U.S. patent application number 12/565629 was filed with the patent office on 2011-08-25 for smad7 inhibitor compositions and uses thereof.
Invention is credited to Rainer Apfel, Gerhard Giegerich, Markus Horn, Ingo Kleiter, Roland Kreutzer, Stefan Limmer, Andreas Steinbrecher, Hans-Peter Vornlocher.
Application Number | 20110207795 12/565629 |
Document ID | / |
Family ID | 8179155 |
Filed Date | 2011-08-25 |
United States Patent
Application |
20110207795 |
Kind Code |
A1 |
Steinbrecher; Andreas ; et
al. |
August 25, 2011 |
SMAD7 INHIBITOR COMPOSITIONS AND USES THEREOF
Abstract
The present invention relates to the use of a specific inhibitor
of Smad7 expression or function for the preparation of a
pharmaceutical composition for the prevention, amelioration or
treatment of a disease of the central nervous system and/or
diseases related and/or caused by said disease of the central
nervous system. Furthermore, methods for preventing, ameliorating
and/or treating such diseases are disclosed.
Inventors: |
Steinbrecher; Andreas;
(Regensburg, DE) ; Giegerich; Gerhard; (Kofering,
DE) ; Kleiter; Ingo; (Regensburg, DE) ; Horn;
Markus; (Sinzing, DE) ; Apfel; Rainer;
(Sinzing, DE) ; Kreutzer; Roland; (Weidenberg,
DE) ; Limmer; Stefan; (Kulmbach, DE) ;
Vornlocher; Hans-Peter; (Bayreuth, DE) |
Family ID: |
8179155 |
Appl. No.: |
12/565629 |
Filed: |
September 23, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10494333 |
Apr 30, 2004 |
7700572 |
|
|
PCT/EP02/12221 |
Oct 31, 2002 |
|
|
|
12565629 |
|
|
|
|
Current U.S.
Class: |
514/44A |
Current CPC
Class: |
A61K 2039/505 20130101;
A61P 25/00 20180101; C12N 15/113 20130101; C12N 2310/14 20130101;
A61K 38/00 20130101; C12N 2310/315 20130101; C12N 2310/53
20130101 |
Class at
Publication: |
514/44.A |
International
Class: |
A61K 31/7088 20060101
A61K031/7088; A61P 25/00 20060101 A61P025/00 |
Foreign Application Data
Date |
Code |
Application Number |
Nov 2, 2001 |
EP |
011 26 140.1 |
Claims
1.-6. (canceled)
7. A method for preventing, ameliorating and/or treating a disease
of the central nervous system, a disease of the central nervous
system and/or diseases related to and/or caused by said disease in
a subject comprising administering a specific inhibitor of Smad7
expression or function to a mammal in need thereof.
8. The method of claim 7, wherein said mammal is a human.
9. The method of claim 7, wherein said disease of the central
nervous system and/or diseases related and/or caused by said
disease of the central nervous system is an autoimmune disease of
the CNS, trauma or is cerebral ischemic stroke.
10. The method of claim 9, wherein said autoimmune disease of the
central nervous system is multiple sclerosis, relapsing-remitting
multiple sclerosis, secondary progressive multiple sclerosis,
primary chronic progressive multiple sclerosis, neuromyelitis
optica (Devic's syndrome) or fulminant multiple sclerosis
(Marburg's variant).
11. The method of claim 9, wherein said trauma is traumatic brain
injury (TBI) or traumatic spinal cord injury.
12. The method of claim 9, wherein said cerebral ischemic stroke is
focal cerebral ischemia, global cerebral ischemia or hypoxic
ischemic brain damage.
13. The method of claim 7, wherein said diseases related to and/or
caused by said disease of the central nervous system is selected
from the group consisting of diabetes (type 1), acute disseminated
encephalomyelitis, isolated autoimmune optic neuritis, isolated
autoimmune transverse myelitis or Balo's concentric sclerosis.
14. The method of claim 7, wherein said disease of the central
nervous system is a neurodegenerative disorder.
15. The method of claim 14, wherein said neurodegenerative disorder
is Alzheimer's disease or Parkinson's disease.
Description
[0001] This application is a continuation of U.S. Ser. No.
10/494,333, filed Apr. 30, 2004, now U.S. Pat. No. 7,700,572, which
is the national stage application of International (PCT) Patent
Application Serial No. PCT/EP2002/012221, filed Oct. 31, 2002,
which claims the benefit of priority to EP Application No.
01126140.1, filed Nov. 2, 2001; the entire disclosures of each
application are hereby incorporated by reference.
[0002] The present invention relates to the use of a specific
inhibitor of Smad7 expression or function for the preparation of a
pharmaceutical composition for the prevention, amelioration or
treatment of a disease of the central nervous system and/or
diseases related and/or caused by said disease of the central
nervous system. Furthermore, methods for preventing, ameliorating
and/or treating such diseases are disclosed.
[0003] Several documents are cited throughout the text of this
specification. The disclosure content of each of the documents
cited herein (including any manufacturer's specifications,
instructions, etc.) are hereby incorporated by reference.
[0004] The current model for the initiation of T cell-mediated
inflammatory disease of the CNS includes peripheral
antigen-specific T cell activation and Th1 differentiation (Martin,
1992; Miller, 1994; Zamvil, 1990). A peripheral T cell activation
step appears to be required for autoreactive T cells to enter the
CNS via the blood-brain barrier (Wekerle, 1986). The process of
lesion formation is further governed by a complex pattern of cyto-
and chemokine expression upon restimulation of autoreactive T cells
in situ (Hoffman, 1998; Karpus, 1999). It is widely accepted that
Th1 cells, critical for cell-mediated immunity by their production
of IL-2, IFN-gamma, TNF-alpha and lymphotoxin are involved in the
immunopathology of organ-specific autoimmune disease (Liblau, 1995;
Raine, 1995; Steinman, 1997). A role as regulators has been
suggested for Th2 cells (Mathisen, 1997; Nicholson, 1995; Racke,
1994) and cells producing Transforming-growth-factor-beta
(TGF-beta) (Chen, 1996; 1994; O'Garra, 1997; Weiner, 1994).
[0005] TGF-beta belongs to a family of peptides with pleiotropic
effects widely distributed throughout the body (Sporn, 1989) and in
particular in the immune system (Letterio, 1998). In addition to
the TGF-betas, bone morphogenetic proteins (BMP) and activin make
up the BMP-superfamily (Miyazono, 2001).
[0006] The three isotypic TGF-betas are extremely well conserved
across species with a greater than 99% identity between the mature
TGF-beta1 sequences of various mammalian species (Derynck, 1986;
1987). TGF-betas have important roles in cell growth and
differentiation, organ development, matrix formation, wound repair
and immune function (Blobe, 2000; Chen, 2001; Letterio, 2000).
[0007] TGF-beta regulates cellular processes by binding to three
high-affinity cell-surface receptors known as types I, II and III.
The type III receptors are the most abundant receptor type. They
bind TFG-beta and transfer it to its signaling receptors, the type
I (RI) and II (RII) receptors. Upon binding of a ligand to a type
II receptor, type II receptor kinases phosphorylate serine and
threonine residues within the intracellular GS
(glycine-serine-rich) domain of type I receptors, leading to
activation of the type I receptor. The activated TGF-betaRI then
interacts with an adaptor molecule SARA (Smad anchor for receptor
activation) (Tsukazaki, 1998), which facilitates the access of
particular members of the Smad family of proteins, called
receptor-regulated Smads (R-Smads) to activated TGF-beta receptors.
The activated type I receptor kinases then phosphorylate R-Smads
differentially at two serine residues at their extreme C termini
(summarized in Itoh, 2000). R-Smads include Smad1, -2, -5 and -8
proteins. Smad2 and -3 mediate the signaling of TGF-beta and
activins; and Smad8 mediates the signaling of ALK-2 receptor
kinases (Baker, 1996; Lagna, 1996; Liu, 1996; Zhang, 1996,
1997).
[0008] Inhibitory Smads (I-Smads) consist of vertebrate Smad6 and
Smad7 and Drosophila daughters against dpp (Dad). Unlike R-Smads,
which augment the signaling of TGF-beta molecules, I-Smads inhibit
TGF-beta superfamily signaling. Whereas Smad6 appears to inhibit
BMP signaling preferentially, Smad7 acts as a general inhibitor of
TGF-beta family signaling (Itoh, 1998; Souchelnytskyi, 1998;
Ishisaki, 1999). I-Smads can bind stably to the intracellular
domain of activated type I receptors, thereby inhibiting further
signal transduction by preventing the phosphorylation of R-Smads by
the receptor (Imamura, 1997; Inoue, 1998; Souchelnytskyi,
1998).
[0009] The expression of I-Smads appears to be part of a negative
feedback loop. The expression of Smad6 and -7 can be induced
rapidly and in some cases directly by BMP, activin and/or TGF-beta
in cultured cells. In addition, Smad3 and -4 can directly bind to
the Smad7 promoter to mediate activation of this promoter by
activin or TGF-beta. (Nagarajan, 1999; von Gersdorff, 2000). In
addition to stimulation through the TGF-beta-Smad pathway, Smad7
expression can also be induced by IFN-gamma through the Jak/Stat
pathway (Ulloa, 1999), by TNF-alpha through activation of NF-kappaB
(Bitzer, 2000), and by norepinephrine also through NF-kappaB
(Kanamaru, 2001).
[0010] In addition to the function of Smad7 as an inhibitor of the
phosphorylation of R-Smads by type I receptors at the
cytoplasm/cell membrane border, Smad7 was also found to occur
abundantly in the nuclei of certain cells and to be exported from
the nucleus upon TGF-beta stimulation or a change in cell substrate
(Itoh, 1998; Zhu, 1999). Pulaski (2001) showed that mutation in a
major phosphorylation site of Smad7 at Ser-249 did not affect the
inhibitory effect of Smad7 on TGF-beta or BMP7 signaling and did
not interfere with nuclear localization of Smad7. Instead,
phosphorylation of Smad7 at Ser-249 was shown to be important for
its ligand-independent ability to regulate transcription.
[0011] Mice overexpressing Smad7 exhibit defective T cell responses
to TGF-beta1, show markedly greater cytokine production in vitro,
and show enhanced antigen-induced airway inflammation (Nakao,
2000). Smad7 has been shown to be overexpressed in inflammatory
bowel disease (IBD) mucosa and purified mucosal T cells. In an in
vitro system specific antisense oligonucleotides for Smad7 reduced
Smad7 protein expression in cells isolated from IBD patients,
permitting the cells to respond to exogenous TGF-beta (Monteleone,
2001).
[0012] WO 97/30065 identifies a cDNA (fchd540) encoding for Smad7
and discusses the upregulation of Smad7 in cardiovascular disease
states. Diseases targeted by methods described in WO 97/30065
relate to cardiovascular disorders, in particular artherosclerosis,
ischemia/reperfusion, hypertension, restenosis and arterial
inflammation, as well as fibroproliferative oncogenic disorders,
including diabetic retinopathy, cancer, tumorigenesis,
vascularization of tumors, angiogenesis, artherosclerosis,
inflammation and fibrosis.
[0013] WO 98/53068 also describes nucleic acid molecules encoding
Smad7 and provides methods for decreasing or increasing TGFbeta
superfamily signal transduction in mammalian cells based on
targeting smad7 genes, gene products or interacting partners.
Furthermore, methods for treating a subject suffering from lung
cancer characterized by elevated expression of a Smad6 gene or a
Smad7 gene are described. These methods involve administering to
the subject an amount of an antisense nucleic acid which binds to
the expression product of the Smad 6 or Smad7 gene effective to
reduce the expression of the gene.
[0014] In addition, medical methods for reducing eye defects in a
developing mammalian embryo are disclosed. These methods include
contacting the cells of the embryo with an agent which reduces the
expression or activity of a Smad7 nucleic acid molecule or an
expression product thereof.
[0015] WO 01/53313 describes antisense compounds, compositions and
methods are provided for modulating the expression of Smad7. The
invention describes a method of treating a human having a disease
or condition associated with Smad7 comprising administering to said
animal a therapeutically or prophylactically effective amount of
the antisense compound so that expression of Smad7 is inhibited. In
the following "sub-claims" said disease or condition is a
developmental disorder, a cardiovascular disorder, a
hyperproliferative disorder or a wound healing disorder.
[0016] WO 01/21794 describes Smad associating polypeptides
identified by yeast two hybrid screening. It is said that this
invention further provides methods for reducing or increasing
TGF-beta family signal transduction in a cell. It is mentioned
that, in vivo, such methods are useful for modulating growth, e.
g., to treat cancer and fibrosis. In addition it is stated that
such methods are also useful in the treatment of conditions which
result from excessive or deficient TGF-signal transduction. In WO
00/77168 antagonists of BMP and TGF-.beta. signaling pathways are
disclosed whereby these antagonists relate to Smurf1 and Smurf2,
capable of interacting with Smad1, 5 and 7. Smurf 1 and Smurf2 are
HECT type E3 ubiquitin ligases, containing the N-terminal C2
domain, followed by WW domains and the C-terminal HECT domain. The
HECT domain is responsible for the E3 ligase activities of Smurfs.
Interaction of Smurfs with I-Smads leads to nuclear export of the
latter. In the cytoplasm, the C2 domain might target I-Smads to the
cell membrane, and facilitate the interaction of I-Smads with
TGFbeta receptors. Smurfs do not only recognize I-Smads as
substrates, but also capture TGFbeta receptors as their targets,
thereby leading to the degradation of both I-Smads and the receptor
complexes (Ebisawa, 2001, Kavsak, 2000, Suzuki, 2002).
[0017] WO 00/77168 describes a protein Smurf2 which induces
degradation of TGF-beta-receptors and Smad7. According to said
application Smurf2 directly interacts with Smad7 via a PPXY motif
in Smad7. Smurf2 is involved with TGF-beta receptor degradation
acting in partnership with Smad7 as an antagonist or negative
regulator of TGF-beta signaling. Activation of TGF-beta signaling
results in Smad7-dependent recruitment of Smurf2 to the TGF-beta
receptor complex. In the absence of activated TGF-beta receptor
complex, Smurf2 does not alter the steady state level and turnover
of Smad7. Recruitment of Smurf2 to the TGF-beta receptor by Smad7
promotes the degradation of the Smad7-TGF-beta receptor complex by
both proteasomal and lysosomal pathways. It is stated that
overexpression of Smurfs by gene therapy may be used to correct
clinical conditions that result from excessive Smad signaling.
[0018] Other proteins found to interfere with Smad7 comprise YAP65
and TIEG. Yes-Associated Protein (YAP65) is a proline rich
phosphoprotein originally identified as a protein binding to the
SH3 domain of the Yes proto-oncogene product (Sudol, 1994).
Ferrigno et al. identified YAP65 as novel Smad7-interacting protein
through yeast two hybrid screening (Ferrigno, 2002). They showed in
COS-7 cells that YAP65 potentiates the inhibitory activity of Smad7
against TGFbeta-induced, Smad3/4 dependent, gene transactivation.
Furthermore, YAP65 was shown to augment the association of Smad7 to
activated TGFbeta receptor type 1 molecules. TGFbeta inducible
early gene (TIEG) is a zinc finger Kruppel-like transcription
factor (KLF) and is induced by TGFbeta in many cell types
(Subramaniam, 1995, Subramaniam, 1998). Overexpression of TIEG
mimics effects of TGFbeta in many cell types (Chalaux, 1999,
Hefferan, 2000, Ribeiro, 1999, Tachibana, 1997). TIEG has been
shown to modulate the TGFbeta/Smad signaling pathway by binding to
the Smad7 promoter and thereby repressing the Smad7 transcription.
In addition TIEG increases transcription of the Smad2 gene. An E3
ubiquitin ligase, Seven in Absentia homologue-1 (SIAH1), acts as a
TIEG1 interacting protein and induces degradation of TIEG1, thereby
limiting the duration and/or magnitude of TGFbeta responses
(Johnsen, 2002a, Johnsen, 2002b, Johnsen, 2002c).
[0019] Other TGF-.beta. pathway genes are described in WO 98/45467
and WO 01/16604 describes a method for screening for agents which
are capable of modulating TGF-.beta. cell signaling.
[0020] Relevant to autoimmune disease in the central nervous system
(CNS) such as multiple sclerosis (MS) the immunosuppressive effects
of TGF-beta were extensively investigated in vitro using
myelin-specific autoimmune T cells, and in vivo, taking advantage
of experimental autoimmune encephalomyelitis (EAE), which is the
prime model for the human disease MS.
[0021] EAE can be induced in susceptible animal strains (e.g.
rodents and primates) either by immunization (=active EAE) with a
myelin antigen in complete or incomplete Freund's adjuvant (CFA) or
by adoptive systemic transfer of autoreactive T cells obtained from
animals previously immunized and activated in vitro with the
respective autoantigen (at-EAE) (Brocke, 1996; Zamvil, 1990).
[0022] The endogenous TGF-beta production was shown by most authors
to be upregulated in the CNS and presumably play a downmodulatory
role during the recovery phase of acute EAE (Khoury, 1992; Racke,
1992; Issazadeh, 1995; Issazadeh, 1998). No upregulation of
TGF-beta was found by Okuda (1995). In later work, however, a
reduction of TGF-beta expression in the preclinical and acute phase
in lymph node cells of mice immunized with myelin antigen in CFA
(Complete Freunds Adjuvant) as compared to control mice treated
with CFA alone was found (Okuda, 1998). Immunizing DA-rats (dark
agouti rats) with rat spinal cord in incomplete Freund's adjuvant
causes a prolonged chronic and relapsing course of EAE featuring
extensive demyelination. While TGF-beta expression was described to
be upregulated in the CNS of Lewis rats during the remission phase
of (monophasic) EAE, a significant expression of regulatory
cytokines such as TGF-beta (and IL-4 and IL-10) was not found in
the DA rat CNS or lymphoid tissues at various time points
(Issazadeh, 1996). Cytokine analysis demonstrated that the mRNA
expression of IL-10 and TGF-beta1 was generally low in both acute
EAE and the first attack of chronic EAE and upregulated at later
stages of chronic EAE. It was suggested that anti-inflammatory
cytokines play only a minor role in the relapse (Tanuma, 2000).
[0023] Recovery of disease in mice transgenic for an MBP-specific T
cell receptor induced to develop EAE was associated with an immune
deviation of Th1 T cells towards cells that secreted IL-4, IL-10,
and TGF-beta both in the periphery and in the CNS [Chen, 1998].
Kiefer and colleagues carried out a systematic study of TGF-beta
expression (Kiefer, 1998). In actively induced monophasic EAE in
the Lewis-rat, in situ hybridization revealed strong expression of
TGF-beta1 in meningeal and perivascular mononuclear infiltrates at
onset of the disease, continued expression in perivascular
infiltrates and scattered mononuclear cells at maximal disease
severity, and expression in scattered parenchymal cells during
recovery. Cellular expression of TGF-beta1 by T-cells, macrophages,
and microglia summed up to a long-lasting elevation of TGF-beta1
mRNA extending well into the recovery phase. While TGF-beta1
expressed early in the disease by T-cells was thought to contribute
to inflammatory lesion development, its expression by microglial
cells was suggested to potentially contribute to recovery (Kiefer,
1998).
[0024] Recombinant human TGF-beta1 administered at 2 .mu.g daily
i.p. for two weeks after the last of several immunizations of
SJL-mice with spinal cord homogenate in CFA delayed but did not
prevent or significantly ameliorate the severity of the first
disease episode in this EAE-model. Treatment after the first attack
during a repeat immunization protocol reduced the severity of
booster-immunization induced second episodes. Injections of
TGF-beta1 initiated after the onset of an acute episode of EAE did
not noticeably influence the course of that episode (Kuruvilla,
1991). However, in the same model spontaneous relapses were very
efficiently blocked by daily treatment initiated 35 days after the
onset of the first attack and maintained for 4 weeks (Kuruvilla,
1991). Using TGF-beta1 purified from human platelets it was
subsequently shown that 1 .mu.g of TGF-beta1 administered i.v. on
days 1-5 after transfer of encephalitogenic lymph node cells in
SJL-mice partially prevented EAE and significantly ameliorated
disease scores mainly during the first and second disease attacks
(Racke, 1991). Histology of TGF-beta1-treated mice sacrificed at
day 7 post transfer revealed markedly reduced inflammation and
absence of demyelination as opposed to mice treated with placebo.
When TGF-beta1 treatment was initiated at the earliest signs of
clinical disease and continued for 5 days the severity of
subsequent relapses was reduced (Racke, 1991; Johns 1991).
Treatment with recombinant simian TGF-beta 2 resulted in similar
inhibition of T cell activation and proliferation in vitro.
[0025] Recent studies showed that adoptive transfer of activated
MBP-specific Th1 clones transduced to secrete latent TGF-beta1
delayed and ameliorated EAE-signs in mice immunized with PLP (Chen,
1998). This strategy allowed for site-specific local delivery of
therapeutic active TGF-beta1 to the CNS inflammatory infiltrates,
was antigen-specific, yet apparently allowed bystander
immunosuppression by T cells activated in situ (Chen, 1998;
Thorbecke, 2000).
[0026] EAE was also successfully inhibited by a single injection of
a cytokine (IL-4, IFN-beta, or TGF-beta) DNA-cationic liposome
complex directly into the central nervous system (Croxford, 1998).
In another study a prolonged continuous TGF-beta delivery was
reached by injection of a naked plasmid DNA expression vector
encoding TGF-beta1 intramuscularly. This resulted in production of
TGF-beta1 and protection from clinical and histopathological signs
of MBP-induced EAE (Piccirillo and Prud'homme, 1999). Low doses of
TGF-beta1 administered nasally inhibited development and relapses
of chronic-relapsing EAE in DA rats.
[0027] Anti-TGF-beta1 antibody treatment in vivo aggravated
EAE-severity (Miller, 1992; Racke, 1992; Santambrogio, 1993; Johns,
1993; Santambrogio, 1998).
[0028] TGF-beta 1 and 2 mRNA-expression in CNS tissue from MS
cases, demonstrated by in situ hybridization, was found mainly in
perivascular rather than parenchymal cells, suggesting circulating
inflammatory cells as the major source (Woodroofe, 1993). In
summary, they found both a stronger expression and a differently
localized cellular distribution in MS (active demyelinating and
chronic active and inactive lesions) as opposed to control
tissue.
[0029] In a bioassay from peripheral blood cultures, TGF-beta like
activity was found to be increased in patients with active disease
as opposed to those with inactive disease and healthy donors and
was found in particular in the subgroup tested during the
regression of symptoms (Beck, 1991). Decreased TGF-beta production
by lymphocytes of patients with MS correlated directly with disease
activity. MS patients with active disease produced less TGF-beta
than MS patients with stable disease. The cells producing TGF-beta
were primarily CD8+ T cells and CD45RA+T cells (Mokhtarian,
1994).
[0030] Using a semiquantitative PCR the expression of TGF-beta and
IL-10 was reported to decrease prior to a relapse while the
expression of TNF-alpha and lymphotoxin increased (Rieckmann,
1995).
[0031] In an open-label phase 1 trial of 11 patients with secondary
progressive (SP) MS the safety of recombinant active TGF-beta2 was
assessed (Calabresi, 1998).
[0032] There is increasing evidence that the powerful
anti-inflammatory properties of TGF-beta as a negative regulator of
T-cell immune response play a key role in the pathophysiology of
cerebral ischemia and other CNS pathologies (Benveniste, 1998,
Kulkarni, 1993). Increased expression of TGF-beta was demonstrated
in post mortem brain tissue of human stroke victims (Krupinski,
1996), and in brain biopsies from patients suffering from various
acute or chronic neurodegenerative disorders including stroke,
Parkinson's disease, or Alzheimer disease (Mattson, 1997, Pratt,
1997). Therefore, this cytokine is regarded as an injury-related
peptide and a potential target for therapeutic intervention
(Krieglstein, 1998).
[0033] In vitro data support a neuroprotective role of the TGF-beta
pathway with particular reference to NMDA-induced neuronal death in
excitotoxic paradigms such as hypoxia-ischemia (Buisson, 1998,
Choi, 1996, Prehn, 1993). On the contrary, findings from in
vivo-studies consistently describe induction of TGF-beta1 mRNA
expression within hours after focal brain ischemia and upregulation
persisting for several weeks after the insult (Lehrmann, 1998,
Ruocco, 1999, Wang, 1995). More detailed data by Ali and coworkers
(Ali, 2001) localized the significantly enhanced expression of
TGF-beta1 to the ischemic penumbra, i.e. to the transitional
metabolic zone between the ischemic core and the periinfarct zone.
As blocking of the biological activity of TGF-beta by a specific
antagonist increased both excitotoxic and ischemic lesions, data
derived from rodent stroke models suggest that activation of the
TGF-beta signaling pathway may be associated with neuroprotection
(Ali, 2001, Ruocco, 1999).
[0034] In vivo data from a stroke model in rat identifying the
cellular source of TGF-beta1 production after focal cerebral
ischemia, demonstrated early induction as well as long-term
upregulation of TGF-beta1 mRNA expression confined to activated
microglia and macrophages. Therefore, TGF-beta1 mediated functions
represent an immediate and persistent response in the acute
ischemic brain lesion and are involved in the phase of tissue
remodeling after stroke (Lehrmann, 1998). More detailed, a biphasic
expression of TGF-beta1 with a first peak at 12 hours and at 7 days
after permanent MCA occlusion in the infarcted tissue has been
reported, the latter most probably linked to the downregulation of
inflammatory tissue response, the induction of neoangiogenesis, and
glial scar formation (Logan, 1994, Yamashita, 1999). The
upregulation of TGF-beta1 gene expression extends from 3 hours to 4
days after transient forebrain ischemia (Zhu, 2000), up to 15 days
after permanent MCA occlusion (Wang, 1995), and from 6 hours to 21
days after global brain ischemia (Lehrmann, 1995),
respectively.
[0035] Data from in vivo studies concerning the intraarterial or
the intracerebroventricular application of TGF-beta1 showed both
treatment before (Gross, 1993) and after induction of pathology
(Gross, 1994, McNeill, 1994) to be associated with a significant
reduction of neuronal loss and infarct size in a rabbit model of
thromboembolic stroke or a rat model of severe hypoxic-ischemic
brain injury, respectively. In transient global ischemia in rats,
Henrich-Noack and colleagues were able to show significant
protection of pyramidal CA1 cells by intrahippocampal injection of
TGF-beta1 prior to ischemia (Henrich-Noack, 1996). In mice
overexpressing TGF-beta1 after adenoviral gene transfer Pang and
coworkers (2001) demonstrated a reduction of infarct volume,
associated with an inhibition of the inflammatory response to MCA
occlusion in terms of reduced leukocyte and monocyte/macrophage
infiltration into the ischemic brain tissue (Pang, 2001).
[0036] Highly elevated levels of TGF-beta1 mRNA were also reported
for the ischemic penumbra in brain samples of human stroke victims
(Krupinski, 1996). Furthermore, the enhanced expression of several
TGF-beta isoforms and of the type I receptor protein in reactive
processes surrounding ischemic brain lesions was demonstrated in
human autopsy and biopsy material (Ata, 1997). While TGF-beta1
serum levels were not significantly different in stroke patients
and healthy volunteers, a close correlation between TGF-beta1
levels and both clinical and neuroradiological parameters of brain
injury have been reported (Kim, 1996, Slevin, 2000, Stanzani,
2001).
[0037] Experimental traumatic brain injury (TBI) results in a rapid
and significant necrosis of cortical tissue at the site of injury.
In the following hours and days, secondary injury exacerbates the
primary damage resulting in significant tissue destruction and
neurological dysfunction (Faden, 1993). Alterations in excitatory
amino acids, increased oxidative stress and increased apoptosis
contribute to progressive neuronal death following TBI. (summarized
in (Sullivan, 2002) and ref. therein). Rimaniol et al. described a
biphasic production of TGFbeta following cerebral trauma, with a
first peak after 30 min. and a second peak 48 h after the lesion
(Rimaniol, 1995). Lindholm et al. showed increased production of
TGFbeta1 mRNA in the rat cerebral cortex after a penetrating brain
injury (Lindholm, 1992). In this paper they argued that TGFbeta1
expressed in the lesioned brain may play a role in nerve
regeneration by stimulating nerve growth factor (NGF) production
and by controlling the extent of astrocyte proliferation and scar
formation. Logan et al, showed a diffuse increase of TGFbeta1 mRNA
and protein around the cerebral stab wound at 1, 2 and 3 days; at 7
and 14 d after lesion the distribution was more localized to the
region of the glial scar (Logan, 1992). They suggested to use
TGFbeta1 antagonists to limit the pathogenesis associated with
matrix deposition in the CNS wound. Kriegelstein et al. showed that
the survival promoting effect of Glial cell line-derived
neurotrophic factor (GDNF) in vivo and in vitro requires the
presence of TGFbeta (Krieglstein, 1998). In a very recent study,
Peterziel et al. demonstrated that the TGFbeta induced GDNF
responsiveness in neurons is caused by the TGFbeta induced
recruitment of the glycosyl-phosphatidyl-inositol-anchored GDNF
receptor (GFR)alpha1 to the plasma membrane (Peterziel, 2002).
[0038] TGF-beta is present in senile amyloid plaques found in the
CNS and is overexpressed in Alzheimer's disease brain compared with
controls (Finch, J. Cell Biochem 53 (1993), 314-322). TGF-beta has
been implicated in Alzheimer's disease pathogenesis (Wyss-Coray,
Nature 389 (1997), 603-606; Flanders, Neurology 45(8) (1995),
1561-1569; van der Wal, Neuroreport 4 (1993), 69-72) for the
following reasons: It accelerates amyloid deposition in an animal
model of Alzheimer's disease; i.e. transgenic mice coexpressing
human TGF-beta1 and mutated amyloid precursor protein (APP) (Finch,
(1993) loc. cit.; Wyss-Coray, (1997), loc. cit.; Wyss-Coray, Ann.
N.Y. Acad. Sci. 903 (2000), 317-323). TGF-beta drives astrocytic
overexpression of mRNA encoding for the APP. On a molecular level,
TGF-beta activation of Smad protein complexes promotes
transcription of the APP gene (Burton, Biochem. Biophys. Res.
Commun. 295 (2002), 702-712; Burton, Biochem. Biophys. Res. Commun.
295 (2002); 713-723). However, it has been shown in contrast by
Wyss-Coray and coworkers (2001) that a modest increase in
astroglial TGF-beta1 production in aged transgenic mice expressing
the human beta-APP significantly reduces the number of parenchymal
amyloid plaques and the overall cortical amyloid-beta load and
decreases the number of dystrophic neuritis (Wyss-Coray, Nat. Med.
7(5) (2001), 612-618). In human APP/TGF-beta1-expressing mice,
amyloid beta accumulated substantially in cerebral blood vessels,
but not in parenchymal plaques (Wyss-Coray, (2001) loc. cit.). In
human Alzheimer cases, plaque-associated amyloid beta
immunoreactivity was inversely correlated with vascular amyloid
beta and cortical TGF-beta1 mRNA levels. The reduction of
parenchymal plaques in human APP/TGF-beta1 mice was associated with
a strong activation of microglia and an increase in inflammatory
mediators. Recombinant TGF-beta1 stimulated amyloid-beta clearance
in microglial cell cultures (Wyss-Coray, (2001), loc. cit.).
[0039] However, research on TGF-beta uncovered ambiguous or
detrimental effects of TGF-beta, last but not least from the
perspective of autoimmune therapy; TGF-beta is considered in the
art as a "two-edged sword". Kiefer (1998), analyzing TGF-beta
expression in monophasic EAE of the Lewis rat, found evidence for
early expression in T cells, possibly contributing to inflammatory
lesion development while the later occurring expression within
microglia was suggested to play a downmodulatory role. When
Ag-specific murine T cell lines and clones were cultured in the
presence of TGF-beta the effector function of these autoreactive
cells and demyelinating lesion formation upon adoptive transfer in
experimental autoimmune encephalomyelitis were markedly enhanced
(Weinberg 1992). In another EAE model it was shown that the effects
of TGF-beta on autoimmune disease expression vary depending on the
timing of treatment with respect to disease induction. Daily i.p.
injections of 0.2-2 .mu.g TGF-beta 1 or TGF-beta 2 on days 5 to 9
after immunization were highly protective, while injections on days
1-5 or 9-13 were not. TGF-beta treatment on days 5-9 prevented the
accumulation of T cells in brain and spinal cord, as assayed on
days 15 to 20. Anti-TGF-beta accelerated and aggrevated EAE when
administered on days 5 and 9, but not on day 12. It was concluded
that the protective effect of TGF-beta is exerted at the level of
the target organ, CNS and/or its vascular endothelium and that
there was a small window of 4 days in which TGF-beta exerts its
protective effect (Santambrogio, 1993).
[0040] Mice genetically targeted to overexpress bioactive TGF-beta1
specifically within astrocytes were reported to show a phenotype
with severe CNS pathology at high levels of expression. While
unmanipulated heterozygous transgenic mice from a low expressor
line showed no such alterations, increasing TGF-beta 1 expression
in this line by injury-induced astroglial activation or generation
of homozygous offspring did result in the abnormal phenotype
(Wyss-Coray, 95). Astroglial overexpression of TGF-beta 1 was not
associated with obvious CNS infiltration by hematogenous cells
(Wyss-Coray, 1995). However, these mice were more susceptible to
EAE-induction with earlier and more severe CNS inflammation. Thus,
local expression of TGF-beta 1 within the CNS parenchyma can
enhance immune cell infiltration and intensify the CNS impairment
resulting from peripherally triggered autoimmune responses
(Wyss-Coray 1997). An Alzheimer's disease-like pathology with
perivascular astrocytosis and deposition of amyloid in cerebral
blood vessels was observed in older mice expressing low-levels of
transgenic active TGF-beta (Wyss-Coray, 2000).
[0041] Various strategies that were successful in modulating EAE
and suggested TGF-beta as part of the protective effect proved not
to be effective or showed considerable toxicity in clinical trials.
In an open-label phase 1 trial of 11 patients with secondary
progressive (SP) MS the safety of recombinant active TGF-beta2 was
assessed (Calabresi, 1998). Groups of patients were treated in a
dose-escalation scheme with 0.2 .mu.g/kg, 0.6 .mu.g/kg or 2.0
.mu.g/kg. Treatment was administered i.v., three times weekly for
four weeks unless discontinued earlier. A reversible decline in the
glomerular filtration rate developed in five patients (three with
0.6 .mu.g/kg, both with 2.0 .mu.g/kg), transient mild to moderate
anemia in seven, hypertension in two and a maculopathy in one
patient. The nephrotoxicity and anemia were likely to be related to
TGF-beta-treatment. A beneficial effect or an effect on clinical or
imaging parameters was not observed (Calabresi, 1998).
[0042] These indications of systemic side-effects considerably
lessened the interest in TGF-beta as a therapeutic tool for MS
(Calabresi 1998; Wiendl 2000). In addition, in a phase III clinical
trial of oral myelin tolerization in RRMS neither clinical nor MRI
outcome parameters were significantly different between myelin and
placebo-treated patients (Panitch 97, Francis 97).
[0043] However, it has also been shown that it is considerably more
difficult to treat ongoing EAE by mucosal tolerization (discussion
in Xu 2000) or TGF-beta itself (discussion in Thorbecke 2000) than
to prevent disease.
[0044] While TGF-beta is one of the most potent growth-inhibitory
substances known for most cell types, it stimulates proliferation
of fibroblasts and osteoblasts. It is also a potent stimulator of
extracellular matrix production by fibroblasts and osteoblasts
(Massague, 1987; Sporn, 1987), inhibits matrix degradation and
upregulates receptors for matrix interaction TGF-beta1 has been
implicated as a key causative factor in the pathogenesis of liver
fibrosis (Border, 1994; Friedman, 1993) and at least as one crucial
mediator of both the beneficial and detrimental effects of
cyclosporine A on the immune system and the kidney (reviewed in
(Khanna, 1999)). In addition, various chronic progressive fibrotic
kidney disorders in humans and experimental models--be they
glomerular or tubulointerstitial--have been shown to be associated
with stimulation of the TGF-beta system (Bitzer, 1998).
Administration of a neutralizing anti-TGF-beta-antibody resulted in
the prevention of renal failure, excess matrix gene expression and
glomerular mesangial matrix expansion in db/db diabetic mice
(Ziyadeh, 2000).
[0045] Chronic TGF-beta upregulation plays a central role in
progressive matrix accumulation and renal insufficiency observed in
diabetic nephropathy (reviewed in Sharma and McGowan, 2000). The
pathology of systemic multidose administration of recombinant human
TGF-beta1 in rats and rabbits was described by Terrell (1993): A 14
day pilot study was performed in rats using rhTGF-beta1 produced in
human A293 cells. After administration of 1000 .mu.g/kg i.v. two
rats died after 5 days. The remaining rats were sacrificed at that
point. The mid-dose and low-dose-groups group received 100 .mu.g/kg
and 10 .mu.g/kg i.v. daily for 14 days, respectively. Adverse
events were most striking in the high-dose group but qualitatively
similar changes were seen at the mid-dose level albeit less severe
and delayed in onset. Besides certain histopathological changes,
the rats displayed reduced body weight (from day 3) and an
increased hematocrit on day 3 with a subsequent decrease. In the
discussion of their findings Terrell and associates stated that the
relative severity and rapidity with which some of the observed
changes--both clinical and histopathological such as the hepatic
involution and the enostosis--occurred in the high-dose
preparations was remarkable (Terrell, 1993).
[0046] The use of TGF-beta for immunomodulation in humans is
severely limited by its toxicity, including excessive stimulation
of matrix production, nephrotoxicity and other detrimental effects.
TGF-beta has oncogenic potential and has been implicated in
glomerulopathies, pulmonary fibrosis, scleroderma and chronic graft
versus host disease. In addition, while TGF-beta is an extremely
potent immunosuppressive cytokine, several lines of evidence
indicate that chronic stimulation of TGF-beta expression--both
disease-related or in transgenic animal models--can paradoxically
lead to or enhance autoimmune inflammation.
[0047] Recently, a potential explanation has been put forward
suggesting that upmodulation of the Smad7 leads to a paralysis of
TGF-beta signaling (Monteleone, 2001). The in vitro analysis
carried out by Monteleone 2001 proposes that blocking of Smad7 may
be beneficial in chronic inflammatory bowel disease, a disorder
neither related to nor associated with disorders of the CNS.
However, immunologically, chronic inflammatory bowel disease (CIBD)
differs in many important aspects from CNS autoimmune inflammation.
While the CNS is anatomically separated and protected from most
circulating cells and exogenous agents by the blood-brain-barrier
conveying the so-called "immunological privilege" of the CNS, the
normal gut contains a rich lymphoid compartment maintaining a
physiological inflammation induced and sustained by enteric flora
and food antigens. The gut's immune system constantly works to
tolerize the individual against the ingested food and the normal
enteric flora. This function is mediated by the special type of
immune reactions induced in the gut, is related to the marked
upregulation of TGF-beta after an antigen-specific oral challenge
(Gonnella 1998) and represents the immunological background of
"oral tolerization" against autoimmunity-inducing antigens from
other tissues (such as myelin components) (Garside 2001). The gut's
physiological inflammation is transformed in persistent destructive
inflammation in chronic inflammatory bowel disease (Fiocchi 1998).
Accordingly, while chronic inflammatory bowel diseases develop at
the regular interface between the external world and the immune
system and frequently cause further manifestations systemically
(such as coagulation disorders) or in other organs such as joint or
skin disease, the autoimmune inflammation and the manifestations of
multiple sclerosis are limited to a rather secluded organ, the CNS.
In addition, in TGF-beta1 knockout mice massive inflammatory
lesions were found in several organs, including colon, but no
significant histological lesions were seen in brain (Kulkarni,
1993).
[0048] Therefore, whereas the prior art has proposed the use of
TGF-beta or an upregulation of TGF-beta signaling pathways for the
treatment of infections, inflammations, or even tumor-formation, a
corresponding systemic upregulation of TGF-beta has severe
side-effects as described herein above.
[0049] There is a need in the art to develop effective drugs for
the treatment of disorders of the CNS for in vivo therapy.
[0050] The solution to said technical problem is achieved by the
embodiments characterized in the claims.
[0051] Accordingly, the present invention relates to the use of a
specific inhibitor of Smad7 expression or function for the
preparation of a pharmaceutical composition for the prevention,
amelioration or treatment of a disease of the central nervous
system and/or diseases related and/or caused by said disease of the
central nervous system.
[0052] In accordance with the present invention, it has
surprisingly be found that the neutralization or antagonization of
Smad7 restores and/or positively modifies TGF-beta signaling
pathways in cells in the nervous system without the side effects of
TGF-beta treatment. Therefore, a medical intervention comprising
Smad7 antagonists/inhibitors as described herein is therapeutically
beneficial in the treatment of diseases of the nervous system, in
particular of neurodegenerative disorders, autoimmune diseases as
described herein, trauma or of stroke. The medical and
therapeutical intervention as described herein is surprisingly not
associated with the deleterious toxicity in various organs that
have been documented in the prior art as being affected by systemic
TGF-beta treatment.
[0053] The appended examples clearly document the beneficial
systemical suppression of Smad7 which leads to a significant
amelioration of diseases of the CNS, in particular of autoimmune
diseases, like multiple sclerosis (MS) as well as conditions in
which an inflammatory response makes a secondary contribution to
tissue injury or repair such as trauma or (ischemic) stroke.
Furthermore, the Smad7 inhibitors or antagonists as described
herein are also useful in the treatment or prevention of
neurodegenerative disorders, like Alzheimer's disease or
Parkinson's disease.
[0054] Without being bound by theory, it is envisaged that pathways
like the TGF-beta (BMP)-Smad signal transduction, the targeting of
TGF-beta (BMP) receptors for proteolytic degradation via
Smurf/ubiquitin ligase pathways, or the nuclear (or cytoplasmic)
modulation of transcription events are positively modulated by the
use of Smad7 inhibitors/antagonists as described herein.
Particularly preferred is the use of these Smad7
antagonists/inhibitors in the treatment of CNS-disorders as
described herein below. Most preferred is this use in the
preparation of a pharmaceutical composition for the treatment of
multiple sclerosis, ischemia, Alzheimer's disease, Parkinson's
disease, stroke and trauma.
[0055] The terms "treatment", "treating" and the like are used
herein to generally mean obtaining a desired pharmacological and/or
physiological effect. The effect may be prophylactic in terms of
completely or partially preventing a disease or symptom thereof
and/or may be therapeutic in terms of partially or completely
curing a disease and/or adverse effect attributed to the disease.
The term "treatment" as used herein covers any treatment of a
disease in a mammal, particularly a human, and includes: (a)
preventing the disease from occurring in a subject which may be
predisposed to the disease but has not yet been diagnosed as having
it; (b) inhibiting the disease, i.e. arresting its development; or
(c) relieving the disease, i.e. causing regression of the
disease.
[0056] In a particular preferred embodiment, the present invention
relates to the use as described herein above, wherein said specific
Smad7 inhibitor/antagonist is selected from the group consisting of
(small) binding molecules, intracellular-binding-partners or
receptors, aptamers, intramers, RNAi (double stranded RNA, siRNA)
and anti-Smad7 antisense molecules. Furthermore, said specific
inhibitor/antagonist to be employed in context of the present
invention may comprise truncated and/or mutated Smad7 molecules
which interfere with the Smad7 and which, thereby, inhibit Smad7
function.
[0057] (Small) binding molecules comprise natural as well as
synthetic compounds. The term "compound" in context of this
invention comprises single substances or a plurality of substances.
Said compound/binding molecules may be comprised in, for example,
samples, e.g., cell extracts from, e.g., plants, animals or
microorganisms. Furthermore, said compound(s) may be known in the
art but hitherto not known to be capable of (negatively)
influencing the activity Smad7 or not known to be capable of
influencing the expression of the nucleic acid molecule encoding
for Smad7, respectively. The plurality of compounds may be, e.g.,
added to a sample in vitro, to the culture medium or injected into
the cell.
[0058] If a sample (collection of compounds) containing (a)
compound(s) is identified in the art as a specific inhibitory
binding molecule of Smad7, then it is either possible to isolate
the compound from the original sample identified as containing the
compound in question or one can further subdivide the original
sample, for example, if it consists of a plurality of different
compounds, so as to reduce the number of different substances per
sample and repeat the method with the subdivisions of the original
sample. It can then be determined whether said sample or compound
displays the desired properties, i.e. the inhibition of Smad7, by
methods known in the art. Depending on the complexity of the
samples, the steps described above can be performed several times,
preferably until the sample identified according to the screening
method only comprises a limited number of or only one substance(s).
Preferably said sample comprises substances of similar chemical
and/or physical properties, and most preferably said substances are
identical.
[0059] Binding molecules/inhibitory molecules for Smad7 may be
deduced by methods in the art. Such methods comprise, e.g., but are
not limited to methods, where a collection of substances is tested
for interaction with Smad7 or with (a) fragment(s) thereof and
where substances which test positive for interaction in a
corresponding readout system are further tested in vivo, in vitro
or in silico for their inhibitory effects on Smad7 expression or
function.
[0060] Said "test for Smad7 interaction" of the above described
method may be carried out by specific immunological, molecular
biological and/or biochemical assays which are well known in the
art and which comprise, e.g., homogenous and heterogenous assays as
described herein below.
[0061] Said interaction assays employing read-out systems are well
known in the art and comprise, inter alia, two hybrid screenings
(as, described, inter alia, in EP-0 963 376, WO 98/25947, WO
00/02911), GST-pull-down columns, co-precipitation assays from cell
extracts as described, inter alia, in Kasus-Jacobi, Oncogene 19
(2000), 2052-2059, "interaction-trap" systems (as described, inter
alia, in U.S. Pat. No. 6,004,746) expression cloning (e.g. lamda
gtll), phage display (as described, inter alia, in U.S. Pat. No.
5,541,109), in vitro binding assays and the like. Further
interaction assay methods and corresponding read out systems are,
inter alia, described in U.S. Pat. No. 5,525,490, WO 99/51741, WO
00/17221, WO 00/14271, WO 00/05410 or Yeast Four hybrid assays as
described in Sandrok & Egly, JBC 276 (2001), 35328-35333.
[0062] Said interaction assays for Smad7 also comprise assays for
FRET-assays, TR-FRETS (in "A homogenous time resolved fluorescence
method for drug discovery" in: High throughput screening: the
discovery of bioactive substances. Kolb, (1997) J. Devlin. NY,
Marcel Dekker 345-360) or commercially available assays, like
"Amplified Luminescent Proximity Homogenous Assay", BioSignal
Packard. Furthermore, the yeast-2-hybrid (Y2H) system may be
employed to elucidate further particular and specific interaction,
association partners of Smad7. Said interaction/association
partners are further screened for their inhibitory effects.
[0063] Similarly, interacting molecules (for example)
(poly)peptides may be deduced by cell-based techniques well known
in the art. These assays comprise, inter alia, the expression of
reporter gene constructs or "knock-in" assays, as described, for,
e.g., the identification of drugs/small compounds influencing the
(gene) expression of Smad7. Said "knock-in" assays may comprise
"knock-in" of Smad7 (or (a) fragment(s) thereof) in tissue culture
cells, as well as in (transgenic) animals. Examples for successful
"knock-ins" are known in the art (see, inter alia, Tanaka, J.
Neurobiol. 41 (1999), 524-539 or Monroe, Immunity 11 (1999),
201-212). Furthermore, biochemical assays may be employed which
comprise, but are not limited to, binding of the Smad7 (or (a)
fragment(s) thereof) to other molecules/(poly)peptides, peptides or
binding of the Smad7 (or (a) fragment(s) thereof) to itself
(themselves) (dimerizations, oligomerizations, multimerizations)
and assaying said interactions by, inter alia, scintillation
proximity assay (SPA) or homogenous time-resolved fluorescence
assay (HTRFA).
[0064] Said "testing of interaction" may also comprise the
measurement of a complex formation. The measurement of a complex
formation is well known in the art and comprises, inter alia,
heterogeneous and homogeneous assays. Homogeneous assays comprise
assays wherein the binding partners remain in solution and comprise
assays, like agglutination assays. Heterogeneous assays comprise
assays like, inter alia, immuno assays, for example, ELISAs, RIAs,
IRMAs, FIAs, CLIAs or ECLs.
[0065] As discussed below the interaction of the inhibiting
molecules of Smad7 mRNA and Smad7 protein or fragments thereof may
also be tested by molecular biological methods, like two-, three-
or four-hybrid-assays, RNA protection assays, Northern blots,
Western blots, micro-, macro- and Protein- or antibody arrays, dot
blot assays, in situ hybridization and immunohistochemistry,
quantitative PCR, coprecipitation, far western blotting, phage
based expression cloning, surface plasmon resonance measurements,
yeast one hybrid screening, DNAse I, footprint analysis, mobility
shift DNA-binding assays, gel filtration chromatography, affinity
chromatography, immunoprecipitation, one- or two dimensional gel
electrophoresis, aptamer technologies, as well as high throughput
synthesis and screening methods.
[0066] The compounds identified and/or obtained according to the
above described method(s), in particular inhibitors of Smad7 or (a)
fragment(s) thereof, are expected to be very beneficial as agents
in pharmaceutical settings disclosed herein and to be used for
medical purposes, in particular, in the treatment of the
CNS-disorders described herein.
[0067] Compounds which may function as specific inhibition of Smad7
also comprise (small) organic compounds, like compounds which can
be used in accordance with the present invention include, inter
alia, peptides, proteins, nucleic acids including cDNA expression
libraries, small organic compounds, ligands, PNAs and the like.
Said compounds can also be functional derivatives or analogues.
Methods for the preparation of chemical derivatives and analogues
are well known to those skilled in the art and are described in,
for example, Beilstein, "Handbook of Organic Chemistry", Springer
Edition New York, or in "Organic Synthesis", Wiley, New York.
Furthermore, said derivatives and analogues can be tested for their
effects, i.e. their inhibitory effects of Smad7 according to
methods known in the art. Furthermore, peptidomimetics and/or
computer aided design of appropriate inhibitors of Smad7 can be
used. Appropriate computer systems for the computer aided design
of, e.g., proteins and peptides are described in the prior art, for
example, in Berry, Biochem. Soc. Trans. 22 (1994), 1033-1036;
Wodak, Ann. N. Y. Acad. Sci. 501 (1987), 1-13; Pabo, Biochemistry
25 (1986), 5987-5991. The results obtained from the above-described
computer analysis can be used in combination with the method of the
invention for, e.g., optimizing known compounds, substances or
molecules. Appropriate compounds can also be identified by the
synthesis of peptidomimetic combinatorial libraries through
successive chemical modification and testing the resulting
compounds, e.g., according to the methods described herein. Methods
for the generation and use of peptidomimetic combinatorial
libraries are described in the prior art, for example in Ostresh,
Methods in Enzymology 267 (1996), 220-234 and Dorner, Bioorg. Med.
Chem. 4 (1996), 709-715. Furthermore, the three-dimensional and/or
crystallographic structure of inhibitors of Smad7 can be used for
the design of (peptidomimetic) inhibitors of Smad7 (Rose,
Biochemistry 35 (1996), 12933-12944; Rutenber, Bioorg. Med. Chem. 4
(1996), 1545-1558).
[0068] As mentioned herein above, the inhibitor of Smad7 expression
or function may also comprise an aptamer.
[0069] In the context of the present invention, the term "aptamer"
comprises nucleic acids such as RNA, ssDNA (ss=single stranded),
modified RNA, modified ssDNA or PNAs which bind a plurality of
target sequences having a high specificity and affinity. Aptamers
are well known in the art and, inter alia, described in Famulok,
Curr. Op. Chem. Biol. 2 (1998), 320-327. The preparation of
aptamers is well known in the art and may involve, inter alia, the
use of combinatorial RNA libraries to identify binding sites (Gold,
Ann. Rev. Biochem. 64 (1995), 763-797).
[0070] Accordingly, aptamers are oligonucleotides derived from an
in vitro evolution process called SELEX (systematic evolution of
ligands by exponential enrichment).
[0071] Pools of randomized RNA or single stranded DNA sequences are
selected against certain targets. The sequences of tighter binding
with the targets are isolated and amplified. The selection is
repeated using the enriched pool derived from the first round
selection. Several rounds of this process lead to winning sequences
that are called `aptamers` or `ligands`. Aptamers have been evolved
to bind proteins which are associated with a number of disease
states. Using this method, many powerful antagonists of such
proteins can be found. In order for these antagonists to work in
animal models of disease and in humans, it is normally necessary to
modify the aptamers. First of all, sugar modifications of
nucleoside triphosphates are necessary to render the resulting
aptamers resistant to nucleases found in serum. Changing the 2'OH
groups of ribose to 2'F or 2'NH2 groups yields aptamers which are
long lived in blood. The relatively low molecular weight of
aptamers (8000-12000) leads to rapid clearance from the blood.
Aptamers can be kept in the circulation from hours to days by
conjugating them to higher molecular weight vehicles. When
modified, conjugated aptamers are injected into animals, they
inhibit physiological functions known to be associated with their
target proteins. Aptamers may be applied systemically in animals
and humans to treat organ specific diseases (Ostendorf, 2001). The
first aptamer that has proceeded to phase I clinical studies is
NX-1838, an injectable angiogenesis inhibitor that can be
potentially used to treat macular degeneration-induced blindness.
(Sun, 2000). Cytoplasmatic expression of aptamers ("intramers") may
be used to inhibit intracellular targets (Blind, 1999; Mayer,
2001). Said intramers are also envisaged to be employed in context
of this invention.
[0072] Said (other) receptors of Smad7 may, for example, be derived
from (an) antibody(ies) against Smad7 by peptidomimetics. The
specificity of the recognition implies that other known proteins,
molecules are not bound. Further, Smad7-receptors which may
function in context of this invention are SARA (Wu, 2000), STRAP
(Datta, 2000), TGF-beta- or BMP-receptors or Smad2 (Kavasak, 2000).
It is in particular envisaged that peptide fragments of such
"natural" Smad7-receptors are employed.
[0073] The RNAi-approach is also envisaged in context of this
invention for use in the preparation of a pharmaceutical
composition for the treatment of CNS-diseases disclosed herein.
[0074] The term RNA interference (RNAi) describes the use of
double-stranded RNA to target specific mRNAs for degradation,
thereby silencing their expression. Double-stranded RNA (dsRNA)
matching a gene sequence is synthesized in vitro and introduced
into a cell. The dsRNA feeds into a natural, but only partially
understood process including the highly conserved nuclease dicer
(Hutvagner, 2001; Grishok, 2001), which cleaves dsRNA precursor
molecules into short interfering RNAs (siRNAs). The generation and
preparation of siRNA(s) as well as the method for inhibiting the
expression of a target gene is, inter alia, described in WO
02/055693, Wei (2000) Dev. Biol. 15, 239-255; La Count (2000),
Biochem. Paras. 111, 67-76, Baker (2000) Curr. Biol. 10, 1071-1074,
Svoboda (2000), Development 127, 4147-4156 or Marie (2000) Curr.
Biol. 10, 289-292. These siRNAs built then the sequence specific
part of an RNA-induced silencing complex (RISC), a multicomplex
nuclease that destroys messenger RNAs homologous to the silencing
trigger. One protein-part of the ribonucleoprotein complex has been
identified as Argonaute2 (Hammond, 2001). Elbashir (2001) showed
that duplexes of 21 nucleotide RNAs may be used in cell culture to
interfere with gene expression in mammalian cells.
[0075] Methods to deduce and construct siRNAs are in the art and
are described in Elbashir et al., 2002, at the internet web sites
of commercial vendors of siRNA, e.g. Xeragon Inc.
(www.xeragon.com/siRNA support.html); Dharmacon
(www.dharmacon.com;); Xeragon Inc. (www.xeragon.com;), and Ambion
(www.ambion.com), or at the web site of the research group of Tom
Tuschl (http://www.mpibpc.qwdg.de/abteilungen/100/105/sirna.html).
In addition, programs are available online to deduce siRNAs from a
given mRNA sequence (e.g. http://www.ambion.com/techlib/misc/siRNA
finder.html or http://katahdin.cshl.org:9331/RNAi/). These were
used to deduce the siRNA molecules listed below (RNAi 1-20, SEQ ID
NO: 44-83). Uridine residues in the 2-nt 3' overhang can be
replaced by 2'deoxythymidine without loss of activity, which
significantly reduces costs of RNA synthesis and may also enhance
resistance of siRNA duplexes when applied to mammalian cells
(Elbashir, 2001). This modification is also incorporated in citing
SEQ Ids 44-83 (see below) of the present application. The siRNAs
may also be sythesized enzymatically using T7 or other RNA
polymerases (Donze, 2002). Short RNA duplexes that mediate
effective RNA interference (esiRNA) may also be produced by
hydrolysis with Escherichia coli Rnase III (Yang, 2002)
Furthermore, expression vectors have been developed to express
double stranded siRNAs connected by small hairpin RNA loops in
eukaryotic cells (e.g. (Brummelkamp, 2002)). All of these
constructs may by developed with the help of the programs named
above. In addition, commercially available sequence prediction
tools incorporated in sequence analysis programs or sold
separately, e.g. the siRNA Design Tool offered by
www.oligoEngine.com (Seattle, Wash.) may be used for siRNA sequence
prediction.
[0076] Accordingly, the present invention also provides for the use
of specific interfering RNAs as inhibitors of Smad7 expression
and/or function. Preferably, said (small) interfering RNAs (siRNAs)
comprise at least 10, more preferably at least 12, more preferably
at least 14, more preferably at least 16, more preferably at least
18 nucleotides. In a particular preferred embodiment these siRNAs
are selected from the group consisting of
TABLE-US-00001 RNAi1: nt 298-318 5'-GUUCAGGACCAAACGAUCUGC-3', (SEQ
ID NO: 44) nt 318-296 5'-GCAGAUCGUUUGGUCCUGAACAU-3', (SEQ ID NO:
45) RNAi2: nt 578-598 5'-CUCACGCACUCGGUGCUCAAG-3', (SEQ ID NO: 46)
nt 598-576 5'-CUUGAGCACCGAGUGCGUGAGCG-3'; (SEQ ID NO: 47) RNAi3: nt
209-227 5'-CUCGGCGCCCGACUUCUUCuu-3', (SEQ ID NO: 48) nt 227-207
5'-GAAGAAGUCGGGCGCCGAGUU-3', (SEQ ID NO: 49) RNAi4: nt 266-284
5'-ACGACUUUUCUCCUCGCCUuu-3', (SEQ ID NO: 50) nt 284-264
5'-AGGCGAGGAGAAAAGUCGUUU-3'; (SEQ ID NO: 51) RNAi5: nt 310-328
5'-ACGAUCUGCGCUCGUCCGGuu-3', (SEQ ID NO: 52) nt 328-308
5'-CCGGACGAGCGCAGAUCGUUU-3'; (SEQ ID NO: 53) RNAi6: nt 574-592
5'-GGCGCUCACGCACUCGGUGuu-3', (SEQ ID NO: 54) nt 592-572
5'-CACCGAGUGCGUGAGCGCCUU-3'; (SEQ ID NO: 55) RNAi7: nt 607-625
5'-GGAGCGGCAGCUGGAGCUGuu-3', (SEQ ID NO: 56) nt 625-605
5'-CAGCUCCAGCUGCCGCUCCUU-3', (SEQ ID NO: 57) RNAi8: nt 778-796
5'-AGUGUUCAGGUGGCCGGAUuu-3', (SEQ ID NO: 58) nt 796-776
5'-AUCCGGCCACCUGAACACUuu-3', (SEQ ID NO: 59) RNAi9:nt 815-833
5'-GUCAAGAGGCUGUGUUGCUuu-3', (SEQ ID NO: 60) nt 833-813
5'-AGCAACACAGCCUCUUGACUU-3', (SEQ ID NO: 61) RNAi10: nt 820-838
5'-GAGGCUGUGUUGCUGUGAAuu-3', (SEQ ID NO: 62) nt 838-818
5'-UUCACAGACACACAGCCUCUU-3', (SEQ ID NO: 63) RNAi11: nt 839-857
5'-UCUUACGGGAAGAUCAACCuu-3', (SEQ ID NO: 64) nt 857-837
5'-GGUUGAUCUUCCCGUAAGAUU-3', (SEQ ID NO: 65) RNAi12: nt 850-868
5'-GAUCAACCCCGAGCUGGUGuu-3', (SEQ ID NO: 66) nt 868-848
5'-CACCAGCUCGGGGUUGAUCUU-3', (SEQ ID NO: 67) RNAi13: nt 856-874
5'-CCCCGAGCUGGUGUGCUGCuu-3', (SEQ ID NO: 68) nt 874-854
5'-GCAGCACACCAGCUCGGGGUU-3', (SEQ ID NO: 69) RNAi14: nt 1008-1026
5'-CGAAUUAUCUGGCCCCUGGuu-3', (SEQ ID NO: 70) nt 1026-1006
5'-CCAGGGGCCAGAUAAUUCGUU-3', (SEQ ID NO: 71) RNAi15: nt 1046-1064
5'-CUUCUUCUGGAGCCUGGGGuu-3', (SEQ ID NO: 72) nt 1064-1044
5'-CCCCAGGCUCCAGAAGAAGUU-3', (SEQ ID NO: 73) RNAi16: nt 1177-1195
5'-UGGCUUUUGCCUCGGACAGuu-3', (SEQ ID NO: 74) nt 1195-1175
5'-CUGUCCGAGGCAAAAGCCAUU-3', (SEQ ID NO: 75) RNAi17: nt 1201-1219
5'-UUCGGACAACAAGAGUCAGuu-3', (SEQ ID NO: 76) nt 1219-1199
5'-CUGACUCUUGUUGUCCGAAUU-3', (SEQ ID NO: 77) RNAi18: nt 1297-1315
5'-CCGCAGCAGUUACCCCAUCuu-3', (SEQ ID NO: 78) nt 1315-1295
5'-GAUGGGGUAACUGCUGCGGUU-3', (SEQ ID NO: 79) RNAi19: nt 1324-1342
5'GUCCGCCACACUGGACAACuu-3', (SEQ ID NO: 80) nt 1342-1322
5'-GUUGUCCAGUGUGGCGGACUU-3', (SEQ ID NO: 81) RNAi20: nt 1342-1360
5'-CCCGGACUCCAGGACGCUGuu-3', (SEQ ID NO: 82) nt 1360-1340
5'-CAGCGUCCUGGAGUCCGGGUU-3', (SEQ ID NO: 83)
[0077] sRNAi are used in pair combinations. The above pairs
comprise SEQ ID NO:44 combined with SEQ ID NO:45 (RNAi1), and SEQ
ID NO:46 combined with SEQ ID NO:47 (RNAi2), and are useful for the
treatment of human patients. Further pairs envisonaged are: SEQ ID
NO:48 combined with SEQ ID NO:49, SEQ ID NO:50 combined with SEQ ID
NO:51, SEQ ID NO:52 combined with SEQ ID NO:53, SEQ ID NO:54
combined with SEQ ID NO:55, SEQ ID NO:56 combined with SEQ ID
NO:57, SEQ ID NO:58 combined with SEQ ID NO:59, SEQ ID NO:60
combined with SEQ ID NO:61, SEQ ID NO:62 combined with SEQ ID
NO:63, SEQ ID NO:64 combined with SEQ ID NO:65, SEQ ID NO:66
combined with SEQ ID NO:67, SEQ ID NO:68 combined with SEQ ID
NO:69, SEQ ID NO:70 combined with SEQ ID NO:71, SEQ ID NO:72
combined with SEQ ID NO:73, SEQ ID NO:74 combined with SEQ ID
NO:75, SEQ ID NO:76 combined with SEQ ID NO:77, SEQ ID NO:78
combined with SEQ ID NO:79, SEQ ID NO:80 combined with SEQ ID
NO:81, SEQ ID NO:82 combined with SEQ ID NO:83.
[0078] As illustrated in the appended examples siRNAs are a
powerfull approach in the treatment of CNS disorders.
[0079] In addition, novel methods to identify molecules useful to
inhibit smad7 RNA or smad7 RNA/protein (smad7 RNP complexes),
including nuclear magnetic resonance (NMR) and fluorescence binding
assays, have been summarized in (Hermann, 2000) and (DeJong, 2002),
and in the references cited therein.
[0080] In a preferred embodiment of the invention the intracellular
binding partner or receptor of Smad7 expression and/or function is
an intracellular antibody.
[0081] Intracellular antibodies are known in the art and can be
used to neutralize or modulate the functional activity of the
target molecule. This therapeutic approach is based on
intracellular expression of recombinant antibody fragments, either
Fab or single chain Fv, targeted to the desired cell compartment
using appropriate targeting sequences (summarized in Teillaud,
1999).
[0082] As mentioned herein above, preferably the inhibitor of Smad7
expression and/or function is an antisense molecule. Preferably
said anti-Smad7 antisense molecule comprises a nucleic acid
molecule which is the complementary strand of a reversed
complementary strand of the coding region of Smad7.
[0083] Coding regions of Smad7 are known in the art and comprise,
inter alia, the Smad7 GenBank entries for mouse Smad7
NM.sub.--008543, AJ00551, AJ000550, the Smad7 rat sequences
NM.sub.--030858, AH008243, AF156730, AF156729, AF156728, AF156727,
AF156726, AF042499 or the human Smad7 sequences entries in GenBank
as XM.sub.--033746, XM.sub.--008803, AF015261 or AF010193. The
person skilled in the art may easily deduce the relevant coding
region of Smad7 in these GenBank entries, which may also comprise
the entry of genomic DNA as well as mRNA/cDNA.
[0084] Furthermore, it is also envisaged that the antisense
molecules against Smad7 expression or function interfere
specifically with promoter regions of Smad7. Such promoter regions
are known in the art and comprise, inter alia, GenBank entries
AF254791 (human), AF156731 (human) or AF188834 (mouse).
[0085] It is envisaged that the antisense molecules to be used in
accordance with the present invention inhibit the expression or
function of Smad7, in particular of human Smad7 and interact with
Smad7 as expressed by the coding regions, mRNAs/cDNAs as deposited
under the above mentioned GenBank accession numbers as well as with
Smad7 as expressed by isoforms and variants of said Smad7. Said
isoforms or variants may, inter alia, comprise allelic variants or
splice variants.
[0086] The term "variant" means in this context that the Smad7
nucleotide sequence and the encoded Smad7 amino acid sequence,
respectively, differs from the distinct sequences available under
said GenBank Accession numbers, by mutations, e.g. deletion,
additions, substitutions, inversions etc.
[0087] Therefore, the antisense-molecule to be employed in
accordance with the present invention specifically interacts
with/hybridizes to one or more nucleic acid molecules encoding
Smad7. Preferably said nucleic acid molecule is RNA, i.e. pre m-RNA
or mRNA. The term "specifically interacts with/hybridizes to one or
more nucleic acid molecules encoding Smad7" relates, in context of
this invention, to antisense molecules which are capable of
interfering with the expression of Smad7. As illustrated in the
appended examples, antisense constructs, like "Smad7-mut4-as" (an
antisense construct comprising 4 mutations) is not capable of
specifically interacting with and/or hybridizing to one or more
nucleic acid sequences encoding Smad7. Accordingly, highly mutated
anti-Smad7 antisense constructs, which are not capable of
hybridizing to or specifically interacting with Smad7-coding
nucleic acid molecules are not to be employed in the uses of the
present invention. The person skilled in the art can easily deduce
whether an antisense construct specifically interacts
with/hybridizes to Smad7 encoding sequences. These tests comprise,
but are not limited to hybridization assays, RNAse protection
assays, Northern Blots, North-western blots, nuclear magnetic
resonance and fluorescence binding assays, dot blots, micro- and
macroarrays and quantitative PCR. In addition, such a screening may
not be restricted to Smad7 mRNA molecules, but may also include
Smad7 mRNA/protein (RNP) complexes (Hermann, 2000; DeJong et al.,
2002). Furthermore, functional tests as provided in the appended
examples are envisaged for testing whether a particular antisense
construct is capable of specifically interacting with/hybridizing
to the Smad7 encoding nucleic acid molecules. These functional
assays comprise in vitro T-cell activation assays; see, inter alia,
example 11. These functional tests may also include Western blots,
immunohistochemistry, immunoprecipitation assay, and bioassays
based on TGFbeta responsive promoters.
[0088] Yet, as also documented in the appended examples mutated
and/or modified antisense constructs may also be employed in
accordance with this invention, provided that said mutated and/or
modified antisense constructs are capable of specifically
interacting with and/or hybridizing to the coding sequences of
Smad7.
[0089] Antisense molecules of Smad7 have been described in the
prior art. For example, U.S. Pat. No. 6,159,697 describes antisense
compounds comprising such antisense-molecules. Yet, U.S. Pat. No.
6,159,697 employs said compounds in the treatment of diseases which
are associated with Smad7 expression. In contrast, the present
invention provides for a specific medical/therapeutic intervention,
where no diseases/conditions associated with Smad7 expression are
to be treated, but specific disorders of the central nervous system
where the systemic administration of TGF-beta was shown to be
detrimental.
[0090] The term "antisense-molecule" as used herein comprises in
particular antisense oligonucleotides. Said antisense
oligonucleotides may also comprise modified nucleotides as well as
modified internucleoside-linkage, as, inter alia, described in U.S.
Pat. No. 6,159,697.
[0091] Most preferably, the antisense oligonucleotides of the
present invention comprise at least 8, more preferably at least 10,
more preferably at least 12, more preferably at least 14, more
preferably at least 16 nucleotides. The deduction as well as the
preparation of antisense molecules is very well known in the art.
The deduction of antisense molecules is, inter alia, described in
Smith, 2000. Usual methods are "gene walking", RnaseH mapping,
RNase L mapping (Leaman and Cramer, 1999), combinatorial
oligonucleotide arrays on solid support, determination of secondary
structure analysis by computational methods (Walton, 2000), aptamer
oligonucleotides targeted to structured nucleic acids (aptastruc),
thetered oligonucleotide probes, foldback triplex-forming
oligonucleotides (FTFOs) (Kandimalla, 1994) and selection of
sequences with minimized non-specific binding (Han, 1994).
[0092] Preferably, the antisense molecules of the present invention
are stabilized against degradation. Such stabilization methods are
known in the art and, inter alia, described in U.S. Pat. No.
6,159,697. Further methods described to protect oligonucleotides
from degradation include oligonucleotides bridged by linkers
(Vorobjev, 2001), minimally modified molecules according to cell
nuclease activity (Samani, 2001), 2'O-DMAOE oligonucleotides
(Prakash, 2001), 3'5'-Dipeptidyl oligonucleotides (Schwope, 1999),
3'methylene thymidine and 5-methyluridine/cytidine h-phosphonates
and phosphonamidites (An, 2001), as well as anionic liposome (De
Oliveira, 2000) or ionizable aminolipid (Semple, 2001)
encapsulation.
[0093] In a preferred embodiment of the invention, the antisense
molecule is a nucleic acid molecule which is the complementary
strand of a reversed complementary strand of the coding region of
Smad7 is selected from the group consisting of SEQ ID NO: 1, SEQ ID
NO: 3 or SEQ ID NO: 5. Sequences as depicted in SEQ ID NOs: 1, 3 or
5 represent illustrative coding regions (mRNA) of human, mouse or
rat Smad7. SEQ ID NOs: 2, 4 and 6 represent translated Smad7 of
human, mouse or rat, respectively. Accordingly, in context of this
invention and as stressed herein above, the Smad7 inhibitors to be
employed in the uses described herein, preferably, interact with
promoter and/or coding regions of nucleic acid molecules which code
for or lead to the expression of Smad7 molecules or shown in SEQ ID
NOs: 2, 4 or 6. It is also envisaged that, e.g., antisense
constructs designed and used in accordance with this invention
inhibit the expression of functional homologues, variants (for
example allelic variants) or isoforms of Smad7-molecules as shown
in SEQ ID NOs: 2, 4 or 6.
[0094] In context of this invention, the term "coding region of
Smad7" comprises not only the translated region of Smad7 cds, but
also comprises untranslated regions. Accordingly, the anti-Smad7
antisense molecule to be used and employed in accordance with this
invention may be antisense molecules which bind to/interact with
mRNA sequences comprising untranslated region. Accordingly, the
"coding region of Smad7" as depicted in SEQ ID NO: 1, 3 and 5
comprises the full mRNA sequences of Smad7.
[0095] In a most preferred embodiment of the present invention, the
anti-Smad7 antisense molecule to be employed in the uses of the
invention or the methods described herein is selected from a
nucleic acid molecule as shown in the following table:
[0096] Preferably, Smad7-Antisense Oligonucleotides, derived from
mouse sequences (5'-3'-direction) are:
TABLE-US-00002 cttcggctgccccacccg (SEQ ID NO: 7) NM_008543, nt
1179-1196, 5'UT atcgtttggtcctgaacat (SEQ ID NO: 8) NM_008543, nt
1437-1455, cds ccctcctcctcgtcctcg (SEQ ID NO: 9) NM_008543, nt
1499-1516, cds gtcgccccttctccccgcag (SEQ ID NO. 10) NM_008543, nt
1545-1564, cds gccgtccgtcgccccttc (SEQ ID NO: 11) NM_008543, nt
1554-1571, cds agcaccgagtgcgtgagc (SEQ ID NO: 12) NM_008543, nt
1718-1735, cds agttcacagagtcgacta (SEQ ID NO: 13) NM_008543, nt
2030-2047, cds ggcaaaagccattcccct (SEQ ID NO: 14) NM_008543, nt
2311-2328, cds gccgatcttgctccgcac (SEQ ID NO: 15) NM_008543, nt
2373-2430, cds, cds
[0097] Relevant mouse Smad7 Genbank entries are NM.sub.--008543
(mRNA sequence) and AJ000551 (mRNA, variation Smad7B, lacks "cag"
(nt 2104-2106 in NM.sub.--008543).
[0098] Most preferably Smad7-Antisense Oligonucleotides of Human
sequences (5'-3'-direction) are:
TABLE-US-00003 ctccggctgccccacccc (SEQ ID NO: 16) AF010193, nt
38-54, 5'UT cgaacatgacctccgcac (SEQ ID NO: 17) AF010193, nt
243-250, 5'UT atcgtttggtcctgaacat (SEQ ID NO: 18) AF010193, nt
296-314, cds ccctcctcctcgtcctcg (SEQ ID NO: 19) AF010193, nt
358-375, cds gtcgccccttctccccgcag (SEQ ID NO: 20) AF010193, nt
404-423, cds gctgtccgtcgccccttc (SEQ ID NO: 21) AF010193, nt
413-430, cds agcaccgagtgcgtgagc (SEQ ID NO: 22) AF010193, nt
577-594, cds agttcgcagagtcggcta (SEQ ID NO: 23) AF010193, nt
889-906, cds ggcaaaagccattcccct (SEQ ID NO: 24) AF010193, nt
1170-1187, cds gccgattttgctccgcac (SEQ ID NO: 25) AF010193, nt
1232-1249, cds ctgccccttcttccaaaa (SEQ ID NO: 26) AF010193, nt
1790-1807, 3'UT actcacacacactcctga (SEQ ID NO: 27) AF010193, nt
1905-1928, 3'UT tgcccaggtactgcctct (SEQ ID NO: 28) AF010193, nt
2076-2093, 3'UT gagatccaggagcagatg (SEQ ID NO: 29) AF010193, nt
2310-2327, 3'UT
[0099] Here, the most relevant human Smad7 Genbank entries are
AF010193 (Smad7 mRNA, complete cds), XM.sub.--033746 (MADH7 mRNA,
variation 1213: /allele="C" /allele="T") and XM.sub.--008803 (MADH7
mRNA, variation 1500: /allele="C" /allele="T")
[0100] Rat Smad7-Antisense Oligonucleotides (5`-3'-direction) which
are preferred are:
TABLE-US-00004 cttcggctgccccacccg (SEQ ID NO: 30) NM_030858, nt
1164-1181, 5'UT atcgtttggtcctgaacat (SEQ ID NO: 31) NM_030858, nt
1422-1440, cds ccctcctcctcgtcctcg (SEQ ID NO: 32) NM_030858, nt
1484-1501, cds gtcgccccttctccccgcag (SEQ ID NO: 33) NM_030858, nt
1530-1549, cds gccgtccgtcgccccttc (SEQ ID NO: 34) NM_030858, nt
1539-1556, cds agcaccgagtgcgtgagc (SEQ ID NO: 35) NM_030858, nt
1703-1720, cds agttcacagagtcgacta (SEQ ID NO: 36) NM_030858, nt
2015-2032, cds ggcaaaagccattcccct (SEQ ID NO: 37) NM_030858, nt
2296-3013, cds gccgatcttgctcctcac (SEQ ID NO: 38) NM_030858, nt
2358-2375, cds
[0101] Here, the relevant rat Smad7 Genbank entry is
NM.sub.--030858 (mRNA, complete cds).
[0102] Furthermore, as documented in the appended examples and
explained herein, modified and/or mutated oligonucleotides are
envisaged in accordance with this invention, an example of such a
oligonucleotide (5'-3'-direction) is gtcgccccttctcccccgcag (SEQ ID
NO: 39).
[0103] Preferably, the antisense molecules to be employed in
accordance with the present invention are 100% complementary to the
mRNA (coding and/or non-coding region) of Smad7 as shown herein;
e.g. SEQ ID NO: 1, 3 or 5 or as shown in GenBank accession numbers
NM.sub.--008543 (mouse), AF010193 (human), NM.sub.--030858 (rat).
Yet, it is also envisaged that said antisense molecule comprises
additional nucleotides, substituted nucleotides, nucleotide
exchanges, nucleotide inversions or nucleotide deletions. However,
as documented in the appended examples, functional antisense
molecules to be employed in the present invention are preferably
more than 85%, more preferably more than 90%, most preferably more
than 95% complementary to the Smad7 mRNA (coding region and/or
non-coding region). For example, most effective anti-Smad7
molecules/antisense molecules comprise nucleotides which are 100%
complementary to the corresponding mRNA. Yet, as also shown in the
appended examples, antisense molecules comprising, inter alia, one
or two additional nucleotides are functional in context of the
invention.
[0104] The invention also relates to a method for preventing,
ameliorating and/or treating a disease of the central nervous
system and/or of diseases related and/or caused by said disease in
a subject comprising administering a specific inhibitor of Smad7
expression or function as defined herein above to a subject in need
thereof. Preferably, said subject is a mammal, most preferably said
mammal is a human.
[0105] A "patient" or "subject" for the purposes of the present
invention includes both humans and other animals, particularly
mammals, and other organisms. Thus, the methods are applicable to
both human therapy and veterinary applications. In the preferred
embodiment the patient is a mammal, and in the most preferred
embodiment the patient is human.
[0106] In a most preferred embodiment of the invention, the disease
of the CNS to be treated by the pharmaceutical composition
comprising a herein defined anti-Smad7 inhibitor is an autoimmune
disease of the CNS, trauma or is cerebral ischemic stroke.
Preferably, said trauma is traumatic brain injury (TBI) or
traumatic spinal cord injury and said cerebral ischemic stroke is
"focal cerebral ischemia". However, global cerebral ischemia,
hypoxic-ischemic brain injury, CNS hypoxia and diseases or
conditions related and/or caused by said diseases share
pathogenetic features including upregulation of TGF-beta with focal
cerebral ischemia and therefore are candidates for the treatment
with Smad7 inhibitors. The appended examples illustrate the
successful and inventive use of Smad7 inhibitors as defined herein
in the treatment of these diseases/disorders. Preferably, said
autoimmune disease is multiple sclerosis. Said multiple sclerosis
may be selected from the group consisting of relapsing-remitting
multiple sclerosis, secondary progressive multiple sclerosis,
primary chronic progressive multiple sclerosis, neuromyelitis
optica (Devic's syndrome), acute disseminated encephalomyelitis,
fulminant multiple sclerosis (Marburg's variant), isolated
autoimmune optic neuritis, isolated autoimmune transverse myelitis,
Balo's concentric sclerosis. All of the aforementioned diseases are
considered subtypes of MS or are CNS autoimmune diseases related to
MS or common early stages of MS prior to clinical definite
diagnosis of MS according to the art. Cerebral ischemic stroke and
CNS trauma involve pathological mechanisms that are shared with MS
and subtypes, e.g. leakage of the blood brain barrier, influx of
immune cells, and microglial activation, leading to a
inflammatory-mediated secondary damage to brain tissue which can be
downregulated by application of antiinflammatory molecules like
TGF-beta. Stroke, e.g. focal hypoxic-ischemic damage of the brain
is characterized by a central necrotic tissue lesion and a
surrounding "penumbra" which can be described as "tissue at risk".
Neuronal cells within this zone are still prone to die for an
extended period of time. TGF-beta expression was reported to be
significantly increased in the penumbra (Slevin, Gunsilius, 2001),
and interpreted as an indication of the amount of salvageable brain
(Ali, 2001). The acute local inflammatory response following
cerebral ischemia is thought to cause part of the perifocal brain
injury. Adenoviral-mediated overexpression of TGF-beta 1 five days
before MCA-occlusion resulted in inhibition of the chemokines MCP-1
and MIP1-alpha and a significantly reduced infarct volume (Pang,
2001). However, when administered after induction of cerebral
ischemia via the contralateral carotid artery in a rabbit model of
thromboembolic stroke TGF-beta did not have significant effect
regarding infarct size or production of excitatory amino acid
levels (Gross, 1994). Nevertheless, TGF-beta apparently has
neuroprotective effects in vivo, as blockade of TGF-beta
interaction with its receptor aggrevated the volume of infarction
in a rat model of stroke (Ruocco, 1999). Therefore it can be
estimated that amplification of signaling via TGF-beta has a
beneficial effect in stroke by saving the not lethally damaged
surrounding cells and finally reducing the infarct volume. With
regard to global brain ischemia the upregulation of TGF-beta1 gene
expression in brain tissue extends from 6 hours to 21 days
(Lehrmann, 1995). Maximum of TGF-beta1 gene induction was
demonstrated to occur between 5 and 7 days after ischemia (Zhu,
2000). The local intraparenchymal injection of TGF-beta1 attenuated
apoptosis and improved postischemic neurological outcome (Zhu,
2002). In transient global ischemia in rats, Henrich-Noack and
colleagues were able to show significant protection of pyramidal
CA1 cells by intrahippocampal injection of TGF-beta1 prior to
ischemia. Several in vivo studies analyzed the effect of
intraarterial or intracerebroventricular administration of
TGF-beta1 before (Gross, 1993) or after induction of ischemia
(Gross, 1994, McNeill, 1994) in a rabbit model of thromboembolic
stroke or a rat model of severe hypoxic-ischemic brain injury,
respectively. These studies showed that either treatment regimen
was associated with a significant reduction of neuronal loss and
infarct size. In transient global ischemia in rats, Henrich-Noack
and colleagues were able to show significant protection of
pyramidal CA1 cells by intrahippocampal injection of TGF-beta1
prior to ischemia (Henrich-Noack, 1996). Similar effects of
increased lesion sizes after application of TGF-beta antagonists in
animal models of excitotoxic damage to the brain suggest that
approaches upregulating TFG-beta effects might be used to protect
from acute excitotoxic injury occurring in traumatic CNS injury
(Hailer, 2001). In some patients with acute traumatic brain injury
an intracerebral production of TGF-beta peaking at the first day
post trauma and possibly conferring a protection against secondary
inflammation-induced brain damage was reported (Morganti-Kossmann,
1999).
[0107] As mentioned herein above, further diseases related and/or
caused by diseases of the central nervous system may be treated by
the use of Smad7 inhibitor, Smad7 antagonist or anti-Smad7
substances as defined herein. These diseases or disorders may be
selected from the group consisting of diabetes, in particular type
I diabetes mellitus. Type I diabetes mellitus is an organ-specific
autoimmune disease and as such comparable to multiple sclerosis. In
addition, recent studies have suggested that patients with type I
diabetes display increased reactivity of peripheral blood T cells
to central nervous system antigens while patients with multiple
sclerosis show significant immune responses to pancreatic islet
antigens (Winer, 2001a). This pattern of interrelated autoimmune T
cell reactivity is also found in animal models of spontaneous
insulin-dependent diabetes. In addition there are similarities in
the T cell response to environmental antigens such as cow milk
protein (Winer, 2001b).
[0108] It is also envisaged that the anti-Smad7, Smad7-inhibitor or
Smad7 antagonists as defined herein are employed in the treatment
or prevention of neurodegenerative disorders, like Alzheimer's
disease or Parkinson's disease.
[0109] Most preferably, the pharmaceutical composition to be
prepared in accordance with this invention and comprising an
anti-Smad7 expression and/or function inhibitor(s) is to be
administered by one or several of the following modes:
Administration can be oral, intravenous, intraarterial,
intratracheal, intranasal, subcutaneous, intramuscular,
intracranial (i.e. intraventricular) or intraspinal (intrathecal),
epidermal or transdermal, pulmonary (e.g. inhalation or
insufflation of aerosol or powder), by delivery to the oral or
rectal mucosa as well as ophthalmic delivery.
[0110] It is, inter alia, envisaged that Smad7 inhibitors, like the
antisense constructs/molecules or siRNAs described herein, are
administered in combination with further compounds/medicaments.
Said further compound/medicament or molecule may, e.g., induce an
upmodulation of TGF-beta or may activate latent TGF-beta. Said
further compound/medicament/molecule may also be an immunomodulator
or an immunosuppressive drug. Such immunomodulators are known in
the art and comprise, inter alia, (recombinant) human
interferon-beta 1a, (recombinant) human interferon-beta 1b or
glatiramer acetate and other drugs/compounds that modulate the
activation, migration, effector function and/or survival of immune
cells. Such compounds may be antibodies or antibody fragments
directed against molecules expressed on cell surfaces (such as
adhesion molecules, cytokine or chemokine receptors, or receptors
for ligands contributing to immune cell activation or immune cell
effector functions) or against circulating molecules such as
cytokines, chemokines, or ligands for receptors mediating immune
cell activation or immune cell effector functions. Such compounds
may also comprise synthetic agonists or inhibitors for cytokine and
chemokine receptors or other endogeneous molecules, such as
adhesion molecules or intracellular transcription or activation
modulatory molecules. Such compounds may also comprise molecules
aimed at modulating antigen specific immune responses (e.g. altered
peptide ligands, T-cell receptor vaccination, DNA vaccination, or
other strategies to modify immune responses). The substances/drugs
to be administered with anti-Smad7 compounds/Smad7 inhibitors
described herein may compromise further substances that supress
growth or activation of immune cells like azathioprine,
mitoxantrone, cyclophosphamide, cyclosporine A, mycophenolate
mofetile, rapamycine, minocycline or methotrexate. Other
drugs/compounds envisaged of immune cells and/or the activation,
migration, effector function and/or survival of immune cells. The
immunosuppressive substances/drugs to be administered with the
anti-Smad7 compounds/Smad7 inhibitors described herein may comprise
azathioprine, mitoxantrone, cyclophosphamide, cyclosporine A,
mycophenolate mofetile, cyclosporine A, rapamycine, minocycline or
methotrexate.
[0111] Dosage and administration regimes for the Smad7-inhibitors
may be established by the physician. For example, for antisense
compounds, like antisense-nucleotides specific dosage regimes have
been established. Such regimes comprise a dosage of 1 mg/kg up to
200 mg/m.sup.2 and are, inter alia, described in Schreibner (2001),
Gastroenterology 120, 1399-1345; Andrews (2001), J. Clin. Oncol.
19, 2189-2200; Blay (2000), Curr. Op. Mol. Ther. 2, 468-472;
Cunnigham (2000), Clin. Cancer Res. 6, 1626-1631; Waters (2000), J.
Clin. Oncol. 18, 1809-1811 or Yacyshyn (1998), Gastroenterology
114, 1133-1142. It is, for example, envisaged that the Smad7
inhibitors described herein, e.g. antisense compounds or RNAi and
the like, be administered in single doses of 0.1 to 25 mg/kg/die
(for example i.v. over 2 to 8 hours), as single or multiple doses
every other day or by continuous infusion(s) of 0.5 to 10 mg/kg/die
over 14 to 21 days with 7 day rest. It is of particular note that
in certain clinical or medical indications it might be desirable to
administer the Smad7-inhibitors as disclosed herein in a single
dose. For example, in an acute traumatic incident (trauma of brain
or spinal cord) or in an ischemic event in the brain (e.g. stroke)
a single administration of the Smad7-inhibitors may suffice to
ameliorate the condition of the affected patient, preferably human
patient. In other disorders of the CNS, like immunological
disorders (e.g. MS), a treatment regime of multiple administrations
may be desired. Yet, further dosage regimes are envisaged and may
easily be established by a physician.
[0112] The Figures show:
[0113] FIG. 1.
[0114] Preventive Smad7-as-ODN-treatment delays onset and
alleviates clinical severity of EAE. Naive mice were injected with
30.times.10.sup.6 PLP-specific LNC as described in Materials and
Methods. In a preventive setting 100 .mu.g Smad7-as-ODN (5 mg/kg/d)
in PBS or an equal volume of PBS were injected i.p. daily from the
day of transfer until the onset of clinical signs in the control
group (day 8). The onset of disease was significantly delayed from
day 14,29.+-.1,10 (mean.+-.SE) to day 27,43.+-.4,28 (p=0,029; Table
1).
[0115] FIG. 2.
[0116] Smad7-as-ODN treatment effect is potentially long lasting
and may be dose dependend. Naive mice were injected with
30.times.10.sup.6 PLP-specific LNC as described in Materials and
Methods. 100 .mu.g of Smad7-as-ODN (5 mg/kg/d) in PBS or an equal
volume of PBS were injected i.p. daily from the day of transfer for
3 weeks, every other day for the following 2 weeks and twice weekly
for the remaining 5 weeks. The difference in median clinical scores
between the experimental groups was statistically significant
between days 15 and 26, on days 28, 40, 41, 50, 53, and between
days 60 and 64 (p.ltoreq.0.05). At day 40 the EAE-prevalence in the
treatment group was 0/6, suggesting a continuous treatment of 5
mg/kg three times weekly to be sufficient for disease
suppression.
[0117] FIG. 3.
[0118] Smad7-as2-ODN-treatment delays onset and alleviates clinical
course of EAE. Naive mice were injected with 5.times.10.sup.6
PLP-specific LNC as described in Materials and Methods. 100 .mu.g
antisense oligonucleotides (5 mg/kg/d) in PBS or an equal volume of
PBS were injected i.p. daily from the day of transfer until the end
of experiment. The onset of disease was delayed in the
Smad7-as2-ODN group from day 10.4.+-.1.66 (mean.+-.SE) to day
15.8.+-.3.69 (Table 3). Smad7-as2-ODN had a more powerful effect
than Smad7-as-ODN, whereas Smad7-mut4-as-ODN (an
antisense-construct which is not capable of specifically
hybridizing to the relevant Smad7 encoding nucleic acid molecule)
deteriorated the clinical course.
[0119] FIG. 4.
[0120] Smad7-as-ODN suppresses the clinical severity of EAE in a
therapeutic manner. Naive mice were injected with 30.times.10.sup.6
PLP-specific LNC as described in Materials and Methods. Mice were
divided in treatment groups of equal EAE-incidence and cumulative
score at the peak of disease (day 12). 100 .mu.g of Smad7-as-ODN (5
mg/kg/d) in PBS or an equal volume of PBS were injected i.p. daily
from day 12 to day 28 and subsequently every other day from day 29
to day 45. The difference in mean EAE-score between the two groups
was statistically significant between days 18 and 20 and between
days 26 and 32 (p.ltoreq.0.05).
[0121] FIG. 5.
[0122] CNS autoimmune disease is preventable by exposing
autoreactive LNC to Smad7-as treatment in vitro. LNC were obtained
from PLP-immunized mice as described in Materials and Methods and
restimulated for 96 hours with 10 .mu.g/ml PLP and 20 .mu.M
Smad7-as-ODN or PBS, respectively. The proliferation was reduced by
approximately 30% as measured by .sup.3H-cytidine intake (not
shown). 5.times.10.sup.6 viable LNC were injected in naive
recipient mice i.p. and clinical score was examined for 20 days
until the peak of disease in the control group was clearly reached.
Mice receiving LNC treated with Smad7-as-ODN did not develop
clinical signs of EAE. This suggests that Smad7-as-ODN-treatment
can prevent the reactivation of primed autoreactive T cells and
block their disease-inducing properties.
[0123] FIG. 6.
[0124] Smad7-as2-ODN suppresses the proliferation of activated LNC
in vitro. PLP-specific LNC were obtained and cultured as described
in Materials and Methods over 96 hours and increasing
concentrations of Smad7-as2-ODN or Smad7-mut4-as-ODN, respectively.
Wells without antisense oligonucleotide or PLP served as controls.
The proliferation of LNC is shown as the mean.+-.standard error of
quadruplicate cultures. A, Smad7-as2-ODN reduced the proliferation
of PLP-restimulated LNC statistically highly significant at
concentrations from 20 .mu.M (*p<0.05, **p<0.005). B,
Smad7-mut4-as-ODN had no effect on LNC-proliferation.
[0125] FIG. 7.
[0126] Smad7-as-ODN diminishes the proliferation of activated LNC
in vitro. PLP-specific LNC were obtained and cultured as described
in Materials and Methods. LNC were restimulated with 10 .mu.g/ml
PLP or 0.2 .mu.g/ml Con A and various concentrations of
Smad7-as-ODN over 96 hours. Wells without antisense oligonucleotide
or PLP served as controls. The proliferation of LNC is shown as the
mean.+-.standard error of quadruplicate cultures. The effect of
Smad7-as-ODN was statistically significant at a concentration of 1
.mu.M (p<0.05).
[0127] FIG. 8.
[0128] Smad7-as-ODN are not toxic against activated LNC.
PLP-specific LNC were obtained and cultured as described in
Materials and Methods. LNC were restimulated with 10 .mu.g/ml PLP
and increasing concentrations of Smad7-as-ODN (initially
8.times.10.sup.5 LNC) or Smad7-as2-ODN (initially 4.times.10.sup.5
LNC) over 96 hours, respectively. Wells without antisense
oligonucleotide served as controls. The viability of LNC is shown
as the mean.+-.standard error of triplicate cultures. Cell
viability was measured by trypan blue exclusion.
[0129] FIG. 9.
[0130] Absence of toxicity of Smad7-as2-ODN against activated LNC.
PLP-specific LNC were obtained and cultured as described in
Materials and Methods. 4.times.10.sup.5 LNC were restimulated with
10 .mu.g/ml PLP and increasing concentrations of Smad7-as2-ODN over
96 hours, Wells without antisense oligonucleotide served as
controls. Cell viability was measured by propidium iodide staining
in Flow-cytometric analysis (2.times.10.sup.4 LNC each). The
viability of LNC is shown as the mean.+-.standard error of
triplicate cultures.
[0131] FIG. 10.
[0132] Smad7-as-ODN treatment in vivo inhibits the priming of
autoreactive T cells. Mice were immunized with 200 .mu.g PLP s.c.
as described above. On days 7, 8, and 9 after immunization the mice
were treated i.p. with either 100 .mu.g Smad7-as-ODN or
Smad7-as2-ODN in PBS, 100 .mu.g of a control random
PTO-Oligonucleotide 5'-atg gac aat atg tct a-3' (SEQ ID NO: 87) in
PBS, or an equal volume of PBS. Lymph nodes of treated mice were
harvested on day 10 and proliferation from LNC cultures was
determined as described above. Cells from PBS-treated mice show a
strong antigen-specific proliferation in contrast to the blunted
proliferative response of cells from mice treated with antisense
molecules (FIG. 11). The cells from the mice treated with
random-ODN proliferated in culture even without adding peptide
antigen.
[0133] FIG. 11.
[0134] In-vivo MRI 7 days after stroke (90 minutes occlusion of the
right middle cerebral artery) in two individual animals treated
either with 400 pmol Smad7-as2-ODN antisense oligonucleotides per
kg body weight (FIG. 11a,b) or with the same amount of the
respective sense oligonucleotides (FIG. 11c,d; treatment control).
Inversion recovery MRI demonstrate a distinct reduction of infarct
volume, especially by preservation of the cerebral cortex, in the
Smad7-antisense treated animal. Similar MRI findings were obtained
in these animals four weeks after ischemia.
[0135] FIG. 12
[0136] Smad7-as2-ODN-treatment reduces CNS inflammation.
Representative mice from the experiment depicted in FIG. 3 were
sacrificed on day 49; paraffin sections of the brain and spinal
cord were prepared, stained for H.-E. and evaluated as described in
Materials and Methods. (a) PBS-treated animal, EAE-grade 2: axial
section of the lumbar part of the spinal cord (obj.-magnification
20.times.). (b) Smad7-mut4-as-ODN-treated animal, EAE-grade 2,5:
longitudinal section of the lower thoracic spinal cord
(obj.-magnification 10.times.). (c) Smad7-as2-ODN-treated animal,
EAE-grade 0: axial section of the lumbar spinal cord
(obj.-magnification: 5.times.). In (a) and (b) EAE-typical
perivascular infiltrates mainly consisting of lymphocytes and
monocytes can be seen; in (c) no inflammation is seen.
[0137] FIG. 13
[0138] No organ toxicity is detected by histopathological
evaluation of Smad7-as2-ODN-treated mice: Selected mice from the
experiment depicted in FIG. 3 were sacrificed on day 49; paraffin
sections of several organs were prepared, stained and evaluated as
described in Materials and Methods. The figure shows representative
sections of organs susceptible to TGF-beta-induced toxicity from a
Smad7-as2-ODN-treated animal; liver (H.-E., obj.-magnification
40.times.), spleen (H.-E. (obj.-magnification 10.times.) and kidney
(Masson-Goldner, (obj.-magnification 20.times.). In particular, no
significant increase in connective tissue production was detected.
In the kidney, a dilatation of the proximal renal tubules and a
widening of the glomerular capsular spaces was observed in mice
from all treatment groups and represents a perfusion artefact. In
the spleen prominent multinucleated macrophages as typical for
EAE-animals were seen in all mice irrespective of treatment. In
addition to the organs shown here, skin, lymph node, colon, heart
and lung were examined.
[0139] FIG. 14
[0140] Smad7-as2-ODN diminishes the proliferation of mitogenically
activated spleen cells.
[0141] Spleen cells were obtained from non-immunized mice and
cultured as described in Materials and Methods using 2 .mu.g/ml
ConA to polyclonally activate T cells and various concentrations of
Smad7-as2-ODN or Smad7-mut4-as-ODN over 96 hours. Wells without
antisense-ODN or ConA served as controls. The proliferation of
spleen cells is shown as the mean.+-.standard error of
quadruplicate cultures.
[0142] FIG. 15
[0143] Smad7-as2-ODN suppress proliferation of splenic CD4.sup.+
and CD8.sup.+ T cells. 10 days after immunization with 200 .mu.g of
PLP.sub.139-151 spleens were dissected and lymphocytes isolated by
Ficoll-Paque Plus. CD4.sup.+ and CD8.sup.+ T cells were sorted on
positive MS-columns using magnetic microbeads coupled to monoclonal
antibodies for CD4 or CD8, respectively. The resulting enriched T
cell (FIG. 15a), CD4.sup.+ (FIG. 15b) and CD8.sup.+ T cell (FIG.
15c) populations were stimulated by plate-bound
anti-mouse-CD3-antibodies for 72 hours in the presence of varying
concentrations of Smad7-as2-ODN or Smad7-mut4-as-ODN as described
in Materials and Methods. Uncoated wells or wells without antisense
PTO-ODN, respectively, served as controls. Results are given as
arithmetic means.+-.standard error from cultures set up at least in
triplicate. A strong suppressive effect of Smad7-as2-ODN on
proliferation is seen at concentrations of 10.mu.M (enriched T
cells) or 20 .mu.M (CD4.sup.+ and CD8.sup.+ T cell subpopulations
was pronounced at concentrations of 20 .mu.M.
[0144] FIG. 16
[0145] Effects of Smad7 antisense-treatment on T cell proliferation
in vitro do not predict efficacy in vivo. PLP-specific LNC were
obtained and cultured as described in Materials and Methods over 96
hours and increasing concentrations of Smad7-as2-ODN, Smad7-as3-ODN
and Smad7-as4-ODN, respectively. Wells without antisense ODN or PLP
served as controls. The proliferation of LNC is shown as the
mean.+-.standard error of at least triplicate cultures. All ODN
dose-dependently suppressed proliferation (FIG. 16a). Smad7-as2-ODN
and Smad7-as3-ODN were then compared with respect to treatment
effect (FIG. 16b): Naive mice were injected with 5.times.10.sup.6
PLP-specific LNC as described in Materials and Methods. 100 pg (5
mg/kg/d) of Smad7-as2-ODN or Smad7-as3-ODN or Smad7-mut4-as-ODN in
PBS or an equal volume of PBS were injected daily from the day of
transfer. Smad7-as2-ODN has a stronger beneficial effect on the
clinical course than Smad7-as3-ODN while Smad7-mut4-as-ODN rather
worsens EAE-signs (FIG. 16b). In the group treated with
Smad7-mut4-as three mice died at early timepoints during the
experiment. By convention they were given a grade 5 in the disease
severity score until the end of the experiment.
[0146] FIG. 17
[0147] Smad7-as2-ODN-treatment in vivo inhibits antigenic priming
responses. Mice immunized with PLP peptide as described in
Materials and Methods were treated with 100 .mu.g (5 mg/kg) of
Smad7-as2 or Smad7-mut4-as-ODN or an equal amount of PBS daily i.p.
from day 6 to day 9 after immunization. LNC from these groups of
mice were restimulated with antigen for 96 hours and used for
proliferation assays as described in Materials and Methods. LNC
from mice treated with Smad7-as2-ODN during antigenic priming
proliferated less vigorously upon specific peptide restimulation as
compared to LNC from mice treated with Smad7-mut4-as-ODN. This
suggests that a blunted primary immune response is the cause for
the reduced LNC encephalitogenicity observed in the experiments of
FIG. 18.
[0148] FIG. 18
[0149] Smad7-as2-ODN-treatment in vivo suppresses the induction of
autoreactive encephalitogenic T cells. Mice immunized with PLP
peptide as described in Materials and Methods were treated with 100
.mu.g (5 mg/kg) of Smad7-as2 or Smad7-mut4-as-ODN or an equal
amount of PBS daily i.p. from day 6 to day 9 after immunization.
LNC from these groups of mice were subsequently restimulated with
antigen for 96 hours and used for adoptive transfer
(5.times.10.sup.6 LNC per recipient mouse) as described in
Materials and Methods. Two separate experiments are shown. LNC from
mice treated with Smad7-as2-ODN either induced a highly attenuated
clinical course (FIG. 18a, compare number of deaths) or did not
induce EAE at all (FIG. 18b).
[0150] FIG. 19
[0151] Preventive treatment with Smad7-specific short interfering
RNAs (siRNAs) alleviates the clinical signs of at-EAE.
5.times.10.sup.6 PLP.sub.139-151-specific LNC, generated as
described in Materials and Methods, were adoptively transferred in
naive mice. Recipient mice were treated twice daily with 20 pmol of
RNAi1 or RNAi2 or an equal volume of PBS i.p. Mice treated with
RNAi1 and RNAi2 show an ameliorated acute disease course as
compared to PBS-treated mice.
[0152] FIG. 20
[0153] Preventive Smad7 antisense-treatment ameliorates the
clinical course in a second disease model relevant for multiple
sclerosis: MOG-induced EAE in rats. Female DA rats were immunized
with 65 .mu.g of recombinant MOG.sub.1-125 in CFA i.c. as described
in Materials and Methods. Rats were treated i.p. with 5 mg/kg
Smad7-as2-ODN or Smad7-mut4-as-ODN or an equal amount of PBS (250
.rho.l) daily starting on day -2 prior to immunization. The
development of clinical signs is delayed in rats treated with
Smad7-as2-ODN as compared to rats treated with PBS.
[0154] FIG. 21
[0155] Local Smad7-as2-ODN-treatment reduces infarct volume as
measured by MR volumetry after transient occlusion of the middle
cerebral artery in rat. MR infarct volumetry was performed to
measure infarct volumes in rats. Occlusion of the middle cerebral
artery was performed as described in Materials and Methods.
Infusion of the ODN into the internal carotid artery was initiated
beginning with reperfusion after 90 min ischemic; rats were treated
with 400 pmol Smad7-as2-ODN per kg body weight (n=8) or
Smad7-sense-ODN (n=8) as described in Materials and Methods. In
vivo infarct volumetry by MRI was performed 7 days and 3 months
after surgery as described in Materials and Methods. At both
timepoints the infarct volume in the rats treated with
Smad7-as2-ODN as compared to Smad7-sense ODN was significantly
reduced (7 days: 1.18.+-.0.26 cm.sup.3 vs. 0.49.+-.0.25 cm.sup.3
(p<0.001); 3 months: 1.36.+-.0.42 cm.sup.3 vs. 0.60.+-.0.28
cm.sup.3, (p<0.001 Student t-test)).
[0156] FIG. 22
[0157] Infarct size as visualized by MRI and by histopathology is
considerably reduced by local Smad7-as2-ODN-treatment after
transient occlusion of the middle cerebral artery in rat. MR
imaging (inversed recovery sequences; coronal and axial
orientation) 7 days and 3 months after ischemia and postmortem
histology including immunostaining for GFAP (glial fibrillary acid
protein) were performed as described in Materials and Methods in
two individual rats either treated with Smad7-sense ODN
(a,b,e,f,i,j) or Smad7-as ODN (c,d,g,h,k,l), respectively. Parts of
this figure correspond to FIG. 11. (FIG. 22a=11c; 22b=11d; 22c=11a;
22d=11b).
[0158] FIG. 23
[0159] SEQ ID NO:1, human Smad7 mRNA
[0160] Target sequences of human Smad7-Antisense Oligonucleotides
SEQ ID No: 16-29 are underlined,one partially overlapping sequence,
corresponding to SEQ ID NO: 21, is shown in italics.
[0161] FIG. 24:
[0162] SEQ ID NO:2, human Smad7 nucleotide sequence
[0163] CDS 296 . . . 1576
[0164] /gene="SMAD7"
[0165] /codonstart=1
[0166] /product="MAD-related gene SMAD7"
[0167] FIG. 25:
[0168] SEQ ID NO:3, Mouse Smad7 mRNA
[0169] Target sequences of mouse Smad7-Antisense Oligonucleotides
SEQ ID No: 7-15 are underlined, one partially overlapping sequence,
corresponding to SEQ ID NO: 11, is shown in italics.
[0170] FIG. 26:
[0171] SEQ ID NO:4, mouse Smad7 Amino Acid sequence
[0172] CDS 1437 . . . 2717
[0173] /gene="Madh7"
[0174] /codon_start=1
[0175] FIG. 27
[0176] SEQ ID NO:5, Rat Smad7 mRNA
[0177] Target sequences of rat Smad7-Antisense Oligonucleotides SEQ
ID No: 30-38 are underlined, one partially overlapping sequence,
corresponding to SEQ ID NO: 34, is shown in italics.
[0178] FIG. 28
[0179] SEQ ID NO:6, rat Smad7 Amino Acid sequence
[0180] CDS 1422 . . . 2702
[0181] /gene="Madh7"
[0182] /codon_start=1
[0183] FIG. 29
[0184] Treatment with Smad7-as2-ODN, but not Smad7-mut4-as-ODN,
suppresses TGFbeta induced Srnad7 mRNA expression in Jurkat
T-cells. Jurkat T-Cells were treated with Smad7-as2-ODN.
Smad7-mut4-AS-ODN or PBS for 4 hours and then incubated with or
without TGFbeta for 30 minutes. Normalized relative amounts of
Smad7 mRNA expression were estimated as described in Materials and
Methods (Example 19).
[0185] The Examples illustrate the invention.
EXAMPLE 1
Methological Part of the Further Examples
[0186] Materials and Methods
[0187] Animals
[0188] Female SJL/J mice were obtained from Harlan Winkelmann
(Borchen, Germany) and from Charles River (Sulzfeld, Germany). Mice
were 8-20 weeks of age when experiments were started. All
procedures were conducted according to protocols approved by the
commission of animal protection at the University of Regensburg.
Mice were housed in normal cages with free access to food and
water; paralyzed mice were afforded easier access to food and
water.
[0189] Antigens
[0190] A serine-substituted peptide 139-151 from proteolipid
protein (PLP), PLP.sub.139-151, was prepared by continuous flow
solid phase synthesis according to the sequence for murine PLP
(HSLGKWLGHPDKF SEQ ID NO: 40) by the Institute of Microbiology.
University of Regensburg, Germany. Amino acid composition of the
peptide was verified by amino acid analysis and purity was
confirmed by mass spectroscopy.
[0191] Induction of Adoptive Transfer EAE
[0192] Each recipient mouse was injected i.v. with 5 to
30.times.10.sup.6 activated PLP.sub.139-151-specific lymph node
cells (LNC) as indicated for the individual experiments. Short term
PLP.sub.139-151-specific T-cell lines were generated by immunizing
SJL/J mice s.c. at four sites across the flank with 200 .mu.g of
PLP.sub.139-151 emusified 1:1 with CFA containing 800 .mu.g of
Mycobacterium tuberculosis H37Ra (Difco Laboratories, Detroit,
Mich., USA) in a total volume of 200 .mu.l/animal. After ten to
eleven days lymph node cells (LNC) derived from draining axillary
and inguinal lymph nodes were harvested and cultured with 10
.mu.g/ml of PLP.sub.139-151 in 24 well plates. The culture medium
was based on RPMI 1640 (Life Technologies Inc.), supplemented with
10% heat-inactivated fetal calf serum (Biochrom KG, Berlin,
Germany), 2 mM L-glutamine, 100 U/ml penicillin, 100 .mu.g/ml
streptomycin, 5.times.10.sup.-5 M 2-ME, 1 mM sodium-pyruvate, 12.5
mM HEPES, and 1% non-essential amino acids (all Life Technologies
Inc.) according to a protocol previously described [Rajan, 2000).
After 96 hours the LNC were harvested and injected into naive SJL/J
recipients.
[0193] Clinical Evaluation
[0194] Mice were examined daily for signs of disease and graded on
a scale of increasing severity from 0 to 5 as follows: 0 no signs;
0.5 partial tail weakness; 1 limp tail or slight slowing of
righting from supine position; 1.5 limp tail and slight slowing of
righting; 2 partial hindlimb weakness or marked slowing of
righting; 2.5 dragging of hindlimb(s) without complete paralysis; 3
complete paralysis of at least one hindlimb; 3.5 hindlimb paralysis
and slight weakness of forelimbs; 4 severe forelimb weakness; 5
moribund or dead. Mice reaching a score of 5 were sacrificed. A
relapse was defined as a sustained increase of at least one full
point for 2 or more days after the animal had improved previously
at least one point and had stabilized for at least 2 days. The day
of onset of clinical signs, the mean maximal score in each
treatment group averaging the maximal score each animal reached at
any time and the cumulative scores of all animals of each treatment
group over defined periods of time were determined as measurements
of disease severity. The number of relapses in a group divided by
the number of the mice of that group was determined as the relapse
rate.
[0195] Antisense PTO-Oligonucleotides and Treatment
[0196] The following single-stranded Smad7-antisense
phosphorothioate (PTO)-Oligonucleotides (ODN) derived from human
Smad-7-mRNA, GenBank AF010193 starting at position 404 from the
mRNA-5'end were used: Smad-7-as-ODN, 5'-gtc gcc cot tct ccc ccg
cag-3' (SEQ ID NO: 39), Smad7-antisense2 ODN 5'-gtc gcc cct tct ccc
cgc ag-3' (SEQ ID NO: 20), and the control Smad7-mut4-antisense ODN
5'-gtc gca ccg tct cac ag cag-3' (SEQ ID NO: 41) were synthesized
by MWG-Biotech (Ebersberg, Germany) and provided in lyophilized
form. PTO-ODN were HPSF.RTM.-purified. The amino acid composition
and purity were confirmed by MALDI-TOF (Matrix Assisted Laser
Desorption Ionization--Time of Flight)-Mass spectrometry. For the
experiments described, the PTO-Oligonucleotides were dissolved in
PBS at 0.4 .mu.g/.mu.l and adjusted to neutral pH. In treatment
experiments 100 .mu.g Smad7-antisense PTO-Oligonucleotides were
injected i.p. daily (5 mg/kg/d), every other day or twice per week
as indicated in the experiments. Distribution to treatment groups
was performed by randomization. Mice injected with equal amounts of
PBS or Smad7-mut4-antisense PTO-Oligonucleotide served as
controls.
[0197] Transfer of in vitro PTO-Oligonucleotide-Treated LNC
[0198] Mice were immunized with 200 .mu.g PLP s.c. as described
above. On day 10 lymph nodes were harvested and LNC cultured with
20 .mu.M of Smad7-antisense PTO-Oligonucleotide and 10 .mu.g/ml PLP
as indicated above. After 96 hours the LNC were harvested and
injected into naive SJL/J recipients.
[0199] In vitro T-Cell Proliferation Assays
[0200] Spleen and draining lymph nodes cells were dissected from
animals immunized with 200 .mu.g of PLP.sub.139-151emusified in 200
.mu.l CFA containing 250 .mu.g Mycobacterium tuberculosis H37Ra
10-11 days previously. LNC were cultured in 96-well plates
(Corning-Costar, Cambridge, Mass., USA) at 4.times.10.sup.5 viable
cells/well in a total volume of 200 .mu.l RPMI 1640-based medium,
as described above. Cells were cultured at 37.degree. C. in 100%
humidity and 5% CO.sub.2 in the presence or absence of
PLP.sub.139-151 at a concentration of 10 .mu.g/ml. Concanavalin A
(Sigma Chemical Co.) was used at a concentration of 0.2-0.5
.mu.g/ml. To determine the effect of the antisense
PTO-Oligonucleotides, varying concentrations were added at a fixed
antigenic concentration. Wells without antisense
PTO-Oligonucleotides or antigenic peptide, respectively, were used
as controls. LNC were pulsed with 1 .mu.Ci of .sup.3H-thymidine
(NEN Life Science Products, Boston, Mass., USA) after 72 hours,
harvested at 96 hours, and .sup.3H-thymidine uptake was detected
using a Packard Topcount microplate scintillation counter (Packard
Instrument Co., Meriden, Connecticut, USA). Results are given as
arithmetic means.+-.standard error from cultures set up at least in
triplicate.
[0201] Priming Studies
[0202] Mice were immunized with 200 .mu.g PLP s.c. as described
above. On days 7, 8, and 9 after immunization the mice were treated
i.p. with either 100 .mu.g Smad7-as-ODN or Smad7-as2-ODN in PBS,
100 .mu.g of a control random PTO-Oligonucleotide 5'-atg gac aat
atg tot a-3' (SEQ ID NO: 42) in PBS, or an equal volume of PBS.
Lymph nodes of treated mice were harvested on day 10 and
proliferation from LNC cultures was determined as described
above.
[0203] Toxicity Assays and Flow-Cytometric Analysis
[0204] PLP.sub.139-151-primed LNC were derived as described above
and cultured with or without 10 .mu.g/ml PLP-peptide in 96-well
microtiter plates at 4 or 8.times.10.sup.5 viable cells/well in 200
.mu.l RPMI 1640 medium, as described above. Smad7-antisense
PTO-Oligonucleotides were added in increasing concentrations. After
96 hours the viability of cells was measured both by trypan blue
exclusion and by flow-cytometry using propidium iodide (10.sup.4
cells/sample) respectively. Data collection and analysis were
performed on a FACSCalibur flow cytometer (Becton Dickinson,
Franklin Lakes, N.J., USA). Results are given as arithmetic
means.+-.standard error from cultures set up at least in
triplicate.
[0205] Histology
[0206] Selected mice were killed with CO.sub.2. Brain, spinal cord,
lymph node, spleen, liver, kidney, colon, heart, lung and skin
tissues were fixed in PFA 4%. Paraffin sections (4-6 .mu.m) were
made and stained with hematoxylin-eosine, luxol fast blue, and by
the Bielschofsky and Masson-Goldner stainings, according to
standard protocols. At least 2 coronal sections from three
rostro-caudal brain-levels and at least 2 longitudinal and coronal
sections from cervical, thoracic and lumbosacral levels of the
spinal cord were evaluated in a blinded fashion. To screen for
treatment toxicity at least 2 coronal sections from all other
tissues were evaluated in in a blinded fashion by an experienced
veterinarian.
[0207] Statistical Analysis
[0208] Differences in clinical scores of mice and cellular
proliferation between groups were analyzed by Student's to test for
unpaired samples. P values less than 0.05 were considered
significant. For the plots mean value and standard error of the
mean (SE) were calculated.
EXAMPLE 2
Preventive Smad7 Antisense-Treatment Delays Onset and Alleviates
Clinical Course in at-EAE
[0209] Adoptive-transfer EAE was induced in SJL mice by injection
of activated PLP.sub.139-151-specific LNC. Clinical disease started
after 8-15 days, followed by partial recovery and one or more
relapses (FIG. 1-4). In three consecutive experiments the effect of
Smad7-as PTO-Oligonucleotides (Smad7-as-ODN) in vivo on the
development of at-EAE was tested. Following LNC-transfer, mice were
initially treated with 100 .mu.g Smad7-as-ODN daily from day 0 (5
mg/kg/d) until the onset of clinical signs in the control group
each (FIG. 1). Interestingly, the onset of disease was delayed by
almost two weeks (Table 1). Subsequently, although there was no
difference in EAE-incidence, maximal score per animal and relapse
rate, the clinical course was mitigated, as documented by the
cumulative disease scores, in particular during the chronic stage
of EAE (days 61-90, Table 1, FIG. 1).
TABLE-US-00005 TABLE 1 Smad7-as PBS group size n = 7 n = 7
EAE-incidence 7/7 7/7 EAE-prevalence (day 16) 1/7 6/7
EAE-prevalence (day 43) 5/7 7/7 EAE-prevalence (day 90) 1/7 4/7 day
of onset (mean .+-. SE) 27.43 .+-. 4.28 14.29 .+-. 1.10 max. score
(mean .+-. SE) 2.86 .+-. 0.24 3.0 .+-. 0.59 cumulative score (d
1-30) 101.5 209 cumulative score (d 31-60) 220 307.5 cumulative
score (d 61-90) 103.5 300.5 relapse rate (mean .+-. SE) 0.71 .+-.
0.33 0.57 .+-. 0.19 relapse (number/animals) 5/3 4/4
[0210] Effects of preventive Smad7-as-ODN treatment on clinical
course of EAE (I). Groups of seven mice were treated with 100 .mu.g
Smad7-as-ODN (5 mg/kg/d) in PBS or an equal volume of PBS i.p.
daily from the day of transfer until the onset of clinical signs in
the control group. The clinical course was mitigated by
Smad7-as-ODN, as indicated by the EAE-score (see FIG. 1), the
cumulative disease scores and the EAE-prevalence on days 16, 43 and
90. There was no difference in EAE-incidence, mean maximal score
and relapse rate.
[0211] Initiating treatment at the day of transfer but extending
the treatment period across the chronic disease stage as indicated
in FIG. 2 revealed that the treatment effect is potentially long
lasting and may be dependent on the dose or the frequency of
application, respectively (FIG. 2, Table 2). Only when the
administrations were tapered from initially daily to ultimately
twice weekly for the last 6 weeks of observation there appeared to
be a slight increase in disease activity (FIG. 2) with the
initially diseased mouse having 2 relapses and another one a first
exacerbation. Altogether a remarkable reduction in EAE-incidence,
mean maximal score, absolute number of relapses (2 vs. 10) and
relapse rate (0.33.+-.0.30 vs. 1.67.+-.0.30) was observed (Table
2).
TABLE-US-00006 TABLE 2 Smad7-as PBS group size n = 6 n = 6
EAE-incidence 2/6 6/6 EAE-prevalence (day 14) 1/6 5/6
EAE-prevalence (day 35) 0/6 2/6 EAE-prevalence (day 60) 2/6 6/6
max. score (mean .+-. SE) 0.67 .+-. 0.45 2.42 .+-. 0.14 relapse
rate (mean .+-. SE) 0.33 .+-. 0.30 1.67 .+-. 0.30 relapse
(number/animals) 2/1 10/6
[0212] Effects of preventive Smad7-as-ODN treatment on clinical
course of EAE (II). Groups of six mice were treated with 100 .mu.g
Smad7-as-ODN (5 mg/kg/d) or PBS daily and then tapered to
ultimately twice weekly as indicated in FIG. 2.
[0213] Significant differences between groups were noted for mean
maximal score (p=0.015) and relapse rate (p=0.018).
[0214] This experiment suggested a treatment regimen of 5 mg/kg
three times weekly to be sufficient to obtain long-lasting
suppression of clinical signs. While Smad7-as-ODN contained an
extra cytidine between position 124 and 125 of human Smad7-mRNA,
the 20mer Smad7-as2-ODN lacks this cytidine. Treatment with the
fully complementary Smad7-as2-ODN molecule appeared to be much more
effective in later time points compared to Smad7-as-ODN. However,
the antisense molecule comprising an additional nucleotide still
appeared to be a valuable reagent during earlier time points; see
FIG. 3. Yet, the documented Smad7-as2-ODN proved to have a more
powerful treatment effect with regard to EAE-incidence, day of
onset and mean maximal score than vehicle or Smad7-as-ODN (Table
3). Yet, appended Table 3 clearly documents the powerful effect of
mutated as well as "wildtype" antisense molecules. The control
PTO-Oligonucleotide Smad7-mut4-as, which is altered in 4
nucleotides compared to Smad7-as2-ODN did not have a protective
effect on the development of acute disease (FIG. 3). The
administration of 100 .mu.g Smad7-mut4-as daily rather resulted in
an earlier, more severe and prolonged first exacerbation compared
to the groups receiving Smad7-as2-ODN, Smad7-as-ODN or PBS (Table
3).
TABLE-US-00007 TABLE 3 Smad7-mut4- Smad7-as Smad7-as2 PBS as group
size n = 7 n = 6 n = 6 n = 6 EAE-incidence 6/7 5/6 5/6 5/6
EAE-prevalence (day 12) 5/7 3/6 4/6 5/6 EAE-prevalence (day 30) 6/7
2/6 4/6 5/6 day of onset (Mean .+-. SE)* 10.67 .+-. 0.81 15.80 .+-.
3.69 10.40 .+-. 1.66 8.33 .+-. 1.12 max. score (mean .+-. SE) 2.36
.+-. 0.37 1.67 .+-. 0.35 2.58 .+-. 0.61 3.25 .+-. 0.68 deaths 0 0 1
2 *sick animals only
[0215] Effects of preventive Smad7-as-ODN treatment on clinical
course of EAE (Ill). Groups of six to seven mice were treated with
100 .mu.g Smad7-as-ODN, Smad7-as2-ODN, the mutated control
Smad7-mut4-as-ODN (5 mg/kg/d each) or PBS daily from the day of
transfer as shown in FIG. 3. Mean maximal score and EAE-prevalence
on days 12 and 30 were remarkably reduced in the Smad7-as2-ODN
group. Smad7-as-ODN treatment resulted in a slightly reduced mean
maximal score with no EAE-related deaths occurring.
[0216] Histology
[0217] Brain and spinal cord of representative mice of the
experiment depicted in FIG. 3 were evaluated histologically.
PBS-treated mice showed typical monocuclar infiltrates in spinal
cord and brain. The extent of CNS inflammation correlated with the
clinical scores with high scores associated with many dense
infiltrates extending from submeningeally deep into the white
matter. Smad7-as2-ODN treated mice showed less CNS inflammation
than mice treated with Smad7-mut4-as-ODN or PBS.
[0218] Smad7as-treatment at peak of disease alleviates clinical
course in at-EAE An additional experiment was performed to examine
whether Smad7-antisense ODN administration is therapeutically
effective (FIG. 4). Treatment with 100 .mu.g Smad7-as-ODN initiated
at the peak of acute disease and administered once daily for 17
days and then every other day for 17 days partially diminished the
clinical disease severity. After 18 days of treatment three out of
four mice had recovered completely from clinical disease (Table 4).
The EAE-score was decreased significantly between days 18-20 (i.e.
approximately 1 week after treatment initiation) and days 26-32
post transfer. The better outcome of mice treated with Smad7-as-ODN
is confirmed by comparing the cumulative disease scores from days
12-60, i.e. the end of the observation period (Table 4). This
documents the therapeutic potential of
Smad7-as-PTO-Oligonucleotides for ongoing autoimmune CNS
disease.
TABLE-US-00008 TABLE 4 Smad7-as PBS group size n = 5 n = 5
EAE-incidence 5/5 5/5 EAE-prevalence (day 12) 4/5 3/5
EAE-prevalence (day 30) 1/5 5/5 EAE-prevalence (day 50) 1/5 3/5
cumulative score (d 1-12) 24 24.5 cumulative score (d 12-60) 137.5
239.5 relapse rate (mean .+-. SE) 0.4 .+-. 0.22 0.4 .+-. 0.22
relapse (number/animals) 2/2 2/2
[0219] Effects of therapeutic Smad7-as-ODN treatment on clinical
course of EAE. Groups of five mice were treated with 100 .mu.g of
Smad7-as-ODN or PBS starting at the peak of disease (FIG. 4). After
18 days of treatment 3 out of 4 diseased mice had clinically
recovered completely. The cumulative disease score showed a
remarkable reduction in the Smad7-as-ODN group.
EXAMPLE 3
Transfer of in vitro Smad7-Antisense-Treated LNC Fails to Induce
at-EAE
[0220] It was also investigated wether Smad7-as-ODN-treatment
interferes with reactivation of PLP-specific T-cells in vitro and
alters the encephalitogenicity of these cells. Therefore freshly
isolated LNC from PLP-immunised SJL mice were restimulated with
PLP(139-151) for 96 hours adding 20 .mu.M of Smad7-as-ODN. The
proliferation of cells cultured in the presence of Smad7-as-ODN was
reduced by approximately 30% as compared to the PBS-treated cells
(data not shown). While the injection of 5.times.10.sup.6
PBS-treated LNC in naive recipients induced typical EAE-signs
starting at day 9, the transfer of Smad7-as-ODN--treated LNC failed
to induce clinical signs during the observation period of 3 weeks
(FIG. 5). This suggests that Smad7-as-ODN-treatment can prevent the
reactivation of primed autoreactive T cells and block their
disease-inducing properties.
EXAMPLE 4
Smad7-Antisense-Treatment Diminishes the Proliferation of Activated
LNC in vitro
[0221] To analyze the potential mechanisms of the treatment effect,
we examined the effect of Smad7-as-ODN on antigen-restimulation of
PLP-primed LNC in vitro. Coincubation of primed LNC and antigen
with Smad7-as2-ODN for 96 hours dose-dependently suppressed
proliferation (FIG. 6a), whereas the presence of Smad7-mut4-as-ODN
which has only 80% complementarity to the Smad7 mRNA did not have
an effect on LNC-proliferation at all (FIG. 6b). The reduction of
proliferation by Smad7-as2-ODN was statistically highly significant
(p<0.005) at concentrations of 20 .mu.M. Smad7-as-ODN also
potently inhibited proliferation of PLP-restimulated as well as
ConA-stimulated LNC at a concentration as low as 1 .mu.M (FIG. 7).
Smad7-as-ODN did not have pro- or antiproliferative effects on
resting LNC in low concentrations (FIG. 7).
EXAMPLE 5
Absence of Toxicity of Smad7-Antisense Oligonucleotides Against
Activated LNC in vitro
[0222] To exclude a toxic effect of Smad7-as-ODN against LNC as a
possible explanation for the highly reduced proliferation rate in
vitro toxicity assays with trypane blue staining were performed.
Comparing 20.mu.M Smad7-as-ODN with PBS added to LNC cultures
restimulated with peptide, no decrease in the proportion of viable
cells was observed. When PLP-primed LNC were restimulated with PLP
and coincubated with Smad7-as-ODN in increasing concentrations for
96 hours no significant loss of cell viability was observed in
concentrations up to 100 .mu.M (FIGS. 8 and 9). Using Smad7-as2-ODN
a reduction of viable cells was only seen at >50 .mu.M (100
.mu.M). This result was confirmed by FACS-analysis and propidium
iodide staining. Even at concentrations of 50 .mu.M Smad7-as2-ODN
which potently suppress T cell proliferation the viability of the
LNC was not significantly affected.
EXAMPLE 6
Long Term Smad7-Antisense-Treatment Leads not to Adverse Side
Effects Locally or Systemically
[0223] Mice treated with Smad7-as- or Smad7-as2-ODN did not show
obvious changes of behavior and did not look different from control
mice except for signs produced by EAE itself. Autopsy of the
animals immediately after cervical dislocation showed no signs of
pathologic changes. Histological evaluation including HE and
Masson-Goldner staining gave no hints of increased production of
connective tissue in all organs examined (brain, spinal cord,
liver, kidney, spleen, lung, heart, skin). A dilatation of the
proximal renal tubules and a widening of the glomerular capsular
space was observed in kidneys of animals of all treatment groups,
including mice treated with PBS. In addition, prominent
multinucleated macrophages were detected in spleens, as typical for
EAE, with no difference between treatment groups.
EXAMPLE 7
Priming
[0224] Treatment with Smad7-as-ODN in vivo inhibits the induction
of an autoreactive T cell response. Cells from PBS-treated mice
show a strong antigen-specific proliferation in contrast to the
blunted proliferative response of cells from mice treated with
antisense molecules (FIG. 10). The cells from the mice treated with
random-ODN proliferated in culture even without adding peptide
antigen.
EXAMPLE 8
Smad7-Antisense-Treatment Attenuates Ischemic Injury in a Model of
Focal Cerebral Ischemia (Stroke)
[0225] The biological effects of Smad-7-antisense oligonucleotide
application were also tested in a rodent model of focal cerebral
ischemia. After 90-minutes intraluminal filament occlusion of the
right middle cerebral artery in adult rats, either 400 pmol
Smad7-as2-ODN (SEQ ID NO: 20) antisense oligonucleotides per kg
body weight or the same amount of the respective Smad7-sense
oligonucleotide 5'-ctgcggggagaaggggcgac-3'(SEQ ID NO: 43) as a
treatment control, respectively, were infused into the right
internal carotid artery continuously during the first 60 minutes of
reperfusion. Rats underwent Magnetic Resonance Imaging (MRI) after
7 days and 4 weeks for in-vivo infarct volumetry. Afterwards,
animals were sacrificed for histological evaluation of the ischemic
brain injury. Data from a series of experiments showed a reduction
of infarct volume in Smad7-antisense-treated rats as compared to
controls. The ischemic infarction in Smad7-antisense-treated rats
predominantly was restricted to the basal ganglia, whereas, the
overlying cerebral cortex was well preserved (FIG. 11). Since this
pattern of ischemic lesion is very similar to that observed in
recent experiments, using anti-apoptotic compounds, tentative
interpretation of these results with Smad7-antisense application in
focal cerebral ischemia strongly support the idea that inhibition
of Smad7, i.e. reinforcement of the effects of tumor growth
factor-beta (TGF-beta), features anti-inflammatory and
anti-apoptotic neuroprotective effects in the ischemic
penumbra.
EXAMPLE 9
Methodological Part of the Further Examples Related to EAE
Experiments in Mice
[0226] Material and Methods are described for the examples 10 to 14
and only if they have not been detailed within example 1. All
procedures were conducted according to protocols approved by the
commission of animal protection at the University of
Regensburg.
[0227] Smad7-Antisense-ODN
[0228] In addition to Smad7-as2-ODN (SEQ ID NO: 20) and
Smad7-as-ODN (SEQ ID NO: 39) used in the examples 2-8,
Smad7-as3-ODN (SEQ ID NO:21) and Smad7-as4-ODN (SEQ ID NO: 9) were
used for treatment experiments and/or T cell proliferation
assays.
[0229] T Cell Proliferation Assays:
[0230] Spleens were dissected and lymphocytes isolated by
Ficoll-Paque Plus (Amersham Biosciences, Uppsala, Sweden).
CD4.sup.+ and CD8.sup.+ T cells were positively selected on
MS-columns using magnetic microbeads coupled to anti-mouse-CD4 or
anti-mouse- CD8, respectively (all Miltenyi Biotec, Bergisch
Gladbach, Germany). The resulting enriched T cells (FIG. 17a),
CD4.sup.+ (FIG. 17b) and CD8.sup.+ T cell (FIG. 17c) populations
were stimulated on microtiter plates coated with
anti-mouse-CD3-antibodies (Becton Dickinson, Two Oak Park, Bedford
Mass., USA) for 72 hours in the presence of varying concentrations
of Smad7-as2-ODN or Smad7-mut4-as-ODN as described in Materials and
Methods. Uncoated wells or wells without antisense PTO-ODN,
respectively, served as controls. Proliferation was measured by
.sup.3H-thymidine uptake as described above. Results are given as
arithmetic means.+-.standard error from cultures set up at least in
triplicate.
[0231] Priming Studies
[0232] The priming studies described in FIGS. 18 and 19 and example
17, respectively, were performed similarly to those described in
FIG. 10/example 7. Treatment of immunized mice was performed
between days 6 to 9 post immunization with 100 .mu.g Smad7-as2-ODN
or Smad7-mut4-as ODN or an equal amount of PBS, respectively. Mice
were immunized with 200 .mu.g PLP s.c. as described above. LNC
cultures, adoptive transfer and proliferation assays were performed
as described above.
[0233] Treatment with Smad7-Specific Short Interfering RNAs
(siRNAs)
[0234] The following Smad7 (AF015260) RNA oligonucleotides were
used:
TABLE-US-00009 RNAi1: nt 3-23 5'-GUUCAGGACCAAACGAUCUGC-3', (SEQ ID
NO: 44) nt 23-1 5'-GCAGAUCGUUUGGUCCUGAACAU-3'. (SEQ ID NO: 45)
RNAi2: nt 283-303 5'-CUCACGCACUCGGUGCUCAAG-3', (SEQ ID NO: 46) nt
303-281 5'-CUUGAGCACCGAGUGCGUGAGCG-3'. (SEQ ID NO: 47)
[0235] The RNA oligonucleotides were chemically synthesized on an
Applied Biosystems Synthesizer (Expedite 8909) using standard
protocols by Ribopharma AG, Kulmbach. For annealing of siRNAs, 20
.mu.M single strands were incubated in annealing buffer for 1min at
90.degree. C. followed by 1 h at 37.degree. C. (Elbashir, 2001a,
Elbashir, 2001b). Starting with the day of transfer EAE-induced SJL
mice were injected twice daily i. p. with 20 pmol annealed RNAi
molecules solubilized in PBS (100 pmol/ml, pH 7,4).
EXAMPLE 10
Histopathology of Preventive Smad7 Antisense-Treatment in vivo
[0236] The histopathology of Smad7 antisense-treatment as seen in
FIG. 13 in vivo is already described in example 2. The
histopathological evaluation of organs outside of the CNS, as seen
in FIG. 14, is described in example 6. The figures illustrate that
treatment with Smad7-as2-ODN suppresses inflammation within the CNS
without inducing side-effects in non-CNS organs known to be
affected by systemic administration of active TGF-beta.
EXAMPLE 11
Smad7 Antisense-Treatment Suppresses the Proliferation of
Polyclonally Activated T Cells in vitro
[0237] This example provides evidence that antisense ODN specific
for Smad7 dose-dependently inhibit the proliferative response
associated with T cell activation mediated by the lectin Con A and
plate-bound anti-CD3-antibodies.
[0238] In the first experiment whole spleen cell populations were
stimulated over 96 hours with the lectin Con A (mediating
polyclonal T cell activation) in the presence of varying
concentrations of Smad7-as2-ODN (SEQ ID NO: 20) or
Smad7-mut4-as-ODN (FIG. 14). Only Smad7-as2-ODN (SEQ ID NO: 20)
significantly reduced proliferation. In the second experiment
plate-bound anti-CD3 antibodies were used to stimulate T cells
enriched over Ficoll, confirming this result (FIG. 15a). To
determine whether this effect is limited to CD4+ or CD8+-T cells
the respective subpopulations were isolated and stimulated with
anti-CD3; the antiproliferative effect of Smad7-as2-ODN extends to
both CD4+ or CD8+-T cells (FIGS. 15b and 15c).
EXAMPLE 12
Effects of Smad7 Antisense-Treatment in vivo
[0239] To screen for further Smad7-specific antisense ODN
potentially effective for treatment of autoimmune disease,
Smad7-as3-ODN (SEQ ID NO: 21) and Smad7-as4-ODN (SEQ ID NO: 9) were
tested in parallel with Smad7-as2-ODN (SEQ ID NO: 20) for their
effect on PLP.sub.139-151-specific LNC proliferation (FIG. 16a).
All ODN tested dose-dependently suppressed proliferation, albeit
with some variability between experiments (compare the effect of
Smad7-as2-ODN in FIGS. 6, 14, 15, 16). Smad7-as3-ODN was somewhat
less effective than Smad7-as2-ODN in preventing the development of
EAE-signs when administered i.p. at a dose of 5 mg/kg daily from
the day of adoptive transfer as described in Materials and Methods
(FIG. 16b, table 5). This example supplements the results from
example 2 (table 3) and example 4 in showing that various ODN
specific for Smad7 suppress proliferation of T cells to a similar
extent while the treatment effect on adoptive transfer EAE varies
between ODN of different sequence.
TABLE-US-00010 TABLE 5 Smad7-mut4- Smad7-as2 Smad7-as3 as PBS group
size n = 7 n = 7 n = 7 n = 7 EAE-incidence 7/7 111 7/7 7/7
EAE-prevalence (day 11) 2/7 3/7 7/7 7/7 day of onset (mean .+-. SE)
12.86 .+-. 0.84 11.86 .+-. 0.91 9.29 .+-. 0.60 9.29 .+-. 0.30 max.
score (mean .+-. SE) 2.36 .+-. 0.17 2.5 .+-. 0.17 3.93 .+-. 0.36
2.71 .+-. 0.14 cumulative score (d 1-28) 167.0 234.0 467.5 280.0
deaths 0 0 3 (d 7, 9, 11) 0
[0240] Effects of preventive treatment with various
Smad7-antisense-ODN. In the group treated with Smad7-mut4-as (an
antisense molecule which is not capable of specifically interacting
with or hybridizing to a Smad7 expression product (mRNA) or
specifically interacting with/hybridizing to one or more nucleic
acid molecules encoding Smad7) three mice died at early timepoints
during the experiment. By convention they were given a grade 5 in
the disease severity score until the end of the experiment.
EXAMPLE 13
Smad7 Antisense-Treatment Suppresses in vivo Priming Responses
[0241] This examples add to data from example 7 in demonstrating
that in vivo antigenic priming responses of autoreactive T cells
are blunted during Smad7-as2-ODN-treatment and result in T cells of
reduced encephalitogenicity. Mice immunized with PLP peptide were
treated with 100 .mu.g (5 mg/kg) of Smad7-as2 or Smad7-mut4-as-ODN
or an equal amount of PBS daily i.p. from day 6 to day 9 after
immunization. LNC from these groups of mice were subsequently
restimulated with antigen for 96 hours and used for proliferation
assays (FIG. 17) and EAE-induction by adoptive transfer
(5.times.10.sup.6 LNC per recipient mouse) (FIG. 18).
[0242] LNC from mice treated with Smad7-as2-ODN during antigenic
priming proliferate less vigorously upon specific peptide
restimulation as compared to LNC from untreated mice or from mice
treated with Smad7-mut4-as-ODN (FIG. 17).
[0243] In FIG. 18, two separate experiments are shown. In contrast
to LNC derived from mice treated with Smad7-mut4-as-ODN or PBS, LNC
from mice treated with Smad7-as2-ODN either induced a highly
attenuated clinical course (FIG. 18a, compare number of deaths) or
did not induce EAE at all (FIG. 18b). The in vitro results from
FIGS. 10 (example 7) and 17 suggest that this is due to partial
inhibition of primary immune responses in
Smad7-antisense-ODN-treated mice with the consequence that, upon
antigenic stimulation, the disease-inducing capacity of the
resulting T cells is considerably compromised.
EXAMPLE 14
Preventive Treatment with Smad7-Specific Short Interfering RNAs
(siRNAs) Alleviates the Clinical Course in at-EAE
[0244] The efficacy of Smad7-antisense-ODN treatment suggests that
approaches targeting Smad7 mRNA or Smad7 protein, resulting in a
reduction of mRNA and/or protein or their functional inhibition may
be similarly effective for the in vivo treatment of disease.
Therefore Smad7-specific short interfering RNAs (siRNAs) were
synthesized and used for the treatment of adoptive transfer EAE
(FIG. 19, table 6). Preventive treatment with two of these
Smad7-specific siRNAs (RNAi1, RNAi2) resulted in an amelioration of
clinical signs of EAE during the acute phase of the disease as
compared to PBS-treated mice.
TABLE-US-00011 TABLE 6 Smad7-RNAi1 Smad7-RNAi2 PBS group size n = 7
n = 7 n = 7 EAE-incidence 7/7 7/7 7/7 EAE-prevalence (day 11) 4/7
5/7 7/7 day of onset (mean .+-. SE) 11.29 .+-. 0.94 11.14 .+-. 0.87
9.29 .+-. 0.30 max. score (mean .+-. SE) 2.36 .+-. 0.19 2.5 .+-.
0.2 2.71 .+-. 0.14 cumulative score (d 1-31) 241.5 244.5 314.5
Deaths 0 0 0
[0245] Preventive treatment with Smad7-specific short interfering
RNAs (siRNAs).
EXAMPLE 15
Methodological Part of the Examples Related to EAE Experiments in
Rats
[0246] Animals:
[0247] Female Dark Agouti-rats (DA-rats) were obtained from Harlan
Winkelmann (Borchen, Germany). Rats were 13 weeks old when used for
immunization procedures. Rats were housed in normal cages with free
access to food and water; paralyzed rats were afforded easier
access to food and water.
[0248] Antigens:
[0249] The N-terminal fragment of rat myelin oligodendrocyte
glycoprotein (MOG) containing the amino acids 1-125 (cDNA obtained
as a kind gift from C. Linington, Munich) were expressed in
Escherichia coli and purified to homogeneity by chelate
chromatography as described by Amor (Amor, 1994). The amino acid
sequence of recombinant ratMOG protein (AA 1-125) depicted in SEQ
ID NO: 84 further comprises a 6xHis peptide tag introduced for the
ease of purification. The purified protein in 6M urea was dialyzed
against PBS and the preparations obtained were stored at
-20.degree. C. For simplicity this MOG-fragment used is named "MOG"
in the remainder of this application.
[0250] Induction, treatment and evaluation of MOG-induced EAE:
[0251] An emulsion was prepared containing 65 .mu.g MOG in PBS and
an equal volume of incomplete Freund's adjuvant supplemented with
400 .mu.g of Mycobacterium tuberculosis (H37RA, see example 1) in
an inoculation volume of 200 .mu.l per immunized rat. Immunizations
were performed in anesthetized rats intradermally at the base of
the tail.
[0252] Treatment with Smad7-as2-ODN or Smad7-mut4-as-ODN or an
equal amount of PBS was performed as indicated in the examples 1
and 9. Rats were examined daily for signs of disease and graded on
a scale of increasing severity from 0 to 5 as follows: 0 no signs;
0.5 partial tail weakness; 1 limp tail; 2 partial hindlimb weakness
or hemiparesis; 3 complete paralysis of at least one hindlimb; 4
severe forelimb weakness; 5 moribund or dead.
EXAMPLE 16
Preventive Smad7 Antisense-Treatment Ameliorates the Clinical
Course of Active MOG-Induced EAE in Rats
[0253] Adoptive transfer EAE in SJL-mice is a model for the human
autoimmune CNS disease multiple sclerosis. The treatment results as
demonstrated in the previous examples therefore suggest that
treatments functionally inhibiting Smad7 mRNA and/or protein such
as Smad7-specific antisense ODN represent a promising approach to
treat multiple sclerosis or related autoimmune inflammatory
diseases of the CNS. To verify this hypothesis a second disease
model relevant for multiple sclerosis was chosen. This model, EAE
induced by immunization with the N-terminal fragment of MOG differs
significantly from the adoptive transfer model. With the presence
of significant demyelination and the putative contribution of
antibodies during lesion pathogenesis it probably even more closely
represents the human disease than murine EAE (Storch, 1998).
Interestingly preventive Smad7 antisense-treatment ameliorated the
clinical course of MOG-induced EAE in rats treated i.p. with 5mg/kg
Smad7-as2-ODN. The development of clinical signs was delayed as
compared to rats treated with PBS (FIG. 20, table 7).
TABLE-US-00012 TABLE 7 Smad7-mut4- Smad7-as2 as PBS group size n =
8 n = 8 n = 8 EAE-incidence 5/8 6/8 6/8 EAE-prevalence (day 14) 1/8
6/8 6/8 EAE-prevalence (day 17) 3/8 4/8 6/8 day of onset (mean .+-.
SE)* 15.20 .+-. 1.66 10.20 .+-. 1.42 11.50 .+-. 0.61 max. score
(mean .+-. SE) 1.44 .+-. 0.49 1.69 .+-. 0.54 2.25 .+-. 0.62
cumulative score (d 1-17) 23.5 57.0 80.5 *sick animals only
Treatment of MOG-induced active EAE
EXAMPLE 17
Methodological Part of the Examples Related to Experimental
Stroke
[0254] The following experiments conformed with the guidelines of
the German law governing animal care. Animal protocols were
approved by the Animal Care Committee of the Bavarian government
and the local ethics committee.
[0255] Animals
[0256] Adult male Wistar rats (body weight 250-270 g) were supplied
by Charles River (Sulzfeld, GermanyF) and were maintained with food
and water ad libitum at 23.degree. C. and 50% relative humidity for
at least 5 days prior to surgery.
[0257] Surgery and Induction of Focal Cerebral Ischemia
[0258] Anesthesia was induced with 4% isoflurane inhalation and
then maintained with 1.5% isoflurane in a gas mixture of 70%
nitrogen and 30% oxygen after endotracheal intubation and
mechanical ventilation by a pressure-controlled small animal
respirator. Rectal temperature was monitored continuously
throughout the experiment and was maintained at 37.0.degree. C. by
use of a thermostatically feed-back-regulated heating lamp and
stage. After cannulation of the tail artery providing monitoring of
blood pressure and blood gases, rats were placed in a stereotactic
frame. The skull was exposed by a midline incision and two burr
holes measuring 2 mm in diameter were drilled for bilateral
monitoring of local cortical blood flow (ICBF). Both MCA supply
territories were continuously monitored by laser doppler flowmetry
(MBF3D, Moor Instruments, U.K.), and cortical EEG was recorded on
both sides. After a midline incision of the neck had been carried
out, the right carotid bifurcation was exposed and the extracranial
branches of the internal carotid artery (ICA) were ligated and
electrocoagulated, assisted by an operating microscope (Zeiss,
Oberkochen, GermanyF). Subsequently, the external carotid artery
(ECA) was ligated and cut distally to the superior thyreoid artery,
after the common carotid artery had been occluded by a microclip
(Biemer FD 68, Tuttlingen, Germany F). Then, a silicone-coated 4-0
nylon monofilament (Ethicon) was introduced in the ECA and gently
advanced through the ICA until its tip occluded the origin of the
right MCA (Schmid-Elsaesser et al. 1998). As a result, ICBF in the
right MCA territory dropped down to approximately 20% of baseline
values. The endovascular filament remained in place until
reperfusion was enabled through withdrawal of the filament and
removal of the microclip at the common carotid artery after 90
minutes of ischemia. Two sham-operated rats were processed
identically including ligation and cutting of the external carotid
artery except for intraluminal filament occlusion of the MCA.
Physiological variables including arterial blood pressure, heart
rate, arterial blood gases (pO.sub.2, pCO.sub.2, pH, base excess,
0.sub.2 saturation), plasma glucose, and hematocrit were recorded
15 min prior to surgery and subsequently every 15 min throughout
the experiment until the animals were replaced to their cages.
[0259] Local Intra-Arterial Administration of Specific Antisense
ODN
[0260] The following single-stranded phosphorothioate PTO-ODN were
used: Smad7-as2-DON (Seq ID NO: 10) and Smad7-sense-ODN (SEQ ID NO:
43). Infusion of ODN beginning with reperfusion after 90 min
ischemia was performed through a PE-catheter introduced via the
external carotid artery into the internal carotid artery and gently
pushed forward until its tip was located directly at the beginning
of the carotid channel. Rats either were treated with 400 pmol
Smad7-as2-ODN per kg body weight dissolved in 0.9% NaCl at pH 7.4
(100 pmol/0.5 ml over 1 hr; treatment, n=8) or with 400 pmol
Smad7-sense-ODN per kg body weight dissolved in 0.9% NaCl at pH 7.4
(100 pmol/0.5 ml over 1 hr; control, n=8).
[0261] Immediately after infusion, the catheter was removed,
followed by ligation of the external carotid artery stump and
closure of the wound by suture. After withdrawal of volative
anesthetics and restitution of sponteaneous respiration, the
animals were extubated and monitored continuously regarding vital
signs, body temperature, and neurological performance, before being
replaced to their cages.
[0262] Clinical Evaluation
[0263] Neurological deficits were scored according to Bederson et
al. (1986): 0, asymptomatic; 1, failure to extend the contralateral
forepaw (mild); 2, circling to the contralateral side (moderate);
and 3, loss of walking or righting reflex (severe). Only animals
with a neurological deficit score of 2 or higher when extubated and
alert were included into the subsequent steps of the protocol.
[0264] Infarct Volume Measurement by in-vivo MRI
[0265] Seven days and three months after ischemia, rats were
reanesthetized for quantification of the ischemic lesion by in vivo
MRI. Measurements were performed on a 1.5 T MR scanner (Siemens
Magnetom Vision, Erlangen, Germany) similar to the approach
described by (Guzman, 2000). The head of the rat was positioned
into the bore of a small surface coil (ID 5 cm) acting as a volume
coil. Two types of sequences were used for scanning the rat brain:
a T.sub.2-weighted TSE sequence (T.sub.2: TR 2500, TE 96, ETL 7, TA
6:04, Acq 8, SL 2 mm, Gap 0, Ma 128.times.256, 4/8 RecFOV, FOV 84
mm) and a heavily T.sub.1-weighted inversion recovery sequence (IR:
TR 3000, TE 60, TI 150, ETL 11, TA 5:33, Acq 10, SL 1.5 mm, Gap 0,
Ma 121.times.256, 4/8 RecFOV, FOV 109 mm). Scanning included axial
and coronal series of both sequence types (T.sub.2, IR). A complete
study following this protocol durated for approximately 45 min
total measuring time.
[0266] Quantitative morphometrical evaluation of the infarcted area
in each MRI slice was performed by an experienced neuroradiologist
who was blinded to the experimental data, using a semi-automatic
image analysis software (Image Analysis, NIH, Bethesda, Md.,
U.S.A.) on a Macintosh G3 computer. Since the inversion recovery
sequences allow the differentiation of infarcted tissue from vital
brain tissue most clearly, IR sequences (axial and coronal
sections) were used for infarct volumetry. Basically, infarct
volumes were calculated in cm.sup.3 by calculating the sum of the
areas of infarcted tissue of each plane, multiplied by the slice
thickness.
[0267] Histology
[0268] Infarct volumes were also assessed semiquantitatively by
histological evaluation. Subsequent to the second MRI at three
months survival after MCA occlusion rats were sacrificed in deep
anesthesia. After decapitation and cryofixation, brains were
entirely cut into 40 .mu.m coronal sections. Representative
sections of the MCA territory were mounted and stained with cresyl
violet (Nissl stain) or immunostained to glial fibrillary acid
protein (GFAP; donkey-anti-rabbit IgG 1:1000; DAB-detected) for
assessment of the ischemic lesion by light microscopy.
[0269] Statistical Analysis
[0270] A comparison between groups (Smad7-as2-ODN, Smad7-sense-ODN)
was made by a one-way analysis of variance (ANOVA) with a post hoc
Bonferroni test for multiple comparisons. Calculations were
performed by use of a software package (SigmaStat) on an IBM
computer.
EXAMPLE 18
Local Smad7-Antisense-ODN Treatment Results in Reduced Infarct
Volume on Day 7 and 3 Months After Focal Cerebral Ischemia
[0271] In vivo Magnetic Resonance Imaging
[0272] Lesion sizes as measured by MRI infarct volumetry at day 7
(3 months) for rats treated by Smad7-sense-ODN or Smad7-as2-ODN
were 1.32.+-.0.33 cm.sup.3 (1.55.+-.0.35 cm.sup.3) vs. 0.49.+-.0.25
cm.sup.3 (0.60.+-.0.28 cm.sup.3), respectively. Accordingly, the
degree of neuroprotection in Smad7-as2 treated rats compared with
control was 58.47% at day 7 and 55.88% at three months after
ischemia (p<0.001). Thus, Smad7-as treatment was associated with
a dramatic reduction of the ischemic injury in both the acute and
the chronic stage of focal cerebral ischemia (FIG. 21).
[0273] Sequential in-vivo MRI findings from two representative
animals either treated with Smad7-sense-ODN or Smad7-as2-ODN are
illustrated in FIG. 22 a-h. There was a close correlation between
the extent of ischemic injury as demonstrated by the follow-up MRI
and the histological appearance of the lesion. Strikingly, both
basal ganglia and cerebral cortex were significantly more affected
in Smad7-sense treated rats than in the Smad7-as2-ODN-treated
group.
[0274] Histology
[0275] Semiquantitative histological assessment of the ischemic
injury on specimen stained with cresyl violet or immunostained for
the astrocyte marker glial fibrillary acidic protein (GFAP)
confirmed the in-vivo MRI Findings. Total infarct volumes were
considerably smaller in Smad7-as2-ODN-treated rats as compared to
rats treated with Smad7-sense-ODN. The protective effect of
Smad7-as2-ODN included cerebral cortex and subcortical white
matter, and basal ganglia (FIG. 22i-l). At the light microscopic
level there was pronounced gliosis covering the lesion in specimen
of both treatment groups, but no evidence for persisting
inflammation at 3 months after stroke.
[0276] These data therefore indicate that local treatment with
Smad7-specific antisense-ODN mediates significant neuroprotection
and reduces infarct volumes after focal cerebral ischemia. This
protection is already seen after administration of a single dose of
antisense-ODN.
EXAMPLE 19
[0277] Jurkat T-cells (ECACC N.sup.o 88042803) were grown in RPMI
medium with 10% FCS, Penicillin 1 U/ml, Streptomicin 10 .mu.g/ml
and Glutamine 20 mM. Before treatment, cells were changed to
starvation medium without FCS. After 3 days cells were counted
using the Neubauer chamber and plated in 24 well plates at
2.times.10.sup.6 cells/well, and then treated with Smad7-as2-ODN
(10 .mu.M), Smad7-mut AS-ODN (10.mu.M) or PBS for 4 hours. Then
cells were incubated with or without TGFbeta (5 ng/.mu.l) for 30
minutes. The cells were centrifugated, washed, and the amount of
1.times.10.sup.7 cells was lysed with 600 .mu.l RLT buffer
according to the Q1AGEN RNeasy mini (Catalog N.sup.o 74104)
protocol. 90 ng total RNA was used for the one step RT PCR, using
QuantiTect SYBR Green PCR Kit from Q1AGEN (Catalog N.sup.o 204143)
using Smad 7 primers and as standard the rRNA primer pair
QuantumRNA Classic 18S from Ambion (Catalog N.sup.o 1716). Smad7
primers were sense: 5'-ATG TTC AGG ACC AAA CGA TCT GCG-3' (SEQ ID
NO: 85) and antisense: 5'-AGC TGC CGC TCC TTC AGT TTC TT-3' (SEQ ID
NO: 86). For amplification, the RotorGene Real Time PCR System
(Corbett Research) was used, with the one step temperature profile:
reverse transcriptase temperature 50.degree., 30 minutes;
activation of polymerase, 95.degree., 15 minutes; 45 cycles of:
denaturating temperature 94.degree., 20 secs, annealing temperature
59.degree., 30 secs, elongation temperature 72.degree., 120 secs.
Fluorescense messure was done after each cycle. At the end, a
melting curve) 80.degree.-95.degree. , hold 10 secs and messure of
fluorescence was done to verify amplification of the expected PCR
product. To measure the concentration of the produced DNA, we used
a standard curve produced by amplification of given amounts of a
Smad7 plasmid produced by cloning of the complete coding region of
the human Smad7 mRNA into the pCR'4 Blunt TOPO cloning vector from
Invitrogen (Catalog N.sup.9 K2875-J10). To estimate the
concentration of rRNA we used the standard RNA delivered with the
primers (Qiagen).
REFERENCES
[0278] Agrawal S (1998) Antisense Nucleic Acid Drug Dev. 8,
135-139
[0279] Ali D (2001) J Cereb Blood Flow Metab 21, 820-827.
[0280] Amor S 1994 J. lmmunol. 153, 4349-4356.
[0281] An H (2001) J Org Chem, 66, 2789-2801.
[0282] Ata AK 1997 Acta Neuropathol (Berl) 93, 326-33.
[0283] Baker JC (1996) Genes Dev. 10, 1880-1889.
[0284] Beck J (1991) Acta Neurol Scand, 84, 452-455.
[0285] Benveniste E N 1998 Cytokine Growth Factor Rev 9,
259-75.
[0286] Bitzer M (1998) Kidney Blood Press Res, 21, 1-12.
[0287] Bitzer M (2000) Genes Dev. 14, 187-197.
[0288] Blind M (1999). Proc Natl Acad Sc/USA 96, 3606-3610.
[0289] Blobe G C (2000) N Engl J Med 342, 1350-1358.
[0290] Border W A (1994) N Engl J Med 331, 1286-1292.
[0291] Brocke S (1996) Methods 9, 458-462.
[0292] Brummelkamp T R (2002) Science 296, 550-553
[0293] Buisson A 1998 Faseb J 12, 1683-91.
[0294] Calabresi P A (1998) Neurology 51, 289-92.
[0295] Chalaux E 1999 FEBS Lett 457, 478-82.
[0296] Chen Y (1996 Proc Natl Acad Sci USA 93, 388-391.
[0297] Chen L Z (1998) Proc. Natl. Acad. Sci. U.S.A. 95,
12516-12521.
[0298] Chen W (2001) J Exp Med 194, 439-453.
[0299] Chen Y (1996) Proc. Natl. Acad. Sci. U.S.A., 93,
388-391.
[0300] Choi D W 1996 Curr Opin Neurobiol 6, 667-72.
[0301] Croxford J L (1998) J Immunol, 160, 5181-5187.
[0302] Datta P K (2000) Mol Cell Biol 20, 3157-3167.
[0303] De Groot C J (1999) J Neuropathol Exp Neurol 58,
174-187.
[0304] De Jong E S (2002) Curr Trop Med Chem 2, 289-302
[0305] Derynck R (1986) J Biol Chem 261, 4377-4379.
[0306] Derynck R (1987) Nucleic Acids Res 15, 3188-3189.
[0307] De Oliveira MC (2000) Life Sci 67, 1625-1637.
[0308] Diab A (1998) J Neuroimmunol 85, 146-154.
[0309] Dixon C E 1991 J Neurosci Methods 39, 253-62.
[0310] Donze O (2002) Nucleic Acids Res 30, e46.
[0311] Dorner (1996) Bioorg Med Chem 4, 709-715.
[0312] Ebisawa T (2001). J Blot Chem 276, 12477-12480.
[0313] Elbashi S M (2002), Methods 26:199-213.
[0314] Elbashir S M (2001a) Nature 411, 494-498.
[0315] Elbashir S M (2001b) Genes Dev. 15, 188-200.
[0316] Faden Al 1993 Crit Rev Neurobiol 7, 175-86.
[0317] Famulok M (1998) Curr Opin Chem Biol 2, 320-327
[0318] Ferrigno O 2002 Oncogene 21, 4879-84,
[0319] Fiocchi C (1998) Gastroenterology 115, 182-205.
[0320] Francis G (1997) Ann Neurol 42, 467
[0321] Friedman S L (1993) N Engl J Med 328, 1828-1835.
[0322] Garside P (2001) Semin Immunol 13, 177-185
[0323] Gayo A (2000) J Neurol Sci 179, 43-49.
[0324] Gold L (1995) Annu Rev Biochem 64, 763-797.
[0325] Gonnella P A (1998) J Immunol 160, 4708-4718
[0326] Grishok A (2001) Cel. 106, 23-34.
[0327] Gross C E 1993 Stroke 24, 558-62.
[0328] Gross C E (1994) Neurol Res. 16 :465-470.
[0329] Guzman R 2000 J Neurosci Methods 97, 77-85.
[0330] Hammond S M (2001) Science 293, 1146-1150.
[0331] Hailer N P (2001) Eur J Neurosci 14, 315-326.
[0332] Han J (1994). Antisense Res Dev 4, 53-65.
[0333] Hayashi H (1997) Cell 89, 1165-1173.
[0334] Hefferan T E 2000 J Biol Chem 275, 20255-9.
[0335] Henrich-Noack P 1996 Stroke 27, 1609-14; discussion
1615.
[0336] Hermann T (2000) Angew Chem Int Ed Engl 39, 1890-1904.
[0337] Hoffman L M (1998) Res. Immunol. 149, 790-794.
[0338] Hughes O (1980) Clin Exp Ommunol, 40, 523-531.
[0339] Hutvagner G (2001) Science 293, 834-838.
[0340] Imamura T (1997) Nature 389, 622-626.
[0341] Inoue H (1998) Mol Biol Cell 9, 2145-2156.
[0342] Ishisaki (1999) J Biol Chem 274, 13637-13642.
[0343] Issazadeh S (1998) J Immunol. 161, 1104-1112.
[0344] Issazadeh S (1995) J Neuroimmunol. 61, 205-212.
[0345] Itoh F (2001) EMBO J 15, 4132-4142.
[0346] Itoh S (2000) Eur J Biochem 267, 6954-6967.
[0347] Itoh S (1998) J Biol Chem. 273, 29195-29201.
[0348] Johns L D (1991) J. lmmunol 147, 1792-1796.
[0349] Johns L D (1993) J Neuroimmunol 1993; 47, 1-7.
[0350] Johnsen S A 2002a Oncogene 21, 5783-90.
[0351] Johnsen S A 2002b J Cell Biochem 87, 233-41.
[0352] Johnsen S A 2002c J Biol Chem 277, 30754-9.
[0353] Kanamaru C (2001) J Biol Chem 276, 45636-45641
[0354] Kandimalla E (1994) Gene 149, 115-121.
[0355] Karpus W J (1999) J Neurovirol 5, 1-2.
[0356] Kasus-Jacobi A (2000) Oncogene. 19, 2052-2059.
[0357] Kaysak P (2000) Mol Cell 6, 1365-1375.
[0358] Khanna A K (1999) Transplantation 67, 882-889.
[0359] Khoury S J (1992) J Exp Med. 176, 1355-1364.
[0360] Kiefer R (1998) J Neuropathol Exp Neurol 57, 385-395.
[0361] Kim J S 1996 Stroke 27, 1553-7.
[0362] Kriegfstein K 1998 J Neurosci 18, 9822-34.
[0363] Krupinski J 1996 Stroke 27, 852-7.
[0364] Kulkarni A B 1993 Am J Pathol 143, 3-9.
[0365] Kulkarni A B (1993) Proc Natl Acad Sci USA, 90, 770-774.
[0366] Kuruvilla A P (1991) Proc Natl Acad Sci USA 88,
2918-2921.
[0367] Lagna G (1996) Nature 383, 832-836.
[0368] Leaman D W (1999) Meth Enzymol 18, 252-265.
[0369] Lehrmann E 1998 Glia 24, 437-48.
[0370] Lehrmann E 1995 Exp Neurol 131, 114-23.
[0371] Letterio J J (2000) Cytokine Growth Factor Rev 11,
81-87.
[0372] Letterio J L (1998) Annu. Rev. lmmunol. 16, 137-161.
[0373] Li J H 2002 J Am Soc Nephrol 13, 1464-72.
[0374] Liblau R S (1995) Immunol. Today 16, 34-38.
[0375] Lindholm D 1992 J Cell Biol 117, 395-400.
[0376] Liu F (1996). Nature 381, 620-623.
[0377] Logan A 1994 Eur J Neurosci 6, 355-63.
[0378] Logan A 1992 Brain Res 587, 216-25.
[0379] Martin R (1992) Annu. Rev. Immunol 10, 153-187.
[0380] Massague J (1987) Cell 49, 437-438.
[0381] Mathisen P M (1997) J Exp Med 186, 159-164.
[0382] Mattson M P 1997 Brain Res Brain Res Rev 23, 47-61.
[0383] Mayer G (2001) Proc Natl Acd Sal USA 98, 4961-4965.
[0384] McNeill H 1994 Neuroreport 5, 901-4.
[0385] Miller A (1992) Proc. Natl. Acad. Sci. U.S.A., 89,
421-425.
[0386] Miller S D (1994) Immunol Today 15, 356-361.
[0387] Miyazono K (2001) J Cell Physiol 187, 265-276.
[0388] Mokhtarian F (1994) J Immunol 152, 6003-10.
[0389] Monteleone G (2001) J Clin Invest 108, 601-609.
[0390] Monroe R J (1999) Immunity 11, 201-212.
[0391] Morganti-Kossmann M C (1999) J Neurotrauma. 16, 617-622.
[0392] Nagarajan R P (1999) J Biol Chem 274, 33412-33418.
[0393] Nakao A (2000) J Exp Med 192, 151-158.
[0394] Nicholson L B (1995) Immunity 3, 397-405.
[0395] O'Garra A (1997) Curr Opin Immunol 9, 872-883.
[0396] Okuda Y (1995) J Neuroimmunol 62, 103-112.
[0397] Ostresh J M (1996) Methods Enzymol. 267, 220-324.
[0398] Ostendorf T (2001) J Am Soc Nephroi. 12, 909-918.
[0399] Pabo C O (1996) Bioorg Med Chem. 4, 1545-1558.
[0400] Pang L 2001 Stroke 32, 544-52.
[0401] Panitch H (1997) Ann Neurol 42, 459-463.
[0402] Peterziel H 2002 J Cell Biol. 159, 157-167
[0403] Prakash T P (2001) Nucleosides Nucleotides Nucleic Acids,
20, 829-832.
[0404] Pratt B M 1997 Cytokine Growth Factor Rev 8, 267-92.
[0405] Prehn J H 1993 J Cereb Blood Flow Metab 13, 521-5.
[0406] Pulaski L (2001) J Biol Chem 276, 14344-14349.
[0407] Racke M K (1994) J Exp Med. 180, 1961-1966.
[0408] Racke M K (1991) J. Immunol., 146, 3012-3017.
[0409] Racke M K (1992). Int Immunol 4, 615-620.
[0410] Racke M K (1993) J Neuroimmunol 46, 175-183.
[0411] Raine C S (1995) Nature Medicine 1, 211-214.
[0412] Ribeiro A 1999 Hepatology 30, 1490-7.
[0413] Rimaniol A C 1995 Neuroreport 7, 133-6.
[0414] Rose R B (1996) Biochemistry 35, 12933-12944
[0415] Ruocco A (1999) J Cereb Blood Flow Metab 19, 1345-1353
[0416] Sandrock B (2001) J Biol Chem 276, 35328-35333.
[0417] Santambrogio L (1993) J. Immunol 151, 1116-1127.
[0418] Santambrogio L (1998) J Neuroimmunol 81, 1-13.
[0419] Samani T D (2001) Antisense Nucleic Acid Drug Dev, 11,
129-136.
[0420] Schwope I (1999) J Org Chem, 64:4749-4761.
[0421] Semple S C (2001) Biochim Biophys Acta, 10, 152-166.
[0422] Sharma K (2000) Cytokine Growth Factor Rev 11, 115-23.
[0423] Slevin M (2000) Stroke 31, 1863-1870.
[0424] Smith L (2000) Eur J Pharmacol Sci 11, 191-198.
[0425] Souchelnytskyi S (1998) J Biol Chem. 273, 25364-25370.
[0426] Sporn M B (1989) Jama 262, 938-941.
[0427] Sporn M B (1987). J Cell Biol 105, 1039-45.
[0428] Stanzani L 2001 Cerebrovasc Dis 12, 240-4.
[0429] Steinman L (1997) J Exp Med 185, 2039-2041.
[0430] Starch M K 1998 Brain Pathol 8, 681-94.
[0431] Subramaniam M 1995 Nucleic Acids Res 23, 4907-12.
[0432] Subramaniam M 1998 J Cell Biochem 68, 226-36.
[0433] Suchanek E G (1986) Biochemistry 25, 5987-5991.
[0434] Sudol M 1994 Oncogene 9, 2145-52.
[0435] Sullivan P 2002 Brain Res 949, 88-96.
[0436] Sun S (2000) Curr Opin Mol Ther 2, 100-105.
[0437] Suzuki C 2002 J Biol Chem. 29, 1621-1625
[0438] Tachibana 11997 J Clin Invest 99, 2365-74.
[0439] Tanaka M (1999) J Neurobiol 41, 524-539.
[0440] Tanuma N (2000) J Neuroimmunol 108, 171-180.
[0441] Teillaud J L (1999) Pathol Biol 47, 771-775.
[0442] Terrell T G (1993) Int Rev Exp Pathol 34 Pt B, 43-67.
[0443] Thorbecke G J (2000) Cytokine Growth Factor Rev 11,
89-96.
[0444] Tsukazaki T (1998) Cell 95:779-791.
[0445] Ulloa L (1999) Nature 397, 710-713.
[0446] Verschueren K (2000) J Biol Chem 275, 11320-11326.
[0447] Vorobjev P E (2001) Antisense Nucleic Acid Drug Dev, 11,
77-85.
[0448] Walton P S (1999) Biotechnol Bioeng, 65, 1-9.
[0449] Wang X 1995 Brain Res Bull 36, 607-9.
[0450] Weinberg A D (1992) J Immunol 148, 2109-2117.
[0451] Weiner H L (1994) Annu. Rev. Immunol 12, 809-837.
[0452] Wekerle H (1986) Trends Neurosci 9, 271-277.
[0453] Wiendl H (2000) Nervenarzt 71, 597-610.
[0454] Winer S (2001) J Immunol 166, 2831-2841.
[0455] Winer S (2001) J lmmunol 166, 4751-4756.
[0456] Wodak S J (1987) Ann N Y Acad Sci 501, 1-13.
[0457] Wolinsky J S (2000) Neurology, 54, 1734-41.
[0458] Woodroofe M N (1993) Cytokine 5, 583-588.
[0459] Wyss-Coray T (1997). J Neuroimmunol, 77, 45-50.
[0460] Wyss-Coray T (1995) Am J Pathol, 147, 53-67.
[0461] Wyss-Coray T. (2000). Am J Pathol, 156, 139-150.
[0462] Xu L Y (2000) Clin Immunol 95, 70-78.
[0463] Yamashita K 1999 Brain Res 836, 139-45.
[0464] Yang D (2002) Proc Natl Acad Sci USA 99, 9942-9947.
[0465] Zhang Y (1996) Nature 383:168-172.
[0466] Zhang Y (1997) Curr Biol. 7, 270-276.
[0467] Zhu H (1999) J Biol Chem 274, 32258-32264.
[0468] Zhu Y 2000 Brain Res 866, 286-98.
[0469] Zhu Y (2002) J Neurosci 22, 3898-3909.
[0470] Zamvil S S (1990) Annu. Rev. lmmunol. 8, 579-621.
[0471] Ziyadeh F N (2000) Proc Natl Acad Sci USA 97, 8015-8020.
Sequence CWU 1
1
9113111DNAHomo sapiens 1ggcacgagcg gagagccgcg cagggcgcgg gccgcgcggg
gtggggcagc cggagcgcag 60gcccccgatc cccggcgggc gcccccgggc ccccgcgcgc
gccccggcct ccgggagact 120ggcgcatgcc acggagcgcc cctcgggccg
ccgccgctcc tgcccgggcc cctgctgctg 180ctgctgtcgc ctgcgcctgc
tgccccaact cggcgcccga cttcttcatg gtgtgcggag 240gtcatgttcg
ctccttagca ggcaaacgac ttttctcctc gcctcctcgc cccgcatgtt
300caggaccaaa cgatctgcgc tcgtccggcg tctctggagg agccgtgcgc
ccggcggcga 360ggacgaggag gagggcgcag ggggaggtgg aggaggaggc
gagctgcggg gagaaggggc 420gacggacagc cgagcgcatg gggccggtgg
cggcggcccg ggcagggctg gatgctgcct 480gggcaaggcg gtgcgaggtg
ccaaaggtca ccaccatccc cacccgccag ccgcgggcgc 540cggcgcggcc
gggggcgccg aggcggatct gaaggcgctc acgcactcgg tgctcaagaa
600actgaaggag cggcagctgg agctgctgct ccaggccgtg gagtcccgcg
gcgggacgcg 660caccgcgtgc ctcctgctgc ccggccgcct ggactgcagg
ctgggcccgg gggcgcccgc 720cggcgcgcag cctgcgcagc cgccctcgtc
ctactcgctc cccctcctgc tgtgcaaagt 780gttcaggtgg ccggatctca
ggcattcctc ggaagtcaag aggctgtgtt gctgtgaatc 840ttacgggaag
atcaaccccg agctggtgtg ctgcaacccc catcacctta gccgactctg
900cgaactagag tctccccccc ctccttactc cagatacccg atggattttc
tcaaaccaac 960tgcagactgt ccagatgctg tgccttcctc cgctgaaaca
gggggaacga attatctggc 1020ccctgggggg ctttcagatt cccaacttct
tctggagcct ggggatcggt cacactggtg 1080cgtggtggca tactgggagg
agaagacgag agtggggagg ctctactgtg tccaggagcc 1140ctctctggat
atcttctatg atctacctca ggggaatggc ttttgcctcg gacagctcaa
1200ttcggacaac aagagtcagc tggtgcagaa ggtgcggagc aaaatcggct
gcggcatcca 1260gctgacgcgg gaggtggatg gtgtgtgggt gtacaaccgc
agcagttacc ccatcttcat 1320caagtccgcc acactggaca acccggactc
caggacgctg ttggtacaca aggtgttccc 1380cggtttctcc atcaaggctt
tcgactacga gaaggcgtac agcctgcagc ggcccaatga 1440ccacgagttt
atgcagcagc cgtggacggg ctttaccgtg cagatcagct ttgtgaaggg
1500ctggggtcag tgctacaccc gccagttcat cagcagctgc ccgtgctggc
tagaggtcat 1560cttcaacagc cggtagccgc gtgcggaggg gacagagcgt
gagctgagca ggccacactt 1620caaactactt tgctgctaat attttcctcc
tgagtgcttg cttttcatgc aaactctttg 1680gtcgtttttt ttttgtttgt
tggttggttt tcttcttctc gtcctcgttt gtgttctgtt 1740ttgtttcgct
ctttgagaaa tagcttatga aaagaattgt tgggggtttt tttggaagaa
1800ggggcaggta tgatcggcag gacaccctga taggaagagg ggaagcagaa
atccaagcac 1860caccaaacac agtgtatgaa ggggggcggt catcatttca
cttgtcagga gtgtgtgtga 1920gtgtgagtgt gcggctgtgt gtgcacgcgt
gtgcaggagc ggcagatggg gagacaacgt 1980gctctttgtt ttgtgtctct
tatggatgtc cccagcagag aggtttgcag tcccaagcgg 2040tgtctctcct
gccccttgga cacgctcagt ggggcagagg cagtacctgg gcaagctggc
2100ggctggggtc ccagcagctg ccaggagcac ggctctgtcc ccagcctggg
aaagcccctg 2160cccctcctct ccctcatcaa ggacacgggc ctgtccacag
gcttctgagc agcgagcctg 2220ctagtggccg aaccagaacc aattattttc
atccttgtct tattcccttc ctgccagccc 2280ctgccattgt agcgtctttc
ttttttggcc atctgctcct ggatctccct gagatgggct 2340tcccaagggc
tgccggggca gccccctcac agtattgctc acccagtgcc ctctcccctc
2400agcctctccc ctgcctgccc tggtgacatc aggtttttcc cggacttaga
aaaccagctc 2460agcactgcct gctcccatcc tgtgtgttaa gctctgctat
taggccagca agcggggatg 2520tccctgggag ggacatgctt agcagtcccc
ttccctccaa gaaggatttg gtccgtcata 2580acccaaggta ccatcctagg
ctgacaccta actcttcttt catttcttct acaactcata 2640cactcgtatg
atacttcgac actgttctta gctcaatgag catgtttaga ctttaacata
2700agctattttt ctaactacaa aggtttaaat gaacaagaga agcattctca
ttggaaattt 2760agcattgtag tgctttgaga gagaaaggac tcctgaaaaa
aaacctgaga tttattaaag 2820aaaaaaatgt attttatgtt atatataaat
atattattac ttgtaaatat aaagacgttt 2880tataagcatc attatttatg
tattgtgcaa tgtgtataaa caagaaaaat aaagaaaaga 2940tgcactttgc
tttaatataa atgcaaataa caaatgccaa attaaaaaag ataaacacaa
3000gattggtgtt ttttcctatg ggtgttatca cctagctgaa tgtttttcta
aaggagttta 3060tgttccatta aacgattttt aaaatgtaca cttgaaaaaa
aaaaaaaaaa a 31112426PRTHomo sapiens 2Met Phe Arg Thr Lys Arg Ser
Ala Leu Val Arg Arg Leu Trp Arg Ser1 5 10 15Arg Ala Pro Gly Gly Glu
Asp Glu Glu Glu Gly Ala Gly Gly Gly Gly 20 25 30Gly Gly Gly Glu Leu
Arg Gly Glu Gly Ala Thr Asp Ser Arg Ala His 35 40 45Gly Ala Gly Gly
Gly Gly Pro Gly Arg Ala Gly Cys Cys Leu Gly Lys 50 55 60Ala Val Arg
Gly Ala Lys Gly His His His Pro His Pro Pro Ala Ala65 70 75 80Gly
Ala Gly Ala Ala Gly Gly Ala Glu Ala Asp Leu Lys Ala Leu Thr 85 90
95His Ser Val Leu Lys Lys Leu Lys Glu Arg Gln Leu Glu Leu Leu Leu
100 105 110Gln Ala Val Glu Ser Arg Gly Gly Thr Arg Thr Ala Cys Leu
Leu Leu 115 120 125Pro Gly Arg Leu Asp Cys Arg Leu Gly Pro Gly Ala
Pro Ala Gly Ala 130 135 140Gln Pro Ala Gln Pro Pro Ser Ser Tyr Ser
Leu Pro Leu Leu Leu Cys145 150 155 160Lys Val Phe Arg Trp Pro Asp
Leu Arg His Ser Ser Glu Val Lys Arg 165 170 175Leu Cys Cys Cys Glu
Ser Tyr Gly Lys Ile Asn Pro Glu Leu Val Cys 180 185 190Cys Asn Pro
His His Leu Ser Arg Leu Cys Glu Leu Glu Ser Pro Pro 195 200 205Pro
Pro Tyr Ser Arg Tyr Pro Met Asp Phe Leu Lys Pro Thr Ala Asp 210 215
220Cys Pro Asp Ala Val Pro Ser Ser Ala Glu Thr Gly Gly Thr Asn
Tyr225 230 235 240Leu Ala Pro Gly Gly Leu Ser Asp Ser Gln Leu Leu
Leu Glu Pro Gly 245 250 255Asp Arg Ser His Trp Cys Val Val Ala Tyr
Trp Glu Glu Lys Thr Arg 260 265 270Val Gly Arg Leu Tyr Cys Val Gln
Glu Pro Ser Leu Asp Ile Phe Tyr 275 280 285Asp Leu Pro Gln Gly Asn
Gly Phe Cys Leu Gly Gln Leu Asn Ser Asp 290 295 300Asn Lys Ser Gln
Leu Val Gln Lys Val Arg Ser Lys Ile Gly Cys Gly305 310 315 320Ile
Gln Leu Thr Arg Glu Val Asp Gly Val Trp Val Tyr Asn Arg Ser 325 330
335Ser Tyr Pro Ile Phe Ile Lys Ser Ala Thr Leu Asp Asn Pro Asp Ser
340 345 350Arg Thr Leu Leu Val His Lys Val Phe Pro Gly Phe Ser Ile
Lys Ala 355 360 365Phe Asp Tyr Glu Lys Ala Tyr Ser Leu Gln Arg Pro
Asn Asp His Glu 370 375 380Phe Met Gln Gln Pro Trp Thr Gly Phe Thr
Val Gln Ile Ser Phe Val385 390 395 400Lys Gly Trp Gly Gln Cys Tyr
Thr Arg Gln Phe Ile Ser Ser Cys Pro 405 410 415Cys Trp Leu Glu Val
Ile Phe Asn Ser Arg 420 42533681DNAMus musculus 3cgagtgcggc
gcggcgagcc cccagcggcg gcagaaggac tcgagcgcca ggagagggcg 60gacgggggac
gaggaggctc cggggcgcga cgaagagagt ctccgaggaa gaggctgcga
120gaggacaccc gggcctcctg ccgccactgt cgggtcgggg ccagcagctc
atgagagcag 180ccccggcggc cacccgcggc caggagaagg agcaccggag
gcccccacac tagcctgtgc 240cctcgggggc gagagcttgc gacccgccgg
agcccgccgc cgcgccgccc tcccccgcgc 300tgacagcccc ccggggcgca
gccgccgccg cagcatcttc tgtccctgct tccccagcgc 360ggaggaagtc
cccgccgagg acctgagccc ccgggaacgc aggaggaaag accagagact
420ctaaaacacc cagatacgca agattgaagc agcctagcca gacctttctg
tggattaaaa 480gaaatacgat tttttttttt tttttttggc agaagaaaag
gaaaggaaga ccggctgggt 540tcagcaagga aaaaaagggg gatgtaactc
gtggatacgg tttttttccc ccacccttcc 600aacatcttgt tttattttgt
aaacattttc tcttttaaac ccgggctcca tccggtgccc 660tccagacctc
cgaggtgcga ggaggtggtg tgttttttca ttgggggctt tgcatatttt
720ggttttgggg gttttgagag accctccaga catctcacga ggggtgaagt
ctactcggtc 780ccctcccgca agtcttcgcg tgcacagaat tcgaggagat
ccggttacta aggatataga 840agaaaaaaaa taaatcgtgc ctgccttttt
tttttaattg cctgcttctc cccaccccca 900aattaagttg cttagcaagg
gggaaagagg ctttttcctc cctttagtag ctcagcctaa 960cgtctttcgt
tttttttttt tttttttttt ttttgccccc gaggatcttc catgtaggaa
1020gccgaggctg gcgagcccga cactcgggag ccactgtagg ggggcctttt
ttgggggagg 1080cgtctaccgg ggttgcctcg gccgccccca gggaagcggc
ggccgcgttc ctccagggca 1140cgccggggcc cgaaagccgc gcagggcgcg
ggccgcgccg ggtggggcag ccgaagcgca 1200gccccccgat ccccggcagg
cgcccctggg cccccgcgcg cgccccggcc tctgggagac 1260tggcgcatgc
cacggagcgc ccctcgggcc gccgccgctt ctgcccgggc ccctgctgtt
1320gctgctgtcg cctgcgcctg ctgccccaac tcggcgcccg acttcttcat
ggtgtgcgga 1380ggtcatgttc gctccttagc cggcaaacga cttttctcct
cgcctcctcg ccccgcatgt 1440tcaggaccaa acgatctgcg ctcgtccggc
gtctctggag gagccgtgcg cccggcggcg 1500aggacgagga ggagggcgtg
gggggtggcg gcggaggagg cgagctgcgg ggagaagggg 1560cgacggacgg
ccgggcttat ggggctggtg gcggcggtgc gggcagggct ggctgctgcc
1620tgggcaaggc agtccgaggt gccaaaggtc accaccatcc ccatccccca
acctcgggtg 1680ccggggcggc cgggggcgcc gaggcggatc tgaaggcgct
cacgcactcg gtgctcaaga 1740aactcaagga gcggcagctg gagctgctgc
ttcaggccgt ggagtcccgc ggcggtacgc 1800gcaccgcgtg cctcctgctg
cccggccgcc tggactgcag gctgggcccg ggggcgcccg 1860ccagcgcgca
gcccgcgcag ccgccctcgt cctactcgct ccccctcctg ctgtgcaaag
1920tgttcaggtg gccggatctc aggcattcct cggaagtcaa gaggctgtgt
tgctgtgaat 1980cttacgggaa gatcaacccc gagctggtgt gctgcaaccc
ccatcacctt agtcgactct 2040gtgaactaga gtctccccct cctccttact
ccagataccc aatggatttt ctcaaaccaa 2100ctgcaggctg tccagatgct
gtaccttcct ccgcggaaac cgggggaacg aattatctgg 2160cccctggggg
gctttcagat tcccaacttc ttctggagcc tggggatcgg tcacactggt
2220gcgtggtggc atactgggag gagaagactc gcgtggggag gctctactgt
gtccaagagc 2280cctccctgga tatcttctat gatctacctc aggggaatgg
cttttgcctc ggacagctca 2340attcggacaa caagagtcag ctggtacaga
aagtgcggag caagatcggc tgtggcatcc 2400agctgacgcg ggaagtggat
ggcgtgtggg tttacaaccg cagcagttac cccatcttca 2460tcaagtccgc
cacactggac aacccggact ccaggacgct gttggtgcac aaagtgttcc
2520ctggtttctc catcaaggct tttgactatg agaaagccta cagcctgcag
cggcccaatg 2580accacgagtt catgcagcaa ccatggacgg gtttcaccgt
gcagatcagc tttgtgaagg 2640gctggggcca gtgctacacc cgccagttca
tcagcagctg cccgtgctgg ctggaggtca 2700tcttcaacag ccggtagtcg
gtcgtgtggt ggggagaaga ggacagggcg gatcgtgagc 2760cgagcaggcc
accgttcaaa ctacttgctg ctaatctttc ccgagtgatt gcttttcatg
2820caaactcttt ggttggtgtt gttattgcca ttcattgttg gttttgtttt
gttctgttct 2880ggtttgtttt tttttttttt cctccccaag ggctgccggg
acagccccag tcacagtatt 2940gctaccccag taccctctca ggcccttcca
ccgggtccca gccgtggtgg ttttttcatc 3000aggtttctcc cagatgtgga
aagtcagctc agcatcccat cccccatcct gtgtgctgag 3060ctctgtagac
cagcgagggg catcagggag ggacctgcgc agtgcccccc cttcctgctg
3120agaagggtgt agccccgtca caacaaaggt accatccctt ggctggctcc
cagcccttct 3180ctcagctcat acgctcgctc gtatgatact ttgacactgt
tcttagctca atgagcatgt 3240ttagaattta acataagcta tttttctaac
tacaaaggtt taaatgaaca agagaagcat 3300tctcattgga aatttagcat
tgtagtgctt tgagagagga aaggactcct taaaagaaaa 3360aaaaagctga
gatttattaa agaaaaatgt attttatgtt atatataaat atattattac
3420ttgtaaatat aaagacgttt tataagcatc attatttatg tattgtgcaa
tgtgtataaa 3480cgagaagaat aaagaaaaga tgcactttgc tttaatataa
atgtaaataa catgccaaat 3540taaaaaaaaa aagataaaca caagattggt
gtttttttct atgggtgtta tcacctagct 3600gaatgttttt ctaaaggagt
ttatgttcca ttaaacaatt tttaaaatgt taaaaaaaaa 3660aaaaaaaaaa
aaaaaaaaaa a 36814426PRTMus musculus 4Met Phe Arg Thr Lys Arg Ser
Ala Leu Val Arg Arg Leu Trp Arg Ser1 5 10 15Arg Ala Pro Gly Gly Glu
Asp Glu Glu Glu Gly Val Gly Gly Gly Gly 20 25 30Gly Gly Gly Glu Leu
Arg Gly Glu Gly Ala Thr Asp Gly Arg Ala Tyr 35 40 45Gly Ala Gly Gly
Gly Gly Ala Gly Arg Ala Gly Cys Cys Leu Gly Lys 50 55 60Ala Val Arg
Gly Ala Lys Gly His His His Pro His Pro Pro Thr Ser65 70 75 80Gly
Ala Gly Ala Ala Gly Gly Ala Glu Ala Asp Leu Lys Ala Leu Thr 85 90
95His Ser Val Leu Lys Lys Leu Lys Glu Arg Gln Leu Glu Leu Leu Leu
100 105 110Gln Ala Val Glu Ser Arg Gly Gly Thr Arg Thr Ala Cys Leu
Leu Leu 115 120 125Pro Gly Arg Leu Asp Cys Arg Leu Gly Pro Gly Ala
Pro Ala Ser Ala 130 135 140Gln Pro Ala Gln Pro Pro Ser Ser Tyr Ser
Leu Pro Leu Leu Leu Cys145 150 155 160Lys Val Phe Arg Trp Pro Asp
Leu Arg His Ser Ser Glu Val Lys Arg 165 170 175Leu Cys Cys Cys Glu
Ser Tyr Gly Lys Ile Asn Pro Glu Leu Val Cys 180 185 190Cys Asn Pro
His His Leu Ser Arg Leu Cys Glu Leu Glu Ser Pro Pro 195 200 205Pro
Pro Tyr Ser Arg Tyr Pro Met Asp Phe Leu Lys Pro Thr Ala Gly 210 215
220Cys Pro Asp Ala Val Pro Ser Ser Ala Glu Thr Gly Gly Thr Asn
Tyr225 230 235 240Leu Ala Pro Gly Gly Leu Ser Asp Ser Gln Leu Leu
Leu Glu Pro Gly 245 250 255Asp Arg Ser His Trp Cys Val Val Ala Tyr
Trp Glu Glu Lys Thr Arg 260 265 270Val Gly Arg Leu Tyr Cys Val Gln
Glu Pro Ser Leu Asp Ile Phe Tyr 275 280 285Asp Leu Pro Gln Gly Asn
Gly Phe Cys Leu Gly Gln Leu Asn Ser Asp 290 295 300Asn Lys Ser Gln
Leu Val Gln Lys Val Arg Ser Lys Ile Gly Cys Gly305 310 315 320Ile
Gln Leu Thr Arg Glu Val Asp Gly Val Trp Val Tyr Asn Arg Ser 325 330
335Ser Tyr Pro Ile Phe Ile Lys Ser Ala Thr Leu Asp Asn Pro Asp Ser
340 345 350Arg Thr Leu Leu Val His Lys Val Phe Pro Gly Phe Ser Ile
Lys Ala 355 360 365Phe Asp Tyr Glu Lys Ala Tyr Ser Leu Gln Arg Pro
Asn Asp His Glu 370 375 380Phe Met Gln Gln Pro Trp Thr Gly Phe Thr
Val Gln Ile Ser Phe Val385 390 395 400Lys Gly Trp Gly Gln Cys Tyr
Thr Arg Gln Phe Ile Ser Ser Cys Pro 405 410 415Cys Trp Leu Glu Val
Ile Phe Asn Ser Arg 420 42554311DNARattus norvegicus 5tgagtgcggc
gcggcgagcc cccagcggcg gcagaaggac tcgagcgcca ggagagggcg 60gacgggggac
gaggaggctc ccgggcgcga cgaagagagt ctcggaggaa gaggctgcga
120gaggacaccc gggcctcctg ccgccactgt cgggtcgggg ccagcagctt
atgcgagcag 180ccccagcgac caccctcggc caggagaagg ggcaccggca
gcccccacgc tagctagcct 240gccgcctgtg ccctcggggg cgagagcttg
cgacccgccg gagcccgccg ccgcgccgcc 300ctcccccgcg ctgacagccc
cccggggcgc agccgccgcc gcagcatctt ctgtccctgc 360ttccccagcg
cggaggaagt ccccgccgag gacctgggcc cccgggagcg caggaggaaa
420gaccagagac tctaaaacac ccagatacgc aagattgaag cagcctaacc
agacctttct 480gtggattaaa agaaatacga tttttttttt gacagaagaa
aaggaaagga agaccggcgg 540ggttcagcaa ggaaaaaaag gggatgtaac
tcgtggatac ggtttttccc cccacccttc 600caacatcttg ttctactttg
taaacatttt ctctttttaa accccggctc catccggtgc 660cctccagacc
tccgaggtgc gagaaggtgg tgtgtttttt cactgggggc tttgcatatt
720tggttttggg gtttttgaga gaccctccag acatctcacg aggggtgaag
tctactcggc 780cccctccctc aagtcttcgc gtgcacagaa ttcgaggaga
tccggttact aaggatatag 840aagaaaaaaa taaatcgtgt gcctgccttt
ttttttttta attgcctgct tctccccacc 900cccaaattaa gttgcttagc
aagggggaaa gaggcttttt cctcccttca gtagctcagc 960ctaacgtctt
tcgttttttg cccctgagga tcttccatgt aggaagccga ggctggcgag
1020cccgacactc gggagccact gtaggggggc ctttttgggg agaggcgtcg
accggggctg 1080cctcggccgc ccccagggaa gcggcggccg cgttcctcag
gggcacgccg gggcccgaga 1140gccgcgcagg gcgcgggccg cgccgggtgg
ggcagccgaa gcgcaggccc ccgatccccg 1200gcgggcgccc ctgggccccc
gcgcgcgccc cggcctccgg gagactggcg catgccacgg 1260agcgcccctc
gggccgccgc cgcttctgcc cgggcccctg ctgttgttgc tgtcgcctgc
1320gcctgctgcc ccaactcggc gcccgacttc ttcatggtgt gcggaggtca
tgttcgctcc 1380ttagccggca aacgactttt ctcctcgcct cctcgccccg
catgttcagg accaaacgat 1440ctgcgctcgt ccggcgtctc tggaggagcc
gtgcgcccgg cggcgaggac gaggaggagg 1500gcgtgggggg tggcggcggc
ggaggcgacc tgcggggaga aggggcgacg gacggccggg 1560cttatggggc
tggtggcggc ggtgcgggca gggctggctg ctgcctgggt aaggcagtcc
1620gaggtgccaa aggtcaccac catccccatc ccccatcctc gggtgccggg
gcggccgggg 1680gcgccgaggc ggatctgaag gcgctcacgc actcggtgct
caagaaactc aaggagcggc 1740agctggagct gctgcttcag gccgtggagt
cccgcggcgg tacgcgcacc gcgtgcctcc 1800tgctgcccgg ccgcctggac
tgcaggctgg gcccgggggc gcccgccagc gcgcagcccg 1860cgcagccgcc
ctcgtcctac tcgctccccc tcctgctgtg caaagtgttc aggtggccgg
1920atctcaggca ttcctcggaa gtcaagaggc tgtgttgctg tgaatcttac
gggaagatca 1980accccgagct ggtgtgctgc aacccccatc accttagtcg
actctgtgaa ctagagtctc 2040cccctcctcc ttactccaga tacccgatgg
attttctcaa accaactgca gactgtccag 2100acgctgtacc ttcctccgat
gaaaccgggg gaacgaatta tctggcccct ggggggcttt 2160cagattccca
acttcttctg gagcctgggg atcggtcaca ctggtgcgtg gtggcatact
2220gggaggagaa gactcgagtg gggaggctct actgtgtcca agagccctcc
ctggatatct 2280tctatgatct acctcagggg aatggctttt gcctcggaca
gctcaattcg gacaacaaga 2340gtcagctggt acagaaagtg aggagcaaga
tcggctgtgg catccagctg acaagggaag 2400tggatggcgt gtgggtttac
aaccgcagca gttaccccat cttcatcaag tccgccacac 2460tggacaaccc
ggactccagg acgctgttgg tgcacaaagt gttccctggt ttctccatca
2520aggcttttga ctatgaaaag gcctacagcc tgcagcggcc caatgaccac
gagttcatgc 2580agcagccatg gacgggcttc accgtgcaga ttagcttcgt
gaagggctgg ggccagtgct 2640acacccgcca gttcatcagc agttgcccgt
gctggctgga ggtcatcttc aacagccggt 2700agtctcccgg tgtggggaga
agaggacagg acggaggggt gagccgagca ggccaccgtt 2760caaactactt
gctgctaatc tttcatgcaa aactctttcg gtcggttttg ttgtttgcca
2820ttcattgttg gttctgtttt gttttgtttt cctttttttt ttttcttcct
tcttcttttt 2880cctcctttct tgtcactctt gtgtcctgtg tgtctcgttc
tttgagaaaa
tatgatgcgg 2940atttttggtt gtgtgttttt ttttttcgtt tgtttgtttg
ttgttgttgt ttgtgttttg 3000aggtggtggt gggtgcggtt ggcaggacac
cccgatacaa aaacgggaag caagagtcag 3060cactgccaag cgtggtgtgc
gaaagtgggt accaccttcc cctttggatc agcatttcag 3120ttgtcagtgt
gtgtgtgtga ggggggtgta cgtgaatgac agatggggga atggcgtgct
3180ttttttgtgt tctttatgga tgtccccagc tgagaggctt gcagttccaa
gctgtgtgtc 3240tctcactgtg tgtctctctc atgagccttt cggacatgct
cggtggggca gaggctgtac 3300ctgggcagac tggcagcagg tgtcccagca
ggtgccgagc tctgctccgc tgaagctccc 3360ccgcccccgc ccccttcccc
acaggacacg ggcctatcca caggcttctg agaagccagc 3420ctgctagaag
gctgaaccag aaccaattgt tttcatccct gtcttactgc ctcctgtcac
3480ccgctgccat tgtcgaaggc tgtctttttt ggccatctgc tcctggatct
ctcttgagat 3540gggcttccca agggctgccg ggacagcccc agtcacagta
ttgctacccc agtaccttct 3600caggcccttc caccggtccc agccgtggtt
ttttcatcag gtttctccca gatctggaaa 3660gtcagctcag caccccatcc
cccagcctgt gtgctgagct ctgtagacca gcgaggggca 3720tcagggaggg
acctgctcag tgcccaccca cccccccttc ccgctgagaa gggtgtagcc
3780ccgtcataac aaaggtacca tcgtaggctg gctcccagcc cttctctcgg
ctcatacact 3840cgtatgatac tctgacactg ttcttggctc aatgagcatg
ctcacacttt aatataagct 3900atttttctaa ctacaaaggt ttaaatgaac
aagagaggcg ttctcatcgg aaatttagca 3960tcgtagtgct ttgagagagg
aaaggactcc ttaaaagaga aaaaaaaaag ctgagattta 4020ttaaagaaaa
aaatgtattt tatgttatat ataaatatat tattacttgt aaatataaag
4080acgttttata agcatcatta tttatgtatt gtgcaatgtg tataaacgag
aataaagaaa 4140agatgcactt tgctttaata taaacgcaaa taacatgcca
aattaaaaaa aaaaaagata 4200aacacaagat tggtgttttt ttctatgggt
gttatcacct agctgaatgt ttttctaaag 4260gagtttatgt tccattaaac
aatttttaaa atgtataaaa aaaaaaaaaa a 43116426PRTRattus norvegicus
6Met Phe Arg Thr Lys Arg Ser Ala Leu Val Arg Arg Leu Trp Arg Ser1 5
10 15Arg Ala Pro Gly Gly Glu Asp Glu Glu Glu Gly Val Gly Gly Gly
Gly 20 25 30Gly Gly Gly Asp Leu Arg Gly Glu Gly Ala Thr Asp Gly Arg
Ala Tyr 35 40 45Gly Ala Gly Gly Gly Gly Ala Gly Arg Ala Gly Cys Cys
Leu Gly Lys 50 55 60Ala Val Arg Gly Ala Lys Gly His His His Pro His
Pro Pro Ser Ser65 70 75 80Gly Ala Gly Ala Ala Gly Gly Ala Glu Ala
Asp Leu Lys Ala Leu Thr 85 90 95His Ser Val Leu Lys Lys Leu Lys Glu
Arg Gln Leu Glu Leu Leu Leu 100 105 110Gln Ala Val Glu Ser Arg Gly
Gly Thr Arg Thr Ala Cys Leu Leu Leu 115 120 125Pro Gly Arg Leu Asp
Cys Arg Leu Gly Pro Gly Ala Pro Ala Ser Ala 130 135 140Gln Pro Ala
Gln Pro Pro Ser Ser Tyr Ser Leu Pro Leu Leu Leu Cys145 150 155
160Lys Val Phe Arg Trp Pro Asp Leu Arg His Ser Ser Glu Val Lys Arg
165 170 175Leu Cys Cys Cys Glu Ser Tyr Gly Lys Ile Asn Pro Glu Leu
Val Cys 180 185 190Cys Asn Pro His His Leu Ser Arg Leu Cys Glu Leu
Glu Ser Pro Pro 195 200 205Pro Pro Tyr Ser Arg Tyr Pro Met Asp Phe
Leu Lys Pro Thr Ala Asp 210 215 220Cys Pro Asp Ala Val Pro Ser Ser
Asp Glu Thr Gly Gly Thr Asn Tyr225 230 235 240Leu Ala Pro Gly Gly
Leu Ser Asp Ser Gln Leu Leu Leu Glu Pro Gly 245 250 255Asp Arg Ser
His Trp Cys Val Val Ala Tyr Trp Glu Glu Lys Thr Arg 260 265 270Val
Gly Arg Leu Tyr Cys Val Gln Glu Pro Ser Leu Asp Ile Phe Tyr 275 280
285Asp Leu Pro Gln Gly Asn Gly Phe Cys Leu Gly Gln Leu Asn Ser Asp
290 295 300Asn Lys Ser Gln Leu Val Gln Lys Val Arg Ser Lys Ile Gly
Cys Gly305 310 315 320Ile Gln Leu Thr Arg Glu Val Asp Gly Val Trp
Val Tyr Asn Arg Ser 325 330 335Ser Tyr Pro Ile Phe Ile Lys Ser Ala
Thr Leu Asp Asn Pro Asp Ser 340 345 350Arg Thr Leu Leu Val His Lys
Val Phe Pro Gly Phe Ser Ile Lys Ala 355 360 365Phe Asp Tyr Glu Lys
Ala Tyr Ser Leu Gln Arg Pro Asn Asp His Glu 370 375 380Phe Met Gln
Gln Pro Trp Thr Gly Phe Thr Val Gln Ile Ser Phe Val385 390 395
400Lys Gly Trp Gly Gln Cys Tyr Thr Arg Gln Phe Ile Ser Ser Cys Pro
405 410 415Cys Trp Leu Glu Val Ile Phe Asn Ser Arg 420 425718DNAMus
musculus 7cttcggctgc cccacccg 18819DNAMus musculus 8atcgtttggt
cctgaacat 19918DNAMus musculus 9ccctcctcct cgtcctcg 181020DNAMus
musculus 10gtcgcccctt ctccccgcag 201118DNAMus musculus 11gccgtccgtc
gccccttc 181218DNAMus musculus 12agcaccgagt gcgtgagc 181318DNAMus
musculus 13agttcacaga gtcgacta 181418DNAMus musculus 14ggcaaaagcc
attcccct 181518DNAMus musculus 15gccgatcttg ctccgcac 181618DNAHomo
sapiens 16ctccggctgc cccacccc 181718DNAHomo sapiens 17cgaacatgac
ctccgcac 181819DNAHomo sapiens 18atcgtttggt cctgaacat 191918DNAHomo
sapiens 19ccctcctcct cgtcctcg 182020DNAHomo sapiens 20gtcgcccctt
ctccccgcag 202118DNAHomo sapiens 21gctgtccgtc gccccttc
182218DNAHomo sapiens 22agcaccgagt gcgtgagc 182318DNAHomo sapiens
23agttcgcaga gtcggcta 182418DNAHomo sapiens 24ggcaaaagcc attcccct
182518DNAHomo sapiens 25gccgattttg ctccgcac 182618DNAHomo sapiens
26ctgccccttc ttccaaaa 182718DNAHomo sapiens 27actcacacac actcctga
182818DNAHomo sapiens 28tgcccaggta ctgcctct 182918DNAHomo sapiens
29gagatccagg agcagatg 183018DNARattus norvegicus 30cttcggctgc
cccacccg 183119DNARattus norvegicus 31atcgtttggt cctgaacat
193218DNARattus norvegicus 32ccctcctcct cgtcctcg 183320DNARattus
norvegicus 33gtcgcccctt ctccccgcag 203418DNARattus norvegicus
34gccgtccgtc gccccttc 183518DNARattus norvegicus 35agcaccgagt
gcgtgagc 183618DNARattus norvegicus 36agttcacaga gtcgacta
183718DNARattus norvegicus 37ggcaaaagcc attcccct 183818DNARattus
norvegicus 38gccgatcttg ctcctcac 183921DNAHomo sapiens 39gtcgcccctt
ctcccccgca g 214012PRTMus musculus 40His Ser Leu Gly Lys Trp Leu
His Pro Asp Lys Phe1 5 104120DNAMus musculus 41gtcgcaccgt
ctcacagcag 204215DNAMus musculus 42atggacaata tgtct 154320DNARattus
norvegicus 43ctgcggggag aaggggcgac 204421RNAHomo sapiens
44guucaggacc aaacgaucug c 214523RNAHomo sapiens 45gcagaucguu
ugguccugaa cau 234621RNAHomo sapiens 46cucacgcacu cggugcucaa g
214723RNAHomo sapiens 47cuugagcacc gagugcguga gcg 234821RNAHomo
sapiens 48cucggcgccc gacuucuucu u 214921RNAHomo sapiens
49gaagaagucg ggcgccgagu u 215021RNAHomo sapiens 50acgacuuuuc
uccucgccuu u 215121RNAHomo sapiens 51aggcgaggag aaaagucguu u
215221RNAHomo sapiens 52acgaucugcg cucguccggu u 215321RNAHomo
sapiens 53ccggacgagc gcagaucguu u 215421RNAHomo sapiens
54ggcgcucacg cacucggugu u 215521RNAHomo sapiens 55caccgagugc
gugagcgccu u 215621RNAHomo sapiens 56ggagcggcag cuggagcugu u
215721RNAHomo sapiens 57cagcuccagc ugccgcuccu u 215821RNAHomo
sapiens 58aguguucagg uggccggauu u 215921RNAHomo sapiens
59auccggccac cugaacacuu u 216021RNAHomo sapiens 60gucaagaggc
uguguugcuu u 216121RNAHomo sapiens 61agcaacacag ccucuugacu u
216221RNAHomo sapiens 62gaggcugugu ugcugugaau u 216321RNAHomo
sapiens 63uucacagaca cacagccucu u 216421RNAHomo sapiens
64ucuuacggga agaucaaccu u 216521RNAHomo sapiens 65gguugaucuu
cccguaagau u 216621RNAHomo sapiens 66gaucaacccc gagcuggugu u
216721RNAHomo sapiens 67caccagcucg ggguugaucu u 216821RNAHomo
sapiens 68ccccgagcug gugugcugcu u 216921RNAHomo sapiens
69gcagcacacc agcucggggu u 217021RNAHomo sapiens 70cgaauuaucu
ggccccuggu u 217121RNAHomo sapiens 71ccaggggcca gauaauucgu u
217221RNAHomo sapiens 72cuucuucugg agccuggggu u 217321RNAHomo
sapiens 73ccccaggcuc cagaagaagu u 217421RNAHomo sapiens
74uggcuuuugc cucggacagu u 217521RNAHomo sapiens 75cuguccgagg
caaaagccau u 217621RNAHomo sapiens 76uucggacaac aagagucagu u
217721RNAHomo sapiens 77cugacucuug uuguccgaau u 217821RNAHomo
sapiens 78ccgcagcagu uaccccaucu u 217921RNAHomo sapiens
79gaugggguaa cugcugcggu u 218021RNAHomo sapiens 80guccgccaca
cuggacaacu u 218121RNAHomo sapiens 81guuguccagu guggcggacu u
218221RNAHomo sapiens 82cccggacucc aggacgcugu u 218321RNAHomo
sapiens 83cagcguccug gaguccgggu u 2184131PRTRattus norvegicus 84Gly
Gln Phe Arg Val Ile Gly Pro Gly His Pro Ile Arg Ala Leu Val1 5 10
15Gly Asp Glu Ala Glu Leu Pro Cys Arg Ile Ser Pro Gly Lys Asn Ala
20 25 30Thr Gly Met Glu Val Gly Trp Tyr Arg Ser Pro Phe Ser Arg Val
Val 35 40 45His Leu Tyr Arg Asn Gly Lys Asp Gln Asp Ala Glu Gln Ala
Pro Glu 50 55 60Tyr Arg Gly Arg Thr Glu Leu Leu Lys Glu Ser Ile Gly
Glu Gly Lys65 70 75 80Val Ala Leu Arg Ile Gln Asn Val Arg Phe Ser
Asp Glu Gly Gly Tyr 85 90 95Thr Cys Phe Phe Arg Asp His Ser Tyr Gln
Glu Glu Ala Ala Val Glu 100 105 110Leu Lys Val Glu Asp Pro Phe Tyr
Trp Ile Asn Pro Gly His His His 115 120 125His His His
1308524DNAArtificial SequencePrimer 85atgttcagga ccaaacgatc tgcg
248623DNAArtificial SequencePrimer 86agctgccgct ccttcagttt ctt
238716DNAArtificial SequenceSynthetic oligonucleotide 87atggacaata
tgtcta 16881282DNAHomo Sapiens 88atgttcagga ccaaacgatc tgcgctcgtc
cggcgtctct ggaggagccg tgcgcccggc 60ggcgaggacg aggaggaggg cgcaggggga
ggtggaggag gaggcgagct gcggggagaa 120ggggcgacgg acagccgagc
gcatggggcc ggtggcggcg gcccgggcag ggctggatgc 180tgcctgggca
aggcggtgcg aggtgccaaa ggtcaccacc atccccaccc gccagccgcg
240ggcgccggcg cggccggggg cgccgaggcg gatctgaagg cgctcacgca
ctcggtgctc 300aagaaactga aggagcggca gctggagctg ctgctccagg
ccgtggagtc ccgcggcggg 360acgcgcaccg cgtgcctcct gctgcccggc
cgcctggact gcaggctggg cccgggggcg 420cccgccggcg cgcagcctgc
gcagccgccc tcgtcctact cgctccccct cctgctgtgc 480aaagtgttca
ggtggccgga tctcaggcat tcctcggaag tcaagaggct gtgttgctgt
540gaatcttacg ggaagatcaa ccccgagctg gtgtgctgca acccccatca
ccttagccga 600ctctgcgaac tagagtctcc cccccctcct tactccagat
acccgatgga ttttctcaaa 660ccaactgcag actgtccaga tgctgtgcct
tcctccgctg aaacaggggg aacgaattat 720ctggcccctg gggggctttc
aggattccca acttcttctg gagcctgggg atcggtcaca 780ctggtgcgtg
gtggcatact gggaggagaa gacgagagtg gggaggctct actgtgtcca
840ggagccctct ctggatatct tctatgatct acctcagggg aatggctttt
gcctcggaca 900gctcaattcg gacaacaaga gtcagctggt gcagaaggtg
cggagcaaaa tcggctgcgg 960catccagctg acgcgggagg tggatggtgt
gtgggtgtac aaccgcagca gttaccccat 1020cttcatcaag tccgccacac
tggacaaccc ggactccagg acgctgttgg tacacaaggt 1080gttccccggt
ttctccatca aggctttcga ctacgagaag gcgtacagcc tgcagcggcc
1140caatgaccac gagtttatgc agcagccgtg gacgggcttt accgtgcaga
tcagctttgt 1200gaagggctgg ggccagtgct acacccgcca gttcatcagc
agctgcccgt gctggctaga 1260ggtcatcttc aacagccggt ag
1282893087DNAHomo Sapiens 89cggagagccg cgcagggcgc gggccgcgcg
gggtggggca gccggagcgc aggcccccga 60tccccggcgg gcgcccccgg gcccccgcgc
gcgccccggc ctccgggaga ctggcgcatg 120ccacggagcg cccctcgggc
cgccgccgct cctgcccggg cccctgctgc tgctgctgtc 180gcctgcgcct
gctgccccaa ctcggcgccc gacttcttca tggtgtgcgg aggtcatgtt
240cgctccttag caggcaaacg acttttctcc tcgcctcctc gccccgcatg
ttcaggacca 300aacgatctgc gctcgtccgg cgtctctgga ggagccgtgc
gcccggcggc gaggacgagg 360aggagggcgc agggggaggt ggaggaggag
gcgagctgcg gggagaaggg gcgacggaca 420gccgagcgca tggggccggt
ggcggcggcc cgggcagggc tggatgctgc ctgggcaagg 480cggtgcgagg
tgccaaaggt caccaccatc cccacccgcc agccgcgggc gccggcgcgg
540ccgggggcgc cgaggcggat ctgaaggcgc tcacgcactc ggtgctcaag
aaactgaagg 600agcggcagct ggagctgctg ctccaggccg tggagtcccg
cggcgggacg cgcaccgcgt 660gcctcctgct gcccggccgc ctggactgca
ggctgggccc gggggcgccc gccggcgcgc 720agcctgcgca gccgccctcg
tcctactcgc tccccctcct gctgtgcaaa gtgttcaggt 780ggccggatct
caggcattcc tcggaagtca agaggctgtg ttgctgtgaa tcttacggga
840agatcaaccc cgagctggtg tgctgcaacc cccatcacct tagccgactc
tgcgaactag 900agtctccccc ccctccttac tccagatacc cgatggattt
tctcaaacca actgcagact 960gtccagatgc tgtgccttcc tccgctgaaa
cagggggaac gaattatctg gcccctgggg 1020ggctttcagg attcccaact
tcttctggag cctggggatc ggtcacactg gtgcgtggtg 1080gcatactggg
aggagaagac gagagtgggg aggctctact gtgtccagga gccctctctg
1140gatatcttct atgatctacc tcaggggaat ggcttttgcc tcggacagct
caattcggac 1200aacaagagtc agctggtgca gaaggtgcgg agcaaaatcg
gctgcggcat ccagctgacg 1260cgggaggtgg atggtgtgtg ggtgtacaac
cgcagcagtt accccatctt catcaagtcc 1320gccacactgg acaacccgga
ctccaggacg ctgttggtac acaaggtgtt ccccggtttc 1380tccatcaagg
ctttcgacta cgagaaggcg tacagcctgc agcggcccaa tgaccacgag
1440tttatgcagc agccgtggac gggctttacc gtgcagatca gctttgtgaa
gggctggggc 1500cagtgctaca cccgccagtt catcagcagc tgcccgtgct
ggctagaggt catcttcaac 1560agccggtagc cgcgtgcgga ggggacagag
cgtgagctga gcaggccaca cttcaaacta 1620ctttgctgct aatattttcc
tcctgagtgc ttgcttttca tgcaaactct ttggtcgttt 1680tttttttgtt
tgttggttgg ttttcttctt ctcgtcctcg tttgtgttct gttttgtttc
1740gctctttgag aaatagctta tgaaaagaat tgttgggggt ttttttggaa
gaaggggcag 1800gtatgatcgg caggacaccc tgataggaag aggggaagca
gaaatccaag caccaccaaa 1860cacagtgtat gaaggggggc ggtcatcatt
tcacttgtca ggagtgtgtg tgagtgtgag 1920tgtgcggctg tgtgtgcacg
cgtgtgcagg agcggcagat ggggagacaa cgtgctcttt 1980gttttgtgtc
tcttatggat gtccccagca gagaggtttg cagtcccaag cggtgtctct
2040cctgcccctt ggacacgctc agtggggcag aggcagtacc tgggcaagct
ggcggctggg 2100gtcccagcag ctgccaggag cacggctctg tccccagcct
gggaaagccc ctgcccctcc 2160tctccctcat caaggacacg ggcctgtcca
caggcttctg agcagcgagc ctgctagtgg 2220ccgaaccaga accaattatt
ttcatccttg tcttattccc ttcctgccag cccctgccat 2280tgtagcgtct
ttcttttttg gccatctgct cctggatctc cctgagatgg gcttcccaag
2340ggctgccggg gcagccccct cacagtattg ctcacccagt gccctctccc
ctcagcctct 2400cccctgcctg ccctggtgac atcaggtttt
tcccggactt agaaaaccag ctcagcactg 2460cctgctccca gcctgtgtgt
taagctctgc tattaggcca gcaagcgggg atgtccctgg 2520gagggacatg
cttagcagtc cccttccctc caagaaggat ttggtccgtc ataacccaag
2580gtaccatcct aggctgacac ctaactcttc tttcatttct tctacaactc
atacactcgt 2640atgatacttc gacactgttc ttagctcaat gagcatgttt
agactttaac ataagctatt 2700tttctaacta caaaggttta aatgaacaag
agaagcattc tcattggaaa tttagcattg 2760tagtgctttg agagagaaag
gactcctgaa aaaaaacctg agatttatta aagaaaaaaa 2820tgtattttat
gttatatata aatatattat tacttgtaaa tataaagacg ttttataagc
2880atcattattt atgtattgtg caatgtgtat aaacaagaaa aataaagaaa
agatgcactt 2940tgctttaata taaatgcaaa taacaaatgc caaattaaaa
aagataaaca caagattggt 3000gtttttttct atgggtgtta tcacctagct
gaatgttttt ctaaaggagt ttatgttcca 3060ttaaacgatt tttaaaatgt acacttg
3087901281DNAHomo Sapiens 90atgttcagga ccaaacgatc tgcgctcgtc
cggcgtctct ggaggagccg tgcgcccggc 60ggcgaggacg aggaggaggg cgcaggggga
ggtggaggag gaggcgagct gcggggagaa 120ggggcgacgg acagccgagc
gcatggggcc ggtggcggcg gcccgggcag ggctggatgc 180tgcctgggca
aggcggtgcg aggtgccaaa tgtcaccacc atccccaccc gccagccgcg
240ggcgccggcg cggccggggg cgccgaggcg gatctgaagg cgctcacgca
ctcggtgctc 300aagaaactga aggagcggca gctggagctg ctgctccagg
ccgtggagtc ccgcggcggg 360acgcgcaccg cgtgcctcct gctgcccggc
cgcctggact gcaggctggg cccgggggcg 420cccgccggcg cgcagcctgc
gcagccgccc tcgtcctact cgctccccct cctgctgtgc 480aaagtgttca
ggtggccgga tctcaggcat tcctcggaag tcaagaggct gtgttgctgt
540gaatcttacg ggaagatcaa ccccgagctg gtgtgctgca acccccatca
ccttagccga 600ctctgcgaac tagagtctcc cccccctcct tactccagat
acccgatgga ttttctcaaa 660ccaactgcag actgtccaga tgctgtgcct
tcctccgctg aaacaggggg aacgaattat 720ctggcccctg gggggctttc
agattcccaa cttcttctgg agcctgggga tcggtcacac 780tggtgcgtgg
tggcatactg ggaggagaag acgagagtgg ggaggctcta ctgtgtccag
840gagccctctc tggatatctt ctatgatcta cctcagggga atggcttttg
cctcggacag 900ctcaattcgg acaacaagag tcagctggtg cagaaggtgc
ggagcaaaat cggctgcggc 960atccagctga cgcgggaggt ggatggtgtg
tgggtgtaca accgcagcag ttaccccatc 1020ttcatcaagt ccgccacact
ggacaacccg gactccagga cgctgttggt acacaaggtg 1080ttccccggtt
tctccatcaa ggctttcgac tacgagaagg cgtacagcct gcagcggccc
1140aatgaccacg agtttatgca gcagccgtgg acgggcttta ccgtgcagat
cagctttgtg 1200aagggctggg gccagtgcta cacccgccag ttcatcagca
gctgcccgtg ctggctagag 1260gtcatcttca acagccggta g 1281913111DNAHomo
Sapiens 91ggcacgagcg gagagccgcg cagggcgcgg gccgcgcggg gtggggcagc
cggagcgcag 60gcccccgatc cccggcgggc gcccccgggc ccccgcgcgc gccccggcct
ccgggagact 120ggcgcatgcc acggagcgcc cctcgggccg ccgccgctcc
tgcccgggcc cctgctgctg 180ctgctgtcgc ctgcgcctgc tgccccaact
cggcgcccga cttcttcatg gtgtgcggag 240gtcatgttcg ctccttagca
ggcaaacgac ttttctcctc gcctcctcgc cccgcatgtt 300caggaccaaa
cgatctgcgc tcgtccggcg tctctggagg agccgtgcgc ccggcggcga
360ggacgaggag gagggcgcag ggggaggtgg aggaggaggc gagctgcggg
gagaaggggc 420gacggacagc cgagcgcatg gggccggtgg cggcggcccg
ggcagggctg gatgctgcct 480gggcaaggcg gtgcgaggtg ccaaaggtca
ccaccatccc cacccgccag ccgcgggcgc 540cggcgcggcc gggggcgccg
aggcggatct gaaggcgctc acgcactcgg tgctcaagaa 600actgaaggag
cggcagctgg agctgctgct ccaggccgtg gagtcccgcg gcgggacgcg
660caccgcgtgc ctcctgctgc ccggccgcct ggactgcagg ctgggcccgg
gggcgcccgc 720cggcgcgcag cctgcgcagc cgccctcgtc ctactcgctc
cccctcctgc tgtgcaaagt 780gttcaggtgg ccggatctca ggcattcctc
ggaagtcaag aggctgtgtt gctgtgaatc 840ttacgggaag atcaaccccg
agctggtgtg ctgcaacccc catcacctta gccgactctg 900cgaactagag
tctccccccc ctccttactc cagatacccg atggattttc tcaaaccaac
960tgcagactgt ccagatgctg tgccttcctc cgctgaaaca gggggaacga
attatctggc 1020ccctgggggg ctttcagatt cccaacttct tctggagcct
ggggatcggt cacactggtg 1080cgtggtggca tactgggagg agaagacgag
agtggggagg ctctactgtg tccaggagcc 1140ctctctggat atcttctatg
atctacctca ggggaatggc ttttgcctcg gacagctcaa 1200ttcggacaac
aagagtcagc tggtgcagaa ggtgcggagc aaaatcggct gcggcatcca
1260gctgacgcgg gaggtggatg gtgtgtgggt gtacaaccgc agcagttacc
ccatcttcat 1320caagtccgcc acactggaca acccggactc caggacgctg
ttggtacaca aggtgttccc 1380cggtttctcc atcaaggctt tcgactacga
gaaggcgtac agcctgcagc ggcccaatga 1440ccacgagttt atgcagcagc
cgtggacggg ctttaccgtg cagatcagct ttgtgaaggg 1500ctggggtcag
tgctacaccc gccagttcat cagcagctgc ccgtgctggc tagaggtcat
1560cttcaacagc cggtagccgc gtgcggaggg gacagagcgt gagctgagca
ggccacactt 1620caaactactt tgctgctaat attttcctcc tgagtgcttg
cttttcatgc aaactctttg 1680gtcgtttttt ttttgtttgt tggttggttt
tcttcttctc gtcctcgttt gtgttctgtt 1740ttgtttcgct ctttgagaaa
tagcttatga aaagaattgt tgggggtttt tttggaagaa 1800ggggcaggta
tgatcggcag gacaccctga taggaagagg ggaagcagaa atccaagcac
1860caccaaacac agtgtatgaa ggggggcggt catcatttca cttgtcagga
gtgtgtgtga 1920gtgtgagtgt gcggctgtgt gtgcacgcgt gtgcaggagc
ggcagatggg gagacaacgt 1980gctctttgtt ttgtgtctct tatggatgtc
cccagcagag aggtttgcag tcccaagcgg 2040tgtctctcct gccccttgga
cacgctcagt ggggcagagg cagtacctgg gcaagctggc 2100ggctggggtc
ccagcagctg ccaggagcac ggctctgtcc ccagcctggg aaagcccctg
2160cccctcctct ccctcatcaa ggacacgggc ctgtccacag gcttctgagc
agcgagcctg 2220ctagtggccg aaccagaacc aattattttc atccttgtct
tattcccttc ctgccagccc 2280ctgccattgt agcgtctttc ttttttggcc
atctgctcct ggatctccct gagatgggct 2340tcccaagggc tgccggggca
gccccctcac agtattgctc acccagtgcc ctctcccctc 2400agcctctccc
ctgcctgccc tggtgacatc aggtttttcc cggacttaga aaaccagctc
2460agcactgcct gctcccatcc tgtgtgttaa gctctgctat taggccagca
agcggggatg 2520tccctgggag ggacatgctt agcagtcccc ttccctccaa
gaaggatttg gtccgtcata 2580acccaaggta ccatcctagg ctgacaccta
actcttcttt catttcttct acaactcata 2640cactcgtatg atacttcgac
actgttctta gctcaatgag catgtttaga ctttaacata 2700agctattttt
ctaactacaa aggtttaaat gaacaagaga agcattctca ttggaaattt
2760agcattgtag tgctttgaga gagaaaggac tcctgaaaaa aaacctgaga
tttattaaag 2820aaaaaaatgt attttatgtt atatataaat atattattac
ttgtaaatat aaagacgttt 2880tataagcatc attatttatg tattgtgcaa
tgtgtataaa caagaaaaat aaagaaaaga 2940tgcactttgc tttaatataa
atgcaaataa caaatgccaa attaaaaaag ataaacacaa 3000gattggtgtt
ttttcctatg ggtgttatca cctagctgaa tgtttttcta aaggagttta
3060tgttccatta aacgattttt aaaatgtaca cttgaaaaaa aaaaaaaaaa a
3111
* * * * *
References