U.S. patent application number 12/662576 was filed with the patent office on 2011-07-28 for methods and systems for annotating biomolecular sequences.
This patent application is currently assigned to Compugen Ltd.. Invention is credited to Nili Beck, Jeanne Bernstein, Dvir Dahary, Shiri Freilich, Erez Levanon, Liat Mintz, Alon Wasserman, Hanqing Xie, Wei-Yong Zhu.
Application Number | 20110183924 12/662576 |
Document ID | / |
Family ID | 32719810 |
Filed Date | 2011-07-28 |
United States Patent
Application |
20110183924 |
Kind Code |
A1 |
Mintz; Liat ; et
al. |
July 28, 2011 |
Methods and systems for annotating biomolecular sequences
Abstract
A method of annotating biomolecular sequences. The method
comprises (a) computationally clustering the biomolecular sequences
according to a progressive homology range, to thereby generate a
plurality of clusters each being of a predetermined homology of the
homology range; and (b) assigning at least one ontology to each
cluster of the plurality of clusters, the at least one ontology
being: (i) derived from an annotation preassociated with at least
one biomolecular sequence of each cluster; and/or (ii) generated
from analysis of the at least one biomolecular sequence of each
cluster thereby annotating biomolecular sequences.
Inventors: |
Mintz; Liat; (East
Brunswick, NJ) ; Xie; Hanqing; (Lambertville, NJ)
; Dahary; Dvir; (Tel-Aviv, IL) ; Levanon;
Erez; (Petach-Tikva, IL) ; Freilich; Shiri;
(Herzlia, IL) ; Beck; Nili; (Kfar Saba, IL)
; Zhu; Wei-Yong; (Plainsboro, NJ) ; Wasserman;
Alon; (Rehovot, IL) ; Bernstein; Jeanne; (Kfar
Yona, IL) |
Assignee: |
Compugen Ltd.
Tel-Aviv
IL
|
Family ID: |
32719810 |
Appl. No.: |
12/662576 |
Filed: |
April 23, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11443428 |
May 31, 2006 |
7745391 |
|
|
12662576 |
|
|
|
|
10242799 |
Sep 13, 2002 |
|
|
|
11443428 |
|
|
|
|
60322285 |
Sep 14, 2001 |
|
|
|
60354242 |
Feb 6, 2002 |
|
|
|
60371494 |
Apr 11, 2002 |
|
|
|
60384096 |
May 31, 2002 |
|
|
|
Current U.S.
Class: |
514/21.8 ;
514/21.7; 530/329; 536/23.5 |
Current CPC
Class: |
A61P 37/00 20180101;
G16B 20/00 20190201; G16B 40/00 20190201; A61P 35/00 20180101; A61P
29/00 20180101; A61P 31/00 20180101; G16B 30/00 20190201 |
Class at
Publication: |
514/21.8 ;
530/329; 536/23.5; 514/21.7 |
International
Class: |
A61K 38/08 20060101
A61K038/08; C07K 7/00 20060101 C07K007/00; C07H 21/04 20060101
C07H021/04; A61P 29/00 20060101 A61P029/00; A61P 31/00 20060101
A61P031/00; A61P 35/00 20060101 A61P035/00; A61P 37/00 20060101
A61P037/00 |
Claims
1. An isolated protein having the sequence according to the amino
acid sequence of any of SEQ ID NOs: 35-38, 737437-1034311.
2. An isolated polynucleotide, consisting of a nucleic acid
sequence encoding the amino acid sequence of the protein of claim
1.
3. A pharmaceutical composition comprising an isolated protein
having the sequence according to the amino acid sequence of any of
SEQ ID NOs: 35-38, 737437-1034311, and a pharmaceutically
acceptable carrier.
Description
[0001] This application is a divisional application of U.S. patent
application Ser. No. 11/443,482, filed on May 31, 2006, which is a
continuation of U.S. patent application Ser. No. 10/242,799, filed
on Sep. 13, 2002, now abandoned, which claims the benefit of U.S.
Provisional Patent Application Nos. 60/322,285, filed on Sep. 14,
2001; 60/354,242, filed on Feb. 6, 2002; 60/371,494, filed on Apr.
11, 2002 and 60/384,096, filed on May 31, 2002. The contents of the
above Applications are all incorporated herein by reference.
FIELD AND BACKGROUND OF THE INVENTION
[0002] The present invention relates to systems and methods useful
for annotating biomolecular sequences. More particularly, the
present invention relates to computational approaches, which enable
systemic characterization of biomolecular sequences and
identification of differentially expressed biomolecular sequences
such as sequences associated with a pathology.
[0003] In the postgenomic era, data analysis rather than data
collection presents the biggest challenge to biologists. Efforts to
ascribe biological meaning to genomic data, whether by
identification of function, structure or expression pattern are
lagging behind sequencing efforts [Boguski M S (1999) Science
286:453-455].
[0004] It is well recognized that elucidation of spatial and
temporal patterns of gene expression in healthy and diseased states
may contribute immensely to further understanding of disease
mechanisms.
[0005] Therefore, any observational method that can rapidly,
accurately and economically observe and measure the pattern of
expression of selected individual genes or of whole genomes is of
great value to scientists.
[0006] In recent years, a variety of techniques have been developed
to analyze differential gene expression. However, current
observation and measurement methods are inaccurate, time consuming,
labor intensive or expensive, oftentimes requiring complex
molecular and biochemical analysis of numerous gene sequences.
[0007] For example, observation methods for individual mRNA or cDNA
molecules such as Northern blot analysis, RNase protection, or
selective hybridization to arrayed cDNA libraries [see Sambrook et
al. (1989) Molecular cloning, A laboratory manual, Cold Spring
Harbor press, NY] depend on specific hybridization of a single
oligonucleotide probe complementary to the known sequence of an
individual molecule. Since a single human cell is estimated to
express 10,000-30,000 genes [Liang et al. (1992) Science
257:967-971], single probe methods to identify all sequences in a
complex sample are ineffective and laborious.
[0008] Other approaches for high throughput analysis of
differential gene expression are summarized infra.
[0009] EST sequencing--The basic idea is to create cDNA libraries
from tissues of interest, pick clones randomly from these libraries
and then perform a single sequencing reaction from a large number
of clones. Each sequencing reaction generates 300 base pairs or so
of sequence that represents a unique sequence tag for a particular
transcript. An EST sequencing project is technically simple to
execute since it requires only a cDNA library, automated DNA
sequencing capabilities and standard bioinformatics protocols.
[0010] To generate meaningful amounts of data, however, high
throughput template preparation, sequencing and analysis protocols
must be applied. As such, the number of new genes identified as
well as the statistical significance of the data is proportional to
the number of clones sequenced as well as the complexity of the
tissue being analyzed [Adams et al. (1995) Nature 377:3-173;
Hillier et al. (1996) Genome Res. 6:807-828].
[0011] Subtractive cloning--Subtractive cloning offers an
inexpensive and flexible alternative to EST sequencing and cDNA
array hybridization. In this approach, double-stranded cDNA is
created from the two-cell or tissue populations of interest,
linkers are ligated to the ends of the cDNA fragments and the cDNA
pools are then amplified by PCR. The cDNA pool from which unique
clones are desired is designated the "tester", and the cDNA pool
that is used to subtract away shared sequences is designated the
"driver". Following initial PCR amplification, the linkers are
removed from both cDNA pools and unique linkers are ligated to the
tester sample. The tester is then hybridized to a vast excess of
driver DNA and sequences that are unique to the tester cDNA pool
are amplified by PCR.
[0012] The primary limitation of subtractive methods is that they
are not always comprehensive. The cDNAs identified are typically
those, which differ significantly in expression level between
cell-populations and subtle quantitative differences are often
missed. In addition each experiment is a pair wise comparison and
since subtractions are based on a series of sensitive biochemical
reactions it is difficult to directly compare a series of RNA
samples.
[0013] Differential display--Differential display is another
PCR-based differential cloning method [Liang and Pardee (1992)
Science 257:967-70; Welsh et al. (1992) Nucleic Acids Res.
20:4965-70]. In classical differential display, reverse
transcription is primed with either oligo-dT or an arbitrary
primer. Thereafter an arbitrary primer is used in conjunction with
the reverse transcription primer to amplify cDNA fragments and the
cDNA fragments are separated on a polyacrylamide gel. Differences
in gene expression are visualized by the presence or absence of
bands on the gel and quantitative differences in gene expression
are identified by differences in the intensity of bands. Adaptation
of differential display methods for fluorescent DNA sequencing
machines has enhanced the ability to quantify differences in gene
expression [Kato (1995) Nucleic Acids Res. 18:3685-90].
[0014] A limitation of the classical differential display approach
is that false positive results are often generated during PCR or in
the process of cloning the differentially expressed PCR products.
Although a variety of methods have been developed to discriminate
true from false positives, these typically rely on the availability
of relatively large amounts of RNA.
[0015] Serial analysis of gene expression (SAGE)--this DNA sequence
based method is essentially an accelerated version of EST
sequencing [Valculescu et al. (1995) Science 270:484-8]. In this
method a digestible unique sequence tag of 13 or more bases is
generated for each transcript in the cell or tissue of interest,
thereby generating a SAGE library.
[0016] Sequencing each SAGE library creates transcript profiles.
Since each sequencing reaction yields information for twenty or
more genes, it is possible to generate data points for tens of
thousands of transcripts in modest sequencing efforts. The relative
abundance of each gene is determined by counting or clustering
sequence tags. The advantages of SAGE over many other methods
include the high throughput that can be achieved and the ability to
accumulate and compare SAGE tag data from a variety of samples,
however the technical difficulties concerning the generation of
good SAGE libraries and data analysis are significant.
[0017] Altogether, it is clear from the above that laboratory bench
approaches are ineffective, time consuming, expensive and often
times inaccurate in handling and processing the vast amount of
genomic information which is now available.
[0018] It is appreciated, that much of the analysis can be effected
by developing computational algorithms, which can be applied to
mining data from existing databases, thereby retrieving and
integrating valuable biological information.
[0019] To date, there are more than a hundred major biomolecule
databases and application servers on the Internet and new sites are
being introduced at an ever-increasing rates [Ashburner and Goodman
(1997) Curr. Opin. Genet. Dev. 7:750-756; Karp (1998) Trends
Biochem. Sci. 23:114-116].
[0020] However, these databases are organized in extremely
heterogeneous formats. These reflect the inherent complexity of
biological data, ranging from plain-text nucleic acid and protein
sequences, through the three dimensional structures of therapeutic
drugs and macromolecules and high resolution images of cells and
tissues, to microarray-chip outputs. Moreover data structures are
constantly evolving to reflect new research and technology
development.
[0021] The heterogeneous and dynamic nature of these biological
databases present major obstacles in mining data relevant to
specific biological queries. Clearly, simple retrieval of data is
not sufficient for data mining; efficient data retrieval requires
flexible data manipulation and sophisticated data integration.
Efficient data retrieval requires the use of complex queries across
multiple heterogeneous data sources; data warehousing by merging
data derived from multiple public sources and local (i.e., private)
sources; and multiple data-analysis procedures that require feeding
subsets of data derived from different sources into various
application programs for gene finding, protein-structure
prediction, functional domain or motif identification, phylogenetic
tree construction, graphic presentation and so forth.
[0022] Current biological data retrieval systems are not fully up
to the demand of smooth and flexible data integration [Etzold et
al. (1996) Methods Enzymol 266:t14-t28; Schuler et al. (1996)
Methods Enzymol. 266:141-162; Chung and Wong (1999) Trends Biotech.
17:351-355].
[0023] There is thus a widely recognized need for, and it would be
highly advantageous to have, systems and methods which can be used
for efficient retrieval and processing of data from biological
databases thereby enabling annotation of previously un-annotated
biomolecular sequences.
SUMMARY OF THE INVENTION
[0024] According to one aspect of the present invention there is
provided a method of annotating biomolecular sequences according to
a hierarchy of interest, the method comprising: (a) computationally
constructing a dendrogram having multiple nodes, the dendrogram
representing the hierarchy of interest, wherein each node of the
multiple nodes of the dendrogram is annotated by at least one
keyword; (b) computationally assigning each biomolecular sequence
of the biomolecular sequences to a specific node of the multiple
nodes of the dendrogram to thereby generate assigned biomolecular
sequences; and (c) computationally classifying each of the assigned
biomolecular sequences to nodes hierarchically higher than the
specific node, thereby annotating biomolecular sequences according
to the hierarchy of interest.
[0025] According to another aspect of the present invention there
is provided a method of identifying differentially expressed
biomolecular sequences, the method comprising: (a) computationally
constructing a dendrogram having multiple nodes, the dendrogram
representing the hierarchy of interest, wherein each node of the
multiple nodes of the dendrogram is annotated by at least one
keyword; (b) computationally assigning each biomolecular sequence
of the biomolecular sequences to a specific node of the multiple
nodes of the dendrogram to thereby generate assigned biomolecular
sequences; (c) computationally classifying each of the assigned
biomolecular sequences to nodes hierarchically higher than the
specific node, to thereby generate annotated biomolecular
sequences; and (d) identifying annotated biomolecular sequences
assigned to a portion of the multiple nodes, thereby identifying
differentially expressed biomolecular sequences.
[0026] According to yet another aspect of the present invention
there is provided a computer readable storage medium comprising a
database stored in a retrievable manner, the database including
files each containing data of a specific node of a dendrogram, the
data including biomolecular sequence information and biomolecular
sequence annotations, wherein the biomolecular sequence annotations
are selected from the group consisting of contig description,
tissue specific expression, pathological specific expression,
functional features, parameters for ontological annotation
assignment, cellular localization, database sequence source and
functional alterations.
[0027] According to still another aspect of the present invention
there is provided a system for generating a database of annotated
biomolecular sequences, the system comprising a processing unit,
the processing unit executing a software application configured
for: (a) constructing a dendrogram having multiple nodes, the
dendrogram representing a hierarchy of interest, wherein each node
of the multiple nodes of the dendrogram is annotated by at least
one keyword; (b) assigning each biomolecular sequence of the
biomolecular sequences to a specific node of the multiple nodes of
the dendrogram to thereby generate assigned biomolecular sequences;
(c) classifying each of the assigned biomolecular sequences to
nodes hierarchically higher than the specific node, to thereby
generate annotated biomolecular sequences; and (d) storing sequence
annotations and sequence information of the annotated biomolecular
sequences, thereby generating the database of annotated
biomolecular sequences.
[0028] According to further features in preferred embodiments of
the invention described below, the biomolecular sequences are
selected from the group consisting of polypeptide sequences and
polynucleotide sequences.
[0029] According to still further features in the described
preferred embodiments the polynucleotides are selected from the
group consisting of genomic sequences, expressed sequence tags,
contigs, complementary DNA (cDNA) sequences, pre-messenger RNA
(mRNA) sequences, and mRNA sequences.
[0030] According to still further features in the described
preferred embodiments the biomolecular sequences are selected from
the group consisting of annotated biomolecular sequences,
unannotated biomolecular sequences and partially annotated
biomolecular sequences.
[0031] According to still further features in the described
preferred embodiments the method further comprising homology
clustering of the biomolecular sequences prior to step (b).
[0032] According to still further features in the described
preferred embodiments the dendrogram is selected from the group
consisting of a graph, a list, a map and a matrix.
[0033] According to still further features in the described
preferred embodiments the hierarchy of interest is selected from
the group consisting of a tissue expression hierarchy, a
developmental expression hierarchy, a pathological expression
hierarchy, a cellular expression hierarchy, an intracellular
expression hierarchy, a taxonomical hierarchy and a functional
hierarchy.
[0034] According to still further features in the described
preferred embodiments each node of the multiple nodes is a parental
node in an additional hierarchy of interest.
[0035] According to still further features in the described
preferred embodiments the method further comprising classifying the
biomolecular sequences of the parental node according to the
additional hierarchy of interest.
[0036] According to still further features in the described
preferred embodiments the system further comprising classifying the
biomolecular sequences of the parental node according to the
additional hierarchy of interest.
[0037] According to still further features in the described
preferred embodiments each of the biomolecular sequences is a
member of a sequence contig.
[0038] According to still further features in the described
preferred embodiments the method further comprising the step of
confirming annotations of the assigned biomolecular sequence
in-vivo and/or in-vitro prior to or following step (c).
[0039] According to still further features in the described
preferred embodiments the system further comprising the step of
confirming annotations of the assigned biomolecular sequence
in-vivo and/or in-vitro prior to or following step (c).
[0040] According to an additional aspect of the present invention
there is provided a method of identifying sequence features unique
to differentially expressed mRNA splice variants, the method
comprising: (a) computationally identifying unique sequence
features in each splice variant of an alternatively spliced
expressed sequences; and (b) identifying differentially expressed
splice variants of the alternatively spliced expressed sequences,
thereby identifying sequence features unique to differentially
expressed mRNA splice variants.
[0041] According to yet an additional aspect of the present
invention there is provided a computer readable storage medium
comprising data stored in a retrievable manner, the data including
sequence information of sequence features unique to differentially
expressed mRNA splice variants as set forth in files:
[0042] "Transcripts_nucleotide_seqs_part1",
[0043] "Transcripts_nucleotide_seqs_part2"
[0044] "Transcripts_nucleotide_seqs_part3.new" and/or
[0045] "Protein.seqs"
[0046] provided in CD-ROMs 1 and/or 2 enclosed herewith, and
sequence annotations as set forth in annotation categories
"#TAA_CD" and "#TAA_TIS", in the file "Summary_table.new" of
CD-ROM3 enclosed herewith.
[0047] According to still an additional aspect of the present
invention there is provided a system for generating a database of
sequence features unique to differentially expressed mRNA splice
variants, the system comprising a processing unit, the processing
unit executing a software application configured for: (a)
identifying unique sequence features in each splice variant of an
alternatively spliced expressed sequences; and (b) identifying
differentially expressed splice variants of the alternatively
spliced expressed sequences, thereby identifying sequence features
unique to differentially expressed mRNA splice variants. (c)
storing the sequence features unique to the differentially
expressed mRNA splice variants, thereby generating the database of
sequence features unique to differentially expressed mRNA splice
variants.
[0048] According to still further features in the described
preferred embodiments step (b) is effected by qualifying
annotations associated with the alternatively spliced expressed
sequences.
[0049] According to still further features in the described
preferred embodiments the method further comprising scoring the
annotations associated with the alternatively spliced expressed
sequences according to:(i) prevalence of the alternatively spliced
expressed sequences in normal tissues; (ii) prevalence of the
alternatively spliced expressed sequences in pathological tissues;
(iii) prevalence of the alternatively spliced expressed sequence in
total tissues; and (iv) number of tissues and/or tissue types
expressing the alternatively spliced expressed sequences;
[0050] According to still further features in the described
preferred embodiments the system further comprising scoring the
annotations associated with the alternatively spliced expressed
sequences according to:(i) prevalence of the alternatively spliced
expressed sequences in normal tissues; (ii) prevalence of the
alternatively spliced expressed sequences in pathological tissues;
(iii) prevalence of the alternatively spliced expressed sequence in
total tissues; and (iv) number of tissues and/or tissue types
expressing the alternatively spliced expressed sequences;
[0051] According to still further features in the described
preferred embodiments step (b) is effected by identifying the
unique sequence feature.
[0052] According to still further features in the described
preferred embodiments the unique sequence feature is selected from
the group consisting of a donor-acceptor concatenation, an
alternative exon, an exon and a retained intron.
[0053] According to still further features in the described
preferred embodiments identifying unique sequence features in each
splice variant of an alternatively spliced expressed sequence is
effected by expressed sequence alignment.
[0054] According to a further aspect of the present invention there
is provided a kit useful for detecting differentially expressed
polynucleotide sequences, the kit comprising at least one
oligonucleotide being designed and configured to be specifically
hybridizable with a polynucleotide sequence selected from the group
consisting of sequence files:
[0055] "Transcripts_nucleotide_seqs_part1"
[0056] "Transcripts_nucleotide_seqs_part2" and
[0057] "Transcripts_nucleotide_seqs_part3.new"
[0058] provided in CD-ROMs 1 and/or 2 enclosed herewith, under
moderate to stringent hybridization conditions.
[0059] According to still further features in the described
preferred embodiments the at least one oligonucleotide is
labeled.
[0060] According to still further features in the described
preferred embodiments the at least one oligonucleotide is attached
to a solid substrate.
[0061] According to still further features in the described
preferred embodiments the solid substrate is configured as a
microarray and whereas the at least one oligonucleotide includes a
plurality of oligonucleotides each being capable of hybridizing
with a specific polynucleotide sequence of the polynucleotide
sequences set forth in the files:
[0062] "Transcripts_nucleotide_seqs_part 1"
[0063] "Transcripts_nucleotide_seqs_part2" and/or
[0064] "Transcripts_nucleotide_seqs_part3.new"
[0065] provided in CD-ROMs 1 and/or 2 enclosed herewith.
[0066] According to still further features in the described
preferred embodiments each of the plurality of oligonucleotides is
being attached to the microarray in a regio-specific manner.
[0067] According to still further features in the described
preferred embodiments the at least one oligonucleotide is designed
and configured for DNA hybridization.
[0068] According to still further features in the described
preferred embodiments the at least one oligonucleotide is designed
and configured for RNA hybridization.
[0069] According to yet a further aspect of the present invention
there is provided a method of annotating biomolecular sequences,
the method comprising: (a) computationally clustering the
biomolecular sequences according to a progressive homology range,
to thereby generate a plurality of clusters each being of a
predetermined homology of the homology range; and (b) assigning at
least one ontology to each cluster of the plurality of clusters,
the at least one ontology being: (i) derived from an annotation
preassociated with at least one biomolecular sequence of each
cluster; and/or (ii) generated from analysis of the at least one
biomolecular sequence of each cluster thereby annotating
biomolecular sequences.
[0070] According to still a further aspect of the present invention
there is provided a system for generating a database of annotated
biomolecular sequences, the system comprising a processing unit,
the processing unit executing a software application configured
for: (a) clustering the biomolecular sequences according to a
progressive homology range, to thereby generate a plurality of
clusters each being of a predetermined homology of the homology
range; and (b) assigning at least one ontology to each cluster of
the plurality of clusters, the at least one ontology being: (i)
derived from an annotation preassociated with at least one
biomolecular sequence of each cluster; and/or (ii) generated from
analysis of the at least one biomolecular sequence of each cluster,
to thereby annotate the biomolecular sequences; and (c) storing
sequence annotations and sequence information of the annotated
biomolecular sequences, thereby generating the database of
annotated biomolecular sequences.
[0071] According to still a further aspect of the present invention
there is provided a computer readable storage medium comprising a
database stored in a retrievable manner, the database including
sequence information as set forth in files:
[0072] "Transcripts_nucleotide_seqs_part1"
[0073] "Transcripts_nucleotide_seqs_part2"
[0074] "Transcripts_nucleotide_seqs_part3.new" and/or
[0075] "Protein.seqs"
[0076] provided in CD-ROMs 1 and/or 2 enclosed herewith, and
sequence ontological annotations in #GO_P, #GO_F, #GO_C annotation
categories in file "Summary_table.new" of CD-ROM3 enclosed
herewith.
[0077] According to still further features in the described
preferred embodiments the biomolecular sequences are selected from
the group consisting of polynucleotide sequences and polypeptide
sequences.
[0078] According to still further features in the described
preferred embodiments the homology range is between 99%-35%.
[0079] According to still further features in the described
preferred embodiments the analysis of the at least one biomolecular
sequence includes literature text mining.
[0080] According to still further features in the described
preferred embodiments the analysis of the at least one biomolecular
sequence includes cellular localization prediction.
[0081] According to still further features in the described
preferred embodiments the analysis of the at least one biomolecular
sequence includes homology analysis.
[0082] According to still further features in the described
preferred embodiments the at least one ontology is selected from
the group consisting of molecular biology, microbiology,
developmental biology, immunology, virology, biochemistry,
physiology, pharmacology, medicine, bioinformatics, cell biology,
endocrinology, structural biology, mathematics, chemistry,
medicine, plant sciences, neurology, genetics, zoology, ecology,
genomics, cheminformatics, computer sciences, statistics, physics
and artificial intelligence.
[0083] According to still further features in the described
preferred embodiments the ontology includes a subontology.
[0084] According to still further features in the described
preferred embodiments the method further comprising scoring the at
least one ontology assigned to a cluster of the plurality of
clusters according to: (i) a degree of homology characterizing the
cluster; and (ii) relevance of annotation to information obtained
from literature text mining.
[0085] According to still further features in the described
preferred embodiments the system further comprising scoring the at
least one ontology assigned to a cluster of the plurality of
clusters according to: (i) a degree of homology characterizing the
cluster; and (ii) relevance of annotation to information obtained
from literature text mining.
[0086] According to still further features in the described
preferred embodiments the method further comprising generating a
sequence profile to each cluster of the plurality of clusters
following step (b).
[0087] According to still further features in the described
preferred embodiments the system further comprising generating a
sequence profile to each cluster of the plurality of clusters
following step (b).
[0088] According to still a further aspect of the present invention
there is provided a computer readable storage medium, comprising a
database stored in a retrievable manner, the database including
biomolecular sequence information as set forth in files:
[0089] "Transcripts_nucleotide_seqs_part1"
[0090] "Transcripts_nucleotide_seqs_part2"
[0091] "Transcripts_nucleotide_seqs_part3.new" and/or
[0092] "Protein.seqs"
[0093] provided in CD-ROMs 1 and/or 2 enclosed herewith, and
biomolecular sequence annotations as set forth in file
"Summary_table.new" of CD-ROM 3 enclosed herewith.
[0094] According to still a further aspect of the present invention
there is provided a method of diagnosing colon cancer in a subject,
the method comprising identifying in the subject the presence or
absence of a biomolecular sequence selected from the group
consisting of SEQ ID NOs: 4, 39, 24-28, 35-38, 12 and 29-31 wherein
presence of the biomolecular sequence indicates colon cancer in the
subject.
[0095] According to still a further aspect of the present invention
there is provided method of diagnosing lung cancer in a subject,
the method comprising identifying in the subject the presence or
absence of a biomolecular sequence selected from the group
consisting of SEQ ID NOs: 15, 18, 21 and 32 wherein presence of the
biomolecular sequence indicates lung cancer in the subject.
[0096] According to still a further aspect of the present invention
there is provided a method of diagnosing Ewing sarcoma in a
subject, the method comprising identifying in the subject the
presence or absence of a biomolecular sequence as set forth in SEQ
ID NO: 7, wherein presence of the biomolecular sequence indicates
Ewing sarcoma in the subject.
[0097] According to still a further aspect of the present invention
there is provided a computer readable storage medium comprising
data stored in a retrievable manner, the data including sequence
information of differentially expressed biomolecular sequences as
set forth in files:
[0098] "Transcripts_nucleotide_seqs_part1"
[0099] "Transcripts_nucleotide_seqs_part2"
[0100] "Transcripts_nucleotide_seqs_part3.new" and
[0101] "Protein.seqs"
[0102] provided in CD-ROMs 1 and/or 2 enclosed herewith, and
sequence annotations as set forth in annotation categories "SA" and
"RA", in the file "Summary_table.new" of CD-ROM3 enclosed
herewith.
[0103] According to still a further aspect of the present invention
there is provided a computer readable storage medium comprising
data stored in a retrievable manner, the data including sequence
information of biomolecular sequences exhibiting gain of function
or loss of function as set forth in files:
"Transcripts_nucleotide_seqs_part1"
[0104] "Transcripts_nucleotide_seqs_part2"
[0105] "Transcripts_nucleotide_seqs_part3.new" and
[0106] "Protein.seqs"
[0107] provided in CD-ROMs 1 and/or 2 enclosed herewith, and
sequence annotations as set forth in annotation category "DN", in
the file "Summary_table.new" of CD-ROM3 enclosed herewith.
[0108] According to still further features in the described
preferred embodiments the database further includes information
pertaining to generation of the data and potential uses of the
data.
[0109] According to still further features in the described
preferred embodiments the medium is selected from the group
consisting of a magnetic storage medium, an optical storage medium
and an optico-magnetic storage medium.
[0110] According to still further features in the described
preferred embodiments the database further includes information
pertaining to gain and/or loss of function of the differentially
expressed mRNA splice variants or polypeptides encoded thereby.
[0111] The present invention successfully addresses the
shortcomings of the presently known configurations by providing
methods and systems useful for systematically annotating
biomolecular sequences.
[0112] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
methods and materials similar or equivalent to those described
herein can be used in the practice or testing of the present
invention, suitable methods and materials are described below. In
case of conflict, the patent specification, including definitions,
will control. In addition, the materials, methods, and examples are
illustrative only and not intended to be limiting.
BRIEF DESCRIPTION OF THE DRAWINGS
[0113] The invention is herein described, by way of example only,
with reference to the accompanying drawings. With specific
reference now to the drawings in detail, it is stressed that the
particulars shown are by way of example and for purposes of
illustrative discussion of the preferred embodiments of the present
invention only, and are presented in the cause of providing what is
believed to be the most useful and readily understood description
of the principles and conceptual aspects of the invention. In this
regard, no attempt is made to show structural details of the
invention in more detail than is necessary for a fundamental
understanding of the invention, the description taken with the
drawings making apparent to those skilled in the art how the
several forms of the invention may be embodied in practice.
[0114] In the drawings:
[0115] FIG. 1a illustrates a system designed and configured for
generating a database of annotated biomolecular sequences according
to the teachings of the present invention.
[0116] FIG. 1b illustrates a remote configuration of the system
described in FIG. 1a.
[0117] FIG. 2 illustrates a gastrointestinal tissue hierarchy
dendogram generated according to the teachings of the present
invention.
[0118] FIG. 3 is a scheme illustrating multiple alignment of
alternatively spliced expressed sequences with a genomic sequence
including 3 exons (A, B and C) and two introns. Two alternative
splicing events are described; One from the donor site, which
involves an AB junction, between donor and proximal acceptor and an
AC junction, between donor and distal acceptor; A Second
alternative splicing event is described from the acceptor site,
which involves AC junction, between distal donor and acceptor and
BC junction, between proximal donor and acceptor.
[0119] FIG. 4 is a tissue hierarchy dendogram generated according
to the teachings of the present invention. The higher annotation
levels are marked with a single number, i.e., 1-16. The lower
annotation levels are marked within the relevant category as
one-four numbers after the point (e.g. 4. genitourinary system; 4.2
genital system; 4.2.1 women genital system; 4.2.1.1 cervix).
[0120] FIG. 5 is a graph illustrating a correlation between LOD
scores of textual information analysis and accuracy of ontological
annotation prediction. Results are based on self-validation
studies. Only predictions made with LOD scores above 2 were
evaluated and used for GO annotation process.
[0121] FIGS. 6a-c are histograms showing the distribution of
proteins (closed squares) and contigs (opened squares) from Ensembl
version 1.0.0 in the major nodes of three GO categories--cellular
component (FIG. 6a), molecular function (FIG. 6b), and biological
process (FIG. 6c).
[0122] FIG. 7 illustrates results from RT-PCR analysis of the
expression pattern of the AA535072 (SEQ ID NO: 39) colorectal
cancer-specific transcript. The following cell and tissue samples
were tested: B--colon carcinoma cell line SW480 (ATCC-228);
C--colon carcinoma cell line SW620 (ATCC-227); D--colon carcinoma
cell line colo-205 (ATCC-222). Colon normal tissue indicates a pool
of 10 different samples, (Biochain, cat no A406029). The
adenocarcinoma sample represents a pool of spleen, lung, stomach
and kidney adenocarcinomas, obtained from patients. Each of the
tissues (i.e., colon carcinoma samples Duke's A-D; and normal
muscle, pancreas, breast, liver, testis, lung, heart, ovary,
thymus, spleen kidney, placenta, stomach, brain) were obtained from
3-6 patients and pooled.
[0123] FIG. 8 illustrates results from RT-PCR analysis of the
expression pattern of the AA513157 (SEQ ID NO: 7) Ewing sarcoma
specific transcript. The (+) or (-) symbols, indicate presence or
absence of reverse transcriptase in the reaction mixture. A
molecular weight standard is indicated by M. Tissue samples (i.e.,
Ewing sarcoma samples, spleen adenocarcinoma, brain, prostate and
thymus) were obtained from patients. The Ln-CAP human prostatic
adenocarcinoma cell line was obtained from the ATCC (Manassas,
Va.).
[0124] FIG. 9 is an autoradiogram of a northern blot analysis
depicting tissue distribution and expression levels of AA513157
(SEQ ID NO: 7) Ewing sarcoma specific transcript. Arrows indicate
the molecular weight of 28S and 18S ribosomal RNA subunits. The
indicated tissue samples were obtained from patients and
SK-ES-1-Ewing sarcoma cell-line was obtained from the ATCC
(CRL-1427).
[0125] FIG. 10 illustrates results from semi quantitative RT-PCR
analysis of the expression pattern of the AA469088 (SEQ ID NO: 40)
colorectal specific transcript. Colon normal was obtained from
Biochain, cat no: A406029. The adenocarcinoma sample represents a
pool of spleen, lung, stomach and kidney adenocarcinomas, obtained
from patients. Each of all other tissues (i.e., colon carcinoma
samples Duke's A-D; and normal thymus, spleen, kidney, placenta,
stomach, brain) were obtained from 3-6 patients and pooled.
[0126] FIG. 11 is a histogram depicting Real-Time RT-PCR
quantification of copy number, of a lung specific transcript, (SEQ
ID NO: 15). Amplification products obtained from the following
tissues were quantified; normal salivary gland from total RNA
(Clontech, cat no: .delta.4110-1); lung normal from pooled adult
total RNA (BioChain, cat no:A409363); lung tumor squamos cell
carcinoma (Clontech, cat no: 64013-1); lung tumor squamos cell
carcinoma (BioChain, cat no:A409017); pooled lung tumor squamos
cell carcinoma (BioChain, cat no: A411075); moderately
differentiated squamos cell carcinoma (BioChain, cat no: A409091);
well differentiated squamos cell carcinoma (BioChain, cat no:
A408175); pooled adenocarcinoma (BioChain, cat no: A411076);
moderately differentiated alveolus cell carcinoma (BioChain, cat
no: A409089); non-small cell lung carcinoma cell line H1299; The
following normal and tumor samples were obtained from patients:
normal lung (internal number-CG-207N), lung carcinoma (internal
number-CG-72), squamos cell carcinoma (internal number-CG-196),
squamos cell carcinoma (internal number-CG-207), lung
adenocarcinoma (internal number-CG-120), lung adenocarcinoma
(internal number-CG-160). Copy number was normalized to the levels
of expression of the housekeeping genes Proteasome 26S subunit
(dark columns) and GADPH (bright columns).
[0127] FIG. 12 is a histogram depicting Real-Time RT-PCR
quantification of copy number, of the lung specific transcript (SEQ
ID NO: 32). Amplification products obtained from the following
tissues and cell-lines were quantified; lung normal from pooled
adult total RNA (BioChain, cat no:A409363); lung tumor squamos cell
carcinoma (Clontech, cat no: 64013-1); lung tumor squamos cell
carcinoma (BioChain, cat no:A409017); pooled lung tumor squamos
cell carcinoma (BioChain, cat no: A411075); moderately
differentiated squamos cell carcinoma (BioChain, cat no: A409091);
well differentiated squamos cell carcinoma (BioChain, cat no:
A408175); pooled adenocarcinoma (BioChain, cat no: A411076);
moderately differentiated alveolus cell carcinoma (BioChain, cat
no: A409089); non-small cell lung carcinoma cell line H1299; The
following normal and tumor samples were obtained from patients:
normal lung (internal number-CG-207N), lung carcinoma (internal
number-CG-72), squamos cell carcinoma (internal number-CG-196),
squamos cell carcinoma (internal number-CG-207), lung
adenocarcinoma (internal number-CG-120), lung adenocarcinoma
(internal number-CG-160). Copy number was normalized to the levels
of expression of the housekeeping genes Proteasome 26S subunit
(dark columns) and GADPH (bright columns).
[0128] FIG. 13 is a histogram depicting Real-Time RT-PCR
quantification of copy number, of the lung specific transcript (SEQ
ID NO: 18). Amplification products obtained from the following
tissues and cell-lines were quantified; lung normal from pooled
adult total RNA (BioChain, cat no:A409363); lung tumor squamos cell
carcinoma (Clontech, cat no: .delta.4013-1); lung tumor squamos
cell carcinoma (BioChain, cat no:A409017); pooled lung tumor
squamos cell carcinoma (BioChain, cat no: A411075); moderately
differentiated squamos cell carcinoma (BioChain, cat no: A409091);
well differentiated squamos cell carcinoma (BioChain, cat no:
A408175); pooled adenocarcinoma (BioChain, cat no: A411076);
moderately differentiated alveolus cell carcinoma (BioChain, cat
no: A409089); non-small cell lung carcinoma cell line H1299; The
following normal and tumor samples were obtained from patients:
normal lung (internal number-CG-207N), lung carcinoma (internal
number-CG-72), squamos cell carcinoma (internal number-CG-196),
squamos cell carcinoma (internal number-CG-207), lung
adenocarcinoma (internal number-CG-120), lung adenocarcinoma
(internal number-CG-160). Copy number was normalized to the levels
of expression of the housekeeping genes Proteasome 26S subunit
(dark columns) and GADPH (bright columns).
[0129] FIG. 14 is a histogram depicting Real-Time RT-PCR
quantification of copy number, of a lung specific transcript (SEQ
ID NO: 21). Amplification products obtained from the following
tissues and cell-lines were quantified; Samples 1-6 are commercial
normal lung samples (BioChain, CDP-061010; A503205, A503384,
A503385, A503204, A503206, A409363). Sample 7 is lung well
differentiated adenocarcinoma (BioChain, CDP-064004A; A504117).
Sample 8 is lung moderately differentiated adenocarcinoma
(BioChain, CDP-064004A; A504119). Sample 9 is lung moderately to
poorly differentiated adenocarcinoma (BioChain, CDP-064004A;
A504116). Sample 10 is lung well differentiated adenocarcinoma
(BioChain, CDP-064004A; A504118). Samples 11-16 are lung
adenocarcinoma samples obtained from patients. Sample 17 is lung
moderately differentiated squamous cell carcinoma (BioChain,
CDP-064004B; A503187). Sample 18 is lung squamous cell carcinoma
(BioChain, CDP-064004B; A503386). Samples 20-21 are lung moderately
differentiated squamous cell carcinoma (BioChain, CDP-064004B;
A503387, A503383). Sample 22 is lung squamous cell carcinoma pooled
(BioChain, CDP-064004B; A411075). Samples 23-26 and sample 31 are
lung squamous cell carcinoma obtained from patients. Sample 27 is
lung squamous cell carcinoma (Clontech, 64013-1). Sample 28 is lung
squamous cell carcinoma (BioChain, A409017). Sample 29 is lung
moderately differentiated squamous cell carcinoma (BioChain,
CDP-064004B; A409091). Sample 30 is lung well differentiated
squamous cell carcinoma (BioChain, CDP-064004B; A408175). Samples
32-35 are lung small cell carcinoma (BioChain, CDP-064004D;
A504115, A501390, A501389, A501391). Sample 36-37 are lung large
cell carcinoma (BioChain, CDP-064004C; A504113, A504114). Sample 38
is lung moderately differentiated alveolus cell carcinoma
(BioChain, A409089). Sample 39 is lung carcinoma obtained from
patient. Sample 40 is lung H1299 non-small cell carcinoma cell
line. Sample 41 is normal salivary gland sample (Clontech,
64110-1). Copy number was normalized to the levels of expression of
the housekeeping genes Proteasome 26S subunit (dark columns) and
GADPH (bright columns).
DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0130] The present invention is of methods and systems, which can
be used for annotating biomolecular sequences. Specifically, the
present invention can be used to identify and annotate
differentially expressed biomolecular sequences, such as
differentially expressed alternatively spliced sequences.
[0131] The principles and operation of the present invention may be
better understood with reference to the drawings and accompanying
descriptions.
[0132] Before explaining at least one embodiment of the invention
in detail, it is to be understood that the invention is not limited
in its application to the details of construction and the
arrangement of the components set forth in the following
description or illustrated in the drawings. The invention is
capable of other embodiments or of being practiced or carried out
in various ways. Also, it is to be understood that the phraseology
and terminology employed herein is for the purpose of description
and should not be regarded as limiting.
TERMINOLOGY
[0133] As used herein, the term "oligonucleotide" refers to a
single stranded or double stranded oligomer or polymer of
ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics
thereof. This term includes oligonucleotides composed of
naturally-occurring bases, sugars and covalent internucleoside
linkages (e.g., backbone) as well as oligonucleotides having
non-naturally-occurring portions which function similarly. Such
modified or substituted oligonucleotides are often preferred over
native forms because of desirable properties such as, for example,
enhanced cellular uptake, enhanced affinity for nucleic acid target
and increased stability in the presence of nucleases.
[0134] The phrase "complementary DNA" (cDNA) refers to the double
stranded or single stranded DNA molecule, which is synthesized from
a messenger RNA template.
[0135] The term "contig" refers to a series of overlapping
sequences with sufficient identity to create a longer contiguous
sequence. A plurality of contigs may form a cluster. Clusters are
generally formed based upon a specified degree of homology and
overlap (e.g., a stringency). The different contigs in a cluster do
not typically represent the entire sequence of the gene, rather the
gene may comprise one or more unknown intervening sequences between
the defined contigs.
[0136] The term "cluster" refers to a nucleic acid sequence cluster
or a protein sequence cluster. The former refers to a group of
nucleic acid sequences which share a requisite level of homology
and or other similar traits according to a given clustering
criterion; and the latter refers to a group of protein sequences
which share a requisite level of homology and/or other similar
traits according to a given clustering criterion.
[0137] A process and/or method to group nucleic acid or protein
sequences as such is referred to as clustering, which is typically
performed by a clustering (i.e., alignment) application program
implementing a cluster algorithm.
[0138] As used herein the phrase "biomolecular sequences" refers to
amino acid sequences (i.e., peptides, polypeptides) and nucleic
acid sequences, which include but are not limited to genomic
sequences, expressed sequence tags, contigs, complementary DNA
(cDNA) sequences, pre-messenger RNA (mRNA) sequences, and mRNA
sequences.
[0139] With the presentation of the human genome working draft,
data analysis rather than data collection presents the biggest
challenge to biologists. Efforts to ascribe biological meaning to
genomic data, include the development of advanced wet laboratorial
techniques as well as computerized algorithms. While the former are
limited due to inaccuracy, time consumption, labor intensiveness
and costs the latter are still unfeasible due to the poor
organization of on hand sequence databases as well as the composite
nature of biological data.
[0140] As is further described hereinbelow, the present inventors
have developed a computer-based approach for the functional,
spatial and temporal analysis of biological data. The present
methodology generates comprehensive databases which greatly
facilitate the use of available genetic information in both
research and commercial applications.
[0141] As is further described hereinunder, the present invention
encompasses several novel approaches for annotating biomolecular
sequences.
[0142] "Annotating" refers to the act of discovering and/or
assigning an annotation (i.e., critical or explanatory notes or
comment) to a biomolecular sequence of the present invention.
[0143] The term "annotation" refers to a functional or structural
description of a sequence, which may include identifying attributes
such as locus name, keywords, Medline references, cloning data,
information of coding region, regulatory regions, catalytic
regions, name of encoded protein, subcellular localization of the
encoded protein, protein hydrophobicity, protein function,
mechanism of protein function, information on metabolic pathways,
regulatory pathways, protein-protein interactions and tissue
expression profile.
The Ontological Annotation Approach
[0144] An ontology refers to the body of knowledge in a specific
knowledge domain or discipline such as molecular biology,
microbiology, immunology, virology, plant sciences, pharmaceutical
chemistry, medicine, neurology, endocrinology, genetics, ecology,
genomics, proteomics, cheminformatics, pharmacogenomics,
bioinformatics, computer sciences, statistics, mathematics,
chemistry, physics and artificial intelligence.
[0145] An ontology includes domain-specific concepts--referred to
herein as sub-ontologies. A sub-ontology may be classified into
smaller and narrower categories.
[0146] The ontological annotation approach of the present invention
is effected as follows.
[0147] First, biomolecular sequences are computationally clustered
according to a progressive homology range, thereby generating a
plurality of clusters each being of a predetermined homology of the
homology range.
[0148] Progressive homology according to this aspect of the present
invention is used to identify meaningful homologies among
biomolecular sequences and thereby assign new ontological
annotations to sequences, which share requisite levels of
homologies. Essentially, a biomolecular sequence is assigned to a
specific cluster if displays a predetermined homology to at least
one member of the cluster (i.e., single linkage). As used herein
"progressive homology range" refers to a range of homology
thresholds, which progress via predetermined increments from a low
homology level (e.g. 35%) to a high homology level (e.g. 99%).
Further description of a progressive homology range is provided in
the Examples section which follows.
[0149] Following generation of clusters, one or more ontologies are
assigned to each cluster. Ontologies are derived from an annotation
preassociated with at least one biomolecular sequence of each
cluster; and/or generated by analyzing (e.g., text-mining) at least
one biomolecular sequence of each cluster thereby annotating
biomolecular sequences.
[0150] Any annotational information identified and/or generated
according to the teachings of the present invention can be stored
in a database which can be generated by a suitable computing
platform.
[0151] Thus, the method according to this aspect of the present
invention provides a novel approach for annotating biomolecular
sequences even on a scale of a genome, a transcriptom (i.e., the
repertoire of all messenger RNA molecules transcribed from a
genome) or a proteom (i.e., the repertoire of all proteins
translated from messenger RNA molecules). This enables
transcriptome-wise comparative analyses (e.g., analyzing
chromosomal distribution of human genes) and cross-transcriptome
comparative studies (e.g., comparing expressed data across species)
both of which may involve various subontologies such as molecular
function, biological process and cellular localization.
[0152] Biomolecular sequences which can be used as working material
for the annotating process according to this aspect of the present
invention can be obtained from a biomolecular sequence database.
Such a database can include protein sequences and/or nucleic acid
sequences derived from libraries of expressed messenger RNA [i.e.,
expressed sequence tags (EST)], cDNA clones, contigs, pre-mRNA,
which are prepared from specific tissues or cell-lines or from
whole organisms.
[0153] This database can be a pre-existing publicly available
database [i.e., GenBank database maintained by the National Center
for Biotechnology Information (NCBI), part of the National Library
of Medicine, and the TIGR is database maintained by The Institute
for Genomic Research, Blocks database maintained by the Fred
Hutchinson Cancer Research Center, Swiss-Prot site maintained by
the University of Geneva and GenPept maintained by NCBI and
including public protein-sequence database which contains all the
protein databases from GenBank,] or private databases (i.e., the
LifeSeq..TM. and PathoSeq..TM. databases available from Incyte
Pharmaceuticals, Inc. of Palo Alto, Calif.). Optionally,
biomolecular sequences of the present invention can be assembled
from a number of pre-existing databases as described in Example 5
of the Examples section.
[0154] Alternatively, the database can be generated from sequence
libraries including, but not limited to, cDNA libraries, EST
libraries, mRNA libraries and the like.
[0155] Construction and sequencing of a cDNA library is one
approach for generating a database of expressed mRNA sequences.
cDNA library construction is typically effected by tissue or cell
sample preparation, RNA isolation, cDNA sequence construction and
sequencing.
[0156] It will be appreciated that such cDNA libraries can be
constructed from RNA isolated from whole organisms, tissues, tissue
sections, or cell populations. Libraries can also be constructed
from a tissue reflecting a particular pathological or physiological
state.
[0157] Once raw sequence data is obtained, biomolecular sequences
are computationally clustered according to a progressive homology
range using one or more clustering algorithms. To obtain
progressive clusters, the biomolecular sequences are clustered
through single linkage. Namely, a biomolecular sequence belongs to
a cluster if this sequence shares a sequence homology above a
certain threshold to one member of the cluster. The threshold
increments from a high homology level to a low homology level with
a predetermined resolution. Preferably the homology range is
selected from 99%-35%.
[0158] Computational clustering can be effected using any
commercially available alignment software including the local
homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482
(1981), using the homology alignment algorithm of Needleman &
Wunsch, J. Mol. Biol. 48:443 (1970), using the search for
similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci.
USA 85:2444 (1988), or using computerized implementations of
algorithms GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin
Genetics Software Package Release 7.0, Genetics Computer Group, 575
Science Dr., Madison, Wis.
[0159] Another example of an algorithm which is suitable for
sequence alignment is the BLAST algorithm, which is described in
Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for
performing BLAST analyses is publicly available through the website
of the National Center for Biotechnology Information.
[0160] Since the present invention requires processing of large
amounts of data, sequence alignment is preferably effected using
assembly software.
[0161] A number of commonly used computer software fragment read
assemblers capable of forming clusters of expressed sequences, and
aligning members of the cluster (individually or as an assembled
contig) with other sequences (e.g., genomic database) are now
available. These packages include but are not limited to, The TIGR
Assembler [Sutton G. et al. (1995) Genome Science and Technology
1:9-19], GAP [Bonfield J K. et al. (1995) Nucleic Acids Res.
23:4992-4999], CAP2 [Huang X. et al. (1996) Genomics 33:21-31], the
Genome Construction Manager [Laurence C B. Et al. (1994) Genomics
23:192-201], Bio Image Sequence Assembly Manager, SeqMan [Swindell
S R. and Plasterer J N. (1997) Methods Mol. Biol. 70:75-89], and
LEADS and GenCarta (Compugen Ltd. Israel).
[0162] It will be appreciated that since applying sequence homology
analysis on large number of sequences is computationally intensive,
local alignment (i.e., the alignment of portions of protein
sequences) is preferably effected prior to global alignment
(alignment of protein sequences along their entire length), as
described in Example 6 of the Examples section.
[0163] Once progressive clusters are formed, one or more
ontological annotations (i.e., assigning an ontology) are assigned
to each cluster.
[0164] Systematic and standardized ontological nomenclature is
preferably used. Such nomenclature (i.e., keywords) can be obtained
from several sources. For example, ontological annotations derived
from three main ontologies: molecular function, biological process
and cellular component are available from the website of the Gene
Ontology Consortium.
[0165] Alternatively a list of homogenized ontological nomenclature
can be obtained from the website of Acromed--a computer generated
database of biomedical acronyms and the associated long forms
extracted from the recent Medline abstracts (available at the
website of the Expert Protein Analysis System-ExPASy, Swiss
Institute for Bioinformatics).
[0166] Optionally, various conversion tables which link Enzyme
Commission
[0167] Ontological annotations can also be extracted from sequence
associated Medical subject heading (MeSH) terms which are assigned
to published papers.
[0168] Additional information on text mining is provided in Example
7 of the Examples section and is disclosed in "Mining Text Using
Keyword Distributions," Ronen Feldman, Ido Dagan, and Haym Hirsh,
Proceedings of the 1995Workshop on Knowledge Discovery in
Databases, "Finding Associations in Collections of Text," Ronen
Feldman and Haym Hirsh, Machine Learning and Data Mining: Methods
and Applications, edited by R. S. Michalski, I. Bratko, and M.
Kubat, John Wiley & Sons, Ltd., 1997 "Technology Text Mining,
Turning Information Into Knowledge: A White Paper from IBM," edited
by Daniel Tkach, Feb. 17, 1998, each of which is fully incorporated
herein by reference.
[0169] It will be appreciated that text mining may be performed, in
this and other embodiments of the present invention, for the text
terms extracted from the definitions of gene or protein sequence
records, retrievable from databases such as GenBank and Swiss-Prot
and title line, abstract of scientific papers, retrievable from
Medline database (e.g., PubMed at the NCBI website).
[0170] Computer-dedicated software for biological text analysis is
available from Expert Protein Analysis System ExPASy website of the
Swiss Institute of Bioinformatics. Examples include, but are not
limited to, MedMiner--A software system which extracts and
organizes relevant sentences in the literature based on a gene,
gene-gene or gene-drug query; Protein Annotator's Assistant--A
software system which assists protein annotators in the task of
assigning functions to newly sequenced proteins; and XplorMed--A
software system which explores a set of abstracts derived from a
bibliographic search in MEDLINE.
[0171] Alternatively, assignment of ontological annotations may be
effected by analyzing molecular, cellular and/or functional traits
of the biomolecular sequences. Prediction of cellular localization
may be done using any computer dedicated software. For example
prediction of cellular localization can be done using the ProLoc
(Einat Hazkani-Covo, Erez Levanon, Galit Rotman, Dan Graur and Amit
Novik, a manuscript submitted for publication) computational
platform. This software is capable of predicting the cellular
localization of polypeptide sequences based on inherent features,
including specific localization signatures, protein domains, amino
acid composition, pI and protein length. Other examples for
cellular localization prediction softwares include
PSORT--Prediction of protein sorting signals and localization sites
and TargetP--Prediction of subcellular location, both available
from the from Expert Protein Analysis System ExPASy website of the
Swiss Institute of Bioinformatics.
[0172] Prediction of functional annotations may be effected by
motif analysis of the biomolecular sequences of the present
invention. Thus for example, by implementing any motif analysis
software, which is based on protein homology (see for example,
genome.net at the Kyoto University Bioinformatics Center website)
it is possible to predict functional motifs of DNA sequences
including repeats, promoter sequences and CpG islands and of
encoded proteins such as zinc finger and leucine zipper.
[0173] Due to the progressive nature of the clusters of the present
invention, ontology assignment starts at the highest level of
homology. Any biomolecular sequence in the cluster, which shares
identical level of homology compared to an ontologically annotated
protein in the cluster is assigned the same ontological annotation.
This procedure progresses from the highest level of homology to a
lower threshold level with a predetermined increment resolution.
Newly discovered homologies enable assignment of existing
ontological annotations to biomolecular sequences sharing
homologous sequences and being previously unannotated or partially
annotated (see Examples 5-9 of the Examples section).
[0174] Once assignment of an annotation is effected, annotated
clusters are disassembled resulting in annotation of each
biomolecular sequence of the cluster.
[0175] Such annotated biomolecular sequences are then tested for
false annotation. This is effected using the following scoring
parameters:
[0176] (i) A degree of homology characterizing the progressive
cluster--accuracy of the annotation directly correlates with the
homology level used for the annotation process (see Examples 7-9 of
the Examples section).
[0177] (ii) Relevance of annotation to information obtained from
literature text mining--each assigned ontological annotation which
results from literature text mining or functional or cellular
prediction is assessed using scoring parameters such as LOD score
(For further details see Example 7 of the Examples section).
[0178] The present invention also enables the use of the homologies
identified according to the teachings of the present invention to
annotate more sensitively and rapidly a query sequence. Essentially
this involves building a sequence profile for each annotated
cluster. A profile enables scoring of a biomolecular sequence
according to functional domains along a sequence and generally
makes searches more sensitive. Essentially, clustered sequences are
also tested for relevance to the cluster based upon shared
functional domains and other characteristic sequence features.
[0179] Ontologically annotated biomolecular sequences are stored in
a database for further use. Additional information on generation
and contents of such databases is provided hereinunder.
[0180] Such a database can be used to query functional domains and
sequences comprising thereof. Alternatively, the database can be
used to query a sequence, and retrieve the compatible
annotations.
[0181] Although the present methodology can be effected using prior
art systems modified for such purposes, due to the large amounts of
data processed and the vast amounts of processing needed, the
present methodology is preferably effected using a dedicated
computational system.
[0182] Thus, according to another aspect of the present invention
and as illustrated in FIGS. 1a-b, there is provided a system for
generating a database of annotated biomolecular sequences.
[0183] System 10 includes a processing unit 12, which executes a
software application designed and configured for annotating
biomolecular sequences, as described hereinabove. System 10 further
serves for storing biomolecular sequence information and
annotations in a retrievable/searchable database 18. Database 18
further includes information pertaining to database generation.
[0184] System 10 may also include a user interface 14 (e.g., a
keyboard and/or a mouse, monitor) for inputting database or
database related information, and for providing database
information to a user.
[0185] System 10 of the present invention may be any computing
platform known in the art including but not limited to a personal
computer, a work station, a mainframe and the like.
[0186] Preferably, database 18 is stored on a computer readable
media such as a magnetic optico-magnetic or optical disk.
[0187] System 10 of the present invention may be used by a user to
query the stored database of annotations and sequence information
to retrieve biomolecular sequences stored therein according to
inputted annotations or to retrieve annotations according to a
biomolecular sequence query.
[0188] It will be appreciated that the connection between user
interface 14 and processing unit 12 is bi-directional. Likewise,
processing unit 12 and database 18 also share a two-way
communication channel, wherein processing unit 12 may also take
input from database 18 in performing annotations and iterative
annotations. Further, user interface 14 is linked directly to
database 18, such a user may dispatch queries to database 18 and
retrieve information stored therein. As such, user interface 14
allows a user to compile queries, send instructions, view querying
results and performing specific analyses on the results as
needed.
[0189] In performing ontological annotations, processing unit 12
may take input from one or more application modules 16. Application
module 16 performs a specific operation and produced a relevant
annotative input for processing unit 12. For example, application
module 16 may perform cellular localization analysis on a
biomolecular sequence query, thereby determining the cellular
localization of the encoded protein. Such a functional annotation
is then input to and used by processing unit 12. Examples for
application software for cellular localization prediction are
provided hereinabove.
[0190] System 10 of the present invention may also be connected to
one or more external databases 20. External database 20 is linked
to processing unit 12 in a bi-directional manner, similar to the
connection between database 18 and processing unit 12. External
database 20 may include any background information and/or sequence
information that pertains to the biomolecular sequence query.
External database 20 may be a proprietary database or a publicly
available database which is accessible through a public network
such as the Internet. External database 20 may feed relevant
information to processing unit 12 as it effects iterative
ontological annotation. External database 20 may also receive and
store ontological annotations generated by processing unit 12. In
this case external database 20 may interact with other components
of system 10 like database 18.
[0191] It will be appreciated that the databases and application
modules of system 10 can be directly connected with processing unit
12 and/or user interface 14 as is illustrated in FIG. 1a, or such a
connection can be achieved via a network 22, as is illustrated in
FIG. 1b.
[0192] Network 22 may be a private network (e.g., a local area
network), a secured network, or a public network (such as the
Internet), or a combination of public and private and/or secured
networks.
[0193] Thus, the present invention provides a well characterized
approach for the systemic annotation of biomolecular sequences. The
use of text information analysis, annotation scoring system and
robust sequence clustering procedure enables for the first time the
creation of the best possible annotations and assignment thereof to
a vast number of biomolecular sequences sharing homologous
sequences. The availability of ontological annotations for a
significant number of biomolecular sequences from different species
can provide a comprehensive account of sequence, structural and
functional information pertaining to the biomolecular sequences of
interest.
The Hierarchical Annotation Approach
[0194] "Hierarchical annotation" refers to any ontology and
subontology, which can be hierarchically ordered. Examples include
but are not limited to a tissue expression hierarchy, a
developmental expression hierarchy, a pathological expression
hierarchy, a cellular expression hierarchy, an intracellular
expression hierarchy, a taxonomical hierarchy, a functional
hierarchy and so forth.
[0195] According to another aspect of the present invention there
is provided a method of annotating biomolecular sequences according
to a hierarchy of interest. The method is effected as follows.
[0196] Each of the multiple nodes of the dendrogram is annotated by
at least one keyword describing the node, and enabling literature
and database text mining, as is further described hereinunder. A
list of keywords can be obtained from the website of the Gene
Ontology Consortium; measures are taken to include as many
keywords, and to include keywords which might be out of date. For
example, for tissue annotation (see FIG. 4), a hierarchy was built
using all available tissue/libraries sources available in the
GenBank, while considering the following parameters: ignoring
GenBank synonyms, building anatomical hierarchies, enabling
flexible distinction between tissue types (normal versus pathology)
and tissue classification levels (organs, systems, cell types,
etc.).
[0197] It will be appreciated that the dendrogram of the present
invention can be illustrated as a graph, a list, a map or a matrix
or any other graphic or textual organization, which can describe a
dendrogram. An example of a dendrogram illustrating the
gastrointestinal tissue hierarchy is provided in FIG. 2.
[0198] In a second step, each of the biomolecular sequences is
assigned to at least one specific node of the dendrogram.
[0199] The biomolecular sequences according to this aspect of the
present invention can be annotated biomolecular sequences,
unannotated biomolecular sequences or partially annotated
biomolecular sequences.
[0200] Annotated biomolecular sequences can be retrieved from
pre-existing annotated databases as described hereinabove.
[0201] For example, in GenBank, relevant annotational information
is provided in the definition and keyword fields. In this case,
classification of the annotated biomolecular sequences to the
dendrogram nodes is directly effected. A search for suitable
annotated biomolecular sequences is performed using a set of
keywords which are designed to classify the biomolecular sequences
to the hierarchy (i.e., same keywords that populate the
dendrogram)
[0202] In cases where the biomolecular sequences are unannotated or
partially annotated, extraction of additional annotational
information is effected prior to classification to dendrogram
nodes. This can be effected by sequence alignment, as described
hereinabove. Alternatively, annotational information can be
predicted from structural studies. Where needed, nucleic acid
sequences can be transformed to amino acid sequences to thereby
enable more accurate annotational prediction.
[0203] Finally, each of the assigned biomolecular sequences is
recursively classified to nodes hierarchically higher than the
specific nodes, such that the root node of the dendrogram
encompasses the full biomolecular sequence set, which can be
classified according to a certain hierarchy, while the offspring of
any node represent a partitioning of the parent set.
[0204] For example, a biomolecular sequence found to be
specifically expressed in "rhabdomyosarcoma", will be classified
also to a higher hierarchy level, which is "sarcoma", and then to
"Mesenchimal cell tumors" and finally to a highest hierarchy level
"Tumor". In another example, a sequence found to be differentially
expressed in endometrium cells, will be classified also to a higher
hierarchy level, which is "uterus", and then to "women genital
system" and to "genital system" and finally to a highest hierarchy
level "genitourinary system". The retrieval can be performed
according to each one of the requested levels.
[0205] Since annotation of publicly available databases is at times
unreliable, newly annotated biomolecular sequences are confirmed
using computational or laboratory approaches as is further
described hereinbelow.
[0206] It will be appreciated that once temporal or spatial
annotations of sequences are established using the teachings of the
present invention, it is possible to identify those sequences,
which are differentially expressed (i.e., exhibit spatial or
temporal pattern of expression in diverse cells or tissues). Such
sequences are assigned to only a portion of the nodes, which
constitute the hierarchical dendrogram.
[0207] Changes in gene expression are important determinants of
normal cellular physiology, including cell cycle regulation,
differentiation and development, and they directly contribute to
abnormal cellular physiology, including developmental anomalies,
aberrant programs of differentiation and cancer. Accordingly, the
identification, cloning and characterization of differentially
expressed genes can provide relevant and important insights into
the molecular determinants of processes such as growth,
development, aging, differentiation and cancer. Additionally,
identification of such genes can be useful in development of new
drugs and diagnostic methods for treating or preventing the
occurrence of such diseases.
[0208] Newly annotated sequences identified according to the
present invention are tested under physiological conditions (i.e.,
temperature, pH, ionic strength, viscosity, and like biochemical
parameters which are compatible with a viable organism, and/or
which typically exist intracellularly in a viable cultured yeast
cell or mammalian cell). This can be effected using various
laboratory approaches such as, for example, FISH analysis, PCR,
RT-PCR, southern blotting, northern blotting, electrophoresis and
the like (see Examples 13-20 of the Examples section) or more
elaborate approaches which are detailed in the Background
section.
[0209] It will be appreciated that true involvement of
differentially expressed genes in a biological process is better
confirmed using an appropriate cell or animal model, as further
described hereinunder.
[0210] Although the present methodology can be effected using prior
art systems modified for such purposes, due to the large amounts of
data processed and the vast amounts of processing needed, the
present methodology is preferably effected using a dedicated
computational system.
[0211] Such a system is described hereinabove. The system includes
a processing unit which executes a software application designed
and configured for hierarchically annotating biomolecular sequences
as described hereinabove. The system further serves for storing
biomolecular sequence information and annotations in a
retrievable/searchable database.
[0212] The hierarchical annotation approach enables to assign an
appropriate annotation level even in cases where expression is not
restricted to a specific tissue type or cell type. For example,
different expressed sequences of a single contig which are
annotated as being expressed in several different tissue types of a
single specific organ or a specific system, are also annotated by
the present invention to a higher hierarchy level thus denoting
association with the specific organ or system. In such cases using
keywords alone would not efficiently identify differentially
expressed sequences. Thus for example, a sequence found to be
expressed in sarcoma, Ewing sarcoma tumors, pnet, rhabdomyosarcoma,
liposarcoma and mesenchymal cell tumors, can not be assigned to
specific sarcomas, but still can be annotated as mesenchymal cell
tumor specific. Using this hierarchical annotation approach in
combination with advanced sequence clustering and assembly
algorithms, capable of predicting alternative splicing, may
facilitate a simple and rapid identification of gene expression
patterns.
Annotation of Differentially Expressed Alternatively Spliced
Sequences
[0213] Although numerous methods have been developed to identify
differentially expressed genes, none of these addressed splice
variants, which occur in over 50% of human genes. Given the common
sequence features of splice variants it is very difficult to
identify splice variants which expression is differential, using
prior art methodologies. Therefore assigning unique sequence
features to differentially expessed splice variants may have an
important impact to the understanding of disease development and
may serve as valuable markers to various pathologies.
[0214] Thus, according to another aspect of the present invention
there is provided a method of identifying sequence features unique
to differentially expressed mRNA splice variants. The method is
effected as follows.
[0215] First, unique sequence features are computationally
identified in identified splice variants of alternatively spliced
expressed sequences.
[0216] As used herein the phrase "splice variants" refers to
naturally occurring nucleic acid sequences and proteins encoded
therefrom which are products of alternative splicing. Alternative
splicing refers to intron inclusion, exon exclusion, or any
addition or deletion of terminal sequences, which results in
sequence dissimilarities between the splice variant sequence and
the wild-type sequence.
[0217] Although most alternatively spliced variants result from
alternative exon usage, some result from the retention of introns
not spliced-out in the intermediate stage of RNA transcript
processing.
[0218] As used herein the phrase "unique sequence features" refers
to donor/acceptor concatenations (i.e., exon-exon junctions),
intron sequences, alternative exon sequences and alternative
polyadenylation sequences.
[0219] Alternatively spliced expressed sequences of this aspect of
the present invention, can be retrieved from numerous publicly
available databases. Examples include but are not limited to
ASDB--an alternative splicing database generated using GenBank and
Swiss-Prot annotations, AsMamDB--a database of alternative splices
in human, mouse and rat, Alternative splicing database--a database
of alternative splices from literature, Yeast intron
database--Database of intron in yeast, available at the University
of California at Santa Cruz website, The Intronerator--alternative
splicing in C. elegans based on analysis of EST data available at
the University of California at Santa Cruz website, ISIS--Intron
Sequence Information System including a section of human
alternative splices, available at the University of Queensland,
Australia, website and TAP--Transcript Assembly Program result of
alternative splicing available at the website of Washington
University at St. Louis and HASDB--database of alternative splices
detected in human EST data.
[0220] Additionally, alternative splicing sequence data utilized by
this aspect of the present invention can be obtained by any of the
following bioinformatical approaches.
[0221] Genomically aligned ESTs--the method identifies ESTs which
come from the same gene and looks for differences between them that
are consistent with alternative splicing, such as large insertion
or deletion in one EST. Each candidate splice variant can be
further assessed by aligning the ESTs with respective genomic
sequence. This reveals candidate exons (i.e., matches to the
genomic sequence) separated by candidate splices (i.e., large gaps
in the EST-genomic alignment). Since intronic sequences at splice
junctions (i.e., donor/acceptor concatenations) are highly
conserved (essentially 99.24% of introns have a GT-AG at their 5'
and 3' ends, respectively) sequence data can be used to verify
candidate splices [Burset et al. (2000) Nucleic Acids Res.
28:4364-75 LEADS module [Shoshan, et al, Proceeding of SPIE (eds.
M. L. Bittner, Y. Chen, A. N. Dorsel, E. D. Dougherty) Vol. 4266,
pp. 86-95 (2001); R. Sorek, G. Ast, D. Graur, Genome Res. In press;
Compugen Ltd. U.S. patent application Ser. No. 09/133,987].
[0222] (ii) Identification based on intron information--The method
creates a database of individual intron sequences annotated in
GenBank and utilizes such sequences to search for EST sequences
which include the intronic sequences [Croft et al. (2000) Nat.
Genet. 24:340-1].
[0223] (iii) EST alignment to expressed sequences--looks for
insertions and deletions in ESTs relative to a set of known mRNAs.
Such a method enables to uncover alternatively spliced variants
with having to align ESTs with genomic sequence [Brett et al.
(2000) FEBS Lett. 474-83-86].
[0224] It will be appreciated that in order to avoid false positive
identification of novel splice isoforms, a set of filters is
applied. For example, sequences are filtered to exclude EST having
sequence deviations, such as chimerism, random variation in which a
given EST sequence or potential vector contamination at the ends of
an EST.
[0225] Filtering can be effected by aligning ESTs with
corresponding genomic sequences. Chimeric ESTs can be easily
excluded by requiring that each EST aligns completely to a single
genomic locus. Genomic location found by homology search and
alignment can often be checked against radiation hybrid mapping
data [Muneer et al (2002) Genomic 79:344-8]. Furthermore, since the
genomic regions which align with an EST sequence correspond to exon
sequences and alignment gaps correspond to introns, the putative
splice sites at exon/intron boundaries can be confirmed. Because
splice donor and acceptor sites primarily reside within the intron
sequence, this methodology can provide validation which is
independent of the EST evidence. Reverse transcriptase artifacts or
other cDNA synthesis errors may also be filtered out using this
approach. Improper inclusion of genomic sequence in ESTs can also
be excluded by requiring pairs of mutually exclusive splices in
different ESTs.
[0226] Additionally, it will be appreciated that observing a given
splice variant in one EST but not in a second EST may be
insufficient, as the latter can be an un-spliced EST rather than a
biological significant intron inclusion. Therefore measures are
taken to focus on mutually exclusive splice variants, two different
splice variants observed in different ESTs, which overlap in a
genomic sequence. A more stringent filtering may be applied by
requiring two splice variants to share one splice site but differ
in another.
[0227] Once splice variants are identified, identification of
unique sequence features therewithin can be effected
computationally by identifying insertions, deletions and
donor-acceptor concatenations in ESTs relative to mRNA and
preferably genomic sequences.
[0228] As mentioned hereinabove, once alternatively spliced
sequences (having unique sequence features) are identified,
determination of their expression patterns is effected in order to
assign an annotation to the unique sequence feature thereof.
[0229] Expression pattern identification may be effected by
qualifying annotations which are preassociated with the
alternatively spliced expressed sequences, as described
hereinabove. This can be accomplished by scoring the annotations.
For example scoring pathological expression annotations can be
effected according to: (i) prevalence of the alternatively spliced
expressed sequences in normal tissues; (ii) prevalence of the
alternatively spliced expressed sequences in pathological tissues;
(iii) prevalence of the alternatively spliced expressed sequence in
total tissues; and (iv) number of tissues and/or tissue types
expressing the alternatively spliced expressed sequences.
[0230] Alternatively, identifying the expression pattern of the
alternatively spliced expressed sequences of the present invention,
is accomplished by identifying the unique sequence feature thereof.
This can be effected by any hybridization-based technique known in
the art, such as northern blot, dot blot, RNase protection assay,
RT-PCR and the like.
[0231] To this end oligonucleotides probes, which are substantially
homologous to nucleic acid sequences that flank and/or extend
across the unique sequence features of the alternatively spliced
expressed sequences of the present invention are generated.
[0232] Preferably, oligonucleotides which are capable of
hybridizing under stringent, moderate or mild conditions, as used
in any polynucleotide hybridization assay are utilized. Further
description of hybridization conditions is provided
hereinunder.
[0233] Oligonucleotides generated by the teachings of the present
invention may be used in any modification of nucleic acid
hybridization based techniques, which are further detailed
hereinunder. General features of oligonucleotide synthesis and
modifications are also provided hereinunder.
[0234] Aside from being useful in identifying specific splice
variants, oligonucleotides generated according to the teachings of
the present invention may also be widely used as diagnostic,
prognostic and therapeutic agents in a variety of disorders which
are associated with specific splice variants.
[0235] Regulation of splicing is involved in 15% of genetic
diseases [Krawzczak et al. (1992) Hum. Genet. 90:41-54] and may
contribute for example to cancer mis-splicing of exon 18 in BRCA1,
which is caused by a polymorphism in an exonic enhancer [Liu et al.
(2001) Nature Genet. 27:55-58].
[0236] Thus, oligonucleotides generated according to the teachings
of the present invention can be included in diagnostic kits. For
example, oligonucleotides sets pertaining to a specific disease
associated with differential expression of an alternatively spliced
transcript can be packaged in a one or more containers with
appropriate buffers and preservatives along with suitable
instructions for use and used for diagnosis or for directing
therapeutic treatment. Additional information on such diagnostic
kits is provided hereinunder.
[0237] It will be appreciated that an ability to identify
alternatively spliced sequences, also facilitates identification of
the various products of alternative splicing.
[0238] Recent studies indicate that most alternative splicing
events result in an altered protein product [International human
genome sequencing consortium (2001) Nature 409:860-921; Modrek et
al. (2001) Nucleic Acids Res. 29:2850-2859]. The majority of these
changes appear to have a functional relevance (i.e., up-regulating
or down-regulating activity), such as the replacement of the amino
or carboxyl terminus, or in-frame addition and removal of a
functional domain. For example, alternative splicing can lead to
the use of a different site for translation initiation (i.e.,
alternative initiation), a different translation termination site
due to a frameshift (i.e., truncation or extension), or the
addition or removal of a stop codon in the alternative coding
sequence (i.e., alternative termination). Additionally, alternative
splicing can change an internal sequence region due to an in-frame
insertion or deletion. One example of the latter is the new FC
receptor .beta.-like protein, whose C-terminal transmembrane domain
and cytoplasmic tail, which is important for signal transduction in
this class of receptors, is replaced with a new transmembrane
domain and tail by alternative polyadenylation. Another example is
the truncated Growth Hormone Receptor which lacks most of its
intracellular domain and has been shown to heterodimerize with the
full-length receptor, thus causing inhibition of signaling by
Growth Hormone [Ross, R. J. M., Growth hormone & IGF Research,
9:42-46, (1999)].
[0239] Thus, assigning a unique sequence feature to a functionally
altered splice variant enables identification of such variants. As
used herein the phrase "functionally altered splice variants"
refers to alternatively spliced expressed sequences, which protein
products exhibit gain of function or loss of function or
modification of the original function.
[0240] As used herein the phrase "gain of function" refers to any
alternative splicing product, which exhibits increased
functionality as compared to the wild type gene product.
[0241] As used herein the phrase "loss of function" refers to any
alternative splicing product, which exhibits reduced function as
compared to the wild type gene product including any reduction in
function, total absence of function or dominant negative
function.
[0242] As used herein the phrase "dominant negative" refers to the
dominant effect of a splice variant on the activity of wild type
mRNA. For example, a protein product of an altered splice variant
may bind a wild type target protein without enzymatically
activating it (e.g., receptor dimmers), thus blocking and
preventing the active enzymes from binding and activating the
target protein.
[0243] As used herein the phrase "functional domain" refers to a
region of a polypeptide, which displays a particular function. This
function may give rise to a biological, chemical, or physiological
consequence which may be reversible or irreversible and which may
include protein-protein interactions (e.g., binding interactions)
involving the functional domain, a change in the conformation or a
transformation into a different chemical state of the functional
domain or of molecules acted upon by the functional domain, the
transduction of an intracellular or intercellular signal, the
regulation of gene or protein expression, the regulation of cell
growth or death, or the activation or inhibition of an immune
response.
[0244] Identification of putative functionally altered splice
variants, according to this aspect of the present invention, can be
effected by identifying sequence deviations from functional domains
of wild-type gene products.
[0245] Identification of functional domains can be effected by
comparing a wild-type gene product with a series of profiles
prepared by alignment of well characterized proteins from a number
of different species. This generates a consensus profile, which can
then be matched with the query sequence.
[0246] Examples of programs suitable for such identification
include, but are not limited to, InterPro Scan--Integrated search
in PROSITE, Pfam, PRINTS and other family and domain databases,
available at the European Bioinformatics Institute website;
ScanProsite--Scans a sequence against PROSITE or a pattern against
SWISS-PROT and TrEMBL, available at the ExPASy-Swiss Institute of
Bioinformatics website; MotifScan--Scans a sequence against protein
profile databases (including PROSITE), available at the hits-Swiss
Institute of Bioinformatics website; Frame-ProfileScan--Scans a
short DNA sequence against protein profile databases (including
PROSITE), available at the ISREC--Swiss Institute of Bioinformatics
website; Pfam HMM search--scans a sequence against the Pfam protein
families database; FingerPRINTScan--Scans a protein sequence
against the PRINTS Protein Fingerprint Database, available at the
website of the University of Manchester, UK; FPAT--Regular
expression searches in protein databases; PRATT--Interactively
generates conserved patterns from a series of unaligned proteins,
available at the European Bioinformatics Institute website;
PPSEARCH--Scans a sequence against PROSITE (allows a graphical
output), available at the European Bioinformatics Institute
website; at EBI; PROSITE scan--Scans a sequence against PROSITE
(allows mismatches), available at the website of ncsa-Pole
Bio-Informatique Lyonnais, France (PBIL); PATTINPROT--Scans a
protein sequence or a protein database for one or several
pattern(s), available at the website of ncsa-Pole Bio-Informatique
Lyonnais, France (PBIL); SMART--Simple Modular Architecture
Research Tool, available at the website of the European Molecular
Biology Laboratory (EMBL); TIERESIAS--Generate patterns from a
collection of unaligned protein or DNA sequences; at IBM, all
available at the ExPASy-Swiss Institute of Bioinformatics
website.
[0247] It will be appreciated that functionally altered splice
variants may also include a sequence alteration at a
post-translation modification consensus site, such as, for example,
a tyrosine sulfation site, a glycosylation site, etc. Examples of
post-translational modification prediction softwares include but
are not limited to: SignalP--Prediction of signal peptide cleavage
sites; ChloroP--Prediction of chloroplast transit peptides;
MITOPROT--Prediction of mitochondrial targeting sequences;
Predotar--Prediction of mitochondrial and plastid targeting
sequences; NetOGlyc--Prediction of type O-glycosylation sites in
mammalian proteins; DictyOGlyc--Prediction of GlcNAc
O-glycosylation sites in Dictyostelium; YinOYang--O-beta-GlcNAc
attachment sites in eukaryotic protein sequences; big-PI
Predictor--GPI Modification Site Prediction; DGPI--Prediction of
GPI-anchor and cleavage sites (Mirror site); NetPhos--Prediction of
Serine, Threonine and Tyrosine phosphorylation sites in eukaryotic
proteins; NetPicoRNA--Prediction of protease cleavage sites in
picornaviral proteins; NMT
[0248] Prediction of N-terminal N-myristoylation;
Sulfinator--Prediction of tyrosine sulfation sites all available at
the ExPASy-Swiss Institute of Bioinformatics website.
[0249] Once putative functionally altered splice variants are
identified, they are validated by experimental verification and
functional studies, using methodologies well known in the art.
[0250] The Examples section which follows illustrates
identification and annotation of splice variants. Identified and
annotated sequences are contained within the enclosed CD-ROMs1-3.
Some of these sequences represent (i.e., are transcribed from)
entirely new splice variants, while others represent new splice
variants of known sequences. In any case, the sequences contained
in the enclosed CD-ROM are novel in that they include previously
undisclosed sequence regions in the context of a known gene or an
entirely new sequence in the context of an unknown gene.
[0251] The nucleic acids of the invention can be "isolated" or
"purified." In the event the nucleic acid is genomic DNA, it is
considered "isolated" when it does not include coding sequence(s)
of a gene or genes immediately adjacent thereto in the naturally
occurring genome of an organism; although some or all of the 5' or
3' non-coding sequence of an adjacent gene can be included. For
example, an isolated nucleic acid (DNA or RNA) can include some or
all of the 5' or 3' non-coding sequence that flanks the coding
sequence (e.g., the DNA sequence that is transcribed into, or the
RNA sequence that gives rise to, the promoter or an enhancer in the
mRNA). For example, an isolated nucleic acid can contain less than
about 5 kb (e.g., less than about 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb,
or 0.1 kb) of the 5' and/or 3' sequence that naturally flanks the
nucleic acid molecule in a cell in which the nucleic acid naturally
occurs. In the event the nucleic acid is RNA or mRNA, it is
"isolated" or "purified" from a natural source (e.g., a tissue) or
a cell culture when it is substantially free of the cellular
components with which it naturally associates in the cell and, if
the cell was cultured, the cellular components and medium in which
the cell was cultured (e.g., when the RNA or mRNA is in a form that
contains less than about 20%, 10%, 5%, 1%, or less, of other
cellular components or culture medium). When chemically
synthesized, a nucleic acid (DNA or RNA) is "isolated" or
"purified" when it is substantially free of the chemical precursors
or other chemicals used in its synthesis (e.g., when the nucleic
acid is in a form that contains less than about 20%, 10%, 5%, 1%,
or less, of the chemical precursors or other chemicals).
[0252] Variants, fragments, and other mutant nucleic acids are also
envisaged by the present invention. As noted above, where a given
biomolecular sequence represents a new gene (rather than a new
splice variant of a known gene), the nucleic acids of the invention
include the corresponding genomic DNA and RNA. Accordingly, where a
given SEQ ID represents a new gene, variations or mutations can
occur not only in that nucleic acid sequence, but in the coding
regions, the non-coding regions, or both, of the genomic DNA or RNA
from which it was made.
[0253] The nucleic acids of the invention can be double-stranded or
single-stranded and can, therefore, either be a sense strand, an
antisense strand, or a portion (i.e., a fragment) of either the
sense or the antisense strand. The nucleic acids of the invention
can be synthesized using standard nucleotides or nucleotide analogs
or derivatives (e.g., inosine, phosphorothioate, or acridine
substituted nucleotides), which can alter the nucleic acid's
ability to pair with complementary sequences or to resist
nucleases. Indeed, the stability or solubility of a nucleic acid
can be altered (e.g., improved) by modifying the nucleic acid's
base moiety, sugar moiety, or phosphate backbone. For example, the
nucleic acids of the invention can be modified as taught by Toulme
[Nature Biotech. 19:17, (2001)] or Faria et al. [Nature Biotech.
19:40-44, (2001)], and the deoxyribose phosphate backbone of
nucleic acids can be modified to generate peptide nucleic acids
[PNAs; see Hyrup et al., (1996) Bioorganic & Medicinal
Chemistry 4:5-23].
[0254] PNAs are nucleic acid "mimics"; the molecule's natural
backbone is replaced by a pseudopeptide backbone and only the four
nucleotide bases are retained. This allows specific hybridization
to DNA and RNA under conditions of low ionic strength. PNAs can be
synthesized using standard solid phase peptide synthesis protocols
as described, for example by Hyrup et al. (supra) and Perry-O'Keefe
et al. [Proc. Natl. Acad. Sci. USA (1996) 93:14670-675]. PNAs of
the nucleic acids described herein can be used in therapeutic and
diagnostic applications.
[0255] Moreover, the nucleic acids of the invention include not
only protein-encoding nucleic acids per se (e.g., coding sequences
produced by the polymerase chain reaction (PCR) or following
treatment of DNA with an endonuclease), but also, for example,
recombinant DNA that is: (a) incorporated into a vector (e.g., an
autonomously replicating plasmid or virus), (b) incorporated into
the genomic DNA of a prokaryote or eukaryote, or (c) part of a
hybrid gene that encodes an additional polypeptide sequence (i.e.,
a sequence that is heterologous to the nucleic acid sequences of
the present invention or fragments, other mutants, or variants
thereof).
[0256] This aspect of the present invention includes naturally
occurring sequences of the nucleic acid sequences described above,
allelic variants (same locus; functional or non-functional),
homologs (different locus), and orthologs (different organism) as
well as degenerate variants of those sequences and fragments
thereof. The degeneracy of the genetic code is well known, and one
of ordinary skill in the art will be able to make nucleotide
sequences that differ from the nucleic acid sequences of the
present invention but nevertheless encode the same proteins as
those encoded by the nucleic acid sequences of the present
invention. The variant sequences (e.g., degenerate variants) can be
used in the same manner as naturally occurring sequences. For
example, the variant DNA sequences of the invention can be
incorporated into a vector, into the genomic DNA of a prokaryote or
eukaryote, or made part of a hybrid gene. Moreover, variants (or,
where appropriate, the proteins they encode) can be used in the
diagnostic assays and therapeutic regimes described below.
[0257] The sequence of nucleic acids of the invention can also be
varied to maximize expression in a particular expression system.
For example, as few as one and as many as about 20% of the codons
in a given sequence can be altered to optimize expression in
bacterial cells (e.g., E. coli), yeast, human, insect, or other
cell types (e.g., CHO cells).
[0258] The nucleic acids of the invention can also be shorter or
longer than those disclosed on CD-ROMs 1 and 2. Where the nucleic
acids of the invention encode proteins, the protein-encoding
sequences can differ from those represented by specific sequences
of file "Protein.seqs" in CD-ROM 2. For example, the encoded
proteins can be shorter or longer than those encoded by one of the
nucleic acid sequences of the present invention. Nucleotides can be
deleted from, or added to, either or both ends of the nucleic acid
sequences of the present invention or the novel portions of the
sequences that represent new splice variants. Alternatively, the
nucleic acids can encode proteins in which one or more amino acid
residues have been added to, or deleted from, one or more sequence
positions within the nucleic acid sequences.
[0259] The nucleic acid fragments can be short (e.g., 15-30
nucleotides). For example, in cases where peptides are to be
expressed therefrom such polynucleotides need only contain a
sufficient number of nucleotides to encode novel antigenic
epitopes. In cases where nucleic acid fragments serve as DNA or RNA
probes or PCR primers, fragments are selected of a length
sufficient for specific binding to one of the sequences
representing a novel gene or a unique portion of a novel splice
variant.
[0260] Nucleic acids used as probes or primers are often referred
to as oligonucleotides, and they can hybridize with a sense or
antisense strand of DNA or RNA. Nucleic acids that hybridize to a
sense strand (i.e., a nucleic acid sequence that encodes protein,
e.g., the coding strand of a double-stranded cDNA molecule) or to
an mRNA sequence are referred to as antisense oligonucleotides.
Antisense oligonucleotides can be used to specifically inhibit
transcription of any of the nucleic acid sequences of the present
invention.
[0261] Design of antisense molecules must be effected while
considering two aspects important to the antisense approach. The
first aspect is delivery of the oligonucleotide into the cytoplasm
of the appropriate cells, while the second aspect is design of an
oligonucleotide which specifically binds the designated mRNA within
cells in a way which inhibits translation thereof.
[0262] The prior art teaches of a number of delivery strategies
which can be used to efficiently deliver oligonucleotides into a
wide variety of cell types [see, for example, Luft (1998) J Mol Med
76(2): 75-6; Kronenwett et al. (1998) Blood 91(3): 852-62; Rajur et
al. (1997) Bioconjug Chem 8(6): 935-40; Lavigne et al. (1997)
Biochem Biophys Res Commun 237(3): 566-71 and Aoki et al. (1997)
Biochem Biophys Res Commun 231(3): 540-5].
[0263] In addition, algorithms for identifying those sequences with
the highest predicted binding affinity for their target mRNA based
on a thermodynamic cycle that accounts for the energetics of
structural alterations in both the target mRNA and the
oligonucleotide are also available [see, for example, Walton et al.
(1999) Biotechnol Bioeng 65(1): 1-9].
[0264] Such algorithms have been successfully used to implement an
antisense approach in cells. For example, the algorithm developed
by Walton et al. enabled scientists to successfully design
antisense oligonucleotides for rabbit beta-globin (RBG) and mouse
tumor necrosis factor-alpha (TNF alpha) transcripts. The same
research group has more recently reported that the antisense
activity of rationally selected oligonucleotides against three
model target mRNAs (human lactate dehydrogenase A and B and rat
gp130) in cell culture as evaluated by a kinetic PCR technique
proved effective in almost all cases, including tests against three
different targets in two cell types with phosphodiester and
phosphorothioate oligonucleotide chemistries.
[0265] In addition, several approaches for designing and predicting
efficiency of specific oligonucleotides using an in vitro system
were also published (Matveeva et al. (1998) Nature Biotechnology
16, 1374-1375).
[0266] Several clinical trials have demonstrated safety,
feasibility and activity of antisense oligonucleotides. For
example, antisense oligonucleotides suitable for the treatment of
cancer have been successfully used (Holmund et al. (1999) Curr Opin
Mol Ther 1(3):372-85), while treatment of hematological
malignancies via antisense oligonucleotides targeting c-myb gene,
p53 and Bcl-2 had entered clinical trials and had been shown to be
tolerated by patients [Gerwitz (1999) Curr Opin Mol Ther
1(3):297-306].
[0267] More recently, antisense-mediated suppression of human
heparanase gene expression has been reported to inhibit pleural
dissemination of human cancer cells in a mouse model [Uno et al.
(2001) Cancer Res 61(20:7855-60].
[0268] Thus, the current consensus is that recent developments in
the field of antisense technology which, as described above, have
led to the generation of highly accurate antisense design
algorithms and a wide variety of oligonucleotide delivery systems,
enable an ordinarily skilled artisan to design and implement
antisense approaches suitable for downregulating expression of
known sequences without having to resort to undue trial and error
experimentation.
[0269] Antisense oligonucleotides can also be a-anomeric nucleic
acids, which form specific double-stranded hybrids with
complementary RNA in which, contrary to the usual b-units, the
strands run parallel to each other [Gaultier et al., Nucleic Acids
Res. 15:6625-6641, (1987)]. Alternatively, antisense nucleic acids
can comprise a 2'-o-methylribonucleotide [Inoue et al., Nucleic
Acids Res. 15:6131-6148, (1987)] or a chimeric RNA-DNA analogue
[Inoue et al., FEBS Lett. 215:327-330, (1987)].
[0270] The nucleic acid sequences described above can also include
ribozymes catalytic sequences. Such a ribozyme will have
specificity for a protein encoded by the novel nucleic acids
described herein (by virtue of having one or more sequences that
are complementary to the cDNAs that represent novel genes or the
novel portions (i.e., the portions not found in related splice
variants) of the sequences that represent new splice variants.
These ribozymes can include a catalytic sequence encoding a protein
that cleaves mRNA [see U.S. Pat. No. 5,093,246 or Haselhoff and
Gerlach, Nature 334:585-591, (1988)]. For example, a derivative of
a tetrahymena L-19 IVS RNA can be constructed in which the
nucleotide sequence of the active site is complementary to the
nucleotide sequence to be cleaved in an mRNA of the invention
(e.g., one of the nucleic acid sequences of the present invention;
see, U.S. Pat. Nos. 4,987,071 and 5,116,742). Alternatively, the
mRNA sequences of the present invention can be used to select a
catalytic RNA having a specific ribonuclease activity from a pool
of RNA molecules [see, e.g., Bartel and Szostak, Science
261:1411-1418, (1993); see also Krol et al., Bio-Techniques
6:958-976, (1988)].
[0271] Fragments having as few as 9-10 nucleotides (e.g., 12-14,
15-17, 18-20, 21-23, or 24-27 nucleotides) can be useful as probes
or expression templates and are within the scope of the present
invention. Indeed, fragments that contain about 15-20 nucleotides
can be used in Southern blotting, Northern blotting, dot or slot
blotting, PCR amplification methods (where naturally occurring or
mutant nucleic acids are amplified), colony hybridization methods,
in situ hybridization, and the like.
[0272] The present invention also encompasses pairs of
oligonucleotides (these can be used, for example, to amplify the
new genes, or portions thereof, or the novel portions of the splice
variant in, for example, potentially diseased tissue) and groups of
oligonucleotides (e.g., groups that exhibit a certain degree of
homology (e.g., nucleic acids that are 90% identical to one
another) or that share one or more functional attributes).
[0273] When used, for example, as probes, the nucleic acids of the
invention can be labeled with a radioactive isotope (e.g., using
polynucleotide kinase to add .sup.32P-labeled ATP to the
oligonucleotide used as the probe) or an enzyme. Other labels, such
as chemiluminescent, fluorescent, or colorimetric, labels can be
used.
[0274] As noted above, the invention features nucleic acids that
are complementary to those represented by the nucleic acid
sequences of the present invention or novel portions thereof (i.e.,
novel fragments) and as such are capable of hybridizing therewith.
In many cases, nucleic acids that are used as probes or primers are
absolutely or completely complementary to all, or a portion of, the
target sequence. However, this is not always necessary. The
sequence of a useful probe or primer can differ from that of a
target sequence so long as it hybridizes with the target under the
stringency conditions described herein (or the conditions routinely
used to amplify sequences by PCR) to form a stable duplex.
[0275] Hybridization of a nucleic acid probe to sequences in a
library or other sample of nucleic acids is typically performed
under moderate to high stringency conditions. Nucleic acid duplex
or hybrid stability is expressed as the melting temperature (Tm),
which is the temperature at which a probe dissociates from a target
DNA and, therefore, helps define the required stringency
conditions. To identify sequences that are related or substantially
identical to that of a probe, it is useful to first establish the
lowest temperature at which only homologous hybridization occurs
with a particular concentration of salt (e.g., SSC or SSPE). (The
terms "identity" or "identical" as used herein are equated with the
terms "homology" or "homologous"). Then, assuming a 1% mismatch
requires a 1.degree. C. decrease in the Tm, the temperature of the
wash (e.g., the final wash) following the hybridization reaction is
reduced accordingly. For example, if sequences having at least 95%
identity with the probe are sought, the final wash temperature is
decreased by 5.degree. C. In practice, the change in Tm can be
between 0.5.degree. C. and 1.5.degree. C. per 1% mismatch
[0276] The hybridization conditions described here can be employed
when the nucleic acids of the invention are used in, for example,
diagnostic assays, or when one wishes to identify, for example, the
homologous genes that fall within the scope of the invention (as
stated elsewhere, the invention encompasses allelic variants,
homologues and orthologues of the sequences that represent new
genes). Homologous genes will hybridize with the sequences that
represent new genes under a stringency condition described
herein.
[0277] A hybridization reaction is carried out at "high stringency"
if hybridization (between the probe and a potential target
sequence) is carried out at 68.degree. C. in (a)
5.times.SSC/5.times.Denhardt's solution/1.0% SDS, (b) 0.5 M
NaHPO.sub.4(pH 7.2)/1 mM EDTA/7% SDS, or (c) 50% formamide/0.25 M
NaHPO.sub.4(pH 7.2)/0.25 M NaCl/1 mM EDTA/7% SDS, and washing is
carried out with (a) 0.2.times.SSC/0.1% SDS at room temperature or
at 42.degree. C., (b) 0.1.times.SSC/0.1% SDS at 68.degree. C., or
(c) 40 mM NaHPO.sub.4(pH 7.2)/1 mM EDTA and either 1% or 5% SDS at
50.degree. C.
[0278] "Moderately stringent" conditions constitute the
hybridization conditions described above and one or more washes in
3.times.SSC at 42.degree. C. Of course, salt concentration and
temperature can be varied to achieve the optimal level of identity
between the probe and the target nucleic acid. This is well known
in the art, and additional guidance is available in, for example,
Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., and
Ausubel et al. (eds.), 1995, Current Protocols in Molecular
Biology, John Wiley & Sons, New York, N.Y.
[0279] As mentioned hereinabove, the nucleic acid sequences of the
present invention can be modified to encode substitution mutants of
the wild type forms. Substitution mutants can include amino acid
residues that represent either a conservative or non-conservative
change (or, where more than one residue is varied, possibly both).
A "conservative" substitution is one in which one amino acid
residue is replaced with another having a similar side chain.
Families of amino acid residues having similar side chains have
been defined in the art. These families include amino acids with
basic side chains (e.g., lysine, arginine, histidine), acidic side
chains (e.g., aspartic acid, glutamic acid), uncharged polar side
chains (e.g., glycine, asparagine, glutamine, serine, threonine,
tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine,
leucine, isoleucine, proline, phenylalanine, methionine,
tryptophan), beta-branched side chains (e.g., threonine, valine,
isoleucine) and aromatic side chains (e.g., tyrosine,
phenylalanine, tryptophan, histidine). The invention includes
polypeptides that include one, two, three, five, or more
conservative amino acid substitutions, where the resulting mutant
polypeptide has at least one biological activity that is the same,
or substantially the same, as a biological activity of the wild
type polypeptide.
[0280] Fragments or other mutant nucleic acids can be made by
mutagenesis techniques well known in the art, including those
applied to polynucleotides, cells, or organisms (e.g., mutations
can be introduced randomly along all or part of the nucleic acid
sequences of the present invention by saturation mutagenesis). The
resultant mutant proteins can be screened for biological activity
to identify those that retain activity or exhibit altered
activity.
[0281] In certain embodiments, nucleic acids of the invention
differ from the nucleic acid sequences provided in files
"Transcripts_nucleotide_seqs_part1",
"Transcripts_nucleotide_seqs_part2",
"Transcripts_nucleotide_seqs_part3.new" and "ProDG_seqs" (provided
in CD-ROM1 and CD-ROM2) by at least one, but less than 10, 20, 30,
40, 50, 100, or 200 nucleotides or, alternatively, at less than 1%,
5%, 10% or 20% of the nucleotides in the subject nucleic acid
(excluding, of course, splice variants known in the art).
Similarly, in certain embodiments, proteins of the invention can
differ from those encoded by those included in File "Protein.seqs"
(provided in CD-ROM2) by at least one, but less than 10, 20, 30,
40, 50, 100, or 200 amino acid residues or, alternatively, at less
than 1%, 5%, 10% or 20% of the amino acid residues in a subject
protein (excluding, of course, proteins encoded by splice variants
known in the art (proteins of the invention are described in more
detail below)). If necessary for this analysis (or any other test
for homology or substantial identity described herein), the
sequences should be aligned for maximum homology, as described
elsewhere here.
[0282] The present invention also encompasses mutants [e.g.,
nucleic acids that are 80% (or more) identical to one of the
nucleic acid sequences disclosed in CD-ROMs 1 and 2], which encode
proteins that retain substantially at least one, or preferably
substantially all of the biological activities of the referenced
protein. What constitutes "substantially all" may vary
considerably. For example, in some instances, a variant or mutant
protein may be about 5% as effective as the protein from which it
was derived. But if that level of activity is sufficient to achieve
a biologically significant result (e.g., transport of a sufficient
number of ions across a cell membrane), the variant or mutant
protein is one that retains substantially all of at least one of
the biological activities of the protein from which it was derived.
A "biologically active" variant or mutant (e.g., fragment) of a
protein can participate in an intra- or inter-molecular interaction
that can be characterized by specific binding between molecules two
or more identical molecules (in which case, homodimerization could
occur) or two or more different molecules (in which case,
heterodimerization could occur). Often, a biologically active
fragment will be recognizable by virtue of a recognizable domain or
motif, and one can confirm biological activity experimentally. More
specifically, for example, one can make (by synthesis or
recombinant techniques) a nucleic acid fragment that encodes a
potentially biologically active portion of a protein of the present
invention by inserting the active fragment into an expression
vector, and expressing the protein (genetic constructs and
expression systems are described further below), and finally
assessing the ability of the protein to function.
[0283] The present invention also encompasses chimeric nucleic acid
sequences that encode fusion proteins. For example, a nucleic acid
sequence of the invention can include a sequence that encodes a
hexa-histidine tag (to facilitate purification of
bacterially-expressed proteins) or a hemagglutinin tag (to
facilitate purification of proteins expressed in eukaryotic
cells).
[0284] The fused heterologous sequence can also encode a portion of
an immunoglobulin (e.g., the constant region (Fc) of an IgG
molecule), a detectable marker, or a signal sequence (e.g., a
sequence that is recognized and cleaved by a signal peptidase in
the host cell in which the fusion protein is expressed). Fusion
proteins containing an Fc region can be purified using a protein A
column, and they have increased stability (e.g., a greater
circulating half-life) in vivo.
[0285] Detectable markers are well known in the art and can be used
in the context of the present invention. For example, the
expression vector pUR278 (Ruther et al., EMBO J., 2:1791, 1983) can
be used to fuse a nucleic acid of the invention to the lacZ gene
(which encodes .beta.-galactosidase).
[0286] A nucleic acid sequence of the invention can also be fused
to a sequence that, when expressed, improves the quantity or
quality (e.g., solubility) of the fusion protein. For example, pGEX
vectors can be used to express the proteins of the invention fused
to glutathione S-transferase (GST). In general, such fusion
proteins are soluble and can be easily purified from lysed cells by
adsorption to glutathione-agarose beads followed by elution in the
presence of free glutathione. The pGEX vectors (Pharmacia Biotech
Inc; Smith and Johnson, Gene 67:31-40, 1988) are designed to
include thrombin or factor Xa protease cleavage sites so that the
cloned target gene product can be released from the GST moiety.
Other useful vectors include pMAL (New England Biolabs, Beverly,
Mass.) and pRIT5 (Pharmacia, Piscataway, N.J.), which fuse maltose
E binding protein and protein A, respectively, to a protein of the
invention.
[0287] A signal sequence, when present, can facilitate secretion of
the fusion protein from a cell, and can be cleaved off by the host
cell. The nucleic acid sequences of the present invention can also
be fused to "inactivating" sequences, which render the fusion
protein encoded, as a whole, inactive. Such proteins can be
referred to as "preproteins," and they can be converted into an
active form of the protein by removal of the inactivating
sequence.
[0288] The present invention also encompasses genetic constructs
(e.g., plasmids, cosmids, and other vectors that transport nucleic
acids) that include a nucleic acid of the invention in a sense or
antisense orientation. The nucleic acids can be operably linked to
a regulatory sequence (e.g., a promoter, enhancer, or other
expression control sequence, such as a polyadenylation signal) that
facilitates expression of the nucleic acid. The vector can
replicate autonomously or integrate into a host genome, and can be
a viral vector, such as a replication defective retrovirus, an
adenovirus, or an adeno-associated virus.
[0289] When present, the regulatory sequence can direct
constitutive or tissue-specific expression of the nucleic acid.
Tissue-specific promoters include, for example, the liver-specific
albumin promoter (Pinkert et al., Genes Dev. 1:268-277, 1987),
lymphoid-specific promoters (Calame and Eaton, Adv. Immunol.
43:235-275, 1988), such as those of T cell receptors (Winoto and
Baltimore, EMBO J. 8:729-733, 1989) and immunoglobulins (Banerji et
al., Cell 33:729-740, 1982; Queen and Baltimore, Cell 33:741-748,
1983), the neuron-specific neurofilament promoter (Byrne and
Ruddle, Proc. Natl. Acad. Sci. USA 86:5473-5477, 1989),
pancreas-specific promoters (Edlund et al., Science 230:912-916,
1985), and mammary gland-specific promoters (e.g., milk whey
promoter; see U.S. Pat. No. 4,873,316 and European Application
Publication No. 264,166). Developmentally-regulated promoters can
also be used. Examples of such promoters include the murine hox
promoters (Kessel and Gruss, Science 249:374-379, 1990) and the
fetoprotein promoter (Campes and Tilghman, Genes Dev. 3:537-546,
1989). Moreover, the promoter can be an inducible promoter. For
example, the promoter can be regulated by a steroid hormone, a
polypeptide hormone, or some other polypeptide (e.g., that used in
the tetracycline-inducible system, "Tet-On" and "Tet-Off"; see,
e.g., Clontech Inc. (Palo Alto, Calif.), Gossen and Bujard Proc.
Natl. Acad. Sci. USA 89:5547, 1992, and Paillard, Human Gene
Therapy 9:983, 1989).
[0290] The expression vector will be selected or designed depending
on, for example, the type of host cell to be transformed and the
level of protein expression desired. For example, when the host
cells are mammalian cells, the expression vector can include viral
regulatory elements, such as promoters derived from polyoma,
Adenovirus 2, cytomegalovirus and Simian Virus 40. The nucleic acid
inserted (i.e., the sequence to be expressed) can also be modified
to encode residues that are preferentially utilized in E. coli
(Wada et al., Nucleic Acids Res. 20:2111-2118, 1992). These
modifications can be achieved by standard DNA synthesis
techniques.
[0291] Expression vectors can be used to produce the proteins
encoded by the nucleic acid sequences of the invention ex vivo
(e.g., the expressed proteins can be purified from expression
systems such as those described herein) or in vivo (m, for example,
whole organisms). Proteins can be expressed in vivo in a way that
restores expression to within normal limits and/or restores the
temporal or spatial patterns of expression normally observed.
Alternatively, proteins can be aberrantly expressed in vivo (i.e.,
at a time or place, or to an extent, that does not normally occur
in vivo). For example, proteins can be over expressed or under
expressed with respect to expression in a wild-type state;
expressed at a different developmental stage; expressed at a
different time during the cell cycle; or expressed in a tissue or
cell type where expression does not normally occur.
[0292] The present invention also encompasses various engineered
cells, including cells that have been engineered to express or
over-express a nucleic acid sequence described herein. Accordingly,
the cells can be transformed with a genetic construct, such as
those described above. A "transformed" cell is a cell into which
(or into an ancestor of which) one has introduced a nucleic acid
that encodes a protein of the invention. The nucleic acid can be
introduced by any of the art-recognized techniques for introducing
nucleic acids into a host cell (e.g., calcium phosphate or calcium
chloride co-precipitation, DEAE-dextran-mediated transfection,
lipofection, or electroporation).
[0293] The terms "transformed cell" or "host cell" refer not only
to the particular subject cell, but also to the progeny or
potential progeny of such cells. Mutations or environmental
influences may modify the cells in succeeding generations and, even
though such progeny may not be identical to the parent cell, they
are nevertheless within the scope of the invention. The cells of
the invention can be "isolated" cells or "purified preparations" of
cells (e.g., an in vitro preparation of cells), either of which can
be obtained from multicellular organisms such as plants and animals
(in which case the purified preparation would constitute a subset
of the cells from the organism). In the case of unicellular
microorganisms (e.g., microbial cells), the preparation is purified
when at least 10% (e.g., 25%, 50%, 75%, 80%, 90%, 95% or more) of
the cells within it are the cells of interest (e.g., the cells that
express a protein of the invention).
[0294] The expression vectors of the invention can be designed to
express proteins in prokaryotic or eukaryotic cells. For example,
polypeptides of the invention can be expressed in bacterial cells
(e.g., E. coli), fungi, yeast, or insect cells (e.g., using
baculovirus expression vectors). For example, a baculovirus such as
Autographa californica nuclear polyhedrosis virus (AcNPV), which
grows in Spodoptera frugiperda cells, can be used as a vector to
express foreign genes. A nucleic acid of the invention can be
cloned into a non-essential region (for example the polyhedrin
gene) of the viral genome and placed under control of a promoter
(e.g., the polyhedrin promoter). Successful insertion of the
nucleic acid results in inactivation of the polyhedrin gene and
production of non-occluded recombinant virus (i.e., virus lacking
the proteinaceous coat encoded by the polyhedrin gene). These
recombinant viruses are then typically used to infect insect cells
(e.g., Spodoptera frugiperda cells) in which the inserted gene is
expressed (see, e.g., Smith et al., J. Virol. 46:584, 1983 and U.S.
Pat. No. 4,215,051). If desired, mammalian cells can be used in
lieu of insect cells, provided the virus is engineered so that the
nucleic acid is placed under the control of a promoter that is
active in mammalian cells.
[0295] Useful mammalian cells include rodent cells, such as Chinese
hamster ovary cells (CHO) or COS cells, primate cells, such as
African green monkey kidney cells, rabbit cells, or pig cells). The
mammalian cells can also be human cells (e.g., a hematopoietic
cell, a fibroblast, or a tumor cell). For example, HeLa cells, 293
cells, 3T3 cells, and WI38 cells are useful. Other suitable host
cells are known to those skilled in the art and are discussed
further in Goeddel [Gene Expression Technology: Methods in
Enzymology 185, Academic Press, San Diego, Calif., (1990)].
[0296] Proteins can also be produced in plant cells, if desired.
For plant cells, viral expression vectors (e.g., cauliflower mosaic
virus and tobacco mosaic virus) and plasmid expression vectors
(e.g., Ti plasmid) are suitable. These cells and other types are
available from a wide range of sources [e.g., the American Type
Culture Collection, Manassas, Va.; see also, e.g., Ausubel et al.,
Current Protocols in Molecular Biology, John Wiley & Sons, New
York, (1994)]. The optimal methods of transformation (by, for
example, transfection) and, as noted above, the choice of
expression vehicle will depend on the host system selected.
Transformation and transfection methods are described in, for
example, Ausubel et al., supra; expression vehicles can be chosen
from those provided in, for example, Pouwels et al., Cloning
Vectors: A Laboratory Manual, (1985), Supp. (1987). The host cells
harboring the expression vehicle can be cultured in conventional
nutrient media, adapted as needed for activation of a chosen
nucleic acid, repression of a chosen nucleic acid, selection of
transformants, or amplification of a chosen nucleic acid.
[0297] Expression systems can be selected based on their ability to
produce proteins that are modified (e.g., by phosphorylation,
glycosylation, or cleavage) in substantially the same way they
would be in a cell in which they are naturally expressed.
Alternatively, the system can be one in which naturally occurring
modifications do not occur, or occur in a different position, or to
a different extent, than they otherwise would.
[0298] If desired, the host cells can be those of a
stably-transfected cell line. Vectors suitable for stable
transfection of mammalian cells are available to the public (see,
e.g., Pouwels et al. (supra) as are methods for constructing them
(see, e.g., Ausubel et al. (supra). In one example, a nucleic acid
of the invention is cloned into an expression vector that includes
the dihydrofolate reductase (DHFR) gene. Integration of the plasmid
and, therefore, the nucleic acid it contains, into the host cell
chromosome is selected for by including 0.01-300 mM methotrexate in
the cell culture medium (as described in Ausubel et al., supra).
This dominant selection can be accomplished in most cell types.
[0299] Moreover, recombinant protein expression can be increased by
DHFR-mediated amplification of the transfected gene. Methods for
selecting cell lines bearing gene amplifications are described in
Ausubel et al. (supra) and generally involve extended culture in
medium containing gradually increasing levels of methotrexate.
DHFR-containing expression vectors commonly used for this purpose
include pCVSEII-DHFR and pAdD26SV(A) (which are also described in
Ausubel et al., supra).
[0300] A number of other selection systems can be used. These
include those based on herpes simplex virus thymidine kinase,
hypoxanthine-guanine phosphoribosyl-transferase, and adenine
phosphoribosyltransferase genes, which can be employed in tk,
hgprt, or aprt cells, respectively. In addition, gpt, which confers
resistance to mycophenolic acid (Mulligan et al., Proc. Natl. Acad.
Sci. USA, 78:2072, 1981); neo, which confers resistance to the
aminoglycoside G-418 (Colberre-Garapin et al., J. Mol. Biol. 150:1,
1981); and hygro, which confers resistance to hygromycin (Santerre
et al., Gene 30:147, 1981), can be used.
[0301] In view of the foregoing, it is clear that one can
synthesize proteins encoded by the nucleic acid sequences of the
present invention (i.e., recombinant proteins). Methods of
generating and recombinant proteins are well known in the art.
Recombinant protein purification can be effected by affinity. Where
a protein of the invention has been fused to a heterologous protein
(e.g., a maltose binding protein, a .beta.-galactosidase protein,
or a trpE protein), antibodies or other agents that specifically
bind to the latter can facilitate purification. The recombinant
protein can, if desired, be further purified (e.g., by high
performance liquid chromatography or other standard techniques
[see, Fisher, Laboratory Techniques In Biochemistry And Molecular
Biology, Eds., Work and Burdon, Elsevier, (1980)].
[0302] Other purification schemes are known as well. For example,
non-denatured fusion proteins can be purified from human cell lines
as described by Janknecht et al. (Proc. Natl. Acad. Sci. USA,
88:8972, 1981). In this system, a nucleic acid is subcloned into a
vaccinia recombination plasmid such that it is translated, in
frame, with a sequence encoding an N-terminal tag consisting of six
histidine residues. Extracts of cells infected with the recombinant
vaccinia virus are loaded onto Ni.sup.2+ nitriloacetic acid-agarose
columns, and histidine-tagged proteins are selectively eluted with
imidazole-containing buffers.
[0303] Alternatively, Chemical synthesis can also be utilized to
generate the proteins of the present invention [e.g., proteins can
be synthesized by the methods described in Solid Phase Peptide
Synthesis, 2nd Ed., The Pierce Chemical Co., Rockford, Ill.,
(1984)].
[0304] The invention also features expression vectors that can be
transcribed and translated in vitro using, for example, a T7
promoter and T7 polymerase. Thus, the invention encompasses methods
of making the proteins described herein in vitro.
[0305] Sufficiently purified proteins can be used as described
herein. For example, one can administer the protein to a patient,
use it in diagnostic or screening assays, or use it to generate
antibodies (these methods are described further below).
[0306] The cells per se can also be administered to patients in the
context of replacement therapies. For example, a nucleic acid of
the present invention can be operably linked to an inducible
promoter (e.g., a steroid hormone receptor-regulated promoter) and
introduced into a human or nonhuman (e.g., porcine) cell and then
into a patient. Optionally, the cell can be cultivated for a time
or encapsulated in a biocompatible material, such as poly-lysine
alginate. See, e.g., Lanza, Nature Biotechnol. 14:1107, (1996);
Joki et al. Nature Biotechnol. 19:35, 2001; and U.S. Pat. No.
5,876,742] When a steroid hormone receptor-regulated promoter is
used, protein production can be regulated in the subject by
administering a steroid hormone to the subject. Implanted
recombinant cells can also express and secrete an antibody that
specifically binds to one of the proteins encoded by the nucleic
acid sequences of the present invention. The antibody can be any
antibody or any antibody derivative described herein. An antibody
"specifically binds" to a particular antigen when it binds to that
antigen but not, to a detectable level, to other molecules in a
sample (e.g., a tissue or cell culture) that naturally includes the
antigen.
[0307] While the host cells described above express recombinant
proteins, the invention also encompasses cells in which gene
expression is disrupted (e.g., cells in which a gene has been
knocked out). These cells can serve as models of disorders that are
related to mutated or mis-expressed alleles and are also useful in
drug screening.
[0308] Protein expression can also be regulated in cells without
using the genetic constructs described above. Instead, one can
modify the expression of an endogenous gene within a cell (e.g., a
cell line or microorganism) by inserting a heterologous DNA
regulatory element into the genome of the cell such that the
element is operably linked to the endogenous gene. For example, an
endogenous gene that is "transcriptionally silent," (i.e., not
expressed at detectable levels) can be activated by inserting a
regulatory element that promotes the expression of a normally
expressed gene product in that cell. Techniques such as targeted
homologous recombination can be used to insert the heterologous DNA
(see, e.g., U.S. Pat. No. 5,272,071 and WO 91/06667).
[0309] The polypeptides of the present invention include the
protein sequences contained in the File "Protein.seqs" of CD-ROM 2
and those encoded by the nucleic acids described herein (so long as
those nucleic acids contain coding sequence and are not wholly
limited to an untranslated region of a nucleic acid sequence),
regardless of whether they are recombinantly produced (e.g.,
produced in and isolated from cultured cells), otherwise
manufactured (by, for example, chemical synthesis), or isolated
from a natural biological source (e.g., a cell or tissue) using
standard protein purification techniques.
[0310] The terms "peptide," "polypeptide," and "protein" are used
herein interchangeably to refer to a chain of amino acid residues,
regardless of length or post-translational modification (e.g.,
glycosylation or phosphorylation). Proteins (including antibodies
that specifically bind to the products of those nucleic acid
sequences that encode protein or fragments thereof) and other
compounds can be "isolated" or "purified." The proteins and
compounds of the present invention are "isolated" or "purified"
when they exist as a composition that is at least 60% (e.g., 70%,
75%, 80%, 85%, 90%, 95%, or 99% or more) by weight the protein or
compound of interest. Thus, the proteins of the invention are
substantially free from the cellular material (or other biological
or cell culture material) with which they may have, at one time,
been associated (naturally or otherwise). Purity can be measured by
any appropriate standard method (e.g., column chromatography,
polyacrylamide gel electrophoresis, or HPLC analysis
[0311] The proteins of the invention also include those encoded by
novel fragments or other mutants or variants of the
protein-encoding sequences of the present invention. These proteins
can retain substantially all (e.g., 70%, 80%, 90%, 95%, or 99%) of
the biological activity of the full-length protein from which they
were derived and can, therefore, be used as agonists or mimetics of
the proteins from which they were derived. The manner in which
biological activity can be determined is described generally
herein, and specific assays (e.g., assays of enzymatic activity or
ligand-binding ability) are known to those of ordinary skill in the
art. In some instances, retention of biological activity is not
necessary or desirable. For example, fragments that retain little,
if any, of the biological activity of a full-length protein can be
used as immunogens, which, in turn, can be used as therapeutic
agents (e.g., to generate an immune response in a patient),
diagnostic agents (e.g., to detect the presence of antibodies or
other proteins in a tissue sample obtained from a patient), or to
generate or test antibodies that specifically bind the proteins of
the invention.
[0312] In other instances, the proteins encoded by nucleic acids of
the invention can be modified (e.g., fragmented or otherwise
mutated) so their activities oppose those of the naturally
occurring protein (i.e., the invention encompasses variants of the
proteins encoded by nucleic acids of the invention that are
antagonistic to a biological process). One of ordinary skill in the
art will recognize that the more extensive the mutation, the more
likely it is to affect the biological activity of the protein (this
is not to say that minor modifications cannot do so as well). Thus,
it is likely that mutant proteins that are agonists of those
encoded by wild type proteins will differ from those wild type
proteins only at non-essential residues or will contain only
conservative substitutions. Conversely, antagonists are likely to
differ at an essential residue or to contain non-conservative
substitutions. Moreover, those of ordinary skill in the art can
engineer proteins so that they retain desirable traits (i.e., those
that make them efficacious in a particular therapeutic, diagnostic,
or screening regime) and lose undesirable traits (i.e., those that
produce side effects, or produce false-positive results through
non-specific binding).
[0313] In the event a protein of the invention is encoded by a new
gene, the invention encompasses proteins that arise following
alternative transcription, RNA splicing, translational- or
post-translational events (e.g., the invention encompasses splice
variants of the new genes). In the event a protein of the invention
is encoded by a novel splice variant, the invention encompasses
proteins that arise following alternative translational- or
post-translational events (i.e., the invention does not encompass
proteins encoded by known splice variants, but does encompass other
variants of the novel splice variant). Post-translational
modifications are discussed above in the context of expression
systems.
[0314] The fragmented or otherwise mutant proteins of the invention
can differ from those encoded by the nucleic acids of the invention
to a limited extent (e.g., by at least one but less than 5, 10 or
15 amino acid residues). As with other, more extensive mutations,
the differences can be introduced by adding, deleting, and/or
substituting one or more amino acid residues. Alternatively, the
mutant proteins can differ from the wild type proteins from which
they were derived by at least one residue but less than 5%, 10%,
15% or 20% of the residues when analyzed as described herein. If
the mutant and wild type proteins are different lengths, they can
be aligned and analyzed using the algorithms described above.
[0315] Useful variants, fragments, and other mutants of the
proteins encoded by the nucleic acids of the invention can be
identified by screening combinatorial libraries of these variants,
fragments, and other mutants for agonist or antagonist activity.
For example, libraries of fragments (e.g., N-terminal, C-terminal,
or internal fragments) of one or more of the proteins of the
invention can be used to generate populations of fragments that can
be screened and, once identified, isolated. The proteins can
include those in which one or more cysteine residues are added or
deleted, or in which a glycosylated residue is added or deleted.
Methods for screening libraries (e.g., combinatorial libraries of
proteins made from point mutants or cDNA libraries) for proteins or
genes having a particular property are known in the art. These
methods can be adapted for rapid screening. Recursive ensemble
mutagenesis (REM), a new technique that enhances the frequency of
functional mutants in libraries, can be used in combination with
screening assays to identify useful variants of the proteins of the
present invention [Arkin and Yourvan, Proc. Natl. Acad. Sci. USA
89:7811-7815, (1992); Delgrave et al., Protein Engineering
6:327-331, (1993)].
[0316] Cell-based assays can be exploited to analyze variegated
libraries constructed from one or more of the proteins of the
invention. For example, cells in a cell line (e.g., a cell line
that ordinarily responds to the protein(s) of interest in a
substrate-dependent manner) can be transfected with a library of
expression vectors. The transfected cells are then contacted with
the protein and the effect of the expression of the mutant on
signaling by the protein (substrate) can be detected (e.g., by
measuring redox activity or protein folding). Plasmid DNA can then
be recovered from the cells that score for inhibition, or
alternatively, potentiation of signaling by the protein
(substrate). Individual clones are then further characterized.
[0317] The invention also contemplates antibodies (i.e.,
immunoglobulin molecules) that specifically bind (see the
definition above) to the proteins described herein and antibody
fragments (e.g., antigen-binding fragments or other immunologically
active portions of the antibody). Antibodies are proteins, and
those of the invention can have at least one or two heavy chain
variable regions (VH), and at least one or two light chain variable
regions (VL). The VH and VL regions can be further subdivided into
regions of hypervariability, termed "complementarity determining
regions" (CDR), which are interspersed with more highly conserved
"framework regions" (FR). These regions have been precisely defined
[see, Kabat et al., Sequences of Proteins of Immunological
Interest, Fifth Edition, U.S. Department of Health and Human
Services, NIH Publication No. 91-3242, (1991) and Chothia.et al.,
J. Mol. Biol. 196:901-917, (1987)], and antibodies or antibody
fragments containing one or more of them are within the scope of
the invention.
[0318] The antibodies of the invention can also include a heavy
and/or light chain constant region [constant regions typically
mediate binding between the antibody and host tissues or factors,
including effector cells of the immune system and the first
component (C1q) of the classical complement system], and can
therefore form heavy and light immunoglobulin chains, respectively.
For example, the antibody can be a tetramer (two heavy and two
light immunoglobulin chains, which can be connected by, for
example, disulfide bonds). The heavy chain constant region contains
three domains (CH1, CH2 and CH3), whereas the light chain constant
region has one (CL).
[0319] An antigen-binding fragment of the invention can be: (i) a
Fab fragment (i.e., a monovalent fragment consisting of the VL, VH,
CL and CH1 domains); (ii) a F(ab').sub.2fragment (i.e., a bivalent
fragment containing two Fab fragments linked by a disulfide bond at
the hinge region); (iii) a Fd fragment consisting of the VH and CH1
domains; (iv) a Fv fragment consisting of the VL and VH domains of
a single arm of an antibody, (v) a dAb fragment [Ward et al.,
Nature 341:544-546, (1989)], which consists of a VH domain; and
(vi) an isolated complementarity determining region (CDR).
[0320] F(ab').sub.2fragments can be produced by pepsin digestion of
the antibody molecule, and Fab fragments can be generated by
reducing the disulfide bridges of F(ab').sub.2fragments.
Alternatively, Fab expression libraries can be constructed [Huse et
al., Science 246:1275, (1989)] to allow rapid and easy
identification of monoclonal Fab fragments with the desired
specificity. Methods of making other antibodies and antibody
fragments are known in the art. For example, although the two
domains of the Fv fragment, VL and VH, are coded for by separate
genes, they can be joined, using recombinant methods or a synthetic
linker that enables them to be made as a single protein chain in
which the VL and VH regions pair to form monovalent molecules
[known as single chain Fv (scFv); see e.g., Bird et al., Science
242:423-426, (1988); Huston et al., Proc. Natl. Acad. Sci. USA
85:5879-5883, (1988); Colcher et al., Ann. NY Acad. Sci.
880:263-80, (1999); and Reiter, Clin. Cancer Res. 2:245-52,
(1996)]. Techniques for producing single chain antibodies are also
described in U.S. Pat. Nos. 4,946,778 and 4,704,692. Such single
chain antibodies are encompassed within the term "antigen-binding
fragment" of an antibody. These antibody fragments are obtained
using conventional techniques known to those of ordinary skill in
the art, and the fragments are screened for utility in the same
manner that intact antibodies are screened. Moreover, a single
chain antibody can form dimers or multimers and, thereby, become a
multivalent antibody having specificities for different epitopes of
the same target protein.
[0321] The antibody can be a polyclonal (i.e., part of a
heterogeneous population of antibody molecules derived from the
sera of the immunized animals) or a monoclonal antibody (i.e., part
of a homogeneous population of antibodies to a particular antigen),
either of which can be recombinantly produced (e.g., produced by
phage display or by combinatorial methods, as described in, e.g.,
U.S. Pat. No. 5,223,409; WO 92/18619; WO 91/17271; WO 92/20791; WO
92/15679; WO 93/01288; WO 92/01047; WO 92/09690; WO 90/02809; Fuchs
et al., Bio/Technology 9:1370-1372, (1991); Hay et al. Human
Antibody Hybridomas 3:81-85, (1992); Huse et al. Science
246:1275-1281, (1989); Griffths et al. EMBO J 12:725-734, (1993);
Hawkins et al., J. Mol Biol 226:889-896, (1992); Clackson et al.
Nature 352:624-628, (1991); Gram et al., Proc. Natl. Acad. Sci. USA
89:3576-3580, (1992); Garrad et al., Bio/Technology 9:1373-1377,
(1991); Hoogenboom et al. Nucl. Acids Res. 19:4133-4137, (1991);
and Barbas et al., Proc. Natl. Acad. Sci. USA 88:7978-7982, (1991).
In one embodiment, an antibody is made by immunizing an animal with
a protein encoded by a nucleic acid of the invention (one, of
course, that contains coding sequence) or a mutant or fragment
(e.g., an antigenic peptide fragment) thereof. Alternatively, an
animal can be immunized with a tissue sample (e.g., a crude tissue
preparation, a whole cell (living, lysed, or fractionated) or a
membrane fraction). Thus, antibodies of the invention can
specifically bind to a purified antigen or a tissue (e.g., a tissue
section, a whole cell (living, lysed, or fractionated) or a
membrane fraction).
[0322] In the event an antigenic peptide is used, it can include at
least eight (e.g., 10, 15, 20, or 30) consecutive amino acid
residues found in a protein of the invention. The antibodies
generated can specifically bind to one of the proteins in their
native form (thus, antibodies with linear or conformational
epitopes are within the invention), in a denatured or otherwise
non-native form, or both. Conformational epitopes can sometimes be
identified by identifying antibodies that bind to a protein in its
native form, but not in a denatured form.
[0323] The host animal (e.g., a rabbit, mouse, guinea pig, or rat)
can be immunized with the antigen, optionally linked to a carrier
(i.e., a substance that stabilizes or otherwise improves the
immunogenicity of an associated molecule), and optionally
administered with an adjuvant (see, e.g., Ausubel et al., supra).
An exemplary carrier is keyhole limpet hemocyanin (KLH) and
exemplary adjuvants, which will be selected in view of the host
animal's species, include Freund's adjuvant (complete or
incomplete), adjuvant mineral gels (e.g., aluminum hydroxide),
surface active substances such as lysolecithin, pluronic polyols,
polyanions, peptides, oil emulsions, dinitrophenol, BCG (bacille
Calmette-Guerin), and Corynebacterium parvum. KLH is also sometimes
referred to as an adjuvant. The antibodies generated in the host
can be purified by, for example, affinity chromatography methods in
which the polypeptide antigen is immobilized on a resin.
[0324] Epitopes encompassed by an antigenic peptide may be located
on the surface of the protein (e.g., in hydrophilic regions), or in
regions that are highly antigenic (such regions can be selected,
initially, by virtue of containing many charged residues). An Emini
surface probability analysis of human protein sequences can be used
to indicate the regions that have a particularly high probability
of being localized to the surface of the protein.
[0325] The antibody can be a fully human antibody (e.g., an
antibody made in a mouse that has been genetically engineered to
produce an antibody from a human immunoglobulin sequence, such as
that of a human immunoglobulin gene (the kappa, lambda, alpha (IgA1
and IgA2), gamma (IgG1, IgG2, IgG3, IgG4), delta, epsilon and mu
constant region genes or the myriad immunoglobulin variable region
genes). Alternatively, the antibody can be a non-human antibody
(e.g., a rodent (e.g., a mouse or rat), goat, or non-human primate
(e.g., monkey) antibody).
[0326] Methods of producing antibodies are well known in the art.
For example, as noted above, human monoclonal antibodies can be
generated in transgenic mice carrying the human immunoglobulin
genes rather than those of the mouse. Splenocytes obtained from
these mice (after immunization with an antigen of interest) can be
used to produce hybridomas that secrete human mAbs with specific
affinities for epitopes from a human protein (see, e.g., WO
91/00906, WO 91/10741; WO 92/03918; WO 92/03917; Lonberg et al.,
Nature 368:856-859, 1994; Green et al., Nature Genet. 7:13-21,
1994; Morrison et al. Proc. Natl. Acad. Sci. USA 81:6851-6855,
1994; Bruggeman et al., Immunol. 7:33-40, 1993; Tuaillon et al.,
Proc. Natl. Acad. Sci. USA 90:3720-3724, 1993; and Bruggeman et
al., Eur. J. Immunol 21:1323-1326, 1991).
[0327] The antibody can also be one in which the variable region,
or a portion thereof (e.g., a CDR), is generated in a non-human
organism (e.g., a rat or mouse). Thus, the invention encompasses
chimeric, CDR-grafted, and humanized antibodies and antibodies that
are generated in a non-human organism and then modified (m, e.g.,
the variable framework or constant region) to decrease antigenicity
in a human. Chimeric antibodies (i.e., antibodies in which
different portions are derived from different animal species (e.g.,
the variable region of a murine mAb and the constant region of a
human immunoglobulin) can be produced by recombinant techniques
known in the art. For example, a gene encoding the Fc constant
region of a murine (or other species) monoclonal antibody molecule
can be digested with restriction enzymes to remove the region
encoding the murine Fc, and the equivalent portion of a gene
encoding a human Fc constant region can be substituted therefore
[see European Patent Application Nos. 125,023; 184,187; 171,496;
and 173,494; see also WO 86/01533; U.S. Pat. No. 4,816,567; Better
et al., Science 240:1041-1043, (1988); Liu et al., Proc. Natl.
Acad. Sci. USA 84:3439-3443, (1987); Liu et al., J. Immunol.
139:3521-3526, (1987); Sun et al., Proc. Natl. Acad. Sci. USA
84:214-218, (1987); Nishimura et al., Cancer Res. 47:999-1005,
(1987); Wood et al., Nature 314:446-449, (1985); Shaw et al., J.
Natl. Cancer Inst. 80:1553-1559, (1988); Morrison et al., Proc.
Natl. Acad. Sci. USA 81:6851, (1984); Neuberger et al., Nature
312:604, (1984); and Takeda et al., Nature 314:452, (1984)].
[0328] In a humanized or CDR-grafted antibody, at least one or two,
but generally all three of the recipient CDRs (of heavy and or
light immuoglobulin chains) will be replaced with a donor CDR. One
need only replace the number of CDRs required for binding of the
humanized antibody to a protein described herein or a fragment
thereof. The donor can be a rodent antibody, and the recipient can
be a human framework or a human consensus framework. Typically, the
immunoglobulin providing the CDRs is called the "donor" (and is
often that of a rodent) and the immunoglobulin providing the
framework is called the "acceptor." The acceptor framework can be a
naturally occurring (e.g., a human) framework, a consensus
framework or sequence, or a sequence that is at least 85% (e.g.,
90%, 95%, 99%) identical thereto. A "consensus sequence" is one
formed from the most frequently occurring amino acids (or
nucleotides) in a family of related sequences (see, e.g., Winnaker,
From Genes to Clones, Verlagsgesellschaft, Weinheim, Germany,
1987). Each position in the consensus sequence is occupied by the
amino acid residue that occurs most frequently at that position in
the family (where two occur equally frequently, either can be
included). A "consensus framework" refers to the framework region
in the consensus immunoglobulin sequence.
[0329] An antibody can be humanized by methods known in the art.
For example, humanized antibodies can be generated by replacing
sequences of the Fv variable region that are not directly involved
in antigen binding with equivalent sequences from human Fv variable
regions. General methods for generating humanized antibodies are
provided by Morrison [Science 229:1202-1207, (1985)], Oi et al.
[BioTechniques 4:214, (1986)], and Queen et al. (U.S. Pat. Nos.
5,585,089; 5,693,761 and 5,693,762). Those nucleic acid sequences
required by these methods can be obtained from a hybridoma
producing an antibody the polypeptides of the present invention, or
fragments thereof. The recombinant DNA encoding the humanized
antibody, or fragment thereof, can then be cloned into an
appropriate expression vector.
[0330] Humanized or CDR-grafted antibodies can be produced such
that one, two, or all CDRs of an immunoglobulin chain can be
replaced [see, e.g., U.S. Pat. No. 5,225,539; Jones et al., Nature
321:552-525, (1986); Verhoeyan et al., Science 239:1534, (1988);
and Beidler et al., J. Immunol. 141:4053-4060, (1988)]. Thus, the
invention features humanized antibodies in which specific amino
acid residues have been substituted, deleted or added (m, e.g., in
the framework region to improve antigen binding). For example, a
humanized antibody will have framework residues identical to those
of the donor or to amino acid residues other than those of the
recipient framework residue. To generate such antibodies, a
selected, small number of acceptor framework residues of the
humanized immunoglobulin chain are replaced by the corresponding
donor amino acids. The substitutions can occur adjacent to the CDR
or in regions that interact with a CDR (U.S. Pat. No. 5,585,089,
see especially columns 12-16). Other techniques for humanizing
antibodies are described in EP 519596 A1.
[0331] In certain embodiments, the antibody has an effector
function and can fix complement, while in others it can neither
recruit effector cells nor fix complement. The antibody can also
have little or no ability to bind an Fc receptor. For example, it
can be an isotype or subtype, or a fragment or other mutant that
cannot bind to an Fc receptor (e.g., the antibody can have a mutant
(e.g., a deleted) Fc receptor binding region). The antibody may or
may not alter (e.g., increase or decrease) the activity of a
protein to which it binds.
[0332] In other embodiments, the antibody can be coupled to a
heterologous substance, such as a toxin (e.g., ricin, diphtheria
toxin, or active fragments thereof), another type of therapeutic
agent (e.g., an antibiotic), or a detectable label. A detectable
label can include an enzyme (e.g., horseradish peroxidase, alkaline
phosphatase, .beta.-galactosidase, or acetylcholinesterase), a
prosthetic group (e.g., streptavidin/biotin and avidin/biotin), or
a fluorescent, luminescent, bioluminescent, or radioactive
material.(e.g., umbelliferone, fluorescein, fluorescein
isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein,
dansyl chloride or phycoerythrin (which are fluorescent), luminol
(which is luminescent), luciferase, luciferin, and aequorin (which
are bioluminescent), and .sup.125I, .sup.131I, .sup.35S or .sup.3H
(which are radioactive)).
[0333] The antibodies of the invention (e.g., a monoclonal
antibody) can be used to isolate the proteins of the invention (by,
for example, affinity chromatography or immunoprecipitation) or to
detect them in, for example, a cell lysate or supernatant (by
Western blotting, ELISAs, radioimmune assays, and the like) or a
histological section. One can therefore determine the abundance and
pattern of expression of a particular protein. This information can
be useful in making a diagnosis or in evaluating the efficacy of a
clinical test.
[0334] The invention also includes the nucleic acids that encode
the antibodies described above and vectors and cells (e.g.,
mammalian cells such as CHO cells or lymphatic cells) that contain
them. Similarly, the invention includes cell lines (e.g.,
hybridomas) that make the antibodies of the invention and methods
of making those cell lines.
[0335] Non-human transgenic animals are also within the scope of
the invention. These animals can be used to study the function or
activity of proteins of the invention and to identify or evaluate
agents that modulate their activity. A "transgenic animal" can be a
mammal (e.g., a mouse, rat, dog, pig, cow, sheep, goat, or
non-human primate), an avian (e.g., a chicken), or an amphibian
(e.g. a frog) having one or more cells that include a transgene
(e.g., an exogenous DNA molecule or a rearrangement (e.g., deletion
of) endogenous chromosomal DNA). The transgene can be integrated
into or can occur within the genome of the cells of the animal, and
it can direct the expression of an encoded gene product in one or
more types of cells or tissues. Alternatively, a transgene can
"knock out" or reduce gene expression. This can occur when an
endogenous gene has been altered by homologous recombination, which
occurs between it and an exogenous DNA molecule that was introduced
into a cell of the animal (e.g., an embryonic cell) at a very early
stage in the animal's development.
[0336] Intronic sequences and polyadenylation signals can be
included in the transgene and, when present, can increase
expression. One or more tissue-specific regulatory sequences can
also be operably linked to a transgene of the invention to direct
expression of protein to particular cells (exemplary regulatory
sequences are described above, and many others are known to those
of ordinary skill in the art).
[0337] A "founder" animal is one that carries a transgene of the
invention in its genome or expresses mRNA from the transgene in its
cells or tissues. Founders can be bred to produce a line of
transgenic animals carrying the founder's transgene or bred with
founders carrying other transgenes (in which case the progeny would
bear the transgenes borne by both founders). Accordingly, the
invention features founder animals, their progeny, cells or
populations of cells obtained therefrom, and proteins obtained
therefrom. For example, a nucleic acid of the invention can be
placed under the control of a promoter that directs expression of
the encoded protein in the milk or eggs of the transgenic animal.
The protein can then be purified or recovered from the animal's
milk or eggs. Animals suitable for such purpose include pigs, cows,
goats, sheep, and chickens.
[0338] The biomolecular sequences of the present invention can be
divided to functional groups, according to GeneOntology
classification (see the website of GeneOntology dot org), defined
by the activity of the original sequences from which the new
variants have been identified or to which the novel genes are
homologous. Based on this classification it is possible to identify
diseases and conditions which can be diagnosed and treated using
novel sequence information and annotations such as those uncovered
by the present invention.
[0339] Immunoglobulin:
[0340] This category contains proteins that are involved in the
immune and complement systems such as antigens and autoantigens,
immunoglobulins, MHC and HLA proteins and their associated
proteins.
[0341] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases involving the immunological
system including inflammation, autoimmune diseases, infectious
diseases, as well as cancerous processes; while probe sequences or
antibodies may be used for diagnosis of such diseases.
[0342] Transcription Factor Binding:
[0343] This category contains proteins involved in transcription
factors binding, RNA and DNA binding, such as transcription
factors, RNA and DNA binding proteins, zinc fingers, helicase,
isomerase, histones, nucleases.
[0344] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases involving transcription
factors binding proteins, for example diseases where there is
non-normal replication or transcription of DNA and RNA
respectively; while probe sequences or antibodies may be used for
diagnosis of such diseases.
[0345] Small GTPase Regulatory/Interacting Protein:
[0346] This category contains proteins such as RAB escort protein,
guanyl-nucleotide exchange factor, guanyl-nucleotide exchange
factor adaptor, GDP-dissociation inhibitor, GTPase inhibitor,
GTPase activator, guanyl-nucleotide releasing factor,
GDP-dissociation stimulator, regulator of G-protein signaling, RAS
interactor, RHO interactor, RAB interactor, RAL interactor.
[0347] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases in which the
signal-transduction, typically involving G-proteases is non-normal,
either as a cause, or as a result of the disease; while probe
sequences or antibodies may be used for diagnosis of such
diseases.
[0348] Calcium Binding:
[0349] This category contains calcium binding proteins, ligand
binding or carriers, such as diacylglycerol kinase, Calpain,
calcium-dependent protein serine/threonine phosphatase, calcium
sensing proteins, calcium storage proteins.
[0350] Oxidoreductase:
[0351] This category contains enzymes that catalyze
oxidation-reduction reactions, such as oxidoreductases acting on
the following groups of donors: CH--OH, CH--CH, CH--NH2, CH--NH;
oxidoreductases acting on NADH or NADPH, nitrogenous compounds,
sulfur group of donors, heme group, hydrogen group, diphenols and
related substances as donors; oxidoreductases acting on peroxide as
acceptor, superoxide radicals as acceptor, oxidizing metal ions,
CH2 groups; oxidoreductases acting on reduced ferredoxin as donor;
oxidoreductases acting on reduced flavodoxin as donor; and
oxidoreductases acting on the aldehyde or oxo group of donors.
[0352] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases caused by non-normal
activity of oxidoreductases; while probe sequences or antibodies
may be used for diagnosis of such diseases.
[0353] Receptors:
[0354] This category contains various receptors, such as signal
transducers, complement receptors, ligand-dependent nuclear
receptors, transmembrane receptors, GPI-anchored membrane-bound
receptors, various coreceptors, internalization receptors,
receptors to neurotransmitters, hormones and various other
effectors and ligands.
[0355] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases caused by non-normal
activity of oxidoreductases diseases involving various receptors,
including receptors to neurotransmitters, hormones and various
other effectors and ligands; while probe sequences or antibodies
may be used for diagnosis of such diseases.
[0356] Examples of these diseases include, but are not limited to,
chronic myelomonocytic leukemia caused by growth factor beta
receptor deficiency [Rao D S, Chang J C, Kumar P D, Mizukami I,
Smithson G M, Bradley S V, Parlow A F, Ross T S (2001) Mol Cell
Biol, 21(22):7796-806], thrombosis associated with
protease-activated receptor deficiency [Sambrano G R, Weiss E J,
Zheng Y W, Huang W, Coughlin S R (2001) Nature, 413(6851):26-7],
hypercholesterolemia associated with low density lipoprotein
receptor deficiency [Koivisto U M, Hubbard A L, Mellman I (2001)
Cell, 105(5):575-85], familial Hibernian fever associated with
tumour necrosis factor receptor deficiency [Simon A, Drenth J P,
van der Meer J W (2001) Ned Tijdschr Geneeskd, 145(2):77-8],
colitis associated with immunoglobulin E receptor expression
[Dombrowicz D, Nutten S, Desreumaux P, Neut C, Torpier G, Peeters
M, Colombel J F, Capron M (2001) J Exp Med, 193(1):25-34], and
alagille syndrome associated with Jagged1 [Stankiewicz P, Rujner J,
Loffler C, Kruger A, Nimmakayalu M, Pilacik B, Krajewska-Walasek M,
Gutkowska A, Hansmann I, Giannakudis I (2001) Am J Med Genet,
103(2):166-71].
[0357] Protein Serine/Threonine Kinases:
[0358] This category contains kinases which phosphorilate
serine/threonine residues, mainly involved in signal transduction,
such as transmembrane receptor protein serine/threonine kinase,
3-phosphoinositide-dependent protein kinase, DNA-dependent protein
kinase, G-protein-coupled receptor phosphorylating protein kinase,
SNF1A/AMP-activated protein kinase, casein kinase, calmodulin
regulated protein kinase, cyclic-nucleotide dependent protein
kinase, cyclin-dependent protein kinase, eukaryotic translation
initiation factor 2alpha kinase, galactosyltransferase-associated
kinase, glycogen synthase kinase 3, protein kinase C, receptor
signaling protein serine/threonine kinase, ribosomal protein S6
kinase, IkB kinase.
[0359] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases which may be ameliorated by
a modulating kinase activity, which is one of the main signaling
pathways inside cell; while probe sequences or antibodies may be
used for diagnosis of such diseases.
[0360] Channel/Pore Class Transporters:
[0361] This category contains proteins that mediate the transport
of molecules and macromolecules across membranes, such as
alpha-type channels, porins, pore-forming toxins.
[0362] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases in which the transport of
molecules and macromolecules such as neurotransmitters, hormones,
sugar etc. is non-normal leading to various pathologies; while
probe sequences or antibodies may be used for diagnosis of such
diseases.
[0363] Hydrolases, Acting on Acid Anhydrides:
[0364] This category contains hydrolytic enzymes that are acting on
acid anhydrides, such as hydrolases acting on acid anhydrides, in
phosphorus-containing anhydrides, in sulfonyl-containing
anhydrides; and hydrolases catalysing transmembrane movement of
substances, and involved in cellular and subcellular movement.
[0365] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases in which the
hydrolase-related activities are non-normal (increased or
decreased); while probe sequences or antibodies may be used for
diagnosis of such diseases.
[0366] Transferases, Transferring Phosphorus-Containing Groups:
[0367] This category contains various enzymes that catalyze the
transfer of phosphate from one molecule to another, such as
phosphotransferases using the following groups as acceptors:
alcohol group, carboxyl group, nitrogenous group, phosphate;
phosphotransferases with regeneration of donors catalysing
intramolecular transfers; diphosphotransferases;
nucleotidyltransferase; and phosphotransferases for other
substituted phosphate groups.
[0368] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases in which the transfer of
functional group to a modulated moiety is not normal so that a
beneficial effect may be achieved by modulation of such transfer;
while probe sequences or antibodies may be used for diagnosis of
such diseases.
[0369] Phosphoric Monoester Hydrolases:
[0370] This category contains hydrolytic enzymes that are acting on
ester bonds, such as: nuclease, sulfuric ester hydrolase,
carboxylic ester hydrolase, thiolester hydrolase, phosphoric
monoester hydrolase, phosphoric diester hydrolase, triphosphoric
monoester hydrolase, diphosphoric monoester hydrolase, and
phosphoric triester hydrolase.
[0371] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases in which the hydrolytic
cleavage of a covalent bond with accompanying addition of water,
--H being added to one product of the cleavage and --OH to the
other, is not normal so that a beneficial effect may be achieved by
modulation of such reaction; while probe sequences or antibodies
may be used for diagnosis of such diseases.
[0372] Enzyme Inhibitors:
[0373] This category contains inhibitors and suppressors of other
proteins and enzymes, such as inhibitors of: kinases, phosphatases,
chaperones, guanylate cyclase, DNA gyrase, ribonuclease, proteasome
inhibitors, diazepam-binding inhibitor, ornithine decarboxylase
inhibitor, GTPase inhibitors, dUTP pyrophosphatase inhibitor,
phospholipase inhibitor, proteinase inhibitor, protein biosynthesis
inhibitors, alpha-amylase inhibitors.
[0374] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases in which beneficial effect
may be achieved by modulating the activity of inhibitors and
suppressors of proteins and enzymes; while probe sequences or
antibodies may be used for diagnosis of such diseases.
[0375] Electron Transporters:
[0376] This category contains ligand binding or carrier proteins
involved in electron transport, such as: flavin-containing electron
transporter, cytochromes, electron donors, electron acceptors,
electron carriers, and cytochrome-c oxidases.
[0377] Transferases, Transferring Glycosyl Groups:
[0378] This category contains various enzymes that catalyze the
transfer of a chemical group, such as a glycosyl, from one molecule
to another. It covers enzymes such as murein lytic
endotransglycosylase E, and sialyltransferase.
[0379] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases in which the transfer of a
glycosyl chemical group from one molecule to another is not normal
so that a beneficial effect may be achieved by modulation of such
reaction; while probe sequences or antibodies may be used for
diagnosis of such diseases.
[0380] Ligases, Forming Carbon-Oxygen Bonds:
[0381] This category contains enzymes that catalyze the linkage
between carbon and oxygen, such as ligase forming aminoacyl-tRNA
and related compounds.
[0382] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases in which the linkage between
carbon and oxygen in an energy dependent process is not normal so
that a beneficial effect may be achieved by modulation of such
reaction; while probe sequences or antibodies may be used for
diagnosis of such diseases.
[0383] Ligases:
[0384] This category contains enzymes that catalyze the linkage of
two molecules, generally utilizing ATP as the energy donor, also
called synthetase. It covers enzymes such as beta-alanyl-dopamine
hydrolase, carbon-oxygen bonds forming ligase, carbon-sulfur bonds
forming ligase, carbon-nitrogen bonds forming ligase, carbon-carbon
bonds forming ligase, and phosphoric ester bonds forming
ligase.
[0385] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases in which the joining
together of two molecules in an energy dependent process is not
normal so that a beneficial effect may be achieved by modulation of
such reaction; while probe sequences or antibodies may be used for
diagnosis of such diseases.
[0386] Hydrolases, Acting on Glycosyl Bonds:
[0387] This category contains hydrolytic enzymes that are acting on
glycosyl bonds, such as hydrolases hydrolyzing N-glycosyl
compounds, S-glycosyl compounds, and O-glycosyl compounds.
[0388] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases in which the
hydrolase-related activities are non-normal (increased or
decreased); while probe sequences or antibodies may be used for
diagnosis of such diseases.
[0389] Kinases:
[0390] This category contains kinases, which phosphorilate
serine/threonine or tyrosine residues, mainly involved in signal
transduction. It covers enzymes such as
2-amino-4-hydroxy-6-hydroxymethyldihydropteridine
pyrophosphokinase, NAD(+) kinase, acetylglutamate kinase, adenosine
kinase, adenylate kinase, adenylsulfate kinase, arginine kinase,
aspartate kinase, choline kinase, creatine kinase, cytidylate
kinase, deoxyadenosine kinase, deoxycytidine kinase, deoxyguanosine
kinase, dephospho-CoA kinase, diacylglycerol kinase, dolichol
kinase, ethanolamine kinase, galactokinase, glucokinase, glutamate
5-kinase, glycerol kinase, glycerone kinase, guanylate kinase,
hexokinase, homoserine kinase, hydroxyethylthiazole kinase,
inositol/phosphatidylinositol kinase, ketohexokinase, mevalonate
kinase, nucleoside-diphosphate kinase, pantothenate kinase,
phosphoenolpyruvate carboxykinase, phosphoglycerate kinase,
phosphomevalonate kinase, protein kinase, pyruvate dehydrogenase
(lipoamide) kinase, pyruvate kinase, ribokinase, ribose-phosphate
pyrophosphokinase, selenide, water dikinase, shikimate kinase,
thiamine pyrophosphokinase, thymidine kinase, thymidylate kinase,
uridine kinase, xylulokinase, 1D-myo-inositol-trisphosphate
3-kinase, phosphofructokinase, pyridoxal kinase, sphinganine
kinase, riboflavin kinase, 2-dehydro-3-deoxygalactonokinase,
2-dehydro-3-deoxygluconokinase,
4-diphosphocytidyl-2C-methyl-D-erythritol kinase, GTP
pyrophosphokinase, L-fuculokinase, L-ribulokinase, L-xylulokinase,
isocitrate dehydrogenase (NADP+)] kinase, acetate kinase, allose
kinase, carbamate kinase, cobinamide kinase, diphosphate-purine
nucleoside kinase, fructokinase, glycerate kinase,
hydroxymethylpyrimidine kinase, hygromycin-B kinase, inosine
kinase, kanamycin kinase, phosphomethylpyrimidine kinase,
phosphoribulokinase, polyphosphate kinase, propionate kinase,
pyruvate, water dikinase, rhamnulokinase, tagatose-6-phosphate
kinase, tetraacyldisaccharide 4'-kinase, thiamine-phosphate kinase,
undecaprenol kinase, uridylate kinase, N-acylmannosamine kinase,
D-erythro-sphingosine kinase.
[0391] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases which may be ameliorated by
a modulating kinase activity, which is one of the main signaling
pathways inside cell; while probe sequences or antibodies may be
used for diagnosis of such diseases.
[0392] Examples of these diseases include, but are not limited to,
acute lymphoblastic leukemia associated with spleen tyrosine kinase
deficiency [Goodman P A, Wood C M, Vassilev A, Mao C, Uckun F M
(2001) Oncogene, 20(30):3969-78), ataxia telangiectasia associated
with ATM kinase deficiency (Boultwood J (2001) J Clin Pathol,
54(7):512-6], congenital haemolytic anaemia associated with
erythrocyte pyruvate kinase deficiency [Zanella A, Bianchi P, Fermo
E, Iurlo A, Zappa M, Vercellati C, Boschetti C, Baronciani L,
Cotton F (2001) Br J Haematol, 113(1):43-8], mevalonic aciduria
caused by mevalonate kinase deficiency [Houten S M, Koster J,
Romeijn G J, Frenkel J, Di Rocco M, Caruso U, Landrieu P, Kelley R
I, Kuis W, Poll-The B T, Gibson K M, Wanders R J, Waterham H R
(2001) Eur J Hum Genet, 9(4):253-9], and acute myelogenous leukemia
associated with over-expressed death-associated protein kinase
[Guzman M L, Upchurch D, Grimes B, Howard D S, Rizzieri D A, Luger
S M, Phillips G L, Jordan C T (2001) Blood, 97(7):2177-9].
[0393] Nucleotide Binding:
[0394] This category contains ligand binding or carrier proteins,
involved in physical interaction with a nucleotide--any compound
consisting of a nucleoside that is esterified with [ortho]phosphate
or an oligophosphate at any hydroxyl group on the glycose moiety,
such as purine nucleotide binding proteins.
[0395] Tubulin Binding:
[0396] This category contains binding proteins that bind tubulin,
such as microtubule binding proteins.
[0397] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases which are associated with
non-normal tubulin activity or structure. Binding of the products
of the genes of this family, or antibodies reactive therewith, can
modulate a plurality of tubulin activities as well as change
microtubulin structure; while probe sequences or antibodies may be
used for diagnosis of such diseases.
[0398] Examples of these diseases include, but are not limited to,
Alzheimer's disease associated with t-complex polypeptide 1
deficiency [Schuller E, Gulesserian T, Seidl R, Cairns N, Lube G
(2001) Life Sci, 69(3):263-70], neurodegeneration associated with
apoE deficiency [Masliah E, Mallory M, Ge N, Alford M, Veinbergs I,
Roses A D (1995) Exp Neurol, 136(2):107-22], progressive axonopathy
associated with dysfunctional neurofilaments [Griffiths I R,
Kyriakides E, Barrie J (1989) Neuropathol Appl Neurobiol,
15(1):63-74], familial frontotemporal dementia associated with tau
deficiency [astor P, Pastor E, Carnero C, Vela R, Garcia T, Amer G,
Tolosa E, Oliva R (2001) Ann Neurol, 49(2):263-7], and colon cancer
suppressed by APC [White R L (1997) Pathol Biol (Paris),
45(3):240-4].
[0399] Receptor Signaling Proteins:
[0400] This category contains receptor proteins involved in signal
transduction, such as receptor signaling protein serine/threonine
kinase, receptor signaling protein tyrosine kinase, receptor
signaling protein tyrosine phosphatase, aryl hydrocarbon receptor
nuclear translocator, hematopoeitin/interferon-class (D200-domain)
cytokine receptor signal transducer, transmembrane receptor protein
tyrosine kinase signaling protein, transmembrane receptor protein
serine/threonine kinase signaling protein, receptor signaling
protein serine/threonine kinase signaling protein, receptor
signaling protein serine/threonine phosphatase signaling protein,
small GTPase regulatory/interacting protein, receptor signaling
protein tyrosine kinase signaling protein, receptor signaling
protein serine/threonine phosphatase.
[0401] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases in which the
signal-transduction is non-normal, either as a cause, or as a
result of the disease; while probe sequences or antibodies may be
used for diagnosis of such diseases.
[0402] Examples of these diseases include, but are not limited to,
complete hypogonadotropic hypogonadism associated with GnRH
receptor deficiency [Kottler M L, Chauvin S, Lahlou N, Harris C E,
Johnston C J, Lagarde J P, Bouchard P, Farid N R, Counis R (2000) J
Clin Endocrinol Metab, 85(9):3002-8], severe combined
immunodeficiency disease associated with IL-7 receptor deficiency
(Puel A, Leonard W J (2000) Curr Opin Immunol, 12(4):468-73),
schizophrenia associated N-methyl-D-aspartate receptor deficiency
(Mohn A R, Gainetdinov R R, Caron M G, Koller B H (1999) Cell,
98(4):427-36), Yersinia-associated arthritis associated with tumor
necrosis factor receptor p55 deficiency [Zhao Y X, Zhang H, Chiu B,
Payne U, Inman R D (1999) Arthritis Rheum, 42(8):1662-72], and
Dwarfism of Sindh caused by growth hormone-releasing hormone
receptor deficiency [aheshwari H G, Silverman B L, Dupuis J,
Baumann G (1998) J Clin Endocrinol Metab, 83(10:4065-74].
[0403] Molecular Function Unknown:
[0404] This category contains various proteins with unknown
molecular function, such as cell surface antigens.
[0405] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases in which regulation of the
recognition, or participation or bind of cell surface antigens to
other moieties may improve the disease. These diseases include
autoimmune diseases, various infectious diseases, cancer diseases
which involve non cell surface antigens recognition and activity,
etc; while probe sequences or antibodies may be used for diagnosis
of such diseases.
[0406] Enzyme Activators:
[0407] This category contains enzyme regulators, such as activators
of: kinases, phosphatases, sphingolipids, chaperones, guanylate
cyclase, tryptophan hydroxylase, proteases, phospholipases,
caspases, proprotein convertase 2 activator, cyclin-dependent
protein kinase 5 activator, superoxide-generating NADPH oxidase
activator, sphingomyelin phosphodiesterase activator, monophenol
monooxygenase activator, proteasome activator, GTPase
activator.
[0408] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases in which beneficial effect
may be achieved by modulating the activity of activators of
proteins and enzymes; while probe sequences or antibodies may be
used for diagnosis of such diseases.
[0409] Transferases, Transferring One-Carbon Groups:
[0410] This category contains various enzymes that catalyze the
transfer of a chemical group, such as a one-carbon, from one
molecule to another. The category covers enzymes such as
methyltransferase, amidinotransferase, hydroxymethyl-, formyl- and
related transferase, carboxyl- and carbamoyltransferase.
[0411] Pharmaceutical compositions including such proteins or
protein encoding to sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases in which the transfer of a
one-carbon chemical group from one molecule to another is not
normal so that a beneficial effect may be achieved by modulation of
such reaction; while probe sequences or antibodies may be used for
diagnosis of such diseases.
[0412] Transferases:
[0413] This category contains various enzymes that catalyze the
transfer of a chemical group, such as a phosphate or amine, from
one molecule to another. It covers enzymes such as: transferases,
transferring one-carbon groups, aldehyde or ketonic groups, acyl
groups, glycosyl groups, alkyl or aryl (other than methyl) groups,
nitrogenous, phosphorus-containing groups, sulfur-containing
groups, lipoyltransferase, deoxycytidyl transferases.
[0414] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases in which the transfer of a
chemical group from one molecule to another is not normal so that a
beneficial effect may be achieved by modulation of such reaction;
while probe sequences or antibodies may be used for diagnosis of
such diseases.
[0415] Chaperone:
[0416] This category contains functional classes of unrelated
families of proteins that assist the correct non-covalent assembly
of other polypeptide-containing structures in vivo, but are not
components of these assembled structures when they a performing
their normal biological function. The category covers proteins such
as: ribosomal chaperone, peptidylprolyl isomerase, lectin-binding
chaperone, nucleosome assembly chaperone, chaperonin ATPase,
cochaperone, heat shock protein, HSP70/HSP90 organizing protein,
fimbrial chaperone, metallochaperone, tubulin folding,
HSC70-interacting protein.
[0417] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases which are associated with
non-normal protein activity or structure or abnormal degradation of
such proteins; while probe sequences or antibodies may be used for
diagnosis of such diseases.
[0418] Cell Adhesion Molecule:
[0419] This category contains proteins that serve as adhesion
molecules between adjoining cells, such as: membrane-associated
protein with guanylate kinase activity, cell adhesion receptor,
neuroligin, calcium-dependent cell adhesion molecule, selectin,
calcium-independent cell adhesion molecule, extracellular matrix
protein.
[0420] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases in which adhesion between
adjoining cells is involved, typically conditions in which the
adhesion is non-normal; while probe sequences or antibodies may be
used for diagnosis of such diseases. Typical examples of such
conditions are cancer conditions in which non-normal adhesion may
cause and enhance the process of metastasis. Other examples of such
conditions include conditions of non-normal growth and development
of various tissues in which modulation adhesion among adjoining
cells can improve the condition.
[0421] Examples of theses diseases include, but are not limited to,
Wiskott-Aldrich syndrome associated with WAS deficiency [Westerberg
L, Greicius G, Snapper S B, Aspenstrom P, Severinson E (2001)
Blood, 98(4):1086-94], asthma associated with intercellular
adhesion molecule-1 deficiency [Tang M L, Fiscus L C (2001) Pulm
Pharmacol Ther, 14(3):203-10], intra-atrial thrombogenesis
associated with increased von Willebrand factor activity [Fukuchi
M, Watanabe J, Kumagai K, Katori Y, Baba S, Fukuda K, Yagi T,
Iguchi A, Yokoyama H, Miura M, Kagaya Y, Sato S, Tabayashi K,
Shirato K (2001) J Am Coll Cardiol, 37(5):1436-42], junctional
epidermolysis bullosa associated with laminin 5 beta3 deficiency
[Robbins P B, Lin Q, Goodnough J B, Tian H, Chen X, Khavari P A
(2001) Proc Natl Acad Sci USA, 98(9):5193-8], and hydrocephalus
caused by neural adhesion molecule L1 deficiency [Rolf B, Kutsche
M, Bartsch U (2001) Brain Res, 891(1-2):247-52].
[0422] Motor Proteins:
[0423] This category contains proteins that are held to generate
force or energy by the hydrolysis of ATP and that functions in the
production of intracellular movement or transportation. It covers
proteins such as: microfilament motor, axonemal motor, microtubule
motor, and kinetochore motor (like dynein, kinesin, or myosin).
[0424] Defense/Immunity Proteins:
[0425] This category contains proteins that are involved in the
immune and complement systems, such as acute-phase response
proteins, antimicrobial peptides, antiviral response proteins,
blood coagulation factors, complement components, immunoglobulins,
major histocompatibility complex antigens, opsonins.
[0426] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases involving the immunological
system including inflammation, autoimmune diseases, infectious
diseases, as well as cancerous processes or diseases which are
manifested by non-normal coagulation processes, which may include
abnormal bleeding or excessive coagulation; while probe sequences
or antibodies may be used for diagnosis of such diseases.
[0427] Examples of these diseases include, but are not limited to,
late (C5-9) complement component deficiency associated with opsonin
receptor allotypes [Fijen C A, Bredius R G, Kuijper E J, Out T A,
De Haas M, De Wit A P, Daha M R, De Winkel J G (2000) Clin Exp
Immunol, 120(2):338-45], combined immunodeficiency associated with
defective expression of MHC class II genes [Griscelli C,
Lisowska-Grospierre B, Mach B (1989) Immunodefic Rev 1(2):135-53],
loss of antiviral activity of CD4 T cells caused by neutralization
of endogenous TNF alpha [Pavic I, Polic B, Crnkovic I, Lucin P,
Jonjic S, Koszinowski U H (1993) J Gen Virol, 74 (Pt 10):2215-23],
autoimmune diseases associated with natural resistance-associated
macrophage protein deficiency [Evans C A, Harbuz M S, Ostenfeld T,
Norrish A, Blackwell J M (2001) Neurogenetics, 3(2):69-78], and
Epstein-Barr virus-associated lymphoproliferative disease inhibited
by combined GM-CSF and IL-2 therapy [Baiocchi R A, Ward J S,
Carrodeguas L, Eisenbeis C F, Peng R, Roychowdhury S, Vourganti S,
Sekula T, O'Brien M, Moeschberger M, Caligiuri M A (2001) J Clin
Invest, 108(6): 887-94].
[0428] Intracellular Transporters:
[0429] This category contains proteins that mediate the transport
of molecules and macromolecules inside the cell, such as:
intracellular nucleoside transporter, vacuolar assembly proteins,
vesicle transporters, vesicle fusion proteins, type II protein
secretors.
[0430] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases in which the transport of
molecules and macromolecules is non-normal leading to various
pathologies; while probe sequences or antibodies may be used for
diagnosis of such diseases.
[0431] Transporters:
[0432] This category contains proteins that mediate the transport
of molecules and macromolecules, such as channels, exchangers,
pumps. The category covers proteins such as: amine/polyamine
transporter, lipid transporter, neurotransmitter transporter,
organic acid transporter, oxygen transporter, water transporter,
carriers, intracellular transportes, protein transporters, ion
transporters, carbohydrate transporter, polyol transporter, amino
acid transporters, vitamin/cofactor transporters, siderophore
transporter, drug transporter, channel/pore class transporter,
group translocator, auxiliary transport proteins, permeases, murein
transporter, organic alcohol transporter, nucleobase, nucleoside,
nucleotide and nucleic acid transporters.
[0433] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases in which the transport of
molecules and macromolecules such as neurotransmitters, hormones,
sugar etc. is non-normal leading to various pathologies; while
probe sequences or antibodies may be used for diagnosis of such
diseases.
[0434] Examples of these diseases include, but are not limited to,
glycogen storage disease caused by glucose-6-phosphate transporter
deficiency (Hiraiwa H, Chou J Y (2001) DNA Cell Biol,
20(8):447-53), tangier disease associated with ATP-binding cassette
transporter-1 deficiency (McNeish J, Aiello R J, Guyot D, Turi T,
Gabel C, Aldinger C, Hoppe K L, Roach M L, Royer L J, de Wet J,
Broccardo C, Chimini G, Francone O L (2000) Proc Natl Acad Sci USA,
97(8):4245-50), systemic primary carnitine deficiency associated
with organic cation transporter deficiency (Tang N L, Ganaphthy V,
Wu X, Hui J, Seth P, Yuen P M, Wanders R J, Fok T F, Hjelm N M
(1999) Hum Mol Genet, 8(4):655-60), Wilson disease associated with
copper-transporting ATPases deficiency (Payne A S, Kelly E J,
Gitlin J D (1998) Proc Natl Acad Sci USA, 95(18):10854-9), and
atelosteogenesis associated with diastrophic dysplasia sulphate
transporter deficiency (Newbury-Ecob R (1998) J Med Genet,
35(1):49-53).
[0435] Lyases:
[0436] This category contains enzymes that catalyze the formation
of double bonds by removing chemical groups from a substrate
without hydrolysis or catalyze the addition of chemical groups to
double bonds. It covers enzymes such as carbon-carbon lyase,
carbon-oxygen lyase, carbon-nitrogen lyase, carbon-sulfur lyase,
carbon-halide lyase, phosphorus-oxygen lyase, and other lyases.
[0437] Actin Binding Proteins:
[0438] This category contains actin binding proteins, such as actin
cross-linking, actin bundling, F-actin capping, actin monomer
binding, actin lateral binding, actin depolymerizing, actin monomer
sequestering, actin filament severing, actin modulating, membrane
associated actin binding, actin thin filament length regulation,
and actin polymerizing proteins.
[0439] Protein Binding Proteins:
[0440] This category contains various proteins, involved in diverse
biological functions, such as: intermediate filament binding,
LIM-domain binding, LLR-domain binding, clathrin binding, ARF
binding, vinculin binding, KU70 binding, troponin C binding
PDZ-domain binding, SH3-domain binding, fibroblast growth factor
binding, membrane-associated protein with guanylate kinase activity
interacting, Wnt-protein binding, DEAD/H-box RNA helicase binding,
beta-amyloid binding, myosin binding, TATA-binding protein binding
DNA topoisomerase I binding, polypeptide hormone binding, RHO
binding, FH 1-domain binding, syntaxin-1 binding,
HSC70-interacting, transcription factor binding, metarhodopsin
binding, tubulin binding, JUN kinase binding, RAN protein binding,
protein signal sequence binding, importin alpha export receptor,
poly-glutamine tract binding, protein carrier, beta-catenin
binding, protein C-terminus binding, lipoprotein binding,
cytoskeletal protein binding protein, nuclear localization sequence
binding, protein phosphatase 1 binding, adenylate cyclase binding,
eukaryotic initiation factor 4E binding, calmodulin binding,
collagen binding, insulin-like growth factor binding, lamin
binding, profilin binding, tropomyosin binding, actin binding,
peroxisome targeting sequence binding, SNARE binding, cyclin
binding.
[0441] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases which are associated with
non-normal protein activity or structure. Binding of the products
of the variants of this family, or antibodies reactive therewith,
can modulate a plurality of protein activities as well as change
protein structure; while probe sequences or antibodies may be used
for diagnosis of such diseases.
[0442] Ligand Binding or Carrier Proteins:
[0443] This category contains various proteins, involved in diverse
biological functions, such as: pyridoxal phosphate binding,
carbohydrate binding, magnesium binding, amino acid binding,
cyclosporin A binding, nickel binding, chlorophyll binding, biotin
binding, penicillin binding, selenium binding, tocopherol binding,
lipid binding, drug binding, oxygen transporter, electron
transporter, steroid binding, juvenile hormone binding, retinoid
binding, heavy metal binding, calcium binding, protein binding,
glycosaminoglycan binding, folate binding, odorant binding,
lipopolysaccharide binding, nucleotide binding.
[0444] ATPases:
[0445] This category contains enzymes that catalyze the hydrolysis
of ATP to ADP, releasing energy that is used in the cell; adenosine
triphosphatase. It covers enzymes such as plasma membrane
cation-transporting ATPase, ATP-binding cassette (ABC) transporter,
magnesium-ATPase, hydrogen-/sodium-translocating ATPase,
arsenite-transporting ATPase, protein-transporting ATPase, DNA
translocase, P-type ATPase, hydrolase, acting on acid to
anhydrides, --involved in cellular and subcellular movement.
[0446] Carboxylic Ester Hydrolases:
[0447] This category contains hydrolytic enzymes, acting on
carboxylic ester bonds, such as
N-acetylglucosaminylphosphatidylinositol deacetylase,
2-acetyl-1-alkylglycerophosphocholine esterase, aminoacyl-tRNA
hydrolase, arylesterase, carboxylesterase, cholinesterase,
gluconolactonase, sterol esterase, acetylesterase,
carboxymethylenebutenolidase, protein-glutamate methylesterase,
lipase, 6-phosphogluconolactonase.
[0448] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases in which the hydrolytic
cleavage of a covalent bond with accompanying addition of water,
--H being added to one product of the cleavage and --OH to the
other, is not normal so that a beneficial effect may be achieved by
modulation of such reaction; while probe sequences or antibodies
may be used for diagnosis of such diseases.
[0449] Hydrolase, Acting on Ester Bonds:
[0450] This category contains hydrolytic enzymes, acting on ester
bonds, such as nucleases, sulfuric ester hydrolase, carboxylic
ester hydrolases, thiolester hydrolase, phosphoric monoester
hydrolase, phosphoric diester hydrolase, triphosphoric monoester
hydrolase, diphosphoric monoester hydrolase, phosphoric triester
hydrolase.
[0451] Pharmaceutical compositions including such proteins or
protein encoding to sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases in which the hydrolytic
cleavage of a covalent bond with accompanying addition of water,
--H being added to one product of the cleavage and --OH to the
other, is not normal so that a beneficial effect may be achieved by
modulation of such reaction; while probe sequences or antibodies
may be used for diagnosis of such diseases.
[0452] Hydrolases:
[0453] This category contains hydrolytic enzymes, such as
GPI-anchor transamidase, peptidases, hydrolases, acting on ester
bonds, glycosyl bonds, ether bonds, carbon-nitrogen (but not
peptide) bonds, acid anhydrides, acid carbon-carbon bonds, acid
halide bonds, acid phosphorus-nitrogen bonds, acid sulfur-nitrogen
bonds, acid carbon-phosphorus bonds, acid sulfur-sulfur bonds.
[0454] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases in which the hydrolytic
cleavage of a covalent bond with accompanying addition of water,
--H being added to one product of the cleavage and --OH to the
other, is not normal so that a beneficial effect may be achieved by
modulation of such reaction; while probe sequences or antibodies
may be used for diagnosis of such diseases.
[0455] Enzymes:
[0456] This category contains naturally occurring or synthetic
macromolecular substance composed wholly or largely of protein,
that catalyzes, more or less specifically, one or more
(bio)chemical reactions at relatively low temperatures. The action
of RNA that has catalytic activity (ribozyme) is often also
regarded as enzymic. Nevertheless, enzymes are mainly proteinaceous
and are often easily inactivated by heating or by
protein-denaturing agents. The substances upon which they act are
known as substrates, for which the enzyme possesses a specific
binding or active site.
[0457] This category covers various proteins possessing enzymatic
activities, such as mannosylphosphate transferase,
para-hydroxybenzoate:polyprenyltransferase, Rieske iron-sulfur
protein, imidazoleglycerol-phosphate synthase, sphingosine
hydroxylase, tRNA 2'-phosphotransferase, sterol C-24(28) reductase,
C-8 sterol isomerase, C-22 sterol desaturase, C-14 sterol
reductase, C-3 sterol dehydrogenase (C-4 sterol decarboxylase),
3-keto sterol reductase, C-4 methyl sterol oxidase,
dihydronicotinamide riboside quinone reductase, glutamate phosphate
reductase, DNA repair enzyme, telomerase, alpha-ketoacid
dehydrogenase, beta-alanyl-dopamine synthase, RNA editase,
aldo-keto reductase, alkylbase DNA glycosidase, glycogen
debranching enzyme, dihydropterin deaminase, dihydropterin oxidase,
dimethylnitrosamine demethylase, ecdysteroid UDP-glucosyl/UDP
glucuronosyl transferase, glycine cleavage system, helicase,
histone deacetylase, mevaldate reductase, monooxygenase,
poly(ADP-ribose) glycohydrolase, pyruvate dehydrogenase, serine
esterase, sterol carrier protein X-related thiolase, transposase,
tyramine-beta hydroxylase, para-aminobenzoic acid (PABA) synthase,
glu-tRNA(gln) amidotransferase, molybdopterin cofactor sulfurase,
lanosterol 14-alpha-demethylase, aromatase, 4-hydroxybenzoate
octaprenyltransferase, 7,8-dihydro-8-oxoguanine-triphosphatase,
CDP-alcohol phosphotransferase,
2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidonone 5'-phosphate
deaminase, diphosphoinositol polyphosphate phosphohydrolase,
gamma-glutamyl carboxylase, small protein conjugating enzyme, small
protein activating enzyme, 1-deoxyxylulose-5-phosphate synthase,
2'-phosphotransferase,
2-octoprenyl-3-methyl-6-methoxy-1,4-benzoquinone hydroxylase,
2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, 3,4
dihydroxy-2-butanone-4-phosphate synthase,
4-amino-4-deoxychorismate lyase,
4-diphosphocytidyl-2C-methyl-D-erythritol synthase,
ADP-L-glycero-D-manno-heptose synthase,
D-erythro-7,8-dihydroneopterin triphosphate 2'-epimerase,
N-ethylmaleimide reductase, O-antigen ligase, O-antigen polymerase,
UDP-2,3-diacylglucosamine hydrolase, arsenate reductase, carnitine
racemase, cobalamin [5'-phosphate] synthase, cobinamide phosphate
guanylyltransferase, enterobactin synthetase, enterochelin
esterase, enterochelin synthetase, glycolate oxidase, integrase,
lauroyl transferase, peptidoglycan synthetase,
phosphopantetheinyltransferase, phosphoglucosamine mutase,
phosphoheptose isomerase, quinolinate synthase, siroheme synthase,
N-acylmannosamine-6-phosphate 2-epimerase,
N-acetyl-anhydromuramoyl-L-alanine amidase, carbon-phosphorous
lyase, heme-copper terminal oxidase, disulfide oxidoreductase,
phthalate dioxygenase reductase, sphingosine-1-phosphate lyase,
molybdopterin oxidoreductase, dehydrogenase, NADPH oxidase,
naringenin-chalcone synthase, N-ethylammeline chlorohydrolase,
polyketide synthase, aldolase, kinase, phosphatase, CoA-ligase,
oxidoreductase, transferase, hydrolase, lyase, isomerase, ligase,
ATPase, sulfhydryl oxidase, lipoate-protein ligase,
delta-1-pyrroline-5-carboxyate synthetase, lipoic acid synthase,
and tRNA dihydrouridine synthase.
[0458] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases which can be ameliorated by
modulating the activity of various enzymes which are involved both
in enzymatic processes inside cells as well as in cell signaling;
while probe sequences or antibodies may be used for diagnosis of
such diseases.
[0459] Cytoskeletal Proteins:
[0460] This category contains proteins involved in the structure
formation of the cytoskeleton.
[0461] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases which are caused or due to
abnormalities in cytoskeleton, including cancerous cells, and
diseased cells including those which do not propagate, grow or
function normally; while probe sequences or antibodies may be used
for diagnosis of such diseases.
[0462] Structural Proteins:
[0463] This category contains proteins involved in the structure
formation of the cell, such as: structural proteins of ribosome,
cell wall structural proteins, structural proteins of cytoskeleton,
extracellular matrix structural proteins, extracellular matrix
glycoproteins, amyloid proteins, plasma proteins, structural
proteins of eye lens, structural protein of chorion (sensu
Insecta), structural protein of cuticle (sensu Insecta), puparial
glue protein (sensu Diptera), structural proteins of bone, yolk
proteins, structural proteins of muscle, structural protein of
vitelline membrane (sensu Insecta), structural proteins of
peritrophic membrane (sensu Insecta), structural proteins of
nuclear pores.
[0464] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases which are caused or due to
abnormalities in cytoskelaton, including cancerous cells, and
diseased cells including those which do not propagate, grow or
function normally; while probe sequences or antibodies may be used
for diagnosis of such diseases.
[0465] Ligands:
[0466] This category contains proteins that bind to another
chemical entity to form a larger complex, involved in various
biological processes, such as signal trunsduction, metabolism,
growth and differentiation, etc. The category covers ligands such
as: opioid peptides, baboon receptor ligand, branchless receptor
ligand, breathless receptor ligand, ephrin, frizzled receptor
ligand, frizzled-2 receptor ligand, heartless receptor ligand,
Notch receptor ligand, patched receptor ligand, punt receptor
ligand, Ror receptor ligand, saxophone receptor ligand, SE20
receptor ligand, sevenless receptor ligand, smooth receptor ligand,
thickveins receptor ligand, Toll receptor ligand, Torso receptor
ligand, death receptor ligand, scavenger receptor ligand,
neuroligin, integrin ligand, hormones, pheromones, growth factors,
sulfonylurea receptor ligand.
[0467] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases which involve non-normal
secretion of proteins which may be due to non-normal presence,
absence or non-normal response to normal levels of secreted
proteins including hormones, neurotransmitters, and various other
proteins secreted by cells to the extracellular environment or
diseases which are endocrine in nature (cause or are a result of
hormones); while probe sequences or antibodies may be used for
diagnosis of such diseases.
[0468] Examples of these diseases include, but are not limited to,
analgesia inhibited by orphanin FQ/nociceptin [Shane R, Lazar D A,
Rossi G C, Pasternak G W, Bodnar R J (2001) Brain Res,
907(1-2):109-16], stroke protected by estrogen [Alkayed N J, Goto
S, Sugo N, Joh H D, Klaus J, Crain B J, Bernard O, Traystman R J,
Hurn P D (2001) J Neurosci, 21(19):7543-50], atherosclerosis
associated with growth hormone deficiency [Elhadd T A, Abdu T A,
Oxtoby J, Kennedy G, McLaren M, Neary R, Belch J J, Clayton R N
(2001) J Clin Endocrinol Metab, 86(9):4223-32], diabetes inhibited
by alpha-galactosylceramide [Hong S, Wilson M T, Serizawa I, Wu L,
Singh N, Naidenko O V, Miura T, Haba T, Scherer D C, Wei J,
Kronenberg M, Koezuka Y, Van Kaer L (2001) Nat Med, 7(9):1052-6],
and Huntington's disease associated with huntingtin deficiency [Rao
D S, Chang J C, Kumar P D, Mizukami I, Smithson G M, Bradley S V,
Parlow A F, Ross T S (2001) Mol Cell Biol, 21(22):7796-806].
[0469] Signal Transducer:
[0470] This category contains various signal transducers, such as:
activin inhibitors, receptor-associated proteins, alpha-2
macroglobulin receptors, morphogens, quorum sensing signal
generators, quorum sensing response regulators, receptor signaling
proteins, ligands, receptors, two-component sensor molecules,
two-component response regulators.
[0471] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases in which the
signal-transduction is non-normal, either as a cause, or as a
result of the disease; while probe sequences or antibodies may be
used for diagnosis of such diseases.
[0472] Examples of these diseases include, but are not limited to,
altered sexual dimorphism associated with signal transducer and
activator of transcription 5b [Udy G B, Towers R P, Snell R G,
Wilkins R J, Park S H, Ram P A, Waxman D J, Davey H W (1997) Proc
Natl Acad Sci USA, 94(14):7239-44], multiple sclerosis associated
with sgp130 deficiency [Padberg F, Feneberg W, Schmidt S, Schwarz M
J, Korschenhausen D, Greenberg B D, Nolde T, Muller N, Trapmann H,
Konig N, Moller H J, Hampel H (1999) J Neuroimmunol, 99(2):218-23],
intestinal inflammation associated with elevated signal transducer
and activator of transcription 3 activity [Suzuki A, Hanada T,
Mitsuyama K, Yoshida T, Kamizono S, Hoshino T, Kubo M, Yamashita A,
Okabe M, Takeda K, Akira S, Matsumoto S, Toyonaga A, Sata M,
Yoshimura A (2001) J Exp Med, 193(4):471-81], carcinoid tumor
inhibited by increased signal transducer and activators of
transcription 1 and 2 [Zhou Y, Wang S, Gobl A, Oberg K (2001)
Oncology, 60(4):330-8], and esophageal cancer associated with loss
of EGF-STAT1 pathway [Watanabe G, Kaganoi J, Imamura M, Shimada Y,
Itami A, Uchida S, Sato F, Kitagawa M (2001) Cancer J,
7(2):132-9].
[0473] RNA Polymerase II Transcription Factors:
[0474] This category contains proteins, such as specific and
non-specific RNA polymerase II transcription factors, enhancer
binding, ligand-regulated transcription factor, general RNA
polymerase II transcription factors.
[0475] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases involving RNA polymerase II
transcription factors, for example diseases where there is
non-normal transcription of RNA; while probe sequences or
antibodies may be used for diagnosis of such diseases.
[0476] RNA Binding Proteins:
[0477] This category contains RNA binding proteins involved in
splicing and translation regulation, such as tRNA binding proteins,
RNA helicases, double-stranded RNA and single-stranded RNA binding
proteins, mRNA binding proteins, snRNA cap binding proteins, 5S RNA
and 7S RNA binding proteins, poly-pyrimidine tract binding
proteins, snRNA binding proteins, and AU-specific RNA binding
proteins.
[0478] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases involving transcription and
translation factors such as: helicases, isomerases, histones and
nucleases, for example diseases where there is non-normal
transcription, splicing, post-transcriptional processing,
translation or stability of the RNA; while probe sequences or
antibodies may be used for diagnosis of such diseases.
[0479] Nucleic Acid Binding Proteins:
[0480] This category contains proteins involved in RNA and DNA
synthesis and expression regulation, such as transcription factors,
RNA and DNA binding proteins, zinc fingers, helicase, isomerase,
histones, nucleases, ribonucleoproteins, transcription and
translation factors and other.
[0481] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat diseases involving DNA or RNA binding
proteins such as: helicases, isomerases, histones and nucleases,
for example diseases where there is non-normal replication or
transcription of DNA and RNA respectively; while probe sequences or
antibodies may be used for diagnosis of such diseases.
[0482] Proteins Involved in Metabolism:
[0483] The totality of the chemical reactions and physical changes
that occur in living organisms, comprising anabolism and
catabolism; may be qualified to mean the chemical reactions and
physical processes undergone by a particular substance, or class of
substances, in a living organism.
[0484] This category covers proteins involved in the reactions of
cell growth and maintenance, such as: metabolism resulting in cell
growth, carbohydrate metabolism, energy pathways, electron
transport, nucleobase, nucleoside, nucleotide and nucleic acid
metabolism, protein metabolism and modification, amino acid and
derivative metabolism, protein targeting, lipid metabolism,
aromatic compound metabolism, one-carbon compound metabolism,
coenzymes and prosthetic group metabolism, sulfur metabolism,
phosphorus metabolism, phosphate metabolism, oxygen and radical
metabolism, xenobiotic metabolism, nitrogen metabolism, fat body
metabolism (sensu Insecta), protein localization, catabolism,
biosynthesis, toxin metabolism, methylglyoxal metabolism, cyanate
metabolism, glycolate metabolism, carbon utilization, antibiotic
metabolism.
[0485] Examples of metabolism-related diseases include, but are not
limited to, multisystem mitochondrial disorder caused by
mitochondrial DNA cytochrome C oxidase II deficiency [Campos Y,
Garcia-Redondo A, Fernandez-Moreno M A, Martinez-Pardo M, Goda G,
Rubio J C, Martin M A, del Hoyo P, Cabello A, Bornstein B, Garesse
R, Arenas J (2001) Ann Neurol Sep; 50(3):409-13], conduction
defects and ventricular dysfunction in the heart associated with
heterogeneous connexin43 expression [Gutstein D E, Morley G E,
Vaidya D, Liu F, Chen F L, Stuhlmann H, Fishman G I (2001)
Circulation, 104(10):1194-9], atherosclerosis associated with
growth suppressor p27 deficiency [Diez-Juan A, Andres V (2001)
FASEB J, 15(11):1989-95], colitis associated with glutathione
peroxidase deficiency [Esworthy R S, Aranda R, Martin M G, Doroshow
J H, Binder S W, Chu F F (2001) Am J Physiol Gastrointest Liver
Physiol, 281(3):G848-55], and systemic lupus erythematosus
associated with deoxyribonuclease I deficiency [Yasutomo K,
Horiuchi T, Kagami S, Tsukamoto H, Hashimura C, Urushihara M,
Kuroda Y (2001) Nat Genet, 28(4):313-4].
[0486] Cell Growth and/or Maintenance Proteins:
[0487] This category contains proteins involved in any biological
process required for cell survival, growth and maintenance. It
covers proteins involved in biological processes such as: cell
organization and biogenesis, cell growth, cell proliferation,
metabolism, cell cycle, budding, cell shape and cell size control,
sporulation (sensu Saccharomyces), transport, ion homeostasis,
autophagy, cell motility, chemi-mechanical coupling, membrane
fusion, cell-cell fusion, stress response.
[0488] Pharmaceutical compositions including such proteins or
protein encoding sequences, antibodies directed against such
proteins or polynucleotides capable of altering expression of such
proteins may be used to treat or prevent diseases such as cancer,
degenerative diseases, for example neurodegenerative diseases or
conditions associated with aging, or alternatively, diseases
wherein apoptosis which should have taken place, does not take
place; while probe sequences or antibodies may be used for
diagnosis of such diseases. Detection of pre-disposition to a
disease, as well as for determination of the stage of the disease
can also be effected
[0489] Examples of these diseases include, but are not limited to,
ataxia-telangiectasia associated with ataxia-telangiectasia mutated
deficiency [Hande et al (2001) Hum Mol Genet, 10(5):519-28],
osteoporosis associated with osteonectin deficiency [Delany et al
(2000) J Clin Invest, 105(7):915-23], arthritis caused by
membrane-bound matrix metalloproteinase deficiency [Holmbeck et al
(1999) Cell, 99(1):81-92], defective stratum corneum and early
neonatal death associated with transglutaminase 1 deficiency
[Matsuki et al (1998) Proc Natl Acad Sci USA, 95(3):1044-9], and
Alzheimer's disease associated with estrogen [Simpkins et al (1997)
Am J Med, 103(3A):19S-25S].
[0490] Thus, the nucleic acid sequences of the present invention
and the proteins encoded thereby and the cells and antibodies
described hereinabove can be used in, for example, screening
assays, therapeutic or prophylactic methods of treatment, or
predictive medicine (e.g., diagnostic and prognostic assays,
including those used to monitor clinical trials, and
pharmacogenetics).
[0491] More specifically, the nucleic acids of the invention can be
used to: (i) express a protein of the invention in a host cell (in
culture or in an intact multicellular organism following, e.g.,
gene therapy, given, of course, that the transcript in question
contains more than untranslated sequence); (ii) detect an mRNA; or
(iii) detect an alteration in a gene to which a nucleic acid of the
invention specifically binds; or to modulate such a gene's
activity.
[0492] The nucleic acids and proteins of the invention can also be
used to treat disorders characterized by either insufficient or
excessive production of those nucleic acids or proteins, a failure
in a biochemical pathway in which they normally participate in a
cell, or other aberrant or unwanted activity relative to the wild
type protein (e.g., inappropriate enzymatic activity or
unproductive protein folding). The proteins of the invention are
especially useful in screening for naturally occurring protein
substrates or other compounds (e.g., drugs) that modulate protein
activity. The antibodies of the invention can also be used to
detect and isolate the proteins of the invention, to regulate their
bioavailability, or otherwise modulate their activity. These uses,
and the methods by which they can be achieved, are described in
detail below.
Screening Assays
[0493] The present invention provides methods (or "screening
assays") for identifying agents (or "test compounds" that bind to
or otherwise modulate (i.e., stimulate or inhibit) the expression
or activity of a nucleic acid of the present invention or the
protein it encodes. An agent may be, for example, a small molecule
such as a peptide, peptidomimetic (e.g., a peptoid), an amino acid
or an analog thereof, a polynucleotide or an analog thereof, a
nucleotide or an analog thereof, or an organic or inorganic
compound (e.g., a heteroorganic or organometallic compound) having
a molecular weight less than about 10,000 (e.g., about 5,000,
1,000, or 500) grams per mole and salts, esters, and other
pharmaceutically acceptable forms of such compounds.
[0494] Agents identified in the screening assays can be used, for
example, to modulate the expression or activity of the nucleic
acids or proteins of the invention in a therapeutic protocol, or to
discover more about the biological functions of the proteins.
[0495] The assays can be constructed to screen for agents that
modulate the expression or activity of a protein of the invention
or another cellular component with which it interacts. For example,
where the protein of the invention is an enzyme, the screening
assay can be constructed to detect agents that modulate either the
enzyme's expression or activity or that of its substrate. The
agents tested can be those obtained from combinatorial libraries.
Methods known in the art allow the production and screening of:
biological libraries; peptoid libraries [i.e., libraries of
molecules that function as peptides even though they have a
non-peptide backbone that confers resistance to enzymatic
degradation; see, e.g., Zuckermann et al., J. Med. Chem.
37:2678-85, (1994)]; spatially addressable parallel solid phase or
solution phase libraries; synthetic libraries requiring
deconvolution; "one-bead one-compound" libraries; and synthetic
libraries. The biological and peptoid libraries can be used to test
only peptides, but the other four are applicable to testing
peptides, non-peptide oligomers or libraries of small molecules
[Lam, Anticancer Drug Des. 12:145, (1997)]. Molecular libraries can
be synthesized as described by DeWitt et al. [Proc. Natl. Acad.
Sci. USA 90:6909, (1993)] Erb et al. [Proc. Natl. Acad. Sci. USA
91:11422, (1994)] Zuckermann et al. [J. Med. Chem. 37:2678, (1994)]
Cho et al. [Science 261:1303, (1993)] and Gallop et al. [J. Med.
Chem. 37:1233, (1994)].
[0496] Libraries of compounds may be presented in solution [see,
e.g., Houghten, Biotechniques 13:412-421, (1992)], or on beads
[Lam, Nature 354:82-84, (1991)], chips [Fodor, Nature 364:555-556,
(1993)], bacteria or spores (U.S. Pat. No. 5,223,409), plasmids
[Cull et al., Proc Natl Acad Sci USA 89:1865-1869, (1992)] or on
phage [Scott and Smith, Science 249:386-390, (1990); Devlin,
Science 249:404-406, (1990); Cwirla et al., Proc. Natl. Acad. Sci.
USA 87:6378-6382, (1990); Felici, J. Mol. Biol. 222:301-310,
(1991); and U.S. Pat. No. 5,223,409].
[0497] The screening assay can be a cell-based assay, in which case
the screening method includes contacting a cell that expresses a
protein of the invention with a test compound and determining the
ability of the test compound to modulate the protein's activity.
The cell used can be a mammalian cell, including a cell obtained
from a human or from a human cell line.
[0498] Alternatively, or in addition to examining the ability of an
agent to modulate expression or activity generally, one can examine
the ability of an agent to interact with, for example, to
specifically bind to, a nucleic acid or protein of the invention.
For example, one can couple an agent (e.g., a substrate) to a label
(those described above, including radioactive or enzymatically
active substances, are suitable), contact the nucleic acid or
protein of the invention with the labeled agent, and determine
whether they bind one another (by detecting, for example, a complex
containing the nucleic acid or protein and the labeled agent).
Labels are not, however, always required. For example, one can use
a microphysiometer to detect interaction between an agent and a
protein of the invention, neither of which were previously labeled
[McConnell et al., Science 257:1906-1912, (1992). A
microphysiometer (also known as a cytosensor) is an analytical
instrument that measures the rate at which a cell acidifies its
environment. The instrument uses a light-addressable potentiometric
sensor (LAPS), and changes in the acidification rate indicate
interaction between an agent and a protein of the invention.
Molecular interactions can also be detected using fluorescence
energy transfer (FET; see, e.g., U.S. Pat. Nos. 5,631,169 and
4,868,103). An FET binding event can be conveniently measured
through fluorometric detection means well known in the art (e.g.,
by means of a fluorimeter). Where analysis in real time is
desirable, one can examine the interaction (e.g., binding) between
an agent and a protein of the invention with Biomolecular
Interaction Analysis [BIA; see, e.g., Sjolander and Urbaniczky
Anal. Chem. 63:2338-2345, (1991) and Szabo et al., Curr. Opin.
Struct. Biol. 5:699-705, (1995)]. BIA allows one to detect
biospecific interactions in real time without labeling any of the
interactants (e.g., BIAcore).
[0499] The screening assays can also be cell-free assays (i.e.,
soluble or membrane-bound forms of the proteins of the invention,
including the variants, mutants, and other fragments described
above, can be used to identify agents that bind those proteins or
otherwise modulate their expression or activity). The basic
protocol is the same as that for a cell-based assay in that, in
either case, one must contact the protein of the invention with an
agent of interest [for a sufficient time and under appropriate
(e.g., physiological) conditions] to allow any potential
interaction to occur and then determine whether the agent binds the
protein or otherwise modulates its expression or activity.
[0500] Those of ordinary skill in the art will, however, appreciate
that there are differences between cell-based and cell-free assays.
For example, when membrane-bound forms of the protein are used, it
may be desirable to utilize a solubilizing agent (e.g., non-ionic
detergents such as n-octylglucoside, n-dodecylglucoside,
n-dodecylmaltoside, octanoyl-N-methylglucamide,
decanoyl-N-methylglucamide, Triton.RTM. X-100, Triton.RTM. X-114,
Thesit.RTM., Isotridecypoly(ethylene glycol ether).sub.n,
3-[(3-cholamidopropyl)dimethylamminio]-1-propane sulfonate (CHAPS),
3-[(3-cholamidopropyl)dimethylamminio]-2-hydroxy-1-propane
sulfonate (CHAPSO), or N-dodecyl=N,N-dimethyl-3-ammonio-1-propane
sulfonate).
[0501] In the assays of the invention, any of the proteins
described herein or the agents being tested can be anchored to a
solid phase or otherwise immobilized (assays in which one of two
substances that interact with one another are anchored to a solid
phase are sometimes referred to as "heterogeneous" assays). For
example, a protein of the present invention can be anchored to a
microtiter plate, a test tube, a microcentrifuge tube, a column, or
the like before it is exposed to an agent. Any complex that forms
on the solid phase is detected at the end of the period of
exposure. For example, a protein of the present invention can be
anchored to a solid surface, and the test compound (which is not
anchored and can be labeled, directly or indirectly) is added to
the surface bearing the anchored protein. Un-reacted (e.g.,
unbound) components can be removed (by, e.g., washing) under
conditions that allow any complexes formed to remain immobilized on
the solid surface, where they can be detected (e.g., by virtue of a
label attached to the protein or the agent or with a labeled
antibody that specifically binds an immobilized component and may,
itself, be directly or indirectly labeled).
[0502] One can immobilize either a protein of the present invention
or an antibody to which it specifically binds to facilitate
separation of complexed (or bound) protein from uncomplexed (or
unbound) protein. Such immobilization can also make it easier to
automate the assay, and fusing the proteins of the invention to
heterologous proteins can facilitate their immobilization. For
example, proteins fused to glutathione-S-transferase can be
adsorbed onto glutathione sepharose beads (Sigma Chemical Co., St.
Louis, Mo.) or glutathione derivatized microtiter plates, then
combined with the agent and incubated under conditions conducive to
complex formation (e.g., conditions in which the salt and pH levels
are within physiological levels). Following incubation, the solid
phase is washed to remove any unbound components (where the solid
phase includes beads, the matrix can be immobilized), the presence
or absence of a complex is determined. Alternatively, complexes can
be dissociated from a matrix, and the level of protein binding or
activity can be determined using standard techniques.
[0503] Immobilization can be achieved with methods known in the
art. For example, biotinylated protein can be prepared from
biotin-NHS (N-hydroxy-succinimide) using techniques known in the
art (e.g., the biotinylation kit from Pierce Chemicals, Rockford,
Ill.) and immobilized in the wells of streptavidin-coated tissue
culture plates (also from Pierce Chemical).
[0504] The screening assays of the invention can employ antibodies
that react with the proteins of the invention but do not interfere
with their activity. These antibodies can be derivatized to a solid
surface, where they will trap a protein of the invention. Any
interaction between a protein of the invention and an agent can
then be detected using a second antibody that specifically binds
the complex formed between the protein of the invention and the
agent to which it is bound.
[0505] Cell-free assays can also be conducted in a liquid phase, in
which case any reaction product can be separated (and thereby
detected) by, for example: differential centrifugation (Rivas and
Minton, Trends Biochem Sci 18:284-7, 1993); chromatography (e.g.,
gel filtration or ion-exchange chromatography); electrophoresis
[see, e.g., Ausubel et al., Eds., Current Protocols in Molecular
Biology, J. Wiley & Sons, New York, N.Y., (1999)]; or
immunoprecipitation [see, e.g., Ausubel et al. (supra); see also
Heegaard, J. Mol. Recognit. 11:141-148, (1998) and Hage and Tweed,
J. Chromatogr. Biomed. Sci. Appl. 699:499-525, (1997)].
Fluorescence energy transfer (see above) can also be used, and is
convenient because binding can be detected without purifying the
complex from solution. Assays in which the entire reaction of
interest is carried out in a liquid phase are sometimes referred to
as homogeneous assays.
[0506] The screening methods of the invention can also be designed
as competition assays in which an agent and a substance that is
known to bind a protein of the present invention compete to bind
that protein. Depending upon the order of addition of reaction
components and the reaction conditions (e.g., whether the reaction
is allowed to reach equilibrium), agents that inhibit complex
formation can be distinguished from those that disrupt preformed
complexes.
[0507] In either approach, the order in which reactants are added
can be varied to obtain different information about the agents
being tested. For example, agents that interfere with the
interaction between a gene product and one or more of its binding
partners (by, e.g., competing with the binding partner), can be
identified by adding the binding partner and the agent to the
reaction at about the same time. Agents that disrupt preformed
complexes (by, e.g., displacing one of the components from the
complex), can be added after a complex containing the gene product
and its binding partner has formed.
[0508] The proteins of the invention can also be used as "bait
proteins" in a two- or three-hybrid assay [see, e.g., U.S. Pat. No.
5,283,317; Zervos et al., Cell 72:223-232, (1993); Madura et al.,
J. Biol. Chem. 268:12046-12054, (1993); Bartel et al. Biotechniques
14:920-924, (1993); Iwabuchi et al., Oncogene 8:1693-1696, (1993);
and WO 94/10300] to identify other proteins that bind to (e.g.,
specifically bind to) or otherwise interact with a protein of the
invention. Such binding proteins can activate or inhibit the
proteins of the invention (and thereby influence the biochemical
pathways and events in which those proteins are active).
[0509] As noted above, the screening assays of the invention can be
used to identify an agent that inhibits the expression of a protein
of the invention by, for example, inhibiting the transcription or
translation of a nucleic acid that encodes it. In these assays, one
can contact a cell or cell free mixture with the agent and then
evaluate mRNA or protein expression relative to the levels that are
observed in the absence of the agent (a statistically significant
increase in expression indicating that the agent stimulates mRNA or
protein expression and a decrease (again, one that is statistically
significant) indicating tat the agent inhibits mRNA or protein
expression). Methods for determining levels of mRNA or protein
expression are known in the art and, here, would employ the nucleic
acids, proteins, and antibodies of the present invention.
[0510] It should be noted that if desired, two or more of the
methods described herein can be practiced together. For example,
one can evaluate an agent that was first identified in a cell-based
assay in a cell free assay. Similarly, and the ability of the agent
to modulate the activity of a protein of the invention can be
confirmed in vivo (e.g., in a transgenic animal).
[0511] The screening methods of the present invention can also be
used to identify proteins (in the event transcripts of the present
invention encode proteins) that are associated (e.g., causally)
with drug resistance. One can then block the activity of these
proteins (with, e.g., an antibody of the invention) and thereby
improve the ability of a therapeutic agent to exert a desirable
effect on a cell or tissue in a subject (e.g., a human
patient).
[0512] Monitoring the influence of therapeutic agents (e.g., drugs)
or other events (e.g., radiation therapy) on the expression or
activity of a biomolecular sequence of the present invention can be
useful in clinical trials (a desired extension of the screening
assays described above). For example, agents that exert an effect
by, in part, altering the expression or activity of a protein of
the invention ex vivo can be tested for their ability to do so as
the treatment progresses in a subject. Moreover, in animal or
clinical trials, the expression or activity of a nucleic acid can
be used, optionally in conjunction with that of other genes, as a
"read out" or marker of the phenotype of a particular cell.
Detection Assays
[0513] The nucleic acid sequences of the invention can serve as
polynucleotide reagents that are useful in detecting a specific
nucleic acid sequence. For example, one can use the nucleic acid
sequences of the present invention to map the corresponding genes
on a chromosome (and thereby discover which proteins of the
invention are associated with genetic disease) or to identify an
individual from a biological sample (i.e., to carry out tissue
typing, which is useful in criminal investigations and forensic
science). The novel transcripts of the present invention can be
used to identify those tissues or cells affected by a disease
(e.g., the nucleic acids of the invention can be used as markers to
identify cells, tissues, and specific pathologies, such as cancer),
and to identify individuals who may have or be at risk for a
particular cancer. Specific methods of detection are described
herein and are known to those of ordinary skill in the art.
[0514] The nucleic acids of the present invention can be used to
determine whether a particular individual is the source of a
biological sample (e.g., a blood sample). This is presently
achieved by examining restriction fragment length polymorphisms
(RFLPs; U.S. Pat. No. 5,272,057), and the sequences disclosed here
are useful as additional DNA markers for RFLP. For example, one can
digest a sample of an individual's genomic DNA, separate the
fragments (e.g. by Southern blotting), and expose the fragments to
probes generated from the nucleic acids of the present invention
(methods employing restriction endonucleases are discussed further
below). If the pattern of binding matches that obtained from a
tissue of an unknown source, then the individual is the source of
the tissue.
[0515] The nucleic acids of the present invention can also be used
to determine the sequence of selected portions of an individual's
genome. For example, the sequences that represent new genes can be
used to prepare primers that can be used to amplify an individual's
DNA and subsequently sequence it. Panels of DNA sequences (each
amplified with a different set of primers) can uniquely identify
individuals (as every person will have unique sequences due to
allelic differences).
[0516] Allelic variation occurs to some degree in the coding
regions of these sequences, and to a greater degree in the
noncoding regions. Each of the sequences described herein can, to
some degree, be used as a standard against which DNA from an
individual can be compared for identification purposes. Because
greater numbers of polymorphisms occur in the noncoding regions,
fewer sequences are necessary to differentiate individuals. The
noncoding sequences disclosed herein can provide positive
individual identification with a panel of perhaps 10 to 1,000
primers which each yield a noncoding amplified sequence of 100
bases. If predicted coding sequences are used, a more appropriate
number of primers for positive individual identification would be
500-2,000.
[0517] If a panel of reagents from the nucleic acids described
herein is used to generate a unique identification database for an
individual, those same reagents can later be used to identify
tissue from that individual. Using the database, the individual,
whether still living or dead, can subsequently be linked to even
very small tissue samples.
[0518] DNA-based identification techniques, including those in
which small samples of DNA are amplified (e.g, by PCR) can also be
used in forensic biology. Sequences amplified from tissues (such as
hair or skin) or body fluids (such as blood, saliva, or semen)
found at a crime scene can be compared to a standard (e.g.,
sequences obtained and amplified from a suspect), thereby allowing
one to determine whether the suspect is the source of the tissue or
bodily fluid.
[0519] The nucleic acids of the invention, when used as probes or
primers, can target specific loci in the human genome. This will
improve the reliability of DNA-based forensic identifications
because the more identifying markers examined, the less likely it
is that one individual will be mistaken for another. Moreover,
tests that rely on obtaining actual genomic sequence (which is
possible here) are more accurate than those in which identification
is based on the patterns formed by restriction enzyme generated
fragments.
[0520] The nucleic acids of the invention can also be used to study
the expression of the mRNAs in histological sections (i.e., they
can be used in in situ hybridization). This approach can be useful
when forensic pathologists are presented with tissues of unknown
origin or when the purity of a population of cells (e.g., a cell
line) is in question. The nucleic acids can also be used in
diagnosing a particular condition and in monitoring a treatment
regime.
Predictive Medicine
[0521] The nucleic acids, proteins, antibodies, and cells described
hereinabove are generally useful in the field of predictive
medicine and, more specifically, are useful in diagnostic and
prognostic assays and in monitoring clinical trials. For example,
one can determine whether a subject is at risk of developing a
disorder associated with a lesion in, or the misexpression of, a
nucleic acid of the invention (e.g., a cancer such as pancreatic
cancer, breast cancer, or a cancer within the urinary system). In
addition, the nucleic acids expressed in tumor tissues and not in
normal tissues are markers that can be used to determine whether a
subject has or is likely to develop a particular type of
cancer.
[0522] The "subject" referred to in the context of any of the
methods of the present invention, is a vertebrate animal (e.g., a
mammal such as an animal commonly used in experimental studies
(e.g. rats, mice, rabbits and guinea pigs); a domesticated animal
(e.g., a dog or cat); an animal kept as livestock (e.g., a pig,
cow, sheep, goat, or horse); a non-human primate (e.g. an ape,
monkey, or chimpanzee); a human primate; an avian (e.g., a
chicken); an amphibian (e.g., a frog); or a reptile. The animal can
be an unborn animal (accordingly, the methods of the invention can
be used to carry out genetic screening or to make prenatal
diagnoses). The subject can also be a human.
[0523] The methods related to predictive medicine can also be
carried out by using a nucleic acid of the invention to, for
example detect, in a tissue of a subject: (i) the presence or
absence of a mutation that affects the expression of the
corresponding gene (e.g., a mutation in the 5' regulatory region of
the gene); (ii) the presence or absence of a mutation that alters
the structure of the corresponding gene; (iii) an altered level
(i.e., a non-wild type level) of mRNA of the corresponding gene
(the proteins of the invention can be similarly used to detect an
altered level of protein expression); (iv) a deletion or addition
of one or more nucleotides from the nucleic acid sequences of the
present invention; (v) a substitution of one or more nucleotides in
the nucleic acid sequences of the present invention (e.g., a point
mutation); (vi) a gross chromosomal rearrangement (e.g., a
translocation, inversion, or deletion); or (vii) aberrant
modification of a gene corresponding to the nucleic acid sequences
of the present invention (e.g., modification of the methylation
pattern of the genomic DNA). Similarly, one can test for
inappropriate post-translational modification of any protein
encoded. Abnormal expression or abnormal gene or protein structures
indicate that the subject is at risk for the associated
disorder.
[0524] A genetic lesion can be detected by, for example, providing
an oligonucleotide probe or primer having a sequence that
hybridizes to a sense or antisense strand of a nucleic acid
sequence of the present invention, a naturally occurring mutant
thereof, or the 5' or 3' sequences that are naturally associated
with the corresponding gene, and exposing the probe or primer to a
nucleic acid within a tissue of interest (e.g., a tumor). One can
detect hybridization between the probe or primer and the nucleic
acid of the tissue by standard methods (e.g., in situ
hybridization) and thereby detect the presence or absence of the
genetic lesion. Where the probe or primer specifically hybridizes
with a new splice variant, the probe or primer can be used to
detect a non-wild type splicing pattern of the mRNA. The antibodies
of the invention can be similarly used to detect the presence or
absence of a protein encoded by a mutant, mis-expressed, or
otherwise deficient gene. Diagnostic and prognostic assays are
described further below.
[0525] Qualitative or quantitative analyses (which reveal the
presence or absence of a substance or its level of expression or
activity, respectively) can be carried out for any one of the
nucleic acid sequences of the present invention, or (where the
nucleic acid encodes a protein) the proteins they encode, by
obtaining a biological sample from a subject and contacting the
sample with an agent capable of specifically binding a nucleic acid
represented by the nucleic acid sequences of the present invention
or a protein those nucleic acids encode. The conditions in which
contacting is performed should allow for specific binding. Suitable
conditions are known to those of ordinary skill in the art. The
biological sample can be a tissue, a cell, or a bodily fluid (e.g.,
blood or serum), which may or may not be extracted from the subject
(i.e., expression can be monitored in vivo).
[0526] More specifically, the expression of a nucleic acid sequence
can be examined by, for example, Southern or Northern analyses,
polymerase chain reaction analyses, or with probe arrays. For
example, one can diagnose a condition associated with expression or
mis-expression of a gene by isolating mRNA from a cell and
contacting the mRNA with a nucleic acid probe with which it can
hybridize under stringent conditions (the characteristics of useful
probes are known to those of ordinary skill in the art and are
discussed elsewhere herein). The mRNA can be immobilized on a
surface (e.g., a membrane, such as nitrocellulose or other
commercially available membrane) following gel electrophoresis.
[0527] Alternatively, one or more nucleic acids (the target
sequence or the probe) can be distributed on a two-dimensional
array (e.g., a gene chip). Arrays are useful in detecting mutations
because a probe positioned on the array can have one or more
mismatches to a nucleic acid of the invention (e.g., a
destabilizing mismatch). For example, genetic mutations in any of
nucleic acid sequences of the present invention can be identified
in two-dimensional arrays containing light-generated DNA probes
[Cronin et al., Human Mutation 7:244-255, (1996)]. Briefly, when a
light-generated DNA probe is used, a first array of probes is used
to scan through long stretches of DNA in a sample and a control to
identify base changes between the sequences by making linear arrays
of sequential overlapping probes. This step allows the
identification of point mutations, and it can be followed by use of
a second array that allows the characterization of specific
mutations by using smaller, specialized probe arrays complementary
to all variants or mutations detected. Each mutation array is
composed of parallel probe sets, one complementary to the wild-type
gene and the other complementary to the mutant gene. Arrays are
discussed further below; see also; Kozal et al. [Nature Medicine
2:753-759, (1996)].
[0528] The level of an mRNA in a sample can also be evaluated with
a nucleic acid amplification technique e.g., RT-PCR (U.S. Pat. No.
4,683,202), ligase chain reaction [LCR; Barany, Proc. Natl. Acad.
Sci. USA 88:189-193, (1991)]; LCR can be particularly useful for
detecting point mutations), self sustained sequence replication
[Guatelli et al., Proc. Natl. Acad. Sci. USA 87:1874-1878, (1990)],
transcriptional amplification system [Kwoh et al., Proc. Natl.
Acad. Sci. USA 86:1173-1177, (1989)], Q-Beta Replicase [Lizardi et
al., Bio/Technology 6:1197, (1988)], or rolling circle replication
(U.S. Pat. No. 5,854,033). Following amplification, the nucleic
acid can be detected using techniques known in the art.
Amplification primers are a pair of nucleic acids that anneal to 5'
or 3' regions of a gene (plus and minus strands, respectively, or
vice-versa) at some distance (possibly a short distance) from one
another. For example, each primer can consist of about 10 to 30
nucleotides and bind to sequences that are about 50 to 200
nucleotides apart. Serial analysis of gene expression can be used
to detect transcript levels (U.S. Pat. No. 5,695,937). Other useful
amplification techniques (useful in, for example, detecting an
alteration in a gene) include anchor PCR or RACE PCR.
[0529] Mutations in the gene sequences of the invention can also be
identified by examining alterations in restriction enzyme cleavage
patterns. For example, one can isolate DNA from a sample cell or
tissue and a control, amplify it (if necessary), digest it with one
or more restriction endonucleases, and determine the length(s) of
the fragment(s) produced (e.g., by gel electrophoresis). If the
size of the fragment obtained from the sample is different from the
size of the fragment obtained from the control, there is a mutation
in the DNA in the sample tissue. Sequence specific ribozymes (see,
for example, U.S. Pat. No. 5,498,531) can be used to detect
specific mutations by development or loss of a ribozyme cleavage
site.
[0530] Any sequencing reaction known in the art (including those
that are automated) can also be used to determine whether there is
a mutation, and, if so, how the mutant differs from the wild type
sequence. Mutations can also be identified by using cleavage agents
to detect mismatched bases in RNA/RNA or RNA/DNA duplexes [Myers et
al., Science 230:1242, (1985); Cotton et al., Proc. Natl. Acad.
Sci. USA 85:4397, (1988); Saleeba et al., Methods Enzymol.
217:286-295, (1992)]. Mismatch cleavage reactions employ one or
more proteins that recognize mismatched base pairs in
double-stranded DNA (so called "DNA mismatch repair" enzymes; e.g.,
the mutY enzyme of E. coli cleaves A at G/A mismatches and the
thymidine DNA glycosylase from HeLa cells cleaves T at G/T
mismatches [see Hsu et al., Carcinogenesis 15:1657-1662, (1994) and
U.S. Pat. No. 5,459,039].
[0531] Alterations in electrophoretic mobility can also be used to
identify mutations. For example, single strand conformation
polymorphism (SSCP) can be used to detect differences in
electrophoretic mobility between mutant and wild type nucleic acids
[Orita et al., Proc. Natl. Acad. Sci. USA 86:2766, (1989); see also
Cotton Mutat. Res. 285:125-144, (1993); and Hayashi, Genet. Anal.
Tech. Appl. 9:73-79, (1992)]. Single-stranded DNA fragments of
sample and control nucleic acids are denatured and allowed to
renature. The secondary structure of single-stranded nucleic acids
varies according to sequence, and the resulting alteration in
electrophoretic mobility enables the detection of even a single
base change. The sensitivity of the assay is enhanced when RNA
(rather than DNA) is used because RNA's secondary structure is more
sensitive to a change in sequence. See also Keen et al., Trends
Genet. 7:5, (1991). The movement of mutant or wild-type fragments
through gels containing a gradient of denaturant is also
informative.
[0532] When denaturing gradient gel electrophoresis [DGGE; Myers et
al., Nature 313:495, (1985)] is used, DNA can be modified so it
will not completely denature (this can be done by, for example by
adding a GC clamp of approximately 40 bp of high-melting GC-rich
DNA by PCR). A temperature gradient can be used in place of a
denaturing gradient to identify differences in the mobility of
control and sample DNA [Rosenbaum and Reissner, Biophys. Chem.
265:12753, (1987)].
[0533] Point mutations can also be detected by selective
oligonucleotide hybridization, selective amplification, or
selective primer extension [Point et al., Nature 324:163, (1986);
Saiki et al., Proc. Natl. Acad. Sci. USA 86:6230, (1989)] or by
chemical ligation of oligonucleotides as described in Xu et al.,
Nature Biotechnol. 19:148, (2001). Allele specific amplification
technology can also be used [see, e.g., Gibbs et al., Nucleic Acids
Res. 17:2437-2448, (1989); Prossner, Tibtech. 11:238, (1993); and
Barany, Proc. Natl. Acad. Sci. USA 88:189, (1991)].
[0534] When analysis of a gene or protein is carried out in a cell
or tissue sample, the cell or tissue can be immobilized on a
support, typically a glass slide, and then contacted with a probe
that can hybridize to the nucleic acid or protein of interest.
[0535] The detection methods of the invention can be carried out
with appropriate controls (e.g., analyses can be conducted in
parallel with a sample known to contain the target sequence and a
target known to lack it).
[0536] Various approaches can be used to determine protein
expression or activity. For example, one can evaluate the amount of
protein in a sample by exposing the sample to an antibody that
specifically binds the protein of interest. The antibodies
described above (e.g., monoclonal antibodies, detectably labeled
antibodies, intact antibodies and fragments thereof) can be used.
The methods can be carried out in-vitro (e.g., one can perform an
enzyme linked immunosorbent assay (ELISA), an immunoprecipitation,
an immunofluorescence analysis, an enzyme immunoassay (EIA), a
radioimmunoassay (RIA), or a Western blot analysis) or in vivo
(e.g., one can introduce a labelled antibody that specifically
binds to a protein of the present invention into a subject and then
detect it by a standard imaging technique). Alternatively, the
sample can be labeled and then contacted with an antibody. For
example, one can biotinylate the sample, contact it with an
antibody (e.g., an antibody positioned on an antibody array) and
then detect the bound sample (e.g., with avidin coupled to a
fluorescent label). As with methods to detect nucleic acids,
appropriate control studies can be performed in parallel with those
designed to detect protein expression.
[0537] The diagnostic molecules disclosed herein can be assembled
as kits. Accordingly, the invention features kits for detecting the
presence of the biomolecular sequences of the present invention in
a biological sample. The kit can include a probe (e.g., a nucleic
acid sequence or an antibody), a standard and, optionally,
instructions for use. More specifically, antibody-based kits can
include a first antibody (e.g., in solution or attached to a solid
support) that specifically binds a protein of the present invention
and, optionally, a second, different antibody that specifically
binds to the first antibody and is conjugated to a detectable
agent. Oligonucleotide-based kits can include an oligonucleotide
(e.g., a labeled oligonucleotide) that hybridizes with one of the
nucleic acids of the present invention under stringent conditions
or a pair of oligonucleotides that can be used to amplify a nucleic
acid sequence of the present invention. The kits can also include a
buffering agent, a preservative, a protein-stabilizing agent, or a
component necessary for detecting any included label (e.g., an
enzyme or substrate). The kits can also contain a control sample or
a series of control samples that can be assayed and compared to the
test sample contained. Each component of the kit can be enclosed
within an individual container, and all of the various containers
can be within a single package.
[0538] The detection methods described herein can identify a
subject who has, or is at risk of developing, a disease, disorder,
condition, or syndrome (the term "disease" is used to encompass all
deviations from a normal state) associated with aberrant or
unwanted expression or activity of a biomolecular sequence of the
present invention. The detection methods also have prognostic value
(e.g., they can be used to determine whether or not it is likely
that a subject will respond positively (i.e., be effectively
treated with) to an agent (e.g., a nucleic acid, protein, small
molecule or other drug)). Samples can also be obtained from a
subject during the course of treatment to monitor the treatment's
efficacy at a cellular level.
[0539] The present invention also features methods of evaluating a
sample by creating a gene expression profile for the sample that
includes the level of expression of one or more of biomolecular
sequences of the present invention. The sample's profile can be
compared with that of a reference profile, either of which can be
obtained by the methods described herein (e.g., by obtaining a
nucleic acid from the sample and contacting the nucleic acid with
those on an array). As with other detection methods, profile-based
assays can be performed prior to the onset of symptoms (in which
case they can be diagnostic), prior to treatment (in which case
they can be predictive) or during the course of treatment (in which
case they serve as monitors) [see, e.g., Golub et al., Science
286:531, (1999)].
[0540] As described hereinabove, the screening methods of the
invention can be used to identify candidate therapeutic agents, and
those agents can be evaluated further by examining their ability to
alter the expression of one or more of the proteins of the
invention. For example, one can obtain a cell from a subject,
contact the cell with the agent, and subsequently examine the
cell's expression profile with respect to a reference profile
(which can be, for example, the profile of a normal cell or that of
a cell in a physiologically acceptable condition). The agent is
evaluated favorably if the expression profile in the subject's cell
is, following exposure to the agent, more similar to that of a
normal cell or a cell in a physiologically acceptable condition. A
control assay can be performed with, for example, a cell that is
not exposed to the agent.
[0541] Expression profiles (obtained by evaluating either nucleic
acid or protein expression) are also useful in evaluating subjects.
One can obtain a sample from a subject (either directly or
indirectly from a caregiver), create an expression profile, and,
optionally, compare the subject's expression profile to one or more
reference profiles and/or select a reference profile most similar
to that of the subject. A variety of routine statistical measures
can be used to compare two reference profiles. One possible metric
is the length of the distance vector that is the difference between
the two profiles. Each of the subject and reference profile is
represented as a multi-dimensional vector, wherein each dimension
is a value in the profile.
[0542] The result, which can be communicated to the subject, a
caregiver, or another interested party, can be the subject's
expression profile per se, a result of a comparison of the
subject's expression profile with another profile, a most similar
reference profile, or a descriptor of any of these. Communication
can be mediated by a computer network (e.g., in the form of a
computer transmission such as a computer data signal embedded in a
carrier wave).
[0543] Accordingly, the invention also features a computer medium
having executable code for effecting the following steps: receive a
subject expression profile; access a database of reference
expression profiles; and either i) select a matching reference
profile most similar to the subject expression profile, or ii)
determine at least one comparison score for the similarity of the
subject expression profile to at least one reference profile. The
subject expression profile and the reference expression profile
each include a value representing the level of expression of one or
more of the biomolecular sequences of the present invention.
Arrays and Uses Thereof
[0544] The present invention also encompasses arrays that include a
substrate having a plurality of addresses, at least one of which
includes a capture probe that specifically binds or hybridizes to a
nucleic acid represented by any one of the biomolecular sequences
of the present invention. The array can have a density of at least
10, 50, 100, 200, 500, 1,000, 2,000, or 10,000 or more
addresses/cm.sup.2, or densities between these. In some
embodiments, the plurality of addresses includes at least 10, 100,
500, 1,000, 5,000, 10,000, or 50,000 addresses, while in other
embodiments, the plurality of addresses can be equal to, or less
than, those numbers.
[0545] Regardless of whether the array contains nucleic acids (as
probes or targets) or proteins (as probes or targets), the
substrate can be two-dimensional (formed, e.g., by a glass slide, a
wafer (e.g., silica or plastic), or a mass spectroscopy plate) or
three-dimensional (formed, e.g., by a gel or pad). Addresses in
addition to the addresses of the plurality can be disposed on the
array.
[0546] At least one address of the plurality can include a nucleic
acid capture probe that hybridizes specifically to one or more of
the nucleic acid sequences of the present invention. In certain
embodiments, a subset of addresses of the plurality will be
occupied by a nucleic acid capture probe for one of the nucleic
acid sequences of the present invention; each address in the subset
can bear a capture probe that hybridizes to a different region of a
selected nucleic acid. In other embodiments, the probe at each
address is unique, overlapping, and complementary to a different
variant of a selected nucleic acid (e.g., an allelic variant, or
all possible hypothetical variants). If desired, the array can be
used to sequence the selected nucleic acid by hybridization (see,
e.g., U.S. Pat. No. 5,695,940). Alternatively, the capture probe
can be a protein that specifically binds to a protein of the
present invention or a fragment thereof (e.g., a
naturally-occurring interaction partners of a protein of the
invention or an antibody described herein). In some instances
(e.g., in the event of an autoimmune disease), it is significant
that a subject produces antibodies, and the arrays described herein
can be used to detect those antibodies. More generally, an array
that contains some or all of the proteins of the present invention
can be used to detect any substance to which one or more those
proteins bind (e.g., a natural binding partner, an antibody, or a
synthetic molecule).
[0547] An array can be generated by methods known to those of
ordinary skill in the art. For example, an array can be generated
by photolithographic methods (see, e.g., U.S. Pat. Nos. 5,143,854;
5,510,270; and 5,527,681), mechanical methods (e.g., directed-flow
methods as described in U.S. Pat. No. 5,384,261), pin-based methods
(e.g., as described in U.S. Pat. No. 5,288,514), and bead-based
techniques (e.g., as described in PCT US/93/04145). Methods of
producing protein-based arrays are described in, for example, De
Wildt et al. [Nature Biotech. 18:89-994, (2000)], Lueking et al.
[Anal. Biochem. 270:103-111, (1999)], Ge [Nucleic Acids Res. 28:e3,
(2000)], MacBeath and Schreiber [Science 289:1760-1763, (2000)],
and WO 99/51773A1. Addresses in addition to the address of the
plurality can be disposed on the array.
[0548] The arrays described above can be used to analyze the
expression of any of the biomolecular sequences of the present
invention. For example, one can contact an array with a sample and
detect binding between a component of the sample and a component of
the array. In the event nucleic acids are analyzed, one can amplify
the nucleic acids obtained from a sample prior to their application
to the array. The array can also be used to examine tissue-specific
gene expression. For example, the nucleic acids or proteins of the
invention (all or a subset thereof) can be distributed on an array
that is then exposed to nucleic acids or proteins obtained from a
particular tissue, tumor, or cell type. If a sufficient number of
diverse samples are analyzed, clustering (e.g., hierarchical
clustering, k-means clustering, Bayesian clustering and the like)
can be used to identify other genes that are co-regulated with
those of the invention. The array can be used not only to determine
tissue specific expression, but also to ascertain the level of
expression of a battery of genes.
[0549] Array analysis of the nucleic acids or proteins of the
invention can be used to study the effect of cell-cell interactions
or therapeutic agents on the expression of those nucleic acids or
proteins. For example, nucleic acid or protein that has been
obtained from a cell that has been placed in the vicinity of a
tissue that has been perturbed in some way can be obtained and
exposed to the probes of an array. Thus, one can use the methods of
the invention to determine the effect of one cell type on another
(i.e., the response (e.g., a change in the type or quantity of
nucleic acids or proteins expressed) to a biological stimulus can
be determined). Similarly, nucleic acid or protein that has been
obtained from a cell that has been treated with an agent can be
obtained and exposed to the probes of an array. In this scenario,
one can determine how the therapeutic agent affects the expression
of any of the biomolecular sequences of the present invention.
Appropriate controls (e.g., assays using cells that have not
received a biological stimulus or a potentially therapeutic
treatment) can be performed in parallel. Moreover, desirable and
undesirable responses can be detected. If an event (e.g., exposure
to a biological stimulus or therapeutic compound) has an
undesirable effect on a cell, one can either avoid the event (by,
e.g., prescribing an alternative therapy) or take steps to
counteract or neutralize it.
[0550] In more straightforward assays, the arrays described here
can be used to monitor the expression of one or more of the
biomolecular sequences of the present invention, with respect to
time. Such analyses allow one to characterize a disease process
associated with the examined sequence.
[0551] The arrays are also useful for ascertaining the effect of
the expression of a gene on the expression of other genes in the
same cell or in different cells (e.g., ascertaining the effect of
the expression of any one of the biomolecular sequences of the
present invention on the expression of other genes). If altering
the expression of one gene has a deleterious effect on the cell
(due to its effect on the expression of other genes) one can,
again, avoid that effect (by, e.g., selecting an alternate
molecular target or counteracting or neutralizing the effect).
Markers
[0552] The molecules of the present invention are also useful as
markers of: (i) a cell or tissue type; (ii) disease; (iii) a
pre-disease state; (iv) drug activity, and (v) predisposition for
disease.
[0553] Using the methods described herein, the presence or amount
of the biomolecular sequences of the present invention, can be
detected and correlated with one or more biological states (e.g., a
disease state or a developmental state). When used in this way, the
compositions of the invention serve as surrogate markers; they
provide an objective indicia of the presence or extent of a disease
(e.g., cancer). Surrogate markers are particularly useful when a
disease is difficult to assess with standard methods (e.g., when a
subject has a small tumor or when pre-cancerous cells are present).
It follows that surrogate markers can be used to assess a disease
before a potentially dangerous clinical endpoint is reached. Other
examples of surrogate markers are known in the art (see, e.g.,
Koomen et al., J. Mass Spectrom. 35:258-264, 2000, and James, AIDS
Treatment News Archive 209, 1994).
[0554] The biomolecular sequences of the present invention, can
also serve as pharmacodynamic markers, which provide an indicia of
a therapeutic result. As pharmacodynamic markers are not directly
related to the disease for which the drug is being administered,
their presence (or levels of expression) indicates the presence or
activity of a drug in a subject (i.e., the pharmacodynamic marker
may indicate the concentration of a drug in a biological tissue, as
the gene or protein serving as the marker is either expressed or
transcribed (or not) in the body in relationship to the level or
activity of the drug). One can also monitor the distribution of a
drug with a pharmacodynamic marker (e.g., these markers can be used
to determine whether a drug is taken up by a particular cell type).
The presence or amount of pharmacodynamic markers can be related to
the drug per se or to a metabolite produced from the drug. Thus,
these markers can indicate the rate at which a drug is broken down
in vivo. Pharmacodynamic markers can be particularly sensitive
(e.g., even a small amount of a drug may activate substantial
transcription or translation of a marker), and they are therefore
useful in assessing drugs that are administered at low doses.
Examples regarding the use of pharmacodynamic markers are known in
the art and include: U.S. Pat. No. 6,033,862; Hattis et al. Env.
Health Perspect. 90:229-238, (1991); Schentag, Am. J. Health-Syst.
Pharm. 56 Suppl. 3:S21-S24, (1999); and Nicolau, Am. J.
Health-Syst. Pharm. 56 Suppl. 3: S16-S20, (1991).
[0555] The biomolecular sequences of the present invention, are
also useful as pharmacogenomic markers, which can provide an
objective correlate to a specific clinical drug response or
susceptibility in a particular subject or class of subjects [see,
e.g., McLeod et al., Eur. J. Cancer 35:1650-1652, (1999)]. The
presence or amount of the pharmacogenomic marker is related to the
predicted response of a subject to a specific drug (or type of
drug) prior to administration of the drug. By assessing one or more
pharmacogenomic markers in a subject, the drug therapy that is most
appropriate for the subject, or which is predicted to have a
greater likelihood of success, can be selected. For example, based
on the presence or amount of RNA or protein associated with a
specific tumor marker in a subject, an optimal drug or treatment
regime can be prescribed for the subject.
[0556] More generally, pharmacogenomics addresses the relationship
between an individual's genotype and that individual's response to
a foreign compound or drug. Differences in the way individual
subjects metabolize therapeutics can lead to severe toxicity or
therapeutic failure because metabolism alters the relation between
dose and blood concentration of the pharmacologically active drug.
Thus, a physician would consider the results of pharmacogenomic
studies when determining whether to administer a composition of the
present invention and how to tailor a therapeutic regimen for the
subject.
[0557] Pharmacogenomics deals with clinically significant
hereditary variations in the response to drugs due to altered drug
disposition and abnormal action in affected persons. See, e.g.,
Eichelbaum et al., Clin. Exp. Pharmacol. Physiol. 23:983-985,
(1996), and Linder et al., Clin. Chem. 43:254-266, (1997). In
general, two types of pharmacogenetic conditions can be
differentiated. Genetic conditions transmitted as a single factor
can: (i) alter the way drugs act on the body (altered drug action)
or (ii) the way the body acts on drugs (altered drug metabolism).
These pharmacogenetic conditions can occur either as rare genetic
defects or as naturally-occurring polymorphisms.
[0558] One approach that can be used to identify genes that predict
drug response, known as "a genome-wide association," relies
primarily on a high-resolution map of the human genome consisting
of already known gene-related markers (e.g., a "bi-allelic" gene
marker map that consists of 60,000-100,000 polymorphic or variable
sites on the human genome, each of which has two variants.) Such a
high-resolution genetic map can be compared to a map of the genome
of each of a statistically significant number of patients taking
part in a Phase II/III drug trial to identify markers associated
with a particular observed drug response or side effect.
Alternatively, a high resolution map can be generated from a
combination of some ten-million known single nucleotide
polymorphisms (SNPs; a common alteration that occurs in a single
nucleotide base in a stretch of DNA) in the human genome. For
example, a SNP may occur once per every 1000 bases of DNA. While a
SNP may be involved in a disease process, the vast majority may not
be disease-associated. Given a genetic map based on the occurrence
of such SNPs, individuals can be grouped into genetic categories
depending on a particular pattern of SNPs in their individual
genome. In such a manner, treatment regimens can be tailored to
groups of genetically similar individuals, taking into account
traits that may be common among such genetically similar
individuals.
[0559] Two alternative methods, the "candidate gene approach" and
"gene expression profiling," can be used to identify
pharmacogenomic markers. According to the first method, if a gene
that encodes a drug's target is known, all common variants of that
gene can be fairly easily identified in the population, and one can
determine whether having one version of the gene versus another is
associated with a particular drug response. In the second approach,
the gene expression of an animal dosed with a drug (e.g., a
composition of the invention) can reveal whether gene pathways
related to toxicity have been activated.
[0560] Information generated using one or more of the approaches
described above can be used in designing therapeutic or
prophylactic treatments that are less likely to fail or to produce
adverse side effects when a subject is treated with a therapeutic
composition.
Informatics
[0561] The biomolecular sequences of the present invention can be
provided in a variety of media to facilitate their use. For
example, one or more of the sequences (e.g., subsets of the
sequences expressed in a defined tissue type) can be provided as a
manufacture (e.g., a computer-readable storage medium such as a
magnetic, optical, optico-magnetic, chemical or mechanical
information storage device). The manufacture can provide a nucleic
acid or amino acid sequence in a form that will allow examination
of the manufacture in ways that are not applicable to a sequence
that exists in nature or in purified form. The sequence information
can include full-length sequences, fragments thereof, polymorphic
sequences including single nucleotide polymorphisms (SNPs), epitope
sequence, and the like.
[0562] The computer readable storage medium further includes
sequence annotations (as described in Example 10 of the Examples
section).
[0563] The computer readable storage medium can further include
information pertaining to generation of the data and/or potential
uses thereof.
[0564] As used herein, a "computer-readable medium" refers to any
medium that can be read and accessed directly by a machine [e.g., a
digital or analog computer; e.g., a desktop PC, laptop, mainframe,
server (e.g., a web server, network server, or server farm), a
handheld digital assistant, pager, mobile telephone, or the like].
Computer-readable media include: magnetic storage media, such as
floppy discs, hard disc storage medium, and magnetic tape; optical
storage media such as CD-ROM; electrical storage media such as RAM,
ROM, EPROM, EEPROM, flash memory, and the like; and hybrids of
these categories such as magnetic/optical storage media.
[0565] A variety of data storage structures are available to those
of ordinary skill in the art and can be used to create a
computer-readable medium that has recorded one or more (or all) of
the nucleic acids and/or amino acid sequences of the present
invention. The data storage structure will generally depend on the
means chosen to access the stored information. In addition, a
variety of data processor programs and formats can be used to store
the sequence information of the present invention on machine or
computer-readable medium. The sequence information can be
represented in a word processing text file, formatted in
commercially-available software such as WordPerfect and Microsoft
Word, or represented in the form of an ASCII file, stored in a
database application, such as DB2, Sybase, Oracle, or the like. One
of ordinary skill in the art can readily adapt any number of data
processor structuring formats (e.g., text file or database) to
obtain machine or computer-readable medium having recorded thereon
the sequence information of the present invention.
[0566] The sequence information and annotations are stored in a
relational database (such as Sybase or Oracle) that can have a
first table for storing sequence (nucleic acid and/or amino acid
sequence) information. The sequence information can be stored in
one field (e.g., a first column) of a table row and an identifier
for the sequence can be stored in another field (e.g., a second
column) of the table row. The database can have a second table (to,
for example, store annotations). The second table can have a field
for the sequence identifier, a field for a descriptor or annotation
text (e.g., the descriptor can refer to a functionality of the
sequence), a field for the initial position in the sequence to
which the annotation refers, and a field for the ultimate position
in the sequence to which the annotation refers. Examples for
annotation to nucleic acid sequences and amino acid sequences are
provided in Examples 10 and 14-20 of the Examples section.
Pharmaceutical Compositions
[0567] The nucleic acids, fragments thereof, hybrid sequences of
which they are a part, and gene constructs containing them;
proteins, fragments thereof, chimeras, and antibodies that
specifically bind thereto; and cells, including those that are
engineered to express the nucleic acids or proteins of the
invention) can be incorporated into pharmaceutical compositions.
These compositions typically also include a solvent, a dispersion
medium, a coating, an antimicrobial (e.g., an antibacterial or
antifungal) agent, an absorption delaying agent (when desired, such
as aluminum monostearate and gelatin), or the like, compatible with
pharmaceutical administration (see below). Active compounds, in
addition to those of the present invention, can also be included in
the composition and may enhance or supplement the activity of the
present agents.
[0568] The composition will be formulated in accordance with their
intended route of administration. Acceptable routes include oral or
parenteral routes (e.g., intravenous, intradermal, transdermal
(e.g., subcutaneous or topical), or transmucosal (i.e., across a
membrane that lines the respiratory or anogenital tract). The
compositions can be formulated as a solution or suspension and,
thus, can include a sterile diluent (e.g., water, saline solution,
a fixed oil, polyethylene glycol, glycerine, propylene glycol or
another synthetic solvent); an antimicrobial agent (e.g., benzyl
alcohol or methyl parabens; chlorobutanol, phenol, ascorbic acid,
thimerosal, and the like); an antioxidant (e.g., ascorbic acid or
sodium bisulfite); a chelating agent (e.g.,
ethylenediaminetetraacetic acid); or a buffer (e.g., an acetate-,
citrate-, or phosphate-based buffer). When necessary, the pH of the
solution or suspension can be adjusted with an acid (e.g.,
hydrochloric acid) or a base (e.g., sodium hydroxide). Proper
fluidity (which can ease passage through a needle) can be
maintained by a coating such as lecithin, by maintaining the
required particle size (in the case of a dispersion), or by the use
of surfactants.
[0569] The compositions of the invention can be prepared as sterile
powders (by, e.g., vacuum drying or freeze-drying), which can
contain the active ingredient plus any additional desired
ingredient from a previously sterile-filtered solution.
[0570] Oral compositions generally include an inert diluent or an
edible carrier. For example, the active compound can be
incorporated with excipients and used in the form of tablets,
troches, or capsules (e.g., gelatin capsules). Oral compositions
can be prepared using fluid carries and used as mouthwashes. The
tablets etc. can also contain a binder (e.g., microcrystalline
cellulose, gum tragacanth, or gelatin); an excipient (e.g., starch
or lactose), a disintegrating agent (e.g., alginic acid, Primogel,
or corn starch); a lubricant (e.g., magnesium stearate or
Sterotes); a glidant (e.g., colloidal silicon dioxide); a
sweetening agent (e.g., sucrose or saccharine); or a flavoring
agent (e.g., peppermint, methyl salicylate, or orange
flavoring.
[0571] For administration by way of the respiratory system, the
compositions can be formulated as aerosol sprays (e.g., from a
pressured container or dispenser that contains a suitable
propellant (e.g., a gas such as carbon dioxide), or a nebulizer.
The ability of a composition to cross a biological barrier can be
enhanced by agents known in the art. For example, detergents, bile
salts, and fusidic acid derivatives can facilitate transport across
the mucosa (and therefore, be included in nasal sprays or
suppositories).
[0572] For topical administration, the active compounds are
formulated into ointments, salves, gels, or creams according to
methods known in the art.
[0573] Controlled release can also be achieved by using implants
and microencapsulated delivery systems (see, e.g., the materials
commercially available from Alza Corporation and Nova
Pharmaceuticals, Inc.; see also U.S. Pat. No. 4,522,811 for the use
of liposome-based suspensions).
[0574] The pharmaceutical compositions of the invention can be
formulated in dosage units (i.e., physically discrete units
containing a predetermined quantity of the active compound) for
uniformity and ease of administration.
[0575] The toxicity and therapeutic efficacy of any given compound
can be determined by standard pharmaceutical procedures carried out
in cell culture or in experimental animals. For example, one of
ordinary skill in the art can routinely determine the LD50 (the
dose lethal to 50% of the population) and the ED50 (the dose
therapeutically effective in 50% of the population). The dose ratio
between toxic and therapeutic effects is the therapeutic index.
Compounds that exhibit high therapeutic indices are preferred.
While compounds that exhibit toxic side effects may be used, care
should be taken to design a delivery system that targets such
compounds to the site of affected tissue in order to minimize
potential damage to uninfected cells and, thereby, reduce side
effects.
[0576] The data obtained from the cell culture assays and animal
studies described hereinabove can be used to formulate a range of
dosage for use in humans (preferably a dosage within a range of
circulating concentrations that include the ED50 with little or no
toxicity). The dosage may vary within this range depending upon the
formulation and the route of administration. For any compound used
in the method of the invention, the therapeutically effective dose
can be estimated initially from cell culture assays. A dose may be
formulated in animal models to achieve a circulating plasma
concentration range that includes the IC50 (i.e., the concentration
of the test compound which achieves a half-maximal inhibition of
symptoms) as determined in cell culture. Such information can be
used to more accurately determine useful doses in humans. Levels in
plasma may be measured, for example, by high performance liquid
chromatography.
[0577] A therapeutically effective amount of a protein of the
present invention can range from about 0.001 to 30 mg/kg body
weight (e.g., about 0.01 to 25 mg/kg, about 0.1 to 20 mg/kg, or
about 1 to 10 (e.g., 2-9, 3-8, 4-7, or 5-6) mg/kg). The protein can
be administered one time per week for between about 1 to 10 weeks
(e.g., 2 to 8 weeks, 3 to 7 weeks, or about 4, 5, or 6 weeks).
However, a single administration can also be efficacious. Certain
factors can influence the dosage and timing required to effectively
treat a subject. These factors include the severity of the disease,
previous treatments, and the general health or age of the
subject.
[0578] When the active ingredient is an antibody, the dosage can be
about 0.1 mg/kg of body weight (generally 10-20 mg/kg). If the
antibody is to act in the brain, a dosage of 50 mg/kg to 100 mg/kg
is usually appropriate. Generally, partially human antibodies and
fully human antibodies have a longer half-life within the human
body than other antibodies. Accordingly, lower dosages and less
frequent administration are often possible with these types of
antibodies. Modifications such as lipidation can be used to
stabilize antibodies and to enhance uptake and tissue penetration
[e.g., into the brain; see Cruikshank et al., J. Acquired Immune
Deficiency Syndromes and Human Retrovirology 14:193, (1997)].
[0579] As noted above, the present invention encompasses agents
(e.g., small molecules) that modulate expression or activity of a
nucleic acid represented by any of biomolecular sequences of the
present invention. Exemplary doses of these agents include
milligram or microgram amounts of the small molecule per kilogram
of subject or sample weight (e.g., about 1-500 mg/kg; about 100
mg/kg; about 5 mg/kg; about 1 mg/kg; or about 50 .mu.g/kg).
Appropriate doses of a small molecule depend upon the potency of
the small molecule with respect to the expression or activity to be
modulated. When one or more of these small molecules is to be
administered to an animal (e.g., a human) to modulate expression or
activity of nucleic acid or protein of the invention, a physician,
veterinarian, or researcher may prescribe a relatively low dose at
first, subsequently increasing the dose until an appropriate
response is obtained. In addition, it is understood that the
specific dose level for any particular animal subject will depend
upon a variety of factors including the activity of the specific
compound employed, the age, body weight, general health, gender,
and diet of the subject, the time of administration, the route of
administration, the rate of excretion, any drug combination, and
the degree of expression or activity to be modulated.
[0580] Pharmaceutical compositions of the present invention may
also include a therapeutic moiety such as a cytotoxin (i.e., an
agent that is detrimental to a cell), a therapeutic agent, or a
radioactive ion can be conjugated to the biomolecular sequences of
the present invention or related compositions, described
hereinabove (e.g., antibodies, antisense molecules, ribozymes
etc.). The cytotoxin can be, for example, taxol, cytochalasin B,
gramicidin D, ethidium bromide, emetine, mitomycin, etoposide,
tenoposide, vincristine, vinblastine, colchicin, doxorubicin,
daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin,
actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine,
tetracaine, lidocaine, propranolol, puromycin, maytansinoids (e.g.,
maytansinol; see U.S. Pat. No. 5,208,020), CC-1065 (see U.S. Pat.
Nos. 5,475,092, 5,585,499, and 5,846,545) and analogs or homologs
thereof. Therapeutic agents include antimetabolites (e.g.,
methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine,
5-fluorouracil decarbazine), alkylating agents (e.g.,
mechlorethamine, thioepa chlorambucil, CC-1065, melphalan,
carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan,
dibromomannitol, streptozotocin, mitomycin C, and
cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines
(e.g., daunorubicin (formerly daunomycin) and doxorubicin),
antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin,
mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g.,
vincristine, vinblastine, taxol and maytansinoids). Radioactive
ions include, but are not limited to iodine, yttrium and
praseodymium.
[0581] Other therapeutic moieties include, but are not limited to,
toxins such as abrin, ricin A, pseudomonas exotoxin, or diphtheria
toxin; a protein such as tumor necrosis factor, .gamma.-interferon,
.beta.-interferon, nerve growth factor, platelet derived growth
factor, tissue plasminogen activator; or, biological response
modifiers such as, for example, lymphokines, interleukin-1 (IL-1),
interleukin-2(IL-2), interleukin-6 (IL-6), granulocyte macrophase
colony stimulating factor (GM-CSF), granulocyte colony stimulating
factor (G-CSF), or other growth factors.
[0582] The nucleic acid molecules of the invention can be inserted
into vectors and used as gene therapy vectors. Gene therapy vectors
can be delivered to a subject by, for example, intravenous
injection, local administration (see U.S. Pat. No. 5,328,470) or by
stereotactic injection (see e.g., Chen et al., Proc. Natl. Acad.
Sci. USA 91:3054-3057, 1994). The pharmaceutical preparation of the
gene therapy vector can include the gene therapy vector in an
acceptable diluent, or can comprise a slow release matrix in which
the gene delivery vehicle is imbedded. Alternatively, where the
complete gene delivery vector can be produced intact from
recombinant cells (e.g. retroviral vectors), the pharmaceutical
preparation can include one or more cells which produce the gene
delivery system. The pharmaceutical compositions of the invention
can be included in a container, pack, or dispenser together with
instructions for administration.
Methods of Treatment
[0583] The present invention provides for both prophylactic and
therapeutic methods of treating a subject at risk of (or
susceptible to) a disorder or having a disorder associated with
aberrant or unwanted expression or activity of a nucleic acid or
protein of the invention. "Treatment" encompasses the application
or administration of a therapeutic agent to a patient, or to an
isolated tissue or cell line (e.g., one obtained from the patient
to be treated), with the purpose of curing or lessening the
severity of the disease or a symptom associated with the
disease.
[0584] Whether carried out prophylactically or therapeutically, the
methods of the invention can be specifically tailored or modified,
based on knowledge obtained from the field of pharmacogenomics (see
above).
[0585] Thus, the invention provides a method for preventing in a
subject, a disease associated with mis-expression of a nucleic acid
or protein of the present invention. Such diseases include cellular
proliferative and/or differentiative disorders, disorders
associated with bone metabolism, immune disorders, cardiovascular
disorders, liver disorders, viral diseases, pain or metabolic
disorders.
[0586] Examples of cellular proliferative and/or differentiative
disorders include cancer (e.g., carcinoma, sarcoma, metastatic
disorders or hematopoietic neoplastic disorders such as leukemias
and lymphomas). A metastatic tumor can arise from a multitude of
primary tumor types, including but not limited to those of
prostate, colon, lung, breast or liver.
[0587] The terms "cancer," "hyperproliferative," and "neoplastic,"
are used in reference to cells that have exhibited a capacity for
autonomous growth (i.e., an abnormal state or condition
characterized by rapid cellular proliferation). Hyperproliferative
and neoplastic disease states can be categorized as pathologic
(i.e., characterizing or constituting a disease state), or can be
categorized as non-pathologic (i.e., deviating from normal but not
associated with a disease state). The term is meant to include all
types of cancerous growths or oncogenic processes, metastatic
tissues or malignantly transformed cells, tissues, or organs,
irrespective of histopathologic type or stage of invasiveness.
"Pathologic hyperproliferative" cells occur in disease states
characterized by malignant tumor growth. Examples of non-pathologic
hyperproliferative cells include proliferation of cells associated
with wound repair.
[0588] The terms "cancer" or "neoplasms" include malignancies of
the various organ systems, such as affecting lung, breast, thyroid,
lymphoid, gastrointestinal, and genito-urinary tract, as well as
adenocarcinomas, which include malignancies such as most colon
cancers, renal-cell carcinoma, prostate cancer and/or testicular
tumors, non-small cell carcinoma of the lung, cancer of the small
intestine and cancer of the esophagus.
[0589] The term "carcinoma" refers to malignancies of epithelial or
endocrine tissues including respiratory system carcinomas,
gastrointestinal system carcinomas, genitourinary system
carcinomas, testicular carcinomas, breast carcinomas, prostatic
carcinomas, endocrine system carcinomas, and melanomas. Exemplary
carcinomas include those forming from tissue of the cervix, lung,
prostate, breast, head and neck, colon and ovary. The term also
includes carcinosarcomas (e.g., which include malignant tumors
composed of carcinomatous and sarcomatous tissues). An
"adenocarcinoma" refers to a carcinoma derived from glandular
tissue or in which the tumor cells form recognizable glandular
structures. The term "sarcoma" is art recognized and refers to
malignant tumors of mesenchymal derivation. As used herein, the
term "hematopoietic neoplastic disorder(s)" includes diseases
involving hyperplastic/neoplastic cells of hematopoietic origin. A
hematopoietic neoplastic disorder can arise from myeloid, lymphoid
or erythroid lineages, or precursor cells thereof. Preferably, the
diseases arise from poorly differentiated acute leukemias (e.g.,
erythroblastic leukemia and acute megakaryoblastic leukemia).
Additional exemplary myeloid disorders include, but are not limited
to, acute promyeloid leukemia (APML), acute myelogenous leukemia
(AML) and chronic myelogenous leukemia (CML) (see Vaickus, Crit.
Rev. in Oncol./Hemotol. 11:267-97, 1991); lymphoid malignancies
include, but are not limited to acute lymphoblastic leukemia (ALL)
which includes B-lineage ALL and T-lineage ALL, chronic lymphocytic
leukemia (CLL), prolymphocytic leukemia (PLL), hairy cell leukemia
(HLL) and Waldenstrom's macroglobulinemia (WM). Additional forms of
malignant lymphomas include, but are not limited to non-Hodgkin
lymphoma and variants thereof, peripheral T cell lymphomas, adult T
cell leukemia/lymphoma (ATL), cutaneous T-cell lymphoma (CTCL),
large granular lymphocytic leukemia (LGF), Hodgkin's disease and
Reed-Sternberg disease.
[0590] The leukemias, including B-lymphoid leukemias, T-lymphoid
leukemias, undifferentiated leukemias, erythroleukemia,
megakaryoblastic leukemia, and monocytic leukemias are encompassed
with and without differentiation; chronic and acute lymphoblastic
leukemia, chronic and acute lymphocytic leukemia, chronic and acute
myelogenous leukemia, lymphoma, myelo dysplastic syndrome, chronic
and acute myeloid leukemia, myelomonocytic leukemia; chronic and
acute myeloblastic leukemia, chronic and acute myelogenous
leukemia, chronic and acute promyelocytic leukemia, chronic and
acute myelocytic leukemia, hematologic malignancies of
monocyte-macrophage lineage, such as juvenile chronic myelogenous
leukemia; secondary AML, antecedent hematological disorder;
refractory anemia; aplastic anemia; reactive cutaneous
angioendotheliomatosis; fibrosing disorders involving altered
expression in dendritic cells, disorders including systemic
sclerosis, E-M syndrome, epidemic toxic oil syndrome, eosinophilic
fasciitis localized forms of scleroderma, keloid, and fibrosing
colonopathy; angiomatoid malignant fibrous histiocytoma; carcinoma,
including primary head and neck squamous cell carcinoma; sarcoma,
including kaposi's sarcoma; fibroadanoma and phyllodes tumors,
including mammary fibroadenoma; stromal tumors; phyllodes tumors,
including histiocytoma; erythroblastosis; and
neurofibromatosis.
[0591] Examples of disorders involving the heart or "cardiovascular
disorders" include, but are not limited to, a disease, disorder, or
state involving the cardiovascular system, e.g., the heart, the
blood vessels, and/or the blood. A cardiovascular disorder can be
caused by an imbalance in arterial pressure, a malfunction of the
heart, or an occlusion of a blood vessel, e.g., by a thrombus.
Examples of such disorders include hypertension, atherosclerosis,
coronary artery spasm, congestive heart failure, coronary artery
disease, valvular disease, arrhythmias, and cardiomyopathies.
[0592] As discussed, diseases associated (e.g., causally
associated) with over expression of a nucleic acid of the invention
(as determined, for example, by the in vivo or ex vivo analyses
described above), can be treated with techniques in which one
inhibits the expression or activity of the nucleic acid or its gene
products. For example, a compound (e.g., an agent identified using
an assay described above) that exhibits negative modulatory
activity with respect to a nucleic acid of the invention (the
expression or over expression of which is causally associated with
a disease) can be used to prevent and/or ameliorate that disease or
one or more of the symptoms associated with it. The compound can be
a peptide, phosphopeptide, small organic or inorganic molecule, or
antibody (e.g., a polyclonal, monoclonal, humanized,
anti-idiotypic, chimeric or single chain antibodies, and Fab,
F(ab')2 and Fab expression library fragments, scFV molecules, and
epitope-binding fragments thereof).
[0593] Further, antisense, ribozyme, and triple-helix molecules
(see above) that inhibit expression of the target gene (e.g., a
gene of the invention) can also be used to reduce the level of
target gene expression, thus effectively reducing the level of
target gene activity. If necessary, to achieve a desirable level of
gene expression, molecules that inhibit gene expression can be
administered with nucleic acid molecules that encode and express
target gene polypeptides exhibiting normal target gene activity. Of
course, where the assays of the invention indicate that expression
or over expression is desirable, the nucleic acid can be introduced
into cells via gene therapy methods with little or no treatment
with inhibitory agents (this can be done to combat not only under
expression, but over secretion of a gene product).
[0594] Aptamer molecules (nucleic acid molecules having a tertiary
structure that permits them to specifically bind to protein
ligands; [see, e.g., Osborne et al., Curr. Opin. Chem. Biol. 1:
5-9, (1997) and Patel Curr. Opin. Chem. Biol. 1:32-46, (1997)] are
also useful therapeutics. Since nucleic acid molecules can usually
be more conveniently introduced into target cells than therapeutic
proteins may be, aptamers offer a method by which protein activity
can be specifically decreased without the introduction of drugs or
other molecules that may have pluripotent effects.
[0595] As noted above, the nucleic acids of the invention and the
proteins they encode can be used as immunotherapeutic agents (to,
e.g., elicit an immune response against a protein of interest).
However, in some circumstances, undesirable effects occur when a
subject is injected with a protein or an epitope that stimulate
antibody production. In those circumstances, one can instead
generate an immune response with an anti-idiotypic antibody [see,
e.g., Herlyn, Ann. Med. 31:66-78, 1991 and Bhattacharya-Chatterjee
and Foon, Cancer Treat. Res. 94:51-68, (1998)]. Effective
anti-idiotypic antibodies stimulate the production of
anti-anti-idiotypic antibodies, which specifically bind the protein
in question. Vaccines directed to a disease characterized by
expression of the nucleic acids of the present invention can also
be generated in this fashion. In other circumstances, the target
antigen is intracellular. In these circumstances, antibodies
(including fragments, single chain antibodies, or other types of
antibodies described above) can be internalized within a cell by
delivering them with, for example, a lipid-based delivery system
(e.g., Lipofectin.TM. or liposomes). Single chain antibodies can
also be administered by delivering nucleotide sequences that encode
them to the target cell population (see, e.g., Marasco et al.,
Proc. Natl. Acad. Sci. USA 90:7889-7893, 1993).
[0596] Additional objects, advantages, and novel features of the
present invention will become apparent to one ordinarily skilled in
the art upon examination of the following examples, which are not
intended to be limiting. Additionally, each of the various
embodiments and aspects of the present invention as delineated
hereinabove and as claimed in the claims section below finds
experimental support in the following examples.
EXAMPLES
[0597] Reference is now made to the following examples, which
together with the above descriptions, illustrate the invention in a
non limiting fashion.
[0598] Generally, the nomenclature used herein and the laboratory
procedures utilized in the present invention include molecular,
biochemical, microbiological and recombinant DNA techniques. Such
techniques are thoroughly explained in the literature. See, for
example, "Molecular Cloning: A laboratory Manual" Sambrook et al.,
(1989); "Current Protocols in Molecular Biology" Volumes I-III
Ausubel, R. M., ed. (1994); Ausubel et al., "Current Protocols in
Molecular Biology", John Wiley and Sons, Baltimore, Md. (1989);
Perbal, "A Practical Guide to Molecular Cloning", John Wiley &
Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific
American Books, New York; Birren et al. (eds) "Genome Analysis: A
Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory
Press, New York (1998); methodologies as set forth in U.S. Pat.
Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057;
"Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E.,
ed. (1994); "Current Protocols in Immunology" Volumes I-III Coligan
J. E., ed. (1994); Stites et al. (eds), "Basic and Clinical
Immunology" (8th Edition), Appleton & Lange, Norwalk, Conn.
(1994); Mishell and Shiigi (eds), "Selected Methods in Cellular
Immunology", W. H. Freeman and Co., New York (1980); available
immunoassays are extensively described in the patent and scientific
literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153;
3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654;
3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219;
5,011,771 and 5,281,521; "Oligonucleotide Synthesis" Gait, M. J.,
ed. (1984); "Nucleic Acid Hybridization" Hames, B. D., and Higgins
S. J., eds. (1985); "Transcription and Translation" Hames, B. D.,
and Higgins S. J., eds. (1984); "Animal Cell Culture" Freshney, R.
I., ed. (1986); "Immobilized Cells and Enzymes" IRL Press, (1986);
"A Practical Guide to Molecular Cloning" Perbal, B., (1984) and
"Methods in Enzymology" Vol. 1-317, Academic Press; "PCR Protocols:
A Guide To Methods And Applications", Academic Press, San Diego,
Calif. (1990); Marshak et al., "Strategies for Protein Purification
and Characterization--A Laboratory Course Manual" CSHL Press
(1996); all of which are incorporated by reference as if fully set
forth herein. Other general references are provided throughout this
document. The procedures therein are believed to be well known in
the art and are provided for the convenience of the reader. All the
information contained therein is incorporated herein by
reference.
Example 1
Identification of Alternatively Spliced Expressed Sequences
Background
[0599] The etiology of many kinds of cancers, especially those
involving multiple genes or sporadic mutations, is yet to be
elucidated. Accumulative EST information coming from heterogeneous
tissues and cell-types, can be used as a considerable source to
understanding some of the events inherent to carcinogenesis.
[0600] Although a large number of current bioinformatics tools are
used to predict tissue specific genes in general and cancer
specific genes in particular, all fail to consider alternatively
spliced variants [Boguski and Schuler (1995) Nat. Genet. 10:369-71,
Audic and Claverie (1997) Genome Res. 7:986-995; Huminiecki and
Bicknell (2000) Genome Res. 10:1796-1806; Kawamoto et al. (2000)
Genome Res. 10:1817-1827]. Alternative splicing is also overlooked
by wet laboratory methods such as SAGE and microarray experiments
which have been widely used to study gene expression, however
remain to be linked to alternative splicing modeling [see
Background section and Valculescu et al. (1995) Science
270:484-487; Caron et al. (2001) Science 291:1289-1292 and Schena
et al. (1995) Science 270:467-470].
[0601] A computational-based approach was developed to identify
alternatively spliced transcripts, which are expressed in a
temporal and/or spatial pattern. Examples 1-4 below describe the
identification of cancer specific alternatively spliced isoforms,
which were identified according to the teachings of the present
invention.
[0602] Experimental Procedures and Reagents
[0603] DATA and LEADS alternative splicing modeling--GenBank
version 125 with genomic build #25 from National Center for
Biotechnology Information (NCBI) was used as an input to the LEADS
platform as described [Shoshan et al. (2001) Proc. SPIE
Microarrays: Optical Technologies and Informatics 4266:86-95;
Matloubian (2000) Nat. Immunol. 1:298-304; David et al. (2002) J.
Biol. Chem. 277:18084-18090; Sorek et al. (2002) Genome Res.
12:1060-7]. UniGene Build #146 and libraryQuest.txt were obtained
from NCBI and Cancer Genome Anatomy Project (CGAP) in National
Cancer Institute (NCI), respectively.
[0604] EST tissue information--EST information was available in web
form from Library Browser or Library Finder in NCBI or in the flat
file libraryQuest.txt. The file listed 53 tissue sources, 5
histological states (cancer, multiple histology, normal,
pre-cancer, and uncharacterized histology), 6 types of tissue
preparations (bulk, cell line, flow-sorted, microdissected,
multiple preparation, and uncharacterized), and brief descriptions
on each library. 5318 libraries were from bulk tissue preparation
{including 5000 ORESTES libraries [Camargo et al. (2001) Proc.
Natl. Acad. Sci. USA 98:12103-12108]}, 329 from cell lines, 37
flow-sorted, 66 microdissected, 5 multiple preparation, and 1121
were from uncharacterized preparations. Excluding ORESTES
libraries, 507 libraries were designated as `non-normalized` and
100 were designated `normalized` or `subtracted` indicating the
pretreatment of mRNA before cDNA library construction. A small
number of libraries were derived from the same original sample.
These were not considered separately. Library counts of ESTs rather
than direct EST counts were used to provide semi-quantitative
measurements of expression level, since EST counts in some cases
reflect the prevalence of ESTs in one or a few particular
libraries, and library counts provide better indications across
different tissue types when both normalized and non-normalized
libraries were analyzed. Such tissue information analyses are
limited to those tissues with a sufficient number of libraries. The
inclusion of normalized cDNA libraries allowed the examination of
genes expressed at low levels.
[0605] The ESTs from `pooled tissue` or `uncharacterized tissue`
were considered as non-conforming in order to maintain the
robustness of the results. In addition, 139,243 ESTs that had no
library information were considered non-conforming in investigating
tissue- or cancer-specific alternative splicing events.
[0606] Results--Human EST and mRNA sequences aligned against
genomic sequences and clustered through Compugen's LEADS platform
were used to identify intron boundaries and alternative splicing
sites [Shoshan et al. (2001) Proc. SPIE Microarrays: Optical
Technologies and Informatics 4266:86-95; Matloubian (2000) Nat.
Immunol. 1:298-304; David et al. (2002) J. Biol. Chem.
277:18084-18090; Sorek et al. (2002) Genome Res. 12:1060-7].
[0607] 20,301 clusters with 2.0 million ESTs contained at least one
mRNA sequence, in general agreement with UniGene build #148 with
20,876 such clusters. The remaining EST sequences, which were
clustered to unknown regions of known genes or to unknown genes
were not analyzed. Table 1 below provides some statistics about EST
and mRNA clustering. 125,115 introns, and 213,483 exons were
aligned either with an mRNA, or with ESTs from at least two
libraries if there was no RNA aligned to the gene segment. This was
effected to exclude possible genomic contamination in expressed
sequences, or other EST technology associated faults.
TABLE-US-00001 TABLE 1 EST Cluster RNA Cluster 1 963 1 6527 2-3
1457 2-3 6372 4-7 1532 4-7 6204 8-15 1655 8-15 1915 16-31 1879
16-31 226 32-63 2500 32-63 40 64-127 3481 64 and above 17 128-255
3240 Total 20301 256-511 1406 512-1023 422 .sup. 1024-above 1766
Total 20301
Example 2
Cluster Distribution of Alternatively Spliced Donor and Acceptor
Sites
[0608] Alternative splice events include exon skipping, alternative
5' or 3' splicing, and intron retention, which can be described by
the following simplification: a single exon connects to at least
two other exons in either the 3' end (donor site) or the 5' end
(acceptor site), as shown in FIG. 3. Table 2 below lists some
statistics of alternative splicing events based on this
simplification.
TABLE-US-00002 TABLE 2 Alternative Alternative donor site Cluster
acceptor site Cluster 1 3690 1 3751 2 2269 2 2388 3 1348 3 1511 4
760 4 799 5 435 5 508 6 and above 566 6 and above 710 Total 9068
Total 9667
[0609] Distribution analysis--As described hereinabove a valid
donor-acceptor concatenation must be supported by at least one mRNA
or by ESTs from at least two different libraries. 8254 clusters
were found to have both alternatively spliced donor and acceptor
sites. When the lower bound on the number of EST libraries
supporting each donor-acceptor concatenation was increased to
three, 13,402 alternatively spliced donor sites were shown to be
included in 6892 clusters and 15,015 alternatively spliced acceptor
sites where shown to be included in 7570 clusters, while 6111
clusters comprised both alternatively spliced donor and acceptor
sites.
Example 3
Tissue Distribution of ESTs and Libraries Following LEADS
Alternative Splicing Modeling
[0610] Cluster analysis performed to identify alternatively spliced
ESTs (see Example 2) was further used for tissue information
extraction. Table 3 below lists ten tissue types with the largest
numbers of ESTs along with those from pooled or uncharacterized
tissues.
TABLE-US-00003 TABLE 3 Number of ESTs Number of Libraries Tissue
Normal Cancer Total Normal Cancer Total Brain 93024 87803 180827 30
25 55 Lung 35455 85596 121051 92 156 248 Placenta 86571 27291
113862 259 3 262 Uterus 30052 71521 101573 99 107 206 Colon 23796
74998 98794 274 445 719 Kidney 42628 46811 89439 9 54 63 Skin 32436
43085 75521 8 10 18 Prostate 40312 27963 68275 131 135 266 Mammary
gland 26509 36638 63147 305 665 970 Head and neck 12354 50167 62521
62 800 862 Pooled 178618 992 179610 15 1 16 Uncharacterized 76193
9721 85914 778 106 884
[0611] Evidently, ESTs derived from lung, uterus, colon, kidney,
mammary gland, head and neck were obtained aminly from cancerous
libraries. The distribution of ESTs in normal and cancer libraries
in each case was taken into a consideration and used as a parameter
for scoring the differential expression annotation.
Example 4
Identification of Putative Cancer Specific Alternatively Spliced
Transcripts
[0612] Alternative splicing events restricted to cancer tissues
were identified by looking for any donor-acceptor concatenations
exclusively supported by ESTs from cancer tissues. Table 4 below
lists six examples for such. An interesting example is the NONO
gene (GenBank Accession No: BC003129), represented by 1496 ESTs.
The NONO gene has been previously suggested to code for a possible
splicing factor [Dong B, Horowitz D S, Kobayashi R, Krainer A R.
Nucleic Acids Res (1993) 25; 21(17):4085-92]. It's newly discovered
restricted to expression to cancer tissues suggests that
alternative splicing of multiple genes may be regulated during
carcinogenesis.
TABLE-US-00004 TABLE 4 Non-specific mRNA/ Uni Gene Total Specific E
Possible EST ID Pos. E R Type E R C N R function BC003129 172207
123, 237 1496 8 d+ 15 1 46 20 3 Splicing factor candidate NM_018035
279851 220, 301 584 2 d- 7 0 21 9 2 No known function AL519365
21938 474, 513 162 3 a- 8 3 6 1 0 Oxysterol binding BF341144 155596
507, 542 148 1 a+ 6 0 7 4 1 BCL2/adenovir- us E1B interacting
AB009357 7510 1372, 1452 205 6 a+ 7 4 2 4 2 MAPKKK 7 NM_002382
42712 57, 84 165 7 a- 8 1 7 3 6 MAX protein One mRNA/EST containing
both splicing junctions identifies the cluster. `Type`--indicates
the type of transcript, which was shown to be cancer specific. The
following symbols were used, (d) donor site; (a) acceptor site;
(`+) proximal exon; (`-`) distal exon. `Total`--indicates the
number of ESTs or mRNAs which were used for analysis.
`Specific/non-specific`--indicates total library number which was
used for analysis. All mRNA sequences under `specific` were from
cancer tissues. `Position`--identifies splicing boundaries on the
sequence. E--EST; R--RNA; C--Cancer; N--Normal.
Example 5
Ontological Annotation of Proteins--Data Collection
Background
[0613] Recent progress in genomic sequencing, computational biology
and ontology development has presented an opportunity to
investigate broad biological systems
[0614] A gene ontology system was developed and specifically used
to annotate human proteins. Examples 5-9 below describe the
development of an ontology engine, a computational platform for
annotation and resultant annotations of human proteins.
[0615] Gene Ontology (GO) and gene association files were obtained
from the website of the Gene Ontology Consortium. InterPro scan
from the website of the European Bioinformatics Institute, and
enzyme database from PROTEOME available at the ExPASy-Swiss
Institute of Bioinformatics website. The following databases and
versions were used, GenBank release 122.0, SwissProt release 39.0,
Enzyme database Release 26.0, InterPro database as of Apr. 6, 2001,
NCBI LocusLink data as of Mar. 6, 2001, MEDLINE databases as of
Apr. 6, 2001, and the following files from Gene Ontology
Consortium: gene_association.fb (version 1.26, Feb. 19, 2001),
gene_association.mgi (version 1.19, Mar. 1, 2001),
gene_association.sgd (version 1.251, Mar. 13, 2001),
gene_association.pombase (version 1.2, Jul. 22, 2000), ec2go
(version 1.2, Oct. 23, 2000), and swp2go (version 1.4, Nov. 15,
2000). 58118 SWISS-Prot proteins have been assigned with at least
one GO node by the following sources: 15534 proteins were assigned
with at least a functional GO node by conversion of EC (enzyme
nomenclature) to GO node. MGI has assigned 5984 SwissProt proteins
with GO nodes. 31869 SwissProt proteins were assigned a GO node
using SwissProt keyword correspondence and 33048 SwissProt proteins
were assigned GO node by InterPro scanning (available at the
European Bioinformatics Institute website). The nonredundant
protein database was constructed from GenPep file from NCBI, along
with proteins collected from the Saccharomyces genome database
(SGD) [Dwight et al. (2002) Nucleic Acids Res. 30:69-72] and the
Drosophila genome database (Flybase) [The Flybase consortium 2002
Nucleic Acids Res. 30:106-108], with a total number of 670130.
Example 6
Generation of Progressive Sequence Clusters
[0616] A two-stage strategy was used to build a detailed homology
map between all proteins in the comprehensive protein database
(Example 5). In a first stage, all protein pairs with an E score
lower than 0.01 using Blastp with default parameters were
cataloged. Table 5 lists the distribution of Blastp results.
TABLE-US-00005 TABLE 5 E escore Percentage 10.sup.-10-10.sup.-2
17.58 10.sup.-20-10.sup.-10 13.81 10.sup.-30-10.sup.-20 11.02
10.sup.-40-10.sup.-30 12.91 10.sup.-50-10.sup.-40 10.24
10.sup.-60-10.sup.-50 5.81 10.sup.-70-10.sup.-60 3.64
10.sup.-80-10.sup.-70 2.65 10.sup.-90-10.sup.-80 2.86
10.sup.-100-10.sup.-90 2.53 10.sup.-110-10.sup.-100 2.18
10.sup.-120-10.sup.-110 1.58 10.sup.-130-10.sup.-120 1.50
10.sup.-140-10.sup.-130 1.13 10.sup.-150-10.sup.-140 1.01
10.sup.-160-10.sup.-150 1.01 10.sup.-170-10.sup.-160 0.92
10.sup.-178-10.sup.-170 0.90 0.00 6.72
[0617] In the second stage, all homologous protein pairs were
aligned through Needlman-Wunsch algorithm with a global alignment
to obtain the percentage of identical amino acids between the two
proteins. BLOSUM62 was used as the substitution matrix. The
percentage of identity was defined as the number of amino acids
aligned with nonnegative scores divided by the number of amino
acids in both aligned and unaligned length of two proteins in the
global alignment. Table 6 shows a percent identity distribution of
protein pairs following global alignment. Evidently, the majority
of protein pairs (i.e., 68.5%) exhibited identity levels in the
range of 10-50%.
TABLE-US-00006 TABLE 6 Identity Level Percentage 0-10% 5.67 10-20%
24.66 20-30% 19.94 30-40% 10.94 40-50% 7.31 50-60% 7.09 60-70% 7.24
70-80% 6.70 80-90% 5.98 90-100% 4.47
Example 7
Text Mining
[0618] Correlations between presence of specific MeSH terms, or
specific English words in available text information and Gene
Ontology assignments in the training data were obtained. The
correlations were then used to predict Gene Ontology for unassigned
genes.
[0619] Method--Non-characters in titles and abstracts, and in
definition line of gene records were eliminated and words were
stemmed through the Lingua::stem module available at the website of
the Comprehensive Perl Archive Network. Due to the standardized and
curated nature of MeSH terms, MeSH terms were not parsed or
stemmed. The frequency of each word in all the available text
information was calculated. Words that occurred at least 5 times
over the whole text information space were retained for further
studies. This cutoff threshold was used to eliminate rare words,
wrong spellings, and sometimes even the base pair sequence present
in either the definition lines or abstracts. In addition, an upper
limit of word frequency (common words such as `and`, `gene`,
`protein`) and a lower limit of word frequency were defined through
repeated training process and manual review. The words within the
upper and the lower limits were considered as predictive. Since the
correlation between the GO nodes and specific words is positive by
nature, negative sentences with words such as `not` and its
variants, such as `unlikely` or `unresponsive` were excluded from
consideration.
[0620] Genes with GO annotation from other sources such as GO
consortium, InterPro scanning or keyword mappings were used as
training data to obtain the correlation between specific words and
specific GO nodes.
[0621] The following formula was used. S=log(P(m,g)/P(m)P(g)),
wherein S is the LOD score for word m-GO g combination, wherein
P(m,g) is the frequency of term m and GO node g co-occurrence among
all word and GO combinations, P(m) is the frequency of occurrence
of term m among all word occurrences, and P(g) is the frequency of
occurrence of GO node g among all GO occurrences.
[0622] In order to predict GO node for any specific gene which is
linked to one to a few dozen words, the sums of LOD scores from all
these words for each possible GO were calculated and sorted, and
used for further GO annotation. Multiple MeSH terms-GO correlations
were tested and were found to be no more informative than the
single MeSH term-GO correlation, and therefore they were not
used.
[0623] Results--Table 7 below, lists general statistics of text
information from publicly available sequence databases.
TABLE-US-00007 TABLE 7 MeSH Definition term Title Abstract line
Number of proteins 110608 106190 113073 516952 Number of articles
71703 77314 82654 n/a Number of unique 40011 18175 26630 25915
words* Average number of 19.05 2.70 11.65 6.56 words per article or
per definition line
[0624] A predictive probabilistic model was then applied to create
possible GO annotations based on the associated text information.
Definition lines of sequence records, MeSH term annotations, titles
and abstracts from sequence related publications were modeled
separately.
[0625] The frequency of association of a specific term with a
specific GO node in the training data was examined. Parameters such
as boundaries of the frequency of MeSH terms and other words were
optimized through the training process, using self-validation and
cross validation methods. LOD (logarithm of odds) scores, defined
as the logarithm of the ratio between the association frequency of
any term-GO pair and the calculated frequency of the random
combination of this pair, were used to indicate the relatedness of
certain terms with certain GO node. These LOD scores were found to
be correlative with the accuracy of GO prediction, as shown in FIG.
5. Text information from titles of MEDLINE records appeared to have
more predictive power, in particular at lower LOD scores, than text
information from other categories. This suggests that the title
tended to summarize the gist of an article in a straightforward
manner. MeSH terms had similar predictive capabilities as the
abstracts, possibly because the MeSH terms were derived from the
abstracts, and thus had similar information contents.
[0626] Based on text information, a significant number of proteins
were predicted to be associated with one or more GO nodes. Table 8
below, lists the number of proteins with predicted GO node from
four types of text information in the three categories of GO. These
predicted GO annotations were incorporated in GO process to
increase the accuracy of homology-based GO annotation and to
generate de novo annotations.
TABLE-US-00008 TABLE 8 MeSH Definition term Title Abstract Line
Total Cellular Component 57845 52094 57597 514191 521396 Molecular
Function 57845 54152 57632 516319 523384 Biological Process 57845
53970 57631 516402 523385
[0627] To further enhance the accuracy and coverage of GO
annotation process, a computational platform for predicting
cellular localization, ProLoc (Einat Hazkani-Covo, Erez Levanon,
Galit Rotman, Dan Graur and Amit Novik, a manuscript submitted for
publication), was used to predict the cellular localization of
individual proteins based on their inherent features such as
specific localization signatures, protein domains, amino acid
composition, pI, and protein length. Only protein sequences that
begin with methionine underwent ProLoc analysis. Thus, 88997 out of
93110 proteins in SwissProt version 39 were analyzed, and 78111
proteins have one to three GO predictions in cellular component
category.
Example 8
Gene Ontology Assignment
[0628] Progressive single-linkage clusters with 1% resolution were
generated to assign GO annotations (i.e., nodes) to proteins (see
Example 6). Protein clustering and annotation assignment were
effected at each level of homology. The resolution was 1% for
global alignment identity (i.e., clustering was first effected at
98%, then at 97% and so forth). The resolution was 10 fold for the
E score of a BlastP homology pair. For example, clustering was
performed at 10.sup.-50, then at 10.sup.-40 and so forth.
[0629] To examine clustering efficiency and homology transitivity,
all homology pairs clustered with at least 90% identity were
examined. At this level, there were a total of 57,004 clusters
containing 263,259 protein members. Among these clusters, 23,231
clusters contained at least three protein members (see FIGS. 6a-c).
The lowest homology pairs had an identity of 46% while being
clustered at 90% or higher identity levels.
[0630] Clusters containing proteins with preassociated or predicted
ontological annotations were analyzed and best annotations for
individual proteins in the clusters were selected through an error
weight calculation. Table 9 below, provides statistics on the
number of input gene ontology annotations and the number of output
annotations following processing.
TABLE-US-00009 TABLE 9 Input GO Consortium annotation, Enzyme
conversion, Text mining InterPro mapping, etc. ProLoc Output
Cellular Component 44702 522179 574607 Molecular Function 85626
526083 580767 Biological Process 69726 525842 578636
[0631] Over 85% of proteins were annotated with one or more GO
nodes in each of three GO categories. Table 10 below, analyses the
number of proteins annotated at different homology levels, showing
that GO annotations were achieved throughout the homology
spectra.
TABLE-US-00010 TABLE 10 Cellular Molecular Biological Component
Function Process Text 32257 34137 30149 .sup. 10.sup.-2-10.sup.-10
87967 71717 74277 10.sup.-10-10.sup.-50 122992 70088 79318
10.sup.-50-0.0 .sup. 98059 55132 59051 35%-75% 111130 97209 108334
75%-90% 38509 68282 67429 90%-99% 38991 98576 90352 Input GO 44702
85626 69726
Example 9
Statistical Validation of Ontological Annotations
[0632] Gene ontology annotations, which were assigned according to
the teachings of the present invention, were assessed by automatic
cross-validation. One fifth of input of input GO annotations were
withheld during the GO annotation process and the resultant
annotations were compared with the withheld GO nodes. For each
protein, the GO node with the lowest error score was examined.
Table 11 below, lists the coverage and accuracy of such
representative test.
TABLE-US-00011 TABLE 11 Total Predicted GO Accurate GO Cellular
Component 7431 7186 4642 Molecular Function 12999 12864 10138
Biological Process 10811 10690 8080
[0633] Evidently, sample coverage ranged from 96% to 99% and the
reproducibility was between 65% and 80%. The lower reproducibility
of GO annotations in the "cellular component" category, as compared
with that in the other two GO categories was consistent with the
notion that a short amino acid segment such as a signal peptide
affects significantly protein localization. The presence or absence
of such small amino acid segments could not be completely captured
in sequence similarity comparisons. Detailed analysis of the
validation of data indicated that the accuracy of the annotations
correlated with the homology levels (data not shown). Manual
validation of assigned annotations was performed on a total of 500
annotations and about 85%-93% of annotations were found to be
correct. The higher percentage of accuracy in the manual
examination over the automatic cross-validation resulted from the
incomplete annotation of input GO.
Example 10
Description of Data
[0634] Example 10a-e below describe the data table in
"Summary_table" file, on the attached CD-ROM3. The data table shows
a collection of annotations of differentially expressed nucleic
acid sequences, which were identified according to the teachings of
the present invention.
[0635] Each feature in the data table is identified by "#".
[0636] Each transcript in the data table is identified by:
[0637] (i) A Serial number, e.g. "251470" in Example 10a,
"445259"-"445262" in Example 10b. I
[0638] (ii) An internal arbitrary transcript accession number, e.g.
"N62228.sub.--4" in Example 10a, "BE674469.sub.--0",
"BE674469.sub.--0.sub.--124", "BE674469.sub.--1",
"BE674469.sub.--1.sub.--124" in Example 10b.
[0639] The first number of the internal transcript accession number
is shared by all transcripts which belong to the same contig, and
represent alternatively spliced variants of each other, e.g.
"BE674469" in "BE674469.sub.--0", "BE674469.sub.--0.sub.--124",
"BE674469.sub.--1", "BE674469.sub.--1.sub.--124" in Example
10b.
[0640] The second number of the internal transcript accession
number is an internal serial transcript number of a specific
contig, e.g. ".sub.--0" or ".sub.--1" in "BE674469.sub.--0",
"BE674469.sub.--0.sub.--124", "BE674469.sub.--1",
"BE674469.sub.--1.sub.--124" in Example 10b.
[0641] The third number of the internal transcript accession number
is optional, and represents the GenBank database version used for
clustering, assembly and annotation processes. Unless otherwise
mentioned, GenBank database version 126 was used. "124" indicates
the use of GenBank version 124, as in "BE674469.sub.--1.sub.--124"
of Example 10b.
[0642] "ProDG" following the internal accession number indicates an
EST sequence data from a proprietary source, e.g., Examples 3d and
3e.
[0643] "han" represents the use of GenBank version 125. This
version was used in the annotation of lung and colon cancer
specific expressed sequences.
[0644] "lab" indicates expressed sequences which differential
pattern of expression has been confirmed in the laboratory.
[0645] Transcript accession number identifies each sequence in the
nucleotide sequence data files "Transcripts_nucleotide_seqs_part1",
"Transcripts_nucleotide_seqs_part2" and
"Transcripts_nucleotide_seqs_part3" on CD-ROMs 1 and 2, and in the
respective amino acid sequences data file "Protein.seqs" on
CD-ROM2. Of note, some nucleotide sequence data files of the above,
do not have respective amino acid sequences in the amino acid
sequence file "Protein.seqs" attached on CD-ROM2.
[0646] Additional lines of the file contain the following
information:
[0647] "*" indicates optional fields; "**" indicates repeatable
features.
[0648] "#EST" represents a list of GenBank accession numbers of all
expressed sequences (ESTs and RNAs) clustered to a contig, from
which a respective transcript is derived. The GenBank accession
numbers of these expressed sequences are listed only for the first
transcript in the contig, e.g."#EST
BC006216,BE674469,BE798748,NM032716" in Example 10b. The rest of
the transcripts derived from the same contig, are indicated by an
#EST field marked with "the same".
[0649] Expressed sequences, marked with "ProDGyXXX", e.g.,
"ProDGy933" in Example 10d, and expressed sequences, marked with
"GeneID XXX", e.g., "GeneID1007Forward" in Example 10e, are
proprietary sequences which do not appear in GenBank database.
These sequences are deposited in the nucleotide sequence file
"ProDG_seqs" in the attached CD-ROM2.
[0650] Data pertaining to differentially expressed alternatively
spliced sequences is presented in the following format:
[0651] *, ** "#TAA_CD" represents the coordinates of the
differentially expressed sequence segment. A single number
represents a differentially expressed edge, corresponding to the
specific junction between 2 exons. "TAA_CD" represented by a pair
of numbers represents the start and end positions of a
differentially expressed sequence node. For example, "#TAA_CD 269
296" in Example 10a indicates that the transcript identified as
N62228.sub.--4 contains a differentially expressed segment, located
between the nucleotides at positions 269 and 296.
[0652] *, ** "#TAA_TIS" contains information pertaining to specific
tissue(s), in which the respective transcript is predicted to be
expressed differentially. Tumor tissues are indicated accordingly.
For example, "#TAA_TIS lung Tumor" indicates that transcript
BE674469.sub.--0 in Example 10b is predicted to be differentially
expressed in lung tumor tissues.
[0653] *, ** "#DN" represents information pertaining transcripts,
which contain altered functional domains, predicted to act in a
dominant negative manner. This field lists the description of the
functional domain(s), which is altered in the respective splice
variants e.g., "#DN EGF-like domain" in Example 10a.
[0654] Functional annotations of transcripts based on Gene Ontology
(GO) are indicated by the following format.
[0655] *, ** "#GO_P", annotations related to Biological
Process,
[0656] *, ** "#GO_F", annotations related to Molecular Function,
and
[0657] *, ** "#GO_C",annotations related to Cellular Component.
[0658] For each category the following features are optionally
addressed:
[0659] "#GOPR" represents internal arbitrary accession number of
the predicted protein corresponding to the functionally annotated
transcript. This internal accession number identifies the protein
in the amino acid sequence file "Protein.seqs" in the attached
CD-ROM2, together with the internal arbitrary transcript accession
number. For example, "#GOPR human.sub.--281192" in Example 10a, is
a protein sequence encoded by transcript N622284, which appears in
the amino acid sequence file "Protein.seqs" in the attached CD-ROM2
and is identified by both numbers, "N62228.sub.--4" and
"human.sub.--281192".
[0660] "#GO_Acc" represents the accession number of the assigned GO
entry, corresponding to the following "#GO_Desc" field.
[0661] "#GO_Desc" represents the description of the assigned GO
entry, corresponding to the mentioned "#GO_Acc" field. For example,
"#GO_Acc 7165 #GO_Desc signal transduction" in Example 10a, means
that the respective transcript is assigned to GO entry number 7165,
corresponding to signal transduction pathway.
[0662] "#CL" represents the confidence level of the GO assignment,
when #CL1 is the highest and #CL5 is the lowest possible confidence
level.
[0663] "#DB" marks the database on which the GO assignment relies
on. The "sp", as in Example 10a, relates to SwissProt Protein
knowledgebase, available from the ExPASy-Swiss Institute of
Bioinformatics website. "InterPro", as in Example 10c, refers to
the InterPro combined database, available from the European
Bioinformatics Institute website, which contains information
regarding protein families, collected from the following databases:
SwissProt available at the European Bioinformatics Institute
website, Prosite--available at the ExPASy-Swiss Institute of
Bioinformatics website, Pfam--available at the website of Wellcome
Trust Sanger Institute, Prints--available at the website of the
Center for Bioinformatics and Computational Biology, Manchester
University, UK, Prodom--available at the website of the Laboratoire
de Genetique Cellulaire, INRA Toulouse, France; Smart-available at
the website of the European Molecular Biology Laboratory,
Heidelberg and Tigrfams--available at the website of the J. Craig
Venter Institute.
[0664] "#EN" represents the accession of the entity in the
database(#DB), corresponding to the best hit of the predicted
protein. For example, "#DB sp #EN_NRG2_HUMAN" in Example 10a means
that the GO assignment in this case was based on SwissProt
database, while the closest homologue to the assigned protein is
depicted in SwissProt entry "NRG2_HUMAN", corresponding to protein
named "Pro-neuregulin-2" (see entry 014511 at the ExPASy-Swiss
Institute of Bioinformatics website). "#DB interpro #EN IPRO01609"
in Example 10c means that GO assignment in this case was based on
InterPro database, while the best hit of the assigned protein is to
protein family depicted in SwissProt accession number "IPRO01609",
corresponding to "Myosin head (motor domain)" protein family
(available at the European Bioinformatics Institute website).
[0665] The following two fields correspond to the hierarchical
assignment of the differentially expressed sequences to a specific
tissue(s), based on the EST content and EST libraries' origin
within the contig.
[0666] *, ** "#SA" indicates that tissue assignment requires a
contig, containing at least 3 ESTs, where at least 80% thereof are
assigned to a selected tissue.
[0667] *, ** "#RA" indicates that tissue assignment requires a
contig derived from at least two different EST libraries,
originally constructed from a specific tissue.
Example 10a
[0668] 251470 N62228.sub.--4 #EST the_same #TAA_CD 269 296 #TAA_TIS
ovary, #TAA_CD 269 296 #TAA_TIS ovary Tumor, #TAA_CD 269 296
#TAA_TIS skin Tumor, #TAA_CD 59 269 #TAA_TIS ovary, #TAA_CD 59 269
#TAA_TIS ovary Tumor, #TAA_CD 59 269 #TAA_TIS skin Tumor #DN
EGF-like domain #GO_F #GOPR human.sub.--281192 #GO_Ace 3823
#GO_Desc antibody #CL 2 #DB sp
[0669] #EN NRG2_HUMAN #GO_P #GOPR human.sub.--281192 #GO_Acc 7165
#GO_Desc signal transduction #CL 2 #DB sp #EN NRG2_--HUMAN
Example 10b
[0670] 445259 BE674469.sub.--0 #EST
BC006216,BE674469,BE798748,NM032716 #TAA_CD 0 2537 #TAA_TIS lung,
#TAA_CD 0 2537 #TAA_TIS lung Tumor
[0671] 445260 BE674469.sub.--0.sub.--124 #124EST
BC006216,BE674469,BE798748,NM.sub.--032716 #SA Lung Tumor #RA
lung_cancer
[0672] 445261 BE674469.sub.--1 #EST the_same #TAA_CD 0 2537
#TAA_TIS lung, #TAA_CD 0 2537 #TAA_TIS lung Tumor
[0673] 445262 BE674469.sub.--1.sub.--124 #124EST
BC006216,BE674469,BE798748,NM.sub.--032716 #SA Lung Tumor #RA
lung_cancer
Example 10c
[0674] 314251 HUMM7BA.sub.--0 #EST
BF804381,BF805793,BF805830,BG978076,HUMM7BA #GO_C #GOPR
human.sub.--313276 #GO_Acc 16459 #GO_Desc myosin #CL 2 #DB interpro
#EN IPRO01609 #GO_F #GOPR human 313281 #GO_Acc 3774 #GO_Desc motor
#CL 1 #DB sp #EN Q14786 #GO_F #GOPR human.sub.--313281 #GO_Acc 5524
#GO_Desc ATP binding #CL 1 #DB sp #EN Q14786 #GO_P #GOPR human
313281 #GO_Acc 5983 #GO_Desc starch catabolism #CL 4 #DB sp #EN
Q14786 #SA colon, colonic, gut #RA colon_normal
Example 10d
[0675] 723873 AA157684_T0_ProDG #EST
[0676] AA157684,AA157764,AK057980,BF355351,ProDGy933
[0677] #GO_C #GO_Acc 0016021 #GO_Desc "integral membrane protein"
#GO_F
[0678] #GO_Acc 0005978 #GO_Desc "glycogen biosynthesis" #GO_P
#GO_Acc 0003707 #GO_Desc "steroid hormone receptor"
Example 10e
[0679] 723928 GeneID1007Forward_T0_ProDG #EST
[0680] AC018755CDS1,AC018755mRNA1,AW403840,AY040820CDS0,BF3
59557,
BF896787,BF898989,BF899932,BF900235,BF905509,BI518761,BI756629,BI
822428,BI906477,BI906754,BM550096,BM922784,GeneID1007Forward,Gen
eID285Forward,ProDGy1006 #GO_C #GO_Acc 0005887 #GO_Desc "integral
plasma membrane protein" #GO_F #GO_Acc 0007267 #GO_Desc "cell-cell
signaling"#GO_P #GO_Acc 0005530 #GO_Desc "lectin"
Example 11
Description of the Sequence Files on the Enclosed CD-ROM
[0681] The sequences in the CD-ROM sequence files are in FastA text
format. Each transcript sequence starts with ">" mark, followed
by the transcript internal accession number. The proprietary ProDG
EST sequences starts with ">" mark, to followed by the internal
sequence accession. An example of the sequence file is presented
below.
Example 11a
TABLE-US-00012 [0682]>R42278_0 (SEQ ID NO: 41)
TGTTTTAGAAATCTCATGATTCCCAGGAAAAAAATTTTAAATTGTGA
TACAGGTTTGACAGCCTTTTAGTCAAATAAGTTAAAACACACACGC
AAACTCATTTACTCACTTTGCCATTATAATTCAATCACAAAGAAATT
TTGGCCAGGCGTGGTGGTTACGCCTGTAATCCCAGCACTTTGGGAGG
CCGAGGCAGGTGGATCACGAGGTCAGGGGATCAAGATCATCCTGGC
TAACATGTGAAACCCCGTCTCTATTAAAAATAAAAAATTAGCCTGGT
GTGGTGGCGGGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCA
GCAGAATGGCGTGAACTCAGGAGGCGGAGCTTGCAGTGAGCCGAG
ATCGCGCCACTGCACTCCAGCCTGGATGACAGAGCGAGACTCCATC TCAAAAAAAAAA
Example 11b
TABLE-US-00013 [0683]>GeneID3Reverse #TY RNA #DE ProDGy sequence
#DT 18-JUN-1000 #DR 5 #LN 348 (SEQ ID NO: 1)
GTGGTTATTACAGCATGGTTCCCAGCCTTACAGTGTCTAAGTGCTTC
TCTTGTGTCCTGTAGATGTTGTGAAAAAGAAAAAAACAAAAAATAC
ACCACACTGTACTTTTTCCCCCTGCCCCCGTTACTGCCGGTGATTATT
ATTAAAAATTAGTTTTTTTCACATCATTATATCTGGCTTCCTATAAAC
AACAGCCTTAATTCAGTCAAGACTCCCTTTGGGGAATTCATTTTATT
AAAAATTGGTGTCTGGATACTTCCCTGTACATGCATAAATATGCATG
CATGTACAGAAAGACTGTATGTGTGTGCCTTGCACACACACCCATAC
CTCTCAGAAAAAGTGTTT
Example 11c
[0684] >ProDGy1339 #OS Homo sapiens #DE ProDGy sequence #DT
26-JUL-
TABLE-US-00014 2002 #TY EST #DR 5 #AC ProDGyl339 #LN 132 (SEQ ID
NO: 2) CAGAAAGCCCAGAGTAGTCCCTGTAAGAAGCTGAGGGGCGCATACC
TCTGGGGTTTGGGTTCCCTTCAGGGAAGCGAAGGGAGATGACCTCTT
TCCAGGCTGGGGACCAAGAGGGCTCCCTAGAAGATATTA
Example 12
Description of the CD-ROM Content
[0685] The CD-ROMs enclosed herewith contain the following
files:
CD-ROM1 (1 file): 1. Transcripts_nucleotide_seqs_part1/580,375
KB/Sep. 4, 2002/ASCII file/PC. CD-ROM2 (4 files): 1. ProDG_seqs/395
KB/Sep. 9, 2002/ASCII file/PC. 2. Protein.seqs/95,546 KB/Sep. 9,
2002/ASCII file/PC. 3. Transcripts_nucleotide_seqs_part2/129,269
KB/Sep. 9, 2002/ASCII file/PC. 4.
Transcripts_nucleotide_seqs_part3/27,060 KB/Sep. 11, 2002/ASCII
file/PC. CD-ROM3 (1 file): 1. Summary_table/570,042 KB/Sep. 11,
2002/ASCII file/PC. CD-ROM4 (1 file): 1.
Pat11_US5_Patentin.part1/604,186 KB/Apr. 27, 2006/text file/PC.
CD-ROM5 (1 file): 1. Pat11_US5_Patentin.part2/605,957 KB/Apr. 27,
2006/text file/PC. CD-ROM6 (1 file): 1.
Pat11_US5_Patentin.part3/594,390 KB/Apr. 27, 2006/text file/PC.
Example 13
In-Vitro Confirmation of Differentially Expressed Transcripts
Experimental Procedures and Reagents
[0686] In-vitro confirmation of in-silico obtained differentially
expressed polynucleotide sequences was effected utilizing
laboratorial methodologies, based on nucleotide hybridization
including northern analysis, RT-PCR and real-time PCR.
[0687] RNA preparation--Total RNA was isolated from the indicated
cell lines or tumor tissues using the Tri-Reagent (Molecular
Research Center Inc.) following the manufacturer's recommendations.
Poly(A) RNA was purified from total RNA using
oligo(dT).sub.25Dynabeads (Dynal).
[0688] Northern blotting--20 .mu.g of total RNA or 2 .mu.g of
poly(A) RNA were electrophoresed on 1% agarose gels containing
formaldehyde, and blotted onto Nytran Super Charge membranes
(Shcleicher & Schuell). Hybridization was carried out using a
DNA probe (SEQ ID NO: 3) in EZ-Hybridization Solution (Biological
Industries, Beit Haemek, Israel) at 68.degree. C. for 18 hrs. The
membranes were rinsed twice with 2.times.SSC, 0.1% SDS at room
temperature, followed by two washes with 0.1.times.SSC, 0.1% SDS at
50.degree. C. Autoradiograms were obtained by exposing the
membranes to X-ray films.
[0689] RT-PCR analysis--Prior to RT reactions, total RNA was
digested with DNase (DNA-free.TM., Ambion) in the presence of
RNasin. Reverse transcription was carried out on 2 .mu.g of total
RNA, in a 20 .mu.l reaction, using 2.5 units of Superscript II
Reverse Transcriptase (Bibco/BRL) in the buffer supplied by the
manufacturer, with 10 pmol of oligo(dT).sub.25(Promega), and 30
units of Rnasin (Promega). RT reactions were standardized by PCR
with GAPDH-specific primers, for 20 cycles. The calibrated reverse
transcriptase samples were then analyzed with gene-specific primers
either at 35 cycles, or at lower cycles (15 and 20 cycles). PCR
products of lower number of cycles were visualized by southern
blotting, followed by hybridization with the appropriate probe (the
same PCR product).
[0690] Real-Time RT-PCR--Total RNA samples were treated with DnaseI
(Ambion) and purified with Rneasy columns (Qiagen). 2 .mu.g of
treated RNA samples were added into 20 .mu.l RT-reaction mixture
including. RT-PCR end product 200 units SuperscriptII (Invitrogen),
40 units RNasin, and 500 pmol oligo dT. All components were
incubated for 1 hr at 50.degree. C. and then inactivated by
incubation for 15 min at 70.degree. C. Amplification products were
diluted, 1:20, in water. 5 .mu.l of diluted products were used as
templates in Real-Time PCR reactions using specific primers and the
intercalating dye Sybr Green.
[0691] The amplification stage was effected as follows, 95.degree.
C. for 15 sec, 64.degree. C. for 7 sec, 78.degree. C. for 5 sec and
72.degree. C. for 14 sec. Detection was effected using Roch light
cycler detector. The cycle in which the reactions achieved a
threshold level of fluorescence was registered and served to
calculate the initial transcript copy number in the RT reaction.
The copy number was calculated using a standard curve created using
serial dilutions of a purified amplicon product. To minimize
inherent differences in the RT reaction, the resulting copy number
was normalized to the levels of expression of the housekeeping
genes Proteasome 26S subunit (GenBank Accession number D78151) or
GADPH (GenBank Accession number: AF261085).
[0692] Semiquantitative PCR--RT-PCR reaction was performed with
sample specific primers, for 16 cycles. PCR products were used as
probes. Labeling procedure was carried out using "Random primer DNA
labeling mix" according to manufacturer's instructions (Cat. No:
20-101-25). Briefly, 25 ng of template DNA were denatured by
heating to 100.degree. C. for 5 minutes, and then chilled on ice
for 5 minutes. Labeling solution contained 11 .mu.l of denatured
DNA, 4 .mu.l of labeling mix solution (Biological industries), 5
.mu.l of .sup.32(p)dCTP (Amersham, Pharmacia, AA0005). Labeling was
effected for 10 minutes in 37.degree. C. Removal of unincorporated
nucleotides was effected using Sephadex G-50 columns. Prior to
hybridization, labeled DNA was denatured by heating to 100.degree.
C. for 5 minutes and then rapidly cooled on ice.
[0693] Southern blotting--PCR products were separated on 1.5%
agarose gel and size separated. The gel was denatured by two
consecutive washes for 20 min in 1.times. denaturation buffer,
containing 1.5M NaCl, 0.5M NaOH. Thereafter a neutralization
procedure was effected by washing twice for 20 min in 1.times.
neutralization buffer, containing 1.5M NaCl, 0.5m Tris/HCL pH=7.0.
Blotting of the denatured DNA to the nylon membrane was performed
overnight with 20.times.SSC. DNA was UV crosslinked (Stratalinker)
to a nylon membrane prior to prehybridization step.
Prehybridization was performed using EZ-hybridization solution
(Biological Industries, Cat no: 01-889-1B) at 68.degree. C. for 1
hour. The DNA blot was subjected to Southern hybridization using
specific oligonucleotides end-labeled with adenosine
5'[.gamma.-.sup.32P]triphosphate (>5000 Ci/mmol, Amersham
Biosciences, Inc.). Hybridization step was effected at 68.degree.
C. for 16 hours.
[0694] Following hybridization the membrane was washed at gradually
increasing stringent conditions: twice in 2.times.SSC, 0.1% SDS,
for 15 min. at room temperature and twice in 0.1.times.SSC, 0.1%
SDS, for 15 min, at 60.degree. C. Radioactive signal was visualized
by autoradiography.
Example 14
Colorectal Cancer Specific Expression of AA535072
[0695] AA535072 (SEQ ID NO: 39) is a common sequence feature to a
series of overlapping sequences (SEQ ID NOs: 4, 24-28) with
predicted amino acid sequences provided in SEQ ID NOs: 35-38.
[0696] The indicated tissues and cell lines were examined for
AA535072 (SEQ ID NOs: 39) expression by RT-PCR analysis. Primers
for AA535072 were GTGACAGCCAGTAGCTGCCATCTC (SEQ ID NO: 5) and
TCCGTTTCTAGCGGCCAGACCTTT (SEQ ID NO: 6). PCR reactions were
denatured at 94.degree. C. for 2 minutes followed by 35 cycles at
94.degree. C. for 30 sec, 64.degree. C. for 30 sec and 72.degree.
C. for 60 sec. All PCR products were separated on an ethidium
bromide stained gel.
[0697] As shown in FIG. 7 amplification yielded a major PCR product
of 1000 bp. Evidently, AA535072 expression was limited to
colorectal cancer tissues; adenocarcinoma, colon carcinoma cell
line and colon carcinoma Duke A cells. Since colon carcinoma Duke A
cells represent an early stage of colon cancer progression,
differentially expressed AA535072 can be used as a putative marker
of polyps and benign stages of colon cancer. Furthermore,
corresponding protein products (SEQ ID NOs: 35-38) may be utilized
as important colon cancer specific diagnostic and prognostic
tools.
Example 15
Bone Tumor Ewing's Sarcoma Specific expression of AA513157 (SEQ ID
NO: 7)
[0698] The indicated tissues and cell lines were examined for
AA513157 (SEQ ID NO: 7) expression by RT-PCR analysis. Primers for
SEQ ID NO: 7 were GAAGGCAGGCGGATGCTACC (SEQ ID NO: 8) and
AGCCTTCCACGCTGTACACGCCA (SEQ ID NO: 9). PCR reactions were
denatured at 94.degree. C. for 2 minutes followed by 35 cycles at
94.degree. C. for 30 sec, 64.degree. C. for 30 sec and 72.degree.
C. for 45 sec. All PCR products were separated on an ethidium
bromide stained gel.
[0699] As shown in FIG. 8, amplification reaction yielded a
specific PCR product of 600 bp. As shown in FIG. 8, in the presence
of reverse transcriptase (indicated by +) high expression of
AA513157 was evident in both samples of Ewing sarcoma, while only
residual expression of AA513157 was seen in Ln-Cap cells, brain and
splenic adenocarcinoma.
[0700] To substantiate these, Northern blot analysis of AA513157
was effected. The following primers were used,
GAAGGCAGGCTGGATGCTACC (SEQ ID NO: 10), GGTAGTATAACCGGGCTCTGT (SEQ
ID NO: 11). FIG. 9 illustrates RNA expression of AA513157 in
various tissues. Several transcripts were evident upon Northern
analysis: two major transcripts of 800 bp and 1800 bp from ployA
RNA preparation and total RNA preparation, respectively. Expression
of both transcripts was limited to the Ewing sarcoma cell line. Low
expression of the 1800 bp transcript was evident in Bone Ewing
sarcoma tissue as well.
[0701] These results corroborate AA513157 as a putative Ewing
sarcoma marker and a putative pharmaceutical target.
Example 16
Colorectal Cancer Specific Expression of AA469088
[0702] AA469088 (SEQ ID NO: 40) is a common sequence feature to a
series of overlapping sequences (SEQ ID NOs: 12 and 29-31).
[0703] The indicated tissues and cell lines were examined for
AA469088 (SEQ ID NO: 40) expression by semi quantitative RT-PCR
analysis. Primers for AA469088 were CATATTTCACTCTGTTCTCTCACC (SEQ
ID NO: 13) and CAGAATGGGATTATGGTAGTCTATCT (SEQ ID NO: 14). PCR
reactions were effected as follows: 14 cycles at 92.degree. C. for
20 sec, 59.degree. C. for 30 sec and 68.degree. C. for 45 sec. The
PCR products were size separated on agarose 1.5% gel, and undergone
Southern blot analysis using the PCR products as specific probe, as
described in details in Example 13. The visualization of the
hybridization signal of the PCR products was performed by
autoradiogram exposure to X-ray film.
[0704] As shown in FIG. 10 amplification reaction yielded a major
PCR product of 484 bp. Evidently, AA469088 expression was limited
to colorectal tumor tissues, normal colon and adenocarcinoma with
only minor expression in the spleen and kidney.
Example 17
HUMMCDR--A Lung Cancer Specific Marker
[0705] Real-time quantitative RT-PCR was used to measure the mRNA
steady state levels of HUMMCDR (SEQ ID NO: 15). The following
primers were used CTTCAATTGGATTATGTTGACCTCTAC (SEQ ID NO: 16) and
CACTATAGGCAACCAGAACAATGTC (SEQ ID NO: 17).
[0706] Real-time PCR analysis (FIG. 11) indicates that SEQ ID NO:
15 is specifically expressed in lung squamous cell carcinoma with
an evident 2-10 fold higher expression than in normal lung
samples.
Example 18
SEQ ID NO: 18--A Lung Cancer Specific Transcript
[0707] Real-time quantitative RT-PCR was used to measure the mRNA
steady state levels of SEQ ID NO: 18. The following primers were
used GCGAGGACCGGGTATAAGAAGC (SEQ ID NO: 19) and
TCGGCTCAGCCAAACACTGTCAG (SEQ ID NO: 20).
[0708] Real-time PCR analysis indicates that SEQ ID NO: 18 is
specifically expressed in lung adenocarcinoma samples and in lung
alveolus cell carcinoma (FIG. 13).
Example 19
SEQ ID NO: 21--A Lung Cancer Specific Transcript
[0709] Real-time quantitative RT-PCR was used to measure the mRNA
steady state levels of SEQ ID NO: 21. The following primers were
used GCTTCGACCGGCTTAGAACT (SEQ ID NO: 22) and GGTGAGCACGATACGGGC
(SEQ ID NO: 23).
[0710] Real-time PCR analysis indicates that SEQ ID NO: 21 is
specifically expressed in small lung cell carcinoma and in
adenocarcinoma (FIG. 14).
Example 20
HSGPGI--A Lung Cancer Specific Transcript
[0711] Real-time quantitative RT-PCR was used to measure the mRNA
steady state levels of HSGPGI (SEQ ID NO: 32). The following
primers were used GAGCCCTGTGCGCCGCTCAGATGTG (SEQ ID NO: 33) and
AGCCCAAGTTGAATCACCAACCAG (SEQ ID NO: 34).
[0712] As shown in FIG. 12, real-time PCR analysis exhibited
specific expression of SEQ ID NO: 32 in lung adenocarcinoma and
lung squamos cell carcinoma, as compared to the expression in
normal lung tissue (2-25 fold).
[0713] It is appreciated that certain features of the invention,
which are, for clarity, described in the context of separate
embodiments, may also be provided in combination in a single
embodiment. Conversely, various features of the invention, which
are, for brevity, described in the context of a single embodiment,
may also be provided separately or in any suitable
subcombination.
[0714] Although the invention has been described in conjunction
with specific embodiments thereof, it is evident that many
alternatives, modifications and variations will be apparent to
those skilled in the art. Accordingly, it is intended to embrace
all such alternatives, modifications and variations that fall
within the spirit and broad scope of the appended claims. All
publications, patents, patent applications and sequences identified
by their accession numbers mentioned in this specification are
herein incorporated in their entirety by reference into the
specification, to the same extent as if each individual
publication, patent, patent application or sequence identified by
their accession number was specifically and individually indicated
to be incorporated herein by reference. In addition, citation or
identification of any reference in this application shall not be
construed as an admission that such reference is available as prior
art to the present invention.
CD-ROM Content
[0715] The following lists the file content of the three CD-ROMs
which are enclosed herewith and filed with the application. The
content of the CD-ROMs is incorporated-by-reference in it's
entirety as if fully set forth by reference herein. File
information is provided as: File name/bite size/date of
creation/operating system/machine format.
CD-ROM1 (1 file): 1. Transcripts_nucleotide_seqs_part1/580,375
KB/Sep. 4, 2002/ASCII file/PC. CD-ROM2 (4 files): 1. ProDG_seqs/395
KB/Sep. 9, 2002/ASCII file/PC. 2. Protein.seqs/95,546 KB/Sep. 9,
2002/ASCII file/PC. 3. Transcripts_nucleotide_seqs_part2/129,269
KB/Sep. 9, 2002/ASCII file/PC. 4.
Transcripts_nucleotide_seqs_part3/27,060 KB/Sep. 11, 2002/ASCII
file/PC. CD-ROM3 (1 file): 1. Summary_table/570,042 KB/Sep. 11,
2002/ASCII file/PC. CD-ROM4 (1 file): 1.
Pat11_US5_Patentin.part1/604,186 KB/Apr. 27, 2006/text file/PC.
CD-ROM5 (1 file): 1. Pat11_US5_Patentin.part2/605,957 KB/Apr. 27,
2006/text file/PC. CD-ROM6 (1 file): 1.
Pat11_US5_Patentin.part3/594,390 KB/Apr. 27, 2006/text file/PC.
TABLE-US-LTS-CD-00001 LENGTHY TABLES The patent application
contains a lengthy table section. A copy of the table is available
in electronic form from the USPTO web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20110183924A1).
An electronic copy of the table will also be available from the
USPTO upon request and payment of the fee set forth in 37 CFR
1.19(b)(3).
Sequence CWU 0 SQTB SEQUENCE LISTING The patent application
contains a lengthy "Sequence Listing" section. A copy of the
"Sequence Listing" is available in electronic form from the USPTO
web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20110183924A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
0 SQTB SEQUENCE LISTING The patent application contains a lengthy
"Sequence Listing" section. A copy of the "Sequence Listing" is
available in electronic form from the USPTO web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20110183924A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
* * * * *
References