U.S. patent application number 13/042205 was filed with the patent office on 2011-07-21 for multipotent adult stem cells, sources thereof, methods of obtaining and maintaining same, methods of differentiation thereof, methods of use thereof and cells derived thereof.
This patent application is currently assigned to ABT Holding Company. Invention is credited to Leo T. Furcht, Morayma Reyes, Catherine M. Verfaillie.
Application Number | 20110177595 13/042205 |
Document ID | / |
Family ID | 27500956 |
Filed Date | 2011-07-21 |
United States Patent
Application |
20110177595 |
Kind Code |
A1 |
Furcht; Leo T. ; et
al. |
July 21, 2011 |
Multipotent Adult Stem Cells, Sources Thereof, Methods of Obtaining
and Maintaining Same, Methods of Differentiation Thereof, Methods
of Use Thereof and Cells Derived Thereof
Abstract
Methods and compositions are provided for circularizing target
sequences in a sample. In particular, ligation oligonucleotides are
employed to selectively hybridize with the target such that the
target can be ligated into a closed circular target. Rolling circle
amplification can then be performed directly on the target sequence
for subsequent detection and analysis.
Inventors: |
Furcht; Leo T.;
(Minneapolis, MN) ; Verfaillie; Catherine M.;
(Leuven, BE) ; Reyes; Morayma; (Minneapolis,
MN) |
Assignee: |
ABT Holding Company
Cleveland
OH
Regents of the University of Minnesota
St. Paul
MN
|
Family ID: |
27500956 |
Appl. No.: |
13/042205 |
Filed: |
March 7, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11084809 |
Mar 21, 2005 |
|
|
|
13042205 |
|
|
|
|
10467963 |
Jan 5, 2004 |
7838289 |
|
|
PCT/US02/04652 |
Feb 14, 2002 |
|
|
|
11084809 |
|
|
|
|
60343386 |
Dec 19, 2001 |
|
|
|
60310625 |
Aug 7, 2001 |
|
|
|
60269062 |
Feb 15, 2001 |
|
|
|
60268786 |
Feb 14, 2001 |
|
|
|
Current U.S.
Class: |
435/372 ;
435/325 |
Current CPC
Class: |
A61P 19/08 20180101;
A61K 48/00 20130101; C12N 2501/113 20130101; A61P 1/00 20180101;
A61P 7/04 20180101; C12N 2501/12 20130101; A01K 2217/075 20130101;
C12N 5/0622 20130101; C12N 15/873 20130101; A01K 2227/106 20130101;
A61P 21/00 20180101; A61P 37/00 20180101; C12N 2503/00 20130101;
A61P 7/06 20180101; C12N 2501/135 20130101; A01K 2227/105 20130101;
A61K 39/001 20130101; A61P 31/04 20180101; A61P 25/02 20180101;
A61P 35/00 20180101; C12N 2502/08 20130101; A61P 31/12 20180101;
A61P 41/00 20180101; C12N 2506/03 20130101; A61P 3/10 20180101;
A61P 9/10 20180101; A61P 31/10 20180101; A61P 17/00 20180101; C12N
2502/30 20130101; A61K 35/12 20130101; A61P 27/02 20180101; C12N
5/0619 20130101; A61P 31/00 20180101; A61P 7/08 20180101; C12N
5/0607 20130101; C12N 2501/237 20130101; A61P 39/02 20180101; C12N
2501/117 20130101; A61P 37/06 20180101; C12N 2501/11 20130101; C12N
2501/115 20130101; C12N 2517/02 20130101; A61P 25/00 20180101; C12N
5/067 20130101; A61P 13/10 20180101; C12N 2501/119 20130101; A61P
1/18 20180101; A61P 3/00 20180101; A01K 67/0271 20130101; A61P
19/04 20180101; A61P 1/16 20180101; C12N 2501/235 20130101; A61P
9/00 20180101; A61P 13/12 20180101; A61P 43/00 20180101; A61P 15/00
20180101; A01K 2217/05 20130101; A61P 7/00 20180101 |
Class at
Publication: |
435/372 ;
435/325 |
International
Class: |
C12N 5/071 20100101
C12N005/071 |
Claims
1-101. (canceled)
102. A substantially homogenous cell population which co-expresses
CD49c, CD90 and at least one cardiac-related transcription
factor.
103. The substantially homogenous cell population of claim 102,
further including co-expression of telomerase.
104. The substantially homogenous cell population of claim 102,
wherein the cells are derived from human bone marrow cells.
105. The substantially homogenous cell population of claim 102,
wherein the cardiac-related transcription factor is selected from
the group consisting of GATA4, Irx4 and NRx2.5.
106. The substantially homogenous cell population of claim 102,
further including a label.
107. The substantially homogenous cell population of claim 102,
wherein the cell population differentiates into cardiac muscle
cells.
108. The substantially homogenous cell population of claim 102,
wherein the cells express at least one trophic factor selected from
the group consisting of IL-6, VEGF, MCP1 and BDNF.
109. A substantially homogenous cell population which co-expresses
CD49c, CD90, and at least one cardiac-related transcription factor,
but does not express bone sialoprotein.
110. The substantially homogenous cell population of claim 109,
wherein the cardiac-related transcription factor is selected from
the group consisting of GATA4, Irx4 and NRx2.5.
111. A substantially homogenous cell population which co-expresses
CD49c, CD90, GATA4, Irx4 and NRx2.5.
112. A substantially homogenous cell population which co-expresses
CD49c, CD90, telomerase, GATA4, lrx4 and NRx2.5.
113. A substantially homogenous cell population which co-expresses
CD49c, CD90 and has a doubling time of less that about 144 hours
when cultured under a low oxygen condition.
114. The substantially homogenous cell population of claim 113,
wherein the doubling time is less than about 72 hours.
115. The substantially homogenous cell population of claim 113,
wherein the doubling time is less than about 48 hours.
116. The substantially homogenous cell population of claim 113,
wherein the doubling time is less than about 65 hours.
117. The substantially homogenous cell population of claim 113,
wherein the doubling time is less than about 35 hours.
118. The substantially homogenous cell population of claim 151,
wherein the low oxygen condition is less than about 5% oxygen.
119. A substantially homogenous cell population which co-expresses
CD49c, CD90 and has a doubling time less than about 144 hours when
cultured under a low oxygen condition, wherein the substantially
homogenous cell population is formed by a method, comprising the
step of culturing a cell population source at a seeding density of
about 100 cells/cm.sup.2 under the low oxygen condition.
120. A pharmaceutical composition comprising a substantially
homogenous cell population which co-expresses CD49c, CD90 and at
least one cardiac-related transcription factor.
121. A pharmaceutical composition comprising a substantially
homogenous cell population which co-expresses CD49c, CD90,
telomerase and at least one cardiac-related transcription
factor.
122. A pharmaceutical composition comprising a substantially
homogenous cell population which co-expresses CD49c, CD90,
telomerase, GATA4, Irx4 and NRx2.5.
123. A pharmaceutical composition comprising a substantially
homogenous cell population which co-expresses CD49c, CD90, GATA4,
Irx4 and NRx2.5.
Description
RELATED CASES
[0001] This application claims the benefit of U.S. Provisional
Application No. 60/343,386, filed Oct. 25, 2001, U.S. Provisional
Application No. 60/310,625, filed Aug. 7, 2001, U.S. Provisional
Application No. 60/269,062, filed Feb. 15, 2001, U.S. Provisional
Application No. 60/268,786, filed Feb. 14, 2001, which are hereby
incorporated by reference for all purposes. Applicants also claim
priority of WO 01/11011, 60/147,324 and 60/164,650 and these
applications are hereby incorporated by reference into this text;
any teachings therein may be used in the practice of this
invention. The present application is a continuation-in-part of WO
01/11011, which is attached herein at Appendix 1 and is part of the
present application. Documents incorporated by reference into this
text are not admitted to be prior art.
FIELD OF THE INVENTION
[0002] The present invention relates generally to mammalian
multipotent adult stem cells (MASC), and more specifically to
methods for obtaining, maintaining and differentiating MASC. Uses
of MASC in the therapeutic treatment of disease are also
provided.
BACKGROUND OF THE INVENTION
[0003] Organ and tissue generation from stem cells, and their
subsequent transplantation provide promising treatments for a
number of pathologies, making stem cells a central focus of
research in many fields. Stem cell technology provides a promising
alternative therapy for diabetes, Parkinson's disease, liver
disease, heart disease, and autoimmune disorders, to name a few.
However, there are at least two major problems associated with
organ and tissue transplantation.
[0004] First, there is a shortage of donor organs and tissues. As
few as 5 percent of the organs needed for transplant in the United
States alone ever become available to a recipient (Evans, et al.
1992). According to the American Heart Association, only 2,300 of
the 40,000 Americans who needed a new heart in 1997 received one.
The American Liver Foundation reports that there are fewer than
3,000 donors for the nearly 30,000 patients who die each year from
liver failure.
[0005] The second major problem is the potential incompatibility of
the transplanted tissue with the immune system of the recipient.
Because the donated organ or tissue is recognized by the host
immune system as foreign, immunosuppressive medications must be
provided to the patient at a significant cost-both financially and
physically.
[0006] Xenotransplantation, or transplantation of tissue or organs
from another species, could provide an alternative means to
overcome the shortage of human organs and tissues.
Xenotransplantation would offer the advantage of advanced planning.
The organ could be harvested while still healthy and the patient
could undergo any beneficial pretreatment prior to transplant
surgery. Unfortunately, xenotransplantation does not overcome the
problem of tissue incompatibility, but instead exacerbates it.
Furthermore, according to the Centers for Disease Control, there is
evidence that damaging viruses cross species barriers. Pigs have
become likely candidates as organ and tissue donors, yet
cross-species transmission of more than one virus from pigs to
humans has been documented. For example, over a million pigs were
recently slaughtered in Malaysia in an effort to contain an
outbreak of Hendra virus, a disease that was transmitted to more
than 70 humans with deadly results (Butler, D. 1999).
Stem Cells: Definition and Use
[0007] The most promising source of organs and tissues for
transplantation, therefore, lies in the development of stem cell
technology. Theoretically, stem cells can undergo self-renewing
cell division to give rise to phenotypically and genotypically
identical daughters for an indefinite time and ultimately can
differentiate into at least one final cell type. By generating
tissues or organs from a patient's own stem cells, or by
genetically altering heterologous cells so that the recipient
immune system does not recognize them as foreign, transplant
tissues can be generated to provide the advantages associated with
xenotransplantation without the associated risk of infection or
tissue rejection.
[0008] Stem cells also provide promise for improving the results of
gene therapy. A patient's own stem cells could be genetically
altered in vitro, then reintroduced in vivo to produce a desired
gene product. These genetically altered stem cells would have the
potential to be induced to differentiate to form a multitude of
cell types for implantation at specific sites in the body, or for
systemic application. Alternately, heterologous stem cells could be
genetically altered to express the recipient's major
histocompatibility complex (MHC) antigen, or no MHC antigen,
allowing transplantion of cells from donor to recipient without the
associated risk of rejection.
[0009] Stem cells are defined as cells that have extensive
proliferation potential, differentiate into several cell lineages,
and repopulate tissues upon transplantation. The quintessential
stem cell is the embryonic stem (ES) cell, as it has unlimited
self-renewal and multipotent differentiation potential (Thomson, J.
et al. 1995; Thomson, J. A. et al. 1998; Shamblott, M. et al. 1998;
Williams, R. L. et al. 1988; Orkin, S. 1998; Reubinoff, B. E., et
al. 2000). These cells are derived from the inner cell mass y of
the blastocyst (Thomson, J. et al. 1995; Thomson, J. A. et al.
1998; Martin, G. R. 1981), or can be derived from the primordial
germ cells from a post-implantation embryo (embryonal germ cells or
EG cells). ES and EG cells have been derived from mouse, and more
recently also from non-human primates and humans. When introduced
into mouse blastocysts, ES cells can contribute to all tissues of
the mouse (animal) (Orkin, S. 1998). Murine ES cells are therefore
pluripotent. When transplanted in post-natal animals, ES and EG
cells generate teratomas, which again demonstrates their
multipotency. ES (and EG) cells can be identified by positive
staining with the antibodies to stage-specific embryonic antigens
(SSEA) 1 and 4.
[0010] At the molecular level, ES and EG cells express a number of
transcription factors highly specific for these undifferentiated
cells. These include oct-4 and Rex-1, leukemia inhibitory factor
receptor (LIF-R). The transcription factors sox-2 and Rox-1 are
expressed in both ES and non-ES cells. Oct-4 is expressed in the
pregastrulation embryo, early cleavage stage embryo, cells of the
inner cell mass of the blastocyst, and embryonic carcinoma (EC)
cells. In the adult animal, oct-4 is only found in germ cells.
[0011] Oct-4, in combination with Rox-1, causes transcriptional
activation of the Zn-finger protein Rex-1, and is also required for
maintaining ES in an undifferentiated state. The oct-4 gene is
down-regulated when cells are induced to differentiate in vitro.
Several studies have shown that oct-4 is required for maintaining
the undifferentiated phenotype of ES cells, and that it plays a
major role in determining early steps in embryogenesis and
differentiation. Sox-2, is required with oct-4 to retain the
undifferentiated state of ES/EC and to maintain murine, but not
human, ES cells. Human or murine primordial germ cells require
presence of LIF. Another hallmark of ES cells is presence of high
levels of telomerase, which provides these cells with an unlimited
self-renewal potential in vitro.
[0012] Stem cells have been identified in most organs or tissues.
The best characterized is the hematopoietic stem cell (HSC). This
mesoderm-derived cell has been purified based on cell surface
markers and functional characteristics. The HSC, isolated from bone
marrow (BM), blood, cord blood, fetal liver and yolk sac, is the
progenitor cell that generates blood cells or following translation
reinitiates multiple hematopoietic lineages and can reinitiate
hematopoiesis for the life of a recipient. (See Fei, R., et al.,
U.S. Pat. No. 5,635,387; McGlave, et al., U.S. Pat. No. 5,460,964;
Simmons, P., et al., U.S. Pat. No. 5,677,136; Tsukamoto, et al.,
U.S. Pat. No. 5,750,397; Schwartz, et al., U.S. Pat. No. 759,793;
DiGuisto, et al., U.S. Pat. No. 5,681,599; Tsukamoto, et al., U.S.
Pat. No. 5,716,827; Hill, B., et al. 1996.) When transplanted into
lethally irradiated animals or humans, HSCs can repopulate the
erythroid, neutrophil-macrophage, megakaryocyte and lymphoid
hemopoietic cell pool. In vitro, hemopoietic stem cells can be
induced to undergo at least some self-renewing cell divisions and
can be induced to differentiate to the same lineages as is seen in
vivo. Therefore, this cell fulfills the criteria of a stem cell.
Stem cells which differentiate only to form cells of hematopoietic
lineage, however, are unable to provide a source of cells for
repair of other damaged tissues, for example, heart or lung tissue
damaged by high-dose chemotherapeutic agents.
[0013] A second stem cell that has been studied extensively is the
neural stem cell (NSC) (Gage F. H. 2000; Svendsen C. N. et al,
1999; Okabe S. et al. 1996). NSCs were initially identified in the
subventricular zone and the olfactory bulb of fetal brain. Until
recently, it was believed that the adult brain no longer contained
cells with stem cell potential. However, several studies in
rodents, and more recently also non-human primates and humans, have
shown that stem cells continue to be present in adult brain. These
stem cells can proliferate in vivo and continuously regenerate at
least some neuronal cells in vivo. When cultured ex vivo, NSCs can
be induced to proliferate, as well as to differentiate into
different types of neurons and glial cells. When transplanted into
the brain, NSCs can engraft and generate neural cells and glial
cells. Therefore, this cell too fulfills the definition of a stem
cell, albeit a hematopoetic stem cell.
[0014] Clarke et al. reported that NSCs from Lac-Z transgenic mice
injected into murine blastocysts or in chick embryos contribute to
a number of tissues of the chimeric mouse or chicken embryo
(Clarke, D. L. et al. 2000). LacZ-expressing cells were found with
varying degree of mosaicism, not only in the central nervous
system, but also in mesodermal derivatives as well as in epithelial
cells of the liver and intestine but not in other tissues,
including the hematopoietic system. These studies therefore
suggested that adult NSCs may have significantly greater
differentiation potential than previously realized but still do not
have the pluripotent capability of ES or of the adult derived
multipotent adult stem cells (MASC) described in Furcht et al.
(International Application No. PCT/US00/21387) and herein. The
terms MASC, MAPC and MPC can also be used interchagably to describe
adult derived multipotent adult stem cells.
[0015] Therapies for degenerative and traumatic brain disorders
would be significantly furthered with cellular replacement
therapies. NSC have been identified in the sub-ventricular zone
(SVZ) and the hippocampus of the adult mammalian brain (Ciccolini
et al., 1998; Morrison et al., 1999; Palmer et al., 1997; Reynolds
and Weiss, 1992; Vescovi et al., 1999) and may also be present in
the ependyma and other presumed non-neurogenic areas of the brain
(Doetsch et al., 1999; Johansson et al., 1999; Palmer et al.,
1999). Fetal or adult brain-derived NSC can be expanded ex vivo and
induced to differentiate into astrocytes, oligodendrocytes and
functional neurons (Ciccolini et al., 1998; Johansson et al., 1999;
Palmer et al., 1999; Reynolds et al., 1996; Ryder et al., 1990;
Studer et al., 1996; Vescovi et al., 1993). In vivo,
undifferentiated NSC cultured for variable amounts of time
differentiate into glial cells, GABAergic and dopaminergic neurons
(Flax et al., 1998; Gage et al., 1995; Suhonen et al., 1996). The
most commonly used source of NSC is allogeneic fetal brain, which
poses both immunological and ethical problems. Alternatively, NSC
could be harvested from the autologous brain. As it is not known
whether pre-existing neural pathology will affect the ability of
NSC to be cultured and induced to differentiate into neuronal and
glial cells ex vivo, and because additional surgery in an already
diseased brain may aggravate the underlying disease, this approach
is less attractive.
[0016] The ideal source of neurons and glia for replacement
strategies would be cells harvestable from adult, autologous tissue
different than the brain that was readily accessible and that can
be expanded in vitro and differentiated ex vivo or in vivo to the
cell type that is deficient in the patient. Recent reports have
suggested that BM derived cells acquire phenotypic characteristics
of neuroectodermal cells when cultured in vitro under NSC
conditions, or when they enter the central nervous system
(Sanchez-Ramos et al., 2000; Woodbury et al., 2000). The phenotype
of the BM cells with this capability is not known. The capacity for
differentiation of cells that acquire neuroectodermal features to
other cell types is also unknown.
[0017] A third tissue specific cell with stem cell properties is
the mesenchymal stem cell (MSC), initially described by
Fridenshtein (1982). MSC, originally derived from the embryonal
mesoderm and isolated from adult BM, can differentiate to form
muscle, bone, cartilage, fat, marrow stroma, and tendon. During
embryogenesis, the mesoderm develops into limb-bud mesoderm, tissue
that generates bone, cartilage, fat, skeletal muscle and possibly
endothelium. Mesoderm also differentiates to visceral mesoderm,
which can give rise to cardiac muscle, smooth muscle, or blood
islands consisting of endothelium and hematopoietic progenitor
cells. Primitive mesodermal or MSCs, therefore, could provide a
source for a number of cell and tissue types. A number of MSCs have
been isolated. (See, for example, Caplan, A., et al., U.S. Pat. No.
5,486,359; Young, H., et al., U.S. Pat. No. 5,827,735; Caplan, A.,
et al., U.S. Pat. No. 5,811,094; Bruder, S., et al., U.S. Pat. No.
5,736,396; Caplan, A., et al., U.S. Pat. No. 5,837,539; Masinovsky,
B., U.S. Pat. No. 5,837,670; Pittenger, M., U.S. Pat. No.
5,827,740; Jaiswal, N., et al., 1997; Cassiede P., et al., 1996;
Johnstone, B., et al., 1998; Yoo, et al., 1998; Gronthos, S.,
1994).
[0018] Of the many MSC that have been described, all have
demonstrated limited differentiation to form cells generally
considered to be of mesenchymal origin. To date, the most
multipotent MSC reported is the cell isolated by Pittenger, et al.,
which expresses the SH2.sup.+ SH4.sup.+ CD29.sup.+ CD44.sup.+
CD71.sup.+ CD90.sup.+ CD106.sup.+ CD120a.sup.+ CD124.sup.- CD
14.sup.- CD34.sup.- CD45.sup.- phenotype. This cell is capable of
differentiating to form a number of cell types of mesenchymal
origin, but is apparently limited in differentiation potential to
cells of the mesenchymal lineage, as the team who isolated it noted
that hematopoietic cells were never identified in the expanded
cultures (Pittenger, et al., 1999).
[0019] Other tissue-specific stem cells have been identified,
including gastrointestinal stem cells (Potten, C. 1998), epidermal
stem cells (Watt, F. 1997), and hepatic stem cells, also termed
oval cells (Alison, M. et al. 1998). Most of these are less well
characterized.
[0020] Compared with ES cells, tissue specific stem cells have less
self-renewal ability and, although they differentiate into multiple
lineages, they are not pluripotent. No studies have addressed
whether tissue specific cells express the markers described above
as seen in ES cells. In addition, the degree of telomerase activity
in tissue specific or lineage comitted stem cells has not been
fully explored, in part because large numbers of highly enriched
populations of these cells are difficult to obtain.
[0021] Until recently, it was thought that tissue specific stem
cells could only differentiate into cells of the same tissue. A
number of recent publications have suggested that adult organ
specific stem cells may be capable of differentiation into cells of
different tissues. However, the true nature of these types of cells
has not been fully discerned. A number of studies have shown that
cells transplanted at the time of a BM transplant can differentiate
into skeletal muscle (Ferrari 1998; Gussoni 1999). This could be
considered within the realm of possible differentiation potential
of mesenchymal cells that are present in marrow. Jackson published
that muscle satellite cells can differentiate into hemopoietic
cells, again a switch in phenotype within the splanchnic mesoderm
of the embryo (Jackson 1999). Other studies have shown that stem
cells from one embryonic layer (for instance splanchnic mesoderm)
can differentiate into tissues thought to be derived during
embryogenesis from a different embryonic layer. For instance,
endothelial cells or their precursors detected in humans or animals
that underwent marrow transplantation are at least in part derived
from the marrow donor (Takahashi, 1999; Lin, 2000). Thus, visceral
mesoderm and not splanchnic mesoderm, capabilities such as MSC,
derived progeny are transferred with the infused marrow. Even more
surprising are the reports demonstrating both in rodents and humans
that hepatic epithelial cells and biliary duct epithelial cells can
be seen in recipients that are derived from the donor marrow
(Petersen, 1999; Theise, 2000; Theise, 2000). Likewise, three
groups have shown that NSCs can differentiate into hemopoietic
cells. Finally, Clarke et al. reported that cells be termed NSCs
when injected into blastocysts can contribute to all tissues of the
chimeric mouse (Clarke et al., 2000).
[0022] It is necessary to point out that most of these studies have
not conclusively demonstrated that a single cell can differentiate
into tissues of different organs. Also, stem cells isolated from a
given organ may not necessarily be a lineage committed cell. Indeed
most investigators did not identify the phenotype of the initiating
cell. An exception is the study by Weissman and Grompe, who showed
that cells that repopulated the liver were present in
LinThy.sub.1LowSca.sub.1.sup.+ marrow cells, which are highly
enriched in HSCs. Likewise, the Mulligan group showed that marrow
Sp cells, highly enriched for HSC, can differentiate into muscle
and endothelium, and Jackson et al. showed that muscle Sp cells are
responsible for hemopoietic reconstitution (Gussoni et al.,
1999).
[0023] Transplantation of tissues and organs generated from
heterologous ES cells requires either that the cells be further
genetically modified to inhibit expression of certain cell surface
markers, or that the use of chemotherapeutic immune suppressors
continue in order to protect against transplant rejection. Thus,
although ES cell research provides a promising alternative solution
to the problem of a limited supply of organs for transplantation,
the problems and risks associated with the need for
immunosuppression to sustain transplantation of heterologous cells
or tissue would remain. An estimated 20 immunologically different
lines of ES cells would need to be established in order to provide
immunocompatible cells for therapies directed to the majority of
the population.
[0024] Using cells from the developed individual, rather than an
embryo, as a source of autologous or from tissue typing matched
allogeneic stem cells would mitigate or overcome the problem of
tissue incompatibility associated with the use of transplanted ES
cells, as well as solve the ethical dilemma associated with ES cell
research. The greatest disadvantage associated with the use of
autologous stem cells for tissue transplant thus far lies in their
relatively limited differentiation potential. A number of stem
cells have been isolated from fully-developed organisms,
particularly humans, but these cells, although reported to be
multipotent, have demonstrated limited potential to differentiate
to multiple cell types.
[0025] Thus, even though stem cells with multiple differentiation
potential have been isolated previously by others and by the
present inventors, a progenitor cell with the potential to
differentiate into a wide variety of cell types of different
lineages, including fibroblasts, hepatic, osteoblasts,
chondrocytes, adipocytes, skeletal muscle, endothelium, stroma,
smooth muscle, cardiac muscle and hemopoietic cells, has not been
described. If cell and tissue transplant and gene therapy are to
provide the therapeutic advances expected, a stem cell or
progenitor cell with the greatest or most extensive differentiation
potential is needed. What is needed is the adult equivalent of an
ES cell.
[0026] BM, muscle and brain are the three tissues in which cells
with apparent greater plasticity than previously thought have been
identified. BM contains cells that can contribute to a number of
mesodermal (Ferrari G. et al., 1998; Gussoni E. et al., 1999; Rafii
S. et al., 1994; Asahara T. et al., 1997; Lin Y. et al., 2000;
Orlic D. et al., 2001; Jackson K. et al., 2001) endodermal
(Petersen B. E. et al., 1999; Theise, N. D. et al., 2000; Lagasse
E. et al., 2000; Krause D. et al., 2001) and neuroectodermal (Mezey
D. S. et al., 2000; Brazelton T. R., et al., 2000, Sanchez-Ramos J.
et al., 2000; Kopen G. et al., 1999) and skin (Krause, D. et al.,
2001) structures. Cells from muscle may contribute to the
hematopoietic system (Jackson K. et al., 1999; Seale P. et al.,
2000). There is also evidence that NSC may differentiate into
hematopoietic cells (Bjornson C. et al., 1999; Shih C. et al.,
2001), smooth muscle myoblasts (Tsai R. Y. et al., 2000) and that
NSC give rise to several cell types when injected in a mouse
blastocyst (Clarke, D. L. et al., 2000).
[0027] The present study demonstrates that cells with multipotent
adult progenitor characteristics can be culture-isolated from
multiple different organs, namely BM, muscle and the brain. The
cells have the same morphology, phenotype, in vitro differentiation
ability and have a highly similar expressed gene profile.
SUMMARY OF THE INVENTION
[0028] The present invention is a multipotent adult stem cell
(MASC) isolated from a mammal, preferably mouse, rat or human. The
cell is derived from a non-embryonic organ or tissue and has the
capacity to be induced to differentiate to form at least one
differentiated cell type of mesodermal, ectodermal and endodermal
origin. In a preferred embodiment, the organ or tissue from which
the MASC are isolated is bone marrow, muscle, brain, umbilical cord
blood or placenta.
[0029] Examples of differentiated cells that can be derived from
MASC are osteoblasts, chondrocytes, adipocytes, fibroblasts, marrow
stroma, skeletal muscle, smooth muscle, cardiac muscle, occular,
endothelial, epithelial, hepatic, pancreatic, hematopoietic, glial,
neuronal or oligodendrocytes. Differentiation can be induced in
vivo or ex vivo.
[0030] The MASC of the present invention is also summarized as a
cell that constitutively expresses oct4 and high levels of
telomerase and is negative for CD44, MHC class I and MHC class II
expression. As a method of treatment, this cell administered to a
patient in a therapeutically effective amount. A surprising benefit
of this treatment is that no teratomas are formed in vivo.
[0031] An object of the invention is to produce a normal, non-human
animal comprising MASC. Preferably, the animal is chimeric.
[0032] Another embodiment of the invention is a composition
comprising a population of MASC and a culture medium that expands
the MASC population. It is advantageous in some cases for the
medium to contain epidermal growth factor (EGF), platelet derived
growth factor (PDGF) and leukemia inhibitory factor (LIF).
[0033] The present invention also provides a composition comprising
a population of fully or partially purified MASC progeny. The
progeny can have the capacity to be further differentiated, or can
be terminally differentiated.
[0034] In a preferable embodiment, the progeny are of the
osteoblast, chondrocyte, adipocyte, fibroblast, marrow stroma,
skeletal muscle, smooth muscle, cardiac muscle, occular,
endothelial, epithelial, hepatic, pancreatic, hematopoietic, glial,
neuronal or oligodendrocyte cell type.
[0035] The present invention also provides a method for isolating
and propagating MASC by obtaining tissue from a mammal,
establishing a population of adherent cells, depleting the
population of CD45.sup.+ cells, recovering CD45.sup.- cells and
culturing them under expansion conditions to produce an expanded
cell population. An object of the present invention, therefore, is
to produce an expanded cell population obtained by this method.
[0036] An aspect of the invention is a method for differentiating
MASC ex vivo by isolating and propagating them, and then culturing
the propagated cells in the presence of desired differentiation
factors. The preferred differentiation factors are basic fibroblast
growth factor (bFGF), vascular endothelial growth factor (VEGF),
dimethylsulfoxide (DMSO) and isoproterenol; or fibroblast growth
factor4 (FGF4) and hepatocyte growth factor (HGF). Another aspect
of the invention is the differentiated cell itself.
[0037] The invention includes a method for differentiating MASC in
vivo, by isolating and expanding them, and then administering the
expanded cell population to a mammalian host, wherein said cell
population is engrafted and differentiated in vivo in tissue
specific cells, such that the function of a cell or organ,
defective due to injury, genetic disease, acquired disease or
iatrogenic treatments, is augmented, reconstituted or provided for
the first time. Using this method, the MASC can undergo
self-renewal in vivo.
[0038] A further aspect of the invention is a differentiated cell
obtained by ex vivo or in vivo differentiation. In a preferred
embodiment, the differentiated cell is ectoderm, mesoderm or
endoderm. In another preferred embodiment, the differentiated cell
is of the osteoblast, chondrocyte, adipocyte, fibroblast, marrow
stroma, skeletal muscle, smooth muscle, cardiac muscle, occular,
endothelial, epithelial, hepatic, pancreatic, hematopoietic, glial,
neuronal or oligodendrocyte cell type.
[0039] An important application of this technology is the method of
treating a patient by administering a therapeutically effective
amount of MASC or their progeny. The progeny can either have the
capacity to be further differentiated, or can be terminally
differentiated. An unexpected benefit of this approach is that the
need for pretreatment and/or post treatment of the patient with
irradiation, chemotherapy, immunosuppressive agents or other drugs
or treatments is reduced or eliminated. The induction of tolerance
before or during treatment is also not required.
[0040] Such treatment can treat a variety of diseases and
conditions, including cancer, cardiovascular disease, metabolic
disease, liver disease, diabetes, hepatitis, hemophilia,
degenerative or traumatic neurological conditions, autoimmune
disease, genetic deficiency, connective tissue disorders, anemia,
infectious disease and transplant rejection.
[0041] MASC or their progeny are administered via localized
injection, including catheter administration, systemic injection,
parenteral administration, oral administration, or intrauterine
injection into an embryo. Administration can be in conjunction with
a pharmaceutically acceptable matrix, which may be
biodegradable.
[0042] MASC or their progeny, administered to a patient, alter the
immune system to resist viral, bacterial or fungal infection.
[0043] Surprisingly, teratomas are not formed when MASC or their
progeny are adminstered to a patient.
[0044] When administered to a patient, MASC or their progeny also
are able to augment, reconstitute or provide for the first time the
function of a cell or organ defective due to injury, genetic
disease, acquired disease or iatrogenic treatments. The organ is
any of bone marrow, blood, spleen, liver, lung, intestinal tract,
brain, immune system, circulatory system, bone, connective tissue,
muscle, heart, blood vessels, pancreas, central nervous system,
peripheral nervous system, kidney, bladder, skin, epithelial
appendages, breast-mammary glands, fat tissue, and mucosal surfaces
including oral esophageal, vaginal and anal. Examples of diseases
treatable by this method are cancer, cardiovascular disease,
metabolic disease, liver disease, diabetes, hepatitis, hemophilia,
degenerative or traumatic neurological conditions, autoimmune
disease, genetic deficiency, connective tissue disorders, anemia,
infectious disease and transplant rejection.
[0045] The MASC or their progeny home to one or more organs in the
patient and are engrafted therein such that the function of a cell
or organ, defective due to injury, genetic disease, acquired
disease or iatrogenic treatments, is augmented, reconstituted or
provided for the first time, which is surprising and unexpected. In
a preferred embodiment, the injury is ischemia or inflammation.
[0046] In another preferred embodiment, the MASC or their progeny
enhance angiogenesis.
[0047] In an additional aspect of the invnetion, MASC or their
progeny are genetically transformed to deliver a therapeutic agent,
preferably an antiangiogenic agent.
[0048] The invention provides a therapeutic composition comprising
MASC and a pharmaceutically acceptable carrier, wherein the MASC
are present in an amount effective to produce tissue selected from
the group consisting of bone marrow, blood, spleen, liver, lung,
intestinal tract, brain, immune system, bone, connective tissue,
muscle, heart, blood vessels, pancreas, central nervous system,
kidney, bladder, skin, epithelial appendages, breast-mammary
glands, fat tissue, and mucosal surfaces including oral esophageal,
vaginal and anal.
[0049] The invention further provides a therapeutic method for
restoring organ, tissue or cellular function to a patient
comprising the steps of removing MASC from a mammalian donor,
expanding MASC to form an expanded population of undifferentiatied
cells, and adminstering the expanded cells to the patient, wherein
organ, tissue or cellular function is restored. The restored
function may be enzymatic or genetic. In a preferred embodiment,
the mammalian donor is the patient.
[0050] The invention provides a method of inhibiting the rejection
of a heterologous MASC transplanted into a patient comprising the
steps of introducing into the MASC, ex vivo, a nucleic acid
sequence encoding the recipient's MHC antigen operably linked to a
promotor, wherein the MHC antigen is expressed by the MASC and
transplanting the MASC into the patient, wherein MHC antigen is
expressed at a level sufficient to inhibit the rejection of the
transplanted MASC. The patient is of the same species or another
mammalian species as the donor of the MASC.
[0051] An alternative method of inhibiting the rejection of a
heterologous MASC transplanted into a patient comprises
transgenically knocking out expression of MHC antigen in the MASC
and transplanting the transgenic MASC into the patient MHC antigen
is not expressed by the MASC and rejection of the transplanted
cells is inhibited.
[0052] An object of the invention is a method of generating blood
or individual blood components ex vivo by the process of isolating
MASC and differentiating the MASC to form blood or blood
components. Preferably, the individual blood components are red
blood cells, white blood cells or platelets.
[0053] Another aspect of the invention is a method of drug
discovery comprising the steps of analyzing the genomic or
proteomic makeup of MASC or their progeny, employing analysis
thereof via bioinformatics and/or computer analysis using
algorithms, and assembling and comparing new data with known
databases to compare and contrast these.
[0054] A further aspect is a method of identifying the components
of a differentiation pathway comprising the steps of analyzing the
genomic or proteomic makeup of MASC, inducing differentiation of
MASC in vitro or in vivo, analyzing the genomic or proteomic makeup
of intermediary cells in the differentiation pathway, analyzing the
genomic or proteomic makeup of terminally differentiated cells in
the differentiation pathway, using bioinformatics and/or algorithms
to characterize the genomic or proteomic makeup of MASC and their
progeny, and comparing the data obtained in (e) to identify the
components of the pathway. Using this method, differentiation that
occurs in vitro can be compared with differentiation that occurs in
vivo such that fundamental differences between the two systems can
be characterized.
[0055] The invention provides a method of generating products in
vitro that have therapeutic, diagnostic or research utility by
identifying the products in MASC and isolating the products from
MASC. In a preferred embodiment, the products are proteins, lipids,
complex carbohydrates, DNA or RNA.
[0056] Included in the invention is a method of inducing, in a
mammal, tolerance to an antigen administered to said mammal, the
method comprising the step of administering to said mammal, after
or simultaneously with the administration of said antigen, an
effective amount of MASC or their progeny so that said mammal's
humoral immune response to a subsequent challenge with said antigen
is suppressed.
[0057] Also included is a method for removing toxins from the blood
of a patient comprising contacting blood ex vivo with MASC derived
cells, wherein said cells line a hollow, fiber based device. In a
preferred embodiment, the cells are kidney or liver cells.
[0058] An object of the invention is a method for delivering
therapeutic products to a patient comprising contacting the blood
of said patient ex vivo with MASC or their progeny, wherein said
MASC or their progeny are genetically transformed to deliver a
therapeutic agent.
[0059] A further object is a method for testing the toxicity of a
drug comprising contacting MASC or their progeny ex vivo with said
drug and monitoring cell survival. In a preferred embodiment, the
progeny are selected from the group consisting of hepatic,
endothelial, epithelial and kidney.
BRIEF DESCRIPTION OF DRAWINGS
[0060] The following Detailed Description, given by way of example,
but not intended to limit the invention to specific embodiments
described, may be understood in conjunction with the accompanying
drawings, incorporated herein by reference, in which:
[0061] FIG. 1 shows a graphical illustration of the expansion
potential of bone marrow (BM), muscle and brain derived MASC.
[0062] FIG. 2 shows a scatter plot representing gene expression in
(A) muscle and brain MASC and (B) bone marrow and muscle MASC.
[0063] FIG. 3 shows a graphical illustration of FACS analysis of
undifferentiated
[0064] MASC and MASC cultured with VEGF. The plots show isotype
control IgG staining profile (thin line) vs. specific antibody
staining profile (thick line). Panel A shows the phenotype of
undifferentiated MASC. MASC express low levels of
.beta.2-microglobulin, Flk1, Flt 1 and AC 133, but do not stain
with any of the other anti-endothelial markers; panel B shows the
phenotype of MASC cultured for 14 days with 10 ng/mL VEGF. MASC
express low levels most markers associated with endothelial cells,
but lost expression of AC 133; and panel C shows phenotype of MASC
cultured or 3-9 days with 10 ng/mL VEGF. MASC lose expression of AC
133 by day 3 of culture with VEGF, acquire expression of Tek and
VE-cadherin by day 3, Tie, vWF, CD34 and HIP12 by day 9.
[0065] FIG. 4 shows a photomicrograph of engraftment and in vivo
differentiation of mMASC. Slides were examined by fluorescence or
confocal microscopy. Panels A, G, J, N, Q and S represent
identically stained tissues of control NOD-SCID animals that were
not injected with mMASC. Panels A-F show a photomicrograph of bone
marrow (BM) cytospin from a control (A) and study (B-F) animal
stained with anti.beta.-gal-FITC antibody and PE-conjugated
antibodies to various hematopoietic antigens. A-B: CD45, C: CD19,
D: MAC1, E: GR1, F:TER119 and DAPI; panels G-I shows a
photomicrograph of a spleen section from a control (G) and study
animal (H, I) stained with anti-.beta.-gal-FITC antibody and
anti-CD45-PE antibody. Donor derived anti-.beta.-gal.sup.+ cells
are seen in clusters. H is 10.times. and I are 60.times.
magnifications; panels J-M shows a photomicrograph of a liver
section from a control mouse (J) and study animal (K-M) stained
with anti-.beta.-gal-FITC. J-L are co-stained with
mouse-anti-CK-18/anti-mouse-Cy5 plus CD45-PE and M with mouse
anti-albumin/anti-mouse Cy3 antibodies. J-K, L and M are 20.times.,
60.times. and 10.times. magnifications respectively; panels N-P
show a photomicrograph of an intestine section from a control mouse
and study animal (O-P), stained with anti-.beta.-gal-FITC plus
mouse-anti-pan-CK/anti-mouse-Cy5 antibodies (N-P). N and P are
costained with CD45-PE antibodies. .beta.-gal.sup.+
Pan-CK.sup.+CD45.sup.- epithelial cells covered 50% (solid arrow,
panel P) of the circumference of villi.
Pan-CK.sup.-/.beta.-gal.sup.+ cells in the core of the villi (open
arrow-panel O) co-stained for CD45 (P); panels Q-R show a
photomicrograph of a lung section from a control mouse (Q) and
study animal (R) stained with anti-.beta.-gal-FITC plus
mouse-anti-pan-CK/anti-mouse-Cy5 plus CD45-PE antibodies. Several
.beta.-gal.sup.+ pan-CK.sup.+ donor cells are seen lining the
alveoli of the recipient animal (R). CD45.sup.+/pan-CK.sup.- cells
of hematopoietic origin are seen distinctly from the epithelial
cells; and panels S-T show a photomicrograph of a blood vessel
section from a control mouse (S) and thymic lymphoma that developed
in a study animal 16 weeks after transplantation (T) stained with
anti-.beta.-gal-FITC, anti-vWF-PE and TO-PRO3. .beta.-gal.sup.+
donor cells differentiated into vWF.sup.+ endothelial cells in the
thymic lymphoma which is of recipient origin, as the tumor cells
did not stain with anti-.beta.-Gal antibodies.
[0066] FIG. 5 shows immunohistochemical evaluation of MASC-derived
endothelial cells using confocal fluorescence microscopy. (a) MASC
grown for 14 days in VEGF. Typical membrane staining is seen for
the adhesion receptor, .alpha.v.beta.5, and for the adherens
junction proteins, ZO-1, .beta.- and .gamma.-catenin. Scale bar=50
.mu.m. (b) Morphology in bright field of MASC at day 0 (upper
panel) and day 21 (lower panel) after VEGF treatment. Bar=25
.mu.m.
[0067] FIG. 6 shows a photomicrograph of MASC derived endothelial
cells. Panel A shows histamine-mediated release of vWF from
MASC-derived endothelium. Staining with antibodies against myosin
shows cytoskeletal changes with increased numbers of myosin stress
fibers, and widening of gap junctions (Arrows) (Representative
example of 3 experiments). Scale bar=60 .mu.m; panel B shows
MASC-derived endothelium takes up a-LDL. After 7 days, cells
expressed Tie-1, but again did not take up a-LDL. However,
acquisition of expression of vVWF on day 9 was associated with
uptake of aLDL (representative example of 10 experiments). Scale
bar=100 .mu.m; and panel C shows vascular tube formation by
MASC-derived endothelium. After 6 h, typical vascular tubes could
be seen. (Representative example of 6 experiments). Scale bar=200
.mu.m
[0068] FIG. 7 shows a graphical illustration of FACS analysis of
MASC derived endothelial cells. The Plots show isotype control IgG
staining profile (thin line) vs. specific antibody staining profile
(thick line) (Representative example of >3 experiments). Number
above plots is the Mean Fluorescence Intensity (MFI) for the
control IgG staining and the specific antibody staining. Panel A
shows hypoxia upregulates Flk1 and Tek expression on MASC-derived
endothelial cells analyzed by flow cytometry; panel B shows that
hypoxia upregulates VEGF production by MASC-derived endothelial
cells. VEGF levels were measured by ELISA and the results are shown
as Mean.+-.SEM of 6 experiments; and panel C shows that IL-1a
induces expression of class II HLA antigens and increases
expression of adhesion receptors. Plots show isotype control IgG
staining profile (thin line) vs. specific antibody staining profile
(thick line) (Representative example of 3 experiments). Number
above plots shows MFI for the control IgG staining and the specific
antibody staining.
[0069] FIG. 8 shows a photomicrograph of human MASC derived
endothelial cells. Panels C-F show the 3-D reconstructed figures
for either anti-human .beta.2-microglobulin-FITC (panel C) or
anti-mouse-CD31-FITC (panel D) and merging of the two (Panel E),
anti-vWF-Cy3 (panel F), and merging of the three staining patterns
(Panel G). Panels A and B show the confocal image of a single slice
stained with either anti-human .beta.2-microglobulin-FITC and
anti-vWF-Cy3, or anti-mouse-CD31-Cy5 and anti-vWF-Cy3. Scale
bar=100 .mu.m. Panel H shows wound healing resulting in a highly
vascularized area in the punched ear stained with
anti-.beta.2-microglobulin-FITC and anti-vWF in mice injected with
human MASC-derived endothelial cells (Top panel) or human foreskin
fibroblasts (Bottom panel). Scale bar=20 .mu.m. C=Cartilage.
D=dermis. Panel I shows that tumor angiogenesis is derived from
endothelial cells generated in vivo from MASC resulting in a highly
vascularized area in the tumor stained with
anti-X32-microglobulin-FITC, anti-vWF and TOPRO-3. Scale bar=20
.mu.m.
[0070] FIG. 9 shows spiking behavior and expressed voltage-gated
sodium currents in hMSC derived neuron-like cells. Panel A shows a
photomicrograph of cultured hMSC-derived neurons that showed
spiking behavior and expressed voltage-gated sodium currents (the
shadow of the pipette points to the cell). Panel B shows graphical
illustrations of current-clamp recordings from a hMSC derived
neuron. Panel C shows graphical illustrations of leak-subtracted
current traces from the same hMSC derived neuron.
[0071] FIG. 10 shows quantitative RT-PCR and Western blot analysis
confirming the hepatocyte-like phenotype. Panels A and B show mMASC
(A) and hMASC (B) cultured on Matrigel.TM. with FGF4 and HGF or
FGF4 alone for 21 and 28 days respectively. For aFP, Cyp2b9 and
Cyp2b13, numbers under the blots are relative to mRNA from liver,
as no transcripts were detected in undifferentiated MASC. Li=mouse
or human liver mRNA; NT=no-template. Representative example of 5
mouse and 1 human studies, Panel C shows hMASC (B) cultured on
Matrigel.TM. with FGF4 and HGF or FGF4 alone for 21 days. FH=FGF4
and HGF-induced hMASC on Matrigel.TM., Huh=Huh7 cell line used as
control.
[0072] FIG. 11 shows a photomicrograph of hepatocyte-like cells.
MASC induced by FGF4 produce glycogen. Glycogen storage is seen as
accumulation of dark staining (Representative example of 3
studies). Scale bar=25 .mu.m.
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0073] As used herein, the following terms shall have the following
meanings:
[0074] "Expansion" shall mean the propogation of a cell without
differentiation.
[0075] "Intermediary cells" are cells produced during
differentiation of a MASC that have some, but not all, of the
characteristics of MASC or their terminally differentiated progeny.
Intermediary cells may be progenitor cells which are committed to a
specific pathway, but not to a specific cell type.
[0076] "Normal" shall mean an animal that is not diseased, mutated
or malformed, i.e., healthy animals.
[0077] "Self-renewal" shall mean the ability of cells to propagate
without the addition of external stimulation. The presence of
cytokines or other growth factors produced locally in the tissue or
organ shall not constitute external stimulation.
[0078] "Home" shall mean the ability of certain MASC or their
progeny to migrate specifically to sites where additional cells may
be needed.
[0079] "Knocking out expression" shall mean the elimination of the
function of a particular gene.
[0080] As used herein, "genomic or proteomic makeup" shall mean the
gene or protein components of a given cell.
[0081] "High levels of telomerase activity" can be correlated to
the two-fold level observed in the immortal human cell line
MCF.sub.7. Soule et al. (1973) J. Cancer Inst. 51:1409-1416.
Application of this Technology
[0082] MASC technology could be used to replace damaged, diseased,
dysfunctional or dead cells in the body of a mammal. Furthermore
these cells could be injected into the host using autologous or
allogeneic cells with or without nature or artificial supports,
matrices or polymers to correct for loss of cells, abnormal
function or cells or organs e.g. genetic such as mutations of genes
affecting a protein function such as sickle cell disease,
hemophilia or "storage diseases" where products accumulate in the
body because of faulty processing, e.g. Guacher's, Neiman Pick's,
mucopolysaccharidosis etc. Examples of restitution of dying or dead
cells would be the use of MASC or their differentiated progeny in
the treatment of macular degeneration and other neurodegenerative
diseases.
[0083] Given the ability to have these MASC to "home" to and
incorporate into organs/tissues of a host animal proliferate and
differentiation they could potentially be used to provide new
endothelial cells to an ischemic heart and also myocardial cells
themselves, numerous other examples exist.
[0084] There may be medical circumstances where transient benefits
to a tissue or organs function could have desirable effects. For
example, there are now cases with liver failure patients hooked up
to a bioartificial liver, which was sufficient to allow for the
recovery of normal liver function, obviating the need for a liver
transplant. This is a serious unmet medical need, for example in
one liver disease alone--hepatitis C. There are 4-5 million
Americans currently infected with hepatitis C and there are
estimates that 50% of these people will get cirrhosis and need a
liver transplant. This is a huge public health problem that is
begging for a remedy. Hepatocytes, derived from autologous or
allogeneic MASC, can be transplanted in this or other liver
diseases. Such transplants may either transiently provide liver
function to allow recovery of the recipient's own liver cells or
permanently repopulate a damaged liver to allow recovery of normal
liver function via the donor cells.
[0085] In addition to many cell therapies where the
undifferentiated MASC are administered to a human or other mammal
to then differentiate into specific cells in the donor, the progeny
of the MASC could be differentiated ex vivo and then be
administered as purified or even mixtures of cells to provide a
therapeutic benefit. These MASC in the undifferentiated state could
also be used as carriers or vehicles to deliver drugs or molecules
of therapeutic benefit. This could be to treat any one of a number
of diseases including but not limited to cancer, cardiovascular,
inflammatory, immunologic, infections, etc. So by example, a cell
perhaps an endothelial cell expressing a novel or high levels of an
angiogenic molecule could be administered to a patient which would
be incorporated into existing blood vessels to promote
angiogenesis, for example in the heart; correspondingly one could
have endothelial cells producing molecules that might suppress
angiogenesis that would be incorporated into blood cells and
inhibit their further formation for example in diabetic retinopathy
or in cancer where new blood vessel formation is key to the
pathogenesis, spread and extent of the disease.
[0086] The ability to populate the BM and to form blood ex vivo has
an untold use for important medical applications. For example
regarding ex vivo production of blood, the transfusion of blood and
blood products around the world is still performed with variable
safety because of transmission of infectious agents. Blood
transfusions have lead to HIV, hepatitis C and B, and now the
impending threat of Mad Cow or CJD, Creuzfeldt-Jakob disease. The
ability to produce blood in vitro, especially red blood cells,
could provide a safe and reliable alternative to collection of
blood from people. It might never fully replace blood collection
from donors. hMASC or their hematopoietic progeny could be placed
in animals in utero such as sheep which could form human
hematopoietic cells and serve as a source for human blood
components or proteins of therapeutic utility. The same could be
true for hepatocytes, islets or many other cell types but would
provide an alternative to producing human cells in vitro and use
the animals as factories for the cells. It could also assist in
blood shortages that are predicted to occur. hMASC could also
conceivably be transplanted into a human embryo to correct any one
of a number of defects.
[0087] Because these MASC can give rise to clonal populations of
specifically differentiated cells they are a rich platform for drug
discovery. This would involve doing gene expression, analyzing gene
expression, discovery of new genes activated patterns of
activation, proteomics and patterns of protein expression and
modification surrounding this. This would be analyzed with
bioinformatics, using data bases and algorithms for analyzing these
data compared to publicly available or proprietary data bases. The
information of how known drugs or agents might act could be
compared to information derived from MASC, their differentiated
progeny and from a population of people which could be available.
Pathways, targets, and receptors could be identified. New drugs,
antibodies or other compounds could be found to produce a
biologically desirable responses. Correspondingly, the MASC and
their differentiated progeny could be used as monitors for
undesirable responses, coupled with databases, bioinformatics and
algorithms.
[0088] These MASC derived from human, mouse, rat or other mammals
appear to be the only normal, non-malignant, somatic cell (non germ
cell) known to date to express very high levels of telomerase even
in late passage cells. The telomeres are extended in MASC and they
are karyotypically normal. Because MASC injected into a mammal,
home to multiple organs, there is the likelihood that newly arrived
MASC in a particular organ could be self renewing. As such, they
have the potential to repopulate an organ not only with themselves
but also with self renewing differentiated cell types that could
have been damaged, died, or otherwise might have an abnormal
function because of genetic or acquired disease.
[0089] For example in type I diabetes there is a progressive loss
of insulin producing beta cells in the pancreatic islets. In
various renal diseases there is progressive loss of function and in
some cases obliteration of glomerulus. If in the case of diabetes,
MASC or differentiated progeny might home to the pancreas and
themselves or via interaction with endogenous cells within the
pancreas, induce islets to be formed. This would have an
ameliorating impact on diabetes. Ultimately conditions, agents or
drugs might be found to in vivo control, i.e. promote or inhibit
their self renewing capability of the MASC and control, or enhance
or inhibit the movement to differentiated progeny, e.g., islet
precursors, hepatocyte precursors, blood precursors, neural and/or
cardiac precursors using MASC one will likely find pathways,
methods of activation and control that might induce endogenous
precursor cells within an organ to proliferate and
differentiation.
[0090] This same ability to repopulate a cellular tissue or organ
compartment and self renew and also differentiate could have
numerous uses and be of unprecedented usefulness to meet profound
unmet medical needs. So for example certain genetic diseases where
there are enzyme deficiencies have been treated by BM
transplantation. Often times this may help but not cure the
complications of the disease where residual effects of the disease
might persist in the brain or bones or elsewhere, MASC and
genetically engineered MASC offer the hope to ameliorate numerous
genetic and acquired diseases. They will also be useful for
diagnostic and research purposes and drug discovery.
[0091] The present invention also provides methods for drug
discovery, genomics, proteomics, and pathway identification;
comprising analyzing the genomic or proteomic makeup of a MASC,
coupled with analysis thereof via bioinformatics, computer analysis
via algorithms, to assemble and compare new with known databases
and compare and contract these. This will identify key components,
pathways, new genes and/or new patterns of gene and protein
expression and protein modification (proteomics) that could lead to
the definition of targets for new compounds, antibodies, proteins,
small molecule organic compounds, or other biologically active
molecules that would have therapeutic benefit.
EXAMPLES
[0092] The following examples are provided to illustrate but not
limit the invention.
Example 1
Selection, Culture and Characterization of Mouse Multipotent Adult
Stem Cells (mMASC)
Cell Isolation and Expansion
[0093] All tissues were obtained according to guidelines from the
University of Minnesota IACUC. BM mononuclear cells (BMMNC) were
obtained by ficoll-hypaque separation of BM was obtained from 5-6
week old ROSA26 mice or C57/BL6 mice. Alternatively, muscle and
brain tissue was obtained from 3-day old 129 mice. Muscles from the
proximal parts of fore and hind limbs were excised from and
thoroughly minced. The tissue was treated with 0.2% collagenase
(Sigma Chemical Co, St Louis, Mo.) for 1 hour at 37.degree. C.,
followed by 0.1% trypsin (Invitrogen, Grand Island, N.Y.) for 45
minutes. Cells were then triturated vigorously and passed through a
70-um filter. Cell suspensions were collected and centrifuged for
10 minutes at 1600 rpm. Brain tissues was dissected and minced
thoroughly. Cells were dissociated by incubation with 0.1% trypsin
and 0.1% DNAse (Sigma) for 30 minutes at 37.degree. C. Cells were
then triturated vigorously and passed through a 70-um filter. Cell
suspension was collected and centrifuged for 10 minutes at 1600
rpm.
[0094] BMMNC or muscle or brain suspensions were plated at
1.times.10.sup.5/cm.sup.2 in expansion medium [2% FCS in low
glucose Dulbecco's minimal essential medium (LG-DMEM), 10 ng/mL
each platelet derived growth factor (PDGF), epidermal growth factor
(EGF) and leukemia inhibitory factor (LIF)] and maintained at
5.times.10.sup.3/cm.sup.2. After 3-4 weeks, cells recovered by
trypsin/EDTA were depleted of CD45.sup.+/glycophorin (Gly)-A.sup.+
cells with micromagnetic beads. Resulting CD45.sup.-/Gly-A.sup.+
cells were replated at 10 cells/well in 96-well plates coated with
FN and were expanded at cell densities between 0.5 and
1.5.times.10.sup.3/cm.sup.2. The expansion potential of MASC was
similar regardless of the tissue from which they were derived (FIG.
1).
Characterization of MASC
[0095] Phenotypically, mMASC derived from BM, muscle and brain and
cultured on FN were CD13.sup.+, CD44.sup.-, CD45.sup.-, class-I and
class-II histocompatibility antigen.sup.-, Flk.sup.low and
cKit.sup.-, identical to the characteristics of hMASC, as described
in Internation Application No. PCT/US00/21387. Although cell
expansion during the initial 2-3 months was greater when cells were
cultured on collagen type IV, laminin or Matrigel.TM., cells had
phenotypic characteristics of MSC, i.e., expressed CD44 and did not
express CD13. As with human cells, mMASC cultured on FN expressed
transcripts for oct-4, and the LIF-R.
[0096] Approximately 1% of wells seeded with 10
CD45.sup.-/GlyA.sup.- cells yielded continuous growing cultures.
This suggests that the cells capable of initiating MASC cultures
are rare and likely less that 1/1,000 of CD45.sup.-/GlyA.sup.-
cells. mMASC cultured on FN were 8-10 .mu.m in diameter with a
large nucleus and scant cytoplasm. Several populations have been
cultured for >100 PDs. The morphology and phenotype of cells
remained unchanged throughout culture.
[0097] mMASC that had undergone 40 and 102 PDs were harvested and
telomere lengths evaluated. Telomere length was measured using the
Telomere Length Assay Kit from Pharmingen (New Jersey, USA)
according to the manufacturer's recommendations. Average telomere
length (ATL) of mMASC cultured for 40 PDs was 27 Kb. When re-tested
after 102 PDs, ATL remained unchanged. For karyotyping of mMASC,
cells were subcultured at a 1:2 dilution 12 h before harvesting,
collected with trypsin-EDTA, and subjected to a 1.5 h colcemid
incubation followed by lysis with hypotonic KCl and fixation in
acid/alcohol as previously described (Verfullie et al., 1992).
Cytogenic analysis was conducted on a monthly basis and showed a
normal karyotype, except for a single population that became
hyperdiploid after 45 PDs, which was no longer used for studies.
Murine MASC obtained after 46 to >80 PDs were tested by
Quantitative (Q)-RT-PCR for expression levels of Oct4 and Rex1, two
transcription factors important in maintaining an undifferentiated
status of ES cells. RNA was extracted from mouse MASC,
neuroectodermal differentiated progeny (day 1-7 after addition of
bFGF) and mouse ES cells. RNA was reverse transcribed and the
resulting cDNA underwent 40 rounds of amplification (ABI PRISM
7700, Perkin Elmer/Applied Biosystems) with the following reaction
conditions: 40 cycles of a two step PCR (95.degree. C. for 15
seconds, 60.degree. C. for 60 seconds) after initial denaturation
(95.degree. C. for 10 minutes) with 2 .mu.l of DNA solution,
1.times. TaqMan SYBR Green Universal Mix PCR reaction buffer.
Primers are listed in Table 1.
TABLE-US-00001 TABLE 1 Primers used NEO 5'-TGGATTGCACGCAGGTTCT-3'
5'-TTCGCTTGGTGGTCGAATG-3' Oct4 5'-GAAGCGTTTCTCCCTGGATT-3'
5'-GTGTAGGATTGGGTGCGTT-3' Rex 1 5'-GAAGCGTTCTCCCTGGAATTTC-3'
5'-GTGTAGGATTGGGTGCGTTT-3' otx 1 5'-GCTGTTCGCAAAGACTCGCTAC-3'
5'-ATGGCTCTGGCACTGATACGGATG-3' otx2 5'-CCATGACCTATACTCAGGCTTCAGG-3'
5'-GAAGCTCCATATCCCTGGGTGGAAAG-3' Nestin 5'
5'-GGAGTGTCGCTTAGAGGTGC-3' 5'-TCCAGAAAGCCAAGAGAAGC-3'
[0098] mRNA levels were normalized using GAPDH as housekeeping
gene, and compared with levels in mouse ES cells. Oct4 and Rex 1
mRNA were present at similar levels in BM, muscle and brain derived
MASC. Rex1 mRNA levels were similar in mMASC and mES cells, while
Oct4 mRNA levels were about 1,000 fold lower in MASC than in ES
cells.
Expressed Gene Profile of Mouse BM, Muscle and Brain Derived MASC
is Highly Similar
[0099] To further evaluate whether MASC derived from different
tissues were similar, the expressed gene profile of BM, muscle and
brain derived MASC was examined using U74A Affimetrix gene array.
Briefly, mRNA was extracted from 2-3.times.10.sup.6 BM, muscle or
brain derived-MASC, cultured for 45 population doublings.
Preparation of cDNA, hybridization to the U74A array containing
6,000 murine genes and 6,000 EST clusters, and data acquisition
were done per manufacturer's recommendations (all from Affimetrix,
Santa Clara, Calif.). Data analysis was done using GeneChip.RTM.
software (Affimetrix). Increased or decreased expression by a
factor of 2.2 fold (Iyer V. R. et al., 1999; Scherf U. et al.,
2000; Alizadeh A. A. et al., 2000) was considered significant.
r.sup.2 value was determined using linear regression analysis (FIG.
2).
[0100] Comparison between the expressed gene profile in MASC from
the three tissues showed that <1% of genes were expressed at
>2.2-fold different levels in MASC from BM than muscle.
Likewise, only <1% of genes were expressed >2.2-fold
different level in BM than brain derived MASC. As the correlation
coefficient between the different MASC populations was >0.975,
it was concluded that MASC derived from the different tissues are
highly homologous, in line with the phenotypic described above and
the differentiation characteristics described in Example 5.
[0101] Using the mouse-specific culture conditions, mMASC cultures
have been maintained for more than 100 cell doublings. mMASC
cultures have been initiated with marrow from C57B1/6 mice, ROSA26
mice and C57BL/6 mice transgenic for the -HMG-LacZ.
Example 2
Selection and Culture of Rat Multipotent Adult Stem Cells
(rMASC)
[0102] BM and MNC from Sprague Dawley or Wistar rats were obtained
and plated under conditions similar for mMASC. After 21-28 days,
cells were depleted of CD45.sup.+ cells, and the resulting
CD45.sup.+ cells were subcultured at 10 cells/well.
[0103] Similar to mMASC, rMASC have been culture expanded for
>100 PDs. Expansion conditions of rat MASC culture required the
addition of EGF, PDGF-BB and LIF and culture on FN, but not
collagen type I, laminin or Matrigel.TM.. rMASC were CD44, CD45 and
MI-IC class I and H negative, and expressed high levels of
telomerase. The ability of a normal cell to grow over 100 cell
doublings is unprecedented, unexpected and goes against
conventional dogma of more than two decades.
[0104] Rat MASC that had undergone 42 PDs, 72 PDs, 80 PDs, and 100
PDs, were harvested and telomere lengths evaluated. Telomeres did
not shorten in culture, as was determined by Southern blot analysis
after 42 PDs, 72 PDs, 80 PDs, and 100 PDs. Monthly cytogenetic
analysis of rat MASC revealed normal karyotype.
Example 3
Selection and Culture of Human Multipotent Adult Stem Cells
(hMASC)
[0105] BM was obtained from healthy volunteer donors (age 2-50
years) after informed consent using guidelines from the University
of Minnesota Committee on the use of Human Subject in Research.
BMMNC were obtained by Ficoll-Paque density gradient centrifugation
and depleted of CD45+ and glycophorin-A.sup.+ cells using
micromagnetic beads (Miltenyii Biotec, Sunnyvale, Calif.).
[0106] Expansion conditions: 5.times.10.sup.3 CD45.sup.-/GlyA.sup.-
cells were diluted in 200 .mu.L expansion medium [58% DMEM-LG, 40%
MCDB-201 (Sigma Chemical Co, St Louis, Mo.), supplemented with
1.times. insulin-transferrin-selenium (ITS), 1.times. linoleic-acid
bovine serum albumin (LA-BSA), 10.sup.-8M Dexamethasone, 10.sup.-4
M ascorbic acid 2-phosphate (all from Sigma), 100 U penicillin and
1,000 U streptomycin (Gibco)] and 0-10% fetal calf serum (FCS)
(Hyclone Laboratories, Logan, Utah) with 10 ng/ml of EGF (Sigma)
and 10 ng/ml PDGF-BB (R&D Systems, Minneapolis, Minn.)] and
plated in wells of 96 well plates that had been coated with 5 ng/ml
of FN (Sigma). Medium was exchanged every 4-6 days. Once wells were
>40-50% confluent, adherent cells were detached with 0.25%
trypsin-EDTA (Sigma) and replated at 1:4 dilution in MASC expansion
medium and bigger culture vessels coated with 5 ng/ml FN to
maintain cell densities between 2 and 8.times.10.sup.3
cells/cm.sup.2.
[0107] Undifferentiated MASC did not express CD31, CD34, CD36,
CD44, CD45, CD62-E, CD62-L, CD62-P, HLA-class I and II, cKit, Tie,
Tek, .alpha.,.beta..sub.3, VE-cadherin, vascular cell adhesion
molecule (VCAM), intracellular adhesion molecule (ICAM)-1. MASC
expressed low/very low levels of .beta.2-microglobulin,
.alpha..sub.v.beta..sub.5, CDw90, AC133, Flk1 and Flt1, and high
levels of CD13 and CD49b (FIG. 3).
Example 4
Immunophenotypic Analysis
Immunofluorescence
[0108] 1. Cultured cells were fixed with 4% paraformaldehyde and
methanol at room temperature, and incubated sequentially for 30 min
each with primary antibody, and with or without secondary antibody.
Between steps, slides were washed with PBS/BSA. Cells were examined
by fluorescence microscopy (Zeiss Axiovert; Carl Zeiss, Inc.,
Thornwood, N.Y.) and confocal fluorescence microscopy (Confocal
1024 microscope; Olympus AX70, Olympus Optical Co. LTD, Japan). To
assess the frequency of different cell types in a given culture,
the number of cells were counted that stained positive with a given
antibody in four visual fields (50-200 cells per field).
[0109] 2. Harvested tissues: Cytospin specimens of blood and BM
were fixed with acetone (Fisher Chemicals) for 10 min at room
temperature. For solid organs, 5 .mu.m thick fresh frozen sections
of tissues were mounted on glass slides and immediately fixed in
acetone for 10 min at room temperature. Following incubation with
isotype sera for 20 min, cytospin preparations or tissue sections
were serially stained for tissue specific antigens, 13-gal and a
nuclear counter stain (DAPI or TO-PRO-3). Cover slips were mounted
using Slowfade-antifade kit (Molecular Probes Inc., Eugene, Oreg.,
USA). Slides were examined by fluorescence microscopy and confocal
fluorescence microscopy.
[0110] 3. Antibodies: Cells were fixed with 4% paraformaldehyde at
room temperature or methanol at -20.degree. C., and incubated
sequentially for 30 min each with primary Ab, and FITC or Cy.sub.3
coupled anti-mouse- or anti-rabbit-IgG Ab. Between each step slides
were washed with PBS+1% BSA. PE or FITC-coupled anti-CD45,
anti-CD31, anti-CD62E, anti-Mac1, anti-Gr1, anti-CD19, anti-CD3,
and anti-Ter119 antibodies were obtained from BD Pharmingen. Abs
against GFAP (clone G-A-5, 1:400), galactocerebroside (GalC)
(polyclonal, 1:50), MBP (polyclonal, 1:50), GABA (clone GB-69,
1:100), parvalbumin (clone PARV-19, 1:2000), TuJ1 (clone SDL.3D10,
1:400), NF-68 (clone NR4, 1:400), NF-160 (clone NN 18, 1:40), and
NF-200 (clone N52, 1:400), NSE (polyclonal, 1:50), MAP2-AB (clone
AP20, 1:400), Tau (polyclonal, 1:400), TH (clone TH-2, 1:1000), DDC
(clone DDC-109, 1:100), TrH (clone WH-3, 1:1000), serotonin
(polyclonal, 1:2000), glutamate (clone GLU-4, 1:400), fast twitch
myosin (clone MY-32; 1:400 dilution) were from Sigma. DAPI and
TOPRO-3 were from Molecular Probes. Abs against vWF (polyclonal;
1:50) Neuro-D (polyclonal, 1:50), c-ret (polyclonal, 1:50) and
Nurrl (polyclonal, 1:50) were from Santa Cruz Biotechnology Inc.,
Santa Cruz, Calif. Abs against PSA-NCAM (polyclonal, 1:500) from
Phanmingen, San Diego, Calif. and against serotonin transporter
(clone MAB 1564, 1:400), DTP (polyclonal, 1:200), Na-gated voltage
channel (polyclonal, 1:100), glutamate-receptors-5, -6 and -7
(clone 3711:500) and NMDA (polyclonal 1:400) receptor from Chemicon
International, Temecula, Calif. Anti-nestin (1:400) Abs were a kind
gift from Dr. U. Lendahl, University of Lund, Sweden. Antibodies
against NSE (1:50) pan-cytokeratin (catalog number C-2562; 1:100),
CK-18 (C-8541; 1:300), albumin (A-6684; 1:100) were all obtained
from Sigma. Polyclonal antibodies against Flk1, Flt1, Tek, HNF-113
were obtained from Santa Cruz Biotechnology Inc., Santa Cruz,
Calif. Anti-nestin (1:400) antibodies were a kind gift from Dr. U.
Lendahl, University of Lund, Sweden. Control-mouse, -rabbit or,
-rat IgGs and FITC/PE/Cy3- and Cy5-labeled secondary antibodies
were obtained from Sigma. Rabbit anti-.beta.-gal-FITC antibody was
obtained from Rockland Immunochemicals, USA. TO-PRO-3 was obtained
from Molecular Probes Inc. and DAPI was obtained from Sigma.
B. X-GAL staining: Tissue sections were stained by for
.beta.-galactosidase enzyme activity using .beta.-gal staining kit
from Invitrogen, pH 7.4. Manufacturer's instructions were followed
except for the fixation step, during which the tissue sections were
incubated for 5 min instead of 10 min. C. FACS: For FACS,
undifferentiated MASC were detached and stained sequentially with
anti-CD44, CD45, CD13, cKit, MHC-class I and II, or
b2-microglobulin (BD Pharmingen) and secondary FITC or PE coupled
antibodies, fixed with 2% paraformaldehyde until analysis using a
FACS-Calibur (Becton-Dickinson).
Example 5
Single Cell Origin of Differentiated Lineages from MASC
[0111] The differentiation ability of mMASC or rMASC was tested by
adding differentiation factors (cytokines) chosen based on what has
been described for differentiation of hMASC or ES cells to
mesoderm, neuroectoderm, and endoderm. Differentiation required
that cells were replated at 1-2.times.10.sup.4 cells/cm.sup.2 in
serum free medium, without EGF, PDGF-BB and LIF, but with lineage
specific cytokines. Differentiation was determined by
immunohistology for tissue specific markers [slow twitch myosin and
MyoD (muscle), von-Willebrand factor (vWF) and Tek (endothelium),
NF200 and MAP2 (neuroectodermal), and cytokeratin-18 and albumin
(endodermal)], RT-PCR, and functional studies.
MASC Differentiation into Neuroectodermal Cells
[0112] Palmer et al. showed that neuroprogenitors can be culture
expanded with PDGF-BB and induced to differentiate by removal of
PDGF and addition of bFGF as a differentiation factor. Based on
those studies and studies conducted using hMASC, mMASC and rMASC
were plated in FN coated wells without PDGF-BB and EGF but with 100
ng/mL bFGF. Progressive maturation of neuron-like cells was seen
throughout culture. After 7 days, the majority of cells expressed
nestin. After 14 days, 15-20% of MASC acquired morphologic and
phenotypic characteristics of astrocytes (GFAP.sup.+), 15-20% of
oligodendrocytes (galactocerebroside (GalC).sup.+) and 50-60% of
neurons (neurofilament-200 (NF-200).sup.+). NF200, GFAP or GalC
were never found in the same cell, suggesting that it is unlikely
that neuron-like cells were hMASC or glial cells that
inappropriately expressed neuronal markers. Neuron-like cells also
expressed Tau, MAP2 and NSE. Approximately 50% of neurons expressed
gamma-amino-butyric-acid (GABA) and parvalbumin, 30% tyrosine
hydroxylase and dopa-decarboxylase (DDC), and 20% serotonin and
tryptophan hydroxylase. Differentiation was similar when MASC had
been expanded for 40 or >90 PDs. Q-RT-PCR, performed as
described in Example 1, confirmed expression of neuroectodermal
markers: on day 2 MASC expressed otx1 and otx2 mRNA, and after 7
days nestin mRNA was detected.
[0113] The effect of fibroblast growth factor (FGF)-8b as a
differentiation factor was tested next. This is important in vivo
for midbrain development and used in vitro to induce dopaminergic
and serotoninergic neurons from murine ES cells on hMASC. When
confluent hMASC (n=8) were cultured with 10 ng/mL FGF-8b+EGF,
differentiation into cells staining positive for neuronal markers
but not oligodendrocytes and astrocytes was seen. Neurons had
characteristics of GABAergic (GABA.sup.+; 40.+-.4%), dopaminergic
(DOPA, TH, DCC and DTP.sup.+, 26.+-.5%) and serotoninergic (TrH,
serotonin and serotonin-transporter.sup.+, 34.+-.6%) neurons.
DOPA.sup.+ neurons stained with Abs against Nurrl suggesting
differentiation to midbrain DA neurons. FGF-8b induced neurons did
not have electrophysiological characteristics of mature neurons.
Therefore, cocultured cells from 3-week old FGF-8b supported
cultures with the glioblastoma cell line, U-87, and FGF-8b for an
additional 2-3 weeks.
[0114] Neurons acquired a more mature morphology with increased
cell size and number, length and complexity of the neurites, and
acquired electrophysiological characteristics of mature neurons (a
transient inward current, blocked reversibly by 1 .mu.M
tetrodotoxin (TTX) together with the transient time course and the
voltage-dependent activation of the inward current is typical for
voltage-activated sodium currents, found only in mature
neurons).
[0115] When hMASC (n=13) were cultured with 10 ng/m brain-derived
neurotrophic factor (BDNF)+EGF, differentiation was to exclusively
DOPA, TH, DCC, DTP and Nurrl positive neurons. Although BDNF
supports neural differentiation from ES cells and NSC (Peault,
1996; Choi et al. 1998), no studies have shown exclusive
differentiation to DA-like neurons.
[0116] Similar results were seen for mMASC induced with bFGF and
rMASC with bFGF and BDNF. Further studies on MASC-derived neuronal
cells are presented in Example 10.
MASC Differentiation into Endothelial Cells
[0117] As an example of mesoderm, differentiation was induced to
endothelium. Undifferentiated mMASC or rMASC did not express the
endothelial markers CD31, CD62E, Tek or vWF, but expressed low
levels of Flk1. mMASC or rMASC were cultured in FN-coated wells
with 10 ng/mL of the endothelial differentiation factor VEGF-B.
Following treatment with VEGF for 14 days, >90% of MASC,
irrespective of the number of PDs they had undergone, expressed
Flt1, CD31, vWF or CD62, consistent with endothelial
differentiation. Like primary endothelial cells, MASC-derived
endothelial cells formed vascular tubes within 6 hours after
replating in Matrigel.TM.
[0118] Similarly, hMASC express Flk1 and Flt1 but not CD34, Muc18
(P1H12), PECAM, E- and P-selectin, CD36, or Tie/Tek. When hMASC
2.times.10.sup.4 cells/cm.sup.2 were cultured in serum free medium
with 20 ng/mL vascular endothelial growth factor (VEGF), cells
expressed CD34, VE-cadherin, VCAM and Muc-18 from day 7 on. On day
14, they also expressed Tie, Tek, Flk1 and Flt1, PECAM, P-selectin
and E-selectin, CD36, vWF, and connexin-40. Furthermore, cells
could uptake low-density lipoproteins (LDL). Results from the
histochemical staining were confirmed by Western blot. To induce
vascular tube formation, MASC cultured for 14 days with VEGF were
replated on Matrigel.TM. with 10 ng/mL VEGF-B for 6 h. Endothelial
differentiation was not seen when hMASC cultured in >2% FCS were
used. In addition, when FCS was left in the media during
differentiation, no endothelial cells were generated.
[0119] At least 1000-fold expansion was obtained when hMASC were
sub-cultured, suggesting that endothelial precursors generated from
hMASC continue to have significant proliferative potential. Cell
expansion was even greater when FCS was added to the cultures after
day 7.
[0120] When hMASC derived endothelial cells were administered
intravenously (I.V.) in NOD-SCI mice who have a human
colon-carcinoma implanted under the skin, contribution of the human
endothelial cells could be seen to the neovascularization in the
tumors. It may therefore be possible to incorporate genetically
modified endothelial cells to derive a therapeutic benefit, i.e.,
to inhibit angiogenesis in for example cancer or to promote it to
enhance vascularization in limbs or other organs such as the heart.
Further studies on MASC-derived endothelial cells are presented in
Example 9.
MASC Differentiation into Endoderm
[0121] Whether mMASC or rMASC could differentiate to endodermal
cells was tested. A number of different culture conditions were
tested including culture with the diffentiation factors
keratinocyte growth factor (KGF), hepatocyte growth factor (HGF)
and FGF-4, either on laminin, collagen, FN or Matrigel.TM. coated
wells. When re-plated on Matrigel.TM. with 10 ng/mL FGF4+10 ng/mL
approximately 70% of MASC acquired morphologic and phenotypic
characteristics of hepatocyte-like cells. Cells became epithelioid,
approximately 10% of cells became binucleated, and about 70% of
cells stained positive for albumin, cytokeratin (CK)-18, and
HNF-1P.
[0122] Endodermal-like cells generated in FGF4 and HGF containing
cultures also had functional characteristics of hepatocytes,
determined by measuring urea levels in supernatants of
undifferentiated MASC and FGF4 and HGF-induced MASC using the Sigma
Urea Nitrogen Kit 640 according to the manufacturer's
recommendations. No urea was detected in undifferentiated MASC
cultures. Urea production was 10 .mu.g/cell/hr 14 days after adding
FGF4 and HGF and remained detectable at similar levels until day
25. This is comparable to primary rat hepatocytes grown in
monolayer. Presence of albumin together with urea production
supports the notion of hepatic differentiation from MASC in vitro.
Further studies on MASC-derived hepatocytes are presented in
Example 11.
[0123] Given the likely existence of an endodermal lineage
precursor cell, MASC likely give rise to a cell that forms various
cells in the liver in the pancreas both exocrine and endocrine
components and other endodermal derived cell tissue lineages.
[0124] MASC derived from muscle or brain were induced to
differentiate to mesoderm (endothelial cells), neuroectoderm
(astrocytes and neurons) and endoderm (hepatocyte-like cells) using
the methods described above for BM-derived MASC.
Transduction
[0125] To demonstrate that differentiated cells were single cell
derived and MASC are indeed "clonal" multipotent cells, cultures
were made in which MASC had been transduced with a retroviral
vector and undifferentiated cells and their progeny were found to
have the retrovirus inserted in the same site in the genome.
[0126] Studies were done using two independently derived ROSA26
MASC, two C57BL/6 MASC and one rMASC population expanded for 40 to
>90PDs, as well as with the eGFP transduced "clonal" mouse and
"clonal" rMASC. No differences were seen between eGFP transduced
and untransduced cells. Of note, eGFP expression persisted in
differentiated MASC.
[0127] Specifically, murine and rat BMMNC cultured on FN with EGF,
PDGF-BB and LIF for three weeks were transduced on two sequential
days with an eGFP oncoretroviral vector. Afterwards, CD45.sup.+ and
GlyA.sup.+ cells were depleted and cells sub-cultured at 10
cells/well. eGFP-transduced rat BMMNC were expanded for 85 PDs.
Alternatively, mouse MASC expanded for 80 PDS were used.
Subcultures of undifferentiated MASC were generated by plating 100
MASC from cultures maintained for 75 PDs and re-expanding them to
>5.times.10.sup.6 cells. Expanded MASC were induced to
differentiate in vitro to endothelium, neuroectoderm and endoderm.
Lineage differentiation was shown by staining with antibodies
specific for these cell types, as described in Example 4.
Single Cell Origin of Mesodermal and Neuroectodermal Progeny
[0128] To prove single cell origin of mesodermal and
neuroectodermal differentiated progeny retroviral marking was used
(Jordan et al., 1990; Nolta et al., 1996). A fraction of hMASC
obtained after 20 PDs was transduced with an MFG-eGFP retrovirus.
eGFP.sup.+ hMASC were diluted in non-transduced MASC from the same
donors to obtain a final concentration of .about.5% transduced
cells. These mixtures were plated at 100 cells/well and culture
expanded until >2.times.10.sup.7 cells were obtained.
5.times.10.sup.6 MASC each were induced to differentiate to
skeletal myoblasts, endothelium and neuroectodermal lineages. After
14 days under differentiation conditions, cells were harvested and
used to identify the retroviral integration site and co-expression
of eGFP and neuroectodermal, muscle and endothelial markers.
[0129] For myoblast differentiation, hMASC were plated at
2.times.10.sup.4 cells/cm.sup.2 in 2% FCS, EGF and PDGF containing
expansion medium and treated with 3 .mu.M 5-azacytidine in the same
medium for 24 h. Afterwards, cells were maintained in expansion
medium with 2% FCS, EGF and PDGF-BB. For endothelial
differentiation, hMASC were replated at 2.times.10.sup.4
cells/cm.sup.2 in serum-free expansion medium without EGF and PDGF
but with 10 ng/ml VEGF-B for 14 days.
[0130] Immunofluorescence evaluation showed that 5-10% of cells in
cultures induced to differentiate with 5-azacytidine stained
positive for eGFP and skeletal actin, 5-10% of cells induced to
differentiate to endothelium costained for eGFP and vWF, and 5-10%
of cells induced to differentiate to neuroectoderm costained for
eGFP and either NF-200, GFAP or MBP. To define the retroviral
insertion site, the host genomic flanking region in MASC and
differentiated progeny was sequenced. The number of retroviral
inserts in the different populations was between one and seven. As
shown in Table 2, a single, identical sequence flanking the
retroviral insert in muscle, endothelium and neuroectodermal cells
in population A16 that mapped to chromosome 7 was identified.
TABLE-US-00002 TABLE 2 Single cell origin of endothelium, muscle
and neuroectodermal cells Sequence: 3'-LTR-ccaaatt Clone A16 TAG
CGGCCGCTTG AATTCGAACG (Chrom. 7) CGAGACTACT GTGACTCACA CT 5- TAG
CGGCCGCTTG AATTCGAACG Azacytidine CGAGACTACT GTGACTCACA CT VEGF TAG
CGGCCGCTTG AATTCGAACG CGAGACTACT GTGACTCACA CT bFGF TAG CGGCCGCTTG
AATTCGAACG CGAGACTACT GTGACTCACA CT Clone A12- ATTTATA TTCTAGTTTAT
A (Chrom. 9) TTGTGTTTGGG GCAGACGAGG 5- ATTTATA TTCTAGTTTAT
Azacytidine TTGTGTTTGGG GCAGACGAGG VEGF ATTTATA TTCTAGTTTAT
TTGTGTTTGGG GCAGACGAGG bFGF ATTTATA TTCTAGTTTAT TTGTGTTTGGG
GCAGACGAGG Clone A12- TCCTGTCTCA TTCAAGCCAC A (Chrom. 12)
ATCAGTTACA TCTGCATTTT 5- TCCTGTCTCA TTCAAGCCAC Azacytidine
ATCAGTTACA TCTGCATTTT VEGF TCCTGTCTCA TTCAAGCCAC ATCAGTTACA
TCTGCATTTT bFGF TCCTGTCTCA TTCAAGCCAC ATCAGTTACA TCTGCATTTT
[0131] Primers specific for the 3' LTR were designed and for the
flanking genomic sequence are shown in Table 3 and using Real-time
PCR, it was confirmed that the retroviral insert site was identical
in undifferentiated and differentiated cells. These results proved
that the flanking sequence and the eGFP DNA sequence was present in
similar quantities. Clone A12 contained two retroviral inserts,
located on chromosome 1 and 7 respectively, and both flanking
sequences could be detected not only in hMASC but also muscle,
endothelium and neuroectodermal lineages. To determine whether this
represented progeny of a single cell with two retroviral integrants
or progeny of two cells, Real-Time PCR was used to compare the
relative amount of the chromosome 1 and 7 flanking sequence to
eGFP. It was found that similar amounts of both flanking regions
were present in hMASC, muscle, endothelium and neuroectodermal
cells, suggesting that a single cell with two retroviral inserts
was likely responsible for the eGFP positive hMASC and
differentiated progeny. In the other populations containing 3 or
more retroviral inserts we were not able to determine whether the
inserts were due to multiple insertion sites in a single cells or
multiple cells contributing to the eGFP positive fraction.
Nevertheless, our finding that in 2 populations, progeny
differentiated into muscle, endothelium and neuroectoderm are
derived from a single BM derived progenitor cell definitively
proves for the first time that primitive cells can be cultured from
BM that differentiate at the single cell level in cells of
mesodermal lineage as well as the three different lineages of the
neuroectoderm.
TABLE-US-00003 TABLE 3 Flanking regions and primers Clone Genomic
sequence Rat flanking GATCCTTGGGAGGGTCTCCTCAGATTGATTGACT sequence
GCCCACCTCGGGGGTCTTTCAAAGTAACTCCAAA
AGAAGAATGGGTTGTTAGTTATTAAACGGTTCTT
AGTAAAGTTTTGGTITTGGGAATCACAGTAACAA CTCACATCACAACTCCAATCGTTCCGTGAAA
Mouse flanking GATCCTTGGGAGGGTCTCCTCAGATTGATTGACT sequence
GCCCATAAGTTATAAGCTGGCATGACTGTGTTGC TAAGGACACTGGTGAAAGC Bold: MSCV
LTR; Bold and underlined: MSCV LTR primer used for Q-PCR Italics
and underlined: Flanking sequence primers used for Q-PCR.
Example 6
Homing and Engraftment of Mammalian MASC into Numerous Organs in
the Body
[0132] mMASC were tested to determine whether they had the ability
to engraft and differentiate in vivo into tissue specific cells.
mMASC were grown as described in Example 1 from a LacZ transgenic
C57 Black 6, ROSA 26 mouse. 10.sup.6 mMASC from the LacZ mouse were
I.V. injected into NOD-SCID mice tail veins with or without 250
Rads of total body radiation 4-6 hrs prior to the injection. The
animals were sacrificed by cervical dislocation at 4-24 weeks after
the injections.
Tissue Harvest
[0133] Blood and bone marrow: 0.5-1 ml of blood was obtained at the
time animals were sacrificed. BM was collected by flushing femurs
and tibias. For phenotyping, red cells in blood and BM were
depleted using ice cold ammonium chloride (Stem Cell Technologies
Inc., Vancouver, Canada) and 10.sup.5 cells used for cytospin
centrifugation. For serial transplantation, 5.times.10.sup.7 cells
from 2 femurs and 2 tibias were transplanted into individual
secondary recipients via tail vein injection. Secondary recipients
were sacrificed after 7-10 weeks.
[0134] Solid organs: Lungs were inflated with 1 ml 1:4 dilution of
OCT compound (Sakura-Finetek Inc, USA) in PBS. Specimens of spleen,
liver, lung, intestine, skeletal muscle, myocardium, kidney and
brain of the recipient animals were harvested and cryopreserved in
OCT at -80.degree. C. and in RNA Later (Ambion Inc., Austin, Tex.,
USA) at -20.degree. C. for quantitative PCR.
mMASC Engraft and Differentiate in Tissue Specific Cells In
Vivo
[0135] Engraftment of the .beta.-gal/neomycin (NEO)
transgene-containing cells (Zambrowicz et al., 1997) was tested by
immunohistochemistry for .beta.-gal and by Q-PCR for NEO.
Immunohistochemistry and Q-PCR were performed as described in
Examples 5 and 1 respectively. Primers are listed in Table 1.
[0136] Engraftment, defined as detection of >1% anti-.beta.-gal
cells, was seen in hematopoietic tissues (blood, BM and spleen) as
well as epithelium of lung, liver, and intestine of all recipient
animals as shown in Table 4 and FIG. 4.
TABLE-US-00004 TABLE 4 Engraftment levels in NOD-SCID mice
transplanted with ROSA26 MASC. Engraftment levels (%) determined by
Time immunofluorescence or (Q-PCR) Animal (Weeks) Radiation Marrow
Blood Spleen Liver Lung Intestine 1 4 No 2 (1) 2 5 7 4 2 2 5 No 3
(4) 4 5 9 5 3 3 10 No 1 3 3 6 3 2 4 16 No 4 2 3 4 3 4 (4.9) 5 24 No
3 2 3 6 4 1 6 8 Yes 8 (8) 6 4 5 2 (1.1) 7 7 8 yes 10 8 7 (7.3) 4 6
8 8 8 Yes 5 8 3 5 5 6 9 8 Yes 7 5 5 6 4 6 10 10 Yes 5 (6) 7 9
(12.5) 5 2 8 11 11 Yes 8 8 6 5 3 10 (11.9) 12 11 Yes 6 5 4 8 (6.2)
10 (12.3) 8 SR-1 7 Yes 6 7 5 1 (1.7) 5 8 SR-2 10 Yes 5 4 8 3 4
6
[0137] .beta.-gal.sup.+ cells in BM (FIGS. 4B-F) and spleen (FIGS.
4H-I) co-labeled with anti-CD 45, anti-CD19, anti-Mac1, anti-Gr1
and anti-TER119Abs. Similar results were seen for peripheral blood.
Of note, no (3-gal.sup.+CD3.sup.+T cells were seen in either blood,
BM or spleen even though .beta.-gal.sup.+CD3.sup.+T-cells were seen
in chimeric mice. The reason for this is currently not known.
[0138] Engraftment in the spleen occurred mostly as clusters of
donor cells, consistent with the hypothesis that when MASC home to
the spleen, they proliferate locally and differentiate to form a
colony of donor cells, similar to CFU-S. It is not believed that
differentiation of mMASC into hematopoietic cells in vivo can by
attributed to contamination of the mMASC with HSC. First, BMMNC are
depleted of CD45 cells by column selection before mMASC cultures
are initiated. Second, early mesodermal or hematopoietic
transcription factors, including brachyury (Robertson et al.,
2000), GATA-2 and GATA-1 (Weiss et al., 1995), are not expressed in
undifferentiated mMASC, as shown by cDNA array analysis. Third, the
culture conditions used for mMASC are not supportive for HCS.
Fourth all attempts at inducing hematopoietic differentiation from
hMASC in vitro, by co-culturing hMASC with hematopoietic supportive
feeders and cytokines, have been unsuccessful (Reyes et al.,
2001).
[0139] Significant levels of mMASC engraftment were also seen in
liver, intestine and lung. Triple-color immunohistochemistry was
used to identify epithelial (CK.sup.+) and hematopoietic
(CD45.sup.+) cells in the same tissue sections of the liver,
intestine and lung. In the liver, .beta.-gal.sup.+ donor-derived
cells formed cords of hepatocytes (CK18.sup.+CD45.sup.+ or
albumin), occupying about 5-10% of a given 5 .mu.m section (FIG.
4K-M). Several CK18.sup.+CD45.sup.+.beta.-gal.sup.+ hematopoietic
cells of recipient origin were distinctly identified from the
epithelial cells. Albumin.sup.+.beta.-gal.sup.+ and
CK18.sup.+.beta.-gal.sup.+ cells engrafted in cords of hepatocytes
surrounding portal tracts, a pattern seen in hepatic regeneration
from hepatic stem cells and oval cells (Alison et al., 1998;
Petersen et al., 1999). This and the fact that only 5/20 sections
contained donor cells, is consistent with the notion that stem
cells engraft in some but not all areas of the liver, where they
proliferate and differentiate into hepatocytes.
[0140] Engraftment in the intestine was also consistent with what
is known about intestinal epithelial stem cells. In the gut, each
crypt contains a population of 4-5 long-lived stem cells (Potten,
1998). Progeny of these stem cells undergo several rounds of
division in the middle and upper portions of cypts and give rise to
epithelial cells that migrate upwards, out of the crypt, onto
adjacent villi. Donor derived,
.beta.-gal.sup.+panCK.sup.+CD45.sup.- epithelial cells entirely
covered several villi (FIGS. 4O-P). In some villi,
.beta.-gal.sup.+panCK.sup.+CD45.sup.- cells constituted only 50% of
the circumference (solid arrows, FIG. 4P) suggesting engraftment in
one but not both crypts. Several .beta.-gal.sup.+panCK.sup.- cells
were distinctly seen in the core of intestinal villi (open arrow,
FIG. 4O). These cells co-stained for CD45 (FIG. 4P), indicating
that they were donor-derived hematopoietic cells. In the lung, the
majority of donor cells gave rise to
.beta.-gal.sup.+panCK.sup.+CD45.sup.- alveolar epithelial cells
whereas, most hematopoietic cells were of recipient-origin
(panCK.sup.-CD45.sup.+.beta.-gal.sup.-) (FIG. 4R).
[0141] Levels of engraftment detected by immunohistochemistry were
concordant with levels determined by Q-PCR for NEO (Table 4).
Engraftment levels were similar in animals analyzed after 4 to 24
weeks following I.V. injection of MASC (Table 4).
[0142] No contribution was seen to skeletal or cardiac muscle. In
contrast to epithelial tissues and the hematopoietic system, little
to no cell turnover is seen in skeletal or cardiac muscle in the
absence of tissue injury. Therefore, one may not expect significant
contribution of stem cells to these tissues. However, engraftment
was not found in skin and kidney, two organs in which epithelial
cells undergo rapid turnover. It is shown in the blastocyst
injection experiments (Example 8) that mMASC can differentiate into
these cell types; one possible explanation for the lack of
engraftment in these organs in post-natal recipients is that mMASC
do not home to these organs, a hypothesis that is currently being
evaluated. Although mMASC differentiated into neuroectoderm-like
cells ex vivo, no significant engraftment of mMASC was seen in the
brain, and rare donor cells found in the brain did not co-label
with neuroectodermal markers. Two recent publications demonstrated
that donor derived cells with neuroectodermal characteristics can
be detected in the brain of animals that underwent BM
transplantation. However, a fully ablative preparative regimen
prior to transplantation or transplantation in newborn animals was
used, conditions associated with break-down of the blood-brain
barrier. Cells were infused in non-irradiated adult animals, or
animals treated with low dose radiation, where the blood-brain
barrier is intact or only minimally damaged. This may explain the
lack of mMASC engraftment in the CNS.
Confluent MASCdo not Differentiate In Vivo
[0143] As control, ROSA26-MASC were infused and grown to confluence
prior injection. MASC allowed to become confluent lose their
ability to differentiate ex vivo in cells outside of the mesoderm,
and behave like classical MSC (Reyes, M. et al. 2001). Infusion of
10.sup.6 confluent mMASC did not yield significant levels of donor
cell engraftment. Although few .beta.-gal.sup.+ cells were seen in
BM, these cells did not co-label with anti-CD45 Abs, indicating
that MSC may engraft in tissues, but are no longer able to
differentiate into tissue specific cells in response to local
cues.
MASC Derived Cells in Bone Marrow of Mice can be Serially
Transferred
[0144] BM from mouse engrafted with ROSA26 MASC was tested to
determine whether they contained cells that would engraft in
secondary recipients. 1.5.times.10.sup.7 BM cells, recovered from
primary recipients 11 weeks after I.V. infusion of mMASC, were
transferred to secondary irradiated NOD-SCID recipients (Table 4:
animal SR-1 and SR-2). After 7 and 10 weeks, secondary recipients
were sacrificed, and blood, BM, spleen, liver, lung and intestines
of the recipient animal were analyzed for engraftment of ROSA26
donor cells by immunohistochemistry and Q-PCR for the NEO gene. A
similar pattern of engraftment was seen in secondary recipients as
in the primary recipients. Four-8% of BM, spleen and PB cells were
.beta.-gal.sup.+CD45.sup.+; six and 8% of intestinal epithelial
cells were .beta.-gal.sup.+pan-CK.sup.+, and 4 and 5% of lung
epithelial cells were .beta.-gal.sup.+pan-CK.sup.+. Levels of
engraftment in the liver of secondary recipients were lower than in
the primary recipients (1 and 3% vs. 5 and 8%
.beta.-galCK18.sup.+). This suggests that mMASC may persist in the
BM of the primary recipient and differentiate into hematopoietic
cells as well as epithelial cells when transferred to a second
recipient.
[0145] MASC derived cells can produce insulin in vivo. MASC from
ROSA26 mice were injected into irradiated NOD-SCID mice as
described herein. The resulting MASC derived cells co-stain for
LacZ and insulin in a model of streptozotocin-induced diabetes.
Summary
[0146] One of the critical questions in "stem cell plasticity" is
whether the engrafted and differentiated donor mMASC are
functional. The results described herein show that one animal
developed a lymphoma in thymus and spleen after 16 weeks, as is
commonly see in aging NOD-SCID mice (Prochazka et al., 1992).
Phenotypic analysis showed that this B-cell lymphoma was
host-derived: CD 19.sup.+ cells were .beta.-gal. Approximately 40%
of CD45.sup.-vWF.sup.+ cells in the vasculasture of the tumor
stained with anti-.beta.-gal Abs, indicating that neoangiogenesis
in the tumor was in part derived from donor mMASC (FIG. 4T). This
suggests that MASC give rise to functioning progeny in vivo.
Likewise, higher levels of mMASC engraftment and differentiation in
radiosensitive organs, such as the hematopoietic system and
intestinal epithelium (Table 4, p<0.001), following low dose
irradiation suggests that mMASC may contribute functionally to host
tissues.
[0147] These results showed that mammalian MASC can be purified,
expanded ex vivo, and infused I.V., homed to various sites in the
body, engraft into numerous organs, and that the cells are alive in
these various organs one month or longer. Such donor cells,
undifferentiated, and differentiated progeny are found, by virtue
of the fluorescent marker, in organs including, but not limited to,
the BM, spleen, liver and lung. These cells can be used to
repopulate one or more compartment(s) to augment or restore cell or
organ function.
Example 7
Demonstration of In Vitro Hematopoiesis and Erythropoiesis
[0148] MASC from, human BM differentiate at the single cell level
into neuroectodermal, endodermal and many mesodermal lineages,
including endothelial cells. Because endothelium and blood are very
closely related in ontogeny, it can be hypothesized that MASC can
differentiate into hematopoietic cells. eGFP transduced human MASC,
that are GlyA, CD45 and CD34 negative (n=20), were cocultured with
the mouse yolk sac mesodermal cell line, YSM5, as suspension cell
aggregates for 6 days in serum free medium supplemented with 10
ng/mL bFGF and VEGF. After six days, only eGFP.sup.+ cells (i.e.,
MASC progeny) remained and YSM5 cells had died.
[0149] Remaining cells were transferred to methylcellulose cultures
containing 10% fetal calf serum supplemented with 10 ng/mL bone
morphogenic protein (BMP)4, VEGF, bFGF, stem cell factor (SCF),
Flt3L, hyper IL6, thrombopoietin (TPO), and erythropoietin (EPO)
for 2 weeks. In these cultures, both adherent eGFP.sup.+ cells and
small, round non-adherent cells, which formed many colonies
attached to the adherent cells were detected. The non-adherent and
adherent fractions were collected separately and cultured in 10%
FCS containing medium with 10 ng/mL VEGF and bFGF for 7 days.
Adherent cells stained positive for vWF, formed vascular tubes when
plated on ECM, and were able to uptake a-LDL, indicating their
endothelial nature. 5-50% of the non-adherent cells stained
positive for human specific GlyA and HLA-class I by flow cytometry.
Gly-A.sup.+/HLA-class-I.sup.+ cells were selected by FACS. On
Wright-Giemsa, these cells exhibited the characteristic morphology
and staining pattern of primitive erythroblasts. Cells were
benzidine.sup.+ and human Hb.sup.+ by immunoperoxidase. By RT-PCR
these cells expressed human specific Hb-e, but not Hb-a.
[0150] When replated in methylcellulose assay with 20% FCS and EPO,
small erythroid colonies were seen after 10 days, and 100% of these
colonies stained positive for human specific GlyA and Hb. As
selection of MASC depends on the depletion of CD45.sup.+ and Gly
A.sup.+ cells from BM, and cultured MASC are CD45.sup.- and
GlyA.sup.- at all times examined using both FACS and cDNA array
analysis, contamination of MASC with hematopoietic cells is very
unlikely.
Example 8
In Vivo Proof of the Multipotent Nature of MASC as Shown by
Multiple Organ Chimerism following Blastocyst Injections of the
Cells
[0151] Important for therapeutic applications of these cells is the
ability of MASC to proliferate and differentiate into the
appropriate cell types in vivo. Up until this point the only cells
that should be capable of contributing to the full constellation of
tissues and organs in the body are ES cells. In order to analyze
whether MASC could show the full capability of ES cells, they were
assayed to determine their contribution to the formation of various
tissues by introducing them into the early blastocyst and observing
the fate of their progeny.
[0152] MASC were generated from marrow of ROSA26 mice that are
transgenic for the .beta.-galactosidase (.beta.-gal) gene (Rafii,
S., et al. 1994, Blood. 84:10-13) and expanded as described in
Example 1. One or 10-12 ROSA26 MASC obtained after 55-65 PDs were
microinjected into 88 and 40 3.5-day C57BL/6 blastocysts,
respectively. Blastocysts (8/mother) were transferred to 16 foster
mothers and mice allowed to develop and be born as shown in Table
5.
TABLE-US-00005 TABLE 5 Degree of chimerism following MASC injection
in blastocyst MASC/ Lit- Total # blasto- ters pups NEO positive by
Q-PCR cyst born born 0% 1-10% 10-20% 20-40% >40% 10-12 4/11 22
5/22 13/22 2/22 1/22 1/22 (23%) (59%) (9%) (4.5%) (4.5%) 1 3/5 15
8/15 5/15 0/15 0/15 2/15 (53%) (33%) (0%) (0%) (13%)
[0153] Seven litters were born, in line with the birth rate seen in
other studies during this period. The number of mice per litter
varied between 1 and 8, for a total of 37 mice. Animals born from
microinjected blastocysts were of similar size as normal animals
and did not display any overt abnormalities.
[0154] After four weeks, animals were evaluated for chimerism by
clipping their tails and assessing the contribution of 11-gal/NEO
transgene containing cells to the tails by Q-PCR for NEO. Percent
chimerism was determined by comparing the number of NEO copies in
test samples with that in tissue from ROSA26 mice according to
manufacturer's recommendations (7700 ABI PRISM Detector Software
1.6). Chimerism could be detected in 70% of mice derived from
blastocysts in which 10 to 12 MASC had been injected and 50% of
mice derived from blastocysts microinjected with 1 MASC (Table 5).
The degree of chimerism ranged between 0.1% to >45%. After 6 to
20 weeks, animals were sacrificed. Some mice were frozen in liquid
nitrogen and thin sections were cut as described. Whole-mouse
sections were stained with X-Gal. One thousand sets of digital
images covering completely each section were then assembled to
create a composite image of each whole-mouse section. In a
representative non-chimeric animal (by Q-PCR for NEO) derived from
a blastocyst in which a single MASC was injected, no X-Gal staining
was seen. In contrast, the animal was 45% chimeric by R-PCR for NEO
by tail clip analysis and had contribution of a single
ROSA26-derived MASC to all somatic tissues.
[0155] For other animals, multiple organs were harvested and
analyzed for the presence of MASC derived cells by X-GAL staining,
staining with an anti-.beta.-gal-FITC antibody, and Q-PCR for NEO.
Animals that had NEO.sup.+ cells in tail-clippings had contribution
of the ROSA26-derived MASC in all tissues, including the brain,
retina, lung, cardiac and skeletal muscle, liver, intestine,
kidney, spleen, BM, blood, and skin as shown by X-GAL staining and
staining with an anti-.beta.-gal-FITC antibody.
[0156] Chimerism was detected by X-Gal staining and anti-.beta.-gal
staining in the animals generated from blastocysts microinjected
with ROSA26 MASC. .beta.-gal.sup.+ cells expressed markers typical
for the tissue in which they had incorporated. .beta.-gal.sup.+
cells co-stained with anti-.beta.-gal.sup.+ FITC and anti-NF200 or
GFAP and TOPRO3 (observed at 20.times. magnification) for NF200 and
GFAP in the central nervous system and for dystrophin in the
skeletal muscle. Lung tissue was stained for anti-.beta.-gal-FITC
and pan-CK in alveoli and bronchi (also TOPRO3) (observed at
20.times. magnification). Skeletal muscle was stained with
anti-.beta.-gal-FITC, dystrophin-PE, and TOPRO3 was observed at
20.times. magnification. Heart was stained with
anti-.beta.-gal-FITC and cardiac troponin-I-Cy3, TOPRO3 was
observed at 20.times. magnification. Liver was stained with
anti-.beta.-gal-FITC and pan-CK-PE and TOPRO3 (was observed with
40.times. magnification and 10.times. magnification). Intestine was
stained with anti-.beta.-gal-FITC, pan-CK-PE, and TOPRO3 was
observed at 20.times. magnification. Kidney was stained with
anti-.beta.-gal-FITC (glomerulus, tubulus) was observed at
20.times. magnification. Marrow staining was observed with
anti-.beta.-gal-FITC and CD45-PE, GR1-PE and MAC1-PE. Spleen
staining was observed with anti-.beta.-gal-FITC and CD45-PE, CD3-PE
and CD 19-PE. Levels of engraftment estimated by Q-PCR for NEO were
concordant with those estimated by X-GAL and anti-.beta.-gal-FITC
staining.
Summary
[0157] These data demonstrate for the first time that BM derived
single MASC integrate into the developing mouse, giving rise to
cells of various fates, and contributing to the generation of all
tissues and organs of the three germ layers of the mouse. As all
live animals, irrespective of the degree of chimerism, had normal
functioning organs, these studies also suggest that MASC can
differentiate in vivo in functional cells of the three germ layers.
Whether MASC contribute to germ cells, when injected in a
blastocyst or when injected postnatally, has not yet been
tested.
Example 9
Origin of Endothelial Progenitors
[0158] Vasculogenesis, the in situ differentiation of primitive
endothelial progenitors, termed angioblasts, into endothelial cells
that aggregate into a primary capillary plexus is responsible for
the development of the vascular system during embryogenesis
(Hirashima et al., 1999). In contrast, angiogenesis, defined as the
formation of new blood vessels by a process of sprouting from
preexisting vessels, occurs both during development and in
postnatal life (Holash et al., 1999; Yang et al., 2001). Until
recently, it was thought that blood vessel formation in post-natal
life was mediated by sprouting of endothelial cells from existing
vessels. However, recent studies have suggested that endothelial
"stem cells" may persist into adult life, where they contribute to
the formation of new blood vessels (Peichev et al., 2000; Lin et
al., 2000; Gehling et al., 2000; Asahara et al., 1997; Shi et al.,
1998), suggesting that like during development neoangiogenesis in
the adult may at least in part depend on a process of
vasculogenesis. Precursors for endothelial cells have been isolated
from BM and peripheral blood (Peichev et al., 2000; Watt et al.,
1995). The ontogeny of these endothelial progenitors is
unknown.
[0159] During development, endothelial cells are derived from
mesoderm. The VEGF receptor 2, Flk1, characterizes the
hemangioblasts, a bipotent stem cell found in the
aorto-gonad-mesonephros region (Medvinsky et al., 1996; Fong et
al., 1999; Peault, 1996) and in fetal liver (Fong et al., 1999),
and commitment of embryoid bodies to hemangioblasts is accompanied
with expression of Flk1 (Choi et al., 1998; Choi, 1998). Whether
hemangioblasts persist in adult life is not known, and only HSC and
endothelial progenitors have been documented. Like hemangioblasts,
endothelial progenitors express Flk1 (Peichev et al., 2000) and one
report suggested that HSC in post-natal life express Flk1 (Ziegler
et al., 1999). During embryology, commitment of the hemangioblast
to the endothelial lineage is characterized by the sequential
expression of VE-cadherin, CD31, and shortly afterwards CD34
(Nishikawa et al., 1998; Yamashita et al., 2000). In post-natal
life, endothelial progenitors have been selected from BM and blood
using Abs against AC133, Flk1, CD34, and the H1P12 Ab (Peichev et
al., 2000; Lin et al., 2000; Gehling et al., 2000). AC133 has also
been found on other cells, including NSCs (Uchida et al., 2000) and
gastrointestinal epithelial cells (Corbeil et al., 2000). Upon
differentiation to mature endothelium, the AC133 receptor is
quickly lost (Peichev et al., 2000; Gehling et al., 2000). Another
receptor found on circulating endothelial cells is a mucin, MUC18,
recognized by the H1P12 Ab (Lin et al., 2000). MUC18 is lost upon
differentiation of endothelial progenitors to endothelium. CD34 is
expressed on endothelial progenitors, as well as on hematopoietic
progenitors (Peichev et al., 2000; Baumhueter et al., 1994) and
hepatic oval cells (Crosby et al., 2001). This antigen is also lost
upon differentiation of endothelial progenitors to endothelium.
Most mature endothelial cells, but microvascular endothelial cells,
no longer express CD34.
[0160] It is described here for the first time, the in vitro
generation of vast numbers of endothelial cells that engraft in
vivo and contribute to neoangiogenesis from a MASC. MASC can be
culture expanded for >80 PDs and endothelial cells generated
from MASC can be expanded for at least and additional 20 PDs. MASC
may therefore be an ideal source of endothelial cells for clinical
therapies. In addition, as MASC are ontogenically less mature than
the "angioblast", this model should be useful to characterize
endothelial commitment and differentiation.
hMASC Differentiate into Cells with Phenotypic Characteristics of
Endothelium
[0161] MASC were obtained and cultured as described in Example 3.
To induce endothelial differentiation, MASC were replated at
2.times.10.sup.4 cells/cm.sup.2 in FN-coated wells in serum-free
expansion medium without EGF and PDGF-BB but with 10 ng/mL VEGF. In
some instances, FCS was added. Cultures were maintained by media
exchange every 4-5 days. In some instances, cells were subcultured
after day 9 at a 1:4 dilution under the same culture conditions for
20+PDs.
[0162] In order to define endothelial differentiation from MASC
more extensively, FACS and immunohistochemical analysis of cells
after 3-18 days was performed. Expression of Flk1 and FM on
undifferentiated MASC was low, was maximal at day 9, and persisted
until day 18. VE-cadherin, present on BM or blood endothelial
progenitors (Peichev et al., 2000; Nishikawa et al., 1998), was not
expressed on undifferentiated MASC, but was expressed after 3 days
of culture with VEGF and persisted until day 18. MASC expressed low
levels of AC133, found on endothelial as well as hematopoietic
progenitors (Peichev et al., 2000; Gehling et al., 2000) but was no
longer detectable after day 3. CD34, present on endothelial and
hematopoietic progenitors (Peichev et al., 2000; Asahara et al.,
1997; Rafii et al., 1994), was not present on undifferentiated MASC
(FIG. 4A) but was expressed from day 9 until day 18. The mucin,
MUC18, recognized by the Ab H1P12 has been used to purify
endothelial progenitors from blood (Lin et al., 2000). Although
MASC did not stain with H1P12 MASC treated with VEGF for 9 days
stained positive, but expression was lost by day 18.
[0163] The endothelium specific integrin, .alpha.v.beta.3,
(Eliceiri et al., 2000) was not present on undifferentiated MASC,
whereas .alpha.v.beta.5 was expressed at very low levels.
Expression of integrins increased progressively during
differentiation and was maximal by day 14 (FIG. 5). The tyrosine
kinase receptors, Tie and Tek, important for angiogenesis but not
endothelial cell differentiation (Partanen et al., 1999), were not
expressed on MASC. Expression of Tek could be seen after day 3 and
Tie after day 7 (FIG. 6). MASC also do not express vWF, but vWF was
expressed from day 9 on (Rosenberg et al., 1998; Wagner et al.,
1982). More mature endothelial markers, including CD31, CD36,
CD62-P (Tedder et al., 1995) (FIG. 7), and the adhesion junction
proteins ZO-1, .beta.-catenin, and .gamma.-catenin (FIG. 5) were
detected after day 14 (Li et al., 1990; Van Rijen et al., 1997;
Petzelbauer et al., 2000). VCAM or CD62-E were not expressed at
high level at any time point during differentiation, unless
endothelium was activated with IL-1.alpha., as described below.
Differentiation to endothelium was associated with acquisition of
.beta.2-microglobulin and low levels of HLA-class I antigens, but
not HLA-class II.
[0164] It has been reported previously, that endothelial
differentiation can only be obtained from MASC expanded with 2% FCS
or less, but not when expanded with 10% FCS (Reyes et al., 2001) as
higher concentrations of FCS supports growth of classical MSC that
differentiate only into osteoblasts, chondroblasts and adipocytes
(Reyes et al., 2001; Pittenger et al., 1999). When FCS was present
during the initial 7 days of differentiation, endothelial
differentiation could not be induced. When non-confluent MASC
(>1.times.10.sup.4 cells/cm.sup.2) were induced to
differentiate, endothelial was not seen. When MASC were subcultured
9-days after exposure to VEGF using serum free medium with 10 ng/mL
VEGF, cells could undergo at least an additional 12 PDs. When 10%
FCS and 10 ng/mL VEGF was added to the medium for subculturing,
MASC-derived endothelial cells could undergo an additional 20+PDs,
irrespective of the number of PDs that MASC had undergone.
[0165] Compared with undifferentiated MASC, endothelial cells were
larger, and had a lower nuclear/cytoplasm ratio. Results were
similar when MASC were used from cultures that had undergone 20
(n=30) or 50+(n=25) PDs.
Functional Characteristics of MASC-derived Endothelium
[0166] It was tested whether VEGF-induced differentiated progeny of
hMASC had functional characteristics of endothelial cells.
Endothelial cells respond to hypoxia by upregulating expression of
VEGF as well as the VEGF receptors Flk1 and the angiogenesis
receptors, Tie-1 and Tek (Kourembanas et al., 1998). hMASC and
hMASC-derived endothelial cells were incubated at 37.degree. C. in
20% or 10% O.sub.2 for 24 h. Cells were stained with Abs against
Flk1, Flt1, Tek and IgG control, fixed in 2% paraformaldehyde and
analyzed by flow cytometry. In addition, VEGF concentrations in the
culture supernatants was measured using an ELISA kit (AP biotech,
Piscataway, N.J.). MASC-derived endothelial cells and
undifferentiated MASC were exposed to hypoxic conditions for 24
h.
[0167] Expression of Flk1 and Tek was significantly increased on
MASC-derived endothelial cells exposed to hypoxia (FIG. 7), while
the levels of these receptors remained unchanged on
undifferentiated MASC. In addition, levels of VEGF in culture
supernatants of hypoxic endothelial cultures was increased by 4
fold (FIG. 7B) whereas VEGF levels in MASC cultures exposed to
hypoxia remained unchanged.
[0168] It was next tested whether MASC-derived endothelial cells
would upregulate expression of HLA-antigens and cell adhesion
ligands in response to inflammatory cytokines, such as IL-1a
(Meager, 1999; Steeber et al., 2001). 10.sup.6 MASC and
MASC-derived endothelial cells were incubated with 75 ng/ml
IL-1.alpha. (R&D Systems) in serum-free medium for 24 h. Cells
were fixed in 2% paraformaldehyde and stained with Abs against
HLA-class I, class II, .beta.2-microglobulin, vWF, CD31, VCAM,
CD62E and CD62P, or control Abs, and analyzed using a FACScalibur
(Becton Dickinson).
[0169] Significantly increased levels of HLA-Class I and II,
132-microglobulin, VCAM, ECAM, CD62E, CD62P were seen by FACS
analysis (FIG. 7C) on endothelial cells. In contrast, on
undifferentiated MASC only upregulation of Flk was seen.
[0170] Another characteristic of endothelial cells is that they
take up LDL (Steinberg et al., 1985). This was tested by incubating
MASC induced to differentiate with VEGF for 2, 3, 5, 7, 9, 12 and
15 and 21 with LDL-dil-acil. The dil-Ac-LDL staining kit was
purchased from Biomedical Technologies (Stoughton, Mass.). The
assay was performed as per manufacture's recommendations. Cells
were co-labeled either with anti-Tek, -Tie-1 or -vWF Abs. After 3
days, expression of Tek was detected but no uptake of a-LDL. After
7 days, cells expressed Tie-1, but did not take up significant
amounts of a-LDL. However, acquisition of expression of vWF on day
9 was associated with uptake of aLDL (FIG. 6B).
[0171] Endothelial cells contain vWF stored in Weibel Pallade
bodies that is released in vivo when endothelium is activated
(Wagner et al., 1982). This can be induced in vitro by stimulating
cells with histamine (Rosenberg et al., 1998), which also results
in activation of the cell cytoskeleton (Vischer et al., 2000).
MASC-derived endothelial cells were plated at high confluency
(10.sup.4 cells/cm.sup.2) in FN-coated chamber slides. After 24 h,
cells were treated with 10 .mu.M histamine (Sigma) in serum free
medium for 25 min. and stained with Abs against vWF and myosin.
Untreated and treated cells were fixed with methanol at -20.degree.
C. for 2 min, stained with Abs against vWF and myosin, and analyzed
using fluorescence and/or confocal microscopy. vWF was present
throughout the cytoplasm of untreated endothelial cells. Cytoplasm
of endothelial cells treated with histamine contained significantly
less vWF and vWF was only detectable in the perinuclear region,
likely representing vWF present in the endoplasmic reticulum (FIG.
6A). Histamine treatment caused widening of gap junctions and
cytoskeletal changes with increased numbers of myosin stress fibers
(FIG. 6A).
[0172] Finally, endothelial cells were tested to determine if they
could form "vascular tubes" when plated on Matrigel.TM. or
extracellular matrix (ECM) (Haralabopoulos et al., 1997). 0.5 ml
extracellular matrix (Sigma) was added per well of a 24 well plate,
incubated for 3 h at 37.degree. C. 10.sup.4 MASC and MASC-derived
endothelial cells were added per well in 0.5 ml of serum free plus
VEGF medium and incubated at 37.degree. C. As shown in FIG. 6C,
culture of MASC derived endothelial cells on ECM resulted in
vascular tube formation within 6 hours.
hMASC-derived Endothelial Cells Contribute to Tumor-angiogenesis In
Vivo
[0173] A breeding colony of NOD-SCID mice was established from mice
obtained from the Jackson Laboratories (Bar Harbor, Me.). Mice were
kept in specific pathogen free conditions and maintained on
acidified water and autoclaved food. Trimethoprim 60 mg and
sulphamethoxazole 300 mg (Hoffmann-La Roche Inc., Nutley, N.J.) per
100 ml water was given twice weekly.
[0174] Three Lewis lung carcinoma spheroids were implanted
subcutaneously in the shoulder. 3 and 5 days after implantation of
the tumor, mice were injected with 0.25.times.10.sup.6 human
MASC-derived endothelial cells or human foreskin fibroblasts via
tail vein injection. After 14 days, animals were sacrificed, tumors
removed and cryopreserved using OTC compound (Santura Finetek USA
Inc, Torrance, Calif.) at -80.degree. C. In addition, the ears that
were clipped to tag the mouse were also removed and cryopreserved
using OTC compound at -80.degree. C. Five .mu.m thick sections of
the tissues were mounted on glass slides and were fixed and stained
as described below.
[0175] Computer-aided analysis of length and number of branches
counted on five sections of each tumor showed that tumors in mice
that received human MASC-derived endothelial cells had a
1.45.+-.0.04 fold greater vascular mass than tumors in control mice
that did with anti-human-.beta.2-microglobulin or HLA-Class I Abs,
combined with anti-mouse-anti-CD31 Abs and anti-vWF, anti-Tek or
anti-Tie-1 Abs, which recognize both human and mouse endothelial
cells. These initial studies showed that some blood vessels in the
tumor contained anti-human-.beta.2-microglobulin or HLA-Class I
positive cells that co-labeled for either vWF, Tie or Tek, but not
with mouse-CD31, indicating that human MASC-derived endothelial
cells contributed to tumor neoangiogenesis in vivo.
[0176] To better address the degree of contribution, 35 sequential
5 .mu.m slides were obtained and were stained in an alternate
fashion with either anti-human 132-microglobulin-FITC or
anti-mouse-CD31-Cy5 and anti-vWF-Cy3. All slides were examined by
confocal microscopy. The different figures were then assembled in
3-D to determine the relative contribution of human and murine
endothelial cells to the tumor vessels. When tumors obtained from
animals injected with human-MASC derived endothelial cells were
analyzed approximately 35% of the tumor vessels were positive for
anti-human .beta.2-microglobulin as well as vWF whereas
approximately 40% of endothelial cells stained positive with
anti-mouse CD31 Abs (FIGS. 8A-G). Tumors in animals that did not
receive endothelial cells or received human fibroblasts did not
contain endothelial cells that stained positive with the
anti-.beta.2-microglobulin or anti-HLA-class-I Abs Abs.
[0177] MASC-derived endothelial cells were also analyzed whether
they contribute to wound healing angiogenesis. The area of the ear
that had been clipped to tag the mouse was then examined.
Neoangiogenesis in the ear wounds was in part derived from the MASC
derived endothelial cells. Similar to blood vessels in the tumor
the percent human endothelial cells present in the healed skin
wound was 30-45% (FIG. 9H).
Undifferentiated hMASC Differentiate in Endothelial Cells In
Vivo
[0178] 10.sup.6 undifferentiated MASC were injected I.V. in 6-week
old NOD-SCID mice. Animals were maintained for 12 weeks and then
sacrificed. In one animal, a thymic tumor was detected, which is
commonly seen in aging NOD-SCID mice (Prochazka et al., 1992). The
thymus was removed and cryopreserved in OTC compound at -80.degree.
C. Ten .mu.m thick sections of the tissues were mounted on glass
slides and were fixed and stained as described below.
[0179] All hematopoietic cells stained positive for mouse CD45 but
not human CD45, indicating that they were murine in origin. The
tumor was then stained with an anti-human
.beta.2-microglobulin-FITC Ab and an anti-vWF-Cy3 Ab that
recognizes both human and mouse endothelial cells. Approximately
12% of the vasculature was derived from hMASC (FIG. 9I). These
studies further confirmed that the hematopoietic elements were not
of human origin, as no human .beta.2-microglobulin was detected
outside of the vascular structures.
Immunohistochemistry and Data Analysis
[0180] In vitro cultures: Undifferentiated MASC or MASC induced to
differentiate to endothelium for 2-18 days, plated in FN coated
chamber slides were fixed with 2% paraformaldehyde (Sigma) for 4
min at room temperature. For cytoskeleton staining chamber slides
were fixed with methanol for 2 min at -20.degree. C. For
intracellular ligands, cells were permeabilized with 0.1 Triton-X
(Sigma) for 10 min and incubated sequentially for 30 h in each with
primary antibody (Ab), and FITC, PE or Cy5 coupled anti-mouse-,
goat- or rabbit-IgG Ab. Between each step, slides were washed with
PBS+1% BSA. Primary Abs against CD31, CD34, CD36, CD44, HLA-class I
and -II, .beta.2-microglobulin were used at a 1:50 dilution.
Primary Abs against VCAM, ICAM, VE-cadherin, selectins, HIP12,
ZO-1, connexin-40, connexin-43, MUC18, a.sub.vb.sub.3,
a.sub.vb.sub.5, B-catenin and .gamma.-catenin (Chemicon) and Tek,
Tie, vWF (Santa Cruz) were used at a 1:50 dilution. Stress fibers
were stained with Abs against myosin (light chain 20 kD, clone no.
MY-21; 1:200). Secondary Abs were purchased from Sigma and used at
the following dilutions: anti-goat IgG-Cy-3 (1:40), anti-goat
IgG-FITC (1:160), anti-mouse IgG-Cy-3 (1:150) and anti-mouse
IgG-FITC (1:320), anti-rabbit-FITC (1:160) and anti-rabbit-Cy-3
(1:30). TOPRO-3 was purchased from Sigma. Cells were examined by
fluorescence microscopy using a Zeiss Axiovert scope (Carl Zeiss,
Inc., Thomwood, N.Y.) as well as by confocal fluorescence
microscopy using a Confocal 1024 microscope (Olympus AX70, Olympus
Optical Co. LTD, Japan).
[0181] Tumors or normal tissue: The tissue was sliced using a
cryostat in 5-10 .mu.m thick slices. Slices were fixed with acetone
for 10 min at room temperature and permeabilized with 0.1 Triton X
for 5 min. Slides were incubated overnight for vWF, Tie or Tek,
followed by secondary incubation with FITC, PE or Cy5 coupled
anti-mouse-, goat- or rabbit-IgG Abs and sequential incubation with
Abs against mouse CD45-PE or human CD45-FITC, human
.beta.2-microglobulin-FITC, mouse CD31-FITC or TOPRO-3 for 60 min.
Between each step, slides were washed with PBS+1% BSA. Slides were
examined by fluorescence microscopy using a Zeiss Axiovert scope as
well as by confocal fluorescence microscopy using a Confocal 1024
microscope. 3D-reconstruction consisted of the collection of
sequential 0.5 .mu.m confocal photos from 35 slides of 5 .mu.m
thick to a total of 350 photos. Slides were stained with vWF-Cy3
and alternately double stained with human.beta.2-microglobulin-FITC
or mouse CD31-FITC. The photos from each slide were aligned with
the next slide in Metamorph software (Universal Imaging Corp) and
the 3D reconstruction was made in 3D Doctor Software (Able software
Corp).
[0182] Volume of relative contribution of human (green) and murine
endothelial cells (false colored as blue) to the 3D vessel was
calculated as cubic pixels of each color. The area of each color
was also calculated as square pixels in 4 vessels through the 35
slides to obtain an accurate percentage of contribution. The area
of each color was also calculated in alternate slides of four
different tumors.
Summary
[0183] The central finding of this study is that cells that
co-purify with MSC from BM have the ability to differentiate to
endothelial cells that have in vitro functional characteristics
indistinguishable from mature endothelial cells. It is also showy
that such endothelial cells contribute to neoangiogenesis in vivo
in the setting of wound healing and tumorigenesis, and that
undifferentiated MASC can respond to local cues in vivo to
differentiate into endothelial cells contributing to tumor
angiogenesis. As the same cell that differentiates to endothelium
also differentiates to other mesodermal cell types, as well as
cells of non-mesodermal origin, the cell defined here precedes the
angioblast, and even the hemangioblast in ontogeny.
[0184] It has also been shown that MASC differentiate into cells
that express markers of endothelial cells, but proved that VEGF
induced MASC function like endothelial cells. Endothelial cells
modify lipoproteins during transport in the artery wall (Adams et
al., 2000). Endothelial cells maintain a permeability barrier
through intercellular junctions that widen when exposed to
hemodynamic forces or vasoactive agents, such as histamine
(Rosenberg et al., 1998; Li et al., 1990; Van Rijen et al., 1997;
Vischer et al., 2000). Endothelial cells release prothrombotic
molecules such as vWF, tissue factor, and plasminogen activator
inhibitor to prevent bleeding (Vischer et al., 2000), and regulate
egress of leukocytes by changing expression levels of adhesion
molecules in response to inflammation (Meager, 1999; Steeber et
al., 2001). Endothelium also reacts to hypoxia by producing VEGF
and expressing VEGF receptor aimed at increasing vascular density
(Kourembanas et al., 1998). Therefore it has been demonstrated that
endothelial cells generated. from MASC can perform all of these
tasks when tested in vitro.
[0185] Finally it has been proved that in vitro generated
MASC-derived endothelial cells respond to angiogenic stimuli by
migrating to the tumor site and contributing to tumor
vascularization as well as wound healing in vivo. This finding
confirms that endothelial cells generated from MASC have all the
functional characteristics of mature endothelium. The degree of
contribution of endothelial cells to tumor angiogenesis and
neo-angiogenesis was 35-45%, levels similar to what has been
described for other sources of endothelial cells (Conway et al.,
2001; Ribatti et al., 2001). In addition, it has been found that
angiogenic stimuli in vivo provided in a tumor microenvironment are
sufficient to recruit MASC to the tumor bed and induce their
differentiation into endothelial cells that contribute to the tumor
vasculature. These studies therefore extend studies reported by
other groups demonstrating that cells present in marrow can
contribute to new blood vessel formation (Peichev et al., 2000; Lin
et al., 2000; Gehling et al., 2000; Asahara et al., 1997), in a
process similar to vasculogenesis, precursor responsible for this
process has been identified the. This is to our knowledge the first
report that identifies a cell present in post-natal BM as a very
early progenitor for endothelial cells.
Example 10
Derivation of Neurons
[0186] Single adult BM-derived hMASC or mMASC were tested to
determine whether they can differentiate ex vivo to functional
neurons, as well astrocytes and oligodendrocytes aside from
mesodermal cell types. mMASC and hMASC were selected and culture
expanded as previously described in Examples 1 and 3, respectively.
Human neural progenitor cells (hNPC) were purchased from Clonetics
(San Diego, Calif.). hNPC were cultured and differentiated per
manufactures' recommendations.
[0187] Electrophysiology: Standard whole-cell patch-clamp recording
was used to examine the physiological properties of MASC-derived
neurons. Voltage-clamp and current-clamp recordings were obtained
using a Dagan 3900A patch-clamp amplifier (Dagan Corporation,
Minneapolis) which was retrofitted with a Dagan 3911 expander unit.
Patch pipettes, made from borosilicate glass, were pulled on a
Narishige pipette puller (model PP-83), and polished using a
Narishige microforge (model MF-83). Patch pipettes were filled with
an intracellular saline consisting of (in mM) 142.0 KF, 7.0
Na.sub.2SO.sub.4, 3.0 MgSO.sub.4, 1.0 CaCl.sub.2, 5.0 HEPES, 11.0
EGTA, 1.0 glutathione, 2.0 glucose, 1.0 ATP (magnesium salt), 0.5
GTP (sodium salt). For most recordings, the fluorescent dye
5,6-carboxyfluorescein (0.5 mm; Eastman Kodak Chemicals) was also
added to the pipette solution to confirm visually, using
fluorescence microscopy, that the whole-cell patch recording
configuration had been achieved. Pipette resistances ranged from 11
to 24 Mohm. The standard extracellular recording saline was
comprised of the following (in mM): 155 NaCl, 5.0 KCl, CaCl.sub.2,
1.0 MgCl.sub.2, 10 HEPES, 5 glucose. For some experiments 1 .mu.M
TTX was added to the standard control solution. The pH of the
intracellular and extracellular recording solutions was adjusted to
7.4 and 7.8, respectively, using NaOH. All chemicals were from
Sigma. PClamp 8.0 (Axon Instruments, Foster City) was used to run
experiments, and to collect and store data. The data presented were
corrected for a 8.4 mV liquid junctional potential, which was
calculated using the JPCALC software package. Off-line analyses and
graphical representations of the data were constructed using
Clampfit 8.0 (Axon Instruments, Foster City) and Prism (Graphpad,
San Diego).
[0188] Transduction: Retroviral supernatant was produced by
incubating MFG-eGFP-containing PG13 cells, provided by Dr.
G.Wagemaker, U. of Rotterdam, Netherlands (Bierhuizen et al.,
1997), with MASC expansion medium for 48 h, filtered and frozen at
-80.degree. C. MASC were incubated with retroviral supernatants and
8 .mu.g/ml protamine (Sigma) for 6 h. This was repeated 24 h later.
Transduction efficiency was analyzed by FACS.
[0189] Gene microarray analysis: RNA was isolated from hMASC, bFGF
or FGF-8b+EGF induced cells using the RNeasy mini kit (Qiagene),
digested with DNase I (Promega) at 37.degree. C. for 1 h and
re-purified using the RNeasy. The [.sup.32P] dATP labeled cDNA
probe, generated according to the manufacturers recommendations,
was hybridzed to the Human Neurobiology Atlas Array (Clonetech #
7736-1, Clonetech Laboratories, Palo Alto, Calif., USA) at
68.degree. C. for 18-20 h, followed by 4 washes in 2.times.SSC, 1%
SDS at 68.degree. C. for 30 min each time, 0.1.times.SSC, 0.5% SDS
at 68.degree. C. for 30 min, and once in 2.times.SSC at room
temperature for 5 min. The arrays were read by a phosphorimager
screen scanner (Molecular Dynamics, Storm 860) and analyzed using
Atlas Image 1.0 (Clontech). Differences between undifferentiated
and differentiated cells greater than 2-fold were considered
significant.
[0190] PCR analysis for retroviral insert: PCR was used o amplify
the flanking sequence 3' from the 3' LTR of the MFG vector in the
human genomic DNA. DNA from 10.sup.6 MASC or endothelial, myoblast
or neuroectodermal differentiated progeny was prepared from cells
by standard methods. 300 ng of genomic DNA was digested with AscI
and a splinkerette linker was ligated to the 5' end (Devon R. S. et
al., 1995). The two oligonucleotides used for the splinkerette
linker were as follows: aattTAGCGGCCGCTTGAATTttttttgcaaaaa, (the
hairpin loop forming sequence is in lower case and the upper case
is the reverse complement of the second splinkerette oligo), and
agtgtgagtcacagtagtctcgcgttc gAATTAAGCGGCCGCTA, (the underlined
sequence is also the sequence of the linker-specific primer (LS
Primer) used for the PCR and RT steps). A 5'-biotin-T7 coupled
primer was used that recognizes a sequence in the eGFP gene
[Biotin-ggc-cag-tga-att-gta-ata-cga-ctc-act-ata-ggc-tgg-CAC-ATG-
-GTC-CTG-CTG-GAG-TTC-GTG-AC; underlined portion shows the minimum
promoter sequence needed for efficient in vitro transcription and
the upper case is the eGFP specific sequence] and LS primer to
amplify the flanking regions for 10 rounds using Advantage 2
polymerase (Clontech). The biotin labeled amplified product was
captured using streptavidin-magnetic beads (Streptavidin Magnetic
Particles; Roche) and the resultant product was further amplified
using the T7 RNA polymerase an approximately 1,000 fold and then
DNAase 1 treated. The resultant product was reverse transcribed
using the agtgtgagtcacagtagtctcgcgttc splinkerette primer according
to the superscript II protocol (Gibco), and subsequently amplified
by 30 rounds of nested PCR using the primer for the 3'LTR [ggc caa
gaa cag atg gaa cag ctg aat atg]. The flanking sequence in the
human genome from endothelium, muscle, and neuroectodermal
differentiated cells and undifferentiated MASC was sequenced.
[0191] To demonstrate that the same insertion site was present in
multiple differentiated progeny, specific primers were generated in
the host-flanking genome. Real time PCR amplification (ABI PRISM
7700, Perkin Elmer/Applied Biosystems) was used to quantitate the
flanking sequence compared to the eGFP sequence. Reaction
conditions for amplification were as follows: 40 cycles of a two
step PCR (95.degree. C. for 15 sec, 60.degree. C. for 60 sec) after
initial denaturation (95.degree. C. for 10 min.) with 2 pd of DNA
solution, 1.times. TaqMan SYBR GreenUniversal Mix (Perkin
Elmer/Applied Biosystems) PCR reaction buffer. Primers used were as
follows: Clone A16: LTR primer=CCA-ATA-AAC-CCT-CTT-GCA-GTT-G;
Flanking sequence chromosome 7=TCC-TGC-CAC-CAG-AAA-TAA-CC; Clone A
12 chromosome 7 sequence: LTR primer=GGA-GGG-TCT-CCT-CTG-AGT-GAT-T,
Flanking sequence=CAG-TGG-CCA-GAT-CTC-ATC-TCA-C; Clone Al2
chromosome 1 sequence: LTR=GGA-GGG-TCT-CCT-CTG-AGT-GAT-T; Flanking
sequence=GCA-GAC-GAG-GTA-GGC-ACT-TG. The relative amount of the
flanking sequence was calculated in comparison with eGFP sequence
according to manufacturer's recommendations using the 7700 ABI
PRISM Detector Software 1.6.
[0192] Neural transplantation: Newborn (P1-P3) male Sprague Dawley
rats (Charles River Laboratories) were used in this study. The rats
were anaesthetized by cryoanesthesia. The cranium was immobilized
using a modified stereotaxic head holder and the scalp reflected to
expose the skull. hMASC were harvested with 0.25% trypsin/EDTA,
washed twice, and resuspended in PBS. The viability of the hMASC
was more than 85%. A 2 .mu.l volume of hMASC suspended in phosphate
buffered saline at a concentration of 0.7.times.10.sup.4
cells/.mu.l was stereotaxically injected intracerebroventricularly
with a tapered glass micropipette attached to a Hamilton syringe
using the following coordinates (mm from bregma): AP -0.6, ML 0.8,
DV 2.1, toothbar was set at -1. Following the injections, the scalp
was sutured and the pups allowed to recover.
[0193] Four and 12 weeks after transplantation, the rats were
anaesthetized with chloral hydrate (350 mg/kg, i.p.), decapitated
the brains removed, frozen in powered dry ice, and stored at
-80.degree. C. Fresh frozen brains were sectioned using a cryostat
and fixed with 4% paraformaldehyde for 20 min immediately before
staining. Sections were incubated for one hour at room temperature
with blocking/permeabilization solution consisting of 2% normal
donkey serum (Jackson Immuno Labs) and 0.3% triton X. Primary and
secondary antibodies were diluted in the same
blocking/permeabilization solution for subsequent steps. Primary
antibodies (mouse anti human nuclei (1:25), anti human nuclear
membrane (1:25) and anti NeuN (1:200) from Chemicon; rabbit anti
GFAP (1:250) from DAKO, rabbit anti NF200 (1:300) from Sigma were
incubated overnight at 4.degree. C., rinsed 3.times.10 minutes each
in PBS and followed by secondary Cy3 (1:200) anti and FITC (1:100)
antibodies (all from Jackson Immuno Labs) for two hours at room
temperature. Slides were examined by fluorescence microscopy using
a Zeiss Axiovert scope as well as by confocal fluorescence
microscopy using a Confocal 1024 microscope.
hMASC Acquire a Neuron, Astrocyte and Oligodendrocyte Phenotype
when Cultured with bFGF.
[0194] Neuroectodermal differentiation was done as described in
Example 5.
[0195] Briefly, cells were cultured in FN-coated chamberslides or
culture plates with serum-free medium consisting of 60% DMEM-LG,
40% MCDB-201 (Sigma Chemical Co, St Louis, Mo.), supplemented with
IX ITS, 1.times.LA-BSA, 10.sup.-8 M dexamethasone, 10.sup.4 M
ascorbic acid 2-phosphate (AA) (all from Sigma), 100 U penicillin
and 1,000 U streptomycin (Gibco). In some cultures, we added 100
ng/mL bFGF whereas in other cultures 10 ng/mL EGF+10 ng/mL FGF-8b
were added (all from R&D Systems). Cells were not subcultured,
but media was exchanged every 3-5 days.
[0196] Two weeks after re-plating with bFGF, 26.+-.4% of cells
expressed astrocyte (GFAP+), 28.+-.3% oligodendrocyte (MBP+) and
46.+-.5% neuron (NF200+) markers as shown in Table 6.
TABLE-US-00006 TABLE 6 Differentiation markers on bFGF and FGF-8b
induced hMSC bFGF bFGF bFGF FGF-8b FGF-8b FGF-8b (day 7) (day 14)
(day 21) (day 7) (day 14) (day 21) GFAP 36 .+-. 4% 26 .+-. 4% 0 0 0
0 MBP 35 .+-. 3% 28 .+-. 3% 4 .+-. 2% 0 0 0 GaIC 30 .+-. x % 26
.+-. 5% 8 .+-. 3% 0 0 0 Nestin 35 .+-. 6% 6 .+-. 3% Not tested 90
.+-. 10% 10 .+-. 6% Not tested Neuro-D 20 .+-. 2% 0% Not tested 50
.+-. 6% Not tested Not tested Tuji 30 .+-. 3% 23 .+-. 5% 23 .+-. 2%
88 .+-. 5% 92 .+-. 3% 98 .+-. 2% PSA- 33 .+-. 2% 16 .+-. 3% Not
tested 40 .+-. 7% Not tested Not tested NCAM NF68 0 26 .+-. 7% 22
.+-. 3% 0 20 .+-. 3% Not tested NF160 0 46 .+-. 5% 50 .+-. 3% 0 65
.+-. 3% Not tested NF200 0 15 .+-. 2% 22 .+-. 5% 0 75 .+-. 8% 92
.+-. 6% NSE 0 40 .+-. 4% 82 .+-. 5% 0 78 .+-. 3% 80 .+-. 8% MAP2-AB
0 40 .+-. 6% 80 .+-. 2% 0 95 .+-. 4% 95 .+-. 3% Tau 0 28 .+-. 2% 78
.+-. 7% 0 93 .+-. 2% 92 .+-. 4% GABA 0 0 0 0 39 .+-. 4% 40 .+-. 2%
Parvalbumin 0 0 0 0 28 .+-. 6% 35 .+-. 3% TH 0 0 0 20 .+-. 5% 23
.+-. 5% 25 .+-. 6% DCC 0 0 0 0 25 .+-. 6% 28 .+-. 2% DTP 0 0 0 0 35
.+-. 7% 38 .+-. 3% TrH 0 0 0 0 26 .+-. 6% 25 .+-. 4% Serotonin 0 0
0 0 30 .+-. 5% 35 .+-. 3% Nurrl 0 0 0 0 20 .+-. 4% 23 .+-. 2% c-ret
0 0 0 0 33 .+-. 3% 35 .+-. 5%
[0197] When hMASC were replated at higher cell densities
(2.times.10.sup.4 cells/cm.sup.2) to induce differentiation, no
cells with neuroectodermal phenotype could be detected, suggesting
that cell-cell interactions prevent bFGF-induced neuroectodermal
differentiation.
[0198] The distribution of astrocyte-, oligodendrocyte- and
neuron-like cells did not differ when differentiation was induced
with hMASC that had undergone 20 or 60 PDs. However, when hMASC
expanded for 20 PDs were cultured with bFGF, >50% of cells died
while >70% of hMASC culture expanded for >30 PDs survived and
acquired a neuron-, astrocyte- or oligodendrocyte-like phenotype.
This suggests that not all hMASC can be induced to acquire neural
characteristics but that a subpopulation of hMASC that survives
long-term in vitro may be responsible for neuronal differentiation.
It has been shown that the karyotype of hMASC is normal
irrespective of culture duration (Reyes et al., 2001).
Differentiation of hMASC into neuroectodermal-like cells is
therefore not likely due to transformation of MASC following
long-term culture.
[0199] Most astrocyte- and oligodendrocyte-like cells died after 3
weeks. Progressive maturation of neuron-like cells was seen
throughout culture. After 1 week, bFGF treated hMASC stained
positive for NeuroD, Nestin, polysialated neural cell adhesion
molecule (PSA-NCAM), and tubulin-.beta.-III (TuJI) (Table 6). After
2 weeks, bFGF treated cells stained positive for NF68, -160, and
-200, NSE, MAP2-AB, and Tau. bFGF-induced neurons did not express
markers of GABA-ergic, serotonergic or dopaminergic neurons, but
expressed glutamate as well as the glutamate-receptors-5, -6 and -7
and N-methyl-D-aspartate (NMDA)-receptor, and Na.sup.+-gated
voltage channels.
[0200] Further confirmation of neuroectodermal differentiation was
obtained from cDNA array analysis of two independent hMASC
populations induced to differentiate for 14 days with 100 ng/mL
bFGF. Expression levels of nestin, otx 1 and otx2Consistent with
the immunohistochemical characterization, a >2 fold increase in
mRNA for nestin was detected, GFAP, glutamate-receptors 4, 5, and
6, and glutamate, and several sodium-gated voltage channels, but
did not detect increases in TH or TrH mRNA levels. A >2 fold
increase in mRNA levels was also found for mammalian achaete-scute
homolog 1 (MASH I) mRNA, a transcription factor found only in brain
(Franco Del Arno et al., 1993) and ephrin-A5 mRNA (O'Leary and
Wilkinson, 1999). The astrocyte specific markers GFAP and S100A5,
and oligodendrocyte specific markers, myelin-oligodendrocyte
glycoprotein precursor and myelin protein zero (PMZ), as well as
Huntingtin, and major prion protein precursor mRNA were expressed
>2-fold higher after exposure to bFGF. A greater than 2 fold
increase was also seen for several glycine receptors,
GABA-receptors, the hydroxytryptophan receptor-A and neuronal
acetylcholine receptor, glycine transporter proteins, synaptobrevin
and synaptosomal-associated protein (SNAP)25. Finally, bFGF induced
expression of BDNF and glia-derived neurotrophic factor (GDNF).
Like hMASC, mMASC Acquire a Neuron, Astrocyte and Oligodendrocyte
Phenotype when Cultured with bFGF.
[0201] MASC derived from other species was tested to determine
whether similar results could be obtained. mMASC expanded for 40-90
PDs were replated at 10.sup.4 cells/cm.sup.2 in conditions
identical to those used for hMASC. After 14 days, mMASC acquired
morphologic and phenotypic characteristics of astrocytes
(GFAP.sup.+), oligodendrocytes (MBP.sup.+) and neurons
(NF-200.sup.+, NSE.sup.+and Tau). NF200 and GFAP or MBP were never
found in the same cell. In contrast to undifferentiated mMASC,
mMASC treated with bFGF were significantly larger and extended
processes for >40 gm.
[0202] To determine whether neuron-like cells had functional
characteristics of neurons, and if bFGF-induced cells showed
evidence of voltage-gated Na.sup.+ currents a patch clamp was used.
No sodium currents or fast spiking behavior was seen in any of the
mMASC derived neuron-like cells (n=59), even though some cells
expressed calcium currents, and in 4 cells there was evidence of
spiking behavior mediated by calcium currents. Thus, bFGF induced
cells did not have functional voltage-gated Na.sup.+ currents,
despite expression of sodium-gated voltage channel mRNA and
protein.
hMASC Acquire a Midbrain Dopaminergic, Serotonergic and GABAergic
Phenotype when Cultured with EGF and FGF-8b.
[0203] FGF-8b, expressed at the mid-hindbrain boundary and by the
rostral forebrain, induces differentiation of dopaminergic neurons
in midbrain and forebrain and serotonergic neurons in the hindbrain
(Ye et al., 1998). In vitro, FGF-8b has been used to induce
dopaminergic and serotonergic neurons from murine ES cells (Lee et
al., 2000).
[0204] hMASC (n=8), expanded=for 20 to 60 PDs, were replated at
2.times.10.sup.4 cells/cm.sup.2 on FN in serum free medium with ITS
and AA and with 10 ng/mL FGF-8b and 10 ng/mL EGF. More than 80% of
cells survived for 3 weeks. FGF-8b and EGF induced differentiation
into cells staining positive for neuronal markers (Table 6) (day 7:
PSA-NCAM, Nestin and TuJ1; day 14: NF-68, NF-160, NF-200; and day
21: MAP2-AB, NSE, Tau, and Natgated voltage channels) but not
oligodendrocytes and astrocytes. In contrast to our observation for
bFGF induced differentiation, cells plated at 10.sup.4
cells/cm.sup.2 with EGF and FGF-8b did not lead to differentiation.
After 2-3 weeks, cells had characteristics of GABAergic
(GABA.sup.+, parvalbumin.sup.+), dopaminergic (TH.sup.+, DCC.sup.+,
and DTP.sup.+) and serotonergic (TrH.sup.+and serotonin.sup.+)
neurons (Table 6). Cells also expressed the GABA-A-receptor and
glutamate receptors. Cells with a dopaminergic phenotype also
stained positive with Abs against the nuclear transcription factor,
Nurrl, expressed only in midbrain dopaminergic neurons
(Saucedo-Cardenas et al., 1998) as well as the proto-oncogene cRet,
a membrane-associated receptor protein tyrosine kinase, which is a
component of the glial cell line-derived neurotrophic factor (GDNF)
receptor complex expressed on dopaminergic neurons (Trupp et al.,
1996). This suggests that FGF-8b induces a phenotype consistent
with midbrain dopaminergic neurons.
[0205] Again, results from immunohistochemical studies were
confirmed by cDNA array analysis on hMASC induced to differentiate
for 14 days with FGF-8b+EGF. Consistent with the
immunohistochemical characterization, a >2 fold increase in mRNA
for TH, TrH, glutamate, several glutamate-receptors, and
sodium-gated voltage channels was detected. As parvalbumin and GABA
are not present on the array, their expression could not be
confirmed by mRNA analysis. Consistent with the almost exclusive
neural differentiation seen by immunhistochemnistry, there was no
increase in expression of GFAP, S100A5 mRNA nor mRNA for the
oligodendrocyte specific marker, PMZ. FGF-8b+EGF induced cells
expressed >2 fold more tyrosine kinase receptor (Trk)A, BDNF and
GDNF, several glycine-, GABA- and hydroxytryptamine-receptors, and
several synaptic proteins.
Coculture with the Glioblastoma Cell Line U87 Enhances Neuron
Maturation.
[0206] Irrespective of the culture conditions used, hMASC-derived
neurons did not survive more than 3-4 weeks in culture. As neither
culture contained glial cells after 3 weeks, it is possible that
neuronal cells that express both glutamate and glutamate-receptors
died due to glutamate toxicity (Anderson and Swanson, 2000).
Alternatively, factors required for neural cell survival,
differentiation and maturation provided by glial cells might not be
present in the cultures (Blondel et al., 2000; Daadi and Weiss,
1999; Wagner et al., 1999). To test this hypothesis, cells from
3-week old FGF-8b+EGF cultures were cocultured with the
glioblastoma cell line, U-87, in serum-free medium supplemented
with FGF-8b+EGF for an additional 2 weeks.
[0207] The glioma cell line, U-87, [American Tissue Cell Collection
(Rockville, Md.)] was maintained in DMEM+10% FCS (Hyclone
Laboratories, Logan, Utah). Cells from 3-week old FGF-8b+EGF
containing cultures were labeled with the lipophylic dye, PKH26
(Sigma), as per manufacturer's recommendations. Labeled cells were
replated in FN coated chamber slides in FGF-8b+EGF containing serum
free medium together with 1,000 U-87 cells and maintained an
additional 2-3 weeks with media changes every 3-5 days. To assure
that PKH26 present in MASC-derived cells did not transfer to the
U-87 cell line, U-87 cells were cultured in BSA-containing medium
and 20 .mu.l PKH26 dye for 7 days. No labeling of glioma cells was
detected.
[0208] Under these serum-free conditions, U-87 cells ceased to
proliferate but survived. hMASC derived neurons were labeled with
the membrane dye, PKH26, prior to coculture with U-87 cells to
allow us to identify the hMASC-derived cells by fluorescence
microscopy. FGF-8b+EGF induced neurons cocultured after 3 weeks
with U-87 cells and the same cytokines survived for at least 2
additional weeks. Neurons acquired a more mature morphology with
increased cell size as well increased number, length and complexity
of the neurites.
[0209] The electrophysiological characteristics of PKH26 labeled
neural cells derived from hMASC after coculture with U-87 cells by
whole-cell current clamp and voltage-clamp after current-injection
was evaluated (FIG. 9B). Current-clamp demonstrated spiking
behavior in response to injected current in 4/8 of PKH26 labeled
hMASC-derived cells present in FGF-8b+EGF/U-87 cultures. The
resting membrane potential of spiking and non-spiking cells was
-64.9.+-.5.5 mV and -29.7.+-.12.4 mV, respectively. For each cell
studied, input resistance of spiking and non-spiking cells was
194.3 (37.3) and 216.3 (52.5) Mohm, respectively. An example of one
of the cells in which w observed spiking behavior is shown in FIG.
9B. The top panel shows a family of voltage traces which was
elicited from a spiking cell under control conditions. A DC current
was first injected in the cell to hold them in the range of -100 to
-120 mV. A current injection protocol, as shown in the middle
panel, was then used to drive the membrane potential to different
levels. As shown in this example, depolarizing current steps that
were sufficiently large to bring the cell to threshold for action
potential, evoked a single spike. The lower panel shows that the
spiking behavior of the cells could be blocked by 1 .mu.M TTX,
suggesting that the action potentials are mediated by Na-gated
voltage channels. Leak-subtracted current records, obtained in
voltage-clamp mode from the same cells (FIG. 9C), demonstrated an
inward current that was transient in time course and activated at
voltages more positive than -58 mV, as well as outward currents.
The transient inward current was blocked reversibly by 1 .mu.M TTX.
This pharmacology, together with the transient time course and the
voltage-dependent activation of the inward current is typical for
voltage-gated Na.sup.+ currents, found only in mature neurons and
skeletal muscle cells (Sah et al., 1997; Whittemore et al., 1999).
Skeletal muscle markers in these neuron-like cells was not
detected. These studies suggest that treatment with FGF-8b+EGF and
co-culture with glioblastoma cellsfresults ininaturation to cells
with the fundamental characteristics of excitable neurons,
TTX-sensitive voltage-gated Na.sup.+ currents.
hMASC Transplanted in Ventricles of Newborn Rats Differentiate in
Cells Expressing Astrocyte and Neuronal Markers
[0210] 1.4.times.10.sup.4 hMASC were stereotactically injected in
the lateral ventricles of P1-P3 Sprague Dawley rats. After 4 and 12
weeks, animals were sacrificed and analyzed for presence of human
cells and evidence of differentiation of hMASC to neuroectoderm.
Human cells, identified by staining with a antibodies against human
nuclei or human nuclear membrane could be seen in the SVZ up to 400
.mu.m away from the ventricle in animals analyzed after 4 weeks,
and after 12 weeks, human cells could also be seen deeper in the
brain parenchyma such as in the hippocampus and along the formix.
Some human cells had typical astrocyte morphology and stained
positive with anti-GFAP antibodies, whereas other cells stained
positive with anti-Neu-N antibodies, NF-200 and anti-human nuclear
membrane antibodies. Triple staining showed that human nuclear
antigen positive Neu-N positive cells did not coexpress and
GFAP.
Summary
[0211] The central finding of this work is that single post-natal
BM-derived MASC can be induced to differentiate not only into
mesodermal cell types but also cells with mature neuronal
characteristics, as well as astrocyte and oligodendrocyte
characteristics. Time-dependent as well as culture-method-dependent
maturation of MASC to cells with neuroectodermal features was
shown. Double staining definitively demonstrated that neuronal or
glial cells were authentic and results were not due to
inappropriately expressed neuronal or glial markers. These results
were confirmed at the mRNA level. Retroviral marking studies were
used to demonstrate that the neurons, astrocytes and
oligodendrocytes were derived from a single MASC that also
differentiates into muscle and endothelium, as the sequence of the
host cell genomic region flanking the retroviral vector was
identical in all lineages. hMASC did not only acquire phenotypic
but also electrophysiological characteristics of mature neurons,
namely TTX-sensitive voltage-gated Na.sup.+ currents. Finally, it
was also shown that MASC can differentiate in vivo into cells
expressing neuronal and astrocyte markers.
[0212] Using retroviral marking of hMASC combined with PCR-based
sequencing of the genomic sequence flanking the 3'-LTR of the
retroviral insert, it was shown that neurons are derived from the
same hMASC that differentiate into astrocytes and oligodendrocytes,
as well as into endothelium and muscle (Jordan et al., 1990). This
conclusively demonstrates that MASC can, at the single cell level,
differentiate to cells of mesodermal and neuroectodermal lineages.
The cells with the ability to differentiate not only into
mesodermal cell types but also neuroectodermal cell types
multipotent adult stem cells, or MASC were re-named. Sanchez-Ramos
et al. (Sanchez-Ramos et al., 2000) and Woodbury et al. (Woodbury
et al., 2000) showed that populations of human or rodent MSC can
express markers of astrocytes and neurons, but not oligodendrocytes
in vitro. However, neither study provided evidence that the same
cell that acquired neuroectodermal markers could also differentiate
into mesodermal cells. Furthermore, neither study showed that cells
expressing neuronal markers also acquired functional neuronal
characteristics. Thus, although suggestive for neural
differentiation, these reports did not conclusively demonstrate
neural and glial differentiation from MSC.
[0213] It was also shown that hMASC transplanted in the ventricle
of newborn rats can migrate in the neurogenic subventricular zone
and into the hippocampus where they respond to local cues to
differentiate into cells expressing astrocyte and neuronal markers.
This model was chosen because migration and differentiation of NSC
to specific neuronal phenotypes occurs to a much greater extent
when transplantation is done in germinal areas of the brain than in
non-neurogenic areas, and when transplants are done in newborn
animals compared with adult animals (Bjorklund and Lindvall, 2000;
Svendsen and Caldwell, 2000). Although hMASC are multipotent and
differentiate into cells outside of the neuroectoderm, hMASC did
not form teratomas. The number of cells that had migrated outside
the subventricular area was low after 4 weeks, but increased after
12 weeks. The ease with which MASC can be isolated from post-natal
BM, expanded and induced to differentiate in vitro to astrocytes,
oligodendrocytes or neuronal cell types may circumvent one of the
key problems in NSC transplantation, namely the availability of
suitable donor tissue.
Example 11
MASC Differentiation into Hepatocyte-like Cells
[0214] During embryogenesis, the first sign of liver morphogenesis
is a thickening of the ventral endodermal epithelium, which occurs
between e7.5 and e8.5 in the mouse (Zaret K. S., 2001). Little is
known about the signals involved in initial endoderm formation and
subsequent endoderm specification. Early in gastrulation (e6-e7)
endoderm is not specified, not even in an anterior/posterior
direction (Melton D., 1997). However, recent studies showed that ex
vivo exposure of endoderm to FGF4 posteriorizes the early endoderm,
which is now competent to express hepatic markers (Wells J. M. et
al., 1999). By e8.5 in the mouse, definitive endoderm has formed
the gut tube and expresses IINF3r3 (Zaret K. S., 2000). The foregut
endoderm is induced to the hepatocyte lineage by acidic (a)FGF and
bFGF, both produced by the adjacent cardiac mesoderm (Zaret K. S.,
2001), which are required to induce a hepatic fate and not the
default pancreatic fate (Zaret K. S., 2001). Basic morphogenetic
proteins (BMP's) produced by the transversum mesenchyme are also
required as they increase levels of the GATA4 transcription factor
which promote the ability of endoderm to respond to FGF's (Zaret K.
S., 2001). GATA4 and HNF3.beta. are required for hepatic
specification and are important effectors of downstream events
leading to hepatocyte differentiation, as they upregulate markers
of hepatocyte specific expression such as albumin, among
others.
[0215] In most instances, mature hepatocytes can undergo several
cell divisions and are responsible for hepatic cell replacement. As
a result, there has been great controversy about the existence and
function of a liver stem cell. During extensive liver necrosis due
to chemical injury or when hepatocytes are treated with chemicals
that block their proliferation, a population of smaller cells with
oval shape, termed oval cells, emerges and proliferates (Petersen,
B. E., 2001). These oval cells may constitute the "stem cell"
compartment in the liver. Oval cells reside in the smallest units
of the biliary tree, called the canals of Herring, from where they
migrate into the liver parenchyma (Theise N. D., et al., 1999).
Oval cells are bi-potential, giving rise in vitro and in vivo to
both hepatocytes and bile ductular epithelium. Oval cells express
several hematopoietic markers such as Thy1.1, CD34, Flt3-receptor,
and c-Kit, and also express .alpha.FP, CK19,
.gamma.-glutamyl-transferase, and OV-6. The origin of oval cells is
not known (Petersen, B. E., 2001; Kim T. H. et al, 1997; Petersen,
B. E., 2001).
[0216] Until recently, it was believed that hepatocytes could only
be derived from cells of endodermal origin and their progenitors.
However, recent studies suggest that non-endodermal cells may also
form hepatocytes in vivo and in vitro (Petersen, B. E., 2001;
Pittenger M. F. et al., 1999). Following bone marrow (BM)
transplantation, oval cells are derived from the donor BM (Theise
N. D., et al., 1999). Transplantation of enriched hematopoietic
stem cells (HSC) in FAH.sup.-/- mice, an animal model of
tyrosenimia type I, resulted in the proliferation of large numbers
of donor LacZ.sup.+ hepatocytes and animals had restored
biochemical function of the liver (Lagasse E. et al., 2000).
Furthermore, single HSC may not only repopulate the hematopoietic
system but also contribute to epithelium of lung, skin, liver and
gut (Krause D. S. et al., 2001). Exocrine pancreatic tumor cells
treated in vitro with dexamethasone (Dex) with or without
oncostatin M (OSM) may acquire a hepatocyte phenotype (Shen C. N.
et al., 2000). Finally, mouse embryonic stem (ES) cells
spontaneously acquire a hepatocyte phenotype, a process that is
enhanced by treatment with aFGF, HGF, OSM, and Dex (Hamazaki T. et
al., 2001).
[0217] It was demonstrated here that single MASC not only
differentiate into mesodermal and neuroectodermal cells, but also
into cells with morphological, phenotypic and functional
characteristics of hepatocytes in vitro.
mMASC, rMASC, and hMASC acquire a hepatocyte-like phenotype when
cultured with FGF4 and/or HGF.
[0218] mMASC, rMASC and hMASC were selected and cultured as
described. To determine optimal conditions for MASC differentiation
into hepatocyte-like cells, the effect of different extracellular
matrix (ECM) components was tested and cytokines known to induce
hepatocyte differentiation in vivo or from ES cells (Zaret K. S.,
2001) on mMASC or rMASC differentiation to hepatocytes. As
differentiation requires cell cycle arrest, the effect of cell
density was also tested. To demonstrate differentiation to
hepatocyte like cells, cells were stained after 14 days with Abs
against albumin, CK18, and HNF3.beta..
[0219] Optimal differentiation of mMASC or rMASC to albumin, CK18
and HNF3.beta. positive epithelioid cells was seen when MASC were
plated at 21.5.times.10.sup.3 cells/cm.sup.2 in the presence of 10
ng/ml FGF4 and 20 ng/ml HGF on Matrigel.TM. as shown in Table 7A.
After 14 days, the percent albumin, CK18 and HNF3.beta. positive
epithelioid cells was 61.4.+-.4.7%, and 17.3% of cells were
binucleated. When plated on FN, differentiation to CK18 and
HNF3.beta. positive epithelioid cells was also seen, even though
only 53.1.+-.6.3% of cells stained and fewer (10.9%) binucleated
cells were seen.
[0220] Culture with either FGF4 or HGF yielded albumin, CK18 and
HNF3.beta. positive epithelioid cells, but the percent albumin,
CK18 and HNF3.beta. positive cells was higher when mMASC or rMASC
were treated with both FGF4 and HGF as shown in Table 7A. Addition
of aFGF, bFGF, FGF7, BMP's, or OSM did not increase the percent
cells positive for hepatocyte markers, while 1% DMSO and 0.1 mM-10
mM Sodium Butyrate did not support differentiation of mMASC or
rMASC to cells positive for hepatocyte markers.
[0221] When cell densities between 2.5 and 25.times.10.sup.3
cells/cm.sup.2 were tested, the highest percent cells with
hepatocyte markers was seen in cultures seeded at
21.5.times.10.sup.3 cells/cm.sup.2. No hepatocyte differentiation
was seen when cells were plated at <12.5.times.10.sup.3
cells/cm.sup.2.
[0222] hMASC were plated at 3-30.times.10.sup.3 cells/cm.sup.2 on
10 ng/mL FN or 1% Matrigel.TM. with aFGF, bFGF, FGF7, 1% DMSO, HGF,
and/or FGF4. Only cells treated with 10 ng/ml FGF4 alone, 20 ng/ml
HGF alone, or a combination of both differentiated into epithelioid
cells that expressed albumin, CK18 and HNF3.beta.. hMASC plated at
15-30.times.10.sup.3 cell/cm.sup.2 differentiated into epithelioid
cells whereas hMASC plated at 3.times.10.sup.3 cell/cm.sup.2 died.
Like mMASC or rMASC, the percent albumin, CK18 and HNF3.beta.
positive epithelioid cells was higher when hMASC were cultured on
Matrigel.TM. (91.3%.+-.4.4) than on FN (89.5%.+-.5.4), and the
percent binucleated cells was higher on Matrigel.TM. (31.3%) than
on FN (28.7%) as shown in Table 7B.
TABLE-US-00007 TABLE 7 Optimization of MASC differentiation into
hepatocyte like cells. A: Mouse and Rat B: Human FGF-4 HGF FGF4 +
HGF FGF-4 HGF FGF-4 + HGF FN Albumin ++/++ ++/+ ++/++ +++++ +++++
+++++ CK18 ++/++ ++/+ +++/++ +++++ +++++ +++++ HNF3.beta. +++/+++
+++/+ ++++/+++ +++++ NT +++++ Matrigel .TM. Albumin ++/++ +/+
+++/+++ +++++ NT +++++ CK18 ++/++ ++/+ +++/+++ +++++ NT +++++
HNF3.beta. +++/+++ +++/++ ++++/++++ +++++ NT +++++ Collagen Albumin
- - - NT NT NT CK18 - - - NT NT NT HNF3.beta. - - - NT NT NT - = 0%
+ = 20%, ++ = 30%, +++ = 40%, ++++ = 60%, +++++ = 80% cells
staining positive for specific markers and NT = not tested.
Phenotypic Characterization of MASC Differentiation to
Hepatocyte-like Cells
[0223] Hepatocyte differentiation was further evaluated over time
by immunofluorescence and confocal microscopy for early
(HNF3.beta., GATA4, CK19, .alpha.FP) and late (CK18, albumin,
HNF1.alpha.) markers of hepatocyte differentiation. mMASC or rMASC
plated on Matrigel.TM. with FGF4 and HGF enlarged from 8 .mu.m to
15 .mu.m diameter as shown in Table 8A. On d21-d28, approximately
60% of cells were epithelioid and surrounded by smaller round or
spindle shaped cells. Undifferentiated mMASC or rMASC did not
express any of the liver specific transcription factors or
cytoplasmic markers. After 4 days, cells expressed HNF3.beta.,
GATA4 and .alpha.FP, low levels of CK19, and very rare cells
stained positive for HNF1.alpha., albumin or CK18. At seven days,
the large epithelioid cells stained positive for HNF3.beta., GATA4,
HNF1.alpha. with increasing staining for albumin and CK18. Only
rare cells expressed .alpha.FP. After 14, 21 and 28 days, the large
epithelioid cells stained positive for GATA4, HNF3.beta.,
HNF1.alpha., CK18 and albumin, but not .alpha.FP or CK19. The
smaller cells surrounding the nodules of epithelioid cells stained
positive for CK19 and aFP. hMASC was plated on Matrigel.TM. with
FGF4 and HGF or FGF4 alone enlarged from 10-12 .mu.m to 20-30 .mu.m
diameter by d21. After 7 days, cells expressed HNF3.beta., GATA4
and low levels of CK19, while few cells stained positive for
albumin or CK18. After 14 and 21 days, >90% of epithelioid cells
stained positive for GATA4, HNF3.beta., HNF1.alpha., HNF4, CK18 and
albumin, while only rare cells stained positive for .alpha.FP or
CK19 as shown in FIG. 10B.
TABLE-US-00008 TABLE 8 Immunohistochemistry Pattern of Hepatocyte
Marker Expression A: Mouse and Rat B: Human D4 D7 D10 D14 D21 D4 D7
D10 D14 D21 HNF3.beta. +/+ +/+ +/+ +/+ +/+ NT + NT + + Gata4 +/+
+/+ +/+ +/+ +/+ NT + NT + + .alpha.-FP +/+ +/+ NT/NT -/- -/- NT +
NT - - HNF1.alpha. -/- +/+ NT/NT +/+ +/+ NT - NT + + Albumin -/-
+/+ +/+ +/+ +/+ NT + NT + + CK18 -/- +/+ +/+ +/+ +/+ NT - NT + + +
= Marker is expressed, - = Marker is not expressed and NT = not
tested
Hepatocyte-like Cells are Derived from the Same Single hMASC that
Differentiated into Neuroectoderm and Endoderm
[0224] It has been shown that single mMASC or rMASC differentiate
into endothelium, neuroectoderm and CK18 and albumin positive
endodermal cells. It has also been shown that single hMASC
differentiate into mesoderm and neuroectoderm. The same single
hMASC was tested to determine whether they can differentiate into
hepatocyte-like cells. MASC were obtained, cultured and expanded as
described. For differentiation, mMASC or rMASC were plated at
5-25.times.10.sup.3 cells/cm.sup.2 on 0.01-10 .mu.g/ml fibronectin
(FN), 0.01-8 .mu.g/ml collagen (Sigma Chemical Co, St. Louis, Mo.),
or 1% Matrigel.TM. (Becton-Dickinson) in serum-free medium [60% low
glucose DMEM (DMEM-LG; Gibco-BRL, Grand Island, N.Y.), 40% MCDB-201
(Sigma), supplemented with 1.times.insulin/transferrin/selenium,
4.7 .mu.g/ml linoleic acid, 1 mg/ml bovine serum albumin (BSA),
10.sup.-8 M dexamethasone, 10.sup.4 M ascorbic acid 2-phosphate
(all from Sigma), 100 U/ml penicillin, 100/ml U streptomycin
(Gibco)], with 2% FCS (Hyclone, Logan Utah) and 10 ng/mL each
epidermal growth factor (EGF) (Sigma), leukemia inhibitory factor
(LIF; Chemicon, Temecula, Calif.), and platelet derived growth
factor (PDGF-BB; R&D Systems, Minneapolis, Minn.). hMASC were
plated at 15-30.times.10.sup.3 cells/cm.sup.2 on 0.1 mg/ml FN, or
1% Matrigel.TM. in the same medium without LIF (Reyes M., 2002).
After 8-12 h, media were removed, cells washed twice with phosphate
buffered saline (PBS) (Fischer) and cultured in serum-free medium
supplemented with 5-50 ng/ml HGF, aFGF, bFGF, FGF4, FGF7, or OSM;
or 10 mg/ml dimethyl-sulphoxide (DMSO), or 0.1-1 mM sodium
butyrate.
[0225] Transduction of hMASC with eGFP was performed using an
eGFP-cDNA containing retrovirus and expanded to
>5.times.10.sup.6 cells. Twenty percent was induced to
differentiate into muscle, endothelium, neuroectoderm and endoderm.
For clone A16 a single retroviral insertion site was present in
undifferentiated MASC as well as mesodermal and neuroectodermal
differentiated cells and eGFP.sup.+ clone A16 MASC differentiated
into CK18 and albumin positive cells. The same insertion site was
present in FGF4-treated MASC generated from the same cell
population (5'-TAG CGGCCGCTTGAATTCGAACGCGAGACTACTGTGACT CACACT-3',
Chromosome 7), proving that single hMASC differentiate into
endoderm aside from mesoderm and neuroectoderm.
Quantitative RT-PCR Demonstrates that FGF4 and HGF induces
hepatocyte Specification and Differentiation.
[0226] Hepatocyte differentiation by quantitative RT-PCR was
confirmed for early (HNF3.beta., GATA4, CK19, aFP) and late (CK18,
albumin, HNF1.alpha., cytochrome P450) markers of hepatocyte
differentiation. RNA was extracted from 3.times.10.sup.5 MASC or
MASC induced to differentiate to hepatocytes. mRNA was reverse
transcribed and cDNA was amplified as follows: 40 cycles of a two
step PCR (95.degree. C. for 15'', 60.degree. C. for 60'') after
initial denaturation (95.degree. C. for 10') with 2 .mu.l of DNA
solution, 1.times. TaqMan SYBR Green Universal Mix PCR reaction
buffer using a ABI PRISM 7700 (Perkin Elmer/Applied Biosystems).
Primers used for amplification are listed in Table 9.
TABLE-US-00009 TABLE 9 Primers used Primer Name Primers MOUSE
HNF1.alpha. S: 5'-TTCTAAGCTGAGCCAGCTGCAGACG-3' A:
5'-GCTGAGGTTCTCCGGCTCTTTCAGA-3' HNF3.beta. S:
5'-CCAACATAGGATCAGATG-3' A: 5'-ACTGGAGCAGCTACTACG-3' GATA4 S:
5'-AGGCATTACATACAGGCTCACC-3' A: 5'-CTGTGGCCTCTATCACAAGATG-3' CK18
S: 5'-TGGTACTCTCCTCAATCTGCTG-3' A: 5'-CTCTGGATTGACTGTGGAAGTG-3'
CK19 S: 5'-CATGGTTCTTCTTCAGGTAGGC-3' A: 5'-GCTGCAGATGACTTCAGAACC-3'
Albumin S: 5'-TCAACTGTCAGAGCAGAGAAGC-3' A:
5'-AGACTGCCTTGTGTGGAAGACT-3' .alpha.FP S:
5'-GTGAAACAGACTTCCTGGTCCT-3' A: 5'-GCCCTACAGACCATGAAACAAG-3' TTR S:
5'-TCTCTCAATTCTGGGGGTTG-3' A: 5'-TTTCACAGCCAACGACTCTG-3' Cyp2b9 S:
5'-GATGATGTTGGCTGTGATGC-3' A: 5'-CTGGCCACCATGAAAGAGTT-3' Cyp2b13 S:
5'-CTGCATCAGTGTATGGCATTTT-3' A: 5'-TTTGCTGGAACTGAGACTACCA-3' HUMAN
.alpha.FP S: 5'-TGCAGCCAAAGTGAAGAGGGAAGA-3' A:
5'-CATAGCGAGCAGCCCAAAGAAGAA-3' Albumin S: 5'-TGC TTG
AATGTGCTGATGACAGGG-3' A: 5'-AAGGCAAGTCAGCAGGCATCTCATC-3' CK19 S:
5'-ATGGCCGAGCAGAACCGGAA-3' A: 5'-CCATGAGCCGCTGGTACTCC-3' CK18 S:
5'-TGGTACTCTCCTCAATCTGCTG-3' A: 5'-CTCTGGATTGACTGTGGAAGT-3' CYP1B1
S: 5'-GAGAACGTACCGGCCACTATCACT-3' A:
5'-GTTAGGCCACTTCAGTGGGTCATGAT-3' CYP2B6 S:
5'-GATCACACCATATCCCCGGA-3' A: 5'-CACCCTACCACCCATGACCG-3' RAT
HNF1.alpha. S: 5'-AGCTGCTCCTCCATCATCAGA-3' A:
5'-TGTTCCAAGCATTAAGTTTTCTATTCTAA-3' HNF3.beta. S:
5'-CCTACTCGTACATCTCGCTCATCA-3' A: 5'-CGCTCAGCGTCAGCATCTT-3' CK18 S:
5'-GCCCTGGACTCCAGCAACT-3' A: 5'-ACTTTGCCATCCACGACCTT-3' CK19 S:
5'-ACCATGCAGAACCTGAACGAT-3' A: 5'-CACCTCCAGCTCGCCATTAG-3' Albumin
S: 5'-CTGGGAGTGTGCAGATATCAGAGT-3' A: 5'-GAGAAGGTCACCAAGTGCTGTAGT-3'
.alpha.FP S: 5'-GTCCTTTCTTCCTCCTGGAGAT-3' A:
5'-CTGTCACTGCTGATTTCTCTGG-3' TTR S: 5'-CAGCAGTGGTGCTGTAGGAGTA-3' A:
5'-GGGTAGAACTGGACACCAAATC-3' Cyp2b1 S: 5'-GAGTTCTTCTCTGGGTTCCTG-3'
A: 5'-ACTGTGGGTCATGGAGAGCTG-3'
[0227] mRNA levels were normalized using .beta.-actin (mouse and
human) or 18S (rat) as housekeeping genes and compared with mRNA
levels in freshly isolated rat or mouse hepatocytes, rat
hepatocytes cultured for 7 days, or mRNA from human adult liver RNA
purchased from Clontech, Palo Alto, Calif.
[0228] On d0, mMASC and rMASC expressed low levels of albumin
.alpha.FP, CK18, CK19, TTR, HNF3.beta., HNF1.alpha. and GATA4 mRNA,
but no CYP2B9 and CYP2B13 (mouse) or CYP2B1 (rat) mRNA (FIG. 10).
Following treatment of mMASC or rMASC with FGF4 and HGF, expression
of HNF3.beta. and GATA4 mRNA increased on d2, became maximal by d4,
decreasing slightly and leveling off by d14. mRNA for .alpha.FP,
and CK19 increased after d2, and became maximal by d4 and decreased
thereafter. TTR mRNA increased after d4, was maximal by d7 and
leveled off. CK18, Albumin, HNF1.alpha. and P450 enzyme mRNA
increased after d7 and was maximal on d14. Between d14 and d21,
FGF4 and HGF induced MASC expressed albumin, TTR, CK18, CYP2B9 and
CYP2B13 (mouse) and CYP2B1 (rat) mRNA.
[0229] Undifferentiated hMASC expressed low levels of albumin,
CK18, and CK19, CYP1B1, but not .alpha.FP (FIG. 10) and CYP2B6
mRNA. Levels of albumin, CK18, CK19, CYP1B1 mRNA increased
significantly in hMASC cultured with FGF4 alone or with FGF4 and
HGF for 14 days compared to day 0 (MASC) cultures. Levels of
albumin, CK18 and CYP1B1 mRNA continued to increase and were higher
on d28. Although, CYP1B1 is not a specific hepatocyte marker, its
upregulation suggests hepatocyte commitment and maturation. Low
levels of CYP2B6, 0.5% to 1.0% of fresh liver mRNA's could be seen
on d14 and d21 but not d0. mRNA levels of immature hepatocyte
markers (CK19 and .alpha.FP) decreased as differentiation
progressed and were higher in cultures induced with FGF4 alone,
whereas mRNA levels for mature hepatocytes (CK18 and albumin) were
higher in FGF4 and HGF-induced hMASC.
Western Blot Demonstrates that FGF4+HGF Induces Hepatocyte
Specification and Differentiation
[0230] Expression of hepatocyte-specific genes was also confirmed
by Western Blot and performed as described by Reyes et al. (2000).
Abs to .alpha.FP, human albumin, CK18 were diluted 1:1000 in
blocking buffer. Goat anti-.beta.-actin (1:1000) was from Santa
Cruz. Secondary Abs were HRP-linked goat anti-mouse and HRP-linked
donkey anti-goat (Amersham, Arlington Heights). ECL was performed
according to manufacturers instructions (Amersham).
Undifferentiated hMASC did not express CK18, albumin, or .alpha.FP
protein (FIG. 10B). After treatment for 35 days with FGF4 alone or
FGF4 and HGF, hMASC expressed albumin and CK18, but not aFP,
consistent with the histochemical analysis.
mMASC, rMASC and hMASC Acquire Hepatocyte Functional Activity
[0231] Five different assays were used to determine whether cells
with morphologic and phenotypic characteristics of hepatocytes also
had functional hepatocyte attributes.
[0232] Urea production and secretion by hepatocyte-like cells was
measured at various time points throughout differentiation. Urea
concentrations were determined by colorimetric assay (Sigma Cat.
640-1) per manufacturer's instructions. Rat hepatocytes grown in
monolayer and fetal mouse liver buds were used as positive
controls, and culture medium as negative control. The assay can
detect urea concentrations as low as 10 mg/ml. As the assay also
measures ammonia, samples were assessed before and after urease
addition.
[0233] No urea or ammonia was detected in culture medium alone.
Undifferentiated MASC did not produce urea. Following treatment
with FGF4 and HGF, urea production by MASC increased in a time
dependent manner. The time course for urea production in mouse and
rat cultures was similar. For hMASC treated with FGF4 and HGF, urea
was not detected on d4, was similar to mouse and rat cultures by
d12, and exceeded that in mouse or rat cultures on d21. Levels of
urea produced by MASC-derived hepatocytes were similar to that in
monolayer cultures of primary rat hepatocytes. For all three
species, significantly more urea was produced by cells
differentiated on Matrigel.TM. compared to FN.
[0234] Albumin production was measured at various time points
throughout the differentiation. Rat albumin concentrations were
determined by a competitive enzyme linked immunoassay (ELISA)
described previously (Tzanakakis E. S., et al., 2001; Wells J. M.
et al., 2000). Human and mouse albumin concentrations were
determined using a similar ELISA method with substitution of human
or mouse albumin and anti-human or anti-mouse albumin Abs for the
rat components where appropriate. Peroxidase conjugated
anti-human-albumin and reference human albumin were from Cappel.
Peroxidase conjugated and affinity purified anti-mouse albumin and
reference mouse albumin were from Bethyl Laboratories (Montgomery,
Tex.). To ensure specificity of the ELISA, human, mouse, and rat
Abs were incubated for 2 hrs at 37.degree. C. with 3% BSA in
distilled water (dH.sub.2O). ELISA's had a sensitivity of at least
1 ng/ml.
[0235] Undifferentiated MASC did not secrete albumin. Following
treatment with FGF4 and HGF, mMASC, rMASC and hMASC produced
albumin in a time dependent manner. As was seen for urea
production, MASC differentiated on Matrigel.TM. produced higher
amounts of albumin than when cultured on FN. Mouse, rat, and human
cells secreted similar levels of albumin, even though albumin was
not detected in human cultures on d3. Levels of albumin produced by
mouse, rat and human MASC-derived hepatocytes were similar to those
seen in monolayer cultures of primary rat hepatocytes.
[0236] Cytochrome P450 activity was next assessed in aggregates of
MASC-derived hepatocytes and primary rat liver hepatocyte spheroids
using the PROD assay. mMASC-hepatocyte aggregates were formed by
plating d14 FGF4 and HGF treated mMASC at 5.times.10.sup.4
cells/cm.sup.2 on non-tissue culture plates, which were placed on a
shaker at 10 revolutions per minute for 5 h. Cell aggregates were
transferred to Primaria.TM. dishes and allowed to compact for 4
days in the presence or absence of 1 mM phenobarbital.
hMASC-hepatocyte aggregates were formed by hanging drop method.
Briefly, 10.sup.3 hMASC treated for 24 days with FGF4 and HGF were
placed into 100 .mu.L drops with or without 1 mM phenobarbital.
After 4 days, aggregates were collected and cytochrome P450
activity assessed by PROD assay. Pentoxyresorufin (PROD) (Molecular
Probes, Eugene, Oreg.) is O-dealkylated by Cytochrome P450,
changing a non-fluorescent compound into a fluorescent compound,
resorufin (Tzanakakis E. S. et al., 2001). Fluorescence intensity
caused by PROD metabolism consequently estimates cytochrome P450
(CYP) activity. Assessment and detection of resorufin in situ was
performed using confocal microscopy as described (Tzanakakis E. S.
et al., 2001).
[0237] No PROD activity was seen in aggregates of undifferentiated
mMASC or hMASC. However, mMASC (18 days with FGF4 and HGF) and
hMASC (28 days, FGF4 alone) induced to form aggregates had
significant PROD activity. PROD activity in MASC-derived hepatocyte
aggregates was similar to that of primary rat hepatocyte
aggregates. A number of different cells have P450 activity, but
P450 activity up-regulation by phenobarbital is only seen in
hepatocytes. Therefore, P450 was also tested in the presence or
absence of phenobarbital. Without phenobarbital, several P450
enzymes partially participate in PROD metabolism giving an inflated
fluorescence value for those samples. In contrast, in the
phenobarbital induced aggregates, PROD activity is almost wholly
metabolized by mouse cytochromes Cyp2b9, Cyp2b10, and Cyp2b13, rat
cytochrome Cyp2b1/2 (Tzanakakis E. S. et al., 2001), and in human,
by CYP2B6. Therefore increased fluorescent activity is smaller than
the actual increase in the protein expression of the stated
cytochrome P450 enzymes. When aggregates were cultured for 96 hours
with phenobarbital, a 32% to 39% increase in PROD activity was
seen, suggesting presence of functional hepatocyte specific Cyp2b9,
Cyp2b10, and Cyp2b13 in mMASC and CYP2B6 in hMASC-derived
hepatocytes.
[0238] MASC-derived hepatocytes were also assessed for their
ability to take up LDL by incubating FGF4 treated hMASC with
LDL-dil-acil. Cells were co-labeled either with anti-CK18 or
anti-Pan-CK and HNF-313 or GATA4 Abs. After 7 days, low level
uptake of a-LDL was detected, which increased to become maximal on
d21.
[0239] Another metabolic function of hepatocytes is glycogen
production or gluconeogenesis. The levels of glycogen storage were
analyzed by periodic acid Schiff (PAS) staining of FGF4 and HGF
induced mouse MASC and FGF induced hMASC at d3, d7, d14, and d21.
For PAS, slides were oxidized in 1% periodic acid for 5' and rinsed
3 times in dH.sub.2O. Afterwards slides were treated with Schiffs
reagent for 15', rinsed in dH.sub.2O for 5-10', stained with
Mayer's hematoxylin for 1' and rinsed in dH.sub.2O. Glycogen
storage was first seen by d14 and maximum levels were seen after
d21 (FIG. 11).
Hepatocyte Isolation and Culture
[0240] Hepatocytes were harvested from 4-6 week old male
Sprague-Dawley rats as described (Seglen P. O., 1976). Hepatocyte
viability after the harvest ranged from 90-95%. Hepatocytes were
cultured as described (Tzanakakis E. S. et al., 2001; Tzanakakis E.
S. et al., 2001). To form a monolayer, hepatocytes were cultured on
35 mM Fischer culture plates (Fischer Scientific, Pittsburgh, Pa.)
coated with 8 .mu.g/cm.sup.2 collagen (Cohesion Technologies, Palo
Alto, Calif.). To form spheroids, hepatocytes were cultured on
35-mm Primaria.TM. dishes (Becton Dickinson). Under both
conditions, seeding density was 5.times.10.sup.4 cells/cm.sup.2. 12
h after initial plating, medium was changed to remove dead and
unattached cells. Medium was replaced every 48 hours
thereafter.
Summary
[0241] It has been shown that a single post-natal mouse, rat and
human BM-derived MASC can differentiate in vitro into an endodermal
cell type with hepatocyte phenotype and function. MASC, cultured
under hepatocyte differentiation conditions, expressed in a
time-dependent fashion primitive and mature hepatocyte markers,
shown by immunofluorescence microscopy of double and triple labeled
cells. The protein expression profile was hepatocyte specific and
not spurious, as non-hepatocyte markers were not co-expressed with
hepatocyte antigens. Results from immunohistochemistry were
confirmed by Western blot. In addition, RT-PCR corroborated
upregulation of the transcription factors HNF3.beta. and GATA4
known to be important in endoderm specification and transcription
factors required for subsequent hepatocyte differentiation, such as
HNF3.beta., and cytoplasmic proteins such as CK19, CK18, .alpha.FP
and albumin.
[0242] Although it was shown that FGF4 alone or both FGF4 and HGF
induced MASC into cells with morphological and phenotypic
characteristics of hepatocytes, this alone does not prove that
cells have differentiated into hepatocytes unless one can
demonstrate acquisition of functional characteristics of
hepatocytes. Therefore, several functional tests were done in
combination to identify functional hepatocytes. mMASC, rMASC or
hMASC produced urea and albumin, contained phenobarbital inducible
cytochrome P450 activity, could take up Dil-acil-LDL, and contained
glycogen granules. Although urea production is characteristic of
hepatocyte activity, kidney tubular epithelium also produces urea
(Hedlund E. et al., 2001). In contrast, albumin production is a
specific test for the presence and metabolic activity of
hepatocytes (Hedlund E. et al., 2001). Cytochrome P450, although
found in hepatocytes, is also present in many other cell types
(Jarukamjorn K. et al., 1999). However, Cyp2b1 activity in rat
(Tzanakakis E. S. et al., 2001), Cyp2b9 and Cyp2b13 in mouse
(Li-Masters T. et al., 2001; Zelko I. Et al., 2000), and CYP2B6 in
human is considered relatively hepatocyte specific. Presence of
these forms of P450 was shown by RT-PCR. The specificity for
hepatocytes is enhanced further when P450 activity is inducible by
phenobarbital (Rader D. J. et al., 2000), as shown. Although LDL
uptake is seen in hepatocytes (Oh S. H. et al., 2000), other cells
such as endothelium have a similar capability (Avital I. et al.,
2001). Finally, only hepatocytes can generate and store glycogen.
When taken together, these functional tests demonstrate that MASC
from mouse, rat or humans treated in vitro with FGF4 and HGF not
only express hepatocyte markers but also have functional
characteristics consistent with hepatocyte metabolic activities.
Several studies have shown that BM derived cells may differentiate
into hepatocyte-like cells in vivo and in vitro (Petersen B. E. et
al., 1999; Theise N. D. et al., 2000; Krause D. S. et al., 2001;
Pittenger M. F. et al., 1999; Wang S. et al., 2001; Lagasse E. et
al., 2000). However, most studies have not addressed the phenotype
of the BM cell that differentiates into cells with hepatocyte
phenotype. It is unknown whether the cells staining positive for
hepatocyte markers had functional characteristics of hepatocytes,
and whether cells that differentiate into hepatocytes can also
differentiate into mesodermal cells, such as hematopoietic cells.
Lagasse et al. demonstrated that
cKit.sup.+Thy.sub.1.sup.lowSca1.sup.+Lin.sup.+- cells present in
murine BM differentiate into cells with not only hepatocyte
phenotype but also hepatocyte function (Lagasse E. et al., 2000).
Even though such results could be seen when as few as 50 cells were
transplanted, this study did not prove that the same cell that
differentiates into hematopoietic cells also differentiates into
hepatocytes. Krause et al showed that a single cell can repopulate
the hematopoietic system and give rise to rare hepatocytes.
However, no functional assessment of the hepatocytes was done
(Krause D. S. et al., 2001). Avital et al recently published that
.beta..sub.2m.sup.-, Thy-1.sup.+ cells in mouse BM express albumin,
HNF4, C/EBP.alpha., and Cytochrome P450 3A2 mRNA and protein
(Wilmut I., et al., 1997), a phenotype of hepatocyte progenitors
usually found in the liver. Thus, presence of such hepatocyte
progenitor cells in BM could explain the in vivo differentiation of
bone marrow into hepatocytes noted in recent studies (Krause D. S.
et al., 2001; Lagasse E. et al., 2000).
[0243] To address the question whether cells giving rise to
functional hepatocyte-like cells also give rise to other cell
types, retroviral marking was used (Reyes M. et al., 2001; Jiang
Y., 2002). It has been recently shown that cells expressing
albumin, CK18 and HNF1.alpha. can be generated from the same mMASC
and rMASC that differentiate into cells with endothelial and
neuroectodermal phenotype (Jiang Y., 2002). It is confirmed that
similar results are seen for hMASC. Extending recently published
studies demonstrating derivation of cells with mesodermal and
neuroectodermal phenotype and function from single hMASC (Reyes M.,
2002), it is shown here that the same single hMASC also
differentiates into cells with hepatocyte morphology and phenotype.
Thus, it is demonstrated for the first time that MASC that do not
express hepatocyte markers and have no functional hepatocyte
activity exist in BM, which depending on the culture conditions,
acquire a hepatocyte phenotype and functional characteristics of
hepatocytes, or phenotypic and functional characteristics of
mesodermal and neuroectodermal cells.
Example 12
Transplantation of LacZ Transgenic MASC to Treat Hemophiliac
Mice
[0244] MASC were derived from ROSA26 mice containing the
.beta.-gal/NEO transgene (10.sup.6 cells/mouse) and were I.V.
injected into hemophiliac mice (N=5) without prior irradiation. The
animals were sacrificed at 1 (N=2) and 2 months (N=3) post-MASC
transplantation. Bone marrow cytospins and frozen sections of
liver, spleen, skeletal muscle, heart, lung and intestine were
stained for presence of .beta.-gal antigen using a FITC-conjugated
anti-.beta.-gal antibody and pan-cytokeratin or CD45. Tissues were
also analyzed by Q-PCR for the .beta.-gal gene as described in
Example 6.
[0245] Preliminary analysis indicates that one of the three animals
(M3) analyzed at 2 months post-injection had 0.1% of pulmonary
epithelial cells derived from the donor cells by
immunohistochemistry and Q-PCR. Immunohistochemistry also showed
that animal M5 had <1% engraftment of CD45.sup.+ donor cells in
the spleen, marrow and intestine. Tissues of the animal M4 had some
donor derived cells on immunohistochemistry; PCR data on this
animal is pending.
[0246] All publications, patents and patent applications are
incorporated herein by reference as though individually
incorporated by reference. While in the foregoing specification
this invention has been described in relation to certain preferred
embodiments thereof, and many details have been set forth for
purposes of illustration, it will be apparent to those skilled in
the art that the invention is susceptible to additional embodiments
and that certain of the details described herein may be varied
considerably without departing from the basic principles of the
invention.
REFERENCES
[0247] Adams, R. H., and Klein, R. (2000). Eph receptors and ephrin
ligands. Essential mediators of vascular development. Trends
Cardiovasc Med. 10:183-188. [0248] Alison, M., and Sarraf, C.
(1998). Hepatic stem cells. J Hepatol 29: 678-83. [0249] Alizadeh,
A. A., M. B. Eisen, R. E. Davis, C. Ma, I. S. Lossos, A. Rosenwald,
J. C. Boldrick, H. Sabet, T. Tran, X. Yu, J. I. Powell, L. Yang, G.
E. Marti, T. Moore, J. J. Hudson, L. LU. D. B. Lewis, R.
Tibshirani, G. Sherlock, W. C. Chan, T. C. Greiner, D. D.
Weisenburger, J. O. Armitage, R. Warnke, and L. M. Staudt. 2000.
Distinct types of diffuse large B-cell lymphoma identified by gene
expression profiling. Nature. 403:503-511. [0250] Anderson, C. M.,
and Swanson, R. A. (2000). Astrocyte glutamate transport: review of
properties, regulation, and physiological functions. Glia 31:1-14.
[0251] Anderson, D. J., Gage, F. H., and Weissman, I. L. (2001).
Can stem cells cross lineage boundaries? Nat. Med., 393-5. [0252]
Arsenijevic, Y., and Weiss, S. (1998). Insulin-like growth facor-I
is a differentiation factor for postmitotic CNS stem cell-derived
neuronal precursors: distinct actions from those of brain-derived
neurotrophic factor. J Neurosci 18:118-28. [0253] Asahara, T.,
Masuda, H., Takahashi, T., Kalka, C., Pastore, C., Silver; M.,
Kearne, M., Magner, M., and Isner, J. M. (1999). Bone marrow origin
of endothelial progenitor cells responsible for postnatal
vasculogenesis in physiological and pathological
neovascularization. Circ Res 85:221-8. [0254] Asahara, T.,
Murohara, T., Sullivan, A., Silver, M., van der Zee, R., Li, T.,
Witzenbichler, B., Schatteman, G., and Isner, J. (1997). Isolation
of putative progenitor endothelial cells for angiogenesis. Science
275, 964-967. [0255] Avital, I., Inderbitzin, D., Aoki, T., Tyan,
D. B., Cohen, A. H., Ferraresso, C., [0256] Baumhueter, S., Dybdal,
N., Kyle, C., and Lasky, L. (1994). Global vascular expression of
murine CD34 a sialomucin-like endothelial ligand for L-selectin.
Blood 84:2554. [0257] Ben-Shushan, E., Thompson, J. R., Gudas, L.
J., and Bergman, Y. (1998). Rex-1, a gene encoding a transcription
factor expressed in the early embryo, is regulated via Oct-3/4 and
Oct-6 binding to an octamer site and a novel protein, Rox-1,
binding to an adjacent site. Mol Cell Biol 18:1866-78. [0258]
Bierhuizen, M. F., Westerman, Y., Visser, T. P., Dimjati, W.,
Wognum, A. W., and Wagemaker, G. (1997). Enhanced green fluorescent
protein as selectable marker of retroviral-mediated gene transfer
in immature hematopoietic bone marrow cells. Blood 90:3304-15.
[0259] Bjorklund, A., and Lindvall, O. (2000). Cell replacement
therapies for central nervous system disorders. Nat Neurosci 3:
537-44. [0260] Bjornson, C., R. Rietze, B. Reynolds, M. Magli, and
A. Vescovi. (1999). Turning brain into blood: a hematopoietic fate
adopted by adult neural stem cells in vivo. Science. 283:354-357.
[0261] Blondel, O., Collin, C., McCarran, W. J., Zhu, S.,
Zamostiano, R., Gozes, I., Brenneman, D. E., and McKay, R. D.
(2000). A glia-derived signal regulating neuronal differentiation.
J. Neurosci. 20:8012-20. [0262] Bradley, A. (1987). Production and
analysis of chimaeric mice. In Teratocarcinomas and ES Cells: A
Practical Approach. E. J. Robertson, ed. Oxford: IRL Press,
113-151. [0263] Brazelton, T. R., Rossi, F. M. V., Keshet, G. I.,
and Blau, H. E. (2000). From Marrow to Brain: Expression of
Neuronal Phenotypes in Adult Mice. Science 290:1775-1779. [0264]
Bruder, S., et al., U.S. Pat. No. 5,736,396 [0265] Brustle, O.,
Jones, K., Learish, R., Karram, K., Choudhary, K., Wiestler, O.,
Duncan, I., and McKay, R. (1999). ES Cell-Derived Glial Precursors:
A Source of Myelinating Transplants. Science 285:754-6. [0266]
Brustle, O., Spiro, A. C., Karram, K., Choudhary, K., Okabe, S.,
and McKay, R. D. (1997). ES cells differentiate into
oligodendrocytes and myelinate in culture and after spinal cord
transplantation. Proc. Natl. Acad. Sci. USA 94:14809-14814. [0267]
Butler, D., (1999) FDA warns on primate xenotransplants. Nature
398:549. [0268] Caplan, A., et al., U.S. Pat. No. 5,486,359 [0269]
Caplan, A., et al., U.S. Pat. No. 5,811,094 [0270] Caplan, A., et
al., U.S. Pat. No. 5,837,539 [0271] Cassiede P., Dennis, J. E., Ma,
F., Caplan, A. I., (1996). Osteochondrogenic potential of marrow
mesenchymal progenitor cells exposed to TGF-beta 1 or PDGF-BB as
assayed in vivo and in vitro. J Bone Miner Res. 9:1264-73. [0272]
Cereghini, S. (1996). Liver-enriched transcription factors and
hepatocyte differentiation. FASEB J. 10:267-82. [0273] Choi, K.
(1998). Hemangioblast development and regulation. Biochem Cell
Biol. 76:947-956. [0274] Choi, K., M. Kennedy, A. Kazarov, J. C.
Papadimitriou, and G. Keller. (1998). A common precursor for
hematopoietic and endothelial cells. Development. 125:725-732.
[0275] Ciccolini, F., and Svendsen, C. N. (1998). Fibroblast growth
factor 2 (FGF-2) promotes acquisition of epidermal growth factor
(EGF) reponsiveness in mouse striata] precursor cells:
Identification of neural precursors responding to both EGF and
FGF-2. J Neuroscience 18:7869-7880. [0276] Clarke, D. L.,
Johansson, C. B., Wilbertz, J., Veress, B., Nilsson, E., Karlstrom,
H., Lendahl, U., and Frisen, J. (2000). Generalized potential of
adult NSCs. Science 288:1660-3. [0277] Conway, E. M., Collen, D.,
and Carmeliet, P. (2001). Molecular mechanisms of blood vessel
growth. Cardiovasc Res. 49:507-521. [0278] Corbeil, D., Roper, K.,
Hellwig, A., Tavian, M., Miraglia, S, Watt, S. M., Simmons, P. J.,
Peault, B., Buck, D. W., and Huttner, W. B. (2000). The human AC
133 HSC antigen is also expressed in epithelial cells and targeted
to plasma membrane protrusions. J Biol Chem. 275:5512-5530. [0279]
Crosby, H. A., Kelly, D. A., and Strain, A. J. 2001. Human hepatic
stem-like cells isolated using c-kit or CD34 can differentiate into
biliary epithelium. Gastroenterology. 120:534-544. [0280] Daadi, M.
M., and Weiss, S. (1999). Generation of tyrosine
hydroxylase-producing neurons from precursors of the embryonic and
adult forebrain. J Neurosci. 19:4484-97. [0281] Dahlstrand, J.,
Lardelli, M., and Lendahl, U. (1995). Nestin mRNA expression
correlates with the central nervous system progenitor cell state in
many, but not all, regions of developing central nervous system.
Brain Res Dev Brain Res. 84:109-29. [0282] Devon R. S., Porteous D.
J., and J., B. A. (1995). Splink-erettes improved vectorettes for
greater efficiency in PCR walking. Nucleic Acids Res 23:1644-1645.
[0283] DiGuisto, et al., U.S. Pat. No. 5,681,599 [0284] Doetsch,
F., Caille, I., Lim, D. A., Garcia-Verdugo, J. M., and
Alvarez-Buylla, A. (1999). Subventricular zone astrocytes are NSCs
in the adult mammalian brain. Cell 97:703-716. [0285] Eliceiri, B.
P., and Cheresh, D. A. (2000). Role of alpha v integrins during
angiogenesis. Cancer J Sci Am. 6, Suppl 13:S245-249. [0286] Evans,
et al., (1992). J. Am. Med. Assoc., 267:239-246. [0287] Faloon, P.,
Arentson, E., Kazarov, A., Deng, C. X., Porcher, C., Orkin, S., and
Choi, K. (2000). Basic fibroblast growth factor positively
regulates hematopoietic development. Development. 127:1931-1941.
[0288] Fei, R., et al., U.S. Pat. No. 5,635,387 [0289] Ferrari, G.,
Cusella-De Angelis, G., Coletta, M., Paolucci, E., Stornaiuolo, A.,
Cossu, G., and Mavilio, F. (1998). Muscle regeneration by bone
marrow-derived myogenic progenitors. Science 279:528-30. [0290]
Flax, J. D., Sanjay, A., Yang, C., Simonin, C., Wills, A. M.,
Billinghurst, L. L., Jendoubi, M., Sidman, R. L., Wolfe, J. H.,
Kim, S. E., and Snyder, E. Y. (1998). Engraftable human NSCs
respond to developmental cues replace neurons and express foreign
genes. Nature Biotech 16:1033-1038. [0291] Fong, G. H., Zhang, L.,
Bryce, D. M., and Peng, J. (1999). Increased hemangioblast
commitment, not vascular disorganization, is the primary defect in
flt-1 knock-out mice. Development. 126:3015-3025. [0292] Franco Del
Arno, F., Gendron-Maguire, M., Swiatek, P. J., and Gridley, T.
(1993). Cloning, sequencing and expression of the mouse mammalian
achaete-scute homolog a (MASH 1). Biochem Biophys Acta 1171:323-7.
[0293] Frankel, M. S. (2000). In Search of Stem Cell Policy.
Science 298:1397. [0294] Fridenshtein; A. (1982). Stromal bone
marrow cells and the hematopoietic microenvironment. Arkh Patol
44:3-11. [0295] Furcht et al. International Application No.
PCT/US00/21387. [0296] Gage, F. H. (2000). Mammalian NSCs. Science
287:1433-1438. [0297] Gage, F., Coates, P., Palmer, T., Kuhn, H.,
Fisher, L., Suhonen, J., Peterson, D., Suhr, S., and Ray, J.
(1995). Survival and differentiation of adult neuronal progenitor
cells transplanted to the adult brain. Proc Natl Acad Sci USA
92:11879-83. [0298] Gehling, U. M., Ergun, S., Schumacher, U.,
Wagener, C., Pantel, K., Otte, M., Schuch, G., Schathausen, P.,
Mende, T., Kilic, N., Kluge, K., Schafer, B., Hossfeld, D. K. and
Fiedler, W. (2000). In vitro differentiation of endothelial cells
from AC 133-positive progenitor cells. Blood. 95:3106-3112. [0299]
Gritti, A., Frolichsthal-Schoeller, P., Galli, R., Parati, E. A.,
Cova, L., Pagano, S. F., Bjornson, C. R., and Vescovi, A. L.
(1999). Epidermal and fibroblast growth factors behave as mitogenic
regulators for a single multipotent stem cell-like population from
the subventricular region of the adult mouse forebrain. J Neurosci.
19:3287-97. [0300] Gronthos, S., Graves, S., Ohta, S., and Simmons,
P. (1994). The STRO-1+ fraction of adult human bone marrow contains
the osteogenic precursors. Blood 84: 4164-73. [0301] Guenechea, G.,
Gan, O., Dorrell, C., and Dick, J. E. (2001). Distinct classes of
human stem cells that differ in proliferative and self-renewal
potential. Nat Immunol 2:75-82. [0302] Gussoni, E., Soneoka, Y.,
Strickland, C., Buzney, E., Khan, M., Flint, A., Kunkel, L., and
Mulligan, R. (1999). Dystrophin expression in the mdx mouse
restored by stem cell transplantation. Nature 401:390-4. [0303]
Hamazaki, T., liboshi, Y., Oka, M., Papst, P. J., Meacham, A. M.,
Zon, L. I., and Terada, N. 2001. Hepatic maturation in
differentiating embryonic stem cells in vitro. FEBS Lett 497:15-19.
[0304] Haralabopoulos, G. C., D. S. Grant, H. K. Kleinman, and M.
E. Maragoudakis. (1997). Thrombin promotes endothelial cell
alignment in Matrigel in vitro and angiogenesis in vivo. Am J
Physiol. 273:C239-245. [0305] Hedlund, E., Gustafsson, J. A., and
Warner, M. (2001). Cytochrome P450 in the brain; a review. Curr
Drug Metab 2:245-263. [0306] Hill, B., Rozler, E., Travis, M.,
Chen, S., Zannetino, A., Simmons, P., Galy, A., Chen, B., Hoffman,
R. (1996). High-level expression of a novel epitope of CD59
identifies a subset of CD34+ bone marrow cells highly enriched for
pluripotent stem cells. Exp Hematol. 8:936-43. [0307] Hirashima,
M., H. Kataoka, S, Nishikawa, N. Matsuyoshi, and S. Nishikawa.
(1999). Maturation of ES cells into endothelial cells in an in
vitro model of vasculogenesis. Blood. 93:1253-1263. [0308] Holash,
J., Maisonpierre, P. C., Compton, D., Boland, P., Alexander, C. R.,
Zagzag, D., Yancopoulos, G. D., and Wiegand, S. J. (1999). Vessel
cooption, regression, and growth in tumors mediated by
angiopoietins and VEGF. Science. 284:994-998. [0309] Hu, Z.,
Evarts, R. P., Fujio, K., Marsden, E. R., and Thorgeirsson, S. S.
(1993). Expression of hepatocyte growth factor and c-met genes
during hepatic differentiation and liver development in the rat. Am
J Pathol. 142:1823-30. [0310] Iyer, V. R., Eisen, M. B., Ross, D.
T., Schuler, G., Moore, T., Lee, J. C. F., Trent, J. M., Staudt, L.
M., Hudson, J. J., Boguski, M. S., Lashkari, D., Shalon, D.,
Botstein, D., and Brown, P. O. (1999). The transcriptional program
in the response of human fibroblasts to serum. Science. 283:83-87.
[0311] Jackson, K., Majka, S. M., Wang, H., Pocius, J., Hartley,
C., Majesky, M. W., Entman, M. L., Michael, L., Hirschi, K. K., and
M. A., G. (2001). Regeneration of ischemic cardiac muscle and
vascular endothelium by adult stem cells. J Clin Invest
107:1395-1402. [0312] Jackson, K., Mi, T., and Goodell, M. A.
(1999). Hematopoietic potential of stem cells isolated from murine
skeletal muscle. Proc Natl Acad Sci USA 96:14482-6. [0313] Jaiswal,
N., et al., (1997). J. Cell Biochem. 64(2):295-312. [0314]
Jarukamjorn, K., Sakuma, T., Miyaura, J., and Nemoto, N. (1999).
Different regulation of the expression of mouse hepatic cytochrome
P450 2B enzymes by glucocorticoid and phenobarbital. Arch Biochem
Biophys 369:89-99. [0315] Jiang, Y. 2002. Submitted. [0316]
Johansson, C. B., Momma, S., Clarke, D. L., Risling, M., Lendahl,
U., and Frisen, J. (1999). Identification of a NSC in the adult
mammalian central nervous system. Cell. 96:25-34. [0317] Johnstone,
B., Hering, T. M., Caplan, A. I., Goldgberg, V. M., Yoo, J. U.
(1998). In vitro chondrogenesis of bone marrow-derived mesenchymal
progenitor cells. Exp Cell Res. 1:265-72. [0318] Jordan, C. T., and
Van Zant, G. (1998). Recent progress in identifying genes
regulating HSC function and fate. Curr Opin Cell Biol. 10:716-20.
[0319] Jordan, C., McKearn, J., and Lemischka, I. (1990). Cellular
and developmental properties of fetal HSCs. Cell 61:953-963. [0320]
Kim, T. H., Mars, W. M., Stolz, D. B., Petersen, B. E., and
Michalopoulos, G. K. (1997). Extracellular matrix remodeling at the
early stages of liver regeneration in the rat. Hepatology
26:896-904. [0321] Kopen, G., D. Prockop, and D. Phinney. 1999.
Marrow stromal cells migrate throughout forebrain and cerebellum,
and they differentiate into astrocytes after injection into
neonatal mouse brains. Proc Natl Acad Sci USA. 96:10711-10716.
[0322] Kourembanas, S., Morita, T., Christou, H., Liu, Y., Koike,
H., Brodsky, D., Arthur, V., and Mitsial, S. A. (1998). Hypoxic
responses of vascular cells. Chest. 11 (Suppl 1):25S-28S. [0323]
Krause, D. S., Theise, N. D., Collector, M. I., Henegariu, O.,
Hwang, S., Gardner, R., Neutzel, S., and Sharkis, S. I. (2001).
Multi-organ, multi-lineage engraftment by a single bone
marrow-derived stem cell. Cell 105:369-77. [0324] Lagasse, E.,
Connors, H., AI-Dhalimy, M., Reitsma, M., Dohse, M., Osborne, L.,
Wang, X., Finegold, M., Weissman, I. L., and Grompe, M. (2000).
Purified hematopoietic stem cells can differentiate into
hepatocytes in vivo. Nat Med. 6:1229-1234. [0325] Larsson, J.,
Goumans, M. J., Sjostrand, L. J., van Rooijen, M. A., Ward, D.,
Leveen, P., Xu, X., ten Dijke, P., Mummery, C. L., and Karlsson, S.
(2001). Abnormal angiogenesis but intact hematopoietic potential in
TGF-beta type I receptor-deficient mice. EMBO J. 20:1663-1673.
[0326] Lazar, A., Peshwa, M. V., Wu, F. J., Chi, C. M., Cerra, F.
B., and Hu, W. S. (1995). Formation of porcine hepatocyte spheroids
for use in a bioartificial liver. Cell Transplant 4:259-68. [0327]
Lee, S. H., Lumelsky, N., Studer, L., Auerbach, J. M., and McKay,
R. D. (2000). Efficient generation of midbrain and hindbrain
neurons from mouse ES cells. Nat Biotechnol 18:675-9. [0328] Lewis,
I. D., Almeida-Porada, G., Du, J., Lemischka, I. R., Moore, K. A.,
Zanjani, E. D., and Verfaillie, C. M. (2001). Long-term
repopulating cord blood stem cells are preserved after ex-vivo
culture in a non-contact system.
Blood 97:441-9. [0329] Li, C. X., and Poznansky, M. J. (1990).
Characterization of the ZO-1 protein in endothelial and other cell
lines. J Cell Sci. 2:231-7. 97:231-237. [0330] Li-Masters, T., and
Morgan, E. T. 2001. Effects of bacterial lipopolysaccharide on
Phenobarbital-induced CYP2B expression in mice. Drug Metab Dispos
29:252-257. [0331] Lin, Y., Weisdorf, D. J., Solovey, A., and
Hebbel, R. P. (2000). Origins of circulating endothelial cells and
endothelial outgrowth from blood. J Clin Inves.t 105:71-7. [0332]
Liu, S., Qu, Y., Stewart, T. J., Howard, M. J., Chakrabortty, S.,
Holekamp, T. F., and McDonald, J. W. (2000). ES cells differentiate
into oligodendrocytes and myelinate in culture and after spinal
cord transplantation. Proc Natl Acad Sci USA 97:6126-31. [0333]
Mahley, R. W., and Ji, Z. S. (1999). Remnant lipoprotein
metabolism: key pathways involving cell-surface heparan sulfate
proteoglycans and apolipoprotein E. J. Lipid Res 40:1-16. [0334]
Martin, G. R. (1981). Isolation of a pluripotent cell line from
early mouse embryos cultured in medium conditioned by
teratocaracinoma stem cells. Proc Natl Acad Sci U.S.A. 12:7634-8.
[0335] Masinovsky, B., U.S. Pat. No. 5,837,670 [0336] Mathon, N.
F., Malcolm, D. S., Harrisingh, M. C., Cheng, L., and Lloyd, A. C.
(2001). Lack of Replicative Senescence in Normal Rodent Glia.
Science 291:872-875. [0337] McGlave, et al., U.S. Pat. No.
5,460,964 [0338] Meager, A. (1999). Cytokine regulation of cellular
adhesion molecule expression in inflammation. Cytokine Growth
Factor Rev. 10:27-39. [0339] Medvinsky, A., and Dzierzak, E.
(1996). Definitive hematopoiesis is autonomously initiated by the
AGM region. Cell. 86:897. [0340] Melton, D. (1997). Signals for
tissue induction and organ formation in vertebrate embryos. Harvey
Lect 93:49-64. [0341] Mezey, E., Chandross, K. J., Harta, G., Maki,
R. A., and McKercher, S. R. (2000). Turning Blood into Brain: Cells
Bearing Neuronal Antigens Generated in vivo from Bone Marrow.
Science 290:1779-1782. [0342] Miyajima, A., Kinoshita, T., Tanaka,
M., Kamiya, A., Mukouyama, Y., arid Hara, T. (2000). Role of
Oncostatin M in hematopoiesis and liver development. Cytokine
Growth Factor Rev 11:177-183. [0343] Morrison, S. J., White, P. M.,
Zock, C., and Anderson, D. J. (1999). Prospective identification
isolation by flow cytometry and in vivo self-renewal of multipotent
mammalian neural crest stem cells. Cell. 96:737-749. [0344]
Nichols, J., Zevnik, B., Anastassiadis, K., Niwa, H.,
Klewe-Nebenius, D., Chambers, I., Scholer, H., and Smith, A.
(1998). Formation of pluripotent stem cells in the mammalian embryo
depends on the POU transcription factor Oct 4. Cell 95:379-91.
[0345] Nishikawa, S., Nishikawa, S., Hirashima, M., Matsuyoshi, N.,
and Kodama, H. (1998). Progressive lineage analysis by cell sorting
and culture identifies FLKI+VEcadherin+ cells at a diverging point
of endothelial and hemopoietic lineages. Development.
125:1747-1757. [0346] Nishikawa, S. I., Nishikawa, S., Kawamoto,
H., Yoshida, H., Kizumoto, M., Kataoka, H. and Katsura, Y. (1998).
In vitro generation of lymphohematopoietic cells from endothelial
cells purified from murine embryos. Immunity. 8:761-769. [0347]
Niwa, H., Miyazaki, J., and Smith, A. G. (2000). Quantitative
expression of Oct-3/4 defines differentiation, dedifferentiation or
self-renewal of ES cells. Nat Genet. 24:372-6. [0348] Nolta, J.,
Dao, M., Wells, S., Smogorzewska, E., and Kohn, D. (1996).
Transduction of pluripotent human HSCs demonstrated by clonal
analysis after engraftment in immune-deficient mice. Proc Natl Acad
Sci USA 93:2414-9. [0349] Odorico, J. S., Kaufman, D. S., and
Thomson, J. A. (2001). Multilineage differentiation from human ES
cell lines. Stem Cells 19:193-204. [0350] Oh, S. H., Miyazaki, M.,
Kouchi, H., Inoue, Y., Sakaguchi, M., Tsuji, T., Shima, N.,
Higashio, K., and Namba, M. (2000). Hepatocyte growth factor
induces differentiation of adult rat bone marrow cells into a
hepatocyte lineage in vitro. Biochem Biophys Res Commun
279:500-504. [0351] Okabe, S., Forsberg-Nilsson, K., Spiro, A. C.,
Segal, M., and McKay, -R. D. (1996). Development of neuronal
precursor cells and functional postmitotic neurons from ES cells in
vitro. Mech Dev 59:89-102. [0352] O'Leary, D. D., and Wilkinson, D.
G. (1999). Eph receptors and ephrins in neural development. Cuff
Opin Neurobiol 9:65-73. [0353] Orkin, S. (1998). Embryonic stem
cells and transgenic mice in the study of hematopoiesis. Int. J.
Dev. Biol. 42:927-34. [0354] Orlic, D., Kajstura, J., Chimenti, S.,
Jakoniuk, I., Anderson, S. M., Li, B., Pickel, J., McKay, R.,
Nadal-Ginard, B., Bodine, D. M., Leri, A., and Anversa, P. (2001).
Bone marrow cells regenerate infarcted myocardium. Nature
410:701-5. [0355] O'Shea, K. (1999). ES cell models of development.
Anat Rec 15:32-41. [0356] Palmer, T. D., Markakis, E. A.,
Willhoite, A. R., Safar, F., and Gage, F. H. (1999). Fibroblast
growth factor-2 activates a latent neurogenic program in NSCs from
diverse regions of the adult CNS. J Neurosci 19:8487-97. [0357]
Palmer, T. D., Takahashi, J., and Gage, F. H. (1997). The adult rat
hippocampus contains primordial NSCs. Mol Cell Neurosci 8:389-404.
[0358] Partanen, J., and D. J. Dumont. (1999). Functions of Tie1
and Tie2 receptor tyrosine kinases in vascular development. Curr
Top Microbiol Immunol. 237:159-172. [0359] Peault, B. 1996.
Hematopoiedc stem cell emergence in embryonic life: developmental
hematology revisited. J. Hematother. 5:369. [0360] Peichev, M.,
Naiyer, A. J., Pereira, D., Zhu, Z., Lane, W. J., Williams, M., Oz,
M. C., Hicklin, D. J., Witte, L., Moore, M. A., and Rafii, S.
(2000). Expression of VEGFR 2 and AC133 by circulating human
CD34(+) cells identifies a population of functional endothelial
precursors. Blood. 95:952-958. [0361] Peshwa M V, W U F J, Follstad
B D, Cerra, F. B., and flu, W. S. 1994. Kinetics of hepatocyte
spheroid formation. Biotechnology Progress 10:460-466. [0362]
Petersen, B. E., Bowen, W. C., Patrene, K. D., Mars, W. M.,
Sullivan, A. K., Murase, N., Boggs, S. S., Greenberger, J. S., and
Goff, J. P. (1999). Bone marrow as a potential source of hepatic
oval cells. Science 284:1168-1170. [0363] Petersen, B. E. 2001.
Hepatic "stem" cells: coming full circle. Blood Cells Mol Dis
27:590-600. [0364] Petersen, B. E., Bowen, W. C., Patrene, K. D.,
Mars, W. M., Sullivan, A. K., Murase, N., Boggs, S. S.,
Greenberger, J. S., and Goff, J. P. 1999. Bone marrow as a
potential source of hepatic oval cells. Science 284:1168-1170.
[0365] Petzelbauer, P., Halama, T., and Groger, M. (2000).
Endothelial adherens junctions. JInvestig Dermatol Symp Proc.
5:10-13. [0366] Pittenger, M. F., Mackay, A. M., Beck, S. C.,
Jaiswal, R. K., Douglas, R., Mosca, J. D., Moorman, M. A.,
Simonetti, D. W., Craig, S., and Marshak, D. R. (1999).
Multilineage potential of adult human MSCs. Science 284:143-147.
[0367] Pittenger, M., U.S. Pat. No. 5,827,740 [0368] Ploemacher, R.
E., and Brons, N. H. (1988). Isolation of hemopoietic stem cell
subsets from murine bone marrow: I. Radioprotective ability of
purified cell suspensions differing in the proportion of day-7 and
day-12 CFU-S. Exp Hematol 16:21-6. [0369] Potten, C. (1998). Stem
cells in gastrointestinal epithelium: numbers, characteristics and
death. Philos Trans R Soc Lond B Biol Sci 353:821-30. [0370]
Prochazka, M., H. R. Gaskins, L. D. Shultz, and E. H. Leiter.
(1992). The nonobese diabetic scid mouse: model for spontaneous
thymomagenesis associated with immunodeficiency. Proc Natl Acad Sci
USA. 89:3290-3294. [0371] Rader, D. J., and Dugi, K. A. (2000). The
endothelium and lipoproteins: insights from recent cell biology and
animal studies. Semin Thromb Hemost 26:521-528. [0372] Rafii, S.,
F. Shapiro, J. Rimarachin, R. Nachman, B. Ferris, B. Weksler, M.
Moore, arid A. Asch. (1994). Isolation and characterization of
human bone marrow microvascular endothelial cells: hematopoietic
progenitor cell adhesion. Blood. 84:10-20. [0373] Rafii, S.,
Shapiro, F., Pettengell, R., Ferris, B., Nachman, R., Moore, M.,
and Asch, A. (1995). Human bone marrow microvascular endothelial
cells support long-term proliferation and differentiation of
myeloid and megakaryocytic progenitors. Blood 86:3353-61. [0374]
Reinhardt, R. L., Khoruts, A., Merica, R., Zell, T., and Jenkins,
M. K. (2001). Visualizing the generation of memory CD4 T cells in
the whole body. Nature 401:101-105. [0375] Reubinoff, B. E., Pera,
M. F., Fong, C. Y., Trounson, A., and Bongso, A. (2000). ES cell
lines from human blastocysts: somatic differentiation in vitro. Nat
Biotech 18:399-404. [0376] Reyes, M., and Verfaillie, C. M. (2001).
Characterization of multipotent adult progenitor cells, a
subpopulation of mesenchymal stem cells. Ann N Y Acad Sci
938:231-233; discussion 233-235. [0377] Reyes, M., Lund, T.,
Lenvik, T., Aguiar, D., Koodie, L., and Verfaillie, C. M. (2001).
Purification and ex vivo expansion of postnatal human marrow
mesodermal progenitor cells. Blood. 98:2615-2625. [0378] Reynolds,
B., and Weiss, S. (1992). Generation of neurons and astrocytes from
isolated cells of the adult mammalian central nervous system.
Science 255:1707-10. [0379] Reynolds, B., and Weiss, S. (1996).
Clonal and population analyses demonstrate that an EGF-responsive
mammalian embryonic CNS precursor is a stem cell. Dev Biol 175:1-13
[0380] Ribatti, D., A. Vacca, B. Nico, L. Roncali, and F. Dammacco.
(2001). Postnatal vasculogenesis. Mech Dev. 100:157-163. [0381]
Richards, L. J., Kilpatrick, T. J., and Bartlett, P. F. (1992). De
novo generation of neuronal cells from the adult mouse brain. Proc
Natl Acad Sci USA. 89:8591-5. [0382] Rideout, W. M., 3rd, Wakayama,
T., Wutz, A., Eggan, K., Jackson-Grusby, L., Dausman, J.,
Yanagimachi, R., and Jaenisch, R. (2000). Generation of mice from
wild-type and targeted ES cells by nuclear cloning. Nat Genet.
24:109-10. [0383] Robertson, S. M., Kennedy, M., Shannon, J. M.,
Keller, G. (2000). A transitional stage in the commitment of
mesoderm to hematopoiesis requiring the transcription factor
SCL/tal-1. Development. 11:2447-59. [0384] Rosenberg, J. B., P. A.
Foster, R. J. Kaufman, E. A. Vokac, M. Moussalli, P. A. Kroner, and
R. R. Montgomery. (1998). Intracellular trafficking of factor VIII
to von Willebrand factor storage granules. J Clin Invest.
101:613-624. [0385] Rozga, J., Arnaout, W. S., and Demetriou, A. A.
(2001). Isolation, characterization, -derived hepatocyte stem
cells. Biochem Biophys Res Commun 288:156-164. [0386] Ryder, E. F.,
Snyder, E. Y., and Cepko, C. L. (1990). Establishment and
characterization of multipotent neural cell lines using retrovirus
vector-mediated oncogene transfer. J Neurobiol 21:356-375. [0387]
Sah, D. W., Ray, J., and Gage, F. H. (1997). Regulation of voltage-
and ligand-gated currents in rat hippocampal progenitor cells in
vitro. J Neurobiol 32:95-110. [0388] Sanchez-Ramos, J., Song, S.,
Cardozo-Pelaez, F., Hazzi, C., Stedeford, T., Willing, A., Freeman,
T. B., Saporta, S., Janssen, W., Patel, N., Cooper, D. R., and
Sanberg, P. R. (2000). Adult bone marrow stromal cells
differentiate into neural cells in vitro. Exp Neurol. 164:247-56.
[0389] Saucedo-Cardenas, O., Quintana-Hau, J. D., Le, W. D., Smidt,
M. P., Cox, J. J., De Mayo, F., Burbach, J. P., and Conneely, O. M.
(1998). Nurrl is essential for the induction of the dopaminergic
phenotype and the survival of ventral mesencephalic late
dopaminergic precursor neurons. Proc Natl Acad Sci USA 95: 4013-8.
[0390] Scherf, U., D. T. Ross, M. Waltham, L. H. Smith, J. K. Lee,
L. Tanabe, K. W. Kohn, W. C. Reinhold, T. G. Myers, D. T. Andrews,
D. A. Scudiero, M. B. Eisen, E. A. Sausville, Y. Pommier, D.
Botstein, P. O. Brown, and J. N. Weinstein. (2000). A gene
expression database for the molecular phafmacology of cancer. Nat.
Biotech. 24:236-244. [0391] Scholer, H. R., Hatzopoulos, A. K.,
Balling, R., Suzuki, N., and Gruss, P. (1989). A family of
octamer-specific proteins present during mouse embryogenesis:
evidence for germline-specific expression of an Oct factor. EMBO J.
8:2543-50. [0392] Schuldiner, M., Yanuka, O., Itskovitz-Eldor, J.,
Melton, D. A., and Benvenisty, N. (2000). From the cover: effects
of eight growth factors on the differentiation of cells derived
from human ES cells. Proc Natl Acad Sci USA 97:11307-12. [0393]
Schwartz, et al., U.S. Pat. No. 759,793 [0394] Seglen, P. O.
(1976). Preparation of isolated rat liver cells. Methods Cell Biol
13:29-83. [0395] Shamblott, M., Axelman, J., Wang, S., Bugg, E.,
Littlefield, J., Donovan, P., Blumenthal, P., Huggins, G.,
Gearhart, J.: (1998) Derivation of pluripotent stem cells from
cultured human primordial germ cells. Proc. Natl. Acad. Sci. U.S.A.
95:13726-31. [0396] Shen, C. N., Slack, J. M., and Tosh, D. (2000).
Molecular basis of transdifferentiation of pancreas to liver. Nat
Cell Biol. 2:879-887. [0397] Shi, Q., S. Rafii, M. Hong-De Wu, E.
S. Wijelath, C. Yu, A. Ishida, Y. Fujita, S. Kothari, R. Mohle, L.
R. Sauvage, M. A. S. Moore, R. F. Storb, and W. P. Hammond. (1998).
Evidence for circulating bone marrow-derived endothelial cells.
Blood. 92:362-367.
[0398] Shih, C. C., Y. Weng, A. Mamelak, T. LeBon, M. C. Hu, and S.
Forman. (2001). Identification of a candidate human
neurohematopoietic stem-cell population. Blood. 98:2412-2422.
[0399] Simeone, A. (1998). Otx1 and Otx2 in the development and
evolution of the mammalian brain. EMBO 117:6790-8. [0400] Simmons,
P., et al., U.S. Pat. No. 5,677,136 [0401] Soule H D, et al. (1973)
A human cell line from a pleural effusion derived from a breast
carcinoma. J Natl Cancer Inst; 51(5):1409-16. [0402] Southern, P.
J., Blount, P., and Oldstone, M. B. (1984). Analysis of persistent
virus infections by in situ hybridization to whole-mouse sections.
Nature 312:555-8. [0403] Steeber, D. A., and T. Tedder, F. (2001).
Adhesion molecule cascades direct lymphocyte recirculation and
leukocyte migration during inflammation. Immunol Res. 22:299-317.
[0404] Steinberg, D., Pittman, R. C. and Carew, T. E. (1985).
Mechanisms involved in the uptake and degradation of low density
lipoprotein by the artery wall in vivo. Ann N Y Acad. Sci.
454:195-206. [0405] Studer, L., Spenger, C., Seiler, R., Othberg,
A., Lindvall, O., and Odin, P. (1996). Effects of brain-derived
neurotrophic factor on neuronal structure of dopaminergic neurons
in dissociated cultures of human fetal mesencephalon. Exp Brain Res
108:328-36. [0406] Suhonen, J., Peterson, D., Ray, J., and Gage, F.
(1996). Differentiation of adult hippocampus-derived progenitors
into olfactory neurons in vivo. Nature 383:624-7. [0407] Svendsen,
C. N., and Caldwell, M. A. (2000). NSCs in the developing central
nervous system: implications for cell therapy through
transplantation. Prog Brain Res. 127:13-34. [0408] Svendsen, C. N.,
Caldwell, M. A., Ostenfeld, T. (1999). Human neural stem cells:
Isolation, expansion and transplantation. Brain Path 9:499-513.
[0409] Tang, D. G., Tokumoto, Y. M., Apperly, J. A., Lloyd, A. C.,
and Raff, M. C. (2001). Lack of replicative senescence in cultured
rat oligodendrocyte precursor cells. Science 291:868-71. [0410]
Tedder, T., Steeber, D., Chen, A., and Engel, P. (1995). The
selections: vascular adhesion molecules. FASEB J. 9:866. [0411]
Theise, N. D., Badve, S., Saxena, R., Henegariu, O., Sell, S.,
Crawford, J. M., and Krause, D. S. (2000). Derivation of
hepatocytes from bone marrow cells in mice after radiation-induced
myeloablation. Hepatology 31:235-40. [0412] Theise, N. D., Saxena,
R., Portmann, B. C., Thung, S. N., Yee, H., Chiriboga, L., Kumar,
A., and Crawford, J. M. (1999). The canals of Hering and hepatic
stem cells in humans. Hepatology 30:1425-1433. [0413] Thomson, J.
A., Itskovitz-Eldor, J., Shapiro, S. S., Waknitz, M. A., Swiergiel,
J. J., Marshall, V. S., and Jones, J. M. (1998). ES cell lines
derived from human blastocysts. Science 282:114-7. [0414] Thomson,
J., Kalisman J., Golos, J., Durning, M., Harris, C., Becker, R.,
Hearn, J. (1995) Isolation of a primate embryonic stem cell line.
Proc. Natl. Acad. Sci. U.S.A. 92:7844-8, [0415] Trupp, M., Arenas,
E., Fainzilber, M., Nilsson, A. S., Sieber, B. A., Grigoriou, M.,
Kilkenny, C., Salazar-Grueso, E., Pachnis, V., and Arumae, U.
(1996). Functional receptor for GDNF encoded by the c-ret
proto-oncogene. Nature 381:785-9. [0416] Tsai, R. Y. and McKay, R.
D. (2000). Cell contact regulates fate choice by cortical stem
cells. J. Neurosci. 20:3725-35. [0417] Tsukamoto, et al., U.S. Pat.
No. 5,750,397 [0418] Tsukamoto, et al., U.S. Pat. No. 5,716,827
[0419] Tzanakakis, E. S., Hansen, L. K., and Hu, W. S. (2001). The
role of actin filaments and microtubules in hepatocyte spheroid
self-assembly. Cell Motil Cytoskeleton 48:175-189. [0420]
Tzanakakis, E. S., Hsiao, C. C., Matsushita, T., Remmel, R. P., and
Hu, W. S. (2001). Probing enhanced cytochrome P450 2B1/2 activity
in rat hepatocyte spheroids through confocal laser scanning
microscopy. Cell Transplant. 10:329342. [0421] Uchida, N., Buck, D.
W., He, D., Reitsma, M. J., Masek, M., Phan, T. V., Tsukamoto, A.
S., Gage, F. H., and Weissman, I. L. (2000). Direct isolation of
human central nervous system stem cells. Proc Natl Acad Sci USA.
97:14720-14725. [0422] Van Rijen, H., van Kempen, M. J., Analbers,
L. J., Rook, M. B., van Ginneken, A. C., Gros, D., and Jongsma, H.
J. (1997). Gap junctions in human umbilical cord endothelial cells
contain multiple connexins. Am J Physiol. 272:C117-130. [0423]
Verfullie, C., Miller, W., Boylan, K., McGlave, P. (1992).
Selection of benign primitive hematopoietic progenitors in chronic
myelogenous leukemia on the basis of HLA-DR antigen expression.
Blood. 79:1003-1010. [0424] Vescovi, A. L., Paraati, E. A., Gritti,
A., Poulin, P., Ferrario, M., Wanke, E., Frolichsthal-Schoeller,
P., Cova, L., Arcellana-Panlilio, M., Colombo, A., and Galli, R.
(1999). Isolation and cloning of multipotential stem cells from the
embryonic human CNS and establishment of transplantable human NSC
lines by epigenetic stimulation. Exp Neurol 156:71-83. [0425]
Vescovi, A., Reynolds, B., Fraser, D., and Weiss, S. (1993). bFGF
regulates the proliferative fate of unipotent (neuronal) and
bipotent (neuronal/astroglial) EGF-generated CNS progenitor cells.
Neuron 11: 951-66. [0426] Vischer, U. M., H. Barth, and C. B.
Wollheim. (2000). Regulated von Willebrand factor secretion is
associated with agonist-specific patterns of cytoskeletal
remodeling in cultured endothelial cells. Arterioscler Thromb Vasc
Biol. 20:883-891. [0427] Wagner, D. D., Olmsted, J. B., and Marder,
V. J. (1982). Immunolocalization of von Willebrand protein in
Weibel-Palade bodies of human endothelial cell's. J. Cell Biol.
95:355-360. [0428] Wagner, J., Akerud, P., Castro, D. S., Holm, P.
C., Canals, J. M., Snyder, E. Y., Perlmann, T., and Arenas, E.
(1999). Induction of a midbrain dopaminergic phenotype in
Nurrl-overexpressing NSCs by type 1 astrocytes. Nat Biotech
17:653-9. [0429] Wakitani, S., Saito, T., and Caplan, A. (1995).
Myogenic cells derived from rat bone marrow MSCs exposed to
5-azacytidine. Muscle Nerve 18:1417-26. [0430] Wang, X.,
AI-Dhalimy, M., Lagasse, E., Finegold, M., and Grompe, M. (2001).
Liver repopulation and correction of metabolic liver disease by
transplanted adult mouse pancreatic cells. Am J Pathol 158:571-579.
[0431] Watt, F. (1997). Epidermal stem cells: markers patterning
and the control of stem cell fate. Philos Trans R Soc Lond B Biol
Sci 353: 831-6. [0432] Watt, S., Gschmeissner, S., and Bates, P.
(1995). PECAM-1: its expression and function as a cell adhesion
molecule on hemopoietic and endothelial cells. Leuk Lymph. 17:229.
[0433] Weiss, M. J., Orkin, S. H. (1995) GATA transcription
factors: key regulators of hematopoiesis. Exp Hematol. 2:99-107.
[0434] Weissman, I. L. (2000). Translating stem and progenitor cell
biology to the clinic: barriers and opportunities. Science
287:1442-6. [0435] Wells, J. M., and Melton, D. A. (2000). Early
mouse endoderm is patterned by soluble factors from adjacent germ
layers. Development. 127:1563-72. [0436] Wells, J. M., and Melton,
D. A. (1999). Vertebrate endoderm development. Annu Rev Cell Dev
Biol 15:393-410. [0437] Whittemore, S. R., Morassutti, D. J.,
Walters, W. M., Liu, R. H., and Magnuson, D. S. (1999). Mitogen and
substrate differentially affect the lineage restriction of adult
rat subventricular zone neural precursor cell populations. Exp Cell
Res 252:75-95. [0438] Williams, R. L., Hilton, D. J., Pease, S.,
Willson, T. A., Stewart, C. If, Gearing, D. P., Wagner, E. F.,
Metcalf, D., Nicola, N. A., and Gough, N. M. (1988). Myeloid
leukemia inhibitory factor maintains the developmental potential of
ES cells. Nature 336:684-7. [0439] Wilmut, I., Schnieke, A. E.,
McWhir, J., Kind, A. J., and Campbell, K. H. (1997). Viable
offspring derived from fetal and adult mammalian cells. Nature
385:810-3. [0440] Woodbury, D., Schwarz, E. J., Prockop, D. J., and
Black, I. B. (2000). Adult rat and human bone marrow stromal cells
differentiate into neurons. J Neurosci Res 15:364-70. [0441]
Yamashita, J., Itoh, H., Hirashima, M., Ogawa, M., Nishikawa, S.,
Yurugi, T., Naito, M., Nakao, K., and Nishikawa, S. (2000).
Flk1-positive cells derived from ES cells serve as vascular
progenitors. Nature. 408:92-96. [0442] Yang, J., Nagavarapu, U.,
Relloma, K., Sjaastad, M. D., Moss, W. C., Passaniti, A., and
Herron, G. S. (2001). Telomerized human microvasculature is
functional in vivo. Nat. Biotechnol. 19:219-224. [0443] Ye, W.,
Shimamura, K., Rubenstein, J., Hynes, M., and Rosenthal, A. (1998).
FGF and Shh signals control dopaminergic and serotonergic cell fate
in the anterior neural plate. Cell 93:755-66. [0444] Yoneya, T.,
Tahara, T., Nagao, K., Yamada, Y., Yamamoto, T., Osawa, M.,
Miyatani, S., and Nishikawa, M. (2001). Molecular cloning of
delta-4, a new mouse and human Notch ligand. J. Biochem. 129:27-34.
[0445] Yoo, J. U., Barthel, T. S., Nishimura, K., Solchaga, L.,
Caplan, A. I., Goldberg, V. M., Johnstone, B. (1998). Then
chondrogenic potential of human bone-marrow-derived mesenchymal
progenitor cells. J Bone Joint Surg Am. 12:1745-57. [0446] Young,
H., et al., U.S. Pat. No. 5,827,735 [0447] Zambrowicz, B. P.,
Imamoto, A., Hering, S., Herzenberg, L. A., Kerr, W. G., and
Soriano, P. (1997). Disruption of overlapping transcripts in the
ROSA beta geo 26 gene trap strain leads to widespread expression of
beta-galactosidase in mouse embryos and hematopoietic cells. Proc
Natl Acad Sci USA. 94:3789-94. [0448] Zaret, K. S. (2000). Liver
specification and early morphogenesis. Mech Dev 92:83-88. [0449]
Zaret, K. S. (2001). Hepatocyte differentiation: from the endoderm
and beyond. Curr Opin Genet Dev. 11:568-574. [0450] Zelko, I., and
Negishi, M. (2000). Phenobarbital-elicited activation of nuclear
receptor CAR in induction of cytochrome P450 genes. Biochem Biophys
Res Commun. 277:1-6. [0451] Zhao, R. C. H., Jiang, Y., and
Verfaillie, C. M. (2000). A model of human p210BCW''BL mediated CML
by transducing primary normal human CD34+ cells with a BCR/ABL
containing retroviral vector. Blood. 97:2406-12. [0452] Ziegler,
B., M. Valtieri, G. Porada, R. De Maria, R. Muller, B. Masella, M.
Gabbianelli, I. Casella, E. Pelosi, T. Bock, E. Zanjani, and C.
Peschle. (1999). KDR Receptor: A Key Marker Defining HSCs. Science.
285:1553 1558.
Sequence CWU 1
1
75119DNAArtificial Sequenceprimer 1tggattgcac gcaggttct
19219DNAArtificial Sequenceprimer 2ttcgcttggt ggtcgaatg
19320DNAArtificial Sequenceprimer 3gaagcgtttc tccctggatt
20419DNAArtificial Sequenceprimer 4gtgtaggatt gggtgcgtt
19522DNAArtificial Sequenceprimer 5gaagcgttct ccctggaatt tc
22620DNAArtificial Sequenceprimer 6gtgtaggatt gggtgcgttt
20722DNAArtificial Sequenceprimer 7gctgttcgca aagactcgct ac
22824DNAArtificial Sequenceprimer 8atggctctgg cactgatacg gatg
24925DNAArtificial Sequenceprimer 9ccatgaccta tactcaggct tcagg
251026DNAArtificial Sequenceprimer 10gaagctccat atccctgggt ggaaag
261120DNAArtificial Sequenceprimer 11ggagtgtcgc ttagaggtgc
201220DNAArtificial Sequenceprimer 12tccagaaagc caagagaagc
201345DNAArtificial Sequenceprimer 13tagcggccgc ttgaattcga
acgcgagact actgtgactc acact 451439DNAArtificial Sequenceprimer
14atttatattc tagtttattt gtgtttgggg cagacgagg 391540DNAArtificial
Sequenceprimer 15tcctgtctca ttcaagccac atcagttaca tctgcatttt
4016167DNAArtificial Sequencerat flanking sequence 16gatccttggg
agggtctcct cagattgatt gactgcccac ctcgggggtc tttcaaagta 60actccaaaag
aagaatgggt tgttagttat taaacggttc ttagtaaagt tttggttttg
120ggaatcacag taacaactca catcacaact ccaatcgttc cgtgaaa
1671787DNAArtificial Sequencemouse flanking sequence 17gatccttggg
agggtctcct cagattgatt gactgcccat aagttataag ctggcatgac 60tgtgttgcta
aggacactgg tgaaagc 871835DNAArtificial Sequencesplinkerette linker
sequence 18aatttagcgg ccgcttgaat ttttttttgc aaaaa
351944DNAArtificial Sequencesplinkerette linker sequence
19agtgtgagtc acagtagtct cgcgttcgaa ttaagcggcc gcta
442062DNAArtificial SequenceeGFP gene sequence 20ggccagtgaa
ttgtaatacg actcactata ggctggcaca tggtcctgct ggagttcgtg 60ac
622127DNAArtificial Sequencesplinkerette primer sequence
21agtgtgagtc acagtagtct cgcgttc 272222DNAArtificial Sequenceprimer
22ccaataaacc ctcttgcagt tg 222320DNAArtificial Sequenceprimer
23tcctgccacc agaaataacc 202422DNAArtificial Sequenceprimer
24ggagggtctc ctctgagtga tt 222522DNAArtificial Sequenceprimer
25cagtggccag atctcatctc ac 222622DNAArtificial Sequenceprimer
26ggagggtctc ctctgagtga tt 222720DNAArtificial Sequenceprimer
27gcagacgagg taggcacttg 202825DNAArtificial Sequenceprimer
28ttctaagctg agccagctgc agacg 252925DNAArtificial Sequenceprimer
29gctgaggttc tccggctctt tcaga 253018DNAArtificial Sequenceprimer
30ccaacatagg atcagatg 183118DNAArtificial Sequenceprimer
31actggagcag ctactacg 183222DNAArtificial Sequenceprimer
32aggcattaca tacaggctca cc 223322DNAArtificial Sequenceprimer
33ctgtggcctc tatcacaaga tg 223422DNAArtificial Sequenceprimer
34tggtactctc ctcaatctgc tg 223522DNAArtificial Sequenceprimer
35ctctggattg actgtggaag tg 223622DNAArtificial Sequenceprimer
36catggttctt cttcaggtag gc 223721DNAArtificial Sequenceprimer
37gctgcagatg acttcagaac c 213822DNAArtificial Sequenceprimer
38tcaactgtca gagcagagaa gc 223922DNAArtificial Sequenceprimer
39agactgcctt gtgtggaaga ct 224022DNAArtificial Sequenceprimer
40gtgaaacaga cttcctggtc ct 224122DNAArtificial Sequenceprimer
41gccctacaga ccatgaaaca ag 224220DNAArtificial Sequenceprimer
42tctctcaatt ctgggggttg 204320DNAArtificial Sequenceprimer
43tttcacagcc aacgactctg 204420DNAArtificial Sequenceprimer
44gatgatgttg gctgtgatgc 204520DNAArtificial Sequenceprimer
45ctggccacca tgaaagagtt 204622DNAArtificial Sequenceprimer
46ctgcatcagt gtatggcatt tt 224722DNAArtificial Sequenceprimer
47tttgctggaa ctgagactac ca 224824DNAArtificial Sequenceprimer
48tgcagccaaa gtgaagaggg aaga 244924DNAArtificial Sequenceprimer
49catagcgagc agcccaaaga agaa 245024DNAArtificial Sequenceprimer
50tgcttgaatg tgctgatgac aggg 245125DNAArtificial Sequenceprimer
51aaggcaagtc agcaggcatc tcatc 255220DNAArtificial Sequenceprimer
52atggccgagc agaaccggaa 205320DNAArtificial Sequenceprimer
53ccatgagccg ctggtactcc 205422DNAArtificial Sequenceprimer
54tggtactctc ctcaatctgc tg 225521DNAArtificial Sequenceprimer
55ctctggattg actgtggaag t 215624DNAArtificial Sequenceprimer
56gagaacgtac cggccactat cact 245726DNAArtificial Sequenceprimer
57gttaggccac ttcagtgggt catgat 265820DNAArtificial Sequenceprimer
58gatcacacca tatccccgga 205920DNAArtificial Sequenceprimer
59caccctacca cccatgaccg 206021DNAArtificial Sequenceprimer
60agctgctcct ccatcatcag a 216129DNAArtificial Sequenceprimer
61tgttccaagc attaagtttt ctattctaa 296224DNAArtificial
Sequenceprimer 62cctactcgta catctcgctc atca 246319DNAArtificial
Sequenceprimer 63cgctcagcgt cagcatctt 196419DNAArtificial
Sequenceprimer 64gccctggact ccagcaact 196520DNAArtificial
Sequenceprimer 65actttgccat ccacgacctt 206621DNAArtificial
Sequenceprimer 66accatgcaga acctgaacga t 216720DNAArtificial
Sequenceprimer 67cacctccagc tcgccattag 206824DNAArtificial
Sequenceprimer 68ctgggagtgt gcagatatca gagt 246924DNAArtificial
Sequenceprimer 69gagaaggtca ccaagtgctg tagt 247022DNAArtificial
Sequenceprimer 70gtcctttctt cctcctggag at 227122DNAArtificial
Sequenceprimer 71ctgtcactgc tgatttctct gg 227222DNAArtificial
Sequenceprimer 72cagcagtggt gctgtaggag ta 227322DNAArtificial
Sequenceprimer 73gggtagaact ggacaccaaa tc 227421DNAArtificial
Sequenceprimer 74gagttcttct ctgggttcct g 217521DNAArtificial
Sequenceprimer 75actgtgggtc atggagagct g 21
* * * * *