U.S. patent application number 13/073811 was filed with the patent office on 2011-09-08 for approaches to identify less harmful tobacco and tobacco products.
This patent application is currently assigned to VECTOR TOBACCO, INC.. Invention is credited to Anthony P. Albino, Zbigniew Darzynkiewicz, Wendy Jin, Ellen D. Jorgensen, Frank Traganos.
Application Number | 20110214680 13/073811 |
Document ID | / |
Family ID | 42221673 |
Filed Date | 2011-09-08 |
United States Patent
Application |
20110214680 |
Kind Code |
A1 |
Albino; Anthony P. ; et
al. |
September 8, 2011 |
APPROACHES TO IDENTIFY LESS HARMFUL TOBACCO AND TOBACCO
PRODUCTS
Abstract
Aspects of the invention concern methods for detecting,
identifying and evaluating tobacco and tobacco products to
determine the potential that these compositions have to contribute
to a tobacco-related disease. It is based, at least in part; on the
discovery that exposure of pulmonary cells to smoke or smoke
condensate obtained from tobacco or tobacco products induces double
stranded breaks in cellular DNA, which were efficiently detected
using assays that measure the presence, absence, or amount of
phosphorylation of the histone, H2AX.
Inventors: |
Albino; Anthony P.; (New
York, NY) ; Jorgensen; Ellen D.; (South Salem,
NY) ; Traganos; Frank; (Katonah, NY) ;
Darzynkiewicz; Zbigniew; (Chappaque, NY) ; Jin;
Wendy; (Chapel Hill, NC) |
Assignee: |
VECTOR TOBACCO, INC.
Morrisville
NC
New York Medical College
Vallhalla
NY
|
Family ID: |
42221673 |
Appl. No.: |
13/073811 |
Filed: |
March 28, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12701322 |
Feb 5, 2010 |
|
|
|
13073811 |
|
|
|
|
11596088 |
Apr 4, 2008 |
7662565 |
|
|
PCT/US05/16941 |
May 11, 2005 |
|
|
|
12701322 |
|
|
|
|
60570175 |
May 12, 2004 |
|
|
|
Current U.S.
Class: |
131/280 ;
435/6.1 |
Current CPC
Class: |
C12N 15/8227 20130101;
A01H 1/04 20130101; C12N 15/8243 20130101; C12N 15/8274 20130101;
C12N 9/0004 20130101 |
Class at
Publication: |
131/280 ;
435/6.1 |
International
Class: |
A24C 5/32 20060101
A24C005/32; C12Q 1/68 20060101 C12Q001/68 |
Goverment Interests
GRANT INFORMATION
[0002] Some of the subject matter described in this application was
developed in part using funds from NIH, NCI grant CA28704 (Probes
for Cytometry, to Z. Darzynkiewicz, PI) so that the United States
Government has certain rights herein.
Foreign Application Data
Date |
Code |
Application Number |
Mar 29, 2005 |
US |
PCT/US2005/010733 |
Claims
1. A method of analyzing whole smoke from a cigarette for the
ability to induce a double-strand DNA break in a human cell
comprising: contacting a human cell with whole smoke obtained from
a cigarette; and performing an assay that detects a double strand
DNA break in said human cell.
2. The method of claim 1, wherein the assay that detects a double
strand DNA break in said human cell is selected from the group
consisting of a Comet assay; a TUNEL assay; a sister chromatid
exchange assay; an assay that detects a phosphorylation of histone
H2AX; and an assay that detects a chromosomal translocation.
3. The method of claim 1, wherein said cigarette comprises a
filter.
4. The method of claim 3, wherein said filter comprises an
antioxidant or a radical scavenger.
5. The method of claim 3, wherein said filter comprises a
charcoal.
6. The method of claim 1, wherein said cigarette comprises a Burley
tobacco.
7. A method of making a cigarette comprising: contacting a first
population of human cells with whole smoke obtained from a first
tobacco; performing an assay that detects double strand DNA breaks
in said first population of human cells; determining whether the
whole smoke obtained from said first tobacco produces fewer double
strand DNA breaks in said first population of human cells than the
amount of double strand DNA breaks produced in a second population
of human cells that were contacted with whole smoke from a second
tobacco; and incorporating said first tobacco into a cigarette when
said whole smoke from said first tobacco produces fewer double
strand DNA breaks in said first population of human cells than the
amount of double strand DNA breaks produced in a second population
of human cells that were contacted with whole smoke from a second
tobacco.
8. The method of claim 7, wherein the assay that detects double
strand DNA breaks in said first population of human cells is
selected from the group consisting of a Comet assay; a TUNEL assay;
a sister chromatid exchange assay; an assay that detects a
phosphorylation of histone H2AX; and an assay that detects a
chromosomal translocation.
9. The method of claim 7, wherein said first tobacco is provided in
a first cigarette and said second tobacco is provided in a second
cigarette and said whole smoke is obtained from said first and
second cigarettes.
10. The method of claim 9, wherein said first and second cigarettes
comprise a filter.
11. The method of claim 10, wherein said filter comprises an
antioxidant or a radical scavenger.
12. The method of claim 10, wherein said filter comprises a
charcoal.
13. A method of making a cigarette comprising: contacting a first
population of human cells with whole smoke obtained from a first
tobacco; performing an assay that detects the amount of apoptosis
in said first population of human cells; determining whether the
whole smoke obtained from said first tobacco produces more
apoptosis in said first population of human cells compared to the
amount of apoptosis produced in a second population of human cells,
which were contacted with whole smoke from a second tobacco; and
incorporating said first tobacco into a cigarette when said whole
smoke obtained from said first tobacco produces more apoptosis in
said first population of human cells compared to the amount of
apoptosis produced in said second population of human cells, which
were contacted with whole smoke from the second tobacco.
14. The method of claim 13, wherein the assay that detects the
amount of apoptosis in said first population of human cells is
selected from the group consisting of detection of caspase
activation; detection of cleavage of the protein poly(ADP-ribose)
polymerase; detection of annexin V binding to the cell membrane;
detection of chromatin condensation; detection of an increase
sensitivity of chromatin in cells to acid or heat-induced
denaturation; detection of fractional DNA content; and TUNEL
assay.
15. The method of claim 13, wherein said first tobacco is provided
in a first cigarette and said second tobacco is provided in a
second cigarette and said whole smoke is obtained from said first
and second cigarettes.
16. The method of claim 15, wherein said first and second
cigarettes comprise a filter.
17. The method of claim 16, wherein said filter comprises an
antioxidant or a radical scavenger.
18. The method of claim 16, wherein said filter comprises a
charcoal.
19. The method of claim 13, wherein said tobacco is a Burley
tobacco.
Description
RELATED APPLICATIONS
[0001] This application is a continuation of and claims the benefit
of priority to U.S. patent application Ser. No. 12/701,322 filed
Feb. 5, 2010, which is a continuation of U.S. patent application
Ser. No. 11/596,088, filed Apr. 4, 2008, now U.S. Pat. No.
7,662,565, which is a National Phase Application of and claims the
benefit of priority to International Patent Application No.
PCT/US2005/016941, filed May 11, 2005, which designated the United
States and was published in English and, which claims priority to
U.S. Provisional Patent Application No. 60/570,175, filed May 12,
2004. All of the aforementioned international patent application,
domestic patent applications, and provisional application are
hereby expressly incorporated by reference in their entireties.
FIELD OF THE INVENTION
[0003] Aspects of the invention relate to methods for detecting,
identifying and evaluating tobacco and tobacco products to
determine the potential that these compositions have to contribute
to a tobacco-related disease. It is based, at least in part; on the
discovery that exposure of pulmonary cells to smoke or smoke
condensate obtained from tobacco or tobacco products induces double
stranded breaks in cellular DNA, which were efficiently detected
using assays that measure the presence, absence, or amount of
phosphorylation of the histone, H2AX.
BACKGROUND OF THE INVENTION
[0004] The leading preventable cause of death and disability in the
United States is the chronic use of tobacco products, in
particular, cigarettes. In addition to lung cancers, tobacco use
plays important direct and indirect roles in the etiology of a wide
range of other cancers, including those of the upper aerodigestive
tract (i.e., oral cavity, pharynx, larynx, and esophagus), bladder,
stomach, kidney, pancreas, uterine cervix, and blood (myeloid
leukemia). Exposure to tobacco carcinogens and toxins is also a
major cause of other diseases of the pulmonary system (e.g.,
bronchitis, emphysema, and chronic obstructive pulmonary disease),
the cardiovascular system (e.g., stroke, atherosclerosis, and
myocardial infarction), and the female reproductive system (e.g.,
increased risk of miscarriage, premature delivery, low birth
weight, and stillbirth). While numerous studies have elucidated
some of the biological effects of cigarette smoke that result in
its ability to induce this range of pathologies in smokers, little
is known about the nature and temporal association of molecular
events that drive specific stages in the multi-step processes that
result in clinically evident disease. This is due to the fact that
cigarette smoke is a complex chemical mixture of gases and
suspended particulate material that consists of a wide variety of
condensed organic compounds (i.e., `tar`) that collectively contain
a large number of toxins, carcinogens, co-carcinogens, mutagens,
and reactive organic and inorganic molecules. To date, only a
limited number of these individual tobacco constituents such as
benzo[a]pyrene have been assessed for genetic impact in model
systems.
[0005] Conventional approaches to evaluate the effects of cigarette
smoke do not have sufficient sensitivity, specificity, and
robustness to be useful in deciphering specific qualitative and
quantitative relationships between tobacco smoke constituents and
cellular processes. Thus, there is a pressing need to develop novel
approaches to accurately evaluate both the genotoxic and biologic
effects of tobacco smoke in a rapid and sensitive manner. In
particular, since genetic instability is a critical step towards
the eventual evolution of a malignant tumor, assessing the various
types of chromosomal damage caused by tobacco smoke is a priority.
The present methods meet this need and provide additional
advantages as well.
SUMMARY OF THE INVENTION
[0006] Aspects of the invention concern several approaches to
determine the extent that a tobacco or tobacco product induces
cellular damage. Some of the embodiments described herein evaluate
the potential for a tobacco or tobacco product to induce DNA damage
(e.g., double strand DNA breaks) or modulate cell homeostasis
(e.g., inhibit apoptosis and/or inhibit cell proliferation). The
assays described herein are useful for identifying tobacco and
tobacco products that are reduced risk in that they are less likely
or have a lower potential to contribute to a tobacco related
disease. The assays described herein can also be used to identify
components in tobacco and tobacco products that induce cellular
damage. Further, the assays described herein can be used to develop
reduced risk tobacco and tobacco products that have a reduced
potential to contribute to a tobacco related disease.
[0007] Several embodiments, for example, concern methods of
identifying a tobacco or a tobacco product that induces a
double-strand DNA break by providing a tobacco or tobacco product,
obtaining smoke or a smoke condensate from the tobacco or tobacco
product, contacting a cell with the smoke or smoke condensate, and
identifying the presence or absence of a double strand DNA break in
the cell after contact with the smoke or smoke condensate. In some
methods provided herein, the tobacco comprises a genetic
modification, a chemical modification, a biotic modification, or
said tobacco has been extracted, expanded, or reconstituted. In
some methods provided herein, the genetic modification reduces the
amount of alkaloid in the tobacco to less than or equal to 5,000
ppm 3,000 ppm, 1,000 ppm, or 500 ppm. In such methods, the genetic
modification reduces the expression of a gene encoding a quinolate
phosphoribosyl transferase, a putrescene methyl transferase, or an
A622 protein. In some methods, the genetic modification of tobacco
reduces the amount of nornicotine in the tobacco without reducing
the amount of nicotine in the tobacco. In some methods, wherein the
genetic modification of tobacco reduces the amount of nornicotine
in the tobacco without reducing the amount of nicotine in the
tobacco, the genetic modification reduces the expression of an A622
protein. In some methods, the genetic modification reduces the
expression of a gene that regulates production of a sterol. In some
methods provided herein, the chemical modification comprises
palladium. In some methods provided herein, the chemical
modification comprises an auxin, auxin analog, or jasmonate
antagonist. In some methods provided herein, the tobacco is
reconstituted tobacco. In some methods provided herein, the tobacco
is extracted or expanded tobacco. In some methods provided herein,
the tobacco comprises a biotic modification. In some methods
provided herein, the biotic modification comprises bacteria. In
some methods provided herein, the tobacco or tobacco product is
processed to remove the presence of a microbe. In such methods the
processing can comprise sterilization, pasteurization, or
radiation. In some methods provided herein, exogenous nicotine or a
nicotine analog has been added to the tobacco or tobacco
product.
[0008] In some methods provided herein, smoke is obtained from the
tobacco or tobacco product. In some methods provided herein, the
smoke is contacted with the cells for greater than, less than, or
equal to 5 minutes, 15 minutes, 20 minutes, 30 minutes, 40 minutes,
or one hour. In some methods provided herein, the presence or
absence of a phosphorylation of histone H2AX is identified. In some
methods provided herein, the presence or absence of phosphorylation
of histone H2AX is identified immunocytochemically, with an
antibody or fragment thereof, which binds to phosphorylated H2AX
but not unphosphorylated H2AX. In some methods provided herein,
activation of one or more protein kinases that are responsible for
histone H2AX phosphorylation are detected or identified. In some
methods provided herein, the appearance of nuclear foci that are
induced by histone H2AX phosphorylation and contain several
proteins involved in DNA repair are immunocytochemically
identified. In some methods provided herein, activation of one or
more protein components of nuclear "foci" induced by H2AX
phosphorylation that are associated with DNA repair, is identified.
In some methods provided herein, the presence or absence of a
chromosomal translocation is identified. In some methods provided
herein, the tobacco is provided in a cigarette and the smoke or
smoke condensate is obtained from the cigarette. Some methods
provided herein further include contacting the smoke or smoke
concentrate with a filter. In some such methods, the smoke or smoke
condensate is obtained from the cigarette after passing through a
filter (e.g., a charcoal, paper, or acetate filter) attached to the
tobacco product, such as a cigarette. In some such methods, the
filter comprises an antioxidant or a radical scavenger. In some
methods provided herein, a plurality of cells are contacted with
the smoke or smoke condensate and the presence or absence of a
double strand break in the plurality of cells is identified. In
some methods provided herein, the plurality of cells are at least,
greater than, or equal to a 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%,
or a 100% population of cells in G.sub.0, G.sub.1, S, G.sub.2, or M
phase. In some methods provided herein, the first cell is a cell
obtained from a human. In some methods provided herein, the cell is
a A549 cell, a normal human bronchial epithelial ("NHBE") cell, or
a cell obtained from a human primary culture. In some methods
provided herein, the first cell is a cell of the oral mucosa of the
human. In some methods provided herein, the cell is a cheek cell.
In some methods provided herein, the first cell is a cell of the
pulmonary system of the human. In some methods provided herein, the
cell is a lung or bronchial cell. In some methods provided herein,
the cell is a lymphocyte, monocyte, neutrophil, eosinophil or
basophil. In some methods provided herein, the first cell is
obtained from a human after the human consumes a cigarette. In some
methods provided herein, the first cell is obtained from a human
after the human consumes a cigarette. Some methods provided herein
further include the step of identifying the tobacco or tobacco
product to be provided as a composition for an analysis of the
potential to induce a double strand DNA break. Some methods
provided herein further include the step of measuring the amount of
double strand DNA breaks induced after exposure of the cell to the
smoke or smoke condensate. In some methods provided herein, double
strand DNA breaks can be identified immunocytochemically by
detection of (i) histone H2AX phosphorylation; (ii) activation of
one or more of the protein kinases that are responsible for H2AX
phosphorylation; (iii) appearance of nuclear foci that are induced
by histone H2AX phosphorylation; or (iv) activation of one or more
protein components of nuclear "foci" induced by H2AX
phosphorylation that are associated with DNA repair. In some
methods provided herein activation of one or more protein kinases
(e.g., ATR, ATM or DNA-dependent--DNA-PK) that phosphorylate H2AX
is identified immunocytochemically using an antibody that binds to
the activated (e.g. phosphorylated) but not to inactive kinase.
ATM, for example undergoes autophosphorylation on serine-1981 and,
thus, an antibody to Ser-1981-P-ATM can be used in the methods
provided herein. In some methods provided herein activation of one
or more proteins, the components of nuclear "foci" induced by H2AX
phosphorylation that are associated with DNA repair, is
immunocytochemically detected.
[0009] The methods provided herein also can be used to identify one
or more biomarkers in a biological sample or fluid indicative of a
tobacco-related disease. A biological fluid or sample such as urine
or blood or a tissue sample can contain one or more molecules such
as a as protein mutant that is indicative of a tobacco-related
disease. Exemplary fluids that can be used include, but are not
limited to, sputum, saliva, tears, cerebro-spinal fluid, blood,
lymph, serum, plasma, interstitial fluid, lavage fluid (e.g., lung
or breast lavage), urine, semen, seminal fluid, amniotic fluid,
cervicovaginal fluid, feces, and secretions of the digestive tract.
Exemplary biological samples include but are not limited to a
tissue sample or a swab, including a sample or swab or lung tissue,
breast tissue or fetal tissue.
[0010] Also provided herein are methods of identifying a tobacco or
tobacco product that induces an inhibition of apoptosis comprising,
providing a tobacco or tobacco product, obtaining smoke or a smoke
condensate from the tobacco or tobacco product, contacting a cell
with the smoke or smoke condensate, identifying an inhibition of
apoptosis in the cell after contact with the smoke or smoke
condensate. In some methods provided herein, the tobacco comprises
a genetic modification. In some methods provided herein, the
genetic modification reduces the amount of alkaloid in the tobacco
to less than or equal to 5,000 ppm 3,000 ppm, 1,000 ppm, or 500
ppm. In some methods provided herein, the genetic modification
reduces the expression of a gene encoding a quinolate
phosphoribosyl transferase, a putrescene methyl transferase, or an
A622 protein. In some embodiments, the genetic modification reduces
the amount of nornicotine in the tobacco without reducing the
amount of nicotine in the tobacco. In some such embodiments, the
genetic modification reduces the expression of an A622 protein. In
some methods provided herein, the genetic modification reduces the
expression of a gene that regulates production of a sterol. In some
methods provided herein, the tobacco comprises a chemical
modification. In some methods provided herein, the chemical
modification comprises palladium. In some methods provided herein,
the chemical modification comprises an auxin, auxin analog, or
jasmonate antagonist. In some methods provided herein, the tobacco
is reconstituted tobacco. In some methods provided herein, the
tobacco is extracted or expanded tobacco. In some methods provided
herein, the tobacco comprises a biotic modification. In some
methods provided herein, the biotic modification comprises
bacteria. In some methods provided herein, the tobacco or tobacco
product is processed to remove the presence of a microbe. In some
methods provided herein, the processing comprises sterilization,
pasteurization, or radiation. In some methods provided herein,
exogenous nicotine or a nicotine analog has been added to the
tobacco or tobacco product. Some methods provided herein include a
step of comparing the extent of apoptosis in two or more
populations of cells upon exposure of each population of cells to
smoke or smoke condensate of different tobaccos, where the exposure
induces the same degree of DNA damage (e.g., DNA strand breaks) to
each population of cells. In some methods provided herein,
different chemopreventive agents, such as antioxidants can be
administered to the cells prior to, during, or subsequent to
exposure of the cells to smoke or smoke condensate.
[0011] In some methods provided herein, smoke is obtained from the
tobacco. In some methods provided herein, the smoke is contacted
with the cells for greater than, less than, or equal to 5 minutes,
15 minutes, 20 minutes, 30 minutes, 40 minutes, or one hour. In
some methods provided herein, the presence or absence of caspase
activation is identified. In some methods provided herein, the
presence or absence of caspase activation is identified with an
antibody or fragment thereof, which binds to activated caspase but
not inactive caspase. In some methods provided herein, the tobacco
is provided in a cigarette and the smoke or smoke condensate is
obtained from the cigarette. Some embodiments further include
contacting the smoke or smoke concentrate with a filter. In some
methods provided herein, the smoke or smoke condensate is obtained
from the cigarette after passing through a filter attached to the
cigarette. In some methods provided herein, the filter comprises an
antioxidant or a radical scavenger. In some methods provided
herein, a plurality of cells is contacted with the smoke or smoke
condensate and the presence or absence of an inhibition of
apoptosis is identified. In some methods provided herein, the
plurality of cells are at least, greater than, or equal to a 50%,
60%, 70%, 75%, 80%, 85%, 90%, 95%, or a 100% population of cells in
G.sub.0, G.sub.1, S, G.sub.2, or M phase. In some methods provided
herein, the first cell is a cell obtained from a human. In some
methods provided herein, the cell is an A549 cell, a NHBE cell, or
a cell obtained from a human primary culture. In some methods
provided herein, the first cell is a cell of the oral mucosa of the
human. In some methods provided herein, the cell is a cheek cell.
In some methods provided herein, the first cell is a cell of the
pulmonary system of the human. In some methods provided herein, the
cell is a lung or bronchial cell. In some methods provided herein,
the first cell is obtained from a human after the human consumes a
cigarette. In some methods provided herein, the first cell is
obtained from a human after the human consumes a cigarette. Some
methods provided herein further include the step of identifying the
tobacco or tobacco product to be provided as a composition for an
analysis of the potential to inhibit apoptosis. Some methods
provided herein further include the step of measuring the amount of
inhibition of apoptosis induced after exposure of the cell to the
smoke or smoke condensate.
[0012] Also provided herein are methods of identifying a tobacco or
tobacco product that induces an inhibition of cell proliferation
comprising, providing a tobacco or tobacco product, obtaining smoke
or a smoke condensate from the tobacco or tobacco product,
contacting a cell with the smoke or smoke condensate, identifying
an inhibition of proliferation of the cell after contact with the
smoke or smoke condensate. In some methods provided herein, the
tobacco comprises a genetic modification. In some methods provided
herein, the genetic modification reduces the amount of alkaloid in
the tobacco to less than or equal to 5,000 ppm 3,000 ppm, 1,000
ppm, or 500 ppm. In some methods provided herein, the genetic
modification reduces the expression of a gene encoding a quinolate
phosphoribosyl transferase, a putrescene methyl transferase, or an
A622 protein. In some methods provided herein, the genetic
modification reduces the amount of nornicotine in the tobacco
without reducing the amount of nicotine in the tobacco. In some
methods provided herein, wherein the genetic modification reduces
the amount of nornicotine in the tobacco without reducing the
amount of nicotine in the tobacco, the genetic modification reduces
the expression of an A622 protein. In some methods provided herein,
the genetic modification reduces the expression of a gene that
regulates production of a sterol. In some methods provided herein,
the tobacco comprises a chemical modification. In some methods
provided herein, the chemical modification comprises palladium. In
some methods provided herein, the chemical modification comprises
an auxin, auxin analog, or jasmonate antagonist. In some methods
provided herein, the tobacco is reconstituted tobacco. In some
methods provided herein, the tobacco is extracted or expanded
tobacco. In some methods provided herein, the tobacco comprises a
biotic modification. In some methods provided herein, the biotic
modification comprises bacteria. In some methods provided herein,
the tobacco or tobacco product is processed to remove the presence
of a microbe. In some methods provided herein, the processing
comprises sterilization, pasteurization, or radiation. In some
methods provided herein, exogenous nicotine or a nicotine analog
has been added to the tobacco or tobacco product. Some methods
provided herein include a step of comparing the extent of
modulation of cell proliferation in two or more populations of
cells upon exposure of each population of cells to smoke or smoke
condensate of different tobaccos, where the exposure induces the
same degree of DNA damage (e.g., DNA strand breaks) to each
population of cells. In some methods provided herein, different
chemopreventive agents, such as antioxidants can be administered to
the cells prior to, during, or subsequent to exposure of the cells
to smoke or smoke condensate.
[0013] In some methods provided herein, smoke is obtained from the
tobacco or tobacco product. In some methods provided herein, the
smoke is contacted with the cells for greater than, less than, or
equal to 5 minutes, 15 minutes, 20 minutes, 30 minutes, 40 minutes,
or one hour. In some methods provided herein, the number of
surviving cells after contact with the smoke or smoke condensate
are identified. In some methods provided herein, the incorporation
of a metabolic label into a nucleic acid or protein is identified.
In some methods provided herein, the incorporation of a labeled
nucleotide is identified. In some methods provided herein, the
tobacco is provided in a cigarette and the smoke or smoke
condensate is obtained from the cigarette. Some methods provided
herein further include contacting the smoke or smoke concentrate
with a filter. In some methods provided herein, the smoke or smoke
condensate is obtained from the cigarette after passing through a
filter (e.g., a charcoal, paper, or acetate filter) attached to the
cigarette. In some methods provided herein, the filter comprises an
antioxidant or a radical scavenger. In some methods provided
herein, a plurality of cells are contacted with the smoke or smoke
condensate and the presence or absence of an inhibition of cell
proliferation is identified. In some methods provided herein, the
plurality of cells is at least, greater than, or equal to a 50%,
60%, 70%, 75%, 80%, 85%, 90%, 95%, or a 100% population of cells in
G.sub.0, G.sub.1, S, G.sub.2, or M phase. In some methods provided
herein, the first cell is a cell obtained from a human. In some
methods provided herein, the cell is an A549 cell, a NHBE cell, or
a cell obtained from a human primary culture. In some methods
provided herein, the first cell is a cell of the oral mucosa of the
human. In some methods provided herein, the cell is a cheek cell.
In some methods provided herein, the first cell is a cell of the
pulmonary system of the human. In some methods provided herein, the
cell is a lung or bronchial cell. In some methods provided herein,
the first cell is obtained from a human after the human consumes a
cigarette. In some methods provided herein, the first cell is
obtained from a human after the human consumes a cigarette. Some
methods provided herein further include the step of identifying the
tobacco or tobacco product to be provided as a tobacco for an
analysis of the potential to inhibit cell proliferation. Some
methods provided herein further include the step of measuring the
amount of inhibition of cell proliferation induced after exposure
of the cell to the smoke or smoke condensate.
[0014] Also provided herein are methods of identifying a compound
in tobacco or tobacco product that induces a double-strand DNA
break in a cell, an inhibition of apoptosis, or an inhibition of
cell proliferation by providing a first tobacco or tobacco product,
obtaining smoke or a smoke condensate from the first tobacco or
tobacco product, contacting a first population of cells with the
smoke or smoke condensate from the first tobacco or tobacco
product, identifying the presence or absence of a double strand DNA
break, an inhibition of apoptosis, or an inhibition of cell
proliferation in the first population of cells after contact with
the smoke or smoke condensate from the first tobacco or tobacco
product, providing a second tobacco or tobacco product that has
been genetically modified to reduce the expression of at least one
gene that regulates production of a compound in the second tobacco
or tobacco product, obtaining smoke or a smoke condensate from the
second tobacco or tobacco product, contacting a second population
of cells with the smoke or smoke condensate from the second tobacco
or tobacco product, and identifying the presence or absence of a
double strand DNA break, an inhibition of apoptosis, or an
inhibition of cell proliferation in the second population of cells
after contact with the smoke or smoke condensate from the second
tobacco or tobacco product, where an identification of a reduction
in the amount of double strand DNA breaks, inhibition of apoptosis,
or inhibition of cell proliferation in the second population of
cells after contact with the smoke or smoke condensate from the
second tobacco or tobacco product identifies the compound as one
that induces the double strand DNA breaks, inhibition of apoptosis,
or inhibition of cell proliferation. In some methods provided
herein, the identification steps comprise identifying the presence
or absence of phosphorylation of histone H2AX, activation of
caspase, or incorporation of a labeled nucleotide or amino acid. In
some methods provided herein, the tobacco is provided in a
cigarette and the smoke or smoke condensate is obtained from the
cigarette. Some methods provided herein further include contacting
the smoke or smoke concentrate with a filter. In some methods
provided herein, the smoke or smoke condensate is obtained from the
cigarette after passing through a filter attached to the cigarette.
In some methods provided herein, the filter comprises an
antioxidant or a radical scavenger. In some methods provided
herein, smoke is obtained from the first and second tobaccos or
tobacco products. In some methods provided herein, the
identification steps comprise identifying the presence or absence
of a double strand DNA break. In some methods provided herein, the
presence or absence of phosphorylation of histone H2AX is
identified with an antibody or fragment thereof, which binds to
phosphorylated H2AX but not unphosphorylated H2AX. In some methods
provided herein, the genetic modification reduces the expression of
a gene that regulates nicotine or sterol biosynthesis. In some
methods provided herein, the gene is selected from the group
consisting of quinolate phosphoribosyl transferase, putrescine
methyl transferase, and A622. In some methods provided herein, the
second tobacco or tobacco product is processed to remove the
presence of a microbe. In some methods provided herein, the
processing comprises sterilization, pasteurization, or radiation.
In some methods provided herein, exogenous nicotine or a nicotine
analog has been added to the second tobacco. In some methods
provided herein, the smoke is contacted with the cells for greater
than, less than, or equal to 5 minutes, 15 minutes, 20 minutes, 30
minutes, 40 minutes, or one hour. In some methods provided herein,
the number of surviving cells after contact with the smoke or smoke
condensate are identified. In some methods provided herein, the
first and second populations of cells are at least, greater than,
or equal to a 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or a 100%
population of cells in G.sub.0, G.sub.1, S, G.sub.2, or M phase. In
some methods provided herein, the first and second populations of
cells are obtained from a human. In some methods provided herein,
the first and second populations of cells are A549 cells, NHBE
cells, or cells obtained from a human primary culture. In some
methods provided herein, the first and second populations of cells
are cells of the oral mucosa of the human. In some methods provided
herein, the first and second populations of cells are cheek cells.
In some methods provided herein, the first and second populations
of cells are cells of the pulmonary system of the human. In some
methods provided herein, the first and second populations of cells
are lung or bronchial cells. In some methods provided herein, the
first and second populations of cells are obtained from a human
after the human consumes a cigarette. Some methods provided herein
further include the step of identifying the second tobacco as a
tobacco for an analysis of the potential to induce a double strand
DNA break. Some methods provided herein further include the step of
measuring the amount of double strand DNA breaks induced after
contact of the first and second populations of cells to the smoke
or smoke condensate. Some methods provided herein further include
the step of identifying the second tobacco or tobacco product as a
composition for an analysis of the potential to inhibit apoptosis.
Some methods provided herein further include the step of measuring
the amount of inhibition of apoptosis induced after contact of the
first and second populations of cells to the smoke or smoke
condensate. Some methods provided herein further include the step
of identifying the tobacco or tobacco product to be provided as a
composition for an analysis of the potential to inhibit cell
proliferation. Some methods provided herein further include the
step of measuring the amount of inhibition of cell proliferation
induced after exposure of the first and second populations of cells
to the smoke or smoke condensate. In some methods, a plurality of
compounds are removed from said tobacco through modification (e.g.,
chemical treatment and/or genetic modification) and each compound
is added back to the modified tobacco incrementally (e.g., by
replacement of the removed compounds, such as by application of
exogenous compound, in the tobacco one at a time followed by
analysis of the effect on cell homeostasis after each compound is
added) so as to identify the individual contribution to tobacco
related disease provided by each of the compounds that were
removed.
[0015] Also provided herein are methods of identifying a tobacco
product that has a reduced potential to contribute to a
tobacco-related disease by providing a first tobacco product,
obtaining smoke or a smoke condensate from the first tobacco
product, contacting a first population of cells with the smoke or
smoke condensate from the first tobacco product, identifying the
presence or absence of a double strand DNA break, an inhibition of
apoptosis, or an inhibition of cell proliferation in the first
population of cells after contact with the smoke or smoke
condensate from the first tobacco product, providing a second
tobacco product, obtaining smoke or a smoke condensate from the
second tobacco product, contacting a second population of cells
with the smoke or smoke condensate from the second tobacco product,
and identifying the presence or absence of a double strand DNA
break, an inhibition of apoptosis, or an inhibition of cell
proliferation in the second population of cells after contact with
the smoke or smoke condensate from the second tobacco product,
where an identification of a reduction in the amount of double
strand DNA breaks, inhibition of apoptosis, or inhibition of cell
proliferation in the second population of cells after contact with
the smoke or smoke condensate from the second tobacco product, as
compared to the amount of double strand DNA breaks, inhibition of
apoptosis, or inhibition of cell proliferation identified in the
first population of cells identifies the second tobacco product as
one that has a reduced potential to contribute to a tobacco-related
disease. In some methods provided herein, the identification steps
comprise identifying the presence or absence of phosphorylation of
histone H2AX, activation of caspase, incorporation of a labeled
nucleotide, incorporation of a labeled amino acid, or cell lysis.
In some methods provided herein, the first and second tobacco
products are cigarettes. Some methods provided herein further
include contacting the smoke or smoke concentrate with a filter. In
some methods provided herein, the smoke or smoke condensate is
obtained from the cigarettes after passing through a filter
attached to the cigarettes. In some methods provided herein, the
filter comprises an antioxidant or a radical scavenger. In some
methods provided herein, smoke is obtained from the first and
second tobaccos. In some methods provided herein, the
identification steps comprise identifying the presence or absence
of a double strand DNA break. In some methods provided herein, the
presence or absence of phosphorylation of histone H2AX is
identified with an antibody or fragment thereof, which binds to
phosphorylated H2AX but not unphosphorylated H2AX. In some methods
provided herein, the second tobacco product comprises a genetically
modified tobacco comprising a reduced amount of a compound. In some
methods provided herein, the second tobacco product comprises a
reduced amount of nicotine and/or a sterol and a collective content
of tobacco specific nitrosamines less than or equal to 0.5 .mu.g/g.
In some methods provided herein, the second tobacco product
comprises a reduced amount of alkaloid or sterol. In some methods
provided herein, the genetically modified tobacco comprises a
reduced expression of a gene selected from the group consisting of
quinolate phosphoribosyl transferase, putrescine methyl
transferase, and A622. In some methods provided herein, the second
tobacco is processed to remove the presence of a microbe. In some
methods provided herein, the processing comprises sterilization,
pasteurization, or radiation. In some methods provided herein,
exogenous nicotine or a nicotine analog has been added to the
second tobacco. In some methods provided herein, the smoke is
contacted with the cells for greater than, less than, or equal to 5
minutes, 15 minutes, 20 minutes, 30 minutes, 40 minutes, or one
hour. In some methods provided herein, the number of surviving
cells after contact with the smoke or smoke condensate are
identified. In some methods provided herein, the first and second
populations of cells are at least, greater than, or equal to a 50%,
60%, 70%, 75%, 80%, 85%, 90%, 95%, or a 100% population of cells in
G.sub.0, G.sub.1, S, G.sub.2, or M phase. In some methods provided
herein, the first and second populations of cells are obtained from
a human. In some methods provided herein, the first and second
populations of cells are A549 cells, NHBE cells, or cells obtained
from a human primary culture. In some methods provided herein, the
first and second populations of cells are cells of the oral mucosa
of the human. In some methods provided herein, the first and second
populations of cells are cheek cells. In some methods provided
herein, the first and second populations of cells are cells of the
pulmonary system of the human. In some methods provided herein, the
first and second populations of cells are lung or bronchial cells.
In some methods provided herein, the first and second populations
of cells are obtained from a human after the human consumes a
cigarette. Some methods provided herein further include the step of
identifying the second tobacco as a tobacco for an analysis of the
potential to induce a double strand DNA break. Some methods
provided herein further include the step of measuring the amount of
double strand DNA breaks induced after contact of the first and
second populations of cells to the smoke or smoke condensate. Some
methods provided herein further include the step of identifying the
second tobacco as a tobacco for an analysis of the potential to
inhibit apoptosis. Some methods provided herein further include the
step of measuring the amount of inhibition of apoptosis induced
after contact of the first and second populations of cells to the
smoke or smoke condensate. Some methods provided herein further
include the step of identifying the tobacco or tobacco product to
be provided as a tobacco for an analysis of the potential to
inhibit cell proliferation. Some methods provided herein further
include the step of measuring the amount of inhibition of cell
proliferation induced after exposure of the first and second
populations of cells to the smoke or smoke condensate.
[0016] Also provided herein are methods of making a tobacco product
that has a reduced potential to contribute to a tobacco-related
disease by providing a first tobacco, obtaining smoke or a smoke
condensate from the first tobacco, contacting a first population of
cells with the smoke or smoke condensate from the first tobacco,
identifying the presence or absence of a double strand DNA break,
an inhibition of apoptosis, or an inhibition of cell proliferation
in the first population of cells after contact with the smoke or
smoke condensate from the first tobacco, providing a second tobacco
that is genetically modified to reduce the expression of at least
one gene that regulates production of a compound in the second
tobacco, obtaining smoke or a smoke condensate from the second
tobacco, contacting a second population of cells with the smoke or
smoke condensate from the second tobacco, identifying the presence
or absence of a double strand DNA break, an inhibition of
apoptosis, or an inhibition of cell proliferation in the second
population of cells after contact with the smoke or smoke
condensate from the second tobacco, where an identification of a
reduction in the amount of double strand DNA breaks, inhibition of
apoptosis, or inhibition of cell proliferation in the second
population of cells after contact with the smoke or smoke
condensate from the second tobacco, as compared to the amount of
double strand DNA breaks, inhibition of apoptosis, or inhibition of
cell proliferation identified in the first population of cells
identifies the second tobacco as one that has a reduced potential
to contribute to a tobacco-related disease, and incorporation of
the second tobacco, which has a reduced potential to contribute to
a tobacco-related disease, into a tobacco product. In some of the
methods provided herein, the identification steps comprise
identifying the presence or absence of phosphorylation of histone
H2AX, activation of caspase, incorporation of a labeled nucleotide,
incorporation of a labeled amino acid, or cell lysis. In some of
the methods provided herein, the first and second tobaccos are
present in cigarettes. Some of the methods provided herein further
include contacting the smoke or smoke concentrate with a filter. In
some of the methods provided herein, the smoke or smoke condensate
is obtained from the cigarettes after passing through a filter
attached to the cigarettes. In some of the methods provided herein,
the filter comprises an antioxidant or a radical scavenger. In some
of the methods provided herein, the filter comprises an interceptor
of an aromatic carcinogen, where the carcinogen associates with
interceptor forming a complex that is retained in the filter. In
some of the methods provided herein, smoke is obtained from the
first and second tobaccos. In some of the methods provided herein,
the identification steps comprise identifying the presence or
absence of a double strand DNA break. In some of the methods
provided herein, the presence or absence of phosphorylation of
histone H2AX is identified with an antibody or fragment thereof,
which binds to phosphorylated H2AX but not unphosphorylated H2AX.
In some of the methods provided herein, the second tobacco product
comprises a genetically modified tobacco comprising a reduced
amount of a compound. In some of the methods provided herein, the
second tobacco product comprises a reduced amount of nicotine
and/or sterol and a collective content of tobacco specific
nitreosamines less than or equal to 0.5 .mu.g/g. In some of the
methods provided herein, the second tobacco product comprises a
reduced amount of alkaloid or sterol or both. In some of the
methods provided herein, the genetically modified tobacco comprises
a reduced expression of a gene selected from the group consisting
of quinolate phosphoribosyl transferase, putrescine methyl
transferase, and A622. In some of the methods provided herein, the
second tobacco is processed to remove the presence of a microbe. In
some of the methods provided herein, the processing comprises
sterilization, pasteurization, or radiation. In some of the methods
provided herein, exogenous nicotine or a nicotine analog has been
added to the second tobacco. In some of the methods provided
herein, the smoke is contacted with the cells for greater than,
less than, or equal to 5 minutes, 15 minutes, 20 minutes, 30
minutes, 40 minutes, or one hour. In some of the methods provided
herein, the number of surviving cells after contact with the smoke
or smoke condensate are identified. In some of the methods provided
herein, the first and second populations of cells are at least,
greater than, or equal to a 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%,
or a 100% population of cells in G.sub.0, G.sub.1, S, G.sub.2, or M
phase. In some of the methods provided herein, the first and second
populations of cells are obtained from a human. In some of the
methods provided herein, the first and second populations of cells
are A549 cells, NHBE cells, or cells obtained from a human primary
culture. In some of the methods provided herein, the first and
second populations of cells are cells of the oral mucosa of the
human. In some of the methods provided herein, the first and second
populations of cells are cheek cells. In some of the methods
provided herein, the first and second populations of cells are
cells of the pulmonary system of the human. In some of the methods
provided herein, the first and second populations of cells are lung
or bronchial cells. In some of the methods provided herein, the
first and second populations of cells are obtained from a human
after the human consumes a cigarette. Some methods provided herein
further include the step of identifying the second tobacco as a
tobacco for an analysis of the potential to induce a double strand
DNA break. Some methods provided herein further include the step of
measuring the amount of double strand DNA breaks induced after
contact of the first and second populations of cells to the smoke
or smoke condensate. Some methods provided herein further include
the step of identifying the second tobacco as a tobacco for an
analysis of the potential to inhibit apoptosis. Some methods
provided herein further include the step of measuring the amount of
inhibition of apoptosis induced after contact of the first and
second populations of cells to the smoke or smoke condensate. Some
methods provided herein further include the step of identifying the
tobacco or tobacco product to be provided as a composition for an
analysis of the potential to inhibit cell proliferation. Some
methods provided herein further include the step of measuring the
amount of inhibition of cell proliferation induced after exposure
of the first and second populations of cells to the smoke or smoke
condensate.
[0017] Also provided herein are tobacco products made by any of the
methods of making a tobacco product provided herein.
[0018] Also provided herein are efficient assays that can be used
to assess and compare the harmful potential of tobacco products as
well as to identify harmful smoke components and thereby develop
new tobacco products without such components that pose a reduced
risk to a consumer. The assays provided herein are based, at least
in part, on the discovery that short-term exposure of (i) A549
pulmonary adenocarcinoma cells to tobacco smoke and (ii) NHBE to
smoke condensate, induced DSBs in a dose-dependent manner. DSBs can
be detected using, for example, an antibody specifically directed
to the phosphorylated form of the DSB-associated histone, H2AX, and
were manifested as an increased degree of phosphorylation of H2AX.
Also provided herein are methods of detecting DSBs using antibodies
to the activated (e.g., phosphorylated) form of protein kinases
ATR, ATM or DNA-PK, that are involved in H2AX phosphorylation. DSBs
can also be detected by revealing the presence of characteristic
"foci" in cell nucleus that comprise of several proteins associated
with DNA repair.
[0019] Accordingly, provided herein are methods and kits for
identifying and/or detecting harmful agents found in or derived
from tobacco products in a variety of contexts, including smoke or
smoke concentrates applied in a laboratory setting or arising in
the environment. These methods and kits can be used to determine
whether a tobacco-derived test composition promotes the formation
of DSBs in chromosomal DNA, preferably using a .gamma.H2AX-based
assay. The kits provided herein can be based on either detection of
.gamma.H2AX or of activated protein kinases ATR, ATM or DNA-PK, or
of protein components of the nuclear "foci" detected
immunocytochemically.
[0020] In specific non-limiting embodiments, the assays provided
herein can be used to identify harmful components arising from
tobacco product use. Steps can then be taken to eliminate,
decrease, or neutralize these components in the tobacco products
themselves, in the environment, or in vivo. Further provided herein
are assay systems to determine whether modified tobacco products
are indeed "reduced risk" as compared to traditional tobacco
products.
BRIEF DESCRIPTION OF THE DRAWINGS
[0021] FIG. 1A-B. Fluorescence photomicrographs of NHBE cells
exposed to 25 .mu.g/ml of tobacco smoke condensate for 24 h. The
cells stained with DAPI and immuno-stained with .gamma.H2AX Ab were
examined under UV light--(A) or blue light--(B) fluorescence
excitation (Nikon Microphot FXA, 60.times. Objective.).
[0022] FIG. 2A-C. Bivariate (cellular DNA content vs cell
immunofluorescence) distributions (scatterplots) of A549 cells,
mock-treated (B) or exposed for 30 min to tobacco smoke (A, C),
immuno-stained either with .gamma.H2AX Ab (B,C) or with an isotype
control IgG (A). The dashed-line represents the maximal
fluorescence level (for 99% cells) of the IgG control.
[0023] FIG. 3. Plots showing the percent increase (A) in mean
.gamma.H2AX immunofluorescence of A549 cells (per unit of DNA)
exposed to smoke for different time intervals, calculated for cells
in particular phases of the cell cycle, as described in Example 1.
The value for mock-exposed cells was subtracted from those exposed
to smoke.
[0024] FIG. 4. Plots showing percent increase (A) in mean
.gamma.H2AX immunofluorescence of NHBE cells treated with 10, 25 or
50 .mu.g/ml concentrations of smoke condensate for different
periods of time. As in FIG. 3, the .gamma.H2AX value for the
mock-exposed cells was subtracted from the values of the cells
exposed to different concentrations of condensate.
[0025] FIG. 5. Percent increase (A) in mean .gamma.H2AX
immunofluorescence of NHBE cells treated with 10 .mu.g/ml of smoke
condensate for different intervals of time, in relation to cell
cycle phase. As in FIG. 3, the .gamma.H2AX value for the
mock-exposed cells was subtracted from the values of the cells
exposed to condensate.
[0026] FIG. 6. Plots showing the percent increase (.DELTA.) in mean
.gamma.H2AX immunofluorescence of A549 cells (per unit of DNA)
exposed to smoke of IM 16 cigarettes for different time intervals,
calculated for cells in particular phases of the cell cycle, as
described in Example 2.
[0027] FIG. 7A-D. (A) Plot showing increase (A) in mean .gamma.H2AX
immunofluorescence of A549 cells exposed to smoke of IM 16
cigarettes for 15 minutes, calculated for cells in particular
phases of the cell cycle. (B) Scatter plot relative increase in
.gamma.H2AX following 60 min of recovery of the A549 cells in
particular phases of the cell cycle. (C) Plot showing increase (A)
in mean .gamma.H2AX immunofluorescence of NHBE cells exposed to
smoke of IM 16 cigarettes for 20 minutes, calculated for cells in
particular phases of the cell cycle. (B) Scatter plot relative
increase in .gamma.H2AX following 60 min of recovery of the NHBE
cells in particular phases of the cell cycle.
[0028] FIG. 8. Plots showing the increase (A) in mean .gamma.H2AX
immunofluorescence during different time points of the recovery of
A549 cells (per unit of DNA) after exposure to smoke of IM 16,
Quest 3.RTM., and Omni.RTM. cigarettes for 20 minutes, calculated
for cells in particular phases of the cell cycle.
[0029] FIG. 9. Bar plots showing the increase (A) in mean
.gamma.H2AX immunofluorescence of A549 cells (top) and NHBE cells
(bottom) exposed to smoke of IM 16 cigarettes for 20 minutes,
followed by a 1 hour recovery, for cells treated with
phosphate-buffered saline (PBS) or N-acetyl-L-cysteine (NAC) during
exposure (first value) and during recovery (second value).
[0030] FIG. 10. Bar plot showing the increase (A) in mean
.gamma.H2AX immunofluorescence of A549 cells exposed to smoke from
IM 16, Omni.RTM. and Quest 3.RTM. in the presence of PBS or
NAC.
[0031] FIG. 11. Plot of the relative amount of mean .gamma.H2AX
immunofluorescence of A549 cells exposed to smoke from IM 16 as a
function of different concentrations of NAC, calculated for cells
in particular phases of the cell cycle. Horizontal dashed line
indicates 50% reduction in .gamma.H2AX immunofluorescence. Vertical
dashed lines indicate the estimated NAC concentration for each cell
type at 50% reduction.
[0032] FIG. 12. Bar plots showing the increase (A) in mean
.gamma.H2AX immunofluorescence of A549 cells (upper plot) and NHBE
cells (lower plot) exposed to the vapor phase of smoke from IM 16,
Quest 1.RTM. and Quest 3.RTM., and smoke from IM 16 in the presence
of PBS or NAC.
[0033] FIG. 13. Bar plots showing the increase (A) in mean
.gamma.H2AX immunofluorescence of G.sub.1, S and G.sub.2M phase
A549 cells (left plots) and G.sub.1, S and G.sub.2M phase NHBE
cells (right plots) exposed to the vapor phase of smoke from IM 16,
Quest 1.RTM. and Quest 3.RTM. in the presence of PBS or NAC.
[0034] FIG. 14. Bar plot showing the relative percent cloning
efficiency of A549 cells 5 days after exposure to smoke from IM 16
or Marlboro.RTM. for 10, 15 or 20 minutes.
[0035] FIG. 15. Bar plots showing the relative percent cloning
efficiency of A549 cells 5 days after exposure to smoke from IM 16,
Quest 1.RTM. or Quest 3.RTM. for 10, 20 or 30 minutes (top two
plots), or 6 days after (bottom plot) exposure to smoke from IM 16,
Marlboro.RTM. or Omni.RTM., for 10, 15 or 20 minutes.
[0036] FIG. 16. Bar plot showing the relative percent cloning
efficiency of A549 cells 5 days after exposure to smoke from IM 16
for 20 minutes in the presence of PBS or 1 mM, 5 mM, 10 mM or 25 mM
NAC.
[0037] FIG. 17. Bar plot showing the relative percent cloning
efficiency of A549 cells 5 days after exposure to smoke from IM 16,
Omni.RTM. or Quest 3.RTM. for 20 minutes in the presence of PBS or
25 mM NAC.
[0038] FIG. 18. Bar plot showing the relative percent cloning
efficiency of A549 cells 5 days after exposure to vapor phase of
smoke from IM 16, Quest 1.RTM. or Quest 3.RTM., or smoke of IM 16
for 20 minutes in the presence of PBS or 25 mM NAC.
[0039] FIG. 19. Bar plot of results from Example 2 showing the
increase (A) in mean .gamma.H2AX immunofluorescence of A549 cells
exposed to smoke from IM 16, Omni.RTM. and Quest 3.RTM. in the
presence of PBS or NAC, calculated for cells in particular phases
of the cell cycle
[0040] FIG. 20. An illustration of a QPTase inhibition construct
comprising a QPTase inhibition cassette including full-length
QPTase coding sequence and a GUS selection cassette.
[0041] FIG. 21. An illustration of a QPTase inhibition construct
comprising a QPTase inhibition cassette including a 360 by fragment
of the QPTase gene and a norflurazone resistance selection cassette
including a mutant phytoene desaturase gene (PDSM-1).
[0042] FIG. 22. An illustration of a PMTase inhibition construct
comprising a PMTase inhibition cassette including a 241 by fragment
of the PMTase gene and a norflurazone resistance selection cassette
including a mutant phytoene desaturase gene (PDSM-1).
[0043] FIG. 23. An illustration of a A622 inhibition construct
comprising a A622 inhibition cassette including a 628 by fragment
of the A622 gene and a norflurazone resistance selection cassette
including a mutant phytoene desaturase gene (PDSM-1).
[0044] FIG. 24. An illustration of a QPTase/A622 double inhibition
construct comprising a QPTase/A622 inhibition cassette including a
360 by fragment of the QPTase gene and a 628 by fragment of the
A622 gene and a norflurazone resistance selection cassette
including a mutant phytoene desaturase gene (PDSM-1).
[0045] FIG. 25. An illustration of a SMT2/A622 double inhibition
construct comprising a A622 inhibition cassette including a 628 by
fragment of the A622 gene, an SMT2 inhibition cassette including a
779 by fragment of the SMT2 gene and a norflurazone resistance
selection cassette including a mutant phytoene desaturase gene
(PDSM-1).
[0046] FIG. 26. Plot depicting .gamma.H2AX associated fluorescence
(.gamma.H2AX; X-axis) and the number of cells having the
corresponding .gamma.H2AX fluorescence level (Y axis), for buccal
cells of a subject subsequent to smoking a cigarette (smoker) or a
subject who did not smoke a cigarette (non-smoker).
[0047] FIG. 27. Bar plot of results from Example 2 showing the
increase (A) in mean .gamma.H2AX immunofluorescence of A549 cells
exposed to smoke from IM 16, Marlboro.RTM., Marlboro Light.RTM.,
and Quest 3.RTM., calculated for cells in particular phases of the
cell cycle.
[0048] FIG. 28. Bar plot of results from FIG. 27 showing the
increase (A) in mean .gamma.H2AX immunofluorescence of A549 cells
exposed to smoke from IM 16, Marlboro.RTM., Marlboro Light.RTM.,
and Quest 3.RTM., averaged for all cell cycles.
DETAILED DESCRIPTION OF THE INVENTION
[0049] Several approaches to determine the extent that a tobacco or
tobacco product induces cellular damage have been developed. In
some embodiments, a tobacco or a tobacco product is analyzed for
its ability to induce DNA damage (e.g., double strand DNA breaks)
or modulate cell homeostasis (e.g., inhibit apoptosis and/or
inhibit cell proliferation). These assays are particularly useful
for identifying tobacco and tobacco products that have a reduced
potential to contribute to a tobacco related disease, as compared
to a reference tobacco (e.g., the industry standard reference
tobacco IM16 (Philip Morris.RTM. USA) or the full-flavor low tar
reference cigarette 2R4F or the ultra low tar cigarette 1R5F, which
are Kentucky reference cigarettes that can be obtained from the
Tobacco and Health Institute at the University of Kentucky), a
conventional tobacco (e.g., a commercially available tobacco of the
same class (e.g., "full-flavor" or "light" or "ultra-light")), or a
non-transgenic tobacco or wild-type tobacco (e.g., a tobacco of the
same variety, such as Burley, Virginia Flue, or Oriental, or
strain, such as LA Burley 21, K326, Tn90, Djebe1174). That is, the
assays provided herein can be used to confirm that a tobacco or
tobacco product is a reduced risk tobacco or tobacco product, as
compared to a reference tobacco or tobacco product (e.g., IM16,
2R4F or 1R5F), a conventional, commercially available, or
traditional tobacco product or a wild-type tobacco. The assays
described herein can also be used to identify components in tobacco
and tobacco products that induce cellular damage. Further, the
assays described herein can be used to develop reduced risk tobacco
and tobacco products that have a lower potential to contribute to a
tobacco related disease than a reference tobacco or tobacco product
(e.g., IM16, 2R4F or 1R5F), a conventional, commercially available,
or traditional tobacco product or a wild-type tobacco.
[0050] Some of the embodiments described herein compare the
effects/damage (e.g., effects on DNA damage, apoptosis, or cell
proliferation) of smoke generated from a transgenic tobacco or a
tobacco product containing transgenic tobacco to a reference
tobacco or reference tobacco product (e.g., IM16, 2R4F or 1R5F), a
commercially available tobacco product of the same class (e.g.,
full-flavor, lights, and ultra-lights), or, preferably, a tobacco
of the same variety (e.g., Burley, Virginia Flue, or Oriental) or
strain (e.g., LA Burley 21, K326, Tn90, Djebe1174). Reduced risk
tobacco products developed according to the methods described
herein include "full-flavor," "lights," and "ultra light"
cigarettes with both reduced levels of alkaloids and/or sterols and
levels of alkaloids and/or sterols that are commensurate with
amounts of these compounds common to the particular class of
cigarette (i.e., a conventional amount of nicotine).
[0051] The term "tobacco products" includes, but is not limited to,
smoking materials (e.g., cigarettes, cigars, pipe tobacco), snuff,
chewing tobacco, gum, and lozenges. The term "reduced risk tobacco
product" or "reduced risk tobacco" includes, but is not limited to,
a tobacco product or tobacco comprising a modified tobacco (e.g.,
chemically or genetically modified tobacco) that has a reduced
amount of a compound that contributes to a tobacco-related disease
(e.g., nicotine, nornicotine, a sterol, or the metabolites thereof
including, but not limited to, a tobacco specific nitrosamine
(TSNA), an acrolein, an aldehyde, polycyclic aromatic hydrocarbon
(PAH), benz[a]pyrene (BAP), a heterocyclic hydrocarbon, or an
aromatic amine), as compared to a reference tobacco or reference
tobacco product (e.g., IM16, 2R4F or 1R5F), a commercially
available tobacco product of the same class (e.g., full-flavor,
lights, and ultra-lights), or, preferably, a tobacco of the same
variety (e.g., Burley, Virginia Flue, or Oriental) or strain (e.g.,
LA Burley 21, K326, Tn90, Djebe1174) as the modified tobacco prior
to modification. Exemplary reference tobaccos that can be used in
the methods provided herein include IM16, 2R4F, and 1R5F, where
2R4F (full flavor low tar) and 1R5F (ultra low tar) Kentucky
reference cigarettes can be obtained from the Tobacco and Health
Institute at the University of Kentucky, and IM16 reference
cigarettes can be obtained from Phillip Morris.RTM. USA.
[0052] In other contexts, a reduced risk tobacco or a reduced risk
tobacco product refers to a modified tobacco or tobacco product
comprising a modified tobacco (e.g., transgenic tobacco or a
tobacco product comprising transgenic tobacco) that induces less
cellular damage (e.g., fewer double strand DNA breaks, or less
modulation of cell homeostasis (e.g., a reduced amount of
inhibition of apoptosis or less inhibition of cell proliferation)
than a reference tobacco or reference tobacco product (e.g., IM16,
2R4F or 1R5F), a commercially available tobacco product of the same
class (e.g., full-flavor, lights, and ultra-lights), or,
preferably, a tobacco of the same variety (e.g., Burley, Virginia
Flue, or Oriental) or strain (e.g., LA Burley 21, K326, Tn90,
Djebe1174) as the modified tobacco prior to modification). In still
other contexts, a reduced risk tobacco or a reduced risk tobacco
product refers to a modified tobacco or tobacco product comprising
a modified tobacco (e.g., transgenic tobacco or a tobacco product
comprising transgenic tobacco) that up-regulates fewer genes
associated with a tobacco-related disease as compared to a
reference tobacco or reference tobacco product (e.g., IM16, 2R4F or
1R5F), a commercially available tobacco product of the same class
(e.g., full-flavor, lights, and ultra-lights), or, preferably, a
tobacco of the same variety (e.g., Burley, Virginia Flue, or
Oriental) or strain (e.g., LA Burley 21, K326, Tn90, Djebe1174) as
the as the modified tobacco prior to modification).
[0053] In still other contexts, a reduced risk tobacco or a reduced
risk tobacco product refers to a modified tobacco or tobacco
product (e.g., a transgenic tobacco or a tobacco product comprising
transgenic tobacco) that down-regulates fewer genes associated with
the repair of tobacco-induced damage (e.g., oxidative damage), as
compared to a reference tobacco or reference tobacco product (e.g.,
IM16, 2R4F or 1R5F), a commercially available tobacco product of
the same class (e.g., full-flavor, lights, and ultra-lights), or,
preferably, a tobacco of the same variety (e.g., Burley, Virginia
Flue, or Oriental) or strain (e.g., LA Burley 21, K326, Tn90,
Djebe1174) as the as the modified tobacco prior to modification).
Accordingly, aspects of the invention provide several assays to
determine whether a tobacco or tobacco product has a reduced
potential to contribute to a tobacco-related disease (i.e., that a
reduced risk tobacco has been identified) by identifying
tobacco-induced changes in cell homeostasis. That is, the degree of
tobacco product-induced change in expression levels in contacted
cells relative to expression levels in homeostatic cells can be
compared (or the expression levels in two or more populations of
contacted cells can be compared), and the tobacco associated with
expression levels that differ less or differ the least from
homeostatic levels can be a tobacco has a reduced potential to
contribute to a tobacco-related disease.
[0054] It should also be emphasized that the word "reduced," or the
phrase "a reduced amount" is intended to refer to an amount of a
harmful compound (e.g., total alkaloid, nicotine, nornicotine, a
sterol, or the metabolites thereof including, but not limited to, a
TSNA, an acrolein, an aldehyde, PAH, BAP, a heterocyclic
hydrocarbon, or an aromatic amine) in or produced by a modified
tobacco plant, tobacco, or tobacco product (e.g., a genetically
modified tobacco plant, tobacco, or a tobacco product containing
said tobacco) that is less than the amount of said harmful compound
found or produced, preferably, in a tobacco plant, tobacco, or a
tobacco product from the same class of tobacco product (e.g.,
full-flavor, light, ultra-light), same variety of tobacco (e.g. the
parental strain of tobacco prior to genetic modification), or in
comparison to a reference cigarette (e.g., IM16, 2R4F or 1R5F),
which has not been modified (e.g., genetically modified tobacco).
Thus, in some contexts and embodiments, wild-type tobacco of the
same variety that has been grown and processed in the same manner
as the modified tobacco (e.g., genetically modified tobacco) is
used as a control by which to measure whether a reduction in a
harmful compound has been obtained by the inventive methods
described herein. In other embodiments, the determination of
whether a reduced amount of a harmful compound in a transgenic
tobacco has been obtained is made by comparing the amount of a
harmful compound in the transgenic tobacco to a commercially
available cigarette and/or a reference cigarette (e.g., IM16, 2R4F
or 1R5F). The section below describes approaches to characterize
the tobacco and tobacco products described herein in greater
detail.
[0055] Methods for Determining the Risk Potential of Tobacco and
Tobacco Products
[0056] Provided herein are several methods for characterizing a
tobacco or tobacco product to determine the potential for said
tobacco or tobacco product to contribute to a tobacco related
disease. Generally, these approaches are practiced by providing a
tobacco, obtaining smoke or a smoke condensate from the tobacco,
contacting a cell with the smoke or smoke condensate, and
identifying one or more attributes of the contacted cell. Tobacco
products contain a number of compounds that induce various types of
cell damage including mutations, chromosomal aberrations, aberrant
sister chromatid exchanges and micronuclei. Attributes of contacted
cells indicative of such tobacco-induced cell damage can be
identified in the methods provided herein, and such attributes
include induction of a double-strand DNA break, inhibition of
apoptosis, or inhibition of cell proliferation. Accordingly, the
methods provided herein can be used to characterize a tobacco by
assay methods including assay for induction of damage of cellular
genetic material or modulation of cell homeostasis. For example,
the methods provided herein can be used to characterize a tobacco
by assay methods including an assay for the induction of a
double-strand DNA break, inhibition of apoptosis, or inhibition of
cell proliferation.
[0057] Several other assays have classically been used to analyze
tobacco for the risk of adverse health effects. Traditionally, the
first manner of testing consists of analysis of cigarette smoke for
various components that can relate to health effects associated
with smoking. A second manner of testing includes testing cigarette
smoke tar on living cells. One of these tests detects changes in
the genetic material of bacteria. Another test uses mouse cells
grown in Petri dishes to detect potential cancer-causing activity.
A third manner of testing seeks to determine if people smoke the
tested tobacco cigarettes differently than the comparable brand or
type currently on the market. If the way the cigarettes are smoked
is different, then the other manners of testing can be repeated
with the smoking machines set to reflect the change in smoking
behavior. A fourth manner of testing examines the response of
animals to cigarette smoke or tar. One test looks for inflammation
in the lungs of mice in response to cigarette smoke. A second test
looks for tumor formation in the upper respiratory tract of
hamsters exposed to smoke. A third test looks for the cancer
producing ability of cigarette smoke tar by applying the tar to the
skin of mice. Each manner of testing can include comparing tobacco
cigarettes and both the effects of mainstream and sidestream smoke
can be tested.
[0058] During smoking, both mainstream smoke (inhaled by the
smoker) and sidestream smoke (mainly: from the burning end of the
cigarette) are generated. While mainstream and sidestream smoke are
qualitatively similar the quantity of specific components differs
between the two. Additionally, modifications to the cigarette can
independently affect the composition of sidestream and mainstream
smoke. It is concluded, therefore, that testing of tobacco or
cigarettes can be assayed for both mainstream and sidestream
smoke.
[0059] Epidemiology is not a practical approach for addressing the
issue of the health effects of changes in a cigarette composition.
Because people can smoke cigarettes differently (ex. longer or
faster puffs) it can be important to consider whether these changes
affect smoke chemistry and therefore toxicity. For example, a new,
cigarette type can result in a smoker taking longer puffs, which
can then change the smoke chemistry and toxicity.
[0060] Testing, however, can examine the effects on toxicity of a
single design change in a cigarette or can examine the effects of a
set of design changes compared to an unchanged control. Testing
protocols can follow either a screening or a tradeoff approach. In
the screening approach new designs can be subjected to a series of
tests each with criteria for passing or failing. Designs that fail
are eliminated from further testing, while those passing are
subjected to additional scrutiny. In the tradeoff approach the
relative changes in each test would be assessed in light of other
information about the particular design. Changing cigarette
additives can complicate toxicity testing. This is because new
additives might introduce entirely new toxic endpoints which are
not associated with current products.
[0061] The FTC method describes: how cigarettes are to be prepared
for smoking, the type of smoking machine to use, the way the
smoking machine should be operated, the method for collecting smoke
products, and ways to measure moisture content, nicotine, carbon
monoxide and tar. Typically in the methods provided herein, the FTC
protocol for studies of cigarette smoke chemistry and toxicity are
used. There is capability to make six runs per day at the Tobacco
Institute Laboratory.
[0062] Toxicity of cigarette smoke is directly related to the
composition of the smoke and the composition of smoke can be
changed if the way the cigarettes are smoked is changed.
[0063] There are a variety of chemical analyses that can be done to
aid in the determination of the change in toxicity of a tobacco.
These relate to the chemical composition of tobacco smoke. The
following lists the chemical composition analysis and the health
effect associated with the component or property measured Analysis
Total Particulate Matter (TPM; carcinogen), pH (effect on nicotine
toxicity), Redox Potential (influence toxicity of whole smoke),
Carbon Monoxide (reduces ability of blood to carry oxygen) Nitrogen
Oxides (NOx; increases nitrosamine formation, inhibits enzyme
function) Hydrogen Cyanide (inhibits lung clearance, lowers ability
of body to use oxygen), Hydrocarbons (benzene, butadiene; suspected
or known carcinogens) Aldehydes (ex. formaldehyde, acrolein;
inhibit lung clearance, animal carcinogens) Volatile nitrosamines
(strong animal carcinogens), Tobacco-specific nitrosamines (strong
animal carcinogens), Nicotine (associated with cardiovascular
disease); Phenols (enhance carcinogen action) Catechol (major
carcinogen), Polynuclear Aromatic Hydrocarbons (PNAs; major tumor
initiators).
[0064] There are also a variety of known cell toxicity tests that
can be performed in a relatively short time scale: bacterial
mutagenicity test, animal cell test to detect potential
carcinogens, and lung inflammation test in animals. One test, the
Ames test, uses certain types of Salmonella bacteria to
quantitatively assess the ability of a material to cause mutations,
such as mutations involved in the process of carcinogenesis. In
this test a solution of collected smoke particulates is mixed with
the bacteria. Bacteria with the ability to grow in the absence of a
particular nutrient are scored as mutants.
[0065] The potential cancer-causing ability of chemicals can also
be evaluated using a cell transformation assay. In this assay
solutions of smoke particulates are given to animal cells grown in
Petri dishes in the laboratory. After several weeks the cells are
examined under the microscope. At this time the cells are scored
for abnormal growth patterns. The number of clusters of abnormally
growing cells is then compared among cigarette types.
[0066] In animal studies, inflammation of the lungs can be
assessed. The changes measured in this test can be related to the
development of chronic obstructive pulmonary disease. In these
tests mice can be exposed to whole smoke two times per day, for any
number of days according to the experimental design. At the end of
the exposure period the animals would be killed and their lungs
washed out to collect inflammatory cells. The numbers and kinds of
the cells would be measured.
[0067] Two long-term animal tests for cancer causing ability of
tobacco can be performed. In the first, test cigarette tar is
applied to the back skin of mice. Skin tumors are then scored over
the life of the animals. The use of this test is based on two
observations: (1) in studies of tumor formation by smoke in
hamsters whole smoke is active but smoke free of particulates is
not and (2) a large number of known carcinogens are contained in
the particulate portion of cigarette smoke.
[0068] The second test examines the tumor forming ability, of whole
smoke in hamsters. A positive response can be observed in the
larynx of hamsters exposed over their lifetime to whole cigarette
smoke. In this test the animals are exposed twice daily to the
diluted smoke of one cigarette every day for their entire lives.
Tumor formation is the endpoint measured in this assay. Because the
test is so labor intensive it is recommended only as a last step in
a series of tests.
[0069] These known methods for assaying tobacco toxicity can have
limitations in terms of time length and/or expense relative to the
assay methods provided herein. Accordingly, there is a long felt
need for more rapid and less costly methods of analysis of tobacco
products of different compositions. Despite the inefficiencies of
the approaches above, it is contemplated herein that these methods
for assaying tobacco toxicity can be used in conjunction with the
methods provided herein so as to provide additional information
regarding the properties of the tobacco being characterized.
[0070] The methods provided herein can be applied to any tobacco or
tobacco product, including, but not limited to pipe, cigar and
cigarette tobacco and chewing tobacco in any form including leaf
tobacco, shredded tobacco or cut tobacco. The term "tobacco
product" includes, but is not limited to, smoking materials (e.g.,
cigarettes, cigars, pipe tobacco), snuff, chewing tobacco, gum, and
lozenges.
[0071] In the methods provided herein, one or more cells can be
contacted with a tobacco composition such as tobacco smoke (TS), or
a tobacco smoke condensate (TSC), where exemplary TS and TSC are
cigarette smoke (CS) and cigarette smoke condensate (CSC).
Preparation of the tobacco composition used in the methods provided
herein can be performed in accordance with the teachings herein and
the knowledge and skill in the art. For example, TS can be
collected using a smoking machine such as an INBIFO-Condor smoking
machine, and TSC can be collected using cold traps, as is known in
the art. For example, CSC for testing can be prepared by passing
smoke through a series of cold traps containing glass beads upon
which CSC condenses; the CSC can then be collected by washing the
beads with acetone as described in Mathewson, H. D. Beitrage zur
Tabforschung. 3(6):430-7. September 1966. In addition, cells can be
contacted with smoke provided in diluted form, where diluted smoke
can be produced in a dilution chamber, as known in the art. For
example, a smoking setup can contain a dilution chamber where the
concentration of the smoke being applied to the cells can be varied
by dilution with air in order to produce different dosages and
intensities of smoke. The dilution chamber can be located between
the burning cigarette and the cell exposure chamber. In addition,
cigarette particulate matter for testing can be prepared by passing
smoke through a glass fiber filter which is subsequently washed
with solvent to collect the sample as described in Coresta
Recommended Method No. 23 (August 1991). Although the description
herein provides several methods in the context of characterizing
tobacco and tobacco products that undergo pyrolysis (e.g.,
cigarettes, pipe tobacco, and cigars), similar approaches can be
applied to the evaluate snuff, chew, and other tobacco products
that do not undergo pyrolysis. Accordingly, the methods provided
herein are not limited to smoke or smoke condensate, but can be
applied to any tobacco composition known in the art. The
preparation and analysis of compositions from such non-pyrolysis
tobacco products is straightforward given the teachings provided
herein or otherwise known in the art. Methods for contacting cells
with compositions from such non-pyrolysis tobacco products also is
straightforward given the teachings provided herein or otherwise
known in the art.
[0072] The tobacco derived composition (i) can originate in a
tobacco product, which can be either pure tobacco or a tobacco
formulation (such as a cigarette, cigar, pipe or chewing tobacco)
having multiple compositional elements, for example but not limited
to structural elements, flavor chemicals and/or other additives,
and (ii) can have multiple components (e.g., smoke or a smoke
condensate, also referred to collectively as "smoke products") or
can be a single known or unidentified component (e.g., a single
chemical compound). The composition can be "derived" from tobacco
or a tobacco formulation (i) by simple physical separation; (ii) as
a product of combustion or heating, (iii) by solvent extraction,
(iv) by chemical reaction(s) or (v) by enzyme activity (e.g., smoke
concentrate treated with a microsomal cellular fraction or purified
cytochrome P450).
[0073] In some methods provided herein, cells are contacted with
TS, such as CS. The contacting of the cells with the CS, CSC, TS,
or TSC can be accomplished using any method known to one of skill
in the art, including but not limited to, placing said cells into a
smoking machine or smoke chamber (e.g., CULTEX.RTM.) for a period
of time to allow the cells to be contacted with smoke, and/or
providing a CSC or TSC to the media for a designated period of time
(e.g., in beeswax or other formulation). The contacting can be for
any amount of time, however, preferably the cells are contacted for
an amount of time that does not result in nonviability of more than
40% of the cells. In some embodiments, the amount of time can be
varied and the results are compared. In a further embodiment, the
cells are treated for an amount of time in which the gene
expression is modulated, but the majority of cells are still
viable. That is, in some embodiments, the cells are treated to a
point in which the cells are at least, equal to, or more than 1%
viable, including but not limited to 1%, 5%, 10%, 15%, 20%, 25%,
30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%,
95%, 99%, and 100% viable.
[0074] In a another embodiment, the amount of time for contacting a
cell with the CS, CSC, TS, or TSC is any amount selected from the
group consisting of about at least, equal to, or more than 1
seconds to about 24 hours, including but not limited to at least,
equal to, or more than 1 second, 15 seconds, 30 seconds, 45
seconds, 1 minute, 3 minutes, 5 minutes, 10 minutes, 15 minutes, 20
minutes, 25 minutes, 30 minutes, 35 minutes, 40 minutes, 45
minutes, 60 minutes, 1.5 hours, 2 hours, 2.5 hours, 3 hours, 3.5
hours, 4 hours, 4.5 hours, 5 hours, 5.5 hours, 6 hours, 6.5 hours,
7 hours, 7.5 hours, 8 hours, 8.5 hours, 9 hours, 9.5 hours, 10
hours, 10.5 hours, 11 hours, 11.5 hours, 12 hours, 12.5 hours, 13
hours, 13.5 hours, 14 hours, 14.5 hours, 15 hours, 15.5 hours, 16
hours, 16.5 hours, 17 hours, 17.5 hours, 18 hours, 18.5 hours, 19
hours, 19.5 hours, 20 hours, 20.5 hours, 21 hours, 22 hours 23
hours and 24 hours. In a further embodiment, the cells are
contacted for less than and including about 20 minutes. In yet
another embodiment, the cells are contacted for about 2 to about 20
minutes.
[0075] The amount of smoke with which the cells are contacted can
be any of a variety of amounts according to the desired level of
exposure. For example, smoke exposure can be performed in
accordance with FTC parameters: 2.0 second puff duration, 35 mL
puff every 60 seconds. Puff duration, volume and frequency can be
increased or decreased to achieve different levels of smoke
exposure, as desired. Similarly, smoke condensate or other tobacco
compositions can be contacted with cells at a variety of different
concentrations and for a variety of different durations, as
desired. For example, smoke condensate at 20 mg/mL can be contacted
with cells for any of the above-provided amounts of time, as
desired.
[0076] Tobacco smoke or smoke products can be treated prior to
contacting the cells with the smoke or smoke product. For example,
the smoke or smoke concentrate can be contacted with a filter, for
example by obtaining smoke or smoke condensate from a cigarette
after passing through a filter attached to the tobacco product,
such as a cigarette. The filters that can be used can be any of a
variety of known filters, including commercially available filters
provided in cigarette products, and other filters known in the art,
such as charcoal and/or paper-containing filters. One exemplary
filter can be a filter containing an antioxidant or a radical
scavenger. Filters containing antioxidants or radical scavengers
can be prepared according to known methods, as exemplified in U.S.
Pat. Nos. 6,832,612 and 6,415,798, herein expressly incorporated by
reference in their entireties. Other filters can be a filter that
can sequester or intercept harmful components that generate DNA
breaks, or enhance DNA breakage, thereby yielding a filter that
removes harmful smoke components. For example, a filter can contain
flat aromatic compounds that can scavenge potential carcinogens
(e.g., components of tar), where exemplary flat aromatic compounds
include caffeine and pontoxyfyllen. In some of the methods provided
herein the filter comprises an interceptor of the carcinogen that
has aromatic chemical structure: the carcinogen associates then
with interceptor forming a complex that is retained in the
filter.
[0077] A tobacco composition used in the methods provided herein,
such as TS, TSC, CS or CSC can be derived from any of a variety of
different tobacco products, where the tobacco products can be
formed from any of a variety of tobaccos known in the art,
including modified tobacco. As used herein, "modified tobacco"
refers to a tobacco that has been subjected to one or more genetic,
chemical or processing steps that is different than the
conventional treatment or processing of traditional "wild-type"
tobacco products. In one example, a tobacco product can be
genetically modified, by, for example, administering to a tobacco
plant a nucleic acid molecule that modulates expression of one or
more genes in the tobacco plant that produce a compound.
Genetically modified tobacco and methods of preparing same are
provided elsewhere herein. In another example, a tobacco product
can be chemically modified, by, for example, extracting or
chemically altering one or more components of tobacco, according to
methods known in the art as exemplified in U.S. Pat. Nos.
6,789,548, 4,557,280; 4,561,452; 4,848,373; 4,183,364; 4,215,706;
4,257,430; 4,248,251; 4,235,251; 4,216,784; 4,177,822; 4,055,191
(all of which are herein expressly incorporated by reference in
their entireties) or by adding one or more compounds to a tobacco
plant prior to harvesting the tobacco, as known in the art and
exemplified in U.S. Pat. Pub. No. 20050072047, herein expressly
incorporated by reference in its entirety. Additional modified
tobaccos contemplated herein include reconstituted tobacco,
extracted tobacco, and expanded or puffed tobacco. In some
embodiments, the tobacco is modified to have a reduced amount of a
compound that contributes to a tobacco-related disease, including,
but not limited to, a compound associated with a tobacco-related
disease or a metabolite thereof (e.g., tobacco sterols, nicotine, a
TSNA, and a gene product that is involved in the production of a
compound associated with a tobacco-related disease or a metabolite
thereof.
[0078] Several genetically modified tobacco plants, tobaccos, and
tobacco products comprising said tobaccos are described in the
sections that follow. The genetically modified tobacco plants
described herein are suitable for conventional growing and
harvesting techniques (e.g. topping or no topping, bagging the
flowers or not bagging the flowers, cultivation in manure rich soil
or without manure) and the harvested leaves and stems are suitable
for use in any traditional tobacco product including, but not
limited to, pipe, cigar and cigarette tobacco and chewing tobacco
in any form including leaf tobacco, shredded tobacco or cut
tobacco. It is also contemplated that the transgenic tobacco (e.g.,
reduced nicotine/TSNA and/or sterol tobacco) described herein can
be processed and blended with conventional tobacco so as to create
a wide-range of tobacco products with varying amounts of nicotine,
nitrosamines, and/or sterols.
[0079] The cells suitable for use in the methods provided herein
include human as well as non-human cells, but are preferably human
pulmonary cells (e.g., lung or bronchial cell), although cells of
other systems impacted by smoking, including but not limited to
cells of the upper aerodigestive tract (e.g., oral cavity including
cheek, pharynx, larynx, and esophagus), bladder, stomach, kidney,
pancreas, and blood (e.g., lymphocytes, monocytes, neutrophils,
esoinophils or basophils, or neoplastic blood cells such as myeloid
leukemia cells); cells of the cardiovascular system (including
endothelial cells, smooth muscle cells (e.g. from vessel walls,
myocardial cells, etc.) and cells of the female reproductive system
(e.g. cells of the uterus, cervix, fallopian tubes, ovary, and
placenta), can also be used. The cells can be normal or can be
neoplastic, metaplastic, dysplastic or malignant. The cells can be
collected from a living organism (e.g., a pulmonary lavage
specimen, tissue section such as a lung or bronchial section, oral
mucosa sample, cheek swab, or sputum sample) or can be established
cell cultures. In some embodiments, the cells can be obtained from
a living organism, including a human, after the organism is
contacted with a tobacco composition, for example, after a human
consumes a cigarette. Cells collected from a living organism can be
collected using any of a variety of known methods known in the art,
according to the cell type to be collected (e.g., a cheek scrape or
lung lavage). In specific, non-limiting embodiments, the cells can
be NHBE cells, or can be human epithelian pulmonary type II cells,
such as A549 cells, or can be cells obtained from a human primary
culture.
[0080] Many embodiments described herein employ NHBE cells that are
maintained in culture, and other embodiments employ human lung
carcinoma cells (A549 cells). Although NHBE and A549 cells are
preferred for the methods described herein, it should be understood
that many other cells that are typically contacted with tobacco or
TS during the process of smoking (e.g., lung cells, bronchial
cells, cells of the oral mucosa, pharynx, larynx, and tongue) can
also be used. Additionally, many immortal cell lines can be used
with the methods described herein. Preferred cells for use with the
embodied approaches include, but are not limited to, human
bronchial cells (e.g., BEP2D or 16HBE140 cells), human bronchial
epithelial cells (e.g., HBEC cells, 1198, or 1170-I cells), NHBE
cells, BEAS cells (e.g., BEAS-2B), NCI-H292 cells, non-small cell
lung cancer (NSCLC) cells or human alveolar cells (e.g., H460,
H1792, SK-MES-1, Calu, H292, H157, H1944, H596, H522, A549, and
H226), tongue cells (e.g., CAL 27), and mouth cells (e.g.,
Ueda-1)). Many of such cultures are available commercially or
through a public repository (e.g., ATCC). Further, several
techniques exist that allow for one to generate primary cultures of
said cells and these primary cultures can be used with the methods
described herein.
[0081] Conventional approaches in tissue culture can be used to
establish and maintain said cells in preparation for the methods
described herein. That is, the cells may be grown in culture by any
method known to one of skill in the art and with the appropriate
media and conditions. The cells grown in culture may require feeder
layers, for example. The cells may be grown to confluence or may be
grown to less than confluence before, during, or after treatment.
In some embodiments the cells are grown to between about 10% and
about 90% confluence, including but not limited to, at least, equal
to, or more than 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%,
65%, 70%, 75%, 80%, 85%, 90%, 95%, and 99% confluence before
contact with CS, CSC, TS, or TSC.
[0082] In some embodiments, the cells contacted and assayed in
accordance with the methods provided herein are manipulated to
control and/or modify the percentage of cells that are in one or
more phases of the cell cycle. For example, the cells can be
manipulated such that at least 50% of the cells of the population
of cells are in the S phase. The cells used herein can be
manipulated to control the population of cells in one or more of
G.sub.0, G.sub.1, S, G.sub.2, or M phases of the cell cycle. For
example, cells can be manipulated such that at least 50%, 60%, 70%,
75%, 80%, 85%, 90%, 95%, or 100%, of the population of cells are in
G.sub.0, G.sub.1, S, G.sub.2, or M phase. In another example, cells
can be manipulated such that greater than 50%, 60%, 70%, 75%, 80%,
85%, 90%, 95%, or 100%, of the population of cells are in G.sub.0,
G.sub.1, S, G.sub.2, or M phase. In another example, cells can be
manipulated such that 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or
100%, of the population of cells are in G.sub.0, G.sub.1, S,
G.sub.2, or M phase. The section below describes several preferred
methods for characterizing tobacco and tobacco products in greater
detail.
[0083] Exemplary Assays
[0084] The methods provided herein for characterizing tobacco can
be used in a variety of applications, including, but not limited
to, the comparison of two or more tobaccos, identifying induction
of damage of cellular genetic material or modulation of cell
homeostasis, identifying a tobacco product that has a reduced
potential to contribute to a tobacco-related disease, and making a
tobacco product that has a reduced potential to contribute to a
tobacco-related disease. In addition to methods provided herein for
characterizing tobacco or a tobacco product, additional methods
known in the art for characterizing tobacco can be used in
conjunction with the methods provided herein.
[0085] The methods of identifying a tobacco, identifying a compound
in tobacco, identifying a tobacco product, and making a tobacco
product provided herein, can in addition be utilized in methods of
identifying two or more tobaccos, identifying a compound in two or
more tobaccos, identifying a tobacco product by comparing two or
more tobacco products, and making a tobacco product by comparing
two or more tobacco products. In some embodiments, the two or more
tobaccos can be compared for their effect on damage to genetic
material of cells. In some embodiments, at least one tobacco can be
a reduced risk tobacco. In some embodiments, at least one tobacco
can be a modified tobacco, such as a chemically modified tobacco or
a genetically modified tobacco. In one example, two or more
tobaccos can be compared to identify a compound in tobacco that
induces a double-strand DNA break, an inhibition of apoptosis, or
an inhibition of cell proliferation.
[0086] In some embodiments, a second tobacco product (e.g., a
cigarette) is compared to a first tobacco product (e.g., a
cigarette) using the methods above so as to identify which of the
two tobacco products is less likely to contribute to a
tobacco-related disease. For example, a first population of
isolated human cells of the mouth, tongue, oral cavity, or lungs
(e.g., NHBE cells), is contacted with a CS from a first tobacco
product (e.g., a "reduced risk full flavor" cigarette) in an amount
and for a time sufficient to induce damage of cellular genetic
material or modulate cell homeostasis. A second population of
isolated human cells of the mouth, tongue, oral cavity, or lungs
(e.g., NHBE cells), preferably the same type of cell as used in the
analysis of the first tobacco product, is also contacted with a CS
from a second tobacco product (e.g., a cigarette) in an amount and
for the same amount of time as used with the first product or for a
time sufficient to induce damage of cellular genetic material or
modulate cell homeostasis.
[0087] The data obtained from the analysis of the first tobacco
product can be compared to the data obtained from the analysis of
the second tobacco product so as to identify, for example, an
increased risk tobacco or a compound in tobacco. The data also can
be used to identify a decreased risk tobacco. Thus, by analyzing
the differences between the tobacco products, one can identify a
tobacco product that has less potential to contribute to a tobacco
related disease or to identify, for example, a first tobacco
product that has a reduced risk to contribute to a tobacco-related
disease, as compared to a second tobacco product or vice versa. By
one technique, a tobacco product that is less likely to contribute
to a tobacco-related disease is identified because it induces less
damage to cellular genetic material. In another technique, a
tobacco product that is less likely to contribute to a
tobacco-related disease is identified because it causes less
modulation of cell homeostasis. By another technique, a tobacco
product that is less likely to contribute to a tobacco-related
disease is identified because it causes less modulation of cell
homeostasis under the same level of damage induced to cellular
genetic material.
[0088] The methods provided herein can be used not only to identify
a tobacco product that has a reduced potential to contribute to a
tobacco-related disease, as compared to a second tobacco product,
but also to develop tobacco products that have a reduced potential
to contribute to a tobacco-related disease, as compared to a second
tobacco product. That is, by screening modified tobacco (e.g.,
chemically or genetically modified tobacco) in accordance with the
methods disclosed herein, one can rapidly determine whether the
modified tobacco has an increased or decreased potential to
contribute to a tobacco-related disease, as compared to the tobacco
that is not modified.
[0089] More embodiments concern methods to identify components of a
tobacco product that contribute to a tobacco-related disease, the
selective removal or inhibition of production of these components,
and the determination that the removal of the component(s)
modulates expression of a gene that is associated with a
tobacco-related disease in a manner that reduces the potential for
the tobacco product to contribute to a tobacco related disease. It
is contemplated that particular components of tobacco products are
the factors that modulate responses in human cells that contribute
to tobacco-related disease. It is further contemplated that
modification of genes that contribute to the production of these
toxic components in tobacco (e.g., genetic engineering or chemical
treatment) will, concomitantly, result in a modulation of the
response in human cells contacted with the smoke from said modified
tobacco, which modulates the likelihood to contribute to a
tobacco-related disease relative to tobacco prior to modification
of the component-producing gene. Accordingly, by selectively
removing the components that induce the events that contribute to
tobacco-related disease in a human, one can develop tobacco
products that are less likely to contribute to a tobacco-related
disease.
[0090] By one approach, for example, CS is generated using a
smoking machine from a first tobacco product that has been
genetically modified to have a reduced amount of a compound. A
first population of NHBE cells is contacted with said CS obtained
from the modified tobacco, and the cells contacted with CS are
assayed for double-strand DNA breaks. A second population of NHBE
cells is then contacted with CS generated from the parental variety
of tobacco. That is, the parental variety of tobacco is the
un-modified tobacco variety used to generate the modified tobacco
variety, wherein the unmodified tobacco retains the component that
was removed or inhibited in the modified tobacco. The second
population of cells contacted with CS is then assayed for
double-strand DNA breaks. A comparison of the data obtained from
the analysis of the first and second tobacco products will reveal
that the difference in double-strand DNA breaks caused by the
modified tobacco relative to the unmodified tobacco. By this
approach, one can effectively identify the contribution of
individual components of a tobacco product to double-strand DNA
breaks, or other assay conditions provided herein. These methods
can thereby be used to identify the contribution of individual
components of a tobacco product to a tobacco-related disease. This
approach can be used to develop tobacco products that are less
likely to contribute to a tobacco-related disease and reduced risk
tobacco products identified by these methods are aspects of the
invention. Further, tobacco products prepared by these approaches
can be prepared according to good manufacturing processes (GMP)
(e.g., suitable for or accepted by a governmental regulatory body,
such as the Federal Drug Administration (FDA), and containers that
house said tobacco products can comprise a label or other indicia,
with or without structure-function indicia, which reflects approval
of said tobacco product from said regulatory body.
[0091] Thus, the methods provided herein can be used to
characterize a first and a second tobacco by providing the first
and second tobaccos, obtaining a first and second tobacco
composition from the first and second tobaccos, respectively,
contacting a first cell with the first tobacco composition and
contacting the second cell with the second tobacco composition, and
identifying one or more attributes of the contacted cells.
Different tobacco products can contain different levels of
carcinogens that can induce various types of cell damage including
mutations, chromosomal aberrations, aberrant sister chromatid
exchanges and micronuclei. Comparison of attributes of cells
contacted with different tobacco compositions can be performed in
the methods provided herein, and such attributes include induction
of damage of cellular genetic material or modulation of cell
homeostasis. Accordingly, the methods provided herein can be used
to compare two or more tobaccos by assay methods including assay
for induction of damage of cellular genetic material or modulation
of cell homeostasis. Exemplary assay methods include assays of a
double-strand DNA break, inhibition of apoptosis, or inhibition of
cell proliferation.
[0092] In some embodiments, the first and second smoke products are
prepared using essentially equivalent protocols. The phrase,
"wherein the first and second smoke products are prepared using
essentially equivalent protocols," as used herein, means that the
two smoke products can be validly compared. For example, both
products can be smoke or both products can be smoke
concentrates.
[0093] The methods provided herein include methods of identifying a
compound in tobacco that induces damage of cellular genetic
material or modulates cell homeostasis by providing a first
tobacco, obtaining smoke or a smoke condensate from the first
tobacco, contacting a first population of cells with the smoke or
smoke condensate from the first tobacco, identifying induction of
damage of cellular genetic material or modulation of cell
homeostasis in the first population of cells after contact with the
smoke or smoke condensate from the first tobacco, providing a
second tobacco that has been modified to reduce a compound in the
second tobacco, obtaining smoke or a smoke condensate from the
second tobacco, contacting a second population of cells with the
smoke or smoke condensate from the second tobacco, and identifying
an induction of damage of cellular genetic material or modulation
of cell homeostasis in the second population of cells after contact
with the smoke or smoke condensate from the second tobacco, where
an identification of a reduction in the induction of damage of
cellular genetic material or modulation of cell homeostasis in the
second population of cells after contact with the smoke or smoke
condensate from the second tobacco identifies the compound as one
that induces damage of cellular genetic material or modulates cell
homeostasis. Compounds identified in accordance with the methods
provided herein can be, for example, compounds that induce the
double strand DNA breaks, inhibit apoptosis, or inhibit cell
proliferation. In some embodiments, the second tobacco can be
genetically modified to reduce the expression of at least one gene
that regulates production of the compound.
[0094] The compound in tobacco that induces damage of cellular
genetic material or modulates cell homeostasis identified by the
methods provided herein can be a tobacco-derived substance
associated with double-strand DNA breaks (DSBs). The
tobacco-derived substance associated with DSBs can be detected in
the context of comparing the harmful potential of two different
tobacco or smoke products (as provided herein elsewhere) or can be
detected in an environmental context, such as TS in a business
office, train car, or restaurant. The ability to detect the tobacco
derived substance can depend on not only its presence, but also its
concentration in the "tobacco test composition" (which can be
smoke, a smoke concentrate, or, for example, an air sample
containing or potentially containing TS). To that end, useful
parameters for assessing the degree of harmfulness can include, for
example, not only the degree of phosphorylation of H2AX (or
accumulation of another DSB marker), but also the initial rate of
DSB accumulation, the period of time required to reach a plateau
and the degree of phosphorylated DSB at the plateau level where a
rapid rise in the degree of H2AX phosphorylation, a protracted
period of time to reach a plateau, and a high plateau level can be
correlated with increased harmful potential (for example, see FIGS.
3 and 4 and accompanying text). Note that where assay conditions
are relatively prolonged (for example, longer than 55 minutes) it
can be desirable to include, in the assay, a phosphatase inhibitor
such as calyculin A or okadaic acid to inhibit and/or prevent
possible dephosphorylation of H2AX molecules.
[0095] Also provided herein are methods of identifying a tobacco
product that has a reduced potential to contribute to a
tobacco-related disease by providing a first tobacco product,
obtaining smoke or a smoke condensate from the first tobacco
product, contacting a first population of cells with the smoke or
smoke condensate from the first tobacco product, identifying the
presence or absence of an induction of damage of cellular genetic
material or modulation of cell homeostasis in the first population
of cells after contact with the smoke or smoke condensate from the
first tobacco product, providing a second tobacco product,
obtaining smoke or a smoke condensate from the second tobacco
product, contacting a second population of cells with the smoke or
smoke condensate from the second tobacco product, and identifying
the presence or absence of an induction of damage of cellular
genetic material or modulation of cell homeostasis in the second
population of cells after contact with the smoke or smoke
condensate from the second tobacco product, where an identification
of a reduction in the amount or the absence of an induction of
damage of cellular genetic material or modulation of cell
homeostasis in the second population of cells after contact with
the smoke or smoke condensate from the second tobacco product, as
compared to the amount or presence of an induction of damage of
cellular genetic material or modulation of cell homeostasis
identified in the first population of cells identifies the second
tobacco product as one that has a reduced potential to contribute
to a tobacco-related disease. Tobacco products identified as having
a reduced potential to contribute to a tobacco-related disease in
accordance with the methods provided herein can be, for example,
tobacco products that are characterized by a reduced induction of
double strand DNA breaks, a lower level of inhibition of apoptosis,
or a lower level of inhibition of cell proliferation.
[0096] Also provided herein are methods of making a tobacco product
that has a reduced potential to contribute to a tobacco-related
disease by providing a first tobacco, obtaining smoke or a smoke
condensate from the first tobacco, contacting a first population of
cells with the smoke or smoke condensate from the first tobacco,
identifying the presence or absence or amount of induction of
damage of cellular genetic material or modulation of cell
homeostasis in the first population of cells after contact with the
smoke or smoke condensate from the first tobacco, providing a
second tobacco that is genetically modified to reduce the
expression of at least one gene that regulates production of a
compound in the second tobacco, obtaining smoke or a smoke
condensate from the second tobacco, contacting a second population
of cells with the smoke or smoke condensate from the second
tobacco, identifying the presence or absence or amount of induction
of damage of cellular genetic material or modulation of cell
homeostasis in the second population of cells after contact with
the smoke or smoke condensate from the second tobacco, where an
identification of a reduction in the presence or amount of
induction of damage of cellular genetic material or modulation of
cell homeostasis in the second population of cells after contact
with the smoke or smoke condensate from the second tobacco, as
compared to the presence or amount of induction of damage of
cellular genetic material or modulation of cell homeostasis
identified in the first cell population identifies the second
tobacco as one that has a reduced potential to contribute to a
tobacco-related disease, and incorporation of the second tobacco,
which has a reduced potential to contribute to a tobacco-related
disease, into a tobacco product. Tobacco products identified as
having a reduced potential to contribute to a tobacco-related
disease in accordance with the methods provided herein, which are
incorporated into a tobacco product, can be, for example, tobacco
products that are characterized by a lower induction of double
strand DNA breaks, lower level of inhibition of apoptosis, or lower
level of inhibition of cell proliferation. The following section
describes several methods for identifying a tobacco or tobacco
product that induces genetic damage.
[0097] Methods for Identifying a Tobacco that Induces Genetic
Damage
[0098] Provided herein are methods of identifying a tobacco that
induces genetic damage by providing a tobacco, obtaining a tobacco
composition from the tobacco, contacting a cell with the tobacco
composition, and identifying the presence or absence of damage of
cellular genetic material in the cell after contact with the
tobacco composition. In some embodiments, the methods provided
herein can be used to identify a tobacco that induces a
double-strand DNA break. In some embodiments, the tobacco
composition can be smoke or smoke condensate.
[0099] Also provided herein are methods of identifying a compound
in tobacco that induces damage of cellular genetic material by
providing a first tobacco, obtaining a tobacco composition from the
first tobacco, contacting a first population of cells with the
tobacco composition from the first tobacco, identifying the amount
of damage of cellular genetic material in the first population of
cells after contact with the tobacco composition from the first
tobacco, providing a second tobacco that has been modified to
reduce a compound in the second tobacco, obtaining a tobacco
composition from the second tobacco, contacting a second population
of cells with the tobacco composition from the second tobacco, and
identifying the amount of damage of cellular genetic material after
contact with the tobacco composition from the second tobacco, where
an identification of a reduction in the amount of damage of
cellular genetic material after contact with the tobacco
composition from the second tobacco identifies the compound as one
that induces the damage of cellular genetic material. In some
embodiments, the methods provided herein can be used to identify a
compound in tobacco that induces a double-strand DNA break. In some
embodiments, the tobacco composition can be smoke or smoke
condensate.
[0100] Also provided herein are methods of identifying a tobacco
product that has a reduced potential to contribute to a
tobacco-related disease by providing a first tobacco product,
obtaining a tobacco composition from the first tobacco product,
contacting a first population of cells with the tobacco composition
from the first tobacco product, identifying the amount of damage of
cellular genetic material in the first population of cells after
contact with the tobacco composition from the first tobacco
product, providing a second tobacco product, obtaining a tobacco
composition from the second tobacco product, contacting a second
population of cells with the tobacco composition from the second
tobacco product, and identifying the amount of damage of cellular
genetic material after contact with the tobacco composition from
the second tobacco product, where an identification of a reduction
in the amount of damage of cellular genetic material after contact
with the tobacco composition from the second tobacco product as
compared to the amount of damage of cellular genetic material after
contact with the tobacco composition from the first tobacco product
identifies the second tobacco product as one that has a reduced
potential to contribute to a tobacco-related disease. In some
embodiments, the second tobacco product has been modified to reduce
a compound in the second tobacco. In some embodiments, the second
tobacco product can be genetically modified to reduce the
expression of at least one gene that regulates production of the
compound. In some embodiments of the methods provided herein, the
amount of damage of cellular genetic material can be determined by
identifying the induction of double-strand DNA breaks. In some
embodiments, the tobacco composition can be smoke or smoke
condensate.
[0101] Also provided herein are methods of making a tobacco product
that has a reduced potential to contribute to a tobacco-related
disease by providing a first tobacco, obtaining a tobacco
composition from the first tobacco, contacting a first population
of cells with the tobacco composition from the first tobacco,
identifying the amount of damage of cellular genetic material in
the first population of cells after contact with the tobacco
composition from the first tobacco, providing a second tobacco,
obtaining a tobacco composition from the second tobacco, contacting
a second population of cells with the tobacco composition from the
second tobacco, identifying the amount of damage of cellular
genetic material after contact with the tobacco composition from
the second tobacco product, where an identification of a reduction
in the amount of damage of cellular genetic material after contact
with the tobacco composition from the second tobacco as compared to
the amount of damage of cellular genetic material after contact
with the tobacco composition from the first tobacco identifies the
second tobacco as one that has a reduced potential to contribute to
a tobacco-related disease, and incorporating the second tobacco,
which has a reduced potential to contribute to a tobacco-related
disease, into a tobacco product. In some embodiments, the second
tobacco has been modified to reduce a compound in the second
tobacco. In some embodiments, the second tobacco can be genetically
modified to reduce the expression of at least one gene that
regulates production of the compound. In some embodiments of the
methods provided herein, the amount of damage of cellular genetic
material can be determined by identifying the induction of
double-strand DNA breaks. In some embodiments, the tobacco
composition can be smoke or smoke condensate.
[0102] Also provided herein are methods, compositions and kits for
evaluating the ability of a tobacco-derived substance to produce
DSBs in chromosomal DNA. The presence of DSBs is detected using an
appropriate marker, which, in preferred embodiments of the
invention, is phosphorylated histone H2AX (also referred to herein
as ".gamma.H2AX"). The presence of DSBs also can be detected by
detecting (i) activation of one or more of the protein kinases that
are responsible for H2AX phosphorylation (e.g., ATM, ATR and/or
DNA-PK); (ii) appearance of nuclear foci that are induced by
histone H2AX phosphorylation; or (iii) activation of one or more
protein components of nuclear "foci" induced by H2AX
phosphorylation that are associated with DNA repair. The term
"activation" in regard to proteins activated by DSBs refers to a
chemical modification such as phosphorylation, acetylation,
ubiquitinylation or poly(ADP)ribosylation, and/or a change in
protein conformation, occurring in response to formation of DSBs.
Activated proteins can be detected, for example,
immunocytochemically.
[0103] Some of the assays provided concern methods of detecting,
quantifying, identifying and/or evaluating (e.g., for harmfulness)
a tobacco-derived substance in the course of research or in the
environment via its promotion of DSBs in the chromosomal DNA of a
test cell. A correlation with harmful potential is drawn based upon
the known relationship between DSBs and genetic mutations
(including cancer-causing and teratogenic mutations) as well as
cell damage and death.
[0104] Accordingly, one set of preferred embodiments provided
herein are methods of detecting a harmful tobacco-derived substance
comprising the steps of (a) exposing a test cell (or test cell
population) to a tobacco test composition; (b) measuring the degree
of H2AX phosphorylation in the test cell or cell population; and
(c) comparing the degree of H2AX phosphorylation determined in the
test cell or cell population to the degree of H2AX phosphorylation
in a control cell or control cell population; wherein a higher
degree of H2AX phosphorylation in the test cell compared to the
control cell indicates the presence of a harmful tobacco derived
substance in the tobacco test composition. The presence of DSBs
also can be detected by detecting (i) activation of one or more of
the protein kinases that are responsible for H2AX phosphorylation
(e.g., ATM, ATR and/or DNA-PK); (ii) appearance of nuclear foci
that are induced by histone H2AX phosphorylation; or (iii)
activation of one or more protein components of nuclear "foci"
induced by H2AX phosphorylation that are associated with DNA
repair.
[0105] Another set of non-limiting embodiments, provided herein
include methods for identifying one or more harmful components of
TS comprising the steps of: (a) exposing a first test cell
population to a first smoke product generated from a first tobacco
composition; (b) exposing a second test cell population to a second
smoke product generated from a second tobacco composition, wherein
the first and second smoke products are prepared using essentially
equivalent protocols; (c) measuring the degree of H2AX
phosphorylation in the first and second test cell populations; and
(d) comparing the degree of H2AX phosphorylation in the first and
second test cell populations; (e) identifying the tobacco
composition associated with a greater degree of H2AX
phosphorylation in steps (a)-(d); and (f) comparing the components
of the first and second tobacco composition to identify one or more
component present in the tobacco composition of step (e) but absent
in the other tobacco composition. Methods for detecting activation
of protein kinases such as ATM, ATR and/or DNA-PK as well as
formation of nuclear "foci" and protein components of the nuclear
foci can be performed according to the same steps. According to
such embodiments, the first tobacco composition can differ from the
second tobacco composition in its ingredients and/or in the way it
was processed. The information obtained by this method can be used
to develop a tobacco product that lacks or has lower levels of the
identified harmful component(s), which can render the product
lower-risk. Alternatively, the information can be used in an
environmental context: for example, air purifiers can be modified
to extract the harmful component from smoke-contaminated air.
[0106] Another set of non-limiting embodiments provided herein
concern methods for identifying one or more harmful components of
TS comprising the steps of: (a) exposing a first test cell
population to a first smoke product generated from a tobacco
composition; (b) exposing a second test cell population to a second
smoke product generated from the tobacco composition, wherein the
first and second smoke products are prepared differently; (c)
measuring the degree of H2AX phosphorylation in the first and
second test cell populations; (d) comparing the degree of H2AX
phosphorylation in the first and second test cell populations; and
(e) identifying the method of smoke product preparation associated
with a greater degree of H2AX phosphorylation in steps (a)-(d);
wherein the method of smoke product preparation identified in step
(e) has greater harmful potential. Methods for detecting activation
of protein kinases such as ATM, ATR and/or DNA-PK as well as
formation of nuclear "foci" and protein components of the nuclear
foci can be performed according to the same steps. In such
embodiments, the methods of smoke product preparation can differ in
the rate of combustion of the tobacco composition (including
whether the tobacco composition is burned or heated), or can differ
in the filtering of the smoke product (e.g., unfiltered, filtered
with a traditional filter, or filtered with a filter containing an
antioxidant), or can differ by other known methods of altering
tobacco smoke products. The components of the different smoke
products can be compared to identify one or more harmful
components. As above, the identification of a harmful component can
facilitate the development of lower-risk tobacco products and/or
environmental safeguards.
[0107] Also provided herein are methods for comparing the harmful
potentials of a first and a second tobacco composition comprising
the steps of: (a) exposing a first test cell population to a first
smoke product generated from the first tobacco composition; (b)
exposing a second test cell population to a second smoke product
generated from the second tobacco composition, wherein the first
and second smoke products are prepared using essentially equivalent
protocols; (c) measuring the degree of H2AX phosphorylation in the
first and second test cell populations; and (d) comparing the
degree of H2AX phosphorylation in the first and second test cell
populations; wherein the tobacco composition which generated the
smoke product that produced a higher degree of H2AX phosphorylation
has greater harmful potential. Methods for detecting activation of
protein kinases such as ATM, ATR and/or DNA-PK as well as formation
of nuclear "foci" and protein components of the nuclear foci can be
performed according to the same steps.
[0108] Accordingly, the methods provided herein include one or more
steps of determining whether damage of cellular genetic material
has occurred. Typically, such methods include assays for damage to
the genomic DNA of the cell. Any of a variety of methods known in
the art for assaying damage of cellular genetic material, such as
genomic DNA, can be used in the methods provided herein. Exemplary
known assays include assays for double-strand DNA breaks, assays
for single-strand DNA breaks, and assays for modulated properties
of DNA resultant from damage, such as assays for micronuclei and
assays for chromosome exchange. Assays for DNA breaks are known in
the art, as exemplified in U.S. Pat. Pub. No. 20040132004 and U.S.
Pat. No. 6,309,838, all of which are hereby expressly incorporated
by reference in their entireties.
[0109] In one example, the methods provided herein can include
detection of double-strand DNA breaks by detection of
phosphorylation of histone H2AX. Mammalian cells respond to agents
that introduce DNA double-stranded breaks with the immediate and
substantial phosphorylation of histone H2AX. While not wishing to
be bound to the following theory, which is only offered to explain
one possible mechanism, H2AX is thought to be involved in the
recognition of regions of chromatin containing a DNA
double-stranded break. Formation of the phosphorylated H2AX
protein, termed gamma-H2AX, can be detected as an indicator of DNA
double-stranded breaks. Known antibodies or antigenically-reactive
fragments thereof that specifically bind to a C-terminal
phosphorylated serine in an H2AX histone protein can be used for
the detection of gamma-H2AX, and, thus can be used to indicate the
presence of double stranded breaks in a cell. Thus, in the methods
provided herein, the presence or absence of DNA damage can be
detected by detecting the presence or absence of phosphorylation of
histone H2AX. For example, the presence or absence of
phosphorylation of histone H2AX can be identified with an antibody
or fragment thereof, which binds to phosphorylated H2AX but not
unphosphorylated H2AX. Antibodies and fragments thereof, and
related methods for selectively detecting gamma-H2AX, are known in
the art, as exemplified in U.S. Pat. Nos. 6,362,317 and 6,884,873,
all of which hereby expressly incorporated by reference in their
entireties.
[0110] In some embodiments provided herein, the methods include
assaying a cell for double-strand DNA breaks (DSBs). DSBs are
generated by a variety of genotoxic agents, and are among the most
critical lesions that lead either to apoptosis, mutations or the
loss of significant sections of chromosomal material. Detection of
DSBs upon cell exposure to a potential carcinogen, therefore,
provides the means to assess the potential hazard of the exposure
in terms of cancer induction. In one embodiment, a sensitive assay
of DSBs detection based on analysis of histone H2AX phosphorylation
can be used. Histone H2AX, a variant of a family of at least eight
protein species of the nucleosome core histone H2A, becomes
phosphorylated in live cells upon induction of DNA double strand
breaks (DSBs). The phosphorylation of H2AX on Ser 139 at sites
flanking the DSBs is carried out by ATM-, ATR-, and/or
DNA-dependent protein kinases (DNA-PKs). The phosphorylated form of
H2AX is denoted .gamma.H2AX.
[0111] The availability of antibodies to .gamma.H2AX allow for
immunocytochemical detection of DSBs. After induction of DSBs, the
appearance of .gamma.H2AX in chromatin manifests in the form of
discrete foci, each focus considered to represent a single DSB.
Checkpoint and DNA repair proteins such as Rad50, Rad51 and Brcal
co-localize with .gamma.H2AX. The intensity of .gamma.H2AX
immunofluorescence (IF) measured by cytometry was reported to
strongly correlate with the dose of ionizing radiation and thus
with the number of the induced DSBs. However, because untreated
cells, particularly cells replicating DNA, express .gamma.H2AX, to
obtain a stoichiometric relationship between DSBs and the intensity
of .gamma.H2AX IF, it is necessary to compensate for the extent of
this "programmed" H2AX phosphorylation. Following compensation, the
.gamma.H2AX IF measured by cytometry offers a sensitive and
convenient means to detect and measure DSBs in individual cells
following radiation. In fact, .gamma.H2AX IF can be a surrogate for
cell killing in viability assays of radiated cells.
[0112] .gamma.H2AX antibody ("Ab") in conjunction with
multiparameter flow- and laser scanning cytometry can be used in
assays of DSBs, to detect and measure their induction in
individual, live cancer cells exposed to antitumor drugs in vitro.
The intensity of .gamma.H2AX IF correlates well with the drug
concentration and duration of cell exposure to the drug, indicating
a relationship between the incidence of DSBs induced by these drugs
and .gamma.H2AX IF intensity. Multiparameter analysis of
.gamma.H2AX IF and cellular DNA content made it possible to relate
the abundance of DSBs (extent of DNA damage) to the position of the
cell in the cycle.
[0113] The ability of the tobacco-derived substance to promote the
formation of DSBs is measured using an appropriate DSB marker,
which is preferably .gamma.H2AX (phosphorylated histone H2AX), but
which can be another associated molecule, such as, but not limited
to, Rad50, Rad51 and Brcal, and other proteins that are
characteristic of nuclear "foci" formation. Formation of DSBs also
can be detected by detecting activate protein kinases associated
with DSBs such as ATM, ATR or DNA-PK. The presence of such markers
can be determined using a marker-specific antibody (or derivative
or fragment thereof), preferably an antibody (or fragment or
derivative thereof) specific for .gamma.H2AX, or an antibody (or
fragment or derivative thereof) specific for Rad50, Rad51 or Brcal,
or ATM, ATR or DNA-PK. The presence of such markers can be
determined using a marker-specific antibody (or derivative or
fragment thereof), preferably an antibody (or fragment or
derivative thereof) specific for a polypeptide encoded by a gene
provided in Tables 1 and 2. The genes provided in Table 1 encode
polypeptides that are involved in homologous recombination
processes in the cell, and these genes can be activated in response
to cellular damage of genetic material. Accordingly, detection of
one or more products of the genes of Table 1 can be indicative of
cellular damage of genetic material, for example, double-strand DNA
breaks. The genes provided in Table 2 encode polypeptides that are
involved in non-homologous nucleic acid end-joining processes in
the cell, and these genes can be activated in response to cellular
damage of genetic material. Accordingly, detection of one or more
products of the genes of Table 2 can be indicative of cellular
damage of genetic material, for example, double-strand DNA breaks.
Provided herein is an exemplary use of antibody directed to
.gamma.H2AX; analogous methods can be applied using antibodies
directed to Rad50, Rad51, Brcal, ATM, ATR or DNA-PK, or the
products of the genes listed in Tables 1 and 2. In preferred
non-limiting embodiments of the invention, antibody binding can be
detected by immunofluorescence-based techniques. Various antibodies
for Rad50, Rad51, Brcal, ATM, ATR, DNA-PK, and the products of the
genes listed in Tables 1 and 2 are known in the art and can be
readily obtained for use in accordance with the methods provided
herein; for example, Anti-phospho-ATM (Ser1981), is available from
Upstate USA as clone 10H11.E12. Such techniques can optionally be
used in conjunction with automated cytometry, such as, for example,
flow and/or laser scanning cytometry.
TABLE-US-00001 TABLE 1 Homologous recombination Top of Page RAD51
Homologous pairing 15q15.1 NM_002875 RAD51L1 Rad51 homolog 14q24.1
NM_002877 (RAD51B) RAD51C Rad51 homolog 17q23.2 NM_002876 RAD51L3
Rad51 homolog 17q12 NM_002878 (RAD51D) DMC1 Rad51 homolog, meiosis
22q13.1 NM_007068 XRCC2 DNA break and crosslink 7q36.1 NM_005431
XRCC3 repair XRCC2, XRCC3 14q32.33 NM_005432 RAD52 Accessory
factors for 12p13.33 NM_002879 RAD54L recombination RAD52, 1p34.1
NM_003579 RAD54B RAD54L, RAD54B 8q22.1 NM_012415 BRCA1 Accessory
factor for 17q21.31 NM_007295 transcription and recombination, E3
Ubiquitin ligase BRCA2 Cooperation with RAD51, 13q13.1 NM_000059
essential function SHFM1 (DSS1) BRCA2 associated 7q21.3 NM_006304
RAD50 ATPase in complex with 5q23.3 NM_005732 MRE11A, NBS1 MRE11A
3' exonuclease 11q21 NM_005590 NBS1 Mutated in Nijmegen 8q21.3
NM_002485 breakage syndrome MUS81 A structure-specific 11q13.1
NM_025128 EME1 (MMS4L) DNA nuclease 17q21.33 NM_152463 MUS81,
MMS4
TABLE-US-00002 TABLE 2 Non-homologous end-joining G22P1 (Ku70)
22q13.2 NM_001469 XRCC5 (Ku80) 2q35 NM_021141 PRKDC 8q11.21
NM_006904 LIG4 13q33.3 NM_002312 XRCC4 5q14.2 NM_003401 DCLRE1C
(Artemis) 10p13 NM_022487
[0114] The term "immunofluorescence-based techniques" or
"immunocytochemical-based techniques" encompasses various forms of
such assays, as are known in the art. For example, and not by way
of limitation, an immunofluorescence-based technique can use an
unlabelled primary antibody and a fluorescently labeled secondary
antibody (as illustrated, for example, in Example 1); or can use a
primary antibody that carries a fluorescent tag to detect the
phosphorylated H2AX molecule directly; or the primary antibody can
carry a biotin molecule while the secondary antibody can carry both
an avidin molecule (which binds specifically to biotin) and a
fluorescence molecule. In the biotin/avidin approach, the binding
of the secondary antibody is based on binding of biotin by avidin
rather than the binding of an antibody of one species directed
against a protein of another species. Other variations of such
techniques that would be known to the skilled artisan as
"immunfluorescence-based techniques" or "immunocytochemical-based
techniques" can be used according to the invention. Likewise,
detection can be made using analogous methods that utilize a
modality other than fluorescence, such as chromogenic or
colorimetric assays, radiologic assays, and so forth.
[0115] Techniques such as immunocytochemical-based techniques can
be used in conjunction with methods for counting cells, sorting
cells, or other method for further characterizing cells. Exemplary
methods include, but are not limited to, flow cytometry, laser
scanning cytometry, fluorescence image analysis, chromogenic
product imaging, fluorescence microscopy or transmission
microscopy.
[0116] The "degree of phosphorylation of H2AX" as used herein
refers to the relative, rather than absolute, amount of
.gamma.H2AX. This is because .gamma.H2AX is produced during normal
progression of the cell cycle. As discussed in Example 1, allowance
can be made for normally occurring phosphorylation of H2AX. For
example, the data can preferably be subjected to two normalization
processes. First, allowance can be made for the normally occurring
"programmed" phosphorylation of H2AX. Second, correction can be
made for the fact that histone content is exactly doubled over the
course of a cell cycle, doubling the size of the target (histone).
In a specific non-limiting embodiment, a data value from cells with
twice the DNA content (e.g., G.sub.2 and mitotic cells) with twice
the histone target can be divided by 2 while a data value from
cells in S phase having an intermediate in histone content can be
divided by 1.5. In this manner, the amount of .gamma.H2AX detected
beyond what occurs in an untreated control cell or cell population
is normalized to a unit of histone so that one can refer to the
"degree of histone H2AX phosphorylation" on a per unit of histone
basis.
[0117] In another example, the methods provided herein can include
detection of DNA breaks and other forms of genomic damage by Comet
assay. Comet assay can be used to detect damaged DNA pulled from
the nucleus of cells exposed to an electric field. Comet assay is a
fluorescent microscopic method to examine DNA damage and repair at
individual cell level. For example, cells can be embedded in
agarose on a microscope slide and lysed with detergent and high
salt to form nucleoids containing supercoiled loops of DNA linked
to the nuclear matrix, and electrophoresis at high pH can result in
structures resembling comets, observed by fluorescence microscopy.
The intensity of the comet tail relative to the head reflects the
number of DNA breaks. This assay can be used for detecting various
forms of DNA damage (e.g., single- and double-strand breaks,
oxidative DNA base damage, and DNA-DNA/DNA-protein/DNA-Drug
cross-linking) and DNA repair in many eukaryotic cell types. Comet
assay not only provides an estimate of how much damage is present
in cells, but what form it takes. Although it is primarily a method
for measuring DNA breaks, modifications of the methods, for
example, by introducing lesion-specific endonucleases, allows
detection of, for example, pyrimidine dimers, oxidized bases, and
alkylation damage. Thus, in the methods provided herein, the
presence or absence of DNA damage can identified by, for example,
detecting the presence or absence of comet-like nuclei in cells.
Various methods for performing Comet assays are known in the art,
as exemplified in Collins, (2004) Mol. Biotechnology 26:249-261,
Tice, et al. (2000) Environ. Mol. Mutagen. 35:206-221 and Gichner
et al. (2004) Mutation Res. 559:49-57, all of which are hereby
expressly incorporated by reference in their entireties.
[0118] In another example, the methods provided herein can include
detection of double-strand DNA breaks by TUNEL assay. TUNEL assay
can be used to measure double-strand breaks by incorporation of
labeled nucleotides at the site of double-strand breaks using
terminal transferase. The labeled nucleotides can then be detected
with antibodies. TUNEL assay is frequently used to detect
apoptosis-induced DNA fragmentation through a quantitative
fluorescence assay. In one exemplary protocol, terminal
deoxynucleotidyl transferase (TdT) catalyzes the incorporation of
bromo-deoxyuridine (BrdU) residues into the fragmenting nuclear DNA
at the 3'-hydroxyl ends by nicked end labeling. A TRITC-conjugated
anti-BrdU antibody can then label the 3'-hydroxyl ends for
detection. The TUNEL assay distinguishes two populations of cells:
non-apoptotic cells (TUNEL-negative) and apoptotic cells
(TUNEL-positive). Thus, in the methods provided herein, the
presence or absence of DNA damage can identified by, for example,
detecting the presence or absence of labeled nucleotides at the
site of double-strand breaks, incorporated by, for example,
terminal transferase. A variety of methods of performing TUNEL
assays is known in the art, as exemplified in Doolin et al., J. Bum
Care Rehabil. 20: 374-376, 1999; Kalyuzhny (2002) Methods Mol.
Biol. 203:219-34; Lawry, Methods Mol. Med. (2004) 88:183-90; U.S.
Pat. No. 6,506,609 and U.S. Pat. Pub. No. 20030017462, all of which
are hereby expressly incorporated by reference in their
entireties.
[0119] In another example, the methods provided herein can include
detection of double-strand DNA breaks by sister chromatid exchange
assay. Sister chromatid exchange assays detect late damage when
genetic material is exchanged between sister chromatids. Sister
chromatid exchange refers to a reciprocal interchange of the two
chromatid arms within a single chromosome. This exchange can be
visualized during the metaphase portion of the cell cycle and can
be mediated by the enzymatic incision, translocation and ligation
of at least two DNA helices. Thus, in the methods provided herein,
the presence or absence of DNA damage can identified by, for
example, detecting the presence or absence of interchange of
chromatid arms within a single chromosome by, for example, sister
chromatid exchange assay. A variety of methods for performing
sister chromatid exchange assays are known in the art, as
exemplified in 40 C.F.R. .sctn.79.65, 40 C.F.R. .sctn.798.5915,
Renqing et al., (2000) Toxicology Letters 115:23-32, Deen et al.
and Cancer Res. (1986) 46:1599-602, all of which are hereby
expressly incorporated by reference in their entireties.
[0120] In another example, the methods provided herein can include
detection of double-strand DNA breaks by micronuclei assays.
Micronuclei assays can be used to detect late damage occurring
after cells attempt to divide so that non-centromeric DNA forms as
micronuclei in daughter cells. The test is based on the observation
that a secondary nucleus (micronucleus) is formed around a
chromosomal fragment, outside the main nucleus of a dividing cell.
A micronucleus may also be produced due to a lagging whole
chromosome formed as a result of a chromosome loss at anaphase.
Thus, in the methods provided herein, the presence or absence of
micronuclei can be identified. Micronuclei can be detected by
microscopic methods, flow cytometric methods and automated image
recognition methods, as known in the art and exemplified in Offer
et al., FASEB J. (2005) 19:485-7; Smolewski et al., Cytometry
(2001) 45:19-26; Driessens et al., Ann N Y Acad Sci. (2003)
1010:775-9; and U.S. Pat. Pub. No. 20050002552, all of which are
hereby expressly incorporated by reference in their entireties.
[0121] In another example, the methods provided herein can include
detection of chromosomal translocations. Chromosomal translocations
can occur as a result of DNA damage. Methods for detecting
chromosomal translocations can include fluorescence in situ
hybridization methods (FISH), in which probe hybridization patterns
in cells containing chromosomal translocation are altered relative
to wild type. Thus, in the methods provided herein, the presence or
absence of DNA damage can identified by, for example, detecting the
presence or absence of chromosomal translocations by, for example,
FISH. Methods for detecting chromosomal translocations are known in
the art, as exemplified by U.S. Pat. Nos. 5,997,869, 6,576,421, and
6,416,948, and U.S. Pat. Pub. Nos. 20040235039 and 20020192692, all
of which are hereby expressly incorporated by reference in their
entireties.
[0122] Working Example 1 herein provides one non-limiting specific
example of the DSB detection methods and materials. Variations of
the assay method used in terms of materials, assay times,
instrumentation and protocols would be apparent to the skilled
artisan for detecting and/or quantifying DSBs, for example via
.gamma.H2AX.
Example 1
Preparation of Cigarette Smoke Condensates
[0123] Smoke was generated from a commercially available nationally
sold brand of American cigarettes (non-menthol, full-flavor type
with averaged FTC measured values of 14.5 mg tar/1.04 mg nicotine)
using an INBIFO-Condor smoking machine under Federal Trade
Commission (FTC) smoking parameters (2.0 second puff duration 35
milliliter puff every 60 seconds). The cigarettes had been
equilibrated at 23.9.degree. C..+-.1.1.degree. C. and 60%.+-.2%
relative humidity for a minimum of 24 hours and a maximum of 14
days. CSC was collected from the smoke via a series of three cold
traps (-10.degree. C., -40.degree. C., and -70.degree. C.) onto
impingers filled with glass beads. The smoke condensate was
dissolved in acetone, which was then removed by rotary evaporation
at 35.degree. C. The resulting smoke condensate was weighed and
dissolved in dimethylsulfoxide (DMSO) to make a stock solution at a
concentration of 20 mg/mL, which was stored at -20.degree. C. prior
to use.
[0124] NHBE Cell Culture and Smoke Condensate Treatment
[0125] NHBE cells were purchased from Cambrex Corporation, East
Rutherford, N.J. The cells were cultured in complete Bronchial
Epithelial Cell Growth Medium (BEGM), prepared by supplementing
Bronchial Epithelial Basal Medium with retinoic acid, human
epidermal growth factor, epinephrine, transferrin,
triiodothyronine, insulin, hydrocortisone, bovine pituitary extract
and gentamicin by addition of SingleQuots,.TM. (both medium and the
supplements were purchased from Cambrex Corporation, East
Rutherford, N.J.). Dual-chambered slides (Nunc Lab-Tek II, Fisher
Scientific, Pittsburgh, Pa.) were seeded with 1 ml of
8.times.10.sup.4 cells/ml cell suspension per chamber. All
incubations were at 37.degree. C. in a humidified atmosphere of 5%
CO.sub.2 in air. Cells were grown to 50% confluency, at which time
they were treated with medium containing smoke condensate.
Appropriate dilutions of the 20 mg/ml smoke condensate in DMSO
stock solution were used to prepare culture medium containing 10,
25, or 50 .mu.g/mL smoke condensate. The final DMSO concentration
was 0.5%. Cells were treated by carefully aspirating the culture
medium from each chamber and replacing it with 1 ml per chamber of
smoke condensate-containing medium at 37.degree. C. For control
slides, the medium was replaced with 1 mL of either fresh medium
(mock-treated control) or medium containing 0.5% DMSO (vehicle
control). Slides were immediately returned to the incubator for up
to 24 hours. At the end of the treatment, medium from each chamber
was carefully aspirated and 1 ml of 1% fresh paraformaldehyde in
1.times. Dulbecco's PBS was added to each chamber and the cells
fixed by gently rocking the slides at room temperature for 15
minutes. Following aspiration of the fixative, the chamber slides
were disassembled and the slides submerged in 50 ml conical tubes
filled with 70% ethanol. The fixed slides were stored at 4.degree.
C. prior to analysis.
[0126] A549 Cell Culture and Smoke Treatment
[0127] A549 cells were purchased from American Type Culture
Collection (ATCC #CCL-185, Manassas, Va.). The cells were cultured
in Ham's F12K medium with 2 mM L-glutamine adjusted to contain 1.5
g/L sodium bicarbonate (ATCC, Manassas, Va.) and supplemented with
10% fetal bovine serum (ATCC, Manassas, Va.). Dual-chambered slides
(Nunc Lab-Tek II) were seeded with 1 ml of 10.sup.5 cells/ml cell
suspension per chamber 48 hours before exposure. All incubations
were at 37.degree. C. in a humidified atmosphere of 5% CO.sub.2 in
air. Cells were grown to 70% confluency, at which time they were
treated with smoke. The cell culture medium was replaced with
37.degree. C. Dulbecco's PBS (D-PBS) containing calcium and
magnesium (Sigma, St. Louis, Mo.) for the smoke exposure. Slide
chamber covers were removed and the slides were placed in a smoke
exposure chamber (20.6 cm.times.6.7 cm.times.6.3
cm--L.times.W.times.H). Smoke was generated from IM16 (Industry
Monitor #16, Philip-Morris, Richmond Va.) cigarettes under FTC
smoking conditions using a KC 5 Port Smoker (KC Automation,
Richmond, Va.). The smoke was diluted by drawing it through a 250
mL round-bottom flask prior to its reaching the exposure chamber.
The time and distance that the smoke traveled from the end of the
cigarette to the exposure chamber was minimized by using the
shortest lengths of tubing possible between the parts of the
apparatus. Cigarettes were smoked to within 3 mm of the filter tip.
Cells were exposed to smoke for up to 40 minutes. Mock-exposed
(control) cells were treated under identical conditions as the
exposed cells except for the absence of a cigarette in the smoking
port. They were mock-exposed for 10 minutes. Following treatment or
mock treatment, the D-PBS was aspirated and replaced with 1 ml per
chamber of fresh culture medium at 37.degree. C. The slides were
placed in the 37.degree. C., 5% CO.sub.2 incubator and incubated
for 15 minutes. Following incubation, the medium was aspirated and
the cells fixed as described above for the NHBE experiment.
[0128] Immunocytochemical Detection of Phosphorylated Histone H2AX
and caspase-3 Activation
[0129] Cells were treated with smoke (i.e., A549) or smoke
condensate (i.e., NHBE) and fixed as described above, then rinsed
twice in PBS and immersed in 0.2% Triton X-100 (Sigma) in a
solution of 1% (w/v) bovine serum albumin (BSA; Sigma) in PBS for
30 min to suppress non-specific antibody binding. The cells were
then incubated in 100 .mu.l volume of 1% BSA containing 1:200
dilution of anti-phosphorylated histone H2AX (.gamma.-H2AX) rabbit
polyclonal Ab (Trevigen, Gaithersburg, Md.). After overnight
incubation at 4.degree. C., the slides were washed twice with PBS
and then incubated in 100 .mu.l of 1:200 dilution of Alexa Fluor
488 goat anti-rabbit IgG (H+L) (Molecular Probes, Eugene, Oreg.)
for 45 min at room temperature in the dark. Parallel samples were
incubated with 1:100 diluted anti-cleaved (activated) caspase-3
rabbit polyclonal Ab (Cell Signaling Technology, Beverly, MA)
overnight at 4.degree. C., washed twice with PBS and incubated with
1:30 diluted FITC-conjugated F(ab')2 fragment of swine anti-rabbit
immunoglobulin (DAKO, Carpinteria, Calif.) for 30 min in room
temperature in the dark. The cells were then counterstained with 1
.mu.g/ml 4,6-diamidino-2-phenylindole (DAPI, Molecular Probes,
Eugene, Oreg.) in PBS for 5 min. Each experiment was performed with
an IgG control in which cells were labeled only with secondary
antibody, Alexa Fluor 488 goat anti-rabbit IgG (H+L) or
FITC-conjugated F(ab')2 fragment of goat anti-mouse
immunoglobulins, without primary antibody incubation to estimate
the extent of nonspecific binding of the secondary antibody to the
cells.
[0130] Measurement of Cell Fluorescence by Laser Scanning
Cytometry
[0131] Cellular green (phosphorylated histone H2AX and cleaved
caspase 3), and blue (DNA-bound DAPI) fluorescence emission was
measured using a Laser Scanning Cytometer (LSC; CompuCyte,
Cambridge, Mass.), utilizing standard filter settings; fluorescence
was excited with 488-nm argon ion and violet diode lasers,
respectively. The intensities of maximal pixel and integrated
fluorescence were measured and recorded for each cell. At least
3,000 cells were measured per sample.
[0132] Statistical Analysis
[0133] To compare the changes in immunofluorescence intensity, the
mean fluorescence intensity (integral values of individual cells)
was calculated for cells in each phase of the cycle by gating
G.sub.1, S and G.sub.2/M cells based on differences in DNA content.
The means of the fluorescence value for G.sub.1, S and G.sub.2/M
populations of cells in the IgG control groups were then subtracted
from the respective means of the smoke condensate or smoke-treated
cells. All experiments were run under identical instrument
settings. Data is presented as mean .gamma.H2AX fluorescence of
each cell cycle compartment or where not indicated, of the entire
population (G.sub.1, S and G.sub.2M). Each experiment was run in
duplicate or triplicate. All experiments were repeated at least
three times.
[0134] Exposure of A549 cells to TS induces H2AX phosphorylation,
which can be detected immunocytochemically (FIG. 1). Though the
intensity of green .gamma.H2AX IF varies from cell to cell, its
distribution is nuclear and punctate. Mock-treated cells have
minimal, but still detectable levels of .gamma.H2AX IF.
[0135] FIG. 2 illustrates the raw data in the form of scattergrams
of the A549 cells untreated (0 time) and exposed to TS for 30 min.
A scattergram representing cells immunostained with an irrelevant
isotype control IgG is also included in the figure. The intensity
of fluorescence of the mock-exposed cells is distinctly higher than
that of the isotype control. This is a reflection of the
"programmed" phosphorylation of H2AX, known to occur during normal
progression through the cell cycle. Exposure of A549 cells to
smoke, in this instance, markedly increased cellular .gamma.H2AX
IF. The increase, however, was proportional for the cells in each
phase of the cell cycle.
[0136] As noted above, the mean "programmed" H2AX IF was subtracted
from the mean .gamma.H2AX IF of the cells exposed to either smoke
or smoke condensate, separately for cells in each phase of the cell
cycle, for each data-point shown in the FIGS. 3 and 4. In addition,
since the amount of histone doubles as cells proceed from G.sub.1
to G.sub.2 phase, .gamma.H2AX IF was normalized to DNA/histone
content by dividing the mean .gamma.H2AX IF of the S and G.sub.2M
phase cells by 1.5 and 2, respectively. The normalized data,
therefore, does not represent the total amount of phosphorylated
H2AX per cells but rather the degree of H2AX phosphorylation,
independent of the increase in total H2AX IF that occurs during
progression through S.
[0137] During the initial 10 min exposure of A549 cells to smoke,
no change in .gamma.H2AX IF was apparent (FIG. 3). However, between
10 and 20 min exposure to smoke, .gamma.H2AX IF increased by 71%,
67.5% and 45.7% for G.sub.1, S and G.sub.2M phase cells,
respectively. An additional 10 min of exposure to smoke (30 min in
total) resulted in an additional increase in .gamma.H2AX IF
compared to mock-exposed cells: 151.2%, 132.2% and 109.3% for
G.sub.1, S or G.sub.2M phase cells.
[0138] The plots shown in FIG. 4 display the increase in the level
of H2AX phosphorylation as a function of length of exposure of NHBE
cells to 10, 25 or 50 .mu.g/ml concentrations of smoke condensate.
At each concentration, the maximal rate of increase in H2AX IF was
seen during the initial 4 h of cell treatment. However, whereas at
10 and 25 .mu.g/ml of smoke condensate the peak of H2AX
phosphorylation occurred at 4 h, followed by a plateau up to 24 h,
at a smoke condensate concentration of 50 .mu.g/H2AX
phosphorylation increased during the entire 24 h time course of the
experiment. No cell cycle phase specificity was apparent in H2AX
phosphorylation when cells were exposed to 10 .mu.g/ml smoke
condensate (FIG. 5). The same was true for these cells exposed to
25 or 50
[0139] Activation of caspase-3 was measured in samples parallel to
those that were subjected to analysis of H2AX phosphorylation, by
detecting the presence of activated caspase-3 immunocytochemically.
Exposure of A549 cells to smoke for up to 40 min followed by their
fixation at 15 minutes had no effect on caspase-3 activation: less
than 0.5% of the cells demonstrated the presence of activated
caspase-3 in either mock-exposed or smoke treated cultures (Table
3). Caspase-3 activation could be shown, however, if A549 cells
exposed to smoke for 20 min were allowed to grow in culture for an
extended period of time (24 h) at which point virtually half the
cells were positive for activated caspase-3 (Table 1).
TABLE-US-00003 TABLE 3 Effect of Smoke on Caspase-3 Activation
Exposure to smoke Time in culture following % Caspase-3 (min)
exposure (h) positive cells (%)* 0 0.25 0.1 10 0.25 0.4 20 0.25 0.1
30 0.25 0.4 40 0.25 0.1 0 24 0.2 20 24 49.9 *Caspase-3 positive
cells were detected immunocytochemically, as described
elsewhere.
[0140] The present results demonstrate that exposure of A549 cells
to TS or NHBE cells to TSC induces phosphorylation of H2AX. The
extent of H2AX phosphorylation is concentration-dependent. It also
correlated with the duration of exposure. In the case of NHBE
cells, while at lower smoke condensate concentrations (10 and 25
.mu.g/ml), a plateau is achieved after 4 h, at 50 .mu.g/ml
concentration, progressive phosphorylation continues for up to 24
h. H2AX phosphorylation in the A549 cells exposed to smoke also
progresses with time of exposure, although it appears to plateau
after 30 min. Phosphorylation of H2AX is a specific marker of
induction of DSBs; the present data indicate that TS and TSC both
induce such breaks in A549 cells and NHBE cells in a dose and time
dependent manner.
[0141] It should be noted that H2AX is intensely phosphorylated in
response to DNA fragmentation that occurs upon induction of
apoptosis. Caspase activation, however, is required to trigger
apoptosis-related DNA fragmentation. In fact, inhibition of
caspase-3 activity (e.g. by z-VAD-FMK) can prevent the
apoptosis-associated H2AX phosphorylation. In the present study, no
caspase-3 activation was detected in the cells exposed for up to 40
min to smoke (Table 3). Thus, apoptosis-associated phosphorylation
of H2AX did not contribute to the .gamma.H2AX IF measured in A549
cells exposed to smoke for up to 40 min, when the cells were
collected within 15 min of exposure.
[0142] The present assay provides quantitative results.
Specifically, the number of H2AX phosphorylation foci is considered
to correspond to the number of DSBs. Assuming that the individual
foci have comparable intensity of IF, the integrated value H2AX IF,
as presently measured, would be expected to correspond to the
number of foci, hence, to the number of DSBs. Furthermore, the mean
.gamma.H2AX IF of the mock-exposed cells was subtracted from each
mean of cells exposed to smoke or smoke condensate, to ensure that
the measurement was not affected by the level of "programmed" H2AX
phosphorylation in these cells (see FIG. 2). Though not applicable
in the present instance in which the time between exposure to smoke
or smoke condensate and harvesting of the cells was relatively
short (55 min or less), a phosphatase inhibitor such as calyculin A
or okadaic acid can be included in the culture to prevent possible
dephosphorylation of H2AX molecules. The data presented in the
plots, therefore, represent the smoke-induced differential
.gamma.H2AX IF. Furthermore, since the H2AX content increases as
cells traverse through S phase, the mean values .gamma.H2AX IF for
S and G.sub.2/M cells were compensated for the H2AX increase. The
intensity of .gamma.H2AX IF so compensated, thus, reflects the
degree of H2AX phosphorylation in the cell, i.e. is unrelated to
H2AX content.
[0143] There is little evidence that CS and specific smoke
constituents can cause single strand breaks (SSBs) in the normal
human genome 40-45, but no evidence for the induction of DSBs. DSBs
are among the most deleterious types of DNA damage in mammalian
cells. A cell that incurs DSBs is at major risk for developing
genomic instability, which can result in an array of specific
defects such as chromosome fragmentation, translocation,
rearrangement and loss. More importantly, each of these chromosomal
abnormalities can play a pivotal role in the etiology or
progression of a wide range of human cancers. Consequently, in
order to ensure the faithful repair of DSBs and maintain genomic
integrity, the cell has evolved sensitive DNA damage-activated
checkpoint control pathways that are coupled to an interconnected
web of efficient repair mechanisms, the most prominent of which are
homologous recombination and non-homologous end joining.
Individuals who either have debilitating alterations or deletions
of the genes involved in detecting and repairing DSBs tend to
manifest the dual syndromes of chromosome instability and higher
incidence of various cancers. Clearly, therefore, the induction of
DSBs by an exogenous agent like TS can be a potentially hazardous
genetic event in the long-term smoker. In particular, if overall
repair efficiencies of DSBs are not as efficient as for other types
of DNA damage, e.g., single strand breaks (SSBs), and/or if an
individual smoker has specific polymorphisms in the relevant genes
that reduce their effectiveness, then cells chronically exposed to
TS can manifest the genetically dangerous combination of increased
levels of DSBs and compromised repair capacities. Furthermore, in
addition to DSB level and repair capacity, the genomic positioning
of DSBs can be another factor that determines how successfully a
cell responds to this type of damage. For example, the probability
that a DSB break is inaccurately rejoined is relatively low when
DSBs are spatially separated but increases considerably when
multiple breaks coincide.
[0144] The successful repair of DSBs appears also to depend on cell
cycle position. The data, however, show no obvious cell cycle
specificity in terms of accumulation of DSBs. Thus, if
proliferating cells exposed to TS experience similar levels of DSBs
during each phase of the cell cycle but dissimilar repair rates,
they can be particularly susceptible to accumulating deleterious
DNA defects during that specific phase. It is relevant to point out
that although the rates of DSB induction and repair in noncycling
cells, which are one of the initial primary target cells in lungs
exposed to CS, can be different than in cycling cells, the lungs of
persistent smokers undergo a significant increase in the number of
proliferating cells due to smoke-induced damage. Moreover, cells
actively dividing at the time of carcinogen exposure are at
particular risk for transformation-related events.
[0145] The methods of identifying a tobacco, identifying a compound
in tobacco, identifying a tobacco product, and making a tobacco
product provided herein, can additionally be used to compare two or
more tobaccos so as to identify a toxic compound, evaluate the
potential risk posed by the tobacco products, or to develop reduced
risk tobacco products. In some embodiments, the two or more
tobaccos are compared for their ability to induce damage to the
genetic material of cells. In some embodiments, at least one
tobacco is a reduced risk tobacco or identified as a reduced risk
tobacco. In some embodiments, at least one tobacco is a modified
tobacco, such as a chemically modified tobacco or a genetically
modified tobacco.
[0146] Working Example 2 herein provides one non-limiting specific
example of methods for comparing tobaccos in accordance with the
methods provided herein. Variations of the assay method used in
terms of assay methodologies (e.g., assay for apoptosis or for cell
proliferation) would be apparent to the skilled artisan for
comparing tobaccos.
Example 2
[0147] A549 cells were exposed to whole smoke from IM 16 cigarettes
for various lengths of time, washed and allowed to grow for an
additional hour before being harvested for analysis. DNA damage was
identified as an increase in phosphorylation of histone H2AX
denoted as .gamma.H2AX.
[0148] In order to compare DNA damage as a function of the cell's
position in the cell cycle, .gamma.H2AX values were normalized to
DNA content since histone content doubles as cells proceed from
G.sub.1 to G.sub.2 phase. Thus, in order to determine any change in
histone H2AX phosphorylation independent of changes in histone/DNA
content or DNA ploidy, the values for S and G.sub.2M phase
populations, gated according to DNA content, were multiplied by
0.75 and 0.5, respectively. In instances where "normalized" values
of .gamma.H2AX are presented, these values were obtained by
subtracting the mean values of each cell cycle population (or the
total population) from the mean of the mock-treated population
whose .gamma.H2AX values represent "scheduled" .gamma.H2AX
expression. In all instances, the values presented represent the
mean .gamma.H2AX fluorescence of the population; typically
3-5.times.10.sup.3 cells were analyzed for each condition.
[0149] As illustrated in FIG. 6, there was little or no change in
.gamma.H2AX when exposure of A549 cells to whole smoke was limited
to 5 min. However, as the time of exposure exceeded 5 min there was
a more or less linear increase in .gamma.H2AX. Initially, S phase
cells appeared most sensitive to DNA damage expressing
approximately 37% higher levels of .gamma.H2AX than G.sub.1 phase
cells following 10 min of exposure to smoke. When the length of
exposure was increased to 20 min, G.sub.1 phase cells invariably
expressed 10-20% higher levels of .gamma.H2AX-associated
fluorescence.
[0150] In another set of experiments it was determined that the
extent of DNA damage varied with the length of time of recovery
following exposure to whole smoke. Previous studies have shown that
following exposure to whole smoke for times in excess of 20 min
leads to a significant increase in apoptotic cells in the
population depending upon when the assay is performed. Apoptotic
cells contained significantly increased levels .gamma.H2AX compared
to what one sees when assessing the primary breaks due to DNA
damaging agents. Based on the absence of activation of caspase 3,
there is little or no induction of apoptosis in A549 cells within
the first 3 h following 20 min exposure to whole smoke from IM
16.
[0151] Within 15 min of exposure to whole smoke, A549 cells already
displayed a dramatic increase in .gamma.H2AX (FIG. 7A). Increasing
the recovery time following exposure led to continued increase in
DNA damage. As noted above, G.sub.1 cells appear to be the most
sensitive to smoke especially when the cells are harvested 30 min
or longer after exposure to whole smoke. The relative increase in
.gamma.H2AX following 60 min of recovery is illustrated in FIG. 7B
where it can be observed that virtually all cells express levels of
.gamma.H2AX in excess to mock-treated cells (e.g., are above the
dotted line).
[0152] The response of NHBE cells to whole smoke from IM 16
cigarettes was more or less identical to that observed for A549
cells (FIG. 7C). The one difference between the two cell lines was
that S phase cells in NHBE cultures always expressed higher
"scheduled" amounts of .gamma.H2AX. Nevertheless, as with A549
cells, G.sub.1 cells are the most sensitive to smoke-induced DNA
damage in these cultures. FIG. 7D demonstrates both the increased
basal level of .gamma.H2AX in mock-treated cultures and the
extensive increase in .gamma.H2AX expression observed 60 min
following a 20 min exposure to whole smoke.
[0153] In the next series of experiments, the DNA damage caused by
whole smoke from different sources was compared. Using an exposure
time of 20 min, damage due to whole smoke from two other cigarettes
could be compared to that caused by IM 16 following various
recovery times. The curves of .gamma.H2AX following exposure of
A549 cells to IM 16 (FIG. 8, top right) were comparable to that
displayed in FIG. 7A. Exposure of the same cells to whole smoke
from Quest 3.RTM. on the other hand resulted in an initial increase
in .gamma.H2AX at 30 min that returned to near background levels
when assayed after longer recovery times (FIG. 8, bottom left).
Whole smoke from Omni.RTM. cigarettes caused damage intermediate
between that of Quest 3.RTM. and IM 16 (FIG. 8, bottom right). The
DNA damage caused by Omni.RTM. increased until 60 min after which
it more or less plateaued. Smoke from Quest 3.RTM. cigarettes
affects S phase cells to a greater extent than any other phase
while G.sub.1 cells are invariably most sensitive to smoke from IM
16 and Omni.RTM.. Importantly, these data demonstrate that tobacco
products containing modified tobacco (i.e., Omni.RTM. and Quest
3.RTM.) induced less DNA damage than a reference tobacco product
(i.e., IM16). Accordingly, the modified tobacco products Omni.RTM.,
and Quest 3.RTM. have a reduced potential to contribute to a
tobacco related disease (i.e., Omni.RTM., and Quest 3.RTM. are
reduced risk tobacco products) according to the double strand break
assay.
[0154] In the next series of experiments, it was determined that
DNA damage caused by whole smoke can be mitigated by the presence
of NAC. Using a standardized set of conditions (20 min of exposure
followed by a 1 h recovery), DNA damage caused by whole smoke from
IM 16 cigarettes was assayed in both A549 and NHBE cells. NAC at a
concentration of 25 mM was either absent or present during exposure
and absent or present during the 1 h recovery time. In this
instance, the background or "scheduled" .gamma.H2AX expression
observed in Mock-treated cells was subtracted from each
measurement. The remaining fluorescence should be indicative of the
level of DNA DSBs under each set of conditions.
[0155] In A549 cells (FIG. 9, top), IM 16 caused a dramatic
increase in H2AX phosphorylation in the absence of NAC (PBS, PBS).
Applying NAC to the media following exposure to smoke did nothing
to mitigate the DNA damage caused by whole smoke. However, if NAC
was present during exposure to smoke, DNA damage was suppressed by
greater than 80% for the entire population; the suppression was
greatest for G.sub.1 cells (91%), intermediate for G.sub.2M (88%)
and least for S (82%) phase cells. The presence of NAC both during
exposure to smoke and during the 1 h recovery period provided
slightly more protection increasing suppression of .gamma.H2AX to
90% for the entire population.
[0156] As with A549 cells, when NHBE cells were exposed to whole
smoke form IM 16 cigarettes, the cells in G.sub.1 phase were the
most sensitive. However, since the S phase cells express somewhat
higher levels of "scheduled" .gamma.H2AX and are not as sensitive
as G.sub.1 cells to smoke (FIG. 7C), the value for S phase cell DNA
damage was considerably less than for cells in G.sub.1 or G.sub.2M
phase (FIG. 9, bottom). Addition of NAC only during recovery had
little effect on the level of DNA damage induced by whole smoke.
NAC present during exposure diminished the damage observed in
G.sub.1 cells by nearly 69%; the decrease was about 65% for
G.sub.2M cells but S phase cells were afforded no protection. NAC
present both during exposure and recovery provided a small degree
of additional protection.
[0157] Next, the effect of NAC on DNA damage caused by whole smoke
from various sources was evaluated. A549 cells were exposed to
smoke from IM 16, Omni.RTM. and Quest 3.RTM. cigarettes in the
presence and absence of NAC during exposure. As illustrated in FIG.
10, NAC dramatically reduced the effects of smoke from IM 16 cells.
Omni.RTM. produced less damage than IM 16 but NAC reduced the
damage to near background levels. Quest 3.RTM. smoke caused the
least amount of damage which could also be reduced to background
levels by the presence of 25 mM NAC during exposure. In all
instances, the level of damage following exposure to smoke in the
presence of NAC was approximately the same, just slightly more than
the background or scheduled level of .gamma.H2AX expression. As
above, the data from this assay demonstrates that tobacco products
containing modified tobacco (i.e., Omni.RTM. and Quest 3.RTM.)
induced less DNA damage than a reference tobacco product (i.e.,
IM16). Again, the double strand break assay has shown that the
modified tobacco products Omni.RTM., and Quest 3.RTM. have a
reduced potential to contribute to a tobacco related disease (i.e.,
Omni.RTM., and Quest 3.RTM. are reduced risk tobacco products).
[0158] In more experiments, the cell cycle specific inhibition of
whole smoke-induced DNA damage by NAC was analyzed. A549 cells were
exposed to whole smoke in the presence and absence of various
concentrations of NAC. Exposure was always for 20 min and recovery
was 1 h. In each instance, the background or "scheduled" expression
of .gamma.H2AX was subtracted from the value obtained for each
population in each cell cycle phase. Since G.sub.1 phase cells were
the most sensitive and had the highest value, all other
measurements were normalized to that of G.sub.1 phase cells exposed
to IM 16 smoke in the absence of NAC (plotted as 0.1 mM NAC on the
log plot).
[0159] As can be seen in FIG. 11, damage by whole smoke from IM 16
to S phase A549 cells was unaffected by the presence of NAC up to a
concentration of 5 mM. In contrast, damage caused to both G.sub.1
and G.sub.2M cells began to decrease when as little as 1 mM NAC was
present during exposure. The damage caused to S phase cells
decreased sharply as the NAC concentration was increased to 10 mM
and, by 25 mM, there was little difference in residual .gamma.H2AX
expression between cells in any phase of the cycle.
[0160] The concentration of NAC that reduced DNA damage by 50% for
each cell cycle phase can be determined from the graph in FIG. 11.
For G.sub.1, S and G.sub.2M phase cells the values were
approximately 4.5, 2.6 and 7.5 mM NAC.
[0161] In more experiments, it was determined that the vapor phase
of smoke induces damage that is abrogated by the presence of NAC.
FIG. 12 (top) illustrates the ability of the vapor phase of smoke
from various tobacco sources to cause DNA damage to A549 cells in
comparison to whole smoke from IM 16 cigarettes. Thus, the vapor
phase from IM 16 cigarettes using standard conditions of exposure
and recovery caused only about 26% of the DNA damage (.gamma.H2AX)
as whole smoke from the same source. In the same comparison, the
vapor phase from Quest 1.RTM. and Quest 3.RTM. caused only 8.1% and
5.6% of the damage caused by whole smoke from IM 16. As a direct
comparison, the vapor phase of smoke from Quest 1.RTM. and
Quest.RTM. caused 68.8% and 78.5%, respectively, less damage than
the vapor phase of smoke from IM 16.
[0162] The presence of 25 mM NAC during exposure of A549 cells to
whole smoke form IM 16 cigarettes reduced .gamma.H2AX by nearly 90%
(89.1%) compared to cells exposed to whole smoke in the absence of
NAC. NAC present during cell exposure to the vapor phase of smoke
from IM 16, Quest 1.RTM. and Quest 3.RTM., reduced .gamma.H2AX by
93.2%, 98.9% and 100%, respectively compared to the damage caused
by the vapor phase of smoke in the absence of NAC.
[0163] The same experiment performed on NHBE cells resulted in more
or less comparable results (FIG. 12, bottom). Whole smoke from IM
16 cells produced less damage in NHBE cells under standard
conditions compared to A549 cells (note the greater background
observed in NHBE cells). The vapor phase from IM 16 CS cause only
about 30% (29.7%) of the damage caused by whole smoke whereas the
vapor phase of smoke from Quest 1.RTM. caused 97% less damage than
whole smoke from IM 16 cigarettes. The vapor phase of smoke from
Quest 3.RTM. produced no increase in .gamma.H2AX over background in
NHBE cells.
[0164] The presence of NAC during exposure of NHBE cells to whole
smoke from IM 16 cigarettes reduced .gamma.H2AX by about 78%
(77.9%). The presence of NAC during exposure of cells the vapor
phase of IM 16, Quest 1.RTM. or Quest 3.RTM. abolished virtually
all DNA damage relative to mock-treated cells; i.e., .gamma.H2AX
was reduced to background levels or below.
[0165] The cell cycle phase specific results are comparable to that
for the whole populations (FIG. 13). The vapor phase of smoke from
IM 16 caused comparable amounts of damage in each cell cycle phase
in A549 cells though the reduction of damage in G.sub.1 phase by
NAC was somewhat higher than it was for S and G.sub.2M phase; 98.5%
versus 89.0% and 92.2%, respectively. The vapor phase from both
Quest 1.RTM. and Quest 3.RTM. caused more damage to S phase cells
though in each instance, the presence of NAC reduced damage to
background levels for each cell cycle phase.
[0166] NHBE cells as noted earlier have higher .gamma.H2AX levels
in S phase of mock-treated cells as can be seen in FIG. 13. The
largest increase in damage caused by the vapor phase of smoke from
IM 16 occurred in G.sub.1 phase cells (54.4% and 66.9% greater than
for cells in S or G.sub.2M, respectively). The presence of NAC
reduced the damage caused by the vapor phase of smoke from IM 16 to
background levels or below. The vapor phase of smoke from Quest
1.RTM. and Quest 3.RTM. cigarettes had only a small effect on DNA
damage in cells in G.sub.1 or S but not G.sub.2M phase. All damage
caused by the vapor phase of smoke from Quest.RTM. cigarettes in
NHBE cells was inhibited in the presence of NAC. Importantly, this
data provide more evidence that the tobacco products containing
modified tobacco (i.e., Quest 1.RTM. and Quest 3.RTM.) induced
significantly less DNA damage (i.e., double strand DNA breaks) than
that of a reference tobacco product (i.e., IM16). Accordingly, the
modified tobacco products Quest 1.RTM., and Quest 3.RTM. have a
reduced potential to contribute to a tobacco related disease (i.e.,
Quest 1.RTM. and Quest 3.RTM. are reduced risk tobacco products,
according to the double strand DNA break assay.
[0167] FIGS. 19, 27 and 28 show additional comparisons of reactions
of A549 cells to smoke from various cigarettes, where the affect
can vary for different cigarettes, and can vary according to the
cell cycle of the cells, and can vary according to the presence of
antioxidant.
[0168] Further performed was a test of double-strand DNA breaks in
the cells of a human subject exposed to tobacco smoke. The level of
.gamma.H2AX expression in the buccal mucosa of a smoker was
compared to the level of .gamma.H2AX expression in the buccal
mucosa of a nonsmoker. A cheek swab was collected from a subject
(smoker) within 5 min completion of smoking a Marlboro Light.RTM.
cigarette, and a second check swab was collected from a subject
that did not smoke a cigarette (non-smoker). Levels of .gamma.H2AX
were then measured for both cell samples. As seen in FIG. 26 the X
axis depicts .gamma.H2AX associated fluorescence (.gamma.H2AX), and
the Y axis depicts the number of cells having the corresponding
gH2AX fluorescence level. There were 358 cells with a very low
value of .gamma.H2AX in the non-smoker sample, whereas the smoker
sample had cells with .gamma.H2AX values spread over a wide range.
Each histogram represents 3.times.10.sup.3 cells. The buccal cells
from the smoker showed a low number of cells having little or no
.gamma.H2AX fluorescence signal, and showed a large number of cells
with higher .gamma.H2AX fluorescence levels. In contrast, almost
all cells of the non-smoker had little or no .gamma.H2AX
fluorescence. Thus, human buccal cells exposed to tobacco smoke
have an increased level of double strand DNA breaks relative to
human buccal cells not exposed to tobacco smoke. These results
parallel the in vitro results observed for A549 cells and for NHBE
cells. Thus, the in vitro approaches described herein are
predictive of in vivo responses.
[0169] Accordingly, the methods that were applied to A549 cells and
NHBE cells for comparing different tobacco products, analyzing
cells at different stages in cell cycle, and determining protection
provided by the presence of an antioxidant, will be performed on
human samples of buccal cells and it is expected, as shown in the
in vitro experiments, that modified tobaccos, in particular
genetically modified tobaccos that have a reduced amount of one or
more compounds that contribute to a tobacco related disease (e.g.,
genetically modified tobacco having a reduced nicotine, TSNA,
and/or sterol content) will induce fewer or a reduced amount of
double strand DNA breaks in humans that are contacted with smoke
from said modified tobaccos than will be observed in humans that
are contacted with smoke from conventional tobacco products,
reference tobacco products, or non-transgenic (wild-type tobacco of
the same variety as the parental strain prior to genetic
modification). The section that follows describes several methods
for identifying a tobacco or tobacco products that modulate cell
homeostasis.
[0170] Methods for Identifying a Tobacco or Tobacco Product that
Modulates Cell Homeostasis
[0171] Provided herein are methods for identifying a tobacco that
modulates cell homeostasis by providing a tobacco, obtaining a
tobacco composition from the tobacco, contacting a cell with the
tobacco composition, and identifying the presence or absence of
modulation of cell homeostasis after contact with the tobacco
composition. In some embodiments, the methods provided herein can
be used to identify a tobacco that modulates apoptosis or a tobacco
that modulates cell proliferation. In some embodiments, the tobacco
composition can be smoke or smoke condensate.
[0172] Also provided herein are methods of identifying a compound
in tobacco that modulates cell homeostasis by providing a first
tobacco, obtaining a tobacco composition from the first tobacco,
contacting a first population of cells with the tobacco composition
from the first tobacco, identifying the degree of modulation of
cell homeostasis in the first population of cells after contact
with the tobacco composition from the first tobacco, providing a
second tobacco that has been modified to reduce a compound in the
second tobacco, obtaining a tobacco composition from the second
tobacco, contacting a second population of cells with the tobacco
composition from the second tobacco, and identifying the degree of
modulation of cell homeostasis after contact with the tobacco
composition from the second tobacco, where an identification of a
reduction in the degree of modulation of cell homeostasis after
contact with the tobacco composition from the second tobacco
identifies the compound as one that modulates cell homeostasis. In
some embodiments, the methods provided herein can be used to
identify a compound in tobacco that modulates apoptosis. In some
embodiments, the methods provided herein can be used to identify a
compound in tobacco that modulates cell proliferation. In some
embodiments, the tobacco composition can be smoke or smoke
condensate.
[0173] Also provided herein are methods of identifying a tobacco
product that has a reduced potential to contribute to a
tobacco-related disease by providing a first tobacco product,
obtaining a tobacco composition from the first tobacco product,
contacting a first population of cells with the tobacco composition
from the first tobacco product, identifying the degree of
modulation of cell homeostasis in the first population of cells
after contact with the tobacco composition from the first tobacco
product, providing a second tobacco product, obtaining a tobacco
composition from the second tobacco product, contacting a second
population of cells with the tobacco composition from the second
tobacco product, and identifying the degree of modulation of cell
homeostasis after contact with the tobacco composition from the
second tobacco product, where an identification of a reduction in
the degree of modulation of cell homeostasis after contact with the
tobacco composition from the second tobacco product as compared to
the degree of modulation of cell homeostasis after contact with the
tobacco composition from the first tobacco product identifies the
second tobacco product as one that has a reduced potential to
contribute to a tobacco-related disease. In some embodiments, the
second tobacco product has been modified to reduce a compound in
the second tobacco. In some embodiments, the second tobacco product
can be genetically modified to reduce the expression of at least
one gene that regulates production of the compound. In some
embodiments of the methods provided herein, the degree of
modulation of cell homeostasis can be determined by identifying the
degree of modulation of apoptosis. In some embodiments of the
methods provided herein, the degree of modulation of cell
homeostasis can be determined by identifying the degree of
modulation of cell proliferation. In some embodiments, the tobacco
composition can be smoke or smoke condensate.
[0174] Also provided herein are methods of making a tobacco product
that has a reduced potential to contribute to a tobacco-related
disease by providing a first tobacco, obtaining a tobacco
composition from the first tobacco, contacting a first population
of cells with the tobacco composition from the first tobacco,
identifying the degree of modulation of cell homeostasis in the
first population of cells after contact with the tobacco
composition from the first tobacco, providing a second tobacco,
obtaining a tobacco composition from the second tobacco, contacting
a second population of cells with the tobacco composition from the
second tobacco, identifying the degree of modulation of cell
homeostasis after contact with the tobacco composition from the
second tobacco product, where an identification of a reduction in
the degree of modulation of cell homeostasis after contact with the
tobacco composition from the second tobacco as compared to the
degree of modulation of cell homeostasis after contact with the
tobacco composition from the first tobacco identifies the second
tobacco as one that has a reduced potential to contribute to a
tobacco-related disease, and incorporating the second tobacco,
which has a reduced potential to contribute to a tobacco-related
disease, into a tobacco product. In some embodiments, the second
tobacco has been modified to reduce a compound in the second
tobacco. In some embodiments, the second tobacco can be genetically
modified to reduce the expression of at least one gene that
regulates production of the compound. In some embodiments of the
methods provided herein, the degree of modulation of cell
homeostasis can be determined by identifying the degree of
modulation of apoptosis. In some embodiments of the methods
provided herein, the degree of modulation of cell homeostasis can
be determined by identifying the degree of modulation of cell
proliferation. In some embodiments, the tobacco composition can be
smoke or smoke condensate.
[0175] The methods provided herein can be used to determine the
affect of a tobacco product or a compound from a tobacco product,
on cell homeostasis. Cells of an organism contacted with a tobacco
composition, e.g., mammalian epithelial cells, can undergo
apoptosis and can proliferate at particular levels under "normal"
conditions, where "normal" as used in this context refers to
conditions in which cells are not contacted with tobacco or a
tobacco composition and are not otherwise placed under atypical
(e.g., stressful) environmental conditions. Environmental
conditions, for example, contacting the cells with a tobacco
composition, can modulate apoptosis of the contacted cells and also
can modulate the proliferation of the contacted cells. Such
modulation can result in processes that can directly lead to
cellular events in tobacco-related disease (e.g., apoptosis can be
decreased, which can lead to neoplastic cell growth) or can
indirectly lead to cellular events in tobacco-related disease
(e.g., apoptosis can be increased, which can trigger a cell growth
response in an organism, which can lead to neoplastic cell growth).
The methods provided herein can be used to examine the affect of a
tobacco product or a compound from a tobacco product, on cell
homeostasis by, for example, determining the affect of a tobacco or
tobacco compound on apoptosis in a cell or a cell population, or,
for example, determining the affect of a tobacco or tobacco
compound on cell proliferation of a cell or a cell population. In
some embodiments, a first tobacco that causes a lesser degree of
modulation of cell homeostasis relative to a second tobacco can be
characterized as a reduced risk tobacco. In some embodiments, a
first tobacco that causes a lesser degree of inhibition of
apoptosis relative to a second tobacco can be characterized as a
reduced risk tobacco. In some embodiments, a first tobacco that
causes a lesser degree of inhibition of cell proliferation relative
to a second tobacco can be characterized as a reduced risk tobacco.
Any of a variety of known methods for determining modulation of
cell homeostasis by, for example, modulating apoptosis or
modulating cell proliferation, as exemplified herein, can be used
in the methods provided herein.
[0176] Also provided herein are methods for determining cell
response to cell damage. Cells can be exposed to environmental
input, such as a tobacco composition, that causes cell damage. The
response of these cells to the environmental input-mediated damage
can be indicative of the likelihood of the environmental input
leading to an environmental input-related disease. In one
embodiment, cells can be contacted with a tobacco composition, and
the response of the cells to the contact by the tobacco composition
can indicate the likelihood of the tobacco composition leading to a
tobacco-related disease.
[0177] As provided herein, cells contacted by different
environmental inputs, for example, different tobacco compositions,
can respond differently to cell damage caused by the environmental
input, where some cell responses are more indicative of leading to
a disease state compared to other cell responses. Thus,
contemplated herein, two or more tobacco compositions can be
compared and characterized according to the cell responses in
reaction to damage induced by exposure to the tobacco compositions.
In such methods, exposure conditions can be manipulated such that
the amount of damage to the cells is equivalent for each different
tobacco composition, resulting in a determination of different
characteristic cell responses to the same amount of cell
damage.
[0178] Accordingly, methods are provided herein for comparing two
or more tobacco compositions by contacting a first tobacco
composition with a first population of cells, and contacting a
second composition with a second population of cells, where the two
different contacting steps are performed in such a manner that the
first and second population of cells undergo equivalent amount of
cell damage, and then determining the degree of modulation of cell
homeostasis in the first and second populations of cells, where the
tobacco composition that is characterized by the lowest degree of
cell modulation can be identified as a tobacco with reduced
likelihood of causing a tobacco-related disease. In such methods,
damage to the cells caused by the tobacco compositions can be
measured by, for example, measuring the degree of damage to the
genetic material of the cells, in accordance with the methods
provided herein or otherwise known in the art. Also in such
methods, the degree of modulation of cell homeostasis can be
determined by the degree of modulation of apoptosis or cell
proliferation relative to cells not contacted by a tobacco
composition or relative to cells contacted by a tobacco composition
from a tobacco, such as a reduced risk tobacco with a known degree
of modulation of cell homeostasis. The following section describes
several methods to evaluate the ability of a tobacco or a tobacco
product to modulate apoptosis in greater detail.
[0179] Modulation of Apoptosis
[0180] In some embodiments, modulation of cell homeostasis can be
identified by determining a modulation of apoptosis. Thus, provided
herein are methods of identifying a tobacco that modulates
apoptosis by providing a tobacco, obtaining a tobacco composition
from the tobacco, contacting a cell with the tobacco composition,
and identifying a modulation of apoptosis in the cell after contact
with the tobacco composition. Also provided herein are methods of
identifying a compound in tobacco that modulates apoptosis, methods
of identifying a tobacco product that has a reduced potential to
contribute to a tobacco-related disease, and methods of making a
tobacco product that has a reduced potential to contribute to a
tobacco-related disease, in accordance with the methods of
identifying a tobacco or tobacco compound that modulates cell
homeostasis provided herein elsewhere. Also provided herein are
methods of identifying a compound in tobacco that modulates
apoptosis, methods of identifying a tobacco product that has a
reduced potential to contribute to a tobacco-related disease, and
methods of making a tobacco product that has a reduced potential to
contribute to a tobacco-related disease, in conjunction with the
methods of identifying a tobacco or tobacco compound that modulates
cell proliferation provided herein.
[0181] Also provided herein are methods of comparing two or more
tobacco products. In some embodiments, a tobacco or tobacco
compound that induces a lower degree of apoptosis can be
characterized as a tobacco that has a potential to contribute to a
tobacco-related disease. In some embodiments, a first tobacco that
induces a lower degree of apoptosis than a second tobacco can be
characterized as a tobacco that has an increased potential to
contribute to a tobacco-related disease. In some embodiments, a
first tobacco that induces a higher degree of apoptosis than a
second tobacco can be characterized as a tobacco that has a reduced
potential to contribute to a tobacco-related disease. In some
embodiments, a tobacco or tobacco compound that induces a higher
degree of apoptosis can be characterized as a tobacco that has a
potential to contribute to a tobacco-related disease. In some
embodiments, a first tobacco that induces a higher degree of
apoptosis than a second tobacco can be characterized as a tobacco
that has an increased potential to contribute to a tobacco-related
disease. In some embodiments, a first tobacco that induces a lesser
degree of apoptosis than a second tobacco can be characterized as a
tobacco that has a reduced potential to contribute to a
tobacco-related disease. In some embodiments, the methods of
identifying a tobacco that modulates apoptosis can be used to
identify modified tobacco that modulates apoptosis as provided
herein or otherwise known in the art.
[0182] Also provided herein are methods of comparing two or more
tobacco products. In some embodiments, a tobacco or tobacco
compound that inhibits apoptosis can be characterized as a tobacco
that has a potential to contribute to a tobacco-related disease. In
some embodiments, upon inducing the same degree of DNA damage
(DSBs) a first tobacco that induces lesser degree of apoptosis than
a second tobacco can be characterized as a tobacco that has an
increased potential to contribute to a tobacco-related disease. In
some embodiments, upon inducing the same degree of DNA damage
(DSBs) a first tobacco that induces lesser degree of apoptosis than
a second tobacco can be characterized as a tobacco that has a
reduced potential to contribute to a tobacco-related disease. In
some embodiments, a tobacco or tobacco compound that increases
apoptosis can be characterized as a tobacco that has a potential to
contribute to a tobacco-related disease. In some embodiments, a
first tobacco that increases apoptosis to a greater degree than a
second tobacco can be characterized as a tobacco that has an
increased potential to contribute to a tobacco-related disease. In
some embodiments, a first tobacco that increases apoptosis to a
lesser degree than a second tobacco can be characterized as a
tobacco that has a reduced potential to contribute to a
tobacco-related disease. In some embodiments, the methods of
identifying a tobacco that modulates apoptosis can be used to
identify modified tobacco that modulates apoptosis as provided
herein or otherwise known in the art.
[0183] As used herein, a tobacco or tobacco compound that induces a
lower or higher degree of apoptosis refers to a tobacco or tobacco
compound that causes a cell or cell population to decrease or
increase, respectively, apoptosis in that cell or cell population
relative to a cell or cell population that is not contacted by the
tobacco or tobacco compound. Any of a variety of methods can be
used to determine apoptosis in a cell or cell population, including
those provided herein, and other methods known in the art.
[0184] While not intending to be limited by the following
explanation, a decreased degree of apoptosis in cells may result in
cells with damaged DNA that can survive and be tumorigenic rather
than die and be eliminated. In other cellular functions, extensive
apoptosis may induce compensatory stem cell proliferation and
result in tumorigenesis. Accordingly, as contemplated herein an
increase or decrease in apoptosis can lead to a tobacco-related
disease.
[0185] Also provided herein are methods of comparing two or more
tobacco products when the two or more tobacco products induce the
same level of damage to cells. In some embodiments, a tobacco or
tobacco compound that inhibits apoptosis can be characterized as a
tobacco that has a potential to contribute to a tobacco-related
disease. In some embodiments, upon inducing the same degree of DNA
damage (DSBs) a first tobacco that induces lesser degree of
apoptosis than a second tobacco can be characterized as a tobacco
that has an increased potential to contribute to a tobacco-related
disease. In some embodiments, upon inducing the same degree of DNA
damage, a first tobacco that induces lesser degree of apoptosis
than a second tobacco can be characterized as a tobacco that has a
reduced potential to contribute to a tobacco-related disease. In
some embodiments, upon inducing the same degree of DNA damage, a
tobacco or tobacco compound that increases apoptosis can be
characterized as a tobacco that has a potential to contribute to a
tobacco-related disease. In some embodiments, upon inducing the
same degree of DNA damage, a first tobacco that increases apoptosis
to a greater degree than a second tobacco can be characterized as a
tobacco that has an increased potential to contribute to a
tobacco-related disease. In some embodiments, upon inducing the
same degree of DNA damage, a first tobacco that increases apoptosis
to a lesser degree than a second tobacco can be characterized as a
tobacco that has a reduced potential to contribute to a
tobacco-related disease. In some embodiments, the methods of
identifying a tobacco that modulates apoptosis can be used to
identify modified tobacco that modulates apoptosis as provided
herein or otherwise known in the art.
[0186] The methods provided herein can include one or more steps of
determining modulation of apoptosis. Typically, such methods
include assays for modulation of apoptosis in a population of
cells. Any of a variety of methods known in the art for assaying
apoptosis can be used in the methods provided herein. Exemplary
known assays include assays for activation of apoptosis-related
proteins, assays for double-strand DNA breaks, and assays for
membrane permeability.
[0187] In one exemplary method, modulation of apoptosis can be
identified by determining caspase activation. Caspases are
proteases involved in apoptosis. Activation of caspases can lead to
apoptosis in the cell. Accordingly, measurement of activated
caspases can be used to identify apoptosis in cells. Typically,
caspases are activated by a cleavage reaction. Thus, activated
caspase can be determined by detecting activated cleaved caspases.
For example, caspase activation can be identified using an antibody
or fragment thereof, which binds to activated caspase but not
inactive caspase. There are a number of caspases that can be
screened in accordance with the methods provided herein, including
but not limited to, caspase 1, 3 and 9. In another example,
activation of caspase by its catalytic activity can be determined.
For example, caspase-3 has substrate selectivity for the amino acid
sequence Asp-Glu-Val-Asp (DEVD) (SEQ. ID. NO. 1). A fluorogenic
indicator such as Ac-DEVD-AMC can be used for fluorometric assay of
caspase-3 activity. A variety of caspase activation assays are
known in the art, as exemplified in Gown et al., J. Histochem.
Cytochem. (2002) 50:449-54; Iordanov et al., Apoptosis (2005)
10:153-66; and Kahlenberg et al., J. Leukoc. Biol. (2004)
76:676-84, all of which are hereby expressly incorporated by
reference in their entireties.
[0188] In another exemplary method, modulation of apoptosis can be
identified by determining cleavage of the protein poly(ADP-ribose)
polymerase (PARP). Enzymatic cleavage of the PARP occurs uniquely
during apoptosis. Activation of caspases results in cleavage of
PARP, which produces inactive PARP fragments. One inactive PARP
fragment binds DNA and inhibits DNA repair. Thus, cleavage of PARP
can be determined using an antibody specific to cleaved PARP
fragments. Cleavage of PARP also can be determined by measuring
decrease in PARP activity. PARP catalyzes the NAD-dependent
addition of poly(ADP-ribose) to nuclear proteins such as histone.
Thus, in one exemplary assay, incorporation of biotinylated
poly(ADP-ribose) onto histone proteins can be measured as an
indicator of PARP activity. Methods for determining PARP cleavage
are known in the art, as exemplified in Mullen, Methods Mol. Med.
(2004) 88:171-81; Yu et al., Science (2002) 297:259-63; and Saldani
et al. Eur. J. Histochem. (2001) 45:389-92, all of which are hereby
expressly incorporated by reference in their entireties.
[0189] In another exemplary method, modulation of apoptosis can be
identified by determining annexin V binding. Annexin V binds to
phosphotidylserine on the cell membrane, a phenomenon that occurs
only in cells undergoing apoptosis. In one exemplary assay,
fluorescently labeled annexin V can be added to cells, and presence
of the fluorescent marker on the cells is indicative of annexin
binding. In another example, antibodies specific for annexin V can
be used to detect the presence of annexin V on the cell membrane.
This technique is often combined with the use of fluorescent dyes
that are normally not able to penetrate the cell membrane unless it
is damaged these include dyes such as propidium iodide and acridine
orange. Methods for determining annexin V binding are known in the
art, as exemplified in U.S. Pat. No. 5,767,247, Vermes et al., J.
Immunol. Methods (1995) 184:39-51; Wilkins et al., Cytometry (2002)
48:14-9; and Peng et al., Chin. Med. Sci. J. (2002) 17:17-21, all
of which are hereby expressly incorporated by reference in their
entireties.
[0190] In another exemplary method, modulation of apoptosis can be
identified by determining chromatin condensation. Chromatin
condensation is a well-established indicator of apoptosis.
Chromatin condensation can be detected by a variety of methods, for
example, detection by decreased forward angle light scatter or
decreased right angle light scatter, and detection by presence of a
specific dye such as Hoechst 33342. Methods for determining
chromatin condensation are known in the art, as exemplified in
Tounekti et al., Exp. Cell Res. (1995) 217:506-16 and Dobrucki et
al., Micron (2001) 32:645-52, all of which are hereby expressly
incorporated by reference in their entireties.
[0191] In another exemplary method, modulation of apoptosis can be
identified by determining an increase sensitivity of chromatin in
cells to acid or heat-induced denaturation. Sensitivity of
chromatin in cells can be a marker of apoptosis. Chromatin
sensitivity to acid or heat-induced denaturation can be detected by
a variety of methods known in the art, such as detecting the
altered binding of the metachromatic dye acridine orange. Methods
for assaying chromatin sensitivity to denaturation are known in the
art, as exemplified in Frankfurt et al., (1996) Exp. Cell Res.
226:387-397, Frankfurt et al., (2001) J. Histochem. Cytochem.
49:369-378, Frankfurt et al., (2001) J. Immunol. Methods. 253:
133-144, Groos et al., (2003) Anat. Rec. 272A:503-513, Zamzani et
al., (1999) Nature 401:127-128, and Allera et al., (1997) J. Biol.
Chem. 272:10817-10822, all of which are hereby expressly
incorporated by reference in their entireties.
[0192] In another exemplary method, modulation of apoptosis can be
identified by determining fractional DNA content. Under appropriate
conditions, small molecular weight DNA fragments occurring as the
result of the apoptotic process can be removed from cells,
resulting in cells with decreased DNA content. Assays can be used
to detect cells with decreased (fractional) DNA content by using,
for example, DNA dyes in flow cytometry according to known methods.
Methods for assaying fraction DNA content are known in the art, as
exemplified in Mazur et al., Hum. Exp. Toxicol. (2002) 21:335-41
and Gorczyca, Endocrine-Related Cancer (1999) 6:17-19, all of which
are hereby expressly incorporated by reference in their
entireties.
[0193] In another exemplary method, modulation of apoptosis can be
identified by determining TUNEL assay, as discussed herein
elsewhere. TUNEL assay can detect DNA strand breaks occurring
following activation of an apoptosis-specific nuclease.
Incorporation of labeled nucleotides at the site of the
double-strand breaks can be detected by, for example, binding of
antibodies or other molecules (biotin-avidin) carrying a
fluorescent tag.
[0194] An exemplary assay for cell apoptosis determination is
provided in Example 1 for caspase-3 activation measurement.
Briefly, cells were treated with smoke (i.e., A549) or smoke
condensate (i.e., NHBE) and fixed as described above, then rinsed
twice in PBS and immersed in 0.2% Triton X-100 (Sigma) in a
solution of 1% (w/v) bovine serum albumin (BSA; Sigma) in PBS for
30 min to suppress non specific antibody binding. The cells were
then incubated in 100 .mu.l volume of 1% BSA containing 1:100
dilution of anti-cleaved (activated) caspase-3 rabbit polyclonal Ab
(Cell Signaling Technology, Beverly, Mass.) overnight at 4.degree.
C., washed twice with PBS and incubated with 1:30 diluted
FITC-conjugated F(ab')2 fragment of swine anti-rabbit
immunoglobulin (DAKO, Carpinteria, Calif.) for 30 min in room
temperature in the dark. The cells were then counterstained with 1
.mu.g/ml 4,6-diamidino-2-phenylindole (DAPI, Molecular Probes,
Eugene, Oreg.) in PBS for 5 min. Each experiment was performed with
an IgG control in which cells were labeled only with secondary
antibody, FITC-conjugated F(ab')2 fragment of goat anti-mouse
immunoglobulins, without primary antibody incubation to estimate
the extent of nonspecific binding of the secondary antibody to the
cells. The following section describes several assays that can be
used to evaluate the ability of a tobacco or a tobacco product to
modulate cell proliferation.
[0195] Modulation of Cell Proliferation
[0196] In some embodiments, modulation of cell homeostasis can be
identified by determining modulation of cell proliferation. Thus,
provided herein are methods of identifying a tobacco that modulates
cell proliferation by providing a tobacco, obtaining a tobacco
composition from the tobacco, contacting a cell with the tobacco
composition, and identifying a modulation of cell proliferation in
the cell after contact with the tobacco composition. Also provided
herein are methods of identifying a compound in tobacco that
modulates cell proliferation, methods of identifying a tobacco
product that has a reduced potential to contribute to a
tobacco-related disease, and methods of making a tobacco product
that has a reduced potential to contribute to a tobacco-related
disease, in accordance with the methods of identifying a tobacco or
tobacco compound that modulates cell homeostasis provided herein
elsewhere. Also provided herein are methods of identifying a
compound in tobacco that modulates cell proliferation, methods of
identifying a tobacco product that has a reduced potential to
contribute to a tobacco-related disease, and methods of making a
tobacco product that has a reduced potential to contribute to a
tobacco-related disease, in conjunction with the methods of
identifying a tobacco or tobacco compound that modulates cell
proliferation provided herein.
[0197] Also provided herein are methods of comparing two or more
tobacco products. In some embodiments, a tobacco or tobacco
compound that inhibits cell proliferation can be characterized as a
tobacco that has a potential to contribute to a tobacco-related
disease. In some embodiments, a first tobacco that inhibits cell
proliferation to a greater degree than a second tobacco can be
characterized as a tobacco that has an increased potential to
contribute to a tobacco-related disease. In some embodiments, a
first tobacco that inhibits cell proliferation to a lesser degree
than a second tobacco can be characterized as a tobacco that has a
reduced potential to contribute to a tobacco-related disease. In
some embodiments, a tobacco or tobacco compound that increases cell
proliferation can be characterized as a tobacco that has a
potential to contribute to a tobacco-related disease. In some
embodiments, a first tobacco that increases cell proliferation to a
greater degree than a second tobacco can be characterized as a
tobacco that has an increased potential to contribute to a
tobacco-related disease. In some embodiments, a first tobacco that
increases cell proliferation to a lesser degree than a second
tobacco can be characterized as a tobacco that has a reduced
potential to contribute to a tobacco-related disease. In some
embodiments, the methods of identifying a tobacco that modulates
cell proliferation can be used to identify modified tobacco that
modulates cell proliferation as provided herein or otherwise known
in the art.
[0198] As used herein, a tobacco or tobacco compound that inhibits
or increases cell proliferation refers to a tobacco or tobacco
compound that causes a cell or cell population to proliferate at a
decreased or increased rate, respectively, relative to a cell or
cell population that is not contacted by the tobacco or tobacco
compound. Any of a variety of methods can be used to determine cell
proliferation in a cell or cell population, including those
provided herein, and other methods known in the art.
[0199] Any of a variety of assays can be used that monitor
alterations to the viability and growth potential of cells in vitro
when challenged by exposure to a vast array of insults (e.g.,
ionizing radiation, ultraviolet radiation, drugs, toxins,
carcinogens, CS, CSC, viruses, chemicals, free radicals, pollution,
and the like). Assays that can be used in the methods provided
herein can include assays that monitor proliferative rates (cell
proliferation assays) and assays that monitor survivability and
proliferation with time (e.g., clonogenic survival assay).
[0200] In one example, clonogenic survival can be monitored. The
clonogenic survival assay can be used to study the ability of
specific agents to impact the proliferation of cells. This assay is
frequently employed in cancer research laboratories to determine
the effect, if any, of a range of substances (e.g., drugs,
radiation, chemicals, organic mixtures, etc), on the proliferation
of tumor cells. The term "clonogenic" refers to the fact that these
cells are clones of one another. Any of a variety of cell types can
be used in such experiments. The cells used typically come from
established cell lines, which have been well-studied and whose
general characteristics are known. Typically, a clonogenic survival
assay has four major steps: (1) inoculating cells into culture
dishes and incubate the cells (e.g., 24-48 hours); (2) upon the
cells reaching the logarithmic phase of growth, the treating the
cells with a tobacco composition (e.g., contacting the cells with
freshly prepared and diluted CS for different periods of time); (3)
allowing the cells to recover for a set number of hours (e.g., up
to 24 hours), then treating the cells and allowing the cells to
grow further (e.g., trypsinizing the cells, replating the cells at
specific dilutions, and allowing the cells to grow for 5-7 days);
and (4) fixing, staining and counting the cells. Experimental
specifics such as time of incubation and growth, number of cells to
use for plating, and the like, can be readily determined by one
skilled in the art according to the type of cell used. Typically,
the number of surviving colonies of 25-50 cells is representative
of the percentage of cells that survived the treatment. A graphical
representation of survival versus exposure time to a tobacco
composition can then be generated. The surviving fraction can be
determined by dividing the number of colonies in the dish by the
number of the colonies in the control (non-treated) dish.
[0201] In addition to clonogenic assays, any of a variety of cell
proliferation assays can be used to monitor an increase or decrease
in proliferative capacity and which can be used in context with
exposure to a tobacco composition such as CS and/or CSCs.
[0202] In one example of cell proliferation assays, intake and
conversion of a dye can be an indicator of cell proliferation. One
example of such an assay is a resazurin-based assay. Resazurin is a
redox dye which is not fluorescent, but upon reduction by
metabolically active cells, is converted into a highly fluorescent
product (resorufin). Living cells can readily reduce this non-toxic
reagent and the resulting increase in fluorescence intensity is
monitored using a fluorescence spectrophotometer or plate reader.
Exemplary commercially available assays include alamarBlue.TM.
reagent fromBioSource International, Camarillo Calif.
[0203] Another example of dye intake and conversion-based cell
proliferation assasy is a tetrazolium salt-based assay. The
tetrazolium salt assay is a colorimetric assay is based on the
conversion of a tetrazolium salt (MTT, WST, or other) to formazan,
a purple dye. This cellular reduction reaction involves the
pyridine nucleotide cofactors NADH/NADPH and is only catalyzed by
living cells. The formazan product has a low aqueous solubility and
is present as purple crystals. Dissolving the resulting formazan
with a solubilization buffer permits the convenient quantification
of product formation. The intensity of the product color is
directly proportional to the number of living cells in the culture.
Exemplary commercially available assays include Quick Cell
Proliferation Assay Kit from BioVision Inc., Mountain View,
Calif.
[0204] In another example of cell proliferation assays, cells can
be monitored for plasma membrane damage. Plasma membrane
damage-based assays can be used to monitor cell death or
cytotoxicity. Typical assays quantitate molecules released from
damaged cells such as adenylate kinase and lactate dehydrogenase.
Exemplary commercially available assays include LDH-Cytotoxicity
Assay Kit from BioVision Inc., Mountain View, Calif.
[0205] In another example of cell proliferation assays, cells can
be monitored for dye exclusion/dye uptake assays. Dye
exclusion/uptake assays distinguish live from dead cells based on
dyes which specifically stain either live or dead cells. Exemplary
commercially available assays include trypan blue dye exclusion,
Live-Dye.TM. (a cell-permeable green fluorescent dye that stains
live cells) from BioVision Inc., Mountain View, Calif.
[0206] In another example of cell proliferation assays, cells can
be monitored for ATP and ADP levels. ATP and ADP level-based assays
utilize the phenomenon that increased levels of ATP and decreased
levels of ADP have been recognized in proliferating cells.
Exemplary commercially available assays include ApoSENSOR.TM. Cell
Viability Assay Kit from MBL International, Woburn Mass.
[0207] In another example of cell proliferation assays, cells can
be monitored for protein or DNA levels in the cells. Cell
proliferation is associated with increased protein and DNA
synthesis. DNA quantitation-based assays can use, for example,
[3H]-thymidine incorporation, the fluorescence of a DNA-dye complex
from lysed cells, or other known markers of DNA synthesis.
Similarly, protein synthesis can be monitored for incorporation of
labeled amino acids into the proteins. Exemplary commercially
available assays include Quantos.TM. Cell Proliferation Assay Kit
from Stratagene, La Jolla, Calif.
[0208] Working Example 3 herein provides one non-limiting specific
example of the clonogenic survival assay methods provided herein.
Variations of the assay method used in terms of materials, assay
times, instrumentation and protocols would be apparent to the
skilled artisan.
Example 3
[0209] A clonogenic survival assay was used to study the ability of
tobaccos and tobacco products to impact the proliferation of cells.
The experiment involves four major steps: (1) inoculate cells into
culture dishes and incubate for 24-48 hours; (2) upon reaching the
logarithmic phase of growth, the treatment is applied; the
treatment in this case is freshly prepared and diluted CS for
increasing periods of time; (3) the cells are then allowed to
recover for a set number of hours (up to 24), then the cells are
trypsinized, replated at specific dilutions, and allowed to
continue growing for 5-7 days; the number of cells used depends
largely on the plating efficiency of the cell line and must be
determined empirically prior to the experiment; and (4) at the
conclusion of the experiment, the cells are fixed, stained, and
counted. The primary measure is to count surviving colonies of
25-50 cells which is presented as the percentage of cells which
survived the treatment. A graphical representation of survival
versus exposure time to CS is then generated. The surviving
fraction is determined by dividing the number of colonies in the
dish by the number of the colonies in the control (non-treated)
dish.
[0210] A549 cells were exposed to smoke as previously described
(see above). Following smoke exposure the medium is aspirated and
the cells rinsed refed with 37.degree. C. BEGM and placed in a
37.degree. C., 5% CO.sub.2 humidified incubator for two to three
hours. The cells are harvested by trypsinization with trypsin-EDTA
(0.25% trypsin-0.38 mg/ml EDTA, Invitrogen). Cells are centrifuged
at 260.times.g for 8 min. Cell pellets are resuspended in 1 ml of
Ham's F-12K medium, 10% FBS (complete medium) per pellet and
counted. Cells are serially diluted so that the mock treated have
.about.65 cells per well and smoke treated have .about.300 cells
per well when seeded onto 96-well flat bottom tissue culture
plates; one plate per condition. The plates are incubated for five
days in a 37.degree. C., 5% CO.sub.2 humidified incubator. The
colonies of cells are fixed with 5% formaldehyde/PBS and colored
with 0.8% crystal violet solution for visualization. The colonies
are counted with the aid of a macroscopic dissecting microscope.
The cloning efficiency results are expressed in relation to the
mock exposed cells. Unless otherwise indicated, each bar in the
graphs represents three replicate data points per experiment.
[0211] A549 cells were exposed to whole smoke from IM16 or
Marlboro.RTM. cigarettes for various lengths of time after which
clonogenic assays were performed. FIG. 14 is a summary of multiple
experiments. The numbers in parentheses indicate the number of
experiments represented by each bar. The industry monitor reference
cigarette IM16 shows an effect on viability essentially identical
to that of the Marlboro.RTM. Red soft pack cigarettes. In both
cases there was a linear decrease in cell viability with increasing
smoke exposure.
[0212] In one set of experiments, A549 cells were exposed to smoke
from various cigarettes for 20 min and clonogenic assays were
performed. IM16, Omni.RTM., Marlboro.RTM., Quest 1.RTM., or Quest
3.RTM. brand cigarettes were compared. Each graph of FIG. 15
represents a separate experiment. The assay distinguishes between
the cigarettes, with Quest 3.RTM. treatment having the least impact
on cell viability and IM16 having the greatest. An overall ranking
of the cigarettes in terms of impact on viability can be seen:
Quest 3.RTM.<Quest 1.RTM. and
Omni.RTM.<Marlboro.RTM.<IM16. Thus, the tobacco products
containing modified tobacco (i.e., Omni.RTM., Quest 1.RTM., and
Quest 3.RTM. had the an impact on cell viability that was
significantly less than a reference tobacco product (i.e., IM16)
and a conventional, commercially available, traditional tobacco
product (i.e., Marlboro.RTM.). Accordingly, the modified tobacco
products Omni.RTM., Quest 1.RTM., and Quest 3.RTM. have a reduced
potential to contribute to a tobacco related disease (i.e.,
Omni.RTM., Quest 1.RTM., and Quest 3.RTM. are reduced risk tobacco
products) according to the clonogenic assay.
[0213] In a next set of experiments, the mitigation of the effect
of whole smoke on cell viability by the presence of NAC was
evaluated. A549 cells were exposed to 20 min IM16 smoke in the
presence of various concentrations of the free radical scavenger
N-acetylcysteine (NAC) and the clonogenic assay performed. NAC
protected the viability of the cells in a dose-dependent manner.
FIG. 16 shows the increasing degree of proliferation resulting from
increasing concentrations of NAC.
[0214] In another series of experiments, the effect of NAC on the
viability of cells contacted with whole smoke from different
cigarettes was evaluated. A549 cells were exposed to smoke from
various cigarettes for 20 min in the presence or absence of 25 mM
NAC and the clonogenic assay performed. IM16, Omni.RTM., and Quest
3.RTM. cigarettes were compared. NAC completely protected the cells
exposed to Quest 3.RTM. smoke, and partially protected cells
exposed to Omni.RTM. or IM16 (FIG. 17). Again, these data show that
tobacco products containing modified tobacco (i.e., Omni.RTM. and
Quest 3.RTM.) had the an impact on cell viability that was
significantly less than a reference tobacco product (i.e., IM16).
Accordingly, the modified tobacco products Omni.RTM. and Quest
3.RTM. have a reduced potential to contribute to a tobacco related
disease (i.e., Omni.RTM. and Quest 3.RTM. are reduced risk tobacco
products).
[0215] In yet another series of experiments, the effect of NAC on
cell death caused by the VAPOR phase of smoke from different
cigarettes was evaluated. A549 cells were exposed to the vapor
phase of smoke for 20 min by inserting a Cambridge filter pad
immediately after the cigarette in the smoking apparatus so as to
filter out the particulate matter ("tar") and leave only the vapor
phase. Three different cigarettes were used: IM16, Quest 1.RTM. and
Quest 3.RTM.. Cells were exposed in the presence or absence of 25
mM NAC. The clonogenic assay was subsequently performed.
[0216] The vapor phase of all cigarettes showed less effect on cell
viability than the corresponding whole smoke exposure, with Quest
3.RTM. exhibiting almost no effect (FIG. 18). The effect of various
cigarette modifications on vapor phase toxicity can thus be
selectively monitored. In all vapor phase exposures, the presence
of the free radical scavenger NAC protected the cells against
viability loss. These experiments provide more evidence that the
tobacco products containing modified tobacco (i.e., Quest 1.RTM.,
and Quest 3.RTM. had an impact on cell viability that was
significantly less than a reference tobacco product (i.e., IM16)
and, thus, Quest 1.RTM., and Quest 3.RTM. have a reduced potential
to contribute to a tobacco related disease (i.e., Quest 1.RTM. and
Quest 3.RTM. are reduced risk tobacco products). The following
section describes several epidemiological approaches to determine
the potential of a tobacco or a tobacco product to contribute to a
tobacco related disease.
[0217] Epidemiological Determinations
[0218] In still more embodiments, cells of the mouth, oral cavity,
trachea, or lung (e.g., NHBE cells) from a plurality of
individuals, preferably the same cell type, are independently
contacted with a tobacco composition (e.g., CS) in an amount and
for a time sufficient to induce damage of cellular genetic material
or modulate cell homeostasis. The fact that CS, as well as various
constituents of CS, can cause disruptions to the cell allows one to
develop a set of relevant biomarkers that are useful for monitoring
exposure to tobacco toxins, detecting pre-malignant disease,
improving diagnosis and prognosis of current disease, developing
new treatment options, and testing risk reduction strategies for
current and former smokers. Accordingly, also provided herein are
methods of detecting pre-malignant disease, improving diagnosis and
prognosis of current disease, developing new treatment options, and
testing risk reduction strategies for current and former smokers by
determining the amount of induction of damage of cellular genetic
material or modulation of cell homeostasis to the cells of a smoker
or other tobacco consumer or a subject exposed to a tobacco
composition. The cells of different individuals can respond
differently to tobacco compositions and thereby have different
levels of risk of developing a tobacco-related disease. The methods
provided herein for determining the amount of induction of damage
of cellular genetic material or modulation of cell homeostasis to
cells contacted with a tobacco composition can be used to assess a
subject's level of risk of developing a tobacco-related disease.
Such methods can be generally performed in accordance with the
methods provided herein, where the cells of the subject can be
first contacted with smoke from the tobacco product in vivo (e.g.,
by the subject smoking a cigarette or side-stream smoke exposure),
and then the cells can be harvested using known methods (e.g., lung
lavage or cheek swab); alternatively, the cells of a subject can be
first harvested and optionally cultured, and then contacted with
smoke from the tobacco product in accordance with the methods
provided herein.
[0219] For example, primary cultures of lung cells, bronchial
cells, cells of the mouth, pharynx, larynx, and tongue can be
generated from an individual to be tested and these cells are be
contacted with a tobacco composition (e.g., CS from a tobacco
product) so as to elucidate the individuals proclivity to acquire a
tobacco related disease. Certain patterns of amount of induction of
damage of cellular genetic material or modulation of cell
homeostasis to tobacco compositions can be associated with
individuals that do not develop a tobacco related disease and a
different pattern of amount of induction of damage of cellular
genetic material or modulation of cell homeostasis can be
associated with individuals that have developed a tobacco-related
disease. Analysis of the amount of induction of damage of cellular
genetic material or modulation of cell homeostasis of many of such
individuals allows the development of databases that provide an
expected type and amount of induction of damage of cellular genetic
material or modulation of cell homeostasis that is associated or
not associated with a tobacco-related disease. That is, this
information can be used to provide a baseline for an individual
that is not likely to acquire a tobacco-related disease (e.g., a
control level exemplified by non-tobacco users that do not develop
a tobacco-related disease) and a baseline for an individual that is
likely to acquire a tobacco related disease (e.g., a control level
exemplified by tobacco users that have developed a tobacco-related
disease). Accordingly, when a subject is analyzed for the
predilection to develop a tobacco-related disease, the amount of
induction of damage of cellular genetic material or modulation of
cell homeostasis can be evaluated and, by comparing the determined
values to that in one or both of the databases described above, the
analyzed subject can be identified as having a predilection for
developing a tobacco-related disease.
[0220] Additionally, a comparison of the induction of DNA damage
induced by conventional tobacco products and a tobacco product
containing a modified tobacco (e.g., a genetically modified
tobacco) is contemplated. By one approach, a first set of
biological samples (e.g., cells of the oral cavity (cheek or gum
swab) or lung cells (lung lavage)) are obtained from individuals
that are consumers of conventional tobacco products. These cells
are analyzed for double strand DNA breaks using one of the assays
described herein. Next, the individuals are provided a tobacco
product comprising a modified tobacco to consume exclusively (i.e.,
in replacement for the conventional product). After a period of
time has passed (e.g., 1, 2, 3, or 4 weeks or 1, 2, 3, 4, 5, 6, 7,
8, 9, 10, 11, or 12 months since the conversion from the
conventional tobacco product to the tobacco product containing the
modified tobacco), a second set of biological samples are taken
from the individual and are analyzed for the presence of double
strand DNA breaks. It will be determined that fewer double strand
breaks will be observed in the second set of biological samples
than the first set, which will provide evidence that the tobacco
product comprising the modified tobacco has a reduced potential to
contribute to a tobacco related disease (i.e., that said tobacco
product comprising the modified tobacco is a reduced risk tobacco
product).
[0221] Further provided herein are kits to be used in practicing
the above methods. In various embodiments such kits can comprise an
antibody that binds to phosphorylated but not unphosphorylated
H2AX, a reference smoke product, a detectably labeled second
antibody that specifically binds to the antibody that binds to
phosphorylated H2AX, and suitable cells, as provided herein
elsewhere.
[0222] Also provided herein are cells containing DNA having
double-stranded breaks produced by exposure to a tobacco smoke
product and, in particular, to genetically altered cells comprising
cells prepared by a method comprising the steps of: (a) exposing a
first cell population to a tobacco smoke product; (b) identifying
cells containing a greater degree of phosphorylated H2AX relative
to control cells; and (c) selectively collecting the cells
identified in step (b) to form the composition of genetically
altered cells. In preferred non-limiting embodiments, the cells
having a higher degree of phosphorylated H2AX are identified by an
immunofluorescence method and selectively collected, for example by
fluorescence activated cell sorting. To permit the identification
of genes associated with tobacco-induced diseases, also provided
herein are libraries prepared by cloning a plurality of nucleic
acid molecules prepared from the cells, the cells prepared
according to methods provided for forming cells containing DNA
having double-stranded breaks produced by exposure to a tobacco
smoke product, herein into a plurality of vector molecules. The
following section describes several types of modified tobacco that
can be used with the methods described herein.
[0223] Modified Tobacco
[0224] The methods provided herein can be used to analyze
traditional tobacco and/or modified tobacco. For example, the
methods provided herein can be used to identify a modified tobacco,
to identify a toxic compound in a modified tobacco, and to make a
product containing a modified tobacco. Generally, the methods
provided herein for analyzing modified tobacco can be performed in
accordance with the methods of identifying tobacco and tobacco
compounds, and methods of making a tobacco product, as provided
elsewhere herein. Modified tobacco that can be used in the methods
and tobacco products provided herein include chemically modified
tobacco, expanded, extracted, or puffed tobacco, reconstituted
tobacco, and genetically modified tobacco.
[0225] There is currently a great interest in developing approaches
to decrease the levels of noxious, carcinogenic, or addictive
substances including tar, nitrosamines, and nicotine in tobacco.
Although researchers have developed several approaches to reduce
some of these harmful compounds, many conventional techniques
result in a product that has poor taste, fragrance, or smoking
properties. Some processes, for example, reduce the nicotine
content of tobacco by microbial enzymatic degradation, chemical
extraction, or high pressure extraction. (See e.g., U.S. Pat. Nos.
4,557,280; 4,561,452; 4,848,373; 4,183,364; and 4,215,706, all of
which are hereby expressly incorporated by reference in their
entireties). More recently, techniques in genetic engineering and
chemically-induced gene suppression have been employed to make
reduced nicotine and/or TSNA tobacco. (See e.g., Conkling et al.,
WO98/56923; U.S. Pat. Nos. 6,586,661; 6,423,520; and U.S. patent
application Ser. Nos. 09/963,340; 10/356,076; 09/941,042;
10/363,069; 10/729,121; 10/943,346; Timko et al., WO 00/67558,
which designated the United States and was published in English,
Nakatani et al., U.S. Pat. Nos. 5,684,241; 5,369,023; 5,260,205;
and Roberts et al. 6,700,040, all of which are hereby expressly
incorporated by reference in their entireties).
[0226] Any of a variety of chemically modified tobaccos can be
included in the methods and tobacco products provided herein. For
example, the chemical modification can include palladium, or can
include an auxin, auxin analog, or jasmonate antagonist (see e.g.,
U.S. Pat. No. 6,789,548 and U.S. Pat. App. Pub. No. 20050072047,
both of which are hereby expressly incorporated by reference in
their entirety).
[0227] By one approach, a chemically modified tobacco is made as
follows. A tobacco is provided and a casing solution is applied
thereto. Thereafter, a plurality of metallic or carbonaceous
catalytic particles having a mean average or a mode average
particle size of less than about 20 microns is applied to the
tobacco in a form separate from the casing solution. Next, a
nitrate or nitrite source in a form separate from the casing
solution and in a form separate from the plurality of metallic or
carbonaceous catalytic particles is applied to the tobacco, before,
after or simultaneously with applying the plurality of particles
but after applying the casing solution, whereby a smoking
composition is obtained. In some embodiments of this modified
tobacco, a polyaromatic hydrocarbon, azaarene, carbazole, or a
phenolic compound is reduced. Using this approach, the Omni.RTM.
tobacco product was developed.
[0228] By another approach, a chemically modified tobacco is made
by identifying a tobacco plant in a field for nicotine reduction;
and contacting said tobacco plant with a composition selected from
the group consisting of an auxin, auxin analog, and jasmonate
antagonist from between about 21 days before topping to about 21
days after topping said tobacco plant, whereby the amount of
nicotine in said topped tobacco plant contacted with said
composition is below that of a topped tobacco plant of the same
variety, grown under the same conditions, which has not been
contacted with said composition.
[0229] In another example, the chemically modified tobacco can be
extracted tobacco. By some approaches the chemically modified
tobacco is extracted with an organic solvent and other processes
use super-critical fluid extraction or carbon dioxide. In another
example, the chemical modification can be a biotic modification.
Microbes that ingest nitrates and alkaloids can be applied to
tobacco so as to obtain a reduced nicotine tobacco; for example
such a biotic modification can include bacteria. In another
example, the tobacco is processed to remove the presence of a
microbe. In another example the chemically modified tobacco can be
sterilized, pasteurized, or radiated.
[0230] In another example, the chemically modified tobacco can have
added thereto an exogenous component of tobacco or analog thereof.
Tobacco can be modified to increase or decrease one or more
compounds such as proteins, metabolites, nicotine-related compounds
and sterols. In some methods provided herein, a tobacco which has
been modified to produce lower levels of one or more compounds such
as nicotine or a nicotine metabolite, or a sterol, can have
exogenously added thereto, one of these lower-level compounds, one
or more but not all lower-level compounds, or all lower-level
compounds or an analog of the compound(s). Such tobaccos with one
or more exogenously added compounds can be compared in accordance
with the methods provided herein to the same tobacco to which no
exogenous compound has been added, to which a different exogenous
compound has been added, or to which a different level of the same
exogenous compound has been added. For example, the methods
provided herein can be used to compare a tobacco that has been
genetically modified to produce reduced nicotine levels with the
same tobacco to which exogenous nicotine or a nicotine analog has
been added thereto. By performing such methods, the role of the
exogenously added compound on cell damage or other response
determined according to the methods provided herein (e.g.,
apoptosis or cell proliferation), can be determined.
[0231] In another example, the chemically modified tobacco has had
added thereto a compound or composition containing antioxidants.
Tobacco at any stage of its processing can have added thereto an
antioxidant compound or a composition with antioxidant properties.
Any of a variety of known antioxidant compounds can be added to the
tobacco, including, but not limited to, lycopene, tocopherol,
tocopherol metabolites, ascorbic acid, unsaturated fatty acids,
N-acetyl cysteine, and other antioxidants known in the art. A
composition with antioxidant properties can include a biological
composition or extract that can neutralized oxidants, such as milk
or milk proteins, tumeric or tumeric extracts, barley or barley
extracts, alfalfa or alfalfa extracts. Other compounds that can be
added to the tobacco include thiol-containing proteins, plant
extracts, aromatic compounds (e.g., caffeine or pentoxyfyllen,
which are contemplated to scavenge carcinogens).
[0232] Another form of modified tobacco is expanded or puffed
tobacco. Included herein are methods to produce reduced-exposure
tobacco products by utilizing the tobacco provided herein,
deproteinized tobacco fiber, and freeze dried tobacco in any
combination and in conjunction with expanded or puffed tobacco.
More than 150 patents have been issued related to tobacco expansion
(e.g., U.S. Pat. No. 3,991,772, herein expressly incorporated by
reference in its entirety). "Expanded tobacco" is an important part
of tobacco filler which is processed through expansion of suitable
gases so that the tobacco is "puffed" resulting in reduced density
and greater filling capacity. It reduces the weight of tobacco used
in cigarettes. Advantageously, expanded tobacco reduces tar,
nicotine and carbon monoxide deliveries and finds use, for example,
in making low tar, low nicotine, and low carbon monoxide delivery
cigarettes. Expanded tobacco is particularly useful in making
low-tar delivery cigarettes. Carlton.RTM. cigarettes, which have
had claims of being the lowest tar and nicotine delivery cigarette,
are reportedly made with a very large percentage of expanded
tobacco. However, use of expanded tobacco also results in reduced
nicotine delivery, which can result in compensation.
[0233] Any method for expansion of tobacco known in the art can be
used in the methods provided herein. The most common method used
today incorporates liquid carbon dioxide (U.S. Pat. Nos. 4,340,073
and 4,336,814, herein expressly incorporated by reference in its
entirety). Liquid propane has also been used for making commercial
cigarettes, predominantly in Europe (U.S. Pat. No. 4,531,529,
herein expressly incorporated by reference in its entirety). Liquid
propane offers advantages over carbon dioxide since higher 3Q
degrees of expansion are possible, in the range of 200%. Under
pressure, the liquid carbon dioxide (or liquid propane) permeates
the tobacco cell structure. When the tobacco is rapidly heated the
carbon dioxide (or liquid propane) expands the cell back to its
pre-cured size.
[0234] Another form of modified tobacco is reconstituted tobacco.
Included herein are methods to produce reduced-exposure tobacco
products by utilizing the tobacco provided herein, deproteinized
tobacco fiber, and freeze dried tobacco in any combination and in
conjunction with reconstituted tobacco. "Reconstituted tobacco"
("recon") is an important part of tobacco filler made from tobacco
dust and other tobacco scrap material, processed into sheet form
and cut into strips to resemble tobacco. In addition to the cost
savings, reconstituted tobacco is very important for its
contribution to cigarette taste from processing flavor development
using reactions between ammonia and sugars.
[0235] The process to produce sheets of reconstituted tobacco
("recon") began during the 1950s. U.S. patents that describe such
processes include: U.S. Pat. Nos. 3,499,454, 4,182,349 4,962,774,
and 6,761,175, herein expressly incorporated by reference in its
entirety. Recon is traditionally produced from tobacco stems and/or
smaller leaf particles in a process that closely resembles a
typical paper making process. The tar and nicotine yields of
reconstituted tobacco are lower than those from equivalent
quantities of whole tobacco leaf. This process entails processing
the various tobacco portions that are to be made into Recon. After
the Recon sheets are produced they are cut into a size and shape
that resembles cut rag tobacco made from whole leaf tobacco. This
cut recon then gets mixed with cut-rag tobacco and is ready for
cigarette making.
[0236] Cigarettes can be manufactured with all recon, no recon, or
any combination thereof. Most major brands have at least 10% of
Recon in the Filler.
[0237] In another embodiment add nicotine can be added, or nicotine
salts, to produce recon, which is made from reduced-nicotine
transgenic tobacco or any non-tobacco plant material including but
not limited to herbal blends so that when such reconstituted sheet
is burned it yields substantially less tobacco-specific
nitrosamines and other carcinogens produced from conventional
cigarettes, yet satisfactory amounts are nicotine are present.
[0238] Processes of removing proteins from tobacco, thereby
creating "deproteinized tobacco fiber" are known in the art, as
exemplified in U.S. Pat. Nos. 4,289,147 and 4,347,324, herein
expressly incorporated by reference in its entirety. Tobacco fiber
is a major byproduct after removing protein. The fibrous remains
from deproteinized tobacco can be included in any percentage as an
ingredient of reconstituted tobacco. Cigarettes made from
deproteinized tobacco have a different taste than conventional
cigarettes. However, appropriate amounts of additives, including
flavorings and nicotine, can be added to help alleviate this taste
deficiency.
[0239] Cigarettes containing deproteinized tobacco have a
significant advantage over conventional cigarettes since they
produce reduced levels of carcinogens and harmful combustion
products. "A 71% reduction in protein content of a flue-cured
tobacco sheet resulted in an 81% reduction in the TA98 Ames
mutagenicity" of the pyrolytic condensate" (Clapp, W. L., et al.,
"Reduction in Ames Salmonella mutagenicity of cigarette mainstream
smoke condensate by tobacco protein removal", Mutation Research,
446, pg 167-174, 1999). Previous research in this area had
determined that tobacco leaf protein might be the principal
precursor of mutagens in TSC (Matsumoto, et al, "Mutagenicities of
the pyrolysis of peptides and proteins", Mutation Research, 56, pg
281-288, 1978).
[0240] Extracting tobacco fiber from genetically modified
reduced-nicotine tobacco effectively eliminates virtually all
carcinogenic TSNAs such tobacco, since nitrosamines require
relatively high concentrations of nicotine and other alkaloids to
form at detectable levels.
[0241] Therefore, it can be advantageous to utilize
reduced-nicotine tobacco in reduced-exposure cigarettes or other
tobacco products to further reduce nitrosamines. Nicotine can be
either left out or introduced later in the process, which can also
be in the form of nicotine salts.
[0242] PAHs are formed from high temperature pyrolysis of amino
acids, sugars, paraffins, terpenes, phytosterols, celluloses and
other components of tobacco. Most of these components are greatly
reduced in tobacco fiber, effectively reducing formation of PAHs.
Catechols and phenols, recognized carcinogenic co-factors in CS,
would also be reduced since low levels of soluble sugar are present
in tobacco fiber.
[0243] Harmful gas phase compounds such as hydrogen cyanide,
nitrogen oxides, and carbon monoxide are also reduced when
cigarette containing only tobacco fiber is smoked compared to
cigarettes made with whole-leaf tobacco. Hydrogen cyanide is formed
from burning proteins and chlorophyll. Nitrogen oxides are formed
from burning soluble protein, chlorophyll, nitrates, and alkaloids.
These components would not be present in significant amounts in
deproteinized tobacco. Tobacco fiber has approximately 85 percent
less starches and cellulosic material thus reducing the major
pyrolytic precursors of carbon monoxide.
[0244] In another embodiment, methods are provided to produce
reconstituted tobacco that includes extracted tobacco fiber derived
from conventional tobacco, reduced-nicotine transgenic tobacco, or
increased-nicotine transgenic tobacco.
[0245] If the tobacco curing process is circumvented, virtually no
TSNAs will be present in traditional tobacco products such as
cigarettes, cigar filler or wrapper, roll-your-own tobacco for
cigarettes, pipe tobacco, chewing tobacco, snuff, reconstituted
tobacco and other preparations made with freeze-dried tobacco would
contain virtually no TSNAs since traditional curing processes are
eliminated.
[0246] In another embodiment TSNAs can be virtually eliminated
through processing freshly harvested tobacco using lyophilization.
This is accomplished by processing freshly harvested tobacco
through freeze-drying units located near tobacco farms. Tobacco
processed in this manner can be grown in a traditional fashion with
spacing of plants or in a biomass setting. In addition to the
economic advantages of eliminating the costs associated with the
curing process, the tobacco can now be grown in a biomass fashion
that can create hundreds of thousands of pounds of fresh tobacco
per acre.
[0247] By growing tobacco in a biomass setting and immediately
freeze drying the fresh tobacco for cigarettes,
roll-your-own-tobacco, pipe tobacco, cigar filler or wrapper,
chewing tobacco, snuff, and other versions of smokeless tobacco,
labor is reduced not only by eliminating the transplant of each
plant from greenhouse to the field but also by eliminating
traditional harvesting and curing of the tobacco. Also, farmland
needed for this purpose is greatly reduced. The yield of tobacco
from one acre of tobacco grown in biomass is equivalent to
approximately 100 acres of tobacco grown in a traditional
manner.
[0248] "Tobacco biomass" is achieved by direct sowing an acre of
land with copious quantities of tobacco seed within a few inches of
each other in the field. Unlike tobacco planted with traditional
spacing, individual plants can no longer be differentiated when
tobacco is planted in a biomass fashion. An acre of tobacco biomass
has the appearance of a continuous, dense, green carpet. U.S. Pub.
Pat. App. No. 20020197688, herein expressly incorporated by
reference in its entirety, describes such methods.
[0249] Lyophilization removes most of the water (-80%) from the
weight of fresh harvested tobacco biomass. The result is Freeze
Dried Tobacco ("FDT"). FDT is easily pulverized into fine particles
suitable for processing into reconstituted tobacco sheet (recon).
This recon can be cut and made into any type of tobacco product
such as filler for cigarettes, roll-your-own-tobacco, pipe tobacco,
cigar filler or wrapper, chewing tobacco, snuff, and other forms of
smokeless tobacco. Flavorings and additives, including sugars, can
be incorporated into the recon process.
[0250] Such recon can be made from 100 percent FDT or in any
proportion that consumers prefer. The lyophilization process can
have adverse affects on the taste of such tobacco products.
Therefore, FDT can even be mixed in any percentage with traditional
pulverized, cured tobacco so that the mixture can be made into
reconstituted tobacco. Alternatively, FDT can be mixed in any
percentages with any forms of traditional tobacco conducive for
manufacturing cigarettes, roll-your-own tobacco, pipe tobacco, and
cigar filler or wrapper, chewing tobacco, snuff and other versions
of smokeless tobacco in order to satisfy the tastes of the mass
market.
[0251] In another embodiment genetically modified reduced-nicotine
tobacco can be used for reducing TSNAs as described above, thereby
creating an additional benefit of such cigarettes,
roll-your-own-tobacco, pipe tobacco, cigar filler or wrapper,
chewing tobacco, snuff and other versions of smokeless tobacco
being non-addictive and without any nitrosamines.
[0252] In another embodiment, nicotine can be added, in amounts
that deliver the desired physiological response, back to the FDT
for uses in cigarettes, cigar filler or wrapper, roll-your-own
tobacco for cigarettes, pipe tobacco, chewing tobacco, snuff, and
other versions of smokeless tobacco so that they will contain
virtually no TSNAs. Cigarettes produced from tobacco fiber obtained
from green leaf cured tobacco.
[0253] In another embodiment, Nicotiana rustica and/or
increased-nicotine transgenic Nicotiana tabacum are freeze dried
after harvest and are incorporated into recon. The benefits are
that the high alkaloid content is preserved for low TNR cigarettes
and that the tobacco curing step is saved. Also, the associated
increase in TSNAs with high alkaloid tobaccos will not materialize.
Preferred tobaccos for use with the methods described herein
include genetically modified tobaccos as described in the following
sections.
[0254] Genetically Modified Tobacco
[0255] In this application, several approaches to create
genetically modified tobacco having a reduced amount of a harmful
compound are described. Many embodiments concern nucleic acid
constructs that inhibit the expression of a gene, which regulates
production of a compound that is associated with a tobacco-related
disease. Since these nucleic acid constructs efficiently reduce the
presence of a compound that contributes to a tobacco-related
disease, the genetically modified tobacco, prepared as described
herein, can be used to create a tobacco product, such as a
cigarette, which has a reduced potential to contribute to a
tobacco-related disease. That is, aspects of the invention concern
"reduced risk" tobacco products made from "reduced risk" transgenic
tobacco created using the nucleic acid constructs described
herein.
[0256] More specifically, aspects of the invention concern nucleic
acid constructs that inhibit the expression of a number of genes
involved in the synthesis and regulation of the production of
nicotine, nornicotine, and/or sterols in tobacco. Alkaloids such as
nicotine and nornicotine are precursors for a number of harmful
compounds that contribute to tobacco-related disease (e.g., the
tobacco specific nitrosamines (TSNAs): N'-nitrosonornicotine (NNN),
N'-nitrosoanatabine (NAT), N'-nitrosoanabasine (NAB),
4-(N-nitrosomethylamino)-1-(3-pyridyl)-1-butanone (NNK),
4-(N-nitrosomethylamino)-4-(3-pyridyl)-1-butanal
(NNA)-4-N-nitrosomethylamino)-1-(3-pyridyl)-1-butanol (NNAL),
4-N-nitrosomethylamino)-4-(3-pyridyl)-1-butanol (iso-NNAL) and/or
4-(N-nitrosomethylamino)-4-(3-pyridyl)-butanoic acid (iso-NNAC) and
acrolein). Sterols are precursors for a number of harmful
compounds, which are generated by pyrolysis of tobacco, that also
contribute to tobacco-related disease (e.g., polyaromatic
hydrocarbons (PAHs), such as benz[a]pyrene (BAP), heterocyclic
hydrocarbons, terpenes, paraffins, aromatic amines, and
aldehydes).
[0257] Because the presence of these harmful compounds in tobacco
contributes to tobacco-related disease, a transgenic or genetically
modified tobacco that comprises a reduced amount of any one of
these compounds, as compared to a reference tobacco (e.g., the
industry standard reference tobacco IM16 (Philip Morris.RTM. USA)
or the full-flavor low tar reference cigarette 2R4F or the ultra
low tar cigarette 1R5F, which are Kentucky reference cigarettes
that can be obtained from the Tobacco and Health Institute at the
University of Kentucky), a conventional tobacco (e.g., a
commercially available tobacco of the same class (e.g.,
"full-flavor" or "light" or "ultra-light")) or a non-transgenic
tobacco (e.g., a tobacco of the same variety, such as Burley,
Virginia Flue, or Oriental, or strain, such as LA Burley 21, K326,
Tn90, Djebe1174, as the transgenic tobacco prior to genetic
modification) has a reduced potential to contribute to a
tobacco-related disease. This "reduced risk" transgenic tobacco can
then be processed, optionally, sterilized or otherwise made
substantially-free of microbes, and said tobacco can be
incorporated into tobacco products, preferably, cigarettes,
optionally, by an aseptic approach so as to not introduce microbes
(e.g., bacteria, mold, yeast, and fungi) into the products. Tobacco
products comprising said transgenic tobacco can then be packaged,
optionally, by an aseptic approach in air-tight or microbe-free
packaging so as to not introduce microbes into the products.
[0258] In this manner, the conversion of alkaloid to TSNA, which
results from microbial growth on the tobacco when microbes are
introduced during processing, packaging, and storage, is
significantly reduced. By using the embodied tobacco preparative
methods, which may include several aseptic processing,
manufacturing, and packaging procedures, one can maintain an amount
of total TSNA (e.g., the collective content of NNN, NAT, NAB, and
NNK) in a commercially available tobacco product of less than or
equal to 0.5 .mu.g/g (e.g., 0.05 .mu.g/g, 0.1 .mu.g, 0.2 .mu.g/g,
0.3 .mu.g/g, 0.4 .mu.g/g, or 0.5 .mu.g/g) for a period of at least
1 week, 1 month, or 1-5 years after packaging or incorporation of
the tobacco into a tobacco product (e.g., at least 1-30 days, 30-90
days, 90-180 days, 180-270 days, 270 days-365 days, 1 year-1.5
years, 1.5-2.0 years, 2.0 years-2.5 years, 2.5 years-3.0 years, 3.0
years-4 years, and 4.0 years-5.0 years).
[0259] In some embodiments, a transgenic tobacco comprising a
reduced amount of alkaloid (e.g., a reduced amount of nicotine,
nornicotine, and/or TSNAs) and one or more of the isolated nucleic
acids, nucleic acid cassettes, or nucleic acid constructs described
herein is contacted with an exogenous nicotine so as to raise the
level of nicotine in the contacted transgenic tobacco in a
controlled fashion. By this approach, nicotine levels in transgenic
tobacco that comprises a reduced amount of endogenous nicotine
(i.e., nicotine that is produced by the transgenic plant from which
the transgenic tobacco is obtained) can be selectively raised to
levels that are commensurate with conventional full-flavor
cigarettes, light cigarettes, or ultra-light cigarettes. (See e.g.,
WO 2005/018307, which designates the United States and was
published in English, herein expressly incorporated by reference in
its entirety). For example, transgenic tobacco comprising a reduced
amount of endogenous nicotine and/or TSNAs can be contacted with an
amount of exogenous nicotine that is at least, equal to, or more
than 0.3 mg/g-20.0 mg/g (nicotine/gram of tobacco). That is,
transgenic tobacco comprising a reduced amount of endogenous
nicotine and/or TSNAs can be contacted with an amount of exogenous
nicotine that is at least, equal to, or more than 0.3 mg/g, 0.4
mg/g, 0.5 mg/g, 0.6 mg/g, 0.7 mg/g, 0.8 mg/g, 0.9 mg/g, 1.0 mg/g,
1.1 mg/g, 1.2 mg/g, 1.3 mg/g, 1.4 mg/g, 1.5 mg/g, 1.6 mg/g, 1.7
mg/g, 1.8 mg/g, 1.9 mg/g, 2.0 mg/g, 2.1 mg/g, 2.2 mg/g, 2.3 mg/g,
2.4 mg/g, 2.5 mg/g, 2.6 mg/g, 2.7 mg/g, 2.8 mg/g, 2.9 mg/g, 3.0
mg/g, 3.1 mg/g, 3.2 mg/g, 3.3 mg/g, 3.4 mg/g, 3.5 mg/g, 3.6 mg/g,
3.7 mg/g, 3.8 mg/g, 3.9 mg/g, 4.0 mg/g, 4.1 mg/g, 4.2 mg/g, 4.3
mg/g, 4.4 mg/g, 4.5 mg/g, 4.6 mg/g, 4.7 mg/g, 4.8 mg/g, 4.9 mg/g,
5.0 mg/g, 5.1 mg/g, 5.2 mg/g, 5.3 mg/g, 5.4 mg/g, 5.5 mg/g, 5.6
mg/g, 5.7 mg/g, 5.8 mg/g, 5.9 mg/g, 6.0 mg/g, 6.1 mg/g, 6.2 mg/g,
6.3 mg/g, 6.4 mg/g, 6.5 mg/g, 6.6 mg/g, 6.7 mg/g, 6.8 mg/g, 6.9
mg/g, 7.0 mg/g, 7.1 mg/g, 7.2 mg/g, 7.3 mg/g, 7.4 mg/g, 7.5 mg/g,
7.6 mg/g, 7.7 mg/g, 7.8 mg/g, 7.9 mg/g, 8.0 mg/g, 8.1 mg/g, 8.2
mg/g, 8.3 mg/g, 8.4 mg/g, 8.5 mg/g, 8.6 mg/g, 8.7 mg/g, 8.8 mg/g,
8.9 mg/g, 9.0 mg/g, 9.1 mg/g, 9.2 mg/g, 9.3 mg/g, 9.4 mg/g, 9.5
mg/g, 9.6 mg/g, 9.7 mg/g, 9.8 mg/g, 9.9 mg/g, 10.0 mg/g, 10.1 mg/g,
10.2 mg/g, 10.3 mg/g, 10.4 mg/g, 10.5 mg/g, 10.6 mg/g, 10.7 mg/g,
10.8 mg/g, 10.9 mg/g, 11.0 mg/g, 11.1 mg/g, 11.2 mg/g, 11.3 mg/g,
11.4 mg/g, 11.5 mg/g, 11.6 mg/g, 11.7 mg/g, 11.8 mg/g, 11.9 mg/g,
12.0 mg/g, 12.1 mg/g, 12.2 mg/g, 12.3 mg/g, 12.4 mg/g, 12.5 mg/g,
12.6 mg/g, 12.7 mg/g, 12.8 mg/g, 12.9 mg/g, 13.0 mg/g, 13.1 mg/g,
13.2 mg/g, 13.3 mg/g, 13.4 mg/g, 13.5 mg/g, 13.6 mg/g, 13.7 mg/g,
13.8 mg/g, 13.9 mg/g, 14.0 mg/g, 14.1 mg/g, 14.2 mg/g, 14.3 mg/g,
14.4 mg/g, 14.5 mg/g, 14.6 mg/g, 14.7 mg/g, 14.8 mg/g, 14.9 mg/g,
15.0 mg/g, 15.1 mg/g, 15.2 mg/g, 15.3 mg/g, 15.4 mg/g, 15.5 mg/g,
15.6 mg/g, 15.7 mg/g, 15.8 mg/g, 15.9 mg/g, 16.0 mg/g, 16.1 mg/g,
16.2 mg/g, 16.3 mg/g, 16.4 mg/g, 16.5 mg/g, 16.6 mg/g, 16.7 mg/g,
16.8 mg/g, 16.9 mg/g, 17.0 mg/g, 17.1 mg/g, 17.2 mg/g, 17.3 mg/g,
17.4 mg/g, 17.5 mg/g, 17.6 mg/g, 17.7 mg/g, 17.8 mg/g, 17.9 mg/g,
18.0 mg/g, 18.1 mg/g, 18.2 mg/g, 18.3 mg/g, 18.4 mg/g, 18.5 mg/g,
18.6 mg/g, 18.7 mg/g, 18.8 mg/g, 18.9 mg/g, 19.0 mg/g, 19.1 mg/g,
19.2 mg/g, 19.3 mg/g, 19.4 mg/g, 19.5 mg/g, 19.6 mg/g, 19.7 mg/g,
19.8 mg/g, 19.9 mg/g, and 20.0 mg/g (nicotine/gram tobacco)). In
some of the aforementioned embodiments, said transgenic tobacco
comprises one or more of the isolated nucleic acids, isolated
nucleic acid cassettes, or isolated nucleic acid constructs,
described herein.
[0260] Nicotine-containing fractions, nicotine, or nicotine salts
of organic acids are added to the reduced-nicotine transgenic
tobacco by contacting said tobacco (e.g., spraying or additive
application), with or without propylene glycol, solvent, flavoring,
or water at any stage of the harvesting, curing, fermenting, aging,
reconstituting, expanding, or otherwise processing of the tobacco,
preferably at a stage that is post-cure, when flavorings and
additives are provided. By "exogenous nicotine" is meant nicotine,
nicotine derivatives, nicotine analogs, nicotine-containing
fractions (e.g., extracts of Nicotiana), and nicotine salts of
organic acids obtained from a source outside of the transgenic
tobacco to which the exogenous nicotine is applied. In this manner,
a transgenic tobacco with virtually any amount of nicotine can be
obtained.
[0261] In some embodiments, the exogenous nicotine (e.g.,
commercially available nicotine salts, liquid, or a
nicotine-containing extract prepared from a Nicotiana plant or
portion thereof) is contacted with a reduced-alkaloid transgenic
tobacco (e.g., a transgenic tobacco comprising a reduced amount of
nicotine and/or TSNA as prepared as described herein) after the
transgenic tobacco has been made substantially free of microbes
(e.g., bacteria, yeast, mold, or fungi). The reduced alkaloid
transgenic tobacco can be made substantially-free of microbes
(e.g., an aseptic preparation) by employing sterilization, heat
treatment, pasteurization, steam treatment, gas treatment, and
radiation (e.g., gamma, microwave, and ultraviolet). The term
"substantially-free of microbes" in some contexts can mean an
amount of bacteria, mold, fungi, or yeast that is reduced to the
point that the conversion of nicotine or total alkaloid to TSNA is
negligible (e.g., the resultant concentration of total TSNA (e.g.,
NNN, NNK, NAT, and NAB in a tobacco or tobacco product is equal to
or below 0.5 m/g (e.g., 0.05 m/g, 0.1m, 0.2 m/g, 0.3 m/g, 0.4 m/g,
or 0.5 m/g) after prolonged storage (e.g., at least 1-30 days,
30-90 days, 90-180 days, 180-270 days, 270 days-365 days, 1
year-1.5 years, 1.5-2.0 years, 2.0 years-2.5 years, 2.5 years-3.0
years, 3.0 years-4 years, and 4.0 years-5.0 years)). The term
"substantially-free of microbes" also includes the term
"substantially-free of bacteria," which means in some contexts that
the tobacco or tobacco product is substantially-free of
Arthrobacter, Proteus, nicotine oxidizing bacteria, such as P-34,
Psuedomonas, Xantomonas, or Zoogloea strains of bacteria. For
example, a tobacco or tobacco product is substantially-free of
bacteria or a particular strain of bacteria when said tobacco or
tobacco product has less than or equal to 20% of the bacteria or a
specific strain of bacteria normally present on the tobacco or
tobacco product in the absence of application of a technique to rid
the tobacco or tobacco product of bacteria (e.g., less than or
equal to 1%, 2%, 3%, 4% 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%,
14%, 15%, 16%, 17%, 18%, 19%, or 20%). With respect to transgenic
tobacco described herein, the term "substantially-free of bacteria"
can refer to tobacco or a tobacco product containing said
transgenic tobacco that has less than or equal to 20% of the
bacteria normally present on the strain of tobacco prior to genetic
modification and/or application of a technique to rid the tobacco
or tobacco product of bacteria (e.g., less than or equal to 1%, 2%,
3%, 4% 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%,
18%, 19%, or 20%).
[0262] Once the exogenous nicotine has been contacted with the
microbe-free transgenic tobacco, it is preferably processed and
packaged aseptically and the tobacco product is maintained in an
airtight container so as to not re-introduce microbes that convert
the exogenous nicotine to TSNAs. By using the aseptic processing,
manufacturing, and packaging procedures, described herein, one can
maintain an amount of total TSNA (e.g., the collective content of
NNN, NAT, NAB, and NNK) in a commercially available tobacco
product, which comprises exogenous nicotine, of less than or equal
to 0.5 m/g (e.g., 0.05 m/g, 0.1m, 0.2 m/g, 0.3 m/g, 0.4 m/g, or 0.5
m/g) for at least 1 week, 1 month, or 1-5 years after packaging
(e.g., at least 1-30 days, 30-90 days, 90-180 days, 180-270 days,
270 days-365 days, 1 year-1.5 years, 1.5-2.0 years, 2.0 years-2.5
years, 2.5 years-3.0 years, 3.0 years-4 years, and 4.0 years-5.0
years). In some embodiments, the exogenous nicotine is contacted
with a transgenic tobacco comprising one of the nucleic acid
constructs described herein and a collective content of NNN, NAT,
NAB, and NNN is less than or equal to 0.5 .mu.g/g (e.g., 0.05
.mu.g/g, 0.1 .mu.g, 0.2 .mu.g/g, 0.3 .mu.g/g, 0.4 .mu.g/g, or 0.5
.mu.g/g). In some embodiments, a collective content of NNN, NAT,
NAB, and NNN of less than or equal to 0.5 .mu.g/g (e.g., 0.05
.mu.g/g, 0.1 .mu.g, 0.2 .mu.g/g, 0.3 .mu.g/g, 0.4 .mu.g/g, or 0.5
.mu.g/g) in a tobacco product containing said transgenic tobacco
can be maintained for at least at least 1 week, 1 month, or 1-5
years after packaging (e.g., at least 1-30 days, 30-90 days, 90-180
days, 180-270 days, 270 days-365 days, 1 year-1.5 years, 1.5-2.0
years, 2.0 years-2.5 years, 2.5 years-3.0 years, 3.0 years-4 years,
and 4.0 years-5.0 years). Accordingly, several embodiments of the
invention address the problem of gradually increasing TSNA levels
in alkaloid-containing tobacco products by employing processing,
storage, and packaging methods that reduce the amount of microbial
flora on the tobacco, limit the re-introduction of microbes during
processing and maintain a reduced amount of microbes (e.g.,
bacteria) once the product is packaged, stored, and sold. Tobacco
and tobacco products comprising transgenic tobacco having a reduced
amount of endogenous nicotine and an amount of exogenous nicotine
can be analyzed by various methods to confirm that said tobacco and
said tobacco products are "reduced risk" or have less of a
potential to contribute to a tobacco-related disease, as compared
to the parent strain of tobacco having conventional amounts of
endogenous nicotine or a reference tobacco, as described supra.
[0263] By using the constructs described herein, the amount of
harmful compounds in tobacco, such as alkaloids and sterols, can be
removed and a tobacco product comprising this genetically modified
tobacco, with or without exogenous nicotine, will have a reduced
potential to contribute to a tobacco-related disease. That is,
genetically modified tobacco comprising the constructs described
herein can be used to manufacture "reduced risk" tobacco products
(e.g., a tobacco product comprising a reduced endogenous nicotine,
reduced endogenous nornicotine, and/or reduced sterol tobacco),
such as a cigarette, which may have exogenous nicotine incorporated
therein.
[0264] Tobacco products that comprise a tobacco comprising one of
the nucleic acid constructs described herein include "full-flavor,"
"lights," and "ultra light" cigarettes with both reduced levels of
alkaloids and levels of alkaloids commensurate with a level of
alkaloid common to the particular class of cigarette (i.e., a
conventional amount of nicotine). The term "tobacco products"
includes, but is not limited to, smoking materials (e.g.,
cigarettes, cigars, pipe tobacco), snuff, chewing tobacco, gum, and
lozenges.
[0265] The term "reduced risk tobacco product" or "reduced risk
tobacco" includes, but is not limited to, a tobacco product or
tobacco comprising a genetically modified tobacco that has a
reduced amount of a compound that contributes to a tobacco-related
disease, such as nicotine, nornicotine, a sterol, or the
metabolites thereof including, but not limited to, a TSNA, an
acrolein, an aldehyde, or harmful compounds generated upon
pyrolysis of tobacco, including but not limited to, PAH, BAP, a
heterocyclic hydrocarbon, or an aromatic amine, as compared to the
amount of these compounds in or generated by a reference tobacco or
reference tobacco product (e.g., IM16, 1R5F, or 2R4F), a
commercially available tobacco product of the same class (e.g.,
full-flavor, lights, and ultra-lights), or, preferably, a tobacco
of the same variety (e.g., Burley, Virginia Flue, or Oriental) or
strain (e.g., LA Burley 21, K326, Tn90, Djebe1174) as the
transgenic tobacco prior to genetic modification). In other
contexts, a reduced risk tobacco or a reduced risk tobacco product
refers to a transgenic tobacco or a tobacco product comprising
transgenic tobacco that up-regulates fewer genes associated with a
tobacco-related disease as compared to a reference tobacco or
reference tobacco product (e.g., IM16, 1R5F, or 2R4F), a
commercially available tobacco product of the same class (e.g.,
full-flavor, lights, and ultra-lights), or, preferably, a tobacco
of the same variety (e.g., Burley, Virginia Flue, or Oriental) or
strain (e.g., LA Burley 21, K326, Tn90, Djebe1174) as the
transgenic tobacco prior to genetic modification).
[0266] In some embodiments, it is desirable to confirm that the
transgenic tobacco comprising the reduced amount of a harmful
compound, in fact, has a reduced potential to contribute to a
tobacco-related disease or that said transgenic tobacco is a
reduced risk tobacco or tobacco product. Accordingly, this
disclosure provides several assays that can be used to make this
determination. Many of these assays have confirmed that embodiments
of the transgenic tobaccos described herein have a reduced
potential to contribute to a tobacco-related disease (i.e., that a
reduced risk tobacco has been obtained).
[0267] That is, aspects of the invention concern methods to
identify a tobacco or tobacco product that has a reduced potential
to contribute to a tobacco-related disease (i.e., a reduced risk
tobacco or tobacco product). By one approach, smoke or a smoke
condensate from a transgenic tobacco comprising a reduced amount of
a compound (e.g., nicotine, nornicotine, TSNA, or a sterol) is
contacted with a first population of cells and the modulation
(e.g., up-regulation or down-regulation) of the expression of a
gene or a plurality of genes is compared with the expression of the
same gene or plurality of genes in a second population of cells
that are contacted with smoke or a smoke condensate from a
reference tobacco or reference tobacco product (e.g., IM16, 1R5F,
or 2R4F), a commercially available tobacco product of the same
class (e.g., full-flavor, lights, and ultra-lights), or,
preferably, a tobacco of the same variety (e.g., Burley, Virginia
Flue, or Oriental) or strain (e.g., LA Burley 21, K326, Tn90,
Djebe1174) as the transgenic tobacco prior to genetic
modification). A determination that said transgenic tobacco has a
reduced potential to contribute to a tobacco-related disease (e.g.,
a determination that said transgenic tobacco is a reduced risk
tobacco) is confirmed by the identification of a reduction in the
expression of a gene that is associated with a tobacco-related
disease or an increase in the expression of a gene that is
associated with cell damage repair (e.g., repair of oxidative
damage).
[0268] In still other contexts, a reduced risk tobacco or a reduced
risk tobacco product refers to a transgenic tobacco or a tobacco
product comprising transgenic tobacco that induces a
down-regulation of fewer genes associated with the repair of
tobacco-induced damage (e.g., oxidative damage), as compared to a
reference tobacco or reference tobacco product (e.g., IM16, 1R5F,
or 2R4F), a commercially available tobacco product of the same
class (e.g., full-flavor, lights, and ultra-lights), or,
preferably, a tobacco of the same variety (e.g., Burley, Virginia
Flue, or Oriental) or strain (e.g., LA Burley 21, K326, Tn90,
Djebe1174) as the transgenic tobacco prior to genetic
modification). In still more contexts, a reduced risk tobacco or a
reduced risk tobacco product refers to a transgenic tobacco or a
tobacco product comprising transgenic tobacco that induces a
reduced level of inhibition of cell proliferation, as compared to a
reference tobacco or reference tobacco product (e.g., IM16, 1R5F,
or 2R4F), a commercially available tobacco product of the same
class (e.g., full-flavor, lights, and ultra-lights), or,
preferably, a tobacco of the same variety (e.g., Burley, Virginia
Flue, or Oriental) or strain (e.g., LA Burley 21, K326, Tn90,
Djebe1174) as the transgenic tobacco prior to genetic
modification). In some embodiments, a reduced risk tobacco product
can comprise exogenous nicotine (e.g., transgenic tobacco
comprising a reduced amount of endogenous nicotine and TSNAs, which
has been contacted with exogenous nicotine and maintained under
conditions that inhibit proliferation of microbes, such as
bacteria).
[0269] Several assays are provided, which can be used to confirm
that the transgenic tobacco created as described herein with or
without exogenous nicotine has in fact, a lower potential to
contribute to a tobacco-related disease (i.e., a reduced risk
tobacco or tobacco product, as compared to conventional tobacco
products, a reference tobacco product, or a tobacco product
comprising the same). Some of the embodiments described herein
compare the effects/damage (e.g., the extent of DNA damage,
inhibition of apoptosis, or inhibition of cell proliferation)
induced by smoke or smoke condensate generated from a transgenic
tobacco or a tobacco product containing transgenic tobacco to a
reference tobacco or reference tobacco product (e.g., IM16, 1R5F,
or 2R4F), a commercially available tobacco product of the same
class (e.g., full-flavor, lights, and ultra-lights), or,
preferably, a tobacco of the same variety (e.g., Burley, Virginia
Flue, or Oriental) or strain (e.g., LA Burley 21, K326, Tn90,
Djebe1174) without the genetic modification. In some embodiments,
the transgenic tobacco or tobacco product comprising said
transgenic tobacco also has incorporated therein an amount of
exogenous nicotine and this product is compared to the parental
strain of tobacco (i.e., tobacco of the same variety without
genetic modification).
[0270] It should also be emphasized that the word "reduced," or the
phrase "a reduced amount" is intended to refer to an amount of a
harmful compound (e.g., total alkaloid, nicotine, nornicotine, a
sterol, or the metabolites thereof including, but not limited to, a
TSNA, an acrolein, an aldehyde, or compounds generated by pyrolysis
including PAH, BAP, a heterocyclic hydrocarbon, or an aromatic
amine) in a genetically modified tobacco plant, tobacco, or a
tobacco product that is less than the amount of said harmful
compound found, or generated preferably, in a tobacco plant,
tobacco, or a tobacco product from the same class of tobacco
product (e.g., full-flavor, light, ultra-light), same variety of
tobacco (e.g. the parental strain of tobacco prior to genetic
modification), or in comparison to a reference cigarette (e.g.,
IM16, 1R5F, or 2R4F), which has not been genetically modified.
Thus, in some contexts and embodiments, wild-type tobacco of the
same variety that has been grown and processed in the same manner
as the genetically modified tobacco is used as a control by which
to measure whether a reduction in a harmful compound has been
obtained by the inventive methods described herein. In other
embodiments, the determination of whether a reduced amount of a
harmful compound in a transgenic tobacco or generated by a
transgenic tobacco upon pyrolysis has been obtained is made by
comparing the amount of a harmful compound in or generated from the
transgenic tobacco to a commercially available cigarette and/or a
reference cigarette (e.g., IM16, 1R5F, or 2R4F).
[0271] Accordingly, aspects of the invention concern genetically
modified tobacco and tobacco products containing a tobacco that
comprises a genetic modification, which have a reduced amount or
are substantially free of a harmful compound including, but not
limited to, nicotine, nornicotine, a sterol, an acrolein, an
aldehyde, a TSNA selected from the group consisting of
N'-nitrosonornicotine (NNN),
4-(N-nitrosomethylamino)-1-(3-pyridyl)-1-butanone (NNK),
N'-nitrosoanatabine (NAT), and/or N'-nitrosoanabasine (NAB) or
generate a reduced amount of a PAH, a BAP, a heterocyclic
hydrocarbon, an aromatic amine upon pyrolysis, wherein this reduced
risk genetically modified tobacco is made by lowering the
expression of a gene in said tobaccos with one of the constructs
described herein. Preferred embodiments include a transgenic
tobacco and a tobacco product (e.g., cigarette) that comprises a
cured tobacco comprising a genetic modification and a reduced
amount of nicotine or total alkaloid (e.g., below a conventional
level of nicotine or total alkaloid typical for the strain of
plant, preferably, less than or equal to 3,000 ppm, 2000 ppm, 1000
ppm, or 500 ppm), wherein said genetic modification comprises an
inhibition of a gene that regulates the production of nicotine
and/or nornicotine, such as arginine decarboxylase (ADC),
methylputrescine oxidase (WO), NADH dehydrogenase, ornithine
decarboxylase (ODC), phosphoribosylanthranilate isomerase (PRAT),
putrescine N-methyltransferase (PMT), quinolate phosphoribosyl
transferase (QPT), S-adenosyl-methionine synthetase (SAMS), or A622
using one or more of the constructs described herein.
[0272] Preferred embodiments also include a transgenic tobacco and
a tobacco product (e.g., cigarette) that comprises a cured tobacco
comprising a genetic modification and a reduced amount of a sterol
(e.g., below a conventional level of said sterol typical for the
strain of plant) wherein said genetic modification comprises an
inhibition of a gene that regulates the production of a sterol in
tobacco using one or more of the constructs described herein.
Related embodiments include a transgenic tobacco and tobacco
product made therefrom (e.g., a cigarette) that upon pyrolysis
generates a reduced amount of a PAH, BAP, a heterocyclic
hydrocarbon, or an aromatic amine, as compared to that generated by
a reference tobacco or reference tobacco product (e.g., IM16, 1R5F,
or 2R4F), a commercially available tobacco product of the same
class (e.g., full-flavor, lights, and ultra-lights), or,
preferably, a tobacco of the same variety (e.g., Burley, Virginia
Flue, or Oriental) or strain (e.g., LA Burley 21, K326, Tn90,
Djebe1174) as the transgenic tobacco prior to genetic
modification).
[0273] Preferred embodiments also include a transgenic tobacco and
a tobacco product (e.g., cigarette) that comprises a cured tobacco
comprising a genetic modification and a reduced amount of nicotine
or total alkaloid and a sterol (e.g., below a conventional level of
nicotine, total alkaloid, or sterol typical for the strain of
plant) wherein said genetic modification comprises an inhibition of
a gene that regulates the production of both nicotine and sterols
in tobacco. That is, aspects of the invention concern isolated
nucleic acids, isolated nucleic acid cassettes, and isolated
nucleic acid constructs that inhibit the expression of a plurality
of genes that regulate the production of nicotine and TSNAS,
isolated nucleic acids, isolated nucleic acid cassettes, and
isolated nucleic acid constructs that inhibit the expression of a
plurality of genes that regulate the production of a sterol or
sterols and, thus PAHs, and isolated nucleic acids, isolated
nucleic acid cassettes, and isolated nucleic acid constructs that
inhibit the expression of a plurality of genes that regulate the
production of nicotine and TSNAS and sterols and, thus, PAHs (e.g.,
a double knock-out of at least two different genes that regulate
the production of at least two different harmful compounds in
tobacco).
[0274] In some embodiments, the tobacco that is substantially free
or comprises a reduced amount of nicotine, nornicotine, TSNAs,
sterols, and/or produces a reduced amount of PAHs upon pyrolysis is
made by exposing at least one tobacco cell of a selected variety
(e.g., Burley, Virginia Flue, or Oriental) to an exogenous nucleic
acid construct encoding an interfering RNA comprising an RNA duplex
that comprises a first strand having a sequence that is
substantially similar or identical to at least a portion of the
coding sequence of a target gene and/or target gene product
involved in nicotine biosynthesis or sterol biosynthesis, and a
second strand that is complementary or substantially complementary
to the first strand. In some embodiments, the nucleic acid
construct further comprises a nucleotide sequence encoding the
interfering RNA operably linked to a promoter operable in a plant
cell. The tobacco cell is transformed with the nucleic acid
construct, transformed cells are selected and at least one
transgenic tobacco plant is regenerated from the transformed cells.
The transgenic tobacco plants described herein can contain a
reduced amount of anyone of nicotine, nornicotine, TSNAs and/or a
sterol as compared to a control tobacco plant of the same variety.
In some embodiments, nucleic acid constructs encoding interfering
RNAs (RNAi) comprising a first strand having a sequence
substantially similar or identical to the entire coding sequence of
a target gene and/or target gene product involved in nicotine or
sterol biosynthesis, and a second strand that is complementary or
substantially complementary to the first strand, are
contemplated.
[0275] In some embodiments, the gene product involved in nicotine
biosynthesis is an enzyme. Such enzymes include, but are not
necessarily limited to, putrescene N-methyltransferase (PMTase),
N-methylputrescene oxidase, ornithine decarboxylase,
S-adenosylmethionine synthetase, NADH dehydrogenase,
phosphoribosylanthranilate isomerase and quinolate phosphoribosyl
transferase (QPTase). In preferred embodiments, the gene product
that is inhibited using a construct described herein is QPTase,
PMTase, and A622. In some embodiments, the tobacco that is made
substantially free of nicotine and/or TSNAs (e.g., less than or
equal to 0.5 mg/g nicotine and/or less than or equal to 0.5 .mu.g/g
collective content of NNN, NAT, NAB, and NNK) is prepared from a
variety of Burley tobacco (e.g., Burley 21), Oriental tobacco
(Djebal 174), or Virginia flue (Tn90 or K326) tobacco. It should be
understood, however, that most tobacco varieties can be made to
have reduced amounts of nicotine and/or TSNAs or can be made
substantially free of nicotine and/or TSNAs by using the
embodiments described herein. For example, plant cells of the
variety Burley 21 are used as the host for the genetic engineering
that results in the reduction of nicotine and/or TSNAs so that the
resultant transgenic plants are a Burley 21 variety that has a
reduced amount of nicotine and/or TSNAs.
[0276] Accordingly, some embodiments concern a tobacco that
comprises a genetic modification comprising a reduced amount or a
reduced level of expression of QPTase, PMTase, or A622, a reduced
amount of nicotine or total alkaloid and/or a collective content of
TSNA (e.g., NNN, NAT, NAB, or NNK) of less than or equal to 0.5
.mu.g/g (e.g., 0.05 .mu.g/g, 0.1 .mu.g, 0.2 .mu.g/g, 0.3 .mu.g/g,
0.4 .mu.g/g, or 0.5 .mu.g/g). More embodiments concern a tobacco
that comprises a reduced amount or a reduced level of expression of
A622, a normal or conventional amount of nicotine (e.g., equal to,
less than, or greater than 0.9 mg/g, 1.0 mg/g, 1.1 mg/g, 1.2 mg/g,
1.3 mg/g, 1.4 mg/g, 1.5 mg/g, 1.6 mg/g, 1.7 mg/g, 1.8 mg/g, 1.9
mg/g, and 2.0 mg/g), and a reduced amount of nornicotine (e.g.,
less than or equal to 0.5 .mu.g/g, and/or a reduced amount of NNN
(e.g., equal to or less than 0.05 .mu.g/g, 0.1 .mu.g, 0.2 .mu.g/g,
0.3 .mu.g/g, 0.4 .mu.g/g, or 0.5 .mu.g/g). That is, particular
lines of transgenic tobacco containing the A622 inhibition cassette
described herein were unexpectedly found to have a reduced level of
nornicotine but conventional levels of nicotine. This finding is
particularly important since nornicotine may be a more important
precursor for NNN than nicotine. (See Carmella et al.,
Carcinogenesis, Vol. 21, No. 4, 839-843, (April 2000), herein
expressly incorporated by reference in its entirety). In other
transgenic lines, wherein the A622 gene was inhibited using one of
the constructs described herein, it was found that both nicotine
and nornicotine were effectively reduced (e.g., total alkaloids
were less than or equal to 7,000 ppm, 5000 ppm, 3000 ppm, 1000 ppm,
or 500 ppm).
[0277] Some of the nucleic acid constructs of the present invention
employ interfering RNAs (e.g., siRNAs or dsRNAs) that comprise an
RNA duplex wherein each RNA portion of the duplex is at least,
greater than, or equal to 30, 40, 50, 60, 70, 80, 90, 100, 120,
140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380,
400, 420, 440, 460, 480, 500, 520, 540, 560, 580, 600, 620, 640,
660, 680, 700, 750, 1000, 1500, 2000, 2500, or 5000 consecutive
nucleotides complementary or substantially complementary to an mRNA
that encodes a gene product or the entire coding sequence of the
enzyme or complement thereof of an enzyme that regulates nicotine
or sterol biosynthesis. In some embodiments, the RNA duplex
comprises a first RNA strand that is complementary to an mRNA that
encodes a gene product involved in nicotine or sterol biosynthesis
and a second RNA stand that is complementary to said first strand.
Some interfering RNAs of the present invention can comprise two
separate RNA strands hybridized to each other by hydrogen bonding.
Other interfering RNAs comprise a single RNA strand comprising a
first and second regions of nucleotide sequence that are
complementary to each other. In such embodiments, the first and
second regions of nucleotide sequence are separated by a nucleotide
sequence (e.g., a "linker") that permits or, in the case of the
FAD2 intron described herein, facilitates formation of a hairpin
structure upon hybridization of the first and second regions. This
"linker" that permits formation of a hairpin structure is
preferably at least, greater than, or equal to 30, 40, 50, 60, 70,
80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320,
340, 360, 380, 400, 420, 440, 460, 480, 500, 520, 540, 560, 580,
600, 620, 640, 660, 680, 700, 800, 900, 1000 or more nucleotides in
length. The section below provides more details on nitrosamines and
TSNAs.
[0278] Nitrosamines and Tobacco-Specific Nitrosamines
[0279] The term nitrosamine generally refers to any of a class of
organic compounds with the general formula R.sub.2NNO or RNHNO
(where R denotes an amine-containing group). Nitrosamines are
present in numerous foods and have been found to be carcinogenic in
laboratory animals. These compounds are formed by nitrosation
reactions of amines such as amino acids and alkaloids with nitrites
and/or nitrous oxides. By themselves, nitrosamines are not
carcinogenic substances, but in mammals nitrosamines undergo
decomposition by enzymatic activation to form alkylating
metabolites which appear to react with biopolymers to initiate
their tumorogenic effect. Thus, by reducing the amount of
nitrosamine intake, one has effectively reduced the carcinogenic
potential in humans.
[0280] Nitrosamines have been identified in tobacco, tobacco
products, and tobacco smoke (TS) by the use of techniques such as
gas chromatography-thermal energy analysis (GC-TEA). Some of these
nitrosamines have been identified as tobacco-specific nitrosamines
(TSNAs). TSNAs are primarily formed by reactions between the two
most abundant alkaloids, nicotine and nornicotine, with nitrous
oxides (NOx), and they account proportionately for the highest
concentration of nitrosamines in both tobacco products and in
mainstream smoke. Of the TSNAs identified, and the subset that have
been found to be present in CS, the most characterized is
N-nitrosamine, 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone
(N-nitrosamine-ketone), or NNK. When injected at relatively high
doses, NNK is carcinogenic in rodents. Minimal amounts of TSNAs are
found in green tobacco, indicating that TSNA formation may occur
during processing steps such as curing, drying, fermentation,
burning or storage of tobacco.
[0281] TSNA formation is attributed to chemical, enzymatic and
bacterial influences during tobacco processing, particularly during
curing, fermentation and aging. Nitrosation of nornicotine,
anatabine, and anabasine gives the corresponding nitrosamines:
N'-nitrosonornicotine (NNN), N'-nitrosoanatabine (NAT) and
N'-nitrosoanabasine (NAB). Nitrosation of nicotine in aqueous
solution affords a mixture of
4-(N-nitrosomethylamino)-1-(3-pyridyl)-1-butanone (NNK), NNN, and
4-(N-nitrosomethylamino)-4-(3-pyridyl)-1-butanal (NNA). Less
commonly encountered TSNAs include NNAL
(4-N-nitrosomethylamino)-1-(3-pyridyl)-1-butanol), iso-NNAL
(4-N-nitrosomethylamino)-4-(3-pyridyl)-1-butanol, 11) and iso-NNAC
(4-(N-nitrosomethylamino)-4-(3-pyridyl)-butanoic acid, 12). See,
U.S. Pat. No. 6,135,121, the entire disclosure of which is hereby
expressly incorporated by reference in its entirety.
[0282] TSNA levels are particularly high in chewing tobaccos and
snuff. The partially anaerobic processes that occur during
fermentation promote the formation of TSNAs from tobacco alkaloids
by promoting increased nitrite levels; in particular,
over-fermentation can increase TSNA levels in snuff by its effects
on nitrate levels and microbial enzymatic activity. The reduction
of the nitrosamine level in snuff in recent years has been achieved
by maintaining a better control over the bacterial content in these
products.
[0283] Since the nitrate level of tobacco is important for
nitrosamine formation in cigarette smoke (CS), a significant
reduction of nitrosamines in smoke can be achieved by low-nitrate
leaf and stem blends. However, these methods may negatively impact
the smokability or the taste of the tobacco. The nitrosamine
content of mainstream smoke can be reduced by as much as 80% by
cellulose acetate filters, and it can be reduced still further by
filter ventilation.
[0284] Air-cured tobaccos such as burley and dark-fired may have
higher levels of TSNAs than certain types of flue-cured bright,
burley, or dark tobaccos apparently because the high temperatures
associated with flue-curing can kill the micro-organisms that
transform the alkaloids into TSNAs. In air-cured types, nitrate
(N--NO.sub.3) is more abundant in the leaf (particularly in the
leaf and stems) than in flue-cured tobacco and the alkaloid content
is also much higher. This N--NO.sub.3 is reduced to nitrite
(NO.sub.2) by microbes during curing and the NO.sub.2.sup.- can be
further reduced to NOx or react directly with alkaloids to form T
SNAs.
[0285] It is contemplated that, in addition to the techniques
described above, nitrate levels in tobacco (especially in the leaf)
can be reduced by limiting exposure to nitrosating agents or
conditions. Air-curing experiments at a higher temperature have
shown that considerably higher levels of N-nitrosamines are formed
at a curing temperature of 32.degree. C. than at 16.degree. C.,
which is associated with a rise of the nitrite level in the
tobacco, and may also be associated with a rise in microbial
enzymatic activity. Modified curing that involves faster drying
from wider spacing or from more open curing structures has been
shown to reduce TSNA levels in burley tobacco. The climatic
conditions prevailing during curing exert a major influence on
N-nitrosamine formation, and the relative humidity during
air-curing can be of importance. Stalk curing results in higher
TSNA levels in the smoke than primed-leaf curing. Sun-cured
Oriental tobaccos have lower TSNA levels than Flue and air-cured
dark tobaccos. Accelerated curing of crude tobaccos such as
homogenized leaf curing limits the ability of bacteria to carry out
the nitrosation reactions. However, many of the methods described
above for reducing TSNAs in Burley tobacco can have undesirable
effects on tobacco taste.
[0286] TSNA formation in flue-cured tobacco also results from
exposure of the tobacco to combustion gases during curing, where
nearly all of the TSNAs in flue-cured tobacco (e.g., Virginia Flue)
result from a reaction involving NOx and nicotine. The predominant
source of NOx is the mixture of combustion gases in direct-fired
barns. At present, flue-cured tobacco is predominantly cured in
commercial bulk barns. As a result of energy pressures in the U.S.
during the 1960's, farmer-built "stick barns" with heat-exchanged
flue systems were gradually replaced with more energy efficient
bulk barns using direct-fired liquid propane gas (LPG) burners.
These LPG direct-fired burner systems exhaust combustion gases and
combustion by-products directly into the barn where contact is made
with the curing tobacco. Studies indicate that LPG combustion
by-products react with naturally occurring tobacco alkaloids to
form TSNA.
[0287] In contrast to direct-fired curing, heat-exchange burner
configurations completely vent combustion gases and combustion
by-products to the external atmosphere rather than into the barn.
The heat-exchange process precludes exposure of the tobacco to LPG
combustion by-products, thereby eliminating an important source of
nitrosating agent for TSNA formation, without degrading leaf
quality or smoking quality. The use of heat exchangers reduces TSNA
levels by about 90%. Steps are being taken to reduce TSNA levels in
US tobacco by converting barns to indirect heat through the use of
a heat exchanger, but these methods are very expensive. Although
many of the approaches described in this section have significant
drawbacks, it should be understood that any or all of these
techniques can be used with other techniques, as described herein,
to make tobacco and tobacco products having reduced nitrosamines.
The section below provides more detail on nicotine and approaches
to reduce nicotine in tobacco.
[0288] Nicotine
[0289] Nicotine is formed primarily in the roots of the tobacco
plant and is subsequently transported to the leaves, where it is
stored (Tso, Physiology and Biochemistry of Tobacco Plants, pp.
233-34, Dowden, Hutchinson & Ross, Stroudsburg, Pa. (1972)).
Classical crop breeding techniques have produced tobacco with lower
levels of nicotine, including varieties with as low as 8% of the
amount of nicotine found in wild-type tobacco. The many methods
described herein can be used with virtually any tobacco variety but
are preferably used with Burley, Oriental or Flue (e.g., Virginia
Flue) varieties.
[0290] Nicotine is produced in tobacco plants by the condensation
of nicotinic acid and 4-methylaminobutanal. Two regulatory loci
(Nic1 and Nic2) act as co-dominant regulators of nicotine
production. Enzyme analyses of root tissue from single and double
Nic mutants show that the activities of two enzymes, quinolate
phosphoribosyl transferase ("QPTase") and putrescence methyl
transferase (PMTase), are directly proportional to levels of
nicotine biosynthesis. It has also been discovered, as reported in
this application for the first time, that inhibition of A622
reduces the amount of nicotine in a tobacco plant. Accordingly,
A622 encodes a gene product that regulates the production of
nicotine.
[0291] An obligatory step in nicotine biosynthesis is the formation
of nicotinic acid from quinolinic acid, a step that is catalyzed by
QPTase. QPTase appears to be a rate-limiting enzyme in the pathway
supplying nicotinic acid for nicotine synthesis in tobacco. (See,
e.g., Feth et al., Planta, 168, pp. 402-07 (1986) and Wagner et
al., Physiol. Plant., 68, pp. 667-72 (1986), herein expressly
incorporated by reference in its entirety). A comparison of enzyme
activity in tobacco tissues (root and callus) with different
capacities for nicotine synthesis shows that QPTase activity is
strictly correlated with nicotine content (Wagner and Wagner,
Planta 165:532 (1985), herein expressly incorporated by reference
in its entirety). In fact, Saunders and Bush (Plant Physiol 64:236
(1979), herein expressly incorporated by reference in its
entirety), showed that the level of QPTase in the roots of low
nicotine mutants is proportional to the level of nicotine in the
leaves.
[0292] The modification of nicotine levels in tobacco plants by
antisense regulation of putrescence methyl transferase (PMTase)
expression has been proposed in U.S. Pat. Nos. 5,369,023 and
5,260,205, to Nakatani and Malik, and in PCT application WO
94/28142 to Wahad and Malik, which describe DNA encoding PMT and
the use of sense and antisense PMT constructs, the entire
disclosures of each of which are hereby expressly incorporated by
reference in their entireties. Other genetic modifications proposed
to reduce nicotine levels are described in PCT application WO
00/67558, to Timko, and WO 93/05646, to Davis and Marcum; the
entire contents of each are hereby expressly incorporated by
reference in their entireties. Although these investigators made
significant contributions, there were significant drawbacks to
their experimental design.
[0293] Most notably, it is presently revealed that there are
several different PMT genes and each may play a role in nicotine
biosynthesis. Knocking-out only one PMT gene creates a leaky system
allowing the other genes to compensate for the reduction.
Accordingly, the PMT constructs described herein were designed to
inhibit a plurality of different PMT genes. That is, the PMT
constructs described herein are designed to complement common
regions to all five of the PMT genes so that inhibition of each of
the PMT genes can be accomplished. Although many of the approaches
described in this section have significant drawbacks, it should be
understood that any or all of these techniques can be used with
other techniques, as described herein, to make tobacco and tobacco
products having reduced nicotine. The section below explains
several approaches to reduce the amount of nicotine and sterols in
tobacco and tobacco products.
[0294] Reducing the Amount of Nicotine and Sterols in Tobacco
[0295] As discussed above, TSNAs, nicotine, nornicotine, and
sterols contribute significantly to tobacco-related disease, most
notably the carcinogenic potential of tobacco and tobacco products.
Thus, tobacco and tobacco products that have or produce reduced
amounts of these compounds are reduced risk compositions (e.g.,
products that have a reduced potential to contribute to a
tobacco-related disease). Without wishing to be bound by any
particular theory, it is contemplated that the creation of tobacco
plants, tobacco and tobacco products that have a reduced amount of
nicotine will also have reduced amounts of TSNAs. That is, by
removing nicotine from tobacco plants, tobacco and tobacco
products, one effectively removes the most significant alkaloid
substrate for TSNA formation. It was found that the reduction of
nicotine in tobacco was directly related to the reduction of TSNAs.
Similarly, it is contemplated that by removing sterols form
tobacco, one can reduce the amount of PAHs generated from pyrolysis
of the tobacco. Unexpectedly, the methods described herein not only
produce tobacco with a reduced addictive potential but,
concomitantly, produce a tobacco that have a reduced potential to
contribute to a tobacco related disease.
[0296] It should be emphasized that the phrase "a reduced amount"
is intended to refer to an amount of nicotine and/or TSNAs in a
treated or transgenic tobacco plant, tobacco or a tobacco product
that is less than what would be found in a tobacco plant, tobacco
or a tobacco product from the same variety of tobacco, processed in
the same manner, which has not been treated or was not made
transgenic for reduced nicotine and/or TSNAs. Thus, in some
contexts, wild-type tobacco of the same variety that has been
processed in the same manner is used as a control by which to
measure whether a reduction in nicotine, nornicotine, a sterol
and/or TSNAs or PAHs has been obtained by the inventive methods
described herein.
[0297] The amount of TSNAs (e.g., collective content of NNN, NAT,
NAB, and NNK) and nicotine in wild-type tobacco varies
significantly depending on the variety and the manner it is grown,
harvested and cured. For example, a cured Burley tobacco leaf can
have approximately 30,000 parts per million (ppm) nicotine and
8,000 parts per billion (ppb) TSNA (e.g., collective content of
NNN, NAT, NAB, and NNK); a Flue-Cured leaf can have approximately
20,000 ppm nicotine and 300 ppb TSNA (e.g., collective content of
NNN, NAT, NAB, and NNK); and an Oriental cured leaf can have
approximately 10,000 ppm nicotine and 100 ppb TSNA (e.g.,
collective content of NNN, NAT, NAB, and NNK). Tobacco having a
reduced amount of nicotine and/or TSNA, can have no detectable
nicotine and/or TSNA (e.g., collective content of NNN, NAT, NAB,
and NNK), or may contain some detectable amounts of one or more of
the TSNAs and/or nicotine, so long as the amount of nicotine and/or
TSNA is less than that found in tobacco of the same variety, grown
under similar conditions, and cured and/or processed in the same
manner. That is, cured Burley tobacco, as described herein, having
a reduced amount of nicotine can have between 0 and 30,000 ppm
nicotine and 0 and 8,000 ppb TSNA, desirably between 0 and 20,000
ppm nicotine and 0 and 6,000 ppb TSNA, more desirably between 0 and
10,000 ppm nicotine and 0 and 5,000 ppb TSNA, preferably between 0
and 5,000 ppm nicotine and 0 and 4,000 ppb TSNA, more preferably
between 0 and 2,500 ppm nicotine and 0 and 2,000 ppb TSNA and most
preferably between 0 and 1,000 ppm nicotine and 0 and 1,000 ppb
TSNA. Embodiments of cured Burley leaf prepared by the methods
described herein can also have between 0 and 1000 ppm nicotine and
0 and 500 ppb TSNA, 0 and 500 ppm nicotine and 0 and 250 ppb TSNA,
0 and 250 ppm nicotine and 0 and 100 ppb TSNA, 0 and 100 ppm
nicotine and 0 and 50 ppb TSNA, 0 and 50 ppm nicotine and 0 and 5
ppb TSNA and some embodiments of cured Burley leaf described herein
have virtually no detectable amount of nicotine or TSNA. In some
embodiments above, the amount of TSNA refers to the collective
content of NNN, NAT, NAB, and NNK.
[0298] Similarly, a cured Flue tobacco embodiment of the invention
having a reduced amount of nicotine can have between 0 and 20,000
ppm nicotine and 0 and 300 ppb TSNA, desirably between 0 and 15,000
ppm nicotine and 0 and 250 ppb TSNA, more desirably between 0 and
10,000 ppm nicotine and 0 and 200 ppb TSNA, preferably between 0
and 5,000 ppm nicotine and 0 and 150 ppb TSNA, more preferably
between 0 and 2,500 ppm nicotine and 0 and 100 ppb TSNA and most
preferably between 0 and 1,000 ppm nicotine and 0 and 50 ppb TSNA.
Embodiments of cured Flue tobacco, as described herein, can also
have between 0 and 500 ppm nicotine and 0 and 25 ppb TSNA, 0 and
200 ppm nicotine and 0 and 10 ppb TSNA, 0 and 100 ppm nicotine and
0 and 5 ppb TSNA and some embodiments of cure Flue tobacco have
virtually no detectable amount of nicotine or TSNA. In some
embodiments above, the amount of TSNA refers to the collective
content of NNN, NAT, NAB, and NNK.
[0299] Further, a cured Oriental tobacco embodiment having a
reduced amount of nicotine can have between 0 and 10,000 ppm
nicotine and 0 and 100 ppb TSNA, desirably between 0 and 7,000 ppm
nicotine and 0 and 75 ppb TSNA, more desirably between 0 and 5,000
ppm nicotine and 0 and 50 ppb TSNA, preferably between 0 and 3,000
ppm nicotine and 0 and 25 ppb TSNA, more preferably between 0 and
1,500 ppm nicotine and 0 and 10 ppb TSNA and most preferably
between 0 and 500 ppm nicotine and no detectable TSNA. Embodiments
of cured Oriental tobacco can also have between 0 and 250 ppm
nicotine and no detectable TSNA and some embodiments of cured
Oriental tobacco have virtually no detectable amount of nicotine or
TSNA. In some embodiments above, the amount of TSNA refers to the
collective content of NNN, NAT, NAB, and NNK.
[0300] Some embodiments comprise cured tobaccos (e.g., Burley,
Flue, or Oriental) with reduced amounts of nicotine as compared to
control varieties, wherein the amount of nicotine is less than
about 2 mg/g, 1 mg/g, 0.75 mg/g, 0.5 mg/g or desirably less than
about 0.1 mg/g, and preferably less than 0.08 mg/g, 0.07 mg/g, 0.06
mg/g, 0.05 mg/g, 0.04 mg/g, 0.03 mg/g, 0.02 mg/g, 0.01 mg/g.
Tobacco products made from these reduced nicotine and TSNA tobaccos
are also embodiments. The term "tobacco products" include, but are
not limited to, smoking materials (e.g., cigarettes, cigars, pipe
tobacco), snuff, chewing tobacco, gum, and lozenges. As mentioned
above, these reduced nicotine and nitrosamine tobaccos can be
treated with exogenous nicotine so as to incrementally increase the
amount of nicotine in the product and by employing aseptic
processing and packaging techniques, the amounts of total TSNAs in
the product can be kept at or below 0.5 ug/g for prolonged periods
of time.
[0301] In some contexts, the phrase "reduced amount of nicotine
and/or TSNAs" refers to the tobacco plants, cured tobacco, and
tobacco products, as described herein, which have less nicotine
and/or TSNAs (e.g., the collective content of NNN, NAT, NAB, and
NNK) by weight than the same variety of tobacco grown, processed,
and cured in the same way. For example, wild type cured tobacco can
have has approximately 1-4% dry weight nicotine and approximately
0.2%-0.8% dry weight TSNA depending on the manner it was grown,
harvested and cured. A typical cigarette has between 2-11 mg of
nicotine and approximately 5.0 .mu.g of TSNAs. Thus, the tobacco
plants, tobacco and tobacco products of the invention can have, in
dry weight for example, less than 0.01%, 0.015%, 0.02%, 0.025%,
0.03%, 0.035%, 0.04%, 0.045%, 0.05%, 0.055%, 0.06%, 0.065%, 0.07%,
0.075%, 0.08%, 0.085%, 0.09%, 0.095%, 0.1%, 0.15%, 0.175%, 0.2%,
0.225%, 0.25%, 0.275%, 0.3%, 0.325%, 0.35%, 0.375%, 0.4%, 0.425%,
0.45%, 0.475%, 0.5%, 0.55%, 0.6%, 0.65%, 0.7%, 0.75%, 0.8%, 0.85%,
0.9%, 0.95%, and 1.0% nicotine and less than 0.01%, 0.015%, 0.02%,
0.025%, 0.03%, 0.035%, 0.04%, 0.045%, 0.05%, 0.055%, 0.06%, 0.065%,
0.07%, 0.075%, and 0.08% TSNA (e.g., collective content of NNN,
NAT, NAB, and NNK).
[0302] Alternatively, a cigarette of the invention can have, for
example, less than 0.1 mg, 0.15 mg, 0.2 mg, 0.25 mg, 0.3 mg, 0.35
mg, 0.4 mg, 0.45 mg, 0.5 mg, 0.55 mg, 0.6 mg, 0.65 mg, 0.7 mg, 0.75
mg, 0.8 mg, 0.85 mg, 0.9 mg, 0.95 mg, 1.0 mg, 1.1 mg, 1.15 mg, 1.2
mg, 1.25 mg, 1.3 mg, 1.35 mg, 1.4 mg, 1.45 mg, 1.5 mg, 1.55 mg, 1.6
mg, 1.65 mg, 1.7 mg, 1.75 mg, 1.8 mg, 1.85 mg, 1.9 mg, 1.95 mg, 2.0
mg, 2.1 mg, 2.15 mg, 2.2 mg, 2.25 mg, 2.3 mg, 2.35 mg, 2.4 mg, 2.45
mg, 2.5 mg, 2.55 mg, 2.6 mg, 2.65 mg, 2.7 mg, 2.75 mg, 2.8 mg, 2.85
mg, 2.9 mg, 2.95 mg, 3.0 mg, 3.1 mg, 3.15 mg, 3.2 mg, 3.25 mg, 3.3
mg, 3.35 mg, 3.4 mg, 3.45 mg, 3.5 mg, 3.55 mg, 3.6 mg, 3.65 mg, 3.7
mg, 3.75 mg, 3.8 mg, 3.85 mg, 3.9 mg, 3.95 mg, 4.0 mg, 4.1 mg, 4.15
mg, 4.2 mg, 4.25 mg, 4.3 mg, 4.35 mg, 4.4 mg, 4.45 mg, 4.4 mg, 4.45
mg, 4.5 mg, 4.55 mg, 4.6 mg, 4.65 mg, 4.7 mg, 4.75 mg, 4.8 mg, 4.85
mg, 4.9 mg, 4.95 mg, 5.0 mg, 5.5 mg, 5.7 mg, 6.0 mg, 6.5 mgmg, 6.7
mg, 7.0 mg, 7.5 mg, 7.7 mg, 8.0 mg, 8.5 mg, 8.7 mg, 9.0 mg, 9.5 mg,
9.7 mg, 10.0 mg, 10.5 mg, 10.7 mg, and 11.0 mg nicotine and less
than 0.001 ug, 0.002 ug, 0.003 ug, 0.004 ug, 0.005 ug, 0.006 ug,
0.007 ug, 0.008 ug, 0.009 ug, 0.01 ug, 0.02 ug, 0.03 ug, 0.04 ug,
0.05 ug, 0.06 ug, 0.07 ug, 0.08 ug, 0.09 ug, 0.1 ug, 0.15 ug, 0.2
ug, 0.25 ug, 0.3 ug, 0.336 ug, 0.339 ug, 0.345 ug, 0.35 ug, 0.375
ug, 0.4 ug, 0.414 ug, 0.45 ug, 0.5 ug, 0.515 ug, 0.55 ug, 0.555 ug,
0.56 ug, 0.578 ug, 0.58 ug, 0.6 ug, 0.611 ug, 0.624 ug, 0.65 ug,
0.7 ug, 0.75 ug, 0.8 ug, 0.85 ug, 0.9 ug, 0.95 ug, 1.0 ug, 1.1 ug,
1.114 ug, 1.15 ug, 1.2 ug, 1.25 ug, 1.3 ug, 1.35 ug, 1.4 ug, 1.45
ug, 1.5 ug, 1.55 ug, 1.6 ug, 1.65 ug, 1.7 ug, 1.75 ug, 1.8 ug, 1.85
ug, 1.9 ug, 1.95 ug, 2.0 ug, 2.1 ug, 2.15 ug, 2.2 ug TSNA (e.g.,
collective content of NNN, NAT, NAB, and NNK).
[0303] Unexpectedly, it was discovered that several methods for
reducing endogenous levels of nicotine in a plant are suitable for
producing tobacco that is substantially free of nitrosamines,
especially TSNAs. Any method that reduces levels of other
alkaloids, including norniticotine, is likewise suitable for
producing tobacco substantially free of nitrosamines, especially
TSNAs. As described, embodiments of this invention comprise methods
of reducing the carcinogenic potential of a tobacco product
comprising providing a cured tobacco as described herein and
preparing a tobacco product from said cured tobacco, whereby the
carcinogenic potential of said tobacco product is thereby
reduced.
[0304] In some embodiments that employed the A622 inhibition
construct, it was found that transgenic tobacco that had
conventional levels of nicotine but significantly reduced levels of
nornicotine were produced. This particular line of tobacco is
particularly useful because nornicotine may be the most significant
precursor for NNN in tobacco. Accordingly, reduced risk
conventional cigarettes and other tobacco products (e.g., snuff)
comprising the A622 inhibition construct are embodiments.
[0305] Other embodiments of the invention include the use of the
cured tobacco described herein for the preparation of a tobacco
product that contains reduced amounts of carcinogens as compared to
control varieties and/or that reduces the amount of a TSNA or TSNA
metobolite in a human that uses tobacco. In some embodiments, for
example, the tobacco smoking products described herein reduce the
carcinogenic potential of side stream or main stream TS in humans
exposed to said side stream or main stream TS. By providing the
genetically modified cured tobacco described herein in a product
that undergoes pyrolysis, for example, the side stream and/or main
stream smoke produced by said product comprises a reduced amount of
TSNAs and/or nicotine. Thus, the cured tobacco described herein can
be used to prepare a tobacco smoking product that comprises a
reduced amount of TSNAs in side stream and/or mainstream smoke.
[0306] In some embodiments, for example, the collective content of
NNN, NAT, NAB, and NNK in the mainstream or side stream smoke from
a tobacco product comprising the genetically modified tobacco
described herein is between about 0-5.0 .mu.g/g, 0-4.0 .mu.g/g,
0-3.0 .mu.g/g, 0-2.0 .mu.g/g, 0-1.5 .mu.g/g, 0-1.0 .mu.g/g, 0-0.75
.mu.g/g, 0-0.5 .mu.g/g, 0-0.25 .mu.g/g, 0-0.15 .mu.g/g, 0-0.1
.mu.g/g, 0-0.05 .mu.g/g, 0-0.02 .mu.g/g, 0-0.015 .mu.g/g, 0-0.01
.mu.g/g, 0-0.005 .mu.g/g, 0-0.002 .mu.g/g, or 0-0.001 .mu.g/g. That
is, some embodiments are genetically modified Burley tobacco,
wherein the side stream or mainstream smoke produced from a tobacco
product comprising said Burley tobacco has a collective content of
NNN, NAT, NAB, and NNK in the mainstream or side stream smoke
between about 0-5.0 .mu.g/g, 0-4.0 .mu.g/g, 0-3.0 .mu.g/g, 0-2.0
.mu.g/g, 0-1.5 .mu.g/g, 0-1.0 .mu.g/g, 0-0.75 .mu.g/g, 0-0.5
.mu.g/g, 0-0.25 .mu.g/g, 0-0.15 .mu.g/g, 0-0.1 .mu.g/g, 0-0.05
.mu.g/g, 0-0.02 .mu.g/g, 0-0.015 .mu.g/g, 0-0.01 .mu.g/g, 0-0.005
.mu.g/g, 0-0.002 .mu.g/g, or 0-0.001 .mu.g/g.
[0307] Other embodiments concern genetically modified Flue tobacco,
wherein the sidestream or mainstream smoke produced from a tobacco
product comprising said Flue tobacco has a collective content of
NNN, NAT, NAB, and NNK in the mainstream or side stream smoke
between about 0-5.0 .mu.g/g, 0-4.0 .mu.g/g, 0-3.0 .mu.g/g, 0-2.0
.mu.g/g, 0-1.5 .mu.g/g, 0-1.0 .mu.g/g, 0-0.75 .mu.g/g, 0-0.5
.mu.g/g, 0-0.25 .mu.g/g, 0-0.15 .mu.g/g, 0-0.1 .mu.g/g, 0-0.05
.mu.g/g, 0-0.02 .mu.g/g, 0-0.015 .mu.g/g, 0-0.01 .mu.g/g, 0-0.005
.mu.g/g, 0-0.002 .mu.g/g, or 0-0.001 .mu.g/g.
[0308] More embodiments concern genetically modified Oriental
tobacco, wherein the sidestream or mainstream smoke produced from a
tobacco product comprising said Oriental tobacco has a collective
content of NNN, NAT, NAB, and NNK in the mainstream or side stream
smoke between about 0-5.0 .mu.g/g, 0-4.0 .mu.g/g, 0-3.0 .mu.g/g,
0-2.0 .mu.g/g, 0-1.5 .mu.g/g, 0-1.0 .mu.g/g, 0-0.75 .mu.g/g, 0-0.5
.mu.g/g, 0-0.25 .mu.g/g, 0-0.15 .mu.g/g, 0-0.1 .mu.g/g, 0-0.05
.mu.g/g, 0-0.02 .mu.g/g, 0-0.015 .mu.g/g, 0-0.01 .mu.g/g, 0-0.005
.mu.g/g, 0-0.002 .mu.g/g, or 0-0.001 .mu.g/g.
[0309] A preferred method of producing tobacco having a reduced
amount of nicotine and TSNAs, involves genetic engineering directed
at reducing the levels of nicotine and/or nornicotine or other
alkaloids. Any enzyme involved in the nicotine synthesis pathway
can be a suitable target for genetic engineering to reduce levels
of nicotine and, optionally, levels of other alkaloids including
nornicotine. Suitable targets for genetic engineering to produce
tobacco having a reduced amount of nicotine and/or nitrosamines,
especially TSNAs, include but are not limited to putrescene
N-methyltransferase, N-methylputrescene oxidase, ornithine
decarboxylase, S-adenosylmethionine synthetase, NADH dehydrogenase,
phosphoribosylanthranilate isomerase, quinolate phosphoribosyl
transferase (QPTase) or a combination of any of the above targets.
Additionally, enzymes that regulate the flow of precursors into the
nicotine or sterol synthesis pathway are suitable targets for
genetic engineering to produce tobacco with a reduced amount of
nicotine and nitrosamines, especially TSNAs, and tobaccos with
reduced amounts of sterols, which produce a reduced amount of PAHs
upon pyrolysis. Suitable methods of genetic engineering are known
in the art and include, for example, the use of antisense and sense
suppression technology to reduce or eliminate the production of
enzymes, the use of interfering RNA molecules (gene silencing) as
described herein to reduce or eliminate the expression of gene
products, and the use of random or targeted mutagenesis to disrupt
gene function, for example, using T-DNA insertion or EMS
mutagenesis. The next section provides more description of these
techniques.
[0310] Inhibition of Gene Expression Using Nucleic Acids
[0311] Inhibition of gene expression refers to the absence or
observable reduction in the level of polypeptide and/or mRNA gene
product. Some embodiments of the present invention relate to
inhibiting the expression of one or more genes involved in the
biosynthesis of nicotine, nornicotine, and/or sterols by
genetically modifying a plant cell, such as a tobacco cell, by
providing the cell with an inhibitory nucleic acid that reduces or
eliminates the production of a gene product involved in nicotine or
sterol biosynthesis. Inhibitory nucleic acids include, but are not
limited to, interfering RNAs, antisense nucleic acids and catalytic
RNAs. Some preferred embodiments of the present invention relate to
interfering RNAs (RNAi).
[0312] RNA interference and gene silencing are terms that are used
to describe a phenomenon by which the expression of a gene product
is inhibited by an interfering RNA molecule. Interfering RNA
molecules are double-stranded RNAs (dsRNA) that are expressed in or
otherwise introduced into a cell. The dsRNA molecules may by of any
length, however, short dsRNA constructs are commonly used. Such
constructs are known as small interfering RNAs (siRNA), and are
typically 21-23 by in length.
[0313] RNA interference is exhibited by nearly every eukaryote and
is thought to function by a highly conserved mechanism (Dillin, A.
PNAS, 100:6289-91). As with antisense inhibition of gene
expression, inhibition mediated by RNA interference is gene
specific. However, in contrast to antisense-mediated inhibition,
inhibition mediated by interfering RNA appears to be inherited
(Dillin, A. PNAS, 100:6289-91). Without being bound by theory, it
is believed that specificity is achieved through nucleotide
sequence interaction between complementary portions of a target
mRNA and the interfering RNA. The target mRNA is selected based on
the specific gene to be silenced. In particular, the target mRNA,
corresponds to the sense strand of the gene to be silenced. An
interfering RNA, such as a dsRNA or an siRNA, comprises an RNA
duplex, which includes a first strand that is substantially similar
or identical to at least a portion of the nucleotide sequence of
the target mRNA, and a second strand having a nucleotide sequence
that is complementary or substantially complementary to the first
strand.
[0314] When used herein with reference to an RNA duplex of the
interfering RNA, it will be appreciated that the terms "first
strand" and "second strand" are used in a relative sense. For
example, the first strand of an RNA duplex can be selected to
comprise either a nucleotide sequence substantially similar or
identical to at least a portion of the nucleotide sequence of the
target mRNA or a nucleotide sequence that is complementary or
substantially complementary to at least a portion of the nucleotide
sequence of the target mRNA. If the first strand is selected to be
substantially similar or identical to at least a portion of the
nucleotide sequence of the target mRNA, then the second strand will
be complementary to at least a portion of the target mRNA because
it is complementary to the first strand. If the first strand is
selected to be complementary or substantially complementary to at
least a portion of the target mRNA, then the second strand will be
substantially similar or identical to at least a portion of the
nucleotide sequence of the target mRNA because it is complementary
to the first strand.
[0315] As used herein with reference to nucleic acids, "portion"
means at least 5 consecutive nucleotides, at least 6 consecutive
nucleotides, at least 7 consecutive nucleotides, at least 8
consecutive nucleotides, at least 9 consecutive nucleotides, at
least 10 consecutive nucleotides, at least 11 consecutive
nucleotides, at least 12 consecutive nucleotides, at least 13
consecutive nucleotides, at least 14 consecutive nucleotides, at
least 15 consecutive nucleotides, at least 16 consecutive
nucleotides, at least 17 consecutive nucleotides, at least 18
consecutive nucleotides, at least 19 consecutive nucleotides, at
least 20 consecutive nucleotides, at least 21 consecutive
nucleotides, at least 22 consecutive nucleotides, at least 23
consecutive nucleotides, at least 24 consecutive nucleotides, at
least 25 consecutive nucleotides, at least 30 consecutive
nucleotides, at least 35 consecutive nucleotides, at least 40
consecutive nucleotides, at least 45 consecutive nucleotides, at
least 50 consecutive nucleotides, at least 60 consecutive
nucleotides, at least 70 consecutive nucleotides, at least 80
consecutive nucleotides, at least 90 consecutive nucleotides, at
least 100 consecutive nucleotides, at least 125 consecutive
nucleotides, at least 150 consecutive nucleotides, at least 175
consecutive nucleotides, at least 200 consecutive nucleotides, at
least 250 consecutive nucleotides, at least 300 consecutive
nucleotides, at least 350 consecutive nucleotides, at least 400
consecutive nucleotides, at least 450 consecutive nucleotides, at
least 500 consecutive nucleotides, at least 600 consecutive
nucleotides, at least 700 consecutive nucleotides, at least 800
consecutive nucleotides, at least 900 consecutive nucleotides, at
least 1000 consecutive nucleotides, at least 1200 consecutive
nucleotides, at least 1400 consecutive nucleotides, at least 1600
consecutive nucleotides, at least 1800 consecutive nucleotides, at
least 2000 consecutive nucleotides, at least 2500 consecutive
nucleotides, at least 3000 consecutive nucleotides, at least 4000
consecutive nucleotides, at least 5000 consecutive nucleotides or
greater than at least 5000 consecutive nucleotides. In some
preferred embodiments, a portion of a nucleotide sequence is
between 20 and 25 consecutive nucleotides. In other preferred
embodiments, a portion of a nucleotide sequence is between 21 and
23 consecutive nucleotides. In some embodiments of the present
invention, a portion of a nucleotide sequence includes the
full-length coding sequence of the gene or the target mRNA.
[0316] Some preferred interfering RNAs that are described herein
comprise an RNA duplex, which comprises a nucleotide sequence that
is substantially similar or identical to at least a portion of the
coding strand of a gene involved in nicotine or sterol
biosynthesis. Although nucleic acid sequences that are
substantially similar or identical to at least a portion of the
coding strand of the target gene involved in nicotine biosynthesis
are preferred, it will be appreciated that nucleotide sequences
with insertions, deletions, and single point mutations relative to
the target sequence are also effective for inhibition of gene
expression. Sequence identity may determined by sequence comparison
and alignment algorithms known in the art (see Gribskov and
Devereux, Sequence Analysis Primer, Stockton Press, 1991, and
references cited therein) and calculating the percent difference
between the nucleotide sequences by, for example, the
Smith-Waterman algorithm as implemented in the BESTFIT software
program using default parameters (e.g., University of Wisconsin
Genetic Computing Group). Greater than 90% sequence identity, or
even 100% sequence identity, between the interfering RNA and a
portion of the target gene is preferred. In especially preferred
embodiments, at least about 21 to about 23 contiguous nucleotides
in the target gene are greater than 90% identical to a sequence
present in the interfering RNA.
[0317] In other embodiments of the present invention, the duplex
region of the RNA may be defined functionally as including a
nucleotide sequence that is capable of hybridizing with a portion
of the target gene transcript. Exemplary hybridization conditions
are 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50.degree. C. or
70.degree. C. hybridization for 12-16 hours; followed by
washing.
[0318] As described above, interfering RNAs disclosed herein
comprise a sequence that is complementary to at least a portion of
the sense strand of a gene encoding a target mRNA, which produces a
polypeptide that is involved in nicotine biosynthesis. Preferred
targets are the products of the quinolate phosphoribosyltransferase
(QTPase) gene, the putrescene N-methyltransferase (PMTase) gene,
and the A622 gene. However, it will be appreciated that interfering
RNAs specific for other gene products or combinations of gene
products involved in nicotine and nornicotine biosynthesis and/or
sterol biosynthesis are contemplated. For example, additional gene
products involved in nicotine biosynthesis include, but are not
limited to, N-methylputrescene oxidase, ornithine decarboxylase,
S-adenosylmethionine synthetase, NADH dehydrogenase, and
phosphoribosylanthranilate isomerase. Additionally, it will be
appreciated that interfering RNAs specific for other gene products
or combinations of gene products involved in in sterol biosynthesis
include HMG-CoA reductase, 14alpha demethylase, squalene synthase,
SMT2, SMT1, C14 sterol reductase, A8-A7-isomerase, and
C4-demethylase.
[0319] Additionally, the interfering RNAs described herein can
comprise a plurality nucleotide sequences that are each
complementary to different portions of the sense strand of a gene
involved in nicotine and/or sterol biosynthesis. Alternatively, the
interfering RNAs described herein can comprise a plurality
nucleotide sequences that are each complementary to at least a
portion of the sense strands of different genes involved in
nicotine and/or sterol biosynthesis. Still further, a single RNAi
construct or inhibition cassette can be used to inhibit a plurality
of genses involved in the regulation of the production of nicotine,
nornicotine, or sterols. For example, as described below, it was
found that the A622 inhibitory fragment and inhibition cassette
(SEQ. ID. Nos. 5 and 26) efficiently reduced production of nicotine
and nor nicotine in some lines of tobacco and in other lines of
tobacco conventional levels of nicotine were maintained but the
amount of nornicotine in said tobacco was 0.00 mg/g. Still further,
the PMTase inhibitory sequence and PMTase inhibition cassette (SEQ.
ID. Nos. 4 and 25) were designed to complement common regions of a
plurality of PMTase genes so that the production of multiple gene
products can be inhibited or reduced with a single construct.
[0320] In still more embodiments, it is contemplated that a single
T-DNA containing construct be used to overexpress one gene and, in
the same construct, inhibiting expression of a second gene. That
is, some embodiments concern constructs, tobacco containing said
constructs, and tobacco products containing said tobacco, wherein
said constructs comprise an overexpression cassette that comprises
a gene that regulates the production of a compound that improves
the composition of the tobacco (e.g, overexpression of a gene
encoding an antioxidant, such as glutathione or tocopherol) and, on
the same construct, an inhibition cassette that comprises an
inhibitory sequence that reduces the production of a compound that
contributes to a tobacco related disease (e.g., nicotine,
nornicotine, or a sterol).
[0321] In preferred embodiments, the interfering RNAs described
herein comprise at least one region of double-stranded RNA (duplex
RNA). This duplex RNA can range from about 10 by in length to about
10,000 by in length. In some embodiments, the duplex RNA ranges
from about 15 by in length to about 1500 by in length. In other
embodiments, the duplex RNA ranges from about 20 by in length to
about 1200 by in length. In still other embodiments, the duplex RNA
ranges from about 21 by in length to about 23 by in length. In a
preferred embodiment, the duplex RNA has a length of 22 bps. Short
regions of duplex RNA are often designated siRNA, whereas longer
regions of RNA duplex are often termed dsRNA. In some embodiments
of the present invention, the interfering RNA duplex region is a
dsRNA. In other embodiments, the interfering RNA duplex region is
an siRNA. In a preferred embodiment, the duplex region about the
length of the coding sequence of a target mRNA encoding a
polypeptide involved in nicotine biosynthesis.
[0322] Interfering RNAs described herein can be generated using a
variety of techniques. For example, an interfering RNA can be
generated in a host cell in vivo by providing the cell with one or
more a nucleic acid constructs that comprise the nucleic acids
necessary to encode the strands of a double-stranded RNA. Such
constructs can be included in various types of vectors. Exemplary
vectors contemplated herein include, but are not limited to,
plasmids, viral vectors, viroids, replicable and nonreplicable
linear DNA molecules, replicable and nonreplicable linear RNA
molecules, replicable and nonreplicable circular DNA molecules and
replicable and nonreplicable circular RNA molecules. Preferred
vectors include plasmid vectors, especially vector systems derived
from the Agrobacterium Ti plasmid, such as pCambia vectors and
derivatives thereof.
[0323] In some embodiments, both strands of the double-stranded
region of the interfering RNA can be encoded by a single vector. In
such cases, the vector comprises a first promoter operably linked
to a first nucleic acid which is substantially similar or identical
to at least a portion of the target mRNA. The vector also comprises
a second promoter operably linked to a second nucleic acid, which
is complementary or substantially to the first nucleic acid.
[0324] Another type of single vector construct, which can be used
to generate interfering RNA, encodes a double-stranded RNA hairpin.
In such embodiments, the vector comprises a promoter operably
linked to a nucleic acid that encodes both strands of the duplex
RNA. The first nucleotide sequence, which encodes the strand that
is substantially similar or identical to at least a portion of the
target mRNA, is separated from the second nucleotide sequence,
which encodes a strand complementary or substantially complementary
to the first strand, by a region of nucleotide sequence that does
not substantially hybridize with either of the strands. This
nonhybridizing region permits the RNA sequence transcribed from the
vector promoter to fold back on itself, thereby permitting the
complementary RNA sequences to hybridize so as to produce an RNA
hairpin. Vectors comprising a plurality of nucleic acids, each of
which encode both strands of the duplex RNA are also
contemplated.
[0325] Other embodiments of the present invention relate to
multiple vector systems for the production of interfering RNA. In
one example, a multiple vector system is used to produce a single
interfering RNA that is specific for a single gene product involved
in nicotine biosynthesis. In such embodiments, at least two vectors
are used. The first vector comprises a promoter operably linked to
a first nucleic acid that encodes a first strand of the RNA duplex
that is present in the interfering RNA. The second vector comprises
a promoter operably linked to a second nucleic acid that encodes
the second strand of the RNA duplex, which is complementary to the
first strand.
[0326] Other multiple vector systems are combinations of vectors,
wherein each vector in the system encodes a different interfering
RNA. Each of the interfering RNAs are specific for different gene
products involved in nicotine biosynthesis. In some embodiments,
the vectors in a multiple vector system can encode different
interfering RNAs that are specific to different portions of a
single gene product involved in nicotine biosynthesis.
[0327] It will be appreciated that the promoters used in the
above-described vectors can either be constitutive or regulated.
Constitutive promoters are promoters that are always expressed. The
constitutive promoters selected for use in the above-described
vectors can range from weak promoters to strong promoters depending
on the desired amount of interfering RNA to be produced. Regulated
promoters are promoters for which the desired level of expression
can be controlled. An example of a regulated promoter is an
inducible promoter. Using an inducible promoter in the
above-described vector constructs permits expression of a wide
range of concentrations of interfering RNA inside a cell.
[0328] It will also be appreciated that there is no requirement
that the same or same types of promoters be used in vectors or
multiple vector systems that comprise a plurality of promoters. For
example, in some vectors or vector systems, a first promoter, which
controls the expression of the first interfering RNA strand, can be
an inducible promoter, whereas the second promoter, which controls
the expression of the second RNA strand, can be a constitutive
promoter. This same principal can also be illustrated in a multiple
vector system. For example, a multiple vector system may have three
vectors each of which includes one or more different types of
promoters. Such a system can include, for example, a first vector
having repressible promoter that controls the expression of an
interfering RNA specific for a first gene product involved in
nicotine biosynthesis, a second vector having a constitutive
promoter that controls the expression of an interfering RNA
specific for a second gene product involved in nicotine
biosynthesis and a third vector having an inducible promoter that
controls the expression of an interfering RNA specific for a third
gene product involved in nicotine biosynthesis.
[0329] In other embodiments of the present invention, interfering
RNAs can be produced synthetically and introduced into a cell by
methods known in the art. Synthetic interfering RNAs can include a
variety of RNA molecules, which include, but are not limited to,
nucleic acids having at least one region of duplex RNA. The duplex
RNA in such molecules can comprise, for example, two antiparallel
RNA strands that form a double-stranded RNA having flush ends, two
antiparallel RNA strands that form a double-stranded RNA having at
least one end that forms a hair pin structure, or two antiparallel
RNA strands that form a double-stranded RNA, wherein both ends form
a hair pin structure. In some embodiments, synthetic interfering
RNAs comprise a plurality of RNA duplexes.
[0330] The regions of RNA duplex in synthetic interfering RNAs can
range from about 10 by in length to about 10,000 by in length. In
some embodiments, the duplex RNA ranges from about 15 by in length
to about 1500 by in length. In other embodiments, the duplex RNA
ranges from about 20 by in length to about 1200 by in length. In
still other embodiments, the duplex RNA ranges from about 21 by in
length to about 23 by in length. In a preferred embodiment, the
duplex RNA has a length of 22 bps. In preferred embodiments,
synthetic interfering RNAs are siRNAs. In another preferred
embodiment, the synthetic interfering RNA is an siRNA specific for
the coding sequence of a target mRNA encoding a polypeptide
involved in nicotine biosynthesis.
[0331] Some aspects of the present invention relate to interfering
nucleic acids that are not comprised entirely of RNA. Still other
aspects relate to interfering nucleic acids that do not comprise
any RNA. Such interfering nucleic acids are synthetic interfering
RNA analogs. These analogs substantially mimic the specificity and
activity of interfering RNA from which they are modeled; however,
they typically include additional properties which make their use
desirable. For example, one or both strands of the interfering
nucleic acid may contain one or more nonnatural nucleotide bases
that improve the stability of the molecule, enhance that affinity
of the molecule for the target mRNA and/or enhance cellular uptake
of the molecule. Other modifications are also contemplated. For
example, an interfering nucleic acid can include one or more
nucleic acid strands composed of naturally-occurring nucleobases,
sugars and covalent internucleoside (backbone) linkages as well as
non-naturally-occurring nucleobases, sugars and covalent
internucleoside linkages.
[0332] As is known in the art, a nucleoside is a base-sugar
combination. The base portion of the nucleoside is normally a
heterocyclic base. The two most common classes of such heterocyclic
bases are the purines and the pyrimidines. Nucleotides are
nucleosides that further include a phosphate group covalently
linked to the sugar portion of the nucleoside. For those
nucleosides that include a pentofuranosyl sugar, the phosphate
group can be linked to either the 2', 3' or 5' hydroxyl moiety of
the sugar. In forming nucleic acids, the phosphate groups
covalently link adjacent nucleosides to one another to form a
linear polymeric compound. In turn the respective ends of this
linear polymeric structure can be further joined to form a circular
structure. Within the nucleic acid structure, the phosphate groups
are commonly referred to as forming the internucleoside backbone of
the oligonucleotide. The normal linkage or backbone of RNA and DNA
is a 3' to 5' phosphodiester linkage.
[0333] Specific examples of interfering nucleic acids useful in
certain embodiments of this invention include one or more nucleic
acid strands containing modified backbones or non-natural
internucleoside linkages. As used herein, nucleic acids having
modified backbones include those that retain a phosphorus atom in
the backbone and those that do not have a phosphorus atom in the
backbone.
[0334] In some embodiments, modified nucleic acid backbones
include, for example, phosphorothioates, chiral phosphorothioates,
phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters,
methyl and other alkyl phosphonates including 3'-alkylene
phosphonates, 5'-alkylene phosphonates and chiral phosphonates,
phosphinates, phosphoramidates including 3'-amino phosphoramidate
and aminoalkylphosphoramidates, thionophosphoramidates,
thionoalkylphosphonates, thionoalkylphosphotriesters,
selenophosphates and borano-phosphates having normal 3'-5'
linkages, 2'-5' linked analogs of these, and those having inverted
polarity wherein one or more internucleotide linkages is a 3' to
3', 5' to 5' or 2' to 2' linkage. Certain nucleic acids having
inverted polarity comprise a single 3' to 3' linkage at the 3'-most
internucleotide linkage i.e. a single inverted nucleoside residue
which may be abasic (the nucleobase is missing or has a hydroxyl
group in place thereof). Various salts, mixed salts and free acid
forms are also included.
[0335] In some embodiments, modified nucleic acid backbones that do
not include a phosphorus atom therein have backbones that are
formed by short chain alkyl or cycloalkyl internucleoside linkages,
mixed heteroatom and alkyl or cycloalkyl internucleoside linkages,
or one or more short chain heteroatomic or heterocyclic
internucleoside linkages. These include those having morpholino
linkages (formed in part from the sugar portion of a nucleoside);
siloxane backbones; sulfide, sulfoxide and sulfone backbones;
formacetyl and thioformacetyl backbones; methylene formacetyl and
thioformacetyl backbones; riboacetyl backbones; alkene containing
backbones; sulfamate backbones; methyleneimino and
methylenehydrazino backbones; sulfonate and sulfonamide backbones;
amide backbones; and others having mixed N, O, S and CH.sub.2
component parts.
[0336] In other embodiments, the interfering nucleic acid can
comprise one or more mimetic regions, wherein both the sugar and
the internucleoside linkage, i.e., the backbone, of the nucleotide
units are replaced with novel groups. In such embodiments, the base
units are maintained for hybridization with an appropriate nucleic
acid target compound. One such compound, a mimetic that has been
shown to have excellent hybridization properties, is referred to as
a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone
of an oligonucleotide is replaced with an amide containing
backbone, in particular an aminoethylglycine backbone. The
nucleobases are retained and are bound directly or indirectly to
aza nitrogen atoms of the amide portion of the backbone.
Representative United States patents that teach the preparation of
PNA compounds include, but are not limited to, U.S. Pat. Nos.
5,539,082; 5,714,331; and 5,719,262, each of which is herein
incorporated by reference in its entirety. Further teaching of PNA
compounds can be found in Nielsen et al., Science, 1991, 254,
1497-1500.
[0337] In still other embodiments of the present invention,
interfering nucleic acids may include nucleic acid strands having
phosphorothioate backbones and/or heteroatom backbones. Modified
interfering nucleic acids may also contain one or more substituted
sugar moieties. In some embodiments, the interfering nucleic acids
comprise one of the following at the 2' position: OH; F; S-, or
N-alkyl; S-, or N-alkenyl; S- or N-alkynyl; or O-alkyl-O-alkyl,
wherein the alkyl, alkenyl and alkynyl may be substituted or
unsubstituted C.sub.1 to C.sub.10 alkyl or C.sub.2 to C.sub.10
alkenyl and alkynyl. Particularly preferred are
O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2).sub.nOCH.sub.3,
O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3,
O(CH.sub.2).sub.nONH.sub.2 and
O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.sub.3)].sub.2, where n and m
are from 1 to about 10. Other preferred oligonucleotides comprise
one of the following at the 2' position: C.sub.1 to C.sub.10 lower
alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl,
O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3,
OCF.sub.3, SOCH.sub.3, SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2,
N.sub.3, NH.sub.2, heterocycloalkyl, heterocycloalkaryl,
aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving
group, a reporter group, an intercalator, a group for improving the
pharmacokinetic properties of an oligonucleotide, or a group for
improving the pharmacodynamic properties of an oligonucleotide, and
other substituents having similar properties. Another modification
includes 2'-methoxyethoxy (2' OCH.sub.2CH.sub.2OCH.sub.3, also
known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv.
Chim. Acta, 1995, 78, 486-504).
[0338] An embodiment of the present invention includes the use of
Locked Nucleic Acids (LNAs) to generate interfering nucleic acids
having enhanced affinity and specificity for the target
polynucleotide. LNAs are nucleic acid in which the 2'-hydroxyl
group is linked to the 3' or 4' carbon atom of the sugar ring
thereby forming a bicyclic sugar moiety. The linkage is preferably
a methelyne (--CH.sub.2--).sub.n group bridging the 2' oxygen atom
and the 4' carbon atom wherein n is 1 or 2. LNAs and preparation
thereof are described in WO 98/39352 and WO 99/14226, the
disclosures of which are incorporated herein by reference in their
entireties.
[0339] Other modifications include 2'-methoxy (2'-O--CH.sub.3),
2'-aminopropoxy (2'-OCH.sub.2CH.sub.2CH.sub.2NH.sub.2), 2'-allyl
(2'-CH.sub.2--CH.dbd.CH.sub.2), 2'-O-allyl
(2'-O--CH.sub.2--CH.dbd.CH.sub.2) and 2'-fluoro (2'-F). The
2'-modification may be in the arabino (up) position or ribo (down)
position. A preferred 2'-arabino modification is 2'-F. Similar
modifications may also be made at other positions on the
oligonucleotide, particularly the 3' position of the sugar on the
3' terminal nucleotide or in 2'-5' linked oligonucleotides and the
5' position of 5' terminal nucleotide. Interfering nucleic acids
may also have sugar mimetics such as cyclobutyl moieties in place
of the pentofuranosyl sugar.
[0340] The interfering nucleic acids contemplated herein may also
include nucleobase (often referred to in the art simply as "base")
modifications or substitutions. As used herein, "unmodified" or
"natural" nucleobases include the purine bases adenine (A) and
guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and
uracil (U). Modified nucleobases include other synthetic and
natural nucleobases such as 5-methylcytosine, 5-hydroxymethyl
cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and
other alkyl derivatives of adenine and guanine, 2-propyl and other
alkyl derivatives of adenine and guanine, 2-thiouracil,
2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine,
5-propynyl uracil and cytosine and other alkynyl derivatives of
pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil
(pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol,
8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and
guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other
5-substituted uracils and cytosines, 7-methylguanine and
7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and
8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine
and 3-deazaadenine. Further modified nucleobases include tricyclic
pyrimidines such as phenoxazine cytidine
(1H-pyrimido[5,4-b][1,4]benzoxazi-n-2(3H)-one), phenothiazine
cytidine (1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps
such as a substituted phenoxazine cytidine (e.g.
9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one),
carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole
cytidine (H-pyrimido[3',':4,5]pyrrolo[2,3-d]pyrimidin-2-one).
Modified nucleobases may also include those in which the purine or
pyrimidine base is replaced with other heterocycles, for example
7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
Further nucleobases include those disclosed in U.S. Pat. No.
3,687,808, those disclosed in The Concise Encyclopedia Of Polymer
Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John
Wiley & Sons, 1990, those disclosed by Englisch et al.,
Angewandte Chemie, International Edition, 1991, 30, 613, and those
disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and
Applications, pages 289-302, Crooke, S. T. and Lebleu, B. ed., CRC
Press, 1993, the disclosures of which are incorporated herein by
reference in their entireties. Certain of these nucleobases are
particularly useful for increasing the binding affinity of the
interfering nucleic acids described herein. These include
5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6
substituted purines, including 2-aminopropyladenine,
5-propynyluracil and 5-propynylcytosine. 5-methylcytosine
substitutions have been shown to increase nucleic acid duplex
stability by 0.6-1.2.degree. C. (Sanghvi, Y. S., Crooke, S. T. and
Lebleu, B., eds., Antisense Research and Applications, CRC Press,
Boca Raton, 1993, pp. 276-278) and are presently preferred base
substitutions, even more particularly when combined with
2'-O-methoxyethyl sugar modifications.
[0341] Another modification of the interfering nucleic acids
described herein involves chemically linking to at least one of the
nucleic acid strands one or more moieties or conjugates which
enhance the activity, cellular distribution or cellular uptake of
the of the interfering nucleic acid. The interfering nucleic acids
can include conjugate groups covalently bound to functional groups
such as primary or secondary hydroxyl groups. Conjugate groups
include intercalators, reporter molecules, polyamines, polyamides,
polyethylene glycols, polyethers, groups that enhance the
pharmacodynamic properties of nucleic acids, and groups that
enhance the pharmacokinetic properties of such molecules. Typical
conjugates groups include cholesterols, lipids, phospholipids,
biotin, phenazine, folate, phenanthridine, anthraquinone, acridine,
fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance
the pharmacodynamic properties, in the context of this invention,
include groups that improve interfering nucleic acid uptake,
enhance its resistance to degradation, and/or strengthen
sequence-specific hybridization with target molecules. Groups that
enhance the pharmacokinetic properties, in the context of this
invention, include groups that improve the uptake, distribution,
metabolism or excretion of the interfering nucleic acid. Conjugate
moieties include but are not limited to lipid moieties such as a
cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA,
1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med.
Chem. Let., 1994, 4, 1053-1060), a thioether, e.g.,
hexyl-5-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992,
660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3,
2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res.,
1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or
undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10,
1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330;
Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid,
e.g., dihexadecyl-rac-glycerol or triethylammonium
1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al.,
Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids
Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol
chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14,
969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron
Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al.,
Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine
or hexylaminocarbonyloxycholesterol moiety (Crooke et al., J.
Pharmacol. Exp. Ther., 1996, 277, 923-937).
[0342] As described above, it is not necessary for all positions in
a given compound to be uniformly modified, and in fact, more than
one of the aforementioned modifications may be incorporated in a
single compound or even at a single nucleoside within an nucleic
acid. The methods described herein also contemplate the use of
interfering nucleic acids which are chimeric compounds. "Chimeric"
interfering nucleic acid compounds or "chimeras," as used herein,
are interfering nucleic acid compounds, which contain two or more
chemically distinct regions, each made up of at least one monomer
unit, i.e., a nucleotide in the case of a nucleic acid compound.
These interfering nucleic acids typically contain at least one
region wherein the nucleic acid is modified so as to confer upon
the interfering nucleic acid increased resistance to nuclease
degradation, increased cellular uptake, and/or increased binding
affinity for the target nucleic acid. An additional region of the
nucleic acid may serve as a substrate for enzymes capable of
cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is
a cellular endonuclease which cleaves the RNA strand of an RNA:DNA
duplex. Activation of RNase H, therefore, results in cleavage of
the RNA target, thereby contributes further to the inhibition of
gene expression by the interfering nucleic acid.
[0343] The above-described interfering nucleic acids may be
conveniently and routinely made through the well-known technique of
solid phase synthesis. Equipment for such synthesis is sold by
several vendors including, for example, Applied Biosystems (Foster
City, Calif.). Any other means for such synthesis known in the art
may additionally or alternatively be employed. It is well known to
use similar techniques to prepare nucleic acids such as the
phosphorothioates and alkylated derivatives.
[0344] The interfering nucleic acid compounds for use with the
methods described herein encompass any pharmaceutically acceptable
salts, esters, or salts of such esters, or any other compound.
[0345] Although terms, such as interfering RNA, dsRNA and siRNA,
are used throughout the remainder of the specification, it will be
appreciated that in the context of synthetically produced
interfering nucleic acids, that such terms are meant to include
interfering nucleic acids of all types, including those which
incorporate modifications, such as those described above.
[0346] Some embodiments of the present invention relate to methods
of reducing or eliminating the expression of one or more target
genes involved in nicotine, nornicotine, and/or sterol
biosynthesis. Target genes that are involved in nicotine,
nornicotine, and/or sterol biosynthesis are expressed through the
transcription a first gene product, the target mRNA, which is then
translated to produce a second gene product, the target
polypeptide. Thus, reduction or elimination of the expression of
one or more target genes results in the reduction or elimination of
one or more target mRNAs and/or target polpypeptides. Target
polypeptides involved in nicotine and nornicotine biosynthesis
include, for example, putrescene N-methyltransferase,
N-methylputrescene oxidase, ornithine decarboxylase,
S-adenosylmethionine synthetase, NADH dehydrogenase,
phosphoribosylanthranilate isomerase, and quinolate phosphoribosyl
transferase (QPTase). In a preferred embodiment, the expression of
the QPTase, PMTase, and A622 product is inhibited.
[0347] Reduction of the expression of one or more target genes
and/or target gene products that are involved in nicotine,
nornicotine, and/or sterol biosynthesis leads to a reduction in the
amount of nicotine, sterols, and TSNAs produced in tobacco and PAHs
upon pyrolysis of the tobacco. In certain embodiments, the
expression of one or more target gene products involved in
nicotine, nornicotine, and/or sterol biosynthesis is eliminated.
Elimination of such target gene products can result in the
elimination of nicotine, nornicotine, and/or sterol biosynthesis,
thereby reducing the amount of nicotine, nornicotine, and/or sterol
present in tobacco to levels below the detection limit of methods
commonly used. Reduction of the amount of nicotine and nornicotine
present in tobacco can lead to a reduction in the amount of TSNAs
produced in the tobacco. In some embodiments, the amount of TSNA
present in tobacco is reduced to levels below the detection limit
of methods commonly used to detect TSNAs. Similarly, the reduction
in the amount of sterol present in tobacco can lead to a reduction
in the amount of PAH generated from the tobacco upon pyrolysis.
[0348] The reduction in or elimination of the expression of target
genes or target gene products involved in nicotine, nornicotine,
and/or sterol biosynthesis is achieved by providing an interfering
RNA specific to one or more such target genes to a tobacco cell,
thereby producing a genetically modified tobacco cell. The
interfering RNA can be provided as a synthetic double-stranded RNA,
or alternatively, as a nucleic acid construct capable of encoding
the interfering RNA. Synthetic double-stranded interfering RNAs are
taken up by the cell directly whereas interfering RNAs encoded by a
nucleic acid construct are expressed from the construct subsequent
to the entry of the construct inside the cell. The reduction in or
elimination of the expression of the target genes and/or the target
gene products is mediated by the presence of the interfering RNA
inside the cell.
[0349] In general, the interfering RNAs that are produced inside
the cell, whether expressed from a nucleic acid construct or
provided as synthetic double-stranded RNA molecules, include an RNA
duplex having a first and second strand. At least a portion the
first strand of the duplex is substantially similar or identical to
at least a portion of a target mRNA or a target gene involved in
nicotine biosynthesis. Correspondingly, at least a portion of the
second strand of the duplex is complementary or substantially
complementary to the first strand, and thus, at least a portion of
the second strand is complementary or substantially complementary
to at least a portion of the mRNA encoded by the target gene. In
some embodiments of the present invention, the interfering RNA can
comprise a first strand that is substantially similar or identical
to the entire coding sequence of the target gene or target mRNA
involved in nicotine biosynthesis and a second strand complementary
or substantially complementary to the first strand.
[0350] The reduction in or elimination of the expression of genes
and/or gene products involved in nicotine, nornicotine, and/or
sterol biosynthesis can be characterized by comparing the amount of
nicotine, nornicotine, and/or sterol produced in genetically
modified cells, with the amount of nicotine, nornicotine, and/or
sterol produced in cells that have not been genetically modified.
Alternatively, such reduction in or elimination of gene expression
can be characterized by genetically analyzing plant cells so as to
determine the level of mRNA present in the genetically modified
plant cell as compared to a non-modified plant cell. Depending on
the assay, quantitation of the amount of gene expression allows one
to determine a degree of reduction in gene expression, which can be
greater than 10%, 33%, 50%, 90%, 95% or 99% as compared to an
untreated cell. As with nicotine and nornicotine, the reduction in
or elimination of TSNA production in tobacco can be characterized
by comparing the amount of TSNAs produced genetically modified
cells, with the amount of TSNAs produced in cells that have not
been genetically modified. The section below provides more
description of the transgenic plants and cells of the
invention.
[0351] Transgenic Plant Cells and Plants
[0352] Aspects of the present invention concern transgenic plant
cells comprising one or more interfering RNAs that are capable of
reducing or eliminating the expression of one or more target genes
and/or target gene products involved in nicotine, nornicotine,
and/or sterol biosynthesis. As described above, an appropriate
interfering RNA comprises a duplex RNA that comprises a first
strand that is substantially similar or identical to at least a
portion of a target gene or target mRNA, which encodes a gene
product involved in nicotine, nornicotine, and/or sterol
biosynthesis. The RNA duplex also comprises a second strand that is
complementary or substantially complementary to the first
strand.
[0353] The interfering RNA or nucleic acid construct comprising the
interfering RNA can be introduced into the plant cell in any
suitable manner. Plant cells possessing stable interfering RNA
activity, for example, by having a nucleic acid construct stably
integrated into a chromosome, can be used to regenerate whole
plants using methods known in the art. As such, some aspects of the
present invention relate to plants, such as tobacco plants,
transformed with one or more nucleic acid constructs and/or vectors
which encode at least one interfering RNA that is capable of
reducing or eliminating the expression of a gene product involved
in nicotine biosynthesis. Transgenic tobacco cells and the plants
described herein are characterized in that they have a reduced
amount of nicotine, nornicotine, sterol and/or TSNA and/or generate
a reduced amount of PAHs, as compared to unmodified or control
tobacco cells and plants.
[0354] The tobacco plants described herein are suitable for
conventional growing and harvesting techniques (e.g. topping or no
topping, bagging the flowers or not bagging the flowers,
cultivation in manure rich soil or without manure) and the
harvested leaves and stems are suitable for use in any traditional
tobacco product including, but not limited to, pipe, cigar and
cigarette tobacco and chewing tobacco in any form including leaf
tobacco, shredded tobacco or cut tobacco. It is also contemplated
that the low nicotine and/or TSNA tobacco described herein can be
processed and blended with conventional tobacco so as to create a
wide-range of tobacco products with varying amounts of nicotine
and/or nitrosamines. These blended tobacco products can be used in
tobacco product cessation programs so as to slowly move a consumer
from a high nicotine and/or sterol product to a low nicotine and
sterol product. Some embodiments of the invention comprise a
tobacco use cessation kit, comprising two or more tobacco products
with different levels of nicotine. For example, a smoker can begin
the program smoking blended cigarettes having 0.6 mg of nicotine,
gradually move to smoking cigarettes with 0.3 mg of nicotine,
followed by cigarettes having less than 0.1 mg nicotine until the
consumer decides to quit smoking altogether. Accordingly, the
blended cigarettes described herein provide the basis for an
approach to reduce the exposure of a tobacco consumer to a tobacco
related disease in a step-wise fashion. The components of the
tobacco use cessation kit described herein may include other
tobacco products, including but not limited to, smoking materials
(e.g., cigarettes, cigars, pipe tobacco), snuff, chewing tobacco,
gum, and lozenges.
[0355] Gene silencing has been employed in several laboratories to
create transgenic plants characterized by lower than normal amounts
of specific gene products. As used herein, "exogenous" or
"heterologous" nucleic acids, including DNAs and/or RNAs, refer to
nucleic acids that have been introduced into a cell (or the cell's
ancestor) through the efforts of humans. The nucleic acid
constructs that are used with the transgenic plants and the methods
for producing the transgenic plants described herein encode one or
more interfering RNA constructs comprising regulatory sequences,
which include, but are not limited to, a transcription initiation
sequence ("promoter") operable in the plant being transformed, and
a polyadenylation/transcription termination sequence. Typically,
the promoter is located upstream of the 5'-end of the nucleotide
sequence to be expressed. The transcription termination sequence is
generally located just downstream of the 3'-end of the nucleotide
sequence to be transcribed.
[0356] In some preferred embodiments, the nucleic acid encoding the
exogenous interfering RNA, which is transformed into a tobacco
cell, comprises a first RNA strand that is identical to the an
endogenous coding sequence of a gene encoding a gene product
involved in nicotine biosynthesis. However, minor variations
between the exogenous and endogenous sequences can be tolerated. It
is preferred, but not necessarily required, that the
exogenously-produced interfering RNA sequence, which is
substantially similar to the endogenous gene coding sequence, be of
sufficient similarity to the endogenous gene coding sequence, such
that the complementary interfering RNA strand is capable of binding
to the endogenous sequence in the cell to be regulated under
stringent conditions as described below.
[0357] In some embodiments, the heterologous sequence utilized in
the methods of the present invention may be selected so as to
produce an interfering RNA product comprising a first strand that
is substantially similar or identical to the entire QTPase mRNA
sequence, or to a portion thereof, and a second strand that is
complementary to the entire QPTase mRNA sequence, or to a portion
thereof. The interfering RNA may be complementary to any contiguous
sequence of the natural messenger RNA. For example, it may be
complementary to the endogenous mRNA sequence proximal to the
5'-terminus or capping site, downstream from the capping site,
between the capping site and the initiation codon and may cover all
or only a portion of the non-coding region, may bridge the
non-coding and coding region, be complementary to all or part of
the coding region, complementary to the C-terminus of the coding
region, or complementary to the 3'-untranslated region of the
mRNA.
[0358] As used herein, the term "gene" refers to a DNA sequence
that incorporates (1) upstream (5') regulatory signals including
the promoter, (2) a coding region specifying the product, protein
or RNA of the gene, (3) downstream regions including transcription
termination and polyadenylation signals and (4) associated
sequences required for efficient and specific expression. The DNA
sequence of the present invention may consist essentially of the
sequence provided herein, or equivalent nucleotide sequences
representing alleles or polymorphic variants of these genes, or
coding regions thereof. Use of the phrase "substantial sequence
similarity" or "substantially similar" in the present specification
and claims means that DNA, RNA or amino acid sequences which have
slight and non-consequential sequence variations from the actual
sequences disclosed and claimed herein are considered to be
equivalent to the sequences of the present invention. In this
regard, "slight and non-consequential sequence variations" mean
that "similar" sequences (i.e., the sequences that have substantial
sequence similarity with the DNA, RNA or proteins disclosed and
claimed herein) will be functionally equivalent to the sequences
disclosed and claimed in the present invention. Functionally
equivalent sequences will function in substantially the same manner
to produce substantially the same compositions as the nucleic acid
and amino acid compositions disclosed and claimed herein.
[0359] As used herein, a "native nucleotide sequence" or "natural
nucleotide sequence" means a nucleotide sequence that can be
isolated from non-transgenic cells or tissue. Native nucleotide
sequences are those which have not been artificially altered, such
as by site-directed mutagenesis. Once native nucleotide sequences
are identified, nucleic acid molecules having native nucleotide
sequences may be chemically synthesized or produced using
recombinant nucleic acid procedures as are known in the art. As
used herein, a "native plant nucleotide sequence" is that which can
be isolated from non-transgenic plant cells or tissue. As used
herein, a "native tobacco nucleotide sequence" is that which can be
isolated from non-transgenic tobacco cells or tissue. Use of the
phrase "isolated" or "substantially pure" in the present
specification and claims as a modifier of nucleic acids,
polypeptides or proteins means that the nucleic acids, polypeptides
or proteins so designated have been separated from their in vivo
cellular environments through the efforts of human beings.
[0360] The nucleotide sequences provided herein, such as
interfering RNAs or nucleic acids encoding interfering RNAs, can be
transformed into a variety of host cells. As used herein,
"transformation" refers to the introduction of exogenous nucleic
acid into cells so as to produce transgenic cells stably
transformed with the exogenous nucleic acid. A variety of suitable
host cells, having desirable growth and handling properties, are
readily available in the art.
[0361] Standard techniques, such as restriction mapping, Southern
blot hybridization, polymerase chain reaction (PCR) and/or
nucleotide sequence analysis can be employed to identify clones
expressing the desired interfering RNA construct. Following the
introduction and verification of the desired interfering RNA or
nucleic acid construct encoding the desired interfering RNA, whole
plants can be regenerated from successfully transformed cells using
conventional techniques.
[0362] Nucleic acid constructs, or "transcription cassettes,"
encoding the interfering RNAs that are used to produce the
transgenic cells and plants of the present invention include, 5' to
3' in the direction of transcription, a promoter as described
herein, a nucleotide sequence as described herein operatively
associated with the promoter, and, optionally, a termination
sequence including stop signal for RNA polymerase and a
polyadenylation signal. All of these regulatory regions should be
capable of operating in the cells of the tissue to be transformed.
Any suitable termination signal may be employed in carrying out the
present invention, examples thereof including, but not limited to,
the nopaline synthase (nos) terminator, the octapine synthase (ocs)
terminator, the CaMV terminator or native termination signals,
derived from the same gene as the transcriptional initiation region
or derived from a different gene. (See, e.g., Rezian et al. (1988)
supra, and Rodermel et al. (1988), supra).
[0363] The term "operatively associated," as used herein, refers to
nucleotide sequences on a single nucleic acid molecule that are
associated so that the function of one sequence is affected by the
other. Thus, a promoter is operatively associated with a nucleotide
sequence when it is capable of affecting the transcription of that
sequence (i.e., the nucleic acid is under the transcriptional
control of the promoter). The promoter is said to be "upstream"
from the transcribed nucleotide sequence, which is in turn said to
be "downstream" from the promoter.
[0364] In some embodiments, the transcription cassette may be
provided in a DNA construct that also has at least one replication
system. For convenience, it is common to have a replication system
functional in Escherichia colit, such as ColE1, pSC101, pACYC184,
or the like. In this manner, at each stage after each manipulation,
the resulting construct may be cloned, sequenced, and the
correctness of the manipulation determined. In addition, or in
place of the E. coli replication system, a broad host range
replication system may be employed, such as the replication systems
of the P-1 incompatibility plasmids, e.g., pRK290. In addition to
the replication system, there will frequently be at least one
marker present, which may be useful in one or more hosts, or
different markers for individual hosts. That is, one marker may be
employed for selection in a prokaryotic host, while another marker
may be employed for selection in a eukaryotic host, particularly
the plant host. The markers may be protection against a biocide
(such as antibiotics, toxins, heavy metals or the like), provide
complementation by imparting prototrophy to an auxotrophic host
and/or provide a visible phenotype through the production of a
novel compound in the plant.
[0365] The various fragments comprising the various constructs,
transcription cassettes, markers and the like may be introduced
consecutively by restriction enzyme cleavage of an appropriate
replication system and insertion of the particular construct or
fragment into the available site. After ligation and cloning, the
DNA construct may be isolated for further manipulation. All of
these techniques are amply exemplified in the literature as
demonstrated by J. Sambrook et al., Molecular Cloning, A Laboratory
Manual (2d Ed. 1989) (Cold Spring Harbor Laboratory).
[0366] Vectors that may be used to transform plant tissue with
nucleic acid constructs of the present invention include
Agrobacterium and Transbacter vectors and ballistic vectors, as
well as vectors suitable for DNA-mediated transformation. In this
particular embodiment, the promoter is a region of a DNA sequence
that incorporates the necessary signals for the efficient
expression of the coding sequence. This region may include
sequences to which an RNA polymerase binds, but is not limited to
such sequences, and may include sequences to which other regulatory
proteins bind along with sequences involved in the control of
protein translation. Such regions may also include coding
sequences.
[0367] Promoters employed in carrying out the invention may be
constitutively active promoters. Numerous constitutively active
promoters that are operable in plants are available. A preferred
example is the Cauliflower Mosaic Virus (CaMV) 35S promoter, which
is expressed constitutively in most plant tissues. As an
alternative, the promoter may be a root-specific promoter or root
cortex specific promoter, as explained in greater detail below.
[0368] Nucleic acid sequences have been expressed in transgenic
tobacco plants utilizing the Cauliflower Mosaic Virus (CaMV) 35S
promoter. (See, e.g., Cornelissen et al., "Both RNA Level and
Translation Efficiency are Reduced by Anti-Sense RNA in Transgenic
Tobacco", Nucleic Acids Res. 17, pp. 833-43 (1989); Rezaian et al.,
"Anti-Sense RNAs of Cucumber Mosaic Virus in Transgenic Plants
Assessed for Control of the Virus", Plant Molecular Biology 11, pp.
463-71 (1988); Rodermel et al., "Nuclear-Organelle Interactions:
Nuclear Antisense Gene Inhibits Ribulose Bisphosphate Carboxylase
Enzyme Levels in Transformed Tobacco Plants", Cell 55, pp. 673-81
(1988); Smith et al., "Antisense RNA Inhibition of
Polygalacturonase Gene Expression in Transgenic Tomatoes", Nature
334, pp. 724-26 (1988); Van der Krol et al., "An Anti-Sense
Chalcone Synthase Gene in Transgenic Plants Inhibits Flower
Pigmentation", Nature 333, pp. 866-69 (1988)).
[0369] Use of the CaMV 35S promoter for expression of interfering
RNAs in the transformed tobacco cells and plants of this invention
is preferred. Use of the CaMV promoter for expression of other
recombinant genes in tobacco roots has been well described (Lam et
al., "Site-Specific Mutations Alter In Vitro Factor Binding and
Change Promoter Expression Pattern in Transgenic Plants", Proc.
Nat. Acad Sci. USA 86, pp. 7890-94 (1989); Poulsen et al.
"Dissection of 5' Upstream Sequences for Selective Expression of
the Nicotiana plumbaginifolia rbcS-8B Gene", Mol. Gen. Genet. 214,
pp. 16-23 (1988)). Other promoters that are active only in root
tissues (root specific promoters) are also particularly suited to
the methods of the present invention. See, e.g., U.S. Pat. No.
5,459,252 to Conkling et al.; Yamamoto et al., The Plant Cell,
3:371 (1991). The TobRD2 root-cortex specific promoter may also be
utilized. All patents cited herein are intended to be incorporated
herein by reference in their entirety.
[0370] The recombinant interfering nucleic acid molecules and
vectors used to produce the transformed tobacco cells and plants of
this invention may further comprise a dominant selectable marker
gene. Suitable dominant selectable markers for use in tobacco
include, inter alia, antibiotic resistance genes encoding neomycin
phosphotransferase (NPTII) and hygromycin phosphotransferase (HPT).
Preferred selectable markers include the norflurazone resistance
genes described in this disclosure. Other well-known selectable
markers that are suitable for use in tobacco include a mutant
dihydrofolate reductase gene that encodes methotrexate-resistant
dihydrofolate reductase. DNA vectors containing suitable antibiotic
resistance genes, and the corresponding antibiotics, are
commercially available.
[0371] Transformed tobacco cells are selected out of the
surrounding population of non-transformed cells by placing the
mixed population of cells into a culture medium containing an
appropriate concentration of the antibiotic (or other compound
normally toxic to tobacco cells) against which the chosen dominant
selectable marker gene product confers resistance. Thus, only those
tobacco cells that have been transformed will survive and multiply.
Additionally, the positive selection techniques described by
Jefferson (e.g., WO 00055333; WO 09913085; U.S. Pat. Nos.
5,599,670; 5,432,081; and 5268463, hereby expressly incorporated by
reference in their entireties) can be used.
[0372] Methods of making recombinant plants of the present
invention, in general, involve first providing a plant cell capable
of regeneration (the plant cell typically residing in a tissue
capable of regeneration). The plant cell is then transformed with
an interfering RNA or a nucleic acid construct encoding an
interfering RNA comprising a transcription cassette of the present
invention (as described above) and a recombinant plant is
regenerated from the transformed plant cell. As explained below,
the transforming step is carried out by techniques as are known in
the art, including but not limited to bombarding the plant cell
with microparticles carrying the transcription cassette, infecting
the cell with an Agrobacterium tumefaciens containing a Ti plasmid
carrying the transcription cassette or any other technique suitable
for the production of a transgenic plant.
[0373] Numerous Agrobacterium vector systems useful in carrying out
the present invention are known. For example, U.S. Pat. No.
4,459,355 discloses a method for transforming susceptible plants,
including dicots, with an Agrobacterium strain containing the Ti
plasmid. The transformation of woody plants with an Agrobacterium
vector is disclosed in U.S. Pat. No. 4,795,855. Further, U.S. Pat.
No. 4,940,838 to Schilperoort et al. discloses a binary
Agrobacterium vector (i.e., one in which the Agrobacterium contains
one plasmid having the vir region of a Ti plasmid but no T region,
and a second plasmid having a T region but no vir region) useful in
carrying out the present invention, all references are hereby
expressly incorporated by reference in their entireties.
[0374] Microparticles suitable for the ballistic transformation of
a plant cell, carrying a nucleic acid construct of the present
invention, are also useful for making the transformed plants
described herein. The microparticle is propelled into a plant cell
to produce a transformed plant cell and a plant is regenerated from
the transformed plant cell. Any suitable ballistic cell
transformation methodology and apparatus can be used in practicing
the present invention. Exemplary apparatus and procedures are
disclosed in Sanford and Wolf, U.S. Pat. No. 4,945,050, and in
Christou et al., U.S. Pat. No. 5,015,580. When using ballistic
transformation procedures, the transcription cassette may be
incorporated into a plasmid capable of replicating in or
integrating into the cell to be transformed. Examples of
microparticles suitable for use in such systems include 1 to 5
.mu.m gold spheres. The nucleic acid construct may be deposited on
the microparticle by any suitable technique, such as by
precipitation.
[0375] Plant species may be transformed with the interfering RNA or
nucleic acid construct encoding an interfering RNA of the present
invention by the nucleic acid-mediated transformation of plant cell
protoplasts. Plants may be subsequently regenerated from the
transformed protoplasts in accordance with procedures well known in
the art. Fusion of tobacco protoplasts with nucleic acid-containing
liposomes or with nucleic acid constructs via electroporation is
known in the art. (Shillito et al., "Direct Gene Transfer to
Protoplasts of Dicotyledonous and Monocotyledonous Plants by a
Number of Methods, Including Electroporation", Methods in
Enzymology 153, pp. 313-36 (1987)).
[0376] These inhibition constructs or RNAi constructs can be
transferred to plant cells by any known method in the art.
Preferably, Agrobacterium-mediated or Biolistic-mediated
transformation are used, according to well-established protocols.
It is also contemplated that Transbacter-mediated transformation
can be used, as described below. (See Broothaerts et al., Nature
433, 629 (2005), herein expressly incorporated by reference in its
entirety).
[0377] By this approach, first bacteria are prepared as follows. YM
plus antibiotic plates (see below) are streaked with bacteria and
the plates are incubated for 2-3 days at 28.degree. C.
Transformation is accomplished by measuring about 20 mL Minimal A
medium for each bacterial strain. Scrapping or washing the Scrape
or wash bacteria from plate with sterile loop and then suspending
said bacteria in 20 mL of Minimal A medium. The cell density is
adjusted to an OD600 0.9-1.0.
[0378] Next, the first healthy fully expanded leaves from 4-5 week
old tissue culture grown tobacco plants are cut into 0.5 cm squares
(or can use a cork borer, which is about 1.0 cm diameter) in deep
Petri dish, under sterile RMOP liquid medium. The tissue pieces are
stored in RMOP in a deep Petri dish. The leaf pieces (about 20 per
transformation) are then transferred to a deep Petri dish
containing bacterial suspension. To ensure that the bacteria have
contacted a cut edge of the leaf, the suspension with leaf cutting
is swirled and is left standing for 5 minutes. The leaf pieces are
then removed from the suspension and blotted dry on filter paper or
on the edge of the container. The leaf pieces are then placed with
adaxial side (upper leaf surface) on solid RMOP at about 10 pieces
per plate.
[0379] The plates are then incubated in the dark at 28.degree. C.
for: 2-3 days, if A. tumefaciens is used, 5 days if S. mehloti is
used, 5 days M loti is used, and 5-11 days if Rhizobium sp. NGR234
is used.
[0380] Over the next week, selection is performed. For the purposes
of this example, hygromycin selction is performed. Accordingly, the
leaf pieces are transferred onto solid RMOP-TCH, with abaxial
surface (lower surface of leaf) in contact with media.
[0381] The plates are incubated for 2-3 weeks in the light at
28.degree. C., with 16 hours daylight per day. Subculture occurs
every 2 weeks.
[0382] Plantlet formation is accomplished as follows. Once shoots
appear, the plantlet is transferred to MST-TCH pots. The plantlets
are grown with 16 hours daylight for 1-2 weeks. Once roots form the
plants appear, the plants can be transferred to soil in the
greenhouse.
[0383] Media and Solutions for Tobacco Transformation:
[0384] YM Media (1 L)
TABLE-US-00004 Mannitol 10 g Yeast extract 0.4 g K2HPO.sub.4 (10%
w/v stock) 1 ml KH2PO.sub.4 (10% w/v stock) 4 ml NaCl (10% w/v
stock) 1 ml MgSO.sub.4.cndot.7H2O (10% w/v stock) 2 ml pH 6.8 Agar
15 g/L Autoclave *When ready to pour add antibiotic selection if
required Keep poured plates for 2 days at room temperature to
visualize any contamination, then store at 4.degree. C.
[0385] RMOP+RMOP-TCH Media
(Svab, Z., et al., 1975. Transgenic tobacco plants by cocultivation
of leaf disks with pPZP Agrobacterium binary vectors. In "Methods
in Plant Molecular Biology-A Laboratory Manual", P. Maliga, D.
Klessig, A. Cashmore, W. Gruissem and J. Varner, eds. Cold Spring
Harbor Press: 55-77), herein expressly incorporated by reference in
its entirety).
1 L Final Conc.
TABLE-US-00005 [0386] Sucrose 30 g (3%) Myo-inositol 100 mg (0.1%)
MS Macro 10x 100 mL (1x) MS Micro 1000x 1 mL (1x) Fe.sub.2EDTA Iron
100x 10 mL (1x) Thiamine-HCl (10 mg/mL stock) 100 .mu.L (1mg) NAA
(1 mg/mL stock) 100 .mu.L 0.1 mg) BAP (1 mg/mL stock) 1 mL (1 mg)
pH 5.8 Phytagel 2.5 g/L for solid autoclave *for RMOP-TCH, when
ready to pour add: Timentin (200 mg/mL stock) 1 mL, Claforan (250
mg/mL stock) 1 mL, and Hygromycin (50 mg/mL stock) 1 mL
[0387] BAP (1 mg/ml) (6-Benzylaminopurine)
Add 1N KOH drop wise to 100 mg BAP until dissolved. Make up to 100
mL with Milli-Q H2O and store at 4.degree. C.
[0388] NAA (1 mg/ml) (Naphthalene acetic acid)
Dissolve 100 mg NAA in 1 mL absolute ethanol. Add 3 mL 1N KOH. Make
up to 80 mL with Milli-Q H2O. Adjust pH to 6.0 with 1N HCl, make up
to 100 mL with Milli-Q H2O, and store at 4.degree. C.
[0389] Cefotaxamine (250 mg/ml)
Add 8 ml sterile Milli-Q H2O to 2 g Claforan and store at 4.degree.
C. in dark
[0390] Timentin (200 mg/ml)
Add 15 ml sterile Milli-Q H2O to 3 g Timentin and store at
4.degree. C.
[0391] MST+MST-TCH Media
(Svab, Z., et al., 1975. Transgenic tobacco plants by cocultivation
of leaf disks with pPZP Agrobacterium binary vectors. In "Methods
in Plant Molecular Biology-A Laboratory Manual", P. Maliga, D.
Klessig, A. Cashmore, W. Gruissem and J. Varner, eds. Cold Spring
Harbor Press: 55-77), herein expressly incorporated by reference in
its entirety).
1 L Final Concentration
TABLE-US-00006 [0392] Sucrose 30 g (3%) MS Macro 10x 100 mL (1x) MS
Micro 1000x 1 mL (1x) Fe.sub.2EDTA Iron 100x 10 mL (1x) pH 5.8
Phytagel 2.5 g/L Autoclave For MST-TCH, when ready to pour add:
Timentin (200 mg/mL stock) (1 mL) Cefotaxamine (250 mg/mL stock) (1
mL) Hygromycin (50 mg/mL stock) (1 mL)
[0393] MS Macro 10.times. ((Murashige and Skoog., Phys. Plant. 15:
473-497 (1962), herein expressly incorporated by reference in its
entirety)).
Final concentration
TABLE-US-00007 10x (g/L) KNO.sub.3 19.0 NH4 N0.sub.3 16.5
CaCl.sub.2.cndot.2H.sub.20 4.4 MgS0.sub.4.cndot.7H.sub.20 3.7
KH.sub.2PO.sub.4 1.7 Store 4.degree. C.
Substituting Chemicals:
CaCl.sub.2 3.3 g/L
MgSO.sub.4 1.8 g/L
[0394] MS Micro 1000.times.
(Murashige and Skoog., Phys. Plant. 15: 473-497 (1962), herein
expressly incorporated by reference in its entirety).
Final Concentration
TABLE-US-00008 [0395] 1000x (g/L) MnS0.sub.4.cndot.4H.sub.20 22.3
ZnS0.sub.4.cndot.7H.sub.20 8.6 H.sub.3BO.sub.3 6.2 KI 0.83
Na.sub.2MoO.sub.4.cndot.2H.sub.20 0.25 CuSO.sub.4.cndot.5H.sub.20
25 mg CoCl.sub.2.cndot.6H.sub.20 25 mg Store 4.degree. C.
Substituting Chemicals:
MnSO.sub.4.H.sub.2O 16.9/L
[0396] FeSO.sub.4EDTA Iron 100.times.
TABLE-US-00009 (g/1 L) FeS0.sub.4.cndot.7H.sub.20 2.78 Na.sub.2EDTA
3.72 Store 4.degree. C. in dark bottle
[0397] Once the transformed cells are selected, by any of the
approaches described above, they are induced to regenerate intact
tobacco plants through application of tobacco cell and tissue
culture techniques that are well known in the art. The method of
plant regeneration is chosen so as to be compatible with the method
of transformation. The stable presence of an interfering RNA or a
nucleic acid encoding an interfering RNA in transgenic tobacco
plants can be verified by Mendelian inheritance of the interfering
RNA or a nucleic acid encoding an interfering RNA sequence, as
revealed by standard methods of nucleic acid analysis applied to
progeny resulting from controlled crosses. After regeneration of
transgenic tobacco plants from transformed cells, the introduced
nucleic acid sequence is readily transferred to other tobacco
varieties through conventional plant breeding practices and without
undue experimentation.
[0398] For example, to analyze the segregation of the transgene,
regenerated transformed plants (TO) may be grown to maturity,
tested for nicotine and/or TSNA levels, and selfed to produce
T.sub.1 plants. A percentage of T.sub.1 plants carrying the
transgene are homozygous for the transgene. To identify homozygous
T.sub.1 plants, transgenic T.sub.1 plants are grown to maturity and
selfed. Homozygous T.sub.1 plants will produce T.sub.2 progeny
where each progeny plant carries the transgene; progeny of
heterozygous T.sub.1, plants will segregate 3:1.
[0399] Any plant tissue capable of subsequent clonal propagation,
whether by organogenesis or embryogenesis, may be transformed with
a nucleic acid embodiment of the present invention. Preferred
plants for introduction of a nucleic acid embodiment, described
herein, include Nicotiana. Preferred varieties of Nicotana for
introduction of a nucleic acid embodiment as described herein
include the Nicotiana tabacum varieties provided in Table 4.
TABLE-US-00010 TABLE 4 Burley Dark One Newest Varieties Varieties
Flu Cured Other Virginia Hybrid Sucker Varieties Oriental KT 200
BLACK K 149 CU 748 BROWN NBH 98 OS400 GL 350 D174 LC MAMMOTH LEAF
KT 204 DF 485 K 326 GL 737 LIZARD MS KY LC TAIL 21xKY 160 ORNOCO 10
KY DF 911 K 346 OX 207 LIZARD MS TAIL 14xKY TURTLE L8 FOOT KY 10 DT
508 K 394 PVH 03 M and N TN 97 KY 14 DT 518 K 730 PVH 09 SHIREY KT
200 KY 17 DT 592 Coker 371 PVH WALKER Gold 2040 BROADLEAF KY 907
GREEN CU 748 RG 17 WOOD KY 907 IMPROVED GL 737 RG 81 LC MADOLE KY
908 KT-D4 LC GL 939 RGH 4 KY 908 KY 160 GL 973 RGH 51 KY 910 KY 171
K 358 RS 1410 MS KY 171 K 399 Speight Burley 21 168 x KY 10 MS KY14
LITTLE NC 102 Speight x L8 CRITTENDEN 179 N 126 LITTLE NC 291
Speight WOOD 190 N 777 NARROW NC 297 Speight LEAF 196 MADOLE N 88
NEWTON'S NC 55 Speight VH MADOLE 200A NBH 98 NL MADOLE NC 606
Speight 210 TN 86 TN D94 NC 71 Speight 218 TN 86 LC TN D950 NC 72
Speight 220 TN 90 TR MADOLE NC 810 Speight H-20 TN 90 LC VA 309 RGH
4 Speight H-6 TN 97 LC VA 312 RGH 51 Speight NF-3 VA 509 VA 355 VA
119 LA21 VA 359 NC 37 NF OX 414 NF Sp. G- 172
[0400] The term "organogenesis," as used herein, means a process by
which shoots and roots are developed sequentially from meristematic
centers; the term "embryogenesis," as used herein, means a process
by which shoots and roots develop together in a concerted fashion
(not sequentially), whether from somatic cells or gametes. The
particular tissue chosen will vary depending on the clonal
propagation systems available for, and best suited to, the
particular species being transformed. Exemplary tissue targets
include leaf disks, pollen, embryos, cotyledons, hypocotyls, callus
tissue, existing meristematic tissue (e.g., apical meristems,
axillary buds, and root meristems) and induced meristem tissue
(e.g., cotyledon meristem and hypocotyl meristem).
[0401] Plants of the present invention may take a variety of forms.
The plants may be chimeras of transformed cells and non-transformed
cells; the plants may be clonal transformants (e.g., all cells
transformed to contain the transcription cassette); the plants may
comprise grafts of transformed and untransformed tissues (e.g., a
transformed root stock grafted to an untransformed scion in citrus
species). The transformed plants may be propagated by a variety of
means, such as by clonal propagation or classical breeding
techniques. For example, first generation (or T.sub.i) transformed
plants may be selfed to give homozygous second generation (or
T.sub.2) transformed plants and the T.sub.2 plants further
propagated through classical breeding techniques. A dominant
selectable marker (such as nptII) can be associated with the
transcription cassette to assist in breeding.
[0402] As used herein, a crop comprises a plurality of plants of
the present invention, and of the same genus, planted together in
an agricultural field. By "agricultural field" is meant a common
plot of soil or a greenhouse. Thus, the present invention provides
a method of producing a crop of plants having reduced amounts of
nicotine, nornicotine, and/or sterol, as compared to a similar crop
of non-transformed plants of the same species and variety.
[0403] The modified tobacco plants described herein are suitable
for conventional growing and harvesting techniques (e.g. topping or
no topping, bagging the flowers or not bagging the flowers,
cultivation in manure rich soil or without manure). The harvested
tobacco leaves and stems are suitable for conventional methods of
processing such as curing and blending. The modified tobacco is
suitable for use in any traditional tobacco product including, but
not limited to, pipe, cigar and cigarette tobacco, and chewing
tobacco in any form including leaf tobacco, shredded tobacco, or
cut tobacco.
[0404] Some embodiments concern the production and identification
of particular lines of a transgenic Burley variety (Vector 21-41),
which have very low levels of nicotine and TSNAs. The constructs
used to create these particular lines of transgenic Burley tobacco
are provided in Conkling et al., WO98/56923; U.S. Pat. Nos.
6,586,661; 6,423,520; and U.S. patent application Ser. Nos.
09/963,340; 10/356,076; 09/941,042; 10/363,069; 10/729,121;
10/943,346, all of which are hereby expressly incorporated by
reference in their entireties. After the creation and analysis of
nearly 2,000 lines of transgenic Burley tobacco, these particular
lines of reduced nicotine and TSNA transgenic tobacco were
identified. Tobacco harvested from these lines were incorporated
into tobacco products (Quest 1.RTM., Quest 2.RTM., and Quest
3.RTM.) and were analyzed for their ability to reduce the potential
to contribute to a tobacco-related disease, as described in the
sections above. It was found that tobacco products comprising these
lines of transgenic Burley tobacco, had a reduced potential to
contribute to a tobacco-related disease (i.e., that these tobacco
products are reduced risk tobacco products).
[0405] Several embodiments concern isolated nucleic acids that
comprise, consist, or consist essentially of the nucleic acids
described in the sequence listing (SEQ. ID. NOs.: 2, 3, 4, 5, 6, 7,
8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24,
25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35) and fragments
thereof at least 30 consecutive nucleotides in length. That is,
embodiments of the invention include an isolated nucleic acid
comprising, consisting of, consisting essentially of, any one or
more of the sequences of SEQ. ID. NOs.: 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, 30, 31, 32, 33, 34, or 35, or a fragment thereof (e.g., a
fragment that is at least, less than or equal to or greater than
30, 40, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240,
260, 280, 300, 320, 340, 360, 380, 400, 420, 440, 460, 480, 500,
520, 540, 560, 580, 600, 620, 640, 660, 680, 700, 800, 900, 1000,
1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100,
2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3100, 3200,
3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200, 4300,
4400, 4500, 4600, 4700, 4800, 4900, 5000, 5100, 5200, 5300, 5400,
5500, 5600, 5700, 5800, 5900, 6000, 6100, 6200, 6300, 6400, 6500,
6600, 6700, 6800, 6900, 7000, 7100, 7200, 7300, 7400, 7500, 7600,
7700, 7800, 7900, 8000, 8100, 8200, 8300, 8400, 8500, 8600, 8700,
8800, 8900, or 9000 consecutive nucleotides of SEQ. ID. NOs.: 2, 3,
4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35.
[0406] In preferred embodiments, the target gene or target mRNA
encodes QTPase, PMTase, or the A622 gene product. In preferred
embodiments, an interfering RNA comprises, consists, or consists
essentially of an RNA strand that is complementary to each least a
portion (e.g., less than, greater than or equal to 30, 35, 40, 45,
50, 60, 75, 100, 150, 250, 500, 750, or 1000 consecutive
nucleotides) of SEQ ID NOS: 2, 3, 4, or 5, and inhibits the
production of QTPase, PMTase, A622, nicotine, nornicotine, NNN,
NNK, NAT, or NAB in a tobacco. In related embodiments, the
interfering RNA comprises, consists, or consists essentially of an
RNA strand that is complementary to each least a portion (e.g.,
less than, greater than or equal to 30, 35, 40, 45, 50, 60, 75,
100, 150, 250, 500, 750, or 1000 consecutive nucleotides) of SEQ ID
NO: 5, and inhibits production of nornicotine but not nicotine in a
tobacco. In still more embodiments, the interfering RNA comprises,
consists, or consists essentially of an RNA strand that is
complementary to each least a portion (e.g., less than, greater
than or equal to 30, 35, 40, 45, 50, 60, 75, 100, 150, 250, 500,
750, or 1000 consecutive nucleotides) of SEQ ID NO: 6, 7, 8, or 9,
and inhibits production of at least one sterol (e.g., squalene
synthase, HMG-CoA reductase, SMT2, or 14alpha demethylase) in a
tobacco and a PAH upon pyrolysis of said tobacco.
[0407] Some of these nucleic acid embodiments comprise, consist, or
consist essentially of fragments of the QPTase, PMTase, and A622
genes that were found to inhibit gene expression unexpectedly well
in the RNAi constructs described herein, producing reduced alkaloid
tobacco (below 7,000 ppm, 1,000 ppm, or 500 ppm). Some of these
nucleic acids concern fragments of genes involved in sterol
biosynthesis (e.g., squalene synthase, HMG-CoA reductase, SMT2, or
14alpha demethylase) and these fragments are particularly useful
for inhibiting production of sterols in tobacco and PAHs when said
tobacco undergoes pyrolysis.
[0408] Still more of the nucleic acid embodiments concern several
phytoene desaturase (PDS) mutants (e.g., PDSM-1, PDSM-2, and
PDSM-3, SEQ. ID. NOs.: 10, 11, or 12) that were developed to confer
resistance to norflurazone, which allows both tissue-culture
selection of cells transformed with the construct, as well as,
field-based selection, wherein weeds and tobacco, which do not
contain an herbicide resistance gene, are removed from the field or
crop by spraying the herbicide norflurazone or an herbicide of the
same class or activity (e.g., herbicides that contain
C.sub.12H.sub.9ClF.sub.3N.sub.3O; (see U.S. Pat. No. 3,644,355,
herein expressly incorporated by reference in its entirety)) but
plants expressing PDSM-1, PDSM-2, or PDSM-3 survive the herbicide
contact. That is, some embodiments include isolated nucleic acids
that comprise, consist, or consist essentially of the PDS mutant
sequences provided by SEQ. ID. NOs.:10, 11, or 12 and fragments
thereof at least 30 nucleotides in length (e.g., less than, greater
than or equal to 30, 35, 40, 45, 50, 60, 75, 100, 150, 250, 500,
750, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, or 1729
consecutive nucleotides) that include a mutation (e.g., T1478G,
which encodes Val493Gly; G863C, which encodes Arg288Pro; and
T1226C, which encodes Leu409Pro) that confers resistance to
norflurazone). Preferably, the fragments of the PDS mutants
described herein confer resistance to norflurazone, although
fragments that do not confer resistance to the herbicide are also
useful in the field in assays designed to follow the retention of
constructs described herein in successive generations of transgenic
plants. Approaches to develop more norflurazone-resistance genes
are also provided herein.
[0409] Additional embodiments include isolated nucleic acids that
comprise, consist, or consist essentially of root-specific
promoters, constitutive promoters, and developmentally regulated
promoters, which can be used interchangeably with the nucleic acid
sequences described herein. Some embodiments, for example, include
a root-specific promoter such as the truncated RD2 promoter (SEQ.
ID NO. 13) or the Putrescene methyl transferase promoter (PMT-1)
(SEQ. ID NO. 14). Constitutive promoters that can be used with
embodiments described herein include the GapC promoter (SEQ. ID.
NO.: 15), Actin 2 promoter (Act2P) (SEQ. ID NO. 16), the tobacco
alcohol dehydrogenase promoter (ADP) (SEQ. ID NO. 17), and the
Arabidopsis ribosomal protein L2 promoter (RPL2P) (SEQ. ID NO. 18).
Developmentally regulated promoters that can be used with the
nucleic acid sequences described herein include the cinnamyl
alcohol dehydrogenase promoter (SEQ. ID NO. 19) and the
metallothionein I promoter (SEQ. ID NO. 20). Additional embodiments
also include isolated nucleic acids that comprise, consist, or
consist essentially of the GAD2 terminator (SEQ. ID NO. 21), a FAD2
intron (provided by (SEQ. ID NO. 22), which was used as a spacer in
several of the RNAi constructs, and the PAP1 intron (provided by
nucleotides 6446-7625 of (SEQ. ID NO. 33). Because of the unique
properties of the FAD2 intron, in particular the hair-pin secondary
structure afforded by the interaction of splice sites in the
sequence, it was found, unexpectedly, that transgenic tobacco could
be made with various inhibitory sequences with nearly equivalent
success (e.g., approximately 50% of the reduced nicotine lines
created by multiple constructs were found to have less than 1,000
ppm total alkaloid). Accordingly, significantly improved RNAi
constructs were generated using this spacer. That is, aspects of
the invention concern the use of an intronic sequence comprising
splicing recognition sequences (preferably FAD2 or PAP1 intron) to
link or join a first RNA sequence to a second RNA sequence that is
complementary to said first RNA sequence, wherein said first or
second RNA sequence is complementary to a target RNA, which,
preferably, regulates the production of a harmful compound in
tobacco (e.g., nicotine, nornicotine, or a sterol).
[0410] Aspects of the invention also concern isolated nucleic acids
that comprise, consist, or consist essentially of the inhibition
and selection cassettes identified as SEQ. ID. Nos. 23, 24, 25, 26,
27, 28, 29, 30, 31, 32, 33, 34, or 35 and fragments thereof (e.g.,
a fragment that is at least, less than or equal to or greater than
30, 40, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240,
260, 280, 300, 320, 340, 360, 380, 400, 420, 440, 460, 480, 500,
520, 540, 560, 580, 600, 620, 640, 660, 680, 700, 800, 900, 1000,
1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100,
2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3100, 3200,
3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200, 4300,
4400, 4500, 4600, 4700, 4800, 4900, 5000, 5100, 5200, 5300, 5400,
5500, 5600, 5700, 5800, 5900, 6000, 6100, 6200, 6300, 6400, 6500,
6600, 6700, 6800, 6900, 7000, 7100, 7200, 7300, 7400, 7500, 7600,
7700, 7800, 7900, 8000, 8100, 8200, 8300, 8400, 8500, 8600, 8700,
8800, 8900, or 9000 consecutive nucleotides) of SEQ. ID. Nos. 23,
24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35).
[0411] Aspects of the invention also concern isolated nucleic acids
that comprise, consist, or consist essentially a plurality of the
nucleic acid sequences described herein. For example, a double
knock-out construct comprising a portion of the A622 gene and a
portion of the QPTase gene has been made and it is expected that
this construct will efficiently reduce expression of at least two
genes involved in the synthesis or regulation of the production of
nicotine (SEQ. ID. No. 27). Another double knock-out construct
comprises, consists of or consists essentially of a first isolated
nucleic acid that inhibits nicotine biosynthesis (e.g., A622) and a
second isolated nucleic acid that inhibits synthesis of at least
one sterol (e.g., SMT2). (See (SEQ. ID. No. 33). Accordingly,
aspects of the invention concern an isolated nucleic acid construct
that inhibits the expression of a plurality of genes that regulate
the production of more than one harmful compound in tobacco. In
some aspects of these embodiments, said isolated nucleic acid
construct inhibits the expression of at least two nicotine
biosynthesis genes, a nicotine biosynthesis gene and a sterol
biosynthesis gene, or two sterol biosynthesis genes. It should also
be understood that aspects of the invention concern tobacco
generated by crossing the transgenic tobaccos described herein. For
example, some embodiments concern progeny of a cross between a
transgenic tobacco having a reduced amount of nicotine and a
transgenic tobacco having a reduced amount of a sterol. Crossings
of the transgenic tobacco described herein and wild-type tobacco
are also aspects of the invention.
[0412] The interfering RNAs used with the embodied nucleic acids
can be expressed from nucleic acid construct that encodes one or
more strands of the RNA duplex of the interfering RNA. In some
embodiments, the nucleic acid construct is present on a vector. The
vectors may be viral vectors, plasmids, or any other vehicles for
nucleic acid delivery. In other embodiments, the interfering RNAs
described herein can be generated synthetically by methods, such as
direct synthesis or in vitro transcription. In some embodiments,
synthetic interfering nucleic acids comprising modified nucleic
acids are contemplated. Other embodiments of the present invention
include multiple vector systems for producing an interfering RNA
wherein a first vector encodes the first strand of the interfering
RNA and a second vector encodes the second strand of the
interfering RNA.
[0413] Still other embodiments of the present invention relate to
tobacco cells comprising one or more of the nucleic acid constructs
described herein, which encode an interfering RNA that is specific
for a gene product involved in nicotine or sterol biosynthesis. In
such embodiments, the interfering RNA reduces or eliminates the
expression of such gene product. Additional embodiments relate to
tobacco cells comprising one or more interfering RNAs that are
specific for a gene product involved in nicotine biosynthesis. In
certain embodiments, the interfering RNAs are synthetic interfering
RNAs.
[0414] Certain embodiments of the present invention relate to
tobacco plants and cured tobacco products having a reduced amount
or nicotine, nornicotine, TSNAs, and/or sterols. In such
embodiments, reduction in nicotine, nornicotine, TSNAs, and/or
sterol amounts in the tobacco plants and cured tobacco products is
mediated by an interfering RNA comprising an RNA duplex wherein at
least 30 consecutive nucleotides (e.g., at least or equal to 30,
40, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240,
260, 280, 300, 320, 340, 360, 380, 400, 420, 440, 460, 480, 500,
520, 540, 560, 580, 600, 620, 640, 660, 680, 700, 800, 900, 1000
consecutive nucleotides) of the RNA duplex are complementary or
substantially complementary to a target mRNA that encodes a gene
product involved in nicotine biosynthesis. Further aspects relate
to a field or crop of tobacco plants comprising one or more of the
constructs described herein. Still other aspects relate to a
tobacco seed produced from one or more of the tobacco plants of the
present invention.
[0415] Transgenic tobacco plants produced by the methods described
herein can be cured by any of the tobacco curing techniques that
are known in the art. As such, some embodiments of the present
invention relate to cured tobacco and cure tobacco products made
from the transgenic plants described herein. In some embodiments,
the cured tobacco product is a blended tobacco product. In some
embodiments, the cured tobacco product is processed in a
microbe-free environment. In other embodiments, the cured tobacco
is contacted with sterilizing vapor, heat, or radiation so as to
prevent the conversion of alkaloid to TSNAs.
[0416] Some aspects of the present invention relate to methods of
preparing a tobacco cell having a reduced nicotine and/or sterol
content, wherein the method comprises providing a tobacco cell with
one or more interfering RNAs or one or more nucleic acid constructs
encoding an interfering RNA comprising an RNA duplex, which
comprises a first strand having a sequence substantially similar or
identical to at least a portion of the coding sequence of a target
gene and/or target gene product involved in nicotine and/or sterol
biosynthesis, and a second strand that is complementary or
substantially complementary to the first strand. In a preferred
embodiment, the target gene product involved in nicotine
biosynthesis is QTPase, PMTase, or A622 and the target gene product
involved in sterol biosynthesis is squalene synthase, HMG-CoA
reductase, SMT2, or 14alpha demethylase.
[0417] Other aspects of the present invention relate to methods of
preparing a tobacco plant having a reduced nicotine and/or sterol
content comprising obtaining a tobacco cell in culture; providing
to the tobacco cell one or more interfering RNAs or one or more
nucleic acid constructs encoding an interfering RNA comprising an
RNA duplex, which comprises a first strand having a sequence
substantially similar or identical to at least a portion of the
coding sequence of a target gene and/or target gene product
involved in nicotine and/or sterol biosynthesis, and a second
strand that is complementary or substantially complementary to the
first strand; allowing expression of the interfering RNA, thereby
reducing cellular nicotine and/or sterol content; and regenerating
a tobacco plant from the tobacco cell. In some embodiments, the
tobacco plants prepared by such method also have a reduced TSNA
content and/or produce a reduced amount of PAHs upon pyrolysis, as
compared to a conventional tobacco product of the same class, a
reference tobacco product (e.g., IM16), or the same strain of
tobacco prior to genetic modification.
[0418] As mentioned above, additional embodiments include tobacco
products that have been carefully blended so that desired levels of
nicotine, TSNAs, and/or sterols are obtained. For example, tobacco
having a reduced level of nicotine and/or TSNAs, prepared as
described above, can be blended with conventional tobacco so as to
obtain virtually any amount of nicotine and/or sterols.
Additionally, as mentioned above, exogenous nicotine can be added
to the tobacco or tobacco product. Further, two or more varieties
of tobacco (e.g., transgenic reduced alkaloid Burley, transgenic
reduced alkaloid Flue-cured, and/or transgenic reduced alkaloid
Oriental) can be blended so as to achieve a desired taste while
maintaining nicotine levels at less than 7,000 ppm, 5,000 ppm, 3000
ppm, 2000 ppm, 1000 ppm, or 500 ppm and TSNA levels at 0.5 ug/g or
less. Similarly, two or more varieties of transgenic tobacco having
a reduced amount of sterols can be blended, as above, or varieties
of sterol-reduced transgenic tobacco can be blended with varieties
of nicotine reduced transgenic tobacco. In this manner, differences
in variety, flavor, as well as amounts of nicotine and/or sterols
can be incrementally adjusted. These blended tobaccos can be
processed into tobacco products, which can be incorporated into
tobacco use cessation kits (e.g., a multiple step nicotine
reduction program, whereby a consumer's exposure to nicotine, TSNA,
or PAH is gradually reduced over time by consumption of tobacco
products that have increasingly smaller quantities of these
compounds). Such kits and programs, are designed to reduce or
eliminate nicotine dependence and reduce the potential to
contribute to a tobacco related disease.
[0419] More embodiments concern methods to reduce the carcinogenic
potential of tobacco products, including cigarettes, cigars,
chewing tobacco, snuff and tobacco-containing gum and lozenges.
Some methods, for example involve the use of the constructs
described herein to obtain transgenic tobacco that comprises a
reduced amount of nicotine, TSNAs, and/or sterols and the
manufacture of tobacco products containing said tobacco.
Accordingly, the transgenic tobacco plants, described above, are
harvested, cured, and processed into tobacco products. These
tobacco products have a reduced carcinogenic potential because they
are prepared from tobacco that has a reduced amount of nicotine,
TSNAs, and sterols. Smoke or smoke condensate generated from these
tobaccos and tobacco products can also be evaluated using the
assays provided above, which have been filed with this application
and are herein expressly incorporated by reference in its
entireties so as to confirm that said tobaccos and tobacco products
have a reduced potential to contribute to a tobacco-related disease
and that said tobaccos and tobacco products are reduced risk
compositions.
[0420] Yet another aspect of the invention concerns the reduction
of the amount of TSNAs, preferably NNN and NNK, and PAHs,
preferably, BAP and metabolites thereof in humans who smoke,
consume or otherwise ingest tobacco. This method is practiced by
providing a tobacco product comprising a transgenic tobacco that
comprises a reduced amount of nicotine and/or a sterol to said
humans, thereby lowering the amount of TSNAs and/or PAHs in said
humans exposed to said tobacco product. By one approach, for
example, the carcinogenic potential of side stream or main stream
TS in a human exposed to said side stream or main stream TS is
reduced by providing the cured tobacco as described above in a
product that undergoes pyrolysis, wherein pyrolysis of said product
results in side stream or main stream smoke comprising a reduced
amount of TSNAs and/or PAHs. The section below describes several
preferred approaches to develop genetically modified tobaccos and
tobacco products containing genetically modified tobacco that have
a reduced amount of a compound that contributes to a tobacco
related disease.
[0421] Preparation of Preferred Transgenic Tobaccos
[0422] A first generation of transgenic Burley tobacco was created
using a full-length antisense QPTase construct. Tobacco of the
variety Burley 21 LA was transformed with the binary Agrobacterium
vector pYTY32 to produce a low nicotine tobacco variety, Vector
21-41. The binary vector pYTY32 carried the 2.0 kb NtQPT1
root-cortex-specific promoter driving antisense expression of the
NtQPT1 cDNA (SEQ. ID. NO. 2) and the nopaline synthase (nos) 3'
termination sequences from Agrobacterium tumefaciens T-DNA. The
selectable marker for this construct was neomycin
phosphotransferase (nptII) from E. coli Tn5 which confers
resistance to kanamycin, and the expression nptII was directed by
the nos promoter from Agrobacterium tumefaciens T-DNA. Transformed
cells, tissues, and seedlings were selected by their ability to
grow on Murashige-Skoog (MS) medium containing 300 .mu.g/ml
kanamycin. Burley 21 LA is a variety of Burley 21 with
substantially reduced levels of nicotine as compared with Burley 21
(i.e., Burley 21 LA has 8% the nicotine levels of Burley 21, see
Legg et al., Can J Genet Cytol, 13:287-91 (1971); Legg et al., J
Hered, 60:213-17 (1969)).
[0423] One-hundred independent pYTY32 transformants of Burley 21 LA
(T.sub.0) were allowed to self. Progeny of the selfed plants
(T.sub.1) were germinated on medium containing kanamycin and the
segregation of kanamycin resistance scored. T.sub.1 progeny
segregating 3:1 resulted from transformation at a single locus and
were subjected to further analysis.
[0424] Nicotine levels of T.sub.1 progeny segregating 3:1 were
measured qualitatively using a micro-assay technique. Approximately
.about.200 mg fresh tobacco leaves were collected and ground in 1
ml extraction solution (Extraction solution: 1 ml Acetic acid in
100 ml H.sub.2O). Homogenate was centrifuged for 5 min at
14,000.times.g and supernatant removed to a clean tube, to which
the following reagents were added: 100 .mu.L NH.sub.4OAC (5 g/100
ml H.sub.2O+50 .mu.L Brij 35); 500 .mu.L Cyanogen Bromide (Sigma
C-6388, 0.5 g/100 ml H.sub.2O+50 .mu.L Brij 35); 400 .mu.L Aniline
(0.3 ml buffered Aniline in 100 ml NH.sub.4OAC+50 .mu.L Brij 35). A
nicotine standard stock solution of 10 mg/ml in extraction solution
was prepared and diluted to create a standard series for
calibration. Absorbance at 460 nm was read and nicotine content of
test samples were determined using the standard calibration
curve.
[0425] T.sub.1 progeny that had less than 10% of the nicotine
levels of the Burley 21 LA parent were allowed to self to produce
T.sub.2 progeny. Homozygous T.sub.2 progeny were identified by
germinating seeds on medium containing kanamycin and selecting
clones in which 100% of the progeny were resistant to kanamycin
(i.e., segregated 4:0; heterozygous progeny would segregate 3:1).
Nicotine levels in homozygous and heterozygous T.sub.2 progeny were
qualitatively determined using the micro-assay and again showed
levels less than 10% of the Burley 21 LA parent. Leaf samples of
homozygous T.sub.2 progeny were sent to the Southern Research and
Testing Laboratory in Wilson, N.C. for quantitative analysis of
nicotine levels using Gas Chromatography/Flame Ionization Detection
(GC/FID). Homozygous T.sub.2 progeny of transformant #41 gave the
lowest nicotine levels (-70 ppm), and this transformant was
designated as "Vector 21-41."
[0426] Vector 21-41 plants were allowed to self-cross, producing
T.sub.3 progeny. T.sub.3 progeny were grown and nicotine levels
assayed qualitatively and quantitatively. T.sub.3 progeny were
allowed to self-cross, producing T.sub.4 progeny. Samples of the
bulked seeds of the T.sub.4 progeny were grown and nicotine levels
tested.
[0427] In general, Vector 21-41 is similar to Burley 21 LA in all
assessed characteristics, with the exception of alkaloid content
and total reducing sugars (e.g., nicotine and nor-nicotine). Vector
21-41 may be distinguished from the parent Burley 21 LA by its
substantially reduced content of nicotine, nor-nicotine and total
alkaloids. As shown below, total alkaloid concentrations in Vector
21-41 are significantly reduced to approximately relative to the
levels in the parent Burley 21 LA, and nicotine and nor-nicotine
concentrations show dramatic reductions in Vector 21-41 as compared
with Burley 21 LA. Vector 21-41 also has significantly higher
levels of reducing sugars as compared with Burley 21 LA.
[0428] Field trials of Vector 21-41 T.sub.4 progeny were performed
at the Central Crops Research Station (Clayton, N.C.) and compared
to the Burley 21 LA parent. The design was three treatments (Vector
21-41, a Burley 21 LA transformed line carrying only the NtQPTJ
promoter [Promoter-Control], and untransformed Burley 21 LA
[Wild-type]), 15 replicates, 10 plants per replicate. The following
agronomic traits were measured and compared: days from transplant
to flowering; height at flowering; leaf number at flowering; yield;
percent nicotine; percent nor-nicotine; percent total nitrogen; and
percent reducing sugars.
[0429] Vector 21-41 was also grown on approximately 5000 acres by
greater than 600 farmers in five states (Pennsylvania, Mississippi,
Louisiana, Iowa, and Illinois). The US Department of Agriculture,
Agriculture Marketing Service (USDA-AMS) quantified nicotine levels
(expressed as percent nicotine per dry weight) using the FTC method
of 2,701 samples taken from these farms. Nicotine levels ranged
from 0.01% to 0.57%. The average percent nicotine level for all
these samples was 0.09%, with the median of 0.07%. Burley tobacco
cultivars typically have nicotine levels between 2% and 4% dry
weight (Tso, T. C., 1972, Physiology and Biochemistry of Tobacco
Plants. Dowden, Hutchinson, and Ross, Inc. Stroudsbury).
[0430] A transgenic Flue-cured tobacco with a reduced amount of
nicotine and TSNAs was created using an RNAi approach. FIG. 20
illustrates an RNAi construct that was used to create a reduced
nicotine tobacco, wherein the root-specific promoter RD2 (Bp
1-2010) was used to drive expression of an RNAi cassette comprising
an antisense full-length QPTase cDNA (Bp 2011-3409) linked to a 382
bp fragment of the cucumber aquaporin gene (Bp 3410-3792), which is
linked to a sense full-length QPTase cDNA (Bp 3793-5191) and the
GapC terminator (Bp5192-5688) (see SEQ. ID. No. 23). This first
RNAi construct also comprises a GUS-selection cassette comprising
the GapC promoter (Bp 1-1291), which drives expression of the GUS
gene (Bp 1292-3103), linked to the GapC terminator (Bp 3104-3600)
(see SEQ. ID. No. 34). This first RNAi construct was ligated into a
binary vector, pBin19 which was then introduced into Agrobacterium
tumefaciens. Leaf disks from flue-cured variety K326 were then
transformed with Agrobacterium that contained the RNAi construct
comprising the RNAi cassette and the GUS selection cassette.
GUS-based selection was then employed to select positively
transformed plantlets (buds), which were then regenerated to
plants. Leaf samples were then harvested and the alkaloid content
was then determined. The alkaloid content of samples obtained from
some of the transgenic lines created with this first RNAi construct
was 6000 ppm. Since the total alkaloid content in tobacco is about
90% nicotine, it is understood by those skilled in the art that the
transgenic Flue-cured tobacco created using the construct shown in
FIG. 20 has significantly reduced levels of nicotine and TSNA, as
compared to a conventional tobacco, a reference tobacco, or the
parental strain of tobacco prior to genetic modification.
[0431] FIG. 21 shows another RNAi construct that was used to
generate several lines of reduced nicotine and TSNA tobacco. This
RNAi construct has a QTPase inhibition cassette (SEQ. ID. No. 24)
and a norflurazone selection cassette (SEQ. ID. No. 35). Starting
from the right border (RB), the QPTase inhibition cassette
comprises an RD2 promoter (Bp 1-2010) operably linked to an
antisense fragment (360 bp) (Bp 2011-2370) of the QTPase gene,
joined to a FAD2 intron (Bp 2371-3501), which is joined to a sense
fragment of the QTPase gene (360 bp) (Bp 3502-3861), which is
joined to the GAD2 terminator (Bp 3862-4134). The selection
cassette comprises the Actin 2 promoter (Bp 1-1161) operably linked
to a mutant phytoene desaturase gene (PDSM1) (Bp 1162-2890) joined
to the GapC terminator (Bp 2891-3387) at the left border (LB).
[0432] Flue-cured tobacco was transformed with the construct shown
in FIG. 21 using Agrobacterium-mediated transformation and 1,140
independent lines were selected, regenerated, and transplanted in
the greenhouse. Of the 1,140 independent lines, 1,097 plants were
harvested and tested for alkaloid content. A total of 608 lines
were identified as having less than 1,000 ppm total alkaloid and
139 lines were identified as having less than 500 ppm total
alkaloid. Accordingly, the transgenic Flue-cured tobacco created
using the construct shown in FIG. 21 has significantly reduced
levels of nicotine and TSNA, as compared to a conventional tobacco,
a reference tobacco, or the parental strain of tobacco prior to
genetic modification.
[0433] Burley tobacco was also transformed with the construct shown
in FIG. 21 using Agrobacterium-mediated transformation and 385
independent lines were selected, regenerated, and transplanted in
the greenhouse. Of the 385 independent lines, 350 lines of plants
were harvested and tested for alkaloid content. A total of 142
lines were identified as having less than 1,000 ppm total alkaloid
and 10 lines were identified as having less than 500 ppm total
alkaloid. Accordingly, it is understood by those skilled in the art
that the transgenic Burley tobacco created using the construct
shown in FIG. 21 also has significantly reduced levels of nicotine
and TSNA, as compared to a conventional tobacco, a reference
tobacco, or the parental strain of tobacco prior to genetic
modification.
[0434] Oriental tobacco will be transformed with the construct
shown in FIG. 21 using Agrobacterium-mediated, Transbacter-mediated
or biolistic transformation and independent lines will be selected,
regenerated, and transplanted in the greenhouse. Most of the
independent lines grown in the greenhouse will be harvested and
tested for alkaloid content. It is expected that approximately 50%
of the lines tested will have less than 1,000 ppm total alkaloid
and approximately 10% of the lines tested will have less than 500
ppm total alkaloid. Accordingly, it is expected that the transgenic
Oriental tobacco that will be created using the construct shown in
FIG. 21 will have significantly reduced levels of nicotine and
TSNA, as compared to a conventional tobacco, a reference tobacco,
or the parental strain of tobacco prior to genetic
modification.
[0435] FIG. 22 illustrates another RNAi construct that can be used
to create a reduced nicotine and TSNA transgenic tobacco. This RNAi
construct has a PMTase inhibition cassette (SEQ. ID. No. 25) and a
norflurazone selection cassette (SEQ. ID. No. 35). Starting from
the right border (RB), the PMTase inhibition cassette comprises an
RD2 promoter (Bp 1-2010) operably linked to an antisense nucleic
acid (241 bp) (Bp 2011-2251) of a PMTase gene, joined to a FAD2
intron (Bp 2252-3382), which is joined to a sense nucleic acid of
the PMTase gene (241 bp) (Bp 3383-3623), which is joined to the
GAD2 terminator (Bp 3624-3896). The selection cassette comprises
the Actin 2 promoter (Bp 1-1161) operably linked to a mutant
phytoene desaturase gene (PDSM1) (Bp 1162-2890) joined to the GapC
terminator (Bp 2891-3387) at the left border (LB).
[0436] Flue-cured tobacco will be transformed with the construct
shown in FIG. 22 using Agrobacterium-mediated, Transbacter-mediated
or biolistic transformation and independent lines will be selected,
regenerated, and transplanted in the greenhouse. Most of the
independent lines grown in the greenhouse will be harvested and
tested for alkaloid content. It is expected that approximately 50%
of the lines tested will have less than 1,000 ppm total alkaloid
and approximately 10% of the lines tested will have less than 500
ppm total alkaloid. Accordingly, it is expected that the transgenic
Flue-cured tobacco that will be created using the construct shown
in FIG. 22 will have significantly reduced levels of nicotine and
TSNA, as compared to a conventional tobacco, a reference tobacco,
or the parental strain of tobacco prior to genetic
modification.
[0437] Burley tobacco will be transformed with the construct shown
in FIG. 22 using Agrobacterium-mediated, Transbacter-mediated (see
e.g., Broothaerts et al., Nature 433:629 (2005), herein expressly
incorporated by reference in its entirety) or biolistic
transformation and independent lines will be selected, regenerated,
and transplanted in the greenhouse. Most of the independent lines
grown in the greenhouse will be harvested and tested for alkaloid
content. It is expected that approximately 50% of the lines tested
will have less than 1,000 ppm total alkaloid and approximately 10%
of the lines tested will have less than 500 ppm total alkaloid.
Accordingly, it is expected that the transgenic Burley tobacco that
will be created using the construct shown in FIG. 22 will have
significantly reduced levels of nicotine and TSNA, as compared to a
conventional tobacco, a reference tobacco, or the parental strain
of tobacco prior to genetic modification.
[0438] Oriental tobacco will also be transformed with the construct
shown in FIG. 22 using Agrobacterium-mediated, Transbacter-mediated
or biolistic transformation and independent lines will be selected,
regenerated, and transplanted in the greenhouse. Most of the
independent lines grown in the greenhouse will be harvested and
tested for alkaloid content. It is expected that approximately 50%
of the lines tested will have less than 1,000 ppm total alkaloid
and approximately 10% of the lines tested will have less than 500
ppm total alkaloid. Accordingly, it is expected that the transgenic
Oriental tobacco that will be created using the construct shown in
FIG. 22 will have significantly reduced levels of nicotine and
TSNA, as compared to a conventional tobacco, a reference tobacco,
or the parental strain of tobacco prior to genetic
modification.
[0439] FIG. 23 illustrates another RNAi construct that was used to
create a reduced nicotine and TSNA transgenic tobacco. This RNAi
construct has a A622 inhibition cassette (SEQ. ID. No. 26) and a
norflurazone selection cassette (SEQ. ID. No. 35). Starting from
the right border (RB), the A622 inhibition cassette comprises an
RD2 promoter (Bp 1-2010) operably linked to an antisense nucleic
acid (628 bp) (Bp 2011-2638) of the A622 gene, joined to a FAD2
intron (Bp 2639-3769), which is joined to a sense nucleic acid of
the A622 gene (628 bp) (Bp 3770-4397), which is joined to the GAD2
terminator (Bp 4398-4670). The selection cassette comprises the
Actin 2 promoter (Bp 1-1161) operably linked to a mutant phytoene
desaturase gene (PDSM1) (Bp 1162-2890) joined to the GapC
terminator (Bp 2891-3387) at the left border (LB).
[0440] Flue-cured tobacco was transformed with the construct shown
in FIG. 23 using Agrobacterium-mediated transformation and 270
independent lines were selected, regenerated, and transplanted in
the greenhouse. Of the 270 independent lines, 259 plants were
harvested and tested for alkaloid content. A total of 131 lines
were identified as having less than 1,000 ppm total alkaloid and 45
lines were identified as having less than 500 ppm total alkaloid.
Accordingly, it is understood by those skilled in the art that the
transgenic Flue-cured tobacco created using the construct shown in
FIG. 23 also has significantly reduced levels of nicotine and TSNA,
as compared to a conventional tobacco, a reference tobacco, or the
parental strain of tobacco prior to genetic modification.
[0441] Several lines that were transformed with this construct were
unexpectedly found to have conventional levels of nicotine but a
significantly reduced amount of nornicotine. That is, 9 lines were
found to have nicotine levels ranging from 2.17 mg/g to 3.99 mg/g
and nornicotine levels less than or equal to 0.00 to 0.06 mg/g (see
Table 5).
TABLE-US-00011 TABLE 5 Transgenic tobacco having reduced
nornicotine and conventional amounts of nicotine ##STR00001##
*Highlighted entries show transgenic tobacco lines having a reduced
amount of nornicotine and conventional amounts of nicotine.
[0442] Tobacco products containing the selectively reduced
nornicotine transgenic tobacco described above are also embodiments
of the invention. That is, tobacco products comprising a transgenic
tobacco that comprises a conventional amount of nicotine (e.g., at
least, less than, greater than, or equal to 1.0, 1.1, 1.2, 1.3,
1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6,
2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9,
4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, or 5.0 mg/g
nicotine) and a reduced amount of nornicotine (e.g., 0.00, 0.01,
0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.11, 0.12,
0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, or 0.2 mg/g), as compared
to a conventional tobacco, a reference tobacco, or the parental
strain of tobacco prior to genetic modification, are embodiments of
the invention. Particularly preferred are transgenic tobacco and
tobacco products made therefrom, which comprise a conventional
amount of nicotine (e.g., at least, less than, greater than, or
equal to 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0,
2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3,
3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6,
4.7, 4.8, 4.9, or 5.0 mg/g nicotine) and a reduced amount of
nornicotine (e.g., 0.00, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07,
0.08, 0.09, 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18,
0.19, or 0.2 mg/g), as compared to a conventional tobacco, a
reference tobacco, or the parental strain of tobacco prior to
genetic modification, and an isolated fragment of the A622 gene, in
particular, comprising, consisting of, or consisting essentially of
an isolated nucleic acid of SEQ. ID. No. 5, or the cassette of SEQ.
ID. No. 26.
[0443] Burley tobacco will be transformed with the construct shown
in FIG. 23 using Agrobacterium-mediated, Transbacter-mediated or
biolistic transformation and independent lines will be selected,
regenerated, and transplanted in the greenhouse. Most of the
independent lines grown in the greenhouse will be harvested and
tested for alkaloid content. It is expected that approximately 50%
of the lines tested will have less than 1,000 ppm total alkaloid
and approximately 10% of the lines tested will have less than 500
ppm total alkaloid. Accordingly, it is expected that the transgenic
Burley tobacco that will be created using the construct shown in
FIG. 23 will have significantly reduced levels of nicotine and
TSNA, as compared to a conventional tobacco, a reference tobacco,
or the parental strain of tobacco prior to genetic modification. It
is also expected that some lines of tobacco created with the
afore-mentioned nucleic acid construct will retain conventional
amounts of nicotine but will comprise a reduced amount of
nornicotine, as compared to a conventional tobacco, a reference
tobacco, or the parental strain of tobacco prior to genetic
modification.
[0444] Oriental tobacco will also be transformed with the construct
shown in FIG. 23 using Agrobacterium-mediated,
Transbacter-mediated, or biolistic transformation and independent
lines will be selected, regenerated, and transplanted in the
greenhouse. Most of the independent lines grown in the greenhouse
will be harvested and tested for alkaloid content. It is expected
that approximately 50% of the lines tested will have less than
1,000 ppm total alkaloid and approximately 10% of the lines tested
will have less than 500 ppm total alkaloid. Accordingly, it is
expected that the transgenic Oriental tobacco that will be created
using the construct shown in FIG. 23 will have significantly
reduced levels of nicotine and TSNA, as compared to a conventional
tobacco, a reference tobacco, or the parental strain of tobacco
prior to genetic modification. It is also expected that some lines
of tobacco created with the afore-mentioned nucleic acid construct
will retain conventional amounts of nicotine but will comprise a
reduced amount of nornicotine, as compared to a conventional
tobacco, a reference tobacco, or the parental strain of tobacco
prior to genetic modification.
[0445] FIG. 24 illustrates a double-knock-out RNAi construct, which
has been created to develop a reduced nicotine and TSNA transgenic
tobacco. This double-knock-out RNAi construct has a QPTase/A622
inhibition cassette (SEQ. ID. No.27) and a norflurazone selection
cassette (SEQ. ID. No. 35). Starting from the right border (RB),
the QPTase/A622 inhibition cassette comprises an RD2 promoter (Bp
1-2010) operably linked to a QPTase antisense nucleic acid (360 bp)
(Bp 2011-2370) of a QPTase gene, which is joined to a A622
antisense nucleic acid (628 bp) (Bp 2371-2998) of a A622 gene,
which is joined to a FAD2 intron (Bp 2999-4129), which is joined to
a sense nucleic acid of the A622 gene (628 bp) (Bp 4130-4757),
which is joined to a sense nucleic acid of the QPTase gene (360 bp)
(Bp 4758-5117), which is joined to the GAD2 terminator (Bp
5118-5390). The selection cassette comprises the Actin 2 promoter
(Bp 1-1161) operably linked to a mutant phytoene desaturase gene
(PDSM1) (Bp 1162-2890) joined to the GapC terminator (Bp 2891-3387)
at the left border (LB).
[0446] Flue-cured tobacco will be transformed with the construct
shown in FIG. 24 using Agrobacterium-mediated,
Transbacter-mediated, or biolistic transformation and independent
lines will be selected, regenerated, and transplanted in the
greenhouse. Most of the independent lines grown in the greenhouse
will be harvested and tested for alkaloid content. It is expected
that approximately 50% of the lines tested will have less than
1,000 ppm total alkaloid and approximately 10% of the lines tested
will have less than 500 ppm total alkaloid. Accordingly, it is
expected that the transgenic Flue-cured tobacco that will be
created using the construct shown in FIG. 24 will have
significantly reduced levels of nicotine and TSNA, as compared to a
conventional tobacco, a reference tobacco, or the parental strain
of tobacco prior to genetic modification.
[0447] Burley tobacco will be transformed with the construct shown
in FIG. 24 using Agrobacterium-mediated, Transbacter-mediated or
biolistic transformation and independent lines will be selected,
regenerated, and transplanted in the greenhouse. Most of the
independent lines grown in the greenhouse will be harvested and
tested for alkaloid content. It is expected that approximately 50%
of the lines tested will have less than 1,000 ppm total alkaloid
and approximately 10% of the lines tested will have less than 500
ppm total alkaloid. Accordingly, it is expected that the transgenic
Burley tobacco that will be created using the construct shown in
FIG. 24 will have significantly reduced levels of nicotine and
TSNA, as compared to a conventional tobacco, a reference tobacco,
or the parental strain of tobacco prior to genetic
modification.
[0448] Oriental tobacco will also be transformed with the construct
shown in FIG. 24 using Agrobacterium-mediated,
Transbacter-mediated, or biolistic transformation and independent
lines will be selected, regenerated, and transplanted in the
greenhouse. Most of the independent lines grown in the greenhouse
will be harvested and tested for alkaloid content. It is expected
that approximately 50% of the lines tested will have less than
1,000 ppm total alkaloid and approximately 10% of the lines tested
will have less than 500 ppm total alkaloid. Accordingly, it is
expected that the transgenic Oriental tobacco that will be created
using the construct shown in FIG. 24 will have significantly
reduced levels of nicotine and TSNA, as compared to a conventional
tobacco, a reference tobacco, or the parental strain of tobacco
prior to genetic modification.
[0449] More embodiments concern an RNAi construct designed to
reduce the amount of sterols in tobacco and thereby reduce
production of a PAH upon pyrolysis of said transgenic tobacco. A
first sterol-reducing RNAi construct has a 14alpha demethylase
inhibition cassette (SEQ. ID. No. 28). The 14alpha demethylase
inhibition cassette comprises a double (two promoters in tandem)
35S promoter (Bp 1-618) operably linked to an antisense 14alpha
demthylase nucleic acid (Bp 619-1503), which is joined to a FAD2
intron (Bp 1504-2634), which is joined to a sense nucleic acid of
the 14alpha demethylase gene (Bp 2635-3519), which is joined to the
Nos terminator (Bp 3520-3773).
[0450] Flue-cured tobacco will be transformed with the 14alpha
demethylase inhibition cassette using Agrobacterium-mediated,
Transbacter-mediated, or biolistic transformation and independent
lines will be selected, regenerated, and transplanted in the
greenhouse. Most of the independent lines grown in the greenhouse
will be harvested and tested for sterol content. It is expected
that approximately 50% of the lines tested will have significantly
less sterol than the parent strain of tobacco. Accordingly, it is
expected that the transgenic Flue-cured tobacco that will be
created using the construct above will have significantly reduced
levels of sterol and will generate significantly less PAHs upon
pyrolysis, as compared to a conventional tobacco, a reference
tobacco, or the parental strain of tobacco prior to genetic
modification.
[0451] Burley tobacco will be transformed with the 14alpha
demethylase inhibition cassette using Agrobacterium-mediated,
Transbacter-mediated, or biolistic transformation and independent
lines will be selected, regenerated, and transplanted in the
greenhouse. Most of the independent lines grown in the greenhouse
will be harvested and tested for sterol content. It is expected
that approximately 50% of the lines tested will have significantly
less sterol than the parent strain of tobacco. Accordingly, it is
expected that the transgenic Burley tobacco that will be created
using the construct above will have significantly reduced levels of
sterol and will generate significantly less PAHs upon pyrolysis, as
compared to a conventional tobacco, a reference tobacco, or the
parental strain of tobacco prior to genetic modification.
[0452] Oriental tobacco will be transformed with the 14alpha
demethylase inhibition cassette using Agrobacterium-mediated,
Transbacter-mediated, or biolistic transformation and independent
lines will be selected, regenerated, and transplanted in the
greenhouse. Most of the independent lines grown in the greenhouse
will be harvested and tested for sterol content. It is expected
that approximately 50% of the lines tested will have significantly
less sterol than the parent strain of tobacco. Accordingly, it is
expected that the transgenic Oriental tobacco that will be created
using the construct above will have significantly reduced levels of
sterol and will generate significantly less PAHs upon pyrolysis, as
compared to a conventional tobacco, a reference tobacco, or the
parental strain of tobacco prior to genetic modification.
[0453] More embodiments concern another RNAi construct designed to
reduce the amount of a sterol in tobacco and thereby reduce
production of a PAH upon pyrolysis of said transgenic tobacco. A
second sterol-reducing RNAi construct has a SMT2 inhibition
cassette (SEQ. ID. No. 29). The SMT2 inhibition cassette comprises
a double (two promoters in tandem) 35S promoter (Bp 1-618) operably
linked to an antisense SMT2 nucleic acid (Bp 619-1398), which is
joined to a FAD2 intron (Bp 1399-2529), which is joined to a sense
nucleic acid of the SMT2 gene (Bp 2530-3309), which is joined to
the Nos terminator (Bp 3310-3563).
[0454] Flue-cured tobacco will be transformed with the SMT2
inhibition cassette using Agrobacterium-mediated,
Transbacter-mediated, or biolistic transformation and independent
lines will be selected, regenerated, and transplanted in the
greenhouse. Most of the independent lines grown in the greenhouse
will be harvested and tested for sterol content. It is expected
that approximately 50% of the lines tested will have significantly
less sterol than the parent strain of tobacco. Accordingly, it is
expected that the transgenic Flue-cured tobacco that will be
created using the construct above will have significantly reduced
levels of sterol and will generate significantly less PAHs upon
pyrolysis, as compared to a conventional tobacco, a reference
tobacco, or the parental strain of tobacco prior to genetic
modification.
[0455] Burley tobacco will be transformed with the SMT2 inhibition
cassette using Agrobacterium-mediated, Transbacter-mediated, or
biolistic transformation and independent lines will be selected,
regenerated, and transplanted in the greenhouse. Most of the
independent lines grown in the greenhouse will be harvested and
tested for sterol content. It is expected that approximately 50% of
the lines tested will have significantly less sterol than the
parent strain of tobacco. Accordingly, it is expected that the
transgenic Burley tobacco that will be created using the construct
above will have significantly reduced levels of sterols and will
generate significantly less PAHs upon pyrolysis, as compared to a
conventional tobacco, a reference tobacco, or the parental strain
of tobacco prior to genetic modification.
[0456] Oriental tobacco will be transformed with the SMT2
inhibition cassette using Agrobacterium-mediated,
Transbacter-mediated, or biolistic transformation and independent
lines will be selected, regenerated, and transplanted in the
greenhouse. Most of the independent lines grown in the greenhouse
will be harvested and tested for sterol content. It is expected
that approximately 50% of the lines tested will have significantly
less sterol than the parent strain of tobacco. Accordingly, it is
expected that the transgenic Oriental tobacco that will be created
using the construct above will have significantly reduced levels of
sterol and will generate significantly less PAHs upon pyrolysis, as
compared to a conventional tobacco, a reference tobacco, or the
parental strain of tobacco prior to genetic modification.
[0457] More embodiments concern another RNAi construct designed to
reduce the amount of a sterol in tobacco and thereby reduce
production of a PAH upon pyrolysis of said transgenic tobacco. A
third sterol-reducing RNAi construct has a squalene synthase
inhibition cassette (SEQ. ID. No. 30). The squalene synthase
inhibition cassette comprises a double (two promoters in tandem)
35S promoter (Bp 1-618) operably linked to an antisense squalene
synthase nucleic acid (Bp 619-1057), which is joined to a FAD2
intron (Bp 1058-2188), which is joined to a sense nucleic acid of
the squalene synthase gene (Bp 2189-2627), which is joined to the
Nos terminator (Bp 2628-2881).
[0458] Flue-cured tobacco will be transformed with the squalene
synthase inhibition cassette using Agrobacterium-mediated,
Transbacter-mediated, or biolistic transformation and independent
lines will be selected, regenerated, and transplanted in the
greenhouse. Most of the independent lines grown in the greenhouse
will be harvested and tested for sterol content. It is expected
that approximately 50% of the lines tested will have significantly
less sterol than the parent strain of tobacco. Accordingly, it is
expected that the transgenic Flue-cured tobacco that will be
created using the construct above will have significantly reduced
levels of sterol and will generate significantly less PAHs upon
pyrolysis, as compared to a conventional tobacco, a reference
tobacco, or the parental strain of tobacco prior to genetic
modification.
[0459] Burley tobacco will be transformed with the squalene
synthase inhibition cassette using Agrobacterium-mediated,
Transbacter-mediated, or biolistic transformation and independent
lines will be selected, regenerated, and transplanted in the
greenhouse. Most of the independent lines grown in the greenhouse
will be harvested and tested for sterol content. It is expected
that approximately 50% of the lines tested will have significantly
less sterol than the parent strain of tobacco. Accordingly, it is
expected that the transgenic Burley tobacco that will be created
using the construct above will have significantly reduced levels of
sterol and will generate significantly less PAHs upon pyrolysis, as
compared to a conventional tobacco, a reference tobacco, or the
parental strain of tobacco prior to genetic modification.
[0460] Oriental tobacco will be transformed with the squalene
synthase inhibition cassette using Agrobacterium-mediated,
Transbacter-mediated, or biolistic transformation and independent
lines will be selected, regenerated, and transplanted in the
greenhouse. Most of the independent lines grown in the greenhouse
will be harvested and tested for sterol content. It is expected
that approximately 50% of the lines tested will have significantly
less sterol than the parent strain of tobacco. Accordingly, it is
expected that the transgenic Oriental tobacco that will be created
using the construct above will have significantly reduced levels of
sterol and will generate significantly less PAHs upon pyrolysis, as
compared to a conventional tobacco, a reference tobacco, or the
parental strain of tobacco prior to genetic modification.
[0461] More embodiments concern yet another RNAi construct designed
to reduce the amount of a sterol in tobacco and thereby reduce
production of a PAH upon pyrolysis of said transgenic tobacco. A
fourth sterol-reducing RNAi construct has a HMG-CoA reductase
inhibition cassette (SEQ. ID. No. 31). The HMG-CoA reductase
inhibition cassette comprises a double (two promoters in tandem)
35S promoter (Bp 1-618) operably linked to an antisense HMG-CoA
reductase nucleic acid (Bp 619-1468), which is joined to a FAD2
intron (Bp 1469-2599), which is joined to a sense nucleic acid of
the HMG-CoA reductase gene (Bp 2600-3449), which is joined to the
Nos terminator (Bp 3450-3703).
[0462] Flue-cured tobacco (K326) was transformed with the HMG-CoA
reductase inhibition cassette using Agrobacterium-mediated
transformation and independent lines were selected, regenerated,
and transplanted in the greenhouse. Several independent lines grown
in the greenhouse were harvested and tested for the presence of
various sterols (see Table 6). As shown in the table, several lines
(e.g., HMGIR 1, HMGIR 2, HMGIR 3-2, HMGIR 4, HMGIR 7, HMGIR 11,
HMGIR 13, HMGIR 16, HMGIR 18, HMGIR 19) were found to have
significantly reduced levels of sterols, as compared to the
parental strain of tobacco (i.e., tobacco of the same variety prior
to genetic modification). Accordingly, embodiments include
transgenic tobacco and tobacco products made therefrom comprising a
reduced amount of sterols, as compared to a tobacco of the same
variety, parental strain or a tobacco that has not been genetically
modified. It is expected that the transgenic Flue-cured tobacco
that was created using the construct above will generate
significantly less PAHs upon pyrolysis, as compared to a
conventional tobacco, a reference tobacco, or the parental strain
of tobacco prior to genetic modification.
TABLE-US-00012 TABLE 6 ##STR00002## *Highlighted entries indicate
transgenic tobacco lines having a reduction in sterols
[0463] Burley tobacco will be transformed with the HMG-CoA
reductase cassette using Agrobacterium-mediated,
Transbacter-mediated, or biolistic transformation and independent
lines will be selected, regenerated, and transplanted in the
greenhouse. Most of the independent lines grown in the greenhouse
will be harvested and tested for sterol content. It is expected
that approximately 50% of the lines tested will have significantly
less sterol than the parent strain of tobacco. Accordingly, it is
expected that the transgenic Burley tobacco that will be created
using the construct above will have significantly reduced levels of
sterol and will generate significantly less PAHs upon pyrolysis, as
compared to a conventional tobacco, a reference tobacco, or the
parental strain of tobacco prior to genetic modification.
[0464] Oriental tobacco will be transformed with the HMG-CoA
reductase inhibition cassette using Agrobacterium-mediated,
Transbacter-mediated, or biolistic transformation and independent
lines will be selected, regenerated, and transplanted in the
greenhouse. Most of the independent lines grown in the greenhouse
will be harvested and tested for sterol content. It is expected
that approximately 50% of the lines tested will have significantly
less sterol than the parent strain of tobacco. Accordingly, it is
expected that the transgenic Oriental tobacco that will be created
using the construct above will have significantly reduced levels of
sterol and will generate significantly less PAHs upon pyrolysis, as
compared to a conventional tobacco, a reference tobacco, or the
parental strain of tobacco prior to genetic modification.
[0465] More embodiments concern still another RNAi construct
designed to reduce the amount of a sterol in tobacco and thereby
reduce production of a PAH upon pyrolysis of said transgenic
tobacco. A fifth sterol-reducing RNAi construct has a
developmentally regulated SMT2 inhibition cassette (SEQ. ID. No.
32). The developmentally regulated SMT2 inhibition cassette
comprises a cinnamyl alcohol dehydrogenase promoter (Bp 1-995)
operably linked to an antisense SMT2 nucleic acid (Bp 996-1775),
which is joined to a PAP 1 intron (Bp 1776-2955), which is joined
to a sense nucleic acid of the SMT2 gene (Bp 2956-3735), which is
joined to the RuBisCo small subunit terminator (Bp 3736-4286).
[0466] Flue-cured tobacco will be transformed with the
developmentally regulated SMT2 inhibition cassette using
Agrobacterium-mediated, Transbacter-mediated, or biolistic
transformation and independent lines will be selected, regenerated,
and transplanted in the greenhouse. Most of the independent lines
grown in the greenhouse will be harvested and tested for sterol
content. It is expected that approximately 50% of the lines tested
will have significantly less sterol than the parent strain of
tobacco. Accordingly, it is expected that the transgenic Flue-cured
tobacco that will be created using the construct above will have
significantly reduced levels of sterol and will generate
significantly less PAHs upon pyrolysis, as compared to a
conventional tobacco, a reference tobacco, or the parental strain
of tobacco prior to genetic modification.
[0467] Burley tobacco will be transformed with the developmentally
regulated SMT2 inhibition cassette using Agrobacterium-mediated,
Transbacter-mediated, or biolistic transformation and independent
lines will be selected, regenerated, and transplanted in the
greenhouse. Most of the independent lines grown in the greenhouse
will be harvested and tested for sterol content. It is expected
that approximately 50% of the lines tested will have significantly
less sterol than the parent strain of tobacco. Accordingly, it is
expected that the transgenic Burley tobacco that will be created
using the construct above will have significantly reduced levels of
sterol and will generate significantly less PAHs upon pyrolysis, as
compared to a conventional tobacco, a reference tobacco, or the
parental strain of tobacco prior to genetic modification.
[0468] Oriental tobacco will be transformed with the
developmentally regulated SMT2 inhibition cassette using
Agrobacterium-mediated, Transbacter-mediated, or biolistic
transformation and independent lines will be selected, regenerated,
and transplanted in the greenhouse. Most of the independent lines
grown in the greenhouse will be harvested and tested for sterol
content. It is expected that approximately 50% of the lines tested
will have significantly less sterol than the parent strain of
tobacco. Accordingly, it is expected that the transgenic Oriental
tobacco that will be created using the construct above will have
significantly reduced levels of sterol and will generate
significantly less PAHs upon pyrolysis, as compared to a
conventional tobacco, a reference tobacco, or the parental strain
of tobacco prior to genetic modification.
[0469] FIG. 25 illustrates a double-knock-out RNAi construct that
can be used to create a reduced nicotine, TSNA, sterol transgenic
tobacco that generates a reduced amount of PAH upon pyrolysis. This
double-knock-out RNAi construct has a A622/SMT2 inhibition cassette
(SEQ. ID. No. 33) and a norflurazone selection cassette (SEQ. ID.
No. 35). Starting from the right border (RB), the A622/SMT2
inhibition cassette comprises an RD2 promoter (Bp 1-2010) operably
linked to a A622 antisense nucleic acid (628 bp) (Bp 2011-2638) of
a A622 gene, which is joined to a FAD2 intron (Bp 2639-3769), which
is joined to a sense nucleic acid of the A622 gene (628 bp)
(Bp3770-4397), which is joined to the GAD2 terminator (Bp
4398-4670); which is joined to a cinnamyl alcohol dehydrogenase
promoter (Bp 4671-5665) operably linked to an antisense SMT2
nucleic acid (Bp 5666-6445), which is joined to a PAP 1 intron (Bp
6446-7625), which is joined to a sense nucleic acid of the SMT2
gene (Bp 7626-8405), which is joined to the RuBisCo small subunit
terminator (Bp 8406-8956).
[0470] Flue-cured tobacco will be transformed with the construct
shown in FIG. 25 using Agrobacterium-mediated,
Transbacter-mediated, or biolistic transformation and independent
lines will be selected, regenerated, and transplanted in the
greenhouse. Most of the independent lines grown in the greenhouse
will be harvested and tested for alkaloid and sterol content. It is
expected that approximately 50% of the lines tested will have less
than 1,000 ppm total alkaloid and a reduced amount of sterols, as
compared to the parental strain of tobacco, and approximately 10%
of the lines tested will have less than 500 ppm total alkaloid and
a reduced amount of sterols, as compared to the parental strain of
tobacco. Accordingly, it is expected that the transgenic Flue-cured
tobacco that will be created using the construct shown in FIG. 25
will have significantly reduced levels of nicotine, TSNA, sterol,
and will generate significantly less PAHs upon pyrolysis, as
compared to a conventional tobacco, a reference tobacco, or the
parental strain of tobacco prior to genetic modification.
[0471] Burley tobacco will be transformed with the construct shown
in FIG. 25 using Agrobacterium-mediated, Transbacter-mediated or
biolistic transformation and independent lines will be selected,
regenerated, and transplanted in the greenhouse. Most of the
independent lines grown in the greenhouse will be harvested and
tested for alkaloid and sterol content. It is expected that
approximately 50% of the lines tested will have less than 1,000 ppm
total alkaloid and a reduced amount of sterols, as compared to the
parental strain of tobacco, and approximately 10% of the lines
tested will have less than 500 ppm total alkaloid and a reduced
amount of sterols, as compared to the parental strain of tobacco.
Accordingly, it is expected that the transgenic Burley tobacco that
will be created using the construct shown in FIG. 25 will have
significantly reduced levels of nicotine, TSNA, sterol, and will
generate significantly less PAHs upon pyrolysis, as compared to a
conventional tobacco, a reference tobacco, or the parental strain
of tobacco prior to genetic modification.
[0472] Oriental tobacco will be transformed with the construct
shown in FIG. 25 using Agrobacterium-mediated,
Transbacter-mediated, or biolistic transformation and independent
lines will be selected, regenerated, and transplanted in the
greenhouse. Most of the independent lines grown in the greenhouse
will be harvested and tested for alkaloid and sterol content. It is
expected that approximately 50% of the lines tested will have less
than 1,000 ppm total alkaloid and a reduced amount of sterols, as
compared to the parental strain of tobacco, and approximately 10%
of the lines tested will have less than 500 ppm total alkaloid and
a reduced amount of sterols, as compared to the parental strain of
tobacco. Accordingly, it is expected that the transgenic Oriental
tobacco that will be created using the construct shown in FIG. 25
will have significantly reduced levels of nicotine, TSNA, sterol,
and will generate significantly less PAHs upon pyrolysis, as
compared to a conventional tobacco, a reference tobacco, or the
parental strain of tobacco prior to genetic modification.
[0473] It should be emphasized that other promoters and terminators
can be used with the nucleic acids of the invention
interchangeably. Although RD2 (SEQ. ID. No. 13) is a preferred
root-specific promoter, there are other root-specific promoters
that can be used, as well. For example, the putrescene methyl
transferase 1 promoter (PMT-1) (SEQ. ID. No. 14) is a root-specific
promoter that can be used in place of the RD2 promoter in any of
the constructs described above. Similarly, although the actin2
promoter (SEQ. ID. No. 16) is preferred for driving expression of a
norflurazone resistance gene, other constitutive promoters such as
the GapC promoter (SEQ. ID. No. 15), the tobacco alcohol
dehydrogenase (ADP) (SEQ. ID. No. 17) and the Arabidopsis ribosomal
protein L2 (RPL2P) (SEQ. ID. No. 18) can be used to drive
expression of the norflurazone resistance gene. Additionally,
developmentally regulatable promoters such as, cinnamyl alcohol
dehydrogenase (SEQ. ID. No. 19) and metallothionein I promoter
(SEQ. ID. No. 20) can be used interchangeable with the cassettes
described herein.
[0474] Further, in some embodiments, a plurality of constitutive
promoters, in tandem, can be used to drive expression of the
norflurazone resistance gene. Additionally, a plurality of
root-specific promoters can be used to drive expression one or more
of the inhibition cassettes described above (e.g., the QTPase
inhibition cassette, the PMTase inhibition cassette, the A622
inhibition cassette, a sterol inhibition cassette, or a
double-knockout inhibition cassette). Developmentally regulatable
promoters, a plurality of developmentally regulated promoters,
constitutive promoters, or a plurality of constitutive promoters
can also be used to drive expression of one or more of the
inhibition or selection cassettes described above. Accordingly, any
promoter operable in tobacco can be used to drive expression of any
of the inhibition cassettes or the selection cassette described
herein (e.g., nos, 35S, or CAMV). Terminators, such as GAD2
terminator (SEQ. ID. No. 21) and the FAD 2 (SEQ. ID. No. 22) or
PAP1 introns can be used interchangeably, as well.
[0475] Other aspects of the invention concern the discovery of
several mutants of the phytoene desaturase gene that confer
resistance to the herbicide norflurazone (e.g., SEQ. ID. Nos.10,
11, and 12). These herbicide resistance genes were used as
selectable markers in the transformations above. Typically, the
selection was accomplished by introducing the transformed plant
tissue to the norflurazone (e.g., 0.005 uM-0.1 uMconc.). That is,
the concentration of norflurazone that can be used to select
positive transformants containing a norflurazone resistance gene,
as described herein can be at least, less than, greater than, or
equal to 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04,
0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7,
0.8, 0.9, or 1.0 uM. Preferably, less than or equal to 0.05 uM
concentration of norflurazone is used when selecting transformants
with Flue-cured tobacco and less than or equal to 0.0125 uM
concentration norflurazone is used when selecting transformants
with Burley tobacco. As the plantlet develops, selection was
accomplished by differentiating the green shoots (positive
transformants) from the yellow or white shoots (negative
transformants). Once selection was made, the herbicide was removed
and the plantlet was allowed to develop in the greenhouse.
[0476] The norflurazone resistant phytoene desaturase mutants
(PDSM-1, PDSM-2, ansd PDSM-3) were generated by site-directed
mutagenesis of particular regions of the gene believed to be
involved in binding of the herbicide. Constructs carrying the
various PDSM genes were then transferred to tobacco leaf disks by
conventional Agrobacterium transformation and the resistance to
norflurazone was analyzed at various concentrations. After several
iterations, the mutants described as SEQ. ID. Nos. 10, 11, and 12,
were identified as sequences that confer resistance to
norflurazone. Accordingly, aspects of the invention concern the
PDSM genes described herein, their use in plants as selectable
markers to identify plant cells that contain a transformed gene,
whether in tissue culture or in the field, and methods of
identifying new PDSM genes that confer norflurazone resistance.
[0477] In a first selection construct, the Arabidopsis phytoene
desaturase gene (PDS) (SEQ. ID. No. 36) was mutated using
site-directed mutagenesis, such that a T to G mutation at position
1478, resulting in a Valine to Glycine change at amino acid residue
493 was created. To generate the norflurazone resistance gene, the
open reading frame of the Arabidopsis phytoene desaturase gene was
amplified and cloned into the TOPO vector (Invitrogen). A single
base pair change from T-G at nucleotide position 1478, leading to a
Valine to Glycine change at amino acid residue 493, was introduced
using QuickChange Site-directed Mutagenisis Kit (Stratgene). The
point mutation was verified by sequencing and the resultant mutant
was named PDSM-1 (SEQ. ID. No. 10). The 1.729 Kb PDSM1 sequence was
then amplified and ligated into the binary vector pWJ001, a pCambia
derivative that contained the RNAi cassettes above, which was then
introduced into Agrobacterium tumefaciens. A similar approach was
used to generate the PDSM-2 and PDSM-3 mutants described in the
sequence listing as SEQ. ID. NOs.11 and 12.
[0478] That is, in a second selection construct, the Arabidopsis
phytoene desaturase gene (PDS) (SEQ. ID. No. 36) was mutated using
site-directed mutagenesis, such that a G to C mutation at position
863, resulting in a Arginine to Proline change at amino acid
residue 288 was created. To generate the norflurazone resistance
gene, the open reading frame of the Arabidopsis phytoene desaturase
gene was amplified and cloned into the TOPO vector (Invitrogen). A
single base pair change was introduced using QuickChange
Site-directed Mutagenisis Kit (Stratgene). The point mutation was
verified by sequencing and the resultant mutant was named PDSM-2.
The 1.729 Kb PDSM-2 sequence was then amplified and ligated into
the binary vector pWJ001, a pCambia derivative that contained the
RNAi cassettes above, which was then introduced into Agrobacterium
tumefaciens
[0479] Further, in a third selection construct, the Arabidopsis
phytoene desaturase gene (PDS) (SEQ. ID. No. 36) was mutated using
site-directed mutagenesis, such that a T to C mutation at position
1226, resulting in a Leucine to Proline change at amino acid
residue 409 was created. To generate the norflurazone resistance
gene, the open reading frame of the Arabidopsis phytoene desaturase
gene was amplified and cloned into the TOPO vector (Invitrogen). A
single base pair change was introduced using QuickChange
Site-directed Mutagenisis Kit (Stratgene). The point mutation was
verified by sequencing and the resultant mutant was named PDSM-3.
The 1.729 Kb PDSM-2 sequence was then amplified and ligated into
the binary vector pWJ001, a pCambia derivative that contained the
RNAi cassettes above, which was then introduced into Agrobacterium
tumefaciens
[0480] Accordingly, aspects of the invention concern methods of
identifying a mutation on a phytoene desaturase gene that confers
resistance to an herbicide, preferably norflurazone. By one
approach, a phytoene desaturase gene is provided, preferably SEQ.
ID. No. 36, a nucleotide in said gene is mutated so as to generate
a mutant phytoene desaturase gene, said mutant phytoene desaturase
gene is transformed to a plant cell so as to generate a plant cell
comprising said mutant phytoene desaturase gene, said plant cell
comprising said mutant phytoene desaturase gene is then contacted
with an herbicide, preferably norflurazone, and the presence or
absence of a resistance to said herbicide is identified, whereby
the presence of a resistance to said herbicide identifies said
mutation as one that confers resistance to said herbicide. By one
approach, the entire sequence of a phytoene desaturase gene (e.g.,
SEQ. ID. NO. 36) is mutated one residue at a time and each mutant
is screened for resistance to the herbicide. Accordingly, aspects
of the invention include compositions (e.g., nucleic acid
constructs or cassettes, plant cells, plants, tobacco, or tobacco
products) that comprise, consist, consist essentially of a mutant
phytoene desaturase nucleic acid of SEQ. ID. NO. 10, 11, or 12 or
fragment thereof at least or equal to 30, 50, 100, 200, 400, 500,
700, 900, 1000, 1200, 1400, 1600, or 1700 consecutive nucleotides
of in length that confers resistance to an herbicide, in particular
norflurazone. Aspects of the invention also include compositions
(e.g., nucleic acid constructs or cassettes, plant cells, plants,
tobacco, or tobacco products) comprising the mutant phytoene
desaturase protein or fragments thereof (e.g., at least 15, 25, 50,
100, 200, 300, 400, 500 consecutive amino acids of a protein
encoded by SEQ. ID. Nos. 10, 11, or 12) that confer resistance to
an herbicide, in particular norflurazone.
[0481] The nucleic acid sequences, cassettes, and constructs
described herein can also be altered by mutation such as
substitutions, additions, or deletions that provide for sequences
encoding functionally equivalent molecules. Due to the degeneracy
of nucleotide coding sequences, other DNA sequences that encode
substantially the same amino acid sequence can be used in some
embodiments of the present invention. These include, but are not
limited to, nucleic acid sequences comprising all or portions of
the nucleic acid embodiments described herein that complement said
sequences and have been altered by the substitution of different
codons that encode a functionally equivalent amino acid residue
within the sequence, thus producing a silent change. In some
contexts, the phrase "substantial sequence similarity" in the
present specification and claims means that DNA, RNA or amino acid
sequences which have slight and non-consequential sequence
variations from the actual sequences disclosed and claimed herein
are considered to be equivalent to the sequences of the present
invention. In this regard, "slight and non-consequential sequence
variations" mean that "similar" sequences (i.e., the sequences that
have substantial sequence similarity with the DNA, RNA, or proteins
disclosed and claimed herein) will be functionally equivalent to
the sequences disclosed and claimed in the present invention.
Functionally equivalent sequences will function in substantially
the same manner to produce substantially the same compositions as
the nucleic acid and amino acid compositions disclosed and claimed
herein.
[0482] Additional nucleic acid embodiments include sequences that
are at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%,
91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100% identical to
the nucleic acids, nucleic acid constructs, and nucleic acid
cassettes provided herein. Preferably these sequences also perform
the functions of the particular nucleic acid embodiment (e.g.,
inhibition of nicotine, nornicotine, or sterol production or confer
resistance to norflurazone). Determinations of sequence similarity
are made with the two sequences aligned for maximum matching; gaps
in either of the two sequences being matched are allowed in
maximizing matching. Gap lengths of 10 or less are preferred, gap
lengths of 5 or less are more preferred, and gap lengths of 2 or
less still more preferred.
[0483] Additional nucleic acid embodiments also include nucleic
acids that hybridize to the nucleic acid sequences disclosed herein
under low, medium, and high stringency, wherein said additional
nucleic acid embodiments also perform the function of the
particular embodiment (e.g., inhibit nicotine, nornicotine, or
sterol production or confer resistance to norflurazone).
Identification of nucleic acids that hybridize to the embodiments
described herein can be determined in a routine manner. (See J.
Sambrook et al., Molecular Cloning, A Laboratory Manual (2d Ed.
1989) (Cold Spring Harbor Laboratory)). For example, hybridization
of such sequences may be carried out under conditions of reduced
stringency or even stringent conditions (e.g., conditions
represented by a wash stringency of 0.3 M NaCl, 0.03 M sodium
citrate, 0.1% SDS at 60 degrees C., or even 70 degrees C.).
Preferably these sequences also perform the functions of the
particular nucleic acid embodiment (e.g., inhibition of nicotine,
nornicotine, or sterol production or confer resistance to
norflurazone).
[0484] Accordingly aspects of the invention also include
compositions comprising, consisting of, or consisting essentially
of: (a) the nucleic acid sequences shown in the sequence listing
(SEQ. ID. NOS. 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33,
34, 35, or 36); (b) nucleotide sequences encoding the amino acid
sequences encoded by the nucleic acids of the sequence listing
(SEQ. ID. NOS. 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33,
34, 35, or 36); (c) any nucleotide sequences that hybridizes to the
complement of the sequences shown in the sequence listing (SEQ. ID.
NOS. 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,
19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35,
or 36) under stringent conditions, e.g., hybridization to
filter-bound DNA in 0.5 M NaHPO4, 7.0% sodium dodecyl sulfate
(SDS), 1 mM EDTA at 50 degrees C. and washing in 0.2.times.SSC/0.2%
SDS at 50 degrees C.; and (d) any nucleotide sequence that
hybridizes to the complement of the sequences shown in the sequence
listing (SEQ. ID. NOS. 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
32, 33, 34, 35, or 36) under less stringent conditions (e.g.,
hybridization in 0.5 M NaHPO4, 7.0% sodium dodecyl sulfate (SDS), 1
mM EDTA at 37 degrees C. and washing in 0.2.times.SSC/0.2% SDS at
37 degrees C. Preferably these sequences also perform the functions
of the particular nucleic acid embodiment (e.g., inhibition of
nicotine, nornicotine, or sterol production or confer resistance to
norflurazone). Aspects of the invention also include peptides
encoded by the nucleic acid sequences of (a), (b), (c), or (d),
above.
[0485] The examples described herein demonstrate that several
different RNAi constructs can be used to effectively reduce the
levels of nicotine, nornicotine, and sterols in tobacco.
Additionally, these examples demonstrate that several mutant
phytoene desaturase genes, which confer resistance to the herbicide
norflurazone, have been created and that selection cassettes
comprising these herbicide resistant nucleic acids can be used to
determine the presence of a linked gene in transformed tobacco
cells. Additionally, the norflurazone resistance nucleic acids
described herein can be used in a general sense (e.g., in plants
other than tobacco) to efficiently select positively transformed
plant cells from plant cells that do not contain a construct
comprising the norflurazone resistance gene. Thus, the norflurazone
selection cassette or the norflurazone resistance gene described
herein can be used to confer resistance to norflurazone in plants
including, but not limited to, corn (Zea mays), canola (Brassica
napus, Brassica rapa ssp.), alfalfa (Medicago saliva), rice (Orya
sativa), rape (Brassica napus), rye (Secale cereale), sorghum
(Sorghum bicolor, Sorghum vulgare), sunflower (Helianthus annus),
wheat (Triticum aestivum), soybean (Glycine max), tobacco
(Nicotiana tabacum), potato (Solanum tuberosum), peanuts (Arachis
hypogaea), cotton (Gossypium hirsutum), sweet potato (Ipomoea
batatus), cassava (Manihot esculenta), coffee (Cofea spp.), coconut
(Cocos nucifera), pineapple (Ananas comosus), citrus trees (Citrus
spp.), cocoa (Theobroma cacao), tea (Camellia sinensis), banana
(Musa spp.), avocado (Persea americana), fig (Ficus casica), guava
(Psidium guajava), mango (Mangifera indica), olive (Olea europaea),
papaya (Carica papaya), cashew (Anacardium occidentale), macadamia
(Macadamia integrifolia), almond (Prunus amygdalus), sugar beets
(Beta vulgaris), apple (Malus pumila), blackberry (Rubus),
strawberry (Fragaria), walnut (Juglans regia), grape (Vitis
vinifera), apricot (Prunus armeniaca), cherry (Prunus), peach
(Prunus persica), plum (Prunus domestica), pear (Pyrus communis),
watermelon (Citrullus vulgaris), duckweed (Lemna), oats, barley,
vegetables, ornamentals, conifers, and turfgrasses (e.g., for
ornamental, recreational or forage purposes). Vegetables include
Solanaceous species (e.g., tomatoes; Lycopersicon esculentum),
lettuce (e.g., Lactuea sativa), carrots (Caucuis carota),
cauliflower (Brassica oleracea), celery (apium graveolens),
eggplant (Solanum melongena), asparagus (Asparagus officinalis),
ochra (Abelmoschus esculentus), green beans (Phaseolus vulgaris),
lima beans (Phaseolus limensis), peas (Lathyrus spp.), members of
the genus Cucurbita such as Hubbard squash (C. Hubbard), Butternut
squash (C. moschtata), Zucchini (C. pepo), Crookneck squash (C.
crookneck), C. argyrosperma, C. argyrosperma ssp, C. digitata, C.
ecuadorensis, C. foetidissima, C. lundelliana, and C. martinezii,
and members of the genus Cucumis such as cucumber (Cucumis
sativus), cantaloupe (C. cantalupensis), and musk melon (C. melo).
Ornamental plants include azalea (Rhododendron spp.), hydrangea
(Macrophylla hydrangea), hibiscus (Hibiscus rosasanensis), roses
(Rosa spp.), tulips (Tulipa spp.), daffodils (Narcissus spp.),
petunias (Petunia hybrida), carnation (Dianthus caryophyllus),
poinsettia (Euphorbia pulcherima), and chrysanthemum. Conifers,
which may be employed in practicing the present invention, include,
for example, pines such as loblolly pine (Pinus taeda), slash pine
(Pinus elliotii), ponderosa pine (Pinus ponderosa), lodgepole pine
(Pinus contorta), and Monterey pine (Pinus radiata), Douglas-fir
(Pseudotsuga menziesii); Western hemlock (Tsuga canadensis); Sitka
spruce (Picea glauca); redwood (Sequoia sempervirens); true firs
such as silver fir (Abies amabilis) and balsam fir (Abies
balsamea); and cedars such as Western red cedar (Thuja plicata) and
Alaska yellow-cedar (Chamaecyparis nootkatensis). Turf grass
include but are not limited to zoysia grasses, bentgrasses, fescue
grasses, bluegrasses, St. Augustine grasses, Bermuda grasses,
buffalo grasses, ryegrasses, and orchard grasses. Also included are
plants that serve primarily as laboratory models, e.g.,
Arabidopsis. Preferred plants for use in the present methods
include (but are not limited to) legumes, solanaceous species
(e.g., tomatoes), leafy vegetables such as lettuce and cabbage,
turf grasses, and crop plants (e.g., tobacco, wheat, sorghum,
barley, rye, rice, corn, soybean, cotton, cassaya, and the like),
and laboratory plants (e.g., Arabidopsis). While any plant may be
used to carry out this aspect of the invention, tobacco plants are
particularly preferred.
[0486] Further, aspects of the invention concern the production of
norflurazone-resistant or tolerant plants, which can be sprayed
with the herbicide in the field. In this manner, weeds and
non-transformed plants will die after contact with the herbicide
but plants containing the construct harboring the norflurazone
resistance gene will survive. In one embodiment, for example, a
norflurazone-containing herbicide is applied to the plant
comprising the DNA constructs of the present invention, and the
plants are evaluated for tolerance to the herbicide. Any
formulation of norflurazone can be used for testing plants
comprising the DNA constructs of the present invention. The testing
parameters for an evaluation of the norflurazone tolerance of the
plant will vary depending on a number of factors. Factors would
include, but are not limited to the type of norflurazone
formulation, the concentration and amount of norflurazone used in
the formulation, the type of plant, the plant developmental stage
during the time of the application, environmental conditions, the
application method, and the number of times a particular
formulation is applied. For example, plants can be tested in a
greenhouse environment using a spray application method. The
testing range using norflurazone. can include, but is not limited
to 0.5 oz/acre to 500 oz/acre. That is, the amount of herbicide
that can be applied to transgenic plants containing a
norflurazone-resistance gene in a field can be less than, equal to,
or more than 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5,
1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8,
2.9, 3.0, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36,
37, 38, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54,
55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71,
72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88,
89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 125, 150, 175,
200, 250, 300, 350, 400, or 500 oz/acre. In some embodiments, the
norflurazone application rate is 2.24 kg to 4.48 kg ai/hectare (2
to 4 lbs ai/acre) or 2.8 to 5.6 kg granules/hectare (2.5 to 5
lb/acre) or 234 L/hectare (25 gal/acre) in solution. Higher amounts
are preferred for finer textured soils or when longer residual
activity is desired.
[0487] The preferred commercially effective range can be from 25
oz/acre to 100 oz/acre of norflurazone, depending on the crop and
stage of plant development. A crop can be sprayed with at least one
application of a norflurazone. For testing in cotton an application
of 32 oz/acre at the 3-leaf stage may be followed by additional
applications at later stages in development. For wheat, corn,
soybean, and tobacco an application of 32 oz/acre of norflurazone.
at the 3-5 leaf stage can be used. The test parameters can be
optimized for each crop in order to find the particular plant
comprising the constructs of the present invention that confers the
desired commercially effective norflurazone tolerance level. The
section below describes typical curing methods which may be used to
prepare the tobacco once it is harvested.
[0488] Curing
[0489] The curing process, which typically lasts about 1 week,
brings out the flavor and aroma of tobacco. Several methods for
curing tobacco may be used, and indeed many methods have been
previously disclosed. For example, U.S. Pat. Nos. 4,499,911 to
Johnson; 5,685,710 to Martinez Sagrera; 3,905,123 to Fowler;
3,840,025 to Fowler; and 4,192,323 to Home describe aspects of the
tobacco curing process which may be used for some embodiments of
the present invention. Conventionally, "sticks" that are loaded
with tobacco are placed into bulk containers and placed into closed
buildings having a heat source known as a curing barn. A flue is
often used to control the smoke (thus earning the term
"flue-cured"). The method of curing will depend, in some cases, on
the type of tobacco-use cessation product desired, (i.e., snuff,
cigarettes, or pipe tobacco may preferably utilize different curing
methods) and preferred methods may vary from region to region and
in different countries. In some approaches, the stems and midveins
of the leaf are removed from the leaves prior to curing to yield a
high quality, low nitrosamine tobacco product.
[0490] "Flue curing" is a popular method for curing tobacco in
Virginia, North Carolina, and the Coastal Plains regions of the
United States. This method is used mainly in the manufacture of
cigarettes. Flue curing requires a closed building equipped with a
system of ventilation and a source of heat. The heating can be
direct or indirect (e.g., radiant heat). When heat and humidity are
controlled, leaf color changes, moisture is quickly removed, and
the leaf and stems dry. Careful monitoring of the heating and
humidity can reduce the accumulation of nitrosamines.
[0491] Another curing method is termed "air curing". In this
method, an open framework is prepared in which sticks of leaves (or
whole plants) are hung so as to be protected from both wind and
sun. Leaf color changes from green to yellow, as leaves and stems
dry slowly.
[0492] "Fire curing" employs an enclosed barn similar to that used
for flue curing. The tobacco is hung over low temperature fire so
that the leaves cure in a smoke-laden atmosphere. This process uses
lower temperatures, so the process may take up to a month, in
contrast to flue curing, which takes about 6 to 8 days.
[0493] A further curing method, termed "sun curing" is the drying
of uncovered sticks or strings of tobacco leaves in the sun. The
best known sun-cured tobaccos are the so-called oriental tobaccos
of Turkey, Greece, Yugoslavia, and nearby countries.
[0494] The curing process, and most particularly the flue-curing
process, is generally divided into the following four stages:
[0495] A) Firing Up: During this step, the tobacco leaves turn
bright lemon-orange in color. This is achieved by a gradual
increase in temperature.
[0496] B) Leaf Yellowing: In this step any moisture is removed.
This creates the "yellowing" of the tobacco. It also prepares the
tobacco for drying in the next step.
[0497] C) Leaf Drying: Leaf drying, an important step in the curing
process, requires much time for the tobacco to dry properly.
Additionally, air flow is increased in this step to facilitate the
drying process.
[0498] D) Stem Drying: The drying process continues, as the stem of
the tobacco leaf becomes dried.
[0499] The cured tobacco may then be blended with other tobaccos or
other materials to create the product to be used for the
tobacco-use cessation method. The section below describes typical
methods of blending and preparing a tobacco product of the
invention.
[0500] Tobacco Blending
[0501] It may be desirable to blend tobacco of varying nicotine
levels to create the cessation product having the desired level of
nicotine. This blending process is typically performed after the
curing process, and may be performed by conventional methods.
Preferred tobacco blending approaches are provided below. In some
embodiments, blending of the transgenic tobacco is conducted to
prepare the tobacco so that it will contain specific amounts of
nicotine, nornicotine, sterol and/or TSNA in specific products.
Preferably, the blending is conducted so that tobacco products of
varying amounts of nicotine are made in specific products.
[0502] A mixture that contains different types of tobacco is
desirably substantially homogeneous throughout in order to avoid
undesirable fluctuations in taste or nicotine levels. Typically,
tobacco to be blended may have a moisture content between 30 and
75%. As an example, the tobacco is first cut or shredded to a
suitable size, then mixed in a mixing device, such as a rotating
drum or a blending box. One such known mixing device is a tumbling
apparatus that typically comprises a rotating housing enclosing
mixing paddles which are attached to and, therefore, rotate with
the housing to stir the tobacco components together in a tumbling
action as the drum turns.
[0503] After the desired tobaccos are thoroughly mixed, the
resulting tobacco blend is removed from the mixing apparatus and
bulked to provide a continuous, generally uniform quantity of the
tobacco blend. The tobacco is then allowed to remain relatively
undisturbed (termed the "bulking step") for the required period of
time before subsequent operations are performed. The bulking step
typically takes 30 minutes or less, and may be carried out on a
conveyor belt. The conveyor belt allows the blended tobacco to
remain in bulk form in an undisturbed condition while it is
continuously moving the tobacco blend through the process from the
mixing stage to the expansion stage.
[0504] The tobacco blend is typically expanded by the application
of steam. The tobacco mixture is typically subjected to at least
0.25 pounds of saturated steam at atmospheric conditions per pound
of blended tobacco for at least 10 seconds to provide an increase
in moisture of at least 2 weight percent to the tobacco blend.
After the tobacco blend has been expanded, it is dried. A typical
drying apparatus uses heated air or superheated steam to dry the
tobacco as the tobacco is conveyed by the heated air or steam
stream through a drying chamber or series of drying chambers.
Generally, the wet bulb temperature of the drying air may be from
about 150 degrees F. to about 211 degrees F. The tobacco blend is
typically dried to a moisture content of from about 60 percent to
about 5 percent. The dried, expanded tobacco blend is then in a
suitable mode to be processed into the tobacco-use cessation
product as described below.
[0505] Some blending approaches begin with tobacco prepared from
varieties that have extremely low amounts of nicotine, nornicotine,
sterols and/or TSNAs. By blending prepared tobacco from a low
nicotine/TSNA variety (e.g., undetectable levels of nicotine and/or
TSNAs) with a conventional tobacco (e.g., Burley, which has 30,000
parts per million (ppm) nicotine and 8,000 parts per billion (ppb)
TSNA; Flue-Cured, which has 20,000 ppm nicotine and 300 ppb TSNA;
and Oriental, which has 10,000 ppm nicotine and 100 ppb TSNA),
tobacco products having virtually any desired amount of nicotine
and/or TSNAs can be manufactured. Other approaches blend only low
nicotine/TSNA tobaccos (e.g., genetically modified Burley,
genetically modified Virginia flue, and genetically modified
Oriental tobaccos that contain reduced amounts of nicotine and/or
TSNAs) and/or low sterol tobaccos (e.g., Burley, Flue-cured, and
Oriental). Tobacco products having various amounts of nicotine
and/or TSNAs can be incorporated into tobacco-use cessation kits
and programs to help tobacco users reduce or eliminate their
dependence on nicotine and reduce the carcinogenic potential.
[0506] By one approach, a step 1 tobacco product is comprised of
approximately 25% low nicotine/TSNA tobacco and 75% conventional
tobacco; a step 2 tobacco product can be comprised of approximately
50% low nicotine/TSNA tobacco and 50% conventional tobacco; a step
3 tobacco product can be comprised of approximately 75% low
nicotine/TSNA tobacco and 25% conventional tobacco; and a step 4
tobacco product can be comprised of approximately 100% low
nicotine/TSNA tobacco and 0% conventional tobacco. A tobacco-use
cessation kit can comprise an amount of tobacco product from each
of the aforementioned blends to satisfy a consumer for a single
month program. That is, if the consumer is a one pack per day
smoker, for example, a single month kit would provide 7 packs from
each step, a total of 28 packs of cigarettes. Each tobacco-use
cessation kit would include a set of instructions that specifically
guide the consumer through the step-by-step process. Of course,
tobacco products having specific amounts of nicotine and/or TSNAs
would be made available in conveniently sized amounts (e.g., boxes
of cigars, packs of cigarettes, tins of snuff, and pouches or
twists of chew) so that consumers could select the amount of
nicotine and/or TSNA they individually desire. There are many ways
to obtain various low nicotine/low TSNA tobacco blends using the
teachings described herein and the following is intended merely to
guide one of skill in the art to one possible approach.
[0507] To obtain a step 1 tobacco product, which is a 25% low
nicotine/TSNA blend, prepared tobacco from an approximately 0 ppm
nicotine/TSNA tobacco can be mixed with conventional Burley,
Flue-cured, or Oriental in a 25%/75% ratio respectively to obtain a
Burly tobacco product having 22,500 ppm nicotine and 6,000 ppb
TSNA, a Flue-cured product having 15,000 ppm nicotine and 225 ppb
TSNA, and an Oriental product having 7,500 ppm nicotine and 75 ppb
TSNA. Similarly, to obtain a step 2 product, which is 50% low
nicotine/TSNA blend, prepared tobacco from an approximately 0 ppm
nicotine/TSNA tobacco can be mixed with conventional Burley,
Flue-cured, or Oriental in a 50%/50% ratio respectively to obtain a
Burly tobacco product having 15,000 ppm nicotine and 4,000 ppb
TSNA, a Flue-cured product having 10,000 ppm nicotine and 150 ppb
TSNA, and an Oriental product having 5000 ppm nicotine and 50 ppb
TSNA. Further, a step 3 product, which is a 75%/25% low
nicotine/TSNA blend, prepared tobacco from an approximately 0 ppm
nicotine/TSNA tobacco can be mixed with conventional Burley,
Flue-cured, or Oriental in a 75%/25% ratio respectively to obtain a
Burly tobacco product having 7,500 ppm nicotine and 2,000 ppb TSNA,
a Flue-cured product having 5,000 ppm nicotine and 75 ppb TSNA, and
an Oriental product having 2,500 ppm nicotine and 25 ppb TSNA.
[0508] By a preferred method, conventional Virginia flue tobacco
was blended with genetically modified Burley (i.e., Burley
containing a significantly reduced amount of nicotine and
nitrosamine) to yield a blended tobacco that was incorporated into
three levels of reduced nicotine cigarettes: a step 1 cigarette
containing 0.6 mg nicotine, a step 2 cigarette containing 0.3 mg
nicotine, and a step 3 cigarette containing less than 0.05 mg
nicotine. The amount of total TSNA was found to range between
approximately 0.17 .mu.g/g-0.6 .mu.g/g.
[0509] In some cigarettes, approximately, 28% of the blend was
Virginia flue tobacco, approximately 29% of the blend was
genetically modified (i.e., reduced nicotine Burley), approximately
14% of the blend was Oriental, approximately 17% of the blend was
expanded flue-cured stem, and approximately 12% was standard
commercial reconstituted tobacco. The amount of total TSNAs in
cigarettes containing this blend was approximately 1.5 .mu.g/g.
[0510] It should be appreciated that tobacco products are often a
blend of many different types of tobaccos, which were grown in many
different parts of the world under various growing conditions. As a
result, the amount of nicotine and TSNAs will differ from crop to
crop. Nevertheless, by using conventional techniques one can easily
determine an average amount of nicotine and TSNA per crop used to
create a desired blend. By adjusting the amount of each type of
tobacco that makes up the blend one of skill can balance the amount
of nicotine and/or TSNA with other considerations such as
appearance, flavor, and smokability. In this manner, a variety of
types of tobacco products having varying level of nicotine and/or
nitrosamine, as well as, appearance, flavor and smokability can be
created.
[0511] Nicotine Reduction and/or Tobacco-Use Cessation Programs
Methods
[0512] It is also contemplated that the low nicotine and/or TSNA
tobacco described herein can be processed and blended with
conventional tobacco so as to create a wide-range of tobacco
products with varying amounts of nicotine and/or nitrosamines.
These blended tobacco products can be used in nicotine reduction
and/or tobacco-use cessation programs so as to move a consumer from
a high nicotine and TSNA product to a low nicotine and TSNA
product.
[0513] In some embodiments of the invention, a stepwise nicotine
reduction and/or tobacco-use cessation program can be established
using the low nicotine, low TSNA products described above. As an
example, the program participant initially determines his or her
current level of nicotine intake. The program participant then
begins the program at step 1, with a tobacco product having a
reduced amount of nicotine, as compared to the tobacco product that
was used prior to beginning the program. After a period of time,
the program participant proceeds to step 2, using a tobacco product
with less nicotine than the products used in step 1. The program
participant, after another period of time, reaches step 3, wherein
the program participant begins using a tobacco product with less
nicotine than the products in step 2, and so on. Ultimately, the
program participant uses a tobacco product having an amount of
nicotine that is less than that which is sufficient to become
addictive or to maintain an addiction. Thus, the nicotine reduction
and/or tobacco-use cessation program limits the exposure of a
program participant to nicotine and, concomitantly, the harmful
effect of nicotine yet retains the secondary factors of addiction,
including but not limited to, smoke intake, oral fixation, and
taste.
[0514] For example, a smoker can begin the program smoking blended
cigarettes having 5 mg of nicotine and 1.5 .mu.g of nitrosamine,
gradually move to smoking cigarettes with 3 mg of nicotine and 1
.mu.g of nitrosamine, followed by cigarettes having 1 mg nicotine
and 0.5 .mu.g nitrosamine, followed by cigarettes having 0.5 mg
nicotine and 0.25 .mu.g nitrosamine, followed by cigarettes having
less than 0.1 mg nicotine and less than 0.1 .mu.g TSNA until the
consumer decides to smoke only the cigarettes having virtually no
nicotine and nitrosamines or quitting smoking altogether.
Preferably, a three-step program is followed whereby at step 1,
cigarettes containing 0.6 mg nicotine and less than 2 .mu.g/g TSNA
are used; at step 2, cigarettes containing 0.3 mg nicotine and less
than 1 TSNA are used; and at step 3, cigarettes containing less
than 0.1 mg nicotine and less than 0.7 .mu.g/g TSNA are used. More
preferably, a three-step program is followed whereby at step 1,
cigarettes containing 0.6 mg nicotine and less than 2 .mu.g/g TSNA
are used; at step 2, cigarettes containing 0.3 mg nicotine and less
than 1 TSNA are used; and at step 3, cigarettes containing less
than 0.05 mg nicotine and less than 0.7 .mu.g/g TSNA are used.
Accordingly, the blended cigarettes described herein provide the
basis for an approach to reduce the carcinogenic potential in a
human in a step-wise fashion.
[0515] The methods described herein facilitate tobacco-use
cessation by allowing the individual to retain the secondary
factors of addiction such as smoke intake, oral fixation, and
taste, while gradually reducing the addictive nicotine levels
consumed. Eventually, complete cessation is made possible because
the presence of addiction for nicotine is gradually decreased while
the individual is allowed to maintain dependence on the secondary
factors, above.
[0516] Embodiments, for example, include stepwise blends of tobacco
products, which are prepared with a variety of amounts of nicotine.
These stepwise blends are made to have reduced levels of TSNAs and
varying amounts of nicotine. As an example, cigarettes may contain,
for example, 5 mg, 4, 3, 2, 1, 0.5, 0.1, or 0 mg of nicotine per
cigarette. More preferably, blended cigarettes contain less than
0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%,
0.1%, 0.2%, 0.3%, 0.4%, 0.5%, and 0.6% nicotine.
[0517] In another aspect of the invention, the cigarettes of
varying levels of nicotine are packaged to clearly indicate the
level of nicotine present, and marketed as a smoking cessation
program. A preferred approach to produce a product for nicotine
reduction and/or tobacco-use cessation program is provided below.
Individuals may wish to step up the program by skipping gradation
levels of nicotine per cigarette or staying at certain steps until
ready to proceed to the next level. Significantly, aspects of the
invention allow a consumer to individually select the amount of
nicotine that is ingested by selection of a particular tobacco
product described herein. Furthermore, because the secondary
factors of addiction are maintained, dependence on nicotine can be
reduced rapidly.
[0518] As an example, Virginia flue tobacco was blended with
genetically modified Burley (i.e., Burley containing a
significantly reduced amount of nicotine and nitrosamine) to yield
a blended tobacco that was incorporated into three levels of
reduced nicotine cigarettes: a step 1 cigarette containing 0.6 mg
nicotine, a step 2 cigarette containing 0.3 mg nicotine, and a step
3 cigarette containing less than 0.05 mg nicotine. The stepwise
packs of cigarettes are clearly marked as to their nicotine
content, and the step in the stepwise nicotine reduction program is
also clearly marked on the package. Each week, the user purchases
packs containing cigarettes having the next lower level of
nicotine, but limits himself to no more cigarettes per day than
consumed previously. The user may define his/her own rate of
nicotine reduction and/or smoking cessation according to individual
needs by choosing a) the number of cigarettes smoked per day b) the
starting nicotine levels c) the change in nicotine level per
cigarette each week, and d) the final level of nicotine consumed
per day. To keep better track of the program, the individual keeps
a daily record of total nicotine intake, as well as the number of
cigarettes consumed per day. Eventually, the individual will be
consuming tobacco products with essentially no nicotine. Since the
nicotine-free tobacco products of the final step are non-addictive,
it should then be much easier to quit the use of the tobacco
products altogether
[0519] The nicotine reduction and/or tobacco-use cessation program
limits the exposure of a program participant to nicotine while
retaining the secondary factors of addiction. These secondary
factors include but are not limited to, smoke intake, oral
fixation, and taste. Because the secondary factors are still
present, the program participant may be more likely to be
successful in the nicotine reduction and/or tobacco-use cessation
program than in programs that rely on supplying the program
participant with nicotine but remove the above-mentioned secondary
factors. Ultimately, the program participant uses a tobacco product
having an amount of nicotine that is less than that which is
sufficient to become addictive.
[0520] In another aspect of the invention, individuals would choose
to obtain only cigarettes with less than 0.05 mg nicotine per
cigarette. Some individuals, such as individuals needing to stop
nicotine intake immediately (for example, individuals with medical
conditions or individuals using drugs that interact with nicotine)
may find this method useful. For some individuals, the mere
presence of a cigarette in the mouth can be enough to ease
withdrawal from nicotine addiction. Gradually, the addictive
properties of smoking can decrease since there is no nicotine in
the cigarettes. These individuals are then able to quit smoking
entirely. More discussion on Smoking Cessation Programs that use
reduced nicotine tobacco can be found in PCT/US2004/01695, which
designates the United States and was published in English, hereby
expressly incorporated by reference in its entirety.
[0521] In another aspect of the invention, packs of cigarettes
containing the gradations of nicotine levels are provided as a
"smoking cessation kit." An individual who wishes to quit smoking
can buy the entire kit of cigarettes at the beginning of the
program. Thus any temptation that may occur while buying cigarettes
at the cigarette counter is avoided. Thus, the success of this
method may be more likely for some individuals. A preferred example
of such a kit is provided below.
[0522] Various nicotine reduction and/or smoking cessation kits are
prepared, geared to heavy, medium, or light smokers. The kits
provide all of the materials needed to quit smoking in either a
two-week period (fast), a one-month period (medium) or in a
two-month period (slow), depending on the kit. Each kit contains a
set number of packs of cigarettes modified according the present
invention, containing either step 1 cigarettes containing 0.6 mg
nicotine, step 2 cigarettes containing 0.3 mg nicotine, and step 3
cigarettes containing less than 0.05 mg nicotine. For example, 1
pack a day smokers would receive 7 packs of cigarettes, each pack
containing the above amounts of nicotine per each cigarette.
Several weeks worth of additional cigarettes containing less than
0.05 mg nicotine/cigarette would also be provided in the kit, to
familiarize the consumer with smoking no nicotine cigarettes. The
kit would also contain a diary for keeping track of daily nicotine
intake, motivational literature to keep the individual interested
in continuing the cessation program, health information on the
benefits of smoking cessation, and web site addresses to find
additional anti-smoking information, such as chat groups, meetings,
newsletters, recent publications, and other pertinent links. The
table below describes the sequences referred to in the present
disclosure.
Sequences
TABLE-US-00013 [0523] (SEQ ID No. 1) Artificial Peptide (Caspase-3
binding peptide) DEVD Nicotiana tabacum QPTase coding sequence (SEQ
ID No. 2) atgtttagag ctattccttt cactgctaca gtgcatcctt atgcaattac
agctccaagg ttggtggtga aaatgtcagc aatagccacc aagaatacaa gagtggagtc
attagaggtg aaaccaccag cacacccaac ttatgattta aaggaagtta tgaaacttgc
actctctgaa gatgctggga atttaggaga tgtgacttgt aaggcgacaa ttcctcttga
tatggaatcc gatgctcatt ttctagcaaa ggaagacggg atcatagcag gaattgcact
tgctgagatg atattcgcgg aagttgatcc ttcattaaag gtggagtggt atgtaaatga
tggcgataaa gttcataaag gcttgaaatt tggcaaagta caaggaaacg cttacaacat
tgttatagct gagagggttg ttctcaattt tatgcaaaga atgagtggaa tagctacact
aactaaggaa atggcagatg ctgcacaccc tgcttacatg ttggagacta ggaaaactgc
tcctggatta cgtttggtgg ataaatgggc ggtattgatc ggtgggggga agaatcacag
aatgggctta tttgatatgg taatgataaa agacaatcac atatctgctg ctggaggtgt
cggcaaagct ctaaaatctg tggatcagta tttggagcaa aataaacttc aaataggggt
tgaggttgaa accaggacaa ttgaagaagt acgtgaggtt ctagactatg catctcaaac
aaagacttcg ttgactagga taatgctgga caatatggtt gttccattat ctaacggaga
tattgatgta tccatgctta aggaggctgt agaattgatc aatgggaggt ttgatacgga
ggcttcagga aatgttaccc ttgaaacagt acacaagatt ggacaaactg gtgttaccta
catttctagt ggtgccctga cgcattccgt gaaagcactt gacatttccc tgaagatcga
tacagagctc gcccttgaag ttggaaggcg tacaaaacga gca tga Nicotiana
Tabacum QPTase inhibitory fragment (SEQ ID No. 3)
ATGtttagagctattcctttcactgctacagtgcatccttatgcaattac
agctccaaggttggtggtgaaaatgtcagcaatagccaccaagaatacaa
gagtggagtcattagaggtgaaaccaccagcacacccaacttatgattta
aaggaagttatgaaacttgcactctctgaagatgctgggaatttaggaga
tgtgacttgtaaggcgacaattcctcttgatatggaatccgatgctcatt
ttctagcaaaggaagacgggatcatagcaggaattgcacttgctgagatg
atattcgcggaagttgatccttcattaaaggtggagtggtatgtaaatga tggcgataaa
Nicotiana tabacum Putrescene methyl transferase inhibitory fragment
(SEQ ID No. 4) cattttaccatctttcgccagaagtatgatcgagtctTAAtcaagtgaat
aatgaacactggtagtacaatcattggaccaagatcgagtcttaatcaag
tgaataaataagtgaaatgcgacgtattgtaggagaattctgcagtaatt
atcataatttccaattcacaatcattgtaaaattattctctgtggtgttt
cgtactttaatataaattttcctgctgaagttttgaatcg Nicotiana tabacum A622
inhibitory fragment (SEQ ID No. 5)
tgatcaagtgaacatcatcaaagcaattaaagaagctggaaatatcaaga
gatttcttccttcagaatttggatttgatgtggatcatgctcgtgcaatt
gaaccagctgcatcactcttcgctctaaaggtaagaatcaggaggatgat
agaggcagaaggaattccatacacatatgtaatctgcaattggtttgcag
atttcttcttgcccaacttggggcagttagaggccaaaacccctcctaga
gacaaagttgtcatttttggcgatggaaatcccaaagcaatatatgtgaa
ggaagaagacatagcgacatacactatcgaagcagtagatgatccacgga
cattgaataagactcttcacatgagaccacctgccaatattctatccttc
aacgagatagtgtccttgtgggaggacaaaattgggaagaccctcgagaa
gttatatctatcagaggaagatattctccagattgtacaagagggacctc
tgccattaaggactaatttggccatatgccattcagtttttgttaatgga
gattctgcaaactttgaggttcagcctcctacaggtgtcgaagccactga
gctatatccaaaagtgaaatacacaacc Nicotiana tabacum Squalene synthase
inhibitory fragment (SEQ ID No. 6)
ccacattggggcttctgttactcaatgcttcataaggtttctcgtagctt
tgctctcgtcattcaacaacttcccgtcgagcttcgtgacgccgtgtgca
ttttctatttggttcttcgagcacttgacactgttgaggatgataccagc
attcccaccgatgttaaagtacctattctgatctcttttcatcagcatgt
ttatgatcgtgaatggcatttttcatgtggtacaaaagagtacaaggttc
tcatggaccagttccatcatgtttcaactgcttttctggagcttaggaaa
cattatcagcaggcaattgaggatattaccatgaggatgggtgcaggaat
ggcaaaattcatatgcaaggaggtggaaacaactgatgattatgacgaat
attgtcactatgtagctgggcttgttgggctaggattgt Nicotiana tabacum HMG CoA
reductase inhibitory fragment (SEQ ID No. 7)
gaggctgtaaatgatggcaaagacctccatatttcagtaactatgccttc
tattgaggttggcacagttggtggtggaactcaacttgcatcacagtcag
cttgcttgaacttattaggagtgaaaggtgcaaacagggaggcagcaggg
tcaaatgcaaggctcttggccacaatagtagcaggttctgttcttgctgg
tgagttatctctcatgtctgctatctcagcagggcagctggttaagagtc
acatgaaatacaatagatctagcaaagatgttactaagatttcctcttag
taaggaaaaagacaaatttattatcccaacatcgtgtacatcaccatcct
ttatggaccatcattattaaagaaatggattacaataaaagtaggaataa
aattttccaattagggagagcaataagtaaagggtagaccaaaaagttga
aaaagtgtaaggcattagtcatgtggagaaagatcaagaagaaaaagaca
agcaaatcaagggtggacgtggatctgtatgtagtgttgtattctttcta
tgaaggcatgtgaggaggtagggtcgtatttttttctgagttcgtgtaaa
aaaacctgcaaatatttggtgaagatctacgaaaggtgttaggtgggatg
gtgaccagtggggttaacttgtaattcaacatttggttaatttcattcat
gcgccaaggaagataacccctttttttttaaataatcttttctgttgtac
tgtctttcgtttgtttgttaattgtgactagattgtaatttagagagaaa
tggcatctcaaactctttatgtttgctcagaaagtttgcttttgtatatg Nicotiana
tabacum SMT2 inhibitory fragment (SEQ ID No. 8)
agaagctacctgccatgcaccagatccattgggatgctataaagagattt
accgggtgctgaagcctggtcaatgtttcgctgtgtatgagtggtgcatg
accgattcttacaaccccaataacgaagagcacaacaggatcaaggccga
aattgagctcggaaatggcctccctgaggttagattgacaacacagtgcc
tcgaagcagccaaacaagctggttttgaagttgtatgggacaaggatctg
gctgatgactcacctgttccatggtacttgcctttggatacgagtcactt
ctcgctcagtagcttccgcctaacagcagttggcagacttttcaccagaa
atctggtttcggcgcttgaatacgtgggacttgctcctaaaggtagtcaa
agggttcaagctttcttagagaaagctgcagaaggtcttgtcggtggtgc
caagaaagggattttcacaccaatgtacttcttcgtggttcgcaagccca
tttcagactctcagTAAtatggagtttagtcacttagctttttgctttag
ctagcaaatctgtaagattcttcgcacagaactttacacattgaatatga
ccgccctaattaaggtgactacagtttttggagggcgttgtgggtggagg
gtttctttttctgtgttgcttgtctggcacaatttgatttcatgtcttgc
tatttttgccattgatgtccttgttctaagatatatacctattgacaagc
tcataaaggtgggcatttgctaatatatgg Nicotiana tabacum 14alpha
demethylase inhibitory fragment (SEQ ID No. 9)
AAGAATATCACGTTCTTCGTTGGCCCAGAAGTGTCGGCCCATTTCTTTAA
GGCCCCAGAAACCGATCTCAG
TCAACAAGAGGTTTATCAGTTCAATGTGCCTACTTTTGGCCCTGGTGTGG
TTTTTGACGTTGATTATACTATCAGACAAG
AGCAATTTAGGTTCTTTACTGAATCTTTGAGGGTAAATAAATTGAAGGGA
TATGTGGATCAGATGGTCATGGAAGCTGAG
GAGTACTTCTCAAAATGGGGTGATAGTGGTGAAGTGGACTTGAAGTATGA
ACTGGAGCATCTTATCATACTGACAGCTAG
TAGATGTCTGTTGGGAGAAGAGGTTCGCAATAAACTCTTTGAGGATGTCT
CTGCTCTCTTCCATGACCTGGACAATGGGA
TGCTTCCTATCAGTGTAATCTTTCCCTACCTTCCCATTCCAGCCCATCGC
CGTCGTGACAATGCCCGCAAGAAGCTCGCG
GAGATCTTTGCAAACATCATAGATTCTAGAAAACGTACAGGCAAGGCGGA
GAGCGATATGTTACAATGCTTCATTGACTC
CAAGTACAAAGATGGGCGGGCAACGACAGAGTCTGAGATCACAGGTCTTC
TGATTGCTGCTCTTTTCGCTGGGCAACACA
CCAGTTCCATCACCTCCACTTGGGCAGGGGCATACCTTCTCTGCAACAAC
AAGTACATGTCTGCCGTCGTAGATGAACAG
AAGAATCTGATGAAGAAACATGGGAATAAGGTCGATCATGACATCCTTTC
CGAGATGGAAGTCCTCTATAGATGCATAAA
GGAAGCCCTGAGACTCCATCCTCCACTGATAATGCTTCTACGTAGTTCGC
ATAGTGATTTCACTGTTAAAACCAGGGAAG GAAAAGAGTATGAT Arab. thal. Phytoene
desaturase mutant - 1 (PDSM-1) (SEQ ID No. 10)
ATGGTTGTGTTTGGGAATGTTTCTGCGGCGAATTTGCCTTATCAAAACGG
GTTTTTGGAGGCACTTTCATCTGGAGGTTG
TGAACTAATGGGACATAGCTTTAGGGTTCCCACTTCTCAAGCGCTTAAGA
CAAGAACAAGGAGGAGGAGTACTGCTGGTC
CTTTGCAGGTAGTTTGTGTGGATATTCCAAGGCCAGAGCTAGAGAACACT
GTCAATTTCTTGGAAGCTGCTAGTTTATCT
GCATCCTTCCGTAGTGCTCCTCGTCCTGCTAAGCCTTTGAAAGTTGTAAT
TGCTGGTGCTGGATTGGCTGGATTGTCAAC
TGCAAAGTACCTGGCTGATGCAGGCCACAAACCTCTGTTGCTTGAAGCAA
GAGATGTTCTTGGTGGAAAGATAGCTGCAT
GGAAGGATGAAGATGGGGACTGGTATGAGACTGGTTTACATATTTTCTTC
GGTGCTTATCCGAATGTGCAGAATTTATTT
GGAGAACTTGGGATCAATGATCGGTTGCAGTGGAAGGAACACTCCATGAT
TTTTGCTATGCCAAGTAAACCTGGAGAATT
TAGTAGATTTGACTTCCCAGATGTCCTACCAGCACCCTTAAATGGTATTT
GGGCTATTTTGCGGAACAACGAGATGCTGA
CATGGCCAGAGAAAATAAAGTTTGCTATTGGACTTTTGCCAGCCATGGTC
GGCGGTCAGGCTTATGTTGAGGCCCAAGAT
GGTTTATCAGTCAAAGAATGGATGGAAAAGCAGGGAGTACCTGAGCGCGT
GACCGACGAGGTGTTTATTGCCATGTCAAA
GGCGCTAAACTTTATAAACCCTGATGAACTGTCAATGCAATGCATTTTGA
TAGCTTTGAACCGGTTTCTTCAGGAAAAAC
ATGGTTCCAAGATGGCATTCTTGGATGGTAATCCTCCGGAAAGGCTTTGT
ATGCCAGTAGTGGATCATATTCGATCACTA
GGTGGGGAAGTGCAACTTAATTCTAGGATAAAGAAAATTGAGCTCAATGA
CGATGGCACGGTTAAGAGTTTCTTACTCAC
TAATGGAAGCACTGTCGAAGGAGACGCTTATGTGTTTGCCGCTCCAGTCG
ATATCCTGAAGCTCCTTTTACCAGATCCCT
GGAAAGAAATACCGTACTTCAAGAAATTGGATAAATTAGTTGGAGTACCA
GTTATTAATGTTCATATATGGTTTGATCGA
AAACTGAAGAACACATATGATCACCTACTCTTTAGCAGAAGTAACCTTCT
GAGCGTGTATGCCGACATGTCCTTAACTTG
TAAGGAATATTACGATCCTAACCGGTCAATGCTGGAGCTAGTATTTGCAC
CAGCAGAGGAATGGATATCACGGACTGATT
CTGACATCATAGATGCAACAATGAAAGAACTTGAGAAACTCTTCCCTGAT
GAAATCTCAGCTGACCAAAGCAAAGCTAAA
ATTCTGAAGTACCATGTCGTTAAGACTCCAAGATCTGGGTACAAGACCAT
CCCAAACTGTGAACCATGTCGTCCTCTACA
AAGATCACCTATTGAAGGATTCTACTTAGCTGGAGATTACACAAAACAGA
AGTACTTAGCTTCCATGGAAGGCGCTGTCC
TCTCTGGCAAATTCTGCTCTCAGTCTATTGTTCAGGATTACGAGCTACTG
GCTGCGTCTGGACCAAGAAAGTTGTCGGAG GCAACAGTATCATCATCATGA Arab. Thal.
Phytoene desaturase mutant - 2 (PDSM-2) (SEQ. ID. No. 11)
ATGGTTGTGTTTGGGAATGTTTCTGCGGCGAATTTGCCTTATCAAAACGG
GTTTTTGGAGGCACTTTCATCTGGAGGTTG
TGAACTAATGGGACATAGCTTTAGGGTTCCCACTTCTCAAGCGCTTAAGA
CAAGAACAAGGAGGAGGAGTACTGCTGGTC
CTTTGCAGGTAGTTTGTGTGGATATTCCAAGGCCAGAGCTAGAGAACACT
GTCAATTTCTTGGAAGCTGCTAGTTTATCT
GCATCCTTCCGTAGTGCTCCTCGTCCTGCTAAGCCTTTGAAAGTTGTAAT
TGCTGGTGCTGGATTGGCTGGATTGTCAAC
TGCAAAGTACCTGGCTGATGCAGGCCACAAACCTCTGTTGCTTGAAGCAA
GAGATGTTCTTGGTGGAAAGATAGCTGCAT
GGAAGGATGAAGATGGGGACTGGTATGAGACTGGTTTACATATTTTCTTC
GGTGCTTATCCGAATGTGCAGAATTTATTT
GGAGAACTTGGGATCAATGATCGGTTGCAGTGGAAGGAACACTCCATGAT
TTTTGCTATGCCAAGTAAACCTGGAGAATT
TAGTAGATTTGACTTCCCAGATGTCCTACCAGCACCCTTAAATGGTATTT
GGGCTATTTTGCGGAACAACGAGATGCTGA
CATGGCCAGAGAAAATAAAGTTTGCTATTGGACTTTTGCCAGCCATGGTC
GGCGGTCAGGCTTATGTTGAGGCCCAAGAT
GGTTTATCAGTCAAAGAATGGATGGAAAAGCAGGGAGTACCTGAGCGCGT
GACCGACGAGGTGTTTATTGCCATGTCAAA
GGCGCTAAACTTTATAAACCCTGATGAACTGTCAATGCAATGCATTTTGA
TAGCTTTGAACCCGTTTCTTCAGGAAAAAC
ATGGTTCCAAGATGGCATTCTTGGATGGTAATCCTCCGGAAAGGCTTTGT
ATGCCAGTAGTGGATCATATTCGATCACTA
GGTGGGGAAGTGCAACTTAATTCTAGGATAAAGAAAATTGAGCTCAATGA
CGATGGCACGGTTAAGAGTTTCTTACTCAC
TAATGGAAGCACTGTCGAAGGAGACGCTTATGTGTTTGCCGCTCCAGTCG
ATATCCTGAAGCTCCTTTTACCAGATCCCT
GGAAAGAAATACCGTACTTCAAGAAATTGGATAAATTAGTTGGAGTACCA
GTTATTAATGTTCATATATGGTTTGATCGA
AAACTGAAGAACACATATGATCACCTACTCTTTAGCAGAAGTAACCTTCT
GAGCGTGTATGCCGACATGTCCTTAACTTG
TAAGGAATATTACGATCCTAACCGGTCAATGCTGGAGCTAGTATTTGCAC
CAGCAGAGGAATGGATATCACGGACTGATT
CTGACATCATAGATGCAACAATGAAAGAACTTGAGAAACTCTTCCCTGAT
GAAATCTCAGCTGACCAAAGCAAAGCTAAA
ATTCTGAAGTACCATGTCGTTAAGACTCCAAGATCTGTGTACAAGACCAT
CCCAAACTGTGAACCATGTCGTCCTCTACA
AAGATCACCTATTGAAGGATTCTACTTAGCTGGAGATTACACAAAACAGA
AGTACTTAGCTTCCATGGAAGGCGCTGTCC
TCTCTGGCAAATTCTGCTCTCAGTCTATTGTTCAGGATTACGAGCTACTG
GCTGCGTCTGGACCAAGAAAGTTGTCGGAG GCAACAGTATCATCATCATGA Arab. Thal.
Phytoene desaturase mutant - 2 (PDSM-3) (SEQ. ID. No. 12)
ATGGTTGTGTTTGGGAATGTTTCTGCGGCGAATTTGCCTTATCAAAACGG
GTTTTTGGAGGCACTTTCATCTGGAGGTTG
TGAACTAATGGGACATAGCTTTAGGGTTCCCACTTCTCAAGCGCTTAAGA
CAAGAACAAGGAGGAGGAGTACTGCTGGTC
CTTTGCAGGTAGTTTGTGTGGATATTCCAAGGCCAGAGCTAGAGAACACT
GTCAATTTCTTGGAAGCTGCTAGTTTATCT
GCATCCTTCCGTAGTGCTCCTCGTCCTGCTAAGCCTTTGAAAGTTGTAAT
TGCTGGTGCTGGATTGGCTGGATTGTCAAC
TGCAAAGTACCTGGCTGATGCAGGCCACAAACCTCTGTTGCTTGAAGCAA
GAGATGTTCTTGGTGGAAAGATAGCTGCAT
GGAAGGATGAAGATGGGGACTGGTATGAGACTGGTTTACATATTTTCTTC
GGTGCTTATCCGAATGTGCAGAATTTATTT
GGAGAACTTGGGATCAATGATCGGTTGCAGTGGAAGGAACACTCCATGAT
TTTTGCTATGCCAAGTAAACCTGGAGAATT
TAGTAGATTTGACTTCCCAGATGTCCTACCAGCACCCTTAAATGGTATTT
GGGCTATTTTGCGGAACAACGAGATGCTGA
CATGGCCAGAGAAAATAAAGTTTGCTATTGGACTTTTGCCAGCCATGGTC
GGCGGTCAGGCTTATGTTGAGGCCCAAGAT
GGTTTATCAGTCAAAGAATGGATGGAAAAGCAGGGAGTACCTGAGCGCGT
GACCGACGAGGTGTTTATTGCCATGTCAAA
GGCGCTAAACTTTATAAACCCTGATGAACTGTCAATGCAATGCATTTTGA
TAGCTTTGAACCGGTTTCTTCAGGAAAAAC
ATGGTTCCAAGATGGCATTCTTGGATGGTAATCCTCCGGAAAGGCTTTGT
ATGCCAGTAGTGGATCATATTCGATCACTA
GGTGGGGAAGTGCAACTTAATTCTAGGATAAAGAAAATTGAGCTCAATGA
CGATGGCACGGTTAAGAGTTTCTTACTCAC
TAATGGAAGCACTGTCGAAGGAGACGCTTATGTGTTTGCCGCTCCAGTCG
ATATCCTGAAGCTCCTTTTACCAGATCCCT
GGAAAGAAATACCGTACTTCAAGAAATTGGATAAATTAGTTGGAGTACCA
GTTATTAATGTTCATATATGGTTTGATCGA
AAACTGAAGAACACATATGATCACCCACTCTTTAGCAGAAGTAACCTTCT
GAGCGTGTATGCCGACATGTCCTTAACTTG
TAAGGAATATTACGATCCTAACCGGTCAATGCTGGAGCTAGTATTTGCAC
CAGCAGAGGAATGGATATCACGGACTGATT
CTGACATCATAGATGCAACAATGAAAGAACTTGAGAAACTCTTCCCTGAT
GAAATCTCAGCTGACCAAAGCAAAGCTAAA
ATTCTGAAGTACCATGTCGTTAAGACTCCAAGATCTGTGTACAAGACCAT
CCCAAACTGTGAACCATGTCGTCCTCTACA
AAGATCACCTATTGAAGGATTCTACTTAGCTGGAGATTACACAAAACAGA
AGTACTTAGCTTCCATGGAAGGCGCTGTCC
TCTCTGGCAAATTCTGCTCTCAGTCTATTGTTCAGGATTACGAGCTACTG
GCTGCGTCTGGACCAAGAAAGTTGTCGGAG GCAACAGTATCATCATCATGA Nicotiana
tabacum Truncated RD2 promoter (SEQ. ID. No. 13)
aatatgaaaggaaacatattcaatacattgtagtttgctactcataatcg
ctagaatactttgtgccttgctaataaagatacttgaaatagcttagttt
aaatataaatagcataatagattttaggaattagtattttgagtttaatt
acttattgacttgtaacagtttttataattccaaggcccatgaaaaattt
aatgattattagttttaaacttactatataaattttttcatatgtaaaat
ttaatcggtatagttcgatattttttcaatttatttttataaaataaaaa
acttaccctaattatcggtacagttatagatttatataaaaatctacggt
tcttcagaagaaacctaaaaatcggttcggtgcggacggttcgatcggtt
tagtcgattttcaaatattcattgacactcctagttgttgttataggtaa
aaagcagttacagagaggtaaaatataacttaaaaaatcagttctaagga
aaaattgacttttatagtaaatgactgttatataaggatgttgttacaga
gaggtatgagtgtagttggtaaattatgttcttgacggtgtatgtcacat
attatttattaaaactagaaaaaacagcgtcaaaactagcaaaaatccaa
cggacaaaaaaatcggctgaatttgatttggttccaacatttaaaaaagt
ttcagtgagaaagaatcggtgactgttgatgatataaacaaagggcacat
tggtcaataaccataaaaaattatatgacagctacagttggtagcatgtg
ctcagctattgaacaaatctaaagaaggtacatctgtaaccggaacacca
cttaaatgactaaattaccctcatcagaaagcagatggagtgctacaaat
aacacactattcaacaaccataaataaaacgtgttcagctactaaaacaa
atataaataaatctatgtttgtaagcactccagccatgttaatggagtgc
tattgcctgttaactctcacttataaaatagtagtagaaaaaatatgaac caaaacacaac
Nicotiana tabacum Putrescene methyl transferase - 1 promoter (SEQ.
ID. No. 14) gaattcaatggagaaggaaaatatttccagtgtaaacacaagtgaatgaa
gagaagccaaaataatctctatcattcaagccttaggtggagattaaaaa
aattatttactttcttatcaaagtaataggtgatcaacagctttcgtaaa
acgtcattaggagaatattataatctcttttatgctgaagaacccacata
aggaagatcataaaatacatgactttcagatgacttcttggagctttatt
tttaaagagtggctagctggtcagcaaagaggtgctcgtcagatatcata
aaattttactattatttgttttaagagggagatggggcacacatgcttgt
gacaaaagtaagaggaagaaaggagacagaagaggaaatagatttggggg
ggggggggggggtttcacaatcaaagaaaatttttaaaatggagagagaa
atgagcacacacatatactaacaaaattttactaataattgcaccgagac
aaacttatattttagttccaaaatgtcagtctaaccctgcacgttgtaat
gaatttttaactattatattatatcgagttgcgccctccactcctcggtg
tccaaattgtatttaaatgcatagatgtttattgggagtgtacagcaagc
tttcggaaaatacaaaccataatactttctcttcttcaatttgtttagtt taattttgaaa
Nicotiana tabacum GapC Promoter (SEQ. ID. No. 15)
TGCGTCAAATGGATAAACAAAAAAATAGCATAAGTTAGTTTTGTTACTCG
AGAGTTATGTATTATAA
GGTATAGGGAAATGACTCAAACATACCACTGAACTTAACGAAACGACGCA
TATATATACTACTTAACTTAACGAAAAAGG
GGTGAGAGTGGATGGGTGCTGGTAAATAATGAAGGGTTTATATAACGTCA
CGTGTCAAAATTCGATAGTAGTAGTTTCGT
TAGTTGTAATAGCATATATGGCCCAAAGTTATAATATAGATAATATGTTT
ATGTCCAACTATTAACGAGTGACATAGACA
GTTCATTTTGTGAAGTTCAATGACATATTTGAGCCCTTTCCCTTTTATTA
TCTCCTTTTATTTGTTCTAATAAAAGAATG
GCATTTATTATGTACATAGACAAATAACTATTTTCTTTGGAATATAATTT
GTTTATATATTTTAAAATCATGTCTCAATT
TAGTTTGTTTTGTGCATATTTCAACTATTCAATTTTGTCCATATATTTAT
TACCTTCCCCCATTTACAAGCATTGAACCG
CTTTGCTCACCAAAACTTATGCACATTGCAAAAATATCATGTAAAGGTTT
TATGTATGCTGTAATTAAGGTCTGAACTCA
TCGTGATTTTATTTTTAGGCTTCATTGACCACTACCAAACTCTTTGATGC
TACATTTTCTAATTATATTGGAGTTCGATT
ATATCCGAATTCGCGTTGCGTAGGGCCCATTCGAGGGAAAACACTCCCTA
TCAAGGATTTTTTCATACCCAGAGCTCGAA
CTCAAGACATCTGGTTAAGGGAAGAACAGTCTCATCCACTGCACCATATC
CTTTTGTGGTCAACAAGTAAATTTTATGTA
GAACCAAAAACTATACTCGAATTGATAAAATAAATGGTGTAAAATATTGT
TTTCTTTCTTACATTTTGGACAGTAAATAT
GTAGGACAATAATAATTAGCGTGGGGTCTTAAGAAAATTAGCATAGATTT
CCAGAAATTCCAAATCAACCGGCAGTTCCA
GGTTTGAAAACTACAACTCATTCCGACGGTTCAAACTTCAAACCATGCTT
GCTGACTCGGCTTCTTCTTTCTTTTTCACC
AAGACAGAGCAGTAGTCACGTGACACCCCTCACGTGCCTCCCCCCTTTAT
ATTTCAGACTGCAACCCTACACTTTCGCTA
CATTCACTACCATATTCTTTTCACTAAGCAATTTTCTCTCCTACTTTTCT
TTAAACCCCTTTTTTCTCCCCTAAGCCATG GCATCTAGATC Nicotiana tabacum Actin2
Promoter (SEQ. ID. No. 16)
ATCTTATTGTATAAATATCCATAAACACATCATGAAAGACACTTTCTTTC
ACGGTCTGAATTAATTATGATACAATTCTA
ATAGAAAACGAATTAAATTACGTTGAATTGTATGAAATCTAATTGAACAA
GCCAACCACGACGACGACTAACGTTGCCTG
GATTGACTCGGTTTAAGTTAACCACTAAAAAAACGGAGCTGTCATGTAAC
ACGCGGATCGAGCAGGTCACAGTCATGAAG
CCATCAAAGCAAAAGAACTAATCCAAGGGCTGAGATGATTAATTAGTTTA
AAAATTAGTTAACACGAGGGAAAAGGCTGT
CTGACAGCCAGGTCACGTTATCTTTACCTGTGGTCGAAATGATTCGTGTC
TGTCGATTTTAATTATTTTTTTGAAAGGCC
GAAAATAAAGTTGTAAGAGATAAACCCGCCtatataAATTCATATATTTT
CTCTCCGCTTTGAATTGTCTCGTTGTCCTC
CTCACTTTCATCGGCCGTTTTTGAATCTCCGGCGACTTGACAGAGAAGAA
CAAGGAAGAAGACTAAGAGAGAAAGTAAGA
GATAATCCAGGAGATTCATTCTCCGTTTTGAATCTTCCTCAATCTCATCT
TCTTCCGCTCTTTCTTTCCAAGGTAATAGG
AACTTTCTGGATCTACTTTATTTGCTGGATCTCGATCTTGTTTTCTCAAT
TTCCTTGAGATCTGGAATTCGTTTAATTTG
GATCTGTGAACCTCCACTAAATCTTTTGGTTTTACTAGAATCGATCTAAG
TTGACCGATCAGTTAGCTCGATTATAGCTA
CCAGAATTTGGCTTGACCTTGATGGAGAGATCCATGTTCATGTTACCTGG
GAAATGATTTGTATATGTGAATTGAAATCT
GAACTGTTGAAGTTAGATTGAATCTGAACACTGTCAATGTTAGATTGAAT
CTGAACACTGTTTAAGTTAGATGAAGTTTG
TGTATAGATTCTTCGAAACTTTAGGATTTGTAGTGTCGTACGTTGAACAG
AAAGCTATTTCTGATTCAATCAGGGTTTAT
TTGACTGTATTGAACTCTTTTTGTGTGTTTGCAGCTCAT Nicotiana tabacum alcohol
dehydrogenase promoter (SEQ. ID. No. 17)
AAGCTTTTTATTTAGCTTTTTCCTCCCTATTTCAATATATAATGGCTCAA
TTTTTGTCAGATAGCAATAAAACCATACAA
GAAAATAAAACAAATCACAAAATACAAAAAGAGGTTATATCTCCATGTAT
GCAATTTCATTATATGCATATAAGCATCTT
ACGTATAAAAAAAAAGAGGGAATCATGGACGTGTCTTTCTAATCCAAGTA
GGGTCAACTTTATAGGGTCGGTGTATGTGT
AGTTTAATCGAAAAAGAATTCCATCATTAGGTAATTTACAATTAGATCCT
TAAATTATACAAATATATAAGGGTATAAAA
GTTGATCAATATTTCAGGGATATTTTAGTCGTTCAACATTTAGTATAAAT
TATTCGTACTTTTATAATAATAAATAGATA
GATAAACATAGATATAGATATAAATATAGATAGATAAATGGGGGATTTGC
ATCTATACCCACTTTTTGGGTCACGTTTTA
ATTTGTGCCCGCTTTGCAAAAAAAATTGCAAGCGTACACACTTTTTCGCG
TAACTTCAGCATACGGGGCTAAAGTAGCAA
AGACAGTCACGCAAAACTTCAGCATACTTCAGTCTTTGCTACTTCAGCCC
CGTATGCTGAAGTTATGCGAAAAGCGGGTA
TGCTTGTAATTTTTTTGCAAAGCGAGCATAAGTTAAAACGTGACACAAAA
AGCGGGTATAGATACAAATGGCCCTTTTTT
TTCTAGCCAAATTTTATTCATTTTTTTGGAATACTTTTTCACTTTATTTT
AAAATTAGTGTTTGGTTATAAATTTTTAAA
TACAACTTGGAGTTGGACTCCAAAGTCTTTACATACTTATTTTTAGTTTT
ATTACCCTATTTTTTTTAACATGAGATATT
TACTTTTACAGATCTAAAAATGATATTTTCTTAGTTTTAACACTATAAAT
AGCCATGAAGGCCCATTTCCTCCCTTTGCA
AAAAGTATACCCAAACGCAACTCCGTCTTCACCTCCAACTCCAACTTCAT
AATTTCAATTAAAGTGAAAATTATTTTAAG
AGACCATTTGGACATGATAATTTTTTCACTTTTTCCGAACTTTTTTTTAC
TTTTTTTCAAATCAGTGTTTGGCCATAAAA
TTTTCATTTTTCACTTGAAGTTGAATTTTTGAATTTTTCGAGAATTCGAA
AAACCCCAGAAAGCTGTTTTTCAAAATTTT
CACTCGGATCCTCACAAAACTTCCAAAATAACCCAAAATTATATTCATGT
CCAACACAACTCTAATTTTCAAATACCATT
TTCACTTGAAAAAGAAATTCACCTTTTTTTTTTTTTTGAACTTTACAATT
CTTATGTCCAAACGCCCCCTTCGAATCTAC
GGCCAACGTTTATTAAGTAAGGAAAGAAAAATGGCTATAATAATTATATC
CCTTTTGAAGTAAATATAATTCTACCAAAT
TAATTAATATGCTTAAAAACAATAAAAATAATCAAAATTGCTAGAGAGGA
CAACCAATTAGCCGAAGCATTGTCAAGATT
GAGCAGGGCGCAGAATGAAGAAAGTAGTTTTTTATCTTTTGATGCCCTAC
GCCTTTTGTATTAAAATACTATATACAAGA
TTTGAAAAAGACGAGTTCCATTCAAAACAGTTCCCTTGTCCCGAAATGTT
CATTGATGAAGTAATATGCACTTTTAAAAT
TATTTTTTTCCAGTTTATCCTAAAAAAAATATTATTTTTATAATCACATA
GAAATAATATATATCAAATAACAAAGGGAA
AAAGAAAGTAGGGAAAGAAAATAATAATTGAAGTGGGCTGGGCTTTGACA
TGGAAAGGAATGGCTTAGTAATAATTGAAG
TTAGCATCGGATCTATTTGAAGTGCCACTCATCCCTCAGAAAAACAGTGT
TAGTATTTTCTCTCACAAATTGATTCTGTG GTCCGAATTGGAGTTCCTAAATC Arab. thal.
ribosomal protein L2 promoter (RPL2P) (SEQ. ID. No. 18)
TTCGTTGAAAAATCATCGAAATTTTCGACGGATTCCAATGATCAAAAATT
CGTCAATAATTTCCAACGATATTCTGACTA
AACTAAATCTGATGAAATATTTTTGACGGCTTTCCAACCAAAATATTTCG
TTGTGACTTGTCAAAAATCCGTTAGAATAC
TAAGCAACTTTTCGACAGATTTTCAGCAAAAATATTCGGTAATATAACGT
GTTAAAAATATGATAAAAAAAAAAACTTGA
TGAATCTACTAAAACTAAATTTTCAATCATATATATCTATTATTCATATA
TTTCATTCATTTTATTATTTTTCTCTTAAC
AATTATTTAGTTATTCTGGTATCGTGTAATTATATTCATATGATTTATTC
TGATATTGATTCGGTTAGCATCCGGATAAA
TCTGGGTTGGGCTTTTTAACTTGGTTTTTCTAAGAAAAATTCTAATATGA
TTTGGTTAGCATCCGGATTAGTCTAGTTTG
GTAGGCCTGCCTTTGTGATTCTTAACTCGGTCTTTTGTATGGGTTTGAAC
AATTACTACACCATTTAGATTCTTCTGACC
CATATCAAATAAAGATCCACTTAGGCCCATTAGGGTTAGAACAAACATGA
GGTTGCAGAATAAAAAGGGTTCATTTTCCT
CACTCTCAAGTTGGATCTCAAAACCCTAAtatctgaacttcgccgtcgag Arab. thal.
cinnamyl alcohol dehydrogenase promoter (SEQ. ID. No. 19)
ttctgttcgtatatttgtaactattatgtgtatttttattttgttagtat
tactaattcaagtggtttaagttgttgagactctttaaaatctaagcatt
ttataaacaataatatataattattgtttaggctaaatttgtcactaatt
aaggtttggatacatagtgtctaaactaagctaataatatcacttaacgt
ttacttgtaacgctaggtgatgatgtcgtcaagtcaattggtacaaggaa
taaacgagtggtcatatgacattatgaccatatgaattcaaactccagta
atccaatggtaattggattcaatgatcaagacttgaaccacgtaatccac
ccttatccttagaagctcataaatatcactaaagggacaggcaacactta
accagtagttgtccaataatttagttttccaaaatgaaaaattattgttg
tcatctattttaggtgttttagttcaatgtggattcctcgtcctaacaaa
tacttgacgaatatatctagactataaaattggttatgagttctactttt
ttttgtttgtgaaattatcaaaatttgttatatttatttatttattctca
ttaatttgagtactaatttttaaattatttatactaaaaacaattactaa
gatacaaaaatggataagagcatggtgtatagatatttaatgggatagaa
tatttcccataattgtatgtgtgtgagaggttttgttttcgtaaggaaag
aaacaaaaaccatttgaccaaagaaaagcaaaagaaggcaaggaatcaaa
caacaaatgttgcaaggcagaaataatggacgttatgttaatgtagtgtc
gtcacacgtgacttaaaagagacgagtctgcgtgtcaaactaaaaatgta
tgcaactataaaaatgggatttgattatctttttagtaccgaagcctacc
aaccacatgcacactaattctactcgccaaataaagtgaaaagag Arab. thal.
Metallothionein I promoter (SEQ. ID. No. 20)
aagtaacttttagaattgattcaatctttttagaatagattttttttttt
tttttttttggatttcgctgaggttttaccattttgttactcagcatatt
ttaacgatgttgcatttgtgtcccatatacgttattgttagtgaaaaata
taatgtaagaataatttatataactatcctactagcaaagctaacgcaaa
ttttgaactcgaactttagttaccgtgaatgaaaataacagacttgaact
ttataatactcgtagtatacgtaatttttgctttttgcagatatgcttgc
cactaataaagtcataaattttatattttcataaactatagttatacact
tttgactaaacaaacaaaatcggtttagcaaaagaaaaagttacttttct
gatgaactaggataaggaattcggaactgaattttgctacgttctctctg
gaccacacacactgaacacccttttaagattttctccttctctttttcaa
cgtaatttatcttttgatcagaaacgacaaaaaagaagtctaacaatatc
aaacaatttttttatagatatttttagatatttttcctgctaattttatc
tagtgtagacaaacccaaatatacgattattataaaaacacgaaatacca
agtggacgactgaggttaatagatctagccgtagaataaagatctgcatg
aaaggcggtgagaatctaaacggtgataagaccataacacacggaacatc
ggtacgctctcgaacgtacaagaatcgacgacacacaaacactccacaat
tatttgaacactggacaattattgaaccgacgtacgagaatcaatgcgct
gagggtaaagacgtaaatgaagaactagttttggagataagagcggagaa
agattgcgacacatgtatggtcaatattaatctcatttagcttataaatt
tgggagcttcctctatcattaattttcattcataaatttttcttcaattt
gaattttctcgagaaaa Arab. Thal. Gad2 Terminator (SEQ. ID. No. 21)
gcaagtgtgttgcctttgtgtgGaAATGAAGAGGTACTTGCGAGGACTTT
GCGTTTATCAGTTTATGTGTTTGTATATCT
ATTTGATCCAGTTATTATGGATTATATACGCTTGAAACTCATTTTAAGCC
ATTGTTATTGAACGTTTATCAAATACTTTA
TTATGCCAAGCAAGTCAAACACATGCTTGTTGATTGAAATCAAGCTATAG
AAATCTCTTCTTCACATACAGCAGTTTAGA TTCACAATACAACAAGCGAAACGATAAAGTTTC
Arab. Thal. Fad2 Intron (SEQ. ID. No. 22)
gtccgtcgcttctcttccatttcttctcattttcgattttgattcttatt
tctttccagtagctcctgctctgtgaatttctccgctcacgatagatctg
cttatactccttacattcaaccttagatctggtctcg
attctctgtttctctgtttttttcttttggtcgagaatctgatgtttgtt
tatgttctgtcaccattaataataatgaactctctcattcatacaatgat
tagtttctctcgtctacaaaacgatatgttgcattttcacttttcttctt
tttttctaagatgatttgctttgaccaatttgtttagatctttattttat
tttattttctggtgggttggtggaaattgaaaaaaaaaaaaacagcataa
attgttatttgttaatgtattcattttttggctatttgttctgggtaaaa
atctgcttctactattgaatctttcctggattttttactcctattgggtt
tttatagtaaaaatacataataaaaggaaaacaaaagttttatagattct
cttaaaccccttacgataaaagttggaatcaaaataattcaggatcagat
gctctttgattgattcagatgcgattacagttgcatggcaaattttctag
atccgtcgtcacattttattttctgtttaaatatctaaatctgatatatg
atgtcgacaaattctggtggcttatacatcacttcaactgttttcttttg
gctttgtttgtcaacttggttttcaatacgatttgtgatttcgatcgctg
aatttttaatacaagcaaactgatgttaaccacaagcaagagatgtgacc
tgccttattaacatcgtattacttactactagtcgtattctcaacgcaat
cgtttttgtatttctcacattatgccgcttctctactctttattcctttt
ggtccacgcattttctatttgtggcaatccctttcacaacctgatttccc
actttggatcatttgtctgaagactctcttgaatcgttaccacttgtttc
ttgtgcatgctctgttttttagaattaatgataaaactattccatagtct
tgagttttcagcttgttgattcttttgcttttggttttctgcag QPTase (full-length)
inhibition cassette (SEQ. ID. No. 23)
ctcgaggatctaaattgtgagttcaatctcttccctattggattgattat
cctttcttttcttccaatttgtgtttctttttgcctaatttattgtgtta
tcccctttatcctattttgtttctttacttatttatttgcttctatgtct
ttgtacaaagatttaaactctatggcacatattttaaagttgttagaaaa
taaattctttcaagattgatgaaagaactttttaattgtagatatttcgt
agattttattctcttactaccaatataacgcttgaattgacgaaaatttg
tgtccaaatatctagcaaaaaggtatccaatgaaaatatatcatatgtga
tcttcaaatcttgtgtcttatgcaagattgatactttgttcaatggaaga
gattgtgtgcatatttttaaaatttttattagtaataaagattctatata
gctgttatagagggataattttacaaagaacactataaatatgattgttg
ttgttagggtgtcaatggttcggttcgactggttattttataaaatttgt
accataccatttttttcgatattctattttgtataaccaaaattagactt
ttcgaaatcgtcccaatcatgtcggtttcacttcggtatcggtaccgttc
ggttaattttcatttttttttaaatgtcattaaaattcactagtaaaaat
agaatgcaataacatacgttcttttataggacttagcaaaagctctctag
acatttttactgtttaaaggataatgaattaaaaaacatgaaagatggct
agagtatagatacacaactattcgacagcaacgtaaaagaaaccaagtaa
aagcaaagaaaatataaatcacacgagtggaaagatattaaccaagttgg
gattcaagaataaagtctatattaaatattcaaaaagataaatttaaata
atatgaaaggaaacatattcaatacattgtagtttgctactcataatcgc
tagaatactttgtgccttgctaataaagatacttgaaatagcttagttta
aatataaatagcataatagattttaggaattagtattttgagtttaatta
cttattgacttgtaacagtttttataattccaaggcccatgaaaaattta
atgctttattagttttaaacttactatataaatttttcatatgtaaaatt
taatcggtatagttcgatattttttcaatttatttttataaaataaaaaa
cttaccctaattatcggtacagttatagatttatataaaaatctacggtt
cttcagaagaaacctaaaaatcggttcggtgcggacggttcgatcggttt
agtcgattttcaaatattcattgacactcctagttgttgttataggtaaa
aagcagttacagagaggtaaaatataacttaaaaaatcagttctaaggaa
aaattgacttttatagtaaatgactgttatataaggatgttgttacagag
aggtatgagtgtagttggtaaattatgttcttgacggtgtatgtcacata
ttatttattaaaactagaaaaaacagcgtcaaaactagcaaaaatccaac
ggacaaaaaaatcggctgaatttgatttggttccaacatttaaaaaagtt
tcagtgagaaagaatcggtgactgttgatgatataaacaaagggcacatt
ggtcaataaccataaaaaattatatgacagctacagttggtagcatgtgc
tcagctattgaacaaatctaaagaaggtacatctgtaaccggaacaccac
ttaaatgactaaattaccctcatcagaaagcagatggagtgctacaaata
acacactattcaacaaccataaataaaacgtgttcagctactaaaacaaa
tataaataaatctatgtttgtaagcactccagccatgttaatggagtgct
attgcctgttaactctcacttataaaatagtagtagaaaaaatatgaacc
aaaacacaacAACATCTCAAAATATTTGAAGTAACACAGAATTTTACATA
CACCAAACTTATAAATCAAGTATTTTCATT
GTAACAAATTCCATGAAACATGAAAACAAAGCTATAATGAAATTACCAAC
TCAAGCAATAAGGTTGGAAAAGAGCCATCT
GAGATATTCCAGCAATTTACATCTTTTTGTTTGATTACACAGTGAAGGAT
CTTTTGTTTGACAACTAGTAAAATGATTCT
TATTTGCACCTTTCAGCTATTCAGCTGCTTTTACTCCAACCCTATAGCAG
AAGTAATGGCGCTCATGCTCGTTTTGTACG
CCTTCCAACTTCAAGGGCGAGCTCTGTATCGATCTTCAGGGAAATGTCAA
GTGCTTTCACGGAATGCGTCAGGGCACCAC
TAGAAATGTAGGTAACACCAGTTTGTCCAATCTTGTGTACTGTTTCAAGG
GTAACATTTCCTGAAGCCTCCGTATCAAAC
CTCCCATTGATCAATTCTACAGCCTCCTTAAGCATGGATACATCAATATC
TCCGTTAGATAATGGAACAACCATATTGTC
CAGCATTATCCTAGTCAACGAAGTCTTTGTTTGAGATGCATAGTCTAGAA
CCTCACGTACTTCTTCAATTGTCCTGGTTT
CAACCTCAACCCCTATTTGAAGTTTATTTTGCTCCAAATACTGATCCACA
GATTTTAGAGCTTTGCCGACACCTCCAGCA
GCAGATATGTGATTGTCTTTTATCATTACCATATCAAATAAGCCCATTCT
GTGATTCTTCCCCCCACCGATCAATACCGC
CCATTTATCCACCAAACGTAATCCAGGAGCAGTTTTCCTAGTCTCCAAGA
TGTAAGCAGGGTGTGCAGCATCTGCCATTT
CCTTAGTTAGTGTAGCTATTCCACTCATTCTTTGCATAAAATTGAGAACA
ACCCTCTCAGCTATAACAATGTTGTAAGCG
TTTCCTTGTACTTTGCCAAATTTCAAGCCTTTATGAACTTTATCGCCATC
ATTTACATACCACTCCACCTTTAATGAAGG
ATCAACTTCCGCGAATATCATCTCAGCAAGTGCAATTCCTGCTATGATCC
CGTCTTCCTTTGCTAGAAAATGAGCATCGG
ATTCCATATCAAGAGGAATTGTCGCCTTACAAGTCACATCTCCTAAATTC
CCAGCATCTTCAGAGAGTGCAAGTTTCATA
ACTTCCTTTAAATCATAAGTTGGGTGTGCTGGTGGTTTCACCTCTAATGA
CTCCACTCTTGTATTCTTGGTGGCTATTGC
TGACATTTTCACCACCAACCTTGGAGCTGTAATTGCATAAGGATGCACTG
TAGCAGTGAAAGGAATAGCTCTAAACATGG
TTTTTTTTTGGGGGGGTTGTGAAATGAATTTTGTGGAAAATAGTTTTTGg
ggcacatcaatcctgcggtgacattcggaa
tgtttctaacaagaaagatatcgttggtccgagccttgctctacatcATA
GCTCAGTGCATAGGGGCcctgtgcgggtgc
gccttagtcaagacattgcagcgagatcattacaaccactatggcggtgg
cgctaaccagctcgttgatggttatagccgaggcactggccttgctgttg
agattatgggcacctttattcttctgtatactgtcttctccgccactgat
cccaaacgcaatgctagagattcccatgttcctgtcttggctccactccc
cattggctttgctgtcttcattgttcacctcgccaccattcccgtcaccg
gcactggcatcaacccagcgagCAAAAACTATTTTCCACAAAATTCATTT
CACAACCCCCCCAAAAAAAA
ACCATGTTTAGAGCTATTCCTTTCACTGCTACAGTGCATCCTTATGCAAT
TACAGCTCCAAGGTTGGTGGTGAAAATGTC
AGCAATAGCCACCAAGAATACAAGAGTGGAGTCATTAGAGGTGAAACCAC
CAGCACACCCAACTTATGATTTAAAGGAAG
TTATGAAACTTGCACTCTCTGAAGATGCTGGGAATTTAGGAGATGTGACT
TGTAAGGCGACAATTCCTCTTGATATGGAA
TCCGATGCTCATTTTCTAGCAAAGGAAGACGGGATCATAGCAGGAATTGC
ACTTGCTGAGATGATATTCGCGGAAGTTGA
TCCTTCATTAAAGGTGGAGTGGTATGTAAATGATGGCGATAAAGTTCATA
AAGGCTTGAAATTTGGCAAAGTACAAGGAA
ACGCTTACAACATTGTTATAGCTGAGAGGGTTGTTCTCAATTTTATGCAA
AGAATGAGTGGAATAGCTACACTAACTAAG
GAAATGGCAGATGCTGCACACCCTGCTTACATCTTGGAGACTAGGAAAAC
TGCTCCTGGATTACGTTTGGTGGATAAATG
GGCGGTATTGATCGGTGGGGGGAAGAATCACAGAATGGGCTTATTTGATA
TGGTAATGATAAAAGACAATCACATATCTG
CTGCTGGAGGTGTCGGCAAAGCTCTAAAATCTGTGGATCAGTATTTGGAG
CAAAATAAACTTCAAATAGGGGTTGAGGTT
GAAACCAGGACAATTGAAGAAGTACGTGAGGTTCTAGACTATGCATCTCA
AACAAAGACTTCGTTGACTAGGATAATGCT
GGACAATATGGTTGTTCCATTATCTAACGGAGATATTGATGTATCCATGC
TTAAGGAGGCTGTAGAATTGATCAATGGGA
GGTTTGATACGGAGGCTTCAGGAAATGTTACCCTTGAAACAGTACACAAG
ATTGGACAAACTGGTGTTACCTACATTTCT
AGTGGTGCCCTGACGCATTCCGTGAAAGCACTTGACATTTCCCTGAAGAT
CGATACAGAGCTCGCCCTTGAAGTTGGAAG
GCGTACAAAACGAGCATGAGCGCCATTACTTCTGCTATAGGGTTGGAGTA
AAAGCAGCTGAATAGCTGAAAGGTGCAAAT
AAGAATCATTTTACTAGTTGTCAAACAAAAGATCCTTCACTGTGTAATCA
AACAAAAAGATGTAAATTGCTGGAATATCT
CAGATGGCTCTTTTCCAACCTTATTGCTTGAGTTGGTAATTTCATTATAG
CTTTGTTTTCATGTTTCATGGAATTTGTTA
CAATGAAAATACTTGATTTATAAGTTTGGTGTATGTAAAATTCTGTGTTA
CTTCAAATATTTTGAGATGTTgagctcgtg
aaatggcctctttagtttttgattgaatcataggggtattagttttctat
ggccgggagtggtcttcttgcttaattgtaatggaataaccagagaggaa
ctactgtgttatctttgaggaatgttgggcttttttcgtttgaattatca
tgaatgaaattttactttttcccaatacaagtttgttttcgtttcttggt
ttttgttatcccttggtttatgtcttggtttggcttaaatgattgaagat
tacactacctatgtttctgctattcctgttgaagatcacatttgataata
atgcatcgaatgcattaaagtttcttattggctctgtcaaaagtattgaa
ggtggatttttctaattggcaagagaaagtattaaagaggtgatttatta
gtacttatatttttctcagcatctctctttcagtgttggagcttcataaa
attagcacttcagagtttcagtcgggagctgaattcga bp1-2010: RD2 promoter
bp2011-3409: antisense QPTase full-length cDNA bp3410-3792:
cucumber aquaporin partial sequence bp3793-5191: sense QPTase
full-lenght cDNA bp5192-5688: GapC terminator Qptase (fragment)
inhibition cassette (SEQ. ID. No. 24)
ctcgaggatctaaattgtgagttcaatctcttccctattggattgattat
cctttcttttcttccaatttgtgtttctttttgcctaatttattgtgtta
tcccctttatcctattttgtttctttacttatttatttgcttctatgtct
ttgtacaaagatttaaactctatggcacatattttaaagttgttagaaaa
taaattctttcaagattgatgaaagaactttttaattgtagatatttcgt
agattttattctcttactaccaatataacgcttgaattgacgaaaatttg
tgtccaaatatctagcaaaaaggtatccaatgaaaatatatcatatgtga
tcttcaaatcttgtgtcttatgcaagattgatactttgttcaatggaaga
gattgtgtgcatatttttaaaatttttattagtaataaagattctatata
gctgttatagagggataattttacaaagaacactataaatatgattgttg
ttgttagggtgtcaatggttcggttcgactggttattttataaaatttgt
accataccatttttttcgatattctattttgtataaccaaaattagactt
ttcgaaatcgtcccaatcatgtcggtttcacttcggtatcggtaccgttc
ggttaattttcatttttttttaaatgtcattaaaattcactagtaaaaat
agaatgcaataacatacgttcttttataggacttagcaaaagctctctag
acatttttactgtttaaaggataatgaattaaaaaacatgaaagatggct
agagtatagatacacaactattcgacagcaacgtaaaagaaaccaagtaa
aagcaaagaaaatataaatcacacgagtggaaagatattaaccaagttgg
gattcaagaataaagtctatattaaatattcaaaaagataaatttaaata
atatgaaaggaaacatattcaatacattgtagtttgctactcataatcgc
tagaatactttgtgccttgctaataaagatacttgaaatagcttagttta
aatataaatagcataatagattttaggaattagtattttgagtttaatta
cttattgacttgtaacagtttttataattccaaggcccatgaaaaattta
atgctttattagttttaaacttactatataaatttttcatatgtaaaatt
taatcggtatagttcgatattttttcaatttatttttataaaataaaaaa
cttaccctaattatcggtacagttatagatttatataaaaatctacggtt
cttcagaagaaacctaaaaatcggttcggtgcggacggttcgatcggttt
agtcgattttcaaatattcattgacactcctagttgttgttataggtaaa
aagcagttacagagaggtaaaatataacttaaaaaatcagttctaaggaa
aaattgacttttatagtaaatgactgttatataaggatgttgttacagag
aggtatgagtgtagttggtaaattatgttcttgacggtgtatgtcacata
ttatttattaaaactagaaaaaacagcgtcaaaactagcaaaaatccaac
ggacaaaaaaatcggctgaatttgatttggttccaacatttaaaaaagtt
tcagtgagaaagaatcggtgactgttgatgatataaacaaagggcacatt
ggtcaataaccataaaaaattatatgacagctacagttggtagcatgtgc
tcagctattgaacaaatctaaagaaggtacatctgtaaccggaacaccac
ttaaatgactaaattaccctcatcagaaagcagatggagtgctacaaata
acacactattcaacaaccataaataaaacgtgttcagctactaaaacaaa
tataaataaatctatgtttgtaagcactccagccatgttaatggagtgct
attgcctgttaactctcacttataaaatagtagtagaaaaaatatgaacc
aaaacacaacTTTATCGCCATCATTTACATACCACTCCACCTTTAATGAA
GGATCAACTTCCGCGAATATCATCTCAGCA
AGTGCAATTCCTGCTATGATCCCGTCTTCCTTTGCTAGAAAATGAGCATC
GGATTCCATATCAAGAGGAATTGTCGCCTT
ACAAGTCACATCTCCTAAATTCCCAGCATCTTCAGAGAGTGCAAGTTTCA
TAACTTCCTTTAAATCATAAGTTGGGTGTG
CTGGTGGTTTCACCTCTAATGACTCCACTCTTGTATTCTTGGTGGCTATT
GCTGACATTTTCACCACCAACCTTGGAGCT
GTAATTGCATAAGGATGCACTGTAGCAGTGAAAGGAATAGCTCTAAACAT
gtccgtcgcttctcttccatttcttctcat
tttcgattttgattcttatttctttccagtagctcctgctctgtgaattt
ctccgctcacgatagatctgcttatactccttacattcaaccttagatct
ggtctcgattctctgtttctctgtttttttcttttggtcgagaatctgat
gtttgtttatgttctgtcaccattaataataatgaactctctcattcata
caatgattagtttctctcgtctacaaaacgatatgttgcattttcacttt
tcttctttttttctaagatgatttgctttgaccaatttgtttagatcttt
attttattttattttctggtgggttggtggaaattgaaaaaaaaaaaaac
agcataaattgttatttgttaatgtattcattttttggctatttgttctg
ggtaaaaatctgcttctactattgaatctttcctggattttttactccta
ttgggtttttatagtaaaaatacataataaaaggaaaacaaaagttttat
agattctcttaaaccccttacgataaaagttggaatcaaaataattcagg
atcagatgctctttgattgattcagatgcgattacagttgcatggcaaat
tttctagatccgtcgtcacattttattttctgtttaaatatctaaatctg
atatatgatgtcgacaaattctggtggcttatacatcacttcaactgttt
tcttttggctttgtttgtcaacttggttttcaatacgatttgtgatttcg
atcgctgaatttttaatacaagcaaactgatgttaaccacaagcaagaga
tgtgacctgccttattaacatcgtattacttactactagtcgtattctca
acgcaatcgtttttgtatttctcacattatgccgcttctctactctttat
tccttttggtccacgcattttctatttgtggcaatccctttcacaacctg
atttcccactttggatcatttgtctgaagactctcttgaatcgttaccac
ttgtttcttgtgcatgctctgttttttagaattaatgataaaactattcc
atagtcttgagttttcagcttgttgattcttttgcttttggttttctgca
gATGTTTAGAGCTATTCCTT
TCACTGCTACAGTGCATCCTTATGCAATTACAGCTCCAAGGTTGGTGGTG
AAAATGTCAGCAATAGCCACCAAGAATACA
AGAGTGGAGTCATTAGAGGTGAAACCACCAGCACACCCAACTTATGATTT
AAAGGAAGTTATGAAACTTGCACTCTCTGA
AGATGCTGGGAATTTAGGAGATGTGACTTGTAAGGCGACAATTCCTCTTG
ATATGGAATCCGATGCTCATTTTCTAGCAA
AGGAAGACGGGATCATAGCAGGAATTGCACTTGCTGAGATGATATTCGCG
GAAGTTGATCCTTCATTAAAGGTGGAGTGG
TATGTAAATGATGGCGATAAAgcaagtgtgttgcctttgtgtggaaatga
agaggtacttgcgaggactttgcgtttatc
agtttatgtgtttgtatatctatttgatccagttattatggattatatac
gcttgaaactcattttaagccattgttattgaacgtttatcaaatacttt
attatgccaagcaagtcaaacacatgcttgttgattgaaatcaagctata
gaaatctcttcttcacatacagcagtttagattcacaatacaacaagcga aacgataaagtttc
bp 1-2010: RD2P bp 2011-2370: AS QPTase-IRA bp 2371-3501: Fad2
intron bp 3502-3861: SN QPTase-IRA bp 3862-4134: Gad2T PMTase
(fragment) inhibiton cassette (SEQ. ID. No. 25)
ctcgaggatctaaattgtgagttcaatctcttccctattggattgattat
cctttcttttcttccaatttgtgtttctttttgcctaatttattgtgtta
tcccctttatcctattttgtttctttacttatttatttgcttctatgtct
ttgtacaaagatttaaactctatggcacatattttaaagttgttagaaaa
taaattctttcaagattgatgaaagaactttttaattgtagatatttcgt
agattttattctcttactaccaatataacgcttgaattgacgaaaatttg
tgtccaaatatctagcaaaaaggtatccaatgaaaatatatcatatgtga
tcttcaaatcttgtgtcttatgcaagattgatactttgttcaatggaaga
gattgtgtgcatatttttaaaatttttattagtaataaagattctatata
gctgttatagagggataattttacaaagaacactataaatatgattgttg
ttgttagggtgtcaatggttcggttcgactggttattttataaaatttgt
accataccatttttttcgatattctattttgtataaccaaaattagactt
ttcgaaatcgtcccaatcatgtcggtttcacttcggtatcggtaccgttc
ggttaattttcatttttttttaaatgtcattaaaattcactagtaaaaat
agaatgcaataacatacgttcttttataggacttagcaaaagctctctag
acatttttactgtttaaaggataatgaattaaaaaacatgaaagatggct
agagtatagatacacaactattcgacagcaacgtaaaagaaaccaagtaa
aagcaaagaaaatataaatcacacgagtggaaagatattaaccaagttgg
gattcaagaataaagtctatattaaatattcaaaaagataaatttaaata
atatgaaaggaaacatattcaatacattgtagtttgctactcataatcgc
tagaatactttgtgccttgctaataaagatacttgaaatagcttagttta
aatataaatagcataatagattttaggaattagtattttgagtttaatta
cttattgacttgtaacagtttttataattccaaggcccatgaaaaattta
atgctttattagttttaaacttactatataaatttttcatatgtaaaatt
taatcggtatagttcgatattttttcaatttatttttataaaataaaaaa
cttaccctaattatcggtacagttatagatttatataaaaatctacggtt
cttcagaagaaacctaaaaatcggttcggtgcggacggttcgatcggttt
agtcgattttcaaatattcattgacactcctagttgttgttataggtaaa
aagcagttacagagaggtaaaatataacttaaaaaatcagttctaaggaa
aaattgacttttatagtaaatgactgttatataaggatgttgttacagag
aggtatgagtgtagttggtaaattatgttcttgacggtgtatgtcacata
ttatttattaaaactagaaaaaacagcgtcaaaactagcaaaaatccaac
ggacaaaaaaatcggctgaatttgatttggttccaacatttaaaaaagtt
tcagtgagaaagaatcggtgactgttgatgatataaacaaagggcacatt
ggtcaataaccataaaaaattatatgacagctacagttggtagcatgtgc
tcagctattgaacaaatctaaagaaggtacatctgtaaccggaacaccac
ttaaatgactaaattaccctcatcagaaagcagatggagtgctacaaata
acacactattcaacaaccataaataaaacgtgttcagctactaaaacaaa
tataaataaatctatgtttgtaagcactccagccatgttaatggagtgct
attgcctgttaactctcacttataaaatagtagtagaaaaaatatgaacc
aaaacacaacCGATTCAAAACTTCAGCAGGAAAATTTATATTAAAGTACG
AAACACCACAGAGAAAGAATTTTACAATGA
TTGTGAATTGGAAATTATGATAATTACTGCAGAATTCTCCTACAATACGT
CGCATTTCACTTATTTATTCACTTGATTAA
GACTCGATCTTGGTCCAATGATTGTACTACCAGTGTTCATTATTCACTTG
ATTAAGACTCGATCATACTTCTGGCGAAAG
ATGGTAAAATGgtccgtcgcttctcttccatttcttctcattttcgattt
tgattcttatttctttccagtagctcctgctctgtgaatttctccgctca
cgatagatctgcttatactccttacattcaaccttagatctggtctcgat
tctctgtttctctgtttttttcttttggtcgagaatctgatgtttgttta
tgttctgtcaccattaataataatgaactctctcattcatacaatgatta
gtttctctcgtctacaaaacgatatgttgcattttcacttttcttctttt
tttctaagatgatttgctttgaccaatttgtttagatctttattttattt
tattttctggtgggttggtggaaattgaaaaaaaaaaaaacagcataaat
tgttatttgttaatgtattcattttttggctatttgttctgggtaaaaat
ctgcttctactattgaatctttcctggattttttactcctattgggtttt
tatagtaaaaatacataataaaaggaaaacaaaagttttatagattctct
taaaccccttacgataaaagttggaatcaaaataattcaggatcagatgc
tctttgattgattcagatgcgattacagttgcatggcaaattttctagat
ccgtcgtcacattttattttctgtttaaatatctaaatctgatatatgat
gtcgacaaattctggtggcttatacatcacttcaactgttttcttttggc
tttgtttgtcaacttggttttcaatacgatttgtgatttcgatcgctgaa
tttttaatacaagcaaactgatgttaaccacaagcaagagatgtgacctg
ccttattaacatcgtattacttactactagtcgtattctcaacgcaatcg
tttttgtatttctcacattatgccgcttctctactctttattccttttgg
tccacgcattttctatttgtggcaatccctttcacaacctgatttcccac
tttggatcatttgtctgaagactctcttgaatcgttaccacttgtttctt
gtgcatgctctgttttttagaattaatgataaaactattccatagtcttg
agttttcagcttgttgattcttttgcttttggttttctgcagCATTTTAC
CATCTTTCGCCAGAAGTATGATCGAGTCTTAATCAAGTGAATAATGAACA
CTGGTAGTACAATCATTGGACCAAGATCGAGTCTTAATCAAGTGAATAAA
TAAGTGAAATGCGACGTATTGTAGGAGAAT
TCTGCAGTAATTATCATAATTTCCAATTCACAATCATTGTAAAATTCTTT
CTCTGTGGTGTTTCGTACTTTAATATAAAT
TTTCCTGCTGAAGTTTTGAATCGgcaagtgtgttgcctttgtgtggaaat
gaagaggtacttgcgaggactttgcgttta
tcagtttatgtgtttgtatatctatttgatccagttattatggattatat
acgcttgaaactcattttaagccattgttattgaacgtttatcaaatact
ttattatgccaagcaagtcaaacacatgcttgttgattgaaatcaagcta
tagaaatctcttcttcacatacagcagtttagattcacaatacaacaagc gaaacgataaagtttc
bp 1-2010: RD2 promoter bp 2011-2251: AS PMT arm bp 2252-3382: Fad2
intron bp 3383-3623: SN PMT arm bp 3624-3896: Gad2 terminator A622
(fragment) inhibition Cassette (SEQ. ID. No. 26)
ctcgaggatctaaattgtgagttcaatctcttccctattggattgattat
cctttcttttcttccaatttgtgtttctttttgcctaatttattgtgtta
tcccctttatcctattttgtttctttacttatttatttgcttctatgtct
ttgtacaaagatttaaactctatggcacatattttaaagttgttagaaaa
taaattctttcaagattgatgaaagaactttttaattgtagatatttcgt
agattttattctcttactaccaatataacgcttgaattgacgaaaatttg
tgtccaaatatctagcaaaaaggtatccaatgaaaatatatcatatgtga
tcttcaaatcttgtgtcttatgcaagattgatactttgttcaatggaaga
gattgtgtgcatatttttaaaatttttattagtaataaagattctatata
gctgttatagagggataattttacaaagaacactataaatatgattgttg
ttgttagggtgtcaatggttcggttcgactggttattttataaaatttgt
accataccatttttttcgatattctattttgtataaccaaaattagactt
ttcgaaatcgtcccaatcatgtcggtttcacttcggtatcggtaccgttc
ggttaattttcatttttttttaaatgtcattaaaattcactagtaaaaat
agaatgcaataacatacgttcttttataggacttagcaaaagctctctag
acatttttactgtttaaaggataatgaattaaaaaacatgaaagatggct
agagtatagatacacaactattcgacagcaacgtaaaagaaaccaagtaa
aagcaaagaaaatataaatcacacgagtggaaagatattaaccaagttgg
gattcaagaataaagtctatattaaatattcaaaaagataaatttaaata
atatgaaaggaaacatattcaatacattgtagtttgctactcataatcgc
tagaatactttgtgccttgctaataaagatacttgaaatagcttagttta
aatataaatagcataatagattttaggaattagtattttgagtttaatta
cttattgacttgtaacagtttttataattccaaggcccatgaaaaattta
atgctttattagttttaaacttactatataaatttttcatatgtaaaatt
taatcggtatagttcgatattttttcaatttatttttataaaataaaaaa
cttaccctaattatcggtacagttatagatttatataaaaatctacggtt
cttcagaagaaacctaaaaatcggttcggtgcggacggttcgatcggttt
agtcgattttcaaatattcattgacactcctagttgttgttataggtaaa
aagcagttacagagaggtaaaatataacttaaaaaatcagttctaaggaa
aaattgacttttatagtaaatgactgttatataaggatgttgttacagag
aggtatgagtgtagttggtaaattatgttcttgacggtgtatgtcacata
ttatttattaaaactagaaaaaacagcgtcaaaactagcaaaaatccaac
ggacaaaaaaatcggctgaatttgatttggttccaacatttaaaaaagtt
tcagtgagaaagaatcggtgactgttgatgatataaacaaagggcacatt
ggtcaataaccataaaaaattatatgacagctacagttggtagcatgtgc
tcagctattgaacaaatctaaagaaggtacatctgtaaccggaacaccac
ttaaatgactaaattaccctcatcagaaagcagatggagtgctacaaata
acacactattcaacaaccataaataaaacgtgttcagctactaaaacaaa
tataaataaatctatgtttgtaagcactccagccatgttaatggagtgct
attgcctgttaactctcacttataaaatagtagtagaaaaaatatgaacc
aaaacacaacGGTTGTGTATTTCACTTTTGGATATAGCTCAGTGGCTTCG
ACACCTGTAGGAGGCTGAACCTCAAAGTTT
GCAGAATCTCCATTAACAAAAACTGAATGGCATATGGCCAAATTAGTCCT
TAATGGCAGAGGTCCCTCTTGTACAATCTG
GAGAATATCTTCCTCTGATAGATATAACTTCTCGAGGGTCTTCCCAATTT
TGTCCTCCCACAAGGACACTATCTCGTTGA
AGGATAGAATATTGGCAGGTGGTCTCATGTGAAGAGTCTTATTCAATGTC
CGTGGATCATCTACTGCTTCGATAGTGTAT
GTCGCTATGTCTTCTTCCTTCACATATATTGCTTTGGGATTTCCATCGCC
AAAAATGACAACTTTGTCTCTAGGAGGGGT
TTTGGCCTCTAACTGCCCCAAGTTGGGCAAGAAGAAATCTGCAAACCAAT
TGCAGATTACATATGTGTATGGAATTCCTT
CTGCCTCTATCATCCTCCTGATTCTTACCTTTAGAGCGAAGAGTGATGCA
GCTGGTTCAATTGCACGAGCATGATCCACA
TCAAATCCAAATTCTGAAGGAAGAAATCTCTTGATATTTCCAGCTTCTTT
AATTGCTTTGATGATGTTCACTTGATCAgt
ccgtcgcttctcttccatttcttctcattttcgattttgattcttatttc
tttccagtagctcctgctctgtgaatttctccgctcacgatagatctgct
tatactccttacattcaaccttagatctggtctcgattctctgtttctct
gtttttttcttttggtcgagaatctgatgtttgtttatgttctgtcacca
ttaataataatgaactctctcattcatacaatgattagtttctctcgtct
acaaaacgatatgttgcattttcacttttcttctttttttctaagatgat
ttgctttgaccaatttgtttagatctttattttattttattttctggtgg
gttggtggaaattgaaaaaaaaaaaaacagcataaattgttatttgttaa
tgtattcattttttggctatttgttctgggtaaaaatctgcttctactat
tgaatctttcctggattttttactcctattgggtttttatagtaaaaata
cataataaaaggaaaacaaaagttttatagattctcttaaaccccttacg
ataaaagttggaatcaaaataattcaggatcagatgctctttgattgatt
cagatgcgattacagttgcatggcaaattttctagatccgtcgtcacatt
ttattttctgtttaaatatctaaatctgatatatgatgtcgacaaattct
ggtggcttatacatcacttcaactgttttcttttggctttgtttgtcaac
ttggttttcaatacgatttgtgatttcgatcgctgaatttttaatacaag
caaactgatgttaaccacaagcaagagatgtgacctgccttattaacatc
gtattacttactactagtcgtattctcaacgcaatcgtttttgtatttct
cacattatgccgcttctctactctttattccttttggtccacgcattttc
tatttgtggcaatccctttcacaacctgatttcccactttggatcatttg
tctgaagactctcttgaatcgttaccacttgtttcttgtgcatgctctgt
tttttagaattaatgataaaactattccatagtcttgagttttcagcttg
ttgattcttttgcttttggttttctgcagTGATCAAGTGAACATCATCAA
AGCAATTAAAGAAGCTGGAAATATCAAGAGATTTCTTCCTTCAGAATTTG
GATTTGATGTGGATCATGCTCGTGCAATTGAACCAGCTGCATCACTCTTC
GCTCTAAAGGTAAGAATCAGGAGGATGATA
GAGGCAGAAGGAATTCCATACACATATGTAATCTGCAATTGGTTTGCAGA
TTTCTTCTTGCCCAACTTGGGGCAGTTAGA
GGCCAAAACCCCTCCTAGAGACAAAGTTGTCATTTTTGGCGATGGAAATC
CCAAAGCAATATATGTGAAGGAAGAAGACA
TAGCGACATACACTATCGAAGCAGTAGATGATCCACGGACATTGAATAAG
ACTCTTCACATGAGACCACCTGCCAATATT
CTATCCTTCAACGAGATAGTGTCCTTGTGGGAGGACAAAATTGGGAAGAC
CCTCGAGAAGTTATATCTATCAGAGGAAGA
TATTCTCCAGATTGTACAAGAGGGACCTCTGCCATTAAGGACTAATTTGG
CCATATGCCATTCAGTTTTTGTTAATGGAG
ATTCTGCAAACTTTGAGGTTCAGCCTCCTACAGGTGTCGAAGCCACTGAG
CTATATCCAAAAGTGAAATACACAACCgca
agtgtgttgcctttgtgtggaaatgaagaggtacttgcgaggactttgcg
tttatcagtttatgtgtttgtatatctatttgatccagttattatggatt
atatacgcttgaaactcattttaagccattgttattgaacgtttatcaaa
tactttattatgccaagcaagtcaaacacatgcttgttgattgaaatcaa
gctatagaaatctcttcttcacatacagcagtttagattcacaatacaac
aagcgaaacgataaagtttc bp 1-2010: RD2 promoter bp 2011-2638:
antisense A622 bp 2639-3769: Fad2 intron bp 3770-4397: sense A622
bp 4398-4670: Gad2 terminator A622/Qptase (fragments) Double
inhibiton cassette (SEQ. ID. No. 27)
ctcgaggatctaaattgtgagttcaatctcttccctattggattgattat
cctttcttttcttccaatttgtgtttctttttgcctaatttattgtgtta
tcccctttatcctattttgtttctttacttatttatttgcttctatgtct
ttgtacaaagatttaaactctatggcacatattttaaagttgttagaaaa
taaattctttcaagattgatgaaagaactttttaattgtagatatttcgt
agattttattctcttactaccaatataacgcttgaattgacgaaaatttg
tgtccaaatatctagcaaaaaggtatccaatgaaaatatatcatatgtga
tcttcaaatcttgtgtcttatgcaagattgatactttgttcaatggaaga
gattgtgtgcatatttttaaaatttttattagtaataaagattctatata
gctgttatagagggataattttacaaagaacactataaatatgattgttg
ttgttagggtgtcaatggttcggttcgactggttattttataaaatttgt
accataccatttttttcgatattctattttgtataaccaaaattagactt
ttcgaaatcgtcccaatcatgtcggtttcacttcggtatcggtaccgttc
ggttaattttcatttttttttaaatgtcattaaaattcactagtaaaaat
agaatgcaataacatacgttcttttataggacttagcaaaagctctctag
acatttttactgtttaaaggataatgaattaaaaaacatgaaagatggct
agagtatagatacacaactattcgacagcaacgtaaaagaaaccaagtaa
aagcaaagaaaatataaatcacacgagtggaaagatattaaccaagttgg
gattcaagaataaagtctatattaaatattcaaaaagataaatttaaata
atatgaaaggaaacatattcaatacattgtagtttgctactcataatcgc
tagaatactttgtgccttgctaataaagatacttgaaatagcttagttta
aatataaatagcataatagattttaggaattagtattttgagtttaatta
cttattgacttgtaacagtttttataattccaaggcccatgaaaaattta
atgctttattagttttaaacttactatataaatttttcatatgtaaaatt
taatcggtatagttcgatattttttcaatttatttttataaaataaaaaa
cttaccctaattatcggtacagttatagatttatataaaaatctacggtt
cttcagaagaaacctaaaaatcggttcggtgcggacggttcgatcggttt
agtcgattttcaaatattcattgacactcctagttgttgttataggtaaa
aagcagttacagagaggtaaaatataacttaaaaaatcagttctaaggaa
aaattgacttttatagtaaatgactgttatataaggatgttgttacagag
aggtatgagtgtagttggtaaattatgttcttgacggtgtatgtcacata
ttatttattaaaactagaaaaaacagcgtcaaaactagcaaaaatccaac
ggacaaaaaaatcggctgaatttgatttggttccaacatttaaaaaagtt
tcagtgagaaagaatcggtgactgttgatgatataaacaaagggcacatt
ggtcaataaccataaaaaattatatgacagctacagttggtagcatgtgc
tcagctattgaacaaatctaaagaaggtacatctgtaaccggaacaccac
ttaaatgactaaattaccctcatcagaaagcagatggagtgctacaaata
acacactattcaacaaccataaataaaacgtgttcagctactaaaacaaa
tataaataaatctatgtttgtaagcactccagccatgttaatggagtgct
attgcctgttaactctcacttataaaatagtagtagaaaaaatatgaacc
aaaacacaacTTTATCGCCATCATTTACATACCACTCCACCTTTAATGAA
GGATCAACTTCCGCGAATATCATCTCAGCA
AGTGCAATTCCTGCTATGATCCCGTCTTCCTTTGCTAGAAAATGAGCATC
GGATTCCATATCAAGAGGAATTGTCGCCTT
ACAAGTCACATCTCCTAAATTCCCAGCATCTTCAGAGAGTGCAAGTTTCA
TAACTTCCTTTAAATCATAAGTTGGGTGTG
CTGGTGGTTTCACCTCTAATGACTCCACTCTTGTATTCTTGGTGGCTATT
GCTGACATTTTCACCACCAACCTTGGAGCT
GTAATTGCATAAGGATGCACTGTAGCAGTGAAAGGAATAGCTCTAAACAT
ggttgtgtatttcacttttggatatagctc
agtggcttcgacacctgtaggaggctgaacctcaaagtttgcagaatctc
cattaacaaaaactgaatggcatatggccaaattagtccttaatggcaga
ggtccctcttgtacaatctggagaatatcttcctctgatagatataactt
ctcgagggtcttcccaattttgtcctcccacaaggacactatctcgttga
aggatagaatattggcaggtggtctcatgtgaagagtcttattcaatgtc
cgtggatcatctactgcttcgatagtgtatgtcgctatgtcttcttcctt
cacatatattgctttgggatttccatcgccaaaaatgacaactttgtctc
taggaggggttttggcctctaactgccccaagttgggcaagaagaaatct
gcaaaccaattgcagattacatatgtgtatggaattccttctgcctctat
catcctcctgattcttacctttagagcgaagagtgatgcagctggttcaa
ttgcacgagcatgatccacatcaaatccaaattctgaaggaagaaatctc
ttgatatttccagcttctttaattgctttgatgatgttcacttgatcaGT
CCGTCGCTTCTCTTCCATTTCTTCTCATTTTCGATTTTGA
TTCTTATTTCTTTCCAGTAGCTCCTGCTCTGTGAATTTCTCCGCTCACGA
TAGATCTGCTTATACTCCTTACATTCAACC
TTAGATCTGGTCTCGATTCTCTGTTTCTCTGTTTTTTTCTTTTGGTCGAG
AATCTGATGTTTGTTTATGTTCTGTCACCA
TTAATAATAATGAACTCTCTCATTCATACAATGATTAGTTTCTCTCGTCT
ACAAAACGATATGTTGCATTTTCACTTTTC
TTCTTTTTTTCTAAGATGATTTGCTTTGACCAATTTGTTTAGATCTTTAT
TTTATTTTATTTTCTGGTGGGTTGGTGGAA
ATTGAAAAAAAAAAAAACAGCATAAATTGTTATTTGTTAATGTATTCATT
TTTTGGCTATTTGTTCTGGGTAAAAATCTG
CTTCTACTATTGAATCTTTCCTGGATTTTTTACTCCTATTGGGTTTTTAT
AGTAAAAATACATAATAAAAGGAAAACAAA
AGTTTTATAGATTCTCTTAAACCCCTTACGATAAAAGTTGGAATCAAAAT
AATTCAGGATCAGATGCTCTTTGATTGATT
CAGATGCGATTACAGTTGCATGGCAAATTTTCTAGATCCGTCGTCACATT
TTATTTTCTGTTTAAATATCTAAATCTGAT
ATATGATGTCGACAAATTCTGGTGGCTTATACATCACTTCAACTGTTTTC
TTTTGGCTTTGTTTGTCAACTTGGTTTTCA
ATACGATTTGTGATTTCGATCGCTGAATTTTTAATACAAGCAAACTGATG
TTAACCACAAGCAAGAGATGTGACCTGCCT
TATTAACATCGTATTACTTACTACTAGTCGTATTCTCAACGCAATCGTTT
TTGTATTTCTCACATTATGCCGCTTCTCTA
CTCTTTATTCCTTTTGGTCCACGCATTTTCTATTTGTGGCAATCCCTTTC
ACAACCTGATTTCCCACTTTGGATCATTTG
TCTGAAGACTCTCTTGAATCGTTACCACTTGTTTCTTGTGCATGCTCTGT
TTTTTAGAATTAATGATAAAACTATTCCAT
AGTCTTGAGTTTTCAGCTTGTTGATTCTTTTGCTTTTGGTTTTCTGCAGt
gatcaagtgaacatcatcaaagcaattaaa
gaagctggaaatatcaagagatttcttccttcagaatttggatttgatgt
ggatcatgctcgtgcaattgaaccagctgcatcactcttcgctctaaagg
taagaatcaggaggatgatagaggcagaaggaattccatacacatatgta
atctgcaattggtttgcagatttcttcttgcccaacttggggcagttaga
ggccaaaacccctcctagagacaaagttgtcatttttggcgatggaaatc
ccaaagcaatatatgtgaaggaagaagacatagcgacatacactatcgaa
gcagtagatgatccacggacattgaataagactcttcacatgagaccacc
tgccaatattctatccttcaacgagatagtgtccttgtgggaggacaaaa
ttgggaagaccctcgagaagttatatctatcagaggaagatattctccag
attgtacaagagggacctctgccattaaggactaatttggccatatgcca
ttcagtttttgttaatggagattctgcaaactttgaggttcagcctccta
caggtgtcgaagccactgagctatatccaaaagtgaaatacacaaccATG
TTTAGAGCTATTCCTTTCACTGCTACAGTGCATCCTTATG
CAATTACAGCTCCAAGGTTGGTGGTGAAAATGTCAGCAATAGCCACCAAG
AATACAAGAGTGGAGTCATTAGAGGTGAAA
CCACCAGCACACCCAACTTATGATTTAAAGGAAGTTATGAAACTTGCACT
CTCTGAAGATGCTGGGAATTTAGGAGATGT
GACTTGTAAGGCGACAATTCCTCTTGATATGGAATCCGATGCTCATTTTC
TAGCAAAGGAAGACGGGATCATAGCAGGAA
TTGCACTTGCTGAGATGATATTCGCGGAAGTTGATCCTTCATTAAAGGTG
GAGTGGTATGTAAATGATGGCGATAAAgca
agtgtgttgcctttgtgtggaaatgaagaggtacttgcgaggactttgcg
tttatcagtttatgtgtttgtatatctatttgatccagttattatggatt
atatacgcttgaaactcattttaagccattgttattgaacgtttatcaaa
tactttattatgccaagcaagtcaaacacatgcttgttgattgaaatcaa
gctatagaaatctcttcttcacatacagcagtttagattcacaatacaac
aagcgaaacgataaagtttc bp 1-2010: RD2 promoter bp 2011-2370: AS
QPTase bp 2371-2998: antisense A622 bp 2999-4129: Fad2 intron bp
4130-4757: sense A622 bp 4758-5117: sense QPTase bp 5118-5390: Gad2
terminator 14alpha demethylase inhibition cassette (SEQ. ID. No.
28) gacggtccgatgtgagacttttcaacaaagggtaatatccggaaacctcc
tcggattccattgcccagctatctgtcactttattgtgaagatagtggaa
aaggaaggtggctcctacaaatgccatcattgcgataaaggaaaggccat
cgttgaagatgcctctgccgacagtggtcccaaagatggacccccaccca
cgaggagcatcgtggaaaaagaagacgttccaaccacgtcttcaaagcaa
gtggattgatgtgatggtccgatgtgagacttttcaacaaagggtaatat
ccggaaacctcctcggattccattgcccagctatctgtcactttattgtg
aagatagtggaaaaggaaggtggctcctacaaatgccatcattgcgataa
aggaaaggccatcgttgaagatgcctctgccgacagtggtcccaaagatg
gacccccacccacgaggagcatcgtggaaaaagaagacgttccaaccacg
tcttcaaagcaagtggattgatgtgatatctccactgacgtaagggatga
cgcacaatcccactatccttcgcaagacccttcctctatataaggaagtt
catttcatttggagaggaATCATACTCTTTTCCTTCCCTG
GTTTTAACAGTGAAATCACTATGCGAACTACGTAGAAGCATTATCAGTGG
AGGATGGAGTCTCAGGGCTTCCTTTATGCA
TCTATAGAGGACTTCCATCTCGGAAAGGATGTCATGATCGACCTTATTCC
CATGTTTCTTCATCAGATTCTTCTGTTCAT
CTACGACGGCAGACATGTACTTGTTGTTGCAGAGAAGGTATGCCCCTGCC
CAAGTGGAGGTGATGGAACTGGTGTGTTGC
CCAGCGAAAAGAGCAGCAATCAGAAGACCTGTGATCTCAGACTCTGTCGT
TGCCCGCCCATCTTTGTACTTGGAGTCAAT
GAAGCATTGTAACATATCGCTCTCCGCCTTGCCTGTACGTTTTCTAGAAT
CTATGATGTTTGCAAAGATCTCCGCGAGCT
TCTTGCGGGCATTGTCACGACGGCGATGGGCTGGAATGGGAAGGTAGGGA
AAGATTACACTGATAGGAAGCATCCCATTG
TCCAGGTCATGGAAGAGAGCAGAGACATCCTCAAAGAGTTTATTGCGAAC
CTCTTCTCCCAACAGACATCTACTAGCTGT
CAGTATGATAAGATGCTCCAGTTCATACTTCAAGTCCACTTCACCACTAT
CACCCCATTTTGAGAAGTACTCCTCAGCTT
CCATGACCATCTGATCCACATATCCCTTCAATTTATTTACCCTCAAAGAT
TCAGTAAAGAACCTAAATTGCTCTTGTCTG
ATAGTATAATCAACGTCAAAAACCACACCAGGGCCAAAAGTAGGCACATT
GAACTGATAAACCTCTTGTTGACTGAGATC
GGTTTCTGGGGCCTTAAAGAAATGGGCCGACACTTCTGGGCCAACGAAGA
ACGTGATATTCTTgtccgtcgcttctcttc
catttcttctcattttcgattttgattcttatttctttccagtagctcct
gctctgtgaatttctccgctcacgatagatctgcttatactccttacatt
caaccttagatctggtctcgattctctgtttctctgtttttttcttttgg
tcgagaatctgatgtttgtttatgttctgtcaccattaataataatgaac
tctctcattcatacaatgattagtttctctcgtctacaaaacgatatgtt
gcattttcacttttcttctttttttctaagatgatttgctttgaccaatt
tgtttagatctttattttattttattttctggtgggttggtggaaattga
aaaaaaaaaaaacagcataaattgttatttgttaatgtattcattttttg
gctatttgttctgggtaaaaatctgcttctactattgaatctttcctgga
ttttttactcctattgggtttttatagtaaaaatacataataaaaggaaa
acaaaagttttatagattctcttaaaccccttacgataaaagttggaatc
aaaataattcaggatcagatgctctttgattgattcagatgcgattacag
ttgcatggcaaattttctagatccgtcgtcacattttattttctgtttaa
atatctaaatctgatatatgatgtcgacaaattctggtggcttatacatc
acttcaactgttttcttttggctttgtttgtcaacttggttttcaatacg
atttgtgatttcgatcgctgaatttttaatacaagcaaactgatgttaac
cacaagcaagagatgtgacctgccttattaacatcgtattacttactact
agtcgtattctcaacgcaatcgtttttgtatttctcacattatgccgctt
ctctactctttattccttttggtccacgcattttctatttgtggcaatcc
ctttcacaacctgatttcccactttggatcatttgtctgaagactctctt
gaatcgttaccacttgtttcttgtgcatgctctgttttttagaattaatg
ataaaactattccatagtcttgagttttcagcttgttgattcttttgctt
ttggttttctgcagAAGAAT
ATCACGTTCTTCGTTGGCCCAGAAGTGTCGGCCCATTTCTTTAAGGCCCC
AGAAACCGATCTCAGTCAACAAGAGGTTTA
TCAGTTCAATGTGCCTACTTTTGGCCCTGGTGTGGTTTTTGACGTTGATT
ATACTATCAGACAAGAGCAATTTAGGTTCT
TTACTGAATCTTTGAGGGTAAATAAATTGAAGGGATATGTGGATCAGATG
GTCATGGAAGCTGAGGAGTACTTCTCAAAA
TGGGGTGATAGTGGTGAAGTGGACTTGAAGTATGAACTGGAGCATCTTAT
CATACTGACAGCTAGTAGATGTCTGTTGGG
AGAAGAGGTTCGCAATAAACTCTTTGAGGATGTCTCTGCTCTCTTCCATG
ACCTGGACAATGGGATGCTTCCTATCAGTG
TAATCTTTCCCTACCTTCCCATTCCAGCCCATCGCCGTCGTGACAATGCC
CGCAAGAAGCTCGCGGAGATCTTTGCAAAC
ATCATAGATTCTAGAAAACGTACAGGCAAGGCGGAGAGCGATATGTTACA
ATGCTTCATTGACTCCAAGTACAAAGATGG
GCGGGCAACGACAGAGTCTGAGATCACAGGTCTTCTGATTGCTGCTCTTT
TCGCTGGGCAACACACCAGTTCCATCACCT
CCACTTGGGCAGGGGCATACCTTCTCTGCAACAACAAGTACATGTCTGCC
GTCGTAGATGAACAGAAGAATCTGATGAAG
AAACATGGGAATAAGGTCGATCATGACATCCTTTCCGAGATGGAAGTCCT
CTATAGATGCATAAAGGAAGCCCTGAGACT
CCATCCTCCACTGATAATGCTTCTACGTAGTTCGCATAGTGATTTCACTG
TTAAAACCAGGGAAGGAAAAGAGTATGATg
atcgttcaaacatttggcaataaagtttcttaagattgaatcctgttgcc
ggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgt
aataattaacatgtaatgcatgacgttatttatgagatgggtttttatga
ttagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatag
cgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactaga tcg bp 1-618:
double 35S promoter bp 619-1503: AS 14alpha demethylase IR arm bp
1504-2634: Fad2 intron bp 2635-3519: SN 14alpha demethylase IR arm
bp 3520-3773: NOS terminator SMT2 inhibition cassette (SEQ ID. No.
29) gacggtccgatgtgagacttttcaacaaagggtaatatccggaaacctcc
tcggattccattgcccagctatctgtcactttattgtgaagatagtggaa
aaggaaggtggctcctacaaatgccatcattgcgataaaggaaaggccat
cgttgaagatgcctctgccgacagtggtcccaaagatggacccccaccca
cgaggagcatcgtggaaaaagaagacgttccaaccacgtcttcaaagcaa
gtggattgatgtgatggtccgatgtgagacttttcaacaaagggtaatat
ccggaaacctcctcggattccattgcccagctatctgtcactttattgtg
aagatagtggaaaaggaaggtggctcctacaaatgccatcattgcgataa
aggaaaggccatcgttgaagatgcctctgccgacagtggtcccaaagatg
gacccccacccacgaggagcatcgtggaaaaagaagacgttccaaccacg
tcttcaaagcaagtggattgatgtgatatctccactgacgtaagggatga
cgcacaatcccactatccttcgcaagacccttcctctatataaggaagtt
catttcatttggagaggaCCATATATTAGCAAATGCCCAC
CTTTATGAGCTTGTCAATAGGTATATATCTTAGAACAAGGACATCAATGG
CAAAAATAGCAAGACATGAAATCAAATTGT
GCCAGACAAGCAACACAGAAAAAGAAACCCTCCACCCACAACGCCCTCCA
AAAACTGTAGTCACCTTAATTAGGGCGGTC
ATATTCAATGTGTAAAGTTCTGTGCGAAGAATCTTACAGATTTGCTAGCT
AAAGCAAAAAGCTAAGTGACTAAACTCCAT
ATTACTGAGAGTCTGAAATGGGCTTGCGAACCACGAAGAAGTACATTGGT
GTGAAAATCCCTTTCTTGGCACCACCGACA
AGACCTTCTGCAGCTTTCTCTAAGAAAGCTTGAACCCTTTGACTACCTTT
AGGAGCAAGTCCCACGTATTCAAGCGCCGA
AACCAGATTTCTGGTGAAAAGTCTGCCAACTGCTGTTAGGCGGAAGCTAC
TGAGCGAGAAGTGACTCGTATCCAAAGGCA
AGTACCATGGAACAGGTGAGTCATCAGCCAGATCCTTGTCCCATACAACT
TCAAAACCAGCTTGTTTGGCTGCTTCGAGG
CACTGTGTTGTCAATCTAACCTCAGGGAGGCCATTTCCGAGCTCAATTTC
GGCCTTGATCCTGTTGTGCTCTTCGTTATT
GGGGTTGTAAGAATCGGTCATGCACCACTCATACACAGCGAAACATTGAC
CAGGCTTCAGCACCCGGTAAATCTCTTTAT
AGCATCCCAATGGATCTGGTGCATGGCAGGTAGCTTCTgtccgtcgcttc
tcttccatttcttctcattttcgattttga
ttcttatttctttccagtagctcctgctctgtgaatttctccgctcacga
tagatctgcttatactccttacattcaaccttagatctggtctcgattct
ctgtttctctgtttttttcttttggtcgagaatctgatgtttgtttatgt
tctgtcaccattaataataatgaactctctcattcatacaatgattagtt
tctctcgtctacaaaacgatatgttgcattttcacttttcttcttttttt
ctaagatgatttgctttgaccaatttgtttagatctttattttattttat
tttctggtgggttggtggaaattgaaaaaaaaaaaaacagcataaattgt
tatttgttaatgtattcattttttggctatttgttctgggtaaaaatctg
cttctactattgaatctttcctggattttttactcctattgggtttttat
agtaaaaatacataataaaaggaaaacaaaagttttatagattctcttaa
accccttacgataaaagttggaatcaaaataattcaggatcagatgctct
ttgattgattcagatgcgattacagttgcatggcaaattttctagatccg
tcgtcacattttattttctgtttaaatatctaaatctgatatatgatgtc
gacaaattctggtggcttatacatcacttcaactgttttcttttggcttt
gtttgtcaacttggttttcaatacgatttgtgatttcgatcgctgaattt
ttaatacaagcaaactgatgttaaccacaagcaagagatgtgacctgcct
tattaacatcgtattacttactactagtcgtattctcaacgcaatcgttt
ttgtatttctcacattatgccgcttctctactctttattccttttggtcc
acgcattttctatttgtggcaatccctttcacaacctgatttcccacttt
ggatcatttgtctgaagactctcttgaatcgttaccacttgtttcttgtg
catgctctgttttttagaattaatgataaaactattccatagtcttgagt
tttcagcttgttgattcttttgcttttggttttctgcagAGAAGCTACCT
GCCATGCACCAGATCCATTG
GGATGCTATAAAGAGATTTACCGGGTGCTGAAGCCTGGTCAATGTTTCGC
TGTGTATGAGTGGTGCATGACCGATTCTTA
CAACCCCAATAACGAAGAGCACAACAGGATCAAGGCCGAAATTGAGCTCG
GAAATGGCCTCCCTGAGGTTAGATTGACAA
CACAGTGCCTCGAAGCAGCCAAACAAGCTGGTTTTGAAGTTGTATGGGAC
AAGGATCTGGCTGATGACTCACCTGTTCCA
TGGTACTTGCCTTTGGATACGAGTCACTTCTCGCTCAGTAGCTTCCGCCT
AACAGCAGTTGGCAGACTTTTCACCAGAAA
TCTGGTTTCGGCGCTTGAATACGTGGGACTTGCTCCTAAAGGTAGTCAAA
GGGTTCAAGCTTTCTTAGAGAAAGCTGCAG
AAGGTCTTGTCGGTGGTGCCAAGAAAGGGATTTTCACACCAATGTACTTC
TTCGTGGTTCGCAAGCCCATTTCAGACTCT
CAGTAATATGGAGTTTAGTCACTTAGCTTTTTGCTTTAGCTAGCAAATCT
GTAAGATTCTTCGCACAGAACTTTACACAT
TGAATATGACCGCCCTAATTAAGGTGACTACAGTTTTTGGAGGGCGTTGT
GGGTGGAGGGTTTCTTTTTCTGTGTTGCTT
GTCTGGCACAATTTGATTTCATGTCTTGCTATTTTTGCCATTGATGTCCT
TGTTCTAAGATATATACCTATTGACAAGCT
CATAAAGGTGGGCATTTGCTAATATATGGgatcgttcaaacatttggcaa
taaagtttcttaagattgaatcctgttgcc
ggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgt
aataattaacatgtaatgcatgacgttatttatgagatgggtttttatga
ttagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatag
cgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactaga tcg bp 1-618:
double 35S promoter bp 619-1398: AS SMT2 (Sterol methyltransferase)
IR arm bp 1399-2529: Fad2 intron bp 2530-3309: SN SMT2 IR arm bp
3310-3563: NOS terminator Squalene Synthase inhibition cassette
(SEQ ID No. 30) gacggtccgatgtgagacttttcaacaaagggtaatatccggaaacctcc
tcggattccattgcccagctatctgtcactttattgtgaagatagtggaa
aaggaaggtggctcctacaaatgccatcattgcgataaaggaaaggccat
cgttgaagatgcctctgccgacagtggtcccaaagatggacccccaccca
cgaggagcatcgtggaaaaagaagacgttccaaccacgtcttcaaagcaa
gtggattgatgtgatggtccgatgtgagacttttcaacaaagggtaatat
ccggaaacctcctcggattccattgcccagctatctgtcactttattgtg
aagatagtggaaaaggaaggtggctcctacaaatgccatcattgcgataa
aggaaaggccatcgttgaagatgcctctgccgacagtggtcccaaagatg
gacccccacccacgaggagcatcgtggaaaaagaagacgttccaaccacg
tcttcaaagcaagtggattgatgtgatatctccactgacgtaagggatga
cgcacaatcccactatccttcgcaagacccttcctctatataaggaagtt
catttcatttggagaggaACAATCCTAGCCCAACAAGCCC
AGCTACATAGTGACAATATTCGTCATAATCATCAGTTGTTTCCACCTCCT
TGCATATGAATTTTGCCATTCCTGCACCCA
TCCTCATGGTAATATCCTCAATTGCCTGCTGATAATGTTTCCTAAGCTCC
AGAAAAGCAGTTGAAACATGATGGAACTGG
TCCATGAGAACCTTGTACTCTTTTGTACCACATGAAAAATGCCATTCACG
ATCATAAACATGCTGATGAAAAGAGATCAG
AATAGGTACTTTAACATCGGTGGGAATGCTGGTATCATCCTCAACAGTGT
CAAGTGCTCGAAGAACCAAATAGAAAATGC
ACACGGCGTCACGAAGCTCGACGGGAAGTTGTTGAATGACGAGAGCAAAG
CTACGAGAAACCTTATGAAGCATTGAGTAA
CAGAAGCCCCAATGTGGgtccgtcgcttctcttccatttcttctcatttt
cgattttgattcttatttctttccagtagctcctgctctgtgaatttctc
cgctcacgatagatctgcttatactccttacattcaaccttagatctggt
ctcgattctctgtttctctgtttttttcttttggtcgagaatctgatgtt
tgtttatgttctgtcaccattaataataatgaactctctcattcatacaa
tgattagtttctctcgtctacaaaacgatatgttgcattttcacttttct
tctttttttctaagatgatttgctttgaccaatttgtttagatctttatt
ttattttattttctggtgggttggtggaaattgaaaaaaaaaaaaacagc
ataaattgttatttgttaatgtattcattttttggctatttgttctgggt
aaaaatctgcttctactattgaatctttcctggattttttactcctattg
ggtttttatagtaaaaatacataataaaaggaaaacaaaagttttataga
ttctcttaaaccccttacgataaaagttggaatcaaaataattcaggatc
agatgctctttgattgattcagatgcgattacagttgcatggcaaatttt
ctagatccgtcgtcacattttattttctgtttaaatatctaaatctgata
tatgatgtcgacaaattctggtggcttatacatcacttcaactgttttct
tttggctttgtttgtcaacttggttttcaatacgatttgtgatttcgatc
gctgaatttttaatacaagcaaactgatgttaaccacaagcaagagatgt
gacctgccttattaacatcgtattacttactactagtcgtattctcaacg
caatcgtttttgtatttctcacattatgccgcttctctactctttattcc
ttttggtccacgcattttctatttgtggcaatccctttcacaacctgatt
tcccactttggatcatttgtctgaagactctcttgaatcgttaccacttg
tttcttgtgcatgctctgttttttagaattaatgataaaactattccata
gtcttgagttttcagcttgttgattcttttgcttttggttttctgcagCC
ACATTGGGGCTTCTGTTACTCAATGCTTCATAAGGTTTCTCGTAGCTTTG
CTCTCGTCATTCAACAACTTCCCGTCGAGCTTCGTGACGCCGTGTGCATT
TTCTATTTGGTTCTTCGAGCACTTGACACT
GTTGAGGATGATACCAGCATTCCCACCGATGTTAAAGTACCTATTCTGAT
CTCTTTTCATCAGCATGTTTATGATCGTGA
ATGGCATTTTTCATGTGGTACAAAAGAGTACAAGGTTCTCATGGACCAGT
TCCATCATGTTTCAACTGCTTTTCTGGAGC
TTAGGAAACATTATCAGCAGGCAATTGAGGATATTACCATGAGGATGGGT
GCAGGAATGGCAAAATTCATATGCAAGGAG
GTGGAAACAACTGATGATTATGACGAATATTGTCACTATGTAGCTGGGCT
TGTTGGGCTAGGATTGTgatcgttcaaaca
tttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatg
attatcatataatttctgttgaattacgttaagcatgtaataattaacat
gtaatgcatgacgttatttatgagatgggtttttatgattagagtcccgc
aattatacatttaatacgcgatagaaaacaaaatatagcgcgcaaactag
gataaattatcgcgcgcggtgtcatctatgttactagatcg bp 1-618: double 35S
promoter bp 619-1057: AS squalene synthase IR arm bp 1058-2188:
Fad2 intron bp 2189-2627: SN squalene synthase IR arm bp 2628-2881:
NOS terminator HMGCoA Reductase inhibition cassette (SEQ ID No 31)
gacggtccgatgtgagacttttcaacaaagggtaatatccggaaacctcc
tcggattccattgcccagctatctgtcactttattgtgaagatagtggaa
aaggaaggtggctcctacaaatgccatcattgcgataaaggaaaggccat
cgttgaagatgcctctgccgacagtggtcccaaagatggacccccaccca
cgaggagcatcgtggaaaaagaagacgttccaaccacgtcttcaaagcaa
gtggattgatgtgatggtccgatgtgagacttttcaacaaagggtaatat
ccggaaacctcctcggattccattgcccagctatctgtcactttattgtg
aagatagtggaaaaggaaggtggctcctacaaatgccatcattgcgataa
aggaaaggccatcgttgaagatgcctctgccgacagtggtcccaaagatg
gacccccacccacgaggagcatcgtggaaaaagaagacgttccaaccacg
tcttcaaagcaagtggattgatgtgatatctccactgacgtaagggatga
cgcacaatcccactatccttcgcaagacccttcctctatataaggaagtt
catttcatttggagaggaCATATACAAAAGCAAACTTTCT
GAGCAAACATAAAGAGTTTGAGATGCCATTTCTCTCTAAATTACAATCTA
GTCACAATTAACAAACAAACGAAAGACAGT
ACAACAGAAAAGATTATTTAAAAAAAAAGGGGTTATCTTCCTTGGCGCAT
GAATGAAATTAACCAAATGTTGAATTACAA
GTTAACCCCACTGGTCACCATCCCACCTAACACCTTTCGTAGATCTTCAC
CAAATATTTGCAGGTTTTTTTACACGAACT
CAGAAAAAAATACGACCCTACCTCCTCACATGCCTTCATAGAAAGAATAC
AACACTACATACAGATCCACGTCCACCCTT
GATTTGCTTGTCTTTTTCTTCTTGATCTTTCTCCACATGACTAATGCCTT
ACACTTTTTCAACTTTTTGGTCTACCCTTT
ACTTATTGCTCTCCCTAATTGGAAAATTTTATTCCTACTTTTATTGTAAT
CCATTTCTTTAATAATGATGGTCCATAAAG
GATGGTGATGTACACGATGTTGGGATAATAAATTTGTCTTTTTCCTTACT
AAGAGGAAATCTTAGTAACATCTTTGCTAG
ATCTATTGTATTTCATGTGACTCTTAACCAGCTGCCCTGCTGAGATAGCA
GACATGAGAGATAACTCACCAGCAAGAACA
GAACCTGCTACTATTGTGGCCAAGAGCCTTGCATTTGACCCTGCTGCCTC
CCTGTTTGCACCTTTCACTCCTAATAAGTT
CAAGCAAGCTGACTGTGATGCAAGTTGAGTTCCACCACCAACTGTGCCAA
CCTCAATAGAAGGCATAGTTACTGAAATAT
GGAGGTCTTTGCCATCATTTACAGCCTCgtccgtcgcttctcttccattt
cttctcattttcgattttgattcttatttctttccagtagctcctgctct
gtgaatttctccgctcacgatagatctgcttatactccttacattcaacc
ttagatctggtctcgattctctgtttctctgtttttttcttttggtcgag
aatctgatgtttgtttatgttctgtcaccattaataataatgaactctct
cattcatacaatgattagtttctctcgtctacaaaacgatatgttgcatt
ttcacttttcttctttttttctaagatgatttgctttgaccaatttgttt
agatctttattttattttattttctggtgggttggtggaaattgaaaaaa
aaaaaaacagcataaattgttatttgttaatgtattcattttttggctat
ttgttctgggtaaaaatctgcttctactattgaatctttcctggattttt
tactcctattgggtttttatagtaaaaatacataataaaaggaaaacaaa
agttttatagattctcttaaaccccttacgataaaagttggaatcaaaat
aattcaggatcagatgctctttgattgattcagatgcgattacagttgca
tggcaaattttctagatccgtcgtcacattttattttctgtttaaatatc
taaatctgatatatgatgtcgacaaattctggtggcttatacatcacttc
aactgttttcttttggctttgtttgtcaacttggttttcaatacgatttg
tgatttcgatcgctgaatttttaatacaagcaaactgatgttaaccacaa
gcaagagatgtgacctgccttattaacatcgtattacttactactagtcg
tattctcaacgcaatcgtttttgtatttctcacattatgccgcttctcta
ctctttattccttttggtccacgcattttctatttgtggcaatccctttc
acaacctgatttcccactttggatcatttgtctgaagactctcttgaatc
gttaccacttgtttcttgtgcatgctctgttttttagaattaatgataaa
actattccatagtcttgagttttcagcttgttgattcttttgcttttggt
tttctgcagGAGGCTGTAAATGATGGCAAAGACCTCCATATTTCAGTAAC
TATGCCTTCTATTGAGGTTGGCACAGTTGGTGGTGGAACTCAACTTGCAT
CACAGTCAGCTTGCTTGAACTTATTAGGAG
TGAAAGGTGCAAACAGGGAGGCAGCAGGGTCAAATGCAAGGCTCTTGGCC
ACAATAGTAGCAGGTTCTGTTCTTGCTGGT
GAGTTATCTCTCATGTCTGCTATCTCAGCAGGGCAGCTGGTTAAGAGTCA
CATGAAATACAATAGATCTAGCAAAGATGT
TACTAAGATTTCCTCTTAGTAAGGAAAAAGACAAATTTATTATCCCAACA
TCGTGTACATCACCATCCTTTATGGACCAT
CATTATTAAAGAAATGGATTACAATAAAAGTAGGAATAAAATTTTCCAAT
TAGGGAGAGCAATAAGTAAAGGGTAGACCA
AAAAGTTGAAAAAGTGTAAGGCATTAGTCATGTGGAGAAAGATCAAGAAG
AAAAAGACAAGCAAATCAAGGGTGGACGTG
GATCTGTATGTAGTGTTGTATTCTTTCTATGAAGGCATGTGAGGAGGTAG
GGTCGTATTTTTTTCTGAGTTCGTGTAAAA
AAACCTGCAAATATTTGGTGAAGATCTACGAAAGGTGTTAGGTGGGATGG
TGACCAGTGGGGTTAACTTGTAATTCAACA
TTTGGTTAATTTCATTCATGCGCCAAGGAAGATAACCCCTTTTTTTTTAA
ATAATCTTTTCTGTTGTACTGTCTTTCGTT
TGTTTGTTAATTGTGACTAGATTGTAATTTAGAGAGAAATGGCATCTCAA
ACTCTTTATGTTTGCTCAGAAAGTTTGCTT
TTGTATATGgatcgttcaaacatttggcaataaagtttcttaagattgaa
tcctgttgccggtcttgcgatgattatcatataatttctgttgaattacg
ttaagcatgtaataattaacatgtaatgcatgacgttatttatgagatgg
gtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaa
caaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatcta tgttactagatcg bp
1-618: double 35S promoter bp 619-1468: AS HMG-CoAR IR bp
1469-2599: Fad2 intron bp 2600-3449: SN HMG-CoAR IR bp 3450-3703:
Nos terminator Developmental-stage regulated SMT2 inhibition
cassette (SEQ. ID. No. 32)
TTCTGTTCGTATATTTGTAACTATTATGTGTATTTTTATTTTGTTAGTAT
TACTAATTCAAGTGGTTTAAGTTGTTGAGA
CTCTTTAAAATCTAAGCATTTTATAAACAATAATATATAATTATTGTTTA
GGCTAAATTTGTCACTAATTAAGGTTTGGA
TACATAGTGTCTAAACTAAGCTAATAATATCACTTAACGTTTACTTGTAA
CGCTAGGTGATGATGTCGTCAAGTCAATTG
GTACAAGGAATAAACGAGTGGTCATATGACATTATGACCATATGAATTCA
AACTCCAGTAATCCAATGGTAATTGGATTC
AATGATCAAGACTTGAACCACGTAATCCACCCTTATCCTTAGAAGCTCAT
AAATATCACTAAAGGGACAGGCAACACTTA
ACCAGTAGTTGTCCAATAATTTAGTTTTCCAAAATGAAAAATTATTGTTG
TCATCTATTTTAGGTGTTTTAGTTCAATGT
GGATTCCTCGTCCTAACAAATACTTGACGAATATATCTAGACTATAAAAT
TGGTTATGAGTTCTACTTTTTTTTGTTTGT
GAAATTATCAAAATTTGTTATATTTATTTATTTATTCTCATTAATTTGAG
TACTAATTTTTAAATTATTTATACTAAAAA
CAATTACTAAGATACAAAAATGGATAAGAGCATGGTGTATAGATATTTAA
TGGGATAGAATATTTCCCATAATTGTATGT
GTGTGAGAGGTTTTGTTTTCGTAAGGAAAGAAACAAAAACCATTTGACCA
AAGAAAAGCAAAAGAAGGCAAGGAATCAAA
CAACAAATGTTGCAAGGCAGAAATAATGGACGTTATGTTAATGTAGTGTC
GTCACACGTGACTTAAAAGAGACGAGTCTG
CGTGTCAAACTAAAAATGTATGCAACTATAAAAATGGGATTTGATTATCT
TTTTAGTACCGAAGCCTACCAACCACATGC
ACACTAATTCTACTCGCCAAATAAAGTGAAAAGAGccatatattagcaaa
tgcccacctttatgagcttgtcaataggta
tatatcttagaacaaggacatcaatggcaaaaatagcaagacatgaaatc
aaattgtgccagacaagcaacacagaaaaagaaaccctccacccacaacg
ccctccaaaaactgtagtcaccttaattagggcggtcatattcaatgtgt
aaagttctgtgcgaagaatcttacagatttgctagctaaagcaaaaagct
aagtgactaaactccatattactgagagtctgaaatgggcttgcgaacca
cgaagaagtacattggtgtgaaaatccctttcttggcaccaccgacaaga
ccttctgcagctttctctaagaaagcttgaaccctttgactacctttagg
agcaagtcccacgtattcaagcgccgaaaccagatttctggtgaaaagtc
tgccaactgctgttaggcggaagctactgagcgagaagtgactcgtatcc
aaaggcaagtaccatggaacaggtgagtcatcagccagatccttgtccca
tacaacttcaaaaccagcttgtttggctgcttcgaggcactgtgttgtca
atctaacctcagggaggccatttccgagctcaatttcggccttgatcctg
ttgtgctcttcgttattggggttgtaagaatcggtcatgcaccactcata
cacagcgaaacattgaccaggcttcagcacccggtaaatctctttatagc
atcccaatggatctggtgcatggcaggtagcttctGTAAGTTCCTGTTTT
CACCTGCACCATGAAAAATATACTATTACTATTATTTTTCATTTATTTGT
GTGGTCCATATTGCTATGTGTGAAATGAAAAAATATTTTTTTTCTCAAAC
TACAATATTGTCAGAAAGAAAGGAATTAAT
ATTCCGAATTTATACCAAAAAATTAATTTCTTTTTTCTCTTTGGTAAGCT
GGATTCTGTTATTCTTTGGTAAAACGGAGA
ATAATTTTGTTTATCAACTTCTGTTGATTTTATGAACAATTCTCAATTAA
TTGAAGGGGTAGTTTAAGGCTGATGAATCT
TTTGGATGAGTTACTTGAGCAGTATGGATTGACTCACATGACTAACTGCT
TCACTAGCTTCCAATATTTTTTAGTTATTA
CATGTTGTGTATGTTGATTATTGTGCTCTAAGCAATCGGATTCTCTTGTT
AAATAAAAACTATCATAGTTTATTTATTCA
ATAATCGAGTTTGAGCTAACACTCCTGTCTATCTGGAATACAAAAGGAAA
GATAATAAAAGTTTTTGGTACCTTGAAAAC
TAGAAGTATCAGGAAGGGGAGCCTTGAACAAAGGTCAAGTTGTCTCCGTT
TGACCTACATGTCATGTTCGAGCCATTGAT
GCTTGCATCAGGATAGACTGCCTACATCACCCCCTCTTGCGGTACGGCCC
TTCCCCGGACCTGCGTGAACGCGGGATACT
TTGTGCACCGGAAAACTACAAGTATCCCTAACACATATCAGGATTTTAGT
GATATCCCTTCACTGCCGTGTTCGATAAAG
GTTACATAAAGTTTTAAATTTATGGGTGCTAAATATCACAGCTAAATATA
CACATTAAAGATATTACTGCATCCATATAT
GTTGCCATGACCATACATCAAGTATACATCCACCCCTAATTTTTGAGTGT
TTTTGAGATGCAGCAAAGTTGAAGGAGATT
ATAATAGTTTGATGTGGAGAGACTAATTTTTTTTTTAACATCACTTTCTA
AGGGTGCTATCTTTTCACCACCATCACTGG
TGGCTTGTTGATTTGTAGCTAATCATTATCTTTTGATGAAAACAAGGACA
TTCTTTAGTGCACTAAGATTGTTAAACGTT
CGTGCTTCATTGTAAATGTAATATACTCGCGCTTGTTGGCATGAACACTT
GGAATTGTTTACTGGAACACTGCAGagaag
ctacctgccatgcaccagatccattgggatgctataaagagatttaccgg
gtgctgaagcctggtcaatgtttcgctgtgtatgagtggtgcatgaccga
ttcttacaaccccaataacgaagagcacaacaggatcaaggccgaaattg
agctcggaaatggcctccctgaggttagattgacaacacagtgcctcgaa
gcagccaaacaagctggttttgaagttgtatgggacaaggatctggctga
tgactcacctgttccatggtacttgcctttggatacgagtcacttctcgc
tcagtagcttccgcctaacagcagttggcagacttttcaccagaaatctg
gtttcggcgcttgaatacgtgggacttgctcctaaaggtagtcaaagggt
tcaagctttcttagagaaagctgcagaaggtcttgtcggtggtgccaaga
aagggattttcacaccaatgtacttcttcgtggttcgcaagcccatttca
gactctcagtaatatggagtttagtcacttagctttttgctttagctagc
aaatctgtaagattcttcgcacagaactttacacattgaatatgaccgcc
ctaattaaggtgactacagtttttggagggcgttgtgggtggagggtttc
tttttctgtgttgcttgtctggcacaatttgatttcatgtcttgctattt
ttgccattgatgtccttgttctaagatatatacctattgacaagctcata
aaggtgggcatttgctaatatatggTTTCCCTTTGCTTTTGTGTAAACCT
CAAAACTTTATCCCCCATCTTTGATTTTATCCCTTGTTTTTCTGCTTTTT
TCTTCTTTCTTGGGTTTTAATTTCCGGACT
TAACGTTTGTTTTCCGGTTTGCGAGACATATTCTATCGGATTCTCAACTG
TCTGATGAAATAAATATGTAATGTTCTATA
AGTCTTTCAATTTGATATGCATATCAACAAAAAGAAAATAGGACAATGCG
GCTACAAATATGAAATTTACAAGTTTAAGA
ACCATGAGTCGCTAAAGAAATCATTAAGAAAATTAGTTTCACATTCAATT
CTTGTCACATGATTAACGAGCTTGAGAGGT
TTAGAGTAACAATATCTTGAAGCAAAAGATGACCCACTTGAAATCTAGTG
ATGGATACATAAGTGGACGTGCCTTGTTTA
GGATAGGATTCTGGATAAGAGTCTCGAATATTCATTTTTACCAAGTATAT
TCAAGGATCTTGTGGATCATATATTTCCTC
AATCAAAGGGACTTGACCCAAATTCACATAAAGATATTTTGGAGTC bp 1-995: A.t.
cinnamyl alcohol dehydrogenase promoter bp 996-1775: AS SMT2 IR arm
bp 1776-2955: N.t. pap intron 1 bp 2956-3735: SN SMT2 IR arm bp
3736-4286: A.t. RBCS RuBisCO small subunit) terminator A622/SMT2
double inhibition cassette (SEQ. ID. No. 33)
ctcgaggatctaaattgtgagttcaatctcttccctattggattgattat
cctttcttttcttccaatttgtgtttctttttgcctaatttattgtgtta
tcccctttatcctattttgtttctttacttatttatttgcttctatgtct
ttgtacaaagatttaaactctatggcacatattttaaagttgttagaaaa
taaattctttcaagattgatgaaagaactttttaattgtagatatttcgt
agattttattctcttactaccaatataacgcttgaattgacgaaaatttg
tgtccaaatatctagcaaaaaggtatccaatgaaaatatatcatatgtga
tcttcaaatcttgtgtcttatgcaagattgatactttgttcaatggaaga
gattgtgtgcatatttttaaaatttttattagtaataaagattctatata
gctgttatagagggataattttacaaagaacactataaatatgattgttg
ttgttagggtgtcaatggttcggttcgactggttattttataaaatttgt
accataccatttttttcgatattctattttgtataaccaaaattagactt
ttcgaaatcgtcccaatcatgtcggtttcacttcggtatcggtaccgttc
ggttaattttcatttttttttaaatgtcattaaaattcactagtaaaaat
agaatgcaataacatacgttcttttataggacttagcaaaagctctctag
acatttttactgtttaaaggataatgaattaaaaaacatgaaagatggct
agagtatagatacacaactattcgacagcaacgtaaaagaaaccaagtaa
aagcaaagaaaatataaatcacacgagtggaaagatattaaccaagttgg
gattcaagaataaagtctatattaaatattcaaaaagataaatttaaata
atatgaaaggaaacatattcaatacattgtagtttgctactcataatcgc
tagaatactttgtgccttgctaataaagatacttgaaatagcttagttta
aatataaatagcataatagattttaggaattagtattttgagtttaatta
cttattgacttgtaacagtttttataattccaaggcccatgaaaaattta
atgctttattagttttaaacttactatataaatttttcatatgtaaaatt
taatcggtatagttcgatattttttcaatttatttttataaaataaaaaa
cttaccctaattatcggtacagttatagatttatataaaaatctacggtt
cttcagaagaaacctaaaaatcggttcggtgcggacggttcgatcggttt
agtcgattttcaaatattcattgacactcctagttgttgttataggtaaa
aagcagttacagagaggtaaaatataacttaaaaaatcagttctaaggaa
aaattgacttttatagtaaatgactgttatataaggatgttgttacagag
aggtatgagtgtagttggtaaattatgttcttgacggtgtatgtcacata
ttatttattaaaactagaaaaaacagcgtcaaaactagcaaaaatccaac
ggacaaaaaaatcggctgaatttgatttggttccaacatttaaaaaagtt
tcagtgagaaagaatcggtgactgttgatgatataaacaaagggcacatt
ggtcaataaccataaaaaattatatgacagctacagttggtagcatgtgc
tcagctattgaacaaatctaaagaaggtacatctgtaaccggaacaccac
ttaaatgactaaattaccctcatcagaaagcagatggagtgctacaaata
acacactattcaacaaccataaataaaacgtgttcagctactaaaacaaa
tataaataaatctatgtttgtaagcactccagccatgttaatggagtgct
attgcctgttaactctcacttataaaatagtagtagaaaaaatatgaacc
aaaacacaacGGTTGTGTATTTCACTTTTGGATATAGCTCAGTGGCTTCG
ACACCTGTAGGAGGCTGAACCTCAAAGTTT
GCAGAATCTCCATTAACAAAAACTGAATGGCATATGGCCAAATTAGTCCT
TAATGGCAGAGGTCCCTCTTGTACAATCTG
GAGAATATCTTCCTCTGATAGATATAACTTCTCGAGGGTCTTCCCAATTT
TGTCCTCCCACAAGGACACTATCTCGTTGA
AGGATAGAATATTGGCAGGTGGTCTCATGTGAAGAGTCTTATTCAATGTC
CGTGGATCATCTACTGCTTCGATAGTGTAT
GTCGCTATGTCTTCTTCCTTCACATATATTGCTTTGGGATTTCCATCGCC
AAAAATGACAACTTTGTCTCTAGGAGGGGT
TTTGGCCTCTAACTGCCCCAAGTTGGGCAAGAAGAAATCTGCAAACCAAT
TGCAGATTACATATGTGTATGGAATTCCTT
CTGCCTCTATCATCCTCCTGATTCTTACCTTTAGAGCGAAGAGTGATGCA
GCTGGTTCAATTGCACGAGCATGATCCACA
TCAAATCCAAATTCTGAAGGAAGAAATCTCTTGATATTTCCAGCTTCTTT
AATTGCTTTGATGATGTTCACTTGATCAgt
ccgtcgcttctcttccatttcttctcattttcgattttgattcttatttc
tttccagtagctcctgctctgtgaatttctccgctcacgatagatctgct
tatactccttacattcaaccttagatctggtctcgattctctgtttctct
gtttttttcttttggtcgagaatctgatgtttgtttatgttctgtcacca
ttaataataatgaactctctcattcatacaatgattagtttctctcgtct
acaaaacgatatgttgcattttcacttttcttctttttttctaagatgat
ttgctttgaccaatttgtttagatctttattttattttattttctggtgg
gttggtggaaattgaaaaaaaaaaaaacagcataaattgttatttgttaa
tgtattcattttttggctatttgttctgggtaaaaatctgcttctactat
tgaatctttcctggattttttactcctattgggtttttatagtaaaaata
cataataaaaggaaaacaaaagttttatagattctcttaaaccccttacg
ataaaagttggaatcaaaataattcaggatcagatgctctttgattgatt
cagatgcgattacagttgcatggcaaattttctagatccgtcgtcacatt
ttattttctgtttaaatatctaaatctgatatatgatgtcgacaaattct
ggtggcttatacatcacttcaactgttttcttttggctttgtttgtcaac
ttggttttcaatacgatttgtgatttcgatcgctgaatttttaatacaag
caaactgatgttaaccacaagcaagagatgtgacctgccttattaacatc
gtattacttactactagtcgtattctcaacgcaatcgtttttgtatttct
cacattatgccgcttctctactctttattccttttggtccacgcattttc
tatttgtggcaatccctttcacaacctgatttcccactttggatcatttg
tctgaagactctcttgaatcgttaccacttgtttcttgtgcatgctctgt
tttttagaattaatgataaaactattccatagtcttgagttttcagcttg
ttgattcttttgcttttggttttctgcagTGATCAAGTGAACATCATCAA
AGCAATTAAAGAAGCTGGAAATATCAAGAGATTTCTTCCTTCAGAATTTG
GATTTGATGTGGATCATGCTCGTGCAATTGAACCAGCTGCATCACTCTTC
GCTCTAAAGGTAAGAATCAGGAGGATGATA
GAGGCAGAAGGAATTCCATACACATATGTAATCTGCAATTGGTTTGCAGA
TTTCTTCTTGCCCAACTTGGGGCAGTTAGA
GGCCAAAACCCCTCCTAGAGACAAAGTTGTCATTTTTGGCGATGGAAATC
CCAAAGCAATATATGTGAAGGAAGAAGACA
TAGCGACATACACTATCGAAGCAGTAGATGATCCACGGACATTGAATAAG
ACTCTTCACATGAGACCACCTGCCAATATT
CTATCCTTCAACGAGATAGTGTCCTTGTGGGAGGACAAAATTGGGAAGAC
CCTCGAGAAGTTATATCTATCAGAGGAAGA
TATTCTCCAGATTGTACAAGAGGGACCTCTGCCATTAAGGACTAATTTGG
CCATATGCCATTCAGTTTTTGTTAATGGAG
ATTCTGCAAACTTTGAGGTTCAGCCTCCTACAGGTGTCGAAGCCACTGAG
CTATATCCAAAAGTGAAATACACAACCgca
agtgtgttgcctttgtgtggaaatgaagaggtacttgcgaggactttgcg
tttatcagtttatgtgtttgtatatctatttgatccagttattatggatt
atatacgcttgaaactcattttaagccattgttattgaacgtttatcaaa
tactttattatgccaagcaagtcaaacacatgcttgttgattgaaatcaa
gctatagaaatctcttcttcacatacagcagtttagattcacaatacaac
aagcgaaacgataaagtttcTTCTGTTCGTATATTTGTAACTATTATGTG
TATTTTTATTTTGTTAGTAT
TACTAATTCAAGTGGTTTAAGTTGTTGAGACTCTTTAAAATCTAAGCATT
TTATAAACAATAATATATAATTATTGTTTA
GGCTAAATTTGTCACTAATTAAGGTTTGGATACATAGTGTCTAAACTAAG
CTAATAATATCACTTAACGTTTACTTGTAA
CGCTAGGTGATGATGTCGTCAAGTCAATTGGTACAAGGAATAAACGAGTG
GTCATATGACATTATGACCATATGAATTCA
AACTCCAGTAATCCAATGGTAATTGGATTCAATGATCAAGACTTGAACCA
CGTAATCCACCCTTATCCTTAGAAGCTCAT
AAATATCACTAAAGGGACAGGCAACACTTAACCAGTAGTTGTCCAATAAT
TTAGTTTTCCAAAATGAAAAATTATTGTTG
TCATCTATTTTAGGTGTTTTAGTTCAATGTGGATTCCTCGTCCTAACAAA
TACTTGACGAATATATCTAGACTATAAAAT
TGGTTATGAGTTCTACTTTTTTTTGTTTGTGAAATTATCAAAATTTGTTA
TATTTATTTATTTATTCTCATTAATTTGAG
TACTAATTTTTAAATTATTTATACTAAAAACAATTACTAAGATACAAAAA
TGGATAAGAGCATGGTGTATAGATATTTAA
TGGGATAGAATATTTCCCATAATTGTATGTGTGTGAGAGGTTTTGTTTTC
GTAAGGAAAGAAACAAAAACCATTTGACCA
AAGAAAAGCAAAAGAAGGCAAGGAATCAAACAACAAATGTTGCAAGGCAG
AAATAATGGACGTTATGTTAATGTAGTGTC
GTCACACGTGACTTAAAAGAGACGAGTCTGCGTGTCAAACTAAAAATGTA
TGCAACTATAAAAATGGGATTTGATTATCT
TTTTAGTACCGAAGCCTACCAACCACATGCACACTAATTCTACTCGCCAA
ATAAAGTGAAAAGAGccatatattagcaaa
tgcccacctttatgagcttgtcaataggtatatatcttagaacaaggaca
tcaatggcaaaaatagcaagacatgaaatcaaattgtgccagacaagcaa
cacagaaaaagaaaccctccacccacaacgccctccaaaaactgtagtca
ccttaattagggcggtcatattcaatgtgtaaagttctgtgcgaagaatc
ttacagatttgctagctaaagcaaaaagctaagtgactaaactccatatt
actgagagtctgaaatgggcttgcgaaccacgaagaagtacattggtgtg
aaaatccctttcttggcaccaccgacaagaccttctgcagctttctctaa
gaaagcttgaaccctttgactacctttaggagcaagtcccacgtattcaa
gcgccgaaaccagatttctggtgaaaagtctgccaactgctgttaggcgg
aagctactgagcgagaagtgactcgtatccaaaggcaagtaccatggaac
aggtgagtcatcagccagatccttgtcccatacaacttcaaaaccagctt
gtttggctgcttcgaggcactgtgttgtcaatctaacctcagggaggcca
tttccgagctcaatttcggccttgatcctgttgtgctcttcgttattggg
gttgtaagaatcggtcatgcaccactcatacacagcgaaacattgaccag
gcttcagcacccggtaaatctctttatagcatcccaatggatctggtgca
tggcaggtagcttctGTAAGTTCCTGTTTTCACCTGCACCATGAAAAATA
TACTATTACTATTATTTTTCATTTATTTGTGTGGTCCATATTGCTATGTG
TGAAATGAAAAAATATTTTTTTTCTCAAAC
TACAATATTGTCAGAAAGAAAGGAATTAATATTCCGAATTTATACCAAAA
AATTAATTTCTTTTTTCTCTTTGGTAAGCT
GGATTCTGTTATTCTTTGGTAAAACGGAGAATAATTTTGTTTATCAACTT
CTGTTGATTTTATGAACAATTCTCAATTAA
TTGAAGGGGTAGTTTAAGGCTGATGAATCTTTTGGATGAGTTACTTGAGC
AGTATGGATTGACTCACATGACTAACTGCT
TCACTAGCTTCCAATATTTTTTAGTTATTACATGTTGTGTATGTTGATTA
TTGTGCTCTAAGCAATCGGATTCTCTTGTT
AAATAAAAACTATCATAGTTTATTTATTCAATAATCGAGTTTGAGCTAAC
ACTCCTGTCTATCTGGAATACAAAAGGAAA
GATAATAAAAGTTTTTGGTACCTTGAAAACTAGAAGTATCAGGAAGGGGA
GCCTTGAACAAAGGTCAAGTTGTCTCCGTT
TGACCTACATGTCATGTTCGAGCCATTGATGCTTGCATCAGGATAGACTG
CCTACATCACCCCCTCTTGCGGTACGGCCC
TTCCCCGGACCTGCGTGAACGCGGGATACTTTGTGCACCGGAAAACTACA
AGTATCCCTAACACATATCAGGATTTTAGT
GATATCCCTTCACTGCCGTGTTCGATAAAGGTTACATAAAGTTTTAAATT
TATGGGTGCTAAATATCACAGCTAAATATA
CACATTAAAGATATTACTGCATCCATATATGTTGCCATGACCATACATCA
AGTATACATCCACCCCTAATTTTTGAGTGT
TTTTGAGATGCAGCAAAGTTGAAGGAGATTATAATAGTTTGATGTGGAGA
GACTAATTTTTTTTTTAACATCACTTTCTA
AGGGTGCTATCTTTTCACCACCATCACTGGTGGCTTGTTGATTTGTAGCT
AATCATTATCTTTTGATGAAAACAAGGACA
TTCTTTAGTGCACTAAGATTGTTAAACGTTCGTGCTTCATTGTAAATGTA
ATATACTCGCGCTTGTTGGCATGAACACTT
GGAATTGTTTACTGGAACACTGCAGagaagctacctgccatgcaccagat
ccattgggatgctataaagagatttaccgg
gtgctgaagcctggtcaatgtttcgctgtgtatgagtggtgcatgaccga
ttcttacaaccccaataacgaagagcacaacaggatcaaggccgaaattg
agctcggaaatggcctccctgaggttagattgacaacacagtgcctcgaa
gcagccaaacaagctggttttgaagttgtatgggacaaggatctggctga
tgactcacctgttccatggtacttgcctttggatacgagtcacttctcgc
tcagtagcttccgcctaacagcagttggcagacttttcaccagaaatctg
gtttcggcgcttgaatacgtgggacttgctcctaaaggtagtcaaagggt
tcaagctttcttagagaaagctgcagaaggtcttgtcggtggtgccaaga
aagggattttcacaccaatgtacttcttcgtggttcgcaagcccatttca
gactctcagtaatatggagtttagtcacttagctttttgctttagctagc
aaatctgtaagattcttcgcacagaactttacacattgaatatgaccgcc
ctaattaaggtgactacagtttttggagggcgttgtgggtggagggtttc
tttttctgtgttgcttgtctggcacaatttgatttcatgtcttgctattt
ttgccattgatgtccttgttctaagatatatacctattgacaagctcata
aaggtgggcatttgctaatatatggTTTCCCTTTGCTTTTGTGTAAACCT
CAAAACTTTATCCCCCATCTTTGATTTTATCCCTTGTTTTTCTGCTTTTT
TCTTCTTTCTTGGGTTTTAATTTCCGGACTTAACGTTTGTTTTCCGGTTT
GCGAGACATATTCTATCGGATTCTCAACTG
TCTGATGAAATAAATATGTAATGTTCTATAAGTCTTTCAATTTGATATGC
ATATCAACAAAAAGAAAATAGGACAATGCG
GCTACAAATATGAAATTTACAAGTTTAAGAACCATGAGTCGCTAAAGAAA
TCATTAAGAAAATTAGTTTCACATTCAATT
CTTGTCACATGATTAACGAGCTTGAGAGGTTTAGAGTAACAATATCTTGA
AGCAAAAGATGACCCACTTGAAATCTAGTG
ATGGATACATAAGTGGACGTGCCTTGTTTAGGATAGGATTCTGGATAAGA
GTCTCGAATATTCATTTTTACCAAGTATAT
TCAAGGATCTTGTGGATCATATATTTCCTCAATCAAAGGGACTTGACCCA
AATTCACATAAAGATATTTTGGAGTC bp 1-2010: RD2 promoter bp 2011-2638:
antisense A622 bp 2639-3769: Fad2 intron bp 3770-4397: sense A622
bp 4398-4670: Gad2 terminator bp 4671-5665: A.t. cinnamyl alcohol
dehydrogenase promoter bp 5666-6445: AS SMT2 IR arm bp 6446-7625:
N.t. pap intron 1 bp 7626-8405: SN SMT2 IR arm bp 8406-8956: A.t.
RBCS (RuBisCO small subunit) terminator GUS Selection Cassette
(SEQ. ID. No. 34)
TCTAGAATGTTCGTGCGTCAAATGGATAAACAAAAAAATAGCATAAGTTA
GTTTTGTTACTCGAGAGTTATGTATTATAA
GGTATAGGGAAATGACTCAAACATACCACTGAACTTAACGAAACGACGCA
TATATATACTACTTAACTTAACGAAAAAGG
GGTGAGAGTGGATGGGTGCTGGTAAATAATGAAGGGTTTATATAACGTCA
CGTGTCAAAATTCGATAGTAGTAGTTTCGT
TAGTTGTAATAGCATATATGGCCCAAAGTTATAATATAGATAATATGTTT
ATGTCCAACTATTAACGAGTGACATAGACA
GTTCATTTTGTGAAGTTCAATGACATATTTGAGCCCTTTCCCTTTTATTA
TCTCCTTTTATTTGTTCTAATAAAAGAATG
GCATTTATTATGTACATAGACAAATAACTATTTTCTTTGGAATATAATTT
GTTTATATATTTTAAAATCATGTCTCAATT
TAGTTTGTTTTGTGCATATTTCAACTATTCAATTTTGTCCATATATTTAT
TACCTTCCCCCATTTACAAGCATTGAACCG
CTTTGCTCACCAAAACTTATGCACATTGCAAAAATATCATGTAAAGGTTT
TATGTATGCTGTAATTAAGGTCTGAACTCA
TCGTGATTTTATTTTTAGGCTTCATTGACCACTACCAAACTCTTTGATGC
TACATTTTCTAATTATATTGGAGTTCGATT
ATATCCGAATTCGCGTTGCGTAGGGCCCATTCGAGGGAAAACACTCCCTA
TCAAGGATTTTTTCATACCCAGAGCTCGAA
CTCAAGACATCTGGTTAAGGGAAGAACAGTCTCATCCACTGCACCATATC
CTTTTGTGGTCAACAAGTAAATTTTATGTA
GAACCAAAAACTATACTCGAATTGATAAAATAAATGGTGTAAAATATTGT
TTTCTTTCTTACATTTTGGACAGTAAATAT
GTAGGACAATAATAATTAGCGTGGGGTCTTAAGAAAATTAGCATAGATTT
CCAGAAATTCCAAATCAACCGGCAGTTCCA
GGTTTGAAAACTACAACTCATTCCGACGGTTCAAACTTCAAACCATGCTT
GCTGACTCGGCTTCTTCTTTCTTTTTCACC
AAGACAGAGCAGTAGTCACGTGACACCCCTCACGTGCCTCCCCCCTTTAT
ATTTCAGACTGCAACCCTACACTTTCGCTA
CATTCACTACCATATTCTTTTCACTAAGCAATTTTCTCTCCTACTTTTCT
TTAAACCCCTTTTTTCTCCCCTAAGCCATG
GCATCTAGATCatgttacgtcctgtagaaaccccaacccgtgaaatcaaa
aaactcgacggcctgtgggcattcagtctggatcgcgaaaactgtggaat
tgatcagcgttggtgggaaagcgcgttacaagaaagccgggcaattgctg
tgccaggcagttttaacgatcagttcgccgatgcagatattcgtaattat
gcgggcaacgtctggtatcagcgcgaagtctttataccgaaaggttgggc
aggccagcgtatcgtgctgcgtttcgatgcggtcactcattacggcaaag
tgtgggtcaataatcaggaagtgatggagcatcagggcggctatacgcca
tttgaagccgatgtcacgccgtatgttattgccgggaaaagtgtacgtat
caccgtttgtgtgaacaacgaactgaactggcagactatcccgccgggaa
tggtgattaccgacgaaaacggcaagaaaaagcagtcttacttccatgat
ttctttaactatgccggaatccatcgcagcgtaatgctctacaccacgcc
gaacacctgggtggacgatatcaccgtggtgacgcatgtcgcgcaagact
gtaaccacgcgtctgttgactggcaggtggtggccaatggtgatgtcagc
gttgaactgcgtgatgcggatcaacaggtggttgcaactggacaaggcac
tagcgggactttgcaagtggtgaatccgcacctctggcaaccgggtgaag
gttatctctatgaactgtgcgtcacagccaaaagccagacagagtgtgat
atctacccgcttcgcgtcggcatccggtcagtggcagtgaagggcgaaca
gttcctgattaaccacaaaccgttctactttactggctttggtcgtcatg
aagatgcggacttgcgtggcaaaggattcgataacgtgctgatggtgcac
gaccacgcattaatggactggattggggccaactcctaccgtacctcgca
ttacccttacgctgaagagatgctcgactgggcagatgaacatggcatcg
tggtgattgatgaaactgctgctgtcggctttaacctctctttaggcatt
ggtttcgaagcgggcaacaagccgaaagaactgtacagcgaagaggcagt
caacggggaaactcagcaagcgcacttacaggcgattaaagagctgatag
cgcgtgacaaaaaccacccaagcgtggtgatgtggagtattgccaacgaa
ccggatacccgtccgcaaggtgcacgggaatatttcgcgccactggcgga
agcaacgcgtaaactcgacccgacgcgtccgatcacctgcgtcaatgtaa
tgttctgcgacgctcacaccgataccatcagcgatctctttgatgtgctg
tgcctgaaccgttattacggatggtatgtccaaagcggcgatttggaaac
ggcagagaaggtactggaaaaagaacttctggcctggcaggagaaactgc
atcagccgattatcatcaccgaatacggcgtggatacgttagccgggctg
cactcaatgtacaccgacatgtggagtgaagagtatcagtgtgcatggct
ggatatgtatcaccgcgtctttgatcgcgtcagcgccgtcgtcggtgaac
aggtatggaatttcgccgattttgcgacctcgcaaggcatattgcgcgtt
ggcggtaacaagaaagggatcttcactcgcgaccgcaaaccgaagtcggc
ggcttttctgctgcaaaaacgctggactggcatgaacttcggtgaaaaac
cgcagcagggaggcaaacaatgaGAGCTCGTGAAATGGCC
TCTTTAGTTTTTGATTGAATCATAGGGGTATTAGTTTTCTATGGCCGGGA
GTGGTCTTCTTGCTTAATTGTAATGGAATA
ACCAGAGAGGAACTACTGTGTTATCTTTGAGGAATGTTGGGCTTTTTTCG
TTTGAATTATCATGAATGAAATTTTACTTT
TTCCCAATACAAGTTTGTTTTCGTTTCTTGGTTTTTGTTATCCCTTGGTT
TATGTCTTGGTTTGGCTTAAATGATTGAAG
ATTACACTACCTATGTTTCTGCTATTCCTGTTGAAGATCACATTTGATAA
TAATGCATCGAATGCATTAAAGTTTCTTAT
TGGCTCTGTCAAAAGTATTGAAGGTGGATTTTTCTAATTGGCAAGAGAAA
GTATTAAAGAGGTGATTTATTAGTACTTAT
ATTTTTCTCAGCATCTCTCTTTCAGTGTTGGAGCTTCATAAAATTAGCAC
TTCAGAGTTTCAGTCGGGAGCTGAATTCGA bp1-1291: GapC Promoter bp1292-3103:
GUS coding sequence bp3104-3600: GapCterminator Norflurazone
resistance selection cassette (SEQ. ID. No. 35)
CGTTTTGACGAGTTCGGATGTAGTAGTAGCCATTATTTAATGTACATACT
AATCGTGAATAGTGAATATGATGAAACATT
GTATCTTATTGTATAAATATCCATAAACACATCATGAAAGACACTTTCTT
TCACGGTCTGAATTAATTATGATACAATTC
TAATAGAAAACGAATTAAATTACGTTGAATTGTATGAAATCTAATTGAAC
AAGCCAACCACGACGACGACTAACGTTGCC
TGGATTGACTCGGTTTAAGTTAACCACTAAAAAAACGGAGCTGTCATGTA
ACACGCGGATCGAGCAGGTCACAGTCATGA
AGCCATCAAAGCAAAAGAACTAATCCAAGGGCTGAGATGATTAATTAGTT
TAAAAATTAGTTAACACGAGGGAAAAGGCT
GTCTGACAGCCAGGTCACGTTATCTTTACCTGTGGTCGAAATGATTCGTG
TCTGTCGATTTTAATTATTTTTTTGAAAGG
CCGAAAATAAAGTTGTAAGAGATAAACCCGCCTATATAAATTCATATATT
TTCTCTCCGCTTTGAATTGTCTCGTTGTCC
TCCTCACTTTCATCGGCCGTTTTTGAATCTCCGGCGACTTGACAGAGAAG
AACAAGGAAGAAGACTAAGAGAGAAAGTAA
GAGATAATCCAGGAGATTCATTCTCCGTTTTGAATCTTCCTCAATCTCAT
CTTCTTCCGCTCTTTCTTTCCAAGGTAATA
GGAACTTTCTGGATCTACTTTATTTGCTGGATCTCGATCTTGTTTTCTCA
ATTTCCTTGAGATCTGGAATTCGTTTAATT
TGGATCTGTGAACCTCCACTAAATCTTTTGGTTTTACTAGAATCGATCTA
AGTTGACCGATCAGTTAGCTCGATTATAGC
TACCAGAATTTGGCTTGACCTTGATGGAGAGATCCATGTTCATGTTACCT
GGGAAATGATTTGTATATGTGAATTGAAAT
CTGAACTGTTGAAGTTAGATTGAATCTGAACACTGTCAATGTTAGATTGA
ATCTGAACACTGTTTAAGTTAGATGAAGTT
TGTGTATAGATTCTTCGAAACTTTAGGATTTGTAGTGTCGTACGTTGAAC
AGAAAGCTATTTCTGATTCAATCAGGGTTT
ATTTGACTGTATTGAACTCTTTTTGTGTGTTTGCAGCTCATatggttgtg
tttgggaatgtttctgcggcgaatttgcct
tatcaaaacgggtttttggaggcactttcatctggaggttgtgaactaat
gggacatagctttagggttcccacttctcaagcgcttaagacaagaacaa
ggaggaggagtactgctggtcctttgcaggtagtttgtgtggatattcca
aggccagagctagagaacactgtcaatttcttggaagctgctagtttatc
tgcatccttccgtagtgctcctcgtcctgctaagcctttgaaagttgtaa
ttgctggtgctggattggctggattgtcaactgcaaagtacctggctgat
gcaggccacaaacctctgttgcttgaagcaagagatgttcttggtggaaa
gatagctgcatggaaggatgaagatggggactggtatgagactggtttac
atattttcttcggtgcttatccgaatgtgcagaatttatttggagaactt
gggatcaatgatcggttgcagtggaaggaacactccatgatttttgctat
gccaagtaaacctggagaatttagtagatttgacttcccagatgtcctac
cagcacccttaaatggtatttgggctattttgcggaacaacgagatgctg
acatggccagagaaaataaagtttgctattggacttttgccagccatggt
cggcggtcaggcttatgttgaggcccaagatggtttatcagtcaaagaat
ggatggaaaagcagggagtacctgagcgcgtgaccgacgaggtgtttatt
gccatgtcaaaggcgctaaactttataaaccctgatgaactgtcaatgca
atgcattttgatagctttgaaccggtttcttcaggaaaaacatggttcca
agatggcattcttggatggtaatcctccggaaaggctttgtatgccagta
gtggatcatattcgatcactaggtggggaagtgcaacttaattctaggat
aaagaaaattgagctcaatgacgatggcacggttaagagtttcttactca
ctaatggaagcactgtcgaaggagacgcttatgtgtttgccgctccagtc
gatatcctgaagctccttttaccagatccctggaaagaaataccgtactt
caagaaattggataaattagttggagtaccagttattaatgttcatatat
ggtttgatcgaaaactgaagaacacatatgatcacctactctttagcaga
agtaaccttctgagcgtgtatgccgacatgtccttaacttgtaaggaata
ttacgatcctaaccggtcaatgctggagctagtatttgcaccagcagagg
aatggatatcacggactgattctgacatcatagatgcaacaatgaaagaa
cttgagaaactcttccctgatgaaatctcagctgaccaaagcaaagctaa
aattctgaagtaccatgtcgttaagactccaagatctgggtacaagacca
tcccaaactgtgaaccatgtcgtcctctacaaagatcacctattgaagga
ttctacttagctggagattacacaaaacagaagtacttagcttccatgga
aggcgctgtcctctctggcaaattctgctctcagtctattgttcaggatt
acgagctactggctgcgtctggaccaagaaagttgtcggaggcaacagta
tcatcatcatgagaaaagggcgaattcgttaaccgcagacGAGCTCGTGA
AATGGCCTCTTTAGTTTTTGATTGAATCATAGGGGTATTAGTTTTCTATG GCCGGGAGTG
GTCTTCTTGCTTAATTGTAATGGAATAACCAGAGAGGAACTACTGTGTTA
TCTTTGAGGAATGTTGGGCTTTTTTCGTTT
GAATTATCATGAATGAAATTTTACTTTTTCCCAATACAAGTTTGTTTTCG
TTTCTTGGTTTTTGTTATCCCTTGGTTTAT
GTCTTGGTTTGGCTTAAATGATTGAAGATTACACTACCTATGTTTCTGCT
ATTCCTGTTGAAGATCACATTTGATAATAA
TGCATCGAATGCATTAAAGTTTCTTATTGGCTCTGTCAAAAGTATTGAAG
GTGGATTTTTCTAATTGGCAAGAGAAAGTA
TTAAAGAGGTGATTTATTAGTACTTATATTTTTCTCAGCATCTCTCTTTC
AGTGTTGGAGCTTCATAAAATTAGCACTTC AGAGTTTCAGTCGGGAGCTGAATTCGA bp
1-1161 Actin 2 Promter bp 1162-2890 PDSM-1 bp 2891-3387 GapC
terminator Phytoene desaturase (wild-type - Arabidopsis) (SEQ ID.
No. 36) ATGGTTGTGTTTGGGAATGTTTCTGCGGCGAATTTGCCTTATCAAAACGG
GTTTTTGGAGGCACTTTCATCTGGAGGTTG
TGAACTAATGGGACATAGCTTTAGGGTTCCCACTTCTCAAGCGCTTAAGA
CAAGAACAAGGAGGAGGAGTACTGCTGGTC
CTTTGCAGGTAGTTTGTGTGGATATTCCAAGGCCAGAGCTAGAGAACACT
GTCAATTTCTTGGAAGCTGCTAGTTTATCT
GCATCCTTCCGTAGTGCTCCTCGTCCTGCTAAGCCTTTGAAAGTTGTAAT
TGCTGGTGCTGGATTGGCTGGATTGTCAAC
TGCAAAGTACCTGGCTGATGCAGGCCACAAACCTCTGTTGCTTGAAGCAA
GAGATGTTCTTGGTGGAAAGATAGCTGCAT
GGAAGGATGAAGATGGGGACTGGTATGAGACTGGTTTACATATTTTCTTC
GGTGCTTATCCGAATGTGCAGAATTTATTT
GGAGAACTTGGGATCAATGATCGGTTGCAGTGGAAGGAACACTCCATGAT
TTTTGCTATGCCAAGTAAACCTGGAGAATT
TAGTAGATTTGACTTCCCAGATGTCCTACCAGCACCCTTAAATGGTATTT
GGGCTATTTTGCGGAACAACGAGATGCTGA
CATGGCCAGAGAAAATAAAGTTTGCTATTGGACTTTTGCCAGCCATGGTC
GGCGGTCAGGCTTATGTTGAGGCCCAAGAT
GGTTTATCAGTCAAAGAATGGATGGAAAAGCAGGGAGTACCTGAGCGCGT
GACCGACGAGGTGTTTATTGCCATGTCAAA
GGCGCTAAACTTTATAAACCCTGATGAACTGTCAATGCAATGCATTTTGA
TAGCTTTGAACCGGTTTCTTCAGGAAAAAC
ATGGTTCCAAGATGGCATTCTTGGATGGTAATCCTCCGGAAAGGCTTTGT
ATGCCAGTAGTGGATCATATTCGATCACTA
GGTGGGGAAGTGCAACTTAATTCTAGGATAAAGAAAATTGAGCTCAATGA
CGATGGCACGGTTAAGAGTTTCTTACTCAC
TAATGGAAGCACTGTCGAAGGAGACGCTTATGTGTTTGCCGCTCCAGTCG
ATATCCTGAAGCTCCTTTTACCAGATCCCT
GGAAAGAAATACCGTACTTCAAGAAATTGGATAAATTAGTTGGAGTACCA
GTTATTAATGTTCATATATGGTTTGATCGA
AAACTGAAGAACACATATGATCACCTACTCTTTAGCAGAAGTAACCTTCT
GAGCGTGTATGCCGACATGTCCTTAACTTG
TAAGGAATATTACGATCCTAACCGGTCAATGCTGGAGCTAGTATTTGCAC
CAGCAGAGGAATGGATATCACGGACTGATT
CTGACATCATAGATGCAACAATGAAAGAACTTGAGAAACTCTTCCCTGAT
GAAATCTCAGCTGACCAAAGCAAAGCTAAA
ATTCTGAAGTACCATGTCGTTAAGACTCCAAGATCTGTGTACAAGACCAT
CCCAAACTGTGAACCATGTCGTCCTCTACA
AAGATCACCTATTGAAGGATTCTACTTAGCTGGAGATTACACAAAACAGA
AGTACTTAGCTTCCATGGAAGGCGCTGTCC
TCTCTGGCAAATTCTGCTCTCAGTCTATTGTTCAGGATTACGAGCTACTG
GCTGCGTCTGGACCAAGAAAGTTGTCGGAG GCAACAGTATCATCATCATGA end
[0524] The various methods and techniques described above provide a
number of ways to carry out the invention. Of course, it is to be
understood that not necessarily all objectives or advantages
described may be achieved in accordance with any particular
embodiment described herein. Thus, for example, those skilled in
the art will recognize that the methods may be performed in a
manner that achieves or optimizes one advantage or group of
advantages as taught herein without necessarily achieving other
objectives or advantages as may be taught or suggested herein.
Furthermore, the skilled artisan will recognize the
interchangeability of various features from different embodiments.
Similarly, the various features and steps discussed above, as well
as other known equivalents for each such feature or step, can be
mixed and matched by one of ordinary skill in this art to perform
methods in accordance with principles described herein. Although
the invention has been disclosed in the context of certain
embodiments and examples, it will be understood by those skilled in
the art that the invention extends beyond the specifically
disclosed embodiments to other alternative embodiments and/or uses
and obvious modifications and equivalents thereof. Accordingly, the
invention is not intended to be limited by the specific disclosures
of preferred embodiments herein, but instead by reference to claims
attached hereto. All references cited herein are hereby expressly
incorporated by reference.
Sequence CWU 1
1
3614PRTArtificial SequenceSynthetic peptide sequence 1Asp Glu Val
Asp121056DNANicotiana tabacum 2atgtttagag ctattccttt cactgctaca
gtgcatcctt atgcaattac agctccaagg 60ttggtggtga aaatgtcagc aatagccacc
aagaatacaa gagtggagtc attagaggtg 120aaaccaccag cacacccaac
ttatgattta aaggaagtta tgaaacttgc actctctgaa 180gatgctggga
atttaggaga tgtgacttgt aaggcgacaa ttcctcttga tatggaatcc
240gatgctcatt ttctagcaaa ggaagacggg atcatagcag gaattgcact
tgctgagatg 300atattcgcgg aagttgatcc ttcattaaag gtggagtggt
atgtaaatga tggcgataaa 360gttcataaag gcttgaaatt tggcaaagta
caaggaaacg cttacaacat tgttatagct 420gagagggttg ttctcaattt
tatgcaaaga atgagtggaa tagctacact aactaaggaa 480atggcagatg
ctgcacaccc tgcttacatg ttggagacta ggaaaactgc tcctggatta
540cgtttggtgg ataaatgggc ggtattgatc ggtgggggga agaatcacag
aatgggctta 600tttgatatgg taatgataaa agacaatcac atatctgctg
ctggaggtgt cggcaaagct 660ctaaaatctg tggatcagta tttggagcaa
aataaacttc aaataggggt tgaggttgaa 720accaggacaa ttgaagaagt
acgtgaggtt ctagactatg catctcaaac aaagacttcg 780ttgactagga
taatgctgga caatatggtt gttccattat ctaacggaga tattgatgta
840tccatgctta aggaggctgt agaattgatc aatgggaggt ttgatacgga
ggcttcagga 900aatgttaccc ttgaaacagt acacaagatt ggacaaactg
gtgttaccta catttctagt 960ggtgccctga cgcattccgt gaaagcactt
gacatttccc tgaagatcga tacagagctc 1020gcccttgaag ttggaaggcg
tacaaaacga gcatga 10563360DNANicotiana tabacum 3atgtttagag
ctattccttt cactgctaca gtgcatcctt atgcaattac agctccaagg 60ttggtggtga
aaatgtcagc aatagccacc aagaatacaa gagtggagtc attagaggtg
120aaaccaccag cacacccaac ttatgattta aaggaagtta tgaaacttgc
actctctgaa 180gatgctggga atttaggaga tgtgacttgt aaggcgacaa
ttcctcttga tatggaatcc 240gatgctcatt ttctagcaaa ggaagacggg
atcatagcag gaattgcact tgctgagatg 300atattcgcgg aagttgatcc
ttcattaaag gtggagtggt atgtaaatga tggcgataaa 3604241DNANicotiana
tabacum 4cattttacca tctttcgcca gaagtatgat cgagtcttaa tcaagtgaat
aatgaacact 60ggtagtacaa tcattggacc aagatcgagt cttaatcaag tgaataaata
agtgaaatgc 120gacgtattgt aggagaattc tgcagtaatt atcataattt
ccaattcaca atcattgtaa 180aattctttct ctgtggtgtt tcgtacttta
atataaattt tcctgctgaa gttttgaatc 240g 2415628DNANicotiana tabacum
5tgatcaagtg aacatcatca aagcaattaa agaagctgga aatatcaaga gatttcttcc
60ttcagaattt ggatttgatg tggatcatgc tcgtgcaatt gaaccagctg catcactctt
120cgctctaaag gtaagaatca ggaggatgat agaggcagaa ggaattccat
acacatatgt 180aatctgcaat tggtttgcag atttcttctt gcccaacttg
gggcagttag aggccaaaac 240ccctcctaga gacaaagttg tcatttttgg
cgatggaaat cccaaagcaa tatatgtgaa 300ggaagaagac atagcgacat
acactatcga agcagtagat gatccacgga cattgaataa 360gactcttcac
atgagaccac ctgccaatat tctatccttc aacgagatag tgtccttgtg
420ggaggacaaa attgggaaga ccctcgagaa gttatatcta tcagaggaag
atattctcca 480gattgtacaa gagggacctc tgccattaag gactaatttg
gccatatgcc attcagtttt 540tgttaatgga gattctgcaa actttgaggt
tcagcctcct acaggtgtcg aagccactga 600gctatatcca aaagtgaaat acacaacc
6286439DNANicotiana tabacum 6ccacattggg gcttctgtta ctcaatgctt
cataaggttt ctcgtagctt tgctctcgtc 60attcaacaac ttcccgtcga gcttcgtgac
gccgtgtgca ttttctattt ggttcttcga 120gcacttgaca ctgttgagga
tgataccagc attcccaccg atgttaaagt acctattctg 180atctcttttc
atcagcatgt ttatgatcgt gaatggcatt tttcatgtgg tacaaaagag
240tacaaggttc tcatggacca gttccatcat gtttcaactg cttttctgga
gcttaggaaa 300cattatcagc aggcaattga ggatattacc atgaggatgg
gtgcaggaat ggcaaaattc 360atatgcaagg aggtggaaac aactgatgat
tatgacgaat attgtcacta tgtagctggg 420cttgttgggc taggattgt
4397850DNANicotiana tabacum 7gaggctgtaa atgatggcaa agacctccat
atttcagtaa ctatgccttc tattgaggtt 60ggcacagttg gtggtggaac tcaacttgca
tcacagtcag cttgcttgaa cttattagga 120gtgaaaggtg caaacaggga
ggcagcaggg tcaaatgcaa ggctcttggc cacaatagta 180gcaggttctg
ttcttgctgg tgagttatct ctcatgtctg ctatctcagc agggcagctg
240gttaagagtc acatgaaata caatagatct agcaaagatg ttactaagat
ttcctcttag 300taaggaaaaa gacaaattta ttatcccaac atcgtgtaca
tcaccatcct ttatggacca 360tcattattaa agaaatggat tacaataaaa
gtaggaataa aattttccaa ttagggagag 420caataagtaa agggtagacc
aaaaagttga aaaagtgtaa ggcattagtc atgtggagaa 480agatcaagaa
gaaaaagaca agcaaatcaa gggtggacgt ggatctgtat gtagtgttgt
540attctttcta tgaaggcatg tgaggaggta gggtcgtatt tttttctgag
ttcgtgtaaa 600aaaacctgca aatatttggt gaagatctac gaaaggtgtt
aggtgggatg gtgaccagtg 660gggttaactt gtaattcaac atttggttaa
tttcattcat gcgccaagga agataacccc 720ttttttttta aataatcttt
tctgttgtac tgtctttcgt ttgtttgtta attgtgacta 780gattgtaatt
tagagagaaa tggcatctca aactctttat gtttgctcag aaagtttgct
840tttgtatatg 8508780DNANicotiana tabacum 8agaagctacc tgccatgcac
cagatccatt gggatgctat aaagagattt accgggtgct 60gaagcctggt caatgtttcg
ctgtgtatga gtggtgcatg accgattctt acaaccccaa 120taacgaagag
cacaacagga tcaaggccga aattgagctc ggaaatggcc tccctgaggt
180tagattgaca acacagtgcc tcgaagcagc caaacaagct ggttttgaag
ttgtatggga 240caaggatctg gctgatgact cacctgttcc atggtacttg
cctttggata cgagtcactt 300ctcgctcagt agcttccgcc taacagcagt
tggcagactt ttcaccagaa atctggtttc 360ggcgcttgaa tacgtgggac
ttgctcctaa aggtagtcaa agggttcaag ctttcttaga 420gaaagctgca
gaaggtcttg tcggtggtgc caagaaaggg attttcacac caatgtactt
480cttcgtggtt cgcaagccca tttcagactc tcagtaatat ggagtttagt
cacttagctt 540tttgctttag ctagcaaatc tgtaagattc ttcgcacaga
actttacaca ttgaatatga 600ccgccctaat taaggtgact acagtttttg
gagggcgttg tgggtggagg gtttcttttt 660ctgtgttgct tgtctggcac
aatttgattt catgtcttgc tatttttgcc attgatgtcc 720ttgttctaag
atatatacct attgacaagc tcataaaggt gggcatttgc taatatatgg
7809885DNANicotiana tabacum 9aagaatatca cgttcttcgt tggcccagaa
gtgtcggccc atttctttaa ggccccagaa 60accgatctca gtcaacaaga ggtttatcag
ttcaatgtgc ctacttttgg ccctggtgtg 120gtttttgacg ttgattatac
tatcagacaa gagcaattta ggttctttac tgaatctttg 180agggtaaata
aattgaaggg atatgtggat cagatggtca tggaagctga ggagtacttc
240tcaaaatggg gtgatagtgg tgaagtggac ttgaagtatg aactggagca
tcttatcata 300ctgacagcta gtagatgtct gttgggagaa gaggttcgca
ataaactctt tgaggatgtc 360tctgctctct tccatgacct ggacaatggg
atgcttccta tcagtgtaat ctttccctac 420cttcccattc cagcccatcg
ccgtcgtgac aatgcccgca agaagctcgc ggagatcttt 480gcaaacatca
tagattctag aaaacgtaca ggcaaggcgg agagcgatat gttacaatgc
540ttcattgact ccaagtacaa agatgggcgg gcaacgacag agtctgagat
cacaggtctt 600ctgattgctg ctcttttcgc tgggcaacac accagttcca
tcacctccac ttgggcaggg 660gcataccttc tctgcaacaa caagtacatg
tctgccgtcg tagatgaaca gaagaatctg 720atgaagaaac atgggaataa
ggtcgatcat gacatccttt ccgagatgga agtcctctat 780agatgcataa
aggaagccct gagactccat cctccactga taatgcttct acgtagttcg
840catagtgatt tcactgttaa aaccagggaa ggaaaagagt atgat
885101701DNAArabidopsis thaliana 10atggttgtgt ttgggaatgt ttctgcggcg
aatttgcctt atcaaaacgg gtttttggag 60gcactttcat ctggaggttg tgaactaatg
ggacatagct ttagggttcc cacttctcaa 120gcgcttaaga caagaacaag
gaggaggagt actgctggtc ctttgcaggt agtttgtgtg 180gatattccaa
ggccagagct agagaacact gtcaatttct tggaagctgc tagtttatct
240gcatccttcc gtagtgctcc tcgtcctgct aagcctttga aagttgtaat
tgctggtgct 300ggattggctg gattgtcaac tgcaaagtac ctggctgatg
caggccacaa acctctgttg 360cttgaagcaa gagatgttct tggtggaaag
atagctgcat ggaaggatga agatggggac 420tggtatgaga ctggtttaca
tattttcttc ggtgcttatc cgaatgtgca gaatttattt 480ggagaacttg
ggatcaatga tcggttgcag tggaaggaac actccatgat ttttgctatg
540ccaagtaaac ctggagaatt tagtagattt gacttcccag atgtcctacc
agcaccctta 600aatggtattt gggctatttt gcggaacaac gagatgctga
catggccaga gaaaataaag 660tttgctattg gacttttgcc agccatggtc
ggcggtcagg cttatgttga ggcccaagat 720ggtttatcag tcaaagaatg
gatggaaaag cagggagtac ctgagcgcgt gaccgacgag 780gtgtttattg
ccatgtcaaa ggcgctaaac tttataaacc ctgatgaact gtcaatgcaa
840tgcattttga tagctttgaa ccggtttctt caggaaaaac atggttccaa
gatggcattc 900ttggatggta atcctccgga aaggctttgt atgccagtag
tggatcatat tcgatcacta 960ggtggggaag tgcaacttaa ttctaggata
aagaaaattg agctcaatga cgatggcacg 1020gttaagagtt tcttactcac
taatggaagc actgtcgaag gagacgctta tgtgtttgcc 1080gctccagtcg
atatcctgaa gctcctttta ccagatccct ggaaagaaat accgtacttc
1140aagaaattgg ataaattagt tggagtacca gttattaatg ttcatatatg
gtttgatcga 1200aaactgaaga acacatatga tcacctactc tttagcagaa
gtaaccttct gagcgtgtat 1260gccgacatgt ccttaacttg taaggaatat
tacgatccta accggtcaat gctggagcta 1320gtatttgcac cagcagagga
atggatatca cggactgatt ctgacatcat agatgcaaca 1380atgaaagaac
ttgagaaact cttccctgat gaaatctcag ctgaccaaag caaagctaaa
1440attctgaagt accatgtcgt taagactcca agatctgggt acaagaccat
cccaaactgt 1500gaaccatgtc gtcctctaca aagatcacct attgaaggat
tctacttagc tggagattac 1560acaaaacaga agtacttagc ttccatggaa
ggcgctgtcc tctctggcaa attctgctct 1620cagtctattg ttcaggatta
cgagctactg gctgcgtctg gaccaagaaa gttgtcggag 1680gcaacagtat
catcatcatg a 1701111701DNAArabidopsis thaliana 11atggttgtgt
ttgggaatgt ttctgcggcg aatttgcctt atcaaaacgg gtttttggag 60gcactttcat
ctggaggttg tgaactaatg ggacatagct ttagggttcc cacttctcaa
120gcgcttaaga caagaacaag gaggaggagt actgctggtc ctttgcaggt
agtttgtgtg 180gatattccaa ggccagagct agagaacact gtcaatttct
tggaagctgc tagtttatct 240gcatccttcc gtagtgctcc tcgtcctgct
aagcctttga aagttgtaat tgctggtgct 300ggattggctg gattgtcaac
tgcaaagtac ctggctgatg caggccacaa acctctgttg 360cttgaagcaa
gagatgttct tggtggaaag atagctgcat ggaaggatga agatggggac
420tggtatgaga ctggtttaca tattttcttc ggtgcttatc cgaatgtgca
gaatttattt 480ggagaacttg ggatcaatga tcggttgcag tggaaggaac
actccatgat ttttgctatg 540ccaagtaaac ctggagaatt tagtagattt
gacttcccag atgtcctacc agcaccctta 600aatggtattt gggctatttt
gcggaacaac gagatgctga catggccaga gaaaataaag 660tttgctattg
gacttttgcc agccatggtc ggcggtcagg cttatgttga ggcccaagat
720ggtttatcag tcaaagaatg gatggaaaag cagggagtac ctgagcgcgt
gaccgacgag 780gtgtttattg ccatgtcaaa ggcgctaaac tttataaacc
ctgatgaact gtcaatgcaa 840tgcattttga tagctttgaa cccgtttctt
caggaaaaac atggttccaa gatggcattc 900ttggatggta atcctccgga
aaggctttgt atgccagtag tggatcatat tcgatcacta 960ggtggggaag
tgcaacttaa ttctaggata aagaaaattg agctcaatga cgatggcacg
1020gttaagagtt tcttactcac taatggaagc actgtcgaag gagacgctta
tgtgtttgcc 1080gctccagtcg atatcctgaa gctcctttta ccagatccct
ggaaagaaat accgtacttc 1140aagaaattgg ataaattagt tggagtacca
gttattaatg ttcatatatg gtttgatcga 1200aaactgaaga acacatatga
tcacctactc tttagcagaa gtaaccttct gagcgtgtat 1260gccgacatgt
ccttaacttg taaggaatat tacgatccta accggtcaat gctggagcta
1320gtatttgcac cagcagagga atggatatca cggactgatt ctgacatcat
agatgcaaca 1380atgaaagaac ttgagaaact cttccctgat gaaatctcag
ctgaccaaag caaagctaaa 1440attctgaagt accatgtcgt taagactcca
agatctgtgt acaagaccat cccaaactgt 1500gaaccatgtc gtcctctaca
aagatcacct attgaaggat tctacttagc tggagattac 1560acaaaacaga
agtacttagc ttccatggaa ggcgctgtcc tctctggcaa attctgctct
1620cagtctattg ttcaggatta cgagctactg gctgcgtctg gaccaagaaa
gttgtcggag 1680gcaacagtat catcatcatg a 1701121701DNAArabidopsis
thaliana 12atggttgtgt ttgggaatgt ttctgcggcg aatttgcctt atcaaaacgg
gtttttggag 60gcactttcat ctggaggttg tgaactaatg ggacatagct ttagggttcc
cacttctcaa 120gcgcttaaga caagaacaag gaggaggagt actgctggtc
ctttgcaggt agtttgtgtg 180gatattccaa ggccagagct agagaacact
gtcaatttct tggaagctgc tagtttatct 240gcatccttcc gtagtgctcc
tcgtcctgct aagcctttga aagttgtaat tgctggtgct 300ggattggctg
gattgtcaac tgcaaagtac ctggctgatg caggccacaa acctctgttg
360cttgaagcaa gagatgttct tggtggaaag atagctgcat ggaaggatga
agatggggac 420tggtatgaga ctggtttaca tattttcttc ggtgcttatc
cgaatgtgca gaatttattt 480ggagaacttg ggatcaatga tcggttgcag
tggaaggaac actccatgat ttttgctatg 540ccaagtaaac ctggagaatt
tagtagattt gacttcccag atgtcctacc agcaccctta 600aatggtattt
gggctatttt gcggaacaac gagatgctga catggccaga gaaaataaag
660tttgctattg gacttttgcc agccatggtc ggcggtcagg cttatgttga
ggcccaagat 720ggtttatcag tcaaagaatg gatggaaaag cagggagtac
ctgagcgcgt gaccgacgag 780gtgtttattg ccatgtcaaa ggcgctaaac
tttataaacc ctgatgaact gtcaatgcaa 840tgcattttga tagctttgaa
ccggtttctt caggaaaaac atggttccaa gatggcattc 900ttggatggta
atcctccgga aaggctttgt atgccagtag tggatcatat tcgatcacta
960ggtggggaag tgcaacttaa ttctaggata aagaaaattg agctcaatga
cgatggcacg 1020gttaagagtt tcttactcac taatggaagc actgtcgaag
gagacgctta tgtgtttgcc 1080gctccagtcg atatcctgaa gctcctttta
ccagatccct ggaaagaaat accgtacttc 1140aagaaattgg ataaattagt
tggagtacca gttattaatg ttcatatatg gtttgatcga 1200aaactgaaga
acacatatga tcacccactc tttagcagaa gtaaccttct gagcgtgtat
1260gccgacatgt ccttaacttg taaggaatat tacgatccta accggtcaat
gctggagcta 1320gtatttgcac cagcagagga atggatatca cggactgatt
ctgacatcat agatgcaaca 1380atgaaagaac ttgagaaact cttccctgat
gaaatctcag ctgaccaaag caaagctaaa 1440attctgaagt accatgtcgt
taagactcca agatctgtgt acaagaccat cccaaactgt 1500gaaccatgtc
gtcctctaca aagatcacct attgaaggat tctacttagc tggagattac
1560acaaaacaga agtacttagc ttccatggaa ggcgctgtcc tctctggcaa
attctgctct 1620cagtctattg ttcaggatta cgagctactg gctgcgtctg
gaccaagaaa gttgtcggag 1680gcaacagtat catcatcatg a
1701131061DNANicotiana tabacum 13aatatgaaag gaaacatatt caatacattg
tagtttgcta ctcataatcg ctagaatact 60ttgtgccttg ctaataaaga tacttgaaat
agcttagttt aaatataaat agcataatag 120attttaggaa ttagtatttt
gagtttaatt acttattgac ttgtaacagt ttttataatt 180ccaaggccca
tgaaaaattt aatgctttat tagttttaaa cttactatat aaatttttca
240tatgtaaaat ttaatcggta tagttcgata ttttttcaat ttatttttat
aaaataaaaa 300acttacccta attatcggta cagttataga tttatataaa
aatctacggt tcttcagaag 360aaacctaaaa atcggttcgg tgcggacggt
tcgatcggtt tagtcgattt tcaaatattc 420attgacactc ctagttgttg
ttataggtaa aaagcagtta cagagaggta aaatataact 480taaaaaatca
gttctaagga aaaattgact tttatagtaa atgactgtta tataaggatg
540ttgttacaga gaggtatgag tgtagttggt aaattatgtt cttgacggtg
tatgtcacat 600attatttatt aaaactagaa aaaacagcgt caaaactagc
aaaaatccaa cggacaaaaa 660aatcggctga atttgatttg gttccaacat
ttaaaaaagt ttcagtgaga aagaatcggt 720gactgttgat gatataaaca
aagggcacat tggtcaataa ccataaaaaa ttatatgaca 780gctacagttg
gtagcatgtg ctcagctatt gaacaaatct aaagaaggta catctgtaac
840cggaacacca cttaaatgac taaattaccc tcatcagaaa gcagatggag
tgctacaaat 900aacacactat tcaacaacca taaataaaac gtgttcagct
actaaaacaa atataaataa 960atctatgttt gtaagcactc cagccatgtt
aatggagtgc tattgcctgt taactctcac 1020ttataaaata gtagtagaaa
aaatatgaac caaaacacaa c 106114711DNANicotiana tabacum 14gaattcaatg
gagaaggaaa atatttccag tgtaaacaca agtgaatgaa gagaagccaa 60aataatctct
atcattcaag ccttaggtgg agattaaaaa aattatttac tttcttatca
120aagtaatagg tgatcaacag ctttcgtaaa acgtcattag gagaatatta
taatctcttt 180tatgctgaag aacccacata aggaagatca taaaatacat
gactttcaga tgacttcttg 240gagctttatt tttaaagagt ggctagctgg
tcagcaaaga ggtgctcgtc agatatcata 300aaattttact attatttgtt
ttaagaggga gatggggcac acatgcttgt gacaaaagta 360agaggaagaa
aggagacaga agaggaaata gatttggggg gggggggggg ggtttcacaa
420tcaaagaaaa tttttaaaat ggagagagaa atgagcacac acatatacta
acaaaatttt 480actaataatt gcaccgagac aaacttatat tttagttcca
aaatgtcagt ctaaccctgc 540acgttgtaat gaatttttaa ctattatatt
atatcgagtt gcgccctcca ctcctcggtg 600tccaaattgt atttaaatgc
atagatgttt attgggagtg tacagcaagc tttcggaaaa 660tacaaaccat
aatactttct cttcttcaat ttgtttagtt taattttgaa a 711151278DNANicotiana
tabacum 15tgcgtcaaat ggataaacaa aaaaatagca taagttagtt ttgttactcg
agagttatgt 60attataaggt atagggaaat gactcaaaca taccactgaa cttaacgaaa
cgacgcatat 120atatactact taacttaacg aaaaaggggt gagagtggat
gggtgctggt aaataatgaa 180gggtttatat aacgtcacgt gtcaaaattc
gatagtagta gtttcgttag ttgtaatagc 240atatatggcc caaagttata
atatagataa tatgtttatg tccaactatt aacgagtgac 300atagacagtt
cattttgtga agttcaatga catatttgag ccctttccct tttattatct
360ccttttattt gttctaataa aagaatggca tttattatgt acatagacaa
ataactattt 420tctttggaat ataatttgtt tatatatttt aaaatcatgt
ctcaatttag tttgttttgt 480gcatatttca actattcaat tttgtccata
tatttattac cttcccccat ttacaagcat 540tgaaccgctt tgctcaccaa
aacttatgca cattgcaaaa atatcatgta aaggttttat 600gtatgctgta
attaaggtct gaactcatcg tgattttatt tttaggcttc attgaccact
660accaaactct ttgatgctac attttctaat tatattggag ttcgattata
tccgaattcg 720cgttgcgtag ggcccattcg agggaaaaca ctccctatca
aggatttttt catacccaga 780gctcgaactc aagacatctg gttaagggaa
gaacagtctc atccactgca ccatatcctt 840ttgtggtcaa caagtaaatt
ttatgtagaa ccaaaaacta tactcgaatt gataaaataa 900atggtgtaaa
atattgtttt ctttcttaca ttttggacag taaatatgta ggacaataat
960aattagcgtg gggtcttaag aaaattagca tagatttcca gaaattccaa
atcaaccggc 1020agttccaggt ttgaaaacta caactcattc cgacggttca
aacttcaaac catgcttgct 1080gactcggctt cttctttctt tttcaccaag
acagagcagt agtcacgtga cacccctcac 1140gtgcctcccc cctttatatt
tcagactgca accctacact ttcgctacat tcactaccat 1200attcttttca
ctaagcaatt ttctctccta cttttcttta aacccctttt ttctccccta
1260agccatggca tctagatc 1278161079DNANicotiana tabacum 16atcttattgt
ataaatatcc ataaacacat catgaaagac actttctttc acggtctgaa 60ttaattatga
tacaattcta atagaaaacg aattaaatta cgttgaattg tatgaaatct
120aattgaacaa gccaaccacg acgacgacta acgttgcctg gattgactcg
gtttaagtta 180accactaaaa aaacggagct gtcatgtaac acgcggatcg
agcaggtcac agtcatgaag 240ccatcaaagc aaaagaacta atccaagggc
tgagatgatt aattagttta aaaattagtt 300aacacgaggg aaaaggctgt
ctgacagcca ggtcacgtta tctttacctg tggtcgaaat 360gattcgtgtc
tgtcgatttt aattattttt ttgaaaggcc gaaaataaag ttgtaagaga
420taaacccgcc tatataaatt catatatttt ctctccgctt tgaattgtct
cgttgtcctc 480ctcactttca tcggccgttt ttgaatctcc ggcgacttga
cagagaagaa caaggaagaa 540gactaagaga gaaagtaaga gataatccag
gagattcatt ctccgttttg aatcttcctc 600aatctcatct tcttccgctc
tttctttcca aggtaatagg aactttctgg atctacttta 660tttgctggat
ctcgatcttg ttttctcaat ttccttgaga tctggaattc gtttaatttg
720gatctgtgaa cctccactaa atcttttggt tttactagaa tcgatctaag
ttgaccgatc
780agttagctcg attatagcta ccagaatttg gcttgacctt gatggagaga
tccatgttca 840tgttacctgg gaaatgattt gtatatgtga attgaaatct
gaactgttga agttagattg 900aatctgaaca ctgtcaatgt tagattgaat
ctgaacactg tttaagttag atgaagtttg 960tgtatagatt cttcgaaact
ttaggatttg tagtgtcgta cgttgaacag aaagctattt 1020ctgattcaat
cagggtttat ttgactgtat tgaactcttt ttgtgtgttt gcagctcat
1079171943DNANicotiana tabacum 17aagcttttta tttagctttt tcctccctat
ttcaatatat aatggctcaa tttttgtcag 60atagcaataa aaccatacaa gaaaataaaa
caaatcacaa aatacaaaaa gaggttatat 120ctccatgtat gcaatttcat
tatatgcata taagcatctt acgtataaaa aaaaagaggg 180aatcatggac
gtgtctttct aatccaagta gggtcaactt tatagggtcg gtgtatgtgt
240agtttaatcg aaaaagaatt ccatcattag gtaatttaca attagatcct
taaattatac 300aaatatataa gggtataaaa gttgatcaat atttcaggga
tattttagtc gttcaacatt 360tagtataaat tattcgtact tttataataa
taaatagata gataaacata gatatagata 420taaatataga tagataaatg
ggggatttgc atctataccc actttttggg tcacgtttta 480atttgtgccc
gctttgcaaa aaaaattgca agcgtacaca ctttttcgcg taacttcagc
540atacggggct aaagtagcaa agacagtcac gcaaaacttc agcatacttc
agtctttgct 600acttcagccc cgtatgctga agttatgcga aaagcgggta
tgcttgtaat ttttttgcaa 660agcgagcata agttaaaacg tgacacaaaa
agcgggtata gatacaaatg gccctttttt 720ttctagccaa attttattca
tttttttgga atactttttc actttatttt aaaattagtg 780tttggttata
aatttttaaa tacaacttgg agttggactc caaagtcttt acatacttat
840ttttagtttt attaccctat tttttttaac atgagatatt tacttttaca
gatctaaaaa 900tgatattttc ttagttttaa cactataaat agccatgaag
gcccatttcc tccctttgca 960aaaagtatac ccaaacgcaa ctccgtcttc
acctccaact ccaacttcat aatttcaatt 1020aaagtgaaaa ttattttaag
agaccatttg gacatgataa ttttttcact ttttccgaac 1080ttttttttac
tttttttcaa atcagtgttt ggccataaaa ttttcatttt tcacttgaag
1140ttgaattttt gaatttttcg agaattcgaa aaaccccaga aagctgtttt
tcaaaatttt 1200cactcggatc ctcacaaaac ttccaaaata acccaaaatt
atattcatgt ccaacacaac 1260tctaattttc aaataccatt ttcacttgaa
aaagaaattc accttttttt tttttttgaa 1320ctttacaatt cttatgtcca
aacgccccct tcgaatctac ggccaacgtt tattaagtaa 1380ggaaagaaaa
atggctataa taattatatc ccttttgaag taaatataat tctaccaaat
1440taattaatat gcttaaaaac aataaaaata atcaaaattg ctagagagga
caaccaatta 1500gccgaagcat tgtcaagatt gagcagggcg cagaatgaag
aaagtagttt tttatctttt 1560gatgccctac gccttttgta ttaaaatact
atatacaaga tttgaaaaag acgagttcca 1620ttcaaaacag ttcccttgtc
ccgaaatgtt cattgatgaa gtaatatgca cttttaaaat 1680tatttttttc
cagtttatcc taaaaaaaat attattttta taatcacata gaaataatat
1740atatcaaata acaaagggaa aaagaaagta gggaaagaaa ataataattg
aagtgggctg 1800ggctttgaca tggaaaggaa tggcttagta ataattgaag
ttagcatcgg atctatttga 1860agtgccactc atccctcaga aaaacagtgt
tagtattttc tctcacaaat tgattctgtg 1920gtccgaattg gagttcctaa atc
194318690DNAArabidopsis thaliana 18ttcgttgaaa aatcatcgaa attttcgacg
gattccaatg atcaaaaatt cgtcaataat 60ttccaacgat attctgacta aactaaatct
gatgaaatat ttttgacggc tttccaacca 120aaatatttcg ttgtgacttg
tcaaaaatcc gttagaatac taagcaactt ttcgacagat 180tttcagcaaa
aatattcggt aatataacgt gttaaaaata tgataaaaaa aaaaacttga
240tgaatctact aaaactaaat tttcaatcat atatatctat tattcatata
tttcattcat 300tttattattt ttctcttaac aattatttag ttattctggt
atcgtgtaat tatattcata 360tgatttattc tgatattgat tcggttagca
tccggataaa tctgggttgg gctttttaac 420ttggtttttc taagaaaaat
tctaatatga tttggttagc atccggatta gtctagtttg 480gtaggcctgc
ctttgtgatt cttaactcgg tcttttgtat gggtttgaac aattactaca
540ccatttagat tcttctgacc catatcaaat aaagatccac ttaggcccat
tagggttaga 600acaaacatga ggttgcagaa taaaaagggt tcattttcct
cactctcaag ttggatctca 660aaaccctaat atctgaactt cgccgtcgag
69019995DNAArabidopsis thaliana 19ttctgttcgt atatttgtaa ctattatgtg
tatttttatt ttgttagtat tactaattca 60agtggtttaa gttgttgaga ctctttaaaa
tctaagcatt ttataaacaa taatatataa 120ttattgttta ggctaaattt
gtcactaatt aaggtttgga tacatagtgt ctaaactaag 180ctaataatat
cacttaacgt ttacttgtaa cgctaggtga tgatgtcgtc aagtcaattg
240gtacaaggaa taaacgagtg gtcatatgac attatgacca tatgaattca
aactccagta 300atccaatggt aattggattc aatgatcaag acttgaacca
cgtaatccac ccttatcctt 360agaagctcat aaatatcact aaagggacag
gcaacactta accagtagtt gtccaataat 420ttagttttcc aaaatgaaaa
attattgttg tcatctattt taggtgtttt agttcaatgt 480ggattcctcg
tcctaacaaa tacttgacga atatatctag actataaaat tggttatgag
540ttctactttt ttttgtttgt gaaattatca aaatttgtta tatttattta
tttattctca 600ttaatttgag tactaatttt taaattattt atactaaaaa
caattactaa gatacaaaaa 660tggataagag catggtgtat agatatttaa
tgggatagaa tatttcccat aattgtatgt 720gtgtgagagg ttttgttttc
gtaaggaaag aaacaaaaac catttgacca aagaaaagca 780aaagaaggca
aggaatcaaa caacaaatgt tgcaaggcag aaataatgga cgttatgtta
840atgtagtgtc gtcacacgtg acttaaaaga gacgagtctg cgtgtcaaac
taaaaatgta 900tgcaactata aaaatgggat ttgattatct ttttagtacc
gaagcctacc aaccacatgc 960acactaattc tactcgccaa ataaagtgaa aagag
995201017DNAArabidopsis thaliana 20aagtaacttt tagaattgat tcaatctttt
tagaatagat tttttttttt tttttttttg 60gatttcgctg aggttttacc attttgttac
tcagcatatt ttaacgatgt tgcatttgtg 120tcccatatac gttattgtta
gtgaaaaata taatgtaaga ataatttata taactatcct 180actagcaaag
ctaacgcaaa ttttgaactc gaactttagt taccgtgaat gaaaataaca
240gacttgaact ttataatact cgtagtatac gtaatttttg ctttttgcag
atatgcttgc 300cactaataaa gtcataaatt ttatattttc ataaactata
gttatacact tttgactaaa 360caaacaaaat cggtttagca aaagaaaaag
ttacttttct gatgaactag gataaggaat 420tcggaactga attttgctac
gttctctctg gaccacacac actgaacacc cttttaagat 480tttctccttc
tctttttcaa cgtaatttat cttttgatca gaaacgacaa aaaagaagtc
540taacaatatc aaacaatttt tttatagata tttttagata tttttcctgc
taattttatc 600tagtgtagac aaacccaaat atacgattat tataaaaaca
cgaaatacca agtggacgac 660tgaggttaat agatctagcc gtagaataaa
gatctgcatg aaaggcggtg agaatctaaa 720cggtgataag accataacac
acggaacatc ggtacgctct cgaacgtaca agaatcgacg 780acacacaaac
actccacaat tatttgaaca ctggacaatt attgaaccga cgtacgagaa
840tcaatgcgct gagggtaaag acgtaaatga agaactagtt ttggagataa
gagcggagaa 900agattgcgac acatgtatgg tcaatattaa tctcatttag
cttataaatt tgggagcttc 960ctctatcatt aattttcatt cataaatttt
tcttcaattt gaattttctc gagaaaa 101721273DNAArabidopsis thaliana
21gcaagtgtgt tgcctttgtg tggaaatgaa gaggtacttg cgaggacttt gcgtttatca
60gtttatgtgt ttgtatatct atttgatcca gttattatgg attatatacg cttgaaactc
120attttaagcc attgttattg aacgtttatc aaatacttta ttatgccaag
caagtcaaac 180acatgcttgt tgattgaaat caagctatag aaatctcttc
ttcacataca gcagtttaga 240ttcacaatac aacaagcgaa acgataaagt ttc
273221131DNAArabidopsis thaliana 22gtccgtcgct tctcttccat ttcttctcat
tttcgatttt gattcttatt tctttccagt 60agctcctgct ctgtgaattt ctccgctcac
gatagatctg cttatactcc ttacattcaa 120ccttagatct ggtctcgatt
ctctgtttct ctgttttttt cttttggtcg agaatctgat 180gtttgtttat
gttctgtcac cattaataat aatgaactct ctcattcata caatgattag
240tttctctcgt ctacaaaacg atatgttgca ttttcacttt tcttcttttt
ttctaagatg 300atttgctttg accaatttgt ttagatcttt attttatttt
attttctggt gggttggtgg 360aaattgaaaa aaaaaaaaac agcataaatt
gttatttgtt aatgtattca ttttttggct 420atttgttctg ggtaaaaatc
tgcttctact attgaatctt tcctggattt tttactccta 480ttgggttttt
atagtaaaaa tacataataa aaggaaaaca aaagttttat agattctctt
540aaacccctta cgataaaagt tggaatcaaa ataattcagg atcagatgct
ctttgattga 600ttcagatgcg attacagttg catggcaaat tttctagatc
cgtcgtcaca ttttattttc 660tgtttaaata tctaaatctg atatatgatg
tcgacaaatt ctggtggctt atacatcact 720tcaactgttt tcttttggct
ttgtttgtca acttggtttt caatacgatt tgtgatttcg 780atcgctgaat
ttttaataca agcaaactga tgttaaccac aagcaagaga tgtgacctgc
840cttattaaca tcgtattact tactactagt cgtattctca acgcaatcgt
ttttgtattt 900ctcacattat gccgcttctc tactctttat tccttttggt
ccacgcattt tctatttgtg 960gcaatccctt tcacaacctg atttcccact
ttggatcatt tgtctgaaga ctctcttgaa 1020tcgttaccac ttgtttcttg
tgcatgctct gttttttaga attaatgata aaactattcc 1080atagtcttga
gttttcagct tgttgattct tttgcttttg gttttctgca g
1131235688DNAArtificial SequenceArtificially created chimeric
nucleic acid sequence 23ctcgaggatc taaattgtga gttcaatctc ttccctattg
gattgattat cctttctttt 60cttccaattt gtgtttcttt ttgcctaatt tattgtgtta
tcccctttat cctattttgt 120ttctttactt atttatttgc ttctatgtct
ttgtacaaag atttaaactc tatggcacat 180attttaaagt tgttagaaaa
taaattcttt caagattgat gaaagaactt tttaattgta 240gatatttcgt
agattttatt ctcttactac caatataacg cttgaattga cgaaaatttg
300tgtccaaata tctagcaaaa aggtatccaa tgaaaatata tcatatgtga
tcttcaaatc 360ttgtgtctta tgcaagattg atactttgtt caatggaaga
gattgtgtgc atatttttaa 420aatttttatt agtaataaag attctatata
gctgttatag agggataatt ttacaaagaa 480cactataaat atgattgttg
ttgttagggt gtcaatggtt cggttcgact ggttatttta 540taaaatttgt
accataccat ttttttcgat attctatttt gtataaccaa aattagactt
600ttcgaaatcg tcccaatcat gtcggtttca cttcggtatc ggtaccgttc
ggttaatttt 660catttttttt taaatgtcat taaaattcac tagtaaaaat
agaatgcaat aacatacgtt 720cttttatagg acttagcaaa agctctctag
acatttttac tgtttaaagg ataatgaatt 780aaaaaacatg aaagatggct
agagtataga tacacaacta ttcgacagca acgtaaaaga 840aaccaagtaa
aagcaaagaa aatataaatc acacgagtgg aaagatatta accaagttgg
900gattcaagaa taaagtctat attaaatatt caaaaagata aatttaaata
atatgaaagg 960aaacatattc aatacattgt agtttgctac tcataatcgc
tagaatactt tgtgccttgc 1020taataaagat acttgaaata gcttagttta
aatataaata gcataataga ttttaggaat 1080tagtattttg agtttaatta
cttattgact tgtaacagtt tttataattc caaggcccat 1140gaaaaattta
atgctttatt agttttaaac ttactatata aatttttcat atgtaaaatt
1200taatcggtat agttcgatat tttttcaatt tatttttata aaataaaaaa
cttaccctaa 1260ttatcggtac agttatagat ttatataaaa atctacggtt
cttcagaaga aacctaaaaa 1320tcggttcggt gcggacggtt cgatcggttt
agtcgatttt caaatattca ttgacactcc 1380tagttgttgt tataggtaaa
aagcagttac agagaggtaa aatataactt aaaaaatcag 1440ttctaaggaa
aaattgactt ttatagtaaa tgactgttat ataaggatgt tgttacagag
1500aggtatgagt gtagttggta aattatgttc ttgacggtgt atgtcacata
ttatttatta 1560aaactagaaa aaacagcgtc aaaactagca aaaatccaac
ggacaaaaaa atcggctgaa 1620tttgatttgg ttccaacatt taaaaaagtt
tcagtgagaa agaatcggtg actgttgatg 1680atataaacaa agggcacatt
ggtcaataac cataaaaaat tatatgacag ctacagttgg 1740tagcatgtgc
tcagctattg aacaaatcta aagaaggtac atctgtaacc ggaacaccac
1800ttaaatgact aaattaccct catcagaaag cagatggagt gctacaaata
acacactatt 1860caacaaccat aaataaaacg tgttcagcta ctaaaacaaa
tataaataaa tctatgtttg 1920taagcactcc agccatgtta atggagtgct
attgcctgtt aactctcact tataaaatag 1980tagtagaaaa aatatgaacc
aaaacacaac aacatctcaa aatatttgaa gtaacacaga 2040attttacata
caccaaactt ataaatcaag tattttcatt gtaacaaatt ccatgaaaca
2100tgaaaacaaa gctataatga aattaccaac tcaagcaata aggttggaaa
agagccatct 2160gagatattcc agcaatttac atctttttgt ttgattacac
agtgaaggat cttttgtttg 2220acaactagta aaatgattct tatttgcacc
tttcagctat tcagctgctt ttactccaac 2280cctatagcag aagtaatggc
gctcatgctc gttttgtacg ccttccaact tcaagggcga 2340gctctgtatc
gatcttcagg gaaatgtcaa gtgctttcac ggaatgcgtc agggcaccac
2400tagaaatgta ggtaacacca gtttgtccaa tcttgtgtac tgtttcaagg
gtaacatttc 2460ctgaagcctc cgtatcaaac ctcccattga tcaattctac
agcctcctta agcatggata 2520catcaatatc tccgttagat aatggaacaa
ccatattgtc cagcattatc ctagtcaacg 2580aagtctttgt ttgagatgca
tagtctagaa cctcacgtac ttcttcaatt gtcctggttt 2640caacctcaac
ccctatttga agtttatttt gctccaaata ctgatccaca gattttagag
2700ctttgccgac acctccagca gcagatatgt gattgtcttt tatcattacc
atatcaaata 2760agcccattct gtgattcttc cccccaccga tcaataccgc
ccatttatcc accaaacgta 2820atccaggagc agttttccta gtctccaaga
tgtaagcagg gtgtgcagca tctgccattt 2880ccttagttag tgtagctatt
ccactcattc tttgcataaa attgagaaca accctctcag 2940ctataacaat
gttgtaagcg tttccttgta ctttgccaaa tttcaagcct ttatgaactt
3000tatcgccatc atttacatac cactccacct ttaatgaagg atcaacttcc
gcgaatatca 3060tctcagcaag tgcaattcct gctatgatcc cgtcttcctt
tgctagaaaa tgagcatcgg 3120attccatatc aagaggaatt gtcgccttac
aagtcacatc tcctaaattc ccagcatctt 3180cagagagtgc aagtttcata
acttccttta aatcataagt tgggtgtgct ggtggtttca 3240cctctaatga
ctccactctt gtattcttgg tggctattgc tgacattttc accaccaacc
3300ttggagctgt aattgcataa ggatgcactg tagcagtgaa aggaatagct
ctaaacatgg 3360tttttttttg ggggggttgt gaaatgaatt ttgtggaaaa
tagtttttgg ggcacatcaa 3420tcctgcggtg acattcggaa tgtttctaac
aagaaagata tcgttggtcc gagccttgct 3480ctacatcata gctcagtgca
taggggccct gtgcgggtgc gccttagtca agacattgca 3540gcgagatcat
tacaaccact atggcggtgg cgctaaccag ctcgttgatg gttatagccg
3600aggcactggc cttgctgttg agattatggg cacctttatt cttctgtata
ctgtcttctc 3660cgccactgat cccaaacgca atgctagaga ttcccatgtt
cctgtcttgg ctccactccc 3720cattggcttt gctgtcttca ttgttcacct
cgccaccatt cccgtcaccg gcactggcat 3780caacccagcg agcaaaaact
attttccaca aaattcattt cacaaccccc ccaaaaaaaa 3840accatgttta
gagctattcc tttcactgct acagtgcatc cttatgcaat tacagctcca
3900aggttggtgg tgaaaatgtc agcaatagcc accaagaata caagagtgga
gtcattagag 3960gtgaaaccac cagcacaccc aacttatgat ttaaaggaag
ttatgaaact tgcactctct 4020gaagatgctg ggaatttagg agatgtgact
tgtaaggcga caattcctct tgatatggaa 4080tccgatgctc attttctagc
aaaggaagac gggatcatag caggaattgc acttgctgag 4140atgatattcg
cggaagttga tccttcatta aaggtggagt ggtatgtaaa tgatggcgat
4200aaagttcata aaggcttgaa atttggcaaa gtacaaggaa acgcttacaa
cattgttata 4260gctgagaggg ttgttctcaa ttttatgcaa agaatgagtg
gaatagctac actaactaag 4320gaaatggcag atgctgcaca ccctgcttac
atcttggaga ctaggaaaac tgctcctgga 4380ttacgtttgg tggataaatg
ggcggtattg atcggtgggg ggaagaatca cagaatgggc 4440ttatttgata
tggtaatgat aaaagacaat cacatatctg ctgctggagg tgtcggcaaa
4500gctctaaaat ctgtggatca gtatttggag caaaataaac ttcaaatagg
ggttgaggtt 4560gaaaccagga caattgaaga agtacgtgag gttctagact
atgcatctca aacaaagact 4620tcgttgacta ggataatgct ggacaatatg
gttgttccat tatctaacgg agatattgat 4680gtatccatgc ttaaggaggc
tgtagaattg atcaatggga ggtttgatac ggaggcttca 4740ggaaatgtta
cccttgaaac agtacacaag attggacaaa ctggtgttac ctacatttct
4800agtggtgccc tgacgcattc cgtgaaagca cttgacattt ccctgaagat
cgatacagag 4860ctcgcccttg aagttggaag gcgtacaaaa cgagcatgag
cgccattact tctgctatag 4920ggttggagta aaagcagctg aatagctgaa
aggtgcaaat aagaatcatt ttactagttg 4980tcaaacaaaa gatccttcac
tgtgtaatca aacaaaaaga tgtaaattgc tggaatatct 5040cagatggctc
ttttccaacc ttattgcttg agttggtaat ttcattatag ctttgttttc
5100atgtttcatg gaatttgtta caatgaaaat acttgattta taagtttggt
gtatgtaaaa 5160ttctgtgtta cttcaaatat tttgagatgt tgagctcgtg
aaatggcctc tttagttttt 5220gattgaatca taggggtatt agttttctat
ggccgggagt ggtcttcttg cttaattgta 5280atggaataac cagagaggaa
ctactgtgtt atctttgagg aatgttgggc ttttttcgtt 5340tgaattatca
tgaatgaaat tttacttttt cccaatacaa gtttgttttc gtttcttggt
5400ttttgttatc ccttggttta tgtcttggtt tggcttaaat gattgaagat
tacactacct 5460atgtttctgc tattcctgtt gaagatcaca tttgataata
atgcatcgaa tgcattaaag 5520tttcttattg gctctgtcaa aagtattgaa
ggtggatttt tctaattggc aagagaaagt 5580attaaagagg tgatttatta
gtacttatat ttttctcagc atctctcttt cagtgttgga 5640gcttcataaa
attagcactt cagagtttca gtcgggagct gaattcga 5688244134DNAArtificial
SequenceArtificially created chimeric nucleic acid sequence
24ctcgaggatc taaattgtga gttcaatctc ttccctattg gattgattat cctttctttt
60cttccaattt gtgtttcttt ttgcctaatt tattgtgtta tcccctttat cctattttgt
120ttctttactt atttatttgc ttctatgtct ttgtacaaag atttaaactc
tatggcacat 180attttaaagt tgttagaaaa taaattcttt caagattgat
gaaagaactt tttaattgta 240gatatttcgt agattttatt ctcttactac
caatataacg cttgaattga cgaaaatttg 300tgtccaaata tctagcaaaa
aggtatccaa tgaaaatata tcatatgtga tcttcaaatc 360ttgtgtctta
tgcaagattg atactttgtt caatggaaga gattgtgtgc atatttttaa
420aatttttatt agtaataaag attctatata gctgttatag agggataatt
ttacaaagaa 480cactataaat atgattgttg ttgttagggt gtcaatggtt
cggttcgact ggttatttta 540taaaatttgt accataccat ttttttcgat
attctatttt gtataaccaa aattagactt 600ttcgaaatcg tcccaatcat
gtcggtttca cttcggtatc ggtaccgttc ggttaatttt 660catttttttt
taaatgtcat taaaattcac tagtaaaaat agaatgcaat aacatacgtt
720cttttatagg acttagcaaa agctctctag acatttttac tgtttaaagg
ataatgaatt 780aaaaaacatg aaagatggct agagtataga tacacaacta
ttcgacagca acgtaaaaga 840aaccaagtaa aagcaaagaa aatataaatc
acacgagtgg aaagatatta accaagttgg 900gattcaagaa taaagtctat
attaaatatt caaaaagata aatttaaata atatgaaagg 960aaacatattc
aatacattgt agtttgctac tcataatcgc tagaatactt tgtgccttgc
1020taataaagat acttgaaata gcttagttta aatataaata gcataataga
ttttaggaat 1080tagtattttg agtttaatta cttattgact tgtaacagtt
tttataattc caaggcccat 1140gaaaaattta atgctttatt agttttaaac
ttactatata aatttttcat atgtaaaatt 1200taatcggtat agttcgatat
tttttcaatt tatttttata aaataaaaaa cttaccctaa 1260ttatcggtac
agttatagat ttatataaaa atctacggtt cttcagaaga aacctaaaaa
1320tcggttcggt gcggacggtt cgatcggttt agtcgatttt caaatattca
ttgacactcc 1380tagttgttgt tataggtaaa aagcagttac agagaggtaa
aatataactt aaaaaatcag 1440ttctaaggaa aaattgactt ttatagtaaa
tgactgttat ataaggatgt tgttacagag 1500aggtatgagt gtagttggta
aattatgttc ttgacggtgt atgtcacata ttatttatta 1560aaactagaaa
aaacagcgtc aaaactagca aaaatccaac ggacaaaaaa atcggctgaa
1620tttgatttgg ttccaacatt taaaaaagtt tcagtgagaa agaatcggtg
actgttgatg 1680atataaacaa agggcacatt ggtcaataac cataaaaaat
tatatgacag ctacagttgg 1740tagcatgtgc tcagctattg aacaaatcta
aagaaggtac atctgtaacc ggaacaccac 1800ttaaatgact aaattaccct
catcagaaag cagatggagt gctacaaata acacactatt 1860caacaaccat
aaataaaacg tgttcagcta ctaaaacaaa tataaataaa tctatgtttg
1920taagcactcc agccatgtta atggagtgct attgcctgtt aactctcact
tataaaatag 1980tagtagaaaa aatatgaacc aaaacacaac tttatcgcca
tcatttacat accactccac 2040ctttaatgaa ggatcaactt ccgcgaatat
catctcagca agtgcaattc ctgctatgat 2100cccgtcttcc tttgctagaa
aatgagcatc ggattccata tcaagaggaa ttgtcgcctt 2160acaagtcaca
tctcctaaat tcccagcatc ttcagagagt gcaagtttca taacttcctt
2220taaatcataa gttgggtgtg ctggtggttt cacctctaat gactccactc
ttgtattctt 2280ggtggctatt gctgacattt tcaccaccaa ccttggagct
gtaattgcat aaggatgcac 2340tgtagcagtg aaaggaatag ctctaaacat
gtccgtcgct tctcttccat ttcttctcat 2400tttcgatttt gattcttatt
tctttccagt agctcctgct ctgtgaattt ctccgctcac 2460gatagatctg
cttatactcc ttacattcaa ccttagatct ggtctcgatt ctctgtttct
2520ctgttttttt cttttggtcg
agaatctgat gtttgtttat gttctgtcac cattaataat 2580aatgaactct
ctcattcata caatgattag tttctctcgt ctacaaaacg atatgttgca
2640ttttcacttt tcttcttttt ttctaagatg atttgctttg accaatttgt
ttagatcttt 2700attttatttt attttctggt gggttggtgg aaattgaaaa
aaaaaaaaac agcataaatt 2760gttatttgtt aatgtattca ttttttggct
atttgttctg ggtaaaaatc tgcttctact 2820attgaatctt tcctggattt
tttactccta ttgggttttt atagtaaaaa tacataataa 2880aaggaaaaca
aaagttttat agattctctt aaacccctta cgataaaagt tggaatcaaa
2940ataattcagg atcagatgct ctttgattga ttcagatgcg attacagttg
catggcaaat 3000tttctagatc cgtcgtcaca ttttattttc tgtttaaata
tctaaatctg atatatgatg 3060tcgacaaatt ctggtggctt atacatcact
tcaactgttt tcttttggct ttgtttgtca 3120acttggtttt caatacgatt
tgtgatttcg atcgctgaat ttttaataca agcaaactga 3180tgttaaccac
aagcaagaga tgtgacctgc cttattaaca tcgtattact tactactagt
3240cgtattctca acgcaatcgt ttttgtattt ctcacattat gccgcttctc
tactctttat 3300tccttttggt ccacgcattt tctatttgtg gcaatccctt
tcacaacctg atttcccact 3360ttggatcatt tgtctgaaga ctctcttgaa
tcgttaccac ttgtttcttg tgcatgctct 3420gttttttaga attaatgata
aaactattcc atagtcttga gttttcagct tgttgattct 3480tttgcttttg
gttttctgca gatgtttaga gctattcctt tcactgctac agtgcatcct
3540tatgcaatta cagctccaag gttggtggtg aaaatgtcag caatagccac
caagaataca 3600agagtggagt cattagaggt gaaaccacca gcacacccaa
cttatgattt aaaggaagtt 3660atgaaacttg cactctctga agatgctggg
aatttaggag atgtgacttg taaggcgaca 3720attcctcttg atatggaatc
cgatgctcat tttctagcaa aggaagacgg gatcatagca 3780ggaattgcac
ttgctgagat gatattcgcg gaagttgatc cttcattaaa ggtggagtgg
3840tatgtaaatg atggcgataa agcaagtgtg ttgcctttgt gtggaaatga
agaggtactt 3900gcgaggactt tgcgtttatc agtttatgtg tttgtatatc
tatttgatcc agttattatg 3960gattatatac gcttgaaact cattttaagc
cattgttatt gaacgtttat caaatacttt 4020attatgccaa gcaagtcaaa
cacatgcttg ttgattgaaa tcaagctata gaaatctctt 4080cttcacatac
agcagtttag attcacaata caacaagcga aacgataaag tttc
4134253896DNAArtificial SequenceArtificially created chimeric
nucleic acid sequence 25ctcgaggatc taaattgtga gttcaatctc ttccctattg
gattgattat cctttctttt 60cttccaattt gtgtttcttt ttgcctaatt tattgtgtta
tcccctttat cctattttgt 120ttctttactt atttatttgc ttctatgtct
ttgtacaaag atttaaactc tatggcacat 180attttaaagt tgttagaaaa
taaattcttt caagattgat gaaagaactt tttaattgta 240gatatttcgt
agattttatt ctcttactac caatataacg cttgaattga cgaaaatttg
300tgtccaaata tctagcaaaa aggtatccaa tgaaaatata tcatatgtga
tcttcaaatc 360ttgtgtctta tgcaagattg atactttgtt caatggaaga
gattgtgtgc atatttttaa 420aatttttatt agtaataaag attctatata
gctgttatag agggataatt ttacaaagaa 480cactataaat atgattgttg
ttgttagggt gtcaatggtt cggttcgact ggttatttta 540taaaatttgt
accataccat ttttttcgat attctatttt gtataaccaa aattagactt
600ttcgaaatcg tcccaatcat gtcggtttca cttcggtatc ggtaccgttc
ggttaatttt 660catttttttt taaatgtcat taaaattcac tagtaaaaat
agaatgcaat aacatacgtt 720cttttatagg acttagcaaa agctctctag
acatttttac tgtttaaagg ataatgaatt 780aaaaaacatg aaagatggct
agagtataga tacacaacta ttcgacagca acgtaaaaga 840aaccaagtaa
aagcaaagaa aatataaatc acacgagtgg aaagatatta accaagttgg
900gattcaagaa taaagtctat attaaatatt caaaaagata aatttaaata
atatgaaagg 960aaacatattc aatacattgt agtttgctac tcataatcgc
tagaatactt tgtgccttgc 1020taataaagat acttgaaata gcttagttta
aatataaata gcataataga ttttaggaat 1080tagtattttg agtttaatta
cttattgact tgtaacagtt tttataattc caaggcccat 1140gaaaaattta
atgctttatt agttttaaac ttactatata aatttttcat atgtaaaatt
1200taatcggtat agttcgatat tttttcaatt tatttttata aaataaaaaa
cttaccctaa 1260ttatcggtac agttatagat ttatataaaa atctacggtt
cttcagaaga aacctaaaaa 1320tcggttcggt gcggacggtt cgatcggttt
agtcgatttt caaatattca ttgacactcc 1380tagttgttgt tataggtaaa
aagcagttac agagaggtaa aatataactt aaaaaatcag 1440ttctaaggaa
aaattgactt ttatagtaaa tgactgttat ataaggatgt tgttacagag
1500aggtatgagt gtagttggta aattatgttc ttgacggtgt atgtcacata
ttatttatta 1560aaactagaaa aaacagcgtc aaaactagca aaaatccaac
ggacaaaaaa atcggctgaa 1620tttgatttgg ttccaacatt taaaaaagtt
tcagtgagaa agaatcggtg actgttgatg 1680atataaacaa agggcacatt
ggtcaataac cataaaaaat tatatgacag ctacagttgg 1740tagcatgtgc
tcagctattg aacaaatcta aagaaggtac atctgtaacc ggaacaccac
1800ttaaatgact aaattaccct catcagaaag cagatggagt gctacaaata
acacactatt 1860caacaaccat aaataaaacg tgttcagcta ctaaaacaaa
tataaataaa tctatgtttg 1920taagcactcc agccatgtta atggagtgct
attgcctgtt aactctcact tataaaatag 1980tagtagaaaa aatatgaacc
aaaacacaac cgattcaaaa cttcagcagg aaaatttata 2040ttaaagtacg
aaacaccaca gagaaagaat tttacaatga ttgtgaattg gaaattatga
2100taattactgc agaattctcc tacaatacgt cgcatttcac ttatttattc
acttgattaa 2160gactcgatct tggtccaatg attgtactac cagtgttcat
tattcacttg attaagactc 2220gatcatactt ctggcgaaag atggtaaaat
ggtccgtcgc ttctcttcca tttcttctca 2280ttttcgattt tgattcttat
ttctttccag tagctcctgc tctgtgaatt tctccgctca 2340cgatagatct
gcttatactc cttacattca accttagatc tggtctcgat tctctgtttc
2400tctgtttttt tcttttggtc gagaatctga tgtttgttta tgttctgtca
ccattaataa 2460taatgaactc tctcattcat acaatgatta gtttctctcg
tctacaaaac gatatgttgc 2520attttcactt ttcttctttt tttctaagat
gatttgcttt gaccaatttg tttagatctt 2580tattttattt tattttctgg
tgggttggtg gaaattgaaa aaaaaaaaaa cagcataaat 2640tgttatttgt
taatgtattc attttttggc tatttgttct gggtaaaaat ctgcttctac
2700tattgaatct ttcctggatt ttttactcct attgggtttt tatagtaaaa
atacataata 2760aaaggaaaac aaaagtttta tagattctct taaacccctt
acgataaaag ttggaatcaa 2820aataattcag gatcagatgc tctttgattg
attcagatgc gattacagtt gcatggcaaa 2880ttttctagat ccgtcgtcac
attttatttt ctgtttaaat atctaaatct gatatatgat 2940gtcgacaaat
tctggtggct tatacatcac ttcaactgtt ttcttttggc tttgtttgtc
3000aacttggttt tcaatacgat ttgtgatttc gatcgctgaa tttttaatac
aagcaaactg 3060atgttaacca caagcaagag atgtgacctg ccttattaac
atcgtattac ttactactag 3120tcgtattctc aacgcaatcg tttttgtatt
tctcacatta tgccgcttct ctactcttta 3180ttccttttgg tccacgcatt
ttctatttgt ggcaatccct ttcacaacct gatttcccac 3240tttggatcat
ttgtctgaag actctcttga atcgttacca cttgtttctt gtgcatgctc
3300tgttttttag aattaatgat aaaactattc catagtcttg agttttcagc
ttgttgattc 3360ttttgctttt ggttttctgc agcattttac catctttcgc
cagaagtatg atcgagtctt 3420aatcaagtga ataatgaaca ctggtagtac
aatcattgga ccaagatcga gtcttaatca 3480agtgaataaa taagtgaaat
gcgacgtatt gtaggagaat tctgcagtaa ttatcataat 3540ttccaattca
caatcattgt aaaattcttt ctctgtggtg tttcgtactt taatataaat
3600tttcctgctg aagttttgaa tcggcaagtg tgttgccttt gtgtggaaat
gaagaggtac 3660ttgcgaggac tttgcgttta tcagtttatg tgtttgtata
tctatttgat ccagttatta 3720tggattatat acgcttgaaa ctcattttaa
gccattgtta ttgaacgttt atcaaatact 3780ttattatgcc aagcaagtca
aacacatgct tgttgattga aatcaagcta tagaaatctc 3840ttcttcacat
acagcagttt agattcacaa tacaacaagc gaaacgataa agtttc
3896264670DNAArtificial SequenceArtificially created chimeric
nucleic acid sequence 26ctcgaggatc taaattgtga gttcaatctc ttccctattg
gattgattat cctttctttt 60cttccaattt gtgtttcttt ttgcctaatt tattgtgtta
tcccctttat cctattttgt 120ttctttactt atttatttgc ttctatgtct
ttgtacaaag atttaaactc tatggcacat 180attttaaagt tgttagaaaa
taaattcttt caagattgat gaaagaactt tttaattgta 240gatatttcgt
agattttatt ctcttactac caatataacg cttgaattga cgaaaatttg
300tgtccaaata tctagcaaaa aggtatccaa tgaaaatata tcatatgtga
tcttcaaatc 360ttgtgtctta tgcaagattg atactttgtt caatggaaga
gattgtgtgc atatttttaa 420aatttttatt agtaataaag attctatata
gctgttatag agggataatt ttacaaagaa 480cactataaat atgattgttg
ttgttagggt gtcaatggtt cggttcgact ggttatttta 540taaaatttgt
accataccat ttttttcgat attctatttt gtataaccaa aattagactt
600ttcgaaatcg tcccaatcat gtcggtttca cttcggtatc ggtaccgttc
ggttaatttt 660catttttttt taaatgtcat taaaattcac tagtaaaaat
agaatgcaat aacatacgtt 720cttttatagg acttagcaaa agctctctag
acatttttac tgtttaaagg ataatgaatt 780aaaaaacatg aaagatggct
agagtataga tacacaacta ttcgacagca acgtaaaaga 840aaccaagtaa
aagcaaagaa aatataaatc acacgagtgg aaagatatta accaagttgg
900gattcaagaa taaagtctat attaaatatt caaaaagata aatttaaata
atatgaaagg 960aaacatattc aatacattgt agtttgctac tcataatcgc
tagaatactt tgtgccttgc 1020taataaagat acttgaaata gcttagttta
aatataaata gcataataga ttttaggaat 1080tagtattttg agtttaatta
cttattgact tgtaacagtt tttataattc caaggcccat 1140gaaaaattta
atgctttatt agttttaaac ttactatata aatttttcat atgtaaaatt
1200taatcggtat agttcgatat tttttcaatt tatttttata aaataaaaaa
cttaccctaa 1260ttatcggtac agttatagat ttatataaaa atctacggtt
cttcagaaga aacctaaaaa 1320tcggttcggt gcggacggtt cgatcggttt
agtcgatttt caaatattca ttgacactcc 1380tagttgttgt tataggtaaa
aagcagttac agagaggtaa aatataactt aaaaaatcag 1440ttctaaggaa
aaattgactt ttatagtaaa tgactgttat ataaggatgt tgttacagag
1500aggtatgagt gtagttggta aattatgttc ttgacggtgt atgtcacata
ttatttatta 1560aaactagaaa aaacagcgtc aaaactagca aaaatccaac
ggacaaaaaa atcggctgaa 1620tttgatttgg ttccaacatt taaaaaagtt
tcagtgagaa agaatcggtg actgttgatg 1680atataaacaa agggcacatt
ggtcaataac cataaaaaat tatatgacag ctacagttgg 1740tagcatgtgc
tcagctattg aacaaatcta aagaaggtac atctgtaacc ggaacaccac
1800ttaaatgact aaattaccct catcagaaag cagatggagt gctacaaata
acacactatt 1860caacaaccat aaataaaacg tgttcagcta ctaaaacaaa
tataaataaa tctatgtttg 1920taagcactcc agccatgtta atggagtgct
attgcctgtt aactctcact tataaaatag 1980tagtagaaaa aatatgaacc
aaaacacaac ggttgtgtat ttcacttttg gatatagctc 2040agtggcttcg
acacctgtag gaggctgaac ctcaaagttt gcagaatctc cattaacaaa
2100aactgaatgg catatggcca aattagtcct taatggcaga ggtccctctt
gtacaatctg 2160gagaatatct tcctctgata gatataactt ctcgagggtc
ttcccaattt tgtcctccca 2220caaggacact atctcgttga aggatagaat
attggcaggt ggtctcatgt gaagagtctt 2280attcaatgtc cgtggatcat
ctactgcttc gatagtgtat gtcgctatgt cttcttcctt 2340cacatatatt
gctttgggat ttccatcgcc aaaaatgaca actttgtctc taggaggggt
2400tttggcctct aactgcccca agttgggcaa gaagaaatct gcaaaccaat
tgcagattac 2460atatgtgtat ggaattcctt ctgcctctat catcctcctg
attcttacct ttagagcgaa 2520gagtgatgca gctggttcaa ttgcacgagc
atgatccaca tcaaatccaa attctgaagg 2580aagaaatctc ttgatatttc
cagcttcttt aattgctttg atgatgttca cttgatcagt 2640ccgtcgcttc
tcttccattt cttctcattt tcgattttga ttcttatttc tttccagtag
2700ctcctgctct gtgaatttct ccgctcacga tagatctgct tatactcctt
acattcaacc 2760ttagatctgg tctcgattct ctgtttctct gtttttttct
tttggtcgag aatctgatgt 2820ttgtttatgt tctgtcacca ttaataataa
tgaactctct cattcataca atgattagtt 2880tctctcgtct acaaaacgat
atgttgcatt ttcacttttc ttcttttttt ctaagatgat 2940ttgctttgac
caatttgttt agatctttat tttattttat tttctggtgg gttggtggaa
3000attgaaaaaa aaaaaaacag cataaattgt tatttgttaa tgtattcatt
ttttggctat 3060ttgttctggg taaaaatctg cttctactat tgaatctttc
ctggattttt tactcctatt 3120gggtttttat agtaaaaata cataataaaa
ggaaaacaaa agttttatag attctcttaa 3180accccttacg ataaaagttg
gaatcaaaat aattcaggat cagatgctct ttgattgatt 3240cagatgcgat
tacagttgca tggcaaattt tctagatccg tcgtcacatt ttattttctg
3300tttaaatatc taaatctgat atatgatgtc gacaaattct ggtggcttat
acatcacttc 3360aactgttttc ttttggcttt gtttgtcaac ttggttttca
atacgatttg tgatttcgat 3420cgctgaattt ttaatacaag caaactgatg
ttaaccacaa gcaagagatg tgacctgcct 3480tattaacatc gtattactta
ctactagtcg tattctcaac gcaatcgttt ttgtatttct 3540cacattatgc
cgcttctcta ctctttattc cttttggtcc acgcattttc tatttgtggc
3600aatccctttc acaacctgat ttcccacttt ggatcatttg tctgaagact
ctcttgaatc 3660gttaccactt gtttcttgtg catgctctgt tttttagaat
taatgataaa actattccat 3720agtcttgagt tttcagcttg ttgattcttt
tgcttttggt tttctgcagt gatcaagtga 3780acatcatcaa agcaattaaa
gaagctggaa atatcaagag atttcttcct tcagaatttg 3840gatttgatgt
ggatcatgct cgtgcaattg aaccagctgc atcactcttc gctctaaagg
3900taagaatcag gaggatgata gaggcagaag gaattccata cacatatgta
atctgcaatt 3960ggtttgcaga tttcttcttg cccaacttgg ggcagttaga
ggccaaaacc cctcctagag 4020acaaagttgt catttttggc gatggaaatc
ccaaagcaat atatgtgaag gaagaagaca 4080tagcgacata cactatcgaa
gcagtagatg atccacggac attgaataag actcttcaca 4140tgagaccacc
tgccaatatt ctatccttca acgagatagt gtccttgtgg gaggacaaaa
4200ttgggaagac cctcgagaag ttatatctat cagaggaaga tattctccag
attgtacaag 4260agggacctct gccattaagg actaatttgg ccatatgcca
ttcagttttt gttaatggag 4320attctgcaaa ctttgaggtt cagcctccta
caggtgtcga agccactgag ctatatccaa 4380aagtgaaata cacaaccgca
agtgtgttgc ctttgtgtgg aaatgaagag gtacttgcga 4440ggactttgcg
tttatcagtt tatgtgtttg tatatctatt tgatccagtt attatggatt
4500atatacgctt gaaactcatt ttaagccatt gttattgaac gtttatcaaa
tactttatta 4560tgccaagcaa gtcaaacaca tgcttgttga ttgaaatcaa
gctatagaaa tctcttcttc 4620acatacagca gtttagattc acaatacaac
aagcgaaacg ataaagtttc 4670275390DNAArtificial SequenceArtificially
created chimeric nucleic acid sequence 27ctcgaggatc taaattgtga
gttcaatctc ttccctattg gattgattat cctttctttt 60cttccaattt gtgtttcttt
ttgcctaatt tattgtgtta tcccctttat cctattttgt 120ttctttactt
atttatttgc ttctatgtct ttgtacaaag atttaaactc tatggcacat
180attttaaagt tgttagaaaa taaattcttt caagattgat gaaagaactt
tttaattgta 240gatatttcgt agattttatt ctcttactac caatataacg
cttgaattga cgaaaatttg 300tgtccaaata tctagcaaaa aggtatccaa
tgaaaatata tcatatgtga tcttcaaatc 360ttgtgtctta tgcaagattg
atactttgtt caatggaaga gattgtgtgc atatttttaa 420aatttttatt
agtaataaag attctatata gctgttatag agggataatt ttacaaagaa
480cactataaat atgattgttg ttgttagggt gtcaatggtt cggttcgact
ggttatttta 540taaaatttgt accataccat ttttttcgat attctatttt
gtataaccaa aattagactt 600ttcgaaatcg tcccaatcat gtcggtttca
cttcggtatc ggtaccgttc ggttaatttt 660catttttttt taaatgtcat
taaaattcac tagtaaaaat agaatgcaat aacatacgtt 720cttttatagg
acttagcaaa agctctctag acatttttac tgtttaaagg ataatgaatt
780aaaaaacatg aaagatggct agagtataga tacacaacta ttcgacagca
acgtaaaaga 840aaccaagtaa aagcaaagaa aatataaatc acacgagtgg
aaagatatta accaagttgg 900gattcaagaa taaagtctat attaaatatt
caaaaagata aatttaaata atatgaaagg 960aaacatattc aatacattgt
agtttgctac tcataatcgc tagaatactt tgtgccttgc 1020taataaagat
acttgaaata gcttagttta aatataaata gcataataga ttttaggaat
1080tagtattttg agtttaatta cttattgact tgtaacagtt tttataattc
caaggcccat 1140gaaaaattta atgctttatt agttttaaac ttactatata
aatttttcat atgtaaaatt 1200taatcggtat agttcgatat tttttcaatt
tatttttata aaataaaaaa cttaccctaa 1260ttatcggtac agttatagat
ttatataaaa atctacggtt cttcagaaga aacctaaaaa 1320tcggttcggt
gcggacggtt cgatcggttt agtcgatttt caaatattca ttgacactcc
1380tagttgttgt tataggtaaa aagcagttac agagaggtaa aatataactt
aaaaaatcag 1440ttctaaggaa aaattgactt ttatagtaaa tgactgttat
ataaggatgt tgttacagag 1500aggtatgagt gtagttggta aattatgttc
ttgacggtgt atgtcacata ttatttatta 1560aaactagaaa aaacagcgtc
aaaactagca aaaatccaac ggacaaaaaa atcggctgaa 1620tttgatttgg
ttccaacatt taaaaaagtt tcagtgagaa agaatcggtg actgttgatg
1680atataaacaa agggcacatt ggtcaataac cataaaaaat tatatgacag
ctacagttgg 1740tagcatgtgc tcagctattg aacaaatcta aagaaggtac
atctgtaacc ggaacaccac 1800ttaaatgact aaattaccct catcagaaag
cagatggagt gctacaaata acacactatt 1860caacaaccat aaataaaacg
tgttcagcta ctaaaacaaa tataaataaa tctatgtttg 1920taagcactcc
agccatgtta atggagtgct attgcctgtt aactctcact tataaaatag
1980tagtagaaaa aatatgaacc aaaacacaac tttatcgcca tcatttacat
accactccac 2040ctttaatgaa ggatcaactt ccgcgaatat catctcagca
agtgcaattc ctgctatgat 2100cccgtcttcc tttgctagaa aatgagcatc
ggattccata tcaagaggaa ttgtcgcctt 2160acaagtcaca tctcctaaat
tcccagcatc ttcagagagt gcaagtttca taacttcctt 2220taaatcataa
gttgggtgtg ctggtggttt cacctctaat gactccactc ttgtattctt
2280ggtggctatt gctgacattt tcaccaccaa ccttggagct gtaattgcat
aaggatgcac 2340tgtagcagtg aaaggaatag ctctaaacat ggttgtgtat
ttcacttttg gatatagctc 2400agtggcttcg acacctgtag gaggctgaac
ctcaaagttt gcagaatctc cattaacaaa 2460aactgaatgg catatggcca
aattagtcct taatggcaga ggtccctctt gtacaatctg 2520gagaatatct
tcctctgata gatataactt ctcgagggtc ttcccaattt tgtcctccca
2580caaggacact atctcgttga aggatagaat attggcaggt ggtctcatgt
gaagagtctt 2640attcaatgtc cgtggatcat ctactgcttc gatagtgtat
gtcgctatgt cttcttcctt 2700cacatatatt gctttgggat ttccatcgcc
aaaaatgaca actttgtctc taggaggggt 2760tttggcctct aactgcccca
agttgggcaa gaagaaatct gcaaaccaat tgcagattac 2820atatgtgtat
ggaattcctt ctgcctctat catcctcctg attcttacct ttagagcgaa
2880gagtgatgca gctggttcaa ttgcacgagc atgatccaca tcaaatccaa
attctgaagg 2940aagaaatctc ttgatatttc cagcttcttt aattgctttg
atgatgttca cttgatcagt 3000ccgtcgcttc tcttccattt cttctcattt
tcgattttga ttcttatttc tttccagtag 3060ctcctgctct gtgaatttct
ccgctcacga tagatctgct tatactcctt acattcaacc 3120ttagatctgg
tctcgattct ctgtttctct gtttttttct tttggtcgag aatctgatgt
3180ttgtttatgt tctgtcacca ttaataataa tgaactctct cattcataca
atgattagtt 3240tctctcgtct acaaaacgat atgttgcatt ttcacttttc
ttcttttttt ctaagatgat 3300ttgctttgac caatttgttt agatctttat
tttattttat tttctggtgg gttggtggaa 3360attgaaaaaa aaaaaaacag
cataaattgt tatttgttaa tgtattcatt ttttggctat 3420ttgttctggg
taaaaatctg cttctactat tgaatctttc ctggattttt tactcctatt
3480gggtttttat agtaaaaata cataataaaa ggaaaacaaa agttttatag
attctcttaa 3540accccttacg ataaaagttg gaatcaaaat aattcaggat
cagatgctct ttgattgatt 3600cagatgcgat tacagttgca tggcaaattt
tctagatccg tcgtcacatt ttattttctg 3660tttaaatatc taaatctgat
atatgatgtc gacaaattct ggtggcttat acatcacttc 3720aactgttttc
ttttggcttt gtttgtcaac ttggttttca atacgatttg tgatttcgat
3780cgctgaattt ttaatacaag caaactgatg ttaaccacaa gcaagagatg
tgacctgcct 3840tattaacatc gtattactta ctactagtcg tattctcaac
gcaatcgttt ttgtatttct 3900cacattatgc cgcttctcta ctctttattc
cttttggtcc acgcattttc tatttgtggc 3960aatccctttc acaacctgat
ttcccacttt ggatcatttg tctgaagact ctcttgaatc 4020gttaccactt
gtttcttgtg catgctctgt tttttagaat taatgataaa actattccat
4080agtcttgagt tttcagcttg ttgattcttt tgcttttggt tttctgcagt
gatcaagtga 4140acatcatcaa agcaattaaa gaagctggaa atatcaagag
atttcttcct tcagaatttg 4200gatttgatgt ggatcatgct cgtgcaattg
aaccagctgc atcactcttc gctctaaagg 4260taagaatcag gaggatgata
gaggcagaag gaattccata cacatatgta atctgcaatt 4320ggtttgcaga
tttcttcttg cccaacttgg ggcagttaga ggccaaaacc cctcctagag
4380acaaagttgt catttttggc gatggaaatc ccaaagcaat atatgtgaag
gaagaagaca 4440tagcgacata cactatcgaa gcagtagatg atccacggac
attgaataag actcttcaca 4500tgagaccacc tgccaatatt ctatccttca
acgagatagt gtccttgtgg gaggacaaaa 4560ttgggaagac cctcgagaag
ttatatctat cagaggaaga tattctccag attgtacaag 4620agggacctct
gccattaagg
actaatttgg ccatatgcca ttcagttttt gttaatggag 4680attctgcaaa
ctttgaggtt cagcctccta caggtgtcga agccactgag ctatatccaa
4740aagtgaaata cacaaccatg tttagagcta ttcctttcac tgctacagtg
catccttatg 4800caattacagc tccaaggttg gtggtgaaaa tgtcagcaat
agccaccaag aatacaagag 4860tggagtcatt agaggtgaaa ccaccagcac
acccaactta tgatttaaag gaagttatga 4920aacttgcact ctctgaagat
gctgggaatt taggagatgt gacttgtaag gcgacaattc 4980ctcttgatat
ggaatccgat gctcattttc tagcaaagga agacgggatc atagcaggaa
5040ttgcacttgc tgagatgata ttcgcggaag ttgatccttc attaaaggtg
gagtggtatg 5100taaatgatgg cgataaagca agtgtgttgc ctttgtgtgg
aaatgaagag gtacttgcga 5160ggactttgcg tttatcagtt tatgtgtttg
tatatctatt tgatccagtt attatggatt 5220atatacgctt gaaactcatt
ttaagccatt gttattgaac gtttatcaaa tactttatta 5280tgccaagcaa
gtcaaacaca tgcttgttga ttgaaatcaa gctatagaaa tctcttcttc
5340acatacagca gtttagattc acaatacaac aagcgaaacg ataaagtttc
5390283773DNAArtificial SequenceArtificially created chimeric
nucleic acid sequence 28gacggtccga tgtgagactt ttcaacaaag ggtaatatcc
ggaaacctcc tcggattcca 60ttgcccagct atctgtcact ttattgtgaa gatagtggaa
aaggaaggtg gctcctacaa 120atgccatcat tgcgataaag gaaaggccat
cgttgaagat gcctctgccg acagtggtcc 180caaagatgga cccccaccca
cgaggagcat cgtggaaaaa gaagacgttc caaccacgtc 240ttcaaagcaa
gtggattgat gtgatggtcc gatgtgagac ttttcaacaa agggtaatat
300ccggaaacct cctcggattc cattgcccag ctatctgtca ctttattgtg
aagatagtgg 360aaaaggaagg tggctcctac aaatgccatc attgcgataa
aggaaaggcc atcgttgaag 420atgcctctgc cgacagtggt cccaaagatg
gacccccacc cacgaggagc atcgtggaaa 480aagaagacgt tccaaccacg
tcttcaaagc aagtggattg atgtgatatc tccactgacg 540taagggatga
cgcacaatcc cactatcctt cgcaagaccc ttcctctata taaggaagtt
600catttcattt ggagaggaat catactcttt tccttccctg gttttaacag
tgaaatcact 660atgcgaacta cgtagaagca ttatcagtgg aggatggagt
ctcagggctt cctttatgca 720tctatagagg acttccatct cggaaaggat
gtcatgatcg accttattcc catgtttctt 780catcagattc ttctgttcat
ctacgacggc agacatgtac ttgttgttgc agagaaggta 840tgcccctgcc
caagtggagg tgatggaact ggtgtgttgc ccagcgaaaa gagcagcaat
900cagaagacct gtgatctcag actctgtcgt tgcccgccca tctttgtact
tggagtcaat 960gaagcattgt aacatatcgc tctccgcctt gcctgtacgt
tttctagaat ctatgatgtt 1020tgcaaagatc tccgcgagct tcttgcgggc
attgtcacga cggcgatggg ctggaatggg 1080aaggtaggga aagattacac
tgataggaag catcccattg tccaggtcat ggaagagagc 1140agagacatcc
tcaaagagtt tattgcgaac ctcttctccc aacagacatc tactagctgt
1200cagtatgata agatgctcca gttcatactt caagtccact tcaccactat
caccccattt 1260tgagaagtac tcctcagctt ccatgaccat ctgatccaca
tatcccttca atttatttac 1320cctcaaagat tcagtaaaga acctaaattg
ctcttgtctg atagtataat caacgtcaaa 1380aaccacacca gggccaaaag
taggcacatt gaactgataa acctcttgtt gactgagatc 1440ggtttctggg
gccttaaaga aatgggccga cacttctggg ccaacgaaga acgtgatatt
1500cttgtccgtc gcttctcttc catttcttct cattttcgat tttgattctt
atttctttcc 1560agtagctcct gctctgtgaa tttctccgct cacgatagat
ctgcttatac tccttacatt 1620caaccttaga tctggtctcg attctctgtt
tctctgtttt tttcttttgg tcgagaatct 1680gatgtttgtt tatgttctgt
caccattaat aataatgaac tctctcattc atacaatgat 1740tagtttctct
cgtctacaaa acgatatgtt gcattttcac ttttcttctt tttttctaag
1800atgatttgct ttgaccaatt tgtttagatc tttattttat tttattttct
ggtgggttgg 1860tggaaattga aaaaaaaaaa aacagcataa attgttattt
gttaatgtat tcattttttg 1920gctatttgtt ctgggtaaaa atctgcttct
actattgaat ctttcctgga ttttttactc 1980ctattgggtt tttatagtaa
aaatacataa taaaaggaaa acaaaagttt tatagattct 2040cttaaacccc
ttacgataaa agttggaatc aaaataattc aggatcagat gctctttgat
2100tgattcagat gcgattacag ttgcatggca aattttctag atccgtcgtc
acattttatt 2160ttctgtttaa atatctaaat ctgatatatg atgtcgacaa
attctggtgg cttatacatc 2220acttcaactg ttttcttttg gctttgtttg
tcaacttggt tttcaatacg atttgtgatt 2280tcgatcgctg aatttttaat
acaagcaaac tgatgttaac cacaagcaag agatgtgacc 2340tgccttatta
acatcgtatt acttactact agtcgtattc tcaacgcaat cgtttttgta
2400tttctcacat tatgccgctt ctctactctt tattcctttt ggtccacgca
ttttctattt 2460gtggcaatcc ctttcacaac ctgatttccc actttggatc
atttgtctga agactctctt 2520gaatcgttac cacttgtttc ttgtgcatgc
tctgtttttt agaattaatg ataaaactat 2580tccatagtct tgagttttca
gcttgttgat tcttttgctt ttggttttct gcagaagaat 2640atcacgttct
tcgttggccc agaagtgtcg gcccatttct ttaaggcccc agaaaccgat
2700ctcagtcaac aagaggttta tcagttcaat gtgcctactt ttggccctgg
tgtggttttt 2760gacgttgatt atactatcag acaagagcaa tttaggttct
ttactgaatc tttgagggta 2820aataaattga agggatatgt ggatcagatg
gtcatggaag ctgaggagta cttctcaaaa 2880tggggtgata gtggtgaagt
ggacttgaag tatgaactgg agcatcttat catactgaca 2940gctagtagat
gtctgttggg agaagaggtt cgcaataaac tctttgagga tgtctctgct
3000ctcttccatg acctggacaa tgggatgctt cctatcagtg taatctttcc
ctaccttccc 3060attccagccc atcgccgtcg tgacaatgcc cgcaagaagc
tcgcggagat ctttgcaaac 3120atcatagatt ctagaaaacg tacaggcaag
gcggagagcg atatgttaca atgcttcatt 3180gactccaagt acaaagatgg
gcgggcaacg acagagtctg agatcacagg tcttctgatt 3240gctgctcttt
tcgctgggca acacaccagt tccatcacct ccacttgggc aggggcatac
3300cttctctgca acaacaagta catgtctgcc gtcgtagatg aacagaagaa
tctgatgaag 3360aaacatggga ataaggtcga tcatgacatc ctttccgaga
tggaagtcct ctatagatgc 3420ataaaggaag ccctgagact ccatcctcca
ctgataatgc ttctacgtag ttcgcatagt 3480gatttcactg ttaaaaccag
ggaaggaaaa gagtatgatg atcgttcaaa catttggcaa 3540taaagtttct
taagattgaa tcctgttgcc ggtcttgcga tgattatcat ataatttctg
3600ttgaattacg ttaagcatgt aataattaac atgtaatgca tgacgttatt
tatgagatgg 3660gtttttatga ttagagtccc gcaattatac atttaatacg
cgatagaaaa caaaatatag 3720cgcgcaaact aggataaatt atcgcgcgcg
gtgtcatcta tgttactaga tcg 3773293563DNAArtificial
SequenceArtificially created chimeric nucleic acid sequence
29gacggtccga tgtgagactt ttcaacaaag ggtaatatcc ggaaacctcc tcggattcca
60ttgcccagct atctgtcact ttattgtgaa gatagtggaa aaggaaggtg gctcctacaa
120atgccatcat tgcgataaag gaaaggccat cgttgaagat gcctctgccg
acagtggtcc 180caaagatgga cccccaccca cgaggagcat cgtggaaaaa
gaagacgttc caaccacgtc 240ttcaaagcaa gtggattgat gtgatggtcc
gatgtgagac ttttcaacaa agggtaatat 300ccggaaacct cctcggattc
cattgcccag ctatctgtca ctttattgtg aagatagtgg 360aaaaggaagg
tggctcctac aaatgccatc attgcgataa aggaaaggcc atcgttgaag
420atgcctctgc cgacagtggt cccaaagatg gacccccacc cacgaggagc
atcgtggaaa 480aagaagacgt tccaaccacg tcttcaaagc aagtggattg
atgtgatatc tccactgacg 540taagggatga cgcacaatcc cactatcctt
cgcaagaccc ttcctctata taaggaagtt 600catttcattt ggagaggacc
atatattagc aaatgcccac ctttatgagc ttgtcaatag 660gtatatatct
tagaacaagg acatcaatgg caaaaatagc aagacatgaa atcaaattgt
720gccagacaag caacacagaa aaagaaaccc tccacccaca acgccctcca
aaaactgtag 780tcaccttaat tagggcggtc atattcaatg tgtaaagttc
tgtgcgaaga atcttacaga 840tttgctagct aaagcaaaaa gctaagtgac
taaactccat attactgaga gtctgaaatg 900ggcttgcgaa ccacgaagaa
gtacattggt gtgaaaatcc ctttcttggc accaccgaca 960agaccttctg
cagctttctc taagaaagct tgaacccttt gactaccttt aggagcaagt
1020cccacgtatt caagcgccga aaccagattt ctggtgaaaa gtctgccaac
tgctgttagg 1080cggaagctac tgagcgagaa gtgactcgta tccaaaggca
agtaccatgg aacaggtgag 1140tcatcagcca gatccttgtc ccatacaact
tcaaaaccag cttgtttggc tgcttcgagg 1200cactgtgttg tcaatctaac
ctcagggagg ccatttccga gctcaatttc ggccttgatc 1260ctgttgtgct
cttcgttatt ggggttgtaa gaatcggtca tgcaccactc atacacagcg
1320aaacattgac caggcttcag cacccggtaa atctctttat agcatcccaa
tggatctggt 1380gcatggcagg tagcttctgt ccgtcgcttc tcttccattt
cttctcattt tcgattttga 1440ttcttatttc tttccagtag ctcctgctct
gtgaatttct ccgctcacga tagatctgct 1500tatactcctt acattcaacc
ttagatctgg tctcgattct ctgtttctct gtttttttct 1560tttggtcgag
aatctgatgt ttgtttatgt tctgtcacca ttaataataa tgaactctct
1620cattcataca atgattagtt tctctcgtct acaaaacgat atgttgcatt
ttcacttttc 1680ttcttttttt ctaagatgat ttgctttgac caatttgttt
agatctttat tttattttat 1740tttctggtgg gttggtggaa attgaaaaaa
aaaaaaacag cataaattgt tatttgttaa 1800tgtattcatt ttttggctat
ttgttctggg taaaaatctg cttctactat tgaatctttc 1860ctggattttt
tactcctatt gggtttttat agtaaaaata cataataaaa ggaaaacaaa
1920agttttatag attctcttaa accccttacg ataaaagttg gaatcaaaat
aattcaggat 1980cagatgctct ttgattgatt cagatgcgat tacagttgca
tggcaaattt tctagatccg 2040tcgtcacatt ttattttctg tttaaatatc
taaatctgat atatgatgtc gacaaattct 2100ggtggcttat acatcacttc
aactgttttc ttttggcttt gtttgtcaac ttggttttca 2160atacgatttg
tgatttcgat cgctgaattt ttaatacaag caaactgatg ttaaccacaa
2220gcaagagatg tgacctgcct tattaacatc gtattactta ctactagtcg
tattctcaac 2280gcaatcgttt ttgtatttct cacattatgc cgcttctcta
ctctttattc cttttggtcc 2340acgcattttc tatttgtggc aatccctttc
acaacctgat ttcccacttt ggatcatttg 2400tctgaagact ctcttgaatc
gttaccactt gtttcttgtg catgctctgt tttttagaat 2460taatgataaa
actattccat agtcttgagt tttcagcttg ttgattcttt tgcttttggt
2520tttctgcaga gaagctacct gccatgcacc agatccattg ggatgctata
aagagattta 2580ccgggtgctg aagcctggtc aatgtttcgc tgtgtatgag
tggtgcatga ccgattctta 2640caaccccaat aacgaagagc acaacaggat
caaggccgaa attgagctcg gaaatggcct 2700ccctgaggtt agattgacaa
cacagtgcct cgaagcagcc aaacaagctg gttttgaagt 2760tgtatgggac
aaggatctgg ctgatgactc acctgttcca tggtacttgc ctttggatac
2820gagtcacttc tcgctcagta gcttccgcct aacagcagtt ggcagacttt
tcaccagaaa 2880tctggtttcg gcgcttgaat acgtgggact tgctcctaaa
ggtagtcaaa gggttcaagc 2940tttcttagag aaagctgcag aaggtcttgt
cggtggtgcc aagaaaggga ttttcacacc 3000aatgtacttc ttcgtggttc
gcaagcccat ttcagactct cagtaatatg gagtttagtc 3060acttagcttt
ttgctttagc tagcaaatct gtaagattct tcgcacagaa ctttacacat
3120tgaatatgac cgccctaatt aaggtgacta cagtttttgg agggcgttgt
gggtggaggg 3180tttctttttc tgtgttgctt gtctggcaca atttgatttc
atgtcttgct atttttgcca 3240ttgatgtcct tgttctaaga tatataccta
ttgacaagct cataaaggtg ggcatttgct 3300aatatatggg atcgttcaaa
catttggcaa taaagtttct taagattgaa tcctgttgcc 3360ggtcttgcga
tgattatcat ataatttctg ttgaattacg ttaagcatgt aataattaac
3420atgtaatgca tgacgttatt tatgagatgg gtttttatga ttagagtccc
gcaattatac 3480atttaatacg cgatagaaaa caaaatatag cgcgcaaact
aggataaatt atcgcgcgcg 3540gtgtcatcta tgttactaga tcg
3563302881DNAArtificial SequenceArtificially created chimeric
nucleic acid sequence 30gacggtccga tgtgagactt ttcaacaaag ggtaatatcc
ggaaacctcc tcggattcca 60ttgcccagct atctgtcact ttattgtgaa gatagtggaa
aaggaaggtg gctcctacaa 120atgccatcat tgcgataaag gaaaggccat
cgttgaagat gcctctgccg acagtggtcc 180caaagatgga cccccaccca
cgaggagcat cgtggaaaaa gaagacgttc caaccacgtc 240ttcaaagcaa
gtggattgat gtgatggtcc gatgtgagac ttttcaacaa agggtaatat
300ccggaaacct cctcggattc cattgcccag ctatctgtca ctttattgtg
aagatagtgg 360aaaaggaagg tggctcctac aaatgccatc attgcgataa
aggaaaggcc atcgttgaag 420atgcctctgc cgacagtggt cccaaagatg
gacccccacc cacgaggagc atcgtggaaa 480aagaagacgt tccaaccacg
tcttcaaagc aagtggattg atgtgatatc tccactgacg 540taagggatga
cgcacaatcc cactatcctt cgcaagaccc ttcctctata taaggaagtt
600catttcattt ggagaggaac aatcctagcc caacaagccc agctacatag
tgacaatatt 660cgtcataatc atcagttgtt tccacctcct tgcatatgaa
ttttgccatt cctgcaccca 720tcctcatggt aatatcctca attgcctgct
gataatgttt cctaagctcc agaaaagcag 780ttgaaacatg atggaactgg
tccatgagaa ccttgtactc ttttgtacca catgaaaaat 840gccattcacg
atcataaaca tgctgatgaa aagagatcag aataggtact ttaacatcgg
900tgggaatgct ggtatcatcc tcaacagtgt caagtgctcg aagaaccaaa
tagaaaatgc 960acacggcgtc acgaagctcg acgggaagtt gttgaatgac
gagagcaaag ctacgagaaa 1020ccttatgaag cattgagtaa cagaagcccc
aatgtgggtc cgtcgcttct cttccatttc 1080ttctcatttt cgattttgat
tcttatttct ttccagtagc tcctgctctg tgaatttctc 1140cgctcacgat
agatctgctt atactcctta cattcaacct tagatctggt ctcgattctc
1200tgtttctctg tttttttctt ttggtcgaga atctgatgtt tgtttatgtt
ctgtcaccat 1260taataataat gaactctctc attcatacaa tgattagttt
ctctcgtcta caaaacgata 1320tgttgcattt tcacttttct tctttttttc
taagatgatt tgctttgacc aatttgttta 1380gatctttatt ttattttatt
ttctggtggg ttggtggaaa ttgaaaaaaa aaaaaacagc 1440ataaattgtt
atttgttaat gtattcattt tttggctatt tgttctgggt aaaaatctgc
1500ttctactatt gaatctttcc tggatttttt actcctattg ggtttttata
gtaaaaatac 1560ataataaaag gaaaacaaaa gttttataga ttctcttaaa
ccccttacga taaaagttgg 1620aatcaaaata attcaggatc agatgctctt
tgattgattc agatgcgatt acagttgcat 1680ggcaaatttt ctagatccgt
cgtcacattt tattttctgt ttaaatatct aaatctgata 1740tatgatgtcg
acaaattctg gtggcttata catcacttca actgttttct tttggctttg
1800tttgtcaact tggttttcaa tacgatttgt gatttcgatc gctgaatttt
taatacaagc 1860aaactgatgt taaccacaag caagagatgt gacctgcctt
attaacatcg tattacttac 1920tactagtcgt attctcaacg caatcgtttt
tgtatttctc acattatgcc gcttctctac 1980tctttattcc ttttggtcca
cgcattttct atttgtggca atccctttca caacctgatt 2040tcccactttg
gatcatttgt ctgaagactc tcttgaatcg ttaccacttg tttcttgtgc
2100atgctctgtt ttttagaatt aatgataaaa ctattccata gtcttgagtt
ttcagcttgt 2160tgattctttt gcttttggtt ttctgcagcc acattggggc
ttctgttact caatgcttca 2220taaggtttct cgtagctttg ctctcgtcat
tcaacaactt cccgtcgagc ttcgtgacgc 2280cgtgtgcatt ttctatttgg
ttcttcgagc acttgacact gttgaggatg ataccagcat 2340tcccaccgat
gttaaagtac ctattctgat ctcttttcat cagcatgttt atgatcgtga
2400atggcatttt tcatgtggta caaaagagta caaggttctc atggaccagt
tccatcatgt 2460ttcaactgct tttctggagc ttaggaaaca ttatcagcag
gcaattgagg atattaccat 2520gaggatgggt gcaggaatgg caaaattcat
atgcaaggag gtggaaacaa ctgatgatta 2580tgacgaatat tgtcactatg
tagctgggct tgttgggcta ggattgtgat cgttcaaaca 2640tttggcaata
aagtttctta agattgaatc ctgttgccgg tcttgcgatg attatcatat
2700aatttctgtt gaattacgtt aagcatgtaa taattaacat gtaatgcatg
acgttattta 2760tgagatgggt ttttatgatt agagtcccgc aattatacat
ttaatacgcg atagaaaaca 2820aaatatagcg cgcaaactag gataaattat
cgcgcgcggt gtcatctatg ttactagatc 2880g 2881313703DNAArtificial
SequenceArtificially created chimeric nucleic acid sequence
31gacggtccga tgtgagactt ttcaacaaag ggtaatatcc ggaaacctcc tcggattcca
60ttgcccagct atctgtcact ttattgtgaa gatagtggaa aaggaaggtg gctcctacaa
120atgccatcat tgcgataaag gaaaggccat cgttgaagat gcctctgccg
acagtggtcc 180caaagatgga cccccaccca cgaggagcat cgtggaaaaa
gaagacgttc caaccacgtc 240ttcaaagcaa gtggattgat gtgatggtcc
gatgtgagac ttttcaacaa agggtaatat 300ccggaaacct cctcggattc
cattgcccag ctatctgtca ctttattgtg aagatagtgg 360aaaaggaagg
tggctcctac aaatgccatc attgcgataa aggaaaggcc atcgttgaag
420atgcctctgc cgacagtggt cccaaagatg gacccccacc cacgaggagc
atcgtggaaa 480aagaagacgt tccaaccacg tcttcaaagc aagtggattg
atgtgatatc tccactgacg 540taagggatga cgcacaatcc cactatcctt
cgcaagaccc ttcctctata taaggaagtt 600catttcattt ggagaggaca
tatacaaaag caaactttct gagcaaacat aaagagtttg 660agatgccatt
tctctctaaa ttacaatcta gtcacaatta acaaacaaac gaaagacagt
720acaacagaaa agattattta aaaaaaaagg ggttatcttc cttggcgcat
gaatgaaatt 780aaccaaatgt tgaattacaa gttaacccca ctggtcacca
tcccacctaa cacctttcgt 840agatcttcac caaatatttg caggtttttt
tacacgaact cagaaaaaaa tacgacccta 900cctcctcaca tgccttcata
gaaagaatac aacactacat acagatccac gtccaccctt 960gatttgcttg
tctttttctt cttgatcttt ctccacatga ctaatgcctt acactttttc
1020aactttttgg tctacccttt acttattgct ctccctaatt ggaaaatttt
attcctactt 1080ttattgtaat ccatttcttt aataatgatg gtccataaag
gatggtgatg tacacgatgt 1140tgggataata aatttgtctt tttccttact
aagaggaaat cttagtaaca tctttgctag 1200atctattgta tttcatgtga
ctcttaacca gctgccctgc tgagatagca gacatgagag 1260ataactcacc
agcaagaaca gaacctgcta ctattgtggc caagagcctt gcatttgacc
1320ctgctgcctc cctgtttgca cctttcactc ctaataagtt caagcaagct
gactgtgatg 1380caagttgagt tccaccacca actgtgccaa cctcaataga
aggcatagtt actgaaatat 1440ggaggtcttt gccatcattt acagcctcgt
ccgtcgcttc tcttccattt cttctcattt 1500tcgattttga ttcttatttc
tttccagtag ctcctgctct gtgaatttct ccgctcacga 1560tagatctgct
tatactcctt acattcaacc ttagatctgg tctcgattct ctgtttctct
1620gtttttttct tttggtcgag aatctgatgt ttgtttatgt tctgtcacca
ttaataataa 1680tgaactctct cattcataca atgattagtt tctctcgtct
acaaaacgat atgttgcatt 1740ttcacttttc ttcttttttt ctaagatgat
ttgctttgac caatttgttt agatctttat 1800tttattttat tttctggtgg
gttggtggaa attgaaaaaa aaaaaaacag cataaattgt 1860tatttgttaa
tgtattcatt ttttggctat ttgttctggg taaaaatctg cttctactat
1920tgaatctttc ctggattttt tactcctatt gggtttttat agtaaaaata
cataataaaa 1980ggaaaacaaa agttttatag attctcttaa accccttacg
ataaaagttg gaatcaaaat 2040aattcaggat cagatgctct ttgattgatt
cagatgcgat tacagttgca tggcaaattt 2100tctagatccg tcgtcacatt
ttattttctg tttaaatatc taaatctgat atatgatgtc 2160gacaaattct
ggtggcttat acatcacttc aactgttttc ttttggcttt gtttgtcaac
2220ttggttttca atacgatttg tgatttcgat cgctgaattt ttaatacaag
caaactgatg 2280ttaaccacaa gcaagagatg tgacctgcct tattaacatc
gtattactta ctactagtcg 2340tattctcaac gcaatcgttt ttgtatttct
cacattatgc cgcttctcta ctctttattc 2400cttttggtcc acgcattttc
tatttgtggc aatccctttc acaacctgat ttcccacttt 2460ggatcatttg
tctgaagact ctcttgaatc gttaccactt gtttcttgtg catgctctgt
2520tttttagaat taatgataaa actattccat agtcttgagt tttcagcttg
ttgattcttt 2580tgcttttggt tttctgcagg aggctgtaaa tgatggcaaa
gacctccata tttcagtaac 2640tatgccttct attgaggttg gcacagttgg
tggtggaact caacttgcat cacagtcagc 2700ttgcttgaac ttattaggag
tgaaaggtgc aaacagggag gcagcagggt caaatgcaag 2760gctcttggcc
acaatagtag caggttctgt tcttgctggt gagttatctc tcatgtctgc
2820tatctcagca gggcagctgg ttaagagtca catgaaatac aatagatcta
gcaaagatgt 2880tactaagatt tcctcttagt aaggaaaaag acaaatttat
tatcccaaca tcgtgtacat 2940caccatcctt tatggaccat cattattaaa
gaaatggatt acaataaaag taggaataaa 3000attttccaat tagggagagc
aataagtaaa gggtagacca aaaagttgaa aaagtgtaag 3060gcattagtca
tgtggagaaa gatcaagaag aaaaagacaa gcaaatcaag ggtggacgtg
3120gatctgtatg tagtgttgta ttctttctat gaaggcatgt gaggaggtag
ggtcgtattt 3180ttttctgagt tcgtgtaaaa aaacctgcaa atatttggtg
aagatctacg aaaggtgtta 3240ggtgggatgg tgaccagtgg ggttaacttg
taattcaaca tttggttaat ttcattcatg 3300cgccaaggaa gataacccct
ttttttttaa ataatctttt ctgttgtact gtctttcgtt 3360tgtttgttaa
ttgtgactag attgtaattt agagagaaat ggcatctcaa actctttatg
3420tttgctcaga aagtttgctt ttgtatatgg atcgttcaaa catttggcaa
taaagtttct 3480taagattgaa tcctgttgcc ggtcttgcga tgattatcat
ataatttctg ttgaattacg 3540ttaagcatgt aataattaac atgtaatgca
tgacgttatt tatgagatgg gtttttatga 3600ttagagtccc gcaattatac
atttaatacg cgatagaaaa caaaatatag cgcgcaaact
3660aggataaatt atcgcgcgcg gtgtcatcta tgttactaga tcg
3703324286DNAArtificial SequenceArtificially created chimeric
nucleic acid sequence 32ttctgttcgt atatttgtaa ctattatgtg tatttttatt
ttgttagtat tactaattca 60agtggtttaa gttgttgaga ctctttaaaa tctaagcatt
ttataaacaa taatatataa 120ttattgttta ggctaaattt gtcactaatt
aaggtttgga tacatagtgt ctaaactaag 180ctaataatat cacttaacgt
ttacttgtaa cgctaggtga tgatgtcgtc aagtcaattg 240gtacaaggaa
taaacgagtg gtcatatgac attatgacca tatgaattca aactccagta
300atccaatggt aattggattc aatgatcaag acttgaacca cgtaatccac
ccttatcctt 360agaagctcat aaatatcact aaagggacag gcaacactta
accagtagtt gtccaataat 420ttagttttcc aaaatgaaaa attattgttg
tcatctattt taggtgtttt agttcaatgt 480ggattcctcg tcctaacaaa
tacttgacga atatatctag actataaaat tggttatgag 540ttctactttt
ttttgtttgt gaaattatca aaatttgtta tatttattta tttattctca
600ttaatttgag tactaatttt taaattattt atactaaaaa caattactaa
gatacaaaaa 660tggataagag catggtgtat agatatttaa tgggatagaa
tatttcccat aattgtatgt 720gtgtgagagg ttttgttttc gtaaggaaag
aaacaaaaac catttgacca aagaaaagca 780aaagaaggca aggaatcaaa
caacaaatgt tgcaaggcag aaataatgga cgttatgtta 840atgtagtgtc
gtcacacgtg acttaaaaga gacgagtctg cgtgtcaaac taaaaatgta
900tgcaactata aaaatgggat ttgattatct ttttagtacc gaagcctacc
aaccacatgc 960acactaattc tactcgccaa ataaagtgaa aagagccata
tattagcaaa tgcccacctt 1020tatgagcttg tcaataggta tatatcttag
aacaaggaca tcaatggcaa aaatagcaag 1080acatgaaatc aaattgtgcc
agacaagcaa cacagaaaaa gaaaccctcc acccacaacg 1140ccctccaaaa
actgtagtca ccttaattag ggcggtcata ttcaatgtgt aaagttctgt
1200gcgaagaatc ttacagattt gctagctaaa gcaaaaagct aagtgactaa
actccatatt 1260actgagagtc tgaaatgggc ttgcgaacca cgaagaagta
cattggtgtg aaaatccctt 1320tcttggcacc accgacaaga ccttctgcag
ctttctctaa gaaagcttga accctttgac 1380tacctttagg agcaagtccc
acgtattcaa gcgccgaaac cagatttctg gtgaaaagtc 1440tgccaactgc
tgttaggcgg aagctactga gcgagaagtg actcgtatcc aaaggcaagt
1500accatggaac aggtgagtca tcagccagat ccttgtccca tacaacttca
aaaccagctt 1560gtttggctgc ttcgaggcac tgtgttgtca atctaacctc
agggaggcca tttccgagct 1620caatttcggc cttgatcctg ttgtgctctt
cgttattggg gttgtaagaa tcggtcatgc 1680accactcata cacagcgaaa
cattgaccag gcttcagcac ccggtaaatc tctttatagc 1740atcccaatgg
atctggtgca tggcaggtag cttctgtaag ttcctgtttt cacctgcacc
1800atgaaaaata tactattact attatttttc atttatttgt gtggtccata
ttgctatgtg 1860tgaaatgaaa aaatattttt tttctcaaac tacaatattg
tcagaaagaa aggaattaat 1920attccgaatt tataccaaaa aattaatttc
ttttttctct ttggtaagct ggattctgtt 1980attctttggt aaaacggaga
ataattttgt ttatcaactt ctgttgattt tatgaacaat 2040tctcaattaa
ttgaaggggt agtttaaggc tgatgaatct tttggatgag ttacttgagc
2100agtatggatt gactcacatg actaactgct tcactagctt ccaatatttt
ttagttatta 2160catgttgtgt atgttgatta ttgtgctcta agcaatcgga
ttctcttgtt aaataaaaac 2220tatcatagtt tatttattca ataatcgagt
ttgagctaac actcctgtct atctggaata 2280caaaaggaaa gataataaaa
gtttttggta ccttgaaaac tagaagtatc aggaagggga 2340gccttgaaca
aaggtcaagt tgtctccgtt tgacctacat gtcatgttcg agccattgat
2400gcttgcatca ggatagactg cctacatcac cccctcttgc ggtacggccc
ttccccggac 2460ctgcgtgaac gcgggatact ttgtgcaccg gaaaactaca
agtatcccta acacatatca 2520ggattttagt gatatccctt cactgccgtg
ttcgataaag gttacataaa gttttaaatt 2580tatgggtgct aaatatcaca
gctaaatata cacattaaag atattactgc atccatatat 2640gttgccatga
ccatacatca agtatacatc cacccctaat ttttgagtgt ttttgagatg
2700cagcaaagtt gaaggagatt ataatagttt gatgtggaga gactaatttt
ttttttaaca 2760tcactttcta agggtgctat cttttcacca ccatcactgg
tggcttgttg atttgtagct 2820aatcattatc ttttgatgaa aacaaggaca
ttctttagtg cactaagatt gttaaacgtt 2880cgtgcttcat tgtaaatgta
atatactcgc gcttgttggc atgaacactt ggaattgttt 2940actggaacac
tgcagagaag ctacctgcca tgcaccagat ccattgggat gctataaaga
3000gatttaccgg gtgctgaagc ctggtcaatg tttcgctgtg tatgagtggt
gcatgaccga 3060ttcttacaac cccaataacg aagagcacaa caggatcaag
gccgaaattg agctcggaaa 3120tggcctccct gaggttagat tgacaacaca
gtgcctcgaa gcagccaaac aagctggttt 3180tgaagttgta tgggacaagg
atctggctga tgactcacct gttccatggt acttgccttt 3240ggatacgagt
cacttctcgc tcagtagctt ccgcctaaca gcagttggca gacttttcac
3300cagaaatctg gtttcggcgc ttgaatacgt gggacttgct cctaaaggta
gtcaaagggt 3360tcaagctttc ttagagaaag ctgcagaagg tcttgtcggt
ggtgccaaga aagggatttt 3420cacaccaatg tacttcttcg tggttcgcaa
gcccatttca gactctcagt aatatggagt 3480ttagtcactt agctttttgc
tttagctagc aaatctgtaa gattcttcgc acagaacttt 3540acacattgaa
tatgaccgcc ctaattaagg tgactacagt ttttggaggg cgttgtgggt
3600ggagggtttc tttttctgtg ttgcttgtct ggcacaattt gatttcatgt
cttgctattt 3660ttgccattga tgtccttgtt ctaagatata tacctattga
caagctcata aaggtgggca 3720tttgctaata tatggtttcc ctttgctttt
gtgtaaacct caaaacttta tcccccatct 3780ttgattttat cccttgtttt
tctgcttttt tcttctttct tgggttttaa tttccggact 3840taacgtttgt
tttccggttt gcgagacata ttctatcgga ttctcaactg tctgatgaaa
3900taaatatgta atgttctata agtctttcaa tttgatatgc atatcaacaa
aaagaaaata 3960ggacaatgcg gctacaaata tgaaatttac aagtttaaga
accatgagtc gctaaagaaa 4020tcattaagaa aattagtttc acattcaatt
cttgtcacat gattaacgag cttgagaggt 4080ttagagtaac aatatcttga
agcaaaagat gacccacttg aaatctagtg atggatacat 4140aagtggacgt
gccttgttta ggataggatt ctggataaga gtctcgaata ttcattttta
4200ccaagtatat tcaaggatct tgtggatcat atatttcctc aatcaaaggg
acttgaccca 4260aattcacata aagatatttt ggagtc 4286338956DNAArtificial
SequenceArtificially created chimeric nucleic acid sequence
33ctcgaggatc taaattgtga gttcaatctc ttccctattg gattgattat cctttctttt
60cttccaattt gtgtttcttt ttgcctaatt tattgtgtta tcccctttat cctattttgt
120ttctttactt atttatttgc ttctatgtct ttgtacaaag atttaaactc
tatggcacat 180attttaaagt tgttagaaaa taaattcttt caagattgat
gaaagaactt tttaattgta 240gatatttcgt agattttatt ctcttactac
caatataacg cttgaattga cgaaaatttg 300tgtccaaata tctagcaaaa
aggtatccaa tgaaaatata tcatatgtga tcttcaaatc 360ttgtgtctta
tgcaagattg atactttgtt caatggaaga gattgtgtgc atatttttaa
420aatttttatt agtaataaag attctatata gctgttatag agggataatt
ttacaaagaa 480cactataaat atgattgttg ttgttagggt gtcaatggtt
cggttcgact ggttatttta 540taaaatttgt accataccat ttttttcgat
attctatttt gtataaccaa aattagactt 600ttcgaaatcg tcccaatcat
gtcggtttca cttcggtatc ggtaccgttc ggttaatttt 660catttttttt
taaatgtcat taaaattcac tagtaaaaat agaatgcaat aacatacgtt
720cttttatagg acttagcaaa agctctctag acatttttac tgtttaaagg
ataatgaatt 780aaaaaacatg aaagatggct agagtataga tacacaacta
ttcgacagca acgtaaaaga 840aaccaagtaa aagcaaagaa aatataaatc
acacgagtgg aaagatatta accaagttgg 900gattcaagaa taaagtctat
attaaatatt caaaaagata aatttaaata atatgaaagg 960aaacatattc
aatacattgt agtttgctac tcataatcgc tagaatactt tgtgccttgc
1020taataaagat acttgaaata gcttagttta aatataaata gcataataga
ttttaggaat 1080tagtattttg agtttaatta cttattgact tgtaacagtt
tttataattc caaggcccat 1140gaaaaattta atgctttatt agttttaaac
ttactatata aatttttcat atgtaaaatt 1200taatcggtat agttcgatat
tttttcaatt tatttttata aaataaaaaa cttaccctaa 1260ttatcggtac
agttatagat ttatataaaa atctacggtt cttcagaaga aacctaaaaa
1320tcggttcggt gcggacggtt cgatcggttt agtcgatttt caaatattca
ttgacactcc 1380tagttgttgt tataggtaaa aagcagttac agagaggtaa
aatataactt aaaaaatcag 1440ttctaaggaa aaattgactt ttatagtaaa
tgactgttat ataaggatgt tgttacagag 1500aggtatgagt gtagttggta
aattatgttc ttgacggtgt atgtcacata ttatttatta 1560aaactagaaa
aaacagcgtc aaaactagca aaaatccaac ggacaaaaaa atcggctgaa
1620tttgatttgg ttccaacatt taaaaaagtt tcagtgagaa agaatcggtg
actgttgatg 1680atataaacaa agggcacatt ggtcaataac cataaaaaat
tatatgacag ctacagttgg 1740tagcatgtgc tcagctattg aacaaatcta
aagaaggtac atctgtaacc ggaacaccac 1800ttaaatgact aaattaccct
catcagaaag cagatggagt gctacaaata acacactatt 1860caacaaccat
aaataaaacg tgttcagcta ctaaaacaaa tataaataaa tctatgtttg
1920taagcactcc agccatgtta atggagtgct attgcctgtt aactctcact
tataaaatag 1980tagtagaaaa aatatgaacc aaaacacaac ggttgtgtat
ttcacttttg gatatagctc 2040agtggcttcg acacctgtag gaggctgaac
ctcaaagttt gcagaatctc cattaacaaa 2100aactgaatgg catatggcca
aattagtcct taatggcaga ggtccctctt gtacaatctg 2160gagaatatct
tcctctgata gatataactt ctcgagggtc ttcccaattt tgtcctccca
2220caaggacact atctcgttga aggatagaat attggcaggt ggtctcatgt
gaagagtctt 2280attcaatgtc cgtggatcat ctactgcttc gatagtgtat
gtcgctatgt cttcttcctt 2340cacatatatt gctttgggat ttccatcgcc
aaaaatgaca actttgtctc taggaggggt 2400tttggcctct aactgcccca
agttgggcaa gaagaaatct gcaaaccaat tgcagattac 2460atatgtgtat
ggaattcctt ctgcctctat catcctcctg attcttacct ttagagcgaa
2520gagtgatgca gctggttcaa ttgcacgagc atgatccaca tcaaatccaa
attctgaagg 2580aagaaatctc ttgatatttc cagcttcttt aattgctttg
atgatgttca cttgatcagt 2640ccgtcgcttc tcttccattt cttctcattt
tcgattttga ttcttatttc tttccagtag 2700ctcctgctct gtgaatttct
ccgctcacga tagatctgct tatactcctt acattcaacc 2760ttagatctgg
tctcgattct ctgtttctct gtttttttct tttggtcgag aatctgatgt
2820ttgtttatgt tctgtcacca ttaataataa tgaactctct cattcataca
atgattagtt 2880tctctcgtct acaaaacgat atgttgcatt ttcacttttc
ttcttttttt ctaagatgat 2940ttgctttgac caatttgttt agatctttat
tttattttat tttctggtgg gttggtggaa 3000attgaaaaaa aaaaaaacag
cataaattgt tatttgttaa tgtattcatt ttttggctat 3060ttgttctggg
taaaaatctg cttctactat tgaatctttc ctggattttt tactcctatt
3120gggtttttat agtaaaaata cataataaaa ggaaaacaaa agttttatag
attctcttaa 3180accccttacg ataaaagttg gaatcaaaat aattcaggat
cagatgctct ttgattgatt 3240cagatgcgat tacagttgca tggcaaattt
tctagatccg tcgtcacatt ttattttctg 3300tttaaatatc taaatctgat
atatgatgtc gacaaattct ggtggcttat acatcacttc 3360aactgttttc
ttttggcttt gtttgtcaac ttggttttca atacgatttg tgatttcgat
3420cgctgaattt ttaatacaag caaactgatg ttaaccacaa gcaagagatg
tgacctgcct 3480tattaacatc gtattactta ctactagtcg tattctcaac
gcaatcgttt ttgtatttct 3540cacattatgc cgcttctcta ctctttattc
cttttggtcc acgcattttc tatttgtggc 3600aatccctttc acaacctgat
ttcccacttt ggatcatttg tctgaagact ctcttgaatc 3660gttaccactt
gtttcttgtg catgctctgt tttttagaat taatgataaa actattccat
3720agtcttgagt tttcagcttg ttgattcttt tgcttttggt tttctgcagt
gatcaagtga 3780acatcatcaa agcaattaaa gaagctggaa atatcaagag
atttcttcct tcagaatttg 3840gatttgatgt ggatcatgct cgtgcaattg
aaccagctgc atcactcttc gctctaaagg 3900taagaatcag gaggatgata
gaggcagaag gaattccata cacatatgta atctgcaatt 3960ggtttgcaga
tttcttcttg cccaacttgg ggcagttaga ggccaaaacc cctcctagag
4020acaaagttgt catttttggc gatggaaatc ccaaagcaat atatgtgaag
gaagaagaca 4080tagcgacata cactatcgaa gcagtagatg atccacggac
attgaataag actcttcaca 4140tgagaccacc tgccaatatt ctatccttca
acgagatagt gtccttgtgg gaggacaaaa 4200ttgggaagac cctcgagaag
ttatatctat cagaggaaga tattctccag attgtacaag 4260agggacctct
gccattaagg actaatttgg ccatatgcca ttcagttttt gttaatggag
4320attctgcaaa ctttgaggtt cagcctccta caggtgtcga agccactgag
ctatatccaa 4380aagtgaaata cacaaccgca agtgtgttgc ctttgtgtgg
aaatgaagag gtacttgcga 4440ggactttgcg tttatcagtt tatgtgtttg
tatatctatt tgatccagtt attatggatt 4500atatacgctt gaaactcatt
ttaagccatt gttattgaac gtttatcaaa tactttatta 4560tgccaagcaa
gtcaaacaca tgcttgttga ttgaaatcaa gctatagaaa tctcttcttc
4620acatacagca gtttagattc acaatacaac aagcgaaacg ataaagtttc
ttctgttcgt 4680atatttgtaa ctattatgtg tatttttatt ttgttagtat
tactaattca agtggtttaa 4740gttgttgaga ctctttaaaa tctaagcatt
ttataaacaa taatatataa ttattgttta 4800ggctaaattt gtcactaatt
aaggtttgga tacatagtgt ctaaactaag ctaataatat 4860cacttaacgt
ttacttgtaa cgctaggtga tgatgtcgtc aagtcaattg gtacaaggaa
4920taaacgagtg gtcatatgac attatgacca tatgaattca aactccagta
atccaatggt 4980aattggattc aatgatcaag acttgaacca cgtaatccac
ccttatcctt agaagctcat 5040aaatatcact aaagggacag gcaacactta
accagtagtt gtccaataat ttagttttcc 5100aaaatgaaaa attattgttg
tcatctattt taggtgtttt agttcaatgt ggattcctcg 5160tcctaacaaa
tacttgacga atatatctag actataaaat tggttatgag ttctactttt
5220ttttgtttgt gaaattatca aaatttgtta tatttattta tttattctca
ttaatttgag 5280tactaatttt taaattattt atactaaaaa caattactaa
gatacaaaaa tggataagag 5340catggtgtat agatatttaa tgggatagaa
tatttcccat aattgtatgt gtgtgagagg 5400ttttgttttc gtaaggaaag
aaacaaaaac catttgacca aagaaaagca aaagaaggca 5460aggaatcaaa
caacaaatgt tgcaaggcag aaataatgga cgttatgtta atgtagtgtc
5520gtcacacgtg acttaaaaga gacgagtctg cgtgtcaaac taaaaatgta
tgcaactata 5580aaaatgggat ttgattatct ttttagtacc gaagcctacc
aaccacatgc acactaattc 5640tactcgccaa ataaagtgaa aagagccata
tattagcaaa tgcccacctt tatgagcttg 5700tcaataggta tatatcttag
aacaaggaca tcaatggcaa aaatagcaag acatgaaatc 5760aaattgtgcc
agacaagcaa cacagaaaaa gaaaccctcc acccacaacg ccctccaaaa
5820actgtagtca ccttaattag ggcggtcata ttcaatgtgt aaagttctgt
gcgaagaatc 5880ttacagattt gctagctaaa gcaaaaagct aagtgactaa
actccatatt actgagagtc 5940tgaaatgggc ttgcgaacca cgaagaagta
cattggtgtg aaaatccctt tcttggcacc 6000accgacaaga ccttctgcag
ctttctctaa gaaagcttga accctttgac tacctttagg 6060agcaagtccc
acgtattcaa gcgccgaaac cagatttctg gtgaaaagtc tgccaactgc
6120tgttaggcgg aagctactga gcgagaagtg actcgtatcc aaaggcaagt
accatggaac 6180aggtgagtca tcagccagat ccttgtccca tacaacttca
aaaccagctt gtttggctgc 6240ttcgaggcac tgtgttgtca atctaacctc
agggaggcca tttccgagct caatttcggc 6300cttgatcctg ttgtgctctt
cgttattggg gttgtaagaa tcggtcatgc accactcata 6360cacagcgaaa
cattgaccag gcttcagcac ccggtaaatc tctttatagc atcccaatgg
6420atctggtgca tggcaggtag cttctgtaag ttcctgtttt cacctgcacc
atgaaaaata 6480tactattact attatttttc atttatttgt gtggtccata
ttgctatgtg tgaaatgaaa 6540aaatattttt tttctcaaac tacaatattg
tcagaaagaa aggaattaat attccgaatt 6600tataccaaaa aattaatttc
ttttttctct ttggtaagct ggattctgtt attctttggt 6660aaaacggaga
ataattttgt ttatcaactt ctgttgattt tatgaacaat tctcaattaa
6720ttgaaggggt agtttaaggc tgatgaatct tttggatgag ttacttgagc
agtatggatt 6780gactcacatg actaactgct tcactagctt ccaatatttt
ttagttatta catgttgtgt 6840atgttgatta ttgtgctcta agcaatcgga
ttctcttgtt aaataaaaac tatcatagtt 6900tatttattca ataatcgagt
ttgagctaac actcctgtct atctggaata caaaaggaaa 6960gataataaaa
gtttttggta ccttgaaaac tagaagtatc aggaagggga gccttgaaca
7020aaggtcaagt tgtctccgtt tgacctacat gtcatgttcg agccattgat
gcttgcatca 7080ggatagactg cctacatcac cccctcttgc ggtacggccc
ttccccggac ctgcgtgaac 7140gcgggatact ttgtgcaccg gaaaactaca
agtatcccta acacatatca ggattttagt 7200gatatccctt cactgccgtg
ttcgataaag gttacataaa gttttaaatt tatgggtgct 7260aaatatcaca
gctaaatata cacattaaag atattactgc atccatatat gttgccatga
7320ccatacatca agtatacatc cacccctaat ttttgagtgt ttttgagatg
cagcaaagtt 7380gaaggagatt ataatagttt gatgtggaga gactaatttt
ttttttaaca tcactttcta 7440agggtgctat cttttcacca ccatcactgg
tggcttgttg atttgtagct aatcattatc 7500ttttgatgaa aacaaggaca
ttctttagtg cactaagatt gttaaacgtt cgtgcttcat 7560tgtaaatgta
atatactcgc gcttgttggc atgaacactt ggaattgttt actggaacac
7620tgcagagaag ctacctgcca tgcaccagat ccattgggat gctataaaga
gatttaccgg 7680gtgctgaagc ctggtcaatg tttcgctgtg tatgagtggt
gcatgaccga ttcttacaac 7740cccaataacg aagagcacaa caggatcaag
gccgaaattg agctcggaaa tggcctccct 7800gaggttagat tgacaacaca
gtgcctcgaa gcagccaaac aagctggttt tgaagttgta 7860tgggacaagg
atctggctga tgactcacct gttccatggt acttgccttt ggatacgagt
7920cacttctcgc tcagtagctt ccgcctaaca gcagttggca gacttttcac
cagaaatctg 7980gtttcggcgc ttgaatacgt gggacttgct cctaaaggta
gtcaaagggt tcaagctttc 8040ttagagaaag ctgcagaagg tcttgtcggt
ggtgccaaga aagggatttt cacaccaatg 8100tacttcttcg tggttcgcaa
gcccatttca gactctcagt aatatggagt ttagtcactt 8160agctttttgc
tttagctagc aaatctgtaa gattcttcgc acagaacttt acacattgaa
8220tatgaccgcc ctaattaagg tgactacagt ttttggaggg cgttgtgggt
ggagggtttc 8280tttttctgtg ttgcttgtct ggcacaattt gatttcatgt
cttgctattt ttgccattga 8340tgtccttgtt ctaagatata tacctattga
caagctcata aaggtgggca tttgctaata 8400tatggtttcc ctttgctttt
gtgtaaacct caaaacttta tcccccatct ttgattttat 8460cccttgtttt
tctgcttttt tcttctttct tgggttttaa tttccggact taacgtttgt
8520tttccggttt gcgagacata ttctatcgga ttctcaactg tctgatgaaa
taaatatgta 8580atgttctata agtctttcaa tttgatatgc atatcaacaa
aaagaaaata ggacaatgcg 8640gctacaaata tgaaatttac aagtttaaga
accatgagtc gctaaagaaa tcattaagaa 8700aattagtttc acattcaatt
cttgtcacat gattaacgag cttgagaggt ttagagtaac 8760aatatcttga
agcaaaagat gacccacttg aaatctagtg atggatacat aagtggacgt
8820gccttgttta ggataggatt ctggataaga gtctcgaata ttcattttta
ccaagtatat 8880tcaaggatct tgtggatcat atatttcctc aatcaaaggg
acttgaccca aattcacata 8940aagatatttt ggagtc 8956343600DNAArtificial
SequenceArtificially created chimeric nucleic acid sequence
34tctagaatgt tcgtgcgtca aatggataaa caaaaaaata gcataagtta gttttgttac
60tcgagagtta tgtattataa ggtataggga aatgactcaa acataccact gaacttaacg
120aaacgacgca tatatatact acttaactta acgaaaaagg ggtgagagtg
gatgggtgct 180ggtaaataat gaagggttta tataacgtca cgtgtcaaaa
ttcgatagta gtagtttcgt 240tagttgtaat agcatatatg gcccaaagtt
ataatataga taatatgttt atgtccaact 300attaacgagt gacatagaca
gttcattttg tgaagttcaa tgacatattt gagccctttc 360ccttttatta
tctcctttta tttgttctaa taaaagaatg gcatttatta tgtacataga
420caaataacta ttttctttgg aatataattt gtttatatat tttaaaatca
tgtctcaatt 480tagtttgttt tgtgcatatt tcaactattc aattttgtcc
atatatttat taccttcccc 540catttacaag cattgaaccg ctttgctcac
caaaacttat gcacattgca aaaatatcat 600gtaaaggttt tatgtatgct
gtaattaagg tctgaactca tcgtgatttt atttttaggc 660ttcattgacc
actaccaaac tctttgatgc tacattttct aattatattg gagttcgatt
720atatccgaat tcgcgttgcg tagggcccat tcgagggaaa acactcccta
tcaaggattt 780tttcataccc agagctcgaa ctcaagacat ctggttaagg
gaagaacagt ctcatccact 840gcaccatatc cttttgtggt caacaagtaa
attttatgta gaaccaaaaa ctatactcga 900attgataaaa taaatggtgt
aaaatattgt tttctttctt acattttgga cagtaaatat 960gtaggacaat
aataattagc gtggggtctt aagaaaatta gcatagattt ccagaaattc
1020caaatcaacc ggcagttcca ggtttgaaaa ctacaactca ttccgacggt
tcaaacttca 1080aaccatgctt gctgactcgg cttcttcttt ctttttcacc
aagacagagc agtagtcacg 1140tgacacccct cacgtgcctc ccccctttat
atttcagact gcaaccctac actttcgcta 1200cattcactac catattcttt
tcactaagca attttctctc ctacttttct ttaaacccct 1260tttttctccc
ctaagccatg gcatctagat catgttacgt cctgtagaaa ccccaacccg
1320tgaaatcaaa aaactcgacg gcctgtgggc attcagtctg gatcgcgaaa
actgtggaat 1380tgatcagcgt tggtgggaaa gcgcgttaca agaaagccgg
gcaattgctg tgccaggcag
1440ttttaacgat cagttcgccg atgcagatat tcgtaattat gcgggcaacg
tctggtatca 1500gcgcgaagtc tttataccga aaggttgggc aggccagcgt
atcgtgctgc gtttcgatgc 1560ggtcactcat tacggcaaag tgtgggtcaa
taatcaggaa gtgatggagc atcagggcgg 1620ctatacgcca tttgaagccg
atgtcacgcc gtatgttatt gccgggaaaa gtgtacgtat 1680caccgtttgt
gtgaacaacg aactgaactg gcagactatc ccgccgggaa tggtgattac
1740cgacgaaaac ggcaagaaaa agcagtctta cttccatgat ttctttaact
atgccggaat 1800ccatcgcagc gtaatgctct acaccacgcc gaacacctgg
gtggacgata tcaccgtggt 1860gacgcatgtc gcgcaagact gtaaccacgc
gtctgttgac tggcaggtgg tggccaatgg 1920tgatgtcagc gttgaactgc
gtgatgcgga tcaacaggtg gttgcaactg gacaaggcac 1980tagcgggact
ttgcaagtgg tgaatccgca cctctggcaa ccgggtgaag gttatctcta
2040tgaactgtgc gtcacagcca aaagccagac agagtgtgat atctacccgc
ttcgcgtcgg 2100catccggtca gtggcagtga agggcgaaca gttcctgatt
aaccacaaac cgttctactt 2160tactggcttt ggtcgtcatg aagatgcgga
cttgcgtggc aaaggattcg ataacgtgct 2220gatggtgcac gaccacgcat
taatggactg gattggggcc aactcctacc gtacctcgca 2280ttacccttac
gctgaagaga tgctcgactg ggcagatgaa catggcatcg tggtgattga
2340tgaaactgct gctgtcggct ttaacctctc tttaggcatt ggtttcgaag
cgggcaacaa 2400gccgaaagaa ctgtacagcg aagaggcagt caacggggaa
actcagcaag cgcacttaca 2460ggcgattaaa gagctgatag cgcgtgacaa
aaaccaccca agcgtggtga tgtggagtat 2520tgccaacgaa ccggataccc
gtccgcaagg tgcacgggaa tatttcgcgc cactggcgga 2580agcaacgcgt
aaactcgacc cgacgcgtcc gatcacctgc gtcaatgtaa tgttctgcga
2640cgctcacacc gataccatca gcgatctctt tgatgtgctg tgcctgaacc
gttattacgg 2700atggtatgtc caaagcggcg atttggaaac ggcagagaag
gtactggaaa aagaacttct 2760ggcctggcag gagaaactgc atcagccgat
tatcatcacc gaatacggcg tggatacgtt 2820agccgggctg cactcaatgt
acaccgacat gtggagtgaa gagtatcagt gtgcatggct 2880ggatatgtat
caccgcgtct ttgatcgcgt cagcgccgtc gtcggtgaac aggtatggaa
2940tttcgccgat tttgcgacct cgcaaggcat attgcgcgtt ggcggtaaca
agaaagggat 3000cttcactcgc gaccgcaaac cgaagtcggc ggcttttctg
ctgcaaaaac gctggactgg 3060catgaacttc ggtgaaaaac cgcagcaggg
aggcaaacaa tgagagctcg tgaaatggcc 3120tctttagttt ttgattgaat
cataggggta ttagttttct atggccggga gtggtcttct 3180tgcttaattg
taatggaata accagagagg aactactgtg ttatctttga ggaatgttgg
3240gcttttttcg tttgaattat catgaatgaa attttacttt ttcccaatac
aagtttgttt 3300tcgtttcttg gtttttgtta tcccttggtt tatgtcttgg
tttggcttaa atgattgaag 3360attacactac ctatgtttct gctattcctg
ttgaagatca catttgataa taatgcatcg 3420aatgcattaa agtttcttat
tggctctgtc aaaagtattg aaggtggatt tttctaattg 3480gcaagagaaa
gtattaaaga ggtgatttat tagtacttat atttttctca gcatctctct
3540ttcagtgttg gagcttcata aaattagcac ttcagagttt cagtcgggag
ctgaattcga 3600353387DNAArtificial SequenceArtificially created
chimeric nucleic acid sequence 35cgttttgacg agttcggatg tagtagtagc
cattatttaa tgtacatact aatcgtgaat 60agtgaatatg atgaaacatt gtatcttatt
gtataaatat ccataaacac atcatgaaag 120acactttctt tcacggtctg
aattaattat gatacaattc taatagaaaa cgaattaaat 180tacgttgaat
tgtatgaaat ctaattgaac aagccaacca cgacgacgac taacgttgcc
240tggattgact cggtttaagt taaccactaa aaaaacggag ctgtcatgta
acacgcggat 300cgagcaggtc acagtcatga agccatcaaa gcaaaagaac
taatccaagg gctgagatga 360ttaattagtt taaaaattag ttaacacgag
ggaaaaggct gtctgacagc caggtcacgt 420tatctttacc tgtggtcgaa
atgattcgtg tctgtcgatt ttaattattt ttttgaaagg 480ccgaaaataa
agttgtaaga gataaacccg cctatataaa ttcatatatt ttctctccgc
540tttgaattgt ctcgttgtcc tcctcacttt catcggccgt ttttgaatct
ccggcgactt 600gacagagaag aacaaggaag aagactaaga gagaaagtaa
gagataatcc aggagattca 660ttctccgttt tgaatcttcc tcaatctcat
cttcttccgc tctttctttc caaggtaata 720ggaactttct ggatctactt
tatttgctgg atctcgatct tgttttctca atttccttga 780gatctggaat
tcgtttaatt tggatctgtg aacctccact aaatcttttg gttttactag
840aatcgatcta agttgaccga tcagttagct cgattatagc taccagaatt
tggcttgacc 900ttgatggaga gatccatgtt catgttacct gggaaatgat
ttgtatatgt gaattgaaat 960ctgaactgtt gaagttagat tgaatctgaa
cactgtcaat gttagattga atctgaacac 1020tgtttaagtt agatgaagtt
tgtgtataga ttcttcgaaa ctttaggatt tgtagtgtcg 1080tacgttgaac
agaaagctat ttctgattca atcagggttt atttgactgt attgaactct
1140ttttgtgtgt ttgcagctca tatggttgtg tttgggaatg tttctgcggc
gaatttgcct 1200tatcaaaacg ggtttttgga ggcactttca tctggaggtt
gtgaactaat gggacatagc 1260tttagggttc ccacttctca agcgcttaag
acaagaacaa ggaggaggag tactgctggt 1320cctttgcagg tagtttgtgt
ggatattcca aggccagagc tagagaacac tgtcaatttc 1380ttggaagctg
ctagtttatc tgcatccttc cgtagtgctc ctcgtcctgc taagcctttg
1440aaagttgtaa ttgctggtgc tggattggct ggattgtcaa ctgcaaagta
cctggctgat 1500gcaggccaca aacctctgtt gcttgaagca agagatgttc
ttggtggaaa gatagctgca 1560tggaaggatg aagatgggga ctggtatgag
actggtttac atattttctt cggtgcttat 1620ccgaatgtgc agaatttatt
tggagaactt gggatcaatg atcggttgca gtggaaggaa 1680cactccatga
tttttgctat gccaagtaaa cctggagaat ttagtagatt tgacttccca
1740gatgtcctac cagcaccctt aaatggtatt tgggctattt tgcggaacaa
cgagatgctg 1800acatggccag agaaaataaa gtttgctatt ggacttttgc
cagccatggt cggcggtcag 1860gcttatgttg aggcccaaga tggtttatca
gtcaaagaat ggatggaaaa gcagggagta 1920cctgagcgcg tgaccgacga
ggtgtttatt gccatgtcaa aggcgctaaa ctttataaac 1980cctgatgaac
tgtcaatgca atgcattttg atagctttga accggtttct tcaggaaaaa
2040catggttcca agatggcatt cttggatggt aatcctccgg aaaggctttg
tatgccagta 2100gtggatcata ttcgatcact aggtggggaa gtgcaactta
attctaggat aaagaaaatt 2160gagctcaatg acgatggcac ggttaagagt
ttcttactca ctaatggaag cactgtcgaa 2220ggagacgctt atgtgtttgc
cgctccagtc gatatcctga agctcctttt accagatccc 2280tggaaagaaa
taccgtactt caagaaattg gataaattag ttggagtacc agttattaat
2340gttcatatat ggtttgatcg aaaactgaag aacacatatg atcacctact
ctttagcaga 2400agtaaccttc tgagcgtgta tgccgacatg tccttaactt
gtaaggaata ttacgatcct 2460aaccggtcaa tgctggagct agtatttgca
ccagcagagg aatggatatc acggactgat 2520tctgacatca tagatgcaac
aatgaaagaa cttgagaaac tcttccctga tgaaatctca 2580gctgaccaaa
gcaaagctaa aattctgaag taccatgtcg ttaagactcc aagatctggg
2640tacaagacca tcccaaactg tgaaccatgt cgtcctctac aaagatcacc
tattgaagga 2700ttctacttag ctggagatta cacaaaacag aagtacttag
cttccatgga aggcgctgtc 2760ctctctggca aattctgctc tcagtctatt
gttcaggatt acgagctact ggctgcgtct 2820ggaccaagaa agttgtcgga
ggcaacagta tcatcatcat gagaaaaggg cgaattcgtt 2880aaccgcagac
gagctcgtga aatggcctct ttagtttttg attgaatcat aggggtatta
2940gttttctatg gccgggagtg gtcttcttgc ttaattgtaa tggaataacc
agagaggaac 3000tactgtgtta tctttgagga atgttgggct tttttcgttt
gaattatcat gaatgaaatt 3060ttactttttc ccaatacaag tttgttttcg
tttcttggtt tttgttatcc cttggtttat 3120gtcttggttt ggcttaaatg
attgaagatt acactaccta tgtttctgct attcctgttg 3180aagatcacat
ttgataataa tgcatcgaat gcattaaagt ttcttattgg ctctgtcaaa
3240agtattgaag gtggattttt ctaattggca agagaaagta ttaaagaggt
gatttattag 3300tacttatatt tttctcagca tctctctttc agtgttggag
cttcataaaa ttagcacttc 3360agagtttcag tcgggagctg aattcga
3387361701DNAArabidopsis thaliana 36atggttgtgt ttgggaatgt
ttctgcggcg aatttgcctt atcaaaacgg gtttttggag 60gcactttcat ctggaggttg
tgaactaatg ggacatagct ttagggttcc cacttctcaa 120gcgcttaaga
caagaacaag gaggaggagt actgctggtc ctttgcaggt agtttgtgtg
180gatattccaa ggccagagct agagaacact gtcaatttct tggaagctgc
tagtttatct 240gcatccttcc gtagtgctcc tcgtcctgct aagcctttga
aagttgtaat tgctggtgct 300ggattggctg gattgtcaac tgcaaagtac
ctggctgatg caggccacaa acctctgttg 360cttgaagcaa gagatgttct
tggtggaaag atagctgcat ggaaggatga agatggggac 420tggtatgaga
ctggtttaca tattttcttc ggtgcttatc cgaatgtgca gaatttattt
480ggagaacttg ggatcaatga tcggttgcag tggaaggaac actccatgat
ttttgctatg 540ccaagtaaac ctggagaatt tagtagattt gacttcccag
atgtcctacc agcaccctta 600aatggtattt gggctatttt gcggaacaac
gagatgctga catggccaga gaaaataaag 660tttgctattg gacttttgcc
agccatggtc ggcggtcagg cttatgttga ggcccaagat 720ggtttatcag
tcaaagaatg gatggaaaag cagggagtac ctgagcgcgt gaccgacgag
780gtgtttattg ccatgtcaaa ggcgctaaac tttataaacc ctgatgaact
gtcaatgcaa 840tgcattttga tagctttgaa ccggtttctt caggaaaaac
atggttccaa gatggcattc 900ttggatggta atcctccgga aaggctttgt
atgccagtag tggatcatat tcgatcacta 960ggtggggaag tgcaacttaa
ttctaggata aagaaaattg agctcaatga cgatggcacg 1020gttaagagtt
tcttactcac taatggaagc actgtcgaag gagacgctta tgtgtttgcc
1080gctccagtcg atatcctgaa gctcctttta ccagatccct ggaaagaaat
accgtacttc 1140aagaaattgg ataaattagt tggagtacca gttattaatg
ttcatatatg gtttgatcga 1200aaactgaaga acacatatga tcacctactc
tttagcagaa gtaaccttct gagcgtgtat 1260gccgacatgt ccttaacttg
taaggaatat tacgatccta accggtcaat gctggagcta 1320gtatttgcac
cagcagagga atggatatca cggactgatt ctgacatcat agatgcaaca
1380atgaaagaac ttgagaaact cttccctgat gaaatctcag ctgaccaaag
caaagctaaa 1440attctgaagt accatgtcgt taagactcca agatctgtgt
acaagaccat cccaaactgt 1500gaaccatgtc gtcctctaca aagatcacct
attgaaggat tctacttagc tggagattac 1560acaaaacaga agtacttagc
ttccatggaa ggcgctgtcc tctctggcaa attctgctct 1620cagtctattg
ttcaggatta cgagctactg gctgcgtctg gaccaagaaa gttgtcggag
1680gcaacagtat catcatcatg a 1701
* * * * *