U.S. patent application number 12/989198 was filed with the patent office on 2011-07-07 for methods of using mir210 as a biomarker for hypoxia and as a therapeutic agent for treating cancer.
Invention is credited to Julia Burchard, Michael Carleton, Michael Cleary, Hongyue Dai, Xudong Dai, Carla Grandori, Sun Hong, Peter Linsley, Jan Schelter, Zhan Zhang.
Application Number | 20110166200 12/989198 |
Document ID | / |
Family ID | 41038043 |
Filed Date | 2011-07-07 |
United States Patent
Application |
20110166200 |
Kind Code |
A1 |
Zhang; Zhan ; et
al. |
July 7, 2011 |
METHODS OF USING MIR210 AS A BIOMARKER FOR HYPOXIA AND AS A
THERAPEUTIC AGENT FOR TREATING CANCER
Abstract
The present invention provides compositions and methods for
predicting the hypoxia response in tumor cells, methods for
predicting the likelihood of cancer metastasis, and methods for
inhibiting tumor cell proliferation using a microRNA comprising
miR-210.
Inventors: |
Zhang; Zhan; (Kirkland,
WA) ; Hong; Sun; (Needham, MA) ; Dai;
Hongyue; (Chestnut Hill, MA) ; Schelter; Jan;
(Bellevue, WA) ; Burchard; Julia; (San Francisco,
CA) ; Dai; Xudong; (Kirkland, WA) ; Carleton;
Michael; (Bothell, WA) ; Cleary; Michael;
(Jamison, PA) ; Linsley; Peter; (Settle, WA)
; Grandori; Carla; (Seattle, WA) |
Family ID: |
41038043 |
Appl. No.: |
12/989198 |
Filed: |
April 16, 2009 |
PCT Filed: |
April 16, 2009 |
PCT NO: |
PCT/US2009/040788 |
371 Date: |
March 10, 2011 |
Current U.S.
Class: |
514/44A ;
435/375; 435/6.1 |
Current CPC
Class: |
C12Q 1/6886 20130101;
C12Q 2600/106 20130101; A61P 35/00 20180101; C12Q 2600/178
20130101 |
Class at
Publication: |
514/44.A ;
435/6.1; 435/375 |
International
Class: |
A61K 31/713 20060101
A61K031/713; C12Q 1/68 20060101 C12Q001/68; C12N 5/09 20100101
C12N005/09; A61P 35/00 20060101 A61P035/00 |
Foreign Application Data
Date |
Code |
Application Number |
Apr 24, 2008 |
US |
61047690 |
Claims
1. A method for determining a hypoxic state in tumor cells obtained
from a subject, comprising: (a) measuring the level of miR-210 in
tumor cells obtained from a tumor in a subject; and (b) comparing
the level of miR-210 with a hypoxia reference value, wherein a
level greater than the hypoxia reference value is indicative of a
hypoxic state in the tumor cells.
2. The method of claim 1, wherein the hypoxia reference value is
selected from the group consisting of: (a) the level of miR-210 in
non-tumor cells obtained from the subject; (b) the level of miR-210
in cells obtained from a plurality of non-hypoxic tumor samples
from one or more subjects, and (c) the level of miR-210 in
non-tumor cells from one or more subjects.
3. The method of claim 1, wherein the tumor cells are obtained from
a tumor type selected from the group consisting of breast, kidney,
lung, and melanoma cancers.
4. The method of claim 1, wherein a hypoxic state is predictive of
metastasis of the cancer.
5. A method for predicting the likelihood of metastasis of a tumor
in a subject, comprising: (a) measuring the level of miR-210 in
tumor cells obtained from a tumor in a subject; and (b) comparing
the measured level of miR-210 with a metastasis reference value,
wherein a level of miR-210 equal to or greater than the metastasis
reference value is predictive of metastasis of the tumor in the
subject.
6. The method of claim 5, wherein the metastasis reference value is
the level of miR-210 measured in cells from non-tumor tissue in one
or more subjects.
7. The method of claim 5, wherein the metastasis reference value is
the median expression level of miR-210 measured in cells from a
plurality of primary tumors from one or more subjects with no
metastasis for at least five years.
8. The method of claim 5, wherein the tumor is selected from the
group consisting of breast, kidney, lung, and melanoma cancers.
9. A method of inhibiting tumor cell proliferation, comprising: (a)
measuring the level of Myc protein or nucleic acid in a tumor cell
sample; (b) comparing the measured level of Myc protein or nucleic
acid with a corresponding Myc reference value; and (c) contacting
the tumor cells having a level of Myc equal to or greater than the
Myc reference value with an amount of a short interfering nucleic
acid (siNA) comprising an miR-210 sequence and is effective to
inhibit the proliferation of tumor cells, wherein said siNA
comprises a guide strand nucleotide sequence wherein at least 6
contiguous nucleotides are identical to 6 contiguous nucleotides of
SEQ ID NO:4.
10. The method of claim 9, wherein step (a) comprises measuring at
least one of: (i) a polynucleotide having at least 95% sequence
identity to the polynucleotide of SEQ ID NO:23, SEQ ID NO:25, or
SEQ ID NO:27, or a variant or polymorphism thereof; or (ii) a
polypeptide having at least 95% sequence identity to the
polypeptide of SEQ ID NO:24, SEQ ID NO:26, or SEQ ID NO:28, or an
isoform thereof.
11. The method of claim 9, wherein the siNA guide strand comprises
a contiguous nucleotide sequence of at least 18 nucleotides,
wherein said guide strand comprises a seed region consisting of
nucleotide positions 1 to 12, and wherein position 1 represents the
5'-end of said guide strand.
12. The method of claim 9, wherein the Myc reference value is
selected from the group consisting of: (i) the level of Myc in
non-tumor cells obtained from one or more subjects; (ii) the level
of Myc in tumor cells obtained from one or more subjects; (iii) the
level of Myc in cells obtained from a plurality of tumors in one or
more subjects; (iv) the level of Myc in one or more tumor cell
lines; and (iv) the level of Myc in non-tumor cells transduced with
a Myc expression vector.
13. The method of claim 9, wherein the tumor is selected from the
group of cancers consisting of lymphoma, neuroblastoma,
medulloblastoma, glioblastomas, rhabdomyosarcomas, hepatocellular
carcinoma, lung cancer, breast cancer, colon cancer, prostate
cancer, pancreatic cancer, skin cancer, and ovarian cancer.
14. A method of reducing the tumor burden in a subject, comprising
contacting a plurality of tumor cells with an amount of a small
interfering nucleic acid (siNA) effective to reduce tumor burden in
the subject, wherein said siNA comprises a guide strand nucleotide
sequence of at least contiguous 18 nucleotides, wherein said guide
strand comprises a seed region consisting of nucleotide positions 1
to 12, wherein position 1 represents the 5'-end of said guide
strand, and wherein said seed region comprises a nucleotide
sequence of at least 6 contiguous nucleotides that is identical to
6 contiguous nucleotides of SEQ ID NO:4.
15. The method of claim 14, wherein the tumor cells express c-Myc,
N-Myc, or L-Myc.
16. The method of claim 14, wherein the tumor is selected from the
group of cancers consisting of lymphoma, neuroblastoma,
medulloblastoma, glioblastomas, rhabdomyosarcomas, hepatocellular
carcinoma, lung cancer, breast cancer, colon cancer, prostate
cancer, pancreatic cancer, skin cancer, and ovarian cancer.
17. A method of inhibiting the proliferation of tumor cells
comprising: (a) measuring the level of Myc protein or nucleic acid
in the tumor cells; (b) comparing the measured level of Myc protein
or nucleic acid in the tumor cells with a corresponding Myc
reference value; and (c) contacting the tumor cells having a level
of Myc equal to or greater than the Myc reference value with an
amount of an inhibitor of the expression or activity of: (i) a
polypeptide having at least 95% identity to the polypeptide set
forth in SEQ ID NO:30; or (ii) a polynucleotide having at least 95%
identity to the polynucleotide set forth in SEQ ID NO:29; that is
effective to inhibit proliferation of the tumor cells.
18. A method of inhibiting tumor cell proliferation in a subject,
comprising: (a) measuring the level of miR-210 in tumor cells
obtained from the subject; (b) comparing the measured level of
miR-210 with a hypoxia reference value; wherein measured levels
equal to or greater than the hypoxia reference value indicate the
tumor cells are hypoxic; and (c) contacting the tumor cells in the
subject with an inhibitor of the hypoxia response pathway; thereby
inhibiting the proliferation of tumor cells in the subject.
19. The method of claim 18, wherein the hypoxia response pathway
comprises a polypeptide selected from the group consisting of
HIF-1.alpha., HIF-1.beta., and HIF-2.alpha..
20. The method of claim 18, wherein the inhibitor of the hypoxia
response pathway inhibits the expression or activity of the
polynucleotide set forth in SEQ ID NO:29 or the polypeptide set
forth in SEQ ID NO:30.
21. The method of claim 18, wherein the hypoxia reference value is
selected from the group consisting of: (i) the level of miR-210 in
non-tumor cells obtained from the subject; (ii) the level of
miR-210 in cells obtained from a plurality of non-hypoxic tumor
samples from one or more subjects, (iii) the level of miR-210 in
non-tumor cells obtained from one or more subjects; and (iv) the
level of miR-210 in cells obtained from one or more non-hypoxic
tumor cell lines.
22. A method of inhibiting tumor cell proliferation in a subject,
comprising: (a) measuring the level of miR-210 in tumor cells
obtained from a subject; (b) comparing the measured level of
miR-210 with a hypoxia reference value; wherein measured levels
equal to or greater than the hypoxia reference value indicate the
tumor cells are hypoxic; and (c) contacting the tumor cells in the
subject with a miR-210 inhibitor, thereby inhibiting the
proliferation of tumor cells in the subject.
23. The method of claim 22, wherein the miR-210 inhibitor comprises
an oligonucleotide complementary to at least 6 contiguous
nucleotides of SEQ ID NO:4.
Description
FIELD OF THE INVENTION
[0001] The invention relates to the use of miR-210 as a biomarker
for hypoxia in tumor cells, and as a therapeutic agent for
inhibiting growth of tumor cells.
BACKGROUND
[0002] Intratumoral hypoxia is a hallmark of most solid tumors and
results from increased oxygen consumption and/or insufficient blood
supply. Many of the hypoxia induced cellular responses are mediated
through the hypoxia-inducible factors (HIFs) (Pouyssegur, J., et
al., "Hypoxia Signalling in Cancer and Approaches to Enforce Tumour
Regression," Nature 441:437-443, 2006; Semenza, G. L., "Targeting
HIF-1 for Cancer Therapy," Nat. Rev. Cancer 3:721-723, 2003), which
act to regulate expression of genes involved in angiogenesis,
survival, cell metabolism, invasion and other functions (Keith, B.,
and M. C. Simon, "Hypoxia-Inducible Factors, Stem Cells, and
Cancer," Cell 129:465-472, 2007). HIFs are members of the
basic-helix-loop-helix-Per-Arnt-Sim domain (PAS) protein family of
transcription factors that bind to hypoxia regulated elements
(HREs) in the promoter or enhancer regions of a specific set of
target genes. HIFs function as obligate heterodimers composed of an
.alpha.-subunit (HIF-1.alpha. or HIF-2.alpha.) and .beta.-subunit
(HIF-1.beta.). In the presence of oxygen, the .alpha.-subunits are
hydroxylated at two key proline residues in their oxygen-dependent
degradation domain (ODD) by a family of prolyl hydroylases.
Hydroxylated HIF-.alpha. protein is then recognized by the tumor
suppressor Von Hippel-Lindau (VHL), part of an E3 ubiquitin ligase
complex, ubiquitinated, and targeted for proteosomal degradation
(Kaelin, W. G., Jr., "The von Hippel-Lindau Protein, HIF
Hydroxylation, and Oxygen Sensing," Biochem. Biophys. Res. Commun.
338:627-638, 2005; Semenza, G. L., "Hypoxia and Cancer," Cancer
Metastasis Rev. 26:223-224, 2007; Shivdasani, R. A., "microRNAs:
Regulators of Gene Expression and Cell Differentiation," Blood
108:3646-3653, 2006; Wang, G. L., et al., "Hypoxia-Inducible Factor
1 is a Basic-Helix-Loop-Helix-PAS Heterodimer Regulated by Cellular
02 Tension," Proc. Natl. Acad. Sci. USA 92:5510-5514, 1995; Wang,
G. L., and G. L. Semenza, "General Involvement of Hypoxia-Inducible
Factor 1 in Transcriptional Response to Hypoxia," Proc. Natl. Acad.
Sci. USA 90:4304-4308, 1993; Wang, G. L., and G. L. Semenza,
"Purification and Characterization of Hypoxia-Inducible Factor 1,"
J. Biol. Chem. 270:1230-1237, 1995). Under hypoxic conditions,
HIF-.alpha. protein is not degraded and translocates to the nucleus
where it binds to the constitutively expressed HIF-1.beta. and
activates HIF target genes.
[0003] The two HIF .alpha.-subunits are differentially expressed,
with HIF-1.alpha. being more ubiquitous while HIF-2.alpha.
expression is limited to specific tissues, including kidney, heart,
lungs, and endothelium. In addition, HIF-1.alpha. and HIF-2.alpha.
are functionally distinct, as evidenced by both gene knock-out
studies in mice and by their ability to either promote
(HIF-2.alpha.) or inhibit (HIF-1.alpha.) VHL deficient renal tumor
cell proliferation (Kondo, K., et al., "Inhibition of HIF2Alpha is
Sufficient to Suppress pVHL-Defective Tumor Growth," PLoS Biol.
1:E83, 2003; Kondo, K., et al., "Inhibition of HIF is Necessary for
Tumor Suppression by the von Hippel-Lindau Protein," Cancer Cell
1:237-246, 2002; Maranchie, J. K., et al., "The Contribution of VHL
Substrate Binding and HIF1-Alpha to the Phenotype of VHL Loss in
Renal Cell Carcinoma," Cancer Cell 1:247-255, 2002; Raval, R. R.,
et al., "Contrasting Properties of Hypoxia-Inducible Factor 1
(HIF-1) and HIF-2 in von Hippel-Lindau-Associated Renal Cell
Carcinoma," Mol. Cell. Biol. 25:5675-5686, 2005). Although
HIF-1.alpha. and HIF-2.alpha. regulate unique target genes (e.g.,
HIF-1.alpha. activates genes involved in glycolysis and
HIF-2.alpha. induces stem cell factor Oct4, TGF.alpha., lysyl
oxidase and cyclinD1), they also share common targets, such as VEGF
and ADRP (adipose differentiation-related protein) (Gordan, J. D.,
and M. C. Simon, "Hypoxia-Inducible Factors: Central Regulators of
the Tumor Phenotype," Curr. Opin. Genet. Dev. 17:71-77, 2007;
Gordan, J. D., et al., "HIF and c-Myc: Sibling Rivals for Control
of Cancer Cell Metabolism and Proliferation," Cancer Cell
12:108-113, 2007b). HIF-1.alpha. and HIF-2.alpha. also differ as
they exert opposite effects on the activity of the c-Myc
oncoprotein. Stabilization of HIF-1.alpha. by hypoxia leads to cell
cycle arrest at G1/S by inhibition of c-Myc transcriptional
activity through multiple mechanisms involving both direct binding
to c-Myc as well as through activation of the antagonist MXI-1
(Dang, C. V., et al., "The Interplay Between MYC and HIF in
Cancer," Nat. Rev. Cancer, 2007; Gordan, J. D., et al., "HIF-2Alpha
Promotes Hypoxic Cell Proliferation by Enhancing c-Myc
Transcriptional Activity," Cancer Cell 11:335-347, 2007a; Gordan,
J. D., and M. C. Simon, "Hypoxia-Inducible Factors: Central
Regulators of the Tumor Phenotype," Curr. Opin. Genet. Dev.
17:71-77, 2007; Gordan, J. D., et al., "HIF and c-Myc: Sibling
Rivals for Control of Cancer Cell Metabolism and Proliferation,"
Cancer Cell 12:108-113, 2007b; Zhang, H., et al., "HIF-1 Inhibits
Mitochondrial Biogenesis and Cellular Respiration in VHL-Deficient
Renal Cell Carcinoma by Repression of c-Myc Activity," Cancer Cell
11:407-420, 2007). In contrast to HIF-1.alpha., HIF-2.alpha.
promotes cell cycle progression by enhancing c-Myc activity through
binding and stabilization of complexes between Myc and its binding
partner, Max (Gordan, J. D., et al., "HIF-2Alpha Promotes Hypoxic
Cell Proliferation by Enhancing c-Myc Transcriptional Activity,"
Cancer Cell 11:335-347, 2007a; Gordan, J. D., et al., "HIF and
c-Myc: Sibling Rivals for Control of Cancer Cell Metabolism and
Proliferation," Cancer Cell 12:108-113, 2007b). Recent data also
indicates Myc-induced lymphomagenesis requires HIF-1.alpha.,
implying that the Myc and HIF pathway interaction is complex and
reciprocal (Dang, C. V., et al., "The Interplay Between MYC and HIF
in Cancer," Nat. Rev. Cancer, 2007).
[0004] Hypoxia alters the expression of hundreds of mRNAs that are
essential for many aspects of tumorigenesis and the HIF
transcription factors play a central role in this response (Chi, J.
T., et al., "Gene Expression Programs in Response to Hypoxia: Cell
Type Specificity and Prognostic Significance in Human Cancers,"
PLoS Med. 3:e47, 2006; Gordan, J. D., and M. C. Simon,
"Hypoxia-Inducible Factors: Central Regulators of the Tumor
Phenotype," Curr. Opin. Genet. Dev. 17:71-77, 2007). Recently, the
effect of hypoxia on microRNA expression has been reported (Donker,
R. B., et al., "The Expression of Argonaute2 and Related microRNA
Biogenesis Proteins in Normal and Hypoxic Trophoblasts," Mol. Hum.
Reprod. 13:273-279, 2007; Fabbri et al., "Regulatory Mechanisms of
microRNAs Involvement in Cancer," Expert Opin. Biol. Ther.
7:1009-1019, 2007; Huam et al., "miRNA-Directed Regulation of VEGF
and Other Angiogenic Factors Under Hypoxia," PLoS ONE 1:e116, 2006;
Kulshreshtha et al., "Regulation of microRNA Expression: The
Hypoxic Component," Cell Cycle 6:1426-1431, 2007a; Kulshreshtha et
al., "A microRNA Signature of Hypoxia," Mol. Cell. Biol.
27:1859-1867, 2007b). microRNAs are a novel class of gene
regulators that can each regulate as many as several hundred genes
with spatial and temporal specificity (Bushati, N., and S. M.
Cohen, "microRNA Functions," Annu. Rev. Cell Dev. Biol. 23:175-205,
2007; Carleton et al., "microRNAs and Cell Cycle Regulation," Cell
Cycle 6:2127-2132, 2007; Dalmay, T., and D. R. Edwards, "microRNAs
and the Hallmarks of Cancer," Oncogene 25:6170-6175, 2006).
microRNAs have been proposed to contribute to oncogenesis by
functioning either as tumor suppressors or oncogenes
(Esquela-Kerscher, A., and F. J. Slack, "Oncomirs--microRNAs With a
Role in Cancer," Nat. Rev. Cancer 6:259-269, 2006; Fabbri et al.,
2007; Leung, A. K., and P. A. Sharp, "microRNAs: A Safeguard
Against Turmoil?" Cell 130:581-585, 2007; Shivdasani, R. A.,
"microRNAs: Regulators of Gene Expression and Cell
Differentiation," Blood 108:3646-3653, 2006; Stahlhut Espinosa, C.
E., and F. J. Slack, "The Role of microRNAs in Cancer," Yale J.
Biol. Med. 79:131-140, 2006).
[0005] Given the importance of hypoxia in tumorigenesis and
metastasis, there is a need to identify modulators of the hypoxia
response pathway. There is also a need to identify biomarkers that
are predictive of patient outcomes after tumor diagnosis.
SUMMARY
[0006] In one aspect, a method is provided for determining a
hypoxic state in tumor cells obtained from a subject. The method
comprises (a) measuring the level of miR-210 in tumor cells, and
(b) comparing the level of miR-210 with a hypoxia reference value,
wherein a level greater than the hypoxia reference value is
indicative of a hypoxic state in the tumor cells.
[0007] In another aspect, a method is provided for predicting the
likelihood of metastasis of a tumor in a subject. The method
according to this aspect of the invention comprises (a) measuring
the level of miR-210 in tumor cells obtained from a tumor in a
subject, and (b) comparing the measured level of miR-210 with a
metastasis reference value, wherein a level or miR-210 equal to or
greater than the metastasis reference value is predictive of
metastasis of the tumor in the subject.
[0008] In another aspect, a method is provided for inhibiting tumor
cell proliferation. The method according to this aspect of the
invention comprises (a) measuring the level of Myc protein or
nucleic acid in a tumor cell sample; (b) comparing the measured
level of Myc with a Myc reference value; and (c) contacting the
tumor cells having a level of Myc equal to or greater than the Myc
reference value with an amount of an siNA comprising miR-210
effective to inhibit the proliferation of tumor cells.
[0009] In another aspect, a method is provided for reducing the
tumor burden in a subject. The method according to this aspect of
the invention comprises contacting a plurality of tumor cells with
an amount of a small interfering nucleic acid (siNA) effective to
reduce tumor burden in the subject, wherein said siNA comprises a
guide strand contiguous nucleotide sequence of at least 18
nucleotides, wherein said guide strand comprises a seed region
consisting of nucleotide positions 1 to 12, wherein position 1
represents the 5'-end of said guide strand and wherein said seed
region comprises a nucleotide sequence of at least 6 contiguous
nucleotides that is identical to 6 contiguous nucleotides of SEQ ID
NO:4.
[0010] In another aspect, a method is provided for inhibiting the
proliferation of tumor cells. The methods according to this aspect
of the invention comprise (a) measuring the level of Myc protein or
nucleic acid in the tumor cells; (b) comparing the measured level
of Myc in the tumor cells with a Myc reference value; and (c)
contacting the tumor cells having a level of Myc equal to or
greater than the Myc reference value with an amount of an inhibitor
of the expression or activity of (i) a polypeptide having at least
95% identity to the full length polypeptide set forth in SEQ ID
NO:30; or (ii) a polynucleotide having at least 95% identity to the
full length polynucleotide set forth in SEQ ID NO:29; effective to
inhibit proliferation of the tumor cells.
[0011] In yet another aspect, a method is provided for inhibiting
tumor cell proliferation in a subject. The method according to this
aspect of the invention comprises (a) measuring the level of
miR-210 in tumor cells from the subject; (b) comparing the measured
level of miR-210 with a hypoxia reference value; wherein measured
levels equal to or greater than the hypoxia reference value
indicate the tumor cells are hypoxic; and (c) contacting the tumor
cells with an inhibitor of the hypoxia response pathway; thereby
inhibiting the proliferation of tumor cells in the subject.
[0012] In a further aspect, a method is provided for inhibiting
tumor cell proliferation in a subject. The methods according to
this aspect of the invention comprise (a) measuring the level of
miR-210 in tumor cells from the subject; (b) comparing the measured
level of miR-210 with a hypoxia reference value, wherein measured
levels equal to or greater than the hypoxia reference value
indicate the tumor cells are hypoxic; and (c) contacting the tumor
cells with a miR-210 inhibitor, thereby inhibiting the
proliferation of tumor cells in the subject.
DESCRIPTION OF THE DRAWINGS
[0013] The foregoing aspects and many of the attendant advantages
of this invention will become more readily appreciated as the same
become better understood by reference to the following detailed
description, when taken in conjunction with the accompanying
drawings, wherein:
[0014] FIG. 1 shows that miR-210 is up-regulated by hypoxia in HT29
colon cancer cells exposed to normal conditions (21% O.sub.2) or
hypoxic conditions (1% O.sub.2) as described in Example 1;
[0015] FIG. 2 shows that miR-210 upregulation by hypoxia in HCT116
Dicer.sup.ex5 cells is reduced by siRNA to HIF-1.beta. and
HIF-1.alpha. as described in Example 2;
[0016] FIG. 3A shows that HIF-1.alpha. protein binds to the miR-210
promoter under hypoxic conditions in HuH7 human hepatoma cells as
described in Example 2;
[0017] FIG. 3B shows that HIF-1.alpha. protein binds to the miR-210
promoter under hypoxic conditions in U251 glioma cells as described
in Example 2;
[0018] FIG. 4A shows that pri-miR-210 is overexpressed in human
kidney tumors compared to adjacent normal tissues as described in
Example 3;
[0019] FIG. 4B shows that pri-miR-210 is overexpressed in human
lung tumors compared to adjacent normal tissues as described in
Example 3;
[0020] FIG. 4C shows that pri-miR-210 is overexpressed in human
breast tumors compared to adjacent normal tissues as described in
Example 3;
[0021] FIG. 5 shows that miR-210 expression positively correlates
with genes up-regulated by hypoxia in human tumors as described in
Example 3;
[0022] FIG. 6A shows that overexpression of pri-miR-210 in breast
cancer tumors is positively correlated with the probability of
metastasis of breast cancer cells as described in Example 3;
[0023] FIG. 6B shows that overexpression of pri-miR-210 in melanoma
cancer cells is positively correlated with the probability of
metastasis of melanoma cancer cells as described in Example 3;
[0024] FIG. 7A shows that the introduction of miR-210 or Mnt siRNA
into human foreskin fibroblasts (HFFs) that overexpress c-Myc
results in a decrease in the number of live cells as described in
Example 7;
[0025] FIG. 7B shows that the introduction of miR-210 or Mnt siRNA
into human foreskin fibroblasts that are transduced with an empty
vector (pBABE), and therefore do not overexpress c-Myc, does not
result in a decrease in the number of live cells as described in
Example 7;
[0026] FIG. 7C shows that the introduction of miR-210 or Mnt siRNA
into human foreskin fibroblasts that overexpress c-Myc results in
an increase in the percentage of dead cells as described in Example
7;
[0027] FIG. 7D shows that the introduction of miR-210 or Mnt siRNA
into human foreskin fibroblasts that are transduced with an empty
vector (pBABE), and therefore do not overexpress c-Myc, does not
result in an increase in the percentage of dead cells as described
in Example 7;
[0028] FIG. 8 shows a proposed model illustrating the intersection
of the hypoxia response, miR-210 and c-Myc pathways.
DETAILED DESCRIPTION
[0029] This section presents a detailed description of the many
different aspects and embodiments that are representative of the
inventions disclosed herein. This description is by way of several
exemplary illustrations, of varying detail and specificity. Other
features and advantages of these embodiments are apparent from the
additional descriptions provided herein, including the different
examples. The provided examples illustrate different components and
methodology useful in practicing various embodiments of the
invention. The examples are not intended to limit the claimed
invention. Based on the present disclosure the ordinary skilled
artisan can identify and employ other components and methodology
useful for practicing the present invention.
I. DEFINITIONS
[0030] Unless defined otherwise, all technical and scientific terms
used herein have the meaning commonly understood by one of ordinary
skill in the art to which this invention belongs. Practitioners are
particularly directed to Sambrook et al., Molecular Cloning: A
Laboratory Manual, 2d ed., Cold Spring Harbor Press, Plainsview,
N.Y. (1989), and Ausubel et al., Current Protocols in Molecular
Biology (Supplement 47), John Wiley & Sons, New York (1999),
for definitions and terms of the art.
[0031] It is contemplated that the use of the term "about" in the
context of the present invention is to connote inherent problems
with precise measurement of a specific element, characteristic, or
other trait. Thus, the term "about," as used herein in the context
of the claimed invention, simply refers to an amount or measurement
that takes into account single or collective calibration and other
standardized errors generally associated with determining that
amount or measurement. Thus, any measurement or amount referred to
in this application can be used with the term "about" if that
measurement or amount is susceptible to errors associated with
calibration or measuring equipment, such as a scale, pipetteman,
pipette, graduated cylinder, etc.
[0032] The use of the word "a" or "an" when used in conjunction
with the term "comprising" in the claims and/or the specification
may mean "one," but it is also consistent with the meaning of "one
or more," "at least one," and "one or more than one."The use of the
term "or" in the claims is used to mean "and/or" unless explicitly
indicated to refer to alternatives only or the alternatives are
mutually exclusive, although the disclosure supports a definition
that refers to only alternatives and "and/or."
[0033] As used in this specification and claim(s), the words
"comprising" (and any form of comprising, such as "comprise" and
"comprises"), "having" (and any form of having, such as "have" and
"has"), "including" (and any form of including, such as "includes"
and "include"), or "containing" (and any form of containing, such
as "contains" and "contain") are inclusive or open-ended and do not
exclude additional, unrecited elements or method steps.
[0034] As used herein, the terms "approximately" or "about" in
reference to a number are generally taken to include numbers that
fall within a range of 5% in either direction (greater than or less
than) the number unless otherwise stated or otherwise evident from
the context (except where such number would exceed 100% of a
possible value). Where ranges are stated, the endpoints are
included within the range unless otherwise stated or otherwise
evident from the context.
[0035] It is contemplated that any embodiment discussed in this
specification can be implemented with respect to any method, kit,
reagent, or composition of the invention and vice versa.
Furthermore, compositions of the invention can be used to achieve
methods of the invention.
[0036] As used herein, the term "gene" encompasses the meaning
known to one of skill in the art, i.e., a nucleic acid (e.g., DNA
or RNA) sequence that comprises coding sequences necessary for the
production of an RNA and/or a polypeptide or its precursor, as well
as noncoding sequences (untranslated regions) surrounding the 5'-
and 3'-ends of the coding sequences. The sequences that are located
5' of the coding region and that are present on the mRNA are
referred to as 5'-untranslated sequences ("5'UTR"). The sequences
that are located 3' or downstream of the coding region and that are
present on the mRNA are referred to as 3'-untranslated sequences,
or ("3'UTR"). The term "gene" may include gene regulatory sequences
(e.g., promoters, enhancers, etc.) and/or intron sequences. The
term "gene" encompasses RNA, cDNA, and genomic forms of a gene. The
term "gene" also encompasses nucleic acid sequences that comprise
microRNAs and other non-protein encoding sequences including, for
example, transfer RNAs, ribosomal RNAs, etc. For clarity, the term
gene generally refers to a portion of a nucleic acid that encodes a
protein; the term may optionally encompass regulatory sequences.
This definition is not intended to exclude application of the term
"gene" to non-protein coding expression units but rather to clarify
that, in most cases, the term as used in this document refers to a
protein coding nucleic acid. In some cases, the gene includes
regulatory sequences involved in transcription or message
production or composition. In other embodiments, the gene comprises
transcribed sequences that encode for a protein, polypeptide or
peptide. A functional polypeptide can be encoded by a full length
coding sequence or by any portion of the coding sequence as long as
the desired activity or functional properties (e.g., enzymatic
activity, ligand binding, signal transduction, antigenic
presentation) of the polypeptide are retained.
[0037] In keeping with the terminology described herein, an
"isolated gene" may comprise transcribed nucleic acid(s),
regulatory sequences, coding sequences, or the like, isolated
substantially away from other such sequences, such as other
naturally occurring genes, regulatory sequences, polypeptide or
peptide encoding sequences, etc. In this respect, the term "gene"
is used for simplicity to refer to a nucleic acid comprising a
nucleotide sequence that is transcribed and the complement thereof.
In particular embodiments, the transcribed nucleotide sequence
comprises at least one functional protein, polypeptide, and/or
peptide encoding unit. As will be understood by those in the art,
this functional term "gene" includes both genomic sequences, RNA or
cDNA sequences, or smaller engineered nucleic acid segments
including nucleic acid segments of a non-transcribed part of a gene
including, but not limited to, the non-transcribed promoter or
enhancer regions of a gene. Smaller engineered gene nucleic acid
segments may express or may be adapted to express using nucleic
acid manipulation technology, proteins, polypeptides, domains,
peptides, fusion proteins, mutants, and/or such like.
[0038] The term "gene expression," as used herein, refers to the
process of transcription and translation of a gene to produce a
gene product, be it RNA or protein. Thus, modulation of gene
expression may occur at any one or more of many levels including
transcription, post-transcriptional processing, translation,
post-translational modification, and the like.
[0039] As used herein, the term "expression cassette" refers to a
nucleic acid molecule that comprises at least one nucleic acid
sequence that is to be expressed, along with its transcription and
translational control sequences. The expression cassette typically
includes restriction sites engineered to be present at the 5'- and
3'-ends such that the cassette can be easily inserted, removed, or
replaced in a gene delivery vector. Changing the cassette will
cause the gene delivery vector into which it is incorporated to
direct the expression of a different sequence.
[0040] As used herein, the terms "microRNA species," "microRNA,"
"miRNA," or "mi-R" refer to small, non-protein coding RNA molecules
that are expressed in a diverse array of eukaryotes, including
mammals. MicroRNA molecules typically have a length in the range of
from 15 to 120 nucleotides, the size depending upon the specific
microRNA species and the degree of intracellular processing.
Mature, fully processed miRNAs are about 15 to 30, 15 to 25, or 20
to 30 nucleotides in length and, more often, between about 16 to
24, 17 to 23, 18 to 22, 19 to 21, or 21 to 24 nucleotides in
length. MicroRNAs include processed sequences as well as
corresponding long primary transcripts (pri-miRNAs) and processed
stem-loop precursors (pre-miRNAs). Some microRNA molecules function
in living cells to regulate gene expression via RNA interference. A
representative set of microRNA species is described in the publicly
available miRBase sequence database as described in Griffith-Jones
et al., Nucleic Acids Research 32:D109-D111 (2004), and
Griffith-Jones et al., Nucleic Acids Research 34:D140-D144 (2006),
accessible on the World Wide Web at the Welcome Trust Sanger
Institute Web site.
[0041] As used herein, "miR-210" refers to the mature miR210
microRNA (SEQ ID NO:1). The primary transcript is referred to as
pri-miR-210 (SEQ ID NO:2) (Genbank Accession number: AK123483). The
stem-loop precursor is referred to as pre-miR-210 (SEQ ID NO:3)
(Sanger microRNA database accession number: hsa-mir-210
MI0000286).
[0042] As used herein, the term "microRNA family" refers to a group
of microRNA species that share identity across at least 6
consecutive nucleotides within nucleotide positions 1 to 12 of the
5'-end of the microRNA molecule, also referred to as the "seed
region," as described in Brennecke, J., et al., PloS Biol.
3(3):pe85 (2005). As used herein, the seed region of miR-210
corresponds to SEQ ID NO:4.
[0043] As used herein, the term "microRNA family member" refers to
a microRNA species that is a member of a microRNA family.
[0044] As used herein, the term "microRNA inhibitor" refers to a
nucleic acid molecule that inhibits the function of a microRNA. For
example, the inhibitor may be a single-stranded oligonucleotide
that binds to a mature microRNA by Watson-Crick base pairing, such
as sense-antisense pairing. The antisense oligonucleotide may
comprise chemically modified nucleic acids, such as locked nucleic
acid (LNA) nucleosides and 2'-O-methyl sugar modified RNA. Other
examples of microRNA inhibitors include antagomirs, RNA-like
oligonucleotides comprising complete 2'-O-methylation of sugar, a
phosphorothioate backbone, and a cholesterol-moiety at the 3'-end
(Krutzfeldt, J., et al., Nucleic Acids Res. 35:25885-2892, 2007),
and antisense oligonucleotides with a complete 2'-O-methoxyethyl
and phosphorothioate modification (Esau, C., et al., Cell. Metab.
3:87-98, 2006). Other examples of microRNA inhibitors include
microRNA sponges comprising transcripts with multiple copies of a
microRNA binding site located in the 3' UTR, as described in Ebert,
M. S., et al., Nature Methods 4:721-726, 2007. MicroRNA inhibitors
are also commercially available, for example, from Exiqon A/S
(Denmark); Ambion, Inc. (Austin, Tex.); and Dharmacon, Inc.
(Lafayette, Colo.). Representative non-limiting examples of
microRNA inhibitors are described in Example 4.
[0045] As used herein, the term "RNA interference" or "RNAi" refers
to the silencing, inhibition, or reduction of gene expression by
iRNA ("interfering RNA") agents (e.g., siRNAs, miRNAs, shRNAs) via
the process of sequence-specific, post-transcriptional gene
silencing in animals and plants, initiated by an iRNA agent that
has a seed region sequence in the iRNA guide strand that is
complementary to a sequence of the silenced gene.
[0046] As used herein, the term an "iNA agent" (abbreviation for
"interfering nucleic acid agent"), refers to a nucleic acid agent,
for example, RNA or chemically modified RNA, which can
down-regulate the expression of a target gene. While not wishing to
be bound by theory, an iNA agent may act by one or more of a number
of mechanisms, including post-transcriptional cleavage of a target
mRNA, or pre-transcriptional or pre-translational mechanisms. An
iNA agent can include a single strand (ss) or can include more than
one strands, e.g., it can be a double-stranded (ds) iNA agent.
[0047] As used herein, the term "single strand iRNA agent" or
"ssRNA" is an iRNA agent that consists of a single molecule. It may
include a duplexed region, formed by intra-strand pairing, e.g., it
may be or include a hairpin or panhandle structure. The ssRNA
agents of the present invention include transcripts that adopt
stem-loop structures, such as shRNA, that are processed into a
double stranded siRNA.
[0048] As used herein, the term "dsiNA agent" is a dsNA (double
stranded nucleic acid (NA)) agent that includes two strands that
are not covalently linked, in which interchain hybridization can
form a region of duplex structure. The dsNA agents of the present
invention include silencing dsNA molecules that are sufficiently
short that they do not trigger the interferon response in mammalian
cells.
[0049] As used herein, the term "siRNA" refers to a small
interfering RNA. In some embodiments, siRNA includes the term
microRNA. In other embodiments, siRNA include short interfering RNA
of about 15 to 60, 15 to 50, 15 to 50, or 15 to 40 (duplex)
nucleotides in length, more typically about 15 to 30, 15 to 25, or
19 to 25 (duplex) nucleotides in length and is preferably about 20
to 24 or about 21 to 22 or 21 to 23 (duplex) nucleotides in length
(e.g., each complementary sequence of the double stranded siRNA is
15 to 60, 15 to 50, 15 to 50, 15 to 40, 15 to 30, 15 to 25, or 19
to 25 nucleotides in length, preferably about 20 to 24 or about 21
to 22 or 21 to 23 nucleotides in length, preferably 19 to 21
nucleotides in length, and the double stranded siRNA is about 15 to
60, 15 to 50, 15 to 50, 15 to 40, 15 to 30, 15 to 25, or 19 to 25,
preferably about 20 to 24 or about 21 to 22 or 19 to 21 or 21 to 23
base pairs in length). siRNA duplexes may comprise 3'-overhangs of
about 1 to about 4 nucleotides, preferably of about 2 to about 3
nucleotides and 5'-phosphate termini. In some embodiments, the
siRNA lacks a terminal phosphate.
[0050] Non-limiting examples of siRNA molecules of the invention
may include a double-stranded polynucleotide molecule comprising
self-complementary sense and antisense regions, wherein the
antisense region comprises nucleotide sequence that is
complementary to nucleotide sequence in a target nucleic acid
molecule or a portion thereof (alternatively referred to as the
guide region or guide strand when the molecule contains two
separate strands) and the sense region having nucleotide sequence
corresponding to the target nucleic acid sequence or a portion
thereof (also referred as the passenger region or the passenger
strand when the molecule contains two separate strands). The siRNA
can be assembled from two separate oligonucleotides, where one
strand is the sense strand and the other is the antisense strand,
wherein the antisense and sense strands are self-complementary
(i.e., each strand comprises nucleotide sequence that is
complementary to nucleotide sequence in the other strand; such as
where the antisense strand and sense strand form a duplex or double
stranded structure, for example, wherein the double stranded region
is about 18 to about 30, e.g., about 18, 19, 20, 21, 22, 23, 24,
25, 26, 27, 28, 29, or 30 base pairs); the antisense strand (guide
strand) comprises nucleotide sequence that is complementary to
nucleotide sequence in a target nucleic acid molecule or a portion
thereof and the sense strand (passenger strand) comprises
nucleotide sequence corresponding to the target nucleic acid
sequence or a portion thereof (e.g., about 15 to about 25
nucleotides of the siRNA molecule are complementary to the target
nucleic acid or a portion thereof). Typically, a short interfering
RNA (siRNA) refers to a double-stranded RNA molecule of about 17 to
about 29 base pairs in length, preferably from 19 to 21 base pairs,
one strand of that is complementary to a target mRNA, that when
added to a cell having the target mRNA or produced in the cell in
vivo, causes degradation of the target mRNA. Preferably the siRNA
is perfectly complementary to the target mRNA, but it may have one
or two mismatched base pairs. Table 1 shows the nucleotide
sequences of the guide strands of miRNAs and siRNAs of the
invention.
TABLE-US-00001 TABLE 1 SEQ ID NOs: of miRNAs and siRNAs SEQ Guide
Strand Sequence ID Identifier (5' to 3') NO: miR-210
CUGUGCGUGUGACAGCGGCUG 1 miR-210 CUGUGCGUGUGA 4 seed region miR-210
mt CUGUCGGUGUGACAGCGGCUG 5 HIF-1.alpha. siRNA1
GUCCUUAAACCGGUUGAAUdTdT 6 HIF-1.alpha. siRNA2
GCAACUUGAGGAAGUACCAdTdT 7 HIF-1.alpha. siRNA3
CCUAAUAGUCCCAGUGAAUdTdT 8 HIF-1.beta. siRNA1
GGCUCAAGGAGAUCGUUUAdTdT 9 HIF-1.beta. siRNA2
GAAUGGACUUGGCUCUGUAdTdT 10 HIF-1.beta. siRNA3
GCCACAGUCUGAAUGGUUUdTdT 11 HIF-2.alpha. siRNA1
CGGGCCAGGUGAAAGUCUAdTdT 12 HIF-2.alpha. siRNA2
GCGACAGCUGGAGUAUGAAdTdT 13 HIF-2.alpha. siRNA3
GCUUCAGUGCCAUGACAAAdTdT 14 Mnt siRNA1 CGUCCAAUCUGAGCGUGCUTT 15 Mnt
siRNA2 GCUGGCACGUGAGAAGAUUTT 16 Mnt siRNA3 GGUACAUCCAGUCCCUGAATT 17
Myc siRNA1 GCUUGUACCUGCAGGAUCUTT 18 Myc siRNA2
CGAUGUUGUUUCUGUGGAATT 19 Myc siRNA3 CGAGAACAGUUGAAACACATT 20
[0051] Alternatively, the siRNA is assembled from a single
oligonucleotide, where the self-complementary sense and antisense
regions of the siRNA are linked by means of a nucleic acid based or
non-nucleic acid-based linker(s). The siRNA can be a polynucleotide
with a duplex, asymmetric duplex, hairpin or asymmetric hairpin
secondary structure, having self-complementary sense and antisense
regions, wherein the antisense region comprises nucleotide sequence
that is complementary to nucleotide sequence in a separate target
nucleic acid molecule or a portion thereof and the sense region
having nucleotide sequence corresponding to the target nucleic acid
sequence or a portion thereof. The siRNA can be a circular
single-stranded polynucleotide having two or more loop structures
and a stem comprising self-complementary sense and antisense
regions, wherein the antisense region comprises nucleotide sequence
that is complementary to nucleotide sequence in a target nucleic
acid molecule or a portion thereof and the sense region having
nucleotide sequence corresponding to the target nucleic acid
sequence or a portion thereof, and wherein the circular
polynucleotide can be processed either in vivo or in vitro to
generate an active siRNA molecule capable of mediating RNAi. The
siRNA can also comprise a single stranded polynucleotide having
nucleotide sequence complementary to nucleotide sequence in a
target nucleic acid molecule or a portion thereof (for example,
where such siRNA molecule does not require the presence within the
siRNA molecule of nucleotide sequence corresponding to the target
nucleic acid sequence or a portion thereof), wherein the single
stranded polynucleotide can further comprise a terminal phosphate
group, such as a 5'-phosphate (see, for example, Martinez et al.,
Cell 110:563-574, 2002; and Schwarz et al., Molecular Cell
10:537-568, 2002), or 5',3'-diphosphate. In certain embodiments,
the siRNA molecule of the invention comprises separate sense and
antisense sequences or regions, wherein the sense and antisense
regions are covalently linked by nucleotide or non-nucleotide
linkers molecules as is known in the art, or are alternately
non-covalently linked by ionic interactions, hydrogen bonding, van
der Waals interactions, hydrophobic interactions, and/or stacking
interactions. In certain embodiments, the siRNA molecules of the
invention comprise nucleotide sequence that is complementary to
nucleotide sequence of a target gene. In another embodiment, the
siRNA molecule of the invention interacts with nucleotide sequence
of a target gene in a manner that causes inhibition of expression
of the target gene.
[0052] As used herein, the miRNA and siRNA molecules need not be
limited to those molecules containing only RNA but may further
encompasses chemically-modified nucleotides and non-nucleotides.
For example, International PCT Publications No. WO 2005/078097, WO
2005/0020521, and WO 2003/070918 detail various chemical
modifications to RNAi molecules, wherein the contents of each
reference are incorporated by reference in its entirety. In certain
embodiments for example, the short interfering nucleic acid
molecules may lack 2'-hydroxy (2'-OH) containing nucleotides. The
siRNA can be chemically synthesized or may be encoded by a plasmid
(e.g., transcribed as sequences that automatically fold into
duplexes with hairpin loops). siRNA can also be generated by
cleavage of longer dsRNA (e.g., dsRNA greater than about 25
nucleotides in length) with the E. coli RNase III or Dicer. These
enzymes process the dsRNA into biologically active siRNA (see,
e.g., Yang et al., PNAS USA 99:9942-7, 2002; Calegari et al., PNAS
USA 99:14236, 2002; Byrom et al., Ambion TechNotes 10(1):4-6, 2003;
Kawasaki et al., Nucleic Acids Res. 31:981-7, 2003; Knight and
Bass, Science 293:2269-71, 2001; and Robertson et al., J. Biol.
Chem. 243:82, 1968). The long dsRNA can encode for an entire gene
transcript or a partial gene transcript.
[0053] As used herein, "percent modification" refers to the number
of nucleotides in each of the strand of the siRNA or to the
collective dsRNA that have been modified. Thus, 19% modification of
the antisense strand refers to the modification of up to 4
nucleotides/bp in a 21 nucleotide sequence (21 mer). One hundred
percent (100%) refers to a fully modified dsRNA. The extent of
chemical modification will depend upon various factors well known
to one skilled in the art such as, for example, target mRNA,
off-target silencing, degree of endonuclease degradation, etc.
[0054] As used herein, the term "shRNA" or "short hairpin RNAs"
refers to an RNA molecule that forms a stem-loop structure in
physiological conditions, with a double-stranded stem of about 17
to about 29 base pairs in length, where one strand of the
base-paired stem is complementary to the mRNA of a target gene. The
loop of the shRNA stem-loop structure may be any suitable length
that allows inactivation of the target gene in vivo. While the loop
may be from 3 to 30 nucleotides in length, typically it is 1 to 10
nucleotides in length. The base paired stem may be perfectly base
paired or may have 1 or 2 mismatched base pairs. The duplex portion
may, but typically does not, contain one or more bulges consisting
of one or more unpaired nucleotides. The shRNA may have
non-base-paired 5'- and 3'-sequences extending from the base-paired
stem. Typically, however, there is no 5'-extension. The first
nucleotide of the shRNA at the 5'-end is a G, because this is the
first nucleotide transcribed by polymerase III. If G is not present
as the first base in the target sequence, a G may be added before
the specific target sequence. The 5'G typically forms a portion of
the base-paired stem. Typically, the 3'-end of the shRNA is a poly
U segment that is a transcription termination signal and does not
form a base-paired structure. As described in the application and
known to one skilled in the art, shRNAs are processed into siRNAs
by the conserved cellular RNAi machinery. Thus shRNAs are
precursors of siRNAs and are, in general, similarly capable of
inhibiting expression of a target mRNA transcript. For the purpose
of description, in certain embodiments, the shRNA constructs of the
invention target one or more mRNAs that are targeted by miR-210.
The strand of the shRNA that is antisense to the target gene
transcript is also known as the "guide strand."
[0055] As used herein, the term "microRNA responsive target site"
refers to a nucleic acid sequence ranging in size from about 5 to
about 25 nucleotides (such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides) that is
complementary, or essentially complementary, to at least a portion
of a microRNA molecule. In some embodiments, the microRNA
responsive target site comprises at least 6 consecutive
nucleotides, at least 7 consecutive nucleotides, at least 8
consecutive nucleotides, or at least 9 nucleotides that are
complementary to the seed region of a microRNA molecule (i.e.,
within nucleotide positions 1 to 12 of the 5'-end of the microRNA
molecule, referred to as the "seed region."
[0056] The phrase "inhibiting expression of a target gene" refers
to the ability of an RNAi agent such as a microRNA or an siRNA to
silence, reduce, or inhibit expression of a target gene. Said
another way, to "inhibit," "down-regulate," or "reduce," is meant
that the expression of the gene, or level of RNA molecules or
equivalent RNA molecules encoding one or more proteins or protein
subunits, or activity of one or more proteins or protein subunits,
is reduced below that observed in the absence of the RNAi agent.
For example, an embodiment of the invention comprises introduction
of a miR-210-like siRNA molecule into cells to inhibit,
down-regulate, or reduce expression of one or more genes regulated
by miR-210 as compared to the level observed for the miR-210
regulated gene in a control cell to which a miR-210-like siRNA
molecule has not been introduced. As used herein, the term
"miR-210-like" siRNA refers to a siRNA that shares at least 6
consecutive nucleotides within nucleotide positions 1 to 12 of SEQ
ID NO:1. In another embodiment, inhibition, down-regulation, or
reduction contemplates inhibition of the target miR-210 responsive
genes below the level observed in the presence of, for example, a
miR210-like siRNA molecule with scrambled sequence or with
mismatches. In yet another embodiment, inhibition, down-regulation,
or reduction of gene expression with a miR210-like siRNA molecule
of the instant invention is greater in the presence of the
invention miR210-like siRNA (e.g., siRNA that down regulates one or
more miR-210 pathway gene mRNA levels), than in its absence. In one
embodiment, inhibition, down regulation, or reduction of gene
expression is associated with post transcriptional silencing, such
as RNAi mediated cleavage of a target nucleic acid molecule (e.g.,
RNA) or inhibition of translation.
[0057] To examine the extent of gene silencing, a test sample
(e.g., a biological sample from organism of interest expressing the
target gene(s) or a sample of cells in culture expressing the
target gene(s)) is contacted with an siRNA that silences, reduces,
or inhibits expression of the target gene(s). Expression of the
target gene in the test sample is compared to expression of the
target gene in a control sample (e.g., a biological sample from
organism of interest expressing the target gene or a sample of
cells in culture expressing the target gene) that is not contacted
with the siRNA. Control samples (i.e., samples expressing the
target gene) are assigned a value of 100%. Silencing, inhibition,
or reduction of expression of a target gene is achieved when the
value of test the test sample relative to the control sample is
about 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%,
35%, 30%, 25%, 20%, or 10%. Suitable assays include, e.g.,
examination of protein or mRNA levels using techniques known to
those of skill in the art such as dot blots, northern blots, in
situ hybridization, ELISA, microarray hybridization,
immunoprecipitation, enzyme function, as well as phenotypic assays
known to those of skill in the art.
[0058] An "effective amount" or "therapeutically effective amount"
of an siRNA or an RNAi agent is an amount sufficient to produce the
desired effect. In one embodiment of the methods of the invention,
an effective amount is an amount sufficient to produce the effect
of inhibition of expression of a target sequence in comparison to
the normal expression level detected in the absence of the siRNA or
RNAi agent. Inhibition of expression of a target gene or target
sequence by a siRNA or RNAi agent is achieved when the expression
level of the target gene mRNA or protein is about 90%, 80%, 70%,
60%, 50%, 40%, 30%, 25%, 20%, 15%, 10%, 5%, or 0% relative to the
expression level of the target gene mRNA or protein of a control
sample. In another embodiment of the invention, an effective amount
is an amount of an siRNA or RNAi agent sufficient to inhibit the
proliferation of a mammalian cell overexpressing Myc.
[0059] As used herein, the term "isolated" in the context of an
isolated nucleic acid molecule is one that is altered or removed
from the natural state through human intervention. For example, an
RNA naturally present in a living animal is not "isolated." A
synthetic RNA or dsRNA or microRNA molecule partially or completely
separated from the coexisting materials of its natural state is
"isolated." Thus, an miRNA molecule that is deliberately delivered
to or expressed in a cell is considered an "isolated" nucleic acid
molecule.
[0060] By "modulate" it is meant that the expression of the gene or
level of RNA molecule or equivalent RNA molecules encoding one or
more proteins or protein subunits or activity of one or more
proteins or protein subunits is up-regulated or down-regulated,
such that expression, level, or activity is greater than or less
than that observed in the absence of the modulator. For example,
the term "modulate" can mean "inhibit," "up-regulate," or
"down-regulate," but the use of the word "modulate" is not limited
to this definition.
[0061] As used herein, "RNA" refers to a molecule comprising at
least one ribonucleotide residue. The term "ribonucleotide" means a
nucleotide with a hydroxyl group at the 2'-position of a
.beta.-D-ribofuranose moiety. The terms include double-stranded
RNA, single-stranded RNA, isolated RNA such as partially purified
RNA, essentially pure RNA, synthetic RNA, recombinantly produced
RNA, as well as altered RNA that differs from naturally occurring
RNA by the addition, deletion, substitution and/or alteration of
one or more nucleotides. Such alterations can include addition of
non-nucleotide material, such as to the end(s) of an RNAi agent or
internally, for example, at one or more nucleotides of the RNA.
Nucleotides in the RNA molecules of the instant invention can also
comprise non-standard nucleotides, such as non-naturally occurring
nucleotides or chemically synthesized nucleotides or
deoxynucleotides. These altered RNAs can be referred to as analogs
or analogs of naturally-occurring RNA.
[0062] As used herein, the term "complementary" refers to nucleic
acid sequences that are capable of base-pairing according to the
standard Watson-Crick complementary rules. That is, the larger
purine will base pair with the smaller pyrimidines to form
combinations of guanine paired with cytosine (G:C) and adenine
paired with either thymine (A:T) in the case of DNA, or adenine
paired with uracil (A:U) in the case of RNA.
[0063] As used herein, the term "essentially complementary" with
reference to microRNA target sequences refers to microRNA target
nucleic acid sequences that are longer than 8 nucleotides that are
complementary (an exact match) to at least 8 consecutive
nucleotides of the 5'-portion of a microRNA molecule from
nucleotide positions 1 to 12, (also referred to as the "seed
region"), and are at least 65% complementary (such as at least 70%,
at least 75%, at least 80%, at least 85%, at least 90%, at least
95%, or at least 96% identical) across the remainder of the
microRNA target nucleic acid sequence as compared to the naturally
occurring microRNA.
[0064] As used herein, "percent identity" refers to the number of
exact matches, expressed as a percentage of the total, between two
nucleotide or amino acid sequences. The comparison of sequences and
determination of percent identity and similarity between two
sequences can be accomplished using a mathematical algorithm of
Karlin and Altschul (PNAS 87:2264-2268, 1990), modified as in
Karlin and Altschul (PNAS 90:5873-5877, 1993). Such an algorithm is
incorporated into the NBLAST and XBLAST programs of Altschul et al.
(J. Mol. Biol. 215:403-410, 1990).
[0065] As used herein, the term "phenotype" encompasses the meaning
known to one of skill in the art, including modulation of the
expression of one or more genes as measured by gene expression
analysis or protein expression analysis.
[0066] As used herein, the term "cancer" means any disease,
condition, trait, genotype, or phenotype characterized by
unregulated cell growth or replication as is known in the art
including cancers of the blood such as leukemias, for example,
acute myelogenous leukemia (AML), chronic myelogenous leukemia
(CML), acute lymphocytic leukemia (ALL), and chronic lymphocytic
leukemia; lymphomas including, but not limited to, Hodgkin and
non-Hodgkin lymphomas, Burkitt's lymphoma, and other B-cell
lymphomas, myelomas, and myelodysplastic syndrome; AIDS-related
cancers such as Kaposi's sarcoma; breast cancers; bone cancers,
such as osteosarcoma, chondrosarcomas, Ewing's sarcoma,
fibrosarcomas, giant cell tumors, adamantinomas, and chordomas;
brain cancers such as meningiomas, glioblastomas, lower-grade
astrocytomas, oligodendrocytomas, pituitary tumors, Schwannomas,
and metastatic brain cancers; cancers of the head and neck
including various lymphomas such as mantle cell lymphoma,
non-Hodgkins lymphoma, adenoma, squamous cell carcinoma, laryngeal
carcinoma, gallbladder and bile duct cancers, cancers of the retina
such as retinoblastoma, cancers of the esophagus, gastric cancers,
multiple myeloma, ovarian cancer, uterine cancer, thyroid cancer,
testicular cancer, endometrial cancer, melanoma, colorectal cancer,
lung cancer, bladder cancer, prostate cancer, lung cancer
(including non-small cell lung carcinoma), pancreatic cancer,
sarcomas, Wilms' tumor, cervical cancer, head and neck cancer, skin
cancers, nasopharyngeal carcinoma, liposarcoma, epithelial
carcinoma, renal cell carcinoma, gallbladder adeno carcinoma,
parotid adenocarcinoma, endometrial sarcoma, multidrug resistant
cancers; and proliferative diseases and conditions, such as
neovascularization associated with tumor angiogenesis, macular
degeneration (e.g., wet/dry AMD), corneal neovascularization,
diabetic retinopathy, neovascular glaucoma, myopic degeneration and
other proliferative diseases and conditions such as restenosis and
polycystic kidney disease; and any other cancer or proliferative
disease, condition, trait, genotype or phenotype that can respond
to the modulation of disease related gene expression in a cell or
tissue, alone or in combination with other therapies.
[0067] As used herein, the term cancer includes the terms "tumor,"
"malignant tumor," and "neoplasm," as those terms are understood in
the art. A cancer cell is a cell derived from a cancer or tumor and
includes tumor stem cells.
[0068] As used herein, the term to "inhibit the proliferation of a
mammalian cell" means to kill the cell or permanently or
temporarily arrest the growth of the cell. Inhibition of the
proliferation of a mammalian cell can be inferred if the number of
such cells, either in an in vitro culture vessel or in a subject,
remains constant or decreases after administration of the
compositions of the invention. An inhibition of tumor cell
proliferation can also be inferred if the absolute number of such
cells increases, but the rate of tumor growth decreases. As used
herein, "cell death" includes apoptosis and programmed cell death
as those terms are understood in the art, and also includes cell
cycle arrest. As used herein, the term "reducing the tumor burden
in a subject" refers to inhibiting the growth rate of a tumor,
slowing or stopping the growth of the tumor, reducing the size of
the tumor, or partial or complete remission of the tumor in the
subject.
[0069] As used herein, the terms "measuring expression levels,"
"obtaining an expression level," and the like includes methods that
quantify a gene expression level of, for example, a transcript of a
gene, including microRNA (miRNA) or a protein encoded by a gene, as
well as methods that determine whether a gene of interest is
expressed at all. Thus, an assay that provides a "yes" or "no"
result without necessarily providing quantification of an amount of
expression is an assay that "measures expression" as that term is
used herein. Alternatively, a measured or obtained expression level
may be expressed as any quantitative value, for example, a
fold-change in expression, up or down, relative to a control gene
or relative to the same gene in another sample or a log ratio of
expression, or any visual representation thereof, such as, for
example, a "heatmap" where a color intensity is representative of
the amount of gene expression detected. Exemplary methods for
detecting the level of expression of a gene include, but are not
limited to, Northern blotting, dot or slot blots, reporter gene
matrix (see, for example, U.S. Pat. No. 5,569,588) nuclease
protection, RT-PCR, microarray profiling, differential display,
Western blot analysis, 2D gel electrophoresis, SELDI-TOF, ICAT,
enzyme assay, antibody assay, and the like.
[0070] As used herein, an "isolated nucleic acid" is a nucleic acid
molecule that exists in a physical form that is non-identical to
any nucleic acid molecule of identical sequence as found in nature;
"isolated" does not require, although it does not prohibit, that
the nucleic acid so described has itself been physically removed
from its native environment. For example, a nucleic acid can be
said to be "isolated" when it includes nucleotides and/or
internucleoside bonds not found in nature. When instead composed of
natural nucleosides in phosphodiester linkage, a nucleic acid can
be said to be "isolated" when it exists at a purity not found in
nature, where purity can be adjudged with respect to the presence
of nucleic acids of other sequence, with respect to the presence of
proteins, with respect to the presence of lipids, or with respect
to the presence of any other component of a biological cell, or
when the nucleic acid lacks sequence that flanks an otherwise
identical sequence in an organism's genome or when the nucleic acid
possesses sequence not identically present in nature. As so
defined, "isolated nucleic acid" includes nucleic acids integrated
into a host cell chromosome at a heterologous site, recombinant
fusions of a native fragment to a heterologous sequence,
recombinant vectors present as episomes or as integrated into a
host cell chromosome.
[0071] The terms "over-expression," "over-expresses,"
"over-expressing" and the like, refer to the state of altering a
subject such that expression of one or more genes in said subject
is significantly higher, as determined using one or more
statistical tests, than the level of expression of said gene or
genes in the same unaltered subject or an analogous unaltered
subject.
[0072] As used herein, a "purified nucleic acid" represents at
least 10% of the total nucleic acid present in a sample or
preparation. In preferred embodiments, the purified nucleic acid
represents at least about 50%, at least about 75%, or at least
about 95% of the total nucleic acid in an isolated nucleic acid
sample or preparation. Reference to "purified nucleic acid" does
not require that the nucleic acid has undergone any purification
and may include, for example, chemically synthesized nucleic acid
that has not been purified.
[0073] As used herein, "specific binding" refers to the ability of
two molecular species concurrently present in a heterogeneous
(inhomogeneous) sample to bind to one another in preference to
binding to other molecular species in the sample. Typically, a
specific binding interaction will discriminate over adventitious
binding interactions in the reaction by at least 2-fold, more
typically by at least 10-fold, often at least 100-fold; when used
to detect analyte, specific binding is sufficiently discriminatory
when determinative of the presence of the analyte in a
heterogeneous (inhomogeneous) sample. Typically, the affinity or
avidity of a specific binding reaction is least about 1 .mu.M
(micro Molar).
[0074] As used herein, "subject" refers to an organism or to a cell
sample, tissue sample, or organ sample derived therefrom including,
for example, cultured cell lines, biopsy, blood sample, or fluid
sample containing a cell. For example, an organism may be an animal
including, but not limited to, an animal such as a cow, a pig, a
mouse, a rat, a chicken, a cat, a dog, etc., and is usually a
mammal, such as a human. As used herein, a "patient" is a subject
who has or may have a disease.
[0075] As used herein, the term "treatment" refers to
administration of one or more agents or therapeutic compounds for
the purpose of alleviating the symptoms of disease, halting or
slowing the progression or worsening of those symptoms, or
prevention or prophylaxis of disease. For example, successful
treatment may include an alleviation of symptoms or halting the
progression of cancer, as measured by a reduction in the growth
rate of a tumor, a reduction in the size of a tumor, partial or
complete remission of the tumor, or increased survival rate or
clinical benefit.
[0076] Treatment regimens as contemplated herein are well known to
those skilled in the art. For example, without limitation, an agent
may be administered to a patient in need thereof daily for 7, 14,
21, or 28 days followed by 7 or 14 days without administration of
the compound. In some embodiments, the treatment cycle comprises
administering the amount of an agent daily for 7 days followed by 7
days without administration of the compound. A treatment cycle may
be repeated one or more times to provide a course of treatment. In
addition, an agent may be administered once, twice, three times, or
four times daily during the administration phase of the treatment
cycle. In other embodiments, the methods further comprise
administering the amount of an agent once, twice, three times, or
four times daily or every other day during a course of
treatment.
[0077] In some embodiments, the treatment regimens further include
administering an agent as part of a treatment cycle. A treatment
cycle includes an administration phase during which an agent is
given to the subject on a regular basis and a holiday, during which
the compound is not administered. For example, the treatment cycle
may comprise administering the agent daily for 7, 14, 21, or 28
days, followed by 7 or 14 days without administration of the agent.
In some embodiments, the treatment cycle comprises administering
the agent daily for 7 days followed by 7 days without
administration of the agent. A treatment cycle may be repeated one
or more times to provide a course of treatment. In addition, an
agent may be administered once, twice, three times, or four times
daily during the administration phase of the treatment cycle. In
other embodiments, the methods further comprise administering the
amount of an agent once, twice, three times, or four times daily or
every other day during a course of treatment. A course of treatment
refers to a time period during which the subject undergoes
treatment for cancer by the present methods. Thus, a course of
treatment may extend for one or more treatment cycles or refer to
the time period during which the subject receives daily or
intermittent doses of an agent.
[0078] As used herein, "hypoxia" refers to a reduced oxygen
concentration or oxygen tension in tissues, as the term is
understood by those of skill in the art. In one embodiment, hypoxia
refers to decreased oxygen concentration or tension levels in tumor
tissues as compared to normal, non-tumor tissues. In another
embodiment, hypoxia refers to oxygen concentrations of 0.2% to 2.0%
in tumor tissues or oxygen concentrations of 0.2% to 2.0% at or
near the external surface of tumor cells. In some embodiments,
hypoxia refers to oxygen concentrations of 1.0% or less in tumor
tissues or oxygen concentrations of 1.0% or less at or near the
external surface of tumor cells.
[0079] As used herein, "hypoxia inducible factor" (HIF) refers to a
family of transcription factors that activate transcription of
target genes during hypoxia. The HIF family includes the
polypeptides HIF-1.alpha. (hypoxia-inducible factor 1.alpha.),
HIF-1.beta. (otherwise known as aryl hydrocarbon receptor nuclear
translocator (ARNT)), and HIF-2.alpha.(otherwise known as
endothelial PAS domain protein 1 (EPAS1)), and naturally occurring
isoforms thereof. As used herein, HIF-1.alpha. includes isoform 1
(SEQ ID NO:31) and isoform 2 (SEQ ID NO:32). HIF-1.beta. includes
isoform 1 (SEQ ID NO:33), isoform 2 (SEQ ID NO:34), and isoform 3
(SEQ ID NO:35). HIF-2.alpha. includes SEQ ID NO:36.
[0080] As used herein, "metastasis" refers to the process by which
cancer cells spread from the primary tumor to other locations in
the body.
[0081] As used herein, "metastatic potential" refers to the
probability or likelihood that tumor cells will spread or
metastasize from their current location, for example the primary
tumor, to other locations in the body of a subject or patient. The
term also refers to the probability that a patient will develop a
cancer metastasis.
[0082] As use herein, "tumor" refers to an abnormal growth or mass
of tissue, or a mass of cancer cells that arise from organs or
other solid tissues, and includes the term neoplasm. As used
herein, the term tumor generally refers to malignant tumors which
are capable of spreading or metastasizing to other parts of the
body. As used herein, a "tumor cell" is a cell derived from a tumor
or other type of cancer, including non-solid tumors, such as
cancers of the blood, including leukemia, multiple myeloma, or
lymphoma. The term tumor cell also includes cancer stem cells and
tumor stem cells (see for example, Hermann, P. C., et al.,
"Metastatic Cancer Stem Cells: A New Target for Anti-Cancer
Therapy?" Cell Cycle 7:188-193, 2008). As used herein, the terms
"tumor" and "cancer" may be used interchangeably.
[0083] As used herein, "apoptosis" refers to cell death, including
but not limited to "programmed cell death". In one embodiment,
apoptosis refers to death of cancer or tumor cells. As used herein,
"synthetic lethal" refers to functional changes in two distinct
genes or genetic pathways that result in cell death. In one
embodiment, synthetic lethal refers to overexpression of a gene and
a microRNA that results in cell death. In another embodiment,
synthetic lethal refers to overexpression of one gene and decreased
expression or inhibition of another gene, which results in cell
death.
[0084] As used herein, "polymorphism" refers to a naturally
occurring variation in a nucleotide sequence between individuals or
between species. For example, a polymorphism may be a single
nucleotide polymorphism (SNP), wherein an SNP represents a single
nucleotide change between two alleles of a gene. A polymorphism may
also encompass more than one nucleotide difference between two
related nucleotide sequences or two alleles of a gene.
[0085] As used herein, "isoform" refers to one version of a protein
or polypeptide that is different from another isoform of the
protein or polypeptide between individuals or between species.
Different isoforms may be encoded by different genes or from the
same gene, for example by alternate splicing of RNA molecules.
Isoforms may also arise from single nucleotide polymorphisms
(SNPs), wherein an SNP represents a single nucleotide change
between two alleles of a gene. Isoforms may be distinguished from
other isoforms by size or by amino acid sequence.
II. ASPECTS AND EMBODIMENTS OF THE INVENTION
[0086] One aspect of the invention relates to the use of miR-210 as
a biomarker for hypoxia in a cell. Another aspect of the invention
relates to the use of miR-210 to predict the likelihood of
metastasis of a tumor. Another aspect of the invention relates to
the use of miR-210 or miR-210-like siRNA molecules (siRNAs
structurally and functionally similar to miR-210) to inhibit the
proliferation of tumor cells that overexpress Myc. Another aspect
of the invention relates to a method for inhibiting the
proliferation of tumor cells expressing Myc by contacting the tumor
cells with an inhibitor of an RNA or polypeptide encoded by one or
more genes that are down-regulated by miR-210, such as Mnt (SEQ ID
NOs:29, 30). In yet another aspect, the invention relates to a
method of inhibiting the proliferation of tumor cells that
overexpress miR-210 by administering an inhibitor of HIF to the
tumor cells.
[0087] A. The Use of miR-210 as a Biomarker for Hypoxia in Tumor
Cells
[0088] In one aspect, the present invention provides a method for
determining the presence of hypoxia in tumor cells isolated from a
subject. In one embodiment, the method comprises isolating cells
from tumors and adjacent non-tumor tissue from a subject; measuring
the expression levels of miR-210 in the tumor and non-tumor cells;
and comparing the measured expression levels of miR-210 to a
hypoxia reference value, wherein expression levels of miR-210 above
the hypoxia reference value are indicative of hypoxia in the cells.
In another embodiment, the method comprises measuring the amount of
miR-210 present in tumor cells from a subject, and comparing the
measured amount of miR-210 with a hypoxia reference value, wherein
expression levels of mIR-210 greater than the hypoxia reference
value are indicative of hypoxia in the cells. As described in
Example 1, it has been determined by the inventors that the
presence of hypoxia correlates with increased miR-210 expression in
tumor cells exposed to hypoxic conditions (1% O.sub.2) relative to
tumor cells exposed to normal (ambient) oxygen levels (21%
O.sub.2).
[0089] In one embodiment of this aspect of the invention, the
expression level of miR-210 is determined by measuring the amount
the mature microRNA (SEQ ID NO:1). The amount of miR-210 present in
cells or tissues can be measured using methods such as nucleic acid
hybridization (Lu et al., Nature 435:834-838, 2005), quantitative
polymerase chain reaction (Raymond et al., "Simple, Quantitative
Primer-Extension PCR Assay for Direct Monitoring of microRNAs and
Short-Interfering RNAs," RNA 11:1737-1744, 2006), incorporated
herein by reference, or any other method that is capable of
providing a measured level (either as a quantitative amount or as
an amount relative to a standard or control amount, i.e., a ratio
or a fold-change) of a micro-RNA within a cell or tissue sample. In
another embodiment, the expression level of miR-210 is determined
by measuring the amount of the primary transcript, pri-miR-210 (SEQ
ID NO:2). The amount of pri-miR-210 present in cells or tissues can
be measured using methods such as gene expression profiling using
microarrays (Jackson et al., "Expression Profiling Reveals
Off-Target Gene Regulation by RNAi," Nat. Biotech. 21:635-637,
2003) or any other method that is capable of providing a measured
level (either as a quantitative amount or as an amount relative to
a standard or control amount, i.e., a ratio or a fold-change) of an
RNA within a cell or tissue sample. In another embodiment, the
expression level of miR-210 is determined by measuring the amount
of the stem-loop precursor, pre-miR-210 (SEQ ID NO:3).
[0090] In one embodiment, the difference between the measured level
of miR-210 in the cell sample and the hypoxia reference value is
evaluated using one or more statistical tests known in the art.
Based upon the outcome of the one or more statistical tests, the
measured level of miR-210 is used to classify the tumor as hypoxic
or non-hypoxic in a statistically significant fashion. For example,
the tumor may be classified as hypoxic if the level of miR-210 in
the cell sample is at least 1.5-fold greater than the hypoxia
reference value, or at least 2-fold greater than the hypoxia
reference value, or at least 3-, 4-, 5-, 6-, 7-, 8-, 9-, 10-, 11-,
12-, 13-, 14-, 15-, 16-, 17-, 18-, 19-, 20-, 25-, or 30-fold
greater than hypoxia reference value.
[0091] In some embodiments, the hypoxia reference value is
determined by measuring the amount of miR-210 in non-tumor cells
taken from the subject. The non-tumor cells may be from adjacent,
non-involved (normal) tissue from the same tissue-type as the
tumor--for example, breast tissue or lung tissue. In other
embodiments, the hypoxia reference value is determined by measuring
the amount of miR-210 in cells from a plurality of non-tumor
samples obtained from one or more subjects. In another embodiment,
the hypoxia reference value is determined by measuring the amount
of miR-210 in cells that are not exposed to hypoxic conditions. In
this embodiment, the cells may be from tumor cell lines or primary
cells cultured in vitro. Exemplary methods in accordance with this
embodiment are described in Example 1.
[0092] B. miR-210 Expression Predicts the Probability of Tumor
Metastasis
[0093] In another aspect, the present invention provides a method
for predicting the likelihood of metastasis of a tumor in a subject
based on expression levels of miR-210. This aspect of the invention
is useful because it will provide more effective treatment options
for patients whose tumors are predicted to metastasize based on
expression levels of miR-210. It is contemplated that the
likelihood of metastasis is correlated with patient prognosis and
disease outcome, whereby a high likelihood of metastasis is
correlated with a poor patient prognosis, and a low likelihood of
metastasis is correlated with a good patient outcome.
[0094] In one embodiment, the measured level of miR-210 in a tumor
cell sample is compared to a metastasis reference value, wherein an
increase in miR-210 level relative to the metastasis reference
value is correlated with the probability of the patient developing
metastasis. As described in Example 3, it has been determined that
miR-210 expression is upregulated in kidney, lung and breast
tumors. As shown in FIG. 6A, upregulation of miR-210 positively
correlates with the metastatic potential of breast cancer tumors,
and inversely correlates with metastasis-free survival. Thus, in
one embodiment, the method is useful for predicting metastasis of
kidney, lung and breast tumor cells. As shown in FIG. 6B,
upregulation of miR-210 positively correlates with the metastatic
potential of melanoma tumors, and inversely correlates with
metastasis-free survival. Thus, in another embodiment, the method
is useful for predicting metastasis of melanoma cells.
[0095] The metastasis reference value may be obtained by measuring
miR-210 levels in one or more samples from non-diseased normal
tissue from a patient with a tumor. In other embodiments, multiple
non-diseased tissue samples can be pooled together and the level of
miR-210 in the resulting pool can be used to determine the
metastasis reference value. In another embodiment described in
Example 3, the metastasis reference value can be obtained by
measuring miR-210 or pri-miR-210 levels in cells from a plurality
of primary tumors from one or more patients, and taking the average
or mean value as the metastasis reference value. Alternatively, the
metastasis reference value can be obtained using individual miR-210
measurements from a plurality of the same or different normal
tissues from one or more patients using any of a variety of
different statistical tests known in the art.
[0096] The amount of miR-210 in a cell can be measured as described
above. Statistical tests to determine statistically significant
changes in the measured level of miR-210 as compared to the
metastasis reference value that are predictive of metastasis can be
performed as described above.
[0097] In one embodiment, measured values statistically higher than
the metastasis reference value are correlated with increased
probability of developing metastasis, wherein an increased
probability of developing metastasis indicates a poor prognosis. As
used herein, poor prognosis means a patient is expected to develop
a metastasis of the primary tumor within a period of time following
diagnosis of the primary tumor or cancer. For example, poor
prognosis means the patient is expected to develop a metastasis of
the tumor within 1, 2, 3, 4, 5, 6, 8, 10, or 12 years following
diagnosis of the primary tumor or cancer.
[0098] In other embodiments, measured values statistically lower
than the metastasis reference value are correlated with decreased
probability of developing metastasis, wherein a decreased
probability of developing metastasis indicates a good prognosis. As
used herein, good prognosis means a patient is not expected to
develop a metastasis of the primary tumor within a period of time
following diagnosis of the primary tumor or cancer. For example,
good prognosis means the patient is not expected to develop a
metastasis of the tumor within 1, 2, 3, 4, 5, 6, 8, 10, or 12 years
following diagnosis of the primary tumor or cancer.
[0099] In other embodiments, the one or more statistical tests can
be used to determine the degree or magnitude of miR-210 expression
in tumor cells relative to non-involved (non-tumor) cells from the
subject. In one embodiment, a statistically significant change of
1.5- to 2-fold increase in the measured level of miR-210 indicates
that the tumor has a low probability of metastasis (i.e., a
probability of less than 50%). In another embodiment, a
statistically significant change of 2- to 5-fold increase in the
measured level of miR-210 indicates that the tumor has a medium
probability of metastasis (a probability of approximately 50%). In
yet another embodiment, a statistically significant change of
5-fold or greater in the measured level of miR-210 indicates that
the tumor has a high probability of metastasis (i.e., a probability
of greater than 50%).
[0100] In one embodiment, the invention provides a method for
predicting the hypoxia response in tumor cells in a subject,
wherein the hypoxia response is positively correlated with the
probability of metastasis or metastatic potential of the tumor
cells. In this embodiment, expression of miR-210 above a hypoxia
reference value indicates the tumor cells are hypoxic. Hypoxic
tumor cells tend to exhibit increased invasive potential and
resistance to conventional therapies (Harris, A. L., Nat. Rev.
Cancer 2:38-47, 2002). Therefore, in this embodiment,
overexpression of miR-210 serves as a biomarker for both hypoxia
and metastatic potential of tumor cells.
[0101] C. Introduction of miR-210 into Cells that Overexpress Myc
Inhibits Cell Proliferation
[0102] In another aspect, the present invention provides methods
for inhibiting the proliferation of cells that overexpress the Myc
oncogene, for example, cancer cells. In this aspect of the
invention, miR-210 siNA is introduced into cells that overexpress
Myc to inhibit their proliferation, thereby reducing the tumor
burden in the subject. This aspect of the invention is useful in
treating cancers that exhibit Myc overexpression.
[0103] As used herein, Myc refers to the oncogenes c-Myc, N-Myc,
and L-Myc, and variants, polymorphisms, or isoforms thereof. For
example, c-Myc includes the nucleotide sequence set forth in SEQ ID
NO:23 (Genbank Accession No. NM.sub.--002467) and the polypeptide
sequence set forth in SEQ ID NO:24 (Genbank Accession No.
NP.sub.--002458), and any naturally occurring variants,
polymorphisms and isoforms thereof. Isoforms of c-Myc include the
c-Myc 1 (p67 Myc) and c-Myc2 (p64 Myc) polypeptides with distinct
amino-terminal regions resulting from alternate translation
initiation codons as described by Nanbru et al., "Alternative
Translation of the Proto-Oncogene c-Myc by an Internal Ribosome
Entry Site," J. Biol. Chem. 272:32061-32066, 1997, which is hereby
incorporated by reference herein. N-Myc, also known as MYCN,
includes the nucleotide sequence set forth in SEQ ID NO:25 (Genbank
Accession No. NM.sub.--005378) and the polypeptide sequence set
forth in SEQ ID NO:26 (Genbank Accession No. NP.sub.--005369), and
any naturally occurring variants, polymorphisms, and isoforms
thereof, including polypeptides with distinct amino-terminal
regions, such as those described by Makela et al., "Two N-Myc
Polypeptides With Distinct Amino Termini Encoded by the Second and
Third Exons of the Gene," Mol. Cell. Biol. 9:1545-1552, 1989, and
Stanton, L. W., and J. M. Bishop, "Alternative Processing of RNA
Transcribed From NMYC," Mol. Cell. Biol. 7:4266-4277, 1987, which
are hereby incorporated by reference herein. L-Myc, also known as
MYCL1, includes the nucleotide sequence set forth in SEQ ID NO:27
(transcript variant 1) and the polypeptide sequence set forth in
SEQ ID NO:28 (isoform 1). L-Myc also includes mRNA transcript
variant 1 (Genbank Accession No. NM.sub.--001033081, SEQ ID NO:27),
variant 2 (Genbank Accession No. NM.sub.--001033082), and variant 3
(Genbank Accession No. NM.sub.--005376). L-Myc further includes
protein isoform 1 (SEQ ID NO:28, encoded by transcript variants 1
and 2) and protein isoform 2 (Genbank Accession No.
NP.sub.--005367). All Genbank Accession numbers are hereby
incorporated by reference herein.
[0104] c-Myc is amplified and/or overexpressed in many cancers and
tumors including Burkitt's lymphoma, medulloblastoma,
hepatocellular carcinoma, lung cancer, breast cancer, colon cancer,
pancreatic cancer, ovarian cancer, and prostate cancer (Gardner et
al., 2002, Encyclopedia of Cancer, 2d ed.; Wu et al., Am. J.
Pathol. 162:1603-1610, 2003; Rao et al., Neoplasia 5:198-205, 2003;
Pavelic et al., Anticancer Res. 16:1707-1717. 1996). Overexpression
of c-Myc sensitizes cells to stimuli that trigger apoptosis and
cell death and can lead to cell-cycle arrest (Nilsson, J. A., and
J. L. Cleveland, Oncogene 22:9007-21, 2003). N-Myc is the homolog
of c-Myc expressed in neural tissue and is amplified and/or
overexpressed in neuroblastomas, medulloblastomas, retinoblastomas,
small cell lung carcinoma, glioblastomas, and certain embryonal
tumors (Pession and Tonelli, Curr. Cancer Drug Targets 5:273-83,
2005). N-Myc deregulation also occurs in rhabdomyosarcomas
(Morgenstern and Anderson, Expert Rev. Anticancer Ther. 6:217-224,
2006). L-Myc is amplified in small cell lung cancer and lung
carcinoma cell lines (Nau et al., Nature 318:69-73, 1985) and is
amplified and overexpressed in ovarian carcinomas (Wu et al., Am.
J. Pathol. 162:1603-1610, 2003).
[0105] As used herein, overexpression of Myc in a cell may result
from gene amplification, increased transcription of RNA, increased
stability or half-life of mRNA, and increased translation of mRNA
into protein, or a combination of any of these factors.
[0106] In one embodiment, the invention provides a method of
inhibiting tumor cell proliferation, comprising measuring the level
of Myc protein or nucleic acid in a tumor cell sample; comparing
the measured level of Myc with a Myc reference value, and
contacting the tumor cells having a level of Myc equal to or
greater than the Myc reference value with an amount of an siNA
comprising miR-210 effective to inhibit the proliferation of tumor
cells.
[0107] In another embodiment, the invention provides a method for
inhibiting the proliferation of tumor cells, comprising measuring
the expression level of Myc in tumor cells, comparing the measured
Myc expression level to a Myc reference value; wherein expression
levels of Myc greater than the Myc reference value indicate that
the cell is sensitized to inhibition of proliferation, and
contacting the tumor cells with an amount of miR-210-like siNA
effective to inhibit proliferation of the tumor cells. As used
herein, the term "sensitized" refers to a state wherein
overexpression of Myc results in enhanced susceptibility to other
stimuli that prevent tumor cells from dividing and proliferating,
thus arresting the cell cycle either temporarily or permanently.
For example, as described in Example 7, it has been determined that
overexpression of miR-210 triggers apoptosis and cell death in
cells that overexpress c-Myc.
[0108] In one embodiment, the expression level of at least one of
c-Myc RNA (SEQ ID NO:23) or c-Myc protein (SEQ ID NO:24) is
measured in tumor cells. In another embodiment, the expression
level of at least one of N-Myc RNA (SEQ ID NO:25) or N-Myc protein
(SEQ ID NO:26) is measured in tumor cells. In another embodiment,
the expression level of at least one of L-Myc RNA (SEQ ID NO:27) or
L-Myc protein (SEQ ID NO:28) is measured in tumor cells. These
embodiments are understood to include natural variants,
polymorphisms, and isoforms of c-Myc, N-Myc and L-Myc, including
variants, polymorphisms and isoforms that are expressed in tumor
cells.
[0109] In one embodiment, the Myc reference value corresponds to
the expression level or amount of Myc in normal, non-tumor cells
from the same tissue in the subject as the tumor cells. In another
embodiment, the Myc reference value corresponds to a mean, median,
or average expression level or amount of Myc in a plurality of
normal, non-tumor tissue samples from one or more subjects. In yet
another embodiment, the Myc reference value corresponds to the
level of Myc expressed by human primary tumor cells, tumor stem
cells, or tumor cell lines. In this aspect of the invention, the
level of Myc protein can be measured by any method known in the
art, including Western blot analysis (Benanti et al., "Epigenetic
Down-Regulation of ARF Expression Is a Selection Step in
Immortalization of Human Fibroblasts by c-Myc," Mol. Cancer. Res.
5:1181-1189, 2007).
[0110] In another embodiment of this aspect of the invention, the
method comprises introducing into a tumor cell that overexpresses
Myc an effective amount of a miR-210-like siNA, wherein the
miR-210-like siNA comprises a guide strand contiguous nucleotide
sequence of at least 18 nucleotides, wherein the guide strand
comprises a seed region consisting of nucleotide positions 1 to 12,
wherein position 1 represents the 5'-end of the guide strand and
wherein the seed region comprises a nucleotide sequence of at least
6 contiguous nucleotides that is identical to 6 contiguous
nucleotides with SEQ ID NO:4.
[0111] In one embodiment exemplified in Example 7, the miR-210-like
siNA is a duplex RNA molecule that is introduced into the cell by
transfection. As used herein, the term "transfection" includes
methods well known in the art for introducing polynucleotides into
cells including chemical, lipid, electrical, and viral delivery
methods. For example, transfection includes the term transduction
as used with viral vectors. In some embodiments, the introduced
siNA includes one or more chemically modified nucleotides. An
effective amount of siNA is the amount sufficient to cause a
measurable inhibition of tumor growth. As used herein, the
miR-210-like siNA comprises an miRNA whose seed region sequence
contains at least a 6 contiguous nucleotide sequence that is
identical to a 6 contiguous nucleotide sequence contained within
SEQ ID NO:4.
[0112] In another embodiment, the tumor cells overexpressing Myc
are contacted with a nucleic acid vector molecule expressing an
shRNA gene that comprises miR-210 nucleotide sequence, wherein the
shRNA transcription product acts as an RNAi agent. The shRNA gene
may encode the mature form of miR-210, such as SEQ ID NO:1, or a
miR-210 precursor RNA, such as, for example, SEQ ID NO:2 or SEQ ID
NO:3. Alternatively, the shRNA gene may encode any other RNA
sequence that is susceptible to processing by endogenous cellular
RNA processing enzymes into an active siRNA sequence, wherein the
seed region of the active siRNA sequence contains at least a 6
contiguous nucleotide sequence that is identical to a 6 contiguous
nucleotide sequence contained within SEQ ID NO:4. An effective
amount of shRNA, is the amount sufficient to cause a measurable
inhibition of tumor growth.
[0113] In some embodiments of this aspect of the invention, the
efficacy of an siNA comprising miR-210 for treatment of tumors that
overexpress Myc can be determined by measuring tumor volume in a
subject using any art-recognized method. For example, caliper
measurements may be used to estimate tumor volume using the formula
(a.times.b.sup.2).times.0.5, where "a" is the largest diameter and
"b" is the length perpendicular to the diameter, as described in
Example 2. Other useful techniques to detect tumor shrinkage in
mammalian subjects such as humans include imaging techniques such
as computed tomography (CT) scan and magnetic resonance imaging
(MRI) scan. Tumor shrinkage in conjunction with imaging techniques
is typically evaluated using the Response Evaluation Criteria In
Solid Tumors (RECIST) criteria as described in Jour. Natl. Cancer
Instit. 92: 205-216 (2000), incorporated herein by reference. Other
techniques may be used to evaluate tumor metabolic activity in vivo
including positron emission tomography (PET) and fluorodeoxyglucose
(FDG-PET) scans. DNA synthesis may be evaluated using
fluorodeoxythymidine (FLT-PET) imaging. For preclinical models,
additional techniques may be used that involve the use of tumor
cells genetically modified with marker genes such as the luciferase
gene.
[0114] In one embodiment, patients having tumors that overexpress
Myc are treated with a therapeutically sufficient amount of a
miR-210 or miR-210-like miRNA, siRNA or shRNA composition. Such
treatment may be in combination with one or more DNA damaging
agents. Therapeutic miR-210 or miR-210-like compositions comprise a
guide strand contiguous nucleotide sequence of at least 18
nucleotides, wherein said guide strand comprises a seed region
consisting of nucleotide positions 1 to 12, wherein position 1
represents the 5'-end of said guide strand and wherein said seed
region comprises a nucleotide sequence of at least 6 contiguous
nucleotides that is identical to 6 contiguous nucleotides within
SEQ ID NO:4. In certain embodiments, at least one of the two
strands further comprises a 1-4, preferably a 2-nucleotide
3'-overhang. The nucleotide overhang can include any combination of
a thymine, uracil, adenine, guanine, or cytosine, or derivatives or
analogues thereof. The nucleotide overhang in certain aspects is a
2-nucleotide overhang, where both nucleotides are thymine.
Importantly, when the dsRNA comprising the sense and antisense
strands is administered, it directs target specific interference
and bypasses an interferon response pathway.
[0115] In order to enhance the stability of the short interfering
nucleic acids, the 3'-overhangs can also be stabilized against
degradation. In one embodiment, the 3'-overhangs are stabilized by
including purine nucleotides, such as adenosine or guanosine
nucleotides. Alternatively, substitution of pyrimidine nucleotides
by modified analogues, e.g., substitution of uridine nucleotides in
the 3'-overhangs with 2'-deoxythymidine, is tolerated and does not
affect the efficiency of RNAi degradation. In particular, the
absence of a 2' hydroxyl in the 2'-deoxythymidine significantly
enhances the nuclease resistance of the 3'-overhang in tissue
culture medium.
[0116] As used herein, a "3'-overhang" refers to at least one
unpaired nucleotide extending from the 3'-end of an siRNA sequence.
The 3'-overhang can include ribonucleotides or deoxyribonucleotides
or modified ribonucleotides or modified deoxyribonucleotides. The
3'-overhang is preferably from 1 to about 5 nucleotides in length,
more preferably from 1 to about 4 nucleotides in length and, most
preferably, from about 2 to about 4 nucleotides in length. The
3'-overhang can occur on the sense or antisense sequence, or on
both sequences of an RNAi construct. The length of the overhangs
can be the same or different for each strand of the duplex. Most
preferably, a 3'-overhang is present on both strands of the duplex
and the overhang for each strand is 2-nucleotides in length. For
example, each strand of the duplex can comprise 3'-overhangs of
dithymidylic acid ("tt") or diuridylic acid ("uu").
[0117] Another aspect of the invention provides chemically modified
siNA constructs. For example, the siNA agent can include a
non-nucleotide moiety. A chemical modification or other
non-nucleotide moiety can stabilize the sense (guide strand) and
antisense (passenger strand) sequences against nucleolytic
degradation. Additionally, conjugates can be used to increase
uptake and target uptake of the siNA agent to particular cell
types. Thus, in one embodiment the siNA agent includes a duplex
molecule wherein one or more sequences of the duplex molecule are
chemically modified. Non-limiting examples of such chemical
modifications include phosphorothioate internucleotide linkages,
2'-deoxyribonucleotides, 2'-O-methyl ribonucleotides,
2'-deoxy-2'-fluoro ribonucleotides, "universal base" nucleotides,
"acyclic" nucleotides, 5'-C-methyl nucleotides, and terminal
glyceryl, and/or inverted deoxy abasic residue incorporation. These
chemical modifications, when used in siNA agents, can help to
preserve RNAi activity of the agents in cells and can increase the
serum stability of the siNA agents.
[0118] In one embodiment, the first and optionally or preferably
the first two internucleotide linkages at the 5'-end of the
antisense and/or sense sequences are modified, preferably by a
phosphorothioate. In another embodiment, the first, and perhaps the
first two, three, or four internucleotide linkages at the 3'-end of
a sense and/or antisense sequence are modified, for example, by a
phosphorothioate. In another embodiment, the 5-end of both the
sense and antisense sequences, and the 3'-end of both the sense and
antisense sequences are modified as described.
[0119] D. Inhibitors of Mnt Inhibit Cell Proliferation in Cells
that Overexpress Myc
[0120] In another aspect, the present invention provides methods
for inhibiting cell proliferation of cells overexpressing Myc. In
this aspect of the invention, a Mnt inhibitor is introduced into
cells that overexpress Myc. c-Myc is a transcription factor that
forms obligate dimers with Max protein, and the heterodimer then
binds to specific DNA sequences to activate transcription of target
genes (Grandori et al., Ann. Rev. Cell Dev. Biol. 16:653-699, 2000;
Guccione et al., Nat. Cell Biol. 8:764-770, 2006; Rottman and
Luscher, Curr. Top. Microbiol. Immunol. 302:63-122, 2006). Mnt
interacts with Max to repress transcription and functions as a
c-Myc antagonist (Hurlin, P. J., et al., "Deletion of Mnt Leads to
Disrupted Cell Cycle Control and Tumorigenesis," Embo. J.
22:4584-4596, 2003; Walker, W., et al., J. Cell Biol. 169:405-413,
2005).
[0121] In one embodiment, the invention provides a method of
inhibiting the proliferation of tumor cells in a subject,
comprising measuring the expression level of at least one of c-Myc,
N-Myc, or L-Myc, or variants, polymorphisms, or isoforms thereof,
in tumor cells; comparing the measured expression level of Myc to a
Myc reference value, wherein Myc expression levels greater than the
Myc reference value indicate that the cell is sensitized to
inhibition of proliferation; and contacting the tumor cells with an
inhibitor of the expression or activity of Mnt (SEQ ID NO:30), or
variants, polymorphisms, or isoforms thereof.
[0122] In one embodiment exemplified in Example 7, the Mnt
inhibitor is an siNA that inhibits the expression of Mnt. In this
embodiment, the anti-Mnt siNA may be duplex siRNA that is
introduced into the cells by transfection. Exemplary embodiments of
anti-Mnt siRNAs are represented by SEQ ID NOS: 15-17, as shown in
Table 1. In some embodiments, the introduced anti-Mnt siNA includes
one or more chemically modified nucleotides.
[0123] In another embodiment, proliferation of tumor cells
overexpressing Myc is inhibited by introduction of a nucleic acid
vector molecule expressing an shRNA gene, wherein the shRNA
transcription product acts as an RNAi agent that inhibits the
expression of Mnt. In one embodiment, the vector expresses an shRNA
sequence selected from the group consisting of SEQ ID NOS: 15, 16,
and 17, as shown in Table 1.
[0124] E. Use of Inhibitors of the Hypoxia Response in Cells that
overexpress miR-210
[0125] Another aspect of the invention provides a method for
treating a disease associated with hypoxia, such as cancer, by
inhibiting the hypoxia response in tumor cells. In one embodiment,
the method comprises measuring the expression level or amount of
miR-210 in tumor cells from a subject; comparing the level or
amount of miR-210 present in the tumor cells to a hypoxia reference
value, wherein expression levels of miR-210 higher than the hypoxia
reference value indicate the tumor cells are hypoxic; and
contacting the tumor cells with an inhibitor of one or more genes,
RNAs or proteins comprising the hypoxia response pathway, such as
HIF-1.alpha., HIF-1.beta., and HIF-2.alpha., or variants,
polymorphisms, or isoforms thereof. Inhibitors of HIFs include
camptothecins and related derivatives, such as topotecan, and other
small molecule inhibitors. In one embodiment, the inhibitor of the
hypoxia response pathway is an siNA that inhibits the expression of
one or more hypoxia inducible factors, including HIF-1.alpha.,
HIF-1.beta., and HIF-2.alpha.. In another embodiment, the inhibitor
of the hypoxia response pathway includes inhibitors of the
expression or activity of Mnt, and variants, polymorphisms, or
isoforms thereof.
[0126] F. Use of Inhibitors of miR-210 in Cells that are
Hypoxic
[0127] Another aspect of the invention provides a method for
treating a disease associated with hypoxia, such as cancer, by
inhibiting the function of miR-210 in tumor cells. In one
embodiment, the method comprises measuring the level or amount of
miR-210 in tumor cells from the subject; comparing the measured
level or amount of miR-210 present in the tumor cells to a hypoxia
reference value, wherein levels of miR-210 higher than the hypoxia
reference value indicate the tumor cells are hypoxic; and
contacting the tumor cells with a miR-210 inhibitor, thereby
inhibiting the proliferation of tumor cells in the subject.
[0128] In one embodiment, the inhibitor of miR-210 function
comprises an oligonucleotide complementary to at least six
contiguous nucleotides of SEQ ID NO:4.
[0129] Representative examples of miR-210 inhibitors include
anti-microRNAs (anti-miRs), such as those described in Example 4.
MicroRNA inhibitors are commercially available, for example, from
Exiqon (Denmark), Ambion (Austin, Tex.), and Dharmacon (Lafayette,
Colo.), thereby enabling one of skill in the art to practice this
method of the invention.
III. NUCLEIC ACID MOLECULES FOR USE IN THE METHODS OF THE
INVENTION
[0130] As used herein a "nucleobase" refers to a heterocyclic base
such as, for example a naturally occurring nucleobase (i.e., an A,
T, G, C, or U) found in at least one naturally occurring nucleic
acid (i.e., DNA and RNA), and naturally or non-naturally occurring
derivative(s) and analogs of such a nucleobase. A nucleobase
generally can form one or more hydrogen bonds ("anneal" or
"hybridize") with at least one naturally occurring nucleobase in
manner that may substitute for naturally occurring nucleobase
pairing (e.g., the hydrogen bonding between A and T, G and C, and A
and U).
[0131] "Purine" and/or "pyrimidine" nucleobase(s) encompass
naturally occurring purine and/or pyrimidine nucleobases and also
derivative(s) and analog(s) thereof, including but not limited to,
those a purine or pyrimidine substituted by one or more of an
alkyl, caboxyalkyl, amino, hydroxyl, halogen (i.e., fluoro, chloro,
bromo, or iodo), thiol or alkylthiol moiety. Preferred alkyl (e.g.,
alkyl, caboxyalkyl, etc.) moieties comprise of from about 1, about
2, about 3, about 4, about 5, to about 6 carbon atoms. Other
non-limiting examples of a purine or pyrimidine include a
deazapurine, a 2,6-diaminopurine, a 5-fluorouracil, a xanthine, a
hypoxanthine, an 8-bromoguanine, an 8-chloroguanine, a
bromothymine, an 8-aminoguanine, an 8-hydroxyguanine, an
8-methylguanine, an 8-thioguanine, an azaguanine, a 2-aminopurine,
a 5-ethylcytosine, a 5-methylcyosine, a 5-bromouracil, a
5-ethyluracil, a 5-iodouracil, a 5-chlorouracil, a 5-propyluracil,
a thiouracil, a 2-methyladenine, a methylthioadenine, a
N,N-diemethyladenine, an azaadenines, an 8-bromoadenine, an
8-hydroxyadenine, a 6-hydroxyaminopurine, a 6-thiopurine, a
4-(6-aminohexyl/cytosine), and the like. A nucleobase may be
comprised in a nucleoside or nucleotide, using any chemical or
natural synthesis method described herein or known to one of
ordinary skill in the art. Such nucleobase may be labeled or it may
be part of a molecule that is labeled and contains the
nucleobase.
[0132] As used herein, a "nucleoside" refers to an individual
chemical unit comprising a nucleobase covalently attached to a
nucleobase linker moiety. A non-limiting example of a "nucleobase
linker moiety" is a sugar comprising 5-carbon atoms (i.e., a
"5-carbon sugar"), including but not limited to a deoxyribose, a
ribose, an arabinose, or a derivative or an analog of a 5-carbon
sugar. Non-limiting examples of a derivative or an analog of a
5-carbon sugar include a 2'-fluoro-2'-deoxyribose or a carbocyclic
sugar where a carbon is substituted for an oxygen atom in the sugar
ring.
[0133] Different types of covalent attachment(s) of a nucleobase to
a nucleobase linker moiety are known in the art. By way of
non-limiting example, a nucleoside comprising a purine (i.e., A or
G) or a 7-deazapurine nucleobase typically covalently attaches the
9-position of a purine or a 7-deazapurine to the 1'-position of a
5-carbon sugar. In another non-limiting example, a nucleoside
comprising a pyrimidine nucleobase (i.e., C, T, or U) typically
covalently attaches a 1-position of a pyrimidine to a 1'-position
of a 5-carbon sugar (Kornberg and Baker, DNA Replication, Freeman
and Company, New York, 1992).
[0134] As used herein, a "nucleotide" refers to a nucleoside
further comprising a "backbone moiety." A backbone moiety generally
covalently attaches a nucleotide to another molecule comprising a
nucleotide or to another nucleotide to form a nucleic acid. The
"backbone moiety" in naturally occurring nucleotides typically
comprises a phosphorus moiety, which is covalently attached to a
5-carbon sugar. The attachment of the backbone moiety typically
occurs at either the 3'- or 5'-position of the 5-carbon sugar.
Other types of attachments are known in the art, particularly when
a nucleotide comprises derivatives or analogs of a naturally
occurring 5-carbon sugar or phosphorus moiety.
[0135] A nucleic acid may comprise, or be composed entirely of, a
derivative or analog of a nucleobase, a nucleobase linker moiety
and/or backbone moiety that may be present in a naturally occurring
nucleic acid. As used herein a "derivative" refers to a chemically
modified or altered form of a naturally occurring molecule, while
the terms "mimic" or "analog" refer to a molecule that may or may
not structurally resemble a naturally occurring molecule or moiety,
but possesses similar functions. As used herein, a "moiety"
generally refers to a smaller chemical or molecular component of a
larger chemical or molecular structure. Nucleobase, nucleoside and
nucleotide analogs or derivatives are well known in the art, and
have been described (see for example, Scheit, Nucleotide Analogs
Synthesis and Biological Function, Wiley, New York, 1980).
[0136] Additional non-limiting examples of nucleosides, nucleotides
or nucleic acids comprising 5-carbon sugar and/or backbone moiety
derivatives or analogs, include those in: U.S. Pat. No. 5,681,947,
which describes oligonucleotides comprising purine derivatives that
form triple helixes with and/or prevent expression of dsDNA; U.S.
Pat. Nos. 5,652,099 and 5,763,167, which describe nucleic acids
incorporating fluorescent analogs of nucleosides found in DNA or
RNA, particularly for use as fluorescent nucleic acids probes; U.S.
Pat. No. 5,614,617, which describes oligonucleotide analogs with
substitutions on pyrimidine rings that possess enhanced nuclease
stability; U.S. Pat. Nos. 5,670,663, 5,872,232, and 5,859,221,
which describe oligonucleotide analogs with modified 5-carbon
sugars (i.e., modified 2'-deoxyfuranosyl moieties) used in nucleic
acid detection; U.S. Pat. No. 5,446,137, which describes
oligonucleotides comprising at least one 5-carbon sugar moiety
substituted at the 4'-position with a substituent other than
hydrogen that can be used in hybridization assays; U.S. Pat. No.
5,886,165, which describes oligonucleotides with both
deoxyribonucleotides with 3' to -5'-internucleotide linkages and
ribonucleotides with 2'- to 5'-internucleotide linkages; U.S. Pat.
No. 5,714,606, which describes a modified internucleotide linkage
wherein a 3'-position oxygen of the internucleotide linkage is
replaced by a carbon to enhance the nuclease resistance of nucleic
acids; U.S. Pat. No. 5,672,697, which describes oligonucleotides
containing one or more 5'-methylene phosphonate internucleotide
linkages that enhance nuclease resistance; U.S. Pat. Nos. 5,466,786
and 5,792,847, which describe the linkage of a substituent moiety
that may comprise a drug or label to the 2'-carbon of an
oligonucleotide to provide enhanced nuclease stability and ability
to deliver drugs or detection moieties; U.S. Pat. No. 5,223,618,
which describes oligonucleotide analogs with a 2- or 3-carbon
backbone linkage attaching the 4'-position and 3'-position of
adjacent 5-carbon sugar moiety to enhanced cellular uptake,
resistance to nucleases and hybridization to target RNA; U.S. Pat.
No. 5,470,967, which describes oligonucleotides comprising at least
one sulfamate or sulfamide internucleotide linkage that are useful
as nucleic acid hybridization probe; U.S. Pat. Nos. 5,378,825,
5,777,092, 5,623,070, 5,610,289, and 5,602,240, which describe
oligonucleotides with three or four atom linker moiety replacing
phosphodiester backbone moiety used for improved nuclease
resistance, cellular uptake, and regulating RNA expression; U.S.
Pat. No. 5,858,988, which describes hydrophobic carrier agent
attached to the 2'-O position of oligonucleotides to enhance their
membrane permeability and stability; U.S. Pat. No. 5,214,136, which
describes oligonucleotides conjugated to anthraquinone at the
5'-terminus that possess enhanced hybridization to DNA or RNA;
enhanced stability to nucleases; U.S. Pat. No. 5,700,922, which
describes PNA-DNA-PNA chimeras wherein the DNA comprises
2'-deoxy-erythro-pentofuranosyl nucleotides for enhanced nuclease
resistance, binding affinity, and ability to activate RNase H; and
U.S. Pat. No. 5,708,154, which describes RNA linked to a DNA to
form a DNA-RNA hybrid; U.S. Pat. No. 5,728,525, which describes the
labeling of nucleoside analogs with a universal fluorescent
label.
[0137] Additional teachings for nucleoside analogs and nucleic acid
analogs are U.S. Pat. No. 5,728,525, which describes nucleoside
analogs that are end-labeled; U.S. Pat. Nos. 5,637,683, 6,251,666
(L-nucleotide substitutions), and 5,480,980 (7-deaza-2'
deoxyguanosine nucleotides and nucleic acid analogs thereof).
[0138] shRNA Mediated Suppression
[0139] Alternatively, certain of the nucleic acid molecules of the
instant invention can be expressed within cells from eukaryotic
promoters (e.g., Izant and Weintraub, Science 229:345, 1985;
McGarry and Lindquist, PNAS USA 83:399, 1986; Scanlon et al., PNAS
USA 88:10591-95, 1991; Kashani-Sabet et al., Antisense Res. Dev.
2:3-15, 1992; Dropulic et al., J. Virol. 66:1432-41, 1992;
Weerasinghe et al., J. Virol. 65:5531-4, 1991; Ojwang et al., PNAS
USA 89:10802-06, 1992; Chen et al., Nucleic Acids Res. 20:4581-89,
1992; Sarver et al., Science 247:1222-25, 1990; Thompson et al.,
Nucleic Acids Res. 23:2259, 1995; Good et al., Gene Therapy 4:45,
1997). Those skilled in the art realize that any nucleic acid can
be expressed in eukaryotic cells from the appropriate DNA/RNA
vector. The activity of such nucleic acids can be augmented by
their release from the primary transcript by a enzymatic nucleic
acid (Draper et al., International PCT Publication No. WO 93/23569,
and Sullivan et al., International PCT Publication No. WO 94/02595;
Ohkawa et al., Nucleic Acids Symp. Ser. 27:15-6, 1992; Taira et
al., Nucleic Acids Res. 19:5125-30, 1991; Ventura et al., Nucleic
Acids Res. 21:3249-55, 1993; Chowrira et al., J. Biol. Chem.
269:25856, 1994). Gene therapy approaches specific to the CNS are
described by Blesch et al., Drug News Perspect. 13:269-280, 2000;
Peterson et al., Cent. Nerv. Syst. Dis. 485:508, 2000; Peel and
Klein, J. Neurosci. Methods 98:95-104, 2000; Hagihara et al., Gene
Ther. 7:759-763, 2000; and Herrlinger et al., Methods Mol. Med.
35:287-312, 2000. AAV-mediated delivery of nucleic acid to cells of
the nervous system is further described by Kaplitt et al., U.S.
Pat. No. 6,180,613.
[0140] In another aspect of the invention, RNA molecules of the
present invention are preferably expressed from transcription units
(see, for example, Couture et al., TIG. 12:510, 1996) inserted into
DNA or RNA vectors. The recombinant vectors are preferably DNA
plasmids or viral vectors. Ribozyme expressing viral vectors can be
constructed based on, but not limited to, adeno-associated virus,
retrovirus, adenovirus, or alphavirus. Preferably, the recombinant
vectors capable of expressing the nucleic acid molecules are
delivered as described above, and persist in target cells.
Alternatively, viral vectors can be used that provide for transient
expression of nucleic acid molecules. Such vectors can be
repeatedly administered as necessary. Once expressed, the nucleic
acid molecule binds to the target mRNA. Delivery of nucleic acid
molecule expressing vectors can be systemic, such as by intravenous
or intramuscular administration, by administration to target cells
ex-planted from the patient or subject followed by reintroduction
into the patient or subject, or by any other means that would allow
for introduction into the desired target cell (for a review see
Couture et al., TIG. 12:510, 1996).
[0141] In one aspect the invention features an expression vector
comprising a nucleic acid sequence encoding at least one of the
nucleic acid molecules of the instant invention is disclosed. The
nucleic acid sequence encoding the nucleic acid molecule of the
instant invention is operably linked in a manner which allows
expression of that nucleic acid molecule.
[0142] In another aspect the invention features an expression
vector comprising (a) a transcription initiation region (e.g.,
eukaryotic pol I, II, or III initiation region); (b) a
transcription termination region (e.g., eukaryotic pol I, II, or
III termination region); and (c) a nucleic acid sequence encoding
at least one of the nucleic acid molecules of the instant
invention; and wherein said sequence is operably linked to said
initiation region and said termination region in a manner that
allows expression and/or delivery of said nucleic acid molecule.
The vector can optionally include an open reading frame (ORF) for a
protein operably linked on the 5'-side or the 3'-side of the
sequence encoding the nucleic acid molecule of the invention;
and/or an intron (intervening sequences).
[0143] Transcription of the nucleic acid molecule sequences are
driven from a promoter for eukaryotic RNA polymerase I (pol I), RNA
polymerase II (pol II), or RNA polymerase III (pol III).
Transcripts from pol II or pol III promoters are expressed at high
levels in all cells; the levels of a given pol II promoter in a
given cell type depends on the nature of the gene regulatory
sequences (enhancers, silencers, etc.) present nearby. Prokaryotic
RNA polymerase promoters are also used, providing that the
prokaryotic RNA polymerase enzyme is expressed in the appropriate
cells (Elroy-Stein and Moss, PNAS USA 87:6743-7, 1990; Gao and
Huang, Nucleic Acids Res. 21:2867-72, 1993; Lieber et al., Methods
Enzymol., 217:47-66, 1993; Zhou et al., Mol. Cell Biol. 10:4529-37,
1990).
[0144] Several investigators have demonstrated that nucleic acid
molecules encoding shRNAs or microRNAs expressed from such
promoters can function in mammalian cells (Brummelkamp et al.,
Science 296:550-553, 2002; Paddison et al., Nat. Methods 1:163-67,
2004; McIntyre and Fanning, BMC Biotechnology 6:1, January 2006;
Taxman et al., BMC Biotechnology 6:7, January 2006). The above
shRNA or microRNA transcription units can be incorporated into a
variety of vectors for introduction into mammalian cells including,
but not restricted to, plasmid DNA vectors, viral DNA vectors (such
as adenovirus or adeno-associated virus vectors), or viral RNA
vectors (such as retroviral or alphavirus vectors) (for a review
see Couture and Stinchcomb, 1996, supra).
[0145] In another aspect the invention features an expression
vector comprising nucleic acid sequence encoding at least one of
the nucleic acid molecules of the invention, in a manner which
allows expression of that nucleic acid molecule. The expression
vector comprises in one embodiment: (a) a transcription initiation
region; (b) a transcription termination region; (c) a nucleic acid
sequence encoding at least one said nucleic acid molecule; and
wherein said sequence is operably linked to said initiation region
and said termination region, in a manner that allows expression
and/or delivery of said nucleic acid molecule.
[0146] In another embodiment, the expression vector comprises (a) a
transcription initiation region; (b) a transcription termination
region; (c) an open reading frame; and (d) a nucleic acid sequence
encoding at least one said nucleic acid molecule, wherein said
sequence is operably linked to the 3'-end of said open reading
frame; and wherein said sequence is operably linked to said
initiation region, said open reading frame and said termination
region in a manner that allows expression and/or delivery of said
nucleic acid molecule. In yet another embodiment the expression
vector comprises (a) a transcription initiation region; (b) a
transcription termination region; (c) an intron; and (d) a nucleic
acid sequence encoding at least one said nucleic acid molecule; and
wherein said sequence is operably linked to said initiation region,
said intron and said termination region, in a manner that allows
expression and/or delivery of said nucleic acid molecule.
[0147] In another embodiment, the expression vector comprises (a) a
transcription initiation region; (b) a transcription termination
region; (c) an intron; (d) an open reading frame; and (e) a nucleic
acid sequence encoding at least one said nucleic acid molecule,
wherein said sequence is operably linked to the 3'-end of said open
reading frame; and wherein said sequence is operably linked to said
initiation region, said intron, said open reading frame and said
termination region in a manner that allows expression and/or
delivery of said nucleic acid molecule.
IV. MODIFIED SINA MOLECULES
[0148] Any of the siNA constructs described herein can be modified
and evaluated for use in the methods of the invention as described
below.
[0149] An siNA construct may be susceptible to cleavage by an
endonuclease or exonuclease, such as, for example, when the siNA
construct is introduced into the body of a subject. Methods can be
used to determine sites of cleavage, e.g., endo- and exonucleolytic
cleavage on an RNAi construct and to determine the mechanism of
cleavage. An siNA construct can be modified to inhibit such
cleavage.
[0150] Exemplary modifications include modifications that inhibit
endonucleolytic degradation, including the modifications described
herein. Particularly favored modifications include 2'-modification,
e.g., a 2'-O-methylated nucleotide, or 2'-deoxy nucleotide (e.g.,
2' deoxy-cytodine), or a 2'-fluoro, difluorotoluoyl,
5-Me-2'-pyrimidines, 5-allyl-amino-pyrimidines, 2'-O-methoxyethyl,
2'-hydroxy, or 2'-ara-fluoro nucleotide, or a locked nucleic acid
(LNA), extended nucleic acid (ENA), hexose nucleic acid (HNA), or
cyclohexene nucleic acid (CeNA). In one embodiment, the
2'-modification is on the uridine of at least one
5'-uridine-adenine-3' (5'-UA-3') dinucleotide, at least one
5'-uridine-guanine-3' (5'-UG-3') dinucleotide, at least one
5'-uridine-uridine-3' (5'-UU-3') dinucleotide, or at least one
5'-uridine-cytidine-3' (5'-UC-3') dinucleotide, or on the cytidine
of at least one 5'-cytidine-adenine-3' (5'-CA-3') dinucleotide, at
least one 5'-cytidine-cytidine-3' (5'-CC-3') dinucleotide, or at
least one 5'-cytidine-uridine-3' (5'-CU-3') dinucleotide. The
2'-modification can also be applied to all the pyrimidines in an
siNA construct. In one preferred embodiment, the 2'-modification is
a 2'OMe modification on the sense strand of an siNA construct. In a
more preferred embodiment the 2'-modification is a 2'-fluoro
modification, and the 2'-fluoro is on the sense (passenger) or
antisense (guide) strand or on both strands.
[0151] Modification of the backbone, e.g., with the replacement of
an O with an S in the phosphate backbone, e.g., the provision of a
phosphorothioate modification can be used to inhibit endonuclease
activity. In some embodiments, an siNA construct has been modified
by replacing one or more ribonucleotides with deoxyribonucleotides.
Preferably, adjacent deoxyribonucleotides are joined by
phosphorothioate linkages, and the siNA construct does not include
more than four consecutive deoxyribonucleotides on the sense or the
antisense strands. Replacement of the U with a C5 amino linker;
replacement of an A with a G (sequence changes are preferred to be
located on the sense strand and not the antisense strand); or
modification of the sugar at the 2', 6', 7', or 8' position can
also inhibit endonuclease cleavage of the siNA construct. Preferred
embodiments are those in which one or more of these modifications
are present on the sense but not the antisense strand, or
embodiments where the antisense strand has fewer of such
modifications.
[0152] Exemplary modifications also include those that inhibit
degradation by exonucleases. In one embodiment, an siNA construct
includes a phosphorothioate linkage or P-alkyl modification in the
linkages between one or more of the terminal nucleotides of an siNA
construct. In another embodiment, one or more terminal nucleotides
of an siNA construct include a sugar modification, e.g., a 2'- or
3'-sugar modification. Exemplary sugar modifications include, for
example, a 2'-O-methylated nucleotide, 2'-deoxy nucleotide (e.g.,
deoxy-cytodine), 2'-deoxy-2'-fluoro (2'-F) nucleotide,
2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl (2'-O-AP),
2'-O--N-methylacetamido (2'-O-NMA), 2'-O-dimethylaminoethlyoxyethyl
(2'-DMAEOE), 2'-O-dimethylaminoethyl (2'-O-DMAOE),
2'-O-dimethylaminopropyl (2'-O-AP), 2'-hydroxy nucleotide, or a
2'-ara-fluoro nucleotide, or a locked nucleic acid (LNA), extended
nucleic acid (ENA), hexose nucleic acid (HNA), or cyclohexene
nucleic acid (CeNA). A 2'-modification is preferably 2'OMe, more
preferably, 2'-fluoro.
[0153] The modifications described to inhibit exonucleolytic
cleavage can be combined onto a single siNA construct. For example,
in one embodiment, at least one terminal nucleotide of an siNA
construct has a phosphorothioate linkage and a 2'-sugar
modification, e.g., a 2'F or 2'OMe modification. In another
embodiment, at least one terminal nucleotide of an siNA construct
has a 5' Me-pyrimidine and a 2' sugar modification, e.g., a 2'F or
2'OMe modification.
[0154] To inhibit exonuclease cleavage, an siNA construct can
include a nucleobase modification, such as a cationic modification,
such as a 3'-abasic cationic modification. The cationic
modification can be, e.g., an alkylamino-dT (e.g., a C6 amino-dT),
an allylamino conjugate, a pyrrolidine conjugate, a pthalamido or a
hydroxyprolinol conjugate, on one or more of the terminal
nucleotides of the siNA construct. In one embodiment, an
alkylamino-dT conjugate is attached to the 3' end of the sense or
antisense strand of an RNAi construct. In another embodiment, a
pyrrolidine linker is attached to the 3'- or 5'-end of the sense
strand or the 3'-end of the antisense strand. In one embodiment, an
allyl amine uridine is on the 3'- or 5'-end of the sense strand and
not on the 5'-end of the antisense strand.
[0155] In one embodiment, the siNA construct includes a conjugate
on one or more of the terminal nucleotides of the siNA construct.
The conjugate can be, for example, a lipophile, a terpene, a
protein binding agent, a vitamin, a carbohydrate, a retiniod, or a
peptide. For example, the conjugate can be naproxen, nitroindole
(or another conjugate that contributes to stacking interactions),
folate, ibuprofen, cholesterol, retinoids, PEG, or a C5-pyrimidine
linker. In other embodiments, the conjugates are glyceride lipid
conjugates (e.g., a dialkyl glyceride derivatives), vitamin E
conjugates, or thio-cholesterols. In one embodiment, conjugates are
on the 3'-end of the antisense strand or on the 5'- or 3'-end of
the sense strand and the conjugates are not on the 3'-end of the
antisense strand and on the 3'-end of the sense strand.
[0156] In one embodiment, the conjugate is naproxen, and the
conjugate is on the 5'- or 3'-end of the sense or antisense
strands. In one embodiment, the conjugate is cholesterol and the
conjugate is on the 5'- or 3'-end of the sense strand and not
present on the antisense strand. In some embodiments, the
cholesterol is conjugated to the siNA construct by a pyrrolidine
linker, or serinol linker, aminooxy, or hydroxyprolinol linker. In
other embodiments, the conjugate is a dU-cholesterol, or
cholesterol is conjugated to the siNA construct by a disulfide
linkage. In another embodiment, the conjugate is cholanic acid, and
the cholanic acid is attached to the 5'- or 3'-end of the sense
strand or the 3'-end of the antisense strand. In one embodiment,
the cholanic acid is attached to the 3'-end of the sense strand and
the 3'-end of the antisense strand. In another embodiment, the
conjugate is PEGS, PEG20, naproxen, or retinal.
[0157] In another embodiment, one or more terminal nucleotides have
a 2'- to 5'-linkage. In certain embodiments, a 2'- to 5'-linkage
occurs on the sense strand, e.g., the 5'-end of the sense
strand.
[0158] In one embodiment, an siNA construct includes an L-sugar,
preferably at the 5'- or 3'-end of the sense strand.
[0159] In one embodiment, an siNA construct includes a
methylphosphonate at one or more terminal nucleotides to enhance
exonuclease resistance, e.g., at the 3'-end of the sense or
antisense strands of the construct.
[0160] In one embodiment, an siRNA construct has been modified by
replacing one or more ribonucleotides with deoxyribonucleotides. In
another embodiment, adjacent deoxyribonucleotides are joined by
phosphorothioate linkages. In one embodiment, the siNA construct
does not include more than four consecutive deoxyribonucleotides on
the sense or the antisense strands. In another embodiment, all of
the ribonucleotides have been replaced with modified nucleotides
that are not ribonucleotides.
[0161] In some embodiments, an siNA construct having increased
stability in cells and biological samples includes a
difluorotoluoyl (DFT) modification, e.g., 2,4-difluorotoluoyl
uracil, or a guanidine to inosine substitution.
[0162] The methods can be used to evaluate a candidate siNA, e.g.,
a candidate siRNA construct, which is unmodified or which includes
a modification, e.g., a modification that inhibits degradation,
targets the dsRNA molecule, or modulates hybridization. Such
modifications are described herein. A cleavage assay can be
combined with an assay to determine the ability of a modified or
non-modified candidate to silence the target transcript. For
example, one might (optionally) test a candidate to evaluate its
ability to silence a target (or off-target sequence), evaluate its
susceptibility to cleavage, modify it (e.g., as described herein,
e.g., to inhibit degradation) to produce a modified candidate, and
test the modified candidate for one or both of the ability to
silence and the ability to resist degradation. The procedure can be
repeated. Modifications can be introduced one at a time or in
groups. It will often be convenient to use a cell-based method to
monitor the ability to silence a target RNA. This can be followed
by a different method, e.g., a whole animal method, to confirm
activity.
[0163] Chemically synthesizing nucleic acid molecules with
modifications (base, sugar, and/or phosphate) can prevent their
degradation by serum ribonucleases, which can increase their
potency (see, e.g., Eckstein et al., International Publication No.
WO 92/07065; Perrault et al., Nature 344:565, 1990; Pieken et al.,
Science 253:314, 1991; Usman and Cedergren, Trends in Biochem. Sci.
17:334, 1992; Burgin et al., Biochemistry 35:14090, 1996; Usman et
al., International PCT Publication No. WO 93/15187; and Rossi et
al., International PCT Publication No. WO 91/03162; Sproat, U.S.
Pat. No. 5,334,711; Gold et al., U.S. Pat. No. 6,300,074; and
Vargeese et al., U.S. Patent Publication No. 2006/021733). All of
the above references describe various chemical modifications that
can be made to the base, phosphate and/or sugar moieties of the
nucleic acid molecules described herein. Modifications that enhance
their efficacy in cells, and removal of bases from nucleic acid
molecules to shorten oligonucleotide synthesis times and reduce
chemical requirements are desired.
[0164] Chemically modified siNA molecules for use in modulating or
attenuating expression of two or more genes down-regulated by
miR-210-like miRNAs are also within the scope of the invention.
Described herein are isolated siNA agents, e.g., RNA molecules
(chemically modified or not, double-stranded, or single-stranded)
that mediate RNAi to inhibit expression of two or more genes that
are down-regulated by miR-210-like siNAs.
[0165] The siNA agents discussed herein include otherwise
unmodified RNA as well as RNAs that have been chemically modified,
e.g., to improve efficacy, and polymers of nucleoside surrogates.
Unmodified RNA refers to a molecule in which the components of the
nucleic acid, namely sugars, bases, and phosphate moieties, are the
same or essentially the same as that which occur in nature,
preferably as occur naturally in the human body. The art has
referred to rare or unusual, but naturally occurring, RNAs as
modified RNAs, see, e.g., Limbach et al., Nucleic Acids Res.
22:2183-2196, 1994. Such rare or unusual RNAs, often termed
modified RNAs (apparently because they are typically the result of
a post-transcriptional modification) are within the term unmodified
RNA, as used herein.
[0166] Modified RNA as used herein refers to a molecule in which
one or more of the components of the nucleic acid, namely sugars,
bases, and phosphate moieties that are the components of the RNAi
duplex, are different from that which occur in nature, preferably
different from that which occurs in the human body. While they are
referred to as modified "RNAs," they will of course, because of the
modification, include molecules that are not RNAs. Nucleoside
surrogates are molecules in which the ribophosphate backbone is
replaced with a non-ribophosphate construct that allows the bases
to the presented in the correct spatial relationship such that
hybridization is substantially similar to what is seen with a
ribophosphate backbone, e.g., non-charged mimics of the
ribophosphate backbone. Examples of all of the above are discussed
herein.
[0167] Modifications described herein can be incorporated into any
double-stranded RNA and RNA-like molecule described herein, e.g.,
an siNA construct. It may be desirable to modify one or both of the
antisense and sense strands of an siNA construct. As nucleic acids
are polymers of subunits or monomers, many of the modifications
described below occur at a position which is repeated within a
nucleic acid, e.g., a modification of a base, or a phosphate
moiety, or the non-linking O of a phosphate moiety. In some cases
the modification will occur at all of the subject positions in the
nucleic acid but in many, and in fact in most, cases it will
not.
[0168] By way of example, a modification may occur at a 3'- or
5'-terminal position, may occur in a terminal region, e.g., at a
position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10
nucleotides of a strand. A modification may occur in a double
strand region, a single strand region, or in both. For example, a
phosphorothioate modification at a non-linking O position may only
occur at one or both termini, may only occur in a terminal regions,
e.g., at a position on a terminal nucleotide or in the last 2, 3,
4, 5, or nucleotides of a strand, or may occur in double strand and
single strand regions, particularly at termini. Similarly, a
modification may occur on the sense strand, antisense strand, or
both. In some cases, a modification may occur on an internal
residue to the exclusion of adjacent residues. In some cases, the
sense and antisense strand will have the same modifications or the
same class of modifications, but in other cases the sense and
antisense strand will have different modifications, e.g., in some
cases it may be desirable to modify only one strand, e.g., the
sense strand. In some cases, the sense strand may be modified,
e.g., capped in order to promote insertion of the anti-sense strand
into the RISC complex.
[0169] Other suitable modifications that can be made to a sugar,
base, or backbone of an siNA construct are described in U.S. Patent
Publication Nos. US 2006/0217331 and US2005/0020521, International
PCT Publication Nos. WO2003/70918 and WO2005/019453, and
International PCT Patent Application No. PCT/US2004/01193. An siNA
construct can include a non-naturally occurring base, such as the
bases described in any one of the above mentioned references. See
also International Patent Application No. PCT/US2004/011822. An
siNA construct can also include a non-naturally occurring sugar,
such as a non-carbohydrate cyclic carrier molecule. Exemplary
features of non-naturally occurring sugars for use in siNA agents
are described in International PCT Patent Application No.
PCT/US2004/11829.
[0170] Two prime objectives for the introduction of modifications
into siNA constructs of the invention are their stabilization
towards degradation in biological environments and the improvement
of pharmacological properties, e.g., pharmacodynamic properties.
There are several examples in the art describing sugar, base and
phosphate modifications that can be introduced into nucleic acid
molecules with significant enhancement in their nuclease stability
and efficacy. For example, oligonucleotides are modified to enhance
stability and/or enhance biological activity by modification with
nuclease resistant groups, for example, 2'-amino, 2'-C-allyl,
2'-fluoro, 2'-O-methyl, 2'-O-allyl, 2'-H, nucleotide base
modifications (for a review see Usman and Cedergren, TIBS
17:334-339, 1992; Usman et al., Nucleic Acids Symp. Ser. 31:163,
1994; Burgin et al., Biochemistry 35:14090, 1996). Sugar
modification of nucleic acid molecules has been extensively
described in the art (see Eckstein et al., International PCT
Publication No. WO 92/07065; Perrault et al., Nature 344:565-568,
1990; Pieken et al., Science 253:314-317, 1991; Usman and
Cedergren, Trends in Biochem. Sci. 17:334-339, 1992; Usman et al.,
International Patent Publication No. WO 93/15187; Sproat, U.S. Pat.
No. 5,334,711; and Beigelman et al., J. Biol. Chem. 270:25702,
1995; Beigelman et al., International Patent Publication No. WO
97/26270; Beigelman et al., U.S. Pat. No. 5,716,824; Usman et al.,
U.S. Pat. No. 5,627,053; Woolf et al., International Patent
Publication No. WO 98/13526; Thompson et al., U.S. Patent
Application No. 60/082,404, which was filed on Apr. 20, 1998;
Karpeisky et al., Tetrahedron Lett. 39:1131, 1998; Earnshaw and
Gait, Biopolymers (Nucleic Acid Sciences) 48:39-55, 1998; Verma and
Eckstein, Annu. Rev. Biochem. 67:99-134, 1998; and Burlina et al.,
Bioorg. Med. Chem. 5:1999-2010, 1997). Such publications describe
general methods and strategies to determine the location of
incorporation of sugar, base, and/or phosphate modifications and
the like into nucleic acid molecules without modulating catalysis.
In view of such teachings, similar modifications can be used as
described herein to modify the siNA molecules of the instant
invention so long as the ability of siNA to promote RNAi in cells
is not significantly inhibited.
[0171] Modifications may be modifications of the sugar-phosphate
backbone. Modifications may also be modification of the nucleoside
portion. Optionally, the sense strand is a RNA or RNA strand
comprising 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100%
modified nucleotides. In one embodiment, the sense polynucleotide
is an RNA strand comprising a plurality of modified
ribonucleotides. Likewise, in other embodiments, the RNA antisense
strand comprises one or more modifications. For example, the RNA
antisense strand may comprise no more than 5%, 10%, 20%, 30%, 40%,
50% or 75% modified nucleotides. The one or more modifications may
be selected so as increase the hydrophobicity of the
double-stranded nucleic acid, in physiological conditions, relative
to an unmodified double-stranded nucleic acid having the same
designated sequence.
[0172] In certain embodiments, the siNA construct comprising the
one or more modifications has a logP value at least 0.5 logP unit
less than the logP value of an otherwise identical unmodified siRNA
construct. In another embodiment, the siNA construct comprising the
one or more modifications has at least 1, 2, 3, or even 4 logP
units less than the logP value of an otherwise identical unmodified
siRNA construct. The one or more modifications may be selected so
as increase the positive charge (or increase the negative charge)
of the double-stranded nucleic acid, in physiological conditions,
relative to an unmodified double-stranded nucleic acid having the
same designated sequence. In certain embodiments, the siNA
construct comprising the one or more modifications has an
isoelectric pH (pI) that is at least 0.25 units higher than the
otherwise identical unmodified siRNA construct. In another
embodiment, the sense polynucleotide comprises a modification to
the phosphate-sugar backbone selected from the group consisting of:
a phosphorothioate moiety, a phosphoramidate moiety, a
phosphodithioate moiety, a PNA moiety, an LNA moiety, a 2'-O-methyl
moiety and a 2'-deoxy-2' fluoride moiety.
[0173] In certain embodiments, the RNAi construct is a hairpin
nucleic acid that is processed to an siRNA inside a cell.
Optionally, each strand of the double-stranded nucleic acid may be
19 to 100 base pairs long, and preferably 19 to 50 or 19 to 30 base
pairs long.
[0174] An siNAi construct can include an internucleotide linkage
(e.g., the chiral phosphorothioate linkage) useful for increasing
nuclease resistance. In addition, or in the alternative, an siNA
construct can include a ribose mimic for increased nuclease
resistance. Exemplary internucleotide linkages and ribose mimics
for increased nuclease resistance are described in International
Patent Application No. PCT/US2004/07070.
[0175] An siRNAi construct can also include ligand-conjugated
monomer subunits and monomers for oligonucleotide synthesis.
Exemplary monomers are described, for example, in U.S. patent
application Ser. No. 10/916,185.
[0176] An siNA construct can have a ZXY structure, such as is
described in co-owned International PCT Patent Application No.
PCT/US2004/07070. Likewise, an siNA construct can be complexed with
an amphipathic moiety. Exemplary amphipathic moieties for use with
siNA agents are described in International PCT Patent Application
No. PCT/US2004/07070.
[0177] The sense and antisense sequences of an siNAi construct can
be palindromic. Exemplary features of palindromic siNA agents are
described in International Patent PCT Application No.
PCT/US2004/07070.
[0178] In another embodiment, the siNA construct of the invention
can be complexed to a delivery agent that features a modular
complex. The complex can include a carrier agent linked to one or
more of (preferably two or more, more preferably all three of): (a)
a condensing agent (e.g., an agent capable of attracting, e.g.,
binding, a nucleic acid, e.g., through ionic or electrostatic
interactions); (b) a fusogenic agent (e.g., an agent capable of
fusing and/or being transported through a cell membrane); and (c) a
targeting group, e.g., a cell or tissue targeting agent, e.g., a
lectin, glycoprotein, lipid or protein, e.g., an antibody, that
binds to a specified cell type. iRNA agents complexed to a delivery
agent are described in International PCT Patent Application No.
PCT/US2004/07070.
[0179] The siNA construct of the invention can have non-canonical
pairings, such as between the sense and antisense sequences of the
iRNA duplex. Exemplary features of non-canonical iRNA agents are
described in International Patent Application No.
PCT/US2004/07070.
[0180] In one embodiment, nucleic acid molecules of the invention
include one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or
more) G-clamp nucleotides. A G-clamp nucleotide is a modified
cytosine analog, wherein the modifications confer the ability to
hydrogen bond both Watson-Crick and Hoogsteen faces of a
complementary guanine within a duplex, see, for example, Lin and
Matteucci, J. Am. Chem. Soc. 120:8531-8532, 1998. A single G-clamp
analog substitution within an oligonucleotide can result in
substantially enhanced helical thermal stability and mismatch
discrimination when hybridized to complementary oligonucleotides.
The inclusion of such nucleotides in nucleic acid molecules of the
invention results in both enhanced affinity and specificity to
nucleic acid targets, complementary sequences, or template strands.
In another embodiment, nucleic acid molecules of the invention
include one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or
more) LNA "locked nucleic acid" nucleotides such as a 2',4'-C
methylene bicyclo nucleotide (see for example Wengel et al.,
International PCT Patent Publication Nos. WO 00/66604 and WO
99/14226).
[0181] An siNA agent of the invention, can be modified to exhibit
enhanced resistance to nucleases. An exemplary method proposes
identifying cleavage sites and modifying such sites to inhibit
cleavage. An exemplary dinucleotides 5'-UA-3',5'-UG-3',5'-CA-3',
5'-UU-3', or 5'-CC-3' as disclosed in PCT/US2005/018931 may serve
as a cleavage site.
[0182] For increased nuclease resistance and/or binding affinity to
the target, a siRNA agent, e.g., the sense and/or antisense strands
of the iRNA agent, can include, for example, 2'-modified ribose
units and/or phosphorothioate linkages, e.g., the 2'-hydroxyl group
(OH) can be modified or replaced with a number of different "oxy"
or "deoxy" substituents.
[0183] Examples of "oxy"-2' hydroxyl group modifications include
alkoxy or aryloxy (or, e.g., R.dbd.H, alkyl, cycloalkyl, aryl,
aralkyl, heteroaryl, or sugar); polyethyleneglycols (PEG),
O(CH.sub.2CH.sub.2O).sub.nCH.sub.2CH.sub.2OR; "locked" nucleic
acids (LNA) in which the 2'-hydroxyl is connected, e.g., by a
methylene bridge, to the 4'-carbon of the same ribose sugar;
O-AMINE (AMINE=NH.sub.2; alkylamino, dialkylamino, heterocyclyl,
arylamino, diaryl amino, heteroaryl amino, or diheteroaryl amino,
ethylene diamine, polyamino), and aminoalkoxy,
O(CH.sub.2).sub.nAMINE (e.g., AMINE=NH.sub.2; alkylamino,
dialkylamino, heterocyclyl, arylamino, diaryl amino, heteroaryl
amino, or diheteroaryl amino, ethylene diamine, polyamino). It is
noteworthy that oligonucleotides containing only the methoxyethyl
group (MOE), (OCH.sub.2CH.sub.2OCH.sub.3, a PEG derivative),
exhibit nuclease stabilities comparable to those modified with the
robust phosphorothioate modification.
[0184] "Deoxy" modifications include hydrogen (i.e., deoxyribose
sugars, which are of particular relevance to the overhang portions
of partially dsRNA); halo (e.g., fluoro); amino (e.g., NH.sub.2;
alkylamino, dialkylamino, heterocyclyl, arylamino, diaryl amino,
heteroaryl amino, diheteroaryl amino, or amino acid);
NH(CH.sub.2CH.sub.2NH).sub.nCH.sub.2CH.sub.2-AMINE (AMINE=NH.sub.2;
alkylamino, dialkylamino, heterocyclyl, arylamino, diaryl amino,
heteroaryl amino, or diheteroaryl amino), --NHC(O)R(R=alkyl,
cycloalkyl, aryl, aralkyl, heteroaryl or sugar), cyano; mercapto;
alkyl-thio-alkyl; thioalkoxy; and alkyl, cycloalkyl, aryl, alkenyl
and alkynyl, which may be optionally substituted with, e.g., an
amino functionality. In one embodiment, the substitutents are
2'-methoxyethyl, 2'-OCH.sub.3, 2'-O-allyl, 2'-C-allyl, and
2'-fluoro.
[0185] In another embodiment, to maximize nuclease resistance, the
2'-modifications may be used in combination with one or more
phosphate linker modifications (e.g., phosphorothioate). The
so-called "chimeric" oligonucleotides are those that contain two or
more different modifications.
[0186] In certain embodiments, all the pyrimidines of a siNA agent
carry a 2'-modification, and the molecule therefore has enhanced
resistance to endonucleases. Enhanced nuclease resistance can also
be achieved by modifying the 5'-nucleotide resulting, for example,
in at least one 5'-uridine-adenine-3' (5'-UA-3') dinucleotide
wherein the uridine is a 2'-modified nucleotide; at least one
5'-uridine-guanine-3' (5'-UG-3') dinucleotide, wherein the
5'-uridine is a 2'-modified nucleotide; at least one
5'-cytidine-adenine-3' (5'-CA-3') dinucleotide, wherein the
5'-cytidine is a 2'-modified nucleotide; at least one
5'-uridine-uridine-3' (5'-UU-3') dinucleotide, wherein the
5'-uridine is a 2'-modified nucleotide; or at least one
5'-cytidine-cytidine-3' (5'-CC-3') dinucleotide, wherein the
5'-cytidine is a 2'-modified nucleotide. The siNA agent can include
at least 2, at least 3, at least 4 or at least 5 of such
dinucleotides. In some embodiments, the 5'-most pyrimidines in all
occurrences of the sequence motifs 5'-UA-3', 5'-CA-3',5'-UU-3', and
5'-UG-3' are 2'-modified nucleotides. In other embodiments, all
pyrimidines in the sense strand are 2'-modified nucleotides, and
the 5'-most pyrimidines in all occurrences of the sequence motifs
5'-UA-3' and 5'-CA-3'. In one embodiment, all pyrimidines in the
sense strand are 2'-modified nucleotides, and the 5'-most
pyrimidines in all occurrences of the sequence motifs
5'-UA-3',5'-CA-3',5'-UU-3', and 5'-UG-3' are 2'-modified
nucleotides in the antisense strand. The latter patterns of
modifications have been shown to maximize the contribution of the
nucleotide modifications to the stabilization of the overall
molecule towards nuclease degradation, while minimizing the overall
number of modifications required to a desired stability, see
International PCT Application No. PCT/US2005/018931. Additional
modifications to enhance resistance to nucleases may be found in
U.S. Patent Publication No. US 2005/0020521, and International PCT
Patent Publication Nos. WO2003/70918 and WO2005/019453.
[0187] The inclusion of furanose sugars in the oligonucleotide
backbone can also decrease endonucleolytic cleavage. Thus, in one
embodiment, the siNA of the invention can be modified by including
a 3'-cationic group, or by inverting the nucleoside at the
3'-terminus with a 3'-3'-linkage. In another alternative, the
3'-terminus can be blocked with an aminoalkyl group, e.g., a 3'
C5-aminoalkyl dT. Other 3' conjugates can inhibit
3'-5'-exonucleolytic cleavage. While not being bound by theory, a
3'-conjugate, such as naproxen or ibuprofen, may inhibit
exonucleolytic cleavage by sterically blocking the exonuclease from
binding to the 3'-end of oligonucleotide. Even small alkyl chains,
aryl groups, or heterocyclic conjugates or modified sugars
(D-ribose, deoxyribose, glucose, etc.) can block
3'-5'-exonucleases.
[0188] Similarly, 5'-conjugates can inhibit 5'-3' exonucleolytic
cleavage. While not being bound by theory, a 5'-conjugate, such as
naproxen or ibuprofen, may inhibit exonucleolytic cleavage by
sterically blocking the exonuclease from binding to the 5'-end of
oligonucleotide. Even small alkyl chains, aryl groups, or
heterocyclic conjugates or modified sugars (D-ribose, deoxyribose,
glucose etc.) can block 3'-5'-exonucleases.
[0189] An alternative approach to increasing resistance to a
nuclease by an siNA molecule proposes including an overhang to at
least one or both strands of an duplex siNA. In some embodiments,
the nucleotide overhang includes 1 to 4, preferably 2 to 3,
unpaired nucleotides. In another embodiment, the unpaired
nucleotide of the single-stranded overhang that is directly
adjacent to the terminal nucleotide pair contains a purine base,
and the terminal nucleotide pair is a G-C pair, or at least two of
the last four complementary nucleotide pairs are G-C pairs. In
other embodiments, the nucleotide overhang may have 1 or 2 unpaired
nucleotides, and in an exemplary embodiment the nucleotide overhang
may be 5'-GC-3'. In another embodiment, the nucleotide overhang is
on the 3'-end of the antisense strand.
[0190] Thus, an siNA molecule can include monomers that have been
modified so as to inhibit degradation, e.g., by nucleases, e.g.,
endonucleases or exonucleases, found in the body of a subject.
These monomers are referred to herein as NRMs or Nuclease
Resistance promoting Monomers or modifications. In some cases these
modifications will modulate other properties of the siNA agent as
well, e.g., the ability to interact with a protein, e.g., a
transport protein, e.g., serum albumin, or a member of the RISC, or
the ability of the first and second sequences to form a duplex with
one another or to form a duplex with another sequence, e.g., a
target molecule.
[0191] While not wishing to be bound by theory, it is believed that
modifications of the sugar, base, and/or phosphate backbone in an
siNA agent can enhance endonuclease and exonuclease resistance and
can enhance interactions with transporter proteins and one or more
of the functional components of the RISC complex. In some
embodiments, the modification may increase exonuclease and
endonuclease resistance and thus prolong the half-life of the siNA
agent prior to interaction with the RISC complex, but at the same
time does not render the siNA agent inactive with respect to its
intended activity as a target mRNA cleavage directing agent. Again,
while not wishing to be bound by any theory, it is believed that
placement of the modifications at or near the 3'- and/or 5'-end of
antisense strands can result in siNA agents that meet the preferred
nuclease resistance criteria delineated above.
[0192] Modifications that can be useful for producing siNA agents
that exhibit the nuclease resistance criteria delineated above may
include one or more of the following chemical and/or stereochemical
modifications of the sugar, base, and/or phosphate backbone, it
being understood that the art discloses other methods as well than
can achieve the same result:
[0193] (i) chiral (Sp) thioates. An NRM may include nucleotide
dimers with an enriched or pure for a particular chiral form of a
modified phosphate group containing a heteroatom at the nonbridging
position, e.g., Sp or Rp, at the position X, where this is the
position normally occupied by the oxygen. The atom at X can also be
S, Se, Nr.sub.2, or Br.sub.3. When X is S, enriched or chirally
pure Sp linkage is preferred. Enriched means at least 70, 80, 90,
95, or 99% of the preferred form.
[0194] (ii) attachment of one or more cationic groups to the sugar,
base, and/or the phosphorus atom of a phosphate or modified
phosphate backbone moiety. In some embodiments, the may include
monomers at the terminal position derivatized at a cationic group.
As the 5'-end of an antisense sequence should have a terminal --OH
or phosphate group this NRM is preferably not used at the 5'-end of
an antisense sequence. The group should preferably be attached at a
position on the base which minimizes interference with H bond
formation and hybridization, e.g., away form the face that
interacts with the complementary base on the other strand, e.g., at
the 5'-position of a pyrimidine or a 7-position of a purine.
[0195] (iii) nonphosphate linkages at the termini. In some
embodiments, the NRMs include non-phosphate linkages, e.g., a
linkage of 4 atoms, which confers greater resistance to cleavage
than does a phosphate bond. Examples include 3'
CH2-NCH.sub.3--O--CH.sub.2-5' and 3'
CH.sub.2--NH--(O.dbd.)-CH.sub.2-5';
[0196] (iv) 3'-bridging thiophosphates and 5'-bridging
thiophosphates. In certain embodiments, the NRMs can included these
structures;
[0197] (v) L-RNA, 2'-5' linkages, inverted linkages, a-nucleosides.
In certain embodiments, the NRMs include L-nucleosides and dimeric
nucleotides derived from L-nucleosides; 2'-5'-phosphate,
non-phosphate, and modified phosphate linkages (e.g.,
thiophosphates, phosphoramidates and boronophpoosphates); dimers
having inverted linkages, e.g., 3'-3'- or 5'-5'-linkages; monomers
having an .alpha.-linkage at the 1'-site on the sugar, e.g., the
structures described herein having an .alpha.-linkage;
[0198] (vi) conjugate groups. In certain embodiments, the NRMs can
include, e.g., a targeting moiety or a conjugated ligand described
herein conjugated with the monomer, e.g., through the sugar, base,
or backbone;
[0199] (vi) abasic linkages. In certain embodiments, the NRMs can
include an abasic monomer, e.g., an abasic monomer as described
herein (e.g., a nucleobaseless monomer); an aromatic or
heterocyclic or polyheterocyclic aromatic monomer as described
herein; and
[0200] (vii) 5'-phosphonates and 5'-phosphate prodrugs. In certain
embodiments, the NRMs include monomers, preferably at the terminal
position, e.g., the 5' position, in which one or more atoms of the
phosphate group is derivatized with a protecting group, which
protecting group or groups are removed as a result of the action of
a component in the subject's body, e.g., a carboxyesterase or an
enzyme present in the subject's body. For example, a phosphate
prodrug in which a carboxy esterase cleaves the protected molecule
resulting in the production of a thioate anion which attacks a
carbon adjacent to the 0 of a phosphate and resulting in the
production of an unprotected phosphate.
[0201] "Ligand," as used herein, means a molecule that specifically
binds to a second molecule, typically a polypeptide or portion
thereof such as a carbohydrate moiety, through a mechanism other
than an antigen-antibody interaction. The term encompasses, for
example, polypeptides, peptides, and small molecules, either
naturally occurring or synthesized, including molecules whose
structure has been invented by man. Although the term is frequently
used in the context of receptors and molecules with which they
interact and that typically modulate their activity (e.g., agonists
or antagonists), the term as used herein applies more
generally.
[0202] One or more different NRM modifications can be introduced
into an siNA agent or into a sequence of a siRNA agent. An NRM
modification can be used more than once in a sequence or in an
siRNA agent. As some NRMs interfere with hybridization, the total
number incorporated should be such that acceptable levels of siNA
agent duplex formation are maintained.
[0203] In some embodiments, NRM modifications are introduced into
the terminal cleavage site or in the cleavage region of a sequence
(a sense strand or sequence) that does not target a desired
sequence or gene in the subject.
[0204] In most cases, the nuclease-resistance promoting
modifications will be distributed differently, depending on whether
the sequence will target a sequence in the subject (often referred
to as an antisense sequence) or will not target a sequence in the
subject (often referred to as a sense sequence). If a sequence is
to target a sequence in the subject, modifications that interfere
with or inhibit endonuclease cleavage should not be inserted in the
region which is subject to RISC mediated cleavage, e.g., the
cleavage site or the cleavage region (as described in Elbashir et
al., Genes and Dev. 15:188, 2001). Cleavage of the target occurs
about in the middle of a 20 or 21 nt guide RNA, or about 10 or 11
nucleotides upstream of the first nucleotide that is complementary
to the guide sequence. As used herein, cleavage site refers to the
nucleotide on either side of the cleavage site, on the target, or
on the iRNA agent strand which hybridizes to it. Cleavage region
means a nucleotide with 1, 2, or 3 nucleotides of the cleave site,
in either direction.)
[0205] Such modifications can be introduced into the terminal
regions, e.g., at the terminal position or with 2, 3, 4, or 5
positions of the terminus of a sequence that targets or a sequence
that does not target a sequence in the subject.
VI. THERAPEUTIC USE
[0206] Examples of cancers that can be treated using the
compositions of the invention include, but are not limited to:
biliary tract cancer; bladder cancer; brain cancer including
glioblastomas and medulloblastomas; breast cancer; cervical cancer;
choriocarcinoma; colon cancer; endometrial cancer; esophageal
cancer; gastric cancer; hematological neoplasms including acute
lymphocytic and myelogenous leukemia; multiple myeloma;
AIDS-associated leukemias and adult T-cell leukemia lymphoma;
intraepithelial neoplasms including Bowen's disease and Paget's
disease; liver cancer; lung cancer; lymphomas including Burkitt's
lymphoma, Hodgkin's disease and lymphocytic lymphomas;
neuroblastomas; oral cancer including squamous cell carcinoma;
ovarian cancer including those arising from epithelial cells,
stromal cells, germ cells, and mesenchymal cells; pancreatic
cancer; prostate cancer; rectal cancer; sarcomas including
leiomyosarcoma, rhabdomyo sarcoma, liposarcoma, fibro sarcoma, and
osteosarcoma; skin cancer including melanoma, Kaposi's sarcoma,
basocellular cancer, and squamous cell cancer; testicular cancer
including germinal tumors such as seminoma, non-seminoma,
teratomas, choriocarcinomas; stromal tumors and germ cell tumors;
thyroid cancer including thyroid adenocarcinoma and medullar
carcinoma; and renal cancer including adenocarcinoma and Wilms'
tumor. Commonly encountered cancers include breast, prostate, lung,
ovarian, colorectal, and brain cancer. In general, an effective
amount of the one or more compositions of the invention for
treating cancer will be that amount necessary to inhibit mammalian
cancer cell proliferation in situ. Those of ordinary skill in the
art are well schooled in the art of evaluating effective amounts of
anti-cancer agents.
[0207] In some cases, the above-described treatment methods may be
combined with known cancer treatment methods. The term "cancer
treatment" as used herein may include, but is not limited to,
chemotherapy, radiotherapy, adjuvant therapy, surgery, or any
combination of these and/or other methods. Particular forms of
cancer treatment may vary, for instance, depending on the subject
being treated. Examples include, but are not limited to, dosages,
timing of administration, duration of treatment, etc. One of
ordinary skill in the medical arts can determine an appropriate
cancer treatment for a subject.
[0208] The molecules of the instant invention can be used as
pharmaceutical agents. Pharmaceutical agents prevent, inhibit the
occurrence, or treat (alleviate a symptom to some extent,
preferably all of the symptoms) of a disease state in a
subject.
[0209] The negatively charged polynucleotides of the invention can
be administered (e.g., RNA, DNA, or protein complex thereof) and
introduced into a subject by any standard means, with or without
stabilizers, buffers, and the like, to form a pharmaceutical
composition. When it is desired to use a liposome delivery
mechanism, standard protocols for formation of liposomes can be
followed. The compositions of the present invention can also be
formulated and used as tablets, capsules or elixirs for oral
administration; suppositories for rectal administration; sterile
solutions; suspensions for injectable administration; and the other
compositions known in the art.
[0210] The present invention also includes pharmaceutically
acceptable formulations of the compounds described. These
formulations include salts of the above compounds, e.g., acid
addition salts, for example, salts of hydrochloric, hydrobromic,
acetic acid, and benzene sulfonic acid.
[0211] A pharmacological composition or formulation refers to a
composition or formulation in a form suitable for administration,
e.g., systemic administration, into a cell or subject, preferably a
human. Suitable forms, in part, depend upon the use or the route of
entry, for example oral, transdermal, or by injection. Such forms
should not prevent the composition or formulation from reaching a
target cell (i.e., a cell to which the negatively charged polymer
is desired to be delivered to). For example, pharmacological
compositions injected into the blood stream should be soluble.
Other factors are known in the art and include considerations such
as toxicity and forms that prevent the composition or formulation
from exerting its effect.
[0212] In some embodiments, the molecules of the instant invention
are administered locally to a localized region of a subject, such
as a tumor, via local injection.
[0213] By "systemic administration" it is meant in vivo systemic
absorption or accumulation of drugs in the blood stream followed by
distribution throughout the entire body. Administration routes that
lead to systemic absorption include, without limitations:
intravenous, subcutaneous, intraperitoneal, inhalation, oral,
intrapulmonary and intramuscular. Each of these administration
routes exposes the desired negatively charged polymers, e.g.,
nucleic acids, to an accessible diseased tissue. The rate of entry
of a drug into the circulation has been shown to be a function of
molecular weight or size. The use of a liposome or other drug
carrier comprising the compounds of the instant invention can
potentially localize the drug, for example, in certain tissue
types, such as the tissues of the reticular endothelial system
(RES). A liposome formulation that can facilitate the association
of drug with the surface of cells, such as, lymphocytes and
macrophages is also useful. This approach can provide enhanced
delivery of the drug to target cells by taking advantage of the
specificity of macrophage and lymphocyte immune recognition of
abnormal cells, such as cancer cells.
[0214] By "pharmaceutically acceptable formulation," it is meant, a
composition or formulation that allows for the effective
distribution of the nucleic acid molecules of the instant invention
in the physical location most suitable for their desired
activity.
[0215] Non-limiting examples of agents suitable for formulation
with the nucleic acid molecules of the instant invention include:
PEG conjugated nucleic acids, phospholipid conjugated nucleic
acids, nucleic acids containing lipophilic moieties,
phosphorothioates, P-glycoprotein inhibitors (such as Pluronic P85)
that can enhance entry of drugs into various tissues, for example,
the CNS (Jolliet-Riant and Tillement, Fundam. Clin. Pharmacol.
13:16-26, 1999); biodegradable polymers, such as poly
(DL-lactide-coglycolide) microspheres for sustained release
delivery after implantation (Emerich, D. F. et al., Cell Transplant
8:47-58, 1999) (Alkermes, Inc., Cambridge, Mass.); and loaded
nanoparticles, such as those made of polybutylcyanoacrylate, which
can deliver drugs across the blood brain barrier and can alter
neuronal uptake mechanisms (Schroeder, U., et al., Prog.
Neuropsychopharmacol. Biol. Psychiatry 23:941-949, 1999). Other
non-limiting examples of delivery strategies, including CNS
delivery of the nucleic acid molecules of the instant invention,
include material described in Boado et al., J. Pharm. Sci.
87:1308-1315, 1998; Tyler et al., FEBS Lett. 421:280-284, 1999;
Pardridge et al., PNAS USA. 92:5592-5596, 1995; Boado R. J.,
"Antisense Drug Delivery Through the Blood-Brain Barrier," Adv.
Drug Del. Rev. 15:73-107, 1995; Aldrian-Herrada et al., Nucleic
Acids Res. 26:4910 4916, 1998; and Tyler et al., PNAS USA
96:7053-7058, 1999. All these references are hereby incorporated
herein by reference.
[0216] The invention also features the use of the composition
comprising surface-modified liposomes containing poly (ethylene
glycol) lipids (PEG-modified, or long-circulating liposomes or
stealth liposomes). Nucleic acid molecules of the invention can
also comprise covalently attached PEG molecules of various
molecular weights. These formulations offer a method for increasing
the accumulation of drugs in target tissues. This class of drug
carriers resists opsonization and elimination by the mononuclear
phagocytic system (MPS or RES), thereby enabling longer blood
circulation times and enhanced tissue exposure for the encapsulated
drug (Lasic et al., Chem. Rev. 95:2601-2627, 1995; Ishiwata et al.,
Chem. Pharm. Bull. 43:1005-1011, 1995). Such liposomes have been
shown to accumulate selectively in tumors, presumably by
extravasation and capture in the neovascularized target tissues
(Lasic et al., Science 267:1275-1276, 1995; Oku et al., Biochim.
Biophys. Acta 1238:86-90, 1995). The long-circulating liposomes
enhance the pharmacokinetics and pharmacodynamics of DNA and RNA,
particularly compared to conventional cationic liposomes which are
known to accumulate in tissues of the MPS (Liu et al., J. Biol.
Chem. 42:24864-24870, 1995; Choi et al., International PCT
Publication No. WO 96/10391; Ansell et al., International PCT
Publication No. WO 96/10390; Holland et al., International PCT
Publication No. WO 96/10392; all of which are incorporated by
reference herein). Long-circulating liposomes are also likely to
protect drugs from nuclease degradation to a greater extent
compared to cationic liposomes, based on their ability to avoid
accumulation in metabolically aggressive MPS tissues such as the
liver and spleen. All of these references are incorporated by
reference herein.
[0217] The invention also includes compositions comprising
interfering nanoparticles composed of natural amino acids labeled
with lipids and complexed with unmodified or modified siRNA as
described in Baigude, H. et al., ACS Chem. Biol. 2:237-241, 2007,
which is hereby incorporated by reference herein.
[0218] The present invention also includes compositions prepared
for storage or administration that include a pharmaceutically
effective amount of the desired compounds in a pharmaceutically
acceptable carrier or diluent. Acceptable carriers or diluents for
therapeutic use are well known in the pharmaceutical art and are
described, for example, Remington's Pharmaceutical Sciences, Mack
Publishing Co. (A. R. Gennaro, ed., 1985) hereby incorporated by
reference herein. For example, preservatives, stabilizers, dyes and
flavoring agents can be provided. These include sodium benzoate,
sorbic acid and esters of p-hydroxybenzoic acid. In addition,
antioxidants and suspending agents can be used.
[0219] A pharmaceutically effective dose is that dose required to
prevent, inhibit the occurrence, or treat (alleviate a symptom to
some extent, preferably all of the symptoms) of a disease state.
The pharmaceutically effective dose depends on the type of disease,
the composition used, the route of administration, the type of
mammal being treated, the physical characteristics of the specific
mammal under consideration, concurrent medication, and other
factors which those skilled in the medical arts will recognize.
Generally, an amount between 0.1 mg/kg and 100 mg/kg body
weight/day of active ingredients is administered dependent upon
potency of the negatively charged polymer.
[0220] The nucleic acid molecules of the invention and formulations
thereof can be administered orally, topically, parenterally, by
inhalation or spray, or rectally in dosage unit formulations
containing conventional non-toxic pharmaceutically acceptable
carriers, adjuvants and vehicles. The term parenteral as used
herein includes percutaneous, subcutaneous, intravascular (e.g.,
intravenous), intramuscular, or intrathecal injection or infusion
techniques and the like. In addition, there is provided a
pharmaceutical formulation comprising a nucleic acid molecule of
the invention and a pharmaceutically acceptable carrier. One or
more nucleic acid molecules of the invention can be present in
association with one or more non-toxic pharmaceutically acceptable
carriers and/or diluents and/or adjuvants, and if desired other
active ingredients. The pharmaceutical compositions containing
nucleic acid molecules of the invention can be in a form suitable
for oral use, for example, as tablets, troches, lozenges, aqueous
or oily suspensions, dispersible powders or granules, emulsion,
hard or soft capsules, or syrups or elixirs.
[0221] Compositions intended for oral use can be prepared according
to any method known to the art for the manufacture of
pharmaceutical compositions and such compositions can contain one
or more such sweetening agents, flavoring agents, coloring agents
or preservative agents in order to provide pharmaceutically elegant
and palatable preparations. Tablets contain the active ingredient
in admixture with non-toxic pharmaceutically acceptable excipients
that are suitable for the manufacture of tablets. These excipients
can be for example, inert diluents, such as calcium carbonate,
sodium carbonate, lactose, calcium phosphate or sodium phosphate;
granulating and disintegrating agents, for example, corn starch, or
alginic acid; binding agents, for example starch, gelatin or
acacia, and lubricating agents, for example magnesium stearate,
stearic acid or talc. The tablets can be uncoated or they can be
coated by known techniques. In some cases such coatings can be
prepared by known techniques to delay disintegration and absorption
in the gastrointestinal tract and thereby provide a sustained
action over a longer period. For example, a time delay material
such as glyceryl monosterate or glyceryl distearate can be
employed.
[0222] Formulations for oral use can also be presented as hard
gelatin capsules wherein the active ingredient is mixed with an
inert solid diluent, for example, calcium carbonate, calcium
phosphate, or kaolin, or as soft gelatin capsules wherein the
active ingredient is mixed with water or an oil medium, for
example, peanut oil, liquid paraffin, or olive oil.
[0223] Aqueous suspensions contain the active materials in
admixture with excipients suitable for the manufacture of aqueous
suspensions. Such excipients are suspending agents, for example
sodium carboxymethylcellulose, methylcellulose,
hydropropyl-methylcellulose, sodium alginate, polyvinylpyrrolidone,
gum tragacanth, and gum acacia; dispersing or wetting agents can be
a naturally-occurring phosphatide, for example, lecithin, or
condensation products of an alkylene oxide with fatty acids, for
example, polyoxyethylene stearate, or condensation products of
ethylene oxide with long chain aliphatic alcohols, for example,
heptadecaethyleneoxycetanol, or condensation products of ethylene
oxide with partial esters derived from fatty acids and an hexitol
such as polyoxyethylene sorbitol monooleate, or condensation
products of ethylene oxide with partial esters derived from fatty
acids and hexitol anhydrides, for example polyethylene sorbitan
monooleate. The aqueous suspensions can also contain one or more
preservatives, for example, ethyl or n-propyl p-hydroxybenzoate,
one or more coloring agents, one or more flavoring agents, and one
or more sweetening agents such as sucrose or saccharin.
[0224] Oily suspensions can be formulated by suspending the active
ingredients in a vegetable oil, for example. arachis oil, olive
oil, sesame oil or coconut oil, or in a mineral oil such as liquid
paraffin. The oily suspensions can contain a thickening agent, for
example, beeswax, hard paraffin, or cetyl alcohol. Sweetening
agents and flavoring agents can be added to provide palatable oral
preparations. These compositions can be preserved by the addition
of an antioxidant such as ascorbic acid.
[0225] Dispersible powders and granules suitable for preparation of
an aqueous suspension by the addition of water provide the active
ingredient in admixture with a dispersing or wetting agent,
suspending agent and one or more preservatives. Suitable dispersing
or wetting agents or suspending agents are exemplified by those
already mentioned above. Additional excipients, for example
sweetening, flavoring, and coloring agents, can also be
present.
[0226] Pharmaceutical compositions of the invention can also be in
the form of oil-in-water emulsions. The oily phase can be a
vegetable oil or a mineral oil or mixtures of these. Suitable
emulsifying agents can be naturally-occurring gums, for example,
gum acacia or gum tragacanth, naturally-occurring phosphatides, for
example, soy bean, lecithin, and esters or partial esters derived
from fatty acids and hexitol, anhydrides, for example, sorbitan
monooleate, and condensation products of the said partial esters
with ethylene oxide, for example, polyoxyethylene sorbitan
monooleate. The emulsions can also contain sweetening and flavoring
agents.
[0227] Syrups and elixirs can be formulated with sweetening agents,
for example, glycerol, propylene glycol, sorbitol, glucose, or
sucrose. Such formulations can also contain a demulcent, a
preservative, and flavoring and coloring agents. The pharmaceutical
compositions can be in the form of a sterile injectable aqueous or
oleaginous suspension. This suspension can be formulated according
to the known art using those suitable dispersing or wetting agents
and suspending agents that have been mentioned above. The sterile
injectable preparation can also be a sterile injectable solution or
suspension in a non-toxic parentally acceptable diluent or solvent,
for example as a solution in 1,3-butanediol. Among the acceptable
vehicles and solvents that can be employed are water, Ringer's
solution, and isotonic sodium chloride solution. In addition,
sterile, fixed oils are conventionally employed as a solvent or
suspending medium. For this purpose, any bland fixed oil can be
employed including synthetic mono- or diglycerides. In addition,
fatty acids such as oleic acid find use in the preparation of
injectables.
[0228] The nucleic acid molecules of the invention can also be
administered in the form of suppositories, e.g., for rectal
administration of the drug. These compositions can be prepared by
mixing the drug with a suitable non-irritating excipient that is
solid at ordinary temperatures but liquid at the rectal temperature
and will therefore melt in the rectum to release the drug. Such
materials include cocoa butter and polyethylene glycols.
[0229] Nucleic acid molecules of the invention can be administered
parenterally in a sterile medium. The drug, depending on the
vehicle and concentration used, can either be suspended or
dissolved in the vehicle. Advantageously, adjuvants such as local
anesthetics, preservatives and buffering agents can be dissolved in
the vehicle.
[0230] Dosage levels of the order of from about 0.1 mg to about 140
mg per kilogram of body weight per day are useful in the treatment
of the above-indicated conditions (about 0.5 mg to about 7 mg per
patient or subject per day). The amount of active ingredient that
can be combined with the carrier materials to produce a single
dosage form varies depending upon the host treated and the
particular mode of administration. Dosage unit forms generally
contain between from about 1 mg to about 500 mg of an active
ingredient.
[0231] It is understood that the specific dose level for any
particular patient or subject depends upon a variety of factors
including the activity of the specific compound employed, the age,
body weight, general health, sex, diet, time of administration,
route of administration, and rate of excretion, drug combination,
and the severity of the particular disease undergoing therapy.
[0232] For administration to non-human animals, the composition can
also be added to the animal feed or drinking water. It can be
convenient to formulate the animal feed and drinking water
compositions so that the animal takes in a therapeutically
appropriate quantity of the composition along with its diet. It can
also be convenient to present the composition as a premix for
addition to the feed or drinking water.
[0233] The nucleic acid molecules of the present invention can also
be administered to a subject in combination with other therapeutic
compounds to increase the overall therapeutic effect. The use of
multiple compounds to treat an indication can increase the
beneficial effects while reducing the presence of side effects.
[0234] Examples are provided below to further illustrate different
features and advantages of the present invention. The examples also
illustrate useful methodology for practicing the invention. These
examples should not be construed to limit the claimed
invention.
Example 1
[0235] This example shows that miR-210 is upregulated under hypoxic
conditions in tumor cell lines.
[0236] Methods.
[0237] Cell Cultures. HCT116 Dicer.sup.ex5, RKO Dicer.sup.ex5 and
DLD-1 Dicer.sup.ex5 cells were previously described (Cummins et
al., 2006). Wild type HCT116, RKO, DLD-1, HeLa, A549, MCF7, Hep3B,
HuH7, H1299, U251, and ME-180 cells were from the American type
Culture Collection, Rockville, Md. 786-O renal cell carcinoma cells
and their variants were a kind gift from William G. Kaelin. 786-O
WT7 cells were 786-O stably transfected with pRc-CMV-HA-VHL (WT7)
(von Hippel-Lindau ("VHL") gene functional) (Li et al., 2007),
786-OpBABE cells were 786-O infected with pBABE empty vector (and
therefore VHL defective), and 786-O-pBABE-VHL cells were 786-O
infected with pBABE-VHL (and therefore VHL functional). HFF-pBABE
and HFF-Myc were described previously (Benanti et al., 2007).
[0238] Hypoxia. Hypoxia (1% O.sub.2) was achieved using a HERAcell
150 Tri-Gas cell culture incubator (Kendro Laboratories Products,
Newtown, Conn.) or an In Vivo2 200 hypoxic station (Ruskinn
Technologies).
[0239] Quantitative PCR. miRNA levels were determined using a
quantitative primer-extension PCR assay (Raymond et al., 2005). Ct
values were converted to copy numbers by comparison to standard
curves generated using single stranded mature miRNAs and are
expressed as copies/10 pg input RNA (approximately equivalent to
copies/cell).
[0240] Microarray analysis. Microarray analysis was performed as
described (Jackson et al., "Expression Profiling Reveals Off-Target
Gene Regulation by RNAi," Nat. Biotechnol. 21:635-637, 2003).
Briefly, total RNA was purified by a QIAGEN RNeasy kit and
processed as described previously (Hughes et al., "Expression
Profiling Using Microarrays Fabricated by an Ink-Jet
Oligonucleotide Synthesizer," Nat. Biotechnol. 19:342-347, 2001)
for hybridization to microarrays containing oligonucleotides
corresponding to about 21,000 human genes. Ratio hybridizations
were performed with fluorescent label reversal to eliminate dye
bias. The data shown are signature genes that display a difference
in expression level (p<0.01) relative to mock-transfected cells.
No cut offs were placed on fold change in expression. The data were
analyzed using Rosetta Resolver.TM. software. Differences in
transcript regulation between unmodified and modified duplexes were
calculated individually for each transcript. Transcript regulation
was calculated as the error-weighted mean log.sub.10 ratio for each
transcript across the fluor-reversed pair. Differences in
regulation between unmodified and modified duplex were then divided
by the log.sub.10 ratio for the unmodified duplex for that
transcript to result in the normalized mean log ratio change.
[0241] Results
[0242] To discover microRNAs that are modulated during the hypoxia
response in tumors, the expression levels of approximately 200
microRNAs in a panel of 8 cancer cell lines from 4 different
tissues was determined. The cell lines tested were HCT116, HT29,
DLD1, and RKO (colon); HeLa and ME-180 (cervical); U251 (glioma),
and 786-O (kidney). HMEC (human mammary epithelial cell) and HFF
(human foreskin fibroblasts) cells were included as normal cell
controls. Cells were exposed to normoxia (21% O.sub.2) or hypoxia
(1% O.sub.2) for 24 hours and RNAs were isolated and analyzed for
the expression of microRNAs using primer extension quantitative PCR
(PE-qPCR). As shown in FIG. 1, miR-210 was up-regulated
approximately 19-fold in HT29 cells after hypoxia treatment
(microRNA copy number per 10 pg of RNA increased from 165 to 3075).
Most of the other miRNAs fall on the diagonal of the graph,
indicating similar expression levels between Normoxia (X axis) and
Hypoxia (Y axis).
[0243] Previous work showed that miR-210 was among several
microRNAs induced by hypoxia (Kulshreshtha et al., 2007a). Table 2
shows that miR-210 was upregulated more than any other miRNA tested
in HT129 cells.
TABLE-US-00002 TABLE 2 Upregulation of miRNAs Under Hypoxic
Conditions in HT29 cells..sup.a miRNA Normoxia Hypoxia Fold
Induction miR-210 165 3075 18.62 miR-302b 1 10 6.97 miR-135a 32 161
4.95 miR-374 2441 10926 4.48 miR-130b 181 776 4.29 miR-146 23 90
3.93 let7f 5480 20527 3.75 miR-142-3p 560 1952 3.49 miR-30a-5p 422
1450 3.44 miR-15a 1221 4183 3.43 miR-433 13 42 3.23 miR-450 9 28
3.06 miR-30d 1667 5007 3.00 miR-223 9 25 2.95 miR-380-5p 5 15 2.94
miR-365 1405 4051 2.88 miR-150 51 146 2.84 let7g 3062 8592 2.81
miR-9 1 2 2.78 miR-152 35 96 2.77 miR-30c 1055 2901 2.75 miR-296 3
9 2.73 miR-375 260 701 2.69 miR-217 5 13 2.64 miR-106b 3431 8874
2.59 miR-27a 4569 11782 2.58 miR-16 4335 11093 2.56 miR-151 59526
147639 2.48 miR-126 4 10 2.48 miR-25 2076 5021 2.42 miR-190 58 139
2.39 miR-135b 680 1610 2.37 miR-148a 25 60 2.36 miR-345 47 107 2.30
miR-429 6865 15650 2.28 miR-34c 1 2 2.27 miR-181c 45 100 2.23
miR-15b 989 2191 2.22 miR-26a 3488 7578 2.17 miR-337 0 1 2.15
miR-30e-3p 65 138 2.13 miR-200c 7081 14962 2.11 miR-224 1465 3065
2.09 miR-181b 1534 3192 2.08 let7i 10944 22427 2.05 miR-367 1 2
2.04 miR-28 53 108 2.02 miR-34a 635 1283 2.02 miR-183 530 1053 1.99
miR-32 252 495 1.96 miR-129 2 4 1.91 miR-10a 11115 21123 1.90
miR-371 1 2 1.90 miR-24 1041 1974 1.90 miR-184 5 9 1.90 miR-31
10994 20719 1.88 miR-96 732 1377 1.88 miR-340 12 23 1.88 miR-133a
11 21 1.88 miR-202 1 1 1.87 miR-10b 2194 4075 1.86 miR-216 12 22
1.84 miR-323 0 0 1.80 miR-103 5829 10469 1.80 miR-133b 8 14 1.79
miR-205 1567 2806 1.79 miR-212 6 11 1.79 miR-302b* 1 2 1.78 miR-147
4 8 1.78 miR-26b 4736 8368 1.77 miR-140 252 443 1.76 miR-192 2642
4603 1.74 miR-125b 10 18 1.74 miR-34b 30 52 1.71 miR-132 44 75 1.71
miR-302c 7 13 1.71 let7e 5534 9427 1.70 miR-372 1 1 1.70 miR-221
26400 43924 1.66 miR-29a 5989 9904 1.65 miR-197 297 490 1.65
miR-182 768 1259 1.64 miR-21 35242 57757 1.64 miR-122a 1 1 1.63
miR-30b 8761 13902 1.59 miR-196a 464 734 1.58 miR-338 1082 1705
1.58 miR-206 3 4 1.58 miR-215 14165 21881 1.54 miR-425 52 80 1.54
miR-145 5 7 1.53 miR-376a 3 4 1.53 miR-301 937 1427 1.52 miR-19b
11003 16720 1.52 miR-22 1770 2690 1.52 let7d 10657 16146 1.52
miR-193 26 40 1.51 miR-185 6590 9874 1.50 miR-29c 1881 2788 1.48
miR-93 4386 6358 1.45 miR-452 67 96 1.44 miR-125a 4046 5824 1.44
miR-189 89 128 1.43 miR-27b 2709 3884 1.43 miR-222 2802 4003 1.43
miR-422a 3 4 1.42 miR-329 13 18 1.42 miR-182* 9 12 1.42 miR-200a
12611 17735 1.41 miR-23a 7199 10064 1.40 miR-203 843 1176 1.39
miR-191 1045 1452 1.39 miR-331 375 521 1.39 miR-194 3091 4290 1.39
miR-376b 6 8 1.38 miR-302a 160 219 1.37 miR-181a 1404 1920 1.37
miR-302d 59 80 1.36 miR-423 640 860 1.34 miR-141 5276 7075 1.34
miR-20 7315 9796 1.34 miR-7 20400 27271 1.34 miR-324-5p 251 335
1.34 miR-127 33 44 1.33 miR-320 1306 1724 1.32 miR-1 4 5 1.32
miR-149 75 99 1.32 miR-339 960 1257 1.31 miR-412 2 3 1.31 miR-17-5p
2469 3213 1.30 miR-372 1 1 1.29 miR-214 22 28 1.27 miR-23b 6081
7744 1.27 miR-211 4 5 1.25 miR-148b 667 833 1.25 miR-134 23 29 1.25
miR-98 1743 2151 1.23 miR-220 0 0 1.23 miR-213 56 67 1.20 miR-99b
1616 1934 1.20 miR-18 6073 7232 1.19 let7c 2681 3161 1.18 miR-200b
8944 10519 1.18 miR-342 0 0 1.17 miR-204 3 3 1.15 miR-328 307 353
1.15 miR-330 49 56 1.15 miR-92 10712 12266 1.15 miR-363 1 1 1.14
miR-107 2176 2462 1.13 miR-422b 220 248 1.13 miR-195 14 16 1.12
miR-143 39 43 1.12 miR-30e-5p 925 1033 1.12 miR-218 1 1 1.12
miR-188 22 24 1.11 miR-138 2 3 1.10 miR-99a 52 57 1.10 miR-198 83
91 1.09 miR-106a 2082 2262 1.09 miR-199a 72 78 1.08 miR-100 834 900
1.08 miR-370 97 104 1.07 miR-29b 10286 10835 1.05 miR-377 24 24
1.04 miR-19a 11203 11653 1.04 miR-153 5 5 1.03 miR-324-3p 858 887
1.03 let7a 12686 13103 1.03 miR-199a* 12 13 1.03 miR-381 74 76 1.02
miR-199b 2 2 1.02 miR-326 129 131 1.02 miR-101 655 663 1.01 let7b
13014 13171 1.01 miR-302a* 3 3 0.98 miR-187 2 2 0.98 miR-128b 299
280 0.94 miR-196b 355 332 0.94 miR-299 2 2 0.92 miR-346 73 67 0.92
miR-186 1849 1693 0.92 miR-219 78 70 0.91 miR-128a 869 761 0.88
miR-378 34 27 0.79 miR-325 26 20 0.78 miR-302c* 508 379 0.75
miR-448 13 8 0.65 miR-144 7 4 0.62 miR-154* 1 0 0.59 miR-124a 31 17
0.54 miR-451 8 3 0.45 miR-154 2 1 0.44 .sup.aCopies per 10 pg of
RNA of the miRNAs were determined using primer extension
quantitative PCR (PE-qPCR). delta Ct was converted to copy number
by comparison with standard curves generated by use of defined
input of single stranded mature miRNAs.
[0244] Further, as shown in Table 3, hypoxia treatment results in
increased expression of miR-210 in most of the cell lines
tested.
TABLE-US-00003 TABLE 3 Upregulation of miR-210 by hypoxia in tumor
cell lines.* Fold induction Cell Line (hypoxia/normoxia) HeLa 27.2
ME180 9.1 HCT116 5.4 HT29 18.6 DLD1 9.1 RKO 16.9 U251 2.1
786-O-pBABE-VHL 3.7 HMEC 1.8 HFF-pBABE 8.6 HFF-c-Myc 7.6 *Fold
induction of miR-210 by hypoxia relative to normoxia (copy number
per 10 pg RNA determined by PE-qPCR).
[0245] miR-210 is located on Chromosome 11 in the intron of a
non-coding transcriptional unit (Genbank Accession number
AK123483). Transcription from the miR-210 promoter yields the
pri-miR-210 primary transcript (SEQ ID NO:2), which is processed in
the cell to produce the mature microRNA (SEQ ID NO:1) (Kim, V. N.,
and J. W. Nam, "Genomics of microRNA," Trends Genet. 22:165-173,
2006). Expression of the primary pri-miR-210 transcript was
detected by microarray analysis as described (Jackson, A. L., et
al., "Expression Profiling Reveals Off-Target Gene Regulation by
RNAi," Nat. Biotechnol. 21:635-637, 2003). As shown in Table 4, the
expression of the pri-miR-210 primary transcript is also
upregulated under hypoxic conditions in the following cell lines:
HCT116, HeLa, HT29, U251, H1299 (human lung carcinoma), MCF7 (human
breast adenocarcinoma), A549 (human lung epithelial carcinoma),
PC-3 (human prostate adenocarcinoma), Hep3B (human hepatoma), HuH7
(human hepatoma), DLD1, RKO, HFF, and ME-180. Further, as shown in
Table 5, a time course study revealed that miR-210 up-regulation
was detected as early as 4 hours after the start of hypoxia
treatment in ME-180 cells, indicating that miR-210 might be a
direct target of HIF.
TABLE-US-00004 TABLE 4 Upregulation of pri-miR-210 by Hypoxia in
Tumor Cell Lines.* Fold induction Cell Line (hypoxia/normoxia)
p-value HCT116 5.9 1.18E-27 HeLa 16.4 1.38E-35 HT29 8.6 5.56E-33
U251 3.1 4.16E-14 786-O-pBABE-VHL 2.5 6.26E-12 H1299 10.0 2.21E-24
MCF7 8.2 5.67E-32 A549 12.4 2.56E-27 PC-3 3.3 1.42E-10 Hep3B 5.2
1.04E-24 HuH7 9.5 4.10E-36 DLD1 2.3 1.51E-08 RKO 1.6 0.003791
HFF-pBABE 1.9 0.000076 HFF-Myc 1.3 0.061481 *The level of
pri-miR-210 was determined by gene expression profiling in cells
exposed to normoxia or hypoxia for 24 hours. Fold induction of
pri-miR-210 by hypoxia relative to normoxia.
TABLE-US-00005 TABLE 5 Time Course of Upregulation of pri- miR-210
by Hypoxia in ME180 Cells.* Fold induction Time (hypoxia/normoxia)
p-value 4 hr 10.2 9.55E-33 8 hr 19.4 1.82E-38 24 hr 18.9 2.79E-25
*The level of pri-miR-210 was determined by gene expression
profiling in cells exposed to normoxia or hypoxia for 4, 8 and 24
hours. Fold induction of pri-miR-210 by hypoxia relative to
normoxia.
[0246] In summary, this example shows that miR-210 is up-regulated
under hypoxic conditions in tumor cell lines and primary cell
lines, suggesting that upregulation of miR-210 is a universal
physiological response to the hypoxic environment. Further, miR-210
is the most highly induced microRNA in HT29 cells treated with
hypoxia. The early time course of induction by hypoxia suggests
that pri-miR-210 is a direct target of HIF transcription
factors.
Example 2
[0247] This example shows that miR-210 is directly regulated by
HIF-1 and HIF-2.
[0248] Methods
[0249] siRNA duplexes. siRNA sequences that target HIF-1.alpha.,
HIF-1.beta., and HIF-2.alpha. were designed with an algorithm
developed to increase efficiency of the siRNAs for silencing while
minimizing their "off target" effects (Jackson et al., 2003b).
siRNA duplexes were ordered from Sigma-Proligo (Boulder,
Colo.).
[0250] Transfections. Cells were plated 24 hours prior to
transfection. Cells were transfected in 6-well plates using
Lipofectamine RNAiMAX (Invitrogen, Carlsbad, Calif.). siRNAs were
used at 100 nM final concentration. For HIF-1.alpha., HIF-1.beta.,
and HIF-2.alpha. siRNA experiments, three siRNAs targeting the same
gene were pooled at equal molarity (final concentration of each
siRNA 33 nM; total siRNA concentration, 100 nM). The siRNAs
targeting HIF-1.alpha. comprise the guide sequences of SEQ ID NOs:
6-8; the siRNAs targeting HIF-1.beta. comprise the guide sequences
of SEQ ID NOs: 9-11; and the siRNAs targeting HIF-2.alpha. comprise
the guide sequences of SEQ ID NOs: 12-14.
[0251] ChIP assay. Chromatin IP was performed following the
protocol from Genpathway (San Diego, Calif.). Cells were exposed to
hypoxia (1% O.sub.2) or normoxia (21% O.sub.2) for 24 hours and
fixed with 1% freshly-prepared formaldehyde for 15 minutes at room
temperature. Nuclear extracts were prepared and sonicated to
produce DNA fragments. Antibody against HIF-1.alpha. (Abcam:
ab2185) was used for immunoprecipitation. Binding events of
HIF-1.alpha. antibody to the miR210 promoter regions were
determined by quantitative PCR (Q-PCR). Q-PCR reactions were
carried out in triplicate on specific genomic regions using SYBR
Green Supermix (Bio-Rad). Experimental Ct values were converted to
copy numbers detected by comparison with a DNA standard curve run
on the same PCR plate. Copy number values were then normalized for
primer efficiency by dividing by the values obtained using Input
DNA and the same primer pairs. Forward primer
(5'-AGGAGCCTTGACGGTTTGAC-3') (SEQ ID NO:21) and reverse primer
(5'-GAGGACCAGGGTGACAGTG-3') (SEQ ID NO:22) were used to amplify the
promoter region of miR-210 with the putative HIF binding site. The
lactate dehydrogenase A (LDHA) promoter HIF-1.alpha. binding site
served as the positive binding control. A region of genomic DNA
without HIF-1.alpha. binding sites served as the negative binding
control.
[0252] Results
[0253] In the first set of experiments, HCT116 or 786-O cells were
transfected with siRNAs that inhibit expression of HIF-1.alpha.,
HIF-2.alpha., or the common subunit HIF-1.beta.. Twenty-four (24)
hours after transfection the cells were exposed to hypoxia for
another 24 hours. Gene expression profiles were then determined by
microarray analysis. Silencing of HIF-1.alpha. in HCT116 cells
using equal amounts of three siRNAs (SEQ ID NOs:6, 7, and 8)
reduced the expression of pri-miR-210 transcript (SEQ ID NO:2) by
64%. Silencing of HIF-1.beta. in HCT116 cells using equal amounts
of three siRNAs (SEQ ID NOs:9, 10, and 11) decreased expression of
pri-miR-210 transcript by 76%. In 786-O-pBABE cells (786-O cells
infected with pBABE empty vector, and therefore VHL defective) that
are primarily HIF-2.alpha. dependent for HIF activity, silencing of
HIF-2.alpha. using equal amounts of three siRNAs (SEQ ID NOs:12,
13, and 14) reduced expression of pri-miR-210 by 45%. Silencing of
HIF-1.beta. in 786-O-pBABE cells using equal amounts of three
siRNAs (SEQ ID NOs:9, 10, and 11) reduced expression of pri-miR-210
by 64%.
[0254] In contrast, overexpression of a stabilized variant of
HIF-2.alpha. (which is not recognized by the VHL complex for
degradation) in 786-O-WT7 cells (a stable subclone of 786-O cells
expressing wild-type pVHL) induced expression of pri-miR-210
3.37-fold, consistent with miR-210 being a transcriptional target
of HIF.
[0255] In the second set of experiments, the effect of HIF
silencing on the expression of mature miR-210 (SEQ ID NO:1) in
HCT116 Dicer.sup.ex5 cells after hypoxia treatment was determined.
HCT116 Dicer.sup.ex5 cells are homozygous for a mutation in the
Dicer helicase domain and have negligible background of endogenous
microRNAs (Cummins et al., 2006; Linsley et al., 2007). As shown in
FIG. 2, silencing of HIF-1.alpha. reduced miR-210 copy number by
30%, whereas silencing of HIF-1.beta. reduced miR-210 copy number
by 45%. Inhibiting HIF-2.alpha. had no effect because HIF-2.alpha.
is not the dominant HIF a family member in the HCT116 cell
line.
[0256] To confirm that miR-210 was a direct target of HIF,
chromatin immunoprecipitation assays were performed. As shown in
FIGS. 3A and 3B, HIF-1.alpha. antibody immunoprecipitated the
postulated promoter region of miR-210 under hypoxic conditions in
both HuH7 and U251 cells.
[0257] In summary, the data shown in this example indicate that
miR-210 expression is directly modulated by HIF family members, in
particular, HIF-1.alpha., HIF-2.alpha., and HIF-1.beta..
Example 3
[0258] This example shows that miR-210 functions as a biomarker for
metastatic potential.
[0259] Methods
[0260] RNA was isolated from matched tumor and adjacent
non-involved normal tissues from the same patients. The level of
pri-miR-210 was determined by microarray gene expression profiling.
In one set of experiments, for each cancer type, up to 75 pairs of
matched tumor and adjacent non-involved normal samples from the
same patients were profiled against a pool of a subset of the
normal samples. The combined p-value indicates the probability that
the expression of pri-miR-210 in normal samples is the same as that
in tumor samples. The data is plotted on the Y-axis as the log 10
value of expression intensity/common reference (a universal human
RNA sample).
[0261] In the second set of experiments, RNA was isolated from a
series of 29 tumors (9 breast, 5 lung, 5 gastric, 5 kidney, and 5
colon cancer tumors) and 28 adjacent non-involved normal tissues.
mRNA expression was measured using microarrays and miR-210 levels
were determined using a quantitative primer-extension PCR assay as
described by Raymond et al. (2005). mRNA and miRNA expression
levels in tumor and adjacent normal tissues are expressed as ratios
to a pool of normal samples from each tissue type. Correlations
were calculated between the expression ratios in tumor tissues and
the expression ratios of miR-210 and transcripts up-regulated after
24 hours of hypoxia treatment in 21 tumor cell lines in tissue
culture. As a control, correlations were also calculated for
approximately 200 random permutations of expression ratios (random
transcripts).
[0262] In a third set of experiments, pri-miR-210 expression was
determined in a retrospective study of a group of 311 breast cancer
patients from the Netherlands Cancer Institute (NM). Pri-miR-210
transcript levels from each individual primary tumor were compared
to the median value determined for all tumors in the study, and the
patients were classified into two groups: group one with miR-210
expression levels higher than the median (up-regulated group), and
group two with miR-210 expression levels lower than the median
(down-regulated group). The probability of metastasis free survival
between the two groups was described by a Kaplan-Meier survival
curve and compared by the log-rank test. Similar analysis was
performed on 58 melanoma tumor samples collected from lymph node
metastasis, of which 35 developed distant metastases.
[0263] Results
[0264] As shown in FIGS. 4A-4C, pri-miR-210 is overexpressed in a
panel of human kidney, lung, and breast tumors. The differential
expression of pri-miR-210 between tumors and adjacent normal tissue
was significant for kidney (p-value=6.4e-34), lung
(p-value=4.3e-28) and breast (p-value=4.6e-20) cancers. However,
miR-210 was not upregulated in colon and gastric cancers relative
to normal tissue.
[0265] Further, as shown in FIG. 5, a significant positive
correlation exists between miR-210 levels and the transcripts
up-regulated by hypoxia in 29 human tumors comprising tumors from 9
breast cancer patients, 5 lung cancer patients, 5 gastric cancer
patients, 5 kidney cancer patients, and 5 colon cancer patients. A
total of 63 genes that were upregulated by hypoxia in tumor cell
lines in culture were positively correlated with miR-210 expression
ratios in tumor cells from the 29 individual tumors
(p-value=1.27e-13).
[0266] To determine if miR-210 levels had predictive power for
patient outcome, the level of pri-miR-210 in a set of previously
studied breast cancer samples from 331 NM patients was determined
(see van't Veer, L. J., et al., "Gene Expression Profiling Predicts
Clinical Outcome of Breast Cancer," Nature 415:530-536, 2002). As
shown in FIG. 6A, up-regulation of pri-miR-210 was found to
positively correlate with the metastatic potential (decreased
probability of metastasis-free survival) of this set of breast
cancer tumor samples. As shown in FIG. 6B, up-regulation of
pri-miR-210 was also found to positively correlate with a decreased
probability of metastasis-free survival in patients with melanoma
tumors. Stated another way, the expression of miR-210 showed a
significant inverse correlation with metastasis-free survival for
both breast and melanoma cancer.
[0267] In summary, this example provides data indicating the
miR-210 is a useful biomarker for hypoxia in certain types of
cancers, particularly breast, kidney, and lung tumors. Further, the
data presented in this example suggests that miR-210 may play a
role in tumor growth under hypoxic conditions. This example also
provides data showing the unexpected result that the level of
expression of miR-210 is useful as an independent predictor of the
probability of tumor cell metastasis, and therefore of cancer
prognosis and patient outcomes.
Example 4
[0268] This example shows that miR-210 overrides hypoxia induced
cell-cycle arrest, and also regulates the cell-cycle under
normoxia.
[0269] Methods
[0270] RNA Duplexes and Transfections. RNA duplexes corresponding
to mature miRNAs were designed as described (Lim et al., 2005).
miRNA duplexes were ordered from Sigma-Proligo (Boulder, Colo.).
miRCURY.TM. LNA Knockdown probes (anti-miRs) for miR-210
(#118103-00) and miR-185 (#138529-00) were obtained from Exiqon,
Copenhagen, Denmark. Cells were transfected as described in Example
2. mRNAs were transfected at 10 nM, and LNA modified anti-miRs were
transfected at 200 nM.
[0271] Cell cycle analysis. Cells were seeded in 6-well plates at a
density such that they would be 50-60% confluent on the day of
analysis. Twenty-four hours after transfection, cells were exposed
to hypoxia or normoxia for an additional 24 hours before
harvesting. The supernatant from each well was combined with cells
harvested from each well by trypsinization. Alternatively,
Nocodazole (100 ng/ml, Sigma-Aldrich) was added 30 hours after
transfection and cells were further incubated for 16 hours before
harvesting. Cells were collected by centrifugation at 1200 rpm for
5 minutes; fixed with ice cold 70% ethanol for about 30 minutes;
washed with PBS; and resuspended in 0.5 ml of PBS containing
Propidium Iodide (10 .mu.g/ml) and RNase A (1 mg/ml). After a final
incubation at 37.degree. C. for 30 minutes, cells were analyzed by
flow cytometry using a FACSCalibur flow cytometer (Becton
Dickinson). For BrdU-incorporation analysis, cells were pulsed with
BrdU (BD Bioscience) for 60 minutes before harvesting. Fixed cells
were stained with FITC-conjugated anti-BrdU antibody and the DNA
dye 7-amino-actinomycin D (7-AAD). Data were analyzed using FlowJo
software (Tree Star, Ashland, Oreg.).
[0272] Results
[0273] Hypoxia treatment has been shown to induce cell cycle arrest
at the G1-S transition (Goda, N., et al., "Hypoxia-Inducible Factor
1Alpha Is Essential for Cell Cycle Arrest During Hypoxia," Mol.
Cell. Biol. 23:359-369, 2003; Gordan, J. D., et al., "HIF-2Alpha
Promotes Hypoxic Cell Proliferation by Enhancing c-Myc
Transcriptional Activity," Cancer Cell 11:335-347, 2007a; Hammer,
S., et al., "Hypoxic Suppression of the Cell Cycle Gene CDC25A in
Tumor Cells," Cell Cycle 6:1919-1926, 2007). To determine if
miR-210 regulates cell cycle progression during hypoxia, HCT116
Dicer cells were transfected as described in Example 2 with
wild-type miR-210 duplexes and a seed region mutant of miR-210
(guide strand comprising SEQ ID NO:5). As shown in Table 6, miR-210
reduced the fraction of cells in G1 (from 60% to 21%) and increased
the number of cells in S phase (from 12.3% to 21.7%) under hypoxic
conditions in comparison to a mock transfection control. The G2/M
population also increased from 21.9% to 46.1%. In contrast, the
miR-210 seed region mutant did not affect the cell cycle profiles,
suggesting that the cell cycle effect of miR-210 was target
specific.
TABLE-US-00006 TABLE 6 Cell cycle progression after transfection
with miR-210 and miR-210 mt.* Cell-cycle phase Control miR-210
miR-210 mt Normoxia G1 (% cells) 45 19 50 S 23 20 14 G2/M 28 54 28
Hypoxia G1 60 21 54 S 12 22 11 G2/M 22 46 22 *HCT116 Dicer.sup.ex5
cells were transfected with either miR-210 duplexes, miR-210
containing mismatches at positions 5 and 6 in the seed region
(miR-210 mt) or mock transfected as control. 24 hours
post-transfection the cells were exposed to hypoxia (1% O.sub.2) or
normoxia (21% O.sub.2) for another 24 hours before analyzing cell
cycle distribution. The percentage of cells in G1, S or G2/M phase
are shown.
[0274] As shown in Table 7, the effect of miR-210 was dose
dependent and was observable at concentrations as low as 0.5 nM.
This data suggests that miR-210 reversed the hypoxia response by
overriding cell cycle arrest.
TABLE-US-00007 TABLE 7 Cell cycle progression after transfection
with different concentrations of miR-210.* miR-210 Cell-cycle
miR-210 miR-210 miR-210 miR-120 mt phase Control 0.1 nM 0.5 nM 1.0
nM 10 nM 10 nM Hypoxia G1 70 66 57 52 35 65 S 8 12 15 16 19 7 G2/M
18 19 24 28 40 24 *HCT116 Dicer.sup.ex5 cells were transfected with
increasing concentrations of miR-210 duplex (0.1, 0.5, 1.0, and
10.0 nM) or miR-210 seed region mutant (10.0 nM). 24 hours
post-transfection the cells were exposed to hypoxia (1% O.sub.2)
for another 48 hours before cell cycle analysis. The percentage of
cells in G1, S or G2/M phase are shown.
[0275] It was also observed that miR-210 accelerates the G1-S
transition under normoxia conditions. As shown in Table 6, the G1
peak is reduced from 45% to 19% and the G2/M peak increased from
28% to 54% compared to mock transfected control cells. Because HIFs
are de-stabilized and non-functional under normoxic conditions,
this data suggests that miR-210 may act independently of HIFs to
regulate cell cycle progression.
[0276] The role of endogenous miR-210 in cell cycle progression was
investigated by performing loss-of-function analysis using Locked
Nucleic Acid (LNA)-modified oligonucleotides that target miR-210
(anti-miR-210) to specifically inhibit miR-210 function.
786-O-pBABE cells were used because this cell line is defective in
pVHL function, which stabilizes HIF-.alpha. resulting in a
constitutively elevated level of miR-210 regardless of the oxygen
level. Previous results showed that the G0/G1 accumulation
phenotype was easier to measure when the microtubule depolymerizing
drug nocodazole was added after transfection to block cells from
reentering the cell cycle after mitosis (Linsley, P. S., et al.,
"Transcripts Targeted by the microRNA-16 Family Cooperatively
Regulate Cell Cycle Progression," Mol. Cell. Biol. 27:2240-2252,
2007). Therefore, cells were treated with nocodazole 30 hours after
transfection and the cell-cycle distribution was analyzed 16 hours
after nocodazole treatment. Nearly all (greater than 90%) of the
cells mock transfected or transfected with a control anti-miR-185
LNA oligonucleotide (that is not known to cause a cell cycle
phenotype) accumulated in G2/M phase (4N DNA content) after
nocodazole treatment. On the other hand, approximately 23% of
anti-miR-210 transfected cells remained in G0/G1 (data not shown),
indicating that miR-210 functions as a positive regulator of the
G1-S transition.
[0277] In summary, this example demonstrates the unexpected result
that miR-210 overexpression in tumor cells was able to override
hypoxia-induced cell-cycle arrest. Further, because miR-210
overexpression also accelerates the cell cycle under normoxia
conditions, the data in this example suggest that miR-210 may act
independently of HIFs to regulate the cell cycle. This example also
suggests that inhibiting miR-210 expression prevents cells from
progressing through the cell cycle under hypoxic conditions, and
that inhibitors of miR-210 may have therapeutic benefits.
Example 5
[0278] This example shows that miR-210 reverses the gene expression
pattern induced by hypoxia.
[0279] Methods
[0280] HCT116 Dicer.sup.ex5 cells were transfected with miR-210
duplexes or HIF-1.alpha. siRNA for 24 hours as described in Example
2, then exposed to hypoxia for 24 hours. ME180 cells were
transfected using DharmaFect (Dharmacon, Lafayette, Colo.).
Microarray analysis was performed as described in Example 1.
[0281] Results
[0282] To understand the mechanism of miR-210 function under both
hypoxic and normoxic conditions, microarray analysis was used to
examine gene expression in cells transfected with miR-210 duplexes
(gain-of-function experiments). Table 8 shows that transcripts
up-regulated by miR-210 under hypoxic conditions overlapped
significantly with transcripts down-regulated by hypoxia in HCT116
Dicer.sup.ex5 cells (p-value=6.3E-12). In contrast, there was no
significant overlap between miR-210 up-regulated transcripts and
those up-regulated by hypoxia. Similarly, transcripts
down-regulated by miR-210 overlapped significantly with transcripts
up-regulated by hypoxia (p-value=8.1E-13), whereas there was no
significant overlap between miR-210 down-regulated transcripts and
transcripts down-regulated by hypoxia.
TABLE-US-00008 TABLE 8 Overlap of miR-210 and hypoxia gene
expression profiles.* Signature Gene Genes up-regulated Genes
down-regulated Sets Compared by miR-210 by miR-210 Genes up-
P-value: 1.0 P-value: 8.1e-13 regulated miR-210: 2414 genes
miR-210: 1178 genes by hypoxia hypoxia: 3673 genes hypoxia: 3281
genes overlap: 151 genes overlap: 543 genes Genes down- P-value:
6.3e-12 P-value: 1.0 regulated miR-210: 936 genes miR-210: 1345
gene by hypoxia hypoxia: 4149 genes hypoxia: 5402 genes overlap:
1629 genes overlap: 376 genes *HCT116 Dicer.sup.ex5 cells were
exposed to hypoxia for 24 hours or transfected with miR-210
duplexes 24 hours prior to hypoxia treatment for an additional 24
hours. RNA was isolated and microarray analysis performed to
identify signature genes (P < 0.01).
[0283] Further, gene expression patterns observed when miR-210 is
overexpressed are similar to those observed when HIF-1.alpha. is
inhibited by siRNA. For example, as shown in Table 9, the signature
gene set up-regulated by miR-210 under hypoxia significantly
overlaps the gene set up-regulated by HIF-1.alpha. siRNA under
hypoxia, and both the up-regulated miR-210 and HIF-1.alpha. siRNA
gene sets significantly overlap the gene set down-regulated by
hypoxia. Likewise, the signature gene set down-regulated by miR-210
under hypoxia significantly overlaps the gene set down-regulated by
HIF-1.alpha. siRNA under hypoxia, and both the down-regulated
miR-210 and HIF-1.alpha. siRNA gene sets significantly overlap the
gene set up-regulated by hypoxia (Table 9). Taken together, these
results indicate that miR-210 negatively regulates a subset of the
hypoxia gene expression response, and that the set of genes
regulated by miR-210 significantly overlaps the set of genes
regulated by siRNA that targets HIF-1.alpha..
TABLE-US-00009 TABLE 9 Overlap of gene expression profiles of cells
treated with hypoxia, miR-210 and HIF-1.alpha. siRNA.* Signature
gene Hypoxia Hypoxia sets compared up-regulated down-regulated
miR-210 P-value = 1.0 P-value = 8.14e-13 up-regulated miR-210
P-value = 6.25e-12 P-value = 1.0 down-regulated HIF-1a siRNA
P-value = 1.0 P-value = 4.84e-11 up-regulated HIF-1a siRNA P-value
= 4.33e-11 P-value = 0.66 down-regulated *HCT116 Dicer.sup.ex5
cells were exposed to hypoxia for 24 hours or they were transfected
with miR-210 duplexes or HIF-1.alpha. siRNA 24 hours prior to
hypoxia treatment for an additional 24 hours. RNA was isolated and
microarray analysis performed to identify signature genes (P <
0.01). The p values were calculated using the Log10 Wilcoxon
signed-rank test, and show the probability that the indicated gene
sets overlap by chance.
[0284] To determine if inhibiting endogenous miR-210 function would
affect gene expression profiles, ME-180 cells were transfected with
miR-210 or anti-miR-210 duplexes as described in Example 2. The
cells were transfected with siRNA targeting luciferase as a
control. Twenty-four hours after transfection, the cells were
exposed to hypoxia for another 24 hours before harvesting RNA for
microarray analysis. Consensus genes that were down-regulated by
miR-210 under hypoxic conditions (see Table 10) were up-regulated
by treatment of cells with anti-miR-210. The up-regulation of
target genes by anti-miR-210 was statistically significant when
compared to control cells treated with siRNA to luciferase
(p-value=1.44E-04).
[0285] In summary, the data presented in this example shows that
miR-210 negatively regulates genes that are up-regulated by hypoxia
and that inhibiting miR-210 reverses the negative regulation of
genes by miR-210 under hypoxic conditions. Further, miR-210 may act
independently of HIF-1.alpha., because the set of genes
down-regulated by miR-210 overlaps the set of genes down-regulated
when HIF-1.alpha. is inhibited by siRNA under hypoxic
conditions.
Example 6
[0286] This example shows that silencing Mnt with siRNA phenocopies
miR-210 overexpression.
[0287] Methods
[0288] miR-210 consensus down-regulated transcripts. HCT116
Dicer.sup.ex5 cells, RKO Dicer.sup.ex5, and DLD-1 Dicerex5 cells
were transfected with miR-210 duplexes, and gene expression
signatures were determined at 24 hours. The intersection signature
(p<0.01) between any two of the cell lines was identified.
Transcripts in the intersection signature that were also regulated
(p<0.05) at 6 hours in HCT116 Dicer.sup.ex5 cells were defined
as miR-210 consensus down-regulated transcripts.
[0289] SiRNAs were transfected into HCT116 Dicer.sup.ex5 cells as
described in Example 2. The siRNAs targeting Mnt comprise the guide
strands of SEQ ID NOs:15-17. Twenty-four hours after transfection,
the cells were exposed to hypoxia or normoxia for 48 hours before
harvesting RNA for cell cycle analysis. Cell cycle analysis was
performed as described in Example 4.
[0290] Immunoblotting was performed as described (Jackson, A. L.,
et al., "Widespread siRNA `Off-Target` Transcript Silencing
Mediated by Seed Region Sequence
[0291] Complementarity," RNA 12:1179-1187, 2006). Anti-Mnt
monoclonal antibody (AB53487) was purchased from Abcam (Cambridge,
Mass.). HCT116 Dicer.sup.ex5 cells were transfected with Luciferase
control siRNA, miR-210 or Mnt siRNA. Twenty-four hours after
transfection, the cells were exposed to hypoxia or normoxia for
another 24 hours before analysis of Mnt protein expression by
western blot analysis. Protein expression was normalized to Actin
for each treatment. Anti-Mnt monoclonal antibody (AB53487) was
purchased from Abcam (Cambridge, Mass.).
[0292] Results
[0293] As shown in Table 10, the gene expression analysis described
in Example 5 identified 31 transcripts that were downregulated by
miR-210 overexpression 6 hours after transfection. These
transcripts also contain miR-210 complementary hexamers in their
3'-UTR regions and are therefore likely to represent direct targets
of miR-210.
TABLE-US-00010 TABLE 10 miR-210 consensus down-regulated
transcripts.sup.a Entrez GeneID Mean Mean p-value (Locus Accession
Gene expression fold for expression Link) Number Symbol change at
24 hr change at 24 hr 103 NM_015840 ADAR -1.457 4.74E-04 9334
NM_004776 B4GALT5 -1.446 8.36E-04 1944 NM_004952 EFNA3 -1.874
3.50E-06 79071 NM_024090 ELOVL6 -2.610 2.20E-16 10447 NM_014888
FAM3C -1.973 4.44E-10 79443 NM_024513 FYCO1 -1.884 2.79E-08 26035
AB020643 GLCE -3.265 2.24E-09 9759 NM_006037 HDAC4 -2.267 1.44E-15
3638 NM_005542 INSIG1 -1.518 8.10E-05 23479 NM_014301 ISCU -2.631
2.05E-14 3726 NM_002229 JUNB -1.136 3.08E-01 51603 NM_015935
KIAA0859 -1.931 1.07E-08 3927 NM_006148 LASP1 -2.059 2.24E-11 10186
NM_005780 LHFP -2.179 2.92E-08 9477 NM_004275 MED20 -1.922 2.00E-06
23295 AB011116 MGRN1 -3.347 1.29E-22 58526 NM_021242 MID1IP1 -1.712
1.00E-05 4335 NM_020310 MNT -1.363 1.38E-02 7994 NM_006766 MYST3
-1.692 4.45E-05 11051 NM_007006 NUDT21 -2.215 5.47E-21 54776
NM_017607 PPP1R12C -1.675 6.19E-04 11099 NM_007039 PTPN21 -1.378
1.54E-02 6388 NM_006923 SDF2 -2.280 3.32E-11 83959 NM_032034
SLC4A11 -1.492 9.58E-03 200734 NM_181784 SPRED2 -1.856 9.00E-06
6845 NM_005638 SYBL1 -3.749 7.47E-28 54386 NM_018975 TERF2IP -2.516
8.75E-13 23534 NM_012470 TNPO3 -2.425 2.80E-10 84969 NM_032883 TOX2
-1.735 5.10E-05 58485 NM_021210 TRAPPC1 -2.447 8.29E-16 84878
NM_032792 ZBTB45 -1.789 1.69E-04 .sup.aA consensus set of genes
that were significantly down-regulated by miR-210 in multiple cell
lines. HCT116 Dicer.sup.ex5 cells, RKO Dicer.sup.ex5 cells and
DLD-1 Dicer.sup.ex5 cells were transfected with miR-210 duplexes,
and gene expression signatures were determined at 24 hrs. The
intersection signature (p < 0.01) between any two of the cell
lines was identified. Transcripts in the intersection signature
that were also regulated (p < 0.05) at 6 hrs in HCT116 Dicerex5
cells were defined as miR-210 consensus down-regulated transcripts.
The 3'UTR of these transcripts also contained sequences matching
the miR210 seed region. The mean expression fold change of each
gene at 24 hr and the corresponding p-value in response to miR-210
duplex transfection in the 3 cell lines are listed in the last two
columns.
[0294] Specific pools of siRNAs (three siRNAs targeting the same
gene) for each of the targets in Table 10 were transfected into
HCT116 Dicer.sup.ex5 cells and analyzed for their effects on cell
cycle progression under hypoxic conditions. Mnt, a basic
helix-loop-helix transcription factor (Hurlin, P. J., et al., "Mnt,
A Novel Max-Interacting Protein Is Coexpressed With Myc in
Proliferating Cells and Mediates Repression at Myc Binding Sites,"
Genes Dev. 11:44-58, 1997; Hurlin, P. J., et al., "Deletion of Mnt
Leads to Disrupted Cell Cycle Control and Tumorigenesis," Embo. J.
22:4584-4596, 2003), was the most prominent target whose silencing
phenocopied miR-210 gain-of-function. As shown in Table 11, cells
treated with miR-210 or Mnt siRNA showed a decrease in cells in G1
and an increase in cells in S phase compared to cells transfected
with a control Luc siRNA.
TABLE-US-00011 TABLE 11 Cell Cycle Progression After Transfection
With miR-210 and Mnt siRNA.* Cell-cycle phase Luc siRNA miR-210 Mnt
siRNA Normoxia G1 (%) 68 40 44 S (%) 11 14 21 G2/M (%) 17 36 22
Hypoxia G1 (%) 80 46 53 S (%) 5 13 16 G2/M (%) 11 29 16 *HCT116
Dicer.sup.ex5 cells were transfected with Luciferase control siRNA,
miR-210 duplexes, or Mnt siRNA. 24 hours post-transfection the
cells were exposed to hypoxia (1% O.sub.2) or normoxia (21%
O.sub.2) for another 48 hours before analyzing cell cycle
distribution. The percentage of cells in G1, S, or G2/M phase is
shown.
[0295] The cell cycle effect under hypoxia was observed with
multiple siRNAs against Mnt (SEQ ID NOs:15-17). The use of multiple
siRNAs that target the same mRNA tends to exclude off-target
effects of individual siRNA molecules (Jackson, A. L., et al.,
"Expression Profiling Reveals Off-Target Gene Regulation by RNAi,"
Nat. Biotechnol. 21:635-637, 2003).
[0296] Consistent with miR-210 directly targeting Mnt, the 3'UTR of
Mnt mRNA contains four potential consensus sites matching the
miR-210 seed region. Further, miR-210 overexpression reduced Mnt
protein levels under both normoxic (by 33%) and hypoxic (by 41%)
conditions (data not shown). Hypoxia elevated the Mnt protein level
by 76% in Luciferase siRNA control transfected cells.
[0297] The effect Mnt silencing had on gene expression was compared
to miR-210 overexpression. As shown in Tables 12 and 13, there was
significant positive overlap between the signature genes of miR-210
and Mnt siRNA in HFF-pBABE cells under both normoxic (Table 12) and
hypoxic (Table 13) conditions.
TABLE-US-00012 TABLE 12 Overlap of miR-210 and Mnt siRNA gene
expression profiles under normoxia.* Signature Gene Genes
up-regulated Genes down-regulated Sets Compared by miR-210 by
miR-210 Genes up- P-value: 1.7e-11 P-value: 1.0 regulated miR-210:
711 genes miR-210: 1200 genes by Mnt siRNA Mnt siRNA: 1367 genes
Mnt siRNA: 860 genes overlap: 536 genes overlap: 47 genes Genes
down- P-value: 1.0 P-value: 1.4e-12 regulated miR-210: 789 genes
miR-210: 575 gene by Mnt siRNA Mnt siRNA: 1832 genes Mnt siRNA: 622
genes overlap: 71 genes overlap: 285 genes *HFF-pBABE cells were
transfected with miR-210 or Mnt siRNA for 48 hours under normoxic
conditions, and microarray analysis was performed to identify
signature genes (P < 0.01).
TABLE-US-00013 TABLE 13 Overlap of miR-210 and Mnt siRNA gene
expression profiles under hypoxia.* Signature Gene Genes
up-regulated Genes down-regulated Sets Compared by miR-210 by
miR-210 Genes up- P-value: 0e00 P-value: 1.0e00 regulated miR-210:
621 genes miR-210: 864 genes by Mnt siRNA Mnt siRNA: 859 genes Mnt
siRNA: 1083 genes overlap: 300 genes overlap: 57 genes Genes down-
P-value: 1.0e00 P-value: 0e00 regulated miR-210: 1279 genes
miR-210: 951 gene by Mnt siRNA Mnt siRNA: 1091 genes Mnt siRNA: 744
genes overlap: 68 genes overlap: 396 genes *HFF-pBABE cells were
transfected with miR-210 or Mnt siRNA for 48 hours under hypoxic
conditions, and microarray analysis was performed to identify
signature genes (P < 0.01).
[0298] In summary, the data presented in this example shows that
Mnt is down-regulated by miR-210. This example also shows that
inhibiting Mnt expression with siRNA produces similar effects on
the cell cycle as overexpression of miR-210. Further, the data in
this example shows that the set of genes regulated by miR-210 and
Mnt siRNA show significant overlap under normoxia and hypoxia.
Example 7
[0299] This example shows that miR-210 regulates the cell cycle
through c-Myc.
[0300] Methods
[0301] HCT116 Dicer.sup.ex5 cells and human foreskin fibroblasts
(HFFs) were transfected with miRNA and siRNA duplexes as described
in Example 2. Cell cycle analysis was performed as described in
Example 4. For co-transfection experiments, 50 nM (final
concentration) of Luciferase control siRNA or Myc siRNA was
combined with 10 nM (final concentration) of Luciferase siRNA,
miR-210 (SEQ ID NO:1) or miR-210 seed region mutant (miR-210 mt;
SEQ ID NO:5). The siRNAs targeting Myc comprise the guide strands
of SEQ ID NOs:18-20. Microarray analysis was performed as described
in Example 1. HFF-pBABE (empty vector) and HFF-c-Myc cells were
described previously (Benanti, J. A., et al., "Epigenetic
Down-Regulation of ARF Expression Is a Selection Step in
Immortalization of Human Fibroblasts by c-Myc," Mol. Cancer. Res.
5:1181-1189, 2007). The level of c-Myc protein expressed by the
HFF-c-Myc cells was measured by Western Blot as described in
Benanti et al. ("Epigenetic Down-Regulation of ARF Expression Is a
Selection Step in Immortalization of Human Fibroblasts by c-Myc,"
Mol. Cancer. Res. 5:1181-1189, 2007).
[0302] For the synthetic lethal experiments, HFF-pBABE or HFF-c-Myc
cells were mock transfected or transfected with Luciferase control
siRNA, miR-210 duplexes, Mnt siRNA, or KIF11 siRNA, as described in
Example 2. Images were captured 4 days post-transfection, and the
number of live and dead cells, as determined by visual inspection
of the images, was counted. Data are presented as the average value
from triplicate experiments with standard deviation error bars.
[0303] Results
[0304] The previous example showed that miR-210 inhibits Mnt
expression. Mnt is a Max-interacting transcriptional repressor that
functions as a c-Myc antagonist (Hurlin, P. J., et al., "Deletion
of Mnt Leads to Disrupted Cell Cycle Control and Tumorigenesis,"
Embo. J. 22:4584-4596, 2003; Walker, W., et al., "Mnt-Max to
Myc-Max Complex Switching Regulates Cell Cycle Entry," J. Cell
Biol. 169:405-413, 2005). Therefore, miR-210 could regulate cell
cycle progression by indirect activation of c-Myc. As shown in
Table 14, knockdown of c-Myc with siRNA in HCT116 Dicer.sup.ex5
cells impaired the ability of miR-210 to override hypoxia induced
G1-S arrest, while a Luc control siRNA had no obvious effect on
miR-210 phenotype. The maximal silencing efficiency of c-Myc siRNA
was only about 50% (data not shown), and the incomplete knockdown
of c-Myc could explain the residual effect of miR-210 on hypoxia
induced G1-S arrest in the c-Myc silenced cells. Similarly, under
normoxia conditions, c-Myc siRNA but not control Luc siRNA
compromised miR-210's ability to drive cells into S phase (Table
14). Collectively, these data illustrate that the effect on cell
cycle induced by miR-210 is largely dependent on c-Myc.
TABLE-US-00014 TABLE 14 The effect of miR-210 and c-Myc on the cell
cycle.* Percentage of cells in S-phase Co- Transfected siRNA
transfected Luc siRNA + c-Myc siRNA + duplex miR- miR-210 Luc miR-
miR-210 RNA None 210 mt siRNA 210 mt Normoxia 14.6% 27.2% 14.4%
8.78% 12.3% 7.22% Hypoxia 5.73% 23.2% 6.29% 4.86% 9.93% 5.16%
*miR-210 and c-Myc siRNA duplexes were transfected into HCT116
Dicer.sup.ex5 cells. Luc siRNA and miR-210 seed region mutant
(miR-210 mt) were used as controls. BrdU incorporation was
determined using flow cytometry 48 hours after hypoxia. Percentage
of cells in S-phase is shown.
[0305] Primary human foreskin fibroblasts (HFFs) were used to
determine the effect of miR-210 gain-of-function,
c-Myc-overexpression, and Mnt loss-of-function on gene expression
profiles. HFFs allow c-Myc overexpression without triggering a
senescent response (Benanti, J. A., et al., "Epigenetic
Down-Regulation of ARF Expression Is a Selection Step in
Immortalization of Human Fibroblasts by c-Myc," Mol. Cancer. Res.
5:1181-1189, 2007). In response to c-Myc, HFFs exhibit many of the
growth phenotypes that characterize c-Myc function, such as
increased rRNA and DNA synthesis (Dominguez-Sola, D., et al.,
"Non-Transcriptional Control of DNA Replication by c-Myc," Nature
448:445-451, 2007; Grandori, C., et al., "c-Myc Binds to Human
Ribosomal DNA and Stimulates Transcription of rRNA Genes by RNA
Polymerase I," Nat. Cell Biol. 7:311-318, 2005). A Myc
overexpression signature was first generated by comparing three
independent sets of HFFs with and without c-Myc constitutively
expressed from a retroviral vector, pBabe. A total of 1063 genes
were up regulated and 981 down-regulated in all three matched pair
of cells (data not shown). As shown in Table 15, miR-210 induced
22% of the genes up-regulated by c-Myc (353 out of 1550 genes). The
probability of observing this level of overlap by chance is less
than 3.5.times.10E-11. Similarly, the genes down-regulated by c-Myc
overexpression and miR-210 overexpression also overlapped
significantly (p-value=4.0.times.10E-12).
TABLE-US-00015 TABLE 15 Overlap of miR-210 and c-Myc gene
expression profiles under normoxia.* Signature Gene Genes
up-regulated Genes down-regulated Sets Compared by miR-210 by
miR-210 Genes up- P-value: 3.5e-11 P-value: 1.0e00 regulated
miR-210: 710 genes miR-210: 926 genes by c-Myc c-Myc: 1550 genes
c-Myc: 870 genes overlap: 353 genes overlap: 37 genes Genes down-
P-value: 1.0e00 P-value: 4.0e-12 regulated miR-210: 867 genes
miR-210: 704 genes by c-Myc c-Myc: 1789 genes c-Myc: 630 genes
overlap: 114 genes overlap: 277 genes *HFF-pBABE cells were
transfected with miR-210 duplexes or pBABE-c-Myc retroviral vector
for 48 hours under normoxic conditions, and microarray analysis was
performed to identify signature genes (P < 0.01). c-Myc
signature genes were determined by comparing the gene expression
profiles of HFF-pBABE and HFF-pBABE-c-Myc cells.
[0306] 2D clustering was used to compare the gene expression
profiles of miR-210 overexpression, c-Myc overexpression, and Mnt
knockdown in HFF cells. Myc siRNA was used as a positive control
for the Myc signature and Luc siRNA was used as a negative control.
Two hundred eighty-four (284) genes were either significantly
up-regulated or down-regulated (P<0.01). The 284 gene set
contained three clusters. Cluster 1 contained genes down-regulated
by Myc overexpression but up-regulated by miR-210 overexpression
and Mnt siRNA knockdown. Cluster 2 includes genes that were
up-regulated by c-Myc overexpression, miR-210 overexpression, and
Mnt siRNA knockdown. Cluster 3 includes genes that were
down-regulated by Myc overexpression, miR-210 overexpression, and
Mnt siRNA knockdown.
[0307] Functional annotation of the genes in each cluster revealed
that cluster 1 was highly enriched in genes potentially involved in
metastasis and angiogenesis. The majority of genes in cluster 2
(upregulated by Myc, miR-210 and Mnt siRNA) functioned in Pol I,
II, and III transcription, or rRNA processing and metabolism,
consistent with the Myc effect on cell growth. A smaller fraction
of the genes are involved in DNA damage, mitochondrial function and
apoptosis, consistent with the known effects of Myc on DNA
replication and sensitization to apoptotic stimuli. Many genes in
cluster 3 (downregulated by Myc, miR-210 and Mnt siRNA) are
involved in cytoskeletal dynamics and extracellular matrix,
including Thrombospondin, which is known to be inhibited by Myc and
whose down-regulation promotes angiogenesis.
[0308] Excessive levels of c-Myc have been shown to enhance cell
death under certain conditions (Evan, G. I., et al., "Induction of
Apoptosis in Fibroblasts by c-Myc Protein," Cell 69:119-128, 1992;
Nilsson, J. A., and J. L. Cleveland, "Myc Pathways Provoking Cell
Suicide and Cancer," Oncogene 22:9007-9021, 2003). Therefore,
HFF-Myc cells were transfected with microRNAs to determine if any
microRNAs enhanced cell death in cells overexpressing c-Myc.
miR-210 was identified as a microRNA that increased cell death in
HFF-Myc cells. As shown in FIG. 7, transfection of HFF-Myc cells
with miR-210 under normoxia conditions decreased the number of live
cells (FIG. 7A) and increased the percentage of dead cells (FIG.
7C) compared to mock transfected controls. The increase in cell
death was not observed in HFF-pBABE (empty vector control) cells
(FIGS. 7B, 7D). Silencing of Mnt with siRNA also decreased the
number of live cells and increased the percentage of dead cells
compared to Luc siRNA transfected control cells (FIGS. 7A, 7C).
KIF11 siRNA was used as a positive control for transfection
efficiency as a reduction in KIF11 levels causes mitotic arrest
(Weil et al., Biotechniques 33:1244-1248, 2002). Thus, both
overexpression of miR-210 and inhibition of Mnt increased cell
death in cells that overexpress c-Myc. While not wishing to be
bound by theory, FIG. 8 shows a model of how the hypoxia, miR-210,
and c-Myc genetic pathways may interact.
[0309] In summary, the data presented in this example show that the
genes regulated by miR-210, c-Myc, and Mnt overlap. An important
and unexpected finding of the present invention is that miR-210
induces cell death in cells that overexpress c-Myc. Further,
inhibition of Mnt also increased cell death in cells that
overexpressed c-Myc, indicating that miR-210 may be a negative
regulator of Mnt. These findings are useful for treatment of tumor
cells that overexpress c-Myc.
[0310] While the preferred embodiment of the invention has been
illustrated and described, it will be appreciated that various
changes can be made therein without departing from the spirit and
scope of the invention.
Sequence CWU 1
1
36121RNAHomo sapiens 1cugugcgugu gacagcggcu g 2121965DNAHomo
sapiens 2gagagggtgc cagcggccgc agctgaagtt gggccgagag ccggcgacgg
ccccgcgccg 60gggtcgcagg cctgcaggag ttgagggctg cacctgctcg ctggagaggg
agaggcagat 120ttagtggacg cctggcatgg actcggactg gcctttggaa
gctccctgcc ctgacggggt 180tgcctgtcac cactgcgaag tgaggcttgg
caggacctgc acctgagaaa ggccgtgtgt 240ggtcttgggg tccacacctg
cagagctaac ttactgccag acggcgactt actgtgggcc 300accctcagtg
aaccggggtg tcctcagctg gccctacaga gcacttctgt gctggggatg
360agtaggaatt ctgggcgagg agggtcccag cgccgcccct cgatacagcc
tggctctgcc 420ctctgcccgt acttatacca ggtgggatcc ctgccctgca
ttgcctgggg attggctggg 480cttgggcccg ccctgctgtg gaactggatg
ttttcaggga gcccagcctt tcctcatgtc 540aacacagttc acaatatagt
tttcaaagta cagtttaaaa ctcaaaagta aacttttcag 600caactcaaag
gtttgctgag tgatctgaag cactctggcc actttttggg gccatgggat
660ttggttcacc tgaaacagcc agtgagaggc cgggtgtggt ggctcacacc
cgtaatccca 720acacttcagg aggcagacgc gggtgatcgc tcacttgaga
tcaggagttc aagaccagcc 780tgggcaacat ggtgaaacct cgtctctact
aaaaatacaa aaattagcta ggcatggtgg 840tgggcacctg taatcccagc
tacttggaag gctgaggcaa gagaatcgct tgaacctggg 900aggtggaggt
tgcagcgaga cgagattacg ccgctgcact ccagcctggg tgacgagaga
960ctctgcctca aaaaaataaa aaaatgaaac agccagtgag gaggaaggct
ccccgccttc 1020cccccgccgg aacatagcca tagctgctgc tgggacaccc
tcttggtggg gaagaagact 1080ggttagcttc atcagagcca gcagcagcag
accagggacg ggcacctagg cagtggcctc 1140agagtgaaca ggagttcctc
agaaacacac acagggacgg cgtggcgcat gctctgccag 1200ctccatgcct
ccttcccatt gtggggctgg gctacgtagg gcagagctca tgacctccgg
1260gaggacatgg gggtgggctc tggatggcac ctggcattgc cccctgctgg
cctatgtgac 1320ggtgtggagg gctggtcaca gaggtacgac catcccttca
gaatgtgggt cggggctgtg 1380gatggaggag taggcccctc atatcccagg
cctgctgccc aggcacaacc cacttggcct 1440atgcattcca ggctccatcc
catgtgactc tgggcttagc cccttctggg gccacaggtc 1500aggcaggtcc
aggccccaag gacctcccag tgacaggcga ctgtgagctg ggcagacagg
1560agtgaagtca ggtgggggtt ctggcttgct gacaccagcg tttggagcct
cctgctgctg 1620cctggcttcc ctgcattccc tgttccctgc ctcaggcaag
aaataaccaa gccgagttgc 1680ctctgcacag cagtgagctc ctggtggccc
tggcttctgg ggagccctgt ggatggcttc 1740cttgcccaag tcaaggcctt
cttgttccct ttgtgtgctc cagagaaagg gggcagcacc 1800agatccagat
ccagggccaa ccaacagaaa gctgagtcca tcccaaactc gcccattctc
1860agagcacaaa gaccccatga tctagggcaa acttgtccaa ctgttggccc
atggaacagc 1920tttgaatgca gcccaacaca aatctataaa ttttcttaaa cattg
19653110RNAHomo sapiens 3acccggcagu gccuccaggc gcagggcagc
cccugcccac cgcacacugc gcugccccag 60acccacugug cgugugacag cggcugaucu
gugccugggc agcgcgaccc 110412RNAHomo sapiens 4cugugcgugu ga
12521RNAArtificial SequenceSynthetic 5cugucggugu gacagcggcu g
21621RNAArtificial SequenceSynthetic 6guccuuaaac cgguugaaun n
21721RNAArtificial SequenceSynthetic 7gcaacuugag gaaguaccan n
21821RNAArtificial SequenceSynthetic 8ccuaauaguc ccagugaaun n
21921RNAArtificial SequenceSynthetic 9ggcucaagga gaucguuuan n
211021RNAArtificial SequenceSynthetic 10gaauggacuu ggcucuguan n
211121RNAArtificial SequenceSynthetic 11gccacagucu gaaugguuun n
211221RNAArtificial SequenceSynthetic 12cgggccaggu gaaagucuan n
211321RNAArtificial SequenceSynthetic 13gcgacagcug gaguaugaan n
211421RNAArtificial SequenceSynthetic 14gcuucagugc caugacaaan n
211521DNAArtificial SequenceSynthetic 15cguccaaucu gagcgugcut t
211621DNAArtificial SequenceSynthetic 16gcuggcacgu gagaagauut t
211721DNAArtificial SequenceSynthetic 17gguacaucca gucccugaat t
211821DNAArtificial SequenceSynthetic 18gcuuguaccu gcaggaucut t
211921DNAArtificial SequenceSynthetic 19cgauguuguu ucuguggaat t
212021DNAArtificial SequenceSynthetic 20cgagaacagu ugaaacacat t
212120DNAArtificial SequenceSynthetic 21aggagccttg acggtttgac
202219DNAArtificial SequenceSynthetic 22gaggaccagg gtgacagtg
19232377DNAHomo sapiensCDS(525)..(1889) 23acccccgagc tgtgctgctc
gcggccgcca ccgccgggcc ccggccgtcc ctggctcccc 60tcctgcctcg agaagggcag
ggcttctcag aggcttggcg ggaaaaagaa cggagggagg 120gatcgcgctg
agtataaaag ccggttttcg gggctttatc taactcgctg tagtaattcc
180agcgagaggc agagggagcg agcgggcggc cggctagggt ggaagagccg
ggcgagcaga 240gctgcgctgc gggcgtcctg ggaagggaga tccggagcga
atagggggct tcgcctctgg 300cccagccctc ccgctgatcc cccagccagc
ggtccgcaac ccttgccgca tccacgaaac 360tttgcccata gcagcgggcg
ggcactttgc actggaactt acaacacccg agcaaggacg 420cgactctccc
gacgcgggga ggctattctg cccatttggg gacacttccc cgccgctgcc
480aggacccgct tctctgaaag gctctccttg cagctgctta gacg ctg gat ttt ttt
536 Leu Asp Phe Phe 1cgg gta gtg gaa aac cag cag cct ccc gcg acg
atg ccc ctc aac gtt 584Arg Val Val Glu Asn Gln Gln Pro Pro Ala Thr
Met Pro Leu Asn Val5 10 15 20agc ttc acc aac agg aac tat gac ctc
gac tac gac tcg gtg cag ccg 632Ser Phe Thr Asn Arg Asn Tyr Asp Leu
Asp Tyr Asp Ser Val Gln Pro 25 30 35tat ttc tac tgc gac gag gag gag
aac ttc tac cag cag cag cag cag 680Tyr Phe Tyr Cys Asp Glu Glu Glu
Asn Phe Tyr Gln Gln Gln Gln Gln 40 45 50agc gag ctg cag ccc ccg gcg
ccc agc gag gat atc tgg aag aaa ttc 728Ser Glu Leu Gln Pro Pro Ala
Pro Ser Glu Asp Ile Trp Lys Lys Phe 55 60 65gag ctg ctg ccc acc ccg
ccc ctg tcc cct agc cgc cgc tcc ggg ctc 776Glu Leu Leu Pro Thr Pro
Pro Leu Ser Pro Ser Arg Arg Ser Gly Leu 70 75 80tgc tcg ccc tcc tac
gtt gcg gtc aca ccc ttc tcc ctt cgg gga gac 824Cys Ser Pro Ser Tyr
Val Ala Val Thr Pro Phe Ser Leu Arg Gly Asp85 90 95 100aac gac ggc
ggt ggc ggg agc ttc tcc acg gcc gac cag ctg gag atg 872Asn Asp Gly
Gly Gly Gly Ser Phe Ser Thr Ala Asp Gln Leu Glu Met 105 110 115gtg
acc gag ctg ctg gga gga gac atg gtg aac cag agt ttc atc tgc 920Val
Thr Glu Leu Leu Gly Gly Asp Met Val Asn Gln Ser Phe Ile Cys 120 125
130gac ccg gac gac gag acc ttc atc aaa aac atc atc atc cag gac tgt
968Asp Pro Asp Asp Glu Thr Phe Ile Lys Asn Ile Ile Ile Gln Asp Cys
135 140 145atg tgg agc ggc ttc tcg gcc gcc gcc aag ctc gtc tca gag
aag ctg 1016Met Trp Ser Gly Phe Ser Ala Ala Ala Lys Leu Val Ser Glu
Lys Leu 150 155 160gcc tcc tac cag gct gcg cgc aaa gac agc ggc agc
ccg aac ccc gcc 1064Ala Ser Tyr Gln Ala Ala Arg Lys Asp Ser Gly Ser
Pro Asn Pro Ala165 170 175 180cgc ggc cac agc gtc tgc tcc acc tcc
agc ttg tac ctg cag gat ctg 1112Arg Gly His Ser Val Cys Ser Thr Ser
Ser Leu Tyr Leu Gln Asp Leu 185 190 195agc gcc gcc gcc tca gag tgc
atc gac ccc tcg gtg gtc ttc ccc tac 1160Ser Ala Ala Ala Ser Glu Cys
Ile Asp Pro Ser Val Val Phe Pro Tyr 200 205 210cct ctc aac gac agc
agc tcg ccc aag tcc tgc gcc tcg caa gac tcc 1208Pro Leu Asn Asp Ser
Ser Ser Pro Lys Ser Cys Ala Ser Gln Asp Ser 215 220 225agc gcc ttc
tct ccg tcc tcg gat tct ctg ctc tcc tcg acg gag tcc 1256Ser Ala Phe
Ser Pro Ser Ser Asp Ser Leu Leu Ser Ser Thr Glu Ser 230 235 240tcc
ccg cag ggc agc ccc gag ccc ctg gtg ctc cat gag gag aca ccg 1304Ser
Pro Gln Gly Ser Pro Glu Pro Leu Val Leu His Glu Glu Thr Pro245 250
255 260ccc acc acc agc agc gac tct gag gag gaa caa gaa gat gag gaa
gaa 1352Pro Thr Thr Ser Ser Asp Ser Glu Glu Glu Gln Glu Asp Glu Glu
Glu 265 270 275atc gat gtt gtt tct gtg gaa aag agg cag gct cct ggc
aaa agg tca 1400Ile Asp Val Val Ser Val Glu Lys Arg Gln Ala Pro Gly
Lys Arg Ser 280 285 290gag tct gga tca cct tct gct gga ggc cac agc
aaa cct cct cac agc 1448Glu Ser Gly Ser Pro Ser Ala Gly Gly His Ser
Lys Pro Pro His Ser 295 300 305cca ctg gtc ctc aag agg tgc cac gtc
tcc aca cat cag cac aac tac 1496Pro Leu Val Leu Lys Arg Cys His Val
Ser Thr His Gln His Asn Tyr 310 315 320gca gcg cct ccc tcc act cgg
aag gac tat cct gct gcc aag agg gtc 1544Ala Ala Pro Pro Ser Thr Arg
Lys Asp Tyr Pro Ala Ala Lys Arg Val325 330 335 340aag ttg gac agt
gtc aga gtc ctg aga cag atc agc aac aac cga aaa 1592Lys Leu Asp Ser
Val Arg Val Leu Arg Gln Ile Ser Asn Asn Arg Lys 345 350 355tgc acc
agc ccc agg tcc tcg gac acc gag gag aat gtc aag agg cga 1640Cys Thr
Ser Pro Arg Ser Ser Asp Thr Glu Glu Asn Val Lys Arg Arg 360 365
370aca cac aac gtc ttg gag cgc cag agg agg aac gag cta aaa cgg agc
1688Thr His Asn Val Leu Glu Arg Gln Arg Arg Asn Glu Leu Lys Arg Ser
375 380 385ttt ttt gcc ctg cgt gac cag atc ccg gag ttg gaa aac aat
gaa aag 1736Phe Phe Ala Leu Arg Asp Gln Ile Pro Glu Leu Glu Asn Asn
Glu Lys 390 395 400gcc ccc aag gta gtt atc ctt aaa aaa gcc aca gca
tac atc ctg tcc 1784Ala Pro Lys Val Val Ile Leu Lys Lys Ala Thr Ala
Tyr Ile Leu Ser405 410 415 420gtc caa gca gag gag caa aag ctc att
tct gaa gag gac ttg ttg cgg 1832Val Gln Ala Glu Glu Gln Lys Leu Ile
Ser Glu Glu Asp Leu Leu Arg425 430 435aaa cga cga gaa cag ttg aaa
cac aaa ctt gaa cag cta cgg aac tct 1880Lys Arg Arg Glu Gln Leu Lys
His Lys Leu Glu Gln Leu Arg Asn Ser440 445 450tgt gcg taa
ggaaaagtaa ggaaaacgat tccttctaac agaaatgtcc 1929Cys Alatgagcaatca
cctatgaact tgtttcaaat gcatgatcaa atgcaacctc acaaccttgg
1989ctgagtcttg agactgaaag atttagccat aatgtaaact gcctcaaatt
ggactttggg 2049cataaaagaa cttttttatg cttaccatct tttttttttc
tttaacagat ttgtatttaa 2109gaattgtttt taaaaaattt taagatttac
acaatgtttc tctgtaaata ttgccattaa 2169atgtaaataa ctttaataaa
acgtttatag cagttacaca gaatttcaat cctagtatat 2229agtacctagt
attataggta ctataaaccc taattttttt tatttaagta cattttgctt
2289tttaaagttg atttttttct attgttttta gaaaaaataa aataactggc
aaatatatca 2349ttgagccaaa aaaaaaaaaa aaaaaaaa 237724454PRTHomo
sapiens 24Leu Asp Phe Phe Arg Val Val Glu Asn Gln Gln Pro Pro Ala
Thr Met1 5 10 15Pro Leu Asn Val Ser Phe Thr Asn Arg Asn Tyr Asp Leu
Asp Tyr Asp 20 25 30Ser Val Gln Pro Tyr Phe Tyr Cys Asp Glu Glu Glu
Asn Phe Tyr Gln 35 40 45Gln Gln Gln Gln Ser Glu Leu Gln Pro Pro Ala
Pro Ser Glu Asp Ile 50 55 60Trp Lys Lys Phe Glu Leu Leu Pro Thr Pro
Pro Leu Ser Pro Ser Arg65 70 75 80Arg Ser Gly Leu Cys Ser Pro Ser
Tyr Val Ala Val Thr Pro Phe Ser 85 90 95Leu Arg Gly Asp Asn Asp Gly
Gly Gly Gly Ser Phe Ser Thr Ala Asp 100 105 110Gln Leu Glu Met Val
Thr Glu Leu Leu Gly Gly Asp Met Val Asn Gln 115 120 125Ser Phe Ile
Cys Asp Pro Asp Asp Glu Thr Phe Ile Lys Asn Ile Ile 130 135 140Ile
Gln Asp Cys Met Trp Ser Gly Phe Ser Ala Ala Ala Lys Leu Val145 150
155 160Ser Glu Lys Leu Ala Ser Tyr Gln Ala Ala Arg Lys Asp Ser Gly
Ser 165 170 175Pro Asn Pro Ala Arg Gly His Ser Val Cys Ser Thr Ser
Ser Leu Tyr 180 185 190Leu Gln Asp Leu Ser Ala Ala Ala Ser Glu Cys
Ile Asp Pro Ser Val 195 200 205Val Phe Pro Tyr Pro Leu Asn Asp Ser
Ser Ser Pro Lys Ser Cys Ala 210 215 220Ser Gln Asp Ser Ser Ala Phe
Ser Pro Ser Ser Asp Ser Leu Leu Ser225 230 235 240Ser Thr Glu Ser
Ser Pro Gln Gly Ser Pro Glu Pro Leu Val Leu His 245 250 255Glu Glu
Thr Pro Pro Thr Thr Ser Ser Asp Ser Glu Glu Glu Gln Glu 260 265
270Asp Glu Glu Glu Ile Asp Val Val Ser Val Glu Lys Arg Gln Ala Pro
275 280 285Gly Lys Arg Ser Glu Ser Gly Ser Pro Ser Ala Gly Gly His
Ser Lys 290 295 300Pro Pro His Ser Pro Leu Val Leu Lys Arg Cys His
Val Ser Thr His305 310 315 320Gln His Asn Tyr Ala Ala Pro Pro Ser
Thr Arg Lys Asp Tyr Pro Ala 325 330 335Ala Lys Arg Val Lys Leu Asp
Ser Val Arg Val Leu Arg Gln Ile Ser 340 345 350Asn Asn Arg Lys Cys
Thr Ser Pro Arg Ser Ser Asp Thr Glu Glu Asn 355 360 365Val Lys Arg
Arg Thr His Asn Val Leu Glu Arg Gln Arg Arg Asn Glu 370 375 380Leu
Lys Arg Ser Phe Phe Ala Leu Arg Asp Gln Ile Pro Glu Leu Glu385 390
395 400Asn Asn Glu Lys Ala Pro Lys Val Val Ile Leu Lys Lys Ala Thr
Ala 405 410 415Tyr Ile Leu Ser Val Gln Ala Glu Glu Gln Lys Leu Ile
Ser Glu Glu 420 425 430Asp Leu Leu Arg Lys Arg Arg Glu Gln Leu Lys
His Lys Leu Glu Gln 435 440 445Leu Arg Asn Ser Cys Ala
450252613DNAHomo sapiensCDS(301)..(1695) 25gtcatctgtc tggacgcgct
gggtggatgc ggggggctcc tgggaactgt gttggagccg 60agcaagcgct agccaggcgc
aagcgcgcac agactgtagc catccgagga cacccccgcc 120cccccggccc
acccggagac acccgcgcag aatcgcctcc ggatcccctg cagtcggcgg
180gagtgttgga ggtcggcgcc ggcccccgcc ttccgcgccc cccacgggaa
ggaagcaccc 240ccggtattaa aacgaacggg gcggaaagaa gccctcagtc
gccggccggg aggcgagccg 300atg ccg agc tgc tcc acg tcc acc atg ccg
ggc atg atc tgc aag aac 348Met Pro Ser Cys Ser Thr Ser Thr Met Pro
Gly Met Ile Cys Lys Asn1 5 10 15cca gac ctc gag ttt gac tcg cta cag
ccc tgc ttc tac ccg gac gaa 396Pro Asp Leu Glu Phe Asp Ser Leu Gln
Pro Cys Phe Tyr Pro Asp Glu 20 25 30gat gac ttc tac ttc ggc ggc ccc
gac tcg acc ccc ccg ggg gag gac 444Asp Asp Phe Tyr Phe Gly Gly Pro
Asp Ser Thr Pro Pro Gly Glu Asp 35 40 45atc tgg aag aag ttt gag ctg
ctg ccc acg ccc ccg ctg tcg ccc agc 492Ile Trp Lys Lys Phe Glu Leu
Leu Pro Thr Pro Pro Leu Ser Pro Ser 50 55 60cgt ggc ttc gcg gag cac
agc tcc gag ccc ccg agc tgg gtc acg gag 540Arg Gly Phe Ala Glu His
Ser Ser Glu Pro Pro Ser Trp Val Thr Glu65 70 75 80atg ctg ctt gag
aac gag ctg tgg ggc agc ccg gcc gag gag gac gcg 588Met Leu Leu Glu
Asn Glu Leu Trp Gly Ser Pro Ala Glu Glu Asp Ala 85 90 95ttc ggc ctg
ggg gga ctg ggt ggc ctc acc ccc aac ccg gtc atc ctc 636Phe Gly Leu
Gly Gly Leu Gly Gly Leu Thr Pro Asn Pro Val Ile Leu 100 105 110cag
gac tgc atg tgg agc ggc ttc tcc gcc cgc gag aag ctg gag cgc 684Gln
Asp Cys Met Trp Ser Gly Phe Ser Ala Arg Glu Lys Leu Glu Arg 115 120
125gcc gtg agc gag aag ctg cag cac ggc cgc ggg ccg cca acc gcc ggt
732Ala Val Ser Glu Lys Leu Gln His Gly Arg Gly Pro Pro Thr Ala Gly
130 135 140tcc acc gcc cag tcc ccg gga gcc ggc gcc gcc agc cct gcg
ggt cgc 780Ser Thr Ala Gln Ser Pro Gly Ala Gly Ala Ala Ser Pro Ala
Gly Arg145 150 155 160ggg cac ggc ggg gct gcg gga gcc ggc cgc gcc
ggg gcc gcc ctg ccc 828Gly His Gly Gly Ala Ala Gly Ala Gly Arg Ala
Gly Ala Ala Leu Pro 165 170 175gcc gag ctc gcc cac ccg gcc gcc gag
tgc gtg gat ccc gcc gtg gtc 876Ala Glu Leu Ala His Pro Ala Ala Glu
Cys Val Asp Pro Ala Val Val 180 185 190ttc ccc ttt ccc gtg aac aag
cgc gag cca gcg ccc gtg ccc gca gcc 924Phe Pro Phe Pro Val Asn Lys
Arg Glu Pro Ala Pro Val Pro Ala Ala 195 200 205ccg gcc agt gcc ccg
gcg gcg ggc cct gcg gtc gcc tcg ggg gcg ggt 972Pro Ala Ser Ala Pro
Ala Ala Gly Pro Ala Val Ala Ser Gly Ala Gly 210 215 220att gcc gcc
cca gcc ggg gcc ccg ggg gtc gcc cct ccg cgc cca ggc 1020Ile Ala Ala
Pro Ala Gly Ala Pro Gly Val Ala Pro Pro Arg Pro Gly225 230 235
240ggc cgc cag acc agc ggc ggc gac cac aag gcc ctc agt acc tcc gga
1068Gly Arg Gln Thr
Ser Gly Gly Asp His Lys Ala Leu Ser Thr Ser Gly 245 250 255gag gac
acc ctg agc gat tca gat gat gaa gat gat gaa gag gaa gat 1116Glu Asp
Thr Leu Ser Asp Ser Asp Asp Glu Asp Asp Glu Glu Glu Asp 260 265
270gaa gag gaa gaa atc gac gtg gtc act gtg gag aag cgg cgt tcc tcc
1164Glu Glu Glu Glu Ile Asp Val Val Thr Val Glu Lys Arg Arg Ser Ser
275 280 285tcc aac acc aag gct gtc acc aca ttc acc atc act gtg cgt
ccc aag 1212Ser Asn Thr Lys Ala Val Thr Thr Phe Thr Ile Thr Val Arg
Pro Lys 290 295 300aac gca gcc ctg ggt ccc ggg agg gct cag tcc agc
gag ctg atc ctc 1260Asn Ala Ala Leu Gly Pro Gly Arg Ala Gln Ser Ser
Glu Leu Ile Leu305 310 315 320aaa cga tgc ctt ccc atc cac cag cag
cac aac tat gcc gcc ccc tct 1308Lys Arg Cys Leu Pro Ile His Gln Gln
His Asn Tyr Ala Ala Pro Ser 325 330 335ccc tac gtg gag agt gag gat
gca ccc cca cag aag aag ata aag agc 1356Pro Tyr Val Glu Ser Glu Asp
Ala Pro Pro Gln Lys Lys Ile Lys Ser 340 345 350gag gcg tcc cca cgt
ccg ctc aag agt gtc atc ccc cca aag gct aag 1404Glu Ala Ser Pro Arg
Pro Leu Lys Ser Val Ile Pro Pro Lys Ala Lys 355 360 365agc ttg agc
ccc cga aac tct gac tcg gag gac agt gag cgt cgc aga 1452Ser Leu Ser
Pro Arg Asn Ser Asp Ser Glu Asp Ser Glu Arg Arg Arg 370 375 380aac
cac aac atc ctg gag cgc cag cgc cgc aac gac ctt cgg tcc agc 1500Asn
His Asn Ile Leu Glu Arg Gln Arg Arg Asn Asp Leu Arg Ser Ser385 390
395 400ttt ctc acg ctc agg gac cac gtg ccg gag ttg gta aag aat gag
aag 1548Phe Leu Thr Leu Arg Asp His Val Pro Glu Leu Val Lys Asn Glu
Lys 405 410 415gcc gcc aag gtg gtc att ttg aaa aag gcc act gag tat
gtc cac tcc 1596Ala Ala Lys Val Val Ile Leu Lys Lys Ala Thr Glu Tyr
Val His Ser 420 425 430ctc cag gcc gag gag cac cag ctt ttg ctg gaa
aag gaa aaa ttg cag 1644Leu Gln Ala Glu Glu His Gln Leu Leu Leu Glu
Lys Glu Lys Leu Gln 435 440 445gca aga cag cag cag ttg cta aag aaa
att gaa cac gct cgg act tgc 1692Ala Arg Gln Gln Gln Leu Leu Lys Lys
Ile Glu His Ala Arg Thr Cys 450 455 460tag acgcttctca aaactggaca
gtcactgcca ctttgcacat tttgattttt 1745tttttaaaca aacattgtgt
tgacattaag aatgttggtt tactttcaaa tcggtcccct 1805gtcgagttcg
gctctgggtg ggcagtagga ccaccagtgt ggggttctgc tgggaccttg
1865gagagcctgc atcccaggat gctgggtggc cctgcagcct cctccacctc
acctccatga 1925cagcgctaaa cgttggtgac ggttgggagc ctctggggct
gttgaagtca ccttgtgtgt 1985tccaagtttc caaacaacag aaagtcattc
cttcttttta aaatggtgct taagttccag 2045cagatgccac ataaggggtt
tgccatttga tacccctggg gaacatttct gtaaatacca 2105ttgacacatc
cgccttttgt atacatcctg ggtaatgaga ggtggctttt gcggccagta
2165ttagactgga agttcatacc taagtactgt aataatacct caatgtttga
ggagcatgtt 2225ttgtatacaa atatattgtt aatctctgtt atgtactgta
ctaattctta cactgcctgt 2285atactttagt atgacgctga tacataacta
aatttgatac ttatattttc gtatgaaaat 2345gagttgtgaa agttttgagt
agatattact ttatcacttt ttgaactaag aaacttttgt 2405aaagaaattt
actatatata tatgcctttt tcctagcctg tttcttcctg ttaatgtatt
2465tgttcatgtt tggtgcatag aactgggtaa atgcaaagtt ctgtgtttaa
tttcttcaaa 2525atgtatatat ttagtgctgc atcttatagc actttgaaat
acctcatgtt tatgaaaata 2585aatagcttaa aattaaatga aaaaaaaa
261326464PRTHomo sapiens 26Met Pro Ser Cys Ser Thr Ser Thr Met Pro
Gly Met Ile Cys Lys Asn1 5 10 15Pro Asp Leu Glu Phe Asp Ser Leu Gln
Pro Cys Phe Tyr Pro Asp Glu 20 25 30Asp Asp Phe Tyr Phe Gly Gly Pro
Asp Ser Thr Pro Pro Gly Glu Asp 35 40 45Ile Trp Lys Lys Phe Glu Leu
Leu Pro Thr Pro Pro Leu Ser Pro Ser 50 55 60Arg Gly Phe Ala Glu His
Ser Ser Glu Pro Pro Ser Trp Val Thr Glu65 70 75 80Met Leu Leu Glu
Asn Glu Leu Trp Gly Ser Pro Ala Glu Glu Asp Ala 85 90 95Phe Gly Leu
Gly Gly Leu Gly Gly Leu Thr Pro Asn Pro Val Ile Leu 100 105 110Gln
Asp Cys Met Trp Ser Gly Phe Ser Ala Arg Glu Lys Leu Glu Arg 115 120
125Ala Val Ser Glu Lys Leu Gln His Gly Arg Gly Pro Pro Thr Ala Gly
130 135 140Ser Thr Ala Gln Ser Pro Gly Ala Gly Ala Ala Ser Pro Ala
Gly Arg145 150 155 160Gly His Gly Gly Ala Ala Gly Ala Gly Arg Ala
Gly Ala Ala Leu Pro 165 170 175Ala Glu Leu Ala His Pro Ala Ala Glu
Cys Val Asp Pro Ala Val Val 180 185 190Phe Pro Phe Pro Val Asn Lys
Arg Glu Pro Ala Pro Val Pro Ala Ala 195 200 205Pro Ala Ser Ala Pro
Ala Ala Gly Pro Ala Val Ala Ser Gly Ala Gly 210 215 220Ile Ala Ala
Pro Ala Gly Ala Pro Gly Val Ala Pro Pro Arg Pro Gly225 230 235
240Gly Arg Gln Thr Ser Gly Gly Asp His Lys Ala Leu Ser Thr Ser Gly
245 250 255Glu Asp Thr Leu Ser Asp Ser Asp Asp Glu Asp Asp Glu Glu
Glu Asp 260 265 270Glu Glu Glu Glu Ile Asp Val Val Thr Val Glu Lys
Arg Arg Ser Ser 275 280 285Ser Asn Thr Lys Ala Val Thr Thr Phe Thr
Ile Thr Val Arg Pro Lys 290 295 300Asn Ala Ala Leu Gly Pro Gly Arg
Ala Gln Ser Ser Glu Leu Ile Leu305 310 315 320Lys Arg Cys Leu Pro
Ile His Gln Gln His Asn Tyr Ala Ala Pro Ser 325 330 335Pro Tyr Val
Glu Ser Glu Asp Ala Pro Pro Gln Lys Lys Ile Lys Ser 340 345 350Glu
Ala Ser Pro Arg Pro Leu Lys Ser Val Ile Pro Pro Lys Ala Lys 355 360
365Ser Leu Ser Pro Arg Asn Ser Asp Ser Glu Asp Ser Glu Arg Arg Arg
370 375 380Asn His Asn Ile Leu Glu Arg Gln Arg Arg Asn Asp Leu Arg
Ser Ser385 390 395 400Phe Leu Thr Leu Arg Asp His Val Pro Glu Leu
Val Lys Asn Glu Lys 405 410 415Ala Ala Lys Val Val Ile Leu Lys Lys
Ala Thr Glu Tyr Val His Ser 420 425 430Leu Gln Ala Glu Glu His Gln
Leu Leu Leu Glu Lys Glu Lys Leu Gln 435 440 445Ala Arg Gln Gln Gln
Leu Leu Lys Lys Ile Glu His Ala Arg Thr Cys 450 455
460273622DNAHomo sapiensCDS(582)..(1676) 27aatgcgcctg cagctcgcgc
tcccgcgccg atcccgagag cgtccgggcc gccgtgcgcg 60agcgagggag ggcgcgcgcg
cggggggggc gcgcttgtga gtgcgggccg cgctctcggc 120ggcgcgcatg
tgcgtgtgtg ctggctgccg ggctgccccg agccggcggg gagccggtcc
180gctccaggtg gcgggcggct ggagcgaggt gaggctgcgg gtggccaggg
cacgggcgcg 240ggtcccgcgg tgcgggctgg ctgcaggctg ccttctgggc
acggcgcgcc cccgcccggc 300cccgccgggc cctgggagct gcgctccggg
cggcgctggc aaagtttgct ttgaactcgc 360tgcccacagt cgggtccgcg
cgctgcgatt ggcttcccct accactctga cccggggccc 420ggcttcccgg
gacgcgagga ctgggcgcag gctgcaagct ggtggggttg gggaggaacg
480agagcccggc agccgactgt gccgagggac ccggggacac ctccttcgcc
cggccggcac 540ccggtcagca cgtcccccct tccctcccgc agggagcgga c atg gac
tac gac tcg 596 Met Asp Tyr Asp Ser 1 5tac cag cac tat ttc tac gac
tat gac tgc ggg gag gat ttc tac cgc 644Tyr Gln His Tyr Phe Tyr Asp
Tyr Asp Cys Gly Glu Asp Phe Tyr Arg 10 15 20tcc acg gcg ccc agc gag
gac atc tgg aag aaa ttc gag ctg gtg cca 692Ser Thr Ala Pro Ser Glu
Asp Ile Trp Lys Lys Phe Glu Leu Val Pro 25 30 35tcg ccc ccc acg tcg
ccg ccc tgg ggc ttg ggt ccc ggc gca ggg gac 740Ser Pro Pro Thr Ser
Pro Pro Trp Gly Leu Gly Pro Gly Ala Gly Asp 40 45 50ccg gcc ccc ggg
att ggt ccc ccg gag ccg tgg ccc gga ggg tgc acc 788Pro Ala Pro Gly
Ile Gly Pro Pro Glu Pro Trp Pro Gly Gly Cys Thr 55 60 65gga gac gaa
gcg gaa tcc cgg ggc cac tcg aaa ggc tgg ggc agg aac 836Gly Asp Glu
Ala Glu Ser Arg Gly His Ser Lys Gly Trp Gly Arg Asn70 75 80 85tac
gcc tcc atc ata cgc cgt gac tgc atg tgg agc ggc ttc tcg gcc 884Tyr
Ala Ser Ile Ile Arg Arg Asp Cys Met Trp Ser Gly Phe Ser Ala 90 95
100cgg gaa cgg ctg gag aga gct gtg agc gac cgg ctc gct cct ggc gcg
932Arg Glu Arg Leu Glu Arg Ala Val Ser Asp Arg Leu Ala Pro Gly Ala
105 110 115ccc cgg ggg aac ccg ccc aag gcg tcc gcc gcc ccg gac tgc
act ccc 980Pro Arg Gly Asn Pro Pro Lys Ala Ser Ala Ala Pro Asp Cys
Thr Pro 120 125 130agc ctc gaa gcc ggc aac ccg gcg ccc gcc gcc ccc
tgt ccg ctg ggc 1028Ser Leu Glu Ala Gly Asn Pro Ala Pro Ala Ala Pro
Cys Pro Leu Gly 135 140 145gaa ccc aag acc cag gcc tgc tcc ggg tcc
gag agc cca agc gac tcg 1076Glu Pro Lys Thr Gln Ala Cys Ser Gly Ser
Glu Ser Pro Ser Asp Ser150 155 160 165gag aat gaa gaa att gat gtt
gtg aca gta gag aag agg cag tct ctg 1124Glu Asn Glu Glu Ile Asp Val
Val Thr Val Glu Lys Arg Gln Ser Leu 170 175 180ggt att cgg aag ccg
gtc acc atc acg gtg cga gca gac ccc ctg gat 1172Gly Ile Arg Lys Pro
Val Thr Ile Thr Val Arg Ala Asp Pro Leu Asp 185 190 195ccc tgc atg
aag cat ttc cac atc tcc atc cat cag caa cag cac aac 1220Pro Cys Met
Lys His Phe His Ile Ser Ile His Gln Gln Gln His Asn 200 205 210tat
gct gcc cgt ttt cct cca gaa agc tgc tcc caa gaa gag gct tca 1268Tyr
Ala Ala Arg Phe Pro Pro Glu Ser Cys Ser Gln Glu Glu Ala Ser 215 220
225gag agg ggt ccc caa gaa gag gtt ctg gag aga gat gct gca ggg gaa
1316Glu Arg Gly Pro Gln Glu Glu Val Leu Glu Arg Asp Ala Ala Gly
Glu230 235 240 245aag gaa gat gag gag gat gaa gag att gtg agt ccc
cca cct gta gaa 1364Lys Glu Asp Glu Glu Asp Glu Glu Ile Val Ser Pro
Pro Pro Val Glu 250 255 260agt gag gct gcc cag tcc tgc cac ccc aaa
cct gtc agt tct gat act 1412Ser Glu Ala Ala Gln Ser Cys His Pro Lys
Pro Val Ser Ser Asp Thr 265 270 275gag gat gtg acc aag agg aag aat
cac aac ttc ctg gag cgc aag agg 1460Glu Asp Val Thr Lys Arg Lys Asn
His Asn Phe Leu Glu Arg Lys Arg 280 285 290cgg aat gac ctg cgt tcg
cga ttc ttg gcg ctg agg gac cag gtg ccc 1508Arg Asn Asp Leu Arg Ser
Arg Phe Leu Ala Leu Arg Asp Gln Val Pro 295 300 305acc ctg gcc agc
tgc tcc aag gcc ccc aaa gta gtg atc cta agc aag 1556Thr Leu Ala Ser
Cys Ser Lys Ala Pro Lys Val Val Ile Leu Ser Lys310 315 320 325gcc
ttg gaa tac ttg caa gcc ctg gtg ggg gct gag aag agg atg gct 1604Ala
Leu Glu Tyr Leu Gln Ala Leu Val Gly Ala Glu Lys Arg Met Ala 330 335
340aca gag aaa aga cag ctc cga tgc cgg cag cag cag ttg cag aaa aga
1652Thr Glu Lys Arg Gln Leu Arg Cys Arg Gln Gln Gln Leu Gln Lys Arg
345 350 355att gca tac ctc act ggc tac taa ctgaccaaaa agcctgacag
ttctgtctta 1706Ile Ala Tyr Leu Thr Gly Tyr 360cgaagacaca agtttatttt
ttaacctccc tctccccttt agtaatttgc acattttggt 1766tatggtggga
cagtctggac agtagatccc agaatgcatt gcagccggtg cacacacaat
1826aaaggcttgc attcttggaa accttgaaac ccagctctcc ctcttccctg
actcatggga 1886gtgctgtatg ttctctggcg cctttggctt cccagcaggc
agctgactga ggagccttgg 1946ggtctgccta gctcactagc tctgaagaaa
aggctgacag atgctatgca acaggtggtg 2006gatgttgtca ggggctccag
cctgcatgaa atctcacact ctgcatgagc tttaggctag 2066gaaaggatgc
tcccaactgg tgtctctggg gtgatgcaag gacagctggg cctggatgct
2126ctccctgagg ctcctttttc cagaagacac acgagctgtc ttgggtgaag
acaagcttgc 2186agacttgatc aacattgacc attacctcac tgtcagacac
tttacagtag ccaaggagtt 2246ggaaaccttt atatattatg atgttagctg
acccccttcc tcccactccc aatgctgcga 2306ccctgggaac acttaaaaag
cttggcctct agattctttg tctcagagcc ctctgggctc 2366tctcctctga
gggagggacc tttctttcct cacaagggac ttttttgttc cattatgcct
2426tgttatgcaa tgggctctac agcacccttt cccacaggtc agaaatattt
ccccaagaca 2486cagggaaatc ggtcctagcc tggggcctgg ggatagcttg
gagtcctggc ccatgaactt 2546gatccctgcc caggtgtttt ccgaggggca
cttgaggccc agtcttttct caaggcaggt 2606gtaagacacc tcagagggag
aactgtactg ctgcctcttt cccacctgcc tcatctcaat 2666ccttgagcgg
caagtttgaa gttcttctgg aaccatgcaa atctgtcctc ctcatgcaat
2726tccaaggagc ttgctggctc tgcagccacc cttgggcccc ttccagcctg
ccatgaatca 2786gatatctttc ccagaatctg ggcgtttctg aagttttggg
gagagctgtt gggactcatc 2846cagtgctcca gaaggtggac ttgcttctgg
tgggttttaa aggagcctcc aggagatatg 2906cttagccaac catgatggat
tttaccccag ctggactcgg cagctccaag tggaatccac 2966gtgcagcttc
tagtctggga aagtcaccca acctagcagt tgtcatgtgg gtaacctcag
3026gcacctctaa gcctgtcctg gaagaaggac cagcagcccc tccagaactc
tgcccaggac 3086agcaggtgcc tgctggctct gggtttggaa gttggggtgg
gtagggggtg gtaagtacta 3146tatatggctc tggaaaacca gctgctactt
ccaaatctat tgtccataat ggtttctttc 3206tgaggttgct tcttggcctc
agaggacccc aggggatgtt tggaaatagc ctctctaccc 3266ttctggagca
tggtttacaa aagccagctg acttctggaa ttgtctatgg aggacagttt
3326gggtgtaggt tactgatgtc tcaactgaat agcttgtgtt ttataagctg
ctgttggcta 3386ttatgctggg ggagtctttt ttttttatat tgtatttttg
tatgcctttt gcaaagtggt 3446gttaactgtt tttgtacaag gaaaaaaact
cttggggcaa tttcctgttg caagggtctg 3506atttattttg aaaggcaagt
tcacctgaaa ttttgtattt agttgtgatt actgattgcc 3566tgattttaaa
atgttgcctt ctgggacatc ttctaataaa agatttctca aacatg 362228364PRTHomo
sapiens 28Met Asp Tyr Asp Ser Tyr Gln His Tyr Phe Tyr Asp Tyr Asp
Cys Gly1 5 10 15Glu Asp Phe Tyr Arg Ser Thr Ala Pro Ser Glu Asp Ile
Trp Lys Lys 20 25 30Phe Glu Leu Val Pro Ser Pro Pro Thr Ser Pro Pro
Trp Gly Leu Gly 35 40 45Pro Gly Ala Gly Asp Pro Ala Pro Gly Ile Gly
Pro Pro Glu Pro Trp 50 55 60Pro Gly Gly Cys Thr Gly Asp Glu Ala Glu
Ser Arg Gly His Ser Lys65 70 75 80Gly Trp Gly Arg Asn Tyr Ala Ser
Ile Ile Arg Arg Asp Cys Met Trp 85 90 95Ser Gly Phe Ser Ala Arg Glu
Arg Leu Glu Arg Ala Val Ser Asp Arg 100 105 110Leu Ala Pro Gly Ala
Pro Arg Gly Asn Pro Pro Lys Ala Ser Ala Ala 115 120 125Pro Asp Cys
Thr Pro Ser Leu Glu Ala Gly Asn Pro Ala Pro Ala Ala 130 135 140Pro
Cys Pro Leu Gly Glu Pro Lys Thr Gln Ala Cys Ser Gly Ser Glu145 150
155 160Ser Pro Ser Asp Ser Glu Asn Glu Glu Ile Asp Val Val Thr Val
Glu 165 170 175Lys Arg Gln Ser Leu Gly Ile Arg Lys Pro Val Thr Ile
Thr Val Arg 180 185 190Ala Asp Pro Leu Asp Pro Cys Met Lys His Phe
His Ile Ser Ile His 195 200 205Gln Gln Gln His Asn Tyr Ala Ala Arg
Phe Pro Pro Glu Ser Cys Ser 210 215 220Gln Glu Glu Ala Ser Glu Arg
Gly Pro Gln Glu Glu Val Leu Glu Arg225 230 235 240Asp Ala Ala Gly
Glu Lys Glu Asp Glu Glu Asp Glu Glu Ile Val Ser 245 250 255Pro Pro
Pro Val Glu Ser Glu Ala Ala Gln Ser Cys His Pro Lys Pro 260 265
270Val Ser Ser Asp Thr Glu Asp Val Thr Lys Arg Lys Asn His Asn Phe
275 280 285Leu Glu Arg Lys Arg Arg Asn Asp Leu Arg Ser Arg Phe Leu
Ala Leu 290 295 300Arg Asp Gln Val Pro Thr Leu Ala Ser Cys Ser Lys
Ala Pro Lys Val305 310 315 320Val Ile Leu Ser Lys Ala Leu Glu Tyr
Leu Gln Ala Leu Val Gly Ala 325 330 335Glu Lys Arg Met Ala Thr Glu
Lys Arg Gln Leu Arg Cys Arg Gln Gln 340 345 350Gln Leu Gln Lys Arg
Ile Ala Tyr Leu Thr Gly Tyr 355 360294865DNAHomo
sapiensCDS(253)..(2001) 29gcagtgccgc cttttttttt tttttgcatc
ccattttttt aaatttgcaa ttttatattt 60tgcaaatatt ttgagagaca ttgatttttc
tccccgtgct cccccgttct tccctgcgga 120gtgcgctgcg ccgcccagcc
ctgtcgcccc ccggaggtga tccctccctc ctgcctgccc 180gccagcctga
cctgtgcccg gctcgcgggc cgcagcctcg gccccggcgc gcccccggca
240gctctcggcg cg atg agc ata gag acg cta ctg gag gcg gcc cgc ttc
ctg 291 Met Ser Ile Glu Thr Leu Leu Glu Ala Ala Arg Phe Leu 1 5
10gaa tgg caa gcg cag caa caa cag aga gca cgt gag gag cag gag cgg
339Glu Trp Gln Ala Gln Gln Gln Gln Arg Ala Arg Glu Glu Gln Glu Arg
15 20 25ctt cgc ttg gag cag gag cga gag cag gaa cag aag aag gcc aat
agc 387Leu Arg Leu Glu Gln Glu Arg Glu Gln Glu Gln Lys Lys Ala Asn
Ser30 35 40
45ctg gcc agg ctg gca cat acc ctt cct gtg gag gaa ccc cgc atg gag
435Leu Ala Arg Leu Ala His Thr Leu Pro Val Glu Glu Pro Arg Met Glu
50 55 60gcg cca ccc ctg cct ctg tct cca ccg gct ccc ccg ccg gca ccc
cca 483Ala Pro Pro Leu Pro Leu Ser Pro Pro Ala Pro Pro Pro Ala Pro
Pro 65 70 75cca cca ctt gcc acc cct gcc cca ctg act gtc atc cct atc
cct gtg 531Pro Pro Leu Ala Thr Pro Ala Pro Leu Thr Val Ile Pro Ile
Pro Val 80 85 90gtg acc aac tcc cct cag cct cta ccc cca ccc cca ccc
ttg ccc gcg 579Val Thr Asn Ser Pro Gln Pro Leu Pro Pro Pro Pro Pro
Leu Pro Ala 95 100 105gca gcc cag cct ctg ccc ctg gcg cct cgt cag
ccg gcc ctg gtt ggc 627Ala Ala Gln Pro Leu Pro Leu Ala Pro Arg Gln
Pro Ala Leu Val Gly110 115 120 125gcc ccc gga ctc agc att aag gag
cct gcc ccc ctg ccc agc agg ccg 675Ala Pro Gly Leu Ser Ile Lys Glu
Pro Ala Pro Leu Pro Ser Arg Pro 130 135 140cag gtg ccc acc cct gct
ccc cta ctg ccg gac tcg aag gcc acc att 723Gln Val Pro Thr Pro Ala
Pro Leu Leu Pro Asp Ser Lys Ala Thr Ile 145 150 155cca ccc aat ggc
agc ccc aag cct ttg cag ccc ctc ccc acg cct gtc 771Pro Pro Asn Gly
Ser Pro Lys Pro Leu Gln Pro Leu Pro Thr Pro Val 160 165 170ctg acc
ata gcg cca cac cct gga gtc cag cct cag ctg gcc ccc cag 819Leu Thr
Ile Ala Pro His Pro Gly Val Gln Pro Gln Leu Ala Pro Gln 175 180
185cag ccg ccc cca ccc acg ctg ggg acc ctg aag ttg gca cca gct gaa
867Gln Pro Pro Pro Pro Thr Leu Gly Thr Leu Lys Leu Ala Pro Ala
Glu190 195 200 205gaa gtc aaa tcc agt gaa cag aag aag agg ccc ggg
ggg atc gga acc 915Glu Val Lys Ser Ser Glu Gln Lys Lys Arg Pro Gly
Gly Ile Gly Thr 210 215 220aga gaa gtc cac aac aaa ttg gag aag aac
agg agg gcc cat ctg aaa 963Arg Glu Val His Asn Lys Leu Glu Lys Asn
Arg Arg Ala His Leu Lys 225 230 235gag tgc ttt gag acc ctg aag cgg
aac atc ccc aac gtg gat gac aag 1011Glu Cys Phe Glu Thr Leu Lys Arg
Asn Ile Pro Asn Val Asp Asp Lys 240 245 250aag acg tcc aat ctg agc
gtg ctg cgg acg gcg ctg cgg tac atc cag 1059Lys Thr Ser Asn Leu Ser
Val Leu Arg Thr Ala Leu Arg Tyr Ile Gln 255 260 265tcc ctg aag agg
aag gag aag gaa tat gag cat gaa atg gag cgg ctg 1107Ser Leu Lys Arg
Lys Glu Lys Glu Tyr Glu His Glu Met Glu Arg Leu270 275 280 285gca
cgt gag aag att gcc acg cag cag cgg ctg gca gag ctc aag cac 1155Ala
Arg Glu Lys Ile Ala Thr Gln Gln Arg Leu Ala Glu Leu Lys His 290 295
300gag ctg agc cag tgg atg gac gta ctg gag att gac cgc gtg ctg cgg
1203Glu Leu Ser Gln Trp Met Asp Val Leu Glu Ile Asp Arg Val Leu Arg
305 310 315cag acg ggc cag ccc gag gat gac cag gcc tcc acc tcc acc
gcc tct 1251Gln Thr Gly Gln Pro Glu Asp Asp Gln Ala Ser Thr Ser Thr
Ala Ser 320 325 330gag ggt gag gac aac ata gac gag gat atg gag gag
gac cgg gcg ggc 1299Glu Gly Glu Asp Asn Ile Asp Glu Asp Met Glu Glu
Asp Arg Ala Gly 335 340 345ctg ggc cca cct aag ctg agc cat cgt ccc
cag ccg gag ctg ctg aag 1347Leu Gly Pro Pro Lys Leu Ser His Arg Pro
Gln Pro Glu Leu Leu Lys350 355 360 365tcc acc ctg cca ccc ccc agc
acc acc cct gcg cct ctg cct cca cac 1395Ser Thr Leu Pro Pro Pro Ser
Thr Thr Pro Ala Pro Leu Pro Pro His 370 375 380cca cac cct cac ccc
cac tcc gtg gcc cta cct cct gcc cac ctc ccc 1443Pro His Pro His Pro
His Ser Val Ala Leu Pro Pro Ala His Leu Pro 385 390 395gtg cag cag
cag cag cca cag cag aag acc cct ctg cca gcc cct cct 1491Val Gln Gln
Gln Gln Pro Gln Gln Lys Thr Pro Leu Pro Ala Pro Pro 400 405 410ccc
cca ccg gct gcc cct gcc cag aca ctg gtg cca gct cca gcc cat 1539Pro
Pro Pro Ala Ala Pro Ala Gln Thr Leu Val Pro Ala Pro Ala His 415 420
425ctg gtg gcg acg gct ggg ggt ggc tcc acg gtc atc gcc cac aca gcc
1587Leu Val Ala Thr Ala Gly Gly Gly Ser Thr Val Ile Ala His Thr
Ala430 435 440 445acc act cac gct tca gtc atc cag act gtg aac cac
gtt ctg cag ggg 1635Thr Thr His Ala Ser Val Ile Gln Thr Val Asn His
Val Leu Gln Gly 450 455 460cca ggc ggc aag cac atc gcc cac atc gcc
ccc tcg gcc ccc agc cct 1683Pro Gly Gly Lys His Ile Ala His Ile Ala
Pro Ser Ala Pro Ser Pro 465 470 475gcg gtg caa ctg gcg cct gcc aca
ccc ccc att ggg cac atc act gtg 1731Ala Val Gln Leu Ala Pro Ala Thr
Pro Pro Ile Gly His Ile Thr Val 480 485 490cac cct gcc acc ctc aac
cat gtg gcc cac ctg ggc tcc cag ctg ccc 1779His Pro Ala Thr Leu Asn
His Val Ala His Leu Gly Ser Gln Leu Pro 495 500 505ttg tac ccg cag
ccc gtg gca gtg agc cac atc gcc cac acc ctc tcg 1827Leu Tyr Pro Gln
Pro Val Ala Val Ser His Ile Ala His Thr Leu Ser510 515 520 525cac
cag caa gtc aac ggc acg gcc ggc ctg ggg ccc ccg gct act gtc 1875His
Gln Gln Val Asn Gly Thr Ala Gly Leu Gly Pro Pro Ala Thr Val 530 535
540atg gca aag ccg gcc gtg ggg gct cag gtg gtg cac cac ccc cag ctg
1923Met Ala Lys Pro Ala Val Gly Ala Gln Val Val His His Pro Gln Leu
545 550 555gtg ggc cag acc gtg ctc aac cct gtg acc atg gtc acc atg
ccc tcc 1971Val Gly Gln Thr Val Leu Asn Pro Val Thr Met Val Thr Met
Pro Ser 560 565 570ttc cca gtc agc aca ctc aag ctg gct tga
ggacgaggcc actcagaggc 2021Phe Pro Val Ser Thr Leu Lys Leu Ala 575
580ccccagtggg gacagggagg gggacctgtc ccccactctc tcacccacca
gctccacaca 2081ttccagccag gcccaggcca gcccccccac ccacccccag
gcctcctagg ggaagggggt 2141gcaaagactc tgagccaagg gagggaaggg
ccaccctgct gcactaggac ttggtaagat 2201gactctgaga aaatgcgaga
ctctgatgga atgtgccacc tgtccggccc agtgccagct 2261ccagtgccgc
tcctgcttcc cctccctacc ctcggaaatc agtgcgatgt ggacgtcacg
2321ctccctgact tctcccccgc cctgccccgc cttcgtgtgc tgctgctgct
attgctgtct 2381ggtgaggtgg cccaggcccc cggctttcct ccggagcctc
atgttctctt cccaggcctt 2441tggaggggaa atggggaaag cagaactgaa
gccacttggc ccagaaagct gcggattggg 2501gtgataaggg gccttgctct
gagcacaggt gacagatcat aggaagtggc tggtctggag 2561tcccacccgg
acaggtgggg cctcagcctg gggctctctg acccggttgc agtcactgtg
2621attcgttacc gtagatacta cttaaaatga ttctctacca acaataaacc
aaacccagcc 2681actgccaagc ttcctgtgcc ctcaccccaa tccctgccac
tgggctctgg acctcaggag 2741ggcaggctga ggtggggaag gagggacttg
gctgtccttc cccttccccg tcccctgcag 2801cctgggtctg gatgggagga
gagccactgg gcccctgtcc ccagtcccca gtccccagcc 2861ctgggcttgg
ctcttggctt ccagaaggca gcaaagaggg gcgctgtcct gcgttcagcc
2921cctgatctct gacctctgct gagtgctggg cactgctcca agggacaggt
gggcctggcg 2981gcctgtgggt ttgggtgcct cctgcagttt gggagacatg
gaccagcatc tggtcttgtt 3041tccaggagca tagaagccac atcgttgaga
catcaggaag gtaaaaaccc agcggcttag 3101ccaagcccta agcctgtccc
cagaccaacc ctgggaccta tacagaacag agggccagag 3161ctagggctgc
tgcttctgct ccagcccctt tgcctctgtc ctcccatccc ctcaacaccc
3221tgcttctccc ggggacgctt ttgagtgggc cctgcccggg gagctgcaga
gcagcagcac 3281ctttctctga gaagaggtcc ttggttgggt caaggacagg
gctgagcgtg gaagggggag 3341gagtcagggg ctctgtgtta ggatgcggct
ttctctgcct ctgggcagcc tgctttggcc 3401tttccttgta tgtgggtgtt
tattacaagt ggctttgtgt cagacacgct cggctcccca 3461cctggacaca
cactcaccag tggcctttca gtgtagcggg aggaagccgg tgtccctgga
3521tgtgaagctc acactgatgg gctggggcag gggcctgggc cggcgagggg
gccgggggga 3581ggggacagag ctgaggattt cctggagtgc cctgcaggca
cagaggaggt cagcaaaggt 3641cttgaataga ttttctctgg aaataaagaa
tccttagatg cctaaaaatt cccttcctgt 3701tccctcctgg tcctggacac
ctcccagggg actgttcctt atttctctct cctggtgtgg 3761gtaaagggac
agttacaaac caggtcacca tcctcagagg ctgagccctg tacccacccc
3821agcacagcca cctccgccag accccgtggc tctgggagag ccagctttgc
tattcccatt 3881gtgacagcga tggcaggcct gacccacggg gcagttagag
cagcctcgtg gagctcgccc 3941ctcccctcag cctgcccacc tctccctgca
tcctgaggcc agtggccccc gggcctgcac 4001agatacctca tcatccaccc
gctgcccctc cccgtccctg tcccccagca tcgggggcct 4061gcaaatctag
tgccgaatga ctatgtccag attggtgacg atgggtgttg ctgtttttct
4121tgtcgtttgt gaacgctgtg atgctgtgtg cccaagtggg cagtcaccac
ccagcccttc 4181cttgggcgtc tcccccagag tgctgtcggg accacatctg
tcctcaccct gtgggaccgc 4241ctggccctcc ctccctagcc cttccagcct
gggacacaca cacacacaca cacacacaca 4301cacgcacgca cacgcacaca
tcttacctct catgcgtgtt ttaccttttg atgttcagag 4361tggctcactg
gctgggagtc cttacctcgg ggagaggggg aggttggttc cttggggggc
4421caaagaaggc agggaatgcc tggagggtaa ctggggggcc accatgaccc
cttctctctc 4481cagaaacagc tgcttctccc cccatcccag ggtcccaccc
ccaaccccca gaggtggccc 4541ttgtttacag tgaggactcg gccactgtgt
ctctgtttcc tgaaatataa actgtagcga 4601ccccagactg tagagatttt
tatgtgtttg gatacatctg ctgtgtggaa aaaaaaaaaa 4661actacaaaaa
ccctaatttt gtacatactg tatttttact attgaactgt attctagtgg
4721ctgttcatgc tccaagactt tagttaccga gacatgaata ctatccatgt
aataagcact 4781tgcctggaat aaaatataaa actgaaataa acctgcactg
aaacctgaga tggagctgcc 4841aaaaaaaaaa aaaaaaaaaa aaaa
486530582PRTHomo sapiens 30Met Ser Ile Glu Thr Leu Leu Glu Ala Ala
Arg Phe Leu Glu Trp Gln1 5 10 15Ala Gln Gln Gln Gln Arg Ala Arg Glu
Glu Gln Glu Arg Leu Arg Leu 20 25 30Glu Gln Glu Arg Glu Gln Glu Gln
Lys Lys Ala Asn Ser Leu Ala Arg 35 40 45Leu Ala His Thr Leu Pro Val
Glu Glu Pro Arg Met Glu Ala Pro Pro 50 55 60Leu Pro Leu Ser Pro Pro
Ala Pro Pro Pro Ala Pro Pro Pro Pro Leu65 70 75 80Ala Thr Pro Ala
Pro Leu Thr Val Ile Pro Ile Pro Val Val Thr Asn 85 90 95Ser Pro Gln
Pro Leu Pro Pro Pro Pro Pro Leu Pro Ala Ala Ala Gln 100 105 110Pro
Leu Pro Leu Ala Pro Arg Gln Pro Ala Leu Val Gly Ala Pro Gly 115 120
125Leu Ser Ile Lys Glu Pro Ala Pro Leu Pro Ser Arg Pro Gln Val Pro
130 135 140Thr Pro Ala Pro Leu Leu Pro Asp Ser Lys Ala Thr Ile Pro
Pro Asn145 150 155 160Gly Ser Pro Lys Pro Leu Gln Pro Leu Pro Thr
Pro Val Leu Thr Ile 165 170 175Ala Pro His Pro Gly Val Gln Pro Gln
Leu Ala Pro Gln Gln Pro Pro 180 185 190Pro Pro Thr Leu Gly Thr Leu
Lys Leu Ala Pro Ala Glu Glu Val Lys 195 200 205Ser Ser Glu Gln Lys
Lys Arg Pro Gly Gly Ile Gly Thr Arg Glu Val 210 215 220His Asn Lys
Leu Glu Lys Asn Arg Arg Ala His Leu Lys Glu Cys Phe225 230 235
240Glu Thr Leu Lys Arg Asn Ile Pro Asn Val Asp Asp Lys Lys Thr Ser
245 250 255Asn Leu Ser Val Leu Arg Thr Ala Leu Arg Tyr Ile Gln Ser
Leu Lys 260 265 270Arg Lys Glu Lys Glu Tyr Glu His Glu Met Glu Arg
Leu Ala Arg Glu 275 280 285Lys Ile Ala Thr Gln Gln Arg Leu Ala Glu
Leu Lys His Glu Leu Ser 290 295 300Gln Trp Met Asp Val Leu Glu Ile
Asp Arg Val Leu Arg Gln Thr Gly305 310 315 320Gln Pro Glu Asp Asp
Gln Ala Ser Thr Ser Thr Ala Ser Glu Gly Glu 325 330 335Asp Asn Ile
Asp Glu Asp Met Glu Glu Asp Arg Ala Gly Leu Gly Pro 340 345 350Pro
Lys Leu Ser His Arg Pro Gln Pro Glu Leu Leu Lys Ser Thr Leu 355 360
365Pro Pro Pro Ser Thr Thr Pro Ala Pro Leu Pro Pro His Pro His Pro
370 375 380His Pro His Ser Val Ala Leu Pro Pro Ala His Leu Pro Val
Gln Gln385 390 395 400Gln Gln Pro Gln Gln Lys Thr Pro Leu Pro Ala
Pro Pro Pro Pro Pro 405 410 415Ala Ala Pro Ala Gln Thr Leu Val Pro
Ala Pro Ala His Leu Val Ala 420 425 430Thr Ala Gly Gly Gly Ser Thr
Val Ile Ala His Thr Ala Thr Thr His 435 440 445Ala Ser Val Ile Gln
Thr Val Asn His Val Leu Gln Gly Pro Gly Gly 450 455 460Lys His Ile
Ala His Ile Ala Pro Ser Ala Pro Ser Pro Ala Val Gln465 470 475
480Leu Ala Pro Ala Thr Pro Pro Ile Gly His Ile Thr Val His Pro Ala
485 490 495Thr Leu Asn His Val Ala His Leu Gly Ser Gln Leu Pro Leu
Tyr Pro 500 505 510Gln Pro Val Ala Val Ser His Ile Ala His Thr Leu
Ser His Gln Gln 515 520 525Val Asn Gly Thr Ala Gly Leu Gly Pro Pro
Ala Thr Val Met Ala Lys 530 535 540Pro Ala Val Gly Ala Gln Val Val
His His Pro Gln Leu Val Gly Gln545 550 555 560Thr Val Leu Asn Pro
Val Thr Met Val Thr Met Pro Ser Phe Pro Val 565 570 575Ser Thr Leu
Lys Leu Ala 58031826PRTHomo sapiens 31Met Glu Gly Ala Gly Gly Ala
Asn Asp Lys Lys Lys Ile Ser Ser Glu1 5 10 15Arg Arg Lys Glu Lys Ser
Arg Asp Ala Ala Arg Ser Arg Arg Ser Lys 20 25 30Glu Ser Glu Val Phe
Tyr Glu Leu Ala His Gln Leu Pro Leu Pro His 35 40 45Asn Val Ser Ser
His Leu Asp Lys Ala Ser Val Met Arg Leu Thr Ile 50 55 60Ser Tyr Leu
Arg Val Arg Lys Leu Leu Asp Ala Gly Asp Leu Asp Ile65 70 75 80Glu
Asp Asp Met Lys Ala Gln Met Asn Cys Phe Tyr Leu Lys Ala Leu 85 90
95Asp Gly Phe Val Met Val Leu Thr Asp Asp Gly Asp Met Ile Tyr Ile
100 105 110Ser Asp Asn Val Asn Lys Tyr Met Gly Leu Thr Gln Phe Glu
Leu Thr 115 120 125Gly His Ser Val Phe Asp Phe Thr His Pro Cys Asp
His Glu Glu Met 130 135 140Arg Glu Met Leu Thr His Arg Asn Gly Leu
Val Lys Lys Gly Lys Glu145 150 155 160Gln Asn Thr Gln Arg Ser Phe
Phe Leu Arg Met Lys Cys Thr Leu Thr 165 170 175Ser Arg Gly Arg Thr
Met Asn Ile Lys Ser Ala Thr Trp Lys Val Leu 180 185 190His Cys Thr
Gly His Ile His Val Tyr Asp Thr Asn Ser Asn Gln Pro 195 200 205Gln
Cys Gly Tyr Lys Lys Pro Pro Met Thr Cys Leu Val Leu Ile Cys 210 215
220Glu Pro Ile Pro His Pro Ser Asn Ile Glu Ile Pro Leu Asp Ser
Lys225 230 235 240Thr Phe Leu Ser Arg His Ser Leu Asp Met Lys Phe
Ser Tyr Cys Asp 245 250 255Glu Arg Ile Thr Glu Leu Met Gly Tyr Glu
Pro Glu Glu Leu Leu Gly 260 265 270Arg Ser Ile Tyr Glu Tyr Tyr His
Ala Leu Asp Ser Asp His Leu Thr 275 280 285Lys Thr His His Asp Met
Phe Thr Lys Gly Gln Val Thr Thr Gly Gln 290 295 300Tyr Arg Met Leu
Ala Lys Arg Gly Gly Tyr Val Trp Val Glu Thr Gln305 310 315 320Ala
Thr Val Ile Tyr Asn Thr Lys Asn Ser Gln Pro Gln Cys Ile Val 325 330
335Cys Val Asn Tyr Val Val Ser Gly Ile Ile Gln His Asp Leu Ile Phe
340 345 350Ser Leu Gln Gln Thr Glu Cys Val Leu Lys Pro Val Glu Ser
Ser Asp 355 360 365Met Lys Met Thr Gln Leu Phe Thr Lys Val Glu Ser
Glu Asp Thr Ser 370 375 380Ser Leu Phe Asp Lys Leu Lys Lys Glu Pro
Asp Ala Leu Thr Leu Leu385 390 395 400Ala Pro Ala Ala Gly Asp Thr
Ile Ile Ser Leu Asp Phe Gly Ser Asn 405 410 415Asp Thr Glu Thr Asp
Asp Gln Gln Leu Glu Glu Val Pro Leu Tyr Asn 420 425 430Asp Val Met
Leu Pro Ser Pro Asn Glu Lys Leu Gln Asn Ile Asn Leu 435 440 445Ala
Met Ser Pro Leu Pro Thr Ala Glu Thr Pro Lys Pro Leu Arg Ser 450 455
460Ser Ala Asp Pro Ala Leu Asn Gln Glu Val Ala Leu Lys Leu Glu
Pro465 470 475 480Asn Pro Glu Ser Leu Glu Leu Ser Phe Thr Met Pro
Gln Ile Gln Asp 485 490 495Gln Thr Pro Ser Pro Ser Asp Gly Ser Thr
Arg Gln Ser Ser Pro Glu 500 505 510Pro Asn Ser Pro Ser Glu Tyr Cys
Phe Tyr Val Asp Ser Asp Met Val 515 520 525Asn Glu Phe Lys Leu Glu
Leu Val Glu Lys Leu Phe Ala Glu Asp Thr 530 535 540Glu Ala Lys Asn
Pro
Phe Ser Thr Gln Asp Thr Asp Leu Asp Leu Glu545 550 555 560Met Leu
Ala Pro Tyr Ile Pro Met Asp Asp Asp Phe Gln Leu Arg Ser 565 570
575Phe Asp Gln Leu Ser Pro Leu Glu Ser Ser Ser Ala Ser Pro Glu Ser
580 585 590Ala Ser Pro Gln Ser Thr Val Thr Val Phe Gln Gln Thr Gln
Ile Gln 595 600 605Glu Pro Thr Ala Asn Ala Thr Thr Thr Thr Ala Thr
Thr Asp Glu Leu 610 615 620Lys Thr Val Thr Lys Asp Arg Met Glu Asp
Ile Lys Ile Leu Ile Ala625 630 635 640Ser Pro Ser Pro Thr His Ile
His Lys Glu Thr Thr Ser Ala Thr Ser 645 650 655Ser Pro Tyr Arg Asp
Thr Gln Ser Arg Thr Ala Ser Pro Asn Arg Ala 660 665 670Gly Lys Gly
Val Ile Glu Gln Thr Glu Lys Ser His Pro Arg Ser Pro 675 680 685Asn
Val Leu Ser Val Ala Leu Ser Gln Arg Thr Thr Val Pro Glu Glu 690 695
700Glu Leu Asn Pro Lys Ile Leu Ala Leu Gln Asn Ala Gln Arg Lys
Arg705 710 715 720Lys Met Glu His Asp Gly Ser Leu Phe Gln Ala Val
Gly Ile Gly Thr 725 730 735Leu Leu Gln Gln Pro Asp Asp His Ala Ala
Thr Thr Ser Leu Ser Trp 740 745 750Lys Arg Val Lys Gly Cys Lys Ser
Ser Glu Gln Asn Gly Met Glu Gln 755 760 765Lys Thr Ile Ile Leu Ile
Pro Ser Asp Leu Ala Cys Arg Leu Leu Gly 770 775 780Gln Ser Met Asp
Glu Ser Gly Leu Pro Gln Leu Thr Ser Tyr Asp Cys785 790 795 800Glu
Val Asn Ala Pro Ile Gln Gly Ser Arg Asn Leu Leu Gln Gly Glu 805 810
815Glu Leu Leu Arg Ala Leu Asp Gln Val Asn 820 82532735PRTHomo
sapiens 32Met Glu Gly Ala Gly Gly Ala Asn Asp Lys Lys Lys Ile Ser
Ser Glu1 5 10 15Arg Arg Lys Glu Lys Ser Arg Asp Ala Ala Arg Ser Arg
Arg Ser Lys 20 25 30Glu Ser Glu Val Phe Tyr Glu Leu Ala His Gln Leu
Pro Leu Pro His 35 40 45Asn Val Ser Ser His Leu Asp Lys Ala Ser Val
Met Arg Leu Thr Ile 50 55 60Ser Tyr Leu Arg Val Arg Lys Leu Leu Asp
Ala Gly Asp Leu Asp Ile65 70 75 80Glu Asp Asp Met Lys Ala Gln Met
Asn Cys Phe Tyr Leu Lys Ala Leu 85 90 95Asp Gly Phe Val Met Val Leu
Thr Asp Asp Gly Asp Met Ile Tyr Ile 100 105 110Ser Asp Asn Val Asn
Lys Tyr Met Gly Leu Thr Gln Phe Glu Leu Thr 115 120 125Gly His Ser
Val Phe Asp Phe Thr His Pro Cys Asp His Glu Glu Met 130 135 140Arg
Glu Met Leu Thr His Arg Asn Gly Leu Val Lys Lys Gly Lys Glu145 150
155 160Gln Asn Thr Gln Arg Ser Phe Phe Leu Arg Met Lys Cys Thr Leu
Thr 165 170 175Ser Arg Gly Arg Thr Met Asn Ile Lys Ser Ala Thr Trp
Lys Val Leu 180 185 190His Cys Thr Gly His Ile His Val Tyr Asp Thr
Asn Ser Asn Gln Pro 195 200 205Gln Cys Gly Tyr Lys Lys Pro Pro Met
Thr Cys Leu Val Leu Ile Cys 210 215 220Glu Pro Ile Pro His Pro Ser
Asn Ile Glu Ile Pro Leu Asp Ser Lys225 230 235 240Thr Phe Leu Ser
Arg His Ser Leu Asp Met Lys Phe Ser Tyr Cys Asp 245 250 255Glu Arg
Ile Thr Glu Leu Met Gly Tyr Glu Pro Glu Glu Leu Leu Gly 260 265
270Arg Ser Ile Tyr Glu Tyr Tyr His Ala Leu Asp Ser Asp His Leu Thr
275 280 285Lys Thr His His Asp Met Phe Thr Lys Gly Gln Val Thr Thr
Gly Gln 290 295 300Tyr Arg Met Leu Ala Lys Arg Gly Gly Tyr Val Trp
Val Glu Thr Gln305 310 315 320Ala Thr Val Ile Tyr Asn Thr Lys Asn
Ser Gln Pro Gln Cys Ile Val 325 330 335Cys Val Asn Tyr Val Val Ser
Gly Ile Ile Gln His Asp Leu Ile Phe 340 345 350Ser Leu Gln Gln Thr
Glu Cys Val Leu Lys Pro Val Glu Ser Ser Asp 355 360 365Met Lys Met
Thr Gln Leu Phe Thr Lys Val Glu Ser Glu Asp Thr Ser 370 375 380Ser
Leu Phe Asp Lys Leu Lys Lys Glu Pro Asp Ala Leu Thr Leu Leu385 390
395 400Ala Pro Ala Ala Gly Asp Thr Ile Ile Ser Leu Asp Phe Gly Ser
Asn 405 410 415Asp Thr Glu Thr Asp Asp Gln Gln Leu Glu Glu Val Pro
Leu Tyr Asn 420 425 430Asp Val Met Leu Pro Ser Pro Asn Glu Lys Leu
Gln Asn Ile Asn Leu 435 440 445Ala Met Ser Pro Leu Pro Thr Ala Glu
Thr Pro Lys Pro Leu Arg Ser 450 455 460Ser Ala Asp Pro Ala Leu Asn
Gln Glu Val Ala Leu Lys Leu Glu Pro465 470 475 480Asn Pro Glu Ser
Leu Glu Leu Ser Phe Thr Met Pro Gln Ile Gln Asp 485 490 495Gln Thr
Pro Ser Pro Ser Asp Gly Ser Thr Arg Gln Ser Ser Pro Glu 500 505
510Pro Asn Ser Pro Ser Glu Tyr Cys Phe Tyr Val Asp Ser Asp Met Val
515 520 525Asn Glu Phe Lys Leu Glu Leu Val Glu Lys Leu Phe Ala Glu
Asp Thr 530 535 540Glu Ala Lys Asn Pro Phe Ser Thr Gln Asp Thr Asp
Leu Asp Leu Glu545 550 555 560Met Leu Ala Pro Tyr Ile Pro Met Asp
Asp Asp Phe Gln Leu Arg Ser 565 570 575Phe Asp Gln Leu Ser Pro Leu
Glu Ser Ser Ser Ala Ser Pro Glu Ser 580 585 590Ala Ser Pro Gln Ser
Thr Val Thr Val Phe Gln Gln Thr Gln Ile Gln 595 600 605Glu Pro Thr
Ala Asn Ala Thr Thr Thr Thr Ala Thr Thr Asp Glu Leu 610 615 620Lys
Thr Val Thr Lys Asp Arg Met Glu Asp Ile Lys Ile Leu Ile Ala625 630
635 640Ser Pro Ser Pro Thr His Ile His Lys Glu Thr Thr Ser Ala Thr
Ser 645 650 655Ser Pro Tyr Arg Asp Thr Gln Ser Arg Thr Ala Ser Pro
Asn Arg Ala 660 665 670Gly Lys Gly Val Ile Glu Gln Thr Glu Lys Ser
His Pro Arg Ser Pro 675 680 685Asn Val Leu Ser Val Ala Leu Ser Gln
Arg Thr Thr Val Pro Glu Glu 690 695 700Glu Leu Asn Pro Lys Ile Leu
Ala Leu Gln Asn Ala Gln Arg Lys Arg705 710 715 720Lys Met Glu His
Asp Gly Ser Leu Phe Gln Ala Val Gly Ile Ile 725 730 73533789PRTHomo
sapiens 33Met Ala Ala Thr Thr Ala Asn Pro Glu Met Thr Ser Asp Val
Pro Ser1 5 10 15Leu Gly Pro Ala Ile Ala Ser Gly Asn Ser Gly Pro Gly
Ile Gln Gly 20 25 30Gly Gly Ala Ile Val Gln Arg Ala Ile Lys Arg Arg
Pro Gly Leu Asp 35 40 45Phe Asp Asp Asp Gly Glu Gly Asn Ser Lys Phe
Leu Arg Cys Asp Asp 50 55 60Asp Gln Met Ser Asn Asp Lys Glu Arg Phe
Ala Arg Ser Asp Asp Glu65 70 75 80Gln Ser Ser Ala Asp Lys Glu Arg
Leu Ala Arg Glu Asn His Ser Glu 85 90 95Ile Glu Arg Arg Arg Arg Asn
Lys Met Thr Ala Tyr Ile Thr Glu Leu 100 105 110Ser Asp Met Val Pro
Thr Cys Ser Ala Leu Ala Arg Lys Pro Asp Lys 115 120 125Leu Thr Ile
Leu Arg Met Ala Val Ser His Met Lys Ser Leu Arg Gly 130 135 140Thr
Gly Asn Thr Ser Thr Asp Gly Ser Tyr Lys Pro Ser Phe Leu Thr145 150
155 160Asp Gln Glu Leu Lys His Leu Ile Leu Glu Ala Ala Asp Gly Phe
Leu 165 170 175Phe Ile Val Ser Cys Glu Thr Gly Arg Val Val Tyr Val
Ser Asp Ser 180 185 190Val Thr Pro Val Leu Asn Gln Pro Gln Ser Glu
Trp Phe Gly Ser Thr 195 200 205Leu Tyr Asp Gln Val His Pro Asp Asp
Val Asp Lys Leu Arg Glu Gln 210 215 220Leu Ser Thr Ser Glu Asn Ala
Leu Thr Gly Arg Ile Leu Asp Leu Lys225 230 235 240Thr Gly Thr Val
Lys Lys Glu Gly Gln Gln Ser Ser Met Arg Met Cys 245 250 255Met Gly
Ser Arg Arg Ser Phe Ile Cys Arg Met Arg Cys Gly Ser Ser 260 265
270Ser Val Asp Pro Val Ser Val Asn Arg Leu Ser Phe Val Arg Asn Arg
275 280 285Cys Arg Asn Gly Leu Gly Ser Val Lys Asp Gly Glu Pro His
Phe Val 290 295 300Val Val His Cys Thr Gly Tyr Ile Lys Ala Trp Pro
Pro Ala Gly Val305 310 315 320Ser Leu Pro Asp Asp Asp Pro Glu Ala
Gly Gln Gly Ser Lys Phe Cys 325 330 335Leu Val Ala Ile Gly Arg Leu
Gln Val Thr Ser Ser Pro Asn Cys Thr 340 345 350Asp Met Ser Asn Val
Cys Gln Pro Thr Glu Phe Ile Ser Arg His Asn 355 360 365Ile Glu Gly
Ile Phe Thr Phe Val Asp His Arg Cys Val Ala Thr Val 370 375 380Gly
Tyr Gln Pro Gln Glu Leu Leu Gly Lys Asn Ile Val Glu Phe Cys385 390
395 400His Pro Glu Asp Gln Gln Leu Leu Arg Asp Ser Phe Gln Gln Val
Val 405 410 415Lys Leu Lys Gly Gln Val Leu Ser Val Met Phe Arg Phe
Arg Ser Lys 420 425 430Asn Gln Glu Trp Leu Trp Met Arg Thr Ser Ser
Phe Thr Phe Gln Asn 435 440 445Pro Tyr Ser Asp Glu Ile Glu Tyr Ile
Ile Cys Thr Asn Thr Asn Val 450 455 460Lys Asn Ser Ser Gln Glu Pro
Arg Pro Thr Leu Ser Asn Thr Ile Gln465 470 475 480Arg Pro Gln Leu
Gly Pro Thr Ala Asn Leu Pro Leu Glu Met Gly Ser 485 490 495Gly Gln
Leu Ala Pro Arg Gln Gln Gln Gln Gln Thr Glu Leu Asp Met 500 505
510Val Pro Gly Arg Asp Gly Leu Ala Ser Tyr Asn His Ser Gln Val Val
515 520 525Gln Pro Val Thr Thr Thr Gly Pro Glu His Ser Lys Pro Leu
Glu Lys 530 535 540Ser Asp Gly Leu Phe Ala Gln Asp Arg Asp Pro Arg
Phe Ser Glu Ile545 550 555 560Tyr His Asn Ile Asn Ala Asp Gln Ser
Lys Gly Ile Ser Ser Ser Thr 565 570 575Val Pro Ala Thr Gln Gln Leu
Phe Ser Gln Gly Asn Thr Phe Pro Pro 580 585 590Thr Pro Arg Pro Ala
Glu Asn Phe Arg Asn Ser Gly Leu Ala Pro Pro 595 600 605Val Thr Ile
Val Gln Pro Ser Ala Ser Ala Gly Gln Met Leu Ala Gln 610 615 620Ile
Ser Arg His Ser Asn Pro Thr Gln Gly Ala Thr Pro Thr Trp Thr625 630
635 640Pro Thr Thr Arg Ser Gly Phe Ser Ala Gln Gln Val Ala Thr Gln
Ala 645 650 655Thr Ala Lys Thr Arg Thr Ser Gln Phe Gly Val Gly Ser
Phe Gln Thr 660 665 670Pro Ser Ser Phe Ser Ser Met Ser Leu Pro Gly
Ala Pro Thr Ala Ser 675 680 685Pro Gly Ala Ala Ala Tyr Pro Ser Leu
Thr Asn Arg Gly Ser Asn Phe 690 695 700Ala Pro Glu Thr Gly Gln Thr
Ala Gly Gln Phe Gln Thr Arg Thr Ala705 710 715 720Glu Gly Val Gly
Val Trp Pro Gln Trp Gln Gly Gln Gln Pro His His 725 730 735Arg Ser
Ser Ser Ser Glu Gln His Val Gln Gln Pro Pro Ala Gln Gln 740 745
750Pro Gly Gln Pro Glu Val Phe Gln Glu Met Leu Ser Met Leu Gly Asp
755 760 765Gln Ser Asn Ser Tyr Asn Asn Glu Glu Phe Pro Asp Leu Thr
Met Phe 770 775 780Pro Pro Phe Ser Glu78534328PRTHomo sapiens 34Met
Ala Ala Thr Thr Ala Asn Pro Glu Met Thr Ser Asp Val Pro Ser1 5 10
15Leu Gly Pro Ala Ile Ala Ser Gly Asn Ser Gly Pro Gly Ile Gln Gly
20 25 30Gly Gly Ala Ile Val Gln Arg Ala Ile Lys Arg Arg Pro Gly Leu
Asp 35 40 45Phe Asp Asp Asp Gly Glu Gly Asn Ser Lys Phe Leu Arg Cys
Asp Asp 50 55 60Asp Gln Met Ser Asn Asp Lys Glu Arg Phe Ala Arg Ser
Asp Asp Glu65 70 75 80Gln Ser Ser Ala Asp Lys Glu Arg Leu Ala Arg
Glu Asn His Ser Glu 85 90 95Ile Glu Arg Arg Arg Arg Asn Lys Met Thr
Ala Tyr Ile Thr Glu Leu 100 105 110Ser Asp Met Val Pro Thr Cys Ser
Ala Leu Ala Arg Lys Pro Asp Lys 115 120 125Leu Thr Ile Leu Arg Met
Ala Val Ser His Met Lys Ser Leu Arg Gly 130 135 140Thr Gly Asn Thr
Ser Thr Asp Gly Ser Tyr Lys Pro Ser Phe Leu Thr145 150 155 160Asp
Gln Glu Leu Lys His Leu Ile Leu Glu Ala Ala Asp Gly Phe Leu 165 170
175Phe Ile Val Ser Cys Glu Thr Gly Arg Val Val Tyr Val Ser Asp Ser
180 185 190Val Thr Pro Val Leu Asn Gln Pro Gln Ser Glu Trp Phe Gly
Ser Thr 195 200 205Leu Tyr Asp Gln Val His Pro Asp Asp Val Asp Lys
Leu Arg Glu Gln 210 215 220Leu Ser Thr Ser Glu Asn Ala Leu Thr Gly
Arg Ile Leu Asp Leu Lys225 230 235 240Thr Gly Thr Val Lys Lys Glu
Gly Gln Gln Ser Ser Met Arg Met Cys 245 250 255Met Gly Ser Arg Arg
Ser Phe Ile Cys Arg Met Arg Cys Gly Ser Ser 260 265 270Ser Val Asp
Pro Val Ser Val Asn Arg Leu Ser Phe Val Arg Asn Arg 275 280 285Cys
Arg Asn Gly Leu Gly Ser Val Lys Asp Gly Glu Pro His Phe Val 290 295
300Val Val His Cys Thr Gly Tyr Ile Lys Ala Trp Pro Pro Ala Gly
Val305 310 315 320Ser Leu Pro Asp Asp Asp Pro Ala 32535774PRTHomo
sapiens 35Met Ala Ala Thr Thr Ala Asn Pro Glu Met Thr Ser Asp Val
Pro Ser1 5 10 15Leu Gly Pro Ala Ile Ala Ser Gly Asn Ser Gly Pro Gly
Ile Gln Gly 20 25 30Gly Gly Ala Ile Val Gln Arg Ala Ile Lys Arg Arg
Pro Gly Leu Asp 35 40 45Phe Asp Asp Asp Gly Glu Gly Asn Ser Lys Phe
Leu Arg Cys Asp Asp 50 55 60Asp Gln Met Ser Asn Asp Lys Glu Arg Phe
Ala Arg Glu Asn His Ser65 70 75 80Glu Ile Glu Arg Arg Arg Arg Asn
Lys Met Thr Ala Tyr Ile Thr Glu 85 90 95Leu Ser Asp Met Val Pro Thr
Cys Ser Ala Leu Ala Arg Lys Pro Asp 100 105 110Lys Leu Thr Ile Leu
Arg Met Ala Val Ser His Met Lys Ser Leu Arg 115 120 125Gly Thr Gly
Asn Thr Ser Thr Asp Gly Ser Tyr Lys Pro Ser Phe Leu 130 135 140Thr
Asp Gln Glu Leu Lys His Leu Ile Leu Glu Ala Ala Asp Gly Phe145 150
155 160Leu Phe Ile Val Ser Cys Glu Thr Gly Arg Val Val Tyr Val Ser
Asp 165 170 175Ser Val Thr Pro Val Leu Asn Gln Pro Gln Ser Glu Trp
Phe Gly Ser 180 185 190Thr Leu Tyr Asp Gln Val His Pro Asp Asp Val
Asp Lys Leu Arg Glu 195 200 205Gln Leu Ser Thr Ser Glu Asn Ala Leu
Thr Gly Arg Ile Leu Asp Leu 210 215 220Lys Thr Gly Thr Val Lys Lys
Glu Gly Gln Gln Ser Ser Met Arg Met225 230 235 240Cys Met Gly Ser
Arg Arg Ser Phe Ile Cys Arg Met Arg Cys Gly Ser 245 250 255Ser Ser
Val Asp Pro Val Ser Val Asn Arg Leu Ser Phe Val Arg Asn 260 265
270Arg Cys Arg Asn Gly Leu Gly Ser Val Lys Asp Gly Glu Pro His Phe
275 280 285Val Val Val His Cys Thr Gly Tyr Ile Lys Ala Trp Pro Pro
Ala Gly 290 295 300Val Ser Leu Pro Asp Asp Asp Pro Glu Ala Gly Gln
Gly Ser Lys Phe305 310 315 320Cys Leu Val Ala Ile Gly Arg Leu Gln
Val Thr Ser Ser Pro Asn Cys 325
330 335Thr Asp Met Ser Asn Val Cys Gln Pro Thr Glu Phe Ile Ser Arg
His 340 345 350Asn Ile Glu Gly Ile Phe Thr Phe Val Asp His Arg Cys
Val Ala Thr 355 360 365Val Gly Tyr Gln Pro Gln Glu Leu Leu Gly Lys
Asn Ile Val Glu Phe 370 375 380Cys His Pro Glu Asp Gln Gln Leu Leu
Arg Asp Ser Phe Gln Gln Val385 390 395 400Val Lys Leu Lys Gly Gln
Val Leu Ser Val Met Phe Arg Phe Arg Ser 405 410 415Lys Asn Gln Glu
Trp Leu Trp Met Arg Thr Ser Ser Phe Thr Phe Gln 420 425 430Asn Pro
Tyr Ser Asp Glu Ile Glu Tyr Ile Ile Cys Thr Asn Thr Asn 435 440
445Val Lys Asn Ser Ser Gln Glu Pro Arg Pro Thr Leu Ser Asn Thr Ile
450 455 460Gln Arg Pro Gln Leu Gly Pro Thr Ala Asn Leu Pro Leu Glu
Met Gly465 470 475 480Ser Gly Gln Leu Ala Pro Arg Gln Gln Gln Gln
Gln Thr Glu Leu Asp 485 490 495Met Val Pro Gly Arg Asp Gly Leu Ala
Ser Tyr Asn His Ser Gln Val 500 505 510Val Gln Pro Val Thr Thr Thr
Gly Pro Glu His Ser Lys Pro Leu Glu 515 520 525Lys Ser Asp Gly Leu
Phe Ala Gln Asp Arg Asp Pro Arg Phe Ser Glu 530 535 540Ile Tyr His
Asn Ile Asn Ala Asp Gln Ser Lys Gly Ile Ser Ser Ser545 550 555
560Thr Val Pro Ala Thr Gln Gln Leu Phe Ser Gln Gly Asn Thr Phe Pro
565 570 575Pro Thr Pro Arg Pro Ala Glu Asn Phe Arg Asn Ser Gly Leu
Ala Pro 580 585 590Pro Val Thr Ile Val Gln Pro Ser Ala Ser Ala Gly
Gln Met Leu Ala 595 600 605Gln Ile Ser Arg His Ser Asn Pro Thr Gln
Gly Ala Thr Pro Thr Trp 610 615 620Thr Pro Thr Thr Arg Ser Gly Phe
Ser Ala Gln Gln Val Ala Thr Gln625 630 635 640Ala Thr Ala Lys Thr
Arg Thr Ser Gln Phe Gly Val Gly Ser Phe Gln 645 650 655Thr Pro Ser
Ser Phe Ser Ser Met Ser Leu Pro Gly Ala Pro Thr Ala 660 665 670Ser
Pro Gly Ala Ala Ala Tyr Pro Ser Leu Thr Asn Arg Gly Ser Asn 675 680
685Phe Ala Pro Glu Thr Gly Gln Thr Ala Gly Gln Phe Gln Thr Arg Thr
690 695 700Ala Glu Gly Val Gly Val Trp Pro Gln Trp Gln Gly Gln Gln
Pro His705 710 715 720His Arg Ser Ser Ser Ser Glu Gln His Val Gln
Gln Pro Pro Ala Gln 725 730 735Gln Pro Gly Gln Pro Glu Val Phe Gln
Glu Met Leu Ser Met Leu Gly 740 745 750Asp Gln Ser Asn Ser Tyr Asn
Asn Glu Glu Phe Pro Asp Leu Thr Met 755 760 765Phe Pro Pro Phe Ser
Glu 77036870PRTHomo sapiens 36Met Thr Ala Asp Lys Glu Lys Lys Arg
Ser Ser Ser Glu Arg Arg Lys1 5 10 15Glu Lys Ser Arg Asp Ala Ala Arg
Cys Arg Arg Ser Lys Glu Thr Glu 20 25 30Val Phe Tyr Glu Leu Ala His
Glu Leu Pro Leu Pro His Ser Val Ser 35 40 45Ser His Leu Asp Lys Ala
Ser Ile Met Arg Leu Ala Ile Ser Phe Leu 50 55 60Arg Thr His Lys Leu
Leu Ser Ser Val Cys Ser Glu Asn Glu Ser Glu65 70 75 80Ala Glu Ala
Asp Gln Gln Met Asp Asn Leu Tyr Leu Lys Ala Leu Glu 85 90 95Gly Phe
Ile Ala Val Val Thr Gln Asp Gly Asp Met Ile Phe Leu Ser 100 105
110Glu Asn Ile Ser Lys Phe Met Gly Leu Thr Gln Val Glu Leu Thr Gly
115 120 125His Ser Ile Phe Asp Phe Thr His Pro Cys Asp His Glu Glu
Ile Arg 130 135 140Glu Asn Leu Ser Leu Lys Asn Gly Ser Gly Phe Gly
Lys Lys Ser Lys145 150 155 160Asp Met Ser Thr Glu Arg Asp Phe Phe
Met Arg Met Lys Cys Thr Val 165 170 175Thr Asn Arg Gly Arg Thr Val
Asn Leu Lys Ser Ala Thr Trp Lys Val 180 185 190Leu His Cys Thr Gly
Gln Val Lys Val Tyr Asn Asn Cys Pro Pro His 195 200 205Asn Ser Leu
Cys Gly Tyr Lys Glu Pro Leu Leu Ser Cys Leu Ile Ile 210 215 220Met
Cys Glu Pro Ile Gln His Pro Ser His Met Asp Ile Pro Leu Asp225 230
235 240Ser Lys Thr Phe Leu Ser Arg His Ser Met Asp Met Lys Phe Thr
Tyr 245 250 255Cys Asp Asp Arg Ile Thr Glu Leu Ile Gly Tyr His Pro
Glu Glu Leu 260 265 270Leu Gly Arg Ser Ala Tyr Glu Phe Tyr His Ala
Leu Asp Ser Glu Asn 275 280 285Met Thr Lys Ser His Gln Asn Leu Cys
Thr Lys Gly Gln Val Val Ser 290 295 300Gly Gln Tyr Arg Met Leu Ala
Lys His Gly Gly Tyr Val Trp Leu Glu305 310 315 320Thr Gln Gly Thr
Val Ile Tyr Asn Pro Arg Asn Leu Gln Pro Gln Cys 325 330 335Ile Met
Cys Val Asn Tyr Val Leu Ser Glu Ile Glu Lys Asn Asp Val 340 345
350Val Phe Ser Met Asp Gln Thr Glu Ser Leu Phe Lys Pro His Leu Met
355 360 365Ala Met Asn Ser Ile Phe Asp Ser Ser Gly Lys Gly Ala Val
Ser Glu 370 375 380Lys Ser Asn Phe Leu Phe Thr Lys Leu Lys Glu Glu
Pro Glu Glu Leu385 390 395 400Ala Gln Leu Ala Pro Thr Pro Gly Asp
Ala Ile Ile Ser Leu Asp Phe 405 410 415Gly Asn Gln Asn Phe Glu Glu
Ser Ser Ala Tyr Gly Lys Ala Ile Leu 420 425 430Pro Pro Ser Gln Pro
Trp Ala Thr Glu Leu Arg Ser His Ser Thr Gln 435 440 445Ser Glu Ala
Gly Ser Leu Pro Ala Phe Thr Val Pro Gln Ala Ala Ala 450 455 460Pro
Gly Ser Thr Thr Pro Ser Ala Thr Ser Ser Ser Ser Ser Cys Ser465 470
475 480Thr Pro Asn Ser Pro Glu Asp Tyr Tyr Thr Ser Leu Asp Asn Asp
Leu 485 490 495Lys Ile Glu Val Ile Glu Lys Leu Phe Ala Met Asp Thr
Glu Ala Lys 500 505 510Asp Gln Cys Ser Thr Gln Thr Asp Phe Asn Glu
Leu Asp Leu Glu Thr 515 520 525Leu Ala Pro Tyr Ile Pro Met Asp Gly
Glu Asp Phe Gln Leu Ser Pro 530 535 540Ile Cys Pro Glu Glu Arg Leu
Leu Ala Glu Asn Pro Gln Ser Thr Pro545 550 555 560Gln His Cys Phe
Ser Ala Met Thr Asn Ile Phe Gln Pro Leu Ala Pro 565 570 575Val Ala
Pro His Ser Pro Phe Leu Leu Asp Lys Phe Gln Gln Gln Leu 580 585
590Glu Ser Lys Lys Thr Glu Pro Glu His Arg Pro Met Ser Ser Ile Phe
595 600 605Phe Asp Ala Gly Ser Lys Ala Ser Leu Pro Pro Cys Cys Gly
Gln Ala 610 615 620Ser Thr Pro Leu Ser Ser Met Gly Gly Arg Ser Asn
Thr Gln Trp Pro625 630 635 640Pro Asp Pro Pro Leu His Phe Gly Pro
Thr Lys Trp Ala Val Gly Asp 645 650 655Gln Arg Thr Glu Phe Leu Gly
Ala Ala Pro Leu Gly Pro Pro Val Ser 660 665 670Pro Pro His Val Ser
Thr Phe Lys Thr Arg Ser Ala Lys Gly Phe Gly 675 680 685Ala Arg Gly
Pro Asp Val Leu Ser Pro Ala Met Val Ala Leu Ser Asn 690 695 700Lys
Leu Lys Leu Lys Arg Gln Leu Glu Tyr Glu Glu Gln Ala Phe Gln705 710
715 720Asp Leu Ser Gly Gly Asp Pro Pro Gly Gly Ser Thr Ser His Leu
Met 725 730 735Trp Lys Arg Met Lys Asn Leu Arg Gly Gly Ser Cys Pro
Leu Met Pro 740 745 750Asp Lys Pro Leu Ser Ala Asn Val Pro Asn Asp
Lys Phe Thr Gln Asn 755 760 765Pro Met Arg Gly Leu Gly His Pro Leu
Arg His Leu Pro Leu Pro Gln 770 775 780Pro Pro Ser Ala Ile Ser Pro
Gly Glu Asn Ser Lys Ser Arg Phe Pro785 790 795 800Pro Gln Cys Tyr
Ala Thr Gln Tyr Gln Asp Tyr Ser Leu Ser Ser Ala 805 810 815His Lys
Val Ser Gly Met Ala Ser Arg Leu Leu Gly Pro Ser Phe Glu 820 825
830Ser Tyr Leu Leu Pro Glu Leu Thr Arg Tyr Asp Cys Glu Val Asn Val
835 840 845Pro Val Leu Gly Ser Ser Thr Leu Leu Gln Gly Gly Asp Leu
Leu Arg 850 855 860Ala Leu Asp Gln Ala Thr865 870
* * * * *