U.S. patent application number 13/095273 was filed with the patent office on 2011-08-25 for glutamic acid decarboxylase (gad) based delivery system.
This patent application is currently assigned to NEUROLOGIX, INC.. Invention is credited to Matthew During, Michael Kaplitt.
Application Number | 20110207802 13/095273 |
Document ID | / |
Family ID | 46150398 |
Filed Date | 2011-08-25 |
United States Patent
Application |
20110207802 |
Kind Code |
A1 |
During; Matthew ; et
al. |
August 25, 2011 |
GLUTAMIC ACID DECARBOXYLASE (GAD) BASED DELIVERY SYSTEM
Abstract
The invention provide methods and compositions for localized
delivery of a vector comprising a therapeutic agent to a specific
region of the brain that is overstimulated in neurodegenerative
diseases. In particular, the invention provides methods and
compositions used to deliver an adeno-associated virus vector (AAV)
comprising a nucleotide sequence encoding glutamic acid
decarboxylase (GAD) to cells in the hippocampus, subthalamic
nucleus of the basal ganglia, mesaphilia and thalamus.
Inventors: |
During; Matthew; (Columbus,
OH) ; Kaplitt; Michael; (New York, NY) |
Assignee: |
NEUROLOGIX, INC.
Fort Lee
NJ
|
Family ID: |
46150398 |
Appl. No.: |
13/095273 |
Filed: |
April 27, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12685385 |
Jan 11, 2010 |
7955595 |
|
|
13095273 |
|
|
|
|
10802497 |
Mar 16, 2004 |
7695959 |
|
|
12685385 |
|
|
|
|
09863179 |
May 23, 2001 |
6780409 |
|
|
10802497 |
|
|
|
|
60206281 |
May 23, 2000 |
|
|
|
Current U.S.
Class: |
514/44R |
Current CPC
Class: |
A61P 25/28 20180101;
C12N 15/86 20130101; A61K 48/00 20130101; A61K 38/51 20130101; A61P
25/08 20180101; C12N 2750/14143 20130101 |
Class at
Publication: |
514/44.R |
International
Class: |
A61K 31/7088 20060101
A61K031/7088; A61P 25/28 20060101 A61P025/28 |
Claims
1. A method of ameliorating a symptom of a neurodegenerative
disorder by altering expression of glutamic acid decarboxylase 67
(GAD.sub.67) in a region of the brain of a subject having a
neurodegenerative disorder comprising; identifying a target site in
the brain that requires modification; delivering an
adeno-associated viral (AAV) vector comprising a nucleotide
sequence encoding glutamic acid decarboxylase 67 (GAD.sub.67)
directly to the target site in the brain; and expressing GAD.sub.67
in the target site, thereby ameliorating at least one symptom of
the neurodegenerative disorder.
2. The method of claim 1, wherein the AAV vector is delivered using
stereotaxic delivery.
3. The method of claim 1, wherein the region of the brain is
selected from the group consisting of basal ganglia, subthalamic
nucleus (STN), pedunculopontine nucleus (PPN), substantia nigra
(SN), thalamus, hippocampus, cortex, and combinations thereof.
4. The method of claim 1, wherein the region of brain is the
subthalamic nucleus (STN).
5. The method of claim 1, wherein the neurodegenerative disorder is
Parkinson's disease.
6. A method of ameliorating a symptom of a neurodegenerative
disorder by altering expression of glutamic acid decarboxylase 67
(GAD.sub.67) in a region of the brain of a subject having a
neurodegenerative disorder which causes morphological and/or
functional abnormality of a neural cell or population of neural
cells comprising: identifying a target site in the brain that
requires modification; delivering an AAV vector comprising a
nucleotide sequence encoding glutamic acid decarboxylase 67
(GAD.sub.67) directly to the target site in the brain; and
expressing GAD.sub.67 in the target site, thereby ameliorating at
least one symptom of the neurodegenerative disorder.
7. The method of claim 6, wherein the AAV vector is delivered using
stereotaxic delivery.
8. The method of claim 6, wherein the region of the brain is
selected from the group consisting of basal ganglia, subthalamic
nucleus (STN), pedunculopontine nucleus (PPN), substantia nigra
(SN), thalamus, hippocampus, cortex, and combinations thereof.
Description
[0001] This application claims priority to U.S. Provisional Patent
Application Ser. No. 60/206,281, filed May 23, 2000, U.S. patent
application Ser. No. 09/863,179, filed May 23, 2001, U.S. patent
application Ser. No. 10/802,497, filed on Mar. 16, 2004, and U.S.
patent application Ser. No. 12/685,385, filed on Jan. 11, 2010, all
of which are expressly incorporated by reference.
BACKGROUND OF THE INVENTION
[0002] The invention is generally in the field of methods and
compositions for treating neurodegenerative diseases such as
Parkinson's disease, alzheimer's disease, epilepsy, and the like,
using viral and non-viral delivery systems that deliver therapeutic
agents to specific regions of the brain. More specifically, using
an adeno-associated viral vector to deliver a nucleotide sequence
encoding glutamic acid decarboxylase (GAD) to specific regions of
the brain that are overstimulated or disinhibited in
neurodegenerative diseases.
[0003] The major inhibitory neurotransmitter in the brain is
gamma-aminobutyric acid (GABA), (Roberts et al, GABA in Nervous
System Function, Raven Press: New York, 1976; McGeer E G, et al,
Glutamine, Glutamate, and GABA in the Central Nervous System; Hertz
L, Kvamme E, McGeer E G, Schousbal A, eds., Liss: New York, 1983;
3-17). Loss of GABA signaling, by a reduction in release, loss of
neurons which synthesize GABA, or antagonism of GABA receptors
leads to disinhibition, overexcitation and depending on the
specific brain region involved, may result in epilepsy, movement
disorders or other neurological deficits and symptoms.
[0004] Diseases such as Parkinson's disease, Huntington's disease,
Amyotrophic Lateral Sclerosis (ALS or Lou Gehrig's Disease),
Epilepsy and Alzheimer's disease, have proved difficult to treat.
Few, if any therapies, have proved effective in slowing or
arresting the degenerative process associated with these
diseases.
[0005] In Parkinson's Disease (PD), the primary neurochemical
disturbance is believed to be the loss of substantia nigra (SN)
dopaminergic (DA) neurons. This loss of DA neurons leads to a
profound deficit of DA in the projection areas of the caudate and
putamen and results in a loss of signaling through dopamine
receptors in the postsynaptic neurons. These neurons, via efferents
referred to as the direct and indirect pathways, synapse on other
cells in the basal ganglia circuitry. Of most relevance to PD, the
loss of dopamine receptors in the basal ganglia circuitry leads to
loss of drive in the GABAergic inhibitory input to the subthalamic
nucleus.
[0006] The loss of inhibitory GABAergic drive to the subthalamic
nucleus (STN) results in increased activity of the STN which sends
excitatory (glutamatergic) afferents to the ventrial media (VM)
thalamus, the substantia nigra pars reticulata (SNPR) and a lesser
projection to the pars compacta, as well as other cells within the
basal ganglia including the globus pallidus. When the concentration
of GABA diminishes below a threshold level in the brain, movement
disorders and convulsions may result (See e.g., Karlsson et al,
(1974) Biochem. Pharmacol 23:3053-3061). GABA synthesis is
regulated by glutamic acid decarboxylase (GAD). GAD is present in
the brain as two isoforms, GAD-65 and GAD-67. When the GABA levels
rise in the brain the convulsions terminate (See e.g., Hayashi
(1959) Physiol. 145:570-578). In convulsive disorders, the
reduction in brain GABA levels is often paralleled by a diminished
level of GAD (McGeer, et al. GABA in Nervous System Function;
Roberts E, Chase T N, Tower D B, eds., Raven Press: New York
1976:487-495; Butterworth et al. (1983) Neurochem. 41:440-447;
Spokes et al. (1978) Adv. Exp. Med. Biol. 123:461-473).
[0007] Levodopa (L-dopa) has historically been the medication of
choice to treat Parkinson's disease. L-dopa is a precursor to
dopamine and is able to cross the blood-brain barrier to target the
brain. Unfortunately, the response with L-dopa is not sustainable.
Most patients develop adverse effects after long-term usage of
L-dopa, and often the benefits of treatment wane as the disease
progresses.
[0008] Other methods for treating Parkinson's disease include
transplantation of cells used to repair regions of the brain
damaged by neurodegeneration. These cells can be engineered to
secrete neuroactive substances such as L-dopa. The procedure
typically involves cell transplantation into the stratium. However,
cell transplantation is a complicated procedure which requires
donor tissue, and there have been reports of mortality associated
with this procedure.
[0009] Alternative forms of treating Parkinson's disease involve
implanting devices for deep-brain stimulation (DBS) in specific
regions of the brain. For example, DBS of the STN. These devices
are typically electrodes implanted into the STN. The electrode is
then stimulated at a desired frequency to reduce the effect of
Parkinson's disease. The significance of the STN overactivity is
reflected in the success of ablative surgery of the STN in both
animal models of Parkinson's disease, as well as in human
Parkinson's disease itself. In addition to ablation, implantation
of nedtronic stimulators are commonly employed. The mechanism of
the stimulators is believed to be mediated by local inhibition (via
GABA signaling), and is replicated by the local infusion of GABA
agonists.
[0010] Like Parkinson's disease, methods for treating epilepsy
include the use of anti-epileptic drugs, such as sodium valporate
(Epilim). Available drugs reduce seizure frequency in the majority
of patients, but it is estimated that only about forty percent are
free of seizures despite optimal treatment. Other forms of
treatment include DBS of certain regions of the brain, such as the
VIM (ventral intermediate thalamus), subthalamic nucleus, and
internal globus pallidus. However, the DBS procedure is not always
effective in many patients who require repeated treatment.
[0011] Each of these approaches, surgical ablation, electrical
stimulation and infusion of pharmacological GABA agonists is
effective in disease palliation, but each has significant adverse
effects. For example, extensive invasive surgery, a high risk of
infection and potential damage to the brain and in the case of drug
infusion, very transient efficiency.
[0012] Thus, the treatments for neurodegenerative disorders are
palliative at best, with limited and transient efficacy. Therefore,
a need exists for a therapeutic approach which has advantages in
targeting specificity, both short and long-term efficacy, as well
as neuroprotection, without extensive surgery or side-effects.
SUMMARY OF THE INVENTION
[0013] The invention is based, at least in part, on the discovery
that localized delivery of a vector comprising a therapeutic agent
to a specific region of the brain that is overstimulated or
disinhibited in neurodegenerative diseases, can reduce the effect
of overstimulation and promote the improvement of the
neurodegenerative disease. In particular, the invention pertains to
methods and compositions used to deliver a vector, (e.g., an
adeno-associated virus vector (AAV)) comprising a nucleotide
sequence encoding glutamic acid decarboxylase (GAD) to target
relevant cells, such as the hippocampus or the subthalamic nucleus
of the basal ganglia.
[0014] Particularly preferred methods of delivering the vector to
specific regions of the brain are those techniques that are simple,
safe, and have a lower risk associated with them than lesioning,
electrode implantation or cell transplantation. For example,
delivery of the vector using stereotactic microinjection
techniques, or delivery of the vector using specialized probes, or
percutaneous delivery via disruption of the blood-brain barrier.
Delivery of the vector using the method of the invention results in
minimal immunological or inflammatory responses within the regions
of the brain, thus eliminating the need for immunosuppression.
After delivery of the vector to a specific region of the brain,
regional dispersion and/or diffusion of vector occurs ensuring
local distribution of gene and stable gene expression.
[0015] The methods and compositions are particularly useful for
treating neurodegenerative diseases, such as Parkinson's disease,
Huntington's disease, Amyotrophic Lateral Sclerosis (ALS or Lou
Gehrig's Disease), Alzheimer's Disease as well as epilepsy.
[0016] Accordingly, the invention is directed to a method for
treating a neurodegenerative disease in a subject identifying a
target site in the central nervous system that requires
modification. A vector comprising a nucleotide sequence encoding a
glutamic acid decarboxylase (GAD) is then delivered to the target
site in the central nervous system. GAD is expressed in the target
site to treat or reduce the neurodegenerative disease.
[0017] In one embodiment, the vector is a viral vector, and is
selected from the group consisting of adenovirus vectors, herpes
virus vectors, parvovirus vectors, and lentivirus vectors. In a
preferred embodiment, the viral vector is an adeno-associated viral
vector.
[0018] In another embodiment, the vector is a non-viral vector. In
a preferred embodiment, the non-viral vector is a liposome-mediated
delivery vector.
[0019] In one embodiment, the vector is delivered to a specific
target site of the central nervous system. In a preferred
embodiment, the vector is delivered using stereotaxic delivery, or
delivery using specialized probes. In a preferred embodiment, the
target site of the central nervous system is a region of the brain.
In another preferred embodiment, the region of the brain is
selected from the group consisting of basal ganglia, subthalamic
nucleus (STN), pedunculopontine nucleus (PPN), substantia nigra
(SN), thalamus, hippocampus, amygdala, hypothalamus, cortex and
combinations thereof. In a more preferred embodiment, the region of
brain is the hippocampus. In one embodiment, the neurodegenerative
disease is selected from the group consisting of Parkinson's
disease and related movement disorders, Alzheimer's disease, senile
dementia, Amyloid Lateral Sclerosis (ALS), and epilepsy.
[0020] In another aspect, the invention pertains to a method for
treating epilepsy in a subject by identifying one or more regions
of the brain that require modification. A vector comprising a
nucleotide sequence encoding a glutamic acid decarboxylase (GAD) is
then delivered to the region of the brain. GAD is expressed in the
region of the to treat or reduce epilepsy.
[0021] In one embodiment, the region of the brain is selected from
the group consisting of basal ganglia, subthalamic nucleus (STN),
pedunculopontine nucleus (PPN), substantia nigra (SN), thalamus,
hippocampus, amygdala, hypothalamus, cortex, and combinations
thereof. In a preferred embodiment, the region of brain is the
hippocampus.
[0022] In another aspect, the invention pertains to a method for
treating epilepsy in a subject by identifying one or more regions
of the brain that require modification. An adeno-associated viral
(AAV) vector comprising a nucleotide sequence encoding a glutamic
acid decarboxylase (GAD) is delivered to the region of the brain,
and GAD in expressed the region of the brain to treat or reduce
epilepsy.
[0023] In yet another aspect, the invention pertains to a vector
for expression of GAD in cells of the central nervous system
comprising a tissue specific promoter operably linked to a
nucleotide sequence encoding GAD, and a post-transcriptional
regulatory element.
[0024] In one embodiment, the promoter is specific for central
nervous system cells and tissues, such as the cells and tissues of
the brain. In a preferred embodiment, the promoter is the neuron
specific enolase (NSE) promoter.
[0025] The vector also preferably comprises post-transcriptional
regulatory elements to enhance expression of the encoded protein.
In a preferred embodiment, the post-transcriptional regulatory
element is the woodchuck post-transcriptional regulatory element.
In another preferred embodiment, the GAD is selected from the group
consisting of GAD-65 and GAD-67.
BRIEF DESCRIPTION OF FIGURES
[0026] FIG. 1 shows images of in primary neuronal cultures from the
subthalamic nucleus infected with AAV virus vectors expressing
GAD-67 (top two panels), or virus vectors expressing GAD-65 (middle
two panels). The bottom two panels show cells infected with the
GAD-65 plasmid (left bottom panel) and the GAD-67 plasmid (right
bottom panel).
[0027] FIGS. 2A-2F are microphotographs showing plasmid
transfection according to the invention; FIGS. 2A and D show
plasmid transfection of HEK 293 cells with 1 .mu.g of rAAV DNA and
FIGS. 2 B and E. show rAAV vector transduction of HEK 293 cells
with 5 .mu.l rAAV vector while FIGS. 2 C and F. show
non-transfected HEK 293 cells.
[0028] FIG. 3 is a graph showing the effect of rAAV transduction on
the GABA release of primary cultured striatal neurons;
[0029] FIG. 4 is a graph showing the effect of rAAV-GAD treatment
on apomorphine-induced rotation in chronic Parkinson's Disease
Rats;
[0030] FIG. 5 is a graph showing the neuroprotective effect of
rAAV-GAD treatment on apomorphine-induced rotation.
[0031] FIG. 6A is a graph showing the potent neuroprotective effect
of GAD65 on apomorphine rotation.
[0032] FIG. 6B is another graph showing the potent neuroprotective
effect of GAD65 on apomorphine rotation.
[0033] FIG. 7A is a graph showing that there was no significant
reduction in head position bias 2 months after rAAV transduction in
chronic Parkinson's Disease Rats.
[0034] FIG. 7B is a further graph showing that there was no
significant reduction in head position bias 4 months after rAAV
transduction in chronic Parkinson's Disease Rats.
[0035] FIG. 8A is a graph demonstrating that head position bias was
improved in rats transduced with rAAV-GAD65.
[0036] FIG. 8B is a further graph showing that rAAV-GAD65
transduced rats showed marked effects on head position bias.
[0037] FIG. 9 is a graph demonstrating a direct correlation between
apomorphine rotation and head position bias.
[0038] FIG. 10 is graph showing that paw touching counts were
significantly improved in all rAAV-GAD and Ibotenic acid lesion
groups.
[0039] FIG. 11 is a further graph showing that rAAV-GAD-65 had a
marked neuroprotective effect on paw touching counts.
[0040] FIG. 12A is a graph demonstrating that a marked improvement
in locomotor activity was observed in Parkinson's Rats with
combined rAAV-GAD65 and 67.
[0041] FIG. 12B is a another graph further demonstrating that a
marked improvement in locomotor activity was observed in
Parkinson's Rats with combined rAAV-GAD65 and 67.
[0042] FIG. 13A is a graph showing that there was also evidence of
neuroprotective effects on locomotor activity by rAAV-GAD
transduction.
[0043] FIG. 13B is a graph further showing a neuroprotective
effects on locomotor activity by rAAV-GAD transduction;
[0044] FIG. 14 is a graph of extracellular GABA Concentration
during STN Stimulation;
[0045] FIG. 15 is a graph of Extracellular Glutamate Concentration
during STN Stimulation;
[0046] FIG. 16 is a histogram showing the response of neurons in
the Substantia Nigra to electrical stimulation in the STN of a
normal rat;
[0047] FIG. 17 is a histogram showing the response of neurons in
the Substantia Nigra to electrical stimulation in the STN in
rAAV-GAD transduced rat;
[0048] FIG. 18A is a graph of extracellular GABA concentration in
the SN during STN stimulation in naive rats;
[0049] FIG. 18B is a graph of extracellular GABA concentration in
the SN during STN stimulation in rAAV-GAD rats;
[0050] FIG. 19A-19F are microphotographs showing rAAV-GAD65
expression in vivo. FIGS. 19A,B,C, and D show GAD65 expression in
the STN detected with GAD65 Ab (Boehringer). FIGS. 19A and C are
derived from naive STN, showing endogenous GAD65 expression. FIGS.
19B and D are based on rAAV-GAD65 transduced STN, such that an
increase in cell bodies expressing GAD65 is seen, while FIGS. 19 E
and F show GAD65 expression in the hippocampus. (FIG. 19E being
naive and FIG. 19F being rAAV-GAD65 transduced);
[0051] FIGS. 20A and 20B are rasterplots showing activity in a
monkey before GAD67 treatment, respectively;
[0052] FIGS. 21A and 21B are more detailed images, showing
neuronal-like cells stained with GFP antibody in 21A and glial-like
cells stained with GFP antibody shown in 21B is;
[0053] FIG. 22 is a microphotograph showing GFP immunostaining at
an injection site;
[0054] FIG. 23 is a photograph of GAD immunostaining on rAAV-GAD
treated monkey, showing an increase in immunostaining on the
rAAV-GAD treated side on the right while the morphology of the
region remained unaltered after surgery;
[0055] FIG. 24A are plasmid constructs. FIG. 24B are images of
plasmid expression in HEK293 cells transfected with the
AAV/NSE-GAD65 or AAV/CMV-GAD65 plasmids, and processed with
anti-GAD65 antibodies. FIG. 24C are images of AAV-mediated
expression in HEK293 cells. The AAV vectors were applied to HEK293
cells which were then processed for immunochemistry with anti-GAD65
or anti-GFP antibody. FIG. 24D is a bar comparing the level of CMV
and NSE driven GAD65 expression in HEK293 cells;
[0056] FIG. 25A is a schematic diagram of CBA-GAD65 and CBA-EGFP
plasmid maps. FIG. 25B are images of plasmid- and AAV-mediated
GAD65 expression in HEK293 cells showing anti-GAD65
immunocytochemistry. FIG. 25C, are photographs of plasmid- and
AAV-mediated EGFP expression in HEK293 cells showing EGFP
fluorescence. FIG. 25D is a schematic diagram of CBA-GAD67 plasmid
map. FIG. 25E are images of plasmid- and AAV-mediated GAD67
expression in HEK293 cells showing anti-GAD67 immunocytochemistry
(anti-67);
[0057] FIG. 26A shows images of AAV-mediated expression of GAD65,
GAD67 and EGFP in C17.2 cells. The top row shows
immunohistochemistry with the antibody appropriate to transgene.
The middle row are mock transfected controls. The bottom row shows
anti-GABA immunohistochemistry. FIG. 26B is a bar chart showing the
GABA release from C17.2 cells following AAV-mediated
transduction;
[0058] FIG. 27A are plasmid maps of AAV/HA-GAD constructs. FIG. 27B
are images of plasmid (p) and AAV-mediated (v) expression of GAD65
and GAD67 in C17.2 cells showing anti-hemaglutinin and anti-GAD
immunochemistry. FIG. 27C are images of AAV-mediated expression of
GAD65 and GAD67 in C17.2 cells showing anti-GABA
immunochemistry;
[0059] FIG. 28 A-I are images of AAVEGFP expression in rat
hippocampus. FIG. 28A, D, G are hippocampal expression of AAVEGFP
from three representative rats. FIG. 28B, E, H are images of
anti-GFP immunohistochemistry in the granule cell layer and hilus
showing AAVEGFP transduction of granule cells and hilar neurons.
FIGS. 28C and F are images of anti-GFP immunohistochemistry in the
CA1 subfield showing transduction of pyramidal cells. FIG. 28I is
an image of the negative control AAVGAD65 section stained with
anti-GFP antibody;
[0060] FIGS. 29A, C, E, G, I, K, M, and O are images of AACEGFP
fluorescence in the hippocampus. FIGS. 29B, D, F H, J, L, N, and P
are immunohistochemistry images (red) for a range of cell type
markers (labeled in white) layered over the AAVEGFP fluorescent
images;
[0061] FIG. 30A-R are images of AAVGAD65 expression in the rat
hippocampus. FIG. 30 A,B,C, are images of anti-GAD65
immunohistochemistry of AAVGAD65 transduced hippocampi. FIG. 30
D,E,F, are images of anti-GAD65 immunohistochemistry of control
AAVGFP transduced hippocampi. FIG. 30 G-O are images of anti-HA
immunohistochemistry of AAVGAD65 transduced hippocampi. FIG. 30P is
the image of a negative control AAVEGFP transduced hippocampus
stained with an anti-HA antibody. FIG. 30Q,R, are images of
molecular layer of an AAVGAD65 transduced hippocampus stained with
HA antibody (O) and the untransduced contralateral molecular layer
(R) with visibly stained commissural fibres (arrow);
[0062] FIG. 31A-R are images of AAVGAD67 expression in the rat
hippocampus. FIG. 31A-F, are images of anti-GAD67
immunohistochemistry of AAVGAD67 transduced hippocampi. FIG. 31 G-I
are images of anti-GAD67 staining of control AAVGFP transduced
hippocampi. FIG. 31 J-O are images of anti-HA immunohistochemistry
of AAVGAD65 transduced hippocampi. FIG. 31 P-R are images of the
negative control AAVEGFP transduced hippocampi stained with an
anti-HA antibody;
[0063] FIG. 32 A-D are bar graphs showing seizure behaviors induced
by kainic acid administration. The graphs depict the seizure
associated behavior of rats for a ninety minute period after kainic
acid administration. FIG. 32A is a bar graph showing the number of
wet dog shakes. FIG. 32B is a bar graph showing the unilateral
forelimb clonus. FIG. 32C is a bar graph showing bilateral forelimb
clonus. FIG. 32D is a bar graph showing rearing;
[0064] FIG. 33 are electroencephalograms (EEG) of seizure activity
in the hippocampus. The EEG activity was measured at 60-70 minutes
after kainic acid administration;
[0065] FIG. 34A-D are bar graphs showing latencies to seizure
associated behavior following kainic acid administration. FIG. 34A
is a bar graph showing the number of wet dog shakes. FIG. 34B is a
bar graph showing the unilateral forelimb clonus. FIG. 34C is a bar
graph showing bilateral forelimb clonus. FIG. 34D is a bar graph
showing rearing;
[0066] FIG. 35 are images of neuronal degeneration three days after
kainic acid administration. The images show Fluoro-Jade stained
neurons in CAL CA3 and hilus of AAVGAD65, AAVGAD67, AAVEGFP and
sham-treated rats; and
[0067] FIG. 36 are bar graphs showing the quantification of
Fluoro-Jade stained cells. three days after kaininc acid
administration, cells in the hilus and CA1 and CA3 subfields were
stained with Fluoro-Jade, a marker of degenerating neurons.
DETAILED DESCRIPTION
[0068] The practice of the present invention employs, unless
otherwise indicated, conventional methods of virology,
microbiology, molecular biology and recombinant DNA techniques
within the skill of the art. Such techniques are explained fully in
the literature. (See, e.g., Sambrook, et al. Molecular Cloning: A
Laboratory Manual (Current Edition); DNA Cloning: A Practical
Approach, Vol. I & II (D. Glover, ed.); Oligonucleotide
Synthesis (N. Gait, ed., Current Edition); Nucleic Acid
Hybridization (B. Hames & S. Higgins, eds., Current Edition);
Transcription and Translation (B. Hames & S. Higgins, eds.,
Current Edition); CRC Handbook of Parvoviruses, Vol. I & II (P.
Tijessen, ed.); Fundamental Virology, 2nd Edition, Vol. I & II
(B. N Fields and D. M Knipe, eds.))
[0069] So that the invention is more clearly understood, the
following terms are defined:
[0070] The terms "neurodegenerative disorder" or a "neurological
disorder" as used herein refers to a disorder which causes
morphological and/or functional abnormality of a neural cell or a
population of neural cells. The neurodegenerative disorder can
result in an impairment or absence of a normal neurological
function or presence of an abnormal neurological function in a
subject. For example, neurodegenerative disorders can be the result
of disease, injury, and/or aging. Non-limiting examples of
morphological and functional abnormalities include physical
deterioration and/or death of neural cells, abnormal growth
patterns of neural cells, abnormalities in the physical connection
between neural cells, under- or over production of a substance or
substances, e.g., a neurotransmitter, by neural cells, failure of
neural cells to produce a substance or substances which it normally
produces, production of substances, e.g., neurotransmitters, and/or
transmission of electrical impulses in abnormal patterns or at
abnormal times. Neurodegeneration can occur in any area of the
brain of a subject and is seen with many disorders including, for
example, head trauma, stroke, ALS, multiple sclerosis, Huntington's
disease, Parkinson's disease, and Alzheimer's disease.
[0071] The term "subject" as used herein refers to any living
organism in which an immune response is elicited. The term subject
includes, but is not limited to, humans, nonhuman primates such as
chimpanzees and other apes and monkey species; farm animals such as
cattle, sheep, pigs, goats and horses; domestic mammals such as
dogs and cats; laboratory animals including rodents such as mice,
rats and guinea pigs, and the like. The term does not denote a
particular age or sex. Thus, adult and newborn subjects, as well as
fetuses, whether male or female, are intended to be covered. The
term "central nervous system" or "CNS" as used herein refers to the
art recognized use of the term. The CNS pertains to the brain,
cranial nerves and spinal cord. The CNS also comprises the
cerebrospinal fluid, which fills the ventricles of the brain and
the central canal of the spinal cord.
[0072] The term "modifies" or "modified" are used interchangeably
herein and refer to the up-regulation or down-regulation of a
target gene or a target protein. The term modifies or modified also
refers to the increase, decrease, elevation, or depression of
processes or signal transduction cascades involving a target gene
or a target protein. For example, a target protein can be a GABA.
Modification to the GABA concentrations may occur when a
therapeutic agent, e.g., GAD, alters GABA concentration. For
example, modifications that result in an increase in GABA
concentration by the expression of GAD in glutaminergic neurons and
intrinsic cells of the STN. Modifications can also result from the
addition of a therapeutic agent that inactivates GABA
aminotransferase. The effect is to block the degradation of GABA
and thereby increase its concentration. Numerous mechanism-based
inactivators of GABA aminotransferase are known (See e.g.,
Silverman Mechanism-Based Enzyme Inactivation: Chemistry and
Enzymology, Vol. I and II, CRC: Boca Raton 1988). The term modifies
also includes increasing, or activating GAD with therapeutic agents
that activate GAD, such as sodium valporate. The increase in GAD
results in an increase in GABA, which subsequently reduces
overstimulation of basal ganglia circuits.
[0073] Non-limiting examples of modifications includes
modifications of morphological and functional processes, under- or
over production or expression of a substance or substances, e.g., a
neurotransmitter, by neural cells, failure of neural cells to
produce a substance or substances which it normally produces,
production of substances, e.g., neurotransmitters, and/or
transmission of electrical impulses.
[0074] The term "tissue-specific promoter" as used herein refers to
a promoter that is operable in cells of the central nervous system
(CNS). Examples of promoters for the CNS include but are not
limited to, neuron-specific promoters (e.g., the neurofilament
promoter; Byrne and Ruddle (1989) Proc. Natl. Acad. Sci. USA
86:5473-5477) and glial specific promoters (Morii et al. (1991)
Biochem. Biophys Res. Commun. 175: 185-191). Preferably, the
promoter is tissue specific and is essentially not active outside
the central nervous system, or the activity of the promoter is
higher in the central nervous system that in other systems. For
example, a promoter specific for the spinal cord, brainstem,
(medulla, pons, and midbrain), cerebellum, diencephalon (thalamus,
hypothalamus), telencephalon (corpus stratium, cerebral cortex, or
within the cortex, the occipital, temporal, parietal or frontal
lobes), STN, SN, or combinations, thereof. The promoter may also be
one that can be used in combination with an AAV to result in higher
expression. For example, a cytomegalovirus enhancer/chicken-Actin
(CBA) hybrid promoter that functions in cells of the CNS (Xu et al.
(2001) Hum Gene Ther. 12:563-73).
[0075] The term "homology" or "identity" as used herein refers to
the percentage of likeness between nucleic acid molecules. To
determine the homology or percent identity of two amino acid
sequences or of two nucleic acid sequences, the sequences are
aligned for optimal comparison purposes (e.g., gaps can be
introduced in one or both of a first and a second amino acid or
nucleic acid sequence for optimal alignment and non-homologous
sequences can be disregarded for comparison purposes). In a
preferred embodiment, the length of a reference sequence aligned
for comparison purposes is at least 30%, preferably at least 40%,
more preferably at least 50%, even more preferably at least 60%,
and even more preferably at least 70%, 80%, or 90% of the length of
the reference sequence. The amino acid residues or nucleotides at
corresponding amino acid positions or nucleotide positions are then
compared. When a position in the first sequence is occupied by the
same amino acid residue or nucleotide as the corresponding position
in the second sequence, then the molecules are identical at that
position (as used herein amino acid or nucleic acid "identity" is
equivalent to amino acid or nucleic acid "homology"). The percent
identity between the two sequences is a function of the number of
identical positions shared by the sequences, taking into account
the number of gaps, and the length of each gap, which need to be
introduced for optimal alignment of the two sequences.
[0076] The comparison of sequences and determination of percent
identity between two sequences can be accomplished using a
mathematical algorithm. For example, the percent identity between
two amino acid sequences can be determined using the Needleman and
Wunsch ((1970) J. Mol. Biol. (48):444-453) algorithm which has been
incorporated into the GAP program in the GCG software package
(available at http://www.gcg.com), using either a Blossom 62 matrix
or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4
and a length weight of 1, 2, 3, 4, 5, or 6. In another example, the
percent identity between two nucleotide sequences is determined
using the GAP program in the GCG software package (available at
http://www.gcg.com), using a NWSgapdna.CMP matrix and a gap weight
of 40, 50, 60, 70, or 80 and a length weight of 1, 2, 3, 4, 5, or
6. In yet another example, the percent identity between two amino
acid or nucleotide sequences is determined using the algorithm of
E. Meyers and W. Miller (CABIOS, 4:11-17 (1989)) which has been
incorporated into the ALIGN program (version 2.0), using a PAM120
weight residue table, a gap length penalty of 12 and a gap
penalty.
[0077] The phrase "first phenotypic state" and "second phenotypic
state" refers to a cell that displays a particular characteristic
typical for that cell. The characteristics can be modified or
altered, by genetic intervention, into a second phenotypic state
such that the cell displays a characteristic that is different from
the original characteristic. For example, delivering GAD to
glutamatergic excitatory neurons changes their phenotypic
characteristic from excitatory neurons to inhibitory neurons.
[0078] The invention is described in more detail in the following
subsections:
I. Neurodegenerative Diseases
[0079] Generally, the methods and compositions of the invention can
be used to change cells from a first phenotypic state to second
phenotypic state. The invention pertains to delivering GAD to
regions of the brain associated with a particular disease or
disorder. These regions vary according to the neurodegenerative
disease, but are well know to the skilled artisan. For example, the
region of the brain associated with PD can be the STN, while the
region of the brain associated with epilepsy can be the
hippocampus. it is also to be understood that the various regions
of the brain treated with DBS can also be treated with the methods
and compositions of the invention.
[0080] In particular, the invention pertains to GAD gene transfer
into glutamatergic excitatory neurons which leads to an inhibitory
bias with altered network activity. This phenotypic shift provides
strong neuroprotection and demonstrates there is plasticity between
excitatory and inhibitory neurotransmission in the mammalian brain
that results in a therapeutic effect. This alteration form a first
state to a second state can be used in a umber of neurodegenerative
disorders such as those described below.
(a) Parkinson's Disease
[0081] Parkinson's disease is associated with a disturbances of
posture, locomotion, facial expression or speech. The
manifestations may be asymmetric, e.g., a slight tremor of the
fingers on one hand at rest, and then become bilateral. Symptoms of
Parkinson's disease are caused by loss of nerve cells in the
pigmented substantia nigra pars compacta (SNPC) and the locus
coeruleus in the midbrain. The stratium or corpus stratium is a
structure in the cerebral hemispheres consisting of two basal
ganglia (the caudate nucleus and the putnam) and the fibre of the
internal capsule that separate them. Parkinson's disease in humans
primarily effects the subcortical structures, especially the
substantia nigra and the locus ceruleus. It is characterized by the
loss of dopamine neurons in the substantia nigra, which have the
basal ganglia as their major target organ. Cell loss also occurs in
the globus pallidus and putamen.
[0082] Parkinson's disease is also associated with eosinophilic
intraneural inclusion granules (Lewy bodies) which are present in
the basal ganglia, brainstem, spinal cord, and sympathetic ganglia.
The pars compacta neurons of the substantia nigra (SN) provide
dopaminergic input into the stratium, which is part of the basal
ganglia. These dopaminergic neurons modulate a monosynaptic
gamma-aminobutyric acid (GABA) inhibitory output in the globus
pallidus interna and pars reticulata of the substantia nigra. In
Parkinson's disease, loss of dopaminergic cells in the substantia
nigra leads to stratial dopamine depletion. This loss of dopamine
alters the activity of neurons within the basal ganglia circuitry,
including excessive firing and activity of these cells.
[0083] The motor abnormalities of Parkinson's disease (PD) are
caused by alterations in basal ganglia network activity, including
disinhibition of the subthalamic nucleus (STN), and excessive
activity of the major output nuclei. Using adeno-associated viral
vector-mediated somatic cell gene transfer, glutamic acid
decarboxylase (GAD) was expressed, the enzyme that catalyzes
synthesis of the neurotransmitter GABA, in excitatory glutamatergic
neurons of the STN in an in vivo animal model. The transduced
neurons, when driven by electrical stimulation, produced mixed
inhibitory responses associated with GABA release. This phenotypic
shift resulted in strong neuroprotection of nigral dopamine neurons
and rescue of the parkinsonian behavioral phenotype. This strategy
suggests that there is plasticity between excitatory and inhibitory
neurotransmission in the mammalian brain that could be exploited
for therapeutic benefit (See Luo et al., (2002) Science 298:
425-429).
[0084] Accordingly, a region of the brain associated with
Parkinson's disease can be inhibited, reduced, treated, or altered
from a first phenotypic state to a second phenotypic state using
the methods and compositions of the invention. In particular, a
vector comprising a therapeutic agent, e.g., a nucleotide sequence
encoding GAD, can be delivered to the site of dopaminergic cell
loss or other regions of the basal ganglia and output nuclei. In
one embodiment, the vector comprising a therapeutic agent can be
delivered to the subthalamic nucleus (SN). In another embodiment,
the vector comprising a therapeutic agent can be delivered to the
substantia nigra pars reticulata (SNPR).
(b) Alzheimer's Disease
[0085] Alzheimer's disease is characterized by the gradual loss of
intellectual capabilities. Post-mortem examination of the brain
shows a generalized atrophy. There are extensive histological
changes in Alzheimer's disease dominated by the presence of
intracellular amyloid plaques and neurofibrillary tangles. Plaques
and tangles are rare, however, in the basal ganglia and substantia
nigra. Many specimens from Alzheimer's disease patients demonstrate
a loss of pigmentation in the area of the locus ceruleus, which is
a major source of noradrenergic synthesis in the brain.
Accordingly, a region of the brain associated with Alzheimer's
disease can be inhibited, reduced, treated, or altered from a first
phenotypic state to a second phenotypic state using the methods and
compositions of the invention.
(c) Epilepsy
[0086] Epileptic seizures are the outward manifestation of
excessive and/or hypersynchronous abnormal activity of neurons in
the cerebral cortex. Seizures are usually self limiting. Many types
of seizures occur. The behavioral features of a seizure reflect
function of the portion of the cortex where the hyper activity is
occurring. Seizures can be generalized, appearing to involve the
entire brain simultaneously. Generalized seizures can result in the
loss of conscious awareness only and are then called absence
seizures (previously referred to as "petit mal"). Alternatively,
the generalized seizure may result in a convulsion with
tonic-clonic contractions of the muscles ("grand mall" seizure).
Some types of seizures, partial seizures, begin in one part of the
brain and remain local. The person may remain conscious throughout
the seizure. If the person loses consciousness the seizure is
referred to as a complex partial seizure.
[0087] Simple partial seizures include autonomic and mental
symptoms and sensory symptoms such as olfaction, audition, or
vision, sometimes concomitant with symptoms of experiences such as
deja-vu and jamais-vu. Complex partial seizures often exhibit
motion stopping followed by eating-function automatism, and are
divided into amygdala-hippocampus seizures and lateral temporal
lobe seizures according to localization. In the case of temporal
lobe epilepsy, 70-80% of the seizures are hippocampus seizures, in
which aura, motion stopping, lip automatism, and clouding of
consciousness are successively developed to result in amnesia. When
the focus is in the amygdala, there are caused autonomic symptoms
such as dysphoria in the epigastrium; phobia; and olfactory
hallucination. Lateral temporal lobe seizures include auditory
illusion, hallucination, and a dreamy state, and disturbance of
speech when the focus is in the dominant hemisphere. Temporal lobe
epilepsy exhibits a long-term psychosis-like state in addition to
other symptoms and recognition-and-memory disorder more frequently
than do other epilepsies. Treatment of temporal lobe epilepsy is
carried out through pharmacotherapy employing a maximum dose of a
combination of drugs, or through surgical treatment. A complex
partial seizure is a partial seizure with impairment of
consciousness, and is similar to a seizure that has conventionally
been called a psycho-motor seizure or a seizure associated with
temporal lobe epilepsy.
[0088] The neuromechanism responsible for seizures includes the
amygdala, the hippocampus, the hypothalamus, the parolfactory
cortex, etc., in addition to the frontal and temporal lobes. The
seizures typically last 1-2 minutes or slightly longer, and the
onset and cessation of the seizures are not abrupt but gradual.
[0089] The existence of a system which can control the propagation
and/or the generation of different kinds of seizures is known. The
involvement of the substantia nigra, a particular portion of the
brain considered to be part of neural circuitry referred to as the
basal ganglia (See e.g., Depaulis, et al. (1994) Prog.
Neurobiology, 42: 33-52). The inhibition of the substantia nigra
will increase the threshold for seizure.
[0090] The neural connections that make up the basal ganglia are
also important in epilepsy. These connections are reviewed by
Alexander et. al. (Alexander, et al. Prog. Brain Res. 85: 119-146).
The substantia nigra receives input from the subthalamic nucleus
(STN) which is excitatory and involves glutamate as the
neurotransmitter conveying information at the synapse. Bergman et
al. have shown that a lesion of the subthalamic nucleus will reduce
the inhibitory output of the internal segment of the globus
pallidus and substantia nigra reticulata (SN) (Bergman, et al
(1990), Science, 249: 1436-1438). The subthalamic nucleus receives
input from the external segment of the globus pallidus (GPe). This
input is inhibitory using GABA as a transmitter substance. Hence,
increased activity of the neurons in GPe will increase inhibition
of neurons in the subthalamic nucleus which will reduce the
excitation of neurons in the substantia nigra.
[0091] Accordingly, a region of the brain associated with epilepsy
can be inhibited, reduced, treated, or altered from a first
phenotypic state to a second phenotypic state using the methods and
compositions of the invention. The invention is intended to include
all regions of the brain associated with epilepsy. Such regions of
the brain include, but are not limited to, the hippocampus,
amygdala, and hypothalamus. In a preferred embodiment, the vector
carrying the GAD gene is delivered to the hippocampus. Also within
the scope of the invention are regions for treatment of epilepsy
via DBS, such as cerebellum, caudate, thalamus, mamillary nuclei,
anterior nucleus of the thalamus, centromedian nucleus of the
thalamus, and subthalamic nucleus.
[0092] The kainate model is an epileptic model in which kainic
acid, which is one of the excitatory amino acids found in the
brain, is injected to nuclei (amygdala, hippocampus, etc.) in the
limbic system in an microamount to induce focal epilepsy. The
kainate model serves as a model for an epileptic seizure; more
particularly, as a model for status epileptics induced from the
limbic system in an acute phase, and as a model for evolution of a
spontaneous limbic seizure to a secondary generalized seizure in a
chronic phase. The kainate model may also be used as a cortex
epilepsy model through injection of kainic acid to the cortex
(sensory motor field).
[0093] The methods and compositions of the invention can be used to
be used to inhibit, reduce, or treat seizures that include, but are
not limited to, tonic seizures, tonic-clonic seizures, atypical
absence seizures, atonic seizures, myoclonic seizures, clonic
seizures, simple partial seizures, complex partial seizures, and
secondary generalized seizures.
(d) Metabolic Disorders
(i) Obesity
[0094] The methods and composition of the invention can also be
used to treat or modify obesity in a subject. Mouse models for
obesity are known in that art, for example, obese-diabetic mice
(ob/ob), and obese-diabetic (db/db) mice from the Jackson
Laboratories (Bar Harbor, Me.). (See e.g., Collins et al. (1996) J
Biol Chem 271:9437-9440; Darling (1996) Curr Opin Genet Dev
6:289-294; Andersson (1996) Ann. Med. 28:5-7). These animal models
can be used to assess the effect of GAD on weight gain,
particularly by delivering GAD to the hypothalamus region of the
brain. The hypothalamus plays a significant role in obesity.
Augmentation of GABA function from neurons within the hypothalamus
can result in alteration of metabolic behavior (Boulis et al.
(2002) AANS meeting, Chicago (abstract)). Accordingly, a region of
the brain associated with obesity can be inhibited, reduced,
treated, or altered from a first phenotypic state to a second
phenotypic state using the methods and compositions of the
invention.
(ii) Diabetes
[0095] A summary of insulin-dependent diabetes mellitus and its
animal models is described by Wong et al. (1999) Curr Opin Immunol
11:643-647. Glutamic acid decarboxylase (GAD) has been associated
with diabetes (Baekkeskov et al. (1990) Nature 347:151-156). These
models can be used to investigate the effect of GAD on diabetes in
a animal. A region of the brain associated with diabetes can be
inhibited, reduced, treated, or altered from a first phenotypic
state using the methods and compositions of the invention.
(e) Pain
[0096] The methods and compositions of the invention can also be
used to reduce pain by delivering GAD to a region of the brain
associated with pain. For example, in Jasmin et al., GABA
neurotransmission in the rostral agranular insular cortex (RAIC) of
freely moving rats, was altered by locally increasing GABA using
two methods: (a) an enzyme inhibitor; and (b) a
double-cassette-defective herpes simplex virus vector. Use of gene
transfer mediated by a viral vector produced lasting analgesia in
the rats by enhancing the descending inhibition of spinal
nociceptive neurons (Jasmin et al. (2003) Nature, 424:316-320). A
region of the brain associated with pain can be inhibited, reduced,
treated, or altered from a first phenotypic state using the methods
and compositions of the invention.
(f) Visual Cortical Function
[0097] The methods and compositions of the invention can also be
used to improve visual cortical function be delivering GAD, and to
subsequently alter GABA levels in a region of the brain associated
with vision. For example, alteration of GABA levels, in a region of
the visual cortex (V1) of aged primates can result in improved
acuity, improved orientation and direction selectivity, decreased
spontaneous activity and an increased ability to signal visual
stimuli (Levanthal et al. (2003) Science 300:812-815). Accordingly,
a region of the brain associated with vision can be inhibited,
reduced, treated, or altered from a first phenotypic state using
the methods and compositions of the invention.
II. Gamma Aminobutyric Acid (GABA) and Glutamic Acid Decarboxylase
(GAD)
[0098] Gamma aminobutyric acid (GABA) and glutamic acid are two
major neurotransmitters involved in the regulation of brain
neuronal activity. GABA is the major inhibitory neurotransmitter
and L-glutamic acid is an excitatory transmitter (Roberts et al.
GABA in Nervous System Function, Raven Press: New York, 1976;
McGeer et al. Glutamine, Glutamate, and GABA in the Central Nervous
System; Hertz L, Kvamme E, McGeer E G, Schousbal A, eds., Liss: New
York, 1983; 3-17). GABA is released from dopaminergic cells. An
imbalance in the concentration of these neurotransmitters can lead
to convulsive states. When the concentration of GABA diminishes
below a threshold level in the brain, convulsions result (Karlsson
et al., (1974) Biochem. Pharmacol. 23:3053-3061). When the GABA
levels rise in the brain the convulsions terminate (Hayashi (1959)
supra). In several convulsive disorders there is concomitant with
reduced brain GABA levels a diminished level of glutamic acid
decarboxylase (GAD) activity (McGeer et al., GABA in Nervous System
Function; Roberts E, Chase T N, Tower D B, eds., Raven Press: New
York 1976:487-495; Butterworth et al., (1983) Neurochem.
41:440-447). The concentrations of GAD and GABA vary in parallel
because decreased GAD concentration results in lower GABA
production.
[0099] GABA interacts with a least two receptors, GABA-A and
GABA-B. GABA-A receptors have been well characterized and are
coupled to chloride channels (Bormann (1988) Trends Neurosci. 11:
112-116). GABA-A receptors are related to ligand gated ion channels
belonging to the same superfamily as the nicotrinic receptor for
acetylcholine. In contrast, GABA-B receptors are less well
understood, although reports describe that the GABA-B receptors are
coupled to either calcium or potassium channels (Bormann (1988)
Trends Neurosci. 11:112-116 supra).
[0100] The majority of neurons in the striatum (caudate-putamen,
dorsal striatum; nucleus accumbens, ventral striatum) and in
striatal projection regions (the palladium, the entopeduncular
nucleus and substantia nigra reticulata) use GABA as transmitter
and express GAD in the synthesis of GABA. Brain contains at least
two molecular forms of GAD, the principal synthetic enzyme for
GABA. Two forms, termed GAD-65 and GAD-67, are the products of two
genes and differ in sequence, molecular weight, and level of
expression among brain regions. GAD-65 appears to be localized in
nerve terminals to a greater degree than GAD-67, which appears to
be more uniformly distributed throughout the cell. Although GAD-65
and GAD-67 differ significantly in several characteristics, they
also have substantial similarities and interactions, and the
presence of individual forms of GAD in certain cell types is
consistent with the idea that GAD-65 and GAD-67 can each synthesize
GABA. Thus, GAD-65 and GAD-67 seem to provide a dual system for the
control of neuronal GABA synthesis. Specific changes in activity in
subpopulations of striatal GABA neurons mediate the
dopamine-dependent effects seen in Parkinson's disease (Lindefors
(1993) Prog Neuropsychopharmacol Biol Psychiatry 17:887-903).
[0101] Human GAD-65 and GAD-67 have been isolated and cloned by Bu
et al. (1992) Proc Natl Acad Sci 89:2115-2119. Human GAD-65 cDNA
encodes a Mr 65,000 polypeptide, with 585 amino acid residues
(Genbank Accession No. NM000818;M81882), Human GAD-67 encodes a Mr
67,000 polypeptide, with 594 amino acid residues (Genbank Accession
No. NM013445;M81883).
[0102] In one embodiment, the invention features a vector
comprising a nucleotide sequence encoding GAD-65. In another
embodiment, the invention features a vector comprising a nucleotide
sequence encoding GAD-67.
[0103] Also within the scope of the invention is a polypeptide
encoded by nucleotide sequence that has at least 60% homology to
GAD-65 or a fragment thereof. A polypeptide encoded by nucleotide
sequence that about 70% homology, about 75% homology, about 80%
homology, about 85% homology, about 90% homology, about 95%
homology, about 99% homology to GAD-65 or a fragment thereof. Also
within the scope of the invention is a polypeptide encoded by
nucleotide sequence that has at least 60% homology to GAD-67 or a
fragment thereof. A polypeptide encoded by nucleotide sequence that
about 70% homology, about 75% homology, about 80% homology, about
85% homology, about 90% homology, about 95% homology, about 99%
homology to GAD-67 or a fragment thereof.
[0104] The GAD transduction in target cells of the STN will
specifically increase the local inhibitory tone, acting via
increasing extracellular GABA and inhibiting neuronal activity in
the STN by acting on both GABA-A and GABA-B receptors. Gene
expression using the method of the invention provides completely
stable levels of the transgene expression for at least 15 months in
vivo (see Example 3). The release of GABA from the transduced cells
diffuses locally binds to the GABA receptors thereby leading to
significant depression of activity. Importantly, unlike either
ablation or DBS, the gene transfer using AAV is devoid of any
cellular infiltration, any microglial cell activation and lack of
reactive astrocytosis. Each of these compensatory or inflammatory
responses to the ablative or DBS approaches is likely to reduce the
efficacy of these respective strategies and potentially have
other.
[0105] Other inhibitory genes that can be used in the method of the
invention includes, but are not limited to, genes which encode
potassium channels, genes which encode other ion channels and genes
that act on the neurotransmitter release machinery, including
endocytosis and exocytosis. Examples of genes include for example,
frequenin and AP 180.
III. Vectors
[0106] The vectors of the invention can be delivered to the cells
of the central nervous system by using viral vectors or by using
non-viral vectors. In a preferred embodiment, the invention uses
adeno-associated viral vectors comprising the a nucleotide sequence
encoding GAD for gene delivery. AAV vectors can be constructed
using known techniques to provide at least the operatively linked
components of control elements including a transcriptional
initiation region, a exogenous nucleic acid molecule, a
transcriptional termination region and at least one
post-transcriptional regulatory sequence. The control elements are
selected to be functional in the targeted cell. The resulting
construct which contains the operatively linked components is
flanked at the 5' and 3' region with functional AAV ITR
sequences.
[0107] The nucleotide sequences of AAV ITR regions are known. The
ITR sequences for AAV-2 are described, for example by Kotin et al.
(1994) Human Gene Therapy 5:793-801; Berns "Parvoviridae and their
Replication" in Fundamental Virology, 2nd Edition, (B. N. Fields
and D. M. Knipe, eds.) The skilled artisan will appreciate that AAV
ITR's can be modified using standard molecular biology techniques.
Accordingly, AAV ITRs used in the vectors of the invention need not
have a wild-type nucleotide sequence, and may be altered, e.g., by
the insertion, deletion or substitution of nucleotides.
Additionally, AAV ITRs may be derived from any of several AAV
serotypes, including but not limited to, AAV-1, AAV-2, AAV-3,
AAV-4, AAV-5, AAVX7, and the like. Furthermore, 5' and 3' ITRs
which flank a selected nucleotide sequence in an AAV expression
vector need not necessarily be identical or derived from the same
AAV serotype or isolate, so long as the ITR's function as intended,
i.e., to allow for excision and replication of the bounded
nucleotide sequence of interest when AAV rep gene products are
present in the cell.
[0108] The skilled artisan can appreciate that regulatory sequences
can often be provided from commonly used promoters derived from
viruses such as, polyoma, Adenovirus 2, cytomegalovirus and Simian
Virus 40. Use of viral regulatory elements to direct expression of
the protein can allow for high level constitutive expression of the
protein in a variety of host cells. Ubiquitously expressing
promoters can also be used include, for example, the early
cytomegalovirus promoter Boshart et al. (1985) Cell 41:521-530,
herpesvirus thymidine kinase (HSV-TK) promoter (McKnight et al.
(1984) Cell 37: 253-262), .beta.-actin promoters (e.g., the human
.beta.-actin promoter as described by Ng et al. (1985) Mol. Cell
Biol. 5: 2720-2732) and colony stimulating factor-1 (CSF-1)
promoter (Ladner et al. (1987) EMBO J. 6: 2693-2698).
[0109] Alternatively, the regulatory sequences of the AAV vector
can direct expression of the gene preferentially in a particular
cell type, i.e., tissue-specific regulatory elements can be used.
Non-limiting examples of tissue-specific promoters which can be
used include, central nervous system (CNS) specific promoters such
as, neuron-specific promoters (e.g., the neurofilament promoter;
Byrne and Ruddle (1989) Proc. Natl. Acad. Sci. USA 86:5473-5477)
and glial specific promoters (Morii et al. (1991) Biochem. Biophys
Res. Commun. 175: 185-191). Preferably, the promoter is tissue
specific and is essentially not active outside the central nervous
system, or the activity of the promoter is higher in the central
nervous system that in other systems. For example, a promoter
specific for the spinal cord, brainstem, (medulla, pons, and
midbrain), cerebellum, diencephalon (thalamus, hypothalamus),
telencephalon (corpus stratium, cerebral cortex, or within the
cortex, the occipital, temporal, parietal or frontal lobes), or
combinations, thereof. The promoter may be specific for particular
cell types, such as neurons or glial cells in the CNS. If it is
active in glial cells, it may be specific for astrocytes,
oligodendrocytes, ependymal cells, Schwann cells, or microglia. If
it is active in neurons, it may be specific for particular types of
neurons, e.g., motor neurons, sensory neurons, or interneurons.
Preferably, the promoter is specific for cells in particular
regions of the brain, for example, the cortex, stratium, nigra and
hippocampus.
[0110] Suitable neuronal specific promoters include, but are not
limited to, neuron specific enolase (NSE) (Olivia et al. (1991)
Genomics 10: 157-165, GenBank Accession No: X51956), and human
neurofilament light chain promoter (NEFL) (Rogaev et al. (1992)
Hum. Mol. Genet. 1: 781, GenBank Accession No: L04147). Glial
specific promoters include, but are not limited to, glial
fibrillary acidic protein (GFAP) promoter (Morii et al. (1991)
Biochem. Biophys Res. Commun. 175: 185-191, GenBank Accession
No:M65210), 5100 promoter (Morii et al. (1991) Biochem. Biophys
Res. Commun. 175: 185-191, GenBank Accession No: M65210) and
glutamine synthase promoter (Van den et al. (1991) Biochem.
Biophys. Acta. 2: 249-251, GenBank Accession No: X59834). In a
preferred embodiment, the gene is flanked upstream (i.e., 5') by
the neuron specific enolase (NSE) promoter. In another preferred
embodiment, the gene of interest is flanked upstream (i.e. 5') by
the elongation factor 1 alpha (EF) promoter.
[0111] The AAV vector harboring the nucleotide sequence encoding a
protein of interest, e.g., GAD, and a post-transcriptional
regulatory sequence (PRE) flanked by AAV ITRs, can be constructed
by directly inserting the nucleotide sequence encoding the protein
of interest and the PRE into an AAV genome which has had the major
AAV open reading frames ("ORFs") excised therefrom. Other portions
of the AAV genome can also be deleted, as long as a sufficient
portion of the ITRs remain to allow for replication and packaging
functions. These constructs can be designed using techniques well
known in the art. (See, e.g., Lebkowski et al. (1988) Molec. Cell.
Biol. 8:3988-3996; Vincent et al. (1990) Vaccines 90 (Cold Spring
Harbor Laboratory Press); Carter (1992) Current Opinion in
Biotechnology 3:533-539; Muzyczka (1992) Current Topics in
Microbiol. and Immunol. 158:97-129; Kotin (1994) Human Gene Therapy
5:793-801; Shelling et al. (1994) Gene Therapy 1:165-169; and Zhou
et al. (1994) J. Exp. Med. 179:1867-1875).
[0112] Alternatively, AAV ITRs can be excised from the viral genome
or from an AAV vector containing the same and fused 5' and 3' of a
selected nucleic acid construct that is present in another vector
using standard ligation techniques, such as those described in
Sambrook et al, Supra. Several AAV vectors are available from the
American Type Culture Collection ("ATCC") under Accession Numbers
53222, 53223, 53224, 53225 and 53226.
[0113] In order to produce recombinant AAV particles, an AAV vector
can be introduced into a suitable host cell using known techniques,
such as by transfection. A number of transfection techniques are
generally known in the art. See, e.g., Graham et al. (1973)
Virology, 52:456, Sambrook et al. (1989) Molecular Cloning, a
laboratory manual, Cold Spring Harbor Laboratories, N.Y., Davis et
al. (1986) Basic Methods in Molecular Biology, Elsevier, and Chu et
al. (1981) Gene 13:197. Particularly suitable transfection methods
include calcium phosphate co-precipitation (Graham et al. (1973)
Virol. 52:456-467), direct micro-injection into cultured cells
(Capecchi (1980) Cell 22:479-488), electroporation (Shigekawa et
al. (1988) BioTechniques 6:742-751), liposome mediated gene
transfer (Mannino et al. (1988) BioTechniques 6:682-690),
lipid-mediated transduction (Felgner et al. (1987) Proc. Natl.
Acad. Sci. USA 84:7413-7417), and nucleic acid delivery using
high-velocity microprojectiles (Klein et al. (1987) Nature
327:70-73).
[0114] Suitable host cells for producing recombinant AAV particles
include, but are not limited to, microorganisms, yeast cells,
insect cells, and mammalian cells, that can be, or have been, used
as recipients of a exogenous nucleic acid molecule. Thus, a "host
cell" as used herein generally refers to a cell which has been
transfected with an exogenous nucleic acid molecule. The host cell
includes any eukaryotic cell or cell line so long as the cell or
cell line is not incompatible with the protein to be expressed, the
selection system chosen or the fermentation system employed.
Non-limiting examples include CHO dhfr-cells (Urlaub and Chasin
(1980) Proc. Natl. Acad. Sci. USA 77:4216-4220), 293 cells (Graham
et al. (1977) J. Gen. Virol. 36: 59) or myeloma cells like SP2 or
NS0 (Galfre and Milstein (1981) Meth. Enzymol. 73(B):3-46).
[0115] In one embodiment, cells from the stable human cell line,
293 (readily available through, e.g., the ATCC under Accession No.
ATCC CRL1573) are preferred in the practice of the present
invention. Particularly, the human cell line 293, which is a human
embryonic kidney cell line that has been transformed with
adenovirus type-5 DNA fragments (Graham et al. (1977) J. Gen.
Virol. 36:59), and expresses the adenoviral E1a and E1b genes
(Aiello et al. (1979) Virology 94:460). The 293 cell line is
readily transfected, and provides a particularly convenient
platform in which to produce rAAV virions.
[0116] Host cells containing the above-described AAV vectors must
be rendered capable of providing AAV helper functions in order to
replicate and encapsidate the expression cassette flanked by the
AAV ITRs to produce recombinant AAV particles. AAV helper functions
are generally AAV-derived coding sequences which can be expressed
to provide AAV gene products that, in turn, function in trans for
productive AAV replication. AAV helper functions are used herein to
complement necessary AAV functions that are missing from the AAV
vectors. Thus, AAV helper functions include one, or both of the
major AAV open reading frames (ORFs), namely the rep and cap coding
regions, or functional homologues thereof.
[0117] The AAV rep coding region of the AAV genome encodes the
replication proteins Rep 78, Rep 68, Rep 52 and Rep 40. These Rep
expression products have been shown to possess many functions,
including recognition, binding and nicking of the AAV origin of DNA
replication, DNA helicase activity and modulation of transcription
from AAV (or other exogenous) promoters. The Rep expression
products are collectively required for replicating the AAV genome.
The AAV cap coding region of the AAV genome encodes the capsid
proteins VP1, VP2, and VP3, or functional homologues thereof. AAV
helper functions can be introduced into the host cell by
transfecting the host cell with an AAV helper construct either
prior to, or concurrently with, the transfection of the AAV vector
comprising the expression cassette, AAV helper constructs are thus
used to provide at least transient expression of AAV rep and/or cap
genes to complement missing AAV functions that are necessary for
productive AAV infection. AAV helper constructs lack AAV ITRs and
can neither replicate nor package themselves. These constructs can
be in the form of a plasmid, phage, transposon, cosmid, virus, or
virion. A number of AAV helper constructs have been described, such
as the commonly used plasmids pAAV/Ad and pIM29+45 which encode
both Rep and Cap expression products. (See, e.g., Samulski et al.
(1989) J. Virol. 63:3822-3828; and McCarty et al. (1991) J. Virol.
65:2936-2945). A number of other vectors have been described which
encode Rep and/or Cap expression products. See, e.g., U.S. Pat. No.
5,139,941.
[0118] As a consequence of the infection of the host cell with a
helper virus, the AAV Rep and/or Cap proteins are produced. The Rep
proteins also serve to duplicate the AAV genome. The expressed Cap
proteins assemble into capsids, and the AAV genome is packaged into
the capsids. This results the AAV being packaged into recombinant
AAV particles comprising the expression cassette. Following
recombinant AAV replication, recombinant AAV particles can be
purified from the host cell using a variety of conventional
purification methods, such as CsCl gradients. The resulting
recombinant AAV particles are then ready for use for gene delivery
to various cell types.
[0119] Alternatively, a vector of the invention can be a virus
other than the adeno-associated virus, or portion thereof, which
allows for expression of a nucleic acid molecule introduced into
the viral nucleic acid. For example, replication defective
retroviruses, adenoviruses, herpes simplex virus, and lentivirus
can be used. Protocols for producing recombinant retroviruses and
for infecting cells in vitro or in vivo with such viruses can be
found in Current Protocols in Molecular Biology, Ausubel et al.
(eds.) Greene Publishing Associates, (1989), Sections 9.10-9.14 and
other standard laboratory manuals. Examples of suitable
retroviruses include pLJ, pZIP, pWE and pEM which are well known to
those skilled in the art. Examples of suitable packaging virus
lines include Crip, Cre, 2 and Am. The genome of adenovirus can be
manipulated such that it encodes and expresses the protein of
interest but is inactivated in terms of its ability to replicate in
a normal lytic viral life cycle. See e.g., Berkner et al. (1988)
BioTechniques 6:616; Rosenfeld et al. (1991) Science 252:431-434;
and Rosenfeld et al. (1992) Cell 68:143-155. Suitable adenoviral
vectors derived from the adenovirus strain Ad type 5 dl324 or other
strains of adenovirus (e.g., Ad2, Ad3, Ad7 etc.) are well known to
those skilled in the art.
[0120] Alternatively, the vector can be delivered using a non-viral
delivery system. This includes delivery of the vector to the
desired tissues in colloidal dispersion systems that include, for
example, macromolecule complexes, nanocapsules, microspheres,
beads, and lipid-based systems including oil-in-water emulsions,
micelles, mixed micelles, and liposomes.
[0121] Liposomes are artificial membrane vesicles which are useful
as delivery vehicles in vitro and in vivo. In order for a liposome
to be an efficient gene transfer vehicle, the following
characteristics should be present: (1) encapsulation of the genetic
material at high efficiency while not compromising the biological
activity; (2) preferential and substantial binding to a target cell
in comparison to non-target cells; (3) delivery of the aqueous
contents of the vesicle to the target cell cytoplasm at high
efficiency; and (4) accurate and effective expression of genetic
information (Mannino, et al. (1988) Biotechniques, 6:682). Examples
of suitable lipids liposomes production include phosphatidyl
compounds, such as phosphatidylglycerol, phosphatidylcholine,
phosphatidylserine, phosphatidylethanolamine, sphingolipids,
cerebrosides, and gangliosides. Additional examples of lipids
include, but are not limited to, polylysine, protamine, sulfate and
3b-[N--(N',N' dimethylaminoethane) carbamoyl] cholesterol.
[0122] Alternatively, the vector can be coupled with a carrier for
delivery Exemplary and preferred carriers are keyhole limpet
hemocyanin (KLH) and human serum albumin. Other carriers may
include a variety of lymphokines and adjuvants such as INF, IL-2,
IL-4, IL-8 and others. Means for conjugating a peptide to a carrier
protein are well known in the art and include glutaraldehyde,
m-maleimidobenzoyl-N-hydroxysuccinimide ester, carbodiimide and
bis-biazotized benzidine. The vector can be conjugated to a carrier
by genetic engineering techniques that are well known in the art.
(See e.g., U.S. Pat. Nos. 4,608,251; 4,601,903; 4,599,231;
4,599,230; 4,596,792; and 4,578,770).
[0123] In one embodiment, particle-mediated delivery using a
gene-gun can be used as a method to deliver the vector. Suitable
particles for gene gun-based delivery of include gold particles. In
one embodiment, the vector can be delivered as naked DNA. Gene gun
based delivery is described, for example by, Braun et al. (1999)
Virology 265:46-56; Drew et al. (1999) Vaccine 18:692-702; Degano
et al. (1999) Vaccine 18:623-632; and Robinson (1999) Int J Mol Med
4:549-555; Lai et al. (1998) Crit Rev Immunol 18:449-84; See e.g.,
Accede et al. (1991) Nature 332: 815-818; and Wolff et al. (1990)
Science 247:1465-1468 Murashatsu et al., (1998) Int. J. Mol. Med.
1: 55-62; Agracetus et al. (1996) J. Biotechnol. 26: 37-42; Johnson
et al. (1993) Genet. Eng. 15: 225-236). Also within the scope of
the invention is the delivery of the vector in one or more
combinations of the above delivery methods.
IV. Delivery Systems
[0124] Delivery systems include methods of in vitro, in vivo and ex
vivo delivery of the vector. For in vivo delivery, the vector can
be administered to a subject in a pharmaceutically acceptable
carrier. The term "pharmaceutically acceptable carrier", as used
herein, refers to any physiologically acceptable carrier for in
vivo administration of the vectors of the present invention. Such
carriers do not induce an immune response harmful to the individual
receiving the composition, and are discussed in section V. In one
embodiment, vector can be distributed throughout a wide region of
the CNS, by injecting the vector into the cerebrospinal fluid,
e.g., by lumbar puncture (See e.g., Kapadia et al. (1996) Neurosurg
10: 585-587).
[0125] Alternatively, precise delivery of the vector into specific
sites of the brain, can be conducted using stereotactic
microinjection techniques. For example, the subject being treated
can be placed within a stereotactic frame base (MRI-compatible) and
then imaged using high resolution MRI to determine the
three-dimensional positioning of the particular region to be
treated. The MRI images can then be transferred to a computer
having the appropriate stereotactic software, and a number of
images are used to determine a target site and trajectory for
antibody microinjection. The software translates the trajectory
into three-dimensional coordinates that are precisely registered
for the stereotactic frame. In the case of intracranial delivery,
the skull will be exposed, burr holes will be drilled above the
entry site, and the stereotactic apparatus used to position the
needle and ensure implantation at a predetermined depth. The vector
can be delivered to regions, such as the cells of the spinal cord,
brainstem, (medulla, pons, and midbrain), cerebellum, diencephalon
(thalamus, hypothalamus), telencephalon (corpus stratium, cerebral
cortex, or within the cortex, the occipital, temporal, parietal or
frontal lobes), or combinations, thereof. In another preferred
embodiment, the vector is delivered using other delivery methods
suitable for localized delivery, such as localized permeation of
the blood-brain barrier. Particularly preferred delivery methods
are those that deliver the vector to regions of the brain that
require modification.
[0126] Modification as used herein refers to a change in the
cellular activity in the region of the brain injected with the
vector. The change in cellular activity can result from changing
the expression, or production of genes responsible for stimulating
a cell. For example, delivery of a vector comprising a nucleotide
sequence encoding GAD, to a region of the brain that is
overstimulated, such as the basal ganglia. In particular, delivery
of the vector to the STN which are overactive in diseases such as
Parkinson's, will result in expression of GAD in this region. While
not being required to provide a mechanism of action, the expression
of GAD in the STN results in production of GABA within the STN
cells, the STN cells release GABA locally such that the released
GABA binds to GABA-A and GABA-B receptors on the STN cell surface.
GABA binding to the GABA receptors results in a reduction in cell
stimulation, thereby reducing overactivity in the STN cells and
prevent neuronal destruction.
V. Pharmaceutical Compositions and Pharmaceutical
Administration
[0127] The vector of the invention can be incorporated into
pharmaceutical compositions suitable for administration to a
subject. Typically, the pharmaceutical composition comprises the
vector of the invention and a pharmaceutically acceptable carrier.
As used herein, "pharmaceutically acceptable carrier" includes any
and all solvents, dispersion media, coatings, antibacterial and
antifungal agents, isotonic and absorption delaying agents, and the
like that are physiologically compatible. Examples of
pharmaceutically acceptable carriers include one or more of water,
saline, phosphate buffered saline, dextrose, glycerol, ethanol and
the like, as well as combinations thereof. In many cases, it will
be preferable to include isotonic agents, for example, sugars,
polyalcohols such as mannitol, sorbitol, or sodium chloride in the
composition. Pharmaceutically acceptable carriers may further
comprise minor amounts of auxiliary substances such as wetting or
emulsifying agents, preservatives or buffers, which enhance the
shelf life or effectiveness of the antibody or antibody
portion.
[0128] The compositions of this invention may be in a variety of
forms. These include, for example, liquid, semi-solid and solid
dosage forms, such as liquid solutions (e.g., injectable and
infusible solutions), dispersions or suspensions, tablets, pills,
powders, liposomes and suppositories. The preferred form depends on
the intended mode of administration and therapeutic application.
Typical preferred compositions are in the form of injectable or
infusible solutions, such as compositions similar to those used for
passive immunization of humans. The preferred mode of
administration is parenteral (e.g., intravenous, subcutaneous,
intraperitoneal, intramuscular). In one embodiment, the vector is
administered by intravenous infusion or injection. In another
embodiment, the vector is administered by intramuscular or
subcutaneous injection. In another embodiment, the vector is
administered perorally. In the most preferred embodiment, the
vector is delivered to a specific location using stereostatic
delivery.
[0129] Therapeutic compositions typically must be sterile and
stable under the conditions of manufacture and storage. The
composition can be formulated as a solution, microemulsion,
dispersion, liposome, or other ordered structure suitable to high
drug concentration. Sterile injectable solutions can be prepared by
incorporating the active compound (i.e., antigen, antibody or
antibody portion) in the required amount in an appropriate solvent
with one or a combination of ingredients enumerated above, as
required, followed by filtered sterilization.
[0130] Generally, dispersions are prepared by incorporating the
active compound into a sterile vehicle that contains a basic
dispersion medium and the required other ingredients from those
enumerated above. In the case of sterile, lyophilized powders for
the preparation of sterile injectable solutions, the preferred
methods of preparation are vacuum drying and spray-drying that
yields a powder of the active ingredient plus any additional
desired ingredient from a previously sterile-filtered solution
thereof. The proper fluidity of a solution can be maintained, for
example, by the use of a coating such as lecithin, by the
maintenance of the required particle size in the case of dispersion
and by the use of surfactants. Prolonged absorption of injectable
compositions can be brought about by including in the composition
an agent that delays absorption, for example, monostearate salts
and gelatin.
[0131] The vector of the present invention can be administered by a
variety of methods known in the art. As will be appreciated by the
skilled artisan, the route and/or mode of administration will vary
depending upon the desired results. In certain embodiments, the
active compound may be prepared with a carrier that will protect
the compound against rapid release, such as a controlled release
formulation, including implants, transdermal patches, and
microencapsulated delivery systems. Biodegradable, biocompatible
polymers can be used, such as ethylene vinyl acetate,
polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and
polylactic acid. Many methods for the preparation of such
formulations are patented or generally known to those skilled in
the art. See, e.g., Sustained and Controlled Release Drug Delivery
Systems, J. R. Robinson, ed., Marcel Dekker, Inc., New York, 1978.
The pharmaceutical compositions of the invention may include a
"therapeutically effective amount" or a "prophylactically effective
amount" of the vectors of the invention. A "therapeutically
effective amount" refers to an amount effective, at dosages and for
periods of time necessary, to achieve the desired therapeutic
result. A therapeutically effective amount of the vector may vary
according to factors such as the disease state, age, sex, and
weight of the individual, and the ability of the vector to elicit a
desired response in the individual. A therapeutically effective
amount is also one in which any toxic or detrimental effects of the
vector are outweighed by the therapeutically beneficial effects. A
"prophylactically effective amount" refers to an amount effective,
at dosages and for periods of time necessary, to achieve the
desired prophylactic result. Typically, since a prophylactic dose
is used in subjects prior to or at an earlier stage of disease, the
prophylactically effective amount will be less than the
therapeutically effective amount.
[0132] Dosage regimens may be adjusted to provide the optimum
desired response (e.g., a therapeutic or prophylactic response).
For example, a single bolus may be administered, several divided
doses may be administered over time or the dose may be
proportionally reduced or increased as indicated by the exigencies
of the therapeutic situation. It is especially advantageous to
formulate parenteral compositions in dosage unit form for ease of
administration and uniformity of dosage. Dosage unit form as used
herein refers to physically discrete units suited as unitary
dosages for the mammalian subjects to be treated; each unit
containing a predetermined quantity of active compound calculated
to produce the desired therapeutic effect in association with the
required pharmaceutical carrier. The specification for the dosage
unit forms of the invention are dictated by and directly dependent
on (a) the unique characteristics of the active compound and the
particular therapeutic or prophylactic effect to be achieved, and
(b) the limitations inherent in the art of compounding such an
active compound for the treatment of sensitivity in
individuals.
[0133] One skilled in the art will appreciate further features and
advantages of the invention based on the above-described
embodiments. Accordingly, the invention is not to be limited by
what has been particularly shown and described, except as indicated
by the appended claims. All publications and references cited
herein are expressly incorporated herein by reference in their
entirety.
EXAMPLES
Example 1
Methods and Materials
(i) Vector Construction
[0134] This example describes the construction of an
adeno-associated virus vector with an GAD cDNA. A full length human
GAD-65 cDNA was subcloned into an AAV plasmid under the control of
a 1.8 kb rat NSE (neuron specific enolase) promoter (Foress-petter
et al. (1986) J. Neurosci. Res. 16, 141-156 (1998)) 5' of the GAD
cDNA followed by the Woodchuck Hepatitis Post-Transcriptional
Regulatory Element (WPRE) and a bovine growth hormone (BGH)
polyadenylation site between the AAV inverted terminal repeats, as
previously described (During et al. (1998) Nature Med.
4:1131-1135). The resulting plasmid is referred to as
pAAV-NSE-GAD-WPRE.
[0135] The plasmids were packaged to generate high titer rAAV-GAD
viral particles using an optimized protocol based on the original
helper-free transient transfection method described by Samulski et
al. (1989) J. Virol. 63:3822-3828), but modified by using an
improved 4th generation helper plasmid, pDG as described by Grimm
et al. (1999) Hum Gene Ther 10, 2445-2450. The helper plasmid
contains both the rep and cap open reading frames, as well the
minimal set of adenoviral genes necessary for helper functions. The
vectors were generated using calcium phosphate transfection of both
plasmids into 293 cells. Vector stocks were purified using ammonium
sulfate followed by double cesium banding. The bands containing the
viral particle were isolated from the cesium chloride preparation
and dialysis into suitable buffer.
[0136] Particle titers were determined using an ELISA assay kit
available (Progen, Inc.) which uses an A20 monoclonal antibody that
recognizes intact particles. Purification of the viral particles
was performed as described by Clark et al., (1999) Hum. Gene. Ther.
10: 1031-1039 and Zolutkhin et al. (1999) Gene Therapy 9:
973-985.
(ii) Packaging Protocol
[0137] To package the recombinant vectors, human embryonic kidney
cells, 293 cells (from American Type Culture Collection (ATCC #
CRL-1573)), passage 4-12 were used. The 293 kidney cells
(1.5.times.10.sup.7 cells) were seeded into forty 15 cm dishes in
complete DMEM (Gibco) containing 10% fetal bovine serum (Hyclone),
0.1 mM MEM non-essential amino acids solution (Gibco), 1 mM MEM
sodium pyruvate (Gibco), 0.05% Penicillin-Streptomycin (5,000
units/ml, Gibco), and incubated overnight at 37.degree. C. When the
cells were 70% confluent and 2-3 hours prior to transfection, the
cells were fed fresh Iscove modified Dulbecco medium (IMDM, Gibco)
containing 10% fetal bovine serum (Hyclone) without
antibiotics.
[0138] All plasmids were isolated from the cells by the alkaline
lysis method (Sambrook et al., supra), and were further purified by
HPLC (BioCAD, Sprint, PerSeptive Biosystems), and concentrated with
2 volumes of 100% ethanol (AR grade, BDH). All HPLC elute buffers
(Buffer A: 250 mM TrisHCl, 10 mM EDTA, pH 8.0; Buffer B: 25 mM
TrisHCl, 1 mM EDTA, 2M NaCl, pH, 8.0; Buffer C: Milli Q water) used
for purification were autoclaved and filter sterilized prior to
use. For each 15 cm tissue culture plate, a total of 60 .mu.g of
plasmid DNA was dissolved in 3.0 ml of 0.25M CaCl.sub.2 and then
quickly mixed with 3.0 ml of HEPES-buffered saline (50 mM HEPES,
280 mM NaCl, 1.5 mM Na.sub.2HPO.sub.4 [pH 7.05-7.10]), incubated
for 2 min and then added to the cells. 6-8 hours after
transfection, the medium was aspirated and cells were washed with
IMDM supplemented with 10% fetal bovine serum without antibiotics.
The washing medium was then aspirated and replaced with fresh IMDM
(Gibco) containing 10% fetal bovine serum with trace pen/strep. The
cells were harvested at 48 hours after transfection. After
low-speed centrifugation on a tabletop centrifuge, the cell pellets
were resuspended in 20 ml of Opti-MEM (Gibco) and subjected to
sonication using 15-20% energy for 50 bursts lasting 1 min. Cell
debris was removed with low speed centrifugation. The clarified
supernatant was collected into a 50 ml polypropylene tube, the cell
pellets were resuspended in 20 ml of Opti-MEM for reextraction. The
supernatants were combined.
[0139] One-third volume of ice-cold saturated
(NH.sub.4).sub.2SO.sub.4 was added to the supernatant, mixed and
placed on ice for 10 minutes. The sample was then centrifuged at
8,000 rpm at 4.degree. C. for 10 min, supernatant was transferred
to a polypropylene centrifuge tube, 2/3 volume of the initial
lysate of saturated (NH.sub.4).sub.2SO.sub.4 was added and mixed
well, then placed on ice for 20 min prior to centrifugation at
12,000 rpm for 20 min at 4.degree. C. The pellet was redissolved in
CsCl-phosphate-buffered saline (PBS) (pH 7.4) solution (density
1.37 g/l) and centrifuged in an SW41 rotor Beckman at 80,000 rpm
(for 24 hours with a 0.5 ml CsCl-PBS cushion (density, 1.5
g/ml).
[0140] The band containing recombinant AAV particle (rAAV) was
collected and re-centrifuged as described above for a further 24
hours. Finally, the rAAV band was collected following the second
CsCl centrifugation and dialyzed against one liter sterile dialysis
buffer containing 50 mM NaCl, 5 mM Tris-HCl and 0.5 mM MgCl.sub.2
(pH 7.4) for an initial 4 hours. Dialysis was repeated using one
liter of fresh cold sterile dialysis buffer for another 4 hours and
finally overnight dialysis using a 50,000 molecular weight cut off
dialysis membrane (Spectrapor) and fresh sterile dialysis buffer.
The AAV virus particle titer was determined using an ELISA method
described by Wistuba et al. ((1997) J. Virol. 71: 1341-1352).
Briefly, a monoclonal antibody specific for AAV assembled capsids
is coated onto microtiter strips and is used to capture AAV
particles. A biotin-conjugated monoclonal antibody to AAV is bound
to the immune complex, streptavidin peroxidase conjugate reacts
with the biotin molecules. Addition of substrate solution results
in a color reaction which is proportional to specifically bound
virus particles, and allows the quantitative determination of an
unknown particle titer.
[0141] Viral particle titre was also determined by the AAV
titration ELISA kit provided by Progen (Germany). One hundred
microliter of ready-to-use wash buffer, positive, negative
controls, and dilutions of standard and samples were pipetted into
appropriate wells of the microtiter strips which were sealed with
adhesion foil. After incubation for 1 hour at 37.degree. C., the
solution was removed and each well was rinsed 3 times with 200
.mu.l of washing buffer for 30 seconds. The washing buffer was
removed and 100 .mu.l of ready to use biotin conjugate was added.
The strips were sealed with adhesion foil and incubated for one
hour at 37.degree. C. The strips were washed as described above. A
volume of 100 .mu.l of ready-to-use streptavidin conjugate was
added, and the strips were sealed with adhesion foil and incubated
for one hour at 37.degree. C. The washing steps were then repeated
as described above. Substrate at a volume of 100 .mu.l was pipetted
into each well and incubated at room temperature for 10 min. The
reaction was stopped by adding 100 .mu.l of stop solution into each
well. Absorbance of each well was measured photometrically at 450
nm wavelength.
(iii) Determination of AAV Particle to Transducing Unit Ratio.
[0142] To determine the transducing unit ratio of the AAV
particles, 293 cells were seeded onto a collagen-coated 24 well
plate at a cell number of 5.times.10.sup.4 cells/well. The cells
were grown in Dulbecco's modified Eagle medium (DMEM, GIBCO)
containing 10% fetal bovine serum (Hyclone), 0.1 mM MEM
non-essential amino acids solution (GIBCO), 1 mM MEM sodium
pyruvate (GIBCO), 0.05% Penicillin-Streptomycin (5,000 units/ml,
GIBCO), at 5% CO.sub.2, 37.degree. C. overnight. AAV/gfap-TH virus
at a volume of 0.5 ml was added to each well and incubated for 48
hours.
[0143] For rat primary neurons and glia, E15 rats was used for
nigra and cortex preparation, while E18 rats were used for
hippocampal and striatal primary cell preparation. The primary
cultures were pipetted into poly-1-lysine-treated 24 well plates at
250,000 cells per well, and incubated in 5% CO.sub.2, at 37.degree.
C. for 24-48 hours. Following the incubation, medium B containing
15% FCS, 0.6% glucose, 100 U/100:g per ml pen/strep in DMEM/F12 was
added to the cultures and the cultures incubated. After 3 days
incubation, 0.5 ml of AAV virus was added onto the cortical
culture. After 4-5 days incubation, 0.5 ml of AAV/gfpa-TH virus was
added onto nigral, hippocampual and striatal cultures. All medium
was replaced with fresh culture medium one day before the virus
addition, cultures were incubated in 5% CO.sub.2, at 37.degree. C.
for 3 days. The cells were then fixed with 4% paraformaldehyde in
0.1 M phosphate buffer (pH 7.4) for 15 min, and washed with
phosphate buffered saline (PBS) containing Trition x100. TH
antibody (dilution 1: 500, Boehringer Mannheim) was used to
determine total TH level, while haemogglutin (HA) antibody
(dilution 1:500, Berkeley Antibody Company) was used to confirm
exogenous TH immunoreactivity. The numbers of positive cells was
counted.
Example 2
In Vitro Transduction of the AAVGAD Vectors
[0144] The GAD-65 and GAD-67 vectors were transduced into primary
neuronal cultures from the subthalamic nucleus. FIG. 1 shows an
image of cells infected with AAV vectors expressing GAD-67 (top two
panels) with a MOI of 10 (multiplicity of infection) in transient
transfection experiments. The antibodies were detected using a
commercially available antibody for Immunocytochemical detection. A
similar experiment was conducted using cells infected with AAV
vectors expressing GAD-65 with an MOI of 10 (middle two panels),
and detected using an antibody specific for GAD-65. This data
demonstrates successful transduction of vectors and successful
expression of the vectors in-vitro in primary neuronal cultures
from the subthalamic nucleus.
Example 3
Additional Vector Constructs and Materials
[0145] Other AAV plasmid constructs that can be used include those
containing different enhancers and promoters. For example, an AAV
plasmid construct for GAD65 with a 1.1 kb Cytomegalovirus
Enhancer/Chicken-Actin (CBA) hybrid promoter, 1760 base pair (bp)
human GAD65 cDNA (Genbank accession number M81882), 647 bp
Woodchuck Hepadnavirus Post Transcriptional Regulatory Element
(WPRE), 269 bp Bovine Growth Hormone Polyadenylation sequence
(BGH-polyA), flanked by 145 bp AAV Inverted Terminal Repeats
(ITRs). This construct is referred to as
pAM/CBA-hGAD65-WPRE-BGHpolyA.
[0146] Another AAV plasmid construct for GAD67 is one with a 1.1 kb
CBA promoter, 1780 bp human GAD67 cDNA (Genbank accession number
M81883), 647 bp WPRE, 269 bp BGH-polyA, flanked by 145 bp AAV ITRs.
This construct is referred to as pAM/CBA-hGAD67-WPRE-BGHpolyA.
[0147] The advantages using CBA is demonstrated by Xu et al., have
shown that an AAV vector with the CBA promoter resulted in 9.5-fold
higher expression after portal vein injection compared with an AAV
vector with the EF1 alpha promoter, and 137-fold higher expression
than an AAV vector with the CMV promoter/enhancer (Xu et al. (2001)
Hum Gene Ther. 12:563-73).
[0148] The constructs also contains a 647 bp Woodchuck hepadnavirus
postregulatory element (WPRE), originating from the 3' region of
the viral S transcript, directly downstream of the human GAD genes.
WPRE appears to be important for high-level expression of native
mRNA transcripts, acting to enhance mRNA processing and transport
of intronless genes (Donello et al. (1998) J. Virol. 72:
5085-92).
[0149] The bovine growth hormone polyadenylation (BGH-polyA)
sequence used in the constructs, drives higher expression than
other polyA sequences such as SV40 early polyA and human collagen
polyA, and was thus incorporated to enhance expression (Pfarr et
al. (1986) DNA 5:115-22).
(i) Construction of pAM/CB-hGAD65-WPRE-BGH and
pAM/CB-hGAD67-WPRE-BGH
[0150] The DNA cassette that was packaged inside each AAV virion
contains the AAV Inverted Terminal Repeats derived from pSub201
(pSub201) is also known as pSSV9. pSub201 was first described in
the J. Virol. (1987) 61:3096-3101 by R. Samulski and coworkers.
This vector contains all of the Adeno-Associated Virus type 2
(AAV-2) wild-type coding regions and cis-acting terminal repeats
cloned into a plasmid backbone. This vector is ideal for cloning,
and was engineered in such a way that restriction digest with Xba I
allowed the removal of the AAV coding region while leaving the AAV
terminal repeats intact in the plasmid backbone. This is important
because the terminal repeats are the only cis acting sequences
required for recombinant virus production.
[0151] The unpackaged backbone of the AAV plasmid (pAM) was derived
from plasmid pSV2-gpt (ATCC 37145). The insert containing the
ampicillin HindIII sites. The pSub201 backbone was swapped for the
pSV2-gpt insert leaving the AAV ITRs. The SV40 ori was inserted
adjacent to the 5' ITR. WPRE-BGH was inserted into Sad and SalI
which created pAM-pL-WPRE-BGH. Next, the rat Neuron Specific
Enolase (NSE) promoter (Peel, Zolotukhin et al. 1997), acting as an
intermediate promoter, was inserted into the rAAV/pL-WPRE-BGH at
the 5' ITR using Asp718 and HindIII. This NSE-polylinker-WPRE-BGH
cloning plasmid provided the basis for cloning CBA-GAD65-WPRE and
CBA-GAD67-WPRE. resistance gene, the E coli. on and the SV40 on was
cloned out of pSV2-gpt using the EcoRI and
(ii) PCR to Obtain GAD65 and GAD67 PCR Amplification and Subcloning
of AAV/CBA-hGAD65-WPRE
[0152] pBluescript II SK+ plasmids containing human GAD65 and GAD67
cDNAs were used. Firstly, the ATG start codon and, 5' and 3'
flanking sequences were removed by PCR amplification, using the
following primers;
TABLE-US-00001 hGAD65up (SEQ ID NO: 1) (5'
ATATATCTCGAGATGGCATCTCGGGGCTC 3') and hGAD65lo (SEQ ID NO: 2) (5'
GCGCGCGAATTCTTATAAATCTTGTCCAAGGCG 3').
[0153] The PCR product was amplified using Expand Polymerase (Roche
Molecular Biochemicals) with the following cycling parameters:
Cycle 1: 94.degree. C. 5 min; Cycles 2-4: 94.degree. C. 30 sec,
50.degree. C. 30 sec, 72.degree. C. 2 min, Cycles 5-24: 94.degree.
C. 30 sec, 72.degree. C. 2 min, Cycle 25: 72.degree. C. 5 min. The
1.76 kb product was digested with EcoRI and XhoI and subcloned into
EcoRI and XhoI digested pBSII KS+ as an intermediate cloning
step.
[0154] The 1.76 kb hGAD65 insert was removed from pBSII Sk+ with
XhoI (blunt) and EcoRI and inserted into NotI (blunt) and EcoRI of
pAM/NSE-pl-WPRE-bGH to create pAM/NSE-hGAD65-WPRE bGH.
[0155] The CMV enhancer/chicken B-actin (CBA) hybrid promoter was
removed from pBACMAM3 (Novagen) with HgaI (blunt/partial) and EcoRI
(blunt) and inserted into Asp718 (blunt) and EcoRI (blunt) digested
pAM/NSE-hGAD65-WPRE to create pAM/CBA-hGAD65-WPRE.
(iii) PCR Amplification and Subcloning of AAV/CBA-hGAD67-WPRE
[0156] The corresponding plasmid containing hGAD67 (1.78 kb) was
constructed by PCR amplification of hGAD67 from pBSII SK+/hGAD67
(2.01 kb).
The following primers were used:
TABLE-US-00002 (SEQ ID NO: 3) hGAD67up (5'
TATATCTCGAGATGGCGTCTTCGACCCA 3') and (SEQ ID NO: 4) hGAD67lo (5'
CAGCTGAATTCTTACAGATCCTGGCCCAG 3').
[0157] The PCR conditions used were identical to those used for
hGAD65 amplification (See above). The 1.78 kb PCR product was
digested with XhoI and EcoRI and inserted into XhoI and EcoRI
digested pBSII KS+ as an intermediate cloning site. hGAD67 was
removed from pBSII KS+/hGAD67 with XhoI (blunt) and EcoRI and
inserted into BamHI (blunt) and EcoRI of pAM/CBA-hGAD65-WPRE to
create pAM/CBA-hGAD67-WPRE.
(iv) Protocal for Vector Production and Purification Cell
Growth
[0158] The 293 cells were cultured in conditions to optimize
transfection.
[0159] Transfection
[0160] Calcium chloride was used in conjunction with the AAV
plasmid (containing GAD65 or 67) and the packaging/helper plasmids
(pRV1 and PF)6) to transfect 293 cells with both plasmids. A Media
wash was then performed.
[0161] Harvesting Cells
[0162] Cells were washed in PBS, then sodium deoxycholate and
benzonase was added. Sodium deoxycholate is used to lyse the cell
membranes, and benzonase is an endonucleaused to beat up cellular
DNA and RNA. The mixture was centrifuged to pellet cellular
components/debris, with the rAAV fraction being left in the
supernatant.
[0163] Heparin Column Purification
[0164] A heparin column was used to purify rAAV, based on heparin
being a ligand for rAAV. The eluted rAAV was then concentrated by
centrifugation and twice dialyzed. The dialyzed rAAV was then
further purified by filtration, and finally aliquoted.
[0165] Quality Control
[0166] rAAV taken from above was run on a protein gel and stained
with coomassie brilliant blue to assess purity. A Western blot is
run with anti VP1, 2 & 3 to verify the presence of the viral
capsid proteins (identity testing).
(v) Genomic Titer Assay for rAAV
[0167] Genomic tittering was performed using the Perkin Elmer 7700
Quantitative PCR Method. This method allows quantification of
genomic copy number. Two samples of the vector stock were diluted
in PCR buffer (1:50 dilution, usually produces a genomic titer of
10.sup.9/ml), one was then used as a no DNase control. Next 350
units of DNase I (Boehringer Mannheim) were added to one sample and
incubated at 37.degree. C. for 30 mins. Following DNase treatment
10 .mu.g of Proteinase K was added to both samples and they were
incubated at 50.degree. C. for 1 hour. Proteinase K was then
inactivated by heating to 95.degree. C. for 20 mins. A dilution
series was then made for both samples. A dilution series of the
rAAV plasmid containing the GAD isoform was then made with the
consideration that linear amplification was possible in the range
of 10.sup.7-10.sup.12 total copies per ml. Both plasmid and sample
dilutions were further diluted 1:4, and 5 .mu.l of each added to a
separate PCR reaction tube. A SYBR green probe was then prepared
with the PCR reaction. Triplicates of each sample, standard and no
template control were prepared, with a total volume for each
reaction of 25 .mu.l. The ABI Prism 7700 was used to detect the PCR
reaction and incorporation of the SYBR probe in the PCR product at
each cycle. A standard curve was produced by taking the average for
each point in the linear range of the standard plasmid dilution
series and plotting the log copy number against the average C.sub.T
value for each point. An adjustment was made to take into account
the single stranded genome of the rAAV as compared to the double
stranded plasmid. Every 10-fold difference in copy number should
correspond to approximately 3 cycles of PCR. See paper by Clark et
al., (1999) Human Gene Therapy 10: 1031-39 for further details. A
standardized genomic titer (dose) of 1.times.10.sup.10 genomes per
ml is sufficient to use in a patient. Stocks can be diluted to the
final formulation in 1.times.PBS.
(vi) Infectious Titer Assay for rAAV
[0168] The infectious titer is an indicator of the concentration of
rAAV particles that have the ability to enter a cell and to release
their DNA cassette into the cellular milieu. This method provides
reliable infectious titers for different rAAV's, independent of the
particular transgene in the rAAV. Replication requires the presence
of a helper virus as well as wild-type AAV genes involved in virion
construction and packaging. Therefore a permissive cell line (C12)
containing the rep and cap genes from the wild-type AAV genome was
used in combination with coinfection using Adenovirus 5 enabling
the replicative production of rAAVs when rAAV was added.
Quantitative PCR was used to assess the quantity of rAAV genomes
after addition to C12 cells. A dilution gradient was produced from
the rAAV. Aliquots of rAAV at decreasing concentrations were added
to C12 cells previously transfected with Adenovirus 5. After
allowing time for replication, quantitative PCR was used to assess
the number of rAAV genomes produced at each dilution of rAAV added
to cells. Two controls were used in this assay. The first set of
controls for the PCR amplification of the original rAAVs that were
added to the cells. Aliquots from the rAAV dilution gradient were
added to C12 cells without Adenovirus. No rAAV replication occurs
without the presence of a helper virus. The quantitative PCR
technique is sensitive enough to amplify a PCR product from the
rAAV genomes originally added to the cells, but over four PCR
amplification cycles were necessary to produce the same amount of
the rAAV amplicon as would be present had replication occurred. The
lowest dilution at which the threshold amplification was reached at
least 4 cycles earlier in the cells that had both rAAV and
Adenovirus added is used to calculate the infectious titer. The
second control is the negative control using C12 cells without
addition of either rAAV or Adenovirus. Only stocks with an
infectious titer greater that 1.times.10.sup.9 infectious particles
per ml will be used (lot release specification).
(vii) Derivation of the Packaging/Helper plasmid pRV1
[0169] The pRV1 plasmid was developed based on two AAV helper
plasmids, pCLR1-1.5 k and pCLV1, with an intron inserted into the
Rep coding region and VP1 coding region, respectively (Cao et al.
(2000) J Virol. 74:11456-63). The 850 bp human .beta.-globin intron
2 was amplified by PCR from human genomic DNA using primers:
TABLE-US-00003 INS1 (SEQ ID NO: 5) (5' Gtt ttg gga cgt ttc ctg agt
cag gtg agt cta tgg gac cct tga tg 3') and INA2 (SEQ ID NO: 6) (5'
cag ttt ttc gcg aat ctg tgg gag gaa gat aag agg tat g 3').
An AAV fragment was amplified with primers:
TABLE-US-00004 VS1 (SEQ ID NO: 7) (5' ccg tgg ccg aga agc tgc agc
gcg act ttc 3') and INA1 (SEQ ID NO: 8) (5' cat caa ggg tcc cat aga
ctc acc tga ctc agg aaa cgt ccc aaa ac 3').
[0170] The intron fragment and AAV fragment were linked together by
PCR amplification using primer VS1 and INA2. The resulting fragment
was digested with SfiI and NruI and cloned into pSub201 at the same
sites to obtain piAAV. The resulting plasmid, piAAV has the
.beta.-globin intron at position 654. The helper plasmid pCLR1 was
cloned by inserting the SfiI-NruI of piAAV850 into pAd/AAV
(Samulski, et al. (1989) J Virol. 63:3822-8). The 1.5 kb Lambda DNA
fragments (EcoRI/HindIII digestion) was cloned into the MfeI site
in the globin intron in pCLR1 to generate pCLR1-1.5 k.
[0171] Plasmid pCLV1 was constructed by a similar method. The human
.beta. globin intron 2 was amplified by using primers:
TABLE-US-00005 D2 (SEQ ID NO: 9) (5' cca cca cca cca aag ccc gca
ggt gag tct atg gga ccc ttg at 3') and D4 (SEQ ID NO: 10) (5' cct
gCt gtc gtc ctt atg ccg ctc tgt ggg agg aag ata aga ggt 3').
An AAV fragment was amplified from pAAV/Ad with primers:
TABLE-US-00006 XF (SEQ ID NO: 11) (5' agt ctc tag agt cct gta tta
gag gtc acg 3') and D2 (SEQ ID NO: 12) (5' atc aag ggt ccc ata gac
tca cct gcg ggc ttt ggt ggt ggt gg 3').
Another AAV fragment was amplified with primers:
TABLE-US-00007 D3 (SEQ ID NO: 13) (5' acc tct tat ctt cct ccc aca
gag cgg cat aag gac gac agc agg 3') and XR (SEQ ID NO: 14) (5' cgg
gtg acg tag tag tct aga gca tgg aaa 3').
[0172] The intron fragment and 2 AAV fragments were linked together
by PCR amplification using primer XF and XR. The resulting fragment
was digested with XbaI and cloned into pAAV/Ad at the same site to
obtain pCLV1. The resulting plasmid pCLV1 has the .beta.-globin
intron at position 2309. These insertion sites in pCLR1-1.5 k and
pCLV1 correspond to the position in RNA for Rep78/68 and VP1,
respectively. All these insertions in the helper plasmids
maintained the consensus sequences for the splice donor sites and
acceptor sites. The pRV1 plasmid was constructed by replacing the
XhoI fragment in pCLR1-1.5 k with the correspondent XhoI fragment
containing globin intron in VP1 from pCLV1. The pRV1 plasmid has an
intron inserted at position 654 and the other at 2309.
(viii) Derivation of Packaging/Helper Plasmid pF6
[0173] The pF6 helper plasmid was constructed from the pBHG10
plasmid. The pBHG10 plasmid was purchased from Microbix (Canada).
The plasmid padF1 was constructed by cloning the Asp700/Sal I
fragment with a Pme I-Sgf I deletion, isolated from pBHG10, into
pBluescript. Further deletions of a 2.3 kb Nm I fragment and 0.5 kb
RsrII/NruI fragment generated helper plasmid pF6.
(ix) Packaging the Virions
[0174] Human embryonic 293 kidney cells were used for packaging.
293 cells were obtained from the American Type Culture Collection
(ATCC # CRL-1573), and express the transforming gene of adenovirus
5 (E1 gene). The 293 cell line is a permanent line of primary human
embryonal kidney transformed by sheared human adenovirus type 5 (Ad
5) DNA. The Master Cell Bank was created using cells supplied by
the American Type Culture Collection (ATCC # CRL-1573). Wild-type
AAV is a dependovirus which means it requires the presence of a
helper virus for normal replication. In addition to the AAV helper
plasmids pRV1 and pF6, the 293 cells supply the remaining helper
virus sequence necessary for AAV capsid production and genome
packaging.
(x) Transduction of Neurons
[0175] Target cells are the intrinsic neurons of the subthalamic
nucleus (STN). The vector was administered at a dose of
3.5.times.10.sup.9 virions in a volume of 35 microliters (based on
genomic titer of rAAV stocks of 10.sup.11/ml) with an additional 15
.mu.l of USP 25% mannitol as a flush. Based on the extensive
analysis of vector distribution using AAV in the rodent brain, it
has been shown that if rAAV is delivered at low infusion rates
(<1.0 .mu.l/min), the best transduction levels were obtained.
Moreover the vector is delivered with high efficiency to cells
immediately surrounding the injection tract, with an exponential
fall off in gene expression extending from the tip of the injection
cannula. Using volumes of 3 microliters delivering 5.times.10.sup.9
virions, 80% of transduced cells lie within 1 mm of the injection
site with less than 5% of transduced cells lying greater than 2 mm
from the injection site. In the study using a 35 .mu.l volume of
vector (12 fold greater volume) but a titer approximately 15-20
fold lower (i.e. roughly equivalent number of vector genomes
delivered), gene expression was restricted to a volume of several
millimeters. This would confine the vector to the STN whose
dimensions are approximately 4.8 mm.times.5 mm.times.6 mm or
.about.140 mm.
(xi) Efficiency of Transduction
[0176] Transduction efficiencies can reach 100% in permissive
cell-lines and permissive target cells in vivo if sufficient MOI
are used. Based on rodent data it is expected that an injection
volume of 35 microliters into a human STN with the absolute number
of virion genomic particles of .about.3.5.times.10.sup.9 is likely
to transduce from 70-175,000 cells. This represents approximately
25-60% of target cells transduced.
(xii) Gene Transfer and Expression
[0177] With rodent data, using both GAD-65, GAD-67, combinations,
as well as HA-tagged GAD-65 and GAD-67, and using injection volumes
of 2:1 of vector stocks of approximately 5.times.10.sup.10 genomic
particles per ml, i.e. a total of 10.sup.8 vector genomes,
approximately 2000 cells in the rodent STN (50,000 vector genomes
for 1 neuron transduced) were transduced. This number reflects 15%
of the total STN neurons (.about.13,600 in the rat (Oorshcot (1996)
J Comp Neurol. 366:580-99) and is sufficient for both partial
behavioral recovery as well as suggestive of neuroprotection as
shown by the data. The ratio of expression to vector dose
administered appears fairly linear, with 1 neuron transduced for
every .about.50,000 genomic AAV particles. Hence, to obtain 100,000
transduced STN neurons in the human STN we estimate a vector dose
of (100,000 cells.times.50,000 virions) or 5.times.10.sup.9 vector
genomes.
Example 4
In Vitro Expression Studies with rAAV-GAD65 and rAAV-GAD67
[0178] HEK 293 cells were plated out at a density of
1.times.10.sup.5 cells/well onto a 24 well plate, 24 hours prior to
addition of 5 .mu.l of virus in 100 .mu.l DMEM per well. Forty
eight hours later, the cells were processed for
immunocytochemistry. The media was aspirated then the cells were
washed with 1.times.PBS. 1 ml 4% paraformaldehyde was added per
well and incubated for 15 minutes (min). After aspiration of the 4%
PFA, the cells were washed with 1.times.PBS then briefly incubated
in 1% H.sub.2O.sub.2 in methanol. The cells were washed in
1.times.PBS then incubated overnight at room temperature in
immunobuffer containing the appropriate dilution of the antibody.
(GAD65, Boehringer Mannheim, 1/1000; GAD67, Chemicon, 1/1000).
After two five minute washes in 1.times.PBS, the cells were
incubated in immunobuffer containing the appropriate secondary
antibody (GAD65, 2 mouse, 1/500. Sigma; GAD67, 2 rabbit, 1/500) for
three hours at room temperature. After two five minute washes in
1.times.PBS, the cells were incubated in immunobuffer containing
ExtrAvidin, 1/500, Sigma for two hours at room temperature. After
two five minute washes in PBS, the antigen was detected with
diaminobenzidine for five minutes where a brown color change
indicated the presence of positive cells.
Results
[0179] The results showed that GAD65/GAD67 expression was detected
after plasmid transfection and virus transduction of HEK 293 cells.
No GAD65 or GAD67 was detected in untransfected or untransduced
cells. FIG. 2A and FIG. 2D show plasmid transfection of HEK 293
cells with 1:g of rAAV DNA. FIG. 2B, FIG. 2E show rAAV vector
transduction of HEK 293 cells with 5:1 rAAV vector. FIG. 2C and
FIG. 2F shows non-transfected HEK 293 cells.
Example 5
GABA Release from Primary Cultured Striatal Neurons Transduced with
rAAV-GAD Vectors
[0180] Primary striatal cultures were prepared from day 15 embryos
and plated onto poly-1-lysine coated wells of a 24 well plate at a
density of 2.5.times.10.sup.5 for striatal culture and 48 hours
later, 2 .mu.l of the following viruses was added to each well in
triplicate:
AAV/CB-hGAD65-WPRE
AAV/CB-hGAD67-WPRE
[0181] AAV/CB-EGFP-WPRE (control virus).
[0182] Ten days later the cells were washed five times in PBS then
incubated 5 min in 200 .mu.l aCSF (first wash). This was collected
then the cells were incubated in 200 .mu.l aCSF+56 mM KCl for 10
mins at 37.degree. C. (high K+). HPLC was performed to determine
the amount of GABA released.
[0183] The results demonstrated that both GAD67 and GAD65
expression significantly increased the basal and K+-induced release
of GABA compared to GFP control (see FIG. 3).
Example 6
In-Vivo Rodent Studies with Neuroprotective and Chronic Lesioned
Parkinson's Disease Models
Methods
(a) Animals
[0184] Male Sprague-Dawley rats (275.about.325 g) were obtained
from Charles River, hosted in standard conditions with constant
temperature (22.+-.1.degree. C.) humidity (relative, 30%), 12 hour
light/dark cycles (light period 7 a.m./7 p.m.). Animals were
allowed free access to food (rodent diet, Labdiet 5001) and
water.
(b) Surgery
[0185] All surgeries were carried out under fresh mixed Ketamine
(67 mg/kg)/Xylazine (6.7 mg/kg) (i.p.) injection; animals were
mounted in a KOPF 900 series stereotaxic frame. The skull was
exposed and a hole drilled above the area of interest. Each
intracerebral injection was made by stereotaxic infusion through a
26-gauge stainless steel needle with 10 l Hamilton syringe and a
microsyringe pump (World Precision Instruments).
(c) Unilateral Lesion of the Medial Forebrain Bundle (MFB):
[0186] Hemiparkinsonian rat models were generated by
6-Hydroxydopamoine (6-OHDA) lesion of the left MFB. Thirty minutes
before lesioning the animals were injected with desipramine (10
mg/kg, s. c.) (Sigma) (A noradrenaline uptake inhibitor to minimize
damage to noradrenergic neurons). Each animal received a unilateral
injection of 8 .mu.g/4 .mu.l sterile 6-hydroxydopamine HCl (Sigma)
with 0.1% ascorbic acid (Sigma) into the left MFB at coordinates
-2.2 mm from Bregma, 1.5 mm from the midline, and 7.8 mm below the
dura, with the incisor bar placed at +5 mm above horizontal zero.
The injection was made over a 4-min period (1 .mu.l/min). The
needle was left in situ for an additional 5 minutes before
removal.
(d) rAAV Vector Transduction into the Subthalamic Nucleus
(STN):
[0187] High titer vectors were used in the intra-STN transduction.
The concentrates or vectors were: rAAV CBA-hGAD65-WPRE-BGH
(6.times.10.sup.10 particles/ml), rAAV CBA-hGAD67-WPRE-BGH
(5.times.10.sup.10 particles/ml), and rAAV CBA-EGFP-WPRE-BGH
(5.times.10.sup.5 particles/ml).
[0188] To enhance the gene expression, combined injection of rAAV
with mannitol (2 .mu.l:1 .mu.l) were used. A total volume of 3
.mu.l rAAV vectors or control vector (saline) were injected into
the ipsilateral (left) STN at coordinates -3.8 mm from Bregma, 2.4
mm from the midline, and 7.7.+-.0.1 mm below the dura, with the
incisor bar placed at 3.5 0.3 mm below the horizontal zero. The
intracerebral vector injection was perfused at the rate of 0.2
.mu.l/min. The needle was left in situ for an additional 5 min
before removal.
(e) Ibotenic Acid-Lesion of the Subthalamic Nucleus (STN):
[0189] Since deep brain stimulation (DBS) and direct lesions of STN
both have shown ameliorate the cardinal symptoms in clinical and
preclinical studies, ibotenic acid-lesion of the STN group were
used to compare the therapeutic efficiency of rAAV-GAD transduction
of STN neurons. Ibotenic Acid solution (3 .mu.l/1.5 .mu.l,
dissolved in 10 mM phosphate-buffered saline, pH adjusted to 7.4
with NaOH) was injected into the ipsilateral STN, using the
following stereotaxic coordinates: -3.8 mm from the bregma, 2.4 mm
lateral to the midline, and 7.7.+-.0.1 mm from the dural surface.
The intracerebral infusion was administered at the rate of 0.2
.mu.l/min, and the needle was left in situ for an additional 5 min
before removal.
(f) Behavioral Tests
(i) Apomorphine-Induced Rotation
[0190] Rats were tested for rotational behavior induced by
apomorphine. For each test, the rat was injected apomorphine
hydrochloride (0.1 mg/kg, s. c.) (Sigma) dissolved in sterile 0.1%
ascorbate-saline, and 15 min after injection each animal was placed
into the 60 cm-diameter hemispherical bowls and the total number of
contralateral rotations over 5 mins were counted. The first
rotation test began at three weeks after the 6-OHDA-lesion of MFB,
and the following tests were performed every three weeks.
6-OHDA-lesioned animals showing apomorphine-induced rotations less
than 15 in the total 5 min test were removed from the gene therapy
of chronic PD group.
(ii) Head Position
[0191] The position of the head relative to the body axis was
measured before the surgeries, and every three weeks after the
lesion and rAAV transduction till the end of the experiment. The
rats were placed in the standard trays, allowed to habituate
freely, and the position of the head (>10 deviation left or
right of the midline, or neutral) was counted in 60 seconds (sec).
The ipsilateral head position bias of unilateral parkinsonian rats
were analyzed using the mean percentage the head was oriented in
the ipsilateral, contralateral or neutral direction at 2 and 4
months after the vector transduction.
(iii) Paw Touching
[0192] The paw-touching test assesses the independent use of the
forepaws for touching movements. Rats were placed in plastic
cylinders (height 30 cm, diameter 25 cm). The number of times the
rat rose up and touched the wall of the cylinder with either left,
right or both forepaws was counted in a 3 min test. The decreased
paw touching movements and bias of unilateral parkinsonian rats
were analyzed at 2 and 4 months after the vector transduction.
(iv) Locomotor Activity
[0193] Locomotor activity of each animal was measured at 3 and 6
months after vector transduction using MED Associate Activity
Monitors (ENV-515). On test days each rat was placed individually
inside a polycarbonate activity monitor chamber
(17.times.17.times.12 inches). Activity was monitored by infrared
light beam sensors (sixteen beams per side) located in the X, Y,
and Z planes. Distance traveled was measured at 5 min intervals for
sixty minutes with a Pentium II PC computer and Activity Monitor
software (Version 4). The mean distance traveled in the 60 min
period was then analyzed.
(g) In Vivo Substantia Nigra Electrophysiology During STN
Stimulation
[0194] Ten male Sprague-Dawley rats (450-700 g) were used in these
experiments. Animals were initially anesthetized with 3% halothane;
1.5% halothane was maintained during surgery and the experiment to
maintain a deep and constant level of anesthesia as determined by
lack of movement to a strong tail pinch. Animals were placed in a
stereotaxic instrument (Cartesian Research) with the incisor bar
angled to establish a flat head between lambda and bregma. Body
temperature was maintained at 37.degree. C. with a
Thermistor-controlled heating pad (FHC, Inc.).
(h) Subthalamic Nucleus (STN) Stimulation Electrode
Implantation:
[0195] The tissue at the rostral skull margin was reflected and
cranial bones were partially removed. Placement of stimulation
electrodes in STN was accomplished using streotaxic coordinates
(-0.6 mm Bregman, 2.6 mm lateral to midline, 15 degree angle, 8.1
mm deep). Stimulation electrodes consisted of a pair of twisted 150
micro diameter stainless steel wires, insulated except for bluntly
cut tips. Electrical stimuli were unipolar pulses (0.5 ms duration)
from a square wave stimulator (AMPI, Master 8) and a constant
current stimulus isolation unit (AMPI, Iso-Flex). Logic pulses
synchronized with STN stimulation were led to a computer for
on-line peristimulus time histogram (P5TH) generation.
(i) Substania Nigra (SN) Recordings
[0196] A 3 mm diameter hole was drilled in the skull above the SN
(5.3 mm caudal to bregma and 2.2 mm lateral to midline), and the
dura was reflected. Extracellular recordings from individual
neurons were obtained with glass micropipettes (2-4 .mu.m tip
diameter, 10-20 MOhm impedance) filled with 1% Pontamine sky blue
dye in 0.5M sodium acetate, 0.5M NaCl. Recordings were obtained and
processed by standard electrophysiological methods. Baseline
spontaneous discharge was monitored for 1-3 min and collected
on-line by computer. Neuronal responses to single-pulse STN
stimulation were examined and threshold for synaptic activation
(driving on approximately half the stimuli) was determined. PSTHs
of SN responses to STN stimulation for at least 30 consecutive
stimulus trials presented at 1/s (up to 5 mA).
(j) Data Analysis
[0197] Spontaneous spike discharge rates were calculated from
computer records averaged over 1 min. To quantify the effects of
STN stimulation, individual PSTHs were analyzed by computer to
determine excitatory and inhibitory epochs. A baseline period was
defined as the 200 ms epoch preceding stimulation, and the mean and
standard deviation of counts per baseline bin were determined. The
onset of significant excitation was defined as the first of 5
consecutive bibs (10 ms bin width) whose mean value exceeded mean
baseline activity by two standard deviations.
(k) In Vivo Substantia Nigra Microdialysis During STN
Stimulation
[0198] The experiments were carried out at four to five months
after the vector transduction into the STN. The rats weighed
between 550-650 g. Animals were anaesthetized with isoflurane with
oxygen and placed in the stereotaxic apparatus (Anilam, Cartesian
Research, Inc.)
(l) STN Stimulation
[0199] The stimulator was placed at the coordinates: -0.6 mm from
bregma and 2.6 mm from the midline, and the stimulator was inserted
8.2.+-.0.1 mm from the dura with an angle of 15 degrees from dorsal
to ventral. Stimuli were delivered by an AMPI accupulser (Master-8,
AMPI) and stimulus isolation units (ISO-Flex, AMPI) which gave a
rectangular pulse. Low and high frequency stimulation (LFS, HFS)
parameters used were: frequency, 10 Hz; pulse width, 500 .mu.s;
intensity 500 .mu.A for STN-LFS; and frequency, 130 Hz; pulse
width, 500 .mu.s; intensity 500 .mu.A for STN-HFS.
(m) Substantia Nigra Microdialysis
[0200] CMA microdialysis probes were customized with an active
dialyzing membrane length of 0.5.about.0.7 mm especially for
microdialysis in small regions. The probe membrane (cuprophane) had
a molecular weight cut off of 6000 Dalton and the outer diameter of
the probe was 0.24 mm. When inserted, the tip of the microdialysis
probe was placed into the SN: -5.8 mm from bregma, 2.4 mm from
midline and 8.3.+-.0.2 mm ventral from dura matter.
[0201] Probes were inserted 2.about.3 hours before the
microdialysis study, connected using vitreous silica tubing (1.2
.mu.l/100 mm) to 1-ml glass syringes mounted on a CMA/100
Microinjection Pump. The dialysis system was perfused at 1.0
.mu.l/min with sterilized, pyrogen-free artificial extracellular
fluid (aECF) (composition in mmol/L: NaCl, 135; KCl, 3; MgCl.sub.2,
1.0; CaCl.sub.2, 1.2; ascobate, 0.2 and 2 mM sodium mono- and
dibasic phosphate to pH 7.4). The collection period was 5 min
during the STN stimulation.
[0202] At the end of experiments, the microdialysis probes were
removed and stored in distilled water between experiments. The
animals were anaesthetized with Euthasol and perfused
intracardially with 0.01M phosphate-saline buffer followed by 4%
paraformaldehyde. The brain was removed and cut into 20 .mu.m
sections using freezing cryostat. Cresyl violet staining was
performed to check the position of the microdialysis probes and the
stimulation electrode. All animals presenting misplaced
microdialysis probes or stimulation electrode were eliminated.
(n) Chromatographic Method for Amino Acid Analysis
[0203] The amino acids content of each sample (specifically GABA
and Glutamate) was analyzed by using a binary gradient
high-performance liquid chromatography (HPLC) (Shimazu) with
fluorescence detection and pre-column derivatization
O-phthalaldehyde (OPA) (obtained from Pierce). A sample to reagent
ratio of 1:3 (v/v) was used (5 .mu.l dialysate sample+15 .mu.l
OPA). After a 60 second reaction, 15 .mu.l of each sample was
auto-injected into the column (100.times.3, 3 .mu.m, 120A,
Keystone). The mobile phases used for separation were A: 0.03M
sodium acetate, 1.0% tetrahydrofuran solution (pH 6.88) and B:
0.02M sodium acetate, 80.0% acetonitrile solution (pH 6.82).
(o) Histology
[0204] Approximately 4-5 months after the rAAV transduction, the
animal were deeply anaesthetized with Euthasol and perfused
intracardially with 0.01M phosphate-saline buffer followed by 4%
paraformaldehyde. The brain was removed and placed into 4%
paraformaldehyde solution about 4 hours and then transferred to 20%
and 30% sucrose solution for 48 hours. Coronal 20 .mu.m tissue
sections were cut at -20.degree. C. using a freezing cryostat
(Leica, Germany) at the pallidal, subthalamic and nigra levels.
[0205] (p) Real Time Quantitative RT-PCR for Gene Expression
[0206] 3-4 months after rAAV transduction, animals were
anesthetized with Euthasol and the brains were removed quickly.
Bilateral STN, Nigra and GPe were dissected. Total RNA was isolated
from each brain regions using TRIzol reagent (Life Technologies,
Inc) as per the manufacturer's protocol. Before RT-PCR, RNA was
incubated with RQ DNase (RNase free) for 30 min at 37.degree. C.
followed by heat denaturation for 5 min at 75.degree. C.
[0207] The mRNA for WPRE was measured by real-time quantitative
RT-PCR using PE Applied Biosystem prism model 7700 sequence
detection system. The sequences of forward and reverse primers were
5'-TGGCGTGGTGTGCACTGT-3' (SEQ ID NO: 15) and
5'-GTTCCGCCGTGGCAATAG-3' (SEQ ID NO: 16) respectively. The WPRE
Taqman fluorogenic probe was
5'-6FAM-TCCGGGACTTTCGCTTTCCCCC-TAMRA-3' SEQ ID NO: 17).
[0208] The mRNA for GAPDH in each sample was used as the endogenous
control to normalize quantitation of hGAD65/67 mRNA for difference
in the amount of total RNA added to each reaction. Taqman rodent
GAPDH control kit from PE Applied Biosystem was used. The sequences
of primers and probe are company's proprietary. RT-PCR was done in
two-steps as per company's protocol. Targets and endogenous control
were run in the same tube with different reporter dyes. Delta Ct
represents WPRE threshold cycle nomalized to GAPDH (.DELTA.Ct=Ct
WPRE-Ct GAPDH).
(q) Statistical Analysis
[0209] Statistical analysis was performed on the data using the
STATVIEW program for ANOVA and t-test.
(r) Summary of Experimental Design
(i) Gene Therapy of Chronic PD Study 1
[0210] In this study, rAAV were administrated three to four months
after the 6-OHDA unilateral lesion of MFB. Animals were grouped
equally according to the stable baseline apomorphine-induced
rotation data as shown in Table 1.
TABLE-US-00008 TABLE 1 AAV Dose Survival Injection AAV + after AAV
Groups Number site mannitol injection NSE-rGAD65 n = 10 ipsi STN 2
.mu.l + 1 .mu.l 10 months NSE-rGAD67 n = 10 ipsi STN 2 .mu.l + 1
.mu.l 10 months NSE-rGAD65 & 67 n = 10 ipsi STN 2 .mu.l + 1
.mu.l 10 months NSE-EGFP n = 10 ipsi STN 2 .mu.l + 1 .mu.l 10
months PBS control n = 5 ipsi STN 2 .mu.l + 1 .mu.l 10 months
CBA-hGAD65 n = 10 ipsi STN 2 .mu.l + 1 .mu.l 8 months empty rAAV n
= 8 ipsi STN 2 .mu.l + 1 .mu.l 14 months
(ii) Gene Therapy on Chronic PD Study 2
[0211] In this study, rAAV were administered three months after the
6-OHDA unilateral lesion of MFB. Animals were grouped equally
according to the stable baseline apomorphine-induced rotation data
as shown in Table 2.
TABLE-US-00009 TABLE 2 AAV Dose Survival Injection AAV + after AAV
Groups Number site mannitol inj. CBA-hGAD65 n = 10 ipsi STN 2 .mu.l
+ 1 .mu.l 5 months CBA-hGAD67 n = 10 ipsi STN 2 .mu.l + 1 .mu.l 5
months CBA-hGAD65 & 67 n = 10 ipsi STN 1 .mu.l + 1 .mu.l + 1
.mu.l 5 months Ibotenic acid n = 10 ipsi STN 2 .mu.l + 1 .mu.l 5
months Chronic PD n = 20
(iii) rAAV Neuroprotective Study
[0212] In this study, rAAVGAD65/67 were administered three weeks
prior to the 6-OHDA ipsilateral lesion of MFB. Groups are shown in
Table 3.
TABLE-US-00010 TABLE 3 AAV Dose Survival Injection AAV + after AAV
Groups Number site mannitol inj. CBA-hGAD65 n = 13 ipsi STN 2 .mu.l
+ 1 .mu.l 7 months CBA-hGAD67 n = 10 ipsi STN 2 .mu.l + 1 .mu.l 2
months CBA-HA-hGAD65 n = 7 ipsi STN 2 .mu.l + 1 .mu.l 6 months
CBA-HA-hGAD67 n = 8 ipsi STN 2 .mu.l + 1 .mu.l 6 months CBA-GFP n =
8 ipsi STN 2 .mu.l + 1 .mu.l 6 months Saline n = 12 ipsi STN 2
.mu.l + 1 .mu.l 6 months HA-GAD65/67 refers to the addition of an
HA epitope tag to the N-terminus of the protein which allowed
immunohistochemical detection of recombinant GAD65/67 to be
distinguished from the endogenous protein.
(s) Results
(i) Behavioral Testing
Apomophine-Induced Rotational Asymmetries
[0213] In the chronic Parkinson's Disease study, rAAV-GAD treatment
groups showed reduced rotations under apomorphine compared to the
progressive PD group, which was similar to the ibotenic acid
lesioning of STN. FIG. 4 is a graph showing the effect of rAAV-GAD
treatment on apomorphine-induced rotation in chronic Parkinson's
Disease Rats.
[0214] In neuroprotective study, all rats administered
rAAV-GAD65/67 showed protection against 6-OHDA insult. FIG. 5 is a
graph showing the neuroprotective effect of rAAV-GAD treatment on
apomorphine-induced rotation. Rats with rAAV-GAD65 showed the best
protective effect, over 69% rats showed absolutely no rotational
asymmetry. FIGS. 6a and 6b are graphs showing the neuroprotective
effect of rAAV-GAD treatment on apomorphine-induced rotation.
Collectively, this data shows that GAD65 and GAD67 injected animals
displayed a decrease in apomorphine induced rotations over 15-20
mins.
Head Position
[0215] The 6-OHDA lesion induced ipsilateral bias. This was used as
one the quantitative markers of the parkinsonian phenotype. No
significant reduction in 6-OHDA lesion induced ipsilateral head
position bias was observed in a rAAV-GAD65, 67 or 65 and 67
administered chronic hemiparkinsonian rats (FIGS. 7a and 7b).
However, in rats with rAAV-GAD65, this symmetry bias was much
improved (FIGS. 8a and 8b). The GAD67 group was not tested at 14
weeks. FIG. 9 is a chart showing there is a direct correlation
between apomorphine rotation and head position bias.
Paw Touching
[0216] The 6-OHDA lesion induced a decreased forepaw rising and
touching movement as well as an ipsilateral bias. Forepaw touching
movement was significantly improved in all rAAV-GAD and Ibotenic
acid lesion groups of Chronic PD rats. FIG. 10 is a chart showing
paw touching counts were significantly improved in all rAAV-GAD and
Ibotenic acid lesion groups. The GAD65/67 group was not tested at
14 weeks. Prior administration of rAAV-GAD65 effectively protected
against the loss of paw touching movement induced by MFB 6-OHDA
lesioning. FIG. 11 is a chart showing rAAV-GAD-65 had a marked
neuroprotective effect on paw touching counts.
Locomotor Activity
[0217] The horizontal locomotor activity decreased progressively in
chronic Parkinson's rats. Combined rAAV-GAD65 and 67 transduced
rats showed marked improvements in their locomotor function. FIGS.
12a and 12b are graphs showing a marked improvement in locomotor
activity was observed in Parkinson's Rats with combined rAAV-GAD65
and 67.
[0218] Prior administration of rAAVGAD65 also protected effectively
against the reducing horizontal locomotor activity induced by MFB
6-OHDA lesion. FIGS. 13a and 13b are charts showing there was
evidence of neuroprotective effects on locomotor activity by
rAAV-GAD transduction.
(ii) In Vivo Substantia Nigra Electrophysiology During STN
Stimulation
[0219] Electrophysiology and microdyalisis was performed in the
substantia nigra (SN) of normal rats and rats treated with the
CBA-GAD65 virus containing human glutamic acid decarboxylase
(GAD65/67) which converts glutamate to GABA in neurons. In rats
that received the virus, 6-OHDA lesions of the medial forebrain
bundle were performed three weeks after the virus was injected into
the subthalamic nucleus (STN) to model the degeneration of dopamine
neurons in PD. Electrophysiology and microdyalysis was performed at
least 4 months after the transduction of the virus.
[0220] Inhibitory GABA containing connections were detected from
the STN to the SN using electrophysiology and microdialysis. In the
microdialysis experiments, a 10.times. increase in GABA was
detected due to low frequency electrical stimulation of the STN,
compared to a 3.times. increase in control rats. Table 4 for GAD
rat #304 and for control rat # 217 shows the concentration of GABA,
glutamate and aspartate in the SN obtained before and after low
frequency stimulation. The sample labels are Basal #, for the
samples taken before stimulation, ST1-#, for successive samples
after the first low frequency stimulation for 2 minutes and ST2-#,
for successive samples after the first low frequency stimulation
for 5 minutes. FIGS. 14 and 15 are charts showing extracellular
GABA concentration during STN stimulation and correspond to the
GABA and glutamate data in Table 4.
TABLE-US-00011 TABLE 4 SN Microdialysis during STN stimulation.
Substantia Nigra Microdialysis During the Subthalamic Nucleus
Stimulation GAD65 Naive Sample Flow Rate GABA Glu GABA Glu 5 ul/15
ul (1.0 ul/min) uM uM uM uM Basal 1 0.031 0.351 0.027 0.056 Basal 2
0.033 0.328 0.007 0.133 Basal 3 0.030 0.357 0.004 0.168 ST1-1
LFS-1: 10 Hz, 0.006 0.125 0.004 0.178 ST1-2 500 uA for 2' 0.010
0.143 0.031 0.553 ST1-3 0.410 1.008 0.021 0.606 ST1-4 0.026 0.673
0.011 0.501 ST1-5 0.139 1.290 0.032 0.644 ST1-6 0.033 0.624 0.037
0.623 ST1-7 0.034 0.787 0.052 0.904 ST1-8 0.065 1.009 0.027 0.514
ST1-9 0.043 0.976 0.023 0.639 ST2-1 LFS-2: 10 Hz, 0.032 0.758 0.078
0.938 ST2-2 500 uA for 5' 0.023 0.819 0.108 1.121 ST2-3 0.033 0.580
0.061 1.213 ST2-4 0.016 0.629 0.043 0.661 ST2-5 0.332 1.564 0.036
0.718 ST2-6 0.044 0.809 0.068 1.220 ST2-7 0.049 0.863 0.049 0.796
ST2-8 0.041 0.866 0.164 1.183 ST2-9 0.038 0.951 0.061 0.852 Note:
each sample was collected every 5-6 min
[0221] FIGS. 16 and 17 show the response of neurons in the
Substantia Nigra (SN) to electrical stimulation of the STN. These
figures show a histogram (20 ms bins) of spike counts after a
electrical stimulation at t=0. Each trial of the stimulation used
to create the histogram is included and labeled sweep of the graph.
FIG. 16 is a chart showing the response of neurons in the
Substantia Nigra to electrical stimulation in the STN of a normal
rat and shows that in normal rats there is a large increase in
impulse activity due to STN stimulation. FIG. 17 is a chart showing
the response of neurons in the Substantia Nigra to electrical
stimulation in the STN in rAAV-GAD transduced rat and shows an
inhibition of spontaneous firing of the neuron in the SN due to STN
stimulation. The stimulation in each of FIGS. 18 and 19 occurred at
time=0. The histograms and raster plots shows 200 ms before and 800
ms after the stimulus for comparison of the impulse rate
immediately after stimulation.
iii) Extracellular GABA And Glu Concentrations in Substantia Nigra
Microdialysis During STN Stimulation
[0222] The current data show a significant increase in
extracellular GABA in GAD65 transduced compared to naive rats
following low frequency stimulation of the STN. There was a
4.4.times. increase in mean GABA concentration during the first 15
min fractions after the LFS in GAD65 transduced group, compare to a
1.5.times. increase in naive control. An increasing extracellular
glutamate was also observed in both naive and GAD65 transduced
rats. FIG. 18A is a chart showing extracellular GABA concentration
in the SN during STN stimulation in naive rats (N=4). FIG. 18B is a
chart showing extracellular GABA concentration in the SN during STN
stimulation in rAAV-GAD rats (N=3) NB. ST1-2 min Low Freq Stim
ST2-5 min Low Freq Stim.
[0223] FIG. 19A-F is a photograph showing AAV-GAD65 expression in
vivo in naive and GAD65 transduced animals. A,B,C, and D; GAD65
expression in the STN detected with GAD65 Ab (Boehringer). A and C;
Naive STN, showing endogenous GAD65 expression. B and D; rAAV-GAD65
transduced STN, an increase in cell bodies expressing GAD65 is
seen. E and F; GAD65 expression in the hippocampus. E; naive. F;
rAAV-GAD65 transduced.
Example 7
In Vivo Primate Studies
[0224] Methods
[0225] (i) Subjects
[0226] Seven Rhesus monkeys were housed at the Biological Research
Laboratories at the University of Illinois. The monkeys were singly
housed in quarters with a 12-hour light/dark cycle. The animals
received food and water ad libitum. The study was performed in
accordance with federal guidelines of proper animal care and with
the approval of both Rush Presbyterian and University of Illinois
Animal Care Committees.
TABLE-US-00012 TABLE 5 Subjects of the present study. D.O.B: date
of birth. Weight corresponds to data obtained on the day of rAAV
surgery (see Table 6 for experimental groups and Table 7 for
progression of weight throughout the study) Monkey # D.O.B. Age Sex
Weight MPTP MRI rAAV Injection Necropsy 6436 July 1994 6 M 7.1 kg
Oct. 6, 1999 May 24, 2000 Sep. 29, 2000 Jan. 10, 2001 Nov. 18, 1999
Dec. 6, 1999 6442 July 1994 6 M 8 kg Oct. 6, 1999 May 24, 2000 Sep.
29, 2000 Jan. 10, 2001 Nov. 18, 1999 Dec. 6, 1999 6474 April 1993 7
M 5.9 kg Oct. 7, 1999 May 24, 2000 Sep. 29, 2000 Jan. 10, 2001 Nov.
18, 1999 Dec. 6, 1999 6485 November 1994 5 M 6.1 kg Oct. 7, 1999
May 24, 2000 Sep. 29, 2000 Jan. 10, 2001 Nov. 18, 1999 Dec. 6, 1999
6446 July 1994 6 M 7.5 kg Oct. 6, 1999 May 24, 2000 Sep. 29, 2000
planned Nov. 18, 1999 Jun. 29, 2001 Dec. 6, 1999 6469 February 1994
6 M 5.9 kg Oct. 6, 1999 May 24, 2000 Sep. 29, 2000 planned Nov. 18,
1999 Jun. 29, 2001 Dec. 6, 1999 6482 February 1994 6 M 6.6 kg Oct.
6, 1999 May 24, 2000 Sep. 29, 2000 planned Nov. 18, 1999 Jun. 29,
2001 Dec. 6, 1999
(ii) Behavioral Testing
Clinical Rating
[0227] A clinical rating scale (CR scale) was used monthly before
and after MPTP administration to quantitatively assess the clinical
status of the monkeys by using a previously validated measure
Kurlan et al. (1991) Ann Neurol. 29:677-9: Kurlan et al. (1991) Mov
Disord. 16:111-8; Jagust et al. (1997) Ann N Y Acad 826:254-62;
Emborg et al. (1998) J Comp Neurol. 401:253-65. All the ratings
were obtained from videotape records by a trained observer blind to
the treatment conditions. The scale consists of ratings of tremor
(0-3 for each arm), posture (0-2), gait (0-5), bradykinesia (0-5),
balance (0-2), gross motor skills (0-4 for each arm), defense
reaction (0-2) and freezing (0-2). The score was obtained as the
sum of the features out of a total of 32 points, 0 corresponds to
normal scoring and 32 to extreme severe disability. Occurrence of
dyskinesias, psychological disturbances and vomiting was also
recorded.
Activity Monitoring
[0228] Each monkey was tranquilized with ketamine (10 mg/kg, i.m.)
and fitted with a primate vest that contained a PAM2 activity
monitor (IM Systems, Baltimore, Md.; Emborg et al. (1998) Supra) in
the inside back pocket. These monitors measure acceleration. Every
time a monitor senses an acceleration that exceeds a threshold of
0.1 G, and electrical pulse is generated and recorded. Thus, each
pulse represents 234 msec. of acceleration above the 0.1 G
threshold. The number of pulses is expressed for a preselected time
period (1 min.).After one week period, the animals were again
tranquilized with ketamine (15 mg/kg, i.m.), the jacket was
removed, the activity monitor interfaced with a Macintosh computer
and the data was downloaded. The data was expressed as the mean of
each 12 hour light/dark cycle.
[0229] (iii) MRI Scanning (MRI)
[0230] All stereotaxic injections were performed under MRI
guidance. The MRI scans were performed in a 1.5 T Sigma Unit. The
animals were anesthetized with telazol (4-6 mg/kg, im) for
transportation and scanning. Atropine (0.02-0.04 mg/kg, s.c.) was
also administered. Vital signs were monitored throughout the
procedure and until waking up response. The animals were placed in
a MRI-compatible stereotaxic frame. Head orientation coordinates
were recorded in order to replicate the head position during
surgery. T1 and T2 weighed images were obtained, as well as a 3D
reconstruction with 1 mm thickness slices. The coronal zero was
identified by the location of ear bars that were filled with
vegetable oil.
[0231] (iii) Surgical Procedures
[0232] MPTP Treatment
[0233] Intracarotid injections of MPTP were performed according to
our previously published protocols Kordower (1994) Proc Natl Acad
Sci USA 91:10898-902; Emborg et al. (1994) Mol Chem Neuropathol
21:75-82; and Emborg et al. (1998) Supra. The monkeys were first
tranquilized with ketamine (10 mg/kg, i. m.) and then anesthesia
was induced and maintained with isofluorane (1-2%). Each animal
received prophylactic antibiotic treatment previous to the incision
(cefazolin 25 mg/kg i.v.).The animals were positioned in the supine
position with neck hyperextend and slightly turned left. Under
sterile conditions a number 15 blade was used to cut through the
skin along the medial edge of the esternocleidomastoide muscle. The
carotid sheath were opened using fine iris scissors and the common
carotid artery, internal jugular vein and vagus nerves identified.
The common carotid were exposed below the carotid bifurcation. Silk
(2.0) thread was looped around the common carotid artery while the
external carotid artery was identified with the superior thyroid
artery seen branching distal to the bifurcation and clamped. A 27-G
butterfly needle was inserted into the common carotid artery in a
direction retrograde to the direction of the blood flow, and 20 ml
of saline containing 3 mg of MPTP-HCL was infused at a rate of 1.33
ml/min. (15 min). After the infusion was completed, a 3 ml
post-flush of saline was delivered. The needle was withdrawn from
the carotid artery, and a small piece of Gelfoam was used to apply
focal pressure to the penetrated vessel. The musculature, SC
tissues and skin were then closed in a routine fashion. Buprenex
(0.01 mg/kg i.m.) was given upon waking up response and 24 hours
post surgery.
[0234] rAAV Injections
[0235] At least 6 months post last unilateral intracarotid MPTP
administration (see Table 6) the animals received AAV intracerebral
injections. Monkeys were intubated and anesthetized with
isofluorane (1-2%). The monkeys were placed in the stereotaxic
frame in the same orientation used during the MRI scans. Under
sterile conditions, a coronal incision was made over the scalp.
Entry point was identified according to its distance from the
MRI-calculated zero mark, then an entry hole was drilled. The
exposure of the superior sagittal sinus served as the midline zero.
Before loading the vector in the syringe, a 20% solution of
mannitol was drawn. The vector was drawn after vortexing the vial
for few seconds before injection. The vector was combined in a
proportion of 1 part virus+1/2 part mannitol 20% (e.g.: 10 .mu.l
AAV+5 .mu.l mannitol). Measurement of cortical surface was recorded
and the Hamilton syringe was lowered to the target. The infusion of
the vector was performed with an infusion pump attached to the
stereotaxic micromanipulator. The rate of infusion was 1.0
.mu.l/min. After the injection was completed, we waited 3 minutes
before retrieving the syringe. The needle gauge was: 22 S (25 .mu.l
and 50 .mu.l syringes according to final total volume, models 1701
and 1705 Hamilton syringes with removable needles and teflon tip
plungers). The target was the subthalamic nucleus, ipsilateral to
the intracarotid MPTP infusion. Identical infusion procedures were
employed for experimental and control animals. Following the
injections, the burr holes were filled with Gelfoam and the skin
was closed in anatomical layers. Analgesics (buprenex, 0.01 mg/kg
i.m.) were administered upon waking up response and 24 hours post
surgery. Prophylactic antibiotic treatment was avoided to prevent
possible interaction with lentiviral transfection.
TABLE-US-00013 TABLE 6 Stereotaxic coordinates (based on MRI
measurements) and experimental groups. Injection site: right
subthalamic nucleus. AP 0 corresponds to the MRI image where the
ear bars of the stereotaxic frame were present. ML 0 corresponds to
the sagittal sinus. Monkey # 6436 6442 6446 6469 6474 6482 6485
rAAV Vector GFP GFP GAD65 GAD65 GAD65 GAD67 GAD67 Vector Volume 20
.mu.l 10 .mu.l 20 .mu.l 10 .mu.l 10 .mu.l 10 .mu.l 10 .mu.l
Mannitol Volume 5 .mu.l 5 .mu.l 10 .mu.l 5 .mu.l 5 .mu.l 5 .mu.l 5
.mu.l ANTEROSTERIOR(AP) 12 13 12 9 10 12 12 MEDIOLATERAL (ML) 7 8 9
8 7 5 6 DORSOVENTRAL(DV) 29 28 25 31 28 30 32 MRI-AP 0 S 1.1 S 0.9
S 2.3 S 1.1 S 1.4 I 0.4 S 1.6
(iv) Necropsy, Preparation of Tissue
[0236] Three months rAAV infusions, 4 monkeys (see Table 5) were
anesthetized with pentobarbital (25 mg/kg, iv.) and perfused
transcardially (previous intraventricular injection of 1 ml of
heparin) with normal saline (300 ml) followed by 4% Zamboni's
fixative (400 ml). The brains were then immersed in a 4% Zamboni's
fixative for 48 hours of post-fixation, cryoprotected by immersion
in a graded (10-40%) sucrose/0.1 M phosphate buffered saline (PBS,
pH 7.2) solution. The brains were cut frozen (40 .mu.m) on a
sliding knife microtome. All the sections were stored in a
cryoprotectant solution before processing.
[0237] Samples of fluids and tissue were obtained for analysis of
unspecific side effects or propagation of viral particles. Serum
samples were obtained previous to necropsy procedure. Before
Zamboni's fixative was perfused samples of heart, liver, kidney,
striate muscle and testicle were obtained and immediately frozen
for posterior PCR analysis of AAV presence. Additional kidney and
liver samples were obtained and postfixated in Zamboni's for
histopathology.
[0238] (v) Immunohistochemistry
[0239] Sections through midbrain and striatum were used for
immunohistochemical staining of TH and GAD according to our
previously published protocol. Endogenous peroxidase activity was
removed with a 20 minute incubation in 0.1 M sodium periodate.
After 3.times.10 minute washes in PBS plus 0.05% Triton-X (dilution
media) background staining were blocked with a 1 hour incubation in
a Tris buffered saline solution containing 3% normal horse serum,
2% bovine serum albumin, and 0.05% Triton X-100. The sections were
then incubated with a monoclonal TH (1:20,000); Chemicon Inc., CA)
primary antibody for 48 hours at room temperature. Sections were
then incubated for 1 hour in horse antimouse (TH) biotinylated
secondary antibodies (1:100; Vector Laboratories, Burlingame,
Calif.). After 12.times.10 minute washes in dilution media, the
sections were placed in the avidin biotin (ABC, "Elite" kit, Vector
Laboratories) substrate (1:1,000) for 75 minutes. sections were
then washed in a 0.1 M imidazole/1.0 M acetate buffer, pH 7.4, and
then reacted in a chromagen solution containing 0.05%
3,3'-diaminobenzidine, and 0.05% H.sub.2O.sub.2.
[0240] Controls consisted of processing tissue in an identical
manner except for by using the primary antibody solvent or an
irrelevant immunoglobulin G (IgG) in lieu of the primary antibody.
sections were mounted on gelatin-coated slides, dehydrated, and
coverslipped with Permount.
[0241] Additional sections were mounted and coverslipped with DPX
for observation of GFP fluorescence with ultraviolet light.
[0242] Results
[0243] (i) General Observations
[0244] All animals tolerated the MPTP lesion and AAV injections
without complications. The animals increased or maintained their
weight throughout the study and did not display evidence of nausea,
vomiting, diarrhea, signs of weakness, fever or infection.
Throughout the study, they were cooperative during test sessions
and responsive to food stimuli (See Table 7 below).
TABLE-US-00014 TABLE 7 Animal weights throughout the course of the
study. Last MPTP rAAV surgery sac/present Monkey # surgery (Kg.)
(Kg.) (Kg.) 6436 6 7.1 7.2 6442 7.1 8 8.4 6474 5.2 5.9 6.6 6485 4
6.1 6.1 6446 6.5 7.5 7.4 6469 5.9 5.9 6.9 6482 5.1 6.6 7.2 The
sac/present weight column corresponds to the weight at the time of
sacrifice for monkeys 6436, 6442, 6474 and 6485. Animals 6446, 6469
and 6482 remain alive.
[0245] (ii) Clinical Rating
[0246] Prior to the administration of MPTP all the animals
displayed behavior indicative of normal young adult male Rhesus
monkeys. They were fast with steady movements and did not show any
neurological impairment. As assessed using the rating scale, all
the animals scored 0 in the pre-MPTP condition. There were no
changes in clinical rating scores during the two weeks period prior
to MPTP treatment.
[0247] After the intracarotid MPTP infusion, there was significant
variability in the parkinsonian status of the animals and to
further their motor impairments ice. MPTP infusions were repeated.
After the third MPTP some animals appeared mildly hemiparkinsonian,
while one animal in particular (6474) appeared severely
hemiparkinsonian, presenting tremor, flexed posture and impaired
motor skills in the hand contralateral to the infusion, as well as
balance disturbance, stooped posture, bradykinesia and slow
spontaneous circling ipsilateral to the lesion side (see Table
8).
[0248] The animals recovered from the rAAV surgery uneventfully.
Two monkeys showed moderate improvement in their clinical score.
Interestingly, 6446 that received the highest total volume of
vector and mannitol improved his score. Another monkey, 6485 also
showed some improvement. The rest of the animals did not show
significant changes.
TABLE-US-00015 TABLE 8 Clinical Rating Score Treatment Monkey # Pre
Post 1 Post 2 Post 3 GFP 6436 7.5 7.5 8 7.5 6442 8 6.5 7 7 GAD65
6446 7.5 7.5 5 5.5 20 + 10 GAD65 6469 5.5 4.5 5.5 5.5 10 + 5 6474
11 10 11.5 10 GAD67 6482 5.5 4 5 5 10 + 5 6485 6.5 4 4 4.5
[0249] (iii) Activity
[0250] Prior to any treatment, spontaneous general activity levels
in the home cage measured with personal activity monitors located
in primate jackets were similar to what was observed in previous
studies. As observed in the clinical rating, after MPTP treatment
the animals presented variable activity levels during the day.
FIGS. 20A and 20B are rasterplots showing activity before (A) and
after (B) GAD67 treatment (monkey 6482). Observe the presence of
hills and valleys corresponding to the activity during the day and
night respectively. In all the cases, a circadian rhythm was
observed and remained unaffected after AAV surgery (FIG. 20).
[0251] In general, the animals' activity during the day decreased
after MPTP treatment. After AAV surgery, the activity of two
animals that received GAD67 was increased (Table 9).
TABLE-US-00016 TABLE 9 Activity recorded with personal monitors.
Pre Post 1 Post 2 Post 3 Treatment Monkey # Mean SE Mean SE Mean SE
Mean SE DAY GFP 6436 7.17 2.09 7.93 1.01 7.14 1.54 7.54 0.46 6442
29.65 9.9 18.45 5.13 14.61 0.47 13.24 0.78 GAD65 6446 5.94 0.75
4.96 0.51 6.32 1.07 4.13 0.47 20 + 10 GAD65 6469 12.45 2.14 11.5
3.02 10.83 3.43 12.74 1.72 10 + 5 6474 13.96 2.71 13.16 1.25 10.22
0.99 7.61 1.43 GAD67 6482 8.23 1.67 5.63 0.98 5.78 1.17 25.89 1.71
10 + 5 6485 21.17 6.13 28.24 0.96 46.72 2.61 32.61 1.49 NIGHT GFP
6436 3.91 1.03 2 0.48 2.19 0.25 2.26 0.16 6442 3.85 0.33 4.29 1.47
3.18 0.16 2.5 0.2 GAD65 6446 1.12 0.33 1.3 0.1 1.9 0.36 0.71 0.11
20 + 10 GAD65 6469 2.7 0.69 3.02 0.82 2.7 0.65 2.2 0.76 10 + 5 6474
2.5 0.31 3.18 0.76 2.17 0.15 1.43 0.09 GAD67 6482 3.07 0.67 2.06
0.34 1.76 0.19 4.5 0.66 10 + 5 6485 1.29 0.59 0.68 0.02 0.64 0.11
0.59 0.09
[0252] (iv) TH Immunostaining
[0253] Sections through the midbrain showed varying degrees of
degeneration of TH-immunoreactive neurons within the substantia
nigra pars compacta ipsilateral to the intracarotid MPTP infusion.
Rhesus 6474, displayed a comprehensive loss of TH-ir neurons within
the central and ventrolateral portions of the A9 region while A10
ventral tegmental area was minimally affected. In addition, severe
loss of TH-ir positive fibers in the caudate and putamen was also
observed. Three of the 4 animals (Rh # 6436, 6442, 6482) displayed
minimal neuronal degeneration within the substantia nigra pars
compacta as well as a mild decrease of TH immunostaining in the
striatum ipsilateral to the side of MPTP intracarotid infusion.
[0254] These findings corresponded to the data obtained with the
clinical ratings scale, e.g. Rh 6474 presented severe parkinsonism
(higher score in the rating scale) and had the most extensive loss
of TH positive cells and fibers in the nigrostriatal system.
[0255] (v) GFP Immunoflourescence
[0256] rAAV-GFP treated monkeys (6436 and 6442) presented GFP
positive cells limited to the subthalamic nucleus ipsilateral to
the rAAV injection. The cell bodies were easily identified and
limited in number to 6-10 positive neuron-like cells per animal. In
contrast, no monkeys receiving rAAV-GAD presented GFP positive
cells. FIGS. 21A and 21B are photographs of GFP immunostaining at
injection site (GFP antibody from Clontech Palo Alto Calif.). FIG.
22 is a more detailed image of FIG. 17, showing neuronal-like cells
stained with GFP antibody in (A), while glial-like cells stained
with GFP antibody are shown in (B).
[0257] (vi) GAD Immunostaining
[0258] rAAV-GFP and rAAV-GAD treated animals did not show signs of
anatomical disruption in the area of injection and the neurons
presented a normal morphology. In the rAAV-GFP treated animals
(6442 and 6436) GAD was observed where is normally found in areas
such as the substantia nigra pars reticulata, striatum, thalamus
and cerebral cortex. The immunostaining did not show differences
between the AAV-GFP treated side and the untreated one.
[0259] In comparison, rAAV-GAD treated animals showed increase GAD
staining in the subthalamic nucleus ipsilateral to the AAV
injection. Rh 6474 (GAD65) presented only a mild increase of GAD
positive fibers. However, Rh 6485 (GAD67) displayed robust
expression of GAD distributed throughout the neuropil of the
subthalamic and immediately adjacent area. FIG. 23 is a photograph
of GAD immunostaining on rAAV-GAD treated monkey. There is an
increase in immunostaining on the rAAV-GAD treated side on the
right. The morphology of the region remained unaltered after
surgery.
[0260] The experimental results appear to demonstrate that the MPTP
lesion induced in most of the animals a mild parkinsonian syndrome.
In three of the four animals that underwent postmortem evaluation,
the dopaminergic marker TH revealed minimal neuronal degeneration
within the substantia nigra pars compacta as well as a mild
decrease of TH immunostaining in the striatum ipsilateral to the
side of MPTP intracarotid infusion.
[0261] The AAV surgery did not further impair the animals. The
monkeys maintained or increased their body weight throughout the
study, their circadian rhythm remained intact (as measured by the
activity monitors) and the animals did not show signs of unspecific
neurological dysfunction, or infection.
[0262] Behaviorally, 6446 (GAD65 20+10) 6485 (GAD67 10+5) showed
moderate improvements in their Parkinsonian signs as measured by
the clinical rating scale. The activity increased in the two
animals that received GAD67. Histologically, only rAAV-GFP monkeys
presented GFP immunofluorescence in 6-10 cells, in the subthalamic
nucleus ipsilateral to the rAAV injection. rAAV-GAD treated animals
displayed mild to strong increase GAD expression in the subthalamic
nucleus
[0263] Collectively, these results demonstrate the phenotypic
correction of Parkinsonian rats following stereotactic injection of
rAAV expressing glutamic acid decarboxylase 65 and 67 into the
subthalamic nucleus. Hemiparkinsonian rats were generated by
unilateral 6-hydroxydopamine (6-OHDA) lesioning of the median
forebrain bundle. The 6-OHDA lesion induced ipsilateral bias in
head position and rotational asymmetry, as well as forepaw touching
and locomotor activity decreasing were used as quantitative markers
of the PD phenotype. In order to inhibit STN activity, high titer
recombinant AAV vectors expressing human glutamic acid
decarboxylase (GAD65/67) were generated and stereotactically
injected into ipsilateral STN. Expression of the transgenic human
GAD65/67 mRNA and proteins were detected by real time quantitative
RT-PCR and immunocytochemistry. Using in vivo microdialysis, the
extracellular GABA and glutamate in the SN in response to STN low
frequency stimulation (STN-LFS) was evaluated. In chronically
(aged) PD rats administered rAAVGAD65/67 intraSTN, rotational
asymmetry was alleviated and forepaw touching and locomotor
activity were improved. Of interest, in rats administered
rAAVGAD65/67 vectors into the STN prior to the MFB 6-OHDA lesion,
all asymmetries were markedly improved with the behavioral
phenotype approaching those of normal animals. Microdialysis data
also show a significant increase of extracellular GABA in GAD
transduced rats compared to normal rats following STN-LFS. These
results suggest that transduction of GAD isoforms into the STN
using rAAV vector can inhibit the overactivity of target neurons in
PD rats and may provide for strong protection against neurotoxic
insults to dopaminergic neurons.
Example 8
GAD65 Transduction of the Subthalamic Nucleus Changes the Action of
Excitatory Projections to the Substantia Nigra
[0264] This example demonstrates the change in excitatory
projections to the substantia nigra (STN). The subthalamic nucleus
has a prominent excitatory connection with the substantia nigra
(SN). In Parkinson's disease, overactivity in the STN leads to
progressive degeneration of dopamine neurons in the SN, as well as
the common features of Parkinsonism such as tremor, rigidity and
bradykinesia.
[0265] The SN of normal rats and rats treated with the recombined
associate adenovirus (rAAV) containing the gene for human glutamic
acid decarboxylase 65 (rAAV CBA-hGAD65), which converts glutamate
to GABA in neurons were used to perform extracellular
electrophysiology and microdialysis. The medial forebrain bundle
was lesioned after the virus was injected into the STN to model
PD.
[0266] Results from extracellular recordings of the SN during STN
stimulation in normal rats (n=4) revealed 78% (n=14/19 neurons)
excitatory responses, 5% (n=1/19) inhibitory, and 21% (n=4/19) had
no response. In GAD transduced rats (n=5), the results showed 17%
(n=3/18 neurons) with excitatory responses, 78% (n=14/18) with
inhibitory and 5% (n=1/18) had no response. Microdialysis
experiments detected a 4.4.times. increase in mean GABA
concentration in the SN of GAD transduced rats (n=4) during low
frequency (10 Hz, 5') electrical stimulation of the STN, compared
to a 1.5.times. increase in control rats (n=3).
[0267] These experiments demonstrate that GAD transduction of
neurons in the STN increases inhibition in the SN and decreases the
excitatory effect of STN stimulation on neurons in the SN which may
alleviate the symptoms of PD. This demonstrates that changing the
excitatory projection from the STN to the SN into an inhibitory
projection, using a gene therapy approach, alleviates the symptoms
of PD.
Example 9
Epilepsy Studies
A. Vectors for Epilepsy
[0268] This examples describes the construction of a vector for use
in delivering GAD to a subject with epilepsy. A 2.0 kb full length
human GAD65 cDNA was obtained from A. Tobin (UCLA), which is 400 bp
shorter than the corresponding rat GAD65 cDNA. The pBS II
SK+/hGAD65(2.0) was digested with Ecl136II (isoschizomer of Sad)
and EcoRI to release a 2 kb hGAD65 fragment which was inserted into
NotI (blunt) and EcoRI of AAV/NSE-pl-WPRE-BGH. The rat and human
GAD65 proteins are 96% identical at the amino acid level, therefore
the assumption was made that human GAD65 would be functional in the
rat brain. The total size of this expression cassette including the
ITRs is 5.1 kb. In addition to the 2.0 kb GAD65 cDNA (which
includes flanking untranslated regions at the 5' and 3' ends), a
1.76 kb portion of the human GAD65 cDNA which consists of just the
coding region, was PCR amplified with the hGAD65for primer
ATATATCTCGAGATGGCATCTCCGGGCTC (SEQ ID NO: 18) and hGAD65rev primer
GCGCGCGAATTCCTTATAAATCTTGTCCAAGGCG (SEQ ID NO: 19) and inserted
into the AAV/NSE-pl-WPRE-BGH cassette (FIG. 24A). The
AAV/NSE-hGAD65(2.0)-WPRE-BGH and AAV/NSE-hGAD65(1.76)-WPRE-BGH
cassettes, at 5.1 kb and 4.86 kb were 109% and 104% of wild-type
size, respectively. Transfection of each plasmid into HEK293 cells
facilitated robust GAD65 expression with a similar overall number
of GAD65 immuno-positive cells as observed after transfection of
the AAV/NSE-rGAD65 (2.4)-WPRE-BGH plasmid (FIG. 24B).
[0269] Another vector that was constructed was the CBA-GAD65
plasmid. In this plasmid, the CMV enhancer/chicken
.E-backward.-actin (CBA) promoter was demonstrated to drive a high
level of stable constitutive, AAV-mediated expression of human V-1
anti trypsin (hAAT) in the liver, which was 9.5 and 137-fold higher
than that driven by EF-1V and CMV, respectively (Xu et al, (2001a)
Hum Gene Ther. 12:563-73).
[0270] The CBA promoter (derived from pBACMAM3, nt 945-1885,
Novagen) was obtained and cloned into the AAV/hGAD65(1.76)-WPRE-BGH
cassette to produce AAV/CBA-hGAD65(1.76)-WPRE-BGH (FIG. 25A). This
plasmid was verified to express GAD65 in 293 cells at a similar
level to AAV/CMV-rGAD65-WPRE-BGH (FIG. 25B). A corresponding EGFP
cassette, AAV/CBA-EGFP-WPRE-BGH was constructed (FIG. 25A), which
also expressed a high level of EGFP expression in HEK293 cells
(FIG. 25C). AAV vectors containing the GAD65 and EGFP expression
cassettes were packaged with titres of 7.times.10.sup.11 and
2.8.times.10.sup.12, respectively. 1.times.10.sup.10 particles of
each vector were applied to 293 cells, which were then processed
for immunocytochemistry after three days. Strong GAD65 expression
was detected with the transduction efficiency similar to that of
AAV/CMV-rGAD65-WPRE-BGH (FIG. 25B).
[0271] After successful packaging of the AAV/CBA-hGAD65-WPRE-BGH
vector, the corresponding GAD67 transgene cassette was constructed.
An AAV vector mediating expression of GAD67 was desired in addition
to GAD65 in order to compare the relative contribution of each GAD
isoform to GABA synthesis and seizure modulation. A 1.78 kb human
GAD67 clone containing the GAD67 open reading frame was PCR
amplified from a 2.0 kb human GAD67 cDNA (obtained from A. Tobin,
UCLA) with the hGAD67for primer TATATCTCGAGACGTCTTCGACCCCA (SEQ ID
NO:20) and hGAD67rev primer CAGCTGAATTCTTACAGATCCTGGCCCAG (SEQ ID
NO:21) and inserted into the AAV/CBA-pl-WPRE-BGH to produce
AAV/CBA-hGAD67(1.78)-WPRE-BGH (FIG. 25D). The 1.76 kb GAD67
transgene was fully sequenced and found to have no errors
incorporated during the PCR amplification. Transfection of this
plasmid into HEK293 cells resulted in robust GAD67 expression (as
determined by immunocytochemistry) at a level comparable to that of
GAD65. AAV/CBA-hGAD67(1.78)-WPRE-BGH virus was packaged, with a
titre of 1.times.10.sup.10 and infection of HEK293 cells with
1.times.10 particles resulted in strong GAD67 expression (FIG.
25E).
B. Confirmation of GABA synthesis in vitro
[0272] Once functional AAV vectors that mediated GAD65 expression
in vitro had been packaged, characterisation of the GAD65 protein
was required to show that the enzyme was functional prior to
embarking on in vivo studies. AAV/CBA-hGAD65(1.76)-WPRE-BGH and
AAV/CBA-hGAD67-WPRE-BGH vectors were applied to C17.2 mouse
neuronal progenitor cells. This cell line does not endogenously
produce GAD65 or GAD67. Transduction of C17.2 cells with either the
GAD65 or GAD67 vector resulted in expression of GAD and synthesis
of GABA (FIG. 26A). To determine relative levels of GABA produced
from each isoform, C17.2 cells were infected with the GAD and EGFP
vectors. Three days following infection, the cells were incubated
in artificial cerebrospinal fluid for five minutes, which was
collected and then subject to HPLC to measure the level of GABA. An
increase in GABA of three-fold and 4.5-fold over background was
measured for GAD65 and GAD67 respectively (FIG. 26B). These data
confirm that the two GAD isoforms act as functional enzymes when
expressed in cell culture and catalyse the synthesis of appreciable
levels of GABA.
C. Modification of the AAV/GAD Vectors for Gene Transfer into the
Hippocampus
[0273] One additional modification was made to the GAD65 and GAD67
transgene cassettes for optimisation of their use in this study on
the effect of GAD over-expression in the hippocampus. The
hippocampus contains endogenous GAD of which a high proportion is
expressed in axon terminals with minimal expression in cell bodies,
therefore it was expected that visualization of the level of
expression of GAD in particular cell types might be extremely
difficult to distinguish from endogenous GAD. Addition of an
epitope tag allows the transgene protein to be distinguished from
the endogenous gene by immunohistochemistry with an antibody
specific to the epitope. The hemagglutinin (HA) epitope was
selected for fusion onto the N-terminus of GAD as this had been
successfully used in our laboratory to tag a protein on its
N-terminus, and the antibody shows high affinity for its epitope
with minimal background.
[0274] The 1.76 kb GAD65 and 1.78 kb GAD67 open reading frames were
PCR amplified to remove the start codons with primers HA-hGAD65for
ATATATGAATTCGCATCTCCGGCTCTGG (SEQ ID NO: 22) and hGAD65rev
GCGCGCGAATTCCTTATAAATCTTGTCCAAGGCG (SEQ ID NO: 23) (for GAD65
amplification) and HA-hGAD67for GCCGGAATTCGCGTCCTTCGACCCCATC (SEQ
ID NO: 24) and hGAD67rev CAGCTGAATTCTTACAGATCCTGGCCCAG (SEQ ID NO:
25) (for GAD67 amplification) and inserted in frame with an
N-terminal HA tag downstream of the CBA promoter (FIG. 27A). Both
transgenes were fully sequenced to determine whether errors were
incorporated during PCR amplification. No base changes were found
in the GAD67 open reading frame, however a nucleotide substitution
from thymine (T) to cytosine (C) was detected in the GAD65 open
reading frame. This substitution changes the codon at amino acid
354 (GenBank accession M81882) from TGT to TGC, however both these
codons encode a cysteine residue hence no alteration to the protein
occurred.
[0275] Transfection of the plasmids into HEK293 cells resulted in
strong expression that was detected with both the HA antibody as
well as antibodies to the appropriate GAD isoform (FIG. 27B). AAV
vectors were packaged and titered. The physical titres for
AAV/CBA-HA-hGAD65(1.76)-WPRE-BGH, AAV/CBA-HA-hGAD67(1.78)-WPREBGH
and AAV/CBA-EGFP-WPRE-BGH were determined by ELISA to be
2.times.10.sup.12, 3.times.10.sup.12 and 3.times.10.sup.12
genomes/ml, respectively and the genomic titres were determined by
quantitative PCR to be 2.times.10.sup.10, 3.times.10.sup.10 and
3.times.10.sup.10 genomes/ml, respectively. AAV-mediated transgene
expression was confirmed in HEK293 cells (FIG. 27B) and in
addition, after transduction of C 17.2 cells both plasmids
facilitated production of GABA, demonstrating that addition of the
tag did not interrupt enzyme activity (FIG. 27C). The names of the
AAV vectors were simplified to AAVGAD65, AAVGAD67 and AAVEGFP for
the rest of this study.
D. AAV-Mediated Gene Expression in the Rat Hippocampus
[0276] Three groups of twelve rats were required, which were to be
injected with the three AAV vectors. A fourth sham group which was
subject to injection with an empty needle was included to control
for injury related to insertion of a needle into the brain tissue.
For the first three groups that were administered AAV vectors, 2:1
of AAV vector matched to a genomic titre of 2.times.10.sup.10
genomes/ml was infused bilaterally into the rat hippocampus. AAV
mediated gene transfer leads to stable and long-term neuronal gene
expression that is maximal by approximately weeks after injection
(Xu et al., 2001b). A subset of animals from each treatment group
was sacrificed five weeks after AAV injection for analysis of
transgene expression.
E. Characterization of EGFP expression
[0277] After sacrifice, perfusion and cryoprotection, brains of
AAVEGFP-treated rats were cryosectioned into 40 .mu.lm sections and
every sixth section through the hippocampus was mounted for
analysis of EGFP expression. Robust EGFP expression was observed in
the dorsal hippocampus with expression spreading approximately one
millimeter in both the rostral-caudal and medial-lateral axis from
the needle tract (FIG. 28). Representative expression from three
rats is displayed (FIG. 28 A,D,G). EGFP protein was detected in the
cell body, axons and dendrites of hilar interneurons with fibre
staining present in the dentate gyrus and the molecular layer (FIG.
28 B,E,H). A small proportion of dentate granule cells expressed
EGFP throughout the cell somata, axons and dendrites (arrows in
FIG. 28 B,E,H).
[0278] A high level of expression was also detected in pyramidal
cells of CAI field (FIG. 28 C,F). The vector was not directly
injected into the CA1 subfield however the needle passed through
this layer as it was lowered into the hilus, which may have allowed
virus to track up the needle tract to transduce this cell layer.
The strong immunoreactivity in these cells indicates that AAV2 may
have a strong tropism for pyramidal cells. No EGFP expression was
detected in rats transduced with either AAVGAD65 or AAVGAD67
(representative control section shown in (FIG. 28).
[0279] Immunohistochemistry with antibodies to cell-type specific
markers were used to characterise the cell populations transduced
by the vector (FIG. 28). All pyramidal cells, granule cells and
hilar neurons that expressed EGFP were co-labeled with NeuN, a
marker of mature neurons, (FIG. 29 A,B,C,D) and no EGFP expressing
cells co-labeled with the astrocytic marker GFAP (FIG. 29 E,F). In
the hilus, the majority of EGFP expressing interneurons co-labeled
with a vesicular GABA transporter (VGAT) (FIG. 29 G,H and higher
magnification in K,L) which is a marker of GABAergic cells. A small
number of EGFP expressing cells that did not co-label with VGAT
were observed. These may be glutamatergic mossy cells or other
classes of interneurons. Labeling with parvalbumin (FIG. 29 I,J),
neuropeptide Y (NPY, FIG. 29 M,N) or somatostatin (FIG. 29 O,P),
revealed transduction of different classes of GABAergic neurons. A
small proportion of EGFP expressing cells contained parvalbumin or
somatostatin whereas the majority contained NPY.
F. Characterization of GAD Expression
(a) Characterization of HA-GAD65 Expression
[0280] Hippocampal sections from AAVGAD65 transduced rats were
processed for antiGAD65 immunohistochemistry (FIG. 30). AAVGAD65
expression was detected approximately one-half to one millimeter
throughout the dorsal hippocampus surrounding the needle tract
(FIG. 30A). Similar patterns of transgene expression to that found
with AAVEGFP was observed, with AAVGAD65 expression present in cell
bodies of hilar interneurons (FIG. 30B) and CA1 pyramidal cells
(FIG. 30C), however the extent of transgene expression could not be
clearly observed due to the high level of endogenous GAD65 (FIG. 30
D,E,F).
[0281] Anti-HA immunohistochemistry against the HA epitope tag (at
the 5' terminus of the recombinant GAD65 protein) is presented from
three representative hippocampi (FIG. 30 G,J,M). HA expression was
observed in the somata of interneurons and in terminals in the
outer third of the molecular layer and surrounding the granule cell
layer (FIG. 30 H,K,I,L). HA-GAD65 expression within the cell body
appeared cytoplasmic with a halo of GAD65 expression surrounding
the nucleus (arrows in FIG. 30 K,L). HA-GAD65 expression was also
present in CA1 pyramidal cells and corresponding fibre projections
in the stratum radiatum and stratum oriens contained HA-GAD65 (FIG.
30 N,O). A much higher level of GAD protein was present in axon
fibres compared with that in the cell bodies, a pattern similar to
that described for endogenous GAD65 (Esclapez and Houser, (1999) J
Comp Neurol. 412:488-505). No GAD expressing cells that showed
morphological characteristics of mossy cells were observed. On
average fewer dentate granule cells expressed HA-GAD65 than EGFP
(compare FIG. 30 H,I,K,L to B,E,H) suggesting a difference in the
regulation or stability of EGFP versus GAD65.
[0282] Unilateral injection of AAVGAD65 (FIG. 30 Q) allowed the
visualization of GAD65-immunoreactivity in the inner third of the
molecular layer of the contralateral hemisphere due to anterograde
transport of GAD protein in commissural fibres (FIG. 30 R). These
projections have been determined by retrograde tracing to originate
from GABAergic interneurons in the hilus and granule cell layer and
from dentate hilar mossy cells (Zappone and Sloviter, (2001) J Comp
Neurol. 441:324-44).
[0283] No HA tagged GAD65 protein was detected in AAVEGFP or
AAVGAD67 injected animals (representative control section shown in
FIG. 30P).
(b) Characterization of HA-GAD67 Expression
[0284] The pattern of HA-GAD67 expression was very similar to that
of HA-GAD65 and GFP with transduction of CA1 pyramidal cells, hilar
neurons and a small number of dentate granule cells (FIG. 31A, D).
Transgene expression extended approximately one-half to one
millimeter throughout the dorsal hippocampus surrounding the needle
tract. In contrast to GAD65 transgene expression, the GAD67
transgene expression was easily detected over endogenous GAD67
(compare FIGS. 31A and D to G). A high level of GAD67 expression
was detected in hilar interneurons with strong cytoplasmic staining
surrounding the nucleus (FIG. 31 B,E). Expression of GAD67 in CA1
pyramidal cells was also at a level high enough to be distinguished
over endogenous GAD67 (compare FIGS. 31C and F to I).
[0285] Anti-HA immunohistochemistry showed a large amount of
intensely stained cell bodies in the hilus with fibres projecting
within the hilus and to the molecular and granule cell layers (FIG.
31 J,M,K,N). When AAVGAD67 expression is compared with that of
AAVGAD65 (Compare FIG. 31 J,M with G,J,M) many more HA positive
cell bodies are seen in the GAD67 sections than in the GAD65
sections, however the HAGAD65 fibre staining is not proportionally
increased in intensity. This suggests that the HA-GAD67 is
concentrated more highly in cell bodies than HA-GAD65, whereas more
of the HA-GAD65 is transported to the fibres and terminals. This is
supported by the low level of GAD positive cell bodies detected in
the HA-GAD65 brains with the GAD65 antibody. This pattern of
transgene staining is reflective of that of endogenous GAD65 and
GAD67 protein transport (where GAD65 is mostly concentrated in the
fibres and terminals and GAD67 is more highly concentrated in the
cell bodies), which suggests that the recombinant proteins are
being post-translationally regulated in a similar way to the
endogenous proteins.
[0286] Anti-HA immunostaining of CA1 pyramidal cells showed
expression in the cytoplasm of the cell bodies and in the dendrites
and axons projecting into the stratum oriens and stratum radiatum
(FIG. 31 L,O). No HA tagged GAD67 protein was detected in AAVEGFP
or AAVGAD65 injected animals (representative control section shown
in FIG. 31 P,Q,R).
G. Behavioural Testing
(1) Kainic Acid Model of Experimental Epilepsy
[0287] The kainic acid model is a very well characterised and
established model of experimental temporal lobe epilepsy. It has
been used extensively for evaluation of anti-seizure drugs due to
the simple, non-invasive nature of the model, and because it
reproduces may of the pathological hallmarks of human seizures
(Sperk (1994) Prog Neurobiol. 42:1-32).
[0288] A subset of AAVEGFP, AAVGAD65 and AAVGAD67-injected animals
(four of the eight animals per groups) were implanted with bipolar
electrodes one week prior to kainic acid administration to confirm
that the seizure behaviors were represented by EEG activity. Each
rat was administered 10 mg/kg (i.p.) kainic acid and was observed
over the next ninety minutes for characteristic progression through
several seizure stages (n=8 animals per group). Shortly after
kainic acid administration, rats typically display staring and
immobility followed by facial clonus, uni- and bilateral forelimb
clonus. These behaviours were graded on a scale of 0-5 based on
previous publications (Zhang et al., (1997) Eur J Neurosci.
9:29-40) as follows: Stage 0--no seizures, stage 1--staring, stage
2--wet dog shakes, stage 3--unilateral forelimb clonus, stage
4--bilateral forelimb clonus, stage 5-rearing with falling.
[0289] AAVGAD65 and AAVGAD67 rats had the same number of wet dog
shakes as control rats (FIG. 32A). Unilateral forelimb clonus was
not significantly reduced, although there was a trend for AAVGAD65
rats to display a decrease (FIG. 32B, p=O.15). AAVGAD65 rats did
have significantly less bilateral forelimb clonus (FIG. 32C,
p=0.05). No GAD65 rat reached stage 5 (rearing and falling) or
developed status epilepticus over the ninety-minute test frame
(FIG. 32D). In total, 4/6 sham, 4/8 AAVGAD67 and 6/8 AAVEGFP rats
reached stage 5 seizures. Chi square analysis showed that there was
a significant reduction from the expected frequency of developing
stage 5 seizures (0.57 compared with 0, p<0.02). Representative
electroencephalograms are presented that show the EEG activity at
60-70 minutes after KA administration reflected the behavioral
observations (FIG. 33).
[0290] To determine whether the GAD65 animals had a similar number
of wet dog shakes as the other groups, but showed less seizure
activity in the later stages due to slower progression of seizures,
the latency for each animal to reach each seizure stage was also
determined. Since not all rats reached each seizure stage, the few
rats that did not reach stages 3, 4, or 5 were graded as having
taken the maximum ninety minutes to reach that seizure stage. There
was no difference in latency to reach any of the seizure stages
between the four groups (FIG. 34A-D). In conclusion, AAV-mediated
gene transfer of AAVGAD65 but not AAVGAD67 afforded a modest
protection against the later stages of KA-induced seizures.
[0291] (d) Quantification of Hippocampal Injury
[0292] Neuronal degeneration was measured by Fluoro-Jade staining.
Fluoro-Jade is an anionic fluorochrome that can selectively label
degenerating neurons (Schmued et al., (1997) Brain Res. 751:37-46).
A characteristic pattern of KA-induced severe cell loss in the
hilus and CA1 and CA3 subfields (Sperk, (1994) Supra) was observed
(FIG. 35), with CA2 pyramidal cells and dentate granule cells
mostly spared from injury.
[0293] Fluoro-Jade stained cells were counted in the CA1, CA2, CA3
subfields and the hilus of each rat. The level of injury correlated
with the level of seizure severity for each treatment group. No
Fluoro-Jade staining was observed in the hippocampi of any rats
that did not have seizures, however in each group there were
animals that displayed some seizure activity but no hippocampal
neuronal degeneration.
[0294] Four out of eight AAVGAD65, 4/8 AAVGAD67, 5/8 AAVEGFP and
4/6 sham rats showed neuronal degeneration in the CAL CA3 and
hilus. Of the rats that displayed injury, AAVGAD65 animals had
significantly less Fluoro-Jade positive cells in the hilus and CA3
subfield than controls (FIG. 36, p=0.04 and 0.05 respectively,
Kruskal Wallis), which corresponded to the decreased amount of
unilateral and bilateral forelimb clonus, and lack of status
epilepticus in the AAVGAD65 group.
[0295] Collectively these results demonstrate that administration
of vector carrying GAD to the hippocampus provides protection
against seizures.
EQUIVALENT
[0296] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein. Such equivalents are intended to be encompassed by the
following claims.
Sequence CWU 1
1
8129DNAHomo sapiens 1atatatctcg agatggcatc tccgggctc 29234DNAHomo
sapiens 2gcgcgcgaat tccttataaa tcttgtccaa ggcg 34326DNAHomo sapiens
3tatatctcga gacgtcttcg acccca 26429DNAHomo sapiens 4cagctgaatt
cttacagatc ctggcccag 29528DNAHomo sapiens 5atatatgaat tcgcatctcc
ggctctgg 28634DNAHomo sapiens 6gcgcgcgaat tccttataaa tcttgtccaa
ggcg 34728DNAHomo sapiens 7gccggaattc gcgtccttcg accccatc
28829DNAHomo sapiens 8cagctgaatt cttacagatc ctggcccag 29
* * * * *
References