U.S. patent application number 13/113732 was filed with the patent office on 2011-09-15 for method for diagnosing non-small cell lung cancer.
This patent application is currently assigned to Oncotherapy Science, Inc.. Invention is credited to Yataro Daigo, Yusuke Nakamura, Shuichi Nakatsuru.
Application Number | 20110223687 13/113732 |
Document ID | / |
Family ID | 34961862 |
Filed Date | 2011-09-15 |
United States Patent
Application |
20110223687 |
Kind Code |
A1 |
Nakamura; Yusuke ; et
al. |
September 15, 2011 |
METHOD FOR DIAGNOSING NON-SMALL CELL LUNG CANCER
Abstract
Disclosed are methods for detecting non-small cell lung cancer
(NSCLC) using differentially expressed genes KIF11, GHSR1b, NTSR1,
and FOXM1. Also disclosed are methods of identifying compounds for
treating and preventing NSCLC, based on the interaction between
KOC1 and KIF11, or NMU and GHSR1b or NTSR1.
Inventors: |
Nakamura; Yusuke; (Tokyo,
JP) ; Daigo; Yataro; (Tokyo, JP) ; Nakatsuru;
Shuichi; (Kanagawa, JP) |
Assignee: |
Oncotherapy Science, Inc.
Kanagawa
JP
|
Family ID: |
34961862 |
Appl. No.: |
13/113732 |
Filed: |
May 23, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12700669 |
Feb 4, 2010 |
7972772 |
|
|
13113732 |
|
|
|
|
10593842 |
Jul 10, 2007 |
7700573 |
|
|
PCT/JP05/05613 |
Mar 18, 2005 |
|
|
|
12700669 |
|
|
|
|
60555789 |
Mar 23, 2004 |
|
|
|
Current U.S.
Class: |
436/501 |
Current CPC
Class: |
C12Q 2600/158 20130101;
C12Q 2600/136 20130101; A61P 11/00 20180101; A61P 35/00 20180101;
A61K 31/731 20130101; C12Q 1/6886 20130101; C12Q 2600/118
20130101 |
Class at
Publication: |
436/501 |
International
Class: |
G01N 33/566 20060101
G01N033/566 |
Claims
1. A method of screening for a compound for treating or preventing
NSCLC, said method comprising the steps of: contacting a KIF11
polypeptide or functional equivalent thereof with KOC1 polypeptide
or functional equivalent thereof in the presence of a test
compound; detecting the binding between the polypeptides; and
selecting the test compound that inhibits the binding between the
polypeptides.
2. The method of claim 1, wherein the functional equivalent of
KIF11 polypeptide comprises amino acid sequence of KOC1 binding
domain.
3. The method of claim 1, wherein the functional equivalent of KOC1
polypeptide comprises amino acid sequence of KIF11 binding domain.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] The present application claims priority to U.S. Ser. No.
12/700,669, filed Feb. 4, 2010, which claims priority to U.S. Ser.
No. 10/593,842, filed Jul. 10, 2007, now U.S. Pat. No. 7,700,573,
which is a U.S. National Phase of International Application No.
PCT/JP2005/005613, filed Mar. 18, 2005, which claims priority to
U.S. Ser. No. 60/555,789 filed Mar. 23, 2004, all of which are
incorporated herein by reference in their entireties.
FIELD OF THE INVENTION
[0002] The present invention relates to the field of biological
science, more specifically to the field of cancer therapy and
diagnosis. In particular, the invention relates to methods of
diagnosing non-small cell lung cancers using genes, KIF11, GHSR1b,
NTSR1, and FOXM1, that show elevated expression in such cancerous
cells.
BACKGROUND OF THE INVENTION
[0003] Lung cancer is one of the most commonly fatal human tumors.
Many genetic alterations associated with the development and
progression of lung cancer have been reported. Although genetic
changes can aid prognostic efforts and predictions of metastatic
risk or response to certain treatments, information about a single
or a limited number of molecular markers generally fails to provide
satisfactory results for clinical diagnosis of non-small cell lung
cancer (NSCLC) (Mitsudomi et al., Clin Cancer Res 6: 4055-63
(2000); Niklinski et al., Lung Cancer. 34 Suppl 2: S53-8 (2001);
Watine, BMJ 320: 379-80 (2000)). NSCLC is by far the most common
form, accounting for nearly 80% of lung tumors (Society, A.C.
Cancer Facts and Figures 2001 (2001)). The overall 10-year survival
rate remains as low as 10% despite recent advances in
multi-modality therapy, because the majority of NSCLCs are not
diagnosed until advanced stages (Fry, W. A. et al., Cancer 86:
1867-76 (1999)). Although chemotherapy regimens based on platinum
are considered the reference standards for treatment of NSCLC,
those drugs are able to extend survival of patients with advanced
NSCLC only about six weeks (Non-small Cell Lung Cancer
Collaborative Group, BMJ. 311: 899-909 (1995)). Numerous targeted
therapies are being investigated for this disease, including
tyrosine kinase inhibitors, but so far promising results have been
achieved in only a limited number of patients and some recipients
suffer severe adverse reactions (Kris M. N. R., Herbst R. S. Proc.
Am. Soc. Clin. Oncol. 21: 292a(A1166) (2002)).
[0004] Many genetic alterations associated with development and
progression of lung cancer have been reported, but the precise
molecular mechanisms remain unclear (Sozzi, G. Eur. J. Cancer 37:
63-73 (2001)). Over the last decade newly developed cytotoxic
agents including paclitaxel, docetaxel, gemcitabine, and
vinorelbine have emerged to offer multiple therapeutic choices for
patients with advanced NSCLC; however, each of the new regimens can
provide only modest survival benefits compared with cisplatin-based
therapies (Schiller, J. H. et al., N. Engl. J. Med. 346: 92-98
(2002); Kelly, K. et al., J. Clin. Oncol. 19: 3210-3218 (2001)).
Hence, new therapeutic strategies, such as development of
molecular-targeted agents, are eagerly awaited by clinicians.
[0005] Systematic analysis of expression levels of thousands of
genes on cDNA microarrays is an effective approach to identifying
unknown molecules involved in pathways of carcinogenesis (Kikuchi,
T. et al., Oncogene 22: 2192-2205 (2003); Kakiuchi, S. et al., Mol.
Cancer Res. 1: 485-499 (2003); Zembutsu, H. et al., Int. J. Oncol.
23: 29-39 (2003); Suzuki, C. et al., Cancer Res. 63: 7038-7041
(2003)) and can reveal candidate targets for development of novel
anti-cancer drugs and tumor markers. To isolate novel molecular
targets for diagnosis, treatment and prevention of NSCLC, pure
populations of tumor cells were prepared from 37 cancer tissues by
laser-capture microdissection and genome-wide expression profiles
of NSCLC cells were analyzed on a cDNA microarray containing 23,040
genes (Kikuchi, T. et al., Oncogene 22: 2192-2205 (2003)). In the
course of those experiments, KOC1 (GenBank Accession No.
NM.sub.--006547) and neuromedin U (NMU; GenBank Accession No.
NM.sub.--006681) were identified as genes that were frequently
over-expressed in lung tumors and indispensable for growth of NSCLC
cells.
[0006] Cell-to-cell communication is a prerequisite for development
and maintenance of multicellular organisms. Several intercellular
information-exchange systems such as chemical synapses, gap
junctions, and plasmadesmata in plant cells have long been
observed, but a new transporting system involving a highly
sensitive nanotubular structure, tunneling nanotubes (TNTs) between
the cells, was only recently reported in mammalian cells (Rustom,
A. et al., Science 303, 1007-1010 (2004). Such a structure would
facilitate the selective transfer of membrane vesicles and
organelles; therefore TNTs in mammalian somatic cells might
contribute to a cell-to-cell transporting system(s) by carrying
transcription factors or ribonucleoparticles (RNPs), as in plants
(Nakajima, K. et al., Nature 413, 307-311 (2001); Lucas, W. J. et
al., Nat. Rev. Mol. Cell Biol. 2, 849-857 (2001)). Some
investigators have documented interactions between some RNA-binding
proteins and motor proteins like kinesin and dynein within
mammalian somatic cells, as well as intercellular mRNA transport in
mammalian germ cells (Brendza, R. P. et al., Science 289, 2120-2122
(2000); Chennathukuzhi, V. et al., Proc. Natl. Acad. Sci. USA 100,
15566-15571 (2003); Villace, P. et al., Nucleic Acids Res. 32,
2411-2420 (2004); Morales, C. R. et al. Dev. Biol. 246, 480-494
(2002).). However, no report has emerged describing an
intercellular mRNA transporting system in mammalian somatic cells
involving a complex of RNA-binding proteins and motor proteins. The
phenomenon of mRNA localization has been reported in oocytes and
developing embryos of Drosophila and Xenopus and in somatic cells
such as fibroblasts and neurons (King, M. L. et al., Bioessays 21:
546-557 (1999); Mowry, K. L., Cote, C. A. FASEB J. 13: 435-445
(1999); Lasko, P. J. Cell Biol. 150: F51-56 (2000); Steward, O.
Neuron 18: 9-12 (1997)). Beta actin (ACTB) mRNA is localized at the
leading lamellae of chicken embryo fibroblasts (CEFs) (Lawrence, J.
B., Singer, R. H. Cell 45: 407-415 (1986)) and at the growth cone
of developing neurons (Bassell, G. J. et al., J. Neurosci. 18:
251-265 (1998)). The localization of ACTB mRNA is dependent on the
zipcode, a cis-acting element located in the 3' UTR of the mRNA
(Kislauskis, E. H. et al., J. Cell Biol. 123: 165-172 (1993)). The
trans-acting factor, zipcode binding protein 1 (ZBP1), was affinity
purified with the zipcode of ACTB mRNA (Ross, A. F. et al., Mol.
Cell Biol. 17, 2158-2165 (1997)). After the identification of ZBP1,
additional homologues were identified in a wide range of organisms
including Xenopus, Drosophila, human, and mouse (Mueller-Pillasch,
F. et al., Oncogene 14: 2729-2733 (1997); Deshler, J. O. et al.,
Science 276: 1128-1131 (1997); Doyle, G. A. et al., Nucleic Acids
Res. 26: 5036-5044 (1998)). ZBP1 family members are expressed in
germ embryonic fibroblasts and in several types of cancer
(Mueller-Pillasch, F. et al., Oncogene 14: 2729-2733 (1997);
Mueller, F. et al., Br. J. Cancer 88; 699-701 (2003)). ZBP1-like
proteins contain two RNA-recognition motifs (RRMs) at the
NH2-terminal part of the protein and four hnRNP K homology (KH)
domains at the COOH-terminal end.
[0007] KOC1 (alias IGF-II mRNA-binding protein 3: IMP-3) is one of
the IMPs (IMP-1, IMP-2, and IMP-3), which belong to the ZBP1 family
members and exhibit multiple attachments to IGF-II leader 3 mRNA
and the reciprocally imprinted H19 RNA (Mueller-Pillasch, F. et
al., Oncogene 14: 2729-2733 (1997)). Although KOC1 was initially
reported to be over-expressed in pancreatic cancer
(Mueller-Pillasch, F. et al., Oncogene 14: 2729-2733 (1997);
Mueller, F. et al., Br. J. Cancer 88: 699-701 (2003)), its precise
function in cancer cells or even in normal mammalian somatic cells
remains unclear.
[0008] KOC1 is orthologous to the Xenopus Vg1 RNA-binding protein
(Vg1RBP/Vera), which mediates the localization of Vg1 mRNA to the
vegetal pole of the oocyte during oocyte maturation, and IMP-1 is
orthologous to the ZBP1. IMP is mainly located at the cytoplasm and
its cellular distribution ranges from a distinct concentration in
perinuclear regions and lamellipodia to a completely delocalized
pattern. H19 RNA co-localized with IMP, and removal of the
high-affinity attachment site led to delocalization of the
truncated RNA (Runge, S. et al., J. Biol. Chem. 275: 29562-29569
(2000)), suggesting that IMPs are involved in cytoplasmic
trafficking of RNA. IMP-1 was able to associate with microtubles
(Nielsen, F. C. et al., J. Cell Sci. 115: 2087-2097 (2002); Havin,
L. et al., Genes Dev. 12: 1593-1598 (1998)), and is likely to
involve a motor protein such as kinesin, myosin, and dyenin. On the
other hand, Oskar mRNA localization to the posterior pole requires
Kinesin I (Palacios, I. M., St. Johnston D. Development 129:
5473-5485 (2002); Brendza, R. P. et al., Science 289: 2120-2102
(2000)).
[0009] KIF11 (alias EG5) is a member of kinesin family, and plays a
role in establishing and/or determining the stability of specific
microtuble arrays that form during cell division. This role may
encompass the ability of KIF11 to influence the distribution of
other protein components associated with cell division (Whitehead,
C. M., Rattner, J. B. J. Cell Sci. 111: 2551-2561 (1998); Mayer, T.
U. et al., Science 286: 971-974 (1999)).
[0010] NMU is a neuropeptide that was first isolated from porcine
spinal cord. It has potent activity on smooth muscles (Minamino, N.
et al., Biochem. Biophys. Res. Commun. 130: 1078-1085 (1985);
Domin, J. et al., Biochem. Biophys. Res. Commun. 140: 1127-1134
(1986); Conlon, J. M. et al., J. Neurochem. 51: 988-991 (1988);
Minamino, N. et al., Biochem. Biophys. Res. Commun. 156: 355-360
(1988); Domin, J. et al., J. Biol. Chem. 264: 20881-20885 (1989),
O'Harte, F. et al., Peptides 12: 809-812 (1991); Kage, R. et al.,
Regul. Pept. 33: 191-198 (1991); Austin, C. et al., J. Mol.
Endocrinol. 12: 257-263 (1994); Fujii, R. et al., J. Biol. Chem.
275: 21068-21074 (2000)), and in mammalian species NMU is
distributed predominantly in the gastrointestinal tract and central
nervous system (Howard, A. D. et al., Nature 406: 70-74 (2000);
Funes, S. et al., Peptides 23: 1607-1615 (2002)). Peripheral
activities of NMU include stimulation of smooth muscle, elevation
of blood pressure, alternation of ion transport in the gut, and
regulation of feeding (Minamino, N. et al., Biochem. Biophys. Res.
Commun. 130: 1078-1085 (1985)); however, the role of NMU during
carcinogenesis has not been addressed. Neuropeptides function
peripherally as paracrine and autocrine factors to regulate diverse
physiologic processes and act as neurotransmitters or
neuromodulators in the nervous system. In general, receptors that
mediate signaling by binding neuropeptides are members of the
superfamily of G protein-coupled receptors (GPCRs) having seven
transmembrane-spanning domains. Two known receptors for NMU, NMU1R
and NMU2R, show a high degree of homology to other neuropeptide
receptors such as GHSR and NTSR1, for which the corresponding known
ligands are Ghrelin (GHRL) and neurotensin (NTS), respectively.
NMU1R (FM3/GPR66) and NMU2R (FM4) have seven predicted
alpha-helical transmembrane domains containing highly conserved
motifs, as do other members of the rhodopsin GPCR family (Fujii, R.
et al., J. Biol. Chem. 275: 21068-21074 (2000); Howard, A. D. et
al., Nature 406: 70-74 (2000); Funes, S. et al., Peptides 23:
1607-1615 (2002)).
[0011] A C-terminal asparaginamide structure and the C-terminal
hepatapeptide core of NMU protein are essential for its contractile
activity in smooth-muscle cells (Westfall, T. D. et al., J.
Pharmacol. Exp. Ther. 301: 987-992 (2002); Austin, C. J. Mol.
Endocrinol. 14: 157-169 (1995)). Recent studies have contributed
evidence that NMU acts at the hypothalamic level to inhibit food
intake; therefore this protein might be a physiological regulator
of feeding and body weight (Howard, A. D. et al., Nature 406: 70-74
(2000); Maggi, C. A. et al., Br. J. Pharmacol. 99: 186-188 (1990);
Wren, A. M. et al., Endocrinology 143: 227-234 (2002); Ivanov, T.
R. et al., Endocrinology 143: 3813-3821 (2002)). However, so far no
reports have suggested involvement of NMU over-expression in
carcinogenesis.
[0012] Studies designed to reveal mechanisms of carcinogenesis have
already facilitated identification of molecular targets for
anti-tumor agents. For example, inhibitors of farnesyltransferase
(FTIs) which were originally developed to inhibit the
growth-signaling pathway related to Ras, whose activation depends
on posttranslational farnesylation, has been effective in treating
Ras-dependent tumors in animal models (He et al., Cell 99:335-45
(1999)). Clinical trials on human using a combination or
anti-cancer drugs and anti-HER2 monoclonal antibody, trastuzumab,
have been conducted to antagonize the proto-oncogene receptor
HER2/neu; and have been achieving improved clinical response and
overall survival of breast-cancer patients (Lin et al., Cancer Res.
61:6345-9 (2001)). A tyrosine kinase inhibitor, STI-571, which
selectively inactivates bcr-abl fusion proteins, has been developed
to treat chronic myelogenous leukemias wherein constitutive
activation of bcr-abl tyrosine kinase plays a crucial role in the
transformation of leukocytes. Agents of these kinds are designed to
suppress oncogenic activity of specific gene products (Fujita et
al., Cancer Res. 61:7722-6 (2001)). Therefore, gene products
commonly up-regulated in cancerous cells may serve as potential
targets for developing novel anti-cancer agents.
[0013] It has been demonstrated that CD8+ cytotoxic T lymphocytes
(CTLs) recognize epitope peptides derived from tumor-associated
antigens (TAAs) presented on MHC Class I molecule, and lyse tumor
cells. Since the discovery of MAGE family as the first example of
TAAs, many other TAAs have been discovered using immunological
approaches (Boon, Int. J. Cancer 54: 177-80 (1993); Boon and van
der Bruggen, J. Exp. Med. 183: 725-9 (1996); van der Bruggen et
al., Science 254: 1643-7 (1991); Brichard et al., J. Exp. Med. 178:
489-95 (1993); Kawakami et al., J. Exp. Med. 180: 347-52 (1994)).
Some of the discovered TAAs are now in the stage of clinical
development as targets of immunotherapy. TAAs discovered so far
include MAGE (van der Bruggen et al., Science 254: 1643-7 (1991)),
gp100 (Kawakami et al., J. Exp. Med. 180: 347-52 (1994)), SART
(Shichijo et al., J. Exp. Med. 187: 277-88 (1998)), and NY-ESO-1
(Chen et al., Proc. Natl. Acad. Sci. USA 94: 1914-8 (1997)). On the
other hand, gene products which had been demonstrated to be
specifically over-expressed in tumor cells, have been shown to be
recognized as targets inducing cellular immune responses. Such gene
products include p53 (Umano et al., Brit. J. Cancer 84: 1052-7
(2001)), HER2/neu (Tanaka et al., Brit. J. Cancer 84: 94-9 (2001)),
CEA (Nukaya et al., Int. J. Cancer 80: 92-7 (1999)), and so on.
[0014] In spite of significant progress in basic and clinical
research concerning TAAs (Rosenbeg et al., Nature Med. 4: 321-7
(1998); Mukherji et al., Proc. Natl. Acad. Sci. USA 92: 8078-82
(1995); Hu et al., Cancer Res. 56: 2479-83 (1996)), only limited
number of candidate TAAs for the treatment of cancer are available.
TAAs abundantly expressed in cancer cells, and at the same time
which expression is restricted to cancer cells would be promising
candidates as immunotherapeutic targets. Further, identification of
new TAAs inducing potent and specific antitumor immune responses is
expected to encourage clinical use of peptide vaccination strategy
in various types of cancer (Boon and can der Bruggen, J. Exp. Med.
183: 725-9 (1996); van der Bruggen et al., Science 254: 1643-7
(1991); Brichard et al., J. Exp. Med. 178: 489-95 (1993); Kawakami
et al., J. Exp. Med. 180: 347-52 (1994); Shichijo et al., J. Exp.
Med. 187: 277-88 (1998); Chen et al., Proc. Natl. Acad. Sci. USA
94: 1914-8 (1997); Harris, J. Natl. Cancer Inst. 88: 1442-5 (1996);
Butterfield et al., Cancer Res. 59: 3134-42 (1999); Vissers et al.,
Cancer Res. 59: 5554-9 (1999); van der Burg et al., J Immunol 156:
3308-14 (1996); Tanaka et al., Cancer Res. 57: 4465-8 (1997); Fujie
et al., Int. J. Cancer 80: 169-72 (1999); Kikuchi et al., Int. J.
Cancer 81: 459-66 (1999); Oiso et al., Int. J. Cancer 81: 387-94
(1999)).
[0015] It has been repeatedly reported that peptide-stimulated
peripheral blood mononuclear cells (PBMCs) from certain healthy
donors produce significant levels of IFN-.gamma. in response to the
peptide, but rarely exert cytotoxicity against tumor cells in an
HLA-A24 or -A0201 restricted manner in .sup.51Cr-release assays
(Kawano et al., Cancer Res. 60: 3550-8 (2000); Nishizaka et al.,
Cancer Res. 60: 4830-7 (2000); Tamura et al., Jpn. J. Cancer Res.
92: 762-7 (2001)). However, both of HLA-A24 and HLA-A0201 are one
of the popular HLA alleles in Japanese, as well as Caucasian (Date
et al., Tissue Antigens 47: 93-101 (1996); Kondo et al., J.
Immunol. 155: 4307-12 (1995); Kubo et al., J. Immunol. 152: 3913-24
(1994); Imanishi et al., Proceeding of the eleventh International
Histocompatibility Workshop and Conference Oxford University Press,
Oxford, 1065 (1992); Williams et al., Tissue Antigen 49: 129
(1997)). Thus, antigenic peptides of cancers presented by these
HLAs may be especially useful for the treatment of cancers among
Japanese and Caucasian. Further, it is known that the induction of
low-affinity CTL in vitro usually results from the use of peptide
at a high concentration, generating a high level of specific
peptide/MHC complexes on antigen presenting cells (APCs), which
will effectively activate these CTL (Alexander-Miller et al., Proc.
Natl. Acad. Sci. USA 93: 4102-7 (1996)).
[0016] Although advances have been made in the development of
molecular-targeting drugs for cancer therapy, the ranges of tumor
types that respond as well as the effectiveness of the treatments
are still very limited. Hence, it is urgent to develop new
anti-cancer agents that target molecules highly specific to
malignant cells and are likely to cause minimal or no adverse
reactions. To achieve the goal molecules whose physiological
mechanisms are well defined need to be identified. A powerful
strategy toward these ends would combine screening of up-regulated
genes in cancer cells on the basis of genetic information obtained
on cDNA microarrays with high-throughput screening of their effect
on cell growth, by inducing loss-of-function phenotypes with RNAi
systems (Kikuchi, T. et al., Oncogene 22: 2192-2205 (2003)).
SUMMARY OF THE INVENTION
[0017] The present invention features a method of diagnosing or
determining a predisposition to non-small cell lung cancer (NSCLC)
in a subject by determining an expression level of a non-small cell
lung cancer-associated gene that is selected from the group of
KIF11, GHSR1b, NTSR1, and FOXM1 in a patient derived biological
sample. An increase of the expression level of any of the genes
compared to a normal control level of the genes indicates that the
subject suffers from or is at risk of developing NSCLC.
[0018] The invention also provides methods of providing a prognosis
of a patient diagnosed with NSCLC. In particular, the methods
involve detecting expression of KOC1, KIF11, or KOC1 in combination
with expression of KIF11.
[0019] A "normal control level" indicates an expression level of
any of the genes detected in a normal, healthy individual or in a
population of individuals known not to be suffering from NSCLC. A
control level is a single expression pattern derived from a single
reference population or from a plurality of expression patterns. In
contrast to a "normal control level", the "control level" is an
expression level of the gene detected in an individual or a
population of individuals whose background of the disease state is
known (i.e., cancerous or non-cancerous). Thus, the control level
may be determined base on the expression level of the gene in a
normal, healthy individual, in a population of individuals known
not to be suffering from NSCLC, a patient of NSCLC or a population
of the patients. The control level corresponding to the expression
level of the gene in a patient of non-small cell lung cancer or a
population of the patients is referred to as "NSCLC control level".
Furthermore, the control level can be a database of expression
patterns from previously tested cells.
[0020] An increase in the expression level of any one of the genes
of KIF11, GHSR1b, NTSR1, and FOXM1 detected in a test biological
sample compared to a normal control level indicates that the
subject (from which the sample was obtained) suffers from NSCLC.
Alternatively, the expression level of any one or all of the genes
in a biological sample may be compared to an NSCLC control level of
the same gene(s).
[0021] Gene expression is increased or decreased 10%, 25%, 50% or
more compared to the control level. Alternatively, gene expression
is increased or decreased 1, 2, 5 or more fold compared to the
control level. Expression is determined by detecting hybridization,
e.g., on a chip or an array, of an NSCLC gene probe to a gene
transcript of a patient-derived biological sample. The
patient-derived biological sample may be any sample derived from a
subject, e.g., a patient known to or suspected of having NSCLC. For
example, the biological sample may be tissue containing sputum,
blood, serum, plasma or lung cell.
[0022] The invention also provides a non-small cell lung cancer
reference expression profile comprising a pattern of gene
expression levels of two or more genes selected from the group of
KIF11, GHSR1b, NTSR1, and FOXM1.
[0023] The invention also provides a kit comprising two or more
detection reagents which detects the expression of one or more of
genes selected from the group of KIF11, GHSR1b, NTSR1, and FOXM1
(e.g., via detecting mRNA and polypeptide). Also provided is an
array of polynucleotides that binds to one or more of the genes
selected from the group of KIF11, GHSR1b, NTSR1, and FOXM1. The
kits of the invention may also comprise reagents used to detect the
expression of KIF11 and KOC1 to be used for the prognosis of NSCLC.
The invention also provides kits for the detection of compounds
that regulate RNA transporting activity. The kits may comprise a
cell expressing a KIF11 polypeptide, or functional equivalent, a
KOC1 polypeptide, or functional equivalent, and RNA to be
transported, and DCTN1. The kits of the invention may also be used
to screen for compounds for treating or preventing NSCLC. The kits
may comprise a KOC1 polypeptide, or functional equivalent, and an
RNA that is bound by the KOC1 polypeptide or functional
equivalent.
[0024] The invention further provides methods of identifying
compounds that inhibit the expression level of an NSCLC-associated
gene (KIF11, GHSR1b, NTSR1 or FOXM1) by contacting a test cell
expressing an NSCLC-associated gene with a test compound and
determining the expression level of the NSCLC-associated gene. The
test cell may be an NSCLC cell. A decrease of the expression level
compared to a normal control level of the gene indicates that the
test compound is an inhibitor of the expression or function of the
NSCLC-associated gene. Therefore, if a compound suppresses the
expression level of KIF11, GHSR1b, NTSR1 or FOXM1 compared to a
control level, the compound is expected to reduce a symptom of
NSCLC.
[0025] Alternatively, the present invention provides a method of
screening for a compound for treating or preventing NSCLC. The
method includes contacting a polypeptide selected from the group of
KIF11, GHSR1b, NTSR1, and FOXM1 with a test compound, and selecting
the test compound that binds to or suppresses the biological
activity of the polypeptide. The invention further provides a
method of screening for a compound for treating or preventing
NSCLC, which includes the steps of contacting a test compound with
a cell that expresses KIF11, GHSR1b, NTSR1 or FOXM1 protein or
introduced with a vector comprising the transcriptional regulatory
region of KIF11, GHSR1b, NTSR1 or FOXM1 gene upstream of a reporter
gene, and then selecting the test compound that reduces the
expression level of the KIF11, GHSR1b, NTSR1 or FOXM1 protein or
protein encoded by the reporter gene. According to these screening
methods, the test compound that suppresses the biological activity
or the expression level compared to a control level is expected to
reduce a symptom of NSCLC. Furthermore, the present invention
provides a method of screening for a compound for treating or
preventing NSCLC wherein the binding between KIF11 and KOC1, or
GHSR1b or NTSR1 and NMU is detected. Compounds that inhibit the
binding between KIF11 and KOC1, or GHSR1b or NTSR1 and NMU are
expected to reduce a symptom of NSCLC.
[0026] We detected a novel intra-cellular and inter-cellular
RNA-transporting system in lung carcinomas, involving
transactivation of KOC1 and KIF11. A complex of these two molecules
in lung tumors was able to bind mRNAs encoding proteins known to
function in intercellular adhesion, cancer-cell progression, and
oncogenesis, and transport them to neighboring cells through
ultrafine intercellular structures. In particular, evidence
provided here shows that KOC1 binds to KIF11 at the RRM domain in
the N-terminal region of KOC1. In addition, evidence provided here
shows inhibition of their binding by dominant-negative KOC1 mutants
effectively suppressed growth of NSCLC cells in vitro. For example,
KOC1 fragments (or nucleic acids encoding them) comprising the RRM
domains of KOC1 can be used as dominant negative fragments to
suppress cell proliferation and thus treat cancer. Alternatively,
the KOC1 fragment may comprise the ribonucleoprotein K-homologous
(KH) domain.
[0027] The invention also provides methods of identifying
polypeptides and other compounds that modulate RNA transport
activity. For example, a polypeptide can be tested for RNA
transporting activity by contacting the polypeptide with a KIF11
polypeptide or a functional equivalent thereof with an RNA that can
be transported by KIF11 under conditions suitable for
transportation of RNA. Alternatively, agents that modulate RNA
transporting activity can be tested by contacting a test agent with
a KIF11 polypeptide or a functional equivalent thereof with an RNA
that can be transported by KIF11 under conditions suitable for
transportation of RNA. Test agents useful for treating NSCLC by
testing the agents for the ability to inhibit binding between a
KOC1 polypeptide, or a functional equivalent, and an RNA that is
bound by KOC1 or the complex of KOC1 and KIF11.
[0028] Immunohistochemical analysis of lung-cancer tissue
microarrays demonstrated that transactivation of KOC1 and KIF11 was
significantly associated with poor prognosis of lung-cancer
patients.
[0029] Methods for treating or preventing NSCLC and compositions to
be used for such methods are also provided. Therapeutic methods
include a method of treating or preventing NSCLC in a subject by
administering to the subject a composition of an antisense, short
interfering RNA (siRNA) or a ribozyme that reduce the expression of
KIF11, GHSR1b, NTSR1 or FOXM1 gene, or a composition comprising an
antibody or fragment thereof that binds and suppresses the function
of a polypeptide encoded by the gene. The compositions of the
invention may also comprise a dominant negative KOC1 mutant (or
nucleic acids encoding it) comprising a KOC1 fragment that contains
one or more RRM domains and/or KH domains of KOC1.
[0030] The invention also includes vaccines and vaccination
methods. For example, a method of treating or preventing NSCLC in a
subject is carried out by administering to the subject a vaccine
containing a polypeptide encoded by KIF11, GHSR1b, NTSR1 or FOXM1
gene, or an immunologically active fragment of the polypeptide. An
immunologically active fragment is a polypeptide that is shorter in
length than the full-length naturally-occurring protein and which
induces an immune response upon introduction into the body. For
example, an immunologically active fragment includes a polypeptide
of at least 8 residues in length that stimulates an immune cell
such as a T cell or a B cell in vivo. Immune cell stimulation can
be measured by detecting cell proliferation, elaboration of
cytokines (e.g., IL-2) or production of antibody.
[0031] Other therapeutic methods include those wherein a compound
selected by the screening method of the present invention is
administered.
[0032] Also included in the invention are double-stranded molecules
that comprise a sense strand and an antisense strand. The sense
strand comprises a ribonucleotide sequence corresponding to a
target sequence comprised within the mRNA of a KIF11, GHSR1b, NTSR1
or FOXM1 gene, and the antisense strand is a complementary sequence
to the sense strand. Such double-stranded molecules of the present
invention can be used as siRNAs against KIF11, GHSR1b, NTSR1 or
FOXM1 gene. Furthermore, the present invention relates to vectors
encoding the double-stranded molecules of the present
invention.
[0033] The present application also provides a composition for
treating and/or preventing NSCLC using any of the antisense
polynucleotides or siRNAs against KIF11, GHSR1b, NTSR1 or FOXM1
gene, or an antibody that binds to a polypeptide encoded by KIF11,
GHSR1b, NTSR1 or FOXM1 gene. Other compositions include those that
contain a compound selected by the screening method of the present
invention as an active ingredient.
[0034] It is to be understood that both the foregoing summary of
the invention and the following detailed description are of a
preferred embodiment, and not restrictive of the invention or other
alternate embodiments of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0035] FIG. 1 shows photographs confirming the relationship between
KOC1 and KIF11. [0036] (a) depicts the result of
co-immunoprecipitation of KOC1 and KIF11 confirming the interaction
between KOC1 and KIF11. A549 cells were transiently co-transfected
with Flag-tagged KIF11 and myc-tagged KOC1, immunoprecipitated with
anti-Flag M2 agarose, and subsequently immunoblotted with anti-myc
antibody. In contrast, using the same combination of vectors and
cells, the cells were immunoprecipitated with anti-myc agarose and
immunoblotted with anti-Flag M2 antibody. A band corresponding to
the immunoblotted protein was found only when both constructs were
co-transfected.
[0037] (b) depicts the result of immunocytochemical staining
showing the co-localization of KOC1 and KIF11. COS-7 cells were
transiently transfected with FLAG-tagged KIF11 and myc-tagged KOC1,
and their co-localization was detected mainly in the cytoplasm
using FITC-labeled anti-FLAG antibody and rhomamine-labeled
anti-myc antibody.
[0038] (c) depicts the result of reciprocal co-immunoprecipitation
of endogenous KOC1 and KIF11 from extracts of lung-cancer cell
lines A549 and LC319. (upper panel) Western-blot analysis of both
cell extracts immunoprecipitated with anti-KOC1 antibodies, with
KIF11 protein detected in the immunoprecipitate. (lower panel)
Western-blot of extracts immunoprecipitated with anti-KIF11
antibodies, with KOC1 protein detected in the
immunoprecipitate.
[0039] FIG. 2 shows photographs confirming co-activation of KOC1
and KIF11 in lung tumors and normal tissues.
[0040] (a) depicts the result of QRT-PCR examining expression of
KOC1 and KIF11 in clinical samples of NSCLC and corresponding
normal lung tissues. Y-axis indicates the relative expression rate
of the two genes (KOC1 or KIF11/ACTS).
[0041] (b) depicts the result of QRT-PCR examining expression of
KOC1 and KIF11 among 20 lung-cancer cell lines.
[0042] (c) depicts the result of Northern-blot analysis detecting
expression of KOC1 and KIF11 in normal human tissues.
[0043] FIG. 3 shows photographs confirming the relationship between
KOC1 and KIF11.
[0044] (a) shows schematic drawing of five KOC1 deletion mutants
lacking either or both of the terminal regions, with N- and
C-terminals tagged with FLAG and HA respectively. KH,
ribonucleoprotein K-homologous domain.
[0045] (b) depicts the result of immunoprecipitation experiments
for identification of the region of KOC1 that binds to KIF11. The
KOC1DEL4 and KOC1DEL5 constructs, which lacked two RNA-recognition
motifs, (RRM) did not retain any appreciable ability to interact
with endogenous KIF11.
[0046] FIG. 4 shows photographs confirming the relationship between
KOC1 and KOC1-associated mRNAs.
[0047] (a) depicts the result of Western blotting with
immunoprecipitated KOC1 deletion mutants and DIG-labeled RAB35 full
length mRNA for identification of the mRNA-binding region in
KOC1.
[0048] (b) depicts the result of Northwestern with
immunoprecipitated KOC1 deletion mutants and DIG-labeled RAB35 full
length mRNA for identification of the mRNA-binding region in KOC1.
The KOC1DEL3 and KOC1DEL5, did not bind to any of these mRNAs, and
the KOC1DEL4, which is a construct with the four KH domains only,
showed similar binding affinities for mRNAs to the KOC1DEL2, a
construct without C-terminal two KH domains.
[0049] (c) depicts the result of IP-RT-PCR for confirmation of
IP-microarray and the ability of various KOC1 deletion mutants
transfected into A549 cells to bind directly to representative
eight endogenous mRNAs (CCT2, SBP2, SLC25A3, RAB35, PSMB7, GL,
PKP4, and WINS1) among 55 candidate genes (see Table 2).
[0050] FIG. 5 shows photographs showing movement of KOC1-KIF11-mRNA
ribonuleoprotein complexes in living cultured mammalian cells.
[0051] (a) are photographs showing transport of the KOC1-KIF11
protein complex. Small particles that expressed fluorescent cyan
(ECFP) KOC1 and yellow (EYFP) KIF11 proteins were co-localized, and
transferred together between connected COS-7 cells through
ultrafine intercellular structures (arrows).
[0052] (b) are photographs showing transport of KOC1-RAB35 mRNA RNP
complex from one COS-7 cell that contains a high level of KOC1-RNP
complex (cell A) to another cell with a lower level of the complex
(stained simply with CellTracker; cell B). Small particles of
KOC1-RAB35 mRNA complex as well as KOC1 particles were transferred
from cell A to cell B through ultrafine intercellular structures
(arrows).
[0053] FIG. 6 shows photographs showing localization of
KOC1-KIF11-mRNA ribonuleoprotein complexes.
[0054] (a) depicts the result of immunoprecipitation of cell
extracts from A549 and LC319 confirming of direct interaction
between endogenous KIF11 and DCTN1 (upper and lower panels).
[0055] FIG. 7 shows photographs showing translation of
KOC1-associated mRNAs transported into the recipient cells.
[0056] (a) are photographs showing translation of mRNA transported
into the recipient cells monitored by in situ hybridization.
[0057] (b) are photographs showing protein synthesis based on
transported mRNA in receiving cell. Constructs with full length
RAB35 mRNA fused in frame to a myc tag sequence (upper panel).
Co-localization of myc-tagged RAB35 proteins in the cytoplasm of
CellTracker-stained receiving cells using immunocytochemistry
(lower panels).
[0058] (c) are photographs showing protein synthesis based on
transported mRNA in receiving cell. Constructs with full length
RAB35 mRNA fused in frame to a EGFP protein sequence.
[0059] (d) are photographs showing protein synthesis based on
transported mRNA in receiving cell. Expression of EGFP-fused RAB35
proteins in CellTracker-positive receiving cells using time-lapse
video microscopy. EGFP and related-DIC image were shown.
[0060] (e) are photographs showing that no significant difference
in the protein level of RAB35-EGFP fused-protein was found between
COS-7 cells that were co-transfected with RAB35-EGFP and
HA-tagged-KOC1 vectors, and those with RAB35-EGFP and mock plasmid
vectors. This indicates that KOC1 is not likely to interfere with
translation of RAB35-EGFP mRNA.
[0061] FIG. 8 shows the effect of KIF11 siRNAs on cells.
[0062] (a) depicts the inhibition on the growth of NSCLC cells by
siRNAs against KIF11. The expression of KIF11 in response to
specific siRNAs (si-KIF#1, #2, and #3) or control siRNAs (EGFP,
LUC, SC) in A549 cells, was analyzed by semiquantitative
RT-PCR.
[0063] (b) depicts the viability of A549 cells in response to
si-KIF#1, #2, #3, EGFP, LUC, or SC, evaluated by triplicate MTT
assays.
[0064] FIG. 9 shows the effect of KOC1 dominant-negative on
cells.
[0065] (a) depicts the results of immunoprecipitation confirming
interaction of KOC1 deletion-mutant KOC1DEL3 with endogenous KIF11
in LC319 cells.
[0066] (b) depicts the results of immunoprecipitation confirming
reduction of the complex formation between endogenous KOC1 and
KIF11 in LC319 cells over-expressing the RRM domains.
[0067] (c) depicts the viability of LC319 cells in response to
dose-dependent dominant-negative effect of KOC1DEL3 evaluated by
triplicate MTT assays. X-axis indicates dosage of KOC1DEL3
plasmid-DNA (.mu.g) transfected into LC319 cells in individual
assays.
[0068] (d) depicts the results of immunoprecipitation detecting
reduction of the complex formation between endogenous KOC1 and
KIF11 in A549 cells that were transfected with the KOC1DEL2
construct.
[0069] (e) depicts the results of immunoprecipitation detecting
interaction of the KOC1DEL2 with endogenous KIF11 in A549
cells.
[0070] (f) depicts the viability of A549 cells in response to
dose-dependent dominant-negative effect of KOC1DEL2 evaluated by
triplicate MTT assays. X-axis indicates dosage of KOC1DEL2
plasmid-DNA (.mu.g) transfected into A549 cells in individual
assays.
[0071] FIG. 10 shows the effect of RAB35 siRNAs on cells.
[0072] (a) depicts the result of semi-quantitative RT-PCR analyzing
mRNA knock-down effect in response to si-RAB35 or control siRNAs in
A549 cells.
[0073] (b) show results of MTT assays of A549 cells transfected
with specific siRNA or control plasmids (EGFP, Scramble, or
Luciferase). Error bars represent the standard deviation of
triplicate assays.
[0074] FIG. 11 shows association of KOC1 and KIF11 over-expression
with worse outcomes in NSCLC.
[0075] (a) depicts the results of immunohistochemical evaluation of
representative samples from surgically-resected SCC tissues, using
anti-KOC1 (left) and anti-KIF11 (right) polyclonal antibodies on
tissue microarrays (.times.200).
[0076] (b) depicts the results of Kaplan-Meier analysis of
tumor-specific survival times according to KOC1 expression (left
panel) and KIF11 expression (right panel) on tissue
microarrays.
[0077] FIG. 12 is schematic model for the mechanism of
intracellular and cell-to-cell mRNA transport by KOC1-KIF11-DCTN1
complexes on microtubules. The KOC1 ribonucleoprotein complex,
including KIF11 motor-protein and DCTN1, transports KOC1-associated
mRNAs through the structure of microtubules within or between
mammalian somatic cells. This model implies that proliferating
cancer-cells may communicate actively by engaging this molecular
complex in a system that transports mRNAs critical for cancer
growth or progression from one cell to another FIG. 8 shows the
relationship between NMU and GHSR1b/NTSR1.
[0078] FIG. 13 (a) shows the result of semiquantitative RT-PCR
analysis depicting the expression of NMU, candidate receptors, and
their known ligands detected in NSCLC cell lines.
[0079] (b) shows GHSR1b expression in normal human tissues.
[0080] (c) depicts the result of immunocytochemical staining using
FITC-labeled anti-FLAG antibody showing the co-localization of NMU
and GHSR1b/NTSR1 on the cell surface of COS-7 cells that were
transiently transfected with FLAG-tagged GHSR1b or NTSR1.
[0081] (d) depicts the interaction of NMU with GHSR1b/NTSR1. COS-7
cells were transiently transfected with the same vectors, and
binding of rhodamine-labeled NMU-25 to the cell surface was
detected by flow cytometry. As negative controls for these assays,
three ligand/cell combinations were prepared: 1) non-transfected
COS-7 cells; 2) NMU-25-rhodamine vs non-transfected COS-7 cells;
and 3) COS-7 cells transfected only with GHSR1b or NTSR1.
[0082] (e) depicts the results of receptor-ligand binding assay
using the LC319 and PC-14 cells treated with NMU-25.
[0083] (f) depicts cAMP production of NMU-treated NSCLC cells.
[0084] FIG. 14 shows the effect of siRNAs on cells.
[0085] (a) depicts the inhibition on the growth of NSCLC cells by
siRNAs against GHSR1b and NTSR1. Expression of GHSR or NTSR1 in
response to specific siRNAs (si-GHSR or si-NTSR1) or control siRNAs
(EGFP, LUC, SCR) in A549 and LC319 cells were analyzed by
semiquantitative RT-PCR.
[0086] (b) depicts the result of triplicate MTT assays evaluating
viability of A549 or LC319 cells in response to si-GHSR, NTSR1,
EGFP, LUC, or SCR.
[0087] FIG. 15 shows validation of candidate downstream genes of
NMU.
[0088] (a) depicts time-dependent reduction of NMU transcript by
si-NMU.
[0089] (b) depicts the result of semiquantitative RT-PCR
experiments of mRNAs from LC319 cells treated with si-NMU, with
gene-specific primers confirming time-dependent reduction of
candidate downstream target gene expression.
[0090] (c) depicts the result of semiquantitative RT-PCR using
mRNAs from LC319 cells incubated with NMU-25 or BSA (control) (100
.mu.M) detecting induction of FOXM1 as the candidate downstream
target gene of NMU.
[0091] FIG. 16 shows the effect of FOXM1 siRNAs on cells.
[0092] (a) depicts inhibition of growth of NSCLC cells by siRNAs
against FOXM1. Expression of FOXM1 in response to specific siRNAs
(si-FOXM1) or control siRNAs (EGFP, LUC, SCR) in A549 cells,
analyzed by semiquantitative RT-PCR (upper panel). Viability of
A549 cells, evaluated by triplicate MTT assays, in response to
si-FOXM1, EGFP, LUC, or SCR (lower panel).
[0093] (b) depicts inhibition of growth of NSCLC cells by siRNAs
against FOXM1. Expression of FOXM1 in response to specific siRNAs
(si-FOXM1) or control siRNAs (EGFP, LUC, SCR) in LC319 cells,
analyzed by semiquantitative RT-PCR (upper panel). Viability of
A549 cells, evaluated by triplicate MTT assays, in response to
si-FOXM1, EGFP, LUC, or SCR (lower panel).
[0094] FIG. 17 is a schematic model for promotion of cancer cell
growth and invasion through the NMU-receptor interaction in the
autocrine NMU-GHSR1b oncogenic signaling pathway. Binding of NMU to
GHSR1b and/or NTSR1 leads to the activation of adenylate cyclase,
accumulation of intracellular cAMP and following activation of
cAMP-dependent protein kinase (PKA). The release of catalytic
subunits of PKA (C) from the regulatory subunits (R) is resulting
in the activation of downstream FOXM1 gene and/or related target
genes.
DETAILED DESCRIPTION OF THE INVENTION
[0095] The words "a", "an" and "the" as used herein mean "at least
one" unless otherwise specifically indicated. The terms "protein"
and "polypeptide" are used interchangeably. Furthermore, the terms
"gene", "polynucleotide", and "nucleic acids" are used
interchangeably unless otherwise specifically indicated.
[0096] To investigate the mechanisms of lung carcinogenesis and
identify genes that might be useful as diagnostic markers or
targets for development of new molecular therapies, genes
specifically up-regulated in non-small cell lung cancers (NSCLC)
were searched by means of cDNA microarray. Through the analysis, a
couple of candidate therapeutic target genes were identified. Two
genes, KH domain containing protein over-expressed in cancer (KOC1)
and neuromedin U (NMU) were abundantly expressed in clinical NSCLC
samples as well as NSCLC cell lines examined. However, their
expression was hardly detectable in corresponding non-cancerous
lung tissue. The growth of NSCLC cells that over-expressed
endogenous NMU was significantly inhibited by anti-NMU antibody.
Furthermore, the treatment of NSCLC cells with siRNA against KOC1
and/or NMU suppressed the expression of the gene and resulted in
growth inhibition of the NSCLC cells. Furthermore, KOC1 was
identified to bind to kinesin family member 11 (KIF11) of the
cancer cells, whereas NMU bound to the neuropeptide G
protein-coupled receptors (GPCRs), growth hormone secretagogue
receptor 1b (GHSR1b) and neurotensin receptor 1 (NTSR1). NMU
ligand-receptor system was identified to activate Homo sapiens
forkhead box M1 (FOXM1). Interestingly, GHSR1b, NTSR1, FOXM1, and
KIF11 were all specifically over-expressed in NSCLC cells.
[0097] RNA binding protein KOC1 and microtubles motor protein KIF11
is required for the localization of some kinds of mRNA needed in
embryogenesis and carcinogenesis (FIG. 12). As previously reported
by the present inventors, treatment of NSCLC cells with specific
siRNA to reduce expression of KOC1 resulted in growth suppression.
In this study, KIF11 was demonstrated to associate with KOC1 in
NSCLC cells and to be the target for the growth-promoting effect of
KOC1 in lung tumors. The present inventors revealed that KOC1 not
only co-localized with KIF11 in human normal tissues, NSCLCs, and
cell lines, but also directly interacted with KIF11 in NSCLC cells
in vitro, and that the treatment of NSCLC cells with siRNAs for
KIF11 reduced its expression and led to growth suppression. The
results show that KOC1-KIF11 signaling affects growth of NSCLC
cells. As shown below, dominant negative fragments of KOC1 (e.g.,
those containing the RRM domains) can be used to inhibit
proliferation of cancer cells. By expression analysis, increased
expression of KOC1 and KIF11 was detected in the majority of NSCLC
samples, but not in normal lung tissues. Since most of the clinical
NSCLC samples used for the present analysis were at an early and
operable stage, KOC1 and KIF11 can be conveniently used as a
biomarker for diagnosing early-stage lung cancer, in combination
with fiberscopic transbronchial biopsy (TBB) or sputum
cytology.
[0098] Therefore, KOC1 and KIF11 are essential for an oncogenic
pathway in NSCLCs. The data reported here provide evidence for
designing new anti-cancer drugs, specific for lung cancer, which
target the KOC1-KIF11 pathway. They also show that siRNAs can be
used to treat chemotherapy-resistant, advanced lung cancers.
[0099] A significant increase in the sub-G1 fraction of NSCLC cells
transfected with siRNA-NMU suggested that blocking the autocrine
NMU-signaling pathway could induce apoptosis. The present inventors
also found other evidence supporting the significance of this
pathway in carcinogenesis; e.g., addition of NMU into the medium
promoted the growth of COS-7 cells in a dose-dependent manner, and
addition of anti-NMU antibody into the culture medium inhibited
this NMU-enhanced cell growth, possibly by neutralizing NMU
activity. Moreover, the growth of NSCLC cells that endogenously
over-expressed NMU was significantly inhibited by anti-NMU
antibody. The expression of NMU also resulted in significant
promotion of COS-7 cell invasion in in vitro assays. These results
show that NMU is an important growth factor for NSCLC and is
associated with cancer cell invasion, functioning in an autocrine
manner, and that screening molecules targeting the NMU-receptor
growth-promoting pathway is a useful therapeutic approach for
treating NSCLCs. By immunohistochemical analysis, increased
expression of NMU protein was detected in the majority of NSCLC
(SCC, ADC, LCC, and BAC) and SCLC samples, but not in normal lung
tissues. Since NMU is a secreted protein and most of the clinical
NSCLC samples used for the present analysis were at an early and
operable stage, NMU can be conveniently used as a biomarker for
diagnosis of early-stage lung cancer, in combination with
fiberscopic transbronchial biopsy (TBB), sputum cytology, or blood
tests.
[0100] Two receptors, NMU1R (FM3/GPR66) and NMU2R (FM4) are known
to interact with NMU. The results presented here, however,
indicated that these two known receptors were not the targets for
the autocrine NMU-signaling pathway in NSCLCs; instead, GHSR1b and
NTSR1 proved to be the targets for the growth-promoting effect of
NMU in lung tumors. The present inventors revealed that NMU-25
bound to these receptors on the cell surface, and that treatment of
NSCLC cells with siRNAs for GHSR1b or NTSR1 reduced expression of
the receptors and led to apoptosis. The results show that NMU
affects growth of NSCLC cells by acting through GHSR1b and/or NTSR1
(FIG. 14). GHSR is a known receptor of Ghrelin (GHRL), a recently
identified 28-amino-acid peptide capable of stimulating release of
pituitary growth hormone and appetite in humans (Lambert, P. D. et
al., Proc. Natl. Acad. Sci. 98: 4652-4657 (2001); Petersenn, S. et
al., Endocrinology 142: 2649-2659 (2001); Kim K. et al., Clin.
Endocrinol. 54: 705-860 (2001); Kojima, M. et al., Nature 402:
656-660 (1999)). Of the two transcripts known to be receptors for
GHRL, GHSR1a and GHSR1b, over-expression of only GHSR1b was
detected in NSCLC tissues and cell lines. Since GHRL was not
expressed in the NSCLCs examined, GHSR1b was suspected to have a
growth-promoting function in lung tumors through binding to NMU,
but not to GHRL.
[0101] NTSR1 is one of three receptors of neurotensin (NTS), a
brain and gastrointestinal peptide that fulfills many central and
peripheral functions (Heasley, L. E. Oncogene 20: 1563-1569
(2001)). NTS modulates transmission of dopamine and secretion of
pituitary hormones, and exerts hypothermic and analgesic effects in
the brain while it functions as a peripheral hormone in the
digestive tract and cardiovascular system. Others have reported
that NTS is produced and secreted in several human cancers,
including small-cell lung cancers (SCLC) (Heasley, L. E. Oncogene
20: 1563-1569 (2001)). The expression of NTS was detected in four
of the 15 NSCLC cell lines that were examined in the present
invention (FIG. 13a), but the expression pattern of NTS was not
necessarily concordant with that of NMU or NTSR1. Therefore NTS
may, along with NMU, contribute to the growth of NSCLC through
NTSR1 or other receptor(s) in a small subset of NSCLCs. In the
present experiments the majority of the cancer cell lines and
clinical NSCLCs that expressed NMU also expressed GHSR1b and/or
NTSR1, indicating that these ligand-receptor interactions were
involved in a pathway that is central to the growth-promoting
activity of NMU in NSCLCs.
[0102] NMU signaling pathway affects the growth promotion of
lung-cancer cells by transactivating a set of downstream genes
including FOXM1. FOXM1 was known to be over-expressed in several
types of human cancers (Teh, M. T. et al., Cancer Res. 62,
4773-4780; van den Boom, J. et al., (2003). Am. J. Pathol. 163,
1033-1043; Kalinichenko, V. V. et al., (2004). Genes. Dev. 18,
830-850). The "forkhead" gene family, originally identified in
Drosophila, comprises transcription factors with a conserved
100-amino acid DNA-binding motif, and has been shown to play
important roles in regulating the expression of genes involved in
cell growth, proliferation, differentiation, longevity, and
transformation. Cotransfection assays in the human hepatoma HepG2
cell line demonstrated that FOXM1 protein stimulated expression of
both the cyclin B1 (CCNB1) and cyclin D1 (CCND1) (Wang, X. et al.,
(2002). Proc. Nat. Acad. Sci. 99, 16881-16886.), suggesting that
these cyclin genes are direct FOXM1 transcription targets and that
FOXM1 controls the transcription network of genes that are
essential for cell division and exit from mitosis. It should be
noted that we observed activation of CCNB1 in the majority of a
series of NSCLC and its good concordance of the expression to FOXM1
(data not shown). The promotion of cell growth in NSCLC cells by
NMU might reflect transactivation of FOXM1, which would affect the
function of those molecular pathways in consequence. Therefore,
NMU, two newly revealed receptors for this molecule, GHSR1b and
NTSR1, and their downstream gene FOXM1 are involved in an autocrine
growth-promoting pathway in NSCLCs. The data reported here provide
the basis for designing new anti-cancer drugs, specific for lung
cancer, that target the NMU-GHSR1b/NTSR1-FOXM1 pathway. They also
show that siRNAs that interfere with this pathway can be used to
treat chemotherapy-resistant, advanced lung cancers.
[0103] These data show that KOC1-KIF11 signaling pathway is
frequently up-regulated in lung carcinogenesis, and that NMU an
important autocrine growth factor for NSCLC, acting through GHSR1b
and NTSR1 receptor molecules. Thus, selective suppression of
components of these complexes can suppress the development and/or
progression of lung carcinogenesis and targeting these pathways are
conveniently used in therapeutic and diagnostic strategies for the
treatment of lung-cancer patients.
Diagnosing Non-Small Cell Lung Cancer (NSCLC)
[0104] By measuring the expression level of KIF11, GHSR1b, NTSR1 or
FOXM1 gene in a biological derived from a subject, the occurrence
of NSCLC or a predisposition to develop NSCLC in the subject can be
determined. The invention involves determining (e.g., measuring)
the expression level of at least one, and up to all of KIF11,
GHSR1b, NTSR1, and FOXM1 gene in the biological sample.
[0105] According to the present invention, a gene transcript of
NSCLC-associated gene, KIF11, GHSR1b, NTSR1 or FOXM1, is detected
for determining the expression level of the gene. The expression
level of a gene can be detected by detecting the expression
products of the gene, including both transcriptional and
translational products, such as mRNA and proteins. Based on the
sequence information provided by the GenBank.TM. database entries
for the known sequences, KIF11 (NM.sub.--004523), GHSR1b
(NM.sub.--004122), NTSR1 (NM.sub.--002531), and FOXM1 (No.
NM.sub.--202003) genes can be detected and measured using
techniques well known to one of ordinary skill in the art. The
nucleotide sequences of the KIF11, GHSR1b, NTSR1, and FOXM1 genes
are described as SEQ ID NOs: 1, 3, 5, and 106, respectively, and
the amino acid sequences of the proteins encoded by the genes are
described as SEQ ID NOs: 2, 4, 6, and 107.
[0106] For example, sequences within the sequence database entries
corresponding to KIF11, GHSR1b, NTSR1 or FOXM1 gene can be used to
construct probes for detecting their mRNAs by, e.g., Northern blot
hybridization analysis. The hybridization of the probe to a gene
transcript in a subject biological sample can be also carried out
on a DNA array. The use of an array is preferred for detecting the
expression level of a plurality of the NSC genes (KIF11, GHSR1b,
NTSR1, and FOXM1). As another example, the sequences can be used to
construct primers for specifically amplifying KIF11, GHSR1b, NTSR1
or FOXM1 gene in, e.g., amplification-based detection methods such
as reverse-transcription based polymerase chain reaction (RT-PCR).
Furthermore, the expression level of KIF11, GHSR1b, NTSR1 or FOXM1
gene can be analyzed based on the quantity of the expressed
proteins encoded by the gene. A method for determining the quantity
of the expressed protein includes immunoassay methods.
Alternatively, the expression level of KIF11, GHSR1b, NTSR1 or
FOXM1 gene can also be determined based on the biological activity
of the expressed protein encoded by the gene. For example, a
protein encoded by KIF11 gene is known to bind to KOC1, and thus
the expression level of the gene can be detected by measuring the
binding ability to KOC1 due to the expressed protein. Furthermore,
KIF11 protein is known to have a cell proliferating activity.
Therefore, the expression level of KIF11 gene can be determined
using such cell proliferating activity as an index. On the other
hand GHSR1b and NTSR1 proteins are known to bind to NMU, and also
have a cell proliferating activity. Thus, similarly to KIF11, the
expression levels of GHSR1b and NTSR1 genes can be detected by
measuring their binding ability to NMU or cell proliferating
activity due to the expressed protein.
[0107] Any biological materials may be used as the biological
sample for determining the expression level so long as any of the
KIF11, GHSR1b, NTSR1, and FOXM1 genes can be detected in the sample
and includes test cell populations (i.e., subject derived tissue
sample). Preferably, the biological sample comprises a lung cell (a
cell obtained from the lung). Gene expression may also be measured
in blood, serum or other bodily fluids such as sputum. Furthermore,
the test sample may be cells purified from a tissue.
[0108] The subject diagnosed for NSCLC according to the method is
preferably a mammal and includes human, non-human primate, mouse,
rat, dog, cat, horse and cow.
[0109] The expression level of one or more of KIF11, GHSR1b, NTSR1
or FOXM1 gene in the biological sample is compared to the
expression level(s) of the same genes in a reference sample. The
reference sample includes one or more cells with known parameters,
i.e., cancerous or non-cancerous. The reference sample should be
derived from a tissue type similar to that of the test sample.
Alternatively, the control expression level may be determined based
on a database of molecular information derived from cells for which
the assayed parameter or condition is known.
[0110] Whether or not a pattern of the gene expression levels in a
biological sample indicates the presence of NSCLC depends upon the
composition of the reference cell population. For example, when the
reference cell population is composed of non-cancerous cells, a
similar gene expression level in the test biological sample to that
of the reference indicates that the test biological sample is
non-cancerous. On the other hand, when the reference cell
population is composed of cancerous cells, a similar gene
expression profile in the biological sample to that of the
reference indicates that the test biological sample includes
cancerous cells.
[0111] The test biological sample may be compared to multiple
reference samples. Each of the multiple reference samples may
differ in the known parameter. Thus, a test sample may be compared
to a reference sample known to contain, e.g., NSCLC cells, and at
the same time to a second reference sample known to contain, e.g.,
non-NSCLC cells (normal cells).
[0112] According to the invention, the expression of one or more of
the NSCLC-associated genes, KIF11, GHSR1b, NTSR1, and FOXM1, is
determined in the biological sample and compared to the normal
control level of the same gene. The phrase "normal control level"
refers to an expression profile of KIF11, GHSR1b, NTSR1 or FOXM1
gene typically found in a biological sample derived from a
population not suffering from NSCLC. The expression level of KIF11,
GHSR1b, NTSR1 or FOXM1 gene in the biological samples from a
control and test subjects may be determined at the same time or the
normal control level may be determined by a statistical method
based on the results obtained by analyzing the expression level of
the gene in samples previously collected from a control group. An
increase of the expression level of KIF11, GHSR1b, NTSR1 or FOXM1
gene in the biological sample derived from a patient derived tissue
sample indicates that the subject is suffering from or is at risk
of developing NSCLC.
[0113] An expression level of KIF11, GHSR1b, NTSR1 or FOXM1 gene in
a test biological sample can be considered altered when the
expression level differs from that of the reference by more than
1.0, 1.5, 2.0, 5.0, 10.0 or more fold. Alternatively, an expression
level of KIF11, GHSR1b, NTSR1 or FOXM1 gene in a test biological
sample can be considered altered, when the expression level is
increased or decreased to that of the reference at least 50%, 60%,
80%, 90% or more.
[0114] The difference in gene expression between the test sample
and a reference sample may be normalized to a control, e.g.,
housekeeping gene. For example, a control polynucleotide includes
those whose expression levels are known not to differ between the
cancerous and non-cancerous cells. The expression levels of the
control polynucleotide in the test and reference samples can be
used to normalize the expression levels detected for KIF11, GHSR1b,
NTSR1 or FOXM1 gene. The control genes to be used in the present
invention include .beta.-actin, glyceraldehyde 3-phosphate
dehydrogenase and ribosomal protein P1.
[0115] The differentially expressed KIF11, GHSR1b, NTSR1 or FOXM1
gene identified herein also allow for monitoring the course of
treatment of NSCLC. In this method, a test biological sample is
provided from a subject undergoing treatment for NSCLC. If desired,
multiple test biological samples are obtained from the subject at
various time points before, during or after the treatment. The
expression of one or more of KIF11, GHSR1b, NTSR1 or FOXM1 gene in
the sample is then determined and compared to a reference sample
with a known state of NSCLC that has not been exposed to the
treatment.
[0116] If the reference sample contains no NSCLC cells, a
similarity in the expression level of KIF11, GHSR1b, NTSR1 or FOXM1
gene in the test biological sample and the reference sample
indicates the efficaciousness of the treatment. However, a
difference in the expression level of KIF11, GHSR1b, NTSR1 or FOXM1
gene in the test and the reference samples indicates a less
favorable clinical outcome or prognosis. In particular, increased
expression of KOC1, KIF11, or KOC1 in combination with increased
expression of KIF11 is significantly associated with poor
prognosis.
[0117] The term "efficacious" refers that the treatment leads to a
reduction in the expression of a pathologically up-regulated gene
(including the present indicator genes, KIF11, GHSR1b, NTSR1, and
FOXM1), or a decrease in size, prevalence or metastatic potential
of NSCLC in a subject. When a treatment is applied
prophylactically, "efficacious" means that the treatment retards or
prevents occurrence of NSCLC or alleviates a clinical symptom of
NSCLC. The assessment of NSCLC can be made using standard clinical
protocols. Furthermore, the efficaciousness of a treatment is
determined in association with any known method for diagnosing or
treating NSCLC. For example, NSCLC is diagnosed histopathologically
or by identifying symptomatic anomalies such as chronic cough,
hoarseness, coughing up blood, weight loss, loss of appetite,
shortness of breath, wheezing, repeated bouts of bronchitis or
pneumonia and chest pain.
[0118] Moreover, the present method for diagnosing NSCLC may also
be applied for assessing the prognosis of a patient with the cancer
by comparing the expression level of KIF11, KOC1, GHSR1b, NTSR1,
FOXM1 gene, or a combination thereof (e.g., KOC1 and KIF11) in the
patient-derived biological sample. Alternatively, the expression
level of the gene(s) in the biological sample may be measured over
a spectrum of disease stages to assess the prognosis of the
patient.
[0119] An increase in the expression level of KIF11, KOC1, GHSR1b,
NTSR1 or FOXM1 gene compared to a normal control level indicates
less favorable prognosis. A similarity in the expression level of
KIF11, KOC1, GHSR1b, NTSR1 or FOXM1 gene compared to a normal
control level indicates a more favorable prognosis of the patient.
Preferably, the prognosis of a subject can be assessed by comparing
the expression profile of KIF11, KOC1, GHSR1b, NTSR1 or FOXM1 gene.
In some embodiments, expression levels of KIF11 and KOC1 are
determined.
Expression Profile
[0120] The invention also provides an NSCLC reference expression
profile comprising a pattern of gene expression levels of two or
more of KIF11, KOC1, GHSR1b, NTSR1 and FOXM1 genes. The expression
profile serves as a control for the diagnosis of NSCLC or
predisposition for developing the disease, monitoring the course of
treatment and assessing prognosis of a subject with the
disease.
Kits of the Invention
[0121] The invention also provides a kit comprising two or more
detection reagents, e.g., a nucleic acid that specifically binds to
or identifies one or more of KIF11, KOC1, GHSR1b, NTSR1 and FOXM1
genes. Such nucleic acids specifically binding to or identifying
one or more of KIF11, KOC1, GHSR1b, NTSR1 and FOXM1 genes are
exemplified by oligonucleotide sequences that are complementary to
a portion of KIF11, KOC1, GHSR1b, NTSR1 or FOXM1 polynucleotides or
antibodies which bind to polypeptides encoded by the KIF11, KOC1,
GHSR1b, NTSR1 or FOXM1 gene. The reagents are packaged together in
the form of a kit. The reagents, such as a nucleic acid or antibody
(either bound to a solid matrix or packaged separately with
reagents for binding them to the matrix), a control reagent
(positive and/or negative) and/or a means of detection of the
nucleic acid or antibody are preferably packaged in separate
containers. Instructions (e.g., written, tape, VCR, CD-ROM, etc.)
for carrying out the assay may be included in the kit. The assay
format of the kit may be Northern hybridization or sandwich ELISA
known in the art.
[0122] For example, a detection reagent is immobilized on a solid
matrix such as a porous strip to form at least one detection site.
The measurement or detection region of the porous strip may include
a plurality of detection sites, each detection site containing a
detection reagent. A test strip may also contain sites for negative
and/or positive controls. Alternatively, control site(s) is located
on a separate strip from the test strip. Optionally, the different
detection sites may contain different amounts of immobilized
reagents, i.e., a higher amount in the first detection site and
lesser amounts in subsequent sites. Upon the addition of a test
biological sample, the number of sites displaying a detectable
signal provides a quantitative indication of the amount of KIF11,
GHSR1b, NTSR1 or FOXM1 gene, or polypeptides encoded by the gene
present in the sample. The detection sites may be configured in any
suitably detectable shape and are typically in the shape of a bar
or dot spanning the width of a teststrip.
[0123] Alternatively, the kit contains a nucleic acid substrate
array comprising two or more of the KIF11, GHSR1b, NTSR1, and FOXM1
gene sequences. The expression of 2 or 3 of the genes represented
by KIF11, GHSR1b, NTSR1, and FOXM1 genes are identified by virtue
of the level of binding to an array test strip or chip. The
substrate array can be on, e.g., a solid substrate, e.g., a "chip"
as described in U.S. Pat. No. 5,744,305.
[0124] In some embodiments, the kits can be used for predicting an
NSCLC prognosis. The kits in these embodiments, can comprise a
reagent for detecting mRNA encoding the amino acid sequence of
KIF11 or KOC1, a reagent for detecting the proteins or reagents for
detecting the biological activity of the KIF11 or KOC1 protein.
[0125] The invention also provides kits for the detection of a
compound that regulates RNA transporting activity. The kits may
comprise a cell expressing a KIF11 polypeptide, or functional
equivalent, a KOC1 polypeptide, or functional equivalent, and RNA
to be transported, and DCTN1.
[0126] The kits of the invention may also be used to screen for
compounds for treating or preventing NSCLC. The kits may comprise a
KOC1 polypeptide, or functional equivalent, and an RNA that is
bound by the KOC1 polypeptide or functional equivalent. In the
present invention, any RNA transportable with RNA transporter
activity of KOC1-KIF11 complex can be used as the RNA to be
transported. Prefer RNA can be selected from transcripts of genes
shown in table 2, or fragment thereof. An RNA to be transported may
also be labeled for detecting RNA transporter activity.
Furthermore, in the present invention, KOC1 and KIF11 polypeptide
or functional equivalent thereof is expressed as fusion protein
with signal generating protein for observation by microscopy or
cell imaging systems. For example, ECFP, EYFP, and EGFP may be used
for signal generating protein.
Array and Pluralities
[0127] The invention also includes a nucleic acid substrate array
comprising one or more of the KIF11, GHSR1b, NTSR1, and FOXM1
genes. The nucleic acids on the array specifically correspond to
one or more polynucleotide sequences represented by KIF11, GHSR1b,
NTSR1, and FOXM1 genes. The expression level of 2, 3 or 4 of the
KIF11, GHSR1b, NTSR1, and FOXM1 genes is identified by detecting
the binding of nucleic acid to the array.
[0128] The invention also includes an isolated plurality (i.e., a
mixture of two or more nucleic acids) of nucleic acids. The nucleic
acids are in a liquid phase or a solid phase, e.g., immobilized on
a solid support such as a nitrocellulose membrane. The plurality
includes one or more of the polynucleotides represented by KIF11,
GHSR1b, NTSR1, and FOXM1 genes. According to a further embodiment
of the present invention, the plurality includes 2, 3, or 4 of the
polynucleotides represented by KIF11, GHSR1b, NTSR1, and FOXM1
genes.
Chips
[0129] The DNA chip is a device that is convenient to compare the
expression levels of a number of genes at the same time. DNA
chip-based expression profiling can be carried out, for example, by
the method as disclosed in "Microarray Biochip Technology" (Mark
Schena, Eaton Publishing, 2000), etc.
[0130] A DNA chip comprises immobilized high-density probes to
detect a number of genes. Thus, the expression levels of many genes
can be estimated at the same time by a single-round analysis.
Namely, the expression profile of a specimen can be determined with
a DNA chip. The DNA chip-based method of the present invention
comprises the following steps of: [0131] (1) synthesizing aRNAs or
cDNAs corresponding to the marker genes; [0132] (2) hybridizing the
aRNAs or cDNAs with probes for marker genes; and [0133] (3)
detecting the aRNA or cDNA hybridizing with the probes and
quantifying the amount of mRNA thereof.
[0134] The term "aRNA" refers to RNA transcribed from a template
cDNA with RNA polymerase. An aRNA transcription kit for DNA
chip-based expression profiling is commercially available. With
such a kit, aRNA can be synthesized from T7 promoter-attached cDNA
as a template using T7 RNA polymerase. On the other hand, by PCR
using random primer, cDNA can be amplified using as a template a
cDNA synthesized from mRNA.
[0135] Alternatively, the DNA chip comprises probes, which have
been spotted thereon, to detect the marker genes of the present
invention (KIF11, GHSR1b, NTSR1 or FOXM1 gene). There is no
limitation on the number of marker genes spotted on the DNA chip,
and 1, 2, 3 or all of the genes, KIF11, GHSR1b, NTSR1, and FOXM1,
may be used. Any other genes as well as the marker genes can be
spotted on the DNA chip. For example, a probe for a gene whose
expression level is hardly altered may be spotted on the DNA chip.
Such a gene can be used to normalize assay results when the assay
results are intended to be compared between multiple chips or
between different assays.
[0136] A probe is designed for each marker gene selected, and
spotted on a DNA chip. Such a probe may be, for example, an
oligonucleotide comprising 5-50 nucleotide residues. A method for
synthesizing such oligonucleotides on a DNA chip is known to those
skilled in the art. Longer DNAs can be synthesized by PCR or
chemically. A method for spotting long DNA, which is synthesized by
PCR or the like, onto a glass slide is also known to those skilled
in the art. A DNA chip that is obtained by the method as described
above can be used for diagnosing NSCLC according to the present
invention.
[0137] The prepared DNA chip is contacted with aRNA, followed by
the detection of hybridization between the probe and aRNA. The aRNA
can be previously labeled with a fluorescent dye. A fluorescent dye
such as Cy3 (red) and Cy5 (green) can be used to label an aRNA.
aRNAs from a subject and a control are labeled with different
fluorescent dyes, respectively. The difference in the expression
level between the two can be estimated based on a difference in the
signal intensity. The signal of fluorescent dye on the DNA chip can
be detected by a scanner and analyzed using a special program. For
example, the Suite from Affymetrix is a software package for DNA
chip analysis.
Identifying Compounds that Inhibit NSCLC-Associated Gene
Expression
[0138] A compound that inhibits the expression or activity of a
target NSCLC-associated gene (KIF11, GHSR1b, NTSR1 or FOXM1 gene)
is identified by contacting a test cell expressing the
NSCLC-associated gene with a test compound and determining the
expression level or activity of the NSCLC-associated gene. A
decrease in expression compared to the normal control level
indicates that the compound is an inhibitor of the NSCLC-associated
gene. Such compounds identified according to the method are useful
for inhibiting NSCLC.
[0139] The test cell may be a population of cells and includes any
cells as long as the cell expresses the target NSCLC-associated
gene(s). For example, the test cell may be an immortalized cell
line derived from an NSCLC cell. Alternatively, the test cell may
be a cell transfected with any of the KIF11, GHSR1b, NTSR1, and
FOXM1 genes, or which has been transfected with the regulatory
sequence (e.g., promoter) of any of the genes that is operably
linked to a reporter gene.
Screening Compounds
[0140] Using KIF11, GHSR1b, NTSR1 or FOXM1 gene, proteins encoded
by the gene or transcriptional regulatory region of the gene,
compounds can be screened that alter the expression of the gene or
biological activity of a polypeptide encoded by the gene. Such
compounds are expected to serve as pharmaceuticals for treating or
preventing NSCLC.
[0141] Therefore, the present invention provides a method of
screening for a compound for treating or preventing NSCLC using the
polypeptide of the present invention. An embodiment of this
screening method comprises the steps of: (a) contacting a test
compound with a polypeptide encoded by KIF11, GHSR1b, NTSR1 or
FOXM1 gene; (b) detecting the binding activity between the
polypeptide of the present invention and the test compound; and (c)
selecting the compound that binds to the polypeptide.
[0142] As explained in more detail below, KOC1 and KIF11 form a
complex that has RNA transporting activity. Thus, the present
invention also provides methods of identifying polypeptides and
other compounds that modulate RNA transport activity. For example,
a polypeptide can be tested for RNA transporting activity by
contacting a KIF11 polypeptide (SEQ ID NO: 2) or a functional
equivalent thereof with an RNA that can be transported by KIF11
under conditions suitable for transportation of RNA. The level of
RNA transported can be measured using well known techniques, such
as by RNA immunoprecipitation, as described in detail below.
[0143] A functional equivalent of a KIF11 polypeptide is a
polypeptide that has a biological activity equivalent to a
polypeptide consisting of the amino acid sequence of SEQ ID NO: 2
and, for example, comprising the amino acid sequence of SEQ ID NO:
2 (KIF11), wherein one or more amino acids (usually less than five)
are substituted, deleted, or inserted. Alternatively, the
polypeptide may be one that comprises an amino acid sequence having
at least about 80% homology (also referred to as sequence identity)
to SEQ ID NO: 2. In other embodiments, the polypeptide can be
encoded by a polynucleotide that hybridizes under stringent
conditions (as defined below) to a polynucleotide consisting of the
nucleotide sequence of SEQ ID NO: 1.
[0144] In some embodiments, the KIF11 polypeptide or functional
equivalent is contacted with a KOC1 polypeptide or functional
equivalent thereof. A functional equivalent of a KOC1 polypeptide
is a polypeptide that has a biological activity equivalent to a
polypeptide consisting of the amino acid sequence of SEQ ID NO: 105
and, for example, comprising the amino acid sequence of SEQ ID NO:
105, wherein one or more amino acids (usually less than five) are
substituted, deleted, or inserted. Alternatively, the polypeptide
may be one that comprises an amino acid sequence having at least
about 80% homology (also referred to as sequence identity) to SEQ
ID NO: 105. In other embodiments, the polypeptide can be encoded by
a polynucleotide that hybridizes under stringent conditions (as
defined below) to a polynucleotide consisting of the nucleotide
sequence of SEQ ID NO: 104. In some embodiments, a functional
equivalent comprises at least one RRM or KH domain.
[0145] The invention also provides methods of identifying agents
that modulate RNA transporting activity. In these methods, an agent
suspected of modulating RNA transporting activity with a KIF11
polypeptide or functional equivalent. The level of transported RNA
is detected and compared to the level in a control in the absence
of the agent.
[0146] The polypeptide to be used for the screening may be a
recombinant polypeptide or a protein derived from the nature or a
partial peptide thereof. The polypeptide to be contacted with a
test compound can be, for example, a purified polypeptide, a
soluble protein, a form bound to a carrier or a fusion protein
fused with other polypeptides.
[0147] As a method of screening for proteins that bind to KIF11,
GHSR1b, NTSR1 or FOXM1 polypeptide, many methods well known by a
person skilled in the art can be used. Such a screening can be
conducted by, for example, immunoprecipitation method using methods
well known in the art. The proteins of the invention can be
recombinantly produced using standard procedures. For example, a
gene encoding any of the KIF11, GHSR1b, NTSR1, and FOXM1
polypeptides is expressed in animal cells by inserting the gene
into an expression vector for foreign genes, such as pSV2neo, pcDNA
I, pcDNA3.1, pCAGGS and pCD8. The promoter to be used for the
expression may be any promoter that can be used commonly and
include, for example, the SV40 early promoter (Rigby in Williamson
(ed.), Genetic Engineering, vol. 3. Academic Press, London, 83-141
(1982)), the EF-.alpha. promoter (Kim et al., Gene 91: 217-23
(1990)), the CAG promoter (Niwa et al., Gene 108: 193-200 (1991)),
the RSV LTR promoter (Cullen, Methods in Enzymology 152: 684-704
(1987)) the SR.alpha. promoter (Takebe et al., Mol Cell Biol 8: 466
(1988)), the CMV immediate early promoter (Seed and Aruffo, Proc
Natl Acad Sci USA 84: 3365-9 (1987)), the SV40 late promoter
(Gheysen and Fiers, J Mol Appl Genet 1: 385-94 (1982)), the
Adenovirus late promoter (Kaufman et al., Mol Cell Biol 9: 946
(1989)), the HSV TK promoter and so on. The introduction of the
gene into animal cells to express a foreign gene can be performed
according to any methods, for example, the electroporation method
(Chu et al., Nucleic Acids Res 15: 1311-26 (1987)), the calcium
phosphate method (Chen and Okayama, Mol Cell Biol 7: 2745-52
(1987)), the DEAE dextran method (Lopata et al., Nucleic Acids Res
12: 5707-17 (1984); Sussman and Milman, Mol Cell Biol 4: 1642-3
(1985)), the Lipofectin method (Derijard, B Cell 7: 1025-37 (1994);
Lamb et al., Nature Genetics 5: 22-30 (1993): Rabindran et al.,
Science 259: 230-4 (1993)), and so on. The NSC polypeptide can also
be expressed as a fusion protein comprising a recognition site
(epitope) of a monoclonal antibody by introducing the epitope of
the monoclonal antibody, whose specificity has been revealed, to
the N- or C-terminus of the polypeptide. A commercially available
epitope-antibody system can be used (Experimental Medicine 13:
85-90 (1995)). Vectors which can express a fusion protein with, for
example, .beta.-galactosidase, maltose binding protein, glutathione
S-transferase, green florescence protein (GFP), and so on, by the
use of its multiple cloning sites are commercially available.
[0148] A fusion protein prepared by introducing only small epitopes
consisting of several to a dozen amino acids so as not to change
the property of the original polypeptide by the fusion is also
reported. Epitopes, such as polyhistidine (His-tag), influenza
aggregate HA, human c-myc, FLAG, Vesicular stomatitis virus
glycoprotein (VSV-GP), T7 gene 10 protein (T7-tag), human simple
herpes virus glycoprotein (HSV-tag), E-tag (an epitope on
monoclonal phage) and such, and monoclonal antibodies recognizing
them can be used as the epitope-antibody system for screening
proteins binding to the KIF11, GHSR1b, NTSR1 or FOXM1 polypeptide
(Experimental Medicine 13: 85-90 (1995)).
[0149] In immunoprecipitation, an immune complex is formed by
adding these antibodies to cell lysate prepared using an
appropriate detergent. The immune complex consists of the KIF11,
GHSR1b, NTSR1 or FOXM1 polypeptide, a polypeptide comprising the
binding ability with the polypeptide, and an antibody.
Immunoprecipitation can be also conducted using antibodies against
the KIF11, GHSR1b, NTSR1 or FOXM1 polypeptide, in addition to the
use of antibodies against the above epitopes, which antibodies can
be prepared according to conventional methods and may be in any
form, such as monoclonal or polyclonal antibodies, and includes
antiserum obtained by immunizing an animal such as a rabbit with
the polypeptide, all classes of polyclonal and monoclonal
antibodies, as well as recombinant antibodies (e.g., humanized
antibodies).
[0150] Specifically, antibodies against KIF11, GHSR1b, NTSR1 or
FOXM1 polypeptide can be prepared using techniques well known in
the art. For example, KIF11, GHSR1b, NTSR1 or FOXM1 polypeptide
used as an antigen to obtain an antibody may be derived from any
animal species, but preferably is derived from a mammal such as a
human, mouse, or rat, more preferably from a human. The polypeptide
used as the antigen can be recombinantly produced or isolated from
natural sources. According to the present invention, the
polypeptide to be used as an immunization antigen may be a complete
protein or a partial peptide of the KIF11, GHSR1b, NTSR1 or FOXM1
polypeptide. A partial peptide may comprise, for example, the amino
(N)-terminal or carboxy (C)-terminal fragment of the KIF11, GHSR1b,
NTSR1 or FOXM1 polypeptide.
[0151] Any mammalian animal may be immunized with the antigen, but
preferably the compatibility with parental cells used for cell
fusion is taken into account. In general, animals of Rodentia,
Lagomorpha or Primates are used. Animals of Rodentia include, for
example, mouse, rat and hamster. Animals of Lagomorpha include, for
example, rabbit. Animals of Primates include, for example, a monkey
of Catarrhini (old world monkey) such as Macaca fascicularis,
rhesus monkey, sacred baboon and chimpanzees.
[0152] Methods for immunizing animals with antigens are known in
the art. Intraperitoneal injection or subcutaneous injection of
antigens is a standard method for immunization of mammals. More
specifically, antigens may be diluted and suspended in an
appropriate amount of phosphate buffered saline (PBS),
physiological saline, etc. If desired, the antigen suspension may
be mixed with an appropriate amount of a standard adjuvant, such as
Freund's complete adjuvant, made into emulsion, and then
administered to mammalian animals. Preferably, it is followed by
several administrations of the antigen mixed with an appropriately
amount of Freund's incomplete adjuvant every 4 to 21 days. An
appropriate carrier may also be used for immunization. After
immunization as above, the serum is examined by a standard method
for an increase in the amount of desired antibodies.
[0153] Polyclonal antibodies against KIF11, GHSR1b, NTSR1 or FOXM1
polypeptide may be prepared by collecting blood from the immunized
mammal examined for the increase of desired antibodies in the
serum, and by separating serum from the blood by any conventional
method. Polyclonal antibodies include serum containing the
polyclonal antibodies, as well as the fraction containing the
polyclonal antibodies may be isolated from the serum.
Immunoglobulin G or M can be prepared from a fraction which
recognizes only the KIF11, GHSR1b, NTSR1 or FOXM1 polypeptide
using, for example, an affinity column coupled with the
polypeptide, and further purifying this fraction using protein A or
protein G column.
[0154] To prepare monoclonal antibodies, immune cells are collected
from the mammal immunized with the antigen and checked for the
increased level of desired antibodies in the serum as described
above, and are subjected to cell fusion. The immune cells used for
cell fusion are preferably obtained from spleen. Other preferred
parental cells to be fused with the above immunocyte include, for
example, myeloma cells of mammalians, and more preferably myeloma
cells having an acquired property for the selection of fused cells
by drugs.
[0155] The above immunocyte and myeloma cells can be fused
according to known methods, for example, the method of Milstein et
al., (Galfre and Milstein, Methods Enzymol 73: 3-46 (1981)).
[0156] Resulting hybridomas obtained by the cell fusion may be
selected by cultivating them in a standard selection medium, such
as HAT medium (hypoxanthine, aminopterin, and thymidine containing
medium). The cell culture is typically continued in the HAT medium
for several days to several weeks, the time being sufficient to
allow all the other cells, with the exception of the desired
hybridoma (non-fused cells), to die. Then, the standard limiting
dilution is performed to screen and clone a hybridoma cell
producing the desired antibody.
[0157] In addition to the above method, in which a non-human animal
is immunized with an antigen for preparing hybridoma, human
lymphocytes such as those infected by EB virus may be immunized
with KIF11, GHSR1b, NTSR1 or FOXM1 polypeptide, cells expressing
the polypeptide, or their lysates in vitro. Then, the immunized
lymphocytes are fused with human-derived myeloma cells that are
capable of indefinitely dividing, such as U266, to yield a
hybridoma producing a desired human antibody that is able to bind
to the KIF11, GHSR1b, NTSR1 or FOXM1 polypeptide can be obtained
(Unexamined Published Japanese Patent Application No. (JP-A) Sho
63-17688).
[0158] The obtained hybridomas are subsequently transplanted into
the abdominal cavity of a mouse and the ascites are extracted. The
obtained monoclonal antibodies can be purified by, for example,
ammonium sulfate precipitation, a protein A or protein G column,
DEAE ion exchange chromatography, or an affinity column to which
any of the target proteins of the present invention (KIF11, GHSR1b,
NTSR1, and FOXM1 polypeptide) is coupled. The antibody can be used
not only in the present screening method, but also for purification
and detection of KIF11, GHSR1b, NTSR1 or FOXM1 polypeptide, and
serve also as candidates for agonists and antagonists of the
polypeptide. In addition, this antibody can be applied to the
antibody treatment for diseases related to the KIF11, GHSR1b, NTSR1
or FOXM1 polypeptide including NSCLC as described infra.
[0159] Monoclonal antibodies thus obtained can be also
recombinantly prepared using genetic engineering techniques (see,
for example, Borrebaeck and Larrick, Therapeutic Monoclonal
Antibodies, published in the United Kingdom by MacMillan Publishers
LTD (1990)). For example, a DNA encoding an antibody may be cloned
from an immune cell, such as a hybridoma or an immunized lymphocyte
producing the antibody, inserted into an appropriate vector, and
introduced into host cells to prepare a recombinant antibody. Such
recombinant antibody can also be used for the present
screening.
[0160] Furthermore, an antibody used in the screening and so on may
be a fragment of an antibody or modified antibody, so long as it
binds to one or more of KIF11, GHSR1b, NTSR1, and FOXM1
polypeptides. For instance, the antibody fragment may be Fab,
F(ab').sub.2, Fv, or single chain Fv (scFv), in which Fv fragments
from H and L chains are ligated by an appropriate linker (Huston et
al., Proc Natl Acad Sci USA 85: 5879-83 (1988)). More specifically,
an antibody fragment may be generated by treating an antibody with
an enzyme, such as papain or pepsin. Alternatively, a gene encoding
the antibody fragment may be constructed, inserted into an
expression vector, and expressed in an appropriate host cell (see,
for example, Co et al., J Immunol 152: 2968-76 (1994); Better and
Horwitz, Methods Enzymol 178: 476-96 (1989); Pluckthun and Skerra,
Methods Enzymol 178: 497-515 (1989); Lamoyi, Methods Enzymol 121:
652-63 (1986); Rousseaux et al., Methods Enzymol 121: 663-9 (1986);
Bird and Walker, Trends Biotechnol 9: 132-7 (1991)).
[0161] An antibody may be modified by conjugation with a variety of
molecules, such as polyethylene glycol (PEG). Modified antibodies
can be obtained through chemically modification of an antibody.
These modification methods are conventional in the field.
[0162] Alternatively, an antibody may be obtained as a chimeric
antibody, between a variable region derived from nonhuman antibody
and the constant region derived from human antibody, or as a
humanized antibody, comprising the complementarity determining
region (CDR) derived from nonhuman antibody, the frame work region
(FR) derived from human antibody, and the constant region. Such
antibodies can be prepared using known technology.
[0163] Humanization can be performed by substituting rodent CDRs or
CDR sequences for the corresponding sequences of a human antibody
(see e.g., Verhoeyen et al., Science 239:1534-1536 (1988)).
Accordingly, such humanized antibodies are chimeric antibodies,
wherein substantially less than an intact human variable domain has
been substituted by the corresponding sequence from a non-human
species.
[0164] Fully human antibodies comprising human variable regions in
addition to human framework and constant regions can also be used.
Such antibodies can be produced using various techniques known in
the art. For example in vitro methods involve use of recombinant
libraries of human antibody fragments displayed on bacteriophage
(e.g., Hoogenboom & Winter, J. Mol. Biol. 227:381 (1991),
Similarly, human antibodies can be made by introducing of human
immunoglobulin loci into transgenic animals, e.g., mice in which
the endogenous immunoglobulin genes have been partially or
completely inactivated. This approach is described, e.g., in U.S.
Pat. Nos. 6,150,584, 5,545,807; 5,545,806; 5,569,825; 5,625,126;
5,633,425; 5,661,016.
[0165] Antibodies obtained as above may be purified to homogeneity.
For example, the separation and purification of the antibody can be
performed according to separation and purification methods used for
general proteins. For example, the antibody may be separated and
isolated by the appropriately selected and combined use of column
chromatographies, such as affinity chromatography, filter,
ultrafiltration, salting-out, dialysis, SDS polyacrylamide gel
electrophoresis, isoelectric focusing, and others (Antibodies: A
Laboratory Manual. Ed Harlow and David Lane, Cold Spring Harbor
Laboratory (1988)), but are not limited thereto. A protein A column
and protein G column can be used as the affinity column. Exemplary
protein A columns to be used include, for example, Hyper D, POROS,
and Sepharose F.F. (Pharmacia).
[0166] Exemplary chromatography, with the exception of affinity
includes, for example, ion-exchange chromatography, hydrophobic
chromatography, gel filtration, reverse-phase chromatography,
adsorption chromatography, and the like (Strategies for Protein
Purification and Characterization: A Laboratory Course Manual. Ed
Daniel R. Marshak et al., Cold Spring Harbor Laboratory Press
(1996)). The chromatographic procedures can be carried out by
liquid-phase chromatography, such as HPLC and FPLC.
[0167] An immune complex can be precipitated, for example with
Protein A sepharose or Protein G sepharose when the antibody is a
mouse IgG antibody. If the KIF11, GHSR1b, NTSR1 or FOXM1
polypeptide is prepared as a fusion protein with an epitope, such
as GST, an immune complex can be formed in the same manner as in
the use of the antibody against the KIF11, GHSR1b, NTSR1 or FOXM1
polypeptide, using a substance specifically binding to these
epitopes, such as glutathione-Sepharose 4B.
[0168] Immunoprecipitation can be performed by following or
according to, for example, the methods in the literature (Harlow
and Lane, Antibodies, 511-52, Cold Spring Harbor Laboratory
publications, New York (1988)).
[0169] SDS-PAGE is commonly used for analysis of immunoprecipitated
proteins and the bound protein can be analyzed by the molecular
weight of the protein using gels with an appropriate concentration.
Since the protein bound to the KIF11, GHSR1b, NTSR1 or FOXM1
polypeptide is difficult to detect by a common staining method,
such as Coomassie staining or silver staining, the detection
sensitivity for the protein can be improved by culturing cells in
culture medium containing radioactive isotope, .sup.35S-methionine
or .sup.35S-cystein, labeling proteins in the cells, and detecting
the proteins. The target protein can be purified directly from the
SDS-polyacrylamide gel and its sequence can be determined, when the
molecular weight of the protein has been revealed.
[0170] As a method for screening proteins binding to any of KIF11,
GHSR1b, NTSR1, and FOXM1 polypeptides using the polypeptide, for
example, West-Western blotting analysis (Skolnik et al., Cell 65:
83-90 (1991)) can be used. Specifically, a protein binding to
KIF11, GHSR1b, NTSR1 or FOXM1 polypeptide can be obtained by
preparing a cDNA library from cells, tissues, organs (for example,
tissues such as lung cells) or cultured cells (particularly those
derived from NSCLC cells) expected to express a protein binding to
the KIF11, GHSR1b, NTSR1 or FOXM1 polypeptide using a phage vector
(e.g., ZAP), expressing the protein on LB-agarose, fixing the
protein expressed on a filter, reacting the purified and labeled
KIF11, GHSR1b, NTSR1 or FOXM1 polypeptide with the above filter,
and detecting the plaques expressing proteins bound to the KIF11,
GHSR1b, NTSR1 or FOXM1 polypeptide according to the label. The
KIF11, GHSR1b, NTSR1 or FOXM1 polypeptide may be labeled by
utilizing the binding between biotin and avidin, or by utilizing an
antibody that specifically binds to the KIF11, GHSR1b, NTSR1 or
FOXM1 polypeptide, or a peptide or polypeptide (for example, GST)
that is fused to the KIF11, GHSR1b, NTSR1 or FOXM1 polypeptide.
Methods using radioisotope or fluorescence and such may be also
used.
[0171] Alternatively, in another embodiment of the screening method
of the present invention, a two-hybrid system utilizing cells may
be used ("MATCHMAKER Two-Hybrid system", "Mammalian MATCHMAKER
Two-Hybrid Assay Kit", "MATCHMAKER one-Hybrid system" (Clontech);
"HybriZAP Two-Hybrid Vector System" (Stratagene); the references
"Dalton and Treisman, Cell 68: 597-612 (1992)", "Fields and
Sternglanz, Trends Genet 10: 286-92 (1994)").
[0172] In the two-hybrid system, KIF11, GHSR1b, NTSR1 or FOXM1
polypeptide is fused to the SRF-binding region or GAL4-binding
region and expressed in yeast cells. A cDNA library is prepared
from cells expected to express a protein binding to the KIF11,
GHSR1b, NTSR1 or FOXM1 polypeptide, such that the library, when
expressed, is fused to the VP16 or GAL4 transcriptional activation
region. The cDNA library is then introduced into the above yeast
cells and the cDNA derived from the library is isolated from the
positive clones detected (when a protein binding to the polypeptide
of the invention is expressed in yeast cells, the binding of the
two activates a reporter gene, making positive clones detectable).
A protein encoded by the cDNA can be prepared by introducing the
cDNA isolated above to E. coli and expressing the protein.
[0173] As a reporter gene, for example, Ade2 gene, lacZ gene, CAT
gene, luciferase gene and such can be used in addition to the HIS3
gene.
[0174] A compound binding to KIF11, GHSR1b, NTSR1 or FOXM1
polypeptide can also be screened using affinity chromatography. For
example, KIF11, GHSR1b, NTSR1 or FOXM1 polypeptide may be
immobilized on a carrier of an affinity column, and a test
compound, containing a protein capable of binding to KIF11, GHSR1b,
NTSR1 or FOXM1 polypeptide, is applied to the column. A test
compound herein may be, for example, cell extracts, cell lysates,
etc. After loading the test compound, the column is washed, and
compounds bound to KIF11, GHSR1b, NTSR1 or FOXM1 polypeptide can be
prepared.
[0175] When the test compound is a protein, the amino acid sequence
of the obtained protein is analyzed, an oligo DNA is synthesized
based on the sequence, and cDNA libraries are screened using the
oligo DNA as a probe to obtain a DNA encoding the protein.
[0176] A biosensor using the surface plasmon resonance phenomenon
may be used as a mean for detecting or quantifying the bound
compound in the present invention. When such a biosensor is used,
the interaction between KIF11, GHSR1b, NTSR1 or FOXM1 polypeptide
and a test compound can be observed real-time as a surface plasmon
resonance signal, using only a minute amount of polypeptide and
without labeling (for example, BIAcore, Pharmacia). Therefore, it
is possible to evaluate the binding between KIF11, GHSR1b, NTSR1 or
FOXM1 polypeptide and a test compound using a biosensor such as
BIAcore.
[0177] The methods of screening for molecules that bind when an
immobilized KIF11, GHSR1b, NTSR1 or FOXM1 polypeptide is exposed to
synthetic chemical compounds, or natural substance banks or a
random phage peptide display library, and the methods of screening
using high-throughput based on combinatorial chemistry techniques
(Wrighton et al., Science 273: 458-64 (1996); Verdine, Nature 384:
11-13 (1996); Hogan, Nature 384: 17-9 (1996)) to isolate not only
proteins but chemical compounds that bind to KIF11, GHSR1b, NTSR1
or FOXM1 protein (including agonist and antagonist) are well known
to one skilled in the art.
[0178] Alternatively, the present invention provides a method of
screening for a compound for treating or preventing NSCLC using
KIF11, GHSR1b, NTSR1 or FOXM1 polypeptide comprising the steps as
follows: [0179] (a) contacting a test compound with KIF11, GHSR1b,
NTSR1 or FOXM1 polypeptide; [0180] (b) detecting the biological
activity of the KIF11, GHSR1b, NTSR1 or FOXM1 polypeptide of step
(a); and [0181] (c) selecting a compound that suppresses the
biological activity of the KIF11, GHSR1b, NTSR1 or FOXM1
polypeptide in comparison with the biological activity detected in
the absence of the test compound.
[0182] Since proteins encoded by any of the genes of KIF11, GHSR1b,
NTSR1, and FOXM1 have the activity of promoting cell proliferation
of NSCLC cells, a compound which inhibits this activity of one of
these proteins can be screened using this activity as an index.
[0183] Any polypeptides can be used for screening so long as they
comprise the biological activity of KIF11, GHSR1b, NTSR1 or FOXM1
proteins. Such biological activity includes cell-proliferating
activity and binding ability to other proteins of the proteins
encoded by KIF11, GHSR1b, NTSR1 or FOXM1 gene. For example, a human
protein encoded by KIF11, GHSR1b, NTSR1 or FOXM1 gene can be used
and polypeptides functionally equivalent to these proteins can also
be used. Such polypeptides may be expressed endogenously or
exogenously by cells.
[0184] The compound isolated by this screening is a candidate for
antagonists of the KIF11, GHSR1b, NTSR1 or FOXM1 polypeptide. The
term "antagonist" refers to molecules that inhibit the function of
KIF11, GHSR1b, NTSR1 or FOXM1 polypeptide by binding thereto.
Moreover, a compound isolated by this screening is a candidate for
compounds which inhibit the in vivo interaction of KIF11, GHSR1b,
NTSR1 or FOXM1 polypeptide with molecules (including DNAs and
proteins).
[0185] When the biological activity to be detected in the present
method is cell proliferation, it can be detected, for example, by
preparing cells which express KIF11, GHSR1b, NTSR1 or FOXM1
polypeptide, culturing the cells in the presence of a test
compound, and determining the speed of cell proliferation,
measuring the cell cycle and such, as well as by measuring the
colony forming activity.
[0186] As discussed in detail above, by controlling the expression
levels of KIF11, GHSR1b, NTSR1 or FOXM1 gene, one can control the
onset and progression of NSCLC. Thus, compounds that may be used in
the treatment or prevention of NSCLC, can be identified through
screenings that use the expression levels of one or more of KIF11,
GHSR1b, NTSR1, and FOXM1 genes as indices. In the context of the
present invention, such screening may comprise, for example, the
following steps: [0187] (a) contacting a test compound with a cell
expressing one or more of KIF11, GHSR1b, NTSR1, and FOXM1 genes;
and [0188] (b) selecting a compound that reduces the expression
level of one or more of the genes in comparison with the expression
level detected in the absence of the test compound.
[0189] Cells expressing at least one of KIF11, GHSR1b, NTSR1, and
FOXM1 genes include, for example, cell lines established from NSCLC
cells; such cells can be used for the above screening of the
present invention (e.g., A549, NCI-H226, NCI-H522, LC319). The
expression level can be estimated by methods well known to one
skilled in the art. In the method of screening, a compound that
reduces the expression level of at least one of the genes can be
selected as candidate agents to be used for the treatment or
prevention of NSCLC.
[0190] Alternatively, the screening method of the present invention
may comprise the following steps: [0191] (a) contacting a test
compound with a cell into which a vector comprising the
transcriptional regulatory region of one or more of the marker
genes and a reporter gene that is expressed under the control of
the transcriptional regulatory region has been introduced, wherein
the marker genes are selected from the group of KIF11, GHSR1b,
NTSR1, and FOXM1; [0192] (b) measuring the activity of said
reporter gene; and [0193] (c) selecting a compound that reduces the
expression level of said reporter gene as compared to a
control.
[0194] Suitable reporter genes and host cells are well known in the
art. The reporter construct required for the screening can be
prepared using the transcriptional regulatory region of a marker
gene. When the transcriptional regulatory region of a marker gene
has been known to those skilled in the art, a reporter construct
can be prepared using the previous sequence information. When the
transcriptional regulatory region of a marker gene remains
unidentified, a nucleotide segment containing the transcriptional
regulatory region can be isolated from a genome library based on
the nucleotide sequence information of the marker gene (e.g., based
the 5' upstream sequence information).
[0195] In a further embodiment of the method of screening for a
compound for treating or preventing NSCLC of the present invention,
the method utilizes the binding ability of KIF11 to KOC1, or GHSR1b
or NTSR1 to NMU.
[0196] As described above, the present inventors revealed that KOC1
not only co-localized with KIF11 in human normal tissues, NSCLCs,
and cell lines, but also directly interacted with KIF11 in NSCLC
cells in vitro, and that the treatment of NSCLC cells with siRNAs
for KIF11 reduced its expression and led to growth suppression. The
results suggest that KOC1-KIF11 signaling affects growth of NSCLC
cells. Thus, it is expected that the inhibition of the binding
between KOC1 and KIF11 leads to the suppression of cell
proliferation, and compounds inhibiting the binding serve as
pharmaceuticals for treating or preventing NSCLCs. This screening
method includes the steps of: (a) contacting a KIF11 polypeptide or
functional equivalent thereof with KOC1, or a functional equivalent
thereof, in the presence of a test compound; (b) detecting the
binding between the polypeptide and KOC1; and (c) selecting the
test compound that inhibits the binding between the polypeptide and
KOC1.
[0197] Furthermore, as described above, the present inventors
revealed GHSR1b and NTSR1 as the likely targets for the
growth-promoting effect of NMU in lung tumors. The present
inventors revealed that NMU-25 bound to these receptors on the cell
surface, and that treatment of NSCLC cells with siRNAs for GHSR1 or
NTSR1 reduced expression of the receptors and led to apoptosis. The
results suggest that NMU affects growth of NSCLC cells by acting
through GHSR1b and/or NTSR1 (FIG. 14). Thus, it is expected that
the inhibition of binding between GHSR1b or NTSR1 and NMU leads to
the suppression of cell proliferation, and compounds inhibiting the
binding serve as pharmaceuticals for treating or preventing NSCLCs.
This screening method includes the steps of: (a) contacting a
GHSR1b or NTSR1 polypeptide or functional equivalent thereof with
NMU in the presence of a test compound; (b) detecting binding
between the polypeptide and NMU; and (c) selecting the test
compound that inhibits binding between the polypeptide and NMU.
[0198] KOC1 and KIF11 polypeptides, or GHSR1b or NTSR1 and NMU
polypeptides to be used for the screening may be a recombinant
polypeptide or a protein derived from the nature, or may also be a
partial peptide thereof so long as it retains the binding ability
to each other. Such partial peptides retaining the binding ability
are herein referred to as "functional equivalents". The KOC1 and
KIF11 polypeptides, or GHSR1b or NTSR1 and NMU polypeptides to be
used in the screening can be, for example, a purified polypeptide,
a soluble protein, a form bound to a carrier or a fusion protein
fused with other polypeptides.
[0199] As a method of screening for compounds that inhibit binding
between KOC1 and KIF11, or GHSR1b or NTSR1 and NMU, many methods
well known by one skilled in the art can be used. Such a screening
can be carried out as an in vitro assay system, for example, in a
cellular system. More specifically, first, either KOC1 or KIF11, or
GHSR1b or NTSR1, or NMU is bound to a support, and the other
protein is added together with a test compound thereto. Next, the
mixture is incubated, washed and the other protein bound to the
support is detected and/or measured.
[0200] Examples of supports that may be used for binding proteins
include insoluble polysaccharides, such as agarose, cellulose and
dextran; and synthetic resins, such as polyacrylamide, polystyrene
and silicon; preferably commercial available beads and plates
(e.g., multi-well plates, biosensor chip, etc.) prepared from the
above materials may be used. When using beads, they may be filled
into a column. Alternatively, the use of magnetic beads of also
known in the art, and enables to readily isolate proteins bound on
the beads via magnetism.
[0201] The binding of a protein to a support may be conducted
according to routine methods, such as chemical bonding and physical
adsorption. Alternatively, a protein may be bound to a support via
antibodies specifically recognizing the protein. Moreover, binding
of a protein to a support can be also conducted by means of avidin
and biotin.
[0202] The binding between proteins is carried out in buffer, for
example, but are not limited to, phosphate buffer and Tris buffer,
as long as the buffer does not inhibit binding between the
proteins.
[0203] In the present invention, a biosensor using the surface
plasmon resonance phenomenon may be used as a mean for detecting or
quantifying the bound protein. When such a biosensor is used, the
interaction between the proteins can be observed real-time as a
surface plasmon resonance signal, using only a minute amount of
polypeptide and without labeling (for example, BIAcore, Pharmacia).
Therefore, it is possible to evaluate binding between the KOC1 and
KIF11, or GHSR1b or NTSR1 and NMU using a biosensor such as
BIAcore.
[0204] Alternatively, either KOC1 or KIF11, or GHSR1b or NTSR1, or
NMU may be labeled, and the label of the bound protein may be used
to detect or measure the bound protein. Specifically, after
pre-labeling one of the proteins, the labeled protein is contacted
with the other protein in the presence of a test compound, and then
bound proteins are detected or measured according to the label
after washing.
[0205] Labeling substances such as radioisotope (e.g., .sup.3H,
.sup.14C, .sup.32P, .sup.33P, .sup.35S, .sup.125I, .sup.131I),
enzymes (e.g., alkaline phosphatase, horseradish peroxidase,
.beta.-galactosidase, .beta.-glucosidase), fluorescent substances
(e.g., fluorescein isothiosyanete (FITC), rhodamine) and
biotin/avidin, may be used for the labeling of a protein in the
present method. When the protein is labeled with radioisotope, the
detection or measurement can be carried out by liquid
scintillation. Alternatively, proteins labeled with enzymes can be
detected or measured by adding a substrate of the enzyme to detect
the enzymatic change of the substrate, such as generation of color,
with absorptiometer. Further, in case where a fluorescent substance
is used as the label, the bound protein may be detected or measured
using fluorophotometer.
[0206] Furthermore, binding of KOC1 and KIF11, or GHSR1b or NTSR1
and NMU can be also detected or measured using antibodies to the
KOC1 and KIF11, or GHSR1b or NTSR1 and NMU. For example, after
contacting the KOC1 polypeptide immobilized on a support with a
test compound and KIF11, the mixture is incubated and washed, and
detection or measurement can be conducted using an antibody against
KIF11. Alternatively, KIF11 may be immobilized on a support, and an
antibody against KOC1 may be used as the antibody. When the
combination of GHSR1b or NTSR1 and NMU is used, GHSR1b or NTSR1
polypeptide may be immobilized on a support with a test compound
and NMU, the mixture is incubated and washed, and detection or
measurement can be conducted using an antibody against NMU.
Alternatively, NMU may be immobilized on a support, and an antibody
against GHSR1b or NTSR1 may be used as the antibody.
[0207] In case of using an antibody in the present screening, the
antibody is preferably labeled with one of the labeling substances
mentioned above, and detected or measured based on the labeling
substance. Alternatively, the antibody against KOC1 or KIF11, or
GHSR1b or NTSR1, or NMU may be used as a primary antibody to be
detected with a secondary antibody that is labeled with a labeling
substance. Furthermore, the antibody bound to the protein in the
screening of the present invention may be detected or measured
using protein G or protein A column.
[0208] Alternatively, in another embodiment of the screening method
of the present invention, a two-hybrid system utilizing cells may
be used ("MATCHMAKER Two-Hybrid system", "Mammalian MATCHMAKER
Two-Hybrid Assay Kit", "MATCHMAKER one-Hybrid system" (Clontech);
"HybriZAP Two-Hybrid Vector System" (Stratagene); the references
"Dalton and Treisman, Cell 68: 597-612 (1992)", "Fields and
Sternglanz, Trends Genet 10: 286-92 (1994)").
[0209] In the two-hybrid system, for example, KOC1 polypeptide is
fused to the SRF-binding region or GAL4-binding region and
expressed in yeast cells. KIF11 polypeptide that binds to KOC1
polypeptide is fused to the VP16 or GAL4 transcriptional activation
region and also expressed in the yeast cells in the existence of a
test compound. Alternatively, KIF11 polypeptide may be fused to the
SRF-binding region or GAL4-binding region, and KOC1 polypeptide to
the VP16 or GAL4 transcriptional activation region. When the
combination of GHSR1b or NTSR1 and NMU is used in the two-hybrid
system, for example, GHSR1b or NTSR1 polypeptide is fused to the
SRF-binding region or GAL4-binding region and expressed in yeast
cells. NMU polypeptide that binds to GHSR1b or NTSR1 polypeptide is
fused to the VP16 or GAL4 transcriptional activation region and
also expressed in the yeast cells in the existence of a test
compound. Alternatively, NMU polypeptide may be fused to the
SRF-binding region or GAL4-binding region, and GHSR1b or NTSR1
polypeptide to the VP16 or GAL4 transcriptional activation region.
When the test compound does not inhibit the binding between KOC1
and KIF11, or GHSR1b or NTSR1 and NMU, the binding of the two
activates a reporter gene, making positive clones detectable.
[0210] As a reporter gene, for example, Ade2 gene, lacZ gene, CAT
gene, luciferase gene and such can be used besides HIS3 gene.
[0211] Moreover, when the combination of GHSR1b or NTSR1 and NMU is
used in the screening method, since GHSR1b and NTSR1 are
polypeptides naturally expressed on the cell surface, in a
preferable embodiment of the present screening method, the
polypeptides are expressed on the surface of a living cell. When
the polypeptides are expressed on the surface of a living cell, the
binding between the polypeptide and NMU can be detected by methods
detecting the autocrine and paracrine signaling leading to
stimulation of tumor cell growth (Heasley, Oncogene 20: 1563-1569
(2001)). For example, the binding between GHSR1 or NTSR1
polypeptide and NMU can be detected by: [0212] (1) detecting the
concentration of calcium or cAMP in the cell (e.g. FLIPR assay,
Biochem. Biophys. Res. Commun. 276: 435-438, 2000; Nature 406:
70-74, 2000; J. Biol. Chem. 275:21068-21074, 2000); [0213] (2)
detecting the activation of the polypeptide; [0214] (3) detecting
the interaction between the polypeptide and G-protein (e.g. FLIPR
assay, Biochem. Biophys. Res. Commun. 276: 435-438, 2000; Nature
406: 70-74, 2000; J. Biol. Chem. 275:21068-21074, 2000, or binding
assay with .sup.125I labeled peptide); [0215] (4) detecting the
activation of phospholipase C or its down stream pathway (Oncogene
20:1563-1569, 2001); [0216] (5) detecting the activation of kinases
of the protein kinase cascade, such as Raf, MEK, ERKs, and protein
kinase D (PKD) (Oncogene 20:1563-1569, 2001); [0217] (6) detecting
the activation of a member of Src/Tec/Bmx-family of tyrosine
kinases (Oncogene 20:1563-1569, 2001); [0218] (7) detecting the
activation of a member of the Ras and Rho family, regulation of a
member of the JNK members of MAP families, or the reorganization of
the actin cytoskeleton (Oncogene 20:1563-1569, 2001); [0219] (8)
detecting the activation of any signal complex mediated by the
polypeptide activation; [0220] (9) detecting the change in
subcellular localization of the polypeptide including the
ligand-induced internalization/endocytosis of the polypeptide (J.
Cell Sci., 113: 2963-2975, 2000; J. Histochem. Cytochem.
48:1553-1563, 2000; Endocrinology Oct. 23, 2003. as doi: 10.
1210/en. 2003-0974); [0221] (10) detecting the activation of any
transcription factor downstream of the polypeptides or the
activation of their downstream gene; and [0222] (11) detecting cell
proliferation, transformation, or any other oncogenic phenotype of
the cell.
[0223] Any test compound, for example, cell extracts, cell culture
supernatant, products of fermenting microorganism, extracts from
marine organism, plant extracts, purified or crude proteins,
peptides, non-peptide compounds, synthetic micromolecular compounds
and natural compounds can be used in the screening methods of the
present invention. The test compound of the present invention can
be also obtained using any of the numerous approaches in
combinatorial library methods known in the art, including (1)
biological libraries, (2) spatially addressable parallel solid
phase or solution phase libraries, (3) synthetic library methods
requiring deconvolution, (4) the "one-bead one-compound" library
method and (5) synthetic library methods using affinity
chromatography selection. The biological library methods using
affinity chromatography selection is limited to peptide libraries,
while the other four approaches are applicable to peptide,
non-peptide oligomer or small molecule libraries of compounds (Lam,
Anticancer Drug Des. 12: 145 (1997)). Examples of methods for the
synthesis of molecular libraries can be found in the art (DeWitt et
al., Proc. Natl. Acad. Sci. USA 90: 6909 (1993); Erb et al., Proc.
Natl. Acad. Sci. USA 91: 11422 (1994); Zuckermann et al., J. Med.
Chem. 37: 2678 (1994); Cho et al., Science 261: 1303 (1993); Carell
et al., Angew. Chem. Int. Ed. Engl. 33: 2059 (1994); Carell et al.,
Angew. Chem. Int. Ed. Engl. 33: 2061 (1994); Gallop et al., J. Med.
Chem. 37: 1233 (1994)). Libraries of compounds may be presented in
solution (see Houghten, Bio/Techniques 13: 412 (1992)) or on beads
(Lam, Nature 354: 82 (1991)), chips (Fodor, Nature 364: 555
(1993)), bacteria (U.S. Pat. No. 5,223,409), spores (U.S. Pat. No.
5,571,698;5,403,484, and 5,223,409), plasmids (Cull et al., Proc.
Natl. Acad. Sci. USA 89: 1865 (1992)) or phage (Scott and Smith,
Science 249: 386 (1990); Delvin, Science 249: 404 (1990); Cwirla et
al., Proc. Natl. Acad. Sci. USA 87: 6378 (1990); Felici, J. Mol.
Biol. 222: 301 (1991); US Pat. Application 2002103360). The test
compound exposed to a cell or protein according to the screening
methods of the present invention may be a single compound or a
combination of compounds. When a combination of compounds are used
in the screening methods of the invention, the compounds may be
contacted sequentially or simultaneously.
[0224] A compound isolated by the screening methods of the present
invention is a candidate for drugs which inhibit the activity of
KIF11, GHSR1b, NTSR1 or FOXM1 polypeptide, for treating or
preventing diseases attributed to, for example, cell proliferative
diseases, such as NSCLC. A compound in which a part of the
structure of the compound obtained by the present screening methods
of the present invention is converted by addition, deletion and/or
replacement, is included in the compounds obtained by the screening
methods of the present invention. A compound effective in
suppressing the expression of over-expressed genes, i.e., KIF11,
GHSR1b, NTSR1 or FOXM1 gene, is deemed to have a clinical benefit
and can be further tested for its ability to prevent cancer cell
growth in animal models or test subjects.
Selecting a Therapeutic Agent for Treating and/or Preventing NSCLC
that is Appropriate for a Particular Individual
[0225] Differences in the genetic makeup of individuals can result
in differences in their relative abilities to metabolize various
drugs. A compound that is metabolized in a subject to act as an
anti-NSCLC agent can manifest itself by inducing a change in gene
expression pattern in the subject's cells from that characteristic
of a cancerous state to a gene expression pattern characteristic of
a non-cancerous state. Accordingly, the differentially expressed
KIF11, GHSR1b, NTSR1, and FOXM1 genes disclosed herein allow for
selection of a putative therapeutic or prophylactic inhibitor of
NSCLC specifically adequate for a subject by testing candidate
compounds in a test cell (or test cell population) derived from the
selected subject.
[0226] To identify an anti-NSCLC agent, that is appropriate for a
specific subject, a test cell or test cell population derived from
the subject is exposed to a therapeutic agent and the expression of
one or more of the KIF11, GHSR1b, NTSR1, and FOXM1 genes is
determined.
[0227] The test cell is or the test cell population contains an
NSCLC cell expressing an NSCLC-associated gene. Preferably, the
test cell is or the test cell population contains a lung cell. For
example, the test cell or test cell population is incubated in the
presence of a candidate agent and the pattern of gene expression of
the test cell or cell population is measured and compared to one or
more reference profiles, e.g., an NSCLC reference expression
profile or an non-NSCLC reference expression profile.
[0228] A decrease in the expression of one or more of KIF11,
GHSR1b, NTSR1, and FOXM1 in a test cell or test cell population
relative to a reference cell population containing NSCLC is
indicative that the agent is therapeutic.
[0229] The test agent can be any compound or composition. For
example, the test agent is an immunomodulatory agent.
Methods for Treating or Preventing NSCLC
[0230] The present invention provides a method for treating,
alleviating or preventing NSCLC in a subject. Therapeutic compounds
are administered prophylactically or therapeutically to subjects
suffering from or at risk of (or susceptible to) developing NSCLC.
Such subjects are identified using standard clinical methods or by
detecting an aberrant level of expression or activity of KIF11,
GHSR1b, NTSR1 or FOXM1 gene or polypeptide. Prophylactic
administration occurs prior to the manifestation of overt clinical
symptoms of disease, such that a disease or disorder is prevented
or alternatively delayed in its progression.
[0231] The method includes decreasing the expression or function,
or both, of one or more gene products of genes whose expression is
aberrantly increased ("over-expressed gene"; KIF11, GHSR1b, NTSR1
or FOXM1 gene) in an NSCLC cell relative to normal cells of the
same tissue type from which the NSCLC cells are derived. The
expression may be inhibited by any method known in the art. For
example, a subject may be treated with an effective amount of a
compound that decreases the amount of one or more of the KIF11,
GHSR1b, NTSR1 or FOXM1 gene in the subject. Administration of the
compound can be systemic or local. Such therapeutic compounds
include compounds that decrease the expression level of such gene
that endogenously exists in the NSCLC cells (i.e., compounds that
down-regulate the expression of the over-expressed gene(s), KIF11,
GHSR1b and/or NTSR1 genes). The administration of such therapeutic
compounds counter the effects of aberrantly-over expressed gene(s)
in the subjects NSCLC cells and are expected to improve the
clinical condition of the subject. Such compounds can be obtained
by the screening method of the present invention described
above.
[0232] The compounds that modulate the activity of a protein
encoded by KIF11, GHSR1b, NTSR1 or FOXM1 gene that can be used for
treating or preventing NSCLC of the present invention include
besides proteins, naturally-occurring cognate ligand of these
proteins, peptides, peptidomimetics and other small molecules.
[0233] Alternatively, the expression of these over-expressed
gene(s) (KIF11, GHSR1b, NTSR1 and/or FOXM1) can be inhibited by
administering to the subject a nucleic acid that inhibits or
antagonizes the expression of the over-expressed gene(s). Antisense
oligonucleotides, siRNAs or ribozymes which disrupt the expression
of the over-expressed gene(s) can be used for inhibiting the
expression of the over-expressed gene(s).
[0234] As noted above, antisense-oligonucleotides corresponding to
any of the nucleotide sequence of KIF11, GHSR1b, NTSR1 or FOXM1
gene can be used to reduce the expression level of the gene.
Antisense-oligonucleotides corresponding to KIF11, GHSR1b, NTSR1,
and FOXM1 genes that are up-regulated in NSCLC are useful for the
treatment or prevention of NSCLC. Specifically, the
antisense-oligonucleotides against the genes may act by binding to
any of the corresponding polypeptides encoded by these genes, or
mRNAs corresponding thereto, thereby inhibiting the transcription
or translation of the genes, promoting the degradation of the
mRNAs, and/or inhibiting the expression of proteins encoded by the
KIF11, GHSR1b, NTSR1, and FOXM1 nucleotides, and finally inhibiting
the function of the proteins. The term "antisense-oligonucleotides"
as used herein encompasses both nucleotides that are entirely
complementary to the target sequence and those having a mismatch of
one or more nucleotides, so long as the antisense-oligonucleotides
can specifically hybridize to the target sequence. For example, the
antisense-oligonucleotides of the present invention include
polynucleotides that have a homology (also referred to as sequence
identity) of at least 70% or higher, preferably at 80% or higher,
more preferably 90% or higher, even more preferably 95% or higher
over a span of at least 15 continuous nucleotides up to the full
length sequence of any of the nucleotide sequences of KIF11,
GHSR1b, NTSR1 or FOXM1 gene. Algorithms known in the art can be
used to determine the homology. Furthermore, derivatives or
modified products of the antisense-oligonucleotides can also be
used as antisense-oligonucleotides in the present invention.
Examples of such modified products include lower alkyl phosphonate
modifications such as methyl-phosphonate-type or
ethyl-phosphonate-type, phosphorothioate modifications and
phosphoroamidate modifications.
[0235] siRNA molecules of the invention can also be defined by
their ability to hybridize specifically to mRNA or cDNA from the
genes disclosed here. For the purposes of this invention the terms
"hybridize" or "hybridize specifically" are used to refer the
ability of two nucleic acid molecules to hybridize under "stringent
hybridization conditions." The phrase "stringent hybridization
conditions" refers to conditions under which a nucleic acid
molecule will hybridize to its target sequence, typically in a
complex mixture of nucleic acids, but not detectably to other
sequences. Stringent conditions are sequence-dependent and will be
different in different circumstances. Longer sequences hybridize
specifically at higher temperatures. An extensive guide to the
hybridization of nucleic acids is found in Tijssen, Techniques in
Biochemistry and Molecular Biology--Hybridization with Nucleic
Probes, "Overview of principles of hybridization and the strategy
of nucleic acid assays" (1993). Generally, stringent conditions are
selected to be about 5-10.degree. C. lower than the thermal melting
point (T.sub.m) for the specific sequence at a defined ionic
strength pH. The T.sub.m is the temperature (under defined ionic
strength, pH, and nucleic concentration) at which 50% of the probes
complementary to the target hybridize to the target sequence at
equilibrium (as the target sequences are present in excess, at
T.sub.m, 50% of the probes are occupied at equilibrium). Stringent
conditions may also be achieved with the addition of destabilizing
agents such as formamide. For selective or specific hybridization,
a positive signal is at least two times background, preferably 10
times background hybridization. Exemplary stringent hybridization
conditions can be as following: 50% formamide, 5.times.SSC, and 1%
SDS, incubating at 42.degree. C., or, 5.times.SSC, 1% SDS,
incubating at 65.degree. C., with wash in 0.2.times.SSC, and 0.1%
SDS at 50.degree. C. The antisense-oligonucleotides and derivatives
thereof act on cells producing the proteins encoded by KIF11,
GHSR1b, NTSR1 or FOXM1 gene by binding to the DNA or mRNA encoding
the protein, inhibiting transcription or translation thereof,
promoting the degradation of the mRNAs and inhibiting the
expression of the protein, thereby resulting in the inhibition of
the protein function.
[0236] An antisense-oligonucleotides and derivatives thereof can be
made into an external preparation, such as a liniment or a
poultice, by mixing with a suitable base material which is inactive
against the derivative.
[0237] The antisense-oligonucleotides of the invention inhibit the
expression of at least one protein encoded by any one of KIF11,
GHSR1b, NTSR1, and FOXM1 genes, and thus are useful for suppressing
the biological activity of the protein.
[0238] The polynucleotides that inhibit one or more gene products
of over-expressed genes also include small interfering RNAs (siRNA)
comprising a combination of a sense strand nucleic acid and an
antisense strand nucleic acid of the nucleotide sequence encoding
an over-expressed protein encoded by KIF11, GHSR1b, NTSR1 or FOXM1
gene. The term "siRNA" refers to a double stranded RNA molecule
which prevents translation of a target mRNA. Standard techniques of
introducing siRNA into the cell can be used in the treatment or
prevention of the present invention, including those in which DNA
is a template from which RNA is transcribed. The siRNA is
constructed such that a single transcript has both the sense and
complementary antisense sequences from the target gene, e.g., a
hairpin.
[0239] The method is used to suppress gene expression of a cell
with up-regulated expression of KIF11, GHSR1b, NTSR1 or FOXM1 gene.
Binding of the siRNA to KIF11, GHSR1b, NTSR1 or FOXM1 gene
transcript in the target cell results in a reduction of KIF11,
GHSR1b, NTSR1 or FOXM1 protein production by the cell. The length
of the oligonucleotide is at least about 10 nucleotides and may be
as long as the naturally occurring transcript. Preferably, the
oligonucleotide is about 19 to about 25 nucleotides in length. Most
preferably, the oligonucleotide is less than about 75, about 50 or
about 25 nucleotides in length. Preferable siRNA of the present
invention include the polynucleotides having the nucleotide
sequence of SEQ ID NO: 32, 33, 34, 35, 36, 37, or 108 as the target
sequence, which all proved to be effective for suppressing cell
viability of NSCLC cell lines. Specifically, a preferable siRNA
used in the present invention has the general formula:
5'-[A]-[B]-[A']-3'
wherein [A] is a ribonucleotide sequence corresponding to a target
sequence of KIF11, GHSR1b, NTSR1 or FOXM1; [B] is a ribonucleotide
sequence consisting of about 3 to about 23 nucleotides; and [A'] is
a ribonucleotide sequence complementary to [A]. Herein, the phrase
a "target sequence of KIF11, GHSR1b, NTSR1 or FOXM1 gene" refers to
a sequence that, when introduced into NSCLC cell lines, is
effective for suppressing cell viability. Preferred target sequence
of KIF11, GHSR1b, NTSR1 or FOXM1 gene includes nucleotide sequences
comprising: SEQ ID NOs: 32, 33, 34, 35, 36, 37, and 108. The
complementary sequence [A'] and [A] hybridize to each other to form
a double strand, and the whole siRNA molecule with the general
formula 5'-[A]-[B]-[A]-3' forms a hairpin loop structure. As used
herein, the term "complementary" refers to a Watson-Crick or
Hoogsteen base pairing between nucleotide units of a
polynucleotide, and hybridization or binding of nucleotide units
indicates physical or chemical interaction between the units under
appropriate conditions to form a stable duplex (double-stranded
configuration) containing few or no mismatches. In a preferred
embodiment, such duplexes contain no more than 1 mismatch for every
10 base pairs. Particularly preferred duplexes are fully
complementary and contain no mismatch. The siRNA against the mRNA
of KIF11, GHSR1b, NTSR1 or FOXM1 gene to be used in the present
invention contains a target sequence shorter than the whole mRNA of
KIF11, GHSR1b, NTSR1 or FOXM1 gene, and has a sequence of 500, 200,
or 75 nucleotides as the whole length. Also included in the
invention is a vector containing one or more of the nucleic acids
described herein, and a cell containing the vectors. The isolated
nucleic acids of the present invention are useful for siRNA against
KIF11, GHSR1b, NTSR1 or FOXM1 or DNA encoding the siRNA. When the
nucleic acids are used for siRNA or coding DNA thereof, the sense
strand is preferably longer than about 19 nucleotides, and more
preferably longer than about 21 nucleotides.
[0240] Furthermore, the nucleotide sequence of siRNAs may be
designed using a siRNA design computer program available from the
Ambion website (found on the World Wide Web at
ambion.com/techlib/misc/siRNA_finder.html). The nucleotide
sequences for the siRNA are selected by the computer program based
on the following protocol:
Selection of siRNA Target Sites: [0241] 1. Beginning with the AUG
start codon of the transcript, scan downstream for AA dinucleotide
sequences. Record the occurrence of each AA and the 3' adjacent 19
nucleotides as potential siRNA target sites. Tuschl, et al. Genes
Dev 13(24): 3191-7 (1999), not recommend against designing siRNA
against the 5' and 3' untranslated regions (UTRs) and regions near
the start codon (within 75 bases) as these may be richer in
regulatory protein binding sites, and thus the complex of
endonuclease and siRNAs that were designed against these regions
may interfere with the binding of UTR-binding proteins and/or
translation initiation complexes. [0242] 2. Compare the potential
target sites to the human genome database and eliminate from
consideration any target sequences with significant homology to
other coding sequences. The homology search can be performed using
BLAST, which can be found on the NCBI server at:
www.ncbi.nlm.nih.gov/BLAST/3. [0243] 3. Select qualifying target
sequences for synthesis. On the website of Ambion, several
preferable target sequences can be selected along the length of the
gene for evaluation.
[0244] The siRNAs inhibit the expression of over-expressed KIF11,
GHSR1b, NTSR1 or FOXM1 protein and is thereby useful for
suppressing the biological activity of the protein. Therefore, a
composition comprising the siRNA is useful in treating or
preventing non-small cell lung cancer.
[0245] The nucleic acids that inhibit one or more gene products of
over-expressed genes KIF11, GHSR1b, NTSR1, and FOXM1 also include
ribozymes against the gene(s).
[0246] The ribozymes inhibit the expression of over-expressed
KIF11, GHSR1b, NTSR1 or FOXM1 protein and is thereby useful for
suppressing the biological activity of the protein. Therefore, a
composition comprising the ribozyme is useful in treating or
preventing NSCLC.
[0247] Generally, ribozymes are classified into large ribozymes and
small ribozymes. A large ribozyme is known as an enzyme that
cleaves the phosphate ester bond of nucleic acids. After the
reaction with the large ribozyme, the reacted site consists of a
5'-phosphate and 3'-hydroxyl group. The large ribozyme is further
classified into (1) group I intron RNA catalyzing
transesterification at the 5'-splice site by guanosine; (2) group
II intron RNA catalyzing self-splicing through a two step reaction
via lariat structure; and (3) RNA component of the ribonuclease P
that cleaves the tRNA precursor at the 5' site through hydrolysis.
On the other hand, small ribozymes have a smaller size (about 40
bp) compared to the large ribozymes and cleave RNAs to generate a
5'-hydroxyl group and a 2'-3' cyclic phosphate. Hammerhead type
ribozymes (Koizumi et al., FEBS Lett. 228: 225 (1988)) and hairpin
type ribozymes (Buzayan, Nature 323: 349 (1986); Kikuchi and
Sasaki, Nucleic Acids Res. 19: 6751 (1992)) are included in the
small ribozymes. Methods for designing and constructing ribozymes
are known in the art (see Koizumi et al., FEBS Lett. 228: 225
(1988); Koizumi et al., Nucleic Acids Res. 17: 7059 (1989); Kikuchi
and Sasaki, Nucleic Acids Res. 19: 6751 (1992)) and ribozymes
inhibiting the expression of an over-expressed NSC protein can be
constructed based on the sequence information of the nucleotide
sequence encoding KIF11, GHSR1b, NTSR1 or FOXM1 protein according
to conventional methods for producing ribozymes.
[0248] The ribozymes inhibit the expression of over-expressed
KIF11, GHSR1b, NTSR1 or FOXM1 protein and is thereby useful for
suppressing the biological activity of the protein. Therefore, a
composition comprising the ribozyme is useful in treating or
preventing NSCLC.
[0249] Alternatively, the function of one or more gene products of
the over-expressed genes is inhibited by administering a compound
that binds to or otherwise inhibits the function of the gene
products. For example, the compound is an antibody which binds to
the over-expressed gene product or gene products.
[0250] The present invention refers to the use of antibodies,
particularly antibodies against a protein encoded by any of the
up-regulated genes KIF11, GHSR1b, NTSR1 or FOXM1, or a fragment of
the antibody. As used herein, the term "antibody" refers to an
immunoglobulin molecule having a specific structure that interacts
(binds) specifically with a molecule comprising the antigen used
for synthesizing the antibody (i.e., the up-regulated gene product)
or with an antigen closely related to it. An antibody that binds to
the over-expressed KIF11, GHSR1b, NTSR1 or FOXM1 nucleotide may be
in any form, such as monoclonal or polyclonal antibodies, and
includes antiserum obtained by immunizing an animal such as a
rabbit with the polypeptide, all classes of polyclonal and
monoclonal antibodies, human antibodies and humanized antibodies
produced by genetic recombination. Furthermore, the antibody used
in the method of treating or preventing NSCLC of the present
invention may be a fragment of an antibody or a modified antibody,
so long as it binds to one or more of the proteins encoded by the
marker genes (KIF11, GHSR1b, NTSR1 or FOXM1 gene). The antibodies
and antibody fragments used in the present method of treating or
preventing NSCLC may be modified, and include chemically modified
and chimeric antibodies. Such antibodies and antibody fragments can
be obtained according to the above-mentioned methods, supra.
[0251] When the obtained antibody is to be administered to the
human body (antibody treatment), a human antibody or a humanized
antibody is preferable for reducing immunogenicity.
[0252] For example, transgenic animals having a repertory of human
antibody genes may be immunized with an antigen such as KIF11,
GHSR1b, NTSR1 or FOXM1 polypeptide, cells expressing the
polypeptide, or their lysates. Antibody producing cells are then
collected from the animals and fused with myeloma cells to obtain
hybridoma, from which human antibodies against the polypeptide can
be prepared (see WO92-03918, WO93-2227, WO94-02602, WO94-25585,
WO96-33735, and WO96-34096).
[0253] Alternatively, an immune cell, such as an immunized
lymphocyte, producing antibodies may be immortalized by an oncogene
and used for preparing monoclonal antibodies.
[0254] The present invention provides a method for treating or
preventing NSCLC, using an antibody against an over-expressed
KIF11, GHSR1b, NTSR1 or FOXM1 polypeptide. According to the method,
a pharmaceutically effective amount of an antibody against KIF11,
GHSR1b, NTSR1 or FOXM1 polypeptide is administered. An antibody
against an over-expressed KIF11, GHSR1b, NTSR1 or FOXM1 polypeptide
is administered at a dosage sufficient to reduce the activity of
KIF11, GHSR1b, NTSR1 or FOXM1 protein. Alternatively, an antibody
binding to a cell surface marker specific for tumor cells can be
used as a tool for drug delivery. Thus, for example, an antibody
against an over-expressed KIF11, GHSR1b, NTSR1 or FOXM1 polypeptide
conjugated with a cytotoxic agent may be administered at a dosage
sufficient to injure tumor cells.
[0255] In addition, dominant negative mutants of the proteins
disclosed here can be used to treat or prevent NSCLC. For example,
fragments of KOC1 that specifically bind KIF11 can be used. As used
here "dominant negative fragment of KOC1" is a mutated form of KOC1
that is capable of complexing with either of KIF11 and RNA to be
transported such that the RNA transporter activity of the complex
is diminished. Thus, a dominant negative fragment is one that is
not functionally equivalent to the full length KOC1 polypeptide.
Preferred dominant negative fragments are those that comprise at
least one RRM domain of KOC1. Alternatively, in another embodiment,
the dominant negative fragments have two RRM domains and zero to
three of KH domains. For example KOC1DEL2 (2.times.RRM+2.times.KH)
and KOC1DEL3 (2.times.RRM without KH) are preferable fragment for
dominant negative effect. The amino acid sequences of KOC1DEL2 and
KOC1DEL3 consist of positions 1 to 406 and 1-197 of SEQ ID NO:105,
respectively. The fragments are typically less than about 300 amino
acids, typically less than about 200 amino acids.
[0256] The present invention also relates to a method of treating
or preventing NSCLC in a subject comprising administering to said
subject a vaccine comprising a polypeptide encoded by a nucleic
acid selected from the group consisting of KIF11, GHSR1b, NTSR1,
and FOXM1 genes or an immunologically active fragment of said
polypeptide, or a polynucleotide encoding the polypeptide or the
fragment thereof. Administration of the polypeptide induces an
anti-tumor immunity in a subject. Thus, the present invention
further provides a method for inducing anti tumor immunity. The
polypeptide or the immunologically active fragments thereof are
useful as vaccines against NSCLC. In some cases the proteins or
fragments thereof may be administered in a form bound to the T cell
receptor (TCR) or presented on an antigen presenting cell (APC),
such as macrophage, dendritic cell (DC) or B-cells. Due to the
strong antigen presenting ability of DC, the use of DC is most
preferable among the APCs.
[0257] In the present invention, the phrase "vaccine against NSCLC"
refers to a substance that has the function to induce anti-tumor
immunity or immunity to suppress NSCLC upon inoculation into
animals. In general, anti-tumor immunity includes immune responses
such as follows: [0258] induction of cytotoxic lymphocytes against
tumors, [0259] induction of antibodies that recognize tumors, and
[0260] induction of anti-tumor cytokine production.
[0261] Therefore, when a certain protein induces any one of these
immune responses upon inoculation into an animal, the protein is
decided to have anti-tumor immunity inducing effect. The induction
of the anti-tumor immunity by a protein can be detected by
observing in vivo or in vitro the response of the immune system in
the host against the protein.
[0262] For example, a method for detecting the induction of
cytotoxic T lymphocytes is well known. A foreign substance that
enters the living body is presented to T cells and B cells by the
action of antigen presenting cells (APCs). T cells that respond to
the antigen presented by APC in antigen specific manner
differentiate into cytotoxic T cells (or cytotoxic T lymphocytes;
CTLs) due to stimulation by the antigen, and then proliferate (this
is referred to as activation of T cells). Therefore, CTL induction
by a certain peptide can be evaluated by presenting the peptide to
T cell by APC, and detecting the induction of CTL. Furthermore, APC
has the effect of activating CD4+ T cells, CD8+ T cells,
macrophages, eosinophils and NK cells. Since CD4+ T cells are also
important in anti-tumor immunity, the anti-tumor immunity inducing
action of the peptide can be evaluated using the activation effect
of these cells as indicators.
[0263] A method for evaluating the inducing action of CTL using
dendritic cells (DCs) as APC is well known in the art. DC is a
representative APC having the strongest CTL inducing action among
APCs. In this method, the test polypeptide is initially contacted
with DC and then this DC is contacted with T cells. Detection of T
cells having cytotoxic effects against the cells of interest after
the contact with DC shows that the test polypeptide has an activity
of inducing the cytotoxic T cells. Activity of CTL against tumors
can be detected, for example, using the lysis of .sup.51Cr-labeled
tumor cells as the indicator. Alternatively, the method of
evaluating the degree of tumor cell damage using .sup.3H-thymidine
uptake activity or LDH (lactose dehydrogenase)-release as the
indicator is also well known.
[0264] Apart from DC, peripheral blood mononuclear cells (PBMCs)
may also be used as the APC. The induction of CTL is reported to be
enhanced by culturing PBMC in the presence of GM-CSF and IL-4.
Similarly, CTL is shown to be induced by culturing PBMC in the
presence of keyhole limpet hemocyanin (KLH) and IL-7.
[0265] The test polypeptides confirmed to possess CTL inducing
activity by these methods are polypeptides having DC activation
effect and subsequent CTL inducing activity. Therefore,
polypeptides that induce CTL against tumor cells are useful as
vaccines against NSCLC. Furthermore, APC that acquired the ability
to induce CTL against NSCLC by contacting with the polypeptides are
useful as vaccines against NSCLC. Furthermore, CTL that acquired
cytotoxicity due to presentation of the polypeptide antigens by APC
can be also used as vaccines against NSCLC. Such therapeutic
methods for NSCLC using anti-tumor immunity due to APC and CTL are
referred to as cellular immunotherapy.
[0266] Generally, when using a polypeptide for cellular
immunotherapy, efficiency of the CTL-induction is known to increase
by combining a plurality of polypeptides having different
structures and contacting them with DC. Therefore, when stimulating
DC with protein fragments, it is advantageous to use a mixture of
multiple types of fragments.
[0267] Alternatively, the induction of anti-tumor immunity by a
polypeptide can be confirmed by observing the induction of antibody
production against tumors. For example, when antibodies against a
polypeptide are induced in a laboratory animal immunized with the
polypeptide, and when growth, proliferation or metastasis of tumor
cells is suppressed by those antibodies, the polypeptide can be
determined to have an ability to induce anti-tumor immunity.
[0268] Anti-tumor immunity is induced by administering the vaccine
of this invention, and the induction of anti-tumor immunity enables
treatment and prevention of NSCLC. Therapy against or prevention of
the onset of NSCLC includes any of the steps, such as inhibition of
the growth of NSCLC cells, involution of NSCLC cells and
suppression of occurrence of NSCLC cells. Decrease in mortality of
individuals having NSCLC, decrease of marker genes (in addition to
KIF11, GHSR1b and/or NTSR1 genes) in the blood, alleviation of
detectable symptoms accompanying NSCLC and such are also included
in the therapy or prevention of NSCLC. Such therapeutic and
preventive effects are preferably statistically significant. For
example, in observation, at a significance level of 5% or less,
wherein the therapeutic or preventive effect of a vaccine against
NSCLC is compared to a control without vaccine administration. For
example, Student's t-test, the Mann-Whitney U-test or ANOVA may be
used for statistical analysis.
[0269] The above-mentioned protein having immunological activity,
or a polynucleotide or vector encoding the protein may be combined
with an adjuvant. An adjuvant refers to a compound that enhances
the immune response against the protein when administered together
(or successively) with the protein having immunological activity.
Examples of adjuvants include cholera toxin, salmonella toxin, alum
and such, but are not limited thereto. Furthermore, the vaccine of
this invention may be combined appropriately with a
pharmaceutically acceptable carrier. Examples of such carriers are
sterilized water, physiological saline, phosphate buffer, culture
fluid and such. Furthermore, the vaccine may contain as necessary,
stabilizers, suspensions, preservatives, surfactants and such. The
vaccine is administered systemically or locally. Vaccine
administration may be performed by single administration or boosted
by multiple administrations.
[0270] When using APC or CTL as the vaccine of this invention,
NSCLC can be treated or prevented, for example, by the ex vivo
method. More specifically, PBMCs of the subject receiving treatment
or prevention are collected, the cells are contacted with the
polypeptide ex vivo, and following the induction of APC or CTL, the
cells may be administered to the subject. APC can be also induced
by introducing a vector encoding the polypeptide into PBMCs ex
vivo. APC or CTL induced in vitro can be cloned prior to
administration. By cloning and growing cells having high activity
of damaging target cells, cellular immunotherapy can be performed
more effectively. Furthermore, APC and CTL isolated in this manner
may be used for cellular immunotherapy not only against individuals
from whom the cells are derived, but also against similar types of
diseases in other individuals.
[0271] Moreover, the present invention provides a method for
treating or preventing NSCLC in a subject, wherein a compound
obtained according to any of the above-described screening methods
is administered to the subject. Any compound that are obtained
according to any of the screening methods of the present invention
can be administered to the subject so long as it decreases the
expression or function, or both, of one or more gene products of
KIF11, GHSR1b, NTSR1, and FOXM1 genes.
siRNA and Vectors Encoding Them
[0272] Transfection of vectors expressing siRNA for KIF11, GHSR1b,
NTSR1 or FOXM1 leads to growth inhibition of NSCLC cells. Thus, it
is another aspect of the present invention to provide a
double-stranded molecule comprising a sense-strand and
antisense-strand which molecule functions as an siRNA for KIF11,
GHSR1b, NTSR1 or FOXM1, and a vector encoding the double-stranded
molecule.
[0273] The double-stranded molecule of the present invention
comprises a sense strand and an antisense strand, wherein the sense
strand comprises a ribonucleotide sequence corresponding to a
KIF11, GHSR1b, NTSR1 or FOXM1 target sequence, and wherein the
antisense strand comprises a ribonucleotide sequence which is
complementary to said sense strand, wherein said sense strand and
said antisense strand hybridize to each other to form said
double-stranded molecule, and wherein said double-stranded
molecule, when introduced into a cell expressing a KIF11, GHSR1b,
NTSR1 or FOXM1 gene, inhibits expression of said gene.
[0274] The double-stranded molecule of the present invention may be
a polynucleotide derived from its original environment (i.e., when
it is a naturally occurring molecule, the natural environment),
physically or chemically altered from its natural state, or
chemically synthesized. According to the present invention, such
double-stranded molecules include those composed of DNA, RNA, and
derivatives thereof. A DNA is suitably composed of bases such as A,
T, C and G, and T is replaced by U in an RNA.
[0275] As described above, the term "complementary" refers to a
Watson-Crick or Hoogsteen base pairing between nucleotide units of
a polynucleotide, and hybridization or binding of nucleotide units
indicates physical or chemical interaction between the units under
appropriate conditions to form a stable duplex (double-stranded
configuration) containing few or no mismatches. In a preferred
embodiment, such duplexes contain no more than 1 mismatch for every
10 base pairs. Particularly preferred duplexes are fully
complementary and contain no mismatch.
[0276] The double-stranded molecule of the present invention
contains a ribonucleotide sequence corresponding to a KIF11,
GHSR1b, NTSR1 or FOXM1 target sequence shorter than the whole mRNA
of KIF11, GHSR1b, NTSR1 or FOXM1 gene. Herein, the phrase a "target
sequence of KIF11, GHSR1b, NTSR1 or FOXM1 gene" refers to a
sequence that, when introduced into NSCLC cell lines, is effective
for suppressing cell viability. Specifically, the target sequence
comprises at least about 10, or suitably about 19 to about 25
contiguous nucleotides from the nucleotide sequences selected from
the group of SEQ ID NOs: 1, 3, 5, and 106. That is, the sense
strand of the present double-stranded molecule consists of at least
about 10 nucleotides, suitably is longer than 19 nucleotides, and
more preferably longer than 21 nucleotides. Preferred target
sequences include the sequences of SEQ ID NOs: 32, 33, 34, 35, 36,
37, and 108. The present double-stranded molecule including the
sense strand and the antisense strand is an oligonucleotide shorter
than about 100, preferably 75, more preferably 50 and most
preferably 25 nucleotides in length. A suitable double-stranded
molecule of the present invention is an oligonucleotide of a length
of about 19 to about 25 nucleotides. Furthermore, in order to
enhance the inhibition activity of the siRNA, nucleotide "u" can be
added to 3' end of the antisense strand of the target sequence. The
number of "u"s to be added is at least 2, generally 2 to 10,
preferably 2 to 5. The added "u"s form single strand at the 3' end
of the antisense strand of the siRNA. In these embodiments, the
siRNA molecules of the invention are typically modified as
described above for antisense molecules. Other modifications are
also possible, for example, cholesterol-conjugated siRNAs have
shown improved pharmacological properties (Song et al. Nature Med.
9:347-351 (2003):).
[0277] Furthermore, the double-stranded molecule of the present
invention may be a single ribonucleotide transcript comprising the
sense strand and the antisense strand linked via a single-stranded
ribonucleotide sequence. Namely, the present double-stranded
molecule may have the general formula:
5'-[A]-[B]-[A']-3'
wherein [A] is a ribonucleotide sequence corresponding to a target
sequence of KIF11, GHSR1b, NTSR1 or FOXM1; [B] is a ribonucleotide
sequence (loop sequence) consisting of 3 to 23 nucleotides; and [A]
is a ribonucleotide sequence complementary to [A]. The
complementary sequence [A] and [A] hybridize to each other to form
a double strand, and the whole siRNA molecule with the general
formula 5'-[A]-[B]-[A']-3' forms a hairpin loop structure.
[0278] The region [A] hybridizes to [A], and then a loop consisting
of region [B] is formed. The loop sequence can be selected from
those described on the World Wide Web at
ambion.com/techlib/tb/tb.sub.--506.html, or those described in
Jacque, J.-M. et al., Nature 418: 435-438 (2002). Additional
examples of the loop sequence that can be included in the present
double-stranded molecules include:
CCC, CCACC or CCACACC: Jacque, J. M. et al., Nature, Vol. 418:
435-438 (2002);
[0279] UUCG: Lee, N. S. et al., Nature Biotechnology 20:500-505
(2002); Fruscoloni, P. et. al., Proc. Natl. Acad. Sci. USA 100(4):
1639-1644 (2003); and
UUCAAGAGA: Dykxhoorn, D. M. et al., Nature Reviews Molecular Cell
Biology 4: 457-467 (2002).
[0280] Preferable siRNAs having hairpin loop structure of the
present invention are shown below. In the following structure, the
loop sequence can be selected from the group consisting of: CCC,
UUCG, CCACC, CCACACC, and UUCAAGAGA. Among these sequences, the
most preferable loop sequence is UUCAAGAGA (corresponding to
"ttcaagaga" in a DNA):
TABLE-US-00001 guuaguguac gaacuggag-[B]-cuccaguuc guacacuaac (for
the target sequence of SEQ ID NO: 32); gugucucugu
uggagaucu-[B]-agaucucca acagagacac (for the target sequence of SEQ
ID NO: 33); gaaggcaguu gaccaacac-[B]-guguugguc aacugccuuc (for the
target sequence of SEQ ID NO: 34); ccucuaccug
uccagcaug-[B]-caugcugga cagguagagg (for the target sequence of SEQ
ID NO: 35); guucaucagc gccaucugg-[B]-ccagauggc gcugaugaac (for the
target sequence of SEQ ID NO: 36); ggucgucaua
caggucaac-[B]-guugaccug uaugacgacc (for the target sequence of SEQ
ID NO: 37); and gcagcagaaa cgaccgaau-[B]-auucggucg uuucugcugc (for
the target sequence of SEQ ID NO: 108).
[0281] The present invention further provides a vector encoding the
double-stranded molecule of the present invention. The vector
encodes a transcript having a secondary structure and which
comprises the sense strand and the antisense strand, and suitably
comprises a single-stranded ribonucleotide sequence linking said
sense strand and said antisense strand. The vector preferably
comprises a regulatory sequence adjacent to the region encoding the
present double-stranded molecule that directs the expression of the
molecule in an adequate cell. For example, the double-stranded
molecules of the present invention are intracellularly transcribed
by cloning their coding sequence into a vector containing, e.g., a
RNA pol III transcription unit from the small nuclear RNA (snRNA)
U6 or the human H1 RNA promoter.
[0282] Alternatively, the present vectors are produced, for
example, by cloning the target sequence into an expression vector
so the objective sequence is operatively-linked to a regulatory
sequence of the vector in a manner to allow expression thereof
(transcription of the DNA molecule) (Lee, N. S. et al., Nature
Biotechnology 20: 500-505 (2002)). For example, the transcription
of an RNA molecule having an antisense sequence to the target
sequence is driven by a first promoter (e.g., a promoter sequence
linked to the 3'-end of the cloned DNA) and that having the sense
strand to the target sequence by a second promoter (e.g., a
promoter sequence linked to the 5'-end of the cloned DNA). The
expressed sense and antisense strands hybridize to each other in
vivo to generate a siRNA construct to silence a gene that comprises
the target sequence. Furthermore, two constructs (vectors) may be
utilized to respectively produce the sense and anti-sense strands
of a siRNA construct.
[0283] For introducing the vectors into a cell,
transfection-enhancing agent can be used. FuGENE
(Rochediagnostices), Lipofectamine 2000 (Invitrogen),
Oligofectamine (Invitrogen), and Nucleofector (Wako pure Chemical)
are useful as the transfection-enhancing agent.
Pharmaceutical Compositions for Treating or Preventing NSCLC
[0284] The present invention provides compositions for treating or
preventing NSCLC comprising a compound selected by the present
method of screening for a compound that alters the expression or
activity of an NSCLC-associated gene.
[0285] When administering a compound isolated by the screening
method of the present invention as a pharmaceutical for humans and
other mammals, such as mice, rats, guinea-pig, rabbits, cats, dogs,
sheep, pigs, cattle, monkeys, baboons or chimpanzees for treating a
cell proliferative disease (e.g., non-small cell lung cancer), the
isolated compound can be directly administered or can be formulated
into a dosage form using conventional pharmaceutical preparation
methods. Such pharmaceutical formulations of the present
compositions include those suitable for oral, rectal, nasal,
topical (including buccal and sub-lingual), vaginal or parenteral
(including intramuscular, sub-cutaneous and intravenous)
administration, or for administration by inhalation or
insufflation. The formulations are optionally packaged in discrete
dosage units.
[0286] Pharmaceutical formulations suitable for oral administration
include capsules, cachets or tablets, each containing a
predetermined amount of the active ingredient. Formulations also
include powders, granules, solutions, suspensions or emulsions. The
active ingredient is optionally administered as a bolus electuary
or paste. Tablets and capsules for oral administration may contain
conventional excipients such as binding agents, fillers,
lubricants, disintegrant or wetting agents. A tablet may be made by
compression or molding, optionally with one or more formulational
ingredients. Compressed tablets may be prepared by compressing in a
suitable machine the active ingredients in a free-flowing form such
as powder or granules, optionally mixed with a binder, lubricant,
inert diluent, lubricating, surface active or dispersing agent.
Molded tablets may be made via molding in a suitable machine a
mixture of the powdered compound moistened with an inert liquid
diluent. The tablets may be coated according to methods well known
in the art. Oral fluid preparations may be in the form of, for
example, aqueous or oily suspensions, solutions, emulsions, syrups
or elixirs, or may be presented as a dry product for reconstitution
with water or other suitable vehicle prior to use. Such liquid
preparations may contain conventional additives such as suspending
agents, emulsifying agents, non-aqueous vehicles (which may include
edible oils) or preservatives. The tablets may optionally be
formulated so as to provide slow or controlled release of the
active ingredient in vivo. A package of tablets may contain one
tablet to be taken on each of the month. The formulation or dose of
medicament in these preparations makes a suitable dosage within the
indicated range acquirable.
[0287] Formulations for parenteral administration include aqueous
and non-aqueous sterile injection solutions which may contain
anti-oxidants, buffers, bacteriostats and solutes which render the
formulation isotonic with the blood of the intended recipient; and
aqueous and non-aqueous sterile suspensions which may include
suspending agents and thickening agents. The formulations may be
presented in unit dose or multi-dose containers, for example sealed
ampoules and vials, and may be stored in a freeze-dried
(lyophilized) condition requiring only the addition of the sterile
liquid carrier, for example, saline, water-for-injection,
immediately prior to use. Alternatively, the formulations may be
presented for continuous infusion. Extemporaneous injection
solutions and suspensions may be prepared from sterile powders,
granules and tablets of the kind previously described.
[0288] Formulations for rectal administration include suppositories
with standard carriers such as cocoa butter or polyethylene glycol.
Formulations for topical administration in the mouth, for example,
buccally or sublingually, include lozenges, which contain the
active ingredient in a flavored base such as sucrose and acacia or
tragacanth, and pastilles comprising the active ingredient in a
base such as gelatin, glycerin, sucrose or acacia. For intra-nasal
administration of an active ingredient, a liquid spray or
dispersible powder or in the form of drops may be used. Drops may
be formulated with an aqueous or non-aqueous base also comprising
one or more dispersing agents, solubilizing agents or suspending
agents.
[0289] For administration by inhalation the compositions are
conveniently delivered from an insufflator, nebulizer, pressurized
packs or other convenient means of delivering an aerosol spray.
Pressurized packs may comprise a suitable propellant such as
dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In
the case of a pressurized aerosol, the dosage unit may be
determined by providing a valve to deliver a metered amount.
[0290] Alternatively, for administration by inhalation or
insufflation, the compositions may take the form of a dry powder
composition, for example, a powder mix of an active ingredient and
a suitable powder base such as lactose or starch. The powder
composition may be presented in unit dosage form in, for example,
capsules, cartridges, gelatin or blister packs from which the
powder may be administered with the aid of an inhalator or
insufflators.
[0291] Other formulations include implantable devices and adhesive
patches; which release a therapeutic agent.
[0292] When desired, the above-described formulations, adapted to
give sustained release of the active ingredient, may be employed.
The pharmaceutical compositions may also contain other active
ingredients such as antimicrobial agents, immunosuppressants or
preservatives.
[0293] It should be understood that in addition to the ingredients
particularly mentioned above, the formulations of this invention
may include other agents conventional in the art having regard to
the type of formulation in question, for example, those suitable
for oral administration may include flavoring agents.
[0294] Preferred unit dosage formulations are those containing an
effective dose, as recited below, of the active ingredient or an
appropriate fraction thereof.
[0295] For each of the aforementioned conditions, the compositions,
e.g., polypeptides and organic compounds are administered orally or
via injection at a dose of from about 0.1 to about 250 mg/kg per
day. The dose range for adult humans is generally from about 5 mg
to about 17.5 g/day, preferably about 5 mg to about 10 g/day, and
most preferably about 100 mg to about 3 g/day. Tablets or other
unit dosage forms of presentation provided in discrete units may
conveniently contain an amount which is effective at such dosage or
as a multiple of the same, for instance, units containing about 5
mg to about 500 mg, usually from about 100 mg to about 500 mg.
[0296] The dose employed will depend upon a number of factors,
including the age and sex of the subject, the precise disorder
being treated, and its severity. Also the route of administration
may vary depending upon the condition and its severity.
[0297] The present invention further provides a composition for
treating or preventing NSCLC comprising active ingredient that
inhibits the expression of any one of the gene selected from the
group of KIF11, GHSR1b, NTSR1, and FOXM1 genes. Such active
ingredient can be an antisense-oligonucleotide, siRNA or ribozyme
against the gene, or derivatives, such as expression vector, of the
antisense-oligonucleotide, siRNA or ribozyme. The active ingredient
may be made into an external preparation, such as liniment or a
poultice, by mixing with a suitable base material which is inactive
against the derivatives.
[0298] Also, as needed, the active ingredient can be formulated
into tablets, powders, granules, capsules, liposome capsules,
injections, solutions, nose-drops and freeze-drying agents by
adding excipients, isotonic agents, solubilizers, preservatives,
pain-killers and such. These can be prepared according to
conventional methods for preparing nucleic acid containing
pharmaceuticals.
[0299] Preferably, the antisense-oligonucleotide derivative, siRNA
derivative or ribozyme derivative is given to the patient by direct
application to the ailing site or by injection into a blood vessel
so that it will reach the site of ailment. A mounting medium can
also be used in the composition to increase durability and
membrane-permiability. Examples of mounting mediums include
liposome, poly-L-lysine, lipid, cholesterol, lipofectin and
derivatives thereof.
[0300] The dosage of such compositions can be adjusted suitably
according to the patient's condition and used in desired amounts.
For example, a dose range of 0.1 to 100 mg/kg, preferably 0.1 to 50
mg/kg can be administered.
[0301] Another embodiment of the present invention is a composition
for treating or preventing NSCLC comprising an antibody against a
polypeptide encoded by any one of the genes selected from the group
of KIF11, GHSR1b, NTSR1, and FOXM1 genes or fragments of the
antibody that bind to the polypeptide.
[0302] Although there are some differences according to the
symptoms, the dose of an antibody or fragments thereof for treating
or preventing NSCLC is about 0.1 mg to about 100 mg per day,
preferably about 1.0 mg to about 50 mg per day and more preferably
about 1.0 mg to about 20 mg per day, when administered orally to a
normal adult (weight 60 kg).
[0303] When administering parenterally, in the form of an injection
to a normal adult (weight 60 kg), although there are some
differences according to the condition of the patient, symptoms of
the disease and method of administration, it is convenient to
intravenously inject a dose of about 0.01 mg to about 30 mg per
day, preferably about 0.1 to about 20 mg per day and more
preferably about 0.1 to about 10 mg per day. Also, in the case of
other animals too, it is possible to administer an amount converted
to 60 kg of body-weight.
[0304] The following examples are presented to illustrate the
present invention and to assist one of ordinary skill in making and
using the same. The examples are not intended in any way to
otherwise limit the scope of the invention.
[0305] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
methods and materials similar or equivalent to those described
herein can be used in the practice or testing of the present
invention, suitable methods and materials are described below. Any
patents, patent applications and publications sited herein are
incorporated by reference.
BEST MODE FOR CARRYING OUT THE INVENTION
Materials and Methods
(1) Patients and Tissue Samples
[0306] Primary NSCLC samples, of which 22 were classified as
adenocarcinomas (ADCs), 14 as squamous-cell carcinomas (SCCs), and
one as adenosquamous carcinoma, had been obtained earlier with
informed consent from 37 patients (Kikuchi, T. et al., Oncogene 22,
2192-2205 (2003)). Fifteen additional primary NSCLCs, including
seven ADCs and eight SCCs, were obtained along with adjacent normal
lung tissue samples from patients undergoing surgery at our
institutes.
(2) Cell Lines
[0307] The 30 human NSCLC and four SCLC cell lines used in this
study were as follows: adenocarcinomas (ADCs) A427, A549, NCI-H23,
NCI-H522, LC174, LC176, LC319, PC3, PC9, PC14, PC14-PE6, NCI-H1373,
NCI-H1435, NCI-H1793, SK-LU-1, NCI-H358, NCI-H1650 and SW1573;
adenosquamous carcinomas (ASCs) NCI-H226, NCI-H596 and NCI-H647;
squamous-cell carcinomas (SCCs) RERF-LC-AI, SW-900, SK-MES-1,
EBC-1, LU61, NCI-H520, NCI-H1703, and NCI-H2170; large-cell
carcinoma (LCC) LX1; and SCLCs DMS114, DMS273, SBC-3, and SBC-5.
Human small airway epithelial cells, SAEC were grown in optimized
medium (SAGM) purchased from Cambrex Bio Science Inc. A human
bronchial epithelial cell line, BEAS2B cells were also served.
[0308] Thirty-four human NSCLC or SCLC cancer cell lines and two
normal bronchial epithelium cell lines were grown in monolayers in
appropriate medium supplemented with 5 or 10% fetal bovine serum
(see Table 1).
TABLE-US-00002 TABLE 1 Cell line name Medium Provider
adenocarcinoma (ADC) A427 EMEM(10% FBS) ATCC(HTB-53) A549
RPMI-1640(10% FBS) ATCC(CCL-185) NCI-H23 RPMI-1640(10% FBS)
ATCC(CRL-5800) NCI-H522 RPMI-1640(10% FBS) ATCC(CRL-5810) LC174
RPMI-1640(10% FBS) Aichi Cancer Center LC176 RPMI-1640(10% FBS)
Aichi Cancer Center LC319 RPMI-1640(10% FBS) Aichi Cancer Center
PC-3 DMEM(10% FBS) Tokushima Univeraity PC-9 DMEM(10% FBS)
Tokushima Univeraity PC14 RPMI-1640(10% FBS) Tokushima Univeraity
PC14-PE6 RPMI-1640(10% FBS) Tokushima Univeraity NCI-H1373
RPMI-1640(10% FBS) ATCC(CRL-5866) NCI-H1435 F12 + DMEM(5% FBS) +
EGF(+) SNU Bank NCI-H1793 F12 + DMEM(5% FBS) + Glu SNU Bank SK-LU-1
DMEM(10% FBS) SNU Bank BAC NCI-H358 RPMI-1640(10% FBS) SNU Bank BAC
NCI-H1650 RPMI-1640(10% FBS) ATCC(CRL-5883) BAC SW1573 Leibovitz's
L-15(10% FBS) ATCC(CRL-2170) adenosquamous carcinoma (ASCs)
NCI-H226 RPMI-1640(10% FBS) ATCC(CRL-5826) NCI-H647 RPMI-1640(10%
FBS) ATCC(CRL-5834) NCI-H596 RPMI-1640(10% FBS) SNU Bank squamous
cell carcinoma (SCC) RERF-LC-Al DMEM(10% FBS) Tokushima Univeraity
SW-900 Leibovitz's L-15(10% FBS) SNU Bank SK-MES-1 DMEM(10% FBS)
SNU Bank EBC-1 DMEM(10% FBS) Tokushima Univeraity LU61 DMEM(10%
FBS) Central Institute for Experimental Animals NCI-H520
RPMI-1640(10% FBS) ATCC(HTB-182) NCI-H1703 RPMI-1640(10% FBS)
ATCC(CRL-5889) NCI-H2170 RPMI-1640(10% FBS) ATCC8(CRL-5928)
large-cell carcinoma (LCC) LX1 DMEM(10% FBS) Central Institute for
Experimental Animals small-cell lung carcinoma (SCLCs) DMS114
RPMI-1640(10% FBS) ATCC(CRL-2066) DMS273 RPMI-1640(10% FBS)
Japanese foundation for cancer research SBC-3 RPMI-1640(10% FBS)
Tokushima Univeraity SBC-5 EMEM(10% FBS) Tokushima Univeraity small
airway epithelial cells SAEC SAGM Cambrex Bio Science Inc. human
bronchial cell line BEAS2B RPMI-1640(10% FBS) ATCC(CRL-9609)
(3) Semiquantitative RT-PCR Analysis
[0309] Total RNA was extracted from cultured cells and clinical
tissues using Trizol reagent (Life Technologies, Inc.) according to
the manufacturer's protocol. Extracted RNAs and normal human tissue
poly(A) RNAs were treated with DNase I (Nippon Gene) and
reverse-transcribed using oligo(dT) primer and SuperScript II
reverse transcriptase (Invitrogen). Semiquantitative RT-PCR
experiments were carried out with the following synthesized
gene-specific primers or with beta-actin (ACTB)-specific primers as
an internal control:
TABLE-US-00003 (SEQ. ID. NO. 7) KOC1, 5'-TAAATGGCTTCAGGAGACTTCAG-3'
and (SEQ. ID. NO. 8) 5'-GGTTTTAAATGCAGCTCCTATGTG-3'; (SEQ. ID. NO.
9) KIF11, 5'-CTGAACAGTGGGTATCTTCCTTA-3' and (SEQ. ID. NO. 10)
5'-GATGGCTCTTGACTTAGAGGTTC-3'; (SEQ. ID. NO. 11) NMU,
5'-TGAAGAGATTCAGAGTGGACGA-3' and (SEQ. ID. NO. 12)
5'-ACTGAGAACATTGACAACACAGG-3'; (SEQ. ID. NO. 13) NMU1R,
5'-AAGAGGGACAGGGACAAGTAGT-3' and (SEQ. ID. NO. 14)
5'-ATGCCACTGTTACTGCTTCAG-3'; (SEQ. ID. NO. 15) NMU2R,
5'-GGCTCTTACAACTCATGTACCCA-3' and (SEQ. ID. NO. 16)
5'-TGATACAGAGACATGAAGTGAGCA-3'; (SEQ. ID. NO. 17) GHSR1a,
5'-TGGTGTTTGCCTTCATCCT-3' and (SEQ. ID. NO. 18)
5'-GAATCCCAGAAGTCTGAACA-3'; (SEQ. ID. NO. 19) GHSR1b,
5'-ACGGTCCTCTACAGTCTCA-3' and (SEQ. ID. NO. 20)
5'-CACAGGGAGAGGATAGGA-3'; (SEQ. ID. NO. 21) NTSR1,
5'-AGTGGGCTCAGAGTCTAGCAAAT-3' and (SEQ. ID. NO. 22)
5'-TATTGAGAGATACACGGGGTTTG-3'; (SEQ. ID. NO. 23) GHRL,
5'-TGAGCCCTGAACACCAGAGAG-3' and (SEQ. ID. NO. 24)
5'-AAAGCCAGATGAGCGCTTCTA-3'; (SEQ. ID. NO. 25) NTS,
5'-TCTTCAGCATGATGTGTTGTGT-3' and (SEQ. ID. NO. 26)
5'-TGAGAGATTCATGAGGAAGTCTTG-3'; (SEQ. ID. NO. 27) ACTB,
5'-GAGGTGATAGCATTGCTTTCG-3' and (SEQ. ID. NO. 28)
5'-CAAGTCAGTGTACAGGTAAGC-3'.
[0310] PCR reactions were optimized for the number of cycles to
ensure product intensity within the logarithmic phase of
amplification.
Quantitative Real-Time RT-PCR (QRT-PCR) Analysis and Northern-Blot
Analyses
[0311] Expression levels of the KOC1 and KIF11 genes were measured
by QRT-PCR using the ABI Prism 7700 sequence detection system
(Applied Biosystems). Total RNA was extracted from cultured cells
and clinical tissues using Trizol reagent (Life Technologies, Inc.)
according to the manufacturer's protocol. Extracted RNAs and normal
human tissue poly(A) RNAs were treated with DNase I (Nippon Gene)
and were reverse-transcribed using oligo (dT) primer and
SuperScript II reverse transcriptase (Invitrogen). The TaqMan
Pre-Developed Assay Human ACTB (Applied Biosystems; #4333762F) was
used for ACTB gene as a quantitative control. A primer pair and a
TaqMan probe for each gene were designed by using Primer Express
software as follows:
TABLE-US-00004 (SEQ. ID. NO. 98) KOC1,
5'-ACGAACTCATTTGCTCACTCCTT-3' (sense), (SEQ. ID. NO. 99)
5'-ACCCACACCCAACACAATTGT-3' (antisense), (SEQ. ID. NO. 100)
5'-ACAGCAAAGCCC-3' (TaqMan-MGB probe); (SEQ. ID. NO. 101) KIF11,
5'-TTCACCCTGACAGAGTTCACAAA-3' (sense) (SEQ. ID. NO. 102)
5'-GGGTGGTCTCCCATAATAGCAA-3' (antisense), (SEQ. ID. NO. 103)
5'-AGCCCACTTTAGAGTATAC-3' (TaqMan-MGB probe).
[0312] PCR for each gene and the ACTB gene was performed in a
single tube in duplicate. Results were expressed as the average of
these two independent tests.
(4) Northern-Blot Analysis
[0313] Human multiple-tissue blots (BD Biosciences Clontech) were
hybridized with .sup.32P-labeled PCR products of KOC1, KIF11 and
GHSR1. cDNA probes of KOC1, KIF11 and GHSR1 were prepared by RT-PCR
using primers similarly as above. Prehybridization, hybridization,
and washing were performed according to the supplier's
recommendations. The blots were autoradiographed with intensifying
BAS screens (BIO-RAD) at room temperature (RT) for 30 to 168
hours.
Generation of Anti-KOC1 and -KIF11 Antibodies
[0314] Plasmids expressing KOC1 (full-length) and KIF11 (partial
amino acid sequence corresponding to codons 361-1056), each
containing His-tagged epitope at the N-terminal, were prepared
using pET28 vector (Novagen). Recombinant proteins were expressed
in Escherichia coli BL21 codon-plus strain (Stratagene), purified
using TALON resin (BD Biosciences Clontech) according to the
supplier's protocol, and inoculated into rabbits. The immune sera
were purified on affinity columns according to standard
methodology. Affinity-purified anti-KOC1 and anti-KIF11 antibodies
were used for western-blot analysis, immunoprecipitation, and
immunostaining We confirmed by western-blot analysis that anti-KOC1
antibody are specific to KOC1 and do not cross-react with other
homologous proteins, IMP-1 and IMP-2 using lysates of NCI-H520
cells, which expressed neither of endogenous IMP-1, -2, and -3, but
had been transfected with HA-tagged IMP-1, -2, and -3 expression
vector.
Construction of KOC1 Deletion Mutants and Immunoprecipitation
Assays for Identification of the KOC1-KIF11 Binding Region
[0315] KOC1 and several of its domains (FIG. 3a) were cloned into
appropriate sites of N-terminal FLAG-tagged and C-terminal
HA-tagged pCAGGS vector. COS-7 cells transfected only with an KOC1
deletion mutant, were immunoprecipitated with anti-HA agarose
(SIGMA). Endogenous KIF11 bands were detected with
affinity-purified anti-KIF11 antibody by western blotting.
TABLE-US-00005 TABLE 3 Primer sequence for constraction of deletion
mutant by RT-PCR SEQ SEQ F ID NO. R ID NO. full
5'-ATGAACAAACTGTATATCGG-3' 69 5'-CTTCCGTCTTGACTGAGG-3' 70 length
KOC1 5'-ATGAACAAACTGTATATCGG-3' 71 5'-ATGAGCTTCAAGTTTCACC-3' 72
DEL1 KOC1 5'-ATGAACAAACTGTATATCGG-3' 73 5'-CTCCGTTTCTGATTGCTC-3' 74
DEL2 KOC1 5'-ATGAACAAACTGTATATCGG-3' 75 5'-AGGCAAATCACATGGTTTCTG-3'
76 DEL3 KOC1 5'-TTGCCTCTGCGCCTGCTG-3' 77 5'-CTTCCGTCTTGACTGAGG-3'
78 DEL4 KOC1 5'-TTGCCTCTGCGCCTGCTG-3' 79 5'-CTCCGTTTCTGATTGCTC-3'
80 DEL5
RNA-immunoprecipitation and cDNA Microarray Screening for
Identification of KOC1-Associated mRNAs
[0316] We adopted the RNA immunoprecipitation protocol of
Niranjanakumari et al. (Niranjanakumari, S. et al. Methods 26,
182-190 (2002)) to analyze RNA-protein interactions involving KOC1
in vivo. Immunoprecipitated RNAs were isolated from five
lung-cancer cell lines (A549, LC319, PC14, RERF-LC-AI, and
SK-MES-1). A 2.5-.mu.g aliquot of T7-based amplified RNAs (aRNAs)
from each immunoprecipiated RNA (IP-RNA) and from the total RNA
(control) were reversely transcribed in the presence of Cy5-dCTP
and Cy3-dCTP respectively as described previously (Kikuchi, T. et
al. Oncogene 22, 2192-2205 (2003)), for hybridization to a cDNA
microarray representing 32,256 genes (IP-microarray analysis). To
confirm the binding to KOC1 of the mRNAs identified by
IP-microarray analysis, we carried out RT-PCR experiments using
gene-specific primers and RNAs from NSCLC cell extracts
immunoprecipitated with anti-KOC1 antibody (IP-RT-PCR). To confirm
the region of KOC1 required for binding to the KOC1-associated
mRNAs, we also carried out northwestern blot analysis as below and
IP-RT-PCR of KOC1-associated mRNAs from these immunoprecipitated
extracts transfected with various KOC1 deletion mutants.
TABLE-US-00006 TABLE 4 Primer sequence for IP-RT-PCR SEQ SEQ F ID
NO. R ID NO. CCT2 5'-TTATCCTGAACAGCTCTTTGGTG-3' 81
5'-AAGCGAAGGTCAGCTAAATATCC-3' 82 SBP2 5'-CTTTCTGAGCACACTACGGATCT-3'
83 5'-AAGCCCTCTTACTTACAGGGAAA-3' 84 SLC25A3
5'-GGTTCCCCTGGATTTAGTGAA-3' 85 5'-CAACAGTAAATCTGAAACTCTTGCC-3' 86
RAB35 5'-GACAAAGGTAGCAAGAGGATTTC-3' 87 5'-CTGGTGTTAAACTCGGTTCTTC-3'
88 PSMB7 5'-CTAGTGAGTGAGGCTATTGCAGC-3' 89
5'-GTCTCTTCTAGCACCTCAATCTCC-3' 90 GL 5'-ATCTGACTTTCTGTCCACTGCAT-3'
91 5'-TAATTCAGCATAAGCCAAAGCC-3' 92 PKP4
5'-ACACAGTATGGACTGAAATCGAC-3' 93 5'-CACCTCAATCTGAACAAGGTTAG-3' 94
WINS1 5'-GGCCTCTCAAAGTCTGGTAGATT-3' 95
5'-ATATTCCCACTTCAGAGACGACA-3' 96
Northwestern Blot Analysis
[0317] Immunoprecipitated extracts from cells transfected with the
KOC1 deletion mutants (.mu.M) were boiled in 2.times.SDS-sample
buffer, electrophoresed through 10-20% gradient polyacrylamide gels
(BIO-RAD) and transferred to a polyvinylidene difluoride membrane
(Hybond-P). The membrane was then blocked for 1 hour at room
temperature in blocking buffer (10 mM Tris-HCl (pH 7.8), 150 mM
NaCl, 1 mg/ml yeast tRNA), and washed twice with 50 ml of 10 mM
Tris-HCl (pH 7.8) for 5 min and incubated with DIG-labeled RNA
probe in 5 ml of NWB buffer (10 mM Tris-HCl (pH 7.8), 1 mM EDTA, 50
mM NaCl, 0.02% Ficoll, 0.02% polyvinyl pyrrolidone, 0.02% BSA) for
2 hours at room temperature. The membrane was washed four times
with NWB buffer and the RNA probe bound to the proteins was then
detected using DIG nucleic acid detection kit (Roche) according to
the supplier's protocol.
Living-Cell Imaging of KOC1 and KIF11 Proteins and KOC1-Associated
RAB35 mRNA
[0318] Plasmids expressing ECFP-fused KOC1 (ECFP-KOC1) protein were
prepared using pECFP-N1 vectors (BD Biosciences Clontech). Plasmids
expressing EYFP-fused KIF11 (EYFP-KIF11) protein were also
prepared, using pEYFP-N1 vectors (BD Biosciences Clontech).
Time-lapse images of COS-7 cells transfected with plasmids
expressing ECFP-KOC1 or EYFP-KIF11 proteins were captured for 5-15
hours by the Live Cell Imaging System (Power IX81, OLYMPUS) and a
confocal microscope (TCS SP2-AOBS, Leica Microsystems; FV1000
FLUOVIEW, OLYMPUS).
[0319] In vitro transcription of linearized plasmids carrying the
full-length cDNA sequence of an KOC1-associated gene, RAB35, was
performed using DAVIS Lab's protocol (found on the World Wide Web
at ed.ac.uk/.about.ilan). To generate fluorescent riboprobes for in
vivo co-localization with KOC1, the plasmids were transcribed using
the mCAP RNA capping kit (Stratagene) in the presence of Alexa
Fluor 546-labeled UTP (Molecular Probes). We constructed plasmids
expressing EGFP-fused KOC1 (EGFP-KOC1) protein were prepared using
pEGFP-N1 vectors (BD Biosciences Clontech). For live-cell imaging
of co-localized EGFP-KOC1 and Alexa Fluor 546-labeled RAB35 mRNA,
COS-7 cells that had been transfected initially with pEGFP-KOC1
were additionally transfected 36 hours later with Alexa Fluor
546-labeled RAB35 mRNA (3 .mu.g per 3.5-cm culture dish) in the
presence of RNase Inhibitor (TAKARA). The plasmid-DNA and RNA
samples were transfected using Lipofectamine 2000 (Invitrogen)
according to the manufacturer's protocols. The cells were washed
twice with PBS, and fresh medium was added 90 min after
transfection with the labeled mRNA. The cells were allowed to
recover in the incubator (37.degree. C., 5% CO.sub.2) for 30 min
before live-cell imaging for 3-6 hours with a confocal microscope
(FV1000 FLUOVIEW, OLYMPUS). To investigate the specific transport
of mRNAs by KOC1-RNP complex from one cell to another cell, we
prepared two different COS-7-derived cells; the COS-7 cells
transfected with pEGFP-KOC1 and Alexa Fluor 546-labeled RAB35 mRNA
and the other, parental COS-7 cells simply labeled with CellTracker
(Molecular Probes) according to the supplier's protocols. These two
cell populations were mixed and co-cultured for 12 hours before
live-cell imaging with confocal microscope for 6 hours.
[0320] To investigate the translation of the mRNA transported by
KOC1-RNP complex in the recipient cells, we prepared two types of
COS-7-derived cell; one type was COS-7 cells co-transfected with
pCAGGS-FLAG tagged-KOC1 and -KIF11. After 24 hours culture, plasmid
containing EGFP-fused RAB35 full length mRNA were re-transfected
into these cells. The other type was COS-7 cells simply labeled
with CellTracker (blue). These two cell-types were mixed and
co-cultured for 24 hours before live-cell imaging with video
microscope for 12 hours. Synthesis of EGFP-tagged RAB35 mRNAs and
corresponding proteins in the CellTracker-stained recipient cells
(blue) as well as on the ultrafine structure between the two cells
was examined by in situ hybridization and time-lapse video
microscopy.
Fluorescent In Situ Hybridization
[0321] We carried out in situ hybridization with DIG-labeled probes
complementary to RAB35 or EGFP mRNA at 60.degree. C. for 16 hours.
The DIG label was detected using NBT-BCIP, an alkaline phosphatase
color substrate. Cells were washed, mounted and visualized on light
microscope. Fixed cells were hybridized with a mixture of
DIG-labeled complementary to RAB35 mRNA for 16 hours in 50%
formamide/2.times.SSC at 42.degree. C. Cells were washed, mounted
and visualized on confocal microscope.
(5) RNA Interference Assay
[0322] To prepare plasmid vector expressing short interfering RNA
(siRNA), we amplified the genomic fragment of H1RNA gene containing
its promoter region by PCR using a set of primers,
5'-TGGTAGCCAAGTGCAGGTTATA-3' (SEQ ID No: 44), and
5'-CCAAAGGGTTTCTGCAGTTTCA-3' (SEQ ID No: 45) and human placental
DNA as a template. The product was purified and cloned into pCR2.0
plasmid vector using a TA cloning kit according to the supplier's
protocol (Invitrogen). The BamHI and XhoI fragment containing H1RNA
was into pcDNA3.1(+) between nucleotides 1257 and 56, and the
fragment was amplified by PCR using
[0323] 5'-TGCGGATCCAGAGCAGATTGTACTGAGAGT-3' (SEQ ID No: 46) and
[0324] 5'-CTCTATCTCGAGTGAGGCGGAAAGAACCA-3' (SEQ ID No: 47),
[0325] The ligated DNA became the template for PCR amplification
with primers,
[0326] 5'-TTTAAGCTTGAAGACCATTTTTGGAAAAAAAAAAAC-3' (SEQ ID No: 48)
and
[0327] 5'-TTTAAGCTTGAAGACATGGGAAAGAGTGGTCTCA-3' (SEQ ID No:
49).
[0328] The product was digested with HindIII, and subsequently
self-ligated to produce psiH1BX3.0 vector plasmid having a
nucleotide sequence shown in SEQ ID NO: 50.
[0329] The DNA fragment encoding siRNA was inserted into the GAP at
nucleotide 489-492 as indicated (-) in the following plasmid
sequence (SEQ ID NO: 50).
TABLE-US-00007 GACGGATCGGGAGATCTCCCGATCCCCTATGGTGCACTCTCAGTACA
ATCTGCTCTGGATCCACTAGTAACGGCCGCCAGTGTGCTGGAATTCG
GCTTGGTAGCCAAGTGCAGGTTATAGGGAGCTGAAGGGAAGGGGGTC
ACAGTAGGTGGCATCGTTCCTTTCTGACTGCCCGCCCCCCGCATGCC
GTCCCGCGATATTGAGCTCCGAACCTCTCGCCCTGCCGCCGCCGGTG
CTCCGTCGCCGCCGCGCCGCCATGGAATTCGAACGCTGACGTCATCA
ACCCGCTCCAAGGAATCGCGGGCCCAGTGTCACTAGGCGGGAACACC
CAGCGCGCGTGCGCCCTGGCAGGAAGATGGCTGTGAGGGACAGGGGA
GTGGCGCCCTGCAATATTTGCATGTCGCTATGTGTTCTGGGAAATCA
CCATAAACGTGAAATGTCTTTGGATTTGGGAATCTTATAAGTTCTGT
ATGAGACCACTCTTTCCC----TTTTTGGGAAAAAAAAAAAAAAAAA
AAAAACGAAACCGGGCCGGGCGCGGTGGTTCACGCCTATAATCCCAG
CACTTTGGGAGGCCGAGGCGGGCGGATCACAAGGTCAGGAGGTCGAG
ACCATCCAGGCTAACACGGTGAAACCCCCCCCCATCTCTACTAAAAA
AAAAAAATACAAAAAATTAGCCATTAGCCGGGCGTGGTGGCGGGCGC
CTATAATCCCAGCTACTTGGGAGGCTGAAGCAGAATGGCGTGAACCC
GGGAGGCGGACGTTGCAGTGAGCCGAGATCGCGCCGACTGCATTCCA
GCCTGGGCGACAGAGCGAGTCTCAAAAAAAAAACCGAGTGGAATGTG
AAAAGCTCCGTGAAACTGCAGAAACCCAAGCCGAATTCTGCAGATAT
CCATCACACTGGCGGCCGCTCGAGTGAGGCGGAAAGAACCAGCTGGG
GCTCTAGGGGGTATCCCCACGCGCCCTGTAGCGGCGCATTAAGCGCG
GCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGC
CCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGT
TCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGG
TTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTA
GGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTC
GCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTC
CAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTT
ATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGA
TTTAACAAAAATTTAACGCGAATTAATTCTGTGGAATGTGTGTCAGT
TAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAA
AGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGG
CTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAG
CAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCG
CCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTAT
TTATGCAGAGGCCGAGGCCGCCTCTGCCTCTGAGCTATTCCAGAAGT
AGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTCCCG
GGAGCTTGTATATCCATTTTCGGATCTGATCAAGAGACAGGATGAGG
ATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGG
CCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACA
ATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCG
CCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAAC
TGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTT
CCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTG
GCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACC
TTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGG
CTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAA
ACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCG
ATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAA
CTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATCTCGT
CGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATG
GCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGAC
CGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCT
TGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCG
CTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTC
TTCTGAGCGGGACTCTGGGGTTCGAAATGACCGACCAAGCGACGCCC
AACCTGCCATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAAAG
GTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCC
AGCGCGGGGATCTCATGCTGGAGTTCTTCGCCCACCCCAACTTGTTT
ATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTT
CACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCA
AACTCATCAATGTATCTTATCATGTCTGTATACCGTCGACCTCTAGC
TAGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTG
TTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGT
GTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCG
TTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCT
GCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTG
GGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTT
CGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTT
ATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAG
GCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTT
TTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTC
AAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGT
TTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCG
CTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCT
TTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTC
GCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGC
TGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACA
CGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAG
CGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAAC
TACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAA
GCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAAC
AAACCACCGCTGGTAGCGGTTTTTTTGTTTGCAAGCAGCAGATTACG
CGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGG
GTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCA
TGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAA
TGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGA
CAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTC
TATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACT
ACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACC
GCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGC
CAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCC
TCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTC
GCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCG
TGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCC
CAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGC
GGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCG
CAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACT
GTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAAC
CAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCC
CGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAA
GTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGAT
CTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCA
ACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCA
AAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACG
GAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCA
TTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATT
TAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGT GCCACCTGACGTC
[0330] Using 30 .mu.l of Lipofectamine 2000 (Invitrogen), 10 .mu.g
of siRNA-expression vector were transfected into NSCLC cell lines,
A549 and LC319, both endogenously over-expressing KOC1, KIF11, NMU,
GHSR1b, NTSR1, RAB35, and FOXM1. More than 90% of the transfected
cells expressed the synthetic siRNAs, and endogenous expression of
target genes (KIF11, GHSR1b, NTSR1, RAB35, or FOXM1) in these cells
was effectively suppressed. The transfected cells were cultured for
five days in the presence of appropriate concentrations of
geneticin (G418), and then, cell numbers and viability were
measured by Giemsa staining and triplicate MTT assays. The target
sequences of the synthetic oligonucleotides for RNAi were as
follows: control 1 (EGFP: enhanced green fluorescent protein (EGFP)
gene, a mutant of Aequorea victoria EGFP),
5'-GAAGCAGCACGACTTCTTC-3' (SEQ. ID. NO. 29); control 2 (Luciferase:
Photinus pyralis luciferase gene), 5'-CGTACGCGGAATACTTCGA-3' (SEQ.
ID. NO. 30); control 3 (Scramble: chloroplast Euglena gracilis gene
coding for 5S and 16S rRNAs), 5'-GCGCGCTTTGTAGGATTCG-3' (SEQ. ID.
NO. 31); siRNA-KIF11-1 (#1), 5'-GTTAGTGTACGAACTGGAG-3' (SEQ. ID.
NO. 32); siRNA-KIF11-2 (#2), 5'-GTGTCTCTGTTGGAGATCT-3' (SEQ. ID.
NO. 33); siRNA-KIF11-3 (#3), 5'-GAAGGCAGTTGACCAACAC-3' (SEQ. ID.
NO. 34); siRNA-GHSR-1 (si-GHSR-1), 5'-CCTCTACCTGTCCAGCATG-3' (SEQ.
ID. NO. 35); siRNA-NTSR1-1 (si-NTSR1-1), 5'-GTTCATCAGCGCCATCTGG-3'
(SEQ. ID. NO. 36); siRNA-NTSR1-2 (si-NTSR1-2),
5'-GGTCGTCATACAGGTCAAC-3' (SEQ. ID. NO. 37), siRNA-RAB35
(si-RAB35), 5'-GAGATGTTCAACTGCATCA-3' (SEQ. ID. NO. 114),
siRNA-FOXM1 (si-FOXM1), 5'-GCAGCAGAAACGACCGAAT-3' (SEQ. ID. NO.
108).
[0331] The oligonucleotides used for these siRNAs are shown below.
Each constructs were prepared by cloning the following
double-stranded oligonucleotide into the BbsI site in the
psiH1BX3.0 vector. The corresponding nucleotide position relative
to the KIF11, GHSR1b, NTSR1, RAB35 and FOXM1 nucleic acid sequence
of SEQ ID NOs:1, 3, 5, 112, and 106 are listed for each
oligonucleotide sequence. Each oligonucleotide is a combination of
a sense nucleotide sequence and an antisense nucleotide sequence of
the target sequence of KIF11, GHSR1b, NTSR1, RAB35 and FOXM1. The
nucleotide sequences of the hairpin loop structure of each siRNAs
are also shown bellow. (endonuclease recognition sites are
eliminated from each hairpin loop structure sequence).
TABLE-US-00008 KIF11 si1 288-306 (for the target sequence of
gttagtgtac gaactggag/SEQ ID NO: 32) (insert F) Tccc
gttagtgtacgaactggag ttcaagaga ctccagttcgtacactaac/SEQ ID NO: 51
(insert R) Aaaa gttagtgtacgaactggag tctcttgaa
ctccagttcgtacactaac/SEQ ID NO: 52 (hairpin) gttagtgtacgaactggag
ttcaagaga ctccagttcgtacactaac/SEQ ID NO: 53 KIF11 si2 612-630 (for
the target sequence of gtgtctctgt tggagatct/SEQ ID NO: 33) (insert
F) Tccc gtgtctctgt tggagatct ttcaagaga agatctccaacagagacac/SEQ ID
NO: 54 (insert R) Aaaa gtgtctctgt tggagatct tctcttgaa
agatctccaacagagacac/SEQ ID NO: 55 (hairpin) gtgtctctgt tggagatct
ttcaagaga agatctccaacagagacac/SEQ ID NO: 56 KIF11 si3 1700-1718
(for the target sequence of gaaggcagtt gaccaacac/SEQ ID NO: 34)
(insert F) Tccc gaaggcagtt gaccaacac ttcaagaga
gtgttggtcaactgccttc/SEQ ID NO: 57 (insert R) Aaaa gaaggcagtt
gaccaacac tctcttgaa gtgttggtcaactgccttc/SEQ ID NO: 58 (hairpin)
gaaggcagtt gaccaacac ttcaagaga gtgttggtcaactgccttc/SEQ ID NO: 59
GHSR1b si1 237-255 (for the target sequence of cctctacctg
tccagcatg/SEQ ID NO: 35) (insert F) Tccc cctctacctg tccagcatg
ttcaagaga catgctggacaggtagagg/SEQ ID NO: 60 (insert R) Aaaa
cctctacctg tccagcatg tctcttgaa catgctggacaggtagagg/SEQ ID NO: 61
(hairpin) cctctacctg tccagcatg ttcaagaga catgctggacaggtagagg/SEQ ID
NO: 62 NTSR1 si1 933-951 (for the target sequence of gttcatcagc
gccatctgg/SEQ ID NO: 36) (insert F) Tccc gttcatcagc gccatctgg
ttcaagaga ccagatggcgctgatgaac/SEQ ID NO: 63 (insert R) Aaaa
gttcatcagc gccatctgg tctcttgaa ccagatggcgctgatgaac/SEQ ID NO: 64
(hairpin) gttcatcagc gccatctgg ttcaagaga ccagatggcgctgatgaac/SEQ ID
NO: 65 NTSR1 si2 1074-1092 (for the target sequence of ggtcgtcata
caggtcaac/SEQ ID NO: 37) (insert F) Tccc ggtcgtcata caggtcaac
ttcaagaga gttgacctgtatgacgacc/SEQ ID NO: 66 (insert R) Aaaa
ggtcgtcata caggtcaac tctcttgaa gttgacctgtatgacgacc/SEQ ID NO: 67
(hairpin) ggtcgtcata caggtcaac ttcaagaga gttgacctgtatgacgacc/SEQ ID
NO: 68 RAB35 si 620-638 (for the target sequence of gagatgttca
actgcatca/SEQ ID NO: 114) (insert F) Tccc gagatgttca actgcatca
ttcaagaga tgatgcagt tgaacatctc/SEQ ID NO: 115 (insert R) Aaaa
gagatgttca actgcatca tctcttgaa tgatgcagt tgaacatctc/SEQ ID NO: 116
(hairpin) gagatgttca actgcatca ttcaagaga tgatgcagt tgaacatctc/SEQ
ID NO: 117 FOXM1 si 1240-1258 (for the target sequence of
gcagcagaaacgaccgaat/SEQ ID NO: 108) (insert F) Tccc gcagcagaaa
cgaccgaat ttcaagaga attcggtcg tttctgctgc/SEQ ID NO: 109 (insert R)
Aaaa gcagcagaaa cgaccgaat tctcttgaa attcggtcg tttctgctgc/SEQ ID NO:
110 (hairpin) gcagcagaaa cgaccgaat ttcaagaga attcggtcg
tttctgctgc/SEQ ID NO: 111.
[0332] To validate RNAi system of the present invention, individual
control siRNAs (EGFP, Luciferase, and Scramble) were initially
confirmed using semiquantitative RT-PCR to decrease the expression
of the corresponding target genes that had been transiently
transfected into COS-7 cells. Down-regulation of KIF11, GHSR1b,
NTSR1, RAB35 and FOXM1 expression by their respective siRNAs
(si-KIF11-1, si-KIF11-2, si-KIF11-3, si-GHSR-1, si-NTSR1-1,
si-NTSR1-2, si-RAB35 and si-FOXM1), but not by controls, was
confirmed with semiquantitative RT-PCR in the cell lines used for
this assay.
Dominant-Negative Assays
[0333] We performed dominant-negative assays using the KOC1
deletion mutants to investigate the functional role of the
KOC1-KIF11 complex in growth or survival of lung-cancer cells. The
KOC1DEL3 and KOC1DEL2 construct (FIG. 3a; 10 .mu.g), mock plasmid
(10 .mu.g), or plasmid mixtures of both constructs in the final
dose of 10-.mu.g DNA (KOC1DEL3 or KOC1DEL2 vs mock (.mu.g),
7.5:2.5; 5:5; or 2.5:7.5, individually) were transfected into LC319
cells. The transfected cells were cultured for 7 days in the
presence of G418 and their viability was measured by triplicate MTT
assays.
(6) Co-Immunoprecipitation and MALDI-TOF Mass Spectrometry
[0334] Human lung cancer cell line LC319 cells were transfected
with bilateral-tagged pCAGGS-n3FH (NH2-terminal FLAG, COOH-terminal
HA)-KOC1 expression vector or empty vector (mock transfection).
Cells were extracted in IP-buffer (0.5% NP-40, 50 mM Tris-HCl, 150
mM NaCl, and protease inhibitor) for 30 min on ice. Extracts were
centrifuged at 14,000 rpm for 15 min, and supernatants were
subjected to immunoprecipitation using anti-Flag M2 agarose
(Sigma-Aldrich) and anti-HA beads (Sigma-Aldrich) for 1-2 hours.
The beads were washed six times with IP-buffer, and protein was
eluted by boiling the beads in Laemmli sample buffer after removing
the final wash fraction. The eluted protein was resolved by
SDS-PAGE and stained with silver staining. A 125 kDa-band was
extracted by gel extraction, and used for mass spectrometric
sequencing using MALDI-TOF mass spectrometry. This analysis
identified KIF11 as the 125 kDa product.
[0335] To confirm the interaction between KOC1 and KIF11, A549
cells were transiently co-transfected with Flag-tagged KIF11 and
myc-tagged KOC1 and the cells were immunoprecipitated with
anti-Flag M2 agarose. Subsequently, the cells were immunoblotted
with anti-myc antibody (9E10; Santa Cruz). Next, using the same
combination of vectors and cells, the cells were immunoprecipitated
with anti-myc agarose (SIGMA) and immunoblotted with anti-Flag M2
antibody (Sigma-Aldrich).
[0336] To further confirm this interaction, A549 cells were
transiently co-transfected with Flag-tagged KIF11 and myc-tagged
KOC1, and co-localization of FITC-labeled KIF11 and
rhodamine-labeled KOC1 mainly in the cytoplasm was detected by
immunocytochemical staining using FITC-labeled anti-FLAG antibody
and rhodamine-labeled anti-myc antibody, as described below.
(7) Immunocytochemistry
[0337] A549 cells grown on coverslips were cultured for 24 hours
after passage, and were co-transfected with Flag-tagged KIF11 and
myc-tagged KOC1. After 24-hours incubation, the cells were fixed
with acetone/methanol (1:1) for 5 min on ice, blocked in CAS BLOCK
(ZYMED) for 7 min at RT, and then incubated with rabbit anti-Flag
polyclonal antibody (SIGMA) for 1 hour at RT. The fixed cells were
washed 3 times with PBS, reacted with anti-rabbit IgG-FITC for 1
hour at RT. Then the cells were blocked again, and incubated with
anti-myc antibody (9E10; Santa Cruz) for 1 hour at RT. Finally
anti-mouse IgG-rhodamin was applied to the cells for 1 hour at RT.
The cells were viewed on a Leica TCS SP2-AOBS confocal
microscope.
Immunohistochemistry and Tissue-Microarray Analysis
[0338] Tumor-tissue microarrays using formalin-fixed NSCLCs were
constructed as published elsewhere (Kononen, J. et al., Nat. Med.
4, 844-847 (1998); Sauter, G. et al., Nat. Rev. Drug Discov. 2,
962-972 (2003)). KOC1 and KIF11 positivity were assessed
semi-quantitatively as absent or positive according to staining
intensity, by three independent investigators with no prior
knowledge of clinical follow-up data.
(8) Ligand-Receptor Binding Assay
[0339] To identify direct binding of NMU-25 to its candidate
receptors, GHSR1a, GHSR1b and NTSR1, the following experiments were
performed. The entire coding region of each receptor gene was
amplified by RT-PCR using primers
TABLE-US-00009 GHSR1a (5'-GGAATTCCATGTGGAACGCGACGCCCAGCGAA-3' (SEQ.
ID. NO. 38) and 5'-CGCGGATCCGCGTGTATTAATACTAGATTCTGTCCAGGCC-3'
(SEQ. ID. NO .39)), GHSR1b (5'-GGAATTCCATGTGGAACGCGACGCCCAGCGAA-3'
(SEQ. ID. NO. 40) and 5'-CGCGGATCCGCGGAGAGAAGGGAGAAGGCACAGGGA-3'
(SEQ .ID .NO .41)), and NTSR1
(5'-GGAATTCCATGCGCCTCAACAGCTCCGCGCCGGGAA-3' (SEQ. ID. NO. 42) and
5'-CGCGGATCCGCGGTACAGCGTCTCGCGGGTGGCATTGCT-3' (SEQ. ID. NO.
43)).
[0340] The products were digested with EcoRI and BamHI and cloned
into appropriate sites of p3XFLAG-CMV10 vector (Sigma-Aldrich Co.).
COS-7 cells were transfected with GHSR1b or NTSR1 expression
plasmids using FuGENE6, as described above. Transfected COS-7 cells
were cultured with 0.5 .mu.M rhodamine-labeled NMU-25 peptide
(NMU-25-rhodamine: Phoenix Pharmaceuticals. Inc.) for 12 hours,
washed five times in PBS(-), and fixed in 4% paraformaldehyde
solution for 60 min at room temperature. Then the cells were
incubated with antibodies to FLAG-tagged GHSR1a, GHSR1b, or NTSR1
proteins (Sigma-Aldrich Co.), stained with a goat anti-mouse
secondary antibody conjugated to FITC (Cappel) and viewed under
laser-confocal microscopy (TCS SP2 AOBS: Leica Microsystems). In
addition, three different negative controls were prepared for this
assay: 1) non-transfected COS-7 cells without addition of
NMU-25-rhodamine; 2) non-transfected COS-7 cells treated with
NMU-25-rhodamine; and 3) COS-7 cells transfected with GHSR1a,
GHSR1, or NTSR1 without NMU-25-rhodamine. COS-7 cells transfected
with a known NMU receptor (NMU1R) served as a positive control for
the assay.
[0341] To confirm the binding of NMU-25 to the candidate receptors,
flow-cytometric analysis was performed using the same series of
COS-7 cells. Specifically, COS-7 cells were plated at a density of
1.times.105 cells/100-mm dish and transfected with either GHSR1b,
NTSR1, or NMU1R expression vectors; 24 hours after transfection,
cells were incubated with 0.5 .mu.M NMU-25-rhodamine for 12 hours,
washed, trypsinized, collected in PBS, and washed once more in PBS.
The population of cells binding to rhodamine-labeled NMU-25 was
determined by flow cytometry.
[0342] To further confirm binding of NMU-25 to the endogenous
candidate receptors on the NSCLC cells, we performed
receptor-ligand binding assay using the LC319 and PC-14 cells.
Briefly, these cells trypsinized were seeded onto 96-well
black-wall, clear-bottom microtiter plates 24 hours prior to the
assay. The medium was removed and the cells were incubated with
Cy5-NMU-25 with a 10-fold excess of unlabeled competitor. The plate
was incubated in the dark for 24 hours at 37.degree. C. and was
scanned on the 8200 Cellular Detection System (Applied Biosystems).
8200 Analysis Software creates a digitized gray scale image,
quantitates the amount of fluorescence bound on the surface of each
cell, and enumerates the fluorescent cells.
Measurement of cAMP Levels
[0343] Trypsinized LC319 cells were seeded onto 96-well microtiter
plate (5.0.times.10.sup.4 cells) and cultured in 10% FCS (+)
RPMI-1640 medium for 24 hours, and then medium was changed to serum
free RPMI-1640 medium/1 mM IBMX (isobutylmethylxanthine) for 20 min
prior to assay. Cells were incubated with NMU-25 peptides for 20
min prior to measuring the cAMP level using the cAMP EIA System
(Amersham Biosystems).
Intracellular Ca.sup.2+ Mobilization Assay
[0344] Trypsinized LC319 cells were seeded onto poly-D-lysine
coated 384-well black-wall, clear-bottom microtiter plate
(1.0.times.10.sup.4 cells/ml) 24 hours prior to assay. Cells were
loaded for 1 hour with 1 mM Fluo-4-AM fluorescent indicator dye in
assay buffer (Hank's balanced salts solution, 20 mM HEPES, 2.5 mM
probenecid), washed three times with assay buffer, and then
returned to the incubator for 10 min before assay on a fluorometric
imaging plate reader (FLIPR, Molecular Devices). Maximum change in
fluorescence over base line was used to determine the response of
the cells to the NMU-25 peptides stimulation.
Identification of Downstream Genes of NMU by cDNA Microarray
[0345] LC319 cells were transfected with either siRNA against NMU
(si-NMU) or Luciferase (control siRNA). mRNAs were extracted 12,
24, and 36 hours after transfection, labelled with Cy5 or Cy3 dye
and subjected to co-hybridization onto cDNA microarray slides
containing 32,256 genes as described (Kakiuchi, S., et al., (2004).
Hum. Mol. Genet. 13, 3029-3043, Ochi, K. et al., (2004). Int. J.
Oncol. 24, 647-655.). After normalization of the data, genes with
signals higher than the cut-off value were analyzed further. Genes
whose intensity were significantly decreased in accordance with the
time-dependent reduction of NMU expression were initially selected
using SOM cluster analysis. Validation of candidate downstream
genes of NMU was performed using semiquantitative RT-PCR
experiments of the same mRNAs from LC319 cells used for microarray
hybridization, with gene-specific primers listed below.
TABLE-US-00010 FLJ42024 (5'-AAAAAGGGGATGCCTAGAACTC-3' (SEQ. ID. NO.
118) and 5'-CTTTCAGCACGTCAAGGACAT-3' (SEQ. ID. NO. 119)), GCDH
(5'-ACACCTACGAAGGTACACATGAC-3' (SEQ. ID. NO. 120) and
(5'-GCTATTTCAGGGTAAATGGAGTC-3' (SEQ. ID. NO. 121)), CDK5RAP1
(5'-CAGAGATGGAGGATGTCAATAAC-3' (SEQ. ID. NO. 122) and
(5'-CATAGCAGCTTTAAAGAGACACG-3' (SEQ. ID. NO. 123)), LOC134145
(5'-CCACCATAACAGTGGAGTGGG-3' (SEQ. ID. NO. 124)
(5'-CAGTTACAGGTGTATGACTGGGAG-3' (SEQ. ID. NO. 125)), NUP188
(5'-CTGAATACAACTTCCTGTTTGCC-3' (SEQ. ID. NO. 126) and
(5'-GACCACAGAATTACCAAAACTGC-3' (SEQ. ID. NO. 127)).
[0346] Expression of the candidate genes was additionally detected
by semiquantitative RT-PCR using mRNAs isolated at 72 and 96 hours
from LC319 cells treated with 1 .mu.M NMU-25 or BSA at the time
point of 0 and 48 hours.
Results
[0347] (1) Identification of KIF11 as a Protein Interacting with
KOC1
[0348] LC319 cells transfected with pCAGGS-n3FH-KOC1 vector were
extracted and immunoprecipitated with anti-Flag M2 monoclonal
antibody, and subsequently immunoprecipitated with anti-HA
monoclonal antibody. The protein complex including KOC1 was stained
with silver staining on SDS-PAGE gel. A 125 kDa band that was
absent in mock transfection was extracted and determined to be
KIF11 (NM.sub.--004523; SEQ. ID. NO. 1) by Mass spectrometric
sequencing.
(2) Confirmation of Interaction Between KOC1 and KIF11
[0349] The A549 cells co-transfected with Flag-tagged KIF11 and
myc-tagged KOC1, the cells transfected with either KIF11 or KOC1,
and the non-transfected cells were immunoprecipitated with
anti-Flag M2 agarose and subsequently immunoblotted with anti-myc
antibody. In contrast, the same series of A549 cells were
immunoprecipitated with anti-myc agarose and immunoblotted with
anti-Flag M2 antibody. A single band was found only when both
constructs were co-transfected (FIG. 1a). Immunocytochemistry
showed that FLAG-tagged FITC-labeled KIF11 co-localized in
cytoplasm of A549 with myc-tagged rhomamine-labeled KOC1 (FIG.
1b).
[0350] Next, we confirmed by western blot analysis that anti-KOC1
antibody are specific to KOC1 and do not cross-react with other
homologous proteins, IMP-1 and IMP-2 using H520 cell lysate, which
had been confirmed to be not expressed endogenous IMP-1, -2, and -3
(KOC1), but had been transfected with HA-tagged IMP-1, -2, and -3
(KOC1) expression vector. Lysates of LC319 cells transfected with
pCAGGS-FLAG-tagged-KOC1 vector or mock vector (control) were
extracted and immunoprecipitated with anti-FLAG M2 monoclonal
antibody. The protein complex including KOC1 was stained with
SilverQuest (Invitrogen) on an SDS-PAGE gel. A 125-kDa band was
detected specifically in immunoprecipitates from lysates of cells
transfected with KOC1 expressing plasmids, but not in control
lysates (mock plasmids). Subsequent MALDI-TOF mass spectrometric
analysis identified this 125-kDa protein as KIF11, a member of the
kinesin family. We confirmed direct interaction between endogenous
KOC1 and KIF11 by immunoprecipitation experiments with extracts
from A549 and LC319, using affinity-purified anti-KOC1 and
anti-KIF11 polyclonal antibodies (FIG. 1c).
(3) KIF11 Expression in NSCLC
[0351] Validation of KIF11 expression was performed in primary
NSCLCs (clinical samples) and lung cancer cell lines. Increased
KIF11 expression was confirmed in 12 of 16 NSCLC cases (5 of 8 ADCs
and in 7 of 8 SCCs. In addition, up-regulation of KIF11 were
observed in 14 of the 15 NSCLC cell lines.
[0352] We subsequently re-examined primary NSCLC tissues and
lung-cancer cell lines, and found increased KIF11 expression in 18
NSCLC clinical samples as well as in all of the 20 NSCLC or SCLC
cell lines examined by quantitative RT-PCR (FIG. 2a,b). The mRNA
levels of the KOC1 and KIF11 genes relative to ACTB genes were
significantly correlated (r=0.702, P=0.0029 by the Spearman rank
correlation). These two genes were coactivated in almost lung
cancer cell lines (r=0.458, P=0.0359 by the Spearman rank
correlation).
(4) KIF11 Expression in Normal Human Tissues
[0353] Northern blotting with KIF11 cDNA as a probe identified 4.5-
and 5.5-kb transcripts as very weak bands, only seen in placenta,
testis, and bone marrow, among the 23 normal human tissues
examined. The reported cDNA sequence of KIF11 was considered to
correspond to the larger transcript. To investigate the transcript
corresponding to the smaller band, we reversely transcribed mRNAs
isolated from tissues of the testis and NSCLC cell lines. We
amplified the entire sequence of KIF11 cDNA by PCR using four
primer sets, but found no alternatively-spliced transcript in these
samples. Therefore, the smaller band may reflect
cross-hybridization to the transcript of some related gene(s). The
expression pattern of KIF11 in normal human tissues was
significantly correlated with that of KOC1 (FIG. 2c).
Identification of the KIF11-Binding Region in KOC1
[0354] To determine the specific domain of KOC1 required for
interaction with KIF11, we transfected into COS-7 cells one of five
deletion-constructs of KOC1 with NH.sub.2 (N)-terminal FLAG- or
COOH (C)-terminal HA-tagged sequences (KOC1DEL1-5; FIG. 3a).
Immunoprecipitation with monoclonal anti-HA indicated that the
KOC1DEL4 and KOC1DEL5 constructs, which both lacked two
RNA-recognition motifs (RRMs), were unable to interact with
endogenous KIF11, while all KOC1 constructs possessing the two RRMs
retained binding affinity for KIF11 (FIG. 3b).
[0355] Isolation of mRNAs Associated with the KOC1-KIF11 Complex
Using RNA-Immunoprecipitation and cDNA Microarray
[0356] KOC1 protein is known to exhibit multiple attachments to
IGF2 leader-3 mRNA, possibly through its two functional RRMs and
four K-homologous (KH) domains (Nielsen, J. et al., Mol. Cell Biol.
19, 1262-1270 (1999).). However, we did not detect expression of
IGF2 mRNA in any of the lung-cancer cell lines or clinical NSCLC
tissue samples we examined. Therefore, to elucidate the function of
KOC1 in lung carcinogenesis, we searched for mRNA(s) that would
interact with KOC1 and might thereby play important roles in growth
and/or progression of lung cancer. First we immunoprecipitated
mRNAs using anti-KOC1 antibody and five NSCLC cell lines (A549,
LC319, PC14, RERF-LC-AI, and SK-MES-1). Then, Cy-5-labeled
immunoprecipitated RNAs (IP-mRNA) and Cy-3-labeled total RNAs
isolated from each matching cell line, were co-hybridized on human
cDNA microarrays (IP-microarray). Among 32,256 genes screened, we
identified a total of 55 that were enriched in IP-mRNA compared
with total RNA in at least four of the five NSCLC cell lines tested
(see Table 2), and confirmed enrichment of all those candidates by
RT-PCR using the IP-mRNAs as templates (IP-RT-PCR). To examine the
specificity of RNA-immunoprecipitation, we performed RT-PCR
experiments with beta-actin (ACTB) mRNA using IP-mRNA as template;
no ACTB was precipitated by anti-KOC1 antibody. As background
controls of RNA-immunoprecipitation, we precipitated mRNAs using
normal rabbit IgG and five NSCLC cell lines, and confirmed that
none of eight KOC1 associated mRNAs tested (CCT2, SBP2, SLC25A3,
RAB35, PSMB7, GL, PKP4, and WINS1) was precipitated by normal
rabbit IgG. We also confirmed elevated expression of many of the
candidate genes in NSCLC samples by RT-PCR (data not shown). To
examine whether the KOC1-KIF11 complex formation requires the
co-presence of these KOC1-associated mRNAs, we performed
immunoprecipitation experiments using cell lysates which were
treated or untreated in vitro with 30 units of RNase T1 (SIGMA),
and found no difference in the interaction of the two proteins in
the presence or absence of mRNAs, suggesting that the KOC1-KIF11
complex formation is unlikely to require these specific mRNAs.
[0357] By pursuing that strategy we have been able to show that
KOC1 and KIF11 not only are co-over-expressed in the great majority
of clinical NSCLC samples and cell lines, but also that a complex
formed by the products of these genes is indispensable for growth
and progression of NSCLC cells, by contributing to an intra- and
inter-cellular mRNA-transporting system. Intracellular mRNA
transport by RNA-binding proteins has been reported in oocytes and
developing embryos of Drosophila and Xenopus, and in somatic cells
such as fibroblasts and neurons (King, M. L. et al., Bioessays 21,
546-557 (1999); Mowry, K. L. & Cote, C. A. Faseb. J. 13,
435-445 (1999); Lasko, P., J. Cell Biol. 150, F51-56 (2000);
Steward, O. Neuron 18, 9-12 (1997)) beta-actin mRNA is transported
to the leading lamellae of chicken-embryo fibroblasts (CEFs) and to
the growth cones of developing neurons (Lawrence, J. B. &
Singer, R. H. Cell 45, 407-415 (1986); Bassell, G. J. et al., J.
Neurosci. 18, 251-265 (1998)). The localization of ACTB mRNA
depends on the "zipcode", a cis-acting element in the 3'UTR of the
mRNA (Kislauskis, E. H. et al., J. Cell Biol. 123, 165-172 (1993)).
The respective trans-acting factor, zipcode-binding protein 1
(ZBP1), was identified by affinity purification with the zipcode of
ACTB mRNA; (Ross, A. F. et al., Mol. Cell Biol. 17, 2158-2165
(1997)) homologues of ZBP1 have since been identified in a wide
range of organisms including Xenopus, Drosophila, mouse, and human
(Mueller-Pillasch, F. et al., Oncogene 14, 2729-2733 (1997);
Deshler, J. O. et al., Science 276, 1128-1131 (1997); Doyle, G. A.
et al., Nucleic Acids Res. 26, 5036-5044 (1998)). ZBP1-like
proteins contain two RRMs in the N-terminal region and four hnRNP
KH (ribonucleoprotein K-homology) domains at the C-terminal end.
KOC1, one of the IGF2 mRNA-binding proteins, is considered to be a
member of the ZBP1 family; it exhibits multiple attachments to IGF2
leader-3 mRNA (Nielsen, J. et al., Mol. Cell Biol. 19, 1262-1270
(1999)) and is over-expressed in several types of cancers
(Mueller-Pillasch, F. et al., Oncogene 14, 2729-2733 (1997); Zhang,
J. Y. et al., Clin. Immunol. 100, 149-156 (2001); Mueller, F. et
al., Br. J. Cancer 88, 699-701 (2003); Wang, T. et al., Br. J.
Cancer 88, 887-894 (2003)). However, since we failed to detect
expression of IGF2 leader-3 mRNA in most of the NSCLC cell lines or
clinical samples we examined, we suspected that KOC1 could mediate
growth of lung-cancer cells through interaction with, and transport
of, other mRNA(s). When we undertook RNA-immunoprecipitation
experiments coupled with cDNA microarrays (IP-microarray), we
identified dozens of candidate mRNAs that were likely to be
associated with KOC1 in NSCLC cells (see Table 2). That list
included genes encoding proteins with functions of cell-adhesion
(PKP4, L1CAM1), cancer-cell progression and invasion (IGFBP2), and
binding of small GTPs (RAB35), (Papagerakis, S. et al., Hum.
Pathol. 34, 565-572 (2003); Fogel, M. et al., Cancer Lett. 189,
237-247 (2003); Wang, H. et al., Cancer Res. 63, 4315-4321 (2003);
Zhao, H. et al., Biochem. Biophys. Res. Commun. 293, 1060-1065
(2002)) and many of them were expressed at high levels in clinical
NSCLC samples (data not shown). Activation of a system that
transports mRNAs whose products are associated with growth or
movement of cells is very interesting, and further investigations
along this line could lead to a better understanding of pulmonary
carcinogenesis.
TABLE-US-00011 TABLE 2 RANK.sup.(1) GENE ACCESSION A549 LC319 PC14
RERF SKMES1 SUM* 1 LOC283050 AA843724 6.0 7.7 5.4 6.4 9.2 34.7 2
KIAA0169 R49113 6.2 8.9 4.9 5.7 6.8 32.5 3 CCT2 AF026166 4.1 8.0
5.4 5.7 9.1 32.3 4 LOH11CR2A NM_014622 9.1 5.6 5.8 3.9 4.5 28.8 5
SNTB2 AA625860 6.0 5.0 6.8 4.0 5.0 26.9 6 CFLAR U97074 5.3 5.7 3.8
4.3 5.9 25.0 7 SBP2 AF380995 5.0 6.1 3.9 2.9 6.1 24.0 8 LOC56267
AA420728 4.8 5.4 5.4 2.5 5.0 23.1 9 SLC25A3 NM_002635 3.5 5.8 2.9
4.1 5.3 21.7 10 IFIT1 M24594 4.4 4.2 3.8 3.6 5.2 21.2 11 OSTalpha
H79642 2.3 5.9 5.6 3.8 2.8 20.4 12 FILIP1 XM_029179 10.3 2.3 2.1
2.7 2.5 19.9 13 ZNF415 AY283600 3.5 5.2 3.3 4.0 3.8 19.8 14 RAB35
BX344673; 3.0 4.1 4.2 4.0 4.6 19.8 NM_006861 15 APG-1 AW966019 0.0
6.2 6.2 2.5 4.4 19.4 16 INPP4B AA759168 3.4 3.2 4.4 3.6 4.5 19.1 17
na AI160370 3.6 4.1 2.9 4.6 3.1 18.3 18 N33 NM_006765 4.5 0.0 4.0
4.7 5.0 18.1 19 RPS3A BX343424 1.6 4.5 3.2 3.1 4.3 16.8 20 PSMB7
BM837906 4.0 4.2 2.2 3.1 2.9 16.5 21 GIT2 NM_057169 3.4 4.2 2.3 2.9
3.4 16.1 22 GL AJ420489 4.4 3.2 3.2 2.3 2.9 16.0 23 SOS2 XM_043720
2.1 3.5 2.5 2.3 4.7 15.1 24 L1CAM M77640 3.4 2.9 2.5 2.6 3.6 14.9
25 BRUNOL4 BM671360 2.8 3.8 1.7 2.5 4.1 14.9 26 RRAGA U41654 2.9
4.3 2.4 2.4 2.8 14.8 27 IGFBP2 BC004312 3.9 3.7 2.0 2.5 2.6 14.8 28
SRPK1 BC038292 3.3 2.5 2.8 2.8 3.4 14.8 29 FLJ12649 R41135 1.2 2.8
2.6 3.4 4.5 14.4 30 AGL NM_000028 4.0 2.8 2.6 2.5 2.4 14.3 31
FLJ23468 BX355581 3.0 3.4 3.0 2.1 2.4 13.9 32 MGC4730 BM665147 2.6
2.8 2.6 2.3 3.1 13.4 33 GAB2 NM_012296 3.7 3.4 1.3 2.8 2.2 13.4 34
USP15 AF106069 2.0 3.0 2.4 2.6 3.2 13.1 35 KIAA0657 AB014557 0.0
4.7 2.2 3.0 3.1 13.1 36 C6orf134 AI146643 3.2 0.0 2.5 2.7 4.5 12.8
37 MSCP AK093931 2.5 3.0 4.2 3.0 0.0 12.7 38 ACAA2 D16294 2.1 2.0
3.0 2.6 3.1 12.7 39 PKP4 AI681111 3.2 2.5 2.9 1.7 2.3 12.6 40 RGS5
BX537427 2.0 3.0 1.3 3.4 2.8 12.5 41 CYFIP1 BC005097 2.2 2.1 2.6
1.3 4.0 12.2 42 PLAGL2 AK026951 1.2 2.7 2.3 2.4 3.3 11.9 43 EHD4
AW779971 2.7 2.3 2.3 1.9 2.6 11.9 44 KIAA1666 XM_300791 2.1 2.9 2.4
2.3 2.2 11.9 45 RAP80 BX537376 2.4 2.1 3.0 1.8 2.5 11.7 46
LOC118812 BG537484 0.0 2.3 2.3 3.2 3.7 11.5 47 UTX AF000993 1.0 2.2
2.8 3.2 2.2 11.4 48 PCBP3 AK094301 2.4 2.9 1.3 2.3 2.5 11.4 49
AP3S2 BC002785 2.4 2.3 1.2 2.8 2.3 11.0 50 WINS1 AA741459 1.4 3.0
2.2 2.1 2.2 10.9 51 na.sup.(2) AF504647 0.8 2.0 2.1 2.1 3.6 10.7 52
LOC203859 AL832374 2.0 2.6 2.5 3.4 0.0 10.5 53 HNMT NM_006895 2.3
2.0 1.9 2.1 2.2 10.5 54 LOC282965 XM_210833 1.1 2.8 2.0 2.2 2.0
10.1 55 PDK2 AK055119 1.0 2.4 2.2 2.4 2.0 10.0 N/C.sup.(3) ACTB
BC053988 0.0 0.0 0.0 0.0 0.0 0.0 .sup.(1)Probe sets are ranked by
the sum (*) of the fold change value (IP-mRNA/input RNA) of all
five cell lines. .sup.(2)na: not annotated .sup.(3)N/C: negative
control
Identification of the mRNA-Binding Region in KOC1
[0358] To determine the region of KOC1 that is required for binding
to KOC1-associated mRNAs, we performed northwestern blot analysis
using immunoprecipitated recombinant proteins of KOC1
deletion-mutants expressed in A549 cells (FIG. 4a) and DIG-labeled
RAB35 mRNA, which is one of the KOC1 associated mRNAs. The
KOC1DEL3, which lacked four KH domains, and KOC1DEL5, which lacked
N-terminal two RRMs and C-terminal two KH domains, did not bind to
the RAB35 mRNA. On the other hand, the KOC1DEL4, which is a
construct with only the four KH domains and the KOC1DEL2, a
construct without C-terminal two KH domains showed very weak
binding affinities for mRNAs compared to the full-length KOC1
construct (FIG. 4b), suggesting the importance of two RRMs as well
as of C-terminal two KH domains for binding to KOC1-associated
mRNAs.
[0359] We further expressed five of the KOC1 deletion-mutants in
A549 cells and performed immunoprecipitation experiments twice with
the cell lysates, first with monoclonal anti-HA and then with
monoclonal anti-FLAG M2 antibody. Using IP-mRNA, we examined the
ability of each deleted-protein to bind to eight endogenous mRNAs
(CCT2, SBP2, SLC25A3, RAB35, PSMB7, GL, PKP4, and WINS1) selected
from the above list (see Table 2). The results were completely
concordant to that of northwestern blot analysis, independently
confirming that both C-terminal two KH domains and two RRMs in the
N-terminal are indispensable for effective binding of KOC1 to mRNAs
(FIG. 4c).
[0360] Microtubule Dependent Intra- and Inter-Cellular Transport of
an KOC1-KIF11 Ribonucleoprotein Complex and KOC1-Associated
mRNAs
[0361] To further investigate the functional roles of KOC1 and
KIF11, we prepared plasmids designed to express ECFP-KOC1 (cyan)
and EYFP-KIF11 (yellow). We then transfected the two plasmids
together into COS-7 cells, and examined their localization using
immunofluorescence video-microscopy and real-time confocal
microscopy. Cells expressing both KOC1 and KIF11 protruded into the
processes, and then connected with adjacent cells (data not shown).
A more detailed observation of living cells found that the KOC1 had
formed a complex with KIF11 (KOC1-KIF11 RNP complex; green
particle) that was transported from one cell to another through an
ultrafine structure connecting the two cells (FIG. 5a). Movement of
the KOC1-KIF11 complex appeared to be unidirectional from one cell
to another.
[0362] Furthermore, to examine whether KOC1-KIF11 complex could
specifically transport KOC1-associated-mRNAs from one cell having a
high level of KOC1-RNP complex to another having a lower level of
the complex, we mixed and co-cultured two different cell
populations; one is COS-7 cells that had been transfected with
pEGFP-KOC1 (green) as well as Alexa Fluor 546-labeled full-length
RAB35 mRNA (red), and the other is parental COS-7 cells simply
labeled with CellTracker (blue). We observed that not only KOC1
particles (green), but also RNP particles of KOC1-RAB35 mRNA
(yellow) were transferred through the ultrafine structure from the
former cells to the latter ones (FIG. 5b). Using in situ
hybridization on A549 cells in which both KOC1 and KIF11 were
over-expressed, we further confirmed that the endogenous RAB35 mRNA
(green) localized on the ultrafine intercellular structures as well
as in the cytoplasm (data not shown).
[0363] We also investigated the endogenous location of KOC1 and
KIF11 particles on the ultrafine structure of microtubules bridging
individual A549 cells by an immunocytochemical study, using
affinity-purified anti-KOC1- or anti-KIF11 for primary antibody and
Alexa594-labeled anti-rabbit IgG for secondary antibody (Molecular
Probe) and anti-alpha-tubulin-FITC monoclonal antibody. A549 cells
treated with 10 .mu.M of the microtubule disrupting agent
nocodazole (SIGMA) for four hours showed collapse and aggregation
of endogenous KOC1 and KIF11, along with the depolymerization of
microtubules in the cytoplasm. Moreover, no particle was found on
the residual structure between the cells. The result suggested the
possibility of a microtubule-dependent transporting mechanism
involving the KOC1-KIF11 complex. To further clarify the detailed
mechanism by which the KOC1-KIF11 complex transports mRNAs in NSCLC
cells, we have searched for other component(s) that might be
interacting with KIF11. Immunoprecipitation with anti-KIF11
polyclonal antibody using a lysate of LC319 cells identified a
150-kDa protein, which was later determined to be a dynactin 1
(DCTN1; p150, glued homolog, Drosophila) by MALDI-TOF
mass-spectrometric analysis. DCTN1 is the largest subunit of DCTN,
which binds to the cytoplasmic motor-protein dynein and activates
vesicle transport along microtubules (Holzbaur, E. L. & Tokito,
M. K. Genomics 31, 398-399 (1996); Tokito, M. K. et al., Mol. Biol.
Cell 7, 1167-1180 (1996)), or binds to KIF11 to probably
participate in centrosome separation (Blangy, A. et al., J. Biol.
Chem. 272, 19418-19424 (1997)). We observed endogenous
co-localization of KOC1/KIF11 and DCTN1 on the ultrafine structure
between the individual A549 cells by immunocytochemistry, using the
combination of affinity-purified anti-KOC1- or
anti-KIF11-polyclonal antibodies for primary antibody and
Alexa488-labeled anti-rabbit IgG for secondary antibody, and the
combination of anti-DCTN1 monoclonal antibody (BD transduction
Laboratories, #610473) for primary antibody and
anti-Alexa594-labeled anti-rabbit IgG for secondary antibody. And
we confirmed direct interaction between endogenous KIF11 and DCTN1
by immunoprecipitation experiments with extracts from A549 and
LC319 cells, using anti-KIF11 polyclonal antibody and anti-DCTN1
monoclonal antibody (BD transduction Laboratories, #610473) (FIG.
6a).
[0364] To further demonstrate the KIF11-dependent intercellular
transport of mRNA, we examined the effect of monastrol, the
cell-permeable inhibitor that specifically inhibits the KIF11.
Previous reports indicated that monastrol partially inhibits KIF11
ATPase activity through binding directly to the motor domain
(DeBonis, S. et al., Biochemistry 42, 338-349 (2003); Kononen, J.
et al., Nat. Med. 4, 844-847 (1998)). Treatment of A549 cells with
150 .mu.M monastrol (SIGMA) for 24 hours induced the accumulation
of endogenous KIF11 and exogenous EYFP-KIF11 at the center of
monoaster along microtubules and the cell cycle arrest in mitosis
with monopolar spindles, which is called "monoastral spindle".
Treatment of A549 cells with 150 .mu.M of monastrol for 24 hours
induced cell cycle arrest for mitotic cells with monopolar spindles
that is called "monoastral spindle" and also caused accumulation of
endogenous KIF11 at the center of monoaster along microtubules. On
the other hand, most non-mitotic cells lost protrusion into the
processes and then lost connection to adjacent cells within 2-hour
of the monastrol treatment. Further quantitative analysis by
counting the number of intercellular ultrafine structures (n=252
structures) with time-lapse video-microscopy demonstrated that more
than a half of the cell-to-cell connections in non-mitotic cells
tested disappeared by the one-hour monastrol treatment. However,
six hours after the release of the cells from the monastrol
exposure, the intercellular bridge formation was re-constituted and
cells at normal mitosis process was observed, indicating that KIF11
was indispensable for the formation of ultrafine intercellular
structures (data not shown).
[0365] Some cells lost protrusion into the processes and then did
not connected with adjacent cells. A more detailed observation of
living cells found that no KOC1-KIF11 RNP complex (green particle)
was transported from one cell to another through an ultrafine
structure connecting the two cells, which subsequently disappeared
during observation.
[0366] In this study we demonstrated endogenous interaction of
KOC1, KIF11 and DCTN1 in human lung cancers, and revealed a
possible role of those complexes in transport of mRNAs from one
cell to another. DCTN1, the largest subunit of DCTN, binds to the
cytoplasmic motor protein dynein and activates vesicle transport
along microtubules (Holzbaur, E. L. & Tokito, M. K. Genomics
31, 398-399 (1996)). Dynein-DCTN interaction is probably a key
component of the mechanism of axonal transport of vesicles and
organelles (Holzbaur, E. L. & Tokito, M. K. Genomics 31,
398-399 (1996); Tokito, M. K. et al., Mol. Biol. Cell 7, 1167-1180
(1996)). The binding of DCTN to dynein is reportedly critical for
neuronal function, since antibodies that specifically disrupt this
binding block vesicle motility along microtubules. In vitro
interaction of DCTN1 and KIF11, and their co-localization during
mitosis have been observed (Blangy, A. et al., J. Biol. Chem. 272,
19418-19424 (1997)), but no report has shown an intercellular
transporting system involving this complex. Since in our
experiments KIF11, a member of the kinesin family, was
over-expressed in NSCLCs along with KOC1, we suggest that direct
interaction of KOC1, KIF11, and DCTN1 could play a significant role
in establishing specific alignment of microtubules between
lung-cancer cells.
Protein Synthesis by Transported KOC1-Associated mRNAs in the
Receiving Cells
[0367] To elucidate whether the mRNA transport by KOC1-KIF11 RNP
complex is physiologically relevant (the recipient cell can
synthesize the protein by translating the mRNAs transported), we
constructed an expression vector of full length RAB35 mRNA, one of
the binding targets of the KOC1/KIF11 complex, fused in frame to
myc tagged and an EGFP protein sequences. We then investigated
whether this chimeric mRNA could be transportable from one cell to
another and subsequently translated into the protein production in
the recipient cell. FLAG-tagged KOC1 and KIF11 expressing-COST
cells were transfected with constructs with these RAB35
mRNA-expressing construct (cell A). Parental mRNA-recipient COS-7
cells were simply stained with CellTracker (blue; cell B). These
two cell populations were mixed together and co-cultured for 24
hours. We first confirmed the intercellular transportation of
RAB35-EGFP mRNAs between cells A and B by in situ hybridization
using antisense EGFP as a probe; after co-culture of the cells for
24 hours, weak-staining of RAB35-EGFP mRNAs were detected in the
CellTracker-stained cell B as well as on the ultrafine structure
between the two cell types (FIG. 7a). We then examined a presence
of the EGFP-fused RAB35 proteins in the CellTracker-stained B-type
cells were found using immunocytochemistry and time-lapse video
microscopy, respectively (FIGS. 7b and 7c). During these
observations using time-lapse video microscopy, no visible
EGFP-protein particle was transported from the type-A to type-B
cells, but the EGFP protein gradually appeared in the apparatus of
cytoplasm, which seemed to be endoplasmic reticulum (ER) of in the
type-B cells (FIG. 7d). These results have indicated that KOC1 and
KIF11 should functionally associate with a subset of mRNAs, which
encode proteins possibly inducing cell proliferation and/or
adhesion, and that the presence of KOC1 and KIF11 is indispensable
to the cell-to-cell transportation. Although previous reports
suggested that high KOC1 levels might interfere with translation of
bound mRNAs such as IGF2 leader-3, our experiment of
co-transfecting KOC1 and full-length RAB35-EGFP mRNA constructs
together into COS-7 cells detected no decrease of RAB35-EGFP-fused
protein levels (FIG. 7e).
[0368] Our experiments also revealed formation of protruding
processes connecting adjacent cells, and showed predominant
co-distribution of transfected RAB35 mRNAs and KOC1 protein on
ultra-fine intercellular structures in two lung-cancer cell lines
(A549 and LC319) that expressed high levels of endogenous KOC1 and
KIF11. On the other hand, we did not find specific localization of
transfected RAB35 mRNAs in NCI-H520 cells, which express KIF11 but
not KOC1. That observation supported the importance of
co-activation of KOC1 and KIF11 for communication among cancer
cells. Among the known cell-to-cell communication systems in human
cancers, formation of functional gap junctions between malignant
glioma cells and vascular endothelial cells appears to influence
angiogenesis in the tumors (Zhang, W. et al., Cancer Res. 59,
1994-2003 (1999); Zhang, W. et al., J. Neurosurg. 98, 846-853
(2003)). However, to our knowledge ours is the first report to
describe inter-cellular transport of mRNA by means of
ribonucleoprotein particles combined with motor proteins in
mammalian somatic cells and to assess its biological significance
for formation of an inter-cellular network critical for growth and
survival of cancer cells.
(5) Inhibition of Growth of NSCLC Cells by siRNA Against KIF11
[0369] Transfection of either siRNA plasmids for KIF11 into A549
(FIG. 8a) or LC319 (data not shown) cells suppressed mRNA
expression of the KIF11 in comparison to cells containing any of
the three control siRNAs and mock transfection. In accordance with
the reduced mRNA expression, A549 and LC319 cells showed
significant decreases in cell viability and colony numbers measured
by MTT (FIG. 8b) and colony-formation assays (data not shown). We
also investigated the effect by siRNA against KIF11 on
intercellular transport using time-lapse videoscopy. A similar
phenomenon to monastrol treatment was observed; some cells reduced
protrusion into the processes and the disappearance of the
ultrafine structure connecting the two cells.
[0370] To investigate the functional significance of KOC1-KIF11
interaction for growth or survival of lung-cancer cells, a deletion
fragment of KOC1 containing the two RRMs, which was able to
interact with KIF11 (KOC1DEL3; FIG. 3a, b) was examined for a
dominant-negative function of suppressing direct interaction
between endogenous KOC1 and KIF11. We transfected KOC1DEL3 and mock
plasmid (control) into LC319 cells and detected interaction of
KOC1DEL3 with endogenous KIF11. We further verified that
overexpression of the RRM domains reduce complex formation between
KOC1 and KIF11 by immunoprecipitation (FIG. 9a,b). Expectedly,
transfection of that fragment resulted in significant
dose-dependent decreases in cell viability as measured by MTT assay
(P<0.001, KOC1DEL3 vs mock; FIG. 9c). We also confirmed that
transfection of construct containing only KH-domains control have
no effect on proliferation.
[0371] Furthermore, to investigate the functional significance of
KOC1-KIF11 interaction for growth or survival of lung-cancer cells,
a deletion fragment of KOC1, which lacked the C-terminal two
KH-domains indispensable for mRNA binding but was able to interact
with KIF11 (KOC1DEL2; FIG. 3a, b), was examined for a
dominant-negative function of suppressing direct interaction
between endogenous KOC1 and KIF11. We transfected KOC1DEL2 and mock
plasmid (control) into A549 cells and detected interaction of
KOC1DEL2 with endogenous KIF11 (FIG. 9d). We further verified by
immunoprecipitation that over-expression of the KOC1DEL2 reduced
complex formation between endogenous KOC1 and KIF11 (FIG. 9e).
Expectedly, transfection of the dominant-negative fragment resulted
in significant dose-dependent decreases in cell viability as
measured by MTT assay (P=0.0006, KOC1DEL2 vs mock; FIG. 9f).
[0372] We also examined some biological role(s) of these
KIF11-transporting mRNAs in controlling the cell growth or survival
of lung-cancer cells, we constructed plasmid to express siRNA
against RAB35 (si-RAB35), which was identified as the KOC1-RNP
complex-associated mRNAs. Transfection of the plasmids (si-RAB35)
into A549 cells significantly suppressed expression of endogenous
RAB35 in comparison with the controls, and resulted in significant
decreases in cell viability and colony numbers measured by MTT and
colony-formation assays (FIG. 10a,b).
Association of KOC1 and KIF11 Over-Expression with Poor Prognosis
of NSCLC Patients
[0373] We performed immunohistochemical analysis with anti-KOC1 and
anti-KIF11 polyclonal antibodies using tissue microarrays
consisting of 265 NSCLC tissues (FIG. 11a). Of the 265 cases, KOC1
staining was positive for 172 (64.9%); 129 cases were positive for
KIF11 (48.7%). The expression pattern of KOC1 was significantly
concordant with KIF11 expression in these tumors (X.sup.2=60.8,
P<0.0001). We then asked whether KOC1 and/or KIF11
over-expression could be associated with clinical outcome. We found
that expression of KOC1 in NSCLCs was significantly associated with
pT factor status (X.sup.2=23.1, P<0.0001) and with
tumor-specific 5-year survival (P=0.0115 by the Log-rank test)
(FIG. 11b, upper panel). Expression of KIF11 in NSCLCs was
significantly associated with pT factor (X.sup.2=15.0,
P<0.0001), pN factor (X.sup.2=4.4, P=0.0356), and 5
year-survival (P=0.0008 by the Log-rank test) (FIG. 11b, lower
panel). By univariate analysis pT, pN, gender, and KOC1/KIF11
expression were each significantly related to a poor tumor-specific
survival among NSCLC patients. Furthermore, KOC1 and KIF11 were
determined to be independent prognostic factors by multivariate
analysis using a Cox proportional-hazard model (P=0.0499 and
P=0.0259, respectively).
(6) Screening of Candidate Receptors for NMU in NSCLC
[0374] Two known NMU receptors, NMU1R (FM3/GPR66) and NMU2R (FM4)
play important roles in energy homeostasis (Fujii, R. et al., J.
Biol. Chem. 275: 21068-21074 (2000); Howard, A. D. et al., Nature
406: 70-74 (2000); Funes, S. et al., Peptides 23: 1607-1615
(2002)). NMU1R is present in many peripheral human tissues (Fujii,
R. et al., J. Biol. Chem. 275: 21068-21074 (2000); Howard, A. D. et
al., Nature 406: 70-74 (2000); Funes, S. et al., Peptides 23:
1607-1615 (2002)), but NMU2R is located only in brain. To
investigate whether NMU1R and NMU2R genes were expressed in NSCLCs,
expression of these NMU receptors were analyzed in normal human
brain and lung, in NSCLC cell lines, and in clinical tissues by
semiquantitative RT-PCR experiments. Neither NMU1R nor NMU2R
expression was detected in any of the cell lines or clinical
samples examined, although NMU1R was expressed in lung and NMU2R in
brain (data now shown), suggesting that NMU could be mediating
growth of lung-cancer cells through interaction with other
receptor(s).
[0375] Since NMU2R and NMU1R were originally isolated as homologues
of known neuropeptide GPCRs, unidentified NMU receptor(s) were
speculated to be members of the same family that would show some
degree of homology to NMU1R/NMU2R. Hence, candidate NMU receptors
were searched using the BLAST program. The results and their high
expression levels in NSCLCs in the expression profile data of the
present inventors indicated GHSR1b (NM.sub.--004122; SEQ ID NOs: 3
and 4) and NTSR1 (NM.sub.--002531; SEQ ID NOs: 5 and 6) to be good
candidates. GHSR has two transcripts, types 1a and 1b. The
full-length human type 1a cDNA encodes a predicted polypeptide of
366 amino acids with seven transmembrane domains, a typical feature
of G protein-coupled receptors. A single intron divides its open
reading frame into two exons encoding transmembrane domains 1-5 and
6-7, thus placing the GHSR1a into the intron-containing class of
GPCRs. Type 1b is a non-spliced mRNA variant transcribed from a
single exon that encodes a polypeptide of 289 amino acids with five
transmembrane domains. The semiquantitative RT-PCR analysis using
specific primers for each variant indicated that GHSR1a was not
expressed in NSCLCs. On the other hand, GHSR1b and NTSR1 were
expressed at a relatively high level in some NSCLC cell lines, but
not at all in normal lung (FIG. 13a). The GHSR1b product has 46%
homology to NMU1R, and NTSR1 encodes 418 amino acids with 47%
homology to NMU1R.
(7) Identification of Candidate Receptors for NMU in NSCLC
[0376] To confirm direct interaction between NMU and GHSR1b/NTSR1,
COS-7 cells were transiently transfected with plasmids designed to
express FLAG-tagged GHSR1b or NTSR1, and cultured in the presence
of rhodamine-labeled NMU-25. Then the localization of FLAG-tagged
GHSR1b/NTSR1 and NMU-25-rhodamine in the cells were examined using
anti-FLAG antibodies conjugated to FITC, and found that NMU-25 and
either of both receptors were located together on the cell membrane
(FIG. 13c). Co-localization of NMU-25 with these receptors was not
observed in control assays involving either of the following
ligand/cell combinations: 1) NMU-25-rhodamine incubated with COS-7
cells that were not transfected with either of the receptor
plasmids; 2) non-transfected COS-7 cells incubated without
NMU-25-rhodamine; and 3) COS-7 cells transfected with either of the
receptor plasmids, but incubated without NMU-25-rhodamine. The
result was confirmed by flow cytometry, which revealed binding of
rhodamine-labeled NMU-25 to the surface of COS-7 cells that
expressed either of the two receptors (FIG. 13d) and binding of
rhodamine-labeled NMU-25 to the surface of COS-7 cells in a dose
dependent manner.
(8) GHSR1b Expression in Normal Human Tissues
[0377] As the expression of GHSR1b in normal human tissues was not
precisely reported at the time, the distribution of GHSR1b was
determined using human multiple tissue Northern-blot. Northern
blotting with GHSR1b cDNA as a probe identified a 0.9-kb transcript
as a very weak signal band in comparison with a 1.1-kb transcript
GHSR1a, seen in the heart, liver, skeletal muscle, pancreas, and
stomach, among the 23 normal human tissues examined (FIG. 13b).
[0378] To further confirm binding of NMU-25 to the endogenous
GHSR1b and NTSR1 on the NSCLC cells, we performed receptor-ligand
binding assay using the LC319 and PC-14 cells treated with NMU-25.
We detected binding of Cy5-labeled NMU-25 to the surface of these
two cell lines that expressed both of the two receptors, but
scarcely expressed NMU1R/NMU2R (FIG. 13e).
[0379] Biologically active ligands for GPCRs have been reported to
bind specifically to their cognate receptors and cause an increase
in second-messengers such as intracellular-Ca.sup.2+ and cAMP
levels. We therefore determined the ability of NMU to induce these
second-messengers in LC319 cells through its interaction with
GHSR1b/NTSR1. cAMP production, but not Ca.sup.2+ flux in LC319
cells, which express both GHSR1b and NTSR1 was observed in a NMU-25
dose dependent manner, when the cells were cultured in the presence
of NMU-25 at final concentrations of 3-100 .mu.M in the culture
media. The results demonstrate that NSCLC cells express functional
GHSR1b/NTSR1 (FIG. 13f left panel). This effect was confirmed to be
NMU-25 specific by adding other reported ligands for GHSR1b/NTSR1,
GHRL or NTS (FIG. 13f right panel). In addition, GHRL and NTS
caused the mobilization response of intracellular calcium in LC319
cells (data not shown), suggesting a variety of function for the
poorly understood for GHSR1b and/or NTSR1.
(9) Inhibition of Growth of NSCLC Cells by siRNA Against
GHSR/NTSR1
[0380] Furthermore, the biological significance of the NMU-receptor
interaction in pulmonary carcinogenesis was examined using plasmids
designed to express siRNA against GHSR or NTSR1 (si-GHSR-1,
si-NTSR1-1, and si-NTSR1-2). Transfection of either of these
plasmids into A549 or LC319 cells suppressed expression of the
endogenous receptor in comparison to cells containing any of the
three control siRNAs (FIG. 14a). In accordance with the reduced
expression of the receptors, A549 and LC319 cells showed
significant decreases in cell viability (FIG. 14b) and numbers of
colonies (data not shown). These results strongly supported the
possibility that NMU, by interaction with GHSR1b and NTSR1, might
play a very significant role in development/progression of
NSCLC.
Identification of Downstream Genes of NMU
[0381] To further elucidate the NMU-signaling pathway and identify
downstream genes regulated by NMU, siRNA against NMU (si-NMU) or
LUC (control siRNA) were transfected into LC319 cells which had
overexpressed NMU and down-regulations in gene expression were
monitored using a cDNA microarray that contained 32,256 genes.
Among hundreds of genes detected by this method, we performed
Self-organizing map (SOM) clustering analysis to further select
candidate genes. SOM clustering is data mining and visualization
method originally developed by Kohonen (Kohonen, T. (1990). The
self-organizing map. IEEE 78, 1464-1480.) and applied to the
analysis of gene expression data from microarrays. The clustering
method is similar to k-means clustering (Kaech, S. M., et al.,
(2002). Cell 111, 837-851.) but differs in that genes are divided
into groups based on expression patterns, and relationships between
groups are illustrated by two-dimensional maps. The genes passing
our variation filter were grouped by a 5.times.4 SOM.
[0382] We initially selected 70 genes using SOM cluster analysis,
whose intensity were significantly decreased in accordance with the
reduction of NMU expression (FIG. 15a). Semiquantitative RT-PCR
analysis confirmed reduction of candidate transcripts in a
time-dependent manner in LC319 cells transfected with si-NMU, but
not with control siRNA for LUC (FIG. 15b). These transcripts were
also confirmed to be up-regulated greater than 2-fold in LC319
cells expressing exogenous NMU, compared with that of normal lung
tissues. Overexpression of these genes in accordance with NMU
expression were evaluated as well in lung-cancer tissues and cell
lines (data not shown). We finally identified 6 candidate NMU
target genes, which satisfied the above selection criteria; FOXM1,
FLJ42024, GCDH, CDK5RAP1, LOC134145, and NUP188 (FIG. 15b).
[0383] FOXM1 mRNA levels were significantly elevated in lung
cancers compared with normal lung tissues and its expression showed
good concordance with NMU and two receptors for NMU, GHSR1b and
NTSR1, whereas the function of FOXM1 in lung carcinogenesis remains
unclear. Therefore, we chose FOXM1 for further analysis. To
determine specific induction of the FOXM1 by the NMU
ligand-receptor signaling, LC319 cells expressing GHSR1b and NTSR1
were cultured in the presence of NMU-25 or BSA (control) at final
concentrations of 100 .mu.M in the culture media. NMU-25-treated
cells showed higher expression of FOXM1 compared to the control
cells (FIG. 15c). Furthermore, FOXM1 was also confirmed to be
up-regulated in LC319 cells expressing exogenous NMU, compared with
that of control cells transfected with mock vector (data not
shown).
[0384] We then examined the biological significance of the FOXM1
activation by NMU signaling for growth or survival of lung-cancer
cells, using plasmids designed to express siRNA against FOXM1
(si-FOXM1). Transfection of si-FOXM1 into A549 or LC319 cells
suppressed expression of the endogenous FOXM1 in comparison to
cells containing any of the three control siRNAs (FIGS. 16a and
16b). In accordance with the reduced expression of the FOXM1, A549
and LC319 cells showed significant decreases in cell viability and
numbers of colonies (FIG. 16a and b). These results strongly
demonstrated that NMU, by the interaction with GHSR1b/NTSR1 and
subsequent activation of its downstream targets, such as FOXM1,
could significantly affect the growth of lung-cancer cells.
[0385] Microarray data of LC319 cells treated with siRNA for NMU
presented herein proved that NMU signaling pathway could affect the
growth promotion of lung-cancer cells by transactivating a set of
downstream genes involving transcripts whose protein products can
function as a transcription factor and are capable of controlling
cell growth or participating in signal transduction. We provided
evidence that the FOXM1 transcription factor is a downstream target
of NMU signaling by additional biological assays. FOXM1 was known
to be over-expressed in several types of human cancers (Teh, M. T.
et al., Cancer Res. 62, 4773-4780; van den Boom, J. et al., (2003).
Am. J. Pathol. 163, 1033-1043; Kalinichenko, V. V. et al., (2004).
Genes. Dev. 18, 830-850). The "forkhead" gene family, originally
identified in Drosophila, comprises transcription factors with a
conserved 100-amino acid DNA-binding motif, and has been shown to
play important roles in regulating the expression of genes involved
in cell growth, proliferation, differentiation, longevity, and
transformation. Cotransfection assays in the human hepatoma HepG2
cell line demonstrated that FOXM1 protein stimulated expression of
both the cyclin B1 (CCNB1) and cyclin D1 (CCND1) (Wang, X. et al.,
(2002). Proc. Nat. Acad. Sci. 99, 16881-16886.), suggesting that
these cyclin genes are direct FOXM1 transcription targets and that
FOXM1 controls the transcription network of genes that are
essential for cell division and exit from mitosis. It should be
noted that we observed activation of CCNB1 in the majority of a
series of NSCLC we examined and its good concordance of the
expression to FOXM1 (data not shown). On the other hand, it was
also demonstrated that p27 (Kip1) and p19 (Arf) (CDKN2A) interact
with FOXM1 and inhibit FOXM1 transcriptional activity
(Kalinichenko, V. V. et al., (2004). Genes. Dev. 18, 830-850). The
promotion of cell growth in NSCLC cells by NMU might reflect
transactivation of FOXM1, which would affect the function of those
molecular pathways in consequence.
[0386] By immunohistochemical analysis on tissue microarray, we
detected increased expression of NMU protein in the majority of
NSCLC (SCC, ADC, LCC, and BAC) and SCLC samples, but not in normal
lung tissues. Since NMU is a secreted protein and most of the
clinical NSCLC samples used for our analysis were at an early and
operable stage, NMU might serve as a biomarker for diagnosis of
early-stage lung cancer, in combination with fiberscopic
transbronchial biopsy (TBB) or blood tests.
[0387] In summary, we have shown that NMU and two newly revealed
receptors for this molecule, GHSR1b and NTSR1, are likely to play
an essential role for an autocrine growth-promoting pathway in
NSCLCs by modulating transcription of down stream target genes. The
data reported here strongly imply the possibility of designing new
anti-cancer drugs, specific for lung cancer, that target the
NMU-GHSR1b/NTSR1 pathway. They also suggest a potential for siRNAs
themselves to interfere with this pathway, as a novel approach to
treatment of chemotherapy-resistant, advanced lung cancers.
INDUSTRIAL APPLICABILITY
[0388] The expression of human genes KIF11, GHSR1b, NTSR1 and FOXM1
are markedly elevated in non-small cell lung cancer (NSCLC) as
compared to normal lung tissues. Accordingly, these genes can be
conveniently used as diagnostic markers of NSCLC and the proteins
encoded thereby may be used in diagnostic assays of NSCLC.
[0389] The present inventors have also shown that the expression of
KIF11, GHSR1b, NTSR1 or FOXM1 promotes cell growth whereas cell
growth is suppressed by small interfering RNAs corresponding to
KIF11, GHSR1b, NTSR1 or FOXM1 gene. These findings show that each
of KIF11, KOC1, GHSR1b, NTSR1 and FOXM1 proteins stimulate
oncogenic activity. Thus, each of these oncoproteins is a useful
target for the development of anti-cancer pharmaceuticals. For
example, agents that block the expression of KIF11, KOC1, GHSR1b,
NTSR1 or FOXM1, or prevent its activity may find therapeutic
utility as anti-cancer agents, particularly anti-cancer agents for
the treatment of NSCLC. Examples of such agents include antisense
oligonucleotides, small interfering RNAs, and ribozymes against the
KIF11, KOC1, GHSR1b, NTSR1 or FOXM1 gene, and antibodies that
recognize KIF11, KOC1, GHSR1b, NTSR1 or FOXM1 polypeptide.
[0390] While the invention has been described in detail and with
reference to specific embodiments thereof, it will be apparent to
one skilled in the art that various changes and modifications can
be made therein without departing from the spirit and scope of the
invention.
Sequence CWU 1
1
12714908DNAHomo sapiensCDS(141)..(3311) 1acctgcgtgc agtcggtcct
ccaggccacg cagcgcccga gagtaccagg gagactccgg 60cccctgtcgg cgccaagccc
ctccgcccct cacagcgccc aggtccgcgg ccgggccttg 120attttttggc
ggggaccgtc atg gcg tcg cag cca aat tcg tct gcg aag aag 173 Met Ala
Ser Gln Pro Asn Ser Ser Ala Lys Lys 1 5 10aaa gag gag aag ggg aag
aac atc cag gtg gtg gtg aga tgc aga cca 221Lys Glu Glu Lys Gly Lys
Asn Ile Gln Val Val Val Arg Cys Arg Pro 15 20 25ttt aat ttg gca gag
cgg aaa gct agc gcc cat tca ata gta gaa tgt 269Phe Asn Leu Ala Glu
Arg Lys Ala Ser Ala His Ser Ile Val Glu Cys 30 35 40gat cct gta cga
aaa gaa gtt agt gta cga act gga gga ttg gct gac 317Asp Pro Val Arg
Lys Glu Val Ser Val Arg Thr Gly Gly Leu Ala Asp 45 50 55aag agc tca
agg aaa aca tac act ttt gat atg gtg ttt gga gca tct 365Lys Ser Ser
Arg Lys Thr Tyr Thr Phe Asp Met Val Phe Gly Ala Ser60 65 70 75act
aaa cag att gat gtt tac cga agt gtt gtt tgt cca att ctg gat 413Thr
Lys Gln Ile Asp Val Tyr Arg Ser Val Val Cys Pro Ile Leu Asp 80 85
90gaa gtt att atg ggc tat aat tgc act atc ttt gcg tat ggc caa act
461Glu Val Ile Met Gly Tyr Asn Cys Thr Ile Phe Ala Tyr Gly Gln Thr
95 100 105ggc act gga aaa act ttt aca atg gaa ggt gaa agg tca cct
aat gaa 509Gly Thr Gly Lys Thr Phe Thr Met Glu Gly Glu Arg Ser Pro
Asn Glu 110 115 120gag tat acc tgg gaa gag gat ccc ttg gct ggt ata
att cca cgt acc 557Glu Tyr Thr Trp Glu Glu Asp Pro Leu Ala Gly Ile
Ile Pro Arg Thr 125 130 135ctt cat caa att ttt gag aaa ctt act gat
aat ggt act gaa ttt tca 605Leu His Gln Ile Phe Glu Lys Leu Thr Asp
Asn Gly Thr Glu Phe Ser140 145 150 155gtc aaa gtg tct ctg ttg gag
atc tat aat gaa gag ctt ttt gat ctt 653Val Lys Val Ser Leu Leu Glu
Ile Tyr Asn Glu Glu Leu Phe Asp Leu 160 165 170ctt aat cca tca tct
gat gtt tct gag aga cta cag atg ttt gat gat 701Leu Asn Pro Ser Ser
Asp Val Ser Glu Arg Leu Gln Met Phe Asp Asp 175 180 185ccc cgt aac
aag aga gga gtg ata att aaa ggt tta gaa gaa att aca 749Pro Arg Asn
Lys Arg Gly Val Ile Ile Lys Gly Leu Glu Glu Ile Thr 190 195 200gta
cac aac aag gat gaa gtc tat caa att tta gaa aag ggg gca gca 797Val
His Asn Lys Asp Glu Val Tyr Gln Ile Leu Glu Lys Gly Ala Ala 205 210
215aaa agg aca act gca gct act ctg atg aat gca tac tct agt cgt tcc
845Lys Arg Thr Thr Ala Ala Thr Leu Met Asn Ala Tyr Ser Ser Arg
Ser220 225 230 235cac tca gtt ttc tct gtt aca ata cat atg aaa gaa
act acg att gat 893His Ser Val Phe Ser Val Thr Ile His Met Lys Glu
Thr Thr Ile Asp 240 245 250gga gaa gag ctt gtt aaa atc gga aag ttg
aac ttg gtt gat ctt gca 941Gly Glu Glu Leu Val Lys Ile Gly Lys Leu
Asn Leu Val Asp Leu Ala 255 260 265gga agt gaa aac att ggc cgt tct
gga gct gtt gat aag aga gct cgg 989Gly Ser Glu Asn Ile Gly Arg Ser
Gly Ala Val Asp Lys Arg Ala Arg 270 275 280gaa gct gga aat ata aat
caa tcc ctg ttg act ttg gga agg gtc att 1037Glu Ala Gly Asn Ile Asn
Gln Ser Leu Leu Thr Leu Gly Arg Val Ile 285 290 295act gcc ctt gta
gaa aga aca cct cat gtt cct tat cga gaa tct aaa 1085Thr Ala Leu Val
Glu Arg Thr Pro His Val Pro Tyr Arg Glu Ser Lys300 305 310 315cta
act aga atc ctc cag gat tct ctt gga ggg cgt aca aga aca tct 1133Leu
Thr Arg Ile Leu Gln Asp Ser Leu Gly Gly Arg Thr Arg Thr Ser 320 325
330ata att gca aca att tct cct gca tct ctc aat ctt gag gaa act ctg
1181Ile Ile Ala Thr Ile Ser Pro Ala Ser Leu Asn Leu Glu Glu Thr Leu
335 340 345agt aca ttg gaa tat gct cat aga gca aag aac ata ttg aat
aag cct 1229Ser Thr Leu Glu Tyr Ala His Arg Ala Lys Asn Ile Leu Asn
Lys Pro 350 355 360gaa gtg aat cag aaa ctc acc aaa aaa gct ctt att
aag gag tat acg 1277Glu Val Asn Gln Lys Leu Thr Lys Lys Ala Leu Ile
Lys Glu Tyr Thr 365 370 375gag gag ata gaa cgt tta aaa cga gat ctt
gct gca gcc cgt gag aaa 1325Glu Glu Ile Glu Arg Leu Lys Arg Asp Leu
Ala Ala Ala Arg Glu Lys380 385 390 395aat gga gtg tat att tct gaa
gaa aat ttt aga gtc atg agt gga aaa 1373Asn Gly Val Tyr Ile Ser Glu
Glu Asn Phe Arg Val Met Ser Gly Lys 400 405 410tta act gtt caa gaa
gag cag att gta gaa ttg att gaa aaa att ggt 1421Leu Thr Val Gln Glu
Glu Gln Ile Val Glu Leu Ile Glu Lys Ile Gly 415 420 425gct gtt gag
gag gag ctg aat agg gtt aca gag ttg ttt atg gat aat 1469Ala Val Glu
Glu Glu Leu Asn Arg Val Thr Glu Leu Phe Met Asp Asn 430 435 440aaa
aat gaa ctt gac cag tgt aaa tct gac ctg caa aat aaa aca caa 1517Lys
Asn Glu Leu Asp Gln Cys Lys Ser Asp Leu Gln Asn Lys Thr Gln 445 450
455gaa ctt gaa acc act caa aaa cat ttg caa gaa act aaa tta caa ctt
1565Glu Leu Glu Thr Thr Gln Lys His Leu Gln Glu Thr Lys Leu Gln
Leu460 465 470 475gtt aaa gaa gaa tat atc aca tca gct ttg gaa agt
act gag gag aaa 1613Val Lys Glu Glu Tyr Ile Thr Ser Ala Leu Glu Ser
Thr Glu Glu Lys 480 485 490ctt cat gat gct gcc agc aag ctg ctt aac
aca gtt gaa gaa act aca 1661Leu His Asp Ala Ala Ser Lys Leu Leu Asn
Thr Val Glu Glu Thr Thr 495 500 505aaa gat gta tct ggt ctc cat tcc
aaa ctg gat cgt aag aag gca gtt 1709Lys Asp Val Ser Gly Leu His Ser
Lys Leu Asp Arg Lys Lys Ala Val 510 515 520gac caa cac aat gca gaa
gct cag gat att ttt ggc aaa aac ctg aat 1757Asp Gln His Asn Ala Glu
Ala Gln Asp Ile Phe Gly Lys Asn Leu Asn 525 530 535agt ctg ttt aat
aat atg gaa gaa tta att aag gat ggc agc tca aag 1805Ser Leu Phe Asn
Asn Met Glu Glu Leu Ile Lys Asp Gly Ser Ser Lys540 545 550 555caa
aag gcc atg cta gaa gta cat aag acc tta ttt ggt aat ctg ctg 1853Gln
Lys Ala Met Leu Glu Val His Lys Thr Leu Phe Gly Asn Leu Leu 560 565
570tct tcc agt gtc tct gca tta gat acc att act aca gta gca ctt gga
1901Ser Ser Ser Val Ser Ala Leu Asp Thr Ile Thr Thr Val Ala Leu Gly
575 580 585tct ctc aca tct att cca gaa aat gtg tct act cat gtt tct
cag att 1949Ser Leu Thr Ser Ile Pro Glu Asn Val Ser Thr His Val Ser
Gln Ile 590 595 600ttt aat atg ata cta aaa gaa caa tca tta gca gca
gaa agt aaa act 1997Phe Asn Met Ile Leu Lys Glu Gln Ser Leu Ala Ala
Glu Ser Lys Thr 605 610 615gta cta cag gaa ttg att aat gta ctc aag
act gat ctt cta agt tca 2045Val Leu Gln Glu Leu Ile Asn Val Leu Lys
Thr Asp Leu Leu Ser Ser620 625 630 635ctg gaa atg att tta tcc cca
act gtg gtg tct ata ctg aaa atc aat 2093Leu Glu Met Ile Leu Ser Pro
Thr Val Val Ser Ile Leu Lys Ile Asn 640 645 650agt caa cta aag cat
att ttc aag act tca ttg aca gtg gcc gat aag 2141Ser Gln Leu Lys His
Ile Phe Lys Thr Ser Leu Thr Val Ala Asp Lys 655 660 665ata gaa gat
caa aaa aag gaa cta gat ggc ttt ctc agt ata ctg tgt 2189Ile Glu Asp
Gln Lys Lys Glu Leu Asp Gly Phe Leu Ser Ile Leu Cys 670 675 680aac
aat cta cat gaa cta caa gaa aat acc att tgt tcc ttg gtt gag 2237Asn
Asn Leu His Glu Leu Gln Glu Asn Thr Ile Cys Ser Leu Val Glu 685 690
695tca caa aag caa tgt gga aac cta act gaa gac ctg aag aca ata aag
2285Ser Gln Lys Gln Cys Gly Asn Leu Thr Glu Asp Leu Lys Thr Ile
Lys700 705 710 715cag acc cat tcc cag gaa ctt tgc aag tta atg aat
ctt tgg aca gag 2333Gln Thr His Ser Gln Glu Leu Cys Lys Leu Met Asn
Leu Trp Thr Glu 720 725 730aga ttc tgt gct ttg gag gaa aag tgt gaa
aat ata cag aaa cca ctt 2381Arg Phe Cys Ala Leu Glu Glu Lys Cys Glu
Asn Ile Gln Lys Pro Leu 735 740 745agt agt gtc cag gaa aat ata cag
cag aaa tct aag gat ata gtc aac 2429Ser Ser Val Gln Glu Asn Ile Gln
Gln Lys Ser Lys Asp Ile Val Asn 750 755 760aaa atg act ttt cac agt
caa aaa ttt tgt gct gat tct gat ggc ttc 2477Lys Met Thr Phe His Ser
Gln Lys Phe Cys Ala Asp Ser Asp Gly Phe 765 770 775tca cag gaa ctc
aga aat ttt aac caa gaa ggt aca aaa ttg gtt gaa 2525Ser Gln Glu Leu
Arg Asn Phe Asn Gln Glu Gly Thr Lys Leu Val Glu780 785 790 795gaa
tct gtg aaa cac tct gat aaa ctc aat ggc aac ctg gaa aaa ata 2573Glu
Ser Val Lys His Ser Asp Lys Leu Asn Gly Asn Leu Glu Lys Ile 800 805
810tct caa gag act gaa cag aga tgt gaa tct ctg aac aca aga aca gtt
2621Ser Gln Glu Thr Glu Gln Arg Cys Glu Ser Leu Asn Thr Arg Thr Val
815 820 825tat ttt tct gaa cag tgg gta tct tcc tta aat gaa agg gaa
cag gaa 2669Tyr Phe Ser Glu Gln Trp Val Ser Ser Leu Asn Glu Arg Glu
Gln Glu 830 835 840ctt cac aac tta ttg gag gtt gta agc caa tgt tgt
gag gct tca agt 2717Leu His Asn Leu Leu Glu Val Val Ser Gln Cys Cys
Glu Ala Ser Ser 845 850 855tca gac atc act gag aaa tca gat gga cgt
aag gca gct cat gag aaa 2765Ser Asp Ile Thr Glu Lys Ser Asp Gly Arg
Lys Ala Ala His Glu Lys860 865 870 875cag cat aac att ttt ctt gat
cag atg act att gat gaa gat aaa ttg 2813Gln His Asn Ile Phe Leu Asp
Gln Met Thr Ile Asp Glu Asp Lys Leu 880 885 890ata gca caa aat cta
gaa ctt aat gaa acc ata aaa att ggt ttg act 2861Ile Ala Gln Asn Leu
Glu Leu Asn Glu Thr Ile Lys Ile Gly Leu Thr 895 900 905aag ctt aat
tgc ttt ctg gaa cag gat ctg aaa ctg gat atc cca aca 2909Lys Leu Asn
Cys Phe Leu Glu Gln Asp Leu Lys Leu Asp Ile Pro Thr 910 915 920ggt
acg aca cca cag agg aaa agt tat tta tac cca tca aca ctg gta 2957Gly
Thr Thr Pro Gln Arg Lys Ser Tyr Leu Tyr Pro Ser Thr Leu Val 925 930
935aga act gaa cca cgt gaa cat ctc ctt gat cag ctg aaa agg aaa cag
3005Arg Thr Glu Pro Arg Glu His Leu Leu Asp Gln Leu Lys Arg Lys
Gln940 945 950 955cct gag ctg tta atg atg cta aac tgt tca gaa aac
aac aaa gaa gag 3053Pro Glu Leu Leu Met Met Leu Asn Cys Ser Glu Asn
Asn Lys Glu Glu 960 965 970aca att ccg gat gtg gat gta gaa gag gca
gtt ctg ggg cag tat act 3101Thr Ile Pro Asp Val Asp Val Glu Glu Ala
Val Leu Gly Gln Tyr Thr 975 980 985gaa gaa cct cta agt caa gag cca
tct gta gat gct ggt gtg gat tgt 3149Glu Glu Pro Leu Ser Gln Glu Pro
Ser Val Asp Ala Gly Val Asp Cys 990 995 1000tca tca att ggc ggg gtt
cca ttt ttc cag cat aaa aaa tca cat 3194Ser Ser Ile Gly Gly Val Pro
Phe Phe Gln His Lys Lys Ser His 1005 1010 1015gga aaa gac aaa gaa
aac aga ggc att aac aca ctg gag agg tct 3239Gly Lys Asp Lys Glu Asn
Arg Gly Ile Asn Thr Leu Glu Arg Ser 1020 1025 1030aaa gtg gaa gaa
act aca gag cac ttg gtt aca aag agc aga tta 3284Lys Val Glu Glu Thr
Thr Glu His Leu Val Thr Lys Ser Arg Leu 1035 1040 1045cct ctg cga
gcc cag atc aac ctt taa ttcacttggg ggttggcaat 3331Pro Leu Arg Ala
Gln Ile Asn Leu 1050 1055tttattttta aagaaaactt aaaaataaaa
cctgaaaccc cagaacttga gccttgtgta 3391tagattttaa aagaatatat
atatcagccg ggcgcggtgg ctcatgcctg taatcccagc 3451actttgggag
gctgaggcgg gtggattgct tgagcccagg agtttgagac cagcctggcc
3511aacgtggcaa aacctcgtct ctgttaaaaa ttagccgggc gtggtggcac
actcctgtaa 3571tcccagctac tggggaggct gaggcacgag aatcacttga
acccaggaag cggggttgca 3631gtgagccaaa ggtacaccac tacactccag
cctgggcaac agagcaagac tcggtctcaa 3691aaacaaaatt taaaaaagat
ataaggcagt actgtaaatt cagttgaatt ttgatatcta 3751cccatttttc
tgtcatccct atagttcact ttgtattaaa ttgggtttca tttgggattt
3811gcaatgtaaa tacgtatttc tagttttcat ataaagtagt tcttttataa
caaatgaaaa 3871gtatttttct tgtatattat taagtaatga atatataaga
actgtactct tctcagcttg 3931agcttaacat aggtaaatat caccaacatc
tgtccttaga aaggaccatc tcatgttttt 3991tttcttgcta tgacttgtgt
attttcttgc atcctcccta gacttcccta tttcgctttc 4051tcctcggctc
actttctccc tttttatttt tcaccaaacc atttgtagag ctacaaaacc
4111tatcctttct tattttcagt agtcagaatt ttatctagaa atcttttaac
acctttttag 4171tggttatttc taaaatcact gtcaacaata aatctaaccc
tagttgtatc cctcctttaa 4231gtatttaaaa cttgttgccc caaatgtgaa
agcatttaat tcctttaaga ggcctaactc 4291attcaccctg acagagttca
caaaaagccc actttagagt atacattgct attatgggag 4351accacccaga
catctgacta atggctctgt gccacactcc aagacctgtg ccttttagag
4411aagctcacaa tgatttaagg actgtttgaa acttccaatt atgtctataa
tttatattct 4471tttgtttaca tgatgaaact ttttgttgtt gcttgtttgt
atataataca atgtgtacat 4531gtatcttttt ctcgattcaa atcttaaccc
ttaggactct ggtatttttg atctggcaac 4591catatttctg gaagttgaga
tgtttcagct tgaagaacca aaacagaagg aatatgtaca 4651aagaataaat
tttctgctca cgatgagttt agtgtgtaaa gtttagagac atctgacttt
4711gatagctaaa ttaaaccaaa ccctattgaa gaattgaata tatgctactt
caagaaacta 4771aattgatctc gtagaattat cttaataaaa taatggctat
aatttctctg caaaatcaga 4831tgtcagcata agcgatggat aatacctaat
aaactgccct cagtaaatcc atggttaata 4891aatgtggttt ctacatt
490821056PRTHomo sapiens 2Met Ala Ser Gln Pro Asn Ser Ser Ala Lys
Lys Lys Glu Glu Lys Gly1 5 10 15Lys Asn Ile Gln Val Val Val Arg Cys
Arg Pro Phe Asn Leu Ala Glu 20 25 30Arg Lys Ala Ser Ala His Ser Ile
Val Glu Cys Asp Pro Val Arg Lys 35 40 45Glu Val Ser Val Arg Thr Gly
Gly Leu Ala Asp Lys Ser Ser Arg Lys 50 55 60Thr Tyr Thr Phe Asp Met
Val Phe Gly Ala Ser Thr Lys Gln Ile Asp65 70 75 80Val Tyr Arg Ser
Val Val Cys Pro Ile Leu Asp Glu Val Ile Met Gly 85 90 95Tyr Asn Cys
Thr Ile Phe Ala Tyr Gly Gln Thr Gly Thr Gly Lys Thr 100 105 110Phe
Thr Met Glu Gly Glu Arg Ser Pro Asn Glu Glu Tyr Thr Trp Glu 115 120
125Glu Asp Pro Leu Ala Gly Ile Ile Pro Arg Thr Leu His Gln Ile Phe
130 135 140Glu Lys Leu Thr Asp Asn Gly Thr Glu Phe Ser Val Lys Val
Ser Leu145 150 155 160Leu Glu Ile Tyr Asn Glu Glu Leu Phe Asp Leu
Leu Asn Pro Ser Ser 165 170 175Asp Val Ser Glu Arg Leu Gln Met Phe
Asp Asp Pro Arg Asn Lys Arg 180 185 190Gly Val Ile Ile Lys Gly Leu
Glu Glu Ile Thr Val His Asn Lys Asp 195 200 205Glu Val Tyr Gln Ile
Leu Glu Lys Gly Ala Ala Lys Arg Thr Thr Ala 210 215 220Ala Thr Leu
Met Asn Ala Tyr Ser Ser Arg Ser His Ser Val Phe Ser225 230 235
240Val Thr Ile His Met Lys Glu Thr Thr Ile Asp Gly Glu Glu Leu Val
245 250 255Lys Ile Gly Lys Leu Asn Leu Val Asp Leu Ala Gly Ser Glu
Asn Ile 260 265 270Gly Arg Ser Gly Ala Val Asp Lys Arg Ala Arg Glu
Ala Gly Asn Ile 275 280 285Asn Gln Ser Leu Leu Thr Leu Gly Arg Val
Ile Thr Ala Leu Val Glu 290 295 300Arg Thr Pro His Val Pro Tyr Arg
Glu Ser Lys Leu Thr Arg Ile Leu305 310 315 320Gln Asp Ser Leu Gly
Gly Arg Thr Arg Thr Ser Ile Ile Ala Thr Ile 325 330 335Ser Pro Ala
Ser Leu Asn Leu Glu Glu Thr Leu Ser Thr Leu Glu Tyr 340 345 350Ala
His Arg Ala Lys Asn Ile Leu Asn Lys Pro Glu Val Asn Gln Lys 355 360
365Leu Thr Lys Lys Ala Leu Ile Lys Glu Tyr Thr Glu Glu Ile Glu Arg
370 375 380Leu Lys Arg Asp Leu Ala Ala Ala Arg Glu Lys Asn Gly Val
Tyr Ile385 390 395 400Ser Glu Glu Asn Phe Arg Val Met Ser Gly Lys
Leu Thr Val Gln Glu 405 410 415Glu Gln Ile Val Glu Leu Ile Glu Lys
Ile Gly Ala Val Glu Glu Glu 420 425 430Leu Asn Arg Val Thr Glu Leu
Phe Met Asp Asn Lys Asn Glu Leu Asp 435 440 445Gln Cys Lys Ser Asp
Leu Gln Asn Lys Thr Gln Glu Leu Glu Thr Thr 450 455 460Gln Lys His
Leu Gln Glu Thr Lys Leu Gln Leu
Val Lys Glu Glu Tyr465 470 475 480Ile Thr Ser Ala Leu Glu Ser Thr
Glu Glu Lys Leu His Asp Ala Ala 485 490 495Ser Lys Leu Leu Asn Thr
Val Glu Glu Thr Thr Lys Asp Val Ser Gly 500 505 510Leu His Ser Lys
Leu Asp Arg Lys Lys Ala Val Asp Gln His Asn Ala 515 520 525Glu Ala
Gln Asp Ile Phe Gly Lys Asn Leu Asn Ser Leu Phe Asn Asn 530 535
540Met Glu Glu Leu Ile Lys Asp Gly Ser Ser Lys Gln Lys Ala Met
Leu545 550 555 560Glu Val His Lys Thr Leu Phe Gly Asn Leu Leu Ser
Ser Ser Val Ser 565 570 575Ala Leu Asp Thr Ile Thr Thr Val Ala Leu
Gly Ser Leu Thr Ser Ile 580 585 590Pro Glu Asn Val Ser Thr His Val
Ser Gln Ile Phe Asn Met Ile Leu 595 600 605Lys Glu Gln Ser Leu Ala
Ala Glu Ser Lys Thr Val Leu Gln Glu Leu 610 615 620Ile Asn Val Leu
Lys Thr Asp Leu Leu Ser Ser Leu Glu Met Ile Leu625 630 635 640Ser
Pro Thr Val Val Ser Ile Leu Lys Ile Asn Ser Gln Leu Lys His 645 650
655Ile Phe Lys Thr Ser Leu Thr Val Ala Asp Lys Ile Glu Asp Gln Lys
660 665 670Lys Glu Leu Asp Gly Phe Leu Ser Ile Leu Cys Asn Asn Leu
His Glu 675 680 685Leu Gln Glu Asn Thr Ile Cys Ser Leu Val Glu Ser
Gln Lys Gln Cys 690 695 700Gly Asn Leu Thr Glu Asp Leu Lys Thr Ile
Lys Gln Thr His Ser Gln705 710 715 720Glu Leu Cys Lys Leu Met Asn
Leu Trp Thr Glu Arg Phe Cys Ala Leu 725 730 735Glu Glu Lys Cys Glu
Asn Ile Gln Lys Pro Leu Ser Ser Val Gln Glu 740 745 750Asn Ile Gln
Gln Lys Ser Lys Asp Ile Val Asn Lys Met Thr Phe His 755 760 765Ser
Gln Lys Phe Cys Ala Asp Ser Asp Gly Phe Ser Gln Glu Leu Arg 770 775
780Asn Phe Asn Gln Glu Gly Thr Lys Leu Val Glu Glu Ser Val Lys
His785 790 795 800Ser Asp Lys Leu Asn Gly Asn Leu Glu Lys Ile Ser
Gln Glu Thr Glu 805 810 815Gln Arg Cys Glu Ser Leu Asn Thr Arg Thr
Val Tyr Phe Ser Glu Gln 820 825 830Trp Val Ser Ser Leu Asn Glu Arg
Glu Gln Glu Leu His Asn Leu Leu 835 840 845Glu Val Val Ser Gln Cys
Cys Glu Ala Ser Ser Ser Asp Ile Thr Glu 850 855 860Lys Ser Asp Gly
Arg Lys Ala Ala His Glu Lys Gln His Asn Ile Phe865 870 875 880Leu
Asp Gln Met Thr Ile Asp Glu Asp Lys Leu Ile Ala Gln Asn Leu 885 890
895Glu Leu Asn Glu Thr Ile Lys Ile Gly Leu Thr Lys Leu Asn Cys Phe
900 905 910Leu Glu Gln Asp Leu Lys Leu Asp Ile Pro Thr Gly Thr Thr
Pro Gln 915 920 925Arg Lys Ser Tyr Leu Tyr Pro Ser Thr Leu Val Arg
Thr Glu Pro Arg 930 935 940Glu His Leu Leu Asp Gln Leu Lys Arg Lys
Gln Pro Glu Leu Leu Met945 950 955 960Met Leu Asn Cys Ser Glu Asn
Asn Lys Glu Glu Thr Ile Pro Asp Val 965 970 975Asp Val Glu Glu Ala
Val Leu Gly Gln Tyr Thr Glu Glu Pro Leu Ser 980 985 990Gln Glu Pro
Ser Val Asp Ala Gly Val Asp Cys Ser Ser Ile Gly Gly 995 1000
1005Val Pro Phe Phe Gln His Lys Lys Ser His Gly Lys Asp Lys Glu
1010 1015 1020Asn Arg Gly Ile Asn Thr Leu Glu Arg Ser Lys Val Glu
Glu Thr 1025 1030 1035Thr Glu His Leu Val Thr Lys Ser Arg Leu Pro
Leu Arg Ala Gln 1040 1045 1050Ile Asn Leu 10553870DNAHomo
sapiensCDS(1)..(870) 3atg tgg aac gcg acg ccc agc gaa gag ccg ggg
ttc aac ctc aca ctg 48Met Trp Asn Ala Thr Pro Ser Glu Glu Pro Gly
Phe Asn Leu Thr Leu1 5 10 15gcc gac ctg gac tgg gat gct tcc ccc ggc
aac gac tcg ctg ggc gac 96Ala Asp Leu Asp Trp Asp Ala Ser Pro Gly
Asn Asp Ser Leu Gly Asp 20 25 30gag ctg ctg cag ctc ttc ccc gcg ccg
ctg ctg gcg ggc gtc aca gcc 144Glu Leu Leu Gln Leu Phe Pro Ala Pro
Leu Leu Ala Gly Val Thr Ala 35 40 45acc tgc gtg gca ctc ttc gtg gtg
ggt atc gct ggc aac ctg ctc acc 192Thr Cys Val Ala Leu Phe Val Val
Gly Ile Ala Gly Asn Leu Leu Thr 50 55 60atg ctg gtg gtg tcg cgc ttc
cgc gag ctg cgc acc acc acc aac ctc 240Met Leu Val Val Ser Arg Phe
Arg Glu Leu Arg Thr Thr Thr Asn Leu65 70 75 80tac ctg tcc agc atg
gcc ttc tcc gat ctg ctc atc ttc ctc tgc atg 288Tyr Leu Ser Ser Met
Ala Phe Ser Asp Leu Leu Ile Phe Leu Cys Met 85 90 95ccc ctg gac ctc
gtt cgc ctc tgg cag tac cgg ccc tgg aac ttc ggc 336Pro Leu Asp Leu
Val Arg Leu Trp Gln Tyr Arg Pro Trp Asn Phe Gly 100 105 110gac ctc
ctc tgc aaa ctc ttc caa ttc gtc agt gag agc tgc acc tac 384Asp Leu
Leu Cys Lys Leu Phe Gln Phe Val Ser Glu Ser Cys Thr Tyr 115 120
125gcc acg gtg ctc acc atc aca gcg ctg agc gtc gag cgc tac ttc gcc
432Ala Thr Val Leu Thr Ile Thr Ala Leu Ser Val Glu Arg Tyr Phe Ala
130 135 140atc tgc ttc cca ctc cgg gcc aag gtg gtg gtc acc aag ggg
cgg gtg 480Ile Cys Phe Pro Leu Arg Ala Lys Val Val Val Thr Lys Gly
Arg Val145 150 155 160aag ctg gtc atc ttc gtc atc tgg gcc gtg gcc
ttc tgc agc gcc ggg 528Lys Leu Val Ile Phe Val Ile Trp Ala Val Ala
Phe Cys Ser Ala Gly 165 170 175ccc atc ttc gtg cta gtc ggg gtg gag
cac gag aac ggc acc gac cct 576Pro Ile Phe Val Leu Val Gly Val Glu
His Glu Asn Gly Thr Asp Pro 180 185 190tgg gac acc aac gag tgc cgc
ccc acc gag ttt gcg gtg cgc tct gga 624Trp Asp Thr Asn Glu Cys Arg
Pro Thr Glu Phe Ala Val Arg Ser Gly 195 200 205ctg ctc acg gtc atg
gtg tgg gtg tcc agc atc ttc ttc ttc ctt cct 672Leu Leu Thr Val Met
Val Trp Val Ser Ser Ile Phe Phe Phe Leu Pro 210 215 220gtc ttc tgt
ctc acg gtc ctc tac agt ctc atc ggc agg aag ctg tgg 720Val Phe Cys
Leu Thr Val Leu Tyr Ser Leu Ile Gly Arg Lys Leu Trp225 230 235
240cgg agg agg cgc ggc gat gct gtc gtg ggt gcc tcg ctc agg gac cag
768Arg Arg Arg Arg Gly Asp Ala Val Val Gly Ala Ser Leu Arg Asp Gln
245 250 255aac cac aag caa acc gtg aaa atg ctg ggt ggg tct cag cgc
gcg ctc 816Asn His Lys Gln Thr Val Lys Met Leu Gly Gly Ser Gln Arg
Ala Leu 260 265 270agg ctt tct ctc gcg ggt cct atc ctc tcc ctg tgc
ctt ctc cct tct 864Arg Leu Ser Leu Ala Gly Pro Ile Leu Ser Leu Cys
Leu Leu Pro Ser 275 280 285ctc tga 870Leu 4289PRTHomo sapiens 4Met
Trp Asn Ala Thr Pro Ser Glu Glu Pro Gly Phe Asn Leu Thr Leu1 5 10
15Ala Asp Leu Asp Trp Asp Ala Ser Pro Gly Asn Asp Ser Leu Gly Asp
20 25 30Glu Leu Leu Gln Leu Phe Pro Ala Pro Leu Leu Ala Gly Val Thr
Ala 35 40 45Thr Cys Val Ala Leu Phe Val Val Gly Ile Ala Gly Asn Leu
Leu Thr 50 55 60Met Leu Val Val Ser Arg Phe Arg Glu Leu Arg Thr Thr
Thr Asn Leu65 70 75 80Tyr Leu Ser Ser Met Ala Phe Ser Asp Leu Leu
Ile Phe Leu Cys Met 85 90 95Pro Leu Asp Leu Val Arg Leu Trp Gln Tyr
Arg Pro Trp Asn Phe Gly 100 105 110Asp Leu Leu Cys Lys Leu Phe Gln
Phe Val Ser Glu Ser Cys Thr Tyr 115 120 125Ala Thr Val Leu Thr Ile
Thr Ala Leu Ser Val Glu Arg Tyr Phe Ala 130 135 140Ile Cys Phe Pro
Leu Arg Ala Lys Val Val Val Thr Lys Gly Arg Val145 150 155 160Lys
Leu Val Ile Phe Val Ile Trp Ala Val Ala Phe Cys Ser Ala Gly 165 170
175Pro Ile Phe Val Leu Val Gly Val Glu His Glu Asn Gly Thr Asp Pro
180 185 190Trp Asp Thr Asn Glu Cys Arg Pro Thr Glu Phe Ala Val Arg
Ser Gly 195 200 205Leu Leu Thr Val Met Val Trp Val Ser Ser Ile Phe
Phe Phe Leu Pro 210 215 220Val Phe Cys Leu Thr Val Leu Tyr Ser Leu
Ile Gly Arg Lys Leu Trp225 230 235 240Arg Arg Arg Arg Gly Asp Ala
Val Val Gly Ala Ser Leu Arg Asp Gln 245 250 255Asn His Lys Gln Thr
Val Lys Met Leu Gly Gly Ser Gln Arg Ala Leu 260 265 270Arg Leu Ser
Leu Ala Gly Pro Ile Leu Ser Leu Cys Leu Leu Pro Ser 275 280 285Leu
54131DNAHomo sapiensCDS(373)..(1629) 5tcaagctcgc cccgcgcagc
ccgagccggg ctgggcgctg tcctcggggg cctggggaac 60cgcgcggttt ggagatcgga
ggcacctgga acccgtggca agcgccgagc cgggagacag 120cccgaggaac
cacgggttct ggagctagga gccggaagct gggagtccgg aggagagcgg
180agcccggagc ccggagcccg gggcggcgcg tctgggtctg gcgcttcccg
actggacggc 240gcgcccgctg gtcttcgcca cgcgccctcc cctgggctcg
cgttcatcgg tccccgcctg 300agacgcgccc actcctgccc ggacttccag
ccccggaggc gccggacaga gccgcggact 360ccagcgccca cc atg cgc ctc aac
agc tcc gcg ccg gga acc ccg ggc acg 411 Met Arg Leu Asn Ser Ser Ala
Pro Gly Thr Pro Gly Thr 1 5 10ccg gcc gcc gac ccc ttc cag cgg gcg
cag gcc gga ctg gag gag gcg 459Pro Ala Ala Asp Pro Phe Gln Arg Ala
Gln Ala Gly Leu Glu Glu Ala 15 20 25ctg ctg gcc ccg ggc ttc ggc aac
gct tcg ggc aac gcg tcg gag cgc 507Leu Leu Ala Pro Gly Phe Gly Asn
Ala Ser Gly Asn Ala Ser Glu Arg30 35 40 45gtc ctg gcg gca ccc agc
agc gag ctg gac gtg aac acc gac atc tac 555Val Leu Ala Ala Pro Ser
Ser Glu Leu Asp Val Asn Thr Asp Ile Tyr 50 55 60tcc aaa gtg ctg gtg
acc gcc gtg tac ctg gcg ctc ttc gtg gtg ggc 603Ser Lys Val Leu Val
Thr Ala Val Tyr Leu Ala Leu Phe Val Val Gly 65 70 75acg gtg ggc aac
acg gtg acg gcg ttc acg ctg gcg cgg aag aag tcg 651Thr Val Gly Asn
Thr Val Thr Ala Phe Thr Leu Ala Arg Lys Lys Ser 80 85 90ctg cag agc
ctg cag agc acg gtg cat tac cac ctg ggc agc ctg gcg 699Leu Gln Ser
Leu Gln Ser Thr Val His Tyr His Leu Gly Ser Leu Ala 95 100 105ctg
tcc gac ctg ctc acc ctg ctg ctg gcc atg ccc gtg gag ctg tac 747Leu
Ser Asp Leu Leu Thr Leu Leu Leu Ala Met Pro Val Glu Leu Tyr110 115
120 125aac ttc atc tgg gtg cac cac ccc tgg gcc ttc ggc gac gcc ggc
tgc 795Asn Phe Ile Trp Val His His Pro Trp Ala Phe Gly Asp Ala Gly
Cys 130 135 140cgc ggc tac tac ttc ctg cgc gac gcc tgc acc tac gcc
acg gcc ctc 843Arg Gly Tyr Tyr Phe Leu Arg Asp Ala Cys Thr Tyr Ala
Thr Ala Leu 145 150 155aac gtg gcc agc ctg agt gtg gag cgc tac ctg
gcc atc tgc cac ccc 891Asn Val Ala Ser Leu Ser Val Glu Arg Tyr Leu
Ala Ile Cys His Pro 160 165 170ttc aag gcc aag acc ctc atg tcc cga
agc cgc acc aag aag ttc atc 939Phe Lys Ala Lys Thr Leu Met Ser Arg
Ser Arg Thr Lys Lys Phe Ile 175 180 185agc gcc atc tgg ctc gcc tcg
gcc ctg ctg acg gtg cct atg ctg ttc 987Ser Ala Ile Trp Leu Ala Ser
Ala Leu Leu Thr Val Pro Met Leu Phe190 195 200 205acc atg ggc gag
cag aac cgc agc gcc gac ggc cag cac gcc ggc ggc 1035Thr Met Gly Glu
Gln Asn Arg Ser Ala Asp Gly Gln His Ala Gly Gly 210 215 220ctg gtg
tgc acc ccc acc atc cac act gcc acc gtc aag gtc gtc ata 1083Leu Val
Cys Thr Pro Thr Ile His Thr Ala Thr Val Lys Val Val Ile 225 230
235cag gtc aac acc ttc atg tcc ttc ata ttc ccc atg gtg gtc atc tcg
1131Gln Val Asn Thr Phe Met Ser Phe Ile Phe Pro Met Val Val Ile Ser
240 245 250gtc ctg aac acc atc atc gcc aac aag ctg acc gtc atg gta
cgc cag 1179Val Leu Asn Thr Ile Ile Ala Asn Lys Leu Thr Val Met Val
Arg Gln 255 260 265gcg gcc gag cag ggc caa gtg tgc acg gtc ggg ggc
gag cac agc aca 1227Ala Ala Glu Gln Gly Gln Val Cys Thr Val Gly Gly
Glu His Ser Thr270 275 280 285ttc agc atg gcc atc gag cct ggc agg
gtc cag gcc ctg cgg cac ggc 1275Phe Ser Met Ala Ile Glu Pro Gly Arg
Val Gln Ala Leu Arg His Gly 290 295 300gtg cgc gtc cta cgt gca gtg
gtc atc gcc ttt gtg gtc tgc tgg ctg 1323Val Arg Val Leu Arg Ala Val
Val Ile Ala Phe Val Val Cys Trp Leu 305 310 315ccc tac cac gtg cgg
cgc ctc atg ttc tgc tac atc tcg gat gag cag 1371Pro Tyr His Val Arg
Arg Leu Met Phe Cys Tyr Ile Ser Asp Glu Gln 320 325 330tgg act ccg
ttc ctc tat gac ttc tac cac tac ttc tac atg gtg acc 1419Trp Thr Pro
Phe Leu Tyr Asp Phe Tyr His Tyr Phe Tyr Met Val Thr 335 340 345aac
gca ctc ttc tac gtc agc tcc acc atc aac ccc atc ctg tac aac 1467Asn
Ala Leu Phe Tyr Val Ser Ser Thr Ile Asn Pro Ile Leu Tyr Asn350 355
360 365ctc gtc tct gcc aac ttc cgc cac atc ttc ctg gcc aca ctg gcc
tgc 1515Leu Val Ser Ala Asn Phe Arg His Ile Phe Leu Ala Thr Leu Ala
Cys 370 375 380ctc tgc ccg gtg tgg cgg cgc agg agg aag agg cca gcc
ttc tcg agg 1563Leu Cys Pro Val Trp Arg Arg Arg Arg Lys Arg Pro Ala
Phe Ser Arg 385 390 395aag gcc gac agc gtg tcc agc aac cac acc ctc
tcc agc aat gcc acc 1611Lys Ala Asp Ser Val Ser Ser Asn His Thr Leu
Ser Ser Asn Ala Thr 400 405 410cgc gag acg ctg tac tag gctgtgcgcc
ccggaacgtg tccaggagga 1659Arg Glu Thr Leu Tyr 415gcctggccat
gggtccttgc ccccgacaga cagagcagcc cccacccggg agccttgatg
1719ggggtcaggc agaggccagc ctgcactgga gtctgaggcc tgggaccccc
ccctcccacc 1779ccctaaccca tgtttctcat tagtgtctcc cgggcctgtc
cccaactcct ccccacccct 1839cccccatctc ctctttgaaa gccagaacaa
gagagcgctc ctctcccaga taggaaaagg 1899gcctctaaca aggagaaatt
agtgtgcggc aaaaggcagt tttctttgtt ctcagactaa 1959tggatggttc
cagagaagga aatgaaatgt gctgggtggg gccgggcctc cggcggcccg
2019gctgctgttc ccatgtccac atctctgagg cctgcacccc ctctgtctag
ctcggggagt 2079ccagccccag tcccgcaggc tccgtggctt tgggcctcac
gtgcagaccc tgccatgcag 2139acccatgccc ccctccccca ggcagctcca
agaaagctcc ctgactcgcc ccttcaggcc 2199tggcaagctg ggggcccatc
gccgtgggga gtccctccca ccaccctcgc cgcaggcagc 2259tgcagccccc
agaggggacc acaagcccaa aaaggacaaa aatgggctgg cctggaatgg
2319cccagacccc agcctcccct cctccctccc atcctcaccc aggccaaggc
ccaggggctc 2379tgccaggaca ccacatggga gggggctcag gcctcagcct
caagatcttc agctgtggcc 2439tctcgggctc ggcagaaggg acgccggatc
aggggcctgg tctccagcac ctgcccgagt 2499ggccgtggcc aggatggggt
gcgcattccg tgtgctttgc ttgtagctgt gcaggctgag 2559gtctggagcc
aggcccagag ctggcttcag ggtggggcct tgagaagggg aatgtgggac
2619aggggcgatg gtgcctggtc tctgagtaag atgccaggtc ccaggaactc
aggcttcagg 2679tgagaaggag cggtgtgtcc aggcaccgct ggccggcagc
cctgggctga ggcacagact 2739catttgtcac cttctggcgg cggcagccct
ggccccggcc tccaagcagt tgaaaaagct 2799ggcgcctcct tggtctctag
gatccaggct ccacagagca catgactagc caggcccctg 2859gcttaagaag
gtcgcctaag cctaagagaa gacagtccca ggagaagctg gccgggacca
2919gccaggagct gggagccaca ggaagcaaaa gtcagccttt tcttcaaggg
atttccctgt 2979ctcagagcag cctttgcccc agggaaatgg gctctgggct
ggctgcctgc accggccatg 3039tcgacccagg acccggacac ctggtcttgg
gctgtgttca gccactttgc cttctctgga 3099ctcagtttcc ccgtctgaga
aatgagagtc gaatgctaca gtatctgcag tcgcttggat 3159ctggctgttg
agttgacggg ttccttgaac cccacaaaat ccctctccaa ccacaggacc
3219cttcggctca ccaagaacgg ggcccagggg agtcaggcct attcgctgca
cttcctgcca 3279aactttgccc ccacaagcct ggtcatcagc caggcagccc
tcccagtgcc caagggccac 3339caaccccagg gaaacagggc cagcacagag
gggccttcct cccccacaga gctcccatga 3399catagtctgc tctgggcgga
agagctttgc tgccagccag ggatgtccag aggtcggtgc 3459agcccctatc
cctgctcagg agtgggctca gagtctagca aatgctaagg cccctcaggc
3519tgggctctga acgaggacct ggactcagag ccagacaggg cagcctcaga
cccttctctg 3579gggctcctgg accttgggcc ataatttctg agcctcggtt
tccccatcta aggaacagat 3639gtggtcgttc cgccctctca gctggatgag
actgtcctgg aggatccacc ccggaacaga 3699cagaacggtg tctctcagga
tggtgctctg agagagggca gagtggatgc cccactgccc 3759tagaccctcg
gtagacgtgg ggtctctggg gcggggtctg tggctgtgac tgaagtcggc
3819tttcccgttg atgtcttgat gctcctatct gtgcacttac cgtaggtagg
gacacgtgtc 3879catgcaccac agacacaccc acgacacctg
atctcgtatc actagcttgc ggccaggtca 3939tgatgtggcc ccggaagctg
gccctgcgtg ccatgagtgc gtcggtcatg gagtccggag 3999cccctgagcc
ggcccctggt gacggcacag ccctcacagc tcaaacgccc acccccactc
4059ccaccatctg caggtggtga aaacaaaccc cgtgtatctc tcaataaagg
tggccgaagg 4119gcctcgatgt gg 41316418PRTHomo sapiens 6Met Arg Leu
Asn Ser Ser Ala Pro Gly Thr Pro Gly Thr Pro Ala Ala1 5 10 15Asp Pro
Phe Gln Arg Ala Gln Ala Gly Leu Glu Glu Ala Leu Leu Ala 20 25 30Pro
Gly Phe Gly Asn Ala Ser Gly Asn Ala Ser Glu Arg Val Leu Ala 35 40
45Ala Pro Ser Ser Glu Leu Asp Val Asn Thr Asp Ile Tyr Ser Lys Val
50 55 60Leu Val Thr Ala Val Tyr Leu Ala Leu Phe Val Val Gly Thr Val
Gly65 70 75 80Asn Thr Val Thr Ala Phe Thr Leu Ala Arg Lys Lys Ser
Leu Gln Ser 85 90 95Leu Gln Ser Thr Val His Tyr His Leu Gly Ser Leu
Ala Leu Ser Asp 100 105 110Leu Leu Thr Leu Leu Leu Ala Met Pro Val
Glu Leu Tyr Asn Phe Ile 115 120 125Trp Val His His Pro Trp Ala Phe
Gly Asp Ala Gly Cys Arg Gly Tyr 130 135 140Tyr Phe Leu Arg Asp Ala
Cys Thr Tyr Ala Thr Ala Leu Asn Val Ala145 150 155 160Ser Leu Ser
Val Glu Arg Tyr Leu Ala Ile Cys His Pro Phe Lys Ala 165 170 175Lys
Thr Leu Met Ser Arg Ser Arg Thr Lys Lys Phe Ile Ser Ala Ile 180 185
190Trp Leu Ala Ser Ala Leu Leu Thr Val Pro Met Leu Phe Thr Met Gly
195 200 205Glu Gln Asn Arg Ser Ala Asp Gly Gln His Ala Gly Gly Leu
Val Cys 210 215 220Thr Pro Thr Ile His Thr Ala Thr Val Lys Val Val
Ile Gln Val Asn225 230 235 240Thr Phe Met Ser Phe Ile Phe Pro Met
Val Val Ile Ser Val Leu Asn 245 250 255Thr Ile Ile Ala Asn Lys Leu
Thr Val Met Val Arg Gln Ala Ala Glu 260 265 270Gln Gly Gln Val Cys
Thr Val Gly Gly Glu His Ser Thr Phe Ser Met 275 280 285Ala Ile Glu
Pro Gly Arg Val Gln Ala Leu Arg His Gly Val Arg Val 290 295 300Leu
Arg Ala Val Val Ile Ala Phe Val Val Cys Trp Leu Pro Tyr His305 310
315 320Val Arg Arg Leu Met Phe Cys Tyr Ile Ser Asp Glu Gln Trp Thr
Pro 325 330 335Phe Leu Tyr Asp Phe Tyr His Tyr Phe Tyr Met Val Thr
Asn Ala Leu 340 345 350Phe Tyr Val Ser Ser Thr Ile Asn Pro Ile Leu
Tyr Asn Leu Val Ser 355 360 365Ala Asn Phe Arg His Ile Phe Leu Ala
Thr Leu Ala Cys Leu Cys Pro 370 375 380Val Trp Arg Arg Arg Arg Lys
Arg Pro Ala Phe Ser Arg Lys Ala Asp385 390 395 400Ser Val Ser Ser
Asn His Thr Leu Ser Ser Asn Ala Thr Arg Glu Thr 405 410 415Leu
Tyr723DNAArtificialAn artificially synthesized primer sequence for
RT-PCR 7taaatggctt caggagactt cag 23824DNAArtificialAn artificially
synthesized primer sequence for RT-PCR 8ggttttaaat gcagctccta tgtg
24923DNAArtificialAn artificially synthesized primer sequence for
RT-PCR 9ctgaacagtg ggtatcttcc tta 231023DNAArtificialAn
artificially synthesized primer sequence for RT-PCR 10gatggctctt
gacttagagg ttc 231122DNAArtificialAn artificially synthesized
primer sequence for RT-PCR 11tgaagagatt cagagtggac ga
221223DNAArtificialAn artificially synthesized primer sequence for
RT-PCR 12actgagaaca ttgacaacac agg 231322DNAArtificialAn
artificially synthesized primer sequence for RT-PCR 13aagagggaca
gggacaagta gt 221421DNAArtificialAn artificially synthesized primer
sequence for RT-PCR 14atgccactgt tactgcttca g 211523DNAArtificialAn
artificially synthesized primer sequence for RT-PCR 15ggctcttaca
actcatgtac cca 231624DNAArtificialAn artificially synthesized
primer sequence for RT-PCR 16tgatacagag acatgaagtg agca
241719DNAArtificialAn artificially synthesized primer sequence for
RT-PCR 17tggtgtttgc cttcatcct 191820DNAArtificialAn artificially
synthesized primer sequence for RT-PCR 18gaatcccaga agtctgaaca
201919DNAArtificialAn artificially synthesized primer sequence for
RT-PCR 19acggtcctct acagtctca 192018DNAArtificialAn artificially
synthesized primer sequence for RT-PCR 20cacagggaga ggatagga
182123DNAArtificialAn artificially synthesized primer sequence for
RT-PCR 21agtgggctca gagtctagca aat 232223DNAArtificialAn
artificially synthesized primer sequence for RT-PCR 22tattgagaga
tacacggggt ttg 232321DNAArtificialAn artificially synthesized
primer sequence for RT-PCR 23tgagccctga acaccagaga g
212421DNAArtificialAn artificially synthesized primer sequence for
RT-PCR 24aaagccagat gagcgcttct a 212522DNAArtificialAn artificially
synthesized primer sequence for RT-PCR 25tcttcagcat gatgtgttgt gt
222624DNAArtificialAn artificially synthesized primer sequence for
RT-PCR 26tgagagattc atgaggaagt cttg 242721DNAArtificialAn
artificially synthesized primer sequence for RT-PCR 27gaggtgatag
cattgctttc g 212821DNAArtificialAn artificially synthesized primer
sequence for RT-PCR 28caagtcagtg tacaggtaag c 212919DNAArtificialA
target sequence for siRNA 29gaagcagcac gacttcttc
193019DNAArtificialA target sequence for siRNA 30cgtacgcgga
atacttcga 193119DNAArtificialA target sequence for siRNA
31gcgcgctttg taggattcg 193219DNAArtificialA target sequence for
siRNA 32gttagtgtac gaactggag 193319DNAArtificialA target sequence
for siRNA 33gtgtctctgt tggagatct 193419DNAArtificialA target
sequence for siRNA 34gaaggcagtt gaccaacac 193519DNAArtificialA
target sequence for siRNA 35cctctacctg tccagcatg
193619DNAArtificialA target sequence for siRNA 36gttcatcagc
gccatctgg 193719DNAArtificialA target sequence for siRNA
37ggtcgtcata caggtcaac 193832DNAArtificialAn artificially
synthesized primer sequence for RT-PCR 38ggaattccat gtggaacgcg
acgcccagcg aa 323940DNAArtificialAn artificially synthesized primer
sequence for RT-PCR 39cgcggatccg cgtgtattaa tactagattc tgtccaggcc
404032DNAArtificialAn artificially synthesized primer sequence for
RT-PCR 40ggaattccat gtggaacgcg acgcccagcg aa 324136DNAArtificialAn
artificially synthesized primer sequence for RT-PCR 41cgcggatccg
cggagagaag ggagaaggca caggga 364236DNAArtificialAn artificially
synthesized primer sequence for RT-PCR 42ggaattccat gcgcctcaac
agctccgcgc cgggaa 364339DNAArtificialAn artificially synthesized
primer sequence for RT-PCR 43cgcggatccg cggtacagcg tctcgcgggt
ggcattgct 394422DNAArtificialAn artificially synthesized primer
sequence for PCR of H1RNA gene promoter region 44tggtagccaa
gtgcaggtta ta 224522DNAArtificialAn artificially synthesized primer
sequence for PCR of H1RNA gene promoter region 45ccaaagggtt
tctgcagttt ca 224630DNAArtificialAn artificially synthesized primer
sequence for PCR of pcDNA3.1 H1RNA gene fragment 46tgcggatcca
gagcagattg tactgagagt 304729DNAArtificialAn artificially
synthesized primer sequence for PCR of pcDNA3.1 H1RNA gene fragment
47ctctatctcg agtgaggcgg aaagaacca 294847DNAArtificialAn
artificially synthesized primer sequence for PCR of the ligated DNA
48tttaagcttg aagaccattt ttggaaaaaa aaaaaaaaaa aaaaaac
474934DNAArtificialAn artificially synthesized primer sequence for
PCR of the ligated DNA 49tttaagcttg aagacatggg aaagagtggt ctca
34505085DNAArtificialAn artificially synthesized vector sequence
50gacggatcgg gagatctccc gatcccctat ggtgcactct cagtacaatc tgctctggat
60ccactagtaa cggccgccag tgtgctggaa ttcggcttgg tagccaagtg caggttatag
120ggagctgaag ggaagggggt cacagtaggt ggcatcgttc ctttctgact
gcccgccccc 180cgcatgccgt cccgcgatat tgagctccga acctctcgcc
ctgccgccgc cggtgctccg 240tcgccgccgc gccgccatgg aattcgaacg
ctgacgtcat caacccgctc caaggaatcg 300cgggcccagt gtcactaggc
gggaacaccc agcgcgcgtg cgccctggca ggaagatggc 360tgtgagggac
aggggagtgg cgccctgcaa tatttgcatg tcgctatgtg ttctgggaaa
420tcaccataaa cgtgaaatgt ctttggattt gggaatctta taagttctgt
atgagaccac 480tctttccctt tttgggaaaa aaaaaaaaaa aaaaaaaacg
aaaccgggcc gggcgcggtg 540gttcacgcct ataatcccag cactttggga
ggccgaggcg ggcggatcac aaggtcagga 600ggtcgagacc atccaggcta
acacggtgaa accccccccc atctctacta aaaaaaaaaa 660atacaaaaaa
ttagccatta gccgggcgtg gtggcgggcg cctataatcc cagctacttg
720ggaggctgaa gcagaatggc gtgaacccgg gaggcggacg ttgcagtgag
ccgagatcgc 780gccgactgca ttccagcctg ggcgacagag cgagtctcaa
aaaaaaaacc gagtggaatg 840tgaaaagctc cgtgaaactg cagaaaccca
agccgaattc tgcagatatc catcacactg 900gcggccgctc gagtgaggcg
gaaagaacca gctggggctc tagggggtat ccccacgcgc 960cctgtagcgg
cgcattaagc gcggcgggtg tggtggttac gcgcagcgtg accgctacac
1020ttgccagcgc cctagcgccc gctcctttcg ctttcttccc ttcctttctc
gccacgttcg 1080ccggctttcc ccgtcaagct ctaaatcggg ggctcccttt
agggttccga tttagtgctt 1140tacggcacct cgaccccaaa aaacttgatt
agggtgatgg ttcacgtagt gggccatcgc 1200cctgatagac ggtttttcgc
cctttgacgt tggagtccac gttctttaat agtggactct 1260tgttccaaac
tggaacaaca ctcaacccta tctcggtcta ttcttttgat ttataaggga
1320ttttgccgat ttcggcctat tggttaaaaa atgagctgat ttaacaaaaa
tttaacgcga 1380attaattctg tggaatgtgt gtcagttagg gtgtggaaag
tccccaggct ccccagcagg 1440cagaagtatg caaagcatgc atctcaatta
gtcagcaacc aggtgtggaa agtccccagg 1500ctccccagca ggcagaagta
tgcaaagcat gcatctcaat tagtcagcaa ccatagtccc 1560gcccctaact
ccgcccatcc cgcccctaac tccgcccagt tccgcccatt ctccgcccca
1620tggctgacta atttttttta tttatgcaga ggccgaggcc gcctctgcct
ctgagctatt 1680ccagaagtag tgaggaggct tttttggagg cctaggcttt
tgcaaaaagc tcccgggagc 1740ttgtatatcc attttcggat ctgatcaaga
gacaggatga ggatcgtttc gcatgattga 1800acaagatgga ttgcacgcag
gttctccggc cgcttgggtg gagaggctat tcggctatga 1860ctgggcacaa
cagacaatcg gctgctctga tgccgccgtg ttccggctgt cagcgcaggg
1920gcgcccggtt ctttttgtca agaccgacct gtccggtgcc ctgaatgaac
tgcaggacga 1980ggcagcgcgg ctatcgtggc tggccacgac gggcgttcct
tgcgcagctg tgctcgacgt 2040tgtcactgaa gcgggaaggg actggctgct
attgggcgaa gtgccggggc aggatctcct 2100gtcatctcac cttgctcctg
ccgagaaagt atccatcatg gctgatgcaa tgcggcggct 2160gcatacgctt
gatccggcta cctgcccatt cgaccaccaa gcgaaacatc gcatcgagcg
2220agcacgtact cggatggaag ccggtcttgt cgatcaggat gatctggacg
aagagcatca 2280ggggctcgcg ccagccgaac tgttcgccag gctcaaggcg
cgcatgcccg acggcgagga 2340tctcgtcgtg acccatggcg atgcctgctt
gccgaatatc atggtggaaa atggccgctt 2400ttctggattc atcgactgtg
gccggctggg tgtggcggac cgctatcagg acatagcgtt 2460ggctacccgt
gatattgctg aagagcttgg cggcgaatgg gctgaccgct tcctcgtgct
2520ttacggtatc gccgctcccg attcgcagcg catcgccttc tatcgccttc
ttgacgagtt 2580cttctgagcg ggactctggg gttcgaaatg accgaccaag
cgacgcccaa cctgccatca 2640cgagatttcg attccaccgc cgccttctat
gaaaggttgg gcttcggaat cgttttccgg 2700gacgccggct ggatgatcct
ccagcgcggg gatctcatgc tggagttctt cgcccacccc 2760aacttgttta
ttgcagctta taatggttac aaataaagca atagcatcac aaatttcaca
2820aataaagcat ttttttcact gcattctagt tgtggtttgt ccaaactcat
caatgtatct 2880tatcatgtct gtataccgtc gacctctagc tagagcttgg
cgtaatcatg gtcatagctg 2940tttcctgtgt gaaattgtta tccgctcaca
attccacaca acatacgagc cggaagcata 3000aagtgtaaag cctggggtgc
ctaatgagtg agctaactca cattaattgc gttgcgctca 3060ctgcccgctt
tccagtcggg aaacctgtcg tgccagctgc attaatgaat cggccaacgc
3120gcggggagag gcggtttgcg tattgggcgc tcttccgctt cctcgctcac
tgactcgctg 3180cgctcggtcg ttcggctgcg gcgagcggta tcagctcact
caaaggcggt aatacggtta 3240tccacagaat caggggataa cgcaggaaag
aacatgtgag caaaaggcca gcaaaaggcc 3300aggaaccgta aaaaggccgc
gttgctggcg tttttccata ggctccgccc ccctgacgag 3360catcacaaaa
atcgacgctc aagtcagagg tggcgaaacc cgacaggact ataaagatac
3420caggcgtttc cccctggaag ctccctcgtg cgctctcctg ttccgaccct
gccgcttacc 3480ggatacctgt ccgcctttct cccttcggga agcgtggcgc
tttctcatag ctcacgctgt 3540aggtatctca gttcggtgta ggtcgttcgc
tccaagctgg gctgtgtgca cgaacccccc 3600gttcagcccg accgctgcgc
cttatccggt aactatcgtc ttgagtccaa cccggtaaga 3660cacgacttat
cgccactggc agcagccact ggtaacagga ttagcagagc gaggtatgta
3720ggcggtgcta cagagttctt gaagtggtgg cctaactacg gctacactag
aagaacagta 3780tttggtatct gcgctctgct gaagccagtt accttcggaa
aaagagttgg tagctcttga 3840tccggcaaac aaaccaccgc tggtagcggt
ttttttgttt gcaagcagca gattacgcgc 3900agaaaaaaag gatctcaaga
agatcctttg atcttttcta cggggtctga cgctcagtgg 3960aacgaaaact
cacgttaagg gattttggtc atgagattat caaaaaggat cttcacctag
4020atccttttaa attaaaaatg aagttttaaa tcaatctaaa gtatatatga
gtaaacttgg 4080tctgacagtt accaatgctt aatcagtgag gcacctatct
cagcgatctg tctatttcgt 4140tcatccatag ttgcctgact ccccgtcgtg
tagataacta cgatacggga gggcttacca 4200tctggcccca gtgctgcaat
gataccgcga gacccacgct caccggctcc agatttatca 4260gcaataaacc
agccagccgg aagggccgag cgcagaagtg gtcctgcaac tttatccgcc
4320tccatccagt ctattaattg ttgccgggaa gctagagtaa gtagttcgcc
agttaatagt 4380ttgcgcaacg ttgttgccat tgctacaggc atcgtggtgt
cacgctcgtc gtttggtatg 4440gcttcattca gctccggttc ccaacgatca
aggcgagtta catgatcccc catgttgtgc 4500aaaaaagcgg ttagctcctt
cggtcctccg atcgttgtca gaagtaagtt ggccgcagtg 4560ttatcactca
tggttatggc agcactgcat aattctctta ctgtcatgcc atccgtaaga
4620tgcttttctg tgactggtga gtactcaacc aagtcattct gagaatagtg
tatgcggcga 4680ccgagttgct cttgcccggc gtcaatacgg gataataccg
cgccacatag cagaacttta 4740aaagtgctca tcattggaaa acgttcttcg
gggcgaaaac tctcaaggat cttaccgctg 4800ttgagatcca gttcgatgta
acccactcgt gcacccaact gatcttcagc atcttttact 4860ttcaccagcg
tttctgggtg agcaaaaaca ggaaggcaaa atgccgcaaa aaagggaata
4920agggcgacac ggaaatgttg aatactcata ctcttccttt ttcaatatta
ttgaagcatt 4980tatcagggtt attgtctcat gagcggatac atatttgaat
gtatttagaa aaataaacaa 5040ataggggttc cgcgcacatt tccccgaaaa
gtgccacctg acgtc 50855151DNAArtificialAn artificially synthesized
oligonucleotide sequence for construction of siRNA expression
vector 51tcccgttagt gtacgaactg gagttcaaga gactccagtt cgtacactaa c
515251DNAArtificialAn artificially synthesized oligonucleotide
sequence for construction of siRNA expression vector 52aaaagttagt
gtacgaactg gagtctcttg aactccagtt cgtacactaa c 515347DNAArtificialAn
artificially synthesized oligonucleotide sequence for hairpin siRNA
53gttagtgtac gaactggagt tcaagagact ccagttcgta cactaac
475451DNAArtificialAn artificially synthesized oligonucleotide
sequence for construction of siRNA expression vector 54tcccgtgtct
ctgttggaga tctttcaaga gaagatctcc aacagagaca c 515551DNAArtificialAn
artificially synthesized oligonucleotide sequence for construction
of siRNA expression vector 55aaaagtgtct ctgttggaga tcttctcttg
aaagatctcc aacagagaca c 515647DNAArtificialAn artificially
synthesized oligonucleotide sequence for hairpin siRNA 56gtgtctctgt
tggagatctt tcaagagaag atctccaaca gagacac 475751DNAArtificialAn
artificially synthesized oligonucleotide sequence for construction
of siRNA expression vector 57tcccgaaggc agttgaccaa cacttcaaga
gagtgttggt caactgcctt c 515851DNAArtificialAn artificially
synthesized oligonucleotide sequence for construction of siRNA
expression vector 58aaaagaaggc agttgaccaa cactctcttg aagtgttggt
caactgcctt c 515947DNAArtificialAn artificially synthesized
oligonucleotide sequence for hairpin siRNA 59gaaggcagtt gaccaacact
tcaagagagt gttggtcaac tgccttc 476051DNAArtificialAn artificially
synthesized oligonucleotide sequence for construction of siRNA
expression vector 60tccccctcta cctgtccagc atgttcaaga gacatgctgg
acaggtagag g 516151DNAArtificialAn artificially synthesized
oligonucleotide sequence for construction of siRNA expression
vector 61aaaacctcta cctgtccagc atgtctcttg aacatgctgg acaggtagag g
516247DNAArtificialAn artificially synthesized oligonucleotide
sequence for hairpin siRNA 62cctctacctg tccagcatgt tcaagagaca
tgctggacag gtagagg 476351DNAArtificialAn artificially synthesized
oligonucleotide sequence for construction of siRNA expression
vector 63tcccgttcat cagcgccatc tggttcaaga gaccagatgg cgctgatgaa c
516451DNAArtificialAn artificially synthesized oligonucleotide
sequence for construction of siRNA expression vector 64aaaagttcat
cagcgccatc tggtctcttg aaccagatgg cgctgatgaa c 516547DNAArtificialAn
artificially synthesized oligonucleotide sequence for hairpin siRNA
65gttcatcagc gccatctggt tcaagagacc agatggcgct gatgaac
476651DNAArtificialAn artificially synthesized oligonucleotide
sequence for construction of siRNA expression vector 66tcccggtcgt
catacaggtc aacttcaaga gagttgacct gtatgacgac c 516751DNAArtificialAn
artificially synthesized oligonucleotide sequence for construction
of siRNA expression vector 67aaaaggtcgt catacaggtc aactctcttg
aagttgacct gtatgacgac c 516847DNAArtificialAn artificially
synthesized oligonucleotide sequence for hairpin siRNA 68ggtcgtcata
caggtcaact tcaagagagt tgacctgtat gacgacc 476920DNAArtificialAn
artificially synthesized primer sequence for construction of IMP-3
deletion mutant 69atgaacaaac tgtatatcgg 207018DNAArtificialAn
artificially synthesized primer sequence for construction of IMP-3
deletion mutant 70cttccgtctt gactgagg 187120DNAArtificialAn
artificially synthesized primer sequence for construction of IMP-3
deletion mutant 71atgaacaaac tgtatatcgg 207219DNAArtificialAn
artificially synthesized primer sequence for construction of IMP-3
deletion mutant 72atgagcttca agtttcacc 197320DNAArtificialAn
artificially synthesized primer sequence for construction of IMP-3
deletion mutant 73atgaacaaac tgtatatcgg 207418DNAArtificialAn
artificially synthesized primer sequence for construction of IMP-3
deletion mutant 74ctccgtttct gattgctc 187520DNAArtificialAn
artificially synthesized primer sequence for construction of IMP-3
deletion mutant 75atgaacaaac tgtatatcgg 207621DNAArtificialAn
artificially synthesized primer sequence for construction of IMP-3
deletion mutant 76aggcaaatca catggtttct g 217718DNAArtificialAn
artificially synthesized primer sequence for construction of IMP-3
deletion mutant 77ttgcctctgc gcctgctg 187818DNAArtificialAn
artificially synthesized primer sequence for construction of IMP-3
deletion mutant 78cttccgtctt gactgagg 187918DNAArtificialAn
artificially synthesized primer sequence for construction of IMP-3
deletion mutant 79ttgcctctgc gcctgctg 188018DNAArtificialAn
artificially synthesized primer sequence for construction of IMP-3
deletion mutant 80ctccgtttct gattgctc 188123DNAArtificialAn
artificially synthesized primer sequence for IP-RT-PCR 81ttatcctgaa
cagctctttg gtg 238223DNAArtificialAn artificially synthesized
primer sequence for IP-RT-PCR 82aagcgaaggt cagctaaata tcc
238323DNAArtificialAn artificially synthesized primer sequence for
IP-RT-PCR 83ctttctgagc acactacgga tct 238423DNAArtificialAn
artificially synthesized primer sequence for IP-RT-PCR 84aagccctctt
acttacaggg aaa 238521DNAArtificialAn artificially synthesized
primer sequence for IP-RT-PCR 85ggttcccctg gatttagtga a
218625DNAArtificialAn artificially synthesized primer sequence for
IP-RT-PCR 86caacagtaaa tctgaaactc ttgcc 258723DNAArtificialAn
artificially synthesized primer sequence for IP-RT-PCR 87gacaaaggta
gcaagaggat ttc 238822DNAArtificialAn artificially synthesized
primer sequence for IP-RT-PCR 88ctggtgttaa actcggttct tc
228923DNAArtificialAn artificially synthesized primer sequence for
IP-RT-PCR 89ctagtgagtg aggctattgc agc 239024DNAArtificialAn
artificially synthesized primer sequence for IP-RT-PCR 90gtctcttcta
gcacctcaat ctcc 249123DNAArtificialAn artificially synthesized
primer sequence for IP-RT-PCR 91atctgacttt ctgtccactg cat
239222DNAArtificialAn artificially synthesized primer sequence for
IP-RT-PCR 92taattcagca taagccaaag cc 229323DNAArtificialAn
artificially synthesized primer sequence for IP-RT-PCR 93acacagtatg
gactgaaatc gac 239423DNAArtificialAn artificially synthesized
primer sequence for IP-RT-PCR 94cacctcaatc tgaacaaggt tag
239523DNAArtificialAn artificially synthesized primer sequence for
IP-RT-PCR 95ggcctctcaa agtctggtag att 239623DNAArtificialAn
artificially synthesized primer sequence for IP-RT-PCR 96atattcccac
ttcagagacg aca 2397197PRTArtificialAn artificially synthesized
sequence of IMP-3 deletion mutant 97Met Asn Lys Leu Tyr Ile Gly Asn
Leu Ser Glu Asn Ala Ala Pro Ser1 5 10 15Asp Leu Glu Ser Ile Phe Lys
Asp Ala Lys Ile Pro Val Ser Gly Pro 20 25 30Phe Leu Val Lys Thr Gly
Tyr Ala Phe Val Asp Cys Pro Asp Glu Ser 35 40 45Trp Ala Leu Lys Ala
Ile Glu Ala Leu Ser Gly Lys Ile Glu Leu His 50 55 60Gly Lys Pro Ile
Glu Val Glu His Ser Val Pro Lys Arg Gln Arg Ile65 70 75 80Arg Lys
Leu Gln Ile Arg Asn Ile Pro Pro His Leu Gln Trp Glu Val 85 90 95Leu
Asp Ser Leu Leu Val Gln Tyr Gly Val Val Glu Ser Cys Glu Gln 100 105
110Val Asn Thr Asp Ser Glu Thr Ala Val Val Asn Val Thr Tyr Ser Ser
115 120 125Lys Asp Gln Ala Arg Gln Ala Leu Asp Lys Leu Asn Gly Phe
Gln Leu 130 135 140Glu Asn Phe Thr Leu Lys Val Ala Tyr Ile Pro Asp
Glu Met Ala Ala145 150 155 160Gln Gln Asn Pro Leu Gln Gln Pro Arg
Gly Arg Arg Gly Leu Gly Gln 165 170 175Arg Gly Ser Ser Arg Gln Gly
Ser Pro Gly Ser Val Ser Lys Gln Lys 180 185 190Pro Cys Asp Leu Pro
1959823DNAArtificialAn artificially synthesized primer sequence for
Quantitative RT-PCR 98acgaactcat ttgctcactc ctt
239921DNAArtificialAn artificially synthesized primer sequence for
Quantitative RT-PCR 99acccacaccc aacacaattg t
2110012DNAArtificialAn artificially synthesized primer sequence for
Quantitative RT-PCR 100acagcaaagc cc 1210123DNAArtificialAn
artificially synthesized primer sequence for Quantitative RT-PCR
101ttcaccctga cagagttcac aaa 2310222DNAArtificialAn artificially
synthesized primer sequence for Quantitative RT-PCR 102gggtggtctc
ccataatagc aa 2210319DNAArtificialAn artificially synthesized
primer sequence for Quantitative RT-PCR 103agcccacttt agagtatac
191044168DNAHomo sapiens 104aagacttagg aagactggtg gatgcgtttg
ggttgtagct aggctttttc ttttctttct 60cttttaaaac acatctagac aaggaaaaaa
caagcctcgg atctgatttt tcactcctcg 120ttcttgtgct tggttcttac
tgtgtttgtg tattttaaag gcgagaagac gaggggaaca 180aaaccagctg
gatccatcca tcaccgtggg tggttttaat ttttcgtttt ttctcgttat
240ttttttttaa acaaccactc ttcacaatga acaaactgta tatcggaaac
ctcagcgaga 300acgccgcccc ctcggaccta gaaagtatct tcaaggacgc
caagatcccg gtgtcgggac 360ccttcctggt gaagactggc tacgcgttcg
tggactgccc ggacgagagc tgggccctca 420aggccatcga ggcgctttca
ggtaaaatag aactgcacgg gaaacccata gaagttgagc 480actcggtccc
aaaaaggcaa aggattcgga aacttcagat acgaaatatc ccgcctcatt
540tacagtggga ggtgctggat agtttactag tccagtatgg agtggtggag
agctgtgagc 600aagtgaacac tgactcggaa actgcagttg taaatgtaac
ctattccagt aaggaccaag 660ctagacaagc actagacaaa ctgaatggat
ttcagttaga gaatttcacc ttgaaagtag 720cctatatccc tgatgaaatg
gccgcccagc aaaacccctt gcagcagccc cgaggtcgcc 780gggggcttgg
gcagaggggc tcctcaaggc aggggtctcc aggatccgta tccaagcaga
840aaccatgtga tttgcctctg cgcctgctgg ttcccaccca atttgttgga
gccatcatag 900gaaaagaagg tgccaccatt cggaacatca ccaaacagac
ccagtctaaa atcgatgtcc 960accgtaaaga aaatgcgggg gctgctgaga
agtcgattac tatcctctct actcctgaag 1020gcacctctgc ggcttgtaag
tctattctgg agattatgca taaggaagct caagatataa 1080aattcacaga
agagatcccc ttgaagattt tagctcataa taactttgtt ggacgtctta
1140ttggtaaaga aggaagaaat cttaaaaaaa ttgagcaaga cacagacact
aaaatcacga 1200tatctccatt gcaggaattg acgctgtata atccagaacg
cactattaca gttaaaggca 1260atgttgagac atgtgccaaa gctgaggagg
agatcatgaa gaaaatcagg gagtcttatg 1320aaaatgatat tgcttctatg
aatcttcaag cacatttaat tcctggatta aatctgaacg 1380ccttgggtct
gttcccaccc acttcaggga tgccacctcc cacctcaggg cccccttcag
1440ccatgactcc tccctacccg cagtttgagc aatcagaaac ggagactgtt
catctgttta 1500tcccagctct atcagtcggt gccatcatcg gcaagcaggg
ccagcacatc aagcagcttt 1560ctcgctttgc tggagcttca attaagattg
ctccagcgga agcaccagat gctaaagtga 1620ggatggtgat tatcactgga
ccaccagagg ctcagttcaa ggctcaggga agaatttatg 1680gaaaaattaa
agaagaaaac tttgttagtc ctaaagaaga ggtgaaactt gaagctcata
1740tcagagtgcc atcctttgct gctggcagag ttattggaaa aggaggcaaa
acggtgaatg 1800aacttcagaa tttgtcaagt gcagaagttg ttgtccctcg
tgaccagaca cctgatgaga 1860atgaccaagt ggttgtcaaa ataactggtc
acttctatgc ttgccaggtt gcccagagaa 1920aaattcagga aattctgact
caggtaaagc agcaccaaca acagaaggct ctgcaaagtg 1980gaccacctca
gtcaagacgg aagtaaaggc tcaggaaaca gcccaccaca gaggcagatg
2040ccaaaccaaa gacagattgc ttaaccaaca gatgggcgct gaccccctat
ccagaatcac 2100atgcacaagt ttttacctag ccagttgttt ctgaggacca
ggcaactttt gaactcctgt 2160ctctgtgaga atgtatactt tatgctctct
gaaatgtatg acacccagct ttaaaacaaa 2220caaacaaaca aacaaaaaaa
gggtggggga gggagggaaa gagaagagct ctgcacttcc 2280ctttgttgta
gtctcacagt ataacagata ttctaattct tcttaatatt cccccataat
2340gccagaaatt ggcttaatga tgctttcact aaattcatca aatagattgc
tcctaaatcc 2400aattgttaaa attggatcag aataattatc acaggaactt
aaatgttaag ccattagcat 2460agaaaaactg ttctcagttt tatttttacc
taacactaac atgagtaacc taagggaagt 2520gctgaatggt gttggcaggg
gtattaaacg tgcattttta ctcaactacc tcaggtattc 2580agtaatacaa
tgaaaagcaa aattgttcct tttttttgaa aattttatat actttataat
2640gatagaagtc caaccgtttt ttaaaaaata aatttaaaat ttaacagcaa
tcagctaaca 2700ggcaaattaa gatttttact tctggctggt gacagtaaag
ctggaaaatt aatttcaggg 2760ttttttgagg cttttgacac agttattagt
taaatcaaat gttcaaaaat acggagcagt 2820gcctagtatc tggagagcag
cactaccatt tattctttca tttatagttg ggaaagtttt 2880tgacggtact
aacaaagtgg tcgcaggaga ttttggaacg gctggtttaa atggcttcag
2940gagacttcag ttttttgttt agctacatga ttgaatgcat aataaatgct
ttgtgcttct 3000gactatcaat acctaaagaa agtgcatcag tgaagagatg
caagactttc aactgactgg 3060caaaaagcaa gctttagctt gtcttatagg
atgcttagtt tgccactaca cttcagacca 3120atgggacagt catagatggt
gtgacagtgt ttaaacgcaa caaaaggcta catttccatg 3180gggccagcac
tgtcatgagc ctcactaagc tattttgaag atttttaagc actgataaat
3240taaaaaaaaa aaattagact ccaccttaag tagtaaagta taacaggatt
tctgtatact 3300gtgcaatcag ttctttgaaa aaaaagtcaa aagatagaga
atacaagaaa agtttttggg 3360atataatttg aatgactgtg aaaacatatg
acctttgata acgaactcat ttgctcactc 3420cttgacagca aagcccagta
cgtacaattg tgttgggtgt gggtggtctc caaggccacg 3480ctgctctctg
aattgatttt ttgagttttg tttgtaagat gatcacagtc atgttacact
3540gatctaaagg acatatatat aaccctttaa aaaaaaaatc actgcctcat
tcttatttca 3600agatgaattt ctatacagac tagatgtttt tctgaagatc
aattagacat tttgaaaatg 3660atttaaagtg ttttccttaa tgttctctga
aaacaagttt cttttgtagt tttaaccaaa 3720aaagtgccct ttttgtcact
ggattctcct agcattcatg attttttttt catacaatga 3780attaaaattg
ctaaaatcat ggactggctt tctggttgga tttcaggtaa gatgtgttta
3840aggccagagc ttttctcagt atttgatttt tttccccaat atttgatttt
ttaaaaatat 3900acacataggt gctgcattta tatctgctgg tttaaattct
gtcatatttc acttctagcc 3960ttttagtatg gcaaatcata ttttactttt
acttaagcat ttgtaatttg gagtatctgg 4020tactagctaa gaaataattc
tataattgag ttttgtactc accatatatg gatcattcct 4080catgtataat
gtgccccaaa tgcagcttca ttttccagat accttgacgc agaataaatt
4140ttttcatcat ttaggtgcaa aaaaaaaa 4168105579PRTHomo sapiens 105Met
Asn Lys Leu Tyr Ile Gly Asn Leu Ser Glu Asn Ala Ala Pro Ser1 5 10
15Asp Leu Glu Ser Ile Phe Lys Asp Ala Lys Ile Pro Val Ser Gly Pro
20 25 30Phe Leu Val Lys Thr Gly Tyr Ala Phe Val Asp Cys Pro Asp Glu
Ser 35 40 45Trp Ala Leu Lys Ala Ile Glu Ala Leu Ser Gly Lys Ile Glu
Leu His 50 55 60Gly Lys Pro Ile Glu Val Glu His Ser Val Pro Lys Arg
Gln Arg Ile65 70 75 80Arg Lys Leu Gln Ile Arg Asn Ile Pro Pro His
Leu Gln Trp Glu Val 85 90 95Leu Asp Ser Leu Leu Val Gln Tyr Gly Val
Val Glu Ser Cys Glu Gln 100 105 110Val Asn Thr Asp Ser Glu Thr Ala
Val Val Asn Val Thr Tyr Ser Ser 115 120 125Lys Asp Gln Ala Arg Gln
Ala Leu Asp Lys Leu Asn Gly Phe Gln Leu 130 135 140Glu Asn Phe Thr
Leu Lys Val Ala Tyr Ile Pro Asp Glu Met Ala Ala145 150 155 160Gln
Gln Asn Pro Leu Gln Gln Pro Arg Gly Arg Arg Gly Leu Gly Gln 165 170
175Arg Gly Ser Ser Arg Gln Gly Ser Pro Gly Ser Val Ser Lys Gln Lys
180 185 190Pro Cys Asp Leu Pro Leu Arg Leu Leu Val Pro Thr Gln Phe
Val Gly 195 200 205Ala Ile Ile Gly Lys Glu Gly Ala Thr Ile Arg Asn
Ile Thr Lys Gln 210 215 220Thr Gln Ser Lys Ile Asp Val His Arg Lys
Glu Asn Ala Gly Ala Ala225 230 235 240Glu Lys Ser Ile Thr Ile Leu
Ser Thr Pro Glu Gly Thr Ser Ala Ala 245 250 255Cys Lys Ser Ile Leu
Glu Ile Met His Lys Glu Ala Gln Asp Ile Lys 260 265 270Phe Thr Glu
Glu Ile Pro Leu Lys Ile Leu Ala His Asn Asn Phe Val 275 280 285Gly
Arg Leu Ile Gly Lys Glu Gly Arg Asn Leu Lys Lys Ile Glu Gln 290 295
300Asp Thr Asp Thr Lys Ile Thr Ile Ser Pro Leu Gln Glu Leu Thr
Leu305 310 315 320Tyr Asn Pro Glu Arg Thr Ile Thr Val Lys Gly Asn
Val Glu Thr Cys 325 330 335Ala Lys Ala Glu Glu Glu Ile Met Lys Lys
Ile Arg Glu Ser Tyr Glu 340 345 350Asn Asp Ile Ala Ser Met Asn Leu
Gln Ala His Leu Ile Pro Gly Leu 355 360 365Asn Leu Asn Ala Leu Gly
Leu Phe Pro Pro Thr Ser Gly Met Pro Pro 370 375 380Pro Thr Ser Gly
Pro Pro Ser Ala Met Thr Pro Pro Tyr Pro Gln Phe385 390 395 400Glu
Gln Ser Glu Thr Glu Thr Val His Leu Phe Ile Pro Ala Leu Ser 405 410
415Val Gly Ala Ile Ile Gly Lys Gln Gly Gln His Ile Lys Gln Leu Ser
420 425 430Arg Phe Ala Gly Ala Ser Ile Lys Ile Ala Pro Ala Glu Ala
Pro Asp 435 440 445Ala Lys Val Arg Met Val Ile Ile Thr Gly Pro Pro
Glu Ala Gln Phe 450 455 460Lys Ala Gln Gly Arg Ile Tyr Gly Lys Ile
Lys Glu Glu Asn Phe Val465 470 475 480Ser Pro Lys Glu Glu Val Lys
Leu Glu Ala His Ile Arg Val Pro Ser 485 490 495Phe Ala Ala Gly Arg
Val Ile Gly Lys Gly Gly Lys Thr Val Asn Glu 500 505 510Leu Gln Asn
Leu Ser Ser Ala Glu Val Val Val Pro Arg Asp Gln Thr 515 520 525Pro
Asp Glu Asn Asp Gln Val Val Val Lys Ile Thr Gly His Phe Tyr 530 535
540Ala Cys Gln Val Ala Gln Arg Lys Ile Gln Glu Ile Leu Thr Gln
Val545 550 555 560Lys Gln His Gln Gln Gln Lys Ala Leu Gln Ser Gly
Pro Pro Gln Ser 565
570 575Arg Arg Lys1063487DNAHomo sapiensCDS(266)..(2512)
106actgaaagct ccggtgccag accccacccc cggccccggc ccgggacccc
ctcccctccc 60gggatccccc ggggttccca ccccgcccgc accgccgggg acccggccgg
tccggcgcga 120gcccccgtcc ggggccctgg ctcggccccc aggttggagg
agcccggagc ccgccttcgg 180agctacggcc taacggcggc ggcgactgca
gtctggaggg tccacacttg tgattctcaa 240tggagagtga aaacgcagat tcata atg
aaa act agc ccc cgt cgg cca ctg 292 Met Lys Thr Ser Pro Arg Arg Pro
Leu 1 5att ctc aaa aga cgg agg ctg ccc ctt cct gtt caa aat gcc cca
agt 340Ile Leu Lys Arg Arg Arg Leu Pro Leu Pro Val Gln Asn Ala Pro
Ser10 15 20 25gaa aca tca gag gag gaa cct aag aga tcc cct gcc caa
cag gag tct 388Glu Thr Ser Glu Glu Glu Pro Lys Arg Ser Pro Ala Gln
Gln Glu Ser 30 35 40aat caa gca gag gcc tcc aag gaa gtg gca gag tcc
aac tct tgc aag 436Asn Gln Ala Glu Ala Ser Lys Glu Val Ala Glu Ser
Asn Ser Cys Lys 45 50 55ttt cca gct ggg atc aag att att aac cac ccc
acc atg ccc aac acg 484Phe Pro Ala Gly Ile Lys Ile Ile Asn His Pro
Thr Met Pro Asn Thr 60 65 70caa gta gtg gcc atc ccc aac aat gct aat
att cac agc atc atc aca 532Gln Val Val Ala Ile Pro Asn Asn Ala Asn
Ile His Ser Ile Ile Thr 75 80 85gca ctg act gcc aag gga aaa gag agt
ggc agt agt ggg ccc aac aaa 580Ala Leu Thr Ala Lys Gly Lys Glu Ser
Gly Ser Ser Gly Pro Asn Lys90 95 100 105ttc atc ctc atc agc tgt ggg
gga gcc cca act cag cct cca gga ctc 628Phe Ile Leu Ile Ser Cys Gly
Gly Ala Pro Thr Gln Pro Pro Gly Leu 110 115 120cgg cct caa acc caa
acc agc tat gat gcc aaa agg aca gaa gtg acc 676Arg Pro Gln Thr Gln
Thr Ser Tyr Asp Ala Lys Arg Thr Glu Val Thr 125 130 135ctg gag acc
ttg gga cca aaa cct gca gct agg gat gtg aat ctt cct 724Leu Glu Thr
Leu Gly Pro Lys Pro Ala Ala Arg Asp Val Asn Leu Pro 140 145 150aga
cca cct gga gcc ctt tgc gag cag aaa cgg gag acc tgt gca gat 772Arg
Pro Pro Gly Ala Leu Cys Glu Gln Lys Arg Glu Thr Cys Ala Asp 155 160
165ggt gag gca gca ggc tgc act atc aac aat agc cta tcc aac atc cag
820Gly Glu Ala Ala Gly Cys Thr Ile Asn Asn Ser Leu Ser Asn Ile
Gln170 175 180 185tgg ctt cga aag atg agt tct gat gga ctg ggc tcc
cgc agc atc aag 868Trp Leu Arg Lys Met Ser Ser Asp Gly Leu Gly Ser
Arg Ser Ile Lys 190 195 200caa gag atg gag gaa aag gag aat tgt cac
ctg gag cag cga cag gtt 916Gln Glu Met Glu Glu Lys Glu Asn Cys His
Leu Glu Gln Arg Gln Val 205 210 215aag gtt gag gag cct tcg aga cca
tca gcg tcc tgg cag aac tct gtg 964Lys Val Glu Glu Pro Ser Arg Pro
Ser Ala Ser Trp Gln Asn Ser Val 220 225 230tct gag cgg cca ccc tac
tct tac atg gcc atg ata caa ttc gcc atc 1012Ser Glu Arg Pro Pro Tyr
Ser Tyr Met Ala Met Ile Gln Phe Ala Ile 235 240 245aac agc act gag
agg aag cgc atg act ttg aaa gac atc tat acg tgg 1060Asn Ser Thr Glu
Arg Lys Arg Met Thr Leu Lys Asp Ile Tyr Thr Trp250 255 260 265att
gag gac cac ttt ccc tac ttt aag cac att gcc aag cca ggc tgg 1108Ile
Glu Asp His Phe Pro Tyr Phe Lys His Ile Ala Lys Pro Gly Trp 270 275
280aag aac tcc atc cgc cac aac ctt tcc ctg cac gac atg ttt gtc cgg
1156Lys Asn Ser Ile Arg His Asn Leu Ser Leu His Asp Met Phe Val Arg
285 290 295gag acg tct gcc aat ggc aag gtc tcc ttc tgg acc att cac
ccc agt 1204Glu Thr Ser Ala Asn Gly Lys Val Ser Phe Trp Thr Ile His
Pro Ser 300 305 310gcc aac cgc tac ttg aca ttg gac cag gtg ttt aag
cag cag aaa cga 1252Ala Asn Arg Tyr Leu Thr Leu Asp Gln Val Phe Lys
Gln Gln Lys Arg 315 320 325ccg aat cca gag ctc cgc cgg aac atg acc
atc aaa acc gaa ctc ccc 1300Pro Asn Pro Glu Leu Arg Arg Asn Met Thr
Ile Lys Thr Glu Leu Pro330 335 340 345ctg ggc gca cgg cgg aag atg
aag cca ctg cta cca cgg gtc agc tca 1348Leu Gly Ala Arg Arg Lys Met
Lys Pro Leu Leu Pro Arg Val Ser Ser 350 355 360tac ctg gta cct atc
cag ttc ccg gtg aac cag tca ctg gtg ttg cag 1396Tyr Leu Val Pro Ile
Gln Phe Pro Val Asn Gln Ser Leu Val Leu Gln 365 370 375ccc tcg gtg
aag gtg cca ttg ccc ctg gcg gct tcc ctc atg agc tca 1444Pro Ser Val
Lys Val Pro Leu Pro Leu Ala Ala Ser Leu Met Ser Ser 380 385 390gag
ctt gcc cgc cat agc aag cga gtc cgc att gcc ccc aag gtg ctg 1492Glu
Leu Ala Arg His Ser Lys Arg Val Arg Ile Ala Pro Lys Val Leu 395 400
405cta gct gag gag ggg ata gct cct ctt tct tct gca gga cca ggg aaa
1540Leu Ala Glu Glu Gly Ile Ala Pro Leu Ser Ser Ala Gly Pro Gly
Lys410 415 420 425gag gag aaa ctc ctg ttt gga gaa ggg ttt tct cct
ttg ctt cca gtt 1588Glu Glu Lys Leu Leu Phe Gly Glu Gly Phe Ser Pro
Leu Leu Pro Val 430 435 440cag act atc aag gag gaa gaa atc cag cct
ggg gag gaa atg cca cac 1636Gln Thr Ile Lys Glu Glu Glu Ile Gln Pro
Gly Glu Glu Met Pro His 445 450 455tta gcg aga ccc atc aaa gtg gag
agc cct ccc ttg gaa gag tgg ccc 1684Leu Ala Arg Pro Ile Lys Val Glu
Ser Pro Pro Leu Glu Glu Trp Pro 460 465 470tcc ccg gcc cca tct ttc
aaa gag gaa tca tct cac tcc tgg gag gat 1732Ser Pro Ala Pro Ser Phe
Lys Glu Glu Ser Ser His Ser Trp Glu Asp 475 480 485tcg tcc caa tct
ccc acc cca aga ccc aag aag tcc tac agt ggg ctt 1780Ser Ser Gln Ser
Pro Thr Pro Arg Pro Lys Lys Ser Tyr Ser Gly Leu490 495 500 505agg
tcc cca acc cgg tgt gtc tcg gaa atg ctt gtg att caa cac agg 1828Arg
Ser Pro Thr Arg Cys Val Ser Glu Met Leu Val Ile Gln His Arg 510 515
520gag agg agg gag agg agc cgg tct cgg agg aaa cag cat cta ctg cct
1876Glu Arg Arg Glu Arg Ser Arg Ser Arg Arg Lys Gln His Leu Leu Pro
525 530 535ccc tgt gtg gat gag ccg gag ctg ctc ttc tca gag ggg ccc
agt act 1924Pro Cys Val Asp Glu Pro Glu Leu Leu Phe Ser Glu Gly Pro
Ser Thr 540 545 550tcc cgc tgg gcc gca gag ctc ccg ttc cca gca gac
tcc tct gac cct 1972Ser Arg Trp Ala Ala Glu Leu Pro Phe Pro Ala Asp
Ser Ser Asp Pro 555 560 565gcc tcc cag ctc agc tac tcc cag gaa gtg
gga gga cct ttt aag aca 2020Ala Ser Gln Leu Ser Tyr Ser Gln Glu Val
Gly Gly Pro Phe Lys Thr570 575 580 585ccc att aag gaa acg ctg ccc
atc tcc tcc acc ccg agc aaa tct gtc 2068Pro Ile Lys Glu Thr Leu Pro
Ile Ser Ser Thr Pro Ser Lys Ser Val 590 595 600ctc ccc aga acc cct
gaa tcc tgg agg ctc acg ccc cca gcc aaa gta 2116Leu Pro Arg Thr Pro
Glu Ser Trp Arg Leu Thr Pro Pro Ala Lys Val 605 610 615ggg gga ctg
gat ttc agc cca gta caa acc tcc cag ggt gcc tct gac 2164Gly Gly Leu
Asp Phe Ser Pro Val Gln Thr Ser Gln Gly Ala Ser Asp 620 625 630ccc
ttg cct gac ccc ctg ggg ctg atg gat ctc agc acc act ccc ttg 2212Pro
Leu Pro Asp Pro Leu Gly Leu Met Asp Leu Ser Thr Thr Pro Leu 635 640
645caa agt gct ccc ccc ctt gaa tca ccg caa agg ctc ctc agt tca gaa
2260Gln Ser Ala Pro Pro Leu Glu Ser Pro Gln Arg Leu Leu Ser Ser
Glu650 655 660 665ccc tta gac ctc atc tcc gtc ccc ttt ggc aac tct
tct ccc tca gat 2308Pro Leu Asp Leu Ile Ser Val Pro Phe Gly Asn Ser
Ser Pro Ser Asp 670 675 680ata gac gtc ccc aag cca ggc tcc ccg gag
cca cag gtt tct ggc ctt 2356Ile Asp Val Pro Lys Pro Gly Ser Pro Glu
Pro Gln Val Ser Gly Leu 685 690 695gca gcc aat cgt tct ctg aca gaa
ggc ctg gtc ctg gac aca atg aat 2404Ala Ala Asn Arg Ser Leu Thr Glu
Gly Leu Val Leu Asp Thr Met Asn 700 705 710gac agc ctc agc aag atc
ctg ctg gac atc agc ttt cct ggc ctg gac 2452Asp Ser Leu Ser Lys Ile
Leu Leu Asp Ile Ser Phe Pro Gly Leu Asp 715 720 725gag gac cca ctg
ggc cct gac aac atc aac tgg tcc cag ttt att cct 2500Glu Asp Pro Leu
Gly Pro Asp Asn Ile Asn Trp Ser Gln Phe Ile Pro730 735 740 745gag
cta cag tag agccctgccc ttgcccctgt gctcaagctg tccaccatcc 2552Glu Leu
Glncgggcactcc aaggctcagt gcaccccaag cctctgagtg aggacagcag
gcagggactg 2612ttctgctcct catagctccc tgctgcctga ttatgcaaaa
gtagcagtca caccctagcc 2672actgctggga ccttgtgttc cccaagagta
tctgattcct ctgctgtccc tgccaggagc 2732tgaagggtgg gaacaacaaa
ggcaatggtg aaaagagatt aggaaccccc cagcctgttt 2792ccattctctg
cccagcagtc tcttaccttc cctgatcttt gcagggtggt ccgtgtaaat
2852agtataaatt ctccaaatta tcctctaatt ataaatgtaa gcttatttcc
ttagatcatt 2912atccagagac tgccagaagg tgggtaggat gacctggggt
ttcaattgac ttctgttcct 2972tgcttttagt tttgatagaa gggaagacct
gcagtgcacg gtttcttcca ggctgaggta 3032cctggatctt gggttcttca
ctgcagggac ccagacaagt ggatctgctt gccagagtcc 3092tttttgcccc
tccctgccac ctccccgtgt ttccaagtca gctttcctgc aagaagaaat
3152cctggttaaa aaagtctttt gtattgggtc aggagttgaa tttggggtgg
gaggatggat 3212gcaactgaag cagagtgtgg gtgcccagat gtgcgctatt
agatgtttct ctgataatgt 3272ccccaatcat accagggaga ctggcattga
cgagaactca ggtggaggct tgagaaggcc 3332gaaagggccc ctgacctgcc
tggcttcctt agcttgcccc tcagctttgc aaagagccac 3392cctaggcccc
agctgaccgc atgggtgtga gccagcttga gaacactaac tactcaataa
3452aagcgaaggt ggacaaaaaa aaaaaaaaaa aaaaa 3487107748PRTHomo
sapiens 107Met Lys Thr Ser Pro Arg Arg Pro Leu Ile Leu Lys Arg Arg
Arg Leu1 5 10 15Pro Leu Pro Val Gln Asn Ala Pro Ser Glu Thr Ser Glu
Glu Glu Pro 20 25 30Lys Arg Ser Pro Ala Gln Gln Glu Ser Asn Gln Ala
Glu Ala Ser Lys 35 40 45Glu Val Ala Glu Ser Asn Ser Cys Lys Phe Pro
Ala Gly Ile Lys Ile 50 55 60Ile Asn His Pro Thr Met Pro Asn Thr Gln
Val Val Ala Ile Pro Asn65 70 75 80Asn Ala Asn Ile His Ser Ile Ile
Thr Ala Leu Thr Ala Lys Gly Lys 85 90 95Glu Ser Gly Ser Ser Gly Pro
Asn Lys Phe Ile Leu Ile Ser Cys Gly 100 105 110Gly Ala Pro Thr Gln
Pro Pro Gly Leu Arg Pro Gln Thr Gln Thr Ser 115 120 125Tyr Asp Ala
Lys Arg Thr Glu Val Thr Leu Glu Thr Leu Gly Pro Lys 130 135 140Pro
Ala Ala Arg Asp Val Asn Leu Pro Arg Pro Pro Gly Ala Leu Cys145 150
155 160Glu Gln Lys Arg Glu Thr Cys Ala Asp Gly Glu Ala Ala Gly Cys
Thr 165 170 175Ile Asn Asn Ser Leu Ser Asn Ile Gln Trp Leu Arg Lys
Met Ser Ser 180 185 190Asp Gly Leu Gly Ser Arg Ser Ile Lys Gln Glu
Met Glu Glu Lys Glu 195 200 205Asn Cys His Leu Glu Gln Arg Gln Val
Lys Val Glu Glu Pro Ser Arg 210 215 220Pro Ser Ala Ser Trp Gln Asn
Ser Val Ser Glu Arg Pro Pro Tyr Ser225 230 235 240Tyr Met Ala Met
Ile Gln Phe Ala Ile Asn Ser Thr Glu Arg Lys Arg 245 250 255Met Thr
Leu Lys Asp Ile Tyr Thr Trp Ile Glu Asp His Phe Pro Tyr 260 265
270Phe Lys His Ile Ala Lys Pro Gly Trp Lys Asn Ser Ile Arg His Asn
275 280 285Leu Ser Leu His Asp Met Phe Val Arg Glu Thr Ser Ala Asn
Gly Lys 290 295 300Val Ser Phe Trp Thr Ile His Pro Ser Ala Asn Arg
Tyr Leu Thr Leu305 310 315 320Asp Gln Val Phe Lys Gln Gln Lys Arg
Pro Asn Pro Glu Leu Arg Arg 325 330 335Asn Met Thr Ile Lys Thr Glu
Leu Pro Leu Gly Ala Arg Arg Lys Met 340 345 350Lys Pro Leu Leu Pro
Arg Val Ser Ser Tyr Leu Val Pro Ile Gln Phe 355 360 365Pro Val Asn
Gln Ser Leu Val Leu Gln Pro Ser Val Lys Val Pro Leu 370 375 380Pro
Leu Ala Ala Ser Leu Met Ser Ser Glu Leu Ala Arg His Ser Lys385 390
395 400Arg Val Arg Ile Ala Pro Lys Val Leu Leu Ala Glu Glu Gly Ile
Ala 405 410 415Pro Leu Ser Ser Ala Gly Pro Gly Lys Glu Glu Lys Leu
Leu Phe Gly 420 425 430Glu Gly Phe Ser Pro Leu Leu Pro Val Gln Thr
Ile Lys Glu Glu Glu 435 440 445Ile Gln Pro Gly Glu Glu Met Pro His
Leu Ala Arg Pro Ile Lys Val 450 455 460Glu Ser Pro Pro Leu Glu Glu
Trp Pro Ser Pro Ala Pro Ser Phe Lys465 470 475 480Glu Glu Ser Ser
His Ser Trp Glu Asp Ser Ser Gln Ser Pro Thr Pro 485 490 495Arg Pro
Lys Lys Ser Tyr Ser Gly Leu Arg Ser Pro Thr Arg Cys Val 500 505
510Ser Glu Met Leu Val Ile Gln His Arg Glu Arg Arg Glu Arg Ser Arg
515 520 525Ser Arg Arg Lys Gln His Leu Leu Pro Pro Cys Val Asp Glu
Pro Glu 530 535 540Leu Leu Phe Ser Glu Gly Pro Ser Thr Ser Arg Trp
Ala Ala Glu Leu545 550 555 560Pro Phe Pro Ala Asp Ser Ser Asp Pro
Ala Ser Gln Leu Ser Tyr Ser 565 570 575Gln Glu Val Gly Gly Pro Phe
Lys Thr Pro Ile Lys Glu Thr Leu Pro 580 585 590Ile Ser Ser Thr Pro
Ser Lys Ser Val Leu Pro Arg Thr Pro Glu Ser 595 600 605Trp Arg Leu
Thr Pro Pro Ala Lys Val Gly Gly Leu Asp Phe Ser Pro 610 615 620Val
Gln Thr Ser Gln Gly Ala Ser Asp Pro Leu Pro Asp Pro Leu Gly625 630
635 640Leu Met Asp Leu Ser Thr Thr Pro Leu Gln Ser Ala Pro Pro Leu
Glu 645 650 655Ser Pro Gln Arg Leu Leu Ser Ser Glu Pro Leu Asp Leu
Ile Ser Val 660 665 670Pro Phe Gly Asn Ser Ser Pro Ser Asp Ile Asp
Val Pro Lys Pro Gly 675 680 685Ser Pro Glu Pro Gln Val Ser Gly Leu
Ala Ala Asn Arg Ser Leu Thr 690 695 700Glu Gly Leu Val Leu Asp Thr
Met Asn Asp Ser Leu Ser Lys Ile Leu705 710 715 720Leu Asp Ile Ser
Phe Pro Gly Leu Asp Glu Asp Pro Leu Gly Pro Asp 725 730 735Asn Ile
Asn Trp Ser Gln Phe Ile Pro Glu Leu Gln 740 74510819DNAArtificialA
target sequence for siRNA. 108gcagcagaaa cgaccgaat
1910951DNAArtificialAn artificially synthesized oligonucleotide
sequence for siRNA. 109tcccgcagca gaaacgaccg aatttcaaga gaattcggtc
gtttctgctg c 5111051DNAArtificialAn artificially synthesized
oligonucleotide sequence for siRNA. 110aaaagcagca gaaacgaccg
aattctcttg aaattcggtc gtttctgctg c 5111147DNAArtificialAn
artificially synthesized hairpin siRNA sequence. 111gcagcagaaa
cgaccgaatt tcaagagaat tcggtcgttt ctgctgc 471122931DNAHomo
sapiensCDS(146)..(751) 112agggggagcg gagggaggtg tttctgtcag
ttccggctgt ttgttcggga agtggatccg 60ccgctgccgg agcagcccga agggagctgc
ggatcgcgag gccagtaccg accccgcccg 120cccgcgcgca ccgcccccgc ccgcc atg
gcc cgg gac tac gac cac ctc ttc 172 Met Ala Arg Asp Tyr Asp His Leu
Phe 1 5aag ctg ctc atc atc ggc gac agc ggt gtg ggc aag agc agt tta
ctg 220Lys Leu Leu Ile Ile Gly Asp Ser Gly Val Gly Lys Ser Ser Leu
Leu10 15 20 25ttg cgt ttt gca gac aac act ttc tca ggc agc tac atc
acc acg atc 268Leu Arg Phe Ala Asp Asn Thr Phe Ser Gly Ser Tyr Ile
Thr Thr Ile 30 35 40gga gtg gat ttc aag atc cgg acc gtg gag atc aac
ggg gag aag gtg 316Gly Val Asp Phe Lys Ile Arg Thr Val Glu Ile Asn
Gly Glu Lys Val 45 50 55aag ctg cag atc tgg gac aca gcg ggg cag gag
cgc ttc cgc acc atc 364Lys Leu Gln Ile Trp Asp Thr Ala Gly Gln Glu
Arg Phe Arg Thr Ile 60 65 70acc tcc acg tat tat cgg ggg acc cac ggg
gtc att gtg gtt tac gac 412Thr Ser Thr Tyr Tyr Arg Gly Thr His Gly
Val Ile Val Val Tyr Asp 75 80 85gtc acc agt gcc gag tcc ttt gtc aac
gtc aag cgg tgg ctt cac gaa 460Val Thr Ser Ala Glu Ser Phe Val Asn
Val Lys Arg Trp Leu His Glu90 95 100 105atc aac cag aac
tgt gat gat gtg tgc cga ata tta gtg ggt aat aag 508Ile Asn Gln Asn
Cys Asp Asp Val Cys Arg Ile Leu Val Gly Asn Lys 110 115 120aat gac
gac cct gag cgg aag gtg gtg gag acg gaa gat gcc tac aaa 556Asn Asp
Asp Pro Glu Arg Lys Val Val Glu Thr Glu Asp Ala Tyr Lys 125 130
135ttc gcc ggg cag atg ggc atc cag ttg ttc gag acc agc gcc aag gag
604Phe Ala Gly Gln Met Gly Ile Gln Leu Phe Glu Thr Ser Ala Lys Glu
140 145 150aat gtc aac gtg gaa gag atg ttc aac tgc atc acg gag ctg
gtc ctc 652Asn Val Asn Val Glu Glu Met Phe Asn Cys Ile Thr Glu Leu
Val Leu 155 160 165cga gca aag aaa gac aac ctg gca aaa cag cag cag
caa caa cag aac 700Arg Ala Lys Lys Asp Asn Leu Ala Lys Gln Gln Gln
Gln Gln Gln Asn170 175 180 185gat gtg gtg aag ctc acg aag aac agt
aaa cga aag aaa cgc tgc tgc 748Asp Val Val Lys Leu Thr Lys Asn Ser
Lys Arg Lys Lys Arg Cys Cys 190 195 200taa tggcacccag tccactgcag
agactgcact gcggtccctc ccccagcccg 801aggcccacgg aggttcctcg
ggggacagtc tcagtttcgt gccgttattt aaagaattct 861ctccatgttt
ttgtatcggg aggtgccatc ggcacttcct cccccgccct cctcgagtgc
921caagaaggtg ttggaccagc ccgcccttcc ctactggtgc cccctcctcc
ccggccaagg 981cgcctggacc tggcgaggac gctgcccgcc gagcggactg
attcgcagag tctgtacata 1041gtgtatattg ctctacccgg ccgcacacca
cgtcctgctc tggcttttgc cttcttgatg 1101ccagcctgct gcaacagacc
ctccccgcgc ccctccccag cccatcttac tgcaagcagc 1161gtcctgagga
gacagcggca cgttctagct gcgtctgcgg ccagcccgtg ccagtggagt
1221gggctccgcg ttgctcattc tctccgacag gttgtcagcc tctgtccccg
ctgcacaggg 1281tcttgcccct tctccggggc ctgtgccagc tcccttccct
ccccgttgtc ctgtccccac 1341agccattctg ggagctgggg aacctggtct
caaggcaggc cctgcagttc cacagaggtg 1401gcaggtcttg ccctttggcc
aacagatttc ttgtcctgcc ttctagatgc ctctgagctc 1461caaacccagg
gcagccatgg cttctcattt acaccaacag gtttcagttc caacagaaag
1521gtcggggtag gttcgtgcag agatggggct ggcagggggg ctatgggagg
attattttaa 1581cagatcaaga aaatgaagcc aaatcaagtg aattaaattc
ctcacaatta ttttctttcc 1641ctgaggtttg attggcacag cagcaaaagt
tgaggccacc ccacttgtgt ccactgtttt 1701tagaaaaaaa tgaatggctt
cctgccattg tggggctgga ctcttgggct ttcttggtgg 1761gagcggagaa
ggggcctccc acccttgtcc gagttgcctc ccactggagg tcaggagtct
1821acactgcagc ctcgggcact gtggggagtg catgcctggg gcctctgggt
ggggaccatg 1881gacaggccct ggtcactgtc ctaacctttg tcaggacaaa
ggtagcaaga ggatttcctg 1941gcgggtggga aggaatggct ggggcggcca
gttttgacac gccccagtgc cctggagaac 2001aaccagggtc atctgcactt
gatgactgct ccccgacccc cagcccggac acctcattcc 2061cctcccacta
cagggatcaa gtgacctggg aagaaccgag tttaacacca ggatgtgttt
2121ccttagattt cctttcctag gcgatttcca gggagagccc tgattggaca
atcacatcac 2181agatcacact gcagtttcca tgttagcact gtggatgggt
ttttaatcaa taaaaactgg 2241gggtttcttc tcaccgactc tccacttgcc
caaactgcca aaagctggtg attctgggac 2301aggccttcac tttggagcca
cgggatgggg tgggggagcc ccatgggcct gggaaggagg 2361gtgctgtgga
gggggctgca gggctgacca gcaggcagcc tcatctggtc gggggcgggg
2421gcggcaggag cagaagcggg gtctccgtcc ttgggactgt cctggttggc
cacgggccct 2481gaggatgcac ggtgcctggg gctcctgtgc cggtgggcgg
ggggcatgct ggcctctgag 2541cgatcaggcg aggccagcga gggtgtgctt
gcaaattcaa gcaataagag gggggttcct 2601gggggcttcc agcccaggct
agaagccccc atggcttctg gcagctggac atcagcccca 2661ggtattgggg
tgattttggt catgacagtg tgcctgtccc actgttacac gcatgaatgg
2721gggttatggg gtgggggtgg ggactcaggg ctggaccgac gtcctagtgg
acctgatgtg 2781aaattcctgt caaacaaaca ccacttttca atggtttgct
aggagtattt ctgtattgaa 2841agtttctaat tatgcttttt aaaaaaatac
taaaaataaa ggttcaagct gccaaaaaaa 2901aaaaaaaaaa aaaaaaaaaa
aaaaaaaaaa 2931113201PRTHomo sapiens 113Met Ala Arg Asp Tyr Asp His
Leu Phe Lys Leu Leu Ile Ile Gly Asp1 5 10 15Ser Gly Val Gly Lys Ser
Ser Leu Leu Leu Arg Phe Ala Asp Asn Thr 20 25 30Phe Ser Gly Ser Tyr
Ile Thr Thr Ile Gly Val Asp Phe Lys Ile Arg 35 40 45Thr Val Glu Ile
Asn Gly Glu Lys Val Lys Leu Gln Ile Trp Asp Thr 50 55 60Ala Gly Gln
Glu Arg Phe Arg Thr Ile Thr Ser Thr Tyr Tyr Arg Gly65 70 75 80Thr
His Gly Val Ile Val Val Tyr Asp Val Thr Ser Ala Glu Ser Phe 85 90
95Val Asn Val Lys Arg Trp Leu His Glu Ile Asn Gln Asn Cys Asp Asp
100 105 110Val Cys Arg Ile Leu Val Gly Asn Lys Asn Asp Asp Pro Glu
Arg Lys 115 120 125Val Val Glu Thr Glu Asp Ala Tyr Lys Phe Ala Gly
Gln Met Gly Ile 130 135 140Gln Leu Phe Glu Thr Ser Ala Lys Glu Asn
Val Asn Val Glu Glu Met145 150 155 160Phe Asn Cys Ile Thr Glu Leu
Val Leu Arg Ala Lys Lys Asp Asn Leu 165 170 175Ala Lys Gln Gln Gln
Gln Gln Gln Asn Asp Val Val Lys Leu Thr Lys 180 185 190Asn Ser Lys
Arg Lys Lys Arg Cys Cys 195 20011419DNAArtificialA target sequence
for siRNA. 114gagatgttca actgcatca 1911551DNAArtificialAn
artificially synthesized oligonucleotide sequence for siRNA.
115tcccgagatg ttcaactgca tcattcaaga gatgatgcag ttgaacatct c
5111651DNAArtificialAn artificially synthesized oligonucleotide
sequence for siRNA. 116aaaagagatg ttcaactgca tcatctcttg aatgatgcag
ttgaacatct c 5111747DNAArtificialAn artificially synthesized
hairpin siRNA sequence. 117gagatgttca actgcatcat tcaagagatg
atgcagttga acatctc 4711822DNAArtificialAn artificially synthesized
primer sequence for RT-PCR. 118aaaaagggga tgcctagaac tc
2211921DNAArtificialAn artificially synthesized primer sequence for
RT-PCR. 119ctttcagcac gtcaaggaca t 2112023DNAArtificialAn
artificially synthesized primer sequence for RT-PCR. 120acacctacga
aggtacacat gac 2312123DNAArtificialAn artificially synthesized
primer sequence for RT-PCR. 121gctatttcag ggtaaatgga gtc
2312223DNAArtificialAn artificially synthesized primer sequence for
RT-PCR. 122cagagatgga ggatgtcaat aac 2312323DNAArtificialAn
artificially synthesized primer sequence for RT-PCR. 123catagcagct
ttaaagagac acg 2312421DNAArtificialAn artificially synthesized
primer sequence for RT-PCR. 124ccaccataac agtggagtgg g
2112524DNAArtificialAn artificially synthesized primer sequence for
RT-PCR. 125cagttacagg tgtatgactg ggag 2412623DNAArtificialAn
artificially synthesized primer sequence for RT-PCR. 126ctgaatacaa
cttcctgttt gcc 2312723DNAArtificialAn artificially synthesized
primer sequence for RT-PCR. 127gaccacagaa ttaccaaaac tgc 23
* * * * *
References