U.S. patent application number 13/121165 was filed with the patent office on 2011-08-25 for method for production of plant imparted with stress tolerance and use thereof.
This patent application is currently assigned to NATIONAL INSTITUTE OF ADVANCED INDUSTRIAL SCIENCE AND TECHNOLOGY. Invention is credited to Kyoko Matsui, Tomomi Mito, Masaru Takagi.
Application Number | 20110209244 13/121165 |
Document ID | / |
Family ID | 42059624 |
Filed Date | 2011-08-25 |
United States Patent
Application |
20110209244 |
Kind Code |
A1 |
Takagi; Masaru ; et
al. |
August 25, 2011 |
METHOD FOR PRODUCTION OF PLANT IMPARTED WITH STRESS TOLERANCE AND
USE THEREOF
Abstract
The present invention provides a method for producing a plant
with a stress tolerance, comprising the step of inhibiting, in a
plant, a function of a first polypeptide including an amino acid
sequence represented by any one of SEQ ID NOS: 2, 4, 6, 8, and 10.
This enables developing a new technique capable of producing a
plant with a stress tolerance such as a salt tolerance and a high
osmotic pressure tolerance.
Inventors: |
Takagi; Masaru; ( Ibaraki,
JP) ; Mito; Tomomi; (Ibaraki, JP) ; Matsui;
Kyoko; (Ibaraki, JP) |
Assignee: |
NATIONAL INSTITUTE OF ADVANCED
INDUSTRIAL SCIENCE AND TECHNOLOGY
Tokyo
JP
GreenSogna, Inc.
Tsukuba-shi, Ibaraki
JP
|
Family ID: |
42059624 |
Appl. No.: |
13/121165 |
Filed: |
September 3, 2009 |
PCT Filed: |
September 3, 2009 |
PCT NO: |
PCT/JP2009/065385 |
371 Date: |
May 4, 2011 |
Current U.S.
Class: |
800/278 ;
435/320.1; 536/23.6; 536/24.33; 800/298 |
Current CPC
Class: |
C12N 15/62 20130101;
C12N 15/8216 20130101; C12N 15/8273 20130101; C12N 15/8271
20130101 |
Class at
Publication: |
800/278 ;
435/320.1; 536/23.6; 536/24.33; 800/298 |
International
Class: |
A01H 1/00 20060101
A01H001/00; C12N 15/82 20060101 C12N015/82; C07H 21/04 20060101
C07H021/04; A01H 5/00 20060101 A01H005/00; A01H 5/10 20060101
A01H005/10 |
Foreign Application Data
Date |
Code |
Application Number |
Sep 29, 2008 |
JP |
2008-251043 |
Claims
1. A method for producing a plant with a stress tolerance,
comprising the step of inhibiting, in a plant, a function of a
first polypeptide including an amino acid sequence represented by
any one of SEQ ID NOS: 2, 4, 6, 8, and 10.
2. The method as set forth in claim 1, wherein the step of
inhibiting a function of a first polypeptide is carried out in such
a manner that a fusion protein of the first polypeptide and a
second polypeptide which converts any transcription factor into a
transcription inhibiting factor is produced in the plant.
3. The method as set forth in claim 1, wherein the step of
inhibiting a function of a first polypeptide is carried out in such
a manner that expression of the first polypeptide is inhibited in
the plant.
4. The method as set forth in claim 1, wherein the stress tolerance
is a salt tolerance and/or a high osmotic pressure tolerance.
5. A plant, produced by a method as set forth in claim 1.
6. The plant as set forth in claim 5, selected from the group
consisting of a grown plant individual, a plant cell, a plant
tissue, a callus, and a seed.
7. A kit for producing a plant with a stress tolerance, comprising:
a first polynucleotide including a base sequence represented by any
one of SEQ ID NOS: 1, 3, 5, 7, and 9; and a second polynucleotide
encoding a functional peptide which converts any transcription
factor into a transcription inhibiting factor.
8. The kit as set forth in claim 7, wherein the first
polynucleotide and the second polynucleotide are bound to each
other in frame.
9. A kit for producing a plant with a stress tolerance, comprising:
an oligonucleotide set including any one of a first primer set (SEQ
ID NOS: 11 and 12), a second primer set (SEQ ID NOS: 13 and 14), a
third primer set (SEQ ID NOS: 15 and 16), a fourth primer set (SEQ
ID NOS: 17 and 18), and a fifth primer set (SEQ ID NOS: 19 and 20);
and a polynucleotide encoding a functional peptide which converts
any transcription factor into a transcription inhibiting
factor.
10. The kit as set forth in claim 7, further comprising an
expression vector for expressing a target polypeptide in a
plant.
11. The kit as set forth in claim 10, further comprising reagents
for introducing the expression vector into a plant cell.
12. A method for imparting a plant with a stress tolerance,
comprising the step of inhibiting, in a plant, a function of a
polypeptide including an amino acid sequence represented by any one
of SEQ ID NOS: 2, 4, 6, 8, and 10.
13. A kit for imparting a plant with a stress tolerance,
comprising: a first polynucleotide including a base sequence
represented by any one of SEQ ID NOS: 1, 3, 5, 7, and 9; and a
second polynucleotide encoding a functional peptide which converts
any transcription factor into a transcription inhibiting
factor.
14. The kit as set forth in claim 13, wherein the first
polynucleotide and the second polynucleotide are bound to each
other in frame.
15. A kit for imparting a plant with a stress tolerance,
comprising: an oligonucleotide set including any one of a first
primer set (SEQ ID NOS: 11 and 12), a second primer set (SEQ ID
NOS: 13 and 14), a third primer set (SEQ ID NOS: 15 and 16), a
fourth primer set (SEQ ID NOS: 17 and 18), and a fifth primer set
(SEQ ID NOS: 19 and 20); and a polynucleotide encoding a functional
peptide which converts any transcription factor into a
transcription inhibiting factor.
16. The kit as set forth in claim 9, further comprising an
expression vector for expressing a target polypeptide in a
plant.
17. The kit as set forth in claim 16, further comprising reagents
for introducing the expression vector into a plant cell.
Description
TECHNICAL FIELD
[0001] The present invention relates to a new technique for
imparting a plant with a stress tolerance. To be more specific, the
present invention relates to a method for production of a plant
imparted with a salt tolerance and/or a high osmotic pressure
tolerance and use thereof.
BACKGROUND ART
[0002] In view of the increase in food production and environment
conservation, there has been expected production of plants having a
tolerance against environmental stresses such as salt and an
osmotic pressure. Researches on plants having a tolerance against
environmental stresses have been made so far, and there have been
reported isolation of plants having resistant mutation (see
Non-patent Literatures 1 and 2 for example) and imparting of
tolerance by overexpression (see Non-patent Literatures 3 and 4 for
example).
Citation List
[Patent Literatures]
[0003] Patent Literature 1: Japanese Patent Application Publication
Tokukai No. 2001-269177 (published on Oct. 2, 2001) [0004] Patent
Literature 2: Japanese Patent Application Publication Tokukai No.
2001-269178 (published on Oct. 2, 2001) [0005] Patent Literature 3:
Japanese Patent Application Publication Tokukai No. 2001-292776
(published on Oct. 2, 2001) [0006] Patent Literature 4: Japanese
Patent Application Publication Tokukai No. 2001-292777 (published
on Oct. 23, 2001) [0007] Patent Literature 5: Japanese Patent
Application Publication Tokukai No. 2001-269176 (published on Oct.
2, 2001) [0008] Patent Literature 6: Japanese Patent Application
Publication Tokukai No. 2001-269179 (published on Oct. 2, 2001)
[0009] Patent Literature 7: Japanese Patent Application Publication
Tokukai No. 2005-13214 (published on Jan. 20, 2005) [0010] Patent
Literature 8: Japanese Patent Application Publication Tokukai No.
2005-27654 (published on Feb. 3, 2005) [0011] Patent Literature 9:
Japanese Patent Application Publication Tokukai No. 2005-204573
(published on Aug. 4, 2005) [0012] Patent Literature 10: Japanese
Patent Application Publication Tokukai No. 2006-006248 (published
on Jan. 12, 2006) [0013] Patent Literature 11: Japanese Patent
Application Publication Tokukai No. 2006-020607 (published on Jan.
26, 2006)
[Non-patent Literatures]
[0013] [0014] Non-patent Literature 1: The Plant Cell (1998) 10:
1181-91 [0015] Non-patent Literature 2: FEBS Lett. (2006) 580:
6537-42 [0016] Non-patent Literature 3: Nat. Biotechnol. (1999) 17:
287-91 [0017] Non-patent Literature 4: J. Biol. Chem. (2007) 282:
9260-8 [0018] Non-patent Literature 5: The Plant Cell (2001) 13:
1959-1968 [0019] Non-patent Literature 6: FEBS Letters (2002) 514:
351-354 [0020] Non-patent Literature 7: The Plant Cell (2007) 19:
473-484 [0021] Non-patent Literature 8: Plant Physiol. (2003)
132(3): 1415-23 [0022] Non-patent Literature 9: Plant Physiol.
(2007) 145: 147-59 [0023] Non-patent Literature 10: The Plant Cell
(2000) 12(3): 393-404
SUMMARY OF INVENTION
Technical Problem
[0024] However, most of the resistant mutations shown in Non-patent
Literatures 1 and 2 are recessive traits, and so it is difficult to
make practical use of plants having the resistant mutations.
Further, imparting of tolerance by overexpression shown in
Non-patent Literatures 3 and 4 may have an influence on growth of
plants and forms of plants, and so it is difficult to make
practical use of plants imparted with a tolerance by
overexpression.
[0025] The present invention was made in view of the foregoing
problems. An object of the present invention is to provide a
technique of easily producing a plant imparted with a stress
tolerance.
Solution to Problem
[0026] The inventors of the present invention have so far developed
a technique of converting a transcription factor into a
transcription inhibiting factor. This technique is useful for
analyzing functions of various plant genes in vivo. In this
technique, any gene is regarded as a target (target gene), for
example, the effecter plasmid is introduced into plant cells so as
to inhibit transcription of the target gene, resulting in
inhibition of the function of the target gene in the plant to which
the effecter plasmid has been introduced. Consequently, observing
the phenotype expressed in the transgenic plant enables analysis of
the function of the target gene. As for functional peptide usable
in such a technique, see Patent Literatures 1-8 and Non-patent
Literatures 5-6 etc. These documents are incorporated herein for
reference.
[0027] The inventors of the present invention have used the above
technique and found that a transcription factor family (TCP family)
protein is essential for normal morphogenesis of a flower and
inhibiting the function of this protein enables effectively
changing the shape of the flower (see Patent Literatures 9-11 and
Non-patent Literature 7). The inventors of the present invention
have further studied in order to clarify TCP family-related
signaling for morphogenesis of leaves and found various genes whose
expressions increase by inhibiting the function of the TCP family
protein.
[0028] The various genes whose expressions increase by inhibiting
the function of the TCP family protein include a transcription
factor whose function was unknown. The inventors of the present
invention have further studied to find what role this transcription
factor plays in morphogenesis of leaves, and found that this
transcription factor is related to a function entirely different
from morphogenesis of leaves. Thus, the present invention has been
completed.
[0029] A method of the present invention for producing a plant with
a stress tolerance includes the step of inhibiting, in a plant, a
function of a first polypeptide including an amino acid sequence
represented by any one of SEQ ID NOS: 2, 4, 6, 8, and 10.
[0030] As described above, the function of the first polypeptide
had not been known other than the fact that the first polypeptide
is a transcription factor. Further, the function conceivable from
the study of TCP family proteins (control of morphogenesis of
leaves) and a stress tolerance are not related to each other at
all. Thus, a person skilled in the art did not know, and could not
have expected, that the first polypeptide is related a stress
tolerance.
[0031] It is preferable to arrange the method of the present
invention such that the step of inhibiting a function of a first
polypeptide is carried out in such a manner that a fusion protein
of the first polypeptide and a second polypeptide which converts
any transcription factor into a transcription inhibiting factor is
produced in the plant.
[0032] The second polypeptide is a functional peptide which was
developed by the inventors of the present invention, and has a
function of converting any transcription factor into a
transcription inhibiting factor. Since such a peptide can be used
as a selection marker, it is possible to select a desired plant
without using chemical agents. Further, most of resistant mutations
isolated so far are recessive traits and it is not easy to make
practical use of plants having such resistant mutations. On the
other hand, use of the functional peptide enables imparting a
resistant trait as a dominant trait, and also enables inducing the
resistant trait by a specific promoter. Further, since the
resistant trait serves as a dominant trait, the functional peptide
is applicable to plants whose gene information is little known.
[0033] The method of the present invention may be arranged such
that the step of inhibiting a function of a first polypeptide is
carried out in such a manner that expression of the first
polypeptide is inhibited in the plant. In this case, the inhibition
of the expression of the first polypeptide may be made by a
knock-put process or an RNAi process.
[0034] It is preferable to arrange the method of the present
invention such that the stress tolerance is a salt tolerance and/or
a high osmotic pressure tolerance.
[0035] The plant of the present invention is produced by the above
method. It is preferable that the plant of the present invention is
selected from the group consisting of a grown plant individual, a
plant cell, a plant tissue, a callus, and a seed.
[0036] A kit of the present invention for producing a plant with a
stress tolerance includes: a first polynucleotide including a base
sequence represented by any one of SEQ ID NOS: 1, 3, 5, 7, and 9;
and a second polynucleotide encoding a functional peptide which
converts any transcription factor into a transcription inhibiting
factor.
[0037] A kit of the present invention for producing a plant with a
stress tolerance may include: an oligonucleotide set including any
one of a first primer set (SEQ ID NOS: 11 and 12), a second primer
set (SEQ ID NOS: 13 and 14), a third primer set (SEQ ID NOS: 15 and
16), a fourth primer set (SEQ ID NOS: 17 and 18), and a fifth
primer set (SEQ ID NOS: 19 and 20); and a polynucleotide (second
polynucleotide) encoding a functional peptide which converts any
transcription factor into a transcription inhibiting factor.
[0038] It is preferable that the kit of the present invention
further includes an expression vector for expressing a target
polypeptide in a plant. It is more preferable that the kit of the
present invention further includes reagents for introducing the
expression vector into a plant cell.
[0039] The method of the present invention for producing a plant
may be a method for imparting a plant with a stress tolerance.
Further, the kit of the present invention may be a kit for
imparting a plant with a stress tolerance.
Advantageous Effects of Invention
[0040] The present invention enables imparting a plant with a salt
tolerance and an osmotic pressure tolerance. This enables producing
a functional plant capable of standing up to salt damage or
dryness. This enables producing a desired crop in a wide variety of
areas.
BRIEF DESCRIPTION OF DRAWINGS
[0041] FIG. 1
[0042] FIG. 1 shows states of wild type Arabidopsis thaliana and
Arabidopsis thaliana expressing a salt-tolerance chimeric
repressor, which were three weeks after sowing with various salt
concentrations.
[0043] FIG. 2
[0044] FIG. 2 shows states of wild type Arabidopsis thaliana and
Arabidopsis thaliana expressing an osmotic pressure-tolerance
chimeric repressor, which were three weeks after sowing with
various mannitol concentrations.
DESCRIPTION OF EMBODIMENTS
[0045] The present invention provides a method for production of a
plant with a stress tolerance. The method of the present invention
includes the step of inhibiting a function of a particular
transcription factor in a plant.
[0046] In the present invention, "transcription factor
(transcription factor etc.)" indicates a transcription factor or a
DNA-binding domain of the transcription factor, and is preferably a
transcription factor of a plant. "transcription factor" indicates a
polypeptide (transcription control factor) which positively or
negatively controls transcription or initiation reaction of the
transcription, and is preferably a polypeptide which positively
controls the transcription or initiation reaction of the
transcription.
[0047] The term "polypeptide" used herein is compatible with
"peptide" or "protein". The term "fragment" of polypeptide
indicates a partial fragment of the polypeptide. The polypeptide
according to the present invention may be isolated from a natural
source or may be synthesized chemically.
[0048] The term "isolated" polypeptide or protein indicates
polypeptide or protein extracted from its natural environment. For
example, recombinantly produced polypeptide or protein expressed in
a host cell is considered as being isolated, as with natural or
recombinant polypeptide or protein which is substantially purified
by any proper technique.
[0049] Examples of the "polypeptide" include naturally purified
products, chemically synthesized products, and products produced by
a recombinant technique from a prokaryote host or a eucaryote host
(e.g. bacteria cells, yeast cells, higher plant cells, insect
cells, and mammal cells). The "polypeptide" may be glycosylated or
non-glycosylated depending on a host used in a recombinant
production process. Further, in some cases, the "polypeptide" may
contain a modified methionine residue resulting from a start codon
as a result of a host-mediated expression process.
[0050] The "polypeptide" may be polypeptide in which amino acids
are bound to each other by a peptide bond. Alternatively, the
"polypeptide" may be a complex polypeptide including a structure
other than polypeptide. Examples of the "structure other than
polypeptide" used herein include, but not limited to, glycans and
isoprenoid groups.
[0051] The term "polynucleotide" used herein is compatible with
"gene", "nucleic acid", or "nucleic acid molecule", and indicates a
polymer of nucleotides. The term "base sequence" used herein is
compatible with "nucleic acid sequence" or "nucleotide sequence",
and is shown as a sequence of deoxyribonucleotides (abbreviated as
A, G, C, and T).
[0052] Polynucleotide can exist in the form of RNA (e.g. mRNA) or
in the form of DNA (e.g. cDNA or genome DNA). DNA may be
double-stranded or single-stranded. The single-stranded DNA or RNA
may be a code strand (also known as a sense strand) or may be a
non-code strand (also known as anti-sense strand).
[0053] The expression "inhibit the function of a transcription
factor" indicates causing the function of the transcription factor
as a transcription control factor to be lost. Examples of the loss
of the transcription control factor include loss of an
interactional function between proteins, loss of a DNA binding
function, loss of a transcription control function and/or inversion
of the transcription control function. A person skilled in the art
who reads the present specification easily understands that a
transcription factor having lost these functions is inhibited from
realizing these functions. As described above, inhibiting the
function of a transcription factor suppresses expression of a
target gene which is a target of the transcription factor.
Alternatively, inhibiting the function of a transcription factor
suppresses expression of a downstream gene which is positioned
downstream of the transcription factor, resulting in subdual of the
function of the downstream gene. That is, in the present
specification, the expression "inhibit the function of a
transcription factor" is compatible with "suppress expression of a
target gene which is a target of the transcription factor",
"suppress expression of a downstream gene which is positioned
downstream of the transcription factor", and "suppress the function
of the downstream gene".
[0054] A method for inhibiting the function of a transcription
factor may be inhibition of expression of a gene or protein
corresponding to a target transcription factor in a plant, or may
be inhibition of synthesis of RNA or inhibition of synthesis of
protein. A method for inhibiting expression of protein may be a
technique well known in the art. Examples of the technique include,
but not limited to, a knock-out process and an RNAi process.
[0055] As described above, the inventors of the present invention
have already developed a technique of converting a transcription
factor into a transcription inhibiting factor. The "transcription
inhibiting factor" used herein is compatible with "chimeric
repressor", and is a fusion protein including a "transcription
factor" and a "functional peptide". That is, in the present
invention, in order to inhibit the function of a transcription
factor, a fusion protein (chimeric repressor) of a target
transcription factor and a functional peptide which converts any
transcription factor into a transcription inhibiting factor may be
expressed in a plant. In order to express a target protein in a
plant, a gene encoding the protein is introduced into the plant. As
described above, application of the chimeric repressor technique
enables subduing expression of a target gene which is a target of a
transcription factor. Alternatively, application of the chimeric
repressor technique enables subduing expression of a downstream
gene which is positioned downstream of the transcription factor,
resulting in subdual of the function of the downstream gene.
[0056] In the present invention, the term "include" indicates
substantially encompassing components, and may be replaced with
"made of", but not limited to "consist of". That is, the term "made
of" also indicates encompassing additional components.
[0057] The wording "a gene is introduced" used herein indicates
that a gene is introduced into a target cell (host cell) by a
well-known genetic engineering process (gene manipulation
technique) in such a manner that the gene can be expressed in the
target cell (i.e. transformant). Accordingly, the transformant used
herein may be obtained by introducing a recombinant expression
vector including a chimeric repressor gene into a living organism.
Examples of the transformant used herein include not only cells but
also tissues and organs of a living organism and individual plants
or animals. The living organism is not particularly limited.
Examples of a living organism to be used in the test include plants
such as Arabidopsis thaliana and animals such as mice, rats,
drosophilas, and nematodes.
[0058] Alternatively, in a case where the present invention is
applied to an industrial field using plants, examples of the living
organism include various products (plants and crops produced in
agriculture, forestry and marine products industry). Specific
examples of such products and crops include grains (e.g. rice
plant, wheat, and corn), vegetables, flowers, ornamental plants,
and timbers (e.g. pine, cedar, and Japanese cypress).
[0059] In the present specification, a method for introducing a
gene into a plant is not particularly limited, but it is preferable
that a target gene is incorporated into an expression vector. An
example of the expression vector may be a publicly known plant
transforming vector (e.g. binary vector (pBIN19, pBI121, pBIG
etc.)). However, as described in Patent Literature 7, in a case
where a publicly known plant transforming vector is used, some
applications of the vector are unable to achieve a sufficient
transformation ratio. Accordingly, it is preferable to use a vector
for constructing an expression vector which is described in Patent
Literature 7. A preferable expression vector is a vector which
includes a promoter and a terminator for a plant and a target gene
positioned between the promoter and the terminator and which
expresses, in a host plant, a protein encoded by the target
gene.
[0060] A method for transforming a plant by using such an
expression vector is not particularly limited, and the recombinant
expression vector may be introduced into a host by a suitable
method of transformation according to the kind of the host. In the
present invention, a particularly preferable example of the host is
a plant. In this case, examples of the method for transformation
are not particularly limited, and may be conventional and publicly
known transformation such as transformation using a gene gun,
protoplast/spheroplast transformation, Agrobacterium
transformation, electroporation, calcium phosphate transformation,
transformation using ribosome, and DEAE dextran transformation. In
order to carry out the present invention, Agrobacterium-mediated
transformation assisted by vacuum infiltration is preferable.
[0061] In order to confirm whether a target gene is introduced into
a host cell or not and whether the target gene is surely expressed
in the host cell or not, a marker may be used. For example, a gene
which is deleted in the host cell is used as a marker, and a
plasmid etc. including the marker and the target gene is introduced
as an expression vector into the host cell. This enables
confirmation of introduction of the target gene by observing
expression of the marker gene. Alternatively, a target protein may
be expressed as a fusion protein. For example, GFP (Green
Fluorescent Protein) derived from Aequorea victoria is used as a
marker and the target protein may be expressed as a GFP fusion
protein. Alternatively, a gene for causing an expression site of a
transgenic plant to be visible for monitoring may be introduced
into a recombinant expression vector. An example of such a gene is
.beta.-glucuronidase (GUS) gene.
[0062] In the present specification, a transcription factor whose
function is to be inhibited in order to impart a plant with a
stress tolerance is also referred to as a first polypeptide. The
first polypeptide is encoded by one of genes whose expression is
increased by inhibiting the function of a TCP family protein known
as relating to morphogenesis of a plant. As for the TCP family
protein, see Patent Literatures 9-11 and Non-patent Literature 7.
The first polypeptide is not related to the structure and the
function of the TCP family protein.
[0063] In one embodiment, the first polypeptide may be a
polypeptide made of an amino acid sequence represented by any one
of SEQ ID. Nos. 2, 4, 6, 8, and 10, or may be a variant of the
polypeptide which variant has the same function as that of the
polypeptide. The function of the first polypeptide indicates a one
inhibition of which enables imparting a plant with a stress
tolerance. In the present invention, the stress tolerance is
preferably a salt tolerance and/or a high osmotic pressure
tolerance.
[0064] As described in later-mentioned Examples, the inventors of
the present invention found that transcription factors At4g21440
(SEQ ID Nos. 1 and 2), At3g04070 (SEQ ID Nos. 3 and 4), and
At1g13300 (SEQ ID Nos. 5 and 6) are related to a salt tolerance.
That is, by inhibiting the function of the transcription factor
At4g21440, At3g04070, or At1g13300, it is possible to prepare a
plant with a salt tolerance. Further, the inventors of the present
invention found that transcription factors At5g04340 (SEQ ID Nos. 7
and 8) and At5g47230 (SEQ ID Nos. 9 and 10) are related to a high
osmotic pressure. That is, by inhibiting the function of the
transcription factor At5g04340 or At5g47230, it is possible to
prepare a plant with a high osmotic pressure tolerance.
[0065] It is reported that At4g21440 is "MYB102" which is involved
in an injury and osmotic pressure stress signaling system (see
Non-patent Literature 8). However, Non-patent Literature 8 neither
describes nor suggests that inhibition of the function of At4g21440
in a plant enables imparting the plant with a salt tolerance.
At3g04070 is also referred to as "ANAC047", but its function has
not been reported. At1g13300 is considered as belonging to "GARP
family", but its function has not been reported.
[0066] It is reported that At5g04340 is "ZAT6" which negatively
controls growth of a main root of Arabidopsis thaliana and changes
the structure of the root in order to balance phosphoric acid (see
Non-patent Literature 9). However, Non-patent Literature 9 neither
describes nor suggests that inhibition of the function of At5g04340
in a plant enables imparting the plant with a high osmotic pressure
tolerance. It is reported that At5g47230 is "AtERF5" which is
induced by injury (see Non-patent Literature 10). However,
Non-patent Literature 10 neither describes nor suggests that
inhibition of the function of At5g47230 in a plant enables
imparting the plant with a high osmotic pressure tolerance.
[0067] In the present specification, an example of a variant is a
polypeptide (protein) including an amino acid sequence derived from
the amino acid sequence represented by any one of SEQ ID NOS: 2, 4,
6, and 10 by deletion, addition, or substitution of one or several
amino acids. It is well known in the art that some amino acids in
the amino acid sequence of the polypeptide can be easily modified
without a significant influence on the structure or the function of
the polypeptide. Further, it is also well known in the art that
other than artificial modification, there exist variants of natural
proteins in which structures or functions of the natural proteins
are not significantly changed.
[0068] A person skilled in the art can easily mutate one or several
amino acids in an amino acid sequence of a polypeptide by using a
well-known art. For example, by employing publicly known point
mutation, it is possible to mutate any base of a polynucleotide
which encodes a polypeptide. Further, by designing a primer
corresponding to any site of a polynucleotide which encodes a
polypeptide, it is possible to prepare a variant with deletion or a
variant with addition. Further, it is also possible to attain the
object by using random variation.
[0069] In the present specification, another example of a variant
is preferably a variant encoded by a polynucleotide including a
base sequence derived from a base sequence represented by any one
of SEQ ID Nos: 1, 3, 5, 7 and 9 by deletion, substitution, or
addition of one or several bases.
[0070] In the present specification, another example of a variant
is preferably a variant encoded by a polynucleotide which is
hybridized, under a stringent condition, with a polynucleotide
including a sequence complementary to a base sequence represented
by any one of SEQ ID Nos: 1, 3, 5, 7 and 9.
[0071] Hybridization may be carried out by a well known method such
as a method described in "Molecular Cloning: A Laboratory Manual,
Third Edition, edited by J. Sambrook and D. W. Russell, Cold Spring
Harbor Laboratory, N.Y. (2001)" (incorporated herein for
reference). Normally, higher temperature and lower salt
concentration makes the condition more stringent (makes
hybridization more difficult), so that a more homologous
polynucleotide can be obtained. A temperature suitable for the
hybridization varies according to a base sequence and the length of
the base sequence. For example, in a case where a DNA fragment
including eighteen bases encoding six amino acids is used as a
probe, the temperature of 50.degree. C. or less is preferable.
[0072] The term "stringent hybridization condition" used herein
indicates one-night incubation at 42.degree. C. in a hybridization
solution (containing 50% formaldehyde, 5.times.SSC (150 mM NaCl and
15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6),
5.times.Denhardt's solution, 10% dextran sulfate, and 20 .mu.g/ml
denatured sonicated sermon sperm DNA), and then washing a filter at
approximately 65.degree. C. in 0.1.times.SSC.
[0073] In the present specification, "functional peptide" indicates
a peptide capable of converting a transcription factor into a
transcription inhibiting factor, and is compatible with
"transcription inhibition converting peptide" or "repressor
domain". In the present specification, the "functional peptide" is
also referred to as a second polypeptide.
[0074] As described above, the "functional peptide" has been
already well known in the art (see Patent Literatures 1-8 and
Non-patent Literatures 5-6 etc.). Accordingly, a person skilled in
the art can easily prepare a desired functional peptide by using a
well-known technique such as a recombinant technique or chemical
synthesis. Further, a person skilled in the art can easily prepare
a fusion protein of a desired transcription factor and a desired
functional peptide.
[0075] In one embodiment, it is preferable that the functional
peptide includes an amino acid sequence represented by any one of
[0076] (1) X1-Leu-Asp-Leu-X2-Leu-X3 [0077] (2)
Y1-Phe-Asp-Leu-Asn-Y2-Y3 [0078] (3) Z1-Asp-Leu-Z2-Leu-Arg-Leu-Z3
[0079] (4) Asp-Leu-Z4-Leu-Arg-Leu where X1 indicates 0-10 amino
acid residues, X2 indicates Asn or Glu, X3 indicates at least 6
amino acid residues, Y1 indicates 0-10 amino acid residues, Y2
indicates Phe or Ile, Y3 indicates at least 6 amino acid residues,
Z1 indicates Leu, Asp-Leu or Leu-Asp-Leu, Z2 indicates Glu, Gln, or
Asp, Z3 indicates 0-10 amino acid residues, and Z4 indicates Glu,
Gln, or Asp.
[0080] In the functional peptide represented by formula (1), the
number of amino acid residues represented by X1 should be 0-10. The
specific kind of an amino acid constituting the amino acid residue
represented by X1 is not particularly limited. In other words, to
an N-terminus of the functional peptide represented by formula (1),
an oligomer made of any one amino acid or any two-ten amino acid
residues may be added, or no amino acid may be added.
[0081] The amino acid residue represented by X1 should be as short
as possible in consideration of easiness in synthesizing the
functional peptide represented by formula (1). Specifically, the
number of amino acid residues represented by X1 is preferably 10 or
less, and more preferably 5 or less.
[0082] Similarly, in the functional peptide represented by formula
(1), the number of amino acid residues represented by X3 should be
at least 6. The specific kind of an amino acid sequence
constituting the amino acid residue represented by X3 is not
particularly limited. In other words, to a C-terminus of the
functional peptide represented by formula (1), an oligomer made of
any at least 6 amino acid residues should be added. The amino acid
residues represented by X3 can express the above function provided
that there exist at least 6 such amino acid residues.
[0083] In the functional peptide represented by formula (2), the
number of amino acid residues represented by Y1 should be 0-10, as
in the case of X1 in the functional peptide represented by formula
(1). The specific kind of an amino acid constituting the amino acid
residue represented by Y1 is not particularly limited. In other
words, to an N-terminus of the functional peptide represented by
formula (2), an oligomer made of any one amino acid or any two-ten
amino acid residues may be added, or no amino acid may be added, as
in the case of the functional peptide represented by formula
(1).
[0084] The amino acid residue represented by Y1 should be as short
as possible in consideration of easiness in synthesizing the
functional peptide represented by formula (2). Specifically, the
number of amino acid residues represented by Y1 is preferably 10 or
less, and more preferably 5 or less.
[0085] Similarly, in the functional peptide represented by formula
(2), the number of amino acid residues represented by Y3 should be
at least 6, as in the case of X3 in the functional peptide
represented by formula (1). The specific kind of an amino acid
sequence constituting the amino acid residue represented by Y3 is
not particularly limited. In other words, to a C-terminus of the
functional peptide represented by formula (2), an oligomer made of
any at least 6 amino acid residues should be added, as in the case
of the functional peptide represented by formula (1). The amino
acid residues represented by Y3 can exert the above function
provided that there exist at least 6 such amino acid residues.
[0086] In the functional peptide represented by formula (3), the
amino acid residue represented by Z1 includes Leu in the number of
1-3. In a case of one amino acid, the amino acid residue
represented by Z1 includes Leu. In a case of two amino acids,
Asp-Leu. In a case of three amino acids, Leu-Asp-Leu.
[0087] On the other hand, in the functional peptide represented by
formula (3), the number of amino acid residues represented by Z3
should be 0-10, as in the case of X1 in the functional peptide
represented by formula (1). The specific kind of an amino acid
constituting the amino acid residue represented by Z3 is not
particularly limited. In other words, to a C-terminus of the
functional peptide represented by formula (3), an oligomer made of
any one amino acid or any two-ten amino acid residues may be added,
or no amino acid may be added.
[0088] The amino acid residue represented by Z3 should be as short
as possible in consideration of easiness in synthesizing the
functional peptide represented by formula (3). Specifically, the
number of amino acid residues represented by Z3 is preferably 10 or
less, and more preferably 5 or less. Specific examples of the amino
acid residue represented by Z3 include, but not limited to, Gly,
Gly-Phe-Phe, Gly-Phe-Ala, Gly-Tyr-Tyr, Ala-Ala-Ala.
[0089] The number of amino acid residues in the whole functional
peptide represented by formula (3) is not particularly limited.
However, in consideration of easiness in synthesis, the number is
preferably 20 or less. The most preferable example of the
functional peptide represented by formula (3) is peptide SRDX
(LDLDLELRLGFA: SEQ ID NO: 21).
[0090] In another embodiment, it is preferable that the functional
peptide includes an amino acid sequence represented by [0091] (5)
.alpha.1-Leu-.beta.1-Leu-.gamma.1-Leu where .alpha.1 represents
Asp, Asn, Glu, Gln, Thr, or Ser, .beta.-1 represents Asp, Gln, Asn,
Arg, Glu, Thr, Ser, or His, and .gamma.1 represents Arg, Gln, Asn,
Thr, Ser, His, Lys, or Asp.
[0092] The amino acid sequence represented by formula (5) may be
further classified into the following (6)-(9): [0093] (6)
.alpha.1-Leu-.beta.1-Leu-.gamma.2-Leu; [0094] (7)
.alpha.1-Leu-.beta.1-Leu-Arg-Leu; or [0095] (8)
.alpha.2-Leu-.beta.1-Leu-Arg-Leu [0096] (9)
Asp-Leu-.beta.3-Leu-Arg-Leu where .alpha.1 represents Asp, Asn,
Glu, Gln, Thr, or Ser, .alpha.2 represents Asn, Glu, Gln, Thr, or
Ser, .beta.1 represents Asp, Gln, Asn, Arg, Glu, Thr, Ser, or His,
.beta.2 represents Asn, Arg, Thr, Ser, or His, .beta.3 represents
Glu, Asp, or Gln, and .gamma.2 represents Gln, Asn, Thr, Ser, His,
Lys, or Asp.
[0097] The functional peptide can convert any transcription factor
into a transcription inhibiting factor by fusing with the
transcription factor. Accordingly, by using an expression vector
including a gene encoding a transcription factor etc. capable of
binding to an expression control region of a specific target gene,
it is possible to efficiently analyze the function of a plant gene
in vivo.
[0098] In the present specification, the term "target gene"
indicates any gene which is a target of a transcription factor etc.
to be fused with a functional peptide. By introducing, to a plant,
an expression vector including a chimera gene of a functional
peptide and a transcription factor etc. in accordance with the
present invention, a chimera protein derived from the chimera gene
serves as a transcription inhibiting factor which inhibits
transcription of the target gene in vivo. Consequently, a protein
encoded by the target gene is not expressed.
[0099] As described above, the functional peptide can convert any
transcription factor into a transcription inhibiting factor.
Accordingly, by incorporating a transcription factor etc. which
controls transcription of a specific target gene, it is possible to
inhibit transcription of the target gene. Consequently, if a plant
shows any change, it is possible to analyze the function of the
target gene in consideration of the change.
[0100] The functional peptide can inhibit expression of a target
gene in preference to activity of other transcription factor which
is functionally redundant. Accordingly, if a transcription
inhibition converting polynucleotide is incorporated into a
constructing vector of the present invention, the constructing
vector can be used for analyzing the function of the activity of
the functionally redundant transcription factor.
[0101] For example, as a transcription factor for controlling
formation of an apical bud of seedling, CUC1 protein and CUC2
protein are known. It is known that only when both of CUC1 gene and
CUC2 gene respectively encoding these proteins have mutation, seed
leaves of a plant having the CUC1 and CUC2 genes have a cup shape,
and a meristem of an apical bud is not formed.
[0102] Even when only one of these functionally redundant genes
(e.g. only CUC1 gene) is bound to the functional peptide to make a
chimera gene and the chimera gene is expressed in a plant, an
expressed chimera protein inhibits not only the transcription
activity of the CUC 1 protein but also the transcription activity
of the CUC2 protein.
[0103] It is often that a plant has a plurality of transcription
factors which are functionally redundant. Since a transcription
inhibiting factor obtained by transforming the function of a
transcription factor by the functional peptide is dominant, use of
the present invention enables analysis of the function of a
transcription factor which function has not been clarified by
knocking out one gene. Further, the present invention is applicable
to a plant having an amphidiploid genome, such as wheat.
[0104] A polynucleotide encoding the first polypeptide (herein,
this polynucleotide is also referred to as a first polynucleotide)
is not particularly limited as long as the polynucleotide contains
a base sequence corresponding to an amino acid sequence of the
first polypeptide, based on a genetic code. If necessary, the first
polynucleotide may contain a base sequence serving as a connection
site to be connected with a polynucleotide encoding a functional
peptide (herein, this polynucleotide is also referred to as a
second polynucleotide). Further, if the reading frame of the first
polynucleotide does not correspond to the reading frame of the
second polynucleotide, the first polynucleotide may contain an
additional base sequence used to make these reading frames
correspond to each other. Further, the first polynucleotide may be
fused, at its 5' terminus or 3' terminus, with a polynucleotide
encoding a tag marker (tag sequence or marker sequence).
[0105] Similarly, the second polynucleotide is not particularly
limited as long as the second polynucleotide contains a base
sequence corresponding to an amino acid sequence of the second
polypeptide, based on a genetic code. If necessary, the second
polynucleotide may contain a base sequence serving as a connection
site to be connected with the first polynucleotide. Further, if the
reading frame of the first polynucleotide does not correspond to
the reading frame of the second polynucleotide, the second
polynucleotide may contain an additional base sequence used to make
these reading frames correspond to each other. Further, the second
polynucleotide may be fused, at its 5' terminus or 3' terminus,
with a polynucleotide encoding a tag marker (tag sequence or marker
sequence).
[0106] In the present specification, the "gene encoding a
transcription inhibiting factor which is a fusion protein of a
transcription factor and a functional peptide" should be designed
such that the first polynucleotide and the second polynucleotide
are bound to each other in frame. Accordingly, the "first
polynucleotide" and the "second polynucleotide" may be individually
inserted into an expression vector to be used, or the "first
polynucleotide" and the "second polynucleotide" may be bound to
each other in advance and then simultaneously inserted into the
expression vector. Further, an expression vector to which the
second polynucleotide is inserted may be designed to have a "site
to which the first polynucleotide is to be inserted" and a desired
gene is inserted into the site.
[0107] A person skilled in the art who reads the present
specification easily understands that the method of the present
invention for production of a plant may be a method for imparting a
plant with a stress tolerance. That is, the present invention
provides a method for imparting a plant with a stress tolerance.
The method includes the step of inhibiting the function of a
transcription factor for controlling expression of the useful
trait. In order to inhibit the function of the transcription
factor, expression of the transcription factor may be inhibited in
the plant, or a fusion protein (chimeric repressor) of the
transcription factor and a functional peptide which converts any
transcription factor into a transcription inhibiting factor may be
expressed in the plant. The method for inhibiting expression of a
protein should be a technique well known in the art. Examples
thereof include, but not limited to, a knock-out process and an
RNAi process.
[0108] Further, the present invention provides a kit for production
of a plant with a stress tolerance. The kit of the present
invention includes members necessary for carrying out the above
method for production of a plant. In one embodiment, the kit
includes at least a gene encoding a transcription factor (first
polynucleotide) and a gene encoding a functional peptide (second
polynucleotide). The kit in accordance with the present embodiment
may include a fusion gene obtained by fusing these genes, and
preferably, further include an expression vector for expressing a
target polypeptide in a plant (plant transforming vector). In one
aspect, the kit in accordance with the present embodiment includes
a first polynucleotide including a base sequence represented by any
one of SEQ ID Nos. 1, 3, 5, 7, and 9, and a second polynucleotide
encoding a functional peptide for converting any transcription
factor into a transcription inhibiting factor.
[0109] In another embodiment, the kit of the present invention may
include, instead of the first polynucleotide, an oligonucleotide
set necessary for obtaining the first polynucleotide. In order to
produce a plant with a stress tolerance, the kit in accordance with
the present embodiment includes a first primer pair (SEQ ID Nos. 11
and 12), a second primer pair (SEQ ID Nos. 13 and 14), a third
primer pair (SEQ ID Nos. 15 and 16), a fourth primer pair (SEQ ID
Nos. 17 and 18), or a fifth primer pair (SEQ ID Nos. 19 and 20),
and a second polynucleotide encoding a functional peptide which
converts any transcription factor into a transcription inhibiting
factor. The kit in accordance with the present embodiment may
further include reagents necessary for PCR.
[0110] The "kit" used herein indicates a member in which a
plurality of components are packaged. For example, the kit
indicates a member in which a "gene encoding a transcription
factor", a "gene encoding a functional peptide", and a "plant
transforming vector" in respective vessels are packaged. It is
preferable that the kit of the present invention further includes
reagents for introducing the expression vector into a plant
cell.
[0111] A person skilled in the art who reads the present
specification easily understands that reagents other than the
reagents for the aforementioned polynucleotide or oligonucleotide
may be ones publicly known in the art. Further, a person skilled in
the art who reads the present specification easily understands that
the kit for production of a plant with a stress tolerance may be
used as a kit for imparting a plant with a stress tolerance.
[0112] Further, a person skilled in the art who reads the present
specification easily understands that a plant produced by the
method and the kit for production of a plant with a stress
tolerance and a plant produced by the method and the kit for
imparting a plant with a stress tolerance are also encompassed in
the scope of the present invention.
EXAMPLES
<1. Preparation of DNA Construct>
[0113] Primers for amplifying protein-encoding regions of genes
encoding transcription factors were synthesized (SEQ ID Nos.
11-20). PCR consisting of 25 cycles each having denaturation at
94.degree. C. for 1 min, annealing at 47.degree. C. for 2 min, and
extension at 74.degree. C. for 1 min was carried out. DNA fragments
amplified by the PCR were inserted into SmaI sites of p35SSRDXG.
p35SSRDXG is a vector having two recombinant sites derived from
publicly known .lamda. phage (hereinafter referred to as att site)
and has cauliflower mosaic virus 35S promoter (hereinafter referred
to as CaMV35S promoter), transcription inhibiting peptide SRDX
derived from Arabidopsis thaliana (LDLDLELRLGFA: SEQ ID No. 21),
and a transcription termination region of a gene of a nopaline
synthesizing enzyme (hereinafter referred to as NOS-ter). Using the
construct thus obtained, Escherichia coli was transformed.
Escherichia coli thus transformed was proliferated and then the
construct was prepared from the Escherichia coli and a base
sequence of the construct was determined. A clone to which a gene
encoding a transcription factor was inserted in a forward direction
was isolated, and a DNA construct containing a chimera gene of the
gene encoding a transcription factor and SRDX was obtained.
<2. Introduction of Transforming Vector into
Agrobacterium>
[0114] DNA fragments containing the two att sites, the CaMV35S
promoter, the chimera gene, and the NOS-ter of the DNA construct
were inserted into a plant transforming vector pBIGCKH (see Patent
Literature 7). For this recombination, Gate way.RTM. and LR
clonase.RTM. (Invitrogen) were used.
[0115] To a mixture of 1.5 .mu.l (approximately 300 ng) of the DNA
construct thus obtained and 4.0 .mu.l (approximately 600 ng) of
pBIGCKH, 4.0 .mu.l of LR buffer diluted 5 times and 5.5 .mu.l of TE
buffer solution (10 mM Tris-Cl (pH 7.0), 1 mM EDTA) were added. 4.0
.mu.l of LR clonase was added to the obtained solution, and the
resultant was incubated at 25.degree. C. for 60 min. Subsequently,
2.0 .mu.l of protein kinase K was added, and the resultant was
incubated at 37.degree. C. for 10 min. Escherichia coli (DH5.alpha.
etc.) to which 1-2 .mu.l of the obtained solution was introduced
was cultivated in a culture solution containing kanamycin so as to
select Escherichia coli to which a marker gene was introduced. From
the Escherichia coli, there was prepared a plant transforming
vector, which was obtained by successfully inserting, into pBIGCKH,
DNA fragments of the DNA construct having the two att and a region
between the two att. The vector thus obtained was introduced into
strains of soil bacteria (Agrobacterium tumefaciens Strain GV3101
(C58C1Rifr) pMP90 (Gmr) (koncz and Sahell 1986)).
<3. Transformation of Plant and Collection of T1 seeds>
[0116] Using 1 liter of a YEP culture medium or an LB culture
medium containing an antibiotic (50 .mu.g/ml of kanamycin (Km), 25
.mu.g/ml of gentamicin (GM), and 50 .mu.pg/ml of rifampicin (Rif),
Agrobacterium to which the above vector had been inserted was
cultured. The culture was carried out until OD600 of the culture
solution became 1, and then the bacterial cells were collected from
the culture solution and suspended in 1 liter of a culture medium
for infection (infiltration medium) (see Patent Literature 7).
Arabidopsis thaliana cultured for 14 days or more was immersed in
the bacterial cell suspension for 2 min so that the Arabidopsis
thaliana was infected with the bacterial cells of Agrobacterium to
which the transforming vector had been introduced. The Arabidopsis
thaliana thus transformed was cultured to obtain T1 seeds.
<4. Selection of Transformant and Collection of T2 seeds>
[0117] The T1 seeds were subjected to sterilization for 7 min with
a solution of 25% bleach and 0.02% Triton X-100, and then rinsed
three times with sterilized water, and were sown on a sterilized
hygromycin selection medium (see Patent Literature 7). From rosette
leaves of Arabidopsis thaliana obtained by growing the sown T1
seeds, genome DNA was extracted using Nucleon Phytopure (GE
Healthcare). Specifically, freeze-dried plant tissues were crushed
into powder with dry ice or liquid nitrogen (breaking-down of cell
walls). The crushed tissues were removed to a tube, Reagent I was
added, and the resultant was suspended, and then Reagent II was
added and the resultant was inverted and mixed (lysis of cells).
The tube was shaken at 65.degree. C. for 10 min in a water bath,
and then left on ice for 20 min. The tube was taken from the ice,
chloroform and PhytoPure resin were added, and then the resultant
was shaken at room temperature for 10 min. The tube was subjected
to centrifugation at 1,300.times.g for 10 min, and then the
supernatant was collected (extraction of DNA). To the collected
supernatant was added cold isopropanol in the same amount as that
of the collected supernatant, and the resultant was inverted and
mixed, subjected to centrifugation at 4,000.times.g for 5 min, and
then the supernatant was removed. The precipitate was washed with
cold 70% ethanol, subjected to centrifugation at 4,000.times.g for
5 min, and the supernatant was removed. The precipitate was dried
by wind for 10 min, and a suitable amount of a TE buffer solution
or water was added to obtain a DNA solution. Using a genome DNA as
a template, PCR was carried out with a primer for a DNA sequence of
CaMV35S promoter (GAAGTTCATTTCATTTGGAGAGG: SEQ ID No. 22) and a
primer for NOS-ter (AGACCGGCAACAGGATTCAATC: SEQ ID No. 23). A plant
having the genome DNA amplified by this PCR was selected as a
target transgenic plant. T2 seeds were obtained from the selected
transgenic plant.
<5. Evaluation of Salt Tolerance>
[0118] T2 seeds of the transgenic plant were sown on an MS culture
medium containing 225 mM of NaCl, and the states of seedlings after
3 weeks were evaluated (first selection). It should be noted that
under this condition, all wild-type plants die. In order to confirm
reproducibility, a further verification test was carried out. MS
culture media with four different salt concentrations (Sodium
Chloride; 0-250 mM) were prepared, T2 seeds of the transgenic
plants and seeds of wild-type plants were sown, and comparison in
the state of growth between the T2 seeds and the wild type seeds
was made after approximately one month.
[0119] FIG. 1 shows the states of growth of breeds which could grow
in culture media having a salt concentration (250 mM NaCl) at which
wild type Arabidopsis thaliana cannot grow.
[0120] FIG. 1 shows states of wild type Arabidopsis thaliana and
Arabidopsis thaliana expressing a salt-tolerance chimeric
repressor, which were three weeks after sowing on MS plates with
various salt concentrations. In the drawing, the uppermost row
shows wild type Arabidopsis Thaliana (WT), the second row shows
At4g21440 (MYB102) chimeric repressor (HR0522) plants, the third
row shows At3g04070 (ANAC047) chimeric repressor (CR242) plants,
and the lowermost row shows At1g13300 chimeric repressor (HR0237)
plants. Panels in each row show, from the left, plants growing on
an MS culture medium with a normal composition, an MS culture
medium containing 150 mM of NaCl, an MS culture medium containing
200 mM of NaCl, and an MS culture medium containing 250 mM of NaCl,
respectively.
[0121] The salt concentration used here (250 mM NaCl) was
sufficiently high as a salt concentration at which a salt tolerance
of a plant was evaluated. It is found from the test that under such
a salt concentration, transgenic plants (HR0522, CR242, and HR0237)
containing chimeric repressors derived from the three kinds of
transcription factors (AT4G21440, AT3G04070, and AT1G13300,
respectively) can growth. This shows that the chimeric repressors
derived from the three kinds of transcription factors are effective
in producing plants capable of standing up to salt damage.
<6. Evaluation of High Osmotic Pressure Tolerance>
[0122] T2 seeds were sown on MS culture media containing 600 mM of
mannitol and the states of seedlings after three weeks were
evaluated (first selection). It should be noted that under this
condition, all wild-type plants die. In order to confirm
reproducibility, a further verification test was carried out. MS
culture media with four different mannitol concentrations (500-650
mM) were prepared, T2 seeds of the transgenic plants and seeds of
wild-type plants were sown, and comparison in the state of growth
between the T2 seeds and the wild type seeds was made after
approximately one month.
[0123] FIG. 2 shows the states of growth of breeds which could grow
in culture media having a mannitol concentration (650 mM) at which
wild type Arabidopsis thaliana cannot grow.
[0124] FIG. 2 shows states of wild type Arabidopsis thaliana and
Arabidopsis thaliana expressing an osmotic pressure-tolerance
chimeric repressor, which were three weeks after sowing on MS
plates with various mannitol concentrations. In the drawing, the
uppermost row shows wild type Arabidopsis Thaliana (WT), the second
row shows AT5G04340 (ZAT6) chimeric repressor (HR1169) plants, and
the third row shows AT5G47230 (ATERF5) chimeric repressor (TP124)
plants. Panels in each row show, from the left, plants growing on
an MS culture medium containing 500 mM mannitol, an MS culture
medium containing 550 mM mannitol, an MS culture medium containing
600 mM mannitol, and an MS culture medium containing 650 mM
mannitol, respectively.
[0125] All wild-type plants die in a culture medium containing 600
mM mannitol. However, it was found from the test that even under
such a condition, transgenic plants (HR1169 and TP124) having
chimeric repressors derived from the two kinds of transcription
factors (AT5G04340 and AT5G47230, respectively) can grow. Since the
condition of a high osmotic pressure can be regarded as a stressed
condition due to dryness, the chimeric repressors having the two
kinds of transcription factors are considered as effective in
preventing global warming from having an influence on plants.
[0126] The present invention is not limited to the description of
the embodiments above, but may be altered by a skilled person
within the scope of the claims. An embodiment based on a proper
combination of technical means disclosed in different embodiments
is encompassed in the technical scope of the present invention.
[0127] All the academic literatures and patent literatures cited in
the specification are incorporated herein for reference.
INDUSTRIAL APPLICABILITY
[0128] The present invention enables producing plants with a stress
tolerance such as a salt tolerance and a high osmotic pressure
tolerance. Accordingly, the present invention can greatly
contribute to the increase in food production. Further, the present
invention is effective in producing plants capable of standing up
to salt damage and in preventing global warming from having an
influence on plants.
Sequence Listing
[0129] 2009001599_seq.txt
Sequence CWU 1
1
2311053DNAArabidopsis thaliana 1atggcaaggt caccttgttg cgagaagaac
ggactcaaga aagggccttg gacatctgaa 60gaagaccaga agcttgttga ctatatccag
aaacatggtt atggtaactg gagaaccctc 120cccaaaaatg ccggtttgca
aagatgtggc aaaagttgta ggttaaggtg gactaattat 180ctccgaccag
atataaagcg aggaaggttc tcttttgagg aagaagaaac cattattcag
240cttcatagct tcttaggaaa caagtggtct gcgattgcgg cgcgtttacc
aggaagaaca 300gataatgaga tcaagaactt ttggaacact catataagaa
agaagctact tagaatgggg 360attgatccag tgactcacag tccacgactc
gatctcctcg atatctcatc catcttagct 420tcatctctat acaattcatc
ttcacatcac atgaacatgt caagactcat gatggatact 480aatcgtcgtc
atcaccagca acatccattg gttaaccccg agatactcaa gctcgctacc
540tctctcttct ctcaaaatca aaaccaaaac cttgtggtgg atcatgactc
gagaactcaa 600gagaagcaaa cagtttatag ccaaaccgga gtaaaccaat
accaaaccaa ccaatatttc 660gagaacacga ttactcaaga actccaatct
tccatgccac cattccccaa tgaagctcgt 720cagtttaaca acatggatca
tcacttcaat ggttttggag aacaaaatct tgtttcaact 780tctactacgt
cagtccaaga ttgctataat ccgtcattca acgattattc aagttcaaat
840tttgtcttgg atccttctta ttcggatcag agcttcaact tcgcaaattc
ggtcttaaac 900acgccatcct cgagcccgag cccgactacg ttaaactcga
gttacatcaa tagtagcagt 960tgcagcactg aggatgaaat agaaagctat
tgcagtaatc tcatgaagtt tgatattccc 1020gatttcttgg acgttaatgg
ttttattata taa 10532350PRTArabidopsis thaliana 2Met Ala Arg Ser Pro
Cys Cys Glu Lys Asn Gly Leu Lys Lys Gly Pro1 5 10 15Trp Thr Ser Glu
Glu Asp Gln Lys Leu Val Asp Tyr Ile Gln Lys His 20 25 30Gly Tyr Gly
Asn Trp Arg Thr Leu Pro Lys Asn Ala Gly Leu Gln Arg 35 40 45Cys Gly
Lys Ser Cys Arg Leu Arg Trp Thr Asn Tyr Leu Arg Pro Asp 50 55 60Ile
Lys Arg Gly Arg Phe Ser Phe Glu Glu Glu Glu Thr Ile Ile Gln65 70 75
80Leu His Ser Phe Leu Gly Asn Lys Trp Ser Ala Ile Ala Ala Arg Leu
85 90 95Pro Gly Arg Thr Asp Asn Glu Ile Lys Asn Phe Trp Asn Thr His
Ile 100 105 110Arg Lys Lys Leu Leu Arg Met Gly Ile Asp Pro Val Thr
His Ser Pro 115 120 125Arg Leu Asp Leu Leu Asp Ile Ser Ser Ile Leu
Ala Ser Ser Leu Tyr 130 135 140Asn Ser Ser Ser His His Met Asn Met
Ser Arg Leu Met Met Asp Thr145 150 155 160Asn Arg Arg His His Gln
Gln His Pro Leu Val Asn Pro Glu Ile Leu 165 170 175Lys Leu Ala Thr
Ser Leu Phe Ser Gln Asn Gln Asn Gln Asn Leu Val 180 185 190Val Asp
His Asp Ser Arg Thr Gln Glu Lys Gln Thr Val Tyr Ser Gln 195 200
205Thr Gly Val Asn Gln Tyr Gln Thr Asn Gln Tyr Phe Glu Asn Thr Ile
210 215 220Thr Gln Glu Leu Gln Ser Ser Met Pro Pro Phe Pro Asn Glu
Ala Arg225 230 235 240Gln Phe Asn Asn Met Asp His His Phe Asn Gly
Phe Gly Glu Gln Asn 245 250 255Leu Val Ser Thr Ser Thr Thr Ser Val
Gln Asp Cys Tyr Asn Pro Ser 260 265 270Phe Asn Asp Tyr Ser Ser Ser
Asn Phe Val Leu Asp Pro Ser Tyr Ser 275 280 285Asp Gln Ser Phe Asn
Phe Ala Asn Ser Val Leu Asn Thr Pro Ser Ser 290 295 300Ser Pro Ser
Pro Thr Thr Leu Asn Ser Ser Tyr Ile Asn Ser Ser Ser305 310 315
320Cys Ser Thr Glu Asp Glu Ile Glu Ser Tyr Cys Ser Asn Leu Met Lys
325 330 335Phe Asp Ile Pro Asp Phe Leu Asp Val Asn Gly Phe Ile Ile
340 345 35031080DNAArabidopsis thaliana 3atgataagca aggatccaag
atcgagttta cctccagggt ttcgatttca tccaacagat 60gaagaactca ttctccatta
cctaaggaag aaagtttcct cttccccagt cccgctttcg 120attatcgccg
atgtcgatat ctacaaatcc gatccatggg atttaccagc taaggctcca
180tttggggaga aagagtggta ttttttcagt ccgagggata ggaaatatcc
aaacggagca 240agaccaaaca gagcagctgc gtctggatat tggaaagcaa
ccggaacaga taaattgatt 300gcggtaccaa atggtgaagg gtttcatgaa
aacattggta taaaaaaagc tcttgtgttt 360tatagaggaa agcctccaaa
aggtgttaaa accaattgga tcatgcatga atatcgtctt 420gccgattcat
tatctcccaa aagaattaac tcttctagga gcggtggtag cgaagttaat
480aataattttg gagataggaa ttctaaagaa tattcgatga gactggatga
ttgggttctt 540tgccggattt acaagaaatc acacgcttca ttgtcatcac
ctgatgttgc tttggtcaca 600agcaatcaag agcatgagga aaatgacaac
gaaccattcg tagaccgcgg aacctttttg 660ccaaatttgc aaaatgatca
accccttaaa cgccagaagt cttcttgttc gttctcaaac 720ttactagacg
ctacagattt gacgtttctc gcaaattttc taaacgaaac cccggaaaat
780cgttctgaat cagatttttc tttcatgatt ggcaatttct ctaatcctga
catttacgga 840aaccattact tggatcagaa gttaccgcag ttgagctctc
ccacttcaga gacaagcggc 900atcggaagca aaagagagag agtggatttt
gcggaagaaa cgataaacgc ttcgaagaag 960atgatgaaca catatagtta
caataatagt atagatcaaa tggatcatag tatgatgcaa 1020caacctagtt
tcctgaacca ggaactcatg atgagttctc accttcaata tcaaggctag
10804359PRTArabidopsis thaliana 4Met Ile Ser Lys Asp Pro Arg Ser
Ser Leu Pro Pro Gly Phe Arg Phe1 5 10 15His Pro Thr Asp Glu Glu Leu
Ile Leu His Tyr Leu Arg Lys Lys Val 20 25 30Ser Ser Ser Pro Val Pro
Leu Ser Ile Ile Ala Asp Val Asp Ile Tyr 35 40 45Lys Ser Asp Pro Trp
Asp Leu Pro Ala Lys Ala Pro Phe Gly Glu Lys 50 55 60Glu Trp Tyr Phe
Phe Ser Pro Arg Asp Arg Lys Tyr Pro Asn Gly Ala65 70 75 80Arg Pro
Asn Arg Ala Ala Ala Ser Gly Tyr Trp Lys Ala Thr Gly Thr 85 90 95Asp
Lys Leu Ile Ala Val Pro Asn Gly Glu Gly Phe His Glu Asn Ile 100 105
110Gly Ile Lys Lys Ala Leu Val Phe Tyr Arg Gly Lys Pro Pro Lys Gly
115 120 125Val Lys Thr Asn Trp Ile Met His Glu Tyr Arg Leu Ala Asp
Ser Leu 130 135 140Ser Pro Lys Arg Ile Asn Ser Ser Arg Ser Gly Gly
Ser Glu Val Asn145 150 155 160Asn Asn Phe Gly Asp Arg Asn Ser Lys
Glu Tyr Ser Met Arg Leu Asp 165 170 175Asp Trp Val Leu Cys Arg Ile
Tyr Lys Lys Ser His Ala Ser Leu Ser 180 185 190Ser Pro Asp Val Ala
Leu Val Thr Ser Asn Gln Glu His Glu Glu Asn 195 200 205Asp Asn Glu
Pro Phe Val Asp Arg Gly Thr Phe Leu Pro Asn Leu Gln 210 215 220Asn
Asp Gln Pro Leu Lys Arg Gln Lys Ser Ser Cys Ser Phe Ser Asn225 230
235 240Leu Leu Asp Ala Thr Asp Leu Thr Phe Leu Ala Asn Phe Leu Asn
Glu 245 250 255Thr Pro Glu Asn Arg Ser Glu Ser Asp Phe Ser Phe Met
Ile Gly Asn 260 265 270Phe Ser Asn Pro Asp Ile Tyr Gly Asn His Tyr
Leu Asp Gln Lys Leu 275 280 285Pro Gln Leu Ser Ser Pro Thr Ser Glu
Thr Ser Gly Ile Gly Ser Lys 290 295 300Arg Glu Arg Val Asp Phe Ala
Glu Glu Thr Ile Asn Ala Ser Lys Lys305 310 315 320Met Met Asn Thr
Tyr Ser Tyr Asn Asn Ser Ile Asp Gln Met Asp His 325 330 335Ser Met
Met Gln Gln Pro Ser Phe Leu Asn Gln Glu Leu Met Met Ser 340 345
350Ser His Leu Gln Tyr Gln Gly 35551035DNAArabidopsis thaliana
5atgattaaaa agttcagcaa tatggattac aaccagaaac gagagagatg tgggcaatac
60atcgaagccc tcgaagagga acgtcgcaag attcatgtat ttcaacgtga acttcctctt
120tgcttagacc ttgtaactca agcgatcgag gcatgtaaga gggagttacc
ggagatgacg 180acggagaata tgtacggaca accagagtgc tcggagcaga
cgaccggaga atgtgggccg 240gtcttggagc agtttctaac tattaaagat
tcatcgacat ccaacgaaga agaagatgaa 300gaattcgacg atgagcatgg
aaatcacgat ccagacaatg attccgagga caagaacacg 360aaatctgatt
ggcttaagtc tgttcaactc tggaatcaac ccgaccaccc acttcttcca
420aaagaggaaa ggttgcagca ggagacgatg acaagagatg agagtatgag
aaaagatccg 480atggtgaacg gtggcgaagg gaggaagaga gaggcggaga
aagacggagg aggagggaga 540aagcaaagaa ggtgttggtc gtcgcaattg
catagacgct tcttgaacgc tcttcaacac 600ttaggtggac ctcatgtagc
tacgccaaag caaatcaggg agtttatgaa ggttgatggg 660ttaaccaatg
atgaagttaa aagccattta cagaaatata gactgcatac aagaaggcca
720cgccaaacag tccctaacaa cggaaactct caaacgcaac atttcgtagt
cgtcggtggt 780ttatgggtac cacaatcgga ctactctacg ggcaagacta
ccggaggagc caccaccagc 840agtaccacca caaccaccgg catctatgga
accatggccg caccgccacc tccacaatgg 900cctagccatt ccaattatag
accgtcgatt attgtggacg aaggatcggg aagtcatagt 960gaaggggtcg
tggtccggtg tagctcgccg gcgatgtctt cttctacccg taatcattac
1020gtcaagaata attaa 10356344PRTArabidopsis thaliana 6Met Ile Lys
Lys Phe Ser Asn Met Asp Tyr Asn Gln Lys Arg Glu Arg1 5 10 15Cys Gly
Gln Tyr Ile Glu Ala Leu Glu Glu Glu Arg Arg Lys Ile His 20 25 30Val
Phe Gln Arg Glu Leu Pro Leu Cys Leu Asp Leu Val Thr Gln Ala 35 40
45Ile Glu Ala Cys Lys Arg Glu Leu Pro Glu Met Thr Thr Glu Asn Met
50 55 60Tyr Gly Gln Pro Glu Cys Ser Glu Gln Thr Thr Gly Glu Cys Gly
Pro65 70 75 80Val Leu Glu Gln Phe Leu Thr Ile Lys Asp Ser Ser Thr
Ser Asn Glu 85 90 95Glu Glu Asp Glu Glu Phe Asp Asp Glu His Gly Asn
His Asp Pro Asp 100 105 110Asn Asp Ser Glu Asp Lys Asn Thr Lys Ser
Asp Trp Leu Lys Ser Val 115 120 125Gln Leu Trp Asn Gln Pro Asp His
Pro Leu Leu Pro Lys Glu Glu Arg 130 135 140Leu Gln Gln Glu Thr Met
Thr Arg Asp Glu Ser Met Arg Lys Asp Pro145 150 155 160Met Val Asn
Gly Gly Glu Gly Arg Lys Arg Glu Ala Glu Lys Asp Gly 165 170 175Gly
Gly Gly Arg Lys Gln Arg Arg Cys Trp Ser Ser Gln Leu His Arg 180 185
190Arg Phe Leu Asn Ala Leu Gln His Leu Gly Gly Pro His Val Ala Thr
195 200 205Pro Lys Gln Ile Arg Glu Phe Met Lys Val Asp Gly Leu Thr
Asn Asp 210 215 220Glu Val Lys Ser His Leu Gln Lys Tyr Arg Leu His
Thr Arg Arg Pro225 230 235 240Arg Gln Thr Val Pro Asn Asn Gly Asn
Ser Gln Thr Gln His Phe Val 245 250 255Val Val Gly Gly Leu Trp Val
Pro Gln Ser Asp Tyr Ser Thr Gly Lys 260 265 270Thr Thr Gly Gly Ala
Thr Thr Ser Ser Thr Thr Thr Thr Thr Gly Ile 275 280 285Tyr Gly Thr
Met Ala Ala Pro Pro Pro Pro Gln Trp Pro Ser His Ser 290 295 300Asn
Tyr Arg Pro Ser Ile Ile Val Asp Glu Gly Ser Gly Ser His Ser305 310
315 320Glu Gly Val Val Val Arg Cys Ser Ser Pro Ala Met Ser Ser Ser
Thr 325 330 335Arg Asn His Tyr Val Lys Asn Asn
3407717DNAArabidopsis thaliana 7atggcacttg aaactcttac ttctccaaga
ttatcttctc cgatgccgac tctgtttcaa 60gattcagcac tagggtttca tggaagcaaa
ggcaaacgat ctaagcgatc aagatctgaa 120ttcgaccgtc agagtctcac
ggaggatgaa tatatcgctt tatgtctcat gcttcttgct 180cgcgacggag
atagaaaccg tgaccttgac ctgccttctt cttcgtcttc acctcctctg
240cttcctcctc ttcctactcc gatctacaag tgtagcgtct gtgacaaggc
gttttcgtct 300taccaggctc ttggtggaca caaggcaagt caccggaaaa
gcttttcgct tactcaatct 360gccggaggag atgagctgtc gacatcgtcg
gcgataacca cgtctggtat atccggtggc 420gggggaggaa gtgtgaagtc
gcacgtttgc tctatctgtc ataaatcgtt cgccaccggt 480caagctctcg
gcggccacaa acggtgccac tacgaaggaa agaacggagg cggtgtgagt
540agtagcgtgt cgaattctga agatgtgggg tctacaagcc acgtcagcag
tggccaccgt 600gggtttgacc tcaacatacc gccgataccg gaattctcga
tggtcaacgg agacgaagag 660gtgatgagtc ctatgccggc gaagaaactc
cggtttgact tcccggagaa accctaa 7178238PRTArabidopsis thaliana 8Met
Ala Leu Glu Thr Leu Thr Ser Pro Arg Leu Ser Ser Pro Met Pro1 5 10
15Thr Leu Phe Gln Asp Ser Ala Leu Gly Phe His Gly Ser Lys Gly Lys
20 25 30Arg Ser Lys Arg Ser Arg Ser Glu Phe Asp Arg Gln Ser Leu Thr
Glu 35 40 45Asp Glu Tyr Ile Ala Leu Cys Leu Met Leu Leu Ala Arg Asp
Gly Asp 50 55 60Arg Asn Arg Asp Leu Asp Leu Pro Ser Ser Ser Ser Ser
Pro Pro Leu65 70 75 80Leu Pro Pro Leu Pro Thr Pro Ile Tyr Lys Cys
Ser Val Cys Asp Lys 85 90 95Ala Phe Ser Ser Tyr Gln Ala Leu Gly Gly
His Lys Ala Ser His Arg 100 105 110Lys Ser Phe Ser Leu Thr Gln Ser
Ala Gly Gly Asp Glu Leu Ser Thr 115 120 125Ser Ser Ala Ile Thr Thr
Ser Gly Ile Ser Gly Gly Gly Gly Gly Ser 130 135 140Val Lys Ser His
Val Cys Ser Ile Cys His Lys Ser Phe Ala Thr Gly145 150 155 160Gln
Ala Leu Gly Gly His Lys Arg Cys His Tyr Glu Gly Lys Asn Gly 165 170
175Gly Gly Val Ser Ser Ser Val Ser Asn Ser Glu Asp Val Gly Ser Thr
180 185 190Ser His Val Ser Ser Gly His Arg Gly Phe Asp Leu Asn Ile
Pro Pro 195 200 205Ile Pro Glu Phe Ser Met Val Asn Gly Asp Glu Glu
Val Met Ser Pro 210 215 220Met Pro Ala Lys Lys Leu Arg Phe Asp Phe
Pro Glu Lys Pro225 230 2359903DNAArabidopsis thaliana 9atggcgactc
ctaacgaagt atctgcactt tggttcatcg agaaacatct actcgacgag 60gcttctcctg
tggctacaga tccatggatg aagcacgaat catcatcagc aacagaatct
120agctctgact cttcttctat catcttcgga tcatcgtcct cttctttcgc
cccaattgat 180ttctctgaat ccgtatgcaa acctgaaatc atcgatctcg
atactcccag atctatggaa 240tttctatcga ttccatttga atttgactca
gaagtttctg tttctgattt cgattttaaa 300ccttctaatc aaaatcaaaa
tcagtttgaa ccggagctta aatctcaaat tcgtaaaccg 360ccattgaaga
tttcgcttcc agctaaaaca gagtggattc aattcgcagc tgaaaacacc
420aaaccggaag ttactaaacc ggtttcggaa gaagagaaga agcattacag
aggagtaaga 480caaagaccgt gggggaaatt cgcggcggag attcgtgacc
cgaataaacg cggatctcgc 540gtttggcttg ggacgtttga tacagcgatt
gaagcggcta gagcttatga cgaagcagcg 600tttagactac gaggatcgaa
agcgattttg aatttccctc ttgaagttgg gaagtggaaa 660ccacgcgccg
atgaaggtga gaagaaacgg aagagagacg atgatgagaa agtgactgtg
720gttgagaaag tgttgaagac ggaacagagc gttgacgtta acggtggaga
gacgtttccg 780tttgtaacgt cgaatttaac ggaattatgt gactgggatt
taacggggtt tcttaacttt 840ccgcttctgt cgccgttatc tcctcatcca
ccgtttggtt attcccagtt gaccgttgtt 900tga 90310300PRTArabidopsis
thaliana 10Met Ala Thr Pro Asn Glu Val Ser Ala Leu Trp Phe Ile Glu
Lys His1 5 10 15Leu Leu Asp Glu Ala Ser Pro Val Ala Thr Asp Pro Trp
Met Lys His 20 25 30Glu Ser Ser Ser Ala Thr Glu Ser Ser Ser Asp Ser
Ser Ser Ile Ile 35 40 45Phe Gly Ser Ser Ser Ser Ser Phe Ala Pro Ile
Asp Phe Ser Glu Ser 50 55 60Val Cys Lys Pro Glu Ile Ile Asp Leu Asp
Thr Pro Arg Ser Met Glu65 70 75 80Phe Leu Ser Ile Pro Phe Glu Phe
Asp Ser Glu Val Ser Val Ser Asp 85 90 95Phe Asp Phe Lys Pro Ser Asn
Gln Asn Gln Asn Gln Phe Glu Pro Glu 100 105 110Leu Lys Ser Gln Ile
Arg Lys Pro Pro Leu Lys Ile Ser Leu Pro Ala 115 120 125Lys Thr Glu
Trp Ile Gln Phe Ala Ala Glu Asn Thr Lys Pro Glu Val 130 135 140Thr
Lys Pro Val Ser Glu Glu Glu Lys Lys His Tyr Arg Gly Val Arg145 150
155 160Gln Arg Pro Trp Gly Lys Phe Ala Ala Glu Ile Arg Asp Pro Asn
Lys 165 170 175Arg Gly Ser Arg Val Trp Leu Gly Thr Phe Asp Thr Ala
Ile Glu Ala 180 185 190Ala Arg Ala Tyr Asp Glu Ala Ala Phe Arg Leu
Arg Gly Ser Lys Ala 195 200 205Ile Leu Asn Phe Pro Leu Glu Val Gly
Lys Trp Lys Pro Arg Ala Asp 210 215 220Glu Gly Glu Lys Lys Arg Lys
Arg Asp Asp Asp Glu Lys Val Thr Val225 230 235 240Val Glu Lys Val
Leu Lys Thr Glu Gln Ser Val Asp Val Asn Gly Gly 245 250 255Glu Thr
Phe Pro Phe Val Thr Ser Asn Leu Thr Glu Leu Cys Asp Trp 260 265
270Asp Leu Thr Gly Phe Leu Asn Phe Pro Leu Leu Ser Pro Leu Ser Pro
275 280 285His Pro Pro Phe Gly Tyr Ser Gln Leu Thr Val Val 290 295
3001130DNAArtificial SequenceSynthetic 11gatggcaagg tcaccttgtt
gcgagaagaa 301230DNAArtificial SequenceSynthetic 12tataataaaa
ccattaacgt ccaagaaatc
301330DNAArtificial SequenceSynthetic 13gatgataagc aaggatccaa
gatcgagttt 301430DNAArtificial SequenceSynthetic 14gccttgatat
tgaaggtgag aactcatcat 301530DNAArtificial SequenceSynthetic
15gatgattaaa aagttcagca atatggatta 301630DNAArtificial
SequenceSynthetic 16attattcttg acgtaatgat tacgggtaga
301730DNAArtificial SequenceSynthetic 17gatggcactt gaaactctta
cttctccaag 301830DNAArtificial SequenceSynthetic 18gggtttctcc
gggaagtcaa accggagttt 301930DNAArtificial SequenceSynthetic
19gatggcgact cctaacgaag tatctgcact 302032DNAArtificial
SequenceSynthetic 20aacaacggtc aactgggaat aaccaaacgg tg
322112PRTArabidopsis thaliana 21Leu Asp Leu Asp Leu Glu Leu Arg Leu
Gly Phe Ala1 5 102223DNAArtificial SequenceSynthetic 22gaagttcatt
tcatttggag agg 232322DNAArtificial SequenceSynthetic 23agaccggcaa
caggattcaa tc 22
* * * * *