U.S. patent application number 13/059710 was filed with the patent office on 2011-07-21 for material for treatment of cerebral infarction and brain tissue regeneration method.
Invention is credited to Misako Nakashima, Masahiko Sugiyama.
Application Number | 20110177041 13/059710 |
Document ID | / |
Family ID | 41707282 |
Filed Date | 2011-07-21 |
United States Patent
Application |
20110177041 |
Kind Code |
A1 |
Nakashima; Misako ; et
al. |
July 21, 2011 |
MATERIAL FOR TREATMENT OF CEREBRAL INFARCTION AND BRAIN TISSUE
REGENERATION METHOD
Abstract
Disclosed is a therapeutic material for cerebral infarction,
which can recover a vascular disorder in an area affected by
cerebral infarction to improve the brain function. The therapeutic
material for cerebral infarction includes a dental pulp stem cell
comprising at least one member selected from a CD105-positive cell,
an SP cell, a CD24-positive cell, a CD133-positive cell, a
CD271-positive cell and a CD150-positive cell. The therapeutic
material may additionally include a protein secreted from a dental
pulp cell. A transplanted dental pulp stem cell cannot be
differentiated directly into a neural progenitor cell or a
neurocyte, but is involved indirectly in the promotion of
differentiation to eliminate an area affected by cerebral
infarction, thereby recovering the affected area into a normal
area.
Inventors: |
Nakashima; Misako; (Aichi,
JP) ; Sugiyama; Masahiko; (Aichi, JP) |
Family ID: |
41707282 |
Appl. No.: |
13/059710 |
Filed: |
August 21, 2009 |
PCT Filed: |
August 21, 2009 |
PCT NO: |
PCT/JP2009/065024 |
371 Date: |
March 14, 2011 |
Current U.S.
Class: |
424/93.7 |
Current CPC
Class: |
A61P 25/28 20180101;
A61P 9/10 20180101; A61K 35/32 20130101; A61L 27/3834 20130101;
A61L 27/3878 20130101; A61P 25/00 20180101; A61P 9/00 20180101;
A61P 43/00 20180101 |
Class at
Publication: |
424/93.7 |
International
Class: |
A61K 35/12 20060101
A61K035/12; A61P 25/00 20060101 A61P025/00 |
Foreign Application Data
Date |
Code |
Application Number |
Aug 22, 2008 |
JP |
2008-214205 |
Claims
1. A material for treatment of cerebral infarction comprising at
least any one of: a dental pulp stem cell comprising at least one
of a CD105-positive cell, a CD24-positive cell, a CD271-positive
cell, and a CD150-positive cell; and a secretory protein of the
dental pulp stem cell.
2. A material for treatment of cerebral infarction comprising at
least one of: a dental pulp stem cell comprising at least one of a
CD105-positive SP cell, a CD24-positive SP cell, a CD271-positive
SP cell, and a CD150-positive SP cell; and a secretory protein of
the dental pulp stem cell.
3. The material for treatment of cerebral infarction according to
claim 1, wherein the dental pulp stem cell expresses a factor
comprising at least one of a cell migration factor, a cell growth
factor, an angiogenic factor, and a neurotrophic factor in a
peri-infarct region of the brain.
4. The material for treatment of cerebral infarction according to
claim 3, wherein the cell migration factor is at least one of SDF1,
GCSF, MMP3, Slit, and GMCSF.
5. The material for treatment of cerebral infarction according to
claim 3, wherein the neurotrophic factor is at least one of VEGF,
NGF, GDNF, BDNF, LIF, MYC, Neurotrophine 3, TP53, and BAX.
6. The material for treatment of cerebral infarction according to
claim 3, wherein the cell growth factor is at least one of bFGF and
PDGF.
7. The material for treatment of cerebral infarction according to
claim 3, wherein the angiogenic factor is at least one of PGF,
CXCL1, CXCL2, CXCL3, CXCL5, CXCL10, ANPEP, NRP1, TGF.beta., ECGF1,
ID1, and CSF3.
8. The material for treatment of cerebral infarction according to
claim 1, wherein the dental pulp stem cell has a concentration of
1.times.10.sup.5 cells/.mu.l to 1.times.10.sup.7 cells/.mu.l.
9. The material for treatment of cerebral infarction according to
claim 1, wherein the dental pulp stem cell is a dental pulp stem
cell derived from a permanent tooth or a deciduous tooth.
10. A brain tissue regeneration method comprising injecting at
least one of: a dental pulp stem cell comprising at least one of a
CD105-positive cell, a CD24-positive cell, a CD271-positive cell,
and a CD150-positive cell; and a secretory protein of the dental
pulp stem cell, into the brain striatum after cerebral infarction,
thereby regenerating the central nervous tissue of the brain to
recover brain function.
11. (canceled)
12. The brain tissue regeneration method according to claim 10,
wherein the dental pulp stem cell expresses a factor comprising at
least one of a cell migration factor, a cell growth factor, an
angiogenic factor, and a neurotrophic factor in a peri-infarct
region of the brain.
13. The brain tissue regeneration method according to claim 10,
wherein the dental pulp stem cell has a concentration of
1.times.10.sup.5 cells/.mu.l to 1.times.10.sup.7 cells/.mu.l.
14. The brain tissue regeneration method according to claim 10,
wherein the dental pulp stem cell is a dental pulp stem cell
derived from a permanent tooth or a deciduous tooth.
Description
TECHNICAL FIELD
[0001] The present invention relates to a material for treatment of
cerebral infarction and to a brain tissue regeneration method using
the material for treatment of cerebral infarction.
BACKGROUND ART
[0002] Cerebral angiopathy is the second leading cause of death in
Japan and is responsible for the greatest cause of being
bed-ridden, while not causing death. Therefore, the aging society
is in urgent need of development of therapy appropriate for
cerebral angiopathy.
[0003] Among cerebral angiopathies, ischemic cerebrovascular
disease such as cerebral infarction or cerebral thrombosis occurs
with the highest frequency. Mortality due to cerebral infarction is
greater than the total mortality due to myocardial infarction and
ischemic heart disease.
[0004] If the cause of paralysis is cerebral infarction, current
treatment is thought to be effective within 3 hours after
development, at present.
[0005] In addition, rtPa (recombinant tissue plasminogen activator)
intravenous drip treatment can be expected to have recanalization
effect and offers functional recovery of up to approximately 30% of
damaged brain function.
[0006] However, the rtPa intravenous drip treatment has the
disadvantage that it is used in only approximately 2% of cases due
to adverse reactions of intracerebral hemorrhage.
[0007] Moreover, thrombolytic therapy using catheters has been
approved by the Ministry of Health, Labour and Welfare of Japan.
However, under the present circumstances, no drug used in this
therapy is covered by national health insurance.
[0008] In the adult brain, the region where new neurons are
produced is thought to be located in the lateral subventricular
zone and in the granular cell layers of the hippocampal dentate
gyrus.
[0009] In addition, new neurons formed after cerebral infarction
are derived from the lateral subventricular zone. These neurons
migrate to the parenchyma of the corpus striatum to form chain-like
cell aggregates, which in turn differentiate into nerves of the
corpus striatum and form synapses.
[0010] Moreover, blood vessels are thought to participate in the
control of neural progenitor cell differentiation and influence
induced nerve regeneration in the corpus striatum.
[0011] The development of therapy based on regenerative medicine
has been pursued for cerebral infarction, and preclinical
experiments using rat or mouse models of cerebral infarction have
been practiced.
[0012] Stem cells derived from bone marrow, peripheral blood,
adipose, or umbilical cord blood, or the like are used as
transplanted cells. Embryonic neural stem cells or ES cells, or the
like are also used. These cells are injected into the brain or
veins.
[0013] As a result, these cells may directly differentiate into
nerves, thereby decreasing cerebral infarction regions, restoring
brain function, or may promote angiogenesis in pen-infarct
areas.
[0014] For example, Patent Document 1 discloses a method for
efficiently inducing in vitro or in vivo the growth of neural stem
cells that are important for, for example, the treatment of nerve
injury sites caused by cerebral infarction.
[0015] In addition, for example, Patent Document 2 discloses
pharmaceuticals for cerebral infarction regions comprising
mesenchymal stem cells and IGF-1 in combination.
[0016] However, these techniques have a difficulty in offering
efficient functional recovery in cerebral infarction regions. Thus,
an effective approach for ameliorating angiopathy at a cerebral
infarction region and improving brain function has been demanded.
[0017] Patent Document 1: Japanese Patent Laid-Open No. 2007-130026
[0018] Patent Document 2: Japanese Patent Laid-Open No.
2007-014780
DISCLOSURE OF THE INVENTION
Problems to be solved by the Invention
[0019] The present invention has been completed in consideration of
the problems described above, and an object of the present
invention is to provide a material for treatment of cerebral
infarction that effectively ameliorates angiopathy at a cerebral
infarction region and improves brain function, and to provide a
brain tissue regeneration method using the material for treatment
of cerebral infarction.
Means for Solving the Problems
[0020] To attain the object, a material for treatment of cerebral
infarction according to the first aspect of this invention includes
at least one of: a dental pulp stem cell comprising at least one of
a CD105-positive cell, a SP cell, a CD24-positive cell, a
CD133-positive cell, a CD271-positive cell, and a CD150-positive
cell; and secretory proteins of the dental pulp stem cells.
[0021] It is preferred that the SP cell be CD31-negative,
CD105-positive, CD24-positive, CD133-positive, CD271-positive, or
CD150-positive.
[0022] It is preferred that the dental pulp stem cell express some
factors including at least one of a cell migration factors, cell
growth factors, angiogenic factors, and neurotrophic factors in a
peri-infarct area of the brain.
[0023] It is preferred that the cell migration factors are at least
one of SDF1, GCSF, MMP3, Slit, and GMCSF.
[0024] It is preferred that the neurotrophic factors are at least
one of VEGF, NGF, GDNF, BDNF, LIF, MYC, Neurotrophine 3, TP53, and
BAX.
[0025] It is preferred that the cell growth factors are at least
one of bFGF and PDGF.
[0026] It is preferred that the angiogenic factors are at least one
of PGF, CXCL1, CXCL2, CXCL3, CXCL5, CXCL10, ANPEP, NRP1, TGF.beta.,
ECGF1, ID1, and CSF3.
[0027] It is preferred that the dental pulp stem cells have a
concentration of 1.times.10.sup.5 cells/.mu.l to 1.times.10.sup.7
cells/.mu.l.
[0028] It is preferred that the dental pulp stem cells are stem
cells derived from a permanent tooth or a deciduous tooth.
[0029] Moreover, to attain the object, a brain tissue regeneration
method according to the second aspect of this invention includes
injecting at least one of: a dental pulp stem cell including at
least one of a CD105-positive cell, a SP cell, a CD24-positive
cell, a CD133-positive cell, a CD271-positive cell, and a
CD150-positive cell; and secretory proteins of the dental pulp stem
cells, into the brain striatum after cerebral infarction, thereby
regenerating the central nervous tissue of the brain to recover
brain function.
[0030] It is preferred that the SP cells are CD31-negative,
CD105-positive, CD24-positive, CD133-positive, CD271-positive, or
CD150-positive.
[0031] It is preferred that the dental pulp stem cells express a
factor including at least one of a cell migration factor, a cell
growth factor, an angiogenic factor, and a neurotrophic factor in a
peri-infarct area of the brain.
[0032] It is preferred that the dental pulp stem cell have a
concentration of 1.times.10.sup.5 cells/.mu.l to
1.times.10.sup.7
[0033] It is preferred that the dental pulp stem cell are stem
cells derived from a permanent tooth or a deciduous tooth.
Advantageous Effects of the Invention
[0034] A material for treatment of cerebral infarction and a brain
tissue regeneration method according to the present invention are
an unprecedented, original, and novel material for treatment of
cerebral infarction and brain tissue regeneration method. The
material for treatment of cerebral infarction and the brain tissue
regeneration method according to the present invention effectively
ameliorate angiopathy at a cerebral infarction region and improve
brain function. As a result, the symptoms of cerebral disorder such
as stroke can be improved effectively. Thus, they make a great
contribution to saving lives in an aging society and offer
immeasurable benefits.
BRIEF DESCRIPTION OF THE DRAWINGS
[0035] FIG. 1A illustrates cell transplantation to the brain
striatum;
[0036] FIG. 1B is a macro image of a cross-section of the
brain;
[0037] FIG. 2A is a confocal scanning laser microscopic image of a
DCX-immunofluorescently stained frozen sections of a peri-infarct
area of the brain on day 21 from the transplantation of porcine
dental pulp tissue-derived CD31-negative SP cells 24 hours after
cerebral infarction;
[0038] FIG. 2B is a confocal scanning laser microscopic image of a
DCX-immunofluorescently stained frozen section of a normal brain
region located on the contralateral side of the cerebral infarction
region;
[0039] FIG. 2C is a confocal scanning laser microscopic image of a
DCX-immunofluorescently stained non-cell-transplanted PBS control
of a peri-infarct area of the brain;
[0040] FIG. 3A is a confocal scanning laser microscopic image of a
neurofilament-immunofluorescently stained frozen section of a
peri-infarct area of the brain on day 21 from the transplantation
of porcine dental pulp tissue-derived CD31-negative SP cells 24
hours after cerebral infarction;
[0041] FIG. 3B is a confocal scanning laser microscopic image of a
neurofilament-immunofluorescently stained frozen section of a
normal brain region located on the contralateral side of the
cerebral infarction region;
[0042] FIG. 3C is a confocal scanning laser microscopic image of a
neurofilament-immunofluorescently stained non-cell-transplanted PBS
control of a peri-infarct area of the brain;
[0043] FIG. 4A is a confocal scanning laser microscopic image of a
NeuN-immunofluorescently stained frozen section of a peri-infarct
area of the brain on day 21 from the transplantation of porcine
dental pulp tissue-derived CD31-negative SP cells 24 hours after
cerebral infarction;
[0044] FIG. 4B is a confocal scanning laser microscopic image of a
NeuN-immunofluorescently stained frozen section of a normal brain
region located on the contralateral side of the cerebral infarction
region;
[0045] FIG. 4C is a confocal scanning laser microscopic image of a
NeuN-immunofluorescently stained non-cell-transplanted PBS control
of a peri-infarct area of the brain;
[0046] FIG. 5 shows results of statistically analyzing the density
of neural progenitor cells on day 21 from the transplantation of
porcine dental pulp tissue-derived CD31-negative SP cells 24 hours
after cerebral infarction;
[0047] FIG. 6 shows results of statistically analyzing the density
of neural cells on day 21 from the transplantation of porcine
dental pulp tissue-derived CD31-negative SP cells 24 hours after
cerebral infarction;
[0048] FIG. 7A shows the expression of VEGF mRNA at a cerebral
infarction region transplanted with porcine dental pulp
tissue-derived CD31-negative SP cells;
[0049] FIG. 7B shows the expression of GDNF mRNA at a cerebral
infarction region transplanted with porcine dental pulp
tissue-derived CD31-negative SP cells;
[0050] FIG. 7C shows the expression of BDNF mRNA at a cerebral
infarction region transplanted with porcine dental pulp
tissue-derived CD31-negative SP cells;
[0051] FIG. 7D shows the expression of NGF mRNA at a cerebral
infarction region transplanted with porcine dental pulp
tissue-derived CD31-negative SP cells;
[0052] FIG. 8A shows an increase of the expression of VEGF mRNA
caused by transplanted cells migrated to a peri-infarct area of the
brain after the transplantation of porcine dental pulp
tissue-derived CD31-negative SP cells;
[0053] FIG. 8B shows results of real-time RT-PCR;
[0054] FIG. 9 shows the migratory effect of a culture conditioned
medium of porcine dental pulp tissue-derived CD31-negative SP cells
on neural progenitor cells;
[0055] FIG. 10 shows the proliferative effect of a culture
conditioned medium of porcine dental pulp tissue-derived
CD31-negative SP cells on neural progenitor cells;
[0056] FIG. 11 shows the anti-apoptotic effect of a culture
conditioned medium of porcine dental pulp tissue-derived
CD31-negative SP cells on neural progenitor cells;
[0057] FIG. 12 shows results of determining over time and
statistically analyzing the motor disability scores of rats with
cerebral infarction into which porcine dental pulp tissue-derived
CD31-negative SP cells were transplanted;
[0058] FIG. 13 shows results of determining over time and
statistically analyzing the motor disability scores of rats with
cerebral infarction into which porcine dental pulp tissue-derived
CD31-negative SP cells, porcine bone marrow tissue-derived
CD31-negative SP cells, and porcine adipose tissue-derived
CD31-negative SP cells, were transplanted respectively;
[0059] FIG. 14A shows the induction of differentiation of human
dental pulp tissue-derived CD105.sup.+ cells into blood
vessels;
[0060] FIG. 14B shows the induction of differentiation of human
dental pulp tissue-derived CD105.sup.+ cells into adipose
cells;
[0061] FIG. 14C shows results of a control without the induction of
differentiation into adipose cells;
[0062] FIG. 14D shows results of determining the induction of
differentiation into adipose cells by real-time RT-PCR;
[0063] FIG. 14E shows the induction of differentiation of human
dental pulp tissue-derived CD105.sup.+ cells into odontoblasts;
[0064] FIG. 14F shows results of a control without the induction of
differentiation into odontoblasts;
[0065] FIG. 14G shows results of determining the induction of
differentiation into odontoblasts by real-time RT-PCR;
[0066] FIG. 15A shows the neurosphere formation of human dental
pulp tissue-derived CD105.sup.+ cells;
[0067] FIG. 15B shows the neural differentiation potency of human
dental pulp tissue-derived CD105.sup.+ cells;
[0068] FIG. 15C shows the neurosphere formation of human dental
pulp tissue-derived CD31.sup.-/CD146.sup.-SP cells;
[0069] FIG. 15D shows the neural differentiation potency of human
dental pulp tissue-derived CD31.sup.-/CD146.sup.- SP cells;
[0070] FIG. 16 illustrates the migration effects of culture
supernatants of human dental pulp tissue-derived CD105.sup.+ cells
and human dental pulp tissue-derived CD31.sup.-/CD146.sup.- SP
cells on neural progenitor cells;
[0071] FIG. 17 illustrates the growth effects of culture
supernatants of human dental pulp tissue-derived CD105.sup.+ cells
and human dental pulp tissue-derived CD31.sup.-/CD146.sup.- SP
cells on neural progenitor cells;
[0072] FIG. 18 shows the apoptosis inhibitory effects of human
dental pulp tissue-derived CD105.sup.+ cells and human dental pulp
tissue-derived CD31.sup.-/CD146.sup.- SP cells on neural progenitor
cells;
[0073] FIG. 19 shows results of statistically analyzing the density
of DCX-immunostained neural progenitor cells in a peri-infarct area
of the brain on day 21 from the cell transplantation of human
dental pulp tissue-derived CD105.sup.+ cells into the corpus
striatum in the brain tissues 24 hours after cerebral
infarction;
[0074] FIG. 20 shows results of statistically analyzing the density
of NeuN-immunofluorescently stained neural cells in a peri-infarct
area of the brain on day 21 from the cell transplantation of human
dental pulp tissue-derived CD105.sup.+ cells into the corpus
striatum in the brain tissues 24 hours after cerebral
infarction;
[0075] FIG. 21 shows results of statistically analyzing the density
of DCX-immunostained neural progenitor cells in a peri-infarct area
of the brain on day 21 from the cell transplantation of human
dental pulp tissue-derived CD105.sup.+ cells and human dental pulp
tissue-derived CD31.sup.-/CD146.sup.- SP cells into the corpus
striatum in the brain tissues 24 hours after cerebral
infarction;
[0076] FIG. 22 shows results of statistically analyzing the density
of NeuN-immuno stained neural cells in a peri-infarct area of the
brain on day 21 from the cell transplantation of human dental pulp
tissue-derived CD105.sup.+ cells and human dental pulp
tissue-derived CD31.sup.-/CD146.sup.- SP cells into the corpus
striatum in the brain tissues 24 hours after cerebral infarction;
and
[0077] FIG. 23 shows results of determining over time and
statistically analyzing the motor disability scores of rats with
cerebral infarction transplanted with human dental pulp
tissue-derived CD105.sup.+ cells and human dental pulp
tissue-derived CD31.sup.-/CD146.sup.- SP cells.
BEST MODE FOR CARRYING OUT THE INVENTION
Material for Treatment of Cerebral Infarction
[0078] A material for treatment of cerebral infarction according to
this embodiment contains dental pulp stem cells, secretory proteins
of the dental pulp stem cells, or a mixture thereof.
[0079] The present inventors have found that the dental pulp stem
cells or the secretory proteins of the dental pulp stem cell
transplanted into a cerebral infarction region indirectly
contributes to the promotion of differentiation of neural
progenitor cells and neural stem cells on the periphery of the
cerebral infarction region. Based on this previously unseen,
original, and novel finding, the present invention has been
completed.
[0080] The dental pulp stem cell is more advantageous than other
stem cells such as bone marrow stem cells and adipose stem cells in
that it restores cerebral infarction region.
[0081] Dental pulp tissues are rich in stem cells, and it is easier
to fractionate them than, for example, bone marrow tissues and
adipose tissues. For example, SP cells are found in porcine dental
pulp tissue:porcine bone marrow tissue:porcine adipose
tissue=3%:0.3%:1.3%. Moreover, VEGFR2-positive cells are found in
porcine dental pulp tissue:porcine bone marrow tissue:porcine
adipose tissue=87%:43%:46%.
[0082] Moreover, the dental pulp stem cell is advantageous in that
it has a higher growth rate than that of, for example, bone marrow
stem cells. For example, porcine dental pulp stem cells require a
time for SP cell subculture that is about twice shorter than that
of porcine bone marrow stem cells.
[0083] Moreover, the dental pulp stem cell is advantageous in that
it expresses larger amounts of blood vessel-inducing factors such
as G-CSF, GM-CSF, MMP3, and VEGF than those of, for example, bone
marrow stem cells and adipose stem cells.
[0084] For example, canine dental pulp stem cells express G-CSF,
GM-CSF, and VEGF in amounts infinite times, 3.8 times, and 3.6
times, respectively, greater than those of canine adipose stem
cells in CD105-positive real-time RT-PCR.
[0085] Moreover, the dental pulp stem cells more easily form a
tube-like structure on matrigel in vitro than, for example, bone
marrow stem cells, aortic stem cells, and adipose stem cells.
[0086] Moreover, the dental pulp stem cells are advantageous in
that they more significantly ameliorate blood flow and more
significantly promote angiogenesis than, for example, bone marrow
stem cells and adipose stem cells. For example, when transplanted
into mice with lower limb ischemia, porcine dental pulp stem cells
more significantly induce angiogenesis than porcine bone marrow
stem cells and porcine adipose stem cells.
[0087] Moreover, the dental pulp stem cells are advantageous in
that they express larger amounts of neural factors such as BDNF,
NPY, TGF.beta.1, and TGF.beta.3 than those of, for example, bone
marrow stem cells and adipose stem cells. For example, the dental
pulp stem cells express BDNF in an amount 19 times greater than
that of bone marrow stem cells and 2 times greater than that of
adipose stem cells. Moreover, the dental pulp stem cells express
NPY in an amount 7 times greater than that of bone marrow stem
cells and 9 times greater than that of adipose stem cells.
[0088] Moreover, bone marrow stem cells are disadvantageous in that
bone marrow puncture is highly burdensome and the number of stem
cells decreases with age. Adipose stem cells have poor collection
efficiency due to large collection amounts required for obtaining
the stem cells. Umbilical cord blood stem cells are disadvantageous
in that they are too susceptible to the time required from
parturition to cell collection and the amount of umbilical cord
blood to stably collect the stem cells, in addition to the low
frequency of the stem cells present. ES cells present a safety
problem in addition to ethical and social problems.
Embryonic-derived neural stem cells also present a safety problem
in addition to ethical and social problems.
[0089] In contrast, dental pulp stem cells are more advantageous
than other stem cells in that: the collection of wisdom teeth and
deciduous teeth has low invasiveness to the human body; it presents
a few ethical problems because it is medical waste; the timing of
obtainment is not limited; its collection requires neither special
tools nor techniques; and it has high growth potential and
multipotency, as shown herein.
[0090] The dental pulp stem cell can be cryopreserved with its
traits maintained. It has much higher immunosuppressive activity
that suppresses the alloreactivity of T cells, than that of bone
marrow stem cells.
[0091] The dental pulp stem cell includes at least one of a
CD105-positive cell, a SP cell, a CD31-negative and CD146-negative
cell, a CD24-positive cell, a CD133-positive cell, a CD271-positive
cell, and a CD150-positive cell.
[0092] The SP cell refers to an undifferentiated cell that was
discovered by Goodell et al. (J. Exp. Med. vol. 183, 1996). This
cell population appears in flow cytometry analysis at a position
(lower left, dark fluorescent region, i.e., "weakly Hoechst
Blue-positive and weakly Hoechst Red-positive") different from that
of usual cells (cells other than undifferentiated cells) emitting
fluorescence at 405 nm and 600 nm on cytogram, when the SP cell is
allowed to incorporate therein a fluorescent dye Hoechst 33342 and
then excited with UV.
[0093] The SP cells are CD31-negative, CD105-positive,
CD31-negative and CD146-negative, CD24-positive, CD133-positive,
CD271-positive, or CD150-positive.
[0094] The dental pulp stem cells express a cell migration factor,
a cell growth factor, an angiogenic factor, or a neurotrophic
factor in a peri-infarct area of the brain.
[0095] The cell migration factors are at least one of SDF1, GCSF,
MMP3, Slit, and GMCSF.
[0096] The neurotrophic factors are at least one of VEGF, NGF,
GDNF, BDNF, LIF, MYC, Neurotrophine 3, TP53, and BAX.
[0097] The cell growth factors are at least one of bFGF and
PDGF.
[0098] The angiogenic factors are at least one of PGF, CXCL1,
CXCL2, CXCL3, CXCL5, CXCL10, ANPEP, NRP1, TGF.beta., ECGF1, ID1,
and CSF3.
[0099] The concentration of the dental pulp stem cells contained in
the material for treatment of cerebral infarction is not
particularly limited and is preferably, for example,
1.times.10.sup.5 cells/.mu.l to 1.times.10.sup.7 cells/.mu.l. This
is because: dental pulp stem cells having a concentration less than
1.times.10.sup.5 cells/.mu.l may possibly make a reduced
contribution to the promotion of differentiation of neural
progenitor cells and neural cells; and, on the other hand, dental
pulp stem cells having a concentration greater than
1.times.10.sup.7 cells/.mu.l may possibly be transplanted in
unnecessary amounts into a cerebral infarction region.
[0100] The dental pulp stem cell may be a cell extracted from a
target animal itself (autologous cell) undergoing treatment for
improving brain function or may be a cell extracted from an animal
other than the target animal (heterologous or xenologous cell)
undergoing treatment for improving brain function.
[0101] Dental pulp stem cells derived from a permanent tooth or a
deciduous tooth can be used. In particular, human deciduous
tooth-derived dental pulp cells contain CD105.sup.+ cells in an
amount as great as approximately 30% (human permanent tooth-derived
CD31.sup.- SP cells contain approximately 20% CD105.sup.+ cells).
The deciduous tooth-derived dental pulp stem cells or dental pulp
cells exhibit the effects of inducing blood vessels in vitro,
ameliorating blood flow at lower limb ischemia, and promoting
angiogenesis, as with permanent tooth-derived dental pulp stem
cells. Moreover, the deciduous tooth-derived dental pulp cells
contain 0.5% of CD150.sup.+ cells, which are higher than 0.2% in
the permanent tooth-derived CD31.sup.- SP cells. The deciduous
tooth-derived dental pulp cells have higher effects of inducing
blood vessels in vitro, ameliorating blood flow at lower limb
ischemia, and promoting angiogenesis than those of permanent
tooth-derived dental pulp cells.
[0102] The material for treatment of cerebral infarction according
to this embodiment not only includes the dental pulp stem cell but
may also include secretory proteins of the dental pulp stem
cells.
[0103] In this context, the secretory protein is an extracellularly
secreted protein. The secretory protein has a sequence called a
secretory signal peptide at the N terminus.
Brain Tissue Regeneration Method
[0104] A brain tissue regeneration method according to this
embodiment includes injecting the material for treatment of
cerebral infarction into the brain striatum after cerebral
infarction, thereby regenerating a central nervous tissue of the
brain to recover brain function.
[0105] The injection into the brain striatum is not particularly
limited and can be performed, for example, by making a hole in a
portion of parietal bone.
[0106] In this context, the cerebral infarction refers to brain
tissue death attributed to deteriorated blood flow due to the
clogging or narrowing of cerebral blood vessels.
[0107] The brain striatum is the subcortical structure of the
telencephalon. The brain striatum is deeply involved in motor
functions and decision-making functions, and the like, and is one
of the main components of basal ganglia in the cerebrum.
[0108] The brain striatum may be neostriatum or ventral striatum.
The neostriatum is also called dorsal striatum and is composed of
the putamen and the caudate nucleus. The ventral striatum contains
the nucleus accumbens and the olfactory tubercle, etc.
[0109] The material for treatment of cerebral infarction can be
injected into the brain striatum, for example, within 24 hours
after the development of cerebral infarction, without particular
limitations.
EXAMPLES
Example 1
[0110] This Example shows nerve regeneration by porcine dental pulp
tissue-derived CD31.sup.-/CD146.sup.- SP transplantation into rats
after cerebral infarction.
[0111] Middle cerebral artery occlusion was performed using SD
(Sprague-Dawley) rats to prepare rat models of cerebral
infarction.
[0112] CD31-negative SP cells were fluorescently labeled with DiI
and then transplanted 24 hours after cerebral infarction into an
injection site Pi of the brain striatum in the brain tissues, as
shown in FIGS. 1A and 1B, A PBS-injected control was used.
[0113] In FIG. 1A, B represents bregma, which is a point of
intersection of the sagittal suture with the coronal suture of the
cranium. L1 represents 6.0 mm, and L2 represents 1.0 mm.
[0114] FIG. 1B is a macro image of a coronal section. L3 represents
5.0 mm, and L4 represents 6.0 mm. ML represents a midline.
[0115] On day 21 after cell transplantation, perfusion fixation was
performed, and frozen sections were prepared according to a routine
method and immunostained with a neural progenitor cell marker, DCX,
and neural markers, neurofilament and NeuN.
[0116] FIG. 2A is a confocal scanning laser microscopic image of a
DCX-immunofluorescently stained frozen section of a site
transplanted with CD31-negative SP cells after cerebral infarction.
FIG. 2B shows a DCX-immunostained section of a normal brain region
located on the contralateral side of the cerebral infarction
region. FIG. 2C shows a DCX-immunostained section of a control
injected with PBS after cerebral infarction.
[0117] In these rat models of cerebral infarction, the infarction
occurred in 1/4 to 1/3 of the cerebral hemisphere after 1 month.
According to the immunostaining (green) with the neural progenitor
cell marker, DCX, the Dif-stained (red) transplanted cells
accumulated on the periphery of the infraction region and were not
confirmed to overlap with DCX-positive cells, while located in
proximity to the DCX-positive cells. A few positive cells were
observed on the contralateral side of the cerebral infarction
region and on the periphery of the cerebral infarction region
non-transplanted with CD31-negative SP cells.
[0118] Next, FIG. 3A is a confocal scanning laser microscopic image
of a neurofilament-immunofluorescently stained frozen section of a
site transplanted with CD31-negative SP cells after cerebral
infarction. FIG. 3B shows a neurofilament-immunostained section of
a normal brain region located on the contralateral side of the
cerebral infarction region. FIG. 3C shows a
neurofilament-immunostained section of a control injected with PBS
after cerebral infarction.
[0119] According to the immunostaining with the neural cell marker
neurofilament, its positive cells were not confirmed to overlap
with cells accumulating in the peri-infarct area of the brain,
while located in proximity to the cells. A very few
neurofilament-positive cells were observed in the
non-cell-transplanted peri-infarct area of the brain.
[0120] Next, FIG. 4A is a confocal scanning laser microscopic image
of a NeuN-immunofluorescently stained frozen section of a site
transplanted with CD31-negative SP cells after cerebral infarction.
FIG. 4B shows a NeuN-immunostained section of a normal brain region
located on the contralateral side of the cerebral infarction
region. FIG. 4C shows a NeuN-immunostained section of a control
injected with PBS after cerebral infarction.
[0121] Also in the NeuN immunostaining, its positive cells were not
confirmed to overlap with cells accumulating in the peri-infarct
area of the brain, while located in proximity to the cells, as with
the neurofilament immunostaining. Moreover, only a few positive
cells were observed in the non-cell-transplanted peri-infarct area
of the brain. The NeuN staining is a method for staining proteins
specific for the nuclei of neural cells. This method is used, for
example, to distinguish between undifferentiated neural stem cells
and differentiated neural cells.
[0122] It has previously been said that after cerebral infarction,
lateral subventricular zone-derived neural progenitor cells and
neural stem cells migrate to the parenchyma of the corpus striatum
where they in turn differentiate into nerves and form synapses.
Nevertheless, as is evident from the results of FIGS. 2A to 2C, 3A
to 3C, and 4A to 4C, neural progenitor cells in the PBS-injected
sample migrated to the corpus striatum due to cerebral infarction
but were not confirmed to differentiate into the nerves, whereas no
overlap with DCX-, neurofilament-, and NeuN-positive cells was seen
in the cell-transplanted sample, suggesting that the transplanted
cells do not directly differentiate into neural progenitor cells or
neural cells and indirectly participate in the promotion of
differentiation.
[0123] Next, a region (width: 6 mm) containing the entire cerebral
infarction region was cut by 1.2 mm into 5 serial sections, which
were then immunostained. Two typical regions of the periphery of
the cerebral infarction region in which the migration of
transplanted CD31-negative SP cells was seen were photographed (10
regions in total per sample) with a KEYENCE fluorescence
microscope. The fluorescence densities of DCX and NeuN were
measured using a Dynamic cell count, thereby statistically
analyzing the densities of neural progenitor cells and neural
cells.
[0124] FIG. 5 shows results of statistically analyzing the density
of neural progenitor cells in a sample transplanted with porcine
dental pulp tissue-derived CD31.sup.-/CD146.sup.- SP cells. FIG. 6
shows results of statistically analyzing the density of neural
cells in a sample transplanted with porcine dental pulp
tissue-derived CD31.sup.-/CD146.sup.- SP cells.
[0125] As shown in FIG. 5, neural progenitor cells on the periphery
of the cerebral infarction region were increased by about 2 times
compared with the PBS control, due to cell transplantation.
[0126] Moreover, as shown in FIG. 6, neural cells on the periphery
of the cerebral infarction region were increased by about 8 times
compared with the PBS control, due to cell transplantation.
[0127] These results suggest that the transplantation of
CD31-negative SP cells into a cerebral infarction region results in
migration of neural progenitor cells to a peri-infarct area of the
brain, promotes growth, inhibits apoptosis, and promotes
differentiation into neural cells.
[0128] Next, the expression of neurotrophic factors was examined by
in situ hybridization.
[0129] FIG. 7A shows the expression of VEGF mRNA at the periphery
of a cerebral infarction region. FIG. 7B shows the expression of
GDNF mRNA in a peri-infarct area of the brain. FIG. 7C shows the
expression of BDNF mRNA in a peri-infarct area of the brain. FIG.
7D shows the expression of NGF mRNA in a peri-infarct area of the
brain. As shown in FIGS. 7A, 7B, 7C, and 7D, the transplanted cells
strongly expressed VEGF mRNA, GDNF mRNA, BDNF mRNA, and NGF mRNA in
the peri-infarct area of the brain.
[0130] Focusing particularly on VEGF, the expression of VEGF was
examined by real-time RT-PCR using porcine-specific reactive
primers:
TABLE-US-00001 (.beta.-actin Forward: CTGGGGCCTAACGTTCTCAC,
.beta.-actin Reverse: GTCCTTTCTTCCCCGATGTT, VEGF Forward:
ATGGCAGAAGGAGACCAGAA, VEGF Reverse: ATGGCGATGTTGAACTCCTC)
The real-time RT-PCR employs a real-time PCR-specific apparatus
integrally comprising a thermal cycler and a fluorescence
spectrophotometer. The real-time RT-PCR analyzes the amount of PCR
amplification by real-time monitoring. This technique requires no
electrophoresis and is excellent in rapidity and quantitative
performance.
[0131] FIG. 8A shows the expression of VEGF in a peri-infarct area
of the brain transplanted with porcine dental pulp tissue-derived
CD31-negative SP cells.
[0132] FIG. 8B shows results of measurement by real-time RT-PCR, As
shown in FIGS. 8A and 8B, a 1000-fold or more rise in the
expression of VEGF mRNA was seen in the peri-infarct area of the
brain compared with the corresponding area of normal porcine brain,
while an approximately 28-fold rise was seen therein compared with
a cell-transplanted cerebral infarction-free region.
[0133] These results suggest that the transplantation of
CD31-negative SP cells promotes the differentiation of neural
progenitor cells and neural stem cells in a peri-infarct area of
the brain, owing to neurotrophic factors including VEGF secreted
from the transplanted cells.
[0134] Next, cultured neural progenitor cells (SHSY5Y human
neuroblastomas) were used to examine a culture supernatant of
CD31-negative SP cells for its migration, growth, and
anti-apoptosis effects.
[0135] FIG. 9 shows the migration effect of a culture supernatant
of porcine dental pulp tissue-derived CD31-negative SP cells. As
shown in FIG. 9, the culture supernatant of CD31-negative SP cells
had excellent migration effect.
[0136] FIG. 10 shows the growth effect of a culture supernatant of
porcine dental pulp tissue-derived CD31-negative SP cells. As shown
in FIG. 10, the culture supernatant of CD31-negative SP cells had
particularly superior growth effects.
[0137] The anti-apoptosis effect was determined by causing
apoptosis with 400 nM staurosporine and measuring the proportions
of necrotic cells and apoptotic cells by flow cytometry.
[0138] FIG. 11 shows the apoptosis inhibitory effect of a culture
supernatant of porcine dental pulp tissue-derived CD31-negative SP
cells. As shown in FIG. 11, the culture supernatant of
CD31-negative SP cells had excellent apoptosis inhibitory
effects.
[0139] Furthermore, porcine dental pulp tissue-derived
CD31-negative SP cells were transplanted into rats with cerebral
infarction. Then, their motor disability scores were determined
over time to examine the recovery effect of cell transplantation on
sensorimotor function.
[0140] The motor disability scores were calculated according to the
following method:
1 . . . When lifted by lifting the tail, the rat is incapable of
extending its upper limb on the paralyzed side (Score of 1). 2 . .
. When a lower limb on the paralyzed side is pulled, the rat is
incapable of pulling back the lower limb (Score of 1). 3 . . . When
the body is tilted to the paralyzed side, the rat is inclined
thereto (Score of 1). 4 . . . When forced to walk, the rat is
incapable of walking (Score of 1). 5 . . . The rat is incapable of
walking to escape within 10 seconds from a circle of 50 cm in
diameter (Score of 1), within 20 seconds therefrom (Score of 2),
and within 30 seconds therefrom (Score of 3). 6-1 . . . When upward
resistance is applied to an upper limb on the paralyzed side, the
rat is incapable of extending it (Score of 1). 6-2 When forward
resistance is applied to an upper limb on the paralyzed side, the
rat is incapable of extending it (Score of 1). 6-3 When lateral
resistance is applied to an upper limb on the paralyzed side, the
rat is incapable of extending it (Score of 1).
[0141] FIG. 12 shows results of determining over time and
statistically analyzing the motor disability scores. The number of
days is counted from cell transplantation. *P<0.05,
**P<0.005, ***P<0.001,
[0142] As shown in FIG. 12, regarding the recovery effect of cell
transplantation on sensorimotor function, almost complete recovery
from motor disability was seen in the cell-transplanted rats on day
9, whereas little recovery was seen in the PBS control. When the
motor disability scores were determined over time and statistically
analyzed, the cell-transplanted group was confirmed to
significantly recover motor function compared with the PBS-injected
control group on day 6 or later. Moreover, porcine total dental
pulp cells are cells in a state before fractionation of porcine
dental pulp tissue-derived CD31-negative SP cells and include not
only the porcine dental pulp tissue-derived CD31-negative SP cells
but also the other cells. The group of rats in transplantation of
the porcine total dental pulp cells showed better recovery from
motor function than that in the PBS control, but less recovery than
that in transplantation of the porcine dental pulp tissue-derived
CD31-negative SP cells. These results demonstrated that superior
recovery in motor function is obtained by the transplantation of
only porcine dental pulp tissue-derived CD31-negative SP cells than
by the transplantation of porcine total dental pulp cells.
[0143] The present inventors also compared porcine dental pulp
tissue-derived CD31-negative SP cells, porcine total dental pulp
cells, porcine bone marrow tissue-derived CD31-negative SP cells,
and porcine adipose tissue-derived CD31-negative SP cells. Their
respective motor disability scores were determined over time and
statistically analyzed. The results shown in FIG. 13 demonstrated
that the porcine dental pulp tissue-derived CD31-negative SP cells
more significantly offer recovery in motor function than porcine
bone marrow tissue-derived CD31-negative SP cells and porcine
adipose tissue-derived CD31-negative SP cells. This suggested that
dental pulp stem cells are more advantageous in functional
improvement for cerebral infarction than bone marrow stem cells and
adipose stem cells.
Example 2
[0144] Unlike Example 1, human dental pulp tissue-derived dental
pulp cells are used in this Example. Table 1 shows the properties
of human dental pulp tissue-derived CD31.sup.- SP cells and porcine
dental pulp tissue-derived CD31.sup.- SP cells.
TABLE-US-00002 TABLE 1 Human Human total Porcine CD31.sup.- dental
pulp CD31.sup.- SP cell cell SP cell (%) (%) (%) CD31 0.00 0.06
0.00 CD146 0.00 40.58 0.00 CD24 0.10 23.87 -- CD34 0.01 0.01 69.00
CD44 92.50 91.60 -- CD90 98.67 72.69 0.20 CD105 21.23 4.35 -- CD117
0.02 0.06 0.00 CD133 0.01 0.47 0.00 CD150 0.21 0.10 0.00 CD271 0.03
0.01 94.00 SSEA1 0.29 0.06 --
[0145] As shown in Table 1, the human dental pulp tissue-derived
CD31.sup.-SP cells highly expressed CD90 and CD150 compared with
porcine dental pulp tissue-derived CD3 V SP cells, in flow
cytometry. Moreover, the human dental pulp tissue-derived
CD31.sup.-SP cells highly expressed CD105 compared with human total
dental pulp cells.
[0146] This Example shows nerve regeneration by the cell
transplantation of human dental pulp tissue-derived
CD31.sup.-/CD146.sup.- SP cells and human dental pulp
tissue-derived CD105.sup.+ cells into rats after cerebral
infarction. Table 2 shows the properties of human dental pulp
tissue-derived CD31.sup.-/CD146.sup.- SP cells and human dental
pulp tissue-derived CD105.sup.+ cells.
TABLE-US-00003 TABLE 2 CD31.sup.-SP CD105.sup.+ total (%) (%) (%)
CD31 0.0 0.2 0.06 CD146 0.0 2.0 40.58 CD24 0.1 11.5 23.87 CD34 0.01
0.0 0.01 CD40 0.0 0.0 0.0 CD44 92.5 98.9 91.6 CD90 98.7 30.6 72.7
CD105 21.2 92.0 4.4 CD117 0.02 0.0 0.06 CD133 0.01 0.0 0.5 CD150
0.21 3.5 0.1 CD271 0.03 2.9 0.01
[0147] As shown in Table 2, the human dental pulp tissue-derived
CD105.sup.+ cells more highly expressed neural stem cell markers
CD24 and CD271 and a more undifferentiated stem cell marker CD150
than human dental pulp tissue-derived CD31.sup.-/CD146.sup.- SP
cells and human total dental pulp cells. This suggests that the
CD105.sup.+ cells are richer in neural stem cells and more
undifferentiated stem cells than CD31.sup.-/CD146.sup.- SP cells
and human total dental pulp cells.
[0148] Next, to elucidate the characteristics of human dental pulp
tissue-derived CD105.sup.+ cells, multipotency was examined As
shown in FIG. 14A, the human dental pulp tissue-derived CD105.sup.+
cells were induced to differentiate into blood vessels.
[0149] Moreover, as shown in FIG. 14B, the human dental pulp
tissue-derived CD105.sup.+ cells were induced to differentiate into
adipose tissue. On the other hand, as shown in FIG. 14C, the
induction of differentiation into adipose tissue was not seen in
the PBS control. FIG. 14D shows results of measurement by real-time
RT-PCR. PPAR.gamma. is a differentiation marker specific for
adipose cells.
[0150] Moreover, as shown in FIG. 14E, the human dental pulp
tissue-derived CD105.sup.+ cells were induced to differentiate into
odontoblasts. On the other hand, as shown in FIG. 14F, the
induction of differentiation into odontoblasts was not seen in the
PBS control. FIG. 14G shows results of measurement by real-time
RT-PCR. Dspp and enamelysin are differentiation markers specific
for odontoblasts.
[0151] Primers for PPAR.gamma., .beta.-actin, Dspp, and enamelysin
(matrix metalloproteinase (MMP) 20) shown in FIGS. 14D and 14G are
shown in Table 3.
TABLE-US-00004 TABLE 3 Product Accession 5'-Sequence-3' size (bp)
number PPAR .gamma. Forward gctgtgcagg agatcacaga 225 U63415
Reverse gggctccata aagtcaccaa .beta.-actin Forward ggacttcgag
caagagatgg 234 NM_001101 Reverse agcactgtgt tggcgtacag Dspp Forward
gaagatgctg gcctggataa 164 NM_014208 Reverse tcttctttcc catggtcctg
Enamelysin Forward ggtgagatgg ttgcaaga 163 NM_004771 Reverse
ggaagaggcg ataattgg
[0152] Next, as shown in FIG. 15A, the human dental pulp
tissue-derived CD105.sup.+ cells exhibited neurosphere formation.
Moreover, as shown in FIG. 15B, the human dental pulp
tissue-derived CD105.sup.+ cells had neural differentiation
potency.
[0153] Moreover, as shown in FIG. 15C, the human dental pulp
tissue-derived CD31.sup.-/CD146.sup.- SP cells exhibited
neurosphere formation. Moreover, as shown in FIG. 15D, the human
dental pulp tissue-derived CD31''/CD146.sup.- SP cells had neural
differentiation potency.
[0154] Next, human dental pulp tissue-derived CD105.sup.+ cells and
human dental pulp tissue-derived CD31/CD146.sup.- SP cells were
examined for their expression of neurotrophic factors and stem cell
markers by real-time RT-PCR. The results are shown in Table 4
below.
TABLE-US-00005 TABLE 4 CD31.sup.-/CD146.sup.-SP/ CD105.sup.+/ total
pulp total pulp BDNF 4.6 1.2 NGF 4.5 0.8 GDNF 0.4 4.1 Neurotrophin
3 0.8 0.2 VEGFA 3.7 4.6 Stat3 4.7 0.8 Bmi1 2.4 0.6
[0155] Primers for BDNF, NGF, GDNF, Neurotrophin 3, VEGFA, Stat3,
and Bmi1 are shown in Table 5.
TABLE-US-00006 TABLE 5 Product Accession 5'-Sequence-3' size (bp)
number BDNF Forward aaacatccga ggacaaggtg 202 NM_170735 Reverse
cgtgtacaag tctgcgtcct NGF Forward atacaggcgg aaccacactc 181
NM_002506 Reverse gcctggggtc cacagtaat GDNF Forward ttaggtactg
cagcggctct 203 BC128108 Reverse tccacacctt ttagcggaat Neurotrophine
3 Forward agactcgctc aattccctca 187 BC107075 Reverse ggtgtccatt
gcaatcactg VEGFA Forward ctacctccac catgccaagt 187 NM_001033756
Reverse cacacaggat gacttgaaga Stat3 Forward gtggtgacgg agaagcagca
191 NM_213662 Reverse ttctgcctgg tcactgactg Bmi1 Forward atatttacgg
tgcccagcag 179 CK_451985 Reverse gaagtggccc attccttctc
[0156] The human dental pulp tissue-derived CD31.sup.-/CD146.sup.-
SP cells had the expression of brain-derived neurotrophic factor
(BDNF) and nerve growth factor (NGF) mRNA 4 to 5 times higher than
that of total dental pulp cells. The human dental pulp
tissue-derived CD31.sup.-/CD146.sup.- SP cells were confirmed to
have the expression of BDNF about 4 times higher and the expression
of NGF mRNA about 5.6 times higher than those of human dental pulp
tissue-derived CD105.sup.+ cells. Both the cell fractions were
confirmed to have the expression of VEGFA mRNA 4 to 5 times higher
than that of total dental pulp cells.
[0157] On the other hand, the human dental pulp tissue-derived
CD105.sup.+ cells were confirmed to have approximately 4-fold
increase in the expression of glial cell-derived neurotrophic
factor (GDNF) mRNA compared with that of total dental pulp cells.
Moreover, the human dental pulp tissue-derived CD105.sup.+ cells
were confirmed to have approximately 10.2-fold increase in the
expression of glial cell-derived neurotrophic factor (GDNF) mRNA
compared with that of human dental pulp tissue-derived
CD31.sup.-/CD146.sup.- SP cells.
[0158] Specifically, these results demonstrated that human dental
pulp tissue-derived CD31.sup.-/CD146.sup.- SP cells strongly
express BDNF and NGF. Moreover, the results demonstrated that human
dental pulp tissue-derived CD105.sup.+ cells strongly express GDNF
mRNA.
[0159] The human dental pulp tissue-derived CD31.sup.-/CD146.sup.-
SP cells expressed the stem cell marker Stat3 mRNA about 5.8 times
more strongly than human dental pulp tissue-derived CD105.sup.+
cells. The human dental pulp tissue-derived CD31.sup.-/CD146.sup.-
SP cells expressed the stem cell marker Bmi1 mRNA about 4 times
more strongly than human dental pulp tissue-derived CD105.sup.+
cells.
[0160] These results suggest that the migration- and
growth-promoting effects of human dental pulp tissue-derived
CD31.sup.-/CD146.sup.- SP cells are based mainly on BDNF and NGF
and these effects of human dental pulp tissue-derived CD105.sup.+
cells are based mainly on GDNF.
[0161] Next, cultured neural progenitor cells (SHSY5Y human
neuroblastomas) were used to examine culture supernatants of human
dental pulp tissue-derived CD31.sup.-/CD146.sup.- SP cells and
human dental pulp tissue-derived CD105.sup.+ cells for their
migratory effects, proliferative effects, and anti-apoptotic
effects.
[0162] FIG. 16 illustrates the enhanced migration by the
conditioned medium of human dental pulp tissue-derived CD105.sup.+
cells and human dental pulp tissue-derived CD31.sup.-/CD146.sup.-
SP cells. As shown in FIG. 16, the conditioned medium of human
dental pulp tissue-derived CD31.sup.-/CD146.sup.- SP cells and
human dental pulp tissue-derived CD105.sup.+ cells significantly
promoted migration compared with the control.
[0163] FIG. 17 illustrates the enhanced proliferation of
conditioned medium of human dental pulp tissue-derived CD105.sup.+
cells and human dental pulp tissue-derived CD31.sup.-/CD146.sup.-
SP cells. As shown in FIG. 17, the conditioned medium of human
dental pulp tissue-derived CD31.sup.-/CD146.sup.- SP cells and
human dental pulp tissue-derived CD105.sup.+ cells significantly
promoted proliferation compared with the control.
[0164] Moreover, the conditioned medium of human dental pulp
tissue-derived CD105.sup.+ cells more highly promoted proliferation
with significant difference than the conditioned medium of human
dental pulp tissue-derived CD31.sup.-/CD146.sup.- SP cells after 24
hours. The significant difference between them was more marked
after 48 hours.
[0165] FIG. 18 shows the anti-apoptotic effects of human dental
pulp tissue-derived CD105.sup.+ cells and human dental pulp
tissue-derived CD31.sup.-/CD146.sup.- SP cells. As shown in FIG.
18, the conditioned medium of human dental pulp tissue-derived
CD31.sup.-/CD146.sup.- SP cells and human dental pulp
tissue-derived CD105.sup.+ cells significantly inhibited apoptosis
compared with the control. Moreover, the conditioned medium of
human dental pulp tissue-derived CD105.sup.+ cells more markedly
inhibited apoptosis than the conditioned medium of human dental
pulp tissue-derived CD31.sup.-/CD146.sup.- SP cells.
[0166] Next, human dental pulp tissue-derived
CD31.sup.-/CD146.sup.- SP cells and human dental pulp
tissue-derived CD105.sup.+ cells were separately transplanted into
the corpus striatum in the brain tissues after cerebral infarction,
and the motor disability scores were determined over time to
examine the recovery effect of cell transplantation on motor
function.
[0167] Models of cerebral infarction were prepared using SD rats in
the same way as in Example 1. Human dental pulp tissue-derived
CD31.sup.-/CD146.sup.- SP cells and CD105.sup.+ cells were
fluorescently labeled with DiI and then transplanted into the
corpus striatum in brain tissues 24 hours after cerebral
infarction.
[0168] A PBS-injected control was used. Then, 21 days after
cerebral infraction, perfusion fixation was performed, and frozen
sections were prepared according to a routine method and
immunostained with a neural progenitor cell marker DCX and a neural
marker NeuN. Furthermore, after cell transplantation, the motor
disability scores were determined over time to examine the recovery
effect of cell transplantation on motor sensation and function.
[0169] FIG. 19 shows results of statistically analyzing the density
of DCX-immunostained neural progenitor cells on day 21 from the
cell transplantation of human dental pulp tissue-derived
CD105.sup.+ cells into the corpus striatum in the brain tissues
after cerebral infarction. As shown in FIG. 19, in the
transplantation of human dental pulp tissue-derived CD105.sup.+
cells there was a 3 times increase in the neural progenitor cells
at the periphery of the cerebral infarction region.
[0170] FIG. 20 shows results of statistical analysis of the density
of NeuN-immunofluorescently stained neural cells on day 21 in the
cell transplantation of human dental pulp tissue-derived
CD105.sup.+ cells into the corpus striatum in the brain tissues
after cerebral infarction. As shown in FIG. 20, the neural cells
were significantly increased in the peri-infarct region of the
brain compared with the PBS-injected control, although the neural
cells exhibited a disturbed nerve tract compared with the
corresponding area of a normal brain region located on the
contralateral side.
[0171] FIG. 21 shows results of statistical analysis of the density
of DCX-immunostained neural progenitor cells on day 21 in human
dental pulp tissue-derived CD105.sup.+ cell transplantation
compared with that in human dental pulp tissue-derived
CD31.sup.-/CD146.sup.- SP cell transplantation into the corpus
striatum in the brain tissues of different SD rats with cerebral
infarction. As shown in FIG. 21, the human dental pulp
tissue-derived CD105.sup.+ cells had the more marked ability to
promote proliferation of neural progenitor cells than that of human
dental pulp tissue-derived CD31.sup.-/CD146.sup.- SP cells.
[0172] FIG. 22 shows results of statistical analysis of the density
of NeuN-immunostained neural cells on day 21 in human dental pulp
tissue-derived CD105.sup.+ cell transplantation with that in human
dental pulp tissue-derived CD31.sup.-/CD146.sup.- SP cell
transplantation into the corpus striatum in the brain tissues of
different SD rats with cerebral infarction. As shown in FIG. 22,
the human dental pulp tissue-derived CD105.sup.+ cells had the more
marked ability to promote the differentiation of neural cells than
that of human dental pulp tissue-derived CD31.sup.-/CD146.sup.- SP
cells.
[0173] These results demonstrated that human dental pulp
tissue-derived transplanted cells do not directly differentiate
into neural progenitor cells or neural cells and indirectly
participate in the promotion of differentiation, as with porcine
dental pulp tissue-derived transplanted cells.
[0174] FIG. 23 shows results of statistical analysis of the motor
disability scores of different SD rats with cerebral infarction in
human dental pulp tissue-derived CD105.sup.+ cell transplantation
and human dental pulp tissue-derived CD31.sup.-/CD146.sup.- SP
cells compared with PBS control transplantation. The number of days
is counted from cell transplantation. As shown in FIG. 23, when the
motor disability scores were determined over time, significant
recovery from motor disability were demonstrated both in the human
dental pulp tissue-derived CD31.sup.-/CD146.sup.- SP cell
transplantation and the human dental pulp tissue-derived
CD105.sup.+ cell transplantation compared with the PBS-injected
control.
[0175] As shown in these Examples, the dental pulp tissue-derived
CD105.sup.+ cells and the dental pulp tissue-derived
CD31.sup.-/CD146.sup.- SP cells have significant effects on cell
migration, proliferation, and anti-apoptosis, and also have
significant effects on enhanced proliferation of neural progenitor
cells and neural cell differentiation.
[0176] Moreover, as shown in these Examples, the dental pulp
tissue-derived CD105.sup.+ cells have significantly higher effects
on proliferation and anti-apoptosis compared with the dental pulp
tissue-derived CD31.sup.-/CD146.sup.- SP cells. The marked
superiority of the dental pulp tissue-derived CD105.sup.+ cells
over the dental pulp tissue-derived CD31.sup.-/CD146.sup.- SP cells
could not have been predicted and has been revealed for the first
time by the experiments of the present inventors.
[0177] Furthermore, although flow cytometry is used for
fractionating the dental pulp tissue-derived CD31.sup.-/CD146.sup.-
SP cells, flow cytometry may cause contamination with cells derived
from other individuals. Therefore, fractionation using flow
cytometry cannot be used clinically from the viewpoint of safety.
On the other hand, the dental pulp tissue-derived CD105.sup.+ cells
can be fractionated by, for example, an immunological magnetic bead
method, without particular limitations.
[0178] The immunological magnetic bead method involves reacting
samples with immunological magnetic beads (magnetic bead-conjugated
antibodies against cell surface antigens) placed in a tube and
adsorbing the samples onto the column for separation. This method
is free from the risk of contamination. Therefore, the material for
treatment of cerebral infarction comprising dental pulp
tissue-derived CD105.sup.+ cells has the great advantage that it
can be used clinically on the spot and can immediately provide
therapeutic means appropriate for cerebral angiopathy.
INDUSTRIAL APPLICABILITY
[0179] A material for treatment of cerebral infarction according to
the present invention is effective to enhance proliferation of
neural progenitor cells and also effective to promote neural cell
differentiation. Moreover, the material for treatment of cerebral
infarction according to the present invention can be used
clinically on the spot and can immediately provide therapeutic
means appropriate for cerebral angiopathy.
Sequence CWU 1
1
26120DNAArtificial SequenceOligonucleotide to act as a linker
between 5 prime and 3 prime 1ctggggccta acgttctcac
20220DNAArtificial SequenceOligonucleotide to act as a linker
between 5 prime and 3 prime 2gtcctttctt ccccgatgtt
20320DNAArtificial SequenceOligonucleotide to act as a linker
between 5 prime and 3 prime 3atggcagaag gagaccagaa
20420DNAArtificial SequenceOligonucleotide to act as a linker
between 5 prime and 3 prime 4atggcgatgt tgaactcctc
20520DNAArtificial SequenceOligonucleotide to act as a linker
between 5 prime and 3 prime 5gctgtgcagg agatcacaga
20620DNAArtificial SequenceOligonucleotide to act as a linker
between 5 prime and 3 prime 6gggctccata aagtcaccaa
20720DNAArtificial SequenceOligonucleotide to act as a linker
between 5 prime and 3 prime 7ggacttcgag caagagatgg
20820DNAArtificial SequenceOligonucleotide to act as a linker
between 5 prime and 3 prime 8agcactgtgt tggcgtacag
20920DNAArtificial SequenceOligonucleotide to act as a linker
between 5 prime and 3 prime 9gaagatgctg gcctggataa
201020DNAArtificial SequenceOligonucleotide to act as a linker
between 5 prime and 3 prime 10tcttctttcc catggtcctg
201118DNAArtificial SequenceOligonucleotide to act as a linker
between 5 prime and 3 prime 11ggtgagatgg ttgcaaga
181218DNAArtificial SequenceOligonucleotide to act as a linker
between 5 prime and 3 prime 12ggaagaggcg ataattgg
181320DNAArtificial SequenceOligonucleotide to act as a linker
between 5 prime and 3 prime 13aaacatccga ggacaaggtg
201420DNAArtificial SequenceOligonucleotide to act as a linker
between 5 prime and 3 prime 14cgtgtacaag tctgcgtcct
201520DNAArtificial SequenceOligonucleotide to act as a linker
between 5 prime and 3 prime 15atacaggcgg aaccacactc
201619DNAArtificial SequenceOligonucleotide to act as a linker
between 5 prime and 3 prime 16gcctggggtc cacagtaat
191720DNAArtificial SequenceOligonucleotide to act as a linker
between 5 prime and 3 prime 17ttaggtactg cagcggctct
201820DNAArtificial SequenceOligonucleotide to act as a linker
between 5 prime and 3 prime 18tccacacctt ttagcggaat
201920DNAArtificial SequenceOligonucleotide to act as a linker
between 5 prime and 3 prime 19agactcgctc aattccctca
202020DNAArtificial SequenceOligonucleotide to act as a linker
between 5 prime and 3 prime 20ggtgtccatt gcaatcactg
202120DNAArtificial SequenceOligonucleotide to act as a linker
between 5 prime and 3 prime 21ctacctccac catgccaagt
202220DNAArtificial SequenceOligonucleotide to act as a linker
between 5 prime and 3 prime 22cacacaggat ggcttgaaga
202320DNAArtificial SequenceOligonucleotide to act as a linker
between 5 prime and 3 prime 23gtggtgacgg agaagcagca
202420DNAArtificial SequenceOligonucleotide to act as a linker
between 5 prime and 3 prime 24ttctgcctgg tcactgactg
202520DNAArtificial SequenceOligonucleotide to act as a linker
between 5 prime and 3 prime 25atatttacgg tgcccagcag
202620DNAArtificial SequenceOligonucleotide to act as a linker
between 5 prime and 3 prime 26gaagtggccc attccttctc 20
* * * * *