U.S. patent application number 12/713554 was filed with the patent office on 2011-07-28 for diagnosis and prognosis of infectious disease clinical phenotypes and other physiologic states using host gene expression biomarkers in blood.
This patent application is currently assigned to The Government of the United States of America, as represented by the Secretary of the Navy. Invention is credited to Brian K. Agan, Eric H. Hanson, Michael J. Jenkins, Baochuan Lin, Jinny Lin Liu, Chris C. Olsen, Robb K. Rowley, David A. Stenger, Dzung C. Thach, Clark J. Tibbetts, Elizabeth A. Walter.
Application Number | 20110183856 12/713554 |
Document ID | / |
Family ID | 37669288 |
Filed Date | 2011-07-28 |
United States Patent
Application |
20110183856 |
Kind Code |
A1 |
Agan; Brian K. ; et
al. |
July 28, 2011 |
Diagnosis and Prognosis of Infectious Disease Clinical Phenotypes
and other Physiologic States Using Host Gene Expression Biomarkers
In Blood
Abstract
The present invention provides a specific set of gene expression
markers from peripheral blood leukocytes that are indicative of a
host response to exposure, response, and recovery infectious
pathogen infections. The present invention further provides methods
for identifying the specific set of gene expression markers,
methods of monitoring disease progression and treatment of
infectious pathogen infections, methods of prognosing the onset of
an infectious pathogen infection, and methods of diagnosing an
infectious pathogen infection and identifying the pathogen
involved.
Inventors: |
Agan; Brian K.; (San
Antonio, TX) ; Hanson; Eric H.; (Las Vegas, NV)
; Jenkins; Michael J.; (San Antonio, TX) ; Lin;
Baochuan; (Bethesda, MD) ; Olsen; Chris C.;
(Cibilo, TX) ; Rowley; Robb K.; (Las Vegas,
NV) ; Stenger; David A.; (Herndon, VA) ;
Thach; Dzung C.; (Annandale, VA) ; Tibbetts; Clark
J.; (Sperryville, VA) ; Walter; Elizabeth A.;
(San Antonio, TX) ; Liu; Jinny Lin; (Ellicott,
MD) |
Assignee: |
The Government of the United States
of America, as represented by the Secretary of the Navy
Washington
DC
The Government of the United States of America, as represented
by the Secretary of the Air Force
|
Family ID: |
37669288 |
Appl. No.: |
12/713554 |
Filed: |
February 26, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11268373 |
Nov 7, 2005 |
|
|
|
12713554 |
|
|
|
|
60626500 |
Nov 5, 2004 |
|
|
|
Current U.S.
Class: |
506/7 |
Current CPC
Class: |
C12Q 1/6806 20130101;
C12Q 1/6883 20130101; C12Q 2600/158 20130101 |
Class at
Publication: |
506/7 |
International
Class: |
C40B 30/00 20060101
C40B030/00 |
Goverment Interests
STATEMENT REGARDING FEDERALLY FUNDED PROJECT
[0002] The United States Government owns rights in the present
invention pursuant to funding from the Defense Threat Reduction
Agency (DTRA; Interagency Cost Reimbursement Order (IACRO
#02-4118), MIPR numbers 01-2817, 02-2292, 02-2219, and 02-2887),
the Office of the U.S. Air Force Surgeon General (HQ USAF SGR; MIPR
Numbers NMIPRO35203650, NMIPRONMIPRO35203881,
NMIPRONMIPRO35203881), the U.S. Army Medical Research Acquisition
Activity (Contract # DAMD17-03-2-0089), the Defense Advance
Research Projects Agency (DARPA; MIPR Number M189/02), and the
Office of Naval Research (NRL Work Unit 6456).
Claims
1. A method for identifying gene expression markers for
distinguishing between healthy, febrile, or convalescence in
reference to one or more infectious pathogens comprising: acquiring
a gene expression profile for a subject that has been exposed to
one or more infectious pathogens and having a fever of
100.4.degree. F. or above; acquiring a gene expression profile for
a subject that has recovered from exposure to the one or more
infectious pathogens; acquiring a gene expression profile for a
healthy subject that has not been exposed to the one or more
infectious pathogens; comparing the gene expression profiles for
the exposed subject, the recovered subject, and the healthy subject
by a pairwise comparison; determining the identity of the nested to
minimal set(s) of genes that classify the subjects' phenotypes as
healthy, febrile, or convalescent by class prediction algorithm
based on the pairwise comparison; and assigning the classification
of healthy, febrile, or convalescent based on gene expression
profile of the minimal set of genes; wherein the gene expression
profiles are acquired by: collecting a biological sample from the
subject; isolating RNA from the sample; removing DNA contaminants
from the sample; spiking into the sample a normalization control;
synthesizing cDNA from the RNA contained in the sample; in vitro
transcribing cRNA from the cDNA and labeling the cRNA; hybridizing
the cRNA to a gene chip followed by washing, staining, and
scanning; and acquiring the gene expression profile from the gene
chip and analyzing the gene expression profile represented by the
RNA in the sample.
2. The method of claim 1, further comprising: classifying a patient
in need thereof as healthy, febrile, or convalescence by:
determining the gene expression profile in the patient of the
minimal set of genes that classify the sub phenotype as healthy,
febrile, or convalescent; and classifying the patient in need
thereof as being healthy, febrile, or convalescent by comparing the
gene expression profile of the patient to that of the
classification assignment of healthy, febrile, or convalescent
based on gene expression profile of the minimal set of genes.
3. The method of claim 2, wherein said biological sample is whole
blood.
4. The method of claim 2, further comprising, between removing DNA
contaminants and spiking: concentrating and purifying said RNA.
5. The method of claim 2, further comprising, between spiking and
synthesizing cDNA: reducing globin mRNA in said sample.
6. The method of claim 5, wherein reducing globin mRNA in the
sample comprises adding biotinylated globin capture oligos to the
sample to bind the globin mRNA and removing the resulting bound
globin mRNA by streptavidin magnetic beads leaving reduced-globin
RNA.
7. The method of claim 6, further comprising: further purifying the
reduced-globin RNA by contacting said reduced-globin RNA with
magnetic RNA beads.
8. The method of claim 2, further comprising, coincident with
synthesizing cDNA: reducing globin mRNA in the sample by adding PNA
to the sample during synthesizing cDNA.
9. The method of claim 2, further comprising, between hybridizing
the cRNA and acquiring the gene expression profile from the gene
chip: repeating hybridizing the cRNA with a second gene chip which
is distinct from the first gene chip; wherein in acquiring the gene
expression profile from the gene chip, following acquisition the
data obtained from said first and second gene chips is merged.
10. The method of claim 2, wherein the minimal set of genes to
distinguish nonfebrile from febrile patients comprises PDCD1LG1,
PLSCR1, FCGR1A, PLSCR1, FCGR1A, CEACAM1, SERPING1, TNFAIP6,
ANKRD22, EPSTI1, FLJ39885, DNAPTP6, IF135, OAS1, PRV1, STK3, GBP1,
GBP1, CASP5, IFIT4, GPR105, MGC20410, cig5, LOC129607, IF144, GBP5,
C1QG, HSXIAPAF1, cig5, UPP1, PML, LAMP3, IFRG28, G1P2, Clorf29,
IF144, LIPA, OAS1, MX1, SN, HSXIAPAF1, IFIT1, OAS2, and IF127.
11. The method of claim 2, wherein the minimal set of genes to
distinguish healthy versus convalescent patients comprises RPL27,
RPS7, DAB2, LAMA2, IGHM, EVA1, and KREMEN1.
12. The method of claim 2, wherein the minimal set of genes to
distinguish febrile with adenovirus versus febrile without
adenovirus patients comprises IL1RAP, ZCCHC2, IF144, ZCCHC2,
ZSIG11, NOP5/NOP58, LGALS3BP, MS4A7, LY6E, BTN3A3, and IF127.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application claims priority to U.S. 60/626,500,
filed on Nov. 5, 2004, the entire contents of which are
incorporated by reference.
REFERENCE TO SEQUENCE LISTING
[0003] The present application includes a sequence listing on an
accompanying compact disk containing a single file named "AFD 764
(GXP) Sequence Listing," created on Nov. 7, 2005 and 2 KB in
size.
[0004] The entire contents of that accompanying compact disk are
incorporated by reference into this application.
REFERENCE TO TABLES
[0005] The present application includes 18 tables on an
accompanying compact disk containing the following files:
TABLE-US-00001 File Name Format Size Created Table 16.txt MS
Windows ASCII 6 kb Nov. 03, 2005 Table 17.txt MS Windows ASCII 2 kb
Nov. 03, 2005 Table 18.txt MS Windows ASCII 802 kb Nov. 03, 2005
Table 19.txt MS Windows ASCII 3 kb Nov. 03, 2005 Table 20.txt MS
Windows ASCII 4 kb Nov. 03, 2005 Table 21.txt MS Windows ASCII 2 kb
Nov. 03, 2005 Table 22.txt MS Windows ASCII 215 kb Nov. 03, 2005
Table 23.txt MS Windows ASCII 4 kb Nov. 03, 2005 Table 24.txt MS
Windows ASCII 3 kb Nov. 03, 2005 Table 25.txt MS Windows ASCII 2 kb
Nov. 03, 2005 Table 26.txt MS Windows ASCII 153 kb Nov. 03, 2005
Table 27.txt MS Windows ASCII 4 kb Nov. 03, 2005 Table 28.txt MS
Windows ASCII 705 kb Nov. 03, 2005 Table 29.txt MS Windows ASCII 3
kb Nov. 03, 2005 Table 30.txt MS Windows ASCII 491 kb Nov. 03, 2005
Table 31.txt MS Windows ASCII 3 kb Nov. 03, 2005 Table 32.txt MS
Windows ASCII 81 kb Nov. 03, 2005 Table 33.txt MS Windows ASCII 5
kb Nov. 03, 2005
[0006] The entire contents of that accompanying compact disk are
incorporated by reference into this application.
BACKGROUND OF THE INVENTION
[0007] 1. Field of the Invention
[0008] The present invention provides a specific set of gene
expression markers from whole blood and/or peripheral blood
leukocytes (PBL) that are indicative of a host response to
exposure, response, and recovery from infectious pathogens. The
present invention further provides methods for identifying the
specific set of gene expression markers, methods of monitoring
disease progression and treatment of infectious pathogen
infections, methods of predicting the onset of the symptoms and/or
manifestation of an infectious pathogen infection, and methods of
diagnosing an infectious pathogen infection and classifying the
pathogen involved.
[0009] The present invention also provides the following:
[0010] (1) methods for validating the differential gene expression
markers in a cohort (such as a Basic Military Trainee (BMT)
population). Such a method can be used to validate and/or expand
upon a subset of biomarkers identified by alternative techniques
for a specific disorder,
[0011] (2) methods for designing and implementing a process of
determining pre-symptomatic gene expression changes in an exposed
population,
[0012] (3) methods for statistical (e.g. Bayesian) inference to
combine other (e.g. metadata) information into a overall diagnosis
or assessment, and
[0013] (4) alternative measurement techniques other than Genechip
microarrays, though not necessarily excluding Genechip microarray,
that could be used to measure changes in a small, differentiating
subset of genes (i.e., a subset of genes identified by the
microarray-based method of the present invention) in a minimal
volume of blood (lancet to produce drops of blood instead of
intravenous blood draw to produce milliliters of blood) in a period
of hours instead of days.
[0014] Moreover, the present invention relates to an overall
business model, components of which include:
[0015] (1) assessment of the morbidity potential of individuals who
were exposed to an infectious pathogen or agent of
chembio-terrorism using pre-symptomatic gene expression
markers,
[0016] (2) pre-assessment of the morbidity potential for select
individuals (e.g. aircrews prior to the start of a 24 hour mission)
or for general public use for pro-active intervention against
infectious disease prior to the onset of major symptoms, and
[0017] (3) assessment of human behavioral activities (i.e.
Exercising, eating, fasting, smoking, etc) that affect physiology
and blood gene-expression, thus enabling discovery of biomarkers
related to these behaviors that may be used to establish past
activities of an individual at a certain probability of
confidence.
[0018] The present invention further relates to:
[0019] (1) methods for extrapolating the methods developed herein
(e.g., PAXgene processing and metadata) for use in other disease
diagnostics (e.g., blood-related; autoimmune diseases,
leukemia);
[0020] (2) methods for assembly of metadata in a format that allows
it to be assimilated into inferential models of disease assessment;
and
[0021] (3) methods for establishing a comprehensive human gene
expression baseline database, against which perturbations, such a
pathogen exposure, infection, and other disease states would be
compared.
[0022] 2. Discussion of the Background
[0023] Recent years have witnessed an explosive growth in the
number of applications involving the use of DNA microarrays to
monitor the expression of genes in various forms of tissues and
cultured cells (1-5). Such "expression profiling" requires a
measurable change in the relative abundance of transcribed
messenger RNA (mRNA) in host cells in response to some type of
perturbation. The measurement is usually performed indirectly by
reverse transcription (RT) of the labile mRNA into more stable
complementary DNA (cDNA) which is in turn labeled with a
fluorophore (true for most work, but the Affymetrix process
involves re-conversion of cDNA back to RNA, which is in turn
labeled and hybridized) and allowed to hybridize with the
microarrays containing a plurality of DNA "probe" molecules that
bind the target cDNA of interest.
[0024] Typically, colored fluorophores are used to label the
"control" and "experimental" pools of cDNA, allowing the relative
transcript abundances to be deduced from the ratio of fluorescence
intensities. Alternatively, a single color measurement can be
enabled by scaling of the intensities between different
microarrays, as in the case with Affymetrix high-density
microarrays (vide infra) because the variation from among
Affymetrix arrays are minimal compared to most spotted array
platforms. Defining sets of genes that are modulated in response to
the external perturbation is non-trivial and is complicated by
"noise" due to biologic variability, microarray production batch,
handling factors, and variability emerging during sample processing
(6).
Types of Microarray Probe Molecules
[0025] Significantly, the DNA probes themselves can be of highly
variable lengths. Probes comprised of cDNA molecules (which are
RT/PCR products of transcriptional isolates known as "Expressed
Sequence Tags"; ESTs) can have varying lengths (usually hundreds of
base pairs) and are often adsorbed (non-covalently) and then
cross-linked (chemically or using ultraviolet radiation) to
positively-charged poly-lysine or aminosilane-coated microscope
slides. In contrast, probes comprised of defined "long" (70-mer) or
"short" (25-mer) oligonucleotides are of fixed length and are
almost invariably attached by a covalent bond via one terminus of
the DNA molecule. Higher degrees of transcript detection
sensitivity can usually be achieved with 70-mer probes compared to
shorter ones (e.g. 20-25mers). However, specificity is reduced
because 70-mer target/probe hybridizations are generally
insensitive to small numbers (e.g., 2-3) of single base mismatches,
whereas shorter probes are sensitive to single mismatches and thus
provide greater specificity. In contrast, little can be said about
transcript-specific cDNA binding to complementary cDNA probes
prepared from EST libraries, because the length of the probes
(hundreds of base pairs) can result in binding of multiple smaller
transcription-specific cDNA molecules. The separation of these
contributions would be impossible from a single fluorescent
intensity signal as measured by a microarray scanner.
[0026] At least a few research groups have developed microarrays
that are capable of distinguishing varying levels of "sequence
resolution". Within the human genome, only a small percentage of
the total sequences called "exons" actually encode for functional
polypeptides and these segments are interspersed with non-coding
segments called "introns". Shoemaker et al (7) developed "exon
arrays" comprised of long (50-60 bases) targeting predicted exon
regions, and "tiling arrays" which used sets of similar length
overlapping oligonucleotides to completely blanket a genomic region
of interest for human chromosome 22. This allows for determination
of most RNA transcripts from this chromosome, including transcripts
that are not traditionally considered as genes. Additionally, these
microarrays should also be able to locate mutations in the
chromosomal DNA itself. Further, this allows determination of which
exons are represented in the formation of specific splice variants
of transcripts coding for functional proteins.
[0027] For the present invention, the authors have used Affymetrix
HG-U133A and HG-U133B Human Genome Expression Chips (Part No.
900444; for detailed information refer to the product literature
available from the manufacturer, which is hereby incorporated by
reference in its entirety) as well as the HG-U133 plus 2.0 chip
(Part No. 900467) which contains probes from HG-U133A, HG-U133B,
and an additional 10,000 probeset on one cartridge. A GeneChip.RTM.
probe array contains "cells", each having a large number of copies
of a unique 25-mer probe and arranged in probe pairs consisting of
a perfect match (PM) and a mis-match (MM) wherein the middle
(number 13) position is varied. Normally, RNA is extracted from
samples and reverse transcribed into cDNA then into double stranded
cDNA with a T7 promoter region added. Then in vitro transcription
is carried out to linearly amplify the RNA and incorporate
biotinylated nucleotides to make biotin labeled cRNA. The labeled
cRNA target is hybridized onto the microarray, usually over night,
then follow by washing and detection via strepavidin conjugated
fluorescent dyes the next day. Following hybridization of the
labeled transcriptional targets to the microarray (for detailed
information refer to the product literature available from
Affymetrix entitled `Eukaryotic Sample and Array Processing,` which
is hereby incorporated by reference in its entirety), the
Affymetrix GCOS software (manual available from Affymetrix) (8) is
used to reduce the raw scanned image (.DAT) file to a simplified
file format (.CEL file) with intensities assigned to each of the
corresponding probe positions.
[0028] A graphical description of the probe pair layouts and the
expression analysis algorithm is found in the Affymetrix GCOS
manual on pages 505-523 (8). On the U133A and B GeneChips.RTM.,
each (.about.39,000) known and putative gene from the Unigene
database U133 build of the human genome (for detailed information
refer to the product literature available from the manufacturer,
which is incorporated by reference in its entirety) are represented
by 10 probe pairs spaced across some length of the gene, with some
bias towards the 3' end (maps and analysis available through the
NetAffx website available through the Affymetrix website). The GCOS
software executes algorithms to assign an overall intensity that is
used to infer abundance of a transcript and calculate fold changes
of expression between two or more experiments. It also provides a
metric to indicate whether a gene is "present" (detectably
expressed) or absent. Following these calculations, the individual
probe intensities are not explicitly referenced but they remain
part of the permanent data in the .CEL file for each
experiment.
[0029] Thus, there are considerable differences in the
interpretability of "gene expression" measurements, depending on
the types and numbers of microarray probes used and the algorithms
used to analyze the spatial patterns of intensity from the
probes.
Transcriptional Markers
[0030] Of equal significance, relative to the "sequence resolution"
of the measurement of transcript abundance in metazoan systems is
the variation in the composition of "genes" and transcriptional
gene products. Initial drafts of the human genome (9, 10) indicate
that the human genome is comprised of approximately 30,000 genes,
mostly identified by computational methods having significant
limitations (11). Yet, orders of magnitude greater numbers of
different proteins can be produced from these genes through the
recombination of the internal coding sequences (exons) that are
interspersed with non-coding sequences (introns). Hence, probes
comprised of cDNA clones derived from a transcriptional library are
biased towards detection of the complete gene product sequences
that are obtained under a specific set of times and conditions, and
cannot represent the multiform nature of mammalian gene expression
in more general conditions where alternative splice variants will
change the transcriptional sequence composition.
Prior Art in Gene Expression Profiling in the Immune Response to
Pathogens
Cell Culture Models
[0031] Several groups have also measured the gene expression
profiles of individual immune cell types following exposure to
microbes or microbial components in vitro. Groups at Whitehead
Institute (12) and Stanford (13) have used Affymetrix and spotted
cDNA microarray types, respectively, to observe relatively
stereotyped responses of cultured human peripheral blood
mononuclear cells (PBMCs; i.e. circulating macrophage precursor
cells, T lymphocytes, B lymphocytes), eosinophils, and basophils
when exposed to a variety of killed bacteria and bacterial cell
wall components. The similarity of the responses is reflective of
evolutionarily conserved pro-inflammatory responses within the
innate immune system and do not suggest that pathogen-specific
responses would be obviously detectable. Chaussable et al (14)
describe a study with in vitro generated macrophages and dendritic
cells, which provides insights into the innate immune response to
diverse pathogens but is impractical for surveillance, as these
cells types can only be isolated by laboratory procedures that will
change their natural gene expression.
Peripheral Blood Leukocytes (PBLs) Drawn from the Infected Host
[0032] Craig Cummings, David Relman and Patrick Brown (Stanford
University) hypothesized that the unique mixtures of virulence
factors expressed by specific pathogens will give rise to a
correspondingly unique transcriptional response in the host (15).
They reasoned that an attractive host tissue source would be
peripheral blood leukocytes (PBLs) because any pathogen gaining
access to the body will elicit a multiplicity of immune response
mechanisms, each characterized by combinations of specific gene
modulations. They also pointed out that this technique might allow
early diagnosis of even uncultivable or uncharacterized pathogens,
that variations in host expression profiles could allow inference
of time since exposure, and that a single technique could be used
to diagnose a large number of different diseases.
[0033] Relman et al have used variations of the "Lymphochip" (16,
17) (which is comprised of probes for approximately 3,000-3,500
"lymphoid" genes comprised of cDNA clones prepared from
transcriptional libraries of human lymphoid tissues) to analyze
expression changes in cultured PBMCs (13), and in PBLs (PBL
contributions-all white blood cells and the differential is
typically 41-77% neutrophils, 20-51% lymphocytes, 1.7-9% monocytes
and less than one percent of basophils and eosinophils), from RNA
isolated from PAXgene Blood RNA tubes from 75 healthy human donors
(18). The latter study (18) illustrated that relative gene
expression levels in PBLs are related to variations in specific
blood cell types, gender, age, and time of day. Relman et al have
also observed changes in PBMC expression in non-human primates
(NHPs) following experimental inoculation with Variola major, the
virus responsible for human smallpox. In addition, Relman et al
compared Ebola infection of NHP. However, the inventors herein are
unaware of any disclosures that relate those changes to NHP
inoculations using other pathogens or to baseline gene expression
in humans. Because of the type of microarray (cDNA EST clones) it
is not possible to ascribe particular transcriptional sequences
that are responsible for assigning fold changes to particular
genes. The present inventors are unaware of any written
descriptions existing in the public domain that describe these
data.
[0034] In short, all of Relman's papers use cDNA arrays and PBMCs
(which require on site isolation centrifuge and technicians). If
they used paxgene, they processed it within 24 hours. This is not
practical for surveillance. Whereas in the present invention, the
inventors demonstrate that the paxgene tubes can give decent gene
expression profiles even when handled in conditions amendable to
surveillance. Relman did not know and/or test this; hence they did
everything within 24 hours to be safe in the notation that the RNA
has not degraded. Also, for cDNA arrays, Relman required reference
RNA with gene expression profiles similar to tissue of interest to
compare 2 colors for all chips, which makes it impractical to study
large population expressing different genes than what is contained
within their reference RNA. Whereas the Affy chip is single color
so no reference common RNA is needed allowing us to compare large
numbers of chips overtime, especially when we spike in
normalization control RNA.
Differential Gene and Protein Expression Following Exposure to
Biological Warfare Agents
[0035] At least one U.S. Pat. No. 6,316,197 B1 (19) makes claim to
methods for determining characteristic gene expression changes from
an infected host to diagnose exposure to biological warfare (or
bioterrorism) agents. The inventors of that application described a
series of steps that begin with the use of differential display PCR
(DD-PCR) to discover genes that are expressed differently in
cultured cells following incubation with biological toxins (e.g.
Staphyloccocus enterotoxin B; SEB, and Botulinum toxin) or microbes
(e.g. Bacillus anthracis). Briefly, DD-PCR involves the use of
reverse transcriptase to convert host RNA transcripts to cDNAs,
which are in turn amplified with PCR and separated by gel
electrophoresis. Specific sequences are determined for each of the
corresponding electrophoretic bands to identify the differentially
expressed genes. The inventors of U.S. Pat. No. 6,316,197 described
methods for measuring (including the use of reverse transcriptase
PCR and DNA microarray hybridization) correlating the observed
changes with methods for measurement in animals exposed to the same
agents, and found gene expression changes that corresponded to
those observed in culture. Overall, this work makes use of a
commonly used method of discovering genes that are involved in
differential biological responses and implicates several
transcriptional markers that correlate with the exposure to several
types of toxic insult. However, there is no ethical way to perform
the same experiments using humans, and consequently, no manner of
obtaining clinically relevant data for a human population. Nor is
there an attempt in this work to compare the perturbations to a
baseline human expression profile. Also, none of the methods
disclosed by Relman et al are amendable to a surveillance
setting
Differential Gene Expression Measurement in an Integrated
Biodefense System
[0036] The concept of a microarray used for broad-spectrum pathogen
identification has considerable and obvious appeal to both medical
practice and national defense. This was best illustrated in the
recommendations of the Defense Sciences Board (DSB) Summer 2000
Panel, which made recommendations to the DATSD (ATL) that the U.S.
Defense Department develop a "Zebra Chip"; that is, a hypothetical
microarray of unspecified technology that could include gene
expression markers, that would be in widely distributed use (DoD
TriCare System) as a routine clinical diagnostic for both common
and uncommon (e.g. bioterrorism) infectious agents. In addition to
having probes for common infectious agents, the Zebra Chip would
also contain a large number of probes for unusual ("zebra")
pathogens. If such a device were in widespread use at the time of a
biological terrorism event or a natural epidemic (e.g. SARS), the
cost savings, both financial and in human suffering, could be
enormous, due to the earliest possible detection of the agent when
only minor (flu-like) symptoms were manifest.
[0037] Furthermore, there is a need to unambiguously define
"baseline" expression profiles, against which the "perturbed" state
profiles are compared, as they may be variable in time and between
individuals.
[0038] Because it may not always be possible to identify the
specific cause of an infection through pathogen genomic markers
(e.g. using PCR or microarrays), there remains a critical need to
determine alternative "biomarkers` from the host that would
elucidate the character of the disease etiology and guide the
clinician in the proper management of the infection.
[0039] Heretofore, none of the published prior art methods are
amendable to large long-term field studies/surveillance. All of the
published methods are simply for a quick one-time gene expression
study. Therefore, and in view of the foregoing, there remains a
critical need of methods for determining characteristics gene
expression changes that arise from an infected host to diagnose
disease states, help guide treatment regimens, and assist in making
treatment/operational decisions. Further, there exists a critical
need for rapid, near real-time methods useful for field
implementation that may be used individually or in combination with
additional detection and diagnostic methods and apparatuses.
SUMMARY OF THE INVENTION
[0040] It is an object of the present invention to provide methods
for determining the baseline gene expression in a healthy
individual, as well as systematic changes in the gene, expression
pattern characteristic to a pathogen or infection. More
specifically, this object relates to methods for establishing a
comprehensive human gene expression baseline database, against
which perturbations, such a pathogen exposure, infection, and other
disease states would be compared.
[0041] It is another object of the present invention to provide a
method for validating the differential gene expression markers
identified in a cohort.
[0042] It is yet another object of the present invention to design
and implement a process to determine pre-symptomatic gene
expression changes in an exposed population and from this to
design/tailor therapeutic regimens.
[0043] Within the aforementioned objects, the present invention
further provides methods for statistical (e.g. Bayesian) inference
to combine other (e.g. metadata) information into an overall
diagnosis or assessment.
[0044] The objects of the present invention may be extended to and
the present invention embraces extrapolating the methods developed
herein (e.g., PAXgene processing and metadata) for use in other
disease diagnostics.
[0045] Further, it is an object of the present invention to provide
a method for assembly of metadata in a format that allows it to be
assimilated into inferential models of disease assessment.
[0046] It is an object of the present invention to further an
overall business model, which includes:
[0047] (1) assessment of the morbidity potential of individuals who
were exposed to an infectious pathogen or agent of
chembio-terrorism using pre-symptomatic gene expression
markers,
[0048] (2) pre-assessment of the morbidity potential for select
individuals (e.g. aircrews prior to the start of a 24 hour mission)
or for general public use for pro-active intervention against
infectious disease prior to the onset of major symptoms, and
[0049] (3) assessment of human behavioral activities (i.e.,
Exercising, eating, fasting, smoking, etc.) that affect physiology
and blood gene-expression, thus enabling discovery of biomarkers
related to these behaviors that may be used to establish past
activities of an individual at a certain probability of
confidence.
[0050] (4) banking of samples (i.e. Paxgene) in conjunction with
clinical information database for any phenotype of interest now or
in the future.
[0051] In a certain object of the present invention is to provide a
method for determining the gene expression profile for (i) a
healthy person and/or (ii) a subject that has been exposed to one
or more infectious pathogens by
[0052] a) collecting a biological sample (e.g., whole blood) from a
subject;
[0053] b) isolating RNA from said sample;
[0054] c) removing DNA contaminants from said sample;
[0055] d) spiking into said sample a normalization control;
[0056] e) synthesizing cDNA from the RNA contained in said
sample;
[0057] f) in vitro transcribing cRNA from said cDNA and labeling
said cRNA;
[0058] g) hybridizing said cRNA to a gene chip followed by washing,
staining, and scanning; and
[0059] h) acquiring a gene expression profile from said gene chip
and analyzing the gene expression profile represented by the RNA in
said sample on the basis of (i) the health of the subject or (ii)
the disease(s) said subject has been exposed to while controlling
for confounder variables.
[0060] Within this object, the following additional steps may also
be performed to increase the overall sensitivity of the method and
to enhance the reliability of the results obtained thereby: [0061]
concentrating and purifying said RNA between (c) and (d); [0062]
reducing and/or eliminating globin mRNA in said sample between (d)
and (e), for example adding biotinylated globin capture oligos to
said sample to bind the globin mRNA and removing the resulting
bound globin mRNA by strepavidin magnetic beads leaving globinclear
RNA and, optionally, further purifying the globinclear RNA by
contacting said globinclear RNA with magnetic RNA binding beads or
RNA binding column; [0063] reducing and/or eliminating globin mRNA
in said sample, coincident with (e), by adding PNA to said sample
during said synthesizing cDNA; and/or [0064] repeating (g) with a
second gene chip, between (g) and (h), which is distinct from said
gene chip in (g), wherein in (h) following acquisition the data
obtained from said first and second gene chips is merged.
[0065] In another object of the present invention, is a method for
identifying gene expression markers for distinguishing between
healthy, febrile, or convalescence in subjects that have been
exposed to one or more infectious pathogens by:
[0066] a) acquiring a gene expression profile by the method
according to the aforementioned object for a subject that has been
exposed to one or more infectious pathogens;
[0067] b) acquiring a gene expression profile by the method
according to the aforementioned object for a subject that has
recovered from exposure to said one or more infectious
pathogens;
[0068] c) acquiring a gene expression profile by the method
according to the aforementioned object for a healthy subject that
has not been exposes to those one or more infectious pathogens;
[0069] d) comparing the gene expression profiles for the subjects
from (a), (b), and (c) by a pairwise comparison;
[0070] e) determining the identify of the minimal set of genes that
classify the patient phenotype as healthy, febrile, or convalescent
by class prediction algorithm based on said pairwise comparison;
and
[0071] f) assigning the classification of healthy, febrile, or
convalescent and/or classifying adenovirus febrile infection from
background cases of other febrile illness in the cohort based on
gene expression profile of the minimal set of genes determined in
(e).
[0072] In yet another object of the present invention, is a method
of classifying a subject in need thereof as healthy, febrile, or
convalescence, by
[0073] a) collecting a biological sample (e.g., whole blood) from
said subject;
[0074] b) isolating RNA from said sample;
[0075] c) removing DNA contaminants from said sample;
[0076] d) spiking into said sample a normalization control;
[0077] e) synthesizing cDNA from the RNA contained in said
sample;
[0078] f) in vitro transcribing cRNA from said cDNA and labeling
said cRNA;
[0079] g) hybridizing said cRNA to a gene chip followed by washing,
staining, and scanning
[0080] h) acquiring a gene expression profile from said gene chip
and analyzing the gene expression profile represented by the RNA in
said sample; and
[0081] i) determining the gene expression profile in said subject
of the minimal set of genes that classify the patient phenotype as
healthy, febrile, or convalescent determined by the method
described herein above;
[0082] j) classifying the subject in need thereof as being healthy,
febrile, or convalescent by comparing the gene expression profile
obtained in (i) to that of the classification assignment of
healthy, febrile, or convalescent based on gene expression profile
of the minimal set of genes as determined by the method described
herein above.
[0083] The results procured by the present inventors provides a
range of gene sets from a few genes to very large number of genes
in various sets that could give the same percent correct
classification results. The larger set size may provide a more
robust prediction when the population involves more phenotypes.
While the advantages and/or utility of the small set size may lie
in the ability to make a quick independent diagnostic.
[0084] The above objects highlight certain aspects of the
invention. Additional objects, aspects and embodiments of the
invention are found in the following detailed description of the
invention.
BRIEF DESCRIPTION OF THE FIGURES
[0085] A more complete appreciation of the invention and many of
the attendant advantages thereof will be readily obtained as the
same becomes better understood by reference to the following
figures in conjunction with the detailed description below.
[0086] FIG. 1 shows a diagram relating the two conditions used to
handle blood collected in PAX tube. Condition E describes the
isolation of total RNA from PAX tube collected blood after the
minimum incubation time of 2 hours at room temperature, whereas
condition O allows for an extended incubation time of 9 hours at
room temperature followed by freezing at -20.degree. C. for 6 days
before RNA isolation.
[0087] FIG. 2 shows DNA contamination and removal. (A) DNA
contamination of total RNA isolated from PAX tube even after
on-column DNase treatment. Gel electrophoresis of real-time-PCR
reactions for detection of gapdh DNA. Lane 1: molecular weight (MW)
markers; lanes 2-7: gapdh 290 by product amplified from total RNA
isolated from PAX tube with on-column DNase treatment; lane 8: no
template negative control. (B) In-solution DNase treatment removed
contaminating DNA to a level undetectable by PCR. Gel
electrophoresis of real-time-PCR reactions detecting gapdh DNA in
various samples. Lane 1: MW markers; lanes 2 & 4: in-solution
DNase treated RNA isolated from PAX tube; lanes 3 & 5: treated
as in lanes 2 & 4, but without DNase; lane 6: cDNA positive
control; lane 7: on-column DNase treated sample as positive
control; lane 8: no template negative control. (C) RNA integrity
was maintained after in-solution DNase treatment as determined by
real-time RT-PCR. Lane 1: MW markers; lanes 2-5: cDNA from RNA
samples used in lanes 2-5 of panel (B); lane 6: no reverse
transcriptase negative control of sample corresponding to lane 4 in
panel (B); lane 7: no template negative control.
[0088] FIG. 3 shows total RNA were of similar quality pre- and
post-DNase treatment and between conditions. Bioanalyzer traces of
fluorescence versus migration time of various total RNA samples.
(A) Total RNA isolated from blood in PAX tube before DNase
treatment. Black traces are from samples of condition E; gray
traces are from samples of condition O. First peak at .about.23 sec
is the marker control. Second peak at .about.41 sec is 18S
ribosomal RNA. Third peak at .about.0.47 sec is the 28S ribosomal
RNA. Large humps after .about.50 sec indicated DNA contamination.
(B) Total RNA after DNase treatment. Descriptions are as in (A).
(C) Comparison of pre- and post-DNase treatment traces. Black
traces, one for each condition, are pre-DNase, whereas gray traces,
also one for each condition, are post-DNase.
[0089] FIG. 4 shows characteristic profiles of double stranded
cDNA, cRNA, and fragmented cRNA. Bioanalyzer traces of fluorescence
versus migration time of various samples. Thick-dark-gray trace is
a sample from condition E. Thin-black trace is a sample from
condition O. Thick-light-gray trace is a no sample negative control
trace. (A) Purified double stranded DNA. (B) Purified cRNA. (C)
Fragmented cRNA.
[0090] FIG. 5 shows individual line charts relating the quality
control metrics of various samples for HG-U133A and HG-U133B chips.
Order of chips on the x-axis is based on the time of generation of
the CEL file. UCL stands for upper control limit; LCL stands for
lower control limit. The limits are set at .+-.3 standard
deviations.
[0091] FIG. 6 shows gene-expression levels from the two conditions
are highly correlated compared to related samples. Clustering
dendrograms for HG-U133A (left panel) and HG-U133B (right panel)
chips. The sample names with letters `E` and `O` correspond to
samples processed at the same time as described in FIG. 1; also,
sample names with the same letters designate technical replicates.
Further descriptions for all samples are shown below the sample
names. Each character encodes a sample descriptive ontology. For
the Condition variable, `E` designates samples processed similar to
condition E, while `O` designates samples processed similar to
condition O. For Operator, `0` designates one individual operator,
while `1` designates another operator. For Type of RNA, `T`
designates total RNA; `H` designates IP RP HPLC purified mRNA; and
`p` designates polyA RNA. For Donor ID, each number represents a
different volunteer.
[0092] FIG. 7 shows optimization of class prediction for
non-febriles vs. febriles (A & B), healthy vs. convalescents (C
& D), and febriles with adenovirus versus febriles without
adenovirus infection (E & F). A, C, & E shows increments of
the univariate significance alpha level (x-axes of A, C, & E),
resulting percent correct classification (left y-axes) for various
algorithms (color traces), and the number of genes in the
classifier (right y-axes, black trace with filled circles); arrows
indicate largest alpha level that resulted in the highest percent
correct classification. In B, D, & F, at the optimal alpha
level for each of the three classifications, classifier genes were
further filtered by fold change level (x-axes of B, D, & F),
with resulting percent correct classification (left y-axes) for
various algorithms (color traces), and the number of genes in the
classifier (right y-axes, black trace with filled circles); arrows
indicate fold change level that resulted in the highest percent
correct classification.
[0093] FIG. 8 shows cRNA profiles derived from Jurkat,
Jurkat+Globin (JG), and paxgene RNA in different technical
conditions. FIG. 8A-Elecropherograms for cRNA derived from JG RNA
treated with biotinylated globin oligos (JGA), with PNA (JGP), no
treatment (JGC) and Jurkat RNA with no treatment (JC). FIG. 8B--Gel
view of cRNA derived from four RNA and showed the size of globin
molecules (arrow indicated .about.0.8 kb) in JGP and JGC. FIG.
8C--Electropherograms for cRNA derived from paxgene RNA treated
with biotinylated globin oligos (BA), with PNA oligos (BP) and no
treatment (BC). FIG. 8D--Gel view of cRNA derived from BA, BP and
BC RNA indicated the size of globin (arrow).
[0094] FIG. 9 shows Venn Diagrams demonstrating present call
concordance among globin reduced Jukat+Globin RNA samples relative
to Jurkat RNA and relationship among paxgene RNA in three different
technical conditions. FIG. 9A-Identification of a control gene set
(JCAP) commonly present in JA, JP and JC. FIG. 9B--There were
additional 1394 genes present in JGA and JCAP relative to genes
present in JGP and JCAP. FIG. 9C--Paxgene RNA followed by
biotinylated globin oligos treatment resulting in additional 4159
(2607+1552) genes relative to no treatment of globin reduction
(BC). At least 62.5% (2607/4159) were likely to be called present
due to globin removal.
[0095] FIG. 10 shows Signal variation for each technical condition.
FIG. 10A-Coefficient of variance (CV) vs. scaling signal
intensities graph using all probe set data derived from Jurkat (J)
and Jurkat+Globin (JG) RNA samples treated with biotinylated globin
oilgos (JA, JGA), with PNA (JP and JGP) and no treatment of globin
reduction (JC, JGC) were shown. FIG. 10B-CV vs. scaling signal
intensities graph using all probe set data derived from paxgene RNA
treated with biotinylated globin oligos (BA), with PNA (BP) and no
treatment (BC). All of data were smoothed by Loess fitting with 2
degree freedom.
[0096] FIG. 11 shows multidimensional scaling cluster analyses
performed on gene expression obtained from Jurkat RNA (J) and
Jurkat RNA spiked in globin (JG) and paxgene RNA. All of probe sets
with log raw signal intensity were used. FIG. 11A-Greater
correlation within each triplicate resulted in a tight cluster for
each triplicates. The triplicate clusters derived from Jurkat RNA
with each technical condition were more closely located relative to
any JG RNA. However, removal of globin (JGA, JGP) brought the
triplicate clusters closer to Jurkat RNA relative to JGC. FIG.
11B-Triplicate for each paxgene RNA with different technical
conditions was clustered more closely. Three technical variations
resulted in three separate triplicate clusters.
[0097] FIG. 12 shows hierarchal cluster analyses performed on gene
expression profiles for Jurkat and JG RNA and paxgene RNA samples.
All probe sets on GeneChip Human Genome U133 plus 2.0
(approximately 56,000) with scaling signal intensities were shown
on overview of gene expression profiles. The differentially gene
expression profiles were obtained from Univariate test in Random
Variance Model with false discovery ratio of 0.001. FIG.
12A-Overview of gene expression profiles among 18 samples
representing Jurkat and JG RNA with three technical conditions.
Globin removal from JG RNA by biotinylated globin oligos resulted
in higher signal correlation to Jurkat RNA, thus, JGA triplicate
and Jurkat RNA were clustered into the same group. FIG. 12B-Cluster
analyses conducted by using differentially expressed gene profile
among these 18 samples. The analyses resulted in 8614
differentially expressed genes and genes were divided into I, II,
III, and IV based on JGA expression pattern. FIG. 12C-Cluster
analyses performed on overall gene expression profiles derived from
paxgene RNA. Globin removal from paxgene RNA by biotinylated globin
oligos (BA) and PNA oligos (BP) exhibited more similar expression
pattern relative to no globin reduction (BC). FIG. 12D-Class
comparison analyses among 9 paxgene RNA samples resulted in 1988
differentially expressed genes.
[0098] FIG. 13 shows quality RNA derived from the PAX system of
samples from the BMT population. (a) Overlay of electropherograms
from BMTs with various phenotypes and handling conditions. The 18S
and 28S ribosomal peaks are indicated. (b) Box plots of quality
metrics calculated from the electropherograms. (c) Correlation
between gapdh 3'/5' values on the A arrays versus degradation
factor (r=0.3, P=0.008, ANOVA). (d) Lack of RNA degradation over
days elapsed from blood collection to processing. Samples marked by
`+`, `x`, or `z` had an additional thawed-froze cycle before final
thawed for RNA isolation. (e) Correlation between the Mean
Corpuscular Hemoglobin (MCH) and number of probesets called Present
in the B arrays, (r=-0.272; P=0.008, ANOVA). Line shown is from
equation: Number Present=8108-117 MCH
[0099] FIG. 14 shows gene expression profiles of the BMTs. To
remove undetected transcripts, those with >80% absent calls
across samples were filtered resulting in 15,721 from 44,928
probesets. To remove uninformative transcripts, probesets in which
less than 20% had a 1.5 fold or greater change from the probeset's
median value were removed, resulting in 7682 probesets. To focus on
transcripts with differences in expression among the four infection
status phenotypes, those probesets with P>0.01 by ANOVA were
excluded, resulting in 4414 probesets. The heat-map shows the
transcript abundance (green to red intensities) detected by these
4414 probesets (rows) in each blood sample (column). The rows were
hierarchically clustered with 1-correlation distance and average
linkage, while the columns were sorted into the infection status
phenotypes. Top blue, brown, yellow, and light blue bars denote
samples from healthy, febrile without and with adenovirus, and
convalescent patients, respectively. Bottom scale denotes
standardized values for the green to red intensities in the
heat-map. Side gray, orange, and purple bars denote clusters of
transcripts that differ among the phenotypes.
[0100] FIG. 15 shows optimization of class prediction for
non-febrile vs. febrile (a), healthy vs. convalescent (b), and
febrile without adenovirus versus febrile with adenovirus infection
(c) phenotypes. Shown in the lower left corners of the three panels
are the estimated optimal P-value cut-off levels for each of the
three classifications. Classifier transcripts were further filtered
by fold change level (x-axes), with resulting percent correct
classification (left y-axes) for various algorithms (color traces),
and the number of probesets in the classifier (right y-axes, beaded
black trace); arrows indicate fold change level that resulted in a
highest percent correct classification.
[0101] FIG. 16 shows identities and expression of genes in
classifiers found from class prediction analysis. In each panel,
top bar indicates the classification phenotypes of the samples
(columns). Panel a has a second bar that further indicates healthy,
convalescent, febrile without and with adenovirus samples as blue,
light blue, brown, and yellow, respectively. The middle set of
color bars in each panel mark samples that were misclassified
(black) by various algorithms. The heat-maps indicate relative
expression levels of genes (green to red intensities) identified by
gene symbols on the right; for cDNA clones without gene symbols,
probeset identifiers are displayed instead. Dendrograms are from
clustering of standardized transcript levels (rows) using
1-correlation distance and average linkage. Bottom scale denotes
standardized values for the green to red intensities in the
heat-map. The transcript sets in panels a, b, and c gave results
marked by arrows in FIGS. 3a, b, and c, respectively.
DETAILED DESCRIPTION OF THE INVENTION
[0102] Unless specifically defined, all technical and scientific
terms used herein have the same meaning as commonly understood by a
skilled artisan in enzymology, biochemistry, cellular biology,
molecular biology, and the medical sciences.
[0103] All methods and materials similar or equivalent to those
described herein can be used in the practice or testing of the
present invention, with suitable methods and materials being
described herein. All publications, patent applications, patents,
and other references mentioned herein are incorporated by reference
in their entirety. In case of conflict, the present specification,
including definitions, will control. Further, the materials,
methods, and examples are illustrative only and are not intended to
be limiting, unless otherwise specified.
[0104] The present invention provides a method for identifying
human gene transcripts in blood, and their expression patterns, to
identify a causative agent of respiratory infection, and provide a
measure of recovery during the period of time following infection.
The methods developed here can be extended to the discovery of gene
expression profiles that will be indicative of exposure and
predictive for the actual development of disease. These abilities
have not previously been demonstrated in a human population. Gene
expression: the following description details the importance of the
present invention and its utility in gene expression analysis:
[0105] 1. Identification of uncultivatable organisms: Mycoplasma
pneumoniae, Bordetella pertussis and Chlamydia pneumoniae, which
commonly cause respiratory disease in all age groups. These
organisms require special transport media for sample collection of
respiratory secretions. Even with optimal transport, it is
tremendously difficult to cultivate these common organisms;
therefore, healthcare workers are often unable to make a diagnosis
and have little opportunity to direct antimicrobial therapy to
potentially shorten the duration or to prevent transmission of
disease with these organisms. Bordetella pertussis is the causative
organism for whooping cough in children and carries a high
morbidity. Adults infected with this organism often develop
prolonged, dry cough and remain undiagnosed during the period of
infectivity and possible transmission. It is likely that adults
represent a typically undiagnosed reservoir of disease for this
organism that can have significant impact on the health of
children.
[0106] 2. Analysis of organisms for which no sample can be taken,
for example TB from children. Young children tend to have
disseminated tuberculosis infection and will not tend to have a
productive cough; this means that it is very difficult to collect
sputum to look for the organism. Having an assay in blood that
detects an immunologic signature for tuberculosis infection and
disease in children would be a significant medical breakthrough.
Worldwide, tuberculosis is a significant cause of morbidity and
mortality in children, especially in impoverished regions of the
world. Early detection of infection can significantly limit
disease. Therefore, this area is of particular interest in the
present invention.
[0107] 3. Analysis of and identification of multiple organisms in a
single blood sample.
[0108] 4. Differentiation of a pathogen from colonization
(discussed further below).
[0109] 5. Determination of pre-symptomatic-exposed individuals.
[0110] 6. Expansion to non-infectious/toxin exposure.
[0111] 7. Identification of normal baseline for comparison for all
studies.
[0112] Based on the foregoing and the embodiments specifically
described herein, the present invention provides an opportunity to
direct treatment options. In other words, by determining the gene
expression patterns (both baseline healthy and ill) the artisan
would be enabled to determine the diagnosis and the corresponding
treatment, i.e. whether an individual has a bacterial
infection-give antibiotics or viral infection-no antibiotics. In
this manner the medical professional may reduce inappropriate
antibiotic use and decrease resistance.
[0113] Further, the present invention may be employed to measure
response to treatment--i.e., is there evidence that the host is
resolving the infection? At times, individuals will be hospitalized
and treated for respiratory infection, they appear to get better,
but then develop fever again--the causes of fever can be: new
infection-intravenous line is now infected or patient has developed
urinary tract infection due to indwelling Foley catheter-typically
multiple tests have to be sent-blood, urine, sputum to determine
whether there is a new site of infection. Also, diseases like
pancreatitis or cholecystitis that develops in very ill patients
while hospitalized can be non-infectious causes of fever that
develops after admission. Gene expression as described herein
provides a means to take a single sample, blood, and differentiate
infectious from non-infectious cause of fever and to identify
whether a new pathogen at a new anatomic site is responsible for
the new fever--e.g., if an individual was admitted with S.
pneumoniae pneumonia and had gene expression pattern consistent
with this, but then developed a new fever in the hospital and had a
changing gene expression pattern consistent with a S. aureus (skin
pathogen) infection, then the new gene expression pattern would
direct the practitioner to look at IV sites and other skin sites,
such as decubitus ulcers, for a new source of infection. If the
gene expression pattern did not appear to be consistent with a
response to an infectious agent, then the practitioner should
consider diagnoses such as pancreatitis or cholecystitis. The
development of fever during hospitalization is not uncommon and
often is a vexing problem for the health care practitioner,
especially in severely ill patients in the Intensive Care Unit.
Therefore, techniques as described herein would be well received in
the medical profession.
[0114] The present invention was accomplished following successful
adaptation of a commercial technology (Affymetrix Human Genome U133
chip set) that has not been demonstrated prior to this to be
effective for whole blood expression profiling due to interferences
from high-abundance globin RNA (20). The demonstration of the
enablement of the present invention has been assisted, in part, by
the employment of enhanced sample preparation methods (e.g.,
PAXgene.TM.). Further, by employing rigorous screening and control
functions the present invention offers a significant advantage in
that the data obtained thereby are free from the confounding
environmental influences that pervade other gene monitoring
studies. Moreover, the gene products used to distinguish between
varying febrile respiratory disease states can be targeted for a
variety of other assay types that do not require whole genome
transcriptional monitoring or the attendant processing steps.
[0115] Herein, the present inventors demonstrate that high density
DNA microarray technology can be adapted for insertion into an
accelerated system for discovery of blood transcriptional markers
of infectious disease and other factors important of health,
occupational, and military significance.
[0116] When considering host gene expression profiling, the
capacity to conduct thousands of assays simultaneously poses
challenges regarding data analysis, storage, and management. While
data storage and management issues are largely technical concerns
for information technology specialists, no clear consensus on
analysis techniques has emerged for making use of host gene
expression profiles. The major role for bioinformatics is the
identification of patterns associated responses to pathogens which
may not only provide a means of detection, but also elucidation of
genetic networks underlying initiation and progression of disease.
The most commonly exploited tool for analysis of gene expression
profiles is hierarchical clustering (21, 22) where the fundamental
assumption is that similar trends, computed through a measure of
distance, in the relative magnitudes of gene modulation imply
similarity of function.
[0117] A critical need for the interpretation of large data files
is the visualization of information, which can be readily
accomplished by dendrograms that can be derived from cluster
analysis. Interpretation of expression profiling data has been used
to gain profound insights into gene function. Clustering of genes
expressed in yeast coupled with statistical algorithms yielded a
model of regulatory transcriptional sub-network (23). A significant
demonstration of the utility of clustering has been offered by
Hughes et al. (24), where a compendium of expression profiles of
300 diverse yeast mutations was used to identify novel open reading
frames that encoded proteins of several cell functions. In regard
to pathogen detection, different pathological conditions reflected
by particular expression profiles could also be clustered
(clustering by arrays rather than by genes), but variation among a
broad set of genes or dimensions may reduce the ability to discern
pathogen exposure states.
[0118] Efforts in functional genomics related to cancer research
have yielded major successes in the pursuit of gene expression
signatures. Expression-based criteria or class predictors have been
defined based on neighborhood analysis (25), Bayesian regression
models (26), and artificial neural networks (27-29). These
predictors were successfully used to classify novel samples in a
manner consistent with clinical assessments. In fact,
classifications based on gene expression alone or class discovery
has also been demonstrated, suggesting that gene expression
profiling has the capacity to identify subtypes that have not been
previously defined (25).
[0119] While promising, one should note that cancer line gene
expression analyses are one-dimensional; in contrast, a host
expression profile evoked by pathogen exposure would be expected to
be temporal and "dose-dependent". Comprehensive sets of gene
expression profiles that explore temporal and dose ranges for
pathogen exposure must be produced to map the continuum of gene
expression changes.
[0120] The present invention has been developed, in part, based on
the rigorous assessment of the RNA quality from PAX tubes from a
relatively large sample of humans with various disease phenotypes,
to determine the following: nested sets of genes that could
optimally classify the four phenotypes of (a) healthy, (b)
recovered, (c) febrile with adenovirus infection, and (d) febrile
without adenovirus infection; lists of differential genes among the
four phenotypes; and the pathways in blood cells involved in
respiratory disease due to adenovirus infection versus
non-adenovirus infection. These results demonstrate possibilities
and issues involved in measurement of gene expression from whole
blood at the population level; show the potential of using host
gene-expression responses in blood cells to distinguish pathogen
classes; elucidate functional pathways involved in adenoviral
respiratory disease; and provide a data set to develop statistical
models to answer other biological questions of interest.
[0121] The present invention was accomplished as a result of the
availability of the BMT population of the U.S. Air Force to the
present inventors. The BMT population offered advantages for
surveillance studies. The major advantage is that the BMT
population is racially and ethnically diverse and is representative
of the racial/ethnic diversity observed in the United States. The
BMT population undergoes environmental factors similar to those of
other populations to include: smoking, exercise, stress, schooling
(education), activities of daily living; while the activities of
daily living may appear to be more regimented than their civilian
counterparts, they largely reflect typical schedules (early
breakfast, exercise, education for 6 hours, regular lunch and
dinner, cleaning of dorms or TV in evening). These characteristics
are advantageous for many research questions. One difference
between the BMT and the civilian population is that there is a
predominance of males in the BMT population (90% male, 10% female)
and the age range is typically from 18-25 years. In order to
address this, the present inventors are extending this study to a
civilian population that includes individuals of all ages greater
than 18, male and female, who present to medical clinics and
hospital wards with symptoms of upper respiratory tract infection.
The ability to ascribe differential gene expression profiles in a
relatively homogeneous population is directly applicable to
military applications and is enabling for the development of
methods necessary for the discovery of a subset of markers that
will be predictive for a larger population.
Sample Preparation--
[0122] There has been considerable speculation within the research
community that blood would provide the best range of gene
expression biomarkers involved with the immune response to a broad
range of viral and bacterial infections. A variety of blood cell
isolation kits and reagents might be useful for collecting blood
cells and isolating RNA for gene expression analysis, including CPT
vacutainer tubes (Beckman Dickenson) which collect blood and after
a spin can segregate the PBMCs; the Paxgene blood RNA system, which
has an RNA stabilizer reagent inside the vacutainer tube for blood
collection; and the Tempus blood collection tube from Applied
Bioscience which also has a stabilizer, but is relatively new on
the market.
[0123] Relman (18) has used PAXgene to successfully measure gene
expression changes in blood using cDNA and long oligonucleotide
(70-mer) microarrays. However, the stability of RNA in PAX tubes
over handling conditions practical for multicenter surveillance was
not assessed. Relman (18) processed all the PAX tubes within 24
hours of collection, which is not practical for large multicenter
surveillance. Also, in principle, a higher degree of sequence
resolution would be obtainable using shorter (25-mer)
oligonucleotide arrays have high-density probe tiling (e.g.
Affymetrix GeneChip) that blanket entire genomic regions of
interest. However, prior observations have been that PAXgene
produced an insufficient number of "percent present" calls (i.e.
the percentage of total genes determined to be measurably expressed
as determined by the Affymetrix GCOS gene expression software) on
Affymetrix GeneChip expression microarrays. Presumably, the
unsatisfactory level of "percent present" calls was caused by the
interference of high abundance globin RNA on binding of lower
abundance transcriptional markers. Thus, there have been no prior
reports of the combined use of PAXgene blood RNA kits and the
Affymetrix GeneChip.RTM. platform prior to that described
herein.
[0124] From a logistical perspective, the use of PAXgene technology
would be highly preferred for discovery of expression markers
during opportunistic encounters of infectious agents with a mobile
human population. This is because of the proposition of the unique
abilities of the PAXgene reagents to rapidly terminate gene
expression in cells and stabilize RNA at the time of blood draw,
minimizing the confounding effects of variable RNA degradation and
gene expression perturbations caused by varying storage and
processing times and conditions in a military clinical setting,
rather than controlled laboratory environment using controlled
exposures and sampling times. Traditionally, studies of blood cells
utilize gradient-density based methods to collect live mononuclear
cells for analysis such as cell sorting, genotyping, and expression
profiling. However, the RNA population may have changed or become
degraded due to the processing of live cells, as transcript levels
can fluctuate early after blood collection (30-32). Additionally,
these methods do not isolate neutrophils, which typically pass
through the gradient-density and are not collected for analysis.
These methods are labor intensive and do not translate well to
mobile populations. In contrast, the PAX tube contains a
proprietary solution that reduces RNA degradation and gene
induction as 2.5 ml of blood is flowed into the tube (30-32).
However, the blood cells are killed and cannot be sorted, nor can
DNA be isolated using procedures described in the PAX kit handbook
(33).
[0125] Since the goal of the present inventors is to measure RNA
transcript levels for diagnosis or epidemiologic surveillance, we
decided that the RNA stabilization capability of the PAX tube
complemented our interests, especially for situations where one
cannot process the blood samples soon after collection. It is to be
understood that alternative sample preparation methods may be used
in the methods of the present application, so long as these
alternative sample preparation methods do not compromise the
integrity of the RNA material contained within the sample.
[0126] In view of the foregoing, the present inventors have
developed a modified protocol for gene-expression analysis of RNA
isolated from human blood collected and processed with the PAXgene
Blood RNA System that works with the Affymetrix GeneChip.RTM.
platform. The protocol was used to compare profiles of blood
samples collected in PAX tubes that were handled in two ways that
may provide practicality to surveillance and clinical studies
(conditions E and O). These methods entailed collecting blood
samples in a PAX tube and then either, (a) incubating the sample
for a minimum of 2 hours at room temperature (condition E) and then
isolating RNA from the PAX tube-collected blood samples, or (b)
incubating the sample at room temperature for nine hours followed
by storage at -20.degree. C. for 6 days (condition O) and then
isolating RNA from the PAX tube-collected blood samples.
[0127] The present inventors found differences between the two
handling methods (although either of these conditions may be
employed in the context of the present invention). Samples of
condition E had higher DNA contamination, lower total RNA yield,
and higher double-stranded cDNA yield than samples of condition O.
ANOVA indicated that the two conditions contributed to differences
in gene expression levels, but the magnitude was minimal, being
0.09% of the total variation. These results should facilitate
incorporation of expression profiling protocols and handling
methods into clinical and surveillance level procedures.
[0128] Genome-wide expression studies of human blood samples in the
context of clinical diagnosis and epidemiologic surveillance face
numerous challenges--one of the foremost being the capability to
produce reliable detection of transcript levels. Many factors
contribute to the variability of target detection, including: the
method of blood collection, sample handling, RNA stabilization, RNA
isolation, and other downstream processes.
[0129] The Affymetrix.RTM. GeneChip.RTM. platform can measure a
significant subset of the transcriptome. In design, it incorporates
a DNA oligonucleotide microarray, manufactured via photolithography
to detect labeled cRNA targets amplified from RNA populations.
However, some labs have observed a lower percentage of genes
detected using RNA from whole blood compared to RNA from
mononuclear cells regardless of the blood collection or processing
method. This phenomenon may be due to the dilution of leukocyte RNA
by RNA from reticulocytes, the activation of leukocytes during the
isolation procedure, and/or the degradation of RNA isolated from
the PAX tubes.
[0130] The RNA, isolated from blood in PAX tubes that is stored at
room temperature, at -20.degree. C., at -80.degree. C., or after
freeze-thaw cycles has been shown to be stable as determined by
ribosomal RNA bands on agarose gel, fluorescence profiles on the
bioanalyzer (Agilent Technologies), or RT-PCR for a few genes (31,
34-45). However, the integrity of the RNA at the transcriptome
level as measured by Affymetrix microarrays has not been
determined. In the context of multi-centered epidemiological
studies, one needs to stabilize the transcriptome at the point of
sample collection and during sample storage and transportation.
Therefore, we compared the gene-expression profiles of parallel
blood samples drawn into PAX tubes handled in two ways (Condition O
and E described above) (FIG. 1). In the first way (FIG. 1,
Condition E, as in fresh), RNA was extracted after the minimum
incubation time of 2 hours from phlebotomy; while in the second way
(FIG. 1. Condition O, as in frozen), the blood sat for 9 hours at
room temperature followed by storage at -20.degree. C. for 6 days,
followed by RNA extraction. If there were no differences between
these two methods as related to gene expression, then this would
allow for a reasonable time frame before the samples have to be
processed or frozen for transportation or later processing.
Otherwise, one needs to consider the magnitude of the differences
and weigh its contribution to transcriptome variability versus the
flexibility, practicality, and feasibility of sample handling,
storage, and processing.
[0131] In the present specification, the present inventors relate a
quality assured and controlled protocol that is capable of
producing reliable gene-expression profiles, using the
GeneChip.RTM. system and RNA isolated from whole blood using the
PAXgene.TM. Blood RNA System. We used this protocol to compare
quality control (QC) metrics and gene-expression profiles of PAX
tube collected blood that was handled by the methods diagramed in
FIG. 1. These results direct protocols for clinical studies and
progress us towards the goal of using the transcriptome in
diagnosis and surveillance.
[0132] Our results implied several recommendations as to sample
handling for multi-centered studies. Since there were differences
between the conditions but they both showed good within-group
reliability, one should preferably pick one method to reduce
variability. In which case, condition O seemed advantageous over E,
as it provided time before one had to process or freeze the samples
and allowed for transportation while frozen. If one needed the
flexibility of the range of handling methods between the
conditions, then this would still be possible, as long as during
subsequent analysis, one increased statistical stringency.
[0133] Therefore, in a preferred embodiment of the present
invention blood samples are obtained and prepared for microarray
analysis by the following general protocol:
[0134] (a) Blood Collection [0135] Preferably using PAX vacutainer
tubes which has RNA stabilization reagent; [0136] Alternatively,
the skilled artisan may use capillary tubes to obtain a few drops
of blood then place in RNAstat to stabilize RNA; [0137] Another
alternative is the use of Tempus tubes from Applied Biosystems,
which also have RNA stabilizing reagent; [0138] Also within the
scope of the present invention, the skilled artisan may use single
cells from drops of blood and pass the sample through microfluidic
channels to different stations that measure different things about
the cell including the transcriptome. In so doing, this technique
may provide sufficient rapid measurements that one does not need to
stabilize RNA;
[0139] (b) Target RNA Isolation [0140] Preferably using PAX tubes,
the PAX kit system is used to isolate target RNA with modifications
to the manufacturer's instructions (described herein elsewhere);
[0141] Other kits that are commercial available and may be used in
the present invention include those available from Qiagen (e.g.,
Qiamp), or from Zymogen, or from Gentra to isolate RNA from whole
blood not in stabilizing solution; [0142] Also suitable for use are
robotics system available for purifying RNA from blood in a
high-throughput manner;
[0143] (c) Labeling and/or Amplification of Target RNA [0144]
Preferably, for amplification of the target RNA, the purified RNA
is reversed transcribed to cDNA then to double stranded cDNA with a
T7 promoter for subsequent in vitro transcription to amplify and
label the resulting cRNA target; [0145] Alternatively, if enough
RNA is isolated from blood, then one could label the RNA directly
with fluorescent dye or other molecules of high light output for
high sensitivity of detection, thus providing a time savings;
[0146] Other RNA amplification and strategies may also be employed,
including, but not limited to, the Ovation RNA amplification
technology (Affymetrix) using one-cycle and two-cycle to reduce
initial amount of RNA needed and also to reduce processing
time;
[0147] (d) Hybridization onto Microarray [0148] Preferably, using
the Affymetrix hybridization oven for 15 to 17 hours at 45.degree.
C. of hybridization of labeled target onto the Genechip microarray.
Conditions, including incubation time and temperature, may be
further modified, so long as sensitivity and accuracy are
maintained. [0149] Other platforms (described elsewhere) may be
suitable for use in the present invention in which one may be able
to reduce the hybridization time;
[0150] (e) Detection of Bound Target RNA [0151] Preferably, using
strepavidin phycoerythrin to bind the biotin on the target RNA,
followed by, further signal amplification with biotinylated
anti-strepavidin antibody and another staining with strepavidin
phycoerythrin to increase sensitivity; [0152] Alternatively, one
can replace this step with a molecule that can emit more light
without much quenching. Examples of such molecules include: quantum
dots, alexi dyes, or biotinylated viruses. Thereby, detection
and/or hybridization times may be shortened;
[0153] (f) Data Integration and Analysis.
[0154] Although the PaxGene-based methods worked well in the
present invention, the present invention contemplates and includes
additional optimized processes. One adjustment to the existing
protocol is to omit the increase in proteinase K during RNA
isolation. To this end, some reports have stated that sufficient
pellet formation is possible by simply increasing centrifugation
time. Therefore, it is also possible to increase the centrifugation
time concomitant with the omission of the proteinase K increase.
Alternatively, the protein K digestion step may be shortened by
using a more concentrated proteinase K and a shorter incubation
time. Also, the eluent volume during mRNA elution was 100 .mu.l,
but a 200 .mu.l total eluent might give better yield. The
in-solution DNase treatment was used to ascertain removal of DNA.
However, the amount of DNA left after on-column DNase treatment
might not interfere with subsequent steps.
[0155] Further, to improve preparation time on the PaxGene
technology itself, vacuum-filtering methods may be employed to
collect the cells rather than spinning the tubes to pellet the
cells. Another permissible modification would be to use filtering
methods to collect the supernatant after proteinase K digestion
rather than spinning down the debris for a defined time (e.g., 30
min). Robotic systems could also be employed to considerably
shorten liquid handling time.
[0156] For alternatives to existing protocols, other related sample
collection methods and transcriptome measurement technologies may
be used. These include: [0157] 1) The Tempus.TM. Blood Collection
Tube from Applied Biosystems; [0158] 2) The CPT.TM. Cell
Preparation Tube from Becton Dickenson, which can collect live
cells and isolate peripheral blood monocytes after a spin down;
[0159] 3) Nanoarrays of oligomer probes on nano wires and
transcriptome measurements from single cells flowing through
microfluidics channels; [0160] 4) Microcapillary tubes to collect a
few drops of blood perhaps followed by lysing of the red blood
cells and storage in RNALater for RNA stabilization. Then, when
needed, the RNA can be extracted from blood cells using other kits
such as the Qiamp kit from Qiagen or the blood RNA isolation kit
from Zymogen.
[0161] Additional alternative and/or supplemental preparation
methods are also contemplated, which may shorten duration time and
reduce initial input RNA amount, for Example: [0162] 1) The new
method published by Affymetrix that can label total or polyA RNA
directly without amplification (46) (Cole K, et al. "Direct
labeling of RNA with multiple biotins allows sensitive expression
profiling of acute leukemia class predictor genes." Nucleic Acids
Res. 2004 Jun. 17; 32(11):e86.); [0163] 2) Direct chemical labeling
of the RNA, for example by the method of Label IT.RTM.
.mu.Array.TM. Biotin Labeling Kit by Mirus; [0164] 3) The Ovation
kit available from NuGEN Technologies, Inc., which can generate a
large quantity of RNA using only 15 ng of RNA in 4 hr. This
technology might even allow direct substitution of the PAX system,
as only a few drops of blood would be needed; [0165] 4) The
Dynabeads.RTM. mRNA DIRECT.TM. Kit from Dynalbiotech, which uses
magnetic beads to extract mRNA in 15 min in a single tube. Can be
performed using whole blood. [0166] 5) The MessageAmp.TM. II aRNA
Amplification Kit available from Ambion.
[0167] Other methods that are also contemplated to increase
sensitivity of the sample preparation processes include: [0168] 1)
Adding unlabeled globin RNA or DNA to the hybridization step to
block background, thereby perhaps increasing detection calls;
[0169] 2) Removal of the globin mRNA via magnetic beads isolation;
and [0170] 3) Adding more cRNA onto the chips and/or background
reduction as in item #2.
[0171] As stated above, the present invention was accomplished
following successful adaptation of a commercial technology
(Affymetrix Human Genome U133 chip set) that has not been
demonstrated prior to this to be effective for whole blood
expression profiling due to interferences from high-abundance
globin RNA (20). Therefore, globin reduction for whole blood RNA is
an important step for improving gene expression profile from whole
blood sample, since 70% total RNA in whole blood samples are globin
mRNA, which would result in decreased percent present calls,
decreased call concordance and increased signal variation.
[0172] In Example 4, the present inventors evaluated biotinylated
globin oligos (Ambion) and PNA oligos (Affymetrix), which prove to
be the two most effective methods to reduce globin mRNA from whole
blood RNA. However, heretofore there was no systematic comparison
on gene expression profiles derived from these two methods. The
present inventors' studies using Jurkat RNA and globin spiked in
Jurkat RNA (JG) in parallel with paxgene RNA provides a detailed
insight of comparison between these two methods for cRNA profiles,
present calls, call concordance, signal variation, multidimensional
scaling and hierarchal cluster analysis in gene expression
profiles.
[0173] Although neither of two globin reduction methods gave the
same gene expression profile (gxp) as Jurkat RNA, the globinclear
method using Biotinylated globin oligos gave closer gxp than PNA
method. The data set forth in Example 4 indicate that the
globinclear RNA resulted in significantly higher number of present
calls (%), higher call concordance %, lower false negative
discovery, and closer gene expression profile to no globin control
relative to the single step PNA reduction method in Jurkat and JG
RNA. However, it also resulted in higher signal variation, lower
triplicate correlation coefficient and no difference in correlation
to no globin control relative to the PNA method, possibly due to
the multi-step procedure that involves a 2 hour processing time. It
is notable that highly pure RNA free from RNase contamination is
required for the globinclear method, necessitating in solution
Dnase digested paxgene RNA to be subjected to cleaning and
concentration using the Rneasy Minelute column (Qiagen). In
contrast, the single step PNA process is easy to perform simply by
adding the oligo mixture to the downstream application tube. But we
noticed that higher ratios of 3'/5' GAPDH and 3'/5' Actin appeared
in paxgene RNA samples and smaller cRNA size in PNA treated paxgene
RNA. Reduction in cRNA size may lead to a higher ratio of the two
control probe sets and likely is the cause of the higher CV seen
with paxgene RNA.
[0174] PNA oligos specifically hybridized to the 3' end of globin
mRNA to prevent reverse transcription, while biotinylated capture
globin specific oligos hybridized to globin mRNA followed by
removal of globin mRNA via strepavidin magnetic beads. Thus,
because the globin clear method physically separates globin mRNA
from the sample, it allowed non 3' bias techniques downstream, such
as direct labeling of globinclear RNA for target preparation.
Globinclear method produces a good quality RNA with the ratio of
260/280 beyond 2.0. However, from paxgene RNA not from J and JG
RNA, the cRNA yield reduces to half of the amount of no treatment
or PNA treated sample and at least 5 .mu.g paxgene RNA is required
to get enough cRNA for hybridization. Whereas, 1 .mu.g paxgene RNA
treated with PNA oligo is able to amplify enough cRNA
(approximately 20 .mu.g) for hybridization
[0175] In sum, the present inventors have compared pros and cons
for the globinclear and PNA methods. Based on this comparison, the
present inventors have found that the both of these methods may be
used to reduce the amount of globin in whole blood RNA. Choice of
methods depends on the individual project setup and goals. However,
in either scenario by employing one of these methods a
significantly higher number of present calls (%), higher call
concordance %, lower false negative discovery, and closer gene
expression profile to no globin control can be obtained.
[0176] Based on the foregoing, the present inventors have developed
a method for identifying gene expression markers for distinguishing
between healthy, febrile, or convalescence in subjects that have
been exposed to one or more of various infectious pathogens.
[0177] In general, a preferred method of the present invention is
as follows:
[0178] a) sample collection;
[0179] b) Isolation of RNA from said sample;
[0180] c) Removal of DNA contaminants from said sample;
[0181] d) Optional concentration and clean-up of RNA;
[0182] e) Spike-in controls for normalization;
[0183] f) Optional globin mRNA reduction/elimination;
[0184] g) Synthesis of cDNA;
[0185] h) IVT (in vitro transcription) labeling and cRNA
synthesis;
[0186] i) cRNA quantification and quality control;
[0187] j) Gene chip hybridization, wash, stain, and scan;
[0188] k) Optional second gene chip hybridization, wash, stain, and
scan;
[0189] l) Data acquisition and management; and
[0190] m) Statistical analysis.
[0191] Within the context of the present invention, including this
preferred embodiment, the sample is preferably whole blood.
However, within the context of the present invention, any RNA
source may be utilized whether from whole blood or extracted from
some other source. In a preferred embodiment, and as described
above and in the Examples, when the sample is whole blood the
collection device is a PAXgene blood RNA tube.
[0192] Within the context of the present invention, including this
preferred embodiment, the RNA may be isolated by any known RNA
isolation technique. As stated above, the RNA isolation technique
may be facilitated by use of a commercially available kit,
including the PAX kit system or Qiamp. Preferably, RNA isolation
may be performed without on-comun Dnase treatment. In addition, in
an embodiment of the present invention, RNA isolation may be
performed with a Qiashredder column (Qiagen Corp.), which helps to
increase the yield of RNA obtained from samples obtained from sick
subjects.
[0193] Within the context of the present invention, including this
preferred embodiment, the DNA may be removed by any known
technique. In a preferred embodiment, the DNA is removed from the
sample by in-solution Dnase treatment. The Dnase treatment may be
performed with or without use of an inactivation reagent. In the
case of use of an inactivation reagent, it is preferred that the
inactivation reagent be added after a defined period after onset of
Dnase treatment. In this case, the defined period is preferably set
by the level of DNA remaining in the sample. In case where the
DNase inactivation reagent is not used is because subsequent use of
column to clean (hence DNase and metal ions are removed) and
concentrate RNA for globinclear method.
[0194] Within the context of the present invention, including this
preferred embodiment, the RNA may be concentrated and cleaned-up
where necessary. For subsequent techniques in the preferred
protocol of the present invention it is preferred that there be a
total of at least 8 .mu.g of RNA initially before going into column
to clean and concentrate. As such, one or more of several
techniques may be used to concentrate and clean-up the RNA. For
example, a Minelute column may be used and the RNA eluted in BR5.
Also it is possible to used ethanol precipitation techniques with
resuspension in water although this is not compatible with
globinclear downstream as this method does not clean the RNA enough
(e.g., approximately 10 .mu.l). Further, to determine whether
additional concentration and/or clean-up is necessary the RNA
and/or quality thereof may be assessed on a bioanalyzer or a
nanodrop.
[0195] Within the context of the present invention, including this
preferred embodiment, it is preferred for the subsequent steps
(i.e., steps (e)-(m)) that the starting amount of total RNA be at
least 5 .mu.g, although 1 .mu.g starting amount can work with PNA
and no globin reduction methods.
[0196] Within the context of the present invention, including this
preferred embodiment, it is important that prior to cDNA synthesis
that a spike-in control be added to the reaction cocktail
containing the subject RNA. This step is critical for normalization
between diseases and patients and poses an improvement over
existing techniques. The spike-in control for use in the present
invention is preferably a polyA control or an ERCC universal
control (http://www.cstl.nist.gov/biotech/workshops/ERCC2003/).
[0197] As stated above, 70% of mRNA in whole blood samples are
globin mRNA, which would result in decreased percent present calls,
decreased call concordance and increased signal variation. As such,
in a particularly preferred embodiment, the globin RNA content is
either reduced or eliminated. To this end, the term "reduced" is
contemplated as meaning that there is a reduction in the total
amount of globin RNA in the sample of at least 50%, preferably at
least 60%, more preferably at least 70%, even more preferably at
least 80%, still even more preferably at least 90%, and most
preferably at least 95% as compared to the sample prior to the
reduction treatment. Within the context of the present invention,
the globin RNA reduction may be performed using biotinylated globin
capture oligos (Ambion globinclear kit) or PNA (Affymetrix GeneChip
globin reduction kit) according to modified manufacturers'
procedures (see the Examples of the present invention).
[0198] When the globin RNA reduction method is that of using
biotinylated globin capture oligos, it is preferred that
biotinylated globin capture oligos are added to the total RNA and,
subsequently, the globin mRNA were removed by contacting the RNA
mixture with streptavidin beads (e.g., Strepavidin magnetic beads).
Globinclear RNA was further purified using magnetic RNA bead.
Alternatively, it is possible to replace the magnetic bead based
total RNA isolation step with Qiagen column chromatography. In
either event, the subject RNA is preferably eluted with water or
BR5 (preferably diluted such that following speedvac concentration
the total salt content is 1.times.BR5 or if water is used for
elution, then speedvac to small volume and then increase to
appropriate volume using BR5). Accordingly, when the globin RNA
reduction method is that of using biotinylated globin capture
oligos is employed it is a highly preferred embodiment that the RNA
be concentrated and cleaned-up before and/or after said method. It
is important to note that the Elution buffer that comes with the
Globin clear kit does not work with downstream speed vac
concentration and affymetrix target prep. Ambion test their Elution
buffer with their Message Amp target prep method, whereas the
present invention preferably uses Affymetrix target prep.
[0199] When the PNA method is used as the RNA reduction method,
this step is performed simultaneously with cDNA synthesis. In this
method, PNA is spiked in with the cDNA synthesis cocktail. Peptide
nucleic acid (PNA) oligonucleotides specifically bind to the 3' end
of globin mRNA to inhibit reverse transcription during cDNA
synthesis. However, when employing this method, care must be taken
to preserve the stability of PNA and one has to take measures to
prevent PNA aggregation and precipitation. It may also be advisable
to run Jurkat globin as a control for efficient globin removal.
[0200] When the method above is practiced in the absence of a
globin RNA reduction protocol low sensitivity and high variance are
observed. When the PNA method is followed the sensitivity is
boosted, low variance is observed, but this method only works for
3'biased reverse transcription assays. When the biotinylated globin
capture oligo method is followed the best sensitivity is obtained,
low variance is observed, and the RNA may be used for nay reverse
transcription assay including non-3' biased assays. With the
biotinylated globin capture oligo method very high quality RNA is
required, whereas the PNA method is useful even without high
quality RNA. It is important to note that if ERCC controls are
uses, then the data can be normalized across highly different gene
expression profiles.
[0201] Within the context of the present invention, including this
preferred embodiment, it is preferred that the purified target RNA
be amplified via reverse transcription to cDNA utilizing a T7 polyT
primer (or a random primer for non 3'-biased assay alternative for
exon arrays) then to double stranded cDNA with a T7 promoter for
subsequent in vitro transcription. Following production of double
stranded cDNA, the double stranded cDNA should be cleaned-up and
concentrated as appropriate.
[0202] Within the context of the present invention, including this
preferred embodiment, commercially available in vitro transcription
kits are preferably used to amplify and label the resulting cRNA.
Examples of such kits are readily available through Enzo Biochem or
Affymetrix. These methods may be performed as instructed by the
manufacturer with a subsequent cRNA clean-up as appropriate.
[0203] Within the context of the present invention, including this
preferred embodiment, the cRNA is quantiated and the quality of the
sample assessed to determine the cRNA yield and purity of the
sample, respectively. To determine whether additional concentration
and/or whether further clean-up is necessary the RNA and/or quality
thereof may be assessed on a bioanalyzer, nanodrop, and/or UV
spectrophotometer (cuvette or plate reader). If necessary, if an
increased cRNA yield is necessary, Ambions Message Amp kit may be
used in accordance with the manufacturers' instructions. Among the
quality controls within this embodiment are the ratio of 260/280,
the yield of cRNA, etc.
[0204] Within the context of the present invention, including this
preferred embodiment, gene chip (first, second, or subsequent
chips) hybridization, washing, staining, and scanning may be
conducted as directed by standard Affymetrix protocols. For
example, hybridization may be conducted by contacting approximately
10 .mu.g of biotin incorporated cRNA to the genechip in the
Affymetrix hybridization oven for 15 to 17 hours at 45.degree. C.
of hybridization of labeled target onto the Genechip microarray.
Conditions, including incubation time and temperature, may be
further modified, so long as sensitivity and accuracy are
maintained. In addition, the washing and staining conditions may
also be modified so long as the sensitivity and accuracy of the
technique are maintained. The nature, identity, and composition of
the genechip for use in the present invention are not limited;
however in a preferred embodiment the genechip is selected from
Affymetrix U133A, U133B, and U133 plus 2.0. In a preferred
embodiment, it is preferred that either U133 plus 2.0 or both U133A
and U133B are used as the genechip.
[0205] As discussed below, data acquisition and handling may be
performed by any means known by the skilled artisan. For example,
data acquisition and handling may be performed by hand and passing
through various programs, including the manufacturer developed
software accompanying the genechip reader.
[0206] A more complete discussion of data management and
statistical/functional analysis is provided in the description
below and the Examples that follow.
[0207] However, briefly, data management is conducted by using
Affymetrix GCOS gene expression software data are exported to
Excel. MAS5.0 signal and present calls are exported and saved as
tab-delimited text files, as are scaled and unsealed Signal values,
to test normalization assumptions and strategies. The text files
(and file names) are subsequently reformatted for import into
Arraytools in house R-script. QC analysis software, datamatrix, and
JMP IN (SAS Institute) programs are used for analysis of variance
and further data exploitation. Where appropriate, the data for
U133A and U133B are joined in Arraytools.
[0208] For analysis software the following can be mentioned: [0209]
Statistical analysis software: SAS and JMP; [0210] Class Prediction
analysis software: BRB-Arraytools; [0211] Clustering analysis
software: BRB-Arraytools and dChip; and [0212] Functional analysis
software: EASE, DAVID, Pathway Assist, and lobion Stratagene.
[0213] To identify gene expression profiles resulting from pathogen
exposure and to enable the general technology described herein, the
following program was undertaken with an adenovirus model
system.
GXP Program Details
Description of Program:
[0214] Lackland Air Force Base (LAFB) in San Antonio, Tex. is the
location of Basic Military Training for all recruits to the United
States Air Force. Approximately 40,000 basic military trainees
(BMTs) undergo a 6-week training course prior to assignment of
duty. These BMTs are organized into flights of 50-60 individuals
that eat, sleep, and train in close quarters. Each flight is paired
with a brother or sister flight with which there is increased
contact due to co-localization for scheduled activities, and
multiple flights are grouped into squadrons which reside in the
same dormitory building, subdivided into dorms for individual
flights. Compared with their civilian peers, young healthy adults
serving in the U.S. Military are at a significantly elevated risk
of respiratory infections. Crowding and numerous stressors
facilitate the transmission of respiratory pathogens. During the
6-week basic training course, approximately 20% of BMTs will
develop fever and respiratory symptoms.
[0215] Adenoviruses are the most common respiratory pathogens seen
in the BMT population today. Before an adenoviral vaccine was
available, adenovirus was consistently isolated in 30-70% of BMTs
with acute respiratory disease. The outbreaks often incapacitate
commands, halting the flow of new trainees through basic training.
In 1971, the adenoviral vaccine directed against serotypes 4 and 7
became routinely available to new military trainees. This vaccine
had a dramatic impact on trainee illness, reducing total
respiratory disease by 50-60%, and reducing adenovirus-specific
disease rates by 95-99%. The use of the adenoviral vaccine
continued uninterrupted for 25 years until the manufacturer of the
vaccine halted production. After discontinuation of the vaccine,
1814 of the 3413 (53%) throat cultures from symptomatic military
trainees yielded adenovirus during the period from October 1996 to
June 1998. At that time, adenovirus types 4, 7, 3, and 21 accounted
for 57%, 25%, 9%, and 7% of the isolates, respectively, and
currently a predominance of adenovirus type 4 is recognized. Since
the discontinuation of the adenoviral vaccine, approximately 20% of
BMTs develop symptoms of fever and respiratory illness and 60% of
these cases are due to adenovirus. Other pathogens such as
influenza A, Mycoplasma pneumoniae, Chlamydia pneumoniae,
Bordetella pertussis, and Streptococcus pyogenes continue to cause
a significant minority of respiratory disease in this population.
Mixed infections are known to occur but the frequency and types of
pathogens involved in mixed infections are largely uncharacterized.
Resolution of mixed pathogens is the topic of a related patent
application by the present group of inventors (U.S. Provisional
Patent Application No. 60/590,931, filed on Jul. 2, 2004). In the
present invention, the present inventors do not attempt to
characterize multiple pathogens but rely on the predominance of a
single pathogen (human Adenovirus type 4; Ad4) to create a category
of infection and compare cases of that to other categories
comprised of non-Ad4 FRI and convalescent Ad4 FRI.
[0216] With the current state of the art, differentiating the
serotypes and strains of adenovirus and influenza is a
time-consuming and labor-intensive undertaking. Cultures of
adenovirus may take a week to grow and subsequent typing of the
adenovirus isolate must then be performed using
hemagglutination-inhibition and neutralization assays which are
cumbersome and subject to significant reciprocal cross-reactions,
making serotype identification take as long as 2-3 weeks. By the
time that the virus is identified, the BMT has often has already
transmitted the infection to multiple others. There is great need
for more rapid diagnostic assays and a need to detail the
epidemiology of these respiratory outbreaks so that public health
measures can be directed appropriately.
[0217] More importantly, especially with regard to the present
invention, there are no known methods to determine reliable
physiological markers that relate the exposure of an individual to
an infectious pathogen to the actual infection. Thus, while a
sample such as a throat swab or nasal wash might produce nucleic
acid markers for the presence of a respiratory pathogen, there are
no techniques available to determine whether the individual will
become ill or has just recovered from infection caused by that
pathogen(s). In addition, an organism may be recovered from a
sampling of the respiratory tract. Generally, it may be unclear
whether this organism is simply colonizing the respiratory tract or
is the cause of disease; assaying for the presence of an
immunologic signature to this organism is expected to assist in the
differentiation of colonization from disease. Furthermore, within
the group of individuals who present with febrile respiratory
illness, there are no methods for determining the severity of
infection, or the degree and type of interaction with the host
immune system. The present invention describes methods for
performing these latter assessments in a statistically valid
manner.
Entry Criteria and Sample Collection--
[0218] In order to determine whether gene expression profiling
could differentiate individuals infected and ill with adenovirus
versus other infectious pathogens, the present inventors undertook
an Institutional Review Board (IRB) approved study (vide infra).
BMTs arriving at LAFB underwent informed consent to participate in
this study. Approximately 15 ml of blood, filling 4 to 5 PAX tubes,
were drawn from each volunteer. On day 1-3 of training, blood
samples were drawn from healthy BMTs into PAX tubes by standard
protocol (described herein elsewhere), but no nasal wash was
collected for this group. A complete blood cell count (CBC) was
also obtained. These individuals were determined to be healthy by
screening with a standardized questionnaire, which eliminated any
initial BMT with acute medical illness within 4 weeks of arriving
at basic training.
[0219] In Phase II of the study, BMTs who presented at a later
stage in training with a temperature greater than 100.4.degree. F.
and respiratory symptoms were consented for a nasal wash, throat
swab and blood draw for PAX tubes and CBC. These individuals were
categorized into either the febrile with- or without-adenovirus
infection groups. At times, a rapid antigen capture assay for
adenovirus was used to screen for individuals who were adenovirus
negative; this was done to improve enrollment of individuals in
this group. All results of rapid assay were confirmed with
culture.
[0220] In Phase III of the study, approximately three weeks after
sample collection from febrile volunteers with adenovirus,
additional blood (PAX tube and CBC) and nasal wash were collected
from these individuals when they recovered, forming the
convalescent group.
[0221] All PAX tubes were maintained at room temperature for 2 hrs
and then were frozen at -20.degree. C. and shipped on dry-ice to
the Navy Research Laboratory (NRL) in Washington, D.C. within 7
days for processing. Nasal washes were performed by standard
protocol using 5 ml of normal saline to lavage the nasopharynx
followed by collection of the eluent in a sterile container. Nasal
wash eluent was stored at 4.degree. C. for 1-24 hrs before being
aliquoted and stored at -20.degree. C. and shipped to NRL within 7
days for processing. The nasal wash and throat swab was sent for
standard viral culture of adenovirus, influenza, parainfluenza 1,
2, and 3 and RSV. The nasal wash and throat swab were also tested
by a multiplex PCR for adenovirus type 4 to further confirm culture
results for this pathogen. Although the foregoing describes the
protocol undertaken in the present study, it is understood that the
present invention further contemplates alternative storage and
shipment conditions so long as the integrity of the sample is not
compromised.
[0222] All BMTs underwent a standardized questionnaire at initial
presentation, during presentation with illness, and at follow-up.
Questions posed to BMTs include: vaccination history, allergies,
last meal, last exercise, last injury, medication taken, smoking
history, observed subjective symptoms, and last menstruation (if
appropriate). Among the observed subjective symptoms asked and
monitored are: sore throat, sinus congestion, cough (productive or
non-productive), fever, chills, nausea, vomiting, diarrhea,
malaise, body aches, runny nose, headache, pain w/deep breath, and
rash. All data was stored in electronic format using personal
identification numbers and date of sample collection.
[0223] During the period of sample collection, two outbreaks of
Streptococcus pyogenes occurred. Throat swab and blood samples were
collected as above on acutely ill BMTs and on those who recovered
from illness and were still in basic training. Diagnosis of
Streptococcus pyogenes was confirmed by bacterial culture and
subsequently by PCR.
[0224] For the experiment supporting the present invention all male
BMTs who were determined to be healthy (no acute medical illness in
4 weeks prior to initiation of basic training) were eligible for
study. In Phase II, any male BMT with T>100.4 and respiratory
symptoms were eligible for consent. In the experiments described in
the examples below, the patient population enrolled consisted of
male BMTs between the ages of 17-25. Seventy percent were white,
12% Hispanic, 12% black and 6% Asian. Thirty BMTs who were
determined to be healthy were enrolled, 30 who had fever and
respiratory symptoms and determined to have adenovirus by rapid
assay (confirmed by viral culture and PCR) were enrolled, 19 with
fever, respiratory symptoms and non-adenoviral infection were
enrolled. The 30 BMTs with fever, respiratory symptoms and
adenovirus had another nasal wash and blood draw performed during
convalescence from their illness.
[0225] Metadata for the experiments supporting the present
invention were obtained by providing the healthy incoming BMTs with
a standardized questionnaire. These individuals were excluded from
inclusion if they had fever, sinus congestion, nausea/vomiting,
burning with urination, cough, sore throat, diarrhea or chills in
the 4 weeks prior to basic training. In order to determine
conditions that might affect baseline gene expression, these
individuals were screened for: race/ethnicity, vaccination status,
time of most recent meal, time of last exercise, perceived stress
level, allergies, recent injuries, current medications, and smoking
history.
[0226] For Phase II, when BMTs were presenting with fever and
respiratory symptoms, a standardized questionnaire was
administered. In order to determine conditions that might affect
baseline gene expression, these individuals were screened for:
race/ethnicity, vaccination status, time of most recent meal, time
of last exercise, perceived stress level, allergies, recent
injuries, current medications, and smoking history. The duration
and type of respiratory symptoms to include sore throat, sinus
congestion, cough, fever, chills, nausea, vomiting, diarrhea,
fatigue, body aches, runny nose, headache, chest pain and rash were
recorded on standardized forms. A physical examination was recorded
on standardized form to detail signs of illness in the BMT. Type
and duration of medications taken were recorded.
[0227] For Phase III when the BMT with adenoviral illness had
recovered (14-28 days after presenting ill) another standardized
questionnaire was administered, including questions on time of most
recent meal, time of last exercise, perceived stress level,
allergies, recent injuries, current medications, and smoking
history. The total duration of each symptom from the Phase II
questionnaire was noted and the total period of recovery from each
symptom was determined. A detailed history of medication use
between the time of Phase II and Phase III was taken.
[0228] The ability to collect samples in a longitudinal study
enables one to study gene expression throughout the course of an
infectious illness. In a study as outlined hereinabove and further
supported by the examples of the present application, the present
inventors particularly followed BMTs who were ill with adenovirus
through the time of their recovery from disease. The detailed
database on type and duration of symptoms thus enabled the present
inventors to determine whether these factors impact the gene
expression signature for adenovirus and Streptococcus pyogenes.
Further, the detailed database also enabled the present inventors
to discriminate early versus late disease and the severity of
disease (for example, expected duration of illness/symptoms).
[0229] The detailed and standardized collection of information such
as recent meal, recent exercise, perceived stress level, recent
injuries, current medications, and smoking history enable control
of confounding variables, strengthening the conclusion that
identified gene expression patterns are specific immunologic
signatures of particular pathogens. This collected information also
can be used to determine whether such conditions significantly
impact gene expression patterns in a population. A statistical
assessment of whether these factors are necessary or confounding
for correct classification will determine whether it will be
necessary to monitor for them in future experiments and
applications.
[0230] In the future, gene expression patterns (immunologic
signatures) for particular pathogens at different stages of disease
may be used to predict morbidity and mortality. This may assist the
healthcare professional in determining the appropriate level of
care (type of medications to use, level of care required-admit to
hospital or provide care in the outpatient setting). There
currently are algorithms for determining whether individuals with
respiratory infection (particularly pneumonia) should be admitted
to the hospital (and to what level of care) and these algorithms
rely on such factors as degree of fever, heart rate, respiratory
rate, blood gases and blood chemistries (47, 48) (49). A detailed
understanding of the state of immunologic activation of the ill
individual through gene expression may further assist with
determining severity of illness.
[0231] Moreover, understanding gene expression patterns, based on
the inventive techniques herein, in individuals who are recovered
from a particular infectious illness would enable forensic analysis
of past outbreaks. Subsequently, this information may be used to
determine whether certain pathogens are naturally endemic in
specific geographic areas or whether new infections have been
imported to regions (e.g., how many have been previously infected
with West Nile Virus?).
[0232] Further, for an individual, the present invention enables
determination of whether these individuals have been infected with
a particular infectious pathogen in the past and from this
information determines the likelihood of immunity/protection
against future infection with the same or related organism. Such
information would be valuable as it could guide whether vaccination
or prophylaxis is necessary for particular deploying/deployed
troops or hospital workers.
Assessment of Use of PAX Tubes in "Real World" Scenario
[0233] Having established a prospective, longitudinal study using
PAX tubes, this gave the present inventors the opportunity to
assess the quality of the modified protocol for gene-expression
analysis of RNA using PAX tubes and the Affymetrix Genechip
platform in a real world test bed of ongoing epidemics of upper
respiratory disease.
[0234] Many factors contribute to the variability of target
detection, with the quality of RNA being one of the most important.
The quality of RNA from PAX tubes collected blood could be
influenced by the disease status of the donors, sample handling,
and other downstream processes. Previously, the present inventors
showed that under two conditions representative of practical sample
handling, the PAX system was capable of preserving blood RNA to
produce good quality metrics and relatively stable transcriptome
measurements (50). Recently, new RNA quality metrics have been
proposed based on associations between experimental treatment of
cells or purified RNA to induce RNA degradation and metrics derived
from electropherograms of the RNA on the bioanalyzer (51). One new
metric is the degradation factor (% Dgr/18S), which is the ratio of
the average intensity of bands from degraded RNA, that is peaks of
lesser molecular weight than the 18S ribosomal peak, to the 18S
band intensity multiplied by 100. It is a continuous variable that
is used to derive a categorical variable named `Alert`. Alert has
five values: [0235] BLACK--indicating that the ribosomal peaks were
not detected; [0236] NULL--no RNA degradation and corresponds to
degradation factor values .ltoreq.8; [0237] YELLOW--for RNA
degradation can be detected and values from >8 to 16; [0238]
ORANGE--for severe degradation and values from >16 to 24; [0239]
RED--for highest alert, strong degradation, for values from >24.
Another new metric is the apoptosis factor (28S/18S), which is the
ratio of the height of the 28S to 18S peak and is indicative of the
percentage of cells undergoing apoptosis (51). The present
inventors compared the RNA QC methods of electropherograms from the
Agilent 2100 bioanalyzer, the degradation factor, Alert, and the
apoptosis factor to determine which is the best indicator of sample
processing quality for RNA used in microarray gene expression
analysis.
[0240] Thus, for PAX system isolated RNA from the present inventors
previous study (50) and current BMTs cohort, the distributions of
RNA quality metrics were reported, which would be useful for
comparisons and planning of protocols by other labs; determined the
up-stream quality metrics that are most indicative of the quality
of microarray target detection outcomes; and determined the effects
of inter-individual hemoglobin variability on the sensitivity of
target detection.
[0241] The present inventors demonstrate that the Alert metric was
a robust indicator of microarray results and will be useful for
high throughput RNA quality control, especially as one practically
cannot look at all the electropherograms directly during an ongoing
study and must be able to rely on an indicator to flag a sample for
further evaluations.
[0242] The magnitude of the apoptosis factor suggested that a high
percentage of blood cells underwent apoptotic cell death. This
could be due to the PAX RNA stabilizing reagent inducing cell death
via apoptosis upon contact with blood cells, or simply due to
differences between whole blood and cultured cells from which the
apoptosis factor was derived. If interested in studying apoptosis
related pathways, one would have to investigate this property
further with the PAX system technology. In this manner it may be
possible to correlate the apoptosis factor with gene-expression
profiles to implicate apoptotic pathways.
[0243] The stability of the RNA from PAX tube blood that was
handled a variety of ways suggest that for future studies one can
be more confident in the stability of RNA throughout the range of
these handling conditions.
[0244] The present inventors were next able to explore appropriate
methods of scaling of gene expression arrays when applied to
detection of clinical phenotypes. While global scaling approaches
have been advocated for other study designs and uses involving gene
expression arrays, we concluded that the use of the 100
housekeeping genes provided the least biased approach, although 5
approaches were considered:
[0245] 1) double scaled global normalization
[0246] 2) no normalization at all
[0247] 3) 100 hk gene scaling
[0248] 4) 100 hk gene median normalization
[0249] 5) empirical set of normalization gene
[0250] After QC/QA of the PAX tube RNA and the microarray scaling,
we undertook class prediction and class comparison modeling (a
summary appears in Tables 7, 10, and 11). The class prediction
using gene-expression, suggestively, performed better than using
CBC or electropherograms alone. This could be that gene-expression
does in fact contain more information about the sample or that it
simply has more variables thus providing more opportunities to find
a good classifier by chance alone. More specifically, the p-value
for the significance test of classification rate suggests that gene
expression is better for classification than the CBC or
electropherogram and that it is not likely a function of number of
variables acquired because the CBC actually has 10 times as many as
gene expression and performed poorly.
Study to Increase Number of Pathogens Recovered (the Hospital
Study)--
[0251] In order to study another patient population (broader age
range, male and female, civilian) and to increase the number of
pathogens recovered, another protocol was undertaken which focused
on patients presenting to medical clinics and hospital wards at the
Wilford Hall Medical Center at Lackland AFB (sometimes referred to
herein as "the Hospital study").
[0252] For the Hospital study, patient selection (Inclusion
criteria) was conducted as follows. Adults (male and female)
greater than the age of 18 were included. All were presenting to
the hospital or hospital clinics with temperature >100.4.degree.
F. and respiratory symptoms. Nasal wash and throat swab were
collected most commonly by a study nurse or by medical personnel
who had been instructed by the study nurse. A portion of the nasal
wash was used to screen for influenza A or B by rapid antigen
capture assay (52) and this result was confirmed by culture and
PCR. All nasal wash specimens were additionally cultured for
Parainfluenza 1, 2, 3, RSV and adenovirus. Accordingly, in an
embodiment of the present invention, the gene expression analysis
may be combined with one or more pre-screening methods. For
example, the pre-screening method may include abovementioned
influenza A or B rapid antigen capture assay, a culture assay, a
PCR-based assay, a method described in U.S. 60/590,931, filed on
Jul. 2, 2004 (the entire contents of which are incorporated herein
by reference).
[0253] A CBC will be obtained for all enrollees with differential.
In addition, each enrollee will be given a standardized
questionnaire including questions relating to race/ethnicity,
vaccination status, time of most recent meal, time of last
exercise, perceived stress level, allergies, recent injuries,
current medications, and smoking history. The duration and type of
respiratory symptoms to include sore throat, sinus congestion,
cough, fever, chills, nausea, vomiting, diarrhea, fatigue, body
aches, runny nose, headache, chest pain and rash are recorded on
standardized forms. Physical examination findings are recorded on
standardized forms.
[0254] This is a cross-sectional study that includes adults of all
ages with differing severity of disease (some will be in the
outpatient clinic setting and others admitted to the hospital). The
ability to collect blood samples over more than one influenza
season will enable the present inventors to determine the gene
expression pattern to influenza A and B and may allow us to
determine whether there is a specific gene expression pattern for
different strains of influenza A (H1N1 vs. H3N2).
[0255] For this study, the present inventors will monitor whether
individuals received the injectable form of the influenza vaccine
and the timing of vaccine relative to illness. The present
inventors will discern whether the gene expression pattern differs
between individuals with "breakthrough" influenza-illness occurring
greater than 2 weeks after time of influenza vaccine compared to
the gene expression pattern seen in unvaccinated individuals with
illness. The present inventors will perform the same comparison for
those individuals who receive FluMist (MedImmune Vaccines)
intranasal vaccination with a live, attenuated strain of influenza.
Understanding gene expression patterns after vaccination may
predict likelihood of protection from disease and likelihood of
breakthrough illness; the efficacy of the influenza vaccine is
considered to be 70-80%
[0256] Because the Lackland BMT population will be receiving
FluMist as a strategy of prophylaxis during the 2004-2005 flu
season, the present inventors will assess gene expression profiles
in individuals who receive FluMist and develop flu-like symptoms
and those without in the 7 days following vaccination; it is well
know that individuals receiving FluMist may develop cough, sore
throat and muscle aches in 2-7 days post-vaccination as they shed
the attenuated virus (CID 2004:38 (1March), 760-762 full reference
below), but the gene expression pattern post vaccination has not
been determined. This study will allow us to determine whether
there is a gene expression pattern that enables us to differentiate
which individual is symptomatic after FluMist vaccination, but
developing a protective immune response and which individual has
actually developed cough, sore throat, muscle aches due to
acquisition of circulating wild type influenza in the population.
This is a critical distinction to make in a closed population, such
as the BMTs or college students in dormitories, because it is this
age group that is most appropriate to receive the FluMist vaccine
and yet the most likely to have transmission of wild type influenza
in closed quarters.
Presymptomatic Study--
[0257] Individuals typically become infected with an infectious
pathogen and remain asymptomatic during the incubation period prior
to onset of disease. During this incubation period, the host begins
to mount an immune response to the infecting pathogen. Typically
the initial response is the innate immune response mounted by
natural killer cells and neutrophils. Later in infection, the
specific host immune response comprised of T lymphocyte, B
lymphocyte and antibody responses becomes effective. In some
infections, such as with the bioagent, Francisella tularensis, as
few as 10 organisms can ultimately cause symptomatic disease; while
this small number of organisms can be difficult to detect directly,
the host immune response typically constitutes an amplified
response of literally millions of immune cells and this immunologic
signature can likely be detected prior to the onset of clinical
symptoms.
[0258] There are clinical scenarios in which it would be
advantageous to the health care provider, public health officers
and commanders/public officials to determine not only who is
infected with a particular pathogen, but who has also been exposed
to this same pathogen either by direct exposure or through
transmission from an infected index case. For example, if the
infectious agent of smallpox was released and an index case was
detected, it is anticipated that each index case would
significantly expose close contacts (face-to-face contact within 3
feet) via respiratory droplets and nuclei. Typically, for each
index case of smallpox as many as 10 other susceptible individuals
may develop the disease. In view of the limited amount of smallpox
vaccine and potential adverse reactions to the vaccine, predicting
who amongst the exposed would develop disease could direct
resources and limit adverse side effects of the vaccine. Gene
expression studies can detect developing, specific immunologic
signatures for pathogens and assist in determining who in a
population has been significantly exposed and infected (carrying
organism) and who amongst the exposed-infected will ultimately
develop disease. Therefore, the methods of the present invention
are particularly useful for the identification of gene expression
signatures and the results obtained thereby may be used directly to
guide and/or tailor therapeutic regimens.
[0259] To this end, the following study design permits the study of
cues and expression profiles at various stages of pathogen exposure
and onset. Since the majority of BMTs arriving to basic training
from their respective home communities will be susceptible to
infection with adenovirus, the present inventors are able to screen
BMTs presenting with fever and respiratory symptoms to Lackland AFB
clinics with a rapid assay for adenovirus. Once a BMT is identified
as being infected with adenovirus, the BMTs with whom he/she has
had face-to-face contact can be followed for infection and
subsequent development of disease. Significantly exposed BMTs can
have blood drawn for gene expression during the
exposed/asymptomatic period and again after development of disease
and during recovery. Gene expression patterns obtained from these
time points are then analyzed to determine the gene expression
pattern that best predicts development of disease.
[0260] In anticipation of the abovementioned study, BMTs who are
ill with fever and respiratory symptoms during basic training are
receiving a standardized questionnaire to determine other BMTs with
whom they have had face-to-face contact within the last week; a
database is being generated which labels the infected BMT as the
current "index case" and all BMTs with who he/she has had recent
contact as "exposed". Data on the exposed and their relationship to
the index case are maintained; for example, the exposed may have
been the Training Instructor or Dorm Chief or Element Leader of the
index case. If an exposed case next presents to a clinic with fever
and respiratory illness, then that case is linked to the initial
index case as well as to other BMTs to which he/she may now have
exposed. The epidemiology is followed to determine whether there
are situations in which the infectious respiratory disease is most
likely transmitted; do Dorm Chief or Element Leaders most commonly
transmit to individuals within their dorms or elements? This will
direct the EOS clinical team on who constitutes the best case
definition for "significant exposure" and, thus, which BMTs would
be best to draw for gene expression studies in the "exposed" group.
This group will be followed for subsequent development of disease
and blood will be drawn if these individuals present with fever and
respiratory symptoms.
[0261] Next the present inventors describe the present invention in
terms of GXP Protocols and Data handling
Description of Transcriptome/mRNA Measurement Techniques:
[0262] There are several techniques to quantitatively measure mRNA
at various level of throughput. Some of them are Northern blot,
RT-PCR, Nuclease protection assay, Quantigene, SAGE, differential
display, in situ hybridization, nanoarrays and microarrays. Some of
these are not readily adapted for high throughput or can measure at
the transcriptome level. For our purposes of surveillance and
biomarker discovery, microarray based techniques are most amendable
for these purposes. Once biomarkers are discovered, techniques that
have short processing time, but less parallel processing capability
may be more useful for diagnostic purposes, such as RT-PCR or
Quantigene. Techniques to measure mRNA generally involves sample
preparation, mRNA amplification and labeling if needed, followed by
hybridization, then washing; staining, and/or detection of signals.
There are variations to all these major steps. Sample preparation
may be extensive such as for the Affymetrix genechip platform or
minimal such as the Quantigene system from Genospectra. Ideally,
for our purpose, we want to measure the most number of transcripts
in the shortest time and the highest sensitivity and specificity.
Although we have used the Genechip technology to discover
biomarkers and pathways, there are many possible improvements on
the current Affymetrix technology or other technologies that one
can think of or already available to assess in the field (several
of which are discussed herein and form a part of the present
invention).
Improvements Over Standard Microarray Techniques:
[0263] For the platform that the present inventors have tested, the
Affymetrix genechip platforms, recent improvements include reducing
the amount of initial RNA needed, shortened time of processing, or
robotics to facilitate high throughput and reduce operator
variability. Several options are available on the market to
incorporate into the sample processing step of the Genechip
platform. One is the new IVT kit from Affymetrix that can use 1
.mu.g starting amount of total RNA versus 5 .mu.g previously.
Another is the double cycle IVT from Affymetrix that can start with
10 ng total RNA, however, the processing time and complexity of the
assayed is increased. The Ovation kit can also amplify and label
RNA starting with as low as 5 ng, and they claim the time is in 4
hours. However, it has not been extensively tested with the
Genechip microarray. A recent publication also attempted to label
the mRNA directly without amplification to shorten processing time,
but the sensitivity was reduced.
[0264] There are many areas of improvements at various steps in the
processing that the present inventors contemplate in the present
invention. One is to combine and develop various steps in the
surveillance process. For sample collection, instead of Paxgene,
one could use microcapillary tubes to collect blood, then stabilize
with RNAstat, then isolate RNA via several available kits for RNA
isolation from small volumes of blood, such as the Dynabeads.RTM.
mRNA DIRECT.TM. Kit that can isolate mRNA using only 1 tube in 15
min, then use the Ovation kit to amplify and label, followed by
hybridization onto Genechip and wash and stain the next day. In
addition, the hybridization time may be reduced from it current
time of 16 hrs on the Genechip to a time ranging from 8-14 hours,
preferably 10-12 hours, or even shorter times. To further reduce
the hybridization time, the present invention contemplates applying
a strong electric/magnetic field to the chip during hybridization.
Also to reduce hybridization time, the hybridizing temperature may
be increased and then ramp down to 45.degree. C., the current
temperature for hybridization.
[0265] To improve sensitivity, the skilled artisan may employ
alternative signal emitters. Currently, the signal emitter is the
strepavidin-phycoerythrin followed by further amplification with
biotinylated anti-strepavidin. However, the present invention
contemplates the use of the branch DNA from Genospectra to amplify
signal, quantum dots followed by multiple scans as the quantum dots
do not quench, alexi dyes, or biotin labeled viruses which greatly
increase signals because of reduced quenching, higher quantum
yields and up to 120 biotin molecule per virus, or RLS particles.
Even further, the present invention contemplates the use of probes
that are synthesized onto a conductive material, thereby it is
possible to detect via electrical signals upon duplex formation,
and then one can detect signals right away. In even a further
embodiment, another mRNA measurement technology may be employed
altogether, especially a nanoarray developed to measure mRNA from
single cells.
Data Acquisition:
[0266] In the present invention data acquisition is performed using
scanner (genechip) and computer.
Data Handling and Analysis:
[0267] Data acquisition and handling may be performed by any means
known by the skilled artisan. For example, data acquisition and
handling may be performed by hand and passing through various
programs. The present inventors are in the process of developing
software to perform all necessary data analysis automatically and
provide results.
Algorithms for Metadata and Microarray Parsing, Grouping, etc.:
[0268] Pseudocode: Genes are ranked by likelihood to discriminate
[0269] Binary vs. multi-characteristic classifiers. Binary
classifiers form binary trees to classify clinical phenotypes into
groups. Each node of the binary tree is determined by the minimal
percent misclassification. The result is that at the tip of each
tree should be each group of phenotypes; although some phenotypes
may not always be able to be segregated because of lack of
classifiers discovered. A multi-characteristic classifier
immediately sorts out the phenotypes instead of dividing through a
tree. Both methods are currently methods of research. The present
inventors' results so far suggest that for a mixture of phenotypes
with large and small optimal classifiers, the binary method may
make more sense. For instance for distinguishing the healthy and
sick, one can obtained a relatively large number of genes in the
classifier, whereas for distinguishing sick with adenovirus and
sick without adenovirus, only a relatively small number of genes in
the classifier may be found. The present inventors' example
analysis of the gxp class prediction is basically a binary analysis
with comparisons between nonfebriles vs. febriles, then healthy vs.
convalescents, then febriles with adenovirus vs. without. This is
basically a manual version of binary class prediction. A
multi-characteristic classifier would classify healthy,
convalescent, febriles with, and febriles without adenovirus all at
once, without going through binary nodes. The current ArrayTools
software can only implement binary tree classification with equal
univariate alpha parameters for all tree nodes resulting in large
classifiers for the first node, and smaller ones for subsequent
nodes for our gxp data. One possible future method is to allow for
different univariate alphas at each node to equalize the size of
the classifiers for each node. Binary tree methods are also very
computationally intensive, especially for finding p-values of
misclassification rate. One needs to perform further in silicon
experiments to find the best algorithm for class prediction
especially where the dynamic range of differences among classes
vary greatly, as in our case. For binary classification, one can
also consider different information from outside
non-gene-expression assays to include at each node in deciding
which branch the case shall be classified. Based on our current gxp
results described herein, the data could be classified into the
four groups with less than 50 genes at each binary node at a
certain percent accuracy at a certain probability of certainty.
[0270] Full Analysis of gene expression data: For analysis of the
GXP results from the N=30 study, first, normalization of complete
cell count data, electropherogram data, and gene-expression data
was carried out after considering various methods. Then, data
quality was assessed via individual control charts to determine
measurement process stability, outliers, and comparisons to
standards suggested by Affymetrix or from other laboratories. This
quality control results in a set of reliable samples for analysis.
Then RNA quality from pax tubes is assessed via overlaying graph of
electropherograms and RNA quality metrics. And the relationship
between RNA quality variability and microarray variability is
determined. Once quality and reliability is established, then
filtering parameters are set to reduce number of variables. Then,
class prediction analysis using supervised methods was performed
and optimized to determine sets of genes that could classify
clinical phenotypes at a certain percent accuracy with a certain
reliability using permutation tests. Potential confounders for
clinical phenotypes are also assessed to assure that the classifier
genes are most likely due to clinical phenotypes rather than
confounders. Then, class comparisons analysis is carried out to
determine genes that show differences between clinical phenotypes.
Finally, functional analysis is carried out to determine pathways
involved in disease phenotypes. Many more analysis can to
performed, such as gene ontology comparisons, promoter analysis,
genome distribution, variation of immune responses in the
population, modeling of differential gene expression while
controlling for cell count heterogeneity, and comparisons with
public microarray databases, and cross platform analysis, discover
functions of genes with unknown functions. [0271] Diagnostic
Capability: This is assessed by determining sensitivity,
specificity, positive predictive values, negative predictive values
of the assay. Some of the sensitivity and specificity of the class
prediction for the gxp study has been calculated as described
herein. Overall, the goal is to optimize the ROC curve of class
prediction results, which is analogous to minimizing the
misclassification rate. Negative and positive predicted values can
be calculated once the prevalence of a disease is known. Improving
assaying time, sensitivity, reliability, and automation of the
assay and analysis would further facilitate diagnostic capability.
To this end, once ethical issues are resolved, the human implanted
chips to connect a patient to medical histories would aid in
automated analysis and prediction of disease outcomes. The utility
of gene-expression data for many diseases also greatly enhances
diagnostic capability. Linkage to genomic variations would also
provide much medical prognosis of patient. Also advancement of
gene-expression technologies to nano scaled microarrays should
greatly enhance diagnostic potential. For the gxp study exemplified
herein, the diagnostic classifiers will be validated with a larger
prediction set; however, even with the data set supporting the
examples of the present invention, this can be assessed. For the
minimal classifiers of healthy versus fever, the prediction set was
100% accurate regardless of processing differences from the
training set. But processing differences in measuring gene
expression has a greater effect on classes with less different
phenotypes, such as among the sick alone. Further analysis study
into the effect of the number of genes in classifiers on class
prediction results of the prediction will be assessed. Future
prospective studies will more assuredly assess the diagnostic
capability of the classifiers we have found and began to validate
in the gxp study.
GXP for Prognostic Ability
[0271] [0272] Experimental protocol [0273] Baseline patient and
track through disease onset In order to determine the prognostic
capability of gene expression for prediction of disease timing,
severity and response to treatment, one must have a cohort that can
be followed from healthy status through infectious exposure to
disease/symptom onset. The Lackland BMT population is unique in
that this population has ongoing, significant endemic rates of
upper respiratory disease with frequent epidemic rates. This
enables studies to determine gene expression markers in
pre-symptomatic individuals. An index case with a specific febrile
respiratory disease will be identified and those BMTs significantly
exposed will be assayed for gene expression to determine the
immunologic signature that predicts later development of disease.
BMTs with disease will be followed to assess severity of disease
and relationship to gene expression. [0274] Challenge with
biologically hostile environment BMTs who are naturally exposed and
infected with a biological agent, such as adenovirus, will be
assayed for gene expression. This group may or may not subsequently
develop disease and the comparison of gene expression profiles will
be made between the groups. [0275] Opportunity to track genes as
function of time and disorder [0276] Prognosis relating to a)
propensity to become ill, b) timeline to onset of disorder, c)
efficacy of treatment regimen, d) recovery, etc.
Ability to Validate Diagnostic and Prognostic Methods and
Classifiers
[0276] [0277] rationale and methodology [0278] To validate
diagnostic and prognostic methods and classifiers. First the
present inventors performed an experiment to discover classifiers
for certain diseases and/or phenotypes. Then, the percent correct
classification is optimized by varying various methods and
parameters. These classifiers are validated at this stage via leave
a subset of samples out cross validation methods. Also, the
reliability of the optimal percent correct classification using the
discovered classifiers is assessed via the permutation test. Once
the optimal classifier and algorithm is found and validated with
the training set, then additional samples are collected and measure
to form the prediction set. The optimal classifier and algorithm is
used to classify cases in the prediction set to further validate
the classifiers because the prediction set is completely
independent of the training set which was used to discover the
classifier genes and to validate them statistically. Additionally,
the classifiers are further validated using different assaying
methodologies, such as RT-PCR, to further confirm that the
classifier gene set is biologically significant and not simply
assaying mythology specific. Then the classifiers are tested
further in a larger sample of the population for which the assay is
intended to be used. [0279] The present method permits detection of
independent gene signatures for virtually any microorganisms.
Notable examples include: [0280] Influenza: Influenza A and B
immunologic markers will be determined to both naturally-occurring
disease as well as vaccine induced immunity (both intramuscular and
intranasal vaccination). [0281] Streptococcus Pyogenes: Ongoing
studies are assessing the gene expression biomarkers for S.
pyogenes in the BMT and clinic population. [0282] Ad4: Currently we
have identified gene expression biomarkers distinguishing febrile
adenovirus positive patients from adenovirus negative patients.
[0283] Additional microbial infections include those caused by
Adenovirus species, N. meningitides, Influenza A and B, Bordetella
pertussis, Parainfluenza MIMI, S. pneumoniae, Rhinovirus, C.
pneumoniae, RSV, S. pyogenes, West Nile Virus, B. anthracis,
Coronavirus, Variola major, Ebola virus, Lassa virus, F.
tularensis, Y. pestis [0284] Combinations of disorders [0285]
Additionally, gene-expression of the host indicates functional
bioactivity of a subset of agents among a set of agents challenging
the body. Thus, results from host gene expression should synergized
with results from other assays that measure only pathogen genomes,
such as PCR, RPM, or chembioagent antigens, such as immunoassays.
Because of current highly parallel usage of these assays, often one
gets multiple results, such as indication of multiple infection in
the presence of asymtopmatic infection, where it is not clear which
agent is the causative agent. Gene-expression profiles may provide
information to sort this out. Also, for multiple etiologic agents
inducing similar diseases, the results from gene-expression
profiles may be analyzed for common nodal pathways with high
connectivity, which then can be targeted as treatments intervention
via therapeutics such as drugs. This would also suggest usage of
therapeutics that is known to target a pathway for a particular
disease to other diseases that activate the same pathway.
[0286] The present invention also offers the practitioner and
clinician an ability to monitor and/or validate expression profiles
identified by other assays. For example, the Griffiths et al (71)
report biomarkers for malaria determined by monitoring host gene
expression in whole blood from patients suffering from acute
malaria or other febrile illnesses. Cobb et al (72) report the
effect of traumatic injury upon the gene expression profile of
blood leukocytes. While Rubins et al (73) report the gene
expression profile determined for primates suffering from smallpox.
The methods of the present invention can be used to assess the
accuracy and reliability of the biomarkers identified in these, and
similar, and to determine whether these biomarkers can be utilized
to trace disease progression.
Exploiting Prior Acquired Knowledge (Bayesian Priors)
[0287] recognition of signature (host response chip) [0288] In this
method, the present invention may be combined with other diagnosis
methods (i.e., RPM, standard blood test, immunoassay, etc.) to
enhance accuracy of diagnosis. Diagnosing the health status of an
individual and prognosing their course of disease usually require
several assays ranging from assessment of signs and symptoms to
laboratory diagnostic tests. Each assaying provides a pretest
probability of positive and negative predictive values for the next
assay. Bayesian statistical theory takes into account this pre-test
probability (whether subjectively determined or via an assay) to
determine the predictive values of the subsequent test, which
should provide more accurate information to help the clinician in
discerning course of action. An example of this is the present
inventors' analysis of class prediction based on the Complete Blood
cell count (CBC) and then the electropherogram data, and then the
gene expression data. Although these different assays are not what
the clinician normally use for class prediction of disease, the
statistical analysis illustrates that the gene-expression profiles
provided the highest amount of accuracy for prediction of infection
status. If binary class prediction algorithms are considered, than
for each node in the binary tree, one might consider diagnostic and
prognostic probabilities from other established assays in addition
to the gene-expression biomarker assays which likely will provide
the most information for better diagnosis and prognosis. Questions
and hypotheses that may be explored with the database approach
developed by the present invention
[0289] In addition to determining the gene expression profiles in
response to pathogen exposure, there are many more questions and
hypotheses that could be explored with the database developed by
the present inventors. Some of these questions are listed below:
[0290] 1) Can one find classifiers for clinical subtypes, such as
those who are febrile and negative for adenovirus by culture, put
positive by PCR? There are some discordances between infection
status as determined by assay type, such as culturing, PCR, or
pathogen microarray. Can one use gene-expression data to classify
these discordances? [0291] 2) What are the concordance,
sensitivity, and specificity relationships between these culture,
PCR, and gene-expression classification? [0292] 3) Is there a
circadian rhythm relationship between time of PAX tube collection
and certain genes in the expression profiles? Gene expression
profiles that correlate with time of day should relate to circadian
rhythm functions [0293] 4) Do lot numbers affect anything? [0294]
5) How do different statistical models to determine transcripts
abundance compare to current results? There are multiple models for
determining the quantity of transcripts based on amount of light
emitted from each cell for each probe. Some of these are Mas4
algorithm, MAS 5 algorithm, and multi-chip models: RMA, dChip,
flier, and mix models. The GXP results herein suggest that one
cannot use the multi-chip models because those models usually
assumes relatively small changes in gene expression profiles
between experimental groups, which is definitely not the case in
surveillance studies of multiple disease states. [0295] 6) How will
different normalization algorithms compare to current results?
There are many normalization methods: median scaling, trimmean
scaling, quantile, splines, and others. Generally, we cannot use
any normalization method that assumes that the distribution of the
gene expression profiles is generally the same for groups such as
healthy vs. sick. Thus the present inventors have found from the
current study, that spiking in polyA RNA would be most logical for
normalization for quantitative comparisons among samples. [0296] 7)
How will we reduce the dimension of the data? (Principle Component
Analysis, Singular Value Decomposition, robust Singular Value
Decomposition?) This analysis will give an idea of how many
independent components explain the majority of variation in the
gene expression data. [0297] 8) What is the variation structure of
the data and which of the metadata variables contribute most to the
variation? Which contribute least? [0298] 9) Which of the component
of the variation structure of the data classify certain metadata
variables most accurately? [0299] 10) What is the latest in gene
expression analysis from the literature? Can we use any of these
new methods and/or software? [0300] 11) Are there subgroups in the
adenovirus negative sick population? The adenovirus negative sick
population can be due to multiple agents. Can evidence for this be
found in the data set obtained by the present inventive methods?
[0301] 12) What is the difference between poly A and total RNA
samples? [0302] 14) What are the functions of the genes found to be
involved in classifying the different phenotypes? [0303] 15) For
the normal group especially, what is the variation of
gene-expression for genes that are biologically equal in expression
in the cohort? What genes show more variation among individuals
than background variation? [0304] 16) Is there more than normal
variation in immune related genes in the cohort? How many types of
immune responses are there to virus infection? Is there a Th1
versus Th2 response? [0305] 17) Do genes that show high variation
in expression correlate with variations in DNA sequences? [0306]
18) Is there a clustering of gene locations on the chromosomes for
genes that differ among phenotypes? [0307] 19) Is there a high
occurrence of certain promoter sequences for the genes that
changed? [0308] 20) Further investigation of the pathways
adenovirus infection and fever? What does this imply about the
biological mechanism of adenovirus infection and fever in humans?
[0309] 21) Can we confirm differences in these genes with RT-PCR?
What is the percentage of concordance? [0310] 22) How do the genes
that we found relevant in our study compare with published in vitro
study of adenovirus infection? Other virus infection? Other
phenotypes such as Smoking exposure? [0311] 23) Use genes that are
cell type specific to decipher whether our gene list is associated
with certain cell type differences [0312] 24) Can we do cross
platform and/or lab analysis? [0313] 25) How do the different
published methods for low level analysis, unsupervised and
supervised clustering, and others compare with our data as oppose
to cancer data? [0314] 26) Can we come up with better models?
[0315] 27) Can one come up with a statistical model determine
differential gene expression at the per cell level for groups with
differing CBC? [0316] 28) What are the genes correlating with other
quantitative traits recorded? Such as time of last meal, exercise,
etc. These genes may be able to be used for determining the
activity of a person at some previous time at a certain probability
to level. [0317] 29) Once pathways involved in fever arc
determined, one maybe able to find genes involved with less
variability across the population than others. This may imply that
these genes should be targets of drug development with effects that
would be more efficacious for the population. Whereas pathways with
genes that show high variation across the population imply these
genes may not be good targets for drugs intended for the general
population.
Application to Normal Gene Expression Measurement
[0318] The present invention will certainly find application in the
measurement of "baseline" (i.e. normal) gene expression signature
measurement. This would have great value in defining the
establishment of baseline gene expression profiles across defined
demographic populations. Such baseline measurements would have high
value in discovery of fundamental differences between sexes, races,
and the development and ageing processes. The value of such
population gene expression profiling is illustrated in the
phenomena such as Gulf War Illness following putative exposures to
chemical weapons and environmental toxins wherein a variety of
immune disorders were reported (53, 54) without the identification
of a specific etiology. In response to Gulf War Illness, the
Department of Defense initiated a broad baseline study known as the
Millennium Cohort that has collected general health questionnaires
from hundreds of thousands of active duty military personnel in
hopes of establishing "baseline" indices of normal health. In
contrast, baseline gene expression for 10.sup.5 to 10.sup.6
specific 25-mer transcriptional sequences would provide orders of
magnitude greater information regarding the possible genomic and
physiological etiologies of phenotypic or asymptomatic illnesses
caused by external perturbations.
Application to Diagnosis Other Blood Disorders and Disease
[0319] The present invention may also be used for diagnoses of:
oncology diseases including: CML (bcr/abl0) (30), circulating tumor
cell detection, colorectal cancer recurrence, neurology (MS),
hemostatus and thrombosis, inflammatory disease (48 inflammatory
genes for Rheumatoid Arthritis from Source Precision Medicine),
diabetes, respiratory disease, and cytotoxicity and toxicology.
(55). Generally, the present invention may find utility in any
diseases or physiological states that have mRNA biomarkers from
blood can use similar methods described herein.
Pre-Symptomatic Prognosis and Assessment of Disease Risk
[0320] Although it has been speculated that gene expression
profiles could be diagnostic for asymptomatic disease diagnosis and
prognosis, the practical reduction of that concept to practice has
proven quite elusive. At least one prior study has shown that
peripheral blood leukocytes obtained using PAXgene kits has yielded
evidence of the utility of obtaining cDNA microarray baseline (i.e.
healthy) expression signatures (Whitney et al 2003) (18). Other
studies and prior art have shown time exposure of a known dosage of
an infectious agent can lead to detectable signatures.
[0321] However, it has been exceptionally difficult, if not
impossible to obtain experimental cohorts that allow simultaneous
measurement of gene expression profiles in a homogeneous, isolated
and experimentally accessible human population that contains
statistically significant numbers of the following categories: (1)
healthy baseline individuals in the identical physical environment
as those who will be infected with a pathogen, (2) individuals who
do not have an acquired immunity against a pathogen but encounter a
low level of pathogen exposure to that pathogen, or have a high
innate immunity, and exhibit distinguishable "successful" immune
responses against the pathogen and do not become symptomatic for
illness, (3) individuals who become ill following actual pathogen
exposure and manifest symptoms without becoming febrile, (4)
individuals who are exposed to the pathogen and develop illness
with symptoms satisfying criteria for "febrile respiratory ill"
(FRI) but who do not become so ill as to require hospitalization,
(5) same as 4 except that severe illness develops and the
individual meets medical criteria for hospitalization, and (6)
individuals in various stages of recovery from categories 3-5.
[0322] While individuals are incubating an infectious agent and
before the onset of symptoms, the innate immune system begins to
mount a rudimentary response followed by a more effective specific
immune response. During these phases, immune cells manufacture
various cytokines and chemokines to mount an effective response.
These biomarkers of the immune response provide an immunologic
signature that may precede clinical symptoms.
[0323] Thus, there is a critical need to develop methods for
discovery of unique gene expression patterns for various time
points within the above mentioned classes, and the present
invention successfully demonstrates those methods.
Preferred Uses of Pre-Symptomatic Assays Based on Gene Expression
Profiles
[0324] Assays for pre-symptomatic diagnosis and prognosis of
infectious disease would find utility in a variety of applications
where the information is of sufficient quality to provide
decision-quality information. For example, individuals who are at
risk to themselves, to others, or to the completion of an important
task as a result of probable or imminent illness can be temporarily
replaced until the impending illness is managed. Examples would
include pilots (commercial or military) prior to long-range
flights, surgeons, etc.
[0325] Another use would be in the mitigation of an act of
bioterrorism or industrial accident where hundreds, thousands, or
even millions of individuals would be exposed to varying degrees of
a toxic or infectious agent. Data obtained following the 2001
anthrax attacks in Washington, D.C. and New York, N.Y. indicated
that for every 1 person who obtained a sufficient exposure to
anthrax cause illness and death, there were another 1,500 "worried
well" persons who were candidates for prophylactic administration
of antibiotics. This number could have been orders of magnitude
higher if the agent had been infectious (e.g. smallpox virus)
instead of anthrax. If the remedial action, such as the
administration of a high dosage of vaccine, antibiotic, or drug
carries an associated risk (e.g. highly adverse reaction in 1 out
of every 250 persons) then the remedial action could be of greater
threat to public health than the initial attack or accident without
the appropriate assessment of risk within an exposed population.
Alternatively, the vaccine, antibiotic, or drug may be in short
supply and a triaging of exposed individuals would be highly
desirable to make maximal use of available quantities. Thus, a set
of pre-symptomatic indicators could be of critical importance in
the appropriate application of countermeasures in the
above-mentioned situations.
Alternative Methods and Platforms for Detection of Transcriptional
Markers
[0326] In the above-mentioned applications, it will be necessary to
measure specific sets of transcriptional markers in a more rapid
and cost-effective manner than that using a DNA microarray. Thus,
the high density DNA microarray is a high-content discovery tool
that teaches the distillation of the most meaningful
transcriptional markers. Although, recent advances, such as
shortening time of sample and target preparation with small initial
amounts of RNA may allow the high density DNA microarray to be a
direct diagnostic platform instead of simply being a biomarker
discovery platform. Other platforms for highly parallel
measurements of gene expression include SAGE and MPSS (56), but
these methods are technically challenging. MPSS can provide the
exact number of an RNA molecule per cell, even the ones at very low
levels. Thus, MPSS might be used to confirm results from
microarrays.
Definition of Subsequences within "Genes"
[0327] The first step in the reduction to an alternative platform
involves a statistical reduction of the number of specific
transcriptional markers that are required to still make a high
percentage of classifications with an acceptable probability of
error. Unlike discoveries of "gene expression" using microarrays
prepared using cDNA molecules (several hundred base pairs of double
stranded DNA) or even long oligonucleotides (e.g. single-stranded
70-mers), the Affymetrix gene expression microarrays probe all
known genes with a combination of at least ten 25-mer probe pairs
across the wherein one of the pair members is a perfect sequence
match to the predicted gene sequence and the other is a mismatch,
comprised of the same sequence as the its partner except for the
middle (number 13 position) nucleotide. Complementary binding
between a 25-mer probe and its target transcriptional marker is
severely attenuated by even a single mismatch (unlike long
oligonucleotide and cDNA probes). Hence, it is critical to
recognize that only small oligonucleotide probes provide probe-wise
interrogation of the highly heterogeneous transcriptome, the
content of which varies with not only gene activation and
deactivation but also with alternative exon splice variation,
depending on exact physiological conditions.
[0328] Although the GCOS software makes "present" or "absent" calls
for a known or predicted full length gene sequence based on an
algorithm which considers the probe pair intensity profiles across
the three prime end of the gene sequences, the result can be
de-convoluted into individual probe pair intensities. The intensity
values that are available for each probe set within each known gene
sequence are relatively high confidence sequence identifications
that are independent of whether that 25-mer transcriptional
sequence has been spliced into different resultant mRNAs. A cDNA
probe for a full length gene product would be entirely incapable of
making such a discrimination, and the 70-mer probe array should
show intermediate level of sequence determination, but would
require higher hybridization stringency. Moreover, the error rate
in a transcriptional sequence determined from the long
oligonucleotide 70-mer would be intermediate to high
inaccuracies.
Reduction of Subsequence Content
[0329] In a manner similar to that described in the present
invention for reducing the number of full sequence genes required
to make classifications, the number of subsequences within the full
length gene sequences may also be selected for use in
classification, irrespective of whether the Affymetrix GCOS
software identified the full length "gene" as being "present" or
"absent". In this manner, the classification problem will be
reduced to a set of defined 25-mer subsequences having
experimentally-verified abundance variations instead of full-length
gene sequences which will be comprised of subsequences might or
might not actually be present or change in abundance.
Alternative Assay Design
[0330] The Affymetrix GeneChip.RTM. platform provides an excellent
format for the discovery genome-wide expression changes in
research, and possibly for clinical diagnostics in situations that
allows one or more days for a result (e.g. tumor prognosis).
However, many applications, including infectious diagnostics, will
be more critically time-dependent. Ideally, these assays will be
performed in several hours.
[0331] In several very preferable embodiments, the information
gleaned from whole genome GeneChip.RTM. experiments will be used
produce a greatly reduced set of markers that can be measured
rapidly in an alternative format that is optimized for both speed
and simplicity. In one very preferable embodiment, a reduced set of
gene expression markers is analyzed by reverse transcription PCR
(RT/PCR) without requiring isolation of total RNA. An example of
this can be found with the Ambion (Austin, Tex.)
"Cells-to-Signal.TM." Kit, which allows RT/PCR amplification
directly from cell lysates following a 5 minute incubation with the
reagent, bypassing the need for mRNA isolation. Such a technique
might be applied to whole blood lysates or to lysates of specific
cell types that are separated from whole blood by any of a number
of methods, including centrifugation, fluorescence-activated cell
sorting (FACS), or by other flow cytometry techniques, such as with
the use of the Agilent Bioanalyzer 2100 or the like.
[0332] The cDNA products from the preparations described above can
be analyzed directly in small numbers using real-time PCR
techniques (e.g. TaqMan, or Fluorescence Energy Transfer (FRET)
techniques, molecular beacons, etc.) or in larger numbers using DNA
microarrays having a much smaller probe content than the whole
genome Affymetrix GeneChips in a system that is optimized for speed
and simplicity (57). The microarrays used for this purpose could be
selected from a large number of options described in a previous
overview (58).
[0333] In a highly preferred embodiment, the volume of blood
required to perform an assay of the type described above would be
greatly reduced relative to that required for the experiments
described in the present invention.
[0334] There are two small aliquot techniques available on the
market currently. Both can amplify from nanograms amount of RNA to
microgram amounts. One is from Affymetrix which supports its
two-cycle amplification protocol. This protocol basically doubles
the in vitro transcription step to obtain more cRNA products. Of
course, this would also increase the workload and the time
considerably. A new protocol for amplifying nanograms of RNA in a
relative short time is available from Ovation.TM.. Although this
technique has not been extensively tested on the Affymetrix system,
it holds much promise and is contemplated by the present invention.
By these techniques only a few drops of blood is needed to isolate
nanograms of RNA. Additional methods may be developed to collect
drops of blood and RNA stabilization. One such possibility is to
use RNAstat to stabilize the blood and for transportation and
storage; followed by RNA isolation when needed.
[0335] Alternatively, the information obtained from whole genome
GeneChip.RTM. experiments could be used produce assays that probe
for the polypeptides that are coded for by the transcriptional
markers detected by the GeneChip.RTM. whole genome assay. These
polypeptides could be detected in blood or from cell lysates using
microarrays comprised of antibodies (59) instead of DNA probes or
by mass spectrometry methods that measure relative protein
abundances.
As Part of an Overall Business Model
[0336] However, it is a central hypothesis of the Epidemic Outbreak
Surveillance (EOS) program and the present invention that the only
economical method to realistically widely deploy a parallel
pathogen surveillance assay in a clinical environment is to do so
in parallel with assays that have validity in their own right for
routine clinical diagnosis of common pathogens. That is, unlike a
reimbursable diagnostic assay for a common pathogen, an
un-reimbursable assay for bioweapons surveillance will only burden
a clinical operation and will not be widely adopted. Because it may
not always be possible to identify the specific cause of an
infection through pathogen genomic markers (e.g. using PCR or
microarrays), there remains a critical need to determine
alternative "biomarkers` from the host that would elucidate the
character of the disease etiology and guide the clinician in the
proper management of the infection. Gene expression monitoring is
thought of as a potentially revolutionary technology that could
provide hundreds if not thousands of such "biomarkers". However, in
order for gene expression-based bio-defense assays to move beyond
scientific curiosity and into the realm of clinical diagnostics, a
significant work must be carried out to demonstrate that the
principle is applicable to routine clinical diagnostics. Hence,
there is a critical need to develop databases of baseline (normal)
human gene expression levels and to understand the nature of
perturbations caused by various levels and stages of pathogen
infection.
[0337] The above written description of the invention provides a
manner and process of making and using it such that any person
skilled in this art is enabled to make and use the same, this
enablement being provided in particular for the subject matter of
the appended claims.
[0338] As used above, the phrases "selected from the group
consisting of," "chosen from," and the like include mixtures of the
specified materials.
[0339] Where a numerical limit or range is stated herein, the
endpoints are included. Also, all values and subranges within a
numerical limit or range are specifically included as if explicitly
written out.
[0340] The above description is presented to enable a person
skilled in the art to make and use the invention, and is provided
in the context of a particular application and its requirements.
Various modifications to the preferred embodiments will be readily
apparent to those skilled in the art, and the generic principles
defined herein may be applied to other embodiments and applications
without departing from the spirit and scope of the invention. Thus,
this invention is not intended to be limited to the embodiments
shown, but is to be accorded the widest scope consistent with the
principles and features disclosed herein.
[0341] Having generally described this invention, a further
understanding can be obtained by reference to certain specific
examples, which are provided herein for purposes of illustration
only, and are not intended to be limiting unless otherwise
specified.
EXAMPLES
Overview
[0342] Informed consented Basic Military Trainees (BMTs) generously
donated blood and/or nasal washes. Blood collection and RNA
isolation was performed using the Paxgene Blood RNA System
(PreAnalytiX), which consists of an evacuated tube (PAX tube) for
blood collection and a processing kit (PAX kit) for isolation of
total RNA from whole blood (35). The isolated RNA was amplified,
labeled, and interrogated on HG-U133A (A) and HG-U133B (B)
Genechips from Affymetrix. The Affymetrix GeneChip platform
measures a significant subset of the transcriptome. In design, it
incorporates a DNA oligonucleotide microarray, manufactured via
photolithography to detect labeled cRNA targets amplified from RNA
populations. Nasal washes were aliquot and sent for determination
of adenovirus infection via culture and real-time PCR.
Example 1
Sample Collection
[0343] Lackland Air Force Base (LAFB) in San Antonio, Tex. is the
location of Basic Military Training for all recruits to the United
States Air Force. More than 50,000 Basic Military Trainees (BMTs)
undergo a 6 week training course prior to assignment of duty. These
BMTs are organized into flights of 50-60 individuals that eat,
sleep and train in close quarters. Each flight is paired with a
brother or sister flight with which there is increased contact due
to co-localization for scheduled activities and multiple flights
are grouped into squadrons which reside in the same dormitory
building, subdivided into dorms for individual flights.
[0344] BMTs arriving to LAFB underwent informed consent to
participate in this study. On day 1-3 of training, approximately 15
milliliters of blood were drawn from each BMT into a total of 5
Paxgene tubes, per standard protocol, to establish baseline gene
expression profiles. BMTs who presented during training with a
temperature of 100.5 or greater and respiratory symptoms were
consented for a nasal wash and Paxgene blood draw. All Paxgene
tubes were maintained at room temperature for 2 hours and then were
frozen at -20 C and shipped on dry ice to the Naval Research
Laboratory (NRL) within 7 days for processing. Nasal washes were
performed by standard protocol using 5 cc of normal saline to
lavage the nasopharynx with collection of the eluent in a sterile
container. Nasal wash eluent was stored at 4.degree. C. for 1-24
hours before being aliquoted and stored at -20.degree. C. and
shipped to NRL within 7 days for processing.
[0345] All BMTs underwent a standardized questionnaire at initial
presentation, during presentation with illness, and at follow-up.
Questions posed to BMTs include: vaccination history, allergies,
last meal, last exercise, last injury, medication taken, smoking
history, observed subjective symptoms, and last menstruation (if
appropriate). Among the observed subjective symptoms asked and
monitored are: sore throat, sinus congestion, cough (productive or
non-productive), fever, chills, nausea, vomiting, diarrhea,
malaise, body aches, runny nose, headache, pain w/deep breath, and
rash. All data was stored in electronic format using personal
identification numbers.
[0346] The present inventors sought to determine the gene
expression patterns that developed in Basic Military Trainees (BMT)
populations as they were naturally exposed to respiratory pathogens
and subsequently developed disease during their 6 week training
period. Up to 50% of BMTs experience upper respiratory tract
infection (URI) during training and 40% of these will have fever
and URI symptoms. Approximately 60-80% of febrile respiratory
disease is due to adenovirus type 4. Other pathogens that cause a
significant minority of disease include Streptococcus pyogenes,
Chlamydia pneumoniae, Mycoplasma pneumoniae, and Bordetella
pertussis.
[0347] BMTs maintain set schedules throughout the 6 week training
program and are kept in close proximity; the BMT population offers
a unique opportunity to evaluate gene expression profiles resulting
from pathogen exposure and/or infection in the absence of
confounding external/environmental factors.
[0348] In the first 18 months of the EOS program, a Lackland and
Air Force Surgeon General Institutional Review Board (IRB)-approved
protocol was implemented. This protocol continues to be supported
by the Lackland 37.sup.th Training Wing Commander and the Base
Commander. The present inventors implemented an experimental model
for comparing whole blood expression profiles from four categories
of BMTs:
[0349] 1. Healthy (baseline),
[0350] 2. Febrile Respiratory Illness (FRI) adenovirus 4 infected
(Ad4+),
[0351] 3. FRI without adenovirus (Ad4-), and
[0352] 4. post-FRI Ad4+ (individuals recovered from adenoviral
infection, i.e. #2 above).
[0353] Individuals were identified as healthy if they were in week
0 of basic training and had no respiratory symptoms in the prior 4
weeks. Individuals with FRI were identified by primary providers
and study nurses as the BMTs presented to health clinics and
dispensaries. All BMTs were consented and underwent blood draw to
determine gene expression profiles. All ill BMTs were administered
a standardized questionnaire to determine the type of presenting
symptoms and the onset and duration of symptoms. Physical
examination and complete blood counts were recorded. BMTs who were
determined to have an adenoviral illness by rapid
immunoassay/PCR/culture underwent a subsequent blood draw and nasal
wash 14-21 days after their initial FRI presentation; the majority
of these individuals had no further symptoms of infection at the
time of the follow-up blood draw. PCR for adenovirus and culture
for all respiratory viruses was performed on nasal washes. One
hundred BMTs were entered on the study, including 30 healthy BMTs.
Whole blood gene expression profiling for 33,000 known genes and
open reading frames (ORFs) was performed on PAXgene blood RNA
samples using Affymetrix U133A/B chip sets. Data from 76 BMTs is
available with the following breakdown: healthy (n=38), febrile
without adenovirus infection (n=14), febrile with adenovirus
infection as determined by culture (n=24), and those who recovered
from adenovirus associated febrile illness (n=26). Initial search
for genes that show expression level differences of >=1.5
fold-change of the lower 90% confidence interval between groups
showed that: 913 genes differ between healthy and febriles at 0.1%
median false discovery rate (FDR); 203 genes differ between healthy
and recovered at 2.0% FDR. Ongoing recruitment with the addition of
a screening rapid assay for adenovirus has enabled increased
enrollment of FRI Ad4- BMTs and will enable statistical analysis
between the FRI Ad4+ and Ad4- groups.
Example 2
Sample Preparation
Materials and Methods
[0354] PAX tube blood collection. Blood was collected into the PAX
tubes from volunteers according to the manufacturer's directions
(60). For the experiment described in FIG. 1, twelve PAX tubes were
collected from one person. Then, the tubes were split into two
groups of six for the two conditions. Subsequently, RNA from pairs
of tubes had to be pooled to obtain enough RNA for further
processing. This resulted in three replicates in each
condition.
[0355] Total RNA isolation. After sample collection, the PAX tubes
were incubated at room temperature for 2 or 9 hours, followed by
immediate total RNA isolation or freezing at -20.degree. C. for 6
days before further processing. For total RNA isolation, we
followed the PAX kit handbook (33), but with modifications to aid
tight pellet formation after proteinase K treatment. Loose pellets
were problematic. To form tight pellets, we increased the
proteinase K added from 40 .mu.l to 80 .mu.l (>600 mAU/ml) per
sample and the 55.degree. C. incubation time from 10 min to 30 min.
After spinning the samples, if a tight pellet still did not form,
then we remixed the samples, incubated at 55.degree. C. for another
5 min, and followed by centrifugation. The optional on-column DNase
digestion mentioned in the PAX kit handbook was not carried out.
Thus, OD measurements at this point would not give accurate
quantification due to DNA contamination; however, the 260/280 ratio
may indicate other contaminants. Approximately 4 .mu.l of the 80
.mu.l eluted RNA was needed to obtain an absorbance greater than
0.1. All aliquots were diluted in 10 mM Tris-Cl pH 7.5 for OD
readings.
[0356] In-solution DNase digestion. Subsequently, in-solution DNase
treatment was carried out using the DNA-free.TM. kit (Ambion).
Briefly, for each sample eluted in 80 .mu.l BR5 buffer, we added 7
.mu.l 10.times.DNase I buffer and 1 .mu.l DNase, followed by mixing
and incubation at 37.degree. C. for 20 min. Afterwards, 7 .mu.l of
DNase inactivation reagent was added, incubated at room temperature
for 2 min, and spun down to pellet the beads that were in the
inactivation reagent. The treated RNA in the supernatant was
pipetted off without disruption of the pellet. An aliquot of each
RNA sample was run on the bioanalyzer for quantification and QC
measurements.
[0357] Poly-A RNA isolation. After DNase treatment, duplicate
samples were pooled, and mRNA was isolated using the Oligotex.TM.
mRNA kit (Qiagen). The mRNA was eluted in 100 .mu.l total of OEB
buffer.
[0358] Sample concentration. Next, the samples were concentrated
via ethanol precipitation. For each 100 .mu.l sample, we added 1
.mu.l glycogen (5 mg/ml) (Ambion), 15 .mu.l 5M ammonium acetate,
and 200 .mu.l 100% ethanol chilled at -20.degree. C. The reaction
was incubated at -20.degree. C. overnight. The next day, the
samples were spun down at 13,791 g at 4.degree. C. for 30 min. The
pellet was washed twice with 80% ethanol chilled at -20.degree. C.;
air-dried; and resuspended in 12 .mu.l of nuclease free water
(Ambion).
[0359] Generation of cRNA. All subsequent steps were carried out as
described in the GeneChip.RTM. expression analysis manual (6). Ten
microliters of each sample were used in the first strand cDNA
synthesis reaction. Ten microliters of purified double-stranded
cDNA were used for synthesis of biotin-labeled cRNA. Fragmentation,
hybridization, and detection were performed as described in the
manual (6).
[0360] Measurements on the bioanalyzer. One microliter, from pre-
and post-DNase total RNA, purified double stranded cDNA, purified
cRNA diluted 1:10, and fragmented cRNA, was run on the bioanalyzer
using the protocols described in the RNA 6000 Nano Assay (Agilent
Technologies) (61). The usage of the bioanalyzer was analogous to
gel electrophoresis, except that the gel matrix and samples were
flowed through microfluidic channels of a cartridge, thus
facilitating small sample usage and automated quantification.
[0361] Real-time PCR for gapdh gene. Each real-time PCR reaction
for gapdh DNA included: 12.5 .mu.l 2.times.SYBR green PCR master
mix (Applied Biosystem), 0.5 .mu.A 5'GTGAAGGTCGGAGTCAACGG forward
primer (10 .mu.M), 0.5 .mu.l of 5'GCCAGTGGACTCCACGACGTA reverse
primer (10 .mu.M), 10.5 .mu.l of water, and 1 .mu.l of template
from total RNA or cDNA samples. The reactions were carried out in
the iCycler (Biorad) with cycling settings of 95.degree. C. 3 min;
95.degree. C. 30 s, 58.degree. C. 30 s, and 72.degree. C. 30 s for
40 cycles; followed by melting curve analysis and/or a 4.degree. C.
hold. The completed reactions were also analyzed by gel
electrophoresis.
[0362] Reverse transcription. For RNA quality assessment during
protocol development, synthesis of cDNA was carried out using the
SuperScript.TM. First-Strand synthesis system for RT-PCR kit
(Invitrogen Life Technologies).
[0363] Statistical analysis. Statview (SAS Institute) software was
used to perform the nonparametric Mann-Whitney U test to determine
statistically significant differences between 260/280 OD ratios,
concentrations via 260 nm absorbance, concentrations via
integration of fluorescence profiles, relative amounts of
contaminating DNA via threshold cycle, RNA quality via ribosomal
28S/18S peak ratios, double stranded cDNA yields, purified cRNA
yields, and 260/280 ratios of purified cRNA. A P-value of less than
or equal to 0.05 was considered statistically significant.
[0364] Affymetrix Microarray Suite 5.0 (MAS 5.0) (62) was used for
generation of QC metrics including: noise (RawQ), an indicator of
variation in pixel intensities; average background; scale factor,
an indicator of variation of intensities between chips; percent
present calls, an indicator of the number of genes detected; and
gapdh 3'/5' signals and actin 3'/5' signals, indicators of RNA
degradation. Dataplot (63) was used to assess autocorrelations of
QC metrics. Statview was used to make individual line charts and to
set quality control limits at .+-.3 standard deviations from the
mean.
[0365] MAS 5.0 CEL files, which contained intensity values of each
probe, and gene expression present calls were imported into dChip
(64, 65) for further analysis. In dChip, HG-U133A and HG-U133B
chips were analyzed separately. dChip uses intensity values of
probes on multiple arrays to calculate an expression index, which
is a measure of transcript abundance. The expression index is
analogous to the signal statistic output by MAS 5.0. dChip was used
for hierarchical clustering and fold-change determinations, and the
expression indices were exported to JMP IN (SAS Institute) for
analysis of variance.
Results
[0366] Adaptation of RNA from PAX tube for use with the
GeneChip.RTM. system. RNA from a PAX tube was isolated using the
protocol provided with the PAX kit. As determined by spectrometry,
the yield was 4.8 .mu.g; the 260/280 ratio was 2.01; and the
concentration was 0.06 .mu.g/.mu.l. This was not sufficient for use
with the GeneChip.RTM. protocol which prescribed an initial total
RNA amount of 5 .mu.g at 0.5 .mu.g/.mu.l (6). Thus, RNA isolated
from two PAX tubes were pooled, followed by ethanol precipitation
and resuspension in 15 .mu.l of BR5 buffer. This resulted in a
yield of 10.4 .mu.g, a 260/280 ratio of 2.07, and a concentration
of 0.7 .mu.g/.mu.l, which met the amounts recommended in the
GeneChip.RTM. protocol.
[0367] The optional on-column DNase digestion step was performed as
described in the PAX kit. However, for quality assurance, the
presence of DNA in the purified RNA was assessed via real-time PCR
for the gapdh gene. PCR could detect the presence of gapdh DNA
(FIG. 2A), suggesting that the on-column DNase digestion was not
efficient enough to remove DNA to a level undetectable by PCR.
Thus, the RNA was treated with DNase in solution. Afterwards, gapdh
DNA was not detected by real-time PCR (FIG. 2B), suggesting that
most DNA had been digested. However, the RNA integrity may be
compromised during in-solution DNase treatment; thus, reverse
transcription followed by real-time PCR for gapdh was performed on
the in-solution DNase treated samples. The gapdh DNA was detected
following reverse transcribed-PCR (FIG. 2C), suggesting that the
RNA was still of good quality.
[0368] The use of Oligotex purified mRNA was based on a preliminary
experiment comparing the number of genes detected when using total
RNA versus mRNA isolated from blood in PAX tubes. The resulting
present calls, signifying the number of genes detected, were 33%
for total RNA and 41% for mRNA on the HG-U133A chips. Comparisons
were also made between mRNA isolated via Oligotex and mRNA isolated
via ion-pair reversed-phase high performance liquid chromatography
(IP RP HPLC) (66). The resulting present calls were 17% and 19% for
IP RP HPLC and 35% and 40% for Oligotex mRNA. Since Oligotex
isolated mRNA showed the highest percent present calls, the step
was incorporated into the protocol.
[0369] The protocol used for gene-expression profiles of human
blood samples using the PAXgene Blood RNA System and the
GeneChip.RTM. platform includes at least 2 PAX tubes per donor,
total RNA isolation without on-column DNase digestion but with
in-solution DNase digestion, mRNA isolation, precipitation for
concentration, followed by standard protocols from the
GeneChip.RTM. manual.
[0370] Comparison of QC measures for conditions E and O. We
compared the quality control measures of PAX tube-collected blood
samples whose RNA were isolated after the minimum incubation time
of 2 hours at room temperature (FIG. 1, condition E) and after
incubation at room temperature for nine hours followed by storage
at -20 C for 6 days (FIG. 1, condition O).
[0371] To compare the purity and yield of total RNA from the two
conditions, we performed spectrometric analysis on the RNA samples.
There was no difference in the 260/280 ratio between the two
treatments (Table 1, row 1), suggesting that RNA purity was
equivalent for the samples. The yield before DNase treatment was
1.0 .mu.g higher for condition E than O (Table 1, row 2). However,
this measure may be confounded by differential DNA contamination in
the samples. Thus, after in-solution DNase treatment, we
quantitated the RNA using the bioanalyzer (FIG. 3B). Surprisingly,
the yield was 0.9 .mu.g higher in condition O than E (Table 1, row
3). This implied that there was more DNA contamination in E
compared to O. Therefore, we measured the relative amount of DNA
contamination in the two treatments via real-time PCR for gapdh.
The threshold crossing cycle was lower in E compared to O (Table 1,
row 4), indicating that there was more DNA in E. These observations
indicated that more DNA contamination occurred in E than O but that
the yield of RNA was higher in O than E.
TABLE-US-00002 TABLE 1 Comparisons between condition E versus O of
quality metrics relating purity, yield, and stability of total RNA
isolated from PAX tube. Each mean .+-. SEM value displayed in each
cell was calculated from n = 6. Mann Treatment WhitneyU of RNA
Condition E Condition O test Row # Description samples Method (mean
.+-. SEM) (mean .+-. SEM) P value 1 Purity via 260/280 No DNase
Spectrometry 2.07 .+-. 0.04 2.07 .+-. 0.05 0.631 OD ratio 2
Concentration via No DNase Spectrometry 7.3 .+-. 0.2 .mu.g 6.3 .+-.
0.2 .mu.g 0.007* 260 Absorbance 3 Concentration via In solution
Bioanalyzer 3.8 .+-. 0.2 .mu.g 4.7 .+-. 0.2 .mu.g 0.025*
integration of DNase fluorescence profiles 4 Relative amounts No
DNase Realtime PCR 14.7 .+-. 0.8 24.3 .+-. 0.6 0.004* via threshold
cycle for gapdh DNA 5 RNA quality via In solution Bioanalyzer 1.7
.+-. 0.1 1.6 .+-. 0.1 0.200 28S/18S peak ratio DNase
[0372] RNA from various samples produced different profiles on the
bioanalyzer, and we would like to use such profiles for QC.
Therefore, we overlaid RNA profiles from our samples to assess
inter-sample variability and RNA quality (FIG. 3). Before DNase
treatment, fluorescence profiles from condition E were, on average,
higher than samples from O (FIG. 3A). After in-solution DNase
treatment, the fluorescence profiles decreased overall and reversed
with respect to the conditions (FIG. 3B). Interestingly,
comparisons of pre- and post-DNase treatment profiles suggested
that DNA tended to show up between the two ribosomal peaks and as a
hump at later times (FIGS. 3A & C). These observations
corroborated the yield and DNA contamination results determined by
spectrometry and real-time PCR. The ratios of the 28S to the 16S
ribosomal RNA peaks averaged around 1.6 (Table 1, row 5) based on
the bioanalyzer automatic peak detection and calculation software.
However, manual adjustment indicated that the 28S/16S ratio
averaged around 2. There was no difference in the 28S/16S ratio
between condition E and O (Table 1, row 5). The shapes of the
fluorescence profiles were similar in both treatments (FIG. 3B).
These results suggested that the RNA populations from both
conditions were of similar good quality.
[0373] Since the RNA were of similar quality for the two
conditions, we continued through the procedures to make fragmented
labeled cRNA. We used the bioanalyzer to monitor double stranded
cDNA synthesis (FIG. 4A), purified cRNA (FIG. 4B), and fragmented
cRNA (FIG. 4C). The characteristic profiles in FIG. 4 were
indicative of successful reactions. The yield of double stranded
cDNA was 0.09 .mu.g higher in condition E than O (Table 2, row 1),
while the yield of purified cRNA was around 30 .mu.g with no
detectable differences between the two conditions (Table 2, row 2).
The 260/280 ratios were similar between the two groups (Table 2,
row 3).
TABLE-US-00003 TABLE 2 Comparisons between condition E versus O of
quality metrics relating yields and purity of double stranded cDNA
and cRNA derived from mRNA isolated from PAX tube. Each mean .+-.
SEM value displayed in each cell was calculated from n = 3.
Condition E Condition O Mann Whitney U Row # Description Method
(mean .+-. SEM) (mean .+-. SEM) test P value 1 Double stranded
Bioanalyzer 0.56 .+-. 0.03 .mu.g 0.47 .+-. 0.03 .mu.g 0.050* cDNA
yield 2 Purified cRNA yield Spectrometry 34 .+-. 4 .mu.g 30 .+-. 3
.mu.g 0.513 3 260/280 of purified Spectrometry 2.3 .+-. 0.03 2.4
.+-. 0.06 0.275 cRNA
[0374] Since the QC metrics suggested that sample preparation was
successful, we hybridized the samples to human HG-U133A chips
followed by hybridization onto the HG-U133B chips using the same
hybridization cocktails, which had been stored at -80.degree. C.
Hybridization, washing, detection, and scanning were done as
described in the GeneChip.RTM. manual (6).
[0375] Afterwards, we assessed the QC metrics along with other
samples processed in our facility (FIG. 5). To determine if the
metrics were fluctuating randomly over time, each QC metric shown
in FIG. 5 was graphed on lag- and autocorrelation plots (not shown)
(67). There was no obvious pattern in the plots, suggesting that
the metrics were randomly drawn from a fixed distribution, thus
enabling the setting of control limits at .+-.3 standard deviations
from the center mean. All measures were within the control limits.
Average Background centered around 70, which was within the typical
range of 20 to 100 (68). Importantly, the percent present centered
at 39% for HG-U133A chips and 25% for HG-U133B chips. Finally, the
3' to 5' signal ratio for both gapdh and actin centered at
.about.1.2, indicating that the RNA was of good quality and cRNA
synthesis was efficient. Comparisons of these QC metrics for the
samples from conditions E and O indicated no significant
differences. These QC results suggested strong confidence in the
reliability of our process.
[0376] Analysis of gene-expression profiles. To determine the
contributions of handling conditions, microarray chips, and
differing genes to the variation in measures of transcript
abundance, we performed a three-way analysis of variance on
dChip-derived gene expression indices from HG-U133A chips.
Quantile-normal plot of expression indices from 6 chips indicated
that the expression indices were not normally distributed. Thus,
100 genes were randomly sampled from the 22,577 genes, and their
expression indices were transformed by adding `1` to every value to
remove zeros followed by a Box-Cox transformation to bring the
distribution closer to normality. Subsequently, the transformed
data was fitted into the following model:
Y.sub.ijk=M+C.sub.i+P.sub.j+G.sub.k+E.sub.ijk
[0377] Where Y stands for the transformed expression indices, M for
the grand mean, C for the two conditions (i=1, 2), G for the 100
sampled genes (k=1, 2, 3, . . . 100), and E for the residual error.
P has three levels (j=1, 2, 3) and encompasses variations due to
the order of the blood draw, order of processing, and/or between
chips. For example, level j=1 of P contains expression indices from
one chip of each condition, and these two chips detected targets
from PAX tube samples that were drawn first (draw order numbered 1,
3 for condition E and 2, 4 for condition O, FIG. 1) and processed
together. After model fitting, the residual versus predicted plot
showed no correlation, and the residuals were normally distributed
(Shapiro-Wilk W test, P=0.24). The coefficient of determination
(R.sup.2) was 0.993. These results suggested that the model
adequately explained most of the variation in the data. The
analysis of variance results are shown in Table 3.
TABLE-US-00004 TABLE 3 3-Way ANOVA results % of Degree total of Sum
of varia- Mean F Source freedom Squares tion Square ratio P value
Condition 1 50,843 0.090 50,843 60.2 <0.0001 (C) Chip (P) 2
94,662 0.167 47,331 56.1 <0.0001 Gene (G) 99 56,189,455 99.004
567,570 672.4 0.0000 Residual 497 419,519 0.739 844 (E)
[0378] The `Sum of Squares` column indicates the magnitude of the
variations explained by the factors listed under the `Source`
column, while the `% of total variation` column converted the sum
of squares into percentages. The F ratio (mean square of a
factor/mean square of the residual) is used to test whether the
variation explained by a factor is statistically greater than the
variation of the residuals; a P-value of less than 0.05 indicated
statistical significance. The results indicated that all three
factors: C, P, and G, significantly explained portions of the total
variation. However, the gene (G) factor explained most of the
variation (99%), while the handling conditions contributed
minimally (0.09%) to differences in gene expression levels. These
results were generalizable to all genes on the chips since the 100
genes analyzed were randomly selected.
[0379] To determine the correlations of gene levels among the
samples of the two conditions relative to other PAX-tube-derived
samples processed in our lab, cluster analysis was performed.
Samples were clustered via hierarchical clustering with average
linkage, no gene filtering, and no standardization of genes or
samples. The distances among samples were l-r, where r is Pearson's
linear correlation coefficient. This distance measure quantified
dissimilarities between entire expression profiles. The resulting
dendrograms with descriptive ontologies of samples are shown in
FIG. 6. The samples from conditions E and O clustered together away
from samples that differed by other factors such operator and
individual donors, and they segregated into E and O conditions for
genes on the HG-U133B chips. This result further support the
analysis of variance in that the differing conditions did not
induced large changes in gene profiles.
[0380] To quantitate differences between the two conditions in
terms of fold-changes, we compared fold changes of all genes
between the conditions. From the set of non-filtered genes
(.about.22,600 genes for HG-U133 chips, with 7,600 genes for
HG-U133A and 5600 genes for HG-U133B called present by MAS 5.0), we
filtered for genes that showed greater than 1.3 fold changes
between the conditions using the lower bound of the 90% confidence
interval of fold-change estimates. This resulted in 5 genes for
HG-U133A chips and 22 genes for HG-U133B chips (Table 4). When the
lower bound was set to 1.5, only 1 gene remained for HG-U133A chips
and none for HG-U133B chips. These results indicated that the
differences between the two conditions were due to genes whose
expression indices differ by no more than 1.5 fold of the 90% lower
bound.
TABLE-US-00005 TABLE 4 List of genes that showed greater than 1.3
fold change using the lower bound of the 90% confidence interval
between condition E and O Lower bound Upper bound E O Fold of fold
of fold probe set gene mean.sup.1 mean.sup.2 change change change
U133A chips 200032 s at ribosomal protein L9 731.73 1272.5 1.74
1.31 2.18 204661 at CDW52 antigen (CAMPATH 1 antigen) 834.26 1394.3
1.67 1.34 2.02 206207 at Charot Leyden crystal protein 657.73
1085.4 1.65 1.36 1.96 210510 s at neuropilin 1 224.6 492.39 2.19
1.9 2.54 211264 at glutamate decarboxylase 2 (pancreatic islets
30.97 49.3 1.59 1.3 2 and brain, 65 kD) U133B chips 222787 s at
hypothetical protein FLJ11273 168.39 106.06 1.59 1.41 1.79 222791
at hypothetical protein FLJ11220 226.09 142.84 1.58 1.39 1.84
222793 at RNA helicase 754.62 490 1.54 1.36 1.73 222833 at
hypothetical protein FLJ20481 317.62 221.84 1.43 1.32 1.56 223243 s
at chromosome 1 open reading frame 22 206.55 135.11 1.53 1.33 1.78
224737 x at Consensus includes gb: BG541830 /FEA = 65.17 36.26 1.8
1.47 2.23 EST 225626 at phosphoprotein associated with 307.44
205.34 1.5 1.36 1.66 glycosphingolipid enriched 226119 at similar
to hypothetical protein FLJ10883 299.72 185.48 1.62 1.39 1.89
226148 at Consensus includes gb: AU144305 /FEA = 274.02 183.58 1.49
1.35 1.66 EST 226465 s at SON DNA binding protein 243.4 154.52 1.58
1.4 1.77 226641 at Consensus includes gb: AU157224 /FEA = 715.14
457.8 1.56 1.34 1.86 EST 226979 at mitogen activated protein kinase
kinase 408.84 261.97 1.56 1.35 1.82 kinase 2 227405 s at frizzled
homolog 8 (Drosophila) 636 373.97 1.7 1.41 2.01 227772 at Consensus
includes gb: AV700849 /FEA = 211.74 138.2 1.53 1.32 1.8 EST 228248
at Consensus includes gb: W49629 /FEA = EST 549.67 356.03 1.54 1.31
1.83 228328 at Consensus includes gb: AI982758 /FEA = EST 158.3
102.72 1.54 1.32 1.82 232744 x at Consensus includes gb: BG485129
/FEA = 27.38 16.57 1.65 1.41 1.96 EST 237403 at Consensus includes
gb: AI097490 /FEA = EST 979.37 603.12 1.62 1.37 1.95 240784 at
Consensus includes gb: BE549627 /FEA = 624.51 390.38 1.6 1.38 1.85
EST 241202 at Consensus includes gb: AA779283 /FEA = 676.47 416.03
1.63 1.31 2.01 EST 241260 at Consensus includes gb: N39326 /FEA =
EST 13.67 22.95 1.68 1.39 2.04 243589 at Consensus includes gb:
AI823453 /FEA = EST 264.88 160.86 1.65 1.41 1.91 .sup.1The mean of
expression indices of condition E (n = 3) .sup.2The mean of
expression indices of condition O (n = 3)
[0381] In comparing the two conditions, there were more genes that
showed changes on the HG-U133B chips than on the HG-U133A chips,
even though more genes were detected on the HG-U133A chips. Also,
the genes that changed on the HG-U133B chips mostly went down in
condition O.
[0382] Our results implied several recommendations as to sample
handling for multi-centered studies. Since there were differences
between the conditions but they both showed good within-group
reliability, one should preferably pick one method to reduce
variability. In which case, condition O seemed advantageous over E,
as it provided time before one had to process or freeze the samples
and allowed for transportation while frozen. If one needed the
flexibility of the range of handling methods between the
conditions, then this would still be possible, as long as during
subsequent analysis, one increased statistical stringency, such as
only passing genes greater than 1.5 fold change of the 90% lower
bound.
Example 3
GXP Program "Quad30" Experiments
Materials and Methods
[0383] Culture of adenovirus from nasal washes. All samples are
cultured for Adenovirus, Parainfluenza 1,2, and 3, Influenza A and
B and RSV. Standard cell types, including Rhesus Monkey Kidney-PMK
or Cynomologous Monkey Kidney-CYN are most commonly used in
addition to A549 cells. Standard culture and shell vial with direct
fluorescent antibody are used. All respiratory cultures are held
for 10-14 days until called negative.
[0384] Fluorogenic real-time PCR for adenovirus serotype 4 from
nasal washes. DNA was extracted from 100 .mu.l of nasal washes
using the MasterPure.TM. DNA purification kit (Epicentre
Technologies, Madison, Wis.) and resuspended in 10 .mu.l nuclease
free water (Ambion Inc., Austin, Tex.). Two different fluorogenic
real-time PCR were used to detect adenovirus serotype 4 hexon and
fiber genes. For hexon gene specific PCR, each reaction was 15
.mu.l total volume containing 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 4
mM MgCl.sub.2, 200 dNTPs (Invitrogen Life Technologies, Carlsbad,
Calif.), 200 nM primers, 100 .mu.M TaqMan probe (Integrated DNA
technologies, Inc. Coralville, Iowa), 0.6 U of Platinum Taq DNA
polymerase (Invitrogen Life Technologies, Carlsbad, Calif.), and
0.6 .mu.l purified DNA from nasal washes. The sequences of
adenovirus 4 specific hexon primers are:
5'-GTTGCTAACTACGATCCAGATATTG-3' (forward; SEQ ID NO:1) and
5'-CCTGGTAAGTGTCTGTCAATCC-3' (reverse; SEQ ID NO:2). The sequence
of adenovirus 4 hexon specific probe is
5'-FAM-CAGTATGTGGAATCAGGCGGTGGACAGC-TAMRA-3' (SEQ ID NO:3), where
FAM is the fluorescent reporter, and TAMRA is the fluorescence
quencher. The reaction conditions were: 94.degree. C. 3 min
denaturation, then 35 two-step cycles of ramping to 95.degree. C.
and 60.degree. C. 20 s. For fiber gene specific PCR, each reaction
was also 15 .mu.l total volumes containing 1.5 .mu.l FastStart DNA
Master SYBR Green I (Roche Applied Science, Indianapolis, Ind.), 3
mM MgCl.sub.2, 200 nM primers, and 0.6 .mu.l purified DNA from
nasal washes. The sequences of adenovirus 4 specific fiber primers
are: 5'-TCCCTACGATGCAGACAACG-3' (forward; SEQ ID NO:4) and
5'-AGTGCCATCTATGCTATCTCC-3' (reverse; SEQ ID NO:5). The reaction
conditions were 94.degree. C. 10 min denaturation, then 40 two-step
cycles of ramping to 95.degree. C. and 60.degree. C. 20 s. Both
reactions were carried out in the RAPID LightCycler.TM. (Idaho
Technology Inc., Salt Lake City, Utah).
[0385] Total RNA isolation from blood. Frozen PAX tubes were thawed
at room temperature for 2 hrs followed by total RNA isolation as
described in the PAX kit handbook (60), but modified to aid in
tight pellet formation by increasing proteinase K from 40 .mu.l to
80 .mu.l (>600 mAU/ml) per sample, extending the 55.degree. C.
incubation time from 10 min to 30 min, and the centrifugation time
to 30 min or more. The optional on-column DNase digestion was not
carried out. Purified total RNA was stored at -80.degree. C.
[0386] Target preparation. For more complete removal of DNA from
purified RNA samples, RNA isolated from multiple PAX tubes of blood
from the same donor at a specific collection date were pulled,
followed by in-solution DNase treatment using the DNA-free.TM. kit
(Ambion). However, to facilitate removal of the DNase inactivating
beads, the completed reaction was spun through a spin column
(Qiagen, Cat#79523), rather than attempting to pipette off the
supernatant without disturbing the bead pellet. Subsequently, one
micro liter from each post-DNase total RNA sample was run on the
bioanalyzer using the RNA 6000 Nano Assay (Agilent Technologies)
for assessment of RNA quality and quantification of RNA amount.
Next, for most samples, 5 .mu.g of RNA were concentrated via
ethanol precipitation. For each 100 .mu.l of RNA sample, we added 1
.mu.l glycogen (5 mg/ml) (Ambion), 15 .mu.l 5M ammonium acetate,
and 200 .mu.l 100% ethanol chilled at -20.degree. C. The reaction
was incubated at -20.degree. C. overnight. The next day, the
samples were spun down at 13,791 g at 4.degree. C. for 30 min. The
pellet was washed twice with 80% ethanol chilled at -20.degree. C.;
air-dried; and resuspended in 10 or 12 .mu.l of nuclease free water
(Ambion). All subsequent steps were as described in the
GeneChip.RTM. Expression Analysis Technical Manual (6).
[0387] Database integration. The database can be divided into two
major categories: 1) metadata, all information relating to the
sample processing that is not gene-expression measurements; and 2)
gene-expression data. The metadata consists of several
subcategories: clinical, laboratory handling, and quality metrics
of microarray results.
[0388] Clinical data captures information about the patients as
transcribed from the questionnaire, complete blood count (CBC), and
about handling of the collected PAX tube blood samples.
[0389] Laboratory data contains information about the processing of
blood samples. For steps from blood in PAX tubes to total RNA
extraction, fields such as date of processing, reagent lots, and
operator are captured. Subsequent bioanalyzer measurements of
DNased treated RNA samples resulted in fluorescent intensities
versus time data, which graphically, form the electropherograms and
were treated as metadata as well. The electropherograms were
analyzed by the Biosizing (Agilent Technologies) software to output
28S-to-18S intensity ratios and RNA yields, and by the Degradometer
1.1 (51) software to consolidate, scale, and calculate quality
metrics such as degradation factors and apoptosis factors. For
steps from after bioanalyzer analysis to hybridization, variables
such as yields of cRNA and processing batches were recorded.
[0390] Quality metrics of microarray results data were information
associated with the scanned chip. This included fields such as lot
numbers of chips and date of scanned images stored in DAT files.
Also included were fields from the Report fifes generated by the
GeneChip Operating Software 1.1 (GCOS1.1) (Affymetrix), which
summarized the quality of target detection for a chip.
[0391] Microsoft Access and Excel worksheets were used to enter
manually clinical and laboratory handling data. Outputs from
Degradometer 1.1 were in Excel worksheets. An in-house script
called ReportToMatrix (script provided hereinbelow) was used to
reformat and consolidate Report files into a data matrix in Excel.
Metadata from GCOS1.1 were exported into Access.
[0392] Finally, the JMP IN (SAS Institute) software was used to
join these various data tables together using identifiers, usually
the volunteer's ID number and date of blood collection. The
metadata table has more than a thousand columns.
[0393] In regard to the gene-expression data, the scanned images of
chips were captured and stored in Microarray Suite 5.0 (MAS 5.0)
(Affymetrix) and later transported to GCOS1.1. Signal values, which
quantify the abundance of genes from intensities of probes, and
detection calls, which qualify the detection of genes into present
(P), marginal (M), or absent (A), were calculated in GCOS1.1 which
uses the MAS5.0 algorithm. For both HG-U133A and B chips, the
scaling factor and normalization value were set to 1, resulting in
no scaling or normalization after generating Signal values. This
allows for testing of various scaling and normalization procedures.
Signals and detection calls were exported to Excel and saved as
tab-delimited text files with A chips in one folder and B chips in
another. Statistical analysis. Statistical quality control and
relations among metadata variables were analyzed in JMP IN and
StatView (SAS). ANOVA, t-tests, and class prediction of clinical
phenotypes using CBC or electropherogram data were performed in
BRB-Arraytools 3.2.0 Beta (Arraytools) developed by Dr. Richard
Simon and Amy Peng Lam (available through the web-site for the
Biometric Research Branch, Division of Cancer Research and
Diagnosis, National Cancer Institute, U.S. National Institutes of
Health). Arraytools is written for analysis of gene-expression
data, but here we have imported certain quantitative metadata
fields, such as CBC, to be treated as `genes` by Arraytools to take
advantage of its class prediction algorithm.
[0394] Relations between metadata variables and gene-expression
profiles were analyzed in Arraytools. To facilitate import of text
files with Signals and detection calls, in-house scripts were
written in R to move files of interest into a different folder and
renaming and reformatting the files to be compatible with
ArrayTools: (Script provided herein below)
Script for Reformatting the Files to be Compatible with
ArrayTools:
TABLE-US-00006 # objects in R scaled each chip via trimmean: #
"from": vector of DAT file names # "sample ID": dataframe of
renamed file names for Arraytools keyed to DAT file names # "t":
older, one error version of `sample ID` # "training": Arraytools
file names for the training set samples # "rename: function to
rename the DAT files in a folder to Arraytools acceptable names
function (from,to) {for (i in 1:length(from)) {file.rename
(paste(from[i], ".txt", sep = ""),paste(to[i], ".txt", sep = ""))}
} #"sample ID only": from "sample ID", but with Arraytools name
column only, no DAT files names #"target": set value to scale to
#"training files": similar to "training", but no column name #"to":
vector of Arraytools compatible file names, corresponding to "from"
DAT names # rewrite: function to reformat GCOS CHP files exported
to excel # saved as tab delimited file text file to be compatible
with Arraytools function(to) {for (i in 1:length(to)) {tempfile
<- read.table(paste(to[i], ".txt", sep = ""), sep = "\t", header
= TRUE); names(tempfile) <- c("Probe Set Name", "Signal",
"Detection"); write.table (tempfile, file = paste(to[i], ".txt",
sep = ""), sep = "\t", quote = FALSE, row.names = FALSE); } }
#select training set: given a list of training set file names #move
these files in the original to folder to a separate folder for
Arraytools function (training files) { for (i in 1:length(training
files)) { #file.create(paste("C:\\Dzung on Affy3\\files for R
conversion\\test training set\\", training files[i],".txt", sep =
"")); file.copy (paste("C:\\Dzung on Affy3\\files for R
conversion\\reformated B chips text files no scaling or
normalization\\", training files[i], " B.txt", sep = ""),
paste("C:\\Dzung on Affy3\\files for R conversion\\test training
set\\", training files[i]," B.txt", sep = "")); } }
[0395] Selected metadata fields were imported into the Experiment
descriptors worksheet of Arraytools. After data import, Arraytools
were used to determine differential gene expression and ontology,
class prediction, and quantitative trait correlations, with,
between, and/or among clinical phenotypes.
[0396] CBC data were obtained from two machines. The first
partitioned the white blood cells (WBC) into only three groups:
lymphocytes, monocytes, and granulocytes, while the second
partitioned the WBC into five groups: lymphocytes, monocytes,
neutrophils, eosinophils, and basophils. Therefore, to make CBC
comparable between the two machines, the following in-silico
transformations were performed. Since granulcytes consist of
neutrophils, eosinophils, and basophils, samples with five groups
were converted to three by summing up the neutrophils, eosinophils,
and basophils counts. Also, blood samples from 25 volunteers not in
this study were run on both machines. Their CBC showed linear
correlations between the two machines (data not shown). Therefore,
linear regression equations were calculated for CBC variables
between the two machines. These equations were used to normalize
the CBC of the current BMT cohort.
[0397] The Degradometer 1.1 software scales the electropherograms
using the spiked in marker peak (51).
[0398] Scaling was performed for gene-expression data. Since for
each blood sample, the same hybridization cocktail went onto the A
chip and then the B chip, concatenation of the data from the two
chips together in-silico to form a virtual array would be logical
and bypasses issues with analyzing the two chip types separately;
also, the 100 control probe sets common between the A and B chips
should detect genes to result in similar Signal distributions.
Several methods were considered to concatenate the A and B chips
profiles.
[0399] First, if each A and B chips were separately globally scaled
to a target value of 500, then the resulting Scale Factors (SF) was
significantly higher for the B chips than for A (data not shown)
(t-test, p<0.0001), suggesting that generally, Signals from B
chips were actually lower than from A. Confirmatory of this bias
was that Signals of the 100 control genes were higher in B chips
than in A after globally scaling each chip. The lower overall
Signals in B are probably due to the B chip containing probesets
that detect mostly low expressing genes (69). These observations
suggested that the above step of globally scaling each chip was not
appropriate to perform prior to concatenating data from the two
array types.
[0400] Thus, another method was assessed, which was to scale all A
and B chips using only the 100 control genes to a target value of
500. This resulted in stable SF over time (data not shown) and that
there was no significant differences in SF among the four
phenotypes of healthy, sick with adenovirus infection and
convalescents, and sick without adenovirus infection (data not
shown) (ANOVA, p=0.1047 A chips, p=0.1782 B chips). The 100 control
genes were selected based on stability in expression from a large
study of various tissue types (69); therefore, this scaling method
would allow for the concatenation of corresponding A and B chips
and also should remove assay variations independent of gene
concentration. This scaling procedure was carried out using an
in-house R script (Script provided herein below):
Script for Scaling:
TABLE-US-00007 [0401] function scaled (sample ID only) (for (i in
1:length(sample ID only)) {tempfileA <-
read.table(paste("C:\\Dzung on Affy3\\hk then global
scaling\\reformated A chips text files no scaling or
normalization\\", sample ID only[i], ".txt", sep = ""), sep = "\t",
header = TRUE, check.names = FALSE); tempfileB <-
read.table(paste("C:\\Dzung on Affy3\\hk then global
scaling\\reformated B chips text files no scaling or
normalization\\", sample ID only[i], " B.txt", sep = ""), sep =
"\t", header = TRUE, check.names = FALSE); target <- 500; hk
scale factorA <- target / mean(tempfileA$Signal[69:168], trim =
0.02); tempfileA$Signal <- (tempfileA$Signal) * hk scale
factorA; hk scale factorB <- target /
mean(tempfileB$Signal[69:168], trim = 0.02); tempfileB$Signal <-
(tempfileB$Signal) * hk scale factorB; #hk scale factors <-
paste (sample ID only[i],"\t", hk scale factorA,"\t", hk scale
factorB); #write.table (hk scale factors, file = "C:\\Dzung on
Affy3\\hk then global scaling\\hk scale factors.txt", append =
TRUE, quote = FALSE, row.names = FALSE); #virtual chip signals
<- c(tempfileA$Signal, tempfileB$signal); #global scale factor
<- target / mean(virtual chip signals, trim = 0.02);
#tempfileA$Signal <- (tempfileA$Signal) * global scale factor;
#tempfileB$Signal <- (tempfileB$Signal) * global scale factor;
#global scale factor list <- c(global scale factor list, global
scale factor); write.table (tempfileA, file = paste("C:\\Dzung on
Affy3\\hk then global scaling\\HKscaled A chips\\", sample ID
only[i], ".txt", sep = ""), quote = FALSE, row.names = FALSE, sep =
"\t"); write.table (tempfileB, file = paste("C:\\Dzung on Affy3\\hk
then global scaling\\HKscaled B chips\\", sample ID only[i], "
B.txt", sep = ""), quote = FALSE, row.names = FALSE, sep = "\t"); }
} #above is for generating scale factors for A and B chips if only
the 100 house keepking genes were used to scaled
[0402] After scaling using the 100 control genes, the expression
profiles from corresponding A and B chips were concatenated to form
virtual arrays. Furthermore, the present inventors considered
globally scaling these virtual arrays to further remove assay
variations. However, the SF from this procedure showed differences
among the four phenotypes: highest SF in the healthy group, then
convalescents, followed by the febrile group (data not shown)
(ANOVA, p<0.0001). Therefore, this step was not used for the
whole data set, although it might still be useful in increasing the
sensitivity of detection of genes with differential expression
between groups with equivalent SF, such as between sick with-
versus without-adenovirus infection. These results also suggested
that relatively large subsets of transcripts differ among healthy,
convalescents, and febrile, while relatively small subsets of
transcripts differ between sick with- and without-adenovirus. These
analysis steps were also carried out using an in-house R script
(Script provided herein below):
Script to Scale `Virtual` Chips:
TABLE-US-00008 [0403] # to normalize A and B chips via trimmean of
100 house keeping genes, then scale concatenated A and B chips #
(virtual chip) to `target` value using the trimmean of the virtual
chip signals # input an object containing names of files for A and
B chips (sample ID only) function(to) {for (i in 1:length(sample ID
only)) {# read in files tempfileA <- read.table(paste("C:\\Dzung
on Affy3\\files for R conversion\\hk then global
scaling\\reformated A chips text files no scaling or
normalization\\", sample ID only[i], ".txt", sep = ""), sep = "\t",
header = TRUE, check.names = FALSE); tempfileB <-
read.table(paste("C:\\Dzung on Affy3\\files for R conversion\\hk
then global scaling\\reformated B chips text files no scaling or
normalization\\", sample ID only[i], " B.txt", sep = ""), sep =
"\t", header = TRUE, check.names = FALSE); target <- 500; #set
target values #scale chip A and B signal via trimmean of 100 house
keeping genes hk scale factorA <- target /
mean(tempfileA$Signal[69:168], trim = 0.02); tempfileA$Signal <-
(tempfileA$Signal) * hk scale factorA; hk scale factorB <-
target / mean(tempfileB$Signal[69:168], trim = 0.02);
tempfileB$Signal <- (tempfileB$Signal) * hk scale factorB;
#scale virtual chip signals virtual chip signals <-
c(tempfileA$Signal, tempfileB$signal); global scale factor <-
target / mean(virtual chip signals, trim = 0.02); tempfileA$Signal
<- (tempfileA$Signal) * global scale factor; tempfileB$Signal
<- (tempfileB$Signal) * global scale factor; #output scaled
files to different folder write.table (tempfileA, file =
paste("C:\\Dzung on Affy3\\files for R conversion\\hk then global
scaling\\scaled A chips\\", sample ID only[i], ".txt", sep = ""),
quote = FALSE, row.names = FALSE, sep = "\t"); write.table
(tempfileB, file = paste("C:\\Dzung on Affy3\\files for R
conversion\\hk then global scaling\\scaled B chips\\", sample ID
only[i], " B.txt", sep = ""), quote = FALSE, row.names = FALSE, sep
= "\t"); } }
Results
[0404] Quality and variations of RNA derived from PAX system from
the BMTs population. Many factors contribute to the variability of
target detection, with the quality of RNA being one of the most
important. The quality of RNA from PAX tubes collected blood could
be influenced by the disease status of the donors, sample handling,
and other downstream processes. Previously, we showed that under
two conditions representative of practical sample handling, the PAX
system was capable of preserving blood RNA to produce good quality
metrics and relatively stable transcriptome measurements (50).
Recently, new RNA quality metrics have been proposed based on
associations between experimental treatment of cells or purified
RNA to induce RNA degradation and metrics derived from
electropherograms of the RNA on the bioanalyzer (51). One new
metric is the degradation factor (% Dgr/18S), which is the ratio of
the average intensity of bands from degraded RNA, that is peaks of
lesser molecular weight than the 18S ribosomal peak, to the 18S
band intensity multiplied by 100. It is a continuous variable that
is used to derive a categorical variable named `Alert`. Alert has
five values:
[0405] BLACK--indicating that the ribosomal peaks were not
detected;
[0406] NULL--no RNA degradation and corresponds to degradation
factor values .ltoreq.8;
[0407] YELLOW--for RNA degradation can be detected and values from
>8 to 16;
[0408] ORANGE--for severe degradation and values from >16 to
24;
[0409] RED--for highest alert, strong degradation, for values from
>24.
[0410] The degradation factor is a more sensitive indicator of RNA
degradation than the traditional 28S to 18S band intensities ratio.
Another new metric is the apoptosis factor (28S/18S), which is the
ratio of the height of the 28S to 18S peak and is indicative of the
percentage of cells undergoing apoptosis (51). Apoptosis factors
from 1 to 3 inversely correlate with 80% to 0% of cultured cells
positive for annexin V. Thus, for PAX system isolated RNA from our
previous study (50) and current BMTs cohort, we report the
distributions of RNA quality metrics, which would be useful for
comparisons and planning of protocols by other labs; determined the
up-stream quality metrics that are most indicative of the quality
of microarray target detection outcomes; and determined the effects
of inter-individual hemoglobin variability on the sensitivity of
target detection.
[0411] Electropherograms from Thach et al (50) were reanalyzed for
the two PAX tube handling conditions, wherein condition E as in
fresh, the RNA was extracted after the minimum incubation time of 2
hours from phlebotomy, and condition O as in frozen, the blood sat
for 9 hours at room temperature followed by storage at -20.degree.
C. for 6 days, followed by RNA extraction. The degradation factor
was 5.34.+-.0.53 (mean.+-.SE, n=6) for E and 6.53.+-.0.40 for O
with no difference between the two handling methods (Wilcoxon,
p=0.13); the magnitude indicated that no degradation was detected
(data not shown). Linear correlation between the degradation factor
and gapdh and actin 3'/5' is tissue dependent (51), and was not
detected here (data not shown). The apoptosis factor was
1.39.+-.0.06 for E and 1.29.+-.0.09 for O, also with no differences
between conditions (Wilcoxon, p=0.38) (data not shown). These
results confirmed the lack of major differences between the
handling conditions.
[0412] The reanalysis above were from samples that only have
technical variation, whereas the current BMTs cohort captures
inter-individual and disease states variations and has more
samples; therefore, electropherograms from the BMTs were assessed.
The degradation factor for the BMTs cohort was 8.47.+-.0.47 (meant
SE, n=120) and the apoptosis factor was 1.17.+-.0.02. The
distribution of the Alerts was: 77 NULL, 36 YELLOW, 3 ORANGE, and 4
RED.
[0413] A closer look at the electropherograms of ORANGE and RED
samples suggested that these samples, mostly from the same run, had
high degradation factors due to increased noise in the bioanalyzer
rather than true RNA degradation. In contrast to the reanalysis of
Condition E and O samples above, linear correlations were detected
between the degradation factor and gapdh and actin 3'/5', probably
because of greater variation and larger number of samples. However,
the magnitudes of the correlations were modest (A chips gapdh
r=0.526, actin r=0.303; B chips gapdh r=0.325, actin r=0.284).
There was no significant correlation between 28S to 18S band
intensity ratio versus degradation factor, gapdh 3'/5', or actin
3'/5'. Also, only about 50% of the 28S to 18S band intensity ratio
values derived from the bioanalyzer software fell between the 1.8
and 2.1 range, while the rest fell outside of this standard
range.
[0414] Finally, the distribution of yields of total RNA as
determined by the bioanalyzer ranges from 1 to 15 .mu.g per PAX
tube. These results suggest that of the metrics relating to RNA
quality obtained at the bioanalyzer step: RNA yield, 28S to 18S
band intensity ratio, degradation factor, and Alert, the variable
Alert would be most useful in assessment of individual RNA samples
for continuation of processing, as the other metrics had large
variation outside of the traditional range, although microarrays
with acceptable quality metrics were still obtained from those RNA
samples.
[0415] In condition O, the frozen time was 6 day, whereas in the
current BMT study, samples were frozen at -20.degree. C. for up to
20 days, and a few samples had been frozen and thawed a couple of
times. Therefore, to determine if frozen time and freeze-thaw
affected RNA quality derived from PAX system, linear correlations
were performed between the time the samples were frozen before RNA
extraction and RNA quality metrics. There was no significant
correlation detected between frozen time versus degradation factor,
apoptosis factor, total RNA yield per PAX tube, 28S to 18S band
intensity ratio, gapdh and actin 3'/5'. These results suggest that
RNA derived from PAX system is stable over these conditions.
[0416] Many factors affect number of present calls, an indication
of sensitivity of detection of targets. One obvious factor is
average background. As average background increases, then number of
present calls decrease. This was observed in the current data set,
but the effect was minor (A chips, r=-0.397, p=0.00003; B chips,
r=-0.211, p=0.032). A less obvious factor affecting sensitivity is
the percent of globin transcripts of the mRNA population. When
increasing amounts of globin mRNA transcripts were spiked into
total RNA from cell line, the percent present calls decreases
linearly (20). To determine if this effect is present and to
quantitate its magnitude in the current data set, linear
correlation was performed between Number Present and Mean Cell
Hemoglobin (MCH), a measurement of picograms of hemoglobin per red
blood cell that is likely to be directly related to globin mRNA
amounts. A significant although minor effect was detected (r=0.229,
p=0.020), but only for the B chips only. The equation of the
regression line suggested that for every picogram increase in
hemoglobin, there is a loss in present detection calls of 100
genes, or about 2% of the average number of present call genes
detected on the B chips.
[0417] These results suggested that the quality of RNA from PAX
tubes collected blood of the BMT population with various disease
phenotypes and handling conditions are of good and reproducible
quality for gene-expression analysis, although variation in
hemoglobin amounts contributed a minor effect to the sensitivity of
detection of target by the Genechip microarray. The Alert metric
seemed to be a robust indicator for continuation to the target
preparation steps, with values of NULL and YELLOW indicating
acceptable microarray results.
Quality of microarray measurements of PAX system derived RNA from
the BMTs population. The numbers of arrays processed and their
allocations were determined. A total of 145 A and B chip sets were
processed from hybridization cocktail samples from PAX system
derived RNA. Of these, 128 were from the BMTs, and the remaining 17
were from civilians.
[0418] Of the 17, 6 were from the same donor and were samples used
in the condition O versus E study (50); 6 were from another donor
to compare using total versus poly A RNA; 2 were technical
replicates from a third donor; and 3 were technical replicates from
a female donor.
[0419] The 128 chips sets from the BMTs were run in 10 batches
(variable name `RNA to hyb cocktail Batch #`). Batch 1 had 8 blood
samples and polyA RNA was used as in Thach et al. (50). Batch 2 had
12 chip sets with 8 blood samples that were processed as in Batch
1, but the RNA was over fragmented; four of these samples had more
than 5 .mu.g of cRNA left over, so these were hybridized to the
arrays resulting in the 12 chip sets for Batch 2. Batch 3 also had
12 chip sets with 8 blood samples that were processed using total
RNA; 4 of the eight blood samples yielded enough total RNA to have
duplicates using polyA RNA instead. The remaining batches totaling
96 chip sets were processed as the 8 total RNA blood samples from
Batch 3. One of the 96 chip sets was from a convalescent BMT whose
nasal wash still had positive adenoviral culture; therefore, this
singular case was excluded from most analysis. The resulting 95
chip sets were used as the training set in class prediction
analysis. The other 50 chip sets, regardless of processing
differences were placed into the test set. The 95 chips sets and
the 8 from Batch 3 summed to 103 chip sets that were processed
similarly, and these 103 chip sets were used for most other
analysis such as class comparisons. Each batch had about equal
representation of the four phenotypes: healthy, febrile with
adenovirus and convalescents, and febrile without adenovirus.
Therefore, comparisons among these four groups should detect
biological differences as these four groups have similar variations
due to processing. These results above are summarized in Table 5
below:
TABLE-US-00009 TABLE 5 batch febrile w/ febrile w/o number
Convalescents healthy adenvirus adenovirus total 10 3 3 3 1 10 3 2
2 2 2 8 4 2 2 2 2 8 5 2 2 2 2 8 6 7 4 7 2 20 7 5 8 4 1 18 8 3 4 4 4
15 9 3 4 4 5 16 total 27 29 28 19 103
[0420] The correlation of signals and concentrations and the
sensitivity of the bioB, bioC, bioD, and cre cRNA spike-ins were
evaluated. The spike-ins showed strong linear relationship with
known concentration across all chips (data not shown) and that the
percent present calls of bioB, whose concentration is at the level
of assay sensitivity, was 100% of the time suggesting good
sensitivity for all the chips. After scaling via 100 control genes,
the spike-ins still showed strong linear relationship with known
concentration, suggesting that the scaling procedure did not
introduce significant artifacts (data not shown).
[0421] Individual control charts versus the date the microarray was
scanned were plotted to look for stability of quality metrics, to
determine outliers and excluded arrays when error in processing was
known, and to compare our results with values from other labs and
values proposed by Affymetrix. The in silico parameter settings
were uniform throughout as expected. For the A chips, there was an
upward drift in background and noise due to drifting in the scanner
as these metrics returned to normal after recalibration of the
scanner. Most of the B chips were processed before drifting and
after recalibration so this factor did not affect them. The percent
present was 32.+-.10 (average .+-.3SD) for A chips and 21.+-.6 for
B chips. Batch 2 had been over fragmented resulting in high gapdh
and actin 3'/5' and was excluded from analysis where appropriate.
All other chips showed gapdh and actin 3'/5' values well less than
three, the limit proposed by Affymetrix (68). All quality metrics,
including background and noise were stable for the 103 chip sets
from identical protocol.
[0422] These QC results suggested the reliability of our process
and facilitated the inclusion and exclusion of microarrays to form
subsets suitable for a particular statistical analysis to answer
certain questions.
Class prediction of infection status. To determine if sets of genes
could classify the four phenotypes, healthy, febrile with
adenovirus and convalescents, and febrile without adenovirus, class
prediction on the training set was performed. For supervised class
prediction, the class labels were results from the gold standard
assay of culture for adenovirus from samples of the febrile and
convalescent groups. Unsupervised clustering of samples suggested
that the predominant variation among gene expression profiles were
febrile versus non-febrile patients (not shown).
[0423] Therefore, to determine sets of genes that could best
classify febrile versus non-febrile patients, febrile with
adenovirus versus without, and healthy versus convalescents, class
prediction was performed and optimized for these three comparisons
(FIG. 7). Four parameters were varied to obtain optimal percent
correct classification. One is the algorithm for classification,
which consisted of six methods tested: compound covariate
predictor, diagonal linear discriminant analysis, 1-nearest
neighbor, 3-nearest neighbors, nearest centroid, and support vector
machines. For all these six methods, the `univariate significant
p-value cut off` or the `univariate misclassification rate` was
varied. Also the effect of using the randomized variance model for
univariate tests was assessed. Finally, in combination with the
optimal univariate p-value or classification rate and present or
absent of randomized variance model, the fold ratio of geometric
means between two classes was optimized.
[0424] The optimized percent correctly classified and the optimal
conditions for the three comparisons results are shown in Table 6
below:
TABLE-US-00010 TABLE 6 Optimal parameters values optimum univariate
Classes to predict percent misclass fold Data used Group 1 Group 2
correct algorithm rate change alpha gene-expression non-febriles
febriles 99 SVM, NN, or 0.05, 0.4, 1.2, 2-3 0.01 3NN 0.5
convalescents healthy 87 DLDA 1.9 0.001 febrile w/ febrile w/o 91
SVM 1.5-1.7 0.00001 adenovirus adenovirus CBC non-febriles febriles
91 SVM 0.2 1.1-1.2 convalescents healthy 77 DLDA 0.3 none febrile
w/ febrile w/o 77 3NN 1.1 0.1 adenovirus adenovirus
Electropherogram non-febriles febriles 81 SVM 0.4 1.02
convalescents healthy 67 SVM 1.02 0.3 febrile w/ febrile w/o 81 SVM
1.02 0.4 adenovirus adenovirus
[0425] Also shown in the table are optimized percent correct and
conditions when using CBC or electropherograms data. The results
showed that under optimal conditions for each data types,
gene-expression data provided information that best classified the
four groups, with 99% correct between febrile versus non-febrile,
87% between healthy and convalescents, and 91% between sick with
adenovirus versus without. The optimal number of genes for equal
optimal classifications among the four groups tended to be nested
sets, with the smallest set that gave the same optimal class
prediction accuracy containing genes with the most differential
expression. This was likely so because some genes are correlated
with each other and thus provided equivalent amounts of information
for classification. Tables 7, 10, and 11 to provide the p-values as
a measure of reliability of prediction and lists the minimal set of
genes used to classify the following classes: febrile versus
non-febrile patients--99% Feverstatus, p<5E-4, number of genes
in classifier=47 (Table 7); healthy versus convalescents--87%
accurate between healthy and convalescents, p=0.001, number of
genes in classifier=8 (Table 10); and febrile with adenovirus
versus without--91% Febriles with vs. without adenovirus infection,
p<5E-4, number of genes in classifier=11 (Table 11).
TABLE-US-00011 TABLE 7 Minimal Set Of Genes Used To Classify
Febrile Versus Non-Febrile Patients (Sorted by T-value) Geom mean
of Geom mean of Parametric p- intensities in intensities in t-value
value % CV support class 1: H class 2: S Probe set 1 -22.56 p <
0.000001 100 64 495.9 227458_at 2 -22.03 p < 0.000001 100 220.4
1320.5 202446_s_at 3 -21.68 p < 0.000001 100 93.1 611.4
216950_s_at 4 -20.81 p < 0.000001 100 96.1 490.5 202430_s_at 5
-20.73 p < 0.000001 100 117.3 779 214511_x_at 6 -18.07 p <
0.000001 100 73.3 389.5 209498_at 7 -16.48 p < 0.000001 100 56.3
557.4 200986_at 8 -15.62 p < 0.000001 100 69.2 374.3 206025_s_at
9 -15.52 p < 0.000001 100 28 199 238439_at 10 -15.4 p <
0.000001 100 148.1 947.6 227609_at 11 -15.3 p < 0.000001 91 81.8
413.6 230036_at 12 -15.01 p < 0.000001 100 34.1 235 222154_s_at
13 -14.58 p < 0.000001 100 86 459.5 209417_s_at 14 -14.46 p <
0.000001 100 60.8 368.9 205552_s_at 15 -14.21 p < 0.000001 100
66.1 484.4 219669_at 16 -14.15 p < 0.000001 100 3.8 32.8
204068_at 17 -14.02 p < 0.000001 100 190.1 974.4 202269_x_at 18
-13.65 p < 0.000001 100 86.9 527.7 202270_at 19 -13.58 p <
0.000001 100 143.7 996.8 231577_s_at 20 -13.41 p < 0.000001 100
13.8 90.1 207500_at 21 -13.23 p < 0.000001 100 353.8 1987.5
229450_at 22 -13.18 p < 0.000001 100 45.5 260.3 206637_at 23
-13.14 p < 0.000001 100 11.4 144.1 228439_at 24 -13.09 p <
0.000001 100 59.8 1137.5 242625_at 25 -12.38 p < 0.000001 100
74.8 783.5 226702_at 26 -12.34 p < 0.000001 100 43.8 239.1
214453_s_at 27 -12.32 p < 0.000001 100 72.8 435.1 238581_at 28
-12.2 p < 0.000001 100 14.9 82.8 225353_s_at 29 -12.07 p <
0.000001 100 82.9 445.5 228617_at 30 -11.93 p < 0.000001 100
33.7 703.8 213797_at 31 -11.86 p < 0.000001 100 37.6 207.3
203234_at 32 -11.68 p < 0.000001 100 16.2 178 211012_s_at 33
-11.67 p < 0.000001 100 18.9 113 205569_at 34 -11.67 p <
0.000001 100 24.9 206.2 219684_at 35 -11.27 p < 0.000001 100
177.7 1219.3 205483_s_at 36 -10.96 p < 0.000001 100 27.6 408.8
204439_at 37 -10.76 p < 0.000001 98 25.4 129.9 214059_at 38
-10.69 p < 0.000001 100 59.2 391 229390_at 39 -10.61 p <
0.000001 100 10.2 106.9 236156_at 40 -10.56 p < 0.000001 100
90.6 617 202869_at 41 -9.98 p < 0.000001 100 241.4 1315
202086_at 42 -9.96 p < 0.000001 100 33.3 178.7 229391_s_at 43
-9.91 p < 0.000001 100 6.5 54.4 219519_s_at 44 -9.77 p <
0.000001 100 18 105.6 206133_at 45 -9.33 p < 0.000001 100 22.3
346.4 203153_at 46 -8.61 p < 0.000001 100 20.3 109.8 206553_at
47 -8.48 p < 0.000001 100 14.9 123 202411_at Gene Chip #
Description symbol 1 Chip `B` programmed cell death 1 ligand 1
PDCD1LG1 2 Chip `A` phospholipid scramblase 1 PLSCR1 3 Chip `A` Fc
fragment of IgG, high affinity Ia, receptor for FCGR1A (CD64) ///
Fc fragment of IgG, high affinity Ia, receptor for (CD64) 4 Chip
`A` phospholipid scramblase 1 PLSCR1 5 Chip `A` Fc fragment of IgG,
high affinity Ia, receptor for FCGR1A (CD64) 6 Chip `A`
carcinoembryonic antigen-related cell adhesion CEACAM1 molecule 1
(biliary glycoprotein) 7 Chip `A` serine (or cysteine) proteinase
inhibitor, clade G SERPING1 (C1 inhibitor), member 1, (angioedema,
hereditary) /// serine (or cysteine) proteinase inhibitor, clade G
(CI inhibitor), member 1, (angioedema, hereditary) 8 Chip `A` tumor
necrosis factor, alpha-induced protein 6 TNFAIP6 9 Chip `B` ankyrin
repeat domain 22 ANKRD22 10 Chip `B` epithelial stromal interaction
1 (breast) EPSTI1 11 Chip `B` hypothetical protein FLJ39885
FLJ39885 12 Chip `A` DNA polymerase-transactivated protein 6
DNAPTP6 13 Chip `A` interferon-induced protein 35 IF135 14 Chip `A`
2',5'-oligoadenylate synthetase 1, 40/46 kDa /// OAS1
2',5'-oligoadenylate synthetase 1, 40/46 kDa 15 Chip `A`
polycythemia rubra vera 1 /// polycythemia rubra PRV1 vera 1 16
Chip `A` serine/threonine kinase 3 (STE20 homolog, yeast) STK3 ///
serine/threonine kinase 3 (STE20 homolog, yeast) 17 Chip `A`
guanylate binding protein 1, interferon-inducible, GBP1 67 kDa 18
Chip `A` guanylate binding protein 1, interferon-inducible, GBP1 67
kDa /// guanylate binding protein 1, interferon- inducible, 67 kDa
19 chip `B` guanylate binding protein 1, interferon-inducible, GBP1
67 kDa 20 Chip `A` caspase 5, apoptosis-related cysteine protease
/// CASP5 caspase 5, apoptosis-related cysteine protease 21 Chip
`B` interferon-induced protein with tetratricopeptide IFIT4 repeats
4 22 Chip `A` G protein-coupled receptor 105 GPR105 23 Chip `B`
hypothetical protein BC012330 MGC20410 24 Chip `B` viperin cig5 25
Chip `B` hypothetical protein LOC129607 LOC129607 26 Chip `A`
interferon-induced protein 44 /// interferon- IFI44 induced protein
44 27 Chip `B` guanylate binding protein 5 GBP5 28 `Chip `B`
complement component 1, q subcomponent, C1QG gamma polypeptide 29
Chip `B` X1AP associated factor-1 HSX1APAF1 30 Chip `A` viperin
cig5 31 Chip `A` uridine phosphorylase 1 /// uridine phosphorylase
1 UPP1 32 Chip `A` promyelocytic leukemia PML 33 Chip `A`
lysosomal-associated membrane protein 3 /// LAMP3
lysosomal-associatcd membrane protein 3 34 Chip `A` 28 kD
interferon responsive protein /// 28 kD IFRG28 interferon
responsive protein 35 Chip `A` interferon, alpha-inducible protein
(clone IFI- G1P2 15K) /// interferon, alpha-inducible protein
(clone IFI-15K) 36 Chip `A` chromosome 1 open reading frame 29 ///
C1orf29 chromosome 1 open reading frame 29 /// 37 Chip `A`
interferon-induced protein 44 IFI44 38 Chip `B` Full length insert
cDNA clone ZA84A12 39 Chip `B` lipase A, lysosomal acid,
cholesterol esterase LIPA (Wolman disease) 40 Chip `A`
2',5'-oligoadenylate synthetase 1, 40/46 kDa OAS1 41 Chip `A`
myxovirus (influenza virus) resistance 1, MX1 interferon-inducible
protein p78 (mouse) /// myxovirus (influenza virus) resistance 1,
interferon-inducible protein p78 (mouse) 42 Chip `B` Full length
insert cDNA clone ZA84A12 43 Chip `A` sialoadhesin SN 44 Chip `A`
XIAP associated factor-1 /// XIAP associated HSXIAPAF1 factor-1 45
Chip `A` interferon-induced protein with tetratricopeptide IFIT1
repeats 1 /// interferon-induced protein with tetratricopeptide
repeats 1 46 Chip `A` 2'-5'-oligoadenylate synthetase 2, 69/71 kDa
OAS2 47 Chip `A` interferon, alpha-inducible protein 27 /// IFI27
interferon, alpha-inducible protein 27
[0426] From the genes listed above, a table of `Observed v.
Expected` table of GO classes and parent classes, in list of 47
genes shown above can be prepared to help elucidate the molecular
function (Table 8) and/or biological processes (Table 9) in which
the identified genes take part. Only GO classes and parent classes
with at least 5 observations in the selected subset and with an
`Observed vs. Expected` ratio of at least 2 are shown.
TABLE-US-00012 TABLE 8 Molecular Function Observed in Expected in
selected selected Observed/ GO id GO classification subset subset
Expected 0005525 GTP binding 5 0.83 5.99 0019001 guanyl nucleotide
5 0.84 5.92 binding 0017076 purine nucleotide 8 3.59 2.23 binding
0000166 nucleotide binding 8 3.62 2.21
TABLE-US-00013 TABLE 9 Biological Process Observed in Expected
selected in selected Observed/ GO id GO classification subset
subset Expected 0009615 response to virus 5 0.15 32.44 0006955
immune response 20 2.6 7.69 0009607 response to biotic 22 3.08 7.14
stimulus 0006952 defense response 20 2.81 7.12 0009613 response to
pest\, 9 1.45 6.21 pathogen or parasite 0043207 response to
external 9 1.47 6.13 biotic stimulus 0050874 organismal 22 3.88
5.67 physiological process 0050896 response to stimulus 22 4.89 4.5
0009605 response to external 9 2.49 3.61 stimulus 0006950 response
to stress 9 2.58 3.49
TABLE-US-00014 TABLE 10 Minimal Set Of Genes Used To Classify
Healthy Versus Convalescent Patients (Sorted by T-value) Geom mean
of Geom mean intensities of intensities Parametric % CV in class in
class Gene t-value p-value support 1: F_NE 2: H_ND Probe set Chip #
Description symbol 1 -4.61 2.8e-05 100 12.8 27.8 213642_at Chip `A`
ribosomal protein L27 RPL27 2 -4.27 8.8e-05 100 24.3 63.4
213941_x_at Chip `A` ribosomal protein S7 RPS7 3 4.04 0.000185 87
39.6 20.3 201280_s_at Chip `A` disabled homolog 2, mitogen- DAB2
responsive phosphoprotein (Drosophila) 4 4.13 0.000139 100 19.3 8.9
205116_at Chip `A` laminin, alpha 2 (merosin, congenital LAMA2
muscular dystrophy) /// laminin, alpha 2 (merosin, congenital
muscular dystrophy) 5 4.13 0.000138 100 182 75.1 213674_x_at Chip
`A` immunoglobulin heavy constant mu IGHM 6 4.2 0.000108 100 67.4
22.5 215621_s_at Chip `A` immunoglobulin heavy constant mu IGHM 7
4.57 3.3e-05 100 13.6 6.7 203780_at Chip `A` epithelial V-like
antigen 1 /// EVA1 epithelial V-like antigen 1 8 4.71 2e-05 98
103.5 51.5 227250_at Chip `B` kringle containing transmembrane
KREMEN1 protein 1
TABLE-US-00015 TABLE 11 Minimal Set Of Genes Used To Classify
Febrile With Adenovirus Versus Febrile Without Adenovirus Patients
(Sorted by T-value) Geom mean Geom mean of intensities of
intensities Parametric % CV in class in class t-value p-value
support 1: S_AD 2: S_NE Probe set Chip # Description Gene symbol 1
-5.15 7e-06 53 47.5 118.4 205227_at Chip `A` interleukin 1 receptor
accessory IL1RAP protein /// interleukin 1 receptor accessory
protein 2 5.18 6e-06 60 198.3 100 219062_s_at Chip `A` zinc finger,
CCHC domain ZCCHC2 containing 2 3 5.39 3e-06 100 356.9 129.5
214453_s_at Chip `A` interferon-induced protein 44 /// IFI44
interferon-induced protein 44 4 5.39 3e-06 100 54.2 12.3 233425_at
Chip `B` zinc finger, CCHC domain ZCCHC2 containing 2 5 5.4 3e-06
100 26 11.8 218548_x_at Chip `A` putative secreted protein ZSIG11
ZSIG11 /// putative secreted protein ZSIG11 6 5.43 3e-06 100 30.7
13.1 223096_at Chip `B` nucleolar protein NOP5/NOP58 NOP5/NOP58 7
5.73 1e-06 100 136.1 42 200923_at Chip `A` lectin,
galactoside-binding, LGALS3BP soluble, 3 binding protein ///
lectin, galactoside-binding, soluble, 3 binding protein 8 5.9 p
< 0.000001 100 354.3 180.2 223343_at Chip `B` membrane-spanning
4-domains, MS4A7 subfamily A, member 7 9 6.24 p < 0.000001 100
1128.4 226 202145_at Chip `A` lymphocyte antigen 6 complex, LY6E
locus E /// lymphocyte antigen 6 complex, locus E 10 6.5 p <
0.000001 100 116.4 64.6 204821_at Chip `A` butyrophilin, subfamily
3, BTN3A3 member A3 11 6.54 p < 0.000001 100 283.4 34.3
202411_at Chip `A` interferon, alpha-inducible protein IFI27 27 ///
interferon, alpha-inducible protein 27
[0427] Categorical and continuous metadata variables co-varying
with the four phenotypes above were assessed. The only categorical
variables that correlated with the four phenotypes involved the
lots of the PAX system used. These covariates were unlikely to
affect gene expression outcomes because the manufacturers have QC
their products for consistency. `Perceived Stress` showed
increasing qualitative trend with sickness, but this was expected.
This increase our confidence that our class prediction set of genes
is due to infection health status rather than other confounding
variables.
[0428] Tables 18, 22, and 26 provide a larger list of genes that
still give high percent correct to classification, in order of:
febrile versus non-febrile patients, febrile with adenovirus versus
without adenovirus patients, and healthy versus convalescent
patients, respectively. In Tables 18, 22, and 26, the composition
of classifiers is listed for genes significant at the 0.001 level
and is sorted by t-value.
[0429] Tables 16, 20, and 24 provide a detailed summary for the
performance of classifiers during cross-validation used for Tables
18, 22, and 26.
[0430] Tables 17, 21, and 25 provide further details as to the
performance of classifiers during cross-validation with respect to
Performance of the Compound Covariate Predictor Classifier,
Performance of the 1-Nearest Neighbor Classifier, Performance of
the 3-Nearest Neighbors Classifier, Performance of the Nearest
Centroid Classifier, Performance of the Support Vector Machine
Classifier, and Performance of the Linear Diagonal Discriminant
[0431] Analysis Classifier. Specifically, Tables 17, 21, and 25
reports the parameters used for each classification method and each
class.
[0432] For compilation of the data in Tables 17, 21, and 25, the
following formulae were employed:
[0433] Let, for some class A, [0434] n11=number of class A samples
predicted as A [0435] n12=number of class A samples predicted as
non-A [0436] n21=number of non-A samples predicted as A [0437]
n22=number of non-A samples predicted as non-A
[0438] Then the following parameters can characterize performance
of classifiers: [0439] Sensitivity=n11/(n11+n12) [0440]
Specificity=n22/(n21+n22) [0441] Positive Predictive Value
(PPV)=n111/(n11+n21) [0442] Negative Predictive Value
(NPV)=n22/(n12+n22)
[0443] Tables 19, 23, and 27 provides a table of `Observed v.
Expected` table of GO classes and parent classes, and lists the
frequency of genes reported in Tables 18, 22, and 26 to help
elucidate the cellular component, molecular function and/or
biological processes in which the identified genes take part. Only
GO classes and parent classes with at least 5 observations in the
selected subset and with an `Observed vs. Expected` ratio of at
least 2 are shown.
Class comparisons. To determine lists of genes that are
differentially expressed among the four phenotypes, class
comparisons were performed. Tables 28, 30, and 32 show the list of
genes found to be different between febrile versus non-febrile
patients, febrile with adenovirus versus without, and healthy
versus convalescents, respectively. Tables 29, 31, and 33 provide a
table of `Observed v. Expected` table of GO classes and parent
classes, and lists the frequency of genes reported in Tables 28,
30, and 32 to help elucidate the cellular component, molecular
function and/or biological processes in which the identified genes
take part. Only GO classes and parent classes with at least 5
observations in the selected subset and with an `Observed vs.
Expected` ratio of at least 2 are shown.
For Table 28--
[0444] Description of the Problem: [0445] Number of classes: 2
[0446] Number of genes: 44928 [0447] Number of genes that passed
filtering criteria: 15720 [0448] Type of univariate test used:
Two-sample T-test (with random variance model) [0449] Column of the
Experiment Descriptors sheet that defines class variable: Fever
status Multivariate Permutations test was computed based on 1000
random permutations [0450] Nominal significance level of each
univariate test: 0.001 [0451] Confidence level of false discovery
rate assessment: 90% [0452] Maximum allowed number of
false-positive genes: 10 [0453] Maximum allowed proportion of
false-positive genes: 0.1
[0454] Summary of Results: [0455] Number of genes significant at
0.001 level of the univariate test: 5768 [0456] Probability of
getting at least 5768 genes significant by chance (at the 0.001
level) if there are no real differences between the classes: 0
[0457] Genes which Discriminate Among Classes: [0458] Table
28--Sorted by p-value of the univariate test. [0459] The first 5768
genes are significant at the nominal 0.001 level of the univariate
test [0460] With probability of 90% the first 5142 genes contain no
more than 10 false discoveries. [0461] With probability of 90% the
first 6430 genes contain no more than 10% of false discoveries.
Further extension of the list was halted because the list would
contain more than 100 false discoveries
For Table 30
[0462] Description of the Problem: [0463] Number of classes: 2
[0464] Number of genes: 44928 [0465] Number of genes that passed
filtering criteria: 15720 [0466] Type of univariate test used:
Two-sample T-test (with random variance model) [0467] Column of the
Experiment Descriptors sheet that defines class variable: H ND vs.
F NE only [0468] Multivariate Permutations' test was computed based
on 1000 random permutations [0469] Nominal significance level of
each univariate test: 0.001 Confidence level of false discovery
rate assessment: 90% [0470] Maximum allowed number of
false-positive genes: 10 Maximum allowed proportion of
false-positive genes: 0.1
[0471] Summary of Results: [0472] Number of genes significant at
0.001 level of the univariate test: 2943 [0473] Probability of
getting at least 2943 genes significant by chance (at the 0.001
level) if there are no real differences between the classes: 0
[0474] Genes which Discriminate Among Classes: [0475] Table
30--Sorted by p-value of the univariate test. [0476] The first 2943
genes are significant at the nominal 0.001 level of the univariate
test With probability of 90% the first 2151 genes contain no more
than 10 false discoveries. [0477] With probability of 90% the first
4562 genes contain no more than 10% of false discoveries. Further
extension of the list was halted because the list would contain
more than 100 false discoveries
For Table 32
[0478] Description of the Problem: [0479] Number of classes: 2
[0480] Number of genes: 44928 [0481] Number of genes that passed
filtering criteria: 15720 [0482] Type of univariate test used:
Two-sample T-test (with random variance model) [0483] Column of the
Experiment Descriptors sheet that defines class variable: S AD vs.
S NE only [0484] Multivariate Permutations test was computed based
on 1000 random permutations [0485] Nominal significance level of
each univariate test: 0.001 [0486] Confidence level of false
discovery rate assessment: 90% [0487] Maximum allowed number of
false-positive genes: 10 [0488] Maximum allowed proportion of
false-positive genes: 0.1
[0489] Summary of Results: [0490] Number of genes significant at
0.001 level of the univariate test: 445 [0491] Probability of
getting at least 445 genes significant by chance (at the 0.001
level) if there are no real differences between the classes:
0.001
[0492] Genes which Discriminate Among Classes: [0493] Table
32--Sorted by p-value of the univariate test. [0494] The first 445
genes are significant at the nominal 0.001 level of the univariate
test [0495] With probability of 90% the first 229 genes contain no
more than 10 false discoveries. [0496] With probability of 90% the
first 758 genes contain no more than 10% of false discoveries.
[0497] However, because of differences in CBC (Table 12 below),
these differences in RNA could be due to cell type heterogeneity
and/or differential expression at the per cell level. Although
large expression differences are likely to be due to differential
expression at the per cell level because the differences in CBC
variables cannot likely to account for these large differences.
Statistical models would have to be developed to sort out these two
effects. Serendipitously, there were no differences in CBC for
comparisons between febrile with adenovirus versus without (Table
12 below).
TABLE-US-00016 TABLE 12 Complete Blood febrile w/ febriles w/o
Count (CBC) non-febriles febriles p-value healthy convalesents
p-value adenovirus adenovirus p-value WBC 7 32 11 26 <0 0001 6
83 7 84 0 1787 10 37 12 57 0 0929 LymCount 1 84 1 14 0 0000 1 93 1
75 0 0697 1 12 1 15 0 7528 MidCount 0 57 0 97 <0 0001 0 60 0 53
0 1664 0 83 1 18 0 0615 Monocytes 4 93 8 94 0 0000 4 33 5 57 0 0561
8 39 9 80 0 2329 LymPerc 26 38 11 64 0 0000 28 83 23 75 0 0163 11
85 11 32 0 7368 MidPerc 7 99 8 97 0 5036 9 03 6 87 0 0103 8 77 9 27
0 2547 GranPerc 66 31 80 85 0 0000 62 95 69 91 0 0028 80 27 81 75 0
5433 RBC 4 73 4 61 0 0696 4 84 4 60 0 0034 4 63 4 59 0 5952 HGB 14
29 14 00 0 1831 14 79 13 75 0 0004 13 96 14 06 0 9309 HCT 41 75 40
95 0 1565 43 00 40 41 0 0011 40 81 41 16 0 9827 MCV 88 32 88 84 0
4581 88 68 87 94 0 5825 86 21 89 76 0 1786 MCH 30 30 30 39 0 6288
30 64 29 94 0 2036 30 21 30 65 0 3510 MCHC 34 18 34 13 0 5067 34 38
33 97 0 0391 34 18 34 05 0 8193 RDW 14 07 13 69 0 0107 13 96 14 19
0 4554 13 74 13 61 0 5152 PLT 267 34 254 22 0 3079 258 21 277 15 0
3093 250 16 260 21 0 9568 MPV 9 56 9 53 0 8920 9 41 9 73 0 3330 9
73 9 25 0 0907
Differences in CBC between non-febriles versus febriles, healthy
versus convalescents, but not between febriles with versus without
adenovirus. P-value columns are from Wilcoxon testing for
differences in CBC variables between the groups. Highlights
indicate significant differences.
[0498] Therefore, one could surmise that the differentially
expressed genes were at the per cell level, suggesting that the
biomolecular pathways involving these genes are involved in
differences between adenovirus infection and non-adenovirus
infection. To determine these pathways, the gene list was
integrated with the KEGG pathway and the Genetic Association
databases using EASE (70) to elucidate the functions of these genes
in known pathways.
[0499] The results for the KEGG pathway database search are as
follows:
[0500] hsa00071 Fatty Acid Metabolism [0501] 2180 ACSL1; acyl-CoA
synthetase long-chain family member 1 [EC:6.2.1.3][SP:LCF1 HUMAN]
[0502] 51703 ACSL5; acyl-CoA synthetase long-chain family member 5
[EC:6.2.1.3] [SP:LCF5 HUMAN]
[0503] hsa00190 Oxidative Phosphorylation [0504] 1355 COX15; COX15
homolog, cytochrome c oxidase assembly protein (yeast) [0505] 522
ATP5J; ATP synthase, H+ transporting, mitochondrial F0 complex,
subunit F6 [EC:3.6.3.14] [SP:ATPR HUMAN]
[0506] hsa00193 ATP Synthesis [0507] 522 ATP5J; ATP synthase, H+
transporting, mitochondrial F0 complex, subunit F6 [EC:3.6.3.14]
[SP:ATPR HUMAN]
[0508] hsa00230 Purine Metabolism [0509] 3614 IMPDH1; IMP (inosine
monophosphate) dehydrogenase 1 [EC:1.1.1.205][SP:IMD1 HUMAN] [0510]
6241 RRM2; ribonucleotide reductase M2 polypeptide
[EC:1.17.4.1][SP:RIR2 HUMAN] [0511] 953 ENTPD1; ectonucleoside
triphosphate diphosphohydrolase 1 [EC:3.6.1.5] [SP:ENP1 HUMAN]
[0512] hsa00240 Pyrimidine Metabolism [0513] 6241 RRM2;
ribonucleotide reductase M2 polypeptide [EC:1.17.4.1][SP:RIR2
HUMAN] [0514] 7298 TYMS; thymidylate synthetase [EC:2.1.1.45]
[SP:TYSY HUMAN] [0515] 953 ENTPD1; ectonucleoside triphosphate
diphosphohydrolase 1 [EC:3.6.1.5] [SP:ENP1 HUMAN]
[0516] hsa00252 Alanine and Aspartate Metabolism [0517] 1615 DARS;
aspartyl-tRNA synthetase [EC:6.1.1.12] [SP:SYD HUMAN]
[0518] hsa00361 Gamma-Hexachlorocyclohexane Degradation [0519]
93650 ACPT; acid phosphatase, testicular [EC:3.1.3.2]
[0520] hsa00510 N-Glycans Biosynthesis [0521] 6185 RPN2; ribophorin
11 [EC:2.4.1.119] [SP:RIB2 HUMAN]
[0522] hsa00532 Chondroitin/Heparan Sulfate Biosynthesis [0523]
55501 CHST12; carbohydrate (chondroitin 4) sulfotransferase 12
[0524] hsa00561 Glycerolipid Metabolism [0525] 2710 GK; glycerol
kinase [EC:2.7.1.30] [SP:GLPK HUMAN]
[0526] hsa00670 One Carbon Pool by Folate [0527] 10588 MTHFS;
5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate
cyclo-ligase) [EC:6.3.3.2] [SP:FTHC HUMAN] [0528] 7298 TYMS;
thymidylate synthetase [EC:2.1.1.45] [SP:TYSY HUMAN]
[0529] hsa00740 Riboflavin metabolism [0530] 93650 ACPT; acid
phosphatase, testicular [EC:3.1.3.2]
[0531] hsa00920 Sulfur metabolism [0532] 55501 CHST12; carbohydrate
(chondroitin 4) sulfotransferase 12
[0533] hsa00970 Aminoacyl-tRNA Biosynthesis [0534] 1615 DARS;
aspartyl-tRNA synthetase [EC:6.1.1.12] [SP:SYD HUMAN]
[0535] hsa03022 Basal Transcription Factors [0536] 2965 GTF2H1;
general transcription factor 11H, polypeptide 1, 62 kDa [SP:TFH1
HUMAN]
[0537] hsa03050 Proteasome [0538] 10213 PSMD14; proteasome
(prosome, macropain) 26S subunit, non-ATPase, 14
[0539] hsa04010 MAPK Signaling Pathway [0540] 6416 MAP2K4;
mitogen-activated protein kinase kinase 4 [EC:2.7.1.-] [SP:MPK4
HUMAN] [0541] 7850 IL1R2; interleukin 1 receptor, type II [SP:IL1S
HUMAN]
[0542] hsa04060 Cytokine-Cytokine Receptor Interaction [0543] 1436
CSF1R; colony stimulating factor 1 receptor, formerly McDonough
feline sarcoma viral (v-fms) oncogene homolog [EC:2.7.1.112]
[SP:KFMS HUMAN] [0544] 1524 CX3CR1; chemokine (C-X3-C motif)
receptor 1 [SP:C3X1 HUMAN] [0545] 3556 IL1RAP; interleukin 1
receptor accessory protein [0546] 7850 IL1R2; interleukin 1
receptor, type II [SP:IL1S HUMAN]
[0547] hsa04110 Cell Cycle [0548] 1028 CDKN1C; cyclin-dependent
kinase inhibitor 1C (p57, Kip2) [SP:CDNC HUMAN] [0549] 4171 MCM2;
MCM2 minichromosome maintenance deficient 2, mitotin (S.
cerevisiae) [0550] 4175 MCM6; MCM6 minichromosome maintenance
deficient 6 (MISS homolog, S. pombe) (S. cerevisiae) [SP:MCM6
HUMAN] [0551] 5111 PCNA; proliferating cell nuclear antigen
[SP:PCNA HUMAN]
[0552] hsa04120 Ubiquitin Mediated Proteolysis [0553] 54926 UBE2R2;
ubiquitin-conjugating enzyme E2R 2
[0554] hsa04210 Apoptosis [0555] 3556 IL1RAP; interleukin 1
receptor accessory protein 5573 PRKAR1A; protein kinase,
cAMP-dependent, regulatory, type I, alpha (tissue specific
extinguisher 1) [SP:KAP0 HUMAN]
[0556] hsa04310 Wnt Signaling Pathway [0557] 6934 TCF7L2;
transcription factor 7-like 2 (T-cell specific, HMG-box)
[0558] hsa04350 TGF-Beta Signaling Pathway [0559] 3398 ID2;
inhibitor of DNA binding 2, dominant negative helix-loop-helix
protein [SP:ID2 HUMAN]
[0560] hsa04610 Complement and Coagulation Cascades [0561] 712
C1QA; complement component l, q subcomponent, alpha polypeptide
[SP:C1QA HUMAN] [0562] 966 CD59; CD59 antigen p18-20 (antigen
identified by monoclonal antibodies 16.3A5, EJ16, EJ30, EL32 and
G344) [SP:CD59 HUMAN]
[0563] hsa04611 [0564] 712 C1QA; complement component l, q
subcomponent, alpha polypeptide [SP:C1QA HUMAN] [0565] 966 CD59;
CD59 antigen p18-20 (antigen identified by monoclonal antibodies
16.3A5, EJ16, EJ30, EL32 and G344) [SP:CD59 HUMAN]
[0566] hsa04620 Toll-Like Receptor Signaling Pathway [0567] 6416
MAP2K4; mitogen-activated protein kinase kinase 4 [EC:2.7.1.-]
[SP:MPK4 HUMAN] [0568] 6772 STAT1; signal transducer and activator
of transcription 1, 91 kDa [SP:STA1 HUMAN]
[0569] hsa04630 Jak-STAT Signaling Pathway [0570] 6772 STAT1;
signal transducer and activator of transcription 1, 91 kDa [SP:STA1
HUMAN] [0571] 868 CBLB; Cas-Br-M (murine) ecotropic retroviral
transforming sequence b
[0572] hsa05110 Cholera--Infection [0573] 377 ARF3;
ADP-ribosylation factor 3 [SP:ARF3 HUMAN]
[0574] A batch search of the Genetic Association database was
performed for the following genes: CX3CR1, TRIM14, ARF3, BRD7,
PILRB, ENTPD1, CSF1R, RABGAP1, ICAM2, KLHL2, PUM1, MTHFS, LY6E,
MRPL47, NPM1, C12orf8, TNFAIP3, CHES1, SIP1, MYOZ2, ATP5J, IF144,
SEC14L1, G1P2, GTF2H1, FBXO2, USP18, ACPT, SP100, AIP, ABHD5, SCO2,
PWWP1, RAN, GRN, MX1, SLC1A4, GZMB, SNRPA1, IMPDH1, TARDBP, ZCCHC2,
IER5, CBLB, STAT1, WBSCR20A, MEA, TNRC6, MAK, TCF7L2, TINF2,
HNRPH1, HNRPH2, GK, SART3, HIFX, PTP4A2, PSMD14, EIF3S4, BTN3A3,
LETM1, TIMM23, HIVEP2, USP22, MTIL, C1QA, IL1RAP, MS4A7, NICAL,
KBTBD7, C1orf29, PNUTL2, RPN2, ILF3, PCNA, HMGB1, BAG1, MCM2, TYMS,
MTIX, CPD, COX15, MCM6, SN, C6orf133, BACE2, SYT6, OAS1, FACL2,
OAS2, C6orf209, NUP98, PRKAR1A, OAS3, CHST12, FACL5, SLP1, CD59,
IFIT1, IFI27, SORL1, RNPC4, IFIT4, HMGN4, CECR1, CDCA7, MTSS1,
C6orf37, CDKN1C, RBPSUH, IL1R2, YWHAQ, RRM2, DARS, UBE2R2, SFRS7,
FCGR2A, OASL, ID2, PLCL2, LGALS3BP, KPNA2, and MAP2K4.
[0575] Of these genes, the following hits were returned:
[0576] CX3CR1 [0577] 1) Disease Class=Infection; Broad Phenotype
(Disease)=HIV/SIV infection; [0578] 2) Disease Class=Unknown; Broad
Phenotype (Disease)=Human Renal Transplantation;
[0579] SCO2 [0580] 1) Disease Class=Cardiovascular; Broad Phenotype
(Disease)=hypertrophic cardiomyopathy and cytochrome c oxidase
deficiency;
[0581] FCGR2A [0582] 1) Disease Class=Infection; Broad Phenotype
(Disease)=Severe Malaria; [0583] 2) Disease Class=Infection; Broad
Phenotype (Disease)=fulminant meningococcal septic shock in
children; [0584] 3) Disease Class=Immune; Broad Phenotype
(Disease)=atopic disease; [0585] 4) Disease Class=Immune; Broad
Phenotype (Disease)=rheumatoid arthritis; [0586] 5) Disease
Class=Immune; Broad Phenotype (Disease)=systemic lupus
erythematosus.
Example 4
Effects of Two Globin mRNA Reduction Methods on Gene Expression
Profiles from Whole Blood
Materials and Methods
[0587] Sample collection. With approval of the Lackland AFB IRB and
after informed consent, approximately 25 ml of blood, filling 10
PAX tubes, were drawn from each healthy volunteer. Blood was drawn
into PAX tubes by standard protocol {Preanalytix #23*}. All PAX
tubes were maintained at room temperature for 2 hrs, then frozen at
-20.degree. C., stored at -80.degree. C. for 5 days, and shipped on
dry-ice to the Navy Research Laboratory in Washington, D.C. for
processing.
[0588] Sample processing. Blood collection and RNA isolation was
performed using the PAX System, which consists of an evacuated tube
(PAX tube) for blood collection and a processing kit (PAX kit) for
isolation of total RNA from whole blood {*Jurgensen #32; Jurgensen
#33}. The isolated RNA underwent globin reduction procedures and
was amplified, labeled, and interrogated on the HG-U133 plus 2.0
Genechip.RTM. microarrays (Affymetrix).
[0589] Total RNA isolation from blood. Frozen PAX tubes were thawed
at room temperature for 2 hrs followed by total RNA isolation as
described in the PAX kit handbook {*Preanalytix #24}, but modified
to aid in tight pellet formation by increasing proteinase K from 40
.mu.l to 80 .mu.l (>600 mAU/ml) per sample, extending the
55.degree. C. incubation time from 10 min to 30 min, and passing
through a QIAshredder spin column (Qiagen). The optional on-column
DNase digestion was not carried out. Purified total RNA was stored
at -80.degree. C.
[0590] Total RNA cleanup and concentration. For more complete
removal of DNA from purified RNA, duplicate RNA samples were
pooled, followed by in-solution DNase treatment using the
DNA-free.TM. kit (Ambion), but without addition of DNase
inactivation reagent. After DNase treatment, RNA were subjected to
RNAeasy MinElute Cleanup (Qiagene cat#74204) and concentrated
according to the manufacturer's procedure. Subsequently, one
microliter from each sample was run on the bioanalyzer 2100
(Agilent) for assessment of RNA quality while the nanodrop
(NanoDrop) was used for quantification. Usage of the bioanalyzer
was analogous to capillary gel electrophoresis. This resulted in
electropherograms displaying florescent intensity versus time,
which correlates with the amount of RNA versus the size of RNA,
respectively.
[0591] Globin reduction and target preparation. To remove globin
mRNA, biotinylated globin capture oligos (Ambion Globinclear kit)
and PNA (Affymetrix GeneChip Globin Reduction kit) were used
according to modified manufacturers' procedures. In brief, for the
Globinclear's procedure, biotinylated globin capture oligos were
added to 5 .mu.g total RNA and globin mRNA were removed by
strepavidin magnetic beads. Then the remaining globin-reduced total
RNA was purified using magnetic beads and eluted in 30 .mu.l, of
water. One microliter of RNA was used for bioanalyzer measurement
and the remaining RNA was concentrated to 8 .mu.L using Speed Vac
concentration at room temperature. For the PNA globin reduction
procedure, 5 .mu.g of total RNA in 9 .mu.l. BR5 from the RNAeasy
MinElute Cleanup step was used for the downstream procedure. The
column that came with the Globin Reduction kit was not used. All
subsequent steps were as described in the GeneChip Expression
Analysis Technical Manual version 701021 Rev. 3.
[0592] Database integration. Laboratory data contained information
about the processing of samples from blood in PAX tubes to cRNA
target preparation, as well as bioanalyzer and nanodrop
measurements. Electropherograms were analyzed by the Biosizing
software (Agilent) to output 28S/18S intensity ratios and RIN QC
metrics while the nanodrop output RNA quantity and 260/280 ratios.
Report files summarizing the quality of target detection for an
array were generated by GeneChip.RTM. Operating Software 1.1
(Affymetrix). JMP (SAS) was used to join these various data tables
together into a metadata table. For gene-expression data, Signal
values were calculated using the Microarray Suite 5.0 algorithm
with and without scaling to test the effects on various downstream
analytical methods.
[0593] Statistical analysis. Statistical quality control and
relations among metadata variables and gene expression profiles
were analyzed in JMP. ANOVAs, multidimensional scaling, and
functional analysis of gene-expression data were performed in
Arraytools 3.2.0. Beta developed by Richard Simon and Amy Lam
(http://linus.nci.nih.gov/BRB-ArrayTools.html). Heat-maps and
dendrograms were graphed using dChip {Li, 2001 #41; Li, 2001 #42}.
Scaled expression data showed no differences in Scale Factors among
treatment groups.
Results
[0594] Quality of RNA, globin reduction, and target preparation.
The following RNA samples were used to study the effects of two
globin reduction methods on gene expression profiles:
[0595] 1) Jurkat RNA isolated from Jurkat cell line (J)
[0596] 2) Jurkat RNA with globin mRNA spiked-in (JG)
[0597] 3) Paxgene RNA from whole blood (B)
[0598] The globin reduction protocols tested were:
[0599] 1) Ambion's Globinclear method using biotinylated globin
capture oligos (A)
[0600] 2) Affymetrix' method using PNA oligos (P)
[0601] 3) No globin reduction treatment as technical control
(C).
[0602] The same lot of J and JG RNA were used throughout. RNA
treated with Ambion globinclear had .about.90% recovery for J and
JG RNA. The yields of cRNA for the Ambion group were the lowest
among the three technical conditions for each RNA species; however,
RNA purity judged by the ratio of 260/280 for Ambion globinclear
group was the highest (Table 13).
TABLE-US-00017 TABLE 13 Comparison of pre-hybridization variables
and post-hybridization chip results in RNA species with different
treatment RNA Jurkat RNA + Jurkat RNA Globin Treatment Ambion PNA
Control Ambion PNA Starting 4 4 4 4 4 material (.mu.g) Yields after
3.56 .+-. 0.41 4 4 3.43 .+-. 0.24 4 treatment Adjusted 71.13 .+-.
5.412 96.4 .+-. 30.66 113.47 .+-. 40.77 58.33 .+-. 2.91 107.93 .+-.
29.99 cRNA yield 260/280 for 2.01 .+-. 0026 1.98 .+-. 0.035 1.92
.+-. 0.047 2.03 .+-. 0.02 1.95 .+-. 0.05 cRNA Results Present Calls
46.8 .+-. 1.18 45.5 .+-. 0.62 44.8 .+-. 1.65 41.5 .+-. 0.83 37.4
.+-. 0.7 (%) Scale Factors 4.50 .+-. 1.38 3.98 .+-. 0.62 4.42 .+-.
0.52 5.13 .+-. 1.06 5.10 .+-. 0.50 Background 64.21 .+-. 12.46
68.47 .+-. 11.30 60.91 .+-. 3.71 56.06 .+-. 3.18 70.90 .+-. 5.86
Noise 3.36 .+-. 0.71 3.58 .+-. 0.70 3.40 .+-. 0.29 2.92 .+-. 0.28
4.02 .+-. 0.75 3'/5' GAPDH 1.06 .+-. 0.04 1.05 .+-. 0.03 1.09 .+-.
0.07 1.06 .+-. 0.07 1.09 .+-. 0.10 3'/5'Actin 1.33 .+-. 0.15 1.23
.+-. 0.06 1.31 .+-. 0.03 1.25 .+-. 0.01 1.17 .+-. 0.05 RNA Jurkat
RNA + Globin Paxgene Treatment Control Ambion PNA Control Starting
4 5 5 5 material (.mu.g) Yields after 4 3.71 .+-. 0.32 5 5
treatment Adjusted 124.27 .+-. 30.96 25.87 .+-. 3.91 30.61 .+-.
17.05 41.18 .+-. 7.76 cRNA yield 260/280 for 1.85 .+-. 0.02 2.13
.+-. 0.02 2.08 .+-. 0.02 2.06 .+-. 0.01 cRNA Results Present Calls
32.37 .+-. 1.56 39.33 .+-. 1.38 38.53 .+-. 2.39 32.77 .+-. 1.39 (%)
Scale Factors 5.41 .+-. 0.89 7.78 .+-. 1.82 7.40 .+-. 1.17 10.6
.+-. 80.71 Background 86.6 .+-. 4.22 57.59 .+-. 3.19 61.27 .+-.
5.58 54.27 .+-. 5.17 Noise 5.34 .+-. 0.10 3.23 .+-. 0.34 3.34 .+-.
0.45 3.07 .+-. 0.40 3'/5' GAPDH 1.14 .+-. 0.02 1.70 .+-. 0.11 3.59
.+-. 1.86 2.25 .+-. 0.11 3'/5'Actin 1.05 .+-. 0.03 2.55 .+-. 0.30
5.94 .+-. 3.74 3.16 .+-. 0.26
[0603] Profiles of cRNA for J and JG RNA compared using the
bioanalyzer (FIG. 8A, B) indicated that JG RNA treated with Ambion
(JGA) and JG RNA treated with PNA (JGP) had a significantly reduced
globin peak (arrow in FIG. 8A) and globin band (FIG. 8B) relative
to JGC. The electropherogram and gel profiles for JGA and JGP were
very similar to Jurkat RNA without treatment (JC). There was no
difference in cRNA profiles derived from JC, or Jurkat RNA treated
with Ambion globinclear (JA) or with the PNA globin reduction
procedure (JP) (data not shown).
[0604] There was no biological variation among paxgene RNA, since
paxgene RNA used for each technical condition was derived from the
pooled paxgene tubes collected from the same individual in one
bleeding. Paxgene RNA with a ratio 260/280 between 1.9-2.1 was used
as starting RNA and .about.75% recovery for paxgene RNA (Table
13)
[0605] Decreasing globin peaks and band were also seen in cRNA
profiles derived from paxgene RNA samples treated with Ambion
globinclear (BA) and PNA globin reduction (BP) compared to BC (no
treatment) (arrow in FIGS. 8C and D). However, the cRNA size from
BA was larger than BP. Overall, our result demonstrated that both
Ambion globinclear and the PNA globin reduction protocols decreased
globin mRNA contaminants effectively.
[0606] Quality of microarray measurements for each technical
condition For microarray data quality assessment, poly A control
graphs for each microarray were plotted using scaling signal
intensity and non-scaling data. Linearity was achieved among the
four control probe sets for all samples (data not shown). All of
the constants and major variables, such as scale factors (SF),
background, and noise (see Table 13) obtained from RPT report were
assessed using the ANOVA and Wilcoxon tests. There was no
statistically significant difference in SF and noise among JA, JC,
JP, JGA, JGP and JGC, neither in BA, BP and BC. Thus, scaling
signal intensities for all probe sets were used in the gene
expression profile comparison. For Jurkat RNA, background was
highest in JGC and was significantly different from the others,
possibly due to the spiked globin mRNA. There was no difference in
background among all paxgene RNA. Ratios of 3'/5' GAPDH for all
microarrays were all below 5 and indicated that there was no RNA
degradation. A slightly higher ratio of 3'/5' Actin and GAPDH was
noted in paxgene RNA with PNA treatment, possibly due to the
reduction of cRNA size (BP in FIG. 8C). Since no significant
difference in other variables was detected, we conducted further
statistical analysis and comparison of gene expression
profiles.
[0607] Globin removal increases number of present calls (%) and
call concordance in gene expression Removal of globin by both
methods significantly increased the number of present calls (%) in
JGA, JGP, BA, BP compared to their corresponding controls, JGC and
BC (ANOVA, Wilcoxon test); however, there was no difference among
three technical conditions in Jurkat RNA using the ANOVA and
Wilcoxon tests. Further analysis of these methods with the student
t-test revealed statistically significant higher present calls in
JGA than JGP (student t-test, p<0.05), but there was no
significant difference in paxgene RNA between BA and BP (Table 13).
The present Call concordance among Jurkat RNA for the three
technical conditions was compared and a gene subset containing
19731 genes, called JCAP, which was not affected by technical
conditions (JCAP in FIG. 9A) was identified to serve as a control
gene set for JG RNA. The present calls for JGA and JGP were then
compared to JCAP, resulting in 18176 (=16349+1827) genes present in
both JCAP and JGA and 16782 (=16349+433) genes present in both JCAP
and JGP (FIG. 9B), while there were only 14069 genes present in
both JCAP and JGC (data not shown). Our data indicated that JGA
exhibited 1394 additional concordant calls relative to JGP and 4107
additional concordant calls relative to JGC. For the paxgene RNA,
BA/BP had 2104 additional concordant calls present relative to
BA/BC and 2406 additional concordant calls present relative to
BC/BP (FIG. 9C).
[0608] In addition to assessing present call concordance, the
overall call concordance excluding margin calls between Jurkat and
JG RNA was tabulated and the percentages of false positive and
negative among technical conditions were compared (Table 14). Our
data demonstrated that JGA and JGP increased concordant present
calls by 8% and 5%, respectively, relative to JGC had 7% and 4%
increased false negative calls compared to JGA and JGP,
respectively. False positive present calls occurred in 1% and 0.22%
of JGA and JGP processed samples, respectively, compared to JGC.
Calculated sensitivities for JGA, JGP and JGC compared to the "gold
standard" of Jurkat RNA were 86%, 79.5% and 68.2%, respectively.
Specificity was retained with all processing methods with specific
values for JGA, JGP and JGC being 94.3%, 96.2% and 96.2%,
respectively. The data suggests that the Ambion globinclear method
had significantly higher sensitivity percent present calls without
significant loss of specificity relative to JGC (Table 15).
TABLE-US-00018 TABLE 14 Comparison of Pearson correlation
coefficient Treatment Description Pearson correlation coefficient
Triplates in each sample Mean .+-. stdev Jurkat-Ambion 0.985 .+-.
0.009 Jurkat-PNA 0.993 .+-. 0.003 Jurkat-no treatment 0.993 .+-.
0.001 Jurkat + Globin-Ambion 0.992 .+-. 0.005 Jurkat + Globin-PNA
0.996 .+-. 0.001 Jurkat + Globin-No treatment 0.993 .+-. 0.004
Paxgene-Ambion 0.997 .+-. 0.001 Paxgene-PNA 0.987 .+-. 0.009
Paxgene-No treatment 0.996 .+-. 0.001 Between Techniques Jurkat RNA
Ambion vs. No treatment 0.986 .+-. 0.005 PNA vs. No treatment 0.992
.+-. 0.004 Ambion vs. PNA 0.987 .+-. 0.006 Jurkat + Globin-RNA
Jurkat RNA 0.966 .+-. 0.011 Ambion vs. No treatment 0.983 .+-.
0.003 PNA vs. No treatment 0.985 .+-. 0.002 Paxgene blood RNA
Jurkat RNA 0.978 .+-. 0.006 Ambion vs. No treatment 0.967 .+-.
0.006 PNA vs. No treatment 0.979 .+-. 0.003 Between RNA species
Jurkat vs. Jurkat + Globin JA/JGA 0.962 .+-. 0.007 JP/JGA 0.963
.+-. 0.006 JC/JGA 0.963 .+-. 0.003 JA/JGP 0.960 .+-. 0.006 JP/JGP
0.967 .+-. 0.005 JC/JGP 0.967 .+-. 0.002 JA/JGC 0.942 .+-. 0.015
JP/JGC 0.946 .+-. 0.014 JC/JGC 0.952 .+-. 0.010
TABLE-US-00019 TABLE 15 Cross tabulation for call concordance JGA
JGP JGC Calls (%) P A P A P A Jurkat RNA P 21100 .+-. 367 3455 .+-.
594 19350 .+-. 338 5055 .+-. 761 16733 .+-. 679 7583 .+-. 1003
Jurkat RNA A 1359 .+-. 261 27296 .+-. 568 938 .+-. 165 27795 .+-.
714 822 .+-. 124 27926 .+-. 740 P = PNA globin reduction A = Ambion
globinclear
[0609] Variance caused by two globin reduction methods Signal
variation among triplicates was assessed by comparing the
coefficient of variance (CV) (FIG. 10). Since there was no
statistical difference in scaling factors for each technical
condition, scaling signal intensities for all probe sets were used
to plot CV graphs and Loess fitting with 2 degree freedom was
introduced to fit the curves. Higher CV introduced by technical
conditions was seen either in JA or JP compared to JC (dash lines
in FIG. 10A). However, globin removal by biotinylated globin oligos
and PNA significantly reduced the variation for each corresponded
technical condition in JG RNA (solid lines in FIG. 10A). JA had the
highest CV among all, especially in gene sets with signal
intensities greater than 10.sup.4. This high CV could be due to the
multistep globinclear procedure. In contrast, in paxgene RNA, CV
among globinclear triplicates was as low as no treatment. RNA
species and purity may affect technical variation caused by
globinclear. In paxgene RNA, CV for PNA triplicates was the highest
among all technical conditions (FIG. 10B) possibly due to reduction
of cRNA size from PNA oligo treatment (FIG. 8C).
[0610] In addition to CV (%) comparison, Pearson correlation
coefficient (again-it was difficult for me to determine whether any
of these observations was significant) was also calculated and
compared in each triplicate between technical conditions within the
same RNA species and between RNA species (Table 15). Higher signal
correlation was seen within triplicates compared to that seen
between technical conditions or between RNA species. In JG RNA,
globin removal by biotinylated globin oligos (Ambion) had lower
signal correlation with no treatment JGC (0.966), but JGP has
higher correlation (0.983) with JGC. This indicated that
globinclear JG RNA has more difference in gene expression profile
relative to JGC than JGP. In paxgene RNA, PNA treatment has lower
signal correlation (0.967) with no treatment (BC), but JGA higher
correlation (0.978) with BC. This suggested that more difference in
gene expression were seen in BP and BC than BA and BC. Removal of
globin mRNA from paxgene RNA or JG RNA resulted in higher signal
correlation in the same RNA species or between Jurkat and
Jurkat+Globin RNA (between RNA species in Table 15).
[0611] Multidimensional scaling cluster analysis of gene expression
profiles To further evaluate correlation between groups of samples
for each technical condition, multidimensional scaling (MDS)
cluster analysis was conducted. Since non-scaling data and scaling
data exhibited similar clustering pattern, we only showed MDS plots
using all probe sets with non-scaling signal intensities (FIG. 11).
Our data indicated that each triplicate was tightly clustered and
triplicate clusters for Jurkat RNA with different technical
conditions were close to one another. Triplicate clusters for JG
RNA with different technical conditions were more separated from
each other than those from Jurkat RNA with the JGA triplicate
cluster located closest to the Jurkat RNA cluster (FIG. 11A).
Paxgene RNA also formed three separate triplicate clusters
corresponding to each technical condition (FIG. 11B).
[0612] Hierarchal cluster analysis of gene expression profiles The
overall expression profiles for Jurkat and JG RNA samples with
different technical conditions were analyzed using center
correlation and average linkage parameters (FIG. 12A). Consistent
with the MDS plot, removal of globin mRNA from JG RNA samples by
biotinylated globin oligos revealed similar gene expression
profiles to the Jurkat RNA group and were clustered in the same
group with Jurkat RNA samples (FIG. 12A). These 18 chips were
grouped into six classes as JA, JP, JC, JGA, JGP and JGC and gene
expression profiles were compared among these classes using the
univariate test in the Random Variance model. The class comparison
resulted in 8614 differentially expressed genes, which were further
clustered using dChip software analysis.
[0613] We divided these differentially expressed genes into 4
groups as indicated on the right side of the dendrogram (FIG. 12B).
Group I represented most of down-regulated genes in JGA and all
Jurkat RNA samples and it included globin genes and genes affected
by globin mRNA cross hybridization. Group II represented
upregulated genes in Jurkat RNA samples, but down-regulated in all
of JG samples. This could include some false negative genes shown
in Table 15. False negative genes could result from a negative
impact caused by globin RNA noise resulting in low signal
intensities Group III represented genes that could be revealed
after globin RNA reduction with biotinylated globin oligos
protocol, but remained down-regulated with PNA protocol and no
treatment (III in FIG. 12B). Group IV represented unique
up-regulated genes resulting from biotinylated globin oligos
protocol. This group could include some false positive genes in
Table 14.
[0614] Using the same approach, gene expression profiles and
differentially expressed gene profiles among BA, BP, and BC, with
total of 9 paxgene blood RNA samples were analyzed and clustered
using center correlation and average linkage. Our results revealed
that removal of globin mRNA using biotinylated globin oligos and
PNA oligos revealed more similar gene expression profile and were
clustered within the same group possibly due to globin
reduction
[0615] (FIG. 12C). Moreover, there were 1988 differentially
expressed genes among paxgene blood RNA samples using the
univariate test for Random Variance model (FIG. 12D). The cluster
analysis result indicated that differentially expressed gene
profiles for BA and BC were more similar than BP. This is
consistent with higher correlation between BA and BC (Table
14).
Example 5
Surveillance of Transcriptomes in Basic Military Trainees with
Normal, Febrile Respiratory Illness, and Convalescent
Phenotypes
Materials and Methods
[0616] Entry criteria and sample collection. LAFB is the location
of Basic Military Training for all recruits to the United States
Air Force. The BMTs are organized into flights of 50-60 individuals
that eat, sleep, and train in close quarters. As many as 40-50
BMTs/week present with FRI and 50-70% are due to adenovirus. With
approval of LAFB IRB and after informed consent, approximately 15
ml of blood, filling 4 to 5 PAX tubes, were drawn from each
volunteer. On day 1-3 of training, blood was drawn from healthy
BMTs into PAX tubes by standard protocol {Preanalytix #23}, but no
nasal wash was collected for this group. During training, BMTs who
presented with a temperature of 38.1.degree. C. or greater and FRI
provided a nasal wash and blood draw. These individuals were
categorized into either the FRI without adenovirus or with
adenovirus group. Approximately three weeks after sample collection
from the FRI volunteers with adenovirus, additional blood and nasal
wash were collected to constitute samples for the convalescent
group. All PAX tubes were maintained at room temperature for 2 hrs,
then frozen at -20.degree. C. and shipped on dry-ice to the Navy
Research Laboratory in Washington, D.C. for processing. Nasal
washes were performed using a standard protocol, with 5 ml of
normal saline lavage of the nasopharynx, followed by collection of
the eluent in a sterile container. Nasal wash eluent was stored at
4.degree. C. for 1-24 hrs before being aliquotted and sent for
adenoviral culture. All BMTs underwent standardized questionnaires
before each sample collection. Healthy individuals were screened
for acute medical illness within 4 weeks of arriving at basic
training. BMTs were screened for race/ethnicity, allergies, recent
injuries, and smoking history to assess confounding variables for
gene expression. The duration and type of respiratory symptoms to
include sore throat, sinus congestion, cough, fever, chills,
nausea, vomiting, diarrhea, fatigue, body aches, runny nose,
headache, chest pain and rash were recorded. A physical examination
was recorded.
[0617] Sample processing. Blood collection and RNA isolation was
performed using the PAX System, which consists of an evacuated tube
(PAX tube) for blood collection and a processing kit (PAX kit) for
isolation of total RNA from whole blood {Jurgensen #32; Jurgensen
#33}. The isolated RNA was amplified, labeled, and interrogated on
the HG-U133A and HG-U133B Genechip.RTM. microarrays (Affymetrix),
noted here as A and B arrays, respectively.
[0618] Total RNA isolation from blood. Frozen PAX tubes were thawed
at room temperature for 2 hrs followed by total RNA isolation as
described in the PAX kit handbook {Preanalytix #24}, but modified
to aid in tight pellet formation by increasing proteinase K from 40
.mu.l to 80 .mu.l (>600 mAU/ml) per sample, extending the
55.degree. C. incubation time from 10 min to 30 min, and the
centrifugation time to 30 min or more. The optional on-column DNase
digestion was not carried out. Purified total RNA was stored at
-80.degree. C.
[0619] Target preparation. For more complete removal of DNA from
purified RNA, duplicate RNA samples were pooled, followed by
in-solution DNase treatment using the DNA-free.TM. kit (Ambion).
However, to facilitate removal of the DNase inactivating beads, the
completed reaction was spun through a spin column (Qiagen,
Cat#79523), rather than attempting to pipette off the supernatant
without disturbing the bead pellet. Subsequently, one microliter
from each sample was run on the bioanalyzer (Agilent) for
assessment of RNA quality and quantity. The usage of the
bioanalyzer was analogous to capillary gel electrophoresis. This
resulted in electropherograms displaying florescent intensity
versus time (FIG. 13a), which correlates with the amount of RNA
versus the size of RNA, respectively. Next, 5 .mu.g of RNA were
concentrated via ethanol precipitation as previously described
{Thach, 2003 #18}. All subsequent steps were as described in the
GeneChip Expression Analysis Technical Manual version 701021 Rev.
3.
[0620] Database integration. The database consisted of clinical
data such as information transcribed from standardized
questionnaires, the complete blood count (CBC), and the handling of
blood samples. Laboratory data contained information about the
processing of samples, from blood in PAX tubes to RNA extraction,
as well as subsequent bioanalyzer measurements. Electropherograms
were analyzed by the Biosizing (Agilent) software to output 28S/18S
intensity ratios and RNA yields, and by the Degradometer 1.1 {Auer,
2003 #26} software to consolidate, scale, and calculate degradation
and apoptosis factors. Report files summarizing the quality of
target detection for an array were generated by GeneChip.RTM.
Operating Software 1.1 (Affymetrix). JMP (SAS) was used to join
these various data tables together into a metadata table with more
than a thousand columns. For gene-expression data, Signal values
were calculated using the Microarray Suite 5.0 algorithm with no
scaling or normalization. This allows for subsequent testing of
various scaling and normalization methods.
[0621] Statistical analysis. Statistical quality control and
relations among metadata variables were analyzed in JMP. ANOVAs and
class prediction of phenotypes using gene-expression data were
performed in Arraytools 3.2.0 Beta developed by Richard Simon and
Amy Lam (http://linus.nci.nih.gov/BRB-ArrayTools.html). Heat-maps
and dendrograms were graphed using dChip {Li, 2001 #41; Li, 2001
#42}. Analysis of gene functions was aided by Arraytools and EASE
{Hosack, 2003 #30}. Data analysis was performed primarily by
D.T.
[0622] Scaling was carried out for gene-expression data. For each
blood sample, the same hybridization cocktail went onto the A and
then the B array, allowing concatenation of the data from the two
arrays to form a virtual array. This bypassed issues with analyzing
the two data sets separately. The 100 control probesets common
between the A and B arrays were selected based on stability in
expression from a large study of various tissue types {Affymetrix,
2002 #27}. Thus, all array data were scaled to a target value of
500 using the trimmed mean of the 100 control probesets. This
resulted in stable Scale Factors (SF) over time and no differences
in SF among the infection status phenotypes (ANOVA, P=0.1047 A
arrays, P=0.1782 B arrays). This scaling method allowed for the
concatenation of corresponding A and B arrays and should also
remove variations that are not gene-specific.
Results
[0623] Clinical Phenotypes. Thirty healthy, 19 with FRI and
negative by culture for adenovirus, 30 with FRI and positive by
culture for adenovirus, and 30 convalescing from
adenovirus-positive FRI were enrolled in this study. Enrollees in
these four infection status phenotypes were matched for age .+-.3
years and race/ethnicity. Only male BMTs were enrolled. After
selection of samples meeting standards for gene expression
analysis, 17 FRI without adenovirus had been ill for 5.+-.3 days
(median.+-.SD), whereas 26 FRI with adenovirus had been ill for
8.+-.4 days (P=0.006, Wilcoxon). The incidence of symptoms over all
the groups was: sore throat (95.3%), cough (93%), sinus congestion
(90.7%), headache (88%), chills (84%), rhinorrhea (81%), body aches
(65%), malaise (63%), nausea (54%), diarrhea (14%), pleuritic chest
pain (14%), vomiting (14%), and rash (0%), with no significant
differences between the FRI groups. There was also no significant
difference in allergies, recent injuries, and smoking history among
the infection status phenotypes.
[0624] Quality and variations of RNA derived from PAX system from
the BMT population. In order to identify clinically relevant gene
expression profile differences for phenotypes in a population, it
is essential that the RNA sample applied to the microarray is
representative of the amount of transcripts in vivo. The PAX system
was used to minimize handling of blood cells post collection and to
immediately stabilize RNA and halt transcription. We previously
have shown two methods using this PAX system that provide stable
RNA for microarray analysis {Thach, 2003 #18}.
[0625] To assess RNA quality on each of the 95 microarrays analyzed
in this study, recently published metrics derived from
electropherograms of the RNA were used {Auer, 2003 #26}. Assessment
of the degradation factor, which is the ratio of the average
intensity of bands of lesser molecular weight than the 18S
ribosomal peak to the 18S band intensity multiplied by 100,
demonstrated minimal degradation of RNA (FIG. 13). This degradation
factor for the samples correlated with gapdh 3'/5' on the A arrays
(FIG. 13c; r=0.3, P=0.008, ANOVA) and actin 3'/5' on the B arrays
(r=0.2; P<0.05, ANOVA), the internal measurements for assessment
of RNA quality on the microarray. There was no significant
correlation between 28S/18S versus degradation factor, gapdh 3'/5',
and actin 3'/5', suggesting that the degradation factor is a
superior method for assessing RNA quality for microarray analysis.
No significant difference in degradation factor was seen among the
phenotype groups.
[0626] Assessment of the apoptosis factor, which is the ratio of
the height of the 28S to 18S peak {Auer, 2003 #26}, suggested that
a high percentage of blood cells underwent apoptotic cell death.
The distribution of the degradation factor, apoptosis factor,
28S/18S, and yields of total RNA are shown in FIG. 13b. No
significant difference in apoptosis factor was seen among the
phenotype groups. There was no significant correlation between
duration of freezing and degradation factor (FIG. 13d); nor was
there correlation with apoptosis factor, RNA yield, 28S/18S, or
gapdh and actin 3'/5'.
[0627] We determined if blood cell type heterogeneity affected the
sensitivity of transcript detection. Assessment of complete blood
count (CBC) variables that affect the number of present calls on
the microarray demonstrated a linear correlation between number of
probesets called Present and Mean Corpuscular Hemoglobin (MCH). A
significant effect was detected (r=0.272; P=0.008, ANOVA) for the B
arrays only (FIG. 13e). The equation of the regression line
suggested that for every picogram increase in hemoglobin, there is
a loss in present detection calls of 100 probesets or 2% of the
average number of present called probesets on the B arrays. There
was no difference in MCH among the infection status phenotypes.
[0628] Quality of microarray measurements of PAX system-derived RNA
from the BMT population. Individual control charts versus the date
of microarray scanning were plotted to look for stability of
quality metrics over time, determine outliers, and compare with
values proposed by the array manufacturer. The percent Present of
transcripts was 32.+-.10 (average.+-.3SD) for A arrays and 21.+-.6
for B arrays. The gapdh and actin 3'/5' values were less than
three, the upper-limit proposed by Affymetrix {Affymetrix, 2004
#29}. Noise was 3.6.+-.1.3 for A arrays and 2.9.+-.0.8 for B
arrays. Average Background was 100.+-.48 for A arrays and 78.+-.33
for B arrays. After exclusions of array sets that were known to
have been processed differently or erroneously, a total of 95 A and
B array sets with stable quality metrics remained. These 95 sets
were processed in batches with nearly equal representation of the
four infection status phenotypes. Therefore, comparisons among
these four groups should detect biological differences as these
groups have similar variations due to processing.
[0629] Gene expression profiles. The gene expression profiles were
displayed on a heat-map with hierarchical clustering of transcripts
to characterize and visualize patterns in the profiles of our
cohort (FIG. 14). Initial examination revealed a large number of
transcripts with high expression levels (FIG. 14, orange bar) and a
smaller number of transcripts with low expression levels (FIG. 14,
purple bar) in the febrile group compared to the non-febrile
healthy and convalescent patients. There were also transcripts that
showed differences between healthy and convalescent patients (FIG.
14, gray bar), while there was no obvious group of transcripts that
showed differences between febrile without adenovirus versus
febrile with adenovirus from this visual inspection. Within each
group, inter-individual variation was observed, suggesting diverse
immune responses in this population.
[0630] Class prediction of infection status phenotype. The pattern
recognition above suggested that there were transcripts with
differences in expression levels among healthy, febrile, and
recovered patients. Therefore, class prediction was performed, to
find sets of transcripts that best classify the four infection
status phenotypes. Probesets with >80% absent calls across
samples were filtered resulting in 15,721 probesets for further
analysis. For supervised class prediction, the class labels for the
febrile group were determine from respiratory viral culture results
identifying presence or absence of adenovirus.
[0631] FIG. 14 suggested that the fever status of individuals was
the predominant source of variation in gene expression profiles
among samples and this was confirmed by unsupervised clustering of
samples. Thus, supervised class prediction analysis was used to
find sets of transcripts that classified non-febrile versus febrile
patients first (node 1), then of the non-febrile patients, further
classified to healthy or convalescent (node 2), and among the
febrile patients, further classified to without or with adenovirus
infection (node 3). The segregation of the samples via this nodal
scheme was confirmed via binary tree class prediction analysis.
[0632] Unlike data from cancer studies {Golub, 2004 #34; Valk, 2004
#9}, there are no reported transcript selection methods or class
prediction algorithms that are optimal for classification of
infectious diseases. Therefore, we determined the transcript
selection method and classification algorithm that would result in
the highest percent correct classification during leave-one-out
cross-validation. To estimate the optimal transcript selection
parameters for classification in each node, the cut-off level of
the univariate P-value was varied, selecting for probesets that
showed statistically significant differences between the two groups
at a P-value that was equaled to or smaller than a set cut-off
level. As the P-value cut-offs became more stringent, the number of
probesets selected decreased. For each P-value cut-off level, the
selected probesets were subsequently used to classify the samples
using various algorithms along with cross-validation analysis. For
classification of node 1, 2 and 3, an optimal P-value cut-off level
of 10.sup.-2, 10.sup.-3, 10.sup.-5 (FIG. 15a-c, lower-left corner)
was chosen, respectively.
[0633] Once an optimal P-value cut-off level was estimated and held
constant, the additional criterion of fold-change cut-off threshold
was varied (FIG. 15a-c, x-axes) for each node. FIG. 15 shows the
percent-correct traces for the six algorithms tested tracking
closely as fold-change cut-off level increases, but can differ by
as much as 10-20% between methods. The black arrows in FIG. 15
indicate an optimal percent-correct classification at the specific
P-value and fold change cut-off For non-febrile vs. febrile, a
percent correct call of 99% was achieved using the support vector
machines algorithm at a P-value cut-off level of 10.sup.-2 and a
fold-change threshold of >5 which selected for 47 probesets to
be in the classifier (FIG. 15a). For classification of healthy
versus convalescent patients, an optimal percent correct of 87%
using the diagonal linear discriminant analysis algorithm at a
P-value cut-off level of 10.sup.-3 and a fold-change threshold of
>1.9 which selected for 8 probesets to be in the classifier was
obtained (FIG. 15b). For classification of febrile patients
without- versus with adenovirus infection, an optimal
percent-correct of 91% using the support vector machine algorithm
at a P-value cut-off level of 10.sup.-5 and a fold-change threshold
of >1.7 which selected for 11 probesets to be in the classifier
was obtained (FIG. 15c).
[0634] The samples that were misclassified by various algorithms
and the associated gene expression profiles for the selected
transcript set are shown in FIG. 16. For node 1, no individuals
were misclassified in the febrile with adenovirus group and
misclassified samples tended to belong to the febrile without
adenovirus or the convalescent group. For node 2, the misclassified
samples seemed to be equally distributed between healthy and
convalescent, while for node 3, the misclassified samples tended to
be in the febrile without adenovirus group. One observes that some
samples were misclassified regardless of algorithm.
[0635] The estimated optimal percent-correct classification of
non-febrile versus febrile, healthy versus convalescents, and
febrile without versus with adenovirus infection patients were 99%,
87%, and 91%, respectively. To determine the reliability of these
percentages, the permutation test was performed with 2000
permutations. This resulted in P-values of <0.0005, 0.001, and
<0.0005, respectively.
[0636] Functions of genes in the classifier sets. The identifiers
of the discovered transcript sets for the class prediction results
are shown in FIG. 16. The 47 probesets used to classify fever
status (FIG. 16a and Table 7) represent 40 transcripts. These
included many that are induced by interferon, including: IF127,
IF144, IF135, IFRG28, IFIT1, IFIT4, OAS1, OAS2, GBP1, CASP5, MX1,
and G1P2. Furthermore, OAS1 and OAS2 catalyze 2', 5' oligomers of
adenosine to activate RNaseL and inhibit cellular protein
synthesis, while MX1 is a member of the GTPase family. OAS1, OAS2,
and MX1 have been shown to have antiviral functions, and
interestingly, have also been found to be activated shortly after
infection of nonhuman primates with high titers of smallpox
{Rubins, 2004 #35}. Transcripts involved in the complement cascade,
C1QG which is downstream of antibody/antigen complexes and SERPING1
which inhibits activation of the first component of complement were
associated with fever. The TNF-alpha and IL-1 induced gene,
TNFAIP6, which is a secretory protein involved in extracellular
matrix stability and cell migration, and STK3 and CASP5, which are
involved in the MAPK signaling pathway and are downstream of the
TNF and IL1 receptors were identified as class predictors. FCGR1A,
which functions in the adaptive immune response and binds IgG, was
part of the classifier. Other transcripts with associated known
functions less clearly related to FRI or with unknown functions
were also identified. Some gene ontology descriptions and, in
parenthesis, their ratios of observed to expected number of
occurrences were as follows (see Tables 8-9): GTP binding (6),
guanyl nucleotide binding (6), response to virus (32), immune
response (8), defense response (7), response to
pest/pathogen/parasite (6), and response to stress (3).
[0637] The 8 probeset classifier (Table 10) for distinguishing
healthy versus convalescent, patients mapped to 7 transcripts,
including RP127 and RPS7 associated with ribosomal structure; IGHM,
the immunoglobulin heavy constant mu transcript; LAMA2, which is
involved with cell adhesion, migration, and tissue remodeling; and
transcripts related to other functions such as DAB2, KREMEN1, and
EVA1.
[0638] The 10 transcript classifier (Table 11) for distinguishing
febrile without adenovirus versus with adenovirus infection
included the interleukin-1 receptor accessory protein, IL1 RAP; two
interferon induced genes, IF127 and IF144, which were also in the
classifier for fever status; and LGALS3BP, which is involved in
cell-cell and cell-matrix interactions and has been found elevated
in individuals infected with the human immunodeficiency virus.
Other transcripts with known functions less clearly related to
adenoviral FRI or with unknown functions included ZCCHC2, ZSIG11,
NOP5/NOP58, MS4A7, LY6E, and BTN3A3.
Discussion
[0639] After having rigorously assessed the RNA quality of samples
processed with PAX tubes in a relatively large sample of humans
with differing infection status phenotypes, we characterized and
compared the transcriptomes from whole blood samples of healthy,
FRI without and with adenovirus infection, and convalescent
individuals, evaluated class prediction methodologies, discovered
nested sets of transcripts that could optimally classify the
infection status phenotypes and have begun to implicate pathways
and gene functions involved in FRI.
[0640] We applied a previously reported quality control metric
called the degradation factor {Auer, 2003 #26} to our RNA samples
and determined that this factor correlates with quality control
metrics (gapdh 3'/5' and actin 3'/5') present on the microarray.
This degradation factor can easily be applied to microarray studies
on large populations by assessing electropherogram data that is
available from a bioanalyzer prior to processing microarrays and an
indicator can be set to flag poor quality samples. We find that
quality metrics typically used, such as the 28S/18S ratio have high
variability outside the traditional standard range of 1.8 to 2.1
and poorly correlate with the quality control metrics present on
the microarray.
[0641] When assessing signal to noise quality metrics, we
discovered that MCH significantly affects number of present calls
on the B array only, likely due to detection of low expression
transcripts on the B array compared to the A array {Affymetrix,
2002 #27}. At the time of probe design, the probes on the A chip
were associated with more annotation than those on the B chip. The
MCH is a measure of picograms of hemoglobin per red blood cell and
likely is directly related to amounts of globin mRNA in whole blood
samples; prior studies have demonstrated that spiking of increasing
amounts of globin mRNA transcripts into total RNA from a cell line
decreases the percent present calls linearly {Affymetrix, 2003
#28}. This factor would need to be controlled in future microarray
studies or globin mRNA would need to be reduced. In the present
study, there was no difference of MCH among the infection status
phenotypes.
[0642] During supervised analysis, we varied the fold-change
cut-off threshold in addition to the P-value cut-off to optimize
percent correct classification. These combined criteria select for
transcripts that not only are statistically different between two
groups, but also vary above a specific fold-change threshold,
reducing transcripts that may represent noise. The accuracy of
classification seemed to be resistant to transcript selection
parameters and algorithms when the gene-expression profiles showed
large consistent differences, such as between non-febrile versus
febrile patients; stricter P-value and fold change cut-off levels
were needed to select informative transcripts that classify the
healthy and convalescent or the febrile patients to an accuracy of
87% and 91%, respectively.
[0643] Misclassified samples tended to belong to groups more likely
to be heterogeneous, suggesting that the misclassification may be
due to the lack of specificity of the class labels. In future
studies of larger size, the convalescent group might be further
sub-classified based on duration of recovery and the febrile
without adenovirus group sub-classified based on specific pathogen
identified. The majority of transcripts in the classifiers shown in
FIG. 16 remained in the classifier 100% of the time during
leave-one-out cross-validation (100% CV support). Thus, these
transcripts in the classifiers are consistently different between
individuals of two clinical phenotypes at the time when they
present for study, as exemplified in FIG. 16a. Individuals in the
FRI with adenovirus group tend to present later in illness than
those without, potentially accounting for gene expression
differences in the two groups. The correlation of changes in
expression of these genes with infection status may also suggest
that these genes are involved in the human host fever and immune
responses to adenovirus infection in vivo. These transcripts
consistently showed the largest fold changes between groups,
suggesting that the changes in expression were at the pathway level
and were unlikely to be accounted for by differences in cell
concentration alone. Furthermore, there were no significant
differences in cell-type concentration between the febrile without-
versus with adenovirus groups. This correlation of transcripts to
fever and immune responses was derived from in vivo natural
infections of humans, suggesting the important role of these genes
in the host response at the population level. Nested sets of
transcripts resulted in similar percent-correct classifications,
likely due to the fact that the expression of each transcript is
not independent but correlated with other transcripts in related
pathways. The discovery of transcripts with functions unrelated to
immune response or with unknown functions implies that these should
be further studied in infection phenotype model systems to
elucidate mechanistic functions.
[0644] Our demonstration that one can predict the class of a
patient with FRI due to adenovirus infection from background cases
of FRI due to other etiologies support the possibility of using
gene-expression in biosurveillance and pathogenesis. To our
knowledge, this is the first in vivo demonstration of
classification of infectious diseases via transcriptional
signatures of the host. We intend to extend these findings to other
respiratory pathogens, both viral and bacterial and to women, to
further determine the capability of applying this technology to
biodefense and infectious disease surveillance.
[0645] Numerous modifications and variations on the present
invention are possible in light of the above teachings. It is,
therefore, to be understood that within the scope of the
accompanying claims, the invention may be practiced otherwise than
as specifically described herein.
REFERENCES
[0646] 1. Cardoso, F. (2003) Breast Cancer Res 5, 303-4, [0647] 2.
Fraser, C. M. (2004) in Nat Rev Genet, Vol. 5, pp. 23-33. [0648] 3.
Potter, J. D. (2003) in Trends Genet, Vol. 19, pp. 690-5. [0649] 4.
Simon, R. (2003) Expert Rev Mol Diagn 3, 587-95. [0650] 5.
Winegarden, N. (2003) Lancet 362, 1428. [0651] 6. Affymetrix,
GeneChip expression analysis technical manual. 701021 Rev. 3.
[0652] 7. Shoemaker, D. D., Schadt, E. E., Armour, C. D., He, Y.
D., Garrett-Engele, P., McDonagh, P. D., Loerch, P. M., Leonardson,
A., Lum, P. Y., Cavet, G., Wu, L. F., Altschuler, S. J., Edwards,
S., King, J., Tsang, J. S., Schimmack, G., Schelter, J. M., Koch,
J., Ziman, M., Marton, M. J., Li, B., Cundiff, P., Ward, T.,
Castle, J., Krolewski, M., Meyer, M. R., Mao, M., Burchard, J.,
Kidd, M. J., Dai, H., Phillips, J. W., Linsley, P. S., Stoughton,
R., Scherer, S. & Boguski, M. S. (2001) Nature 409, 922-7.
[0653] 8. Affymetrix (2004), Genechip operating software version
1.2. 701439 Rev 3.
http://www.affymetrix.com/support/technical/manuals.affx. [0654] 9.
Lander, E. S., Linton, L. M., Birren, B., Nusbaum, C., Zody, M. C.,
Baldwin, J., Devon, K., Dewar, K., Doyle, M., FitzHugh, W., Funke,
R., Gage, D., Harris, K., Heaford, A., Howland, J., Kann, L.,
Lehoczky, J., LeVine, R., McEwan, P., McKernan, K., Meldrim, J.,
Mesirov, J. P., Miranda, C., Morris, W., Naylor, J., Raymond, C.,
Rosetti, M., Santos, R., Sheridan, A., Sougnez, C., Stange-Thomann,
N., Stojanovic, N., Subramanian, A., Wyman, D., Rogers, J.,
Sulston, J., Ainscough, R., Beck, S., Bentley, D., Burton, J.,
Clee, C., Carter, N., Coulson, A., Deadman, R., Deloukas, P.,
Dunham, A., Dunham, I., Durbin, R., French, L., Grafham, D.,
Gregory, S., Hubbard, T., Humphray, S., Hunt, A., Jones, M., Lloyd,
C., McMurray, A., Matthews, L., Mercer, S., Milne, S., Mullikin, J.
C., Mungall, A., Plumb, R., Ross, M., Shownkeen, R., Sims, S.,
Waterston, R. H., Wilson, R. K., Hillier, L. W., McPherson, J. D.,
Marra, M. A., Mardis, E. R., Fulton, L. A., Chinwalla, A. T.,
Pepin, K. H., Gish, W. R., Chissoe, S. L., Wendl, M. C.,
Delehaunty, K. D., Miner, T. L., Delehaunty, A., Kramer, J. B.,
Cook, L. L., Fulton, R. S., Johnson, D. L., Minx, P. J., Clifton,
S. W., Hawkins, T., Branscomb, E., Predki, P., Richardson, P.,
Wenning, S., Slezak, T., Doggett, N., Cheng, J. F., Olsen, A.,
Lucas, S., Elkin, C., Uberbacher, E., Frazier, M., et al. (2001)
Nature 409, 860-921. [0655] 10. Venter, J. C., Adams, M. D., Myers,
E. W., Li, P. W., Mural, R. J., Sutton, G. G., Smith, H. O.,
Yandell, M., Evans, C. A., Holt, R. A., Gocayne, J. D., Amanatides,
P., Ballew, R. M., Huson, D. H., Wortman, J. R., Zhang, Q., Kodira,
C. D., Zheng, X. H., Chen, L., Skupski, M., Subramanian, G.,
Thomas, P. D., Zhang, J., Gabor Miklos, G. L., Nelson, C., Broder,
S., Clark, A. G., Nadeau, J., McKusick, V. A., Zinder, N., Levine,
A. J., Roberts, R. J., Simon, M., Slayman, C., Hunkapiller, M.,
Bolanos, R., Delcher, A., Dew, I., Fasulo, D., Flanigan, M.,
Florea, L., Halpern, A., Hannenhalli, S., Kravitz, S., Levy, S.,
Mobarry, C., Reinert, K., Remington, K., Abu-Threideh, J., Beasley,
E., Biddick, K., Bonazzi, V., Brandon, R., Cargill, M.,
Chandramouliswaran, I., Charlab, R., Chaturvedi, K., Deng, Z., Di
Francesco, V., Dunn, P., Eilbeck, K., Evangelista, C., Gabrielian,
A. E., Gan, W., Ge, W., Gong, F., Gu, Z., Guan, P., Heiman, T. J.,
Higgins, M. E., Ji, R. R., Ke, Z., Ketchum, K. A., Lai, Z., Lei,
Y., Li, Z., Li, J., Liang, Y., Lin, X., Lu, F., Merkulov, G. V.,
Milshina, N., Moore, H. M., Naik, A. K., Narayan, V. A., Neelam,
B., Nusskern, D., Rusch, D. B., Salzberg, S., Shao, W., Shue, B.,
Sun, J., Wang, Z., Wang, A., Wang, X., Wang, J., Wei, M., Wides,
R., Xiao, C., Yan, C., et al. (2001) Science 291, 1304-51. [0656]
11. Wheelan, S. J. & Boguski, M. S. (1998) Genome Res 8, 168-9.
[0657] 12. Nau, G. J., Richmond, J. F., Schlesinger, A., Jennings,
E. G., Lander, E. S. & Young, R. A. (2002) Proc Natl Acad Sci
USA 99, 1503-8. [0658] 13. Boldrick, J. C., Alizadeh, A. A., Diehn,
M., Dudoit, S., Liu, C. L., Belcher, C. E., Botstein, D., Staudt,
L. M., Brown, P. O. & Relman, D. A. (2002) Proc Natl Acad Sci
USA 99, 972-7. [0659] 14. Chaussabel, D., Semnani, R. T., McDowell,
M. A., Sacks, D., Sher, A. & Nutman, T. B. (2003) Blood 102,
672-81. [0660] 15. Cummings, C. A. & Relman, D. A. (2000) Emerg
Infect Dis 6, 513-25. [0661] 16. Alizadeh, A. A., Eisen, M. B.,
Davis, R. E., Ma, C., Lossos, I. S., Rosenwald, A., Boldrick, J.
C., Sabet, H., Tran, T., Yu, X., Powell, J. I., Yang, L., Marti, G.
E., Moore, T., Hudson, J., Jr., Lu, L., Lewis, D. B., Tibshirani,
R., Sherlock, G., Chan, W. C., Greiner, T. C., Weisenburger, D. D.,
Armitage, J. O., Warnke, R., Levy, R., Wilson, W., Greyer, M. R.,
Byrd, J. C., Botstein, D., Brown, P. O. & Staudt, L. M. (2000)
Nature 403, 503-11. [0662] 17. Alizadeh, A. A. & Staudt, L. M.
(2000) Curr Opin Immuno112, 219-25. [0663] 18. Whitney, A. R.,
Diehn, M., Popper, S. J., Alizadeh, A. A., Boldrick, J. C., Relman,
D. A. & Brown, P. O. (2003) Proc Natl Acad Sci USA 100,
1896-901. [0664] 19. Das, R., Jett, M. & Mendis, C. (2001).
[0665] 20. Affymetrix (2003), Globin Reduction Protocol: A Method
for Processing Whole Blood RNA Samples for Improved Array Results
http://www.affymetrix.com/support/technical/technotes/blood2_technote.pdf
(Accessed September 2004). [0666] 21. Eisen, M. B., Spellman, P.
T., Brown, P. O. & Botstein, D. (1998) Proc Natl Acad Sci USA
95, 14863-8. [0667] 22. Quackenbush, J. (2001) Nat Rev Genet 2,
418-27. [0668] 23. Tavazoie, S., Hughes, J. D., Campbell, M. J.,
Cho, R. J. & Church, G. M. (1999) Nat Genet 22, 281-5. [0669]
24. Hughes, T. R., Marton, M. J., Jones, A. R., Roberts, C. J.,
Stoughton, R., Armour, C. D., Bennett, H. A., Coffey, E., Dai, H.,
He, Y. D., Kidd, M. J., King, A. M., Meyer, M. R., Slade, D., Lum,
P. Y., Stepaniants, S. B., Shoemaker, D. D., Gachotte, D.,
Chakraburtty, K., Simon, J., Bard, M. & Friend, S. H. (2000)
Cell 102, 109-26. [0670] 25. Golub, T. R., Slonim, D. K., Tamayo,
P., Huard, C., Gaasenbeek, M., Mesirov, J. P., Coller, H., Loh, M.
L., Downing, J. R., Caligiuri, M. A., Bloomfield, C. D. &
Lander, E. S. (1999) Science 286, 531-7. [0671] 26. West, M.,
Blanchette, C., Dressman, H., Huang, E., Ishida, S., Spang, R.,
Zuzan, H., Olson, J. A., Jr., Marks, J. R. & Nevins, J. R.
(2001) Proc Natl Acad Sci USA 98, 11462-7. [0672] 27. Khan, J.,
Wei, J. S., Ringner, M., Saal, L. H., Ladanyi, M., Westermann, F.,
Berthold, F., Schwab, M., Antonescu, C. R., Peterson, C. &
Meltzer, P. S. (2001) Nat Med 7, 673-9. [0673] 28. Khan, S. A.,
Shahani, D. T. & Agarwala, A. K. (2003) ISA Trans 42, 337-52.
[0674] 29. Khan, Z. H., Mohapatra, S. K., Khodiar, P. K. & Ragu
Kumar, S. N. (1998) Indian J Physiol Pharmacol 42, 321-42. [0675]
30. Muller, M. C., Merx, K., Weibetaer, A., Kreil, S., Lahaye, T.,
Hehlmann, R. & Hochhaus, A. (2002) Leukemia 16, 2395-9. [0676]
31. Rainen, L., Oelmueller, U., Jurgensen, S., Wyrich, R., Ballas,
C., Schram, J., Herdman, C., Bankaitis-Davis, D., Nicholls, N.,
Trollinger, D. & Tryon, V. (2002) Clin Chem 48, 1883-90. [0677]
32. Thomson, S. A. & Wallace, M. R. (2002) Hum Genet 110,
495-502. [0678] 33. Preanalytix, PAXgene blood RNA kit handbook.
http://www.preanalytix.com/pdf/RNA_handbook.pdf (Accessed April
2003). [0679] 34. Jurgensen, S., Schram, J., Herdman, C., Rainen,
L., Wyrich, R. & Oelmueller, U. [0680] 35. Jurgensen, S.,
Schram, J., Herdman, C., Rainen, L., Wyrich, R. & Oelmueller,
U. [0681] 36. Preanalytix, Nuclease degradation of RNA.
http://www.preanalytix.com/pdf/NucleaseDegradationotRNA.pdf
(Accessed April 2003). [0682] 37. Preanalytix, Repeatability--RNA
purification. http://www.preanalytix.com/pdf/repeatability.pdf
(Accessed April 2003). [0683] 38. Preanalytix, Northern blot from
messenger blood RNA.
http://www.preanalytix.com/pdf/NorthernBlot.pdf (Accessed April
2003). [0684] 39. Preanalytix, Long-term stability of RNA using the
PAXgene.TM. blood RNA system.
http://www.preanalytix.com/pdf/TN_Storage_PAX.sub.--0702.pdf
(Accessed April 2003). [0685] 40. Preanalytix, Evaluation of
organic extraction of RNA from PAXgene.TM. blood RNA tubes.
http://www.preanalytix.com/pdf/TN_OrganicExtr_PAX.sub.--0702.pdf
(Accessed April 2003). [0686] 41. Preanalytix, Increased
Concentrations of RNA using the PAXgene.TM. Blood RNA System.
http://www.preanalytix.com/pdf/TN_ElutionMeth_PAX.sub.--0702.pdf
(Accessed April 2003). [0687] 42. Preanalytix, Integrity of RNA
purified from whole blood samples using the PAXgene.TM. system.
http://www.preanalytix.com/pdf/TN_Agilent_PAX.sub.--0702.pdf
(Accessed April 2003). [0688] 43. Preanalytix, Purification of RNA
from blood using the PAXgene.TM. blood RNA system following
multiple freeze-thaw cycles.
http://www.preanalytix.com/pdf/TN_FreezeThaw_PAX.sub.--0702.pdf
(Accessed April 2003). [0689] 44. Preanalytix, Effects of dry ice
storage on stability of RNA purified using the PAXgene.TM. blood
RNA system.
http://www.preanalytix.com/pdf/TN_DrylceShip_PAX.sub.--0702.pdf
(Accessed April 2003). [0690] 45. Rainen, L., Ballas, c.,
Oelmueller, U., Jurgensen, S., Wyrich, R., Schram, J., Walenciak,
M., Herdman, C., Paumen, M., Nicholls, N., Koga, T., Goodrich, J.
& J. Vanderbeek. [0691] 46. Cole, K., Truong, V., Barone, D.
& McGall, G. (2004) Nucleic Acids Res 32, e86. [0692] 47.
Bartlett, J. G., Dowell, S. F., Mandell, L. A., File Jr, T. M.,
Musher, D. M. & Fine, M. J. (2000) Clin Infect Dis 31, 347-82.
[0693] 48. Mandell, L. A., Bartlett, J. G., Dowell, S. F., File, T.
M., Jr., Musher, D. M. & Whitney, C. (2003) Clin Infect Dis 37,
1405-33. [0694] 49. Summary, How The Pneumonia PORT Severity Index
(PSI) is Derived Patients are stratified into 5 severity classes by
means of a 2-step process. [0695] Step 1. Determination of whether
patients meet the following criteria for class I: age <50 years,
with 0 of 5 comorbid conditions (i.e., neoplastic disease, liver
disease, congestive heart failure, cerebrovascular disease, and
renal disease), normal or only mildly deranged vital signs, and
normal mental status. [0696] Step 2. Patients not assigned to risk
class I are stratified into classes II V on the basis of points
assigned for 3 demographic variables (age, sex, and nursing home
residency), 5 comorbid conditions (listed above), 5 physical
examination findings (pulse, 125 beats/min; respiratory rate, 30
breaths/min; systolic blood pressure, <90 mm Hg; temperature,
<35.degree. C. or 40.degree. C.; and altered mental status), and
7 laboratory and/or radiographic findings (arterial pH, <7.35;
blood urea nitrogen level, 30 mg/dL; sodium level, <130 mmoUL;
glucose level, 250 mg/dL; hematocrit, <30%; hypoxemia by O2
saturation, <90% by pulse oximetry or <60 mm Hg by arterial
blood gas; and pleural effusion on baseline radiograph). [0697] For
classes I III, hospitalization is usually not required. For classes
IV and V, the patient will usually require hospitalization. [0698]
It should be noted that social factors, such as outpatient support
mechanisms and probability of adherence to treatment, are not
included in this assessment. [0699] 50. Thach, D.C., Lin, B.,
Walter, E., Kruzelock, R., Rowley, R. K., Tibbetts, C. &
Stenger, D. A. (2003) J Immunol Methods 283, 269-79. [0700] 51.
Auer, H., Lyianarachchi, S., Newsom, D., Klisovic, M. I., Marcucci,
G., Kornacker, K. & Marcucci, U. (2003) Nat Genet 35, 292-3.
[0701] 52. Dickinson, B. [0702] 53. Gray, G. C., Gackstetter, G.
D., Kang, H. K., Graham, J. T. & Scott, K. C. (2004) Am J Prev
Med 26, 443-52. [0703] 54. Patarca, R. (2001) Ann N Y Acad Sci 933,
185-200. [0704] 55. Preanalytix (2003). [0705] 56. Brenner, S.,
Johnson, M., Bridgham, J., Golda, G., Lloyd, D. H., Johnson, D.,
Luo, S., McCurdy, S., Foy, M., Ewan, M., Roth, R., George, D.,
Eletr, S., Albrecht, G., Vermaas, E., Williams, S. R., Moon, K.,
Burcham, T., Pallas, M., DuBridge, R. B., Kirchner, J., Fearon, K.,
Mao, J. & Corcoran, K. (2000) Nat Biotechnol 18, 630-4. [0706]
57. Lin, B., Vora, G. J., Thach, D., Walter, E., Metzgar, D.,
Tibbetts, C. & Stenger, D. A. (2004) J Clin Microbiol 42,
3232-9. [0707] 58. Stenger, D. A., Andreadis, J. D., Vora, G. J.
& Pancrazio, J. J. (2002) Curr Opin Biotechnol 13, 208-12.
[0708] 59. Haab, B. B. (2001) Curr Opin Drug Discov Devel 4,
116-23. [0709] 60. Preanalytix, Product circular. PAXgene Blood RNA
Tube. http://www.preanalytix.com/pdf/prodcir.pdf (Accessed April
2003). [0710] 61. Agilent (October 2002). [0711] 62. Affymetrix
(2001), Microarray Suite user's guide version 5.0. 701099 Rev 1.
http://www.affymetrix.com/support/technical/manuals.affx. [0712]
63. Filliben, J. J., Heckert, A. & Lipman, R. R. [0713] 64. Li,
C. & Hung Wong, W. (2001) Genome Biol 2. [0714] 65. Li, C.
& Wong, W. H. (2001) Proc Natl Acad Sci USA 98, 31-6. [0715]
66. Azarani, A. & Hecker, K. H. (2001) Nucleic Acids Res 29,
E7. [0716] 67. Filliben, J. J. (NIST SEMATECH. [0717] 68.
Affymetrix (2004), GeneChip.RTM. Expression Analysis Data Analysis
Fundamentals. Part No. 701190 Rev. 4. Page 39.
https://www.affymetrix.com/support/downloads/manuals/data_analysis_fundam-
entals_manual.pdf (accessed September 2004). [0718] 69. Affymetrix
(2002), Performance and Validation of the GeneChip.RTM. Human
Genome U133 Set.
http://www.affymetrix.com/support/technical/technotes/hgu133
performance_technote.pdf (Accessed September 2004). [0719] 70.
Hosack, D. A., Dennis, G., Jr., Sherman, B. T., Lane, H. C. &
Lempicki, R. A. (2003) Genome Biol 4, R70. [0720] 71. Griffiths, M.
J. et al. (2005) The Journal of Infectious Disease 191, 1599-1611.
[0721] 72. Cobb, J. P. et al. (2005) Proc Natl Acad Sci USA 102,
4801-4806. [0722] 73. Rubins, K. H. et al (2004) Proc Natl Acad Sci
USA 101, 15190-15195.
Supplemental Info: List of Tables Provided in Electronic Form and
Brief Description
[0723] Table 16--Performance of classifiers during cross-validation
for Class Prediction for fever status (i.e., febrile versus
non-febrile patients) Table 17--Performance of classifiers during
cross-validation, table of parameters for Table 16 Table
18--Composition of classifier, list of genes significant at the
0.01 level (sorted by t-value) for Class Prediction for fever
status Table 19--`Observed v. Expected` table of GO classes and
parent classes, in list of significant genes shown in Table 18
Table 20--Performance of classifiers during cross-validation for
Class Prediction for febrile with adenovirus versus without
adenovirus patients Table 21--Performance of classifiers during
cross-validation, table of parameters for Table 20 Table
22--Composition of classifier, list of genes significant at the
0.01 level (sorted by t-value) for Class Prediction for rile with
adenovirus versus without adenovirus patients Table 23--`Observed
v. Expected` table of GO classes and parent classes, in list of
significant genes shown in Table 22 Table 24--Performance of
classifiers during cross-validation for Class Prediction for
healthy versus convalescent patients Table 25--Performance of
classifiers during cross-validation, table of parameters for Table
24 Table 26--Composition of classifier, list of genes significant
at the 0.01 level (sorted by t-value) for Class Prediction for
healthy versus convalescent patients Table 27--`Observed v.
Expected` table of GO classes and parent classes, in list of
significant genes shown in Table 26 Table 28--List of genes that
discriminate for fever status (i.e., febrile versus non-febrile
patients) Table 29--`Observed v. Expected` table of GO classes and
parent classes, in list of significant genes shown in Table 28
Table 30--List of genes that discriminate for adenovirus versus
without adenovirus patients Table 31--`Observed v. Expected` table
of GO classes and parent classes, in list of significant genes
shown in Table 30 Table 32--List of genes that discriminate for
healthy versus convalescent patients Table 33--`Observed v.
Expected` table of GO classes and parent classes, in list of
significant genes shown in Table 32
Sequence CWU 1
1
5125DNAArtificial SequenceSynthetic DNA 1gttgctaact acgatccaga
tattg 25222DNAArtificial SequenceSynthetic DNA 2cctggtaagt
gtctgtcaat cc 22328DNAArtificial SequenceSynthetic DNA 3cagtatgtgg
aatcaggcgg tggacagc 28420DNAArtificial SequenceSynthetic DNA
4tccctacgat gcagacaacg 20521DNAArtificial SequenceSynthetic DNA
5agtgccatct atgctatctc c 21
* * * * *
References