane potential is created across the
bilayers of the liposomes or protein-liposome complexes and the
drug is loaded into the liposome by means of the transmembrane
potential. The transmembrane potential is generated by creating a
concentration gradient for one or more charged species (e.g.,
Na.sup.+, K.sup.- and/or H.sup.+) across the membranes. This
concentration gradient is generated by producing liposomes having
different internal and external media and has an associated proton
gradient. Drug accumulation can than occur in a manner predicted by
the Henderson-Hasselbach equation.
[0221] The liposome compositions of the present invention can by
administered to a subject according to standard techniques.
Preferably, pharmaceutical compositions of the liposome
compositions are administered parenterally, i.e.,
intraperitoneally, intravenously, subcutaneously or
intramuscularly. More preferably, the pharmaceutical compositions
are administered intravenously by a bolus injection. Suitable
formulations for use in the present invention are found in
Remington's Pharmaceutical Sciences, Mack Publishing Company,
Philadelphia, Pa., 17th ed. (1985). The pharmaceutical compositions
can be used, for example, to diagnose a variety of conditions, or
treat a variety of disease states (such as inflammation, infection
(both viral and bacterial infections), neoplasis, cancer,
etc.).
[0222] Preferably, the pharmaceutical compositions are administered
intravenously. Thus, this invention provides compositions for
intravenous administration which comprise a solution of the
liposomes suspended in an acceptable carrier, preferably an aqueous
carrier. A variety of aqueous carriers can be used, e.g., water,
buffered water, 0.9% isotonic saline, and the like. These
compositions can be sterilized by conventional, well known
sterilization techniques, or may be sterile filtered. The resulting
aqueous solutions may be packaged for use as is or lyophilized, the
lyophilized preparation being combined with a sterile aqueous
solution prior to administration. The compositions may contain
pharmaceutically acceptable auxiliary substances as required to
approximate physiological conditions, such as pH adjusting and
buffering agents, tonicity adjusting agents, wetting agents and the
like, for example, sodium acetate, sodium lactate, sodium chloride,
potassium chloride, calcium chloride, sorbitan monolaurate,
triethanolamine oleate, etc.
[0223] The concentration of liposome compositions in the
pharmaceutical formulations can vary widely, i.e., from less than
about 0.05%, usually at or at least about 2-5% to as much as 10 to
30% by weight and will be selected primarily by fluid volumes,
viscosities, etc., in accordance with the particular mode of
administration selected. For diagnosis, the amount of composition
administered will depend upon the particular label used (i.e.,
radiolabel, fluorescence label, and the like), the disease state
being diagnosed and the judgement of the clinician, but will
generally be between about 1 and about 5 mg per kilogram of body
weight.
EXAMPLES
[0224] The invention will be described in greater detail by way of
the following examples. The following examples are offered for
illustrative purposes, and are not intended to limit the invention
in any manner. Those of skill in the art will readily recognize a
variety of noncritical parameters which can be changed or modified
to yield essentially the same results.
Example 1
Materials and Methods
[0225] Materials: DPPS, 1,2-Distearoyl-sn-glycero-3-phosphocholine
(DSPC) and cholesterol were purchased from Avanti Polar Lipids
(Alabaster, Ala.). TNS was obtained from Sigma-Aldrich Canada
(Oakville, ON). RiboGreen was obtained from Molecular Probes
(Eugene, Oreg.). The alkyl mesylates were purchased from Nu-Chek
Prep, Inc. (Elysian, Minn., USA). siRNA (anti-luciferase and
mismatch control) was purchased from Dharmacon (Lafayette, Colo.,
USA). The anti-luciferase sense sequence was
5'-G.A.U.U.A.U.G.U.C.C.G.G.U.U.A.U.G.U.A.U.U-3'. The
anti-luciferase antisense sequence was
5'-U.A.C.A.U.A.A.C.C.G.G.A.C.A.U.A.A.U.C.U.U-3'. All other
chemicals were purchased from Sigma-Aldrich (Oakville, ON,
Canada).
[0226] Synthesis of DSDMA and DODMA: DSDMA and DODMA were
synthesized using the respective alkyl bromides with methodology
derived from that of a DOTMA precursor (Felgner et al, PNAS USA,
84, 7413-7417 (1987)). 3-(Dimethylamino)-1,2-propanediol (714 mg, 6
mmol) and 95% sodium hydride (NaH, 1.26 g, 50 mmol) were stirred in
benzene (30 mL) under argon for 30 minutes. The correct (either
oleyl or stearyl) alkyl bromide (5.0 g, 15 mmol) was added and the
reaction refluxed under argon for 18 hours. The reaction mixture
was then cooled in an ice bath while quenching via the slow
addition of ethanol. Following dilution with a further 150 mL of
benzene, the mixture was washed with distilled water (2.times.150
mL) and brine (150 mL), using ethanol (.about.20 mL) to aid phase
separation if necessary. The organic phase was dried over magnesium
sulphate and evaporated. The crude product was purified on a silica
gel (Kiesel Gel 60) column eluted with chloroform containing 0-5%
methanol. Column fractions were analyzed by thin layer
chromatography (TLC) (silica gel, chloroform/methanol 9:1 v/v,
visualized with molybdate) and fractions containing pure product
(R.sub.f=0.5) were pooled and concentrated. The product was
decolorized by stirring for 30 minutes in a suspension of activated
charcoal (1 g) in ethanol (75 mL) at 60.degree. C. The charcoal was
removed by filtration through Celite, and the ethanol solution
concentrated to typically yield 2.4 g (65%) of pure product.
.sup.1H-NMR (DSDMA): .delta..sub.H 3.65-3.32 (m, 7H, OCH,
3.times.OCH.sub.2), 2.45-2.31 (m, 2H, NCH.sub.2), 2.27 (s, 6H,
2.times.NCH.sub.3), 1.61-1.45 (m, 4H, OCH.sub.2CH.sub.2), 1.40-1.17
(m, 60H, H.sub.stearyl), 0.86 (t, 6H, CH.sub.2CH.sub.3).
.sup.1H-NMR (DODMA); .delta..sub.H 5.4-5.27 (m, 4H,
2.times.CH.dbd.CH), 3.65-3.35 (m, 7H, OCH, 3.times.OCH.sub.2),
2.47-2.33 (m, 2H, NCH.sub.2), 2.28 (s, 6H, 2.times.NCH.sub.3),
2.06-1.94 (m, 8H, 4.times.CH.sub.2CH.dbd.CH), 1.61-1.50 (m, 4H,
OCH.sub.2CH.sub.2), 1.38-1.20 (m, 48H, H.sub.oleyl), 0.88 (t, 6H,
CH.sub.2CH.sub.3).
[0227] Synthesis of DLinDMA and DLenDMA: The DLinDMA and DLenDMA
were synthesized similarly to the DSDMA and DODMA, but used the
alkyl mesylates instead of alky bromides. The general synthetic
protocol was identical for those of DSDMA and DODMA, substituting
the alkyl mesylates for the bromides in the same molar ratios. The
activated charcoal decolorization step was omitted, since the
products here contain conjugated double bonds and activated
charcoal is expected to adsorb compounds containing such features.
Yields were typically 2.0 g (55%). .sup.1H-NMR (DLinDMA):
.delta..sub.H 5.43-5.27 (m, 8H, 4.times.CH.dbd.CH), 3.65-3.35 (m,
7H, OCH, 3.times.OCH.sub.2), 2.77 (t, 4H, .dbd.CHCH.sub.2CH.dbd.),
2.47-2.33 (m, 2H, NCH.sub.2), 2.28 (s, 6H, 2.times.NCH.sub.3), 2.05
(q, 8H, 4.times.CH.sub.2CH.sub.2CH.dbd.), 1.62-1.50(m, 4H,
OCH.sub.2CH.sub.2), 1.40-1.22 (m, 32H, H.sub.linolenyl), 0.89 (t,
6H, CH.sub.2CH.sub.3). .sup.1H-NMR (DLenDMA): .delta..sub.H
5.44-5.27 (m, 8H, 4.times.CH.dbd.CH), 3.62-3.48 (m, 7H, OCH,
3.times.OCH.sub.2), 2.80 (t, 4H, .dbd.CHCH.sub.2CH.dbd.), 2.43-2.32
(m, 2H, NCH.sub.2), 2.26 (s, 6H, 2.times.NCH.sub.3), 2.12-1.99 (m,
8H, 4.times.CH.sub.2/3CH.sub.2CH.dbd.), 1.61-1.51 (m, 4H,
OCH.sub.2CH.sub.2), 1.40-1.22 (m, 20H, H.sub.linolenyl), 0.98 (t,
6H, CH.sub.2CH.sub.3).
[0228] Synthesis of PEG.sub.2000-C-DMA: PEG-C-DMA was synthesized
as follows. In brief, a C.sub.14 lipid anchor was prepared by first
alkylating the hydroxyl groups of 3-allyloxypropane-1,2-diol with
myristyl bromide. The allyl group was subsequently removed via
palladium catalysis, resulting in the C.sub.14 hydroxyl lipid. The
hydroxyl group was converted to the primary amine by mesylation and
amination to yield 1,2-dimyristyloxypropyl-3-amine, the lipid
anchor. Conjugation with PEG was effected by treating monomethoxy
poly(ethylene glycol) (average molecular weight 2000) with an
excess of diphosgene to form the chloroformate. Addition of the
C.sub.14 amine lipid anchor and stirring overnight yielded
PEG.sub.2000-C-DMA, referred to here as PEG-C-DMA.
[0229] SNALP Preparation: SNALP with a lipid composition of
DSPC:Chol:PEG-C-DMA:Cationic Lipid (20:48:2:30 molar percent) were
prepared using the spontaneous vesicle formation by ethanol
dilution method [Jeffs et al., Pharm. Res. In Press (2005)]. The
sample's were diafiltered against 100 mL of PBS (20 wash volumes)
using a cross flow ultrafltration cartridge (Amersham Biosciences,
Piscataway, N.J.) and sterile filtered through Acrodisc 0.2 .mu.m
Posidyne filters (Pall Corp., Ann Arbor, Mich.). The siRNA
concentration of final samples was determined using the RiboGreen
assay and a siRNA standard curve. Particle size and polydispersity
was determined using a Malvern Instruments Zetasizer 3000HSA
(Malvern, UK). Nucleic acid encapsulation was determined using a
RiboGreen assay, comparing fluorescence in the presence and absence
of Triton X-100. RiboGreen fluorescence was measured using a Varian
Eclipse Spectrofluorometer (Varian Inc) with .lamda..sub.ex=500 nm,
.lamda..sub.em=525 nm.
[0230] TNS Assay: 20 .mu.M of SNALP lipid and 6 .mu.M of TNS were
mixed in a fluorescence cuvette in 2 mL of 20 mM sodium phosphate,
25 mM citrate, 20 mM ammonium acetate and 150 mM NaCl, at a pH that
was varied from 4.5 to 9.5. Fluorescence was determined at each pH
using a Varian Eclipse Spectrofluorometer (Varian Inc) with
settings of .lamda..sub.ex=322 nm, .lamda..sub.em=431 nm.
Fluorescence for each system at the various pH was then normalized
to the value at pH 4.5. The pK.sub.a values are the point at which
50% of the molecules present are charged. By assuming that minimum
fluorescence represents zero charge, and maximum fluorescence
represents 100% charge, pK.sub.a can be estimated by measuring the
pH at the point exactly half way between the values of minimum and
maximum charge.
[0231] .sup.31P Nuclear Magnetic Resonance Spectroscopy:
Multilamellar vesicles (MLV) were prepared comprising DPPS and
cationic lipid at a molar ratio of 1:1. This was accomplished by
drying the lipids from chloroform solution, transferring to 10 mm
NMR tubes, and hydrating in 1.5 mL of 10 mM sodium citrate, pH 4.
Free induction decays (FIDs) corresponding to 1000 scans were
obtained with a 3.0 .mu.s, 60o pulse with a 1 s interpulse delay
and a spectral width of 25000 Hz. A gated two-level proton
decoupling was used to ensure sufficient decoupling with minimum
sample heating. An exponential multiplication corresponding to 50
Hz of line broadening was applied to the FIDs prior to Fourier
transformation. The sample temperature (+/-1.degree. C.) was
regulated using a Bruker B-VT1000 variable temperature unit.
Chemical shifts were referenced to 85% phosphoric acid as an
external standard.
[0232] In vitro Transfection: Cells were cultured in MEM
(Invitrogen) containing 10% fetal bovine serum (FBS) (CanSera) and
0.25 mg/mL G418 (Invitrogen). Neuro2A-G cells (Neuro2A cells stably
transfected to express luciferase [R. E. Kingston. in Current
Protocols in Molecular Biology, Vol. 2, pp. 9.1.4-9.1.9, John Wiley
& Sons, Inc. (1997)]) were plated at a concentration of
4.times.10.sup.4 cells per well in 24-well plates and grown
overnight. Cells were treated with SNALP at doses of 0.0625-1.0
.mu.g/mL nucleic acid (AntiLuc Active or Mismatch Control) and
incubated for 48 hours at 37.degree. C. and 5% CO.sub.2. Cells were
then washed with PBS and lysed with 200 .mu.L 250 mM sodium
phosphate containing 0.1% Triton X-100. The luciferase activity for
each well was determined using Luciferase Reagent (Promega) and a
standard luciferase protein (Roche). The luminescence for each was
measured using a Berthold MicroLumatPlus LB96V plate luminometer.
The resulting luciferase activity was then normalized for the
amount of protein using the Micro BCA assay kit (Pierce).
Luciferase knockdown relative to a control was then determined for
each system.
[0233] Cellular Uptake: SNALP were prepared incorporating the
non-exchangeable tritium-labeled lipid cholesteryl hexadecyl ether
(3H-CHE) (11.1 .mu.Ci/.mu. mol total lipid) [Bally et al., in
Liposome Technology, Vol. III, pp. 27-41, CRC Press (1993)].
Neuro2A cells (ATCC, VA, USA) were plated in 12 well plates at
1.6.times.105 cells per well in minimal essential media. The
following day, media was removed and replaced with media containing
radiolabelled SNALP at 0.5 .mu.g/mL nucleic acid. After 24 hours,
the media and unincorporated SNALP were removed, adherent cells
gently washed 4 times with PBS, and then lysed with 600 .mu.L Lysis
Buffer (250 mM phosphate with 0.1% Triton X-100). The resulting
cell lysate (500 .mu.L) was added to glass scintillation vials
containing 5 mL Picofluor 40 (Perkin Elmer) and .sup.3H-CHE was
determined using a Beckman LS6500 scintillation counter (Beckman
Instruments). The protein content of cell lysates was determined
using the Micro BCA assay (Pierce). Uptake was expressed as a
percentage of the total amount of activity applied to the cells per
mg of cellular protein.
[0234] Uptake of SNALP Containing Cy3-labeled siRNA: SNALP were
formulated as previously described, but using siRNA labelled with
the fluorophore Cy3 (Cy3-siRNA was a gift of Sirna Therapeutics
Inc, Boulder, Colo.). The encapsulation, siRNA concentration, and
particle size were determined as described.
[0235] For the uptake study, 8.times.10.sup.4 Neuro2A-G cells were
grown overnight on 4-well chamber slides (B D Falcon, Mississauga,
ON) in MEM containing 0.25 mg/mL G418. DSDMA, DODMA, DLinDMA, and
DLenDMA SNALP containing Cy3-siRNA, as well as naked Cy3-siRNA and
unlabeled DSDMA SNALP were placed on the cells at 0.5 .mu.m/mL
siRNA. After a 4 hour incubation with the transfection media, the
cells were washed with PBS, then with MEM containing G418 and
finally with PBS once more. The cells were then fixed in a 4%
paraformaldehyde solution in PBS for 10 min at room temperature.
The cells were washed with PBS and stained with 300 nM DAPI
(Molecular Probes, Eugene, Oreg.) in PBS for 5 minutes. The cells
were washed with PBS, the mounting media ProLong Gold Antifade
Reagent (Molecular Probes, Eugene, Oreg.) applied and a cover slip
added. The cells were viewed using an Olympus BX60 Microscope
modified for fluorescence capabilities. Cy3 fluorescence within the
cells was visualized using a rhodamine cube set (Microgen Optics,
Redding, Calif.) and the DAPI fluorescence was visualized using a
DAPI cube set (Carsen Group, Markham, ON). Digital pictures were
captured using an Olympus DP70 camera system. Pictures of the cells
were taken at exposure times of 1/4 sec when examining Cy3
fluorescence and 1/80 sec when examining DAPI fluorescence.
Example 2
Assays for Serum Stability
[0236] Lipid/nucleic acid particles formulated according to the
above noted techniques can be assayed for serum stability by a
variety of methods.
[0237] For instance, in a typical DNase 1 digestion, 1 .mu.g of DNA
encapsulated in the particle of interest is incubated in a total
volume of 100 .mu.L of 5 mM HEPES, 150 mM NaCl, 10.0 mM MgCl.sub.2
pH 7.4. DNase treated samples are treated with either 100 or 10 U
of DNase I (Gibco--BRL). 1.0% Triton X-100 can be added in control
experiments to ensure that lipid formulations are not directly
inactivating the enzyme. Samples are incubated at 37.degree. C. for
30 min after which time the DNA is isolated by addition of 500
.mu.L of DNAZOL followed by 1.0 mL of ethanol. The samples are
centrifuged for 30 min at 15,000 rpm in a tabletop microfuge. The
supernatant is decanted and the resulting DNA pellet is washed
twice with 80% ethanol and dried. This DNA is resuspended in 30
.mu.L of TE buffer. 20 .mu.L of this sample is loaded on a 1.0%
agarose gel and subjected to electrophoresis in TAE buffer.
[0238] In a typical serum assay, 50 .mu.g of DNA in free,
encapsulated, or encapsulated+0.5% Triton X100 was aliquoted into
1.5 mL Eppendorf tubes. To the tubes were added 45 .mu.l normal
murine or human serum, dH2O (to make final volume 50 .mu.L). The
tubes were sealed with parafilm and incubated at 37.degree. C. A
sample of the free, encapsulated, or encapsulated+0.5% Triton X100
not digested by nuclease (standard) was frozen in liquid nitrogen
in an Eppendorf tube and stored at -20.degree. C. Aliquots were
taken at various time points, added to GDP buffer containing
proteinase K (133 .mu.g/mL) and immediately frozen in liquid
nitrogen to stop the reaction. Once all of the time points were
collected, the samples were incubated at 55.degree. C. in a
waterbath to activate proteinase K enabling it to denature any
remaining exonuclease. Proteinase K digested samples were applied
to polyacrylamide gels to assess levels of exonuclease
degradation.
[0239] Particles disclosed above demonstrate serum stability by
showing less than 5% and preferably undetectable amounts of DNA
degradation (partial or total) as a result of such treatment, even
in the presence of 100 U DNase 1. This compares favorably to free
DNA, which is completely degraded, and plasmid/lipid complexes
(such as DOTMA or DODAC:DOPE complexes), wherein DNA is
substantially (i.e., greater than 20%, often 80%) degraded after
such treatment.
Example 3
Synthesis of 1,2-DiLinoleyloxy-N,N-dimethylaminopropane (DLinDMA)
and 1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA)
[0240] 3-(Dimethylamino)-1,2-propanediol (714 mg, 6 mmol) and 95%
sodium hydride (NaH, 1.26 g, 50 mmol) are stirred in benzene (30
mL) under nitrogen for 30 minutes. Linoleyl mesylate (5.0 g, 15
mmol) is added and the reaction refluxed under nitrogen for 3
hours. The reaction mixture is then cooled in an ice bath while
quenching via the slow addition of ethanol. Following dilution with
a further 150 mL of benzene, the mixture is washed with distilled
water (2.times.150 mL) and brine (150 mL). The organic phase is
dried over magnesium sulphate and evaporated to give the crude
product.
[0241] The crude product is purified on a silica gel (Kiesel Gel
60) column eluted with 0-5% methanol in chloroform. Column
fractions are analyzed by thin layer chromatography (TLC) (silica
gel, chloroform/methanol 9:1 v/v, visualized with molybdate dip)
and fractions containing purified product (R.sub.f=0.5) are pooled
and concentrated.
[0242] Decolorization and further purification of DLinDMA is
effected with a second column, this time eluting with 20-50% ethyl
acetate in hexane. Column fractions are analyzed by TLC (silica
gel, ethyl acetate/hexane 1:1 v/v, visualized with molybdate) and
fractions containing pure product (R.sub.f=0.4) are pooled and
concentrated. The procedure described herein typically yields 2.2 g
(60%) of pure product.
[0243] For synthesis of DLenDMA, linolenyl mesylate is substituted
for linoleyl mesylate and the remainder of the synthesis,
decolorization, and purification reactions is carried out as
described above.
Example 4
Formulation Characteristics of Unsaturated Lipids Are Uniform and
Reproducible
[0244] This example sets forth the physical properties of the SNALP
formulations described herein. SNALP containing the various
cationic lipids were prepared as described and encapsulated RNA and
particle size assessed (Table 1 below). The three unsaturated
cationic lipids resulted in formulations that were approximately
the same size (132-140 nm). Polydispersity of all formulations was
low, indicating a narrow distribution of particle size. RNA
encapsulation in the final particles was 84-85% of the total.
Attempts to encapsulate siRNA in SNALP using the saturated lipid
DSDMA resulted in the formation of slightly larger particles (180
nm) with encapsulation of 67%.
[0245] Percentage Encapsulation was determined using the RiboGreen
fluorescence assay to measure the amount of encapsulated nucleic
acid relative to the total nucleic acid present. Particle diameter
and polydispersity was measured using a Malvern Zetasizer. Values
are the mean of 3 separate experiments, the error is standard
deviation.
TABLE-US-00002 Cationic Lipid % Encapsulation Diameter (nm)
Polydispersity DSDMA 67 .+-. 3 182 .+-. 11 0.15 .+-. 0.03 DODMA 84
.+-. 1 137 .+-. 4 0.12 .+-. 0.01 DLinDMA 84 .+-. 3 140 .+-. 6 0.11
.+-. 0.02 DLenDMA 85 .+-. 1 132 .+-. 7 0.13 .+-. 0.03
Example 5
pKa of Cationic Lipids is Influenced by Saturation
[0246] The apparent pK.sub.a of the cationic lipids was determined
as described in Example 1 above. Our determination of lipid
pK.sub.a utilized 2-(p-toluidino)naphthalene-6-sulfonic acid, a
negatively charged indicator of membrane potential (Bailey and
Cullis, Biochemistry 33 12573-80 (1994)). TNS is electrostatically
attracted to positively charged membranes. Subsequent adsorption to
the lipid membrane results in the immediate environment of the TNS
becoming more lipophilic, removing the water molecules that
otherwise quench TNS fluorescence. Since TNS is more readily
absorbed by positively charged membranes, TNS fluorescence is an
indicator of positive membrane surface charge. The surface pK.sub.a
values of each SNALP formulation were determined by varying the
local pH in the presence of TNS. In FIG. 5, it can be seen that
formulations containing unsaturated lipids have similar pK.sub.a
values (6.7-7.0) suggesting that the particles are charge neutral
at physiological pH but become positively charged at endosomal pH.
The saturated lipid DSDMA, however, generated particles with a
higher pK.sub.a of approximately 7.6. SNALP particles containing
DSDMA would be expected to be charged at physiological pH.
[0247] The results shown in FIG. 5 demonstrate that lipid pK.sub.a
correlated with degree of saturation with DSDMA, DODMA, DLinDMA,
and DLenDMA exhibiting pK.sub.as of 7.6, 7.0, 6.7, and 6.7,
respectively.
Example 6
The Bilayer-To-Hexagonal Phase Transition Temperature Increases
With Alkyl Chain Saturation
[0248] The significance of saturation with respect to phase
transition temperature was investigated using .sup.31P-NMR. Lipid
polymorphism in anionic phospholipid/cationic lipid mixtures has
been examined by others using this technique, facilitated by the
presence of a phosphate group in the phospholipid (Epand et al.,
Chem. Phys. Lipids 57 75-80 (1991)); Felgner et al., PNAS USA 84
7413-7417 (1987)). The shape of the NMR trace varies depending on
the arrangement of the lipids. A bi-layer structure yields a high
field peak with a low field shoulder. However, above the Phase
Transition Temperature, (T.sub.c), lipids adopt a fusogenic
H.sub.II phase, indicated by a reversed pattern with the peak
appearing on the low field side. .sup.31P-NMR studies have
previously shown that above certain temperatures (the Phase
Transition Temperature, T.sub.c), lipids may adopt the fusogenic
H.sub.11 phase [Epand et al., Chem. Phys. Lipids 57 75-80 (1991);
Felgner et al., PNAS USA. 84 7413-7417 (1987)]. A higher
temperature required to convert a bilayer (La phase) to the H.sub.H
phase indicates a less fusogenic bilayer. By determining the
temperature at which the conversion occurs, the relative ease with
which the lipids form the H.sub.H phase, their `fusogenicity`, can
be determined.
[0249] MLV were prepared using the anionic lipid DPPS in a 1:1
molar ratio with each cationic lipid. The .sup.31P-NMR spectra of
the MLV were measured at various temperatures. MLV containing the
saturated lipid DSDMA showed no appreciable sign of adopting the
H.sub.II phase, even at temperatures as high as 50.degree. C.
However DODMA (1 double bond per alkyl chain) containing MLV
exhibit a phase transition temperature between 30 and 35.degree. C.
The presence of a second double bond (DLinDMA) reduced the T.sub.c
still further to between 20 and 25.degree. C., while incorporation
of a 3rd double bond (DLenDMA) has little further effect. As can be
seen in FIG. 6A, for the DSDMA/DPPS system, the bilayer pattern
occurs from temperatures of 30 to 50.degree. C. (a high-field peak
with a low-field shoulder). Therefore, DSDMA would appear to have
very little ability to form H.sub.II phases in conjunction with the
anionic lipid. The cationic lipid with a single double bond, DODMA,
possesses a transition temperature between 30 and 35.degree. C.
(FIG. 6B). The DLinDMA (2 double bonds) and DLenDMA (3 double
bonds) systems exhibit somewhat similar transition temperatures
between 20 and 25.degree. C. (FIGS. 6C and 6D). It should be noted
that the central, isotropic peak seen in traces 6C and 6D does not
represent the phase transition temperature but rather results from
small phospholipid vesicles that are also present in the
preparation. The shift in lineshape asymmetry from a high-field
peak/low-field shoulder (bi-layer phase, lower temperatures) to
low-field peak/high-field shoulder (inverted hexagonal phase,
higher temperatures) is an indication of phase transition. This is
exhibited, inter alia, in trace 6B (DODMA). Based on these results
we postulated that the fusogenicity of SNALPs comprising the
cationic lipids would increase in the following order:
DSDMA<<DODMA<DLinDMA.apprxeq.DLenDMA and hypothesized that
the potency of the SNALPs with respect to nucleic acid delivery
would demonstrate a similar hierarchy
(DSDMA<<DODMA<DLinDMA.apprxeq.DLenDMA).
Example 7
Silencing of Gene Expression Following Delivery of siRNA
Encapsulated in SPLP Comprising Cationic Lipids
[0250] This example describes experiments comparing expression of
nucleic acids following in vitro transfection of Neuro2A cells with
SNALP comprising: (1) DODAC, DODMA, or DLinDMA; (2) PEG-C-DMA; and
(3) an siRNA duplex directed against luciferase encapsulated in the
SNALP (i.e., siRNA comprising the following sequence:
GAUUAUGUCCGGUUAUGUAUU and targeting the DNA sequence complementary
to: GATTATGTCCGGTTATGTATT). Neuro2A cells were stably transfected
with a plasmid encoding luciferase under the control of the CMV
promoter (pLO55). The stably transfected cells were then
transfected with SNALP comprising: 15, 20, 25, 30, 35, or 40% of
DODAC, DODMA, or DLinDMA; 2% PEG-C-DMA, and an siRNA duplex
directed against luciferase encapsulated in the SNALP. Luciferase
protein expression was measured 48 hours after transfection with
SNALP. SNALP comprising 30% DLinDMA was more effective in reducing
luciferase expression in the Neuro2A cells than SNALP comprising
DODAC or DODMA were. These results are shown in FIG. 6.
[0251] As shown in FIG. 6, the results of luciferase gene silencing
experiments, using SNALP to deliver siRNA directed against the
luciferase gene supported the .sup.31P-NMR data. Cells were treated
with SNALP containing each of the four cationic lipids (i.e.,
DSDMA. DODMA, DLinDMA, and DLenDMA). After 48 hours, SNALP
containing DSDMA, which was shown to be poorly fusogenic by NMR,
had no effect on luciferase gene expression. In contrast, the
unsaturated lipid formulations, which are more amenable to H.sub.II
phase formation, resulted in significant silencing of the
luciferase gene. Further, the extent of silencing corresponds with
the propensity for each cationic lipid to form the fusogenic
H.sub.II phase. DLinDMA, the most fusogenic lipid with the lowest
apparent phase transition temperature, yielded the greatest
knockdown when incorporated in SNALP, with luciferase expression
only 21% that of the untreated control. This was followed by the
DLenDMA formulation (32%), and DODMA (54%). The close
correspondence between knockdown efficiency and the H.sub.11 phase
forming ability of the cationic lipid as observed suggests that the
two parameters are linked.
Example 8
SNALP Containing Unsaturated Cationic Lipids Show Increased
Gene-Silencing Activity
[0252] The ability of SNALP containing each of the four cationic
lipids (i.e., DSDMA, DODMA, DLinDMA, and DLenDMA) to effect gene
silencing in stably transfected Neuro2A cells was evaluated.
Neuro2A cells stably transfected to express the luciferase were
treated with SNALP containing anti-luciferase siRNA for 48 hours.
Gene-silencing efficiency was evaluated by comparing the remaining
luciferase activity in these cells to that remaining in cells
treated with control SNALP containing mismatch siRNA.
[0253] It was found that, as hypothesized, knockdown efficiency
corresponded to the ability of lipids to form the fusogenic
inverted hexagonal phase. Formulations comprising the saturated
lipid DSDMA demonstrated no activity. As unsaturation in the
lipid's alkyl chain increased, so did the capacity for RNA
interference, with DLinDMA particles yielding an 80% knockdown in
gene expression. .sup.31P-NMR established DLinDMA as having the
lowest phase transition temperature in the series and accordingly,
being the most fusogenic lipid. Particles comprising DLenDMA, the
most unsaturated lipid, were slightly less efficient than those
containing DLinDMA. All results were found to be significant by
t-Test (P<0.05 at siRNA concentration of 0.5 .mu.g/mL, and
P<0.01 at siRNA concentration of 1.0 .mu.g/mL). Error bars
represent standard deviation, n=3. The results are shown in FIG.
7.
Example 9
In Vivo Transfection of Organs by Various SPLP Formulations
[0254] This example describes experiments demonstrating in vivo
transfection of organs with that SPLP comprising 15% DLinDMA can be
used SPLP encapsulating a plasmid encoding luciferase under the
control of the CMV promoter were administered to Neuro2A tumor
bearing male A/J mice. The SPLP had the following formulations:
TABLE-US-00003 Sample Description A SPLP-PEG.sub.2000-C-DMA
(CHOL:DSPC:DODMA:PEG.sub.2000-C-DMA 55:20:15:10 mol %) B
SPLP-PEG.sub.2000 DlinDMA (CHOL:DSPC:DlinDMA:PEG.sub.2000-C-DMA
55:20:15:10 mol %) C SPLP-PEG.sub.750-C-DMA/DODMA
(CHOL:DSPC:DODMA:PEG.sub.750-C-DMA 55:20:15:10 mol %) D
SPLP-PEG.sub.750-C-DMA/DLinDMA (CHOL:DSPC:DlinDMA:PEG.sub.750-C-DMA
55:20:15:10 mol %) 0.41 mg/ml E SPLP- High PEG.sub.750-C-DMA
(CHOL:DSPC:DODMA:PEG.sub.750-C-DMA 50:20:15:15 mol %) F SPLP- High
PEG.sub.750-C-DMA (CHOL:DSPC:DlinDMA:PEG.sub.750-C-DMA 50:20:15:15
mol %) G SPLP-DODAC (CHOL:DSPC:DODMA:PEG.sub.2000-C-DMA:DODAC
45:20:15:10:10 mol %) 0.35 mg/ml
[0255] Luciferase gene expression was assessed in liver, lung,
spleen, heart and tumors 48 hours after intravenous administration
of the SPLP. The results are shown in FIG. 8.
Example 10
In Vivo Transfection of Tumor by Additional SPLP Formulations
[0256] This example describes experiments demonstrating in vivo
transfection of organs with that SPLP comprising DLinDMA or DODMA
and varying percentages (15%, 10%, 5%, or 2.5%) of PEG-C-DMA. SPLP
encapsulating a plasmid encoding luciferase were administered to
Neuro2A tumor bearing male A/J mice. The SPLP had the following
formulations:
TABLE-US-00004 Mol % (DSPC:Chol: PEG-C-DMA: DXDMA A 20:50:15:15
(DODMA) B 20:55:10:15 (DODMA) C 20:60:5:15 (DODMA) D 20:62.5:2.5:15
(DODMA) E 20:55:10:15 (DLinDMA) F 20:60:5:15 (DLinDMA) G
20:62.5:2.5:15 (DLinDMA)
[0257] Luciferase gene expression was assessed in tumors 48 hours
after intravenous administration of SPLP. The results are shown in
FIG. 9.
Example 11
Blood Clearance of Lipid Vesicles comprising PEG-C-DMA
[0258] This example describes experiments conducted to assess the
blood clearance rate of lipid vesicles comprising various
percentages of PEG-C-DMA. A single intravenous dose of
.sup.3H-CHE-labeled SPLP, SNALP, or empty vesicles was administered
to male A/J mice. SPLP comprised the cationic lipid DODMA and SNALP
comprised the cationic lipid DLinDMA. The lipid vesicles had the
following formulations:
TABLE-US-00005 Mol % (DSPC:Chol: PEG-C-DMA: Group Treatment
Cationic Lipid) A Empty vesicles 20:48:2:30 B SNALP (DlinDMA,
PEG-C-DMA) 20:48:2:30 C SNALP (DlinDMA, PEG-C-DMA) 20:55:5:20 D
SPLP (15 mol % PEG-C-DMA) 20:50:15:15 E SPLP (10 mol % PEG-C-DMA)
20:55:10:15 F SPLP (5 mol % PEG-C-DMA) 20:60:5:15
[0259] The percentage of the injected dose of lipid vesicle
remaining in plasma of the mice was determined at 1, 2, 4, and 24
hours following the administration of the .sup.3H-CHE-labeled SPLP,
SNALP, or empty vesicles. The results are shown in FIG. 10.
Example 12
Biodistribution of Lipid Vesicles Comprising PEG-C-DMA
[0260] The example describes experiments conducted to assess the
biodistribution of lipid vesicles comprising various percentages of
PEG-C-DMA. A single intravenous dose of .sup.3H-CHE-labeled SPLP,
SNALP, or empty vesicles was administered to Neuro 2A tumor bearing
male A/J mice. SPLP comprised the cationic lipid DODMA and SNALP
comprised the cationic lipid DLinDMA. The lipid vesicles had the
following formulations:
TABLE-US-00006 Mol % (DSPC:Chol: PEG-C-DMA: Group Treatment
Cationic Lipid) A Empty vesicles 20:48:2:30 B SNALP (DlinDMA,
PEG-C-DMA) 20:48:2:30 C SNALP (DlinDMA, PEG-C-DMA) 20:55:5:20 D
SPLP (15 mol % PEG-C-DMA) 20:50:15:15 E SPLP (10 mol % PEG-C-DMA)
20:55:10:15 F SPLP (5 mol % PEG-C-DMA) 20:60:5:15
[0261] The percentage of the injected dose of lipid vesicles was
assessed in the liver, spleen, lungs, and tumor of the mice 48
hours after administration of the .sup.3H-CHE-labeled vesicles. The
results are shown in FIG. 11.
Example 13
Silencing of Gene Expression at a Distal Tumor
[0262] This example describes experiments demonstrating gene
silencing in distal tumors following administration of SNALP
comprising DLinDMA and encapsulating an anti-luciferase siRNA
sequence.
[0263] Neuro 2A cells were stably transfected with a plasmid
encoding luciferase under the control of the CMV promoter (pLO55)
to generate Neuro 2A-G cells. Male A/J mice were seeded with the
Neuro 2A-G cells. The SNALP encapsulating the anti-luciferase siRNA
sequence (i.e., siRNA comprising the following sequence:
GAUUAUGUCCGGUUAUGUAUU and targeting the DNA sequence complementary
to: GATTATGTCCGGTTATGTATT) were administered to the Neuro2A-G tumor
bearing A/J mice intravenously. The SNALP formulations were as
follows:
TABLE-US-00007 Mol % (DSPC:Chol: PEG-C-DMA: Group DLinDMA) PBS A
Anti Luciferase SNALP 20:48:2:30 B Control (Invert Sequence) SNALP
20:48:2:30 C Anti Luciferase SNALP 20:55:5:20 D Control (Invert
Sequence) SNALP 20:55:5:20 E Anti Luciferase SNALP 20:55:10:15 F
Control (Invert Sequence) SNALP 20:55:10:15
[0264] Luciferase gene expression was measured 48 hours following
administration of SNALP comprising DLinDMA and encapsulating an
anti-luciferase siRNA sequence. The results are shown in FIG.
12.
Example 14
Silencing of Gene Expression in Neuro2A-G Tumor Cells in vitro
[0265] This example describes experiments demonstrating gene
silencing in mammalian cells following contact with SNALP
comprising DLinDMA and encapsulating an anti-luciferase siRNA
sequence described in Example 3 above. Neuro 2A cells were stably
transfected with a plasmid encoding luciferase as described in
Example 3 above to generate Neuro 2A-G cells. The Neuro 2A-G cell
were contacted with SNALP formulations for 24 or 48 hours. The
SNALP formulations comprised either PEG-C-DLA (C.sub.12) or
PEG-C-DMA (C.sub.14) and are as follows:
TABLE-US-00008 Mol % (DSCP:Chol: PEG-C-DAA: Group Treatment
DLinDMA) A SNALP (PEG-C-DLA) 20:48:2:30 B SNALP (PEG-C-DLA)
20:45:5:30 C SNALP (PEG-C-DLA) 20:40:10:30 D SNALP (PEG-C-DMA)
20:48:2:30
[0266] Luciferase gene expression was measured 24 or 48 hours
following contacting the Neuro 2A-G cells with SNALP encapsulating
an anti-luciferase siRNA sequence. The results are shown in FIG.
13.
Example 15
Silencing of Gene Expression in Neuro2A-G Tumor Cells in vitro
[0267] This example describes experiments demonstrating gene
silencing in mammalian cells following contact with SNALP
comprising DLinDMA and encapsulating an anti-luciferase siRNA
sequence described in Example 3 above. Neuro 2A cells were stably
transfected with a plasmid encoding luciferase as described in
Example 3 above to generate
[0268] Neuro 2A-G cells. The Neuro 2A-G cells were contacted with
SNALP formulations for 48 hours in the presence and absence of
chloroquine. The SNALP formulations contained varying percentages
of PEG-C-DMA (C.sub.14) and either DODMA or DLinDMA. The
formulation were as follows:
TABLE-US-00009 Mol % (DSPC:Chol: PEG-C-DAA: Group Treatment
DLinDMA) A PBS -- B Naked siRNA -- C SNALP (PEG-C-DMA) 20:40:10:30
D SNALP (PEG-C-DMA) 20:46:4:30 E SNALP (PEG-C-DMA) 20:48:2:30 F
SNALP (PEG-C-DMA) 20:49:1:30
[0269] Luciferase gene expression was measured 48 hours following
contacting the Neuro 2A-G cells with the SNALP encapsulating an
anti-luciferase siRNA sequence. The results are shown in FIG.
14.
Example 16
SNALP Uptake is Not Rate Limiting for Gene-Silencing Efficiency
[0270] The extent to which formulations are taken up by cells was
measured with SNALP incorporating .sup.3H-labeled CHE [Bally et
al., in Liposome Technology, Vol. III, pp. 27-41, CRC Press
(1993)]. Neuro2A cells were treated with SNALP containing
3H-labeled CHE for 24 hours. The cells were washed to remove
unincorporated SNALP prior to determination of .sup.3H-CHE. Uptake
is expressed as a percentage of the total activity applied to the
cells. Cellular uptake is shown to increase with increasing
cationic lipid saturation. Error bars represent standard deviation,
n=3. The results are shown in FIG. 15.
[0271] After exposing cells to SNALP formulations for 24 hours,
cells were rinsed, lysed and .sup.3H-CHE uptake determined (FIG.
15). Uptake of each individual formulation was independent of SNALP
concentration, with DSDMA particles exhibiting the greatest degree
of uptake. SNALP uptake was observed to decrease with decreasing
saturation the DLenDMA formulation appearing particularly limited
in this respect. These results are contrary to our expectations,
based on the gene silencing results, where the DSDMA formulation is
found to be least effective. They suggest that cellular uptake does
not limit the gene silencing ability of SNALP, but that endosomal
escape, mediated by a fusion event with the endosomal membrane
plays an important role in SNALP mediated nucleic acid delivery.
Analysis by t-test found all results to be significant (P<0.05),
apart from the difference between DODMA and DLinDMA at
concentrations of 0.10, 0.50 and 1.00 .mu.g/mL.
[0272] The uptake process was examined further with the use of
fluorescently labelled SNALP. Neuro2A-G cells were treated with
formulations containing Cy3-labeled siRNA for 4 hours. After
washing and fixing, cell nuclei were stained (blue) with the
fluorescent marker DAPI, to more accurately determine the location
of the fluorescently labelled siRNA (FIG. 6). In keeping with the
results of the .sup.3H-CHE uptake experiment, it can be seen that
the DSDMA formulation is clearly the most efficient at delivering
siRNA to cells. The Cy3 fluorescence (red) is most intense in cells
treated with DSDMA containing SNALP. Again, in agreement with the
radiolabelled uptake study, as the degree of saturation of the
cationic lipid increases, cellular uptake of Cy3 labelled siRNA
increases. Again, Cy3 fluorescence is extremely faint for the
DLenDMA formulation, indicating poor uptake. Negative controls
treated with either naked Cy3-labeled siRNA or unlabeled SNALP
revealing no cell associated Cy3 fluorescence.
[0273] SNALP labeled with the fluorophore Cy3 were applied to cells
and incubated for 4 hours. After washing and fixing, fluorescence
microscopy indicates that siRNA uptake, as measured by Cy3
fluorescence, correlates with cationic lipid saturation. Cell
nuclei were stained with the fluorophore DAPI. Unlabeled SNALP and
naked Cy3-siRNA were used as negative controls
[0274] Investigating the efficiency of SNALP uptake by
incorporation of radiolabelled markers yields further interesting
observations (FIG. 5). It might be expected that SNALP uptake would
be related to the pK.sub.a of the cationic lipid component; the
more positively charged particles having a greater affinity for the
negatively charged cell surface and subsequently greater uptake.
This hypothesis is borne out by the results of this study. The
DSDMA containing formulation, possessing the highest pK.sub.a
(.about.7.6) is clearly taken up most readily, followed by the
DODMA and DLinDMA formulations. Curiously, the uptake of the
DLenDMA formulation is limited when compared to that of the DLinDMA
formulation given that the pK.sub.a of these particles are
identical. This suggests that another attribute of these lipids,
other than pKa, effects cellular uptake. This finding is unlikely
to be a related to differences in particle stability, since
time-course studies confirm that the rate of DLenDMA formulation
uptake is constant over the 24 h period, suggesting that the
formulation remains intact in tissue culture media.
[0275] These results suggest that endocytosis is not rate-limiting
in gene-silencing in vitro when using encasulated siRNA. In fact,
differences in cellular uptake appear to have remarkably little
impact on formulation potency. DLinDMA and DLenDMA formulations,
while similar in their ability to inhibit gene expression, are very
different in the extent to which they are taken up by cells.
Conversely, the DSDMA formulation has almost no capacity for
effecting RNA interference, yet it is clearly quite readily taken
up by cells. The data suggest that the events which have the
greatest effect on the efficiency of gene-silencing occur once the
siRNA has been internalized by the cell.
[0276] In summary, we have synthesized a homologous series of
cationic lipids with incremental degrees of saturation. We show
that the degree of saturation of cationic lipids affects lipid pKa,
fusogenicity, cellular uptake and gene silencing ability when used
to encapsulate and deliver siRNA. Remarkably, more fusogenic
cationic lipids are more potent mediators of RNAi, in spite of
their reduced efficiency at mediating internalization by the cell.
This highlights the relative importance of endosomal release of
nucleic acid payloads. This knowledge can be used to enhance the
efficacy of other lipidic nucleic acid delivery systems and should
be considered in the design of delivery systems for small molecule
drugs.
[0277] It is to be understood that the above description is
intended to be illustrative and not restrictive. Many embodiments
will be apparent to those of skill in the art upon reading the
above description. The scope of the invention should, therefore, be
determined not with reference to the above description, but should
instead be determined with reference to the appended claims, along
with the full scope of equivalents to which such claims are
entitled. The disclosures of all articles and references, including
patent applications, patents and PCT publications, and Genbank
Accession Nos., are incorporated herein by reference for all
purposes.
Sequence CWU 1
1
3121RNAArtificial SequenceDescription of Artificial Sequenceanti-
luciferase siRNA sense sequence 1gauuaugucc gguuauguau u
21221RNAArtificial SequenceDescription of Artificial Sequenceanti-
luciferase siRNA antisense sequence 2uacauaaccg gacauaaucu u
21321DNAArtificial SequenceDescription of Artificial
Sequencesequence complementary to DNA target 3gattatgtcc ggttatgtat
t 21
* * * * *
References