U.S. patent application number 13/053169 was filed with the patent office on 2011-09-22 for methods for identifying modulators of apoptosis.
This patent application is currently assigned to Sanford-Burnham Medical Research Institute. Invention is credited to Bin Guo, John C. Reed.
Application Number | 20110230364 13/053169 |
Document ID | / |
Family ID | 23305812 |
Filed Date | 2011-09-22 |
United States Patent
Application |
20110230364 |
Kind Code |
A1 |
Reed; John C. ; et
al. |
September 22, 2011 |
METHODS FOR IDENTIFYING MODULATORS OF APOPTOSIS
Abstract
The invention provides a method of identifying an effective
compound that modulates the binding of Humanin to Bax or Bid. The
invention also provides a method of identifying an effective
compound that modulates an activity of Bax or Bid. In addition, the
invention provides a method of identifying a Humanin-like compound
that binds to Bax or Bid or modulates an activity of Bax or Bid, or
inhibits the apoptotic activity of Bax or Bid. The invention
further provides an isolated polypeptide containing a
mitochondrial-derived form of Humanin (SEQ ID NO:3) or a functional
fragment thereof where the fragment contains the methionine at
position 16 of SEQ ID NO:3.
Inventors: |
Reed; John C.; (Rancho Sant
Fe, CA) ; Guo; Bin; (San Diego, CA) |
Assignee: |
Sanford-Burnham Medical Research
Institute
La Jolla
CA
|
Family ID: |
23305812 |
Appl. No.: |
13/053169 |
Filed: |
March 21, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12206670 |
Sep 8, 2008 |
7927816 |
|
|
13053169 |
|
|
|
|
10306878 |
Nov 27, 2002 |
7422862 |
|
|
12206670 |
|
|
|
|
60334149 |
Nov 28, 2001 |
|
|
|
Current U.S.
Class: |
506/9 |
Current CPC
Class: |
G01N 33/5008 20130101;
G01N 33/502 20130101; G01N 33/5079 20130101; G01N 33/566 20130101;
G01N 2510/00 20130101; G01N 33/5011 20130101; G01N 33/5091
20130101 |
Class at
Publication: |
506/9 |
International
Class: |
C40B 30/04 20060101
C40B030/04 |
Goverment Interests
[0002] This invention was made with government support under grant
number GM60554 awarded by the National Institutes of Health. The
United States Government has certain rights in this invention.
Claims
1. A method for identifying a Humanin-like compound that binds to
Bax, comprising the steps of: (a) contacting said Humanin-like
compound with said Bax, under conditions suitable to form a
complex; and (b) determining the ability of said Humanin-like
compound to bind said Bax.
2. The method of claim 1, wherein said contacting is performed in
vitro.
3. The method of claim 1, wherein said ability to bind said Bax is
determined using a method selected from the group consisting of: a
two-hybrid assay, co-immunoprecipitation assay, co-localization
assay, scintillation proximity assay (SPA), UV or chemical
cross-linking, biomolecular interaction analysis (BIA), mass
spectrometry (MS), nuclear magnetic resonance (NMR), and
fluorescence polarization assays (FPA).
4. The method of claim 3, wherein said ability to bind said Bax is
determined using a yeast two-hybrid assay.
Description
[0001] This application is a divisional of U.S. application Ser.
No. 12/206,670, filed Sep. 8, 2008, which is a divisional of U.S.
application Ser. No. 10/306,878, filed Nov. 27, 2002, now U.S. Pat.
No. 7,422,862, which claims the benefit of priority of U.S.
Provisional Application No. 60/334,149, filed Nov. 28, 2001, each
of which the entire contents are incorporated herein by
reference.
BACKGROUND OF THE INVENTION
[0003] This invention relates generally to the fields of molecular
biology and molecular medicine and more specifically to
polypeptides involved in the regulation of neuronal apoptotic cell
death.
[0004] Apoptosis is the term used to describe a type of cellular
death that occurs in many tissues as a normal physiological
process. This form of cellular demise involves the activation of a
built-in genetic program for cell suicide by which cells
essentially autodigest. The remnants of these dead cells are then
cleared by neighboring phagocytic cells, without resulting in
inflammation or scarring. Apoptosis thus stands in marked contrast
to cell death caused, for example, by oxygen-deprivation in the
settings of myocardial infarction or stroke, where cells lose their
energy supplies, rupture and spill their contents into the
extracellular milieu. This type of cell death or necrosis often
results in inflammation and undesirable consequences.
[0005] Apoptosis is required for normal tissue turnover, for the
proper development and maintenance of the immune system, for the
development of the nervous system, and for the elimination of
virus-infected cells. It is a well-ordered process that is
characterized by DNA fragmentation, chromatin condensation,
membrane blebbing and cell shrinkage. Cells undergoing apoptosis
ultimately disassemble into membrane-enclosed vesicles (apoptotic
bodies) that are engulfed by neighboring cells and phagocytes, thus
preventing an inflammatory response. In addition, apoptosis can be
induced to occur by cellular, hormonal or other stimuli to remove
unwanted cells from the body. For example, apoptosis occurs in the
female reproductive tissues with each menstrual cycle via loss of
hormonal stimulation in the absence of a successful pregnancy.
[0006] In contrast to the effect of apoptosis in normal cellular
processes, when aberrantly regulated, the death of cells through
apoptosis can lead to a variety of disease states and pathological
conditions. For example, the death of neurons that occurs in
diseases such as Alzheimer's dementia and Parkinson's disease shows
many hallmarks of apoptosis. Additionally, cell death caused by
viral infection can occur through apoptosis in many cases,
including T-cell death induced by the human immunodeficiency virus
(HIV). Autoimmune diseases, where immune cells inappropriately
attack normal tissues, is due, in part, to a failure of apoptosis
to occur. In addition, a lack of apoptosis can also play a role in
tumorigenesis.
[0007] In the nervous system, apoptosis is normally involved in the
loss of redundant neurons during fetal development. However, the
dysregulation of apoptosis in the nervous system can result in
unintended neuronal cell death and can be involved in
neurodegenerative diseases such as Alzheimer's disease, Parkinson's
disease and Amyotrophic Lateral Sclerosis (ALS). Alzheimer's
disease is the most common form of dementia and the fourth leading
cause of deaths in adults after heart disease, cancer and stroke.
It is estimated that one in ten Americans over the age of 65, and
nearly one half of those over the age of 85, have Alzheimer's
disease. Amyloid b-protein (ABP) has been identified as a possible
causative agent of this disease. Addition of ABP, or of specific
fragments of this polypeptide, to cultured neurons and neuronal
cell lines results in cell death. Expression of Bcl-2 in these
cultured cells can reduce neuronal cell death induced by ABP
indicating that apoptosis can contribute to neuronal cell death in
Alzheimer's disease. Currently there are no biological screening
procedures or effective treatments that can stop the progression of
Alzheimer's disease.
[0008] Thus there exists a need to identify polypeptide
interactions that regulate apoptosis and identify compounds that
bind to these polypeptides or modulate the interaction of these
polypeptides. The present invention satisfies this need and
provides related advantages as well.
SUMMARY OF THE INVENTION
[0009] The invention provides a method of identifying an effective
compound that modulates the binding of Humanin to Bax, by: (a)
contacting Humanin with Bax under conditions suitable to form a
Humanin-Bax complex; (b) contacting the Humanin-Bax complex with a
candidate compound; and (c) determining the ability of the
candidate compound to modulate the binding of Humanin to Bax, where
modulation of the binding of Humanin to Bax indicates that the
candidate compound is an effective compound that modulates the
binding of Humanin to Bax.
[0010] The invention also provides a method of identifying an
effective compound that modulates an activity of Bax, by: (a)
contacting Humanin with Bax under conditions suitable to form a
Humanin-Bax complex; (b) measuring an activity of Bax; (c)
contacting the Humanin-Bax complex with a candidate compound; (d)
determining the amount of activity of Bax in the presence of the
candidate compound; and (e) comparing the amount of activity from
step (b) with the amount of activity from step (d), where
modulation of an activity of Bax indicates that the candidate
compound is an effective compound that modulates an activity of
Bax.
[0011] The invention also provides a method of identifying an
effective compound that modulates the binding of Humanin to Bid,
by: (a) contacting Humanin with Bid under conditions suitable to
form a Humanin-Bid complex; (b) contacting the Humanin-Bid complex
with a candidate compound; and (c) determining the ability of the
candidate compound to modulate the binding of Humanin to Bid, where
modulation of the binding of Humanin to Bid indicates that the
candidate compound is an effective compound that modulates the
binding of Humanin to Bid.
[0012] The invention also provides a method of identifying an
effective compound that modulates an activity of Bid, by: (a)
contacting Humanin with Bid under conditions suitable to form a
Humanin-Bid complex; (b) measuring an activity of Bid; (c)
contacting the Humanin-Bid complex with a candidate compound; (d)
determining the amount of activity of Bid in the presence of the
candidate compound; and (e) comparing the amount of activity from
step (b) with the amount of activity from step (d), where
modulation of an activity of Bid indicates that the candidate
compound is an effective compound that modulates an activity of
Bid.
[0013] The invention further provides an isolated polypeptide
containing the amino acid sequence designated as SEQ ID NO:3, or a
functional fragment thereof, where the fragment contains the
methionine at position 16 of SEQ ID NO:3.
BRIEF DESCRIPTION OF THE DRAWINGS
[0014] FIG. 1 shows the growth, on leucine deficient media, of
yeast cells containing different constructs from a yeast two-hybrid
assay. In addition, the results of a lacZ filter assay is shown.
For this assay, pGilda-Bax(S184K) and pJG4-5-HN were transfected
into yeast strain EGY48.
[0015] FIG. 2 shows immunoprecipitation assays where GFP and GFP-HN
were co-transfected into 293T cells with (A) HA-Bax or (B) tBid.
The lysates were immunoprecipitated with (A) anti-GFP antibody or
(B) anti-tBid antibody and blotted with (A) anti-HA antibody or (B)
anti-GFP antibody. The data shown were obtained using the cytosolic
form of Humanin; however, both cytosolic and mitochondrial forms of
Humanin were tested and the results were the same.
[0016] FIG. 3. FIG. 3A shows the location of Humanin in the human
mitochondrial genome. FIG. 3B shows the difference between Humanin
translated in the cytosol (SEQ ID NO:2) compared to mitochondria
(SEQ ID NO:3), based on differences in the mitochondrial genetic
code. Humanin from mitochondria can contain a methionine at
position 16 instead of an isoleucine and lack three amino acids at
the C-terminus. FIG. 3C shows the results of a reverse
transcription polymerase chain reaction assay (RT-PCR) of purified
mitochondria RNA isolated from 293T cells. Primers specific for
Bax, Humanin, NADH dehydrogenase subunit I, and cytochrome c
oxidase subunit I were used, respectively.
[0017] FIG. 4 shows the percentage of apoptosis in primary rat
hippocampal neuronal cell line CSM14.1 cells co-transfected with
GFP, GFP-Humanin, GFP-Humanin (C8A) and (A) Flag-Bax or (B) t-Bid.
Apoptosis was examined by DAPI staining. The data shown were
obtained using the cytosolic form of Humanin; however, both
cytosolic and mitochondrial forms of Humanin were tested and the
results were the same.
[0018] FIG. 5 shows the interaction between Humanin and Bax. (A)
HEK293T cells were transfected with pcDNA3-myc plasmids encoding
Bax or other Bcl-2 family proteins with GFP, GFP-HN, or
GFP-HN(C8P). Cell lysates were immunoprecipitated with polyclonal
anti-GFP antibody. The immunoprecipitates or the lysates were
blotted with anti-myc or anti-GFP antibodies, respectively. The
slower migrating form of GFP seen in lane 1 (asterisk) represents
an alternative form of GFP produced from the wild-type (control)
p-EGFP-C1 plasmid (http://clonotech.com). (B) Testes of
three-week-old mice were homogenized in lysis buffer (0.1% Triton
X-100, 50 mM Tris-HCl, pH7.5, 1 mM EDTA, plus protease inhibitor
cocktail). The lysates were immunoprecipitated with control rabbit
serum or polyclonal anti-mouse Bax antibody. The immunoprecipitates
or the lysates were subjected to electrophoresis in Tris/Tricine
gels (16% T, 3% C), electroblotted to PVDF membrane, and
immunoblotted with polyclonal anti-HN antibody or monoclonal
anti-Bax antibody 6A7 (Trevigen). (C) The affinity (Kd) of Bax/HN
interaction was measured by fluorescence polarization assay, using
various concentrations of purified recombinant Bax and 40 nM
rhodamine-conjugated FIN peptide. Control peptide from CD40 is also
shown (mean.+-.Std Dev; n=3).
[0019] FIG. 6 shows Humanin can inhibit cell death induced by Bax.
(A-D) CMS 14.1 neuronal cells were transfected with plasmids
encoding Flag-HN peptide or Flag-control (27-amino-acid) peptide,
together with GFP-encoding plasmid at 4:1 ratio. Cells were either
cultured without further treatment (open bars) or subjected to
various apoptotic stimuli for various times (dark bars), including
(A) STS for 8 h (dark symbols=Flag-control; open symbols=Flag-FIN),
(B) Serum-deprivation for 72 h, (C) 10 joules/m2 Uvirradiation
followed by 24 h culture, and (D) 50 ng/ml TNFa in 1 .mu.m CDDO for
24 h. Cells were then fixed and stained with DAPI to determine the
percentage of apoptotic cells, evaluating=200 GFP-positive cells
per sample (mean.A-inverted.SD; n=3). (inset) Lysates prepared from
replicate cultures of transfected cells were normalized for total
protein content and analyzed by immunoblotting using anti-Flag
(top) and anti-tubulin (bottom) antibodies, confirming production
of similar amounts of Flag-control and Flag-FIN peptides. (E) SF268
cells were transfected with Humanin siRNA (HN-siRNA) (dark bars) or
mutant siRNA containing two mismatches (mut-siRNA) as negative
control (open bars). (Upper panel) After 72 hr, cell lysates were
prepared and 100 ug was analyzed by immunoblotting using anti-HN
and anti-tubulin (as a loading control) antibodies. (Lower panel)
At 72 hr after siRNA transfection, SF268 cells were cultured with
0.1 .mu.M STS for 8 hrs, then % apoptosis was determined
(mean.+-.std dev; n=3). (F) FIN protects against Bax- but not
Bak-induced apoptosis. CSM14.1 neuronal cells were co-transfected
with pcDNA3-HA-Bax or pcDNA3-HA-Bak together with plasmids encoding
with GFP (indicated by A-A), GFP-HN, or GFP-HN(C8P). Apoptosis (%)
was measured 48 hrs later among GFP-positive cells. (G) Humanin
inhibits STS-induced apoptosis in wild type HCT116 cells, but not
HCT116 BAX -/- cells. HCT116 cells heterozygous or homozygous for
BAX gene inactivation were transfected with plasmids encoding GFP
(open bars) or GFP-HN (dark bars). After 24 h, cells were cultured
without (C) or with STS (0.2 .mu.M for wild type and 1.0 .mu.M for
Bax -/- cells) for 8 h, then % apoptosis was determined for
GFP-positive cells (mean.+-.std dev; n=3). (inset) Lysates from the
cells were analyzed by immunoblotting (20 ug) using anti-Bax (top)
and anti-Bid (bottom) antibodies. (H) FIN prevents Bax-induced cell
death in yeast. Cells were co-transformed with YEp51-Bax (encoding
Bax under control of a GAL10 promoter) and plasmid control (C) or
plasmids encoding Humanin or Humanin(C8P) fusion polypeptides.
Cells initially grown in glucose-containing medium were streaked
onto either glucose (top) or galactose (bottom) plates to suppress
or induce Bax expression, respectively.
[0020] FIG. 7 shows that Humanin can block Bax translocation to
mitochondria. (A-B) Humanin peptide prevents STS-induced Bax
translocation in vivo. Cos-7 cells were first transfected with
GFP-Bax plasmids. After 24 hrs, untagged wild-type or C8P mutant
Humanin peptides were introduced into cells using Chariot.TM.
reagent, and 2 h later cells were treated with 1 .mu.M STS. After 4
h, the percentage of cells with translocated Bax was determined
(mean V SD; n=3) by confocal microscopy (A) and representative
photomicrographs (B). (C) Wild-type or C8P mutant Humanin peptides
were introduced into Cos7 cells using Chariot.TM. reagent.
Cytosolic (C) and mitochondria-containing (M) fractions were
isolated by differential centrifugation 23 and analyzed by
immunoblotting using anti-Bax (top), Hsp60 (middle) (mitochondrial
marker), or Tubulin (bottom) (cytosol marker) antibodies. (D) FIN
or mutant control double-strand siRNAs were transfected into SF268
cells. After 48 h, cells were cultured without (Control) or with
0.1 uM STS. After 24 hr, cells were fractionated and analyzed by
immunoblotting as above. (E) Isolated mitochondria were mixed with
400 ng Bax protein, with or without preincubating Bax with 100 uM
Humanin or Humanin(C8P) peptides for 10 min. After 3 h at
30.degree. C., mitochondria were centrifuged and the resulting
pellets (P) and supernatants (S) were analyzed by immunoblotting
using anti-Cytochrome c (top), Hsp60 (middle), and Bax (bottom)
antibodies. (F) HN peptide enforces the interaction of Bax.TM.
domain with Bax.TM.. Lysates from HEK293T cells expressing
Flag-Bax.TM. were pretreated with or without Humanin or
Humanin(C8P) peptides. Lysates were then mixed in vitro with
lysates of HEK293T cells expressing GFP-TM(Bax).
Immunoprecipitations were performed with anti-Flag antibody,
analyzing lysates and immunoprecipitates (IP) by immunoblotting
using monoclonal anti-GFP antibody.
[0021] FIG. 8 shows a comparison of nuclear (N)- and mitochondria
(M)-encoded HN. (A) HEK293T cells were transfected with
pcDNA3-HA-Bax together with plasmids encoding GFP, GFP-HN(N), or
GFP-HN(M). Cell lysates were immunoprecipitated with polyclonal
anti-GFP antibody. Immunoprecipitates (IP) or cell lysates were
analyzed by immunoblotting using anti-HA or anti-GFP antibodies,
respectively. (B) CSM14.1 neuronal cells were co-transfected with
pcDNA3-HA-Bax together with plasmids encoding GFP, GFP-HN(N), or
GFP-HN(M). Percent apoptosis was determined 48 h later by DAPI
staining (mean.A-inverted.SD; n=3).
DETAILED DESCRIPTION OF THE INVENTION
[0022] There are two major apoptotic pathways known in mammalian
cells (see Hengatner, M. O., Nature 407:770-776). One pathway is
through "death receptors" such as CD95 and tumor necrosis factor
receptor I at the cell surface. The other pathway is the
mitochondrial pathway which is used in response to extracellular
cues and internal insults such as DNA damage. In the death receptor
pathway, binding of a ligand to a death receptor induces the
formation of a death inducing signaling complex which recruits the
Fas-associated death domain protein (FADD) and multiple
procaspase-8 molecules, resulting in caspase-8 activation through
induced proximity. In the mitochondrial pathway, Bcl-2 pro- and
anti-apoptotic family member polypeptides in mitochondrial
membranes compete to regulate cytochrome c exit. If cyotochrome c
is released it can associate with Apaf-1 which in turn binds
procaspase-9 to form an apoptosome.
[0023] Several polypeptides, including Bcl-2 and Bcl-2 related
polypeptides, are known to be involved in the process of apoptosis.
The Bcl-2 related family is comprised of well over a dozen
polypeptides that have different functions. Bcl-2 was first
discovered because of its involvement in B-cell lymphomas in
humans. Bcl-2 has been shown to promote cell survival by blocking
apoptosis. In contrast, the Bcl-2 related polypeptides Bax and Bid
have been shown to promote apoptosis. Bax is a 192 amino acid
polypeptide that was first discovered based on its similarity to
Bcl-2 (Oltvai et al., Cell 74:609-619 (1993)). The ratio of
anti-apoptotic Bcl-2 to pro-apoptotic Bax can be used as an
indicator of whether a cell will die or survive. Bid is a 195 amino
acid polypeptide that is related to Bcl-2, although more distantly
than Bax. Bid can act as a point of contact between the death
receptor and mitochondrial apoptosis pathways. Bid can be cleaved
by caspase-8 into a truncated form, t-Bid, which increases its
pro-death activity and results in its translocation to the
mitochondria where it promotes cytochrome c exit. Unlike Bcl-2,
which is post-translationally inserted into intracellular
membranes, Bax and Bid can shuttle between the cytosol and
organelles.
[0024] Humanin is a recently discovered 24 amino acid polypeptide
that is thought to be secreted from the cell (Hashimoto et al.,
Proc. Natl. Acad. Sci. USA 98: 6336-6341 (2001)). Humanin prevents
neuronal cell death induced by familial Alzheimer's disease genes
and b-amyloid. However, Humanin does not protect cells from death
induced by other agents such as Q79 or superoxide dismutase-1
mutants. The mechanism by which Humanin protects neurons from cell
death induced by familial Alzheimer's disease genes and b-amyloid
is unknown. Furthermore, Humanin has not been reported to bind to,
or act on, any other polypeptides within a cell.
[0025] Disclosed herein is the discovery that Humanin can bind to
and inhibit the pro-apoptotic function of Bax and Bid. The
discovery that Bax can interact with Humanin came from a yeast
two-hybrid screening assay that was performed to identify any
polypeptides that interact with Bax. A mutant form of Bax that does
not induce apoptosis was used (Nechushtan, et al. EMBO J.
18:2330-2341 (1990)). This assay is described in Example I. Several
positive clones were sequenced from this assay and one of these
clones contained a cDNA that encoded the Humanin gene. The Humanin
polypeptide had not been reported to interact with any other
polypeptides so several assays were performed to confirm that
Humanin did interact with Bax. First, Humanin and Bax were assayed
in the yeast two-hybrid system. As shown in FIG. 1, Humanin and Bax
were co-expressed into yeast cells and cells that expressed both
Humanin and Bax were able to grow on selection media indicating
that the Humanin and Bax were interacting. The interaction of
Humanin and Bax was further confirmed using a
co-immunoprecipitation assay and a co-localization assay as
described in Example II and shown in FIG. 2. In addition, a
fragment of Bid, t-Bid, was found to interact with Humanin using
the co-immunoprecipitation assay as shown in FIG. 2. Furthermore,
transfection of the Humanin gene along with Bax or Bid resulted in
a decrease of Bax- or Bid-induced apoptosis as described in Example
V and shown in FIG. 4.
[0026] The discovery, disclosed herein, of Humanin-Bax and
Humanin-Bid complexes enables the design of diagnostics and
therapeutics based on these interactions. For example, this
discovery enables the design of convenient high-throughput assays
for identifying compounds that mimic or modulate the interaction
between Humanin and Bax or Bid.
[0027] The interaction between Humanin and Bax or Bid can be used
advantageously as a basis for the design of pharmaceutical
screening assays. For example, compounds from chemical libraries
can be tested for modulating the binding of Humanin to Bax or Bid.
In addition, Humanin-like compounds can be designed and tested for
binding to Bax or Bid. Similarly, Bax- or Bid-like compounds can be
designed and tested for binding to Humanin. Several binding assay
formats are well known in the art that are amenable for
high-thoroughput screening. The use of these assays requires the
knowledge of a stable interaction between two macromolecules such
as Humanin and Bax or Humanin and Bid, as disclosed herein.
[0028] A functional interaction between Humanin and Bax and Humanin
and Bid is also disclosed. As shown in FIG. 4, Humanin decreases
Bax-induced apoptosis and Bid-induced apoptosis. A mechanism for
how Bax decreases Bax-induced apoptosis is also disclosed herein.
As shown in Example XI and FIGS. 7A-E, Humanin can suppress Bax
translocation to mitochondria. Furthermore, as shown in Example XII
and FIG. 7F, Humanin can stabilize the latent conformation of Bax
in which its C-terminal tail is docked onto a hydrophobic crevice
on the surface of the Bax molecule. These discoveries can also be
used in the design of high-thoroughput functional screening assays.
For example, Humanin-like compounds can be tested for their effect
on Bax-induced apoptosis or Bid-induced apoptosis.
[0029] The interaction between Humanin and Bax or Bid also can be
used advantageously for designing pharmaceutical compounds
directly. The site of interaction between Humanin and Bax or Bid
can be explored using several techniques well known in the art such
as, for example, X-ray crystallography, nuclear magnetic radiation
(NMR), and structure-function mutagenesis. The three dimensional
structures of Bid (Chou et al., Cell 96:615-624 (1999); McDonnell
et al., Cell 96:625-634 (1999)) and Bax (Suzuki et al., Cell
103:645-654 (2000) are known. Knowledge of the three dimensional
shape of the interaction site between Humanin and Bax or Bid can be
used to design drugs that can mimic or modulate these interactions.
This type of rational drug design requires the knowledge that
Humanin interacts with Bax and Bid, as disclosed herein.
[0030] The discovery of Humanin-Bax and Humanin-Bid complexes can
also be used to design diagnostic assays. The detection of these
complexes or different amounts of these complexes within cells can
be used to predict whether a cell will survive or undergo
apoptosis. For example, when Bax or Bid is in a complex with
Humanin a cell can be more likely to survive than when Bax and Bid
are not bound to Humanin. These complexes can be detected by
several methods, for example, using an antibody that specifically
recognizes the complex. Determination of the apoptotic status of
cells can be useful, for example, for the diagnosis of
neurodegenerative diseases or cancer.
[0031] The Humanin polypeptide has been published as the 24 amino
acid sequence shown in FIG. 3B (SEQ ID NO:2). Disclosed herein is
evidence that Humanin is transcribed in mitochondria (see FIG. 3C).
Based on this finding, and the mitochondrial genetic code, the
invention provides a mitochondrial-derived Humanin polypeptide
comprising the 21 amino acid sequence shown in FIG. 3B (SEQ ID
NO:3). Humanin translated in mitochondria is predicted to contain
one amino acid difference compared to the published Humanin
polypeptide. As shown in FIG. 3, Humanin translated in the
mitochondrial (mtHumanin) is predicted to contain a methionine (M)
at residue 16 instead of an isoleucine (I) as found in the
published form of Humanin. In addition, the mitochondrial form of
Humanin is predicted to lack the three amino acid sequence arginine
(R)- arginine (R)- alanine (A) at the carboxyl-terminus of the
polypeptide. Since Humanin can be transcribed in mitochondria, the
mitochondrial-derived form of Humanin can be considered a
biologically relevant form of Humanin. This form of Humanin can be
used in diagnostic and therapeutic methods as disclosed herein and
apparent to one skilled in the art.
[0032] The invention provides methods for identification of
compounds that modulate the binding of Humanin to Bax or Bid or
modulate an activity of Bax or Bid. In addition, the invention
provides a method of identifying Humanin-like compounds that bind
to Bax or Bid or modulate an activity of Bax or Bid. In one
embodiment, the invention provides a method of identifying
Humanin-like compounds that bind to Bax or Bid using a competition
assay. The invention also provides a method of diagnosing and/or
treating a pathology characterized by an increased or decreased
level of a Humanin-Bax or Humanin-Bid complex in a subject. The
invention further provides a mitochondrial derived form of Humanin
of a different sequence than the cytosolic form and methods of
diagnosing and/or treating a pathology characterized by Bax- or
Bid-induced cell death.
[0033] As used herein, the term ABax@ refers to a polypeptide with
substantially the same amino acid sequence as that shown in SEQ ID
NO:5 (human Bax) that specifically binds to SEQ ID NO:2 or 3
(cytosolic or mitochondrial-derived Humanin, respectively). The
GenBank accession number for the nucleotide sequence of human Bax
is L22473. "Substantially the same amino acid sequence" is intended
to mean an amino acid sequence contains a considerable degree of
sequence identity or similarity, such as at least 70%, 80%, 90%,
95%, 98%, or 100% sequence identity or similarity, to a reference
amino acid sequence. Conservative and non-conservative amino acid
changes, gaps, and insertions to an amino acid sequence can be
compared to a reference sequence using available algorithms and
programs such as the Smith-Waterman algorithm and the BLAST
homology search program (Altschul et al., J. Mol. Biol. 215:403-410
(1990)).
[0034] The term "specifically binds" is intended to mean the
polypeptide will have an affinity for the target polypeptide that
is measurably higher than its affinity for a non-specific
interaction. Bax can bind to Humanin with low or high affinity so
long as the binding is sufficient to be detectable. For example,
Bax can bind Humanin with a binding affinity (Kd) of about
10.sup.-4 M or less, 10.sup.-5 M or less, 10.sup.-6 M or less,
about 10.sup.-7 M or less, including about 10.sup.-8 M or less,
such as 10.sup.-9 M or less. Several methods for detecting or
measuring polypeptide binding are known in the art and disclosed
herein.
[0035] It is understood that a fragment of Bax can be sufficient in
order to produce this activity. For example, fragments of Bax which
retain substantially the Humanin-binding function of the entire
polypeptide are included within the definition. Fragments can
include, for example, amino terminal, carboxyl terminal, or
internal deletions of a full length Bax polypeptide. For example, a
fragment can contain at least about 10, 20, 50, 75, 100, 125, 150,
175, or 190 or more contiguous or non-contiguous amino acid
residues of a full-length Bax polypeptide. Polypeptide fragments
can be generated, for example, using recombinant DNA methods or
enzymatic or chemical cleavage of larger polypeptides. In addition,
various molecules, such as other polypeptides, carbohydrates, or
lipids, or small molecules can be attached to Bax including
fragments of Bax. For example, Bax can contain a label moiety, a
sequence such as a FLAG epitope, or be fused to another polypeptide
such as a DNA binding domain.
[0036] It is understood that limited modifications to the Bax
polypeptide can be made without destroying the ability of Bax to
specifically bind to SEQ ID NO:2 or 3. For example, Bax is intended
to include other Bax family members such as those polypeptides that
are found to exhibit the above sequence homologies. Such members
include, for example, homologs of Bax that can be cloned from other
organisms such as monkeys, cows, rats, mice, chickens, frogs, flies
or worms. The sequence of homologs of human Bax are available in
the database. For example, the GenBank accession number for mouse
Bax is L22472.
[0037] Various modifications of the Bax primary amino acid sequence
can result in polypeptides having substantially equivalent,
decreased, or enhanced function as compared to the sequence set
forth as SEQ ID NO:5. Those skilled in the art recognize that such
modifications can be desirable at times in order to enhance the
bioactivity, bioavailability or stability of Bax, or to facilitate
its synthesis or purification. Contemplated amino acid
substitutions to the native sequence of Bax can include, for
example, conservative changes, wherein a substituted amino acid has
similar structural or chemical properties (e.g., replacement of a
polar amino acid with another polar amino acid; replacement of a
charged amino acid with a similarly charged amino acid, etc.).
Those skilled in the art also recognize that nonconservative
changes (e.g., replacement of an uncharged polar amino acid with an
non-polar amino acid; replacement of a charged amino acid with an
uncharged polar amino acid, etc.) can also be made without
affecting a function of Bax. In addition, a variety of polypeptide
modifications are known in the art for constraining the structure
of polypeptides to enhance stability or binding (Cabezas and
Satterthwait, J. Am. Chem. Soc. 121:3862-3875 (1999); Stanfield et
al., Structure 7:131-142 (1999)).
[0038] A polypeptide can be modified by naturally occurring
modifications such as post-translational modifications, including
phosphorylation, lipidation, prenylation, sulfation, hydroxylation,
acetylation, addition of carbohydrate, addition of prosthetic
groups or cofactors, formation of disulfide bonds, proteolysis,
assembly into macromolecular complexes, and the like. Chemical
modifications of the polypeptide such as, for example, alkylation,
acylation, carbamylation, and iodination can also be used so long
as the polypeptide retains its ability to specifically bind to SEQ
ID NO:2 or 3.
[0039] Those skilled in the art can determine which residues and
which regions of a Bax sequence are likely to be tolerant of
modification and still retain an ability to specifically bind to
SEQ ID NO:2 or 3. For example, amino acid substitutions or chemical
or enzymatic modifications at residues that are less well conserved
between species are more likely to be tolerated than substitutions
at highly conserved residues. Accordingly, an alignment can be
performed among Bax sequences of various species to determine
residues and regions in which modifications are likely to be
tolerated. Additional guidance for determining residues and regions
of Bax likely to be tolerant of modification is provided by studies
of Bax fragments and variants. For example, the BH3 and
transmembrane domains of Bax are important for apoptotic function
as determined by structure-function comparisons of Bax in yeast and
mammalian cells (Zha et al., Mol. Cell. Biol. 16:6494-6508 (1996);
Reed et al., Adv. Exp. Med. Biol. 406:99-112 (1996)).
[0040] As used herein, the term ABid@ refers to a polypeptide with
substantially the same amino acid sequence as that shown in SEQ ID
NO: 7 (human Bid) that specifically binds to SEQ ID NO:2 or 3
(cytosolic or mitochondrial-derived Humanin, respectively). The
GenBank accession number for the nucleotide sequence of human Bid
is AF042083. The definition of substantially the same amino acid
sequence and specific binding is the same as stated above for Bax.
For example, Bid can bind Humanin with a binding affinity (Kd) of
about 10.sup.-4 M or less, 10.sup.-5 M or less, 10.sup.-6 M or
less, about 10.sup.-7 M or less, including about 10.sup.-8 M or
less, such as 10.sup.-9 M or less.
[0041] As with Bax it is understood that a fragment of Bid can be
sufficient in order to produce this activity. For example,
fragments of Bid which retain substantially the Humanin binding
function of the entire polypeptide are included within the
definition. Fragments can include, for example, amino terminal,
carboxyl terminal, or internal deletions of a full length Bid
polypeptide. For example, a fragment can contain at least about 10,
20, 50, 75, 100, 125, 135, 150, 175 or 190 or more contiguous or
non-contiguous amino acid residues of a native Bid polypeptide. For
example, a truncated fragment of Bid called t-Bid is shown herein
to bind to Humanin. This 22 kD full length Bid polypeptide is
cleaved into the 15 kD truncated form of Bid by caspase-8. The
t-Bid polypeptide has the polypeptide sequence substantially the
same as that shown in SEQ ID NO:9. In addition, various molecules,
such as other polypeptides, carbohydrates, lipids, or small
molecules can be attached to Bid including fragments of Bid such as
t-Bid. For example, Bid can contain a sequence such as a c-myc
epitope or be fused to another polypeptide such as a
transcriptional activation domain.
[0042] It is understood that limited modifications to the Bid
polypeptide can be made without destroying the ability of Bid to
specifically bind to SEQ ID NO:2 or 3. For example, Bid is intended
to include other Bid family members such as those polypeptides that
are found to exhibit the above sequence homologies. Such members
include, for example, homologs of Bid that can be cloned from other
organisms such as monkeys, cows, rats, mice, chickens, frogs, flies
or worms. The sequence of homologs of human Bid can be found in the
database.
[0043] Various modifications of the Bid primary amino acid sequence
can result in polypeptides having substantially equivalent,
decreased, or enhanced function as compared to the sequences set
forth as SEQ ID NOS: 7 or 9. Contemplated modifications include all
of those listed above for the Bax polypeptide. Those skilled in the
art can determine which residues and which regions of a Bid
sequence are likely to be tolerant of modification and still retain
an ability to specifically bind to SEQ ID NO:2 or 3. Additional
guidance for determining residues and regions of Bid likely to be
tolerant of modification is provided by studies of Bid fragments
such as t-Bid. In addition, mutagenesis studies have shown that the
BH3 domain of Bid is important for pro-apoptotic activity (Wang et
al., Genes Dev. 10:2859-2869 (1996)).
[0044] As used herein, the term AHumanin@ refers to a polypeptide
with substantially the same amino acid sequence as that shown in
SEQ ID NO: 2 or 3 (cytosolic or mitochondrial-derived Humanin,
respectively) that specifically binds to SEQ ID NO: 5 (Bax) or SEQ
ID NO: 7 or 9 (Bid or t-Bid, respectively). The GenBank accession
number for the nucleotide sequence of human Humanin is AY029066.
The definition of substantially the same amino acid sequence and
specific binding is the same as stated above for Bax. For example,
Humanin can bind Bax or Bid with a binding affinity (Kd) of about
10.sup.-4 M or less, 10.sup.-5 M or less, 10.sup.-6 M or less,
about 10.sup.-7 M or less, including about 10.sup.-8 M or less,
such as 10.sup.-9 M or less.
[0045] As with Bax, it is understood that a fragment of Humanin can
be sufficient in order to produce this activity. For example,
fragments of Humanin which retain substantially the Bax or Bid
binding function of the entire polypeptide are included within the
definition. Fragments can include, for example, amino terminal,
carboxyl terminal, or internal deletions of either full length
Humanin polypeptides. For example, a fragment can contain at least
about 5, 7, 9, 11, 13, 15, 17, 19, 21, or 23 contiguous or
non-contiguous amino acid residues of a full-length Humanin
polypeptide. As disclosed herein in Table I, fragments of Humanin
can be generated that retain Bax binding activity and the ability
to decrease Bax-induced apoptosis. In addition, various molecules,
such as other polypeptides, carbohydrates, lipids or small
molecules can be attached to Humanin including fragments of
Humanin. For example, Humanin can contain a sequence such as a
histidine tag or be fused to another polypeptide such as a green
fluorescent protein (GFP).
[0046] It is understood that limited modifications to the Humanin
polypeptide can be made without destroying the ability of Humanin
to specifically bind to SEQ ID NO: 5, 7, or 9. For example, Humanin
is intended to include both the cytosolic (SEQ ID NO:2) and the
mitochondrial-derived (SEQ ID NO:3) forms of Humanin in addition to
Humanin family members such as those polypeptides that are found to
exhibit the above sequence homologies. Such members include, for
example, homologs of Humanin that can be cloned from other
organisms such as monkeys, cows, rats, mice, chickens, frogs, flies
or worms. In addition, the inventors have identified about 30
copies of the Humanin nucleotide sequence, some identical to SEQ ID
NO:1 and some with small modifications, in the human genome. In
addition, using BLAST searches, the inventors have found that cDNAs
identical or similar to Humanin are expressed in plants, nematodes,
rats, mice and many other species (GenBank Accession numbers for
Humanin and Humanin-like cDNAs are: BQ250660 {Wheat Triticum
aestivun}, AI209224 {Nematode Onchorcerca volvulus}, BG667570
{Rat}, BM250174 {Mouse}).
[0047] Various modifications of the Humanin primary amino acid
sequence can result in polypeptides having substantially
equivalent, decreased, or enhanced function as compared to the
sequences set forth as SEQ ID NOS: 2 and 3. Contemplated
modifications include all of those described above for the Bax and
Bid polypeptides. Those skilled in the art recognize that such
modifications can be desirable at times in order to enhance the
bioactivity, bioavailability or stability of Humanin, or to
facilitate its synthesis or purification.
[0048] Those skilled in the art can determine which residues and
which regions of a Humanin sequence are likely to be tolerant of
modification and still retain an ability to bind Bax or Bid at a
detectable level. For example, as described above an alignment can
be performed among Humanin sequences of various species to
determine residues and regions in which modifications are likely to
be tolerated. Additional guidance for determining residues and
regions of Humanin likely to be tolerant of modification is
provided by studies of Humanin fragments and variants. For example,
since both the cytosolic and mitochondrial forms of Humanin bind to
Bax and Bid, the carboxyl-terminal three residues of cytosolic
Humanin are likely to be tolerant to modification.
[0049] The discovery that Humanin can bind to Bax and Bid and that
co-expression of Humanin in cells that express Bax or Bid can
rescue cells from Bax- or Bid-induced apoptosis, implicates the
formation of a complex between Humanin and Bax or Humanin and Bid
in the regulation of apoptosis. An increase in the amount or
stability of a Humanin-Bax or Humanin-Bid complex can reduce or
prevent apoptotic cell death, while a reduction in the amount or
stability of a Humanin-Bax or Humanin-Bid complex can increase or
induce apoptotic cell death. Free Bax or Bid can be involved in the
initiation of apoptosis, while Bax or Bid sequestered in a complex
with Humanin can be prevented from initiating apoptosis. It can be
desirable to reduce or prevent apoptotic cell death, for example,
in neurodegenerative diseases such as Alzheimer's disease.
Alternatively, it can be desirable in some cases to increase or
induce apoptotic cell death, for example, in tumors.
[0050] Methods of the invention are directed to the formation of
Humanin-Bax or Humanin-Bid complexes and to compounds that can
modulate the amount or stability of these complexes. For example,
methods of the invention are directed to identifying an effective
compound that modulates the binding of Humanin to Bax or Bid. In
addition, methods of the invention are directed to identifying a
Humanin-like compound that binds to Bax or Bid or modulates an
activity of Bax or Bid. Furthermore, the methods of the invention
are directed to identifying an effective compound that modulates an
activity of Bax or Bid when complexed to Humanin.
[0051] In one aspect, the invention provides a method of
identifying an effective compound that modulates the binding of
Humanin to Bax by (a) contacting Humanin with Bax under conditions
suitable to form a Humanin-Bax complex; (b) contacting the
Humanin-Bax complex with a candidate compound; and (c) determining
the ability of the candidate compound to modulate the binding of
Humanin to Bax, where modulation of the binding of Humanin to Bax
indicates that the candidate compound is an effective compound that
modulates the binding of Humanin to Bax.
[0052] While the invention is often described below with specific
embodiments to a Humanin-Bax complex or to Humanin-like compounds,
it is understood that Humanin-Bid complexes and Bax-like compounds
and Bid-like compounds can also be similarly used in the methods of
the invention as described herein. Therefore, the invention also
provides a method of identifying an effective compound that
modulates the binding of Humanin to Bid by (a) contacting Humanin
with Bid under conditions suitable to form a Humanin-Bid complex;
(b) contacting the Humanin-Bid complex with a candidate compound;
and (c) determining the ability of the candidate compound to
modulate the binding of Humanin to Bid, where modulation of the
binding of Humanin to Bid indicates that the candidate compound is
an effective compound that modulates the binding of Humanin to
Bid.
[0053] Humanin can be contacted with Bax, or Bid, either in an in
vitro or in vivo environment. As used herein, the term Ain vivo@ is
intended to mean within a living organism or living cell. A living
organism includes for example, multi-cellular organisms such as a
humans, animals, insects, or worms, and uni-cellular organisms such
as a single-celled protozoan, yeast cell, or bacterium. In
addition, a living cell derived from an organism used directly or
grown in cell culture is considered to be an in vivo environment.
For example, an oocyte removed from an organism such as a frog used
directly or grown in a tissue culture dish would constitute an in
vivo environment.
[0054] As used herein, the term Ain vitro@ is intended to mean in
an artificial environment outside of a living organism or cell.
Assays performed in a test tube, 96 well plate, or other assay
format outside of an organism are considered in vitro assays.
Experiments performed in cells or tissues that have been fixed and
are therefore dead (sometimes referred to as in situ experiments)
are considered an in vitro experiment. In addition, experiments
using cell-free extracts from cells are considered to be in vitro
experiments.
[0055] For an in vitro assay, Humanin and Bax or Bid polypeptides
can be added together directly in a solution under conditions that
are suitable for the formation of a complex. For example, this
contact can occur in a test tube, microcentrifuge tube, or 96 well
plate. In vitro assays can utilize isolated polypeptides or
cell-free extracts derived from cell lines, yeast or bacteria.
Polypeptides, such as those used for in vitro assays, can be of
recombinant origin, purified from cellular or tissue sources, or
chemically synthesized.
[0056] The isolated polypeptides used in the methods of the
invention can be obtained using well-known recombinant methods
(see, for example, Sambrook et al., supra, 1989; Ausubel et al.,
supra, 1999). An example of a method for preparing the invention
polypeptides is to express nucleic acids encoding Bax, Bid, or
Humanin in a suitable host cell, such as a bacterial cell, a yeast
cell, an amphibian cell such as an oocyte, or a mammalian cell,
using methods well known in the art, and recovering the expressed
polypeptide, again using well-known purification methods, so
described herein. Polypeptides can be isolated directly from cells
that have been transformed with expression vectors as described
herein. Recombinantly expressed polypeptides of the invention can
also be expressed as fusion polypeptides with appropriate affinity
tags, such as glutathione S transferase (GST) or poly His, and
affinity purified.
[0057] The polypeptides of the invention can be prepared in
substantially purified form using conventional biochemical
purification methods, starting either from tissues containing the
desired polypeptides or from recombinant sources. Polypeptides can
be isolated by a variety of methods well-known in the art, for
example, precipitation, gel filtration, ion-exchange, reverse-phase
and affinity chromatography, and the like. Other well-known methods
are described in Deutscher et al., Guide to Protein Purification:
Methods in Enzymology Vol. 182, (Academic Press, (1990)). The
methods and conditions for biochemical purification of a
polypeptide of the invention can be chosen by those skilled in the
art, and purification monitored, for example, by an immunological
assay or a functional assay.
[0058] The polypeptides of the invention, including fragments, and
polypeptides with modifications, can also be produced by chemical
synthesis. For example, synthetic polypeptides can be produced
using Applied Biosystems, Inc. Model 430A or 431A automatic peptide
synthesizer (Foster City, Calif.) employing the chemistry provided
by the manufacturer. Methods for synthesizing polypeptides are well
known in the art (see, for example, M. Bodanzsky, Principles of
Peptide Synthesis (1st ed. & 2d rev. ed.), Springer-Verlag, New
York, N.Y. (1984 & 1993), see Chapter 7; Stewart and Young,
Solid Phase Peptide Synthesis, (2d ed.), Pierce Chemical Co.,
Rockford, Ill. (1984)).
[0059] Conditions suitable for the formation of a polypeptide
complex in vitro are dependent on the characteristics of the
polypeptides within the complex. For example, the overall charge of
the polypeptides can be considered when adjusting the salt
concentration or pH of a binding solution to optimize the stability
of the complex. Usually a salt concentration and pH in the
physiological range, for example, about 100 mM KCl and pH 7.0 are
reasonable starting points. In addition, other components such as
glycerol or protease inhibitors can be added to the solution, for
example, to inhibit polypeptide degradation. The stability of the
polypeptide complex and can be effected by the temperature of the
binding reaction. The optimal temperature for binding can be
experimentally determined by those skilled in the art. For example,
binding reactions can be performed on ice (4.degree. C.), at room
temperature (about 25.degree. C.) or at body temperature
(37.degree. C.).
[0060] Alternatively, a Humanin-Bax or Humanin-Bid complex can be
formed in vivo. For example, these polypeptides can be
recombinantly expressed in a living cell, such a cell in a human,
or a cell line, a yeast cell or bacterial cell. These polypeptides
can be expressed in a cell that does not normally contain one or
both of these polypeptides, or in a cell that does express one or
both of these polypeptides. For example, it can be desirable to
over-express these polypeptides in a cell that expresses these
polypeptides at a low level.
[0061] Expression vectors containing Bax, Bid, or Humanin nucleic
acids can be used in recombinant expression of these polypeptides
in cells. Suitable expression vectors are well-known in the art and
include vectors capable of expressing nucleic acid operatively
linked to a regulatory sequence or element such as a promoter
region or enhancer region that is capable of regulating expression
of such nucleic acid. Appropriate expression vectors include those
that are replicable in eukaryotic cells and/or prokaryotic cells
and those that remain episomal or those which integrate into the
host cell genome. Promoters or enhancers, depending upon the nature
of the regulation, can be constitutive or regulated. The regulatory
sequences or regulatory elements are operatively linked to a
nucleic acid of the invention such that the physical and functional
relationship between the nucleic acid and the regulatory sequence
allows transcription of the nucleic acid.
[0062] Suitable vectors for expression in prokaryotic or eukaryotic
cells are well known to those skilled in the art (see, for example,
Ausubel et al., supra, 1999). Vectors useful for expression in
eukaryotic cells can include, for example, regulatory elements
including the SV40 early promoter, the cytomegalovirus (CMV)
promoter, the mouse mammary tumor virus (MMTV) steroid-inducible
promoter, Moloney murine leukemia virus (MMLV) promoter, and the
like. Vectors are useful for subcloning and amplifying a Bax, Bid
or Humanin nucleic acid molecule and for recombinantly expressing a
Bax, Bid or Humanin polypeptide. A vector can include, for example,
viral vectors such as a bacteriophage, a baculovirus or a
retrovirus; cosmids or plasmids; and, particularly for cloning
large nucleic acid molecules, bacterial artificial chromosome
vectors (BACs) and yeast artificial chromosome vectors (YACs). Such
vectors are commercially available, and their uses are well known
in the art. One skilled in the art will know or can readily
determine an appropriate promoter for expression in a particular
host cell.
[0063] Vectors useful for expression of a Bax, Bid or Humanin
polypeptide can contain a regulatory element that provides tissue
specific or inducible expression of an operatively linked nucleic
acid. One skilled in the art can readily determine an appropriate
tissue-specific promotor or enhancer that allows expression of a
Bax, Bid or Humanin polypeptide or nucleic acid in a desired
tissue. Any of a variety of inducible promoters or enhancers can
also be included in the vector for regulatable expression of a Bax,
Bid or Humanin polypeptide or nucleic acid. Such inducible systems,
include, for example, tetracycline inducible system (Gossen &
Bizard, Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992); Gossen et
al., Science, 268:1766-1769 (1995); Clontech, Palo Alto, Calif.);
metallothionein promoter induced by heavy metals; insect steroid
hormone responsive to ecdysone or related steroids such as
muristerone (No et al., Proc. Natl. Acad. Sci. USA, 93:3346-3351
(1996); Yao et al., Nature, 366:476-479 (1993); Invitrogen,
Carlsbad, Calif.); mouse mammory tumor virus (MMTV) induced by
steroids such as glucocortocoid and estrogen (Lee et al., Nature,
294:228-232 (1981); and heat shock promoters inducible by
temperature changes.
[0064] In addition, viral vectors such as retroviral, adenovirus,
adeno-associated virus, lentivirus, and herpesvirus vectors can be
used to express Bax, Bid or Humanin polypeptides into a cell. Viral
based systems provide the advantage of being able to introduce
relatively high levels of a heterologous nucleic acid into a
variety of cells. Additionally, such viruses can introduce
heterologous DNA into nondividing cells. Suitable viral vectors for
introducing invention nucleic acid encoding a Bax, Bid or Humanin
polypeptide into mammalian cells (e.g., neuronal cell lines) are
well known in the art. These viral vectors include, for example,
Herpes simplex virus vectors (U.S. Pat. No. 5,501,979), Vaccinia
virus vectors (U.S. Pat. No. 5,506,138), Cytomegalovirus vectors
(U.S. Pat. No. 5,561,063), Modified Moloney murine leukemia virus
vectors (U.S. Pat. No. 5,693,508), adenovirus vectors (U.S. Pat.
Nos. 5,700,470 and 5,731,172), adeno-associated virus vectors (U.S.
Pat. No. 5,604,090), constitutive and regulatable retrovirus
vectors (U.S. Pat. Nos. 4,405,712; 4,650,764 and 5,739,018,
respectively), papilloma virus vectors (U.S. Pat. Nos. 5,674,703
and 5,719,054), and the like.
[0065] Bax-, Bid- or Humanin-encoding vectors can be introduced
into cells using transfection methods well-known to one skilled in
the art. Such methods include, for example, infection using viral
vectors, lipofection, electroporation, particle bombardment and
transfection. Detailed procedures for these methods can be found in
Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold
Spring Harbor Laboratory Press, 1989) and the references cited
therein). Useful mammalian expression vectors and methods of
introducing such vectors into mammalian cells either ex vivo or in
vivo, for expression of the encoded polypeptide, are well known in
the art. For example, a plasmid expression vector can be introduced
into a cell by calcium-phosphate mediated transfection,
DEAE-Dextran-mediated transfection, lipofection, polybrene- or
polylysine-mediated transfection, electroporation, or by
conjugation to an antibody, gramacidin S, artificial viral
envelopes or other intracellular carriers. A viral expression
vector can be introduced into a cell in an expressible form by
infection or transduction, for example, or by encapsulation in a
liposome.
[0066] Following transfection, cells expressing recombinant Bax,
Bid, or Humanin, or increased levels of these polypeptides can be
selected for use in the methods of the invention. In addition,
polypeptides can be delivered directly into cells using a
lipid-mediated delivery system (Zelphati et al., J. Biol. Chem.
276:35103-35110 (2001)). A quantitative assay such as, for example,
immunoblot analysis, immunoprecipitation and ELISA can determine
the amount of the polypeptides of the invention in the transfected
cells. Such methods are known to one skilled in the art and can be
found in Ausubel et al., Current Protocols in Molecular Biology
(John Wiley and Sons, 1989) or in Harlow et al., Antibodies: A
Laboratory Manual (Cold Spring Harbor Laboratory Press, 1988)).
[0067] Additionally, recombinant cells containing Bax, Bid or
Humanin nucleic acids can be used in the methods of the invention.
The recombinant cells are generated by introducing into a host cell
a vector containing a Bax, Bid or Humanin nucleic acid molecule.
The recombinant cells are transducted, transfected or otherwise
genetically modified. Exemplary host cells that can be used to
express recombinant Bax, Bid or Humanin molecules include mammalian
primary cells; established mammalian cell lines, such as COS, CHO,
HeLa, NIH3T3, HEK 293, IMR-32, GT1-7 and PC12 cells; amphibian
cells, such as Xenopus embryos and oocytes; and other vertebrate
cells. Exemplary host cells also include insect cells such as
Drosophila and Spodoptera frugiperda (e.g. for use in well-known
baculovirus expression systems, such as described in Murakimi et
al., 2001, Cytokine, 13(1):18-24, and the like), yeast cells such
as Saccharomyces cerevisiae, Saccharomyces pombe, or Pichia
pastoris, and prokaryotic cells such as Escherichia coli.
[0068] In addition to recombinantly expressing Bax, Bid, or Humanin
polypeptides in a cell, a cell that endogenously expresses these
polypeptides can be used directly in the methods of the invention.
For example, a cell that already contains a Humanin-Bax or
Humanin-Bid complex can be contacted with a compound. Therefore,
the invention provides a method of identifying an effective
compound that modulates the binding of Humanin to Bax, by (a)
obtaining a cell that contains a Humanin-Bax complex; (b)
contacting the cell containing the Humanin-Bax complex with a
candidate compound; and (c) determining the ability of the
candidate compound to modulate the binding of Humanin to Bax, where
modulation of the binding of Humanin to Bax indicates that the
candidate compound is an effective compound that modulates the
binding of Humanin to Bax. For example, an antibody can be used to
detect modulation of Humanin-Bax complex levels. In addition, the
invention provides an analogous method of identifying an effective
compound that modulates the binding of Humanin to Bid.
[0069] Humanin and Bax or Bid complexes can be detected by several
methods, for example, using an antibody that specifically
recognizes the complex. Other methods for detecting these complexes
include detecting labeled Humanin bound to Bax or Bid which is
immobilized. For example, a Humanin peptide or active fragment can
be conjugated to a radiolabel, fluorescent label or enzyme label
such as alkaline phosphatase, horse radish peroxidase or
luciferase. Labeled Humanin can then bind to Bax or Bid which is
immobilized for example, on a solid support such as a latex bead.
Unbound Humanin is washed away and the amount of bound Humanin can
be detected based on its label. Fluorescently labeled Humanin can
also be bound to Bax or Bid in solution and bound complexes
detected, for example using a fluorescence polarization assay
(FPA). An example of a FPA is shown in Example VI and FIG. 5C. In
addition, Humanin and Bax or Bid complexes can be detected using
surface plasmon resonance as detected by a BIA Core chip.
Furthermore, the binding of Humanin to .sup.15N-labeled Bax or Bid
can be detected using NMR.
[0070] As used herein the term "modulate" an activity refers to a
compound=s ability to alter an activity. For example, a compound
can increase or decrease the binding or other activity of a
polypeptide or complex of polypeptides. Such modulatory compounds
include agonists, which increase an activity, and antagonists which
decrease an activity. One skilled in the art understands that an
increase or decrease in an activity is dependent on the particular
assay used and takes into account the variability inherent in the
assay. Assays to identify compounds that modulate an activity, for
example the binding of Humanin to Bax or Bid, are described herein.
As understood by those of skill in the art, assay methods for
identifying compounds that modulate an activity generally require
comparison to a "control." One type of a control is a reaction or
cell that is treated substantially the same as the test reaction or
cell exposed to the compound, with the distinction that the control
reaction or cell is not exposed to the compound.
[0071] Several types of compounds can be assayed using the methods
of the invention. As used herein, the term Acompound@ is intended
to mean an isolated macromolecule of natural or synthetic origin
that can be assayed using the methods of the invention. A compound
includes, for example, a polypeptide, peptidomimetic, non-peptidyl
compound, carbohydrate, lipid, an antibody or antibody fragment, a
small organic or inorganic molecule, or a nucleotide sequence such
as an aptamer. For example, a compound can be a small organic
compound obtained from a combinatorial chemical library. A compound
can have a known or unknown structure. A compound which is assayed
in the methods of the invention is called a "candidate compound"
and if the candidate compound has the desired activity it is called
an "effective compound." One compound or more than one compound can
be used in the methods of the invention.
[0072] A useful compound in the methods of the invention includes a
Humanin-like compound. As used herein, the term "Humanin-like
compound" is intended to mean a compound that is structurally
related to Humanin or specifically binds to Bax, Bid (including
t-Bid) in the same manner as Humanin. However, in contrast to
Humanin, the Bax- or Bid-binding activity of a Humanin-like
compound is not necessarily known a priori. A Humanin-like compound
has physical characteristics that are similar to Humanin such as a
similar topology or shape, or similar charge and charge spacing
characteristics of Humanin.
[0073] A Humanin-like compound includes, for example, derivatives
or analogues of Humanin polypeptides which contain one or more
naturally occurring amino acid derivatives of the twenty standard
amino acids, for example, 4-hydroxyproline, 5-hydroxylysine,
3-methylhistidine, homoserine, ornithine or carboxyglutamate, and
can include amino acids that are not linked by polypeptide bonds.
Similarly, the term also includes cyclic polypeptides and other
conformationally constrained structures. Specific examples of
modifications, analogs and derivatives can be found described in,
for example, Roberts and Vellaccio, The Peptides: Analysis,
Synthesis, Biology, Eds. Gross and Meinhofer, Vol. 5, p. 341,
Academic Press, Inc., New York, N.Y. (1983), and Burger=s Medicinal
Chemistry and Drug Discovery, Ed. Manfred E. Wolff, Ch. 15, pp.
619-620, John Wiley & Sons Inc., New York, N.Y. (1995)).
[0074] Humanin-like compounds also include peptidomimetics of
Humanin. Peptidomimetics, which include chemically modified
polypeptides, polypeptide-like molecules containing non-naturally
occurring amino acids, peptoids and the like, have a structure
substantially the same as the reference polypeptides upon which the
peptidomimetic is derived (see, for example, "Burger's Medicinal
Chemistry and Drug Discovery", 1995, supra). A peptidomimetic shows
a considerable degree of structural identity when compared to the
reference polypeptide and exhibits characteristics which are
recognizable or known as being derived from or related to the
reference polypeptide. Peptidomimetics include, for example,
organic structures which exhibit similar properties such as charge
and charge spacing characteristics of the reference polypeptide.
Peptidomimetics also can include constrained structures so as to
maintain optimal spacing and charge interactions of the amino acid
functional groups.
[0075] Similarly, "Bax-like compound" and "Bid-like compound" is
intended to mean a compound that is structurally related to Bax or
Bid, respectively, or specifically binds to Humanin in the same
manner as Bax or Bid, respectively. The Humanin-binding activity of
the compound is not necessarily known a priori.
[0076] A candidate compound can be a polypeptide such as an
antibody or antibody fragment. The antibody or antibody fragment
can have binding affinity for any type of antigen including a
polypeptide antigen or a small molecule antigen. These antibodies
can be monoclonal antibodies or polyclonal antibodies. In addition,
an antibody or antibody fragment can have binding affinity
specifically for a Bax, Bid, or Humanin polypeptide. In addition to
being a candidate or effective compound, an antibody or antibody
fragment with affinity for a Bax, Bid, or Humanin polypeptide of
the invention can be used to determine the amounts of these
polypeptides either alone or in a complex.
[0077] An antibody can modulate the level of one or both of the
polypeptides of the invention within a complex. For example, an
antibody can block the binding site of the polypeptide or remove
the polypeptide from its normal location. In addition, an antibody
can increase or decrease the stability of the complex. For example,
the binding of an antibody to a complex can induce a conformational
change in one or both polypeptides that effects the stability of
their interaction.
[0078] An isolated anti-Bax, anti-Bid, and anti-Humanin antibody
having specific reactivity with Bax, Bid or Humanin, respectively
can be used in the methods of the invention. These antibodies can
be either monoclonal or polyclonal antibodies as well as antigen
binding fragments of such antibodies. Cell lines producing
monoclonal antibodies having specific reactivity with a polypeptide
or complex of the invention can also be useful in providing a
source of antibodies. An anti-Bax, anti-Bid, or anti-Humanin
antibody, or antibody fragment is characterized by having specific
binding activity for a Bax, Bid, or Humanin polypeptide or a
polypeptide portion thereof of at least about 1.times.10.sup.5
M.sup.-1. Thus, Fab, F(ab').sub.2, Fd and Fv fragments of these
antibodies which retain specific binding activity for a Bax, Bid,
or Humanin polypeptide, are included within the definition of an
antibody. Specific binding activity of a polypeptide of the
invention can be readily determined by one skilled in the art. For
example, specific binding activity of a Humanin polypeptide can be
determined by comparing the binding activity of an anti-Humanin
antibody to a Humanin polypeptide versus a control polypeptide that
is not a Humanin polypeptide. In addition, an antibody can
specifically recognize a complex of polypeptides. For example, an
antibody can specifically bind to an epitope that includes amino
acids from two different polypeptides that are in contact with each
other. Methods of preparing polyclonal or monoclonal antibodies are
well known to those skilled in the art (see, for example, Harlow
and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor
Laboratory Press (1988)).
[0079] In addition, the term antibody as used herein includes
naturally occurring antibodies as well as non-naturally occurring
antibodies, including, for example, single chain antibodies,
chimeric, bifunctional and humanized antibodies, as well as
antigen-binding fragments thereof. Such non-naturally occurring
antibodies can be constructed using solid phase peptide synthesis,
can be produced recombinantly or can be obtained, for example, by
screening combinatorial libraries consisting of variable heavy
chains and variable light chains as described by Huse et al.
(Science 246:1275-1281 (1989)). These and other methods of making,
for example, chimeric, humanized, CDR-grafted, single chain, and
bifunctional antibodies are well known to those skilled in the art
(Winter and Harris, Immunol. Today 14:243-246 (1993); Ward et al.,
Nature 341:544-546 (1989); Harlow and Lane, supra, 1988); Hilyard
et al., Protein Engineering: A practical approach (IRL Press 1992);
Borrabeck, Antibody Engineering, 2d ed. (Oxford University Press
1995)).
[0080] A candidate compound can also include a nucleic acid or
nucleotide sequence. Exemplary nucleotide sequences can include an
anti-sense nucleotide sequence, an RNA molecule, or an aptamer
sequence. For example, a nucleotide sequence, such as an aptamer,
can bind to one or more components of a Bax-Humanin or Bid-Humanin
complex and modulate the level or stability of that complex.
Aptamers are nucleic acid sequences that have three dimensional
structures capable of binding small molecular targets including
metal ions, organic dyes, drugs, amino acids, co-factors,
aminoglycosides, antibiotics, nucleotide base analogs, nucleotides
and polypeptides (Jayasena, S. D., Clinical Chemistry 45:9,
1628-1650, (1999)). Nucleotide sequences can be modified by several
methods known in the art in order to increase the stability of
these nucleotide sequences within cells.
[0081] A sub-class of candidate compounds include the Humanin-like,
Bax-like, and Bid-like compounds. These compounds are structurally
related to Humanin, Bax, and Bid respectively, however their
functional binding activity is not necessarily known a priori and
so these compounds are assayed in the methods of the invention.
[0082] A Humanin-like compound can be a random compound, isolated
based on a Humanin-like function, that when characterized is found
to be structurally related to Humanin. Several methods are known in
the art for determining the structure of a compound. For example,
the structure of compounds that contain amino acid or nucleotide
sequences can be determined using sequencing methods. Also, for
example, several methods are known in the chemical arts for
determining the structure of small molecules.
[0083] In addition, a Humanin-like compound can be rationally
designed based on the structure of Humanin. For example, Humanin
can be used as a template for the design of a library of
peptidomimetics. As described earlier, a peptidomimetic refers to a
non-peptide compound that is a topological analog of the
corresponding polypeptide. Such a peptidomimetic can, for example,
retain some or all of the functional groups of the amino acids
shown to be functionally important in the polypeptide. A
peptidomimetic can also, for example, consist partially or
completely of a non-peptide backbone used in the art in the design
of other peptidomimetics, such as a glucose scaffold, a
pyrrolidinone scaffold, a steroidal scaffold, a benzodiazepine
scaffold, or the like. Peptidomimetics can provide various
advantages over polypeptides, and can be useful for oral
administration since they can be stable when administered to a
subject during passage throughout the digestive tract. In addition,
peptidomimetics can be designed to allow for better penetration of
the blood brain barrier (BBB).
[0084] Methods of rationally designing peptidomimetics of peptides
are known in the art. For example, the rational design of three
peptidomimetics based on the sulfated 8-mer peptide CCK26-33, and
of two peptidomimetics based on the 11-mer peptide Substance P, and
related peptidomimetic design principles, are described in Horwell,
Trends Biotechnol. 13:132-134 (1995). Individual, rationally
designed peptidomimetics of the polypeptides of the invention can
be assayed for their ability to bind a relevant polypeptide, or to
have some other activity using one or more of the assays described
herein. Similarly, a plurality of peptidomimetic compounds, such as
variants of a peptidomimetic lead compound, or a plurality of other
compounds, can be assayed simultaneously or sequentially using the
binding and functional assays described herein.
[0085] Methods for producing pluralities of candidate compounds to
use in screening for effective compounds, including chemical or
biological molecules such as simple or complex organic molecules,
metal-containing compounds, carbohydrates, peptides, polypeptides,
peptidomimetics, glycoproteins, lipoproteins, nucleic acids,
antibodies, and the like, are well known in the art and are
described, for example, in Huse, U.S. Pat. No. 5,264,563; Francis
et al., Curr. Opin. Chem. Biol. 2:422-428 (1998); Tietze et al.,
Curr. Biol., 2:363-371 (1998); Sofia, Mol. Divers. 3:75-94 (1998);
Eichler et al., Med. Res. Rev. 15:481-496 (1995); and the like.
Libraries containing large numbers of natural and synthetic
compounds also can be obtained from commercial sources.
Combinatorial libraries of molecules can be prepared using well
known combinatorial chemistry methods (Gordon et al., J. Med. Chem.
37: 1233-1251 (1994); Gordon et al., J. Med. Chem. 37: 1385-1401
(1994); Gordon et al., Acc. Chem. Res. 29:144-154 (1996); Wilson
and Czarnik, eds., Combinatorial Chemistry Synthesis and
Application, John Wiley & Sons, New York (1997)).
[0086] Compounds can be introduced into an assay, for example, by
direct addition to a binding solution or by addition to cell
culture media containing a target cell of interest. Depending on
the chemical characteristics of the compound, one skilled in the
art can adjust solution conditions to avoid precipitation of the
compound out of solution. When adding a compound to a cell, some
compounds, based on chemical structure, will enter the cell while
other compounds will require some facilitation to penetrate the
cell membrane. Several methods can be used to facilitate
penetration of a compound through the cell membrane. For example,
several lipids are known in the art which can chaperone compounds
through a cell membrane. In addition, transformation or
transfection methods such as electroporation or calcium phosphate
precipitation can be used. In addition, spheroblasts, which are
yeast cells lacking the cell wall, can be prepared by one skilled
in the art.
[0087] Several assays are known in the art that can be used to
determine the ability of a candidate compound to modulate the
binding of Humanin to Bax or Bid. In addition, these binding assays
can be used to assess the binding of a compound such as a
Humanin-like compound to a polypeptide such as Bax or Bid.
Analogously, these assays can be used to assess the binding of a
compound such as a Bax-like compound or a Bid-like compound to a
Humanin polypeptide. These binding assays include, for example, a
two-hybrid assay, co-immunoprecipitation assay, co-localization
assay, scintillation proximity assay (SPA), UV or chemical
cross-linking, biomolecular interaction analysis (BIA), mass
spectrometry (MS), nuclear magnetic resonance (NMR), and
fluorescence polarization assays (FPA). These assays can be low- or
high-throughput assays. In addition, these assays can be direct
binding assays or competition binding assays (Yamamura et al.,
Methods in Neurotransmitter Receptor Analysis, Raven Press, New
York).
[0088] Exemplary methods include, for example, transcription based
assays such as reporter assays and two-hybrid assays, including
yeast and mammalian two-hybrid assays. Such assays are well known
in the art and can be found in standard reference texts such as
Sambrook et al., supra, and Ausubel et al., supra, 1999. An example
of a yeast two-hybrid assay is described in Example I.
[0089] Other methods for detecting the ability of a candidate
compound to modulate the binding of Humanin to Bax or Bid or to
assess the binding of a compound such as a Humanin-like compound to
a polypeptide such as Bax or Bid include, for example, assaying a
compound in co-immunoprecipitation assays, co-localization assays,
ELISA assays, and FACS analysis, which are described, for example,
in Harlow and Lane, Eds., Antibodies: A Laboratory Manual, Cold
Spring Harbor Laboratory (1988). A candidate compound, for example
a polypeptide, can be added to a Humanin-Bax or Humanin-Bid
co-immunoprecipitation assay as described in Example II to
determine whether the compound can modulate the binding of Humanin
to Bax or Bid. In addition, for example, a Humanin-like compound
can be added to Bax or Bid in the co-immunoprecipitation assay to
determine whether the Humanin-like compound can bind to Bax or
Bid.
[0090] High-thoroughput methods for detecting a modulatory compound
or for detecting the binding of a Humanin-like compound to Bax or
Bid can include, for example, a scintillation proximity assay (SPA)
(Alouani, Methods Mol. Biol. 138:135-41 (2000)) or a fluorescence
polarization assay (FPA) (Degterev, et al., Nature Cell Biology
3:173-182 (2001)). SPA involves the use of a fluomicrosphere coated
with an acceptor molecule, such as an antibody, to which a ligand
will bind selectively in a reversible manner. This assay can be
used, for example to detect a Humanin-like compound that binds to
Bax. For example, Bax can be bound to a fluomicrosphere using a Bax
antibody and a .sup.3H or .sup.125I labeled Humanin-like compound
can be added. If the labeled Humanin-like compound binds to Bax,
the radiation energy from the Humanin-like compound is absorbed by
the fluomicrosphere. This induces the fluomicrosphere to produce
light which is easily measured. In addition, an SPA assay can be
used to detect modulation of a Humanin-Bax or Humanin-Bid complex
by a candidate compound. For example, Humanin can be bound to the
fluormicrosphere and the amount of light generated in the presence
of Bax can be measured. A candidate compound can then be added to
the reaction and the amount of light generated can be measured and
compared to the reaction without the compound.
[0091] A fluorescence polarization assay (FPA) can also be used,
for example, to detect modulation of a Humanin-Bax or Humanin-Bid
complex by a candidate compound. For example, Humanin can be
labeled with a fluorophore such as Oregon Green (Molecular Probes,
Eugene Oreg.) and bound to a GST-Bax fusion protein. A candidate
compound can be added and the displacement of fluorescently labeled
Humanin from the GST-Bax fusion protein can be measured using a
spectrophotometer, for example an Analyst plate reader (LJL
Biosystems). An example of a FPA can be found herein in Example VI
and FIG. 5C.
[0092] Another example of a method for detecting a modulatory
compound or for detecting the binding of a Humanin-like compound to
Bax or Bid can include, for example, UV or chemical cross-linking
(Fancy, Curr. Opin. Chem. Biol. 4:28-33 (2000)) or a biomolecular
interaction analysis (BIA) (Weinberger et al., Pharmacogenomics
1:395-416 (2000)). The binding of a Humanin-like compound to Bax or
Bid can be determined by cross-linking these two components, if
they interact, using UV or a chemical cross-linking agent. In
addition, a biomolecular interaction analysis (BIA) can detect
whether two components interact. One component, for example, Bax
can be bound to a BIA chip and a second component such as a
Humanin-like compound can be passed over the chip. If the two
components interact an electrical signal is generated. This type of
assay can also be used to detect compounds that modulate an
interaction, for example a Humanin-Bax interaction. For example,
Bax can be bound to the chip and Humanin can be passed over the
chip. A candidate compound is then added and the signal is measured
to determine the effect of the compound on the binding of Bax to
Humanin.
[0093] Further examples of a method for detecting a modulatory
compound or for detecting the binding of a Humanin-like compound to
Bax or Bid can include, for example, mass spectrometry (MS)
(McLafferty et al., Science 284:1289-1290 (1999) and Degterev, et
al., Nature Cell Biology 3:173-182 (2001)), or nuclear magnetic
resonance (NMR) (Shuker et al., Science 274:1531-1534 (1996),
Hajduk et al., J. Med. Chem. 42:2315-2317 (1999), and Chen and
Shapiro, Anal. Chem. 71:669 A-675A (1999)). Mass spectrometry can
be used to measure polypeptide interactions without the need for
first labeling the polypeptides. For example, a polypeptide, such
as Bax, can be covalently attached to a SELDI chip (Ciphergen) and
the binding of a second component such as a Humanin-like compound
to the immobilized polypeptide can be monitored by mass
spectrometry. The samples embedding in the matrix can be analyzed
for mass by matrix-assisted laser desorption ionization
time-of-flight (MALDI-TOF) mass spectrometry. Likewise NMR
spectroscopy can detect the interaction of two components. For
example .sup.1H/.sup.15N HSQC spectra can be recorded by adding
different amounts of a candidate compound and Humanin into
.sup.15N-labeled Bax/His.sub.6.
[0094] In addition, virtual computational methods (see for example,
Shukur et al., supra 1996; Lengauer et al., 1996, Current Opinions
in Structural Biology, 6:402-406; Choichet et al., 1991, Journal of
Molecular Biology, 221:327-346; Cherfils et al., 1991, Proteins,
11:271-280; Palma et al., 2000, Proteins, 39:372-384; Eckert et
al., 1999, Cell 99:103-115; Loo et al., 1999, Med. Res. Rev.,
19:307-319; Kramer et al., J. Biol. Chem., (2000)), and the like
can be used. Exemplary virtual computational methodology involves
virtual docking of small-molecule compounds on a virtual
representation of the polypeptide structure. In addition, other
methods for detecting a modulatory compound or for detecting the
binding of a Humanin-like compound to Bax or Bid can include, for
example, any of those listed for screening for Bax inhibitory
proteins as in U.S. Pat. No. 6,130,317.
[0095] The number of different compounds to screen in a particular
assay can be determined by those skilled in the art, and can be 2
or more, such as 5, 10, 15, 20, 50 or 100 or more different
compounds. For certain applications, such as when a library of
random compounds is to be screened, and for automated procedures,
it may be desirable to screen 10.sup.3 or more compounds, such as
10.sup.5 or more compounds, including 10.sup.7 or more compounds.
Compounds can be screened individually or several compounds can be
screen together. For example, several compounds can be added to one
well of a multi-well plate and if a positive signal is obtained
from that well the compounds can be separated into individual wells
and re-tested for the desired activity. Testing several compounds
at one time in a multiplexed reaction can allow a large number of
compounds to be tested in a shorter period of time.
[0096] The methods of the invention identify effective compound
that can increase or decrease the binding of Humanin to Bax or Bid.
In addition, effective compounds can increase or decrease the
stability of Humanin-Bax or Humanin-Bid complexes. The stability of
a complex can be assessed by determining the on/off rate of the
components of the complex. For example, Scatchard analysis can be
used determine the on/off rate of the components of a complex
(Schutz W., Wien Klin Wochenschr 103:438-42 (1991); Monot, et al.
Fundam Clin Pharmacol 81:18-25 (1994)).
[0097] The invention further provides a method for modulating an
activity mediated by a Bax or Bid polypeptide by contacting the
polypeptide with an effective, modulating amount of an compound
that modulates Bax or Bid activity. Modulation of an activity in a
particular assay can be determined by quantitating levels of
activity within the assay. As understood by those of skill in the
art, assay methods for identifying compounds that modulate an
activity generally require comparison to a control or standard.
[0098] In addition to methods that identify compounds that modulate
the binding of Humanin to Bax, the invention also provides several
methods to identify a Humanin-like compound that binds to Bax.
These methods include, for example, direct binding assays, survival
assays, and competition assays.
[0099] The invention provides a method for identifying a
Humanin-like compound that binds to Bax, by: (a) contacting the
Humanin-like compound with Bax, under conditions suitable to form a
complex; and (b) determining the ability of the Humanin-like
compound to bind Bax. The contacting of the Humain-like compound
with Bax can occur in vitro such as within a test tube, or in vivo
such as within a yeast or bacterial cell. The assays described
above such as the two-hybrid assay, co-immunoprecipitation assay,
co-localization assay, scintillation proximity assay (SPA), UV or
chemical cross-linking, biomolecular interaction analysis (BIA),
mass spectrometry (MS), nuclear magnetic resonance (NMR), and
fluorescence polarization assays (FPA) can be used to determine the
ability of the Humanin-like compound to bind to Bax or Bid.
[0100] The invention also provides a method of determining the
level of binding between a Humanin-like compound and Bax by: (a)
contacting the Humanin-like compound with Bax under conditions
suitable to form a complex; (b) determining the amount of binding
of the Humanin-like compound to Bax; and (c) comparing the amount
of binding of the Humanin-like compound to Bax, to the amount of
binding of Humanin to Bax in a reference sample. Again, the
contacting can be performed in vitro or in vivo and the assay
methods described above, for example, a biomolecular interaction
analysis (BIA) can be used.
[0101] In addition to measuring the binding of a Humanin-like
compound to Bax or Bid using the assays described above, the
invention also provides a survival or selection type of assay. The
invention provides a method for identifying a Humanin-like compound
that inhibits the apoptotic activity of Bax by: (a) expressing Bax
in a cell, wherein expression results in the death of said cell;
(b) exposing the cell to a Humanin-like compound; and (c) detecting
the survival of the cell, where survival indicates that the
Humanin-like compound binds to Bax. This type of assay can be
performed, for example in a mammalian cell such as the cells used
in Example IV and FIG. 4, or in a non-mammalian cell such as a
yeast cell. In addition, for example, the Bax polypeptide can be
expressed from an inducible expression vector, as described
earlier. Furthermore an analogous assay can be used where cell
death is induced by Bid or t-Bid.
[0102] An example of a survival assay can be to express a Bax in a
mammalian cell line under the control of an inducible promoter so
that in the presence of the inducer the cells are no longer able to
grow in culture. This cell line can be aliquoted into a 96 well
plate with media that contains the inducer. A compound or
Humanin-like compound can be then be added to these cells or
expressed in these cells. The cells are then incubated under
conditions amenable for cell growth for two to three days. The
amount of cell growth can be measured by a variety of assays. For
example, optical density measurements of the well using a standard
spectrophotometer, uptake of dyes such as trypan blue or alomar
blue, uptake of .sup.3H or any other cell viability assay. As a
positive control, full length Humanin can be added to or expressed
in these cells resulting in cell growth.
[0103] Another example of a survival assay system can be to express
a mammalian Bax in yeast. For this assay, a yeast cell strain can
be constructed with a mammalian Bax under the control of an
inducible promoter. Expression of the mammalian Bax polypeptide in
yeast will result in yeast cell death. A compound or Humanin-like
compound can be added to or expressed in this yeast cell stain and
compounds that modulate Bax-induced cell death will result in the
survival or growth of yeast colonies. Yeast cell survival can be
easily detected by identifying colonies on solid media or can be
measured in liquid cultures by optical density.
[0104] The invention also provides a competition assay format for
the detection of a Humanin-like compound that binds to Bax. The
invention provides a method for identifying a Humanin-like compound
that binds to Bax, by: (a) contacting Humanin with Bax under
conditions suitable to form a Humanin-Bax complex; (b) contacting
the Humanin-Bax complex with the Humanin-like compound; and (c)
determining the ability of the Humanin-like compound to bind to
Bax. This type of assay can be performed, for example, in vitro in
a 96 well plate.
[0105] The method described above can be performed, for example,
utilizing a labeled Humanin polypeptide. As used herein, the terms
"label" refer to molecules that are either directly or indirectly
involved in the production of a detectable signal. Any label can be
linked to polypeptides or compounds used in the methods of the
invention. These atoms or molecules can be used alone or in
conjunction with additional reagents. Such labels are themselves
well-known in clinical diagnostic chemistry.
[0106] The labeling means can be a fluorescent labeling compound
that chemically binds to polypeptides without denaturation to form
a fluorochrome (dye) that is a useful fluorescent tracer. In
addition, a radioactive moiety can be attached to or incorporated
within a polypeptide of the invention. For example, a polypeptide
can be iodinated with .sup.125I or can be synthesized in the
presence of .sup.35S labeled amino acids, using methods well known
in the art. See, for example, Galfre et al., Meth. Enzymol.,
73:3-46 (1981). Conventional means of polypeptide conjugation or
coupling by activated functional groups are also applicable. See,
for example, Aurameas et al., Scand. J. Immunol., Vol. 8, Suppl.
7:7-23 (1978), Rodwell et al., Biotech., 3:889-894 (1984), and U.S.
Pat. No. 4,493,795.
[0107] An example of a competition assay as described above can be
to contact a known amount of .sup.125I labeled Humanin with Bax in
a microcentrifuge tube under conditions suitable to form a
Humanin-Bax complex. A Humanin-like compound can then be added to
above mixture and allowed to interact for a specified period of
time. An antibody to Bax can then be added and antibody-Bax complex
can be precipitated using for example, a protein A sepharose bead.
The amount of radioactivity in the pellet compared to the
supernatant indicates whether the Humanin-like compound was able to
compete with the labeled Humanin for binding to Bax. Alternatively,
the Humanin-like compound can be labeled and the Humanin used in
complex can be unlabeled. Competition assays can also be performed
using an SPA, FPA and BIA format as described previously above.
[0108] Also provided herein are methods of identifying a site on
Humanin that interacts with Bax or Bid, said method comprising,
constructing a plurality of Humanin mutants; contacting the Humanin
mutants with Bax or Bid under conditions that permit Bax or Bid
binding to native Humanin; and selecting a Humanin mutant that does
not bind to Bax or Bid, thereby identifying a site on Humanin that
interacts with Bax or Bid. The same procedure can be used to
identify a site on Bax or Bid that interacts with Humanin. Methods
for constructing mutants are well-known in the art including single
or multiple amino-acid deletions or substitutions, truncated
mutants, and the like. Once a region containing a binding site on
Humanin or Bax or Bid is identified, this site can be used as a
target in bioassays to identify compounds that can bind to and
modulate this site.
[0109] Techniques of structural biology can also be used to
identify sites on Humanin or Bax and Bid required for their
interactions, using techniques such as X-ray crystallography,
photoaffinity labeling, MALDI mass spectrometry (see, e.g., Kramer
et al., J. Biol. Chem., supra, (2000) and the like); and high speed
NMR using TROSY (transverse relaxation-optimized spectroscopy; see,
e.g., Pervushin et al., PNAS, USA, 94:12366-12371 (1997)) methods.
Exemplary virtual computational methods include, for example,
protein-protein docking prediction (as described in, e.g., Lengauer
et al., Current Opinions in Structural Biology, 6:402-406 (1996);
Choichet et al., Journal of Molecular Biology, 221:327-346 (1991);
Cherfils et al., Proteins, 11:271-280 (1991); Palma et al.,
Proteins, 39:372-384 (2000); and the like).
[0110] In addition to identifying a Humanin-like compound that
binds to Bax, the invention also provides a method for identifying
a Humanin-like compound that modulates an activity of Bax by: (a)
measuring an activity of Bax; (b) contacting Bax with a
Humanin-like compound under conditions suitable to form a
Humanin-like compound/Bax complex; (c) determining the amount of
activity of Bax when bound to the Humanin-like compound and (d)
comparing the amount of activity of from step (a) with the amount
of activity from step (c). The contacting of Bax with a
Humanin-like compound can be performed in vitro or in vivo.
[0111] The activity of Bax can be increased or decreased by the
Humanin-like compound. In addition, an analogous assay can be used
to identify a Humanin-like compound that binds to Bid. Furthermore,
an analogous assay can be used to identify a Bax-like compound or a
Bid-like compound that binds to Humanin.
[0112] Several activities of Bax, or Bid, can be measured. For
example, Bax can form dimers with Bcl-2 related polypeptides,
homodimerize or self-associate, translocate from the cytosol to
mitochondria upon activation, integrate into membranes, for example
in a mitochondrial membrane, form a pore, and induce cell death. In
addition, Bid can translocate from the cytosol to mitochondria upon
activation, form dimers with Bcl-2 related polypeptides, integrate
into membranes such as mitochondrial membranes, trigger Bax
activation and pore formation, and induce cell death. Furthermore,
Bax and Bid can indirectly activate the caspase cascade by causing
the release of cytochrome c from the mitochondria. When this
released cytochrome c associates with Apaf-1, activate procaspase-9
can be activated which initiates a cascade of caspases. All of
these steps can be measured using assays well known in the art or
described herein.
[0113] Induction of apoptosis by Bax or Bid can involve different
mechanisms. For example, Bcl-2 family members are known to
heterodimerize and homodimerize in a way that regulates the
activities of the polypeptides in the dimer. For example, the
anti-apoptotic Bcl-2 polypeptide can dimerize with and thereby
inactivate the pro-apoptotic Bax polypeptide. The ratio of Bcl-2 to
Bax can indicate whether a cell will undergo apoptosis or survive.
Dimerization of Bcl-2 family member polypeptides in mitrochondrial
membranes can be a mechanism to regulate apoptosis at the
mitochondrial level. This dimerization can be achieved when the BH3
domain of one molecule binds into a pocket formed by the BH1, BH2,
and BH3 domains of another family member. In addition, Bcl-2 family
members in mitochondrial membranes can interact with other
polypeptides. For example, in C. elegans the Bcl-2 homologue CED-9
protects cells from death by directly binding to an sequestering
the Apaf-1 homologue CED-4.
[0114] Assays for determining whether Bax or Bid can form dimers
with other Bcl-2 family members are well known in the art and
include all the protein-protein interaction assays described
herein. For example, the ability of Bax to dimerize with Bcl-2 can
be detected using an immunoprecipitation assay as described by
Oltvai et al. supra (1993).
[0115] Bcl-2 family members can insert into synthetic lipid
bilayers, oligomerize, and form channels with discrete
conductances. It has been proposed that Bcl-2 family members can
form a pore in the mitochondria through which cytochrome c and
other polypeptides can be released. In addition, pro-apoptotic
Bcl-2 family members can recruit other mitochondrial outer membrane
proteins into forming a pore or channel. For example, several Bcl-2
family members can bind to the voltage-dependent anion channel
(VDAC) polypeptide and regulate its channel activity. Furthermore,
it is possible that Bcl-2 family members control the homeostasis of
the mitochondria so that apoptotic signals result in rupture of the
mitochondrial outer membrane and release of cytochrome c.
[0116] Assays for measuring the formation of a pore in a lipid
bilayer include ion-efflux or dye efflux assays using unilammelar
liposomes or electrical measurements in planar bilayer membranes
such as those described in Schendel et al., J. Biol. Chem.
274:21932-21936 (1999); Schendel et al., Proc. Natl. Acad. Sci. USA
94:5113-5188 (1997); and Montal et al., Proc. Natl. Acad. Sci. USA
69:3561-3566 (1972). Both Bax and t-Bid are able to form pores in
lipid bilayers.
[0117] Bax and Bid can indirectly activate the caspase cascade by
causing the release of cytochrome c from the mitochondria. Assays
to detect cells with active caspases can be performed, for example
by staining these cells using a CaspaTag kit (Intergen). In
addition, the invention provides a method for identifying a
Humanin-like compound that modulates an activity of Bax by
measuring an activity downstream of Bax. For example, the invention
provides a method for identifying a Humanin-like compound that
modulates an activity of Bax by: (a) expressing Bax in a cell,
where expression results in the activation of an enzyme; (b)
expressing in the cell a Humanin-like compound; and (c) detecting
the level of the enzyme, where modulation of the enzyme level
indicates that the Humanin-like compound modulates an activity of
Bax. The enzyme can be, for example, a caspase.
[0118] In addition to identifying a Humanin-like compound that
modulates an activity of Bax, the invention provides a method of
identifying any effective compound that modulates an activity of
Bax by: (a) contacting Humanin with Bax under conditions suitable
to form a Humanin-Bax complex; (b) measuring an activity of Bax;
(c) contacting the Humanin-Bax complex with a candidate compound;
(d) determining the amount of activity of Bax in the presence of
the candidate compound; and (e) comparing the amount of activity
from step (b) with the amount of activity from step (d), where
modulation of an activity of Bax indicates that the candidate
compound is an effective compound that modulates an activity of
Bax.
[0119] The contacting of Humanin with Bax and the Humanin-Bax
complex with a candidate compound can be performed in vitro or in
vivo. All of the candidate compounds listed above including a
polypeptide, peptidomimetic, non-peptidyl compound, carbohydrate,
lipid, a synthetic compound, a natural product, an antibody or
antibody fragment, a small organic molecules, a small inorganic
molecule, and a nucleotide sequence can be used in this assay.
Furthermore, the same assays described above for detecting an
activity of Bax can be used.
[0120] In addition to identifying a Humanin-like compound that
modulates an activity of Bax or Bid, an analogous method can be
used to identify a Bax-like compound or Bid-like compound that
modulates an activity of Humanin. An activity of Humanin that can
be measured is its ability to decrease apoptosis in cells
transfected with Bax or Bid. Another activity of Humanin is its
ability to decrease apoptosis in cells transfected with familial
Alzheimer's genes or beta amyloid fragments. For example, the V642I
form of APP is known to cause cell death when transfected into F11
cells (Hashimoto et al., supra (2001)). Several assays well known
in the art can be used to measure apoptotic cell death. These
assays detect changes in the cell membrane or the digestion of DNA
into a ladder. For example, annexin V/PI staining can be performed
with an Annexin V-EGFP apoptosis detection kit (PanVera). TUNEL
assays can also be used to detect apoptosis, for example using a
Fluorescent FragEL kit (Oncogene Research Products).
[0121] The invention also provides a method of diagnosing and
treating a pathology characterized by a Humanin-Bax or Humanin-Bid
complex. For example, the invention provides a method of diagnosing
or predicting a pathology characterized by an increased or
decreased level of Humanin-Bax complexes in a subject by: (a)
obtaining a test sample from the subject; (b) determining the
amount of Humanin-Bax complex in the test sample and (c) comparing
the amount of Humanin-Bax complex in the test sample with the
amount of Humanin-Bax complex in a reference sample, where an
increased or decreased amount of the complex in the test sample as
compared to the reference sample is diagnostic or predictive of a
pathology.
[0122] Pathologies that can be characterized by a Humanin-Bax or
Humanin-Bid complex can include any disease where Bax or
Bid-induced apoptosis is implicated. Such pathologies include
stroke, heart attack, autoimmunity, trauma, neuron cell death,
inflammatory diseases, and cancer. In this regard, Bax has been
implicated through gene ablation studies in mouse models in
numerous diseases associated with pathological cell loss, including
stroke, Parkinson's disease, and oocyte depletion during menopause,
making it a promising target for new therapies. In addition,
neurodegenerative diseases such as Alzheimer's disease, Parkinson's
disease, Huntington's disease and Amyotrophic Lateral Sclerosis
(ALS), and diseases induced by excitoxicity can be included in
pathologies characterized by Humanin-Bax or Humanin-Bid complexes.
The presence, absence, increased or decreased level of a
Humanin-Bax or Humanin-Bid complex can be indicative of one of
these pathologies.
[0123] Parkinson's disease is a progressive and ultimately fatal
neurodegenerative disorder characterized by loss of the pigmented
dopaminergic neurons of the substantia nigra. The symptoms of
Parkinson's disease can often be managed initially by
administration of L-DOPA, the immediate precursor of dopamine.
However, reduced efficacy of L-DOPA treatment often occurs possibly
because metabolism of the drug prevents effective delivery to the
CNS. Programmed cell death has also been implicated to play an
important role in this neurodegenerative disorder inasmuch as
withdrawal of neurotrophic factors from neurons leads to cell death
through a mechanism consistent with apoptosis. Moreover, the
absence of inflammatory cells or scar formation in the brains of
patients with Parkinson's disease indicates that striatal neuron
death can occur through apoptosis as opposed, for example, to
necrosis.
[0124] ALS is characterized clinically by progressive weakness,
muscle atrophy, and eventual paralysis and death. These symptoms
are due to the progressive degenerative of upper and lower motor
neurons in the brain and spinal cord. Aberrantly occurring
apoptosis can be a cause of motor neuron loss in ALS (Martin et
al., J. Neuropathol. Exp. Neurol. 58:459-471 (1999); Martin et al.,
Int. J. Mol. Med. 5:3-13 (2000)). Motor neurons undergo DNA
fragmentation and are eliminated with minimal inflammatory
involvement. In addition, mitochrondrial enriched fractions from
postmortem samples of ALS motor cortex and spinal cord, show
increased Bax and Bak protein levels and reduced Bcl-2 protein
levels.
[0125] In addition to neurodegenerative disorders, apoptosis has
been indicated to result in cell death from glutamate-induced
neurotoxicity arising from conditions such as stroke.
Glutamate-induced toxicity occurs when glutamate is released from
dying neurons in the brain at times of acute injury. Glutamate
released by dying neurons in turn binds to specific receptors for
glutamate on adjacent healthy neurons, triggering signals that
set-off a complex series of biochemical events leading to apoptotic
cell death.
[0126] As described earlier, Alzheimer's disease (AD) is the most
common type of dementia occurring in middle and late life. AD
causes profound degeneration of the cerebral cortex and loss of
neurons in the neocortex and hippocampus Inherited cases of AD are
linked to mutation in the genes encoding amyloid precursor protein
or presenilin proteins. The amyloid hypothesis of AD is based on
the premise that generation of a fragment of APP called amyoid-b
protein is a critical pathogenic mechanism. Overexpression and
intracellular accumulation of APP activates caspase-3, APP is a
target of caspase-3 and APP cleavage by caspase-3 or caspase-6 can
promote Ab formation (Uetsuki et al., J. Neurosci. 19:6955-6964
(1999); Weidemann, et al., J. Biol. Chem. 274:5823-5829 (1999);
Gervais et al., Cell 97:395-406 (1999); LeBlanc et al., J. Biol.
Chem. 274:23426-23436 (1999)). Currently AD is diagnosed based on a
checklist of symptoms, however no biological diagnostic procedures
are available and a post-mortem brain biopsy is currently used to
confirm the diagnosis of AD.
[0127] The invention additionally provides a method of identifying
pathologically proliferative cells, such as neoplastic cells, in a
sample in order to diagnose cancer, monitor cancer therapy, or
assess the prognosis of patients with cancer by determining the
presence, absence, increased or decreased level of a Humanin-Bax or
Humanin-Bid complex in a sample from a patient. Several cancer
chemotherapeutics act through a variety of intracellular targets
which culminate in the activation of the apoptotic pathway.
[0128] As used herein, the term "neoplastic cell" is intended to
mean a cell that exhibits histological or proliferative features of
a malignant or premalignant cell. For example, by histological
methods, a neoplastic cell can be observed to invade into
surrounding normal tissue, have an increased mitotic index, an
increased nuclear to cytoplasmic ratio, altered deposition of
extracellular matrix, or a less differentiated phenotype. A
neoplastic cell can also exhibit unregulated proliferation, such as
anchorage independent cell growth, proliferation in reduced-serum
medium, loss of contact inhibition, or rapid proliferation compared
to normal cells. The diagnostic methods described herein are
applicable to the identification of any type of neoplastic cell,
such as neoplastic cells present in solid tumors (carcinomas and
sarcomas) such as breast, colorectal, gynecological, lung,
prostate, bladder, renal, liver, urethral, endocrinal, melanoma,
basal cell, central nervous system, lymphoma, stomach, esophageal,
squamous cell cancers, as well as all forms of leukemias, and
metastases therefrom.
[0129] The diagnostic methods described herein can also be adapted
for use as prognostic assays. Such an application takes advantage
of the observation that alterations in expression or structure of
different molecules involved in apoptosis can take place at
characteristic stages in the progression of a proliferative disease
or of a tumor. Knowledge of the stage of the tumor allows the
clinician to select the most appropriate treatment for the tumor
and to predict the likelihood of success of that treatment.
[0130] In the methods of the invention, a sample to be analyzed is
obtained from the individual to be diagnosed. The term "sample," as
used herein, means any biological specimen obtained from an
individual that contains Humanin, Bax or Bid. A sample can be, for
example, whole blood, plasma, saliva or other bodily fluid or
tissue containing these polypeptides. One skilled in the art
understands that samples such as serum samples can be diluted prior
to analysis of polypeptide or polypeptide complex content.
[0131] As used herein, the term Asubject@ is intended to mean any
animal containing neurons, for example, a mammal such as a mouse,
rat, dog, primate or human. A subject can suffer from or be at high
risk of developing any disease related to apoptosis such as
autoimmune diseases, cancer, stroke, or a neurodegenerative
disorder such as Parkinson=s disease, Huntington=s disease,
Alzheimer=s disease, ALS, multiple sclerosis; epilepsy; head or
spinal cord injury; optic neuropathies including glaucoma and
macular degeneration, and disorders of photoreceptor degeneration
such as retinitis pigmentosa; metabolic, mitochondrial or
infectious brain abnormalities such as encephalitis, or suffers
from neuropathic pain (see, for example, Lipton and Rosenberg, New
Engl. J. Med. 330: 613 (1994)).
[0132] Immunological procedures useful for in vitro or in vivo
detection of Humanin-Bax or Humanin-Bid complexes in a sample
include immunoassays that employ a detectable antibody. Such
immunoassays include, for example, immunohistochemistry,
immunofluorescence, ELISA assays, radioimmunoassay, FACS analysis,
immunoprecipitation, immunoblot analysis, Pandex microfluorimetric
assay, agglutination assays, flow cytometry and serum diagnostic
assays, which are well known in the art (Harlow and Lane, supra,
1988; Harlow and Lane, Using Antibodies: A Laboratory Manual, Cold
Spring Harbor Press (1999)). An antibody can be made detectable by
various means well known in the art. For example, a detectable
marker can be directly attached to the antibody or indirectly
attached using, for example, a secondary compound that recognizes a
Humanin, Bax, or Bid specific antibody. Useful markers include, for
example, radionucleotides, enzymes, binding polypeptides such as
biotin, fluorogens, chromogens and chemiluminescent labels.
[0133] In accordance with another embodiment of the present
invention, there are provided diagnostic systems, preferably in kit
form, comprising at least one invention polypeptide or antibody in
a suitable packaging material. A suitable diagnostic system
includes at least one invention polypeptide or antibody, as a
separately packaged chemical reagent(s) in an amount sufficient for
at least one assay. A kit containing a Humanin, Bax, or Bid
antibody can contain a reaction cocktail that provides the proper
conditions for performing an assay, for example, an ELISA or other
immunoassay, for determining the level of expression of these
polypeptides or a complex of these polypeptides in a sample. In
addition a kit can contain control samples that contain known
amounts of a Humanin, Bax, or Bid polypeptide and, if desired, a
second antibody specific for the anti-Humanin, anti-Bax, or
anti-Bid antibody.
[0134] The contents of the kit of the invention, for example,
antibodies, are contained in packaging material, preferably to
provide a sterile, contaminant-free environment. In addition, the
packaging material contains instructions indicating how the
materials within the kit can be employed both to detect the
presence or absence of a particular Humanin, Bax, or Bid
polypeptide or complex or to diagnose the presence of, or a
predisposition for a condition associated with the presence or
absence of these polypeptides or complexes such as Alzheimer's
disease. The instructions for use typically include a tangible
expression describing the reagent concentration or at least one
assay method parameter, such as the relative amounts of reagent and
sample to be admixed, maintenance time periods for reagent/sample
admixtures, temperature, buffer conditions, and the like.
[0135] The invention also provides a method of treating a pathology
characterized by the presence, absence, increased or decreased
amount of a Humanin-Bax or Humanin-Bid complex by administering to
an individual an effective compound, for example, a Humanin-like
compound, determined using the methods of the invention described
above for identifying effective compounds.
[0136] The effective compounds of the invention described herein
can optionally be formulated together with a pharmaceutically
acceptable carrier for delivery to a cultured cell or to a subject.
Suitable pharmaceutically acceptable carriers are well known in the
art and include, for example, aqueous or organic solvents such as
physiologically buffered saline, glycols, glycerol, oils or
injectable organic esters. A pharmaceutically acceptable carrier
can also contain a physiologically acceptable compound that acts,
for example, to stabilize or increase the solubility of a
pharmaceutical composition. Such a physiologically acceptable
compound can be, for example, a carbohydrate, such as glucose,
sucrose or dextrans; an antioxidant, such as ascorbic acid or
glutathione; a chelating agent; a low molecular weight polypeptide;
or another stabilizer or excipient. Pharmaceutically acceptable
carriers, including solvents, stabilizers, solubilizers and
preservatives, are described, for example, in Martin, Remington's
Pharm. Sci., 15th Ed. (Mack Publ. Co., Easton, 1975).
[0137] Those skilled in the art can formulate the therapeutic
molecules to ensure proper distribution in vivo. For example, the
blood-brain barrier (BBB) excludes many highly hydrophilic
compounds. To ensure that the effective compounds of the invention
cross the BBB, if desired, they can be formulated, for example, in
liposomes, or chemically derivatized. For a review of strategies
for increasing bioavailability of polypeptide drugs in the brain,
and of methods for determining the permeability of polypeptides
through the BBB using in vitro and in vivo assays, see Engleton et
al., Peptides 9:1431-1439 (1997). Strategies that have been
successfully used to increase the permeability of other
neuropeptides through the BBB are particularly contemplated. For
example, modifying the opioid polypeptide analgesic Met-enkephalin
with D-penicillamine at two positions, forming a disulfide bridge
that conformationally constrains the polypeptide, increases its
stability towards BBB endothelial cell proteases and its BBB
permeability. Likewise, linking two enkephalin polypeptides, each
containing a D-amino acid residue at the second position, with a
hydrazide bridge, results in a metabolically stable polypeptide
with improved brain penetration. Additionally, halogenation of an
enkephalin polypeptide has been shown to increase its BBB
permeability. Additional modifications to a polypeptide of the
invention that can increase its BBB penetration include conjugating
the peptide to a lipophilic moiety, such as a lipophilic amino acid
or methyldihydropyridine. Similar modifications to invention
polypeptides or peptidomimetics are likewise expected to be
advantageous.
[0138] Methods of ensuring appropriate distribution in vivo can
also be provided by rechargeable or biodegradable devices,
particularly where gradients of concentrations of drug in a tissue
are desired. Various slow release polymeric devices are known in
the art for the controlled delivery of drugs, and include both
biodegradable and non-degradable polymers and hydrogels. Those
skilled in the art understand that the choice of the pharmaceutical
formulation and the appropriate preparation of the composition will
depend on the intended use and mode of administration.
[0139] The effective compounds of the invention can be administered
to a subject by any effective route. Suitable routes for delivering
the therapeutic molecules of the invention include topically,
intraocularly, intradermally, parenterally, orally, intranasally,
intravenously, intramuscularly, intraspinally, intracerebrally and
subcutaneously. The present invention also provides compounds
containing an acceptable carrier such as any of the standard
pharmaceutical carriers, including phosphate buffered saline
solution, water and emulsions such as an oil and water emulsion,
and various types of wetting agents.
[0140] An effective dose of an effective compound of the invention
can be determined, for example, by extrapolation from the
concentration required for in the binding or Bax activity assays
described herein; or from the dose required to modulate cell
proliferation. An effective dose of an effective compound of the
invention for the treatment of a pathology can also be determined
from appropriate animal models, such as transgenic mice. Transgenic
mice that over-express beta amyloid are known to exhibit cognitive
defects similar to those seen for Alzheimer's patients. An
effective dose for treating this disease is a dose that results in
either partial or complete reversal of cognitive skills as assayed
by several known behavioral assays. Animal models for pathologies
such as tumors are well-known in the art. An effective dose for
treating this disease is a dose that results in either partial or
complete regression of the tumor, reduction in metastasis, reduced
discomfort, or prolonged life span. The appropriate dose for
treatment of a human subject with a therapeutic molecule of the
invention can be determined by those skilled in the art, and is
dependent on the nature and bioactivity of the particular compound,
the desired route of administration, the gender, age and health of
the individual, the number of doses and duration of treatment, and
the particular condition being treated.
[0141] In addition the invention provides a method of prolonging
the in vivo survival of transplanted cells for the treatment of a
disease or pathological condition. The method includes increasing
the amount or stability of a Humanin-Bax or Humanin-Bid complex in
a population of cells and transplanting the population of cells
into a subject. Diseases or pathological conditions can include,
for example, neurodegenerative diseases, cancer and virus-infected
cells.
[0142] Cell transplantation is now being explored for the treatment
of certain diseases, including Parkinson's and Alzheimer's
diseases. For example, potential therapies in animal models of
Parkinson's disease have included cell transplantation of
genetically modified fibroblasts, which produce L-DOPA in the
vicinity of the substantia nigra. Although the results of these
experiments have been encouraging, the survival time of the
transplanted cells is limited and, therefore, results in only a
temporary and minor improvement of the condition.
[0143] Transplantation of fetal brain cells, which contain
precursors of the dopaminergic neurons, has also been examined as a
potential treatment for Parkinson's disease. In animal models and
in patients with this disease, fetal brain cell transplantations
have resulted in the temporary reduction of motor abnormalities.
Furthermore, it appears that the implanted fetal dopaminergic
neurons form synapses with surrounding host neurons. However, the
transplantation of fetal brain cells is again limited due, for
example, to the limited survival time of the implanted neuronal
precursors.
[0144] In the specific case of Parkinson's disease, intervention by
increasing the amount or stability of a Humanin-Bax or Humanin-Bid
complex can improve the in vitro and in vivo survival of fetal and
adult dopaminergic neurons, their precursors and dopamine-secreting
fibroblasts and, thus, can provide a more effective treatment of
this disease. Likewise, improved in vivo survival of essentially
any cell type to be transplanted will improve the treatment of that
disease. For example, neuronal cells or their precursors can be
used for the treatment of other neurodegenerative diseases such as
Alzheimer's disease and glutamate-induced neuronal cell death by
enhancing the in vivo survival of cells.
[0145] Cells to be transplanted for the treatment of a particular
disease can be genetically modified in vitro so as to increase the
amount or stability of a Humanin-Bax or Humanin-Bid complex.
Vectors used for transfecting cells ex vivo include adenovirus
vectors and adeno-associated virus 2 vectors. Such methods are
known within the art and are essentially the same as those
described above, except that an increased amount or stability of a
Humanin-Bax or Humanin-Bid complex is first achieved within the
cells in vitro.
[0146] The invention further provides a mitochondrial-derived
Humanin polypeptide having substantially the same sequence as in
SEQ ID NO:3 and encoded by a nucleotide sequence substantially the
same as that shown in SEQ ID NO:1. The Humanin polypeptide has been
published as the 24 amino acid sequence shown in FIG. 4B (SEQ ID
NO:2). The invention provides evidence, as shown in FIG. 4C, that
Humanin is transcribed in mitochondria. As described in Example IV,
RNA from mitochondria was used as a template for an RT-PCR assay.
Using primers specific for Humanin, a product corresponding to
Humanin was detected and sequenced. Based on this finding, and the
mitochondrial genetic code, the invention provides a
mitochondrial-derived Humanin polypeptide comprising the 21 amino
acid sequence shown in FIG. 4B (SEQ ID NO:3).
[0147] Exceptions to the universal genetic code occur in the
mitochondria from several species (see Osawa et al., Microbiol Rev.
56:229-264 (1992)). A common change is that UGA has the same
meaning as UGG, and therefore represents tryptophan instead of
termination. This change is found in yeasts, invertebrates and
vertebrates, but not in plants. Other changes are characteristic
for particular organisms. Table I shows codon usage in the
vertebrate mitochondrial genetic code.
[0148] Based on the differences in the genetic code in
mitochondria, Humanin translated in mitochondria is predicted to
contain one amino acid difference compared to the published Humanin
polypeptide. As shown in FIG. 4, Humanin translated in the
mitochondria (mtHumanin) is predicted to contain a methionine (M)
at residue 16 instead of an isoleucine (I) as found in the
published form of Humanin. In addition, the mitochondrial form of
Humanin is predicted to lack the three amino acid sequence arginine
(R)- arginine (R)- alanine (A) at the carboxyl-terminus of the
polypeptide due to termination before this sequence. Since Humanin
can be transcribed in mitochondria, the mitochondrial-derived form
of Humanin can be considered a biologically relevant form of
Humanin.
TABLE-US-00001 TABLE I Anti-codons in Vertebrate Mitochondria Amino
Acid Amino Acid Amino Acid Amino Acid Anti-codon Anti-codon
Anti-codon Anti-codon (codon) (codon) (codon) (codon) Phe (UUU) Ser
(UCU) Tyr (UAU) Cys (UGU) GAA GUA GCA Phe (UUC) Ser UCC) Tyr (UAC)
Cys (UGC) UGA Leu (UUA) Stop (UAA) Trp (UGA) UAA Ser (UCA) UCA Leu
(UUG) Stop (UAG) Trp (UGG) Ser (UCG) Leu (CUU) Pro (CCU) His (CAU)
Arg (CGU) GUG Leu (CUC) Pro (CCC) His (CAC) Arg (CGC) UAG UGG UCG
Leu (CUA) Pro (CCA) Gln (CAA) Arg (CGA) UUG Leu (CUG) Pro (CCG) Gln
(CAG) Arg (CGG) Ile (AUU) Thr (ACU) Asn (AAU) Ser (AGU) GAU GUU GCU
Ile (AUC) Thr (ACC) Asn (AAC) Ser (AGC) UGU Met (AUA) Thr (ACA) Lys
(AAU) Stop (AGA) UAU UUU Met (AUG) Thr (ACG) Lys (AAG) Stop (AGC)
Val (GUU) Ala (GCU) Asp (GAU) Gly (GGU) GUC Val (GUC) Ala (GCC) Asp
(GAC) Gly (GGC) UAC UGC UCC Val (GUA) Ala (GCA) Glu (GAA) Gly (GGA)
UUC Val (GUG) Ala (GCG) Glu (GAG) Gly (GGG)
[0149] The invention provides an isolated polypeptide containing
the amino acid sequence designated as SEQ ID NO:3, or a functional
fragment thereof, where the fragment contains the methionine at
position 16 of SEQ ID NO:3. A functional fragment of SEQ ID NO:3
can be a fragment with the ability to bind to Bax or Bid or the
ability to be used as an immunogen to generate anti-Humanin
antibodies. Fragments can include, for example, amino terminal,
carboxyl terminal, or internal deletions of SEQ ID NO:3 where the
fragment contains the methionine at position 16 of SEQ ID NO:3. For
example, a fragment can contain at least about 6, 8, 10, 12, 14,
16, 18, or 20 contiguous or non-contiguous amino acid residues of
SEQ ID NO:3 where the fragment contains the methionine at position
16 of SEQ ID NO:3. Examples of fragments that contain 8 contiguous
amino acid residues of SEQ ID NO:3 where the fragment contains the
methionine at position 16 include, for example, LLLLTSEM, LLLTSEMD,
LLTSEMDL, LTSEMDLP, TSEMDLPV, and SEMDLPVK. In addition, various
molecules or moieties, such as other polypeptides, carbohydrates,
lipids or small molecules can be attached to SEQ ID NO:3 including
the fragments of SEQ ID NO:3 where the fragment contains the
methionine at position 16 of SEQ ID NO:3.
[0150] The invention also provides an isolated polypeptide
containing the amino acid sequence designated as SEQ ID NO:3, or a
functional fragment thereof, where the fragment contains the
methionine at position 16 of SEQ ID NO:3, and where the polypeptide
has been modified, for example, where non-natural amino acids have
been substituted for one or more amino acids. A modification of a
polypeptide can include non-naturally occurring derivatives,
analogues and functional mimetics thereof generated by, for
example, chemical synthesis. For example, derivatives can include
chemical modifications of the polypeptide such as alkylation,
acylation, carbamylation, iodination, or any modification that
derivatizes the polypeptide. Such derivatized molecules include,
for example, those molecules in which free amino groups have been
derivatized to form amine hydrochlorides, p-toluene sulfonyl
groups, carbobenzoxy groups, t-butyloxycarbonyl groups,
chloroacetyl groups or formyl groups. Free carboxyl groups can be
derivatized to form salts, methyl and ethyl esters or other types
of esters or hydrazides. Free hydroxyl groups can be derivatized to
form O-acyl or O-alkyl derivatives. The imidazole nitrogen of
histidine can be derivatized to form N-im-benzylhistidine. Also
included as derivatives or analogues are those polypeptides which
contain one or more naturally occurring amino acid derivatives of
the twenty standard amino acids, for example, 4-hydroxyproline,
5-hydroxylysine, 3-methylhistidine, homoserine, ornithine or
carboxyglutamate, and can include amino acids that are not linked
by peptide bonds.
[0151] The invention further provides an isolated polypeptide
containing the amino acid sequence designated as SEQ ID NO:3, or a
functional fragment thereof, where the fragment contains the
methionine at position 16 of SEQ ID NO:3, and where the isolated
polypeptide contains a targeting molecule or moiety. A targeting
molecule is a molecule that can be attached to a Humanin
polypeptide of the invention that preferentially directs the
polypeptide to a certain region of a cell or to a certain organ or
site within the body. For example, the mitochondrial-derived
Humanin polypeptide can be fused to the human immunodeficiency
virus (HIV) tat polypeptide or to the Drosophila antennapedia
membrane penetrating polypeptide sequence in order to target the
mitochondrial-derived Humanin polypeptide to a cellular membrane.
In addition, for example, a polypeptide such as PKKKRKV (SEQ ID
NO:10) from SV40 T antigen is sufficient to cause nuclear import of
a cytoplasmic polypeptide to which it is linked. Several targeting
molecules are known in the art for targeting different locations
within a cell.
[0152] In addition, targeting molecules and methods of identifying
targeting molecules, are known in the art for preferentially
directing polypeptides or other molecules to different organs in
the body (see, for example, U.S. Pat. Nos. 6,068,829, 6,232,287,
and 6,296,832). For example, a mitochondrial-derived Humanin
polypeptide can be expressed as a fusion protein with a polypeptide
such as CNSRLHLRC (SEQ ID NO:11) or VLREGPAGG (SEQ ID NO:12), as
disclosed in U.S. Pat. No. 6,296,832, which can be used to target
the brain. Other polypeptides such as antibodies or antibody
fragments can also be used to target a Humanin polypeptide of the
invention to a particular site in the body. Methods for generating
fusion proteins are well known in the art (see, for example,
Sambrook et al., supra, 1989; Ausubel et al., supra, 1999).
[0153] An isolated mitochondrial-derived polypeptide or a
functional fragment thereof, containing a targeting molecule can be
used to target Humanin to sites in the body where Humanin can be
beneficial. For example, Humanin can be targeted to a neurological
plaque or tangle region in the brain of an Alzheimer's disease
patient. In addition, for example, Humanin can be targeted to any
region of the body where Bax or Bid-induced apoptosis is occurring
inappropriately.
[0154] The invention further provides an isolated polypeptide
containing the amino acid sequence designated as SEQ ID NO:3, or a
functional fragment thereof, where the fragment contains the
methionine at position 16 of SEQ ID NO:3, and where the isolated
polypeptide contains a detection molecule or moiety. A detection
moiety is a moiety that is detectable external to a cell, tissue,
or subject to which it is administered and, thus, can be useful for
performing a diagnostic study. Typical detection moieties include
radioactive molecules or fluorescent molecules. A diagnostic study
can be performed in vivo, in situ, or in vitro. For example, a
diagnostic study can be performed in a subject, a tissue slice or
biopsy sample, cell culture, or in a test tube. An isolated
mitochondrial-derived Humanin polypeptide of the invention linked
to a detection moiety can be used, for example, in a binding assay
to determine the amount of Bax or Bid in a cell extract that is
capable of binding Humanin.
[0155] The invention further provides antibodies that specifically
bind to the mitochondrial-derived form of Humanin designated as SEQ
ID NO:3, or a functional fragment thereof, where the fragment
contains the methionine at position 16 of SEQ ID NO:3. In addition,
the invention provides antibodies that bind to the
mitochondrial-derived form of Humanin designated as SEQ ID NO:3,
but do not bind to the cytosolic form of Humanin designated as SEQ
ID NO:2. Furthermore, the invention provides functional fragments
of these antibodies. As used herein, the term "functional fragment"
when used in reference to an antibody is intended to refer to a
portion of an antibody which still retain some or all of the
Humanin binding activity. Such functional fragments can include,
for example, antibody functional fragments such as Fv, single chain
Fv (scFv), Fab, F(ab'), F(ab).sub.2, F(ab')2, and minibody. Other
functional fragments can include, for example, heavy or light chain
polypeptides, variable region polypeptides, CDR polypeptides,
single domain antibodies, or portions thereof so long as such
functional fragments retain binding activity.
[0156] Antibodies that bind to Humanin can be used in diagnositic
and therapeutic methods. For example, a Humanin antibody can be
labeled with a detection moiety and used to detect the presence,
absence or amount of Humanin in vivo, in vitro, or in situ.
Detection of the presence, absence or amount of Humanin at a site
in the body can be useful in the diagnosis of certain diseases. For
example, a decreased amount or lack of Humanin can be diagnostic of
a disease such as Alzheimer's disease. Alternatively, the presence
or an increased amount of Humanin can be diagnostic of a disease
such as cancer where beneficial apoptosis has been blocked. In
addition, a Humanin antibody can be labeled with a therapeutic
moiety such as chemotherapeutic agent and used, for example, to
treat a tumor that over-expresses Humanin. Therapies directed to
increasing the amount of Humanin in a disease can be achieved by
linking the Humanin polypeptide to a targeting molecule and
directing Humanin to a particular disease site in the body as
described further above.
[0157] A moiety, such as a fluorescent molecule, can be linked to a
polypeptide, including an antibody, of the invention at any
location within the polypeptide. For example, the moiety can be
linked to the carboxyl terminus of the polypeptide, the amino
terminus of the polypeptide, or at an internal site in the
polypeptide. In addition, more than one moiety can be linked to the
same polypeptide, for example, a moiety can be linked to the
carboxyl terminus and another moiety, of the same or different
type, can be linked to the amino terminus of the polypeptide.
[0158] Chemistries used for the linkage of various moieties to
polypeptides are well known in the art. A moiety such as detection
moiety can be linked to a polypeptide, including an antibody, of
the invention using, for example, carbodiimide conjugation
(Bauminger and Wilchek, Meth. Enzymol. 70:151-159 (1980)).
Carbodiimides comprise a group of compounds that have the general
formula R--N.dbd.C.dbd.N--R', where R and R' can be aliphatic or
aromatic, and are used for synthesis of polypeptide bonds. The
preparative procedure is simple, relatively fast, and is carried
out under mild conditions. Carbodiimide compounds attack carboxylic
groups to change them into reactive sites for free amino groups.
Carbodiimide conjugation has been used to conjugate a variety of
compounds to carriers for the production of antibodies. The water
soluble carbodiimide, 1-ethyl-3-(3-dimethylaminopropyl)
carbodiimide (EDC) is useful for conjugating a moiety to a
polypeptide, including an antibody of the invention.
[0159] In addition to using carbodiimides for the direct formation
of polypeptide bonds, EDC also can be used to prepare active esters
such as N-hydroxysuccinimide (NHS) ester. The NHS ester, which
binds only to amino groups, then can be used to induce the
formation of an amide bond with the single amino group of the
doxorubicin. The use of EDC and NHS in combination is commonly used
for conjugation in order to increase yield of conjugate formation
(Bauminger and Wilchek, supra, 1980). Other methods of conjugating
moieties to a polypeptide include, for example, sodium periodate
oxidation followed by reductive alkylation of appropriate reactants
and glutaraldehyde crosslinking. However, it is recognized that,
regardless of which method of producing a polypeptide-moiety
conjugate of the invention is selected, a determination must be
made that the polypeptide or antibody maintains its selectivity and
that the moiety maintains its relevant function.
[0160] The yield of polypeptide-moiety conjugate formed is
determined using routine methods. For example, HPLC or capillary
electrophoresis or other qualitative or quantitative method can be
used (see, for example, Liu et al., J. Chromatogr. 735:357-366
(1996); Rose et al., J. Chromatogr. 425:419-412 (1988)). In
particular, the skilled artisan will recognize that the choice of a
method for determining yield of a conjugation reaction depends, in
part, on the physical and chemical characteristics of the specific
moiety. Following conjugation, the reaction products are desalted
to remove any free polypeptide and free drug.
[0161] In one embodiment, a detection moiety such as a radioactive
or fluorescent molecule can be linked to an antibody of the
invention in order to diagnose, predict, prevent, or monitor
diseases involving Humanin or Humanin-deficiency. A diagnostic
study can be performed in vivo, in situ, or in vitro. For example,
a diagnostic study can be performed in a subject, a tissue slice or
biopsy sample, cell culture, or in a test tube.
[0162] An antibody of the invention labeled with a detection moiety
can be used to detect the presence, absence or amount of Humanin in
a subject or in a sample from a subject using methods known to one
skilled in the art. For example, a moiety such as a gamma ray
emitting radio-nucleotide, for example, indium-111 or
technitium-99, can be linked to an antibody of the invention. For
in vivo diagnostic studies, this conjugate can be administered to a
subject and detected using a solid scintillation detector.
Similarly, a positron emitting radionucleotide such as carbon-11 or
a paramagnetic spin label such as carbon-13 can be linked to a
polypeptide of the invention and, following administration to a
subject, the localization of the detection moiety can be detected
using positron emission transaxial tomography or magnetic resonance
imaging, respectively (van Roggen et al., Curr. Opin. Rheumatol.
12:77-83 (2000); Stubbs et al., Acta Oncol. 38:845-853 (1999);
Ikeda et al., Topics Magn. Reson. Imaging 10:143-151 (1999); Parker
et al., Topics Magn. Reson. Imaging 10:130-142 (1999)). A detection
moiety can also be, for example, a MRI contrast dye or a
fluorescent agent.
[0163] An antibody of the invention labeled with a detectable
moiety also can be used to detect the presence, absence or amount
of Humanin in a sample derived from a subject. For example, a
labeled antibody can be bound to a tissue slice for example, from a
tumor biopsy or a post-mortem brain. In addition, for example, a
labeled antibody can be used to detect Humanin using any standard
immunological assay, for example, an ELISA assay or
immunoprecipitation assay. Since a Humanin antibody bound to
Humanin is a protein:protein complex, several of the methods
described further above, such as a biomolecular interaction
analysis (BIA) and fluorescence polarization assay (FPA) can be
used to detect Humanin using a labeled antibody.
[0164] A detection moiety linked to a polypeptide of the invention
can be used to diagnose, predict, prevent, or monitor diseases
involving Humanin or Humanin-deficiency. For example, a Humanin
antibody linked to a detection moiety can be used to detect the
presence, absence or amount of Humanin in a subject or a sample
from a subject in order to diagnose Alzheimer's disease or a tumor
that over-expresses Humanin. In addition, the presence, absence or
amount of Humanin can be used to predict, and therefore possibly
prevent, a disease involving Humanin. Furthermore, labeled
antibodies to Humanin can be used to monitor the progress of
treatment, for example to determine if the amount of Humanin is
decreased in a tumor after treatment.
[0165] In another embodiment, an antibody of the invention can
contain a therapeutic moiety. A therapeutic moiety can include, for
example, a cytotoxic agent, including a chemotherapeutic agent or a
radioactive agent, an anti-antigogenic agent, a pro-angiogenic
agent, and an agent that promotes tissue repair. Cytotoxic
chemotherapy or radiation therapy is the basis of the systemic
treatment of disseminated malignant tumors. However, a limitation
of the currently used cytotoxic agents is that these agents have a
narrow therapeutic index. As such, the dose of these cytotoxic
agents generally is limited by undesirable toxicity. However,
coupling of an antibody of the invention to a cytotoxic agent can
effectively increase the concentration of the cytotoxic agent at a
site of Humanin over-expression, such as a tumor, and reduce side
effects associated with the presence of the toxic agent in other
tissues.
[0166] Chemotherapeutic agents include, for example, anthracycline,
alkylating agents, vinca alkaloids, nucleotide analogs,
cis-platinum, doxoribicin, methotrexate and mitomycin C. A
chemotherapeutic agent useful in the invention can be, for example,
an anthracyclin such as doxorubicin, which is a commonly used
cancer chemotherapeutic agent and is useful for treating breast
cancer (Sivam et al., Cancer Res. 55:2352-2356 (1995); Lau et al.,
Bioorg. Med. Chem. 3:1299-1304 (1995); Shih et al., Cancer Immunol.
Immunother. 38:92-98 (1994); Stewart and Ratain, In: "Cancer:
Principles and practice of oncology" 5th ed., chap. 19 (eds.
DeVita, Jr., et al.; J. P. Lippincott 1997); Harris et al., In
"Cancer: Principles and practice of oncology," supra, 1997). In
addition, doxorubicin has anti-angiogenic activity (Folkman, supra,
1997; Steiner, In "Angiogenesis: Key principles-Science, technology
and medicine," pp. 449-454 (eds. Steiner et al.; Birkhauser Verlag,
1992)), which can contribute to its effectiveness in treating
cancer. Other anthracycline, including idarubicin and daunorubicin,
also can be linked to an an antibody of the invention and delivered
effectively to angiogenic vasculature (Rowland et al., Cancer
Immunol. Immunother. 37:195-202 (1993); Aboud-Pirak et al.,
Biochem. Pharmacol. 38:641-648 (1989)).
[0167] The polypeptides and antibodies of the invention described
herein can optionally be formulated together with a
pharmaceutically acceptable carrier for delivery to a cultured cell
or to a subject as described further above. Pharmaceutically
acceptable carriers, including solvents, stabilizers, solubilizers
and preservatives, are described, for example, in Martin, supra,
1975. As described above those skilled in the art can formulate the
therapeutic molecules to ensure proper distribution in vivo. For
example, strategies for increasing the bioavailability of
polypeptide drugs in the brain, and methods for determining the
permeability of polypeptides through the BBB using in vitro and in
vivo assays can be found in Engleton et al. supra, 1997. In
addition, the polypeptides and antibodies of the invention can be
administered to a subject by any effective route such as, for
example intravenously, intraspinally, intracerebrally and
subcutaneously. Furthermore, an effective dose of a polypeptide or
antibody of the invention can be determined, for example, by
extrapolation from appropriate animal models, such as transgenic
mice.
[0168] The invention also provides nucleic acid molecules encoding
variants of the Humanin nucleotide sequence (SEQ ID NO:1) and
polypeptides encoded by these nucleic acid molecules. As described
above, the inventors have identified about 30 copies of the Humanin
nucleotide sequence, some identical to SEQ ID NO:1 and some with
small modifications compared to SEQ ID NO:1, in the human genome.
Humanin polypeptide variants expressed from these genomic sequences
can be used in the methods of the invention.
[0169] The following examples are intended to illustrate but not
limit the present invention.
Example I
Identification of Humanin as Bax Binding Target Using a Yeast
Two-Hybrid Screening Assay
[0170] A yeast two-hybrid screening assay was performed to identify
polypeptides that interact with an apoptotically-inactive mutant
form of Bax. A yeast two-hybrid system is designed to screen a cDNA
library for a gene encoding a polypeptide that interacts with a
known target (bait) polypeptide (Golemis, et al., In Current
Protocols in Molecular Biology, John Wiley & Sons, Inc., Ch.
20.0 and 20.1. (1996); Mendelsohn and Brent, Current Opinion in
Biotechnology 5:482-486 (1994)). In this experiment, a S184K (a
serine at position 184 in the transmembrane domain mutated to a
lysine) mutant of mouse Bax was used as a bait, since the wild type
Bax induces cell death in yeast. The S184K mutant human Bax does
not localize to mitochondria and does not induce apoptosis
(Mechushtan et al., EMBO Journal 18(g): 2330-2341 (1999)).
[0171] Bax (S184K) cDNA was constructed in a pGilda yeast
expression vector at EcoRV XhoI sites, producing a LexA-Bax fusion
polypeptide. The prokaryotic LexA polypeptide, which functions as
the DNA binding domain and binds to LexA operators, was used. A
human adult testes cDNA library in a pYESTrp vector was purchased
from Invitrogen. This library contains library cDNA fused with a
B42 transcription activation domain (an 88-residue acidic E. coli
peptide). The pGilda-Bax (S184K) and cDNA library plasmids were
co-transfected into EGY48 yeast cells together with a reporter
plasmid pSH18-34. The transformants were cultured on
leucine-deficient galactose-containing media, which induces gene
expression through the GAL1 promoter located within both the pGilda
and pYESTrp vectors. Since the Leu-auxotrophic host EGY48 can not
grow on Leu-deficient media, only the clones that contain Bax
binding polypeptides (which binds to Bax and brings B42 and LexA
into close proximity activating the LEU2 reporter gene) can grow
and form colonies.
[0172] A total of 19 positive colonies were identified. To
eliminate the false positives, a subsequent LacZ filter assay was
performed. When B42 and LexA were brought into close proximity,
they also activate the transcription of LacZ reporter in the
pSH18-34 plasmid. The cells produced b-galactosidase and turned
blue in LacZ filter assay. All 19 clones tested positive. When the
plasmids were isolated from the yeast clones and sequenced, one of
these clones contained a cDNA that encoded Humanin (Hashimoto, et
al. supra 2001). The interaction between Humanin and Bax was
further confirmed by co-transfection into EGY48 cells. Yeast cells
expressing both pGilda-Bax (S184K) and pYESTrp-Humanin grew on Leu-
media, while cells contain either Bax (S184K) or Humanin alone did
not grow.
Example II
Interaction of Humanin and Bax: Co-Immunoprecipitation and Cellular
Co-Localization
[0173] The following experiments confirm an interaction between
Humanin and Bax. Similar experiments were performed to confirm an
interaction between Humanin and Bid.
[0174] Humanin (HN) cDNA was sub-cloned into a Green Fluorescence
Protein (GFP) expression vector GFP-Cl at the XhoI/Hind III sites,
producing a GFP-HN fusion polypeptide. GFP and GFP-HN were
transfected into 293T cells with pcDNA3-HA-Bax. Cell lysates from
these cells were immunoprecipitated with anti-GFP antibody and
subsequently blotted with anti-HA antibody. The lysates were also
blotted with anti-GFP antibody to confirm polypeptide expression.
Humanin was found to co-immunoprecipitate with Bax. The data shown
were obtained using the cytosolic form of Humanin; however, both
cytosolic and mitochondrial forms of Humanin were tested and the
results were the same.
[0175] GFP-HN and a Red Fluorecence Protein (RFP) vector, RFP-Bax,
were transfected into Cos-7 cells. The intracellular localization
of the expressed polypeptides was examined using a confocal
microscope. As a control, GFP and RFP alone were shown to localize
diffusely inside the cells. GFP-HN localized to punctuate
intracellular membranes and when GFP-HN and RFP-Bax were
co-expressed, the two polypeptides co-localized to intracellular
membranes (data not shown).
Example III
Expression of Humanin in Mitochondria
[0176] Mitochondria were isolated from 5.times.10.sup.6 293T cells
using differential centrifugation. RNA was then isolated from the
mitochondria using TriZol reagent (Gibco-BRL). The RNA was
subjected to reverse transcription using an oligo-dT primer. The
products of the reverse transcription reaction were digested with
RNaseH and RNase A to remove any RNA. The remaining cDNA was used
as a template for PCR reaction with primers specific for Bax,
Humanin, NADHD and COX.
[0177] As seen in FIG. 3C, a product was detected for NADHD and COX
which are known mitochondrial genes and no product was detected for
Bax which is a cytosolic gene. However, a product was detected when
using the Bax primers and a pcDNA3-Bax template demonstrating that
the Bax primers are capable of generating a product. When using
primers for Humanin with the mitochondrial cDNA, a product of the
correct size was detected. The Humanin product was excised and
sequenced and the sequence matched the published Humanin sequence
(SEQ ID NO:1).
[0178] The PCR conditions used in this example were: initial
denaturing at 95.degree. C. for 30 seconds then 30 cycles of
denaturing at 95.degree. C., 30 seconds; annealing at 55.degree.
C., 30 seconds; and extension at 72.degree. C., 1 minute; followed
by final extension at 72.degree. C., 5 minutes then hold at
4.degree. C. The sequence of the forward (F) and reverse (R)
primers used in the PCR reactions and the size of the expected PCR
products are listed below. For NADH the expected product size was
230 base pairs and the primers were NADHF CCTCATTGTACCCATTCTAATCGC
(SEQ ID NO: 13) and NADHR GTAGAAGAGCGATGGTGAGAGC (SEQ ID NO: 14).
For COX the expected product size was 377 base pairs and the
primers were COXF CTCCCTCTCTCCTACTCCTGCTCG (SEQ ID NO: 15) and COXR
GGTATAGAATGGGGTCTCCTCCTCC (SEQ ID NO: 16). For Humanin the expected
product size was 75 base pairs and the primers were HNF
ATGGCTCCACGAGGGTTC (SEQ ID NO: 17) and HNR TTATGCCCGCCTCTTCAC (SEQ
ID NO: 18). For Bax the expected product size was 576 base pairs
and the primers were BAXF ATGGACGGGTCCGGG (SEQ ID NO: 19) and BAXR
TCAGCCCATCTTCTTCCAG (SEQ ID NO: 20). In addition, the sequence of
primers used for making the mitochondrial form of Humanin cDNA
were: BGHNF1 GGCTCGAGATGGCTCCACGAGGGTTC (SEQ ID NO: 21) and
BGHNI16MR GGAAGCTTACTTCACGGGCAGGTCCATTTC (SEQ ID NO: 22).
Example IV
Humanin Inhibition of Apoptosis
[0179] Rat neuronal cell line CSM14.1 cells were transfected with
various plasmids using the Lipofectamine reagent (Invitrogen). For
transfection, 10.times.10.sup.5 cells were plated per well using 6
well plates. Each well received 1 g DNA plus 4 ml of Lipofectamine.
After 24 hours of transfection, the percentage of cell death was
determined using 4'-6-diamidino-2-phenylindole (DAPI) staining. As
seen in FIG. 4, Humanin decreased both Bax- and Bid-induced
apoptosis. However, a mutant form of Humanin where the cysteine at
position 8 was mutated to an alanine, was not able to decrease Bax-
or Bid-induced apoptosis. The data shown were obtained using the
cytosolic form of Humanin; however, both cytosolic and
mitochondrial forms of Humanin were tested and the results were the
same.
[0180] The mutant form of Humanin where the cysteine at position 8
was mutated to an alanine (C8A) was made by direct PCR using
primers containing the desired mutation. The sequence of primers
used for the C8A mutant were: BGXHOC8AF
GGCTCGAGGAATGGCTCCACGAGGGTTCAGCGCTC (SEQ ID NO: 23) and BGHNR
GGAAGCTTTTATGCCCGCCTCTTCAC (SEQ ID NO: 24).
Example V
Humanin Binds Bax in Human Cells and Mouse Testis Lysates
[0181] This example shows the ability of Humanin to interact with
Bax in human cells, and additionally shows that Humanin does not
bind to Bcl-2, Bcl-XL, Bak, Bcl-B, Mcl-1, and Bok. Furthermore,
this example shows that endogenous Humanin can interact with
endogenous Bax in a mouse testis lysate.
[0182] Co-immunoprecipitation assays were performed using Humanin
polypeptides expressed as fusion polypeptides with the Green
Fluorescent Protein (GFP) in human cells. Wild-type Humanin fused
to GFP is referred to as GFP-HN and a mutant form of Humanin, where
the cysteine at position 8 is replaced with proline, fused to GFP
is referred to as GFP-C8P. As shown in FIG. 5A, GFP-HN
co-immunoprecipitated myc-tagged Bax from HEK293T cells, while GFP
and GFP-HN(C8P) did not. Immunoblot analysis of lysates of the
transfected cells confirmed production of all proteins. In
addition, GFP-HN also coimmunoprecipitated endogenous Bax from cell
lines, which contain relatively high levels of the Bax protein.
[0183] Furthermore, multiple Bcl-2 family proteins were surveyed
for interactions with Humanin by coimmunoprecipitation experiments
(FIG. 5A). GFP-HN did not co-immunoprecipitate with other Bcl-2
family proteins that are predicted to share structural similarity
with Bax, including Bcl-2, Bcl-XL, Bak, Bcl-B, Mcl-1, and Bok.
[0184] Expression of endogenous Humanin has been demonstrated in
the testis and colon of mice (Tajima et al., Neurosci. Lett.
324:227-231 (2002)). A rabbit polyclonal antibody raised against
Humanin peptide (P04, gift of Dr. Ikuo Nishimoto) was used to
examine whether endogenous Humanin peptide interacts with
endogenous Bax polypeptide. As shown in FIG. 5B, Humanin can be
co-immunoprecipitated together with Bax from the lysates of mouse
testis. In addition, endogenous Humanin was determined to be a
cytosolic protein, based on subcellular fractionation
experiments.
[0185] Immunoblotting and immunoprecipitations were performed as
follows. Immunoblotting was performed as described previously
(Fields and Song, Nature 340:245-246 (1989)). For
co-immunoprecipitations, cells were cultured in 50 uM benzocarbonyl
Valine Alanine Asparate fluoromethyl-ketone (zVAD-fmk) to prevent
apoptosis. Cells were suspended in lysis buffer (50 mM Tris-HCl,
pH7.4; 150 mM NaCl; 20 mM EDTA; 50 mM NaF; 0.5% NP-40; 0.1 mM
Na3VO4; ug/ml Leupeptin; 20 ug/ml Aprotinin; 1 mM DTT; and 1 mM
PMSF). Lysates (200 ul diluted in 1 ml final volume of lysis
buffer) were cleared by incubation with 15 ul of protein
G-Sepharose 4B (Zymed) and then incubated with 15 ul of polyclonal
antibody and 15 ul of protein G at 4.degree. C. overnight. Beads
were then washed 4 times with 1.5 mls lysis buffer before boiling
in Laemmli sample buffer and performing
SDS-PAGE/immunoblotting.
Example VI
Fluorescence Polarization Assay (FPA)
[0186] This example demonstrates the binding of Humanin to Bax
using a fluorescence polarization assay (FPA).
[0187] The binding of Humanin to Bax was further investigated using
an in vitro binding assay. In this example, the in vitro binding
assay is a fluorescence polarization assay (FPA). For this
experiment, full-length Bax protein was produced in bacteria and
purified. Various concentrations of Bax protein were incubated with
40 nM of rhodamine-conjugated synthetic purified Humanin peptide.
The extent of peptide binding was then monitored by measuring
polarization of monochromatic light passed through the sample,
where peptide binding to the bulkier protein slows the rate of
peptide tumbling in solution, enhancing the polarization effect. As
shown in FIG. 5C, Bax bound rhodamine-HN in a concentration
dependent and saturable manner, with an estimated Kd of 2 nM. In
contrast, various control peptides of similar length, such as
rhodamine-CD40 (residue 250P to 266G) did not display interactions
with Bax in these fluorescence polarization assays. Recombinant
Bcl-XL protein also did not bind rhodamine-HN, further confirming
specificity.
[0188] Fluorescence Polarization Assays were performed as follows.
Recombinant Bax protein was isolated from E. coli BL21 harboring
pTYB1-Bax essentially as described (Suzuki et al., Cell 103:645-654
(2000)). For fluorescence polarization assays (FPA), various
concentrations of Bax protein were incubated with 40 nM of
rhodamine-conjugated synthetic purified Humanin peptide dissolved
in water for 30 minutes in dark. Fluorescence polarization was
measured using an Analyst.TM. AD Assay Detection System (LJL
Biosystem, Sunnyvale, Calif.).
[0189] Peptides were synthesized as follows. Rhodamine-conjugated
Humanin peptide was synthesized on MBHA resin and is amidated at
the C-terminus. 1-aminohexanoic acid(ahx)-Humanin was initially
prepared with an Advanced Chemtech 350 multiple peptide synthesizer
using standard fluorenylmethoxycarbonyl chemistry with DIC coupling
(Atherton and Sheppard, Solid-phase Synthesis, Oxford Publishing
Co., New York (1989)). Rhodamine B (Aldrich) was coupled to
ahx-humanin using
N-[(Dimethylamino0-1H-1,2,3-triazolo[4,5-b]pyridin-1-ylmethylene]-N-methy-
lmethanaminium hexafluorophosphate N-oxide, 1-hydroxybenzotriazole
hydrate, and Diisopropylethylamine and occasional sonication until
the ninhydrin test was negative. The peptide was deprotected and
cleaved from the resin, precipitated with ice-cold diethyl ether
and purified by HPLC on a reverse-phase C18 Cosmosil column, eluted
with a water-acetonitile, 0.1% trifluoroacetic acid gradient and
analyzed by matrix-assisted laser desorption/ionization (MALDI)-
time-of-flight (TOF) mass spectrometry.
Example VII
Effect of Humanin on Cell Death
[0190] This example demonstrates the effect of Humanin on cell
death induced by several stimuli that are known to induce
apoptosis, at least in part, through Bax-dependent mechanisms (Wei
et al., Science 292:727-730 (2001)).
[0191] For these experiments, Flag-epitope tagged Humanin (Flag-HN)
or Flag control polypeptides were expressed in CSM14.1 cells, an
immortalized rat hippocampal neuronal cell line that has been used
as a model for neuronal apoptosis studies (Kermer et al., Cell
Death Differ. 9:405-413 (2002)). Apoptosis of CSM14.1 cells induced
by Staurosporine (STS), UV-irradiation, and serum-deprivation was
suppressed by Flag-HN (FIG. 6A-C). Conversely, apoptosis induced by
a Bax-independent death stimulus, TNF, was not suppressed by
Flag-HN (FIG. 6D). Note that at higher doses of STS (FIG. 6A),
Humanin-mediated protection was overcome, indicating
Humanin-insensitive mechanisms of apoptosis induction exist, even
when using a mitochondria-dependent death stimuli.
[0192] Apoptosis assays were performed as follows. Both floating
and adherent cells (after trypsinization) were collected 48 hr
after transfection, fixed, and stained using
4=,6-diamidine-2=-phenylindole dihydrochloride (DAPI) for assessing
apoptosis based on nuclear fragmentation and chromatin condensation
(Fields and Song, supra (1989)).
Example VIII
Reduction of Humanin Using Small Interfering RNA (siRNA)
[0193] This example uses siRNA to demonstrate that endogenous
Humanin can participate in cytoprotection.
[0194] Synthetic small interfering RNA (siRNA) (Elbashir et al.,
Nature 411:494-498 (2001)) was used to knock-down expression of
endogenous Humanin in SF268 cells, a glioblastoma cell line that
was empirically determined to contain high levels of endogenous
Humanin peptide expression. As shown in FIG. 6E, transfection into
SF268 cells of Humanin siRNA, but not a mutant siRNA containing two
mismatches, reduced endogenous levels of Humanin peptide, as
determined by immunoblotting, correlating with increased
sensitivity to STS-induced apoptosis. Thus, endogenous Humanin can
participate in cytoprotection.
[0195] Preparation and transfection of siRNA was performed as
follows. Oligonucleotides with the following sequences were
purchased from Qiagen: Humanin sense r(CCAGUGAAAUUGACCUGCC)d(TT)
[SEQ ID NO:25]; Humanin anti-sense r(GGCAGGUCAAUUUCACUGG)d(TT) [SEQ
ID NO:26]; Humanin mutant sense r(CCGAUGAAAUUGACCUGCC)d(TT) [SEQ ID
NO:27]; Humanin mutant anti-sense r(GGCAGGUCAAUUUCAUCGG)d(TT) [SEQ
ID NO:28] where Ar@ denotes a ribonucleotide sequence and Ad@
denotes a deoxynucleotide sequence. Complementary oligonucleotides
were annealed by the manufacturer. The resulting double-strand RNAs
were dissolved in sterile 100 mM potassium acetate, 30 mM
HEPES-KOH, 2 mM magnesium acetate [pH 7.4] to final concentration
of 20 .mu.M. SF268 cells were cultured in 6-well plates in 2 ml
DMEM media containing with 10% FBS. Cells were transfected at 40%
confluency using a mixture of 10 .mu.l of oligofectamine
(Invitrogen) and 10 .mu.l of siRNA (final concentration 100 nM) in
serum-free media. Cells were rinsed with medium after 16 hours of
incubation and cultured for 56 hours more before analysis.
Example IX
Correlation Between Humanin Binding to Bax and Humanin-Mediated
Suppression of Apoptosis
[0196] This example shows a correlation between Humanin binding to
Bax and suppression of apoptosis.
[0197] In order to explore whether a correlation exists between
Humanin binding to Bax and Humanin-mediated suppression of
apoptosis, Bax was co-expressed with various GFP-fusion
polypeptides encoding wild-type, full-length Humanin or various
truncation and site-specific mutants of Humanin (Table 1).
Expression of all GFP-fusion polypeptides was confirmed by
immunoblotting, and ability to bind Bax was determined by
co-immunoprecipitation assay. Each Humanin mutant was scored for
ability to suppress apoptosis induced by Bax over-expression by
>50% using a 3:1 ratio of HN: Bax plasmid DNA. As shown in Table
1, a perfect correlation was observed between Bax-binding and
suppression of apoptosis. Based on these studies, an active region
of the 24 amino-acid Humanin peptide mapped to residues 7-17. Two
mutants within this region, C8P and L9R, previously were reported
to lack anti-apoptotic activity when expressed in cells (Hashimoto
et al., Proc Natl Acad Sci USA 98:6336-6341 (2001); Hashimoto et
al., J. Neurosci, 21:9235-9245 (2001)). These Humanin mutants
lacked Bax-binding activity and failed to protect against
Bax-induced apoptosis, thus further confirming the correlation
between binding to Bax and anti-apoptotic function of Humanin
(Table 1).
TABLE-US-00002 TABLE 1 Analysis of Humanin Mutants: Correlation
with Bax-binding and antiapoptotic function. HN Peptide Bax binding
Bax suppression 1-24 + + 3-24 + + 4-24 + + 7-24 + + 10-24 - - 13-24
- - 1-17 + + 1-15 - - 1-12 - - 3-19 + + 3-18 + + 3-17 + + C8P - -
L9R - - GFP Only - -
[0198] Plasmids were constructed as follows. A cDNA containing the
ORF of Humanin without additional flanking sequences was generated
by PCR using an EST clone encoding full-length Humanin as a
template. The resulting PCR products were digested with restriction
endonucleases and subcloned into the Xho I and Hind III sites of
pEGFP-C1 and Xho I and EcoR I sites of pEGFP-N2 (Clontech).
Truncation and site-specific mutants of Humanin were created by
PCR.
[0199] Cell culture and transfections were performed as follows.
CSM14.1, HCT116, Cos-7, and SF268 cells were cultured in DMEM high
glucose media (Irvine Scientific, Santa Ana, Calif.) containing 10%
fetal bovine serum (FBS). PC-3 cells were cultured with RPMI 1640
media containing 10% FBS. Transfection of cells was performed using
SuperFect (Qiagen, Chatsworth, Calif.) or LipofectaminePLUS reagent
(Invitrogen). CSM14.1 cells were cultured at 39.degree. C. after
transfection to inactive temperature-sensitive Large T antigen, as
described (Kermer et al., Cell Death Differ 9:405-413 (2002)).
Example X
The Effect of Humanin on Bak
[0200] This example shows Humanin does not affect apoptosis induced
by Bak.
[0201] Since Humanin co-immunoprecipitates with Bax but not Bak,
the effects of Humanin over-expression on apoptosis induced by
these members of the Bcl-2 family was compared. As shown in FIG.
6F, when GFP-HN was co-expressed with plasmids encoding Bax or Bak
by transient transfection into a CSM14.1 or human prostate cancer
PC-3 cells, apoptosis induced by Bax was suppressed by about half,
while Bak-induced apoptosis was not affected. Similar results were
obtained regardless of whether Humanin was fused to the N- or
C-terminus of GFP, with both of these GFP fusion polypeptides
localizing to the cytosol of cells. In contrast to GFP-HN,
expression of GFP control protein and non-Bax-binding GFP-HN(C8P)
mutant protein did not suppress Bax-induced apoptosis,
demonstrating the specificity of these results (FIG. 6F).
Immunoblot analysis was used to demonstrate production of all
plasmid-derived polypeptides.
Example XI
Effect of Humanin in Bax-Expressing and Bax-Deficient Cells
[0202] This example shows the effect of Humanin in Bax-expressing
and Bax-deficient human cells and in yeast cells which do not
express Bax.
[0203] For these experiments, HCT116 colon cancer cells, which
contain one intact and one mutant Bax allele, were used as well as
a mutant of HCT116 (gift of B Vogelstein) in which the remaining
Bax allele was disrupted by homologous recombination, producing
Bax-deficient cells (Zhange et al., Science 290:989-992 (2000)). In
contrast to their differences in Bax expression, these cell lines
both express comparable amounts of Bid (FIG. 6G) as well as several
other Bcl-2 family proteins. The broad-spectrum kinase inhibitor,
Staurosporine (STS), induces apoptosis through a mechanism
involving translocation of Bax to mitochondria and release of
cytochrome c (Korsmeyer et al., Cell Death & Differ.
7:1166-1173 (2000)). As shown in FIG. 6G, when apoptosis was
induced by STS in HCT116 parental cells, GFP-HN reduced the
percentage of cells undergoing apoptosis by about half. In
contrast, GFP-HN failed to suppress apoptosis in Bax-deficient
HCT116 cells. Based on previous studies using cells from gene
knock-out mice that have shown either Bax or Bak is sufficient for
STS-induced apoptosis, a reason that Humanin only partially
suppresses apoptosis in these cells can be because it does not
interfere with Bak.
[0204] Furthermore, the effects of Humanin in yeast (S. cerevisiae)
was tested since these cells provide a heterologous system lacking
endogenous Bcl-2 family proteins that might complicate
interpretation of data. In yeast, ectopic expression of Bax induces
cell death through a mechanism similar to mammalian cells (reviewed
in Jin and Reed, Nature Rev. Mol. Cell. Biol. 3:453-459 (2002)).
For these experiments, Bax was expressed under a GAL10-promoter,
which permits conditional expression, so that Bax is produced when
yeast are plated on galactose-containing, but not
glucose-containing medium (Xu et al., Methods in Enzymology 283-296
(Academic Press, San Diego,) 2000)). As shown in FIG. 2H,
coexpression of wild-type Humanin polypeptide, expressed as a
TAD-fusion polypeptide, rescued yeast from Bax-induced lethality,
while the Humanin (C8P) mutant did not rescue yeast from
Bax-induced lethality. Immunoblot analysis demonstrated that both
TAD-tagged wild-type Humanin and Humanin (C8P) mutant polypeptides
were produced at comparable levels in yeast, excluding differences
in expression as a trivial explanation for the findings.
Example XII
Humanin Suppresses Bax Translocation to Mitochondria
[0205] This example shows suppression of Bax translocation to
mitochondria by Humanin.
[0206] To explore the mechanism by which Humanin suppresses
apoptosis induced by Bax, the effects of Humanin over-expression on
STS-induced translocation of GFP-Bax polypeptide from cytosol to
mitochondria in Cos7 cells was examined. Cos7 cells are a cell
model used previously for studies of the Bax translocation
phenomenon (Wolter et al., J. Cell Biol. 139:1281-1292 (1997);
Nechushtan et al., EMBO Journal 18:2330-2341 (1999); Nouraini et
al., Mol. Cell. Biol. 20:1604-1615 (2000)). For these experiments,
synthetic Humanin or Humanin (C8P) peptides were introduced into
cells using a reagent optimized for polypeptide delivery. Confocal
UV-microscopy was used to monitor translocation of GFP-Bax to
punctate cytosolic structures previously documented to represent
mitochondria (Wolter et al, supra (1997); Nechushtan et al., supra
(1999); Nouraini et al., supra (2000)), counting the percentage of
cells in which cytosolic fluorescence was diffuse versus punctate.
Confocal microscopy was performed as described (Nouraini et al.,
supra (2000); Guo et al., J. Biol. Chem. 276:2780-2785 (2001)). As
shown in FIGS. 7A and 7B, treatment of GFP-Bax-expressing Cos7
cells with STS induced mitochondrial translocation of GFP-Bax in
most of the cells expressing this polypeptide. In contrast, GFP-Bax
translocation was suppressed by about half in cells transduced with
Humanin but not Humanin(C8P) peptide.
[0207] These findings were also confirmed by subcellular
fractionation, where cytosol and mitochondria-enriched heavy
membrane preparations were prepared from Cos7 cells transduced with
untagged Humanin or Humanin(C8P) peptides, and the relative amounts
of endogenous Bax protein in these two fractions were measured by
immunoblot analysis of samples normalized for cell-equivalents. As
shown in FIG. 7C, Bax protein was located primarily in the cytosol
of unstimulated cells, but was predominantly membrane associated
after STS treatment. Transduction of Humanin peptide reduced Bax
translocation, while Humanin(C8P) had no effect. Conversely, when
Humanin expression was knocked-down by siRNA in SF268 cells, which
contain high endogenous levels of Humanin (FIG. 6E), then
STS-induced translocation of Bax to membranes was enhanced (FIG.
7D). Incubating the same blots with antibodies to mitochondrial
protein Hsp60 and cytosolic .beta.-Tubulin verified proper
fractionation and protein loading in these experiments (FIGS. 7C
and 7D). Therefore, Humanin can suppress translocation of Bax to
mitochondria. Differences in the relative potency of Humanin at
blocking Bax translocation as measured by microscopy (FIG. 7A)
versus cell fractionation methods (FIG. 7C) can be explained by
differences in the sensitivity of the assays, or could possibly
indicate that even in cells where some Bax translocation has
occurred, less of the total Bax protein associated with
mitochondria.
[0208] To determine whether Humanin can act directly on Bax, the
effects of Humanin on isolated mitochondria were tested. Addition
of recombinant purified Bax protein to mitochondria in vitro
induces cytochrome c release (Jurgensmeier et al., Proc. Natl.
Acad. Sci. USA 95:4997-5002 (1998)). As shown in FIG. 7E,
preincubating Bax with wild-type Humanin peptide suppressed Bax
association with mitochondria and reduced cytochrome c release. In
contrast, the non-Bax-binding Humanin(C8P) mutant peptide did not
interfere with Bax effects on isolated mitochondria. Therefore
Humanin can directly suppress Bax targeting to mitochondria,
without requirement for intact cells.
[0209] Peptide transfections were performed as follows. Humanin or
C8P peptides were transfected into GFP-Bax transfected Cos-7 cells
using Chariot.TM. reagent (Active Motif, Carlsbad, Calif.). One
microgram of peptide was mixed with 6 .mu.l of Chariot reagent in
200 .mu.l water and incubated for 30 minutes. Two hours before STS
treatment, GFP-Bax-expressing cells in 6-well plates were washed
with PBS and incubated with Chariot-peptide complex in serum-free
media at 37.degree. C. for 1 hour. Cells were incubated for an
additional hour after 1 ml complete growth media was added. Cells
were then treated with STS to induce Bax translocation.
[0210] Subcellular fractionation was performed as follows. Cells
(10.sup.7 cells) were resuspended with 5 volumes of buffer A (20 mM
Hepes-KOH, pH 7.5, 10 mM KCl, 1.5 mM MgCl2, 1 mM Na2-EDTA, 1 mM
Na2-EGTA, 1 mM dithiothreitol, and 0.1 mM
phenylmethylsulfonylfluoride) containing 250 mM sucrose. Cells were
homogenized with 25 strokes of a Teflon homogenizer, and
centrifuged two times at 750.times.g for 10 min at 4.degree. C.
Supernatants were centrifuged at 10,000.times.g for 20 min at
4.degree. C. The resulting mitochondria-containing pellets were
washed twice with buffer A, then resuspended in buffer A containing
250 mM sucrose. The supernatants of the 10,000.times.g spin were
further centrifuged at 100,000.times.g for 1 h at 4.degree. C. to
produce cytosol.
[0211] Cytochrome c release assays were performed as follows.
Mitochondria were isolated from HCT116 cells by differential
centrifugation as described above. Purified recombinant human Bax
protein (400 ng for each sample) was pre-incubated with or without
100 .mu.M synthetic Humanin peptide or mutant Humanin (C8P) peptide
for 10 min at 4.degree. C. The untreated or peptide pre-treated
Baxprotein samples were then mixed with equal amount of HCT116
mitochondria (in a volume of 40 .mu.l) at 30.degree. C. for 3
hours. Samples were then centrifuged at 10,000 g for 20 min to
obtain pellet (P) and supernatant (S) fractions, measuring
cytochrome c by immunoblotting.
Example XIII
Humanin Can Stabilize the Latent Conformation of Bax
[0212] This example shows Humanin can stabilize the latent
conformation of Bax (previously delineated by solution NMR), in
which its C-terminal tail is docked onto a hydrophobic crevice on
the surface of the Bax molecule.
[0213] Solution NMR and antibody-based epitope mapping studies
suggest that the mechanism of conversion of Bax from latent to
active form involves the dislodging of a C-terminal hydrophobic
.alpha.-helix (transmembrane [TM] domain) from the body of the Bax
protein, exposing this membrane-anchoring TM domain for insertion
into mitochondrial membranes (Suzuki et al., Cell 103:645-654
(2000)). To test the effects of Humanin on the interaction of the
TM domain of Bax with the rest of the Bax protein, a C-terminally
truncated Bax protein (residues 1-169) (Bax.DELTA.TM) and a
GFP-fusion containing the C-terminal TM domain of Bax (residues
170-192) were separately produced. The Bax.DELTA.TM protein was
pre-incubated with Humanin or control peptide, then mixed with
GFP-TM, testing for interaction by co-immunoprecipitation assay. As
shown in FIG. 7F, in the absence of Humanin, no binding of GFP-TM
to Bax.DELTA.TM was detected. In contrast, when Humanin was added,
Bax.DELTA.TM was immunoprecipitated with GFP-TM. Humanin (C8P)
peptide did not promote interaction of Bax.DELTA.TM with GFP-TM,
demonstrating the specificity of these results. Thus, Humanin can
stabilize the latent conformation of Bax (previously delineated by
solution NMR), in which its C-terminal tail is docked onto a
hydrophobic crevice on the surface of the Bax molecule.
Example XIV
Nuclear and Mitochondria Encoded Humanin Can Bind Bax
[0214] This example shows both the nuclear and mitochondrial
encoded Humanin can bind Bax and suppress Bax-induced
apoptosis.
[0215] As shown in Example IV and FIG. 3, during analysis of
Humanin-encoding sequences in the human genome, an identical open
reading frame embedded in the 16S rRNA gene of the mammalian
mitochondria genome was discovered. Differences in codon usage by
the endogenous protein translation machinery of mitochondria would
be predicted to result in a slightly different Humanin polypeptide
(SEQ ID NO:3). To investigate the ability of the predicted
nuclear-encoded and mitochondria-encoded Humanin peptides [termed
HN(N) and HN(M), respectively] to bind Bax and to suppress
apoptosis induced by over-expression of Bax, HN(N) and HN(M) were
expressed as GFP fusion polypeptides. As shown in FIG. 8A,
comparable amounts of Bax co-immunoprecipitated with both GFP-HN(N)
and GFP-HN(M). As shown in FIG. 8B, Bax-induced apoptosis was also
suppressed to comparable extents by both GFP-HN(N) and GFP-HN(M).
Thus, the nuclear and the mitochondrial translations of the Humanin
ORF are capable of binding and suppressing Bax.
[0216] All journal article, reference and patent citations provided
above, including referenced sequence accession numbers of
nucleotide and amino acid sequences contained in various databases,
in parentheses or otherwise, whether previously stated or not, are
incorporated herein by reference in their entirety.
[0217] Although the invention has been described with reference to
the disclosed embodiments, those skilled in the art will readily
appreciate that the specific experiments detailed are only
illustrative of the invention. It should be understood that various
modifications can be made without departing from that spirit of the
invention.
Summary of Nucleotide and Amino Acid Sequences
[0218] Sequence ID NO. 1 is a nucleotide sequence of a cytosolic
form of human Humanin.
[0219] Sequence ID NO. 2 is an amino acid sequence of a cytosolic
form of human Humanin.
[0220] Sequence ID NO. 3 is an amino acid sequence of a
mitochondrial-derived form of human Humanin.
[0221] Sequence ID NO. 4 is a nucleotide sequence of a human
Bax.
[0222] Sequence ID NO. 5 is an amino acid sequence of human
Bax.
[0223] Sequence ID NO. 6 is a nucleotide sequence of human Bid.
[0224] Sequence ID NO. 7 is an amino acid sequence of human
Bid.
[0225] Sequence ID NO. 8 is a nucleotide sequence of human
truncated Bid (t-Bid).
[0226] Sequence ID NO. 9 is an amino acid sequence of human
truncated Bid (t-Bid).
[0227] Sequence ID NO. 10 is an amino acid sequence derived from
SV40 T Antigen.
[0228] Sequence ID NO. 11 is an amino acid sequence of a brain
homing polypeptide.
[0229] Sequence ID NO. 12 is an amino acid sequence of a brain
homing polypeptide.
[0230] Sequence ID NO. 13 is a nucleotide sequence of a NADH
oligonucleotide forward primer.
[0231] Sequence ID NO. 14 is a nucleotide sequence of a NADH
oligonucleotide reverse primer.
[0232] Sequence ID NO. 15 is a nucleotide sequence of a COX
oligonucleotide forward primer.
[0233] Sequence ID NO. 16 is a nucleotide sequence of a COX
oligonucleotide reverse primer.
[0234] Sequence ID NO. 17 is a nucleotide sequence of a Humanin
oligonucleotide forward primer.
[0235] Sequence ID NO. 18 is a nucleotide sequence of a Humanin
oligonucleotide reverse primer.
[0236] Sequence ID NO. 19 is a nucleotide sequence of a Bax
oligonucleotide forward primer.
[0237] Sequence ID NO. 20 is a nucleotide sequence of a Bax
oligonucleotide reverse primer.
[0238] Sequence ID NO. 21 is a nucleotide sequence of a
mitochondrial derived Humanin oligonucleotide forward primer.
[0239] Sequence ID NO. 22 is a nucleotide sequence of a
mitochondrial derived Humanin oligonucleotide reverse primer.
[0240] Sequence ID NO. 23 is a nucleotide sequence of a C8A Humanin
oligonucleotide forward primer.
[0241] Sequence ID NO. 24 is a nucleotide sequence of a C8A Humanin
oligonucleotide reverse primer.
[0242] Sequence ID NO. 25 is a small interfering RNA sequence of
the sense strand of Humanin.
[0243] Sequence ID NO. 26 is a small interfering RNA sequence of
the anti-sense strand of Humanin.
[0244] Sequence ID NO. 27 is a small interfering RNA sequence of
the sense strand of a mutant Humanin.
[0245] Sequence ID NO. 28 is a small interfering RNA sequence of
the anti-sense strand of a mutant Humanin.
Sequence CWU 1
1
28175DNAHomo sapiensCDS(1)...(75) 1atg gct cca cga ggg ttc agc tgt
ctc tta ctt tta acc agt gaa att 48Met Ala Pro Arg Gly Phe Ser Cys
Leu Leu Leu Leu Thr Ser Glu Ile1 5 10 15gac ctg ccc gtg aag agg cgg
gca taa 75Asp Leu Pro Val Lys Arg Arg Ala * 20224PRTHomo sapiens
2Met Ala Pro Arg Gly Phe Ser Cys Leu Leu Leu Leu Thr Ser Glu Ile1 5
10 15Asp Leu Pro Val Lys Arg Arg Ala 20321PRTHomo sapiens 3Met Ala
Pro Arg Gly Phe Ser Cys Leu Leu Leu Leu Thr Ser Glu Met1 5 10 15Asp
Leu Pro Val Lys 204579DNAHomo sapiensCDS(1)...(579) 4atg gac ggg
tcc ggg gag cag ccc aga ggc ggg ggg ccc acc agc tct 48Met Asp Gly
Ser Gly Glu Gln Pro Arg Gly Gly Gly Pro Thr Ser Ser1 5 10 15gag cag
atc atg aag aca ggg gcc ctt ttg ctt cag ggt ttc atc cag 96Glu Gln
Ile Met Lys Thr Gly Ala Leu Leu Leu Gln Gly Phe Ile Gln 20 25 30gat
cga gca ggg cga atg ggg ggg gag gca ccc gag ctg gcc ctg gac 144Asp
Arg Ala Gly Arg Met Gly Gly Glu Ala Pro Glu Leu Ala Leu Asp 35 40
45ccg gtg cct cag gat gcg tcc acc aag aag ctg agc gag tgt ctc aag
192Pro Val Pro Gln Asp Ala Ser Thr Lys Lys Leu Ser Glu Cys Leu Lys
50 55 60cgc atc ggg gac gaa ctg gac agt aac atg gag ctg cag agg atg
att 240Arg Ile Gly Asp Glu Leu Asp Ser Asn Met Glu Leu Gln Arg Met
Ile65 70 75 80gcc gcc gtg gac aca gac tcc ccc cga gag gtc ttt ttc
cga gtg gca 288Ala Ala Val Asp Thr Asp Ser Pro Arg Glu Val Phe Phe
Arg Val Ala 85 90 95gct gac atg ttt tct gac ggc aac ttc aac tgg ggc
cgg gtt gtc gcc 336Ala Asp Met Phe Ser Asp Gly Asn Phe Asn Trp Gly
Arg Val Val Ala 100 105 110ctt ttc tac ttt gcc agc aaa ctg gtg ctc
aag gcc ctg tgc acc aag 384Leu Phe Tyr Phe Ala Ser Lys Leu Val Leu
Lys Ala Leu Cys Thr Lys 115 120 125gtg ccg gaa ctg atc aga acc atc
atg ggc tgg aca ttg gac ttc ctc 432Val Pro Glu Leu Ile Arg Thr Ile
Met Gly Trp Thr Leu Asp Phe Leu 130 135 140cgg gag cgg ctg ttg ggc
tgg atc caa gac cag ggt ggt tgg gac ggc 480Arg Glu Arg Leu Leu Gly
Trp Ile Gln Asp Gln Gly Gly Trp Asp Gly145 150 155 160ctc ctc tcc
tac ttt ggg acg ccc acg tgg cag acc gtg acc atc ttt 528Leu Leu Ser
Tyr Phe Gly Thr Pro Thr Trp Gln Thr Val Thr Ile Phe 165 170 175gtg
gcg gga gtg ctc acc gcc tcg ctc acc atc tgg aag aag atg ggc 576Val
Ala Gly Val Leu Thr Ala Ser Leu Thr Ile Trp Lys Lys Met Gly 180 185
190tga 579*5192PRTHomo sapiens 5Met Asp Gly Ser Gly Glu Gln Pro Arg
Gly Gly Gly Pro Thr Ser Ser1 5 10 15Glu Gln Ile Met Lys Thr Gly Ala
Leu Leu Leu Gln Gly Phe Ile Gln 20 25 30Asp Arg Ala Gly Arg Met Gly
Gly Glu Ala Pro Glu Leu Ala Leu Asp 35 40 45Pro Val Pro Gln Asp Ala
Ser Thr Lys Lys Leu Ser Glu Cys Leu Lys 50 55 60Arg Ile Gly Asp Glu
Leu Asp Ser Asn Met Glu Leu Gln Arg Met Ile65 70 75 80Ala Ala Val
Asp Thr Asp Ser Pro Arg Glu Val Phe Phe Arg Val Ala 85 90 95Ala Asp
Met Phe Ser Asp Gly Asn Phe Asn Trp Gly Arg Val Val Ala 100 105
110Leu Phe Tyr Phe Ala Ser Lys Leu Val Leu Lys Ala Leu Cys Thr Lys
115 120 125Val Pro Glu Leu Ile Arg Thr Ile Met Gly Trp Thr Leu Asp
Phe Leu 130 135 140Arg Glu Arg Leu Leu Gly Trp Ile Gln Asp Gln Gly
Gly Trp Asp Gly145 150 155 160Leu Leu Ser Tyr Phe Gly Thr Pro Thr
Trp Gln Thr Val Thr Ile Phe 165 170 175Val Ala Gly Val Leu Thr Ala
Ser Leu Thr Ile Trp Lys Lys Met Gly 180 185 1906588DNAHomo
sapiensCDS(1)...(585) 6atg gac tgt gag gtc aac aac ggt tcc agc ctc
agg gat gag tgc atc 48Met Asp Cys Glu Val Asn Asn Gly Ser Ser Leu
Arg Asp Glu Cys Ile1 5 10 15aca aac cta ctg gtg ttt ggc ttc ctc caa
agc tgt tct gac aac agc 96Thr Asn Leu Leu Val Phe Gly Phe Leu Gln
Ser Cys Ser Asp Asn Ser 20 25 30ttc cgc aga gag ctg gac gca ctg ggc
cac gag ctg cca gtg ctg gct 144Phe Arg Arg Glu Leu Asp Ala Leu Gly
His Glu Leu Pro Val Leu Ala 35 40 45ccc cag tgg gag ggc tac gat gag
ctg cag act gat ggc aac cgc agc 192Pro Gln Trp Glu Gly Tyr Asp Glu
Leu Gln Thr Asp Gly Asn Arg Ser 50 55 60agc cac tcc cgc ttg gga aga
ata gag gca gat tct gaa agt caa gaa 240Ser His Ser Arg Leu Gly Arg
Ile Glu Ala Asp Ser Glu Ser Gln Glu65 70 75 80gac atc atc cgg aat
att gcc agg cac ctc gcc cag gtc ggg gac agc 288Asp Ile Ile Arg Asn
Ile Ala Arg His Leu Ala Gln Val Gly Asp Ser 85 90 95atg gac cgt agc
atc cct ccg ggc ctg gtg aac ggc ctg gcc ctg cag 336Met Asp Arg Ser
Ile Pro Pro Gly Leu Val Asn Gly Leu Ala Leu Gln 100 105 110ctc agg
aac acc agc cgg tcg gag gag gac cgg aac agg gac ctg gcc 384Leu Arg
Asn Thr Ser Arg Ser Glu Glu Asp Arg Asn Arg Asp Leu Ala 115 120
125act gcc ctg gag cag ctg ctg cag gcc tac cct aga gac atg gag aag
432Thr Ala Leu Glu Gln Leu Leu Gln Ala Tyr Pro Arg Asp Met Glu Lys
130 135 140gag aag acc atg ctg gtg ctg gcc ctg ctg ctg gcc aag aag
gtg gcc 480Glu Lys Thr Met Leu Val Leu Ala Leu Leu Leu Ala Lys Lys
Val Ala145 150 155 160agt cac acg ccg tcc ttg ctc cgt gat gtc ttt
cac aca aca gtg aat 528Ser His Thr Pro Ser Leu Leu Arg Asp Val Phe
His Thr Thr Val Asn 165 170 175ttt att aac cag aac cta cgc acc tac
gtg agg agc tta gcc aga aat 576Phe Ile Asn Gln Asn Leu Arg Thr Tyr
Val Arg Ser Leu Ala Arg Asn 180 185 190ggg atg gac tga 588Gly Met
Asp 1957195PRTHomo sapiens 7Met Asp Cys Glu Val Asn Asn Gly Ser Ser
Leu Arg Asp Glu Cys Ile1 5 10 15Thr Asn Leu Leu Val Phe Gly Phe Leu
Gln Ser Cys Ser Asp Asn Ser 20 25 30Phe Arg Arg Glu Leu Asp Ala Leu
Gly His Glu Leu Pro Val Leu Ala 35 40 45Pro Gln Trp Glu Gly Tyr Asp
Glu Leu Gln Thr Asp Gly Asn Arg Ser 50 55 60Ser His Ser Arg Leu Gly
Arg Ile Glu Ala Asp Ser Glu Ser Gln Glu65 70 75 80Asp Ile Ile Arg
Asn Ile Ala Arg His Leu Ala Gln Val Gly Asp Ser 85 90 95Met Asp Arg
Ser Ile Pro Pro Gly Leu Val Asn Gly Leu Ala Leu Gln 100 105 110Leu
Arg Asn Thr Ser Arg Ser Glu Glu Asp Arg Asn Arg Asp Leu Ala 115 120
125Thr Ala Leu Glu Gln Leu Leu Gln Ala Tyr Pro Arg Asp Met Glu Lys
130 135 140Glu Lys Thr Met Leu Val Leu Ala Leu Leu Leu Ala Lys Lys
Val Ala145 150 155 160Ser His Thr Pro Ser Leu Leu Arg Asp Val Phe
His Thr Thr Val Asn 165 170 175Phe Ile Asn Gln Asn Leu Arg Thr Tyr
Val Arg Ser Leu Ala Arg Asn 180 185 190Gly Met Asp 1958408DNAHomo
sapiensCDS(1)...(408) 8ggc aac cgc agc agc cac tcc cgc ttg gga aga
ata gag gca gat tct 48Gly Asn Arg Ser Ser His Ser Arg Leu Gly Arg
Ile Glu Ala Asp Ser1 5 10 15gaa agt caa gaa gac atc atc cgg aat att
gcc agg cac ctc gcc cag 96Glu Ser Gln Glu Asp Ile Ile Arg Asn Ile
Ala Arg His Leu Ala Gln 20 25 30gtc ggg gac agc atg gac cgt agc atc
cct ccg ggc ctg gtg aac ggc 144Val Gly Asp Ser Met Asp Arg Ser Ile
Pro Pro Gly Leu Val Asn Gly 35 40 45ctg gcc ctg cag ctc agg aac acc
agc cgg tcg gag gag gac cgg aac 192Leu Ala Leu Gln Leu Arg Asn Thr
Ser Arg Ser Glu Glu Asp Arg Asn 50 55 60agg gac ctg gcc act gcc ctg
gag cag ctg ctg cag gcc tac cct aga 240Arg Asp Leu Ala Thr Ala Leu
Glu Gln Leu Leu Gln Ala Tyr Pro Arg65 70 75 80gac atg gag aag gag
aag acc atg ctg gtg ctg gcc ctg ctg ctg gcc 288Asp Met Glu Lys Glu
Lys Thr Met Leu Val Leu Ala Leu Leu Leu Ala 85 90 95aag aag gtg gcc
agt cac acg ccg tcc ttg ctc cgt gat gtc ttt cac 336Lys Lys Val Ala
Ser His Thr Pro Ser Leu Leu Arg Asp Val Phe His 100 105 110aca aca
gtg aat ttt att aac cag aac cta cgc acc tac gtg agg agc 384Thr Thr
Val Asn Phe Ile Asn Gln Asn Leu Arg Thr Tyr Val Arg Ser 115 120
125tta gcc aga aat ggg atg gac tga 408Leu Ala Arg Asn Gly Met Asp *
130 1359135PRTHomo sapiens 9Gly Asn Arg Ser Ser His Ser Arg Leu Gly
Arg Ile Glu Ala Asp Ser1 5 10 15Glu Ser Gln Glu Asp Ile Ile Arg Asn
Ile Ala Arg His Leu Ala Gln 20 25 30Val Gly Asp Ser Met Asp Arg Ser
Ile Pro Pro Gly Leu Val Asn Gly 35 40 45Leu Ala Leu Gln Leu Arg Asn
Thr Ser Arg Ser Glu Glu Asp Arg Asn 50 55 60Arg Asp Leu Ala Thr Ala
Leu Glu Gln Leu Leu Gln Ala Tyr Pro Arg65 70 75 80Asp Met Glu Lys
Glu Lys Thr Met Leu Val Leu Ala Leu Leu Leu Ala 85 90 95Lys Lys Val
Ala Ser His Thr Pro Ser Leu Leu Arg Asp Val Phe His 100 105 110Thr
Thr Val Asn Phe Ile Asn Gln Asn Leu Arg Thr Tyr Val Arg Ser 115 120
125Leu Ala Arg Asn Gly Met Asp 130 135107PRTArtificial
SequenceSynthetic construct 10Pro Lys Lys Lys Arg Lys Val1
5119PRTArtificial SequenceSynthetic construct 11Cys Asn Ser Arg Leu
His Leu Arg Cys1 5129PRTArtificial SequenceSynthetic construct
12Val Leu Arg Glu Gly Pro Ala Gly Gly1 51324DNAArtificial
SequencePrimer 13cctcattgta cccattctaa tcgc 241422DNAArtificial
SequencePrimer 14gtagaagagc gatggtgaga gc 221524DNAArtificial
SequencePrimer 15ctccctctct cctactcctg ctcg 241625DNAArtificial
SequencePrimer 16ggtatagaat ggggtctcct cctcc 251718DNAArtificial
SequencePrimer 17atggctccac gagggttc 181818DNAArtificial
SequencePrimer 18ttatgcccgc ctcttcac 181915DNAArtificial
SequencePrimer 19atggacgggt ccggg 152019DNAArtificial
SequencePrimer 20tcagcccatc ttcttccag 192126DNAArtificial
SequencePrimer 21ggctcgagat ggctccacga gggttc 262230DNAArtificial
SequencePrimer 22ggaagcttac ttcacgggca ggtccatttc
302335DNAArtificial SequencePrimer 23ggctcgagga atggctccac
gagggttcag cgctc 352426DNAArtificial SequencePrimer 24ggaagctttt
atgcccgcct cttcac 262521RNAArtificial Sequencesynthetic construct
of RNA and DNA oligonucleotide 25ccagugaaau ugaccugccn n
212621RNAArtificial Sequencesynthetic construct of RNA and DNA
oligonucleotide 26ggcaggucaa uuucacuggn n 212721RNAArtificial
Sequencesynthetic construct of RNA and DNA oligonucleotide
27ccgaugaaau ugaccugccn n 212821RNAArtificial Sequencesynthetic
construct of RNA and DNA oligonucleotide 28ggcaggucaa uuucaucggn n
21
* * * * *
References