U.S. patent application number 13/005346 was filed with the patent office on 2011-09-29 for compositions and methods for modulating lymphocyte activity.
This patent application is currently assigned to THE WASHINGTON UNIVERSITY. Invention is credited to Kenneth M. Murphy, Theresa L. Murphy.
Application Number | 20110236401 13/005346 |
Document ID | / |
Family ID | 37595615 |
Filed Date | 2011-09-29 |
United States Patent
Application |
20110236401 |
Kind Code |
A1 |
Murphy; Kenneth M. ; et
al. |
September 29, 2011 |
COMPOSITIONS AND METHODS FOR MODULATING LYMPHOCYTE ACTIVITY
Abstract
The invention derives from the identification of HVEM as the
native ligand for BTLA. The invention provides compositions and
methods for modulating BTLA-HVEM interactions and BTLA and HVEM
activity, which are useful for modulating immune responses.
Agonists and antagonists of the BTLA-HVEM interaction are provided,
and methods of treating a variety of conditions through the
modulation of immune responses are provided.
Inventors: |
Murphy; Kenneth M.; (St.
Louis, MO) ; Murphy; Theresa L.; (St. Louis,
MO) |
Assignee: |
THE WASHINGTON UNIVERSITY
St. Louis
MO
|
Family ID: |
37595615 |
Appl. No.: |
13/005346 |
Filed: |
January 12, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11719356 |
Dec 12, 2007 |
|
|
|
PCT/US2005/041446 |
Nov 15, 2005 |
|
|
|
13005346 |
|
|
|
|
60628474 |
Nov 15, 2004 |
|
|
|
Current U.S.
Class: |
424/172.1 ;
424/184.1 |
Current CPC
Class: |
A61P 35/00 20180101;
A61P 3/10 20180101; C07K 16/2818 20130101; A61P 29/00 20180101;
C07K 2317/34 20130101; A61P 11/06 20180101; A61P 37/04 20180101;
A61P 19/02 20180101 |
Class at
Publication: |
424/172.1 ;
424/184.1 |
International
Class: |
A61K 39/395 20060101
A61K039/395; A61K 39/00 20060101 A61K039/00; A61P 37/04 20060101
A61P037/04; A61P 35/00 20060101 A61P035/00; A61P 11/06 20060101
A61P011/06; A61P 29/00 20060101 A61P029/00; A61P 19/02 20060101
A61P019/02; A61P 3/10 20060101 A61P003/10 |
Claims
1. A method of modulating an immune response to an antigen,
comprising administering a BTLA-HVEM agonist.
2. The method of claim 1, wherein the immune response is reduced or
shortened by administering a BTLA-HVEM agonist.
3. A method of treating asthma, cancer, inflammatory disease, or
autoimmune disease, the method comprising administering to a
patient in need of such treatment a therapeutically effective
amount of a BTLA-HVEM agonist.
4. A method of claim 3, wherein the patient is in need of treatment
for an autoimmune disease.
5. A method of claim 4, wherein the patient is in need of treatment
for rheumatoid arthritis.
6. A method of claim 4, wherein the patient is in need of treatment
for autoimmune throiditis.
7. A method of claim 4, wherein the patient is in need of treatment
for lupus.
8. A method of claim 4, wherein the patient is in need of treatment
for type 1 diabetes.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. application Ser.
No. 11/719,356, filed May 15, 2007, which is a National Stage Entry
of PCT/US2005/041446, filed Nov. 15, 2005, which claims the benefit
of U.S. Provisional Application Ser. No. 60/628,474, filed Nov. 15,
2004, the disclosures of which are hereby incorporated by reference
in their entireties.
FIELD OF THE INVENTION
[0002] The present invention relates to mechanisms of
immunomodulation, as well as to compositions and methods useful for
modulating an immune response for therapeutic purposes. The
invention relates to the treatment of cancer, infection, autoimmune
disease, inflammation, and allergy by immunomodulatory means. The
invention further relates to the treatment of transplant
recipients, and to the reduction of graft versus host reactions in
patients by immunomodulatory means.
BACKGROUND
[0003] Positive and negative costimulatory signals play critical
roles in the modulation of T cell activity. Positive costimulation,
in addition to T cell receptor (TCR) engagement, is required for
optimal activation of naive T cells, whereas negative costimulation
is believed to be required for the acquisition of immunologic
tolerance to self, as well as the termination of effector T cell
functions. Upon interaction with B7.1 or B7.2 on the surface of
antigen-presenting cells (APC), CD28, the prototypic T cell
costimulatory molecule, emits signals that promote T cell
proliferation and differentiation in response to TCR engagement,
while the CD28 homologue cytotoxic T lymphocyte antigen-4 (CTLA-4)
emits signals that inhibit T cell proliferation and effector
functions (Chambers et al., Ann. Rev. Immunol., 19:565-594, 2001;
Egen et al., Nature Immunol., 3:611-618, 2002).
[0004] Agents capable of modulating positive and negative
costimulatory signals are highly desirable for use in the
modulation of adaptive immune responses. Many autoimmune disorders
are known to involve autoreactive T cells and autoantibodies.
Agents that are capable of inhibiting the activation of lymphocytes
that are specific for self antigens are desirable. Similarly, under
certain conditions it is desirable to inhibit normal immune
responses to antigen. For example, the suppression of normal immune
responses in a patient receiving a transplant is desirable, and
agents that exhibit such immunosuppressive activity are highly
desirable.
[0005] Conversely, many cancer immunotherapies, such as adoptive
immunotherapy, expand tumor-specific T cell populations and direct
them to attack and kill tumor cells (Dudley et al., Science
298:850-854, 2002; Pardoll, Nature Biotech., 20:1207-1208, 2002;
Egen et al., Nature Immunol., 3:611-618, 2002). Agents capable of
augmenting tumor attack are highly desirable.
[0006] In addition, immune responses to many different antigens
(e.g., microbial antigens or tumor antigens), while detectable, are
frequently of insufficient magnitude to afford protection against a
disease process. Agents capable of promoting and/or prolonging the
activation (delaying termination) of lymphocytes that are specific
for such antigens are highly desirable.
[0007] Costimulatory signals, particularly positive costimulatory
signals, also play a role in the modulation of B cell activity. For
example, B cell activation and the survival of germinal center B
cells require T cell-derived signals in addition to stimulation by
antigen. CD40 ligand present on the surface of helper T cells
interacts with CD40 on the surface of B cells and provides such a
positive costimulatory signal to B cells.
[0008] Recently, a negative costimulatory receptor analogous to
CTLA-4 was identified on B cells and T cells (Watanabe et al., Nat.
Immunol., 4:670-679, 2003; U.S. patent application Ser. No.
10/600,997, filed 20 Jun. 2003; both of which are expressly
incorporated herein in their entirety by reference). B and T
lymphocyte attenuator (BTLA) is an immunoglobulin domain-containing
glycoprotein with a Grb2 binding site, an immunoreceptor
tyrosine-based inhibitory motif (ITIM), and an immunoreceptor
tyrosine-based switch motif (ITSM). Partial BTLA sequences were
disclosed previously (WO 99/40100 and WO 02/07294) though the
complete sequence, distribution, and function of BTLA was not
reported. Additionally, the partial BTLA sequences disclosed were
asserted to correspond to secreted proteins rather than a
functional receptor on the surface of lymphocytes.
[0009] BTLA acts a negative regulator of both B and T lymphocyte
activity (Watanabe et al., Nat. Immunol., 4:670-679, 2003).
Crosslinking BTLA with antigen receptors induces its tyrosine
phosphorylation and association with the Src homology domain 2
(SH2)-containing protein tyrosine phosphatases SHP-1 and SHP-2, and
attenuates production of interleukin 2 (IL-2). BTLA-deficient T
cells show increased proliferation, and BTLA-deficient mice have
increased specific antibody responses and enhanced sensitivity to
experimental autoimmune encephalomyelitis.
[0010] Based on indirect evidence, the ligand for BTLA was
previously asserted to be B7x (Watanabe et al., supra). However, as
disclosed herein, B7x does not bind to BTLA. The identification of
BTLA's cognate ligand thus remains highly desirable for an
understanding of BTLA function, and for diagnostic and therapeutic
purposes.
[0011] Herpes virus entry mediator ("HVEM"), a member of the
TNF/NGF receptor family, is another positive costimulatory receptor
that additionally mediates the entry of herpes simplex virus (HSV)
into cells (Montgomery et al., Cell. Nov. 1, 1996; 87(3):427-36).
Anti-HVEM antibodies and a soluble hybrid protein containing the
HVEM ectodomain have been shown to inhibit such HVEM-dependent
viral entry. HSV-1 glycoprotein D (gD), a structural component of
the HSV envelope, binds to HVEM to facilitate viral entry (Whitbeck
et al., J Virol. August 1997; 71(8):6083-93). HVEM binds two
cellular ligands, secreted lymphotoxin alpha and LIGHT (Mauri et
al., Immunity. January 1998; 8(1):21-30). HSV-1 gD inhibits the
interaction of HVEM with LIGHT. Additionally, targeted disruption
of LIGHT causes immunomodulatory defects (Scheu et al., J. Exp.
Med., 195:1613-1624, 2002). Additionally, a phagederived peptide
BP-2 reportedly binds to HVEM and can compete with HSV-1 gD (Carfi
et al., Mol. Cell 8:169-179, 2001; Sarrias et al., Mol. Immunol.,
37:665-673, 2000).
SUMMARY OF THE INVENTION
[0012] The present disclosure establishes that Herpes virus entry
mediator (HVEM) is the cognate ligand of BTLA. HVEM belongs to the
TNF receptor family of proteins and is itself a costimulatory
receptor expressed on naive T cells. HVEM is also expressed to a
lesser extent on dendritic cells, resting B cells, and macrophages.
HVEM has four extracellular cysteine-rich domains (CRDs) and
interacts with two known TNF family members, LIGHT and lymphotoxin
alpha (LTa), through CRD2 and CRD3. For further discussion of HVEM,
see for example Granger et al., Cytokine Growth Factor Rev.,
14:289-96, 2003; and Croft, Nat. Rev. Immunol., 3:609-620, 2003. As
disclosed herein, HVEM directly binds to BTLA and stimulates BTLA
activity. As further disclosed herein, HVEM binding to BTLA can
reduce the activation of BTLA expressing lymphocytes, as well as
decrease the effector activity of BTLA expressing lymphocytes.
[0013] The present disclosure also establishes that B7x does not
directly bind to BTLA and does not directly modulate BTLA activity.
B7x is expressed in a wide variety of normal and cancer cells, and
was previously reported to be a ligand for BTLA based on indirect
evidence. It was postulated that the interaction of B7x with BTLA
inhibited both B and T cell responses, and was a means by which
B7x-expressing tumor tissue inhibited the activity of
tumor-specific T cells. It was further posited that B7x expressed
on non-tumor non-lymphoid tissue served to maintain immunological
tolerance to self antigens.
[0014] Stemming from the discovery of the HVEM-BTLA interaction, in
one aspect, the present invention provides BTLA antibodies,
sometimes referred to herein as BTLA blocking antibodies. A BTLA
antibody of the invention is capable of specifically binding to a
BTLA protein and is capable of reducing the binding of the BTLA
protein to an HVEM protein. Especially preferred are BTLA
antibodies that specifically bind to a region of the BTLA Ig
domain, which region binds to the HVEM CRD1 domain. Such a BTLA
antibody is capable of binding to a fragment of the BTLA Ig domain,
which fragment is capable of binding to an HVEM CRD1 domain.
[0015] In one embodiment, a BTLA antibody is capable of binding to
a mouse BTLA Ig domain.
[0016] In one embodiment, a BTLA antibody is capable of binding to
a mouse BTLA Ig domain in a human BTLA tetramer.
[0017] In one embodiment, a BTLA antibody is capable of binding to
a human BTLA Ig domain.
[0018] In one embodiment, a BTLA antibody is capable of binding to
a human BTLA Ig domain in a human BTLA tetramer.
[0019] In one embodiment, a BTLA antibody is capable of binding
toward the DEBA face of the Ig fold of BTLA. The phrase "DEBA face"
refers to the regions of the BTLA molecule composed of the beta
strands labelled "D", "E", "B", and "A" strands. See, for example,
structure of BTLA ectodomain deposited at NCBI by C. A. Nelson, D.
H. Fremont, Midwest Center For Structural & Genomics (Mcsg), 26
Aug. 2004. See also Compaan et al., J Biol Chem. Sep. 16, 2005,
Epub manuscript M507629200.
[0020] In one embodiment, a BTLA antibody is capable of binding an
epitope of BTLA that is capable of binding to an antibody selected
from the group consisting of `6A6`, `6F7`, `6G3`, `6H6`, `8F4`, and
`3F9.D12`.
[0021] In one embodiment, a BTLA antibody is capable of competing
with an antibody selected from the group consisting of `6A6`,
`6F7`, `6G3`, `6H6`, `8F4`, and `3F9.D12` for binding to BTLA.
[0022] In one embodiment, a BTLA antibody is capable of binding to
an epitope of BTLA that is homologous to an epitope capable of
binding an antibody selected from the group consisting of `6A6`,
`6F7`, `6G3`, `6H6`, `8F4`, and `3F9.D12`.
[0023] In one embodiment, a BTLA antibody is capable of binding to
an epitope comprising one or more residues selected from the group
consisting of R55, Q63, Q 102, and C85 of murine C57BL/6 BTLA (SEQ
ID NO:1).
[0024] In one embodiment, a BTLA antibody is capable of binding to
an epitope comprising one or more residues selected from the group
consisting of the residues in a BTLA protein corresponding to the
residues V42, Q43, L44, R55, Q63, Q102, and C85 of murine C57BL/6
BTLA (SEQ ID NO:1).
[0025] In one embodiment, a BTLA antibody is capable of binding to
an epitope comprising one or more residues selected from the group
consisting of the residues in human BTLA corresponding to the
residues V42, Q43, L44, R55, Q63, Q102, and C85 of murine C57BL/6
BTLA (SEQ ID NO:1).
[0026] In one embodiment, a BTLA antibody is capable of binding to
an epitope comprising one or more residues selected from the group
consisting of V36, Q37, L38, L49, E57, C79, K93, and S96 in the
human BTLA sequence set forth at Genbank accession no. AAP44003.1
(SEQ ID NO:2).
[0027] In one embodiment, a BTLA antibody is capable of binding to
an epitope comprising one or more residues in a human BTLA
corresponding to residues from the group consisting of V36, Q37,
L38, L49, E57, C79, K93, and S96 in the human BTLA sequence set
forth at Genbank accession no. AAP44003.1 (SEQ ID NO:2).
[0028] In one embodiment, a BTLA antibody is capable of binding to
a polypeptide having at least about 80%, more preferably 85%, more
preferably 90%, more preferably 95% identity to the amino acid
sequence set forth by residues 37-47, 39-49, 41-49, 50-60, 58-68,
80-90, 97-107, 50-90, 55-85, 58-90, 63-85, 80-107, 85-102, 127-137,
55-102, 50-107, and 41-137 of murine BL/6 BTLA (SEQ ID NO:1).
[0029] In one embodiment, a BTLA antibody is capable of binding to
a polypeptide selected from the group consisting of the amino acid
sequences set forth by residues 37-47, 39-49, 41-49, 50-60, 58-68,
80-90, 97-107, 50-90, 55-85, 58-90, 63-85, 80-107, 85-102, 127-137,
55-102, 50107, and 41-137 of murine C57BL/6 BTLA (SEQ ID NO:1).
[0030] In one embodiment, a BTLA antibody is capable of binding to
a polypeptide having at least about 80%, more preferably 85%, more
preferably 90%, more preferably 95% identity to the amino acid
sequence set forth by residues 31-41, 32-42, 35-43, 44-54, 52-62,
74-84, 88-98, 44-84, 49-79, 52-84, 57-79, 74-98, 79-93, 118-128,
49-93, 44-98, 35-98, and 35-128 of the human BTLA isoform found at
Genbank accession no. AAP44003.1 (SEQ ID NO:2).
[0031] In one embodiment, a BTLA antibody is capable of binding to
a polypeptide selected from the group consisting of the amino acid
sequences set forth by residues 31-41, 32-42, 35-43, 44-54, 52-62,
74-84, 88-98, 44-84, 49-79, 52-84, 57-79, 74-98, 79-93, 118-128,
49-93, 44-98, 35-98, and 35-128 of the human BTLA isoform found at
Genbank accession no. AAP44003.1 (SEQ ID NO:2).
[0032] In one embodiment, a BTLA antibody is selected from the
group consisting of `6A6`, `6F7`, `6G3`, `6H6`, `8F4`, and
`3F9.D12`.
[0033] In one embodiment, a BTLA antibody is capable of competing
with CMV UL144 for binding to BTLA.
[0034] In one embodiment, the invention provides BTLA antibodies
which are monoclonal antibodies.
[0035] In one embodiment, the invention provides BTLA antibodies
which are human antibodies.
[0036] In one aspect, the invention provides a hybridoma that
produces a BTLA antibody disclosed herein.
[0037] In one aspect, the invention provides BTLA antibodies that
are capable of modulating BTLA activity.
[0038] In one embodiment, the invention provides BTLA antibodies
that are antagonistic BTLA antibodies, which are capable of
reducing BTLA activity. Such antibodies are capable of reducing the
activation of BTLA by HVEM. Preferably, such antagonistic BTLA
antibodies are also capable of reducing the activation of BTLA by
another ligand which binds to the HVEM binding region of BTLA, such
as UL144. The UL144 open reading frame in human cytomegalovirus
(CMV) encodes a homologue of the herpesvirus entry mediator, HVEM,
a member of the tumor necrosis factor receptor superfamily (Lurain
et al., J Virol. December 1999; 73(12):10040-50).
[0039] In another embodiment, the invention provides BTLA
antibodies that are agonistic BTLA antibodies, which are capable of
increasing BTLA activity. Such antibodies are capable of increasing
BTLA activity in a cell having BTLA on its surface.
[0040] In one aspect, the invention provides HVEM antibodies,
sometimes referred to herein as HVEM blocking antibodies. An HVEM
antibody specifically binds to an HVEM protein and is capable of
reducing the binding of the HVEM protein to a BTLA protein.
Especially preferred are HVEM antibodies that specifically bind to
a region of the HVEM CRD1 domain that binds to the BTLA Ig domain.
Such an HVEM antibody is capable of binding to a fragment of the
HVEM CRD1 domain, which fragment is capable of binding to a BTLA Ig
domain. Preferred HVEM antibodies do not bind to the HVEM CRD2 or
HVEM CRD3 domains, though antibodies binding to the CRD2 and/or
CRD3 domains in addition to the CRD1 domain may be used in the
methods herein.
[0041] In one embodiment, the invention provides HVEM antibodies
which are monoclonal antibodies.
[0042] In one aspect, the invention provides a hybridoma that
produces a HVEM antibody disclosed herein.
[0043] In one embodiment, the invention provides HVEM antibodies
which are human antibodies.
[0044] In one aspect, the invention provides HVEM antibodies that
are capable of modulating BTLA activity.
[0045] In a preferred embodiment, the invention provides HVEM
antibodies that are antagonistic HVEM antibodies, which are capable
of reducing the ability of HVEM to activate BTLA on the surface of
a cell.
[0046] In another embodiment, the invention provides HVEM
antibodies that are agonistic HVEM antibodies, which are capable of
binding to HVEM and stimulating HVEM activity in a cell, thereby
mimicking BTLA. HVEM activity in this sense includes increased
NF-kB activity and increased AP-1 activity.
[0047] In one embodiment, the invention provides HVEM antibodies
that do not inhibit the binding of HVEM to LIGHT or LTa.
[0048] In one embodiment, the invention provides HVEM antibodies
that additionally reduce the binding of HSV-1 glycoprotein D to
HVEM.
[0049] In one aspect, the invention provides BTLA-HVEM antagonists.
A BTLA-HVEM antagonist may be any of a wide variety of bioactive
agents capable of reducing the activation of BTLA by HVEM. In a
preferred embodiment, a BTLA-HVEM antagonist is capable of reducing
the binding of an HVEM CRD1 domain to a BTLA Ig domain. While many
BTLA-HVEM antagonists are capable of binding to BTLA, such a
BTLA-HVEM antagonist does not increase BTLA activity in a cell
expressing BTLA on its surface.
[0050] Preferred BTLA-HVEM antagonists are capable of reducing BTLA
activity in a cell having BTLA on its surface. In a preferred
embodiment, the cell is a lymphocyte, a T cell, a CD4.sup.+ T cell,
a TH1 cell, a CD8.sup.+ T cell, a B cell, a plasma cell, a
macrophage, or an NK cell.
[0051] Suitable bioactive agents include BTLA antibodies and HVEM
antibodies (e.g., monoclonal, polyclonal, single chain, and/or
bispecific antibodies as well as Fab and F(ab).sub.2 fragments,
variants and derivatives thereof). Suitable bioactive agents also
include fragments and truncated forms of BTLA and HVEM proteins,
fusion proteins, and the like, for example, soluble proteins and
polypeptides comprising or consisting essentially of a BTLA Ig
domain fragment capable of binding an HVEM CRD1 domain; soluble
proteins and polypeptides comprising or consisting essentially of
an HVEM CRD1 domain or fragment thereof capable of binding a BTLA
Ig domain; a BTLA Ig domain peptide, a CRD1 domain peptide.
Suitable bioactive agents also include small molecule chemical
compositions.
[0052] In one embodiment, the invention provides a BTLA-HVEM
antagonist capable of reducing the binding of a BTLA protein to an
HVEM protein, wherein the antagonist does not comprise an HVEM CRD2
domain, an HVEM CRD3 domain, or both, and wherein the antagonist
does not bind to an HVEM CRD2 domain or an HVEM CRD3 domain, with
the proviso that the antagonist is not an HSV-1 glycoprotein D, a
phage-derived peptide BP-2, or a soluble protein comprising a
complete BTLA Ig domain capable of binding said HVEM protein.
[0053] In the methods herein, glycoprotein D and phage-derived
peptide BP-2, as well as HVEM-binding fragments thereof, and fusion
proteins comprising the same, may be used as BTLA-HVEM
antagonists.
[0054] Preferred BTLA-HVEM antagonists are capable of binding to a
BTLA Ig domain and are capable of reducing the binding of the BTLA
Ig domain to an HVEM CRD1 domain. Especially preferred are
BTLA-HVEM antagonists capable of binding to a region of the BTLA Ig
domain that binds to the HVEM CRD1 domain. Such a BTLA-HVEM
antagonist is capable of binding to a fragment of the BTLA Ig
domain, which fragment is capable of binding to an HVEM CRD1
domain.
[0055] In one embodiment, a BTLA-HVEM antagonist binds an epitope
of BTLA that is capable of binding to an antibody selected from the
group consisting of `6A6`, `6F7`, `6G3`, `6H6`, `8F4`, and
`3F9.D12`.
[0056] In one embodiment, a BTLA-HVEM antagonist is capable of
competing with an antibody selected from the group consisting of
`6A6`, `6F7`, `6G3`, `6H6`, `8F4`, and `3F9.D12` for binding to
BTLA.
[0057] In one embodiment, a BTLA-HVEM antagonist binds to an
epitope of BTLA that is homologous to an epitope capable of binding
an antibody selected from the group consisting of `6A6`, `6F7`,
`6G3`, `6H6`, `8F4`, and `3F9.D12`.
[0058] In one embodiment, a BTLA-HVEM antagonist is capable of
binding to an epitope comprising one or more residues selected from
the group consisting of V42, Q43, L44, R55, Q63, Q102, and C85 of
murine C57BL/6 BTLA (SEQ ID NO:1).
[0059] In one embodiment, a BTLA-HVEM antagonist is capable of
binding to an epitope comprising one or more residues selected from
the group consisting of the residues in a BTLA protein
corresponding to the residues V42, Q43, L44, R55, Q63, Q102, and
C85 of murine C57BL/6 BTLA (SEQ ID NO:1).
[0060] In one embodiment, a BTLA-HVEM antagonist is capable of
binding to an epitope comprising one or more residues selected from
the group consisting of the residues in human BTLA corresponding to
the residues V42, Q43, L44, R55, Q63, Q102, and C85 of murine
C57BL/6 BTLA (SEQ ID NO:1).
[0061] In one embodiment, a BTLA-HVEM antagonist is capable of
binding to an epitope comprising one or more residues selected from
the group consisting of V36, Q37, L38, L49, E57, C79, K93, and S96
in the human BTLA sequence set forth at Genbank accession no.
AAP44003.1 (SEQ ID NO:2).
[0062] In one embodiment, a BTLA-HVEM antagonist is capable of
binding to an epitope comprising one or more residues of human BTLA
corresponding to residues from the group consisting of V36, Q37,
L38, L49, E57, C79, K93, and S96 in the human BTLA sequence set
forth at Genbank accession no. AAP44003.1 (SEQ ID NO:2).
[0063] In one embodiment, a BTLA-HVEM antagonist is capable of
binding to a polypeptide having at least about 80%, more preferably
85%, more preferably 90%, more preferably 95% identity to the amino
acid sequence set forth by residues 37-47, 39-49, 41-49, 50-60,
58-68, 80-90, 97-107, 50-90, 55-85, 58-90, 63-85, 80-107, 85-102,
127-137, 55-102, 50-107, and 41-137 of murine C57BL/6 BTLA (SEQ ID
NO:1).
[0064] In one embodiment, a BTLA-HVEM antagonist is capable of
binding to a polypeptide selected from the group consisting of the
amino acid sequences set forth by residues 37-47, 39-49, 41-49,
50-60, 58-68, 80-90, 97-107, 50-90, 55-85, 58-90, 63-85, 80-107,
85-102, 127-137, 55-102, 50-107, and 41-137 of murine C57BL/6 BTLA
(SEQ ID NO:1).
[0065] In one embodiment, a BTLA-HVEM antagonist is capable of
binding to a polypeptide having at least about 80%, more preferably
85%, more preferably 90%, more preferably 95% identity to the amino
acid sequence set forth by residues 31-41, 32-42, 35-43, 44-54,
52-62, 74-84, 88-98, 44-84, 49-79, 52-84, 57-79, 74-98, 79-93,
118-128, 49-93, 44-98, 35-98, and 35-128 of the human BTLA isoform
found at Genbank accession no. AAP44003.1 (SEQ ID NO:2).
[0066] In one embodiment, a BTLA-HVEM antagonist is capable of
binding to a polypeptide selected from the group consisting of the
amino acid sequences set forth by residues 31-41, 32-42, 35-43,
44-54, 52-62, 74-84, 88-98, 44-84, 49-79, 52-84, 57-79, 74-98,
79-93, 118-128, 4993, 44-98, 35-98, and 35-128 of the human BTLA
isoform found at Genbank accession no. AAP44003.1 (SEQ ID
NO:2).
[0067] In one embodiment, a BTLA-HVEM antagonist is capable of
competing with CMV UL144 for binding to BTLA.
[0068] In one embodiment, a BTLA-HVEM antagonist is capable of
competing with HSV-1 glycoprotein D for binding to HVEM.
[0069] In one embodiment, a BTLA-HVEM antagonist is a BTLA
antibody.
[0070] In one embodiment, a BTLA-HVEM antagonist is an HVEM
antibody.
[0071] In one aspect, the invention provides BTLA-HVEM antagonists
that comprise a BTLA Ig domain fragment capable of binding an HVEM
CRD1 domain. In another aspect, the invention provides BTLA-HVEM
antagonists that consist essentially of a BTLA Ig domain fragment
capable of binding an HVEM CRD1 domain.
[0072] Accordingly, in a preferred embodiment, the invention
provides BTLA-HVEM antagonists that are BTLA fusion proteins which
are capable of binding to an HVEM CRD1 domain and reducing the
binding of the HVEM CRD1 domain to a BTLA Ig domain. Preferred BTLA
fusion proteins do not bind to the CRD2 or CRD3 domains of HVEM.
Preferred BTLA fusion proteins can compete with an HVEM antibody
disclosed herein for binding to an HVEM CRD1 domain. Preferred BTLA
fusion proteins do not comprise an entire BTLA Ig domain.
[0073] In another preferred embodiment, the invention provides
BTLA-HVEM antagonists that are BTLA protein fragments which are
capable of binding to the CRD1 domain of HVEM and reducing the
binding of the HVEM CRD1 domain to a BTLA Ig domain. Preferred BTLA
protein fragments do not bind to the CRD2 or CRD3 domains of HVEM.
In a preferred embodiment, a BTLA protein fragment consists
essentially of a BTLA Ig domain fragment that is capable of binding
to an HVEM CRD1 domain. Preferred BTLA protein fragments can
compete with an HVEM antibody disclosed herein for binding to an
HVEM CRD1 domain.
[0074] In one aspect, the invention provides BTLA-HVEM antagonists
that comprise an HVEM CRD1 domain or fragment thereof capable of
binding to a BTLA Ig domain. In another aspect, the invention
provides BTLA-HVEM antagonists that consist essentially of an HVEM
CRD1 domain or fragment thereof capable of binding to a BTLA Ig
domain.
[0075] Accordingly, in a preferred embodiment, the invention
provides BTLA-HVEM antagonists that are HVEM fusion proteins which
are capable of binding to a BTLA Ig domain and reducing the binding
of the BTLA Ig domain to an HVEM CRD1 domain. Such HVEM fusion
proteins lack an HVEM CRD2 and/or CRD3 domain. Preferred HVEM
fusion proteins can compete with a BTLA antibody disclosed herein
for binding to a BTLA Ig domain.
[0076] In another preferred embodiment, the invention provides
BTLA-HVEM antagonists that are HVEM protein fragments which are
capable of binding to a BTLA Ig domain and reducing the binding of
the BTLA Ig domain to an HVEM CRD1 domain. Such HVEM protein
fragments lack an HVEM CRD2 and/or CRD3 domain. In a preferred
embodiment, an HVEM protein fragment consists essentially of an
HVEM CRD1 domain or fragment thereof which is capable of binding to
a BTLA Ig domain. Preferred HVEM protein fragments can compete with
a BTLA antibody disclosed herein for binding to a BTLA Ig
domain.
[0077] In one embodiment, the invention provides fusion proteins
that comprise an Fc region of an immunoglobulin.
[0078] In one embodiment, for use in the methods herein, HSV-1
glycoprotein D may be used as a BTLA-HVEM antagonist.
[0079] In one embodiment, a BTLA-HVEM antagonist is capable of
reducing tyrosine phosphorylation on the intracellular domain of
BTLA protein in a cell having BTLA protein on its surface.
[0080] In one embodiment, a BTLA-HVEM antagonist is capable of
reducing association of BTLA protein with SHP-2, PI3K, or Grb2 in a
cell having BTLA protein on its surface.
[0081] In one embodiment, a BTLA-HVEM antagonist is capable of
increasing proliferation of a cell having BTLA protein on its
surface.
[0082] In one embodiment, a BTLA-HVEM antagonist is capable of
increasing IL-2 production by a cell having BTLA protein on its
surface.
[0083] In one embodiment, a BTLA-HVEM antagonist is capable of
increasing or prolonging antibody production by a cell having said
BTLA protein on its surface.
[0084] In one embodiment, a BTLA-HVEM antagonist is capable of
increasing or prolonging the cytotoxicity of a cell having said
BTLA protein on its surface.
[0085] In one aspect, the invention provides BTLA-HVEM agonists. A
BTLA-HVEM agonist may be any of a wide variety of bioactive agents
capable of activating BTLA and thereby mimicking the activity of
HVEM.
[0086] Preferred BTLA-HVEM agonists are capable of increasing BTLA
activity in a cell having BTLA on its surface. In a preferred
embodiment, the cell is a lymphocyte, a T cell, a CD4.sup.+ T cell,
a T.sub.H1 cell, a CD8.sup.+ T cell, a B cell, a plasma cell, a
macrophage, or an NK cell.
[0087] Suitable bioactive agents include BTLA antibodies (e.g.,
monoclonal, polyclonal, single chain, and/or bispecific antibodies
as well as Fab and F(ab).sub.2 fragments, variants and derivatives
thereof). Suitable bioactive agents also include fragments and
truncated forms of HVEM proteins, fusion proteins, and the like,
such as soluble proteins and polypeptides comprising or consisting
essentially of an HVEM CRD1 domain or fragment thereof capable of
binding to a BTLA Ig domain and increasing BTLA activity, and
lacking a CRD2 and/or CRD3 domain. Suitable bioactive agents also
include small molecule chemical compositions.
[0088] In one embodiment, the invention provides a BTLA-HVEM
agonist capable of binding to BTLA protein and increasing BTLA
activity, wherein the agonist does not comprise an HVEM CRD2
domain, an HVEM CRD3 domain, or both, with the proviso that the
agonist is not a human CMV UL144 protein.
[0089] In one embodiment, for use in the methods herein, CMV UL144,
BTLA-binding fragments thereof, and fusion proteins comprising the
same, may be used as a BTLA-HVEM agonist. Further regarding UL144,
see Cheung et al., PNAS 102:13218-13223, 2005.
[0090] Preferred BTLA-HVEM agonists bind to a BTLA Ig domain and
are capable of reducing the binding of the BTLA Ig domain to an
HVEM CRD1 domain, and mimicking the stimulation of BTLA by HVEM.
Especially preferred are BTLA-HVEM agonists capable of binding to a
region of the BTLA Ig domain that binds to the HVEM CRD1
domain.
[0091] In one embodiment, a BTLA-HVEM agonist binds an epitope of
BTLA that is capable of binding to an antibody selected from the
group consisting of `6A6`, `6F7`, `6G3`, `6H6`, `8F4`, and
`3F9.D12`.
[0092] In one embodiment, a BTLA-HVEM agonist is capable of
competing with an antibody selected from the group consisting of
`6A6`, `6F7`, `6G3`, `6H6`, `8F4`, and `3F9.D12` for binding to
BTLA.
[0093] In one embodiment, a BTLA-HVEM agonist binds to an epitope
of BTLA that is homologous to an epitope capable of binding an
antibody selected from the group consisting of `6A6`, `6F7`, `6G3`,
`6H6`, `8F4`, and `3F9.D12`.
[0094] In one embodiment, a BTLA-HVEM agonist is capable of binding
to an epitope comprising one or more residues selected from the
group consisting of V42, Q43, L44, R55, Q63, Q102, and C85 of
murine C57BL/6 BTLA (SEQ ID NO:1).
[0095] In one embodiment, a BTLA-HVEM agonist is capable of binding
to an epitope comprising one or more residues selected from the
group consisting of the residues in a BTLA protein corresponding to
the residues V42, Q43, L44, R55, Q63, Q102, and C85 of murine
C57BL/6 BTLA (SEQ ID NO:1).
[0096] In one embodiment, a BTLA-HVEM agonist is capable of binding
to an epitope comprising one or more residues selected from the
group consisting of the residues in human BTLA corresponding to the
residues V42, Q43, L44, R55, Q63, Q102, and C85 of murine C57BL/6
BTLA (SEQ ID NO:1).
[0097] In one embodiment, a BTLA-HVEM agonist is capable of binding
to an epitope comprising one or more residues selected from the
group consisting of V36, Q37, L38, L49, E57, C79, K93, and S96 in
the human BTLA sequence set forth at Genbank accession no.
AAP44003.1 (SEQ ID NO:2).
[0098] In one embodiment, a BTLA-HVEM agonist is capable of binding
to an epitope comprising one or more residues in human BTLA
corresponding to residues from the group consisting of V36, Q37,
L38, L49, E57, C79, K93, and S96 in the human BTLA sequence set
forth at Genbank accession no. AAP44003.1 (SEQ ID NO:2).
[0099] In one embodiment, a BTLA-HVEM agonist is capable of binding
to a polypeptide having at least about 80%, more preferably 85%,
more preferably 90%, more preferably 95% identity to the amino acid
sequence set forth by residues 37-47, 39-49, 41-49, 50-60, 58-68,
80-90, 97-107, 50-90, 55-85, 58-90, 63-85, 80-107, 85-102, 127-137,
55-102, 50-107, and 41-137 of murine C57BL/6 BTLA (SEQ ID
NO:1).
[0100] In one embodiment, a BTLA-HVEM agonist is capable of binding
to a polypeptide selected from the group consisting of the amino
acid sequences set forth by residues 37-47, 39-49, 41-49, 50-60,
58-68, 80-90, 97-107, 50-90, 55-85, 58-90, 63-85, 80-107, 85-102,
127-137, 55-102, 50-107, and 41-137 of murine C57BL/6 BTLA (SEQ ID
NO:1).
[0101] In one embodiment, a BTLA-HVEM agonist is capable of binding
to a polypeptide having at least about 80%, more preferably 85%,
more preferably 90%, more preferably 95% identity to the amino acid
sequence set forth by residues 31-41, 32-42, 35-43, 44-54, 52-62,
74-84, 88-98, 44-84, 49-79, 52-84, 57-79, 74-98, 79-93, 118-128,
49-93, 44-98, 35-98, and 35-128 of the human BTLA isoform found at
Genbank accession no. AAP44003.1 (SEQ ID NO:2).
[0102] In one embodiment, a BTLA-HVEM agonist is capable of binding
to a polypeptide selected from the group consisting of the amino
acid sequences set forth by residues 31-41, 32-42, 35-43, 44-54,
52-62, 74-84, 88-98, 44-84, 49-79, 52-84, 57-79, 74-98, 79-93,
118-128, 4993, 44-98, 35-98, and 35-128 of the human BTLA isoform
found at Genbank accession no. AAP44003.1 (SEQ ID NO:2).
[0103] In one embodiment, a BTLA-HVEM agonist is capable of
competing with CMV UL144 for binding to BTLA.
[0104] In one embodiment, a BTLA-HVEM agonist is a BTLA
antibody.
[0105] In one aspect, the invention provides BTLA-HVEM agonists
that comprise an HVEM CRD1 domain or fragment thereof capable of
binding to a BTLA Ig domain and stimulating BTLA activity. In
another aspect, the invention provides BTLA-HVEM agonists that
consist essentially of an HVEM CRD1 domain or fragment thereof
capable of binding to a BTLA Ig domain and stimulating BTLA
activity.
[0106] Accordingly, in a preferred embodiment, the invention
provides BTLA-HVEM agonists that are agonistic HVEM fusion proteins
which are capable of binding to a BTLA Ig domain, reducing the
binding of the BTLA Ig domain to an HVEM CRD1 domain, and
stimulating BTLA activity. Such agonistic HVEM fusion proteins lack
an HVEM CRD2 and/or CRD3 domain. Preferred agonistic HVEM fusion
proteins can compete with a BTLA antibody disclosed herein for
binding to a BTLA Ig domain.
[0107] In another preferred embodiment, the invention provides
BTLA-HVEM agonists that are agonistic HVEM protein fragments which
are capable of binding to a BTLA Ig domain, reducing the binding of
the BTLA Ig domain to an HVEM CRD1 domain, and stimulating BTLA
activity. Such agonistic HVEM protein fragments lack an HVEM CRD2
and/or CRD3 domain. In a preferred embodiment, an agonistic HVEM
protein fragment consists essentially of an HVEM CRD1 domain or
fragment thereof which is capable of binding to a BTLA Ig domain
and stimulating BTLA activity. Preferred agonistic HVEM protein
fragments can compete with a BTLA antibody disclosed herein for
binding to a BTLA Ig domain.
[0108] In one embodiment, a BTLA-HVEM agonist is capable of
increasing tyrosine phosphorylation on the intracellular domain of
BTLA protein in a cell having BTLA protein on its surface.
[0109] In one embodiment, a BTLA-HVEM agonist is capable of
increasing association of BTLA protein with SHP-2, PI3K, or Grb2 in
a cell having BTLA protein on its surface.
[0110] In one embodiment, a BTLA-HVEM agonist is capable of
decreasing proliferation of a cell having BTLA protein on its
surface.
[0111] In one embodiment, a BTLA-HVEM agonist is capable of
decreasing IL-2 production by a cell having BTLA protein on its
surface.
[0112] In one embodiment, a BTLA-HVEM agonist is capable of
decreasing antibody production by a cell having said BTLA protein
on its surface.
[0113] In one embodiment, a BTLA-HVEM antagonist is capable of
decreasing the cytotoxicity of a cell having said BTLA protein on
its surface.
[0114] In one aspect, the invention provides methods for modulating
BTLA activity which involve the use of BTLA-HVEM agonists or
BTLA-HVEM antagonists described herein.
[0115] In one aspect, the invention provides methods for decreasing
BTLA activity, comprising contacting BTLA or HVEM with a BTLA-HVEM
antagonist.
[0116] In a preferred embodiment, the method comprises contacting a
cell having BTLA on its surface with a BTLA-HVEM antagonist,
wherein the cell is capable of contacting HVEM protein in the
absence of the BTLA-HVEM antagonist. In one embodiment, the methods
involve use of a BTLA antibody.
[0117] In a preferred embodiment, the cells having BTLA on their
surface are lymphocytes, NK cells, or macrophages.
[0118] In another embodiment, the method comprises contacting HVEM
protein with a BTLA-HVEM antagonist, wherein the HVEM protein is
capable of contacting a cell having BTLA on its surface in the
absence of the BTLA-HVEM antagonist. In one embodiment, the methods
involve use of an HVEM antibody.
[0119] In a preferred embodiment, the HVEM protein is on the
surface of a dendritic cell or a lymphocyte.
[0120] In another embodiment, the invention provides methods for
decreasing BTLA activation by a BTLA ligand that is capable of
competing with HVEM for binding to BTLA, which comprise the use of
a BTLA-HVEM antagonist. In one embodiment, the BTLA ligand is CMV
UL144.
[0121] In one aspect, the invention provides methods for increasing
BTLA activity comprising contacting a cell having BTLA on its
surface with a BTLA-HVEM agonist. In one embodiment, the methods
involve use of a BTLA antibody.
[0122] In a preferred embodiment, the cells having BTLA on their
surface are lymphocytes, NK cells, or macrophages.
[0123] In one aspect, the invention provides methods for modulating
lymphocyte activation which involve the use of BTLA-HVEM agonists
or BTLA-HVEM antagonists described herein.
[0124] In one aspect, the invention provides methods for increasing
lymphocyte activation. In one embodiment, the methods comprise
contacting a lymphocyte having BTLA on its surface with a BTLA-HVEM
antagonist, wherein the lymphocyte is capable of contacting HVEM
protein in the absence of the BTLA-HVEM antagonist. In one
embodiment, the methods involve use of a BTLA antibody.
[0125] In one embodiment, the methods involve contacting HVEM
protein with a BTLA-HVEM antagonist, wherein the HVEM protein is
capable of contacting a lymphocyte having BTLA on its surface in
the absence of the BTLA-HVEM antagonist. In one embodiment, the
methods involve use of a HVEM antibody.
[0126] In a preferred embodiment, a lymphocyte in which activation
is increased is selected from the group consisting of naive T
cells, CD8.sup.+ T cells, CD4.sup.+ T cells, TH1 cells, naive B
cells, and plasma cells.
[0127] In another embodiment, the invention provides methods for
decreasing lymphocyte activation, comprising contacting a
lymphocyte having BTLA on its surface with a BTLA-HVEM agonist. In
one embodiment, the Methods involve use of a BTLA antibody.
[0128] In a preferred embodiment, a lymphocyte in which activation
is decreased is selected from the group consisting of naive T
cells, CD8.sup.+ T cells, CD4.sup.+ T cells, TH1 cells, naive B
cells, and plasma cells.
[0129] In one aspect, the invention provides methods for modulating
lymphocyte effector activity.
[0130] In one aspect, the invention provides methods for decreasing
lymphocyte effector activity, comprising contacting a lymphocyte
having BTLA on its surface with a BTLA-HVEM agonist. In one
embodiment, the methods involve the use of a BTLA antibody.
Decreasing lymphocyte effector activity includes promoting the
termination of effector activity, i.e., shortening the duration of
effector activity.
[0131] In one aspect, the invention provides methods for increasing
and/or prolonging lymphoctye effector activity, comprising
contacting a lymphocyte having BTLA on its surface with a BTLA-HVEM
antagonist. In one embodiment, the methods involve the use of a
BTLA antibody. In another embodiment, the methods involve
contacting an HVEM protein with a BTLA-HVEM antagonist. Prolonging
effector activity includes delaying the termination of effector
activity.
[0132] In another aspect, the invention provides methods for
modulating an immune response to an antigen, which involve the use
of BTLA-HVEM agonists or BTLA-HVEM antagonists described
herein.
[0133] In one aspect, the invention provides methods for increasing
an immune response to an antigen, comprising contacting a
lymphocyte having BTLA on its surface with a BTLA-HVEM antagonist,
wherein the lymphocyte has specificity for the antigen, and wherein
the lymphocyte is capable of contacting HVEM protein in the absence
of the BTLA-HVEM antagonist. In one embodiment, the methods involve
use of a BTLA antibody.
[0134] In another embodiment, the methods comprise contacting HVEM
protein with a BTLA-HVEM antagonist, wherein the HVEM protein is
capable of contacting a lymphocyte having BTLA on its surface in
the absence of the BTLA-HVEM antagonist, wherein the lymphocyte has
specificity for the antigen. In one embodiment, the methods involve
use of a HVEM antibody.
[0135] In a preferred embodiment, the antigen is a cancer cell
antigen.
[0136] In another preferred embodiment, the antigen is a viral
antigen.
[0137] In another preferred embodiment, the antigen is presented by
a pathogen.
[0138] In another preferred embodiment, the antigen is provided by
a vaccine.
[0139] In a preferred embodiment, the lymphocyte having BTLA on its
surface and specificity for the antigen is contacted with a
BTLA-HVEM antagonist in vivo.
[0140] In a preferred embodiment, the HVEM protein is contacted
with a BTLA-HVEM antagonist in vivo.
[0141] In a preferred embodiment, the lymphocyte having specificity
for the antigen is selected from the group consisting of naive T
cells, CD8.sup.+ T cells, CD4.sup.+ T cells, T.sub.H1 cells, naive
B cells, and plasma cells.
[0142] In one embodiment, the methods further comprise
administering antigen to a patient receiving the BTLA-HVEM
antagonist.
[0143] In one embodiment, the methods further comprise
administering a bioactive agent that increases a positive
costimulatory signal to a patient receiving the BTLA-HVEM
antagonist.
[0144] In one embodiment, the methods further comprise
administering a bioactive agent that decreases a negative
costimulatory signal to a patient receiving the BTLA-HVEM
antagonist. For example, it is contemplated that use of a BTLA-HVEM
antagonist will be synergistic in combination with agents capable
of providing CTLA-4 blockade as described in U.S. Pat. Nos.
5,855,887; 5,811,097;and 6,051,227, and International Publication
WO 00/32231, the disclosures of which are expressly incorporated
herein by reference.
[0145] In one embodiment, the invention provides methods for
increasing an immune reaction against a tumor in a patient,
comprising contacting a lymphocyte having BTLA on its surface with
a BTLA-HVEM antagonist, wherein the lymphocyte has specificity for
a cancer cell antigen associated with the tumor and is capable of
contacting HVEM protein. In one embodiment, the methods involve use
of a BTLA antibody.
[0146] In another embodiment, the methods comprise contacting HVEM
protein with a BTLA-HVEM antagonist, wherein the HVEM protein is
capable of contacting a lymphocyte having BTLA on its surface, and
wherein the lymphocyte has specificity for a cancer cell antigen
associated with the tumor. In one embodiment, the methods involve
use of a HVEM antibody.
[0147] In a preferred embodiment, the methods further comprise
administering a cancer cell antigen to the patient.
[0148] In a preferred embodiment, the methods further comprise
administering a bioactive agent that increases a positive
costimulatory signal.
[0149] In a preferred embodiment, the methods further comprise
administering a bioactive agent that decreases a negative
costimulatory signal to the cancer patient. For example, it is
contemplated that use of a BTLA-HVEM antagonist will be synergistic
in combination with agents capable of providing CTLA-4 blockade as
described in U.S. Pat. Nos. 5,855,887; 5,811,097;and 6,051,227, and
International Publication WO 00/32231.
[0150] In a preferred embodiment, the lymphocyte having BTLA on its
surface and specificity for the cancer cell antigen is contacted
with a BTLA-HVEM antagonist in vivo.
[0151] In a preferred embodiment, the HVEM protein is contacted
with a BTLA-HVEM antagonist invivo.
[0152] In a preferred embodiment, the lymphocyte having specificity
for the cancer cell antigen is selected from the group consisting
of naive T cells, CD8.sup.+ T cells, CD4.sup.+ T cells, T.sub.H1
cells, naive B cells, and plasma cells.
[0153] In one aspect, the invention provides methods for inhibiting
tumor growth, comprising administering to a patient a
therapeutically effective amount of a BTLA-HVEM antagonist.
[0154] In a preferred embodiment, the methods further comprise
administering a cancer cell antigen to the patient.
[0155] In a preferred embodiment, the methods further comprise
administering a bioactive agent that increases a positive
costimulatory signal.
[0156] In a preferred embodiment, the methods further comprise
administering a bioactive agent that decreases a negative
costimulatory signal to the cancer patient. For example, it is
contemplated that use of a BTLA-HVEM antagonist will be synergistic
in combination with agents capable of providing CTLA-4 blockade as
described in U.S. Pat. Nos. 5,855,887; 5,811,097;and 6,051,227, and
International Publication WO 00/32231.
[0157] In one aspect, the invention provides methods for treating
cancer, comprising administering to a patient a therapeutically
effective amount of a BTLA-HVEM antagonist.
[0158] In a preferred embodiment, the methods further comprise
administering a cancer cell antigen to the patient.
[0159] In a preferred embodiment, the methods further comprise
administering a bioactive agent that increases a positive
costimulatory signal.
[0160] In a preferred embodiment, the methods further comprise
administering a bioactive agent that decreases a negative
costimulatory signal to the cancer patient. For example, it is
contemplated that use of a BTLA-HVEM antagonist will be synergistic
in combination with agents capable of providing CTLA-4 blockade as
described in U.S. Pat. Nos. 5,855,887; 5,811,097; and 6,051,227,
and International Publication WO 00/32231.
[0161] In one aspect, the invention provides methods for reducing
an immune response to an antigen, comprising contacting a
lymphocyte having BTLA on its surface with a BTLA-HVEM agonist,
wherein the lymphocyte has specificity for the antigen. In one
embodiment, the methods involve use of a BTLA antibody.
[0162] In a preferred embodiment, the antigen is a graft cell
antigen.
[0163] In another preferred embodiment, the antigen is a self
antigen.
[0164] In another preferred embodiment, the lymphocyte having
specificity for the antigen is selected from the group consisting
of naive T cells, CD8.sup.+ T cells, CD4.sup.+ T cells, T.sub.H1
cells, naive B cells, and plasma cells.
[0165] In one embodiment, the methods further comprise
administering a bioactive agent that decreases a positive
costimulatory signal to the patient.
[0166] In one embodiment, the methods further comprise
administering an immunosuppressant to the patient.
[0167] In one embodiment, the methods further comprise
administering a bioactive agent that increases a negative
costimulatory signal to the patient.
[0168] In one embodiment, the invention provides methods for
reducing an immune reaction against a graft in a patient,
comprising contacting a lymphocyte having BTLA on its surface with
a BTLA-HVEM agonist, wherein the lymphocyte has specificity for a
graft cell antigen. In one embodiment, the BTLA-HVEM agonist is a
BTLA antibody.
[0169] In another preferred embodiment, the lymphocyte having
specificity for the antigen is selected from the group consisting
of naive T cells, CD8 T cells, CD4.sup.+ T cells, T.sub.H1 cells,
naive B cells, and plasma cells.
[0170] In one embodiment, the methods further comprise
administering a bioactive agent that decreases a positive
costimulatory signal to the patient.
[0171] In one embodiment, the methods further comprise
administering an immunosuppressant to the patient.
[0172] In one embodiment, the methods further comprise
administering a bioactive agent that increases a negative
costimulatory signal to the patient.
[0173] In one aspect, the invention provides methods for reducing
rejection of a graft by a patient, comprising administering to the
patient a therapeutically effective amount of a BTLA-HVEM
agonist.
[0174] In one embodiment, the methods further comprise
administering a bioactive agent that decreases a positive
costimulatory signal to the patient.
[0175] In one embodiment, the methods further comprise
administering an immunosuppressant to the patient.
[0176] In one embodiment, the methods further comprise
administering a bioactive agent that increases a negative
costimulatory signal to the patient.
[0177] In one aspect, the invention provides methods for prolonging
the survival of a graft in a patient, comprising administering to
the patient a therapeutically effective amount of a BTLA-HVEM
agonist.
[0178] In one embodiment, the methods further comprise
administering a bioactive agent that decreases a positive
costimulatory signal to the patient.
[0179] In one embodiment, the methods further comprise
administering an immunosuppressant to the patient.
[0180] In one embodiment, the methods further comprise
administering a bioactive agent that increases a negative
costimulatory signal to the patient.
[0181] In one aspect, the invention provides methods for reducing a
graft versus host response in a patient, comprising administering
to the patient a therapeutically effective amount of a BTLA-HVEM
antagonist.
[0182] In one embodiment, the methods further comprise
administering a bioactive agent that increases a positive
costimulatory signal to the patient.
[0183] In one embodiment, the methods further comprise
administering a bioactive agent that decreases a negative
costimulatory signal to the patient. For example, it is
contemplated that use of a BTLA-HVEM antagonist will be synergistic
in combination with agents capable of activating CTLA-4 as
described in U.S. Pat. Nos. 5,855,887; 5,811,097;and 6,051,227, and
International Publication WO 00/32231.
[0184] In one aspect, the invention provides methods for treating a
patient having an autoimmune disease, comprising administering to
the patient a therapeutically effective amount of a BTLA-HVEM
agonist.
[0185] In one embodiment, the autoimmune disease is selected from
the group consisting of Rheumatoid arthritis, type 1 diabetes,
autoimmune thyroiditis, and Lupus.
[0186] In one embodiment, the methods further comprise
administering a bioactive agent that decreases a positive
costimulatory signal to the patient.
[0187] In one embodiment, the methods further comprise
administering an immunosuppressant to the patient.
[0188] In one embodiment, the methods further comprise
administering a bioactive agent that increases a negative
costimulatory signal to the patient.
[0189] In one aspect, the invention provides methods for treating a
patient having an allergic reaction, comprising administering to
the patient a therapeutically effective amount of a BTLA-HVEM
agonist.
[0190] In one aspect, the invention provides methods for preventing
a patient from having an allergic reaction, comprising
administering to the patient a therapeutically effective amount of
a BTLA-HVEM agonist.
[0191] In one aspect, the invention provides methods for reducing
an allergic reaction in a patient, comprising administering to the
patient a therapeutically effective amount of a BTLA-HVEM
agonist.
[0192] In one aspect, the invention provides methods for reducing
an asthmatic response in a patient, comprising administering to the
patient a therapeutically effective amount of a BTLA-HVEM
agonist.
[0193] In one aspect, the invention provides methods for enhancing
recovery from an asthmatic response in a patient, comprising
administering to the patient a therapeutically effective amount of
a BTLA-HVEM agonist.
[0194] In one aspect, the invention provides methods for treating
asthma, comprising administering to an asthma patient a
therapeutically effective amount of a BTLA-HVEM agonist.
[0195] In one aspect, the invention provides methods for reducing
an inflammatory reaction in a patient, comprising administering to
the patient a therapeutically effective amount of a BTLA-HVEM
agonist.
[0196] In one aspect, the invention provides methods for reducing
the interaction of cell having BTLA on its surface and a second
cell having HVEM on its surface. The methods involve the use of a
BTLA-HVEM antagonist or a BTLA-HVEM agonist. In a preferred
embodiment, the methods involve use of a BTLA antibody or a HVEM
antibody. In a preferred embodiment, the cell having BTLA on its
surface is selected from the group consisting of naive T cells,
CD8.sup.+ T cells, CD4.sup.+ T cells, T.sub.H1 cells, naive B
cells, and plasma cells.
[0197] In one aspect, the invention provides methods for modulating
memory cell formation, comprising contacting a lymphocyte exposed
to antigen with a BTLA-HVEM agonist or antagonist. In a preferred
embodiment, the methods involve the use of a BTLA antibody.
[0198] In one aspect, the invention provides methods for modulating
tolerance of self antigen, comprising contacting a lymphocyte
exposed to self antigen with a BTLA-HVEM agonist or antagonist. In
a preferred embodiment, the methods involve the use of a BTLA
antibody.
[0199] Also provided are adjuvant compositions comprising at least
one of the BTLA-HVEM antagonists described herein.
[0200] Also provided are immunosuppressant compositions comprising
at least one of the BTLA-HVEM agonists described herein.
[0201] In another aspect, the present invention provides methods of
screening for BTLA-HVEM agonists and BTLA-HVEM antagonists, which
agonists and antagonists find therapeutic uses for the modulation
of immune reactions.
[0202] The invention further contemplates the use of the
aforementioned polypeptides in immunoassays.
[0203] The invention further contemplates the use of the
aforementioned polypeptides as immunogens for the production of
antibodies.
BRIEF DESCRIPTION OF THE DRAWINGS
[0204] FIG. 1 BTLA recognizes a ligand on naive T cells.
Splenocytes from BALB/c and C57BL/6 mice were collected and either
were directly stained (None) or were activated with plate-bound
500A2 (Anti-CD3; 1:200 dilution of ascites fluid) or soluble
anti-IgM (10 .mu.g/ml) for 48 h, and then were stained with BTLA-Fc
or PD-L1-Fc fusion protein (shaded histograms) followed by
anti-human IgG-phycoerythrin (Anti-human IgG-PE), anti-CD4-tricolor
and anti-B220-FITC. Open histograms, staining with human IgG1
isotype control in place of Fc fusion protein.
[0205] FIG. 2 BTLA tetramer staining identifies a ligand on CD4+
and CD8+ cells. (a) Splenocytes and lymph node cells from pooled
C57BL/6 and BALB/c mice were stained with anti-CD8-FITC,
antiCD4-CyChrome, and either streptavidin-phycoerythrin (open
histograms) or BTLA tetramer-phycoerythrin (shaded histograms). Dot
plots (left) show the CD4-CD8 gates used for single-color
histograms of BTLA tetramer-phycoerythrin staining (right). (b)
Splenocytes from pooled C57BL/6 and BALB/c mice were left untreated
or were activated 48 h with anti-CD3 or anti-IgM as described in
FIG. 1 or with lipopolysaccharide (1 .mu.g/ml) for 24 h and were
stained with antiB220-FITC, anti-CD4-CyChrome, and either
streptavidin-phycoerythrin (open histograms) or BTLA
tetramer-phycoerythrin (shaded histograms). (c) Thymocytes from
pooled C57BL/6 and BALB/c mice were stained with anti-CD8-FITC,
anti-CD4-CyChrome, and either streptavidin-phycoerythrin (open
histograms) or BTLA tetramer-phycoerythrin (shaded histograms). The
dot plot (left) shows the CD4/CD8 gates used for the single-color
histograms of BTLA-tetramer staining.
[0206] FIG. 3 BTLA ligand expression is modulated during T cell
activation. D011.10 splenocytes were stimulated with 0.3 .mu.M OVA
peptide in T helper type 1 conditions (T.sub.H1; 10 U/ml of IL-12
and 10 .mu.g/ml of anti-IL-4) or T helper type 2 conditions
(T.sub.H2; 100 U/ml of IL-4 and 3 .mu.g/ml of anti-IL-12). Cultures
were collected after activation (time, horizontal axis) and were
stained with anti-CD4-FITC and BTLA tetramer-phycoerythrin. Filled
circles, streptavidin-phycoerythrin (SA-PE) staining of T helper
type 1 cultures without BTLA tetramer. MFI, mean fluorescence
intensity.
[0207] FIG. 4 HVEM is a ligand for BTLA. (a) NIH 3T3 cells and BJAB
cells were transduced with splenocyte cDNA libraries and were
directly stained with anti-Thy1.1-FITC and the C57BL/6 BTLA
tetramer-phycoerythrin (Before sorting). These cells were sorted
for the highest 0.5% population of BTLA tetramer staining with
BTLA-phycoerythrin tetramer and Thy1.1-FITC and were subjected to
an additional three rounds of similar sequential purification.
After the fourth round of sorting, cell populations were expanded
and cells were stained (After sorting). Numbers in each quadrant
indicate the percentage of live cells in the indicated gate. (b)
BJAB cells were transduced with the retroviruses mHVEM-IRES-GFP
(mHVEM; mouse), hHVEM-IRES-GFP (hHVEM; human), 4-1 BB-IRES-GFP (4-1
BB; mouse) and LTBR-1 RES-GFP (LT(3R; mouse) and were stained with
C57BL/6 BTLA tetramer-phycoerythrin or BALB/c BTLA
tetramer-phycoerythrin. Numbers in dot plots indicate the
percentage of BTLA tetramer staining in the GFP-positive
population. (c,d) HVEM activates BTLA phosphorylation and SHP-2
association. EL-4 cells (EL4), BJAB cells expressing GFP (BJAB-GFP)
or BJAB cells expressing mouse HVEM (BJAB-mHVEM) were added (+) or
not added (-) for 4 min at 37.degree. C. at a density of
25.times.10.sup.6 cells/ml. Cells were left untreated (-) or were
treated (+) with pervanadate (VO.sub.4) for 4 min. Total cell
lysates were prepared and were immunoprecipitated with 6A6
(anti-mouse BTLA), and immunoblots were probed for SHP-2 (c) or for
phosphotyrosine (d) in immunoprecipitates (IP) or in lysates
without immunoprecipitation. Immunoblots using the isotype control
for immunoprecipitation were negative for SHP-2 association (data
not shown). Data in c and d are representative of four independent
experiments. (e) BJAB cells were transduced with retrovirus
mHVEM-ires-GFP or hHVEM-ires-GFP and were stained with human IgG1
isotype control (hIgG1), mB7x-Fc, mBTLA-Fc or hBTLA-Fc followed by
anti-human IgG-phycoerythrin. Numbers in dot plots show the
percentage of fusion protein staining in the GFP-positive
population.
[0208] FIG. 5 HVEM is the unique ligand for BTLA and interacts
through CRD1. (a) Splenocytes from wild-type (Tnfrsf14+/+) or
HVEM-deficient (Tnfrsfl4-/-) mice were stained with anti-CD4-FITC
(CD4+), anti-CD8-FITC (CD8+) or anti-B220-FITC (B220+) and either
C57BL/6 BTLA tetramer-phycoerythrin (shaded histograms) or
streptavidin-phycoerythrin alone (open histograms). (b) Splenocytes
from wild-type (BTLA+/+) and BTLA-/- mice were stained with
anti-B220-FITC (top) or anti-CD11c-FITC (bottom) and with either
mHVEM-Fc (shaded histograms) or isotype control human IgG1 (open
histograms) followed by anti-human IgG-phycoerythrin. (c)
Splenocytes from wild-type (Tnfrsfl4+/+) and Tnfrsfl4-/- mice were
stained with B220-FITC (top) or CD11c-FITC (bottom) and mHVEM-Fc or
isotype control human IgG1 (open histograms), followed by
anti-human IgG-phycoerythrin. (d) BJAB cells were left uninfected
or were transduced with retroviruses expressing mouse HVEM-GFP
fusion protein (mHVEM-GFP), the HVEM deletion mutant lacking
N-terminal CRD1 as a GFP fusion protein (mHVEMCRDI-GFP), intact
human HVEM (hHVEM-IRES-GFP) or chimeric HVEM containing mouse CRD1
linked to human CRD2 (m/hHVEM-IRES-GFP). Left, cells stained with
BTLA tetramer-phycoerythrin (shaded histograms) or
streptavidin-phycoerythrin alone (open histograms); right, cells
stained with either anti-hHVEM (shaded histograms) or a mouse IgG1
isotype control (9E10) followed by goat anti-mouse
IgG1-phycoerythrin. Single-color histograms were gated on
GFP-positive live cells. Right margin, composition of the HVEM
constructs, with mouse CRDs (open ovals) and human CRDs (shaded
ovals).
[0209] FIG. 6 HVEM expression on APCs inhibits T cell
proliferation. (a) CD4+ cells were purified from BALB/c mice by
magnetic separation and were stimulated (1.times.10.sup.6 cells/ml)
with plate-bound anti-CD3 (2C11; dose, horizontal axis) and
increasing concentrations (wedges; 0, 0.3, 1.0, 3.0 and 10.0
.mu.g/ml) of plate-bound LIGHT. Cultures were pulsed with
[.sup.3H]thymidine at 48 h and were collected at 60 h. Data
represent c.p.m. s.d. from one of three similar experiments. (b)
CD4+ T cells from D011.10 mice were purified by magnetic
separation, followed by cell sorting for CD4+B220-CD11ccells to
more than 98% purity, and were added to cultures alone (T alone) or
with (T+) CHO cells expressing I-Ad, I-Ad and B7.1, or I-Ad and
BTLA, plus various concentration of OVA peptide (horizontal axis),
and proliferation was measured as described in a. (c) T cells
prepared as described in b were cultured alone or with CHO cells
expressing I-Ad, or I-Ad and HVEM, plus various concentrations of
OVA peptide, and proliferation was measured as described in a. (d)
T cells prepared as described in b were cultured alone or with CHO
cells expressing I-Ad, or I-Ad and B7.1, or I-Ad, B7.1 and HVEM,
and were activated with various concentration of OVA peptide.
Proliferation was measured as described in a.
[0210] FIG. 7 HVEM inhibits T cell proliferation in a
BTLA-dependent way. (a) Highly purified D011.10 CD4+ T cells from
wild-type (BTLA+/+) or BTLA-/- mice were prepared as described in
FIG. 6, were labeled with CFSE and were cultured for 3 or 4 d with
CHO cells expressing I-Ad, or I-Ad and BTLA, or I-Ad and HVEM, plus
0.03 or 0.3 .mu.M OVA peptide. Cells were analyzed by flow
cytometry. Data are single-color histograms of CFSE gated on CD4+T
cells. Numbers indicate percentage of live cells that have divided
at least once, as indicated by the gate drawn. (b) T cells prepared
as described in a were cultured for 3 or 4 d with CHO cells
expressing I-Ad and B7.1, I-Ad, B7.1 and BTLA, or I-Ad, B7.1 and
HVEM, plus 0.03 or 0.3 .mu.M OVA peptide, and were analyzed as
described in a. Numbers indicate percentage of live cells that have
divided at least once.
[0211] FIG. 8 Polymorphisms in the BTLA Ig domain. A, Exon 2 of
BTLA, comprising the Ig domain, was amplified by PCR from genomic
DNA of the indicated mouse strains and sequenced. The amino acid
alignment of the Ig domains of BALB/c (SEQ ID NO:3), MLR/Ipr (SEQ
ID NO:4), and C57BL/6 (SEQ ID NO:5) BTLA is shown, starting with
the aspartic acid (D) residue that corresponds to residue 37 of the
entire BTLA protein. The last line of the alignment shows a
consensus sequence (bottom), with differences between BALB/c and
MLR/Ipr (#) and differences between BALB/c and C57BL/6 (*) shown.
B, Strains sharing identical alleles of BTLA are grouped together
under the index headings of BALB/c, MLR/Ipr, and C57BL/6.
[0212] FIG. 9 Production of mAbs to allelic variants of murine
BTLA. A and B, BJAB cells were stably transfected with retroviral
constructs expressing the extracellular/transmembrane domains of
BTLA from C57BL/6 (BJAB.B6 BTLA-GFP, solid histogram) or BALB/c
(BJAB.BALB/c BTLA-GFP, dotted histogram) as GFP fusion proteins.
Cells were stained with the indicated purified mAbs or postimmune
serum (hamster anti-BTLA (A) serum, mouse anti-BTLA (B) serum).
Secondary staining was with either anti-hamster IgG (A) or
anti-mouse Ig (B). Histograms shown are gated on GFP+BJAB. B6
BTLA-GFP or BJAB.BALB/c BTLA-GFP cells stained separately. Shaded
histogram for the hamster and mouse immune serum are controls using
normal hamster serum or normal mouse serum to stain a mixture of
BJAB. B6 BTLA-GFP and BJAB.BALB/c BTLA-GFP cells. Shaded histogram
for mAb staining shows the isotype control of either hamster IgG
(A) or murine IgG1 (B) staining a mixture of cells. C, Splenocytes
from C57BL/6 or BALB/c wild-type mice (solid histogram) or BTLA-/-
mice (dotted histogram) were stained with 6A6 (left) or 6F7
(right). BTLA-/- staining was equivalent to that of the isotype
control (shaded histogram). D, Lysates from 25.times.10.sup.6 cells
BJAB. B6 BTLA-GFP or BJAB.BALB/c BTLA-GFP cells were
immunoprecipitated (IP) with 10 .mu.g of the indicated Ab and
Western blots probed (Blot) with either 6F7, or with anti-GFP Ab,
as indicated. As controls, cell lysates were immunoprecipitated
with mouse or hamster IgG as indicated (lanes 7-10). E, EL4 cells
were incubated in the absence (-) or presence (+) of pervanadate
for 4 min at 37.degree. C., and lysed in 1% Triton X-100 lysis
buffer, immunoprecipitated (IP) with 6A6 or isotype control Ab (PIP
anti-GST) and Western blots probed (Blot) with antiSHP-2 as
described.
[0213] FIG. 10 Mapping epitopes recognized by BTLA Abs using Yeast
Display. A panel of yeast cells expressing the indicated BTLA Ig
domain Aga2 fusion proteins was analyzed for Ab staining. As a
positive control, expression of the fusion protein was confirmed
first for each line using staining with anti-HA Ab specific for the
HA-tag incorporated into the BTLA-Aga2 fusion protein, and was
positive for each line tested (data not shown). Yeast cells were
stained with the anti-BTLA Ab indicated on top of each column. The
amino acid substitutions (and corresponding nucleotide
substitutions) in each yeast line are indicated on the left.
Single-color histograms are marked (*) to indicate mutations that
are not recognized by the corresponding Ab.
[0214] FIG. 11 BTLA shows broad and allelic-specific expression on
lymphoid cell populations. A, Four-color FACS analysis was
conducted on splenocytes from C57BL/6 (solid histogram) or BALB/c
(dotted histogram). Two-color histograms (upper row) of the
indicated markers used to gate cells for single-color histograms of
6A6 (middle row) or 6F7 (lower row) staining are shown. In the
columns one, two, and three, cells were stained with anti-B220
allophycocyanin, anti-CD4 CyChrome, anti-CD8 FITC, and either
biotinylated b-6A6 or b-6F7 followed by SA-PE secondary. In columns
four, five, and six, cells were stained with anti-I-Ad PE (BALB/c
cells) or anti-I-Ab PE (C57BU6 cells), and anti-CD11b FITC (fourth
column), CD11c-FITC (fifth column), or anti-DX-5 FITC (sixth
column), and b-6A6 or b-6F7 followed by SA-CyChrome secondary.
Shaded histograms are staining of a mixture of C57BL/6 and BALB/c
splenocytes using isotype controls of biotinylated hamster IgG
(middle row) and mouse IgG1 (lower row). The numbers shown in top
panels are the percentage of live cells within the indicated gate.
The identity of the gated population is indicated in the panel. B,
C57BL/6 and BALB/c splenocytes were stained with Abs to identify
the following B cell populations: follicular B cells (FO),
IgMlowCD21/CD35int; marginal zone (MZ), IgMhighCD21/CD35high;
transitional (TR), IgMlowCD21/CD35low. Staining with the
pan-BTLA-specific Ab 6F7 revealed equivalent BTLA levels between
strains for all subsets.
[0215] FIG. 12 BTLA is expressed during late stages of B and T
lymphocyte development. A, Thymocytes from C57BL/6 (solid
histogram) or BALB/c (dotted histogram) mice were stained with a
combination of markers, anti-B220 RTC, anti-CD11c FITC, anti-CD11b
FITC, anti-GR-1 FITC, antiDX-5 FITC, CD4-CyChrome, CD8-PE, and
either biotinylated (b)-6A7 or b-mouse IgG1, and
SA-allophycocyanin. The two-color histogram (first panel) is gated
on marker (FITC)-negative live cells, and the numbers indicate the
percentage of cells in the indicated gates. Single-color histograms
for each gate are shown for b-6F7/SA-allophycocyanin staining for
CD4.sup.-CD8.sup.- double negative (DN), CD4+CD8+ double positive
(DP), CD4+ single positive (CD4 SP), or CD8+ single positive (CD8
SP) populations. Shaded histograms are staining the b-mouse IgG1
isotype control. B, Bone marrow cells were stained with anti-B220
allophycocyanin, anti-IgM PerCp Cy5.5, either b-6F7 or murine IgG1
biotin, and SA-PE. The numbers are the percentage of live gated
cells within the three numbered gates. BTLA expression is shown in
the single-color histograms for each gate; gate 1, Pre-B cells and
Pro-B cells (IgM-B220low); gate 2, Immature B cells (IgM+B220low);
gate 3, Mature B cells (IgM+B220high). Shaded regions are mouse
IgG1 isotype control staining.
[0216] FIG. 13 BTLA expression during CD4+ T cell activation and
Th1 polarization. A, DO11.10 transgenic T cells were purified by
cell sorting and activated with 0.3 .mu.M OVA peptide 324-336 under
Th1 or Th2 conditions (see Examples). Cells were harvested either
before activation (Day 0) or on the indicated day following primary
activation, and stained with KJ1-26 Tricolor, b-6F7, and SA-PE. T
cells were restimulated with OVA peptide on day 7 and day 14. B,
BALB/c splenocytes were stimulated with 10 .mu.g/ml anti-IgM and 5
.mu.g/ml anti-CD40 (left) or 1 .mu.g/ml LPS (right). Single-color
histograms of B220+ cells (anti-B220-FITC) are shown for
b-6F7/SA-PE staining on day 0 (dotted histogram) and day 2 (solid
histogram) after activation. Shaded histograms are the biotinylated
mouse IgG1 isotype control.
[0217] FIG. 14 BTLA is induced on anergic CD4+ T cells, but not
CD4+CD25+ regulatory T cells. A, HA-TCR T cells were transferred
into and subsequently harvested from B10.D2 mice (naive), C3-HAhigh
mice (anergized) or B10.D2 mice infected with vaccinia-HA
(activated) on days 2, 3, 4, or 7 after transfer as indicated.
After harvest, T cells were isolated using combined magnetic bead
and fluorescence sorting, and cDNA probe prepared and hybridized to
Affymetrix microarrays M174A, M174B, and M174C. Relative BTLA
expression intensity was determined using a latin-squares approach
in Affymetrix Microarray Suite, version 5.1. software. Expression
of myosin Vila gene is shown as a control. B, CFSE-labeled HA-TCR T
cells were adoptively transferred into B10.D2 mice (naive),
C3-HAhigh mice (anergized), or B10.D2 mice immunized with
vaccinia-HA (activated), and harvested on day 6 as in A. Cells were
stained with anti-CD4 allophycocyanin, anti-Thy1.1 PerCP, and
either b-6F7 or murine IgGI-biotin, and SA-PE. BTLA expression is
shown as single-color histogram for CFSE+ (naive) or
CFSE-(activated and anergized) for CD4+ Thy1.1+ donor cells. C,
Splenocytes harvested from recipients as in A were restimulated
with HA peptide and proliferation measured on day 2. D, Splenocytes
and lymph node cells from BALB/c mice were enriched for
CD25-negative and CD25-positive populations using anti-CD25-PE and
magnetic beads as described in Materials and Methods, and stained
with anti-CD4-Cy-chrome, and biotin-conjugated 6F7, or biotin-IgG1,
followed by SA-allophycocyanin. Two-color dot plots are shown for
CD25 and CD4 (left panels), or single-color histograms gated on
CD4+ cells for 6F7 (middle panels) or anti-PD-1 (right panels) for
the CD25- (top row) and CD25+ (bottom row) fractions. For BTLA
staining, histograms are shown for both the freshly isolated cells
(thin histogram) and 36 h antiCD3-activated cells (thick
histogram). Shaded histograms are the staining of the mouse IgG1
istoype control. E, Cells isolated in D were stimulated with the
indicated amount of anti-CD3 and proliferation measured after 2
days.
[0218] FIG. 15 BTLA-/- mice have modestly augmented IgG3 responses
to T-independent Ag. 129SvEv wild-type mice or BTLA-/- mice (n=5)
were immunized with 50 pg NP-Ficoll in alum by i.p. injection. At
day 14, relative isotype-specific anti-NP Ab titer in serum was
determined by ELISA. Data are shown as the percentage of the Ab
titer produced in serum of naive BTLA+/+ or BTLA-/- mice.
Mean.+-.SD is shown.
[0219] FIG. 16 BTLA-/- parental cells engraft and initially
expand.
[0220] FIG. 17 BTLA-/- parental cells fail to survive following
transfer.
[0221] FIG. 18 BTLA-/- cells do not persist as GHVD progresses.
Until about day 9, the expansion of WT and BTLA KO donor T cells is
similar; At later times, BTLA-/- show rapid decrease in the number
of remaining donor cells.
[0222] FIG. 19 HVEM induces BTLA-phosphorylation and SHP-2
recruitment in trans.
[0223] FIG. 20 HVEM on APCs inhibits T cell proliferation through
BTLA. HVEM on APCs inhibits T cell proliferation: HVEM does not
inhibit BTLA-/- T cells.
[0224] FIG. 21 HVEM on APCs inhibits T cell proliferation through
BTLA.
[0225] FIG. 22 HVEM inhibition is overcome by strong costimulation.
HVEM inhibition of T cells is less with stronger co-stimulation.
HVEM inhibition of T cells is less at highest antigen doses.
[0226] FIG. 23 6A6 binds to amino acid residues E34 and R73 of
BTLA. Antibody interactions are most affected by E34Q and R73Q
mutations, and slightly affected by H23Q and W56C mutations. E34
and R73 are E63 and R102 in full length protein.
[0227] FIG. 24 shows the amino acid sequence of human BTLA, also
found at Genbank Accession No. AAP44003.1 (SEQ ID NO:2).
[0228] FIG. 25 PD-1 and BTLA are expressed on BAL CD4 T cells:
C57BL/6 mice were sensitized and challenged with Ovalbumin. On days
1, 3, 4, and 7 following challenge, groups of mice were euthanized
and the cells recovered in the BAL analyzed for expression of CD4
and PD-1 or BTLA by 2-color flow cytometry. The percentage of cells
positive for CD4 as a fraction of either the total sample or of the
lymphocyte gate as well as the total number of CD4+ cells recovered
is indicated in each box. Histograms of PD-1 or BTLA expression on
the CD4+ cells are shown for days 3, 4 and 7. Representative data
of 3 independent experiments is presented.
[0229] FIG. 26 PD-1 and BTLA have a minor effect on acute allergic
airway inflammation: C57BL/6, PD-1 -/- and BTLA -/- mice (n=5 per
group) were sensitized and challenged with OVA. 3 days following
challenge, the mice were euthanized and samples collected for
analysis. A) Total cell counts in the BAL fluid. B) Differential
analysis of the cell types present in the BAL. C) Representative
fields of H and E stained sections (40.times. magnification).
*=P<0.05 **=P<0.005 compared to C57BL/6 by 2 tailed T test.
Representative data from 5 independent experiments is shown.
[0230] FIG. 27 Expression of the ligands for PD-1 and BTLA during
allergic airway inflammation: Total RNA was isolated from whole
lungs of allergen challenged mice on the indicated days
post-challenge or from primary cultured murine tracheal epithelial
cells (mTEC). RT-PCR was performed using specific primers that
spanned intronic sequences of each gene. Shown is representative
data from 2 independent experiments.
[0231] FIG. 28 shows that PD-1 and BTLA-deficient mice have a
prolonged duration of airway inflammation: C57BL/6, PD-1 -/- and
BTLA -/- mice were sensitized and challenged with OVA. On days 10
and 15 cohorts of mice (n=5/group) were euthanized and samples
collected for A) analysis of the BAL and B) histology. *=p<0.05
compared to C57BL/6 using a 2 tailed T-test.
[0232] FIG. 29 shows graphs and micrographs illustrating that BTLA
and HVEM, but not PD-1, regulate the survival of partially
MHC-mismatched cardiac allografts. a, The lack of BTLA or HVEM, or
administration of a neutralizing anti-BTLA mAb, led to rejection of
all MHC class II-mismatched cardiac allografts within 3-4 wk of
transplantation, whereas wild-type (WT) recipients accepted Bm12
allografts indefinitely. Data were generated from six to 12
allografts/group; p<0.001 for BTLA-/-, HVEM-/-, or anti-BTLA
mAb-treated group vs respective WT controls. Panels at the right
show acute cellular rejection of Bm12 allografts harvested 2 wk
after transplant from BTLA-/-, but not WT, recipients
(H&E-stained paraffin sections; original magnifications,
.times.300). b, In contrast to BTLA and HVEM, a lack of PD-1 still
allowed >80% long-term survival of MHC class II-mismatched
cardiac allografts (p<0.05 compared with isotype-treated WT
control), and an absence of both PD-1 and BTLA (DKO) led to only a
minor acceleration of allograft rejection compared with lack of
BTLA alone (p<0.05 vs BTLA-/- alone) in B6 recipients of Bm12
cardiac allografts. Data were generated from four to eight
allografts per group. c, Lack of BTLA led to rejection of all MHC
class I-mismatched cardiac allografts, whereas WT recipients
accepted Bm1 allografts indefinitely. Data were generated from six
to 12 allografts/group (p<0.001). Panels at the right show
histologic evidence of developing cellular rejection of Bm1
allografts harvested 4 wk after transplant from BTLA-/-, but not
WT, recipients (H&E-stained paraffin sections; original
magnifications, .times.300).
[0233] FIG. 30 shows graphs illustrating that BTLA suppresses T
cell responses to MHC class II alloantigens. a, Intragraft mRNA
expression of BTLA, PD-1, and ligands was determined by qPCR; data
are expressed as the fold increase compared with naive heart and
are representative of three separate experiments (Bm123B6 cardiac
allografts). b, Compared with wild-type (WT) CD4.sup.+ T cells,
CD4.sup.+ T cells from BTLA-/- mice had markedly enhanced
proliferative responses to Bm12 APC. Data at 72 h are expressed as
a percentage of live BrdU.sup.+ CD4 cells at each stimulator (S) to
responder (R) ratio (pooled triplicate wells). c, Assessment of
alloactivation induced CD4.sup.+ T cell proliferation at 72 h
induced by irradiated Bm12 APC; the percentage of dividing
CD4.sup.+ T cells was determined by CFSE dilution. d, Markedly
increased proliferation of CFSE-labeled BTLA-/- CD4.sup.+ T cells
72 h after transfer into irradiated Bm12 hosts. Data are
representative of two experiments with similar results. e,
Marginally increased proliferation of CFSE-labeled BTLA-/-
CD8.sup.+ T cells 72 h after transfer into irradiated Bm12 hosts.
Data are representative of two experiments with similar results. f,
Significantly increased responder frequency in BTLA-/- recipients
of class II-mismatched cardiac allografts, as shown by harvesting
of recipient spleens 10 days after transplant and stimulation of
recipient splenocytes in vitro with irradiated Bm12 (p<0.001 at
all ratios) or B6 DC (syngeneic control) for 24 h. Donor-specific
responder frequency was expressed as the number of IFN-y
spot-forming cells (SFC) per 1.times.10.sup.6 splenocytes, and data
(mean.+-.SD) are representative of two experiments.
[0234] FIG. 31 shows graphs and photographic images demonstrating
that BTLA targeting prolongs survival of fully MHC-mismatched
cardiac allografts. Targeting of BTLA significantly prolonged
BALB/c cardiac allograft in fully allogeneic B6 recipients, as
shown using BTLA-/recipients (a) and anti-BTLA mAb in wild-type
(WT) mice (b). c, In addition, a subtherapeutic course of rapamycin
(RPM; 10 .mu.g/kg/day, i.p., for 14 days) significantly prolonged
cardiac allograft survival compared with either identically treated
WT mice or BTLA-/- controls. Allograft survival data in a-c were
obtained from six to eight transplants per group. d, BALB/c hearts
transplanted to WT or BTLA-/- B6 mice were harvested 7 days after
transplant for qPCR. Data from three allografts per group are
expressed as the fold increase compared with native heart. e,
Western blots of CXCR3 and IP-10 proteins, using extracts of three
allografts per group. The effects of targeting BTLA, alone or in
combination with low dose RPM, on allogeneic T cell proliferation
and cytokine production were determined by adoptive transfer of
CFSE-labeled splenocytes from WT or BTLA-/- mice to B6D2F1 hosts,
and recipient spleens were harvested at 72 h. The responses of
donor T cells were identified by gating on Kd-Dd-cells. Data are
shown as an overlay of CFSE histograms (f) and analysis of
intracellular cytokine production (g). The figure in each box is
the percentage of the indicated population, and data are
representative of two experiments with similar results.
[0235] FIG. 32 shows graphs illustrating the dominant role of PD-1
in regulating the survival of fully MHC-mismatched cardiac
allografts. a, Dual PD-1/BTLA-/- (DKO) recipients rejected fully
MHC-disparate allografts at the same speed as wildtype (WT)
recipients. b, Neutralization of PD-1 in BTLA-/- recipients
reversed the prolongation of survival seen in BTLA-/- mice
(p<0.001). c, The dominant role of PD-1 was also seen by the
quick rejection of allografts in DKO mice, despite therapy with
rapamycin (RPM; 10 .mu.g/kg/day, i.p., for 14 days), in marked
contrast to the prolonged survival in BTLA-/- recipients treated
with the same dose of RPM (p<0.001). d, The key contribution of
PD-1, but not BTLA, in promoting the survival of fully MHC
mismatched cardiac allografts in RPM-treated recipients was
confirmed by the rapid onset of acute rejection in BTLA-/-
recipients treated with anti-PD-1 mAb (p<0.001).
[0236] FIG. 33 shows plots that demonstrate increased PD-1
expression and function by alloreactive T cells of BTLA-/-
recipients of fully MHC-mismatched cardiac allografts. a,
Intragraft mRNA expression of BTLA, PD-1, and ligands was
determined by qPCR. Data are expressed as the fold increase
compared with naive heart and are representative of three separate
experiments (BALB/c3B6 cardiac allografts). b, PD-1 expression by
alloreactive T cells determined by adoptive transfer of
CFSE-labeled wild-type (WT) or BTLA-/- splenocytes to irradiated
Bm12 or B6D2F1 hosts, with or without added rapamycin (RPM; 0.01
mg/kg, i.p., for 3 days). Figures indicate the percentages of PD-1
cells in the divided and undivided donor T cell populations. c,
Increased proliferation of CFSE-labeled T cells from DKO mice or
PD-1-/mice vs WT or BTLA-/- controls after adoptive transfer to F1
hosts, with or without RPM therapy. Analysis of corresponding
intracellular cytokine production by the groups shown in c was
undertaken, alone (d) or in conjunction with RPM therapy (e). Cells
were stained with KdPE and CD4- or CD8-PerCP, and IL-2 or IFN-y
APCs and donor cells were identified as the KdDd-population; the
percentage of each indicated population is shown.
[0237] FIG. 34 shows graphs illustrating that as the strength of T
cell signaling increases, PD-1 induction predominates over that of
BTLA. Increasing T cell activation by mature fully allogeneic
BALB/c bone marrow-derived DC leads to increasing expression of
PD-1, rather than BTLA, by C57BL/6 CD4 and CD8 T cells, as shown by
flow cytometric analysis of cells cultured at varying stimulator
(S) to responder (R) ratios for 72 h. Data are representative of
three such experiments.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0238] As used herein, the term "HVEM CRD1 domain" refers to the
CRD1 domain of an HVEM protein. An HVEM CRD1 domain binds to a BTLA
Ig domain, and can be specifically bound by a preferred HVEM
antibody disclosed herein. The HVEM CRD1 domain does not include
the CRD2 or CRD3 domains of the HVEM protein. A preferred CRD1
domain is that set forth by residues 41-76 of the human HVEM
protein sequence at Genbank accession no. AAB58354.1 (SEQ ID NO:6).
See Montgomery et al., Cell, 87:427-436, 1996. Other preferred CRD1
domains are those having at least about 80%, 85%, 90% or 95%
identity to the sequence set forth by residues 41-76 of the human
HVEM protein sequence at Genbank accession no. AAB58354.1 (SEQ ID
NO:6). Another preferred CRD1 domain is that set forth by residues
3980 of the murine HVEM protein sequence at Genbank accession no.
AAQ08183.1 (SEQ ID NO:7). Other preferred CRD 1 domains are those
having at least about 80%, 85%, 90% or 95% identity to the sequence
set forth by residues 39-80 of the murine HVEM protein sequence at
Genbank accession no. AAQ08183.1 (SEQ ID NO:7).
[0239] As used herein, the term "HVEM CRD1 domain peptide" refers
to a peptide corresponding in sequence to a region of the CRD1
domain of HVEM, which peptide can bind to the Ig domain of BTLA. An
HVEM CRD1 domain peptide is capable of reducing the binding of the
HVEM CRD1 domain to the BTLA Ig domain, and is a BTLA-HVEM
antagonist.
[0240] As used herein, the term "BTLA Ig domain" refers to the
portion of a BTLA protein corresponding to the portion of BTLA that
has been used to identify the HVEM-BTLA interaction. In particular,
the BTLA Ig domain, as used herein, comprises an immunogloublin
domain. Further, as compared to the BTLA sequence of C57BL/6 mouse,
as found at Genbank accession no. NP 808252.1 (SEQ ID NO:1), the
BTLA Ig domain corresponds to amino acids 30-166. Further, as
compared to the human BTLA sequence found at Genbank accession no.
AAP44003.1 (SEQ ID NO:2), the BTLA Ig domain corresponds to amino
acids 31-149. A BTLA Ig domain binds to an HVEM CRD1 domain.
Further, a fragment of a BTLA Ig domain binds to an HVEM CRD1
domain, and can be specifically bound by a preferred BTLA antibody
disclosed herein. Some preferred BTLA Ig domains comprise a
cysteine residue corresponding to residue C85 of the murine BL/6
BTLA isoform (SEQ ID NO:1), which corresponds to residue C79 of the
human BTLA isoform found at Genbank accession no. AAP44003.1 (SEQ
ID NO:2).
[0241] As used herein, the term "BTLA Ig domain peptide" refers to
a peptide corresponding in sequence to a region of the Ig domain of
BTLA, which peptide can bind to the CRD1 domain of HVEM and is
capable of reducing the binding of the BTLA Ig domain to the HVEM
CRD1 domain. Such peptides are BTLA-HVEM antagonists.
[0242] As used herein, the term "HVEM blocking antibody" refers to
an antibody that specifically binds to HVEM and reduces binding of
HVEM to BTLA. Preferred HVEM blocking antibodies bind to the CRD1
domain, more preferably to a segment thereof that binds to the Ig
domain of BTLA.
[0243] As used herein, the term "BTLA blocking antibody" refers to
an antibody that specifically binds to BTLA and reduces binding
BTLA to HVEM. Preferred BTLA blocking antibodies bind to the Ig
domain of BTLA, preferably to a segment thereof that binds to the
HVEM CRD1 domain.
[0244] As used herein, the term "BTLA-HVEM antagonist" refers to a
bioactive agent capable of reducing BTLA activity in a cell having
BTLA on its surface. Preferred BTLA-HVEM antagonists are capable of
reducing the binding of HVEM on the surface of a cell to BTLA on
the surface of the same or a second cell. In some preferred
embodiments, BTLA-HVEM antagonists are capable of binding to the
BTLA Ig domain. Binding of a BTLA-HVEM antagonist to BTLA on the
surface of a cell does not increase BTLA activity in the cell.
[0245] As used herein, the term "BTLA-HVEM agonist" refers to a
bioactive agent capable of increasing BTLA activity in a cell
having BTLA on its surface, thereby mimicking the action of HVEM on
BTLA. Preferred BTLA-HVEM agonists are capable of reducing the
binding of HVEM on the surface of a cell to BTLA on the surface of
the same or a second cell.
[0246] Both HVEM and BTLA are synthesized and inserted into the
plasma membrane as transmembrane proteins, and thereby expose
respective extracellular domains. The phrase "on the surface of a
cell" in respect of BTLA or HVEM refers to non-soluble BTLA and
HVEM protein localized at the plasma membrane.
[0247] As used herein, the term "antagonistic HVEM antibody" refers
to an antibody that specifically binds to HVEM and can reduce the
ability of HVEM to increase BTLA activity in a cell having BTLA on
its surface.
[0248] As used herein, the term "antagonistic BTLA antibody" refers
to an antibody that specifically binds to BTLA and can reduce the
ability of HVEM to increase BTLA activity in a cell having BTLA on
its surface. Binding of an antagonistic BTLA antibody to BTLA on
the surface of a cell does not increase BTLA activity in the
cell.
[0249] As used herein, the term "agonistic BTLA antibody' refers to
an antibody that specifically binds to BTLA, is capable of reducing
the binding of HVEM to BTLA, and increases BTLA activity in a cell
having BTLA on its surface.
[0250] By "BTLA activity" and variations thereof is meant
intracellular signaling and the effects thereof, caused by the
binding of BTLA on the surface of a cell by a BTLA agonist, e.g.,
HVEM on the surface of a second cell; CMV UL144. BTLA activity
includes but is not limited to inhibition of lymphocyte activation;
phosphorylation of BTLA intracellular domain tyrosine residues,
particularly those in the Grb2 binding site, the immunoreceptor
tyrosine-based inhibitory motif (ITIM), and/or the immunoreceptor
tyrosine-based switch motif (ITSM); binding of BTLA to SHP-1 and/or
SHP-2; activation of SHP-1 and/or SHP-2; binding of BTLA to Grb2;
and binding of BTLA to p85 of PI3K.
[0251] By "modulating BTLA activity" is meant increasing or
decreasing BTLA activity, which includes completely decreasing BTLA
activity such that no BTLA activity is detectable.
[0252] As used herein, the term "lymphocyte activation" refers to
the processes attendant B cell and T cell activation in primary or
subsequent immune responses, which processes include but are not
limited to cell proliferation, differentiation, migration, and
survival, as well as effector activities exhibited by B cells and T
cells such as, but not limited to, cytokine production, antibody
production, Fas ligand production, chemokine production, granzyme
production and release, and antigen presentation. Accordingly, as
used herein, modulation of lymphocyte activation includes
modulation of effector function, such as modulation of the
termination of effector function, etc. Numerous assays are well
known to the skilled artisan for detecting and/or monitoring such
processes.
[0253] By "modulating lymphocyte activation" is meant increasing or
decreasing lymphocyte activation, which includes decreasing
lymphocyte activation such that no lymphocyte activation is
detectable.
[0254] Decreasing", "reducing", "inhibiting", and grammatical
equivalents thereof are used interchangeably herein and refer to
reductions in levels of binding, activity, etc., which include
reductions to levels beyond detection, including complete
inhibition. Reduced binding can be effected, for example, by
competitive binding of an antagonist.
[0255] As used herein, the term "immune response" includes T and/or
B cell responses, i.e., cellular and/or humoral immune
responses.
[0256] By "inhibiting tumor growth" is meant maintaining or
reducing the tumor burden of an animal having an extant tumor,
which includes eradicating the tumor. Even though the tumor burden
is maintained or reduced, cancer cell proliferation may be
ongoing.
[0257] As used herein, "human antibodies" includes humanized
antibodies.
[0258] It will be evident herein that the use of "BTLA" and "HVEM"
refers to BTLA protein and HVEM protein in many instances.
[0259] In some embodiments herein, CRD1 domains, and BTLA Ig
domains are identified by their percent identity to a particular
CRD1 or BTLA sequence. As is known in the art, a number of
different programs can be used to identify whether a protein or
nucleic acid has sequence identity or similarity to a known
sequence. For a detailed discussion, see D. Mount, Bioinformatics,
Cold Spring Harbor Press, Cold Spring Harbor, N.Y., 2001, ISBN
0-87969-608-7. Sequence identity and/or similarity is determined
using standard techniques known in the art, including, but not
limited to, the local sequence identity algorithm of Smith &
Waterman, Adv. Appl. Math. 2:482 (1981), by the sequence identity
alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443
(1970), by the search for similarity method of Pearson &
Lipman, PNAS USA 85:2444 (1988), by computerized implementations of
these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin
Genetics Software Package, Genetics Computer Group, 575 Science
Drive, Madison, Wis.), the Best Fit sequence program described by
Devereux et al., Nucl. Acid Res. 12:387-395 (1984), preferably
using the default settings, or by inspection. Preferably, percent
identity is calculated by FastDB based upon the following
parameters: mismatch penalty of 1; gap penalty of 1; gap size
penalty of 0.33; and joining penalty of 30, "Current Methods in
Sequence Comparison and Analysis," Macromolecule Sequencing and
Synthesis, Selected Methods and Applications, pp 127-149 (1988),
Alan R. Liss, Inc.
[0260] An example of a useful algorithm is PILEUP. PILEUP creates a
multiple sequence alignment from a group of related sequences using
progressive, pairwise alignments. It can also plot a tree showing
the clustering relationships used to create the alignment. PILEUP
uses a simplification of the progressive alignment method of Feng
& Doolittle, J. Mol. Evol. 35:351-360 (1987); the method is
similar to that described by HIgG1ns & Sharp CABIOS 5:151-153
(1989). Useful PILEUP parameters including a default gap weight of
3.00, a default gap length weight of 0.10, and weighted end
gaps.
[0261] Another example of a useful algorithm is the BLAST
algorithm, described in Altschul et al., J. Mol. Biol. 215,
403-410, (1990) and Karlin et al., PNAS USA 90:5873-5787 (1993). A
particularly useful BLAST program is the WU-BLAST-2 program which
was obtained from Altschul et al., Methods in Enzymology, 266:
460-480 (1996)]. WU-BLAST-2 uses several search parameters, most of
which are set to the default values. The adjustable parameters are
set with the following values: overlap span=1, overlap
fraction=0.125, word threshold (T)=11. The HSP S and HSP S2
parameters are dynamic values and are established by the program
itself depending upon the composition of the particular sequence
and composition of the particular database against which the
sequence of interest is being searched; however, the values may be
adjusted to increase sensitivity.
[0262] An additional useful algorithm is gapped BLAST as reported
by Altschul et al. Nucleic Acids Res. 25:3389-3402. Gapped BLAST
uses BLOSUM-62 substitution scores; threshold T parameter set to 9;
the two-hit method to trigger ungapped extensions; charges gap
lengths of k a cost of 10+k; Xu set to 16, and Xg set to 40 for
database search stage and to 67 for the output stage of the
algorithms. Gapped alignments are triggered by a score
corresponding to .sup.-22 bits. A percent amino acid sequence
identity value is determined by the number of matching identical
residues divided by the total number of residues of the longer
sequence in the aligned region. The longer sequence is the one
having the most actual residues in the aligned region (gaps
introduced by WU-Blast-2 to maximize the alignment score are
ignored).
[0263] The alignment may include the introduction of gaps in the
sequences to be aligned. In addition, for sequences which contain
either more or fewer amino acids than the protein sequences set
forth in the figures, it is understood that in one embodiment, the
percentage of sequence identity will be determined based on the
number of identical amino acids in relation to the total number of
amino acids. Thus, for example, the percent sequence identity of
sequences shorter than those shown in the figures will be
determined using the number of amino acids in the shorter sequence,
in one embodiment. In percent identity calculations relative weight
is not assigned to various manifestations of sequence variation,
such as, insertions, deletions, substitutions, etc.
[0264] In one embodiment, only identities are scored positively
(+1) and all forms of Sequence variation including gaps are
assigned a value of 0, which obviates the need for a weighted scale
or parameters as described below for sequence similarity
calculations. Percent sequence identity can be calculated, for
example, by dividing the number of matching identical residues by
the total number of residues of the shorter sequence in the aligned
region and multiplying by 100. The longer sequence is the one
having the most actual residues in the aligned region.
[0265] In a similar manner, percent (%) nucleic acid sequence
identity is defined as the percentage of nucleotide residues in a
candidate sequence that are identical with the nucleotide residues
in the B7x nucleic acid set forth in FIG. 2 or 4, or a BTLA nucleic
acid sequence encoding a BTLA amino acid sequence set forth in FIG.
19. A preferred method utilizes the BLASTN module of WU-BLAST2 set
to the default parameters, with overlap span and overlap fraction
set to 1 and 0.125, respectively.
(a) BTLA Antibodies and HVEM Antibodies
Antibody Structure
[0266] The basic antibody structural unit is known to comprise a
tetramer. Each tetramer is composed of two identical pairs of
polypeptide chains, each pair having one "light" (about 25 kDa) and
one "heavy" chain (about 50-70 kDa). The amino-terminal portion of
each chain includes a variable region of about 100 to 110 or more
amino acids primarily responsible for antigen recognition. The
carboxy-terminal portion of each chain defines a constant region
primarily responsible for effector function. Human light chains are
classified as kappa and lambda light chains. Heavy chains are
classified as mu, delta, gamma, alpha, or epsilon, and define the
antibody's isotype as IgM, IgD, IgG, IgA, and IgE, respectively.
Within light and heavy chains, the variable and constant regions
are joined by a "J" region of about 12 or more amino acids, with
the heavy chain also including a "D" region of about 10 more amino
acids. See generally, Fundamental Immunology Ch. 7 (Paul, W., ed.,
2nd ed. Raven Press, N.Y. (1989)) (incorporated by reference in its
entirety for all purposes). The variable regions of each
light/heavy chain pair form the antibody binding site.
[0267] Thus, an intact IgG antibody has two binding sites. Except
in bifunctional or bispecific antibodies, the two binding sites are
the same.
[0268] The chains all exhibit the same general structure of
relatively conserved framework regions (FR) joined by three hyper
variable regions, also called complementarity determining regions
or CDRs. The CDRs from the two chains of each pair are aligned by
the framework regions, enabling binding to a specific epitope. From
N-terminal to C-terminal, both light and heavy chains comprise the
domains FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4. The assignment of
amino acids to each domain is in accordance with the definitions of
Kabat Sequences of Proteins of Immunological Interest (National
Institutes of Health, Bethesda, Md. (1987 and 1991)), or Chothia
& Lesk J. Mol. Biol. 196:901-917 (1987); Chothia et al. Nature
342:878-883 (1989).
[0269] A bispecific or bifunctional antibody is an artificial
hybrid antibody having two different heavy/light chain pairs and
two different binding sites. Bispecific antibodies can be produced
by a variety of methods including fusion of hybridomas or linking
of Fab' fragments. See, e.g., Songsivilai & Lachmann Clin. Exp.
Immunol. 79: 315-321 (1990), Kostelny et al. J. Immunol.
148:1547-1553 (1992). In addition, bispecific antibodies may be
formed as "diabodies" (Holliger et al. "`Diabodies`: small bivalent
and bispecific antibody fragments" PNAS USA 90:6444-6448 (1993)) or
"Janusins" (Traunecker et al. "Bispecific single chain molecules
(Janusins) target cytotoxic lymphocytes on HIV infected cells" EMBO
J 10:3655-3659 (1991) and Traunecker et al. "Janusin: new molecular
design for bispecific reagents" Int J Cancer Suppl 7:51-52 (1992)).
Production of bispecific antibodies can be a relatively labor
intensive process compared with production of conventional
antibodies and yields and degree of purity are generally lower for
bispecific antibodies. Bispecific antibodies do not exist in the
form of fragments having a single binding site (e.g., Fab, Fab',
and Fv).
Human Antibodies and Humanization of Antibodies
[0270] Human antibodies avoid certain of the problems associated
with antibodies that possess murine or rat variable and/or constant
regions. The presence of such murine or rat derived proteins can
lead to the rapid clearance of the antibodies or can lead to the
generation of an immune response against the antibody by a patient.
In order to avoid the utilization of murine or rat derived
antibodies, it has been postulated that one can develop humanized
antibodies or generate fully human antibodies through the
introduction of human antibody function into a rodent so that the
rodent would produce antibodies having fully human sequences.
Human Antibodies
[0271] Introduction of human immunoglobulin (Ig) loci into mice in
which the endogenous Ig genes have been inactivated provides an
ideal source for production of fully human monoclonal antibodies
(Mabs). Fully human antibodies are expected to minimize the
immunogenic and allergic responses intrinsic to mouse or
mouse-derivatized Mabs and thus to increase the efficacy and safety
of the administered antibodies. The use of fully human antibodies
can be expected to provide a substantial advantage in the treatment
of chronic and recurring human diseases, such as cancer, which may
require repeated antibody administrations.
[0272] Mouse strains have been engineered with large fragments of
the human Ig loci and to produce human antibodies in the absence of
mouse antibodies.
[0273] See Green et al. Nature Genetics 7:13-21 (1994). The
XenoMouse.TM. strains were engineered with yeast artificial
chromosomes (YACs) containing 245 kb and 190 kb-sized germline
configuration fragments of the human heavy chain locus and kappa
light chain locus, respectively, which contained core variable and
constant region sequences. Further reported work involved the
introduction of greater than approximately 80% of the human
antibody repertoire through introduction of megabase sized,
germline configuration YAC fragments of the human heavy chain loci
and kappa light chain loci, respectively, to produce XenoMouse.TM.
mice. See Mendez et al. Nature Genetics 15:146-156 (1997), Green
and Jakobovits J. Exp. Med. 188:483-495 (1998), the disclosures of
which are hereby incorporated by reference.
[0274] Such approaches are further discussed and delineated in
European Patent No., EP 0 463 151 B1, grant published Jun. 12,
1996, International Patent Application No., WO 94/02602, published
Feb. 3, 1994, International Patent Application No., WO 96/34096,
published Oct. 31, 1996, and WO 98/24893, published Jun. 11, 1998.
The disclosures of each of the above-cited patents, applications,
and references are hereby incorporated by reference in their
entirety.
[0275] In an alternative approach, others have utilized a
"minilocus" approach. In the minilocus approach, an exogenous Ig
locus is mimicked through the inclusion of pieces (individual
genes) from the Ig locus. Thus, one or more VH genes, one or more
DH genes, one or more JH genes, a p constant region, and a second
constant region (preferably a gamma constant region) are formed
into a construct for insertion into an animal. This approach is
described in U.S. Pat. No. 5,545,807 to Surani et al. and U.S. Pat.
Nos. 5,545,806, 5,625,825, 5,625,126, 5,633,425, 5,661,016,
5,770,429, 5,789,650, and 5,814,318 each to Lonberg and Kay, U.S.
Pat. No. 5,591,669 to Krimpenfort and Berns, U.S. Pat. Nos.
5,612,205, 5,721,367, 5,789,215 to Berns et al., and U.S. Pat. No.
5,643,763 to Choi and Dunn. See also European Patent No. 0 546 073
B1, International Patent Application Nos. WO 92/03918, WO 92/22645,
WO 92/22647, WO 92/22670, WO 93/12227, WO 94/00569, WO 94/25585, WO
96/14436, WO 97/13852, and WO 98/24884, the disclosures of which
are hereby incorporated by reference in their entirety. See further
Taylor et al., Nucleic Acids Research 20:62876295 (1992); Chen et
al. International Immunology 5:647-656 (1993); Tuaillon et al.,
Proc. Natl. Acad. Sci. USA 90:3720-3724 (1993); Choi et al., Nature
Genetics 4:117-123 (1993); Lonberg et al., Nature 368:856-859
(1994); Taylor et al., International Immunology 6:579-59.1 (1994);
Tuaillon et al., J. Immunol. 154:6453-6465 (1995); Fishwild et al.,
Nature Biotech. 14:845-851(1996); the disclosures of which are
hereby incorporated by reference in their entirety.
[0276] BTLA and HVEM proteins and fragments thereof, HVEM CRD1
domain peptides, BTLA Ig domain peptides, BTLA fusion proteins, and
HVEM fusion proteins may be used to generate BTLA antibodies and
HVEM antibodies of the present invention.
[0277] The term "antibody" as used herein includes both monoclonal
and polyclonal antibodies as well as antibody fragments, as are
known in the art, including Fab, F(ab).sub.2, single chain
antibodies (Fv for example), chimeric antibodies, humanized
antibodies, etc., either produced by the modification of whole
antibodies or those synthesized de novo using recombinant DNA
technologies. Antibody fragments include those portions of the
antibody that bind to an HVEM CRD1 domain or a BTLA Ig domain.
[0278] Preferably, when a BTLA or HVEM protein fragment is to be
used as an immunogen to generate antibodies, the fragment must
share at least one epitope or determinant with the full length
protein, particularly in an HVEM CRD1 domain or a BTLA Ig domain.
By epitope or determinant herein is meant a portion of a protein
which will generate and/or bind an antibody. Thus, in most
instances, antibodies made to a smaller or truncated BTLA or HVEM
protein will be able to bind to the corresponding full length
protein. In a preferred embodiment, the epitope is unique; that is,
antibodies generated to a unique epitope show little or no
cross-reactivity.
[0279] In one embodiment, the invention provides antagonistic BTLA
antibodies that are capable of reducing, including eliminating, one
or more biological functions of the BTLA protein expressed at the
surface of a cell. That is, the addition of an antagonistic BTLA
antibody (polyclonal, or preferably monoclonal) to a cell
expressing BTLA at its surface can reduce or eliminate at least one
BTLA activity. BTLA activity includes but is not limited to the
inhibition of lymphocyte activation; phosphorylation of tyrosine
residues in the Grb2 binding site, the ITIM, or the ITSM; binding
to SHP-1 and/or SHP-2; and activation of SHP-1 and/or SHP-2. The
reduction of BTLA activity is observed in the presence of BTLA
agonist (eg. HVEM on the surface of a second cell) which stimulates
BTLA activity in the absence of an antagonistic BTLA antibody. In a
preferred embodiment, such an antagonistic BTLA antibody interferes
with the binding of HVEM on the surface of one cell to BTLA on the
surface of a second cell.
[0280] Generally, at least a 25% decrease in BTLA activity is
preferred, with at least about 50% being particularly preferred and
about a 95-100% decrease being especially preferred.
[0281] Such antagonistic BTLA antibodies are sometimes referred to
herein as function-blocking antibodies. Such antibodies have the
ability to increase B and T lymphocyte activation by decreasing
BTLA activity in lymphocytes. Further, such antibodies have the
ability to modulate immunoglobulin production by B cells expressing
BTLA, and more particularly, to increase immunoglobulin
production.
[0282] In an alternative embodiment, the invention provides
agonistic BTLA antibodies that increase or potentiate one or more
biological functions of the BTLA protein expressed at the surface
of a cell. That is, the addition of an agonistic BTLA antibody
(polyclonal, or preferably monoclonal) to a cell expressing BTLA at
its surface will increase or potentiate at least one BTLA activity.
BTLA activity includes but is not limited to the inhibition of
lymphocyte activation; phosphorylation of tyrosine residues in the
Grb2 binding site, the ITIM, or the ITSM; binding to SHP-1 and/or
SHP-2; and activation of SHP-1 and/or SHP-2.
[0283] In a preferred embodiment, the agonistic BTLA antibodies are
function-activating antibodies. Such antibodies have the ability to
decrease B and T lymphocyte activation by increasing BTLA activity
in lymphocytes. Further, such antibodies have the ability to
modulate immunoglobulin production by B cells expressing BTLA, and
more particularly, to decrease immunoglobulin production.
[0284] A BTLA antibody of the invention specifically binds to the
BTLA Ig domain of a BTLA protein. By "specifically bind" herein is
meant that the antibodies bind to the protein with a binding
constant in the range of at least 10.sup.-4-10.sup.-6 M.sup.-1,
with a preferred range being 10.sup.-7-10.sup.-9 M.sup.-1.
[0285] The BTLA proteins bound by BTLA antibodies may be human BTLA
proteins, murine BTLA proteins, or other, preferably mammalian,
BTLA proteins. In a preferred embodiment, the BTLA protein is a
human BTLA protein.
[0286] The murine BTLA gene is polymorphic, and variations in
sequence within the Ig domain that binds to murine HVEM are
described herein in the figures. Despite their sequence variation,
the murine BTLA Ig domains are each capable of binding to murine
HVEM, and a number of BTLA blocking antibodies are capable of
binding to multiple isoforms of murine BTLA.
[0287] The human BTLA gene is also polymorphic, as disclosed in
U.S. application Ser. No. 10/600,997, expressly incorporated herein
in its entirety by reference. As disclosed herein, human HVEM is
capable of binding to human BTLA. It is within the skill of the
artisan to determine if alternative alleles of human BTLA are
capable of binding to HVEM. As used herein, the term "BTLA"
includes any human isoform of BTLA that is capable of binding to
HVEM.
[0288] In a preferred embodiment, the present invention provides
monoclonal BTLA antibodies that specifically bind to murine and/or
human BTLA proteins.
[0289] In one embodiment, the invention provides antagonistic HVEM
antibodies that are capable of reducing, including eliminating, the
ability of HVEM protein when expressed at the surface of a cell to
increase BTLA activity in a second cell expressing BTLA at its
surface. BTLA activity includes but is not limited to the
inhibition of lymphocyte activation; phosphorylation of tyrosine
residues in the Grb2 binding site, the ITIM, or the ITSM; binding
to SHP-1 and/or SHP-2; and activation of SHP-1 and/or SHP-2. In a
preferred embodiment, such an antagonistic HVEM antibody interferes
with the binding of HVEM on the surface of one cell to BTLA on the
surface of a second cell.
[0290] Generally, at least a 25% decrease in activity is preferred,
with at least about 50% being particularly preferred and about a
95-100% decrease being especially preferred.
[0291] Such antibodies have the ability to increase B and T
lymphocyte activation by decreasing BTLA activity in lymphocytes.
Further, such antibodies have the ability to modulate
immunoglobulin production by B cells expressing BTLA, and more
particularly, to increase immunoglobulin production.
[0292] The HVEM antibodies of the invention specifically bind to
HVEM CRD1 domains. By "specifically bind" herein is meant that the
antibodies bind to the protein with a binding constant in the range
of at least 10.sup.-4-10.sup.-6 M.sup.-1, with a preferred range
being 10.sup.-7-10.sup.-9 M.sup.-1.
[0293] The HVEM proteins bound by HVEM antibodies may be human HVEM
proteins, murine HVEM proteins, or other, preferably mammalian,
HVEM proteins.
[0294] HVEM protein sequences and encoding nucleic acid sequences
are well known in the art. For example, see Montgomery et al.,
Cell, 87: 427-436, 1996; Kwon et al., Journal of Biological
Chemistry, 272:14272-14276, 1997; Hsu et al., Journal of Biological
Chemistry 272:13471-13474, 1997.
[0295] The term "antibody", as used herein, includes immunoglobulin
molecules comprised of four polypeptide chains, two heavy (H)
chains and two light (L) chains inter-connected by disulfide bonds.
Each heavy chain is comprised of a heavy chain variable region
(abbreviated herein as HCVR or VH) and a heavy chain constant
region. The heavy chain constant region is comprised of three
domains, CHI, CH2 and CH3. Each light chain is comprised of a light
chain variable region (abbreviated herein as LCVR or VL) and a
light chain constant region. The light chain constant region is
comprised of one domain, CL. The VH and VL regions can be further
subdivided into regions of hypervariability, termed complementarity
determining regions (CDR), interspersed with regions that are more
conserved, termed framework regions (FR). Each VH and VL is
composed of three CDRs and four FRs, arranged from amino-terminus
to carboxy-terminus in the following order: FRI, CDR1, FR2, CDR2,
FR3, CDR3, FR4. The phrase "complementary determining region" (CDR)
includes the region of an antibody molecule which comprises the
antigen binding site.
[0296] The antibody may be an IgG such as IgG1, IgG2, IgG3 or IgG4;
or IgM, IgA, IgE or IgD isotype. The constant domain of the
antibody heavy chain may be selected depending upon the effector
function desired. The light chain constant domain may be a kappa or
lambda constant domain.
[0297] The term "antibody" as used herein also encompasses antibody
fragments, and in particular, fragments that retain the ability to
specifically bind to an antigen. It has been shown that the
antigen-binding function of an antibody can be performed by
fragments of a full-length antibody. Examples of such binding
fragments include (i) a Fab fragment, a monovalent fragment
consisting of the VL, VH, CL and CHI domains; (ii) a F(ab').sub.2
fragment, a bivalent fragment comprising two Fab fragments linked
by a disulfide bridge at the hinge region; (iii) a Fd fragment
consisting of the VH and CHI domains; (iv) a Fv fragment consisting
of the VL and VH domains of a single arm of an antibody, (v) a dAb
fragment (Ward et al., (1989) Nature 341:544-546), which consists
of a VH domain; and (vi) an isolated complementarity determining
region (CDR). Furthermore, although the two domains of the Fv
fragment, VL and VH, are coded for by separate genes, they can be
joined, using recombinant methods, by a synthetic linker that
enables them to be made as a single protein chain in which the VL
and VH regions pair to form monovalent molecules (known as single
chain Fv (scFv); see e.g., Bird et al. (1988) Science 242:423-426;
and Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883).
Such single chain antibodies are also intended to be encompassed
within the term "antibody." Other forms of single chain antibodies,
such as diabodies are also encompassed. Diabodies are bivalent,
bispecific antibodies in which VH and VL domains are expressed on a
single polypeptide chain, but using a linker that is too short to
allow for pairing between the two domains on the same chain,
thereby forcing the domains to pair with complementary domains of
another chain and creating two antigen binding sites (see e.g.,
Holliger, P., et al. (1993) Proc. Natl. Acad. Sci. USA
90:6444-6448; Poljak, R. J., et al. (1994) Structure
2:1121-1123).
[0298] Still further, an antibody or fragment thereof may be part
of a larger immunoadhesion molecule, formed by covalent or
noncovalent association of the antibody or antibody portion with
one or more other proteins or peptides. Examples of such
immunoadhesion molecules include use of the streptavidin core
region to make a tetrameric scFv molecule (Kipriyanov, S. M., et
al. (1995) Human Antibodies and Hybridomas 6:93-101) and use of a
cysteine residue, a marker peptide and a C-terminal polyhistidine
tag to make bivalent and biotinylated scFv molecules (Kipriyanov,
S. M., et al. (1994) Mol. Immunol. 31:1047-1058). Antibody
portions, such as Fab and F(ab').sub.2 fragments, can be prepared
from whole antibodies using conventional techniques, such as papain
or pepsin digestion, respectively, of whole antibodies. Moreover,
antibodies, antibody fragments and immunoadhesion molecules can be
obtained using standard recombinant DNA techniques, as described
herein.
[0299] Antibodies may be polyclonal or monoclonal; xenogeneic,
allogeneic, or syngeneic; or modified forms thereof, e.g.
humanized, chimeric, etc. Preferably, antibodies of the invention
bind specifically or substantially specifically to an HVEM CRD1
domain or a BTLA Ig domain. The terms "monoclonal antibodies" and
"monoclonal antibody composition", as used herein, refer to a
population of antibody molecules that contain only one species of
an antigen binding site capable of immunoreacting with a particular
epitope of an antigen, whereas the term "polyclonal antibodies" and
"polyclonal antibody composition" refer to a population of antibody
molecules that contain multiple species of antigen binding sites
capable of interacting with a particular antigen. A monoclonal
antibody composition typically displays a single binding affinity
for a particular antigen with which it immunoreacts.
[0300] The antibodies described herein may be humanized antibodies,
e.g., antibodies made by a non-human cell having variable and
constant regions which have been altered to more closely resemble
antibodies that would be made by a human cell. For example, by
altering the non-human antibody amino acid sequence to incorporate
amino acids found in human germline immunoglobulin sequences. The
humanized antibodies of the invention may include amino acid
residues not encoded by human germline immunoglobulin sequences
(e.g., mutations introduced by random or site-specific mutagenesis
in vitro or by somatic mutation in vivo), for example in the CDRs.
Such humanized antibodies may also include antibodies in which CDR
sequences derived from the germline of another mammalian species,
such as a mouse, have been grafted onto human framework
sequences.
[0301] (b) BTLA-binding domain peptides and HVEM-binding domain
peptides
[0302] As used herein, peptide refers to at least two covalently
attached amino acids, which includes proteins, polypeptides, and
oligopeptides. The protein may be made up of naturally occurring
amino acids and peptide bonds, or synthetic peptidomimetic
structures. Thus, "amino acid" or "peptide residue" as used herein
means both naturally occurring and synthetic amino acids. For
example, homo-phenylalanine, citrulline, and norleucine are
considered amino acids for the purposes of the invention. "Amino
acids" also includes imino residues such as proline and
hydroxyproline. The side chains may be either the D- or
L-configuration, or combinations thereof. Although the bond between
each amino acid is typically an amide or peptide bond, it is to be
understood that peptide also includes analogs of peptides in which
one or more peptide linkages are replaced with other than an amide
or peptide linkage, such as a substituted amide linkage, an
isostere of an amide linkage, or a peptide or amide mimetic linkage
(See, for example, Spatola, "Peptide Backbone Modifications," in
Chemistry and Biochemistry of Amino Acids Peptides and Proteins,
Weinstein, Ed., Marcel Dekker, New York (1983); Son et al., J. Med.
Chem. 36:3039-3049 (1993); and Ripka and Rich, Curr. Opin. Chem.
Biol. 2:441-452 (1998)).
[0303] Typically, peptides will generally be less than about 100
amino acids, less that about 50 amino acids, or less than about 20
amino acids.
[0304] A peptide herein is typically an isolated or purified
peptide. As used herein, a peptide is said to be "isolated" or
"purified" when it is substantially free of cellular material or
free of chemical precursors or other chemicals. The peptides of the
present invention can be purified to homogeneity or other degrees
of purity. The level of purification will be based on the intended
use. The phrase "substantially free of chemical precursors or other
chemicals" includes preparations of the peptide in which it is
separated from chemical precursors or other chemicals that are
involved in its synthesis. Preparations of a peptide are
substantially free of precursors in preparation having less than
about 30% (by dry weight) chemical precursors or other chemicals,
less than about 20% chemical precursors or other chemicals, less
than about 10% chemical precursors or other chemicals, or less than
about 5% chemical precursors or other chemicals.
[0305] The peptides of this invention can be made by chemical
synthesis methods which are well known to the ordinarily skilled
artisan. See, for example, Fields et al., Chapter 3 in Synthetic
Peptides: A User's Guide, ed. Grant, W. H. Freeman & Co., New
York, N.Y., 1992, p. 77. Peptides can be synthesized using the
automated Merrifield techniques of solid phase synthesis with the a
NH.sub.2 protected by either t-Boc or Fmoc chemistry using side
chain protected amino acids on, for example, an Applied Biosystems
Peptide Synthesizer Model 430A or 431.
[0306] After complete assembly of the desired peptide, the resin is
treated according to standard procedures to cleave the peptide from
the resin and deblock the functional groups on the amino acid side
chains. The free peptide is purified, for example by HPLC, and
characterized biochemically, for example, by amino acid analysis,
mass spectrometry, and/or by sequencing. Purification and
characterization methods for peptides are well known to those of
ordinary skill in the art.
[0307] Longer synthetic peptides can be synthesized by well-known
recombinant DNA techniques. Many standard manuals on molecular
cloning technology provide detailed protocols to produce the
peptides of the invention by expression of recombinant DNA and RNA.
To construct a gene encoding a peptide of this invention, the amino
acid sequence is reverse translated into a nucleic acid sequence,
preferably using optimized codon usage for the organism in which
the gene will be expressed. Next, a gene encoding the peptide is
made, typically by synthesizing overlapping oligonucleotides which
encode the peptide and necessary regulatory elements. The synthetic
gene is assembled and inserted into the desired expression vector.
Nucleic acids which comprise sequences that encode the peptides of
this invention are also provided. The synthetic gene is inserted
into a suitable cloning vector and recombinants are obtained and
characterized. The peptide is then expressed under conditions
appropriate for the selected expression system and host. The
peptide is purified and characterized by standard methods.
(c) Fusion Proteins
[0308] Variant polypeptides of the present invention may also be
fused to another, heterologous polypeptide or amino acid sequence
to form a chimera. In some embodiments, fusion proteins comprise
fusion partners comprising labels (e.g. autofluorescent proteins,
survival and/or selection proteins), stability and/or purification
sequences, toxins, or any other protein sequences of use.
Additional fusion partners are described below. In some instances,
the fusion partner is not a protein.
[0309] In another embodiment, a polypeptide of the invention is
fused with human serum albumin to improve pharmacokinetics.
[0310] In a further embodiment, a polypeptide of the invention is
fused to a cytotoxic agent. In this method, the polypeptide of the
invention acts to target the cytotoxic agent to cells, resulting in
a reduction in the number of afflicted cells. Cytotoxic agents
include, but are not limited to, diphtheria A chain, exotoxin A
chain, ricin A chain, abrin A chain, curcin, crotin, phenomycin,
enomycin and the like, as well as radiochemicals.
Peptide Tags
[0311] Various tag polypeptides and their respective antibodies are
well known in the art. Epitope tags may be placed at the amino-or
carboxyl-terminus of a polypeptide of the invention to enable
antibody detection. Also, the epitope tag enables a polypeptide of
the invention to be readily purified by affinity purification.
Examples of peptide tags include, but are not limited to,
poly-histidine (poly-His) or poly-histidine-glycine (poly-His-Gly)
tags; the flu HA tag polypeptide [Field et al., Mol. Cell. Biol.
8:2159-2165 (1988)]; the c-myc tag [Evan et al., Molecular and
Cellular Biology, 5:3610-3616 (1985)]; the Herpes Simplex virus
glycoprotein D (gD) tag [Paborsky et al., Protein Engineering,
3(6):547-553 (1990)1 the Flag-peptide [Hopp et al., BioTechnology
6:1204-1210 (1988)]; the KT3 epitope peptide [Martin et al.,
Science 255:192-194 (1992)]; tubulin epitope peptide [Skinner et
al., J. Biol. Chem. 266:15163-15166 (1991)]; and the T7 gene 10
protein peptide tag [Lutz-Freyermuth et al., Proc. Natl. Acad. Sci.
U.S.A. 87:6393-6397 (1990)].
Labels
[0312] In one embodiment, a polypeptide of the invention is
modified by the addition of one or more labels. For example, labels
that may be used are well known in the art and include but are not
limited to biotin, tag and fluorescent labels (e.g. fluorescein).
These labels may be used in various assays as are also well known
in the art to achieve characterization.
(d) Additional BTLA-HVEM Agonists and BTLA-HVEM Antagonists
[0313] It will be appreciated that additional bioactive agents may
be screened for BTLA-HVEM antagonistic activity and BTLA-HVEM
agonistic activity. In a preferred embodiment, candidate bioactive
agents are screened for their ability to reduce binding of BTLA to
HVEM. In another preferred embodiment, candidate bioactive agents
are screened for their ability to reduce BTLA activation by
HVEM.
[0314] The assays preferably utilize human BTLA and human HVEM
proteins, although other BTLA and HVEM proteins may also be
used.
[0315] In a preferred embodiment, the methods comprise combining an
Ig domain of a BTLA protein, or an HVEM binding portion thereof,
with a candidate bioactive agent, and determining the binding of
the candidate agent to the BTLA domain. In another preferred
embodiment, the methods involve combining an HVEM CRD1 domain, or a
BTLA binding portion thereof, with a candidate agent, and
determining the binding of the candidate agent to the HVEM
domain.
[0316] The term "candidate bioactive agent" as used herein
describes any molecule, e.g., protein, small organic molecule,
carbohydrates (including polysaccharides), polynucleotide, lipids,
etc. Generally a plurality of assay mixtures are run in parallel
with different agent concentrations to obtain a differential
response to the various concentrations. Typically, one of these
concentrations serves as a negative control, i.e., at zero
concentration or below the level of detection. In addition,
positive controls, i.e. the use of agents known to bind BTLA or
HVEM may be used.
[0317] Candidate agents encompass numerous chemical classes, though
typically they are organic molecules, preferably small organic
compounds having a molecular weight of more than 100 and less than
about 2,500 daltons, more preferably between 100 and 2000, more
preferably between about 100 and about 1250, more preferably
between about 100 and about 1000, more preferably between about 100
and about 750, more preferably between about 200 and about 500
daltons. Candidate agents comprise functional groups necessary for
structural interaction with proteins, particularly hydrogen
bonding, and typically include at least an amine, carbonyl,
hydroxyl or carboxyl group, preferably at least two of the
functional chemical groups. The candidate agents often comprise
cyclical carbon or heterocyclic structures and/or aromatic or
polyaromatic structures substituted with one or more of the above
functional groups. Candidate agents are also found among
biomolecules including peptides, saccharides, fatty acids,
steroids, purines, pyrimidines, derivatives, structural analogs or
combinations thereof. Particularly preferred are peptides, e.g.,
peptidomimetics. Peptidomimetics can be made as described, e.g., in
WO 98/56401.
[0318] Candidate agents are obtained from a wide variety of sources
including libraries of synthetic or natural compounds. For example,
numerous means are available for random and directed synthesis of a
wide variety of organic compounds and biomolecules, including
expression of randomized oligonucleotides. Alternatively, libraries
of natural compounds in the form of bacterial, fungal, plant and
animal extracts are available or readily produced. Additionally,
natural or synthetically produced libraries and compounds are
readily modified through conventional chemical, physical and
biochemical means. Known pharmacological agents may be subjected to
directed or random chemical modifications, such as acylation,
alkylation, esterification, amidification to produce structural
analogs.
[0319] In a preferred embodiment, the candidate bioactive agents
are organic chemical moieties or small molecule chemical
compositions, a wide variety of which are available in the art.
(e) Additional Therapeutic Agents
[0320] In a further embodiment, the bioactive agents disclosed
herein, including BTLA-HVEM agonists and BTLA-HVEM antagonists,
including antagonistic BTLA antibodies and agonistic BTLA
antibodies, may be advantageously combined with one or more
additional therapeutic agents.
[0321] In one aspect, the BTLA-HVEM antagonists described herein
can be administered in combination with additional immune response
stimulating agents such as, e.g., cytokines as well as various
antigens and vaccine preparations including tumor antigens and
tumor vaccines. In preferred embodiments, such cytokines stimulate
antigen presenting cells, e.g., GM-CSF, M-CSF, G-CSF, IL-3, IL-12,
etc. Additional proteins and/or cytokines known to enhance T cell
proliferation and secretion, such as IL-2, IL-2, B7, anti-CD3 and
anti-CD28 can be employed simultaneously or sequentially with the
BTLA-HVEM antagonists to augment the immune response. The subject
therapy may also be combined with the transfection or transduction
of tumor cells with genes encoding for various cytokines or cell
surface receptors, as is known in the art. See, e.g. Ogasawara et
al. (1993) Cancer Res. 53:3561-8 and Townsend et al. (1993) Science
259:368-370.
[0322] In another aspect, the BTLA-HVEM agonists described herein
can be administered in combination with immunosuppressive agents,
e.g., antibodies against other lymphocyte surface markers (e.g.,
CD40) or against cytokines, other fusion proteins, e.g., CTLA4Ig,
or other immunosuppressive drugs (e.g., cyclosporin A, FK506-like
compounds, rapamycin compounds, or steroids).
[0323] It is further contemplated that methods using BTLA-HVEM
antagonists and BTLA-HVEM agonists may be synergistically combined
with immunotherapies based on modulation of other positive and
negative costimulatory pathways, and with CTLA-4 modulation in
particular. For example, BTLA-HVEM antagonists may be
advantageously combined with CTLA-4 blocking agents as described in
U.S. Pat. Nos. 5,855,887; 5,811,097;and 6,051,227, and
International Publication WO 00/32231. Such CTLA-4 blocking agents
inhibit T cell down-regulation mediated by CTLA-4 interaction with
B7 family members B71 and B72 expressed on lymphoid and dendritic
cells. Similarly, BTLA-HVEM agonists may be advantageously combined
with CTLA-4 mimicking agents such as CTLA-4Ig, which has already
found clinical use as an immunosuppressive agent.
[0324] As used herein the term "rapamycin compound" includes the
neutral tricyclic compound rapamycin, rapamycin derivatives,
rapamycin analogs, and other macrolide compounds which are thought
to have the same mechanism of action as rapamycin (e.g., inhibition
of cytokine function). The language "rapamycin compounds" includes
compounds with structural similarity to rapamycin, e.g., compounds
with a similar macrocyclic structure, which have been modified to
enhance their therapeutic effectiveness. Exemplary Rapamycin
compounds suitable for use in the invention, as well as other
methods in which Rapamycin has been administered are known in the
art (See, e.g. WO 95/22972, WO 95/16691, WO 95/04738, U.S. Pat.
Nos. 6,015,809; 5,989,591; U.S. Pat. Nos. 5,567,709; 5,559,112;
5,530,006; 5,484,790; 5,385,908; 5,202,332; 5,162,333; 5,780,462;
5,120,727).
[0325] The language "FK506-like compounds" includes FK506, and
FK506 derivatives and analogs, e.g., compounds with structural
similarity to FK506, e.g., compounds with a similar macrocyclic
structure which have been modified to enhance their therapeutic
effectiveness. Examples of FK506 like compounds include, for
example, those described in WO 00/01385. Preferably, the language
"rapamycin compound" as used herein does not include FK506-like
compounds.
(f) Administration of Therapeutic Compositions
[0326] The bioactive agents of the present invention are
administered to subjects in a biologically compatible form suitable
for pharmaceutical administration in vivo. By "biologically
compatible form suitable for administration in vivo" is meant a
form of the agent to be administered in which any toxic effects are
outweighed by the therapeutic effects of the agent. The term
subject is intended to include living organisms in which an immune
response can be elicited, e.g., mammals. Examples of subjects
include humans, dogs, cats, mice, rats, and transgenic species
thereof. Administration of a bioactive agent as described herein
can be in any pharmacological form, including a therapeutically
active amount of a BTLA antibody, optionally in combination with an
additional therapeutic agent as described herein, and a
pharmaceutically acceptable carrier. Administration of a
therapeutically effective amount of the therapeutic compositions of
the present invention is defined as an amount effective, at dosages
and for periods of time necessary to achieve the desired
therapeutic result. For example, a therapeutically active amount of
a BTLA antibody may vary according to factors such as the disease
state, age, sex, and weight of the individual, and the ability of
the antibody to elicit a desired response in the individual. A
dosage regime may be adjusted to provide the optimum therapeutic
response. For example, several divided doses may be administered
daily or the dose may be proportionally reduced as indicated by the
exigencies of the therapeutic situation.
[0327] The bioactive agent (e.g., BTLA antibody) may be
administered in a convenient manner such as by injection
(subcutaneous, intravenous, etc.), oral administration, inhalation,
transdermal application, or rectal administration. Depending on the
route of administration, the bioactive agent may be coated in a
material to protect the compound from the action of enzymes, acids
and other natural conditions which may inactivate the compound.
[0328] To administer a bioactive agent comprising a protein, e.g. a
BTLA antibody, by other than parenteral administration, it may be
necessary to coat the protein with, or co-administer the protein
with, a material to prevent its inactivation. A bioactive agent
such as a BTLA antibody may be administered to an individual in an
appropriate carrier, diluent or adjuvant, co-administered with
enzyme inhibitors or in an appropriate carrier such as liposomes.
Pharmaceutically acceptable diluents include saline and aqueous
buffer solutions. Adjuvant is used in its broadest sense and
includes any immune stimulating compound such as interferon.
Exemplary adjuvants include alum, resorcinols, non-ionic
surfactants such as polyoxyethylene oleyl ether and n-hexadecyl
polyethylene ether. Enzyme inhibitors include pancreatic trypsin
inhibitor, dilsopropylfluorophosphate (DEP) and trasylol. Liposomes
include water-in-oil-in-water emulsions as well as conventional
liposomes (Strejan et al., (1984) J. Neuroimmunol 7:27).
[0329] The bioactive agent may also be administered parenterally or
intraperitoneally. Dispersions can also be prepared in glycerol,
liquid polyethylene glycols, and mixtures thereof and in oils.
Under ordinary conditions of storage and use, these preparations
may contain a preservative to prevent the growth of
microorganisms.
[0330] In one embodiment, a pharmaceutical composition suitable for
injectable use includes sterile aqueous solutions (where water
soluble) or dispersions and sterile powders for the extemporaneous
preparation of sterile injectable solutions or dispersion. In all
cases, the composition will preferably be sterile and fluid to the
extent that easy syringability exists. It will preferably be stable
under the conditions of manufacture and storage and must be
preserved against the contaminating action of microorganisms such
as bacteria and fungi. The carrier can be a solvent or dispersion
medium containing, for example, water, ethanol, polyol (for
example, glycerol, propylene glycol, and liquid polyetheylene
glycol, and the like), and suitable mixtures thereof. The proper
fluidity can be maintained, for example, by the use of a coating
such as lecithin, by the maintenance of the required particle size
in the case of dispersion and by the use of surfactants. Prevention
of the action of microorganisms can be achieved by various
antibacterial and antifungal agents, for example, parabens,
chlorobutanol, phenol, asorbic acid, thimerosal, and the like. In
many cases, it will be preferable to include isotonic agents, for
example, sugars, polyalcohols such as manitol, sorbitol, sodium
chloride in the composition. Prolonged absorption of the injectable
compositions can be brought about by including in the composition
an agent which delays absorption, for example, aluminum
monostearate and gelatin.
[0331] Sterile injectable solutions can be prepared by
incorporating one or more bioactive agents, together or separately
with additional immune response stimulating agents or
immunosupressants, in the required amount in an appropriate solvent
with one or a combination of ingredients enumerated above, as
required, followed by filtered sterilization. Generally,
dispersions are prepared by incorporating the bioactive agent into
a sterile vehicle which contains a basic dispersion medium and the
required other ingredients from those enumerated above. In the case
of sterile powders for the preparation of sterile injectable
solutions, the preferred methods of preparation are vacuum drying
and freeze-drying which yields a powder of the active ingredient
plus any additional desired ingredient from a previously
sterile-filtered solution thereof.
[0332] When a bioactive agent comprising a peptide is suitably
protected, as described above, the protein may be orally
administered, for example, with an inert diluent or an assimilable
edible carrier. As used herein "pharmaceutically acceptable
carrier" includes any and all solvents, dispersion media, coatings,
antibacterial and antifungal agents, isotonic and absorption
delaying agents, and the like. The use of such media and agents for
pharmaceutically active substances is well known in the art. Except
insofar as any conventional media or agent is incompatible with the
active compound, use thereof in the therapeutic compositions is
contemplated. Supplementary bioactive agents can also be
incorporated into the compositions.
[0333] It is especially advantageous to formulate parenteral
compositions in dosage unit form for ease of administration and
uniformity of dosage. Dosage unit form as used herein refers to
physically discrete units suited as unitary dosages for the
mammalian subjects to be treated; each unit containing a
predetermined quantity of bioactive agent calculated to produce the
desired therapeutic effect in association with the required
pharmaceutical carrier. The specification for the dosage unit forms
of the invention are dictated by and directly dependent on (a) the
unique characteristics of the bioactive agent(s) and the particular
therapeutic effect to be achieved, and (b) the limitations inherent
in the art of compounding such an agent for the treatment of
sensitivity in individuals.
[0334] The specific dose can be readily calculated by one of
ordinary skill in the art, e.g., according to the approximate body
weight or body surface area of the patient or the volume of body
space to be occupied. The dose will also be calculated dependent
upon the particular route of administration selected. Further
refinement of the calculations necessary to determine the
appropriate dosage for treatment is routinely made by those of
ordinary skill in the art. Such calculations can be made without
undue experimentation by one skilled in the art in light of the
activity disclosed herein in assay preparations of target cells.
Exact dosages are determined in conjunction with standard
dose-response studies. It will be understood that the amount of the
composition actually administered will be determined by a
practitioner, in the light of the relevant circumstances including
the condition or conditions to be treated, the choice of
composition to be administered, the age, weight, and response of
the individual patient, the severity of the patient's symptoms, and
the chosen route of administration.
[0335] The toxicity and therapeutic efficacy of the bioactive
agents described herein can be determined by standard
pharmaceutical procedures in cell cultures or experimental animals,
e.g., for determining the LD50 (the dose lethal to 50% of the
population) and the ED50 (the dose therapeutically effective in 50%
of the population). The dose ratio between toxic and therapeutic
effects is the therapeutic index and it can be expressed as the
ratio LD50/ED50. Compounds which exhibit large therapeutic indices
are preferred. While compounds that exhibit toxic side effects may
be used, care should be taken to design a delivery system that
targets such compounds to the site of affected tissue in order to
minimize potential damage to uninfected cells and, thereby, reduce
side effects.
[0336] The data obtained from the cell culture assays and animal
studies can be used in formulating a range of dosage for use in
humans. The dosage of such agents lies preferably within a range of
circulating concentrations that include the ED50 with little or no
toxicity. The dosage may vary within this range depending upon the
dosage form employed and the route of administration utilized. For
any agent used in the method of the invention, the therapeutically
effective dose can be estimated initially from cell culture assays.
A dose may be formulated in animal models to achieve a circulating
plasma concentration range that includes the IC50 (i.e., the
concentration of the test agent which achieves a half-maximal
inhibition of symptoms) as determined in cell culture. Such
information can be used to more accurately determine useful doses
in humans. Levels in plasma may be measured, for example, by high
performance liquid chromatography.
[0337] In one embodiment of the present invention a therapeutically
effective amount of an antibody to BTLA or HVEM is administered to
a subject. As defined herein, a therapeutically effective amount of
antibody (i.e., an effective dosage) ranges from about 0.001 to 50
mg/kg body weight, preferably about 0.01 to 40 mg/kg body weight,
more preferably about 0.1 to 30 mg/kg body weight, about 1 to 25
mg/kg, 2 to 20 mg/kg, 5 to 15 mg/kg, or 7 to 10 mg/kg body weight.
The optimal dose of the antibody given may even vary in the same
patient depending upon the time at which it is administered.
[0338] The skilled artisan will appreciate that certain factors may
influence the dosage required to effectively treat a subject,
including but not limited to the severity of the disease or
disorder, previous treatments, the general health and/or age of the
subject, and other diseases present. Moreover, treatment of a
subject with a therapeutically effective amount of an antibody can
include a single treatment or, preferably, can include a series of
treatments. In a preferred example, a subject is treated with
antibody in the range of between about 0.1 to 20 mg/kg body weight,
one time per week for between about 1 to 10 weeks, preferably
between 2 to 8 weeks, more preferably between about 3 to 7 weeks,
and even more preferably for about 4, 5, or 6 weeks. It will also
be appreciated that the effective dosage of antibody used for
treatment may increase or decrease over the course of a particular
treatment. Changes in dosage may result from the results of assays
designed to monitor transplant status (e.g., whether rejection or
an immune response in the subject has occurred) as known in the art
or as described herein.
[0339] In one embodiment, a pharmaceutical composition for
injection could be made up to contain 1 ml sterile buffered water,
and 1 to 50 mg of antibody. A typical composition for intravenous
infusion could be made up to contain 250 ml of sterile Ringer's
solution, and 150 mg of antibody. Actual methods for preparing
parenterally administrable compositions will be known or apparent
to those skilled in the art and are described in more detail in,
for example, Remington's Pharmaceutical Science, 15th ed., Mack
Publishing Company, Easton, Pa. (1980), which is incorporated
herein by reference. The compositions comprising the present
antibodies can be administered for prophylactic and/or therapeutic
treatments. In therapeutic application, compositions can be
administered to a patient already suffering from a disease, in an
amount sufficient to cure or at least partially arrest the disease
and its complications. An amount adequate to accomplish this is
defined as a "therapeutically effective dose." Amounts effective
for this use will depend upon the clinical situation and the
general state of the patient's own immune system. For example,
doses for preventing transplant rejection may be lower than those
given if the patient presents with clinical symptoms of rejection.
Single or multiple administrations of the compositions can be
carried out with dose levels and pattern being selected by the
treating physician. In any event, the pharmaceutical formulations
should provide a quantity of the bioactive agents described herein
sufficient to effectively treat the patient.
[0340] Dose administration can be repeated depending upon the
pharmacokinetic parameters of the dosage formulation and the route
of administration used. It is also provided that certain protocols
may allow for one or more agents describe herein to be administered
orally. Such formulations are preferably encapsulated and
formulated with suitable carriers in solid dosage forms. Some
examples of suitable carriers, excipients, and diluents include
lactose, dextrose, sucrose, sorbitol, mannitol, starches, gum
acacia, calcium phosphate, alginates, calcium silicate,
microcrystalline cellulose, olyvinylpyrrolidone, cellulose,
gelatin, syrup, methyl cellulose, methyl- and
propylhydroxybenzoates, talc, magnesium, stearate, water, mineral
oil, and the like. The formulations can additionally include
lubricating agents, wetting agents, emulsifying and suspending
agents, preserving agents, sweetening agents or flavoring agents.
The compositions may be formulated so as to provide rapid,
sustained, or delayed release of the active ingredients after
administration to the patient by employing procedures well known in
the art. The formulations can also contain substances that diminish
proteolytic degradation and/or substances which promote absorption
such as, for example, surface active agents.
[0341] The pharmaceutical compositions can be included in a
container, pack, or dispenser together with instructions for
administration. Kits for practice of the instant invention are also
provided. For example, such a kit comprises a bioactive agent such
as, e.g., an antibody reactive with BTLA or HVEM, together with a
means for administering the antibody conjugate, e.g., one or more
syringes. The kit can come packaged with instructions for use.
(g) Modulation of Immune Responses
[0342] The present invention provides methods for modulating
lymphocyte activity and immune responses to antigens using
BTLA-HVEM antagonists and BTLA-HVEM agonists described herein. The
methods are useful for modulating the activity of, for example,
naive T cells, CD8+ Tc cells, CD4+ cells, T.sub.H1 cells, and B
cells.
[0343] BTLA-HVEM antagonists are used alone or in combination with
other therapeutic agents to reduce the negative costimulatory
signals emitted by BTLA, and to reduce the suppression and/or
attenuation of lymphocyte activity mediated by BTLA signaling.
[0344] BTLA-HVEM agonists are used alone or in combination with
other therapeutic agents to increase negative costimulatory signals
emitted by BTLA, thereby increasing the suppression and/or
attenuation of lymphocyte activity mediated by BTLA signaling.
[0345] In a preferred embodiment, the methods comprise contacting a
lymphocyte expressing BTLA on its surface, or a second cell
expressing HVEM on its surface, or both, with a BTLA-HVEM
antagonist, wherein the lymphocyte and second cell are able to
contact each other such that BTLA on the lymphocyte can bind to
HVEM on the second cell, and wherein the BTLA-HVEM antagonist
reduces the activation of BTLA on the lymphocyte by HVEM on the
second cell.
[0346] In another preferred embodiment, the methods comprise
contacting a lymphocyte expressing BTLA on its surface with a
BTLA-HVEM agonist, such that the BTLA-HVEM agonist increases BTLA
activity in the lymphocyte.
(h) Antigens
[0347] In one aspect, the invention provides methods for modulating
an immune response to antigen. Such antigens can be, for example,
tumor-associated antigens, pathogen antigens, and autoantigens
(self antigens). Antigenic stimulation may be a result of ongoing
malignancy or infection, and/or may be a result of exposure to
antigens delivered by vaccine.
[0348] A wide variety of antigens may find use in the invention. In
particular, the adjuvant compositions provided herein may be
advantageously combined with antigenic stimulation from
tumor-associated antigens or pathogen antigens to increase
lymphocyte activity against the corresponding tumor or pathogen.
Generally, suitable antigens may be derived from proteins,
peptides, polypeptides, lipids, glycolipids, carbohydrates and DNA
found in the subject tumor or pathogen.
[0349] Tumor-associated antigens finding utility herein include
both mutated and non-mutated molecules which may be indicative of a
single tumor type, shared among several types of tumors, and/or
exclusively expressed or over-expressed in tumor cells in
comparison with normal cells. In addition to proteins and
glycoproteins, tumor-specific patterns of expression of
carbohydrates, gangliosides, glycolipids and mucins have also been
documented.
[0350] Exemplary tumor-associated antigens for use in the subject
cancer vaccines include protein products of oncogenes, tumor
suppressor genes and other genes with mutations or rearrangements
unique to tumor cells, reactivated embryonic gene products,
oncofetal antigens, tissue-specific (but not tumor-specific)
differentiation antigens, growth factor receptors, cell surface
carbohydrate residues, foreign viral proteins and a number of other
self proteins.
[0351] Specific embodiments of tumor-associated antigens include,
e.g., mutated antigens such as the protein products of the Ras p21
protooncogenes, tumor suppressor p53 and HER-2/neu and BCR-abl
oncogenes, as well as CDK4, MUM1, Caspase 8, and Beta catenin;
overexpressed antigens such as galectin 4, galectin 9, carbonic
anhydrase, Aldolase A, PRAME, Her2/neu, ErbB-2 and KSA, oncofetal
antigens such as alpha fetoprotein (AFP), human chorionic
gonadotropin (hCG); self antigens such as carcinoembryonic antigen
(CEA) and melanocyte differentiation antigens such as Mart 1/Melan
A, gp100, gp75, Tyrosinase, TRP1 and TRP2; prostate associated
antigens such as PSA, PAP, PSMA, PSM-P1 and PSM-P2; reactivated
embryonic gene products such as MAGE 1, MAGE 3, MAGE 4, GAGE 1,
GAGE 2, BAGE, RAGE, and other cancer testis antigens such as
NYESO1, SSX2 and SCP1; mucins such as Muc-1 and Muc-2; gangliosides
such as GM2, GD2 and GD3, neutral glycolipids and glycoproteins
such as Lewis (y) and globo-H; and glycoproteins such as Tn,
Thompson-Freidenreich antigen (TF) and sTn. Also included as
tumor-associated antigens herein are whole cell and tumor cell
lysates as well as immunogenic portions thereof, as well as
immunoglobulin idiotypes expressed on monoclonal proliferations of
B lymphocytes for use against B cell lymphomas.
[0352] Tumor-associated antigens and their respective tumor cell
targets include, e.g., cytokeratins, particularly cytokeratin 8, 18
and 19, as antigens for carcinoma. Epithelial membrane antigen
(EMA), human embryonic antigen (HEA-125), human milk fat globules,
MBr1, MBr8, Ber-EP4, 17-1A, C26 and T16 are also known carcinoma
antigens. Desmin and muscle-specific actin are antigens of myogenic
sarcomas. Placental alkaline phosphatase, beta-human chorionic
gonadotropin, and alphafetoprotein are antigens of trophoblastic
and germ cell tumors. Prostate specific antigen is an antigen of
prostatic carcinomas, carcinoembryonic antigen of colon
adenocarcinomas. HMB-45 is an antigen of melanomas. In cervical
cancer, useful antigens could be encoded by human papilloma virus.
Chromagranin-A and synaptophysin are antigens of neuroendocrine and
neuroectodermal tumors. Of particular interest are aggressive
tumors that form solid tumor masses having necrotic areas. The
lysis of such necrotic cells is a rich source of antigens for
antigen-presenting cells, and thus the subject compositions and
methods may find advantageous use in conjunction with conventional
chemotherapy and/or radiation therapy.
[0353] Tumor-associated antigens can be prepared by methods well
known in the art. For example, these antigens can be prepared from
cancer cells either by preparing crude extracts of cancer cells
(e.g., as described in Cohen et al., Cancer Res., 54:1055 (1994)),
by partially purifying the antigens, by recombinant technology, or
by de novo synthesis of known antigens. The antigen may also be in
the form of a nucleic acid encoding an antigenic peptide in a form
suitable for expression in a subject and presentation to the immune
system of the immunized subject. Further, the antigen may be a
complete antigen, or it may be a fragment of a complete antigen
comprising at least one epitope.
[0354] Antigens derived from pathogens known to predispose to
certain cancers may also be advantageously utilized in conjunction
with the compositions and methods provided herein. It is estimated
that close to 16% of the worldwide incidence of cancer can be
attributed to infectious pathogens, and a number of common
malignancies are characterized by the expression of specific viral
gene products. Thus, the inclusion of one or more antigens from
pathogens implicated in causing cancer may help broaden the host
immune response and enhance the prophylactic or therapeutic effect
of the cancer vaccine. Pathogens of particular interest for use
herein include the hepatitis B virus (hepatocellular carcinoma),
hepatitis C virus (heptomas), Epstein Barr virus (EBV) (Burkitt
lymphoma, nasopharynx cancer, PTLD in immunosuppressed
individuals), HTLV1 (adult T cell leukemia), oncogenic human
papilloma viruses types 16, 18, 33, 45 (adult cervical cancer), and
the bacterium Helicobacter pylori (B cell gastric lymphoma).
[0355] Also contemplated herein are pathogen antigens derived from
infectious microbes such as virus, bacteria, parasites and fungi
and fragments thereof, in order to increase lymphocyte activity in
response to active infection or improve the efficacy of
prophylactic vaccine therapy. Examples of infectious virus include,
but are not limited to: Retroviridae (e.g. human immunodeficiency
viruses, such as HIV-1 (also referred to as HTLV-III, LAV or
HTLV-III/LAV, or HIV-III; and other isolates, such as HIV-LP;
Picornaviridae (e.g. polio viruses, hepatitis A virus;
enteroviruses, human Coxsackie viruses, rhinoviruses, echoviruses);
Calciviridae (e.g. strains that cause gastroenteritis); Togaviridae
(e.g. equine encephalitis viruses, rubella viruses); Flaviridae
(e.g. dengue viruses, encephalitis viruses, yellow fever viruses);
Coronoviridae (e.g. coronaviruses); Rhabdoviradae (e.g. vesicular
stomatitis viruses, rabies viruses); Coronaviridae (e.g.
coronaviruses); Rhabdoviridae (e.g. vesicular stomatitis viruses,
rabies viruses); Filoviridae (e.g. ebola viruses); Paramyxoviridae
(e.g. parainfluenza viruses, mumps virus, measles virus,
respiratory syncytial virus); Orthomyxoviridae (e.g. influenza
viruses); Bungaviridae (e.g. Hantaan viruses, bunga viruses,
phleboviruses and Nairo viruses); Arena viridae (hemorrhagic fever
viruses); Reoviridae (e.g. reoviruses, orbiviurses and
rotaviruses); Birnaviridae; Hepadnaviridae (Hepatitis B virus);
Parvovirida (parvoviruses); Papovaviridae (papilloma viruses,
polyoma viruses); Adenoviridae (most adenoviruses); Herpesviridae
herpes simplex virus (HSV) 1 and 2, varicella zoster virus,
cytomegalovirus (CMV), herpes virus; Poxviridae (variola viruses,
vaccinia viruses, pox viruses); and Iridoviridae (e.g. African
swine fever virus); and unclassified viruses (e.g. the etiological
agents of Spongiform encephalopathies, the agent of delta hepatitis
(thought to be a defective satellite of hepatitis B virus), the
agents of non-A, non-B hepatitis (class 1=internally transmitted;
class 2=parenterally transmitted (i.e. Hepatitis C); Norwalk and
related viruses, and astroviruses).
[0356] Also, gram negative and gram positive bacteria serve as
antigens in vertebrate animals. Such gram positive bacteria
include, but are not limited to Pasteurella species, Staphylococci
species, and Streptococcus species. Gram negative bacteria include,
but are not limited to, Escherichia coli, Pseudomonas species, and
Salmonella species. Specific examples of infectious bacteria
include but are not limited to: Helicobacterpyloris, Borelia
burgdorferi, Legionella pneumophilia, Mycobacteria sps (e.g. M.
tuberculosis, M. avium, M. intracellulare, M. kansaii, M.
gordonae), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria
meningitidis, Listeria monocytogenes, Streptococcus pyogenes (Group
A Streptococcus), Streptococcus agalactiae (Group B Streptococcus),
Streptococcus (viridans group), Streptococcusfaecalis,
Streptococcus bovis, Streptococcus (anaerobic sps.), Streptococcus
pneumoniae, pathogenic Campylobacter sp., Enterococcus sp.,
Haemophilus infuenzae, Bacillus antracis, corynebacterium
diphtheriae, corynebacterium sp., Erysipelothrix rhusiopathiae,
Clostridium perfringers, Clostridium tetani, Enterobacter
aerogenes, Klebsiella pneumoniae, Pasturella multocida, Bacteroides
sp., Fusobacterium nucleatum, Streptobacillus moniliformis,
Treponema pallidium, Treponema pertenue, Leptospira, Rickettsia,
and Actinomyces israelli.
[0357] Examples of pathogens also include, but are not limited to,
infectious fungi that infect mammals, and more particularly humans.
Examples of infectious fingi include, but are not limited to:
Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides
immitis, Blastomyces dermatitidis, Chlamydia trachomatis, Candida
albicans. Examples of infectious parasites include Plasmodium such
as Plasmodium falciparum, Plasmodium malariae, Plasmodium ovate,
and Plasmodium vivax. Other infectious organisms (i.e. protists)
include Toxoplasma gondii.
[0358] Other medically relevant microorganisms that serve as
antigens in mammals and more particularly humans are described
extensively in the literature, e.g., see C. G. A Thomas, Medical
Microbiology, Bailliere Tindall, Great Britain 1983, the entire
contents of which is hereby incorporated by reference. In addition
to the treatment of infectious human diseases, the compositions and
methods of the present invention are useful for treating infections
of nonhuman mammals. Many vaccines for the treatment of non-human
mammals are disclosed in Bennett, K. Compendium of Veterinary
Products, 3rd ed. North American Compendiums, Inc., 1995.
(i) Treatment of Cancer
[0359] The present invention also provides immunotherapeutic
methods for treating cancer, comprising administering to a patient
a therapeutically effective amount of a BTLA-HVEM antagonist,
either alone or in combination with other therapeutic
compositions.
[0360] In a preferred embodiment, immunization is done to promote a
tumor-specific T cell immune response. In this embodiment, a
BTLA-HVEM antagonist is administered in combination with a
tumor-associated antigen. The combination of a tumor-associated
antigen and a BTLA-HVEM antagonist promotes a tumor specific T cell
response, in which T cells encounter reduced negative costimulatory
signals mediated by BTLA as compared to those in the absence of the
BTLA-HVEM antagonist.
[0361] In one aspect, the present invention provides a medicament
for the treatment of cancer, wherein the medicament comprises a
BTLA-HVEM antagonist. Also provided are methods for making a
medicament useful for the treatment of cancer, which medicament
comprises a BTLA-HVEM antagonist.
(j) Treatment of Autoimmune Disease, Allergy, and Asthma
[0362] The present invention also provides methods for inhibiting
autoimmune responses and treating autoimmune diseases, comprising
administering to a patient a therapeutically effective amount of a
BTLA-HVEM agonist. Without being bound by theory, administration of
a therapeutically effective amount of a BTLA-HVEM agonist inhibits
the activity of autoreactive T and B cells that specifically
recognize autoantigens and otherwise negatively affect the
physiology of cells that bear them.
[0363] Autoimmune disease as used herein includes Rheumatoid
arthritis, type 1 diabetes, autoimmune thyroiditis, and Lupus.
Additional autoimmune diseases are described, for example, in
Mackay et al., NEJM, 345:340-350, 2001.
[0364] In one aspect, the present invention provides a medicament
for the treatment of autoimmune disease, wherein the medicament
comprises a BTLA-HVEM agonist. Also provided are methods for making
a medicament useful for the treatment of autoimmune disease, which
medicament comprises a BTLA-HVEM agonist.
[0365] In another aspect, the invention provides methods for
preventing or reducing an allergic reaction in a patient,
comprising administering to a patient a therapeutically effective
amount of a BTLA-HVEM agonist.
[0366] In one aspect, the present invention provides a medicament
for the treatment or prevention of allergy, wherein the medicament
comprises a BTLA-HVEM agonist. Also provided are methods for making
a medicament useful for the treatment or prevention of allergy,
which medicament comprises a BTLA-HVEM agonist.
[0367] In one aspect, the invention provides methods for reducing
the severity of an asthmatic reaction in a patient, comprising
administering to a patient a therapeutically effective amount of a
BTLA-HVEM antagonist.
[0368] In one aspect, the invention provides methods for shortening
the duration of an asthmatic reaction in a patient, comprising
administering to a patient a therapeutically effective amount of a
BTLA-HVEM antagonist.
[0369] In one aspect, the invention provides methods for improving
recovery from an asthmatic reaction in a patient, comprising
administering to a patient a therapeutically effective amount of a
BTLA-HVEM antagonist.
(k) Increasing Graft Survival
[0370] The present invention also provides methods for inhibiting a
host immune response to transplanted tissue, comprising
administering to a patient receiving transplanted tissue a
therapeutically effective amount of a BTLA-HVEM agonist.
Administration of the therapeutically effective amount of the
BTLA-HVEM agonist inhibits the host immune response to the tissue
and prolongs its survival.
[0371] In one aspect, the present invention provides a medicament
for use as an immunosuppressant, wherein the medicament comprises a
BTLA-HVEM agonist. Also provided are methods for making such a
medicament.
[0372] All references cited herein are expressly incorporated
herein in their entirety by reference.
EXAMPLES
Experimental BTLA Antibodies
[0373] Armenian hamsters and Balb/c BTLA KO mice were immunized
with oxidatively refolded BI/6 BTLA tetramer protein. The ability
of antibody to block binding of BTLA tetramer to HVEM was
determined.
TABLE-US-00001 Clone Isotype Allelic Blocking? Applications 6A6
Hamster IgG BL/6 only Yes FACS, IP 6F7 Mouse IgG1, kappa Balb/c and
Yes FACS, IP, WB BL/6 6G3 Mouse IgG1, kappa Balb/c and Yes FACS, IP
BL/6 6H6 Mouse IgG1, kappa Balb/c and Weak FACS, IP BL/6 8F4 Mouse
IgG1, kappa Balb/c and Yes FACS, IP BL/6 3F9.D12 Mouse IgG1, kappa
Balb/c and Yes FACS, IP BL/6 3F9.C6. Mouse IgG1, kappa BL/6 only No
FACS, IP, WB
[0374] Yeast Display Data: The ability of antibody to bind to BTLA
mutants was determined.+indicates binding.
TABLE-US-00002 Bl/6 BTLA Mutations 6A6 3F9.C6 6G3 6F7 3F9.D12 P41E
+ + + + + T45N + + + + + P41 E, T47K + + + + + P41 E, Q52H + + + +
+ P41 E, + - + + + P41 E, Q63E - + + + + P41 E, +/- + +/- +/- +/-
P41 E, S91G + + + + + P41E, - + + + + P41 E, + + + + + WEHI.2 - - -
- -
(I) BTLA Ligand Binding and BTLA Activation
[0375] B7 molecules bind to MYPPPY motif on CD28 and CTLA4 within
FG loop. For example, PD-L1 and PD-L2 bind to FG loop of PD-1. The
FG loop of BTLA is four amino acids shorter than FG loop in
CD28/CTLA4, and epitope mapping places HVEM interaction towards
`DEBA` face of Ig fold.
BTLA Binds Naive T Cells but Does not Bind B7x
[0376] To test for direct interactions between BTLA and B7x, we
made NIH 3T3 cell lines stably expressing the extracellular domains
of B7x, BTLA, and programmed death 1 (PD-1) and its ligand (PD-L1),
and stained the cells with PD-1 and BTLA tetramers and with PD-L1
and B7x Fc fusion proteins. Whereas PD-1 tetramer bound to cells
expressing PD-L1, as expected, the BTLA tetramer did not bind to
cells expressing PD-L1 or B7x. Furthermore, our B7x-Fc fusion
protein did not bind cells expressing BTLA.
[0377] To identify potential ligands on normal lymphocytes, we next
used a BTLA-Fc fusion protein and BTLA tetramer to stain
splenocytes (FIGS. 1 and 2). As a control, the PD-L1Fc fusion
protein showed selective binding to activated but not resting CD4+
T cells and B220+ B cells (FIG. 1), as expected and consistent with
the reported inducibility of PD-1 expression. Notably, our BTLA-Fc
fusion protein showed specific binding to resting CD4+ and CD8+ T
cells but not to B220+ B cells (FIG. 1). In addition, this binding
was greatly reduced after T cell activation by treatment with
antibody to CD3 (anti-CD3) but was not affected by B cell
activation. As B7x is not reported to be expressed by naive T
cells, the binding of the BTLA-Fc fusion protein to T cells is not
consistent with an interaction with B7x. However, we independently
confirmed that B7x was not expressed by T cells by examining the
expression of B7x and several other CD28-B7 family members. B7x
mRNA was most highly expressed in heart and lung but was absent
from spleen, lymph node and naive CD4+ T cells. In contrast, we
confirmed the expected lymphoid-specific expression pattern for
several CD28- B7 family members, including ICOS, PD-1 and BTLA.
[0378] To confirm and characterize the potential ligand on T cells
identified by the BTLA-Fc fusion protein, we next analyzed the
properties of BTLA tetramers binding to lymphocytes (FIG. 2). The
BTLA tetramer showed strong binding to both CD4+ and CD8+ T cells
obtained from both spleen and lymph nodes and bound weakly to non-T
lymphocytes (FIG. 2a). Furthermore, binding to T cells was reduced
after anti-CD3 stimulation (FIG. 2b), similar to our results
obtained with BTLA-Fc fusion proteins (FIG. 1). In contrast,
treatment of splenocytes with antiimmunoglobulin M (anti-IgM) or
lipopolysaccharide did not reduce BTLA tetramer staining of CD4+ T
cells. BTLA tetramers showed very slight binding to resting and
activated B cells (FIG. 2b). We also examined BTLA tetramer
staining in thymic subsets (FIG. 2c). BTLA tetramer staining was
lowest in CD4+CD8+ (double-positive) thymocytes and showed more
staining in mature CD4+ or CD8+ thymocytes and double- negative
(CD4-CD8-) thymocytes, again indicating some physiological
regulation of the BTLA ligand. As BTLA tetramer binding was
modulated 48 h after anti-CD3 stimulation of T cells, we did a more
detailed kinetic analysis using D011.10 T cells activated in vitro
with ovalbumin (OVA) peptide (FIG. 3). Again, BTLA tetramer binding
was regulated during activation, initially increasing by twofold at
24 and 48 h after antigen-specific stimulation, decreasing on day 3
and day 4, and increasing again by day 7. Expression of this BTLA
ligand was similar in both T helper type 1- and T helper type
2-inducing conditions. Thus, BTLA tetramers and BTLA-Fc fusion
proteins have very similar binding properties to lymphocytes, and a
BTLA ligand is expressed by resting T cells and undergoes
regulation during thymocyte development and T cell activation.
Cloning a BTLA-Interacting Protein
[0379] We constructed a retroviral cDNA library from lymphocytes
and transduced two host cell lines, BJAB and NIH 3T3, that were
negative for BTLA tetramer binding (FIG. 4a). After four successive
rounds of sorting, we obtained lines uniformly positive for BTLA
tetramer staining, which we used to amplify retrovirus-specific
inserts. From BJAB cells, we obtained a predominant RT-PCR product
that we identified as mouse HVEM. From NIH 3T3 cells we also
obtained mouse HVEM as the main component of RT-PCR isolates. Among
the minor retroviral inserts identified from NIH 3T3 cells, 4-1 BB
was the only transmembrane receptor; it also belongs to the TNFR
superfamily.
[0380] We next tested these isolates as candidates for direct
interactions with BTLA tetramers. We expressed full-length cDNA
clones of mouse HVEM, human HVEM, mouse 4-1 BB and mouse LTI3R,
which binds the same ligands (LIGHT and LT.alpha.) as HVEM, in BJAB
cells and analyzed these cells for binding to BTLA tetramers. We
specifically constructed BTLA tetramers from both the C57BL/6 and
BALB/c alleles to identify any potential allelic differences in
binding (FIG. 4b). We found specific binding of both forms of BTLA
tetramers to green fluorescent protein (GFP)-positive BJAB cells
expressing mouse HVEM but not to BJAB cells expressing human HVEM,
mouse 4-1 BB or mouse LTI3R or to GFP-negative uninfected BJAB
cells.
HVEM Induces BTLA Phosphotylation
[0381] We next sought to determine if HVEM could induce BTLA
phosphorylation (FIGS. 4c, d). We analyzed BTLA phosphorylation in
EL4 cells using immunoprecipitation immunoblot analysis as
described above. EL4 cells had low expression of BTLA but no
detectable HVEM, as assessed by BTLA tetramer binding. We therefore
examined EL4 cells for BTLA phosphorylation and SHP-2
coimmunoprecipitation after contact with mouse HVEM expressed by
BJAB cells. EL4 cells alone showed neither coimmunoprecipitation of
SHP-2 with BTLA (FIG. 4c) nor direct tyrosine phosphorylation of
BTLA (FIG. 4d). Mixing of EL4 cells with HVEM-expressing BJAB cells
induced both coimmunoprecipitation of SHP-2 with BTLA and tyrosine
phosphorylation of BTLA. In contrast, mixing EL4 cells with HVEM
negative BJAB cells induced neither coimmunoprecipitation of SHP-2
with BTLA nor BTLA phosphorylation. As controls, pervanadate
treatment of EL-4 cells induced coimmunoprecipitation of SHP-2 and
tyrosine phosphorylation of BTLA, but BJAB cells alone, either
HVEM-negative or expressing HVEM, showed neither SHP-2
coimmunoprecipitation nor BTLA phosphorylation. Thus, these results
show that HVEM can induce BTLA tyrosine phosphorylation and
association with SHP-2.
HVEM-BTLA Interactions are Conserved in Human.
[0382] Because tetramers of mouse BTLA bound mouse HVEM but not
human HVEM, we sought to determine if the BTLA-HVEM interaction was
conserved in humans. Therefore, we generated a human BTLA-Fc fusion
protein and characterized its interactions with mouse and human
HVEM (FIG. 4e). The mouse BTLA-Fc fusion protein bound to BJAB
cells expressing mouse HVEM but not cells expressing human HVEM,
confirming the data obtained with mouse BTLA tetramers (FIG. 4b).
In addition, the human BTLA-Fc fusion protein bound to BJAB cells
expressing human HVEM (FIG. 4e). The human BTLA-Fc fusion protein
also bound, although more weakly, to BJAB cells expressing mouse
HVEM. These interactions were specific, as the isotype control
antibody and the B7x-Fc fusion protein did not bind to BJAB cells
expressing either mouse or human HVEM. Thus, the interaction
between BTLA and HVEM occurs in human lymphocytes, as it does in
mouse lymphocytes. Also, although cross-species interactions are
noted for human BTLA and mouse HVEM (FIG. 4e), it seems that this
cross-species interaction is weaker than the intraspecies
interaction.
BTLA Interacts with the CRD I Region of HVEM
[0383] HVEM is a member of the TNFR superfamily and interacts with
the two known TNF family members LIGHT and LT.alpha.. Because HVEM
has multiple ligands, we sought to determine whether we could
detect additional ligands for BTLA. Thus, we compared binding of
BTLA tetramers to wild-type and HVEM-deficient lymphocytes (FIG.
5a). BTLA tetramers showed no detectable specific binding to
HVEM-deficient CD4+ or CD8+ T cells but showed the expected binding
to wild-type T cells. Even the low binding of BTLA tetramer to B
cells was reduced to undetectable amounts in HVEM-deficient B cells
(FIG. 5a). Thus, we found no evidence of additional ligands for
BTLA in mice.
[0384] The interaction between HVEM and LIGHT can be detected with
an HVEM-Fc fusion protein containing the four extracellular CRD
regions of HVEM fused to the Fc region of human IgG1. We therefore
sought to determine whether this HVEM-Fc fusion protein can also
bind BTLA (FIG. 5b). Because LIGHT is expressed by CD11c+ DCs but
not by B220+ B cells, we compared the binding of HVEM-Fc fusion
protein to B cells and DCs from wild-type and BTLA-deficient mice
(FIG. 5b). The HVEM-Fc fusion protein bound to wild-type B cells
but not to Btla-/- B cells. In contrast, the HVEM-Fc fusion protein
bound to wild-type DCs with only slightly reduced binding to
BTLA-/- DCs. We next compared the binding of HVEM-Fc fusion protein
to wild-type and LIGHT-deficient (Tnfrsfl4-/-) B cells and DCs
(FIG. 5c). The HVEM-Fc fusion protein bound to wild-type and
Tnfrsfl4-/- B cells and DCs with nearly equal intensity. In
addition, HVEM expression was actually increased in BTLA-/- mice
compared with that in wild-type mice. This result might indicate
that endogenous HVEM expression is regulated by interaction with
BTLA, similar to the reported regulation of HVEM expression by
LIGHT. Furthermore, this result formally shows that HVEM expression
does not require BTLA as a `chaperone`. These results might suggest
that BTLA is the only ligand for HVEM on B cells, but such
conclusions based solely on soluble staining reagents may be
misleading, and it is possible that HVEM could also interact with
other unknown molecules on B cells. For DCs, it seems that both
BTLA and LIGHT are ligands for HVEM.
[0385] We sought to identify which domains of HVEM are involved in
BTLA interactions. HVEM has four extracellular CRDs; it binds LIGHT
and LTa through CRD2 and CRD3 and binds herpes glycoprotein D
through CRD1. We constructed a series of HVEM mutants, including a
mouse HVEM GFP fusion protein, an HVEM deletion mutant lacking the
N-terminal CRD1 as a GFP fusion protein, an intact human HVEM, and
a chimeric HVEM containing mouse CRD1 linked to human CRD2. We
expressed this panel of HVEM mutants in BJAB cells and examined
binding of the mouse BTLA tetramer (FIG. 5d). As expected, the BTLA
tetramer did not bind uninfected BJAB cells but bound to wild-type
mouse HVEM. However, the mouse BTLA tetramer did not bind to the
HVEM mutant lacking CRD1. In addition, BTLA tetramer did not bind
to human HVEM but did bind to the mouse-human chimeric HVEM (FIG.
5d). As a control, we assessed the amounts of human HVEM expressed
by these cell lines (FIG. 5d), confirming expression of the human
and chimeric HVEM molecules. These results indicate an important
function for the CRD1 domain of mouse HVEM for BLTA interactions
but do not exclude the possibility of a contribution by other
domains.
HVEM Inhibits Antigen-Driven T Cell Proliferation
[0386] HVEM is expressed by several types of cells, including T
cells, B cells and DCs, complicating the analysis of potential
interactions between cells expressing LIGHT, BTLA and HVEM. Thus,
we first sought to confirm the reported costimulatory effects of
LIGHT on CD4+ T cells in our system. We stimulated highly purified
CD4+ T cells with increasing amounts of anti-CD3 in the presence of
various concentrations of plate-bound LIGHT (FIG. 6a). At
suboptimal concentrations of anti-CD3 stimulation, LIGHT strongly
augmented T cell proliferation in a dose-dependent way. At the
highest dose of anti-CD3, the costimulatory effect of LIGHT was
reduced slightly because of an increase in the LIGHT- independent
proliferation. These data confirm reports that LIGHT engagement of
HVEM provides positive costimulation.
[0387] We next tested whether BTLA or HVEM expression by
antigen-presenting cells (APCs) inhibited or activated T cells. For
this, we produced a panel of Chinese hamster ovary (CHO) cells
expressing various combinations of I-Ad and B7-1 plus either BTLA
or HVEM using retrovirus transduction and cell sorting. We
confirmed expression of I-Ad, B7-1, BTLA and HVEM by these cell
lines using flow cytometry. We sought to determine if BTLA
expression by APCs costimulated D011.10 T cells (FIG. 6b). CHO
cells expressing I-Ad alone supported minimal T cell proliferation,
similar to that seen with T cells and peptide alone. As a positive
control, CHO cells expressing I-Ad and B7-1 supported higher
proliferation in response to OVA peptide. In contrast, BTLA
expression by APCs did not augment T cell proliferation induced by
CHO cells expressing I-Ad alone (FIG. 6b), as did expression of
B7-1, suggesting that BTLA does not provide costimulation to T
cells through HVEM engagement.
[0388] Whereas BTLA, unlike LIGHT, may not activate HVEM, HVEM
seems to activate BTLA, as evidenced by BTLA phosphorylation and
SHP-2 association (FIGS. 4c, d). Thus, we sought to determine
whether HVEM expression by APCs influenced T cell proliferation
(FIG. 6c). The peptide dose-dependent proliferation supported by
CHO cells expressing I-Ad alone was reduced when HVEM was
coexpressed on these CHO cells (FIG. 6c). Furthermore, as expected,
B7-1 increased T cell proliferation induced by peptide and I-Ad
(FIG. 6d), shifting the dose-response to lower concentrations of
peptide. Again, coexpression of HVEM on these CHO cells reduced
peptide-dependent T cell proliferation. The inhibition produced by
HVEM at the highest peptide concentrations was smaller than the
inhibition seen with intermediate stimulation.
[0389] We extended this analysis using T cells labeled with
carboxyfluorescein diacetate succinimidyl diester (CFSE; FIG. 7).
In addition, we tested whether the inhibitory effect of HVEM on T
cell proliferation required BTLA by using BTLA-/- D011.10 T cells.
Using CHO cells lacking B7-1 expression, we did not note T cell
proliferation at the lowest dose of OVA peptide (0.03 .mu.M) on
days 3 and 4 (FIG. 7a). However, higher peptide concentrations (0.3
.mu.M) induced T cell proliferation on days 3 and 4. In these
conditions, expression of BTLA on CHO cells had no effect on T cell
proliferation at anytime. However, expression of HVEM on CHO cells
greatly reduced T cell proliferation, which occurred only in
wild-type D011.10 T cells, not BTLA-/- T cells, and was evident on
days 3 and 4 after activation.
[0390] We next examined the effects of HVEM on T cell proliferation
in response to antigen presentation by CHO cells expressing B7-1
(FIG. 7b). Again, B7-1 increased T cell proliferation induced by
peptide and I-Ad, shifting the dose-response to lower
concentrations of peptide, as demonstrated by larger numbers of
cellular divisions at lower doses of peptide; this was clearly
evident on day 3 as well as day 4. In these conditions,
coexpression of BTLA on CHO cells had no effect on T cell
proliferation. In contrast, coexpression of HVEM on CHO cells
caused a reduction in proliferation of wild-type D011.10 T cells,
but this was evident only at the lowest peptide dose and was
evident only on day 3, not day 4, after T cell activation. This
inhibition of T cell proliferation was specific to BTLA, as we
found it only in wild-type but not BTLA-/- T cells. In summary,
HVEM inhibits both costimulation-independent and costimulation
dependent proliferation, but is more effective in blocking
activation of antigen stimulated T cells at low B7-1 expression.
Furthermore, HVEM-mediated inhibition of T cell proliferation
requires BTLA expression by T cells.
Methods (I)
Mice
[0391] C57BL/6 and BALB/c mice (Jackson Labs) were bred in our
facility. BTLA-/- mice were backcrossed to BALB/c for nine
generations and were subsequently crossed onto the D011.10 T cell
receptor-transgenic background. LIGHT-deficient mice were
previously described and HVEM- deficient (Tnfrsfl4-/-) mice will be
described elsewhere.
Plasmids and Retroviral Constructs.
[0392] The sequences of all oligonucleotides are provided in Sedy
et al., Nature Immunology (2005) 6:90-98. For preparation of
B7x-B7h-GFP-RV, a PCR product made with primers 5'Bg12 mB7x and
B7xB7h bottom using IMAGE cDNA clone 3709434 as the template, plus
a PCR product made with primers B7xB7h top and 3'RI GFP using the
B7h-GFP plasmid (a gift from W. Sha, University of California,
Berkeley, Calif.) as the template, were annealed and amplified with
Pfu polymerase with primers 5'Bg12 mB7x and 3'RI GFP. This product,
encoding the B7x extracellular domain, B7h transmembrane and
cytoplasmic domains fused to GFP, was digested with BgIII and EcoRI
and was cloned into IRES- GFP-RV that had been digested with BgIII
and EcoRI.
[0393] The plasmid huHVEM-IRES-GFP-RV was produced by amplification
of huHVEM with primers 5'Bg12 huHVEM and 3'Xho1 huHVEM using IMAGE
cDNA clone 5798167 (Invitrogen) as the template, followed by
digestion with BgIII and XhoI and ligation into Tb-lym-IRES-GFP-RV
that had been digested with BgIII and XhoI, replacing the Tb-lym
cDNA with that of huHVEM. Similarly, m4-1BB-IRES-GFP-RV was
prepared with primers 5'Bgl2 m4-1BB and 3'Xho1 m4-1BB using library
plasmid as the template, followed by digestion with BgIII and XhoI
and ligation into Tb-lym-IRES-GFPRV. The plasmid mLT R-IRES-GFP-RV
was prepared with primers 5'Bg12 mLT R and 3'Sal1 mLT R using IMAGE
cDNA clone 5293090 (Invitrogen) as the template, followed by
digestion with BgIII and SalI and ligation into Tb-lym-IRES-GFP-RV.
The plasmid mHVEM-FL-IRES-GFP-RV was similarly prepared with
primers 5'Bg12 mHVEM and 3'Xho1 mHVEM using, as the template, cDNA
from library infected BJAB cells sorted for BTLA tetramer binding,
followed by digestion with BgIII and XhoI and ligation into
Tb-lym-IRES-GFP-RV. Three amino acid changes (N58S, K92R and E128G)
in mouse HVEM cDNA cloned from the retrovirus library, compared
with that of mouse HVEM cDNA from the 129 SvEv mouse strain, were
implemented by Quick Change mutagenesis (Stratagene) to generate
mHVEM(129)-IRES-GFP-RV with serial application of the primers S-N
top plus S-N bot; R-K top plus R-K bot; and G-E top plus G-E
bot.
[0394] The plasmid mHVEM-FL-GFP-RV was made from two PCR products,
with primers 5'Bg12 mHVEM and mHVEM/GFP bot using
mHVEM-FL-IRES-GFP-RV as the template, and primers mHVEM/GFP top and
3'GFP+Sal using mHVEM-FL-IRES-GFP-RV as the template; the PCR
products were annealed, amplified with primers 5'Bg12 mHVEM and
3'GFP+Sal, digested with BgIII and SalI and ligated into
IRES-GFP-RV that had been digested with BgIII and SalI. The plasmid
mHVEM-FL-GFP-RV CRD1 was made by Quick Change mutagenesis from
mHVEM-FL-GFP-RV with primers mHVEM dl top and mHVEM dl bot. The
plasmid m/hHVEM-IRES-GFP-RV (mouse CRD1 fused to human CRD2) was
made from two PCR products, with primers 5'Bg12 mHVEM and m/hHVEM
bot using mHVEM-FL-IRES-GFP-RV as the template, and primers m/hHVEM
top and 3'Xho hHVEM using hHVEM-IRES-GFP-RV as the template; the
PCR products were annealed, amplified with primers 5'Bgl2 mHVEM and
3'Xho huHVEM, digested with BgIII and XhoI and ligated into
Tb-lym-IRES-GFP-RV that had been digested with BgIII and XhoI.
C57BL/6-BTLA-GFP-RV, a BTLA-GFP chimera, was prepared from two PCR
products, with primers J1ORV1 (Bgl 2) and 3'J10+10 using C57BL/6
BTLA cDNA as the template, and primers 5'GFP+10 and 3'GFP+Sal using
GFP cDNA as the template; the PCR products were annealed, amplified
with J1ORV1 (Bgl 2) and 3'GFP+Sal, digested with BgIII and SalI and
ligated into Tb-lym-IRES-GFP-RV that had been digested with BgIII
and XhoI. A cytoplasmic deletion of this construct,
BTLA-trunc-GFP-RV, was made by site- directed mutagenesis
(Stratagene) with primers mj1ltrunc top and mj1ltrunc bottom.
[0395] PD-1-GFP-RV was made by amplification of the PD-1 coding
region with primers PD15' and PD13' using PD-1 cDNA as the template
(a gift from T. Honjo, Kyoto University, Kyoto, Japan); the PCR
product was digested with BgIII and BamHI and was cloned into
A183-GFP MSCV that had been digested with BgIII and BamHI (a gift
from W. Shay. Similarly, PD-L1-GFP-RV was made by amplification of
the region encoding PD-L1 with primers PD-L1G5' and PD-LIG3' using
PD-L1 cDNA (a gift from T. Honjo) as the template; the PCR product
was digested with BgIII and BamHI and was ligated into AIB3-GFP
MSCV.
[0396] PD-1 pET28 was made by amplification of the immunoglobulin
domain of PD-1 with primers PD1Tet5' and PD1Tet3' using PD-1-GFP-RV
plasmid as the template, followed by digestion with NcoI and BamHI
and ligation intoMLL1-pET28 (a gift from D. Fremont, Washington
University, St. Louis, Mo.) that had been digested with NcoI and
BamHI. Similarly, B6-BTLA pET28 was made by amplification of the
extracellular immunoglobulin domain of BTLA with primers
J11TetMus5' and J11TetB63' using C57BL/6 BTLA-GFP-RV plasmid as the
template, followed by digestion with NcoI and BamHI and ligation
into MLL1- pET28. Similarly, BALB-BTLA pET28 was made with primers
J11TetMus5' and J11TetWEHI3' using mJ11W1 as the template, and
digestion with NcoI and BamHI and ligation into MML1-pET28. The
immunoglobulin domain was `corrected` to e authentic BALB/c allelic
sequence (data not shown) by serial mutagenesis with primers
Wle23k5' and Wle23k3' followed by primers W1h38n3B and
W1h38n5C.
Fc Fusion Proteins
[0397] For the creation of CD47-Fc-aTP-ires-GFP-RV, a bicistronic
retroviral vector for Fc fusion proteins, CP318 (a gift from Lewis
Lanier, University of California, San Francisco, Calif.) was
digested with PfIF I and NotI, treated with Vent polymerase and
ligated into m1L-12R-ires-GFP-RV that had been digested with BgIII
and XhoI and treated with mung bean nuclease. The plasmids
mBTLA-Fc-aTP-ires-GFP-RV, mB7x-Fc-aTP-ires-GFP-RV,
mPDLI-Fc-aTP-ires-GFP-RV and hBTLA-Fc-ocTP-ires-GFP-RV were made by
ligation of the following XhoI-digested PCR products containing the
immunoglobulin domains regions of these genes into the XhoI site of
CD47-Fc-aTP- ires-GFP-RV. The product mBTLA was made with primers
5'xho mJ11 dodecamer and 3'xho mJ11 dodecamer using as a template
the C57BL/6 splenocyte phage library (Stratagene). The product mB7x
was made with primers 5'xho mB7x dodecamer and 3'xho mB7x dodecamer
using IMAGE cDNA clone 3709434 (Invitrogen) as the template. PD-LI
was made with primers 5'xho mPDL2 dodecamer and 3'Xho PDL1
dodecamer using pBacPAK8-PDL1 (a gift from T. Honjo) as the
template. Human BTLA was made with primers 5'Xho hJ11 Ig and 3'Xho
hJ11 Ig using hJ11(corr)ires- GFP-RV as the template.
[0398] Fc fusion proteins were produced by transfection of Phoenix
E cells, were purified with Affiprep protein A columns (Biorad) and
were dialyzed against PBS and stored at -70.degree. C. For flow
cytometry, cells were stained with 200 ng of purified Fc-fusion
protein or, for hBTLA-Fc fusion protein, 1 ml of supernatant,
followed by phycoerythrin-conjugated anti-human IgG (heavy plus
light) that had been adsorbed against proteins from mouse, rat, cow
and other species (Jackson Immunoresearch), and anti-mCD4-tricolor
(Caltag) and anti-mB220-fluorescein isothiocyanate (FITC;
BD-Pharmingen).
Production of Tetramers
[0399] Tetramers produced with plasmid PD-1 pET28, B6-BTLA pET28 or
BALB-BTLA pET28 were transformed into BL21-CodonPlus (DE3) RIPL
Competent Cells (Stratagene). Purified proteins were biotinylated
in vitro with BirA ligase (Avidity), purified by gel filtration and
concentrated. Tetramers were formed by the addition of biotinylated
protein to streptavidin-phycoerythrin at a molar ratio of 1:4.
Cell Lines
[0400] BJAB and NIH 3T3 cells were from A. Chan (Washington
University, St. Louis, Mo.); EL- 4 cells were from T. Ley
(Washington University, St. Louis, Mo.); 293T cells were from R.
Schreiber (Washington University, St. Louis, Mo.); CHO cells were
from A. Sharpe (Harvard University, Boston, Mass.); and Phoenix A
and E packaging cells were from American Type Culture Collection.
Retrovirus constructs were packaged either in Phoenix A or E cells
by calcium phosphate transfection. CHO cells were transduced by
retrovirus packaged by transfection of 293T cells with pYITG plus
pCGP (a gift from W. Sha) and were sorted for GFP to more than 95%
purity, followed by staining with 6A6 (anti-BTLA) or
BTLA-phycoerythrin tetramers.
Retrovirus Library
[0401] Purified BALB/c and C57BL/6 splenocytes were left
unstimulated or were activated for 48 h with plate-bound anti-CD3
(500A.2 ascites) or soluble anti-IgM (Jackson Immunoresearch), then
RNA was purified (RNeasy mini kit; Qiagen) and mRNA was made with
the Nucleotrap mRNA purification kit (Clontech), full-length cDNA
was made with the SMART cDNA Library Construction Kit (Clontech)
and double-stranded cDNA was made by long-distance PCR with 5'PCR
primer and CDS III/3'PCR primer; the PCR products were digested
with SfH, size fractionated, amplified cDNA ligated into
Sfi1-digested MSCV-ires-Thy1.1 retrovirus vector (a gift from W.
Sha) and were transduced into XL-10 gold (Stratagene) for a library
transcript complexity of 2.times.10.sup.6. The library plasmid was
purified without further amplification by CsCl gradient
ultracentrifugation. Infected NIH-3T3 cells (8.times.10.sup.6) and
infected BJAB cells (6.times.10.sup.6) were generated from
retrovirus made by calcium phosphate transfection of Phoenix E
cells; the total number of infected cells was assessed by
anti-Thy1.1-FITC (eBioscience) staining. Serial rounds of cell
sorting used anti-Thy1.1-FITC and BALB/c and C57BL/66 BTLA
tetramers. When the sorted cells were more than 80% positive for
Thy1.1 and BTLA tetramer, RNA was prepared and reverse-transcribed,
cDNA was amplified with Taq polymerase and primers Sfi 5' and Sfi
3', and PCR products were cloned into pGEM-T Easy (Promega).
T Cell Purification and Stimulation
[0402] T cells were purified (>90%) with anti-CD4 magnetic beads
(Miltenyi) and, where indicated (FIGS. 6b-d, 7) by subsequent
sorting for populations that were negative for B220-FITC and CD11c-
phycoerythrin and positive for CD4-CyChrome (>98%). For T cell
stimulation with anti-CD3 and LIGHT, 2C11 (BD Pharmingen) was
coated onto 96-well plates, followed by LIGHT (PeproTech) at the
indicated doses (FIG. 6a). Purified T cells were plated at a
density of 1.times.10.sup.6 cells/ml in 100 .mu.l media per well.
CHO cells were treated in media for 16 h at 37.degree. C. with 50
.mu.g/ml of mitomycin C (Sigma), were washed twice in PBS and were
plated at a density of 1.times.10.sup.6 cells/ml in 100 .mu.l media
in 96-well plates for proliferation assays or in 1 ml media in
24-well plates for CFSE analysis. For proliferation assays,
purified T cells were plated directly onto CHO cells at a density
of 1.times.10.sup.6 cells/ml in 100 .mu.l media and OVA peptide.
After 48 h, cells were pulsed for 12 h with 1 .mu.Ci/well of
[.sup.3H]thymidine. For CFSE analysis, purified T cells were washed
three times with PBS, were incubated for 8 min at 20.degree. C.
with 1 .mu.M CFSE (Molecular Probes), were `quenched` with fetal
calf serum, were washed twice with media and were plated directly
onto CHO cells at a density of 1.times.10.sup.6 cells/ml in 1 ml
media plus OVA peptide. After 3 and 4 d, cells were stained with
CD4-FITC and were analyzed by flow cytometry.
Immunoblot Analysis
[0403] For cell-mixing experiments, 25.times.10.sup.6 EL4 cells
were mixed with 25.times.10.sup.6 BJAB cells expressing GFP or
25.times.10.sup.6 BJAB cells expressing mouse HVEM in 1 ml for 4
min at 37.degree. C. and were lysed. Extracts were precleared with
protein G-Sepharose (Pharmacia), followed by immunoprecipitation
with 9 .mu.g of 6A6 (anti-mBTLA) or isotype control Armenian
hamster IgG (Santa Cruz) and 40 ul protein G-Sepharose (Pharmacia),
then were washed and analyzed by SDS-PAGE. Immunobiot analyses for
SHP-2 and phosphotyrosine were done as described in Watanabe et al,
Nat. Immunol. (2003) 4:670-679 and Gavrieli et al, Biochem.
Biophys. Res. Commun. 312:1236-1243 (2003).
[0404] For further details regarding Example I, including
references, see Sedy et al., Nat. Immunol., 6:90-98, which is
expressly incorporated herein in its entirety by reference.
(II) BTLA Polymorphism and BTLA Binding Antibodies
Allelic Polymorphisms in BTLA
[0405] We previously generated BTLA cDNA from several sources,
including from the cell line WEHI 231, a commercial murine C57BL/6
splenocyte cDNA library, and 129SvEv mice, finding several
polymorphisms within the BTLA Ig domain coding sequence. To
determine the basis of differences, we sequenced the coding region
for the BTLA Ig domain from genomic DNA of several inbred and wild
mouse strains (FIG. 8). Among 23 strains, we identified three
distinct alleles of BTLA, differing in their predicted amino acid
sequence and potential predicted disulphide bonding pattern (FIG.
8a). The allele represented by BALB/c was present in CBA/J, SJL/J,
New Zealand White (NZW), BXSB, C3H/J, New Zealand Black (NZB/BinJ),
NOD, 129SvEv, and 129SWJ (FIG. 8b). A second allele, represented by
the strains MLR/Ipr, AKR, SWR, CALB/RK, and DBA/2J, differed from
the BALB/c allele at only one amino acid, containing histidine
rather than asparagine at residue 38 of the BTLA protein. These two
alleles each have five cysteine residues within the Ig domain,
predicting two disulfide bonds and one unpaired cysteine. The third
allele, represented by C57BL/6, was also present in B10.PL and
several wild-derived inbred strains, and differed from the BALB/c
and MLR/Ipr alleles at 10 and 11 amino acid residues, respectively
(FIG. 8a). Notably, the C57BL/6 allele has a cysteine at amino acid
residue 49, making six total cysteine residues with three predicted
disulfide bonds in the BTLA Ig domain. As a control, we found no
sequence polymorphisms in the PD-1 Ig domain from BALB/c, MLR/Ipr,
and C57BL/6.
Generation of Allele-Specific mAbs to Murine BTLA
[0406] To generate anti-BTLA mAbs, we immunized Armenian hamsters
and BTLA-/- BALB/c mice with recombinant Ig domain of the C57BL/6
BTLA allele. To allow the identification of Abs that could
potentially recognize either the BALB/c or C57BL/6 allele of BTLA,
hybridoma supernatants were screened for binding to BJAB cells
expressing either the C57BL/6 or BALB/c allele of BTLA as a GFP
fusion protein. One hamster anti-BTLA Ab, 6A6, was identified that
reacted only with the C57BL/6, but not the BALB/c, allele of BTLA
(FIG. 9a). The majority of the murine anti-BTLA mAbs reacted with
both the C57BL/6 and BALB/c BTLA alleles, including 6F7, 6G3, 8F4,
and 3F9.D12 (FIG. 9b). One murine Ab, 3F9.C6, reacted only with
C57BL/6 BTLA, and not with BALB/c BTLA. Another Ab, 6H6, reacted
with both alleles, but stained the C57BL/6 allele more highly than
the BALB/c allele. For each of these Abs, staining was observed on
wild type splenocytes, but not splenocytes of BTLA-/- mice (FIG.
9c), suggesting that these Abs in fact recognize BTLA, and react
with native BTLA as well.
[0407] To further assess how these Abs interact with BTLA, we
characterized their behavior in IP and Western blot analysis (FIGS.
9d and e). The pan-specific Abs 6F7 and 6G3 each specifically
immunoprecipitated both the C57BL/6 and BALB/c BTLA-GFP fusions
proteins from BJAB cells (FIG.9d, bottom panel). Importantly, the
C57BL/6-specific 6A6 Ab did immunoprecipitate the C57BL/6 BTLA
allele, but not the BALB/c allele (FIG. 9d, compare lanes 3 and 6),
indicating that the allelic specificity observed by FACS analysis
extends to its behavior in IP Western blot analysis. Also, these
interactions seen in IP Western blot analysis were specific because
no BTLA was immunoprecipitated using mouse or hamster IgG1 as an
isotype control (FIG. 9d, lanes 7-10).
[0408] Notably, although equivalent amounts of each BTLA allele
were immunoprecipitated when assessed by immunoblotting for the GFP
epitope of the fusion proteins, detection of the Ig domain by IP
Western blot analysis was not equally efficient. Following
immunoprecipitation, the C57BL/6 BTLA Ig domain was detected much
more strongly than the BALB/c allele by 6G3 and 6F7, both
pan-specific anti-BTLA Abs, (FIG. 9d, top panel, lanes 1, 2, and
4-6). These results may indicate differential sensitivity between
alleles for recognition or detection of the Ig domains, even using
pan-specific Abs, which could result from differential sensitivity
to denaturation of the antigenic epitope. Whatever the cause, it is
necessary to consider this fact when using IP Western blot analysis
in comparing BTLA from varying allelic backgrounds. Finally,
certain Abs allow coimmunoprecipitation of BTLA-associated
proteins. For example, IP Western blot analysis using 6A6
reproduces the known specific and inducible coassociation of SHP-2
with BTLA following pervanadate treatment (FIG. 9e).
Mapping Antigenic Epitopes Recognized by Anti-BTLA Abs
[0409] To map which of the polymorphic residues differing between
BALB/c and C57BL/6 BTLA were involved in strain-specific reactivity
of 6A6 and 3F9.C6, we used yeast display technology. We first
expressed the BTLA Ig domain as an Aga2 fusion protein, and then
generated a series of mutant BTLA Ig domains with single amino acid
substitutions at the polymorphic residues, replacing BALB/c
residues into the C57BL/6 allele one residue at a time (FIG. 10).
This series of wild type and mutant BTLA proteins were then
analyzed for reactivity with pan-specific anti-BTLA mAbs and two
B6- specific Abs, 6A6 and 3F9.C6 (FIG. 10). As a positive control,
we confirmed that the pan-specific anti- BTLA mAb 6F7 recognized
the wild type C57BL/6 BTLA Ig domain, and also recognized each of
the single residue substitutions of BTLA (FIG. 10, left column), as
expected for pan-specific reactivity. In contrast, the two
C57BL/6-specific Abs recognized some, but not all of BTLA mutants.
Specifically, 6A6 showed a very selective loss of reactivity only
with the Q27E, C49W, and Q66R substitutions, indicating that these
residues are involved in the strain-specific recognition of BTLA. A
distinct pattern of reactivity was observed with 3F9.C6, with a
selective loss of reactivity with the R107W substitution and
reduced reactivity with the Q27E substitution. Also, whereas 6A6
reactivity is sensitive to the C49W substitution, which disrupts
one of three predicted disulphide bonds, 3F9.C6 reactivity remains
in this substitution. These results indicate that the C57BL/6
specificity of these two Abs derive from interactions with the
distinct, but polymorphic, region of the BTLA Ig domain.
[0410] In summary, at least two of the BTLA alleles can be
distinguished by their antigenic structure, as shown by two
C57BL/6-specific anti-BTLA Abs. Importantly, we also identified
several pan-specific anti-BTLA Abs, which now allow direct
comparisons of the fine specificity of tissue expression of native
BTLA expression between various murine strains.
Distribution and Expression of Murine BTLA
[0411] In our previous studies, we were restricted to analyzing
BTLA expression either by mRNA expression or by using epitope-tags
because we lacked Abs to native BTLA. Conceivably, we failed to
detect low but physiologically important levels of BTLA on certain
lymphocyte subsets for this reason. Thus, we examined BTLA surface
expression on various lymphoid subsets again, using both
allele-specific Ab 6A6 and pan-specific Ab 6F7 (FIG. 11).
[0412] First, BTLA was expressed uniformly on B cells at levels
that were similar for C57BL/6 and BALB/c mice (FIG. 11a). CD4+ and
CD8+ T cells expressed lower levels of BTLA compared with B cells,
but again, at levels that were similar for C57BL/6 and BALB/c mice.
For 6A6, we found that a subpopulation of CD11b+ cells, CD11c+
dendritic cells, and DX5+ cells were positive for BTLA expression,
and again identified only in C57BL/6 cells as expected (FIG. 11a,
middle row). Using the pan-specific 6F7 Ab, we found that B cells
express the highest levels of BTLA, again at levels similar between
C57BL/6 and BALB/c mice, with lower levels expressed in CD4 and CD8
T cells (FIG. 11a, lower row). Interestingly, using the
pan-specific reagent 6F7, we found that BTLA was expressed on
CD11c+ BALB/c cells at levels similar to CD11c+ C57BL/6 cells, but
that BTLA was only expressed on CD11b+ macrophages and DX5+ NK
cells from C57BL/6 mice, but not in BALB/c mice (FIG. 11a, lower
row). The fact that 6F7 detects BTLA expression on B cells, T
cells, and CD11c+ cells from both BALB/c and C57BL/6 mice serves as
a control for its ability to bind BTLA from both strains. Thus, the
selective binding of 6F7 to DX5+ and CD11b+ cells only in C57BL/6,
not BALB/c mice, indicates a difference between these strains for
BTLA expression by these cell types. Thus, these strains appear to
have a distinct difference in the cell types expressing detectable
BTLA, explaining the differences between BTLA expression reported
previously.
[0413] We also examined BTLA expression in splenic B cell
populations (FIG. 11b). BTLA expression was detected at the highest
levels on follicular B cells (1gMlowCD21/CD35int), and at reduced
levels on marginal zone B cells (1gMhighCD21/CD35high) and
transitional B cells (1gMlowCD21/CD35low) (FIG. 11b). Notably,
because the 6F7 pan-specific Ab was used for analysis, we can also
conclude that the levels on each subpopulation of B cells are
similar between C57BL/6 and BALB/c mice (FIG. 11b).
[0414] We next examined BTLA expression in thymocyte and B cell
development (FIG. 12). In thymus, BTLA was expressed at highest
levels on mature CD4+ T cells, and at slightly reduced levels on
CD8+ T cells (FIG. 12A). BTLA expression on immature CD4-CD8- T
cells or CD4+ CD8+ double positive T cells was nearly undetectable
(FIG. 12a). In bone marrow, BTLA was expressed at the highest
levels on B220highlgM+ mature B cells (FIG. 12b), and was detected
at relatively low levels on B220low/IgM+ immature B cells. BTLA
expression was undetectable on B220+IgM- pro-B cells and pre-B
cells. Further, we found no differences between C57BL/6 or BALB/c
mice for the levels of BTLA expression on the thymocyte and bone
marrow populations.
[0415] Finally, we examined the BTLA expressed on CD4+ T cells
under various conditions of activation and polarization by
cytokines (FIG. 13a). BTLA surface expression on resting CD4+ T
cells was induced by 10-fold on day 2 following activation with Ag
and APCs, decreased by day 4, and was nearly undetectable by day 7
after activation (FIG. 13a). The rapid increase in BTLA expression
by day 2 on Ag-activated CD4+ T cells occurred both in Th1 inducing
or Th2-inducing conditions (FIG. 13a). Upon secondary T cell
activation, BTLA was again highly induced 2 days following
activation, again in both Th1 and Th2 cultures (data not shown).
However, tertiary activation of T cells revealed selective
induction in the Th1 cultures, but not in the Th2 cultures (FIG.
13a). These results suggest that BTLA expression on CD4+ T cells is
initially controlled primarily by T cell activation and not by
factors governing Th1 or Th2 differentiation. The delayed loss of
BTLA inducibility in Th2 cells might suggest a silencing process
rather than a Th1-specific pathway for induction, which would be
consistent with our initial finding that BTLA expression is not
dependent on Stat4 or Stat1. Finally, the rapid modulation of BTLA
expression, peaking on day 2 and extinguished by day 7, suggests
that it may act in the mid-phases of T cell activation following
interactions with APCs.
[0416] In contrast to the activation-dependent expression of BTLA
seen in CD4+ T cells, BTLA expression on B cells was maintained at
high levels throughout activation by LPS or anti-IgM stimulation
(FIG. 13b). These results differ slightly from the reported 3- to
10-fold decrease in BTLA expression following LPS activation of B
cells. Nonetheless, our results agree with that report in the
finding of high levels of BTLA expression on B220+B cells in the
periphery, and to some degree, the constitutive nature of its
expression.
Selective Induction of BTLA an Anergic T Cells
[0417] Previously, a method of anergy induction for naive CD4+ T
cells was developed that involves adoptive transfer of Ag-specific
CD4+ T cells into recipients expressing Ag on somatic tissues.
Specifically, clone 6.5 transgenic T cells, reactive to HA peptide
110-120 presented by I-Ad, become anergic when transferred into
recipient mice expressing a membrane bound form of HA targeted for
expression on lung and prostate tissue. We analyzed BTLA expression
following T cell transfer on various days after transfer using
Affymetrix gene arrays and FACS (FIGS. 14, a and b). We found that
BTLA mRNA was highly induced in these anergic CD4+ T cells in this
system, compared with CD4+ T cells activated by Agexpressing
vaccinia virus (FIG. 14a). At 2 days after transfer, BTLA
expression by T cells undergoing anergy induction was twice the
level of naive T cells, and significantly higher than activated T
cells. This induction was more evident by day 3 and day 4 following
transfer, with BTLA expression about 3-fold higher than in naive T
cells. By contrast, BTLA levels were substantially reduced in fully
activated T cells compared with naive or anergic T cells at these
times (FIG. 14a). As a control, myosin Vila, a constitutive
"housekeeping" gene, showed essentially no change in these three
conditions over these times. Thus, BTLA mRNA appears to decline
more rapidly than BTLA surface protein in activated T cells because
activated T cells express peak BTLA surface levels at day 2 (FIG.
13), but show reduced BTLA mRNA (FIG. 14b). These observations are
consistent with the reduced BTLA surface expression by day 4 and
the essentially undetectable BTLA expression by day 7.
[0418] We next measured BTLA expression by FACS under conditions of
anergy induction or activation (FIG. 14b). Notably, the highest
levels of BTLA surface expression coincided with induction of
anergy in vivo. Specifically, 6 days after transfer, anergic T
cells expressed about 10-fold higher BTLA than naive T cells, and
about 3-fold higher than in vivo-activated T cells (FIG. 14b). We
verified that the CD4+ T cells transferred into HA-expressing
recipients did become anergic as defined by lack of proliferation
(FIG. 14c), consistent with previous reports. For comparison, we
also wished to evaluate BTLA expression on conventional naive CD4+
T cells (CD4+CD25-) T cells or T regulatory cells (CD4+CD25+)
either as resting cells ex vivo or after in vitro activation with
anti-CD3 (FIG. 14d). As expected, BTLA was expressed at low levels
on naive T cells, and was induced about 10-fold 36 h after anti-CD3
treatment. Freshly isolated T regulatory cells expressed similar
levels of BTLA as freshly isolated naive CD4+ T cell, but showed
only a slight increase after treatment with antiCD3 (FIG. 14d). As
a control, we confirmed that T regulatory cells, but not naive T
cells, expressed PD-1, consistent with previous reports. As a
further control, we showed that the isolated CD25+ T regulatory
cells failed to proliferate in vitro, in contrast to the robust
proliferation of freshly isolated naive T cells (FIG. 14e). In
summary, BTLA shows a pattern of expression that is somewhat
distinct from that of CTLA-4 and PD-1 in terms of its response to
anergy induction and expression by T regulatory cells.
Role of BTLA in T Cell-Independent Ab Responses
[0419] Our initial analysis of BTLA was motivated by consideration
of its role in T cell activation. However, the fact that B cells
express the highest level of BTLA, and the constitutive nature of
this expression, motivated a second examination of its effect on Ab
production. In our study, we examined T cell-independent Ab
responses using immunization with NP-Ficoll in wild-type mice or
BTLA-/- 129SvEv mice, which express the BALB/c allele of BTLA. We
immunized cohorts of mice with one injection of NP-Ficoll in alum
and measured production of anti-NP Abs of specific isotypes on day
14 (FIG. 15). For the isotypes IgM, IgG1, IgA, we found no specific
changes in levels of anti-NP Abs. For IgG2a or IgG2b, we found only
slight increases in anti-NP Abs in the BTLA-/- compared with
wild-type mice. However, for Abs of the IgG3 isotype, which is
primarily associated with T-independent responses, we found an
about 2-fold increased in anti-NP-specific Abs in BTLA-/- mice
compared with wild-type mice. The size of this difference is
consistent with the relatively modest increases in B cell and T
cell proliferation responses described for BTLA-/- cells
previously, and is consistent with an inhibitory rather than
activating role of BTLA. However, the relatively modest magnitude
of this effect could also be an indication that BTLA expression by
B cells may serve a purpose other than cell-intrinsic signaling,
such as perhaps delivery of a signal toward cells expressing
ligands for BTLA.
Methods (II)
[0420] The following Abs used for FACS analysis were from BD
Pharmingen: CD4-CyChrome (RM4-5), CD8-FITC (53-6.7),
B220-allophycocyanin (RA3-6B2), CDHb-FITC (M1/70), CD11c-FITC
(HL3), DX5-FITC, I-Ad-PE (AMS-32.1), I-Ab-PE (AF6-120.1), IgM-PerCP
Cy5.5 (R6.60.2), CD21/CD25-FITC (7G6), CD25-allophycocyanin (PC61),
CD62 ligand-FITC (MEL-14), Thy1.1-PerCP (OX-7), goat anti-mouse
Ig-PE, mouse anti-Armenian/Syrian hamster IgG-PE (mixture),
Streptavidin (SA)-PE, SA-CyChrome, and SA-aliophycocyanin. KJ1-26
Tricolor, hamster IgG-biotin, and murine IgGI-biotin were from
Caltag Laboratories. All FACS analysis included an initial
incubation with 2.4G2 (anti-CD16/CD32; BD Pharmingen) to block Fc
receptor interactions.
Sequencing of BTLA and PD-1 Ig Domains
[0421] Exon 2 of BTLA or PD-1, encompassing the Ig domain, was
amplified by PCR from genomic DNA from a panel of mouse strains
using Easy-A High Fidelity PCR Cloning Enzyme (Stratagene) and the
following intronic primers: BTLA (sense) ATGGTCCTTCTAAGAGTGAAC (SEQ
ID NO: 8), (antisense) ATAGATGGTCTGGGGTAGATC (SEQ ID NO:9) and PD-1
(sense) CAGGCTCCTTCCTCACAGC (SEQ ID NO:10), (antisense)
CTAAGAGGTCTCTGGGCAG3' (SEQ ID NO:11).
[0422] PCR products were cloned into the pGEM-T Easy vector
(Promega) and inserts from at least three individual subclones from
each strain were sequenced using the T7 universal primer.
Generation of Soluble BTLA Ig Domain
[0423] The Ig domain of C57BL/6 BTLA was PCR amplified from cDNA
using the following primers: BTLA (sense)
CATGCCATGGAGAAAGCTACTAAGAGGAAT (SEQ ID NO:12) and BTLA (antisense)
CGGGATCCTGAAGAGTTTTGAGTCCTTTC-3' (SEQ ID NO:13). The product was
subcloned into the pET28 vector (Novagen) that had been modified to
contain a BirA biotinylation sequence (GGGLNDIFEAQKIEWHE) (SEQ ID
NO:14) onto the C terminus of the BTLA Ig domain. Proteins were
expressed as insoluble inclusion bodies in BL21 (DE3) Codon Plus
RIL cells (Stratagene) and refolded.
Production of mAbs to BTLA
[0424] Armenian hamsters or BALB/c background BTLA-/- mice were
immunized with 100 .mu.g of refolded C57BL/6 BTLA Ig domain protein
in CFA, boosted biweekly with 100 .mu.g of protein in IFA, and
received a final i.v. boost 3 days before fusion. Splenocytes were
fused with the P3X63Ag8 myeloma, and hybridoma supernatants
screened for binding to BJAB cells expressing either C57BL/6 or
BALB/c BTLA Ig domains as GFP fusion proteins. The BTLAGFP chimera
was prepared by splicing by overlap extension (SOEing). A PCR
fragment containing the BTLA cDNA with a 3' tail annealing to the
5' end of GFP was amplified by PCR made using Vent polymerase, the
primers J1ORV1-BgIII (AGCTCTGAAGATCTCTAGGGAGGAAG) (SEQ ID NO: 15)
and 3' J 10+10 (CCTTGCTCACACTTCTCACACAAATGGATGC) (SEQ ID NO: 16)
with DO11.10 BTLA cDNA as template. A second fragment containing
GFP cDNA, without its start codon, with a 5' tail annealing to the
3' end of BTLA was amplified by PCR using Vent polymerase and the
primers 5' GFP+10 (TGTGAGAAGTGTGAGCAAGGGCGAGGAGC) (SEQ ID NO: 17)
and 3' GFP+Sal (ACGCGTCGACTTACTTGTACAGCTCGTCCATG) (SEQ ID NO: 18)
with the GFP cDNA as template. The chimeric BTLA-GFP fusion cDNA
was amplified by PCR from a mixture of these two PCR fragments
using the primers J1ORV1-BgIII and 3' GFP+Sal, digested with BgIII
and SalI, and cloned into the BgIII/SalI sites of IRES-GFP-RV to
produce D011.10-BTLA-GFP-RV. A cytoplasmic deletion was made using
site directed mutagenesis (Stratagene) and the primers mj 1 Itrunc
top (GTTGATATTCCAGTGAGCAAGGGCGAGGAG) (SEQ ID NO: 19) and mj 1
Itrunc bottom (CTTGCTCACTGGAATATCAACCAGGTTAGTG) (SEQ ID NO: 20) to
produce D011.10-BTLA-trunc-GFP-RV. The C56BL/6 version of BTLA
trunc-GFPRV was made by purifying a natural BgIII/BamHI fragment
from a BTLA cDNA cloned from a mouse spleen cDNA phage library
(Stratagene). This fragment was then cloned into the BgIII/BamHI
digested D011.10-BTLA trunc-GFP-RV to produce C57BL/6-BTLA
trunc-GFPRV.
[0425] Positive hybridomas were expanded and Abs purified using
MAPS II-protein A columns. Hamster monoclonal 6A6 is of the IgG
isotype, whereas all murine Abs are IgG1x. Unless otherwise stated,
all Abs were biotinylated using EZ-Link Sulfo-NHS-LC-biotin
(Pierce) and detected with SA- conjugated fluorochromes. This
procedure eliminated secondary Ab cross-reactivity with murine
cells.
Yeast Display Mapping
[0426] The Ig domain of the C57BL/6 BTLA allele was amplified from
cDNA using the primers 5'-GGAATTCCATATGCAGCCAAGTCCTGCCTG-3' (SEQ ID
NO: 21) and 5'-CATGCTAGCGAGAAAGCTACTAAGAGGAA-3' (SEQ ID NO: 22) and
subcloned into the NdeI and the NheI sites of the pCT302-AGA2d
vector to create an HA-tagged fusion to the Aga2 peptide.
QuickChange mutagenesis was used to introduce mutations into this
construct using the following primer pairs:
TABLE-US-00003 C26At, (SEQ ID NO: 23)
CAGTGCAACTTAATATTACGAGGAATTCCAAACAG; C26Ab, (SEQ ID NO: 24)
CTCGTAATATTAAGTTGCACTGGACACTCTT; C32At, (SEQ ID NO: 25)
GCAACTTACTATTAAGAGGAATTCCAAACAGTCTGC; C32Ab, (SEQ ID NO: 26)
AATTCCTCTTAATAGTAAGTTGCACTGGACA; G48Ct, (SEQ ID NO: 27)
GAATCCCAAACACTCTGCCAGGACAGGAGAGT; G48Cb, (SEQ ID NO: 28)
CTGGCAGAGTGTTTGGAATTCCTCGTAATAG; A55Tt, (SEQ ID NO: 29)
ACAGTCTGCCTGGACAGGAGAGTTATTTAAAATT; A55Tb, (SEQ ID NO: 30)
TCCTGTCCAGGCAGACTGTTTTGAATTCCT; C79Gt, (SEQ ID NO: 31)
GAGTTATTTAAAATTGAATGTCCTGTGAAATACTGTGT; C79Gb, (SEQ ID NO: 32)
AGGACATTCAATTTTAAATAACTCTCCTGTCC; T147Gt, (SEQ ID NO: 33)
ATGGAACAATCTGGGTACCCCTTGAGGTTAGCC; T147Gb, (SEQ ID NO: 34)
GGGTACCCAGATTGTTCCATTGTGCTTAC; A163G/T168Gt, (SEQ ID NO: 35)
TTGAGGTTGGCCCGCAGCTATACACTAG; A163/T168Gb, (SEQ ID NO: 36)
GCTGCGGGCCAACCTCAAGGGGTACACAGA; A197Gt, (SEQ ID NO: 37)
TTGGGAAGAAAATCGATCAGTTCCGGTTTTTGTTCT; A197Gb, (SEQ ID NO: 38)
AACTGATCGATTTTCTTCCCAACTAGTGTA; C320Gt, (SEQ ID NO: 39)
ATCCATGTGAGAGAAAGGACTCAAAACTCTTCA; and C320Gb, (SEQ ID NO: 40)
AGTCCTTTCTCTCACATGGATGGTTACTGAATG.
[0427] Transformation of EBY100.Agal yeast with each construct
resulted in surface expression of the BTLA mutant. Expression level
was confirmed by anti-HA staining. Yeast cells were stained with
anti-BTLA Abs as indicated to determine mutations that abolished Ab
recognition.
CD4+ T Cell Activation and Expression Analysis
[0428] DOI 1.10 TCR transgenic cells were activated with 0.3 .mu.M
OVA peptide (amino acids 323- 339) and irradiated (2000 rad) BALB/c
splenic APCs. Th1 conditions consisted of heat-killed Listeria
monocytogenes, IL-2 (40 U/ml; Takeda Chemical Industries), and 10
.mu.g/ml anti-IL- 4 (11 B11). Th2 cells were differentiated in 100
U/ml IL-4, 3 pg/ml anti-IL-12 (TOSH), and IL-2. Cells were
restimulated with Ag and APCs on days 7 and 14. Th1/Th2 phenotypes
were confirmed at days 7 and 14 by intracellular cytokine staining
for IFN-.gamma. and IL-4.
Gene Microarray
[0429] Anergic T cells were isolated by adoptively transferring
2.5.times.10.sup.6 Thy1.1+HA-specific T cells to recipient mice
(C3-HAhigh). After 4 days in vivo, animals were sacrificed via
CO.sub.2 asphyxiation. Spleens were harvested, and subjected to ACK
lysis. Adoptively transferred HA-specific T cells were enriched by
binding the resulting cells with Abs to CD8a (53-6.7), B220
(RA3-6B2) and Thy1.2 (30-H12), followed by incubation with
SA-conjugated magnetic microbeads (Miltenyi Biotec). Unwanted cells
were depleted by passage over LS columns (Miltenyi Biotec)
according to the manufacturer's protocol. The remaining cells were
stained with an Ab to Thy1.1 (OX-7) and further enriched using
fluorescence-based cell sorting on a FACSVantage TurboSort (BD
Biosciences). The resulting populations were between 95 and 99%
pure. Cells were kept at 4.degree. C. throughout the enrichment
procedure. In vitro assays confirmed the anergic phenotype of the
sorted cells. All Abs were purchased from BD Pharmingen. This
procedure specifically avoids ligation of the TCR or CD4 during the
isolation process. Activated, memory and naive clonal T cells were
isolated in an analogous manner, using a specific viral construct
(vaccinia-HA) to activate the cells after adoptive transfer to
nontransgenic B10.d2 mice. RNA was isolated from each T cell
population using the RNAeasy kit according to the manufacturer's
instructions (Qiagen), and cRNA probe was prepared. Fragmented cRNA
was hybridized to mouse GeneChips MU174A, MU174B, and MU174C per
Affymetrix standard hybridization protocol. Each chip contained
about 12,000 different genes (chip A) per expressed sequence tag
(EST) with (chips B and C), for a total of about 36,000 genes per
EST from the three chips. A single gene/EST was represented by a
probe set defined by 16-20 perfect match oligonucleotides that span
the length of the gene, as well as 16 oligonucleotides with 1 by
mismatch. The intensity of a gene was determined by evaluating the
perfect match and mismatch intensities, as described in Affymetrix
Microarray Suite, version 5.1 software (Affymetrix). The experiment
was replicated once, for a total of two replicate intensities
within each condition. To identify probe sets associated with an
anergic phenotype, we used the hypothesis-based analysis of
microarrays algorithm with the boolean hypothesis day 4
anergy>naive AND day 4 anergy>day 4 activation.
Assessment of Anergy by Proliferation
[0430] On indicated days following transfer of HA-TCR transgenic T
cells, 20.times.10.sup.6 splenocytes were incubated with increasing
doses of HA peptide. Proliferation was assayed after 48 h, with a
[.sup.3H]thymidine pulse in the final 12 h.
BTLA Expression by Naive, Activated, and Anergic CD4+ T Cells
[0431] HA-TCR transgenic T cells were enriched by depletion of CD8+
and B220+ cells as earlier described. Cells were CFSE-labeled
before adoptive transfer of 2.5.times.10.sup.6 clonotypic cells via
tail vein injection. Cells were stained with anti-Thy1.1 PerCP and
the anti-BTLA Ab 6F7-biotin, followed by SA-PE.
Purification and Activation of CD44-CD25+ T Regulatory Cells
[0432] Splenocytes and lymph node cells from BALB/c mice were
isolated. Following erythrocyte lysis, B220+ cells were depleted by
magnetic separation with anti-B220 Microbeads (Miltenyi Biotec).
The negative fraction was stained with CD25-PE (BD Pharmingen) and
anti-PE Microbeads (Miltenyi Biotec) and magnetically separated
into CD25+ and CD25- fractions. Enrichment was assessed by FACS as
shown (see FIG. 14d). Contaminating non-CD4+ cells were mainly
B220+ or CD8+ cells. To activate T cells, 1.times.10.sup.6 cells/ml
of each fraction were cultured on flat-bottom plates coated with 10
ug/ml 2G11 (anti-CD3; BD Pharmingen) for 48 h. Cells were pulse
with 1 .mu.Ci/well [.sup.3H]thymidine for an additional 12 h.
Ab Response to NP-Ficoll
[0433] Eight-week-old BTLA+/+ and BTLA-/- littermate mice on the
129SvEv background were immunized i.p. with 50 pg of nitrophenyl
(NP)-Ficoll (Biosearch Technologies) in Imject alum (Pierce). Sera
were collected on day 14, and the titers of anti-NP were determined
by ELISA using NP25-BSA (Biosearch Technologies) for Ab capture and
the Southern Biotechnology clonotyping/HRP kit for IgG
subclass-specific ELISA (Southern Biotechnology Associates).
[0434] For further details regarding Example II, including
references, see Hurchla et al., J. Immunol., 174: 3377-3385, 2005,
which is expressly incorporated herein in its entirety by
reference.
(III) BTLA-HVEM Effects in Graft Survival
BMA and HVEM Regulate Acceptance of Partially MHC-Mismatched
Cardiac Allografts
[0435] Primarily vascularized cardiac allografts are the most
frequent organ transplant undertaken in mice and may be performed
across full MHC disparities, with rejection in 7-8 days, or across
MHC class I or II disparities, which leads to long-term survival
(>100 days). The basis for this unexpectedly long-term survival
of cardiac transplants across partial MHC disparities is unknown
and has received little attention. As anticipated from the
literature, we indeed found that cardiac allografts performed
across an MHC class II mismatch (Bm12 B6) survived long term in
wild-type recipients (mean survival time (MST), >100 days; n=6).
Histologic assessment of these allografts harvested at 2 wk after
transplant showed preservation of myocardial architecture and
generally only sparse mononuclear cell infiltration (FIG. 29a). In
contrast, BTLA-/- recipients rejected Bm12 cardiac allografts by
2-3 wk after transplant (MST, 14.3.+-.3.8 days; n=12; p<0.001),
and histology showed a marked increase in leukocyte infiltration
and myocardial injury (FIG. 29a). In addition, comparable
abrogation of Bm12 allograft survival was seen with mAb targeting
of BTLA in wild-type recipients (MST, 23.2.+-.3.2; n=6; p<0.001)
or by engraftment of recipients lacking the BTLA ligand, HVEM (MST,
17.4.+-.4.2 days; n=8; p<0.001; FIG. 29a). Thus, BTLA and HVEM
are required to allow long-term survival of partially mismatched
cardiac allografts. In contrast to results obtained with BTLA-/-
recipients, PD-1-/- recipients receiving Bm12 cardiac allografts
exhibited an 80% long-term allograft survival (FIG. 29b), although
we did observe a minor role for PD-1 in regulating responses to
Bm12 cardiac allografts. Dual BTLA-/- and PD-1-/- knockout mice
(DKO) mice rejected Bm12 donor hearts more rapidly (MST, 10.5+1.5
days; n=4) than singly deficient BTLA-/- recipients (p<0.05) or
wild-type controls (p<0.0001; FIG. 29b).
[0436] Like MHC class II-mismatched grafts, MHC class I-mismatched
(Bm1 B6) cardiac allografts survived long term when transplanted to
wild-type B6 mice, but were rejected in BTLA-/- mice (FIG. 29c).
Furthermore, in contrast to wild-type B6 recipients, the MHC class
I-mismatched allografts in BTLA-/- recipients showed increased
mononuclear cell infiltration and progressive tissue damage
indicative of the development of cellular rejection (FIG. 29c).
PD-1-/- recipients receiving Bm1 cardiac allografts had 100%
long-term allograft survival. Collectively, these findings indicate
that BTLA, in contrast to PD-1, is capable of inhibiting the
generation of a functional allogeneic immune response in the
context of partial MHC mismatches.
BTLA Suppresses MHC Class II-Dependent T Cell Responses
[0437] The unexpected rejection of Bm12 allografts by BTLA-/-, but
not PD-1-/-, mice suggested that BTLA and PD-1, or their ligands,
might be differentially expressed in partially MHC-mismatched
allografts. BTLA mRNA expression within Bm12 allografts was 20-fold
higher than PD-1 at 7 days after transplant, whereas no BTLA
expression was detected within Bm12 hearts engrafted into BTLA-/-
recipients, indicating BTLA expression primarily by infiltrating
host leukocytes (FIG. 30a). Comparable BTLA expression was observed
within long-surviving allografts. Unlike BTLA, only very low levels
of PD-1 were detected in Bm12 allografts in either wild-type or
BTLA-/- recipients (FIG. 30a). No differences in the levels of
expression of HVEM, PD-L1, or PD-L2 were seen between wild-type and
BTLA-/- recipients (FIG. 30a). These data suggest that in the Bm12
B6 model, BTLA is the predominant inhibitory receptor expressed by
infiltrating alloreactive T cells, and that in the absence BTLA,
there is no compensatory increase in expression of additional
inhibitory molecules.
[0438] We next studied the in vitro and in vivo responses of T
cells from wild-type and BTLA/- mice to MHC class II Ags. First, we
examined the in vitro proliferation of purified wild-type or
BTLA-/- CD4+ T cells cocultured with irradiated Bm12 DC.
Proliferation of BTLA-/- T cells was increased compared with that
of wild-type T cells, as measured by either BrdU incorporation
(FIG. 30b) or CFSE dilution (FIG. 30c). To assess in vivo
responses, 40 million CFSE-labeled wild-type or BTLA-/- splenocytes
were adoptively transferred into irradiated Bm12 hosts, and donor
CD4+ T cell proliferation was assessed. Although a large portion of
wild-type CD4+ T cells remained undivided 72 h after adoptive
transfer, almost all BTLA-/- CD4+ T cells had entered the cycle and
proceeded through several rounds of division (FIG. 30d). Hence,
BTLA regulates CD4+ T cell alloactivation and proliferative
responses to MHC class II Ags.
[0439] MHC class II-restricted CD4+ T cell proliferation dominates
host alloresponses in the Bm12 B6 model, although host responses
are known to include stimulation of CD8+ precursor CTL by class
II-restricted CD4+ T cells. We found that although proliferative
responses of CD8+ T cells in irradiated Bm 12 hosts were low
compared with those of CD4 cells, the alloactivation and
proliferation of CD8+ T cells from BTLA-/- mice were marginally
increased over control cells in this assay system (FIG. 30e). We
examined recipient anti-donor responder frequencies by ELISPOT,
with the readout of IFN-spot-forming cells by recipient
splenocytes. BTLA-/- recipient splenocytes had significantly higher
anti-donor responder frequencies when challenged with Bm12 APCs
(FIG. 30f), consistent with the increased allogeneic proliferation
in vitro and the accelerated graft rejection in vivo of T cells
from BTLA-/- mice.
Minor Role of BTLA in Fully MHC-Mismatched Alloresponses
[0440] We next tested whether BTLA played a similar dominant role
in regulating responses to fully MHC-mismatched cardiac allografts
as it did for partially MHC-mismatched cardiac allografts.
Wild-type recipients (B6, H-2b) rejected cardiac grafts (BALB/c,
H-2d) in 7-10 days (MST, 8.+-.1 days; n=6), whereas BTLA-/-
recipients showed a small and unexpected prolongation of graft
survival (MST, 12.+-.5 days; n=6; p<0.05; FIG. 31a). In
addition, wild-type mice treated with a neutralizing anti-BTLA mAb
showed a similar prolongation of allograft survival (MST, 13.+-.1
days; n=4; p<0.05) compared with control IgG treated recipients
(MST, 8+1 days; n=4; FIG. 31b). Furthermore, addition of a
subtherapeutic course of rapamycin prolonged graft survival in
wild-type mice by a few days (MST, 11.+-.2 days; n=6; p<0.05),
but significantly prolonged graft survival in BTLA-/- mice (MST,
53.+-.12 days; n=8; p<0.001), with 25% of the latter recipients
achieving long-term acceptance (FIG. 31c). Hence, in the case of
fully MHC-mismatched cardiac allografts, loss of BTLA did not
accelerate allograft rejection, but, rather, caused a surprising,
albeit small, increase in allograft survival. By contrast, the
presence or the absence of BTLA had no effect on the tempo of
rejection of B6 cardiac allografts by BALB/c recipients; all
allografts were rejected within 7-10 days (n=4/group;
p>0.05).
[0441] To understand the prolongation of fully MHC-mismatched graft
survival, we measured the expression of cytokines and chemokine
receptors important to host T cell recruitment in this model, using
allografts harvested 7 days after transplant. We found decreases in
IL-2 and IFN-mRNA in BTLA-/- recipients compared with wild-type
recipients (FIG. 31d). We also found reduced expression of CXCR3
and CCR5 in BTLA-/- recipients compared with wild-type recipients
(FIG. 31d). Therapy with rapamycin accentuated differences in
cytokine and chemokine receptor mRNA expression between BTLA-/- and
wild-type recipients (FIG. 31d). Given a key role for IFN-induced
IFN-inducible protein 10 (IP-10) production in promoting CXCR3+
cell recruitment and allograft rejection in this model, we
performed Western blotting, which confirmed that allografts in
BTLA-/- recipients had reduced IP-10 and CXCR3 proteins compared
with wild-type controls, with or without rapamycin therapy (FIG.
31e).
[0442] To assess whether the lack of BTLA affected the strong
alloactivation and proliferation induced in T cells by 72 h in this
model, we used the parent-to-F1 model involving transfer of
CFSE-labeled cells across fully allogeneic barriers (FIG. 31f). In
this model, the activation and cell cycle progression of CD4+
responses were similar for BTLA-/- and wild-type cells, and CD8+ T
cells from BTLA-/- mice were only marginally decreased compared
with those from wild-type controls (FIG. 31f). However, the
evaluation of intracellular cytokine production by alloreactive T
cells showed decreased IL-2 and IFN-production by alloreactive
BTLA-/- CD4+ and CD8+ T cells compared with wild-type T cells (FIG.
31g). Again, a subtherapeutic rapamycin dose caused a modest
decrease in proliferation of BTLA-/- T cells compared with
wild-type T cells, particularly CD8+ responses (FIG. 31f), and
decreased production of IL-2 and IFN- by both T cell subsets (FIG.
31g). These data indicate that T cell activation, proliferation,
and production of cytokines such as IL-2 and IFN- are decreased in
BTLA-/- mice, especially when recipients are treated with limited
immunosuppression, and that these impaired responses are associated
with modulation of chemokine/chemokine receptor effector
pathways.
Involvement of PD-9 and BTLA in Fully MHC-Mismatched
Alloresponses
[0443] In considering explanations for the differing effects of
BTLA in the partial MHC mismatch and full MHC mismatch models, we
wondered whether differential reliance on PD-1 between these models
might play a role. Therefore, we examined the contributions of both
PD-1 and BTLA in the fully MHC-mismatched model (FIG. 32). We
found, first, that BALB/c cardiac allografts were rejected at
similar rates (p>0.05) by C57BL/6 wild-type mice and DKO mice
(FIG. 32a). Second, consistent with the DKO data, mAb blockade of
PD-1 increased the rate of rejection of fully MHC-mismatched
allografts by BTLA-/- recipients (p<0.001; FIG. 32b). Third, the
duration of allograft survival in BTLA-/- recipients receiving
subtherapeutic course of rapamycin (MST, 53.+-.12 days; n=8) was
markedly decreased by loss of PD-1, as seen by examining either DKO
recipients (MST1 12.8.+-.2.2 days; n=4; p<0.001; FIG. 32c) or by
mAb Ab blockade of PD-1 in BTLA-/- mice (MST, 14.0.+-.3.5 days;
n=4; p<0.001; FIG. 32d). In summary, in contrast to partial
MHC-mismatched allografts, the responses against fully
MHC-mismatched cardiac allografts are regulated by both BTLA and
PD-1.
[0444] We next asked whether PD-1 regulated the proliferation and
function of T cells responding to fully MHC-mismatched allografts.
Analysis by qPCR of BALB/c cardiac allografts harvested on day 7
after transplant from C57BL/6 recipients showed intragraft
expression of BTLA, PD-1, and their ligands, HVEM, PD-L1, and PD-L2
(FIG. 33a). By comparison with wild-type recipients, BALB/c
allografts harvested from BTLA-/- recipients had increased PD-1
expression (FIG. 33a; p<0.01). In contrast to PD-1 expression,
the expression of HVEM, PD-L1, and PD-L2 was not increased in
BTLA-/- recipients. These results suggest that in the absence of
BTLA, host leukocytes might express more PD-1 in response to
allostimulation.
[0445] To directly examine PD-1 expression by alloreactive
wild-type or BTLA-/- T cells, we adoptively transferred
CFSE-labeled splenocytes into irradiated Bm12 (class II-mismatched)
or B6D2F1 (fully MHC-mismatched) recipients. At analysis 72 h
later, we found that in the MHC class II partial mismatch, PD-1 was
weakly expressed by alloreactive CD4+ T cells, but not at all by
CD8+ T cells, from wild-type or BTLA-/- mice (FIG. 33b). In
contrast, with a full MHC mismatch, PD-1 expression by both CD4+
and CD8+ donor T cells was markedly increased, and the extent of
PD-1 expression was higher in BTLA-/- vs wild-type T cells (FIG.
33b). Moreover, treatment with rapamycin reduced PD-1 expression by
wild-type T cells, but had only minor effects on PD-1 induction by
T cells from BTLA-/- mice (FIG. 33b).
[0446] Lastly, we used in vivo and in vitro approaches to examine
the roles of BTLA and PD-1 in regulating T cell proliferation and
cytokine production in response to fully MHC-mismatched
allostimulation (FIGS. 33, c-e). Compared with wild-type or BTLA-/-
cells, DKO cells showed enhanced proliferation (FIGS. 33c) and Th1
cytokine production (FIG. 33d). Therapy with rapamycin decreased
the alloactivation-induced proliferation (FIG. 33c) and cytokine
production (FIG. 33e) of CD4+ and CD8+ T cells from wild-type and
BTLA-/donors, but did not block these events in DKO CD4+ or CD8+ T
cells (FIGS. 33, c and e). Indeed, the production of IL-2 and IFN-
was increased in DKO T cells compared with wild-type and BTLA-/- T
cells (FIG. 33d), including in the presence of rapamycin therapy
(FIG. 33e). Collectively, these data indicate that 1) PD-1
expression is highly induced on the surfaces of alloreactive CD4+
and CD8+ T cells upon exposure to fully MHC-disparate allografts;
2) the levels of PD-1 on alloreactive CD4+ and CD8+ T cells are
still further increased in the absence of BTLA; and 3) increased
PD-1 expression is associated with inhibitory effects on the
alloantigen-induced production of cytokines such as IL-2 and IFN-.
In associated in vitro studies, as T cell activation increased in
response to allogeneic DC (FIG. 34), the induction of PD-1 was
increasingly apparent compared with that of BTLA. BTLA
up-regulation occurred upon T cell activation, but did not show
expansion comparable with that of PD-1 with increasing T cell
activation, suggesting that the strength of T cell activation
determines the relative importance of these two pathways.
Methods (III)
Mice
[0447] BTLA-/-, PD-1-/-, and dual BTLA-/- and PD-1-/- mice were
backcrossed for more than eight generations on a C57BL/6
background; HVEM-/- mice were generated by homologous recombination
and backcrossed more than five generations on a B6 background.
Wild-type C57BL/6 (H-2b), BALB/c (H-2d), C57BL6/DBA F1 (H-2b/d),
Bm12 (B6.C-H2bm12/KhEg), and Bm1 (B6.C-H2bml/ByJ) mice were
purchased from The Jackson Laboratory, housed in specific
pathogen-free conditions, and used for studies approved by the
institutional animal care and use committee of Children's Hospital
of Philadelphia.
[0448] An Armenian hamster anti-mBTLA neutralizing mAb, 6A6, was
described previously in Sedy et al. Nature Immunol. 6:90-98 (2005),
and we purchased mAbs for flow cytometry (BD Pharmingen) and Abs
for Western blotting (Santa Cruz Biotechnology). Labeling of cells
with CFSE (Molecular Probes) was undertaken as previously
reported,
Quantitative PCR (qPCR)
[0449] We performed qPCR as previously described. Briefly, RNA was
extracted with TRIzol (Invitrogen Life Technologies), RT of random
hexamers was performed with an ABI PRISM 5700 unit (Applied
Biosystems), and specific primer and probe sequences for target
genes were used for qPCR amplification of total cDNA (TaqMan PDAR;
Applied Biosystems). Relative quantitation of target cDNA was
determined using a control value of 1; the sample cDNA content was
expressed as the fold change from the control value. Differences in
cDNA input were corrected by normalizing signals obtained with
specific primers to ribosomal RNA; nonspecific amplification was
excluded by performing RT-PCRs without target cDNA.
Flow Cytometry
[0450] Alloreactive T cells were generated by i.v. injection of
40.times.10.sup.6 CFSE-labeled B6 spleen and lymph node cells into
B6/DBA F1 recipients, a parent F1 MHC mismatch in which only donor
cells respond. Splenocytes harvested after 3 days were incubated
with CD4-PE, CD8-PE, CD25-PE, CD44-PE, CD62L-PE, PD-1-PE, ICOS-PE,
and biotin-conjugated anti-H-2Kd and anti-H-2Dd mAb. Donor
alloreactive T cells were identified by gating on H-2Kd and H-2Dd
cells (FACSCalibur; BD Biosciences), and their proliferation was
assessed by CFSE division profiles. For intracellular cytokine
staining, splenocytes (3.times.10.sup.6/ml) were treated with
Golgi-Stop (BD Pharmingen), stimulated for 4 h with PMA (3 ng/ml)
and ionomycin (1 .mu.M) in 24-well plates in complete medium (RPMI
1640, 10% FCS, 100 U/ml penicillin, 100 .mu.g/ml streptomycin, and
50 .mu.M 2-ME), and stained with cell surface markers (CD4-PE or
CD8-PE, biotin-conjugated H-2Kd or H-2Dd, followed by streptavidin-
PerCP), fixed, and stained with IFN-allophycocyanin or
IL-2-allophycocyanin after permeabilization (Perm-Wash buffer; BD
Pharmingen).
In Vitro Cellular Assays
[0451] For propagation of bone marrow-derived DC, bone marrow cells
harvested from the femurs and tibia were cultured for 5-7 days in
24-well plates (2.times.10.sup.6 /well) in medium plus mouse GM-CSF
(5 ng/ml) and IL-4 (10 ng/ml). One-way MLR cultures were performed
in triplicate, using magnetic column-eluted splenic T cells
(2.times.10.sup.5/well) as responders and gamma-irradiated (20 Gy)
DC as stimulators. Cultures were maintained in complete medium for
72-96 h, and T cell proliferation was determined by BrdU
incorporation or CFSE dilution profile. BrdU staining with a BrdU
labeling kit (BD Pharmingen) was performed using the manufacturer's
instructions. Cells were pulsed with BrdU, treated with
FcR-blocking CD16/CD32 mAbs, stained with cell surface markers,
fixed, permeabilized, treated with DNase/Triton X-100, stained with
anti-BrdII mAb, and analyzed by flow cytometry.
ELISPOT
[0452] Immunospot assays for IFN- were performed by coating ELISPOT
plates (BD Pharmingen) with anti-IFN-mAb, blocking, and addition of
responder cells isolated from cardiac transplant recipients plus
donor splenocytes or bone marrow-derived DC as stimulators;
recipient splenocytes or DC were used as syngeneic controls. At 24
h, cells were discarded, and wells were washed, followed by
biotinylated anti-IFN-mAb, streptavidin-HRP, and substrate. Spots
were counted using an Immunospot Analyzer (Cellular Technology),
and recipient anti-donor responder frequency was determined as the
number of IFN-spot-forming cells per-10.sup.6 splenocytes.
Western Blots
[0453] Grafts were sonicated in lysis buffer containing Triton
X-100 and protease inhibitors, followed by centrifugation and assay
of supernatant protein content. Proteins were reduced, separated by
SDS-PAGE, and transferred to nitrocellulose membranes. Membranes
were blocked, incubated with primary and HRP-linked secondary Abs,
and, after the substrate reaction, analyzed using National
Institutes of Health Image.
Transplantation
[0454] Intra-abdominal vascularized cardiac allografting was
performed as previously described using 6- to 8-wk-old mice.
Briefly, donor ascending aorta and pulmonary artery were
anastomosed end-to-side to recipient infrarenal aorta and inferior
vena cava, respectively. Graft survival was assessed twice daily by
abdominal palpation; rejection was defined as total cessation of
cardiac contraction and was confirmed by histology.
Immunopathology
[0455] Portions of harvested allografts were fixed in formalin,
paraffin-embedded or snap-frozen, and analyzed by immunoperoxidase
staining with mAbs and an Envision kit (DakoCytomation).
Statistics
[0456] Allograft survival was used to generate Kaplan-Meier
survival curves, and comparison between groups was performed by
log-rank analysis.
[0457] For further details regarding Example III, including
references, see Tao et al., J. Immunol., 175:5774-5782, 2005, which
is expressly incorporated herein in its entirety by reference.
(IV) BTLA-HVEM Effects in Asthma
Regulated Expression of PD-1 and BTLA During Acute Allergic Airway
Inflammation.
[0458] We first determined the kinetics of lymphocyte accumulation
and receptor expression in vivo by examining the cells recovered in
the bronchoalveolar lavage (BAL) fluid. Mice were systemically
sensitized and challenged with OVA. At 1, 3, 4, or 7 days following
challenge groups of mice were euthanized and BAL performed. On 1
day following challenge, few CD4+ T cells were found in the BAL
fluid. Significantly increased numbers of CD4 T cells appeared by
day 3 which peaked by day 7 post-challenge (FIG. 25). We next
examined the expression of PD-1 and BTLA on CD4 T cells recovered
in the BAL fluid. Consistent with previous reports that PD-1
expression is induced on activated cells, we found that PD-1
expression gradually increased, being detectible on day 3 and
reaching its maximum on day 7 following challenge. BTLA expression
exhibited a reciprocal pattern with expression being greatest on
day 3 and nearly undetectable by day 7 (FIG. 25).
[0459] Given the distinct patterns of expression of these receptors
on BAL T cells, we next examined the phenotype of mice deficient in
either BTLA or PD-1 in the acute allergic airway inflammation model
(FIG. 26). Both BTLA-deficient and PD-1-deficient mice showed some
increase in inflammatory cell recruitment compared to wild type
mice (FIGS. 26a and 26b). All genotypes had a mixed inflammatory
cell infiltrate, although there was an increased percentage of
neutrophils and eosinophils in the BTLA deficient mice (FIGS. 26a
and 26b). Examination of the lung tissues revealed a mild increase
in the intensity of inflammatory infiltrates in PD-1 and
BTLA-deficient animals compared to wild type controls. Thus, while
PD-1 and BTLA have been reported as being potent inhibitory
receptors, we found only a relatively mild increase in the
inflammatory response following of acute allergic airway
inflammation in the absence of either of these inhibitory
receptors.
Delayed Expression of Ligands for BTLA and PD-1 in Acute Allergic
Airway Inflammation.
[0460] Given the documented inhibitory activity of BTLA and PD-1 in
vivo, we were surprised that the absence of either of these
receptors did not have a greater effect on acute airway
inflammation. We therefore speculated that the ligands for these
receptors might not be expressed thereby not allowing this axis of
regulation to be apparent. We examined the expression of mRNA for
Herpes Virus Entry Mediator (HVEM), the ligand for BTLA, and PD-L1
and PD-L2, the ligands for PD-1, during an extended time course of
airway inflammation (FIG. 27). Expression of HVEM message was
nearly undetectable in the first four days of acute allergic airway
inflammation following challenge but became apparent by day 7 and
was maximal by day 10 and 15 (FIG. 25, upper panels). Likewise, the
expression of PD-L1 was first detectable at day 2, but remained
relatively low in expression until approximately day 7 to day 10.
Expression of PD-L2, a second ligand for PD-1, was maximum at day 4
following intranasal challenge, and declined subsequently.
Interestingly, both HVEM and PD-L1 were detectable in RNA samples
obtained from cultured murine tracheal epithelial cells (mTEC),
suggesting that the source of ligand may be non-immune cells of the
lung.
BTLA and PD-1 Limit the Duration of Acute Allergic Airway
Inflammation.
[0461] Because the ligands for PD-1 and BTLA were maximally
expressed in the second week following intranasal challenge, we
next examined BAL cell numbers and compositions at day 10 and day
15 following intranasal challenge (FIG. 28). Wild type mice had
completely resolved the inflammation, as evidenced by a low number
of cells recovered in the BAL fluid and histology at days 10 and 15
following challenge. In stark contrast, mice deficient in BTLA and
PD-1 showed a persistent increase in BAL cells on day 10 following
intranasal challenge. Furthermore, the composition of these cells
in this fluid revealed a greater proportion of lymphocytes and
eosinophils in comparison to the few cells in the wild type mice,
which consisted predominantly of macrophages. Even on day 15,
examination of BTLA-deficient mice revealed the continued presence
increased numbers of lymphocytes and eosinophils: Direct
histological examination of H and E stained sections also
demonstrated persistent inflammation in the lungs of both PD-1 and
BTLA-deficient mice at days 10 and 15, whereas the wild type mice
had complete resolution in this time frame. Thus, these receptors
are critical for the normal resolution of airway inflammation.
[0462] T cell dependent immune responses are determined by the
coordinate integration of signals derived from both cell:cell
interactions and soluble mediators. We have recently described a
novel role for CD28 signaling not only in the early priming phase
but also in maintenance of the effector phase of allergic airway
inflammation. These studies focused on an acute model, acting
between days 1 and 3. By contrast, the present results show that
the inhibitory receptors BTLA and PD-1 exert a slight effect in
attenuating the degree of acute inflammation but have a profound
effect on the duration of inflammation, suggesting they act to
terminate the immune response. We also observed a temporal
regulation of expression of the ligands for these receptors during
the course of the inflammatory response. Therefore, these data
support that the regulated expression of inhibitory receptors on
lymphocytes and their ligands in the lung are critical for the
proper termination of the acute inflammatory response. In the
absence of the inhibitory receptors on lymphocytes, the normally
self limited acute inflammatory response progresses to a chronic
infiltrate that persists for at least 15 days. We propose, based on
these findings, that abnormalities in this axis could play a role
in pathologic situations such as chronic persistent asthma and may
represent novel targets for therapeutic intervention.
Methods (IV)
Mice
[0463] BTLA-deficient mice were generated as previously described.
PD-1 deficient mice were obtained from Tasuka Honjo (Kyoto
University, Kyoto Japan). C57BL/6 mice were purchased from Jackson
Laboratories (Bar Harbor, Me.). All mice were housed in specific
pathogen free facilities at Washington University School of
Medicine. All animal studies have been approved by the Washington
University Animal Studies Committee.
Antibodies
[0464] Anti-BTLA antibody (Clone 6F7, mouse IgG1) was generated as
previously described. Anti-PD-1 and anti-CD4 antibodies were
purchased from Ebiosciences. Flow cytometric analysis was performed
on a FacsCalibur cytometer using Cellquest software (Becton
Dickinson Corporation). Analysis was performed using FloJo
software.
RT-PCR
[0465] Total RNA was extracted from lung tissue of control or
allergen challenged mice using Trizol (Invitrogen). Random primed
cDNA was prepared using the Retroscript kit (Ambion). Specific
primers for PDL1, PDL2 and HVEM were designed that spanned intronic
sequences. Control primers amplify ribosomal S15 RNA and are
provided with the Retroscript Kit.
Experimental Allergic Airway Inflammation
[0466] Mice were sensitized and challenged with Ovalbumin. Briefly,
mice were injected i.p. with Ova adsorbed to alum on days 0 and 7.
On day 14 they received an intranasal challenge of 50 .mu.l of 1%
Ova in the morning and afternoon. Samples were collected as
previously described on the indicated days following inhaled
challenge.
[0467] Preparation of murine tracheal epithelial cells: Primary
mouse airway epithelial cells were cultured and differentiated
using an established high fidelity model of the mouse airway.
Briefly, epithelial cells were harvested from mouse tracheas of
C57/BL6 strain mice (5-6 weeks old) using pronase digestion. Cells
were purified by differential adherence of fibroblasts to yield a
preparation composed of greater than 99% epithelial cells
determined by expression of cytokeratin. Mouse tracheal epithelial
cells (MTEC) were cultured in the presence of growth factor
supplemented media on semi-permeable membranes (Transwell,
Corning-Costar, Corning, N.Y.). Media was maintained in upper and
lower chambers until the transmembrane resistance was greater than
1,000 Ohms.sup.-cm2 indicating tight junction formation. Media was
then removed from the upper chamber to establish an air-liquid
interface (ALI) condition used for epithelial cell differentiation.
Cells were differentiated for at least 7 days at ALI to generate a
multilayer model of the airway composed of ciliated, secretory, and
basal airway epithelial cells. RNA was prepared from day 7 ALI
cultures using Trizol reagent.
(V) Effect of BTLA Loss of Function on Humoral Response
[0468] We immunized cohorts of mice with one injection of NP-Ficoll
in alum and measured production of anti-NP antibodies of specific
isotypes on day 14. For the isotypes IgM, IgG1, IgA, we found no
specific changes in levels of anti-NP antibodies. For IgG2a or
IgG2b, we found only slight increases in anti-NP antibodies in the
BTLA-/- compared to wild type mice. However, for antibodies of the
IgG3 isotype, which is primarily associated with T-independent
responses, we found approximately a two-fold increased in anti-NP
specific antibodies in BTLA-/- mice compared to wild type mice.
[0469] In addition, spontaneous germinal centers have been observed
at a higher frequency than control in aging BTLA-/- mice.
(VI) BTLA Modulates Response to Viral Infection
[0470] Wildtype and BTLA knockout mice were infected with Sendai
virus and monitored for three weeks. BTLA knockout mice maintained
higher body weight and exhibited greater survival following
infection with Sendai virus. Similar results were obtained using
West Nile virus.
Sequence CWU 1
1
401305PRTMus musculus 1Met Lys Thr Val Pro Ala Met Leu Gly Thr Pro
Arg Leu Phe Arg Glu1 5 10 15Phe Phe Ile Leu His Leu Gly Leu Trp Ser
Ile Leu Cys Glu Lys Ala 20 25 30Thr Lys Arg Asn Asp Glu Glu Cys Pro
Val Gln Leu Thr Ile Thr Arg 35 40 45Asn Ser Lys Gln Ser Ala Arg Thr
Gly Glu Leu Phe Lys Ile Gln Cys 50 55 60Pro Val Lys Tyr Cys Val His
Arg Pro Asn Val Thr Trp Cys Lys His65 70 75 80Asn Gly Thr Ile Cys
Val Pro Leu Glu Val Ser Pro Gln Leu Tyr Thr 85 90 95Ser Trp Glu Glu
Asn Gln Ser Val Pro Val Phe Val Leu His Phe Lys 100 105 110Pro Ile
His Leu Ser Asp Asn Gly Ser Tyr Ser Cys Ser Thr Asn Phe 115 120
125Asn Ser Gln Val Ile Asn Ser His Ser Val Thr Ile His Val Thr Glu
130 135 140Arg Thr Gln Asn Ser Ser Glu His Pro Leu Ile Ile Ser Asp
Ile Pro145 150 155 160Asp Ala Thr Asn Ala Ser Gly Pro Ser Thr Met
Glu Glu Arg Pro Gly 165 170 175Arg Thr Trp Leu Leu Tyr Thr Leu Leu
Pro Leu Gly Ala Leu Leu Leu 180 185 190Leu Leu Ala Cys Val Cys Leu
Leu Cys Phe Leu Lys Arg Ile Gln Gly 195 200 205Lys Glu Lys Lys Pro
Ser Asp Leu Ala Gly Arg Asp Thr Asn Leu Val 210 215 220Asp Ile Pro
Ala Ser Ser Arg Thr Asn His Gln Ala Leu Pro Ser Gly225 230 235
240Thr Gly Ile Tyr Asp Asn Asp Pro Trp Ser Ser Met Gln Asp Glu Ser
245 250 255Glu Leu Thr Ile Ser Leu Gln Ser Glu Arg Asn Asn Gln Gly
Ile Val 260 265 270Tyr Ala Ser Leu Asn His Cys Val Ile Gly Arg Asn
Pro Arg Gln Glu 275 280 285Asn Asn Met Gln Glu Ala Pro Thr Glu Tyr
Ala Ser Ile Cys Val Arg 290 295 300Ser3052289PRTHomo sapiens 2Met
Lys Thr Leu Pro Ala Met Leu Gly Thr Gly Lys Leu Phe Trp Val1 5 10
15Phe Phe Leu Ile Pro Tyr Leu Asp Ile Trp Asn Ile His Gly Lys Glu
20 25 30Ser Cys Asp Val Gln Leu Tyr Ile Lys Arg Gln Ser Glu His Ser
Ile 35 40 45Leu Ala Gly Asp Pro Phe Glu Leu Glu Cys Pro Val Lys Tyr
Cys Ala 50 55 60Asn Arg Pro His Val Thr Trp Cys Lys Leu Asn Gly Thr
Thr Cys Val65 70 75 80Lys Leu Glu Asp Arg Gln Thr Ser Trp Lys Glu
Glu Lys Asn Ile Ser 85 90 95Phe Phe Ile Leu His Phe Glu Pro Met Leu
Pro Asn Asp Asn Gly Ser 100 105 110Tyr Arg Cys Ser Ala Asn Phe Gln
Ser Asn Leu Ile Glu Ser His Ser 115 120 125Thr Thr Leu Tyr Val Thr
Asp Val Lys Gly Ala Ser Glu Arg Pro Ser 130 135 140Lys Asp Glu Val
Ala Ser Arg Pro Trp Leu Leu Tyr Ser Leu Leu Pro145 150 155 160Leu
Gly Gly Leu Pro Leu Leu Ile Thr Thr Trp Phe Cys Leu Phe Cys 165 170
175Cys Leu Arg Arg His Gln Gly Lys Gln Asn Glu Leu Ser Asp Thr Ala
180 185 190Gly Arg Glu Ile Asn Leu Val Asp Ala His Leu Lys Ser Glu
Gln Thr 195 200 205Glu Ala Ser Thr Arg Gln Asn Ser Gln Val Leu Leu
Ser Glu Ala Gly 210 215 220Ile Tyr Asp Asn Asp Pro Asp Leu Cys Phe
Arg Met Gln Glu Gly Ser225 230 235 240Glu Val Cys Ser Asn Pro Cys
Leu Glu Glu Asn Lys Pro Gly Ile Val 245 250 255Tyr Ala Ser Leu Asn
His Ser Val Ile Gly Leu Asn Ser Arg Leu Ala 260 265 270Arg Asn Val
Lys Glu Ala Pro Thr Glu Tyr Ala Ser Ile Cys Val Arg 275 280 285Ser
3107PRTMus musculus 3Asp Glu Glu Cys Glu Val Gln Leu Asn Ile Lys
Arg Asn Ser Lys His1 5 10 15Ser Ala Trp Thr Gly Glu Leu Phe Lys Ile
Glu Cys Pro Val Lys Tyr 20 25 30Cys Val His Arg Pro Asn Val Thr Trp
Cys Lys His Asn Gly Thr Ile 35 40 45Trp Val Pro Leu Glu Val Gly Pro
Gln Leu Tyr Thr Ser Trp Glu Glu 50 55 60Asn Arg Ser Val Pro Val Phe
Val Leu His Phe Lys Pro Ile His Leu65 70 75 80Ser Asp Asn Gly Ser
Tyr Ser Cys Ser Thr Trp Phe Trp Ser Gln Val 85 90 95Ile Asn Ser His
Ser Val Thr Ile His Val Arg 100 1054107PRTMus musculus 4Asp Glu Glu
Cys Glu Val Gln Leu Asn Ile Lys Arg Asn Ser Lys His1 5 10 15Ser Ala
Trp Thr Gly Glu Leu Phe Lys Ile Glu Cys Pro Val Lys Tyr 20 25 30Cys
Val His Arg Pro His Val Thr Trp Cys Lys His Asn Gly Thr Ile 35 40
45Trp Val Pro Leu Glu Val Gly Pro Gln Leu Tyr Thr Ser Trp Glu Glu
50 55 60Asn Arg Ser Val Pro Val Phe Val Leu His Phe Lys Pro Ile His
Leu65 70 75 80Ser Asp Asn Gly Ser Tyr Ser Cys Ser Thr Trp Phe Trp
Ser Gln Val 85 90 95Ile Trp Ser His Ser Val Thr Ile His Val Arg 100
1055107PRTMus musculus 5Asp Glu Glu Cys Pro Val Gln Leu Thr Ile Thr
Arg Asn Ser Lys Gln1 5 10 15Ser Ala Arg Thr Gly Glu Leu Phe Lys Ile
Gln Cys Pro Val Lys Tyr 20 25 30Cys Val His Arg Pro Asn Val Thr Trp
Cys Lys His Asn Gly Thr Ile 35 40 45Cys Val Pro Leu Glu Val Ser Pro
Gln Leu Tyr Thr Ser Trp Glu Glu 50 55 60Asn Gln Ser Val Pro Val Phe
Val Leu His Phe Lys Pro Ile His Leu65 70 75 80Ser Asp Asn Gly Ser
Tyr Ser Cys Ser Thr Asn Phe Asn Ser Gln Val 85 90 95Ile Trp Ser His
Ser Val Thr Ile His Val Thr 100 1056283PRTHomo sapiens 6Met Glu Pro
Pro Gly Asp Trp Gly Pro Pro Pro Trp Arg Ser Thr Pro1 5 10 15Arg Thr
Asp Val Leu Arg Leu Val Leu Tyr Leu Thr Phe Leu Gly Ala 20 25 30Pro
Cys Tyr Ala Pro Ala Leu Pro Ser Cys Lys Glu Asp Glu Tyr Pro 35 40
45Val Gly Ser Glu Cys Cys Pro Lys Cys Ser Pro Gly Tyr Arg Val Lys
50 55 60Glu Ala Cys Gly Glu Leu Thr Gly Thr Val Cys Glu Pro Cys Pro
Pro65 70 75 80Gly Thr Tyr Ile Ala His Leu Asn Gly Leu Ser Lys Cys
Leu Gln Cys 85 90 95Gln Met Cys Asp Pro Ala Met Gly Leu Arg Ala Ser
Arg Asn Cys Ser 100 105 110Arg Thr Glu Asn Ala Val Cys Gly Cys Ser
Pro Gly His Phe Cys Ile 115 120 125Val Gln Asp Gly Asp His Cys Ala
Ala Cys Arg Ala Tyr Ala Thr Ser 130 135 140Ser Pro Gly Gln Arg Val
Gln Lys Gly Gly Thr Glu Ser Gln Asp Thr145 150 155 160Leu Cys Gln
Asn Cys Pro Pro Gly Thr Phe Ser Pro Asn Gly Thr Leu 165 170 175Glu
Glu Cys Gln His Gln Thr Lys Cys Ser Trp Leu Val Thr Lys Ala 180 185
190Gly Ala Gly Thr Ser Ser Ser His Trp Val Trp Trp Phe Leu Ser Gly
195 200 205Ser Leu Val Ile Val Ile Val Cys Ser Thr Val Gly Leu Ile
Ile Cys 210 215 220Val Lys Arg Arg Lys Pro Arg Gly Asp Val Val Lys
Val Ile Val Ser225 230 235 240Val Gln Arg Lys Arg Gln Glu Ala Glu
Gly Glu Ala Thr Val Ile Glu 245 250 255Ala Leu Gln Ala Pro Pro Asp
Val Thr Thr Val Ala Val Glu Glu Thr 260 265 270Ile Pro Ser Phe Thr
Gly Arg Ser Pro Asn His 275 2807276PRTMus musculus 7Met Glu Pro Leu
Pro Gly Trp Gly Ser Ala Pro Trp Ser Gln Ala Pro1 5 10 15Thr Asp Asn
Thr Phe Arg Leu Val Pro Cys Val Phe Leu Leu Asn Leu 20 25 30Leu Gln
Arg Ile Ser Ala Gln Pro Ser Cys Arg Gln Glu Glu Phe Leu 35 40 45Val
Gly Asp Glu Cys Cys Pro Met Cys Asn Pro Gly Tyr His Val Lys 50 55
60Gln Val Cys Ser Glu His Thr Gly Thr Val Cys Ala Pro Cys Pro Pro65
70 75 80Gln Thr Tyr Thr Ala His Ala Asn Gly Leu Ser Lys Cys Leu Pro
Cys 85 90 95Gly Val Cys Asp Pro Asp Met Gly Leu Leu Thr Trp Gln Glu
Cys Ser 100 105 110Ser Trp Lys Asp Thr Val Cys Arg Cys Ile Pro Gly
Tyr Phe Cys Glu 115 120 125Asn Gln Asp Gly Ser His Cys Ser Thr Cys
Leu Gln His Thr Thr Cys 130 135 140Pro Pro Gly Gln Arg Val Glu Lys
Arg Gly Thr His Asp Gln Asp Thr145 150 155 160Val Cys Ala Asp Cys
Leu Thr Gly Thr Phe Ser Leu Gly Gly Thr Gln 165 170 175Glu Glu Cys
Leu Pro Trp Thr Asn Cys Ser Ala Phe Gln Gln Glu Val 180 185 190Arg
Arg Gly Thr Asn Ser Thr Asp Thr Thr Cys Ser Ser Gln Val Val 195 200
205Tyr Tyr Val Val Ser Ile Leu Leu Pro Leu Val Ile Val Gly Val Gly
210 215 220Ile Ala Gly Phe Leu Ile Cys Thr Arg Arg His Leu His Thr
Ser Ser225 230 235 240Val Ala Lys Glu Leu Glu Pro Phe Gln Gln Glu
Gln Gln Glu Asn Thr 245 250 255Ile Arg Phe Pro Val Thr Glu Val Gly
Phe Ala Glu Thr Glu Glu Glu 260 265 270Thr Ala Ser Asn 275821DNAMus
musculus 8atggtccttc taagagtgaa c 21921DNAMus musculus 9atagatggtc
tggggtagat c 211019DNAMus musculus 10caggctcctt cctcacagc
191119DNAMus musculus 11ctaagaggtc tctgggcag
191230DNAArtificialPRIMER 12catgccatgg agaaagctac taagaggaat
301329DNAArtificialPRIMER 13cgggatcctg aagagttttg agtcctttc
291417PRTArtificialBIOTINYLATION SEQUENCE 14Gly Gly Gly Leu Asn Asp
Ile Phe Glu Ala Gln Lys Ile Glu Trp His1 5 10
15Glu1526DNAArtificialPRIMER 15agctctgaag atctctaggg aggaag
261631DNAArtificialPRIMER 16ccttgctcac acttctcaca caaatggatg c
311729DNAArtificialPRIMER 17tgtgagaagt gtgagcaagg gcgaggagc
291832DNAArtificialPRIMER 18acgcgtcgac ttacttgtac agctcgtcca tg
321930DNAArtificialPRIMER 19gttgatattc cagtgagcaa gggcgaggag
302031DNAArtificialPRIMER 20cttgctcact ggaatatcaa ccaggttagt g
312130DNAArtificialPRIMER 21ggaattccat atgcagccaa gtcctgcctg
302229DNAArtificialPRIMER 22catgctagcg agaaagctac taagaggaa
292335DNAArtificialPRIMER 23cagtgcaact taatattacg aggaattcca aacag
352431DNAArtificialPRIMER 24ctcgtaatat taagttgcac tggacactct t
312536DNAArtificialPRIMER 25gcaacttact attaagagga attccaaaca gtctgc
362631DNAArtificialPRIMER 26aattcctctt aatagtaagt tgcactggac a
312732DNAArtificialPRIMER 27gaatcccaaa cactctgcca ggacaggaga gt
322831DNAArtificialPRIMER 28ctggcagagt gtttggaatt cctcgtaata g
312934DNAArtificialPRIMER 29acagtctgcc tggacaggag agttatttaa aatt
343030DNAArtificialPRIMER 30tcctgtccag gcagactgtt ttgaattcct
303138DNAArtificialPRIMER 31gagttattta aaattgaatg tcctgtgaaa
tactgtgt 383232DNAArtificialPRIMER 32aggacattca attttaaata
actctcctgt cc 323333DNAArtificialPRIMER 33atggaacaat ctgggtaccc
cttgaggtta gcc 333429DNAArtificialPRIMER 34gggtacccag attgttccat
tgtgcttac 293528DNAArtificialPRIMER 35ttgaggttgg cccgcagcta
tacactag 283630DNAArtificialPRIMER 36gctgcgggcc aacctcaagg
ggtacacaga 303736DNAArtificialPRIMER 37ttgggaagaa aatcgatcag
ttccggtttt tgttct 363830DNAArtificialPRIMER 38aactgatcga ttttcttccc
aactagtgta 303933DNAArtificialPRIMER 39atccatgtga gagaaaggac
tcaaaactct tca 334033DNAArtificialPRIMER 40agtcctttct ctcacatgga
tggttactga atg 33
* * * * *