Cry1f And Cry1ac Transgenic Cotton Lines And Event-specific Identification Thereof

Abstract

This invention relates to plant breeding and the protection of plants from insects. More specifically, this invention includes novel transformation events of cotton plants comprising one or more polynucleotide sequences, as described herein, inserted into specific site(s) within the genome of a cotton cell. In highly preferred embodiments, said polynucleotide sequences encode "stacked" Cry1F and Cry1Ac lepidopteran insect inhibitory proteins. However, the subject invention includes plants having single cry1F or cry1Ac events, as described herein. Additionally, the invention is related to cotton plants derived from that transformation event and to assays for detecting the presence of the event in a sample. More specifically, the present invention provides DNA and related assays for detecting the presence of certain insect-resistance events in cotton. The assays are based on the DNA sequences of recombinant constructs inserted into the cotton genome and of the genomic sequences flanking the insertion sites. These sequences are unique. Based on these insert and border sequences, event-specific primers were generated. PCR analysis demonstrated that these cotton lines can be identified in different cotton genotypes by analysis of the PCR amplicons generated with these event-specific primer sets. Thus, these and other related procedures can be used to uniquely identify these cotton lines. Kits and conditions useful in conducting the assays are also provided. These materials and methods can also be used to assist breeding programs to further develop traits in cotton.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application is a divisional of U.S. Ser. No. 11/704,418, filed Feb. 9, 2007, which was a divisional of U.S. Ser. No. 10/964,838, filed Oct. 13, 2004, now U.S. Pat. No. 7,179,965, which claims the benefit of provisional application Ser. No. 60/556,586, filed Mar. 26, 2004, and to provisional application Ser. No. 60/613,851, filed Sep. 27, 2004.

BACKGROUND OF THE INVENTION

[0002] Cotton is an important fiber crop. Breeding and biotechnology have been applied to cotton to improve its agronomic traits and the quality of the product. One such agronomic trait is resistance to insects, the advantages of which are readily apparent. Genes encoding insecticidal proteins have been introduced into cotton plants. In order to alleviate any concern that a given type of insect could develop resistance to a single type of insecticidal protein, plants are often developed that produce two different types of insecticidal proteins. Thus, the odds of an insect being hypothetically capable of developing resistance to two different insecticidal proteins are extremely low.

[0003] Cry1Ac insecticidal proteins and genes are known in the art. See, e.g., U.S. Pat. Nos. 6,114,138; 5,710,020; 6,251,656; and 6,229,004. Cry1F insecticidal proteins and genes are also known in the art. See, e.g., U.S. Pat. Nos. 5,188,960; 5,691,308; 6,096,708; and 6,573,240.

[0004] The expression of foreign genes in plants is influenced by where the foreign gene is inserted in the chromosome. This could be due to chromatin structure (e.g., heterochromatin) or the proximity of transcriptional regulation elements (e.g., enhancers) close to the integration site (Weising et al., Ann. Rev. Genet 22:421-477, 1988). For example, the same gene in the same type of transgenic plant (or other organism) can exhibit a wide variation in expression level amongst different events. There may also be differences in spatial or temporal patterns of expression. For example, differences in the relative expression of a transgene in various plant tissues may not correspond to the patterns expected from transcriptional regulatory elements present in the introduced gene construct.

[0005] Thus, it is necessary to create and screen a large number of events in order to identify an event that optimally expresses an introduced gene of interest. For commercial purposes, it is common to produce hundreds to thousands of different events and to screen those events for a single event that has desired transgene expression levels and patterns. An event that has desired levels and/or patterns of transgene expression is useful for introgressing the transgene into other genetic backgrounds by sexual outcrossing using conventional breeding methods. Progeny of such crosses maintain the transgene expression characteristics of the original transformant. This strategy is used to ensure reliable gene expression in a number of varieties that are well adapted to local growing conditions.

[0006] It would be advantageous to be able to detect the presence of a particular event in order to determine whether progeny of a sexual cross contain a transgene of interest. In addition, a method for detecting a particular event would be helpful for complying with regulations requiring the pre-market approval and labeling of foods derived from recombinant crop plants, for example. It is possible to detect the presence of a transgene by any well-known nucleic acid detection method such as polymerase chain reaction (PCR) or DNA hybridization using nucleic acid probes. These detection methods generally focus on frequently used genetic elements, such as promoters, terminators, marker genes, and the like. As a result, such methods may not be useful for discriminating between different events, particularly those produced using the same DNA construct, unless the sequence of chromosomal DNA adjacent to the inserted DNA ("flanking DNA") is known. An event-specific PCR assay is discussed, for example, by Windels et al. (Med. Fac. Landbouww, Univ. Gent 64/5b:459462, 1999). This related to the identification of glyphosate tolerant soybean event 40-3-2 by PCR using a primer set spanning the junction between the insert and flanking DNA. More specifically, one primer included sequence from the insert and a second primer included sequence from flanking DNA.

[0007] U.S. Patent Apps. 20020120964 A1 and 20040009504 A1 relate to cotton event PV-GHGT07(1445) and compositions and methods for the detection thereof. WO 02/100163 relates to cotton event MONI5985 and compositions and methods for the detection thereof. WO 2004/011601 relates to corn event MON863 plants and compositions and methods for the detection thereof. WO 2004/072235 relates to cotton event MON 88913 and compositions and methods for the detection thereof.

[0008] However, no such procedures and materials were specifically known, heretofore, that could be used to specifically identify Cry1F and/or Cry1Ac stacked cotton as discussed below.

BRIEF SUMMARY OF THE INVENTION

[0009] This invention relates to plant breeding and the protection of plants from insects. More specifically, this invention includes novel transformation events of cotton plants comprising one or more polynucleotide sequences, as described herein, inserted into specific site(s) within the genome of a cotton cell. In highly preferred embodiments, said polynucleotide sequences encode "stacked" Cry1F and Cry1Ac lepidopteran insect inhibitory proteins. However, the subject invention includes plants having single Cry1F or Cry1Ac events, as described herein.

[0010] Additionally, the subject invention provides assays for detecting the presence of one or more of the subject events in a sample. The present invention provides DNA and related assays for detecting the presence of certain insect-resistance events in cotton. The assays are based on the DNA sequences of recombinant constructs inserted into the cotton genome and of the genomic sequences flanking the insertion sites. Kits and conditions useful in conducting the assays are also provided.

[0011] Thus, the subject invention relates in part to the cloning and analysis of the DNA sequences of a whole cry1F insert, whole cry1Ac inserts, and the border regions thereof (in transgenic cotton lines). These sequences are unique. Based on these insert and border sequences, event-specific primers were generated. PCR analysis demonstrated that these events can be identified by analysis of the PCR amplicons generated with these event-specific primer sets. Thus, these and other related procedures can be used to uniquely identify cotton lines comprising one or more events of the subject invention.

BRIEF DESCRIPTION OF THE FIGURES

[0012] FIG. 1 illustrates the inserted cry1F transgene and flanking sequences for cotton event 281-24-236. This Figure also shows amplicons and primers as described herein.

[0013] FIG. 2 illustrates an inserted cry1Ac transgene and flanking sequences for cotton event 3006-210-23. This Figure also shows amplicons and primers as described herein.

BRIEF DESCRIPTION OF THE SEQUENCES

[0014] SEQ ID NO:1 is the DNA sequence for the cry1F event 281-24-236 insert and its border sequences.

[0015] SEQ ID NO:2 is the DNA sequence for the cry1Ac event 3006-210-23 insert and its border sequences.

[0016] SEQ ID NO:3 is the sequence of forward primer "281-14" used with reverse primer "281-15" to amplify a 603 bp amplicon that spans the 5' junction between the flanking and insert regions of cry1F event 281-24-236.

[0017] SEQ ID NO:4 is the sequence of the reverse primer "281-15" used with forward primer "281-14" to amplify a 603 bp amplicon that spans the 5' junction between the flanking and insert regions of cry1F event 281-24-236.

[0018] SEQ ID NO:5 is the 603 bp sequence of the amplicon produced using the primers of SEQ ID NOS:3 and 4.

[0019] SEQ ID NO:6 is the sequence of forward primer "281-9" used with reverse primer "281-10" to amplify a 562 bp amplicon that spans the 3' junction between the insert and flanking regions of cry1F event 281-24-236.

[0020] SEQ ID NO:7 is the sequence of the reverse primer "281-10" used with forward primer "281-9" to amplify a 562 bp amplicon that spans the 3' junction between the flanking and insert regions of cry1F event 281-24-236.

[0021] SEQ ID NO:8 is the 562 bp sequence of the amplicon produced using the primers of SEQ ID NOS:6 and 7.

[0022] SEQ ID NO:9 is the sequence of forward primer "3006-20" used with reverse primer "3006-22" to amplify a 614 bp amplicon that spans the 5' junction between the flanking and insert regions of cry1Ac event 3006-210-23.

[0023] SEQ ID NO:10 is the sequence of the reverse primer "3006-22" used with forward primer "3006-20" to amplify a 614 bp amplicon that spans the 5' junction between the flanking and insert regions of cry1Ac event 3006-210-23.

[0024] SEQ ID NO:11 is the 614 bp sequence of the amplicon produced using the primers of SEQ ID NOS:9 and 10.

[0025] SEQ ID NO:12 is the sequence of forward primer "3006-9" used with reverse primer "3006-12" to amplify a 662 bp amplicon that spans the 3' junction between the insert and flanking regions of cry1Ac event 3006-210-23.

[0026] SEQ ID NO:13 is the sequence of the reverse primer "3006-12" used with forward primer "3006-9" to amplify a 662 bp amplicon that spans the 3' junction between the flanking and insert regions of cry1Ac event 3006-210-23.

[0027] SEQ ID NO:14 is the 662 bp sequence of the amplicon produced using the primers of SEQ ID NOS:12 and 13.

[0028] SEQ ID NO:15 is a segment of genomic cotton DNA for event 281-24-236 (53 missing bases).

[0029] SEQ ID NO:16 is a segment of genomic cotton DNA for event 3006-210-23 (16 missing bases).

DETAILED DESCRIPTION OF THE INVENTION

[0030] This invention relates to plant breeding and the protection of plants from insects. More specifically, this invention includes novel transformation events of cotton plants (e.g. Gossypium hirsutum and Gossypium barbadense) comprising one or more polynucleotide sequences, as described herein, inserted into specific site(s) within the genome of a cotton cell. In highly preferred embodiments, said polynucleotide sequences encode "stacked" Cry1F and Cry1Ac lepidopteran insect inhibitory proteins. However, the subject invention includes plants having single Cry1F or Cry1Ac events, as described herein.

[0031] Additionally, the subject invention provides assays for detecting the presence of one or more of the subject events in a sample. Aspects of the subject invention include methods of designing and/or producing any of the diagnostic nucleic acid molecules exemplified or suggested herein, particularly those based wholly or partially on the subject flanking sequences.

[0032] More specifically, the subject invention relates in part to two transgenic cotton events (cry1F 281-24-236 and cry1Ac 3006-210-23), plant lines comprising these events, and the cloning and analysis of the DNA sequences of this cry1F insert, these cry1Ac inserts, and/or the border regions thereof. Plant lines of the subject invention can be detected using sequences disclosed and suggested herein.

[0033] In preferred embodiments, this invention relates to insect-resistant cotton lines, and the identification thereof, that produces two "stacked" insecticidal proteins known as Cry1F and Cry1Ac. In preferred embodiments, a plant line of the subject invention comprises cry1F event 281-24-236 and cry1Ac event 3006-210-23. However, plants of the subject invention can comprise any one or, preferably, both of the events discussed herein.

[0034] As alluded to above in the Background section, the introduction and integration of a transgene into a plant genome involves some random events (hence the name "event" for a given insertion that is expressed). That is, with many transformation techniques such as Agrobacterium transformation, the "gene gun," and WHISKERS, it is unpredictable where in the genome a transgene will become inserted. Thus, identifying the flanking plant genomic DNA on both sides of the insert can be important for identifying a plant that has a given insertion event. For example, PCR primers can be designed that generate a PCR amplicon across the junction region of the insert and the host genome. This PCR amplicon can be used to identify a unique or distinct type of insertion event.

[0035] As "events" are random events and generally cannot be duplicated, as part of this disclosure at least 2500 seeds of a cotton line, comprising the cry1F event 281-24-236 and cry1Ac event 3006-210-23, have been deposited, and made available to the public without restriction (but subject to patent rights), with the American Type Culture Collection (ATCC), Rockville, Md. 20852. The deposit has been designated as ATCC Deposit No. PTA-6233. The deposit will be maintained without restriction at the ATCC depository, which is a public depository, for a period of 30 years, or five years after the most recent request, or for the effective life of the patent, whichever is longer, and will be replaced if it becomes nonviable during that period.

[0036] The deposited seeds are part of the subject invention. Clearly, cotton plants can be grown from these seeds, and such plants are part of the subject invention. The subject invention also relates to DNA sequences contained in these cotton plants that are useful for detecting these plants and progeny thereof. Detection methods and kits of the subject invention can be directed to identifying any one, two, or even all three of these events, depending on the ultimate purpose of the test.

[0037] Definitions and examples are provided herein to help describe the present invention and to guide those of ordinary skill in the art to practice the invention. Unless otherwise noted, terms are to be understood according to conventional usage by those of ordinary skill in the relevant art. The nomenclature for DNA bases as set forth at 37 CFR .sctn.1.822 is used.

[0038] A transgenic "event" is produced by transformation of plant cells with heterologous DNA, i.e., a nucleic acid construct that includes a transgene of interest, regeneration of a population of plants resulting from the insertion of the transgene into the genome of the plant, and selection of a particular plant characterized by insertion into a particular genome location. The term "event" refers to the original transformant and progeny of the transformant that include the heterologous DNA. The term "event" also refers to progeny produced by a sexual outcross between the transformant and another variety that includes the genomic/transgene DNA. Even after repeated back-crossing to a recurrent parent, the inserted transgene DNA and flanking genomic DNA (genomic/transgene DNA) from the transformed parent is present in the progeny of the cross at the same chromosomal location. The term "event" also refers to DNA from the original transformant and progeny thereof comprising the inserted DNA and flanking genomic sequence immediately adjacent to the inserted DNA that would be expected to be transferred to a progeny that receives inserted DNA including the transgene of interest as the result of a sexual cross of one parental line that includes the inserted DNA (e.g., the original transformant and progeny resulting from selfing) and a parental line that does not contain the inserted DNA.

[0039] A "junction sequence" spans the point at which DNA inserted into the genome is linked to DNA from the cotton native genome flanking the insertion point, the identification or detection of one or the other junction sequences in a plant's genetic material being sufficient to be diagnostic for the event. Included are the DNA sequences that span the insertions in herein-described cotton events and similar lengths of flanking DNA. Specific examples of such diagnostic sequences are provided herein; however, other sequences that overlap the junctions of the insertions, or the junctions of the insertions and the genomic sequence, are also diagnostic and could be used according to the subject invention.

[0040] The subject invention relates to the identification of such flanking, junction, and insert sequences. Related PCR primers and amplicons are included in the invention. According to the subject invention, PCR analysis methods using amplicons that span across inserted DNA and its borders (of Cry1F 281-24-236 and/or Cry1Ac 3006-210-23) can be used to detect or identify commercialized transgenic cotton varieties or lines derived from the subject proprietary transgenic cotton lines.

[0041] The entire sequences of each of these inserts, together with the respective flanking sequences, are provided herein as SEQ ID NO:1 (cry1F 281-24-236) and SEQ ID NO:2 (cry1Ac 3006-210-23). Table 1 provides the coordinates of the insert and flanking sequences for these events.

TABLE-US-00001 TABLE 1 For indicated SEQ ID NO:, residue location of: Event 5' Flanking Insert 3' Flanking cry1F 1-2074 2,075-12,748 12,749-15,490 281-24-236 (SEQ ID NO: 1) cry1Ac 1-527 528-8,900 8,901-9,382 3006-210-23 (SEQ ID NO: 2)

[0042] These insertion events, and further components thereof, are further illustrated in FIGS. 1 and 2. These sequences (particularly the flanking sequences) are unique. Based on these insert and border sequences, event-specific primers were generated. PCR analysis demonstrated that these cotton lines can be identified in different cotton genotypes by analysis of the PCR amplicons generated with these event-specific primer sets. Thus, these and other related procedures can be used to uniquely identify these cotton lines. The sequences identified herein are unique. For example, BLAST searches against GENBANK databases did not reveal any significant homology between the cloned border sequences and sequences in the database.

[0043] Detection techniques of the subject invention are especially useful in conjunction with plant breeding, to determine which progeny plants comprise a given event, after a parent plant comprising an event of interest is crossed with another plant line in an effort to impart one or more additional traits of interest in the progeny. These PCR analysis methods benefit cotton breeding programs as well as quality control, especially for commercialized transgenic cottonseeds. PCR detection kits for these transgenic cotton lines can also now be made and used. This can also benefit product registration and product stewardship.

[0044] Furthermore, flanking cotton sequences can be used to specifically identify the genomic location of each insert. This information can be used to make molecular marker systems specific to each event. These can be used for accelerated breeding strategies and to establish linkage data.

[0045] Still further, the flanking sequence information can be used to study and characterize transgene integration processes, genomic integration site characteristics, event sorting, stability of transgenes and their flanking sequences, and gene expression (especially related to gene silencing, transgene methylation patterns, position effects, and potential expression-related elements such as MARS [matrix attachment regions], and the like).

[0046] In light of all the subject disclosure, it should be clear that the subject invention includes seeds available under ATCC Deposit No. PTA-6233. The subject invention also includes an insect-resistant cotton plant grown from a seed deposited with the ATCC under accession number PTA-6233. The subject invention further includes parts of said plant, such as leaves, tissue samples, seeds produced by said plant, pollen, and the like.

[0047] Still further, the subject invention includes descendant and/or progeny plants of plants grown from the deposited seed, preferably an insect-resistant cotton plant wherein said plant has a genome comprising a detectable wild-type genomic DNA/insert DNA junction sequence as described herein. As used herein, the term "cotton" means Gossypium hirsutum and includes all plant varieties that can be bred with cotton, including Gossypium barbadense.

[0048] This invention further includes processes of making crosses using a plant of the subject invention as at least one parent. For example, the subject invention includes an F.sub.1 hybrid plant having as one or both parents any of the plants exemplified herein. Also within the subject invention is seed produced by such F.sub.1 hybrids of the subject invention. This invention includes a method for producing an F.sub.1 hybrid seed by crossing an exemplified plant with a different (e.g. in-bred parent) plant and harvesting the resultant hybrid seed. The subject invention includes an exemplified plant that is either a female parent or a male parent. Characteristics of the resulting plants may be improved by careful consideration of the parent plants.

[0049] An insect-resistant cotton plant can be bred by first sexually crossing a first parental cotton plant consisting of a cotton plant grown from seed of any one of the lines referred to herein, and a second parental cotton plant, thereby producing a plurality of first progeny plants; and then selecting a first progeny plant that is resistant to insects (or that possesses at least one of the events of the subject invention); and selfing the first progeny plant, thereby producing a plurality of second progeny plants; and then selecting from the second progeny plants a plant that is resistant to insects (or that possesses at least one of the events of the subject invention). These steps can further include the back-crossing of the first progeny plant or the second progeny plant to the second parental cotton plant or a third parental cotton plant. A cotton crop comprising cotton seeds of the subject invention, or progeny thereof, can then be planted.

[0050] It is also to be understood that two different transgenic plants can also be mated to produce offspring that contain two independently segregating added, exogenous genes. Selfing of appropriate progeny can produce plants that are homozygous for both added, exogenous genes. Back-crossing to a parental plant and out-crossing with a non-transgenic plant are also contemplated, as is vegetative propagation. Other breeding methods commonly used for different traits and crops are known in the art. Backcross breeding has been used to transfer genes for a simply inherited, highly heritable trait into a desirable homozygous cultivar or inbred line, which is the recurrent parent. The source of the trait to be transferred is called the donor parent. The resulting plant is expected to have the attributes of the recurrent parent (e.g., cultivar) and the desirable trait transferred from the donor parent. After the initial cross, individuals possessing the phenotype of the donor parent are selected and repeatedly crossed (backcrossed) to the recurrent parent. The resulting parent is expected to have the attributes of the recurrent parent (e.g., cultivar) and the desirable trait transferred from the donor parent.

[0051] The DNA molecules of the present invention can be used as molecular markers in a marker assisted breeding (MAB) method. DNA molecules of the present invention can be used in methods (such as, AFLP markers, RFLP markers, RAPD markers, SNPs, and SSRs) that identify genetically linked agronomically useful traits, as is known in the art. The insect-resistance trait can be tracked in the progeny of a cross with a cotton plant of the subject invention (or progeny thereof and any other cotton cultivar or variety) using the MAB methods. The DNA molecules are markers for this trait, and MAB methods that are well known in the art can be used to track the insect-resistance trait(s) in cotton plants where at least one cotton line of the subject invention, or progeny thereof, was a parent or ancestor. The methods of the present invention can be used to identify any cotton variety having the insect-resistance event from cotton line 281-24-236 (cry1F) and/or 3006-210-23 (cry1Ac).

[0052] Methods of the subject invention include a method of producing an insect-resistant cotton plant wherein said method comprises breeding with a plant of the subject invention. More specifically, said methods can comprise crossing two plants of the subject invention, or one plant of the subject invention and any other plant. Preferred methods further comprise selecting progeny of said cross by analyzing said progeny for an event detectable according to the subject invention.

[0053] A preferred plant, or a seed, of the subject invention comprises in its genome at least one of the insert sequences, as identified in Table 1, together with at least 20-500 or more contiguous flanking nucleotides on both sides of the insert, as identified in Table 1. Unless indicated otherwise, "cry1F cotton event 281-24-236" refers to DNA of SEQ ID NO:1 that includes the heterologous DNA inserted in the original transformant (nucleotides 2075-12,748 of SEQ ID NO:1) and all or part of both of the flanking genomic sequences of SEQ ID NO:1 (nucleotide residues 1-2074 and 12,749-15,490) immediately adjacent to the inserted DNA that would be expected to be transferred to progeny that receives the inserted DNA as a result of a sexual cross of a parental line that includes the event. Similarly, unless indicated otherwise, "cry1Ac cotton event 3006-210-23" refers to DNA of SEQ ID NO:2 that includes the heterologous DNA inserted in the original transformant (nucleotides 528-8900 of SEQ ID NO:2) and all or part of both of the flanking genomic sequences of SEQ ID NO:2 (residues 1-527 and 8901-9382) immediately adjacent to the inserted DNA that would be expected to be transferred to progeny that receives the inserted DNA as a result of a sexual cross of a parental line that includes the event.

[0054] The subject invention includes tissue cultures of regenerable cells of a plant of the subject invention. Also included is a plant regenerated from such tissue culture, particularly where said plant is capable of expressing all the morphological and physiological properties of an exemplified variety. Preferred plants of the subject invention have all the physiological and morphological characteristics of a plant grown from the deposited seed. This invention further comprises progeny of such seed and seed possessing the quality traits of interest.

[0055] Manipulations (such as mutation, further transfection, and further breeding) of plants or seeds, or parts thereof, may lead to the creation of what may be termed "essentially derived" varieties. The International Union for the Protection of New Varieties of Plants (UPOV) has provided the following guideline for determining if a variety has been essentially derived from a protected variety:

[0056] [A] variety shall be deemed to be essentially derived from another variety ("the initial variety") when

[0057] (i) it is predominantly derived from the initial variety, or from a variety that is itself predominantly derived from the initial variety, while retaining the expression of the essential characteristics that result from the genotype or combination of genotypes of the initial variety;

[0058] (ii) it is clearly distinguishable from the initial variety; and

[0059] (iii) except for the differences which result from the act of derivation, it conforms to the initial variety in the expression of the essential characteristics that result from the genotype or combination of genotypes of the initial variety.

[0060] UPOV, Sixth Meeting with International Organizations, Geneva, Oct. 30, 1992; document prepared by the Office of the Union.

[0061] As used herein, a "line" is a group of plants that display little or no genetic variation between individuals for at least one trait. Such lines may be created by several generations of self-pollination and selection, or vegetative propagation from a single parent using tissue or cell culture techniques.

[0062] As used herein, the terms "cultivar" and "variety" are synonymous and refer to a line which is used for commercial production.

[0063] "Stability" or "stable" means that with respect to the given component, the component is maintained from generation to generation and, preferably, at least three generations at substantially the same level, e.g., preferably .+-.15%, more preferably .+-.10%, most preferably .+-.5%. The stability may be affected by temperature, location, stress and the time of planting. Comparison of subsequent generations under field conditions should produce the component in a similar manner.

[0064] "Commercial Utility" is defined as having good plant vigor and high fertility, such that the crop can be produced by farmers using conventional farming equipment, and the oil with the described components can be extracted from the seed using conventional crushing and extraction equipment. To be commercially useful, the yield, as measured by seed weight, oil content, and total oil produced per acre, is within 15% of the average yield of an otherwise comparable commercial canola variety without the premium value traits grown in the same region.

[0065] "Agronomically elite" means that a line has desirable agronomic characteristics such as yield, maturity, disease resistance, and the like, in addition to the insect resistance due to the subject event(s).

[0066] As one skilled in the art will recognize in light of this disclosure, preferred embodiments of detection kits, for example, can include probes and/or primers directed to and/or comprising "junction sequences" or "transition sequences" (where the cotton genomic flanking sequence meets the insert sequence). For example, this includes a polynucleotide probe, primer, or amplicon comprising a sequence including residues 2074-2075 or 12,748-12,749 of SEQ ID NO:1, or residues 527-528 or 8,900-8,901 of SEQ ID NO:2, as indicated in Table 1. To be diagnostic for these particular events, preferred "junction primers" should include at least .about.15 residues of the adjacent flanking sequence and at least .about.15 residues of the adjacent insert sequence. With this arrangement, another primer in either the flanking or insert region can be used to generate a detectable amplicon that indicates the presence of an event of the subject invention. In preferred embodiments, however, one primer binds in the flanking region and one binds in the insert, and these primers can be used to generate an amplicon that spans (and includes) a junction sequence as indicated above.

[0067] One skilled in the art will also recognize that primers and probes can be designed to hybridize, under a range of standard hybridization and/or PCR conditions, to a segment of SEQ ID NO:1, SEQ ID NO:2, and complements thereof, wherein the primer or probe is not perfectly complementary to the exemplified sequence. That is, some degree of mismatch can be tolerated. For an approximately 20 nucleotide primer, for example, typically one or two or so nucleotides do not need to bind with the opposite strand if the mismatched base is internal or on the end of the primer that is opposite the amplicon. Various appropriate hybridization conditions are provided below. Synthetic nucleotide analogs, such as inosine, can also be used in probes. Peptide nucleic acid (PNA) probes, as well as DNA and RNA probes, can also be used. What is important is that such probes and primers are diagnostic for (able to uniquely identify and distinguish) the presence of an event of the subject invention.

[0068] It should be further noted that errors in PCR amplification can occur which might result in minor sequencing errors, for example. That is, unless otherwise indicated, the sequences listed herein were determined by generating long amplicons from cotton genomic DNAs, and then cloning and sequencing the amplicons. It is not unusual to find slight differences and minor discrepancies in sequences generated and determined in this manner, given the many rounds of amplification that are necessary to generate enough amplicon for sequencing from genomic DNAs. For example, the following differences between the determined sequences of the event-flanking DNAs and the corresponding, known/wild-type/genomic DNAs are noted. In the 5' flank for the subject cry1F event, residue 2037 of SEQ ID NO:1 was determined to be/is listed as "G" whereas the corresponding residue of the 281-24-236 locus of the known genomic sequence is "A" (R can be used in a consensus sequence, according to standard IUPAC-IUB conventions). In the 3' flank of this event, residue 12,781 of SEQ ID NO:1 is listed herein as T whereas C is provided in the published genomic sequence at the corresponding location (Y is the consensus code). Position 12,811 of SEQ ID NO:1 is C whereas T is provided for the genome (Y would be the consensus). Position 12,866 is listed as C in SEQ ID NO:1 whereas T appears in the genome (Y is the consensus). Position 12,882 is listed as G in SEQ ID NO:1 whereas A appears for the genome (R is the consensus). Position 12,918 is listed as A in SEQ ID NO:1 whereas G appears in the genome (R is the consensus). Residue 13,129 is listed as G in SEQ ID NO:1 whereas A appears in the genome (R is the consensus). Residue 13,222 is listed as C in SEQ ID NO:1 whereas T appears in the genomic sequence (Y is the consensus). At position 13,441 in SEQ ID NO:1, a T appears whereas there is no corresponding residue in the genomic listing. Thus, this apparent insertion would shift the downstream numbering of SEQ ID NO:1 accordingly, as compared to the genomic sequence. One skilled in the art should recognize and be put on notice than any adjustments needed due to these types of common sequencing errors or discrepancies are within the scope of the subject invention.

[0069] Similar differences also appear in the 5' flank for the subject cry1Ac event. At positions 149, 153, 159, 165, and 244 of SEQ ID NO:2, the following residues are listed, respectively: C, G, C, C, and C. In the genomic sequence at the 3006-210-23 locus, the following residues appear, respectively, at corresponding locations: A, A, A, A, and A. Consensus codes for these substitutions are, respectively, M, R, M, M, and M. Adjustments to probes and primers can be made accordingly, and corresponding differences might be noted in amplicons that span or include any of the above residues.

[0070] It should also be noted that it is not uncommon for some genomic sequence to be deleted when a sequence is inserted during the creation of an event. This was the case for both events of the subject invention. That is, SEQ ID NO:1 provides a 53-base segment of genomic cotton DNA for event 281-24-236 that was deleted during the insertion. This "interior segment" occurs between residues 2074 and 12,749 of SEQ ID NO:1 in the non-transformed cotton genome. Similarly, SEQ ID NO:2 provides a 16-base segment of genomic cotton DNA for event 3006-210-23 that was deleted during the insertion. This "interior segment" occurs between residues 527 and 8,901 of SEQ ID NO:2 in the non-transformed cotton genome.

[0071] As illustrated in FIGS. 1 and 2, the components of each of the "inserts" are as follows. The transgene genetic element DNA molecules contained in the subject event Cry1F 281-24-236 consists of the maize ubiquitin 1 promoter, operably connected to the phosphinothricin N-acetyltransferase (PAT) from Streptomyces viridochromogenes, operably connected to the ORF25 polyadenylation sequences (Baker et al., Plant Molecular Biology 2:335-350, 1983); the chimeric promoter [(4OCS).delta.MAS] containing a partially deleted mannopines synthase promoter with 4 enhancer elements from the octopine synthase promoter, operably connected to the Cry1F(synpro) from Bacillus thuringiensis var. aizawai, operably connected to ORF25 polyadenylation sequences (Baker et al., Plant Molecular Biology 2:335-350, 1983); and the maize ubiquitin 1 promoter unoperably connected to a partial pat sequence. The DNA polynucleotide sequences or fragments of these components can be used as DNA primers or probes in the methods of the present invention.

[0072] The transgene genetic element DNA molecules contained in the subject event Cry1Ac 3006-210-23 consists of the (4OCS).delta.MAS promoter operably connected to the PAT (as described above), operably connected to the ORF25; and the maize ubiquitin 1 promoter operably connected to the Cry1Ac (synpro) from Bacillus thuringiensis var. kurstaki, operably connected to the ORF25 polyadenylation sequences. The DNA polynucleotide sequences of these components, or fragments thereof, can be used as DNA primers or probes in the methods of the present invention.

[0073] In some embodiments of the invention, compositions and methods are provided for detecting the presence of the transgene/genomic insertion region, in plants and seeds and the like, from a cotton plant designated WIDESTRIKE comprising Cry1F event 281-24-236 and Cry1Ac event 3006-210-23. DNA sequences are provided that comprise at least one transgene/genomic insertion region junction sequence provided herein in SEQ ID NO:1, SEQ ID NO:2, segments thereof, and complements of the exemplified sequences and any segments thereof. The insertion region junction sequence spans the junction between heterologous DNA inserted into the genome and the DNA from the cotton cell flanking the insertion site. Such sequences are diagnostic for one or more of the given events.

[0074] Based on these insert and border sequences, event-specific primers were generated. PCR analysis demonstrated that these cotton lines (Cry1F 281-24-236 and Cry1Ac 3006-210-23) can be identified in different cotton genotypes by analysis of the PCR amplicons generated with these event-specific primer sets. These and other related procedures can be used to uniquely identify these cotton lines. Thus, PCR amplicons derived from such primer pairs are unique and can be used to identify these cotton lines.

[0075] In some embodiments, DNA sequences that comprise at least one of the novel transgene/genomic insertion regions are an aspect of this invention. Included are DNA sequences that comprise a sufficient length of polynucleotides of transgene insert sequence and a sufficient length of polynucleotides of cotton genomic sequence from one or more of the three aforementioned cotton plants and/or sequences that are useful as primer sequences for the production of an amplicon product diagnostic for one or more of these cotton plants.

[0076] Related embodiments pertain to DNA sequences that comprise at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more contiguous nucleotides of a transgene portion of a DNA sequence selected from the group consisting of SEQ ID NO:1 and SEQ ID NO:2, or complements thereof, and a similar length of flanking cotton DNA sequence from these sequences, or complements thereof. Such sequences are useful as DNA primers in DNA amplification methods. The amplicons produced using these primers are diagnostic for any of the cotton events referred to herein. Therefore, the invention also includes the amplicons produced by such DNA primers and homologous primers.

[0077] Following is a table that summarizes specific embodiments of the subject invention:

TABLE-US-00002 TABLE 2 List of Primers and Their Sequences Used in Event-Specific PCR Amplification Forward Reverse Amplicon Sequence Sequence Size Target Event (5'-3) (5'-3') (bp) Region 281- tgtcggctgaa ccggacatga 603 5' insert 24- ggtagggagg agccatttac (SEQ ID junction 236 (281-14) (281-15) NO: 5) (SEQ ID (SEQ ID NO: 3) NO: 4) tctctagagag Cgagctggaga 562 3' insert gggcacgacc gaccggtgac (SEQ ID junction (281-9) (281-10) NO: 8) (SEQ ID (SEQ ID NO: 6) NO: 7) 3006- ttccaacctttaa gctgcggaca 614 5' insert 210- ctattatcctgc tctacatttt (SEQ ID junction 23 (3006-20) (3006-22) NO: 11) (SEQ ID (SEQ ID NO: 9) NO: 10) gacatgcaatgc Aagtctctgcc 662 3' insert tcattatctcta ttctaccctgg (SEQ ID junction (3006-9) (3006-12) NO: 14) (SEQ ID (SEQ ID NO: 12) NO: 13)

[0078] This invention also includes methods of detecting the presence of DNA, in a sample, that corresponds to at least one of the cotton events referred to herein. Such methods can comprise: (a) contacting the sample comprising DNA with a primer set that, when used in a nucleic acid amplification reaction with DNA from at least one of these cotton events, produces an amplicon that is diagnostic for said event(s); (b) performing a nucleic acid amplification reaction, thereby producing the amplicon; and (c) detecting the amplicon.

[0079] Further detection methods of the subject invention include a method of detecting the presence of a DNA, in a sample, corresponding to at least one of said events, wherein said method comprises: (a) contacting the sample comprising DNA with a probe that hybridizes under stringent hybridization conditions with DNA from at least one of said cotton events and which does not hybridize under the stringent hybridization conditions with a control cotton plant (non-event-of-interest DNA); (b) subjecting the sample and probe to stringent hybridization conditions; and (c) detecting hybridization of the probe to the DNA.

[0080] In still further embodiments, the subject invention includes methods of producing a cotton plant comprising a cry1F and/or a cry1Ac event of the subject invention, wherein said method comprises the steps of: (a) sexually crossing a first parental cotton line (comprising an expression cassettes of the present invention, which confers said insect resistance trait to plants of said line) and a second parental cotton line (that lacks this insect tolerance trait) thereby producing a plurality of progeny plants; and (b) selecting a progeny plant by the use of molecular markers. Such methods may optionally comprise the further step of back-crossing the progeny plant to the second parental cotton line to producing a true-breeding cotton plant that comprises said insect tolerance trait.

[0081] According to another aspect of the invention, methods of determining the zygosity of progeny of a cross with any one (or more) of said three events are provided. Said methods can comprise contacting a sample, comprising cotton DNA, with a primer set of the subject invention. Said primers, when used in a nucleic-acid amplification reaction with genomic DNA from at least one of said cotton events, produce a first amplicon that is diagnostic for at least one of said cotton events. Such methods further comprise performing a nucleic acid amplification reaction, thereby producing the first amplicon; detecting the first amplicon; and contacting the sample comprising cotton DNA with said primer set (said primer set, when used in a nucleic-acid amplification reaction with genomic DNA from cotton plants, produces a second amplicon comprising the native cotton genomic DNA homologous to the cotton genomic region of a transgene insertion identified as one of said cotton events); and performing a nucleic acid amplification reaction, thereby producing the second amplicon. The methods further comprise detecting the second amplicon, and comparing the first and second amplicons in a sample, wherein the presence of both amplicons indicates that the sample is heterozygous for the transgene insertion.

[0082] DNA detection kits can be developed using the compositions disclosed herein and methods well known in the art of DNA detection. The kits are useful for identification of the subject cotton event DNA in a sample and can be applied to methods for breeding cotton plants containing this DNA. The kits contain DNA sequences homologous or complementary to the amplicons, for example, disclosed herein, or to DNA sequences homologous or complementary to DNA contained in the transgene genetic elements of the subject events. These DNA sequences can be used in DNA amplification reactions or as probes in a DNA hybridization method. The kits may also contain the reagents and materials necessary for the performance of the detection method.

[0083] A "probe" is an isolated nucleic acid molecule to which is attached a conventional detectable label or reporter molecule (such as a radioactive isotope, ligand, chemiluminescent agent, or enzyme). Such a probe is complementary to a strand of a target nucleic acid, in the case of the present invention, to a strand of genomic DNA from one of said cotton events, whether from a cotton plant or from a sample that includes DNA from the event. Probes according to the present invention include not only deoxyribonucleic or ribonucleic acids but also polyamides and other probe materials that bind specifically to a target DNA sequence and can be used to detect the presence of that target DNA sequence.

[0084] "Primers" are isolated nucleic acids that are annealed to a complementary target DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand, then extended along the target DNA strand by a polymerase, e.g., a DNA polymerase. Primer pairs of the present invention refer to their use for amplification of a target nucleic acid sequence, e.g., by the polymerase chain reaction (PCR) or other conventional nucleic-acid amplification methods.

[0085] Probes and primers are generally 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, or 500 polynucleotides or more in length. Such probes and primers hybridize specifically to a target sequence under high stringency hybridization conditions. Preferably, probes and primers according to the present invention have complete sequence similarity with the target sequence, although probes differing from the target sequence and that retain the ability to hybridize to target sequences may be designed by conventional methods.

[0086] Methods for preparing and using probes and primers are described, for example, in Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, ed. Sambrook et al., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989. PCR-primer pairs can be derived from a known sequence, for example, by using computer programs intended for that purpose.

[0087] Primers and probes based on the flanking DNA and insert sequences disclosed herein can be used to confirm (and, if necessary, to correct) the disclosed sequences by conventional methods, e.g., by re-cloning and sequencing such sequences.

[0088] The nucleic acid probes and primers of the present invention hybridize under stringent conditions to a target DNA sequence. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of DNA from a transgenic event in a sample. Nucleic acid molecules or fragments thereof are capable of specifically hybridizing to other nucleic acid molecules under certain circumstances. As used herein, two nucleic acid molecules are said to be capable of specifically hybridizing to one another if the two molecules are capable of forming an anti-parallel, double-stranded nucleic acid structure. A nucleic acid molecule is said to be the "complement" of another nucleic acid molecule if they exhibit complete complementarity. As used herein, molecules are said to exhibit "complete complementarity" when every nucleotide of one of the molecules is complementary to a nucleotide of the other. Two molecules are said to be "minimally complementary" if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under at least conventional "low-stringency" conditions. Similarly, the molecules are said to be "complementary" if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under conventional "high-stringency" conditions. Conventional stringency conditions are described by Sambrook et al., 1989. Departures from complete complementarity are therefore permissible, as long as such departures do not completely preclude the capacity of the molecules to form a double-stranded structure. In order for a nucleic acid molecule to serve as a primer or probe it need only be sufficiently complementary in sequence to be able to form a stable double-stranded structure under the particular solvent and salt concentrations employed.

[0089] As used herein, a substantially homologous sequence is a nucleic acid sequence that will specifically hybridize to the complement of the nucleic acid sequence to which it is being compared under high stringency conditions. The term "stringent conditions" is functionally defined with regard to the hybridization of a nucleic-acid probe to a target nucleic acid (i.e., to a particular nucleic-acid sequence of interest) by the specific hybridization procedure discussed in Sambrook et al., 1989, at 9.52-9.55. See also, Sambrook et al., 1989 at 9.47-9.52 and 9.56-9.58. Accordingly, the nucleotide sequences of the invention may be used for their ability to selectively form duplex molecules with complementary stretches of DNA fragments.

[0090] Depending on the application envisioned, one can use varying conditions of hybridization to achieve varying degrees of selectivity of probe towards target sequence. For applications requiring high selectivity, one will typically employ relatively stringent conditions to form the hybrids, e.g., one will select relatively low salt and/or high temperature conditions, such as provided by about 0.02 M to about 0.15 M NaCl at temperatures of about 50.degree. C. to about 70.degree. C. Stringent conditions, for example, could involve washing the hybridization filter at least twice with high-stringency wash buffer (0.2.times.SSC, 0.1% SDS, 65.degree. C.). Appropriate stringency conditions which promote DNA hybridization, for example, 6.0.times. sodium chloride/sodium citrate (SSC) at about 45.degree. C., followed by a wash of 2.0.times.SSC at 50.degree. C. are known to those skilled in the art, 6.3.1-6.3.6. For example, the salt concentration in the wash step can be selected from a low stringency of about 2.0.times.SSC at 50.degree. C. to a high stringency of about 0.2.times.SSC at 50.degree. C. In addition, the temperature in the wash step can be increased from low stringency conditions at room temperature, about 22.degree. C., to high stringency conditions at about 65.degree. C. Both temperature and salt may be varied, or either the temperature or the salt concentration may be held constant while the other variable is changed. Such selective conditions tolerate little, if any, mismatch between the probe and the template or target strand. Detection of DNA sequences via hybridization is well-known to those of skill in the art, and the teachings of U.S. Pat. Nos. 4,965,188 and 5,176,995 are exemplary of the methods of hybridization analyses.

[0091] In a particularly preferred embodiment, a nucleic acid of the present invention will specifically hybridize to one or more of the primers (or amplicons or other sequences) exemplified or suggested herein, including complements and fragments thereof, under high stringency conditions. In one aspect of the present invention, a marker nucleic acid molecule of the present invention has the nucleic acid sequence set forth in SEQ ID NOS:3-14, or complements and/or fragments thereof.

[0092] In another aspect of the present invention, a marker nucleic acid molecule of the present invention shares between 80% and 100% or 90% and 100% sequence identity with such nucleic acid sequences. In a further aspect of the present invention, a marker nucleic acid molecule of the present invention shares between 95% and 100% sequence identity with such sequence. Such sequences may be used as markers in plant breeding methods to identify the progeny of genetic crosses. The hybridization of the probe to the target DNA molecule can be detected by any number of methods known to those skilled in the art, these can include, but are not limited to, fluorescent tags, radioactive tags, antibody based tags, and chemiluminescent tags.

[0093] Regarding the amplification of a target nucleic acid sequence (e.g., by PCR) using a particular amplification primer pair, "stringent conditions" are conditions that permit the primer pair to hybridize only to the target nucleic-acid sequence to which a primer having the corresponding wild-type sequence (or its complement) would bind and preferably to produce a unique amplification product, the amplicon.

[0094] The term "specific for (a target sequence)" indicates that a probe or primer hybridizes under stringent hybridization conditions only to the target sequence in a sample comprising the target sequence.

[0095] As used herein, "amplified DNA" or "amplicon" refers to the product of nucleic-acid amplification of a target nucleic acid sequence that is part of a nucleic acid template. For example, to determine whether the cotton plant resulting from a sexual cross contains transgenic event genomic DNA from the cotton plant of the present invention, DNA extracted from a cotton plant tissue sample may be subjected to nucleic acid amplification method using a primer pair that includes a primer derived from flanking sequence in the genome of the plant adjacent to the insertion site of inserted heterologous DNA, and a second primer derived from the inserted heterologous DNA to produce an amplicon that is diagnostic for the presence of the event DNA. The amplicon is of a length and has a sequence that is also diagnostic for the event. The amplicon may range in length from the combined length of the primer pairs plus one nucleotide base pair, and/or the combined length of the primer pairs plus about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, or 500, 750, 1000, 1250, 1500, 1750, 2000, or more nucleotide base pairs (plus or minus any of the increments listed above). Alternatively, a primer pair can be derived from flanking sequence on both sides of the inserted DNA so as to produce an amplicon that includes the entire insert nucleotide sequence. A member of a primer pair derived from the plant genomic sequence may be located a distance from the inserted DNA sequence. This distance can range from one nucleotide base pair up to about twenty thousand nucleotide base pairs. The use of the term "amplicon" specifically excludes primer dimers that may be formed in the DNA thermal amplification reaction.

[0096] Nucleic-acid amplification can be accomplished by any of the various nucleic-acid amplification methods known in the art, including the polymerase chain reaction (PCR). A variety of amplification methods are known in the art and are described, inter alia, in U.S. Pat. No. 4,683,195 and U.S. Pat. No. 4,683,202. PCR amplification methods have been developed to amplify up to 22 kb of genomic DNA. These methods as well as other methods known in the art of DNA amplification may be used in the practice of the present invention. The sequence of the heterologous transgene DNA insert or flanking genomic sequence from a subject cotton event can be verified (and corrected if necessary) by amplifying such sequences from the event using primers derived from the sequences provided herein followed by standard DNA sequencing of the PCR amplicon or of the cloned DNA.

[0097] The amplicon produced by these methods may be detected by a plurality of techniques. Agarose gel electrophoresis and staining with ethidium bromide is a common well known method of detecting DNA amplicons. Another such method is Genetic Bit Analysis where an DNA oligonucleotide is designed which overlaps both the adjacent flanking genomic DNA sequence and the inserted DNA sequence. The oligonucleotide is immobilized in wells of a microwell plate. Following PCR of the region of interest (using one primer in the inserted sequence and one in the adjacent flanking genomic sequence), a single-stranded PCR product can be hybridized to the immobilized oligonucleotide and serve as a template for a single base extension reaction using a DNA polymerase and labelled ddNTPs specific for the expected next base. Readout may be fluorescent or ELISA-based. A signal indicates presence of the insert/flanking sequence due to successful amplification, hybridization, and single base extension.

[0098] Another method is the Pyrosequencing technique as described by Winge (Innov. Pharma. Tech. 00:18-24, 2000). In this method an oligonucleotide is designed that overlaps the adjacent genomic DNA and insert DNA junction. The oligonucleotide is hybridized to single-stranded PCR product from the region of interest (one primer in the inserted sequence and one in the flanking genomic sequence) and incubated in the presence of a DNA polymerase, ATP, sulfurylase, luciferase, apyrase, adenosine 5' phosphosulfate and luciferin. DNTPs are added individually and the incorporation results in a light signal that is measured. A light signal indicates the presence of the transgene insert/flanking sequence due to successful amplification, hybridization, and single or multi-base extension.

[0099] Fluorescence Polarization is another method that can be used to detect an amplicon of the present invention. Following this method, an oligonucleotide is designed which overlaps the genomic flanking and inserted DNA junction. The oligonucleotide is hybridized to single-stranded PCR product from the region of interest (one primer in the inserted DNA and one in the flanking genomic DNA sequence) and incubated in the presence of a DNA polymerase and a fluorescent-labeled ddNTP. Single base extension results in incorporation of the ddNTP. Incorporation can be measured as a change in polarization using a fluorometer. A change in polarization indicates the presence of the transgene insert/flanking sequence due to successful amplification, hybridization, and single base extension.

[0100] TAQMAN (PE Applied Biosystems, Foster City, Calif.) is a method of detecting and quantifying the presence of a DNA sequence. Briefly, a FRET oligonucleotide probe is designed that overlaps the genomic flanking and insert DNA junction. The FRET probe and PCR primers (one primer in the insert DNA sequence and one in the flanking genomic sequence) are cycled in the presence of a thermostable polymerase and dNTPs. Hybridization of the FRET probe results in cleavage and release of the fluorescent moiety away from the quenching moiety on the FRET probe. A fluorescent signal indicates the presence of the flanking/transgene insert sequence due to successful amplification and hybridization.

[0101] Molecular Beacons have been described for use in sequence detection. Briefly, a FRET oligonucleotide probe is designed that overlaps the flanking genomic and insert DNA junction. The unique structure of the FRET probe results in it containing secondary structure that keeps the fluorescent and quenching moieties in close proximity. The FRET probe and PCR primers (one primer in the insert DNA sequence and one in the flanking genomic sequence) are cycled in the presence of a thermostable polymerase and dNTPs. Following successful PCR amplification, hybridization of the FRET probe to the target sequence results in the removal of the probe secondary structure and spatial separation of the fluorescent and quenching moieties. A fluorescent signal results. A fluorescent signal indicates the presence of the flanking genomic/transgene insert sequence due to successful amplification and hybridization.

[0102] Having disclosed two general locations in the cotton genome that are excellent for insertions, the subject invention also comprises a cotton seed and/or a cotton plant comprising at least one non-cry1F and non-cry1Ac insert in the general vicinity of one or both of these locations. One option is to substitute a different insert in place of the cry1F and/or cry1Ac insert exemplified herein. In these generally regards, targeted homologous recombination, for example, can be used according to the subject invention. This type of technology is the subject of, for example, WO 03/080809 A2 and the corresponding published U.S. application (USPA 20030232410).

[0103] All patents, patent applications, provisional applications, and publications referred to or cited herein are incorporated by reference in their entirety to the extent they are not inconsistent with the explicit teachings of this specification.

[0104] The following examples are included to illustrate procedures for practicing the invention and to demonstrate certain preferred embodiments of the invention. These examples should not be construed as limiting. It should be appreciated by those of skill in the art that the techniques disclosed in the following examples represent specific approaches used to illustrate preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in these specific embodiments while still obtaining like or similar results without departing from the spirit and scope of the invention. Unless otherwise indicated, all percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted.

Example 1

Production of Deposited Seed

[0105] WideStrike.TM. brand insect resistance for cotton is a transgenic trait developed by Dow AgroSciences that provides in-plant insect resistance against Lepidoptera. It contains two insect tolerance genes, cry1Ac and cry1F, which were derived from Bacillus thuringiensis subspecies kurstaki and Bacillus thuringiensis subspecies aizawai, respectively. Bacillus thuringiensis (B.t.) is a common, gram-positive, soil-borne bacterium. In its spore-forming stage, it produces several insecticidal protein crystals (known as delta-endotoxins) including Cry1Ac and Cry1F. These proteins are toxic to certain lepidopteran insects. In susceptible insects, they bind to specific receptors present on midgut epithelial cells, forming pores that disrupt osmotic balance and eventually result in cell lysis and death. Cry1Ac and Cry1F have been shown to be non-toxic to humans, livestock, and beneficial insects, which do not have binding sites for the delta-endotoxin. Using two delta-endotoxins rather than one will provide improved insect resistance because the two Cry proteins provide a greater spectrum of control than either does alone and have differential activity against the lepidopteran pests that they are effective against. More importantly, it may help delay the development of resistant insects.

[0106] The cry1Ac and cry1F genes in WideStrike were introduced using Agrobacterium mediated transformation into GC-510 cotton (Gossypium hirsutum L.) plants in two separate transformation events, 3006-210-23 and 281-24-236. Following crossing into an elite cotton variety, these events were combined by conventional breeding to produce cotton bearing the WideStrike insect-resistance trait. WideStrike also contains the pat gene from Streptomyces viridochromogenes, a common aerobic soil bacteria. The pat gene codes for the Phosphinothricin Acetyl Transferase (PAT) enzyme, which detoxifies glufosinate ammonium into an inactive compound by acetylation. The pat gene was included to allow for selection of transformed cotton plants.

Example 2

Diagnostic Test for Cry1F Cotton Event 281-24-236

[0107] DNA from Cry1F event 281-24-236 and Cry1Ac events 3006-210-23, and non-transgenic cotton PCS355 was extracted from cotton leaves using QIAGEN's Plant DNeasy kit (catalog #69181, Qiagen, Valencia, Calif., USA). The manufacturer's suggested protocol was followed. In brief, leaf discs were disrupted in an RNAse supplemented preheated buffer using a tungsten carbide bead (0.125 mm diameter) and a Retsch MM3000 Mixer Mill. The mixture was centrifuged at room temperature, and the supernatant was subsequently captured by running through a DNeasy 96 plate. DNA was eluted in an elution buffer and stored frozen until use.

[0108] The DNA extracted from the cotton leaf tissue was used in a PCR DNA amplification of the 5' genomic/transgene insert sequences in Cry1F event 281-24-236 using primer 281-14 (SEQ ID NO:3, 5'TGTCGGCTGAAGGTAGGGAGG3') and primer 281-15 (SEQ ID NO:4, 5' CCGGACATGAAGCCATTTAC3'), and the 3' genomic/transgene insert sequences flanking using primer 281-9 (SEQ ID NO:6, 5'TCTCTAGAGAGGGGCACGACC3') and primer 281-10 (SEQ ID NO:7, 5'CGAGCTGGAGAGACCGGTGAC3'). The PCR DNA amplification analyses were conducted using genomic DNA extracted from cotton event Cry1F 281-24-236 and non-transgenic cotton line PCS355. The amplification reaction for the 5' flanking genomic sequence was conducted using QIAGEN HotStarTaq PCR kit (catalog #203203 or 203205, QIAGEN, Valencia, Calif., USA) with a final concentration of 0.4 .mu.M for Primer 281-14 and Primer 281-15 in a 50 .mu.l reaction volume. The reactions were performed using a GenAmp PCR System 9600 (Applied Biosystem, Foster City, Calif.) under the following cycling conditions: 1 cycle at 95.degree. C. for 15 minute; 35 cycles of 94.degree. C. for 30 seconds, 57.degree. C. for 30 seconds, 72.degree. C. for 60 seconds; 1 cycle at 72.degree. C. for 10 minutes. The PCR for the 3' flanking genomic sequence was conducted using Takara ExTaq PCR kit (Catalog #RR001A, Panvera, Madison, Wis.) in a 50 .mu.l reaction volume containing a final concentration of 0.4 .mu.M of Primer 281-9 and Primer 281-10. The reactions were performed using a GenAmp PCR System 9600 (Applied Biosystem, Foster City, Calif.) under the following cycling conditions: 1 cycle at 95.degree. C. for 5 minute; 35 cycles of 94.degree. C. for 30 seconds, 60.degree. C. for 30 seconds, 72.degree. C. for 60 seconds; 1 cycle at 72.degree. C. for 10 minutes. The PCR products were separated using 1.0% agarose gel electrophoresis at 100 V for about 1 hour and visualized by ethidium bromide staining.

[0109] The 5' PCR product DNA sequence was determined resulting in a 603 nucleotide base pair sequence representing the 5' genomic/transgene insert sequence of cotton Cry1F event 281-24-236 and identified as SEQ ID NO:5. The 3' PCR product DNA sequence was determined resulting in a 562 nucleotide base pair sequence representing the 3' genomic/transgene insert sequence of cotton Cry1F event 281-24-236 and identified in SEQ ID NO:8.

[0110] The genomic/transgene junction sequences, SEQ ID NO:5 and SEQ ID NO:8 are novel DNA sequences in Cry1F event 281-24-236 that are diagnostic for cotton plant Cry1F event 281-24-236 and its progeny.

Example 3

Diagnostic Test for Cry1Ac Cotton Event 3006-210-23

[0111] The DNA extracted from the cotton leaf tissue was used in a PCR DNA amplification of the 5' genomic/transgene insert sequences in Cry1Ac event 3006-210-23 using primer 3006-20 (SEQ ID NO:9, 5'TTCCAACCTTTAACTATTATCCTGC3') and primer 3006-22 (SEQ ID NO:10, 5'GCTGCGGACATCTACATTTT3'), and the 3' genomic/transgene insert sequences flanking using primer 3006-9 (SEQ ID NO:12, 5'GACATGCAATGCTCATTATCTCTA3') and primer 3006-12 (SEQ ID NO:13, 5'AAGTCTCTGCCTTCTACCCTGG3'). The PCR DNA amplification analyses were conducted using genomic DNA extracted from cotton event Cry1Ac 3006-210-23 and non-transgenic cotton line PCS355. The amplification reaction for the 5' flanking genomic sequence was conducted using QIAGEN HotStarTaq PCR kit (catalog #203203 or 203205, QIAGEN, Valencia, Calif., USA) with a final concentration of 0.4 .mu.M for Primer 3006-20 and Primer 3006-22 in a 50 .mu.l reaction volume. The reactions were performed using a GenAmp PCR System 9600 (Applied Biosystem, Foster City, Calif.) under the following cycling conditions: 1 cycle at 95.degree. C. for 15 minute; 35 cycles of 94.degree. C. for 30 seconds, 53.degree. C. for 30 seconds, 72.degree. C. for 60 seconds; 1 cycle at 72.degree. C. for 10 minutes. The PCR for the 3' flanking genomic sequence was conducted using QIAGEN HotStarTaq PCR kit (catalog #203203 or 203205, QIAGEN, Valencia, Calif., USA) in a 50 .mu.l reaction volume containing a final concentration of 0.4 .mu.M of Primer 3006-9 and Primer 3006-12. The reactions were performed using a GenAmp PCR System 9600 (Applied Biosystem, Foster City, Calif.) under the following cycling conditions: 1 cycle at 95.degree. C. for 5 minutes; 30 cycles of 94.degree. C. for 30 seconds, 56.degree. C. for 30 seconds, 72.degree. C. for 60 seconds; 1 cycle at 72.degree. C. for 10 minutes. The PCR products were separated using 1.0% agarose gel electrophoresis at 100 V for about. 1 hour and visualized by ethidium bromide staining.

[0112] The 5' PCR product DNA sequence was determined resulting in a 614 nucleotide base pair sequence representing the 5' genomic/transgene insert sequence of cotton Cry1Ac event 3006-210-23 (identified here as SEQ ID NO:11). The 3' PCR product DNA sequence was determined resulting in a 662 nucleotide base pair sequence representing the 3' genomic/transgene insert sequence of cotton Cry1Ac event 3006-210-23 (identified here as SEQ ID NO:14).

[0113] The genomic/transgene junction sequences, SEQ ID NO:11 and SEQ ID NO:14 are novel DNA sequences in Cry1Ac event 3006-210-23 that are diagnostic for cotton plant Cry1Ac event 3006-210-23 and its progeny.

Example 4

Further Diagnostic Tests

[0114] DNA event primer pairs are used to produce an amplicon diagnostic for Cry1F event 281-24-23 and Cry1Ac event 3006-210-23. These event primer pairs include, but are not limited to, SEQ ID NO:3 SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:12, and SEQ ID NO:13. When used in a DNA amplification method (PCR), these primers produce an amplicon diagnostic for Cry1F event 281-24-236 and/or Cry1Ac event 3006-210-23, and their progenies. In addition to these primer pairs, further aspects of the subject invention include any primer pair derived from the amplicon product of SEQ ID NO:5, SEQ ID NO:9, SEQ ID NO:11, and/or SEQ ID NO:14 that, in a DNA amplification reaction, produces an amplicon diagnostic for Cry1F event 281-24-236, Cry1Ac event 3006-210-23, and their progenies. Any modification involving the use of DNA primers to produce an amplicon diagnostic for Cry1F event 281-24-236, Cry1Ac event 3006-210-23, and their progenies is within the ordinary skill of the art, given the benefit of the subject disclosure. The analysis of plant tissue sample from Cry1F event 281-24-236, Cry1Ac event 3006-210-23, and their progenies should include a positive tissue control from these events, a negative control from a cotton plant that is not any of these events, and a negative control that contains no template cotton DNA. Additional primer sequences can be derived from SEQ ID NO:1 and/or SEQ ID NO:2 by those skilled in the art of DNA amplification methods. Conditions optimized for the production of an amplicon may differ from the methods described in the Examples above. The use of these DNA primer sequences with modifications to the methods described in these Examples is within the scope of the invention. Amplicons and primers derived from SEQ ID NO:1 and/or SEQ ID NO:2 that are diagnostic for Cry1F event 281-24-236 and/or Cry1Ac event 3006-210-23, and their progenies are aspects of the invention. The assay for amplicons of the Cry1F event 281-24-236, Cry1Ac event 3006-210-23, and their progenies can be performed by using a Stratagene Robocycler, MJ, Engine, or Eppendorf Mastercycler Gradient thermocycler, or by methods and apparatus known to those skilled in the art.

[0115] Having illustrated and described the principles of the present invention, it should be apparent to persons skilled in the art that the invention can be modified in arrangement and detail without departing from such principles. We claim all modifications that are within the spirit and scope of the appended claims.

Sequence CWU 1

1

21115490DNAArtificial SequenceCry1F event 281-24-236 insert and its border sequences 1aagcttgctt aaaagtatca caagccatga tccttataaa aatgatatct gacactatgc 60ttctttgcac attcttcact atgctttctc atttgagcaa tggtgggatt tgctctcaaa 120tttggtggcc ctatgtcagt attcaaaaat tttcataggt caaaggcttg aagataagcc 180ttcattttta ccacccatat gtagtaaatt tcaccgatga atacaagagg tggaggtggt 240gagaaactag atgaatacat tcttgcagaa aacgtccctc aaagatcaaa atggctctca 300ataccaattc ttggtgtttt cagactaaga gagaaagcaa aacgagacaa tgaacccaca 360agatgaatta atttcaatac atttttttaa atttcatttc aaacggttac aatatatacc 420ttttgttttc caaacaactc aactgatcca actaacatct tggaaatagg aaaacttaac 480ttgtacacaa actgattgtg aaatcaacac ctaaacacat caagtcatta ccaacttagt 540ttattcctag ctaagtatct taacataagg attgaacaaa aggttaaacc aaaactttga 600tttttttgct ctaggaagac agcttgcact tcatcataca gttcgcctta ttgttaatca 660actcacactt tggctgtccg ttgatatgct ggcagttaaa atgttcacca atgtgcttag 720acaatccgcc aagcctatcg tgtaaaaact ctttgcatga cagttcacct attgacagtc 780cgccagtctt ttaatgctca gactgtctac catgtgactt agagacggaa ttgtttgcca 840tatgtgttcg ccaactagat tgttcaccat ttgtgttgtt taccatgtgt gttcgctaat 900gcatggttgg ccatgtcgca aaacaaattt ttggatgggc caaaattgga attttttcat 960ttgaccaaat ataaaaaaac gaattgaaca aattactttt agagggatta aaaattaaaa 1020ttatactatt tatcgagggg agtcaaggct cctatcttct tcgcttcttc tattgtttag 1080attaagacta aaattttaaa atttatagaa attaaaattg atgaaattaa aatacaaaat 1140taaatatata attcagttag gtttaaccat tttttaatgt tgcttagctt taatgtttgg 1200gatttggcta ctttcagtcg ttatgcagtt atgctcagac aaatttgttc tctttctgtc 1260ttatcaacta ctcaaaatct cagtatagtt atgtcattta atctcttcat cgtagatgtt 1320atattggtga aaatggggcc aagaaatcca cattcaatga ctttgaaaga atatatattg 1380ttagttgcac attcccttat tcaatcacag ttgcttgttt ctgagtctat agaatcatga 1440tatttgtaaa tcttatataa agtaagagta tatggctaga cagtctggcc ctgtcggctg 1500aaggtaggga ggaattaatc aatcacagtt gcttgtttct gagtctatag aatcatgaat 1560tttaaattta tggaatgcat tttttcgaag atattgtatg cattaagtgt aattttagtt 1620tcaatatgaa atttgagatt tatatatata cttacataaa accctccttt actgaattag 1680tgccatggat aaaagaccaa ttaagcaatc cttccaacac gtgcatgcac tggattttca 1740tcgcctcgtc cattgttaaa ttgataggtt aataagaaca attagttggc tactgattat 1800atggattctg ggttaaaagt atttaggttt actgttacat acatggagga tctacatcta 1860ttttcacttt tgtttaatta atttaagtta gttttgatga gtttaaggat tgtactagcc 1920aatagtagta cataaaggag atagagtacc aaaacaaaga aaaagccgaa aggtgttaat 1980gctaaattgt aaaagaaagt taaaataaga gactcgaatt ataatatgat tctctggcgc 2040actaattaag ctactatata ttgtcaatag tattgtaaat ggcttcatgt ccgggaaatc 2100tacatggatc agcaatgagt atgatggtca atatggagaa aaagaaagag taattaccaa 2160ttttttttca attcaaaaat gtagatgtcc gcagcgttat tataaaatga aagtacattt 2220tgataaaacg acaaattacg atccgtcgta tttataggcg aaagcaataa acaaattatt 2280ctaattcgga aatctttatt tcgacgtgtc tacattcacg tccaaatggg ggccacttgg 2340ctgcagtgca gcgtgacccg gtcgtgcccc tctctagaga taatgagcat tgcatgtcta 2400agttataaaa aattaccaca tatttttttt gtcacacttg tttgaagtgc agtttatcta 2460tctttataca tatatttaaa ctttactcta cgaataatat aatctatagt actacaataa 2520tatcagtgtt ttagagaatc atataaatga acagttagac atggtctaaa ggacaattga 2580gtattttgac aacaggactc tacagtttta tctttttagt gtgcatgtgt tctccttttt 2640tttgcaaata gcttcaccta tataatactt catccatttt attagtacat ccatttaggg 2700tttagggtta atggttttta tagactaatt tttttagtac atctatttta ttctatttta 2760gcctctaaat taagaaaact aaaactctat tttagttttt ttatttaata atttagatat 2820aaaatagaat aaaataaagt gactaaaaat taaacaaata ccctttaaga aattaaaaaa 2880actaaggaaa catttttctt gtttcgagta gataatgcca gcctgttaaa cgccgtcgac 2940gagtctaacg gacaccaacc agcgaaccag cagcgtcgcg tcgggccaag cgaagcagac 3000ggcacggcat ctctgtcgct gcctctggac ccctctcgag agttccgctc caccgttgga 3060cttgctccgc tgtcggcatc cagaaattgc gtggcggagc ggcagacgtg agccggcacg 3120gcaggcggcc tcctcctcct ctcacggcac cggcagctac gggggattcc tttcccaccg 3180ctccttcgct ttcccttcct cgcccgccgt aataaataga caccccctcc acaccctctt 3240tccccaacct cgtgttgttc ggagcgcaca cacacacaac cagatctccc ccaaatccac 3300ccgtcggcac ctccgcttca aggtacgccg ctcgtcctcc cccccccccc cctctctacc 3360ttctctagat cggcgttccg gtccatggtt agggcccggt agttctactt ctgttcatgt 3420ttgtgttaga tccgtgtttg tgttagatcc gtgctgctag cgttcgtaca cggatgcgac 3480ctgtacgtca gacacgttct gattgctaac ttgccagtgt ttctctttgg ggaatcctgg 3540gatggctcta gccgttccgc agacgggatc gatttcatga ttttttttgt ttcgttgcat 3600agggtttggt ttgccctttt cctttatttc aatatatgcc gtgcacttgt ttgtcgggtc 3660atcttttcat gctttttttt gtcttggttg tgatgatgtg gtctggttgg gcggtcgttc 3720tagatcggag tagaattctg tttcaaacta cctggtggat ttattaattt tggatctgta 3780tgtgtgtgcc atacatattc atagttacga attgaagatg atggatggaa atatcgatct 3840aggataggta tacatgttga tgcgggtttt actgatgcat atacagagat gctttttgtt 3900cgcttggttg tgatgatgtg gtgtggttgg gcggtcgttc attcgttcta gatcggagta 3960gaatactgtt tcaaactacc tggtgtattt attaattttg gaactgtatg tgtgtgtcat 4020acatcttcat agttacgagt ttaagatgga tggaaatatc gatctaggat aggtatacat 4080gttgatgtgg gttttactga tgcatataca tgatggcata tgcagcatct attcatatgc 4140tctaaccttg agtacctatc tattataata aacaagtatg ttttataatt attttgatct 4200tgatatactt ggatgatggc atatgcagca gctatatgtg gattttttta gccctgcctt 4260catacgctat ttatttgctt ggtactgttt cttttgtcga tgctcaccct gttgtttggt 4320gttacttctg caggtcgaca tgtctccgga gaggagacca gttgagatta ggccagctac 4380agcagctgat atggccgcgg tttgtgatat cgttaaccat tacattgaga cgtctacagt 4440gaactttagg acagagccac aaacaccaca agagtggatt gatgatctag agaggttgca 4500agatagatac ccttggttgg ttgctgaggt tgagggtgtt gtggctggta ttgcttacgc 4560tgggccctgg aaggctagga acgcttacga ttggacagtt gagagtactg tttacgtgtc 4620acataggcat caaaggttgg gcctaggatc cacattgtac acacatttgc ttaagtctat 4680ggaggcgcaa ggttttaagt ctgtggttgc tgttataggc cttccaaacg atccatctgt 4740taggttgcat gaggctttgg gatacacagc ccggggtaca ttgcgcgcag ctggatacaa 4800gcatggtgga tggcatgatg ttggtttttg gcaaagggat tttgagttgc cagctcctcc 4860aaggccagtt aggccagtta cccagatctg agtcgacgga tccccgacat atgccccggt 4920ttcgttgcga ctaacatgag ttcttggaca aatttgattg gacctgatga gatgatccaa 4980cccgaggata tagcaaagct cgttcgtgca gcaatggaac ggccaaaccg tgcttttgtc 5040cccaagaatg aggtgctatg catgaaggaa tctacccgtt gatgtccaac agtctcaggg 5100ttaatgtcta tgtatcttaa ataatgttgt cggtattttg taatctcata tagattttca 5160ctgtgcgacg caaaaatatt aaataaatat tattattatc tacgttttga ttgagatatc 5220atcaatatta taataaaaat atccattaaa cacgatttga tacaaatgac agtcaataat 5280ctgatttgaa tatttattaa ttgtaacgaa ttacataaag atcgaataga aaatactgca 5340ctgcaaatga aaattaacac atactaataa atgcgtcaaa tatctttgcc aagatcaagc 5400ggagtgaggg cctcatatcc ggtctcagtt acaagcacgg tatccccgaa gcgcgctcca 5460ccaatgccct cgacatagat gccgggctcg acgctgagga cattgcctac cttgagcatg 5520gtctcagcgc cggctttaag ctcaatccca tcccaatctg aatatcctat cccgcgccca 5580gtccggtgta agaacgggtc tgtccatcca cctctgttgg gaattctgat cttggcggta 5640cccggggatc ctcattcctc catcagaagt aactccacgc tatcaacaat gaatgttcct 5700tccgtttctc caatctcaat ccaaaccttg tcggtttctg gaaagtactc taactctttg 5760gtgacatagc cggctggtaa cggtgtgtag tccccatagc ctctgttaga ttcgcaagga 5820ttgtccctac gtccatcggt gtaagccttc tcctcatagg ctgatgcata gtcagcgggt 5880acagaagagt tgctctcata ggctccatcg tatcctcgat tgcgagaagt gtaagtaccc 5940tcatactcct cttgagtcgc agtgtagtca ttgcaagtta cggtgttgtt tgggtagact 6000tcctcctcga cgcagttgct gaacttcagc tcgtcggtgt tgttctcaat ctcgtgtatg 6060gtgacgcaac cttctccgta tccttctttg tacgcggtaa cacgaagaat gtagccacga 6120ccaggacaga cacgaacttc ttgtgaaact tctgcttccc actcaggaac aacaaggaca 6180gagcggtgat tgttctgttc ttctacatct acgtgccctt tcacattcca gcaggatagg 6240ccattgttga agtcaccatt cttgatgaca ttcctcgcat catacaagga gaatgcagtg 6300aagatgcgcc cttctaactc ttcaaagata gcagcattga cacccggaat cacgctaagt 6360tcaggaaggt aagcttcccg aatgctatga acgcgtttgt ctgcagcatg aatcatagct 6420atgttggtat cagcttggag cctatcatac tgagagttca caaacagagc gtcaacgctt 6480tctttggctt ctttgtacac aatgtttgtt tcccattcca acttctctct cttgtccctc 6540cacttcttct cagccctctt cactctagcg agggcttctc caacaagtgg tttctcttct 6600agaaactcca gattgcctag cctggcatgg ccatcttgag tcttgatctt gaagatcacc 6660cacacaccga ggtcttcgtt caggtcggta cagccaacgt ctatgtccaa ggagaagtgg 6720tgtgagtgat gggcacactt gccgatggga cttggggctg aaagtggcca gagtgaaccc 6780gtcccaggca cattgactgt ctcatgtttg gcgttgtatc tgatgaggta gatctcaagg 6840tcttgactgt cctcgatgta acctctcaac tggtatcttg tgtaggcttt gagtttcgat 6900tcatctatct tctggtacag gtatgttgga tagcactcat caaaggtacc caagagcgta 6960acatagttct ccttgaacac atcatcacct ccttgaatgg tgatgtccgt acttcccctc 7020catccacgat ctagttgcct gttgatcccg cgaaagttgg gatcttgaag caagttccgc 7080tcatcactaa gtcgcttagc atgtttgacc ttctcggaca actccttctt ctcatccaaa 7140cagaactcat cagagaggca ctcaacaagg ttggaaacgc gatcgatgtg atagtcagtc 7200acatctgtct tgagcccaat ctgattggac gaagtgaaca gagcattcac cgccttctgt 7260gctctttcca agtcagactc tgcctcgagt gtggcagtaa ctggaatcaa ctcaaacctg 7320tcaatgtaca cttcgttgcc tgaactgaag gtatcagcac ctactgtgaa actgctctgg 7380ctcattggaa aggtgaacgc ggtgttgata gtggcgtagg agaaagattg gaatgtaagt 7440ggatcaccgg tatccattgt cttgttgaac tgaccagcaa agatccgttc acctgcaacc 7500gtaacgtaga ttcttagatt ggtagtagag gcatagcgta tcctggcacg atacctttgg 7560ggaagttgcc cattgatgtt gacaatggtg tacgcgaatg gtcctccact agtgcgtcga 7620agaatgtctc ctcccgtgaa ccccggccct cttacaactg tagttcctga ctgaagtgtg 7680tgtgccttca ccaagggaat ctgagtgatt ctctctggat caatggtgtt tgtgggggta 7740gcgctacgat gcgtccaaga gaacattggt gctctccatg agtcggaacc tgagatctca 7800cctggccagc gcacaaaggt aacatgattc agcacatggg agtagtcatt ccaaggtgcg 7860ccgctgttgt cttgaggtgg tatctcatct agagagtcaa tggtcccgga gttcctgaat 7920gtgcgggtgt gattcgtacc agtttgttga aaggccactc ccctaagacc gagtacatag 7980tgaggattgc caaagcctcc tcggacgaag acaggatctg acaaggtccg atagaaagga 8040cgtggatctt catctgcaat ccagatggcg cccccgggat tgaagacccc gtaactagga 8100aagttgatac gattgccagc cgtgttgcgt gagctaacta agtgtcctcc ccacacagtt 8160tgggatctaa cagtctctgc agtcacaaac aaagagttca tgaagtccat gagatggggt 8220ggtctgactc caaactcagc cctgttgaaa ccattgggta tgttcgcaga aactggagag 8280tcttcaatga ctgaactggt gtagatctcc cttgtaagtt gggatgacgt ttgaatcgga 8340taggtacgaa catcgtagtt cggaaagaga gcaactatgt ctaacacagt aagtgtaagg 8400tctctcctga actgattgaa cctggcccat tggcgagtgt tagtacctct caggttctcc 8460aatccctgat tgtaggtatc caaacaatgt ttcgtgtatc gatgaatcag attgatgagt 8520ctgttgtagt gattgttgac agtagctatg tccagtcccc aaccttgccc aaacgacaca 8580gcgtcgcgca gtagtgacaa gtgcaggtta gcagcttgaa catagaccga gagaagaggg 8640atctcgaagc tggtaagggt gaagttgttg atggctgtga tcaaagcatc atctgtgtta 8700gcaaagcgta tacgcacatc ttctctcagt tgggcattgt taggattggc ttcccactct 8760cttagtgctt caatgtagat ctcatagctg tctgctaagc cacgaagggt agtgatggcc 8820cgattccttt ccaaggtctc aatcctttgt tcaatcaact gttcaatctg gagaagaaag 8880aggctccaat cagatggagt gatgaagccc cagatgaggt cgaagaggcc aaacgcaact 8940cccacacctg gaacaaactc agacaacagg agacgtgtaa gggacaggga gatgtctaac 9000ggcaatctgc cagtcgacct ctcttcgttg agaatctcta cttcaggatt gttgaggcag 9060ttgtagggga cgcactgatt ctgtatgttg ttctccattg ttggatccgc gatttggtgt 9120atcgagattg gttatgaaat tcagatgcta gtgtaatgta ttggtaattt gggaagatat 9180aataggaagc aaggctattt atccatttct gaaaaggcga aatggcgtca ccgcgagcgt 9240cacgctctag tcgaccatgt acgtaagcgc ttacgttttt ggtggacccc ctcgaccatg 9300tacgtaagcg cttacgtttt tggtggaccc cctcgaccat gtacgtaagc gcttacgttt 9360ttggtggacc ccctcgacca tgtacgtaag cgcttacgtt tttggtggac cccctcgacg 9420gatcccccct cgaccctaga cgtatctatt caaaagtcgt taatggctgc ggatcaagaa 9480aaagttggaa tagaaacaga atacccgcga aattcaggcc cggttgccat gtcctacacg 9540ccgaaataaa cgaccaaatt agtagaaaaa taaaaactga ctcggatact tacgtcacgt 9600cttgcgcact gatttgaaaa atctcaatat aaacaaagac ggccacaaga aaaaaccaaa 9660acaccgatat tcattaatct tatctagttt ctcaaaaaaa ttcatatctt ccacaccctc 9720gagatctaga tatcgatgaa ttttggcgcg ccttaattaa ggaattcctc gagtttaaac 9780ggatccctga aagcgacgtt ggatgttaac atctgcaaat tgccttttct tatcgaccat 9840gtacgtaagc gcttacgttt ttggtggacc cttgaggaaa ctggtagctg ttgtgggcct 9900gtggtctcaa gatggatcat taatttccac cttcacctac gatggggggc atcgcaccgg 9960tgagtaatat tgtacggcta agagcgaatt tggcctgtag acctcaattg cgagctttct 10020aatttcaaac tattcgagct ttctaattga atatatccag ggcccagcgt aagcaatacc 10080agccacaaca ccctcaacct cagcaaccaa ccaagggtat ctatcttgca acctctctag 10140atcatcaatc cactcttgtg gtgtttgtgg ctctgtccta aagttcactg tagacgtctc 10200aatgtaatgg ttaacgatat cacaaaccgc ggccatatca gctgctgtag ctggcctaat 10260ctcaactggt ctcctctccg gagacatgtc gacctgcaga agtaacacca aacaacaggg 10320tgagcatcga caaaagaaac agtaccaagc aaataaatag cgtatgaagg cagggctaaa 10380aaaatccaca tatagctgct gcatatgcca tcatccaagt atatcaagat caaaataatt 10440ataaaacata cttgtttatt ataatagata ggtactcaag gttagagcat atgaatagat 10500gctgcatatg ccatcatgta tatgcatcag taaaacccac atcaacatgt atacctatcc 10560tagatcgata tttccatcca tcttaaactc gtaactatga agatgtatga cacacacata 10620cagttccaaa attaataaat acaccaggta gtttgaaaca gtattctact ccgatctaga 10680acgaatgaac gaccgcccaa ccacaccaca tcatcacaac caagcgaaca aaaagcatct 10740ctgtatatgc atcagtaaaa cccgcatcaa catgtatacc tatcctagat cgatatttcc 10800atccatcatc ttcaattcgt aactatgaat atgtatggca cacacataca gatccaaaat 10860taataaatcc accaggtagt ttgaaacaga attctactcc gatctagaac gaccgcccaa 10920ccagaccaca tcatcacaac caagacaaaa aaaagcatga aaagatgacc cgacaaacaa 10980gtgcacggca tatattgaaa taaaggaaaa gggcaaacca aaccctatgc aacgaaacaa 11040aaaaaatcat gaaatcgatc ccgtctgcgg aacggctaga gccatcccag gattccccaa 11100agagaaacac tggcaagtta gcaatcagaa cgtgtctgac gtacaggtcg catccgtgta 11160cgaacgctag cagcacggat ctaacacaaa cacggatcta acacaaacat gaacagaagt 11220agaactaccg ggccctaacc atggaccgga acgccgatct agagaaggta gagagggggg 11280gggggggggg aggacgagcg gctgtacctt gaagcggagg tgccgacggg tggatttggg 11340ggagatctgg ttgtgtgtgt gtgcgctccg aacaacacga ggttggggaa agagggtgtg 11400gagggggtgt ctatttatta cggcgggcga ggaagggaaa gcgaaggagc ggtgggaaag 11460gaatcccccg tagctgccgg tgccgtgaga ggaggaggag gccgcctgcc gtgccggctc 11520acgtctgccg ctccgccacg caatttctgg atgccgacag cggagcaagt ccaacggtgg 11580agcggaactc tcgagagggg tccagaggca gcgacagaga tgccgtgccg tctgcttcgc 11640ttggcccgac gcgacgctgc tggttcgctg gttggtgtcc gttagactcg tcgacggcgt 11700ttaacaggct ggcattatct actcgaaaca agaaaaatgt ttccttagtt tttttaattt 11760cttaaagggt atttgcttaa tttttagtca ctttatttta ttctatttta tatctaaatt 11820attaaataaa aaaactaaaa tagagtttta gttttcttaa tttagaggct aaaatagaat 11880aaaatagatg tactaaaaaa attagtctat aaaaaccatt aaccctaaac cctaaatgga 11940tgtactaata aaatggatga agtattatat aggtgaagct atttgcaaaa aaaaaggaga 12000acacatgcac actaaaaaga taaaactgta gagtcctgtt gtcaaaatac tcaattgtcc 12060tttagaccat gtctaactgt tcatttatat gattctctaa aacactgata ttattgtagt 12120actatagatt atattattcg tagagtaaag tttaaatata tgtataaaga tagataaact 12180gcacttcaaa caagtgtgac aaaaaaaata tgtggtaatt ttttataact tagagatgca 12240atgctcatta tctctagaga ggggcacgac cgggtcacgc tgcactgcag ccaagtggcc 12300cccatttgga cgtgaatgta gacacgtcga aataaagatt tccgaattag aataatttgc 12360ttattgcttt cgcctataaa tacgacggat cgtaatttgt cgctttatca gaatgtactt 12420tcattttata ataacgctgc ggacatctac atttttgaat tgaaaaaaaa ttggtaatta 12480ctctttcttt ttctccatat tgaccatcat actcattgct gatccatgta gatttccctt 12540acttgtctcc ctctaatctg actttattaa cccaaagcaa ttgcttattt gttccccacg 12600cccacaaagc ccagcattgt ccctaaggta ttaatttgtt gttcgattct tgttcttgaa 12660cccatttgga gaatgcaaca agggttttca tgtcagcacg gtaatggttc tgtgtaaatt 12720ccagtagtgc tgcccaagta aagtctgggt atttcctcga atttgcggca ttaactaagc 12780tagctgctgg tgtcaccggt ctctccagct cgggacatag aaagaatgca agtgattttc 12840tcaccgtttc agtattcact actgcccaag cagctcttgt agataccgtt tgtcaaagcc 12900tgtattcaaa caccacaacc tcattttcgt taaaattttt tgtatatacg tatgcatata 12960tgttcagaat gtttattacc atgaatgtat cgcaatgttg acaacgaaag ctcctgggat 13020atgagcaacg gagtgccact tttcatcggc aaacacttga aggcctccaa cttgatcctg 13080atgaaggatt gtcaaggaag tgggatcggt gtggggaccg gttcccaggg tcaactcagg 13140cttttcgcat ggagagtagt gattcagtct caggattgaa tcattttgtt cgaaaaagtc 13200tttgaagtag gcttggtcaa gccctagact tatccctagc agccccatta tctctttgga 13260aaccttgttc ctggcttcac aatattcctg gtaaagcctc ctgtcaagta cgaaaagcaa 13320aatcgagtgt tagattccta tcctatggta aaacttgtcg caacattcta caaattaaca 13380taggttataa aagagaaacg caaagtcaaa aaaggccatc cagttataat gtgtattttt 13440tgttttagga gaaggggtat ttaagcaatc catgttgaat ggacttaggg ttcggtcaat 13500gcaaggaatg atgtctattg aatttgtcac cccatctctt tcaaacctaa aaaagatgta 13560tatccaattg tcactatttg tacaaggctt gaaatacaca tggggttaac aaatacgctg 13620aaactgcaac atgtattttt tgcattttgg agactaaatc ttgacgtaaa aataagctga 13680tcatctcgta tattgactga atgcaaatta gcatttctcc tatttaatta ggaatggaag 13740ggtgagaaga atttatttac ccaaaatctc taaaatcttc agtgccgaaa agacagtgtt 13800tctttccatg gcaacttgga ggaaaacctg ccaacgaaac tgcttgcata cccatagctt 13860tctcctactt ttctcttagc cttttgcttc tcagagagtt gcaggctgaa gaagcggtcc 13920atgtactgat gagcttacaa ccaaaaaaaa cccatgcttc ttgcatgcct cattcaccgc 13980ccctgccact tttgatacag caagagagcc cccaagcaag aaagctccca agtcaatggc 14040ttgaattaca agttccgggt catccaggca tggcttatcg tcgtcaggcc atatgaactg 14100agagggtata ttggattcag atccaaggat tgatgcatcg aaagctaaag ggcgatgctc 14160attctttgcg acagcagcag ttggcggaag catcggcttc tcttgaatga cagaaactat 14220tggcagacaa tgtaccattt tctgtttctt gttttaggtg gtcggagagg aaaaagaaga 14280caagatatag aggagcaaaa ctaagagggt ttaaataaga gaagtagaaa accaataata 14340tttggaatct aattgtttgt tttgaactgt tgcctcattt cccctttaat ttgtgttgtg 14400ttggcagctt aacgcttcct ttgggttcga ttgcaatata gtgcgttgaa atttttacct 14460tgattttcaa tctcactaca ccacagtgac ttgcttggtt gtttggataa tttttacctt 14520gattttcaat ctcactacac cacagtgact tgcttggttg tttggataat ttttaccttg 14580attttcaatc tcactacacc acagtgactt gcctggttgt ttggatatct tggtttccag 14640cacagtgaga caagcctgct gcactcgaca accttatctt cactggtgct aaaagctcca 14700gtcagctcta gctagggcaa taggtatttt tggatgacaa aaatacccat actttaattt 14760attattttac cattttatcc ttagatgtta aactaatttc tttcccaatc ttatttgttt 14820tcagatttgg gaataaaaca atagtttctc ccttgttctt gctggtttct cccttgttct 14880tgctggtttc tcccctcttt tttgctttgt tcttggttgt gggagcttag gatattcttt 14940ttcttcaatc agactaacaa gttagagata tcttgtgttt tttcacttta

ttttctcatg 15000ctcaacattt accctttttc tcaattaaca ggggaagtct acattaatta gtgcactctc 15060agatagtaat ctgtatagtg atgcaatgta tatatattct ttaaaacagt ttttcctcga 15120agttaaattc tttgttaaaa gtaaaaggct ggatgttttt acctaattgg aggtaatgtc 15180tttgtgtaga ttgtttgcaa cattggatgg ttgattaaaa agtgttgttc ttccttcaag 15240gtgagatggt ttgctgtcac tcactattat tattgttgtt attgttattg cttttccatt 15300gaatagcctg gttctaaatg atatacttac cttatcccat aggcagcaac attttatctt 15360ttgatctttg gacctatcat ttagcatgct ttacactcta tttagtaata ttattactaa 15420ctataatttt aagtcataca caatgaaatt acctaaacat ctaaactcaa aaaattataa 15480cttaaagctt 1549029382DNAArtificial SequenceCry1Ac event 3006-210-23 insert and its border sequences 2accaattatt atcgtctttt ttaattattc caacctttaa ctattatcct gccttaaaat 60tcgaatacat ttattatcta taaactatcc gaatattatt atctaaatcc taattaaata 120ctatttttta tcgagtattc gtatccgcca aggaaatcca tctccaaatt ttcaattatt 180tttcagatat ctaaatctgt aaaatttcaa attcaagtac gttacaattc tttataaata 240atccaaatta taaatatttt ataactatta attcataaat taaaatttat tattcaaata 300ttcgaataat ctatttttaa gacgtaaagt attacatcga agggttactt tcaaagggta 360gtgtatttcc atttcaatta ttcagaacgt tgtcgttttg ttccggtcat agaaaagggc 420tctggaagag aagaaaatga cttgactttt caatttcatg ctcatccact cgtttcaatt 480actgtttact aaaaaaataa taaaataaaa tattaacaat gcattgagta tgatgtccgg 540gaaatctaca tggatnagca atgagtatga tggtcaatat ggagaaaaag aaagagtaat 600taccaatttt ttttcaattc aaaaatgtag atgtccgcag cgttattata aaatgaaagt 660acattttgat aaaacgacaa attacgatcc gtcgtattta taggcgaaag caataaacaa 720attattctaa ttcggaaatc tttatttcga cgtgtctaca ttcacgtcca aatgggggcc 780acttggctgc agccaagctt tcgcgagctc gagatccccg acatatgccc cggtttcgtt 840gcgactaaca tgagttcttg gacaaatttg attggacctg atgagatgat ccaacccgag 900gatatagcaa agctcgttcg tgcagcaatg gaacggccaa accgtgcttt tgtccccaag 960aatgaggtgc tatgcatgaa ggaatctacc cgttgatgtc caacagtctc agggttaatg 1020tctatgtatc ttaaataatg ttgtcggtat tttgtaatct catatagatt ttcactgtgc 1080gacgcaaaaa tattaaataa atattattat tatctacgtt ttgattgaga tatctagatc 1140tcgaggtgtg gaagatatga atttttttga gaaactagat aagattaatg aatatcggtg 1200ttttggtttt ttcttgtggc cgtctttgtt tatattgaga tttttcaaat cagtgcgcaa 1260gacgtgacgt aagtatccga gtcagttttt atttttctac taatttggtc gtttatttcg 1320gcgtgtagga catggcaacc gggcctgaat ttcgcgggta ttctgtttct attccaactt 1380tttcttgatc cgcagccatt aacgactttt gaatagatac gtctagggtc gaggggggat 1440ccgtcgaggg ggtccaccaa aaacgtaagc gcttacgtac atggtcgagg gggtccacca 1500aaaacgtaag cgcttacgta catggtcgag ggggtccacc aaaaacgtaa gcgcttacgt 1560acatggtcga gggggtccac caaaaacgta agcgcttacg tacatggtcg actagagcgt 1620gacgctcgcg gtgacgccat ttcgcctttt cagaaatgga taaatagcct tgcttcctat 1680tatatcttcc caaattacca atacattaca ctagcatctg aatttcataa ccaatctcga 1740tacaccaaat cgcggatccg tcgacctgca ggtcgacatg tctccggaga ggagaccagt 1800tgagattagg ccagctacag cagctgatat ggccgcggtt tgtgatatcg ttaaccatta 1860cattgagacg tctacagtga actttaggac agagccacaa acaccacaag agtggattga 1920tgatctagag aggttgcaag atagataccc ttggttggtt gctgaggttg agggtgttgt 1980ggctggtatt gcttacgctg ggccctggaa ggctaggaac gcttacgatt ggacagttga 2040gagtactgtt tacgtgtcac ataggcatca aaggttgggc ctaggatcca cattgtacac 2100acatttgctt aagtctatgg aggcgcaagg ttttaagtct gtggttgctg ttataggcct 2160tccaaacgat ccatctgtta ggttgcatga ggctttggga tacacagccc ggggtacatt 2220gcgcgcagct ggatacaagc atggtggatg gcatgatgtt ggtttttggc aaagggattt 2280tgagttgcca gctcctccaa ggccagttag gccagttacc cagatctgag tcgacggatc 2340cccgacatat gccccggttt cgttgcgact aacatgagtt cttggacaaa tttgattgga 2400cctgatgaga tgatccaacc cgaggatata gcaaagctcg ttcgtgcagc aatggaacgg 2460ccaaaccgtg cttttgtccc caagaatgag gtgctatgca tgaaggaatc tacccgttga 2520tgtccaacag tctcagggtt aatgtctatg tatcttaaat aatgttgtcg gtattttgta 2580atctcatata gattttcact gtgcgacgca aaaatattaa ataaatatta ttattatcta 2640cgttttgatt gagatatcat caatattata ataaaaatat ccattaaaca cgatttgata 2700caaatgacag tcaataatct gatttgaata tttattaatt gtaacgaatt acataaagat 2760cgaatagaaa atactgcact gcaaatgaaa attaacacat actaataaat gcgtcaaata 2820tctttgccaa gatcaagcgg agtgagggcc tcatatccgg tctcagttac aagcacggta 2880tccccgaagc gcgctccacc aatgccctcg acatagatgc cgggctcgac gctgaggaca 2940ttgcctacct tgagcatggt ctcagcgccg gctttaagct caatcccatc ccaatctgaa 3000tatcctatcc cgcgcccagt ccggtgtaag aacgggtctg tccatccacc tctgttggga 3060attctgatct tggcgcgcat gcggatcctc attcctccat cagaagtaac tccacgctat 3120caacaatgaa tgttccttcc gtttctccaa tctcaatcca aaccttgtcg gtttctggaa 3180agtactctaa ctctttggtg acatagccgg ctggtaacgg tgtgtagtcc ccatagcctc 3240tgttagattc gcaaggattg tccctacgtc catcggtgta agccttctcc tcataggctg 3300atgcatagtc agcgggtaca gaagagttgc tctcataggc tccatcgtat cctcgattgc 3360gagaagtgta agtaccctca tactcctctt gagtcgcagt gtagtcattg caagttacgg 3420tgttgtttgg gtagacttcc tcctcgacgc agttgctgaa cttcagctcg tcggtgttgt 3480tctcaatctc gtgtatggtg acgcaacctt ctccgtatcc ttctttgtac gcggtaacac 3540gaagaatgta gccacgacca ggacagacac gaacttcttg tgaaacttct gcttcccact 3600caggaacaac aaggacagag cggtgattgt tctgttcttc tacatctacg tgccctttca 3660cattccagca ggataggcca ttgttgaagt caccattctt gatgacattc ctcgcatcat 3720acaaggagaa tgcagtgaag atgcgccctt ctaactcttc aaagatagca gcattgacac 3780ccggaatcac gctaagttca ggaaggtaag cttcccgaat gctatgaacg cgtttgtctg 3840cagcatgaat catagctatg ttggtatcag cttggagcct atcatactga gagttcacaa 3900acagagcgtc aacgctttct ttggcttctt tgtacacaat gtttgtttcc cattccaact 3960tctctctctt gtccctccac ttcttctcag ccctcttcac tctagcgagg gcttctccaa 4020caagtggttt ctcttctaga aactccagat tgcctagcct ggcatggcca tcttgagtct 4080tgatcttgaa gatcacccac acaccgaggt cttcgttcag gtcggtacag ccaacgtcta 4140tgtccaagga gaagtggtgt gagtgatggg cacacttgcc gatgggactt ggggctgaaa 4200gtggccagag tgaacccgtc ccaggcacat tgactgtctc atgtttggcg ttgtatctga 4260tgaggtagat ctcaaggtct tgactgtcct cgatgtaacc tctcaactgg tatcttgtgt 4320aggctttgag tttcgattca tctatcttct ggtacaggta tgttggatag cactcatcaa 4380aggtacccaa gagcgtaaca tagttctcct tgaacacatc atcacctcct tgaatggtga 4440tgtccgtact tcccctccat ccacgatcta gttgcctgtt gatcccgcga aagttgggat 4500cttgaagcaa gttccgctca tcactaagtc gcttagcatg tttgaccttc tcggacaact 4560ccttcttctc atccaaacag aactcatcag agaggcactc aacaaggttg gaaacgcgat 4620cgatgtgata gtcagtcaca tctgtcttga gcccaatctg attggacgaa gtgaacagag 4680cattcaccgc cttctgtgct ctttccaagt cagactctgc ctcgagcgtt gcagtaacgg 4740gaatgaattc gaagcggtcg attatcactc cggcggttcc ggagaaattt ctaacaccta 4800ctatgttacc tagggaagag gtgaaggcat tggcactttc gaagtaaccg aaatcgctag 4860attggagatt atccaaggat gtagctgtcg ctggtactgt attggaaaag atggaggaat 4920taccccaatt gacgttgagg tgaatagggg taacagaggc ataccttaca cgaacacgat 4980atctggtaga tgtcgatggg aagtgaatgg gcacttcaat ataccctcta ttctggatgt 5040tgttgccgga agaattcagc ctaaccaagt cgcctccagt gaatcctggt cctgaaatga 5100cagaaccatt aaagagaaag ttccccttga cagctgggat ctgagtaatg ctatcggatg 5160caattatgtt gttaaactca gcactacgat gtatccaaga gaacatcgga gctctgatga 5220tactaacgct gctattacta aagcctgaac ggaacatgga cacatggcta aggcgatggc 5280taaacccttg cctaggtgga acgttgttgt tctgtggagg gatctcatcc aagctatcaa 5340ctgttccgct ctttctgtag acagcggatg gcagatttga ggaggttcca taggcaaatt 5400ctgtcccgtc aagcacagac aattgttgat tgttgatgcc gatgttgaaa ggtctcctat 5460atagagtgct ggacaaggtt ctatacacgc cctgaccgag ttgagcaaca atacgttgtt 5520gtggagctgc attgcccata gtcccgtaaa gtgggaaagt gaattctggt ccagagaacc 5580caacgggtga tgccatgatc tgatgccctg accagtagta ataaccgcgg tgcgcatcgg 5640tgtagatcgt gatactgttc aatatgtcca tcaggtgtgg agacctgatg cttctctcta 5700tgccctgagc cgagcctcga aagctaccgt cgaagttctc gaggactggg tttgtgtaga 5760tttcccgggt caattgtgac acagtacgga ttgggtagcg cctagagtcg tagttgggaa 5820agagagcgac aatgtctagg acagttagtg tcaactctcg cctgaactgg ttgtacctga 5880cccaatctct agaatccggt ccccagacac gttcgagacc cgtgttgtac cagcgaacag 5940cataatcggt atagttgcca ataagcctag tcagatcatt ataacgacta ttgatagttg 6000cggcatcaaa gccccaccgt tgtccgaaca cggagacatc gcggagcacc gacaagtgca 6060ggttggcagc ctgcacgtac acggataaaa gaggaacttg gtaattctga acggcgaaga 6120gcggaattgc ggtcgtcagc gcgctgttca tgtcattgaa ttgaatgcgc atctcctctc 6180ttaaggcagg attggtcggg tctgcttccc actctcgaaa agattctgcg taaatctggt 6240aaaggttgct gaggccttct aaccttgaga tggcttggtt cctagcgaat tcttctattc 6300tttggttaat taactgctct atctgtacaa gaaaggcgtc ccattgagag ggaccaaaga 6360ttccccaaat gatatcgaca agtccaagca cgaatccagc accgggcacg aactctgaca 6420aaaggaattg ggtaagtgac aacgagatgt cgataggtgt gtaaccagtc tcaatccgtt 6480ctccacccag cacctcaacc tcagggttgc tcaggcagtt gtaaggaatg cactcgttga 6540tgttgggatt gttgtccatt gttggatcct ctagagtcga cctgcagaag taacaccaaa 6600caacagggtg agcatcgaca aaagaaacag taccaagcaa ataaatagcg tatgaaggca 6660gggctaaaaa aatccacata tagctgctgc atatgccatc atccaagtat atcaagatca 6720aaataattat aaaacatact tgtttattat aatagatagg tactcaaggt tagagcatat 6780gaatagatgc tgcatatgcc atcatgtata tgcatcagta aaacccacat caacatgtat 6840acctatccta gatcgatatt tccatccatc ttaaactcgt aactatgaag atgtatgaca 6900cacacataca gttccaaaat taataaatac accaggtagt ttgaaacagt attctactcc 6960gatctagaac gaatgaacga ccgcccaacc acaccacatc atcacaacca agcgaacaaa 7020aagcatctct gtatatgcat cagtaaaacc cgcatcaaca tgtataccta tcctagatcg 7080atatttccat ccatcatctt caattcgtaa ctatgaatat gtatggcaca cacatacaga 7140tccaaaatta ataaatccac caggtagttt gaaacagaat tctactccga tctagaacga 7200ccgcccaacc agaccacatc atcacaacca agacaaaaaa aagcatgaaa agatgacccg 7260acaaacaagt gcacggcata tattgaaata aaggaaaagg gcaaaccaaa ccctatgcaa 7320cgaaacaaaa aaaatcatga aatcgatccc gtctgcggaa cggctagagc catcccagga 7380ttccccaaag agaaacactg gcaagttagc aatcagaacg tgtctgacgt acaggtcgca 7440tccgtgtacg aacgctagca gcacggatct aacacaaaca cggatctaac acaaacatga 7500acagaagtag aactaccggg ccctaaccat ggaccggaac gccgatctag agaaggtaga 7560gagggggggg gggggaggac gagcggcgta ccttgaagcg gaggtgccga cgggtggatt 7620tgggggagat ctggttgtgt gtgtgtgcgc tccgaacaac acgaggttgg ggaaagaggg 7680tgtggagggg gtgtctattt attacggcgg gcgaggaagg gaaagcgaag gagcggtggg 7740aaaggaatcc cccgtagctg ccggtgccgt gagaggagga ggaggccgcc tgccgtgccg 7800gctcacgtct gccgctccgc cacgcaattt ctggatgccg acagcggagc aagtccaacg 7860gtggagcgga actctcgaga ggggtccaga ggcagcgaca gagatgccgt gccgtctgct 7920tcgcttggcc cgacgcgacg ctgctggttc gctggttggt gtccgttaga ctcgtcgacg 7980gcgtttaaca ggctggcatt atctactcga aacaagaaaa atgtttcctt agttttttta 8040atttcttaaa gggtatttgt ttaattttta gtcactttat tttattctat tttatatcta 8100aattattaaa taaaaaaact aaaatagagt tttagttttc ttaatttaga ggctaaaata 8160gaataaaata gatgtactaa aaaaattagt ctataaaaac cattaaccct aaaccctaaa 8220tggatgtact aataaaatgg atgaagtatt atataggtga agctatttgc aaaaaaaaag 8280gagaacacat gcacactaaa aagataaaac tgtagagtcc tgttgtcaaa atactcaatt 8340gtcctttaga ccatgtctaa ctgttcattt atatgattct ctaaaacact gatattattg 8400tagtactata gattatatta ttcgtagagt aaagtttaaa tatatgtata aagatagata 8460aactgcactt caaacaagtg tgacaaaaaa aatatgtggt aattttttat aacttagaca 8520tgcaatgctc attatctcta gagaggggca cgaccgggtc acgctgcact gcaggcatgc 8580gcgccttaat taaggaattc ctcgagttta aacggatccc tgaaagcgac gttggatgtt 8640aacatctaca aattgccttt tcttatcgac catgtacgta agcgcttacg tttttggtgg 8700acccttgagg aaactggtag ctgttgtggg cctgtggtct caagatggat cattaatttc 8760caccttcacc tacgatgggg ggcatcgcac cggtgagtaa tattgtacgg ctaagagcga 8820atttggcctg tagacctcaa ttgcgagctt tctaatttca aactattcgg gcctaacttt 8880tggtgtgatg atgctgactg gcttacgtgt ggaaaaaatt tgcaatctat gtagtcttta 8940actaatgttt ttttctttaa aaaaaaagtc attatttttg gtttgattaa tatatttggt 9000ttaaattaaa taaaatatta aaaagtttag ttaaatcatc tatttaaacg atttgtactg 9060atttgtgatc tattaatttt ttaacttaat ctagaccagg gtactagttg gtccgatccc 9120atcttgaaaa cactatcttt agcttgctgg taggttccag ggtagaaggc agagactttt 9180ttggagggtt tttattatta aatttatatt tttataattt ttaaatgatt aaaataaaaa 9240tttattattt taagaggaga taaagtgcaa ttttaccata tattaattta aaattttata 9300aatttaaaaa agaaaaaaac taaaatttta attttatagg ttctaaaata ataaatataa 9360cttactgagt ttttttaagc tt 9382310348DNAArtificial SequenceCry1Ac event 3006-48-81 insert and its border sequences 3gaatcaatct tttacgggaa aactcaattg gaatgaaact tgtttccagt aaaagtatta 60aaaaatgtat aaactagtcc atgtatgata gtgtaaagag tatattggag ttaaaaattt 120catcccatgt tactctatat tacattataa aggaagctat aggttggctc actgcaccac 180ccaatcaaga tactcatatg tattacttaa tatataatat taaaagatat catttctttt 240tgttatcaga ttaaagagaa ctaagatatt acaaacttgc aaaacaatag ttaggccaac 300ccatatttta aatattttct tcttttttct actcaaacct attttgtttc caaatattga 360agagttctgt tctgattgga tatactctcg gacaagttta actctaaatt ttccaaatat 420tgaaatatgg atttgctcac atggaaaaac ggttcttgaa caataaatca aaatagcata 480ttctatcaat ggaatcaagg aattccatat tcatttcaaa gttggagcca agcatgcatg 540ataatgattt atagcaattt tgtcaaaagg aaaaaataag gtgattggat gacaagaaac 600aaagggaaaa tgaattaaca gcctgcattt aatatcattc atgtccggga aatctacatg 660gatnagcaat gagtatgatg gtcaatatgg agaaaaagaa agagtaatta ccaatttttt 720ttcaattcaa aaatgtagat gtccgcagcg ttattataaa atgaaagtac attttgataa 780aacgacaaat tacgatccgt cgtatttata ggcgaaagca ataaacaaat tattctaatt 840cggaaatctt tatttcgacg tgtctacatt cacgtccaaa tgggggccac ttggctgcag 900ccaagctttc gcgagctcga gatccccgac atatgccccg gtttcgttgc gactaacatg 960agttcttgga caaatttgat tggacctgat gagatgatcc aacccgagga tatagcaaag 1020ctcgttcgtg cagcaatgga acggccaaac cgtgcttttg tccccaagaa tgaggtgcta 1080tgcatgaagg aatctacccg ttgatgtcca acagtctcag ggttaatgtc tatgtatctt 1140aaataatgtt gtcggtattt tgtaatctca tatagatttt cactgtgcga cgcaaaaata 1200ttaaataaat attattatta tctacgtttt gattgagata tctagatctc gaggtgtgga 1260agatatgaat ttttttgaga aactagataa gattaatgaa tatcggtgtt ttggtttttt 1320cttgtggccg tctttgttta tattgagatt tttcaaatca gtgcgcaaga cgtgacgtaa 1380gtatccgagt cagtttttat ttttctacta atttggtcgt ttatttcggc gtgtaggaca 1440tggcaaccgg gcctgaattt cgcgggtatt ctgtttctat tccaactttt tcttgatccg 1500cagccattaa cgacttttga atagatacgt ctagggtcga ggggggatcc gtcgaggggg 1560tccaccaaaa acgtaagcgc ttacgtacat ggtcgagggg gtccaccaaa aacgtaagcg 1620cttacgtaca tggtcgaggg ggtccaccaa aaacgtaagc gcttacgtac atggtcgagg 1680gggtccacca aaaacgtaag cgcttacgta catggtcgac tagagcgtga cgctcgcggt 1740gacgccattt cgccttttca gaaatggata aatagccttg cttcctatta tatcttccca 1800aattaccaat acattacact agcatctgaa tttcataacc aatctcgata caccaaatcg 1860cggatccgtc gacctgcagg tcgacatgtc tccggagagg agaccagttg agattaggcc 1920agctacagca gctgatatgg ccgcggtttg tgatatcgtt aaccattaca ttgagacgtc 1980tacagtgaac tttaggacag agccacaaac accacaagag tggattgatg atctagagag 2040gttgcaagat agataccctt ggttggttgc tgaggttgag ggtgttgtgg ctggtattgc 2100ttacgctggg ccctggaagg ctaggaacgc ttacgattgg acagttgaga gtactgttta 2160cgtgtcacat aggcatcaaa ggttgggcct aggatccaca ttgtacacac atttgcttaa 2220gtctatggag gcgcaaggtt ttaagtctgt ggttgctgtt ataggccttc caaacgatcc 2280atctgttagg ttgcatgagg ctttgggata cacagcccgg ggtacattgc gcgcagctgg 2340atacaagcat ggtggatggc atgatgttgg tttttggcaa agggattttg agttgccagc 2400tcctccaagg ccagttaggc cagttaccca gatctgagtc gacggatccc cgacatatgc 2460cccggtttcg ttgcgactaa catgagttct tggacaaatt tgattggacc tgatgagatg 2520atccaacccg aggatatagc aaagctcgtt cgtgcagcaa tggaacggcc aaaccgtgct 2580tttgtcccca agaatgaggt gctatgcatg aaggaatcta cccgttgatg tccaacagtc 2640tcagggttaa tgtctatgta tcttaaataa tgttgtcggt attttgtaat ctcatataga 2700ttttcactgt gcgacgcaaa aatattaaat aaatattatt attatctacg ttttgattga 2760gatatcatca atattataat aaaaatatcc attaaacacg atttgataca aatgacagtc 2820aataatctga tttgaatatt tattaattgt aacgaattac ataaagatcg aatagaaaat 2880actgcactgc aaatgaaaat taacacatac taataaatgc gtcaaatatc tttgccaaga 2940tcaagcggag tgagggcctc atatccggtc tcagttacaa gcacggtatc cccgaagcgc 3000gctccaccaa tgccctcgac atagatgccg ggctcgacgc tgaggacatt gcctaccttg 3060agcatggtct cagcgccggc tttaagctca atcccatccc aatctgaata tcctatcccg 3120cgcccagtcc ggtgtaagaa cgggtctgtc catccacctc tgttgggaat tctgatcttg 3180gcgcgcatgc ggatcctcat tcctccatca gaagtaactc cacgctatca acaatgaatg 3240ttccttccgt ttctccaatc tcaatccaaa ccttgtcggt ttctggaaag tactctaact 3300ctttggtgac atagccggct ggtaacggtg tgtagtcccc atagcctctg ttagattcgc 3360aaggattgtc cctacgtcca tcggtgtaag ccttctcctc ataggctgat gcatagtcag 3420cgggtacaga agagttgctc tcataggctc catcgtatcc tcgattgcga gaagtgtaag 3480taccctcata ctcctcttga gtcgcagtgt agtcattgca agttacggtg ttgtttgggt 3540agacttcctc ctcgacgcag ttgctgaact tcagctcgtc ggtgttgttc tcaatctcgt 3600gtatggtgac gcaaccttct ccgtatcctt ctttgtacgc ggtaacacga agaatgtagc 3660cacgaccagg acagacacga acttcttgtg aaacttctgc ttcccactca ggaacaacaa 3720ggacagagcg gtgattgttc tgttcttcta catctacgtg ccctttcaca ttccagcagg 3780ataggccatt gttgaagtca ccattcttga tgacattcct cgcatcatac aaggagaatg 3840cagtgaagat gcgcccttct aactcttcaa agatagcagc attgacaccc ggaatcacgc 3900taagttcagg aaggtaagct tcccgaatgc tatgaacgcg tttgtctgca gcatgaatca 3960tagctatgtt ggtatcagct tggagcctat catactgaga gttcacaaac agagcgtcaa 4020cgctttcttt ggcttctttg tacacaatgt ttgtttccca ttccaacttc tctctcttgt 4080ccctccactt cttctcagcc ctcttcactc tagcgagggc ttctccaaca agtggtttct 4140cttctagaaa ctccagattg cctagcctgg catggccatc ttgagtcttg atcttgaaga 4200tcacccacac accgaggtct tcgttcaggt cggtacagcc aacgtctatg tccaaggaga 4260agtggtgtga gtgatgggca cacttgccga tgggacttgg ggctgaaagt ggccagagtg 4320aacccgtccc aggcacattg actgtctcat gtttggcgtt gtatctgatg aggtagatct 4380caaggtcttg actgtcctcg atgtaacctc tcaactggta tcttgtgtag gctttgagtt 4440tcgattcatc tatcttctgg tacaggtatg ttggatagca ctcatcaaag gtacccaaga 4500gcgtaacata gttctccttg aacacatcat cacctccttg aatggtgatg tccgtacttc 4560ccctccatcc acgatctagt tgcctgttga tcccgcgaaa gttgggatct tgaagcaagt 4620tccgctcatc actaagtcgc ttagcatgtt tgaccttctc ggacaactcc ttcttctcat 4680ccaaacagaa ctcatcagag aggcactcaa caaggttgga aacgcgatcg atgtgatagt 4740cagtcacatc tgtcttgagc ccaatctgat tggacgaagt gaacagagca ttcaccgcct 4800tctgtgctct ttccaagtca gactctgcct cgagcgttgc agtaacggga atgaattcga 4860agcggtcgat tatcactccg gcggttccgg agaaatttct aacacctact atgttaccta 4920gggaagaggt

gaaggcattg gcactttcga agtaaccgaa atcgctagat tggagattat 4980ccaaggatgt agctgtcgct ggtactgtat tggaaaagat ggaggaatta ccccaattga 5040cgttgaggtg aataggggta acagaggcat accttacacg aacacgatat ctggtagatg 5100tcgatgggaa gtgaatgggc acttcaatat accctctatt ctggatgttg ttgccggaag 5160aattcagcct aaccaagtcg cctccagtga atcctggtcc tgaaatgaca gaaccattaa 5220agagaaagtt ccccttgaca gctgggatct gagtaatgct atcggatgca attatgttgt 5280taaactcagc actacgatgt atccaagaga acatcggagc tctgatgata ctaacgctgc 5340tattactaaa gcctgaacgg aacatggaca catggctaag gcgatggcta aacccttgcc 5400taggtggaac gttgttgttc tgtggaggga tctcatccaa gctatcaact gttccgctct 5460ttctgtagac agcggatggc agatttgagg aggttccata ggcaaattct gtcccgtcaa 5520gcacagacaa ttgttgattg ttgatgccga tgttgaaagg tctcctatat agagtgctgg 5580acaaggttct atacacgccc tgaccgagtt gagcaacaat acgttgttgt ggagctgcat 5640tgcccatagt cccgtaaagt gggaaagtga attctggtcc agagaaccca acgggtgatg 5700ccatgatctg atgccctgac cagtagtaat aaccgcggtg cgcatcggtg tagatcgtga 5760tactgttcaa tatgtccatc aggtgtggag acctgatgct tctctctatg ccctgagccg 5820agcctcgaaa gctaccgtcg aagttctcga ggactgggtt tgtgtagatt tcccgggtca 5880attgtgacac agtacggatt gggtagcgcc tagagtcgta gttgggaaag agagcgacaa 5940tgtctaggac agttagtgtc aactctcgcc tgaactggtt gtacctgacc caatctctag 6000aatccggtcc ccagacacgt tcgagacccg tgttgtacca gcgaacagca taatcggtat 6060agttgccaat aagcctagtc agatcattat aacgactatt gatagttgcg gcatcaaagc 6120cccaccgttg tccgaacacg gagacatcgc ggagcaccga caagtgcagg ttggcagcct 6180gcacgtacac ggataaaaga ggaacttggt aattctgaac ggcgaagagc ggaattgcgg 6240tcgtcagcgc gctgttcatg tcattgaatt gaatgcgcat ctcctctctt aaggcaggat 6300tggtcgggtc tgcttcccac tctcgaaaag attctgcgta aatctggtaa aggttgctga 6360ggccttctaa ccttgagatg gcttggttcc tagcgaattc ttctattctt tggttaatta 6420actgctctat ctgtacaaga aaggcgtccc attgagaggg accaaagatt ccccaaatga 6480tatcgacaag tccaagcacg aatccagcac cgggcacgaa ctctgacaaa aggaattggg 6540taagtgacaa cgagatgtcg ataggtgtgt aaccagtctc aatccgttct ccacccagca 6600cctcaacctc agggttgctc aggcagttgt aaggaatgca ctcgttgatg ttgggattgt 6660tgtccattgt tggatcctct agagtcgacc tgcagaagta acaccaaaca acagggtgag 6720catcgacaaa agaaacagta ccaagcaaat aaatagcgta tgaaggcagg gctaaaaaaa 6780tccacatata gctgctgcat atgccatcat ccaagtatat caagatcaaa ataattataa 6840aacatacttg tttattataa tagataggta ctcaaggtta gagcatatga atagatgctg 6900catatgccat catgtatatg catcagtaaa acccacatca acatgtatac ctatcctaga 6960tcgatatttc catccatctt aaactcgtaa ctatgaagat gtatgacaca cacatacagt 7020tccaaaatta ataaatacac caggtagttt gaaacagtat tctactccga tctagaacga 7080atgaacgacc gcccaaccac accacatcat cacaaccaag cgaacaaaaa gcatctctgt 7140atatgcatca gtaaaacccg catcaacatg tatacctatc ctagatcgat atttccatcc 7200atcatcttca attcgtaact atgaatatgt atggcacaca catacagatc caaaattaat 7260aaatccacca ggtagtttga aacagaattc tactccgatc tagaacgacc gcccaaccag 7320accacatcat cacaaccaag acaaaaaaaa gcatgaaaag atgacccgac aaacaagtgc 7380acggcatata ttgaaataaa ggaaaagggc aaaccaaacc ctatgcaacg aaacaaaaaa 7440aatcatgaaa tcgatcccgt ctgcggaacg gctagagcca tcccaggatt ccccaaagag 7500aaacactggc aagttagcaa tcagaacgtg tctgacgtac aggtcgcatc cgtgtacgaa 7560cgctagcagc acggatctaa cacaaacacg gatctaacac aaacatgaac agaagtagaa 7620ctaccgggcc ctaaccatgg accggaacgc cgatctagag aaggtagaga gggggggggg 7680gggaggacga gcggcgtacc ttgaagcgga ggtgccgacg ggtggatttg ggggagatct 7740ggttgtgtgt gtgtgcgctc cgaacaacac gaggttgggg aaagagggtg tggagggggt 7800gtctatttat tacggcgggc gaggaaggga aagcgaagga gcggtgggaa aggaatcccc 7860cgtagctgcc ggtgccgtga gaggaggagg aggccgcctg ccgtgccggc tcacgtctgc 7920cgctccgcca cgcaatttct ggatgccgac agcggagcaa gtccaacggt ggagcggaac 7980tctcgagagg ggtccagagg cagcgacaga gatgccgtgc cgtctgcttc gcttggcccg 8040acgcgacgct gctggttcgc tggttggtgt ccgttagact cgtcgacggc gtttaacagg 8100ctggcattat ctactcgaaa caagaaaaat gtttccttag tttttttaat ttcttaaagg 8160gtatttgttt aatttttagt cactttattt tattctattt tatatctaaa ttattaaata 8220aaaaaactaa aatagagttt tagttttctt aatttagagg ctaaaataga ataaaataga 8280tgtactaaaa aaattagtct ataaaaacca ttaaccctaa accctaaatg gatgtactaa 8340taaaatggat gaagtattat ataggtgaag ctatttgcaa aaaaaaagga gaacacatgc 8400acactaaaaa gataaaactg tagagtcctg ttgtcaaaat actcaattgt cctttagacc 8460atgtctaact gttcatttat atgattctct aaaacactga tattattgta gtactataga 8520ttatattatt cgtagagtaa agtttaaata tatgtataaa gatagataaa ctgcacttca 8580aacaagtgtg acaaaaaaaa tatgtggtaa ttttttataa cttcgacatg caatgctcat 8640tatctctaga gaggggcacg accgggtcac gctgcactgc aggcatgcgc gccttaatta 8700aggaattcct cgagtttaaa cggatccctg aaagcgacgt tggatgttaa catctacaaa 8760ttgccttttc ttatcgacca tgtacgtaag cgcttacgtt tttggtggac ccttgaggaa 8820actggtagct gttgtgggcc tgtggtctca agatggatca ttaatttcca ccttcaccta 8880cgatgggggg catcgcaccg gtgagtaata ttgtacggct aagagcgaat ttggcctgta 8940gacctcaatt gcgagctttc taatttcaaa ctattcgggc ctaacttttg gtgtgatgat 9000gctgactgaa taattacacg gccttcttgt gagacctcgc caatctgctc ggtgtaccct 9060agcatctcca tatcctcatg tagaagattc aaggaagttg gccttgcatt cagtaccgca 9120agaccattga acatgttgaa tagatttaca ggttcatcag ccacgctagt gcactcagat 9180ctggccttcc ggcagtaaga aggatcccag ttccgcctat gcaacattaa aacaaaccta 9240ggatctccga cctgcagctg agaatatttg gctggtcggg ggactttaaa actcacgata 9300tgaagatcac aaggtaaggg agtagttaat ggagaaaagg gcccccagtg tgtctgcaca 9360ttaatgtctt gtggcttctt ggcaatgaat gtgtgtaagg gatgattcaa gtgagcacca 9420acacaatgcg agagaagaga tggattcaga ggctgtgggt cagaaacggg atttgaagtc 9480gaagaaatgt tggattcgat caagatatgg aaaacaacat tcataacacg attgtccacc 9540acaccttgtc caagaccacg accatcgtct tttgccaaac gacggtcaag cataatctct 9600agccacccct gtttacagct tgctgcaccc agtgactgcc gagaatggac agaataccta 9660tggccattgg acccctgcat gaaagcgaga gaaggcatgg ggtagtaatt cccctgcaac 9720ggaatcttat gatatgtttc tctccgactc atctgaaagc cattcaagtc ggtgtagaaa 9780attcttttgt tgtcaatatc tgtcttatat ctaacaatta attctttgtc aataaaactg 9840ttgccgagaa gctcaacatg atattccttc tcaatcagaa actcctggat cgtatttcct 9900ccattataaa tacgagtact atgggagatc ggagtattct cccatgcagt cttcggataa 9960gagtacacct cctgcatcaa gggaccctca gagataacca gatgcccacc agattgactt 10020ataggcacag cttcaccatg gggaacaaat aagtatgcac ctccggtact tgagtaaagg 10080cttatctctt cagccacggt attttgcaga ccatttttct ggattacctt ttgtaacaaa 10140ccatgcttga caccaaaggt gagagtttga tgctgattct caatttcaac cacatctcct 10200tctacttctg agcaatcata cagtgtaggg cactgtattg aactcaaatt tgagaagagc 10260ttgagttttg ccggtttagc tttttcacat ccgacaaagc cattggcaat ataatatgtc 10320tgcaaaccca tggcaggaac agaagctt 10348421DNAArtificial SequenceForward primer 281-14 4tgtcggctga aggtagggag g 21520DNAArtificial SequenceReverse primer 281-15 5ccggacatga agccatttac 206603DNAArtificial Sequence603 bp sequence of the amplicon produced using the primers of SEQ ID NO4 and SEQ ID NO5 6tgtcggctga aggtagggag gaattaatca atcacagttg cttgtttctg agtctataga 60atcatgaatt ttaaatttat ggaatgcatt ttttcgaaga tattgtatgc attaagtgta 120attttagttt caatatgaaa tttgagattt atatatatac ttacataaaa ccctccttta 180ctgaattagt gccatggata aaagaccaat taagcaatcc ttccaacacg tgcatgcact 240ggattttcat cgcctcgtcc attgttaaat tgataggtta ataagaacaa ttagttggct 300actgattata tggattctgg gttaaaagta tttaggttta ctgttacata catggaggat 360ctacatctat tttcactttt gtttaattaa tttaagttag ttttgatgag tttaaggatt 420gtactagcca atagtagtac ataaaggaga tagagtacca aaacaaagaa aaagccgaaa 480ggtgttaatg ctaaattgta aaagaaagtt aaaataagag actcgaatta taatatgatt 540ctctggcgca ctaattaagc tactatatat tgtcaatagt attgtaaatg gcttcatgtc 600cgg 603721DNAArtificial SequenceForward primer 281-9 7tctctagaga ggggcacgac c 21821DNAArtificial SequenceReverse primer 281-10 8cgagctggag agaccggtga c 219562DNAArtificial Sequence562 bp sequence of the amplicon produced using the primers of SEQ ID NO7 and SEQ ID NO8 9tctctagaga ggggcacgac cgggtcacgc tgcactgcag ccaagtggcc cccatttgga 60cgtgaatgta gacacgtcga aataaagatt tccgaattag aataatttgc ttattgcttt 120cgcctataaa tacgacggat cgtaatttgt cgctttatca gaatgtactt tcattttata 180ataacgctgc ggacatctac atttttgaat tgaaaaaaaa ttggtaatta ctctttcttt 240ttctccatat tgaccatcat actcattgct gatccatgta gatttccctt acttgtctcc 300ctctaatctg actttattaa cccaaagcaa ttgcttattt gttccccacg cccacaaagc 360ccagcattgt ccctaaggta ttaatttgtt gttcgattct tgttcttgaa cccatttgga 420gaatgcaaca agggttttca tgtcagcacg gtaatggttc tgtgtaaatt ccagtagtgc 480tgcccaagta aagtctgggt atttcctcga atttgcggca ttaactaagc tagctgctgg 540tgtcaccggt ctctccagct cg 5621025DNAArtificial SequenceForward primer 3006-20 10ttccaacctt taactattat cctgc 251120DNAArtificial SequenceReverse primer 3006-22 11gctgcggaca tctacatttt 2012614DNAArtificial Sequence614 bp sequence of the amplicon produced using the primers of SEQ ID NO10 and SEQ ID NO11 12ttccaacctt taactattat cctgccttaa aattcgaata catttattat ctataaacta 60tccgaatatt attatctaaa tcctaattaa atactatttt ttatcgagta ttcgtatccg 120ccaaggaaat ccatctccaa attttcaatt atttttcaga tatctaaatc tgtaaaattt 180caaattcaag tacgttacaa ttctttataa ataatccaaa ttataaatat tttataacta 240ttaattcata aattaaaatt tattattcaa atattcgaat aatctatttt taagacgtaa 300agtattacat cgaagggtta ctttcaaagg gtagtgtatt tccatttcaa ttattcagaa 360cgttgtcgtt ttgttccggt catagaaaag ggctctggaa gagaagaaaa tgacttgact 420tttcaatttc atgctcatcc actcgtttca attactgttt actaaaaaaa taataaaata 480aaatattaac aatgcattga gtatgatgtc cgggaaatct acatggatca gcaatgagta 540tgatggtcaa tatggagaaa aagaaagagt aattaccaat tttttttcaa ttcaaaaatg 600tagatgtccg cagc 6141324DNAArtificial SequenceForward primer 3006-9 13gacatgcaat gctcattatc tcta 241422DNAArtificial SequenceReverse primer 3600-12 14aagtctctgc cttctaccct gg 2215662DNAArtificial Sequence662 bp sequence of the amplicon produced using the primers of SEQ ID NO13 and SEQ ID NO14 15gacatgcaat gctcattatc tctagagagg ggcacgaccg ggtcacgctg cactgcaggc 60atgcgcgcct taattaagga attcctcgag tttaaacgga tccctgaaag cgacgttgga 120tgttaacatc tacaaattgc cttttcttat cgaccatgta cgtaagcgct tacgtttttg 180gtggaccctt gaggaaactg gtagctgttg tgggcctgtg gtctcaagat ggatcattaa 240tttccacctt cacctacgat ggggggcatc gcaccggtga gtaatattgt acggctaaga 300gcgaatttgg cctgtagacc tcaattgcga gctttctaat ttcaaactat tcgggcctaa 360cttttggtgt gatgatgctg actggcttac gtgtggaaaa aatttgcaat ctatgtagtc 420tttaactaat gtttttttct ttaaaaaaaa agtcattatt tttggtttga ttaatatatt 480tggtttaaat taaataaaat attaaaaagt ttagttaaat catctattta aacgatttgt 540actgatttgt gatctattaa ttttttaact taatctagac cagggtacta gttggtccga 600tcccatcttg aaaacactat ctttagcttg ctggtaggtt ccagggtaga aggcagagac 660tt 6621620DNAArtificial SequenceForward primer 3006-23 16gaatcaatct tttacgggaa 201720DNAArtificial SequenceReverse primer 3006-25 17catgtagatt tcccggacat 2018660DNAArtificial Sequence660 bp sequence of the amplicon produced using the primers of SEQ ID NO16 and SEQ ID NO17 18gaatcaatct tttacgggaa aactcaattg gaatgaaact tgtttccagt aaaagtatta 60aaaaatgtat aaactagtcc atgtatgata gtgtaaagag tatattggag ttaaaaattt 120catcccatgt tactctatat tacattataa aggaagctat aggttggctc actgcaccac 180ccaatcaaga tactcatatg tattacttaa tatataatat taaaagatat catttctttt 240tgttatcaga ttaaagagaa ctaagatatt acaaacttgc aaaacaatag ttaggccaac 300ccatatttta aatattttct tcttttttct actcaaacct attttgtttc caaatattga 360agagttctgt tctgattgga tatactctcg gacaagttta actctaaatt ttccaaatat 420tgaaatatgg atttgctcac atggaaaaac ggttcttgaa caataaatca aaatagcata 480ttctatcaat ggaatcaagg aattccatat tcatttcaaa gttggagcca agcatgcatg 540ataatgattt atagcaattt tgtcaaaagg aaaaaataag gtgattggat gacaagaaac 600aaagggaaaa tgaattaaca gcctgcattt aatatcattc atgtccggga aatctacatg 6601924DNAArtificial SequenceForward primer 3006-9 19gacatgcaat gctcattatc tcta 242024DNAArtificial SequenceReverse primer 3006-11C 20gaacctgtaa atctattcaa catg 2421531DNAArtificial Sequence531 bp sequence of the amplicon produced using the primers of SEQ ID NO19 and SEQ ID NO20 21gacatgcaat gctcattatc tctagagagg ggcacgaccg ggtcacgctg cactgcaggc 60atgcgcgcct taattaagga attcctcgag tttaaacgga tccctgaaag cgacgttgga 120tgttaacatc tacaaattgc cttttcttat cgaccatgta cgtaagcgct tacgtttttg 180gtggaccctt gaggaaactg gtagctgttg tgggcctgtg gtctcaagat ggatcattaa 240tttccacctt cacctacgat ggggggcatc gcaccggtga gtaatattgt acggctaaga 300gcgaatttgg cctgtagacc tcaattgcga gctttctaat ttcaaactat tcgggcctaa 360cttttggtgt gatgatgctg actgaataat tacacggcct tcttgtgaga cctcgccaat 420ctgctcggtg taccctagca tctccatatc ctcatgtaga agattcaagg aagttggcct 480tgcattcagt accgcaagac cattgaacat gttgaataga tttacaggtt c 531

Claims

1. A transgenic cotton plant comprising an insert that disrupts a genomic sequence selected from the group consisting of a. a first DNA sequence comprising a 5' end comprising nucleotides 1-2074 of SEQ ID NO:1, a first interior segment comprising SEQ ID NO:15, and a 3' end comprising nucleotides 12,749-15,490 of SEQ ID NO:1, and b. a second DNA sequence comprising a 5' end comprising nucleotides 1-527 of SEQ ID NO:2, a second interior segment comprising SEQ ID NO:16, and a 3' end comprising nucleotides 8,901-9,382 of SEQ ID NO:2.

2. A cotton plant comprising at least one insert that disrupts a genomic sequence selected from the group consisting of a. a first DNA sequence comprising a 5' end comprising nucleotides 1-2074 of SEQ ID NO:1, and a 3' end comprising nucleotides 12,749-15,490 of SEQ ID NO:1; and b. a second DNA sequence comprising a 5' end comprising nucleotides 1-527 of SEQ ID NO:2, and a 3' end comprising nucleotides 8,901-9,382 of SEQ ID NO:2.

3. The plant of claim 1 wherein said insert is a non-cry1F and non-cry1Ac insert.

4. The plant of claim 2 wherein said insert is a non-cry1F and non-cry1Ac insert.

5. A method for targeted homologous recombination, said method comprising targeting a genomic cotton sequence for insertion of a transgene genetic insert, and introducing said transgene genetic insert into said genomic cotton sequence, wherein said genomic sequence is selected from the group consisting of a. a first DNA sequence comprising a 5' end comprising nucleotides 1-2074 of SEQ ID NO:1, and a 3' end comprising nucleotides 12,749-15,490 of SEQ ID NO:1; and b. a second DNA sequence comprising a 5' end comprising nucleotides 1-527 of SEQ ID NO:2, and a 3' end comprising nucleotides 8,901-9,382 of SEQ ID NO:2.

6. A seed of the plant of claim 1, wherein said seed comprises said insert.

7. A seed of the plant of claim 2, wherein said seed comprises said insert.