U.S. patent application number 12/971469 was filed with the patent office on 2011-10-06 for anti-icos antibodies and their use in treatment of oncology, transplantation and autoimmune disease.
This patent application is currently assigned to Medlmmune, LLC. Invention is credited to Michael Bowen, Gianluca Carlesso, Anthony COYLE, Bahija Jallal, Yihong Yao.
Application Number | 20110243929 12/971469 |
Document ID | / |
Family ID | 39944236 |
Filed Date | 2011-10-06 |
United States Patent
Application |
20110243929 |
Kind Code |
A1 |
COYLE; Anthony ; et
al. |
October 6, 2011 |
ANTI-ICOS ANTIBODIES AND THEIR USE IN TREATMENT OF ONCOLOGY,
TRANSPLANTATION AND AUTOIMMUNE DISEASE
Abstract
The present invention provides anti-human ICOS antibodies with
increased effector function. The invention further relates to
pharmaceutical compositions, immunotherapeutic compositions, and
methods using therapeutic antibodies that bind to the human ICOS
antigen and that may mediate ADCC, CDC, and/or antibody-dependent
phagocytosis (opsonisation) for the treatment and prevention of T
cell-mediated diseases and disorders, such as, but not limited to,
chronic infection, autoimmune disease or disorder, inflammatory
disease or disorder, graft-versus-host disease (GVHD), transplant
rejection, and T cell proliferative disorder.
Inventors: |
COYLE; Anthony; (Boston,
MA) ; Yao; Yihong; (Boyds, MD) ; Jallal;
Bahija; (Potomac, MD) ; Carlesso; Gianluca;
(Rockville, MD) ; Bowen; Michael; (Rockville,
MD) |
Assignee: |
Medlmmune, LLC
Gaithersburg
MD
|
Family ID: |
39944236 |
Appl. No.: |
12/971469 |
Filed: |
December 17, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12116512 |
May 7, 2008 |
|
|
|
12971469 |
|
|
|
|
60916400 |
May 7, 2007 |
|
|
|
61049131 |
Apr 30, 2008 |
|
|
|
Current U.S.
Class: |
424/133.1 ;
435/320.1; 435/325; 530/387.3; 536/23.53 |
Current CPC
Class: |
A61P 43/00 20180101;
A61P 35/00 20180101; C07K 2317/56 20130101; C07K 2317/72 20130101;
A61P 17/00 20180101; A61P 21/00 20180101; C07K 2317/41 20130101;
A61P 37/02 20180101; A61P 29/00 20180101; C07K 2317/732 20130101;
A61P 37/00 20180101; A61K 2039/505 20130101; C07K 16/28 20130101;
C07K 16/2818 20130101; A61P 37/06 20180101 |
Class at
Publication: |
424/133.1 ;
530/387.3; 536/23.53; 435/320.1; 435/325 |
International
Class: |
A61K 39/395 20060101
A61K039/395; C07K 16/18 20060101 C07K016/18; C07H 21/04 20060101
C07H021/04; C12N 15/63 20060101 C12N015/63; C12N 5/10 20060101
C12N005/10; A61P 37/06 20060101 A61P037/06 |
Claims
1. An isolated anti-ICOS antibody comprising a VH domain, a VK
domain and a variant Fc region, wherein the antibody mediates
enhanced ADCC activity as compared to the level of ADCC activity
mediated by a parent antibody comprising the VH and VK domains and
a wild type Fc region, wherein said antibody is capable of
depleting circulating ICOS-expressing T cells in a mammal for at
least 14 days when administered as a single dose of 125 mg/m.sup.2,
and wherein the variant Fc region is either: a. a variant Fc region
comprising at least one substitution of an amino acid residue
selected from the group consisting of: residue 239, 330, and 332,
wherein the amino acid residue positions are determined according
to the EU convention; or b. an engineered Fc region, wherein the
engineered Fc region comprises complex N-glycoside-linked sugar
chains in which fucose is not bound to N-acetylglucosamine in the
reducing end in the sugar chain.
2. The antibody of claim 1, wherein the EC50 of the antibody as
measured in an in vitro ADCC assay is at least about 7.times.lower
than the EC50 value of the parent antibody.
3. (canceled)
4. (canceled)
5. (canceled)
6. (canceled)
7. (canceled)
8. (canceled)
9. (canceled)
10. The antibody of 1, wherein the VH domain comprises the amino
acid sequence of SEQ ID NO:7 and the VK domain comprises the amino
acid sequence of SEQ ID NO:2.
11. A nucleic acid encoding the amino acid sequence of the antibody
of claim 1 wherein said nucleic acid comprises a nucleotide
sequence selected from the group consisting of SEQ ID NO:28, SEQ ID
NO:29, SEQ ID NO:30, and SEQ ID NO:31.
12. (canceled)
13. A vector comprising the nucleic acid of claim 11.
14. (canceled)
15. An isolated cell comprising the vector of claim 13.
16. (canceled)
17. (canceled)
18. (canceled)
19. (canceled)
20. (canceled)
21. A pharmaceutical composition comprising the antibody of claim 1
in a pharmaceutically-acceptable carrier.
22. (canceled)
23. A method of treating an autoimmune disease or disorder or an
inflammatory disease or disorder in a human, comprising
administering to a human in need thereof a
therapeutically-effective amount of the antibody of claim 1.
24. The method of claim 23, wherein the autoimmune disease or
disorder is SLE or scleroderma.
25. (canceled)
26. (canceled)
27. (canceled)
28. (canceled)
29. The method of claim 23, wherein the inflammatory disease or
disorder is inclusion-body myositis (IBM), polymyositis (PM) or
dermatomyositis (DM).
30. A method of depleting ICOS expressing T cells in a human
patient comprising administering to a human in need thereof a
therapeutically-effective amount of the antibody of claim 1.
31. The method of claim 30, wherein the depletion substantially
persists for at least about 1, at least about 2, at least about 3
or at least about 4 weeks following the administration of the
antibody.
32. The method of claim 30, wherein at least about 95% of the T
cells are depleted.
33. The method of claim 30, wherein the ICOS expressing T cell is a
memory T cell.
34. The method of claim 30, wherein the ICOS expressing T cell is a
circulating T cell.
35. (canceled)
36. (canceled)
37. (canceled)
38. (canceled)
39. (canceled)
40. (canceled)
41. A method of depleting circulating class switched B cells in a
human patient comprising administering an effective amount of the
antibody of claim 1.
42. (canceled)
43. (canceled)
44. The method of claim 41, wherein the depletion substantially
persists for at least about 1, at least about 2, at least about 3
or at least about 4 weeks following the administration of the
antibody.
45. The method of claim 41, wherein at least about 95% of the
circulating class switched B cells are depleted.
46. (canceled)
47. (canceled)
48. (canceled)
49. (canceled)
50. (canceled)
51. (canceled)
52. (canceled)
53. (canceled)
54. (canceled)
55. (canceled)
56. (canceled)
57. (canceled)
58. (canceled)
59. An isolated anti-ICOS antibody comprising a VH domain, a VK
domain and a modified Fc region, wherein the antibody has complex
N-glycoside-linked sugar chains bound to the modified Fc region in
which fucose is not bound to N-acetylglucosamine in the reducing
end in the sugar chain, wherein the antibody mediates enhanced ADCC
activity as compared to the level of ADCC activity mediated by a
parent antibody comprising the VH and VK domains and a
non-engineered Fc region, and wherein said antibody is capable of
depleting class switched B cells in a primate, and wherein the
modified Fc region is either a. a variant Fc region comprising at
least one substitution of an amino acid residue selected from the
group consisting of: residue 239, 330, and 332, wherein the amino
acid residue positions are determined according to the EU
convention; or b. an engineered Fc region, wherein the engineered
Fc region comprises complex N-glycoside-linked sugar chains in
which fucose is not bound to N-acetylglucosamine in the reducing
end in the sugar chain.
60. The antibody of claim 59, wherein the primate is a non-human
primate.
61. The antibody of claim 59, wherein the primate is a human.
62. The antibody of claim 59, wherein the depletion substantially
persists for at least about 1, at least about 2, at least about 3
or at least about 4 weeks following the administration of the
antibody.
63. The antibody of claim 59, wherein at least about 95% of the
circulating class switched B cells are depleted.
Description
[0001] This application claims the benefit under 35 U.S.C.
.sctn.119 (e) of U.S. Provisional Application Nos. 60/916,400,
filed May 7, 2007, and 61/049,131, filed Apr. 30, 2008, the
disclosures of each of which are incorporated herein in their
entirety for all purposes.
1. INTRODUCTION
[0002] The present invention relates to anti-ICOS antibodies with
enhanced effector function. The present invention is also directed
to compositions comprising anti-ICOS antibodies with enhanced
effector function that may mediate one or more of the following:
complement-dependent cell-mediated cytotoxicity (CDC),
antigen-dependent cell-mediated-cytotoxicity (ADCC), and
antibody-dependent phagocytosis (opsonisation). The present
invention is further directed to compositions comprising anti-ICOS
antibodies of the IgG1 and/or IgG3 human isotype, as well as to
compositions comprising anti-ICOS antibodies of the IgG2 and/or
IgG4 human isotype that may mediate human ADCC, CDC, and/or
antibody-dependent phagocytosis.
[0003] The present invention is further directed to methods for the
treatment and prevention of T cell-mediated diseases and disorders,
such as, but not limited to, chronic infection, autoimmune disease
or disorder, inflammatory disease or disorder, graft-versus-host
disease (GVHD), transplant rejection, and T cell proliferative
disorder using therapeutic anti-ICOS antibodies with enhanced
effector function.
2. BACKGROUND
[0004] ICOS is a type I transmembrane protein comprising an
extracellular (Ig)V-like domain. ICOS serves as the receptor for
the B7h co-stimulatory molecule. ICOS expression is low on naive
human T cells but becomes upregulated within hours after TCR
engagement. ICOS expression persists on activated T cells
subpopulations such as Th1, Th2, and Th17 CD4.sup.+ cells.
[0005] Given that ICOS expression is concentrated on activated T
helper cell populations, the therapeutic use of an anti-ICOS
antibody with enhanced effector function holds the promise of
improving the efficacy of treatment and prevention of T
cell-mediated diseases and disorders, such as, but not limited to,
chronic infection, autoimmune disease or disorder, inflammatory
disease or disorder, graft-versus-host disease (GVHD), transplant
rejection, and T cell proliferative disorder using therapeutic
anti-ICOS antibodies with enhanced effector function.
3. SUMMARY
[0006] The present invention relates to anti-ICOS antibodies with
enhanced effector function that bind to the human ICOS molecule, as
well as to compositions comprising those antibodies. In one
embodiment, the present invention provides JMab-136 anti-ICOS
antibodies (see, U.S. Pat. No. 6,803,039) that are able to mediate
an antibody effector function more efficiently than the parental
JMab-136 antibody. In one embodiment, an anti-ICOS antibody of the
invention comprises a variant Fc region. In one embodiment, an
anti-ICOS antibody of the invention comprises a glycosylation
pattern different from that of the parental antibody.
[0007] The present invention also provides pharmaceutical
compositions comprising an anti-ICOS antibody with enhanced
effector function.
[0008] The present invention also relates to methods of treating or
preventing T cell-mediated diseases and disorders, such as, but not
limited to, chronic infection, autoimmune disease or disorder,
inflammatory disease or disorder, graft-versus-host disease (GVHD),
transplant rejection, and T cell proliferative disorder using
therapeutic anti-ICOS antibodies with enhanced effector
function.
3.1. DEFINITIONS
[0009] As used herein, the terms "antibody" and "antibodies"
(immunoglobulins) encompass monoclonal antibodies (including
full-length monoclonal antibodies), polyclonal antibodies,
multispecific antibodies (e.g., bispecific antibodies) formed from
at least two intact antibodies, human antibodies, humanized
antibodies, camelised antibodies, chimeric antibodies, single-chain
Fvs (scFv), single-chain antibodies, single domain antibodies,
domain antibodies, Fab fragments, F(ab')2 fragments, antibody
fragments that exhibit the desired biological activity,
disulfide-linked Fvs (sdFv), and anti-idiotypic (anti-Id)
antibodies (including, e.g., anti-Id antibodies to antibodies of
the invention), intrabodies, and epitope-binding fragments of any
of the above. In particular, antibodies include immunoglobulin
molecules and immunologically active fragments of immunoglobulin
molecules, i.e., molecules that contain an antigen-binding site.
Immunoglobulin molecules can be of any type (e.g., IgG, IgE, IgM,
IgD, IgA and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and
IgA2) or subclass.
[0010] Native antibodies are usually heterotetrameric glycoproteins
of about 150,000 daltons, composed of two identical light (L)
chains and two identical heavy (H) chains. Each light chain is
linked to a heavy chain by one covalent disulfide bond, while the
number of disulfide linkages varies between the heavy chains of
different immunoglobulin isotypes. Each heavy and light chain also
has regularly spaced intrachain disulfide bridges. Each heavy chain
has at one end a variable domain (VH) followed by a number of
constant domains. Each light chain has a variable domain at one end
(VL) and a constant domain at its other end; the constant domain of
the light chain is aligned with the first constant domain of the
heavy chain, and the light chain variable domain is aligned with
the variable domain of the heavy chain. Light chains are classified
as either lambda chains or kappa chains based on the amino acid
sequence of the light chain constant region. The variable domain of
a kappa light chain may also be denoted herein as VK. The term
"variable region" may also be used to describe the variable domain
of a heavy chain or light chain. Particular amino acid residues are
believed to form an interface between the light and heavy chain
variable domains. Such antibodies may be derived from any mammal,
including, but not limited to, humans, monkeys, pigs, horses,
rabbits, dogs, cats, mice, etc.
[0011] The term "variable" refers to the fact that certain portions
of the variable domains differ extensively in sequence among
antibodies and are responsible for the binding specificity of each
particular antibody for its particular antigen. However, the
variability is not evenly distributed through the variable domains
of antibodies. It is concentrated in segments called
Complementarity Determining Regions (CDRs) both in the light chain
and the heavy chain variable domains. The more highly conserved
portions of the variable domains are called the framework regions
(FW). The variable domains of native heavy and light chains each
comprise four FW regions, largely adopting a .beta.-sheet
configuration, connected by three CDRs, which form loops
connecting, and in some cases forming part of, the .beta.-sheet
structure. The CDRs in each chain are held together in close
proximity by the FW regions and, with the CDRs from the other
chain, contribute to the formation of the antigen-binding site of
antibodies (see, Kabat et al., Sequences of Proteins of
Immunological Interest, 5th Ed. Public Health Service, National
Institutes of Health, Bethesda, Md. (1991)). The constant domains
are generally not involved directly in antigen binding, but may
influence antigen binding affinity and may exhibit various effector
functions, such as participation of the antibody in ADCC, CDC,
antibody-dependent phagocytosis and/or apoptosis.
[0012] The term "hypervariable region" when used herein refers to
the amino acid residues of an antibody which are associated with
its binding to antigen. The hypervariable regions encompass the
amino acid residues of the "complementarity determining regions" or
"CDRs" (e.g., residues 24-34 (L1), 50-56 (L2) and 89-97 (L3) of the
light chain variable domain and residues 31-35 (H1), 50-65 (H2) and
95-102 (H3) of the heavy chain variable domain; Kabat et al.,
Sequences of Proteins of Immunological Interest, 5th Ed. Public
Health Service, National Institutes of Health, Bethesda, Md.
(1991)) and/or those residues from a "hypervariable loop" (e.g.,
residues 26-32 (L1), 50-52 (L2) and 91-96 (L3) in the light chain
variable domain and 26-32 (H1), 53-55 (H2) and 96-101 (H3) in the
heavy chain variable domain; Chothia and Lesk, J. Mol. Biol.,
196:901-917 (1987)). "Framework" or "FW" residues are those
variable domain residues flanking the CDRs. FW residues are present
in chimeric, humanized, human, domain antibodies, diabodies,
vaccibodies, linear antibodies, and bispecific antibodies.
[0013] As used herein "Fc region" includes the polypeptides
comprising the constant region of an antibody excluding the first
constant region immunoglobulin domain. Thus Fc refers to the last
two constant region immunoglobulin domains of IgA, IgD, and IgG,
and the last three constant region immunoglobulin domains of IgE
and IgM, and the flexible hinge N-terminal to these domains. For
IgA and IgM Fc may include the J chain. For IgG, Fc comprises
immunoglobulin domains Cgamma2 and Cgamma3 (C.gamma.2 and
C.gamma.3) and the hinge between Cgamma1 (C.gamma.1) and Cgamma2
(C.gamma.2). Although the boundaries of the Fc region may vary, the
human IgG heavy chain Fc region is usually defined to comprise
residues C226 or P230 to its carboxyl-terminus, wherein the
numbering is according to the EU index as in Kabat et al. (1991,
NIH Publication 91-3242, National Technical Information Service,
Springfield, Va.). The "EU index as set forth in Kabat" refers to
the residue numbering of the human IgG1 EU antibody as described in
Kabat et al. supra. Fc may refer to this region in isolation, or
this region in the context of an antibody, antibody fragment, or Fc
fusion protein. An Fc variant protein may be an antibody, Fc
fusion, or any protein or protein domain that comprises an Fc
region. Particularly preferred are proteins comprising variant Fc
regions, which are non-naturally occurring variants of an Fc
region. The amino acid sequence of a non-naturally occurring Fc
region (also referred to herein as a "variant Fc region") comprises
a substitution, insertion and/or deletion of at least one amino
acid residue compared to the wild type amino acid sequence. Any new
amino acid residue appearing in the sequence of a variant Fc region
as a result of an insertion or substitution may be referred to as a
non-naturally occurring amino acid residue. Note: Polymorphisms
have been observed at a number of Fc positions, including but not
limited to Kabat 270, 272, 312, 315, 356, and 358, and thus slight
differences between the presented sequence and sequences in the
prior art may exist.
[0014] The term "monoclonal antibody" as used herein refers to an
antibody obtained from a population of substantially homogeneous
antibodies, i.e., the individual antibodies comprising the
population are identical except for possible naturally occurring
mutations that may be present in minor amounts. Monoclonal
antibodies are highly specific, being directed against a single
antigenic site. Furthermore, in contrast to conventional
(polyclonal) antibody preparations which typically include
different antibodies directed against different determinants
(epitopes), each monoclonal antibody is directed against a single
determinant on the antigen. In addition to their specificity,
monoclonal antibodies are advantageous in that they can be
synthesized by hybridoma cells that are uncontaminated by other
immunoglobulin producing cells. Alternative production methods are
known to those trained in the art, for example, a monoclonal
antibody may be produced by cells stably or transiently transfected
with the heavy and light chain genes encoding the monoclonal
antibody.
[0015] The modifier "monoclonal" indicates the character of the
antibody as being obtained from a substantially homogeneous
population of antibodies, and is not to be construed as requiring
engineering of the antibody by any particular method. The term
"monoclonal" is used herein to refer to an antibody that is derived
from a clonal population of cells, including any eukaryotic,
prokaryotic, or phage clone, and not the method by which the
antibody was engineered. For example, the monoclonal antibodies to
be used in accordance with the present invention may be made by the
hybridoma method first described by Kohler et al., Nature, 256:495
(1975), or may be made by any recombinant DNA method (see, e.g.,
U.S. Pat. No. 4,816,567), including isolation from phage antibody
libraries using the techniques described in Clackson et al.,
Nature, 352:624-628 (1991) and Marks et al., J. Mol. Biol.,
222:581-597 (1991), for example. These methods can be used to
produce monoclonal mammalian, chimeric, humanized, human, domain
antibodies, diabodies, vaccibodies, linear antibodies, and
bispecific antibodies.
[0016] A "human antibody" can be an antibody derived from a human
or an antibody obtained from a transgenic organism that has been
"engineered" to produce specific human antibodies in response to
antigenic challenge and can be produced by any method known in the
art. In certain techniques, elements of the human heavy and light
chain loci are introduced into strains of the organism derived from
embryonic stem cell lines that contain targeted disruptions of the
endogenous heavy chain and light chain loci. The transgenic
organism can synthesize human antibodies specific for human
antigens, and the organism can be used to produce human
antibody-secreting hybridomas. A human antibody can also be an
antibody wherein the heavy and light chains are encoded by a
nucleotide sequence derived from one or more sources of human DNA.
A fully human antibody also can be constructed by genetic or
chromosomal transfection methods, as well as phage display
technology, or in vitro activated ICOS expressing T cells, all of
which are known in the art.
[0017] "Antibody-dependent cell-mediated cytotoxicity" and "ADCC"
refer to a cell-mediated reaction in which non-specific cytotoxic
cells (e.g., Natural Killer (NK) cells, neutrophils, and
macrophages) recognize bound antibody on a target cell and
subsequently cause lysis of the target cell. In one embodiment,
such cells are human cells. While not wishing to be limited to any
particular mechanism of action, these cytotoxic cells that mediate
ADCC generally express Fc receptors (FcRs). The primary cells for
mediating ADCC, NK cells, express Fc.gamma.RIII, whereas monocytes
express Fc.gamma.RI, Fc.gamma.RII, Fc.gamma.RIII and/or
Fc.gamma.RIV. FcR expression on hematopoietic cells is summarized
in Ravetch and Kinet, Annu. Rev. Immunol., 9:457-92 (1991). To
assess ADCC activity of a molecule, an in vitro ADCC assay, such as
that described in U.S. Pat. No. 5,500,362 or 5,821,337 may be
performed. Useful effector cells for such assays include peripheral
blood mononuclear cells (PBMC) and Natural Killer (NK) cells.
Alternatively, or additionally, ADCC activity of the molecules of
interest may be assessed in vivo, e.g., in an animal model such as
that disclosed in Clynes et al., Proc. Natl. Acad. Sci. (USA),
95:652-656 (1998).
[0018] "Complement dependent cytotoxicity" or "CDC" refers to the
ability of a molecule to initiate complement activation and lyse a
target in the presence of complement. The complement activation
pathway is initiated by the binding of the first component of the
complement system (C1q) to a molecule (e.g., an antibody) complexed
with a cognate antigen. To assess complement activation, a CDC
assay, e.g., as described in Gazzano-Santaro et al., J. Immunol.
Methods, 202:163 (1996), may be performed.
[0019] "Antibody-dependent phagocytosis" or "opsonization" as used
herein refers to the cell-mediated reaction wherein nonspecific
cytotoxic cells that express Fc.gamma.Rs recognize bound antibody
on a target cell and subsequently cause phagocytosis of the target
cell.
[0020] "Effector cells" are leukocytes which express one or more
FcRs and perform effector functions. The cells express at least
Fc.gamma.RI, FC.gamma.RII, Fc.gamma.RIII and/or Fc.gamma.RIV and
carry out ADCC effector function. Examples of human leukocytes
which mediate ADCC include peripheral blood mononuclear cells
(PBMC), natural killer (NK) cells, monocytes, cytotoxic T cells and
neutrophils.
[0021] The terms "Fc receptor" or "FcR" are used to describe a
receptor that binds to the Fc region of an antibody. In one
embodiment, the FcR is a native sequence human FcR. Moreover, in
certain embodiments, the FcR is one which binds an IgG antibody (a
gamma receptor) and includes receptors of the Fc.gamma.RI,
Fc.gamma.RII, Fc.gamma.RIII, and Fc.gamma.RIV subclasses, including
allelic variants and alternatively spliced forms of these
receptors. Fc.gamma.RII receptors include Fc.gamma.RIIA (an
"activating receptor") and Fc.gamma.RIIB (an "inhibiting
receptor"), which have similar amino acid sequences that differ
primarily in the cytoplasmic domains thereof. Activating receptor
Fc.gamma.RIIA contains an immunoreceptor tyrosine-based activation
motif (ITAM) in its cytoplasmic domain. Inhibiting receptor
Fc.gamma.RIIB contains an immunoreceptor tyrosine-based inhibition
motif (ITIM) in its cytoplasmic domain. (See, Daeron, Annu. Rev.
Immunol., 15:203-234 (1997)). FcRs are reviewed in Ravetch and
Kinet, Annu. Rev. Immunol., 9:457-92 (1991); Capel et al.,
Immunomethods, 4:25-34 (1994); and de Haas et al., J. Lab. Clin.
Med., 126:330-41 (1995). Other FcRs, including those to be
identified in the future, are encompassed by the term "FcR" herein.
The term also includes the neonatal receptor, FcRn, which is
responsible for the transfer of maternal IgGs to the fetus (Guyer
et al., Immunol., 117:587 (1976) and Kim et al., J. Immunol.,
24:249 (1994)).
[0022] "Affinity" of an antibody for an epitope to be used in the
treatment(s) described herein is a term well understood in the art
and means the extent, or strength, of binding of antibody to
epitope. Affinity may be measured and/or expressed in a number of
ways known in the art, including, but not limited to, equilibrium
dissociation constant (KD or Kd), apparent equilibrium dissociation
constant (KD' or Kd'), and IC.sub.50 (amount needed to effect 50%
inhibition in a competition assay). It is understood that, for
purposes of this invention, an affinity is an average affinity for
a given population of antibodies which bind to an epitope. Values
of KD' reported herein in terms of mg IgG per mL or mg/mL indicate
mg Ig per mL of serum, although plasma can be used. When antibody
affinity is used as a basis for administration of the treatment
methods described herein, or selection for the treatment methods
described herein, antibody affinity can be measured before and/or
during treatment, and the values obtained can be used by a
clinician in assessing whether a human patient is an appropriate
candidate for treatment.
[0023] As used herein, the term "avidity" is a measure of the
overall binding strength (i.e., both antibody arms) with which an
antibody binds an antigen. Antibody avidity can be determined by
measuring the dissociation of the antigen-antibody bond in antigen
excess using any means known in the art, such as, but not limited
to, by the modification of indirect fluorescent antibody as
described by Gray et al., J. Virol. Meth., 44:11-24. (1993) An
"epitope" is a term well understood in the art and means any
chemical moiety that exhibits specific binding to an antibody. An
"antigen" is a moiety or molecule that contains an epitope, and, as
such, also specifically binds to antibody. The term "antibody
half-life" as used herein means a pharmacokinetic property of an
antibody that is a measure of the mean survival time of antibody
molecules following their administration. Antibody half-life can be
expressed as the time required to eliminate 50 percent of a known
quantity of immunoglobulin from the patient's body or a specific
compartment thereof, for example, as measured in serum or plasma,
i.e., circulating half-life, or in other tissues. Half-life may
vary from one immunoglobulin or class of immunoglobulin to another.
In general, an increase in antibody half-life results in an
increase in mean residence time (MRT) in circulation for the
antibody administered.
[0024] The term "isotype" refers to the classification of an
antibody's heavy or light chain constant region. The constant
domains of antibodies are not involved in binding to antigen, but
exhibit various effector functions. Depending on the amino acid
sequence of the heavy chain constant region, a given human antibody
or immunoglobulin can be assigned to one of five major classes of
immunoglobulins: IgA, IgD, IgE, IgG, and IgM. Several of these
classes may be further divided into subclasses (isotypes), e.g.,
IgG1 (gamma 1), IgG2 (gamma 2), IgG3 (gamma 3), and IgG4 (gamma 4),
and IgA1 and IgA2. The heavy chain constant regions that correspond
to the different classes of immunoglobulins are called .alpha.,
.delta., .epsilon., .gamma., and .mu., respectively. The structures
and three-dimensional configurations of different classes of
immunoglobulins are well-known. Of the various human immunoglobulin
classes, only human IgG1, IgG2, IgG3, IgG4, and IgM are known to
activate complement. Human IgG1 and IgG3 are known to mediate ADCC
in humans. Human light chain constant regions may be classified
into two major classes, kappa and lambda
[0025] As used herein, the term "immunogenicity" means that a
compound is capable of provoking an immune response (stimulating
production of specific antibodies and/or proliferation of specific
T cells).
[0026] As used herein, the term "antigenicity" means that a
compound is recognized by an antibody or may bind to an antibody
and induce an immune response.
[0027] By the terms "treat," "treating" or "treatment of" (or
grammatically equivalent terms) it is meant that the severity of
the subject's condition is reduced or at least partially improved
or ameliorated and/or that some alleviation, mitigation or decrease
in at least one clinical symptom is achieved and/or there is an
inhibition or delay in the progression of the condition and/or
prevention or delay of the onset of a disease or illness. Thus, the
terms "treat," "treating" or "treatment of" (or grammatically
equivalent terms) refer to both prophylactic and therapeutic
treatment regimes.
[0028] As used herein, a "sufficient amount" or "an amount
sufficient to" achieve a particular result refers to an amount of
an antibody or composition of the invention that is effective to
produce a desired effect, which is optionally a therapeutic effect
(i.e., by administration of a therapeutically effective amount).
For example, a "sufficient amount" or "an amount sufficient to" can
be an amount that is effective to deplete ICOS expressing T
cells.
[0029] A "therapeutically effective" amount as used herein is an
amount that provides some improvement or benefit to the subject.
Stated in another way, a "therapeutically effective" amount is an
amount that provides some alleviation, mitigation, and/or decrease
in at least one clinical symptom. Clinical symptoms associated with
the disorders that can be treated by the methods of the invention
are well-known to those skilled in the art. Further, those skilled
in the art will appreciate that the therapeutic effects need not be
complete or curative, as long as some benefit is provided to the
subject.
4. BRIEF DESCRIPTION OF THE DRAWINGS
[0030] FIG. 1. Amino acid sequence of the VH (A) and VL (B) domains
of the JMab-136 anti-ICOS antibody. CDR residues, defined according
to Kabat, are in boxed bold letters. Potential O-glycosylation
sites (T or S residue) and deamidation sites (DS or DG residues)
are highlighted in gray.
[0031] FIG. 2. Enhanced binding affinity of IC9G1-aFuc to human and
cynomolgus FcgRIIIa. Binding affinity (nM) of IC9G1-aFuc to
recombinant human and cynomolgus Fc.gamma.Rs was measured as
compared to a control antibodies (IC009 and IC9G1) and is
summarized in this Figure.
[0032] FIG. 3. IC9G1-aFuc inhibits CD3/ICOSL induced human T Cell
proliferation. Human T cells were incubated for 72 hrs on a plate
coated with B7h-Fc (50 .mu.l of 4 .mu.g/ml) and anti-CD3 antibody
(50 .mu.l of 0.2 .mu.g/ml) in the presence of increasing amounts of
the IC9G1-aFuc antibody. T cell proliferation as a function of
IC9G1-aFuc antibody concentration is shown. Data obtained from
control experiments using the IC009 and IC9G1 antibodies are also
shown.
[0033] FIG. 4. IC9G1-aFuc does not inhibit anti-CD3/anti-CD28
antibody mediated proliferation of human tonsillar T cells.
Isolated human tonsillar T cells were incubated for 72 hrs on a
plate coated with anti-CD3 and/or anti-CD28 antibodies. Cell
proliferation detected in the presence of 10 microg/ml of IC9G1 is
shown.
[0034] FIG. 5. The ADCC activity of IC9G1-aFuc is higher than that
of the IC9G1 or IC009 antibodies. ADCC activity was measured using
stable tranfectants (A) HPB-ALL cells (HPB-ALL h-ICOS) and (B)
Jurkat cells (Jurkat h-ICOS) expressing a human ICOS as target
cells. The EC50 activity of the IC9G1-aFuc and IC9G1 antibodies on
HPB-ALL h-ICOS cells was 138 pM and 648 pM, respectively. The EC50
activity of the IC9G1-aFuc and IC9G1 antibodies on transgenic
Jurkat h-ICOS cells was 5.7 pM and 61 pM, respectively.
[0035] FIG. 6. ICOS expression in human tonsil is restricted to
CD4+ memory T.sub.FH cells. The anti-ICOS staining pattern of CD4+
CD45RO-CXCR5- naive T cells and CD4+ CD45RO+CXCR5+ memory T.sub.FH
is shown.
[0036] FIG. 7. The ADCC activity of IC9G1-aFuc is higher than that
of the IC9G1 or IC009 antibodies. ADCC activity was measured using
isolated human tonsillar T cells as target cells. The EC50 activity
of the IC9G1-aFuc and IC9G1 antibodies was 8.2 pM and 60.4 pM,
respectively, in this assay.
[0037] FIG. 8. IC9G1-aFuc mediated ADCC activity on freshly
isolated cynomolgus splenic T cell targets. (A) ICOS expression
profile of isolated cynomolgus splenic CD4+ CD45RA+ naive T cells
and CD4+ CD45RA- memory T cells was determined using flow
cytometry. Flow cytometry plots of stained cells are shown. ICOS
expression level of CD4+ CD45RA- memory T cells is significantly
higher than that of the CD4+ CD45RA+naive T cells. (B) ADCC
cytotoxicity curves of IC009, IC9G1 and IC9G1-aFuc antibodies
measured using isolated cynomolgus splenic T cells is shown. The
ADCC activity of IC9G1-aFuc is higher than that of either the IC009
or IC9G1 antibodies. The EC50 activity of the IC9G1-aFuc and IC9G1
antibodies was 14.6 pM and 236 pM, respectively, in this assay.
[0038] FIG. 9. IC9G1-aFuc mediated ADCC activity on freshly
isolated cynomolgus mesenteric lymph node (MLN) T cell targets. (A)
ICOS expression profile of isolated cynomolgus MLN CD4+ CD45RA+
naive T cells and CD4+ CD45RA- activated T cells was determined
flow cytometry. Flow cytometry plots of stained cells are shown.
ICOS expression level of CD4+ CD45RA- activated T cells is
significantly higher than that of the CD4+ CD45RA+ naive T cells.
(B) ADCC cytotoxicity curves of IC009, IC9G1 and IC9G1-aFuc
antibodies measured using isolated cynomolgus MLN T cells is shown.
The ADCC activity of IC9G1-aFuc is higher than that of either the
IC009 or IC9G1 antibodies. The EC50 activity of the IC9G1-aFuc and
IC9G1 antibodies was 17.1 pM and 198 pM, respectively, in this
assay.
[0039] FIG. 10. IC9G1-aFuc PK profile in cynomolgus monkeys. A
single dose of 0.1 mg/kg, 1 mg/kg or 10 mg/kg of IC9G1-aFuc
antibody was administered intravenously to cynomolgus monkeys.
Serum concentration of the IC9G1-aFuc antibody was measured for 4
weeks post-administration. IC9G1-aFuc serum concentration as a
function of time is shown.
[0040] FIG. 11. A single IV dose of IC9G1-aFuc significantly
depletes the level of CD3+ CD4+CD45RA_ICOS+ memory T cells in
cynomolgus monkeys in vivo. A single dose of 0.01 mg/kg, 0.1 mg/kg,
1 mg/kg or 10 mg/kg of IC9G1-aFuc antibody was administered
intravenously to cynomolgus monkeys. The level CD3+
CD4+CD45RA-ICOS+ memory T cells was monitored over time. Normalized
memory T cell levels as a function of time after IC9G1-aFuc
administration is shown. Administration of a single dose of 0.1
mg/kg, 1 mg/kg or 10 mg/kg of IC9G1-aFuc antibody achieved
essentially complete elimination of CD3+CD4+CD45RA_ICOS+ memory T
cells by day 4. The recovery of the ICOS+ memory T cells was dose
dependent.
[0041] FIG. 12. Flow cytometry based characterization of germinal
center B cells. Cynomolgus germinal center B cells were identified
either as CD3-CD20+IgM-CD95+ cells or CD3-CD20+IgM-CD27+ cells.
[0042] FIG. 13. A single IV dose of IC9G1-aFuc significantly
reduces the level of mesenteric lymph node (MLN) memory helper
ICOS+ T cells and MLN germinal center B cells in cynomolgus monkeys
in vivo. A single dose of 0.1 mg/kg, or 10 mg/kg of IC9G1-aFuc
antibody was administered intravenously to cynomolgus monkeys.
Control animals were treated with 10 mg/kg IC009 or PBS. The level
MLN memory ICOS+ T cells and MLN germinal center B cells were
monitored over time. MLN memory helper T cells were identified as
CD3+ CD4+CD45RA-ICOS+ cells. MLN germinal center B cells were
identified as CD20+CD95+IgM-cells. (A) Total number of MLN T cells
and MLN germinal center B cells on day 8 after treatment are shown.
(B) Percent depletion of ICOS+ T cells and % dissolution of
germinal center B cells on day 8 after treatment are shown.
IC9G1-aFuc administration resulted in a dose dependent depletion of
the memory helper ICOS+ T cells and germinal center B cells from
the MLN.
[0043] FIG. 14. A single IV dose of IC9G1-aFuc significantly
reduces the level of splenic memory helper ICOS+ T cells and
germinal center B cells in cynomolgus monkeys in vivo. A single
dose of 0.1 mg/kg, or 10 mg/kg of IC9G1-aFuc antibody was
administered intravenously to cynomolgus monkeys. Control animals
were treated with 10 mg/kg IC009 or PBS. The level of splenic
memory ICOS+ T cells and germinal center B cells were monitored
over time. Splenic memory helper T cells were identified as
CD3+CD4+CD45RA-ICOS+ cells; germinal center B cells were identified
as CD3-CD20+CD95+IgM-cells. (A) Total number of splenic memory
helper T cells and germinal center B cells on days 8 and 30 after
treatment are shown. (B) Percent depletion of T cells and %
dissolution of germinal center B cells on days 8 and 29 after
treatment are shown. IC9G1-aFuc administration resulted in a
significant depletion of the memory helper T cells and germinal
center B cells from the spleen. Depletion levels were significantly
higher in animals receiving IC9G1-aFuc than in control animals
receiving the IC009 antibody. Maximum depletion of T cells was
achieved by day 8 after IC9G1-aFuc administration. Maximum level of
germinal center B cell depletion was seen on day 29 after
IC9G1-aFuc administration.
[0044] FIG. 15. Splenic germinal centers were atrophied on day 29
after administration of a single dose of IC9G1-aFuc antibody to
cynomolgus monkeys. The morphology of splenic white pulp was
examined following the administration of a single dose f IC9G1-aFuc
antibody. Histological sections of the spleen isolated on day 8 (A)
and day 29 (B) after IC9G1-aFuc antibody administration are shown.
IC9G1-aFuc administration results in severe atrophy of splenic
follicles by day 29.
[0045] FIG. 16. Amino acid sequence alignment of long and short
isoforms of human ICOS (SEQ ID NO: 32 and 33, respectively).
[0046] FIG. 17. Nucleotide sequence complementarity of ICOS mRNA
(SEQ ID NO:34) and selected micro RNA molecules.
[0047] FIG. 18. Relative expression level of miR-101 in muscle
specimen from inclusion-body myositis (IBM), polymyositis (PM), and
dermatomyositis (DM) patients compared to healthy normal controls
as measured by TaqMan QRT-PCR.
[0048] FIG. 19. Relative levels of (A) ICOS and ICOS-L, (B) CD4 and
(C) CD3.epsilon. mRNA in muscle specimen from inclusion-body
myositis (IBM), polymyositis (PM), and dermatomyositis (DM)
patients compared with normal controls as measured by Affymetrix
whole genome array. (D) ICOS and ICOS-L mRNA expression levels in
whole blood (WB) samples isolated from inclusion-body myositis
(IBM), polymyositis (PM), and dermatomyositis (DM) patients
compared to normal controls as measured by TaqMan QRT-PCR.
[0049] FIG. 20. Relative mRNA expression levels of (A) ICOS and
ICOSL, (B) CD4 and (C) CD3.epsilon. in affected skin lesions of SLE
patients compared to normal controls as measured by TaqMan
QRT-PCR.
[0050] FIG. 21. Relative mRNA expression levels of (A) CD28, CTLA4,
ICOS, ICOS-L, (B) CD4 and (C) CD38 in whole blood (WB) from SLE
patients compared to normal controls as measured by TaqMan
QRT-PCR.
5. DETAILED DESCRIPTION
[0051] The present invention relates to methods for generating
anti-ICOS antibodies with enhanced effector function. Using the
methods of the invention, an anti-ICOS parental antibody is
modified to yield an anti-ICOS antibody with enhanced effector
function, such as, but not limited to, enhanced ADCC, enhanced CDC,
and enhanced antibody-dependent phagocytosis. Any anti-ICOS
antibody that specifically binds to the human ICOS antigen may
serve as a parental antibody for the purpose of practicing a method
of the present invention. In one embodiment, anti-ICOS antibodies
disclosed in U.S. Pat. No. 6,803,039 serve as parental antibody. In
a specific embodiment, the JMAb-136 (IgG2) anti-ICOS antibody
serves as the parental antibody.
[0052] The present invention provides anti-ICOS antibodies with
enhanced effector function. In one embodiment, an anti-ICOS
antibody of the invention mediates an antibody dependent effector
function more efficiently than the parental anti-ICOS antibody. In
a specific embodiment, an anti-ICOS antibody of the invention
mediates an antibody dependent effector function more efficiently
than the JMAb-136 (see, U.S. Pat. No. 6,803,039).
[0053] In one embodiment, an anti-ICOS antibody described herein
mediates an antibody dependent effector function more efficiently
than the parental anti-ICOS antibody wherein said effector function
is selected from the group consisting of: antibody-dependent
cell-mediated cytotoxicity (ADCC), complement mediated cytotoxicity
(CDC), antibody-dependent phagocytosis. In one embodiment, an
anti-ICOS antibody of the invention mediates antibody-dependent
cell-mediated cytotoxicity (ADCC) more efficiently than the
parental anti-ICOS antibody. In another embodiment, an anti-ICOS
antibody of the invention mediates complement mediated cytotoxicity
(CDC) more efficiently than the parental anti-ICOS antibody. In a
further embodiment, an anti-ICOS antibody of the invention mediates
antibody-dependent phagocytosis more efficiently than the parental
anti-ICOS antibody.
[0054] In one embodiment, an anti-ICOS antibody of the invention
mediates antibody-dependent cell-mediated cytotoxicity (ADCC) more
efficiently than the parental anti-ICOS antibody wherein the ADCC
activity is determined using an in vitro cytotoxicity assay. In a
specific embodiment, an anti-ICOS antibody of the invention
mediates at least about 5%, at least about 10%, at least about 20%,
at least about 30%, at least about 40%, at least about 50%, at
least about 75%, at least about 100% higher maximum cytotoxicity in
an in vitro ADCC assay than the parental anti-ICOS antibody. In
another specific embodiment, an anti-ICOS antibody of the invention
mediates at least 2 fold, at least 3 fold, at least 4 fold, at
least 5 fold or at least 10 fold higher maximum cytotoxicity in an
in vitro ADCC assay than the parental anti-ICOS antibody.
[0055] In one embodiment, an anti-ICOS antibody of the invention
mediates antibody-dependent cell-mediated cytotoxicity (ADCC) more
efficiently than the JMab-136 anti-ICOS antibody wherein the ADCC
activity is determined using an in vitro cytotoxicity assay. In a
specific embodiment, an anti-ICOS antibody of the invention
mediates at least about 5%, at least about 10%, at least about 20%,
at least about 30%, at least about 40%, at least about 50%, at
least about 75%, at least about 100% higher maximum cytotoxicity in
an in vitro ADCC assay than the JMab-136 anti-ICOS antibody. In
another specific embodiment, an anti-ICOS antibody of the invention
mediates at least 2 fold, at least 3 fold, at least 4 fold, at
least 5 fold or at least 10 fold higher maximum cytotoxicity in an
in vitro ADCC assay than the JMab-136 anti-ICOS antibody.
[0056] In one embodiment, the EC50 of an anti-ICOS antibody of the
invention in an in vitro ADCC assay is at least about 2.times., at
least about 5.times., at least about 10.times., at least about
20.times., at least about 50.times., or at least about 100.times.
lower than that of the parental anti-ICOS antibody.
[0057] In another embodiment, the EC50 of an anti-ICOS antibody of
the invention in an in vitro ADCC assay is at least about 2.times.,
at least about 5.times., at least about 10.times., at least about
20.times., at least about 50.times., or at least about 100.times.
lower than that of the JMab-136 anti-ICOS antibody.
[0058] In one embodiment, an anti-ICOS antibody of the invention
mediates antibody-dependent cell-mediated cytotoxicity (ADCC) more
efficiently than the parental anti-ICOS antibody wherein the ADCC
activity is determined using an in vivo cytotoxicity assay. In a
specific embodiment, an anti-ICOS antibody of the invention
mediates at least about 5%, at least about 10%, at least about 20%,
at least about 30%, at least about 40%, at least about 50%, at
least about 75%, at least about 100% higher maximum cytotoxicity in
an in vivo ADCC assay than the parental anti-ICOS antibody.
[0059] In one embodiment, an anti-ICOS antibody of the invention
mediates antibody-dependent cell-mediated cytotoxicity (ADCC) more
efficiently than the JMab-136 anti-ICOS antibody wherein the ADCC
activity is determined using an in vivo cytotoxicity assay. In a
specific embodiment, an anti-ICOS antibody of the invention
mediates at least about 5%, at least about 10%, at least about 20%,
at least about 30%, at least about 40%, at least about 50%, at
least about 75%, at least about 100% higher maximum cytotoxicity in
an in vivo ADCC assay than the JMab-136 anti-ICOS antibody.
[0060] In one embodiment, an anti-ICOS antibody of the invention
mediates complement-dependent cytotoxicity (CDC) more efficiently
than the parental anti-ICOS antibody wherein the CDC activity is
determined using an in vitro cytotoxicity assay. In a specific
embodiment, an anti-ICOS antibody of the invention mediates at
least about 5%, at least about 10%, at least about 20%, at least
about 30%, at least about 40%, at least about 50%, at least about
75%, at least about 100% higher maximum cytotoxicity in an in vitro
CDC assay than the parental anti-ICOS antibody.
[0061] In one embodiment, an anti-ICOS antibody of the invention
mediates complement-dependent cytotoxicity (CDC) more efficiently
than the JMab-136 anti-ICOS antibody wherein the CDC activity is
determined using an in vitro cytotoxicity assay. In a specific
embodiment, an anti-ICOS antibody of the invention mediates at
least about 5%, at least about 10%, at least about 20%, at least
about 30%, at least about 40%, at least about 50%, at least about
75%, at least about 100% higher maximum cytotoxicity in an in vitro
CDC assay than the JMab-136 anti-ICOS antibody.
[0062] In one embodiment, the EC50 of an anti-ICOS antibody of the
invention in an in vitro CDC assay is at least about 2.times., at
least about 5.times., at least about 10.times., at least about
20.times., at least about 50.times., or at least about 100.times.
lower than that of the parental anti-ICOS antibody. In another
embodiment, the EC50 of an anti-ICOS antibody of the invention in
an in vitro CDC assay is at least about 2.times., at least about
5.times., at least about 10.times., at least about 20.times., at
least about 50.times., or at least about 100.times. lower than that
of the JMab-136 anti-ICOS antibody.
[0063] In one embodiment, an anti-ICOS antibody of the invention
mediates antibody-dependent phagocytosis more efficiently than the
parental anti-ICOS antibody wherein the antibody-dependent
phagocytosis activity is determined using an in vitro cytotoxicity
assay. In a specific embodiment, an anti-ICOS antibody of the
invention mediates at least about 5%, at least about 10%, at least
about 20%, at least about 30%, at least about 40%, at least about
50%, at least about 75%, at least about 100% higher maximum
cytotoxicity in an in vitro antibody-dependent phagocytosis assay
than the parental anti-ICOS antibody.
[0064] In one embodiment, an anti-ICOS antibody of the invention
mediates antibody-dependent phagocytosis more efficiently than the
JMab-136 anti-ICOS antibody wherein the antibody-dependent
phagocytosis activity is determined using an in vitro cytotoxicity
assay. In a specific embodiment, an anti-ICOS antibody of the
invention mediates at least about 5%, at least about 10%, at least
about 20%, at least about 30%, at least about 40%, at least about
50%, at least about 75%, at least about 100% higher maximum
cytotoxicity in an in vitro antibody-dependent phagocytosis assay
than the JMab-136 anti-ICOS antibody.
[0065] In one embodiment, the EC50 of an anti-ICOS antibody of the
invention in an in vitro antibody-dependent phagocytosis assay is
at least about 2.times., at least about 5.times., at least about
10.times., at least about 20.times., at least about 50.times., or
at least about 100.times. lower than that of the parental anti-ICOS
antibody. In another embodiment, the EC50 of an anti-ICOS antibody
of the invention in an in vitro antibody-dependent phagocytosis
assay is at least about 2.times., at least about 5.times., at least
about 10.times., at least about 20.times., at least about
50.times., or at least about 100.times. lower than that of the
JMab-136 anti-ICOS antibody.
[0066] In one embodiment, an anti-ICOS antibody of the invention
comprises a variant Fc region. In another embodiment, an anti-ICOS
antibody of the invention comprises a variant Fc region that has an
altered affinity for an Fc ligand protein. In a further embodiment,
an anti-ICOS antibody of the invention comprises a variant Fc
region that has an altered affinity for an Fc ligand selected from
the group consisting of: Fc.gamma.RIA, Fc.gamma.RIIA,
Fc.gamma.RIIB, Fc.gamma.RIIIA, Fc.gamma.RIIIB, Fc.gamma.RIV, and
C1q. In a specific embodiment, an anti-ICOS antibody of the
invention comprises a variant Fc region that has an altered
affinity for the Fc.gamma.RIIIA protein. In a further embodiment,
an anti-ICOS antibody of the invention comprises a variant Fc
region that has an altered affinity for the C1q protein. In a
specific embodiment, an Fc ligand protein may be a mouse, human or
primate (e.g., cynomolgus) Fc ligand protein.
[0067] In one embodiment, an anti-ICOS antibody of the invention
comprises a variant Fc region that has an increased affinity for an
Fc ligand protein. In a further embodiment, an anti-ICOS antibody
of the invention comprises a variant Fc region that has an
increased affinity for an Fc ligand selected from the group
consisting of: Fc.gamma.RIA, Fc.gamma.RIIA, Fc.gamma.RIIB,
Fc.gamma.RIIIA, Fc.gamma.RIIIB, Fc.gamma.RIV, and C1q. In a
specific embodiment, an anti-ICOS antibody of the invention
comprises a variant Fc region that has an increased affinity for
the Fc.gamma.RIIIA protein. In a further embodiment, an anti-ICOS
antibody of the invention comprises a variant Fc region that has an
increased affinity for the C1q protein. In a specific embodiment,
an Fc ligand protein may be a mouse, human or primate (e.g.,
cynomolgus) Fc ligand protein.
[0068] In one embodiment, an anti-ICOS antibody of the invention
comprises a variant Fc region wherein said variant Fc region
comprises at least one amino acid substitution, insertion or
deletion. In another embodiment, an anti-ICOS antibody of the
invention comprises a variant Fc region comprising at least one
amino acid substitution, insertion or deletion wherein said at
least one amino acid residue substitution, insertion or deletion
results in an increased affinity for an Fc ligand selected from the
group consisting of: Fc.gamma.RIA, Fc.gamma.RIIA, Fc.gamma.RIIB,
Fc.gamma.RIIIA, Fc.gamma.RIIIB, Fc.gamma.RIV, and C1q. In a
specific embodiment, an anti-ICOS antibody of the invention
comprises a variant Fc region comprising at least one amino acid
substitution, insertion or deletion wherein said at least one amino
acid residue substitution, insertion or deletion results in an
increased affinity for the Fc.gamma.RIIIA protein. In a further
embodiment, an anti-ICOS antibody of the invention comprises a
variant Fc region comprising at least one amino acid substitution,
insertion or deletion wherein said at least one amino acid residue
substitution, insertion or deletion results in an increased
affinity for the C1q protein. In a specific embodiment, an Fc
ligand protein may be a mouse, human or primate (e.g., cynomolgus)
Fc ligand protein.
[0069] In one embodiment, an anti-ICOS antibody of the invention
comprises a variant Fc region comprising at least one amino acid
substitution, insertion or deletion wherein said at least one amino
acid residue is selected from the group consisting of: residue 239,
330, and 332, wherein amino acid residues are numbered following
the EU index. In another embodiment, an anti-ICOS antibody of the
invention comprises a variant Fc region comprising at least one
amino acid substitution, insertion or deletion wherein said at
least one substituted, inserted or deleted amino acid residue is
selected from the group consisting of: residue 239, 330, and 332,
wherein amino acid residues are numbered following the EU index. In
a further embodiment, an anti-ICOS antibody described herein
comprises a variant Fc region comprising at least one amino acid
substitution wherein said at least one substituted amino acid
residue is selected from the group consisting of: residue 239, 330,
and 332, wherein amino acid residues are numbered following the EU
index. In another embodiment, an anti-ICOS antibody described
herein comprises a variant Fc region comprising at least one amino
acid substitution wherein said at least one amino acid substitution
is selected from the group consisting of: S239D, A330L, A330Y, and
1332E, wherein amino acid residues are numbered following the EU
index. In a specific embodiment, an anti-ICOS antibody of the
invention comprises a variant Fc region comprising the S239D,
A330L, and I332E amino acid substitutions, wherein amino acid
residues are numbered following the EU index.
[0070] In one embodiment, an anti-ICOS antibody of the invention
comprises a variant Fc region comprising at least one of the amino
acid residues selected from the group consisting of: D at residue
239, E at residue 239, L at residue 330, Y at residue 330, E at
residue 332, and D at residue 332, wherein amino acid residues are
numbered following the EU index. In a specific embodiment, an
anti-ICOS antibody of the invention comprises a variant Fc region
comprising D at residue 239, L at residue 330, and E at residue
332, wherein amino acid residues are numbered following the EU
index.
[0071] In one embodiment, an anti-ICOS antibody of the invention
comprises an engineered Fc region wherein the engineered Fc region
comprises a posttranslational modification that is different from
that of the parental anti-ICOS antibody. In a specific embodiment,
an anti-ICOS antibody of the invention comprises an engineered Fc
region wherein said engineered Fc region comprises complex
N-glycoside-linked sugar chains in which fucose is not bound to
N-acetylglucosamine in the reducing end in the sugar chain.
[0072] In one embodiment, an anti-ICOS antibody of the invention
comprises an engineered Fc region that has an altered affinity for
an Fc ligand protein. In a further embodiment, an anti-ICOS
antibody of the invention comprises an engineered Fc region that
has an altered affinity for an Fc ligand selected from the group
consisting of: Fc.gamma.RIA, Fc.gamma.RIIA, Fc.gamma.RIIB,
Fc.gamma.RIIIA, Fc.gamma.RIIIB, Fc.gamma.RIV, and C1q. In a
specific embodiment, an anti-ICOS antibody of the invention
comprises an engineered Fc region that has an altered affinity for
the Fc.gamma.RIIIA protein. In a further embodiment, an anti-ICOS
antibody of the invention comprises an engineered Fc region that
has an altered affinity for the C1q protein.
[0073] In one embodiment, an anti-ICOS antibody of the invention
comprises an engineered Fc region that has an increased affinity
for an Fc ligand protein. In a further embodiment, an anti-ICOS
antibody of the invention comprises an engineered Fc region that
has an increased affinity for an Fc ligand selected from the group
consisting of: Fc.gamma.RIA, Fc.gamma.RIIA, Fc.gamma.RIIB,
Fc.gamma.RIIIA, Fc.gamma.RIIIB, Fc.gamma.RIV, and C1q. In a
specific embodiment, an anti-ICOS antibody of the invention
comprises an engineered Fc region that has an increased affinity
for the Fc.gamma.RIIIA protein. In a further embodiment, an
anti-ICOS antibody of the invention comprises an engineered Fc
region that has an increased affinity for the C1q protein.
[0074] In one embodiment, an anti-ICOS antibody of the invention
comprises an engineered Fc region wherein said engineered Fc region
comprises a reduced level of fucose compared to a native antibody.
In another embodiment, an anti-ICOS antibody of the invention
comprises an engineered Fc region comprising a reduced level of
fucose, wherein said reduction in fucose level results in an
increased affinity for an Fc ligand selected from the group
consisting of: Fc.gamma.RIA, Fc.gamma.RIIA, Fc.gamma.RIIB,
Fc.gamma.RIIIA, Fc.gamma.RIIIB, Fc.gamma.RIV, and C1q. In a
specific embodiment, an anti-ICOS antibody of the invention
comprises an engineered Fc region comprising a reduced level of
fucose, wherein said reduction in fucose level results in an
increased affinity for the Fc.gamma.RIIIA protein. In a further
embodiment, an anti-ICOS antibody of the invention comprises an
engineered Fc region comprising a reduced level of fucose, wherein
said reduction in fucose level results in an increased affinity for
the C1q protein.
[0075] Anti-ICOS antibodies described herein comprise Fc regions
having a high binding affinity for the human Fc.gamma.RIIIA
protein. In one embodiment, an anti-ICOS antibody of the invention
comprises an Fc region that has an affinity constant or K.sub.a
(k.sub.on/k.sub.off) of at least 10.sup.3 M.sup.-1, at least
5.times.10.sup.3 M.sup.-1, at least 10.sup.4 M.sup.-1, at least
5.times.10.sup.4 M.sup.-1, at least 10.sup.5 M.sup.-1, at least
5.times.10.sup.5 M.sup.-1, at least 10.sup.6 M.sup.-1, at least
5.times.10.sup.6 M.sup.-1, at least 10.sup.7 M.sup.-1, at least
5.times.10.sup.7 M.sup.-1, at least 10.sup.8 M.sup.-1, at least
5.times.10.sup.3 M.sup.-1, at least 10.sup.9 M.sup.-1, at least
5.times.10.sup.9 M.sup.-1, at least 10.sup.10 M.sup.-1, at least
5.times.10.sup.10 M.sup.-1, at least 10.sup.11 M.sup.-1, at least
5.times.10.sup.11 M.sup.-1, at least 10.sup.12 M.sup.-1, or at
least 5.times.10.sup.12 M.sup.-1. In another embodiment, an
anti-ICOS antibody of the invention comprises an Fc region that has
a dissociation constant or K.sub.d (k.sub.off/k.sub.on) of less
than 5.times.10.sup.-3 M, less than 10.sup.-3 M, less than
5.times.10.sup.-4 M, less than 10.sup.-4 M, less than
5.times.10.sup.-5 M, less than 10.sup.-5 M, less than
5.times.10.sup.-6 M, less than 10.sup.-6 M, less than
5.times.10.sup.-7 M, less than 10.sup.-7 M, less than
5.times.10.sup.-8 M, less than 10.sup.-8 M, less than
5.times.10.sup.-9 M, less than 10.sup.-9 M, less than
5.times.10.sup.-10 M, less than 10.sup.-10 M, less than
5.times.10.sup.11 M.sup.-1, less than 10.sup.-11 M, less than
5.times.10.sup.-12 M, or less than 10.sup.-12 M.
[0076] An antibody used in accordance with a method described
herein may comprise an Fc region that binds to human Fc.gamma.RIIIA
with a dissociation constant (K.sub.d) of less than 3000 nM, less
than 2500 nM, less than 2000 nM, less than 1500 nM, less than 1000
nM, less than 750 nM, less than 500 nM, less than 250 nM, less than
200 nM, less than 150 nM, less than 100 nM, less than 75 nM, less
than 50 nM, less than 25 nM, less than 10 nM, less than 5 nM, less
than 1 nM as assessed using a method described herein or known to
one of skill in the art (e.g., a BIAcore assay, ELISA) (Biacore
International AB, Uppsala, Sweden). In a specific embodiment, an
antibody used in accordance with a method described herein may
comprise an Fc region that binds to human Fc.gamma.RIIIA with a
dissociation constant (K.sub.d) of between 1 to 3000 nM, 1 to 3000
nM, 1 to 2000 nM, 1 to 1500 nM, 1 to 1000 nM, 1 to 750 nM, 1 to 500
nM, 1 to 250 nM, 1 to 100 nM, 1 to 50 nM, 1 to 25 nM, 1 to 10 nM as
assessed using a method described herein or known to one of skill
in the art (e.g., a BIAcore assay, ELISA). In another embodiment,
an anti-ICOS antibody used in accordance with a method described
herein may comprise an Fc region that binds to human Fc.gamma.RIIIA
with a dissociation constant (K.sub.d) of 500 nM, 250 nM, 100 nM,
75 nM, 50 nM, 25 nM, 10 nM or 1 nM as assessed using a method
described herein or known to one of skill in the art (e.g., a
BIAcore assay, ELISA).
[0077] Anti-ICOS antibodies described herein comprise Fc regions
having a high binding affinity for the non-human primate (e.g.,
cynomolgus) Fc.gamma.RIIIA protein. In one embodiment, an anti-ICOS
antibody of the invention comprises an Fc region that has an
affinity constant or K.sub.a (k.sub.on/k.sub.off) of at least
10.sup.3 M.sup.-1, at least 5.times.10.sup.3 M.sup.-1, at least
10.sup.4 M.sup.-1, at least 5.times.10.sup.4 M.sup.-1, at least
10.sup.5 M.sup.-1, at least 5.times.10.sup.5 M.sup.-1, at least
10.sup.6 M.sup.-1, at least 5.times.10.sup.6 M.sup.-1, at least
10.sup.7 M.sup.-1, at least 5.times.10.sup.7M.sup.-1, at least
10.sup.3 M.sup.-1, at least 5.times.10.sup.3 M.sup.-1, at least
10.sup.9 M.sup.-1, at least 5.times.10.sup.9 M.sup.-1, at least
1010 M.sup.-1, at least 5.times.10.sup.10 M.sup.-1, at least
10.sup.11 M.sup.-1, at least 5.times.10.sup.11 M.sup.-1, at least
10.sup.12 M.sup.-1, or at least 5.times.10.sup.12 M.sup.-1. In
another embodiment, an anti-ICOS antibody of the invention
comprises an Fc region that has a dissociation constant or K.sub.d
(k.sub.off/k.sub.on) of less than 5.times.10.sup.-3 M, less than
10.sup.-3 M, less than 5.times.10.sup.-4 M, less than 10.sup.-4 M,
less than 5.times.10.sup.-5 M, less than 10.sup.-5 M, less than
5.times.10.sup.-6 M, less than 10.sup.-6 M, less than
5.times.10.sup.-7 M, less than 10.sup.-7 M, less than
5.times.10.sup.-8 M, less than 10.sup.-8 M, less than
5.times.10.sup.-9 M, less than 10.sup.-9 M, less than
5.times.10.sup.-10 M, less than 10.sup.-10 M, less than
5.times.10.sup.-11 M, less than 10.sup.-11 M, less than
5.times.10.sup.-12 M, or less than 10.sup.-12 M.
[0078] An antibody used in accordance with a method described
herein may comprise an Fc region that binds to non-human primate
(e.g., cynomolgus) Fc.gamma.RIIIA with a dissociation constant
(K.sub.d) of less than 3000 nM, less than 2500 nM, less than 2000
nM, less than 1500 nM, less than 1000 nM, less than 750 nM, less
than 500 nM, less than 250 nM, less than 200 nM, less than 150 nM,
less than 100 nM, less than 75 nM, less than 50 nM, less than 25
nM, less than 10 nM, less than 5 nM, less than 1 nM as assessed
using a method described herein or known to one of skill in the art
(e.g., a BIAcore assay, ELISA) (Biacore International AB, Uppsala,
Sweden). In a specific embodiment, an antibody used in accordance
with a method described herein may comprise an Fc region that binds
to non-human primate (e.g., cynomolgus) Fc.gamma.RIIIA with a
dissociation constant (K.sub.d) of between 1 to 3000 nM, 1 to 3000
nM, 1 to 2000 nM, 1 to 1500 nM, 1 to 1000 nM, 1 to 750 nM, 1 to 500
nM, 1 to 250 nM, 1 to 100 nM, 1 to 50 nM, 1 to 25 nM, 1 to 10 nM as
assessed using a method described herein or known to one of skill
in the art (e.g., a BIAcore assay, ELISA). In another embodiment,
an anti-ICOS antibody used in accordance with a method described
herein may comprise an Fc region that binds to non-human primate
(e.g., cynomolgus) Fc.gamma.RIIIA with a dissociation constant
(K.sub.d) of 500 nM, 250 nM, 100 nM, 75 nM, 50 nM, 25 nM, 10 nM or
1 nM as assessed using a method described herein or known to one of
skill in the art (e.g., a BIAcore assay, ELISA).
[0079] Anti-ICOS antibodies described herein comprise Fc regions
having a high binding affinity for the mouse Fc.gamma.RIIIA
protein. In one embodiment, an anti-ICOS antibody of the invention
comprises an Fc region that has an affinity constant or K.sub.a
(k.sub.on/k.sub.off) of at least 10.sup.3 M.sup.-1, at least
5.times.10.sup.3 M.sup.-1, at least 10.sup.4 M.sup.-1, at least
5.times.10.sup.4 M.sup.-1, at least 10.sup.5 M.sup.-1, at least
5.times.10.sup.5 M.sup.-1, at least 10.sup.6 M.sup.-1, at least
5.times.10.sup.6 M.sup.-1, at least 10.sup.7 M.sup.-1, at least
5.times.10.sup.7 M.sup.-1, at least 10.sup.8 M.sup.-1, at least
5.times.10.sup.3 M.sup.-1, at least 10.sup.9 M.sup.-1, at least
5.times.10.sup.9 M.sup.-1, at least 10.sup.10 M.sup.-1, at least
5.times.10.sup.10 M.sup.-1, at least 10.sup.11 M.sup.-1, at least
5.times.10.sup.11 M.sup.-1, at least 10.sup.-11 M.sup.-1, or at
least 5.times.10.sup.12 M.sup.-1. In another embodiment, an
anti-ICOS antibody of the invention comprises an Fc region that has
a dissociation constant or K.sub.d (k.sub.off/k.sub.on) of less
than 5.times.10.sup.-3 M, less than 10.sup.-3 M, less than
5.times.10.sup.-4 M, less than 10.sup.-4 M, less than
5.times.10.sup.-5 M, less than 10.sup.-5 M, less than
5.times.10.sup.-6 M, less than 10.sup.-6 M, less than
5.times.10.sup.-7 M, less than 10.sup.-7 M, less than
5.times.10.sup.-8 M, less than 10.sup.-8 M, less than
5.times.10.sup.-9 M, less than 10.sup.-9 M, less than
5.times.10.sup.-10 M, less than 10.sup.-10 M, less than
5.times.10.sup.11 M, less than 10.sup.-11 M, less than
5.times.10.sup.-12 M, or less than 10.sup.-12 M.
[0080] An antibody used in accordance with a method described
herein may comprise an Fc region that binds to mouse Fc.gamma.RIIIA
with a dissociation constant (K.sub.d) of less than 3000 nM, less
than 2500 nM, less than 2000 nM, less than 1500 nM, less than 1000
nM, less than 750 nM, less than 500 nM, less than 250 nM, less than
200 nM, less than 150 nM, less than 100 nM, less than 75 nM, less
than 50 nM, less than 25 nM, less than 10 nM, less than 5 nM, less
than 1 nM as assessed using a method described herein or known to
one of skill in the art (e.g., a BIAcore assay, ELISA) (Biacore
International AB, Uppsala, Sweden). In a specific embodiment, an
antibody used in accordance with a method described herein may
comprise an Fc region that binds to mouse Fc.gamma.RIIIA with a
dissociation constant (K.sub.d) of between 1 to 3000 nM, 1 to 3000
nM, 1 to 2000 nM, 1 to 1500 nM, 1 to 1000 nM, 1 to 750 nM, 1 to 500
nM, 1 to 250 nM, 1 to 100 nM, 1 to 50 nM, 1 to 25 nM, 1 to 10 nM as
assessed using a method described herein or known to one of skill
in the art (e.g., a BIAcore assay, ELISA). In another embodiment,
an anti-ICOS antibody used in accordance with a method described
herein may comprise an Fc region that binds to mouse Fc.gamma.RIIIA
with a dissociation constant (K.sub.d) of 500 nM, 250 nM, 100 nM,
75 nM, 50 nM, 25 nM, 10 nM or 1 nM as assessed using a method
described herein or known to one of skill in the art (e.g., a
BIAcore assay, ELISA).
[0081] In one embodiment, anti-ICOS antibodies of the invention
comprise one, two, three, four, five, or all six of the CDRs of
JMAb-136 (see, U.S. Pat. No. 6,803,039).
[0082] The amino acid sequences for CDR1, CDR2, and CDR3 of the
heavy chain variable region of JMAb-136 defined according to Kabat
are identified as SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:10,
respectively. The amino acid sequences for CDR1, CDR2 and CDR3 of
the light chain variable region of JMAb-136 defined according to
Kabat are identified as SEQ ID NO:3, SEQ ID NO:4, and SEQ ID NO:5,
respectively.
[0083] Kabat numbering is based on the seminal work of Kabat et al.
(1991) Sequences of Proteins of Immunological Interest, Publication
No. 91-3242, published as a three volume set by the National
Institutes of Health, National Technical Information Service
(hereinafter "Kabat"). Kabat provides multiple sequence alignments
of immunoglobulin chains from numerous species antibody isotypes.
The aligned sequences are numbered according to a single numbering
system, the Kabat numbering system. The Kabat sequences have been
updated since the 1991 publication and are available as an
electronic sequence database (latest downloadable version 1997).
Any immunoglobulin sequence can be numbered according to Kabat by
performing an alignment with the Kabat reference sequence.
Accordingly, the Kabat numbering system provides a uniform system
for numbering immunoglobulin chains. Unless indicated otherwise,
all immunoglobulin amino acid sequences described herein are
numbered according to the Kabat numbering system. Similarly, all
single amino acid positions referred to herein are numbered
according to the Kabat numbering system. In certain embodiments, an
anti-ICOS antibody described herein may comprise a heavy chain
variable region, VH, comprising at least one CDR having the amino
acid sequence selected from the group consisting of SEQ ID NO:8,
SEQ ID NO:9, and SEQ ID NO: 10. In certain embodiments, an
anti-ICOS antibody of the invention may comprise a VH domain having
the amino acid sequence of SEQ ID NO:7.
[0084] In certain embodiments, an anti-ICOS antibody described
herein may comprise a light chain variable region, VK, comprising
at least one CDR having an amino acid sequence selected from the
group consisting of SEQ ID NO:3, SEQ ID NO:4, and SEQ ID NO:5. In
certain embodiments, an anti-ICOS antibody of the invention may
comprise a VK domain having the amino acid sequence of SEQ ID
NO:2.
[0085] In one embodiment, an anti-ICOS antibody of the invention
comprises a VK domain having the amino acid sequence of SEQ ID NO:2
and further comprises a VH domain having the amino acid sequence of
SEQ ID NO:7.
[0086] The present invention encompasses antibodies that bind to
human ICOS, comprising derivatives of the VH domain, VH CDR1, VH
CDR2, VH CDR3, VK domain, VK CDR1, VK CDR2, or VK CDR3 described
herein that may bind to human ICOS. Standard techniques known to
those of skill in the art can be used to introduce mutations (e.g.,
additions, deletions, and/or substitutions) in the nucleotide
sequence encoding an antibody, including, for example,
site-directed mutagenesis and PCR-mediated mutagenesis that are
routinely used to generate amino acid substitutions. In one
embodiment, the VH and/or VK CDR derivatives may include less than
25 amino acid substitutions, less than 20 amino acid substitutions,
less than 15 amino acid substitutions, less than 10 amino acid
substitutions, less than 5 amino acid substitutions, less than 4
amino acid substitutions, less than 3 amino acid substitutions,
less than 2 amino acid substitutions, or 1 amino acid substitution
relative to the original VH and/or VK CDRs of the JMab-136
anti-ICOS antibody. In another embodiment, the VH and/or VK CDR
derivatives may have conservative amino acid substitutions (e.g.
supra) made at one or more predicted non-essential amino acid
residues (i.e., amino acid residues which are not critical for the
antibody to specifically bind to human ICOS). Mutations can also be
introduced randomly along all or part of the VH and/or VK CDR
coding sequences, such as by saturation mutagenesis, and the
resultant mutants can be screened for biological activity to
identify mutants that retain activity. Following mutagenesis, the
encoded antibody can be expressed and the activity of the antibody
can be determined.
[0087] The present invention further encompasses antibodies that
bind to human ICOS, said antibodies or antibody fragments
comprising one or more CDRs wherein said CDRs comprise an amino
acid sequence that is at least 45%, at least 50%, at least 55%, at
least 60%, at least 65%, at least 70%, at least 75%, at least 80%,
at least 85%, at least 90%, at least 95%, or at least 99% identical
to the amino acid sequence of one or more CDRs of the JMab-136
anti-ICOS antibody. The percent identity of two amino acid
sequences can be determined by any method known to one skilled in
the art, including, but not limited to, BLAST protein searches.
[0088] The present invention further encompasses antibodies that
bind to human ICOS, said antibodies or antibody fragments
comprising a VH and/or a VK domain wherein said VH and/or VK
domains comprise an amino acid sequence that is at least 45%, at
least 50%, at least 55%, at least 60%, at least 65%, at least 70%,
at least 75%, at least 80%, at least 85%, at least 90%, at least
95%, or at least 99% identical to the amino acid sequence of the VH
and VK domain of the JMab-136 anti-ICOS antibody. The percent
identity of two amino acid sequences can be determined by any
method known to one skilled in the art, including, but not limited
to, BLAST protein searches.
[0089] In one embodiment, an anti-ICOS antibody of the invention
may bind to human ICOS with an affinity comparable to that of the
JMab-136 anti-ICOS antibody.
[0090] In one embodiment, an anti-ICOS antibody of the invention
specifically binds the same epitope of ICOS as the JMab-136
anti-ICOS antibody.
[0091] In one embodiment, an anti-ICOS antibody specifically
competes the JMab-136 anti-ICOS antibody for ICOS binding. The
competition assay may be performed using any binding assay known in
the art, for example, but not limited to ELISA assay,
radioimmunoassay, flow cytometry.
[0092] The invention further provides polynucleotides comprising a
nucleotide sequence encoding an anti-ICOS antibody with enhanced
effector function. The invention also encompasses polynucleotides
that hybridize under stringent or lower stringency hybridization
conditions, as defined herein, to polynucleotides that encode an
anti-ICOS antibody with enhanced effector function.
[0093] In one embodiment, a polynucleotide of the invention
encoding an effector function enhanced anti-ICOS antibody described
herein comprises an optimized polynucleotide sequence. In a
specific embodiment, a polynucleotide of the invention encoding the
VH domain of an antibody described herein comprises the nucleotide
sequence of SEQ ID NO: 28. In a specific embodiment, a
polynucleotide of the invention encoding the VK domain of an
antibody described herein comprises the nucleotide sequence of SEQ
ID NO: 29. In a specific embodiment, a polynucleotide of the
invention encoding the heavy chain of an antibody described herein
comprises the nucleotide sequence of SEQ ID NO: 30. In a specific
embodiment, a polynucleotide of the invention encoding the light
chain of an antibody described herein comprises the nucleotide
sequence of SEQ ID NO: 31.
[0094] Another embodiment of the invention is a vector comprising
one or more nucleotide sequences encoding an anti-ICOS antibody
with enhanced effector function.
[0095] In one embodiment, a vector of the invention comprises one
or more nucleotide sequences encoding an anti-ICOS antibody with
enhanced effector function wherein the nucleotide sequence is an
optimized nucleotide sequence. In a specific embodiment, a vector
of the invention comprises the nucleotide sequence of SEQ ID NO:
28. In a specific embodiment, a vector of the invention comprises
the nucleotide sequence of SEQ ID NO: 29. In a specific embodiment,
a vector of the invention comprises the nucleotide sequence of SEQ
ID NO: 30. In a specific embodiment, a vector of the invention
comprises the nucleotide sequence of SEQ ID NO: 31. In a further
specific embodiment, a vector of the invention comprises one or
more nucleotide sequences encoding an anti-ICOS antibody with
enhanced effector function wherein the nucleotide sequence is
selected from the group comprising SEQ ID NO:28-31. In a further
specific embodiment, a vector of the invention comprises one or
more nucleotide sequences encoding an anti-ICOS antibody with
enhanced effector function wherein the nucleotide sequence is
selected from the group consisting of SEQ ID NO:28-31.
[0096] The present invention further relates to an isolated cell
comprising a vector wherein said vector comprises one or more
nucleotide sequences encoding an anti-ICOS antibody with enhanced
effector function. In a specific embodiment, an isolated cell of
the invention comprises a polynucleotide comprising the nucleotide
sequence selected from the group comprising SEQ ID NO:28-31. In a
further specific embodiment, an isolated cell of the invention
comprises a polynucleotide comprising the nucleotide sequence
selected from the group consisting of SEQ ID NO:28-31.
[0097] Anti-ICOS antibodies of the invention include those of the
IgG1, IgG2, IgG3, or IgG4 human isotype.
[0098] The present invention further relates to pharmaceutical
compositions comprising an anti-ICOS antibody with enhanced
effector function.
[0099] In still another other aspect, the present invention is
directed toward methods of treating and preventing T cell-mediated
diseases and disorders, such as, but not limited to, chronic
infection, autoimmune disease or disorder, inflammatory disease or
disorder, graft-versus-host disease (GVHD), transplant rejection,
and T cell proliferative disorder, comprising administering to a
human in need thereof a therapeutically-effective amount of a an
anti-ICOS antibody with enhanced effector function.
[0100] The present invention relates to anti-ICOS antibodies with
enhanced effector function, as well as to compositions comprising
those antibodies. In certain embodiments, an anti-ICOS antibody of
the invention may mediate
antigen-dependent-cell-mediated-cytotoxicity (ADCC). In other
embodiments, the present invention is directed toward compositions
comprising an anti-ICOS antibody of the IgG1 and/or IgG3 human
isotype, as well as to an anti-ICOS antibody of the IgG2 and/or
IgG4 human isotype, that may mediate human ADCC, CDC, and/or
antibody-dependent phagocytosis.
[0101] Anti-ICOS antibodies described herein may have a high
binding affinity for the human ICOS antigen. For example, an
antibody described herein may have an association rate constant or
k.sub.on rate (antibody (Ab)+antigen (Ag).sup.k-on.fwdarw.Ab-Ag) of
at least 2.times.10.sup.5 M.sup.-1s.sup.-1, at least
5.times.10.sup.5 M.sup.-1s.sup.-1, at least 10.sup.6
M.sup.-1s.sup.-1, at least 5.times.10.sup.6 M.sup.-1s.sup.-1, at
least 10.sup.7 M.sup.-1s.sup.-1, at least 5.times.10.sup.7
M.sup.-1s.sup.-1, or at least 10.sup.3 M.sup.-1s.sup.-1.
[0102] In another embodiment, an anti-ICOS antibody may have a
k.sub.off rate ((Ab-Ag).sup.k-off.fwdarw.antibody (Ab)+antigen
(Ag)) of less than 5.times.10.sup.-1s.sup.-1, less than 10.sup.-1
s.sup.-1, less than 5.times.10.sup.-2 s.sup.-1, less than 10.sup.-2
s.sup.-1, less than 5.times.10.sup.-3 s.sup.-1, less than 10.sup.-3
s.sup.-1, less than 5.times.10.sup.-4 s.sup.-1, or less than
10.sup.-4 s.sup.-1. In a another embodiment, an antibody of the
invention has a k.sub.off of less than 5.times.10.sup.-5 s.sup.-1,
less than 10.sup.-5 s.sup.-1, less than 5.times.10.sup.-6 s.sup.-1,
less than 10.sup.-6 s.sup.-1, less than 5.times.10.sup.-7 s.sup.-1,
less than 10.sup.-7 s.sup.-1, less than 5.times.10.sup.-8 s.sup.-1,
less than 10.sup.-8 s.sup.-1, less than 5.times.10.sup.-9 s.sup.-1,
less than 10.sup.-9 s.sup.-1, or less than 10.sup.-10 s.sup.-1.
[0103] In another embodiment, an anti-ICOS antibody may have an
affinity constant or K.sub.a (k.sub.on/k.sub.off) of at least
10.sup.2 M.sup.-1, at least 5.times.10.sup.2 M.sup.-1, at least
10.sup.3 M.sup.-1, at least 5.times.10.sup.3 M.sup.-1, at least
10.sup.4 M.sup.-1, at least 5.times.10.sup.4 M.sup.-1, at least
10.sup.5 M.sup.-1, at least 5.times.10.sup.5 M.sup.-1, at least
10.sup.6 M.sup.-1, at least 5.times.10.sup.6 M.sup.-1, at least
10.sup.7 M.sup.-1, at least 5.times.10.sup.7 M.sup.-1, at least
10.sup.8 M.sup.-1, at least 5.times.10.sup.8 M.sup.-1, at least
10.sup.9 M.sup.-1, at least 5.times.10.sup.9 M.sup.-1, at least
1010 M.sup.-1, at least 5.times.10.sup.10 M.sup.-1, at least
10.sup.11 M.sup.-1, at least 5.times.10.sup.11 M.sup.-1, at least
10.sup.12 M.sup.-1, at least 5.times.10.sup.12 M.sup.-1, at least
10.sup.13 M.sup.-1, at least 5.times.10.sup.13 M.sup.-1, at least
10.sup.14 M.sup.-1, at least 5.times.10.sup.14 M.sup.-1, at least
1015 M.sup.-1, or at least 5.times.10.sup.15 M.sup.-1. In yet
another embodiment, an anti-ICOS antibody may have a dissociation
constant or K.sub.d (k.sub.off/k.sub.on) of less than
5.times.10.sup.-2 M, less than 10.sup.-2 M, less than
5.times.10.sup.-3 M, less than 10.sup.-3 M, less than
5.times.10.sup.-4 M, less than 10.sup.-4 M, less than
5.times.10.sup.-5 M, less than 10.sup.-5 M, less than
5.times.10.sup.-6 M, less than 10.sup.-6 M, less than
5.times.10.sup.-7 M, less than 10.sup.-7 M, less than
5.times.10.sup.-8 M, less than 10.sup.-8 M, less than
5.times.10.sup.-9 M, less than 10.sup.-9 M, less than
5.times.10.sup.-10 M, less than 10.sup.-10 M, less than
5.times.10.sup.11 M, less than 10.sup.-11 M, less than
5.times.10.sup.-12 M, less than 10.sup.-12 M, less than
5.times.10.sup.-13 M, less than 10.sup.-13 M, less than
5.times.10.sup.-14 M, less than 10.sup.-14 M, less than
5.times.10.sup.-15 M, or less than 10.sup.-15 M.
[0104] An antibody used in accordance with a method described
herein may immunospecifically bind to ICOS and may have a
dissociation constant (K.sub.d) of less than 3000 pM, less than
2500 pM, less than 2000 pM, less than 1500 pM, less than 1000 pM,
less than 750 pM, less than 500 pM, less than 250 pM, less than 200
pM, less than 150 pM, less than 100 pM, less than 75 pM as assessed
using a method described herein or known to one of skill in the art
(e.g., a BIAcore assay, ELISA) (Biacore International AB, Uppsala,
Sweden). In a specific embodiment, an antibody used in accordance
with a method described herein may immunospecifically bind to a
human ICOS antigen and may have a dissociation constant (K.sub.d)
of between 25 to 3400 pM, 25 to 3000 pM, 25 to 2500 pM, 25 to 2000
pM, 25 to 1500 pM, 25 to 1000 pM, 25 to 750 pM, 25 to 500 pM, 25 to
250 pM, 25 to 100 pM, 25 to 75 pM, 25 to 50 pM as assessed using a
method described herein or known to one of skill in the art (e.g.,
a BIAcore assay, ELISA). In another embodiment, an anti-ICOS
antibody used in accordance with a method described herein may
immunospecifically bind to ICOS and may have a dissociation
constant (K.sub.d) of 500 pM, 100 pM, 75 pM or 50 pM as assessed
using a method described herein or known to one of skill in the art
(e.g., a BIAcore assay, ELISA).
[0105] The invention further provides polynucleotides comprising a
nucleotide sequence encoding an anti-ICOS antibody with enhanced
effector function. The invention also encompasses polynucleotides
that hybridize under stringent or lower stringency hybridization
conditions, e.g., as defined herein, to polynucleotides that encode
an anti-ICOS antibody with enhanced effector function.
[0106] Stringent hybridization conditions include, but are not
limited to, hybridization to filter-bound DNA in 6.times. sodium
chloride/sodium citrate (SSC) at about 45.degree. C. followed by
one or more washes in 0.2.times.SSC/0.1% SDS at about 50-65.degree.
C., highly stringent conditions such as hybridization to
filter-bound DNA in 6.times.SSC at about 45.degree. C. followed by
one or more washes in 0.1.times.SSC/0.2% SDS at about 60.degree.
C., or any other stringent hybridization conditions known to those
skilled in the art (see, for example, Ausubel, F. M. et al., eds.
1989 Current Protocols in Molecular Biology, vol. 1, Green
Publishing Associates, Inc. and John Wiley and Sons, Inc., NY at
pages 6.3.1 to 6.3.6 and 2.10.3).
[0107] The polynucleotides may be obtained, and the nucleotide
sequence of the polynucleotides determined, by any method known in
the art. For example, if the nucleotide sequence of the antibody is
known, a polynucleotide encoding the antibody may be assembled from
chemically synthesized oligonucleotides (e.g., as described in
Kutmeier et al., BioTechniques 17:242 (1994)), which, briefly,
involves the synthesis of overlapping oligonucleotides containing
portions of the sequence encoding the antibody, annealing and
ligating of those oligonucleotides, and then amplification of the
ligated oligonucleotides by PCR.
[0108] A polynucleotide encoding an antibody may also be generated
from nucleic acid from a suitable source. If a clone containing a
nucleic acid encoding a particular antibody is not available, but
the sequence of the antibody molecule is known, a nucleic acid
encoding the immunoglobulin may be chemically synthesized or
obtained from a suitable source (e.g., an antibody cDNA library, or
a cDNA library generated from, or nucleic acid, preferably
polyA+RNA, isolated from, any tissue or cells expressing the
antibody, such as hybridoma cells selected to express an antibody)
by PCR amplification using synthetic primers hybridizable to the 3'
and 5' ends of the sequence or by cloning using an oligonucleotide
probe specific for the particular gene sequence to identify, e.g.,
a cDNA clone from a cDNA library that encodes the antibody.
Amplified nucleic acids generated by PCR may then be cloned into
replicable cloning vectors using any method well known in the
art.
[0109] The present invention further provides for antibodies that
efficiently deplete ICOS expressing cells in a mouse xenograft
model system. In one embodiment, administration of one or more
therapeutic doses of an anti-ICOS antibody of the invention may
achieve at least about 20%, at least about 30%, at least about 40%,
at least about 50%, at least about 60%, at least about 70%, at
least about 80%, at least about 90%, at least about 95%, at least
about 97%, at least about 99%, or at least about 100% depletion of
ICOS expressing cells in a mouse xenograft model system.
[0110] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention depletes ICOS
expressing cells in a mouse xenograft model more efficiently than
that of the parental anti-ICOS antibody (e.g., an antibody
comprising the same variable domain amino acid sequence, but having
1) a fucosylated Fc domain or 2) an Fc domain amino acid sequence,
which has not been modified to increase ADCC). In another
embodiment, administration of one or more therapeutic doses of an
anti-ICOS antibody of the invention depletes ICOS expressing cells
in a mouse xenograft model more efficiently than that of the
fucosylated JMab-136 anti-ICOS antibody.
[0111] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 2-fold, at least about 3-fold, at least about 5-fold, or at
least about 10-fold higher depletion of ICOS expressing cells in a
mouse xenograft model than that of the parental anti-ICOS antibody
(e.g., an antibody comprising the same variable domain amino acid
sequence, but having 1) a fucosylated Fc domain or 2) an Fc domain
amino acid sequence, which has not been modified to increase ADCC).
In one embodiment, administration of one or more therapeutic doses
of an anti-ICOS antibody of the invention achieves at least about
2-fold, at least about 3-fold, at least about 5-fold, or at least
about 10-fold higher depletion of ICOS expressing cells in a mouse
xenograft model than that of the fucosylated JMab-136 anti-ICOS
antibody.
[0112] In one embodiment, the EC50 value of an anti-ICOS antibody
of the invention for the depletion of ICOS expressing cells in a
mouse xenograft model is at least about 2.times., at least about
5.times., at least about 10.times., at least about 20.times., at
least about 50.times., or at least about 100.times. lower than that
of the parental anti-ICOS antibody (e.g., an antibody comprising
the same variable domain amino acid sequence, but having 1) a
fucosylated Fc domain or 2) an Fc domain amino acid sequence, which
has not been modified to increase ADCC). In another embodiment, the
EC50 value of an anti-ICOS antibody of the invention for the
depletion of ICOS expressing cells in a mouse xenograft model is at
least about 2.times., at least about 5.times., at least about
10.times., at least about 20.times., at least about 50.times., or
at least about 100.times. lower than that of the parental anti-ICOS
antibody (e.g., an antibody comprising the same variable domain
amino acid sequence, but having 1) a fucosylated Fc domain or 2) an
Fc domain amino acid sequence, which has not been modified to
increase ADCC).
[0113] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 5%, at least about 10%, at least about 20%, at least about
30%, at least about 40%, at least about 50%, at least about 75%, at
least about 100% higher depletion of ICOS expressing cells in a
mouse xenograft model than that of the parental anti-ICOS antibody
(e.g., an antibody comprising the same variable domain amino acid
sequence, but having 1) a fucosylated Fc domain or 2) an Fc domain
amino acid sequence, which has not been modified to increase ADCC).
In another embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 5%, at least about 10%, at least about 20%, at least about
30%, at least about 40%, at least about 50%, at least about 75%, at
least about 100% higher depletion of ICOS expressing cells in a
mouse xenograft model than that of the fucosylated JMab-136
anti-ICOS antibody.
[0114] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 2.times., at least about 5.times., at least about 10.times.,
at least about 15.times., at least about 20.times., at least about
25.times., at least about 50.times., or at least about 100.times.
higher depletion of ICOS expressing cells in a mouse xenograft
model than that of the parental anti-ICOS antibody (e.g., an
antibody comprising the same variable domain amino acid sequence,
but having 1) a fucosylated Fc domain or 2) an Fc domain amino acid
sequence, which has not been modified to increase ADCC). In another
embodiment, administration of one or more therapeutic doses of an
anti-ICOS antibody of the invention achieves at least about
2.times., at least about 5.times., at least about 10.times., at
least about 15.times., at least about 20.times., at least about
25.times., at least about 50.times., or at least about 100.times.
higher depletion of ICOS expressing cells in a mouse xenograft
model than that of the fucosylated JMab-136 anti-ICOS antibody.
[0115] The present invention further provides for antibodies that
efficiently deplete ICOS expressing cells in a transgenic mouse
model system. In one embodiment, administration of one or more
therapeutic doses of an anti-ICOS antibody of the invention may
achieve at least about 20%, at least about 30%, at least about 40%,
at least about 50%, at least about 60%, at least about 70%, at
least about 80%, at least about 90%, at least about 95%, at least
about 97%, at least about 99%, or at least about 100% depletion of
ICOS expressing cells in a transgenic mouse model system.
[0116] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention depletes ICOS
expressing cells in a transgenic mouse model more efficiently than
that of the parental anti-ICOS antibody (e.g., an antibody
comprising the same variable domain amino acid sequence, but having
1) a fucosylated Fc domain or 2) an Fc domain amino acid sequence,
which has not been modified to increase ADCC). In another
embodiment, administration of one or more therapeutic doses of an
anti-ICOS antibody of the invention depletes ICOS expressing cells
in a transgenic mouse model more efficiently than that of the
fucosylated JMab-136 anti-ICOS antibody.
[0117] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 2-fold, at least about 3-fold, at least about 5-fold, or at
least about 10-fold higher depletion of ICOS expressing cells in a
transgenic mouse model than that of the parental anti-ICOS antibody
(e.g., an antibody comprising the same variable domain amino acid
sequence, but having 1) a fucosylated Fc domain or 2) an Fc domain
amino acid sequence, which has not been modified to increase ADCC).
In one embodiment, administration of one or more therapeutic doses
of an anti-ICOS antibody of the invention achieves at least about
2-fold, at least about 3-fold, at least about 5-fold, or at least
about 10-fold higher depletion of ICOS expressing cells in a
transgenic mouse model than that of the fucosylated JMab-136
anti-ICOS antibody.
[0118] In one embodiment, the EC50 value of an anti-ICOS antibody
of the invention for the depletion of ICOS expressing cells in a
transgenic mouse model is at least about 2.times., at least about
5.times., at least about 10.times., at least about 20.times., at
least about 50.times., or at least about 100.times. lower than that
of the parental anti-ICOS antibody (e.g., an antibody comprising
the same variable domain amino acid sequence, but having 1) a
fucosylated Fc domain or 2) an Fc domain amino acid sequence, which
has not been modified to increase ADCC). In another embodiment, the
EC50 value of an anti-ICOS antibody of the invention for the
depletion of ICOS expressing cells in a transgenic mouse model is
at least about 2.times., at least about 5.times., at least about
10.times., at least about 20.times., at least about 50.times., or
at least about 100.times. lower than that of the parental anti-ICOS
antibody (e.g., an antibody comprising the same variable domain
amino acid sequence, but having 1) a fucosylated Fc domain or 2) an
Fc domain amino acid sequence, which has not been modified to
increase ADCC).
[0119] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 5%, at least about 10%, at least about 20%, at least about
30%, at least about 40%, at least about 50%, at least about 75%, at
least about 100% higher depletion of ICOS expressing cells in a
transgenic mouse model than that of the parental anti-ICOS antibody
(e.g., an antibody comprising the same variable domain amino acid
sequence, but having 1) a fucosylated Fc domain or 2) an Fc domain
amino acid sequence, which has not been modified to increase ADCC).
In another embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 5%, at least about 10%, at least about 20%, at least about
30%, at least about 40%, at least about 50%, at least about 75%, at
least about 100% higher depletion of ICOS expressing cells in a
transgenic mouse model than that of the fucosylated JMab-136
anti-ICOS antibody.
[0120] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 2.times., at least about 5.times., at least about 10.times.,
at least about 15.times., at least about 20.times., at least about
25.times., at least about 50.times., or at least about 100.times.
higher depletion of ICOS expressing cells in a transgenic mouse
model than that of the parental anti-ICOS antibody (e.g., an
antibody comprising the same variable domain amino acid sequence,
but having 1) a fucosylated Fc domain or 2) an Fc domain amino acid
sequence, which has not been modified to increase ADCC). In another
embodiment, administration of one or more therapeutic doses of an
anti-ICOS antibody of the invention achieves at least about
2.times., at least about 5.times., at least about 10.times., at
least about 15.times., at least about 20.times., at least about
25.times., at least about 50.times., or at least about 100.times.
higher depletion of ICOS expressing cells in a transgenic mouse
model than that of the fucosylated JMab-136 anti-ICOS antibody.
[0121] The present invention also provides for antibodies that
efficiently deplete ICOS expressing cells in a primate (non-human
primate or human). In one embodiment, administration of one or more
therapeutic doses of an anti-ICOS antibody of the invention may
achieve at least about 20%, at least about 30%, at least about 40%,
at least about 50%, at least about 60%, at least about 70%, at
least about 80%, at least about 90%, at least about 95%, at least
about 97%, at least about 99%, or at least about 100% depletion of
ICOS expressing cells in a primate (non-human primate or
human).
[0122] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention depletes ICOS
expressing cells in a primate (non-human primate or human) more
efficiently than that of the parental anti-ICOS antibody (e.g., an
antibody comprising the same variable domain amino acid sequence,
but having 1) a fucosylated Fc domain or 2) an Fc domain amino acid
sequence, which has not been modified to increase ADCC). In another
embodiment, administration of one or more therapeutic doses of an
anti-ICOS antibody of the invention depletes ICOS expressing cells
in a primate (non-human primate or human) more efficiently than
that of the fucosylated JMab-136 anti-ICOS antibody.
[0123] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 2-fold, at least about 3-fold, at least about 5-fold, or at
least about 10-fold higher depletion of ICOS expressing cells in a
primate (non-human primate or human) than that of the parental
anti-ICOS antibody (e.g., an antibody comprising the same variable
domain amino acid sequence, but having 1) a fucosylated Fc domain
or 2) an Fc domain amino acid sequence, which has not been modified
to increase ADCC). In one embodiment, administration of one or more
therapeutic doses of an anti-ICOS antibody of the invention
achieves at least about 2-fold, at least about 3-fold, at least
about 5-fold, or at least about 10-fold higher depletion of ICOS
expressing cells in a primate (non-human primate or human) than
that of the fucosylated JMab-136 anti-ICOS antibody.
[0124] In one embodiment, the EC50 value of an anti-ICOS antibody
of the invention for the depletion of ICOS expressing cells in a
primate (non-human primate or human) is at least about 2.times., at
least about 5.times., at least about 10.times., at least about
20.times., at least about 50.times., or at least about 100.times.
lower than that of the parental anti-ICOS antibody (e.g., an
antibody comprising the same variable domain amino acid sequence,
but having 1) a fucosylated Fc domain or 2) an Fc domain amino acid
sequence, which has not been modified to increase ADCC). In another
embodiment, the EC50 value of an anti-ICOS antibody of the
invention for the depletion of ICOS expressing cells in a primate
(non-human primate or human) is at least about 2.times., at least
about 5.times., at least about 10.times., at least about 20.times.,
at least about 50.times., or at least about 100.times. lower than
that of the parental anti-ICOS antibody (e.g., an antibody
comprising the same variable domain amino acid sequence, but having
1) a fucosylated Fc domain or 2) an Fc domain amino acid sequence,
which has not been modified to increase ADCC).
[0125] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 5%, at least about 10%, at least about 20%, at least about
30%, at least about 40%, at least about 50%, at least about 75%, at
least about 100% higher depletion of ICOS expressing cells in a
primate (non-human primate or human) than that of the parental
anti-ICOS antibody (e.g., an antibody comprising the same variable
domain amino acid sequence, but having 1) a fucosylated Fc domain
or 2) an Fc domain amino acid sequence, which has not been modified
to increase ADCC). In another embodiment, administration of one or
more therapeutic doses of an anti-ICOS antibody of the invention
achieves at least about 5%, at least about 10%, at least about 20%,
at least about 30%, at least about 40%, at least about 50%, at
least about 75%, at least about 100% higher depletion of ICOS
expressing cells in a primate (non-human primate or human) than
that of the fucosylated JMab-136 anti-ICOS antibody.
[0126] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 2.times., at least about 5.times., at least about 10.times.,
at least about 15.times., at least about 20.times., at least about
25.times., at least about 50.times., or at least about 100.times.
higher depletion of ICOS expressing cells in a primate (non-human
primate or human) than that of the parental anti-ICOS antibody
(e.g., an antibody comprising the same variable domain amino acid
sequence, but having 1) a fucosylated Fc domain or 2) an Fc domain
amino acid sequence, which has not been modified to increase ADCC).
In another embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 2.times., at least about 5.times., at least about 10.times.,
at least about 15.times., at least about 20.times., at least about
25.times., at least about 50.times., or at least about 100.times.
higher depletion of ICOS expressing cells in a primate (non-human
primate or human) than that of the fucosylated JMab-136 anti-ICOS
antibody.
[0127] The present invention also provides for antibodies that
efficiently deplete ICOS expressing T cells in a primate (non-human
primate or human). In one embodiment, administration of one or more
therapeutic doses of an anti-ICOS antibody of the invention may
achieve at least about 20%, at least about 30%, at least about 40%,
at least about 50%, at least about 60%, at least about 70%, at
least about 80%, at least about 90%, at least about 95%, at least
about 97%, at least about 99%, or at least about 100% depletion of
ICOS expressing T cells in a primate (non-human primate or
human).
[0128] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention depletes ICOS
expressing T cells in a primate (non-human primate or human) more
efficiently than that of the parental anti-ICOS antibody (e.g., an
antibody comprising the same variable domain amino acid sequence,
but having 1) a fucosylated Fc domain or 2) an Fc domain amino acid
sequence, which has not been modified to increase ADCC). In another
embodiment, administration of one or more therapeutic doses of an
anti-ICOS antibody of the invention depletes ICOS expressing T
cells in a primate (non-human primate or human) more efficiently
than that of the fucosylated JMab-136 anti-ICOS antibody.
[0129] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 2-fold, at least about 3-fold, at least about 5-fold, or at
least about 10-fold higher depletion of ICOS expressing T cells in
a primate (non-human primate or human) than that of the parental
anti-ICOS antibody (e.g., an antibody comprising the same variable
domain amino acid sequence, but having 1) a fucosylated Fc domain
or 2) an Fc domain amino acid sequence, which has not been modified
to increase ADCC). In one embodiment, administration of one or more
therapeutic doses of an anti-ICOS antibody of the invention
achieves at least about 2-fold, at least about 3-fold, at least
about 5-fold, or at least about 10-fold higher depletion of ICOS
expressing T cells in a primate (non-human primate or human) than
that of the fucosylated JMab-136 anti-ICOS antibody.
[0130] In one embodiment, the EC50 value of an anti-ICOS antibody
of the invention for the depletion of ICOS expressing T cells in a
primate (non-human primate or human) is at least about 2.times., at
least about 5.times., at least about 10.times., at least about
20.times., at least about 50.times., or at least about 100.times.
lower than that of the parental anti-ICOS antibody (e.g., an
antibody comprising the same variable domain amino acid sequence,
but having 1) a fucosylated Fc domain or 2) an Fc domain amino acid
sequence, which has not been modified to increase ADCC). In another
embodiment, the EC50 value of an anti-ICOS antibody of the
invention for the depletion of ICOS expressing T cells in a primate
(non-human primate or human) is at least about 2.times., at least
about 5.times., at least about 10.times., at least about 20.times.,
at least about 50.times., or at least about 100.times. lower than
that of the parental anti-ICOS antibody (e.g., an antibody
comprising the same variable domain amino acid sequence, but having
1) a fucosylated Fc domain or 2) an Fc domain amino acid sequence,
which has not been modified to increase ADCC).
[0131] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 5%, at least about 10%, at least about 20%, at least about
30%, at least about 40%, at least about 50%, at least about 75%, at
least about 100% higher depletion of ICOS expressing T cells in a
primate (non-human primate or human) than that of the parental
anti-ICOS antibody (e.g., an antibody comprising the same variable
domain amino acid sequence, but having 1) a fucosylated Fc domain
or 2) an Fc domain amino acid sequence, which has not been modified
to increase ADCC). In another embodiment, administration of one or
more therapeutic doses of an anti-ICOS antibody of the invention
achieves at least about 5%, at least about 10%, at least about 20%,
at least about 30%, at least about 40%, at least about 50%, at
least about 75%, at least about 100% higher depletion of ICOS
expressing T cells in a primate (non-human primate or human) than
that of the fucosylated JMab-136 anti-ICOS antibody.
[0132] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 2.times., at least about 5.times., at least about 10.times.,
at least about 15.times., at least about 20.times., at least about
25.times., at least about 50.times., or at least about 100.times.
higher depletion of ICOS expressing T cells in a primate (non-human
primate or human) than that of the parental anti-ICOS antibody
(e.g., an antibody comprising the same variable domain amino acid
sequence, but having 1) a fucosylated Fc domain or 2) an Fc domain
amino acid sequence, which has not been modified to increase ADCC).
In another embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 2.times., at least about 5.times., at least about 10.times.,
at least about 15.times., at least about 20.times., at least about
25.times., at least about 50.times., or at least about 100.times.
higher depletion of ICOS expressing T cells in a primate (non-human
primate or human) than that of the fucosylated JMab-136 anti-ICOS
antibody.
[0133] The present invention also provides for antibodies that
efficiently deplete ICOS expressing T helper cells in a primate
(non-human primate or human). In one embodiment, administration of
one or more therapeutic doses of an anti-ICOS antibody of the
invention may achieve at least about 20%, at least about 30%, at
least about 40%, at least about 50%, at least about 60%, at least
about 70%, at least about 80%, at least about 90%, at least about
95%, at least about 97%, at least about 99%, or at least about 100%
depletion of ICOS expressing T helper cells in a primate (non-human
primate or human).
[0134] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention depletes ICOS
expressing T helper cells in a primate (non-human primate or human)
more efficiently than that of the parental anti-ICOS antibody
(e.g., an antibody comprising the same variable domain amino acid
sequence, but having 1) a fucosylated Fc domain or 2) an Fc domain
amino acid sequence, which has not been modified to increase ADCC).
In another embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention depletes ICOS
expressing T helper cells in a primate (non-human primate or human)
more efficiently than that of the fucosylated JMab-136 anti-ICOS
antibody.
[0135] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 2-fold, at least about 3-fold, at least about 5-fold, or at
least about 10-fold higher depletion of ICOS expressing T helper
cells in a primate (non-human primate or human) than that of the
parental anti-ICOS antibody (e.g., an antibody comprising the same
variable domain amino acid sequence, but having 1) a fucosylated Fc
domain or 2) an Fc domain amino acid sequence, which has not been
modified to increase ADCC). In one embodiment, administration of
one or more therapeutic doses of an anti-ICOS antibody of the
invention achieves at least about 2-fold, at least about 3-fold, at
least about 5-fold, or at least about 10-fold higher depletion of
ICOS expressing T helper cells in a primate (non-human primate or
human) than that of the fucosylated JMab-136 anti-ICOS
antibody.
[0136] In one embodiment, the EC50 value of an anti-ICOS antibody
of the invention for the depletion of ICOS expressing T helper
cells in a primate (non-human primate or human) is at least about
2.times., at least about 5.times., at least about 10.times., at
least about 20.times., at least about 50.times., or at least about
100.times. lower than that of the parental anti-ICOS antibody
(e.g., an antibody comprising the same variable domain amino acid
sequence, but having 1) a fucosylated Fc domain or 2) an Fc domain
amino acid sequence, which has not been modified to increase ADCC).
In another embodiment, the EC50 value of an anti-ICOS antibody of
the invention for the depletion of ICOS expressing T helper cells
in a primate (non-human primate or human) is at least about
2.times., at least about 5.times., at least about 10.times., at
least about 20.times., at least about 50.times., or at least about
100.times. lower than that of the parental anti-ICOS antibody
(e.g., an antibody comprising the same variable domain amino acid
sequence, but having 1) a fucosylated Fc domain or 2) an Fc domain
amino acid sequence, which has not been modified to increase
ADCC).
[0137] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 5%, at least about 10%, at least about 20%, at least about
30%, at least about 40%, at least about 50%, at least about 75%, at
least about 100% higher depletion of ICOS expressing T helper cells
in a primate (non-human primate or human) than that of the parental
anti-ICOS antibody (e.g., an antibody comprising the same variable
domain amino acid sequence, but having 1) a fucosylated Fc domain
or 2) an Fc domain amino acid sequence, which has not been modified
to increase ADCC). In another embodiment, administration of one or
more therapeutic doses of an anti-ICOS antibody of the invention
achieves at least about 5%, at least about 10%, at least about 20%,
at least about 30%, at least about 40%, at least about 50%, at
least about 75%, at least about 100% higher depletion of ICOS
expressing T helper cells in a primate (non-human primate or human)
than that of the fucosylated JMab-136 anti-ICOS antibody.
[0138] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 2.times., at least about 5.times., at least about 10.times.,
at least about 15.times., at least about 20.times., at least about
25.times., at least about 50.times., or at least about 100.times.
higher depletion of ICOS expressing T helper cells in a primate
(non-human primate or human) than that of the parental anti-ICOS
antibody (e.g., an antibody comprising the same variable domain
amino acid sequence, but having 1) a fucosylated Fc domain or 2) an
Fc domain amino acid sequence, which has not been modified to
increase ADCC). In another embodiment, administration of one or
more therapeutic doses of an anti-ICOS antibody of the invention
achieves at least about 2.times., at least about 5.times., at least
about 10.times., at least about 15.times., at least about
20.times., at least about 25.times., at least about 50.times., or
at least about 100.times. higher depletion of ICOS expressing T
helper cells in a primate (non-human primate or human) than that of
the fucosylated JMab-136 anti-ICOS antibody.
[0139] The present invention also provides for antibodies that
efficiently deplete ICOS expressing Th1 cells in a primate
(non-human primate or human). In one embodiment, administration of
one or more therapeutic doses of an anti-ICOS antibody of the
invention may achieve at least about 20%, at least about 30%, at
least about 40%, at least about 50%, at least about 60%, at least
about 70%, at least about 80%, at least about 90%, at least about
95%, at least about 97%, at least about 99%, or at least about 100%
depletion of ICOS expressing Th1 cells in a primate (non-human
primate or human).
[0140] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention depletes ICOS
expressing Th1 cells in a primate (non-human primate or human) more
efficiently than that of the parental anti-ICOS antibody (e.g., an
antibody comprising the same variable domain amino acid sequence,
but having 1) a fucosylated Fc domain or 2) an Fc domain amino acid
sequence, which has not been modified to increase ADCC). In another
embodiment, administration of one or more therapeutic doses of an
anti-ICOS antibody of the invention depletes ICOS expressing Th1
cells in a primate (non-human primate or human) more efficiently
than that of the fucosylated JMab-136 anti-ICOS antibody.
[0141] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 2-fold, at least about 3-fold, at least about 5-fold, or at
least about 10-fold higher depletion of ICOS expressing Th1 cells
in a primate (non-human primate or human) than that of the parental
anti-ICOS antibody (e.g., an antibody comprising the same variable
domain amino acid sequence, but having 1) a fucosylated Fc domain
or 2) an Fc domain amino acid sequence, which has not been modified
to increase ADCC). In one embodiment, administration of one or more
therapeutic doses of an anti-ICOS antibody of the invention
achieves at least about 2-fold, at least about 3-fold, at least
about 5-fold, or at least about 10-fold higher depletion of ICOS
expressing Th1 cells in a primate (non-human primate or human) than
that of the fucosylated JMab-136 anti-ICOS antibody.
[0142] In one embodiment, the EC50 value of an anti-ICOS antibody
of the invention for the depletion of ICOS expressing Th1 cells in
a primate (non-human primate or human) is at least about 2.times.,
at least about 5.times., at least about 10.times., at least about
20.times., at least about 50.times., or at least about 100.times.
lower than that of the parental anti-ICOS antibody (e.g., an
antibody comprising the same variable domain amino acid sequence,
but having 1) a fucosylated Fc domain or 2) an Fc domain amino acid
sequence, which has not been modified to increase ADCC). In another
embodiment, the EC50 value of an anti-ICOS antibody of the
invention for the depletion of ICOS expressing Th1 cells in a
primate (non-human primate or human) is at least about 2.times., at
least about 5.times., at least about 10.times., at least about
20.times., at least about 50.times., or at least about 100.times.
lower than that of the parental anti-ICOS antibody (e.g., an
antibody comprising the same variable domain amino acid sequence,
but having 1) a fucosylated Fc domain or 2) an Fc domain amino acid
sequence, which has not been modified to increase ADCC).
[0143] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 5%, at least about 10%, at least about 20%, at least about
30%, at least about 40%, at least about 50%, at least about 75%, at
least about 100% higher depletion of ICOS expressing Th1 cells in a
primate (non-human primate or human) than that of the parental
anti-ICOS antibody (e.g., an antibody comprising the same variable
domain amino acid sequence, but having 1) a fucosylated Fc domain
or 2) an Fc domain amino acid sequence, which has not been modified
to increase ADCC). In another embodiment, administration of one or
more therapeutic doses of an anti-ICOS antibody of the invention
achieves at least about 5%, at least about 10%, at least about 20%,
at least about 30%, at least about 40%, at least about 50%, at
least about 75%, at least about 100% higher depletion of ICOS
expressing Th1 cells in a primate (non-human primate or human) than
that of the fucosylated JMab-136 anti-ICOS antibody.
[0144] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 2.times., at least about 5.times., at least about 10.times.,
at least about 15.times., at least about 20.times., at least about
25.times., at least about 50.times., or at least about 100.times.
higher depletion of ICOS expressing Th1 cells in a primate
(non-human primate or human) than that of the parental anti-ICOS
antibody (e.g., an antibody comprising the same variable domain
amino acid sequence, but having 1) a fucosylated Fc domain or 2) an
Fc domain amino acid sequence, which has not been modified to
increase ADCC). In another embodiment, administration of one or
more therapeutic doses of an anti-ICOS antibody of the invention
achieves at least about 2.times., at least about 5.times., at least
about 10.times., at least about 15.times., at least about
20.times., at least about 25.times., at least about 50.times., or
at least about 100.times. higher depletion of ICOS expressing Th1
cells in a primate (non-human primate or human) than that of the
fucosylated JMab-136 anti-ICOS antibody.
[0145] The present invention also provides for antibodies that
efficiently deplete ICOS expressing Th2 cells in a primate
(non-human primate or human). In one embodiment, administration of
one or more therapeutic doses of an anti-ICOS antibody of the
invention may achieve at least about 20%, at least about 30%, at
least about 40%, at least about 50%, at least about 60%, at least
about 70%, at least about 80%, at least about 90%, at least about
95%, at least about 97%, at least about 99%, or at least about 100%
depletion of ICOS expressing Th2 cells in a primate (non-human
primate or human).
[0146] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention depletes ICOS
expressing Th2 cells in a primate (non-human primate or human) more
efficiently than that of the parental anti-ICOS antibody (e.g., an
antibody comprising the same variable domain amino acid sequence,
but having 1) a fucosylated Fc domain or 2) an Fc domain amino acid
sequence, which has not been modified to increase ADCC). In another
embodiment, administration of one or more therapeutic doses of an
anti-ICOS antibody of the invention depletes ICOS expressing Th2
cells in a primate (non-human primate or human) more efficiently
than that of the fucosylated JMab-136 anti-ICOS antibody.
[0147] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 2-fold, at least about 3-fold, at least about 5-fold, or at
least about 10-fold higher depletion of ICOS expressing Th2 cells
in a primate (non-human primate or human) than that of the parental
anti-ICOS antibody (e.g., an antibody comprising the same variable
domain amino acid sequence, but having 1) a fucosylated Fc domain
or 2) an Fc domain amino acid sequence, which has not been modified
to increase ADCC). In one embodiment, administration of one or more
therapeutic doses of an anti-ICOS antibody of the invention
achieves at least about 2-fold, at least about 3-fold, at least
about 5-fold, or at least about 10-fold higher depletion of ICOS
expressing Th2 cells in a primate (non-human primate or human) than
that of the fucosylated JMab-136 anti-ICOS antibody.
[0148] In one embodiment, the EC50 value of an anti-ICOS antibody
of the invention for the depletion of ICOS expressing Th2 cells in
a primate (non-human primate or human) is at least about 2.times.,
at least about 5.times., at least about 10.times., at least about
20.times., at least about 50.times., or at least about 100.times.
lower than that of the parental anti-ICOS antibody (e.g., an
antibody comprising the same variable domain amino acid sequence,
but having 1) a fucosylated Fc domain or 2) an Fc domain amino acid
sequence, which has not been modified to increase ADCC). In another
embodiment, the EC50 value of an anti-ICOS antibody of the
invention for the depletion of ICOS expressing Th2 cells in a
primate (non-human primate or human) is at least about 2.times., at
least about 5.times., at least about 10.times., at least about
20.times., at least about 50.times., or at least about 100.times.
lower than that of the parental anti-ICOS antibody (e.g., an
antibody comprising the same variable domain amino acid sequence,
but having 1) a fucosylated Fc domain or 2) an Fc domain amino acid
sequence, which has not been modified to increase ADCC).
[0149] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 5%, at least about 10%, at least about 20%, at least about
30%, at least about 40%, at least about 50%, at least about 75%, at
least about 100% higher depletion of ICOS expressing Th2 cells in a
primate (non-human primate or human) than that of the parental
anti-ICOS antibody (e.g., an antibody comprising the same variable
domain amino acid sequence, but having 1) a fucosylated Fc domain
or 2) an Fc domain amino acid sequence, which has not been modified
to increase ADCC). In another embodiment, administration of one or
more therapeutic doses of an anti-ICOS antibody of the invention
achieves at least about 5%, at least about 10%, at least about 20%,
at least about 30%, at least about 40%, at least about 50%, at
least about 75%, at least about 100% higher depletion of ICOS
expressing Th2 cells in a primate (non-human primate or human) than
that of the fucosylated JMab-136 anti-ICOS antibody.
[0150] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 2.times., at least about 5.times., at least about 10.times.,
at least about 15.times., at least about 20.times., at least about
25.times., at least about 50.times., or at least about 100.times.
higher depletion of ICOS expressing Th2 cells in a primate
(non-human primate or human) than that of the parental anti-ICOS
antibody (e.g., an antibody comprising the same variable domain
amino acid sequence, but having 1) a fucosylated Fc domain or 2) an
Fc domain amino acid sequence, which has not been modified to
increase ADCC). In another embodiment, administration of one or
more therapeutic doses of an anti-ICOS antibody of the invention
achieves at least about 2.times., at least about 5.times., at least
about 10.times., at least about 15.times., at least about
20.times., at least about 25.times., at least about 50.times., or
at least about 100.times. higher depletion of ICOS expressing Th2
cells in a primate (non-human primate or human) than that of the
fucosylated JMab-136 anti-ICOS antibody.
[0151] The present invention also provides for antibodies that
efficiently deplete ICOS expressing Th17 cells in a primate
(non-human primate or human). In one embodiment, administration of
one or more therapeutic doses of an anti-ICOS antibody of the
invention may achieve at least about 20%, at least about 30%, at
least about 40%, at least about 50%, at least about 60%, at least
about 70%, at least about 80%, at least about 90%, at least about
95%, at least about 97%, at least about 99%, or at least about 100%
depletion of ICOS expressing Th17 cells in a primate (non-human
primate or human).
[0152] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention depletes ICOS
expressing Th17 cells in a primate (non-human primate or human)
more efficiently than that of the parental anti-ICOS antibody
(e.g., an antibody comprising the same variable domain amino acid
sequence, but having 1) a fucosylated Fc domain or 2) an Fc domain
amino acid sequence, which has not been modified to increase ADCC).
In another embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention depletes ICOS
expressing Th17 cells in a primate (non-human primate or human)
more efficiently than that of the fucosylated JMab-136 anti-ICOS
antibody.
[0153] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 2-fold, at least about 3-fold, at least about 5-fold, or at
least about 10-fold higher depletion of ICOS expressing Th17 cells
in a primate (non-human primate or human) than that of the parental
anti-ICOS antibody (e.g., an antibody comprising the same variable
domain amino acid sequence, but having 1) a fucosylated Fc domain
or 2) an Fc domain amino acid sequence, which has not been modified
to increase ADCC). In one embodiment, administration of one or more
therapeutic doses of an anti-ICOS antibody of the invention
achieves at least about 2-fold, at least about 3-fold, at least
about 5-fold, or at least about 10-fold higher depletion of ICOS
expressing Th17 cells in a primate (non-human primate or human)
than that of the fucosylated JMab-136 anti-ICOS antibody.
[0154] In one embodiment, the EC50 value of an anti-ICOS antibody
of the invention for the depletion of ICOS expressing Th17 cells in
a primate (non-human primate or human) is at least about 2.times.,
at least about 5.times., at least about 10.times., at least about
20.times., at least about 50.times., or at least about 100.times.
lower than that of the parental anti-ICOS antibody (e.g., an
antibody comprising the same variable domain amino acid sequence,
but having 1) a fucosylated Fc domain or 2) an Fc domain amino acid
sequence, which has not been modified to increase ADCC). In another
embodiment, the EC50 value of an anti-ICOS antibody of the
invention for the depletion of ICOS expressing Th17 cells in a
primate (non-human primate or human) is at least about 2.times., at
least about 5.times., at least about 10.times., at least about
20.times., at least about 50.times., or at least about 100.times.
lower than that of the parental anti-ICOS antibody (e.g., an
antibody comprising the same variable domain amino acid sequence,
but having 1) a fucosylated Fc domain or 2) an Fc domain amino acid
sequence, which has not been modified to increase ADCC).
[0155] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 5%, at least about 10%, at least about 20%, at least about
30%, at least about 40%, at least about 50%, at least about 75%, at
least about 100% higher depletion of ICOS expressing Th17 cells in
a primate (non-human primate or human) than that of the parental
anti-ICOS antibody (e.g., an antibody comprising the same variable
domain amino acid sequence, but having 1) a fucosylated Fc domain
or 2) an Fc domain amino acid sequence, which has not been modified
to increase ADCC). In another embodiment, administration of one or
more therapeutic doses of an anti-ICOS antibody of the invention
achieves at least about 5%, at least about 10%, at least about 20%,
at least about 30%, at least about 40%, at least about 50%, at
least about 75%, at least about 100% higher depletion of ICOS
expressing Th17 cells in a primate (non-human primate or human)
than that of the fucosylated JMab-136 anti-ICOS antibody.
[0156] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 2.times., at least about 5.times., at least about 10.times.,
at least about 15.times., at least about 20.times., at least about
25.times., at least about 50.times., or at least about 100.times.
higher depletion of ICOS expressing Th17 cells in a primate
(non-human primate or human) than that of the parental anti-ICOS
antibody (e.g., an antibody comprising the same variable domain
amino acid sequence, but having 1) a fucosylated Fc domain or 2) an
Fc domain amino acid sequence, which has not been modified to
increase ADCC). In another embodiment, administration of one or
more therapeutic doses of an anti-ICOS antibody of the invention
achieves at least about 2.times., at least about 5.times., at least
about 10.times., at least about 15.times., at least about
20.times., at least about 25.times., at least about 50.times., or
at least about 100.times. higher depletion of ICOS expressing Th17
cells in a primate (non-human primate or human) than that of the
fucosylated JMab-136 anti-ICOS antibody.
[0157] The present invention also provides for antibodies that
efficiently deplete ICOS expressing memory helper T cells in a
primate (non-human primate or human). In one embodiment,
administration of one or more therapeutic doses of an anti-ICOS
antibody of the invention may achieve at least about 20%, at least
about 30%, at least about 40%, at least about 50%, at least about
60%, at least about 70%, at least about 80%, at least about 90%, at
least about 95%, at least about 97%, at least about 99%, or at
least about 100% depletion of ICOS expressing memory helper T cells
in a primate (non-human primate or human).
[0158] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention depletes ICOS
expressing memory helper T cells in a primate (non-human primate or
human) more efficiently than that of the parental anti-ICOS
antibody (e.g., an antibody comprising the same variable domain
amino acid sequence, but having 1) a fucosylated Fc domain or 2) an
Fc domain amino acid sequence, which has not been modified to
increase ADCC). In another embodiment, administration of one or
more therapeutic doses of an anti-ICOS antibody of the invention
depletes ICOS expressing memory helper T cells in a primate
(non-human primate or human) more efficiently than that of the
fucosylated JMab-136 anti-ICOS antibody.
[0159] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 2-fold, at least about 3-fold, at least about 5-fold, or at
least about 10-fold higher depletion of ICOS expressing memory
helper T cells in a primate (non-human primate or human) than that
of the parental anti-ICOS antibody (e.g., an antibody comprising
the same variable domain amino acid sequence, but having 1) a
fucosylated Fc domain or 2) an Fc domain amino acid sequence, which
has not been modified to increase ADCC). In one embodiment,
administration of one or more therapeutic doses of an anti-ICOS
antibody of the invention achieves at least about 2-fold, at least
about 3-fold, at least about 5-fold, or at least about 10-fold
higher depletion of ICOS expressing memory helper T cells in a
primate (non-human primate or human) than that of the fucosylated
JMab-136 anti-ICOS antibody.
[0160] In one embodiment, the EC50 value of an anti-ICOS antibody
of the invention for the depletion of ICOS expressing memory helper
T cells in a primate (non-human primate or human) is at least about
2.times., at least about 5.times., at least about 10.times., at
least about 20.times., at least about 50.times., or at least about
100.times. lower than that of the parental anti-ICOS antibody
(e.g., an antibody comprising the same variable domain amino acid
sequence, but having 1) a fucosylated Fc domain or 2) an Fc domain
amino acid sequence, which has not been modified to increase ADCC).
In another embodiment, the EC50 value of an anti-ICOS antibody of
the invention for the depletion of ICOS expressing memory helper T
cells in a primate (non-human primate or human) is at least about
2.times., at least about 5.times., at least about 10.times., at
least about 20.times., at least about 50.times., or at least about
100.times. lower than that of the parental anti-ICOS antibody
(e.g., an antibody comprising the same variable domain amino acid
sequence, but having 1) a fucosylated Fc domain or 2) an Fc domain
amino acid sequence, which has not been modified to increase
ADCC).
[0161] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 5%, at least about 10%, at least about 20%, at least about
30%, at least about 40%, at least about 50%, at least about 75%, at
least about 100% higher depletion of ICOS expressing memory helper
T cells in a primate (non-human primate or human) than that of the
parental anti-ICOS antibody (e.g., an antibody comprising the same
variable domain amino acid sequence, but having 1) a fucosylated Fc
domain or 2) an Fc domain amino acid sequence, which has not been
modified to increase ADCC). In another embodiment, administration
of one or more therapeutic doses of an anti-ICOS antibody of the
invention achieves at least about 5%, at least about 10%, at least
about 20%, at least about 30%, at least about 40%, at least about
50%, at least about 75%, at least about 100% higher depletion of
ICOS expressing memory helper T cells in a primate (non-human
primate or human) than that of the fucosylated JMab-136 anti-ICOS
antibody.
[0162] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 2.times., at least about 5.times., at least about 10.times.,
at least about 15.times., at least about 20.times., at least about
25.times., at least about 50.times., or at least about 100.times.
higher depletion of ICOS expressing memory helper T cells in a
primate (non-human primate or human) than that of the parental
anti-ICOS antibody (e.g., an antibody comprising the same variable
domain amino acid sequence, but having 1) a fucosylated Fc domain
or 2) an Fc domain amino acid sequence, which has not been modified
to increase ADCC). In another embodiment, administration of one or
more therapeutic doses of an anti-ICOS antibody of the invention
achieves at least about 2.times., at least about 5.times., at least
about 10.times., at least about 15.times., at least about
20.times., at least about 25.times., at least about 50.times., or
at least about 100.times. higher depletion of ICOS expressing
memory helper T cells in a primate (non-human primate or human)
than that of the fucosylated JMab-136 anti-ICOS antibody.
[0163] Depletion of a particular cell type may lead to the
depletion of a secreted product of said cell type. For example,
depletion of Th17 cells using an effector function enhanced
anti-ICOS antibody of the invention may lead to depletion of IL-17.
The present invention also provides for antibodies that efficiently
deplete IL-17 in a primate (non-human primate or human). In one
embodiment, administration of one or more therapeutic doses of an
anti-ICOS antibody of the invention may achieve at least about 20%,
at least about 30%, at least about 40%, at least about 50%, at
least about 60%, at least about 70%, at least about 80%, at least
about 90%, at least about 95%, at least about 97%, at least about
99%, or at least about 100% depletion of IL-17 in a primate
(non-human primate or human).
[0164] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention depletes IL-17 in a
primate (non-human primate or human) more efficiently than that of
the parental anti-ICOS antibody (e.g., an antibody comprising the
same variable domain amino acid sequence, but having 1) a
fucosylated Fc domain or 2) an Fc domain amino acid sequence, which
has not been modified to increase ADCC). In another embodiment,
administration of one or more therapeutic doses of an anti-ICOS
antibody of the invention depletes IL-17 in a primate (non-human
primate or human) more efficiently than that of the fucosylated
JMab-136 anti-ICOS antibody.
[0165] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 2-fold, at least about 3-fold, at least about 5-fold, or at
least about 10-fold higher depletion of IL-17 in a primate
(non-human primate or human) than that of the parental anti-ICOS
antibody (e.g., an antibody comprising the same variable domain
amino acid sequence, but having 1) a fucosylated Fc domain or 2) an
Fc domain amino acid sequence, which has not been modified to
increase ADCC). In one embodiment, administration of one or more
therapeutic doses of an anti-ICOS antibody of the invention
achieves at least about 2-fold, at least about 3-fold, at least
about 5-fold, or at least about 10-fold higher depletion of IL-17
in a primate (non-human primate or human) than that of the
fucosylated JMab-136 anti-ICOS antibody.
[0166] In one embodiment, the EC50 value of an anti-ICOS antibody
of the invention for the depletion of IL-17 in a primate (non-human
primate or human) is at least about 2.times., at least about
5.times., at least about 10.times., at least about 20.times., at
least about 50.times., or at least about 100.times. lower than that
of the parental anti-ICOS antibody (e.g., an antibody comprising
the same variable domain amino acid sequence, but having 1) a
fucosylated Fc domain or 2) an Fc domain amino acid sequence, which
has not been modified to increase ADCC). In another embodiment, the
EC50 value of an anti-ICOS antibody of the invention for the
depletion of IL-17 in a primate (non-human primate or human) is at
least about 2.times., at least about 5.times., at least about
10.times., at least about 20.times., at least about 50.times., or
at least about 100.times. lower than that of the parental anti-ICOS
antibody (e.g., an antibody comprising the same variable domain
amino acid sequence, but having 1) a fucosylated Fc domain or 2) an
Fc domain amino acid sequence, which has not been modified to
increase ADCC).
[0167] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 5%, at least about 10%, at least about 20%, at least about
30%, at least about 40%, at least about 50%, at least about 75%, at
least about 100% higher depletion of IL-17 in a primate (non-human
primate or human) than that of the parental anti-ICOS antibody
(e.g., an antibody comprising the same variable domain amino acid
sequence, but having 1) a fucosylated Fc domain or 2) an Fc domain
amino acid sequence, which has not been modified to increase ADCC).
In another embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 5%, at least about 10%, at least about 20%, at least about
30%, at least about 40%, at least about 50%, at least about 75%, at
least about 100% higher depletion of IL-17 in a primate (non-human
primate or human) than that of the fucosylated JMab-136 anti-ICOS
antibody.
[0168] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 2.times., at least about 5.times., at least about 10.times.,
at least about 15.times., at least about 20.times., at least about
25.times., at least about 50.times., or at least about 100.times.
higher depletion of IL-17 in a primate (non-human primate or human)
than that of the parental anti-ICOS antibody (e.g., an antibody
comprising the same variable domain amino acid sequence, but having
1) a fucosylated Fc domain or 2) an Fc domain amino acid sequence,
which has not been modified to increase ADCC). In another
embodiment, administration of one or more therapeutic doses of an
anti-ICOS antibody of the invention achieves at least about
2.times., at least about 5.times., at least about 10.times., at
least about 15.times., at least about 20.times., at least about
25.times., at least about 50.times., or at least about 100.times.
higher depletion of IL-17 in a primate (non-human primate or human)
than that of the fucosylated JMab-136 anti-ICOS antibody.
[0169] The present invention also provides for antibodies that
efficiently deplete IL-2 in a primate (non-human primate or human).
In one embodiment, administration of one or more therapeutic doses
of an anti-ICOS antibody of the invention may achieve at least
about 20%, at least about 30%, at least about 40%, at least about
50%, at least about 60%, at least about 70%, at least about 80%, at
least about 90%, at least about 95%, at least about 97%, at least
about 99%, or at least about 100% depletion of IL-2 in a primate
(non-human primate or human).
[0170] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention depletes IL-2 in a
primate (non-human primate or human) more efficiently than that of
the parental anti-ICOS antibody (e.g., an antibody comprising the
same variable domain amino acid sequence, but having 1) a
fucosylated Fc domain or 2) an Fc domain amino acid sequence, which
has not been modified to increase ADCC). In another embodiment,
administration of one or more therapeutic doses of an anti-ICOS
antibody of the invention depletes IL-2 in a primate (non-human
primate or human) more efficiently than that of the fucosylated
JMab-136 anti-ICOS antibody.
[0171] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 2-fold, at least about 3-fold, at least about 5-fold, or at
least about 10-fold higher depletion of IL-2 in a primate
(non-human primate or human) than that of the parental anti-ICOS
antibody (e.g., an antibody comprising the same variable domain
amino acid sequence, but having 1) a fucosylated Fc domain or 2) an
Fc domain amino acid sequence, which has not been modified to
increase ADCC). In one embodiment, administration of one or more
therapeutic doses of an anti-ICOS antibody of the invention
achieves at least about 2-fold, at least about 3-fold, at least
about 5-fold, or at least about 10-fold higher depletion of IL-2 in
a primate (non-human primate or human) than that of the fucosylated
JMab-136 anti-ICOS antibody.
[0172] In one embodiment, the EC50 value of an anti-ICOS antibody
of the invention for the depletion of IL-2 in a primate (non-human
primate or human) is at least about 2.times., at least about
5.times., at least about 10.times., at least about 20.times., at
least about 50.times., or at least about 100.times. lower than that
of the parental anti-ICOS antibody (e.g., an antibody comprising
the same variable domain amino acid sequence, but having 1) a
fucosylated Fc domain or 2) an Fc domain amino acid sequence, which
has not been modified to increase ADCC). In another embodiment, the
EC50 value of an anti-ICOS antibody of the invention for the
depletion of IL-2 in a primate (non-human primate or human) is at
least about 2.times., at least about 5.times., at least about
10.times., at least about 20.times., at least about 50.times., or
at least about 100.times. lower than that of the parental anti-ICOS
antibody (e.g., an antibody comprising the same variable domain
amino acid sequence, but having 1) a fucosylated Fc domain or 2) an
Fc domain amino acid sequence, which has not been modified to
increase ADCC).
[0173] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 5%, at least about 10%, at least about 20%, at least about
30%, at least about 40%, at least about 50%, at least about 75%, at
least about 100% higher depletion of IL-2 in a primate (non-human
primate or human) than that of the parental anti-ICOS antibody
(e.g., an antibody comprising the same variable domain amino acid
sequence, but having 1) a fucosylated Fc domain or 2) an Fc domain
amino acid sequence, which has not been modified to increase ADCC).
In another embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 5%, at least about 10%, at least about 20%, at least about
30%, at least about 40%, at least about 50%, at least about 75%, at
least about 100% higher depletion of IL-2 in a primate (non-human
primate or human) than that of the fucosylated JMab-136 anti-ICOS
antibody.
[0174] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 2.times., at least about 5.times., at least about 10.times.,
at least about 15.times., at least about 20.times., at least about
25.times., at least about 50.times., or at least about 100.times.
higher depletion of IL-2 in a primate (non-human primate or human)
than that of the parental anti-ICOS antibody (e.g., an antibody
comprising the same variable domain amino acid sequence, but having
1) a fucosylated Fc domain or 2) an Fc domain amino acid sequence,
which has not been modified to increase ADCC). In another
embodiment, administration of one or more therapeutic doses of an
anti-ICOS antibody of the invention achieves at least about
2.times., at least about 5.times., at least about 10.times., at
least about 15.times., at least about 20.times., at least about
25.times., at least about 50.times., or at least about 100.times.
higher depletion of IL-2 in a primate (non-human primate or human)
than that of the fucosylated JMab-136 anti-ICOS antibody.
[0175] ICOS expressing T cells have been implicated in germinal
center formation in mouse model systems. Data disclosed herein
demonstrates that ICOS expressing cells are also involved in
maintaining of the structural integrity and B cell compartment of
already formed germinal centers. Without being bound by a
particular model, the depletion of ICOS expressing T cells in a
primate (non-human primate or human) by administering one or more
therapeutic doses of an anti-ICOS antibody of the invention may
prevent the formation of germinal centers, may disrupt the
architecture of already formed germinal centers, may deplete
germinal center B cells from secondary lymphoid organs and/or may
deplete circulating class switched B cells. Germinal center
formation may be monitored by any method known in the art, for
example, but not limited to, histological examination of secondary
lymphoid organs or analysis of the lymphoid cells isolated from
secondary lymphoid tissues by flow cytometry. The disruption of
germinal center architecture may be monitored by any method known
in the art, for example, but not limited to, histological
examination of secondary lymphoid organs. Depletion of germinal
center B cells from secondary lymphoid organs may be monitored by
any method known in the art, for example, but not limited to,
histological examination of secondary lymphoid organs or analysis
of the lymphoid cells isolated from secondary lymphoid tissues by
flow cytometry. Depletion of circulating class switched B cells may
be monitored by any method known in the art, for example, but not
limited to, analysis of circulating lymphoid cells by flow
cytometry. Class switched B cells may be identified based on their
specific expression, or lack thereof, of cell surface markers, for
example, but not limited to, circulating class switched B cells may
be identified as CD27+IgM-IgD-B cells.
[0176] The present invention provides for antibodies that
efficiently prevent germinal center formation in a secondary
lymphoid organ of a primate (non-human primate or human).
[0177] In one embodiment, the secondary lymphoid organ is a lymph
node. In another embodiment, the secondary lymphoid organ is the
spleen. In a further embodiment, the secondary lymphoid organ is
the tonsil. In one embodiment, the secondary lymphoid organ is a
mesenteric lymph node.
[0178] In one embodiment, the administration of one or more
therapeutic doses of an anti-ICOS antibody of the invention
prevents germinal center formation in a secondary lymphoid organ of
a primate (non-human primate or human) for at least 1 day, at least
2 days at least 5 days, at least 1 week, at least 2 weeks, at least
3 weeks, at least 1 month, at least 2 months, at least 3 months, at
least 4 months, at least 5 months, at least 6 months, at least 9
months. In a specific embodiment, the secondary lymphoid organ is
the spleen. In another specific embodiment, the secondary lymphoid
organ is the tonsil.
[0179] In one embodiment, the administration of one or more
therapeutic doses of an anti-ICOS antibody of the invention
prevents germinal center formation in a secondary lymphoid organ of
a primate (non-human primate or human) for a longer time period
than that of the parental anti-ICOS antibody (e.g., an antibody
comprising the same variable domain amino acid sequence, but having
1) a fucosylated Fc domain or 2) an Fc domain amino acid sequence,
which has not been modified to increase ADCC). In another
embodiment, administration of one or more therapeutic doses of an
anti-ICOS antibody of the invention prevents germinal center
formation in a secondary lymphoid organ of a primate (non-human
primate or human) for a longer time period than that of the
fucosylated JMAb-136 anti-ICOS antibody. In a specific embodiment,
the secondary lymphoid organ is the spleen. In another specific
embodiment, the secondary lymphoid organ is the tonsil.
[0180] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention prevents germinal
center formation in a secondary lymphoid organ of a primate
(non-human primate or human) more efficiently than that of the
parental anti-ICOS antibody (e.g., an antibody comprising the same
variable domain amino acid sequence, but having 1) a fucosylated Fc
domain or 2) an Fc domain amino acid sequence, which has not been
modified to increase ADCC). In another embodiment, administration
of one or more therapeutic doses of an anti-ICOS antibody of the
invention prevents germinal center formation in a secondary
lymphoid organ of a primate (non-human primate or human) more
efficiently than that of the fucosylated JMAb-136 anti-ICOS
antibody.
[0181] The present invention also provides for antibodies that
efficiently disrupt germinal center architecture in a secondary
lymphoid organ of a primate (non-human primate or human). In one
embodiment, the secondary lymphoid organ is a lymph node. In
another embodiment, the secondary lymphoid organ is the spleen. In
a further embodiment, the secondary lymphoid organ is the tonsil.
In one embodiment, the secondary lymphoid organ is a mesenteric
lymph node.
[0182] In one embodiment, the administration of one or more
therapeutic doses of an anti-ICOS antibody of the invention
disrupts germinal center architecture in a secondary lymphoid organ
of a primate (non-human primate or human) for at least 1 day, at
least 2 days at least 5 days, at least 1 week, at least 2 weeks, at
least 3 weeks, at least 1 month, at least 2 months, at least 3
months, at least 4 months, at least 5 months, at least 6 months, at
least 9 months. In a specific embodiment, the secondary lymphoid
organ is the spleen. In another specific embodiment, the secondary
lymphoid organ is the tonsil.
[0183] In one embodiment, the administration of one or more
therapeutic doses of an anti-ICOS antibody of the invention
disrupts germinal center architecture in a secondary lymphoid organ
of a primate (non-human primate or human) for a longer time period
than that of the parental anti-ICOS antibody (e.g., an antibody
comprising the same variable domain amino acid sequence, but having
1) a fucosylated Fc domain or 2) an Fc domain amino acid sequence,
which has not been modified to increase ADCC). In another
embodiment, administration of one or more therapeutic doses of an
anti-ICOS antibody of the invention disrupts germinal center
architecture in a secondary lymphoid organ of a primate (non-human
primate or human) for a longer time period than that of the
fucosylated JMAb-136 anti-ICOS antibody. In a specific embodiment,
the secondary lymphoid organ is the spleen. In another specific
embodiment, the secondary lymphoid organ is the tonsil.
[0184] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention disrupts germinal
center architecture in a secondary lymphoid organ of a primate
(non-human primate or human) more efficiently than that of the
parental anti-ICOS antibody (e.g., an antibody comprising the same
variable domain amino acid sequence, but having 1) a fucosylated Fc
domain or 2) an Fc domain amino acid sequence, which has not been
modified to increase ADCC). In another embodiment, administration
of one or more therapeutic doses of an anti-ICOS antibody of the
invention disrupts germinal center architecture in a secondary
lymphoid organ of a primate (non-human primate or human) more
efficiently than that of the fucosylated JMAb-136 anti-ICOS
antibody.
[0185] The present invention also provides for antibodies that
efficiently deplete germinal center B cells from a secondary
lymphoid organ in a primate (non-human primate or human). In one
embodiment, the secondary lymphoid organ is a lymph node. In
another embodiment, the secondary lymphoid organ is the spleen. In
a further embodiment, the secondary lymphoid organ is the tonsil.
In one embodiment, the secondary lymphoid organ is a mesenteric
lymph node.
[0186] In one embodiment, the administration of one or more
therapeutic doses of an anti-ICOS antibody of the invention
depletes germinal center B cells from a secondary lymphoid organ in
a primate (non-human primate or human) for at least 1 day, at least
2 days at least 5 days, at least 1 week, at least 2 weeks, at least
3 weeks, at least 1 month, at least 2 months, at least 3 months, at
least 4 months, at least 5 months, at least 6 months, at least 9
months. In a specific embodiment, the secondary lymphoid organ is
the spleen. In another specific embodiment, the secondary lymphoid
organ is the tonsil. Depletion of germinal center B cells is
considered to "substantially persist" during the time period
following the administration of one or more doses of anti-ICOS
antibody when the number of germinal center B cells is at least 10%
lower in the antibody treated sample than the number of germinal
center B cells in the untreated control sample.
[0187] In one embodiment, the administration of one or more
therapeutic doses of an anti-ICOS antibody of the invention
depletes germinal center B cells from a secondary lymphoid organ in
a primate (non-human primate or human) for a longer time period
than that of the parental anti-ICOS antibody (e.g., an antibody
comprising the same variable domain amino acid sequence, but having
1) a fucosylated Fc domain or 2) an Fc domain amino acid sequence,
which has not been modified to increase ADCC). In another
embodiment, administration of one or more therapeutic doses of an
anti-ICOS antibody of the invention depletes germinal center B
cells from a secondary lymphoid organ in a primate (non-human
primate or human) for a longer time period than that of the
fucosylated JMAb-136 anti-ICOS antibody. In a specific embodiment,
the secondary lymphoid organ is the spleen. In another specific
embodiment, the secondary lymphoid organ is the tonsil.
[0188] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention may achieve at
least about 20%, at least about 30%, at least about 40%, at least
about 50%, at least about 60%, at least about 70%, at least about
80%, at least about 90%, at least about 95%, at least about 97%, at
least about 99%, or at least about 100% depletion of germinal
center B cells from a secondary lymphoid organ in a primate
(non-human primate or human).
[0189] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention depletes germinal
center B cells from a secondary lymphoid organ in a primate
(non-human primate or human) more efficiently than that of the
parental anti-ICOS antibody (e.g., an antibody comprising the same
variable domain amino acid sequence, but having 1) a fucosylated Fc
domain or 2) an Fc domain amino acid sequence, which has not been
modified to increase ADCC). In another embodiment, administration
of one or more therapeutic doses of an anti-ICOS antibody of the
invention depletes germinal center B cells from a secondary
lymphoid organ in a primate (non-human primate or human) more
efficiently than that of the fucosylated JMAb-136 anti-ICOS
antibody.
[0190] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 2-fold, at least about 3-fold, at least about 5-fold, or at
least about 10-fold higher depletion of germinal center B cells
from a secondary lymphoid organ in a primate (non-human primate or
human) than that of the parental anti-ICOS antibody (e.g., an
antibody comprising the same variable domain amino acid sequence,
but having 1) a fucosylated Fc domain or 2) an Fc domain amino acid
sequence, which has not been modified to increase ADCC). In one
embodiment, administration of one or more therapeutic doses of an
anti-ICOS antibody of the invention achieves at least about 2-fold,
at least about 3-fold, at least about 5-fold, or at least about
10-fold higher depletion of germinal center B cells from a
secondary lymphoid organ in a primate (non-human primate or human)
than that of the fucosylated the JMab-136 anti-ICOS antibody.
[0191] In one embodiment, the EC50 value of an anti-ICOS antibody
of the invention for the depletion of germinal center B cells from
a secondary lymphoid organ in a primate (non-human primate or
human) is at least about 2.times., at least about 5.times., at
least about 10.times., at least about 20.times., at least about
50.times., or at least about 100.times. lower than that of the
parental anti-ICOS antibody (e.g., an antibody comprising the same
variable domain amino acid sequence, but having 1) a fucosylated Fc
domain or 2) an Fc domain amino acid sequence, which has not been
modified to increase ADCC). In another embodiment, the EC50 value
of an anti-ICOS antibody of the invention for the depletion of
germinal center B cells from a secondary lymphoid organ in a
primate (non-human primate or human) is at least about 2.times., at
least about 5.times., at least about 10.times., at least about
20.times., at least about 50.times., or at least about 100.times.
lower than that of the parental anti-ICOS antibody.
[0192] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 5%, at least about 10%, at least about 20%, at least about
30%, at least about 40%, at least about 50%, at least about 75%, at
least about 100% higher depletion of germinal center B cells from a
secondary lymphoid organ in a primate (non-human primate or human)
than that of the parental anti-ICOS antibody (e.g., an antibody
comprising the same variable domain amino acid sequence, but having
1) a fucosylated Fc domain or 2) an Fc domain amino acid sequence,
which has not been modified to increase ADCC). In another
embodiment, administration of one or more therapeutic doses of an
anti-ICOS antibody of the invention achieves at least about 5%, at
least about 10%, at least about 20%, at least about 30%, at least
about 40%, at least about 50%, at least about 75%, at least about
100% higher depletion of germinal center B cells from a secondary
lymphoid organ in a primate (non-human primate or human) than that
of the fucosylated the JMab-136 anti-ICOS antibody.
[0193] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 2.times., at least about 5.times., at least about 10.times.,
at least about 15.times., at least about 20.times., at least about
25.times., at least about 50.times., or at least about 100.times.
higher depletion of germinal center B cells from a secondary
lymphoid organ in a primate (non-human primate or human) than that
of the parental anti-ICOS antibody (e.g., an antibody comprising
the same variable domain amino acid sequence, but having 1) a
fucosylated Fc domain or 2) an Fc domain amino acid sequence, which
has not been modified to increase ADCC). In another embodiment,
administration of one or more therapeutic doses of an anti-ICOS
antibody of the invention achieves at least about 2.times., at
least about 5.times., at least about 10.times., at least about
15.times., at least about 20.times., at least about 25.times., at
least about 50.times., or at least about 100.times. higher
depletion of germinal center B cells from a secondary lymphoid
organ in a primate (non-human primate or human) than that of the
fucosylated JMab-136 anti-ICOS antibody.
[0194] The present invention also provides for antibodies that
efficiently deplete circulating class switched B cells in a primate
(non-human primate or human). In one embodiment, the administration
of one or more therapeutic doses of an anti-ICOS antibody of the
invention depletes circulating class switched B cells in a primate
(non-human primate or human) for at least 1 day, at least 2 days at
least 5 days, at least 1 week, at least 2 weeks, at least 3 weeks,
at least 1 month, at least 2 months, at least 3 months, at least 4
months, at least 5 months, at least 6 months, at least 9 months.
Depletion of circulating class switched B cells is considered to
"substantially persist" during the time period following the
administartion of one or more doses of anti-ICOS antibody when the
number of circulating class switched B cells is at least 10% lower
in the antibody treated sample than the number of circulating class
switched B cells in the untreated control sample.
[0195] In one embodiment, the administration of one or more
therapeutic doses of an anti-ICOS antibody of the invention
depletes circulating class switched B cells in a primate (non-human
primate or human) for a longer time period than that of the
parental anti-ICOS antibody (e.g., an antibody comprising the same
variable domain amino acid sequence, but having 1) a fucosylated Fc
domain or 2) an Fc domain amino acid sequence, which has not been
modified to increase ADCC). In another embodiment, administration
of one or more therapeutic doses of an anti-ICOS antibody of the
invention depletes circulating class switched B cells in a primate
(non-human primate or human) for a longer time period than that of
the fucosylated JMAb-136 anti-ICOS antibody.
[0196] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention may achieve at
least about 20%, at least about 30%, at least about 40%, at least
about 50%, at least about 60%, at least about 70%, at least about
80%, at least about 90%, at least about 95%, at least about 97%, at
least about 99%, or at least about 100% depletion of circulating
class switched B cells in a primate (non-human primate or
human).
[0197] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention may deplete
circulating class switched B cells to less than 2%, less than 1.5%,
less than 1%, less than 0.9%, less than 0.8%, less than 07%, less
than 0.6%, less than 0.5%, less than 0.4%, less than 0.3% or less
than 0.1% of peripheral blood lymphocytes (PBL) in a primate
(non-human primate or human).
[0198] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention depletes
circulating class switched B cells in a primate (non-human primate
or human) more efficiently than that of the parental anti-ICOS
antibody (e.g., an antibody comprising the same variable domain
amino acid sequence, but having 1) a fucosylated Fc domain or 2) an
Fc domain amino acid sequence, which has not been modified to
increase ADCC). In another embodiment, administration of one or
more therapeutic doses of an anti-ICOS antibody of the invention
depletes circulating class switched B cells in a primate (non-human
primate or human) more efficiently than that of the fucosylated
JMAb-136 anti-ICOS antibody.
[0199] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 2-fold, at least about 3-fold, at least about 5-fold, or at
least about 10-fold higher depletion of circulating class switched
B cells in a primate (non-human primate or human) than that of the
parental anti-ICOS antibody (e.g., an antibody comprising the same
variable domain amino acid sequence, but having 1) a fucosylated Fc
domain or 2) an Fc domain amino acid sequence, which has not been
modified to increase ADCC). In one embodiment, administration of
one or more therapeutic doses of an anti-ICOS antibody of the
invention achieves at least about 2-fold, at least about 3-fold, at
least about 5-fold, or at least about 10-fold higher depletion of
circulating class switched B cells in a primate (non-human primate
or human) than that of the fucosylated the JMab-136 anti-ICOS
antibody.
[0200] In one embodiment, the EC50 value of an anti-ICOS antibody
of the invention for the depletion of circulating class switched B
cells in a primate (non-human primate or human) is at least about
2.times., at least about 5.times., at least about 10.times., at
least about 20.times., at least about 50.times., or at least about
100.times. lower than that of the parental anti-ICOS antibody
(e.g., an antibody comprising the same variable domain amino acid
sequence, but having 1) a fucosylated Fc domain or 2) an Fc domain
amino acid sequence, which has not been modified to increase ADCC).
In another embodiment, the EC50 value of an anti-ICOS antibody of
the invention for the depletion of circulating class switched B
cells in a primate (non-human primate or human) is at least about
2.times., at least about 5.times., at least about 10.times., at
least about 20.times., at least about 50.times., or at least about
100.times. lower than that of the parental anti-ICOS antibody
(e.g., an antibody comprising the same variable domain amino acid
sequence, but having 1) a fucosylated Fc domain or 2) an Fc domain
amino acid sequence, which has not been modified to increase
ADCC).
[0201] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 5%, at least about 10%, at least about 20%, at least about
30%, at least about 40%, at least about 50%, at least about 75%, at
least about 100% higher depletion of circulating class switched B
cells in a primate (non-human primate or human) than that of the
parental anti-ICOS antibody (e.g., an antibody comprising the same
variable domain amino acid sequence, but having 1) a fucosylated Fc
domain or 2) an Fc domain amino acid sequence, which has not been
modified to increase ADCC). In another embodiment, administration
of one or more therapeutic doses of an anti-ICOS antibody of the
invention achieves at least about 5%, at least about 10%, at least
about 20%, at least about 30%, at least about 40%, at least about
50%, at least about 75%, at least about 100% higher depletion of
circulating class switched B cells in a primate (non-human primate
or human) than that of the fucosylated the JMab-136 anti-ICOS
antibody.
[0202] In one embodiment, administration of one or more therapeutic
doses of an anti-ICOS antibody of the invention achieves at least
about 2.times., at least about 5.times., at least about 10.times.,
at least about 15.times., at least about 20.times., at least about
25.times., at least about 50.times., or at least about 100.times.
higher depletion of circulating class switched B cells in a primate
(non-human primate or human) than that of the parental anti-ICOS
antibody (e.g., an antibody comprising the same variable domain
amino acid sequence, but having 1) a fucosylated Fc domain or 2) an
Fc domain amino acid sequence, which has not been modified to
increase ADCC). In another embodiment, administration of one or
more therapeutic doses of an anti-ICOS antibody of the invention
achieves at least about 2.times., at least about 5.times., at least
about 10.times., at least about 15.times., at least about
20.times., at least about 25.times., at least about 50.times., or
at least about 100.times. higher depletion of circulating class
switched B cells in a primate (non-human primate or human) than
that of the fucosylated JMab-136 anti-ICOS antibody.
[0203] In one embodiment, an anti-ICOS antibody described herein
mediates antibody-dependent cellular cytotoxicity (ADCC),
complement-dependent cell-mediated cytotoxicity (CDC), and/or
antibody-dependent phagocytosis. In one embodiment, an anti-ICOS
antibody of the invention mediates antibody-dependent cellular
cytotoxicity (ADCC) and/or antibody-dependent phagocytosis. In one
embodiment, an anti-ICOS antibody of the invention has enhanced
antibody-dependent cellular cytotoxicity (ADCC).
[0204] In one embodiment, an anti-ICOS antibody of the invention
comprises a variant Fc region that mediates enhanced
antibody-dependent cellular cytotoxicity (ADCC). In a further
embodiment, an anti-ICOS antibody of the invention comprises a
variant Fc region comprising at least one substitution of an amino
acid residue selected from the group consisting of: residue 239,
330, and 332, wherein the amino acid residue positions are
determined according to the EU convention. In a specific
embodiment, an anti-ICOS antibody of the invention comprises a
variant Fc region comprising at least on amino acid substitution
selected from the group consisting of: S239D, A330L, and 1332E;
wherein the amino acid residue positions are determined according
to the EU convention. In a further embodiment, an anti-ICOS
antibody of the invention comprises at least one amino acid residue
selected from the group consisting of: D at position 239, L at
position 330, and E at position 332; wherein the amino acid residue
positions are determined according to the EU convention.
[0205] In one embodiment, an anti-ICOS antibody of the invention
comprises an engineered Fc region comprising at least one
engineered glycoform, wherein said engineered Fc region mediates
enhanced antibody-dependent cellular cytotoxicity (ADCC). In one
embodiment, an anti-ICOS antibody of the inventions comprises an
engineered Fc region lacking glycosylation. In one embodiment, an
anti-ICOS antibody of the invention comprises an engineered Fc
region having complex N-glycoside-linked sugar chains linked to
Asn297 in which fucose is not bound to N-acetylglucosamine in the
reducing end.
[0206] In certain embodiments, an anti-ICOS antibody of the
invention comprises a variant Fc region that has a higher affinity
for an Fc binding protein such as, but not limited to, Fc receptor,
C1q than a wild type Fc region. In one embodiment, an anti-ICOS
antibody of the invention comprises a variant Fc region that has
higher affinity for the Fc.gamma.RIIIA receptor protein than a wild
type Fc region.
[0207] In certain embodiments, an anti-ICOS antibody of the
invention comprises an engineered Fc region comprising at least one
engineered glycoform, wherein said engineered Fc region has a
higher affinity for an Fc binding protein such as, but not limited
to, Fc receptor, C1q than a wild type Fc region. In one embodiment,
an anti-ICOS antibody of the invention comprises an engineered Fc
region comprising at least one engineered glycoform, wherein said
engineered Fc region has higher affinity for the Fc.gamma.RIIIA
receptor protein than a wild type Fc region.
[0208] The present invention also relates to methods of treating
and preventing T cell-mediated diseases and disorders, such as, but
not limited to, chronic infection, autoimmune disease or disorder,
inflammatory disease or disorder, graft-versus-host disease (GVHD),
transplant rejection, and T cell proliferative disorder in a human,
comprising administering to a human in need thereof an anti-ICOS
antibody with enhanced effector function (e.g., antibody-dependent
cellular cytotoxicity (ADCC), complement-dependent cell-mediated
cytotoxicity (CDC), and/or antibody-dependent phagocytosis) in an
amount sufficient to deplete circulating ICOS expressing cells. In
a particular aspect, the present invention also concerns methods of
treating and preventing T cell-mediated diseases and disorders,
such as, but not limited to, chronic infection, autoimmune disease
or disorder, inflammatory disease or disorder, graft-versus-host
disease (GVHD), transplant rejection, and T cell proliferative
disorder in a human comprising administration of a therapeutically
effective regimen of an anti-ICOS antibody with enhanced effector
function, which is of the IgG1 or IgG3 human isotype.
[0209] The invention encompasses methods of identifying,
diagnosing, treating, and monitoring disease progression in
patients. The patient may have the disease, disorder, or condition
as a result of experimental research, e.g., it may be an
experimental model developed for the disease, disorder, or
condition. Alternatively, the patient may have the disease,
disorder, or condition in the absence of experimental manipulation.
Patients include humans, mice, rats, horses, pigs, cats, dogs, and
any animal used for research.
[0210] The patient may comprise a differentially regulated ICOS
mRNA or ICOSL mRNA or miR-101 level. A differentially regulated
ICOS mRNA or ICOSL mRNA or miR-101 level may be one in which a
tissue sample of the patient exhibits increased expression of ICOS
mRNA or ICOSL mRNA or miR-101 relative to a control tissue sample
of the patient or relative to a healthy control individual. A
differentially regulated ICOS mRNA or ICOSL mRNA or miR-101 level
may be one in which a tissue sample of the patient exhibits
decreased expression of ICOS mRNA or ICOSL mRNA or miR-101 relative
to a control sample of the patient or relative to a healthy control
individual. The differential increase or decrease in expression may
be approximately 10%-500% of the control sample, approximately
10%-400% of the control sample, approximately 10%-300% of the
control sample, approximately 10%-250% of the control sample,
approximately 10%-200% of the control sample, approximately
10%-150% of the control sample, approximately 10%-100% of the
control sample, approximately 10%-50% of the control sample,
approximately 100%-500% of the control sample, approximately
200%-500% of the control sample, approximately 300%-500% of the
control sample, approximately 400%-500% of the control sample,
approximately 50%-100% of the control sample, approximately
100%-200% of the control sample, approximately 100%-400% of the
control sample, approximately 200%-400% of the control sample,
approximately 10%-50% of the control sample, approximately 20%-100%
of the control sample, approximately 25%-75% of the control sample,
or approximately 50%-100% of the control sample. It may be 10, 20,
25, 30, 40, 50, 75, 100, 125, 150, 175, 200, 250, 300, 400, or 500
percent of the control sample.
[0211] Administration of an anti-ICOS antibody of the invention may
result in neutralization of the differentially regulated ICOS mRNA
or ICOSL mRNA or miR-101 level. Neutralization of the
differentially regulated ICOS mRNA or ICOSL mRNA or miR-101 level
may be a reduction of at least 2%, at least 3%, at least 4%, at
least 5%, at least 7%, at least 8%, at least 10%, at least 15%, at
least 25%, at least 30%, at least 35%, at least 40%, at least 45%,
at least 50%, at least 60%, at least 70%, at least 75%, at least
80%, or at least 90% of ICOS mRNA or ICOSL mRNA or miR-101 level.
Alternatively, neutralization of the differentially regulated ICOS
mRNA or ICOSL mRNA or miR-101 level refers to a reduction of
expression of up-regulated ICOS mRNA or ICOSL mRNA or miR-101 that
is within at most 50%, at most 45%, at most 40%, at most 35%, at
most 30%, at most 25%, at most 20%, at most 15%, at most 10%, at
most 5%, at most 4%, at most 3%, at most 2%, or at most 1% of
expression levels of the ICOS mRNA or ICOSL mRNA or miR-101 level
in a control sample.
[0212] The upregulation or downregulation of the ICOS mRNA or ICOSL
mRNA or miR-101 in the patient may be by any degree relative to
that of a sample from a control (which may be from a sample that is
not disease tissue of the patient (e.g., non-lesional skin of a SLE
patient) or from a healthy person not afflicted with the disease or
disorder). The degree upregulation or downregulation may be at
least 10%, at least 15%, at least 20%, at least 25%, at least 30%,
at least 40%, at least 50%, at least 60%, at least 70%, at least
75%, at least 80%, at least 90%, at least 100%, at least 125%, at
least 150%, or at least 200%, or at least 300%, or at least 400%,
or at least 500% that of the control or control sample.
[0213] In methods of monitoring or prognosing disease progression
of a patient, samples from the patient may be obtained before and
after administration of an agent.
[0214] Samples include any biological fluid or tissue, such as
whole blood, serum, muscle, saliva, urine, synovial fluid, bone
marrow, cerebrospinal fluid, nasal secretions, sputum, amniotic
fluid, bronchoalveolar lavage fluid, peripheral blood mononuclear
cells, total white blood cells, lymph node cells, spleen cells,
tonsil cells, or skin. The samples may be obtained by any means
known in the art.
[0215] ICOS mRNA or ICOSL mRNA or miR-101 levels are obtained in
the (before and after agent administration) samples. The ICOS mRNA
or ICOSL mRNA or miR-101 levels in the samples are compared.
[0216] The sample obtained from the patient may be obtained prior
to a first administration of the agent, i.e., the patient is naive
to the agent. Alternatively, the sample obtained from the patient
may occur after administration of the agent in the course of
treatment. For example, the agent may have been administered prior
to the initiation of the monitoring protocol. Following
administration of the agent an additional samples may be obtained
from the patient. The samples may be of the same or different type,
e.g., each sample obtained may be a blood sample, or each sample
obtained may be a serum sample. The ICOS mRNA or ICOSL mRNA or
miR-101 levels detected in each sample may be the same, may overlap
substantially, or may be similar.
[0217] The samples may be obtained at any time before and after the
administration of the therapeutic agent. The sample obtained after
administration of the therapeutic agent may be obtained at least 2,
at least 3, at least 4, at least 5, at least 6, at least 7, at
least 8, at least 9, at least 10, at least 12, or at least 14 days
after administration of the therapeutic agent. The sample obtained
after administration of the therapeutic agent may be obtained at
least 2, at least 3, at least 4, at least 5, at least 6, at least
7, or at least 8 weeks after administration of the therapeutic
agent. The sample obtained after administration of the therapeutic
agent may be obtained at least 2, at least 3, at least 4, at least
5, or at least 6 months following administration of the therapeutic
agent.
[0218] Additional samples may be obtained from the patient
following administration of the therapeutic agent. At least 2, at
least 3, at least 4, at least 5, at least 6, at least 7, at least
8, at least 9, at least 10, at least 12, at least 15, at least 20,
at least 25 samples may be obtained from the patient to monitor
progression or regression of the disease or disorder over time.
Disease progression may be monitored over a time period of at least
1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at
least 5 weeks, at least 6 weeks, at least 7 weeks, at least 2
months, at least 3 months, at least 4 months, at least 5 months, at
least 6 months, at least 1 year, at least 2 years, at least 3
years, at least 4 years, at least 5 years, at least 10 years, or
over the lifetime of the patient. Additional samples may be
obtained from the patient at regular intervals such as at monthly,
bimonthly, once a quarter year, twice a year, or yearly intervals.
The samples may be obtained from the patient following
administration of the agent at regular intervals. For instance, the
samples may be obtained from the patient at one week following each
administration of the agent, or at two weeks following each
administration of the agent, or at three weeks following each
administration of the agent, or at one month following each
administration of the agent, or at two months following each
administration of the agent. Alternatively, multiple samples may be
obtained from the patient following each administration of the
agent.
[0219] The invention also encompasses methods employing ICOS mRNA
or ICOSL mRNA or miR-101 levels to treat, diagnose, prognose, and
monitor myositis. The ICOS mRNA or ICOSL mRNA or miR-101 levels can
also be used to guide dosage and treatment of myositis patients or
models of myositis disease.
5.1. Monoclonal Anti-ICOS Antibodies
[0220] A monoclonal anti-ICOS antibody exhibits binding specificity
to human ICOS antigen and may mediate human ADCC, CDC and/or
antibody-dependent phagocytosis. Such an antibody can be generated
using a wide variety of techniques known in the art including the
use of hybridoma, recombinant, and phage display technologies, or a
combination thereof. Antibodies are highly specific, being directed
against a single antigenic site. An engineered anti-ICOS antibody
can be produced by any means known in the art, including, but not
limited to, those techniques described below and improvements to
those techniques. Large-scale high-yield production typically
involves culturing a host cell that produces the engineered
anti-ICOS antibody and recovering the anti-ICOS antibody from the
host cell culture.
5.1.1. Hybridoma Technique
[0221] Monoclonal antibodies can be produced using hybridoma
techniques including those known in the art and taught, for
example, in Harlow et al., Antibodies: A Laboratory Manual, (Cold
Spring Harbor Laboratory Press, 2nd ed. 1988); Hammerling et al.,
in Monoclonal Antibodies and T Cell Hybridomas, 563-681 (Elsevier,
N.Y., 1981) (said references incorporated herein by reference in
their entireties). For example, in the hybridoma method, a mouse or
other appropriate host animal, such as a hamster or macaque monkey,
is immunized to elicit lymphocytes that produce or are capable of
producing antibodies that will specifically bind to the protein
used for immunization. Lymphocytes may also be immunized in vitro.
Lymphocytes then are fused with myeloma cells using a suitable
fusing agent, such as polyethylene glycol, to form a hybridoma cell
(Goding, Monoclonal Antibodies: Principles and Practice, pp. 59-103
(Academic Press, 1986)).
[0222] The hybridoma cells thus prepared are seeded and grown in a
suitable culture medium that contains one or more substances that
inhibit the growth or survival of the unfused, parental myeloma
cells. For example, if the parental myeloma cells lack the enzyme
hypoxanthine guanine phosphoribosyl transferase (HGPRT or HPRT),
the culture medium for the hybridomas typically will include
hypoxanthine, aminopterin, and thymidine (HAT medium), which
substances prevent the growth of HGPRT-deficient cells.
[0223] Specific embodiments employ myeloma cells that fuse
efficiently, support stable high-level production of antibody by
the selected antibody-producing cells, and are sensitive to a
medium such as HAT medium. Among these myeloma cell lines are
murine myeloma lines, such as those derived from MOPC-21 and MPC-11
mouse tumors available from the Salk Institute Cell Distribution
Center, San Diego, Calif., USA, and SP-2 or X63-Ag8.653 cells
available from the American Type Culture Collection, Rockville,
Md., USA. Human myeloma and mouse-human heteromyeloma cell lines
also have been described for the production of human monoclonal
antibodies (Kozbor, J. Immunol, 133:3001 (1984); Brodeur et al.,
Monoclonal Antibody Production Techniques and Applications, pp.
51-63 (Marcel Dekker, Inc., New York, 1987)).
[0224] Culture medium in which hybridoma cells are growing is
assayed for production of monoclonal antibodies directed against
the human ICOS antigen. The binding specificity of monoclonal
antibodies produced by hybridoma cells can be determined by
immunoprecipitation or by an in vitro binding assay, such as
radioimmunoassay (RIA) or enzyme-linked immunoabsorbent assay
(ELISA).
[0225] After hybridoma cells are identified that produce antibodies
of the desired specificity, affinity, and/or activity, the clones
may be subcloned by limiting dilution procedures and grown by
standard methods (Goding, Monoclonal Antibodies: Principles and
Practice, pp. 59-103 (Academic Press, 1986)). Suitable culture
media for this purpose include, for example, D-MEM or RPMI 1640
medium. In addition, the hybridoma cells may be grown in vivo as
ascites tumors in an animal.
[0226] The monoclonal antibodies secreted by the subclones are
suitably separated from the culture medium, ascites fluid, or serum
by conventional immunoglobulin purification procedures such as, for
example, protein A-Sepharose, hydroxylapatite chromatography, gel
electrophoresis, dialysis, or affinity chromatography.
5.1.2. Recombinant DNA Techniques
[0227] DNA encoding an anti-ICOS antibody described herein is
readily isolated and sequenced using conventional procedures (e.g.,
by using oligonucleotide probes that are capable of binding
specifically to genes encoding the heavy and light chains of
anti-ICOS antibodies). The hybridoma cells serve as a source of
such DNA. Once isolated, the DNA may be placed into expression
vectors, which are then transfected into host cells such as E. coli
cells, simian COS cells, Chinese hamster ovary (CHO) cells, or
myeloma cells that do not otherwise produce immunoglobulin protein,
to obtain the synthesis of anti-ICOS antibodies in the recombinant
host cells.
[0228] In phage display methods, functional antibody domains are
displayed on the surface of phage particles which carry the
polynucleotide sequences encoding them. In particular, DNA
sequences encoding VH and VL domains are amplified from animal cDNA
libraries (e.g., human or murine cDNA libraries of affected
tissues). The DNA encoding the VH and VL domains are recombined
together with an scFv linker by PCR and cloned into a phagemid
vector. The vector is electroporated in E. coli and the E. coli is
infected with helper phage. Phage used in these methods is
typically filamentous phage including fd and M13 and the V.sub.H
and V.sub.L domains are usually recombinantly fused to either the
phage gene III or gene VIII. Phage expressing an antigen-binding
domain that binds to a particular antigen can be selected or
identified with antigen, e.g., using labeled antigen or antigen
bound or captured to a solid surface or bead. Examples of phage
display methods that can be used to make the antibodies of the
present invention include those disclosed in Brinkman et al., 1995,
J. Immunol. Methods, 182:41-50; Ames et al., 1995, J. Immunol.
Methods, 184:177-186; Kettleborough et al, 1994, Eur. J. Immunol.,
24:952-958; Persic et al., 1997, Gene, 187:9-18; Burton et al.,
1994, Advances in Immunology, 57:191-280; International Application
No. PCT/GB91/O1 134; International Publication Nos. WO 90/02809, WO
91/10737, WO 92/01047, WO 92/18619, WO 93/11236, WO 95/15982, WO
95/20401, and WO97/13844; and U.S. Pat. Nos. 5,698,426, 5,223,409,
5,403,484, 5,580,717, 5,427,908, 5,750,753, 5,821,047, 5,571,698,
5,427,908, 5,516,637, 5,780,225, 5,658,727, 5,733,743, and
5,969,108; each of which is incorporated herein by reference in its
entirety.
[0229] As described in the above references, after phage selection,
the antibody coding regions from the phage can be isolated and used
to generate whole antibodies, including human antibodies, or any
other desired antigen-binding fragment, and expressed in any
desired host, including mammalian cells, insect cells, plant cells,
yeast, and bacteria, e.g., as described below. Techniques to
recombinantly produce Fab, Fab' and F(ab').sub.2 fragments can also
be employed using methods known in the art such as those disclosed
in PCT Publication No. WO 92/22324; Mullinax et al., 1992,
BioTechniques, 12(6):864-869; Sawai et al., 1995, AJRI, 34:26-34;
and Better et al., 1988, Science, 240:1041-1043 (said references
incorporated by reference in their entireties).
[0230] Antibodies may be isolated from antibody phage libraries
generated using the techniques described in McCafferty et al.,
Nature, 348:552-554 (1990). Clackson et al., Nature, 352:624-628
(1991). Marks et al., J. Mol. Biol., 222:581-597 (1991) describe
the isolation of murine and human antibodies, respectively, using
phage libraries. Chain shuffling can be used in the production of
high affinity (nM range) human antibodies (Marks et al.,
Bio/Technology, 10:779-783 (1992)), as well as combinatorial
infection and in vivo recombination as a strategy for constructing
very large phage libraries (Waterhouse et al, Nuc. Acids. Res.,
21:2265-2266 (1993)). Thus, these techniques are viable
alternatives to traditional monoclonal antibody hybridoma
techniques for isolation of anti-ICOS antibodies.
[0231] To generate whole antibodies, PCR primers including VH or VL
nucleotide sequences, a restriction site, and a flanking sequence
to protect the restriction site can be used to amplify the VH or VL
sequences in scFv clones. Utilizing cloning techniques known to
those of skill in the art, the PCR amplified VH domains can be
cloned into vectors expressing a heavy chain constant region, e.g.,
the human gamma 4 constant region, and the PCR amplified VL domains
can be cloned into vectors expressing a light chain constant
region, e.g., human kappa or lambda constant regions. The vectors
for expressing the VH or VL domains may comprise an EF-1.alpha.
promoter, a secretion signal, a cloning site for the variable
domain, constant domains, and a selection marker such as neomycin.
The VH and VL domains may also be cloned into one vector expressing
the necessary constant regions. The heavy chain conversion vectors
and light chain conversion vectors are then co-transfected into
cell lines to generate stable or transient cell lines that express
full-length antibodies, e.g., IgG, using techniques known to those
of skill in the art.
[0232] The DNA also may be modified, for example, by substituting
the coding sequence for human heavy and light chain constant
domains in place of the homologous murine sequences (U.S. Pat. No.
4,816,567; Morrison et al., Proc. Natl. Acad. Sci. USA, 81:6851
(1984)), or by covalently joining to the immunoglobulin coding
sequence all or part of the coding sequence for a
non-immunoglobulin polypeptide.
5.2. Chimeric Antibodies
[0233] The anti-ICOS antibodies herein specifically include
chimeric antibodies (immunoglobulins) in which a portion of the
heavy and/or light chain is identical with or homologous to
corresponding sequences in antibodies derived from a particular
species or belonging to a particular antibody class or subclass,
while another portion of the chain(s) is identical with or
homologous to corresponding sequences in antibodies derived from
another species or belonging to another antibody class or subclass,
as well as fragments of such antibodies, so long as they exhibit
the desired biological activity (U.S. Pat. No. 4,816,567; Morrison
et al., Proc. Natl. Acad. Sci. USA, 81:6851-6855 (1984)). Chimeric
antibodies of interest herein include "primatized" antibodies
comprising variable domain antigen-binding sequences derived from a
nonhuman primate (e.g., Old World Monkey, such as baboon, rhesus or
cynomolgus monkey) and human constant region sequences (U.S. Pat.
No. 5,693,780).
5.3.Altered/Mutant Antibodies
[0234] Anti-ICOS antibodies of compositions and methods described
herein can be mutant antibodies. As used herein, "antibody mutant"
or "altered antibody" refers to an amino acid sequence variant of
an anti-ICOS antibody wherein one or more of the amino acid
residues of an anti-ICOS antibody have been modified. The
modifications to the amino acid sequence of an anti-ICOS antibody
include modifications to the sequence that may improve affinity or
avidity of the antibody for its antigen, and/or modifications to
the Fc portion of the antibody that may improve effector
function.
[0235] The present invention therefore relates to anti-ICOS
antibodies with enhanced effector function disclosed herein as well
as altered/mutant derivatives thereof including, but not limited to
ones exhibiting altered human ICOS binding characteristics; e.g.
altered association constants k.sub.ON, dissociation constants
k.sub.OFF, and/or equilibrium constant or binding affinity,
K.sub.D. In certain embodiments the K.sub.D of an anti-ICOS
antibody described herein, or an altered/mutant derivative thereof,
for human ICOS may be no more than about 10.sup.-6M, 10.sup.-7M,
10.sup.-8M, or 10.sup.-9M. Methods and reagents suitable for
determination of such binding characteristics of an antibody of the
present invention, or an altered/mutant derivative thereof, are
known in the art and/or are commercially available (se above and,
e.g., U.S. Pat. No. 6,849,425, U.S. Pat. No. 6,632,926, U.S. Pat.
No. 6,294,391, and U.S. Pat. No. 6,143,574, each of which is hereby
incorporated by reference in its entirety). Moreover, equipment and
software designed for such kinetic analyses are commercially
available (e.g. Biacore.RTM. A100, and Biacore.RTM. 2000
instruments; Biacore International AB, Uppsala, Sweden).
[0236] The modifications may be made to any known anti-ICOS
antibodies or anti-ICOS antibodies identified as described herein.
Such altered antibodies necessarily have less than 100% sequence
identity or similarity with a known anti-ICOS antibody. By way of
example, an altered antibody may have an amino acid sequence that
is within the range of from about 25% to about 95% identical or
similar to the amino acid sequence of either the heavy or light
chain variable domain of an anti-ICOS antibody as described herein.
An altered antibody may have an amino acid sequence having at least
25%, 35%, 45%, 55%, 65%, 75%, 80%, 85%, 90%, or 95% amino acid
sequence identity or similarity with the amino acid sequence of
either the heavy or light chain variable domain of an anti-ICOS
antibody as described herein. In another embodiment, an altered
antibody may have an amino acid sequence having at least 25%, 35%,
45%, 55%, 65%, 75%, 80%, 85%, 90%, or 95% amino acid sequence
identity or similarity with the amino acid sequence of the heavy
chain CDR1, CDR2, or CDR3 of an anti-ICOS antibody as described
herein. In one embodiment, an altered antibody may maintain human
ICOS binding capability. In certain embodiments, an anti-ICOS
antibody as described herein may comprise a VH that is at least or
about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%,
70%, 75%, 80%, 85%, 90%, 95% or more identical to the amino acid
sequence of SEQ ID NO:7.
[0237] In another embodiment, an altered antibody may have an amino
acid sequence having at least 25%, 35%, 45%, 55%, 65%, 75%, 80%,
85%, 90%, or 95% amino acid sequence identity or similarity with
the amino acid sequence of the light chain CDR1, CDR2, or CDR3 of
an anti-ICOS antibody as described herein. In certain embodiments,
an anti-ICOS antibody of the invention may comprise a VL that is at
least or about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%,
60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more identical to an
amino acid sequence of SEQ ID NO:2.
[0238] Identity or similarity with respect to a sequence is defined
herein as the percentage of amino acid residues in the candidate
sequence that are identical (i.e., same residue) or similar (i.e.,
amino acid residue from the same group based on common side-chain
properties, see below) with anti-ICOS antibody residues, after
aligning the sequences and introducing gaps, if necessary, to
achieve the maximum percent sequence identity. None of N-terminal,
C-terminal, or internal extensions, deletions, or insertions into
the antibody sequence outside of the variable domain shall be
construed as affecting sequence identity or similarity.
[0239] "% identity," as known in the art, is a measure of the
relationship between two polynucleotides or two polypeptides, as
determined by comparing their sequences. In general, the two
sequences to be compared are aligned to give a maximum correlation
between the sequences. The alignment of the two sequences is
examined and the number of positions giving an exact amino acid or
nucleotide correspondence between the two sequences determined,
divided by the total length of the alignment and multiplied by 100
to give a % identity figure. This % identity figure may be
determined over the whole length of the sequences to be compared,
which is particularly suitable for sequences of the same or very
similar length and which are highly homologous, or over shorter
defined lengths, which is more suitable for sequences of unequal
length or which have a lower level of homology.
[0240] For example, sequences can be aligned with the software
clustalw under Unix which generates a file with an ".aln"
extension, this file can then be imported into the Bioedit program
(Hall, T. A. 1999, BioEdit: a user-friendly biological sequence
alignment editor and analysis program for Windows 95/98/NT. Nucl.
Acids. Symp. Ser. 41:95-98) which opens the .aln file. In the
Bioedit window, one can choose individual sequences (two at a time)
and alignment them. This method allows for comparison of the entire
sequence.
[0241] Methods for comparing the identity of two or more sequences
are well known in the art. Thus for instance, programs are
available in the Wisconsin Sequence Analysis Package, version 9.1
(Devereux J. et al., Nucleic Acids Res., 12:387-395, 1984,
available from Genetics Computer Group, Madison, Wis., USA). The
determination of percent identity between two sequences can be
accomplished using a mathematical algorithm. For example, the
programs BESTFIT and GAP, may be used to determine the % identity
between two polynucleotides and the % identity between two
polypeptide sequences. BESTFIT uses the "local homology" algorithm
of Smith and Waterman (Advances in Applied Mathematics, 2:482-489,
1981) and finds the best single region of similarity between two
sequences. BESTFIT is more suited to comparing two polynucleotide
or two polypeptide sequences which are dissimilar in length, the
program assuming that the shorter sequence represents a portion of
the longer. In comparison, GAP aligns two sequences finding a
"maximum similarity" according to the algorithm of Neddleman and
Wunsch (J. Mol. Biol., 48:443-354, 1970). GAP is more suited to
comparing sequences which are approximately the same length and an
alignment is expected over the entire length. Preferably the
parameters "Gap Weight" and "Length Weight" used in each program
are 50 and 3 for polynucleotides and 12 and 4 for polypeptides,
respectively. Preferably % identities and similarities are
determined when the two sequences being compared are optimally
aligned.
[0242] Other programs for determining identity and/or similarity
between sequences are also known in the art, for instance the BLAST
family of programs (Karlin & Altschul, 1990, Proc. Natl. Acad.
Sci. USA, 87:2264-2268, modified as in Karlin & Altschul, 1993,
Proc. Natl. Acad. Sci. USA, 90:5873-5877, available from the
National Center for Biotechnology Information (NCB), Bethesda, Md.,
USA and accessible through the home page of the NCBI at
www.ncbi.nlm.nih.gov). These programs are non-limiting examples of
a mathematical algorithm utilized for the comparison of two
sequences. Such an algorithm is incorporated into the NBLAST and
XBLAST programs of Altschul et al., 1990, J. Mol. Biol.,
215:403-410. BLAST nucleotide searches can be performed with the
NBLAST program, score=100, wordlength=12 to obtain nucleotide
sequences homologous to a nucleic acid molecule encoding all or a
portion if an anti-ICOS antibody of the invention. BLAST protein
searches can be performed with the XBLAST program, score=50,
wordlength=3 to obtain amino acid sequences homologous to a protein
molecule of the invention. To obtain gapped alignments for
comparison purposes, Gapped BLAST can be utilized as described in
Altschul et al., 1997, Nucleic Acids Res., 25:3389-3402. PSI-Blast
can also be used to perform an iterated search which detects
distant relationships between molecules (Id.). When utilizing
BLAST, Gapped BLAST, and PSI-Blast programs, the default parameters
of the respective programs (e.g., XBLAST and NBLAST) can be used.
See, http://www.ncbi.nlm.nih.gov.
[0243] Another non-limiting example of a program for determining
identity and/or similarity between sequences known in the art is
FASTA (Pearson W. R. and Lipman D. J., Proc. Natl. Acad. Sci. USA,
85:2444-2448, 1988, available as part of the Wisconsin Sequence
Analysis Package). Preferably the BLOSUM62 amino acid substitution
matrix (Henikoff S. and Henikoff J. G., Proc. Natl. Acad. Sci. USA,
89:10915-10919, 1992) is used in polypeptide sequence comparisons
including where nucleotide sequences are first translated into
amino acid sequences before comparison.
[0244] Yet another non-limiting example of a program known in the
art for determining identity and/or similarity between amino acid
sequences is SeqWeb Software (a web-based interface to the GCG
Wisconsin Package: Gap program) which is utilized with the default
algorithm and parameter settings of the program: blosum62, gap
weight 8, length weight 2.
[0245] The percent identity between two sequences can be determined
using techniques similar to those described above, with or without
allowing gaps. In calculating percent identity, typically exact
matches are counted.
[0246] Preferably the program BESTFIT is used to determine the %
identity of a query polynucleotide or a polypeptide sequence with
respect to a polynucleotide or a polypeptide sequence of the
present invention, the query and the reference sequence being
optimally aligned and the parameters of the program set at the
default value.
[0247] To generate an altered antibody, one or more amino acid
alterations (e.g., substitutions) are introduced in one or more of
the hypervariable regions of the species-dependent antibody. One or
more alterations (e.g., substitutions) of framework region residues
may also be introduced in an anti-ICOS antibody where these result
in an improvement in the binding affinity of the antibody mutant
for the antigen from the second mammalian species. Examples of
framework region residues to modify include those which
non-covalently bind antigen directly (Amit et al., Science,
233:747-753 (1986)); interact with/effect the conformation of a CDR
(Chothia et al., J. Mol. Biol., 196:901-917 (1987)); and/or
participate in the VL-VH interface (EP 239 400B1). In certain
embodiments, modification of one or more of such framework region
residues results in an enhancement of the binding affinity of the
antibody for the antigen from the second mammalian species. For
example, from about one to about five framework residues may be
altered in this embodiment of the invention. Sometimes, this may be
sufficient to yield an antibody mutant suitable for use in
preclinical trials, even where none of the hypervariable region
residues have been altered. Normally, however, an altered antibody
will comprise additional hypervariable region alteration(s).
[0248] The hypervariable region residues which are altered may be
changed randomly, especially where the starting binding affinity of
an anti-ICOS antibody for the antigen from the second mammalian
species is such that such randomly produced altered antibody can be
readily screened.
[0249] One useful procedure for generating such an altered antibody
is called "alanine scanning mutagenesis" (Cunningham and Wells,
Science, 244:1081-1085 (1989)). Here, one or more of the
hypervariable region residue(s) are replaced by alanine or
polyalanine residue(s) to affect the interaction of the amino acids
with the antigen from the second mammalian species. Those
hypervariable region residue(s) demonstrating functional
sensitivity to the substitutions then are refined by introducing
additional or other mutations at or for the sites of substitution.
Thus, while the site for introducing an amino acid sequence
variation is predetermined, the nature of the mutation per se need
not be predetermined. The Ala-mutants produced this way are
screened for their biological activity as described herein.
[0250] Another procedure for generating such an altered antibody
involves affinity maturation using phage display (Hawkins et al.,
J. Mol. Biol., 254:889-896 (1992) and Lowman et al., Biochemistry,
30(45):10832-10837 (1991)). Briefly, several hypervariable region
sites (e.g., 6-7 sites) are mutated to generate all possible amino
acid substitutions at each site. The antibody mutants thus
generated are displayed in a monovalent fashion from filamentous
phage particles as fusions to the gene III product of M13 packaged
within each particle. The phage-displayed mutants are then screened
for their biological activity (e.g., binding affinity) as herein
disclosed.
[0251] Mutations in antibody sequences may include substitutions,
deletions, including internal deletions, additions, including
additions yielding fusion proteins, or conservative substitutions
of amino acid residues within and/or adjacent to the amino acid
sequence, but that result in a "silent" change, in that the change
produces a functionally equivalent anti-ICOS antibody. Conservative
amino acid substitutions may be made on the basis of similarity in
polarity, charge, solubility, hydrophobicity, hydrophilicity,
and/or the amphipathic nature of the residues involved. For
example, non-polar (hydrophobic) amino acids include alanine,
leucine, isoleucine, valine, proline, phenylalanine, tryptophan,
and methionine; polar neutral amino acids include glycine, serine,
threonine, cysteine, tyrosine, asparagine, and glutamine;
positively charged (basic) amino acids include arginine, lysine,
and histidine; and negatively charged (acidic) amino acids include
aspartic acid and glutamic acid. In addition, glycine and proline
are residues that can influence chain orientation. Non-conservative
substitutions will entail exchanging a member of one of these
classes for a member of another class. Furthermore, if desired,
non-classical amino acids or chemical amino acid analogs can be
introduced as a substitution or addition into the antibody
sequence. Non-classical amino acids include, but are not limited
to, the D-isomers of the common amino acids, .alpha.-amino
isobutyric acid, 4-aminobutyric acid, Abu, 2-amino butyric acid,
.gamma.-Abu, .epsilon.-Ahx, 6-amino hexanoic acid, Aib, 2-amino
isobutyric acid, 3-amino propionic acid, ornithine, norleucine,
norvaline, hydroxyproline, sarcosine, citrulline, cysteic acid,
t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine,
.beta.-alanine, fluoro-amino acids, designer amino acids such as
.beta.-methyl amino acids, C.alpha.-methyl amino acids,
N.alpha.-methyl amino acids, and amino acid analogs in general.
[0252] In another embodiment, the sites selected for modification
are affinity matured using phage display (see above).
[0253] Any technique for mutagenesis known in the art can be used
to modify individual nucleotides in a DNA sequence, for purposes of
making amino acid substitution(s) in the antibody sequence, or for
creating/deleting restriction sites to facilitate further
manipulations. Such techniques include, but are not limited to,
chemical mutagenesis, in vitro site-directed mutagenesis (Kunkel,
Proc. Natl. Acad. Sci. USA, 82:488 (1985); Hutchinson, C. et al.,
J. Biol. Chem., 253:6551 (1978)), oligonucleotide-directed
mutagenesis (Smith, Ann. Rev. Genet., 19:423-463 (1985); Hill et
al., Methods Enzymol., 155:558-568 (1987)), PCR-based overlap
extension (Ho et al., Gene, 77:51-59 (1989)), PCR-based megaprimer
mutagenesis (Sarkar et al, Biotechniques, 8:404-407 (1990)), etc.
Modifications can be confirmed by double-stranded dideoxy DNA
sequencing.
[0254] In certain embodiments of the invention, an anti-ICOS
antibody can be modified to produce fusion proteins; i.e., the
antibody, or a fragment thereof, fused to a heterologous protein,
polypeptide or peptide. In certain embodiments, the protein fused
to the portion of an anti-ICOS antibody is an enzyme component of
Antibody-Directed Enzyme Prodrug Therapy (ADEPT). Examples of other
proteins or polypeptides that can be engineered as a fusion protein
with an anti-ICOS antibody include, but are not limited to toxins
such as ricin, abrin, ribonuclease, DNase I, Staphylococcal
enterotoxin-A, pokeweed anti-viral protein, gelonin, diphtherin
toxin, Pseudomonas exotoxin, and Pseudomonas endotoxin. See, for
example, Pastan et al., Cell, 47:641 (1986), and Goldenberg et al,
Cancer Journal for Clinicians, 44:43 (1994). Enzymatically active
toxins and fragments thereof which can be used include diphtheria A
chain, non-binding active fragments of diphtheria toxin, exotoxin A
chain (from Pseudomonas aeruginosa), ricin A chain, abrin A chain,
modeccin A chain, alpha-sarcin, Aleurites fordii proteins, dianthin
proteins, Phytolaca americana proteins (PAPI, PAPII, and PAP-S),
momordica charantia inhibitor, curcin, crotin, sapaonaria
officinalis inhibitor, gelonin, mitogellin, restrictocin,
phenomycin, enomycin and the tricothecenes. See, for example, WO
93/21232 published Oct. 28, 1993.
[0255] Additional fusion proteins may be generated through the
techniques of gene-shuffling, motif-shuffling, exon-shuffling,
and/or codon-shuffling (collectively referred to as "DNA
shuffling"). DNA shuffling may be employed to alter the activities
of the anti-ICOS antibody or fragments thereof (e.g., an antibody
or a fragment thereof with higher affinities and lower dissociation
rates). See, generally, U.S. Pat. Nos. 5,605,793; 5,811,238;
5,830,721; 5,834,252; and 5,837,458, and Patten et al., 1997, Curr.
Opinion Biotechnol., 8:724-33; Harayama, 1998, Trends Biotechnol.
16(2):76-82; Hansson et al., 1999, J. Mol. Biol., 287:265-76; and
Lorenzo and Blasco, 1998, Biotechniques 24(2):308-313 (each of
these patents and publications are hereby incorporated by reference
in its entirety). The antibody can further be a binding-domain
immunoglobulin fusion protein as described in U.S. Publication
20030118592, U.S. Publication 200330133939, and PCT Publication WO
02/056910, all to Ledbetter et al., which are incorporated herein
by reference in their entireties.
5.4. Domain Antibodies
[0256] Anti-ICOS antibodies of compositions and methods of the
invention can be domain antibodies, e.g., antibodies containing the
small functional binding units of antibodies, corresponding to the
variable regions of the heavy (V.sub.H) or light (V.sub.L) chains
of human antibodies. Examples of domain antibodies include, but are
not limited to, those available from Domantis Limited (Cambridge,
UK) and Domantis Inc. (Cambridge, Mass., USA) that are specific to
therapeutic targets (see, for example, WO04/058821; WO04/003019;
U.S. Pat. Nos. 6,291,158; 6,582,915; 6,696,245; and 6,593,081).
Commercially available libraries of domain antibodies can be used
to identify anti-ICOS domain antibodies. In certain embodiments,
anti-ICOS antibodies comprise an ICOS functional binding unit and a
Fc gamma receptor functional binding unit.
[0257] In one embodiment, an anti-ICOS domain antibody may comprise
any one of, or any combination of the CDRs of the heavy or light
chains of the JMab-136 monoclonal antibody.
[0258] In another embodiment, an anti-ICOS domain antibody may
comprise VH CDR3 of JMab-136 together with any combination of the
CDRs comprised by the heavy or light chains variable regions of the
JMab-136 monoclonal antibody. An anti-ICOS domain antibody may also
comprise VK CDR3 of JMab-136 together with any combination of the
CDRs comprised by the heavy or light chains variable regions of the
JMab-136 monoclonal antibody.
[0259] In yet another embodiment, an anti-ICOS domain antibody may
comprise VH CDR3 of JMab-136. An anti-ICOS domain antibody may also
comprise VK CDR3 of JMab-136.
5.5. Diabodies
[0260] In certain embodiments of the invention, anti-ICOS
antibodies are "diabodies". The term "diabodies" refers to small
antibody fragments with two antigen-binding sites, which fragments
comprise a heavy chain variable domain (V.sub.H) connected to a
light chain variable domain (V.sub.L) in the same polypeptide chain
(V.sub.H-V.sub.L). By using a linker that is too short to allow
pairing between the two domains on the same chain, the domains are
forced to pair with the complementary domains of another chain and
create two antigen-binding sites. Diabodies are described more
fully in, for example, EP 404,097; WO 93/11161; and Hollinger et
al., Proc. Natl. Acad. Sci. USA, 90:6444-6448 (1993).
5.6. Vaccibodies
[0261] In certain embodiments of the invention, anti-ICOS
antibodies are Vaccibodies. Vaccibodies are dimeric polypeptides.
Each monomer of a vaccibody consists of a scFv with specificity for
a surface molecule on APC connected through a hinge region and a
C.gamma.3 domain to a second scFv. In other embodiments of the
invention, vaccibodies containing as one of the scFv's an anti-ICOS
antibody fragment may be used to juxtapose those ICOS expressing
cells to be destroyed and an effector cell that mediates ADCC. For
example, see, Bogen et al., U.S. Patent Application Publication No.
20040253238.
5.7. Linear Antibodies
[0262] In certain embodiments of the invention, anti-ICOS
antibodies are linear antibodies. Linear antibodies comprise a pair
of tandem Fd segments (V.sub.H-C.sub.H1-V.sub.H-C.sub.H1) which
form a pair of antigen-binding regions. Linear antibodies can be
bispecific or monospecific. See, Zapata et al., Protein Eng.,
8(10):1057-1062 (1995).
5.8. Parent Antibody
[0263] In certain embodiments of the invention, an anti-ICOS
antibody is a parent antibody. A "parent antibody" is an antibody
comprising an amino acid sequence which may lack, or may be
deficient in, one or more amino acid residues in or adjacent to one
or more hypervariable regions thereof compared to an altered/mutant
antibody as herein disclosed. Thus, the parent antibody may have a
shorter hypervariable region than the corresponding hypervariable
region of an antibody mutant as herein disclosed. The parent
polypeptide may comprise a native antibody sequence (i.e., a
naturally occurring, including a naturally occurring allelic
variant) or an antibody sequence with pre-existing amino acid
sequence modifications (such as other insertions, deletions and/or
substitutions) of a naturally occurring sequence. The parent
antibody may be a humanized antibody or a human antibody.
5.9. Antibody Fragments
[0264] "Antibody fragments" comprise a portion of a full-length
antibody, generally the antigen binding or variable region thereof.
Examples of antibody fragments include Fab, Fab', F(ab').sub.2, and
Fv fragments; diabodies; linear antibodies; single-chain antibody
molecules; and multispecific antibodies formed from antibody
fragments.
[0265] Traditionally, these fragments were derived via proteolytic
digestion of intact antibodies (see, e.g., Morimoto et al., Journal
of Biochemical and Biophysical Methods, 24:107-117 (1992) and
Brennan et al., Science, 229:81 (1985)). However, these fragments
can now be produced directly by recombinant host cells. For
example, the antibody fragments can be isolated from the antibody
phage libraries discussed above. Fab'-SH fragments can also be
directly recovered from E. coli and chemically coupled to form
F(ab').sub.2 fragments (Carter et al., Bio/Technology, 10:163-167
(1992)). According to another approach, F(ab').sub.2 fragments can
be isolated directly from recombinant host cell culture. Other
techniques for the production of antibody fragments will be
apparent to the skilled practitioner. In other embodiments, the
antibody of choice is a single-chain Fv fragment (scFv). See, for
example, WO 93/16185. In certain embodiments, the antibody is not a
Fab fragment.
5.10. Bispecific Antibodies
[0266] Bispecific antibodies are antibodies that have binding
specificities for at least two different epitopes. Exemplary
bispecific antibodies may bind to two different epitopes of the
ICOS expressing T cell surface marker. Other such antibodies may
bind a first ICOS expressing T cell marker and further bind a
second ICOS expressing T cell surface marker. An anti-ICOS
expressing T cell marker binding arm may also be combined with an
arm which binds to a triggering molecule on a leukocyte such as a T
cell receptor molecule (e.g., CD2 or CD3), or Fc receptors for IgG
(Fc.gamma.R), so as to focus cellular defense mechanisms to the
ICOS expressing T cell. Bispecific antibodies may also be used to
localize cytotoxic agents to the ICOS expressing T cell. These
antibodies possess a ICOS expressing T cell marker-binding arm and
an arm which binds the cytotoxic agent (e.g., saporin,
anti-interferon-.alpha., vinca alkaloid, ricin A chain,
methola-exate or radioactive isotope hapten). Bispecific antibodies
can be prepared as full-length antibodies or antibody fragments
(e.g., F(ab'): bispecific antibodies).
[0267] Methods for making bispecific antibodies are known in the
art. (See, for example, Millstein et al., Nature, 305:537-539
(1983); Traunecker et al., EMBO J., 10:3655-3659 (1991); Suresh et
al., Methods in Enzymology, 121:210 (1986); Kostelny et al., J.
Immunol., 148(5):1547-1553 (1992); Hollinger et al., Proc. Natl.
Acad. Sci. USA, 90:6444-6448 (1993); Gruber et al., J. Immunol.,
152:5368 (1994); U.S. Pat. Nos. 4,474,893; 4,714,681; 4,925,648;
5,573,920; 5,601,81; 95,731,168; 4,676,980; and 4,676,980, WO
94/04690; WO 91/00360; WO 92/200373; WO 93/17715; WO 92/08802; and
EP 03089.)
[0268] In one embodiment, where an anti-ICOS antibody of
compositions and methods of the invention is bispecific, the
anti-ICOS antibody may be human or humanized and may have
specificity for human ICOS and an epitope on a T cell or may be
capable of binding to a human effector cell such as, for example, a
monocyte/macrophage and/or a natural killer cell to effect cell
death.
5.11. Variant Fc Regions
[0269] The present invention provides formulation of proteins
comprising a variant Fc region. That is, a non naturally occurring
Fc region, for example an Fc region comprising one or more non
naturally occurring amino acid residues. Also encompassed by the
variant Fc regions of present invention are Fc regions which
comprise amino acid deletions, additions and/or modifications.
[0270] It will be understood that Fc region as used herein includes
the polypeptides comprising the constant region of an antibody
excluding the first constant region immunoglobulin domain. Thus Fc
refers to the last two constant region immunoglobulin domains of
IgA, IgD, and IgG, and the last three constant region
immunoglobulin domains of IgE and IgM, and the flexible hinge
N-terminal to these domains. For IgA and IgM Fc may include the J
chain. For IgG, Fc comprises immunoglobulin domains Cgamma2 and
Cgamma3 (C.gamma.2 and C.gamma.3) and the hinge between Cgamma1
(C.gamma.1) and Cgamma2 (C.gamma.2). Although the boundaries of the
Fc region may vary, the human IgG heavy chain Fc region is usually
defined to comprise residues C226 or P230 to its carboxyl-terminus,
wherein the numbering is according to the EU index as in Kabat et
al. (1991, NIH Publication 91-3242, National Technical Information
Service, Springfield, Va.). The "EU index as set forth in Kabat"
refers to the residue numbering of the human IgG1 EU antibody as
described in Kabat et al. supra. Fc may refer to this region in
isolation, or this region in the context of an antibody, antibody
fragment, or Fc fusion protein. An Fc variant protein may be an
antibody, Fc fusion, or any protein or protein domain that
comprises an Fc region including, but not limited to, proteins
comprising variant Fc regions, which are non naturally occurring
variants of an Fc. Note: Polymorphisms have been observed at a
number of Fc positions, including but not limited to Kabat 270,
272, 312, 315, 356, and 358, and thus slight differences between
the presented sequence and sequences in the prior art may
exist.
[0271] The present invention encompasses Fc variant proteins which
have altered binding properties for an Fc ligand (e.g., an Fc
receptor, C1q) relative to a comparable molecule (e.g., a protein
having the same amino acid sequence except having a wild type Fc
region). Examples of binding properties include but are not limited
to, binding specificity, equilibrium dissociation constant
(K.sub.D), dissociation and association rates (k.sub.off and
k.sub.on respectively), binding affinity and/or avidity. It is
generally understood that a binding molecule (e.g., a Fc variant
protein such as an antibody) with a low K.sub.D may be preferable
to a binding molecule with a high K.sub.D. However, in some
instances the value of the k.sub.on or k.sub.off may be more
relevant than the value of the K.sub.D. One skilled in the art can
determine which kinetic parameter is most important for a given
antibody application.
[0272] The affinities and binding properties of an Fc domain for
its ligand may be determined by a variety of in vitro assay methods
(biochemical or immunological based assays) known in the art for
determining Fc-Fc.gamma.R interactions, i.e., specific binding of
an Fc region to an Fc.gamma.R including but not limited to,
equilibrium methods (e.g., enzyme-linked immunoabsorbent assay
(ELISA), or radioimmunoassay (RIA)), or kinetics (e.g.,
BIACORE.RTM. analysis), and other methods such as indirect binding
assays, competitive inhibition assays, fluorescence resonance
energy transfer (FRET), gel electrophoresis and chromatography
(e.g., gel filtration). These and other methods may utilize a label
on one or more of the components being examined and/or employ a
variety of detection methods including but not limited to
chromogenic, fluorescent, luminescent, or isotopic labels. A
detailed description of binding affinities and kinetics can be
found in Paul, W. E., ed., Fundamental Immunology, 4th Ed.,
Lippincott-Raven, Philadelphia (1999), which focuses on
antibody-immunogen interactions.
[0273] In one embodiment, the Fc variant protein has enhanced
binding to one or more Fc ligand relative to a comparable molecule.
In another embodiment, the Fc variant protein has an affinity for
an Fc ligand that is at least 2 fold, or at least 3 fold, or at
least 5 fold, or at least 7 fold, or a least 10 fold, or at least
20 fold, or at least 30 fold, or at least 40 fold, or at least 50
fold, or at least 60 fold, or at least 70 fold, or at least 80
fold, or at least 90 fold, or at least 100 fold, or at least 200
fold greater than that of a comparable molecule. In a specific
embodiment, the Fc variant protein has enhanced binding to an Fc
receptor. In another specific embodiment, the Fc variant protein
has enhanced binding to the Fc receptor Fc.gamma.RIIIA. In still
another specific embodiment, the Fc variant protein has enhanced
binding to the Fc receptor FcRn. In yet another specific
embodiment, the Fc variant protein has enhanced binding to C1q
relative to a comparable molecule.
[0274] The serum half-life of proteins comprising Fc regions may be
increased by increasing the binding affinity of the Fc region for
FcRn. In one embodiment, the Fc variant protein has enhanced serum
half life relative to comparable molecule.
[0275] "Antibody-dependent cell-mediated cytotoxicity" or "ADCC"
refers to a form of cytotoxicity in which secreted Ig bound onto Fc
receptors (FcRs) present on certain cytotoxic cells (e.g., Natural
Killer (NK) cells, neutrophils, and macrophages) enables these
cytotoxic effector cells to bind specifically to an antigen-bearing
target cell and subsequently kill the target cell with cytotoxins.
Specific high-affinity IgG antibodies directed to the surface of
target cells "arm" the cytotoxic cells and are absolutely required
for such killing. Lysis of the target cell is extracellular,
requires direct cell-to-cell contact, and does not involve
complement. It is contemplated that, in addition to antibodies,
other proteins comprising Fc regions, specifically Fc fusion
proteins, having the capacity to bind specifically to an
antigen-bearing target cell will be able to effect cell-mediated
cytotoxicity. For simplicity, the cell-mediated cytotoxicity
resulting from the activity of an Fc fusion protein is also
referred to herein as ADCC activity.
[0276] The ability of any particular Fc variant protein to mediate
lysis of the target cell by ADCC can be assayed. To assess ADCC
activity an Fc variant protein of interest is added to target cells
in combination with immune effector cells, which may be activated
by the antigen antibody complexes resulting in cytolysis of the
target cell. Cytolysis is generally detected by the release of
label (e.g. radioactive substrates, fluorescent dyes or natural
intracellular proteins) from the lysed cells. Useful effector cells
for such assays include peripheral blood mononuclear cells (PBMC)
and Natural Killer (NK) cells. Specific examples of in vitro ADCC
assays are described in Wisecarver et al., 1985 79:277-282;
Bruggemann et al., 1987, J Exp Med 166:1351-1361; Wilkinson et al.,
2001, J Immunol Methods 258:183-191; Patel et al., 1995 J Immunol
Methods 184:29-38. ADCC activity of the Fc variant protein of
interest may also be assessed in vivo, e.g., in a animal model such
as that disclosed in Clynes et al., 1998, Proc. Natl. Acad. Sci.
USA 95:652-656.
[0277] In one embodiment, an Fc variant protein has enhanced ADCC
activity relative to a comparable molecule. In a specific
embodiment, an Fc variant protein has ADCC activity that is at
least 2 fold, or at least 3 fold, or at least 5 fold or at least 10
fold or at least 50 fold or at least 100 fold greater than that of
a comparable molecule. In another specific embodiment, an Fc
variant protein has enhanced binding to the Fc receptor
Fc.gamma.RIIIA and has enhanced ADCC activity relative to a
comparable molecule. In other embodiments, the Fc variant protein
has both enhanced ADCC activity and enhanced serum half life
relative to a comparable molecule.
[0278] "Complement dependent cytotoxicity" and "CDC" refer to the
lysing of a target cell in the presence of complement. The
complement activation pathway is initiated by the binding of the
first component of the complement system (C1q) to a molecule, an
antibody for example, complexed with a cognate antigen. To assess
complement activation, a CDC assay, e.g. as described in
Gazzano-Santoro et al., 1996, J. Immunol. Methods, 202:163, may be
performed. In one embodiment, an Fc variant protein has enhanced
CDC activity relative to a comparable molecule. In a specific
embodiment, an Fc variant protein has CDC activity that is at least
2 fold, or at least 3 fold, or at least 5 fold or at least 10 fold
or at least 50 fold or at least 100 fold greater than that of a
comparable molecule. In other embodiments, the Fc variant protein
has both enhanced CDC activity and enhanced serum half life
relative to a comparable molecule.
[0279] In one embodiment, the present invention provides
compositions, wherein the Fc region comprises a non naturally
occurring amino acid residue at one or more positions selected from
the group consisting of 234, 235, 236, 237, 238, 239, 240, 241,
243, 244, 245, 247, 251, 252, 254, 255, 256, 262, 263, 264, 265,
266, 267, 268, 269, 279, 280, 284, 292, 296, 297, 298, 299, 305,
313, 316, 325, 326, 327, 328, 329, 330, 332, 333, 334, 339, 341,
343, 370, 373, 378, 392, 416, 419, 421, 440 and 443 as numbered by
the EU index as set forth in Kabat. Optionally, the Fc region may
comprise a non naturally occurring amino acid residue at additional
and/or alternative positions known to one skilled in the art (see,
e.g., U.S. Pat. Nos. 5,624,821; 6,277,375; 6,737,056; PCT Patent
Publications WO 01/58957; WO 02/06919; WO 04/016750; WO 04/029207;
WO 04/035752; WO 04/074455; WO 04/099249; WO 04/063351; WO
05/070963; WO 05/040217, WO 05/092925 and WO 06/020114).
[0280] In a specific embodiment, the present invention provides an
Fc variant protein composition, wherein the Fc region comprises at
least one non naturally occurring amino acid residue selected from
the group consisting of 234D, 234E, 234N, 234Q, 234T, 234H, 234Y,
234I, 234V, 234F, 235A, 235D, 235R, 235W, 235P, 235S, 235N, 235Q,
235T, 235H, 235Y, 235I, 235V, 235F, 236E, 239D, 239E, 239N, 239Q,
239F, 239T, 239H, 239Y, 240I, 240A, 240T, 240M, 241W, 241 L, 241Y,
241E, 241R, 243W, 243L 243Y, 243R, 243Q, 244H, 245A, 247L, 247V,
247G, 251F, 252Y, 254T, 255L, 256E, 256M, 262I, 262A, 262T, 262E,
263I, 263A, 263T, 263M, 264L, 264I, 264W, 264T, 264R, 264F, 264M,
264Y, 264E, 265G, 265N, 265Q, 265Y, 265F, 265V, 265I, 265L, 265H,
265T, 266I, 266A, 266T, 266M, 267Q, 267L, 268E, 269H, 269Y, 269F,
269R, 270E, 280A, 284M, 292P, 292L, 296E, 296Q, 296D, 296N, 296S,
296T, 296L, 296I, 296H, 269G, 297S, 297D, 297E, 298H, 298I, 298T,
298F, 299I, 299L, 299A, 299S, 299V, 299H, 299F, 299E, 305I, 313F,
316D, 325Q, 325L, 325I, 325D, 325E, 325A, 325T, 325V, 325H, 327G,
327W, 327N, 327L, 328S, 328M, 328D, 328E, 328N, 328Q, 328F, 328I,
328V, 328T, 328H, 328A, 329F, 329H, 329Q, 330K, 330G, 330T, 330C,
330L, 330Y, 330V, 330I, 330F, 330R, 330H, 332D, 332S, 332W, 332F,
332E, 332N, 332Q, 332T, 332H, 332Y, 332A, 339T, 370E, 370N, 378D,
392T, 396L, 416G, 419H, 421K, 440Y and 434W as numbered by the EU
index as set forth in Kabat. Optionally, the Fc region may comprise
additional and/or alternative non naturally occurring amino acid
residues known to one skilled in the art (see, e.g., U.S. Pat. Nos.
5,624,821; 6,277,375; 6,737,056; PCT Patent Publications WO
01/58957; WO 02/06919; WO 04/016750; WO 04/029207; WO 04/035752 and
WO 05/040217).
[0281] In another embodiment, the present invention provides an Fc
variant protein composition, wherein the Fc region comprises at
least a non naturally occurring amino acid at one or more positions
selected from the group consisting of 239, 330 and 332, as numbered
by the EU index as set forth in Kabat. In a specific embodiment,
the present invention provides an Fc variant protein formulation,
wherein the Fc region comprises at least one non naturally
occurring amino acid selected from the group consisting of 239D,
330L and 332E, as numbered by the EU index as set forth in Kabat.
Optionally, the Fc region may further comprise additional non
naturally occurring amino acid at one or more positions selected
from the group consisting of 252, 254, and 256, as numbered by the
EU index as set forth in Kabat. In a specific embodiment, the
present invention provides an Fc variant protein formulation,
wherein the Fc region comprises at least one non naturally
occurring amino acid selected from the group consisting of 239D,
330L and 332E, as numbered by the EU index as set forth in Kabat
and at least one non naturally occurring amino acid at one or more
positions are selected from the group consisting of 252Y, 254T and
256E, as numbered by the EU index as set forth in Kabat.
[0282] In one embodiment, the Fc variants of the present invention
may be combined with other known Fc variants such as those
disclosed in Ghetie et al., 1997, Nat. Biotech. 15:637-40; Duncan
et al, 1988, Nature 332:563-564; Lund et al., 1991, J. Immunol.
147:2657-2662; Lund et al, 1992, Mol Immunol 29:53-59; Alegre et
al, 1994, Transplantation 57:1537-1543; Hutchins et al., 1995, Proc
Natl. Acad Sci USA 92:11980-11984; Jefferis et al, 1995, Immunol
Lett. 44:111-117; Lund et al., 1995, Faseb J 9:115-119; Jefferis et
al, 1996, Immunol Lett 54:101-104; Lund et al, 1996, J Immunol
157:4963-4969; Armour et al., 1999, Eur J Immunol 29:2613-2624;
Idusogie et al, 2000, J Immunol 164:4178-4184; Reddy et al, 2000, J
Immunol 164:1925-1933; Xu et al., 2000, Cell Immunol 200:16-26;
Idusogie et al, 2001, J Immunol 166:2571-2575; Shields et al.,
2001, J Biol Chem 276:6591-6604; Jefferis et al, 2002, Immunol Lett
82:57-65; Presta et al., 2002, Biochem Soc Trans 30:487-490); U.S.
Pat. Nos. 5,624,821; 5,885,573; 5,677,425; 6,165,745; 6,277,375;
5,869,046; 6,121,022; 5,624,821; 5,648,260; 6,528,624; 6,194,551;
6,737,056; 6,821,505; 6,277,375; U.S. Patent Publication Nos.
2004/0002587 and PCT Publications WO 94/29351; WO 99/58572; WO
00/42072; WO 02/060919; WO 04/029207; WO 04/099249; WO 04/063351.
Also encompassed by the present invention are Fc regions which
comprise deletions, additions and/or modifications. Still other
modifications/substitutions/additions/deletions of the Fc domain
will be readily apparent to one skilled in the art.
[0283] Methods for generating non naturally occurring Fc regions
are known in the art. For example, amino acid substitutions and/or
deletions can be generated by mutagenesis methods, including, but
not limited to, site-directed mutagenesis (Kunkel, Proc. Natl.
Acad. Sci. USA 82:488-492 (1985)), PCR mutagenesis (Higuchi, in
"PCR Protocols: A Guide to Methods and Applications", Academic
Press, San Diego, pp. 177-183 (1990)), and cassette mutagenesis
(Wells et al., Gene 34:315-323 (1985)). Preferably, site-directed
mutagenesis is performed by the overlap-extension PCR method
(Higuchi, in "PCR Technology: Principles and Applications for DNA
Amplification", Stockton Press, New York, pp. 61-70 (1989)). The
technique of overlap-extension PCR (Higuchi, ibid.) can also be
used to introduce any desired mutation(s) into a target sequence
(the starting DNA). For example, the first round of PCR in the
overlap-extension method involves amplifying the target sequence
with an outside primer (primer 1) and an internal mutagenesis
primer (primer 3), and separately with a second outside primer
(primer 4) and an internal primer (primer 2), yielding two PCR
segments (segments A and B). The internal mutagenesis primer
(primer 3) is designed to contain mismatches to the target sequence
specifying the desired mutation(s). In the second round of PCR, the
products of the first round of PCR (segments A and B) are amplified
by PCR using the two outside primers (primers 1 and 4). The
resulting full-length PCR segment (segment C) is digested with
restriction enzymes and the resulting restriction fragment is
cloned into an appropriate vector. As the first step of
mutagenesis, the starting DNA (e.g., encoding an Fc fusion protein,
an antibody or simply an Fc region), is operably cloned into a
mutagenesis vector. The primers are designed to reflect the desired
amino acid substitution. Other methods useful for the generation of
variant Fc regions are known in the art (see, e.g., U.S. Pat. Nos.
5,624,821; 5,885,573; 5,677,425; 6,165,745; 6,277,375; 5,869,046;
6,121,022; 5,624,821; 5,648,260; 6,528,624; 6,194,551; 6,737,056;
6,821,505; 6,277,375; U.S. Patent Publication Nos. 2004/0002587 and
PCT Publications WO 94/29351; WO 99/58572; WO 00/42072; WO
02/060919; WO 04/029207; WO 04/099249; WO 04/063351).
[0284] In some embodiments, an Fc variant protein comprises one or
more engineered glycoforms, i.e., a carbohydrate composition that
is covalently attached to the molecule comprising an Fc region.
Engineered glycoforms may be useful for a variety of purposes,
including but not limited to enhancing or reducing effector
function. Engineered glycoforms may be generated by any method
known to one skilled in the art, for example by using engineered or
variant expression strains, by co-expression with one or more
enzymes, for example DI N-acetylglucosaminyltransferase III
(GnTI11), by expressing a molecule comprising an Fc region in
various organisms or cell lines from various organisms, or by
modifying carbohydrate(s) after the molecule comprising Fc region
has been expressed. Methods for generating engineered glycoforms
are known in the art, and include but are not limited to those
described in Umana et al, 1999, Nat. Biotechnol 17:176-180; Davies
et al., 20017 Biotechnol Bioeng 74:288-294; Shields et al, 2002, J
Biol Chem 277:26733-26740; Shinkawa et al., 2003, J Biol Chem
278:3466-3473) U.S. Pat. No. 6,602,684; U.S. Ser. No. 10/277,370;
U.S. Ser. No. 10/113,929; PCT WO 00/61739A1; PCT WO 01/292246A1;
PCT WO 02/311140A1; PCT WO 02/30954A1; Potillegent.TM. technology
(Biowa, Inc. Princeton, N.J.); GlycoMAb.TM. glycosylation
engineering technology (GLYCART biotechnology AG, Zurich,
Switzerland). See, e.g., WO 00061739; EA01229125; US 20030115614;
Okazaki et al., 2004, JMB, 336: 1239-49.
5.12. Glycosylation of Antibodies
[0285] In still another embodiment, the glycosylation of antibodies
utilized in accordance with the invention is modified. For example,
an aglycoslated antibody can be made (i.e., the antibody lacks
glycosylation). Glycosylation can be altered to, for example,
increase the affinity of the antibody for a target antigen. Such
carbohydrate modifications can be accomplished by, for example,
altering one or more sites of glycosylation within the antibody
sequence. For example, one or more amino acid substitutions can be
made that result in elimination of one or more variable region
framework glycosylation sites to thereby eliminate glycosylation at
that site. Such aglycosylation may increase the affinity of the
antibody for antigen. Such an approach is described in further
detail in U.S. Pat. Nos. 5,714,350 and 6,350,861. One or more amino
acid substitutions can also be made that result in elimination of a
glycosylation site present in the Fc region (e.g., Asparagine 297
of IgG). Furthermore, aglycosylated antibodies may be produced in
bacterial cells which lack the necessary glycosylation
machinery.
[0286] An antibody can also be made that has an altered type of
glycosylation, such as a hypofucosylated antibody having reduced
amounts of fucosyl residues or an antibody having increased
bisecting GlcNAc structures. Such altered glycosylation patterns
have been demonstrated to increase the ADCC ability of antibodies.
Such carbohydrate modifications can be accomplished by, for
example, expressing the antibody in a host cell with altered
glycosylation machinery. Cells with altered glycosylation machinery
have been described in the art and can be used as host cells in
which to express recombinant antibodies of the invention to thereby
produce an antibody with altered glycosylation. See, for example,
Shields, R. L. et al. (2002) J. Biol. Chem. 277:26733-26740; Umana
et al. (1999) Nat. Biotech. 17:176-1, as well as, U.S. Pat. No.
6,946,292; European Patent No: EP 1,176,195; PCT Publications WO
03/035835; WO 99/54342 each of which is incorporated herein by
reference in its entirety.
[0287] Antibodies with altered glycosylation pattern may also be
generated using lower eukaryotic host cells comprising a modified
glycosylation machinery as described in U.S. Pat. No. 7,029,872, US
Patent Publication US20060148035A1, each of which is incorporated
herein by reference in its entirety.
5.13. Engineering Effector Function
[0288] It may be desirable to modify an anti-ICOS antibody of the
invention with respect to effector function, so as to enhance the
effectiveness of the antibody in treating T cell-mediated diseases,
for example. For example, cysteine residue(s) may be introduced in
the Fc region, thereby allowing interchain disulfide bond formation
in this region. The homodimeric antibody thus generated may have
improved internalization capability and/or increased
complement-mediated cell killing and/or antibody-dependent cellular
cytotoxicity (ADCC) and/or antibody dependent phagocytosis. See,
Caron et al., J. Exp Med., 176:1191-1195 (1992) and Shopes, B., J.
Immunol., 148:2918-2922 (1992). Homodimeric antibodies with
enhanced anti-tumor activity may also be prepared using
heterobifunctional cross-linkers as described in Wolff et al,
Cancer Research, 53:2560-2565 (1993). An antibody can also be
engineered which has dual Fc regions and may thereby have enhanced
complement lysis, antibody-dependent phagocytosis and/or ADCC
capabilities. See, Stevenson et al., Anti-Cancer Drug Design,
3:219-230 (1989).
[0289] Other methods of engineering Fc regions of antibodies so as
to alter effector functions are known in the art (e.g., U.S. Patent
Publication No. 20040185045 and PCT Publication No. WO 2004/016750,
both to Koenig et al., which describe altering the Fc region to
enhance the binding affinity for Fc.gamma.RIIB as compared with the
binding affinity for FC.gamma.RIIA; see, also, PCT Publication Nos.
WO 99/58572 to Armour et al., WO 99/51642 to Idusogie et al., and
U.S. Pat. No. 6,395,272 to Deo et al.; the disclosures of which are
incorporated herein in their entireties). Methods of modifying the
Fc region to decrease binding affinity to Fc.gamma.RIIB are also
known in the art (e.g., U.S. Patent Publication No. 20010036459 and
PCT Publication No. WO 01/79299, both to Ravetch et al., the
disclosures of which are incorporated herein in their entireties).
Modified antibodies having variant Fc regions with enhanced binding
affinity for Fc.gamma.RIIIA and/or Fc.gamma.RIIA as compared with a
wildtype Fc region have also been described (e.g., PCT Publication
Nos. WO 2004/063351, to Stavenhagen et al., the disclosure of which
is incorporated herein in its entirety).
[0290] In vitro assays known in the art can be used to determine
whether anti-ICOS antibodies used in compositions and methods of
the invention are capable of mediating ADCC, CDC, and/or
antibody-dependent phagocytosis, such as those described
herein.
5.14. Manufacture/Production of Anti-ICOS Antibodies
[0291] Once a desired anti-ICOS antibody is engineered, the
anti-ICOS antibody can be produced on a commercial scale using
methods that are well-known in the art for large scale
manufacturing of antibodies. For example, this can be accomplished
using recombinant expressing systems such as, but not limited to,
those described below.
5.15. Recombinant Expression Systems
[0292] Recombinant expression of an antibody or variant thereof,
generally requires construction of an expression vector containing
a polynucleotide that encodes the antibody. Once a polynucleotide
encoding an antibody molecule or a heavy or light chain of an
antibody, or portion thereof, has been obtained, the vector for the
production of the antibody molecule may be produced by recombinant
DNA technology using techniques well-known in the art. See, e.g.,
U.S. Pat. No. 6,331,415, which is incorporated herein by reference
in its entirety. Thus, methods for preparing a protein by
expressing a polynucleotide containing an antibody encoding
nucleotide sequence are described herein. Methods which are
well-known to those skilled in the art can be used to construct
expression vectors containing antibody coding sequences and
appropriate transcriptional and translational control signals.
These methods include, for example, in vitro recombinant DNA
techniques, synthetic techniques, and in vivo genetic
recombination. The invention, thus, provides replicable vectors
comprising a nucleotide sequence encoding an antibody molecule, a
heavy or light chain of an antibody, a heavy or light chain
variable domain of an antibody or a portion thereof, or a heavy or
light chain CDR, operably linked to a promoter. Such vectors may
include the nucleotide sequence encoding the constant region of the
antibody molecule (see, e.g., International Publication Nos. WO
86/05807 and WO 89/01036; and U.S. Pat. No. 5,122,464) and the
variable domain of the antibody may be cloned into such a vector
for expression of the entire heavy, the entire light chain, or both
the entire heavy and light chains.
[0293] In another embodiment, anti-ICOS antibodies can be made
using targeted homologous recombination to produce all or portions
of the anti-ICOS antibodies (see, U.S. Pat. Nos. 6,063,630,
6,187,305, and 6,692,737). In certain embodiments, anti-ICOS
antibodies can be made using random recombination techniques to
produce all or portions of the anti-ICOS antibodies (see, U.S. Pat.
Nos. 6,361,972, 6,524,818, 6,541,221, and 6,623,958). Anti-ICOS
antibodies can also be produced in cells expressing an antibody
from a genomic sequence of the cell comprising a modified
immunoglobulin locus using Cre-mediated site-specific homologous
recombination (see, U.S. Pat. No. 6,091,001). The host cell line
may be derived from human or nonhuman species including but not
limited to mouse, and Chinese hamster. Where human or humanized
antibody production is desired, the host cell line should be a
human cell line. These methods may advantageously be used to
engineer stable cell lines which permanently express the antibody
molecule.
[0294] Once the expression vector is transferred to a host cell by
conventional techniques, the transfected cells are then cultured by
conventional techniques to produce an antibody. Thus, the invention
includes host cells containing a polynucleotide encoding an
antibody of the invention or fragments thereof, or a heavy or light
chain thereof, or portion thereof, or a single-chain antibody of
the invention, operably linked to a heterologous promoter. In
certain embodiments for the expression of double-chained
antibodies, vectors encoding both the heavy and light chains may be
co-expressed in the host cell for expression of the entire
immunoglobulin molecule, as detailed below.
[0295] A variety of host-expression vector systems may be utilized
to express an anti-ICOS antibody or portions thereof that can be
used in the engineering and generation of anti-ICOS antibodies
(see, e.g., U.S. Pat. No. 5,807,715). For example, mammalian cells
such as Chinese hamster ovary cells (CHO), in conjunction with a
vector such as the major intermediate early gene promoter element
from human cytomegalovirus is an effective expression system for
antibodies (Foecking et al., Gene, 45:101 (1986); and Cockett et
al., Bio/Technology, 8:2 (1990)). In addition, a host cell strain
may be chosen which modulates the expression of inserted antibody
sequences, or modifies and processes the antibody gene product in
the specific fashion desired. Such modifications (e.g.,
glycosylation) and processing (e.g., cleavage) of protein products
may be important for the function of the protein. Different host
cells have characteristic and specific mechanisms for the
post-translational processing and modification of proteins and gene
products. Appropriate cell lines or host systems can be chosen to
ensure the correct modification and processing of the antibody or
portion thereof expressed. To this end, eukaryotic host cells which
possess the cellular machinery for proper processing of the primary
transcript, glycosylation, and phosphorylation of the gene product
may be used. Such mammalian host cells include but are not limited
to CHO, VERY, BHK, Hela, COS, MDCK, 293, 3T3, WI 38, BT483, Hs578T,
HTB2, BT2O and T47D, NS0 (a murine myeloma cell line that does not
endogenously produce any functional immunoglobulin chains), CRL7O3O
and HsS78Bst cells.
[0296] In one embodiment, human cell lines developed by
immortalizing human lymphocytes can be used to recombinantly
produce monoclonal human anti-ICOS antibodies.
[0297] In one embodiment, the human cell line PER.C6. (Crucell,
Netherlands) can be used to recombinantly produce monoclonal human
anti-ICOS antibodies.
[0298] In bacterial systems, a number of expression vectors may be
advantageously selected depending upon the use intended for the
antibody molecule being expressed. For example, when a large
quantity of such an antibody is to be produced, for the generation
of pharmaceutical compositions comprising an anti-ICOS antibody,
vectors which direct the expression of high levels of fusion
protein products that are readily purified may be desirable. Such
vectors include, but are not limited to, the E. coli expression
vector pUR278 (Ruther et al., EMBO, 12:1791 (1983)), in which the
antibody coding sequence may be ligated individually into the
vector in frame with the lac Z coding region so that a fusion
protein is produced; pIN vectors (Inouye & Inouye, 1985,
Nucleic Acids Res. 13:3101-3109 (1985); Van Heeke & Schuster,
1989, J. Biol. Chem., 24:5503-5509 (1989)); and the like. pGEX
vectors may also be used to express foreign polypeptides as fusion
proteins with glutathione-S-transferase (GST). In general, such
fusion proteins are soluble and can easily be purified from lysed
cells by adsorption and binding to glutathione-agarose affinity
matrix followed by elution in the presence of free glutathione. The
pGEX vectors are designed to introduce athrombin and/or factor Xa
protease cleavage sites into the expressed polypeptide so that the
cloned target gene product can be released from the GST moiety.
[0299] In an insect system, Autographa californica nuclear
polyhedrosis virus (AcNPV) is used as a vector to express foreign
genes. The virus grows in Spodoptera frugiperda cells. The antibody
coding sequence may be cloned individually into non-essential
regions (for example, the polyhedrin gene) of the virus and placed
under control of an AcNPV promoter (for example, the polyhedrin
promoter).
[0300] In mammalian host cells, a number of virus based expression
systems may be utilized. In cases where an adenovirus is used as an
expression vector, the antibody coding sequence of interest may be
ligated to an adenovirus transcription/translation control complex,
e.g., the late promoter and tripartite leader sequence. This
chimeric gene may then be inserted in the adenovirus genome by in
vitro or in vivo recombination. Insertion into a non-essential
region of the viral genome (e.g., region E1 or E3) will result in a
recombinant virus that is viable and capable of expressing the
antibody molecule in infected hosts (e.g., see, Logan & Shenk,
Proc. Natl. Acad. Sci. USA, 81:355-359 (1984)). Specific initiation
signals may also be required for efficient translation of inserted
antibody coding sequences. These signals include the ATG initiation
codon and adjacent sequences. Furthermore, the initiation codon
should generally be in frame with the reading frame of the desired
coding sequence to ensure translation of the entire insert. These
exogenous translational control signals and initiation codons can
be of a variety of origins, both natural and synthetic. The
efficiency of expression may be enhanced by the inclusion of
appropriate transcription enhancer elements, transcription
terminators, etc. (see, e.g., Bittner et al., Methods in Enzymol.,
153:51-544 (1987)).
[0301] Stable expression can be used for long-term, high-yield
production of recombinant proteins. For example, cell lines which
stably express the antibody molecule may be generated. Host cells
can be transformed with an appropriately engineered vector
comprising expression control elements (e.g., promoter, enhancer,
transcription terminators, polyadenylation sites, etc.), and a
selectable marker gene. Following the introduction of the foreign
DNA, cells may be allowed to grow for 1-2 days in an enriched
media, and then are switched to a selective media. The selectable
marker in the recombinant plasmid confers resistance to the
selection and allows cells that stably integrated the plasmid into
their chromosomes to grow and form foci which in turn can be cloned
and expanded into cell lines. Plasmids that encode an anti-ICOS
antibody can be used to introduce the gene/cDNA into any cell line
suitable for production in culture.
[0302] A number of selection systems may be used, including, but
not limited to, the herpes simplex virus thymidine kinase (Wigler
et al., Cell, 11:223 (1977)), hypoxanthineguanine
phosphoribosyltransferase (Szybalska & Szybalski, Proc. Natl.
Acad. Sci. USA, 48:202 (1992)), and adenine
phosphoribosyltransferase (Lowy et al., Cell, 22:8-17 (1980)) genes
can be employed in tk.sup.-, hgprt.sup.- or aprT.sup.- cells,
respectively. Also, antimetabolite resistance can be used as the
basis of selection for the following genes: dhfr, which confers
resistance to methotrexate (Wigler et al., Natl. Acad. Sci. USA,
77:357 (1980); O'Hare et al., Proc. Natl. Acad. Sci. USA, 78:1527
(1981)); gpt, which confers resistance to mycophenolic acid
(Mulligan & Berg, Proc. Natl. Acad. Sci. USA, 78:2072 (1981));
neo, which confers resistance to the aminoglycoside G-418 (Wu and
Wu, Biotherapy 3:87-95 (1991); Tolstoshev, Ann. Rev. Pharmacol.
Toxicol. 32:573-596 (1993); Mulligan, Science 260:926-932 (1993);
and Morgan and Anderson, Ann. Rev. Biochem. 62:191-217 (1993); May,
TIB TECH 11(5):155-2 15 (1993)); and hygro, which confers
resistance to hygromycin (Santerre et al., Gene, 30:147 (1984)).
Methods commonly known in the art of recombinant DNA technology may
be routinely applied to select the desired recombinant clone, and
such methods are described, for example, in Ausubel et al. (eds.),
Current Protocols in Molecular Biology, John Wiley & Sons, NY
(1993); Kriegler, Gene Transfer and Expression, A Laboratory
Manual, Stockton Press, NY (1990); and in Chapters 12 and 13,
Dracopoli et al. (eds.), Current Protocols in Human Genetics, John
Wiley & Sons, NY (1994); Colberre-Garapin et al., 1981, J. Mol.
Biol., 150:1, which are incorporated by reference herein in their
entireties.
[0303] The expression levels of an antibody molecule can be
increased by vector amplification (for a review, see, Bebbington
and Hentschel, The use of vectors based on gene amplification for
the expression of cloned genes in mammalian cells in DNA cloning,
Vol. 3. Academic Press, New York (1987)). When a marker in the
vector system expressing antibody is amplifiable, increase in the
level of inhibitor present in culture of host cell will increase
the number of copies of the marker gene. Since the amplified region
is associated with the antibody gene, production of the antibody
will also increase (Crouse et al., Mol. Cell. Biol., 3:257 (1983)).
Antibody expression levels may be amplified through the use
recombinant methods and tools known to those skilled in the art of
recombinant protein production, including technologies that remodel
surrounding chromatin and enhance transgene expression in the form
of an active artificial transcriptional domain.
[0304] The host cell may be co-transfected with two expression
vectors, the first vector encoding a heavy chain derived
polypeptide and the second vector encoding a light chain derived
polypeptide. The two vectors may contain identical or different
selectable markers. A single vector which encodes, and is capable
of expressing, both heavy and light chain polypeptides may also be
used. In such situations, the light chain should be placed 5' to
the heavy chain to avoid an excess of toxic free heavy chain
(Proudfoot, Nature 322:562-65 (1986); and Kohler, 1980, Proc. Natl.
Acad. Sci. USA, 77:2197 (1980)). The coding sequences for the heavy
and light chains may comprise cDNA or genomic DNA.
[0305] Once an antibody molecule has been produced by recombinant
expression, it may be purified by any method known in the art for
purification of an immunoglobulin molecule, for example, by
chromatography (e.g., ion exchange, affinity, particularly by
affinity for the specific antigens Protein A or Protein G, and
sizing column chromatography), centrifugation, differential
solubility, or by any other standard technique for the purification
of proteins. Further, the antibodies of the present invention or
fragments thereof may be fused to heterologous polypeptide
sequences described herein or otherwise known in the art to
facilitate purification.
5.15.1. Antibody Purification and Isolation
[0306] When using recombinant techniques, the antibody can be
produced intracellularly, in the periplasmic space, or directly
secreted into the medium. If the antibody is produced
intracellularly, as a first step, the particulate debris, either
host cells or lysed fragments, is removed, for example, by
centrifugation or ultrafiltration. Carter et al., Bio/Technology,
10: 163-167 (1992) describe a procedure for isolating antibodies
which are secreted into the periplasmic space of E. coli. Briefly,
cell paste is thawed in the presence of sodium acetate (pH 3.5),
EDTA, and phenylmethylsulfonylfluoride (PMSF) over about 30 min.
Cell debris can be removed by centrifugation. Where the antibody
mutant is secreted into the medium, supernatants from such
expression systems are generally first concentrated using a
commercially available protein concentration filter, for example,
an Amicon or Millipore Pellicon ultrafiltration unit. A protease
inhibitor such as PMSF may be included in any of the foregoing
steps to inhibit proteolysis and antibiotics may be included to
prevent the growth of adventitious contaminants.
[0307] The antibody composition prepared from the cells can be
purified using, for example, hydroxylapatite chromatography,
hydrophobic interaction chromatography, ion exchange
chromatography, gel electrophoresis, dialysis, and/or affinity
chromatography either alone or in combination with other
purification steps. The suitability of protein A as an affinity
ligand depends on the species and isotype of any immunoglobulin Fc
domain that is present in the antibody mutant. Protein A can be
used to purify antibodies that are based on human .gamma.1,
.gamma.2, or .gamma.4 heavy chains (Lindmark et al., J. Immunol.
Methods, 62:1-13 (1983)). Protein G is recommended for all mouse
isotypes and for human .gamma.3 (Guss et al., EMBO J., 5:15671575
(1986)). The matrix to which the affinity ligand is attached is
most often agarose, but other matrices are available. Mechanically
stable matrices such as controlled pore glass or
poly(styrenedivinyl)benzene allow for faster flow rates and shorter
processing times than can be achieved with agarose. Where the
antibody comprises a CH.sub.3 domain, the Bakerbond ABX resin (J.
T. Baker, Phillipsburg, N.J.) is useful for purification. Other
techniques for protein purification such as fractionation on an
ion-exchange column, ethanol precipitation, Reverse Phase HPLC,
chromatography on silica, chromatography on heparin, SEPHAROSE
chromatography on an anion or cation exchange resin (such as a
polyaspartic acid column), chromatofocusing, SDS-PAGE, and ammonium
sulfate precipitation are also available depending on the antibody
to be recovered.
[0308] Following any preliminary purification step(s), the mixture
comprising the antibody of interest and contaminants may be
subjected to low pH hydrophobic interaction chromatography using an
elution buffer at a pH between about 2.5-4.5, and performed at low
salt concentrations (e.g., from about 0-0.25 M salt).
5.16. Therapeutic Anti-ICOS Antibodies
[0309] An anti-ICOS antibody used in compositions and methods of
the invention may be a human antibody or a humanized antibody that
may mediate T cell lineage ADCC, antibody-dependent phagocytosis
and/or CDC, or can be selected from known anti-ICOS antibodies that
may mediate T lineage cell ADCC, antibody-dependent phagocytosis
and/or CDC. In certain embodiments, anti-ICOS antibodies can be
chimeric antibodies. In certain embodiments, an anti-ICOS antibody
can be a monoclonal human, humanized, or chimeric anti-ICOS
antibody. An anti-ICOS antibody used in compositions and methods of
the invention may be a human antibody or a humanized antibody of
the IgG1 or IgG3 human isotype or any IgG1 or IgG3 allele found in
the human population. In other embodiments, an anti-ICOS antibody
used in compositions and methods of the invention can be a human
antibody or a humanized antibody of the IgG2 or IgG4 human isotype
or any IgG2 or IgG4 allele found in the human population.
[0310] While such antibodies can be generated using the techniques
described above, in other embodiments of the invention, the human
JMab-136 anti-ICOS antibody (see, U.S. Pat. No. 6,803,039) can be
modified to generate an anti-ICOS antibody with enhanced effector
function such as, but not limited to, ADCC, antibody-dependent
phagocytosis and/or CDC. For example, known anti-ICOS antibodies
that can be used include, but are not limited to, anti-human ICOS
monoclonal antibodies disclosed in U.S. Pat. No. 6,803,039, and
clone ISA-3 (eBioscience, US).
[0311] In certain embodiments, the antibody is an isotype switched
variant of a known antibody (e.g., to an IgG1 or IgG3 human
isotype) such as those described above.
[0312] An anti-ICOS antibodies used in compositions and methods of
the invention can be naked antibodies, immunoconjugates or fusion
proteins. Anti-ICOS antibodies described above for use in
compositions and methods of the invention may be able to reduce or
deplete ICOS expressing T cells and circulating immunoglobulin in a
human treated therewith. Depletion of T cells can be in circulating
T cells, or in particular tissues such as, but not limited to, bone
marrow, spleen, gut-associated lymphoid tissues, and/or lymph
nodes. Such depletion may be achieved via various mechanisms such
as antibody-dependent cell-mediated cytotoxicity (ADCC), and/or
antibody dependent phagocytosis, and/or by blocking of ICOS
interaction with its intended ligand, and/or complement dependent
cytotoxicity (CDC). By "depletion" of T cells it is meant a
reduction in circulating ICOS expressing T cells and/or ICOS
expressing T cells in particular tissue(s) by at least about 25%,
40%, 50%, 65%, 75%, 80%, 85%, 90%, 95% or more. In particular
embodiments, virtually all detectable ICOS expressing T cells are
depleted from the circulation and/or particular tissue(s). By
"depletion" of circulating immunoglobulin (Ig) it is meant a
reduction by at least about 25%, 40%, 50%, 65%, 75%, 80%, 85%, 90%,
95% or more. In particular embodiments, virtually all detectable Ig
is depleted from the circulation.
5.16.1. Screening of Antibodies for Human ICOS Binding
[0313] Binding assays can be used to identify antibodies that bind
the human ICOS antigen. Binding assays may be performed either as
direct binding assays or as competition-binding assays. Binding can
be detected using standard ELISA or standard Flow Cytometry assays.
In a direct binding assay, a candidate antibody is tested for
binding to human ICOS antigen. In certain embodiments, the
screening assays comprise, in a second step, determining the
ability to of an antibody to induce downstream signaling events in
T cells expressing human ICOS. Competition-binding assays, on the
other hand, assess the ability of a candidate antibody to compete
with a known anti-ICOS antibody or other compound that binds human
ICOS.
[0314] In a direct binding assay, the human ICOS antigen is
contacted with a candidate antibody under conditions that allow
binding of the candidate antibody to the human ICOS antigen. The
binding may take place in solution or on a solid surface. The
candidate antibody may have been previously labeled for detection.
Any detectable compound can be used for labeling, such as, but not
limited to, a luminescent, fluorescent, or radioactive isotope or
group containing same, or a nonisotopic label, such as an enzyme or
dye. After a period of incubation sufficient for binding to take
place, the reaction is exposed to conditions and manipulations that
remove excess or non-specifically bound antibody. Typically, it
involves washing with an appropriate buffer. Finally, the presence
of a ICOS-antibody complex is detected.
[0315] In a competition-binding assay, a candidate antibody is
evaluated for its ability to inhibit or displace the binding of a
known anti-ICOS antibody (or other compound) to the human ICOS
antigen. A labeled known binder of ICOS may be mixed with the
candidate antibody, and placed under conditions in which the
interaction between them would normally occur, with and without the
addition of the candidate antibody. The amount of labeled known
binder of ICOS that binds the human ICOS may be compared to the
amount bound in the presence or absence of the candidate
antibody.
[0316] In one embodiment, the binding assay is carried out with one
or more components immobilized on a solid surface to facilitate
antibody antigen complex formation and detection. In various
embodiments, the solid support could be, but is not restricted to,
polyvinylidene fluoride, polycarbonate, polystyrene, polypropylene,
polyethylene, glass, nitrocellulose, dextran, nylon, polyacrylamide
and agarose. The support configuration can include beads,
membranes, microparticles, the interior surface of a reaction
vessel such as a microtiter plate, test tube or other reaction
vessel. The immobilization of human ICOS, or other component, can
be achieved through covalent or non-covalent attachments. In one
embodiment, the attachment may be indirect, i.e., through an
attached antibody. In another embodiment, the human ICOS antigen
and negative controls are tagged with an epitope, such as
glutathione S-transferase (GST) so that the attachment to the solid
surface can be mediated by a commercially available antibody such
as anti-GST (Santa Cruz Biotechnology).
[0317] For example, such an affinity binding assay may be performed
using the human ICOS antigen which is immobilized to a solid
support. Typically, the non-mobilized component of the binding
reaction, in this case the candidate anti-ICOS antibody, is labeled
to enable detection. A variety of labeling methods are available
and may be used, such as luminescent, chromophore, fluorescent, or
radioactive isotope or group containing same, and nonisotopic
labels, such as enzymes or dyes. In one embodiment, the candidate
anti-ICOS antibody is labeled with a fluorophore such as
fluorescein isothiocyanate (FITC, available from Sigma Chemicals,
St. Louis). Such an affinity binding assay may be performed using
the human ICOS antigen immobilized on a solid surface. Anti-ICOS
antibodies are then incubated with the antigen and the specific
binding of antibodies is detected by methods known in the art
including, but not limited to, BiaCore Analyses, ELISA, FMET and
RIA methods.
[0318] Finally, the label remaining on the solid surface may be
detected by any detection method known in the art. For example, if
the candidate anti-ICOS antibody is labeled with a fluorophore, a
fluorimeter may be used to detect complexes.
[0319] The human ICOS antigen can be added to binding assays in the
form of intact cells that express human ICOS antigen, or isolated
membranes containing human ICOS antigen. Thus, direct binding to
human ICOS antigen may be assayed in intact cells in culture or in
animal models in the presence and absence of the candidate
anti-ICOS antibody. A labeled candidate anti-ICOS antibody may be
mixed with cells that express human ICOS antigen, or with crude
extracts obtained from such cells, and the candidate anti-ICOS
antibody may be added. Isolated membranes may be used to identify
candidate anti-ICOS antibodies that interact with human ICOS. For
example, in a typical experiment using isolated membranes, cells
may be genetically engineered to express human ICOS antigen.
Membranes can be harvested by standard techniques and used in an in
vitro binding assay. Labeled candidate anti-ICOS antibody (e.g.,
fluorescent labeled antibody) is bound to the membranes and assayed
for specific activity; specific binding is determined by comparison
with binding assays performed in the presence of excess unlabeled
(cold) candidate anti-ICOS antibody. Soluble human ICOS antigen may
also be recombinantly expressed and utilized in non-cell based
assays to identify antibodies that bind to human ICOS antigen. The
recombinantly expressed human ICOS polypeptides can be used in the
non-cell based screening assays. Peptides corresponding to one or
more of the binding portions of human ICOS antigen, or fusion
proteins containing one or more of the binding portions of human
ICOS antigen can also be used in non-cell based assay systems to
identify antibodies that bind to portions of human ICOS antigen. In
non-cell based assays the recombinantly expressed human ICOS is
attached to a solid substrate such as a test tube, microtiter well
or a column, by means well-known to those in the art (see, Ausubel
et al., supra). The test antibodies are then assayed for their
ability to bind to human ICOS antigen.
[0320] The binding reaction may also be carried out in solution. In
this assay, the labeled component is allowed to interact with its
binding partner(s) in solution. If the size differences between the
labeled component and its binding partner(s) permit such a
separation, the separation can be achieved by passing the products
of the binding reaction through an ultrafilter whose pores allow
passage of unbound labeled component but not of its binding
partner(s) or of labeled component bound to its partner(s).
Separation can also be achieved using any reagent capable of
capturing a binding partner of the labeled component from solution,
such as an antibody against the binding partner and so on.
[0321] In another specific embodiment, the solid support is
membrane containing human ICOS antigen attached to a microtiter
dish. Candidate antibodies, for example, can bind cells that
express library antibodies cultivated under conditions that allow
expression of the library members in the microtiter dish. Library
members that bind to the human ICOS are harvested. Such methods,
are generally described by way of example in Parmley and Smith,
1988, Gene, 73:305-318; Fowlkes et al., 1992, BioTechniques,
13:422-427; PCT Publication No. WO94/18318; and in references cited
hereinabove. Antibodies identified as binding to human ICOS antigen
can be of any of the types or modifications of antibodies described
above.
5.16.2. Screening of Antibodies for Human ADCC Effector
Function
[0322] Antibodies of the human IgG class, which have functional
characteristics such a long half-life in serum and the ability to
mediate various effector functions are used in certain embodiments
of the invention (Monoclonal Antibodies: Principles and
Applications, Wiley-Liss, Inc., Chapter 1 (1995)). The human IgG
class antibody is further classified into the following 4
subclasses: IgG1, IgG2, IgG3 and IgG4. A large number of studies
have so far been conducted for ADCC and CDC as effector functions
of the IgG class antibody, and it has been reported that among
antibodies of the human IgG class, the IgG1 subclass has the
highest ADCC activity and CDC activity in humans (Chemical
Immunology, 65, 88 (1997)).
[0323] Expression of ADCC activity and CDC activity of the human
IgG1 subclass antibodies generally involves binding of the Fc
region of the antibody to a receptor for an antibody (hereinafter
referred to as "Fc.gamma.R") existing on the surface of effector
cells such as killer cells, natural killer cells or activated
macrophages. Various complement components can be bound. Regarding
the binding, it has been suggested that several amino acid residues
in the hinge region and the second domain of C region (hereinafter
referred to as "C.gamma.2 domain") of the antibody are important
(Eur. J. Immunol., 23, 1098 (1993), Immunology, 86, 319 (1995),
Chemical Immunology, 65, 88 (1997)) and that a sugar chain in the
C.gamma.2 domain (Chemical Immunology, 65, 88 (1997)) is also
important.
[0324] Anti-ICOS antibodies can be modified with respect to
effector function, e.g., so as to enhance ADCC and/or complement
dependent cytotoxicity (CDC) of the antibody. This may be achieved
by introducing one or more amino acid substitutions in the Fc
region of an antibody. Cysteine residue(s) may also be introduced
in the Fc region, allowing for interchain disulfide bond formation
in this region. In this way a homodimeric antibody can be generated
that may have improved internalization capability and or increased
complement-mediated cell killing and ADCC (Caron et al., J. Exp.
Med., 176:1191-1195 (1992) and Shopes, J. Immunol., 148:2918-2922
(1992)). Heterobifunctional cross-linkers can also be used to
generate homodimeric antibodies with enhanced anti-tumor activity
(Wolff et al, Cancer Research, 53:2560-2565 (1993)). Antibodies can
also be engineered to have two or more Fc regions resulting in
enhanced complement lysis and ADCC capabilities (Stevenson et al.,
Anti-Cancer Drug Design, (3)219-230 (1989)).
[0325] Other methods of engineering Fc regions of antibodies so as
to alter effector functions are known in the art (e.g., U.S. Patent
Publication No. 20040185045 and PCT Publication No. WO 2004/016750,
both to Koenig et al., which describe altering the Fc region to
enhance the binding affinity for Fc.gamma.RIB as compared with the
binding affinity for FC.gamma.RIIA; see also PCT Publication Nos.
WO 99/58572 to Armour et al., WO 99/51642 to Idusogie et al., and
U.S. Pat. No. 6,395,272 to Deo et al.; the disclosures of which are
incorporated herein in their entireties). Methods of modifying the
Fc region to decrease binding affinity to Fc.gamma.RIB are also
known in the art (e.g., U.S. Patent Publication No. 20010036459 and
PCT Publication No. WO 01/79299, both to Ravetch et al., the
disclosures of which are incorporated herein in their entireties).
Modified antibodies having variant Fc regions with enhanced binding
affinity for Fc.gamma.RIIIA and/or Fc.gamma.RIIA as compared with a
wildtype Fc region have also been described (e.g., PCT Publication
No. WO 2004/063351, to Stavenhagen et al.; the disclosure of which
is incorporated herein in its entirety).
[0326] At least four different types of Fc.gamma.R have been found,
which are respectively called Fc.gamma.RI (CD64), Fc.gamma.RII
(CD32), Fc.gamma.RIII (CD16), and Fc.gamma.RIV. In human,
Fc.gamma.RII and Fc.gamma.RIII are further classified into
Fc.gamma.RIIa and Fc.gamma.RIIb, and Fc.gamma.RIIIa and
Fc.gamma.RIIIb, respectively. Fc.gamma.R is a membrane protein
belonging to the immunoglobulin superfamily, Fc.gamma.RII,
Fc.gamma.RIII, and Fc.gamma.RIV have an a chain having an
extracellular region containing two immunoglobulin-like domains,
Fc.gamma.RI has an a chain having an extracellular region
containing three immunoglobulin-like domains, as a constituting
component, and the .alpha. chain is involved in the IgG binding
activity. In addition, Fc.gamma.RI and Fc.gamma.RIII have a .gamma.
chain or .zeta. chain as a constituting component which has a
signal transduction function in association with the a chain (Annu.
Rev. Immunol., 18, 709 (2000), Annu. Rev. Immunol., 19, 275
(2001)). Fc.gamma.RIV has been described by Bruhns et al., Clin.
Invest. Med., (Canada) 27:3 D (2004).
[0327] To assess ADCC activity of an anti-ICOS antibody of
interest, an in vitro ADCC assay can be used, such as that
described in U.S. Pat. No. 5,500,362 or 5,821,337. The assay may
also be performed using a commercially available kit, e.g. CytoTox
96.RTM. (Promega). Useful effector cells for such assays include,
but are not limited to peripheral blood mononuclear cells (PBMC),
Natural Killer (NK) cells, and NK cell lines. NK cell lines
expressing a transgenic Fc receptor (e.g. CD16) and associated
signaling polypeptide (e.g. FC.epsilon.RI-.gamma.) may also serve
as effector cells (see, e.g. WO 2006/023148 A2 to Campbell). For
example, the ability of any particular antibody to mediate lysis of
the target cell by complement activation and/or ADCC can be
assayed. The cells of interest are grown and labeled in vitro; the
antibody is added to the cell culture in combination with immune
cells which may be activated by the antigen antibody complexes;
i.e., effector cells involved in the ADCC response. The antibody
can also be tested for complement activation. In either case,
cytolysis of the target cells is detected by the release of label
from the lysed cells. The extent of target cell lysis may also be
determined by detecting the release of cytoplasmic proteins (e.g.
LDH) into the supernatant. In fact, antibodies can be screened
using the patient's own serum as a source of complement and/or
immune cells. The antibodies that are capable of mediating human
ADCC in the in vitro test can then be used therapeutically in that
particular patient. ADCC activity of the molecule of interest may
also be assessed in vivo, e.g., in an animal model such as that
disclosed in Clynes et al., Proc. Natl. Acad. Sci. (USA) 95:652-656
(1998). Moreover, techniques for modulating (i.e., increasing or
decreasing) the level of ADCC, and optionally CDC activity, of an
antibody are well-known in the art. See, e.g., U.S. Pat. No.
6,194,551. Antibodies of the present invention may be capable or
may have been modified to have the ability of inducing ADCC and/or
CDC. Assays to determine ADCC function can be practiced using human
effector cells to assess human ADCC function. Such assays may also
include those intended to screen for antibodies that induce,
mediate, enhance, block cell death by necrotic and/or apoptotic
mechanisms. Such methods including assays utilizing viable dyes,
methods of detecting and analyzing caspases, and assays measuring
DNA breaks can be used to assess the apoptotic activity of cells
cultured in vitro with an anti-ICOS antibody of interest.
[0328] For example, Annexin V or TdT-mediated dUTP nick-end
labeling (TUNEL) assays can be carried out as described in Decker
et al., Blood (USA) 103:2718-2725 (2004) to detect apoptotic
activity. The TUNEL assay involves culturing the cell of interest
with fluorescein-labeled dUTP for incorporation into DNA strand
breaks. The cells are then processed for analysis by flow
cytometry. The Annexin V assay detects the appearance of
phosphatidylserine (PS) on the outside of the plasma membrane of
apoptotic cells using a fluorescein-conjugated Annexin V that
specifically recognizes the exposed PS molecules. Concurrently, a
viable dye such as propidium iodide can be used to exclude late
apoptotic cells. The cells are stained with the labeled Annexin V
and are analyzed by flow cytometry.
5.16.3. Immunoconjugates and Fusion Proteins
[0329] According to certain aspects of the invention, therapeutic
agents or toxins can be conjugated to anti-ICOS antibodies for use
in compositions and methods of the invention. In certain
embodiments, these conjugates can be generated as fusion proteins.
Examples of therapeutic agents and toxins include, but are not
limited to, members of the enediyne family of molecules, such as
calicheamicin and esperamicin. Chemical toxins can also be taken
from the group consisting of duocarmycin (see, e.g., U.S. Pat. No.
5,703,080 and U.S. Pat. No. 4,923,990), methotrexate, doxorubicin,
melphalan, chlorambucil, ARA-C, vindesine, mitomycin C,
cis-platinum, etoposide, bleomycin and 5-fluorouracil. Examples of
chemotherapeutic agents also include Adriamycin, Doxorubicin,
5-Fluorouracil, Cytosine arabinoside (Ara-C), Cyclophosphamide,
Thiotepa, Taxotere (docetaxel), Busulfan, Cytoxin, Taxol,
Methotrexate, Cisplatin, Melphalan, Vinblastine, Bleomycin,
Etoposide, Ifosfamide, mitomycin C, Mitoxantrone, Vincreistine,
Vinorelbine, Carboplatin, Teniposide, Daunomycin, Caminomycin,
Aminopterin, Dactinomycin, Mitomycins, Esperamicins (see, U.S. Pat.
No. 4,675,187), Melphalan, and other related nitrogen mustards.
[0330] In certain embodiments, anti-ICOS antibodies are conjugated
to a cytostatic, cytotoxic or immunosuppressive agent wherein the
cytotoxic agent is selected from the group consisting of an
enediyne, a lexitropsin, a duocarmycin, a taxane, a puromycin, a
dolastatin, a maytansinoid, and a vinca alkaloid. In certain, more
specific embodiments, the cytotoxic agent is paclitaxel, docetaxel,
CC-1065, SN-38, topotecan, morpholino-doxorubicin, rhizoxin,
cyanomorpholino-doxorubicin, dolastatin-10, echinomycin,
combretastatin, calicheamicin, maytansine, DM-1, auristatin E, AEB,
AEVB, AEFP, MMAE (see, U.S. patent application Ser. No.
10/983,340), or netropsin.
[0331] In certain embodiments, the cytotoxic agent of an anti-ICOS
antibody-cytotoxic agent conjugate of the invention is an
anti-tubulin agent. In specific embodiments, the cytotoxic agent is
selected from the group consisting of a vinca alkaloid, a
podophyllotoxin, a taxane, a baccatin derivative, a cryptophysin, a
maytansinoid, a combretastatin, and a dolastatin. In other
embodiments, the cytotoxic agent is vincristine, vinblastine,
vindesine, vinorelbine, VP-16, camptothecin, paclitaxel, docetaxel,
epithilone A, epithilone B, nocodazole, coichicine, colcimid,
estramustine, cemadotin, discodermolide, maytansine, DM-1, AEFP,
auristatin E, AEB, AEVB, AEFP, MMAE or eleutherobin.
[0332] In specific embodiments, an anti-ICOS antibody is conjugated
to the cytotoxic agent via a linker, wherein the linker is peptide
linker. In other embodiments, an anti-ICOS antibody is conjugated
to the cytotoxic agent via a linker, wherein the linker is a
val-cit linker, a phe-lys linker, a hydrazone linker, or a
disulfide linker.
[0333] In certain embodiments, the anti-ICOS antibody of an
anti-ICOS antibody-cytotoxic agent conjugate is conjugated to the
cytotoxic agent via a linker, wherein the linker is hydrolysable at
a pH of less than 5.5. In a specific embodiment the linker is
hydrolyzable at a pH of less than 5.0.
[0334] In certain embodiments, the anti-ICOS antibody of an
anti-ICOS antibody-cytotoxic agent conjugate is conjugated to the
cytotoxic agent via a linker, wherein the linker is cleavable by a
protease. In a specific embodiment, the protease is a lysosomal
protease. In other embodiments, the protease is, inter alia, a
membrane-associated protease, an intracellular protease, or an
endosomal protease.
[0335] Other toxins that can be used in immunoconjugates of the
invention include poisonous lectins, plant toxins such as ricin,
abrin, modeccin, botulina, and diphtheria toxins. Of course,
combinations of the various toxins could also be coupled to one
antibody molecule thereby accommodating variable cytotoxicity.
Illustrative of toxins which are suitably employed in combination
therapies of the invention are ricin, abrin, ribonuclease, DNase I,
Staphylococcal enterotoxin-A, pokeweed anti-viral protein, gelonin,
diphtherin toxin, Pseudomonas exotoxin, and Pseudomonas endotoxin.
See, for example, Pastan et al., Cell, 47:641 (1986), and
Goldenberg et al., Cancer Journal for Clinicians, 44:43 (1994).
Enzymatically active toxins and fragments thereof which can be used
include diphtheria A chain, non-binding active fragments of
diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa),
ricin A chain, abrin A chain, modeccin A chain, alpha-sarcin,
Aleurites fordii proteins, dianthin proteins, Phytolaca americana
proteins (PAPI, PAPII, and PAP-S), Momordica charantia inhibitor,
curcin, crotin, Sapaonaria officinalis inhibitor, gelonin,
mitogellin, restrictocin, phenomycin, enomycin and the
tricothecenes. See, for example, WO 93/21232 published Oct. 28,
1993.
[0336] Suitable toxins and chemotherapeutic agents are described in
Remington's Pharmaceutical Sciences, 19th Ed. (Mack Publishing Co.
1995), and in Goodman And Gilman's The Pharmacological Basis of
Therapeutics, 7th Ed. (MacMillan Publishing Co. 1985). Other
suitable toxins and/or chemotherapeutic agents are known to those
of skill in the art.
[0337] The present invention further encompasses antibodies
(including antibody fragments or variants thereof) comprising or
conjugated to a radioactive agent suitable for diagnostic purposes.
Examples of suitable radioactive materials include, but are not
limited to, iodine (.sup.121I, .sup.123I, .sup.125I, .sup.131I),
carbon (.sup.14C), sulfur (.sup.35S), tritium (.sup.3H), indium
(.sup.111In, .sup.112In, .sup.113mIn, .sup.115mIn), technetium
(.sup.99Tc, .sup.99 mTc), thallium (.sup.201Ti), gallium
(.sup.68Ga, .sup.67Ga), palladium (.sup.103Pd), molybdenum
(.sup.99Mo), xenon (.sup.135 Xe), fluorine (.sup.18F), .sup.153Sm,
.sup.177Lu, .sup.159Gd, .sup.14 Pm, .sup.14La, .sup.175Yb,
.sup.166Ho, .sup.90Y, .sup.47Sc, .sup.186Re, .sup.188Re,
.sup.142Pr, .sup.105Rh, and .sup.97Ru.
[0338] Further, an anti-ICOS antibody of the invention (including
an scFv or other molecule comprising, or alternatively consisting
of, antibody fragments or variants thereof), may be coupled or
conjugated to a radioactive metal ion utilized for therapeutic
purposes. Examples of suitable radioactive ions include, but are
not limited to, alpha-emitters such as .sup.213Bi, or other
radioisotopes such as .sup.103Pd, .sup.135Xe, .sup.131I, .sup.68Ge,
.sup.57Co, .sup.65Zn, .sup.85Sr, .sup.32P, .sup.35S, .sup.90Y,
.sup.153Sm, .sup.153Gd, .sup.169Yb, .sup.51Cr, .sup.54Mn,
.sup.75Se, .sup.113 Sn, .sup.90Y, .sup.117Tin, .sup.186Re,
.sup.188Re and .sup.166Ho. In specific embodiments, an antibody or
fragment thereof is attached to macrocyclic chelators that chelate
radiometal ions, including but not limited to, .sup.177Lu,
.sup.90Y, .sup.166Ho, and .sup.153Sm, to polypeptides. In specific
embodiments, the macrocyclic chelator is
1,4,7,10-tetraazacyclododecane-N,N',N'',N'''-tetraacetic acid
(DOTA). In other specific embodiments, the DOTA is attached to the
an antibody of the invention or fragment thereof via a linker
molecule. Examples of linker molecules useful for conjugating DOTA
to a polypeptide are commonly known in the art--see, for example,
DeNardo et al., Clin Cancer Res 4(10):2483-90, 1998; Peterson et
al., Bioconjug Chem 10(4):553-7, 1999; and Zimmerman et al., Nucl
Med Biol 26(8):943-50, 1999 which are hereby incorporated by
reference in their entirety.
[0339] An anti-ICOS antibody of the present invention may also be
used in ADEPT by conjugating the antibody to a prodrug-activating
enzyme which converts a prodrug (e.g., a peptidyl chemotherapeutic
agent, see, WO81/01145) to an active anti-cancer drug. See, for
example, WO 88/07378 and U.S. Pat. No. 4,975,278. The enzyme
component of the immunoconjugate useful for ADEPT includes any
enzyme capable of acting on a prodrug in such a way so as to covert
it into its more active, cytotoxic form.
[0340] Enzymes that are useful in the method of this invention
include, but are not limited to, alkaline phosphatase useful for
converting phosphate-containing prodrugs into free drugs;
arylsulfatase useful for converting sulfate-containing prodrugs
into free drugs; cytosine deaminase useful for converting non-toxic
5-fluorocytosine into the anti-cancer drug, 5-fluorouracil;
proteases, such as serratia protease, thermolysin, subtilisin,
carboxypeptidases and cathepsins (such as cathepsins B and L), that
are useful for converting peptide-containing prodrugs into free
drugs; D-alanylcarboxypeptidases, useful for converting prodrugs
that contain D-amino acid substituents; carbohydrate-cleaving
enzymes such as .beta.-galactosidase and neuraminidase useful for
converting glycosylated prodrugs into free drugs; .beta.-lactamase
useful for converting drugs derivatized with .alpha.-lactams into
free drugs; and penicillin amidases, such as penicillin V amidase
or penicillin G amidase, useful for converting drugs derivatized at
their amine nitrogens with phenoxyacetyl or phenylacetyl groups,
respectively, into free drugs. Antibodies with enzymatic activity,
also known in the art as "abzymes," can be used as well to convert
the prodrugs into free active drugs (see, e.g., Massey, Nature
328:457-458 (1987)). Antibody-abzyme conjugates can be prepared as
described herein for delivery of the abzyme as desired to portions
of a human affected by a ICOS expressing T cell malignancy.
[0341] Antibodies of this invention may be covalently bound to the
enzymes by techniques well-known in the art such as the use of the
heterobifunctional crosslinking reagents discussed above. Fusion
proteins comprising at least the antigen-binding region of an
anti-ICOS antibody linked to at least a functionally active portion
of an enzyme may also be constructed using recombinant DNA
techniques well-known in the art (see, e.g., Neuberger et al.,
Nature, 312:604-608 (1984)).
[0342] Covalent modifications of an anti-ICOS antibody are included
within the scope of this invention. They may be made by chemical
synthesis or by enzymatic or chemical cleavage of the antibody, if
applicable. Other types of covalent modifications of an anti-ICOS
antibody are introduced into the molecule by reacting targeted
amino acid residues of the antibody with an organic derivatizing
agent that is capable of reacting with selected side chains or the
N- or C-terminal residues.
[0343] Cysteinyl residues most commonly are reacted with
.alpha.-haloacetates (and corresponding amines), such as
chloroacetic acid or chloroacetamide, to give carboxymethyl or
carboxyamidomethyl derivatives. Similarly, iodo-reagents may also
be used. Cysteinyl residues also are derivatized by reaction with
bromotrifluoroacetone, .alpha.-bromo-.beta.-(5-imidozoyl)propionic
acid, chloroacetyl phosphate, N-alkylmaleimides, 3-nitro-2-pyridyl
disulfide, methyl 2-pyridyl disulfide, p-chloromercuribenzoate,
2-chloromercuri-4-nitrophenol, or
chloro-7-nitrobenzo-2-oxa-1,3-diazole.
[0344] Histidyl residues are derivatized by reaction with
diethylpyrocarbonate at pH 5.5-7.0 because this agent is relatively
specific for the histidyl side chain. Para-bromophenacyl bromide
also is useful; the reaction can be performed in 0.1 M sodium
cacodylate at pH 6.0.
[0345] Lysyl and amino-terminal residues are reacted with succinic
or other carboxylic acid anhydrides. Derivatization with these
agents has the effect of reversing the charge of the lysinyl
residues. Other suitable reagents for derivatizing
.alpha.-amino-containing residues and/or .epsilon.-amino-containing
residues include imidoesters such as methyl picolinimidate,
pyridoxal phosphate, pyridoxal, chloroborohydride,
trinitrobenzenesulfonic acid, 0-methylisourea, 2,4-pentanedione,
and transaminase-catalyzed reaction with glyoxylate.
[0346] Arginyl residues are modified by reaction with one or
several conventional reagents, among them phenylglyoxal,
2,3-butanedione, 1,2-cyclohexanedione, and ninhydrin.
Derivatization of arginyl residues generally requires that the
reaction be performed in alkaline conditions because of the high
pKa of the guanidine functional group. Furthermore, these reagents
may react with the .epsilon.-amino groups of lysine as well as the
arginine epsilon-amino group.
[0347] The specific modification of tyrosyl residues may be made,
with particular interest in introducing spectral labels into
tyrosyl residues by reaction with aromatic diazonium compounds or
tetranitromethane. Most commonly, N-acetylimidizole and
tetranitromethane are used to form O-acetyl tyrosyl species and
3-nitro derivatives, respectively. Tyrosyl residues are iodinated
using .sup.125I or .sup.131I to prepare labeled proteins for use in
radioimmunoassay.
[0348] Carboxyl side groups (aspartyl or glutamyl) are selectively
modified by reaction with carbodiimides (R--N.dbd.C.dbd.N--R'),
where R and R' are different alkyl groups, such as
1-cyclohexyl-3-(2-morpholinyl--4-ethyl)carbodiimide or
1-ethyl-3-(4-azonia-4,4-dimethylpentyl)carbodiimide. Furthermore,
aspartyl and glutamyl residues are converted to asparaginyl and
glutaminyl residues by reaction with ammonium ions.
[0349] Glutaminyl and asparaginyl residues are frequently
deamidated to the corresponding glutamyl and aspartyl residues,
respectively. These residues are deamidated under neutral or basic
conditions. The deamidated form of these residues falls within the
scope of this invention.
[0350] Other modifications include hydroxylation of proline and
lysine, phosphorylation of hydroxyl groups of seryl or threonyl
residues, methylation of the .alpha.-amino groups of lysine,
arginine, and histidine side chains (T. E. Creighton, Proteins:
Structure and Molecular Properties, W.H. Freeman & Co., San
Francisco, pp. 79-86 (1983)), acetylation of the N-terminal amine,
and amidation of any C-terminal carboxyl group.
[0351] Another type of covalent modification involves chemically or
enzymatically coupling glycosides to the antibody. These procedures
are advantageous in that they do not require production of the
antibody in a host cell that has glycosylation capabilities for N-
or O-linked glycosylation. Depending on the coupling mode used, the
sugar(s) may be attached to (a) arginine and histidine, (b) free
carboxyl groups, (c) free sulfhydryl groups such as those of
cysteine, (d) free hydroxyl groups such as those of serine,
threonine, or hydroxyproline, (e) aromatic residues such as those
of phenylalanine, tyrosine, or tryptophan, or (f) the amide group
of glutamine. These methods are described in WO 87/05330 published
11 Sep. 1987, and in Aplin and Wriston, CRC Crit. Rev. Biochem.,
pp. 259-306 (1981).
5.17. Chemotherapeutic Combinations
[0352] According to the invention, cancer or one or more symptoms
thereof may be prevented, treated, managed or ameliorated by the
administration of an anti-ICOS mAb in combination with the
administration of one or more therapies such as, but not limited
to, chemotherapies, radiation therapies, hormonal therapies, and/or
biological therapies/immunotherapies.
[0353] In a specific embodiment, methods of the invention encompass
the administration of one or more angiogenesis antagonists such as
but not limited to: Angiostatin (plasminogen fragment);
antiangiogenic antithrombin III; Angiozyme; ABT-627; Bay 12-9566;
Benefin; Bevacizumab; BMS-275291; cartilage-derived inhibitor
(CDI); CAI; CD59 complement fragment; CEP-7055; Col 3;
Combretastatin A-4; Endostatin (collagen XVIII fragment);
Fibronectin fragment; Gro-beta; Halofuginone; Heparinases; Heparin
hexasaccharide fragment; HMV833; Human chorionic gonadotropin
(hCG); IM-862; Interferon alpha/beta/gamma; Interferon inducible
protein (IP-10); Interleukin-12; Kringle 5 (plasminogen fragment);
Marimastat; Metalloproteinase inhibitors (TIMPs);
2-Methoxyestradiol; MMI 270 (CGS 27023A); MoAb IMC-IC11; Neovastat;
NM-3; Panzem; PI-88; Placental ribonuclease inhibitor; Plasminogen
activator inhibitor; Platelet factor-4 (PF4); Prinomastat;
Prolactin 16 kD fragment; Proliferin-related protein (PRP); PTK
787/ZK 222594; Retinoids; Solimastat; Squalamine; SS 3304; SU 5416;
SU6668; SU11248; Tetrahydrocortisol-S; tetrathiomolybdate;
thalidomide; Thrombospondin-1 (TSP-1); TNP-470; Transforming growth
factor-beta (TGF-b); Vasculostatin; Vasostatin (calreticulin
fragment); ZD6126; ZD 6474; farnesyl transferase inhibitors (FTI);
and bisphosphonates (such as but are not limited to, alendronate,
clodronate, etidronate, ibandronate, pamidronate, risedronate,
tiludronate, and zoledronate).
[0354] In a specific embodiment, methods of the invention encompass
the administration of one or more immunomodulatory agents, such as
but not limited to, chemotherapeutic agents and
non-chemotherapeutic immunomodulatory agents. Non-limiting examples
of chemotherapeutic agents include methotrexate, cyclosporin A,
leflunomide, cisplatin, ifosfamide, taxanes such as taxol and
paclitaxol, topoisomerase I inhibitors (e.g., CPT-11, topotecan,
9-AC, and GG-211), gemcitabine, vinorelbine, oxaliplatin,
5-fluorouracil (5-FU), leucovorin, vinorelbine, temodal,
cytochalasin B, gramicidin D, emetine, mitomycin, etoposide,
tenoposide, vincristine, vinblastine, colchicin, doxorubicin,
daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin,
actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine,
tetracaine, lidocaine, propranolol, and puromycin homologues, and
cytoxan. Examples of non-chemotherapeutic immunomodulatory agents
include, but are not limited to, anti-T cell receptor antibodies
(e.g., anti-CD4 antibodies (e.g., cM-T412 (Boeringer),
IDEC-CE9.1.RTM. (IDEC and SKB), mAB 4162W94, Orthoclone and
OKTcdr4a (Janssen-Cilag)), anti-CD3 antibodies (e.g., Nuvion
(Product Design Labs), OKT3 (Johnson & Johnson), or Rituxan
(IDEC)), anti-CD5 antibodies (e.g., an anti-CD5 ricin-linked
immunoconjugate), anti-CD7 antibodies (e.g., CHH-380 (Novartis)),
anti-CD8 antibodies, anti-CD40 ligand monoclonal antibodies (e.g.,
IDEC-131 (IDEC)), anti-CD52 antibodies (e.g., CAMPATH IH (Ilex)),
anti-CD2 antibodies (e.g., MEDI-507 (MedImmune, Inc., International
Publication Nos. WO 02/098370 and WO 02/069904), anti-CD11a
antibodies (e.g., Xanelim (Genentech)), and anti-B7 antibodies
(e.g., IDEC-114) (IDEC)); anti-cytokine receptor antibodies (e.g.,
anti-IFN receptor antibodies, anti-IL-2 receptor antibodies (e.g.,
Zenapax (Protein Design Labs)), anti-IL-4 receptor antibodies,
anti-IL-6 receptor antibodies, anti-IL-10 receptor antibodies, and
anti-IL-12 receptor antibodies), anti-cytokine antibodies (e.g.,
anti-IFN antibodies, anti-TNF-.alpha. antibodies, anti-IL-1.beta.
antibodies, anti-IL-6 antibodies, anti-IL-8 antibodies (e.g.,
ABX-IL-8 (Abgenix)), anti-IL-12 antibodies and anti-IL-23
antibodies)); CTLA4-immunoglobulin; LFA-3TIP (Biogen, International
Publication No. WO 93/08656 and U.S. Pat. No. 6,162,432); soluble
cytokine receptors (e.g., the extracellular domain of a TNF-.alpha.
receptor or a fragment thereof, the extracellular domain of an
IL-1.beta. receptor or a fragment thereof, and the extracellular
domain of an IL-6 receptor or a fragment thereof); cytokines or
fragments thereof (e.g., interleukin (IL)-2, IL-3, IL-4, IL-5,
IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-15, IL-23,
TNF-.alpha., TNF-.beta., interferon (IFN)-.alpha., IFN-.beta.,
IFN-.gamma., and GM-CSF); and anti-cytokine antibodies (e.g.,
anti-IL-2 antibodies, anti-IL-4 antibodies, anti-IL-6 antibodies,
anti-IL-10 antibodies, anti-IL-12 antibodies, anti-IL-15
antibodies, anti-TNF-.alpha. antibodies, and anti-IFN-.gamma.
antibodies), and antibodies that immunospecifically bind to
tumor-associated antigens (e.g., Herceptin.RTM.). In certain
embodiments, an immunomodulatory agent is an immunomodulatory agent
other than a chemotherapeutic agent. In other embodiments an
immunomodulatory agent is an immunomodulatory agent other than a
cytokine or hemapoietic such as IL-1, IL-2, IL-4, IL-12, IL-15,
TNF, IFN-.alpha., IFN-.beta., IFN-.gamma., M-CSF, G-CSF, IL-3 or
erythropoietin. In yet other embodiments, an immunomodulatory agent
is an agent other than a chemotherapeutic agent and a cytokine or
hemapoietic factor.
[0355] In a specific embodiment, methods of the invention encompass
the administration of one or more anti-inflammatory agents, such as
but not limited to, non-steroidal anti-inflammatory drugs (NSAIDs),
steroidal anti-inflammatory drugs, beta-agonists, anticholingeric
agents, and methyl xanthines. Examples of NSAIDs include, but are
not limited to, aspirin, ibuprofen, celecoxib (CELEBREX.TM.),
diclofenac (VOLTAREN.TM.), etodolac (LODINE.TM.), fenoprofen
(NALFON.TM.), indomethacin (INDOCIN.TM.), ketoralac (TORADOL.TM.),
oxaprozin (DAYPRO.TM.), nabumentone (RELAFEN.TM.), sulindac
(CLINORIL.TM.), tolmentin (TOLECTIN.TM.), rofecoxib (VIOXX.TM.),
naproxen (ALEVE.TM., NAPROSYN.TM.), ketoprofen (ACTRON.TM.) and
nabumetone (RELAFEN.TM.). Such NSAIDs function by inhibiting a
cyclooxygenase enzyme (e.g., COX-1 and/or COX-2). Examples of
steroidal anti-inflammatory drugs include, but are not limited to,
glucocorticoids, dexamethasone (DECADRON.TM.), cortisone,
hydrocortisone, prednisone (DELTASONE.TM.), prednisolone,
triamcinolone, azulfidine, and eicosanoids such as prostaglandins,
thromboxanes, and leukotrienes.
[0356] In another specific embodiment, methods of the invention
encompass the administration of one or more antiviral agents (e.g.,
amantadine, ribavirin, rimantadine, acyclovir, famciclovir,
foscarnet, ganciclovir, trifluridine, vidarabine, didanosine,
stavudine, zalcitabine, zidovudine, interferon), antibiotics (e.g.,
dactinomycin (formerly actinomycin), bleomycin, mithramycin, and
anthramycin (AMC)), anti-emetics (e.g., alprazolam, dexamethoasone,
domperidone, dronabinol, droperidol, granisetron, haloperidol,
haloperidol, iorazepam, methylprednisolone, metoclopramide,
nabilone, ondansetron, prochlorperazine), anti-fungal agents (e.g.,
amphotericin, clotrimazole, econazole, fluconazole, flucytosine,
griseofulvin, itraconazole, ketoconazole, miconazole and nystatin),
anti-parasite agents (e.g., dehydroemetine, diloxanide furoate,
emetine, mefloquine, melarsoprol, metronidazole, nifurtimox,
paromomycin, pentabidine, pentamidine isethionate, primaquine,
quinacrine, quinidine) or a combination thereof.
[0357] Specific examples of anti-cancer agents that can be used in
various embodiments of the invention, including pharmaceutical
compositions and dosage forms and kits, include, but are not
limited to: acivicin; aclarubicin; acodazole hydrochloride;
acronine; adozelesin; aldesleukin; altretamine; ambomycin;
ametantrone acetate; aminoglutethimide; amsacrine; anastrozole;
anthramycin; asparaginase; asperlin; azacitidine; azetepa;
azotomycin; batimastat; benzodepa; bicalutamide; bisantrene
hydrochloride; bisnafide dimesylate; bizelesin; bleomycin sulfate;
brequinar sodium; bropirimine; busulfan; cactinomycin; calusterone;
caracemide; carbetimer; carboplatin; carmustine; carubicin
hydrochloride; carzelesin; cedefingol; chlorambucil; cirolemycin;
cisplatin; cladribine; crisnatol mesylate; cyclophosphamide;
cytarabine; dacarbazine; dactinomycin; daunorubicin hydrochloride;
decitabine; dexormaplatin; dezaguanine; dezaguanine mesylate;
diaziquone; docetaxel; doxorubicin; doxorubicin hydrochloride;
droloxifene; droloxifene citrate; dromostanolone propionate;
duazomycin; edatrexate; eflomithine hydrochloride; elsamitrucin;
enloplatin; enpromate; epipropidine; epirubicin hydrochloride;
erbulozole; esorubicin hydrochloride; estramustine; estramustine
phosphate sodium; etanidazole; etoposide; etoposide phosphate;
etoprine; fadrozole hydrochloride; fazarabine; fenretinide;
floxuridine; fludarabine phosphate; fluorouracil; fluorocitabine;
fosquidone; fostriecin sodium; gemcitabine; gemcitabine
hydrochloride; hydroxyurea; idarubicin hydrochloride; ifosfamide;
ilmofosine; interleukin II (including recombinant interleukin II,
or rIL2), interferon alpha-2a; interferon alpha-2b; interferon
alpha-n1; interferon alpha-n3; interferon beta-I a; interferon
gamma-I b; iproplatin; irinotecan hydrochloride; lanreotide
acetate; letrozole; leuprolide acetate; liarozole hydrochloride;
lometrexol sodium; lomustine; losoxantrone hydrochloride;
masoprocol; maytansine; mechlorethamine hydrochloride; megestrol
acetate; melengestrol acetate; melphalan; menogaril;
mercaptopurine; methotrexate; methotrexate sodium; metoprine;
meturedepa; mitindomide; mitocarcin; mitocromin; mitogillin;
mitomalcin; mitomycin; mitosper; mitotane; mitoxantrone
hydrochloride; mycophenolic acid; nocodazole; nogalamycin;
ormaplatin; oxisuran; paclitaxel; pegaspargase; peliomycin;
pentamustine; peplomycin sulfate; perfosfamide; pipobroman;
piposulfan; piroxantrone hydrochloride; plicamycin; plomestane;
porfimer sodium; porfiromycin; prednimustine; procarbazine
hydrochloride; puromycin; puromycin hydrochloride; pyrazofurin;
riboprine; rogletimide; safingol; safingol hydrochloride;
semustine; simtrazene; sparfosate sodium; sparsomycin;
spirogermanium hydrochloride; spiromustine; spiroplatin;
streptonigrin; streptozocin; sulofenur; talisomycin; tecogalan
sodium; tegafur; teloxantrone hydrochloride; temoporfin;
teniposide; teroxirone; testolactone; thiamiprine; thioguanine;
thiotepa; tiazofurin; tirapazamine; toremifene citrate; trestolone
acetate; triciribine phosphate; trimetrexate; trimetrexate
glucuronate; triptorelin; tubulozole hydrochloride; uracil mustard;
uredepa; vapreotide; verteporfin; vinblastine sulfate; vincristine
sulfate; vindesine; vindesine sulfate; vinepidine sulfate;
vinglycinate sulfate; vinleurosine sulfate; vinorelbine tartrate;
vinrosidine sulfate; vinzolidine sulfate; vorozole; zeniplatin;
zinostatin; zorubicin hydrochloride. Other anti-cancer drugs
include, but are not limited to: 20-epi-1,25 dihydroxyvitamin D3;
5-ethynyluracil; abiraterone; aclarubicin; acylfulvene; adecypenol;
adozelesin; aldesleukin; ALL-TK antagonists; altretamine;
ambamustine; amidox; amifostine; aminolevulinic acid; amrubicin;
amsacrine; anagrelide; anastrozole; andrographolide; angiogenesis
inhibitors; antagonist D; antagonist G; antarelix; anti-dorsalizing
morphogenetic protein-1; antiandrogen, prostatic carcinoma;
antiestrogen; antineoplaston; antisense oligonucleotides;
aphidicolin glycinate; apoptosis gene modulators; apoptosis
regulators; apurinic acid; ara-CDP-DL-PTBA; arginine deaminase;
asulacrine; atamestane; atrimustine; axinastatin 1; axinastatin 2;
axinastatin 3; azasetron; azatoxin; azatyrosine; baccatin III
derivatives; balanol; batimastat; BCR/ABL antagonists;
benzochlorins; benzoylstaurosporine; beta lactam derivatives;
beta-alethine; betaclamycin B; betulinic acid; bFGF inhibitor;
bicalutamide; bisantrene; bisaziridinylspermine; bisnafide;
bistratene A; bizelesin; breflate; bropirimine; budotitane;
buthionine sulfoximine; calcipotriol; calphostin C; camptothecin
derivatives; canarypox IL-2; capecitabine;
carboxamide-amino-triazole; carboxyamidotriazole; CaRest M3; CARN
700; cartilage derived inhibitor; carzelesin; casein kinase
inhibitors (ICOS); castanospermine; cecropin B; cetrorelix;
chlorlns; chloroquinoxaline sulfonamide; cicaprost; cis-porphyrin;
cladribine; clomifene analogues; clotrimazole; collismycin A;
collismycin B; combretastatin A4; combretastatin analogue;
conagenin; crambescidin 816; crisnatol; cryptophycin 8;
cryptophycin A derivatives; curacin A; cyclopentanthraquinones;
cycloplatam; cypemycin; cytarabine ocfosfate; cytolytic factor;
cytostatin; dacliximab; decitabine; dehydrodidemnin B; deslorelin;
dexamethasone; dexifosfamide; dexrazoxane; dexverapamil;
diaziquone; didemnin B; didox; diethylnorspermine;
dihydro-5-azacytidine; dihydrotaxol, 9-; dioxamycin; diphenyl
spiromustine; docetaxel; docosanol; dolasetron; doxifluridine;
droloxifene; dronabinol; duocarmycin SA; ebselen; ecomustine;
edelfosine; edrecolomab; eflornithine; elemene; emitefur;
epirubicin; epristeride; estramustine analogue; estrogen agonists;
estrogen antagonists; etanidazole; etoposide phosphate; exemestane;
fadrozole; fazarabine; fenretinide; filgrastim; finasteride;
flavopiridol; flezelastine; fluasterone; fludarabine;
fluorodaunorunicin hydrochloride; forfenimex; formestane;
fostriecin; fotemustine; gadolinium texaphyrin; gallium nitrate;
galocitabine; ganirelix; gelatinase inhibitors; gemcitabine;
glutathione inhibitors; hepsulfam; heregulin; hexamethylene
bisacetamide; hypericin; ibandronic acid; idarubicin; idoxifene;
idramantone; ilmofosine; ilomastat; imidazoacridones; imiquimod;
immunostimulant peptides; insulin-like growth factor-1 receptor
inhibitor; interferon agonists; interferons; interleukins;
iobenguane; iododoxorubicin; ipomeanol, 4-; iroplact; irsogladine;
isobengazole; isohomohalicondrin B; itasetron; jasplakinolide;
kahalalide F; lamellarin-N triacetate; lanreotide; leinamycin;
lenograstim; lentinan sulfate; leptolstatin; letrozole; leukemia
inhibiting factor; leukocyte alpha interferon;
leuprolide+estrogen+progesterone; leuprorelin; levamisole;
liarozole; linear polyamine analogue; lipophilic disaccharide
peptide; lipophilic platinum compounds; lissoclinamide 7;
lobaplatin; lombricine; lometrexol; lonidamine; losoxantrone;
HMG-CoA reductase inhibitor (such as but not limited to,
Lovastatin, Pravastatin, Fluvastatin, Statin, Simvastatin, and
Atorvastatin); loxoribine; lurtotecan; lutetium texaphyrin;
lysofylline; lytic peptides; maitansine; mannostatin A; marimastat;
masoprocol; maspin; matrilysin inhibitors; matrix metalloproteinase
inhibitors; menogaril; merbarone; meterelin; methioninase;
metoclopramide; MIF inhibitor; mifepristone; miltefosine;
mirimostim; mismatched double stranded RNA; mitoguazone;
mitolactol; mitomycin analogues; mitonafide; mitotoxin fibroblast
growth factor-saporin; mitoxantrone; mofarotene; molgramostim;
monoclonal antibody, human chorionic gonadotrophin; monophosphoryl
lipid A+myobacterium cell wall sk; mopidamol; multiple drug
resistance gene inhibitor; multiple tumor suppressor 1-based
therapy; mustard anticancer agent; mycaperoxide B; mycobacterial
cell wall extract; myriaporone; N-acetyldinaline; N-substituted
benzamides; nafarelin; nagrestip; naloxone+pentazocine; napavin;
naphterpin; nartograstim; nedaplatin; nemorubicin; neridronic acid;
neutral endopeptidase; nilutamide; nisamycin; nitric oxide
modulators; nitroxide antioxidant; nitrullyn; O6-benzylguanine;
octreotide; okicenone; oligonucleotides; onapristone; ondansetron;
ondansetron; oracin; oral cytokine inducer; ormaplatin; osaterone;
oxaliplatin; oxaunomycin; paclitaxel; paclitaxel analogues;
paclitaxel derivatives; palauamine; palmitoylrhizoxin; pamidronic
acid; panaxytriol; panomifene; parabactin; pazelliptine;
pegaspargase; peldesine; pentosan polysulfate sodium; pentostatin;
pentrozole; perflubron; perfosfamide; perillyl alcohol;
phenazinomycin; phenylacetate; phosphatase inhibitors; picibanil;
pilocarpine hydrochloride; pirarubicin; piritrexim; placetin A;
placetin B; plasminogen activator inhibitor; platinum complex;
platinum compounds; platinum-triamine complex; porfimer sodium;
porfiromycin; prednisone; propyl bis-acridone; prostaglandin J2;
proteasome inhibitors; protein A-based immune modulator; protein
kinase C inhibitor; protein kinase C inhibitors, microalgal;
protein tyrosine phosphatase inhibitors; purine nucleoside
phosphorylase inhibitors; purpurins; pyrazoloacridine;
pyridoxylated hemoglobin polyoxyethylene conjugate; raf
antagonists; raltitrexed; ramosetron; ras farnesyl protein
transferase inhibitors; ras inhibitors; ras-GAP inhibitor;
retelliptine demethylated; rhenium Re 186 etidronate; rhizoxin;
ribozymes; RII retinamide; rogletimide; rohitukine; romurtide;
roquinimex; rubiginone B1; ruboxyl; safingol; saintopin; SarCNU;
sarcophytol A; sargramostim; Sdi 1 mimetics; semustine; senescence
derived inhibitor 1; sense oligonucleotides; signal transduction
inhibitors; signal transduction modulators; single chain antigen
binding protein; sizofuran; sobuzoxane; sodium borocaptate; sodium
phenylacetate; solverol; somatomedin binding protein; sonermin;
sparfosic acid; spicamycin D; spiromustine; splenopentin;
spongistatin 1; squalamine; stem cell inhibitor; stem-cell division
inhibitors; stipiamide; stromelysin inhibitors; sulfinosine;
superactive vasoactive intestinal peptide antagonist; suradista;
suramin; swainsonine; synthetic glycosaminoglycans; tallimustine;
tamoxifen methiodide; tauromustine; tazarotene; tecogalan sodium;
tegafur; tellurapyrylium; telomerase inhibitors; temoporfin;
temozolomide; teniposide; tetrachlorodecaoxide; tetrazomine;
thaliblastine; thiocoraline; thrombopoietin; thrombopoietin
mimetic; thymalfasin; thymopoietin receptor agonist; thymotrinan;
thyroid stimulating hormone; tin ethyl etiopurpurin; tirapazamine;
titanocene bichloride; topsentin; toremifene; totipotent stem cell
factor; translation inhibitors; tretinoin; triacetyluridine;
triciribine; trimetrexate; triptorelin; tropisetron; turosteride;
tyrosine kinase inhibitors; tyrphostins; UBC inhibitors; ubenimex;
urogenital sinus-derived growth inhibitory factor; urokinase
receptor antagonists; vapreotide; variolin B; vector system,
erythrocyte gene therapy; velaresol; veramine; verdins;
verteporfin; vinorelbine; vinxaltine; Vitaxin.RTM.; vorozole;
zanoterone; zeniplatin; zilascorb; and zinostatin stimalamer.
Additional anti-cancer drugs are 5-fluorouracil and leucovorin.
These two agents may be useful when used in methods employing
thalidomide and a topoisomerase inhibitor. In specific embodiments,
an anti-cancer agent is not a chemotherapeutic agent.
[0358] In more particular embodiments, the present invention also
comprises the administration of an anti-ICOS mAb in combination
with the administration of one or more therapies such as, but not
limited to, anti-cancer agents such as those disclosed in Table 1,
for the treatment of breast, ovary, melanoma, prostate, colon and
lung cancers as described above. When used in a combination
therapy, the dosages and/or the frequency of administration listed
in Table 1 may be decreased.
TABLE-US-00001 TABLE 1 Anti-cancer agents Therapeutic Agent
Dose/Administration/Formulation doxorubicin Intravenous 60-75
mg/m.sup.2 on Day 1 21 day intervals hydrochloride (Adriamycin RDF
.RTM. and Adriamycin PFS .RTM. epirubicin Intravenous 100-120
mg/m.sup.2 on Day 1 of 3-4 week cycles hydrochloride each cycle or
(Ellence .TM.) divided equally and given on Days 1-8 of the cycle
fluorousacil Intravenous How supplied: 5 mL and 10 mL vials
(containing 250 and 500 mg flourouracil respectively) docetaxel
Intravenous 60-100 mg/m.sup.2 over 1 hour Once every 3 weeks
(Taxotere .RTM.) paclitaxel Intravenous 175 mg/m.sup.2 over 3 hours
Every 3 weeks for (Taxol .RTM.) 4 courses (administered
sequentially to doxorubicin-containing combination chemotherapy)
tamoxifen citrate Oral 20-40 mg Daily (Nolvadex .RTM.) (tablet)
Dosages greater than 20 mg should be given in divided doses
(morning and evening) leucovorin intravenous How supplied: Dosage
is unclear from calcium for or 350 mg vial text. PDR 3610 injection
intramuscular injection luprolide acetate single 1 mg (0.2 mL or 20
unit Once a day Lupron .RTM.) subcutaneous mark) injection
flutamide Oral 50 mg 3 times a day at 8 hour (Eulexin .RTM.)
(capsule) (capsules contain 125 mg intervals (total daily flutamide
each) dosage 750 mg) nilutamide Oral 300 mg or 150 mg 300 mg once a
day for 30 (Nilandron .RTM.) (tablet) (tablets contain 50 or 150 mg
days followed by 150 mg nilutamide each) once a day bicalutamide
Oral 50 mg Once a day (Casodex .RTM.) (tablet) (tablets contain 50
mg bicalutamide each) progesterone Injection USP in sesame oil 50
mg/mL ketoconazole Cream 2% cream applied once or (Nizoral .RTM.)
twice daily depending on symptoms prednisone Oral Initial dosage
may vary from (tablet) 5 mg to 60 mg per day depending on the
specific disease entity being treated. estramustine Oral 14 mg/kg
of body weight Daily given in 3 or 4 phosphate (capsule) (i.e. one
140 mg capsule for divided doses sodium each 10 kg or 22 lb of body
(Emcyt .RTM.) weight) etoposide or Intravenous 5 mL of 20 mg/mL
solution VP-16 (100 mg) dacarbazine Intravenous 2-4.5 mg/kg Once a
day for 10 days. (DTIC-Dome .RTM.) May be repeated at 4 week
intervals polifeprosan 20 wafer placed 8 wafers, each containing
7.7 with carmustine in resection mg of carmustine, for a total
implant (BCNU) cavity of 61.6 mg, if size and shape (nitrosourea)
of resection cavity allows (Gliadel .RTM.) cisplatin Injection [n/a
in PDR 861] How supplied: solution of 1 mg/mL in multi-dose vials
of 50 mL and 100 mL mitomycin Injection supplied in 5 mg and 20 mg
vials (containing 5 mg and 20 mg mitomycin) gemcitabine HCl
Intravenous For NSCLC- 2 schedules 4 week schedule- (Gemzar .RTM.)
have been investigated and Days 1, 8 and 15 of each the optimum
schedule has 28-day cycle. Cisplatin not been determined
intravenously at 100 4 week schedule- mg/m.sup.2 on day 1 after the
administration intravenously infusion of Gemzar. at 1000 mg/m.sup.2
over 30 3 week schedule- minutes on 3 week schedule- Days 1 and 8
of each 21 Gemzar administered day cycle. Cisplatin at
intravenously at 1250 mg/m.sup.2 dosage of 100 mg/m.sup.2 over 30
minutes administered intravenously after administration of Gemzar
on day 1. carboplatin Intravenous Single agent therapy: Every 4
weeks (Paraplatin .RTM.) 360 mg/m.sup.2 I.V. on day 1 (infusion
lasting 15 minutes or longer) Other dosage calculations:
Combination therapy with cyclophosphamide, Dose adjustment
recommendations, Formula dosing, etc. ifosamide Intravenous 1.2
g/m.sup.2 daily 5 consecutive days (Ifex .RTM.) Repeat every 3
weeks or after recovery from hematologic toxicity topotecan
Intravenous 1.5 mg/m.sup.2 by intravenous 5 consecutive days,
hydrochloride infusion over 30 minutes starting on day 1 of 21 day
(Hycamtin .RTM.) daily course Bisphosphonates Intravenous 60 mg or
90 mg single Pamidronate or Oral infusion over 4-24 hours to
Alendronate take with correct hypercalcemia in Risedronate 6-8 oz
cancer patients water. 5 mg/d daily for 2 years and then 10 mg/d
for 9 month to prevent or control bone resorption. 5.0 mg to
prevent or control bone resorption. Lovastatin Oral 10-80 mg/day in
single or (Mevacor .TM.) two divided dose.
[0359] The invention also encompasses administration of an
anti-ICOS mAb in combination with radiation therapy comprising the
use of x-rays, gamma rays and other sources of radiation to destroy
the cancer cells. In particular embodiments, the radiation
treatment is administered as external beam radiation or teletherapy
wherein the radiation is directed from a remote source. In other
embodiments, the radiation treatment is administered as internal
therapy or brachytherapy wherein a radiaoactive source is placed
inside the body close to cancer cells or a tumor mass.
[0360] Cancer therapies and their dosages, routes of administration
and recommended usage are known in the art and have been described
in such literature as the Physician's Desk Reference (56.sup.th
ed., 2002).
5.18. Pharmaceutical Compositions
[0361] The invention also relates to immunotherapeutic compositions
and methods for the treatment of T cell-mediated diseases and
disorders in human subjects, such as, but not limited to, chronic
infection, autoimmune disease or disorder, inflammatory disease or
disorder, graft-versus-host disease (GVHD), transplant rejection,
and T cell proliferative disorder in human subjects, using
therapeutic antibodies that bind to the ICOS antigen and mediate
human ADCC.
[0362] The present invention relates to pharmaceutical compositions
comprising effector function enhanced anti-ICOS antibodies of the
IgG1 or IgG3 human isotype. The present invention also relates to
pharmaceutical compositions comprising human or humanized anti-ICOS
antibodies of the IgG2 or IgG4 human isotype that mediate human
ADCC. In certain embodiments, the present invention also relates to
pharmaceutical compositions comprising monoclonal anti-ICOS
antibodies with enhanced effectro function that can be produced by
means known in the art.
[0363] Therapeutic formulations and regimens are described for
treating human subjects diagnosed with autoimmune diseases, such
as, but not limited to, systemic lupus erythematosis, rheumatoid
arthritis, immune thrombocytopenic purpura (ITP), diabetes,
psoriasis, and hypersensitivity reactions (e.g., allergies, hay
fever, asthma, and acute edema cause type I hypersensitivity
reactions). The present invention also relates to formulations and
regimens for the treatment of human subjects diagnosed with chronic
inflammatory diseases, such as, but not limited to, inflammatory
bowel disease (Crohn's disease and ulcerative colitis), Grave's
disease, Hashimoto's thyroiditis, and diabetes mellitus.
[0364] Therapeutic formulations and regimens are described for
treating human subjects diagnosed with T cell malignancies that
derive from ICOS expressing T cells and their precursors.
[0365] In particular embodiments, anti-ICOS antibodies may mediate
ADCC, complement-dependent cellular cytoxicity, or
antibody-dependent phagocytosis. Compositions and methods of the
present invention also have the advantage of targeting a narrower
population of T cells than other T cell directed immunotherapies.
For example, anti-ICOS antibodies of the present invention may be
effective to specifically target activated T cells, for example,
but not limited to, activated T cells. Accordingly, methods and
compositions of the invention may be effective to reduce or deplete
circulating activated CD4+ T cells as well as activated CD8+ T
cells.
[0366] Accordingly, in one aspect, the invention provides
compositions and methods for the treatment and prevention of GVHD
and graft rejection, which are associated with fewer and/or less
severe complications than less-targeted therapeutic agents and
regimens. In one embodiment, compositions and methods of the
invention are used with lower doses of traditional therapeutic
agents than would be possible in the absence of the methods and
compositions of the invention. In another embodiment, compositions
and methods of the invention obviate the need for a more severe
form of therapy, such as radiation therapy, high-dose chemotherapy,
or splenectomy.
[0367] In certain embodiments, anti-ICOS antibodies and
compositions may be administered to a transplant recipient patient
prior to or following transplantation, alone or in combination with
other therapeutic agents or regimens for the treatment or
prevention of GVHD and graft rejection. For example, anti-ICOS
antibodies and compositions may be used to deplete activated T
cells from a transplant recipient prior to or following
transplantation of an allogeneic graft. Anti-ICOS antibodies and
compositions may also be used to deplete activated T cells from the
graft ex vivo, prior to transplantation, or in the donor, or as
prophylaxis against GVHD and graft rejection.
5.19. Pharmaceutical Formulations, Administration and Dosing
[0368] Pharmaceutical formulations of the invention contain as the
active ingredient anti-ICOS antibodies with enhanced effector
function. The formulations contain naked antibody, immunoconjugate,
or fusion protein in an amount effective for producing the desired
response in a unit of weight or volume suitable for administration
to a human patient, and are preferably sterile. The response can,
for example, be measured by determining the physiological effects
of the anti-ICOS antibody composition, such as, but not limited to,
T cell depletion, IL-17 depletion, regression of a T cell
malignancy, or decrease of disease symptoms. Other assays will be
known to one of ordinary skill in the art and can be employed for
measuring the level of the response.
5.19.1. Pharmaceutical Formulations
[0369] A composition comprising an anti-ICOS antibody with enhanced
effector function may be formulated with a pharmaceutically
acceptable carrier. The term "pharmaceutically acceptable" means
one or more non-toxic materials that do not interfere with the
effectiveness of the biological activity of the active ingredients.
Such preparations may routinely contain salts, buffering agents,
preservatives, compatible carriers, and optionally other
therapeutic agents. Such pharmaceutically acceptable preparations
may also routinely contain compatible solid or liquid fillers,
diluents or encapsulating substances which are suitable for
administration into a human. When used in medicine, the salts
should be pharmaceutically acceptable, but non-pharmaceutically
acceptable salts may conveniently be used to prepare
pharmaceutically acceptable salts thereof and are not excluded from
the scope of the invention. Such pharmacologically and
pharmaceutically acceptable salts include, but are not limited to,
those prepared from the following acids: hydrochloric, hydrobromic,
sulfuric, nitric, phosphoric, maleic, acetic, salicylic, citric,
boric, formic, malonic, succinic, and the like. Also,
pharmaceutically acceptable salts can be prepared as alkaline metal
or alkaline earth salts, such as sodium, potassium or calcium
salts. The term "carrier" denotes an organic or inorganic
ingredient, natural or synthetic, with which the active ingredient
is combined to facilitate the application. The components of the
pharmaceutical compositions also are capable of being co-mingled
with the antibodies of the present invention, and with each other,
in a manner such that there is no interaction which would
substantially impair the desired pharmaceutical efficacy.
[0370] According to certain aspects of the invention, anti-ICOS
antibody compositions can be prepared for storage by mixing the
antibody or immunoconjugate having the desired degree of purity
with optional physiologically acceptable carriers, excipients or
stabilizers (Remington's Pharmaceutical Sciences, 16th edition,
Osol, A. Ed. (1999)), in the form of lyophilized formulations or
aqueous solutions. Acceptable carriers, excipients, or stabilizers
are nontoxic to recipients at the dosages and concentrations
employed, and include buffers such as histidine, phosphate,
citrate, and other organic acids; antioxidants including ascorbic
acid and methionine; preservatives (such as octadecyldimethylbenzyl
ammonium chloride; hexamethonium chloride; benzalkonium chloride,
benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl
parabens such as methyl or propyl paraben; catechol; resorcinol;
cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less
than about 10 residues) polypeptide; proteins, such as serum
albumin, gelatin, or immunoglobulins; hydrophilic polymers such as
polyvinylpyrolidone; amino acids such as glycine, glutamine,
asparagine, histidine, arginine, or lysine; monosaccharides,
disaccharides, and other carbohydrates including trehalose,
glucose, mannose, or dextrins; chelating agents such as EDTA;
sugars such as sucrose, mannitol, trehalose or sorbitol;
salt-forming counter-ions such as sodium; metal complexes (e.g.,
Zn-protein complexes); and/or non-ionic surfactants such as TWEEN,
polysorbate 80, PLURONICS.TM. or polyethylene glycol (PEG).
[0371] Anti-ICOS antibody compositions also may contain,
optionally, suitable preservatives, such as: benzalkonium chloride;
chlorobutanol; parabens and thimerosal.
[0372] Anti-ICOS antibody compositions may conveniently be
presented in unit dosage form and may be prepared by any of the
methods well-known in the art of pharmacy. All methods include the
step of bringing the active agent into association with a carrier
which constitutes one or more accessory ingredients. In general,
anti-ICOS antibody compositions are prepared by uniformly and
intimately bringing the active compound into association with a
liquid carrier, a finely divided solid carrier, or both, and then,
if necessary, shaping the product.
[0373] Compositions suitable for parenteral administration
conveniently comprise a sterile aqueous or non-aqueous preparation
of anti-ICOS antibody, which may be isotonic with the blood of the
recipient. This preparation may be formulated according to known
methods using suitable dispersing or wetting agents and suspending
agents. The sterile injectable preparation also may be a sterile
injectable solution or suspension in a non-toxic parenterally
acceptable diluent or solvent, for example, as a solution in
1,3-butanediol. Among the acceptable vehicles and solvents that may
be employed are water, Ringer's solution, and isotonic sodium
chloride solution. In addition, sterile, fixed oils are
conventionally employed as a solvent or suspending medium. For this
purpose any bland fixed oil may be employed including synthetic
mono- or di-glycerides. In addition, fatty acids such as oleic acid
may be used in the preparation of injectables. Carrier formulation
suitable for oral, subcutaneous, intravenous, intramuscular, etc.
administration can be found in Remington's Pharmaceutical Sciences,
Mack Publishing Co., Easton, Pa. In certain embodiments, carrier
formulation suitable for various routes of administration can be
the same or similar to that described for RITUXAN.TM.. See,
Physicians'Desk Reference (Medical Economics Company, Inc.,
Montvale, N.J., 2005), pp. 958-960 and 1354-1357, which is
incorporated herein by reference in its entirety. In certain
embodiments of the invention, anti-ICOS antibody compositions are
formulated for intravenous administration with sodium chloride,
sodium citrate dihydrate, polysorbate 80, and sterile water where
the pH of the composition is adjusted to approximately 6.5. Those
of skill in the art are aware that intravenous injection provides a
useful mode of administration due to the thoroughness of the
circulation in rapidly distributing antibodies. Intravenous
administration, however, is subject to limitation by a vascular
barrier comprising endothelial cells of the vasculature and the
subendothelial matrix. Still, the vascular barrier is a more
notable problem for the uptake of therapeutic antibodies by solid
tumors. Lymphomas have relatively high blood flow rates,
contributing to effective antibody delivery. Intralymphatic routes
of administration, such as subcutaneous or intramuscular injection,
or by catheterization of lymphatic vessels, also provide a useful
means of treating T cell-mediated diseases and disorders. In
certain embodiments, anti-ICOS antibodies of compositions and
methods of the invention are self-administered subcutaneously. In
such embodiments, the composition is formulated as a lyophilized
drug or in a liquid buffer (e.g., histidine buffer, PBS, citrate)
at about 50 mg/mL.
[0374] The formulation herein may also contain more than one active
compound as necessary for the particular indication being treated,
preferably those with complementary activities that do not
adversely affect each other. For example, it may be desirable to
further provide an immunosuppressive agent. Such molecules are
suitably present in combination in amounts that are effective for
the purpose intended.
[0375] The active ingredients may also be entrapped in microcapsule
prepared, for example, by coacervation techniques or by interfacial
polymerization, for example, hydroxymethylcellulose or
gelatin-microcapsule and poly-(methylmethacylate) microcapsule,
respectively, in colloidal drug delivery systems (for example,
liposomes, albumin microspheres, microemulsions, nano-particles and
nanocapsules) or in macroemulsions. Such techniques are disclosed
in Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed.
(1980).
[0376] The formulations to be used for in vivo administration are
typically sterile. This is readily accomplished by filtration
through sterile filtration membranes.
[0377] Sustained-release preparations may be prepared. Suitable
examples of sustained-release preparations include semipermeable
matrices of solid hydrophobic polymers containing an anti-ICOS
antibody, which matrices are in the form of shaped articles, e.g.,
films, or microcapsule. Examples of sustained-release matrices
include polyesters, hydrogels (for example,
poly(2-hydroxyethyl-methacrylate), or poly(vinylalcohol)),
polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic
acid and .gamma.-ethyl-L-glutamate, non-degradable ethylene-vinyl
acetate, degradable lactic acid-glycolic acid copolymers such as
the LUPRON DEPOT.TM. (injectable microspheres composed of lactic
acid-glycolic acid copolymer and leuprolide acetate), and
poly-D-(-)-3-hydroxybutyric acid. While polymers such as
ethylene-vinyl acetate and lactic acid-glycolic acid enable release
of molecules for over 100 days, certain hydrogels release proteins
for shorter time periods. When encapsulated antibodies remain in
the body for a long time, they may denature or aggregate as a
result of exposure to moisture at 37.degree. C., resulting in a
loss of biological activity and possible changes in immunogenicity.
Rational strategies can be devized for stabilization depending on
the mechanism involved. For example, if the aggregation mechanism
is discovered to be intermolecular S--S bond formation through
thio-disulfide interchange, stabilization may be achieved by
modifying sulfhydryl residues, lyophilizing from acidic solutions,
controlling moisture content, using appropriate additives, and
developing specific polymer matrix compositions. In certain
embodiments, the pharmaceutically acceptable carriers used in
compositions of the invention do not affect human ADCC or CDC.
[0378] Anti-ICOS antibody compositions disclosed herein may also be
formulated as immunoliposomes. A "liposome" is a small vesicle
composed of various types of lipids, phospholipids and/or
surfactant which is useful for delivery of a drug (such as
anti-ICOS antibodies disclosed herein) to a human. The components
of the liposome are commonly arranged in a bilayer formation,
similar to the lipid arrangement of biological membranes. Liposomes
containing antibodies of the invention are prepared by methods
known in the art, such as described in Epstein et al., Proc. Natl.
Acad. Sci. USA, 82:3688 (1985); Hwang et al., Proc. Natl. Acad.
Sci. USA, 77:4030 (1980); and U.S. Pat. Nos. 4,485,045 and
4,544,545. Liposomes with enhanced circulation time are disclosed
in U.S. Pat. No. 5,013,556. Particularly useful liposomes can be
generated by the reverse phase evaporation method with a lipid
composition comprising phosphatidylcholine, cholesterol and
PEG-derivatized phosphatidylethanolamine (PEG-PE). Liposomes are
extruded through filters of defined pore size to yield liposomes
with the desired diameter. The antibody of the present invention
can be conjugated to the liposomes as described in Martin et al.,
J. Biol. Chem., 257:286-288 (1982) via a disulfide interchange
reaction. A therapeutic agent can also be contained within the
liposome. See, Gabizon et al., J. National Cancer Inst., (19)1484
(1989).
[0379] Some of the pharmaceutical formulations include, but are not
limited to:
[0380] (a) a sterile, preservative-free liquid concentrate for
intravenous (i.v.) administration of anti-ICOS antibody, supplied
at a concentration of 10 mg/ml in either 100 mg (10 mL) or 500 mg
(50 mL) single-use vials. The product can be formulated for i.v.
administration using sodium chloride, sodium citrate dihydrate,
polysorbate and sterile water for injection. For example, the
product can be formulated in 9.0 mg/mL sodium chloride, 7.35 mg/mL
sodium citrate dihydrate, 0.7 mg/mL polysorbate 80, and sterile
water for injection. The pH is adjusted to 6.5.
[0381] (b) A sterile, lyophilized powder in single-use glass vials
for subcutaneous (s.c.) injection. The product can be formulated
with sucrose, L-histidine hydrochloride monohydrate, L-histidine
and polysorbate 20. For example, each single-use vial can contain
150 mg anti-ICOS antibody, 123.2 mg sucrose, 6.8 mg L-histidine
hydrochloride monohydrate, 4.3 mg L-histidine, and 3 mg polysorbate
20. Reconstitution of the single-use vial with 1.3 ml sterile water
for injection yields approximately 1.5 ml solution to deliver 125
mg per 1.25 ml (100 mg/ml) of antibody.
[0382] (c) A sterile, preservative-free lyophilized powder for
intravenous (i.v.) administration. The product can be formulated
with .alpha.-trehalose dihydrate, L-histidine HCl, histidine and
polysorbate 20 USP. For example, each vial can contain 440 mg
anti-ICOS antibody, 400 mg .alpha.,.alpha.-trehalose dihydrate, 9.9
mg L-histidine HCl, 6.4 mg L-histidine, and 1.8 mg polysorbate 20,
USP. Reconstitution with 20 ml of bacteriostatic water for
injection (BWFI), USP, containing 1.1% benzyl alcohol as a
preservative, yields a multi-dose solution containing 21 mg/ml
antibody at a pH of approximately 6.
[0383] (d) A sterile, lyophilized powder for intravenous infusion
in which an anti-ICOS antibody is formulated with sucrose,
polysorbate, monobasic sodium phosphate monohydrate, and dibasic
sodium phosphate dihydrate. For example, each single-use vial can
contain 100 mg antibody, 500 mg sucrose, 0.5 mg polysorbate 80, 2.2
mg monobasic sodium phosphate monohydrate, and 6.1 mg dibasic
sodium phosphate dihydrate. No preservatives are present. Following
reconstitution with 10 ml sterile water for injection, USP, the
resulting pH is approximately 7.2.
[0384] (e) A sterile, preservative-free solution for subcutaneous
administration supplied in a single-use, 1 ml pre-filled syringe.
The product can be formulated with sodium chloride, monobasic
sodium phosphate dihydrate, dibasic sodium phosphate dihydrate,
sodium citrate, citric acid monohydrate, mannitol, polysorbate 80
and water for injection, USP. Sodium hydroxide may be added to
adjust pH to about 5.2.
[0385] For example, each syringe can be formulated to deliver 0.8
ml (40 mg) of drug product. Each 0.8 ml contains 40 mg anti-ICOS
antibody, 4.93 mg sodium chloride, 0.69 mg monobasic sodium
phosphate dihydrate, 1.22 mg dibasic sodium phosphate dihydrate,
0.24 mg sodium citrate, 1.04 citric acid monohydrate, 9.6 mg
mannitol, 0.8 mg polysorbate 80 and water for injection, USP.
[0386] (f) A sterile, preservative-free, lyophilized powder
contained in a single-use vial that is reconstituted with sterile
water for injection (SWFI), USP, and administered as a subcutaneous
(s.c.) injection. The product can be formulated with sucrose,
histidine hydrochloride monohydrate, L-histidine, and polysorbate.
For example, a 75 mg vial can contain 129.6 mg or 112.5 mg of an
anti-ICOS antibody, 93.1 mg sucrose, 1.8 mg L-histidine
hydrochloride monohydrate, 1.2 mg L-histidine, and 0.3 mg
polysorbate 20, and is designed to deliver 75 mg of the antibody in
0.6 ml after reconstitution with 0.9 ml SWFI, USP. A 150 mg vial
can contain 202.5 mg or 175 mg anti-ICOS antibody, 145.5 mg
sucrose, 2.8 mg L-histidine hydrochloride monohydrate, 1.8 mg
L-histidine, and 0.5 mg polysorbate 20, and is designed to deliver
150 mg of the antibody in 1.2 ml after reconstitution with 1.4 ml
SWFI, USP.
[0387] (g) A sterile, hyophilized product for reconstitution with
sterile water for injection. The product can be formulated as
single-use vials for intramuscular (IM) injection using mannitol,
histidine and glycine. For example, each single-use vial can
contain 100 mg anti-ICOS antibody, 67.5 mg of mannitol, 8.7 mg
histidine and 0.3 mg glycine, and is designed to deliver 100 mg
antibody in 1.0 ml when reconstituted with 1.0 ml sterile water for
injection. As another example, each single-use vial can contain 50
mg anti-ICOS antibody, 40.5 mg mannitol, 5.2 mg histidine and 0.2
mg glycine, and is designed to deliver 50 mg of antibody when
reconstituted with 0.6 ml sterile water for injection.
[0388] (h) A sterile, preservative-free solution for intramuscular
(IM) injection, supplied at a concentration of 100 mg/ml. The
product can be formulated in single-use vials with histidine,
glycine, and sterile water for injection. For example, each
single-use vial can be formulated with 100 mg antibody, 4.7 mg
histidine, and 0.1 mg glycine in a volume of 1.2 ml designed to
deliver 100 mg of antibody in 1 ml. As another example, each
single-use vial can be formulated with 50 mg antibody, 2.7 mg
histidine and 0.08 mg glycine in a volume of 0.7 ml or 0.5 ml
designed to deliver 50 mg of antibody in 0.5 ml.
[0389] In certain embodiments, a pharmaceutical composition of the
invention is stable at 4.degree. C. In certain embodiments, a
pharmaceutical composition of the invention is stable at room
temperature.
[0390] In one embodiment, a liquid formulation of the invention is
an aqueous formulation. In a specific embodiment, a liquid
formulation of the invention is an aqueous formulation wherein the
aqueous carrier is distilled water.
[0391] In one embodiment, a formulation of the invention is
sterile. In one embodiment, a formulation of the invention is
homogeneous. In one embodiment, a formulation of the invention is
isotonic.
[0392] In one embodiment, a formulation of the invention comprises
at least about 1 mg/ml, at least about 5 mg/ml, at least about 10
mg/ml, at least about 20 mg/ml, at least about 30 mg/ml, at least
about 40 mg/ml, at least about 50 mg/ml, at least about 60 mg/ml,
at least about 70 mg/ml, at least about 80 mg/ml, at least about 90
mg/ml, at least about 100 mg/ml, at least about 110 mg/ml, at least
about 120 mg/ml, at least about 130 mg/ml, at least about 140
mg/ml, at least about 150 mg/ml, at least about 160 mg/ml, at least
about 170 mg/ml, at least about 180 mg/ml, at least about 190
mg/ml, at least about 200 mg/ml, or at least about 300 mg/ml of an
anti-ICOS antibody or a fragment thereof.
[0393] Optionally, the formulations of the invention may comprise
common excipients and/or additives such as buffering agents,
saccharides, salts and surfactants. Additionally or alternatively,
the formulations of the invention may further comprise common
excipients and/or additives, such as, but not limited to,
solubilizers, diluents, binders, stabilizers, salts, lipophilic
solvents, amino acids, chelators, preservatives, or the like.
[0394] In certain embodiments, the buffering agent is selected from
the group consisting of histidine, citrate, phosphate, glycine, and
acetate. In other embodiments the saccharide excipient is selected
from the group consisting of trehalose, sucrose, mannitol, maltose
and raffinose. In still other embodiments the surfactant is
selected from the group consisting of polysorbate 20, polysorbate
40, polysorbate 80, and Pluronic F68. In yet other embodiments the
salt is selected from the group consisting of NaCl, KCl,
MgCl.sub.2, and CaCl.sub.2
[0395] Optionally, the formulations of the invention may further
comprise other common auxiliary components, such as, but not
limited to, suitable excipients, polyols, solubilizers, diluents,
binders, stabilizers, lipophilic solvents, chelators,
preservatives, or the like.
[0396] The formulations of the invention include a buffering or pH
adjusting agent to provide improved pH control. In one embodiment,
a formulation of the invention has a pH of between about 3.0 and
about 9.0, between about 4.0 and about 8.0, between about 5.0 and
about 8.0, between about 5.0 and about 7.0, between about 5.0 and
about 6.5, between about 5.5 and about 8.0, between about 5.5 and
about 7.0, or between about 5.5 and about 6.5. In a further
embodiment, a formulation of the invention has a pH of about 3.0,
about 3.5, about 4.0, about 4.5, about 5.0, about 5.1, about 5.2,
about 5.3, about 5.4, about 5.5, about 5.6, about 5.7, about 5.8,
about 5.9, about 6.0, about 6.1, about 6.2, about 6.3, about 6.4,
about 6.5, about 6.6, about 6.7, about 6.8, about 6.9, about 7.0,
about 7.5, about 8.0, about 8.5, or about 9.0. In a specific
embodiment, a formulation of the invention has a pH of about
6.0.
[0397] The pH of the formulation generally should not be equal to
the isoelectric point of the particular antibody (including
antibody fragment thereof) to be used in the formulation (for
example, but not limited to, the isoelectric point of 13H5, 13H7 or
7H9) and may range from about 4.0 to about 8.0, or may range from
about 5.5 to about 6.5.
[0398] Typically, the buffering agent is a salt prepared from an
organic or inorganic acid or base. Representative buffering agents
include, but are not limited to, organic acid salts such as salts
of citric acid, ascorbic acid, gluconic acid, carbonic acid,
tartaric acid, succinic acid, acetic acid, or phthalic acid; Tris,
tromethamine hydrochloride, or phosphate buffers. In addition,
amino acid components can also function in a buffering capacity.
Representative amino acid components which may be utilized in the
formulations of the invention as buffering agents include, but are
not limited to, glycine and histidine. In certain embodiments, the
buffering agent is selected from the group consisting of histidine,
citrate, phosphate, glycine, and acetate. In a specific embodiment,
the buffering agent is histidine. In another specific embodiment,
the buffering agent is citrate. The purity of the buffering agent
should be at least 98%, or at least 99%, or at least 99.5%. As used
herein, the term "purity" in the context of histidine refers to
chemical purity of histidine as understood in the art, e.g., as
described in The Merck Index, 13.sup.th ed., O'Neil et al. ed.
(Merck & Co., 2001).
[0399] Buffering agents are typically used at concentrations
between about 1 mM and about 200 mM or any range or value therein,
depending on the desired ionic strength and the buffering capacity
required. The usual concentrations of conventional buffering agents
employed in parenteral formulations can be found in: Pharmaceutical
Dosage Form: Parenteral Medications, Volume 1, 2.sup.nd Edition,
Chapter 5, p. 194, De Luca and Boylan, "Formulation of Small Volume
Parenterals", Table 5: Commonly used additives in Parenteral
Products. In certain embodiments, a formulation of the invention
comprises a buffering agent. In one embodiment, said buffering
agent is selected from the group consisting of histidine, citrate,
phosphate, glycine, and acetate. In a specific embodiment, a
formulation of the invention comprises histidine as a buffering
agent. In a further embodiment, a formulation of the invention
comprises a citrate buffer.
[0400] In one embodiment, a formulation of the invention comprises
at least about 1 mM, at least about 5 mM, at least about 10 mM, at
least about 20 mM, at least about 30 mM, at least about 40 mM, at
least about 50 mM, at least about 75 mM, at least about 100 mM, at
least about 150 mM, or at least about 200 mM buffering agent.
[0401] In certain embodiments, the formulations of the invention
comprise a carbohydrate excipient. Carbohydrate excipients can act,
e.g., as viscosity enhancing agents, stabilizers, bulking agents,
solubilizing agents, and/or the like. Carbohydrate excipients are
generally present at between about 1% to about 99% by weight or
volume. In one embodiment, the carbohydrate excipient is present at
between about 0.1% to about 20%. In another embodiment, the
carbohydrate excipient is present at between about 0.1% to about
15%. In a specific embodiment, the carbohydrate excipient is
present at between about 0.1% to about 5%, or between about 1% to
about 20%, or between about 5% to about 15%, or between about 8% to
about 10%, or between about 10% and about 15%, or between about 15%
and about 20%. In another specific embodiment, the carbohydrate
excipient is present at between 0.1% to 20%, or between 5% to 15%,
or between 8% to 10%, or between 10% and 15%, or between 15% and
20%. In still another specific embodiment, the carbohydrate
excipient is present at between about 0.1% to about 5%. In still
another specific embodiment, the carbohydrate excipient is present
at between about 5% to about 10%. In yet another specific
embodiment, the carbohydrate excipient is present at between about
15% to about 20%. In still other specific embodiments, the
carbohydrate excipient is present at 1%, or at 1.5%, or at 2%, or
at 2.5%, or at 3%, or at 4%, or at 5%, or at 10%, or at 15%, or at
20%.
[0402] Carbohydrate excipients suitable for use in the formulations
of the invention include, for example, monosaccharides such as
fructose, maltose, galactose, glucose, D-mannose, sorbose, and the
like; disaccharides, such as lactose, sucrose, trehalose,
cellobiose, and the like; polysaccharides, such as raffinose,
melezitose, maltodextrins, dextrans, starches, and the like; and
alditols, such as mannitol, xylitol, maltitol, lactitol, xylitol
sorbitol (glucitol) and the like. In one embodiment, the
carbohydrate excipients for use in the present invention are
selected from the group consisting of, sucrose, trehalose, lactose,
mannitol, and raffinose. In a specific embodiment, the carbohydrate
excipient is trehalose. In another specific embodiment, the
carbohydrate excipient is mannitol. In yet another specific
embodiment, the carbohydrate excipient is sucrose. In still another
specific embodiment, the carbohydrate excipient is raffinose. The
purity of the carbohydrate excipient should be at least 98%, or at
least 99%, or at least 99.5%.
[0403] In one embodiment, a formulation of the invention comprises
an excipient. In a specific embodiment, a formulation of the
invention comprises at least one excipient selected from the group
consisting of: sugar, salt, surfactant, amino acid, polyol,
chelating agent, emulsifier and preservative. In one embodiment, a
formulation of the invention comprises a salt. In one embodiment, a
formulation of the invention comprises a salt selected from the
group consisting of: NaCl, KCl, CaCl.sub.2, and MgCl.sub.2. In a
specific embodiment, a formulation of the invention comprises
NaCl.
[0404] In one embodiment, a formulation of the invention comprises
at least about 10 mM, at least about 25 mM, at least about 50 mM,
at least about 75 mM, at least about 100 mM, at least about 125 mM,
at least about 150 mM, at least about 175 mM. at least about 200
mM, or at least about 300 mM sodium chloride.
[0405] The formulations of the invention may further comprise a
surfactant. The term "surfactant" as used herein refers to organic
substances having amphipathic structures; namely, they are composed
of groups of opposing solubility tendencies, typically an
oil-soluble hydrocarbon chain and a water-soluble ionic group.
Surfactants can be classified, depending on the charge of the
surface-active moiety, into anionic, cationic, and nonionic
surfactants. Surfactants are often used as wetting, emulsifying,
solubilizing, and dispersing agents for various pharmaceutical
compositions and preparations of biological materials.
Pharmaceutically acceptable surfactants like polysorbates (e.g.
polysorbates 20 or 80); polyoxamers (e.g. poloxamer 188); Triton;
sodium octyl glycoside; lauryl-, myristyl-, linoleyl-, or
stearyl-sulfobetaine; lauryl-, myristyl-, linoleyl- or
stearyl-sarcosine; linoleyl-, myristyl-, or cetyl-betaine;
lauroamidopropyl-, cocamidopropyl-, linoleamidopropyl-,
myristamidopropyl-, palmidopropyl-, or isostearamidopropyl-betaine
(e.g. lauroamidopropyl); myristamidopropyl-, palmidopropyl-, or
isostearamidopropyl-dimethylamine; sodium methyl cocoyl-, or
disodium methyl oleyl-taurate; and the MONAQUA.TM. series (Mona
Industries, Inc., Paterson, N.J.), polyethyl glycol, polypropyl
glycol, and copolymers of ethylene and propylene glycol (e.g.
Pluronics, PF68 etc), can optionally be added to the formulations
of the invention to reduce aggregation. Surfactants are
particularly useful if a pump or plastic container is used to
administer the formulation. The presence of a pharmaceutically
acceptable surfactant mitigates the propensity for the protein to
aggregate. In a specific embodiment, the formulations of the
invention comprise a polysorbate which is at a concentration
ranging from between about 0.001% to about 1%, or about 0.001% to
about 0.1%, or about 0.01% to about 0.1%. In other specific
embodiments, the formulations of the invention comprise a
polysorbate which is at a concentration of 0.001%, or 0.002%, or
0.003%, or 0.004%, or 0.005%, or 0.006%, or 0.007%, or 0.008%, or
0.009%, or 0.01%, or 0.015%, or 0.02%. In another specific
embodiment, the polysorbate is polysorbate-80.
[0406] In one embodiment, a formulation of the invention comprises
a surfactant. In one embodiment, a formulation of the invention
comprises Polysorbate 20, Polysorbate 40, Polysorbate 60, or
Polysorbate 80. In a specific embodiment, a formulation of the
invention comprises Polysorbate 80.
[0407] Optionally, the formulations of the invention may further
comprise other common excipients and/or additives including, but
not limited to, diluents, binders, stabilizers, lipophilic
solvents, preservatives, adjuvants, or the like. Pharmaceutically
acceptable excipients and/or additives may be used in the
formulations of the invention. Commonly used excipients/additives,
such as pharmaceutically acceptable chelators (for example, but not
limited to, EDTA, DTPA or EGTA) can optionally be added to the
formulations of the invention to reduce aggregation. These
additives are particularly useful if a pump or plastic container is
used to administer the formulation.
[0408] Preservatives, such as phenol, m-cresol, p-cresol, o-cresol,
chlorocresol, benzyl alcohol, phenylmercuric nitrite,
phenoxyethanol, formaldehyde, chlorobutanol, magnesium chloride
(for example, but not limited to, hexahydrate), alkylparaben
(methyl, ethyl, propyl, butyl and the like), benzalkonium chloride,
benzethonium chloride, sodium dehydroacetate and thimerosal, or
mixtures thereof can optionally be added to the formulations of the
invention at any suitable concentration such as between about
0.001% to about 5%, or any range or value therein. The
concentration of preservative used in the formulations of the
invention is a concentration sufficient to yield an microbial
effect. Such concentrations are dependent on the preservative
selected and are readily determined by the skilled artisan.
[0409] Other contemplated excipients/additives, which may be
utilized in the formulations of the invention include, for example,
flavoring agents, antimicrobial agents, sweeteners, antioxidants,
antistatic agents, lipids such as phospholipids or fatty acids,
steroids such as cholesterol, protein excipients such as serum
albumin (human serum albumin (HSA), recombinant human albumin
(rHA)), gelatin, casein, salt-forming counterions such as sodium
and the like. These and additional known pharmaceutical excipients
and/or additives suitable for use in the formulations of the
invention are known in the art, e.g., as listed in "Remington: The
Science & Practice of Pharmacy", 21.sup.st ed., Lippincott
Williams & Wilkins, (2005), and in the "Physician's Desk
Reference", 60.sup.th ed., Medical Economics, Montvale, N.J.
(2005). Pharmaceutically acceptable carriers can be routinely
selected that are suitable for the mode of administration,
solubility and/or stability of Fc variant protein as well known in
the art or as described herein.
[0410] It will be understood by one skilled in the art that the
formulations of the invention may be isotonic with human blood,
that is the formulations of the invention have essentially the same
osmotic pressure as human blood. Such isotonic formulations will
generally have an osmotic pressure from about 250 mOSm to about 350
mOSm. Isotonicity can be measured by, for example, using a vapor
pressure or ice-freezing type osmometer. Tonicity of a formulation
is adjusted by the use of tonicity modifiers. "Tonicity modifiers"
are those pharmaceutically acceptable inert substances that can be
added to the formulation to provide an isotonity of the
formulation. Tonicity modifiers suitable for this invention
include, but are not limited to, saccharides, salts and amino
acids.
[0411] In certain embodiments, the formulations of the present
invention have an osmotic pressure from about 100 mOSm to about
1200 mOSm, or from about 200 mOSm to about 1000 mOSm, or from about
200 mOSm to about 800 mOSm, or from about 200 mOSm to about 600
mOSm, or from about 250 mOSm to about 500 mOSm, or from about 250
mOSm to about 400 mOSm, or from about 250 mOSm to about 350
mOSm.
[0412] Concentration of any one or any combination of various
components of the formulations of the invention are adjusted to
achieve the desired tonicity of the final formulation. For example,
the ratio of the carbohydrate excipient to antibody may be adjusted
according to methods known in the art (e.g., U.S. Pat. No.
6,685,940). In certain embodiments, the molar ratio of the
carbohydrate excipient to antibody may be from about 100 moles to
about 1000 moles of carbohydrate excipient to about 1 mole of
antibody, or from about 200 moles to about 6000 moles of
carbohydrate excipient to about 1 mole of antibody, or from about
100 moles to about 510 moles of carbohydrate excipient to about 1
mole of antibody, or from about 100 moles to about 600 moles of
carbohydrate excipient to about 1 mole of antibody.
[0413] The desired isotonicity of the final formulation may also be
achieved by adjusting the salt concentration of the formulations.
Salts that are pharmaceutically acceptable and suitable for this
invention as tonicity modifiers include, but are not limited to,
sodium chloride, sodium succinate, sodium sulfate, potassium
chloride, magnesium chloride, magnesium sulfate, and calcium
chloride. In specific embodiments, formulations of the inventions
comprise NaCl, MgCl.sub.2, and/or CaCl.sub.2. In one embodiment,
concentration of NaCl is between about 75 mM and about 150 mM. In
another embodiment, concentration of MgCl.sub.2 is between about 1
mM and about 100 mM. Amino acids that are pharmaceutically
acceptable and suitable for this invention as tonicity modifiers
include, but are not limited to, proline, alanine, L-arginine,
asparagine, L-aspartic acid, glycine, serine, lysine, and
histidine.
[0414] In one embodiment the formulations of the invention are
pyrogen-free formulations which are substantially free of
endotoxins and/or related pyrogenic substances. Endotoxins include
toxins that are confined inside a microorganism and are released
only when the microorganisms are broken down or die. Pyrogenic
substances also include fever-inducing, thermostable substances
(glycoproteins) from the outer membrane of bacteria and other
microorganisms. Both of these substances can cause fever,
hypotension and shock if administered to humans. Due to the
potential harmful effects, even low amounts of endotoxins must be
removed from intravenously administered pharmaceutical drug
solutions. The Food & Drug Administration ("FDA") has set an
upper limit of 5 endotoxin units (EU) per dose per kilogram body
weight in a single one hour period for intravenous drug
applications (The United States Pharmacopeial Convention,
Pharmacopeial Forum 26 (1):223 (2000)). When therapeutic proteins
are administered in amounts of several hundred or thousand
milligrams per kilogram body weight, as can be the case with
antibodies, even trace amounts of harmful and dangerous endotoxin
must be removed. In certain specific embodiments, the endotoxin and
pyrogen levels in the composition are less then 10 EU/mg, or less
then 5 EU/mg, or less then 1 EU/mg, or less then 0.1 EU/mg, or less
then 0.01 EU/mg, or less then 0.001 EU/mg.
[0415] When used for in vivo administration, the formulations of
the invention should be sterile. The formulations of the invention
may be sterilized by various sterilization methods, including
sterile filtration, radiation, etc. In one embodiment, the antibody
formulation is filter-sterilized with a presterilized 0.22-micron
filter. Sterile compositions for injection can be formulated
according to conventional pharmaceutical practice as described in
"Remington: The Science & Practice of Pharmacy", 21.sup.st ed.,
Lippincott Williams & Wilkins, (2005). Formulations comprising
antibodies, such as those disclosed herein, ordinarily will be
stored in lyophilized form or in solution. It is contemplated that
sterile compositions comprising antibodies are placed into a
container having a sterile access port, for example, an intravenous
solution bag or vial having an adapter that allows retrieval of the
formulation, such as a stopper pierceable by a hypodermic injection
needle.
[0416] The terms "stability" and "stable" as used herein in the
context of a formulation comprising an anti-ICOS antibody of the
invention refer to the resistance of the antibody in the
formulation to aggregation, degradation or fragmentation under
given manufacture, preparation, transportation and storage
conditions. The "stable" formulations of the invention retain
biological activity under given manufacture, preparation,
transportation and storage conditions. The stability of said
antibody can be assessed by degrees of aggregation, degradation or
fragmentation, as measured by HPSEC, static light scattering (SLS),
Fourier Transform Infrared Spectroscopy (FTIR), circular dichroism
(CD), urea unfolding techniques, intrinsic tryptophan fluorescence,
differential scanning calorimetry, and/or ANS binding techniques,
compared to a reference formulation. For example, a reference
formulation may be a reference standard frozen at -70.degree. C.
consisting of 10 mg/ml of an anti-ICOS antibody of the invention in
PBS. The overall stability of a formulation comprising an anti-ICOS
antibody of the invention can be assessed by various assays
including, for example, ELISA assay, radioimmunoassay and ADCC
assay. The overall stability of a formulation comprising an
anti-ICOS antibody of the invention can also be assessed by in vivo
assays including, for example, in vivo depletion assays.
[0417] In one embodiment, a formulation of the invention comprises
an anti-ICOS antibody. In one embodiment, a formulation of the
invention reduces aggregation of an anti-ICOS antibody or fragment
thereof. In another embodiment, a formulation of the invention
reduces fragmentation of an anti-ICOS antibody or fragment thereof.
In a further embodiment, a formulation of the invention reduces
deamidation of an anti-ICOS antibody or fragment thereof.
[0418] In one embodiment, a formulation of the invention comprises
an anti-ICOS antibody of the invention and is stable upon storage
at about 40.degree. C. for at least about 1 week, at least about 2
weeks, at least about 3 weeks, or at least about 4 weeks. In one
embodiment, a formulation of the invention is stable upon storage
at about 40.degree. C. for at least about 1 month, at least about 2
months, at least about 3 months, at least about 4 months, at least
about 5 months, or at least about 6 months.
[0419] In one embodiment, a formulation of the invention comprises
an anti-ICOS antibody of the invention and is stable upon storage
at about 5.degree. C. for at least about 1 month, at least about 2
months, at least about 3 months, at least about 4 months, at least
about 5 months, at least about 6 months, at least about 7 months,
at least about 8 months, at least about 9 months, at least about 10
months, at least about 11 months, or at least about 12 months. In
one embodiment, a formulation of the invention is stable upon
storage at about 5.degree. C. for at least about 1 year, at least
about 2 years, at least about 3 years, at least about 4 years, at
least about 5 years, at least about 6 years, at least about 7
years, at least about 8 years, at least about 9 years, at least
about 10 years, at least about 11 years, or at least about 12
years.
[0420] In a specific embodiment, a formulation of the invention
comprises at least about 50 mg/ml of an anti-ICOS antibody
described herein, wherein the formulation is stable upon storage at
about 40.degree. C. for at least about 1 week, at least about 2
weeks, at least about 3 weeks, at least about 4 weeks, at least
about 2 months, at least about 3 months, at least about 4 months,
at least about 5 months, or at least about 6 months.
[0421] In a specific embodiment, a formulation of the invention
comprises at least about 50 mg/ml of an anti-ICOS antibody
described herein, wherein the formulation is stable upon storage at
about 5C for at least about 6 months, at least about 7 months, at
least about 8 months, at least about 9 months, at least about 1
year, at least about 2 years, or at least about 3 years.
[0422] In a specific embodiment, a formulation of the invention
comprises at least about 100 mg/ml of an anti-ICOS antibody
described herein, wherein the formulation is stable upon storage at
about 40.degree. C. for at least about 1 week, at least about 2
weeks, at least about 3 weeks, at least about 4 weeks, at least
about 2 months, at least about 3 months, at least about 4 months,
at least about 5 months, or at least about 6 months.
[0423] In a specific embodiment, a formulation of the invention
comprises at least about 100 mg/ml of an anti-ICOS antibody
described herein, wherein the formulation is stable upon storage at
about 5.degree. C. for at least about 6 months, at least about 7
months, at least about 8 months, at least about 9 months, at least
about 1 year, at least about 2 years, or at least about 3
years.
[0424] In a specific embodiment, a formulation of the invention
comprises at least about 110 mg/ml of an anti-ICOS antibody
described herein, wherein the formulation is stable upon storage at
about 40.degree. C. for at least about 1 week, at least about 2
weeks, at least about 3 weeks, at least about 4 weeks, at least
about 2 months, at least about 3 months, at least about 4 months,
at least about 5 months, or at least about 6 months.
[0425] In a specific embodiment, a formulation of the invention
comprises at least about 110 mg/ml of an anti-ICOS antibody
described herein, wherein the formulation is stable upon storage at
about 5.degree. C. for at least about 6 months, at least about 7
months, at least about 8 months, at least about 9 months, at least
about 1 year, at least about 2 years, or at least about 3
years.
[0426] In a specific embodiment, a formulation of the invention
comprises at least about 150 mg/ml of an anti-ICOS antibody
described herein, wherein the formulation is stable upon storage at
about 40.degree. C. for at least about 1 week, at least about 2
weeks, at least about 3 weeks, at least about 4 weeks, at least
about 2 months, at least about 3 months, at least about 4 months,
at least about 5 months, or at least about 6 months.
[0427] In a specific embodiment, a formulation of the invention
comprises at least about 150 mg/ml of an anti-ICOS antibody
described herein, wherein the formulation is stable upon storage at
about 5.degree. C. for at least about 6 months, at least about 7
months, at least about 8 months, at least about 9 months, at least
about 1 year, at least about 2 years, or at least about 3
years.
5.19.2. Antibody Half-Life
[0428] In certain embodiments, the half-life of an anti-ICOS
antibody of compositions and methods of the invention is at least
about 4 to 7 days. In certain embodiments, the mean half-life of an
anti-ICOS antibody of compositions and methods of the invention is
at least about 2 to 5 days, 3 to 6 days, 4 to 7 days, 5 to 8 days,
6 to 9 days, 7 to 10 days, 8 to 11 days, 8 to 12, 9 to 13, 10 to
14, 11 to 15, 12 to 16, 13 to 17, 14 to 18, 15 to 19, or 16 to 20
days. In other embodiments, the mean half-life of an anti-ICOS
antibody of compositions and methods of the invention is at least
about 17 to 21 days, 18 to 22 days, 19 to 23 days, 20 to 24 days,
21 to 25, days, 22 to 26 days, 23 to 27 days, 24 to 28 days, 25 to
29 days, or 26 to 30 days. In still further embodiments the
half-life of an anti-ICOS antibody of compositions and methods of
the invention can be up to about 50 days. In certain embodiments,
the half-lives of antibodies of compositions and methods of the
invention can be prolonged by methods known in the art. Such
prolongation can in turn reduce the amount and/or frequency of
dosing of the antibody compositions. Antibodies with improved in
vivo half-lives and methods for preparing them are disclosed in
U.S. Pat. No. 6,277,375; and International Publication Nos. WO
98/23289 and WO 97/3461.
[0429] The serum circulation of anti-ICOS antibodies in vivo may
also be prolonged by attaching inert polymer molecules such as high
molecular weight polyethyleneglycol (PEG) to the antibodies with or
without a multifunctional linker either through site-specific
conjugation of the PEG to the N- or C-terminus of the antibodies or
via epsilon-amino groups present on lysyl residues. Linear or
branched polymer derivatization that results in minimal loss of
biological activity will be used. The degree of conjugation can be
closely monitored by SDS-PAGE and mass spectrometry to ensure
proper conjugation of PEG molecules to the antibodies. Unreacted
PEG can be separated from antibody-PEG conjugates by size-exclusion
or by ion-exchange chromatography. PEG-derivatized antibodies can
be tested for binding activity as well as for in vivo efficacy
using methods known to those of skill in the art, for example, by
immunoassays described herein.
[0430] Further, the antibodies of compositions and methods of the
invention can be conjugated to albumin in order to make the
antibody more stable in vivo or have a longer half-life in vivo.
The techniques are well known in the art, see, e.g., International
Publication Nos. WO 93/15199, WO 93/15200, and WO 01/77137; and
European Patent No. EP 413, 622, all of which are incorporated
herein by reference.
[0431] Additionally, variant Fc regions that confer increased in
vivo half-life on antibodies has been described (see, US Patent
Publication No: US2003/0190311 A1). The use of Fc variants with
extended in vivo half-life in combination with the compositions and
methods of the current invention is contemplated. In one
embodiment, an anti-ICOS antibody of the invention comprises a
variant Fc region with increased in vivo half-life. In a further
embodiment, an anti-ICOS antibody of the invention comprises a
varian tfc region comprising at least one substitution of an amino
acid residue selected from the group consisting of: residue 252,
254, and 256, wherein the amino acid residue positions are
determined according to the EU convention. In a specific
embodiment, an anti-ICOS antibody of the invention comprises a
variant Fc region comprising at least one amino acid substitution
selected from the group consisting of: M252Y, S254T, and T256E;
wherein the amino acid residue positions are determined according
to the EU convention. In a further embodiment, an anti-ICOS
antibody of the invention comprises a variant Fc region comprising
at least one amino acid residue selected from the group consisting
of: Y at position 252, T at position 254, and E at position 256;
wherein the amino acid residue positions are determined according
to the EU convention.
5.19.3. Administration and Dosing
[0432] Administration of compositions of the invention to a human
patient can be by any route, including but not limited to
intravenous, intradermal, transdermal, subcutaneous, intramuscular,
inhalation (e.g., via an aerosol), buccal (e.g., sub-lingual),
topical (i.e., both skin and mucosal surfaces, including airway
surfaces), intrathecal, intraarticular, intraplural, intracerebral,
intra-arterial, intraperitoneal, oral, intralymphatic, intranasal,
rectal or vaginal administration, by perfusion through a regional
catheter, or by direct intralesional injection. In one embodiment,
compositions of the invention are administered by intravenous push
or intravenous infusion given over defined period (e.g., 0.5 to 2
hours). Compositions of the invention can be delivered by
peristaltic means or in the form of a depot, although the most
suitable route in any given case will depend, as is well known in
the art, on such factors as the species, age, gender and overall
condition of the subject, the nature and severity of the condition
being treated and/or on the nature of the particular composition
(i.e., dosage, formulation) that is being administered. In
particular embodiments, the route of administration is via bolus or
continuous infusion over a period of time, once or twice a week. In
other particular embodiments, the route of administration is by
subcutaneous injection, optionally once or twice weekly. In one
embodiment, compositions, and/or methods of the invention are
administered on an outpatient basis.
[0433] In certain embodiments, the dose of a composition comprising
anti-ICOS antibody is measured in units of mg/kg of patient body
weight. In other embodiments, the dose of a composition comprising
anti-ICOS antibody is measured in units of mg/kg of patient lean
body weight (i.e., body weight minus body fat content). In yet
other embodiments, the dose of a composition comprising anti-ICOS
antibody is measured in units of mg/m.sup.2 of patient body surface
area. In yet other embodiments, the dose of a composition
comprising anti-ICOS antibody is measured in units of mg per dose
administered to a patient. Any measurement of dose can be used in
conjunction with compositions and methods of the invention and
dosage units can be converted by means standard in the art.
[0434] Those skilled in the art will appreciate that dosages can be
selected based on a number of factors including the age, sex,
species and condition of the subject (e.g., stage of disease), the
desired degree of cellular depletion, the disease to be treated
and/or the particular antibody or antigen-binding fragment being
used and can be determined by one of skill in the art. For example,
effective amounts of compositions of the invention may be
extrapolated from dose-response curves derived in vitro test
systems or from animal model (e.g., the cotton rat or monkey) test
systems. Models and methods for evaluation of the effects of
antibodies are known in the art (Wooldridge et al., Blood, 89(8):
2994-2998 (1997)), incorporated by reference herein in its
entirety). In certain embodiments, for particular ICOS expressing T
cell malignancies, therapeutic regimens standard in the art for
antibody therapy can be used with compositions and methods of the
invention.
[0435] Examples of dosing regimens that can be used in methods of
the invention include, but are not limited to, daily, three times
weekly (intermittent), weekly, or every 14 days. In certain
embodiments, dosing regimens include, but are not limited to,
monthly dosing or dosing every 6-8 weeks.
[0436] Those skilled in the art will appreciate that dosages are
generally higher and/or frequency of administration greater for
initial treatment as compared with maintenance regimens.
[0437] In some embodiments of the invention, anti-ICOS antibodies
bind to ICOS expressing T cells and may result in efficient (i.e.,
at low dosage) depletion of ICOS expressing T cells (as described
herein). In certain embodiments, dosages of the antibody
(optionally in a pharmaceutically acceptable carrier as part of a
pharmaceutical composition) are at least about 0.0005, 0.001, 0.05,
0.075, 0.1, 0.25, 0.375, 0.5, 1, 2.5, 5, 10, 20, 37.5, or 50
mg/m.sup.2 and/or less than about 500, 475, 450, 425, 400, 375,
350, 325, 300, 275, 250, 225, 200, 175, 150, 125, 100, 75, 60, 50,
37.5, 20, 15, 10, 5, 2.5, 1, 0.5, 0.375, 0.1, 0.075 or 0.01
mg/m.sup.2. In certain embodiments, the dosage is between about
0.0005 to about 200 mg/m.sup.2, between about 0.001 and 150
mg/m.sup.2, between about 0.075 and 125 mg/m.sup.2, between about
0.375 and 100 mg/m.sup.2, between about 2.5 and 75 mg/m.sup.2,
between about 10 and 75 mg/m.sup.2, and between about 20 and 50
mg/m.sup.2. In related embodiments, the dosage of anti-ICOS
antibody used is at least about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7,
0.8, 0.9, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5,
8, 8.5, 9, 9.5, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5,
15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5 mg/kg of
body weight of a patient. In certain embodiments, the dose of naked
anti-ICOS antibody used is at least about 1 to 10, 5 to 15, 10 to
20, or 15 to 25 mg/kg of body weight of a patient. In certain
embodiments, the dose of anti-ICOS antibody used is at least about
1 to 20, 3 to 15, or 5 to 10 mg/kg of body weight of a patient. In
other embodiments, the dose of anti-ICOS antibody used is at least
about 5, 6, 7, 8, 9, or 10 mg/kg of body weight of a patient. In
certain embodiments, a single dosage unit of the antibody
(optionally in a pharmaceutically acceptable carrier as part of a
pharmaceutical composition) can be at least about 0.5, 1, 2, 4, 6,
8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40,
42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74,
76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106,
108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132,
134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158,
160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184,
186, 188, 190, 192, 194, 196, 198, 200, 204, 206, 208, 210, 212,
214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238,
240, 242, 244, 246, 248, or 250 micrograms/m.sup.2. In other
embodiments, dose is up to 1 g per single dosage unit.
[0438] In some embodiments of methods of this invention, antibodies
and/or compositions of this invention can be administered at a dose
lower than about 375 mg/m.sup.2; at a dose lower than about 37.5
mg/m.sup.2; at a dose lower than about 0.375 mg/m.sup.2; and/or at
a dose between about 0.075 mg/m.sup.2 and about 125 mg/m.sup.2. In
certain embodiments of methods of the invention, dosage regimens
comprise low doses, administered at repeated intervals. For
example, in one embodiment, compositions of the invention can be
administered at a dose lower than about 375 mg/m.sup.2 at intervals
of approximately every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25,
30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 125, 150, 175, or 200
days.
[0439] The specified dosage can result in ICOS expressing T cell
depletion in the human treated using compositions and methods of
the invention for a period of at least about 1, 2, 3, 5, 7, 10, 14,
20, 30, 45, 60, 75, 90, 120, 150 or 180 days or longer. In certain
embodiments of methods of the invention, ICOS expressing T cells
are depleted by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%
in comparison to ICOS expressing T cell levels in the patient being
treated before use of compositions and methods of the invention. In
other embodiments of methods of the invention, ICOS expressing T
cells are depleted by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%,
or 100% in comparison to typical standard ICOS expressing T cell
levels for humans. In related embodiments, the typical standard
ICOS expressing T cell levels for humans are determined using
patients comparable to the patient being treated with respect to
age, sex, weight, and other factors.
[0440] In certain embodiments of the invention, a dosage of about
125 mg/m.sup.2 or less of an antibody or antigen-binding fragment
results in ICOS expressing T cell depletion for a period of at
least about 7, 14, 21, 30, 45, 60, 90, 120, 150, or 200 days. In
another representative embodiment, a dosage of about 37.5
mg/m.sup.2 or less depletes ICOS expressing T cells for a period of
at least about 7, 14, 21, 30, 45, 60, 90, 120, 150, or 200 days. In
still other embodiments, a dosage of about 0.375 mg/m.sup.2 or less
results in depletion of ICOS expressing T cells for at least about
7, 14, 21, 30, 45 or 60 days. In another embodiment, a dosage of
about 0.075 mg/m.sup.2 or less results in depletion of ICOS
expressing T cells for a period of at least about 7, 14, 21, 30,
45, 60, 90, 120, 150, or 200 days. In yet other embodiments, a
dosage of about 0.01 mg/m.sup.2, 0.005 mg/m.sup.2 or even 0.001
mg/m.sup.2 or less results in depletion of ICOS expressing T cells
for at least about 3, 5, 7, 10, 14, 21, 30, 45, 60, 90, 120, 150,
or 200 days. According to these embodiments, the dosage can be
administered by any suitable route, but is optionally administered
by a subcutaneous route.
[0441] As another aspect, the invention provides the discovery that
ICOS expressing T cell depletion and/or treatment of T
cell-mediated disorders can be achieved at lower dosages of
antibody or antibody fragments than employed in currently available
methods. Thus, in another embodiment, the invention provides a
method of depleting ICOS expressing T cells and/or treating a T
cell-mediated disorder, comprising administering to a human, an
effective amount of an antibody that specifically binds to ICOS,
wherein a dosage of about 500, 475, 450, 425, 400, 375, 350, 325,
300, 275, 250, 225, 200, 175, 150, 125, 100, 75, 60, 50, 37.5, 20,
10, 5, 2.5, 1, 0.5, 0.375, 0.25, 0.1, 0.075, 0.05, 0.001, 0.0005
mg/m.sup.2 or less results in a depletion of ICOS expressing T
cells (circulating and/or tissue ICOS expressing T cells) of 25%,
35%, 50%, 60%, 75%, 80%, 85%, 90%, 95%, 98% or more for a period at
least about 3, 5, 7, 10, 14, 21, 30, 45, 60, 75, 90, 120, 150, 180,
or 200 days or longer. In representative embodiments, a dosage of
about 125 mg/m.sup.2 or 75 mg/m.sup.2 or less results in at least
about 50%, 75%, 85% or 90% depletion of ICOS expressing T cells for
at least about 7, 14, 21, 30, 60, 75, 90, 120, 150 or 180 days. In
other embodiments, a dosage of about 50, 37.5 or 10 mg/m.sup.2
results in at least about a 50%, 75%, 85% or 90% depletion of ICOS
expressing T cells for at least about 7, 14, 21, 30, 60, 75, 90,
120 or 180 days. In still other embodiments, a dosage of about
0.375 or 0.1 mg/m.sup.2 results in at least about a 50%, 75%, 85%
or 90% depletion of ICOS expressing T cells for at least about 7,
14, 21, 30, 60, 75 or 90 days. In further embodiments, a dosage of
about 0.075, 0.01, 0.001, or 0.0005 mg/m.sup.2 results in at least
about a 50%, 75%, 85% or 90% depletion of ICOS expressing T cells
for at least about 7, 14, 21, 30 or 60 days.
[0442] In certain embodiments of the invention, the dose can be
escalated or reduced to maintain a constant dose in the blood or in
a tissue, such as, but not limited to, bone marrow. In related
embodiments, the dose is escalated or reduced by about 2%, 5%, 8%,
10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, and 95% in order
to maintain a desired level of an antibody of compositions and
methods of the invention.
[0443] In certain embodiments, the dosage can be adjusted and/or
the infusion rate can be reduced based on patient's immunogenic
response to compositions and methods of the invention.
5.19.4. Toxicity Testing
[0444] The tolerance, toxicity and/or efficacy of the compositions
and/or treatment regimens of the present invention can be
determined by standard pharmaceutical procedures in cell cultures
or experimental animals, e.g., for determining the LD50 (the dose
lethal to 50% of the population), the ED50 (the dose
therapeutically effective in 50% of the population), and IC50 (the
dose effective to achieve a 50% inhibition). In one embodiment, the
dose is a dose effective to achieve at least a 60%, 70%, 80%, 90%,
95%, or 99% depletion of circulating ICOS expressing T cells. The
dose ratio between toxic and therapeutic effects is the therapeutic
index and it can be expressed as the ratio LD50/ED50. Therapies
that exhibit large therapeutic indices may be preferred. While
therapies that exhibit toxic side effects may be used, care should
be taken to design a delivery system that targets such agents to
ICOS-expressing cells in order to minimize potential damage to ICOS
negative cells and, thereby, reduce side effects.
[0445] Data obtained from the cell culture assays and animal
studies can be used in formulating a range of dosages of the
compositions and/or treatment regimens for use in humans. The
dosage of such agents may lie within a range of circulating
concentrations that include the ED50 with little or no toxicity.
The dosage may vary within this range depending upon the dosage
form employed and the route of administration utilized. For any
therapy used in methods of the invention, a therapeutically
effective dose can be estimated by appropriate animal models.
Depending on the species of the animal model, the dose can be
scaled for human use according to art-accepted formulas, for
example, as provided by Freireich et al., Quantitative comparison
of toxicity of anticancer agents in mouse, rat, monkey, dog, and
human, Cancer Chemotherapy Reports, NCI 1966 40:219-244. Data
obtained from cell culture assays can be useful for predicting
potential toxicity. Animal studies can be used to formulate a
specific dose to achieve a circulating plasma concentration range
that includes the IC50 (i.e., the concentration of the test
compound that achieves a half-maximal inhibition of symptoms) as
determined in cell culture. Such information can be used to more
accurately determine useful doses in humans. Plasma drug levels may
be measured, for example, by high performance liquid
chromatography, ELISA, or by cell based assays.
5.20. Therapeutic Uses
[0446] Compositions comprising an anti-ICOS antibody with enhanced
effector function may be used for the treatment of autoimmune
diseases, such as systemic lupus erythematosis, rheumatoid
arthritis, multiple sclerosis, diabetes, immune thrombocytopenic
purpura (ITP), and psoriasis; chronic inflammatory diseases, such
as inflammatory bowel disease (Crohn's disease and ulcerative
colitis), Grave's disease, Hashimoto's thyroiditis, and diabetes
mellitis. Anti-ICOS compositions described herein may also be used
to alleviate toxic shock syndrome, inflammatory bowel disease,
allosensitization due to blood transfusions, T-cell dependent
B-cell-mediated diseases, and the treatment of graft vs. host
disease. In addition, compositions and methods of the invention may
be useful in therapeutic indications that call for the inhibition
or enhancement of antibody production.
[0447] Compositions comprising an anti-ICOS antibody with enhanced
effector function may also be used as immunosuppressive agents for
bone marrow and organ transplantation and may be used to prolong
graft survival. Such compositions may provide significant
advantages over existing treatment. Bone marrow and organ
transplantation therapy must contend with T-cell-mediated rejection
of the foreign cells or tissue by the host. Present therapeutic
regimens for inhibiting T-cell-mediated rejection involve treatment
with the drugs cyclosporine or FK506. While drugs are effective,
patients suffer from serious side effects, including
hepatotoxicity, nephrotoxicity, and neurotoxicity. The target for
the cyclosporin/FK506 class of therapeutics is calcineurin, a
phosphatase with ubiquitous expression. Since ICOS expression is
restricted to T-cells, depletion of ICOS expressing T cells may
lack the severe side effects observed with the use of the present
immunotherapeutic agents.
[0448] Hypersensitivity is a normally beneficial immune response
that is exaggerated or inappropriate, and leads to inflammatory
reactions and tissue damage. Hypersensitivity reactions which are
antibody-mediated may be particularly susceptible to antagonism by
depletion of ICOS expressing cells. Allergies, hay fever, asthma,
and acute edema cause type I hypersensitivity reactions, and these
reactions may be suppressed by depletion of ICOS expressing
cells.
[0449] Diseases that cause antibody-mediated hypersensitivity
reactions, including systemic lupus erythematosis, arthritis
(rheumatoid arthritis, reactive arthritis, psoriatic arthritis),
nephropathies (glomerulo-nephritis, membranous, mesangiocapillary,
focal segmental, focal necrotizing, crescentic,
proliferative--tubulopathies), skin disorders (pemphigus and
pemphigoid, erythema nodosum), endocrinopathies
(thyroiditis--Grave's, Hashimoto's--insulin dependent diabetes
mellitus), various pneumopathies (especially extrinsic alveolitis),
various vasculopathies, coeliac disease, with aberrant production
of IgA, many anemias and thrombocytopenias, Guillain-Barre
Syndrome, and myasthenia gravis, may be treated using compositions
comprising an anti-ICOS antibody with enhanced effector
function.
[0450] In addition, lymphoproliferative disorders, such as multiple
myeloma, Waldenstrom's macroglobulinemia, and crioglobulinemias may
be inhibited by administering a composition comprising an anti-ICOS
antibody with enhanced effector function. Additionally, graft
versus host disease, an "artificial" immune disorder, may benefit
from the depletion of ICOS expressing cells.
[0451] The ICOS dependent co-stimulatory pathway is involved in
regulating IgE production. IgE is an immunoglobulin isotype
specifically involved in mediating allergic responses such as
asthma, food allergies, hay fever, type 1 hypersensitivity and
sinus inflammation. Upon exposure to an allergen, a process
involving T-cell and B cell collaboration results in B cell
production of IgE specific for the allergen. Allergen-specific IgE
released into the circulation by B cells bind to mast cells and
basophils through the high affinity IgE receptor (FceRI). Mast
cells and basophils to which IgE is bound become sensitized and
subsequent exposure to the allergen results in cross-linking of the
surface receptors and release of histamines.
[0452] The invention provides for the use of an anti-ICOS antibody
to regulate IgE production and to prevent or treat IgE-mediated
disorders. By way of example, such disorders include allergic
responses such as asthma, food allergies, hay fever,
hypersensitivity, and sinus inflammation. In one embodiment, an
anti-ICOS antibody of the invention is used to partially or
completely inhibit IgE production. An anti-ICOS antibody of the
invention may be used separately, or in combination, in a treatment
regimen for decreasing IgE levels.
[0453] The invention also provides for the use of an anti-ICOS
antibody in combination with an IgE antagonist to partially or
completely inhibit IgE production and to prevent and/or treat
disorders characterized by excessive or inappropriate IgE
production. As used herein the term "IgE antagonist" refers to a
compound capable of disrupting or blocking the interaction of IgE
with its high affinity receptor FceRI on cells such that the
response to allergen stimulus is attenuated or eliminated.
Antagonists include an anti-IgE antibody and fragments thereof,
soluble FceRI receptor and fragments thereof, anti-FceRI antibody
and fragments thereof, IgE variants and fragments thereof, IgE
binding peptides, FceRI receptor binding peptides, and small
molecules capable of binding to IgE or competing with IgE for
binding to FceRI receptor. An anti-ICOS antibody of the invention
may also be used with in combination with antihistamines, allergen
desensitization, reduction in exposure to allergen and the like for
treatment of allergic disorders.
[0454] The invention also provides for the prevention and/or
treatment of asthma comprising administering an anti-ICOS antibody
of the invention alone or in conjunction with one or more agents
for treating asthma. Examples of such agents include
bronchodilators (anti-cholinergic agents, .beta-2 adrenergic
receptor agonists, lenkotriene D-4 antagonists, neurokinin
antagonists, potassium channel openers, substance P antagonists,
thromboxane A-2 antagonists, and xanthines), anti-inflammatories
(5-lipoxygenase inhibitors, 5-lipoxygenase activating protein
inhibitors, phosphodiesterase IV inhibitors, platelet activating
factor antagonists, respiratory NSAIDS, steroids, and tyrosine
kinase inhibitors), cytokine inhibitors (CD4, IL-4 and IL-5
inhibitors) and IgE antagonists as set forth above.
[0455] Compositions and methods according to this invention are
able to control (suppress or stimulate) proliferation of ICOS
expressing cells or production of cytokine (for example, IL-17) by
ICOS expressing cells, thereby enabling suppression of various
pathological conditions and treatment or prevention of various
disorders caused by diverse physiological phenomena related to
signal transduction mediated by ICOS.
[0456] Compositions comprising an anti-ICOS antibody of this
invention enables suppression, prevention and/or treatment of, for
example, but not limited to, rheumatoid arthritis, multiple
sclerosis, autoimmune thyroiditis, allergic contact-type
dermatitis, chronic inflammatory dermatosis (e.g., lichen planus),
systemic lupus erythematosus, insulin-dependent diabetes mellitus,
psoriasis, autoimmune or allergic disorders, autoimmune disease and
delayed allergy caused by cellular immunity; arthropathia (for
example, but not limited to, rheumatoid arthritis (RA) and
osteoarthritis (OA)), inflammation (e.g., hepatitis), graft versus
host reaction (GVH reaction), graft versus host disease (GVHD),
immune rejection accompanying transplantation of a tissue (e.g.,
skin, cornea, bone) or organ (e.g., liver, heart, lung, kidney,
pancreas), immune response triggered by a foreign antigen or
autoantigen (for example, production of antibodies against said
antigen, cell proliferation, production of cytokines), and
disorders caused by the abnormal intestinal immunity (e.g.,
inflammatory intestinal disorders, Crohn's disease, ulcerative
colitis, alimentary allergy).
[0457] Furthermore, compositions and methods described herein may
be utilized for the suppression/treatment of transplant rejection
or GVHD in combination with known immunosuppressive agents such as
inhibitors of cytokine transcription (e.g., cyclosporin A,
tacrolimus), nucleotide synthesis (e.g., azathiopurine,
mycophenolate mofetil), growth factor signal transduction (e.g.,
sirolimus, rapamycin), and the T cell interleukin 2 receptor (e.g.,
daclizumab, basiliximab). In a particular embodiment, an
immunosuppressant agent used in combination with compositions and
methods of the invention includes one or more of the following:
adriamycin, azathiopurine, busulfan, cyclophosphamide, cyclosporin
A ("CyA"), cytoxin, fludarabine, 5-fluorouracil, methotrexate,
mycophenolate mofetil (MOFETIL), nonsteroidal anti-inflammatories
(NSAIDs), rapamycin, and tacrolimus (FK506).
[0458] The compositions and methods of the present invention can be
applied to inflammatory disease for example, inflammation
accompanying various arthritis (for example, rheumatoid arthritis,
osteoarthritis), pneumonia, hepatitis (including viral hepatitis),
inflammation accompanying infectious diseases, inflammatory bowel
diseases, intestinal enteritis, nephritis (e.g., glomerular
nephritis, nephrofibrosis), gastritis, angiitis, pancreatitis,
peritonitis, bronchitis, myocarditis, cerebritis, inflammation in
postischemic reperfusion injury (myocardial ischemic reperfusion
injury), inflammation attributed to immune rejection after
transplantation of tissue and organ, burn, various skin
inflammation (psoriasis, allergic contact-type dermatitis, lichen
planus), inflammation in multiple organ failure, inflammation after
operation of PTCA or PTCR, and inflammation accompanying
arteriosclerosis, and autoimmune thyroiditis.
[0459] Compositions of the invention comprising an anti-ICOS
antibody with enhanced effector function as an active ingredient
may be used to inhibit, treat and/or prevent a variety of diseases,
for example, but not limited to rheumatoid arthritis, multiple
sclerosis, autoimmune thyroiditis, allergic contact dermatitis,
lichen planus, systemic lupus erythematosus, insulin dependent
diabetes mellitus, psoriasis, autoimmune diseases or allergic
diseases, delayed allergies mediated by cellular immunity;
arthropathies (e.g., rheumatoid arthritis (RA), osteoarthritis
(OA)), inflammation (e.g., hepatitis), graft versus host reaction
(GVH reaction), graft versus host disease (GVHD), immunorejection
associated with transplantation of tissues (e.g., skin, cornea and
bone) or organs (e.g., liver, heart, lung, kidney, pancreas),
inflammatory bowel disease, Crohn's disease, ulcerative colitis,
and alimentary allergy.
[0460] The compositions in accordance with the present invention
make it possible to treat or prevent some inflammations for which
various steroidal drugs are used as anti-inflammatory drugs, for
example, inflammation associated with various arthritides (e.g.,
rheumatoid arthritis, osteoarthritis), pneumonia, hepatitis
(including viral hepatitis), inflammation associated with
infectious diseases, inflammatory bowel disease, enteritis,
nephritis, glomerular nephritis, inflammation associated with
kidney fibrosis, gastritis, vasculitis, pancreatitis, peritonitis,
bronchitis, myocarditis, encephalitis, inflammation associated with
ischemia-reperfusion injury, myocaridial ischemia-reperfusion
injury, inflammation associated with immunorejection after
transplantation of tissues or organs, psoriasis, allergic contact
dermatitis, lichen planus, inflammation associated with multiple
organ failure, inflammation after operation of PTCA or PTCR,
inflammation associated with atherosclerosis, and autoimmune
thyroiditis.
5.21. Transplantation
[0461] According to certain aspects of the invention, the treatment
regimen and dose used with compositions and methods of the
invention is chosen based on a number of factors including, for
example, clinical manifestation that place a patient at risk for
developing transplant rejection, or clinical evidence that such a
rejection is developing.
[0462] The present invention provides compositions, therapeutic
formulations, methods and regimens effective to reduce the
incidence, severity, or duration of GVHD, a rejection episode, or
post-transplant lymphoproliferative disorder. In certain
embodiments, compositions and methods of the invention are
effective to attenuate the host response to ischemic reperfusion
injury of a solid tissue or organ graft. In one embodiment,
compositions and methods of the invention are effective to prolong
survival of a graft in a transplant recipient.
[0463] The present invention encompasses grafts that are
autologous, allogeneic, or xenogeneic to the recipient. The types
of grafts encompassed by the invention include tissue and organ
grafts, including but not limited to, bone marrow grafts,
peripheral stem cell grafts, skin grafts, arterial and venous
grafts, pancreatic islet cell grafts, and transplants of the
kidney, liver, pancreas, thyroid, and heart. The terms "graft" and
"transplant" are used interchangeably herein. In one embodiment,
the autologous graft is a bone marrow graft, an arterial graft, a
venous graft or a skin graft. In one embodiment, the allograft is a
bone marrow graft, a corneal graft, a kidney transplant, a
pancreatic islet cell transplant, or a combined transplant of a
kidney and pancreas. In one embodiment, the graft is a xenograft,
wherein the possible animal donors include, but are not limited to
pigs. The compositions and methods of the present invention may
also be used to suppress a deleterious immune response to a
non-biological graft or implant, including but not limited to an
artificial joint, a stent, or a pacemaker device.
[0464] Anti-ICOS antibodies, compositions, and methods of the
invention may be used to treat or prevent GVHD, rejection, or
post-transplant lymphoproliferative disorder without regard to the
particular indications initially giving rise to the need for the
transplant or the particular type of tissue transplanted.
[0465] Therapeutic formulations and regimens of the present
invention are described for treating human subjects diagnosed with
autoimmune diseases or disorders, including but not limited to,
rheumatoid arthritis, SLE, ITP, pemphigus-related disorders,
diabetes, and scleroderma.
[0466] Appropriate treatment regimens can be determined by one of
skill in the art for the particular patient or patient population.
In particular embodiments, the treatment regimen is a
pre-transplant conditioning regimen, a post-transplant maintenance
regimen, or post-transplant treatment regimen for an acute or a
chronic rejection. In certain embodiments, the particular regimen
is varied for a patient who is assessed as being at a high or
intermediate risk of developing a rejection response, compared with
the regimen for a patient who is assessed as being at a low risk of
rejection.
[0467] In certain embodiments, the particular regimen is varied
according to the stage of rejection, with more aggressive therapy
being indicated for patients at later stages of rejection. The
stages of humoral rejection may be classified according to the
knowledge and skill in the art. For example, the stages of humoral
rejection may be classified as one of stages I to IV according to
the following criteria: Stage I Latent Response, characterized by
circulating anti-donor alloantibodies, especially anti-HLA
antibodies; Stage II Silent Reaction, characterized by circulating
anti-donor alloantibodies, especially anti-HLA antibodies, and C4d
deposition, but without histologic changes or graft dysfunction;
Stage III Subclinical Rejection: characterized by circulating
anti-donor alloantibodies, especially anti-HLA antibodies, C4d
deposition, and tissue pathology, but without graft dysfunction;
Stage 1V Humoral Rejection: characterized by circulating anti-donor
alloantibodies, especially anti-HLA antibodies, C4d deposition,
tissue pathology, and graft dysfunction.
[0468] Anti-ICOS antibodies, compositions and methods of the
invention may be practiced to treat or prevent GVHD, rejection, or
post-transplantation lymphoproliferative disorders, either alone or
in combination with other therapeutic agents or treatment regimens.
Other therapeutic regimens for the treatment or prevention of GVHD,
rejection, or post-transplantation lymphoproliferative disorders
may comprise, for example, one or more of anti-lymphocyte therapy,
steroid therapy, antibody depletion therapy, immunosuppression
therapy, and plasmapheresis.
[0469] Anti-lymphocyte therapy may comprise the administration to
the transplant recipient of anti-thymocyte globulins, also referred
to as thymoglobulin. Anti-lymphocyte therapy may also comprise the
administration of one or more monoclonal antibodies directed
against T cell surface antigens. Examples of such antibodies
include, without limitation, OKT3.TM. (muromonab-CD3),
CAMPATH.TM.-1H (alemtuzumab), CAMPATH.TM.-1G, CAMPATH.TM.-1M,
SIMULECT.TM. (basiliximab), and ZENAPAX.TM. (daclizumab). In a
specific embodiment, the anti-lymphocyte therapy comprises one or
more antibodies directed against B cells, including, without
limitation, RITUXAN.TM. (rituximab).
[0470] Steroid therapy may comprise administration to the
transplant recipient of one or more steroids selected from the
group consisting of cortisol, prednisone, methyl prednisolone,
dexamethazone, and indomethacin. One or more of the steroids may be
corticosteroids, including without limitation, cortisol,
prednisone, and methylprednisolone.
[0471] Antibody depletion therapy may include, for example,
administration to the transplant recipient of intravenous
immunoglobulin. Antibody depletion therapy may also comprise
immunoadsorption therapy applied to the graft ex vivo, prior to
transplantation. Immunoadsorption may be accomplished using any
suitable technique, for example, protein A affinity, or antibody
based affinity techniques using antibodies directed against T cell
or B cell surface markers such as anti-CD3 antibodies, anti-CD19
antibodies, anti-CD.sub.20 antibodies, and anti-CD22
antibodies.
[0472] Immunosuppression therapy may comprise the administration of
one or more immunosuppressive agents such as inhibitors of cytokine
transcription (e.g., cyclosporin A, tacrolimus), nucleotide
synthesis (e.g., azathiopurine, mycophenolate mofetil), growth
factor signal transduction (e.g., sirolimus, rapamycin), and the T
cell interleukin 2 receptor (e.g., daclizumab, basiliximab). In a
particular embodiment, an immunosuppressant agent used in
combination with compositions and methods of the invention includes
one or more of the following: adriamycin, azathiopurine, busulfan,
cyclophosphamide, cyclosporin A ("CyA"), cytoxin, fludarabine,
5-fluorouracil, methotrexate, mycophenolate mofetil (MOFETIL),
nonsteroidal anti-inflammatories (NSAIDs), rapamycin, and
tacrolimus (FK506). Immunosuppressive agents may also comprise
inhibitors of complement, for example, soluble complement
receptor-1, anti-C5 antibody, or a small molecule inhibitor of C1s,
for example as described in Buerke et al. (J. Immunol., 167:5375-80
(2001).
[0473] In one embodiment, compositions and methods of the invention
are used in combination with one or more therapeutic regimens for
suppressing rejection, including, without limitation, tacrolimus
and mycophenolate mofetil therapy, immunoadsorption, intravenous
immunoglobulin therapy, and plasmapheresis.
5.22. Inflammatory Disorder
[0474] Anti-ICOS antibodies of the invention may be administered to
a subject in need thereof to prevent, manage, treat or ameliorate
an inflammatory disorder (e.g., asthma) or one or more symptoms
thereof. Compositions of the invention may also be administered in
combination with one or more other therapies, preferably therapies
useful for the prevention, management, treatment or amelioration of
an inflammatory disorder (including, but not limited to the
prophylactic or therapeutic agents listed herein) to a subject in
need thereof to prevent, manage, treat or ameliorate an
inflammatory disorder or one or more symptoms thereof. In a
specific embodiment, the invention provides a method of preventing,
managing, treating or ameliorating an inflammatory disorder or one
or more symptoms thereof, said method comprising administering to a
subject in need thereof a dose of a prophylactically or
therapeutically effective amount of an anti-ICOS antibody of the
invention. In another embodiment, the invention provides a method
of preventing, managing, treating or ameliorating an inflammatory
disorder or one or more symptoms thereof, said method comprising
administering to a subject in need thereof a dose of a
prophylactically or therapeutically effective amount of an effector
function enhanced anti-ICOS antibody of the invention and a dose of
a prophylactically or therapeutically effective amount of one or
more therapies (e.g., prophylactic or therapeutic agents) other
than antibodies (including antibody fragments thereof) that
immunospecifically bind to an ICOS polypeptide.
[0475] The invention provides methods for managing, treating or
ameliorating one or more symptoms of an inflammatory disorder in a
subject refractory to conventional therapies (e.g., methotrexate
and a TNF-alpha antagonist (e.g., REMICADE.TM. or ENBREL.TM.)) for
such an inflammatory disorder, said methods comprising
administering to said subject a dose of a prophylactically or
therapeutically effective amount of an effector function enhanced
anti-ICOS antibody of the invention. The invention also provides
methods for managing, treating or ameliorating one or more symptoms
of an inflammatory disorder in a subject refractory to existing
single agent therapies for such an inflammatory disorder, said
methods comprising administering to said subject a dose of a
prophylactically or therapeutically effective amount of an effector
function enhanced anti-ICOS antibody of the invention and a dose of
a prophylactically or therapeutically effective amount of one or
more therapies (e.g., prophylactic or therapeutic agents) other
than antibodies (including antibody fragments thereof) that
immunospecifically bind to an ICOS polypeptide. The invention also
provides methods for managing or treating an inflammatory disorder
by administering an effector function enhanced anti-ICOS antibody
of the invention in combination with any other treatment to
patients who have proven refractory to other treatments but are no
longer on these treatments. The invention also provides alternative
methods for the treatment of an inflammatory disorder where another
therapy has proven or may prove too toxic, i.e., results in
unacceptable or unbearable side effects, for the subject being
treated. For example, a composition of the invention may be
administered to a subject, wherein the subject is refractory to a
TNF antagonist or methotrexate. Further, the invention provides
methods for preventing the recurrence of an inflammatory disorder
in patients that have been treated and have no disease activity by
administering an effector function enhanced anti-ICOS antibody of
the invention.
[0476] Inflammatory disorders that can be treated by the methods
encompassed by the invention include, but are not limited to,
asthma, encephilitis, inflammatory bowel disease, chronic
obstructive pulmonary disease (COPD), allergic disorders, septic
shock, pulmonary fibrosis, undifferentiated spondyloarthropathy,
undifferentiated arthropathy, arthritis, osteoarthritis,
spondyloarthropathies (e.g., psoriatic arthritis, ankylosing
spondylitis, Reiter's Syndrome (reactive arthritis), inflammatory
osteolysis, Wilson's disease and chronic inflammation resulting
from chronic viral or bacteria infections. As described herein,
some autoimmune disorders are associated with an inflammatory
condition.
[0477] Anti-inflammatory therapies and their dosages, routes of
administration and recommended usage are known in the art and have
been described in such literature as the Physician's Desk Reference
(61th ed., 2007).
5.22.1.Anti-Inflammatory Therapies
[0478] The present invention provides methods of preventing,
managing, treating or ameliorating an inflammatory disorder or one
or more symptoms thereof, said methods comprising administering to
a subject in need thereof an effector function enhanced anti-ICOS
antibody of the invention and one or more therapies (e.g.,
prophylactic or therapeutic agents other than antibodies (including
antibody fragments thereof) that immunospecifically bind to an ICOS
polypeptide. Any agent or therapy which is known to be useful, or
which has been used or is currently being used for the prevention,
management, treatment or amelioration of an inflammatory disorder
or one or more symptoms thereof can be used in combination with an
effector function enhanced anti-ICOS antibody of the invention in
accordance with the invention described herein.
[0479] Any anti-inflammatory agent, including agents useful in
therapies for inflammatory disorders, well-known to one of skill in
the art can be used in the compositions and methods of the
invention. Non-limiting examples of anti-inflammatory agents
include non-steroidal anti-inflammatory drugs (NSAIDs), steroidal
anti-inflammatory drugs, anticholinergics (e.g., atropine sulfate,
atropine methylnitrate, and ipratropium bromide (ATROVENT.TM.)),
beta2-agonists (e.g., abuterol (VENTOLIN.TM. and PROVENTIL.TM.),
bitolterol (TORNALATE.TM.), levalbuterol (XOPONEX.TM.),
metaproterenol (ALUPENT.TM.), pirbuterol (MAXAIR.TM.), terbutlaine
(BRETHAIRE.TM. and BRETHINE.TM.), albuterol (PROVENTIL.TM.,
REPETABS.TM., and VOLMAX.TM.), formoterol (FORADIL AEROLIZER.TM.),
and salmeterol (SEREVEN.TM. and SEREVEN.TM. DISKUS.TM.)), and
methylxanthines (e.g., theophylline (UNIPHYL.TM., THEO-DUR.TM.,
SLO-BID.TM., AND TEHO-42.TM.)). Examples of NSAIDs include, but are
not limited to, aspirin, ibuprofen, celecoxib (CELEBREX.TM.),
diclofenac (VOLTAREN.TM.), etodolac (LODINE.TM.), fenoprofen
(NALFON.TM.), indomethacin (INDOCIN.TM.), ketoralac (TORADOL.TM.),
oxaprozin (DAYPRO.TM.), nabumentone (RELAFEN.TM.), sulindac
(CLINORIL.TM.), tolmentin (TOLECTIN.TM.), rofecoxib (VIOXX.TM.),
naproxen (ALEVE.TM., NAPROSYN.TM.), ketoprofen (ACTRON.TM.) and
nabumetone (RELAFEN.TM.). Such NSAIDs function by inhibiting a
cyclooxygenase enzyme (e.g., COX-1 and/or COX-2). Examples of
steroidal anti-inflammatory drugs include, but are not limited to,
glucocorticoids, dexamethasone (DECADRON.TM.), corticosteroids
(e.g., methylprednisolone (MEDROL.TM.)), cortisone, hydrocortisone,
prednisone (PREDNISONE.TM. and DELTASONE.TM.), prednisolone
(PRELONE.TM. and PEDIAPRED.TM.), triamcinolone, azulfidine, and
inhibitors of eicosanoids (e.g., prostaglandins, thromboxanes, and
leukotrienes).
[0480] In one embodiment, an effective amount of one or more
compositions of the invention is administered in combination with a
mast cell protease inhibitor to a subject at risk of or with an
inflammatory disorder. In another embodiment, the mast cell
protease inhibitor is a tryptase kinase inhibitor, such as, but not
limited to GW-45, GW-58, and genisteine. In a specific embodiment,
the mast cell protease inhibitor is phosphatidylinositide-3'
(PI3)-kinase inhibitors, such as, but not limited to calphostin C.
In another embodiment, the mast cell protease inhibitor is a
protein kinase inhibitor such as, but not limited to staurosporine.
In one embodiment, the mast cell protease inhibitor is administered
locally to the affected area.
[0481] Specific examples of immunomodulatory agents which can be
administered in combination with an effector function enhanced
anti-ICOS antibody of the invention to a subject with an
inflammatory disorder include, but are not limited to,
methothrexate, leflunomide, cyclophosphamide, cytoxan, Immuran,
cyclosporine A, minocycline, azathioprine, antibiotics (e.g., FK506
(tacrolimus)), methylprednisolone (MP), corticosteroids, steroids,
mycophenolate mofetil, rapamycin (sirolimus), mizoribine,
deoxyspergualin, brequinar, malononitriloamindes (e.g.,
leflunamide), anti-T cell receptor antibodies (e.g., anti-CD4
antibodies (e.g., cM-T412 (Boeringer), IDEC-CE9.1.RTM. (IDEC and
SKB), mAB 4162W94, Orthoclone and OKTcdr4a (Janssen-Cilag)),
anti-CD3 antibodies (e.g., Nuvion (Product Design Labs), OKT3
(Johnson & Johnson), or Rituxan (IDEC)), anti-CD5 antibodies
(e.g., an anti-CD5 ricin-linked immunoconjugate), anti-CD7
antibodies (e.g., CHH-380 (Novartis)), anti-CD8 antibodies,
anti-CD40 ligand monoclonal antibodies (e.g., IDEC-131 (IDEC)),
anti-CD52 antibodies (e.g., CAMPATH 1H (Ilex)), anti-CD2 antibodies
(e.g., MEDI-507 (MedImmune, Inc., International Publication Nos. WO
02/098370 and WO 02/069904), anti-CD11a antibodies (e.g., Xanelim
(Genentech)), and anti-B7 antibodies (e.g., IDEC-114) (IDEC));
anti-cytokine receptor antibodies (e.g., anti-IFN receptor
antibodies, anti-IL-2 receptor antibodies (e.g., Zenapax (Protein
Design Labs)), anti-IL-4 receptor antibodies, anti-IL-6 receptor
antibodies, anti-IL-10 receptor antibodies, and anti-IL-12 receptor
antibodies), anti-cytokine antibodies (e.g., anti-IFN antibodies,
anti-TNF-alpha antibodies, anti-IL-1beta antibodies, anti-IL-6
antibodies, anti-IL-8 antibodies (e.g., ABX-IL-8 (Abgenix)), and
anti-IL-12 antibodies)); CTLA4-immunoglobulin; LFA-3TIP (Biogen,
International Publication No. WO 93/08656 and U.S. Pat. No.
6,162,432); soluble cytokine receptors (e.g., the extracellular
domain of a TNF-alpha receptor or a fragment thereof, the
extracellular domain of an IL-1beta receptor or a fragment thereof,
and the extracellular domain of an IL-6 receptor or a fragment
thereof); cytokines or fragments thereof (e.g., interleukin (IL)-2,
IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12,
IL-15, TNF-alpha, TNF-beta, interferon (IFN)-alpha, IFN-beta,
IFN-gamma, and GM-CSF); and anti-cytokine antibodies (e.g.,
anti-IL-2 antibodies, anti-IL-4 antibodies, anti-IL-6 antibodies,
anti-IL-9 antibodies, anti-IL-10 antibodies, anti-IL-12 antibodies,
anti-IL-15 antibodies, anti-IL17 antibodies, anti-TNF-alpha
antibodies, and anti-IFN-gamma antibodies).
[0482] Any TNF-alpha antagonist well-known to one of skill in the
art can be used in the compositions and methods of the invention.
Non-limiting examples of TNF-alpha antagonists which can be
administered in combination with an effector function enhanced
anti-ICOS antibody of the invention to a subject with an
inflammatory disorder include proteins, polypeptides, peptides,
fusion proteins, antibodies (e.g., human, humanized, chimeric,
monoclonal, polyclonal, Fvs, ScFvs, Fab fragments, F(ab).sub.2
fragments, and antigen-binding fragments thereof) such as
antibodies that immunospecifically bind to TNF-alpha, nucleic acid
molecules (e.g., antisense molecules or triple helices), organic
molecules, inorganic molecules, and small molecules that blocks,
reduces, inhibits or neutralizes the function, activity and/or
expression of TNF-alpha. In various embodiments, a TNF-alpha
antagonist reduces the function, activity and/or expression of
TNF-alpha by at least 10%, at least 15%, at least 20%, at least
25%, at least 30%, at least 35%, at least 40%, at least 45%, at
least 50%, at least 55%, at least 60%, at least 65%, at least 70%,
at least 75%, at least 80%, at least 85%, at least 90%, at least
95% or at least 99% relative to a control such as phosphate
buffered saline (PBS). Examples of antibodies that
immunospecifically bind to TNF-alpha include, but are not limited
to, infliximab (REMICADE.TM.; Centacor), D2E7 (Abbott
Laboratories/Knoll Pharmaceuticals Co., Mt. Olive, N.J.), CDP571
which is also known as HUMICADE.TM. and CDP-870 (both of
Celltech/Pharmacia, Slough, U.K.), and TN3-19.12 (Williams et al.,
1994, Proc. Natl. Acad. Sci. USA 91: 2762-2766; Thorbecke et al.,
1992, Proc. Natl. Acad. Sci. USA 89:7375-7379). The present
invention also encompasses the use of antibodies that
immunospecifically bind to TNF-alpha disclosed in the following
U.S. patents in the compositions and methods of the invention: U.S.
Pat. Nos. 5,136,021; 5,147,638; 5,223,395; 5,231,024; 5,334,380;
5,360,716; 5,426,181; 5,436,154; 5,610,279; 5,644,034; 5,656,272;
5,658,746; 5,698,195; 5,736,138; 5,741,488; 5,808,029; 5,919,452;
5,958,412; 5,959,087; 5,968,741; 5,994,510; 6,036,978; 6,114,517;
and 6,171,787; each of which are herein incorporated by reference
in their entirety. Examples of soluble TNF-alpha receptors include,
but are not limited to, sTNF-R1 (Amgen), etanercept (ENBREL.TM.;
Immunex) and its rat homolog RENBREL.TM., soluble inhibitors of
TNF-alpha derived from TNFrI, TNFrII (Kohno et al., 1990, Proc.
Natl. Acad. Sci. USA 87:8331-8335), and TNF-alpha Inh (Seckinger et
al, 1990, Proc. Natl. Acad. Sci. USA 87:5188-5192).
[0483] Other TNF-alpha antagonists encompassed by the invention
include, but are not limited to, IL-10, which is known to block
TNF-alpha production via interferon gamma-activated macrophages
(Oswald et al. 1992, Proc. Natl. Acad. Sci. USA 89:8676-8680),
TNFR-IgG (Ashkenazi et al., 1991, Proc. Natl. Acad. Sci. USA
88:10535-10539), the murine product TBP-1 (Serono/Yeda), the
vaccine CytoTAb (Protherics), antisense molecule 104838 (ISIS), the
peptide RDP-58 (SangStat), thalidomide (Celgene), CDC-801
(Celgene), DPC-333 (Dupont), VX-745 (Vertex), AGIX-4207
(AtheroGenics), ITF-2357 (Italfarmaco), NPI-13021-31 (Nereus),
SCIO-469 (Scios), TACE targeter (Immunix/AHP), CLX-120500 (Calyx),
Thiazolopyrim (Dynavax), auranofin (Ridaura) (SmithKline Beecham
Pharmaceuticals), quinacrine (mepacrine dichlorohydrate), tenidap
(Enablex), Melanin (Large Scale Biological), and anti-p38 MAPK
agents by Uriach.
[0484] Non-limiting examples of anti-inflammatory agents which can
be administered in combination with an effector function enhanced
anti-ICOS antibody of the invention to a subject with an
inflammatory disorder include non-steroidal anti-inflammatory drugs
(NSAIDs), steroidal anti-inflammatory drugs, beta-agonists,
anticholingeric agents, and methyl xanthines. Examples of NSAIDs
include, but are not limited to, aspirin, ibuprofen, celecoxib
(CELEBREX.TM.), diclofenac (VOLTAREN.TM.), etodolac (LODINE.TM.),
fenoprofen (NALFON.TM.), indomethacin (INDOCIN.TM.), ketoralac
(TORADOL.TM.), oxaprozin (DAYPRO.TM.), nabumentone (RELAFEN.TM.),
sulindac (CLINORIL.TM.), tolmentin (TOLECTIN.TM.), rofecoxib
(VIOXX.TM.), naproxen (ALEVE.TM., NAPROSYN.TM.), ketoprofen
(ACTRON.TM.) and nabumetone (RELAFEN.TM.). Such NSAIDs function by
inhibiting a cyclooxygenase enzyme (e.g., COX-1 and/or COX-2).
Examples of steroidal anti-inflammatory drugs include, but are not
limited to, glucocorticoids, dexamethasone (DECADRON.TM.),
cortisone, hydrocortisone, prednisone (DELTASONE.TM.),
prednisolone, triamcinolone, azulfidine, and eicosanoids such as
prostaglandins, thromboxanes, and leukotrienes.
[0485] In specific embodiments, patients with osteoarthritis are
administered a prophylactically or therapeutically effective amount
of an effector function enhanced anti-ICOS antibody of the
invention in combination with other agents or therapies useful for
osteoarthritis prevention, treatment, management or amelioration
including but not limited to: analgesics (non-limiting examples are
acetaminophen, in a dose up to 4000 mg/d; phenacetin; and tramadol,
in a daily dose in the range of 200 to 300 mg); NSAIDs
(non-limiting examples include but not limited to, aspirin,
diflunisal, diclofenac, etodolac, fenamates, fenoprofen,
flurbiprofen, ibuprofen, indomethacin, ketoprofen,
methylsalicylate, nebumetone, naproxin, oxaprazin, phenylbutazone,
piroxicam, sulindac, and tolmetin. Low dose NSAIDs are preferred,
e.g., ibuprofen at 1200 mg/d, naproxen at 500 mg/d. A
gastroprotective agent, e.g., misoprostol, famotidine or
omeprazole, is preferred to use concurrently with a NSAID);
nonacetylated salicylates including but not limited to salsalate;
cyclooxygenase (Cox)-2-specific inhibitors (CSIs), including but
not limited to, celecoxib and rofecoxib; intra- or periarticular
injection of a depot glucocorticoid preparation; intra-articular
injection of hyaluronic acid; capsaicin cream; copious irrigation
of the osteroarthritis knee to flush out fibrin, cartilage shards
and other debris; and joint replacement surgery. Compositions and
methods of the invention can also be used in combination with other
nonpharmacologic measures in prevention, treatment, management and
amelioration of osteoarthritis including but not limited to:
reduction of joint loading (non-limiting examples are correction of
poor posture, support for excessive lumbar lordosis, avoid
excessive loading of the involved joint, avoid prolonged standing,
kneeling and squatting); application of heat to the affected joint;
aerobic exercise and other physical therapies.
[0486] In specific embodiments, patients with rheumatoid arthritis
are administered a prophylactically or therapeutically effective
amount of an effector function enhanced anti-ICOS antibody of the
invention in combination with other agents or therapies useful in
prevention, treatment, management and amelioration of rheumatoid
arthritis including but not limited to: NSAIDs (non-limiting
examples include but not limited to, aspirin, diflunisal,
diclofenac, etodolac, fenamates, fenoprofen, flurbiprofen,
ibuprofen, indomethacin, ketoprofen, methylsalicylate, nebumetone,
naproxin, oxaprazin, phenylbutazone, piroxicam, sulindac, and
tolmetin.); analgesics (non-limiting examples are acetaminophen,
phenacetin and tramadol); CSIs including but not limited to,
celecoxib and rofecoxib; glucocorticoids (preferably low-dose oral
glucocorticoids, e.g., <7.5 mg/d prednisone, or monthly pulses
with high-dose glucocorticoids, or intraarticular glucocorticoids);
disease-modifying antirheumatic drugs (DMARDs) including but not
limited to, methotrexate (preferably given intermittent low dose,
e.g., 7.5-30 mg once weekly), gold compounds (e.g., gold salts),
D-penicillamine, the antimalarials (e.g., chloroquine), and
sulfasalazine; TNF-alpha neutralizing agents including but not
limited to, etanercept and infliximab; immunosuppressive and
cytotoxic agents (examples include but not limited to,
azathioprine, leflunomide, cyclosporine, and cyclophosphamide), and
surgery (examples include but not limited to, arthroplasties, total
joint replacement, reconstructive hand surgery, open or
arthroscopic synovectomy, and early tenosynovectomy of the wrist).
The compositions and methods of the invention may also be used in
combination with other measures in prevention, treatment,
management and amelioration of the rheumatoid arthritis including
but not limited to: rest, splinting to reduce unwanted motion of
inflamed joint, exercise, used of a variety of orthotic and
assistive devices, and other physical therapies. The compositions
and methods of the invention may also be used in combination with
some nontraditional approaches in prevention, treatment, management
and amelioration of rheumatoid arthritis including but not limited
to, diets (e.g., substituting omega-3 fatty acids such as
eicosapentaenoic acid found in certain fish oils for dietary
omega-6 essential fatty acids found in meat), vaccines, hormones
and topical preparations.
[0487] In specific embodiments, patients with chronic obstructive
pulmonary disease (COPD) are administered a prophylactically or
therapeutically effective amount of an effector function enhanced
anti-ICOS antibody of the invention in combination with other
agents or therapies useful in prevention, treatment, management and
amelioration of COPD including but not limited to: bronchodilators
including but not limited to, short- and long-acting
beta2-adrenergic agonists (examples of short-acting beta2 agonist
include but not limited to, albuterol, pirbuterol, terbutaline, and
metaproterenol; examples of long-acting beta2 agonist include but
not limited to, oral sustained-release albuterol and inhaled
salmeterol), anticholinergics (examples include but not limited to
ipratropium bromide), and theophylline and its derivatives
(therapeutic range for theophylline is preferably 10-20 .mu.g/mL);
glucocorticoids; exogenous alpha1AT (e.g., alpha1AT derived from
pooled human plasma administered intravenously in a weekly dose of
60 mg/kg); oxygen; lung transplantation; lung volume reduction
surgery; endotracheal intubation, ventilation support; yearly
influenza vaccine and pneumococcal vaccination with 23-valent
polysaccharide; exercise; and smoking cessation.
[0488] In specific embodiments, patients with asthma are
administered a prophylactically or therapeutically effective amount
of an effector function enhanced anti-ICOS antibody of the
invention in combination with an effective amount of one or more
other agents useful for asthma therapy. Non-limiting examples of
such agents include adrenergic stimulants (e.g., catecholamines
(e.g., epinephrine, isoproterenol, and isoetharine), resorcinols
(e.g., metaproterenol, terbutaline, and fenoterol), and saligenins
(e.g., salbutamol)), adrenocorticoids, blucocorticoids,
corticosteroids (e.g., beclomethadonse, budesonide, flunisolide,
fluticasone, triamcinolone, methylprednisolone, prednisolone, and
prednisone), other steroids, beta2-agonists (e.g., albtuerol,
bitolterol, fenoterol, isoetharine, metaproterenol, pirbuterol,
salbutamol, terbutaline, formoterol, salmeterol, and albutamol
terbutaline), anti-cholinergics (e.g., ipratropium bromide and
oxitropium bromide), IL-4 antagonists (including antibodies), IL-5
antagonists (including antibodies), IL-9 antagonists (including
antibodies), IL-13 antagonists (including antibodies), IL.sub.--17
antagonists (including antibodies), PDE4-inhibitor, NF-Kappa-beta
inhibitor, VLA-4 inhibitor, CpG, anti-CD23, selectin antagonists
(TBC 1269), mast cell protease inhibitors (e.g., tryptase kinase
inhibitors (e.g., GW-45, GW-58, and genisteine),
phosphatidylinositide-3' (PI3)-kinase inhibitors (e.g., calphostin
C), and other kinase inhibitors (e.g., staurosporine) (see Temkin
et al., 2002 J Immunol 169(5):2662-2669; Vosseller et al., 1997
Mol. Biol. Cell 8(5):909-922; and Nagai et al., 1995 Biochem
Biophys Res Commun 208(2):576-581)), a C3 receptor antagonists
(including antibodies), immunosuppressant agents (e.g.,
methotrexate and gold salts), mast cell modulators (e.g., cromolyn
sodium (INTAL.TM.) and nedocromil sodium (TILADE.TM.)), and
mucolytic agents (e.g., acetylcysteine)). In a specific embodiment,
the anti-inflammatory agent is a leukotriene inhibitor (e.g.,
montelukast (SINGULAIR.TM.), zafirlukast (ACCOLATE.TM.), pranlukast
(ONON.TM.), or zileuton (ZYFLO.TM.)).
[0489] In specific embodiments, patients with allergy are
administered a prophylactically or therapeutically effective amount
of an effector function enhanced anti-ICOS antibody of the
invention in combination with an effective amount of one or more
other agents useful for allergy therapy. Non-limiting examples of
such agents include antimediator drugs (e.g., antihistamine),
corticosteroids, decongestants, sympathomimetic drugs (e.g.,
alpha-adrenergic and .beta-adrenergic drugs), TNX901 (Leung et al.,
N Engl J Med 348(11):986-993 (2003)), IgE antagonists (e.g.,
antibodies rhuMAb-E25 omalizumab (see Finn et al., 2003 J Allergy
Clin Immuno 111(2):278-284; Corren et al., 2003 J Allergy Clin
Immuno 111(1):87-90; Busse and Neaville, 2001 Curr Opin Allergy
Clin Immuno 1(1):105-108; and Tang and Powell, 2001, Eur J Pediatr
160(12): 696-704), HMK-12 and 6HD5 (see Miyajima et al., 2202 Int
Arch Allergy Immuno 128(1):24-32), and mAB Hu-901 (see van Neerven
et al., 2001 Int Arch Allergy Immuno 124(1-3):400), theophylline
and its derivatives, glucocorticoids, and immunotherapies (e.g.,
repeated long-term injection of allergen, short course
desensitization, and venom immunotherapy).
5.23. Autoimmune Disease
[0490] According to certain aspects of the invention, the treatment
regimen and dose used with compositions and methods of the
invention is chosen based on a number of factors including, but not
limited to, the stage of the autoimmune disease or disorder being
treated. Appropriate treatment regimens can be determined by one of
skill in the art for particular stages of an autoimmune disease or
disorder in a patient or patient population. Dose response curves
can be generated using standard protocols in the art in order to
determine the effective amount of compositions of the invention for
treating patients having different stages of a autoimmune disease
or disorder. In general, patients having more activity of a
autoimmune disease or disorder will require higher doses and/or
more frequent doses which may be administered over longer periods
of time in comparison to patients having less activity of an
autoimmune disease or disorder.
[0491] Anti-ICOS antibodies, compositions and methods may be
practiced to treat an autoimmune disease or disorder. The term
"autoimmune disease or disorder" refers to a condition in a subject
characterized by cellular, tissue and/or organ injury caused by an
immunologic reaction of the subject to its own cells, tissues
and/or organs. The term "inflammatory disease" is used
interchangeably with the term "inflammatory disorder" to refer to a
condition in a subject characterized by inflammation, including,
but not limited to chronic inflammation. Autoimmune disorders may
or may not be associated with inflammation. Moreover, inflammation
may or may not be caused by an autoimmune disorder. Thus, certain
disorders may be characterized as both autoimmune and inflammatory
disorders. Exemplary autoimmune diseases or disorders include, but
are not limited to: alopecia greata, ankylosing spondylitis,
antiphospholipid syndrome, autoimmune Addison's disease, autoimmune
diseases of the adrenal gland, autoimmune hemolytic anemia,
autoimmune hepatitis, autoimmune oophoritis and orchitis,
autoimmune thrombocytopenia, Behcet's disease, bullous pemphigoid,
cardiomyopathy, celiac sprue-dermatitis, chronic fatigue immune
dysfunction syndrome (CFIDS), chronic inflammatory demyelinating
polyneuropathy, Churg-Strauss syndrome, cicatrical pemphigoid,
CREST syndrome, cold agglutinin disease, Crohn's disease, discoid
lupus, essential mixed cryoglobulinemia, diabetes, eosinophilic
fascites, fibromyalgia-fibromyositis, glomerulonephritis, Graves'
disease, Guillain-Barre, Hashimoto's thyroiditis, Henoch-Schonlein
purpura, idiopathic pulmonary fibrosis, idiopathic/autoimmune
thrombocytopenia purpura (ITP), IgA neuropathy, juvenile arthritis,
lichen planus, lupus erthematosus, Meniere's disease, mixed
connective tissue disease, multiple sclerosis, type 1 or
immune-mediated diabetes mellitus, myasthenia gravis,
pemphigus-related disorders (e.g., pemphigus vulgaris), pernicious
anemia, polyarteritis nodosa, polychrondritis, polyglandular
syndromes, polymyalgia rheumatica, polymyositis and
dermatomyositis, primary agammaglobulinemia, primary biliary
cirrhosis, psoriasis, psoriatic arthritis, Raynauld's phenomenon,
Reiter's syndrome, Rheumatoid arthritis, sarcoidosis, scleroderma,
Sjogren's syndrome, stiff-man syndrome, systemic lupus
erythematosis (SLE), Sweet's syndrome, Still's disease, lupus
erythematosus, takayasu arteritis, temporal arteristis/giant cell
arteritis, ulcerative colitis, uveitis, vasculitides such as
dermatitis herpetiformis vasculitis, vitiligo, and Wegener's
granulomatosis. Examples of inflammatory disorders include, but are
not limited to, asthma, encephilitis, inflammatory bowel disease,
chronic obstructive pulmonary disease (COPD), allergic disorders,
septic shock, pulmonary fibrosis, undifferentitated
spondyloarthropathy, undifferentiated arthropathy, arthritis,
inflammatory osteolysis, graft versus host disease, urticaria,
Vogt-Koyanagi-Hareda syndrome and chronic inflammation resulting
from chronic viral or bacteria infections.
5.23.1.Autoimmune Disorder Treatment
[0492] An effector function enhanced anti-ICOS antibody of the
invention may be administered to a subject in need thereof to
prevent, manage, treat or ameliorate an autoimmune disorder or one
or more symptoms thereof. Compositions of the invention may also be
administered in combination with one or more other therapies,
preferably therapies useful for the prevention, management or
treatment of an autoimmune disorder (including, but not limited to
the prophylactic or therapeutic agents) to a subject in need
thereof to prevent, manage, treat or ameliorate an autoimmune
disorder or one or more symptoms thereof. In a specific embodiment,
the invention provides a method of preventing, managing, treating
or ameliorating an autoimmune disorder or one or more symptoms
thereof, said method comprising administering to a subject in need
thereof a dose of a prophylactically or therapeutically effective
amount of an effector function enhanced anti-ICOS antibody of the
invention. In another embodiment, the invention provides a method
of preventing, managing, treating or ameliorating an autoimmune
disorder or one or more symptoms thereof, said method comprising
administering to a subject in need thereof a dose of a
prophylactically or therapeutically effective amount of an effector
function enhanced anti-ICOS antibody of the invention and a dose of
a prophylactically or therapeutically effective amount of one or
more therapies (e.g., prophylactic or therapeutic agents) other
than antibodies (including antibody fragments thereof) that
immunospecifically bind to an ICOS polypeptide.
[0493] The invention provides methods for managing, treating or
ameliorating an autoimmune disorder or one or more symptoms thereof
in a subject refractory to conventional therapies for such an
autoimmune disorder, said methods comprising administering to said
subject a dose of a prophylactically or therapeutically effective
amount of an effector function enhanced anti-ICOS antibody of the
invention. The invention also provides methods for managing,
treating or ameliorating an autoimmune disorder or one or more
symptoms thereof in a subject refractory to existing single agent
therapies for such an autoimmune disorder, said methods comprising
administering to said subject a dose of a prophylactically or
therapeutically effective amount of an effector function enhanced
anti-ICOS antibody of the invention and a dose of a
prophylactically or therapeutically effective amount of one or more
therapies (e.g., prophylactic or therapeutic agents) other than
antibodies (including antibody fragments thereof) that
immunospecifically bind to an ICOS polypeptide. The invention also
provides methods for managing, treating or ameliorating an
autoimmune disorder or one or more symptoms thereof by
administering an effector function enhanced anti-ICOS antibody of
the invention in combination with any other treatment to patients
who have proven refractory to other treatments but are no longer on
these treatments. The invention also provides alternative methods
for the management or treatment of an autoimmune disorder where
another therapy has proven or may prove too toxic, i.e., results in
unacceptable or unbearable side effects, for the subject being
treated. Particularly, the invention provides alternative methods
for the management or treatment of an autoimmune disorder where the
patient is refractory to other therapies. Further, the invention
provides methods for preventing the recurrence of an autoimmune
disorder in patients that have been treated and have no disease
activity by administering an effector function enhanced anti-ICOS
antibody of the invention.
[0494] Examples of autoimmune disorders that can be treated by the
methods of the invention include, but are not limited to, alopecia
greata, ankylosing spondylitis, antiphospholipid syndrome,
autoimmune Addison's disease, autoimmune diseases of the adrenal
gland, autoimmune hemolytic anemia, autoimmune hepatitis,
autoimmune oophoritis and orchitis, autoimmune thrombocytopenia,
Behcet's disease, bullous pemphigoid, cardiomyopathy, celiac
sprue-dermatitis, chronic fatigue immune dysfunction syndrome
(CFIDS), chronic inflammatory demyelinating polyneuropathy,
Churg-Strauss syndrome, cicatrical pemphigoid, CREST syndrome, cold
agglutinin disease, Crohn's disease, discoid lupus, essential mixed
cryoglobulinemia, fibromyalgia-fibromyositis, glomerulonephritis,
Graves' disease, Guillain-Barre, Hashimoto's thyroiditis,
idiopathic pulmonary fibrosis, idiopathic thrombocytopenia purpura
(ITP), IgA neuropathy, juvenile arthritis, lichen planus, lupus
erthematosus, Mnire's disease, mixed connective tissue disease,
multiple sclerosis, type 1 or immune-mediated diabetes mellitus,
myasthenia gravis, pemphigus vulgaris, pernicious anemia,
polyarteritis nodosa, polychrondritis, polyglandular syndromes,
polymyalgia rheumatica, polymyositis and dermatomyositis, primary
agammaglobulinemia, primary biliary cirrhosis, psoriasis, psoriatic
arthritis, Raynauld's phenomenon, Reiter's syndrome, Rheumatoid
arthritis, sarcoidosis, scleroderma, Sjogren's syndrome, stiff-man
syndrome, systemic lupus erythematosus, lupus erythematosus,
takayasu arteritis, temporal arteristis/giant cell arteritis,
ulcerative colitis, uveitis, vasculitides such as dermatitis
herpetiformis vasculitis, vitiligo, and Wegener's
granulomatosis.
[0495] Autoimmune therapies and their dosages, routes of
administration and recommended usage are known in the art and have
been described in such literature as the Physician's Desk Reference
(61th ed., 2007).
5.23.2.Autoimmune Disorder Therapies
[0496] The present invention provides methods of preventing,
managing, treating or ameliorating an autoimmune disorder or one or
more symptoms thereof, said methods comprising administering to a
subject in need thereof an effector function enhanced anti-ICOS
antibody of the invention and one or more therapies (e.g.,
prophylactic or therapeutic agents) other than antibodies
(including antibody fragments thereof) that immunospecifically bind
to an ICOS polypeptide. Any agent or therapy which is known to be
useful, or which has been used or is currently being used for the
prevention, management, treatment or amelioration of an autoimmune
disorder or one or more symptoms thereof can be used in combination
with an effector function enhanced anti-ICOS antibody of the
invention in accordance with the invention described herein.
Examples of such agents include, but are not limited to,
immunomodulatory agents, anti-inflammatory agents and TNF-alpha
antagonists. Specific examples of immunomodulatory agents,
anti-inflammatory agents and TNF-alpha antagonists which can be
used in combination with an effector function enhanced anti-ICOS
antibody of the invention for the prevention, management, treatment
or amelioration of an autoimmune disorder are disclosed herein.
[0497] In specific embodiments, patients with multiple sclerosis
(MS) are administered a prophylactically or therapeutically
effective amount of an effector function enhanced anti-ICOS
antibody of the invention in combination with other agents or
therapies useful in prevention, treatment, management and
amelioration of MS including but not limited to: IFN-beta1b
(Betaseron) (e.g., 8.0 million international unites (MIU) is
administered by subcutaneous injection every other day); IFN-beta1a
(Avonex) (e.g., 6.0 MIU is administered by intramuscular injection
once every week); glatiramer acetate (Copaxone) (e.g., 20 mg is
administered by subcutaneous injection every day); mitoxantrone
(e.g., 12 mg/m.sup.2 is administered by intravenous infusion every
third month); azathioprine (e.g., 2-3 mg/kg body weight is
administered orally each day); methotrexate (e.g., 7.5 mg is
administered orally once each week); cyclophosphamide; intravenous
immunoglobulin (e.g., 0.15-0.2 g/kg body weight administered
monthly for up to 2 years); glucocorticoids; methylprednisolone
(e.g., administered in bimonthly cycles at high doses);
2-chlorodeoxyadenosine (cladribine); baclofen (e.g., 15 to 80 mg/d
in divided doses, or orally in higher doses up to 240 mg/d, or
intrathecally via an indwelling catheter); cycloenzaprine
hydrochloride (e.g., 5-10 mg bid or tid); clonazepam (e.g., 0.5 to
1.0 mg tid, including bedtime dose); clonidine hydrochloride (e.g.,
0.1 to 0.2 mg tid, including a bedtime dose); carbamazepine (e.g.,
100-1200 mg/d in divided, escalating doses); gabapentin (e.g.,
300-3600 mg/d); dilantin (e.g., 300-400 mg/d); amitriptyline (e.g.,
25-150 mg/d); baclofen (e.g., 10-80 mg/d); primidone (e.g., 125-250
mg bid or tid); ondansetron (e.g., 4 to 8 mg bid or tid); isoniazid
(e.g., up to 1200 mg in divided doses); oxybutynin (e.g., 5 mg bid
or tid); tolterodine (e.g., 1-2 mg bid); propantheline (e.g., 7.5
to 15 mg qid); bethanecol (e.g., 10-50 mg tid or qid); terazosin
hydrochloride (e.g., 1-5 mg at bedtime); sildenafil citrate (e.g.,
50-100 mg po prn); amantading (e.g., 100 mg bid); pemoline (e.g.,
37.5 mg bid); high dose vitamins; calcium orotate; gancyclovir;
antibiotic; and plasma exchange.
[0498] In specific embodiments, patients with psoriasis are
administered a prophylactically or therapeutically effective amount
of an effector function enhanced anti-ICOS antibody of the
invention in combination with other agents or therapies useful in
prevention, treatment, management and amelioration of psoriasis
including but not limited to: topical steroid cream or ointment;
tar (examples including but not limited to, Estar, Psorigel,
Fototar cream, and LCD 10% in Nutraderm lotion or mixed directly
with triamcinolone 0.1% cream); occlusion; topical vitamin D
analogue (a non-limiting example is calcipotriene ointment);
ultraviolet light; PUVA (psoralen plus ultraviolet A); methotrexate
(e.g., up to 25 mg once weekly or in divided doses every 12 hours
for three doses once a week); synthetic retinoid (a non-limiting
examples is etretinate, e.g., in dosage of 0.5-1 mg/kg/d);
immunomodulatory therapy (a non-limiting example is cyclosporine);
sulfasalazine (e.g., in dosages of 1 g three times daily).
[0499] In specific embodiments, patients with Crohn's disease are
administered a prophylactically or therapeutically effective amount
of an effector function enhanced anti-ICOS antibody of the
invention in combination with other agents or therapies useful in
prevention, treatment, management and amelioration of Crohn's
disease including but not limited to: antidiarrheals (e.g.,
loperamide 2-4 mg up to 4 times a day, diphenoxylate with atropine
1 tablet up to 4 times a day, tincture of opium 8-15 drops up to 4
times a day, cholestyramine 2-4 g or colestipol 5 g once or twice
daily), antispasmodics (e.g., propantheline 15 mg, dicyclomine
10-20 mg, or hyoscyamine 0.125 mg given before meals),
5-aminosalicylic acid agents (e.g., sulfasalazine 1.5-2 g twice
daily, mesalamine (ASACOL.TM.) and its slow release form
(PENTASA.TM.), especially at high dosages, e.g., PENTASA.TM. 1 g
four times daily and ASACOL.TM. 0.8-1.2 g four times daily),
corticosteroids, immunomodulatory drugs (e.g., azathioprine (1-2
mg/kg), mercaptopurine (50-100 mg), cyclosporine, and
methotrexate), antibiotics, TNF inhibitors (e.g., inflixmab
(REMICADE.TM.)), immunosuppressive agents (e.g., tacrolimus,
mycophenolate mofetil, and thalidomide), anti-inflammatory
cytokines (e.g., IL-10 and IL-11), nutritional therapies, enteral
therapy with elemental diets (e.g., Vivonex for 4 weeks), and total
parenteral nutrition.
[0500] In specific embodiments, patients with lupus erythematosus
are administered a prophylactically or therapeutically effective
amount of an effector function enhanced anti-ICOS antibody of the
invention in combination with other agents or therapies useful in
prevention, treatment, management and amelioration of lupus
erythematosus including but not limited to: antimalarials
(including but not limited to, hydroxychloroquine); glucocorticoids
(e.g., low dose, high dose, or high-dose intravenous pulse therapy
can be used); immunosuppressive agents (including but not limited
to, cyclophosphamide, chlorambucil, and azanthioprine); cytotoxic
agents (including but not limited to methotrexate and mycophenolate
mofetil); androgenic steroids (including but not limited to
danazol); and anticoagulants (including but not limited to
warfarin).
[0501] The antibody formulations of the invention or combination
therapies of the invention may be used as the first, second, third,
fourth, or fifth therapy to prevent, manage, treat, and/or
ameliorate an autoimmune disorder or one or more symptom thereof.
The invention also includes methods of preventing, treating,
managing, and/or ameliorating an autoimmune disorder or one or more
symptoms thereof in a patient undergoing therapies for other
disease or disorders. The invention encompasses methods of
preventing, managing, treating, and/or ameliorating an autoimmune
disorder or one or more symptoms thereof in a patient before any
adverse effects or intolerance to therapies other than antibodies
of the invention develops. The invention also encompasses methods
of preventing, treating, managing, and/or ameliorating an
autoimmune disorder or a symptom thereof in refractory patients.
The invention encompasses methods for preventing, treating,
managing, and/or ameliorating a proliferative disorder or a symptom
thereof in a patient who has proven refractory to therapies other
than antibodies, compositions, or combination therapies of the
invention. The determination of whether a patient is refractory can
be made either in vivo or in vitro by any method known in the art
for assaying the effectiveness of a treatment of autoimmune
disorders, using art-accepted meanings of "refractory" such a
context. In certain embodiments, a patent with an autoimmune
disorder is refractory to a therapy when one or more symptoms of an
autoimmune disorder is not prevented, managed, and/or alleviated.
The invention also encompasses methods of preventing, managing,
treating, and/or ameliorating an autoimmune disorder or a symptom
thereof in patients who are susceptible to adverse reactions to
conventional therapies.
[0502] The present invention encompasses methods for preventing,
treating, managing, and/or ameliorating an autoimmune disorder or
one or more symptoms thereof as an alternative to other
conventional therapies. In specific embodiments, the patient being
managed or treated in accordance with the methods of the invention
is refractory to other therapies or is susceptible to adverse
reactions from such therapies. The patient may be a person with a
suppressed immune system (e.g., post-operative patients,
chemotherapy patients, and patients with immunodeficiency disease,
patients with broncho-pulmonary dysplasia, patients with congenital
heart disease, patients with cystic fibrosis, patients with
acquired or congenital heart disease, and patients suffering from
an infection), a person with impaired renal or liver function, the
elderly, children, infants, infants born prematurely, persons with
neuropsychiatric disorders or those who take psychotropic drugs,
persons with histories of seizures, or persons on medication that
would negatively interact with conventional agents used to prevent,
manage, treat, or ameliorate an autoimmune disease or disorder.
[0503] Autoimmune therapies and their dosages, routes of
administration and recommended usage are known in the art and have
been described in such literature as the Physician's Desk Reference
(61th ed., 2007).
5.23.3. Diagnosis of Autoimmune Diseases or Disorders
[0504] The diagnosis of an autoimmune disease or disorder is
complicated in that each type of autoimmune disease or disorder
manifests differently among patients. This heterogeneity of
symptoms means that multiple factors are typically used to arrive
at a clinical diagnosis. Generally, clinicians use factors, such
as, but not limited to, the presence of autoantibodies, elevated
cytokine levels, specific organ dysfunction, skin rashes, joint
swelling, pain, bone remodeling, and/or loss of movement as
primarily indicators of an autoimmune disease or disorder. For
certain autoimmune diseases or disorders, such as RA and SLE,
standards for diagnosis are known in the art. For certain
autoimmune diseases or disorders, stages of disease have been
characterized and are well known in the art. These art recognized
methods for diagnosing autoimmune diseases and disorders as well as
stages of disease and scales of activity and/or severity of disease
that are well known in the art can be used to identify patients and
patient populations in need of treatment for an autoimmune disease
or disorder using compositions and methods of the invention.
5.23.4. Clinical Criteria for Diagnosing Autoimmune Diseases or
Disorders
[0505] Diagnostic criteria for different autoimmune diseases or
disorders are known in the art. Historically, diagnosis is
typically based on a combination of physical symptoms. More
recently, molecular techniques such as gene-expression profiling
have been applied to develop molecular definitions of autoimmune
diseases or disorders. Exemplary methods for clinical diagnosis of
particular autoimmune diseases or disorders are provided below.
Other suitable methods will be apparent to those skilled in the
art.
[0506] In certain embodiments, patients with low levels of
autoimmune disease activity or patients with an early stage of an
autoimmune disease (for diseases where stages are recognized) can
be identified for treatment using anti-ICOS antibody compositions
and methods. The early diagnosis of autoimmune disease is difficult
due to the general symptoms and overlap of symptoms among diseases.
In such embodiments, a patient treated at an early stage or with
low levels of an autoimmune disease activity has symptoms
comprising at least one symptom of an autoimmune disease or
disorder. In related embodiments, a patient treated at an early
stage or with low levels of an autoimmune disease has symptoms
comprising at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
or 15 symptoms of an autoimmune disease or disorder. The symptoms
may be of any autoimmune diseases and disorders or a combination
thereof. Examples of autoimmune disease and disorder symptoms are
described below.
5.24. Immunotherapeutic Protocols
[0507] Anti-ICOS antibody compositions used in the therapeutic
regimen/protocols, referred to herein as "anti-ICOS immunotherapy"
can be naked antibodies, immunoconjugates and/or fusion proteins.
Compositions of the invention can be used as a single agent therapy
or in combination with other therapeutic agents or regimens.
Anti-ICOS antibodies or immunoconjugates can be administered prior
to, concurrently with, or following the administration of one or
more therapeutic agents. Therapeutic agents that can be used in
combination therapeutic regimens with compositions of the invention
include any substance that inhibits or prevents the function of
cells and/or causes destruction of cells. Examples include, but are
not limited to, radioactive isotopes, chemotherapeutic agents, and
toxins such as enzymatically active toxins of bacterial, fungal,
plant or animal origin, or fragments thereof.
[0508] The therapeutic regimens described herein, or any desired
treatment regimen can be tested for efficacy using a transgenic
animal model which expresses human ICOS antigen in place of native
ICOS antigen. Thus, an anti-ICOS antibody treatment regimen can be
tested in an animal model to determine efficacy before
administration to a human.
5.25. Anti-ICOS Immunotherapy
[0509] In accordance with the present invention "anti-ICOS
immunotherapy" encompasses the administration of any of the
anti-ICOS antibodies of the invention in accordance with any
therapeutic regimen described herein. Anti-ICOS antibodies can be
administered as naked antibodies, or immunoconjugates or fusion
proteins. In one embodiment, a human subject having a T
cell-mediated disease or disorder can be treated by administering
an anti-ICOS antibody capable to mediate human ADCC.
[0510] Antibodies of IgG1 or IgG3 human isotypes are in some cases
preferred for therapy. However, the IgG2 or IgG4 human isotypes can
be used as well, provided they have the relevant effector function,
for example human ADCC. Such effector function can be assessed by
measuring the ability of the antibody in question to mediate target
cell lysis by effector cells in vitro or in vivo.
[0511] In one embodiment, the dose of antibody used should be
sufficient to deplete circulating ICOS expressing T cells. Progress
of the therapy can be monitored in the patient by analyzing blood
samples. Other signs of clinical improvement can be used to monitor
therapy.
[0512] Methods for measuring depletion of ICOS expressing T cells
that can be used in connection with compositions and methods of the
invention are well known in the art and include, but are not
limited to the following embodiments. In one embodiment,
circulating ICOS expressing T cells depletion can be measured with
flow cytometry using a reagent other than an anti-ICOS antibody
that binds to ICOS expressing T cells to define the amount of ICOS
expressing T cells. In another embodiment, ICOS expressing T cell
depletion can be measured by immunochemical staining to identify
ICOS expressing T cells. In such embodiments, ICOS expressing T
cells or tissues or serum comprising ICOS expressing T cells
extracted from a patient can be placed on microscope slides,
labeled and examined for presence or absence. In related
embodiments, a comparison is made between ICOS expressing T cells
extracted prior to therapy and after therapy to determine
differences in the presence of ICOS expressing T cells.
[0513] In embodiments of the invention where an anti-ICOS antibody
is administered as a single agent therapy, the invention
contemplates use of different treatment regimens.
[0514] According to certain aspects of the invention, an anti-ICOS
antibody used in compositions and methods of the invention, is a
naked antibody. In related embodiments, the dose of naked anti-ICOS
antibody used is at least about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7,
0.8, 0.9, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5,
8, 8.5, 9, 9.5, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5,
15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5 mg/kg of
body weight of a patient. In certain embodiments, the dose of naked
anti-ICOS antibody used is at least about 1 to 10, 5 to 15, 10 to
20, or 15 to 25 mg/kg of body weight of a patient. In certain
embodiments, the dose of naked anti-ICOS antibody used is at least
about 1 to 20, 3 to 15, or 5 to 10 mg/kg of body weight of a
patient. In other embodiments, the dose of naked anti-ICOS antibody
used is at least about 5, 6, 7, 8, 9, or 10 mg/kg of body weight of
a patient.
[0515] In certain embodiments, the dose comprises about 375
mg/m.sup.2 of anti-ICOS antibody administered weekly for about 1,
2, 3, 4, 5, 6, 7 or 8 consecutive weeks. In certain embodiments,
the dose is at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, or 15 mg/kg of body weight of the patient administered
weekly for about 1, 2, 3, 4, 5, 6, 7 or 8 consecutive weeks.
[0516] The exemplary doses of anti-ICOS antibody described above
can be administered as described herein. In one embodiment, the
above doses are single dose injections. In other embodiments, the
doses are administered over a period of time. In other embodiments,
the doses are administered multiple times over a period of time.
The period of time may be measured in days, weeks, or months.
Multiple doses of an anti-ICOS antibody can be administered at
intervals suitable to achieve a therapeutic benefit while balancing
toxic side effects. For example, where multiple doses are used, it
may be preferred to time the intervals to allow for recovery of the
patient's monocyte count prior to the repeat treatment with
antibody. This dosing regimen will optimize the efficiency of
treatment, since the monocyte population reflects ADCC function in
the patient.
[0517] In certain embodiments, compositions of the invention are
administered to a human patient as long as the patient is
responsive to therapy. In other embodiments, compositions of the
invention are administered to a human patient as long as the
patient's disease does not progress. In related embodiments,
compositions of the invention are administered to a human patient
until a patient's disease does not progress or has not progressed
for a period of time, then the patient is not administered
compositions of the invention unless the disease reoccurs or begins
to progress again. If disease progression stops or reverses, then
he patient will not be administered compositions of the invention
until that patient relapses, i.e., the disease being treated
reoccurs or progresses. Upon this reoccurrence or progression, the
patient can be treated again with the same dosing regimen initially
used or using other doses described above.
[0518] In certain embodiments, compositions of the invention can be
administered as a loading dose followed by multiple lower doses
(maintenance doses) over a period of time. In such embodiments, the
doses may be timed and the amount adjusted to maintain effective
ICOS expressing T cell depletion. In certain embodiments, the
loading dose is about 10, 11, 12, 13, 14, 15, 16, 17, or 18 mg/kg
of patient body weight and the maintenance dose is at least about 5
to 10 mg/kg of patient body weight. In other embodiments, the
maintenance dose is administered at intervals of every 7, 10, 14 or
21 days.
5.26. Combination with Chemotherapeutic Agents
[0519] Anti-ICOS immunotherapy (using naked antibody,
immunoconjugates, or fusion proteins) can be used in conjunction
with other therapies including but not limited to, chemotherapy,
radioimmunotherapy (RIT), chemotherapy and external beam radiation
(combined modality therapy, CMT), or combined modality
radioimmunotherapy (CMRIT) alone or in combination, etc. In certain
embodiments, an anti-ICOS antibody therapy of the present invention
can be administered in conjunction with CHOP
(Cyclophosphamide-Hydroxydoxorubicin-Oncovin
(vincristine)-Prednisolone) As used herein, the term "administered
in conjunction with" means that an anti-ICOS immunotherapy can be
administered before, during, or subsequent to the other therapy
employed.
[0520] In certain embodiments, an anti-ICOS immunotherapy is in
conjunction with a cytotoxic radionuclide or radiotherapeutic
isotope. For example, an alpha-emitting isotope such as .sup.225Ac,
.sup.224Ac, .sup.211At, .sup.212Bi, .sup.213Bi, .sup.212Pb,
.sup.224Ra, or .sup.223Ra. The cytotoxic radionuclide may also be a
beta-emitting isotope such as .sup.186Re, .sup.188Re, .sup.90Y,
.sup.131I, .sup.67Cu, .sup.177Lu, .sup.153Sm, .sup.166Ho, or
.sup.64Cu. Further, the cytotoxic radionuclide may emit Auger and
low energy electrons and include the isotopes .sup.125I, .sup.123I
or .sup.77Br. In other embodiments the isotope may be .sup.198Au,
.sup.32P, and the like. In certain embodiments, the amount of the
radionuclide administered to the subject is between about 0.001
mCi/kg and about 10 mCi/kg.
[0521] In some embodiments, the amount of the radionuclide
administered to the subject is between about 0.1 mCi/kg and about
1.0 mCi/kg. In other embodiments, the amount of the radionuclide
administered to the subject is between about 0.005 mCi/kg and 0.1
mCi/kg.
[0522] In certain embodiments, an anti-ICOS immunotherapy is in
conjunction with a chemical toxin or chemotherapeutic agent. The
chemical toxin or chemotherapeutic agent may be selected from the
group consisting of an enediyne such as calicheamicin and
esperamicin; duocarmycin, methotrexate, doxorubicin, melphalan,
chlorambucil, ARA-C, vindesine, mitomycin C, cis-platinum,
etoposide, bleomycin and 5-fluorouracil.
[0523] Suitable chemical toxins or chemotherapeutic agents that can
be used in combination therapies with an anti-ICOS immunotherapy
include members of the enediyne family of molecules, such as
calicheamicin and esperamicin. Chemical toxins can also be taken
from the group consisting of duocarmycin (see, e.g., U.S. Pat. No.
5,703,080 and U.S. Pat. No. 4,923,990), methotrexate, doxorubicin,
melphalan, chlorambucil, ARA-C, vindesine, mitomycin C,
cis-platinum, etoposide, bleomycin and 5-fluorouracil. Examples of
chemotherapeutic agents also include Adriamycin, Doxorubicin,
5-Fluorouracil, Cytosine arabinoside ("Ara-C"), Cyclophosphamide,
Thiotepa, Taxotere (docetaxel), Busulfan, Cytoxin, Taxol,
Methotrexate, Cisplatin, Melphalan, Vinblastine, Bleomycin,
Etoposide, Ifosfamide, Mitomycin C, Mitoxantrone, Vincreistine,
Vinorelbine, Carboplatin, Teniposide, Daunomycin, Caminomycin,
Aminopterin, Dactinomycin, Mitomycins, Esperamicins (see, U.S. Pat.
No. 4,675,187), Melphalan and other related nitrogen mustards.
[0524] In other embodiments, for example, "CVB" (1.5 g/m.sup.2
cyclophosphamide, 200-400 mg/m.sup.2 etoposide, and 150-200
mg/m.sup.2 carmustine) can be used in combination therapies of the
invention. CVB is a regimen used to treat non-Hodgkin's lymphoma.
Patti et al., Eur. J. Haematol. 51:18 (1993). Other suitable
combination chemotherapeutic regimens are well-known to those of
skill in the art. See, for example, Freedman et al., "Non-Hodgkin's
Lymphomas," in CANCER MEDICINE, VOLUME 2, 3rd Edition, Holland et
al (eds.), pp. 2028-2068 (Lea & Febiger 1993). As an
illustration, first generation chemotherapeutic regimens for
treatment of intermediate-grade non-Hodgkin's lymphoma include
C-MOPP (cyclophosphamide, vincristine, procarbazine and prednisone)
and CHOP (cyclophosphamide, doxorubicin, vincristine, and
prednisone). A useful second generation chemotherapeutic regimen is
m-BACOD (methotrexate, bleomycin, doxorubicin, cyclophosphamide,
vincristine, dexamethasone and leucovorin), while a suitable third
generation regimen is MACOP-B (methotrexate, doxorubicin,
cyclophosphamide, vincristine, prednisone, bleomycin and
leucovorin). Additional useful drugs include phenyl butyrate and
brostatin-1. In a multimodal therapy, both chemotherapeutic drugs
and cytokines are co-administered with an antibody, immunoconjugate
or fusion protein according to the present invention. The
cytokines, chemotherapeutic drugs and antibody, immunoconjugate or
fusion protein can be administered in any order, or together.
[0525] Other toxins that may be used in compositions and methods of
the invention include poisonous lectins, plant toxins such as
ricin, abrin, modeccin, botulina and diphtheria toxins. Of course,
combinations of the various toxins could also be coupled to one
antibody molecule thereby accommodating variable cytotoxicity.
Illustrative of toxins which are suitably employed in combination
therapies of the invention are ricin, abrin, ribonuclease, DNase I,
Staphylococcal enterotoxin-A, pokeweed antiviral protein, gelonin,
diphtherin toxin, Pseudomonas exotoxin, and Pseudomonas endotoxin.
See, for example, Pastan et al., Cell 47:641 (1986), and Goldenberg
et al., Cancer Journal for Clinicians 44:43 (1994). Enzymatically
active toxins and fragments thereof which can be used include
diphtheria A chain, nonbinding active fragments of diphtheria
toxin, exotoxin A chain (from Pseudomonas aeruginosa), ricin A
chain, abrin A chain, modeccin A chain, alpha-sarcin, Aleurites
fordii proteins, dianthin proteins, Phytolaca americana proteins
(PAPI, PAPII, and PAP-S), momordica charantia inhibitor, curcin,
crotin, sapaonaria officinalis inhibitor, gelonin, mitogellin,
restrictocin, phenomycin, enomycin and the tricothecenes. See, for
example, WO 93/21232 published Oct. 28, 1993.
[0526] Suitable toxins and chemotherapeutic agents are described in
REMINGTON'S PHARMACEUTICAL SCIENCES, 19th Ed. (Mack Publishing Co.
1995), and in GOODMAN AND GILMAN'S THE PHARMACOLOGICAL BASIS OF
THERAPEUTICS, 7th Ed. (MacMillan Publishing Co. 1985). Other
suitable toxins and/or chemotherapeutic agents are known to those
of skill in the art.
[0527] An anti-ICOS immunotherapy of the present invention may also
be in conjunction with a prodrug-activating enzyme which converts a
prodrug (e.g., a peptidyl chemotherapeutic agent, see, WO81/01145)
to an active anti-cancer drug. See, for example, WO 88/07378 and
U.S. Pat. No. 4,975,278. The enzyme component of such combinations
includes any enzyme capable of acting on a prodrug in such a way so
as to covert it into its more active, cytotoxic form. The term
"prodrug" as used in this application refers to a precursor or
derivative form of a pharmaceutically active substance that is less
cytotoxic to tumor cells compared to the parent drug and is capable
of being enzymatically activated or converted into the more active
parent form. See, e.g., Wilman, "Prodrugs in Cancer Chemotherapy"
Biochemical Society Transactions, 14, pp. 375-382, 615th Meeting
Belfast (1986) and Stella et al., "Prodrugs: A Chemical Approach to
Targeted Drug Delivery," Directed Drug Delivery, Borchardt et al.
(ed.), pp. 247-267, Humana Press (1985). Prodrugs that can be used
in combination with anti-ICOS antibodies include, but are not
limited to, phosphate-containing prodrugs, thiophosphate-containing
prodrugs, sulfate-containing prodrugs, peptide-containing prodrugs,
D-amino acid-modified prodrugs, glycosylated prodrugs,
.alpha.-lactam-containing prodrugs, optionally substituted
phenoxyacetamide-containing prodrugs or optionally substituted
phenylacetamide-containing prodrugs, 5-fluorocytosine and other
5-fluorouridine prodrugs which can be converted into the more
active cytotoxic free drug. Examples of cytotoxic drugs that can be
derivatized into a prodrug form for use in this invention include,
but are not limited to, those chemotherapeutic agents described
above.
[0528] In certain embodiments, administration of compositions and
methods of the invention may enable the postponement of toxic
therapy and may help avoid unnecessary side effects and the risks
of complications associated with chemotherapy and delay development
of resistance to chemotherapy. In certain embodiments, toxic
therapies and/or resistance to toxic therapies is delayed in
patients administered compositions and methods of the invention
delay for up to about 6 months, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10
years.
5.27. Combination with Therapeutic Antibodies
[0529] An anti-ICOS immunotherapy described herein may be
administered in combination with other antibodies, including, but
not limited to, anti-CD19 mAb, anti-CD52 mAb, anti-CD22 antibody,
and anti-CD20 antibodies, such as RITUXAN.TM. (C2B8; RITUXIMAB.TM.;
IDEC Pharmaceuticals). Other examples of therapeutic antibodies
that can be used in combination with antibodies of the invention or
used in compositions of the invention include, but are not limited
to, HERCEPTIN.TM. (Trastuzumab; Genentech), MYLOTARG.TM.
(Gemtuzumab ozogamicin; Wyeth Pharmaceuticals), CAMPATH.TM.
(Alemtuzumab; Berlex), ZEVALIN.TM. (Ipritumomab tiuxetan; Biogen
Idec), BEXXAR.TM. (Tositumomab; GlaxoSmithKline Corixa),
ERBITUX.TM. (Cetuximab; Imclone), and AVASTIN.TM. (Bevacizumab;
Genentech).
5.28. Combination Compounds that Enhance Monocyte or Macrophage
Function
[0530] In certain embodiments of methods of the invention, a
compound that enhances monocyte or macrophage function (e.g., at
least about 25%, 50%, 75%, 85%, 90%, 95% or more) can be used in
conjunction with an anti-ICOS immunotherapy. Such compounds are
known in the art and include, without limitation, cytokines such as
interleukins (e.g., IL-12), and interferons (e.g., alpha or gamma
interferon).
[0531] The compound that enhances monocyte or macrophage function
or enhancement can be formulated in the same pharmaceutical
composition as the antibody, immunoconjugate or antigen-binding
fragment. When administered separately, the antibody/fragment and
the compound can be administered concurrently (within a period of
hours of each other), can be administered during the same course of
therapy, or can be administered sequentially (i.e., the patient
first receives a course of the antibody/fragment treatment and then
a course of the compound that enhances macrophage/monocyte function
or vice versa). In such embodiments, the compound that enhances
monocyte or macrophage function is administered to the human
subject prior to, concurrently with, or following treatment with
other therapeutic regimens and/or compositions of the invention. In
one embodiment, the human subject has a blood leukocyte, monocyte,
neutrophil, lymphocyte, and/or basophil count that is within the
normal range for humans. Normal ranges for human blood leukocytes
(total) is about 3.5-about 10.5 (10.sup.9/L). Normal ranges for
human blood neutrophils is about 1.7-about 7.0 (10.sup.9/L),
monocytes is about 0.3-about 0.9 (10.sup.9/L), lymphocytes is about
0.9-about 2.9 (10.sup.9/L), basophils is about 0-about 0.3
(10.sup.9/L), and eosinophils is about 0.05-about 0.5 (10.sup.9/L).
In other embodiments, the human subject has a blood leukocyte count
that is less than the normal range for humans, for example at least
about 0.01, 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8
(10.sup.9/L) leukocytes.
5.29. Combination with Immunoregulatory Agents
[0532] The anti-ICOS immunotherapy of the present invention may
also be in conjunction with an immunoregulatory agent. The term
"immunoregulatory agent" as used herein for combination therapy
refers to substances that act to suppress, mask, or enhance the
immune system of the host.
[0533] Examples of immunomodulatory agents include, but are not
limited to, proteinaceous agents such as cytokines, peptide
mimetics, and antibodies (e.g., human, humanized, chimeric,
monoclonal, polyclonal, Fvs, ScFvs, Fab or F(ab).sub.2 fragments or
epitope binding fragments), nucleic acid molecules (e.g., antisense
nucleic acid molecules, RNAi and triple helices), small molecules,
organic compounds, and inorganic compounds. In particular,
immunomodulatory agents include, but are not limited to,
methothrexate, leflunomide, cyclophosphamide, cytoxan, Immuran,
cyclosporine A, minocycline, azathioprine, antibiotics (e.g., FK506
(tacrolimus)), methylprednisolone (MP), corticosteroids, steriods,
mycophenolate mofetil, rapamycin (sirolimus), mizoribine,
deoxyspergualin, brequinar, malononitriloamindes (e.g.,
leflunamide), T cell receptor modulators, and cytokine receptor
modulators. Examples of immunosupressant, include, but are not
limited to, mycophenolate mofetil (CELLCEPT.TM.), D-penicillamine
(CUPRIMINE.TM., DEPEN.TM.), methotrexate (RHEUMATREX.TM.,
TREXALL.TM.), and hydroxychloroquine sulfate (PLAQUENIL.TM.).
[0534] Immunomodulatory agents would also include substances that
suppress cytokine production, downregulate or suppress self-antigen
expression, or mask the MHC antigens. Examples of such agents
include 2-amino-6-aryl-5-substituted pyrimidines (see, U.S. Pat.
No. 4,665,077), azathioprine (or cyclophosphamide, if there is an
adverse reaction to azathioprine); bromocryptine; glutaraldehyde
(which masks the MHC antigens, as described in U.S. Pat. No.
4,120,649); anti-idiotypic antibodies for MHC antigens and MHC
fragments; cyclosporin A; steroids such as glucocorticosteroids,
e.g., prednisone, methylprednisolone, and dexamethasone; cytokine
or cytokine receptor antagonists including anti-interferon-gamma,
-beta, or -alpha antibodies; anti-tumor necrosis factor-alpha
antibodies; anti-tumor necrosis factor-beta antibodies;
anti-interleukin-2 antibodies and anti-IL-2 receptor antibodies;
anti-L3T4 antibodies; heterologous anti-lymphocyte globulin; pan-T
antibodies, preferably anti-CD3 or anti-CD4/CD4a antibodies;
soluble peptide containing a LFA-3 binding domain (WO 90/08187
published Jul. 26, 1990); streptokinase; TGF-.beta.; streptodomase;
RNA or DNA from the host; FK506; RS-61443; deoxyspergualin;
rapamycin; T-cell receptor (U.S. Pat. No. 5,114,721); T-cell
receptor fragments (Offner et al., Science 251:430-432 (1991); WO
90/11294; and WO 91/01133); and T-Cell receptor antibodies (EP
340,109) such as T10B9.
[0535] Examples of cytokines include, but are not limited to
lymphokines, monokines, and traditional polypeptide hormones.
Included among the cytokines are growth hormone such as human
growth hormone, N-methionyl human growth hormone, and bovine growth
hormone; parathyroid hormone; thyroxine; insulin; proinsulin;
relaxin; prorelaxin; glycoprotein hormones such as follicle
stimulating hormone (FSH), thyroid stimulating hormone (TSH), and
luteinizing hormone (LH); hepatic growth factor; fibroblast growth
factor; prolactin; placental lactogen; tumor necrosis factor-alpha;
mullerian-inhibiting substance; mouse gonadotropin-associated
peptide; inhibin; activin; vascular endothelial growth factor;
integrin; thrombopoiotin (TPO); nerve growth factors such as
NGF-alpha; platelet-growth factor; transforming growth factors
(TGFs) such as TGF-alpha and TGF-alpha; insulin-like growth
factor-I and -II; erythropoietin (EPO); osteoinductive factors;
interferons; colony stimulating factors (CSFs) such as
macrophage-CSF (M-CSF); granulocyte-macrophage-CgP (GM-CSP); and
granulocyte-CSF (G-CSF); interleukins (ILs) such as IL-1, IL-1a,
IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-11, IL-12,
IL-15; a tumor necrosis factor such as TNF-alpha or TNF-beta; and
other polypeptide factors including LIF and kit ligand (KL). As
used herein, the term cytokine includes proteins from natural
sources or from recombinant cell culture and biologically active
equivalents of the native sequence cytokines. In certain
embodiments, the methods further include administering to the
subject one or more immunomodulatory agents, preferably a cytokine.
Preferred cytokines are selected from the group consisting of
interleukin-1 (IL-1), IL-2, IL-3, IL-12, IL-15, IL-18, G-CSF,
GM-CSF, thrombopoietin, and gamma interferon.
[0536] In certain embodiments, the immunomodulatory agent is a
cytokine receptor modulator. Examples of cytokine receptor
modulators include, but are not limited to, soluble cytokine
receptors (e.g., the extracellular domain of a TNF-alpha receptor
or a fragment thereof, the extracellular domain of an IL-1beta
receptor or a fragment thereof, and the extracellular domain of an
IL-6 receptor or a fragment thereof), cytokines or fragments
thereof (e.g., interleukin (IL)-2, IL-3, IL-4, IL-5, IL-6, IL-7,
IL-8, IL-9, IL-10, IL-11, IL-12, IL-15, TNF-alpha, TNF-beta,
interferon (IFN)-alpha, IFN-beta, IFN-gamma, and GM-CSF),
anti-cytokine receptor antibodies (e.g., anti-IL-2 receptor
antibodies, anti-IL-4 receptor antibodies, anti-IL-6 receptor
antibodies, anti-IL-10 receptor antibodies, and anti-IL-12 receptor
antibodies), anti-cytokine antibodies (e.g., anti-IFN receptor
antibodies, anti-TNF-alpha antibodies, anti-IL-1beta antibodies,
anti-IL-6 antibodies, anti-IL-9, anti-IL-17 antibodies, antibodies,
and anti-IL-12 antibodies). In a specific embodiment, a cytokine
receptor modulator is IL-4, IL-10, or a fragment thereof. In
another embodiment, a cytokine receptor modulator is an
anti-IL-1beta antibody, anti-IL-6 antibody, anti-IL-12 receptor
antibody, anti-TNF-alpha antibody. In another embodiment, a
cytokine receptor modulator is the extracellular domain of a
TNF-alpha receptor or a fragment thereof. In certain embodiments, a
cytokine receptor modulator is not a TNF-alpha antagonist.
[0537] In certain embodiments, the immunomodulatory agent is a T
cell receptor modulator. Examples of T cell receptor modulators
include, but are not limited to, anti-T cell receptor antibodies
(e.g., anti-CD4 antibodies (e.g., cM-T412 (Boeringer), IDEC-CE9.1
(IDEC and SKB), mAB 4162W94, Orthoclone and OKTcdr4a
(Janssen-Cilag)), anti-CD3 antibodies, anti-CD5 antibodies (e.g.,
an anti-CD5 ricin-linked immunoconjugate), anti-CD7 antibodies
(e.g., CHH-380 (Novartis)), anti-CD8 antibodies, anti-CD40 ligand
monoclonal antibodies, anti-CD52 antibodies (e.g., CAMPATH 1H
(Ilex)), anti-CD2 monoclonal antibodies) and
CTLA4-immunoglobulin.
[0538] In certain embodiments, the immunomodulatory agent is a
TNF-alpha antagonist. Examples of TNF-alpha antagonists include,
but are not limited to, antibodies (e.g., infliximab (REMICADE.TM.;
Centocor), D2E7 (Abbott Laboratories/Knoll Pharmaceuticals Co., Mt.
Olive, N.J.), CDP571 which is also known as HUMIRA.TM. and CDP-870
(both of Celltech/Pharmacia, Slough, U.K.), and TN3-19.12 (Williams
et al., 1994, Proc. Natl. Acad. Sci. USA 91: 2762-2766; Thorbecke
et al., 1992, Proc. Natl. Acad. Sci. USA 89:7375-7379)) soluble
TNF-alpha receptors (e.g., sTNF-R1 (Amgen), etanercept (ENBREL.TM.;
Immunex) and its rat homolog RENBREL.TM., soluble inhibitors of
TNF-alpha derived from TNFrI, TNFrII (Kohno et al., 1990, Proc.
Natl. Acad. Sci. USA, 87:8331-8335), and TNF-alpha Inh (Seckinger
et al, 1990, Proc. Natl. Acad. Sci. USA, 87:5188-5192)), IL-10,
TNFR-IgG (Ashkenazi et al., 1991, Proc. Natl. Acad. Sci. USA,
88:10535-10539), the murine product TBP-1 (Serono/Yeda), the
vaccine CytoTAb (Protherics), antisense molecule 104838 (ISIS), the
peptide RDP-58 (SangStat), thalidomide (Celgene), CDC-801
(Celgene), DPC-333 (Dupont), VX-745 (Vertex), AGIX-4207
(AtheroGenics), ITF-2357 (Italfarmaco), NPI-13021-31 (Nereus),
SCIO-469 (Scios), TACE targeter (Immunix/AHP), CLX-120500 (Calyx),
Thiazolopyrim (Dynavax), auranofin (Ridaura) (SmithKline Beecham
Pharmaceuticals), quinacrine (mepacrine dichlorohydrate), tenidap
(Enablex), Melanin (Large Scale Biological), and anti-p38 MAPK
agents by Uriach.
[0539] An anti-ICOS immunotherapy may also be in conjunction with
an immunoregulatory agent. In this approach, a chimeric, human or
humanized anti-ICOS antibody can be used. The term
"immunoregulatory agent" as used herein for combination therapy
refers to substances that act to suppress, mask, or enhance the
immune system of the host. This would include substances that
suppress cytokine production, downregulate or suppress self-antigen
expression, or mask the MHC antigens. Examples of such agents
include 2-amino-6-aryl-5-substituted pyrimidines (see, U.S. Pat.
No. 4,665,077), azathioprine (or cyclophosphamide, if there is an
adverse reaction to azathioprine); bromocryptine; glutaraldehyde
(which masks the MHC antigens, as described in U.S. Pat. No.
4,120,649); anti-idiotypic antibodies for MHC antigens and MHC
fragments; cyclosporin A; steroids such as glucocorticosteroids,
e.g., prednisone, methylprednisolone, and dexamethasone; cytokine
or cytokine receptor antagonists including anti-interferon-.gamma.,
-.beta., or -.alpha. antibodies; anti-tumor necrosis factor-.alpha.
antibodies; anti-tumor necrosis factor-.beta. antibodies;
anti-interleukin-2 antibodies and anti-IL-2 receptor antibodies;
anti-L3T4 antibodies; heterologous anti-lymphocyte globulin; pan-T
antibodies, for example anti-CD3 or anti-CD4/CD4a antibodies;
soluble peptide containing a LFA-3 binding domain (WO 90/08187
published Jul. 26, 1990); streptokinase; TGF-.beta.; streptodomase;
RNA or DNA from the host; FK506; RS-61443; deoxyspergualin;
rapamycin; T-cell receptor (U.S. Pat. No. 5,114,721); T-cell
receptor fragments (Offner et al., Science 251:430-432 (1991); WO
90/11294; and WO 91/01133); and T-cell receptor antibodies (EP
340,109) such as T10B9. Examples of cytokines include, but are not
limited to lymphokines, monokines, and traditional polypeptide
hormones. Included among the cytokines are growth hormone such as
human growth hormone, N-methionyl human growth hormone, and bovine
growth hormone; parathyroid hormone; thyroxine; insulin;
proinsulin; relaxin; prorelaxin; glycoprotein hormones such as
follicle stimulating hormone (FSH), thyroid stimulating hormone
(TSH), and luteinizing hormone (LH); hepatic growth factor;
fibroblast growth factor; prolactin; placental lactogen; tumor
necrosis factor-.alpha.; mullerian-inhibiting substance; mouse
gonadotropin-associated peptide; inhibin; activin; vascular
endothelial growth factor; integrin; thrombopoiotin (TPO); nerve
growth factors such as NGF-.alpha.; platelet-growth factor;
transforming growth factors (TGFs) such as TGF-.alpha. and
TGF-.alpha.; insulin-like growth factor-I and -II; erythropoietin
(EPO); osteoinductive factors; interferons; colony stimulating
factors (CSFs) such as macrophage-CSF (M-CSF);
granulocyte-macrophage-CgP (GM-CSP); and granulocyte-CSF (G-CSF);
interleukins (ILs) such as IL-1, IL-1a, IL-2, IL-3, IL-4, IL-5,
IL-6, IL-7, IL-8, IL-9, IL-1 I, IL-12, IL-15; a tumor necrosis
factor such as TNF-.alpha. or TNF-.beta.; and other polypeptide
factors including LIF and kit ligand (KL). As used herein, the term
cytokine includes proteins from natural sources or from recombinant
cell culture and biologically active equivalents of the native
sequence cytokines. In certain embodiments, the methods further
include administering to the subject one or more immunomodulatory
agents, for example a cytokine. Suitable cytokines may be selected
from the group consisting of interleukin-1 (IL-1), IL-2, IL-3,
IL-12, IL-15, IL-18, G-CSF, GM-CSF, thrombopoietin, and .gamma.
interferon.
[0540] These immunoregulatory agents are administered at the same
time or at separate times from anti-ICOS antibodies. The preferred
immunoregulatory agent will depend on many factors, including the
type of disorder being treated, as well as the patient's history,
but the agent frequently may be selected from cyclosporin A, a
glucocorticosteroid (for example prednisone or methylprednisolone),
azathioprine, bromocryptine, heterologous anti-lymphocyte globulin,
or a mixture thereof.
5.30. Combination with Other Therapeutic Agents
[0541] Agents that act on the tumor neovasculature can also be used
in conjunction with anti-ICOS immunotherapy and include
tubulin-binding agents such as combrestatin A4 (Griggs et al.,
Lancet Oncol. 2:82, (2001)) and angiostatin and endostatin
(reviewed in Rosen, Oncologist 5:20 (2000), incorporated by
reference herein). Immunomodulators suitable for use in combination
with anti-ICOS antibodies include, but are not limited to, of
.alpha.-interferon, .gamma.-interferon, and tumor necrosis factor
alpha (TNF.alpha.). In certain embodiments, the therapeutic agents
used in combination therapies using compositions and methods of the
invention are peptides.
[0542] In certain embodiments, an anti-ICOS immunotherapy is in
conjunction with one or more calicheamicin molecules. The
calicheamicin family of antibiotics are capable of producing
double-stranded DNA breaks at sub-picomolar concentrations.
Structural analogues of calicheamicin which may be used include,
but are not limited to, .gamma.1.sup.I, .gamma.2.sup.I,
.gamma.3.sup.I, N-acetyl-.gamma.1.sup.I, PSAG and 011 Hinman et
al., Cancer Research 53:3336-3342 (1993) and Lode et al., Cancer
Research 58: 2925-2928 (1998)).
[0543] In certain embodiments, a treatment regimen includes
compounds that mitigate the cytotoxic effects of an anti-ICOS
antibody composition. Such compounds include analgesics (e.g.,
acetaminophen), bisphosphonates, antihistamines (e.g.,
chlorpheniramine maleate), and steroids (e.g., dexamethasone,
retinoids, deltoids, betamethasone, cortisol, cortisone,
prednisone, dehydrotestosterone, glucocorticoids,
mineralocorticoids, estrogen, testosterone, progestins).
[0544] In certain embodiments, the therapeutic agent used in
combination with an anti-ICOS immunotherapy is a small molecule
(i.e., inorganic or organic compounds having a molecular weight of
less than about 2500 daltons). For example, libraries of small
molecules may be commercially obtained from Specs and BioSpecs B.V.
(Rijswijk, The Netherlands), Chembridge Corporation (San Diego,
Calif.), Comgenex USA Inc. (Princeton, N.J.), and Maybridge
Chemicals Ltd. (Cornwall PL34 OHW, United Kingdom).
[0545] In certain embodiments an anti-ICOS immunotherapy can be
administered in combination with an anti-bacterial agent.
Non-limiting examples of anti-bacterial agents include proteins,
polypeptides, peptides, fusion proteins, antibodies, nucleic acid
molecules, organic molecules, inorganic molecules, and small
molecules that inhibit and/or reduce a bacterial infection, inhibit
and/or reduce the replication of bacteria, or inhibit and/or reduce
the spread of bacteria to other cells or subjects. Specific
examples of anti-bacterial agents include, but are not limited to,
antibiotics such as penicillin, cephalosporin, imipenem, axtreonam,
vancomycin, cycloserine, bacitracin, chloramphenicol, erythromycin,
clindamycin, tetracycline, streptomycin, tobramycin, gentamicin,
amikacin, kanamycin, neomycin, spectinomycin, trimethoprim,
norfloxacin, rifampin, polymyxin, amphotericin B, nystatin,
ketocanazole, isoniazid, metronidazole, and pentamidine.
[0546] In certain embodiments an anti-ICOS immunotherapy can be
administered in combination with an anti-fungal agent. Specific
examples of anti-fungal agents include, but are not limited to,
azole drugs (e.g., miconazole, ketoconazole (NIZORAL.RTM.),
caspofungin acetate (CANCIDAS.RTM.), imidazole, triazoles (e.g.,
fluconazole (DIFLUCAN.RTM.)), and itraconazole (SPORANOX.RTM.)),
polyene (e.g., nystatin, amphotericin B (FUNGIZONE.RTM.),
amphotericin B lipid complex ("ABLC") (ABELCET.RTM.), amphotericin
B colloidal dispersion ("ABCD") (AMPHOTEC.RTM.), liposomal
amphotericin B (AMBISONE.RTM.)), potassium iodide (KI), pyrimidine
(e.g., flucytosine (ANCOBON.RTM.), and voriconazole (VFEND.RTM.)).
Administration of anti bacterial and anti-fungal agents can
mitigate the effects or escalation of infectious disease that may
occur in methods of the invention where a patient's ICOS expressing
T cells are significantly depleted.
[0547] In certain embodiments of the invention, an anti-ICOS
immunotherapy can be administered in combination with one or more
of the agents described above to mitigate the toxic side effects
that may accompany administration of compositions of the invention.
In other embodiments, an anti-ICOS immunotherapy can be
administered in combination with one or more agents that are well
known in the art for use in mitigating the side effects of antibody
administration, chemotherapy, toxins, or drugs.
[0548] In embodiments of the invention where an anti-ICOS
immunotherapy is administered in combination with another antibody
or antibodies and/or agent, the additional antibody or antibodies
and/or agents can be administered in any sequence relative to the
administration of the antibody of this invention. For example, the
additional antibody or antibodies can be administered before,
concurrently with, and/or subsequent to administration of an
anti-ICOS antibody or immunoconjugate to the human subject. The
additional antibody or antibodies can be present in the same
pharmaceutical composition as an antibody of the invention, and/or
present in a different pharmaceutical composition. The dose and
mode of administration of an antibody of this invention and the
dose of the additional antibody or antibodies can be the same or
different, in accordance with any of the teachings of dosage
amounts and modes of administration as provided in this application
and as are well known in the art.
5.31. Use of Anti-ICOS Antibodies in Diagnosing T Cell
Malignancies
[0549] The present invention also encompasses anti-ICOS antibodies,
and compositions thereof, that immunospecifically bind to the human
ICOS antigen, which anti-ICOS antibodies are conjugated to a
diagnostic or detectable agent. In certain embodiments, the
antibodies are anti-ICOS antibodies with enhanced effector
function. Such anti-ICOS antibodies can be useful for monitoring or
prognosing the development or progression of a T cell malignancy as
part of a clinical testing procedure, such as determining the
efficacy of a particular therapy. Such diagnosis and detection can
be accomplished by coupling an anti-ICOS antibody that
immunospecifically binds to the human ICOS antigen to a detectable
substance including, but not limited to, various enzymes, such as
but not limited to, horseradish peroxidase, alkaline phosphatase,
beta-galactosidase, or acetylcholinesterase; prosthetic groups,
such as but not limited to, streptavidin/biotin and avidin/biotin;
fluorescent materials, such as but not limited to, umbelliferone,
fluorescein, fluorescein isothiocynate, rhodamine,
dichlorotriazinylamine fluorescein, dansyl chloride or
phycoerythrin; luminescent materials, such as but not limited to,
luminol; bioluminescent materials, such as but not limited to,
luciferase, luciferin, and aequorin; radioactive materials, such as
but not limited to iodine (.sup.131I, .sup.125I, .sup.123I,
.sup.121I,), carbon (.sup.14C), sulfur (.sup.35S), tritium
(.sup.3H), indium (.sup.115In, .sup.113In, .sup.112In,
.sup.111In,), and technetium (.sup.99Tc), thallium (.sup.201Ti),
gallium (.sup.68Ga, .sup.67Ga), palladium (.sup.103Pd), molybdenum
(.sup.99Mo), xenon (.sup.133Xe), fluorine (.sup.18F), .sup.153Sm,
.sup.177Lu, .sup.159Gd, .sup.149 Pm, .sup.140La, .sup.175Yb,
.sup.166Ho, .sup.90Y, .sup.47Sc, .sup.186Re, .sup.188Re,
.sup.142Pr, .sup.105Rh, .sup.97Ru, .sup.68Ge, .sup.57Co, .sup.65Zn,
.sup.85Sr, .sup.32P, .sup.153Gd, .sup.169Yb, .sup.51Cr, .sup.54Mn,
.sup.75Se, .sup.113Sn, and .sup.117Tin; positron emitting metals
using various positron emission tomographies, noradioactive
paramagnetic metal ions, and molecules that are radiolabelled or
conjugated to specific radioisotopes. Any detectable label that can
be readily measured can be conjugated to an anti-ICOS antibody and
used in diagnosing T cell malignancies. The detectable substance
may be coupled or conjugated either directly to an antibody or
indirectly, through an intermediate (such as, for example, a linker
known in the art) using techniques known in the art. See, e.g.,
U.S. Pat. No. 4,741,900 for metal ions which can be conjugated to
antibodies for use as a diagnostics according to the present
invention. In certain embodiments, the invention provides for
diagnostic kits comprising an anti-ICOS antibody conjugated to a
diagnostic or detectable agent.
5.32. Use of Anti-ICOS Antibodies in Monitoring Immune
Reconstitution
[0550] The present invention also encompasses anti-ICOS antibodies,
and compositions thereof, that immunospecifically bind to the human
ICOS antigen, which anti-ICOS antibodies are conjugated to a
diagnostic or detectable agent. Such anti-ICOS antibodies can be
useful for monitoring immune system reconstitution following
immunosuppressive therapy or bone marrow transplantation. Such
monitoring can be accomplished by coupling an anti-ICOS antibody
that immunospecifically binds to the human ICOS antigen to a
detectable substance including, but not limited to, various
enzymes, such as, but not limited to, horseradish peroxidase,
alkaline phosphatase, beta-galactosidase, or acetylcholinesterase;
prosthetic groups, such as, but not limited to, streptavidin/biotin
and avidin/biotin; fluorescent materials, such as, but not limited
to, umbelliferone, fluorescein, fluorescein isothiocynate,
rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or
phycoerythrin; luminescent materials, such as, but not limited to,
luminol; bioluminescent materials, such as, but not limited to,
luciferase, luciferin, and aequorin; radioactive materials, such
as, but not limited to, iodine (.sup.131I, .sup.125I, .sup.123I,
.sup.121I,), carbon (.sup.14C), sulfur (.sup.35S), tritium
(.sup.3H), indium (.sup.115In, .sup.113In, .sup.112In, .sup.111In),
and technetium (.sup.99Tc), thallium (.sup.201Ti), gallium
(.sup.68Ga, .sup.67Ga), palladium (.sup.103Pd), molybdenum
(.sup.99Mo), xenon (.sup.133Xe), fluorine (.sup.18F), .sup.153Sm,
.sup.177Lu, .sup.159Gd, .sup.149 Pm, .sup.140La, .sup.175Yb,
.sup.166Ho, .sup.90Y, .sup.47Sc, .sup.186Re, .sup.188Re,
.sup.142Pr, 105Rh, .sup.97Ru, .sup.68Ge, .sup.57Co, .sup.65Zn,
.sup.35Sr, .sup.32P, .sup.153Gd, .sup.169Yb .sup.51Cr, .sup.54Mn,
.sup.75Se, .sup.113Sn, and .sup.117Tin; positron-emitting metals
using various positron-emission tomographies, noradioactive
paramagnetic metal ions, and molecules that are radiolabelled or
conjugated to specific radioisotopes. Any detectable label that can
be readily measured can be conjugated to an anti-ICOS antibody and
used in diagnosing an autoimmune disease or disorder. The
detectable substance may be coupled or conjugated either directly
to an antibody or indirectly, through an intermediate (such as, for
example, a linker known in the art) using techniques known in the
art. See, e.g., U.S. Pat. No. 4,741,900 for metal ions which can be
conjugated to antibodies for use as a diagnostics according to the
present invention. In certain embodiments, the invention provides
for diagnostic kits comprising an anti-ICOS antibody conjugated to
a diagnostic or detectable agent.
5.33. Use of Anti-ICOS Antibodies in Diagnosing Autoimmune Diseases
or Disorders
[0551] The present invention also encompasses anti-ICOS antibodies,
and compositions thereof, that immunospecifically bind to the human
ICOS antigen, which anti-ICOS antibodies are conjugated to a
diagnostic or detectable agent. In certain embodiments, the
antibodies are anti-ICOS antibodies with enhanced effector
function. Such anti-ICOS antibodies can be useful for monitoring or
prognosing the development or progression of an autoimmune disease
or disorder as part of a clinical testing procedure, such as
determining the efficacy of a particular therapy. Such diagnosis
and detection can be accomplished by coupling an anti-ICOS antibody
that immunospecifically binds to the human ICOS antigen to a
detectable substance including, but not limited to, various
enzymes, such as but not limited to, horseradish peroxidase,
alkaline phosphatase, beta-galactosidase, or acetylcholinesterase;
prosthetic groups, such as but not limited to, streptavidin/biotin
and avidin/biotin; fluorescent materials, such as but not limited
to, umbelliferone, fluorescein, fluorescein isothiocynate,
rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or
phycoerythrin; luminescent materials, such as but not limited to,
luminol; bioluminescent materials, such as but not limited to,
luciferase, luciferin, and aequorin; radioactive materials, such as
but not limited to iodine (.sup.131I, .sup.125I, .sup.123I,
.sup.121I,), carbon (.sup.14C), sulfur (.sup.35S), tritium (3H),
indium (.sup.115In, .sup.113In, .sup.112In, .sup.111In), and
technetium (.sup.99Tc), thallium (.sup.201Ti), gallium (.sup.68Ga,
.sup.67Ga), palladium (.sup.103Pd), molybdenum (.sup.99Mo), xenon
(.sup.133Xe), fluorine (.sup.18F), .sup.153Sm, .sup.177Lu,
.sup.159Gd, .sup.149 Pm, .sup.140La, .sup.175Yb, .sup.166Ho, 90Y,
.sup.47Sc, .sup.186Re, .sup.188Re, .sup.142Pr, .sup.105Rh,
.sup.97Ru, .sup.68Ge, .sup.57Co, .sup.65Zn, .sup.85Sr, .sup.32P,
.sup.153Gd, .sup.169Yb .sup.51Cr, .sup.54Mn, .sup.75Se, .sup.113Sn,
and .sup.117Tin; positron emitting metals using various positron
emission tomographies, noradioactive paramagnetic metal ions, and
molecules that are radiolabelled or conjugated to specific
radioisotopes. Any detectable label that can be readily measured
can be conjugated to an anti-ICOS antibody and used in diagnosing
an autoimmune disease or disorder. The detectable substance may be
coupled or conjugated either directly to an antibody or indirectly,
through an intermediate (such as, for example, a linker known in
the art) using techniques known in the art. See, e.g., U.S. Pat.
No. 4,741,900 for metal ions which can be conjugated to antibodies
for use as a diagnostics according to the present invention. In
certain embodiments, the invention provides for diagnostic kits
comprising an anti-ICOS antibody conjugated to a diagnostic or
detectable agent.
5.34. KITS
[0552] The invention provides a pharmaceutical pack or kit
comprising one or more containers filled with a composition of the
invention for the prevention, treatment, management or amelioration
of a T cell-mediated disease and disorder, such as, but not limited
to, chronic infection, autoimmune disease or disorder, inflammatory
disease or disorder, graft-versus-host disease (GVHD), transplant
rejection, and T cell proliferative disorder, or one or more
symptoms thereof, potentiated by or potentiating a T cell-mediated
disease and disorder.
[0553] The present invention provides kits that can be used in the
above-described methods. In one embodiment, a kit comprises a
composition of the invention, in one or more containers. In another
embodiment, a kit comprises a composition of the invention, in one
or more containers, and one or more other prophylactic or
therapeutic agents useful for the prevention, management or
treatment of a T cell-mediated disease and disorder, or one or more
symptoms thereof, potentiated by or potentiating a T cell-mediated
disease and disorder in one or more other containers. The kit may
further comprise instructions for preventing, treating, managing or
ameliorating a T cell-mediated disease and disorder, as well as
side effects and dosage information for method of administration.
Optionally associated with such container(s) can be a notice in the
form prescribed by a governmental agency regulating the
manufacture, use or sale of pharmaceuticals or biological products,
which notice reflects approval by the agency of manufacture, use or
sale for human administration.
6. SPECIFIC EMBODIMENTS
[0554] 1. An isolated anti-ICOS antibody comprising a VH domain, a
VK domain and a variant Fc region, wherein the antibody mediates
enhanced ADCC activity as compared to the level of ADCC activity
mediated by a parent antibody comprising the VH and VK domains and
a wild type Fc region.
[0555] 2. The antibody of embodiment 1, wherein the EC50 of the
antibody as measured in an in vitro ADCC assay is at least about
7.times. lower than the EC50 value of the parent antibody.
[0556] 3. The antibody of embodiments 1 or 2, wherein the variant
Fc region has a higher affinity for an Fc receptor than the wild
type Fc region.
[0557] 4. The antibody of embodiment 3, wherein the Fc receptor is
human FcgammaRIIIA.
[0558] 5. The antibody of embodiment 1, wherein the variant Fc
region comprises at least one substitution of an amino acid residue
selected from the group consisting of: residue 239, 330, and 332,
wherein the amino acid residue positions are determined according
to the EU convention.
[0559] 6. The antibody of embodiment 1, wherein the variant Fc
region comprises at least on amino acid substitution selected from
the group consisting of: S239D, A330L, and 1332E; wherein the amino
acid residue positions are determined according to the EU
convention.
[0560] 7. An isolated anti-ICOS antibody comprising a VH domain, a
VK domain and an engineered Fc region, wherein the antibody has
complex N-glycoside-linked sugar chains bound to the engineered Fc
region in which fucose is not bound to N-acetylglucosamine in the
reducing end in the sugar chain.
[0561] 8. The antibody of embodiment 7, wherein the antibody
mediates enhanced ADCC activity as compared to the level of ADCC
activity mediated by a parent antibody comprising the VH and VK
domains and a non-engineered Fc region.
[0562] 9. The antibody of embodiment 8, wherein the EC50 of the
antibody as measured in an in vitro ADCC assay is at least about
7.times. lower than the EC50 value of the parent antibody.
[0563] 10. The antibody of any one of the embodiments 1-7, wherein
the VH domain comprises the amino acid sequence of SEQ ID NO:7 and
the VK domain comprises the amino acid sequence of SEQ ID NO:2.
[0564] 11. A nucleic acid encoding the amino acid sequence of the
antibody as in any one of the embodiments 1-10.
[0565] 12. The nucleic acid of embodiment 11, wherein the nucleic
acid comprises a nucleotide sequence selected from the group
consisting of SEQ ID NO:28-31.
[0566] 13. A vector comprising the nucleic acid of embodiment
11.
[0567] 14. The vector of embodiment 13, wherein the vector
comprises a nucleotide sequence selected from the group consisting
of SEQ ID NO:28-31.
[0568] 15. An isolated cell comprising the vector of embodiment
13.
[0569] 16. The isolated cell of embodiment 15, wherein said cell
lacks the activity of a glycosylation enzyme.
[0570] 17. The glycosylation enzyme of embodiment 16, wherein said
enzyme is selected from the group consisting of FUT8 or GnTIII.
[0571] 18. The isolated cell of embodiment 16, wherein the enzyme
is selected from the group consisting of FUT8 or GnTIII, and
wherein the cell comprises a vector comprising the nucleotide
sequence selected from the group consisting of SEQ ID NO:28-31.
[0572] 19. An isolated cell expressing the antibody as in any one
of the embodiments 1-10.
[0573] 20. A method of producing an antibody comprising culturing
the isolated cell of embodiment 19 under conditions sufficient for
the production of the antibody and recovering the antibody from the
culture.
[0574] 21. A pharmaceutical composition comprising the antibody as
in any one of the embodiments 1-10 in a pharmaceutically-acceptable
carrier.
[0575] 22. The pharmaceutical composition of embodiment 21, wherein
the antibody is of the IgG1, IgG2, IgG3, or IgG4 human isotype.
[0576] 23. A method of treating an autoimmune disease or disorder
in a human, comprising administering to a human in need thereof a
therapeutically-effective amount of the antibody as in any one of
the embodiments 1-10.
[0577] 24. The method of embodiment 23, wherein the autoimmune
disease or disorder is SLE or scleroderma.
[0578] 25. A method of treating or preventing rejection in a human
transplant patient, comprising administering to a human in need
thereof a therapeutically-effective amount of the antibody as in
any one of the embodiments 1-10.
[0579] 26. A method of treating a T cell malignancy in a human
comprising administering to a human in need thereof a
therapeutically-effective amount of the antibody as in any one of
the embodiments 1-10.
[0580] 27. A method of treating an inflammatory disease or disorder
in a human, comprising administering to a human in need thereof a
therapeutically-effective amount of the antibody as in any one of
the embodiments 1-10.
[0581] 28. The method of embodiment 27, wherein the inflammatory
disease or disorder is myositis.
[0582] 29. The method of embodiment 28, wherein the myositis is
inclusion-body myositis (IBM), polymyositis (PM) or dermatomyositis
(DM).
[0583] 30. A method of depleting ICOS expressing T cells in a human
patient comprising administering to a human in need thereof a
therapeutically-effective amount of the antibody as in any one of
the embodiments 1-10.
[0584] 31. The method of embodiment 30, wherein the depletion
substantially persists for at least about 1, at least about 2, at
least about 3 or at least about 4 weeks following the
administration of the antibody.
[0585] 32. The method of embodiment 30, wherein at least about 95%
of the T cells are depleted.
[0586] 33. The method of embodiment 30, wherein the ICOS expressing
T cell is a memory T cell.
[0587] 34. The method of embodiment 30, wherein the ICOS expressing
T cell is a circulating T cell.
[0588] 35. A method of disrupting germinal center architecture in a
secondary lymphoid organ of a primate, comprising administering an
effective amount of the antibody as in any one of the embodiments
1-10.
[0589] 36. The method of embodiment 35, wherein the primate is a
non-human primate.
[0590] 37. A method of depleting germinal center B cells from a
secondary lymphoid organ of a primate comprising administering an
effective amount of the antibody as in any one of the embodiments
1-10.
[0591] 38. The method of embodiment 37, wherein the primate is a
non-human primate.
[0592] 39. The method of embodiment 37, wherein the primate is a
human.
[0593] 40. The method of embodiment 37, wherein the depletion
substantially persists for at least about 1, at least about 2, at
least about 3 or at least about 4 weeks following the
administration of the antibody.
[0594] 41. A method of depleting circulating class switched B cells
in a primate comprising administering an effective amount of the
antibody as in any one of the embodiments 1-10.
[0595] 42. The method of embodiment 41, wherein the primate is a
non-human primate.
[0596] 43. The method of embodiment 41, wherein the primate is a
human.
[0597] 44. The method of embodiment 41, wherein the depletion
substantially persists for at least about 1, at least about 2, at
least about 3 or at least about 4 weeks following the
administration of the antibody.
[0598] 45. The method of embodiment 41, wherein at least about 95%
of the circulating class switched B cells are depleted.
[0599] 46. An isolated anti-ICOS antibody comprising a VH domain, a
VK domain and a variant Fc region, wherein the antibody mediates
enhanced ADCC activity as compared to the level of ADCC activity
mediated by a parent antibody comprising the VH and VK domains and
a wild type Fc region, and wherein said antibody is capable of
depleting germinal center B cells from a secondary lymphoid organ
of a primate.
[0600] 47. The antibody of embodiment 46, wherein the primate is a
non-human primate.
[0601] 48. The antibody of embodiment 46, wherein the primate is a
human.
[0602] 49. The antibody of embodiment 46, wherein the depletion
substantially persists for at least about 1, at least about 2, at
least about 3 or at least about 4 weeks following the
administration of the antibody.
[0603] 50. An isolated anti-ICOS antibody comprising a VH domain, a
VK domain and a variant Fc region, wherein the antibody mediates
enhanced ADCC activity as compared to the level of ADCC activity
mediated by a parent antibody comprising the VH and VK domains and
a wild type Fc region, and wherein said antibody is capable of
depleting circulating class switched B cells in a primate.
[0604] 51. The antibody of embodiment 50, wherein the primate is a
non-human primate.
[0605] 52. The antibody of embodiment 50, wherein the primate is a
human.
[0606] 53. The antibody of embodiment 50, wherein the depletion
substantially persists for at least about 1, at least about 2, at
least about 3 or at least about 4 weeks following the
administration of the antibody.
[0607] 4. The antibody of embodiment 50, wherein at least about 95%
of the circulating class switched B cells are depleted.
[0608] 5. An isolated anti-ICOS antibody comprising a VH domain, a
VK domain and an engineered Fc region, wherein the antibody has
complex N-glycoside-linked sugar chains bound to the engineered Fc
region in which fucose is not bound to N-acetylglucosamine in the
reducing end in the sugar chain, wherein the antibody mediates
enhanced ADCC activity as compared to the level of ADCC activity
mediated by a parent antibody comprising the VH and VK domains and
a non-engineered Fc region, and wherein said antibody is capable of
depleting germinal center B cells from a secondary lymphoid organ
of a primate.
[0609] 56. The antibody of embodiment 55, wherein the primate is a
non-human primate.
[0610] 57. The antibody of embodiment 55, wherein the primate is a
human.
[0611] 58. The antibody of embodiment 55, wherein the depletion
substantially persists for at least about 1, at least about 2, at
least about 3 or at least about 4 weeks following the
administration of the antibody.
[0612] 59. An isolated anti-ICOS antibody comprising a VH domain, a
VK domain and an engineered Fc region, wherein the antibody has
complex N-glycoside-linked sugar chains bound to the engineered Fc
region in which fucose is not bound to N-acetylglucosamine in the
reducing end in the sugar chain, wherein the antibody mediates
enhanced ADCC activity as compared to the level of ADCC activity
mediated by a parent antibody comprising the VH and VK domains and
a non-engineered Fc region, and wherein said antibody is capable of
depleting class switched B cells in a primate.
[0613] 60. The antibody of embodiment 59, wherein the primate is a
non-human primate.
[0614] 61. The antibody of embodiment 59, wherein the primate is a
human.
[0615] 62. The antibody of embodiment 59, wherein the depletion
substantially persists for at least about 1, at least about 2, at
least about 3 or at least about 4 weeks following the
administration of the antibody.
[0616] 63. The antibody of embodiment 59, wherein at least about
95% of the circulating class switched B cells are depleted.
7. EXAMPLES
7.1. Construction of ADCC Enhanced Anti-ICOS Antibodies
[0617] The following sections describe the design of an ADCC
enhanced anti-ICOS antibody comprising a human IgH.gamma.1 constant
region. An ADCC enhanced anti-ICOS antibody may comprise variant Fc
regions with increased effector function (see, US Patent
Publication No's: US 2007-0003546 A1, US20060160996A9, US
2005-0054832 A1, US 2004-0132101 A1, and US 2004-0110226 A1). An
ADCC enhanced anti-ICOS antibody may comprise complex
N-glycoside-linked sugar chains linked to Asn297 of the Fc region
in which fucose is not bound to N-acetylglucosamine in the reducing
end (see, U.S. Pat. No. 6,946,292, US Patent Publication No's: US
2006-0223147 A1, US 2006-0021071 A1, US 2005-0272916 A1, US
2004-0259150 A1, US 2004-0132140 A1, US 2004-0110704 A1, and US
2004-0110282 A1). The ADCC enhanced anti-ICOS antibodies described
in the Examples comprise the heavy and light chain variable domains
of the JMab-136 anti-ICOS antibody described in U.S. Pat. No.
6,803,039. The amino acid sequence of the JMab anti-ICOS antibody
VH and VK domains are disclosed herein as SEQ ID NO: 7 and 2,
respectively. The anti ICOS antibody comprising JMab-136 VH and VL
domains and further comprising the IgH.gamma.2 constant region is
hereinafter referred to as IC009. The anti ICOS antibody comprising
JMab-136 VH and VL domains and further comprising the IgH.gamma.1
constant region is hereinafter referred to as as IC9G1. Those
skilled in the art recognize that the experimental methods
described herein may also be applied to any other anti-ICOS
antibody, for example, but not limited to, those described in U.S.
Pat. No. 6,803,039.
7.1.1. Sequence Optimization
[0618] Amino acid sequence: The amino acid sequence of the VK
domain (SEQ ID NO: 1) comprises the following motifs: a potential
o-glycosylation site at amino acid position 5, and a potential
deamidation motif at amino acid position 92 in the VK CDR3. The
amino acid sequence of the VH domain (SEQ ID NO: 6) comprises the
following motifs: a potential o-glycosylation site at amino acid
position 17, and a potential isoaspartate formation motif at amino
acid position 99 in the VH CDR3. Amino acid positions are
determined according to the Kabat consensus. The amino acid
sequence of the VH or VK domain may be changed to eliminate any one
of these sequence motifs and thus eliminate the potential for
posttranslational modification at the altered sequence motifs. For
example, an NG potential deamidation motif may be eliminated by
substituting the N residue with a Y, D or G residue. Methods for
introducing a substitution into the amino acid sequence of the
anti-ICOS antibody are described below. The antigen binding
properties of an amino acid substitution comprising anti-ICOS
antibody may be ascertained using the methods described herein.
[0619] Nucleic acid sequence: The polynucleotides encoding the
heavy and light chains of the anti-ICOS antibody may be subjected
to nucleic acid sequence optimization. The final goal of the
sequence optimization process is to create a coding region that is
transcribed and translated at the highest possible efficiency.
Sequence optimization is achieved by a combination of: (i) codon
usage optimization, (ii) G/C content adaptation, (iii) elimination
of internal splicing sites and premature polyadenylation sites,
(iv) disruption of stable RNA secondary structures, (v) elimination
of direct repeat sequences, (vi) elimination of sequences that may
form stable dsRNA with host cell transcripts, (vii) eliminate
sequences targeted by host cell micro RNAs, and (viii) introduction
of RNA stabilizing and RNA translocation signals. Detailed sequence
optimization methods are described in WO2004059556A2,
WO2006015789A2, Bradel-Tretheway et al., J. Virol. Methods 111:
145-56 (2003), Valencik & McDonald, Transgenic Res. 3:269-75
(2001). Alternatively, a sequence may be optimized by a commercial
provider (e.g., GENEART Inc.).
[0620] Nucleotide sequences encoding the VH, VK, heavy chain and
light chain of the IC9G1 were optimized following the methods
described herein. The optimized nucleotide sequences encoding the
VH, VK, heavy chain and light chain of IC9G1 is disclosed as SEQ ID
NO:28-31, respectively.
7.1.2. Gene Assembly and Expression Cloning
[0621] Constructs may be generated by a PCR-based gene assembly
method first described by Stemmer (Stemmer, W. P. et al. 1995 Gene,
164:49-53). This method consists of four steps: oligonucleotide
synthesis; gene assembly; gene amplification and cloning. Eight VH
gene specific primers and six VK gene specific primers that may be
used for PCR mediated gene assembly are listed in Table 2. Primer
sets for variant VH and VK regions comprising specific amino acid
substitutions may be generated by modifying the nucleic acid
sequence of the primer encoding the given amino acid residue.
Primers are designed to overlap by 15-20 nucleotides and are
ligated into a complete variable region during thermal cycling. In
case of VH, an additional vector specific primer (Universal VH FW
in Table 2.) is included in the PCR mediated gene assembly process.
The external 5' and 3' primers for VH region incorporate a unique
recognition site for the XbaI and ApaI restriction endonuclease,
respectively, to help with the subsequent cloning steps. The
external 5' and 3' primers for VK incorporate a unique recognition
site for the XmaI and BsiWI restriction endonuclease, respectively,
to help with the subsequent cloning steps. PCR products of the
correct size are restriction digested and ligated in frame into an
expression vector wherein VH regions are digested with XbaI and
ApaI, and VK regions are digested with XmaI and BsiWI according to
the manufacturer's instructions. The heavy chain assembly vector
comprises eukaryotic transcription control elements operably linked
to a polynucleotide encoding the MGDNDIHFAFLSTGVHS VH leader (SEQ
ID NO: 26) and a human IgH.gamma.1 constant region wherein said
transcription control elements comprise a CMV immediate early
promoter and a SV40 poly A addition signal. The use of
appropriately designed primers for VH assembly ensures that the
polynucleotide sequences encoding the VH leader, VH region and
IgH.gamma.1 constant region are joined in frame within the final
heavy chain expression vector. The light chain assembly vector
comprises eukaryotic transcription control elements operably linked
to a polynucleotide encoding the human VK1-L12 leader (amino acid
sequence MDMRVPAQLLGLLLLWLPGAKC (SEQ ID NO:27); Bentley, D. L.
& Rabbitts, T. H., Nature 288, 730-733 (1980)) and a human IgLK
constant region wherein said transcription control elements
comprise a CMV immediate early promoter and a SV40 poly A addition
signal. The use of appropriately designed primers for VK assembly
ensures that the polynucleotide sequences encoding the VK1-L12
leader, VK region and IgLK constant region are joined in frame
within the final light chain expression vector. The ligation
product is used to transform DH10B competent E. coli cells
according to the manufacturer's protocols. Colonies containing the
plasmid and a correct sized insert can be identified using various
methods known in the art (e.g. restriction digest of vector DNA
preparation, PCR amplification of vector sequences). Plasmid clones
with correct sized insert may be sequenced using dideoxy sequencing
reaction (e.g., BigDye.RTM. Terminator v3.0 Cycle Sequencing Ready
Reaction Kit, ABI). Plasmid DNA is prepared from selected clones
using the QIAGEN Mini and Maxi Plasmid Kit according to the
manufacturer's protocols.
[0622] DNA plasmid expression vector preparations encoding the
anti-ICOS heavy chain and light chain polypeptides are used to
co-transfect HEK293 cells. The co-transfected HEK293 cells are
cultured under standard conditions. Antibody-containing conditioned
medium is harvested 72 and 144 hours post-transfection. The
secreted, soluble human IgG is purified from the conditioned media
directly using 1 ml HiTrap protein A columns according to the
manufacturer's instructions (APBiotech, Inc., Piscataway, N.J.).
Purified human IgG (typically >95% pure, as judged by SDS-PAGE)
is dialyzed against phosphate buffered saline (PBS), flash frozen
and stored at -70.degree. C.
[0623] IgG concentration of the purified preparation is quantified
using a capture ELISA assay. Briefly, IgG molecules are captured on
a 96-well plate via an immobilized goat anti-human IgG H+L specific
antibody, and detected with an HRP conjugated anti-human kappa
light chain antibody. The assay is calibrated using a reference
IgG1 mAb of irrelevant specificity.
TABLE-US-00002 TABLE 2 Representative primer sets for VH and VK
region assembly. Gene specific nucleotides are printed in upper
case, vector specific nucleotides are printed in lower case.
Recognition sites for restriction endonucleases used for VH and VK
fragment cloning are underlined. Univ VH FW
tatatatatctagacatatatatgggtgacaatgacatc cactttgcctttctctcc (SEQ ID
NO: 11) VH FW1 tccactttgcctttctctccacaggtgtccactccCAGG
TGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTG GGGCCTCAGTG (SEQ ID NO: 12)
VH RE2 CATATAGTAGCCGGTGAAGGTGTATCCAGAAGCCTTGCA
GGAGACCTTCACTGAGGCCCCAGGCTTC (SEQ ID NO: 13) VH FW3
CACCGGCTACTATATGCACTGGGTGCGACAGGCCCCTGG
ACAAGGGCTTGAGTGGATGGGATGGATC (SEQ ID NO: 14) VH RE4
CTGCCCTGAAACTTCTGTGCATAGTTTGTGCCACCACTG TGAGGGTTGATCCATCCCATCCAC
(SEQ ID NO: 15) VH FW5 CAGAAGTTTCAGGGCAGGGTCACCATGACCAGGGACACG
TCCATCAGCACAGCCTACATGGAGCTGAG (SEQ ID NO: 16) VH RE6
GTCCTCGCACAGTAATACACGGCCGTGTCGTCGGATCTC AGCCTGCTCAGCTCCATGTAGGCTG
(SEQ ID NO: 17) VH FW7 GTATTACTGTGCGAGGACGTATTACTATGATAGTAGTGG
TTATTACCATGATGCTTTTGATATCTG (SEQ ID NO: 18) VH RE8
tatatatagggcccttggtggaggcCTGAAGAGACGGTG
ACCATTGTCCCTTGGCCCCAGATATCAAAAGCATC (SEQ ID NO: 19) VK FW1
tatatataccccggggccaaatgtGACATCCAGATGACC
CAGTCTCCATCTTCCGTGTCTGCATCTGTAGGAGACAGA G (SEQ ID NO: 20) VK RE2
GATACCAGGCTAACAACCTGCTAATACCCTGACTCGCCC
GACAAGTGATGGTGACTCTGTCTCCTACAGA (SEQ ID NO: 21) VK FW3
GTTAGCCTGGTATCAGCAGAAACCAGGGAAAGCCCCTAA
ACTCCTGATCTATGTTGCATCCAGTTTGCAAAGTG (SEQ ID NO: 22) VK RE4
GTGAAATCTGTCCCAGATCCACTGCCGCTGAACCTTGAT GGGACCCCACTTTGCAAACTGGATG
(SEQ ID NO: 23) VK FW5 CTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGC
CTGAAGATTTTGCAACTTACTATTGTCAACAG (SEQ ID NO: 24) VK RE6
tatatatacgtacgTTTGATTTCCACCTTGGTCCCTTGG
CCGAACGTCCACGGGAAACTGTTAGCCTGTTGACAATAG TAAG (SEQ ID NO: 25)
7.1.3. ADCC Enhanced Anti-ICOS Antibody Comprising a Variant FC
Domain
[0624] An antibody expression vector encoding an ADCC enhanced
anti-ICOS antibody having a variant Fc domain comprising the S239D,
A330L, and I332E amino acid substitutions (hereinafter referred to
as "IC9G1-3M") may be generated using the methods described in US
Patent Publications 2004/0132101 and 2005/0054832, both to Lazar et
al. Briefly, the above described antibody expression vector
encoding the JMab136 VH and VL domains is modified using a site
directed mutagenesis kit (e.g., QuickChange (Promega)) to introduce
the necessary nucleotide residue substitutions into the
polynucleotide sequence encoding the heavy chain constant region to
generate the IC.sub.9G1-3M antibody expression vector. Purified
IC9G1-3M antibody is generated by transfecting HEK239F cells with
the IC9G1-3M antibody expression vector. Transfected cells are fed
at day3 and 6 and the antibody-containing conditioned medium is
harvested at day 9. Antibody is purified from the conditioned
medium using a pre-cast protein A column (GE Healthcare). Antibody
is eluted from the column with low pH buffer, neutralized, and
dialyzed against PBS. The concentration of the purified antibody is
calculated from the solution's optical density at 280 nm.
7.1.4. ADCC Null Anti-ICOS Fc Variant Antibody
[0625] An antibody expression vector encoding an anti-ICOS antibody
with reduced ADCC activity having an Fc region comprising the
L234F, L235E, and P331 S amino acid substitutions (hereinafter
referred to as "IC9G1-TM") is generated using methods described in
US 2004/0132101 and US 2005/0054832, both to Lazar et al. Briefly,
the above described antibody expression vector encoding the JMab136
VH and VL domains is modified using a site directed mutagenesis kit
(e.g., QuickChange (Promega)) to introduce the necessary nucleotide
residue substitutions into the polynucleotide sequence encoding the
heavy chain constant region to generate the IC9G1-TM antibody
expression vector. Purified IC9G1-TM antibody is generated by
transfecting HEK239F cells with the IC9G1-TM antibody expression
vector. Transfected cells are fed at day3 and 6 and the
antibody-containing conditioned medium is harvested at day 9.
Antibody is purified from the conditioned medium using a pre-cast
protein A column (GE Healthcare). Antibody is eluted from the
column with low pH buffer, neutralized, and dialyzed against PBS.
The concentration of the purified antibody is calculated from the
solution's optical density at 280 nm.
7.1.5. Afucosylated Anti-ICOS Antibody with Increased ADCC
[0626] An IC9G1 antibody composition (hereinafter referred to as
IC9G1-aFuc) comprising a plurality of antibodies having complex
N-glycoside-linked sugar chains linked to Asn297 of the Fc region
in which fucose is not bound to N-acetylglucosamine in the reducing
end was prepared according to the methods set forth in U.S. Pat.
No. 6,946,292 to Kanda et al. Briefly, fucosyltransferase knock-out
CHO cells are transfected with a DNA plasmid expression vector
preparation encoding the heavy and light chains of JMab136.
Transfected cells are fed at day3 and 6 and the antibody-containing
conditioned medium is harvested at day 9. Antibody is purified from
the conditioned medium using a pre-cast protein A column (GE
Healthcare). Antibody is eluted from the column with low pH buffer,
neutralized, and dialyzed against PBS. The concentration of the
purified antibody is calculated from the solution's optical density
at 280 nm.
7.2. Binding Profile Characterization of ADCC Enhanced Anti-ICOS
Antibodies
[0627] The binding profile of ADCC enhanced anti-ICOS antibodies
may be characterized by a number of methods known to one of skill
in the arts. The antibodies may be characterized by using, for
example, but not limited to, cell based ELISA assays, ELISA assays
using a recombinant ICOS molecule as capture reagent, flow
cytometry, Biacore analysis.
[0628] The ability of an ADCC enhanced anti-ICOS antibody to bind
ICOS may be assessed by a cell based ICOS binding assay utilizing
stable transfectants cells expressing recombinant ICOS protein on
their cell surface as a capture agent. U.S. Pat. No. 6,803,039
describes an ICOS transgenic CHO cell line and an ICOS transgenic
HPB-ALL cell line, each of which may be used in a cell based ELISA
assay. A cell based ELISA may be performed by using any one of the
methods known to one skilled in the arts. For example, HPB-ALL
h-ICOS+ cells are cultured according to standard protocols in RPMI
1640 medium containing L-glutamine and supplemented with 10% Fetal
Calf Serum. Individual wells of a 96 well U bottom plate are seeded
with 1.times.10e5 stable transfectants HPB-ALL hICOS cells and
incubated overnight. Cells are washed once with ELISA buffer prior
to incubation on ice with various amounts of anti-ICOS antibodies.
Binding reactions are performed in triplicates for each antibody
concentration tested. Negative control wells using an isotype
matched antibody of irrelevant specificity should be included in
the assay. Additional negative control wells seeded with
non-transfected HPB-ALL cells may also be used to further
demonstrate the binding specificity the anti-ICOS antibody.
Following incubation with the antibody, HPB-ALL hICOScells are
washed three times with 200 micro liter of ELISA buffer. The amount
of anti-ICOS antibodies bound to HPB-ALL hICOS cells may be
detected using a goat anti-human kappa antibody conjugated with
horseradish peroxidase following standard protocols. An ICOS
specific antibody should give a dose dependent ELISA signal with
the HPB-ALL hICOS cells but not with the parental HPB-ALL cells.
The ELISA signal is expected to reach a maximum at an antibody
concentration where all available epitopes on the cell surface are
bound.
[0629] Anti-ICOS antibodies may also be characterized by an ELISA
assay that uses a recombinant ICOS-Fc fusion protein (R&D
Systems) as a capture reagent. ELISA assays may be performed
according to any one of the established protocols known to one of
skill in the art. For example, microtiter plates are coated with
ICOS-Fc fusion protein (e.g., 100 .mu.l of 0.25 .mu.g/ml ICOS-Fc
protein) and incubated at 4.degree. C. overnight. Any remaining
binding sites are blocked with 4% skimmed milk in PBS buffer
(blocking buffer) for 1 h at 37.degree. C. Approximately 25-50
.mu.l of anti-ICOS antibody solution of various concentrations is
added to each well and incubated for 1 h at 37.degree. C. After
washing the wells, a goat anti-human kappa antibody conjugated with
horseradish peroxidase is used for the detection of ICOS-Fc fusion
protein bound anti-ICOS antibody following the manufacturer's
directions. Detection is carried out by adding 30 .mu.l of
tetramethylbenzidine (TMB) substrate (Pierce) followed by
neutralization with 30 .mu.l of 0.2 M H.sub.2SO.sub.4. The
absorbance is read at 450 nm. Negative control wells using an
isotype matched antibody of irrelevant specificity should be
included in the assay. In addition, negative control wells without
ICOS-Fc protein may also be included in the assay. An ICOS specific
antibody should give a dose dependent ELISA signal with the ICOS-Fc
coated wells but not with the uncoated negative control wells. The
ELISA signal is expected to reach a maximum at an antibody
concentration where all available epitopes are occupied.
[0630] The antigen specificity of ADCC enhanced anti-ICOS
antibodies may also be characterized by flow cytometry assays.
Isolated cells expressing human ICOS on their cell surface (e.g.,
stable transfectant CHO hICOS cells, activated T lymphocytes) are
incubated with a fluorescently conjugated anti-ICOS antibody
following a standard protocols. Negative control cell that do not
display ICOS on the cell surface are stained as well using the same
protocol. Immuno stained cells are analyzed on a flow cytometer.
Cells incubated with a negative control antibody of unrelated
specificity may also be included in the assay. An ICOS expressing
cell stained with a fluorescently conjugated anti-ICOS antibody
should have a mean fluorescence intensity that is higher than that
of either a non-ICOS expressing cell stained with the same antibody
or an ICOS expressing cell stained with a negative control antibody
of irrelevant specificity.
[0631] The binding affinity of ADCC enhanced anti-ICOS antibodies
may also be determined using the Biacore System (see, U.S. Pat. No.
6,803,039).
7.3. Antigen Binding Affinity of Deamidated Anti-ICOS
Antibodies
[0632] Deamidation of asparagines residue may significantly
contribute to the chemical degradation of antibody pharmaceuticals
(see, Chelius et al., Anal. Chem. 77:6004-11 (2005)). Deamidation
may be especially important when the potential deamidation site is
located within the CDR regions of an antibody. CDR3 of the JMAb 136
light chain variable domain comprises a NS potential deamidation
site at Kabat position 92. The effect of deamidation on the antigen
binding affinity of an anti-ICOS antibody may be assessed using
methods known to one of skills in the art. Briefly, an anti-ICOS
antibody is stored under conditions known to enhance the chemical
deamidation process. For example, an anti-ICOS antibody may be
stored for two weeks at 40.degree. C. in a buffer with a pH of 8.5
or 9.5 to accelerate the deamidation process. As deamidation of an
asparagine residue changes the overall charge of the protein, the
extent of deamidation in a given purified antibody sample may be
assessed by a number of analytical methods, for example, but not
limited to, ion exchange chromatography (IEC), isoelectro focusing
(IEF), Liquid Chromatography/Mass Sprectometry (LC-MS). The effect
of deamidation on ICOS binding affinity may be ascertained by
comparing the binding properties of IC9G1 antibody preparations
with high and low levels of deamidation. Binding affinity of the
various antibody preparations may be analaysed by for example, but
not limited to, cell based ELISA assays, ELISA assays using a
recombinant ICOS molecule as capture reagent, flow cytometry,
Biacore analysis. A significant decrease in the ICOS binding
activity of a IC9G1 anti-ICOS antibody preparations upon
deamidation would suggest that deamidation plays a major role in
the chemical degradation of the antibody. Alternatively, the ICOS
binding activity of non-deamidated and deamidated IC9G1 antibody
preparations may be very similar suggesting that deamidation is not
a major concern when considering the degradation pathways of the
antibody. If deamidation poses a problem for the long term
stability of the IC9G1 anti-ICOS antibody, then the deamidation
site may be eliminated from the amino acid sequence by generating
single amino acid substitution variants using the methods described
above. The ICOS binding affinity of any deamidation null anti-ICOS
antibody variant may be characterized by using the methods
described herein.
7.4. In Vitro ADCC Activity of ADCC Enhanced Anti-ICOS
Antibodies
[0633] The ADCC activity of various anti-ICOS antibodies may be
determined by an in vitro ADCC assay, such as that described in
U.S. Pat. No. 5,500,362 or 5,821,337. The ADCC assay may be
performed using a commercially available assay kit, for example,
but not limited to CytoTox 96.RTM. Non-Radioactive Cytotoxicity
Assay (Promega). The CytoTox 96.RTM. Non-Radioactive Cytotoxicity
Assay (Promega) is a calorimetric alternative to .sup.51Cr release
cytotoxicity assays. The CytoTox 96.RTM. Assay quantitatively
measures lactate dehydrogenase (LDH), a stable cytosolic enzyme
that is released upon cell lysis. Released LDH in culture
supernatants is measured with a 30-minute coupled enzymatic assay,
which results in the conversion of a tetrazolium salt (INT) into a
red formazan product. The amount of color formed is proportional to
the number of lysed cells.
[0634] The assays are performed according to the manufacturer's
directions. Briefly, target cells are washed with PBS, resuspended
in RPMI-5 Phenol Free media at a cell density of
0.4.times.10.sup.6/ml. NK effector cells are washed once in PBS and
resuspended in RPMI-5 Phenol Free media at a cell density
1.times.10.sup.6/ml. Assays are performed in U bottom 96 well
plates. Each assay plate includes a combination of experimental and
control wells. Experimental wells are set up by combining 50 .mu.l
of the appropriate antibody dilution, 50 ul of target cell
suspension and 50 ul of effector cell suspension. The cell
densities described above result in a 1:2.5 target to effector cell
ratio; effector cell stock may be further diluted or concentrated
if a different target to effector ratio is desired. Several
different types of control wells are used to account for (i) the
spontaneous LDH release form target cells (Target Spontaneous),
(ii) the spontaneous LDH release from effector cells (Effector
Spontaneous), (iii) the maximum LDH release from the target cells
(Target Maximum), and (iv) the presence of contaminants in the
culture medium (Background). All wells in use on a 96 well plate
contain the same final volume. Reactions are set up in triplicates.
Following set up, plates are spun at 120.times.g for 3 minutes to
pellet the cells. Incubate plate at 37.degree. C./5% CO.sub.2 for 4
hours. Forty five minutes prior to the end of incubation 15 .mu.l
of manufacturer provided Lysis Buffer is added to the Target Cell
Maximum Release Control well. After incubation the plate is
centrifuged at 120.times.g for 4 minutes. 50 .mu.l of the
supernatant from each well is transferred to a new flat bottom 96
well plate. 50 .mu.l of reconstituted substrate mix (assembled from
manufacturer provided components) is added and the plate is
incubated at room temperature 10-20 minutes protected from light.
50 .mu.l of manufacturer provided stop buffer is added and
absorbance at 490 or 492 nm is measured in a plate reader. %
cytotoxicity equals (Experimental-Effector spontaneous-Target
Spontaneous)/(Target Maximum-Target Spontaneous). Prior to
calculating the % cytotoxicity all other values are reduced by the
Background.
[0635] Potential target cells for an anti-ICOS antibody dependent
cytotoxicity assay include, but are not limited to, stable
transfectant hICOS expressing cell lines (e.g., human ICOS
expressing CHO cell line and human ICOS expressing HPB-ALL cell
line described in U.S. Pat. No. 6,803,039). Alternatively, freshly
isolated cells displaying human ICOS on their cell surface (e.g.,
activated T cells) may also be used as target cells. Suitable
effector cells include, but are not limited to, freshly isolated
natural killer cells (NK cells), and peripheral blood mononuclear
cells (PMBC). NK cell lines expressing a transgenic Fc receptor
(e.g. CD16) and associated signaling polypeptide (e.g.
FC.epsilon.RI-.gamma.) may also serve as effector cells (see, e.g.
WO 2006/023148 A2 to Campbell).
[0636] ADCC assays are performed in parallel using unmodified
anti-ICOS antibody (e.g., IC9G1), ADCC enhanced anti-ICOS antibody
(e.g., IC9G1-aFuc, IC9G1-3M). ADCC enhanced antibodies are expected
to mediate the lysis of a higher percentage of target cells than
that of mediated by the unmodified antibody. An anti-ICOS antibody
with reduced ADCC activity (e.g., IC9G1-TM) may also be include in
the assay as a negative control. Target specificity of the
anti-ICOS mediated ADCC assay may be demonstrated by using target
cells not expressing hICOS. The background cytotxicity in ADCC
assays performed using target cells not expressing hICOS is
expected to be similar between reactions using ADCC enhanced and
unmodified anti-ICOS antibodies.
7.5.Human ICOS Expression in Transgenic Mice
[0637] Human ICOS transgenic mice, which can be developed using
methods well known to persons trained in the art, or other
transgenic animals expressing human ICOS can be used to assess
different therapeutic regimens comprising anti-ICOS antibodies,
such as variations in dosing concentration, amount, and timing. The
efficacy in human patients of different therapeutic regimens can be
predicted using, e.g., the two indicators described below, i.e., T
cell depletion in certain bodily fluids and/or tissues and the
ability of an anti-ICOS antibody to bind T cells. In particular
embodiments, treatment regimens that are effective in human ICOS
transgenic mice could be used with compositions and methods of the
invention to treat human T cell disorders and disease including,
but not limited to, autoimmune diseases or disorders, inflammatory
diseases or disorders, and T cell malignancies.
[0638] In order to determine whether human ICOS is expressed on T
cell subpopulations from transgenic mice (hICOStg) comprising the
human ICOS transgene, T cells could be extracted from the thymus,
peripheral blood, spleen, lymph node and peritoneal lavage of these
mice. Human ICOS and mouse ICOS expression could be assessed in
these cells by contacting the cells with anti-ICOS antibodies that
specifically bind human ICOS (e.g., IC9G1) or mouse ICOS (mICOS)
(e.g., clone 15F9, BioLegend, CA). Binding of the antibody to T
lineage cell subpopulations could be detected using four-color
immunofluorescence staining with flow cytometry analysis. The
relative expression levels of mICOS and hICOS, could then be
assessed by measuring mean fluorescence intensity (anti-hICOS for
hICOS and anti-mICOS for mICOS) respectively.
7.6. Anti-ICOS Antibody Mediated Depletion of T Cells In Vivo
[0639] Anti-ICOS antibodies of the invention, which bind to human
ICOS, can be assessed for their ability to deplete hICOStg thymic,
peripheral blood, splenic, and lymph node T cell subpopulations in
vivo. For example, each antibody would be given to mice at either
250 or 50 .mu.g/mouse, a single dose about 10 to 50-fold lower than
a 375 mg/m.sup.2 dose given to a human subject. T cell depletion
from thymus, blood, spleen and lymph nodes of hICOStg mice would be
determined by immunofluorescence staining with flow cytometry
analysis. The results using anti-ICOS antibodies identified as
capable of depleting T cells can be correlated to use in humans and
antibodies with properties of the identified antibodies can be used
in the compositions and methods of the invention for the treatment
of human T cell disorders and disease including, but not limited
to, autoimmune diseases or disorders, inflammatory diseases or
disorders, and T cell malignancies.
7.6.1. Determination Whether Tissue T Cell Depletion is
FC.gamma.R-Dependent
[0640] Should administration of an anti-ICOS mAb of the invention
result in tissue T cell depletion, the following assays can be used
to demonstrate dependence upon Fc.gamma.R expression. Through a
process of interbreeding hICOStg mice with mice lacking expression
of certain Fc.gamma.R, mice can be generated that express hICOS and
lack expression of certain Fc.gamma.R. Such mice can be used in
assays to assess the ability of anti-ICOS antibodies to deplete T
cells through pathways that involve Fc.gamma.R expression, e.g.,
ADCC. Thus, anti-ICOS antibodies identified in these assays can be
used to engineer anti-ICOS antibodies with enhanced effector
function using the techniques described above. Such antibodies can
in turn be used in the compositions and methods of the invention
for the treatment of human T cell disorders and disease including,
but not limited to, autoimmune diseases or disorders, inflammatory
diseases or disorders, and T cell malignancies.
[0641] Mouse effector cells express four different Fc.gamma.R
classes for IgG, the high-affinity Fc.gamma.RI (CD64), and the
low-affinity Fc.gamma.RII (CD32), Fc.gamma.RIII (CD16), and
Fc.gamma.RIV molecules. Fc.gamma.RI, Fc.gamma.RIII and Fc.gamma.RIV
are hetero-oligomeric complexes in which the respective
ligand-binding a chains associate with a common .gamma. chain
(FcR.gamma.). FcR.gamma. chain expression is required for
Fc.gamma.R assembly and for Fc.gamma.R triggering of effector
functions, including phagocytosis by macrophages. Since
FcR.gamma..sup.-/- mice lack high-affinity Fc.gamma.RI (CD64) and
low-affinity Fc.gamma.RIII (CD16) and Fc.gamma.RIV molecules,
FcR.gamma..sup.-/- mice expressing hICOS can be used to assess the
role of Fc.gamma.R in tissue T cell depletion following anti-ICOS
antibody treatment.
7.6.2. Durability of Anti-ICOS Antibody-Induced T cell
Depletion
[0642] To assess the efficacy and duration of T cell depletion,
hICOStg mice can be administered a single low dose (e.g. 250 .mu.g)
injection of anti-ICOS antibody and the duration and dose response
of T cell depletion followed as a function of time. The results are
expected to demonstrate that circulating T cells are depleted for a
substantial amount of time (e.g. one week to six months), followed
by a gradual recovery of ICOS expressing T cells.
7.7. Therapeutic Efficacy of Subcutaneous (S.C.) Administration of
an Anti-ICOS Antibody of the Invention
[0643] The assay described herein can be used to determine whether
a subcutaneous route of administration of an anti-ICOS antibody of
the invention can effectively deplete T cell subpopulations. The
results of the efficacy of different delivery routes tested in
animal models can be correlated to humans by means well-known in
the art.
[0644] For example, hICOStg mice can be treated with an anti-ICOS
antibody of the invention at 250 .mu.g either by subcutaneous
(s.c.), intraperitoneal (i.p.) or intravenous (i.v.)
administration. Values are determined for the mean (.+-.SEM) blood
(per mL), thymus, spleen, lymph node, and peritoneal cavity ICOS
positive T cell numbers on day seven as assessed using flow
cytometry. Results are expected to demonstrate that subcutaneous
(s.c.), intraperitoneal (i.p.) and intravenous (i.v.)
administration of an anti-ICOS antibody of the invention will
effectively deplete ICOS expressing circulating and tissue T cells
in vivo.
7.8. Use of Anti-ICOS Antibodies in Reducing Tumor Growth in an In
Vivo Lymphoma Model
[0645] Anti-ICOS antibodies of the invention, which bind to human
ICOS, may be assessed for their ability to reduce tumor growth in
in vivo animal models. For example, SCID mice would be injected
with human ICOS expressing cell lines to establish a tumor
xenograft (e.g., stable transfectant HBP-ALL hICOS cells).
Subsequently, the mice would be given several doses of an anti-ICOS
antibody of the invention (e.g., 100 .mu.g antibody/mouse 5 times).
Tumor growth would be followed using standard methods (e.g., tumor
volume, animal weight, paralysis) The effect of anti-ICOS treatment
on tumor growth may be determined by comparing animals receiving
anti-ICOS or control antibody treatment. The results obtained using
anti-ICOS antibodies identified as capable of reducing tumor growth
can be correlated to use in humans, and antibodies capable of
reducing tumor growth can be used in the compositions and methods
of the invention for the treatment of human T cell disorders and
diseases including, but not limited to, autoimmune diseases or
disorders, inflammatory diseases or disorders, and T cell
malignancies.
[0646] To determine whether an anti-ICOS antibody's ability to
reduce tumor growth is dependent on ICOS density, tumor cell lines
with different ICOS expression profiles may be tested in the above
described in vivo tumor growth assay. The results obtained may
demonstrate whether human ICOS density on the tumor cell surface
can influence the tumor growth reducing activity of an anti-ICOS
antibody. The results can be correlated to treatment of human
patients with varying levels of ICOS expression. Thus, the methods
for examining ICOS presence and density, described herein, can be
used in human subjects to identify patients or patient populations
for which certain anti-ICOS antibodies can reduce the growth of
malignant T cells and/or to determine suitable dosages.
[0647] To determine whether an anti-ICOS antibody's ability to
reduce tumor growth is dependent Fc.gamma.R, the above described in
vivo tumor growth assay would be performed using SCID mice with
compromised Fc.gamma. receptor activity (e.g., FcR.gamma..sup.-/-).
Through a process of interbreeding SCID mice with mice lacking
expression of certain Fc.gamma.R, SCID mice can be generated that
also lack expression of certain Fc.gamma.R (e.g., SCID,
FcR.gamma..sup.-/- mice). Such mice can be used in assays to assess
the ability of anti-ICOS antibodies to reduce tumor growth through
pathways that involve Fc.gamma.R expression, e.g., ADCC. Based on
the results, anti-ICOS antibodies with increased ADCC can be
engineered using the techniques described above. Such antibodies
can in turn be used in the compositions and methods of the
invention for the treatment of human T cell disorders and diseases
including, but not limited to, autoimmune diseases or disorders,
inflammatory diseases or disorders, and T cell malignancies.
7.8.1. IC9G1-aFuc Binding to Fcgamma Receptors.
[0648] The equilibrium binding constants of IC009, IC9G1 and
IC9G1-aFuc to human and cynomolgus Fc.gamma.RIIIA-V158,
Fc.gamma.RIIIA-F158, Fc.gamma.RIIA and Fc.gamma.RIIB are measured
on a BIAcore 3000 instrument (Uppsala, Sweden). The measurements
are performed according to standard protocols. Briefly, all IgGs
are immobilized onto separate flow cells of two CM5 sensor chips
using standard amino coupling chemistry as recommended by the
manufacturer. Immobilized IgG levels range from 8194 to 8725 RUs.
Stock solutions of the recombinantly expressed extracellular
domains of all Fc.gamma.Rs at either 4000 or 16000 nM are prepared
and then serially diluted down to the desired concentrations using
the instrument buffer (50 mM HBS buffer containing 0.01 M HEPES, pH
7.4, 0.15 M NaCl, 3 mM EDTA and 0.005% P-20). Duplicate injections
of each concentration of Fc.gamma.R ared then injected over all of
the IgG surfaces at a flow rate of 5 .mu.L/min. Binding data are
collected for approximately 50 min, followed by a 30 sec. pulse of
5 mM HCl between injections to regenerate the IgG surfaces. Several
buffer injections are also interspersed throughout the injection
series. One of these buffer injections is used along with the
reference cell data to correct the raw data sets. After all binding
data is collected, individual data sets are averaged for each y
concentration, then fit to a 1:1 binding isotherm from which the
equilibrium binding constants, K.sub.D, are derived. Analysis is
carried out using the BIAevaluation software. The K.sub.D values
(nM) are presented in FIG. 2.
7.9. IC9G1-aFuc Inhibits Anti-CD3/ICOSL Induced Human T Cell
Proliferation
[0649] 96-well tissue culture plates are coated with 25 microL 2
.mu.g/ml B7h-Fc protein and 25 microL of 0.2 .mu.g/ml anti-CD3
antibody (OKT3). Isolated T cells are plated on the pre-coated
plates in the presence of various concentration (0.1-20 .mu.g/ml)
of IC009, IC9G1 and IC9G1-aFuc antibody. T cell proliferation is
ascertained by measuring after 72 hours of incubation the number of
viable cells in each well using a luminescence assay. The
proliferation of T cells in uncoated wells, and wells coated with
either anti-CD3 antibody or B7h-Fc protein alone is determined as a
control.
[0650] An example of the results obtained is shown in FIG. 3.
Unstimulated T cells or T cells stimulated by anti-CD3 or B7h-Fc
alone displayed a very limited baseline proliferation. T cell
induction by surface bound anti-CD3 and B7h-Fc in the presence of
0.01 mg/ml antibody resulted in cell proliferation significantly
above the baseline. Anti-CD3/B7h-Fc induced T cell proliferation is
inhibited by all three anti-ICOS antibody tested (IC009, IC9G1 and
IC9G1-aFuc) in a dose dependent manner. The inhibitory activity of
IC009, IC9G1 and IC9G1-aFuc antibodies was substantially identical
in the assay.
7.10. IC9G1-aFuc Does not Inhibit anti-CD3/anti-CD28 Induced Human
T Cell Proliferation
[0651] 96-well tissue culture plates are coated with anti-CD3
(OKT3) and anti-CD28 antibodies. Isolated tonsillar T cells are
plated on the pre-coated plates in the presence of 10 .mu.g/ml of
IC9G1-aFuc antibody. T cell proliferation is ascertained by
measuring after 72 hours of incubation the number of viable cells
in each well using a luminescence assay. The proliferation of T
cells in uncoated wells, and wells coated with either anti-CD3 or
anti-CD28 antibody only is determined as a control.
[0652] An example of the results obtained is shown in FIG. 4.
Unstimulated T cells or T cells stimulated by anti-CD3 or anti-CD28
antibody alone displayed a very limited baseline proliferation. T
cell induction by surface bound anti-CD3 and anti-CD28 antibodies
resulted in cell proliferation significantly above the baseline
(aCd3+aCD28). The IC9G1-aFuc antibody (10 .mu.g/ml) did not inhibit
the anti-CD3/anti-CD28 induced T cell proliferation
(.alpha.Cd3+.alpha.CD28+IC9G1-aFuc).
7.11. IC9G1-aFuc has Enhanced ADCC Activity
[0653] The ADCC activity of IC9G1-aFuc is ascertained by an in
vitro ADCC assay using various ICOS expressing primary cells and
cell lines. The ADCC assays are performed following a standard
protocol. Briefly, target cells and effector cells (e.g.,
transgenic NK cells expressing CD16 and associated signaling
polypeptide FC.epsilon.RI-.gamma.) are plated at a predetermined
ratio (e.g., 2.5:1 effector to target ratio) in the presence of the
IC9G1-aFuc antibody. The plates are incubated for a pre-determined
length of time (e.g. 4 hrs). Cell death is ascertained by measuring
LDH release into the supernatant using a commercially available LDH
detection kit. Antibody mediated cytotoxicity is calculated by
subtracting from the LDH levels detected in the antibody containing
wells the background LDH levels detected in antibody-free control
wells. Antibody mediated cytotoxicity is expressed as a % of
maximum cytotoxicity achievable. The maximum cytotoxicity value is
derived from the LDH levels measured in wells containing chemically
lysed cells (e.g. Triton-X 100 treated well). ADCC activity is
presented by plotting antibody mediated cytotoxicity as a function
of the antibody concentration. EC50 values correspond to the
antibody concentration resulting in a 50% maximum antibody mediated
cytotoxicity in the particular assay.
[0654] FIG. 5A shows an example of ADCC activity measurements
performed using stable transfectant HPB-ALL hICOS cells as target
cells. The generation of human ICOS transgenic HPB-ALL cell line is
described in U.S. Pat. No. 6,803,039. The ADCC assay was performed
using CD 16/FC.epsilon.RI-.gamma. transgenic NK cells as effector
cells at a 2.5:1 effector to target ratio. The ADCC reaction was
allowed to proceed for 4 hrs. The ADCC activity of IC009, IC9G1 and
IC9G1-aFuc antibodies was ascertained. IC009 mediated ADCC activity
was below the detection level. The ADCC activity of IC9G1-aFuc was
significantly higher than that of the IC9G1 antibody. The EC50
values of IC9G1-aFuc and IC9G1 antibodies were 138 pM and 648 pM,
respectively, in this assay.
[0655] FIG. 5B shows an example of ADCC activity measurements
performed using human ICOS transgenic Jurkat cells as target cells.
The ADCC assay was performed using CD16/FC.epsilon.RI-.gamma.
transgenic NK cells as effector cells at a 2.5:1 effector to target
ratio. The ADCC reaction was allowed to proceed for 4 hrs. The ADCC
activity of IC009, IC9G1 and IC9G1-aFuc antibodies was ascertained.
All three antibodies displayed measurable ADCC activity. Maximum %
ADCC activity of IC9G1-aFuc and IC9G1 was higher then that of
IC009. Maximum % ADCC activity of IC9G1-aFuc and IC9G1 were
substantially identical. The EC50 values of IC9G1-aFuc and IC9G1
antibodies were 5.7 pM and 61 pM, respectively, in this assay.
[0656] FIG. 7 shows an example of ADCC activity measurements
performed using isolated human tonsillar T cells as target cells.
ICOS expression of human tonsillar T cells was restricted to the
CD4+CD45RO+CD45RA--CXCR5+ memory T.sub.FH cell population (FIG. 6).
Human tonsillar T cells were isolated with the help of a
commercially available kit (Miltenyi MACS human PanT cell isolation
kit). The ADCC assay was performed using isolated human NK cells as
effector cells ar a 2:1 effector to target ratio; the reaction was
incubated overnight. The ADCC activity of IC009, IC9G1 and
IC9G1-aFuc antibodies was ascertained. IC009 mediated ADCC activity
was slightly above detection level. The IC9G1-aFuc and IC9G1
antibodies displayed a dose dependent ADCC activity in this assay.
The ADCC activity of IC9G1-aFuc was significantly higher than that
of the IC9G1 antibody. The EC50 values of IC9G1-aFuc and IC9G1
antibodies were 8.2 pM and 60.4 pM, respectively, in this
assay.
[0657] FIG. 8 shows an example of ADCC activity measurements
performed using isolated cynomolgus splenic T cells as target
cells. ICOS expression was substantially restricted to the
CD4+CD45RA- memory T cell population in the spleen (FIG. 8A).
Cynomolgus splenic T target cells were isolated using a non-human
primate T cell isolation kit (Miltenyi). The ADCC assay was
performed using isolated human NK cells as effector cells ar a 2:1
effector to target ratio; the reaction was incubated overnight. The
ADCC activity of IC009, IC9G1 and IC9G1-aFuc antibodies was
ascertained. IC009 mediated ADCC activity was below detection
level. The IC9G1-aFuc and IC9G1 antibodies displayed a dose
dependent ADCC activity in this assay. The ADCC activity of
IC9G1-aFuc was significantly higher than that of the IC9G1
antibody. The EC50 values of IC9G1-aFuc and IC9G1 antibodies were
14.6 pM and 236 pM, respectively, in this assay.
[0658] FIG. 8 shows an example of ADCC activity measurements
performed using isolated cynomolgus mesenteric lymph node (MLN) T
cells as target cells. ICOS expression was substantially restricted
to the CD4+CD45RA- activated T cell population in the MLN (FIG.
9A). Cynomolgus splenic T target cells were isolated using a
non-human primate T cell isolation kit (Miltenyi). The ADCC assay
was performed using isolated human NK cells as effector cells ar a
2:1 effector to target ratio; the reaction was incubated overnight.
The ADCC activity of IC009, IC9G1 and IC9G1-aFuc antibodies was
ascertained. IC009 mediated ADCC activity was at detection level.
The IC9G1-aFuc and IC9G1 antibodies displayed a dose dependent ADCC
activity in this assay. The ADCC activity of IC9G1-aFuc was
significantly higher than that of the IC9G1 antibody. The EC50
values of IC9G1-aFuc and IC9G1 antibodies were 17.1 pM and 198 pM,
respectively, in this assay.
7.12. Pharmacokinetic Profile of IC9G1-aFuc in Cynomolgus
Monkeys
[0659] Cynomolgus monkeys were administered a single IV dose of
IC9G1-aFuc antibody on day 0 of the experiment. Experimental design
is outlined in Table 3.
TABLE-US-00003 TABLE 3 Experimental design of in vivo studies of
IG9G1-aFuc in cynomolgus monkeys. Group Agent Dose (mg/kg) Number 1
Carrier only 0 5 males 2 IC9G1-aFuc 0.01 5 males 3 IC9G1-aFuc 0.1 5
males 4 IC9G1-aFuc 1 5 males 5 IC9G1-aFuc 10 5 males 6 IC009 10 5
males
[0660] The pharmacokinetic profile of IC9G1-aFuc was analyzed by
delivering a single dose of the antibody and monitoring its serum
concentration over time. Serum concentration of IC9G1-aFuc was
measured by ELISA according to standard protocols. ICG91-aFuc serum
concentration as a function of time is presented in FIG. 10.
Systemic exposure based on estimates of AUC.sub.LAST for IC9G1-aFuc
and Cmax increased in a dose proportional manner with increasing
the dose, reflecting the linearity in the antibody pharmacokinetic
properties. Mean terminal half-life (t1/2 lz) values of
4.36.+-.1.52 days, 6.34.+-.1.44 days and 7.87.+-.1.09 days were
observed following bolus infusions of 0.1 mg/kg, 1 mg/kg and 10
mg/kg, respectively.
7.13. In vivo T Cell Depletion following the Administration of a
Single Dose of IC9G1-aFuc
[0661] Cynomolgus monkeys were administered a single IV dose of
IC9G1-aFuc antibody. Antibody dose administered to the various
animals is described in Table 3. Two animals from each group were
sacrificed on day 8 post-dosing. Three animals from each group were
sacrificed on day 29 post-dosing. The level of circulating, splenic
and mesnteric lymph node (MLN) ICOS+ T cells were monitored for
four weeks following the delivery of the single antibody dose.
ICOS+ T cells were monitored by flow cytometry.
[0662] FIG. 11 shows the changes in circulating ICOS+ memory T cell
level following the administration of a single dose of IC9G1-aFuc
antibody. Circulating memory T cells were defined as
CD3+CD4+CD45RA-ICOS+ cells for the purposes of this study. Absolute
numbers of circulating memory T cells detected were normalized to
the circulating memory T cell numbers detected on day 0 prior to
antibody administration. Administration of a single dose of 0.01
mg/kg of IC9G1-aFuc antibody resulted in a significant reduction in
circulating memory T cell count by day 4. Administration of a
single dose of 0.1 mg/kg, 1 mg/kg or 10 mg/kg of IC9G1-aFuc
antibody resulted in the complete elimination of circulating memory
T cells by day 4 of the experiment. Recovery of the circulating
memory T cell compartment over time was dose dependent.
[0663] FIG. 13 provides an example of the depletion results seen in
the mesenteric lymph node (MLN) T cell compartment. MLN T cells
were isolated from animals sacrificed on day 8 and day 29 of the
experiment. Absolute numbers of ICOS+ memory helper T cells
isolated from the MLN were determined by flow cytometry. Memory
helper T cells were defined as CD3+CD4+CD45RA- for the purposes of
the experiment. Absolute numbers of ICOS+ memory T cells isolated
from the MLN on day 8 are displayed in FIG. 13A. Administration of
a single dose of 0.1 mg/kg and 10 mg/kg of IC9G1-aFuc antibody
resulted in a significant dose dependent depletion of ICOS+ memory
helper T cells from the mesenteric lymph node. Similar depletion of
ICOS+ memory helper T cells was detected in the tonsil and
mandibular lymph node. FIG. 13B presents the % depletion of ICOS+
memory helper T cells in the mesenteric lymph node on day 8. %
depletion was calculated by normalizing the absolute ICOS+ memory
helper T cell numbers detected in IC9G1-aFuc treated animals to the
cell numbers detected in the carrier only treated control animals.
Administration of a single dose of 0.1 mg/kg and 10 mg/kg of
IC9G1-aFuc antibody resulted in the depletion of greater than 60%
and 90%, respectively, of ICOS+ memory helper T cells from the
mesenteric lymph node by day 8.
[0664] FIG. 14 provides an example of the depletion results seen in
the splenic T cell compartment. Splenic T cells were isolated from
animals sacrificed on day 8 and day 29 of the experiment. Absolute
numbers of splenic ICOS+ memory helper T cells were determined by
flow cytometry. Memory helper T cells were defined as
CD3+CD4+CD45RA- for the purposes of the experiment. Absolute
numbers of ICOS+ memory T cells isolated from the MLN on day 8 and
29 are displayed in FIG. 14A. Administration of a single dose of
0.1 mg/kg and 10 mg/kg of IC9G1-aFuc antibody resulted in a
significant depletion of splenic ICOS+ memory helper T cells by day
8. The recovery of splenic ICOS+ memory helper T cells were dose
dependent; splenic ICOS+ T cell recovery on day 28 was more
pronounced in animals dosed with 0.1 mg/kg IC9G1-aFuc than in
animals dosed with 10 mg/kg IC9G1-aFuc. FIG. 14B presents the %
depletion of splenic ICOS+ memory helper T cells in the mesenteric
lymph node on day 8 and 29. % depletion was calculated by
normalizing the absolute ICOS+ memory helper T cell numbers
detected in IC9G1-aFuc treated animals to the cell numbers detected
in the carrier only treated control animals. Administration of a
single dose of 0.1 mg/kg and 10 mg/kg of IC9G1-aFuc antibody
resulted in the depletion of greater than 60% of splenic ICOS+
memory helper T cells by day 8. By day 29, the splenic ICOS+memory
helper T cell compartment of animals dosed with 0.1 mg/kg of
IC9G1-aFuc started to recover. The splenic ICOS+ memory helper T
cell compartment of animals dosed with 10 mg/kg of IC9G1-aFuc was
more depleted on day 29 than on day 8.
7.14. In Vivo Administration of a Single Dose of IC9G1-aFuc Results
in the Dissolution of Already Formed Germinal Centers
[0665] Cynomolgus monkeys were administered a single IV dose of
IC9G1-aFuc antibody. Antibody dose administered to the various
animals is described in Table 3. Two animals from each group were
sacrificed on day 8 post-dosing. Three animals from each group were
sacrificed on day 29 post-dosing. The architecture of splenic white
pulp was examined on day 8 and 29 using standard histology
protocols. The number of mesenteric lymp node and splenic germinal
center B cells were measured on day 8 and 29 by flow cytometry.
[0666] FIG. 15 presents an example of the architectural changes to
the splenic white pulp caused by the administration of a single IV
dose of IC9G1-aFuc. Low (10.times.) and high (20.times.)
magnification of histological sections of white pulp isolated from
control and IC9G1-aFuc dosed animals on day 8 (FIG. 15A) and day 29
(FIG. 15B) of the experiment is shown. Splenic follicles were
atrophied on day 29 after administration of a single dose of
IC9G1-aFuc antibody to cynomolgus monkeys. The morphology of
splenic white pulp was examined following the administration of a
single dose f IC9G1-aFuc antibody. Histological sections of the
spleen isolated on day 8 (A) and day 29 (B) after IC9G1-aFuc
antibody administration are shown. IC9G1-aFuc administration
results in severe atrophy of splenic follicles by day 29.
[0667] FIG. 12 shows the flow cytometry protocol that was used to
identify germinal center B cells. Lymphocytes were isolated from
lymphatic organs of sacrificed animals following standard
protocols. Isolated lymphocytes were immunostained with anti-CD3,
anti-CD20, anti-IgM and anti CD95 or anti-CD27 antibodies. Dead
cells were excluded from the analysis with the aid of 7AAD
staining. Germinal center N cells were defined as either
CD3-CD20+IgM-CD95+ or CD3-CD20+IgM-CD27+ cells.
[0668] FIG. 13 provides an example of the effects on the mesenteric
lymph node (MLN) germinal center B cell compartment caused by the
administration of a single dose of IC9G1-aFuc. MLN lymphocytes were
isolated from animals sacrificed on day 8 and day 29 of the
experiment. Absolute numbers of germinal center B cells were
determined by flow cytometry. Germinal center B cells were defined
as CD20+IgM-CD95+ cells for the purposes of the experiment.
Absolute numbers of germinal center B cells isolated from the MLN
on day 8 are displayed in FIG. 13A. Administration of a single dose
of 0.1 mg/kg and 10 mg/kg of IC9G1-aFuc antibody resulted in a
significant dose dependent loss of germinal center B cells from the
mesenteric lymph node. The administration of a single dose of the
IC009 antibody resulted in a comparable loss of germinal center B
cells from the MLN on day 8. FIG. 13B presents the % dissolution of
germinal centers in the mesenteric lymph node on day 8. %
dissolution was calculated by normalizing the absolute germinal
center B cell numbers detected in IC9G1-aFuc treated animals to the
cell numbers detected in the carrier only treated control animals.
Administration of a single dose of 0.1 mg/kg and 10 mg/kg of
IC9G1-aFuc antibody resulted in the dissolution of greater than 75%
and 90%, respectively, of germinal centers from the mesenteric
lymph node by day 8. Administration of a single dose of 10 mg/kg of
IC009 antibody resulted in the dissolution of greater than 80% of
germinal centers from the mesenteric lymph node by day 8. The
germinal center B cells in this model system were present in the
MLN prior to administration of the IC9G1-aFuc antibody. The loss of
germinal center B cells from the MLN therefore indicates that the
depletion of ICOS+ memory helper T cells leads to the dissolution
of previously formed germinal centers.
[0669] FIG. 14 provides an example of the effects on the splenic
germinal center B cell compartment caused by the administration of
a single dose of IC9G1-aFuc. Splenic lymphocytes were isolated from
animals sacrificed on day 8 and day 29 of the experiment. Absolute
numbers of germinal center B cells were determined by flow
cytometry. Germinal center B cells were defined as CD20+IgM-CD95+
cells for the purposes of this experiment. Absolute numbers of
germinal center B cells isolated from the spleen on day 8 and 29
are displayed in FIG. 14A. Administration of a single dose of 0.1
mg/kg and 10 mg/kg of IC9G1-aFuc antibody did not significantly
affect splenic germinal center B cells numbers on day 8. By day 29,
however, the splenic germinal center B cell numbers were
significantly reduced in IC9G1-aFuc treated animals, In contrast,
no significant change in splenic germinal center B cell numbers
were detected in IC009 treated animals. FIG. 14B presents the %
dissolution of splenic germinal centers on day 8 and 29. %
dissolution was calculated by normalizing the absolute germinal
center B cell numbers detected in IC9G1-aFuc treated animals to the
cell numbers detected in the carrier only treated control animals.
Administration of a single dose of IC9G1-aFuc antibody did not
result in significant dissolution of splenic germinal centers by
day 8. By day 29, however, approximately 80% of splenic germinal
centers were dissolved in the IC9G1-aFuc treated animals. No
significant dissolution of splenic germinal centers were detected
on either day 8 or 29 following the administration of 10 mg/kg of
IC009. The germinal center B cells in this model system were
present in the spleen prior to administration of the IC9G1-aFuc
antibody. The loss of germinal center B cells from the spleen
therefore indicates that the depletion of ICOS+ memory helper T
cells leads to the dissolution of previously formed germinal
centers.
7.15. ICOS and ICOSL mRNA Expression is Elevated in Patients
Affected by Inflammatory or Autoimmune Diseases
7.16. ICOS is a Therapeutic Target in Systemic Lupus
Erythematosus
[0670] Inducible costimulator (ICOS) is involved in the regulation
of autoimmune and proinflammatory responses and may play important
roles in the pathogenesis of SLE. We used a genomics approach to
evaluate the mRNA expression levels of a panel of cytokines and
immune regulators in lesional skin of active SLE patients with
cutaneous involvement.
[0671] We profiled lesional skin and whole blood (WB) from a large
panel of SLE patients with cutaneous involvement using the
Affymetrix.RTM. human whole genome array (WGA) platform.
TaqMan.RTM. QRT-PCR using a BioMark.TM. 48.48 dynamic array from
Fluidigm was used to measure the mRNA levels of both long and short
alternative splicing forms of ICOS, along with a large panel of
cytokines.
[0672] ICOS mRNA was overexpressed in lesional skin for
approximately 50-60% of the SLE patients evaluated in the study
(FIG. 20). Positive correlations between ICOS and the ICOS ligand
mRNA overexpression, and between ICOS and IL-10 mRNA overexpression
were observed. Robust overexpression of these mRNAs was not
observed in peripheral uninvolved tissues of SLE patients.
Additionally, we used TaqMan QRT-PCR to determine whether the short
or long alternative splicing form of ICOS is overexpressed in SLE,
and also evaluated miR-101 expression in ICOS+ memory T cells
purified from WB of SLE patients.
[0673] Two protein isoforms of ICOS were identified from the cDNA
database (see FIG. 16). Full length of ICOS (SEQ ID NO:32) has 199
amino acids. It contains a signal peptide, an extracellular domain,
a transmembrane domain and a cytoplasmic domain. In the cytoplasmic
domain, it contains YMFM (residues 180-183 of SEQ ID NO:32)
conserved motif for PI3K binding. The short form of ICOS (SEQ ID
NO:33) has 168 amino acids. The short form has a in frame
truncation in cytoplasmic domain caused by exon 4 skipping. The
truncation generated a much shorter cytoplasmic domain and lost
PI3K binding site that may have functional impacts on ICOS
function.
[0674] In silico analysis of ICOS 3' UTR (residues 238-2284 of SEQ
ID NO:34) using a MiRanda revealed several putative miRNA target
sites (FIG. 17). MicroRNA target region one (MTR1), a 47 bp region
containing target sequences for miR-101, 103/107 and 338, and miRNA
target region two (MTR2), a 47 bp region containing the target
sequence for miR-149. Complementarity of ICOS cDNA and the
identified miRNA molecules is shown in FIG. 17. (Di Yu, &
Carola G. Vinuesa et al. Nature (2007) 450, 299-303).
[0675] Affymetrix GeneChip and qRT-PCR Profiling--SLE: We profiled
lesional skin and whole blood (WB) from a panel of SLE patients
with cutaneous involvement using the Affymetrix.RTM. human whole
genome array (WGA) platform. TaqMan.RTM. qRT-PCR using a
BioMark.TM. 48.48 dynamic array from Fluidigm was used to measure
the mRNA levels of ICOS, along with a large panel of cytokines.
[0676] FIG. 20A shows ICOS and ICOSL mRNA relative expression (log
2 scale) in SLE (Systemic Lupus Erythematosus) skin lesion
specimens. Individual fold-change values were determined relative
to a normal skin sample control. Data was generated on Fluidigm's
BioMark.TM. 48.48 dynamic array. Bars represent mean of relative
expression (fold-change) for each transcript (ICOS or ICOSL)
examined.
[0677] Raw signal intensity values (log 2 scale) for CD4 (FIG. 20B)
and CD3.epsilon. mRNA (FIG. 20C) in normal and SLE (Systemic Lupus
Erythematosus) skin specimens. Data (GC-RMA normalized) was
generated on the Affymetrix Human Genome U133 Plus 2.0 Array. Bars
represent mean of raw signal intensity for normal and SLE
samples.
[0678] FIG. 21A: CD28, CTLA4, ICOS and ICOSL mRNA relative
expression (log 2 scale) in SLE (Systemic Lupus Erythematosus)
whole blood specimens. Individual fold-change values were
determined relative to a pooled normal whole blood sample control.
Data was generated on Fluidigm's BioMark.TM. 48.48 dynamic array.
Bars represent mean of relative expression (fold-change) for each
transcript (CD28, CTLA4, ICOS or ICOSL) analyzed.
[0679] Raw signal intensity values (log 2 scale) for CD4 (FIG. 21B)
and CD3.epsilon. mRNA (FIG. 21C).in normal and SLE (Systemic Lupus
Erythematosus) whole blood specimens. Data (GC-RMA normalized) was
generated on the Affymetrix Human Genome U133 Plus 2.0 Array. Bars
represent mean of raw signal intensity for normal and SLE
samples.
7.17. ICOS Expression in Inclusion Body Myositis (IBM) and
Dermatomyositis (DM)
[0680] Inducible costimulator (ICOS), a receptor on activated
T-cells, plays a central role in humoral immunity. Elevated levels
of ICOS are present in patients with autoimmune diseases (e.g.,
rheumatoid arthritis and systemic lupus) and effector cytokines
have been shown to correlate with increased levels of this protein.
We used genomics technologies to investigate the over-expression of
ICOS and the ICOS ligand (ICOSL) in muscle tissue taken from
patients with inclusion body myositis (IBM), dermatomyositis (DM)
and polymyositis (PM) and present results consistent with a
regulatory mechanism of ICOS by the T-cell expressed miRNA,
miR-101.
[0681] We profiled muscle specimens from myositis patients using
TaqMan.RTM. QRT-PCR (Fluidigm's BioMark.TM. 48.48 dynamic array).
mRNAs (noncoding RNAs expressed by T lymphocytes and known to
regulate gene expression) that potentially regulate ICOS were
identified by 2 criteria: (1) their sequences were complementary to
the 3' UTR region of ICOS, and (2) they were significantly
differentially expressed in the opposite direction of ICOS mRNA in
IBM, PM and DM muscle, compared with normal control muscle.
[0682] ICOS mRNA in IBM muscle specimens were highly up-regulated
by an average of 40-fold, with mRNAs of ICOSL up-regulated by an
average of 3.5-fold, compared to normal controls. In DM muscle
specimens, ICOS mRNAs were up-regulated by an average of 5-fold;
ICOSL mRNA showed no significant upregulation compared with normal
controls. ICOS mRNA in IBM muscle specimens were highly
up-regulated (over 70 fold upregulation), with ICOSL mRNAs
up-regulated by 2-fold, compared to normal controls. Overexpression
of ICOS and ICOSL mRNA was not observed in whole blood from IBM or
DM muscle. CD4 and CD3.epsilon. mRNAs were strongly over-expressed
in IBM muscle specimens, whereas only CD4 mRNA was over-expressed
in muscle specimens of DM patients. The presence of ARE sites (AU
rich region for protein binding) and sequence complementarity
between the 3' UTR domain in ICOS and miR-101 suggest that miR-101
is a potential regulator of ICOS. We subsequently evaluated the
expression level of miR-101, as well as the feasibility of this
miRNA to regulate this transcript. The expression of miR-101 was
significantly down-regulated by an average of 4-fold and 2.5-fold,
respectively, in IBM and DM muscle compared with normal control
muscle.
[0683] ICOS mRNA is overexpressed in muscle tissue from IBM, DM and
PM patients. Strong over-expression of mRNAs of CD4 and
CD3.epsilon. suggest an increase in CD4+ T cell infiltration at the
disease site of IBM patients as has been previously noted. The
significant under-expression of miR-101 in muscle tissue from IBM
and DM patients confirmed the observation from sanroque mice
previously reported.
[0684] Affymetrix GeneChip, qRT-PCR and microRNA
Profiling--Myositis: We profiled muscle biopsy and whole blood (WB)
from a panel of myositis patients using the Affymetrix.RTM. human
whole genome array (WGA) platform. Additionally, we profiled muscle
specimens from myositis patients using both TaqMan.RTM. qRT-PCR
(Fluidigm's BioMark.TM. 48.48 dynamic array) and the Applied
Biosystem MicroRNA TaqMan Human MicroRNA Array v1.0 platforms.
mRNAs (noncoding RNAs expressed by T lymphocytes and known to
regulate gene expression) that potentially regulate ICOS were
identified by 2 criteria: (1) their sequences were complementary to
the 3' UTR region of ICOS, and (2) they were significantly
differentially expressed in the opposite direction of ICOS mRNA in
IBM, PM and DM muscle, compared with normal control muscle.
[0685] FIG. 18 shows miR-101 relative expression in muscle
specimens from myositis patients (IBM=Inclusion-body myositis,
PM=polymyositis, DM=Dermatomyositis). Individual expression values
were determined relative to a normal muscle sample control. Data
was generated on ABI's Human MicroRNA Array v1.0 platform. Bars
represent mean of relative expression for each disease
sub-type.
[0686] FIG. 19A shows ICOS and ICOSL mRNA relative expression (log
2 scale) in myositis muscle specimens (IBM=Inclusion-body myositis,
PM=polymyositis, DM=Dermatomyositis). Individual fold-change values
were determined relative to a normal muscle sample control. Data
was generated on Fluidigm's BioMark.TM. 48.48 dynamic array. Bars
represent mean of relative expression (fold-change) for each
disease sub-type and transcript (ICOS or ICOSL) combination.
[0687] Raw signal intensity values (log 2 scale) for CD4 (FIG. 19B)
and CD3.epsilon. (FIG. 19C) mRNA in normal and myositis muscle
specimens (IBM=Inclusion-body myositis, PM=polymyositis,
DM=Dermatomyositis). Data (GC-RMA normalized) was generated on the
Affymetrix Human Genome U133 Plus 2.0 Array. Bars represent mean of
raw signal intensity for normals and each disease sub-type.
[0688] FIG. 19D shows ICOS and ICOSL mRNA relative expression (log
2 scale) in myositis whole blood samples (IBM=Inclusion-body
myositis, PM=polymyositis, DM=Dermatomyositis). Individual
fold-change values were determined relative to a normal muscle
sample control. Data was generated on Fluidigm's BioMark.TM. 48.48
dynamic array. Bars represent mean of relative expression
(fold-change) for each disease sub-type and transcript (ICOS or
ICOSL) combination.
[0689] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein. Such equivalents are intended to be encompassed by the
following claims.
[0690] Various publications are cited herein, the disclosures of
which are incorporated by reference in their entireties.
[0691] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it will be obvious that certain changes and
modifications may be practiced within the scope of the appended
claims.
Sequence CWU 1
1
391321DNAHomo sapiens 1gacatccaga tgacccagtc tccatcttcc gtgtctgcat
ctgtaggaga cagagtcacc 60atcacttgtc gggcgagtca gggtattagc aggttgttag
cctggtatca gcagaaacca 120gggaaagccc ctaaactcct gatctatgtt
gcatccagtt tgcaaagtgg ggtcccatca 180aggttcagcg gcagtggatc
tgggacagat ttcactctca ccatcagcag cctgcagcct 240gaagattttg
caacttacta ttgtcaacag gctaacagtt tcccgtggac gttcggccaa
300gggaccaagg tggaaatcaa a 3212107PRTHomo sapiens 2Asp Ile Gln Met
Thr Gln Ser Pro Ser Ser Val Ser Ala Ser Val Gly1 5 10 15Asp Arg Val
Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Arg Leu 20 25 30Leu Ala
Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45Tyr
Val Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55
60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65
70 75 80Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ala Asn Ser Phe Pro
Trp 85 90 95Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 100
105311PRTHomo sapiens 3Arg Ala Ser Gln Gly Ile Ser Arg Leu Leu Ala1
5 1047PRTHomo sapiens 4Val Ala Ser Ser Leu Gln Ser1 559PRTHomo
sapiens 5Gln Gln Ala Asn Ser Phe Pro Trp Thr1 56376DNAHomo sapiens
6caggtgcagc tggtgcagtc tggggctgag gtgaagaagc ctggggcctc agtgaaggtc
60tcctgcaagg cttctggata caccttcacc ggctactata tgcactgggt gcgacaggcc
120cctggacaag ggcttgagtg gatgggatgg atcaaccctc acagtggtgg
cacaaactat 180gcacagaagt ttcagggcag ggtcaccatg accagggaca
cgtccatcag cacagcctac 240atggagctga gcaggctgag atccgacgac
acggccgtgt attactgtgc gaggacgtat 300tactatgata gtagtggtta
ttaccatgat gcttttgata tctggggcca agggacaatg 360gtcaccgtct cttcag
3767125PRTHomo sapiens 7Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val
Lys Lys Pro Gly Ala1 5 10 15Ser Val Lys Val Ser Cys Lys Ala Ser Gly
Tyr Thr Phe Thr Gly Tyr 20 25 30Tyr Met His Trp Val Arg Gln Ala Pro
Gly Gln Gly Leu Glu Trp Met 35 40 45Gly Trp Ile Asn Pro His Ser Gly
Gly Thr Asn Tyr Ala Gln Lys Phe 50 55 60Gln Gly Arg Val Thr Met Thr
Arg Asp Thr Ser Ile Ser Thr Ala Tyr65 70 75 80Met Glu Leu Ser Arg
Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Thr Tyr
Tyr Tyr Asp Ser Ser Gly Tyr Tyr His Asp Ala Phe 100 105 110Asp Ile
Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser 115 120 12585PRTHomo
sapiens 8Gly Tyr Tyr Met His1 5917PRTHomo sapiens 9Trp Ile Asn Pro
His Ser Gly Gly Thr Asn Tyr Ala Gln Lys Phe Gln1 5 10
15Gly1016PRTHomo sapiens 10Thr Tyr Tyr Tyr Asp Ser Ser Gly Tyr Tyr
His Asp Ala Phe Asp Ile1 5 10 151157DNAArtificialnucleotide primer
11tatatatatc tagacatata tatgggtgac aatgacatcc actttgcctt tctctcc
571289DNAArtificialnucleotide primer 12tccactttgc ctttctctcc
acaggtgtcc actcccaggt gcagctggtg cagtctgggg 60ctgaggtgaa gaagcctggg
gcctcagtg 891367DNAArtificialnucleotide primer 13catatagtag
ccggtgaagg tgtatccaga agccttgcag gagaccttca ctgaggcccc 60aggcttc
671467DNAArtificialnucleotide primer 14caccggctac tatatgcact
gggtgcgaca ggcccctgga caagggcttg agtggatggg 60atggatc
671563DNAArtificialnucleotide primer 15ctgccctgaa acttctgtgc
atagtttgtg ccaccactgt gagggttgat ccatcccatc 60cac
631668DNAArtificialnucleotide primer 16cagaagtttc agggcagggt
caccatgacc agggacacgt ccatcagcac agcctacatg 60gagctgag
681764DNAArtificialnucleotide primer 17gtcctcgcac agtaatacac
ggccgtgtcg tcggatctca gcctgctcag ctccatgtag 60gctg
641866DNAArtificialnucleotide primer 18gtattactgt gcgaggacgt
attactatga tagtagtggt tattaccatg atgcttttga 60tatctg
661974DNAArtificialnucleotide primer 19tatatatagg gcccttggtg
gaggcctgaa gagacggtga ccattgtccc ttggccccag 60atatcaaaag catc
742079DNAArtificialnucleotide primer 20tatatatacc ccggggccaa
atgtgacatc cagatgaccc agtctccatc ttccgtgtct 60gcatctgtag gagacagag
792170DNAArtificialnucleotide primer 21gataccaggc taacaacctg
ctaataccct gactcgcccg acaagtgatg gtgactctgt 60ctcctacaga
702274DNAArtificialnucleotide primer 22gttagcctgg tatcagcaga
aaccagggaa agcccctaaa ctcctgatct atgttgcatc 60cagtttgcaa agtg
742364DNAArtificialnucleotide primer 23gtgaaatctg tcccagatcc
actgccgctg aaccttgatg ggaccccact ttgcaaactg 60gatg
642471DNAArtificialnucleotide primer 24ctgggacaga tttcactctc
accatcagca gcctgcagcc tgaagatttt gcaacttact 60attgtcaaca g
712582DNAArtificialnucleotide primer 25tatatatacg tacgtttgat
ttccaccttg gtcccttggc cgaacgtcca cgggaaactg 60ttagcctgtt gacaatagta
ag 822617PRTHomo sapiens 26Met Gly Asp Asn Asp Ile His Phe Ala Phe
Leu Ser Thr Gly Val His1 5 10 15Ser2722PRTHomo sapiens 27Met Asp
Met Arg Val Pro Ala Gln Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu
Pro Gly Ala Lys Cys 2028375DNAArtificialoptimized coding sequence
28caggtgcagc tggtgcagag cggcgctgag gtgaagaagc ctggcgccag cgtcaaggtg
60tcctgcaagg ccagcggcta caccttcacc ggctactaca tgcactgggt gcggcaggct
120ccaggacagg gcctggaatg gatgggctgg atcaaccccc acagcggcgg
caccaactac 180gcccagaagt tccagggcag ggtcaccatg accagggaca
ccagcatcag caccgcctac 240atggaactgt ccaggctgag aagcgacgac
accgccgtgt actactgcgc caggacctac 300tactacgaca gcagcggcta
ctaccacgac gccttcgaca tctggggcca gggcaccatg 360gtgaccgtga gcagc
37529321DNAArtificialoptimized coding sequence 29gacatccaga
tgacccagag ccccagcagc gtgagcgcca gcgtgggcga cagggtgacc 60atcacctgca
gggccagcca gggcatcagc aggctgctgg cctggtatca gcagaagccc
120ggcaaggccc ccaagctgct gatctacgtg gcctccagcc tccagagcgg
cgtgcccagc 180aggttcagcg gcagcggctc cggcaccgac ttcaccctga
ccatcagctc cctgcagccc 240gaggacttcg ccacctacta ctgccagcag
gccaacagct tcccctggac cttcggccag 300ggcaccaagg tggagatcaa g
321301368DNAArtificialoptimized coding sequence 30caggtgcagc
tggtgcagag cggcgctgag gtgaagaagc ctggcgccag cgtcaaggtg 60tcctgcaagg
ccagcggcta caccttcacc ggctactaca tgcactgggt gcggcaggct
120ccaggacagg gcctggaatg gatgggctgg atcaaccccc acagcggcgg
caccaactac 180gcccagaagt tccagggcag ggtcaccatg accagggaca
ccagcatcag caccgcctac 240atggaactgt ccaggctgag aagcgacgac
accgccgtgt actactgcgc caggacctac 300tactacgaca gcagcggcta
ctaccacgac gccttcgaca tctggggcca gggcaccatg 360gtgaccgtga
gcagcgccag caccaagggg cccagcgtgt tccccctggc ccccagcagc
420aagagcacct ccggcggcac agccgccctg ggctgcctgg tgaaggacta
cttccccgaa 480ccggtgaccg tgtcctggaa cagcggcgct ctgaccagcg
gcgtgcacac cttccccgcc 540gtgctgcaga gcagcggcct gtacagcctg
agcagcgtgg tgacagtgcc cagcagcagc 600ctgggcaccc agacctacat
ctgcaacgtg aaccacaagc ccagcaacac caaggtggac 660aagagagtgg
agcccaagag ctgcgacaag acccacacct gccccccctg ccctgcccct
720gagctgctgg gcggacctag cgtgttcctg ttccccccca agcccaagga
caccctgatg 780atcagcagga cccccgaggt gacctgcgtg gtggtggacg
tgagccacga ggaccctgag 840gtgaagttca attggtacgt ggacggcgtg
gaggtgcaca acgccaagac caagcccaga 900gaggagcagt acaacagcac
ctacagggtg gtgtccgtgc tgaccgtgct gcaccaggac 960tggctgaacg
gcaaggaata caagtgcaag gtctccaaca aggccctgcc tgcccccatc
1020gaaaagacca tcagcaaggc caagggccag cctcgggagc cccaggtgta
caccctgccc 1080cctagccggg aggagatgac caagaaccag gtgtccctga
cctgtctggt gaagggcttc 1140taccccagcg acatcgccgt ggagtgggag
agcaacggcc agcccgagaa caactacaag 1200accacccccc ctgtgctgga
cagcgacggc agcttcttcc tgtacagcaa gctgaccgtg 1260gacaagtcca
ggtggcagca gggcaacgtg ttcagctgca gcgtgatgca cgaggccctg
1320cacaaccact acacccagaa gagcctgagc ctgtcccccg gcaagtaa
136831645DNAArtificialoptimized coding sequence 31gacatccaga
tgacccagag ccccagcagc gtgagcgcca gcgtgggcga cagggtgacc 60atcacctgca
gggccagcca gggcatcagc aggctgctgg cctggtatca gcagaagccc
120ggcaaggccc ccaagctgct gatctacgtg gcctccagcc tccagagcgg
cgtgcccagc 180aggttcagcg gcagcggctc cggcaccgac ttcaccctga
ccatcagctc cctgcagccc 240gaggacttcg ccacctacta ctgccagcag
gccaacagct tcccctggac cttcggccag 300ggcaccaagg tggagatcaa
gcgtacggtg gccgctccca gcgtgttcat cttccccccc 360agcgacgagc
agctgaagag cggcaccgcc tccgtggtgt gcctgctgaa caacttctac
420ccccgcgagg ccaaggtgca gtggaaggtg gacaacgccc tgcagtccgg
caacagccag 480gagagcgtca ccgagcagga cagcaaggac tccacctaca
gcctgagcag caccctgacc 540ctgagcaagg ccgactacga gaagcacaag
gtgtacgcct gcgaggtgac ccaccagggc 600ctgtccagcc ccgtgaccaa
gagcttcaac aggggcgagt gctga 64532199PRTHomo saoiens 32Met Lys Ser
Gly Leu Trp Tyr Phe Phe Leu Phe Cys Leu Arg Ile Lys1 5 10 15Val Leu
Thr Gly Glu Ile Asn Gly Ser Ala Asn Tyr Glu Met Phe Ile 20 25 30Phe
His Asn Gly Gly Val Gln Ile Leu Cys Lys Tyr Pro Asp Ile Val 35 40
45Gln Gln Phe Lys Met Gln Leu Leu Lys Gly Gly Gln Ile Leu Cys Asp
50 55 60Leu Thr Lys Thr Lys Gly Ser Gly Asn Thr Val Ser Ile Lys Ser
Leu65 70 75 80Lys Phe Cys His Ser Gln Leu Ser Asn Asn Ser Val Ser
Phe Phe Leu 85 90 95Tyr Asn Leu Asp His Ser His Ala Asn Tyr Tyr Phe
Cys Asn Leu Ser 100 105 110Ile Phe Asp Pro Pro Pro Phe Lys Val Thr
Leu Thr Gly Gly Tyr Leu 115 120 125His Ile Tyr Glu Ser Gln Leu Cys
Cys Gln Leu Lys Phe Trp Leu Pro 130 135 140Ile Gly Cys Ala Ala Phe
Val Val Val Cys Ile Leu Gly Cys Ile Leu145 150 155 160Ile Cys Trp
Leu Thr Lys Lys Lys Tyr Ser Ser Ser Val His Asp Pro 165 170 175Asn
Gly Glu Tyr Met Phe Met Arg Ala Val Asn Thr Ala Lys Lys Ser 180 185
190Arg Leu Thr Asp Val Thr Leu 19533168PRTHomo saoiens 33Met Lys
Ser Gly Leu Trp Tyr Phe Phe Leu Phe Cys Leu Arg Ile Lys1 5 10 15Val
Leu Thr Gly Glu Ile Asn Gly Ser Ala Asn Tyr Glu Met Phe Ile 20 25
30Phe His Asn Gly Gly Val Gln Ile Leu Cys Lys Tyr Pro Asp Ile Val
35 40 45Gln Gln Phe Lys Met Gln Leu Leu Lys Gly Gly Gln Ile Leu Cys
Asp 50 55 60Leu Thr Lys Thr Lys Gly Ser Gly Asn Thr Val Ser Ile Lys
Ser Leu65 70 75 80Lys Phe Cys His Ser Gln Leu Ser Asn Asn Ser Val
Ser Phe Phe Leu 85 90 95Tyr Asn Leu Asp His Ser His Ala Asn Tyr Tyr
Phe Cys Asn Leu Ser 100 105 110Ile Phe Asp Pro Pro Pro Phe Lys Val
Thr Leu Thr Gly Gly Tyr Leu 115 120 125His Ile Tyr Glu Ser Gln Leu
Cys Cys Gln Leu Lys Phe Trp Leu Pro 130 135 140Ile Gly Cys Ala Ala
Phe Val Val Val Cys Ile Leu Gly Cys Ile Leu145 150 155 160Ile Cys
Trp Leu Thr Lys Lys Met 165342609DNAHomo saoiens 34ctgaacgcga
ggactgttaa ctgtttctgg caaacatgaa gtcaggcctc tggtatttct 60ttctcttctg
cttgcgcatt aaagttttaa caggagaaat caatggttct gccaattatg
120agatgtttat atttcacaac ggaggtgtac aaattttatg caaatatcct
gacattgtcc 180agcaatttaa aatgcagttg ctgaaagggg ggcaaatact
ctgcgatctc actaagacaa 240aaggaagtgg aaacacagtg tccattaaga
gtctgaaatt ctgccattct cagttatcca 300acaacagtgt ctcttttttt
ctatacaact tggaccattc tcatgccaac tattacttct 360gcaacctatc
aatttttgat cctcctcctt ttaaagtaac tcttacagga ggatatttgc
420atatttatga atcacaactt tgttgccagc tgaagttctg gttacccata
ggatgtgcag 480cctttgttgt agtctgcatt ttgggatgca tacttatttg
ttggcttaca aaaaagaagt 540attcatccag tgtgcacgac cctaacggtg
aatacatgtt catgagagca gtgaacacag 600ccaaaaaatc tagactcaca
gatgtgaccc tataatatgg aactctggca cccaggcatg 660aagcacgttg
gccagttttc ctcaacttga agtgcaagat tctcttattt ccgggaccac
720ggagagtctg acttaactac atacatcttc tgctggtgtt ttgttcaatc
tggaagaatg 780actgtatcag tcaatgggga ttttaacaga ctgccttggt
actgccgagt cctctcaaaa 840caaacaccct cttgcaacca gctttggaga
aagcccagct cctgtgtgct cactgggagt 900ggaatccctg tctccacatc
tgctcctagc agtgcatcag ccagtaaaac aaacacattt 960acaagaaaaa
tgttttaaag atgccagggg tactgaatct gcaaagcaaa tgagcagcca
1020aggaccagca tctgtccgca tttcactatc atactacctc ttctttctgt
agggatgaga 1080attcctcttt taatcagtca agggagatgc ttcaaagctg
gagctatttt atttctgaga 1140tgttgatgtg aactgtacat tagtacatac
tcagtactct ccttcaattg ctgaacccca 1200gttgaccatt ttaccaagac
tttagatgct ttcttgtgcc ctcaattttc tttttaaaaa 1260tacttctaca
tgactgcttg acagcccaac agccactctc aatagagagc tatgtcttac
1320attctttcct ctgctgctca atagttttat atatctatgc atacatatat
acacacatat 1380gtatataaaa ttcataatga atatatttgc ctatattctc
cctacaagaa tatttttgct 1440ccagaaagac atgttctttt ctcaaattca
gttaaaatgg tttactttgt tcaagttagt 1500ggtaggaaac attgcccgga
attgaaagca aatttatttt attatcctat tttctaccat 1560tatctatgtt
ttcatggtgc tattaattac aagtttagtt ctttttgtag atcatattaa
1620aattgcaaac aaaatcatct ttaatgggcc agcattctca tggggtagag
cagaatattc 1680atttagcctg aaagctgcag ttactatagg ttgctgtcag
actataccca tggtgcctct 1740gggcttgaca ggtcaaaatg gtccccatca
gcctggagca gccctccaga cctgggtgga 1800attccagggt tgagagactc
ccctgagcca gaggccacta ggtattcttg ctcccagagg 1860ctgaagtcac
cctgggaatc acagtggtct acctgcattc ataattccag gatctgtgaa
1920gagcacatat gtgtcagggc acaattccct ctcataaaaa ccacacagcc
tggaaattgg 1980ccctggccct tcaagatagc cttctttaga atatgatttg
gctagaaaga ttcttaaata 2040tgtggaatat gattattctt agctggaata
ttttctctac ttcctgtctg catgcccaag 2100gcttctgaag cagccaatgt
cgatgcaaca acatttgtaa ctttaggtaa actgggatta 2160tgttgtagtt
taacattttg taactgtgtg cttatagttt acaagtgaga cccgatatgt
2220cattatgcat acttatatta tcttaagcat gtgtaatgct ggatgtgtac
agtacagtac 2280tgaacttgta atttgaatct agtatggtgt tctgttttca
gctgacttgg acaacctgac 2340tggctttgca caggtgttcc ctgagttgtt
tgcaggtttc tgtgtgtggg gtggggtatg 2400gggaggagaa ccttcatggt
ggcccacctg gcctggttgt ccaagctgtg cctcgacaca 2460tcctcatccc
cagcatggga cacctcaaga tgaataataa ttcacaaaat ttctgtgaaa
2520tcaaatccag ttttaagagg agccacttat caaagagatt ttaacagtag
taagaaggca 2580aagaataaac atttgatatt cagcaactg 26093523RNAHomo
sapiens 35aguuguuuua gugacuacga ccu 233623RNAHomo sapiens
36aguaucggga cauguuacga cga 233723RNAHomo sapiens 37acuaucggga
cauguuacga cga 233822RNAHomo sapiens 38gaagucaaua gugucaugac au
223922RNAHomo sapiens 39ccucacuucu gugccucggu cu 22
* * * * *
References