U.S. patent application number 12/932151 was filed with the patent office on 2011-07-07 for methods for treating anemia using inhibitors of hypoxia-inducible factor (hif) hydroxylase.
This patent application is currently assigned to FibroGen, Inc.. Invention is credited to Michael P. Arend, Lee A. Flippin, Volkmar Guenzler-Pukall, Stephen J. Klaus, Al Y. Lin, Alex Melekhov, Thoams B. Neff, Qingjian Wang.
Application Number | 20110166178 12/932151 |
Document ID | / |
Family ID | 27502557 |
Filed Date | 2011-07-07 |
United States Patent
Application |
20110166178 |
Kind Code |
A1 |
Klaus; Stephen J. ; et
al. |
July 7, 2011 |
Methods for treating anemia using inhibitors of hypoxia-inducible
factor (HIF) hydroxylase
Abstract
The present invention relates to methods for treating
erythropoietin-associated conditions by increasing endogenous
erythropoietin in vitro and in vivo. Methods for treating,
pretreating or preconditioning, or preventing
erythropoietin-associated conditions are also included. Compounds
for use in these methods are provided, as are methods of
identifying such compounds.
Inventors: |
Klaus; Stephen J.; (San
Francisco, CA) ; Lin; Al Y.; (Castro Valley, CA)
; Neff; Thoams B.; (Atherton, CA) ; Wang;
Qingjian; (Belmont, CA) ; Guenzler-Pukall;
Volkmar; (Emeryville, CA) ; Arend; Michael P.;
(Foster City, CA) ; Flippin; Lee A.; (Woodside,
CA) ; Melekhov; Alex; (Irvine, CA) |
Assignee: |
FibroGen, Inc.
San Francisco
CA
|
Family ID: |
27502557 |
Appl. No.: |
12/932151 |
Filed: |
February 17, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11406023 |
Apr 17, 2006 |
|
|
|
12932151 |
|
|
|
|
10313643 |
Dec 6, 2002 |
|
|
|
11406023 |
|
|
|
|
60386488 |
Jun 5, 2002 |
|
|
|
60359683 |
Feb 25, 2002 |
|
|
|
60349659 |
Jan 16, 2002 |
|
|
|
60337082 |
Dec 6, 2001 |
|
|
|
Current U.S.
Class: |
514/309 |
Current CPC
Class: |
A61K 31/4375 20130101;
A61K 38/1709 20130101; C07K 14/4702 20130101; A61P 31/00 20180101;
A61P 1/04 20180101; A61P 1/16 20180101; A61P 25/28 20180101; A61P
29/00 20180101; A61P 9/04 20180101; A61P 7/06 20180101; A61K
31/4738 20130101; A61K 31/00 20130101; A61K 31/472 20130101; C07K
14/505 20130101; A61K 31/17 20130101; A61P 35/00 20180101; A61P
11/00 20180101; A61P 25/08 20180101; A61P 39/00 20180101; A61K
31/44 20130101; A61P 9/12 20180101; A61P 25/00 20180101; A61K 31/63
20130101; A61P 9/10 20180101; A61P 37/00 20180101; A61P 3/10
20180101; A61P 25/16 20180101; A61P 43/00 20180101; A61P 13/12
20180101; A61K 31/47 20130101; A61P 7/00 20180101; A61P 17/02
20180101; A61P 37/04 20180101; A61K 31/496 20130101; G01N 33/746
20130101; A61P 25/14 20180101; A61K 31/4745 20130101; A61P 9/00
20180101; A61K 31/4418 20130101; A61P 9/08 20180101 |
Class at
Publication: |
514/309 |
International
Class: |
A61K 31/472 20060101
A61K031/472; A61P 7/06 20060101 A61P007/06 |
Claims
1. A method for treating anemia in a subject, the method comprising
administering to the subject an effective amount of a compound that
inhibits hypoxia-inducible factor (HIF) prolyl hydroxylase.
2. The method of claim 1, wherein the subject is a subject having
chronic kidney disease.
3. The method of claim 1, wherein the compound is selected from the
group consisting of a heterocyclic carboxamide, a phenanthroline,
and a hydroxamate.
4. The method of claim 1, wherein the compound is a heterocyclic
carboxamide.
5. The method of claim 1, wherein the subject is undergoing or is
at risk for undergoing kidney dialysis.
6. The method of claim 1, wherein the compound is delivered orally.
Description
[0001] This application claims the benefit of U.S. application Ser.
No. 11/406,023 filed Apr. 17, 2006; U.S. application Ser. No.
10/313,643, filed Dec. 6, 2002; U.S. Provisional Application Ser.
No. 60/349,659 filed Jan. 16, 2002; U.S. Provisional Application
Ser. No. 60/386,488, filed Jun. 5, 2002; U.S. Provisional
Application Ser. No. 60/337,082, filed Dec. 6, 2001; and U.S.
Provisional Application Ser. No. 60/359,683, filed Feb. 25, 2002;
each of which is incorporated by reference herein in its
entirety.
FIELD OF THE INVENTION
[0002] The present invention relates to methods for increasing
endogenous erythropoietin, ex vivo and in vivo, and to compounds
that can be used in the methods.
BACKGROUND OF THE INVENTION
[0003] Erythropoietin (EPO), a naturally occurring hormone,
stimulates the production of red blood cells (erythrocytes), which
carry oxygen throughout the body. EPO is normally secreted by the
kidneys, and endogenous EPO is increased under conditions of
reduced oxygen (hypoxia). All types of anemia are characterized by
the blood's reduced capacity to carry oxygen, and thus are
associated with similar signs and symptoms, including pallor of the
skin and mucous membranes, weakness, dizziness, easy fatigability,
and drowsiness, leading to a decrease in quality of life. Subjects
with severe cases of anemia show difficulty in breathing and heart
abnormalities. Anemia is typically associated with a condition in
which the blood is deficient in red blood cells or in
hemoglobin.
[0004] Common causes of anemia include deficiencies of iron,
vitamin B.sub.12, and folic acid. Anemia can also develop in
association with chronic diseases, e.g., in inflammatory disorders,
including disorders with consequent inflammatory suppression of
marrow, etc. Anemia may be caused by loss of blood, for example,
due to accidents, surgery, or gastrointestinal bleeding caused by
medications such as aspirin and ibuprofen. Excessive blood loss can
also be seen in women with heavy menstrual periods, and in people
with stomach ulcers, duodenal ulcers, hemorrhoids, or cancer of the
stomach or large intestine, etc.
[0005] Various conditions can cause the destruction of erythrocytes
(hemolysis), thus leading to anemia. For example, allergic-type
reactions to bacterial toxins and various chemical agents such as
sulfonamides and benzene can cause hemolysis. Hemolytic anemia is
often caused by chemical poisoning, parasites, infection, or
sickle-cell anemia. In addition, there are unusual situations in
which the body produces antibodies against its own erythrocytes,
resulting in hemolysis. Any disease or injury to the bone marrow
can cause anemia, since that tissue is the site of erythropoiesis,
i.e. erythrocyte synthesis. Irradiation, disease, or various
chemical agents can also cause bone marrow destruction, producing
aplastic anemia. Cancer patients undergoing chemotherapy often have
aplastic anemia. Anemia is also associated with renal dysfunction,
the severity of the anemia correlating highly with the extent of
the dysfunction. Most patients with renal failure undergoing
dialysis suffer from chronic anemia.
[0006] In addition to being produced in the kidney, erythropoietin
is produced by astrocytes and neurons in the central nervous system
(CNS), and EPO and EPO receptors are expressed at capillaries of
the brain-periphery interface. Furthermore, systemically
administered EPO crosses the blood-brain barrier and reduces
neuronal cell loss in response to cerebral and spinal chord
ischemia, mechanical trauma, epilepsy, excitotoxins, and
neuroinflammation. (Sakanaka (1998) Proc Natl Acad Sci USA
95:4635-4640; Celik et al. (2002) Proc Natl Acad Sci USA
99:2258-2263; Brines et al. (2000) Proc Natl Acad Sci USA
97:10526-10531; Calapai et al. (2000) Eur J Pharmacol 401:349-356;
and Siren et al. (2001) Proc Natl Acad Sci USA 98:4044-404.)
[0007] In the late 1980s, Amgen introduced a genetically engineered
EPO for the treatment of anemia in chronic renal failure patients.
EPO is also administered to cancer patients undergoing radiation
and/or chemotherapy, decreasing the need for blood transfusions.
EPO is used to treat anemia associated with HIV infection or
azidothymidine (AZT) therapy. Although the market for EPO therapy
is increasing, future sales are adversely affected by the high cost
of the product. In addition, recombinant EPO therapy requires
intravenous administration of EPO one to three times per week for
up to twelve weeks, a treatment regimen that limits
self-administration and is inconvenient for the patient. Further,
human serum EPO shows size heterogeneity due to extensive and
varied glycosylation not reproduced in any recombinant human
EPO.
[0008] Due to deficiencies in current production and use of
recombinant EPO, there remains a need for methods and compounds
effective in the treatment of erythropoietin-associated conditions
such as anemia, including anemia associated with diabetes, ulcers,
kidney failure, cancer, infection, dialysis, surgery, and
chemotherapy. Specifically, there is a need in the art for methods
and compounds that increase endogenous erythropoietin.
SUMMARY OF THE INVENTION
[0009] The present invention relates generally to methods for
increasing endogenous erythropoietin. In one aspect, the present
invention provides a method of increasing endogenous erythropoietin
(EPO) in a subject, the method comprising stabilizing the alpha
subunit of hypoxia inducible factor (HIF.alpha.). In another
aspect, the present invention provides a method of increasing
endogenous EPO in a subject, the method comprising inhibiting
hydroxylation of HIF.alpha.. In yet another aspect, a method of
increasing endogenous EPO in a subject, the method comprising
inhibiting 2-oxoglutarate dioxygenase enzyme activity, is provided.
The present invention provides in a further aspect a method of
increasing endogenous EPO levels in a subject, the method
comprising inhibiting HIF prolyl hydroxylase enzyme activity.
[0010] The subject can be, in various embodiments, an animal, a
mammal, a human, a cell, a tissue, an organ, etc.
[0011] In one aspect, the invention provides a method of increasing
endogenous EPO, the method comprising stabilizing HIF.alpha.,
wherein the stabilizing takes place in vivo. A method of increasing
endogenous EPO, the method comprising stabilizing HIF.alpha.,
wherein the stabilizing takes place in vitro, is also
contemplated.
[0012] In particular embodiments of the invention in which methods
of stabilizing endogenous HIF.alpha. are contemplated, the
HIF.alpha. is selected from the group consisting of HIF-1.alpha.,
HIF-2.alpha., HIF-3.alpha., and any fragment thereof. In one
embodiment, the HIF.alpha. is endogenous to the subject.
[0013] In methods of the invention relating to inhibition of
2-oxoglutarate dioxygenase enzyme activity, various embodiments are
provided in which the 2-oxoglutarate dioxygenase enzyme is selected
from the group consisting of EGLN1, EGLN2, EGLN3, procollagen
prolyl 4-hydroxylase, procollagen prolyl 3-hydroxylase, procollagen
lysyl hydroxylase, PHD4, FIH-1, and any subunit or fragment
thereof. With respect to methods for increasing endogenous EPO
which comprise inhibiting HIF prolyl hydroxylase enzyme activity,
embodiments in which the HIF prolyl hydroxylase enzyme is selected
from the group consisting of EGLN1, EGLN2, EGLN3, and any subunit
or fragment thereof are contemplated.
[0014] A preferred method for increasing endogenous EPO according
to the present invention comprises administering to the subject a
compound that increases endogenous EPO. In one aspect, the compound
stabilizes HIF.alpha.. In another aspect, the compound inhibits
hydroxylation of HIF.alpha.. In a further aspect, the compound
inhibits 2-oxoglutarate dioxygenase enzyme activity. In a
particular aspect, the compound inhibits HIF prolyl hydroxylase
enzyme activity.
[0015] In certain embodiments, the present invention provides a
method for increasing endogenous EPO in a subject, the method
comprising administering to the subject a compound selected from
the group consisting of heterocyclic carboxamides, phenanthrolines,
hydroxamates, and physiologically active salts and prodrugs derived
therefrom. In a particular embodiment, the compound is a
heterocyclic carboxamide selected from the group consisting of
pyridine carboxamides, quinoline carboxamides, isoquinoline
carboxamides; cinnoline carboxamides, and beta-carboline
carboxamides. In a preferred embodiment, the compound is delivered
to the subject in the form of an oral formulation. In another
preferred embodiment, the compound is delivered in a transdermal
formulation.
[0016] Various methods for treating, preventing, or pretreating an
EPO-associated disorder in a subject are provided. In one aspect,
the present invention provides a method for treating, preventing,
or pretreating an EPO-associated disorder, the method comprising
increasing endogenous EPO. In another aspect, a method for
treating, preventing, or pretreating an EPO-associated disorder in
a subject, the method comprising stabilizing HIF.alpha., is
provided. In another method according to the present invention, a
method of treating, preventing, or pretreating an EPO-associated
disorder in a subject comprises inhibiting hydroxylation of
HIF.alpha.. In yet another aspect, the invention provides a method
of treating, preventing, or pretreating an EPO-associated disorder
in a subject, the method comprising inhibiting 2-oxoglutarate
dioxygenase enzyme activity. In a preferred aspect of the present
invention, a method for treating, preventing, or pretreating an
EPO-associated disorder in a subject, the method comprising
inhibiting HIF prolyl hydroxylase enzyme activity, is
contemplated.
[0017] The present invention specifically relates to methods for
treating, preventing, or pretreating anemia in a subject. In one
embodiment, the method comprises increasing endogenous EPO,
including, in various embodiments, stabilizing HIF.alpha.,
inhibiting 2-oxoglutarate dioxygenase enzyme activity, inhibiting
HIF prolyl hydroxylase enzyme activity, etc.
[0018] In one aspect, the invention provides methods for treatment,
prevention, and pretreatment/preconditioning of anemia, wherein the
anemia is associated with abnormal hemoglobin or erythrocytes. In a
further aspect, the anemia is associated with a condition selected
from the group consisting of diabetes, cancer, ulcers, kidney
disease, immunosuppressive disease, infection, and inflammation. In
yet another aspect, the anemia is associated with a procedure or
treatment selected from the group consisting of radiation therapy,
chemotherapy, dialysis, and surgery. In another aspect, methods for
treatment, prevention, and pretreatment/preconditioning of anemia,
wherein the anemia is associated with blood loss, are provided. In
various aspects, the blood less is associated with bleeding
disorders, trauma, injury, surgery, etc. It is contemplated in
specific embodiments that the anemia can be associated with defects
in iron transport, processing, or utilization. Methods of
pretreating/preconditioning, preventing, or treating anemia, the
methods comprising increasing endogenous EPO, and further
comprising administering to the subject a compound selected from
the group consisting of, e.g., an iron supplement, vitamin
B.sub.12, folic acid, exogenous erythropoietin, and
granulocyte-colony stimulating factor, etc., are also
contemplated.
[0019] The present invention further relates to a method of
treating, preventing, or pretreating a neurological disorder in a
subject the method comprising increasing-endogenous-EPO. In various
aspects, the method comprises stabilizing HIF.alpha., inhibiting
2-oxoglutarate dioxygenase enzyme activity, and inhibiting HIF
prolyl hydroxylase enzyme activity. The invention contemplates in
certain aspects that the neurological disorder is associated with a
condition selected from the group consisting of stroke, trauma,
epilepsy, and neurodegenerative disease.
[0020] In one embodiment, the present invention includes a method
of enhancing oxygen consumption in a subject, the method comprising
increasing endogenous EPO.
[0021] Methods for identifying compounds that increase endogenous
EPO in a subject are also provided. In one embodiment, the
invention contemplates a method of identifying a compound that
increases endogenous EPO, the method comprising administering a
compound to a subject; measuring EPO in the subject or in a sample
from the subject; and comparing the EPO in the subject or in the
sample to a standard, wherein an increase in the EPO in the subject
or in the sample relative to the standard is indicative of a
compound that increases endogenous EPO.
[0022] The methods of the invention increase endogenous
erythropoietin ex vivo, e.g., in cell culture, or in vivo, e.g., in
an animal. Preferably, the animal is a mammal, e.g., a cat or dog,
and, more preferably, the animal is a human. In certain
embodiments, the methods of the invention increase synthesis of
endogenous erythropoietin in tissues including, but not limited to,
renal, hepatic, hematopoietic, and/or neural tissues. In other
embodiments, the methods of the invention are used to prevent,
pretreat, or treat erythropoietin-associated conditions including
neurological disorders and anemia. Erythropoietin-associated
conditions associated with anemia include, but are not limited to,
polycystic kidney disease, chronic renal failure, diabetes, cancer,
ulcers, and immunosuppressive conditions such as AIDS. In further
embodiments, the methods of the invention are used to treat anemia
associated with procedures or treatments including, but not limited
to, radiation therapy, chemotherapy, kidney dialysis, or surgery.
In specific embodiments, the methods of the invention are used to
increase endogenous erythropoietin levels in an HIV-infected anemic
subject being treated with zidovudine or other reverse
transcriptase inhibitors. In other embodiments, the methods are
used to increase endogenous erythropoietin levels in an anemic
cancer patient receiving cyclic cisplatin- or
non-cisplatin-containing chemotherapy. In further embodiments, the
methods are used to increase endogenous erythropoietin levels in an
anemic patient scheduled to undergo elective, noncardiac,
nonvascular surgery, thereby reducing the need for allogenic blood
transfusions or to facilitate banking of blood prior-to-surgery. In
one specific embodiment, the method is used to increase endogenous
erythropoietin levels in a subject prior to procedures such as,
e.g., surgery requiring aortic clamping such as thoracoabdominal
aortic surgery. In yet another embodiment, the method is used to
increase endogenous erythropoietin produced by cells in vitro.
[0023] In one aspect, the invention provides compounds that
increase endogenous erythropoietin plasma levels. In one
embodiment, a therapeutically effective amount of the compound or a
pharmaceutically acceptable salt thereof, alone or in combination
with a pharmaceutically acceptable excipient, is administered to a
subject having an erythropoietin-associated condition. In another
aspect, a therapeutically effective amount of the compound or a
pharmaceutically acceptable salt thereof, alone or in combination
with a pharmaceutically acceptable excipient, is administered to a
patient having anemia.
[0024] Preferred embodiments of the invention comprise methods
using oral and transdermal delivery mechanisms. Such mechanisms
could provide advantages over current therapies, e.g., increased
ease of administration, self-administration by patient, reduced
cost, fewer physician visits, and reduced risks due to infection
and immunogenic complications, minimizing the adverse reactions
some subjects develop in response to dosing with recombinant EPO.
In one preferred embodiment, the present methods involve oral
administration of a compound that increases endogenous
erythropoietin levels. Thus, the present invention also provides an
oral formulation comprising a compound of the invention. In another
preferred embodiment, the present methods involve transdermal
administration of a compound that increases endogenous
erythropoietin levels. Thus, the present invention also provides a
transdermal patch or pad comprising a compound of the
invention.
[0025] In another aspect, the invention provides compounds that
increase endogenous erythropoietin produced by cells in culture and
methods of using the compounds to produce erythropoietin using in
vitro cell culture technologies. In one embodiment, the method
comprises adding an effective amount of the compound or a
pharmaceutically acceptable salt thereof to cells in culture under
conditions suitable for production of erythropoietin, and
collecting and purifying the erythropoietin produced thereby.
Examples of cells that produce erythropoietin in vitro include
hepatic cells such as Hep3B hepatocarcinoma cells.
[0026] In certain embodiments, compounds used in the methods of the
invention are selected from a compound of the formula (I)
##STR00001##
wherein A is 1,2-arylidene, 1,3-arylidene, 1,4-arylidene; or
(C.sub.1-C.sub.4)-alkylene, optionally substituted by one or two
halogen, cyano, nitro, trifluoromethyl, (C.sub.1-C.sub.6)-alkyl,
(C.sub.1-C.sub.6)-hydroxyalkyl, (C.sub.1-C.sub.6)-alkoxy,
--O--[CH.sub.2].sub.x--C.sub.fH.sub.(2f+1-g)Hal.sub.g,
(C.sub.1-C.sub.6)-fluoroalkoxy, (C.sub.1-C.sub.8)-fluoroalkenyloxy,
(C.sub.1-C.sub.8)-fluoroalkynyloxy, --OCF.sub.2Cl,
--O--CF.sub.2--CHFCl; (C.sub.1-C.sub.6)-alkylmercapto,
(C.sub.1-C.sub.6)-alkylsulfinyl, (C.sub.1-C.sub.6)-alkylsulfonyl,
(C.sub.1-C.sub.6)-alkylcarbonyl, (C.sub.1-C.sub.6)-alkoxycarbonyl,
carbamoyl, N--(C.sub.1-C.sub.4)-alkylcarbamoyl,
N,N-di-(C.sub.1-C.sub.4)-alkylcarbamoyl,
(C.sub.1-C.sub.6)-alkylcarbonyloxy, (C.sub.3-C.sub.8)-cycloalkyl,
phenyl, benzyl, phenoxy, benzyloxy, anilino, N-methylanilino,
phenylmercapto, phenylsulfonyl, phenylsulfinyl, sulfamoyl,
N--(C.sub.1-C.sub.4)-alkylsulfamoyl,
N,N-di-(C.sub.1-C.sub.4)-alkylsulfamoyl; or by a substituted
(C.sub.6-C.sub.12)-aryloxy, (C.sub.7-C.sub.11)-aralkyloxy,
(C.sub.6-C.sub.12)-aryl, (C.sub.7-C.sub.11)-aralkyl radical, which
carries in the aryl moiety one to five identical or different
substituents selected from halogen, cyano, nitro, trifluoromethyl,
(C.sub.1-C.sub.6)-alkyl, (C.sub.1-C.sub.6)-alkoxy,
--O--[CH.sub.2].sub.x--C.sub.fH.sub.(2f+1-g)Hal.sub.g,
--OCF.sub.2Cl, --O--CF.sub.2--CHFCl,
(C.sub.1-C.sub.6)-alkylmercapto, (C.sub.1-C.sub.6)-alkylsulfinyl,
(C.sub.1-C.sub.6)-alkylsulfonyl, (C.sub.1-C.sub.6)-alkylcarbonyl,
(C.sub.1-C.sub.6)-alkoxycarbonyl, carbamoyl,
N--(C.sub.1-C.sub.4)-alkylcarbamoyl,
N,N-di-(C.sub.1-C.sub.4)-alkylcarbamoyl,
(C.sub.1-C.sub.6)-alkylcarbonyloxy, (C.sub.3-C.sub.8)-cycloalkyl,
sulfamoyl, N--(C.sub.1-C.sub.4)-alkylsulfamoyl,
N,N-di-(C.sub.1-C.sub.4)-alkylsulfamoyl; or wherein A is
--CR.sup.5R.sup.6 and R.sup.5 and R.sup.6 are each independently
selected from hydrogen, (C.sub.1-C.sub.6)-alkyl,
(C.sub.3-C.sub.7)-cycloalkyl, aryl, or a substituent of the
.alpha.-carbon atom of an .alpha.-amino acid, wherein the amino
acid is a natural L-amino acid or its D-isomer. B is --CO.sub.2H,
--NH.sub.2, --NHSO.sub.2CF.sub.3, tetrazolyl, imidazolyl,
3-hydroxyisoxazolyl, --CONHCOR''', --CONSOR''', CONHSO.sub.2R''',
where R''' is aryl, heteroaryl, (C.sub.3-C.sub.7)-cycloalkyl, or
(C.sub.1-C.sub.4)-alkyl, optionally monosubstituted by
(C.sub.6-C.sub.12)-aryl, heteroaryl, OH, SH,
(C.sub.1-C.sub.4)-alkyl, (C.sub.1-C.sub.4)-alkoxy,
(C.sub.1-C.sub.4)-thioalkyl, (C.sub.1-C.sub.4)-sulfinyl,
(C.sub.1-C.sub.4)-sulfonyl, CF.sub.3, Cl, Br, F, I, NO2, --COOH,
(C.sub.2-C.sub.5)-alkoxycarbonyl, NH.sub.2,
mono-(C.sub.1-C.sub.4-alkyl)-amino,
di-(C.sub.1-C.sub.4-alkyl)-amino, or
(C.sub.1-C.sub.4)-perfluoroalkyl; or wherein B is a CO.sub.2-G
carboxyl radical, where G is a radical of an alcohol G-OH in which
G is selected from (C.sub.1-C.sub.20)-alkyl radical,
(C.sub.3-C.sub.8) cycloalkyl radical, (C.sub.2-C.sub.20)-alkenyl
radical, (C.sub.3-C.sub.8)-cycloalkenyl radical, retinyl radical,
(C.sub.2-C.sub.20)-alkynyl radical, (C.sub.4-C.sub.20)-alkenynyl
radical, where the alkenyl, cycloalkenyl, alkynyl, and alkenynyl
radicals contain one or more multiple bonds;
(C.sub.6-C.sub.16)-carbocyclic aryl radical,
(C.sub.7-C.sub.16)-carbocyclic aralkyl radical, heteroaryl radical,
or heteroaralkyl-radical, wherein a heteroaryl radical or
heteroaryl moiety of a heteroaralkyl radical contains 5 or 6 ring
atoms; and wherein radicals defined for G are substituted by one or
more hydroxyl, halogen, cyano, trifluoromethyl, nitro, carboxyl,
(C.sub.1-C.sub.12)-alkyl, (C.sub.3-C.sub.8)-cycloalkyl,
(C.sub.5-C.sub.8)-cycloalkenyl, (C.sub.6-C.sub.12)-aryl,
(C.sub.7-C.sub.16)-aralkyl, (C.sub.2-C.sub.12)-alkenyl,
(C.sub.2-C.sub.12)-alkynyl, (C.sub.1-C.sub.12)-alkoxy,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkyl,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxy,
(C.sub.6-C.sub.12)-aryloxy, (C.sub.7-C.sub.16)-aralkyloxy,
(C.sub.1-C.sub.8)-hydroxyalkyl,
--O--[CH.sub.2].sub.x--C.sub.fH.sub.(2f+1-g)-OCF.sub.2Cl,
--CF.sub.2--CHFCl, (C.sub.1-C.sub.12)-alkylcarbonyl,
(C.sub.3-C.sub.8)-cycloalkylcarbonyl,
(C.sub.6-C.sub.12)-arylcarbonyl,
(C.sub.7-C.sub.16)-aralkylcarbonyl, cinnamoyl,
(C.sub.2-C.sub.12)-alkenylcarbonyl,
(C.sub.2-C.sub.12)-alkynylcarbonyl,
(C.sub.1-C.sub.12)-alkoxycarbonyl,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxycarbonyl,
(C.sub.6-C.sub.12)-aryloxycarbonyl,
(C.sub.7-C.sub.16)-aralkoxycarbonyl,
(C.sub.3-C.sub.8)-cycloalkoxycarbonyl,
(C.sub.2-C.sub.12)-alkenyloxycarbonyl,
(C.sub.2-C.sub.12)-alkynyloxycarbonyl, acyloxy,
(C.sub.1-C.sub.12)-alkoxycarbonyloxy,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxycarbonyloxy,
(C.sub.6-C.sub.12)-aryloxycarbonyloxy, (C.sub.7-C.sub.16)
aralkyloxycarbonyloxy, (C.sub.3-C.sub.8)-cycloalkoxycarbonyloxy,
(C.sub.2-C.sub.12)-alkenyloxycarbonyloxy,
(C.sub.2-C.sub.12)-alkynyloxycarbonyloxy, carbamoyl,
N--(C.sub.1-C.sub.12)-alkylcarbamoyl,
N,N-di(C.sub.1-C.sub.12)-alkylcarbamoyl,
N--(C.sub.3-C.sub.8)-cycloalkyl-carbamoyl,
N--(C.sub.6-C.sub.16)-arylcarbamoyl,
N--(C.sub.7-C.sub.16)-aralkylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.16)-arylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylcarbamoyl,
N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyl,
N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.10)alkyl)-carbamoyl,
N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.-
10)-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.6-C.sub.16)-aryloxy-(C.sub.1-C.sub-
.10)-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.-
sub.10)-alkyl)-carbamoyl, carbamoyloxy,
N--(C.sub.1-C.sub.12)-alkylcarbamoyloxy,
N,N-di-(C.sub.1-C.sub.12)-alkylcarbamoyloxy,
N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyloxy,
N--(C.sub.6-C.sub.12)-arylcarbamoyloxy,
N--(C.sub.7-C.sub.16)-aralkylcarbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.6-C.sub.12)-arylcarbamoyloxy,
N(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylcarbamoyloxy,
N--((C.sub.1-C.sub.10)-alkyl)-carbamoyloxy,
N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyloxy,
N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.-
10)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub-
.10)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.-
sub.10)-alkyl)-carbamoyloxy, amino, (C.sub.1-C.sub.12)-alkylamino,
di-(C.sub.1-C.sub.12)-alkylamino,
(C.sub.3-C.sub.8)-cycloalkylamino, (C.sub.2-C.sub.12)-alkenylamino,
(C.sub.2-C.sub.12)-alkynylamino, N--(C.sub.6-C.sub.12)-arylamino,
N--(C--C.sub.11)-aralkylamino, N-alkyl-aralkylamino,
N-alkyl-arylamino, (C.sub.1-C.sub.12)-alkoxyamino,
(C.sub.1-C.sub.12)-alkoxy-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.1-C.sub.12)-alkylcarbonylamino,
(C.sub.3-C.sub.8)-cycloalkylcarbonylamino, (C.sub.6-C.sub.12)
arylcarbonylamino, (C.sub.7-C.sub.16)-aralkylcarbonylamino,
(C.sub.1-C.sub.12)-alkylcarbonyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.3-C.sub.8)-cycloalkylcarbonyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.6-C.sub.12)-arylcarbonyl-N--(C.sub.1-C.sub.10)alkylamino,
(C.sub.7-C.sub.11)-aralkylcarbonyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.1-C.sub.12)-alkylcarbonylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.3-C.sub.8)-cycloalkylcarbonylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)-arylcarbonylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.12)-aralkylcarbonylamino(C.sub.1-C.sub.8)-alkyl,
amino-(C.sub.1-C.sub.10)-alkyl,
N--(C.sub.1-C.sub.10)alkylamino-(C.sub.1-C.sub.10)-alkyl,
N,N-di-(C.sub.1-C.sub.10)-alkylamino-(C.sub.1-C.sub.10)-alkyl,
(C.sub.3-C.sub.8)cycloalkylamino-(C.sub.1-C.sub.10)-alkyl,
(C.sub.1-C.sub.12)-alkylmercapto, (C.sub.1-C.sub.12)-alkylsulfinyl,
(C.sub.1-C.sub.12)-alkylsulfonyl, (C.sub.6-C.sub.16)-arylmercapto,
(C.sub.6-C.sub.16)-arylsulfinyl, (C.sub.6-C.sub.12)-arylsulfonyl,
(C.sub.7-C.sub.16)-aralkylmercapto,
(C.sub.7-C.sub.16)-aralkylsulfinyl,
(C.sub.7-C.sub.16)-aralkylsulfonyl, sulfamoyl,
N--(C.sub.1-C.sub.10)-alkylsulfamoyl,
N,N-di(C.sub.1-C.sub.10)-alkylsulfamoyl,
(C.sub.3-C.sub.8)-cycloalkylsulfamoyl,
N--(C.sub.6-C.sub.12)-alkylsulfamoyl,
N--(C.sub.7-C.sub.16)-aralkylsulfamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.12)-arylsulfamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylsulfamoyl,
(C.sub.1-C.sub.10)-alkylsulfonamido,
N--((C.sub.1-C.sub.10)-alkyl)-(C.sub.1-C.sub.10)-alkylsulfonamido,
(C.sub.7-C.sub.16)-aralkylsulfonamido, or
N--((C.sub.1-C.sub.10)-alkyl-(C.sub.7-C.sub.16)-aralkylsulfonamido;
wherein radicals which are aryl or contain an aryl moiety, may be
substituted on the aryl by one to five identical or different
hydroxyl, halogen, cyano, trifluoromethyl, nitro, carboxyl,
(C.sub.1-C.sub.12)-alkyl, (C.sub.3-C.sub.8)-cycloalkyl,
(C.sub.6-C.sub.12)-aryl, (C.sub.7-C.sub.16)-aralkyl,
(C.sub.1-C.sub.12)-alkoxy,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)alkyl,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1 C.sub.12)alkoxy,
(C.sub.6-C.sub.12)-aryloxy, (C.sub.7-C.sub.16)-aralkyloxy,
(C.sub.1-C.sub.8)-hydroxyalkyl, alkylcarbonyl,
(C.sub.3-C.sub.8)-cycloalkyl-carbonyl,
(C.sub.6-C.sub.12)-arylcarbonyl, (C.sub.7-C.sub.16)
aralkylcarbonyl, (C.sub.1-C.sub.12)-alkoxycarbonyl,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxycarbonyl,
(C.sub.6-C.sub.12)-aryloxycarbonyl,
(C.sub.7-C.sub.16)-aralkoxycarbonyl,
(C.sub.3-C.sub.8)-cycloalkoxycarbonyl,
(C.sub.2-C.sub.12)-alkenyloxycarbonyl,
(C.sub.2-C.sub.12)-alkynyloxycarbonyl,
(C.sub.1-C.sub.12)-alkylcarbonyloxy,
(C.sub.3-C.sub.8)-cycloalkylcarbonyloxy,
(C.sub.6-C.sub.12)-arylcarbonyloxy,
(C.sub.7-C.sub.16)-aralkylcarbonyloxy, cinnamoyloxy,
(C.sub.2-C.sub.12)-alkenylcarbonyloxy,
(C.sub.2-C.sub.12)-alkynylcarbonyloxy,
(C.sub.1-C.sub.12)-alkoxycarbonyloxy,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxycarbonyloxy,
(C.sub.6-C.sub.12)-aryloxycarbonyloxy,
(C.sub.7-C.sub.16)-aralkyloxycarbonyloxy,
(C.sub.3-C.sub.8)-cycloalkoxycarbonyloxy,
(C.sub.2-C.sub.12)-alkenyloxycarbonyloxy,
(C.sub.2-C.sub.12)-alkynyloxycarbonyloxy, carbamoyl,
N--(C.sub.1-C.sub.12)-alkylcarbamoyl,
N,N-di-(C.sub.1-C.sub.12)-alkylcarbamoyl,
N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyl,
N--(C.sub.6-C.sub.12)-arylcarbamoyl,
N--(C.sub.7-C.sub.16)-aralkylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.12)-arylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylcarbamoyl,
N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyl,
N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyl,
N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.-
10)-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub-
.10)-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.-
sub.10)-alkyl)-carbamoyl, carbamoyloxy,
N--(C.sub.1-C.sub.12)-alkylcarbamoyloxy,
N,N-di-(C.sub.1-C.sub.12)-alkylcarbamoyloxy,
N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyloxy,
N--(C.sub.6-C.sub.12)-arylcarbamoyloxy,
N--(C.sub.7-C.sub.16)-aralkylcarbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.12)-arylcarbamoyloxy,
N(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylcarbamoyloxy,
N--((C.sub.1-C.sub.10)-alkyl)-carbamoyloxy,
N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyloxy,
N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.-
10)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub-
.10)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.-
sub.10)-alkyl)-carbamoyloxy, amino, (C.sub.1-C.sub.12)-alkylamino,
di-(C.sub.1-C.sub.12)-alkylamino,
(C.sub.3-C.sub.8)-cycloalkylamino, (C.sub.3-C.sub.12)-alkenylamino,
(C.sub.3-C.sub.12)-alkynylamino, N--(C.sub.6-C.sub.12)-arylamino,
N--(C.sub.7-C.sub.11)-aralkylamino, N-alkylaralkylamino,
N-alkyl-arylamino, (C.sub.1-C.sub.12)-alkoxyamino,
(C.sub.1-C.sub.12)-alkoxy-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.1-C.sub.12)-alkylcarbonylamino,
(C.sub.3-C.sub.8)-cycloalkylcarbonylamino,
(C.sub.6-C.sub.12)-arylcarbonylamino,
(C.sub.7-C.sub.16)-alkylcarbonylamino,
(C.sub.1-C.sub.12)-alkylcarbonyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.3-C.sub.8)-cycloalkylcarbonyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.6-C.sub.12)-arylcarbonyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.7-C.sub.11)-aralkylcarbonyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.1-C.sub.12)-alkylcarbonylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.3-C.sub.8)-cycloalkylcarbonylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)-arylcarbonylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.16)-aralkylcarbonylamino-(C.sub.1-C.sub.8)-alkyl,
amino-(C.sub.1-C.sub.10)-alkyl,
N--(C.sub.1-C.sub.10)-alkylamino-(C.sub.1-C.sub.10)alkyl,
N,N-di-(C.sub.1-C.sub.10)-alkylamino-(C.sub.1-C.sub.10)-alkyl,
(C.sub.3-C.sub.8)-cycloalkylamino-(C.sub.1-C.sub.10)-alkyl,
(C.sub.1-C.sub.12)-alkylmercapto, (C.sub.1-C.sub.12)-alkylsulfinyl,
(C.sub.1-C.sub.12)-alkylsulfonyl, (C.sub.6-C.sub.12)-arylmercapto,
(C.sub.6-C.sub.12)-arylsulfinyl, (C.sub.6-C.sub.12)-arylsulfonyl,
(C.sub.7-C.sub.16)-aralkylmercapto,
(C.sub.7-C.sub.16)-aralkylsulfinyl, or
(C.sub.7-C.sub.16)-aralkylsulfonyl;
X is O or S;
[0027] Q is O, S, NR', or a bond; where, if Q is a bond, R.sup.4 is
halogen, nitrile, or trifluoromethyl; or where, if Q is O, S, or
NR', R.sup.4 is hydrogen, (C.sub.1-C.sub.10)-alkyl radical,
(C.sub.2-C.sub.10)-alkenyl radical, (C.sub.2-C.sub.10)-alkynyl
radical, wherein alkenyl or alkynyl radical contains one or two
C--C multiple bonds; unsubstituted fluoroalkyl radical of the
formula --[CH.sub.2].sub.x--C.sub.fH.sub.(2f+1-g))--F.sub.g,
(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.6)-alkyl radical,
(C.sub.1-C.sub.6)-alkoxy-(C.sub.1-C.sub.4)-alkoxy-(C.sub.1-C.sub.4)-alkyl
radical, aryl radical, heteroaryl radical,
(C.sub.7-C.sub.11)-aralkyl radical, or a radical of the formula
Z
-[CH.sub.2].sub.v--[O].sub.w--[CH.sub.2].sub.t-E (Z)
where E is a heteroaryl radical, a (C.sub.3-C.sub.8)-cycloalkyl
radical, or a phenyl radical of the formula F
##STR00002##
v is 0-6, w is 0 or 1, t is 0-3, and R.sup.7, R.sup.8, R.sup.9,
R.sup.10, and R.sup.11 are identical or different and are hydrogen,
halogen, cyano, nitro, trifluoromethyl, (C.sub.1-C.sub.6)-alkyl,
(C.sub.3-C.sub.8)-cycloalkyl, (C.sub.1-C.sub.6)-alkoxy,
--O--[CH.sub.2].sub.x--C.sub.fH.sub.(2f+1-g)--F.sub.g,
--OCF.sub.2--Cl, --O--CF.sub.2--CHFCl,
(C.sub.1-C.sub.6)-alkylmercapto, (C.sub.1-C.sub.6)-hydroxyalkyl,
(C.sub.1-C.sub.6)-alkoxy-(C.sub.1-C.sub.6)-alkoxy,
(C.sub.1-C.sub.6)-alkoxy-(C.sub.1-C.sub.6)-alkyl,
(C.sub.1-C.sub.6)-alkylsulfinyl, (C.sub.1-C.sub.6)-alkylsulfonyl,
(C.sub.1-C.sub.6)-alkylcarbonyl, (C.sub.1-C.sub.8)-alkoxycarbonyl,
carbamoyl, N--(C.sub.1-C.sub.8)-alkylcarbamoyl,
N,N-di-(C.sub.1-C.sub.8)-alkylcarbamoyl, or
(C.sub.7-C.sub.11)-aralkylcarbamoyl, optionally substituted by
fluorine, chlorine, bromine, trifluoromethyl,
(C.sub.1-C.sub.6)-alkoxy, N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyl,
N--((C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.4)-alkylcarbamoyl,
(C.sub.1-C.sub.6)-alkylcarbonyloxy, phenyl, benzyl, phenoxy,
benzyloxy, NR.sup.YR.sup.Z wherein R.sup.y and R.sup.z are
independently selected from hydrogen, (C.sub.1-C.sub.12)-alkyl,
(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.12)-aralkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.3-C.sub.10)-cycloalkyl, (C.sub.3-C.sub.12)-alkenyl,
(C.sub.3-C.sub.12)-alkynyl, (C.sub.6-C.sub.12)-aryl,
(C.sub.7-C.sub.11)-aralkyl, (C.sub.1-C.sub.12)-alkoxy,
(C.sub.7-C.sub.12)aralkoxy, (C.sub.1-C.sub.12)-alkylcarbonyl,
(C.sub.3-C.sub.8)-cycloalkylcarbonyl, (C.sub.6-C.sub.12)
arylcarbonyl, (C.sub.7-C.sub.16)-aralkylcarbonyl; or further
wherein R.sup.y and R.sup.z together are --[CH.sub.2].sub.h, in
which a CH.sub.2 group can be replaced by O, S,
N--(C.sub.1-C.sub.4)-alkylcarbonylimino, or
N--(C.sub.1-C.sub.4)-alkoxycarbonylimino; phenylmercapto,
phenylsulfonyl, phenylsulfinyl, sulfamoyl,
N--(C.sub.1-C.sub.8)-alkylsulfamoyl, or
N,N-di-(C.sub.1-C.sub.8)-alkylsulfarnoyl; or alternatively R.sup.7
and R.sup.8, R.sup.8 and R.sup.9, R.sup.9 and R.sup.10, or R.sup.10
and R.sup.11, together are a chain selected from
--[CH.sub.2].sub.n-- or --CH.dbd.CH--CH.dbd.CH--, where a CH.sub.2
group of the chain is optionally replaced by O, S, SO, SO.sub.2, or
NR.sup.Y; and n is 3, 4, or 5; and if E is a heteroaryl radical,
said radical can carry 1-3 substituents selected from those defined
for R.sup.7-R.sup.11, or if E is a cycloalkyl radical, the radical
can carry one-substituent selected from those defined for
R.sup.7-R.sup.11; or where, if Q is NR', R.sup.4 is alternatively
R'', where R' and R'' are identical or different and are hydrogen,
(C.sub.6-C.sub.12)-aryl, (C.sub.7-C.sub.11)-aralkyl,
(C.sub.1-C.sub.8)-alkyl,
(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.8)-alkyl;
(C.sub.7-C.sub.12)-aralkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.1-C.sub.10)-alkylcarbonyl, optionally substituted
(C.sub.7-C.sub.16)-aralkylcarbonyl, or optionally substituted
C.sub.6-C.sub.12)-arylcarbonyl; or R' and R'' together are
--[CH.sub.2].sub.h, in which a CH.sub.2 group can be replaced by O,
S, N-acylimino, or N--(C.sub.1-C.sub.10)-alkoxycarbonylimino, and h
is 3 to 7.
Y is N or CR.sup.3;
[0028] R.sup.1, R.sup.2 and R.sup.3 are identical or different and
are hydrogen, hydroxyl, halogen, cyano, trifluoromethyl, nitro,
carboxyl, (C.sub.1-C.sub.20)-alkyl, (C.sub.3-C.sub.8)-cycloalkyl,
(C.sub.3-C.sub.8)cycloalkyl-(C.sub.1-C.sub.12)-alkyl,
(C.sub.3-C.sub.8)-cycloalkoxy,
(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.12)-alkoxy,
(C.sub.3-C.sub.8)-cycloalkyloxy-(C.sub.1-C.sub.12)-alkyl,
(C.sub.3-C.sub.8)-cycloalkyloxy-(C.sub.1-C.sub.12)-alkoxy,
(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.8)-alkyl-(C.sub.1-C.sub.6)-al-
koxy,
(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub-
.6)-alkyl,
(C.sub.3-C.sub.8)-cycloalkyloxy-(C.sub.1-C.sub.8)-alkoxy-(C.sub-
.1-C.sub.6)-alkyl,
(C.sub.3-C.sub.8)-cycloalkoxy-(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.8)--
alkoxy, (C.sub.6-C.sub.12)-aryl, (C.sub.7-C.sub.16)-aralkyl,
(C.sub.7-C.sub.16)-aralkenyl, (C.sub.7-C.sub.16)-aralkenyl,
(C.sub.2-C.sub.20)-alkenyl, (C.sub.2-C.sub.20)-alkynyl,
(C.sub.1-C.sub.20)-alkoxy, (C.sub.2-C.sub.20)-alkenyloxy,
(C.sub.2-C.sub.20)-alkynyloxy, retinyloxy,
(C.sub.1-C.sub.20)-alkoxy-(C.sub.1-C.sub.12)-alkyl,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxy,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.8)-alky-
l, (C.sub.6-C.sub.12)-aryloxy, (C.sub.7-C.sub.16)-aralkyloxy,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.6)-alkoxy,
(C.sub.7-C.sub.16)-aralkoxy-(C.sub.1-C.sub.6)-alkoxy,
(C.sub.1-C.sub.16)-hydroxyalkyl,
(C.sub.6-C.sub.16)-aryloxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.16)-aralkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.6)-alk-
yl,
(C.sub.7-C.sub.12)-aralkyloxy-(c.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.-
6)-alkyl, (C.sub.2-C.sub.20)-alkenyloxy-(C.sub.1-C.sub.6)-alkyl,
(C.sub.2-C.sub.20)-alkynyloxy-(C.sub.1-C.sub.6)-alkyl,
retinyloxy-(C.sub.1-C.sub.6)-alkyl,
--O--[CH.sub.2].sub.xCfH.sub.(2f+1-g)F.sub.g, --OCF.sub.2Cl,
--OCF.sub.2--CHFCl, (C.sub.1-C.sub.20)-alkylcarbonyl,
(C.sub.3-C.sub.8)-cycloalkylcarbonyl,
(C.sub.6-C.sub.12)-arylcarbonyl,
(C.sub.7-C.sub.16)-aralkylcarbonyl, cinnamoyl,
(C.sub.2-C.sub.20)-alkenylcarbonyl,
(C.sub.2-C.sub.20)-alkynylcarbonyl,
(C.sub.1-C.sub.20)-alkoxycarbonyl,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxycarbonyl,
(C.sub.6-C.sub.12)-aryloxycarbonyl,
(C.sub.7-C.sub.16)-aralkoxycarbonyl,
(C.sub.3-C.sub.8)-cycloalkoxycarbonyl,
(C.sub.2-C.sub.20)-alkenyloxycarbonyl, retinyloxycarbonyl,
(C.sub.2-C.sub.20)-alkynyloxycarbonyl,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.6)-alkoxycarbonyl,
(C.sub.7-C.sub.16)-aralkoxy-(C.sub.1-C.sub.6)-alkoxycarbonyl,
(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.6)-alkoxycarbonyl,
(C.sub.3-C.sub.8)-cycloalkoxy-(C.sub.1-C.sub.6)-alkoxycarbonyl,
(C.sub.1-C.sub.12)-alkylcarbonyloxy,
(C.sub.3-C.sub.8)-cycloalkylcarbonyloxy,
(C.sub.6-C.sub.12)-arylcarbonyloxy,
(C.sub.7-C.sub.16)-aralkylcarbonyloxy, cinnamoyloxy,
(C.sub.2-C.sub.12)-alkenylcarbonyloxy,
(C.sub.2-C.sub.12)-alkynylcarbonyloxy,
(C.sub.1-C.sub.12)-alkoxycarbonyloxy,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxycarbonyloxy,
(C.sub.6-C.sub.12)-aryloxycarbonyloxy,
(C.sub.7-C.sub.16)-aralkyloxycarbonyloxy,
(C.sub.3-C.sub.8)-cycloalkoxycarbonyloxy,
(C.sub.2-C.sub.12)-alkenyloxycarbonyloxy,
(C.sub.2-C.sub.12)-alkynyloxycarbonyloxy, carbamoyl,
N--(C.sub.1-C.sub.12)-alkylcarbamoyl,
N,N-di-(C.sub.1-C.sub.12)-alkylcarbamoyl,
N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyl,
N,N-dicyclo-(C.sub.3-C.sub.8)-alkylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyl,
N--((C.sub.3-C.sub.g)-cycloalkyl-(C.sub.1-C.sub.6)-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.6)-alkyl-N--((C.sub.3-C.sub.8)--cycloalkyl-(C.sub.1-C.s-
ub.6)-alkyl)-carbamoyl, N-(+)-dehydroabietylcarbamoyl,
N--(C.sub.1-C.sub.6)-alkyl-N-(+)-dehydroabietylcarbamoyl,
N--(C.sub.6-C.sub.12)-arylcarbamoyl,
N--(C.sub.7-C.sub.16)-aralkylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.16)-arylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylcarbamoyl,
N--((C.sub.1-C.sub.18)-alkoxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyl,
N--((C.sub.6-C.sub.16)-aryloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyl,
N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.-
10)-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub-
.10)-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.-
sub.10)-alkyl)-carbamoyl; CON(CH.sub.2).sub.h, in which a CH.sub.2
group can be replaced by O, S, N--(C.sub.1-C.sub.8)-alkylimino,
N--(C.sub.3-C.sub.8)-cycloalkylimino,
N--(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.4)-alkylimino,
N--(C.sub.6-C.sub.12)-arylimino,
N--(C.sub.7-C.sub.16)-aralkylimino,
N--(C.sub.1-C.sub.4)-alkoxy-(C.sub.1-C.sub.6)-alkylimino, and h is
from 3 to 7; a carbamoyl radical of the formula R
##STR00003##
in which R.sup.x and R.sup.v are each independently selected from
hydrogen, (C.sub.1-C.sub.6)-alkyl, (C.sub.3-C.sub.7)-cycloalkyl,
aryl, or the substituent of an .alpha.-carbon of an .alpha.-amino
acid, to which the L- and D-amino acids belong, s 1-5, T is OH, or
NR*R**, and R*, R** and R*** are identical or different and are
selected from hydrogen, (C.sub.6-C.sub.12)-aryl,
(C.sub.7-C.sub.11)-aralkyl, (C.sub.1-C.sub.8)-alkyl,
(C.sub.3-C.sub.8)-cycloalkyl, (+)-dehydroabietyl,
(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.12)-aralkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.1-C.sub.10)-alkanoyl, optionally substituted
(C.sub.7-C.sub.16)-aralkanoyl, optionally substituted
(C.sub.6-C.sub.12)-aroyl; or R* and R** together are
--[CH.sub.2].sub.h, in which a CH.sub.2 group can be replaced by O,
S, SO, SO.sub.2, N-acylamino,
N--(C.sub.1-C.sub.10)-alkoxycarbonylimino,
N--(C.sub.1-C.sub.g)-alkylimino,
N--(C.sub.3-C.sub.3)-cycloalkylimino,
N--(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.4)-alkylimino,
N--(C.sub.6-C.sub.12)-arylimino,
N--(C.sub.7-C.sub.16)-aralkylimino,
N--(C.sub.1-C.sub.4)-alkoxy-(C.sub.1-C.sub.6)-alkylimino, and h is
from 3 to 7; carbamoyloxy, N--(C.sub.1-C.sub.12)-alkylcarbamoyloxy,
N,N-di-(C.sub.1-C.sub.12)-alkylcarbamoyloxy,
N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyloxy,
N--(C.sub.6-C.sub.12)-arylcarbamoyloxy,
N--(C.sub.7-C.sub.16)-aralkylcarbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.12)-arylcarbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylcarbamoyloxy,
N--((C.sub.1-C.sub.10)-alkyl)-carbamoyloxy,
N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyloxy,
N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.-
10)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub-
.10)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.-
sub.10)-alkyl)-carbamoyloxyamino, (C.sub.1-C.sub.12)-alkylamino,
di-(C.sub.1-C.sub.12)-alkylamino,
(C.sub.3-C.sub.8)-cycloalkylamino, (C.sub.3-C.sub.12)-alkenylamino,
(C.sub.3-C.sub.12)-alkynylamino, N--(C.sub.6-C.sub.12)-arylamino,
N--(C.sub.7-C.sub.11)-aralkylamino, N-alkyl-aralkylamino,
N-alkyl-arylamino, (C.sub.1-C.sub.12)-alkoxyamino,
(C.sub.1-C.sub.12)-alkoxy-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.1-C.sub.12)-alkanoylamino,
(C.sub.3-C.sub.8)-cycloalkanoylamino,
(C.sub.6-C.sub.12)-aroylamino, (C.sub.7-C.sub.16)-aralkanoylamino,
(C.sub.1-C.sub.12)-alkanoyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.3-C.sub.8)-cycloalkanoyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.6-C.sub.12)-aroyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.7-C.sub.11)-aralkanoyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.1-C.sub.12)-alkanoylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.3-C.sub.8)-cycloalkanoylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)-aroylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.16)-aralkanoylamino-(C.sub.1-C.sub.8)-alkyl,
amino-(C.sub.1-C.sub.10)-alkyl,
N--(C.sub.1-C.sub.10)-alkylamino-(C.sub.1-C.sub.10)-alkyl,
N,N-di(C.sub.1-C.sub.10)-alkylamino-(C.sub.1-C.sub.10)-alkyl,
(C.sub.3-C.sub.8)-cycloalkylamino(C.sub.1-C.sub.10)-alkyl,
(C.sub.1-C.sub.20)-alkylmercapto, (C.sub.1-C.sub.20)-alkylsulfinyl,
(C.sub.1-C.sub.20)-alkylsulfonyl, (C.sub.6-C.sub.12)-arylmercapto,
(C.sub.6-C.sub.12)-arylsulfinyl, (C.sub.6-C.sub.12)-arylsulfonyl,
(C.sub.7-C.sub.16)-aralkylmercapto,
(C.sub.7-C.sub.16)-aralkylsulfinyl,
(C.sub.7-C.sub.16)-aralkylsulfonyl,
(C.sub.1-C.sub.12)-alkylmercapto-(C.sub.1-C.sub.6)-alkyl,
(C.sub.1-C.sub.12)-alkylsulfinyl-(C.sub.1-C.sub.6)-alkyl,
(C.sub.1-C.sub.12)-alkylsulfonyl-(C.sub.1-C.sub.6)-alkyl,
(C.sub.6-C.sub.12)-arylmercapto-(C.sub.1-C.sub.6)-alkyl,
(C.sub.6-C.sub.12)-arylsulfinyl-(C.sub.1-C.sub.6)-alkyl,
(C.sub.6-C.sub.12)-arylsulfonyl-(C.sub.1-C.sub.6)-alkyl,
(C.sub.7-C.sub.16)-aralkylmercapto-(C.sub.1-C.sub.6)-alkyl,
(C.sub.7-C.sub.16)-aralkylsulfinyl-(C.sub.1-C.sub.6)-alkyl,
(C.sub.7-C.sub.16)-aralkylsulfonyl-(C.sub.1-C.sub.6)-alkyl,
sulfamoyl, N--(C.sub.1-C.sub.10)-alkylsulfamoyl,
N,N-di-(C.sub.1-C.sub.10)-alkylsulfamoyl,
(C.sub.3-C.sub.8)-cycloalkylsulfamoyl,
N--(C.sub.6-C.sub.12)-arylsulfamoyl,
N--(C.sub.7-C.sub.16)-aralkylsulfamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.12)-arylsulfamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylsulfamoyl,
(C.sub.1-C.sub.10)-alkylsulfonamido,
N--((C.sub.1-C.sub.10)-alkyl)-(C.sub.1-C.sub.10)-alkylsulfonamido,
(C.sub.7-C.sub.16)-aralkylsulfonamido, and
N--((C.sub.1-C.sub.10)-alkyl-(C.sub.7-C.sub.16)-aralkylsulfonamido;
where an aryl radical may be substituted by 1 to 5 substituents
selected from hydroxyl, halogen, cyano, trifluoromethyl, nitro,
carboxyl, (C.sub.2-C.sub.16)-alkyl, (C.sub.3-C.sub.8)-cycloalkyl,
(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.12)-alkyl,
(C.sub.3-C.sub.8)-cycloalkoxy,
(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.12)-alkoxy,
(C.sub.3-C.sub.8)-cycloalkyloxy-(C.sub.1-C.sub.12)-alkyl,
(C.sub.3-C.sub.8)-cycloalkyloxy-(C.sub.1-C.sub.12)-alkoxy,
(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.8)-alkyl-(C.sub.1-C.sub.6)-al-
koxy,
(C.sub.3-C.sub.8)-cycloalkyl(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.-
6)-alkyl,
(C.sub.3-C.sub.8)-cycloalkyloxy-(C.sub.1-C.sub.8)-alkoxy-(C.sub.-
1-C.sub.6)-alkyl,
(C.sub.3-C.sub.8)-cycloalkoxy-(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.8)--
alkoxy, (C.sub.6-C.sub.12)-aryl, (C.sub.7-C.sub.16)-aralkyl,
(C.sub.2-C.sub.16)-alkenyl, (C.sub.2-C.sub.12)-alkynyl,
(C.sub.1-C.sub.16)-alkoxy, (C.sub.1-C.sub.16)-alkenyloxy,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkyl,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxy,
(C.sub.1-C.sub.12)-alkoxy(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.8)-alkyl-
, (C.sub.6-C.sub.12)-aryloxy, (C.sub.7-C.sub.16)-aralkyloxy,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.6)-alkoxy,
(C.sub.7-C.sub.16)-aralkoxy-(C.sub.1-C.sub.6)-alkoxy,
(C.sub.1-C.sub.8)-hydroxyalkyl,
(C.sub.6-C.sub.16)-aryloxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.16)-aralkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.6)-alk-
yl,
(C.sub.7-C.sub.12)-aralkyloxy-(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.-
6)-alkyl, --O--[CH.sub.2].sub.xC.sub.fH.sub.(2f+1-g)F.sub.g,
--OCF.sub.2Cl, --OCF.sub.2--CHFCl,
(C.sub.1-C.sub.12)-alkylcarbonyl,
(C.sub.3-C.sub.8)-cycloalkylcarbonyl,
(C.sub.6-C.sub.12)-arylcarbonyl,
(C.sub.7-C.sub.16)-aralkylcarbonyl,
(C.sub.1-C.sub.12)-alkoxycarbonyl,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxycarbonyl,
(C.sub.6-C.sub.12)-aryloxycarbonyl,
(C.sub.7-C.sub.16)-aralkoxycarbonyl,
(C.sub.3-C.sub.8)-cycloalkoxycarbonyl,
(C.sub.2-C.sub.12)-alkenyloxycarbonyl,
(C.sub.2-C.sub.12)-alkynyloxycarbonyl,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.6)-alkoxycarbonyl,
(C.sub.7-C.sub.16)-aralkoxy-(C.sub.1-C.sub.6)-alkoxycarbonyl,
(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.6)-alkoxycarbonyl,
(C.sub.3-C.sub.8)-cycloalkoxy-(C.sub.1-C.sub.6)-alkoxycarbonyl,
(C.sub.1-C.sub.12)-alkylcarbonyloxy,
(C.sub.3-C.sub.8)-cycloalkylcarbonyloxy,
(C.sub.6-C.sub.12)-arylcarbonyloxy,
(C.sub.7-C.sub.16)-aralkylcarbonyloxy, cinnamoyloxy,
(C.sub.2-C.sub.12)-alkenylcarbonyloxy,
(C.sub.2-C.sub.12)-alkynylcarbonyloxy,
(C.sub.1-C.sub.12)-alkoxycarbonyloxy,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxycarbonyloxy,
(C.sub.6-C.sub.12)--aryloxycarbonyloxy,
(C.sub.7-C.sub.16)-aralkyloxyoarbonyloxy,
(C.sub.3-C.sub.8)-cycloalkoxycarbonyloxy,
(C.sub.2-C.sub.12)-alkenyloxycarbonyloxy,
(C.sub.2-C.sub.12)-alkynyloxycarbonyloxy, carbamoyl,
N--(C.sub.1-C.sub.12)-alkylcarbamoyl,
N,N-di(C.sub.1-C.sub.12)-alkylcarbamoyl,
N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyl,
N,N-dicyclo-(C.sub.3-C.sub.8)-alkylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyl,
N--((C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.6)-alkyl)carbamoyl,
N--(C.sub.1-C.sub.6)-alkyl-N--((C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.su-
b.6)-alkyl)carbamoyl, N-(+)-dehydroabietylcarbamoyl,
N-(+)-dehydroabietylcarbamoyl, N--(C.sub.6-C.sub.12)-arylcarbamoyl,
N--(C.sub.7-C.sub.16)-aralkylcarbamoyl,
N--(C.sub.1-C.sub.10)--alkyl-N--(C.sub.6-C.sub.16)-arylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylcarbamoyl,
N--((C.sub.1-C.sub.16)-alkoxy-(C.sub.1-C.sub.10)-alkyl)carbamoyl,
N--((C.sub.6-C.sub.16)-aryloxy-(C.sub.1-C.sub.10)-alkyl)carbamoyl,
N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.sub.10)-alkyl)carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.-
10)-alkyl)carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub-
.10)-alkyl)carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.-
sub.10)-alkyl)-carbamoyl, CON(CH.sub.2).sub.h, in which a CH.sub.2
group can be replaced by, O, S, N--(C.sub.1-C.sub.8)-alkylimino,
N--(C.sub.3-C.sub.8)-cycloalkylimino,
N--(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.4)-alkylimino,
N--(C.sub.6-C.sub.12)-arylimino,
N--(C.sub.7-C.sub.16)-aralkylimino,
N--(C.sub.1-C.sub.4)-alkoxy-(C.sub.1-C.sub.6)-alkylimino, and h is
from 3 to 7; carbamoyloxy, N--(C.sub.1-C.sub.12)-alkylcarbamoyloxy,
N,N-di-(C.sub.1-C.sub.12)-alkylcarbamoyloxy,
N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyloxy,
N--(C.sub.6-C.sub.16)-arylcarbamoyloxy,
N--(C.sub.7-C.sub.16)-aralkylcarbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.12)-arylcarbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylcarbamoyloxy,
N--((C.sub.1-C.sub.10)-alkyl)carbamoyloxy,
N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.10)-alkyl)carbamoyloxy,
N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.sub.10)-alkyl)carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.1-
0)-alkyl)carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub-
.10)-alkyl)carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.-
sub.10-alkyl)carbamoyloxy, amino, (C.sub.1-C.sub.12)-alkylamino,
di-(C.sub.1-C.sub.12)-alkylamino,
(C.sub.3-C.sub.8)-cycloalkylamino, (C.sub.3-C.sub.12)-alkenylamino,
(C.sub.3-C.sub.12)-alkynylamino, N--(C.sub.6-C.sub.12)-arylamino,
N--(C.sub.7-C.sub.11)-aralkylamino, N-alkyl-aralkylamino,
N-alkyl-arylamino, (C.sub.1-C.sub.12)-alkoxyamino,
(C.sub.1-C.sub.12)-alkoxy-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.1-C.sub.12)-alkanoylamino,
(C.sub.3-C.sub.8)-cycloalkanoylamino,
(C.sub.6-C.sub.12)-aroylamino, (C.sub.7-C.sub.16)-aralkanoylamino,
(C.sub.1-C.sub.12)-alkanoyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.3-C.sub.8)-cycloalkanoyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.6-C.sub.12)-aroyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.7-C.sub.11)-aralkanoyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.1-C.sub.12)-alkanoylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.3-C.sub.8)-cycloalkanoylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)-aroylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.16)-aralkanoylamino-(C.sub.1-C.sub.8)-alkyl,
amino-(C.sub.1-C.sub.10)-alkyl,
N--(C.sub.1-C.sub.10)-alkylamino-(C.sub.1-C.sub.10)-alkyl,
N,N-di-(C.sub.1-C.sub.10)-alkylamino-(C.sub.1-C.sub.10)-alkyl,
(C.sub.3-C.sub.8)-cycloalkylamino-(C.sub.1-C.sub.10)-alkyl,
(C.sub.1-C.sub.12)-alkylmercapto, (C.sub.1-C.sub.12)-alkylsulfinyl,
(C.sub.1-C.sub.12)-alkylsulfonyl, (C.sub.6-C.sub.16)-arylmercapto,
(C.sub.6-C.sub.16)-arylsulfinyl, (C.sub.6-C.sub.16)-arylsulfonyl,
(C.sub.7-C.sub.16)-aralkylmercapto,
(C.sub.7-C.sub.16)-aralkylsulfinyl, or
(C.sub.7-C.sub.16)-aralkylsulfonyl; or wherein R.sup.1 and R.sup.2,
or R.sup.2 and R.sup.3 form a chain [CH.sub.2].sub.o, which is
saturated or unsaturated by a double bond, in which 1 or 2 CH.sub.2
groups are optionally replaced by O, S, SO, SO.sub.2, or NR', and
R' is hydrogen, (C.sub.6-C.sub.12)-aryl, (C.sub.1-C.sub.8)-alkyl,
(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.12)-aralkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.1-C.sub.10)-alkanoyl, optionally substituted
(C.sub.7-C.sub.16)-aralkanoyl, or optionally substituted
(C.sub.6-C.sub.12)-aroyl; and o is 3, 4 or 5; or wherein the
radicals R.sup.1 and R.sup.2, or R.sup.2 and R.sup.3, together with
the pyridine or pyridazine carrying them, form a
5,6,7,8-tetrahydroisoquinoline ring, a 5,6,7,8-tetrahydroquinoline
ring, or a 5,6,7,8-tetrahydrocinnoline ring; or wherein R.sup.1 and
R.sup.2, or R.sup.2 and R.sup.3 form a carbocyclic or heterocyclic
5- or 6-membered aromatic ring; or where R.sup.1 and R.sup.2, or
R.sup.2 and R.sup.3, together with the pyridine or pyridazine
carrying them, form an optionally substituted heterocyclic ring
systems selected from thienopyridines, furanopyridines,
pyridopyridines, pyrimidinopyridines, imidazopyridines,
thiazolopyridines, oxazolopyridines, quinoline, isoquinoline, and
cinnoline; where quinoline, isoquinoline or cinnoline preferably
satisfy the formulae Ia, Ib and Ic:
##STR00004##
and the substituents R.sup.12 to R.sup.23 in each case
independently of each other have the meaning of R.sup.1, R.sup.2
and R.sup.3; or wherein the radicals R.sup.1 and R.sup.2, together
with the pyridine carrying them, form a compound of Formula Id:
##STR00005##
where V is S, O, or NR.sup.k, and R.sup.k is selected from
hydrogen, (C.sub.1-C.sub.6)-alkyl, aryl, or benzyl; where an aryl
radical may be optionally substituted by 1 to 5 substituents as
defined above; and R.sup.24, R.sup.25, R.sup.26, and R.sup.27 in
each case independently of each other have the meaning of R.sup.1,
R.sup.2 and R.sup.3; f is 1 to 8; g is 0 or 1 to (2f+1); x is 0 to
3; and h is 3 to 7; including the physiologically active salts and
prodrugs derived therefrom.
[0029] In some embodiments, compounds of Formula (I) as defined
above include, but are not limited to,
N-((6-(1-butyloxy)-3-hydroxyquinolin-2-yl)-carbonyl)-glycine;
N-((6-chloro-3-hydroxyquinolin-2-yl)-carbonyl)-glycine;
N-((3-hydroxy-6-(2-propyloxy)-quinolin-2-yl)-carbonyl)-glycine; and
N-((7-chloro-3-hydroxyquinolin-2-yl)-carbonyl)-glycine;
[(3-methoxy-pyridine-2-carbonyl)-amino]-acetic acid;
3-methoxypyridine-2-carboxylic acid
N-(((hexadecyloxy)-carbonyl)-methyl)-amide hydrochloride,
3-methoxypyridine-2-carboxylic acid
N-(((1-octyloxy)-carbonyl)-methyl)-amide,
3-methoxypyridine-2-carboxylic acid
N-(((hexyloxy)-carbonyl)-methyl)-amide,
3-methoxypyridine-2-carboxylic acid
N-(((butyloxy)-carbonyl)-methyl)-amide,
3-methoxypyridine-2-carboxylic acid
N-(((2-nonyloxy)-carbonyl)-methyl)-amide racemate,
3-methoxypyridine-2-carboxylic acid
N-(((heptyloxy)-carbonyl)-methyl)-amide,
3-benzyloxypyridine-2-carboxylic acid
N-(((octyloxy)-carbonyl)-methyl)-amide,
3-benzyloxypyridine-2-carboxylic acid
N-(((butyloxy)-Carbonyl)-methyl)-amide,
5-(((3-(1-butyloxy)-propyl)-amino)-carbonyl)-3-methoxypyridine-2-carboxyl-
ic acid N-((benzyloxycarbonyl)-methyl)-amide,
5-(((3-(1-butyloxy)-propyl)-amino)-carbonyl)-3-methoxypyridine-2-carboxyl-
ic acid N-(((1-butyloxy)-carbonyl)-methyl)-amide,
5-[(3-lauryloxy)-propyl)amino)-carbonyl)-3-methoxypyridine-2-carboxylic
acid N-(((benzyloxy)-carbonyl)-methyl)-amide,
3-hydroxypyridine-2-carboxylic acid
N-(((hexadecyloxy)-carbonyl)-methyl)-amide hydrochloride,
3-hydroxypyridine-2-carboxylic acid
N-(((1-octyloxy)-carbonyl)-methyl)-amide,
3-hydroxypyridine-2-carboxylic acid
N-(((hexyloxy)-carbonyl)-methyl)-amide,
3-hydroxypyridine-2-carboxylic acid
N-(((butyloxy)-carbonyl)-methyl)-amide,
3-hydroxypyridine-2-carboxylic acid
N-(((2-nonyloxy)-carbonyl)-methyl)-amide racemate,
3-hydroxypyridine-2-carboxylic acid
N-(((heptyloxy)-carbonyl)-methyl)-amide,
3-benzyloxypyridine-2-carboxylic acid
N-(((octyloxy)-carbonyl)-methyl)-amide,
3-benzyloxypyridine-2-carboxylic acid
N-(((butyloxy)-carbonyl)-methyl)-amide,
5-(((3-(1-butyloxy)-propyl)-amino)-carbonyl)-3-hydroxypyridine-2-carboxyl-
ic acid N-((benzyloxycarbonyl)-methyl)-amide,
5-(((3-(1-butyloxy)-propyl)-amino)-carbonyl)-3-hydroxypyridine-2-carboxyl-
ic acid N-(((1-butyloxy)-carbonyl)-methyl)-amide, and
5-(((3-lauryloxy)-propyl)amino)-carbonyl)-3-hydroxypyridine-2-carboxylic
acid N-(((benzyloxy)-carbonyl)-methyl)-amide. In other embodiments,
compounds of Formula (Ia) as defined above include, but are not
limited to,
N-((6-(1-butyloxy)-3-hydroxyquinolin-2-yl)-carbonyl)-glycine,
N-((6-chloro-3-hydroxyquinolin-2-yl)-carbonyl)-glycine,
N-((3-hydroxy-6-(2-propyloxy)-quinolin-2-yl)-carbonyl)-glycine,
N-((7-chloro-3-hydroxy-quinoline-2-carbonyl)-amino]-acetic acid,
[(3-benzyloxy-7-chloro-quinoline-2-carbonyl)-amino]-acetic acid,
[(3-hydroxy-6-isopropoxy-quinoline-2-carbonyl)-amino]-acetic acid,
[(3-hydroxy-6-phenoxy-quinoline-2-carbonyl)-amino]-acetic acid, and
[(3-hydroxy-6-trifluoromethoxy-quinoline-2-carbonyl)-amino]-acetic
acid. In still other embodiments, compounds of Formula (Ib) as
defined above include, but are not limited to,
N-((1-chloro-4-hydroxy-7-(2-propyloxy)isoquinolin-3-yl)-carbonyl)-glycine-
, N-((7-bromo-4-hydroxy-isoquinoline-3-carbonyl)-amino)-acetic
acid,
N-((1-chloro-4-hydroxy-6-(2-propyloxy)isoquinolin-3-yl)-carbonyl)-glycine-
,
N-((1-chloro-4-hydroxy-7-methoxyisoquinolin-3-yl)-carbonyl)-glycine,
N-((1-chloro-4-hydroxy-6-methoxyisoquinolin-3-yl)-carbonyl)-glycine,
[(7-butoxy-1-chloro-4-hydroxy-isoquinoline-3-carbonyl)-amino]-acetic
acid,
N-((7-benzyloxy-1-chloro-4-hydroxyisoquinolin-3-yl)-carbonyl)-glyci-
ne,
N-((6-benzyloxy-1-chloro-4-hydroxyisoquinolin-3-yl)-carbonyl)-glycine,
[(1-chloro-4-hydroxy-isoquinoline-3-carbonyl)-amino]-acetic acid,
N-((8-chloro-4-hydroxyisoquinolin-3-yl)-carbonyl)-glycine, and
[(7-butoxy-4-hydroxy-isoquinoline-3-carbonyl)-amino]-acetic
acid.
[0030] In one aspect, a compound of the invention increases
endogenous erythropoietin plasma levels by increasing synthesis of
erythropoietin in tissues, such as renal, hepatic, hematopoietic,
and/or neural tissues, in vivo or ex vivo. In one embodiment, the
compound increases erythropoietin synthesis by inhibiting
hydroxylation of the alpha subunit of hypoxia inducible factor
(HIF.alpha.), thereby stabilizing HIF within a cell. In one
specific embodiment, the agent inhibits hydroxylation of the
HIF-1.alpha. P.sub.564 residue or a homologous proline in another
HIF.alpha. isoform. In another specific embodiment, the agent
inhibits hydroxylation of the HIF-1.alpha. P.sub.402 residue or a
homologous proline in another HIF.alpha. isoform. In yet another
embodiment, the compound may additionally inhibit hydroxylation of
HIF.alpha. asparagine residues. In one specific embodiment, the
agent inhibits hydroxylation of the HIF-1.alpha. N.sub.803 residue
or a homologous asparagine residue in another HIF.alpha.
isoform.
[0031] The present invention also provides methods for identifying
compounds that increase endogenous erythropoietin plasma levels,
the methods comprising administering a compound of interest to,
e.g., an animal or to cultured cells and measuring erythropoietin
in, e.g., the blood or conditioned culture media, respectively. An
increase in EPO in treated animals or cells relative to untreated
controls is indicative of a compound that increases endogenous EPO.
Alternatively, the methods identify compounds that indirectly
increase synthesis of erythropoietin by stabilizing HIF.alpha. in
cells.
[0032] The methods and compounds of the invention can be
administered in combination with various other therapeutic
approaches. In one embodiment, the compound is administered with an
iron supplement, e.g., ferrous sulfate, vitamin B.sub.12, and/or
folic acid. In another embodiment, the compound is administered in
conjunction with administration of exogenous erythropoietin, e.g.,
recombinant human erythropoietin, and/or granulocyte-colony
stimulating factor (G-CSF), e.g., recombinant G-CSF.
[0033] These and other embodiments of the subject invention will
readily occur to those of skill in the art in light of the
disclosure herein, and all such embodiments are specifically
contemplated.
BRIEF DESCRIPTION OF THE DRAWINGS
[0034] FIG. 1 shows erythropoietin induction in vitro in response
to compounds of the invention. Cells in culture were treated with
compounds at the concentrations indicated. Cell types shown in the
figure are human liver cells derived from a hepatocellular
carcinoma (Hep3B).
[0035] FIGS. 2A, 2B, and 2C show erythropoietin induction and
subsequent hematocrit increase in animals treated with a compound
of the invention. FIG. 2A shows expression of erythropoietin
transcript in the liver and kidney of animals treated for 3 days
with either a vehicle control (0 mg compound/kg body weight/day) or
a compound of the invention. FIG. 2B shows erythropoietin levels in
plasma, and FIG. 2C shows blood hematocrit, in blood samples
collected 4 hours after final treatment from the same animals
represented in FIG. 2A.
[0036] FIGS. 3A and 3B show increase in plasma erythropoietin and
resulting increase in hematocrit in animals treated with compounds
of the invention. FIG. 3A shows an increase in plasma
erythropoietin two days after treatment with compound. FIG. 3B
shows the increase in hematocrit 2 and 7 days after treatment with
various compounds of the invention.
[0037] FIGS. 4A, 4B, 4C, and 4D show changes in serum
erythropoietin, circulating blood reticulocytes, blood hemoglobin
level, and hematocrit, respectively, in animals treated with
variable dosing regimens of a compound of the invention.
[0038] FIGS. 5A and 5B show changes in hematocrit and circulating
blood reticulocytes in animals exposed to a single dose of
cisplatin and subsequently treated with a compound of the
invention.
[0039] FIGS. 6A, 6B, and 6C show expression of erythropoietin
transcripts in the brain, liver, and kidney, respectively, in
animals treated with a compound of the invention.
[0040] FIG. 7 shows increases in endogenous erythropoietin levels
in sham-operated and bilaterally nephrectomized animals treated
with a compound of the invention relative to untreated sham and BN
controls.
DESCRIPTION OF THE INVENTION
[0041] Before the present compositions and methods are described,
it is to be understood that the invention is not limited to the
particular methodologies, protocols, cell lines, assays, and
reagents described, as these may vary. It is also to be understood
that the terminology used herein is intended to describe particular
embodiments of the present invention, and is in no way intended to
limit the scope of the present invention as set forth in the
appended claims.
[0042] It must be noted that as used herein and in the appended
claims, the singular forms "a," "an," and "the" include plural
references unless context clearly dictates otherwise. Thus, for
example, a reference to "a fragment" includes a plurality of such
fragments, a reference to an "antibody" is a reference to one or
more antibodies and to equivalents thereof known to those skilled
in the art, and so forth.
[0043] Unless defined otherwise, all technical and scientific terms
used herein have the same meanings as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
any methods and materials similar or equivalent to those described
herein can be used in the practice or testing of the present
invention, the preferred methods, devices, and materials are now
described. All publications cited herein are incorporated herein by
reference in their entirety for the purpose of describing and
disclosing the methodologies, reagents, and tools reported in the
publications which might be used in connection with the invention.
Nothing herein is to be construed as an admission that the
invention is not entitled to antedate such disclosure by virtue of
prior invention.
[0044] The practice of the present invention will employ, unless
otherwise indicated, conventional methods of chemistry,
biochemistry, molecular biology, cell biology, genetics, immunology
and pharmacology, within the skill of the art. Such techniques are
explained fully in the literature. (See, e.g., Gennaro, A. R., ed.
(1990) Remington's Pharmaceutical Sciences, 18.sup.th ed., Mack
Publishing Co.; Colowick, S. et al., eds., Methods In Enzymology,
Academic Press, Inc.; Handbook of Experimental Immunology, Vols.
I-IV (D. M. Weir and C. C. Blackwell, eds., 1986, Blackwell
Scientific Publications); Maniatis, T. et al., eds. (1989)
Molecular Cloning: A Laboratory Manual, 2n.sup.d edition, Vols.
I-III, Cold Spring Harbor Laboratory Press; Ausubel, F. M. et al.,
eds. (1999) Short Protocols in Molecular Biology, 4.sup.th edition,
John Wiley & Sons; Ream et al., eds. (1998) Molecular Biology
Techniques: An Intensive Laboratory Course, Academic Press); PCR
(Introduction to Biotechniques Series), 2nd ed. (Newton &
Graham eds., 1997, Springer Verlag).)
DEFINITIONS
[0045] The term "anemia" as used herein refers to any abnormality
in hemoglobin or erythrocytes that leads to reduced oxygen levels
in the blood. Anemia can be associated with abnormal production,
processing, or performance of erythrocytes and/or hemoglobin. The
term anemia refers to any reduction in the number of red blood
cells and/or level of hemoglobin in blood relative to normal blood
levels.
[0046] Anemia can arise due to conditions such as acute or chronic
kidney disease, infections, inflammation, cancer, irradiation,
toxins, diabetes, and surgery. Infections may be due to, e.g.,
virus, bacteria, and/or parasites, etc. Inflammation may be due to
infection, autoimmune disorders, such as rheumatoid arthritis, etc.
Anemia can also be associated with blood loss due to, e.g., stomach
ulcer, duodenal ulcer, hemorrhoids, cancer of the stomach or large
intestine, trauma, injury, surgical procedures, etc. Anemia is
further associated with radiation therapy, chemotherapy, and kidney
dialysis. Anemia is also associated with HIV-infected patients
undergoing treatment with azidothymidine (zidovudine) or other
reverse transcriptase inhibitors, and can develop in cancer
patients undergoing chemotherapy, e.g., with cyclic cisplatin- or
non-cisplatin-containing chemotherapeutics. Aplastic anemia and
myelodysplastic syndromes are diseases associated with bone marrow
failure that result in decreased production of erythrocytes.
Further, anemia can result from defective or abnormal hemoglobin or
erythrocytes, such as in disorders including microcytic anemia,
hypochromic anemia, etc. Anemia can result from disorders in iron
transport, processing, and utilization, see, e.g., sideroblastic
anemia, etc.
[0047] The terms "disorders" and "diseases" and "conditions" are
used inclusively and refer to any condition deviating from
normal.
[0048] The terms "anemic conditions" and "anemic disorders" refer
to any condition, disease, or disorder associated with anemia. Such
disorders include, but are not limited to, those disorders listed
above. Anemic disorders further include, but are not limited to,
aplastic anemia, autoimmune hemolytic anemia, bone marrow
transplantation, Churg-Strauss syndrome, Diamond Blackfan anemia,
Fanconi's anemia, Felty syndrome, graft versus host disease,
hematopoietic stem cell transplantation, hemolytic uremic syndrome,
myelodysplasic syndrome, nocturnal paroxysmal hemoglobinuria,
osteomyelofibrosis, pancytopenia, pure red-cell aplasia, purpura
Schoenlein-Henoch, sideroblastic anemia, refractory anemia with
excess of blasts, rheumatoid arthritis, Shwachman syndrome, sickle
cell disease, thalassemia major, thalassemia minor,
thrombocytopenic purpura, etc.
[0049] The term "erythropoietin-associated conditions" is used
inclusively and refers to any condition associated with below
normal, abnormal, or inappropriate modulation of erythropoietin.
Erythropoietin-associated conditions include any condition wherein
an increase in EPO level would provide therapeutic benefit. Levels
of erythropoietin associated with such conditions can be determined
by any measure accepted and utilized by those of skill in the art.
Erythropoietin-associated conditions include anemic conditions such
as those described above.
[0050] Erythropoietin-associated conditions further include
neurological disorders and/or injuries, including cases of stroke,
trauma, epilepsy, neurodegenerative disease and the like, wherein
erythropoietin may provide a neuroprotective effect.
Neurodegenerative diseases contemplated by the invention include
Alzheimer's disease, Parkinson's disease, Huntington's disease, and
the like.
[0051] The term "erythropoietin" refers to any recombinant or
naturally occurring erythropoietin including, e.g., human
erythropoietin (GenBank Accession No. AAA52400; Lin et al. (1985)
Proc Natl Acad Sci USA 82:7580-7584), EPOETIN human recombinant
erythropoietin (Amgen, Inc., Thousand Oaks Calif.), ARANESP human
recombinant erythropoietin (Amgen), PROCRIT human recombinant
erythropoietin (Ortho Biotech Products, L.P., Raritan N.J.),
etc.
[0052] The term "HIF.alpha." refers to the alpha subunit of hypoxia
inducible factor protein. HIF.alpha. may be any human or other
mammalian protein, or fragment thereof, including human
HIF-1.alpha. (Genbank Accession No. Q16665), HIF-2.alpha. (Genbank
Accession No. AAB41495), and HIF-3.alpha. (Genbank Accession No.
AAD22668); murine HIF-1.alpha. (Genbank Accession No. Q61221),
HIF-2.alpha. (Genbank Accession No. BAA20130 and AAB41496), and
HIF-3.alpha. (Genbank Accession No. AAC72734); rat HIF-1.alpha.
(Genbank Accession No. CAA70701), HIF-2.alpha. (Genbank Accession
No. CAB96612), and HIF-3.alpha. (Genbank Accession No. CAB96611);
and bovine HIF-1.alpha. (Genbank Accession No. BAA78675).
HIF.alpha. may also be any non-mammalian protein or fragment
thereof, including Xenopus laevis HIF-1.alpha. (Genbank Accession
No. CAB96628), Drosophila melanogaster HIF-1.alpha. (Genbank
Accession No. JC4851), and chicken HIF-1.alpha. (Genbank Accession
No. BAA34234). HIF.alpha. gene sequences may also be obtained by
routine cloning techniques, for example by using all or part of a
HIF.alpha. gene sequence described above as a probe to recover and
determine the sequence of a HIF.alpha. gene in another species.
[0053] A fragment of HIF.alpha. includes any fragment retaining at
least one functional or structural characteristic of HIF.alpha..
Fragments of HIF.alpha. include, e.g., the regions defined by human
HIF-1.alpha. from amino acids 401 to 603 (Huang et al., supra),
amino acid 531 to 575 (Jiang et al. (1997) J Biol Chem
272:19253-19260), amino acid 556 to 575 (Tanimoto et al., supra),
amino acid 557 to 571 (Srinivas et al. (1999) Biochem Biophys Res
Commun 260:557-561), and amino acid 556 to 575 (Ivan and Kaelin
(2001) Science 292:464-468). Further, HIF.alpha. fragments include
any fragment containing at least one occurrence of the motif
LXXLAP, e.g., as occurs in the human HIF-1.alpha. native sequence
at L.sub.397TLLAP and L.sub.559EMLAP. For example, a HIF peptide
for use in the screening assay of Example 9 may comprise
[methoxycoumarin]-DLDLEALAPYIPADDDFQL-amide (SEQ ID NO:5).
[0054] The terms "amino acid sequence" or "polypeptide" as used
herein, e.g., to refer to HIF.alpha. and fragments thereof,
contemplate an oligopeptide, peptide, or protein sequence, or to a
fragment of any of these, and to naturally occurring or synthetic
molecules. "Fragments" can refer to any portion of a sequence that
retains at least one structural or functional characteristic of the
protein. Immunogenic fragments or antigenic fragments are fragments
of polypeptides, preferably, fragments of about five to fifteen
amino acids in length, that retain at least one biological or
immunological activity. Where "amino acid sequence" is used to
refer to the polypeptide sequence of a naturally occurring protein
molecule, "amino acid sequence" and like terms are not meant to
limit the amino acid sequence to the complete native sequence
associated with the recited protein molecule.
[0055] The term "related proteins" as used herein, for example, to
refer to proteins related to HIF.alpha. prolyl hydroxylase,
encompasses other 2-oxoglutarate dioxygenase enzymes, especially
those family members that similarly require Fe.sup.2+,
2-oxoglutarate, and oxygen to maintain hydroxylase activity. Such
enzymes include, but are not limited to, e.g., procollagen lysyl
hydroxylase, procollagen prolyl 4-hydroxylase, and Factor
Inhibiting HIF (FIH), an asparaginyl hydroxylase responsible for
regulating transactivation of HIF.alpha.. (GenBank Accession No.
AAL27308; Mahon et al. (2001) Genes Dev 15:2675-2686; Lando et al.
(2002) Science 295:858-861; and Lando et al. (2002) Genes Dev
16:1466-1471. See also Elkins et al. (2002) J Biol Chem C200644200,
etc.)
[0056] The terms "HIF prolyl hydroxylase" and "HIF PH" refer to any
enzyme capable of hydroxylating a proline residue in the HIF
protein. Preferably, the proline residue hydroxylated by HIF PH
includes the proline found within the motif LXXLAP, e.g., as occurs
in the human HIF-1.alpha. native sequence at L.sub.397TLLAP and
L.sub.559EMLAP. HIF PH includes members of the Egl-Nine (EGLN) gene
family described by Taylor (2001, Gene 275:125-132), and
characterized by Aravind and Koonin (2001, Genome Biol
2:RESEARCH0007), Epstein et al. (2001, Cell 107:43-54), and Bruick
and McKnight (2001, Science 294:1337-1340). Examples of HIF PH
enzymes include human SM-20 (EGLN1) (GenBank Accession No.
AAG33965; Dupuy et al. (2000) Genomics 69:348-54), EGLN2 isoform 1
(GenBank Accession No. CAC42510; Taylor, supra), EGLN2 isoform 2
(GenBank Accession No. NP.sub.--060025), and EGLN3 (GenBank
Accession No. CAC42511; Taylor, supra); mouse EGLN1 (GenBank
Accession No. CAC42515), EGLN2 (GenBank Accession No. CAC42511),
and EGLN3 (SM-20) (GenBank Accession No. CAC42517); and rat SM-20
(GenBank Accession No. AAA 19321). Additionally, HIF PH may include
Caenorhabditis elegans EGL-9 (GenBank Accession No. AAD56365) and
Drosophila melanogaster CG 1114 gene product (GenBank Accession No.
AAF52050). HIF PH also includes any fragment of the foregoing
full-length proteins that retain at least one structural or
functional characteristic.
[0057] The term "agonist" refers to a molecule that increases or
prolongs the duration of the effect of a particular molecule.
Agonists may include proteins, nucleic acids, carbohydrates, or any
other molecules that increase the effect(s) of the target
molecule.
[0058] The term "antagonist" refers to a molecule which decreases
the extent or duration of the effect of the biological or
immunological activity of a particular molecule. Antagonists may
include proteins, nucleic acids, carbohydrates, antibodies, or any
other molecules that decrease the effect(s) of the target
molecule.
[0059] The term "microarray" refers to any arrangement of nucleic
acids, amino acids, antibodies, etc., on a substrate. The substrate
can be any suitable support, e.g., beads, glass, paper,
nitrocellulose, nylon, or any appropriate membrane, etc. A
substrate can be any rigid or semi-rigid support including, but not
limited to, membranes, filters, wafers, chips, slides, fibers,
beads, including magnetic or nonmagnetic beads, gels, tubing,
plates, polymers, microparticles, capillaries, etc. The substrate
can provide a surface for coating and/or can have a variety of
surface forms, such as wells, pins, trenches, channels, and pores,
to which the nucleic acids, amino acids, etc., may be bound.
[0060] The term "excipient" as used herein means an inert or
inactive substance used in the production of pharmaceutical
products or other tablets, including without limitation any
substance used as a binder, disintegrant, coating,
compression/encapsulation aid, cream or lotion, lubricant,
parenteral, sweetener or flavoring, suspending/gelling agent, or
wet granulation agent. Binders include, e.g., carbopol, povidone,
xanthan gum, etc.; coatings include, e.g., cellulose acetate
phthalate, ethylcellulose, gellan gum, maltodextrin, etc.;
compression/encapsulation aids include, e.g., calcium carbonate,
dextrose, fructose dc, honey dc, lactose (anhydrate or monohydrate;
optionally in combination with aspartame, cellulose, or
microcrystalline cellulose), starch dc, sucrose, etc.;
disintegrants include, e.g., croscarmellose sodium, gellan gum,
sodium starch glycolate, etc.; creams and lotions include, e.g.,
maltodextrin, carrageenans, etc.; lubricants include, e.g.,
magnesium stearate, stearic acid, sodium stearyl fumarate, etc.;
materials for chewable tablets include, e.g., dextrose, fructose
dc, lactose (monohydrate, optionally in combination with aspartame
or cellulose), etc.; parenterals include, e.g., mannitol, povidone,
etc.; plasticizers include, e.g., dibutyl sebacate,
polyvinylacetate phthalate, etc.; suspending/gelling agents
include, e.g., carrageenan, sodium starch glycolate, xanthan gum,
etc.; sweeteners include, e.g., aspartame, dextrose, fructose dc,
sorbitol, sucrose dc, etc.; and wet granulation agents include,
e.g., calcium carbonate, maltodextrin, microcrystalline cellulose,
etc.
[0061] The term "loading dose" as used herein refers to a single or
multiple dose administered initially to rapidly achieve the desired
pharmacological level. For example, a loading dose in reference to
the methods of the invention refers to an initial dosing regimen
that rapidly increases, e.g., the plasma concentration of a
compound of the invention to a pharmaceutically active level.
[0062] The term "induction dose" as used herein refers to a
repeated dose strength administered initially to rapidly achieve
the desired physiological response. For example, an induction dose
in reference to the methods of the invention refers to an initial
dosing regimen that rapidly increases the hematocrit or hemoglobin
level to within a target range, which may be at or below normal
hematocrit/hemoglobin levels.
[0063] The term "maintenance dose" as used herein refers to the
dose level administered after a loading or induction dose in order
to maintain a desired physiological response. For example, a
maintenance dose in reference to the methods of the invention
refers to a dosing regimen that maintains hematocrit and/or
hemoglobin within a desired target range, which may be at or below
normal hematocrit/hemoglobin levels.
[0064] The term "sample" is used herein in its broadest sense.
Samples may be derived from any source, for example, from bodily
fluids, secretions, tissues, cells, or cells in culture including,
but not limited to, saliva, blood, urine, serum, plasma, vitreous,
synovial fluid, cerebral spinal fluid, amniotic fluid, and organ
tissue (e.g., biopsied tissue); from chromosomes, organelles, or
other membranes isolated from a cell; from genomic DNA, cDNA, RNA,
mRNA, etc.; and from cleared cells or tissues, or blots or imprints
from such cells or tissues. Samples may be derived from any source,
such as, for example, a human subject, or a non-human mammalian
subject, etc. Also contemplated are samples derived from any animal
model of disease. A sample can be in solution or can be, for
example, fixed or bound to a substrate. A sample can refer to any
material suitable for testing for the presence of erythropoietin or
HIF.alpha. or to fragments thereof, or suitable for screening for
molecules that increase endogenous levels of erythropoietin or
HIF.alpha. or to fragments thereof. Methods for obtaining such
samples are within the level of skill in the art.
[0065] The term "subject" is used herein in its broadest sense.
Subjects may include isolated cells, either prokaryotic or
eukaryotic, or tissues grown in culture. In certain embodiments, a
subject is an animal, particularly an animal selected from a
mammalian species including rat, rabbit, bovine, ovine, porcine,
canine, feline, murine, equine, and primate, particularly
human.
INVENTION
[0066] The present invention provides methods of increasing
endogenous erythropoietin (EPO). These methods can be applied in
vivo, e.g., in blood plasma, or in vitro, e.g., in cell culture
conditioned media. The invention further provides methods of
increasing endogenous EPO levels to prevent, pretreat, or treat
EPO-associated conditions, including, e.g., conditions associated
with anemia and neurological disorders. Conditions associated with
anemia include disorders such as acute or chronic kidney disease,
diabetes, cancer, ulcers, infection with virus, e.g., HIV,
bacteria, or parasites; inflammation, etc. Anemic conditions can
further include those associated with procedures or treatments
including, e.g., radiation therapy, chemotherapy, dialysis, and
surgery. Disorders associated with anemia additionally include
abnormal hemoglobin and/or erythrocytes, such as found in disorders
such as microcytic anemia, hypochromic anemia, aplastic anemia,
etc.
[0067] The present methods can be used to increase endogenous EPO
in a subject undergoing a specific treatment or procedure,
prophylactically or concurrently, for example, an HIV-infected
anemic patient being treated with azidothymidine (zidovudine) or
other reverse transcriptase inhibitors, an anemic cancer patient
receiving cyclic cisplatin- or non-cisplatin-containing
chemotherapeutics, or an anemic or non-anemic patient scheduled to
undergo surgery. Methods of increasing endogenous EPO can also be
used to prevent, pretreat, or treat EPO-associated conditions
associated with nerve damage or neural tissue degeneration
including, but not limited to, stroke, trauma, epilepsy, spinal
cord injury, and neurodegerative disorders.
[0068] Additionally, the methods can be used to increase endogenous
EPO levels in an anemic or non-anemic patient scheduled to undergo
surgery to reduce the need for allogenic blood transfusions or to
facilitate banking of blood prior to surgery. The small decreases
in hematocrit that typically occur after presurgical autologous
blood donation do not stimulate an increase in endogenous EPO or in
compensatory erythropoiesis. However, preoperative stimulation of
endogenous EPO would effectively increase erythrocyte mass and
autologous donation volumes while maintaining higher hematocrit
levels, and such methods are specifically contemplated herein. In
some surgical populations, particularly those individuals who
experience surgical blood losses in excess of 2 liters, the methods
of the invention could be applied to reduce allogeneic blood
exposure. (Crosby (2002) Amer J Therap 9:371-376.)
[0069] The methods of the invention can also be used to enhance
athletic performance, improve exercise capacity, and facilitate or
enhance aerobic conditioning. Such methods can be used, e.g., by
athletes to facilitate training and by soldiers to improve, e.g.,
stamina and endurance.
[0070] The methods of the invention have been shown to increase
endogenous erythropoietin levels in media from cultured cells
treated in vitro and in blood plasma from animals treated in vivo.
Although the kidney is the major source of erythropoietin in the
body, other organs, including brain, liver, and bone marrow, can
and do synthesize erythropoietin upon appropriate stimulation.
Using the methods of the invention, endogenous erythropoietin
expression can be increased in various organs of the body,
including brain, kidney, and liver. Indeed, methods of the
invention even increase endogenous erythropoietin levels in animals
that have undergone bilateral nephrectomy.
[0071] The methods of the invention demonstrate that erythropoietin
levels can be increased even when kidney function is compromised.
Although the invention is not to be limited by the mechanism by
which erythropoietin is produced, the decrease in erythropoietin
secretion typically seen during kidney failure may be due to
hyperoxia in renal tissue due to increased flowthrough/reperfusion.
(Priyadarshi et al. (2002) Kidney Int 61:542-546.)
[0072] Further, the methods of the invention increase the
hematocrit and blood hemoglobin level in animals treated in vivo.
The increases in plasma EPO, hematocrit, and blood hemoglobin in
response to the compounds used in the methods of the invention are
dose-sensitive; however, dosing regimes can be established which
produce a constant, controlled level of response to the compounds
of the invention. Further, treatment with compounds of the
invention can correct anemia, for example, induced by a toxic
compound such as the chemotherapeutic agent cisplatin, or due to
blood loss, e.g., trauma, injury, parasites, or surgery.
[0073] The increase in hematocrit and blood hemoglobin in animals
treated with compounds of the invention is preceded by an increase
in the percentage of circulating immature red blood cells
(reticulocytes) within the blood. As such, the invention
contemplates the use of the compounds of the invention in methods
to increase reticulocyte levels in the blood of animals for
production of cell-free reticulocyte lysates as described by, e.g.,
Pelham and Jackson. (1976, Eur J Biochem 67:247-256.) Circulating
reticulocyte levels are increased in animals, e.g., rabbits, etc.,
by treatment with compounds of the invention, alone or in
combination with another compound such as, e.g.,
acetylphenylhydrazine, etc. The blood is collected, and
reticulocytes are pelleted by centrifugation and lysed with
distilled water. Extracts can be further processed using any
appropriate methodology known to those skilled in the art. (See,
e.g., Jackson and Hunt (1983) Methods Enzymol 96:50-74.)
[0074] The invention also contemplates increasing iron transport,
processing, and utilization using the methods of the invention.
(See, e.g., commonly owned, copending U.S. patent application Ser.
No. 10/313,551, incorporated herein by reference in its entirety.)
Specifically, the methods of the invention may increase enzymes and
proteins involved in iron uptake, transport, and processing. Such
enzymes and proteins include, but are not limited to, transferrin
and transferrin receptor, which together facilitate iron transport
to and uptake by, e.g., erythroid tissue, and ceruloplasmin, a
ferroxidase required to oxidize ferrous iron to ferric iron. As
transferrin can only bind and transport ferric iron, ceruloplasmin
is important for supply of iron to tissues. The ability of the
methods of the invention to increase both endogenous erythropoietin
and transport and utilization of iron in a single course of
treatment provides benefits not addressed by current anemia
therapeutics, such as administration of recombinant erythropoietin,
in the treatment of anemic disorders including, but not limited to,
rheumatoid arthritis, sideroblastic anemia, etc.
[0075] Although the invention is not limited by the method in which
endogenous erythropoietin is induced, one specifically contemplated
mechanism by which the compounds increase synthesis of endogenous
erythropoietin is by inhibiting hydroxylation of the alpha subunit
of hypoxia inducible factor (HIF.alpha.). More specifically, the
compounds inhibit hydroxylation of HIF.alpha. proline residues,
e.g., the P.sub.564 residue in HIF-1.alpha. or a homologous proline
in another HIF.alpha. isoform, or the P.sub.402 residue in
HIF-1.alpha. or a homologous proline in another HIF.alpha. isoform.
Additionally, the compounds may be used to inhibit hydroxylation of
HIF.alpha. asparagine residues, e.g., the N.sub.803 residue of
HIF-1.alpha. or a homologous asparagine residue in another
HIF.alpha. isoform.
[0076] As HIF.alpha. is modified by hydroxylation, a reaction
requiring oxygen and Fe2.sup.+, the present invention contemplates
in one aspect that the enzyme responsible for HIF.alpha.
hydroxylation is a member of the 2-oxoglutarate dioxygenase family.
Such enzymes include, but are not limited to, procollagen lysyl
hydroxylase, procollagen prolyl 3-hydroxylase, procollagen prolyl
4-hydroxylase .alpha.(I) and .alpha.(II), thymine 7-hydroxylase,
aspartyl (asparaginyl) .beta.-hydroxylase,
.epsilon.-N-trimethyllysine hydroxylase, .gamma.-butyrobetaine
hydroxylase, etc. These enzymes require oxygen, Fe2.sup.+,
2-oxoglutarate, and ascorbic acid for their hydroxylase activity.
(See, e.g., Majamaa et al. (1985) Biochem J 229:127-133; Myllyharju
and Kivirikko (1997) EMBO J. 16:1173-1180; Thornburg et al. (1993)
32:14023-14033; and Jia et al. (1994) Proc Natl Acad Sci USA
91:7227-7231.)
[0077] Several small molecule inhibitors of prolyl 4-hydroxylase
have been identified. (See, e.g., Majamaa et al., supra; Kivirikko
and Myllyharju (1998) Matrix Biol 16:357-368; Bickel et al. (1998)
Hepatology 28:404-411; Friedman et al. (2000) Proc Natl Acad Sci
USA 97:4736-4741; and Franklin et al. (2001) Biochem J 353:333-338;
all incorporated by reference herein in their entirety.) The
present invention contemplates the use of these compounds in the
methods provided herein.
[0078] Compounds that can be used in the methods of the invention
include, e.g., structural-mimetics of 2-oxoglutarate. Such
compounds may inhibit the target 2-oxoglutarate dioxygenase family
member competitively with respect to 2-oxoglutarate and
noncompetitively with respect to iron. (Majamaa et al. (1984) Eur J
Biochem 138:239-45; and Majamaa et al., supra.)
[0079] In certain embodiments, compounds used in the methods of the
invention are selected from a compound of the formula (I)
##STR00006##
wherein A is 1,2-arylidene, 1,3-arylidene, 1,4-arylidene; or
(C.sub.1-C.sub.4)-alkylene, optionally substituted by one or two
halogen, cyano, nitro, trifluoromethyl, (C.sub.1-C.sub.6)-alkyl,
(C.sub.1-C.sub.6)-hydroxyalkyl, (C.sub.1-C.sub.6)-alkoxy,
--O--[CH.sub.2].sub.x--C.sub.fH.sub.(2f+1-g)Hal.sub.g,
(C.sub.1-C.sub.6)-fluoroalkoxy, (C.sub.1-C.sub.8)-fluoroalkenyloxy,
(C.sub.1-C.sub.8)-fluoroalkynyloxy, --OCF.sub.2Cl,
--O--CF.sub.2--CHFCl; (C.sub.1-C.sub.6)-alkylmercapto,
(C.sub.1-C.sub.6)-alkylsulfinyl, (C.sub.1-C.sub.6)-alkylsulfonyl,
(C.sub.1-C.sub.6)-alkylcarbonyl, (C.sub.1-C.sub.6)-alkoxycarbonyl,
carbamoyl, N--(C.sub.1-C.sub.4)-alkylcarbamoyl,
N,N-di-(C.sub.1-C.sub.4)-alkylcarbamoyl,
(C.sub.1-C.sub.6)-alkylcarbonyloxy, (C.sub.3-C.sub.8)-cycloalkyl,
phenyl, benzyl, phenoxy, benzyloxy, anilino, N-methylanilino,
phenylmercapto, phenylsulfonyl, phenylsulfinyl, sulfamoyl,
N--(C.sub.1-C.sub.4)-alkylsulfamoyl,
N,N-di-(C.sub.1-C.sub.4)-alkylsulfamoyl; or by a substituted
(C.sub.6-C.sub.12)-aryloxy, (C.sub.7-C.sub.11)-aralkyloxy,
(C.sub.6-C.sub.12)-aryl, (C.sub.7-C.sub.11)-aralkyl radical, which
carries in the aryl moiety one to five identical or different
substituents selected from halogen, cyano, nitro, trifluoromethyl,
(C.sub.1-C.sub.6)-alkyl, (C.sub.1-C.sub.6)-alkoxy,
--O--[CH.sub.2].sub.8--C.sub.2H.sub.(2f+1-g)Hal.sub.g,
--OCF.sub.2Cl, --O--CF.sub.2--CHFCl,
(C.sub.1-C.sub.6)-alkylmercapto, (C.sub.1-C.sub.6)-alkylsulfinyl,
(C.sub.1-C.sub.6)-alkylsulfonyl, (C.sub.1-C.sub.6)-alkylcarbonyl,
(C.sub.1-C.sub.6)-alkoxycarbonyl, carbamoyl,
N--(C.sub.1-C.sub.4)-alkylcarbamoyl,
N,N-di-(C.sub.1-C.sub.4)-alkylcarbamoyl,
(C.sub.1-C.sub.6)-alkylcarbonyloxy, (C.sub.3-C.sub.8)-cycloalkyl,
sulfamoyl, N--(C.sub.1-C.sub.4)-alkylsulfamoyl,
N,N-di-(C.sub.1-C.sub.4)-alkylsulfamoyl; or wherein A is
--CR.sup.5R.sup.6 and R.sup.5 and R.sup.6 are each independently
selected from hydrogen, (C.sub.1-C.sub.6)-alkyl,
(C.sub.3-C.sub.7)-cycloalkyl, aryl, or a substituent of the
.alpha.-carbon atom of an .alpha.-amino acid, wherein the amino
acid is a natural L-amino acid or its D-isomer. B is --CO.sub.2H,
--NH.sub.2, --NHSO.sub.2CF.sub.3, tetrazolyl, imidazolyl,
3-hydroxyisoxazolyl, --CONHCOR''', --CONHSOR''', CONHSO.sub.2R''',
where R''' is aryl, heteroaryl, (C.sub.3-C.sub.7)-cycloalkyl, or
(C.sub.1-C.sub.4)-alkyl, optionally monosubstituted by
(C.sub.6-C.sub.12)-aryl, heteroaryl, OH, SH,
(C.sub.1-C.sub.4)-alkyl, (C.sub.1-C.sub.4)-alkoxy,
(C.sub.1-C.sub.4)-thioalkyl, (C.sub.1-C.sub.4)-sulfinyl,
(C.sub.1-C.sub.4)-sulfonyl, CF.sub.3, Cl, Br, F, I, NO.sub.2,
--COOH, (C.sub.2-C.sub.5)-alkoxycarbonyl, NH.sub.2,
mono-(C.sub.1-C.sub.4-alkyl)-amino,
di-(C.sub.1-C.sub.4-alkyl)-amino, or
(C.sub.1-C.sub.4)-perfluoroalkyl; or wherein B is a CO.sub.2-G
carboxyl radical, where G is a radical of an alcohol G-OH in which
G is selected from (C.sub.1-C.sub.20)--alkyl radical,
(C.sub.3-C.sub.8) cycloalkyl radical, (C.sub.2-C.sub.20)-alkenyl
radical, (C.sub.3-C.sub.8)-cycloalkenyl radical, retinyl radical,
(C.sub.2-C.sub.20)-alkynyl radical, (C.sub.4-C.sub.20)-alkenynyl
radical, where the alkenyl, cycloalkenyl, alkynyl, and alkenynyl
radicals contain one or more multiple bonds;
(C.sub.6-C.sub.16)-carbocyclic aryl radical,
(C.sub.7-C.sub.16)-carbocyclic aralkyl radical, heteroaryl radical,
or heteroaralkyl radical, wherein a heteroaryl radical or
heteroaryl moiety of a heteroaralkyl radical contains 5 or 6 ring
atoms; and wherein radicals defined for G are substituted by one or
more hydroxyl, halogen, cyano, trifluoromethyl, nitro, carboxyl,
(C.sub.1-C.sub.12)-alkyl, --(C.sub.3-C.sub.8)-cycloalkyl,
(C.sub.5-C.sub.8)-cycloalkenyl, (C.sub.6-C.sub.12)-aryl,
(C.sub.7-C.sub.16)-aralkyl, (C.sub.2-C.sub.12)-alkenyl,
(C.sub.2-C.sub.12)-alkynyl, (C.sub.1-C.sub.12)-alkoxy,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkyl,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxy,
(C.sub.6-C.sub.12)-aryloxy, (C.sub.7-C.sub.16)-aralkyloxy,
(C.sub.1-C.sub.8)-hydroxyalkyl,
--O--[CH.sub.2].sub.x--C.sub.fH.sub.(2f+1-g)F.sub.g, --OCF.sub.2Cl,
--OCF.sub.2--CHFCl, (C.sub.1-C.sub.12)-alkylcarbonyl,
(C.sub.3-C.sub.8)-cycloalkylcarbonyl,
(C.sub.6-C.sub.12)-arylcarbonyl,
(C.sub.7-C.sub.16)-aralkylcarbonyl, cinnamoyl,
(C.sub.2-C.sub.12)-alkenylcarbonyl,
(C.sub.2-C.sub.12)-alkynylcarbonyl,
(C.sub.1-C.sub.12)-alkoxycarbonyl,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxycarbonyl,
(C.sub.6-C.sub.12)-aryloxycarbonyl,
(C.sub.7-C.sub.16)-aralkoxycarbonyl,
(C.sub.3-C.sub.8)-cycloalkoxycarbonyl,
(C.sub.2-C.sub.12)-alkenyloxycarbonyl,
(C.sub.2-C.sub.12)-alkynyloxycarbonyl, acyloxy,
(C.sub.1-C.sub.12)-alkoxycarbonyloxy,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxycarbonyloxy,
(C.sub.6-C.sub.12)-aryloxycarbonyloxy, (C.sub.7-C.sub.16)
aralkyloxycarbonyloxy, (C.sub.3-C.sub.8)-cycloalkoxycarbonyloxy,
(C.sub.2-C.sub.12)-alkenyloxycarbonyloxy,
(C.sub.2-C.sub.12)-alkynyloxycarbonyloxy, carbamoyl,
N--(C.sub.1-C.sub.12)-alkylcarbamoyl,
N,N-di(C.sub.1-C.sub.12)-alkylcarbamoyl,
N--(C.sub.3-C.sub.8)-cycloalkyl-carbamoyl,
N--(C.sub.6-C.sub.16)-arylcarbamoyl,
N--(C.sub.7-C.sub.16)-aralkylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.16)-arylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylcarbamoyl,
N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyl,
N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.10)alkyl)-carbamoyl,
N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.-
10)-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.6-C.sub.16)-aryloxy-(C.sub.1-C.sub-
.10)-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.-
sub.10)-alkyl)-carbamoyl, carbamoyloxy,
N--(C.sub.1-C.sub.12)-alkylcarbamoyloxy,
N,N-di-(C.sub.1-C.sub.12)-alkylcarbamoyloxy,
N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyloxy,
N--(C.sub.6-C.sub.12)-arylcarbamoyloxy,
N--(C.sub.7-C.sub.16)-aralkylcarbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.12)-arylcarbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylcarbamoyloxy,
N--((C.sub.1-C.sub.10-alkyl)-carbamoyloxy,
N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyloxy,
N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.1-
0)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub-
.10)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.-
sub.10)-alkyl)-carbamoyloxy, amino, (C.sub.1-C.sub.12)-alkylamino,
di-(C.sub.1-C.sub.12)-alkylamino,
(C.sub.3-C.sub.8)-cycloalkylamino, (C.sub.2-C.sub.12)-alkenylamino,
(C.sub.2-C.sub.12)-alkynylamino, N--(C.sub.6-C.sub.12)-arylamino,
N--(C--C.sub.11)-aralkylamino, N-alkyl-aralkylamino,
N-alkyl-arylamino, (C.sub.1-C.sub.12)-alkoxyamino,
(C.sub.1-C.sub.12)-alkoxy-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.1-C.sub.12)-alkylcarbonylamino,
(C.sub.3-C.sub.8)-cycloalkylcarbonylamino, (C.sub.6-C.sub.12)
arylcarbonylamino, (C.sub.7-C.sub.16)-aralkylcarbonylamino,
(C.sub.1-C.sub.12)-alkylcarbonyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.3-C.sub.8)-cycloalkylcarbonyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.6-C.sub.12)-arylcarbonyl-N--(C.sub.1-C.sub.10)alkylamino,
(C.sub.7-C.sub.11)-aralkylcarbonyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.1-C.sub.12)-alkylcarbonylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.3-C.sub.8)-cycloalkylcarbonylamino-(C.sub.1-C.sub.8)alkyl,
(C.sub.6-C.sub.12)-arylcarbonylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.12)-aralkylcarbonylamino(C.sub.1-C.sub.8)-alkyl,
amino-(C.sub.1-C.sub.10)-alkyl,
N--(C.sub.1-C.sub.10)alkylamino-(C.sub.1-C.sub.10)-alkyl,
N,N-di-(C.sub.1-C.sub.10)-alkylamino-(C.sub.1-C.sub.10)-alkyl,
(C.sub.3-C.sub.8)cycloalkylamino-(C.sub.1-C.sub.10)-alkyl,
(C.sub.1-C.sub.12)-alkylmercapto, (C.sub.1-C.sub.12)-alkylsulfinyl,
(C.sub.1-C.sub.12)-alkylsulfonyl, (C.sub.6-C.sub.16)-arylmercapto,
(C.sub.6-C.sub.16)-arylsulfinyl, (C.sub.6-C.sub.12)-arylsulfonyl,
(C.sub.7-C.sub.16)-aralkylmercapto,
(C.sub.7-C.sub.16)-aralkylsulfinyl,
(C.sub.7-C.sub.16)-aralkylsulfonyl, sulfamoyl,
N--(C.sub.1-C.sub.10)-alkylsulfamoyl,
N,N-di(C.sub.1-C.sub.10)-alkylsulfamoyl,
(C.sub.3-C.sub.8)-cycloalkylsulfamoyl,
N--(C.sub.6-C.sub.12)-alkylsulfamoyl,
N--(C.sub.7-C.sub.16)-aralkylsulfamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.12)-arylsulfamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylsulfamoyl,
(C.sub.1-C.sub.10)-alkylsulfonamido,
N--((C.sub.1-C.sub.10-alkyl)-(C.sub.1-C.sub.10)-alkylsulfonamido,
(C.sub.7-C.sub.16)-aralkylsulfonamido, or
N--((C.sub.1-C.sub.10)-alkyl-(C.sub.7-C.sub.16)-aralkylsulfonamido;
wherein radicals which are aryl or contain an aryl moiety, may be
substituted on the aryl by one to five identical or different
hydroxyl, halogen, cyano, trifluoromethyl, nitro, carboxyl,
(C.sub.1-C.sub.12)-alkyl, (C.sub.3-C.sub.8)-cycloalkyl,
(C.sub.6-C.sub.12)-aryl, (C.sub.7-C.sub.16)-aralkyl,
(C.sub.1-C.sub.12)-alkoxy,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)alkyl,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)alkoxy,
(C.sub.6-C.sub.12)-aryloxy, (C.sub.7-C.sub.16)-aralkyloxy,
(C.sub.1-C.sub.8)-hydroxyalkyl, (C.sub.1-C.sub.12)-alkylcarbonyl,
(C.sub.3-C.sub.8)-cycloalkyl-carbonyl,
(C.sub.6-C.sub.12)-arylcarbonyl, (C.sub.7-C.sub.16)aralkylcarbonyl,
(C.sub.1-C.sub.12)-alkoxycarbonyl,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxycarbonyl,
(C.sub.6-C.sub.12)-aryloxycarbonyl,
(C.sub.7-C.sub.16)-aralkoxycarbonyl,
(C.sub.3-C.sub.8)-cycloalkoxycarbonyl,
(C.sub.2-C.sub.12)-alkenyloxycarbonyl,
(C.sub.2-C.sub.12)-alkynyloxycarbonyl,
(C.sub.1-C.sub.12)-alkylcarbonyloxy,
(C.sub.3-C.sub.8)-cycloalkylcarbonyloxy,
(C.sub.6-C.sub.12)-arylcarbonyloxy,
(C.sub.7-C.sub.16)-aralkylcarbonyloxy, cinnamoyloxy,
(C.sub.2-C.sub.12)-alkenylcarbonyloxy,
(C.sub.2-C.sub.12)-alkynylcarbonyloxy,
(C.sub.1-C.sub.12)-alkoxycarbonyloxy,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxycarbonyloxy,
(C.sub.6-C.sub.12)-aryloxycarbonyloxy,
(C.sub.7-C.sub.16)-aralkyloxycarbonyloxy,
(C.sub.3-C.sub.8)-cycloalkoxycarbonyloxy,
(C.sub.2-C.sub.12)-alkenyloxycarbonyloxy,
(C.sub.2-C.sub.12)-alkynyloxycarbonyloxy, carbamoyl,
N--(C.sub.1-C.sub.12)-alkylcarbamoyl,
N,N-di-(C.sub.1-C.sub.12)-alkylcarbamoyl,
N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyl,
N--(C.sub.6-C.sub.12)-arylcarbamoyl,
N--(C.sub.7-C.sub.16)-aralkylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.12)-arylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyl,
N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyl,
N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.-
10)-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub-
.10)-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.-
sub.10)-alkyl)-carbamoyl, carbamoyloxy,
N--(C.sub.1-C.sub.12)-alkylcarbamoyloxy,
N,N-di-(C.sub.1-C.sub.12)-alkylcarbamoyloxy,
N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyloxy,
N--(C.sub.6-C.sub.12)-arylcarbamoyloxy,
N--(C.sub.7-C.sub.16)-aralkylcarbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.12)-arylcarbamoyloxy,
N(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylcarbamoyloxy,
N--((C.sub.1-C.sub.10)-alkyl)-carbamoyloxy,
N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyloxy,
N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.-
10)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub-
.10)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.-
sub.10)-alkyl)-carbamoyloxy, amino, (C.sub.1-C.sub.12)-alkylamino,
di-(C.sub.1-C.sub.12)-alkylamino,
(C.sub.3-C.sub.8)-cycloalkylamino, (C.sub.3-C.sub.12)-alkenylamino,
(C.sub.3-C.sub.12)-alkynylamino, N--(C.sub.6-C.sub.12)-arylamino,
N--(C.sub.7-C.sub.11)-aralkylamino, N-alkylaralkylamino,
N-alkyl-arylamino, (C.sub.1-C.sub.12)-alkoxyamino,
(C.sub.1-C.sub.12)-alkoxy-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.1-C.sub.12)-alkylcarbonylamino,
(C.sub.3-C.sub.8)-cycloalkylcarbonylamino,
(C.sub.6-C.sub.12)-arylcarbonylamino,
(C.sub.7-C.sub.16)-alkylcarbonylamino,
(C.sub.1-C.sub.12)-alkylcarbonyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.3-C.sub.8)-cycloalkylcarbonyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.6-C.sub.12)-arylcarbonyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.7-C.sub.11)-aralkylcarbonyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.1-C.sub.12)-alkylcarbonylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.3-C.sub.8)-cycloalkylcarbonylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)--arylcarbonylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.16)-aralkylcarbonylamino-(C.sub.1-C.sub.8)-alkyl,
amino-(C.sub.1-C.sub.10)-alkyl,
N--(C.sub.1-C.sub.10)-alkylamino-(C.sub.1-C.sub.10)alkyl,
N,N-di-(C.sub.1-C.sub.10)-alkylamino-(C.sub.1-C.sub.10)-alkyl,
(C.sub.3-C.sub.8)-cycloalkylamino-(C.sub.1-C.sub.10)-alkyl,
(C.sub.1-C.sub.12)-alkylmercapto, (C.sub.1-C.sub.12)-alkylsulfinyl,
(C.sub.1-C.sub.12)-alkylsulfonyl, (C.sub.6-C.sub.12)-arylmercapto,
(C.sub.6-C.sub.12)-arylsulfinyl, (C.sub.6-C.sub.12)-arylsulfonyl,
(C.sub.7-C.sub.16)-aralkylmercapto,
(C.sub.7-C.sub.16)-aralkylsulfinyl, or
(C.sub.7-C.sub.16)-aralkylsulfonyl;
X is O or S;
[0080] Q is O, S, NR', or a bond; where, if Q is a bond, R.sup.4 is
halogen, nitrile, or trifluoromethyl; or where, if Q is O, S, or
NR', R.sup.4 is hydrogen, (C.sub.1-C.sub.10)-alkyl radical,
(C.sub.2-C.sub.10)-alkenyl radical, (C.sub.2-C.sub.10)-alkynyl
radical, wherein alkenyl or alkynyl radical contains one or two
C--C multiple bonds; unsubstituted fluoroalkyl radical of the
formula --[CH.sub.2].sub.x--C.sub.fH.sub.(2+1-g)---F.sub.g,
(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.6)-alkyl radical,
(C.sub.1-C.sub.6)-alkoxy-(C.sub.1-C.sub.4)-alkoxy-(C.sub.1-C.sub.4)-alkyl
radical, aryl radical, heteroaryl radical,
(C.sub.7-C.sub.11)-aralkyl radical, or a radical of the formula
Z
--[CH.sub.2].sub.v--[O].sub.w--[CH.sub.2].sub.t-E (Z)
where E is a heteroaryl radical, a (C.sub.3-C.sub.8)-cycloalkyl
radical, or a phenyl radical of the formula F
##STR00007##
v is 0-6, w is 0 or 1, t is 0-3, and R.sup.7, R.sup.8, R.sup.9,
R.sup.10, and R.sup.11 are identical or different and are hydrogen,
halogen, cyano, nitro, trifluoromethyl, (C.sub.1-C.sub.6)-alkyl,
(C.sub.3-C.sub.8)-cycloalkyl, (C.sub.1-C.sub.6)-alkoxy,
--O--[CH.sub.2].sub.x--C.sub.fH.sub.(2f+1-g)--F.sub.g,
--OCF.sub.2--Cl, --O--CF.sub.2--CHFCl,
(C.sub.1-C.sub.6)-alkylmercapto, (C.sub.1-C.sub.6)-hydroxyalkyl,
(C.sub.1-C.sub.6)-alkoxy-(C.sub.1-C.sub.6)-alkoxy,
(C.sub.1-C.sub.6)-alkoxy-(C.sub.1-C.sub.6)-alkyl,
(C.sub.1-C.sub.6)-alkylsulfinyl, (C.sub.1-C.sub.6)-alkylsulfonyl,
(C.sub.1-C.sub.6)-alkylcarbonyl, (C.sub.1-C.sub.8)-alkoxycarbonyl,
carbamoyl, N--(C.sub.1-C.sub.8)-alkylcarbamoyl,
N,N-di-(C.sub.1-C.sub.8)-alkylcarbamoyl, or
(C.sub.7-C.sub.11)-aralkylcarbamoyl, optionally substituted by
fluorine, chlorine, bromine, trifluoromethyl,
(C.sub.1-C.sub.6)-alkoxy, N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyl,
N--(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.4)-alkylcarbamoyl,
(C.sub.1-C.sub.6)-alkylcarbonyloxy, phenyl, benzyl, phenoxy,
benzyloxy, NR.sup.YR.sup.Z wherein R.sup.y and R.sup.z are
independently selected from hydrogen, (C.sub.1-C.sub.12)-alkyl,
(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.12)-aralkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.3-C.sub.10)-cycloalkyl, (C.sub.3-C.sub.12)-alkenyl,
(C.sub.3-C.sub.12)-alkynyl, (C.sub.6-C.sub.12)-aryl,
(C.sub.7-C.sub.11)-aralkyl, (C.sub.1-C.sub.12)-alkoxy,
(C.sub.7-C.sub.12)aralkoxy, (C.sub.1-C.sub.12)-alkylcarbonyl,
(C.sub.3-C.sub.8)-cycloalkylcarbonyl, (C.sub.6-C.sub.12),
(C.sub.7-C.sub.16)-aralkylcarbonyl; or further wherein R.sup.y and
R.sup.z together are --[CH.sub.2].sub.h, in which a CH.sub.2 group
can be replaced by O, S, N--(C.sub.1-C.sub.4)-alkylcarbonylimino,
or N--(C.sub.1-C.sub.4)-alkoxycarbonylimino; phenylmercapto,
phenylsulfonyl, phenylsulfinyl, sulfamoyl,
N--(C.sub.1-C.sub.8)-alkylsulfamoyl, or
N,N-di-(C.sub.1-C.sub.8)-alkylsulfamoyl; or alternatively R.sup.7
and R.sup.8, R.sup.8 and R.sup.9, R.sup.9 and R.sup.10, or R.sup.10
and R.sup.11, together are a chain selected from
--[CH.sub.2].sub.n-- or --CH.dbd.CH--CH.dbd.CH--, where a CH.sub.2
group of the chain is optionally replaced by O, S, SO, SO.sub.2, or
NR.sup.Y; and n is 3, 4, or 5; and if E is a heteroaryl radical,
said radical can carry 1-3 substituents selected from those defined
for R.sup.7-R.sup.11, or if E is a cycloalkyl radical, the radical
can carry one substituent selected from those defined for
R.sup.7-R.sup.11; or where, if Q is NR', R.sup.4 is alternatively
R'', where R' and R'' are identical or different and are hydrogen,
(C.sub.6-C.sub.12)-aryl, (C.sub.7-C.sub.11)-aralkyl,
(C.sub.1-C.sub.8)-alkyl,
(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.12)-aralkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.1-C.sub.10)-alkylcarbonyl, optionally substituted
(C.sub.7-C.sub.16)-aralkylcarbonyl, or optionally substituted
C.sub.6-C.sub.12)-arylcarbonyl; or R' and R'' together are
--[CH.sub.2].sub.h, in which a CH.sub.2 group can be replaced by O,
S, N-acylimino, or N--(C.sub.1-C.sub.10)-alkoxycarbonylimino, and h
is 3 to 7.
Y is N or CR.sup.3;
[0081] R.sup.1, R.sup.2 and R.sup.3 are identical or different and
are hydrogen, hydroxyl, halogen, cyano, trifluoromethyl, nitro,
carboxyl, (C.sub.1-C.sub.20)-alkyl, (C.sub.3-C.sub.8)-cycloalkyl,
(C.sub.3-C.sub.8)cycloalkyl-(C.sub.1-C.sub.12)-alkyl,
(C.sub.3-C.sub.8)-cycloalkoxy,
(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.12)-alkoxy,
(C.sub.3-C.sub.8)-cycloalkyloxy-(C.sub.1-C.sub.12)-alkyl,
(C.sub.3-C.sub.8)-cycloalkyloxy-(C.sub.1-C.sub.12)-alkoxy,
(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.8)-alkyl-(C.sub.1-C.sub.6)-al-
koxy,
(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub-
.6)-alkyl,
(C.sub.3-C.sub.8)-cycloalkyloxy-(C.sub.1-C.sub.8)-alkoxy-(C.sub-
.1-C.sub.6)-alkyl,
(C.sub.3-C.sub.8)-cycloalkoxy-(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.8)--
alkoxy, (C.sub.6-C.sub.12)-aryl, (C.sub.7-C.sub.16)-aralkyl,
(C.sub.7-C.sub.16)-aralkenyl, (C.sub.7-C.sub.16)-aralkynyl,
(C.sub.2-C.sub.20)-alkenyl, (C.sub.2-C.sub.20)-alkynyl,
(C.sub.1-C.sub.20)-alkoxy, (C.sub.2-C.sub.20)-alkenyloxy,
(C.sub.2-C.sub.20)-alkynyloxy, retinyloxy,
(C.sub.1-C.sub.20)-alkoxy-(C.sub.1-C.sub.12)-alkyl,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxy,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.8)-alky-
l, (C.sub.6-C.sub.12)-aryloxy, (C.sub.7-C.sub.16)-aralkyloxy,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.6)-alkoxy,
(C.sub.7-C.sub.16)-aralkoxy-(C.sub.1-C.sub.6)-alkoxy,
(C.sub.1-C.sub.16)-hydroxyalkyl,
(C.sub.6-C.sub.16)-aryloxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.16)-aralkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.6)-alk-
yl,
(C.sub.7-C.sub.12)-aralkyloxy-(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.-
6)-alkyl, (C.sub.2-C.sub.20)-alkenyloxy-(C.sub.1-C.sub.6)-alkyl,
(C.sub.2-C.sub.20)-alkynyloxy-(C.sub.1-C.sub.6)-alkyl,
retinyloxy-(C.sub.1-C.sub.6)-alkyl,
--O--[CH.sub.2].sub.xCfH.sub.(2f+1-g)F.sub.g, --OCF.sub.2Cl,
--OCF.sub.2--CHFCl, (C.sub.1-C.sub.20)-alkylcarbonyl,
(C.sub.3-C.sub.8)-cycloalkylcarbonyl,
(C.sub.6-C.sub.12)-arylcarbonyl,
(C.sub.7-C.sub.16)-aralkylcarbonyl, cinnamoyl,
(C.sub.2-C.sub.20)-alkenylcarbonyl,
(C.sub.2-C.sub.20)-alkynylcarbonyl,
(C.sub.1-C.sub.20)-alkoxycarbonyl,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxycarbonyl,
(C.sub.6-C.sub.12)-aryloxycarbonyl,
(C.sub.7-C.sub.16)-aralkoxycarbonyl,
(C.sub.3-C.sub.8)-cycloalkoxycarbonyl,
(C.sub.2-C.sub.20)-alkenyloxycarbonyl, retinyloxycarbonyl,
(C.sub.2-C.sub.20)-alkynyloxycarbonyl,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.6)-alkoxycarbonyl,
(C.sub.7-C.sub.16)-aralkoxy-(C.sub.1-C.sub.6)--alkoxycarbonyl,
(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.6)-alkoxycarbonyl,
(C.sub.3-C.sub.8)-cycloalkoxy-(C.sub.1-C.sub.6)-alkoxycarbonyl,
(C.sub.1-C.sub.12)-alkylcarbonyloxy,
(C.sub.3-C.sub.8)-cycloalkylcarbonyloxy,
(C.sub.6-C.sub.12)-arylcarbonyloxy,
(C.sub.7-C.sub.16)-aralkylcarbonyloxy, cinnamoyloxy,
(C.sub.2-C.sub.12)-alkenylcarbonyloxy,
(C.sub.2-C.sub.12)-alkynylcarbonyloxy,
(C.sub.1-C.sub.12)-alkoxycarbonyloxy,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxycarbonyloxy,
(C.sub.6-C.sub.12)-aryloxycarbonyloxy,
(C.sub.7-C.sub.16)-aralkyloxycarbonyloxy,
(C.sub.3-C.sub.8)-cycloalkoxycarbonyloxy,
(C.sub.2-C.sub.12)-alkenyloxycarbonyloxy,
(C.sub.2-C.sub.12)-alkynyloxycarbonyloxy, carbamoyl,
N--(C.sub.1-C.sub.12)-alkylcarbamoyl,
N,N-di-(C.sub.1-C.sub.12)-alkylcarbamoyl,
N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyl,
N,N-dicyclo-(C.sub.3-C.sub.8)-alkylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyl,
N--((C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.6)-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.6)-alkyl-N--((C.sub.3-C.sub.g)--cycloalkyl-(C.sub.1-C.s-
ub.6)-alkyl)-carbamoyl, N-(+)-dehydroabietylcarbamoyl,
N--(C.sub.1-C.sub.6)-alkyl-N-(+)-dehydroabietylcarbamoyl,
N--(C.sub.6-C.sub.12)-arylcarbamoyl,
N--(C.sub.7-C.sub.16)-aralkylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.16)-arylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylcarbamoyl,
N--((C.sub.1-C.sub.18)-alkoxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyl,
N--((C.sub.6-C.sub.16)-aryloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyl,
N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.sub.10-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.1-
0)-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub-
.10)-alkyl)-carbamoyl,
N--((C.sub.1-C.sub.10)-alkyl-N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C-
.sub.10)-alkyl)-carbamoyl; CON(CH.sub.2).sub.h, in which a CH.sub.2
group can be replaced by O, S, N--(C.sub.1-C.sub.8)-alkylimino,
N--(C.sub.3-C.sub.8)-cycloalkylimino,
N--(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.4)-alkylimino,
N--(C.sub.6-C.sub.12)-arylimino,
N--(C.sub.7-C.sub.16)-aralkylimino,
N--(C.sub.1-C.sub.4)-alkoxy-(C.sub.1-C.sub.6)-alkylimino, and h is
from 3 to 7; a carbamoyl radical of the formula R
##STR00008##
in which R.sup.x and R.sup.v are each independently selected from
hydrogen, (C.sub.1-C.sub.6)-alkyl, (C.sub.3-C.sub.7)-cycloalkyl,
aryl, or the substituent of an .alpha.-carbon of an .alpha.-amino
acid, to which the L- and D-amino acids belong, s 1-5, T is OH, or
NR*R**, and R*, R** and R*** are identical or different and are
selected from hydrogen, (C.sub.6-C.sub.12)-aryl,
(C.sub.7-C.sub.11)-aralkyl, (C.sub.1-C.sub.8)-alkyl,
(C.sub.3-C.sub.8)-cycloalkyl, (+)-dehydroabietyl,
(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.12)-aralkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.1-C.sub.10)-alkanoyl, optionally substituted
(C.sub.7-C.sub.16)-aralkanoyl, optionally substituted
(C.sub.6-C.sub.12)-aroyl; or R* and R** together are
--[CH.sub.2].sub.h, in which a CH.sub.2 group can be replaced by O,
S, SO, SO.sub.2, N-acylamino,
N--(C.sub.1-C.sub.10)-alkoxycarbonylimino,
N--(C.sub.1-C.sub.8)-alkylimino,
N--(C.sub.3-C.sub.8)-cycloalkylimino,
N--(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.4)-alkylimino,
N--(C.sub.6-C.sub.12)-arylimino,
N--(C.sub.7-C.sub.16)-aralkylimino,
N--(C.sub.1-C.sub.4)-alkoxy-(C.sub.1-C.sub.6)-alkylimino, and h is
from 3 to 7; carbamoyloxy, N--(C.sub.1-C.sub.12)-alkylcarbamoyloxy,
N,N-di-(C.sub.1-C.sub.12)-alkylcarbamoyloxy,
N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyloxy,
N--(C.sub.6-C.sub.12)-arylcarbamoyloxy,
N--(C.sub.7-C.sub.16)-aralkylcarbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.12)-arylcarbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylcarbamoyloxy,
N--((C.sub.1-C.sub.10)--alkyl)-carbamoyloxy,
N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyloxy,
N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.-
10)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub-
.10)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.-
sub.10)-alkyl)-carbamoyloxyamino, (C.sub.1-C.sub.12)-alkylamino,
di-(C.sub.1-C.sub.12)-alkylamino,
(C.sub.3-C.sub.8)-cycloalkylamino, (C.sub.3-C.sub.12)-alkenylamino,
(C.sub.3-C.sub.12)-alkynylamino, N--(C.sub.6-C.sub.12)-arylamino,
N--(C.sub.7-C.sub.11)-aralkylamino, N-alkyl-aralkylamino,
N-alkyl-arylamino, (C.sub.1-C.sub.12)-alkoxyamino,
(C.sub.1-C.sub.12)-alkoxy-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.1-C.sub.12)-alkanoylamino,
(C.sub.3-C.sub.8)-cycloalkanoylamino,
(C.sub.6-C.sub.12)-aroylamino, (C.sub.7-C.sub.16)-aralkanoylamino,
(C.sub.1-C.sub.12)-alkanoyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.3-C.sub.8)-cycloalkanoyl-N--(C.sub.1-C.sub.10-alkylamino,
(C.sub.6-C.sub.12)-aroyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.7-C.sub.11)-aralkanoyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.1-C.sub.12)-alkanoylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.3-C.sub.8)-cycloalkanoylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)-aroylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.16)-aralkanoylamino-(C.sub.1-C.sub.8)-alkyl,
amino-(C.sub.1-C.sub.10)-alkyl,
N--(C.sub.1-C.sub.10)-alkylamino-(C.sub.1-C.sub.10)-alkyl,
N,N-di(C.sub.1-C.sub.10)-alkylamino-(C.sub.1-C.sub.10)-alkyl,
(C.sub.3-C.sub.8)-cycloalkylamino(C.sub.1-C.sub.10)-alkyl,
alkylmercapto, (C.sub.1-C.sub.20)-alkylsulfinyl,
(C.sub.1-C.sub.20)-alkylsulfonyl, (C.sub.6-C.sub.12)-arylmercapto,
(C.sub.6-C.sub.12)-arylsulfinyl, (C.sub.6-C.sub.12)-arylsulfonyl,
(C.sub.7-C.sub.16)-aralkylmercapto,
(C.sub.7-C.sub.16)-aralkylsulfinyl,
(C.sub.7-C.sub.16)-aralkylsulfonyl,
(C.sub.1-C.sub.12)-alkylmercapto-(C.sub.1-C.sub.6)-alkyl,
(C.sub.1-C.sub.12)-alkylsulfinyl-(C.sub.1-C.sub.6)-alkyl,
(C.sub.1-C.sub.12)-alkylsulfonyl-(C.sub.1-C.sub.6)-alkyl,
(C.sub.6-C.sub.12)-arylmercapto-(C.sub.1-C.sub.6)-alkyl,
(C.sub.6-C.sub.12)-arylsulfinyl-(C.sub.1-C.sub.6)-alkyl,
(C.sub.6-C.sub.12)-arylsulfonyl-(C.sub.1-C.sub.6)-alkyl,
(C.sub.7-C.sub.16)-aralkylmercapto-(C.sub.1-C.sub.6)-alkyl,
(C.sub.7-C.sub.16)-aralkylsulfinyl-(C.sub.1-C.sub.6)-alkyl,
(C.sub.7-C.sub.16)-aralkylsulfonyl-(C.sub.1-C.sub.6)-alkyl,
sulfamoyl, N--(C.sub.1-C.sub.10)-alkylsulfamoyl,
N,N-di-(C.sub.1-C.sub.10-alkylsulfarnoyl,
(C.sub.3-C.sub.8)-cycloalkylsulfamoyl,
N--(C.sub.6-C.sub.12)-arylsulfamoyl,
N--(C.sub.7-C.sub.16)-aralkylsulfamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.12)-arylsulfamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylsulfamoyl,
alkylsulfonamido,
N--((C.sub.1-C.sub.10)-alkyl)-(C.sub.1-C.sub.10)-alkylsulfonamido,
(C.sub.7-C.sub.16)-aralkylsulfonamido, and
N--((C.sub.1-C.sub.10)-alkyl-(C.sub.7-C.sub.16)-aralkylsulfonamido;
where an aryl radical may be substituted by 1 to 5 substituents
selected from hydroxyl, halogen, cyano, trifluoromethyl, nitro,
carboxyl, (C.sub.2-C.sub.16)-alkyl, (C.sub.3-C.sub.8)-cycloalkyl,
(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.12)-alkyl,
(C.sub.3-C.sub.8)-cycloalkoxy,
(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.12)-alkoxy,
(C.sub.3-C.sub.8)-cycloalkyloxy-(C.sub.1-C.sub.12)-alkyl,
(C.sub.3-C.sub.8)-cycloalkyloxy-(C.sub.1-C.sub.12)-alkoxy,
(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.8)-alkyl-(C.sub.1-C.sub.6)-al-
koxy,
(C.sub.3-C.sub.8)-cycloalkyl(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.-
6)-alkyl,
(C.sub.3-C.sub.8)-cycloalkyloxy-(C.sub.1-C.sub.8)-alkoxy-(C.sub.-
1-C.sub.6)-alkyl,
(C.sub.3-C.sub.8)-cycloalkoxy-(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.8)--
alkoxy, (C.sub.6-C.sub.12)-aryl, (C.sub.7-C.sub.16)-aralkyl,
(C.sub.2-C.sub.16)-alkenyl, (C.sub.2-C.sub.12)-alkynyl,
(C.sub.1-C.sub.16)-alkoxy, (C.sub.1-C.sub.16)-alkenyloxy,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkyl,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxy,
(C.sub.1-C.sub.12)-alkoxy(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.8)-alkyl-
, (C.sub.6-C.sub.12)-aryloxy, (C.sub.7-C.sub.16)-aralkyloxy,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.6)-alkoxy,
(C.sub.7-C.sub.16)-aralkoxy-(C.sub.1-C.sub.6)-alkoxy,
(C.sub.1-C.sub.8)-hydroxyalkyl,
(C.sub.6-C.sub.16)-aryloxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.16)-aralkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.6)-alk-
yl,
(C.sub.7-C.sub.12)-aralkyloxy-(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.-
6)-alkyl, --O--[CH.sub.2].sub.xC.sub.fH.sub.(2f+1-g)F.sub.g,
--OCF.sub.2Cl, --OCF.sub.2--CHFCl,
(C.sub.1-C.sub.12)-alkylcarbonyl,
(C.sub.3-C.sub.8)-cycloalkylcarbonyl,
(C.sub.6-C.sub.12)-arylcarbonyl,
(C.sub.7-C.sub.16)-aralkylcarbonyl,
(C.sub.1-C.sub.12)-alkoxycarbonyl,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxycarbonyl,
(C.sub.6-C.sub.12)-aryloxycarbonyl,
(C.sub.7-C.sub.16)-aralkoxycarbonyl,
(C.sub.3-C.sub.8)-cycloalkoxycarbonyl,
(C.sub.2-C.sub.12)-alkenyloxycarbonyl,
(C.sub.2-C.sub.12)-alkynyloxycarbonyl,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.6)-alkoxycarbonyl,
(C.sub.7-C.sub.16)-aralkoxy-(C.sub.1-C.sub.6)-alkoxycarbonyl,
(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.6)-alkoxycarbonyl,
(C.sub.3-C.sub.8)-cycloalkoxy-(C.sub.1-C.sub.6)-alkoxycarbonyl,
(C.sub.1-C.sub.12)-alkylcarbonyloxy,
(C.sub.3-C.sub.8)-cycloalkylcarbonyloxy,
(C.sub.6-C.sub.12)-arylcarbonyloxy,
(C.sub.7-C.sub.16)-aralkylcarbonyloxy, cinnamoyloxy,
(C.sub.2-C.sub.12)-alkenylcarbonyloxy,
(C.sub.2-C.sub.12)-alkynylcarbonyloxy,
(C.sub.1-C.sub.12)-alkoxycarbonyloxy,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxycarbonyloxy,
(C.sub.6-C.sub.12)-aryloxycarbonyloxy,
(C.sub.7-C.sub.16)-aralkyloxycarbonyloxy,
(C.sub.3-C.sub.8)-cycloalkoxycarbonyloxy,
(C.sub.2-C.sub.12)-alkenyloxycarbonyloxy,
(C.sub.2-C.sub.12)-alkynyloxycarbonyloxy, carbamoyl,
N--(C.sub.1-C.sub.12)-alkylcarbamoyl,
N,N-di(C.sub.1-C.sub.12)-alkylcarbamoyl,
N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyl,
N,N-dicyclo-(C.sub.3-C.sub.8)-alkylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyl,
N--((C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.6)-alkyl)carbamoyl,
N--(C.sub.1-C.sub.6)-alkyl-N--(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub-
.6)-alkyl)carbamoyl, N-(+)-dehydroabietylcarbamoyl,
N--(C.sub.1-C.sub.6)-alkyl-N-(+)-dehydroabietylcarbamoyl,
N--(C.sub.6-C.sub.12)-arylcarbamoyl,
N--(C.sub.7-C.sub.16)-aralkylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.16)-arylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylcarbamoyl,
N--((C.sub.1-C.sub.16)-alkoxy-(C.sub.1-C.sub.10)-alkyl)carbamoyl,
N--(C.sub.6-C.sub.16)-aryloxy-(C.sub.1-C.sub.10)-alkyl)carbamoyl,
N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.sub.10)-alkyl)carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.-
10)-alkyl)carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub-
.10)-alkyl)carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.-
sub.10)-alkyl)-carbamoyl, CON(CH.sub.2).sub.h, in which a CH.sub.2
group can be replaced by, O, S, N--(C.sub.1-C.sub.8)-alkylimino,
N--(C.sub.3-C.sub.8)-cycloalkylimino,
N--(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.4)-alkylimino,
N--(C.sub.6-C.sub.12)-arylimino,
N--(C.sub.7-C.sub.16)-aralkylimino,
N--(C.sub.1-C.sub.4)-alkoxy-(C.sub.1-C.sub.6)-alkylimino, and h is
from 3 to 7; carbamoyloxy, N--(C.sub.1-C.sub.12)-alkylcarbamoyloxy,
N,N-di-(C.sub.1-C.sub.12)-alkylcarbamoyloxy,
N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyloxy,
N--(C.sub.6-C.sub.16)-arylcarbamoyloxy,
N--(C.sub.7-C.sub.16)-aralkylcarbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.12)-arylcarbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylcarbamoyloxy,
N--((C.sub.1-C.sub.10)-alkyl)carbamoyloxy,
N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.10)-alkyl)carbamoyloxy,
N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.sub.10)-alkyl)carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.-
10)-alkyl)carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub-
.10)-alkyl)carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.-
sub.10)-alkyl)carbamoyloxy, amino, (C.sub.1-C.sub.12)-alkylamino,
di-(C.sub.1-C.sub.12)-alkylamino,
(C.sub.3-C.sub.8)-cycloalkylamino, (C.sub.3-C.sub.12)-alkenylamino,
(C.sub.3-C.sub.12)-alkynylamino, N--(C.sub.6-C.sub.12)-arylamino,
N--(C.sub.7-C.sub.11)-aralkylamino, N-alkyl-aralkylamino,
N-alkyl-arylamino, (C.sub.1-C.sub.12)-alkoxyamino,
(C.sub.1-C.sub.12)-alkoxy-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.1-C.sub.12)-alkanoylamino,
(C.sub.3-C.sub.8)-cycloalkanoylamino,
(C.sub.6-C.sub.12)-aroylamino, (C.sub.7-C.sub.16)-aralkanoylamino,
(C.sub.1-C.sub.12)-alkanoyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.3-C.sub.8)-cycloalkanoyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.6-C.sub.12)-aroyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.7-C.sub.11)-aralkanoyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.1-C.sub.12)-alkanoylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.3-C.sub.8)-cycloalkanoylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)-aroylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.16)-aralkanoylamino-(C.sub.1-C.sub.8)-alkyl,
amino-(C.sub.1-C.sub.10)-alkyl,
N--(C.sub.1-C.sub.10)-alkylamino-(C.sub.1-C.sub.10)-alkyl,
N,N-di-(C.sub.1-C.sub.10)-alkylamino-(C.sub.1-C.sub.10)-alkyl,
(C.sub.3-C.sub.8)-cycloalkylamino-(C.sub.1-C.sub.10)-alkyl,
(C.sub.1-C.sub.12)-alkylmercapto, (C.sub.1-C.sub.12)-alkylsulfinyl,
(C.sub.1-C.sub.12)-alkylsulfonyl, (C.sub.6-C.sub.16)-arylmercapto,
(C.sub.6-C.sub.16)-arylsulfinyl, (C.sub.6-C.sub.16)-arylsulfonyl,
(C.sub.7-C.sub.16)-aralkylmercapto,
(C.sub.7-C.sub.16)-aralkylsulfinyl, or
(C.sub.7-C.sub.16)-aralkylsulfonyl; or wherein R.sup.1 and R.sup.2,
or R.sup.2 and R.sup.3 form a chain [CH.sub.2].sub.o, which is
saturated or unsaturated by a C.dbd.C double bond, in which 1 or 2
CH.sub.2 groups are optionally replaced by O, S, SO, SO.sub.2, or
NR', and R' is hydrogen, (C.sub.6-C.sub.12)-aryl,
(C.sub.1-C.sub.8)-alkyl,
(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.12)-aralkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.1-C.sub.10)-alkanoyl, optionally substituted
(C.sub.7-C.sub.16)-aralkanoyl, or optionally substituted
(C.sub.6-C.sub.12)-aroyl; and o is 3, 4 or 5; or wherein the
radicals R.sup.1 and R.sup.2, or R.sup.2 and R.sup.3, together with
the pyridine or pyridazine carrying them, form a
5,6,7,8-tetrahydroisoquinoline ring, a 5,6,7,8-tetrahydroquinoline
ring, or a 5,6,7,8-tetrahydrocinnoline ring; or wherein R.sup.1 and
R.sup.2, or R.sup.2 and R.sup.3 form a carbocyclic or heterocyclic
5- or 6-membered aromatic ring; or where R.sup.1 and R.sup.2, or
R.sup.2 and R.sup.3, together with the pyridine or pyridazine
carrying them, form an optionally substituted heterocyclic ring
systems selected from thienopyridines, furanopyridines,
pyridopyridines, pyrimidinopyridines, imidazopyridines,
thiazolopyridines, oxazolopyridines, quinoline, isoquinoline, and
cinnoline; where quinoline, isoquinoline or cinnoline preferably
satisfy the formulae Ia, Ib and Ic:
##STR00009##
and the substituents R.sup.12 to R.sup.23 in each case
independently of each other have the meaning of R.sup.1, R.sup.2
and R.sup.3; or wherein the radicals R.sup.1 and R.sup.2, together
with the pyridine carrying them, form a compound of Formula Id:
##STR00010##
where V is S, O, or NR.sup.k, and R.sup.k is selected from
hydrogen, (C.sub.1-C.sub.6)-alkyl, aryl, or benzyl; where an aryl
radical may be optionally substituted by 1 to 5 substituents as
defined above; and R.sup.24, R.sup.25, R.sup.26, and R.sup.27 in
each case independently of each other have the meaning of R.sup.1,
R.sup.2 and R.sup.3; f is 1 to 8; g is 0 or 1 to (2f+1); x is 0 to
3; and h is 3 to 7; including the physiologically active salts and
prodrugs derived therefrom.
[0082] Exemplary compounds according to Formula (I) are described
in European Patent Nos. EP0650960 and EP0650961. All compounds
listed in EP0650960 and EP0650961, in particular, those listed in
the compound claims and the final products of the working examples,
are hereby incorporated into the present application by reference
herein. An exemplary compound contained therein is
[(3-methoxy-pyridine-2-carbonyl)-amino]-acetic acid.
[0083] Additionally, exemplary compounds according to Formula (I)
are described in U.S. Pat. No. 5,658,933. All compounds listed in
U.S. Pat. No. 5,658,933, in particular, those listed in the
compound claims and the final products of the working examples, are
hereby incorporated into the present application by reference
herein. Exemplary compounds of Formula (I) include, but are not
limited to, 3-methoxypyridine-2-carboxylic acid
N-(((hexadecyloxy)-carbonyl)-methyl)-amide hydrochloride,
3-methoxypyridine-2-carboxylic acid
N-(((1-octyloxy)-carbonyl)-methyl)-amide,
3-methoxypyridine-2-carboxylic acid
N-(((hexyloxy)-carbonyl)-methyl)-amide,
3-methoxypyridine-2-carboxylic acid
N-(((butyloxy)-carbonyl)-methyl)-amide,
3-methoxypyridine-2-carboxylic acid
N-(((2-nonyloxy)-carbonyl)-methyl)-amide racemate,
3-methoxypyridine-2-carboxylic acid
N-(((heptyloxy)-carbonyl)-methyl)-amide,
3-benzyloxypyridine-2-carboxylic acid
N-(((octyloxy)-carbonyl)-methyl)-amide,
3-benzyloxypyridine-2-carboxylic acid
N-(((butyloxy)-carbonyl)-methyl)-amide,
5-(((3-(1-butyloxy)-propyl)-amino)-carbonyl)-3-methoxypyridine-2-carboxyl-
ic acid N-((benzyloxycarbonyl)-methyl)-amide,
5-(((3-(1-butyloxy)-propyl)-amino)-carbonyl)-3-methoxypyridine-2-carboxyl-
ic acid N-(((1-butyloxy)-carbonyl)-methyl)-amide, and
5-(((3-lauryloxy)-propyl)amino)-carbonyl)-3-methoxypyridine-2-carboxylic
acid N-(((benzyloxy)-carbonyl)-methyl)-amide.
[0084] Additional compounds according to Formula (I) are
substituted heterocyclic carboxyamides described in U.S. Pat. No.
5,620,995; 3-hydroxypyridine-2-carboxamidoesters described in U.S.
Pat. No. 6,020,350; sulfonamidocarbonylpyridine-2-carboxamides
described in U.S. Pat. No. 5,607,954; and
sulfonamidocarbonyl-pyridine-2-carboxamides and
sulfonamidocarbonyl-pyridine-2-carboxesteramides described in U.S.
Pat. Nos. 5,610,172 and 5,620,996. All compounds listed in these
patents, in particular, those compounds listed in the compound
claims and the final products of the working examples, are hereby
incorporated into the present application by reference herein.
Exemplary compounds of Formula (I) include, but are not limited to,
3-methoxypyridine-2-carboxylic acid
N-(((hexadecyloxy)-carbonyl)-methyl)-amide hydrochloride,
3-methoxypyridine-2-carboxylic acid
N-(((1-octyloxy)-carbonyl)-methyl)-amide,
3-methoxypyridine-2-carboxylic acid
N-(((hexyloxy)-carbonyl)-methyl)-amide,
3-methoxypyridine-2-carboxylic acid
N-(((butyloxy)-carbonyl)-methyl)-amide,
3-methoxypyridine-2-carboxylic acid
N-(((2-nonyloxy)-carbonyl)-methyl)-amide racemate,
3-methoxypyridine-2-carboxylic acid
N-(((heptyloxy)-carbonyl)-methyl)-amide,
3-benzyloxypyridine-2-carboxylic acid
N-(((octyloxy)-carbonyl)-methyl)-amide,
3-benzyloxypyridine-2-carboxylic acid
N-(((butyloxy)-carbonyl)-methyl)-amide,
5-(((3-(1-butyloxy)-propyl)-amino)-carbonyl)-3-methoxypyridine-2-carboxyl-
ic acid N-((benzyloxycarbonyl)-methyl)-amide,
5-(((3-(1-butyloxy)-propyl)-amino)-carbonyl)-3-methoxypyridine-2-carboxyl-
ic acid N-(((1-butyloxy)-carbonyl)-methyl)-amide, and
5-(((3-lauryloxy)-propyl)amino)-carbonyl)-3-methoxypyridine-2-carboxylic
acid N-(((benzyloxy)-carbonyl)-methyl)-amide.
[0085] Additionally, exemplary compounds of Formula (I) include,
but are not limited to, 3-hydroxypyridine-2-carboxylic acid
N-(((hexadecyloxy)-carbonyl)-methyl)-amide hydrochloride,
3-hydroxypyridine-2-carboxylic acid
N-(((1-octyloxy)-carbonyl)-methyl)-amide,
3-hydroxypyridine-2-carboxylic acid
N-(((hexyloxy)-carbonyl)-methyl)-amide,
3-hydroxypyridine-2-carboxylic acid
N-(((butyloxy)-carbonyl)-methyl)-amide,
3-hydroxypyridine-2-carboxylic acid
N-(((2-nonyloxy)-carbonyl)-methyl)-amide racemate,
3-hydroxypyridine-2-carboxylic acid
N-(((heptyloxy)-carbonyl)-methyl)-amide,
3-benzyloxypyridine-2-carboxylic acid
N-(((octyloxy)-carbonyl)-methyl)-amide,
3-benzyloxypyridine-2-carboxylic acid
N-(((butyloxy)-carbonyl)-methyl)-amide,
5-(((3-(1-butyloxy)-propyl)-amino)-carbonyl)-3-hydroxypyridine-2-carboxyl-
ic acid N-((benzyloxycarbonyl)-methyl)-amide,
5-(((3-(1-butyloxy)-propyl)-amino)-carbonyl)-3-hydroxypyridine-2-carboxyl-
ic acid N-(((1-butyloxy)-carbonyl)-methyl)-amide, and
5-(((3-lauryloxy)-propyl)amino)-carbonyl)-3-hydroxypyridine-2-carboxylic
acid N-(((benzyloxy)-carbonyl)-methyl)-amide.
[0086] Exemplary compounds according to Formula (Ia) are described
in U.S. Pat. Nos. 5,719,164 and 5,726,305. All compounds listed in
the foregoing patents, in particular, those listed in the compound
claims and the final products of the working examples, are hereby
incorporated into the present application by reference herein.
Exemplary compounds of Formula (Ia) include, but are not limited
to, N-((6-(1-butyloxy)-3-hydroxyquinolin-2-yl)-carbonyl)-glycine,
N-((6-chloro-3-hydroxyquinolin-2-yl)-carbonyl)-glycine,
N-((3-hydroxy-6-(2-propyloxy)-quinolin-2-yl)-carbonyl)-glycine,
N-((7-chloro-3-hydroxy-quinoline-2-carbonyl)-amino]-acetic acid,
[(3-benzyloxy-7-chloro-quinoline-2-carbonyl)-amino]-acetic acid
(Compound D),
[(3-hydroxy-6-isopropoxy-quinoline-2-carbonyl)-amino]-acetic acid
(Compound E),
[(3-hydroxy-6-phenoxy-quinoline-2-carbonyl)-amino]-acetic acid
(Compound F), and
[(3-hydroxy-6-trifluoromethoxy-quinoline-2-carbonyl)-amino]-acetic
acid (Compound G).
[0087] Exemplary compounds according to Formula (Ib) are described
in U.S. Pat. No. 6,093,730. All compounds listed in U.S. Pat. No.
6,093,730, in particular, those listed in the compound claims and
the final products of the working examples, are hereby incorporated
into the present application by reference herein. Exemplary
compounds of Formula (Ib) include, but are not limited to,
N-((1-chloro-4-hydroxy-7-(2-propyloxy)isoquinolin-3-yl)-carbonyl)-glycine-
, N-((7-bromo-4-hydroxy-isoquinoline-3-carbonyl)-amino)-acetic
acid,
N-((1-chloro-4-hydroxy-6-(2-propyloxy)isoquinolin-3-yl)-carbonyl)-glycine-
,
N-((1-chloro-4-hydroxy-7-methoxyisoquinolin-3-yl)-carbonyl)-glycine
(Compound J),
N-((1-chloro-4-hydroxy-6-methoxyisoquinolin-3-yl)-carbonyl)-glycine,
[(7-butoxy-1-chloro-4-hydroxy-isoquinoline-3-carbonyl)-amino]-acetic
acid,
N-((7-benzyloxy-1-chloro-4-hydroxyisoquinolin-3-yl)-carbonyl)-glyci-
ne,
N-((6-benzyloxy-1-chloro-4-hydroxyisoquinolin-3-yl)-carbonyl)-glycine,
[(1-chloro-4-hydroxy-isoquinoline-3-carbonyl)-amino]-acetic acid
(Compound C),
N-((8-chloro-4-hydroxyisoquinolin-3-yl)-carbonyl)-glycine,
[(4-Hydroxy-7-isopropoxy-isoquinoline-3-carbonyl)-amino]-acetic
acid (Compound H),
[(7-butoxy-4-hydroxy-isoquinoline-3-carbonyl)-amino]-acetic acid
(Compound I), and
[(1-Chloro-4-hydroxy-7-isopropoxy-isoquinoline-3-carbonyl)-amino]-acetic
acid (Compound K).
[0088] Additionally, compounds for use in the methods of the
invention are compounds described by Majamaa et al. (1984, Eur J
Biochem 138:239-245; and 1985, Biochem J 229:127-133), Kivirikko
and Myllyharju (1998, Matrix Biol 16:357-368), Bickel et al. (1998,
Hepatology 28:404-411), Friedman et al. (2000, Proc Natl Acad Sci
USA 97:4736-4741), and Franklin et al. (2001, Biochem J
353:333-338), all of which are incorporated by reference herein in
their entirety. Further, the invention provides additional
exemplary compounds wherein, e.g., position A and B together may
be, e.g., hexanoic acid, cyanomethyl, 2-aminoethyl, benzoic acid,
1H-benzoimidazol-2-ylmethyl, etc.
[0089] In other embodiments, compounds used in the methods of the
invention are selected from a compound of the formula (II)
##STR00011##
where R.sup.28 is hydrogen, nitro, amino, cyano, halogen,
(C.sub.1-C.sub.4)-alkyl, carboxy or a metabolically labile ester
derivative thereof; (C.sub.1-C.sub.4)-alkylamino,
di-(C.sub.1-C.sub.4)-alkylamino, (C.sub.1-C.sub.6)-alkoxycarbonyl,
(C.sub.2-C.sub.4)-alkanoyl, hydroxy-(C.sub.1-C.sub.4)-alkyl,
carbamoyl, N--(C.sub.1-C.sub.4)-alkylcarbamoyl,
(C.sub.1-C.sub.4)-alkylthio, (C.sub.1-C.sub.4)-alkylsulfinyl,
(C.sub.1-C.sub.4)-alkylsulfonyl, phenylthio, phenylsulfinyl,
phenylsulfonyl, said phenyl or phenyl groups being optionally
substituted with 1 to 4-identical or different halogen,
(C.sub.1-C.sub.4)-alkyoxy, (C.sub.1-C.sub.4)-alkyl, cyano, hydroxy,
trifluoromethyl, fluoro-(C.sub.1-C.sub.4)-alkylthio,
fluoro-(C.sub.1-C.sub.4)-alkylsulfinyl,
fluoro-(C.sub.1-C.sub.4)-alkylsulfonyl,
(C.sub.1-C.sub.4)-alkoxy-(C.sub.2-C.sub.4)-alkoxycarbonyl,
N,N-di-[(C.sub.1-C.sub.4)-alkyl]carbamoyl-(C.sub.1-C.sub.4)-alkoxycarbony-
l, (C.sub.1-C.sub.4)-alkylamino-(C.sub.2-C.sub.4)-alkoxycarbonyl,
di-(C.sub.1-C.sub.4)-alkylamino-(C.sub.2-C.sub.4)-alkoxycarbonyl,
(C.sub.1-C.sub.4)-alkoxy-(C.sub.2-C.sub.4)-alkoxy-(C.sub.2-C.sub.4)-alkox-
ycarbonyl, (C.sub.2-C.sub.4)-alkanoyloxy-C.sub.1-C.sub.4)-alkyl, or
N--[amino-(C.sub.2-C.sub.8)-alkyl]-carbamoyl; R.sup.29 is hydrogen,
hydroxy, amino, cyano, halogen, (C.sub.1-C.sub.4)-alkyl, carboxy or
metabolically labile ester derivative thereof,
(C.sub.1-C.sub.4)-alkylamino, di-(C.sub.1-C.sub.4)-alkylamino,
(C.sub.1-C.sub.6)-alkoxycarbonyl, (C.sub.2-C.sub.4)-alkanoyl,
(C.sub.1-C.sub.4)-alkoxy, carboxy-(C.sub.1-C.sub.4)-alkoxy,
(C.sub.1-C.sub.4)-alkoxycarbonyl-(C.sub.1-C.sub.4)-alkoxy,
carbamoyl, N--(C.sub.1-C.sub.8)-alkylcarbamoyl,
N,N-di-(C.sub.1-C.sub.8)-alkylcarbamoyl,
N-[amino-(C.sub.2-C.sub.8)-alkyl)-carbamoyl,
N--[(C.sub.1-C.sub.4)-alkylamino-(C.sub.1-C.sub.8)-alkyl]-carbamoyl,
N--[di-(C.sub.1-C.sub.4)-alkylamino-(C.sub.1-C.sub.8)-alkyl)]-carbamoyl,
N-cyclohexylcarbamoyl, N--[cyclopentyl]-carbamoyl,
N--(C.sub.1-C.sub.4)-alkylcyclohexylcarbamoyl,
N--(C.sub.1-C.sub.4)-alkylcyclopentylcarbamoyl, N-phenylcarbamoyl,
N--(C.sub.1-C.sub.4)-alkyl-N-phenylcarbamoyl,
N,N-diphenylcarbamoyl,
N-[phenyl-(C.sub.1-C.sub.4)-alkyl]-carbamoyl,
N--(C.sub.1-C.sub.4)-alkyl-N--[phenyl-(C.sub.1-C.sub.4)-alkyl]-carbamoyl,
or N,N-di-[phenyl-(C.sub.1-C.sub.4)-alkyl]-carbamoyl, said phenyl
or phenyl groups being optionally substituted with 1 to 4 identical
or different halogen, (C.sub.1-C.sub.4)-alkyoxy,
(C.sub.1-C.sub.4)-alkyl, cyano, hydroxy, trifluoromethyl,
N--[(C.sub.2-C.sub.4)-alkanoyl]-carbamoyl,
N--[(C.sub.1-C.sub.4)-alkoxycarbonyl]-carbamoyl,
N--[fluoro-(C.sub.2-C.sub.6)-alkyl]-carbamoyl,
N,N-[fluoro-(C.sub.2-C.sub.6)-alkyl]-N--(C.sub.1-C.sub.4)-alkylcarbamoyl,
N,N-[di-fluoro-(C.sub.2-C.sub.6)-alkyl]carbamoyl,
pyrrolidin-1-ylcarbonyl, piperidinocarbonyl,
piperazin-1-ylcarbonyl, morpholinocarbonyl, wherein the
heterocyclic group, is optionally substituted with 1 to 4,
(C.sub.1-C.sub.4)-alkyl, benzyl,
1,2,3,4-tetrahydro-isoquinolin-2-ylcarbonyl,
N,N-[di-(C.sub.1-C.sub.4)-alkyl]-thiocarbamoyl,
N--(C.sub.2-C.sub.4)-alkanoylamino, or
N--[(C.sub.1-C.sub.4)-alkoxycarbonyl]-amino; R.sup.30 is hydrogen,
(C.sub.1-C.sub.4)-alkyl, (C.sub.2-C.sub.4)-alkoxy, halo, nitro,
hydroxy, fluoro-(1-4C)alkyl, or pyridinyl; R.sup.31 is hydrogen,
(C.sub.1-C.sub.4)-alkyl, (C.sub.2-C.sub.4)-alkoxy, halo, nitro,
hydroxy, fluoro-(C.sub.1-C.sub.4)-alkyl, pyridinyl, or methoxy;
R.sup.32 is hydrogen, hydroxy, amino, (C.sub.1-C.sub.4)-alkylamino,
di-(C.sub.1-C.sub.4)-alkylamino, halo,
(C.sub.1-C.sub.4)-alkoxy-(C.sub.2-C.sub.4)-alkoxy,
fluoro-(C.sub.1-C.sub.6)-alkoxy, pyrrolidin-1-yl, piperidino,
piperazin-1-yl, or morpholino, wherein the heterocyclic group is
optionally substituted with 1 to 4 identical or different
(C.sub.1-C.sub.4)-alkyl or benzyl; and R.sup.33 and R.sup.34 are
individually selected from hydrogen, (C.sub.1-C.sub.4)-alkyl, and
(C.sub.1-C.sub.4)-alkoxy; including pharmaceutically-acceptable
salts and pro-drugs derived therefrom.
[0090] Exemplary compounds of Formula (II) are described in U.S.
Pat. Nos. 5,916,898 and 6,200,974, and International Publication
No. WO 99/21860. All compounds listed in the foregoing patents and
publication, in particular, those listed in the compound claims and
the final products of the working examples, are hereby incorporated
into the present application by reference herein. Exemplary
compounds contained therein are
3-carboxy-4-oxo-3,4-dihydro-1,10-phenanthroline (see, e.g., Seki et
al. (1974) Chem Abstracts 81:424, No. 21),
3-carboxy-5-hydroxy-4-oxo-3,4-dihydro-1,10-phenanthroline,
3-carboxy-5-methoxy-4-oxo-3,4-dihydro-1,10-phenanthroline (Compound
A), and
3-carboxy-8-hydroxy-4-oxo-3,4-dihydro-1,10-phenanthroline.
[0091] In other embodiments, compounds used in the methods of the
invention are selected from a compound of the formula (III)
##STR00012##
or pharmaceutically acceptable salts thereof, wherein: a is an
integer from 1 to 4; b is an integer from 0 to 4; c is an integer
from 0 to 4; Z is selected from the group consisting of
(C.sub.3-C.sub.10)cycloalkyl, (C.sub.3-C.sub.10)cycloalkyl
independently substituted with one or more Y.sup.1, 3-10 membered
heterocycloalkyl and 3-10 membered heterocycloalkyl independently
substituted with one or more Y.sup.1; (C.sub.5-C.sub.20)aryl,
(C.sub.5-C.sub.20) independently substituted with one or more
Y.sup.1, 5-20 membered heteroaryl and 5-20 membered heteroaryl
independently substituted with one or more Y.sup.1; Ar.sup.1 is
selected from the group consisting of (C.sub.5-C.sub.20),
(C.sub.5-C.sub.20)aryl independently substituted with one or more
Y.sup.2, 5-20 membered heteroaryl and 5-20 membered heteroaryl
independently substituted with one or more Y.sup.2; each Y.sup.1 is
independently selected from the group consisting of a lipophilic
functional group, (C.sub.5-C.sub.20) aryl,
(C.sub.6-C.sub.26)alkaryl, 5-20 membered heteroaryl and 6-26
membered alk-heteroaryl; each Y.sup.2 is independently selected
from the group consisting of --R', --OR', --OR'', --SR', --SR'',
--NR'R', --NO.sub.2, --CN, -halogen, -trihalomethyl,
trihalomethoxy, --C(O)R', --C(O)OR', --C(O)NR'R', --C(O)NR'OR',
--C(NR'R').dbd.NOR', --NR'--C(O)R', --SO.sub.2R', --SO.sub.2R'',
--NR'--SO.sub.2--R', --NR'--C(O)--NR'R', tetrazol-5-yl,
--NR'--C(O)--OR', --C(NR'R').dbd.NR', --S(O)--R', --S(O)--R'', and
--NR'--C(S)--NR'R'; and each R' is independently selected from the
group consisting of --H, (C.sub.1-C.sub.8),
(C.sub.2-C.sub.8)alkenyl, and (C.sub.2-C.sub.8)alkynyl; and each
R'' is independently selected from the group consisting of
(C.sub.5-C.sub.20) and (C.sub.5-C.sub.20) independently substituted
with one or more --OR', --SR', --NR'R', --NO.sub.2, --CN, halogen
or trihalomethyl groups, or wherein c is 0 and Ar.sup.1 is an N'
substituted urea-aryl, the compound has the structural formula
(IIIa):
##STR00013##
or pharmaceutically acceptable salts thereof, wherein: a, b, and Z
are as defined above; and R.sup.35 and R.sup.36 are each
independently selected from the group consisting of hydrogen,
(C.sub.1-C.sub.8), (C.sub.2-C.sub.8) alkenyl,
(C.sub.2-C.sub.8)alkynyl, (C.sub.3-C.sub.10)cycloalkyl,
(C.sub.5-C.sub.20), (C.sub.5-C.sub.20)substituted aryl,
(C.sub.6-C.sub.26)alkaryl, (C.sub.6-C.sub.26)substituted alkaryl,
5-20 membered heteroaryl, 5-20 membered substituted heteroaryl,
6-26 membered alk-heteroaryl, and 6-26 membered substituted
alk-heteroaryl; and R.sup.37 is independently selected from the
group consisting of hydrogen, (C.sub.1-C.sub.8)alkyl,
(C.sub.2-C.sub.8)alkenyl, and (C.sub.2-C.sub.8)alkynyl.
[0092] Exemplary compounds of Formula (III) are described in
International Publication No. WO 00/50390. All compounds listed in
the foregoing publication, in particular, those listed in the
compound claims and the final products of the working examples, are
hereby incorporated into the present application by reference
herein. Exemplary compounds of Formula (III) include, but are not
limited to,
3-{[4-(3,3-dibenzyl-ureido)-benzenesulfonyl]-[2-(4-methoxy-phenyl)-ethyl]-
-amino}-N-hydroxy-propionamide (Compound B),
3-{{4-[3-(4-chloro-phenyl)-ureido]-benzenesulfonyl}-[2-(4-methoxy-phenyl)-
-ethyl]amino}-N-hydroxy-propionamide, and
3-{{4-[3-(1,2-diphenyl-ethyl)-ureido]-benzenesulfonyl}-[2-(4-methoxy-phen-
yl)-ethyl]-amino}-N-hydroxy-propionamide.
[0093] Therefore, the invention provides methods for treating,
preventing, or pretreating erythropoietin-associated conditions,
for example, anemic and neurological conditions. Methods using the
compounds described herein are specifically contemplated. Further,
the invention provides methods for treating a patient having anemia
associated with particular courses of treatment such as, e.g.,
chemotherapy, dialysis, etc. In specific embodiments, these methods
involve the use of compounds such as those described herein.
Additionally, the invention provides methods for producing
endogenous erythropoietin using in vitro cell culture technologies.
The invention also contemplates methods of increasing the number of
circulating reticulocytes in animals for the production of
cell-free reticulocyte lysates for in vitro messenger RNA
translation.
Methods of Using the Compounds of the Invention
[0094] The present invention provides methods of increasing
endogenous erythropoietin, thereby increasing erythropoiesis. The
methods can be used to prevent, pretreat, or treat
erythropoietin-associated conditions such as conditions and
disorders associated with anemia, neurological disorders, etc. Such
conditions and disorders include those described herein, supra.
[0095] The present invention also provides methods of increasing
endogenous erythropoietin to prevent, pretreat, or treat
erythropoietin-associated neurological disorders including, but not
limited to, acute disorders such as stroke, trauma, epilepsy, and
spinal cord injury, and chronic disorders such as neurodegenerative
disease. The methods can be used to treat neurological disorders
associated with procedures including, but not limited to, surgery
such as thoracoabdominal aortic surgery.
[0096] The invention provides compounds that can be used in the
methods described above. For example, a therapeutically effective
amount of the compound or a pharmaceutically acceptable salt
thereof, alone or in combination with a pharmaceutically acceptable
excipient, can be administered to a patient having or at risk of
developing an erythropoietin-associated disorder such as, e.g.,
anemia. The anemia can be due to a condition or disorder including,
but not limited to, acute or chronic kidney disease, diabetes,
cancer, ulcers; infection with virus, bacteria, or parasites;
inflammation, etc.; or can be associated with a medical procedure
or treatment including, e.g., radiation therapy, chemotherapy,
kidney dialysis, surgery, etc.
[0097] For example, a therapeutically effective amount of the
compound or a pharmaceutically acceptable salt thereof, alone or in
combination with a pharmaceutically acceptable excipient, may be
administered to an HIV-infected patient being treated with
zidovudine or other reverse transcriptase inhibitors. In another
example, a therapeutically effective amount of the compound or a
pharmaceutically acceptable salt thereof, alone or in combination
with a pharmaceutically acceptable excipient, may be administered
to an anemic cancer patient receiving cyclic cisplatin- or
non-cisplatin-containing chemotherapy. In yet another example, a
therapeutically effective amount of the compound or a
pharmaceutically acceptable salt thereof, alone or in combination
with a pharmaceutically acceptable excipient, may be administered
to an anemic or non-anemic patient scheduled to undergo surgery to
reduce the need for allogenic blood transfusions.
[0098] Preferred routes of administration include oral and
transdermal delivery mechanisms. Such mechanisms provide benefit
over current EPO replacement therapies by allowing for, e.g., ease
of administration, self-administration by patient, reduced cost,
fewer physician visits, and reduced risks due to infection and
immunogenic complications, minimizing the adverse reactions some
patients develop in response to dosing with recombinant EPO.
[0099] In one aspect, a compound of the invention inhibits one or
more 2-oxoglutarate dioxygenase enzymes. In one embodiment, the
compound inhibits at least two 2-oxoglutarate dioxygenase family
members, e.g., HIF prolyl hydroxylase and HIF
asparagine-hydroxylase (FIH-1), etc., with either the same
specificity or with differential specificity. In another
embodiment, the compound is specific for one 2-oxoglutarate
dioxygenase, e.g., HIF prolyl hydroxylase, and shows little to no
specificity for other family members.
[0100] The compounds of the invention can be administered in
combination with various other therapeutic approaches. In one
embodiment, the compound is administered with another
2-oxoglutarate dioxygenase inhibitor, wherein the two compounds
have differential specificity for individual 2-oxoglutarate
dioxygenase family members. The two compounds may be administered
at the same time as a ratio of one relative to the other.
Determination of a ratio appropriate to a given course of treatment
or a particular subject is within the level of skill in the art.
Alternatively, the two compounds may be administered consecutively
during a treatment time course, e.g., following myocardial
infarction. In a particular embodiment, one compound specifically
inhibits HIF prolyl hydroxylase enzyme activity, and a second
compound specifically inhibits procollagen prolyl 4-hydroxylase
enzyme activity. In another specific embodiment, one compound
specifically inhibits HIF prolyl hydroxylase enzyme activity, and a
second compound specifically inhibits HIF asparaginyl-hydroxylase
enzyme activity. Additionally, the compound can be administered
with another agent such as an iron supplement, e.g., ferrous
sulfate, vitamin B.sub.12, and/or folic acid, etc. The compound can
also be administered in conjunction with exogenous erythropoietin,
e.g., EPOGEN or ARANESP recombinant human erythropoietin (Amgen,
Inc., Thousand Oaks Calif.), and/or granulocyte-colony stimulating
factor (G-CSF), e.g., NEUPOGEN or NEULASTA recombinant G-CSF
(Amgen).
Pharmaceutical Formulations And Routes Of Administration
[0101] The compositions of the present invention can be delivered
directly or in pharmaceutical compositions along with suitable
carriers or excipients, as is well known in the art. Present
methods of treatment can comprise administration of an effective
amount of a compound of the invention to a subject having or at
risk for anemia due to, e.g., chronic renal failure, diabetes,
cancer, AIDS, radiation therapy, chemotherapy, kidney dialysis, or
surgery. In a preferred embodiment, the subject is a mammalian
subject, and in a most preferred embodiment, the subject is a human
subject.
[0102] An effective amount of such agents can readily be determined
by routine experimentation, as can the most effective and
convenient route of administration and the most appropriate
formulation. Various formulations and drug delivery systems are
available in the art. (See, e.g., Gennaro, A. R., ed. (1995)
Remington's Pharmaceutical Sciences, supra.)
[0103] Suitable routes of administration may, for example, include
oral, rectal, transmucosal, nasal, or intestinal administration and
parenteral delivery, including intramuscular, subcutaneous,
intramedullary injections, as well as intrathecal, direct
intraventricular, intravenous, intraperitoneal, intranasal, or
intraocular injections. The agent or composition thereof may be
administered in a local rather than a systemic manner. For example,
a suitable agent can be delivered via injection or in a targeted
drug delivery system, such as a depot or sustained release
formulation.
[0104] The pharmaceutical compositions of the present invention may
be manufactured by any of the methods well-known in the art, such
as by conventional mixing, dissolving, granulating, dragee-making,
levigating, emulsifying, encapsulating, entrapping, or lyophilizing
processes. As noted above, the compositions of the present
invention can include one or more physiologically acceptable
carriers such as excipients and auxiliaries that facilitate
processing of active molecules into preparations for pharmaceutical
use.
[0105] Proper formulation is dependent upon the route of
administration chosen. For injection, for example, the composition
may be formulated in aqueous solutions, preferably in
physiologically compatible buffers such as Hanks' solution,
Ringer's solution, or physiological saline buffer. For transmucosal
or nasal administration, penetrants appropriate to the barrier to
be permeated are used in the formulation. Such penetrants are
generally known in the art. In a preferred embodiment of the
present invention, the present compounds are prepared in a
formulation intended for oral administration. For oral
administration, the compounds can be formulated readily by
combining the active compounds with pharmaceutically acceptable
carriers well known in the art. Such carriers enable the compounds
of the invention to be formulated as tablets, pills, dragees,
capsules, liquids, gels, syrups, slurries, suspensions and the
like, for oral ingestion by a subject. The compounds may also be
formulated in rectal compositions such as suppositories or
retention enemas, e.g., containing conventional suppository bases
such as cocoa butter or other glycerides.
[0106] Pharmaceutical preparations for oral use can be obtained as
solid excipients, optionally grinding a resulting mixture, and
processing the mixture of granules, after adding suitable
auxiliaries, if desired, to obtain tablets or dragee cores.
Suitable excipients are, in particular, fillers such as sugars,
including lactose, sucrose, mannitol, or sorbitol; cellulose
preparations such as, for example, maize starch, wheat starch, rice
starch, potato starch, gelatin, gum tragacanth, methyl cellulose,
hydroxypropylmethyl-cellulose, sodium-carboxymethylcellulose,
and/or polyvinylpyrrolidone (PVP). If desired, disintegrating
agents may be added, such as the cross-linked polyvinyl
pyrrolidone, agar, or alginic acid or a salt thereof such as sodium
alginate. Also, wetting agents such as sodium dodecyl sulfate may
be included.
[0107] Dragee cores are provided with suitable coatings. For this
purpose, concentrated sugar solutions may be used, which may
optionally contain gum arabic, talc, polyvinyl pyrrolidone,
carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer
solutions, and suitable organic solvents or solvent mixtures.
Dyestuffs or pigments may be added to the tablets or dragee
coatings for identification or to characterize different
combinations of active compound doses.
[0108] Pharmaceutical preparations for oral administration include
push-fit capsules made of gelatin, as well as soft, sealed capsules
made of gelatin and a plasticizer, such as glycerol or sorbitol.
The push-fit capsules can contain the active ingredients in
admixture with filler such as lactose, binders such as starches,
and/or lubricants such as talc or magnesium stearate and,
optionally, stabilizers. In soft capsules, the active compounds may
be dissolved or suspended in suitable liquids, such as fatty oils,
liquid paraffin, or liquid polyethylene glycols. In addition,
stabilizers may be added. All formulations for oral administration
should be in dosages suitable for such administration.
[0109] In one embodiment, the compounds of the present invention
can be administered transdermally, such as through a skin patch, or
topically. In one aspect, the transdermal or topical formulations
of the present invention can additionally comprise one or multiple
penetration enhancers or other effectors, including agents that
enhance migration of the delivered compound. Transdermal or topical
administration could be preferred, for example, in situations in
which location specific delivery is desired.
[0110] For administration by inhalation, the compounds for use
according to the present invention are conveniently delivered in
the form of an aerosol spray presentation from pressurized packs or
a nebuliser, with the use of a suitable propellant, e.g.,
dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethane, carbon dioxide, or any other suitable
gas. In the case of a pressurized aerosol, the appropriate dosage
unit may be determined by providing a valve to deliver a metered
amount. Capsules and cartridges of, for example, gelatin, for use
in an inhaler or insufflator may be formulated. These typically
contain a powder mix of the compound and a suitable powder base
such as lactose or starch.
[0111] Compositions formulated for parenteral administration by
injection, e.g., by bolus injection or continuous infusion can be
presented in unit dosage form, e.g., in ampoules or in multi-dose
containers, with an added preservative. The compositions may take
such forms as suspensions, solutions or emulsions in oily or
aqueous vehicles, and may contain formulatory agents such as
suspending, stabilizing and/or dispersing agents. Formulations for
parenteral administration include aqueous solutions or other
compositions in water-soluble form.
[0112] Suspensions of the active compounds may also be prepared as
appropriate oily injection suspensions. Suitable lipophilic
solvents or vehicles include fatty oils such as sesame oil and
synthetic fatty acid esters, such as ethyl oleate or triglycerides,
or liposomes. Aqueous injection suspensions may contain substances
that increase the viscosity of the suspension, such as sodium
carboxymethyl cellulose, sorbitol, or dextran. Optionally, the
suspension may also contain suitable stabilizers or agents that
increase the solubility of the compounds to allow for the
preparation of highly concentrated solutions. Alternatively, the
active ingredient may be in powder form for constitution with a
suitable vehicle, e.g., sterile pyrogen-free water, before use.
[0113] As mentioned above, the compositions of the present
invention may also be formulated as a depot preparation. Such long
acting formulations may be administered by implantation (for
example, subcutaneously or intramuscularly) or by intramuscular
injection. Thus, for example, the present compounds may be
formulated with suitable polymeric or hydrophobic materials (for
example as an emulsion in an acceptable oil) or ion exchange
resins, or as sparingly soluble derivatives, for example, as a
sparingly soluble salt.
[0114] Suitable carriers for the hydrophobic molecules of the
invention are well known in the art and include co-solvent systems
comprising, for example, benzyl alcohol, a nonpolar surfactant, a
water-miscible organic polymer, and an aqueous phase. The
co-solvent system may be the VPD co-solvent system. VPD is a
solution of 3% w/v benzyl alcohol, 8% w/v of the nonpolar
surfactant polysorbate 80, and 65% w/v polyethylene glycol 300,
made up to volume in absolute ethanol. The VPD co-solvent system
(VPD:5W) consists of VPD diluted 1:1 with a 5% dextrose in water
solution. This co-solvent system is effective in dissolving
hydrophobic compounds and produces low toxicity upon systemic
administration. Naturally, the proportions of a co-solvent system
may be varied considerably without destroying its solubility and
toxicity characteristics. Furthermore, the identity of the
co-solvent components may be varied. For example, other
low-toxicity nonpolar surfactants may be used instead of
polysorbate 80, the fraction size of polyethylene glycol may be
varied, other biocompatible polymers may replace polyethylene
glycol, e.g., polyvinyl pyrrolidone, and other sugars or
polysaccharides may substitute for dextrose.
[0115] Alternatively, other delivery systems for hydrophobic
molecules may be employed. Liposomes and emulsions are well known
examples of delivery vehicles or carriers for hydrophobic drugs.
Liposomal delivery systems are discussed above in the context of
gene-delivery systems. Certain organic solvents such as
dimethylsulfoxide also may be employed, although usually at the
cost of greater toxicity. Additionally, the compounds may be
delivered using sustained-release systems, such as semi-permeable
matrices of solid hydrophobic polymers containing the effective
amount of the composition to be administered. Various
sustained-release materials are established and available to those
of skill in the art. Sustained-release capsules may, depending on
their chemical nature, release the compounds for a few weeks up to
over 100 days. Depending on the chemical nature and the biological
stability of the therapeutic reagent, additional strategies for
protein stabilization may be employed.
[0116] For any composition used in the present methods of
treatment, a therapeutically effective dose can be estimated
initially using a variety of techniques well known in the art. For
example, in a cell culture assay, a dose can be formulated in
animal models to achieve a circulating concentration range that
includes the IC.sub.50 as determined in cell culture. Dosage ranges
appropriate for human subjects can be determined, for example,
using data obtained from cell culture assays and other animal
studies.
[0117] A therapeutically effective dose of an agent refers to that
amount of the agent that results in amelioration of symptoms or a
prolongation of survival in a subject. Toxicity and therapeutic
efficacy of such molecules can be determined by standard
pharmaceutical procedures in cell cultures or experimental animals,
e.g., by determining the LD.sub.50 (the dose lethal to 50% of the
population) and the ED.sub.50 (the dose therapeutically effective
in 50% of the population). The dose ratio of toxic to therapeutic
effects is the therapeutic index, which can be expressed as the
ratio LD.sub.50/ED.sub.50. Agents that exhibit high therapeutic
indices are preferred.
[0118] Dosages preferably fall within a range of circulating
concentrations that includes the ED.sub.50 with little or no
toxicity. Dosages may vary within this range depending upon the
dosage form employed and the route of administration utilized. The
exact formulation, route of administration, and dosage should be
chosen, according to methods known in the art, in view of the
specifics of a subject's condition.
[0119] Dosage amount and interval may be adjusted individually to
provide plasma levels of the active moiety that are sufficient to
modulate endogenous erythropoietin plasma levels as desired, i.e.
minimal effective concentration (MEC). The MEC will vary for each
compound but can be estimated from, for example, in vitro data.
Dosages necessary to achieve the MEC will depend on individual
characteristics and route of administration. Agents or compositions
thereof should be administered using a regimen which maintains
plasma levels above the MEC for about 10-90% of the duration of
treatment, preferably about 30-90% of the duration of treatment,
and most preferably between 50-90%. In cases of local
administration or selective uptake, the effective local
concentration of the drug may not be related to plasma
concentration. Alternatively, stimulation of endogenous
erythropoietin may be achieved by 1) administering a loading dose
followed by a maintenance dose, 2) administering an induction dose
to rapidly achieve erythropoietin levels within a target range,
followed by a lower maintenance dose to maintain hematocrit within
a desired target range, or 3) repeated intermittent dosing.
[0120] The amount of agent or composition administered will, of
course, be dependent on a variety of factors, including the sex,
age, and weight of the subject being treated, the severity of the
affliction, the manner of administration, and the judgment of the
prescribing physician.
[0121] The present compositions may, if desired, be presented in a
pack or dispenser device containing one or more unit dosage forms
containing the active ingredient. Such a pack or device may, for
example, comprise metal or plastic foil, such as a blister pack.
The pack or dispenser device may be accompanied by instructions for
administration. Compositions comprising a compound of the invention
formulated in a compatible pharmaceutical carrier may also be
prepared, placed in an appropriate container, and labeled for
treatment of an indicated condition. Suitable conditions indicated
on the label may include treatment of conditions, disorders, or
diseases in which anemia is a major indication.
Compound Screening and Identification
[0122] The present invention provides methods of screening for and
identifying additional compounds that increase endogenous
erythropoietin. In a particular embodiment, methods of identifying
compounds that increase endogenous EPO plasma levels are provided.
Various assays and screening techniques, including those described
below, can be used to identify small molecules that increase the
level of endogenous erythropoietin. One assay that is particularly
useful involves treating animals with a compound of interest and
measuring erythropoietin levels in plasma. (See, e.g., Example 2.)
Assays will typically provide for detectable signals associated
with the consumption of a reaction substrate or production of a
reaction product. Detection can involve, for example, fluorophores,
radioactive isotopes, enzyme conjugates, and other detectable
labels well known in the art. The results may be qualitative or
quantitative. Isolation of the reaction product may be facilitated
by a label such as biotin or a histidine tag that allows
purification from other reaction components via precipitation or
affinity chromatography.
[0123] In preferred embodiments in which increasing endogenous
erythropoietin expression involves stabilization of HIF.alpha.
within cells, assays used to identify small molecules that modulate
(e.g., increase or decrease) the level or activity of HIF.alpha.
are contemplated. Assays for HIF.alpha. hydroxylation may involve
measuring hydroxylated proline or asparagine residues in HIF.alpha.
or a fragment thereof, or measuring formation of succinate from
2-oxoglutarate in the presence of enzyme and HIF.alpha. or a
fragment thereof. (See, e.g., Palmerini et al. (1985) J Chromatogr
339:285-292; Cunliffe et al. (1986) Biochem J 240:617-619.)
Exemplary procedures that measure HIF.alpha. hydroxylation are
described in, e.g., Ivan et al. (supra) and Example 9. An exemplary
procedure that measures production of succinate from 2-oxoglutarate
is described by Kaule and Gunzler. (1990, Anal Biochem
184:291-297.) Substrate molecules may include HIF.alpha. or a
fragment thereof, e.g., HIF(556-575); for example, an exemplary
substrate for use in the assay described in Example 7 is
[methoxycoumarin]-DLDLEALAPYIPADDDFQL-amide (SEQ ID NO:5). Enzyme
may include, e.g., HIF.alpha. prolyl hydroxylase (see, e.g.,
GenBank Accession No. AAG33965, etc.), obtained from any source.
Enzyme may also be present in a crude cell lysate or in a partially
purified form. Measuring and comparing enzyme activity in the
absence and presence of the compound identifies compounds that
inhibit hydroxylation of HIF.alpha..
[0124] Additionally, and in combination with the above methods,
compounds of the invention can be identified by any of a variety of
screening techniques known in the art. Such screening methods may
allow for target polypeptides or the compounds to be free in
solution, affixed to a solid support, borne on a cell surface,
located within a cell, etc. For example, test compounds may be
arrayed on a surface and analyzed for activity in a manner
analogous to array methods currently available in the art. (See,
e.g., Shalon et al. (1995) International Publication No. WO
95/35505; Baldeschweiler et al. (1995) International Publication
No. WO 95/251116; Brennan et al. (1995) U.S. Pat. No. 5,474,796;
and Heller et al. (1997) U.S. Pat. No. 5,605,662.)
Production of Endogenous Erythropoietin In Vitro
[0125] The invention provides methods for producing endogenous
erythropoietin using in vitro cell culture technologies. In
particular embodiments, cells derived from animal tissues,
preferably human tissues, capable of expressing erythropoietin when
stimulated by compounds of the invention are cultured, using any of
the various techniques available to one of skill in the art, for
the in vitro production of endogenous proteins. Cells contemplated
for use in such methods include, but are not limited to, cells
derived from hepatic, hematopoietic, renal, and neural tissues,
etc. An exemplary cell line for production of endogenous
erythropoietin according to the present invention is Hep3B derived
from hepatic tissue.
[0126] Cell culture techniques are generally available in the art
and include any method that maintains cell viability and
facilitates expression of endogenous proteins. Cells are typically
cultured in a growth medium optimized for cell growth, viability,
and protein production. Cells may be in suspension or attached to a
substrate, and medium may be supplied in batch feed or continuous
flow-through regimens. Compounds of the invention are added to the
culture medium at levels that stimulate erythropoietin production
without compromising cell viability. Erythropoietin produced by the
cells is secreted into the culture medium. The medium is then
collected and the erythopoietin is purified using methods known to
those of skill in the art. (See, e.g., Lai et al. (1987) U.S. Pat.
No. 4,667,016; and Egrie (1985) U.S. Pat. No. 4,558,006.)
[0127] These and other embodiments of the present invention will
readily occur to those of ordinary skill in the art in view of the
disclosure herein, and are specifically contemplated.
EXAMPLES
[0128] The invention is further understood by reference to the
following examples, which are intended to be purely exemplary of
the invention. The present invention is not limited in scope by the
exemplified embodiments, which are intended as illustrations of
single aspects of the invention only. Any methods that are
functionally equivalent are within the scope of the invention.
Various modifications of the invention in addition to those
described herein will become apparent to those skilled in the art
from the foregoing description and accompanying figures. Such
modifications fall within the scope of the appended claims.
Example 1
Increase in Endogenous Erythropoietin Levels In Vitro
[0129] Human cells derived from hepatocarcinoma (Hep3B) tissue
(see, e.g., American Type Culture Collection, Manassas Va.) were
seeded into 35 mm culture dishes and grown at 37.degree. C., 20%
O.sub.2, 5% CO.sub.2 in Minimal Essential Medium (MEM), Earle's
balanced salt solution (Mediatech Inc., Herndon Va.), 2 mM
L-glutamine, 0.1 mM non-essential amino acids, 1 mM sodium
pyruvate, and 10% FBS. When cell layers reached confluence, the
media was replaced with OPTI-MEM media (Invitrogen Life
Technologies, Carlsbad Calif.) and cell layers were incubated for
approximately 24 hours in 20% O.sub.2, 5% CO.sub.2 at 37.degree. C.
A compound of the invention (one of compounds A to I) or 1% DMSO
(negative control) was then added to existing media and incubation
was continued overnight.
[0130] Following incubation, the conditioned media was collected
from cell cultures and analyzed for erythropoietin expression using
a QUANTIKINE immunoassay (R&D Systems, Inc., Minneapolis Minn.)
according to the manufacturer's instructions. As seen in FIG. 1,
liver-derived cells (Hep3B) showed significant increase in
expression of erythropoietin when treated with compounds of the
invention. Thus, compounds of the invention increase erythropoietin
expression in vitro in cells derived from tissues that normally
produce erythropoietin in animals.
Example 2
Increase in Endogenous Erythropoietin Levels In Vivo
Experiment I
[0131] Twelve Swiss Webster male mice (30-32 g) were obtained from
Simonsen, Inc. (Gilroy Calif.), and treated by oral gavage two
times per day for 2.5 days (5 doses) with a 4 ml/kg volume of
either 0.5% carboxymethyl cellulose (CMC; Sigma-Aldrich, St. Louis
Mo.) (0 mg/kg/day) or 2.5% Compound C (25 mg/ml in 0.5% CMC) (200
mg/kg/day). Four hours after the final dose, animals were
anesthetized with isoflurane and two blood samples were collected
from the abdominal vein. One blood sample was collected into a
MICROTAINER serum separator tube (Becton-Dickinson, Franklin Lakes
N.J.), and incubated at room temperature for 30 minutes,
centrifuged at 8,000 rpm at 4.degree. C. for 10 minutes. The serum
fraction was then processed and analyzed for erythropoietin (EPO)
expression using a QUANTIKINE immunoassay (R&D Systems)
according to the manufacturer's instructions. The second blood
sample was collected into a MICROTAINER EDTA-2K tube
(Becton-Dickinson) for hematocrit analysis. Hematocrit was measured
by drawing EDTA-blood into a 75 mm.times.1.1-1.2 mm I.D. capillary
tube (Chase Scientific Glass, Inc., Rockwood Tenn.) to
approximately 3/4 length. One end of the tube was sealed with
CRITOSEAL sealant (Sherwood Medical Company) and the tube was
centrifuged in a J-503M MICROHEMATOCRIT centrifuge (Jorgensen
Laboratories, Inc., Loveland Colo.) at 12,000 rpm for 5 minutes.
Hematocrit was read against a reader card. The mice were then
sacrificed and approximately 150 mg of liver and each kidney were
isolated and stored in RNALATER solution (Ambion) at -20.degree.
C.
[0132] RNA isolation was carried out using the following protocol.
Tissue slices were cut into small pieces, 1.75 ml of RLT lysis
buffer (RNEASY kit; Qiagen Inc., Valencia Calif.) was added, and
the pieces were homogenized for about 20 seconds using a
rotor-stator POLYTRON homogenizer (Kinematica, Inc., Cincinnati
Ohio). A 350 .mu.l volume of homogenate was micro-centrifuged for 3
minutes to pellet insoluble material, the supernatant was
transferred to a new tube and RNA was isolated using an RNEASY kit
(Qiagen) according to the manufacturer's instructions. The RNA was
eluted into 80 .mu.L of water and quantitated with RIBOGREEN
reagent (Molecular Probes, Eugene Oreg.). Genomic DNA was then
removed from the RNA using a DNA-FREE kit (Ambion Inc., Austin
Tex.) according to the manufacturer's instructions. The absorbance
at 260 and 280 nm was measured to determine RNA purity and
concentration.
[0133] cDNA synthesis was performed using 1 .mu.M random hexamer
primers, 1 .mu.g of total RNA, and OMNISCRIPT reverse transcriptase
(Qiagen), according to the manufacturer's instructions. Resulting
cDNA was diluted 5-fold with water to give 100 .mu.L final volume.
Analysis of the relative level of erythropoietin gene expression
was performed by quantitative PCR using a FASTSTART DNA MASTER SYBR
GREEN I kit (Roche) and gene-specific primers, using a LIGHTCYCLER
system (Roche), according to manufacturer's instructions. Samples
were heated to 94.degree. C. for 6 minutes and then cycled through
95.degree. C. for 15 seconds, 60.degree. C. for 5 seconds, and
72.degree. C. for 10 seconds for a total of 42 cycles.
Erythropoietin-specific primers were as follows:
TABLE-US-00001 mEPO-R3 TTCTGGCCCCGAGGATGTCA (SEQ ID NO: 1) mEPO-F3
ACGAACTTGCTCCCCGTCACTG (SEQ ID NO: 2)
[0134] The relative level of 18S ribosomal RNA gene expression was
measured as a control. Quantitative PCR was performed using a
QUANTITECT SYBR GREEN PCR kit (Qiagen) and gene-specific primers,
using a LIGHTCYCLER system (Roche), according to manufacturer's
instructions. Samples were heated to 95.degree. C. for 15 minutes
and then cycled through 94.degree. C. for 15 seconds, 60.degree. C.
for 20 seconds, 72.degree. C. for 10 seconds for a total of 42
cycles. Ribosomal RNA-specific primers were as follows:
TABLE-US-00002 18S-rat-2B TAGGCACGGCGACTACCATCGA (SEQ ID NO: 3)
18S-rat-2A CGGCGGCTTTGGTGACTCTAGAT (SEQ ID NO: 4)
[0135] Each PCR run included a standard curve and water blank. In
addition, a melt curve was run after completion of each PCR run to
assess the specificity of the amplification. Erythropoietin gene
expression was normalized relative to the expression level of 18S
ribosomal RNA for that sample.
[0136] As seen in FIG. 2A, erythropoietin gene expression was
induced in both the kidney and liver in treated animals relative to
untreated controls. The liver showed an approximately 32-fold
increase and the kidney showed an approximately 580-fold increase
over background in EPO transcript level relative to the untreated
liver and kidney, respectively (y-axis units are arbitrary). As
seen in FIG. 2B, the same animals showed a significant increase in
erythropoietin plasma level in the treated group relative to
untreated controls. Further, as seen in FIG. 2C, the increase in
endogenous erythropoietin induced by the compound of the invention
significantly increased hematocrit in the treated animals relative
to untreated controls.
Experiment II
[0137] Male Swiss Webster mice (29-34 g) were obtained from
Simonson, Inc., and were treated by oral gavage once per day for
2.5 days (5 doses) with a 4 ml/kg volume of either 0.5%
carboxymethyl cellulose (CMC; Sigma-Aldrich, St. Louis Mo.) (0
mg/kg/day) or one of compounds E or K at 100 mg/kg/day for 3 days.
Blood samples were collected and tissues were processed as for
Experiment I (supra). Alternatively, mice were treated with 0.5%
CMC or one of compounds F or J at 60 mg/kg/day for 5 days.
Forty-eight hours after the final treatment, blood samples were
collected, mice were sacrificed, and tissues were harvested as
described above.
[0138] As seen in FIG. 3A, plasma erythropoietin levels were
increased over controls after 2 days of treatment with compounds of
the invention. Also, as seen in FIG. 3B, hematocrit was measurably
higher after 2 and 7 days in animals treated with compound relative
to untreated controls.
Example 3
Dose Response In Vivo
[0139] Twelve Sprague Dawley male rats (approx. 260 g) were
obtained from Charles River Laboratories, Inc., and treated by oral
gavage as follows: (1) Four rats were dosed daily for days 1 to 7
with 0.5% carboxymethyl cellulose (CMC; Sigma-Aldrich, St. Louis
Mo.) (0 mg/kg), were not treated for days 8 to 14, and then were
dosed daily for days 15 to 19 with 0.5% CMC (0 mg/kg); (2) four
animals were treated on day 0 and day 3 with a total of 7 ml/kg/day
of 5.0% compound C (50 mg/ml in 0.5% CMC) (350 mg/kg), were not
treated days 8 to 14, and then were dosed daily for days 15 to 19
with 3% compound C (30 mg/ml in 0.5% CMC) (60 mg/kg/day); and (3)
four animals were treated daily for days 1 to 7 with a total volume
of 4 ml/kg/day of 2.5% compound C (25 mg/ml in 0.5% GMC) (100
mg/kg), were not treated days 8 to 14, and then were dosed daily
for days 15 to 19 with 3% compound C (60 mg/kg/day). Thus, groups
(2) and (3) received a total of 700 mg compound/kg body weight over
the first 7 days, no treatment from days 8 to 14, and then 60
mg/kg/day for another 5 days. Animals were monitored for change in
body weight and signs of toxicity. Blood samples (2.times.0.5 ml)
were collected on days 1, 3, 7, 10, 17 and 21 as follows. Animals
were anesthetized with isoflurane and 0.5 ml of blood was collected
from the tail vein of each animal into each of two MICROTAINER
EDTA-2K tubes (Becton-Dickinson). Blood samples were processed for
erythropoietin levels, hemoglobin, and hematocrit as described
above.
[0140] As can be seen in FIG. 4A, the compound significantly
increased serum erythropoietin level within 1 day of treatment. As
seen in FIG. 4B, the increase in serum EPO led to a subsequent
increase in immature blood cells (reticulocytes), demonstrating
that the compound stimulates new red blood cell formation.
Additionally, as seen in FIGS. 4C and 4D, the compound increased
blood hemoglobin levels and hematocrit, respectively. Further, the
increase in hemoglobin and hematocrit was maintained over an
extended period of time with lower doses of the compound. These
results demonstrate that a compound of the invention can produce a
controlled increase in red blood cells and the animals remain
responsive to the compound over an extended period of time.
Example 4
Treatment of Anemia Induced by Cisplatin
[0141] The ability of a compound of the invention to treat anemia
associated with post-ischemic acute renal failure was assayed using
a procedure described by Vaziri et al. (1994, Am J Physiol 266(3 Pt
2):F360-6.) Fifteen Sprague Dawley male rats (280-300 g) were
obtained from Charles River Laboratories. On day 0, rats were
treated by intraperitoneal injection with a single dose of saline
(control; n=3) at 8 ml/kg, or cisplatin (CP; Bedford Laboratories,
Bedford Ohio) at either 7 mg/kg (7 ml/kg; n=6) or 10 mg/kg (10
ml/kg; n=6). Blood samples (0.2 ml) were collected on days 5, 9,
and 16 as follows. Animals were anesthetized with isoflurane and
0.2 ml of blood was collected from the tail vein into a MICROTAINER
EDTA-2K tube (Becton-Dickinson). Blood samples were processed for
hematocrit as described above to determine the degree of anemia
produced in each animal.
[0142] Beginning on day 19, one half of each cisplatin-treated
group (n=3.times.2) and all of the control group were treated by
oral gavage once per day for 5 consecutive days with a 2 ml/kg
volume of 0.5% CMC (Sigma-Aldrich). The other half of each
cisplatin-treated group (n=3.times.2) was treated by oral gavage
once per day for five consecutive days with a 2 ml/kg volume of
2.5% compound C (25 mg/ml in 0.5% CMC). Blood samples (0.5 ml) were
collected as described above immediately prior to treatment and 4
days after treatment initiation. Blood samples were analyzed for
CBC and reticulocyte counts as described above. On day 9 after
initiation of oral treatment, a blood sample (0.1 ml) was collected
and processed for hematocrit as described above.
[0143] FIG. 5A shows that, prior to treatment with the methods of
the invention, exposure to 7 and 10 mg/kg CP reduced hematocrit by
14 and 22%, respectively, relative to controls by day 19. The
compound of the invention, however, increased hematocrit in the
CP-treated animals 4 days after initiating treatment with compound,
and hematocrits were significantly higher than non-treated
counterparts by day 9 post-treatment. As can be seen in FIG. 5A,
hematocrit levels in animals initially exposed to 7 mg/kg CP and
subsequently treated with the compound of the invention were at or
above normal control values by day 9. FIG. 5B shows that the
increase in hematocrit was due to the formation of new red blood
cells, as the number of circulating reticulocytes was also
increased in animals treated with the compound.
Example 5
Treatment of Hemolytic Anemia
[0144] Hemolytic anemia can be caused by numerous factors
including, but not limited to, exposure to toxins, hemodialysis,
etc. The ability of a compound of the invention to treat hemolytic
anemia is assayed using a procedure described by Rencricca et al.
(1970, Blood 36:764-71.) Briefly, mice are treated by oral gavage 2
times per day for 5 days with a 2 ml/kg volume of either 0.5% CMC
(Sigma-Aldrich) (group A) or a compound of the invention. Beginning
at day 3, mice are treated with 3 consecutive daily subcutaneous
doses of either saline or 60 mg/kg phenylhydrazine (PHZ). On day 8,
blood is drawn from each of the experimental animals by cardiac
puncture and the hematocrit is measured. Mice that receive PHZ
alone should exhibit the lowest hematocrit levels (approximately
50% of control) 4 days after the first PHZ administration.
Hematocrit levels return to normal in about 8 days. Treatment with
the compound of the invention should minimize the drop in
hematocrit levels in mice as compared to the vehicle-treated
controls.
[0145] Alternatively, rats are treated using a procedure described
by Criswell et al. (2000, J Appl Toxicol 20:25-34.) The procedure
is essentially as described above for mice, except rats are given
50 mg/kg PHZ by intraperitoneal injection instead of by
subcutaneous administration. Maximum decreases (68%) in red blood
counts are expected on day three in PHZ-treated animals.
Example 6
Treatment of Anemia Associated with Renal Failure
[0146] The ability of a compound of the invention to treat anemia
associated with post-ischemic acute renal failure is assayed using
a procedure described by Tan et al. (1996, Kidney Int 50:1958-64.)
Briefly, rats are subjected to unilateral clamping of the left
renal artery for one hour. The arterial clamp is then removed and
the incisional wound is closed. Rats are treated by oral gavage two
times per day with a 2 ml/kg volume of either 0.5% CMC
(Sigma-Aldrich) (group A) or 5% a compound of the invention. At 2
hours, 24 hours, and 1 week following-release of the arterial
clamp, blood is drawn for determination of the hematocrit.
Hematocrit values in the rats treated with vehicle are expected to
be about 85%, 91%, and 93% of sham control rats at the respective
time points.
[0147] Additionally, the ability of a compound of the invention to
treat anemia associated with ischemic acute renal failure is
assayed using a procedure described by Nemoto et al. (2001, Kidney
Int 59:246-51.) Briefly, rats are treated by oral gavage two times
per day with a 2 ml/kg volume of either 0.5% CMC (Sigma-Aldrich)
(group A) or 5% a compound of the invention. Rats are subjected to
clamping of the right kidney with a vascular clip with simultaneous
nephrectomy of the left kidney. After each occlusion, the clip is
released at either 30 (moderate) or 45 (severe) minutes, and
reperfusion is observed.
Example 7
Erythropoietin Expression In Vivo
[0148] Twenty-five male Swiss Webster mice (35-38 g) were obtained
from Simonson, Inc., and treated by oral gavage once per day for
2.5 days (5 doses) with a 4 ml/kg volume of either 0.5%
carboxymethyl cellulose (CMC; Sigma-Aldrich, St. Louis Mo.) (0
mg/kg/day), compound C at 30 or 100 mg/kg/day for 4 days, or blood
was collected daily from animals as described above to induce
anemia. Blood samples were collected and kidney, liver, brain,
lung, heart, and skeletal muscle tissues were harvested and
processed as for Example 2, Experiment I (supra).
[0149] RNA isolation was carried out using the following protocol.
A 50 mg section of each organ was diced, 875 .mu.l of RLT buffer
(RNEASY kit; Qiagen Inc., Valencia Calif.) was added, and the
pieces were homogenized for about 20 seconds using a rotor-stator
POLYTRON homogenizer (Kinematica, Inc., Cincinnati Ohio). The
homogenate was micro-centrifuged for 3 minutes to pellet insoluble
material, the supernatant was transferred to a new tube and RNA was
isolated using an RNEASY kit (Qiagen) according to the
manufacturer's instructions. The RNA was eluted into 80 .mu.L of
water and quantitated with RIBOGREEN reagent (Molecular Probes,
Eugene Oreg.). Genomic DNA was then removed from the RNA using a
DNA-FREE kit (Ambion Inc., Austin Tex.) according to the
manufacturer's instructions. The absorbance at 260 and 280 nm was
measured to determine RNA purity and concentration.
[0150] RNA was precipitated in 0.3 M sodium acetate (pH 5.2), 50
ng/ml glycogen, and 2.5 volumes of ethanol for one hour at
-20.degree. C. Samples were centrifuged and pellets were washed
with cold 80% ethanol, dried, and resuspend in water. Double
stranded cDNA was synthesized using a T7-(dT)24 first strand primer
(Affymetrix, Inc., Santa Clara Calif.) and the SUPERSCRIPT CHOICE
system (Invitrogen) according to the manufacturer's instructions.
The final cDNA was extracted with an equal volume of 25:24:1
phenol:chloroform:isoamyl alcohol using a PHASE LOCK GEL insert
(Brinkman, Inc., Westbury N.Y.). The aqueous phase was collected
and cDNA was precipitated using 0.5 volumes of 7.5 M ammonium
acetate and 2.5 volumes of ethanol. Alternatively, cDNA was
purified using the GENECHIP sample cleanup module (Affymetrix)
according to the manufacturer's instructions.
[0151] Biotin-labeled cRNA was synthesized from the cDNA in an in
vitro translation (IVT) reaction using a BIOARRAY HighYield RNA
transcript labeling kit (Enzo Diagnostics, Inc., Farmingdale N.Y.)
according to the manufacturer's instructions. Final labeled product
was purified and fragmented using the GENECHIP sample cleanup
module (Affymetrix) according to the manufacturer's
instructions.
[0152] Hybridization cocktail was prepared by bringing 5 .mu.g
probe to 100 .mu.l in 1.times. hybridization buffer (100 mM MES, 1
M [Na.sup.+], 20 mM EDTA, 0.01% Tween 20), 100 .mu.g/ml herring
sperm DNA, 500 .mu.g/ml acetylated BSA, 0.03 nM control oligo B2
(Affymetrix), and 1.times. GENECHIP eukaryotic hybridization
control (Affymetrix). The cocktail was sequentially incubated at
99.degree. C. for 5 minutes and 45.degree. C. for 5 minutes, and
then centrifuged for 5 minutes. The Murine genome U74AV2 array
(MG-U74Av2; Affymetrix) was brought to room temperature and then
prehybridized with 1.times. hybridization buffer at 45.degree. C.
for 10 minutes with rotation. The buffer was then replaced with 80
.mu.l hybridization cocktail and the array was hybridized for 16
hours at 45.degree. C. at 60 rpm with counter balance. Following
hybridization, arrays were washed once with 6.times.SSPE, 0.1%
Tween 20, and then washed and stained using
R-phycoerythrin-conjugated streptavidin (Molecular Probes, Eugene
Oreg.), goat anti-streptavidin antibody (Vector Laboratories,
Burlingame Calif.), and a GENECHIP Fluidics Station 400 instrument
(Affymetrix) according to the manufacturer's micro.sub.--1v1
protocol (Affymetrix). Arrays were analyzed using a GENEARRAY
scanner (Affymetrix) and Microarray Suite software
(Affymetrix).
[0153] The Murine Genome U74AV2 array (Affymetrix) represents all
sequences (.about.6,000) in Mouse UniGene database build 74
(National Center for Biotechnology Information, Bethesda Md.) that
have been functionally characterized and approximately 6,000
unannotated expressed sequence tag (EST) clusters.
[0154] As can be seen in FIGS. 6A, 6B, and 6C, a dose-dependent
increase in erythropoietin transcript was seen in brain, kidney,
and liver tissues, respectively. The level of expression was
equivalent to or exceeded the level of transcription seen with
bleed-induced anemia in the same tissue. Thus, the compounds used
in the methods of the invention can penetrate and induce endogenous
erythropoietin production in organs that normally produce
erythropoietin in animals.
Example 8
Erythropoietin Production Following Bilateral Nephrectomy
[0155] The ability of a compound of the invention to induce
endogenous erythropoietin production in the absence of functioning
kidney was assayed using a procedure described by Jacobson et al.
(1957, Nature 179:633-634.) Briefly, rats were anesthetized under
isoflurane and a midline abdominal incision was made under sterile
conditions. The kidney capsules were peeled off, the pedicles were
ligated, and both kidneys were removed. The abdomen was then closed
and the animal was allowed to recover.
[0156] Animals were treated by oral gavage at 2 and 20 hours
post-surgery with either 0.5% carboxymethyl cellulose (CMC;
Sigma-Aldrich, St. Louis Mo.) or with compound C at 100 or 150
mg/kg. Blood samples (0.6 ml) were collected at 24 hours as
follows. Animals were anesthetized with isoflurane and blood was
collected from the tail vein into a MICROTAINER EDTA-2K tube
(Becton-Dickinson). Blood samples were processed for erythropoietin
levels and hematocrit as described in Example 2. Complete Blood
Count (CBC) analysis, including blood hemoglobin level,
reticulocyte number, and hematocrit, was performed by IDEXX
veterinary service (W. Sacramento, Calif.).
[0157] As can be seen in FIG. 7, the compound significantly
increased serum erythropoietin levels in sham-operated animals.
Further, serum erythropoietin levels noticably increased in
bilaterally nephrectomized animals treated with the compound
relative to untreated BN and sham controls (FIG. 7).
Example 9
Screening Assay
[0158] Compounds that increase endogenous erythropoietin levels can
be identified using the procedure described in Example 1.
Additional compounds that inhibit HIF-specific prolyl hydroxylase
activity and stabilize HIF.alpha., increasing endogenous
erythropoietin, can be identified and characterized using the
following assay. A 50 .mu.l aliquot of a reaction mix containing 4
mg/ml BSA, 0.1 M Tris HCl (pH 7.2), 2 mM ascorbate, 80 .mu.M
ferrous sulfate, 0.2 mM 2-oxoglutarate, 600 units/ml catalase, with
or without 100 .mu.M HIF.alpha. peptide, is mixed with 50 .mu.l
HeLa cell extract or purified HIF prolyl hydroxylase and incubated
1.5 hours at 37.degree. C. Following incubation, 50 .mu.l of
streptavidin beads are added and the mixture is incubated for 1
hour with agitation at 4.degree. C. The mixture is transferred to
tubes and centrifuged at low speed to pellet the beads. The beads
are washed three times with 0.5-1 ml 20 mM Tris HCl (pH 7.2). The
peptide is then eluted from the beads with 5 .mu.l 2 mM biotin in
20 mM Tris HCl (pH 7.2) for 1 hour. The tubes are centrifuged to
pellet the resin and 40-50 .mu.l of supernatant is removed and an
equal volume of acetonitrile is added. Alternatively, the peptide
is attached to methoxycoumarin, a pH insensitive fluorophore. The
fluorophore may provide sensitivity and specificity to enhance
detection in assays run with crude cell lysate. An exemplary HIF
peptide for use in the screening assay may comprise
[methoxycoumarin]-DLDLEALAPYIPADDDFQL-amide (SEQ ID NO:5). The
non-hydroxylated and hydroxylated peptides are then separated by
reverse-phase HPLC on a C18 column with UV detection at 214 nm.
[0159] Various modifications of the invention, in addition to those
shown and described herein, will become apparent to those skilled
in the art from the foregoing description. Such modifications are
intended to fall within the scope of the appended claims.
[0160] All references cited herein are hereby incorporated by
reference herein in their entirety.
Sequence CWU 1
1
5122DNAMus musculus 1acgaacttgc tccccgtcac tg 22220DNAMus musculus
2ttctggcccc gaggatgtca 20323DNARattus norvegicus 3cggcggcttt
ggtgactcta gat 23422DNARattus norvegicus 4taggcacggc gactaccatc ga
22519PRTartificial sequencesynthetic peptide 5Asp Leu Asp Leu Glu
Ala Leu Ala Pro Tyr Ile Pro Ala Asp Asp Asp1 5 10 15Phe Gln Leu
* * * * *